ISSCA

International Society for the Study

and Conservation of Amphibians

(International Society of Batrachology)

SEAT

Laboratoire des Reptiles et Amphibiens, Muséum national d'Histoire naturelle, 25 rue Cuvier, 75005

Paris, France. — Tel.: (33).(0)1.40.79.34.87. - Fax: (33).(0)1.40.79.34.88. - E-mail: dubois@mnhn.fr.

BOARD

President: W. Ronald HEYER (Washington, USA).

General Secretary: Alain DuBois (Paris, France).

Deputy Secretary: Annemarie OHLER (Paris, France).

Treasurer: Jean-Louis DENIAUD (Paris, France).

Deputy Treasurer: Rafael DE S4 (Richmond, USA).

Councillors: C. Kenneth Dopp, Jr. (Gainesville, USA); Britta GriLLirscH (Wien, Austria); Julio Mario

Hovos (Bogotä, Colombia): Thierry LODÉ (Angers, France) ; Jon LOMAN (Lund, Sweden); Alain

PAGANO (Angers, France); Stephen J. RICHARDS (Adelaide, Autralia).

TARIFF FOR 2001

INDIVIDUALS

[Regular 2001 subscription to Alytes (volume 19) + ISSCA + Circalytes | 300FF/60$/46 E]

Student 2001 subscription to Alytes (volume 19) + ISSCA + Circalytes 150 FF/30$/23€

:gifthalf-pricesubscription of one year for acolleagueof yourchoice: Halfof price above

Regular 2001 subscription to Alpes (volume 19) alone 280 FF 756 8744€

Student 2001 subscription to Apres (volume 19) alone 140 FF/28$/22€

Back issues of Alyres: any single issue T0FF/14S/11€

Back issues of Alpes: any complete volume (4 issues) 225 FF/45$/35€

Back issues of A/ytes: complete set of volumes 1 to 18 (1982-2000) 3240 FF / 648 $/494€

Regular five-year (2001-2005, volumes 19 to 23) individual subscription to A/ytes +

ISSCA + Circalytes 1500 FF / 300 $/229€

Regular five-year (2001-2005. volumes 1910 23) individualsubscriptionto A/ytes 1120 FF/224$/171 €

SrEciaL orrer: five-year (2001-2005, volumes 19 to 23) individual subscription to A/ytes + ISSCA + Cir-

calytes, with complete set of back issues of Alytes(1982-2000, volumes 1 to 18) 3500 FF/700$/534 €)

Life individual subscription to 4/ytes from 2000 on 5600 FF/1120 $/854€

Life individual subscription to A/ytes + ISSCA + Circalytes from 2000 on 7000 FF / 1400 $ / 1067 €

Patron individual subscription to A/ytes from 2000 on 11200 FF / 2240 $ / 1708 €

or more

Patron individual subscription to Alytes + ISSCA + Circalytes from 2000 on: 14000 FF / 2800 $/2135 €

or more

Important notice: from 1996 on, any new life or patron à

complete collection of back issues of Aytes from the first

ividual subscriber to A/ytes is offered a free

ue (February 1982) until the start of her/his

subscription.

INSTITUTIONS

2001 subscription to Alytes (volume 19) + ISSCA + Circalytes 600 FF / 120 $/92

2001 subscription to Alytes (volume 19) alone _ 560 FF/112$/88€

Back issues Of A/ytes: any single issue 140 FF/28$/22€

ny complete volume (4 issues) 450 FF / 90 $/ 70 €

omplete set volumes 1 10 18 6480 FF / 1296 $ /988 €

ve-year (2001-2005, volumes 19 to 23) subscription to Alytes + ISSCA + Circalytes.

Alytes (1982-2000, volumes 1 10 18) 3500 FF / 700 $ / 534 €

Circalytes às the internal information bulletin of ISSCA. Back issues of this bulletin are also available:

prices can be provided upon request by our Secretariat.

MODES OF PAYMENT

— In French Frances or in Euros, by cheques drawn on a French bank payable to “ISSCA”, sent to our

ddress above).

nes or in Euros, by direct postal transfer to our postal account: “ISSCA'”, Nr. 1-398-1 L,

s mode of payment, add 15 FF or 2.30 € to your payment for postal charges at our end.

by cheques payable to “ISSCA”, sent 10 Rafael O. DE S4, Associate Professor.

Department of Biology, University of Richmond, Richmond, VA 23173, USA (e-mail.

rdesa@richmond.edu: fax: (804)289-8233). Source : MNHN, Paris

secretariat (

Bibliothèque Centrale Muséum

AIVTES

3 3001 00135917 2

INTERNATIONAL JOURNAL OF BATRACHOLOGY

May 2001 Volume 19, N° 1

Alytes, 2001, 19 (1): 1.

Editorial

Alain DuBois

Laboratoire des Reptiles et Amphibiens,

Muséum national d'Histoire naturelle,

25 rue Cuvier, 75005 Paris, France

Following the workshop on “Declining amphibian populations — a global phenomenon?” held in Irvine (California,

USA) on 19-20 February 1990 (see Wake et al., 1991) and the subsequent foundation of the Declining Amphibian

Population Task Force (DAPTF), the study of amphibian population declines and of their causes has become a major

research field (see review in ALrORD & RicHaRDs, 1999). The scientific literature dealing with these questions has been

dispersed in various periodicals. The quarterly journal Froglog, published by DAPTF, regularly provides reviews and

bibliographic lists regarding this field of research. Until now, the journal Alytes has seldom been used as an outlet for the

publication of such reports. This is unfortunate, as Alytes is the only journal in the world entirely dedicated to the

publication of scientific works dealing with amphibians, and as the International Society for the Study and Conservation

of Amphibians (ISSCA), the non-profit association that publishes this journal, has among its statutory aims “to

contribute, on a world scale (... to the conservation of Amphibians and to that of their environment” (ANONYMOUS,

1994: 62). In order to call attention to the possibility of publishing papers dealing with amphibian declining populations,

and, more generally, with all problems related with the conservation biology of amphibians, the ISSCA Board has

decided to create a third position of Editor for the journal, that of Conservation Editor. Stephen J. Richards (Adelaide,

Australia) has agreed 10 take on this responsibility. AÏl amphibian biologists working on questions related to the

conservation of amphibians, to declining populations, their causes and possible remedies, are warmly invited to submit

their manuscripts to Steve. From now on, manuscripis intended for Alyres can be submitted to three different editors,

who will care for their submission to referees, for correspondence with the authors and for the final decision regarding

them:

— Alain Dubois (Laboratoire des Reptiles et Amphibiens, Muséum National d'Histoire Naturelle, 25 rue Cuvier,

75005 Paris, France; <dubois@mnhn.fr>), for any paper dealing with amphibian morphology, anatomy, systematics,

biogeography, evolution, genetics, anomalies or developmental biology:

— Thierry Lodé (Laboratoire d'Ecologie animale, Université d'Angers, 2 boulevard Lavoisier, 49045 Angers Cedex,

France; <thierry.lode@univ-angers.fr>) for any paper dealing with amphibian population genetics, ecology, ethology or

life history;

Stephen J. Richards (Vertebrates Department, South Australian Museum, North Terrace, Adelaide, S.A. 5000,

Australia; <Richards Steve@saugov.sa.govau>) for any paper dealing with declining amphibian populations, amphib-

jan pathology, and more generally with all matters related to amphibian conservation biology.

Another recent decision of the ISSCA Board has bx larity in the publication of Alytes. From

now on, and for an undetermined number of years, the journal will be published as two double (or one single and one

es per year, at fixed dates, in May and November. This schedule will be maintained irrespective of the number

of papers and pages accepted for publication at these dates. The result will be that some issues (like this one) will be

somewhat thin, while others (like next one) will be much thicker: despite this, all effort will be made to provide subscribers

and readers with our usual number of 200 pages or more per year. Hopefully, this change in the publication schedule of

the journal will be appreciated by our subscribk m now on. it will be possible 10 foresee the dates of publication of

the journal, instead of receiving it suddenly at unexpected dates. Our readers are welcome to let us know their feelings

about these new changes in our journal. just before it reaches the age of 20!

LITERATURE CITED

CA. Circalh

nes: a proble

6 (6): 49-84

in applied ecology. Ann. Rer. Ecol. Syst...

Anonymous, 1994. - Statutes

ALFORD, R.A. & RICHARDS, S,

30: 133-165

Wake, D. B. Morowrtz, H. 1. BLAUSTEIN, A. BRaDrORD, D. BURY, R. B., CALDWELL, J., CoRN, P. $., DUROIS, A.

Hart, J, Hayes, M. INGER, Ra NETTMANN, H-K., RAND, A. S. SuIrH, D. Tvisr, M. & Vtt, L.. 1991.

Declining'amphibian populations = globg} phenomenon? Findings and recommendations. Altes 9 (1): 33-42

nd Internal Regulations of

. 1999. - Global amphibian de

Source : MNHN, Paris

Alytes, 2001, 19 (1): 2-4.

A replacement name

for Rana (Paa) rara Dubois & Matsui, 1983

(Amphibia, Anura, Ranidae, Raninae)

Alain Dugois*, Masafumi MATSsUI** & Annemarie OHLER*

* Laboratoire des Reptiles et Amphibiens, Muséum national d'Histoire naturelle,

25 rue Cuvier, 75005 Paris, France

** Graduate School of Human and Environmental Studies,

Kyoto University, Sakyo, Kyoto 606-8501, Japan

A replacement name is proposed for the frog species Rana (Paa) rara

Dubois & Matsui, 1983 from north-western Nepal, as the latter name

proves to be a junior primary homonym of Rana danubina rara E. Fraas,

1903, a name given to a fossil frog species from the Miocene of Germany.

A lectotype is designated here for the latter taxon.

Dugois & MaïTsui (1983: 895) described a new frog species from Rara lake in north-

western Nepal under the name Rana (Paa) rara. DUBoIs (1992: 320) raised the subgenus Paa

Dubois, 1976 to the rank of genus, with three subgenera, and recognized this species as Paa

(Paa) rara (Dubois & Matsui, 1983).

This name, however, cannot be conserved for this species, as it is a junior primary

homonym in the genus Rana, being preoccupied by the name Rana danubina var. rara E.

Fraas, 1903. The history of the latter name, however, is a little complicated, and deserves some

discussion.

In à paper dealing with the Miocene fossil fauna of Steinheim am Albruch (48°41°N,

10°03'E; Baden-Württemberg, Germany), Oscar FRAAS (1870: 291) mentioned once the new

name Rana rara, but without providing any information about this species: as rightly

remarked by SANCHIZ (1998: 142), this name is therefore a nomen nudum, without nomen-

clatural status. According to this later author, this name was based on a tibio-fibula, still kept

in the collection of the Staatliches Museum für Naturkunde of Stuttgart under number

SMNS 80207, and which “probably belongs to a small mammal (R. Bôttcher, in litt., 1995)”.

More than thirty years later, E. FRAAS (1903) described in detail a complete articulated

fossil frog skeleton from the Miocene of Steinheim, for which, instead of coining a new name,

he used the name rara proposed by his father, but as a subspecific name, using the combination

Rana danubina var. rara. SANCHIZ (1998: 130) stated that, in this combination, the specific

epithet danubina was an “unwarranted spelling change” for the specific name Rana danu-

biana, proposed by MEYER (1858: 203), but this does not tell us whether this epithet h:

not, a status in nomenclature (see e.g. DuBois, 1987, 2000). Actually, the spelling danubina

Source : MNHN, Paris

Duois, MATSUI & OHLER 3

introduced by MEYER (1860: 142), who used it consistently in his text and figure legend, so that

we regard it as an unjustified emendation of danubiana, therefore a name having an indepen-

dent status in nomenclature and its own author and date (i. e., MEYER, 1860).

As for the epithet rara, E. FRAAS (1903: 105-106) borrowed it to his father’s work (where

it applied to an isolated tibio-fibula), but used it to name the new complete skeleton collected

by A. Pharion in 1902, and also applied it with some doubts to a third specimen from

Steinheim, a radio-ulna found by C. Joos. He provided (E. FRAAS, 1903: 107-108) a very

detailed description of the complete skeleton, with measurements. Earlier in the paper (E.

FRAAS, 1903: 105), he had also given a photograph of this fossil that clearly shows a frog. As

rightly commented by SANCHIZ (1998: 130), by providing a description, E. FRAAS (1903) gave

for the first time a nomenclatural status to the epithet rara, as Rana danubina rara E. Fraas,

1903.

Because he assumed that only one specimen was involved, SANCHIZ (1998: 130) stated

that the “holotype” of this nominal species was the complete articulated skeleton found by A.

Pharion in Steinheim, still kept in Stuttgart under number SMNS 11354, and that should be

referred to the “Rana (ridibunda) group” (SANCHIZ, 1998: 130), i.e. to the subgenus Rana

(Pelophylax) (Dusois & OnLER, 1995). However, E. FRAAS (1903) never used the terms

“holotype” or “type” for this skeleton, and his use of the name Rana rara proposed by his

father suggests that the name Rana danubina rara must be considered based on at least two

syntypes, the original isolated tibio-fibula and the new articulated skeleton; whether or not it

was also based on the third specimen, the isolated radio-ulna, is more open to discussion, but

the inclusion of the original bone (implied by the use of the name rara) suggests that it was

also the case for this second isolated bone. Because both isolated bones are of doubtful

taxonomic allocation (and possibly not frogs), it is important for the future allocation of the

name rara to designate a lectotype among these two (or three) syntypes. To stabilize definitely

the status of this name, we hereby designate the articulated skeleton, SMNS 11354, as

lectotype of Rana danubina rara E. Fraas, 1903. This name was considered by SANCHIZ (1998:

130) as a junior subjective synonym of Rana danubiana Meyer, 1858, a name based on an

incomplete articulated frog skeleton from the Miocene of Günzburg (48°27°N, 10°16'E;

Bayern, Germany), that was “presumably destroyed in 1944” (SANCHIZ, 1998: 130). Stabili-

Zation of the nomenclatural status of the latter name (considered as a “nomen dubium” by

Sancuiz, 1998) would require the discovery and designation as neotype of another specimen

from Günzburg and from the same stratigraphic level as the lost holotype, which is not the

case of the lectotype of Rana danubina rara (see SCHLEICH, 1981).

To the best of our knowledge, after E. FRAAS’S (1903) paper, his name rara was

mentioned only twice in the literature: by KUHN (1938: 16), as Rana danubiana var. rara, and

by SaNCHIZ (1998: 130), as a junior subjective synonym of Rana danubiana Meyer, 1858. A

neotype designation would stabilize definitively this synonymy. Nevertheless, even if the name

Rana danubina rara disappeared definitely from scientific literature as a permanent junior

synonym, this would have no bearing on the nomenclatural availability of this name (for more

details, see DuBois, 2000), and the epithet rara E. Fraas, 1903 will always remain available and

will preoccupy the use of the same epithet in the nominal genus Rana.

As a matter of fact, according to Articles 57 and 60 of the Code (ANONYMOUS, 1999), a

junior primary homonym “is permanently invalid” and must be replaced. As the name Rana

Source : MNHN, Paris

4 ALYTES 19 (1)

(Paa) rara Dubois & Matsui, 1983 is not known to have a synonym, we have to provide a

nomen novum (new replacement name) for the Paa species. Therefore we propose the nomen

novum Paa (Paa) rarica for the species described by Dugois & MaTsuI (1983). The adjective

rarica means “from Rara”, “living in Rara”, and refers to the type-locality of the species,

Rara lake (Rara Daha; 29931°N, 82°05°E; 2990 m; Jumla Province; Nepal), which until now

remains the only known locality of occurrence of the species.

ACKNOWLEDGEMENTS

For bibliographic advice, information, and comments on an earlier draft of this paper, we are pleased

to thank France de Lapparent de Broin (Paris, France), Borja Sanchiz (Madrid, Spain), Miguel Vences

(Paris, France) and an anonymous reviewer.

LITERATURE CITED

ANONYMOUS [International Commission on Zoological Nomenclature], 1999. — International code of

zoological nomenclature. Fourth edition. London, International Trust for zoological Nomencla-

ture: i-xxix + 1-306.

Dumois, A., 1987. - Again on the nomenclature of frogs. A/yres, 6 (1-2): 27-55.

_— 1992. - Notes sur la classification des Ranidae (Amphibiens, Anoures). Bull. Soc. linn. Lyon, 61 (10):

305-352.

ss 2000. - Synonymies and related lists in zoology: general proposals, with examples in herpetology.

Dumerilia, 4 (2): 33-98.

Dumoïs, A. & MATSUI, M. 1983. - À new species of frog (genus Rana, subgenus Paa) from western Nepal

(Amphibia: Anura). Copeia, 1983: 895-901.

Dumois, A. & OHLER, A., 1995. — Frogs of the subgenus Pelophylax (Amphibia, Anura, genus Rana): a

catalogue of available and valid scientific names, with comments on name-bearing types, complete

synonymies, proposed common names, and maps showing all type localities. Zool. Polon., (1994),

39 (3-4): 139-204.

FRAAS, E., 1903. - Rana danubina H. v. Meyer var. rara O. Fraas aus der Obermiocän von Steinheim.

Jahresheften des Vereins für vaterländische Naturkunde in Württemberg, 89: 105-110.

FRAAS, O., 1870. - Die Fauna von Steinheim. Mit Rücksicht auf die miocänen Säugethier- und Vogel-

reste des Steinheimer Beckens. Jahreshefte des Vereins für vaterländische Naturkunde in Württem-

berg, 26: 145-306, pl. 4-13.

KUHN, O., 1938. — Anura. /n: O. KUHN, Fossilium catalogus, 1, Animalia, Pars 84, Stegocephalia

(Labyrinthodontiis exclusis), Urodela, Anura, Nr. 3, Anura, The Hague, Junk: 1-26.

MEYER, H. v., 1858. - [Untitled report.] Neues Jahrbuch Mineralogie Geognosie Geologie Petrefakten-

07.

Gebilden Deutschland’s. Palacontographica, Beiträge zur Naturges-

el, 7 (8): 123-182.

Sancuiz, B. 1998. - Salientia. Zn: P. WELLNHOrER (ed), Handbuch der Paläoherpetologie, Teil 4,

München, Friedrich Pf ii + 1-275.

Scuueicn, H. H., 1981. -Jungtertiäre Schildkrôten Süddeutschlands unter besonderer Berücksichtigung

der Fundstelle Sandelzhausen. Cour Forsch. Senckenberg, 48: 1-372

Corresponding editor: Miguel VENCES.

Source : MNHN, Paris

Alytes, 2001, 19 (1): 5-28. 5

Systematics of Fejervarva limnocharis

(Gravenhorst, 1829)

(Amphibia, Anura, Ranidae)

and related species.

2. Morphological and molecular variation

in frogs from the Greater Sunda Islands

(Sumatra, Java, Borneo)

with the definition of two species

Michael VerrH*, Joachim KosucH*, Annemarie OHLER** & Alain DUBOIS**

* Institut für Zoologie, Jniversität,

bt. Okologie, Johannes Gutenberg

r. 21, 55099 Mainz, Germany

** Laboratoire des Reptiles et Amphibiens, Muséum national d'Histoire naturelle,

25 rue Cuvier, 75005 Paris, France

Frogs of the species Fejervarva limnocharis and related species are

among the most common in Southeast Asia. We studied 52 individuals from

eight populations of the Great Sunda Islands by means of allozyme electro-

phoresis, mtDNA sequencing and morphometry. Patterns of variation of all

characters among populations were congruent in separating one Javanese

population from all other populations (Java, Sumatra, Borneo) as a distinct

species. The frequencies of four distinct mid-dorsal stripe showed no

distinct geographic pattern. Morphometric analysis unambiguously permits

assignment of the name Rana limnocharis Gravenhorst, 1829 to the

widespread form that occurs in Java, Sumatra and Borneo. The two taxa

recognised in this study occur in sympatry in Java. As the taxon known only

from Java lacks a name, we describe and name it.

ABBREVIATIONS

FMNH Field Museum of Natural History, Chicago, USA.

MNHN Muséum National d'Histoire Naturelle, Paris, France.

RMNH Nationaal Natuurhistorisch Museum, Leiden, Netherlands.

ZFMK Zoologisches Forschungsinstitut und Museum Alexander Koenig, Bonn,

Germany.

Source : MNHN, Paris

6 ALYTES 19 (1)

INTRODUCTION

Description of existing biodiversity is one of the main goals of conservation biology.

Especially in the tropics very little is known about the real number of species and our

knowledge on intraspecific variability of tropical animal and plant species is even lower. The

Amphibia of most parts of the Oriental faunal region have been poorly studied until now

(INGER, 1999). This holds especially for the Greater Sunda Islands, although two reviews of its

batrachofauna were recently published (MANTHEY & GROSSMANN, 1997; INGER & STUEBING,

1997). Within the last decades, many new species have been described from these islands based

on morphological traits (e.g., INGER, 1989; INGER & GriTis, 1983; INGER & STUEBING, 1991,

1997). However, the few biochemical studies on Southeast Asian anurans have made apparent

that a great amount of cryptic variation is present within species (e.g., INGER et al., 1974;

DonxELLAN et al., 1989; KosuCH et al., 1997; Topa et al., 1998a).

The ranid genus Fejervarya Bolkay, 1915 is distributed throughout Southeast Asia

(Dusois & OHLER, 2000). These species show substantial morphological and colour variation

over their distribution range. In Nepal, studies of mating calls showed the co-existence of four

species (Dugois, 1975). In their study on genetic divergence among Southeast Asian Rana

limnocharis, Top et al. (1997, 1998a-b) discovered genetic divergence and sympatric cryptic

species in this group without morphological differentiation.

The present study focuses on the variation within frogs known as Fejervarya limnocharis

(Gravenhorst, 1829) in the Greater Sunda Islands, a group of frogs that are known to be

abundant in areas of intensive human activities (INGER, 1966; INGER & STUEBING, 1989;

MANTHEY & GROSSMANN, 1997). To describe the pattern of variation in this common frog

group we compared the within- and between-island variability of molecular and morpholog-

ical traits.

The nomenclatural situation in this group of frogs was presented in detail in part 1 of this

series of papers (DuBois & OHLER, 2000). Generic classification follows Dumois (1992),

slightly modified by phylogenetic data of DNA analysis (MARMAYOU et al., 2000). In order to

formalise the systematic position of the different forms of Fejervarya found in our genetic

analysis, we linked molecular data to morphometric data. This allows us to cross-reference old

names based on museum specimens with results of modern molecular population studies.

MATERIAL AND METHODS

Frogs were collected from six natural populations or bought from local fish markets of

Java (J), Sumatra (S) and Kalimantan (K), the latter being the Indonesian part of Borneo (fig.

D: 11 (4 specimens, FMNH 256721-256724), swampy meadow along the road between Bogor

and Parung; J2 (11 specimens, FMNH 256725-256733, MNHN 1997.4916, ZMFK 68867),

paddy field at Chianjur; KI (2 specimens, FMNH 256734-256735), fish market at Pontianak:

K3 (12 specimens, FMNH 256736-256747), paddy field at the village Desa Lape; SI (13

specimens, FMNH 256749-256761), fish market at Medan: S2 (2 specimens, FMNH 256762-

256763), paddy field and small brook at village Sidikalang: SS (5 specimens, FMNH 256764-

Source : MNHN, Paris

VEITH, KOSUCH, OHLER & DuBoIs 7

Borneo

Sumatra

Fig, 1. - Sample localities of Fejervarya on the Great Sunda Islands, Indonesia (* refers to the sample

locality 3/4 of Toba et al., 1998u).

256768), frogs collected by inhabitants at a small village about 10 km SE Tapaktuan; S6 (3

specimens, FMNH 256769-256771), frogs collected by inhabitants of the village Desa Seleu-

Kat near Tapaktuan. In the molecular analyses we used the ranids Fejervarya cancrivora

(Gravenhorst, 1829) (Kalimantan, Borneo), Rana temporaria Linnaeus, 1758 (Germany) and

Rana catesbeiana Shaw, 1802 (from a frog farm at Java) as outgroups.

A specimen from the collection of Heinrich Kuhl from Java (RMNH 4287), designated

as neotype of Rana limnocharis Gravenhorst, 1829 by Dugois & OHLER (2000), was included

in a discriminant analysis for nomenclatural decisions.

Sex of all specimens was determined either by presence of secondary sexual characters or

by observation of gonads through small lateral or ventral incision on the frogs (most of the

frogs were ventrally opened because of tissue dissection in the field).

ALLOZYME ELECTROPHORESIS

Pieces of fresh muscle and liver were dissected and stored in liquid nitrogen. Frogs were

preserved for determination and morphometry in 70 % alcohol after pre-fixation in 10 %

formaldehyde.

Source : MNHN, Paris

8 ALYTES 19 (1)

Allozyme electrophoresis was carried out on muscle and liver homogenates on cellulose

acetate gels (RICHARDSON et al., 1986). Twelve enzyme systems providing information on 15

presumptive gene loci were stained according to HEBERT & BEATON (1986). Gels were run in

three different buffer systems: tris-glycine, pH 8.5 [acon-1 and -2 (E.C. 4.1.1.3), fum (E.C.

4.2.1.2), aat-1 and -2 (E.C. 2.6.1.1), mdh (E.C. 1.1.1.37), pépoiyeu (EC. 3.4.1), pgm (E.C.

54.22) and tpi (E.C. 5.3.1.1)], tris-citrate, pH 7.0 [idh-1 and -2 (E.C. 1.1.1.42), me (E.C.

1.1.1.40) and mpi (E.C. 5.3.1.8)] and phosphate, pH 8.0 [44h (E.C. 1.1.1.27) and pk (E.C.

2.7.1.40)]. Average expected heterozygosity (H,) and mean number of polymorphic loci (P)

were calculated as population characteristics using the computer program G-STAT (SiGis-

MUND, 1993). Ners (1972) standard genetic distance estimates and UPGMA cluster analysis

were calculated using the program NTSYS (RouLr, 1990).

DNA-SEQUENCING

DNA was extracted from frozen muscle tissue using the standard phenol-chloroform

protocol of SAMBROOK et al. (1989). Double-stranded PCR amplification was performed in

50 ul reactions containing 1 unit of Tag polymerase, 5 yl of 10 X reaction buffer (Bochringer),

250 ymol each of dGTP, dATP, dT TP and dCTP, 20 pmol each of light- and heavy-strand

primers and 1 yl of mtDNA extract. The primers 16Sa-L and 16Sb-H (KoCHER et al., 1980)

amplified a double-stranded DNA segment of 560 bp of the mitochondrial 168 ribosomal

RNA gene. Thermal cycling was carried out in a programmable heating block (Perkin Elmer

Gene Amp PCR System 9600) for 35 cycles (initial denaturation step of 90 s at 94°C,

denaturation for 45 s at 94°C, primer annealing for 45 s at 55°C and extension for 90 s at 72°C).

PCR products were purified with a PCR purification kit (QuiaQuickspin) and directly

sequenced with a sequenase kit (Amersham) using only primer 16Sa-L. The products of the

sequencing reaction were resolved by the automatic sequencer 377 of Applied Biosystems.

After sequence alignment with CLUSTAL-W (HiGGiNs & SHARP, 1993), the alignment

was adjusted manually. The aligned 390 bp sequence corresponds to nucleotides 4039-4429 in

the Xenopus laevis mitochondrial genome (RoE et al., 1985). Phylogenetic relationships were

determined using maximum parsimony (PAUP, version 3.1.1; SWOFFoRD, 1993) and maxi-

mum likelihood approaches (PHYLIP, version 3.5c; FELSENSTEIN, 1993). For maximum

parsimony analysis, 1000 bootstrap replicates were run to test for confidence in the topology

of the phylogenetic trees (FELSE: IN, 1985).

Sequences have the GenBank accession numbers AF346810-AF346811, and the EMBL

accession numbers AJ292014-A7292023.

MORPHOMETRY

Twenty-seven measurements of 39 adult specimens were taken with a slide caliper to

0.1 mm precision or for measurements smaller than 5 mm with an ocular micrometer to the

nearest 0.01 mm (app. 1). To control for isometry, all measurements were divided by snout-

vent length (SVL), expressed as per thousands of SVL, or transformed into the Neperian

logarithm. Male and female specimens were grouped after their homogeneity was established

Source : MNHN, Paris

VEITH, KOSUCH, OHLER & DUBOIS 9

(OHLeR, 1996). For morphometrical analyses we used SPSS statistical programs for personal

computers (NoRUSIS, 1992).

Morphological analysis should test if genetically close populations from different islands

are also morphologically homogenous and, conversely, if the two genetically differentiated

species can be distinguished by their morphology. Non-parametric Kruskal-Wallis test was

performed to measure morphological variation in Fejervarya specimens of different islands.

Differentiation between genetically distinct samples was tested using non-parametrie Mann-

Whitney U test.

Discriminant analysis

Groups obtained by the molecular analyses were subjected to a discriminant analysis

(Norusis, 1992). The measurement data for the female neotype of Rana limnocharis were

incorporated into the analysis after the production of the original discriminant function

model based on all other data, following examples of nomenclatural clarification using this

approach (HEYER, 1994; Ouer, 1999; OnLer & Dugois, 1999).

Colour patterns

Frogs of the genus Fejervarya are known to frequently have mid-dorsal stripes, which are

an interesting character for evolutionary biology studies (see e.g. MILSTEAD et al., 1974;

Dugois, 1980). Heritability studies by MoriWwakI (1953) and MoHaNTY & DurrA (1999)

suggested that presence or absence of a dorsal line in Fejervarya is coded by two alleles of

a single locus. The allele for the striped phenotype appears to be dominant over that for

the unstriped one. However, MoriWaki (1953) and others (e.g., SHiBATA, 1988) only

discriminated between two phenotypes (striped and unstriped). DuBois (1977) and MOHANTY

& Durra (1999) distinguished between three phenotypes: a pattern showing no line at all, a

pattern showing a fine line and a third pattern showing a wide stripe. The patterns are not

distributed equally in the four different species of Fejervarpa from Nepal which can be

distinguished by their mating calls: whereas Æ teraiensis (Dubois, 1984) and Æ pierrei

(Dubois, 1975) show all three different patterns, hadrensis (Annandale, 1919) does not

show the wide stripe phenotype, and all Æ nepalensis (Dubois, 1975) specimens have mid-

dorsal stripes (DuBois, 1977).

Four mid-dorsal patterns can be recognised in the Fejervarya specimens that we studied

(fig. 2): (1) no mid-dorsal line or stripe: (2) a fine clear mid-dorsal line alone present: (3) a wide

mid-dorsal stripe alone present; (4) both a fine line and a wide stripe present, superimposed.

Presence and absence of both kinds of lines as well as frequency of combination of the two

lines and their distribution among populations were noted, and their pattern of variation was

studied using Kruskal-Wallis test.

Source : MNHN, Paris

(D 61 SHLATV

Fig. 2.—(a) Holotype of Fejervarva iskandari, MNHN 1997.4916, from Chianjur, Java, phenotype no line/no stripe, 168 haplotype J2-C: (b) Fejervarya

limnocharis from Desa Lape, Bornco. phenotype line/stripe, 16S haplotype K3-A; (c) Fejervarva limnocharis from Tapaktuan 2, Sumatra, phenotype

line/no stripe, 16S haplotype S5-A. Drawings by Käthe Rehbinder, Mainz.

Source : MNHN, Paris

VerrH, KosuCH, OHLER & DUBoIS 11

RESULTS

ALLOZYME VARIATION

Of the 15 allozyme loci studied, five were monomorphic (fun, idh-1, idh-2, me, pk) within

and between the Fejervarya samples. Acon-1, acon-2 and /dh were monomorphie within

populations, but exhibited a fixed allelic difference in population J2 relative to all other

populations (app. 2). Between populations J1 and J2 further allelic differences appeared to be

fixed at the loci aat-2, mpi and pep. Thus, these two geographically closely related populations

did not share alleles at six out of 15 loci.

Intra-populational genetic variability (4,) was lowest in the Sumatran samples with the

exception of sample S1 from the Medan fish market. This was the only sample that showed

significant genotype deviations from Hardy-Weinberg expectation at two loci (mpi and pep; P

< 0.05) due to a lack of heterozygous specimens, indicating a mix-up of different populations.

Sample S5 was completely monomorphic. Three to six loci were polymorphic in the Javanese

and Borneo samples, even though sample sizes were in some cases lower than for S5.

NErs (1972) standard genetic distance between populations ranged from 0.004 between

SI and S2 and 0.337 between J2 and SS (tab. 1). Population J2 was the genetically most

distinct. It was separated even from the geographically close population J1 by a relatively high

genetic distance estimate of 0.316. The Borneo and Sumatra populations formed distinct

clusters in the UPGMA phenogram (fig. 3).

MTDNA SEQUENCE DIVERGENCE

We sequenced 390 bp of the mitochondrial 16$ rRNA gene from 52 individuals of

Fejervarva and from the three outgroup species. One hundred twenty seven bp positions were

variable. Samples of Fejervarya comprised nine different haplotypes (tab. 2) with 60 sites being

variable among them. Fifty-two of these variable sites were parsimonious informative, 49 of

which supported the monophyly of either of the two main haplotype lineages.

The average substitution rate between the haplotypes of population J2 and the remaining

populations from Java, Sumatra and Borneo was 0.135. This is only about 0.02 less than

between either of the two Fejervarya forms and FE cancrivora, thus suggesting the differenti-

ation of J2 from the other Fejervarya limnocharis populations as distinct species.

The maximum parsimony and maximum likelihood trees produced exactly the same

topology with two rather homogeneous but well differentiated groups of Fejervarya mito-

chondrial 16S haplotypes (tab. 3). Bootstrap support in the maximum parsimony tree was

100 % for both clades (fig. 4) which we subsequently name JT and J2. No further significant

topology was found within the two clades.

Source : MNHN, Paris

12 ALYTES 19 (1)

Table 1. - NEI°s (1972) standard genetic distance estimates between 9 samples of Fejervarya

from Java (J), Kalimantan (K) and Sumatra (S). See text (Material and methods) for

details on localities. Sample Kc belongs to the species Fejervarya cancrivora.

Table 2. — Variable bp positions of a partial sequence of the mitochondrial 168-rRNA gene of nine

Fejervarya and three outgroup taxa haplotypes.

00000000000000000011111111111111111122222222222222222222222222222222

11244555666778888800444688888999999900000000111111111222222222233333

580074673586725678143574145781346789012346780123467890123456 78912356

Fejarvarya J2-B CGCATAGGACECCACCTCTOGTACCATAGACCAATCAACACACTATOTAATTCTTTCTECCCCGCTTT

Fejervarya J2-A von

Fejervarya J2-C

Fejervarya J1-A

Fejervarya J1-B

Fejervarya K1-A

Fejervarya K3-A

Fejervarya S5-A

rejervarya S6-A hu *;

F. cancrivora Ke T..C.TAR...T.G...TC.T.C...CGA..TT.G.CC.T.C.CCCAA.

Rana temporaria -A.C.. .ACTC. TG. TAT. TCA.GTCCC.CT.GTG.CC-T. . .CC.TA.CACAAGAGAT.

Rana catesbeiana .A.CC.A.TIC. .G.TATC.T. . .TTCTACT. .TG.CC-T-TA. .A. . TCACAAGAAA .

+++ TA... .GACT.G.CT. .TCT. .C.ATACC. .

++. TA... .GACT.G.CT. . TCT. .C.ARACC.

GACT.G.CT. . TCT. .C.AAACC. .

GACT.G.CT..TCT. .C.AAACC. .

22222222222222222222233333333333333333333333333333332333333

35566777788888899999900001111112233333334444444445555566678

838690139124568235678078923478959012678901234567814 78901800

Fejervarya J2-B GTAACATT- CGCGTCA- TA -ACCAAGCCCGCGCGACTTGACGTTTTTTITAATATTCAC

Fejervarya J2-A .............. re SU RE

Fejervarya J2-C

Fejervarya J1-A

Fejervarya J1-B

Fejervarya K1-A

Fejervarya K3-A

Fejervarya S5-A

+C.C.CT.TTA. ATT. A

+C.C.CT.TTA. AIT. A.

:C:C.CT.TTA. .ATIT.A.

++... CT. TTA. AIT. A.

Fejervarya S6-A st CIC CÉSTTAS ART A)

F. cancrivora Kc LATE TR COCO. «0e 4 Tuer

Rana temporaria AG.T.T.ACTA.AAT-CA.C...,T.A.A. . .TACT-

Rana catesbeiana AG.TTTAA.TA.AAT-CA.C..T.C.ATAC. .TACTC.A.

ÉCEEEER

Source : MNHN, Paris

VEITH, KOSUCH, OHLER & DUBOIS 13

Table 3. - Average substitution rate between samples of the two Fejervarya lineages J1 and

J2 and three outgroup taxa; transitions and transversions were weighted equally; gaps

treated as fifth base.

132 lineage | F cancrivora | R. temporaria

J1 lineage (J/K/S) | 0.006 + 0.004

J2 lineage 0.135 + 0.004 | 0.006 + 0.003

Æ. cancrivora 0.160 + 0.001 | 0.155 + 0.001 F

R. temporaria 0.219 + 0.002 | 0.229 + 0.001 0.210 à

R. catesbeiana 0.209 + 0.002 | 0.212 + 0.002 0.192 0.112

ARR ITEENAS

MORPHOMETRIC VARIATION

For all measurements and ratios, the mean, standard deviation and minimum and

maximum values are given for adult specimens of Fejervarya separating samples by sex and

geographical origin (app. 3). Comparisons of adult individuals using the Kruskal-Wallis test

(tab. 4) show significant differences in the frogs from the three islands in the ratios which all

concern head shape (head length, distance between anterior border of eyes, distance between

posterior border of eyes, internarial distance). Fejervarya from Java have significantly shorter

heads and more pointed snouts than the frogs from Sumatra and Borneo. Frogs from Sumatra

are significantly distinct in having a greater distance between posterior border of eyes (app. 3,

tab. 4).

Dorsal pattern

In the populations we studied, 32.1 % of the specimens have no mid-dorsal stripe, a fine

mid-dorsal line is present in 57.6 % of all specimens examined, a wide stripe in 30.5 % of the

specimens, and the combined fine-wide striped phenotype was observed in 15.3 % of the

specimens (tab. 5).

1 line and FE females have a combination of both

0181, 4 = 3, P < 0.001). Neither males nor females differ

in a significant manner from the overall distribution of dorsal pattern (chi-square test: males,

5.7635, df = 3, P > 0.05; females, .1466, df = 3, P > 0.05).

The different populations can be put in three groups: a series of populations showing no

wide stripe phenotypes (group 1 in table 5); a population from Sumatra showing no narrow

line pattern (group 3 in table 5); and a group of populations showing all four patterns (group

2 in table 5). Statistical test shows heterogeneity of phenotype ibution for the wide stripe

pattern between populations studied (Kruskal-Wallis tes! 38, df = 7, P < 0.01).

Distribution between populations for narrow line pattern is not statistically heterogeneous

(Kruskal-Wallis test: ;? = 12.05, df = 7, P > 0.05). The population from Chianjur is in the

More males lack a mid-dor:

Source : MNHN, Paris

14 ALYTES 19 (1)

Neïs (1972) standard genetic distance

0.32 0.24 0.16 0.08 0.00

Fig. 3.— UPGMA phenogram of Ners (1972) standard genetic distances between the Fejervarya samples

(allozyme data); the tree is rooted by the outgroup Féjervarya cancrivorar the cophenetic value is 0.99.

same dorsal pattern group as the population from Desa Lape (Borneo) and the population

from Medan (Sumatra). The two Javanese populations are not in the same dorsal pattern

group.

In conclusion, populations of Fejervarya from the Sunda Islands show statistically

significant variation of dorsal colour patterns, but this variation is not congruent with

allozyme or mtDNA variation as shown in this study.

To which population does the name Rana limnocharis Gravenhorst, 1829 apply?

The name-bearing type provides the objective standard of reference by which the

application of the name it bears is determined (ANONYMOUS, 1999: Article 61.a). Generally,

taxa have been described using morphological methods, and new techniques are rarely

applicable to dead museum specimens. Systematics is, however, a largely historical science, as

new results are added to previous knowledge. One scope of modern science therefore is to

define methods to find quantifiable links between historical museum specimens (especially

type-specimens) and new material studied by modern methods.

Multivariate statistics have been used to refer single type-specimens to biologically

defined populations (HEYER, 1994; OHLer, 1996, 1999; OnLer & DuBois,1999). This also

applies to the case of the two Fejervarva lineages here defined by allozyme and DNA data.

The historical specimen of Heinrich Kuhl, who first collected the species Rana limnocha-

ris, Was a judicious choice for a neotype (see DuBois & OHLER, 2000). In order to find out to

Source : MNHN, Paris

VEITH, KoSUCH, OHLER & DUBOIS

Table 4. - Comparison by Kruskal Wallis test of snout-vent length (SL) and of ratios of measurements in adult

specimens of Féjervarva from different origins. For each sample, minimum and maximum values, mean

and standard deviation are given. df, degree of freedom: », sample size; P, probability; *, significance

level P < 0.05.

EL/SVL

EN/SVL

FLL/SVL

FOL/SVL

FTL/SVL

HAL/SVL

HL/SVL

HW/SVL

IBE/SVL

IFE/SVL

IMT/SVL

IN/SVL

/SVL

MBE /SVL

MFE/SVL

MN/SVL

svL

TEL/SVL

TL/S

TYD/SVL

WI/SVL

WIL/SVL

WIF/SVI

96-117

1084 106

86—91

8842.55

196-221

2094 126

496-554

5234292

303-324

3164116

176-221

1994225

329-375

3564241

342-360

3504 9.34

210-246

2324188

129-145

1384 8.60

44-56

504626

66-69

684 1.58

96-126

1084 154

140-154

145481

221-255

2374175

306-326

3144107

444-552

4844 5.91

114-130

1234 7.97

489-532

504 4 23.9

63-66

654 1.86

35-40

372245

73-102

834165

75-87

824591

55-79

644127

86-108

964112

97-129

1124 8.59

80-101

914545

191-227

2154912

490 563

5334204

292-338

3194144

173-219

1974 132

369-448

3884178

332-365

3474103

208 249

2254115

135-162

1472 8.87

45-57

514321

68-79

734313

103-123

1164495

137-171

1494110

226-294

2494160

310-393

3304192

32.6- 59.0

486 à 836

102-130

1184 6.76

475-537

142171

58-69

634333

32-44

394332

63-92

774826

65-88

7747.39

40-75

604897

74-100

874869

109— 126

1154 4.60

81-95

894 4.70

207-230

2214 6.80

465-560

5304241

273-344

3194168

180-223

2034 12.0

363-416

3914145

319-367

3482133

217-273

2384148

141-173

1564 10.1

46-57

5143.49

66-85

7544.69

108 125

1184538

135-193

1584 173

229-279

2524147

304-373

3354162

362-542

46.1 + 6.06

105-135

1234784

465-534

5084 16.9

59-73

6644.05

27-49

402474

52-97

784122

63-92

794878

46-79

#= 2.010

P=0366 ns

5259

P-0072ns

= 0.576

P-0750ns

0.407

P-08I6ns

Le 1.601

P= 0449 ns

1 = 6.849

P0033*

2 = 0268

P= 0875 ns

1 = 6.668

P=0.036

= 8.680

P-0013

L=0.542

P=0762

= 7739

P=0021*

2.148

P 20.342

1 = 2.840

P=0242ns

#=1.746

P=0418ns

= 5.330

P= 0.069 ns

11458

P-0A82ns

ané

P-O121ns

1772

04I2ns

A = 5454

0065 ns

1.408

0.495

0207

10902 n

#< 1083

P = 0.582

022

F-02895 ns

2713

0258 ns

Source

MNHN, Paris

16 ALYTES 19 (1)

fee

100 J2-3B

J2-C

r— J1-A

Fr J1-B

K1-A

F K3-A

+ S5-A

— S6-A

100 Fresnes —— À. temporaria

R. catesbeiana

Fig. 4. - Maximum parsimony tree of 390 bp of the mitochondrial 16-rRNA gene of nine Fejervarya

haplotypes. Tree length is 202 steps (one shortest tree only); bootstrap values > 50 % for 1000 replicates

are indicated.

£ 0

4 Brio 2

Neotpe

F3 rom imnocheris

2 Our

BE popuatious

is #80 64 418 32 16 00 16 32 48

Discriminant fanion scores

- Stacked histogram of discriminant function for specimens of population J2 and other popula-

of Fejervarya from Sunda Islands. The neotype RMNH 4287 of Rana limnocharis Gravenhorst,

1829 was included into this analysis without a priori group membership.

Source : MNHN, Paris

VEITH, KosUCH, OHLER & DUBoIS 17

Table 5. — Coloration pattern of dorsum in Fejervarya from Sunda Islands. Frequency distribution

of phenotypes of mid-dorsal line and alleles supposed present in populations studied. n,

allele wild narrow line; N, allele narrow line; w, allele wild wide line; W, allele wide line

Proposed phenotypical groups: 1, line absent or narrow line present (wide line never

observed); 2, line absent or fine and/or wide line present (all 4 phenotypes observed); 3, line

absent or wide line present (fine line never observed)

Alleles

Sample (sample size) | Line absent| Fincline | Widetine | Feand ue À png

in genotype

1 Bogor (4) 2 0 0 mn N/w 1

S2 Sidikalang (2) 1 [ 0 0 n,N/w 1

$5 Tapaktuan (5) 2 3 0 0 nN/w 1

$6 Desa Scleutkat (3) 2. [ 0 0 n,N/w 1

S1 Medan (13) [ 10 0 2. [nN/wwl 2

32 Chianjur (11) 5 3 [ 2 [aN/mwW| 2

K3 Desa Lape (13) 2 2 6 3 InN/wwW| 2

KI Pontianak (2) 0 0 2 0 n/w,W 3

which genetically defined lineage (population J2 or the other populations from Sunda Islands)

this name applies, a discriminant analysis was performed and subsequently applied to the

neotype of Rana limnocharis. The analysis clearly classes the neotype with lineage J1 and not

with the specimens from population J2 (tab. 6, fig. 5). This indicates that the name Rana

limnocharis Gravenhorst, 1829 should apply to the widely distributed taxon occurring in Java,

Sumatra and Borneo, and that a new name should be created for the species from population

32. As no other name is available for this taxon (see DuBois & OHLER, 2000), we describe it as

a new species. The morphological comparison of adult males of the new species and

Fejervarya limnocharis is summarised in table 7.

Fejervarya iskandari sp. nov.

Diagnosis. - Medium sized Fejervarya With a relatively wide head and interorbital distance,

small tympanum, short eye length, short forearms, short inner toes and small inner metatarsal

tubercles.

Description of holotype. - MNHN 19974916, adult male (fig. 2a), from paddy field at

Chianjur (Java) (6°12'S, 107°08'E).

(A) Size and general aspect. — (1) Specimen of rather small size (SVL 40.4 mm), body

moderately stout.

Source : MNHN, Paris

ALYTES 19 (1)

Table 6. — Results of canonical discriminant analysis between genetically determinated

specimens of Fejervarya.

À. Statistical significance.

Wilks Lambda

Chi-square de

EEE

B. Standardiscd canonical discriminant function coefficients.

186131

= 3.16796

138762

—0.52334

= 644177

—0.01355

= 11.188090

=1.91388

= 3.850940

2.55580

188979

—0.99019

— 0.29879

325966

5.56794

488480

421029

121313

726577

231338

193537

0.69464

0.54972

186954

— 0.75687

€. Classification success.

Actual group

Lejervarva iskandari

— 0,96165

Predicted group

E iskandari

5 (100 %)

F linmocharis

Lejervarva limnocharis

33 (100%)

Neotype of Rana limnocharis (ungrouped)

100%)

Source : MNHN, Paris

VerrH, KosucH, OHLer & Dugois

Table 7. - Comparison of adult males of Fejervarya iskandari sp. nov. and Fejervarya

limnocharis (Gravenhorst, 1829) by Mann-Whitney U test. n, sample size; P,

probability; U, Mann-Whitney U, ns, significance level P > 0.0:

P<0.01

EL/SVL

106 + 2.89

F. limnocharis

120 + 687

Mann-Wbitney

Utest

U=0

**, significance level

102 - 109 12-129 _| P=00045 +

DELA DENT Tai

FRE 88-09 82— 101 P= 0.568 ns

209 26.12 2225436 U-0

AÉANT 199 -215 218-230 | P-0.0045%

SHITTIG | 53621267 U= 14

FOBASVE 489-557 522 - 557 5698 ne

FEIIA4T | 24e 817 U= 16

RASE 308-337 315-397 | P-08075»

ADS | 2034154 U=n

HALPSVES 200-224 19-223 | P=02912n

FSHIZIS | 39722356 U=17

HEIBNE 374-416 375-447 | P-09353n

EEE EEE D=7

1SVL

RUE 337-367 340-354 | P-0.0882n

DES | 22164 Ua

ISBVL 232-245 221-273 | P-04649n

1221067 | 1972782 PEN

ME 141-162 144-166 | P-0.5698 ns

DEENT] 50228 U=i

LE NE 43-48 46-53 P= 0.0526 ns

TALT6T HEZKE DE

NÉSYE 72-76 miss P= 0.687 ns

par T0 10.1 T9 39 EU

FTLISVL 96-124 13-124 | P-00882ns

ÉEES RENE U=T

JE/

Lis 50-56 46-55 LP 0.0882 ns

re 16322035 | 13341410 U= 12

MÉRIRE 138-188 14-171 378 ns

: 255198 | 25521962 16

MER 234-275 237-294 | P=0.8075 ns

RE HOLI9O7 | 33912519 T=16

MOPSVE 318-360 320-393 | P-08075m

pr ELENTE LAN DEEE] EN

NE 404-427 326-467 | _P=0.5691 ns

| DTENIET 13249 US

THE 111-136 18-132 | P-06847n

Are AL T7ST | 30741276 U=S

$ 468-511 488-523 | P-01229m

: GTE 287 CEE LE

DSL 63-70 59-73 P=0.5698 ns

mas 532293 381429 U=T

L'HSNE 31-38 32-43 P= 0.0882 ns

TENTE CHERS SIL 67 U=T

UEW/SVL 76-88 87-100 | P-00882ns

Far F4 106 ROLE

WAFLEE 69-08 61-97

7621299 SIL #2

64-96 69-92 P=0378 ns

red CENT GI 110€ D

Wit/SVL 47-80 46-79 P= 06847 ns

DE F2 1208 DATE I] = 10

TES 76106 82-99 P-02232 ns

Source : MNHN, Paris

20 ALYTES 19 (1)

(B) Head. — (2) Head of medium size, longer (HL 15.4 mm) than wide (HW 14.4 mm;

MN 13.1 mm; MFE 9.5 mm; MBE 5.9 mm), convex. (3) Snout pointed, protruding, its length

(SL 7.90 mm) much longer than horizontal diameter of eye (EL 4.34 mm). (4) Canthus

rostralis rounded, loreal region very concave, vertical. (5) Interorbital space flat, smaller (UE

2.27 mm) than upper eyelid (UEW 3.57 mm) and internarial distance (IN 2.92 mm); distance

between front of eyes (IFE 5.7 mm) about half of distance between back of eyes (IBE

9.5 mm). (6) Nostrils oval with flap of skin laterally, closer to tip of snout (NS 3.55 mm) than

to eye (EN 4.02 mm). (7) Pupil rounded. (8) Tympanum (TYD 2.72 mm) distinct, rounded,

more than half of eye diameter; tympanum-eye distance (TYE 1.30 mm) about half its

diameter. (9) Pineal ocellus present, between anterior border of eyes. (10) Vomerine ridge

present, bearing few small teeth, between choanae, with an angle of 45° to body axis, less close

to choanae than from each other, longer than distance between them. (11) Tongue large,

rounded, emarginate. (12) Supratympanic fold distinct, from eye to shoulder. (13) Parotoid

glands absent. (14) Cephalic ridges absent. (15) Co-ossified skin absent.

8.7 mm), not enlarged. (17) Fingers I, III and IV long, finger II short, all thin (TFL 5.32 mm).

(18) Relative length of fingers, shortest to longest: II < IV < I < II. (19) Tips of fingers

pointed. (20) Finger II with dermal fringe; webbing absent. (21) Subarticular tubercles

prominent, rounded, single, all present. (22) Prepollex oval, prominent; two oval, distinct

palmar tubercles; supernumerary tubercles absent.

(D) Hindlimbs. — (23) Shank three times longer (TL 20.6 mm) than wide (TW 6.0 mm),

longer than thigh (FL 18.8 mm), but shorter than distance from base of internal metatarsal

tubercle to tip of toe IV (FOL 22.5 mm). (24) Toes long, thin; toe IV long (FTL 13.6 mm), more

than one third of distance from base of tarsus to tip of toe IV (TFOL 29.6 mm). (25) Relative

length of toes, shortest to longest: 1 < II < V < III < IV. (26) Tips of toes pointed. (27) Webbing

moderate:11-2111-21111-22/31V21/3-1 V(WTF 4.28 mm; WFF 3.95 mm; WI 3.89 mm;

WI13.24 mm; MTTF 9.7 mm; MTFF 10.3 mm; TFTF 9.5 mm; FFTF 10.0 mm). (28) Dermal

fringe along toe V present, from tip of toe to base of metatarsus, well developed. (29)

Subarticular tubercles prominent, oval, simple, all present. (30) Inner metatarsal tubercle

long, very prominent, its length (IMT 1.94 mm) less than 2.5 times in length of toe I (ITL

4.60 mm). (31) Inner tarsal ridge well developed, along distal half of tarsus. (32) Outer

metatarsal tubercle prominent; supernumerary tubercles absent; tarsal tubercle absent.

(E) Skin. — (33) Dorsal and lateral parts of head and body: snout smooth; between the

eyes and side of head with few, flat glandular warts: back with glandular folds and glandular

warts between them: flanks with glandular warts. (34) Latero-dorsal folds absent. (35) Dorsal

parts of limbs: forelimbs smooth; shank, thigh and tarsus with glandular warts. (36) Ventral

parts of head, body and limbs: throat, chest and belly smooth: thigh with glandular warts. (37)

No macroglands.

(F) Coloration in alcohol. - (38) Dorsal and lateral parts of head and body: brown with

blackish paired spots: shoulder spots indistinct; four brown spots on each side of upper lip.

(39) Dorsal parts of limbs: forelimb, thigh, shank and foot light brown with dark bands:

tof thigh with brown and whitish marbling. (40) Ventral parts of head, body and

chest, belly and thigh cream white; throat cream white with grey W-shaped pattern:

margin of throat white with large brown spots.

Source : MNHN, Paris

VerrH, KosuCH, OHLER & DUBOIS 21

(G) Male sexual characters. - (41) Nuptial spines in one single patch on prepollex and

finger L; numerous, indistinct, cream coloured spines. (42) Vocal sacs as greyish, folded skin on

the two sides of the throat; slit-like openings in rather anterior part of mouth floor. (43) Fine

horny spinules on the anterior border of the throat.

(H) Part of the 16$ rRNA sequence that corresponds to the nucleotides 3994-4554 of

Xenopus laevis (ROE et al., 1985). — (44) (EMBL AJ292018) TCTTGTTTTTTCATAA

GAGGTCCAGCCTGCCCAGTGACACAATTAAAGGCCGCGGTACCCTGACCGTG

CGAAGGTAGCATAATAACTTGTTCTTTAAATGGGGACTAGCATGAACGGCAC

CACGAAGGCCTCACTGTCTCCTTTTTCCAATCAGTGAAACTGATCTCCCCGTG

AAGAAGCGGGGATGATAATATAAGACGAGAAGACCCCATGGAGCTTTAAACC

CAATAAGCAACCCTAATCAACACAACTCATCTAAATTCTTTETCCCCCTGCTTT

TTGGTTTTAGGTTGGGGTGACCACGGAGTAAAACATATCCTCCACGACGTAC

GGATTAACCCTTATCCAAGAGCCACCGCTCTAAGAATCGACAAATTGACGTTT

TTTGATCCAATATATTGATCAACGAACCAAGTTACCCTGGGGATAACAGCGCA

ATCCATTTTTAGAGCCCCTATCGACGAATGGGTTTACGACCTCGATGTTGGAT

CAGGGTACCCAAGTGGTGCAGCCGCTACTAATGGTTTGTTTGTTCAACAATT

AAAACCCTACGTGATCTGAGTTC.

Paratopotypes. - FMNH 256725-256733, 3 adult males, 1 adult female, 5 juvenile males;

ZFMK 68867, adult male. Same collection data.

Etymology.— The new species is dedicated to Djoko Iskandar, herpetologist from Indonesia.

DISCUSSION

Fejervarya iskandari sp. nov. and Fejervarya limnocharis (Gravenhorst, 1829) from Java

clearly represent two genetically distinct lineages. Their Nei D values calculated from allo-

zyme data (average: 0.314) falls within the interspecific range known from other ranids (e.g.,

1978; NisHioKA & SUMIDA, 1990; MENSI et al., 1992; ARANO et al., 1993; BEERLI et al.

H, 1996). However, the observed morphological variation between the genetically

well differentiated lineages F. iskandari and F limnocharis is slightly more pronounced than

among members of the other populations, as estimated by the number of significantly distinct

measurements. Therefore these two forms are clearly a pair of sibling species that are

morphologically scarcely distinct from one another, but show substantial genetic differentia-

tion. In addition, a comparison of our allozyme data with those of the samples 3 and 4 of

Topa et al. (19984) reveals that their samples fit almost perfectly with our analysis: in nine out

of eleven loci which were analysed in both studies the results are identical, one locus shows

similar allele frequencies and only in one locus the results are different. Discrepancies in the

results may have been caused by using different protocols in the two laboratories (see VEITH,

1994 for further examples). Therefore the new species includes specimens from the Javanese

populations of Chianjur and Malingping (sample 4 in Toba et al., 1998a). It is genctically well

defined, but morphologically very similar to Æ limmocharis. Distribution ranges of Æ iskan-

dari and EF. limnocharis overlap at l between Malingping and Chianjur over a distance of

ca. 130 km. Syntopy was shown for a paddy field near Malingping, Java (TODA et al., 19984),

confirming species status of Æ éskandari.

Source : MNHN, Paris

22 ALYTES 19 (1)

Discriminant analysis of morphometric data resolves the nomenclatural relevance of the

observed genetic divergence. The name Rana limnocharis Gravenhorst, 1829 applies to a

taxon widely distributed in the Sunda Islands. As there is no indication of genetic or

morphological differentiation of the frogs from Borneo island, the name Rana wasl Annan-

dale, 1917 (based on a holotype from Kuching, Sarawak, Malaysia, on this island) is here

considered a junior subjective synonym of Rana limnocharis (see DuBois & OHLER, 2000), but

remains available for further systematic decisions, should Bornean Fejervarya prove hetero-

geneous.

RÉSUMÉ

Les grenouilles de l'espèce Fejervarya limnocharis et d'espèces voisines de celle-ci sont

parmi les plus communes en Asie du Sud-Est. Nous avons étudié 52 spécimens de huit

populations des Iles de la Sonde par les méthodes de l’électrophorèse d’allozymes, du

séquençage d'ADN mitochondrial et de la morphométrie. Les patrons de variation de tous les

caractères entre les populations se montrent congruents pour séparer une population de Java

de toutes les autres populations (Java, Sumatra, Bornéo) et considérer qu'elle appartient à une

espèce distincte. Les fréquences des quatre phénotypes observés concernant la présence et la

largeur d’une ligne médio-dorsale dans les populations examinées ne permettent pas de

dégager de claire corrélation avec les caractères moléculaires et morphométriques. Notre

analyse morphométrique permet d’attribuer sans ambiguïté le nom Rana limnocharis Gra-

venhorst, 1829 à l’espèce à vaste répartition qui se trouve à Java, Sumatra et Bornéo. Les deux

taxa vivant en sympatrie, nous donnons un nom nouveau, Fejervarya iskandari, à la popula-

tion de Chianjur, Java.

ACKNOWLEDGEMENTS

to thank R. Feldmann for his help in the field and K. Rehbinder for her outstanding

study was supported by the “German Science Foundation (DFG)", grant Nr. SE 506/5-1

and by the “German Bundesamt für Naturschutz (BIN)”, grant Nr. Vw-534 11-5/02, The morphometric

work was part of the programme of MESR 2586 “Systématique et évolution des vertébrés tétrapodes”

This is publication Nr. 01-36 of PPF “Faune et flore du sud-est asiatique” (Nr. 00 EUVE & TIAN,

2001).

LITERATURE CITED

ANONYMOUS, 1999, — Jnternational code of zoological nomenclature. Fourth edition. London, Internatio-

nal Trust for Zoological Nomenclature: i-xxix + 1-306.

ARANO, B.. ESTEBAN, M. & HERRERO, P., 1993. - Evolutionary divergence of the Iberian brown frogs. Ann.

Sci. nat. Zool. Paris, V4: 49-57.

Source : MNHN, Paris

VEITH, KOSUCH, OnLer & DUBoIs 23

B£ERLI, P., HOTZ, H. & UZZELL, T., 1996. - Geologically dated sea barriers calibrate a protein clock for

Aegean water frogs. Evolution, 50: 1676-1687.

Case, S.M., 1978. - Biochemical systematics of members of the genus Rana native to western North

America. Syst. Zool., 27: 299-311.

DEUvE, T. & Tia, M.-Y., 2001. — Zolinopatrobus nanlingensis n. gen., n. sp., de la Chine méridionale,

premier représentant d’une sous-tribu nouvelle parmi les Trechidae Patrobinae (Coleoptera,

Caraboidea). Bull. Soc. ent. France, in press.

DONNELLAN, S$. C., ADAMS, M. & APLIN, K. P., 1989. — A biochemical and morphological study of Rana

(Anura: Ranidae) from the Chimbu Province, Papua New Guinea. Herpetologica, 45: 336-343.

Dusois, A., 1975. - Un nouveau complexe d'espèces jumelles distinguées par le chant: les grenouilles du

Népal voisines de Rana limnocharis Boie (Amphibiens, Anoures). C. r Acad. Sci, (D), 281:

1717-1720.

_— 1977. - Les problèmes de l'espèce chez les amphibiens anoures. Mém. Soc. zool. France, 39: 161-284.

= 1980. - Populations, polymorphisme et adaptation: quelques exemples chez les amphibiens anoures.

An: R. BARBAULT, P. BLANDIN & J.-A. MEYER (ed.), Recherches d'écologie théorique — Les stratégies

adaptative, Paris, Maloine: 141-158.

1992. — Notes sur la classification des Ranidae (Amphibiens Anoures). Bull. Soc. linn. Lyon, 61:

305-352.

Duoïs, A. & OuLrr, À. 2000. - Systematics of Fejervarya linnocharis (Gravenhorst, 1829) (Amphibia,

Anura, Ranidae) and related species. 1. Nomenclatural status and types specimens of the nominal

species Rana limnocharis Gravenhorst, 1829. Alytes, 18 (1-2):

FELSENSTENN, J,, 1985. - Confidence limits on phylogenies: an approach Me bootstrap. Evolution, 39:

783-791.

_— 1993. — PHYLIP: Phylogenetic Inference Package, version 3.5c. Seattle, Univ. of Washington, Dep.

Genetics.

GRAVENHORST, J. L. C., 1829. — Deliciae Musei Zoologici Vratislaviensis. Fasciculus primus, continens

Chelonios et Batrachiae. Lipsiae, Sumptibus Leopoldi Vossii: i-xiv + 1-106, pl. 1-17.

HEBerT, P. D. N. & BEATON, M. L., 1986. — Merhodologies for allozyme analysis using cellulose acetate

electrophoresis. Beaumont, TX, Helena Laboratories: à

Hever, W.R., 1994. - Variation within the Leprodactylus podicipinus-wagneri complex of frogs (Amphi-

bia: Leptodactylidae). Smithsonian Contrib. Zool., 546: i-iv+1-124.

HiGGis, D. G. & Suarr, P. M., 1993. - CLUSTAL W: a package for performing multiple sequence

alignment on a microcomputer. Cubios, 5: 151-153.

INGER, R. F,, 1966. - The systematics and zoogeography of the Amphibia of Borneo. Fieldiana: Zool., 52:

1-402.

---- 1989. - Four new species of frogs from Borneo. Malayan Nature J., 42: 229-243.

---- 1999. - Distribution of amphibians in Southern Asia and adjacent islands. Zn: W. E. DUELLMAN (ed.),

Patterns of distribution of amphibians — A global perspective, Baltimore & London, The John

Hopkins University Press: 445-471.

INGER, R. EF. & Grimis, P À., 1983. - Variation in Bornean frogs of the Amolops jerboa species group, with

description of two new species. Fieldiana: Zool., 19: 1-13.

INGER, R. F. & STUEBING, R. B., 1989. — Frogs of Sabah. Sabah Parks Publication Nr. 10.

== 1991. - New species of frogs of the genus Leprobrachella Smith (Anura: Pelobatidae) with a key to the

species from Borneo. Raffles Bull. Zool., 39: 99-103.

- 1997. — 4 field guide 10 the frogs of Borneo. Borneo, Natural History Publications: 1-205.

INGER, R. F., Voris, H. K. & Voris, H. H., 1974. - Genetic variation and population ecology of some

Southeast Asian frogs of the genera Bufo and Rana. Biochem. Genet., 12: 121-145.

KOCHER, T. D., THOMAS, W. K., MEYER, A. EDWARDS, S. V., PAÂBO, S., VILLABLANCA, FE. X. & WILSON,

C., 1989. - Dynamics of mitochondrial DNA evolution in mammals: amplification and

equencing with conserved primers. Proc. nat. Acad. Sci. USA, 86: 6196-6200.

L, A. & VerrH, M. 1997. - Genetic and morphological variation in Limmonectes

limnocharis (Gravenhorst, 1829) from the Great Sunda Islands (Sumatra, Java, Borneo). /n: Z.

), Abstracts of the Third World Congress of Herpetology 1997: 249.

U. & GROSSMANN, W., 1997. Amphibien und Reptilien Südostasiens. Münster, Natur und Tier:

1-512

Source : MNHN, Paris

24 ALYTES 19 (1)

MaRMAYOU, J., DUBoïs, À., OuLer, A., PASQUET, E. & TILLIER, A., 2000. - Phylogenetic relationships in

the Ranidae. Independent origin of direct development in the genera Taylorana and Philautus. C.

r. Acad. Sci., Sci. Vie, 323: 287-297.

MENSI, P., LATTES, A., MARCARIO, B., SALVIDIO, $., GrAcOMO, C. & BALLETTO, E., 1992. - Taxonomy and

evolution of European brown frogs. Zool. J. Linn. Soc., 104: 293-311.

Mursrean, W. W. RAND, A. $. & Srewarr, M. M., 1974.- Polymorphism in cricket frogs: an hypothesis.

Evolution, 28: 489-491.

MOHANTY, A. K. & DurrA,S. K. ,1999. - Biological notes on Limnonectes limnocharis (Anura: Ranidae)

in India, Russ. J. Herp., 6: 33-44.

MorIWaki, T., 19 The inheritance of the dorso-median stripe in Rana limnocharis Wiegmann. J Sci.

Hiroshima Univ., (B), div.1, 14: 159-164.

Neï, M., 1972. - Genetic distance between populations. Am. Nar., 106: 283-293.

NismiokA, M. & SumiDa, M., 1990. — Differentiation of Rana limnocharis and two allied species

elucidated by electrophoretic analyses. Lab. amphibian Biol., Hiroshima Univ., 10: 125-154.

Norusis, M. J., 1992. SPSS for Windows. Professional Statistics. Release 5. Chicago, SPSS Inc.

1-348.

OuLER, A., 1996. — Systematics, morphometrics and biogeography of the genus Aubria (Ranidae,

Pyxicephalinae). Alytes, 13: 141-166.

— 1999. — The identity of Dendrobatorana Ahl, 1927 (Amphibia, Ranoïdea). Mit. Mus. Naturkd.

Berlin, 75: 37-45.

OuLer, À. & DuBoïs, A., 1999. - The identity of Elachyglossa gyldenstolpei Andersson, 1916 (Amphibia.

Ranidae) with a discussion of some aspects of statistical support to taxonomy. Zoo!. scripta, 28:

269-279.

RICHARDSON, B. J., BAVERSTOCK, P. R. & ADams, M., 1986. — Allozyme electrophoresis. A handbook for

animal systematics and population structure. Sydney, Academic Press.

ROE, B. A., DIN-Pow, M., WiLsON, R. K. & WONG, JF. 1985. - The complete nucleotide sequence of the

Xenopus laevis mitochondrial genome. J. biol. Chem., 260: 9759-9774.

Roue, FE J, 1990. - NTSYS: Numerical Taxonomy and Multivariate Analysis System, version 1.60. New

York, Setauket.

SAMBROOK, J., FRITSCH, E. F. & MANIATIS, T., 1989. — Molecular cloning: a laboratory manual. Cold

Spring Harbor Laboratory Press: 1-729.

SHIBATA, Y., 1988. — Mid-dorsal stripe type of a frog, Rana limnocharis, in northwestern

Kyushu, Japan (Amphibia: Ranidae). Shizenshi-Kenkyu occ. Pap. Osaka Mus. nat. Hist.,

69-71.

SIGISMUND, H. R., 1993. — G-STAT, version 3. Munich.

SworroRD, D. L., 1993. - PAUP: Phylogenetic Analysis Using Parsimony, version 3.1.1. Computer

program distributed by the Illinois Natural History Survey, Champaign, Illinois.

Top, M., Matsut, M., NisHiDa M. & OrA, H., 19984. - Genetic divergence among Southeast and East

Asian populations of Rana limnocharis (Amphibia: Anura), with special reference to sympatrie

c species in Java. Zool. Sci., 15: 607-613.

sHiDA, M., MaTsUI, M., FU, W.G. & OrA, H., 1997. - Allozyme variation among East Asian

populations of the Indian rice frog, Rana limnocharis (Amphibia: Anura). Biochem. Syst. Ecol., 25:

143-159.

Toba, M., NisHiDA, M. MaTsUI, M., LUE, K.-Y. & OTA, H., 1998b. - Genetic variation in the Indian rice

frog, Rana limnocharis (Amphibia: Anura), in Taiwan, as revealed by allozyme data. Herpetolo-

gica, 54 (1):73-82.

Vera, M. 1994. - Morphological, molecular and life history variation in Salamandra salamandra (L.).

. GREVEN & B. THIESMEIER (ed.), Biology of Salamandra and Mertensiella, Mertensiella, 4:

355-398.

—— 1996. - Molecular markers and species delimitation: examples from the European batrachofauna.

Amplhibia-Reptilia, 17: 303-314.

i-xii] +

Corresponding editor: W. Ronald HEYER.

Source : MNHN, Paris

VEITH, KosuCH, OHLEr & Dumois 25

Appendix 1. — List of morphometric measurements of Fejervarya specimens used in this

study.

Measurement

EL eye length

EN distance from front of eye to nostril

FFTF webbing measured from maximum incurvation between toes IV and V to tip

of toe IV

FLL length of arm from elbow to base of outer palmar tubercle

FOL length of foot from proximal border of inner metatarsal tubercle to tip oftoe

FTL length of fourth toe from basal border of proximal subarticular tubercle to

tip of toe IV

HAL length of hand from base of outer palmar tubercle to tip of finger III

HL head length from mandibular articulation to tip of snout

HW head width

IBE distance between posterior borders of eyes

IFE distance between anterior borders of eyes

IMT length of inner metatarsal tubercle

IN internarial distance

ITL inner toe length from distal border of inner metatarsal tubercle to tip of toe I

MBE distance from mandibular articulation to posterior border of eye

MFE distance from mandibular articulation to anterior border of eye

MN [distance from mandibular articulation to nostril

MTFF webbing measured from distal border of inner metatarsal tubercle to

maximum incurvation between toes IV and V

MTTF webbing measured from distal border of inner metatarsal tubercle to

maximum incurvation between toes III and TV

SVL snout-vent length

TFL length of finger from basal border of proximal subarticular tubercle to tip of

finger LIL

TETE webbing measured from maximum incurvation between toes IT and IV to

tip of toe IV

TL length of tibia from tibio-metatarsal articulation to knee

maximum tympanum diameter

tympanum-eye distance

Source : MNHN, Paris

Appendix 2. — Allele frequencies, average expected heterozygosity (4) and polymorphism (P) at 15 presumptive enzyme loci in 9 samples of

Fejervarya from Java (1), Kalimantan (K) and Sumatra (S). See text (Material and methods) for details on localities. Sample Ke belongs to

the species Féjervarya cancrivora

Sample pl mA KI K3 ST s2 ss s6 Ke

15 6 3 25

a a a

b ] b ©

a a | a a

AAT-1 a (0.05) b (0.04 e © € (0.02)

€ (0.90) € (0.96) £ (0.98)

d (0.05)

AAT-2 a b a (025) a 0.70) a a a a c

b (0.75) b (0.30)

IDH-1 a a a a a a a a D

IDH-2 a a a a a a a a à (0.96)

b (0.04)

LDH a b a a a a a a c

MDH a (0.87) a © © (0.56) D (0.09) cO25) d € (0.50) e

b(0.13) d (0.04) € (0.50) d(0.75) d (0.50)

d (0.41)

ME a a a a a a a a b

MPI d b (0.59) a (0.25) a (0.25) b(0.35) b b b b (0.60)

<(041) € (0.50) b (0.45) d (0.65) £(0.14)

€ (0.25) d (0.25) 2(0.26)

e (0.05)

PEP (Gly- | b(0.37) a b b a(G.15) b b b b

Leu) c(063) | b (0.85)

PGM a | a a a (0.84) a (0.88) a a a €

b (0.16) b (0.12)

PK a a a a a a a a b

TPI b(0.87) b (0.95) a (0.25) a (0.05) b b b b b

c@13) | c(005) b (0.50) b (0.95)

| c (0.25)

H. CS TS O1 015 01 002 0 00 004

P 02 0.2 0.2 04 0.26 0.06 0 0.06 0.2

(D 61 SALATV

Source : MNHN, Paris

VEITH, KOSUCH, OHLER & DUBOIS

Appendix 3. - Morphometrical data for adult specimens of Fejervarya samples from Sunda Islands. Mean,

standard deviation, minimum and maximum values are given for all samples.

1 76-106 LL 0-7 I

Desa Seleukat | — Desa Laÿ : Modan

| en ets) an | dm | Peer [en | di

ar w [ pas

DR ME SR. REX NETINE

IE SE SRUNES: IE MEME

Pr SES SRE: SE EN E

TES SE: SRE: SEEN EE:

mont ES [AUS us [Me mn | mm |

mn [SE un [M | m | = [ve

TUE SET SNME: SE MERE ME:

CIE SE SES SE ME EL:

TIR SE SE: SN METRE

MTS | “sas os _ es se # ri

men RS D Don [le | e [49

mn [en [ue un fn | |

CARE Fe. 52 in 46 50 rs

aan [SEE | ue [ET me | w [2

ES IE- NME SN MEME:

TIR ES SRE SM ME

ou TRE DE ne [US me | ee [4%

msn [D Qu [M Qu | un |

TIRE SE ET EE:

nossu. | GS s ou G ss es

rene [ne fon [ls Je [eu

re g =. a & S ve x = pese 1 = #7 Be

| wu/svr. an rs 70 un. 50 55 Lo

Source : MNHN, Paris

28 ALYTES 19 (1)

Appendix 3. - Continued.

Sidikalang Tapaktuan | DesaSeleukat | Desa Lape Pontiak | p je épars

(Sumatra) (Sumatra) (Sumatra) | (Kalimantan) | (Kalimantan) ne

1 female 4 females 2 females 8 females 2 females re

mn un | Se Ne | eo | uw

ersw | #0 | Wu | mn | S-% oi

FuL/svL | 206 uen (de 196

mate [é| #7 CARE

TIME: HE HE: EH

DE NE HE SE AE IE

PIRE AE NE AE: EE

a nl PLUS |

TIMES SES SE SET EEE

men ( ue | Me | De | one | We |

RENSVE # Pres 5 Re - “2-5

ment mn és | ue [|

manf ue [ses us [e | =

met ns | 2 [ie | 9e [eu]

mnt un | PS | es [ie | US |

TRE METIERS SET SEL UE

TIME SE: SEE HR

mm [me Jensen] l

ma] ue [AN DURS LES [EU | 10

men) un |] D | ee | M | mn

TE, = T 2335 DE2SS Das A 436 ra

UEW/SVL 83 mean pee Hs 93 LEA 0 88

mem] a | ee us | te | vue

men] ne [US een | | dx

ment [ue [es (Hs

Source : MNHN, Paris

Alytes, 2001, 19 (1): 29-44. 29

Un nouveau Leptopelis

de la zone forestière camerounaise

(Amphibia, Anura, Hyperoliidae)

Jean-Louis AMIET

48 rue des Souchères,

26110 Nyons, France

A new species of Leptopelis from southern Cameroon is described. It is

readily distinguishable by its dorsal pattern, transversely striped except a

trapezium-shaped cephalic blotch, very rounded canthus rostralis, immacu-

late ventrum and characteristic nuptial call. The distribution of this rare

species is traced, mainly from aural records, and information on its

etho-ecology - including the “phonocenosis” to which it participates - is

given.

Hormis une analyse de ses appels sous la dénomination de “Leptopelis sp. 2° (AMIET &

Scmorz, 1974), l'espèce décrite ici n’a jamais été mentionnée dans la littérature batracholo-

gique concernant le Cameroun, et plus généralement l'Afrique centrale (PERRET, 1966:

LAURENT, 1973; ScHIOTZ, 1999). Sa découverte illustre bien l’utilité, voire la nécessité, de la

prospection acoustique en forêt équatoriale: c’est l'audition de vocalisations non identifiables

qui a permis de capturer le premier individu en 1972, et les 14 autres spécimens (sauf l’unique

femelle) ont aussi été pris grâce à un repérage acoustique préalable. Contrairement à Lepto-

pelis omissus Amiet, 1991, la nouvelle espèce n’a été relevée que dans de rares localités de la

zone forestière, et les sites d’activité vocale, étroitement circonscrits, ne regroupent que

quelques mâles. Il n°y a donc rien d'étonnant à ce que l'espèce, pourtant facile à reconnaître,

soit restée inconnue jusqu'ici.

L'holotype et la moitié des paratypes sont déposés au Muséum national d'Histoire

naturelle de Paris (numéros précédés par le sigle MNHN), les autres sont actuellement dans la

collection de l’auteur (sigle JLA). Les indications relatives au sexe et à l’origine des spécimens

étudiés sont regroupées dans le tableau 1.

Pour alléger le texte, les noms des auteurs et les dates de création des espèces citées sont

mentionnés ci-après (ordre alphabétique): Afrixalus paradorsalis Perret, 1960; Alexteroon

obstetricans (Ah, 1931); Amnirana albolabris (Hallowell, 1856); Amnirana amnicola (Perret,

1977); Astylosternus batesi (Boulenger, 1900); Bufo gracilipes Boulenger, 1900; Bufo tuberosus

Günther, 1859; Cardioglossa escalerae Boulenger, 1903; Cardioglossa gracilis Boulenger, 1900;

Cardioglossa gratiosa Amiet, 1972; Cardioglossa leucomystax (Boulenger, 1903); Chiromantis

rufescens (Günther, 1868); Conraua crassipes (Buchholz & Peters, 1875); Dimorphognathus

Source : MNHN, Paris

30 ALYTES 19 (1)

Tableau 1. - Leptopelis zebra: références et origine du matériel étudié. JLA, numéros de collection de

l'auteur, MNHN, numéros des spécimens déposés au Muséum national d'Histoire naturelle de Paris.

Sexe: M, mâle: F, femelle. L'holotype est signalé par un astérisque.

MNHN Sexe! Localité Coordonnées Altitude Date

£ M | Ototomo | 11°17Ex3°40'N| env. 720 m | 18.11.72

DS M IST Ex 3°40'N | env. 720 m | 30.VI.72

_2000.2712 | M 1I917'E x 3°40'N | env. 720m | 7.174

_2000.2713 | M 11917Ex3°40'N | env. 720m | 141.74

L M | 11917'E x 3°40'N | env. 720 m | 14.1.74

_2000.2714| M | Awae |11°51'Ex3°53N| env. 700m | 241.74

93* |2000.2715*| M | Ototomo |11°17Ex3°40'N| env. 720 m | 23.VI.75

| 2000.2716| M | Ototomo |11°17Ex3°40°N| env. 720 m | 8.VIL75

__ | M} Ototomo |11°17'Ex3°40'N | env. 720 m | 8.VIL75

M | Kala-Afomo | 1122'E x 3°50° N | env. 740 m | 10.VIL78

| M | Kala-Afomo | 11°22'E x 3°50'N | env. 740 m | 10.VIL78 |

ji _M | Kala-Afomo | 11°22'E x 3°50' N | env. 740 m | 10.VIL78

_| 20002717 | M | Kala-Afomo | 11°22'E x 3°50' N | env. 740 m | 10.VIL78

2000.2718| F | Kala-Afomo | 11°22'E x 3°50' N | env. 740 m | 10.VIL78 |

2000.2719 | M | Kala-Afomo | 11°22'E x 3°50' N | env. 740 m 12.1.79

africanus (Hallowell, 1857); Hyperolius endjami Amiet, 1980; Hyperolius kuligae Mertens,

1940; Hyperolius ocellatus Günther, 1859; Hyperolius platyceps (Boulenger, 1900); Leptopelis

il, 1856); Leptopelis boulengeri (Werner, 1898); Leptopelis brevirostris (Werner,

1898); Leptopelis calcaratus (Boulenger, 1906); Leptopelis millsoni (Boulenger, 1894); Lepto-

pelis modestus (Werner, 1898); Leptopelis notatus (Buchholz & Peters, 1875); Leptopelis

ocellatus (Mocquard, 1902); Leptopelis omissus Amiet, 1991; Leptopelis rufus (Reichenow,

1874); Opisthothylax immaculatus (Boulenger, 1903); Prychadena aequiplicata (Werner, 1898).

Leptopelis zebra n. sp.

Matériel étudié.

Holotype. - Mäle MNHN 2000.2715 (ex JLA 75.293) de la Réserve forestière d'Oto-

tomo, à environ 30 km SSW de Yaoundé, 11°17°E, 3°40°N, 720 m d'altitude, forêt dense de

bas-fond, 23.VL.75. Mensurations et proportions: voir tableaux 2 et 3. Livrée dorsale (en

alcool) bien contrastée, avec une douzaine de bandes brunes transverses sur fond beige: voir

fig. 3.

Source : MNHN, Paris

AMIET 31

Tableau 2. - Quelques mensurations (en dixièmes de mm) chez Lepropelis zebra. L'holotype est signalé

par un astérisque, L, longueur du corps, mesurée du bout du museau à l'entrejambe; T, largeur de la

tête derrière les yeux; C, longueur de la cuisse, de l’entrejambe au genou: J, longueur de la jambe, de

la saillie du genou à celle du talon: P, longueur du pied, du talon à l'extrémité de l’orteil IV; œ,

diamètre de l'œil entre les angles palpébraux; ty, plus grand diamètre du tympan; on, distance

œil-narine, Valeurs maximales en grasses, valeurs minimales en italiques.

72.134 : 375 | 190 | 195 | 270 | 165 | 54 | 39

72466 | _330 | 165 | 175 | 235 | 135 | 43 | 33

74.003 |2000.2712 | 335 | 180 | 185 | 250 | 150 | 51 | 37 | 35

| 74.005 | 2000.2713 | 185 | 235 | 150 | 54 | 33

| 74.006 | 170 | 230 | 135 | 50 | 37

74.016 |2000.2714 | 29. | 165 | 200 | 125

[75.293* |2000.2715*| 345 | 195 | 180 | 260 | 160

| 75.297 |2000.2716| 360 | 180 | 180 | 240 | 150

325 | 185 | 180 | 225 | 135

300 | 165 | 165 | 220 | 140 52

330 | 170 | 185 | 230 | 150 36

Lu _[ 180 | 175 | 240 | 150 35

2000.2717 170 | 225 | 150 | 37

20002719 | 350 185 | 250 | 155 | 50 | 3

moyenne | 133571/176.43| 178,21 123643| 146,43] 50,14 | 35.36 | 35,57

23,19 | 10,27 | 8,68 | 17,59 | 10,99 | 3.98 | 3

écart-type

Femelle

78.180 |2000.2718| 450 | 245 | 235 | 335 | 190 | 55 40 43

Paratypes. — Treize mâles et une femelle; localités d'origine et dates de capture: voir

tableau 1.

Autre matériel. — 51 diapositives, 3 enregistrements sonores.

Diagnose. — Lepropelis sylvicole de taille médiocre, bien caractérisé par: (1) son canthus

rostralis très à rée dorsale constituée d’une macule céphalique

trapézoïdale et de ban nsverses sur un fond plus clair; (3) sa face ventrale immaculée, de

teinte saumon-orangé sur le vivant: (4) ses vocalisations. L. rufus et L. millsoni peuvent avoir

Source : MNHN, Paris

3 ALYTES 19 (1)

Tableau 3. - Quelques rapports morphométriques chez Leptopelis zebra. L'holotype est signalé par un

astérisque. Abréviations: voir la légende du tableau 2. Valeurs maximales en grasses, valeurs

minimales en italiques.

CE —

MNHN CL JL PL TL on/œ ty/œ

50,67 | 52 | 72 | 44 | 7407 | 722

: 50 | 53,03 | 7121 | 40,97 | 70,06 | 76,74

03 |2000.2712| 53,73 | 55,22 | 74,63 | 4478 | 68.62 | 72.54

| 2000.2713 | 50 | 52,86 | 67,14 | 42,86 | 7407 | 61.11

54,84 | 74,19 | 43,55 | 64 74

24 | 55,93 | 678 | 4237 | 7333 | 62,22

52.17 | 75,36 | 4638 | 72,22 | 70,34

50 | 66,67 | 41,67 | 72,72 | 709

5538 | 69.23 | 41,54 | 7142 | 67,34

74.016 | 2000.2714

75.293* |2000.2715*

75.297 | 2000.2716

78.176 1] 55 73,33 46,67 69,56 71,73

78.177 | 56,06 | 697 | 4545 | 72 | 72 |

78.178 | 50 48,61 | 66.67 | 41,67 | 79,06 | 67.27 |

78.179 | 2000.2717| 50,75 | 50,75 | 67,16 | 44.78 | 80,43 | 73,91

79.001 | 2000.2719| 52.86 | 52.86 | 71,43 | 44,29 | 72 76

moyenne 52,65 | 53,19 70,47 | 43,64 | 73.04 | 70,59

écart-type 16.74 16,80 22,74 14,05 23.82 26.46

Femelle

78.180 | 2000.2718] 54,44 | 52,22 | 74,44 | 42,22 | 72.73 | 22,63

un patron dorsal similaire mais se distinguent aisément de L. zebra par leur bande interocu-

laire étroite et subrectiligne et par la présence d'au moins quelques macules ventrales foncées.

Etymologie. - Allusion aux bandes transversales qui ornent le pelage du zèbre (latin =ebra).

Habitus, proportions, membres, tégument. — Les tableaux 2 et 3 donnent les principales

ations et proportions relatives aux 14 mâles récoltés, adultes puisque vocalement

s. Avec une longueur museau-anus variant de 29,5 à 37,5 mm (moyenne 33,5 mm), ces

mâles ont une taille médiocre par rapport à celle des autre: forestières c: ï

mais cependant un peu supérieure à celle de L. omissus (29, mm, moyenne 32 mm) et,

surtout, de L. modestus (26 à 28,5 mm, moyenne 27 mm). L'habitus peut être qualifié de

est modérément dilatée, sa largeur repré-

ans disproportions apparentes. La tê

Source : MNHN, Paris

AMIET 33

sentant de 41 à 46 % environ de la longueur totale, et les membres postérieurs sont relative-

ment courts pour une espèce à mœurs très arboricoles.

Le museau est court, la distance œil-narine représentant environ les trois-quarts du

diamètre oculaire (moyenne 73 %); il est fortement déclive à son extrémité qui, vue de dessus,

a un aspect tronqué ou en arc très arrondi; les narines, peu saillantes, sont largement écartées,

l'espace internasal représentant environ 80 % de l’espace interorbitaire. Un caractère impor-

tant de l'espèce est l’atténuation des canthus, plus arrondis que chez les autres Leptopelis

forestiers et passant à des lores faiblement obliques et à peine concaves. Les yeux sont gros et

saillants, le diamètre interpalpébral mesurant de 4,3 à 5,5 mm (moyenne 5 mm). Ce diamètre

est supérieur à la distance œil-narine (3,2 à 4 mm, moyenne 3,5 mm) et à celui du tympan (2,8

à 3,9 mm, moyenne 3,5 mm). Ce dernier est circulaire, contigu à l’œil et saillant vers le bas,

au-dessus de la commissure buccale; il est entouré plus ou moins complètement par un fin

rebord granuleux.

La main (fig. 1), du repli cutané du poignet à l'extrémité du doigt III, est un peu plus

longue que l’avant-bras (d’un cinquième environ). Les doigts sont relativement courts et

larges, impression accentuée par les replis cutanés qui les bordent jusqu'aux disques adhésifs

terminaux. Ces derniers sont aussi larges ou un peu plus larges que longs aux doigts II, III et

IV, celui du doigt I étant un peu plus long que large, proportions qui se retrouvent chez la

plupart des Leptopelis arboricoles. Il y a un tubercule sous-articulaire sous les doigts I et IT,

deux sous les doigts III et IV; ces tubercules sont très saillants, en particulier les tubercules

distaux des doigts III et IV, en forme d’épaisses lames bifides:; le tubercule proximal du doigt

IV est, comme chez d’autres Leptopelis, un peu décalé vers le bord externe du doigt. La paume

porte de grosses granulations irrégulières, qui s'étendent sur la base des doigts. Entre les doigts

Let IL, la membrane interdigitale est étroite, guère plus large que la frange cutanée des doigts;

elle est plus étendue entre les doigts II et IT et, surtout, IT et IV, où son bord libre se situe au

niveau de la mi-distance entre les tubercules proximaux et distaux de ces derniers; elle porte,

sur sa face inférieure, des verrucosités semblables à celles de la paume, mais plus petites.

Des mensurations effectuées à titre comparatif sur des spécimens de L. omissus, L.

calcaratus, L. modestus et L. aubryi ont montré que le membre postérieur est relativement plus

court que chez toutes ces espèces, y compris, mais de peu, la dernière, La jambe est légèrement

plus longue que la cuisse, chacune représentant un peu plus de la moitié de la longueur

museau-anus (tableau 3). Le pied (fig. 1) ne présente pas de caractère particulier, et ressemble

beaucoup à celui de L. omissus (AMIET, 1991). Les orteils sont largement rebordés, les disques

adhésifs à peu près a longs que larges aux orteils II, III et V: celui de l’orteil I est un peu

plus long que large et celui de l'orteil IV un peu plus large que long. Les tubercules

sous-articulaires sont très saillants, les plus développés de forme conique, et ont la même

répartition que chez les autres espèces du genre: un aux orteils I et IT, deux aux orteils IT et V

et trois à l’orteil IV; le tubercule distal de ce dernier est plus ou moins dédoublé, ce caractère

étant variable suivant les individus. La palmure pédieuse est assez étendue: entre les orteils III

et IVet IV et V, sa partie la plus concave arrive au niveau du tubereule sous-articulaire médian

de l’orteil IV: elle est plus profondément échancrée entre les orteils Let II et IT et III. Le

tubercule métatarsien interne est bien développé, à peu près aussi long que l'orteil au-delà du

tubercule sous-articulaire: il est bien saillant, assez comprimé mais avec une arête obtuse. Il y

a des petites excroissances plantaires, mais elles sont moins prononcées que sous la main.

Source : MNHN, Paris

34 ALYTES 19 (1)

Fig. 1. — Face plantaire du pied et face palmaire de la main chez Lepropelis zebra.

Sur le dessus de la tête, du dos et des membres, le tégument est très finement et densément

granuleux, ce qui lui donne un aspect mat; sur les flancs, les granulations deviennent plus

grosses et plus inégales. Sur la face ventrale, il est opaque, réticulé-granulé, les granulations

étant plus grosses dans les régions pectorale et abdominale que dans la région gulaire. Chezles

mâles, près de la racine des bras, deux petites plages circulaires de 3 mm de diamètre environ,

d'aspect lisse mais en fait finement poreuses, correspondent aux glandes pectorales. Sous les

cuisses, la peau est en partie transparente, avec des petits polygones opaques d'aspect

pavimenteux. La tranche externe des avant-bras et des pieds est soulignée par un net repli

cutané, s'étendant jusqu'à l’extrémité du doigt et de l’orteil externes.

Pigmentation. — La teinte de fond de la face dorsale (fig. 2) varie du mastic au beige clair ou au

fauve, avec le plus souvent une chaude nuance orangée sans équivalent chez les autres

Leptopelis camerounais. Le dessin (fig. 3), très caractéristique, est constitué par des bandes

transversales brun clair, assez régulières, se succédant depuis le dessus du museau jusqu'à la

région lombaire: ces barres sont plus ou moins nombreuses et étroites suivant les individus.

Sur la tête, une épaisse barre interoculaire constitue la base d’un trapèze ou d’un triangle à

sommet orienté vers l'arrière: il s'agit en fait de la macule céphalique, présente chez de

nombreuses autres espèces de Leptopelis, mais ici largement évidée dans sa partie centrale.

Source : MNHN, Paris

AMIET 35

2.- Mâles de Leptopelis zebra: (a) Ototomo, 18.11.72; (b) Ototomo, 7.1.74 (ILA 74.005); (c) Kala,

10.VIL.78 (ILA 78.176): la coloration rouge des orteils et des doigts n’est visible que chez certains

individus; (d) Ototomo, 18.11.72 (JLA 72.134): livrée diurne à dessin imperceptible: (e) Ototomo,

7.1.74 (ILA 74.006): chez cet individu en livrée diurne le dessin est atténué, mais la fine granulation

gumentaire et les points noirs, présents chez certains individus, sont plus apparents: (f) Awaë,

2411.74 (ILA 74.016): malgré la surexposition de la région gulaire, une teinte verte reste visible sur les

côtés de la gorge: (g) Ototomo, 18.11.72 (72.134): f à forte suffusion saumonée, de

l'individu figuré en (d)

Source : MNHN, Paris

36 ALYTES 19 (1)

Fig. 3. - Variation du patron dorsal de Lepropelis zebra, dessins à la chambre claire schématisés, Les

numéros sont ceux de la collection de l’auteur (voir tableau 1). H, holotype (ILA 75.293 = MNHN

2000.2715).

Source : MNHN, Paris

AMIET 37

Cette ornementation céphalique est un caractère discriminant important par rapport à L.

rufus et L. millsoni, dont le dessin dorsal peut être aussi, assez souvent, formé de bandes

transverses: chez ces derniers, il n’y a pas de macule céphalique mais uniquement une bande

interoculaire étroite, très régulière et indépendante des autres éléments du patron dorsal. De

plus, chez L. rufus et L. millsoni, les fascies dorsales sont souvent réunies par des anastomoses

médio-dorsales et circonscrites par un liséré foncé plus apparent que chez Z. zebra.

Le dessus des avant-bras et des jambes est aussi orné de bandes transversales, dont la

densité et la largeur reproduisent celles du dos, avec les mêmes variations individuelles.

Comme chez de nombreuses espèces de Leptopelis, il peut y avoir quelques petits points

blancs ou, plus souvent, noirs (fig. 2b, e), correspondant à des granulations un peu plus

grosses, dispersés sur le dos et le dessus des jambes, mais pas sur la tête. Il n’y a aucune trace

de pigmentation verte chez les 15 spécimens étud

L’ornementation latérale est très sobre. Les côtés de la tête ne montrent ni pigmentation

sombre sub-canthale, ni macule blanche sous-oculaire, contrairement à de nombreuses autres

espèces de Leptopelis. Les flancs sont unis, de la même teinte que le dos mais plus clairs, ou

tout au plus mouchetés de brun (fig. 2a). La coloration de l'œil n’en est que mieux mise en

valeur, l'iris, d’un cuivreux doré, étant surmonté d’une bande d’un rouge sang (fig. 2a-d),

beaucoup plus soutenu que chez les autres espèces camerounaises ayant la même pigmenta-

tion oculaire (L. millsoni, L. modestus, L. omissus et certains L. aubryi). Dans la région

postérieure, une macule foncée périanale, surmontée d’un étroit liséré blanc, est reprise au

niveau des talons et se poursuit en une bande irrégulière sous le bord externe du tarse: cette

ornementation n’a rien de particulier et se retrouve chez presque tous les Lepropelis camerou-

nais.

La description précédente concerne des individus à livrée contrastée, se développant sous

une forte hygrométrie et une faible luminosité. Dans des conditions inverses, le contraste

s’atténue, au point que les bandes dorsales peuvent devenir difficilement perceptibles (fig.

2d-e).

Le dessous des régions gulaire, pectorale et abdominale est remarquable par sa pigmen-

tation unie, sans aucune trace de maculation. La gorge est blanche, mais peut présenter une

teinte turquoise chez certains individus (fig. 2f), orangée chez d’autres (fig. 2g). Ces différences

ne paraissent pas individuelles, mais plutôt liées aux conditions ambiantes: mes notes de

terrain mentionnent, à plusieurs reprises, que la couleur vert turquoise de la gorge ne se voit

que la nuit, pendant le chant, alors que les photos d'individus fortement éclairés au préalable,

faites en laboratoire, ne montrent pas cette coloration. La poitrine et l'abdomen sont blancs

ou lavés d’orangé. Le dessous des mains, des pieds et des cuisses est toujours coloré de

saumon, pouvant tirer sur le rouge clair ou l'orangé. Le dessous des cuisses est très caracté-

ristique, avec des granulations plates polygonales d’un blanc opaque ressortant sur le reste du

tégument, transparent et vivement coloré. Le même contraste s’observe pour le pli cutané

bordant les membres antérieurs et postérieurs, lui aussi de teinte blanche. Assez paradoxale-

ment, le dessous du tarse est, sur son bord externe, fortement pigmenté de brun, coloration qui

se poursuit le long du cinquième orteil.

ace ventrale est blanchâtre, les Zones transparentes devenant opa-

animal

En alcool, toute la f

ques. Sur la face supérieure, le patron à bandes transversales reste visible, du moins

a été fixé en livrée contre

Source : MNHN, Paris

38 ALYTES 19 (1)

NE SET IT

Æ l i

Leptopelis zebra HE .

NIGERIA

GUINEE

EQUATORIALE GABON CONGO

RCA

Fig. 4. — Carte du Cameroun au sud du 8° parallèle montrant les carrés (de 10 minutes sexagésimales de

côté) où la présence de l'espèce a été relevée. En trait plein: courbe de niveau de 600 m; en tireté: limite

nord de la forêt dense continue.

Distribution géographique. - Comme le montre la carte de la fig. 4, tramée en carrés de 10 mn

de côté (pour la méthode de cartographie, voir AMIET, 1983), la présence de l'espèce a été

relevée dans une quinzaine de carrés seulement, ce qui est très inférieur aux chiffres atteints

par la plupart des autres Leptopelis sylvicoles (L. omissus 122; L. calcaratus 91; L. brevirostris

83; L. boulengeri 65; L. millsoni 54; L. ocellatus 51: L. rufus: 46). L'aire de l'espèce englobe le

centre et l’est du Cameroun, avec une limite nord coïncidant apparemment avec celle de la

forêt dense et une limite ouest constituée par le rebord du Plateau sud-camerounais. Les

prospections dans la plaine littorale et l’ouest du Cameroun ont été assez denses pour qu'on

puisse considérer l'absence de L. =ebra dans ces régions comme établie. En revanche, les

grandes lacunes dans l’est et le sud-est du territoire sont probablement dues à un manque de

prospections aux périodes favorables. D'autres Anoures camerounais ont une distribution

Source : MNHN, Paris

AMIET 39

semblable (par exemple Hyperolius platyceps, Leptopelis ocellatus et Cardioglossa escalerae),

paraissant correspondre à un aréotype “congolais” (AMIET, 1983).

Ecologie en période de reproduction. — Les sites où ont été entendus les mâles de L. zebra

présentaient plusieurs caractéristiques communes: (1) localisation dans des vallées plates,

parcourues par de petites rivières forestières à cours lent, sur fond de sable, gravier et feuilles

mortes; (2) substrat parsemé, en saison pluvieuse, de trous d’eau ou de flaques, sans être

franchement marécageux: au moins en grande saison sèche, ces collections d’eau sont taries:

(3) végétation dense, enchevêtrée, où l’abondance des lianes et les discontinuités de la canopée

évoquent souvent des formations secondaires âgées.

Les postes de chant, fournis par des branchettes ou des lianes, se situent nettement

plus haut que pour les autres Leptopelis forestiers, L. omissus compris. Leur hauteur, difficile

à estimer dans un sous-bois dense, a souvent paru atteindre la dizaine de mètres. Cette

situation élevée n’est cependant pas obligatoire, comme l’a montré l'“expérience naturelle”

suivante.

Le site de Kala-Afomo, où quelques mâles appelaient à chaque saison de reproduction à

proximité d’une petite mare tapissée de feuilles mortes, a été profondément transformé par un

défrichement effectué fin 1977. Les grands arbres ont été abattus, et seuls ont subsisté à

proximité de la mare des arbustes, des grandes herbacées et des masses de lianes privées de

leurs supports. Les mâles de L. zebra se sont alors établis dans cette végétation broussailleuse

proche de la mare, émettant leurs appels à seulement 2 ou 3 m du sol, ce qui a permis d'en

capturer plusieurs, auxquels s’est ajoutée la seule femelle connue de l'espèce. La croissance de

la végétation, rapide dans ce type de milieu, a entraîné, au fil des saisons, une remontée des

postes de chant.

Vocalisations. Cycle annuel d'activité vocale. - Les appels se distinguent facilement de ceux des

autres Leptopelis camerounais. Ils consistent en 3 ou 4 notes, d’une durée de 0,2 s et séparées

par des intervalles d'environ I s, qui pourraient être transcrites par des “hon”’ assez graves; la

dernière note est plus sonore que les précédentes. Ce type d'appel est le plus souvent émis mais,

sporadiquement, il peut y avoir des notes plus courtes, “konk”” à tonalité nasale et grave. Un

sonagramme a été publié sous la dénomination “ Leptopelis sp. 2” (Amrer & ScHioTz, 1974)

mais il est en partie obscurci par une épaisse bande de bruit de fond. Il permet cependant de

constater le faible niveau de la fréquence dominante.

Trois localités de la région de Yaoundé ont permis de suivre le cycle d'activité vocale de

l'espèce: Ototomo (janvier 1972 à décembre 1975), Kala-Afomo (janvier 1973 à décembre

1984) et Nkoladjap-Ekombitié (janvier 1976 à décembre 1984). Le tableau 4 donne le détail

des relevés acoustiques mensuels effectués dans ces localités, ainsi que le nombre de relevés au

cours desquels l'espèce a été entendue (il n’y a pas eu de sorties en août et pendant la première

quinzaine de septembre).

Ce tableau permet de constater qu'il y a deux périodes d'activité vocale, séparées par des

phases durant lesquelles l'espèce est totalement silencieuse. L'une va de décembre à mars et

l’autre comprend au moins juin et juillet. Il faut toutefois préciser qu'une analyse plus fine des

dates des relevés montre que l'espèce a été notée une seule fois avant la mi-décembre et jamais

au-delà du 7 mars, ce qui ramène à une période d'activité d’un peu moins de trois mois. De

même, l'espèce n’a été entendue qu'une seule fois (très peu active) un 12 juin, les autres relevés

Source : MNHN, Paris

40 ALYTES 19 (1)

Tableau 4. - Activité vocale de Leptopelis zebra dans trois localités de la région de Yaoundé. NR, nombre

de relevés acoustiques effectués (les tirets correspondent à des mois où aucun relevé n’a été effectué):

RZ, relevés au cours desquels L. zebra a été entendu.

Jan Fév Mar Avr Mai Jun Jul Aou Sep Oct Nov Déc

Ototomo NR|5 6 4 4 4 3 4 - - - 4

LR PNR RASE et , ne Anse à

Kala-Afomo NR|12 11 11 12 12 12 13 - 13 13 13

[= RU #6 2"Bh ue Verrine

Nkoladjap/ NR| 9 9 9 9 8 8 8 - 10 9 9

Ekombitié RZ:|NSR 3 22 See

Total NR|26 26 24 25 24 23 25 - 23 22 26 26

RZ|20 13 5 4 17 - 8

du même mois se situant après le 20; la lacune de prospection en août ne permet pas de savoir

quand s'achève cette seconde période, mais il est probable que les dernières émissions sonores

ont lieu début septembre. Les autres relevés effectués dans des localités proches de Yaoundé

coïncident aussi avec ces deux périodes. En revanche, plus à l’est, dans le domaine de la forêt

mésophile ou de la forêt congolaise, il semble y avoir un décalage des périodes d’activité car

l'espèce a été entendue fin-mars à Mintom (13°17°E) et à Mayang (13°56'E) et jusqu'aux 5-6

avril à Sandja (12°47°E).

Comme le montrent les graphiques de la figure 5, il y a une étroite corrélation entre les

périodes d'activité vocale et les deux saisons sèches ca istiques des climats équatoriaux.

Il faut cependant remarquer que: (1) la petite saison sèche (juillet-août) ne s'accompagne pas

d’une baisse marquée de l’hygrométrie et peut même, certaines années, être quasi virtuelle: (2)

le commencement de la grande saison sèche peut varier, dans la région concernée, du début à

la fin du mois de novembre. Or ces variations ne se répercutent pas sur les phases d'activité

vocale de L. zebra, ce qui laisse supposer que celle-ci n’est pas induite par les conditions

propres aux saisons sèches.

Plusieurs autres espèces forestières, surtout des Lepropelis et des Cardioglossa (AMIET,

1989), ont un cycle semblable, mais celui de Z. =ebra est remarquable par le fort “resserre-

ment” des périodes d'activité vocale. Ce phénomène est probablement en relation avec les

faibles effectifs des mâles actifs dans un site donné: les relevés acoustiques ont souvent reposé

sur l’audition de 3 ou 4 mâles seulement, alors que, simultanément, les autres espèces de

Leptopelis, L. omissus en particulier, étaient représentées par des dizaines de mâles actifs. À

l'extrême, certaines saisons de reproduction ont donné l'impression d'être “’sautées”, aucun

mâle n'ayant été entendu dans un site et à une date propices. C’est ce qui explique que dans le

tableau 4, même lors des meilleurs mois, les relevés positifs ne représentent pas la totalité des

relevés effectués.

Source : MNHN, Paris

AMIET 41

100

Jan Fév Mar Avr Mai Jun Jui Aou Sep Oct Nov Déc

Moyennes mensuelles de précipitations à Yaoundé |

Fig. 5. — Cycle d'activité vocale de Leptopelis zebra dans trois localités de la région de Yaoundé

{explications dans le texte), comparé au cycle annuel des précipitations. Les données pluviométri-

ques, exprimées en pourcentage du total annuel moyen pour une période de 30 ans (1597 mm), sont

empruntées à SUCHEL (1972

Espèces compagnes de L. zebra en période d'activité vocale. - Le tableau 5 regroupe toutes les

espèces d'Anoures entendues lors de 61 relevés auditifs durant lesquels l’activité vocale de L.

zebra a été constatée. Pour chacune des localités suivies (les mêmes que ci-dessus), les relevés

de grande et de petite che ont été distingués. Les relevés effectués à Ototomo en 1972

n'ont pas été retenus car, à l'époque, toutes les espèces ne pouvaient être identifiées auditive-

ment. Le rapport du nombre de relevés où une espèce a été entendue au nombre de relevés où

l'activité de L. zebra a été notée a été exprimé en pourcentage, pour faciliter les comparaisons.

aisOn $

Source : MNHN, Paris

ALYTES 19 (1)

Tableau 5. - Anoures participant à la même phonocénose que Lepropelis zebra. Explications dans le texte.

NT, nombre total de relevés où une espèce a été entendue. Groupes: À, développement en eau

stagnante B, développement en eau stagnante renouvelée (proximité d’un cours d’eau); C, dévelop-

pement en eau courante.

F Ototomo | Ototomo | Kala Af. | Kala Af. [Nkol./Ek.| Nkol/Ek.

Gde. S. | Pet, S. s. |Gde. $. s| Pet, S. s.]Gde. $. s| Pet, S. [NT

(8) _| (5) {19) |} (11) CON SCES S

Poste de chant sur | | |

la végétation | | |

Groupe A | | |

Le. omissus 62,5 80 947 | 100 100 | 100 |55

Le.calcaratus 75 | #0 73.7 | 91 692 | 80 |47

Le. boulengeri 625 | 60 63,1 | 54,4 53,8 6 | 36

Le. notatus 25 | 40 421 | 364 100 | 100 |34

Hy. ocellatus 50 | 60 737 | 727 307 | 20 |3

Le. ocellatus 89,5 | 72,7 te | MS 27

Le. aubryi 62,5 100 CESR 3 20 |17

Af paradorsalis 105 | 89 | 1

Hy. plaryceps 12,5 2 | 307 | 40 |7

Hy. endjami - | 364 | 4

Ch. rufescens 125 | 40 52 | - | 4

Le. modestus | ÉOSA NE, 51 3

Hy. kuligae | | 154 | - 2

Groupe B | |

Le. rufus 375 | - 684 | 364 | 20

Le. millsoni | | 61,5 | 60 |ii

Groupe C | | |

Op.immaculatus | 62,5 | 60 842 | 100 46 | so |45

Al obstetricans 50 60 | ET Tee | ME 8

Poste de chant au | &:

sol | |

Groupe À | | |

Am. albolabris - | 4 158 | - 385 | 60 |13

Pi.aequiplicata 37,5 | 20 | 4

Groupe B |

Di. africanus 25 | 100 91 154 40 |39

Am. amnicola 316 | 91 77 r 8

Groupe C |

Ca.gratiosa 50 80 79 | 100 100 100 |52

Ca.escalerae 100 | 80 84,2 82 37

Co. crassipes 37,5 40 63,1 54,5 23 20 |27

Ca. gracilis 37,5 60 158 | 100 23 80 |27

As. batesi 12.5 20 58 63,6 23 20 |24

Ca. leucomystax 75 100 31,6 54,5 23

Bu. gracilipes 25 | 36,8 36.4 13

(eu tuberosus 36,8 ï 154 # 9

Source : MNHN, Paris

AMIET 43

On constate que près d’une dizaine d'espèces accompagnent fidèlement L. zebra, quelles

que soient la localité et la saison considérées, puisqu'elles se retrouvent dans plus de 50 % des

relevés: Leptopelis omissus (55 relevés sur 61), Cardioglossa gratiosa (52), Leptopelis calcaratus

(47), Opisthothylax immaculatus (45), Dimorphognathus africanus (39), Cardioglossa escalerae

(37), Leptopelis boulengeri (36), L. notatus (34) et Hyperolius ocellatus (34).

D'autres espèces sont plus souvent notées en même temps que L. zebra lors d’une des

deux saisons sèches. Par exemple, Curdioglossa gracilis est plus fréquente en petite saison

sèche. En effet, l’activité vocale de cette espèce, plus “opportuniste” que les autres Cardio-

glossa sylvicoles, débute aux premières pluies de fin février et connaît seulement un ralentis-

sement en petite saison sèche, en relation peut-être avec le maintien d’un degré hygrométrique

plus élevé qu’en grande saison sèche.

On remarquera aussi que certaines espèces n’accompagnent L. zebra que dans certaines

localités, probablement en raison de particularités environnementales présentées par ces

dernières. C’est ainsi que les bas-fonds de Nkoladjap-Ekombitié, parcourus par de petites

rivières à cours lent, sur fond finement sableux, susceptibles de tarir en grande saison sèche (et

même en petite), conviennent à Leptopelis millsoni, mais pas à Cardioglossa escalerae (qui

recherche pourtant, en période de reproduction, des substrats sableux).

On pourrait qualifier de “phonocénoses” les ensembles d'espèces qui exercent leur

activité vocale, et donc reproductrice, pendant la même période de l’année et dans des sites

présentant des caractéristiques écologiques similaires. Ces ensembles ne sont, à proprement

parler, ni des peuplements, ni des communautés, ni des associations, ni des synusies. Ils

méritent néanmoins d’être décrits car ils constituent de bons indicateurs de certaines combi-

naisons de facteurs écologiques, en ayant de plus le grand avantage d'intégrer la dimension

temporelle. Dans le cas présent, il faut cependant remarquer que le tableau 5 ne donne qu'une

image incomplète de la phonocénose à laquelle participe L. zebra, car il ne tient pas compte:

(1) des relevés effectués dans les mêmes sites et aux mêmes saisons mais où L. zebra n’a pas été

noté; (2) des relevés effectués dans les mêmes sites mais à d’autres saisons (ils permettraient de

mettre en évidence l’évolution de la phonocénose au cours de l’année); (3) des relevés effectués

dans d’autres milieux (qui permettraient de définir les phonocénoses de façon comparative, en

mettant en évidence des espèces “caractéristiques” et/ou constantes). Tel quel, le tableau 5

représente cependant une esquisse significative de la phonocénose à laquelle participe L.

cebra.

RÉSUMÉ

Une nouvelle espèce de Leptopelis provenant du Cameroun méridional est décrite. Elle

est facilement reconnaissable par son patron dorsal, constitué de bandes transverses sauf une

macule céphalique trapézoïdale, son canthus très arrondi, sa face ventrale dépourvue de

maculation et son appel nuptial caractéristique. Les limites de répartition de cette rare espèce

sont définies, surtout à partir de relevés auditifs, et des informations sont fournies sur son

étho-écologie, y compris la *phonocénose” à laquelle elle participe.

Source : MNHN, Paris

44 ALYTES 19 (1)

REMERCIEMENTS

Tous mes remerciements vont à Annemarie Ohler, Alain Dubois et Arme Schiotz pour la lecture du

manuscrit et les informations et suggestions qu'ils m'ont communiquées.

RÉFÉRENCES BIBLIOGRAPHIQUES

, 1983. — Un essai de cartographie des Anoures du Cameroun, A/yies, 2 (4): 124-146.

—— 1989. — Quelques aspects de la biologie des Amphibiens Anoures du Cameroun. Ann. biol., 28 (2):

73-136.

— 1991. — Un Leptopelis méconnu de la faune forestière camerounaise (Amphibia, Anura, Hyperolii-

dac). Alpes, 9 (4): 89-102.

Ave, J.-L. & Scmiorz, À. 1974. - Voix d’Amphibiens camerounais. III. Hyperoliinae: genre Lepropelis.

‘Ann. Fac. Sci. Cameroun, 17: 131-163.

LAURENT, R., 1973. - Le genre Lepropelis Günther au Zaire (Salientia). Ann. Mus. r Afr cent., Sci. zool.,

202: 1-62.

Perker, J-L., 1966. - Les Amphibiens du Cameroun. Zool. Jb. Spst., 8: 289-464.

Scmiorz, À. 1999. Treefrogs of Africa. Chimaira, Frankfurt am Main

SucHez, J-B., 1972. - La répartition des pluies et les régimes pluviométriques au Cameroun. Travaux et

documents de géographie tropicale, C.E.G.E.T., C.N.R.S, n° 5: 1-287.

Corresponding editor: Alain DuBois.

Source : MNHN, Paris

Alytes, 2001, 19 (1): 45-52. 45

Local variation in Rana temporaria

egg and clutch size

adaptations to pond drying?

Jon LOMAN

Department of Animal Ecology,

Lund University, 223 62 Lund, Sweden

<jon.loman@z00ekol.lu.se>

Egg and clutch size variation among populations of common frogs

(Rana temporaria) were studied in 14 ponds in Sweden. Also two secon-

dary indices, clutch mass and allocation tactics (egg size*/clutch size) were

studied. For all four characters there was a pond-wise correlation between

the values across the two study years. Al characters differed among ponds

and all but allocation tactics differed between years. At least part of this

variation must be environmental. The ponds were classified as permanent

or temporary. The latter dried completely in some years, g all tadpoles.

Pond type affected all characters except egg size. Thus, clutches in shallow

ponds were smaller, lighter and, correcting for clutch mass, had larger eggs

(from the allocation tactics index). 1 suggest that this variation may be

adaptive.

INTRODUCTION

character variation is a trait of all non-endemic animal populations. In common

frogs (Rana temporaria), JoLY (1991) and RYsEr (1996) found differences in body size among

local populations. My study is concerned with two other life history characters that are well

covered by frog studies, namely clutch and egg size (GiBBoNs & MCCARTHY, 1986; BERVEN,

1988: TEJEDO, 1992; SEMLITSCH & SCHMIEDHAUSEN, 1994). However most studies are con-

cerned with within-population variation and how this is related to individual strategies

(exceptions being JoLY, 1991, and MARTIN & Miaup, 1999). This is also the approach taken

in a number of theoretical studies and reviews of life history theory (SMirH & FRETWELL,

1974; Rorr, 1992; EBerT, 1993). The models can be used to compare optimal trait expression

in different localities (CUNNINGTON & BROOKS, 2000).

Loc.

The question posed in the present study is: does population variation in egg and clutch

size characters exist in the study area and is this related to pond hydroperiod? Pond hydrope-

riod is studied because it has a profound effect on the survival of common frog tadpoles in the

study ponds (LOMAN, 1996) as well as in other areas (COOKkE, 1985; KUTENKOV & PANARIN,

1995). So, in temporary ponds fast developing tadpoles are at an obvious advantage. For some

frogs (Bombina orientalis: PARICHY & KAPLAN, 1995; Rana sylvatica: BERVEN & CHADRA,

Source : MNHN, Paris

46 ALYTES 19 (1)

1988), it has been shown that large eggs hatch into fast developing tadpoles. The same

correlation has already been found for Rana temporaria in the present study area (unpubl.).

This makes it particularly interesting to study if there is a relation between pond hydroperiod

and egg size, one of the response variables studied here.

One reason local character variation is important to study is this. Basically, the variation

may be genetic and/or due to direct environmental effects. If the variation has a genetic basis

and is adaptive, this is a factor that must be taken into consideration in conservation work.

Translocating individuals in order to increase diminishing populations may lead to “ecologi-

cal outbreeding depression” (SCHIERUP & CHRISTIANSEN, 1996; LARDNER, 2000). This is the

case if the introduced genotype is not adapted to the new environment.

METHODS

The study is based on measurements on eggs and spawn clumps collected in the field and

on field measurements of the length of the source pond hydroperiod.

During the breeding seasons of 1993 and 1994, spawn clumps were sampled in 14 ponds.

All ponds were sampled in both years. The ponds are located in the central and southwestern

part of Skäne, the southernmost province of Sweden. The southwesternmost ponds are in the

vicinity of Lund, 40 km from the northeasternmost. The study ponds were classified as

permanent or temporary. Temporary ponds were those eight that in some years dried out

before or during the time the tadpoles metamorphosed. During the six years 1992-1997, when

the ponds were monitored during the time of metamorphosis, this happened 2, 2, 2, 2, 5, 5,5

and 6 times. The six permanent ponds always contained enough water for the entire period of

tadpole life and metamorphosis. The number of spawn clumps laid in the ponds (average of

1993 and 1994) was between 19 and 310 in the temporary and between 16 and 160 in the

permanent ponds.

From each pond I collected data on 6 to 22 spawn clumps. Each spawn clump was

weighed and a sample of approximately 10 g was collected. The clump was then immediately

returned to the pond. The sample was weighed at the pond and brought to the laboratory

where the number of eggs in the sample was counted. This information was used to estimate

“clutch size” (total number of eggs in the clump). The egg diameter (egg proper, excluding

jelly) was measured with calipers in a sample of 15 eggs from each clump and the mean value

was used as measure of “egg size”. Because the ponds were visited every 5 days, I could age the

spawn. Only spawn aged one to four days was used.

Two secondary indices were computed. Clutch volume was computed as the average egg

volume times clutch size. “Allocation tactics index” was computed as average egg diameter”

divided by clutch size. A large value of tactics means that a female, relative to other females

that make the same total investment (same clutch mass), is more inclined to put her effort in

large eggs but a smaller clutch.

Source : MNHN, Paris

LOMAN 47

Table 1. — Pearson correlation test between 1993 and 1994 values for the four indexes studied.

Measurements are defined in the methods section. All tests are based on 14 ponds. The P

values are one-tailed probabilities. A one-tailed test was used as any, hypothetical, negative

correlations a priori would have been discarded as non sensical

Index

Egg size

Clutch size 0.820 < 0.001

Clutch mass index

Allocation tactics index

Table 2. — Average clutch and pond values for permanent and temporary ponds. Egg size is diameter

(mm), clutch size is number of eggs per clutch and clutch volume is total volume of eggs (cc)

Allocation tactics is an index that is explained in the methods. x, mean; s, standard deviation;

n, sample size.

Pond type Egg size |Clutch size] ie Poe

1929 6.96 0.0040

Permanent s 0.12 347 1.30 0.0010

n 6 6 6 6

x 1.87 1464 5.26 0.0052

Temporary s 0.066 289 151 0.0009

8 8

RESULTS

For all four characters (egg size, clutch size, clutch mass index and allocation tactics

index), there was a significant correlation between the average value for a pond in 1993 and

that in 1994 (tab. 1, fig. 1).

1 also tested the independent effects of year, pond and pond type (permanent or

temporary) on the four characters. Egg size was larger in 1994 than in 1993. It differed

significantly among ponds but there was no effect of pond type (tab. 2-3, fig. 1). Clutch size

was significantly larger in 1994 than in 1993 and it differed significantly among ponds.

De that were deposited in permanent ponds were larger than those in temporary ones

(tab. 2-3, fig. 1). Clutch mass index showed the same pattern as elutch size; higher mass in

1994, a significant effect of pond and on average a higher mass for clutches in permanent

ponds (tab. 2-3, fig. 1). The allocation tactics index differed significantly among ponds but not

Source : MNHN, Paris

1994

Egg size (mm) Ciutch size (N)

1994

1998

Cluich voiume (c.c.) Allocation tactics index

25 — 77" —7— OO07 p—— 5 —— 5 — #7 —

| / À

0.006! <<

| | |

| ë |

| _ |

| |

: |

| Ze |

— 0. 09e! A LE ——

6 7 10 0002 0004 0.006 0.008 0.010

1993 1993

Fig. 1. - Relation between egg and clutch characters in 1993 and 1994. Permanent ponds are indicated

with open circles and temporary ones with filled circles. The dashed line represents equal 1993 and

1994 values. A positive slope of the fitted linear regression (the unbroken line) indicates constancy in

pond characteristics over years.

(D 61 SALATV

Source : MNHN, Paris

LOMAN 49

Table 3. — Effects from pond (individual pond, nested under pond hydroperiod), pond type

(hydroperiod permanent or temporary) and year on egg and clutch characters, tested with a

3-way ANOVA. The interaction Pond*Year was tested but not found significant and

removed for the definite test. Data are individual clutch measurements.

Egg size |Clutehsize| Cteh | Alocation

df 11:224 11:221 11:221

Pond F 6.73 7.93 6.59

Ed < 0.001 < 0.001 < 0.001 < 0.001

df 1:222 1:224 1:221 1:221 |

Type F 0.015 43.0 22.7 28.3

P 0.90 < 0.001 < 0.001 < 0.001

df 1222 1:224 1:221 1:221

Year F 6.86 16.22 22.0 1.46

A 0.009 < 0.001 < 0.001 0.23

years. The value was higher for temporary ponds than for permanent ones (tab. 2-3, fig. 1).

This means that when correcting for the fact that females breeding in temporary ponds put

less effort (a lower clutch mass index) altogether into breeding, they were more inclined to

invest in larger eggs.

DISCUSSION

Indeed, there were differences in the four egg and clutch characters studied among

populations breeding in different ponds. In previous studies, MARTIN & MIAUD (1999) and

JoLy (1991) have detected differences in female size among neighbouring populations. In the

Joly study, there were also differences in egg and clutch size between two populations. Because

these variables have been shown to be correlated to female size within populations (HÔNIG,

1966; GisBons & MCCaRTHY, 1986; Jo, 1991; RySER, 1996), it may well be that egg size

variation between populations, both in the Joly study and in the present one, is a direct effect

of among-population variation in female size. In the MARTIN & MIAUD (1998) study, the

variation in egg size among populations was weak, despite among-population differences in

female size.

Egg size, clutch size and clutch mass index varied between the two years. This was

especially clear for clutch size; in all ponds but two were 1994 clutches larger than 1993

clutches. Also for egg size was the average pond value larger in 1994. This pond wide year

suggests that weather factors are involved but, with only two years available for analysis,

itis not possible to analyze which factors are crucial. Because the eggs are gradually formed

during the preceding summer, there are numerous possibilities. Rainfall and temperature

Source : MNHN, Paris

50 ALYTES 19 (1)

during any combination of months up to a year before spawning may potentially be involved.

Again, because female size affects the clutch and egg size variables, between-year variation in

female size may partly be the proximate cause, as suggested by BERVEN (1988) in a study of

Rana sylvatica. Whatever the exact cues, this shows an environmental effect on egg and clutch

size, either directly or indirectly through effects on female size.

Although there was a between-year variation, there was a significant year to year

correlation among ponds (tab. 1); some ponds had consistently small eggs and clutches. This

stresses the pond specificity. This was also manifest as a significant pond effect (tab. 3) on all

variables. The pond effect was partly an effect of pond hydroperiod but note that it was still

present when accounting for all effects of hydroperiod (as both factors were included in the

ANOVA). These effects may be directly or indirectly (through effects on female size) due to

variation in the environment and feeding conditions surrounding the ponds.

Genetic differences have been detected in allozyme studies between close populations of

frogs (Rana temporaria: RER & Seirz, 1990; REGNAUT, 1997; LARDNER, 2000; Bufo calamita:

SinscH, 1992). Also, frog species with a biology similar to that of Rana temporaria have been

shown to exhibit natal pond fidelity: this includes Bufo bufo (HEUSSER, 1966; READING et al.,

1991) and Rana sylvatica (BERVEN & GRUDZIEN, 1990). In a study of Rana sylvatica, BERVEN

(1988) has shown that population differences in clutch hand egg size may have a genetic basis.

Is it possible that the variation found in this study is due to microevolution? The design does

not allow any definite conclusions. However, if microevolution is involved, one would expect

the observed variation to be adaptive.

Was the effect of pond hydroperiod on the clutch mass index, parental investment,

adaptive? Yes, possibly. The investment was less in shallow ponds. This means less stress on the

female and possibly a higher survival with a better possibility to breed more times (MADSEN &

SHINE, 2000). In shallow ponds, where breeding fails completely in some dry years, this means

a higher likelihood of at least some surviving offspring during a life-time. Actually, life history

theory predicts that iteroparous tendencies should be favoured in unpredictable environments

(RoFF, 1992).

Itis also possible to find an adaptive effect of the variation in the allocation tacties. Given

a fixed total investment (clutch mass), it is reasonable that it is more important to invest in

large eggs (hatching into fast developing tadpoles) in temporary than in permanent ponds.

Large eggs may hatch into tadpoles that develop faster than those hatched from small eggs

(BERVEN & CHADRA, 1988; ParICHY & KAPLAN, 1992), thus decreasing the risk of total loss of

recruits in a dry summer when the pond may dry early.

Itis surprising that there was no effect of pond hydroperiod directly on egg size (tab. 3).

This effect could also be predicted for the same reasons I use above to argue an adaptive

explanation for variation in allocation tactics index. However, egg size may (regardless of

pond hydroperiod) be affected by female size (HGNIG, 1966, Giggons & MCCARTHY, 1986:

RYSER, 1996). For this variable I have no data for the present ponds and thus I cannot control

for it. If female size is not related to pond hydroperiod, such a correlation may mask possible

effects of pond hydroperiod on egg size. However, the use of allocation tacties index is a

method to control for variation in clutch mass, which means it may in turn control for some of

the variation in female size (and other female characters that affect total clutch investment).

Source : MNHN, Paris

LOMAN sl

If the patterns recorded are indeed adaptive, it is easier to see this as an outcome of a

direct, selected genetic effect than as a reaction norm (STEARNS & KOELLA, 1986; SCHLICHTING

& PiGLiucci, 1998) or phenotypic plasticity. This means that females in all study populations

may share the same genotype but this codes for different egg and clutch size strategies under

the actual conditions present in the different ponds. This would lead to transgenerational

phenotypic plasticity (MoussEAU & Fox, 1998). However, eggs are formed during the summer

preceding breeding (JORGENSEN, 1981), far ahead of the females’ arrival to the breeding

pond. Although complicated pathways based on breeding site fidelity are possible, such

explanations seem far fetched.

To sum up, the variation recorded must at least in part be due to environmental effects.

The fact that some of the variation was adaptive in ways predicted by life history theory

suggests that microevolution was also involved. No direct proof for this is however available.

Further studies to reveal the nature of between-pond variation in these characters need to use

frogs originating in different ponds and raised in a “common garden” (FAUTH, 1998) from egg

to maturity. Comparing the traits of their spawn should provide the necessary evidence.

If local adaptions are indeed involved, this also means that translocating frogs affects the

genetic make-up of local target populations. In principle, this could have adverse effects

(STORFER, 1999). However, the fact that evolution may have occurred in response to such a

“fine grained” habitat variable as pond hydroperiod also means that this evolution may

proceed quite quickly. Thus the progeny of translocated individuals are likely to adapt

quickly, provided a sufficient genetical basis is provided (LARDNER, 2000).

ACKNOWLEDGEMENTS

The study was done with support from the Swedish Council for Forestry and Agricultural Research.

Bjôrn Lardner and Bodil Enoksson helped me measure the eggs. Bjôm Lardner’s and Linus Svensson's

comments improved the presentation

LITERATURE CITED

BERVEN, K. A., 1982. - The genetic basis of altitudinal variation in the wood frog Rana sylratica. 1. An

experimental analysis of life history traits. Evolution, 36: 962-983.

—— 1988. — Factors affecting variation in reproductive traits within a population of wood frogs Rana

vatica. Copeia, 1988: 605-615.

Ex, K. A. & CHaDraA, B. G. 1988. - The relationship among egg size density and food level on larval

development in the wood frog Rana svlvatica. Oecologia, 75: 67-72.

BERVEN, K. À. & GRUDZIEN, T. A., 1990. — Dispersal in the wood frog (Rana sylvatica): implications for

genetic population structure. Evolution, 44: 2047-2056.

CookE, A. S.. 1985. - The deposition and fate of spawn clumps of the common frog Rana temporaria at

a site in Cambridgeshire 1971-1983. Biol. Conserr., 32: 165-187.

NGTON, D. C. & BROOKS, R. J. 2000, - Optimal egg size theory: does predation by fish affect eggsize

in Ambystoma maculatum. J Herp., 34: 46-53.

EBerT, D., 1993. - The trade-off between offspring size and number in Daphnia magna: the influence of

genetic, environmental and maternal effects. Arch. Hydrobiol., suppl., 90: 453-473.

FauTH, JL. 1998. — Investigating geographical variation in interspecific interactions using common garden

experiments, Jn: W. J. RESETARITS, Jr. & J. BERNARDO (ed.), Experimental ecology — Issues and

perspectives, New York, Oxford Univ. Press: 394-415

Gi8BoNs, M. M. & MCCARTHY, T. K., 1986. - The reproductive output of frogs Rana temporaria (L.) with

particular reference to body size and age. Z Zool.. 209:579-593.

BTL. DU |

MUSÉ UM

PARC

CUN

Source : MNHN, Paris

52 ALYTES 19 (1)

HEUSSER, H., 1968. — Die Lebenweise der Erdkrôte Bufo bufo (L.). Rev. suisse Zool., 75: 927-982.

HÔNIG, J., 1966 . — Über Eizahlen von Rana temporaria. Salamandra, 2: 70-72.

JoLv, P, 1991. - Variation in size and fecundity between neighbouring populations in the common frog

Rana temporaria. Alytes, 9: 79-88.

JORGENSEN, C. B., 1981. - Ovarian cycles in a temperate zone frog, Rana temporaria, with special reference

to factors determining number and size of eggs. J Zool., 195: 449-458.

KING, E. G. & KAPLAN, R. H., 1997. - Estimating ovum size in amphibians: eggsize increases diflerently

among species during carly development. Z Herp., 31: 299-302.

KUTENKOV, À. P. & PANARIN, À. E., 1995. - Ecology and status of populations of the common frog (Rana

temporaria) and the moor frog (Rana arvalis) in northwestern Russia, with notes on their distribu-

tion in Fennoscandia. /n: S. L. KuzMIN, C. K. Dopn & M. M. PiKkULIK (ed.), Amphibian

populations of CIS, Moscow, Pennsoft: 64-71.

LARDNER, B., 2000. - Phenotypic plasticity and local adaptions in tadpoles. Lund, Department of Ecology:

1-30.

LOWAN, J., 1996. — Overvakningsprogram fôr brungrodor i Skäne. Rapport frän Mi

Malmôhus län, 7: 1-47.

R., 2000. — Energy versus risk: cost of reproduction in free-ranging pythons in

Austr. J. Ecol., 6: 670-675.

MARTIN, R. & MiauD, C., 1999. — Reproductive investment and duration of embryonic development in

the common frog Rana temporaria. In: C. MiAUD & R. GUYÉTANT, Current studies in herpetology,

Le Bourget du Lac, SEH: 309-313.

MoussEau, T. A. & Fox, S. W., 1998. - The adaptive significance of maternal effects. Trends Ecol. Evol.,

13: 403-407.

PARICHY, D. M. & KaPLAN, R. H., 1995. - Maternal investment and developmental plasticity: functional

consequences for locomotor performance of hatchling frog larvae. Funet. Ecol., 4: 606-617.

READING, C. J., LOMAN, I. & MADSEN, T., 1991. - Breeding pond fidelity in the common toad, Bufo bufo.

J. Zool., 225: 201-211.

REGNAUT, $., 1997. — Population structure of the moor frog (Rana arvalis) in a Baltic sea archipelago.

Lund University, Dept. anim, Ecol.: 1-18.

Re, W. & Serrz, À., 1990. - The influence of land use on the genetic structure of populations of the

common frog Rana temporaria. Biol. Conserv., 54: 239-249.

ROFF, D. A., 1992. — The evolution of life histories. Theory and analysis. New York, Chapman & Hall:

1-535.

RYSER, J., 1996. - Comparative life histories of a low- and a high-elevation population of the common

frog Rana temporaria. Amphibia-Reptilia, V7: 183-195.

Soeur, M. H. & CHRISTIANSEN, F. B., 1996. — Inbreeding depression and outbreeding depression in

plants. Heredity, 77: 461-468.

SCHLICHTING, C. D. & PiGLiuccr, M., 1998. — Phenotypic evolution. A reaction norm perspective.

Sunderland, Mass., Sinauer Ass. Inc.: 1-387.

SEMLITSCH, R. D. & SCHMIEDHAUSEN, S., 1994. — Parental contributions to variation in hatchlin:

its relationship to growth and metamorphosis in tadpoles of Rana lessonae and Rana

Copeia, 1994: 406-412.

Sixsen, U., 1992. - Structure and dynamics of a natterjack population (Bufo calamita). Oecologia, 9:

489-499.

SuirH, C. & FRETWELL, L., 1974, — The optimal balance between size and number of offspring. Amer.

Nat., 108: 499-506.

Srarxs, $. C. & KoëLLA, J C., 1986. — The evolution of phenotypic plasticity in life-history traits:

predictions of reaction norms for age and size at maturity. Evolution, 40: 893-913.

STORFER, A., 1999. - Gene flow and endangered species translocations: a topic revisited. Biol. Conserr.,

87: 173-180.

Tekno, M. 1992. - Absense of trade-off between the size and number of offspring in the natterjack toad

(Bufo calamita). Oecologia, 90: 294-296.

rvakningen à

e and

sculenta.

Corresponding editor: Thierry LoDÉ.

Source : MNHN, Paris

ANTES

International Journal of Batrachology

published by ISSCA

EDITORIAL BOARD

Chief Editor: Alain Durois (Laboratoire des Reptiles et Amphibiens, Muséum national d'Histoire naturelle, 25

rue Cuvier, 75005 Paris, France; <dubois@mnhn.fr>).

Deputy Editor: Thierry LODÉ (Laboratoire d'Écologie animale, Université d'Angers, 2 boulevard Lavoisier,

49045 Angers Cedex, France; <thierry-lode@univ-angers.r>).

Conservation Editor: Stephen J, RICHARDS (Vertebrates Department, South Australian Museum, North Terrace,

Adelaide, S.A. 5000, Australia; <Richards.Steve@saugov.sa.gov.au>).

Editorial Board: Franco ANDREONE (Torino, Italy); Lauren E. BROWN (Normal, USA); Janalee P. CALDWELL

(Norman, USA); Ulisses CARAMASCHI (Rio de Janeiro, Brazil); Günter GOLLMANN (Wien, Austria); Tim

HaLLiDaY (Milton Keynes, United Kingdom); W. Ronald HEVER (Washington, USA); Esteban O. LAVILLA

(Tucumän, Argentina); Karen R. Lips (Canton, USA); Masafumi Maïsut (Kyoto, Japan): Donald F.

MCALPINE (Saint John, Canada): John C. PoyNToN (London, England).

Technical Editorial Team (Paris, France): Alain Duois (texts); Roger BOUR (tables); Annemarie OHLer (figures).

Book Review Editor: Annemarie OHLER (Paris, France).

SHORT GUIDE FOR AUTHORS

(for more detailed Instructions 10 Authors, see Alytes, 1997, 14: 175-200)

Alytes publishes original papers in English, French or Spanish, in any discipline dealing with amphibians.

Beside articles and notes reporting results of original research, consideration is given for publication Lo synthetic

review articles, book reviews, comments and replies, and to papers based upon original high quality illustrations

(such as colour or black and white photographs), showing beautiful or rare species, interesting behaviour, etc.

The title should be followed by the name(s) and address(es) of the author(s). The text should be typewritten

or printed double-spaced on one side of the paper. The manuscript should be organized as follows: English

abstract, introduction, material and methods, results, discussion, conclusion, French or Spanish abstract,

acknowledgements, literature cited, appendix.

Figures and tables should be mentioned in the text as follows: fig. 4 or tab, 4. Figures should not exceed 16

x 24 em. The size of the lettering should ensure its legibility after reduction. The legends of figures and tables

should be assembled on a separate sheet. Each figure should be numbered using a pencil.

References in the text are to be written in capital letters (BOURRET, 1942; GRAF & POLLS PELAZ, 1989; INGER

et al., 1974). References in the Literature Cited section should be presented as follows:

BOURRET, R., 1942. - Les batraciens de l'Indochine. Hanoï, Institut Océanographique de l’Indochine: i-x + 1-547,

pl.

GRAF, 1.-D. & PoLLs PELAZ, M. 1989. - Evolutionary genetics of the Rana esculenta complex. In: R. M. DAWLEY

&J. P. BoGarT (ed.), Evolution and ecology of unisexual vertebrates, Albany, The New York State Museum:

289-302.

IxGER, R. F., Voris, H.K. & Voris, H. H., 1974. - Genetic variation and population ecology of some Southeast

Asian frogs of the genera Bufo and Rana. Biochem. Genet., 12: 121-145.

Manuscripts should be submitted in triplicate either to Alain Dusois (address above) if dealing with

amphibian morphology, anatomy, systematics, biogeography, evolution, genetics, anomalies or developmental

biology, or to Thierry LODÉ (address above) if dealing with amphibian population genetics, ecology, ethology or

life history, or to Stephen J. RICHARDS (address above) if dealing with conservation biology, including declining

amphibian populations or pathology. Acceptance for publication will be decided by the editors following review

by at least two referees.

If possible, after acceptance, a copy of the final manuscript on a floppy disk (3 % or 5 /4) should be sent 10

the Chief Editor. We welcome the following formats of text processing: (1) preferably, MS Word (1.1 to 6.0, DOS

or Windows), WordPerfect (4.1 to 5.1, DOS or Windows) or WordStar (3.3 to 7.0): (2) less preferably, formated

DOS (ASCII) or DOS-formated MS Word for the Macintosh (on a 3 V4 high density 1.44 Mo floppy disk only).

Page charges are requested only from authors having institutional support for this purpose. The publication of

colour photographs is charged. For each published paper, 25 free reprints are offered by ISSCA to the author(s).

Additional reprints may be purchased.

Published with the support of AALRAM

(Association des Amis du Laboratoire des Reptiles et Amphibiens

du Muséum National d'Histoire Naturelle, Paris, France).

Directeur de la Publication: Alain Dusors.

Numéro de Commission Paritaire: 64851.

Source : MNHN, Paris

Alytes, 2001, 19 (1): 1-52.

Contents

Alain DuBois

Editorial ..

Alain Dugois, Masafumi MATsUI & Annemarie OHLER

A replacement name for Rana (Paa) rara Dubois & Matsui, 1983

(Amphibia, Anura, Ranidae, Raninae) ..............................0 2-4

Michael VrITH, Joachim KosUCH, Annemarie OHLER & Alain DuBois

Systematics of Fejervarya limnocharis (Gravenhorst, 1829)

(Amphibia, Anura, Ranidae) and related species.

2. Morphological and molecular variation in frogs

from the Greater Sunda Islands (Sumatra, Java, Borneo)

with the definition of two species .....,................,.... 5-28

Jean-Louis AMIET

Un nouveau Leptopelis de la zone forestière camerounaise

(Amphibia, Anura, Hyperoliidae) 44:42. 29-44

Jon LOMAN

Local variation in Rana temporaria egg and clutch size:

adaptations to pond drying? .......:..1...000.020 Re 45-52

Alytes is printed on acid-free paper.

Alytes is indexed in Biosis, Cambridge Scientific Abstracts, Current Awareness in Biological

Sciences, Pascal, Referativny Zhurnal and The Zoological Record.

Imprimerie F. Paillart, Abbeville, France.

Dépôt légal: 2° trimestre 2001.

Source : MNHN, Paris