Editorial Committee

L W. Jessup (editor)

R.J.F. Henderson (technical advisor)

B.K. Simon (technical advisor)

Word Processing

Y.C. Smith

Austrobaileya

Vol. 1, No. 1 was published on 1 December 1977

Vol. 4, No. 3 was published on 5 October 1995

Austrobaileya 1s published once per year.

Exchange: This journal will be distributed on the basis of exchange.

Subscriptions: Orders for single issues and subscriptions may be placed. The price is (1997) A$25

per issue for individuals, A$40 for institutions, including postage.

All correspondence relating to exchange, subscriptions or contributions to this journal should be

addressed to The Editor, Austrobaileya, Queensland Herbarium, Meiers Road, Indooroopilly Qld

4068, Australia.

ISSN 0155-4131

Austrobaileya is the journal of the Queensland Herbarium and is devoted to publication of results

of sound research and of informed discussion on plant systematics, with special emphasis on

Queensland plants.

Opinions expressed by authors are their own and do not necessarily represent the policies or views

of the Queensland Herbarium.

Austrobaileya 4(4): 455-696

Contents

A Revision of Micromyrtus Benth. (Myrtaceae) in Queensland

Pe ARTS ARL 69 5 Mira: 2 cons Sehaee 42 a heae tel Aloe A MAE LALA inn APE aD tk RA oe AIR, be > Hae FTLK

A taxonomic revision of Drypetes Vahl (Euphorbiaceae) in Australia

PaO IPOTSICR ccs ain Ropar Spoke ee hun he LL ae eR ae Tae e RK EAA dow a 9 477

Notes on Tiliaceae in Australia, 3: A revision of the genus Triumfetta L.

ER POAT ORG Fo rsycaceeins aes theresa tian ate tae s a ead "sof eettee Tae Mae ns Dalle baw ae bela 495

Two new species of Eucryphia Cav. (Cunoniaceae) from Queensland

Paul. Porster & B-P.MiBylands. 45-. .ccase baked ek er eke ba ee ede Ob ewan 589

Borya inopinata (Anthericaceae), a new species of resurrection plant from

north Queensland

Paull Porsterde E. Jon THOmpson. <6, acide ee GN a eens ee Vea eee 597

The use of rubisco DNA sequences to examine the systematic position of

Hernandia albiflora (C.R.White) Kubitzi (Hernandiaceae), andrelationships

among the Laurales

Effie M. Ablett, Julia Playford & Stephanie Mills... 0... .. 0.0.0.0... ccc eee 601

Acomis bella (Asteraceae: Gnaphalieae), a new species from north Queensland

Al Sal. sO LARC ses, procs et caecad. chasers 3 cee arent beak ee raaatent oa tat deb aetebine BAR ib be 609

A new subspecies of Caustis blakei Kuk. in Queensland

Margaret E. Johnston, John T. Swarbrick, Alan H. Wearing &

PUMA NEA NV OUOEL Bre, brvewcchacs Mech he nAgee steed toc ttepmcidt east decadh ch eeeneteer ane ites ceryl woes aerate ae a A 613

A taxonomic revision of Austrobuxus Miq. (Euphorbiaceae: Dissiliariinae) in

Australia

PAVE ATSU OTS UCR Spee Bales eres ft 9p nan eesote taps ePite Bath eas Sytem eevee tuna Beato ters 619

TES CARAS Foor 0 | CD TR OT PY OT Pk Lav 627

A new species of 7hryptomene Endl. and anew spectes of Ochrosperma Trudgen

(Myrtaceae) from the Northern Territory, Australia

PBB 1S edo ar shoo to 7 ow A PALE ALD DSTI AGS BIOL & Glen: HAG W Uk Gb nh Rate wld 6047

Plectranthus amoenus and P. thalassoscopicus (Lamiaceae), new species from

north-eastern Queensland, Australia

PAE Met PELL Sean set gronciasd dene aaete ie Phere ta afi ecorae hla en gerade ad Pee char Ee weeny hey tae 653

Four new rare species of Sauropus Blume (Euphorbiaceae: Phyllantheae) from

north Queensland

John T. Hunter and Jeremy J. Bruhl... 0... eee teen 661

Dubouzetia saxatilis (Elaeocarpaceae), a new species from north Queensland,

Australia

A.R.Bean & L.W Jessup ...... stg bd nla ppd dela a pig dig Bee utes wkachip eailek wate g 673

(continued)

Austrobaileya 4(4): 455-696

A revision of Rubus subg. Idaeobatus (Focke) Focke (Rosaceae) in Australia

RAB ET ts talus teva fan § tat ancgcertie npg tee Peevey) ec abet To U/eed-e ele © piney eke Band mytate wulee eaty 677

Note

Significant range extensions for species of vascular plants in northern New South

Wales

John: 1; Fanter-c Jeremy Fi Bun. os jc oa he ek Grae wae le HO DD lee ed 691

Book Review

A revision of Micromyrtus Benth. (Myrtaceae) in Queensland

A.R.Bean

Summary

Bean, A.R. (1997). A revision of Micromyrtus Benth. (Myrtaceae) in Queensland. Austrobaileya 4(4):

455-476. The genus Micronryrtus is revised for Queensland, with the recognition of fourteen species, of

which the following ten are new: M. albicans, M. capricornia, M. carinata, M. delicata, M. forsteri, M.

gracilis, M. littoralis, M. patula, M. rotundifolia and M. vernicosa. All new species are endemic to

Queensland. Ilustrations are provided for all new taxa and for M, leptocalyx (F.Muell.) Benth. M. striata

J.W.Green is newly recorded for Queensland, Descriptions and distribution maps are provided for all

Queensland taxa, Informal species groups are established within Microntyrtus, into which the Queensland

species are allocated. A key to all Microntyrtus species occurring in Queensland is given.

Keywords: taxonomy; Myrtaceae; Micromyrtus; Queensland flora; key; new species; Micromyrtus

albicans; Micromyrtus capricornia; Micromyrtus carinata; Micromyrtus delicata; Microntyrtus forsteri;

Micromyrtus gracilis; Micromyrtus leptocalyx; Micromyrtus littoralis; Micromyrtus patula; Micromyrtus

rotundifolia; Micromyrtus striata; Micromyrtus vernicosa.

A.R. Bean, Queensland Herbarium, Meters Road, Indooroopilly Queensland 4068, Australia

Introduction

The genus Micromyrtus was established by

Bentham (1865) to accommodate some species

previously included under Thryptomene

Endl. He distinguished his new genus from

Thryptomene on the basis of stamen and ovule

arrangement, and ovule number. Bentham

(1867) listed seven species of Micromyrtus,

including M. leptocalyx (F.Muell.) Benth. In

distinguishing between these species, Bentham

used two principal characters: ovule number,

which varies from 2 to 8, and stamen number,

which is 5 or 10 in pentamerous flowers, and 6

or 12 in hexamerous flowers.

Green (1983) recognised three

Micromyrtus species for Queensland, namely

M. leptocalyx, M. sessilis and M. hexamera.

The present author recognises fourteen

Queensland species, with most of the newly

recognised species being allied to M. leptocalyx.

Since Bentham’s time, the name

M. leptocalyx has been broadly applied to all

Micromyrtus specimens having flowers with 5

stamens, 6—8 ovules, and aribbed hypanthium.

This has resulted in the lumping of a broad

assemblage of taxa with widely divergent habits,

bark types and other morphological

characteristics.

_ Accepted for publication 15 April 1996

Inthe current study, closer examination of

M. leptocalyx sens. lat. has resulted in the

recognition of several taxa which are not only

morphologically dissimilar but have distinct

climatic and habitat requirements. These taxa

are named here at species level. All are endemic

to Queensland.

One of the new species presented here,

M. forsteri, is not related to the M. leptocalyx

group butis allied to M. fimbrisepalaJ.W.Green

and M. hymenonema (F.Muell.) C.A.Gardner,

both from Western Australia,

The Queensland species of Micromyrtus

are here arranged into three informal groups and

the M. leptocalyx group is further divided into

four subgroups.

Taxonomic characters and terminology used

The morphological characters used here to

distinguish Queensland species of Micromyrtus

are principally habit, bark type, leaf shape,

entire or denticulate leaf margins, peduncle

length, hypanthium features (including length,

curvature, number of ribs, branching and

thickness of ribs), calyx lobes (presence or

absence, size, entire or fimbriate margins), petals

(size, colour, margin type, presence or absence

of oil glands), stamen number, style length and

ovule number.

456

Stem flange is aterm given to the tissue on

the surface of the young branchlets between

successive pairs of leaves. The colour, shape

and gland patterns of these flanges can be

diagnostic for species.

The floral disc is the fleshy area

surrounding the base of the style and above the

ovary. In Micromyrtus, the floral disc may be

‘perpendicular’ i.e. set at 90 degrees to a

longitudinal section of the flower, or ‘oblique’

i.e. set at an angle less than 90 degrees to a

longitudinal section (usually 60-80 degrees)

and towards the subtending branchlet.

Terminology pertaining to anthers follows

Green (1980Qa).

Taxonomy

Conspectus of informal groups within

Micromyrtus Benth.

(1) The M. leptocalyx group

This group of species is characterised by its

flowers which possess the same number of

stamens as petals (usually 5, sometimes 6),

peduncles (0.3)0.5—1.5 mm long, ovules 6-8(9),

styles 0.2—-0.6 mm long, and hypanthia with thin

straight ribs.

Members: M. albicans, M. capricornia,

M. carinata, M. delicata, M. gracilis,

M. leptocalyx, M. littoralis, M. patula,

M. rotundifolia, M. vernicosa.

(la) The M. delicata subgroup

This subgroup is defined by: slender,

conspicuously quadrifarious leaves 1.7—3.9 mm

long and with a length:breadth ratio of 4-6:1;

ovules (6)7—-8(9) per flower; calyx lobes

inconspicuous, 0.1—0.25 mm long; petals with

oil glands,

Members: M. delicata, M. patula.

Austrobaileya 4(4): 455-476 (1997)

(1b) M. rotundifolia subgroup

This subgroup is defined by: leaves almost

orbicular in outline, ovules 6 per flower, flowers

2,5—3.5 mm diameter; petals fimbriate and calyx

lobes fimbriate; flowers either hexamerous or

pentamerous.

Sole member: M. rotundifolia.

(lc) M. leptocalyx subgroup

This subgroup is defined by: bark orangy-brown

(minniritchi’); leaves 2-3.5 mm long and with

a length:breadth ratio of 4—6:1; ovules 6 per

flower; flowers 4.5—5 mm diameter; calyx lobes

conspicuous, fimbriate; petals withoutoil glands.

Sole member: M. leptocalyx.

(1d) M. albicans subgroup

This subgroup is defined by: leaves medium-

sized (1.1-3.0 mm long) and with a

length: breadth ratio 2.3—4:1; flowers less than 3

mm diameter; ovules 6(7) per flower; calyx

lobes with entire margins or absent; petals with

entire margins.

Members: M. albicans, M. capricornia,

M. carinata, M. gracilis, M. littoralits,

M. vernicosa.

(2) The M. ciliata group

This group of species is characterised by its

flowers which have 5 petals and stamens,

peduncles 0O-0.3 mm long; ovules 4 per flower;

style 1-1.5 mm long; and hypanthium with thick

curved ribs.

Members: M. blakelyi, M. ciliata, M. sessilis,

M. striata.

(3) The M. hymenonema group

This group of species is characterised by its

flowers which have 5(6) petals and calyx lobes;

peduncles 0.5—1.2 mm long; stamens 10(12)

and ovules 6—8 per flower.

Members: M. fimbrisepala, M. forsteri,

M. helmsu, M. hexamera, M. hymenonema.

Bean, Micromyrtus A457

Key to Queensland species of Micromyrtus

Ln Use aves: tad SNe LON Bett ETAT DIGG 6: pranaus a rary WEEE a Be Se yerel wh PE AR tin Sa Peete ae 2

Leaves 2.3—6 times longer than broad...............0000. Pee TH De rh MB ae een ae 4

2. Stamens 5 or 6; corolla 2.5—3.5 mm in diameter........ 0.0.00 eee eee. M. rotundifolia

Stamens 10 or 12; corolla 4.5-6 mm in diameter ......... 0... 00sec eee eee eee naan 3

Se, MES AIS he LAPIS ALI crs costae ee ctan coe be piteltecs Phd aoa th Grune bare, eqatecrah fn a ea he enenp ee, M. forsteri

Pellets Go Stamens ie. no. E ecceoe wntt ice ap sleet ater Delay teeth ewe en toe aw a Se aa ny M. hexamera

4, Peduncles 0.3-1.5 mm long; style 0.2-0.6 mm long... 0.0... ee ee ee ees 5

Peduncles 0—0.3 mm long; style l-l.5 mm long..... cc. cee ee eee 14

O;, MASALSERUL OOS SEM Loe», yee thc settee uekes bv td wasps pieidicens ana, eradtorntien anes. a: Mice hbara-dutpee teens Urata 6

Cay ODES 2G AUTOS oh aerate x 8 doe ch ont ace sgt wate ak Eats deca ge ts ble whi be aes Fi

6. Petals yellow, strongly keeled, 0.8-0.9 mm long ........... 00.0 eevee eee M. carinata

Petals white, not or faintly keeled, 1-1.3 mmlong............ 0.0.00. cee. M. gracilis

Fz Se CPALS AVG NOU LOLS UGS og ary an dh ne ferdigt dh tee ores “AP Penis aectnd ete evades a babe ink wrk lB oe age eta ee ine 8

Petals with oil glands on abaxial surface... . cece ee eee een )

8. Petals 2—2.5 mm long; bark loose, orangy-brown ........ 0.00000 eee M. leptocalyx

Petals 1—1.25 mm long; bark tight, grey .... 0... 00. ccc ee ee ae M, capricornia

Du MSSAP MALOU OMbIEeS 5, te bods ket cy 9, ere Ws oe chaos and DURBAN icp vege AGW ge ERB ee hoe aa aed hak ae wd LO

EVGAL TVA OTIS CEMUICU PAG gcc. wt e fo sod Raphieveh Vilnalal enix ses adel ee edaanbint 4 aoe ac Ril lw wana fe eves a hcg abated able Bu 13

LOsPetals Or biciulat: yes. soc, sane cca atien oe odd iglaie W Saad S Hale Albee wbdrn ene Big Be dan orn 11

Petals elliptical, c. 1.5 times longer than wide... .. 2.0... 0c cee eee M. vernicosa

BL, Calyx lobes 0:40; Ss TON. 6 oie Soe alo ao ack eet eek we | Reet 8 M. albicans

CAIY XS 1ODES AE TAZ IB LONG «oe 53, Reh vp Ge x ae “ofial bev Wie al 8 edad a gly OL eG ADA ly Bans Ren le Koa oak 2

12. Floral disc perpendicular; flowers 5- or 6-merouS...... 00.0. eee ees M. patula

Floral disc oblique; flowers 5-merousS .. 0.0... eens M. delicata

13. Petals elliptical, c. 1.5 times longer than wide....... 0... 0.0000 cece ue eee M. littoralis

POLAIS OT DLEUEL ATS. 9, = 5. 2k wre lel aes, Ings ph rib hp w file To aP alee as alee died] abv fe heatie! « Soak acters “eta M. delicata

L4,. Hypanthium S ribbed at-base:. cis ine oa eee Va a eee be be rey ee eek eo M. sessilis

Hypanthium 7-10 ribbed at base... ec ee eee nee M., striata

Micromyrtus delicata A.R.Bean sp. noy. access road, off Herberton—Watsonville

attinis Micromyrto patulae sed disco floris road, 17°23’S, 145°20’E, 31 January 1994,

obliquo, lobis calycis marginibus P.l, Forster PIF 14719 (holo: BRI

fimbriatis et ovulis plerumque 6 vel 7 in Sheets + spirit); iso: A, AD, B, BISH,

quoque flore differens. Typus: CANB, DNA, HO, K, L, MEL, NSW, P,

Queensland. Cook District: 4 km W of ORS, distribuendi).

Herberton; 1.5 km N along powerline

458

Shrub to 1 m high, branchlets not pendulous.

Bark grey, persistent, closely adhering, not

fibrous or flaky. Stem flanges grey or brown,

flat, not winged, not warty, margins entire.

Leaves imbricate, linear to narrowly obovate,

[.7-3.9 x 0.4-0.8 mm, concavo-convex, not

keeled on dorsal surface, glabrous, apex acute

or obtuse, margins entire or denticulate, oil

glands prominent; petioles absent or up to 0.3

mm long. Flowers 2.5—3.0 mm across; peduncles

0.5—0.9 mm long, solitary, axillary; bracteoles

2, conduplicate, acute, c. 0.6 mm long, somewhat

persistent. Hypanthium obconical, straight,

[-1.5 mm long; ribs 5, shallow, branching

towards distal end. Calyx lobes 5, rather

inconspicuous, obtuse, 0.2—0.25 x 0.5—0.6 mm,

translucent, with margins fimbriate. Petals 5,

obovate or elliptical, 0.9-1.2 x 0.9-1.0 mm,

keeled, thick, white or yellowish near centre,

margins entire, oil glands prominent on outer

surface. Disc flat, perpendicular or slightly

oblique. Stamens 5, antepetalous; filaments

terete, O.3-0.4 mm _ =4Iong; anthers

versatile, bilocular; stomia linear, parallel;

connective gland ovoid, about half length of

anthers, with two lateral lobes. Style terete, c.

0.5 mm long, stigma capitate. Ovules 6—7, rarely

8, radially arranged around a small apical

placenta. Fruits and seeds not seen. Fig. 1 A—D.

Additional specimens examined: Queensland. Cook

District: Baal Gammon Mining tease, Mar 1980, Hyland

10352 (BRI, QRS).

Distribution and habitat: M. delicatais known

only from the type locality west of Herberton

(Map 1). It grows tn open woodland dominated

by Eucalyptus abergiana F.Muell. with a

shrubby understorey of Xanthorrhoea johnsonti

A.T.Lee, Borya septentrionalis F.Muell. and

Cryptandra sp., in grey clayey soil. The altitude

at the site 1s approximately 1000 metres.

Phenology: Flowers have been collected in

January and March.

Affinities: M. delicata differs from M. patula

by its oblique floral disc, calyx lobes with

fimbriate margins, and the mostly 6-7 ovular

flowers.

Conservation Status: The risk category for

Micromyrtus delicata, according to the criteria

of Chalson & Keith (1995), 1s ‘endangered’

Austrobaileya 4(4): 455-476 (1997)

(criteria B2, Cl and D2). The species is known

from only two populations in close proximity

with a total of approximately several hundred

plants. If is under threat from its limited

distribution, mining activities and disturbance

from powerline maintenance procedures.

The recommended conservation status for

this species as defined by the Queensland Nature

Conservation Act 1992 is ‘endangered’.

Etymology: The specific epithet is from the

Latin delicatus, meaning charming, inreference

to the attractive foliage of the species.

Micromyrtus patula A.R.Beansp. nov. affinis

Micromyrto delicatae a qua distinguitur

hypanthio recto, disco floris haud obliquo,

lobis calycis marginibus integris et ovulis

plerumque 8 in quoque flore. Typus:

Queensland. BURNETT DistTrRIcT: Waaje,

Barakula State Forest, NNW of Chinchilla,

26°09’S, 150°20’E, 19 March 1994,

A.R. Bean 7563 (holo: BRI; iso: A, AD,

CANB, HO, K, MEL, NSW, distribuendt).

Shrub up to 2 x 2.5 m, branchlets spreading, not

pendulous. Bark grey, loose and fibrous at base

of large plants, otherwise closely adhering, with

shallow longitudinal fissures, Stem flanges grey,

convex, not winged, not warty, margins entire.

Leaves imbricate, linear to oblanceolate, 2.0-2.8

x 0.5—0.8 mm, concavo-convex, dorsal surface

not keeled, glabrous; oil glands prominent; apex

acute, margins entire; petioles absent. Flowers

pentamerous, rarely hexamerous, 2.2—2.6 mm

across, solitary, axillary, with peduncles 0.5—0.7

mm long; bracteoles 2, conduplicate,

membranous, acute, 0.5—0.9 mm long, deciduous

or persistent. Hypanthium obconical, straight,

1.2—-1.5 mm long, c. 1 mm across at distal end;

ribs 5, branching towards calyx lobes. Calyx

lobes 5(6), inconspicuous, obtuse, 0.1~—0.2 x

Q.5—0.6 mm, transparent, margins entire. Petals

5(6), orbicular, c. 1 x 1 mm, keeled, white, oil

glands prominent on outer surface; margins

entire. Disc flat or convex, perpendicular.

Stamens 5(6), antepetalous; filaments terete,

Q.3-0.5 mm long; anthers versatile, bilocular,

stomia linear, parallel; connective gland ovoid,

almost as long as anthers, with two lateral lobes.

Style terete, c. 0.3 mm long, stigma capitate.

Ovules /—9, usually 8, radially arranged around

a small apical placenta. Fruits and seeds not

seen, Fig. 1 E—H.

Fae WB Meee gh le ee i ee ee ee ae ep ee ee

nibh nn

Foo. HH be ed oe ee

Bean, Micromyrtus 459

a 5

ag) ial

wee +

ale Mer

“oat

hom

bag

tes

Pigs :

te :

+, 8

at Eat

ease ’ ‘

tot 4

ote

‘ MH 3 cf

: a :

= aedytee J+

ttt * +f ure

= +* pet. w 7

uf aa ‘ = ee

+ + 2

a anrF ats

+ Pe Tg.

+ a m=

~ Taebe we* Vo +e 7 ig

we, =i re es 4

pier =,' ee eh

+,* Maar ad

= prea ee a eT

wht a¥ oe tt L

i a” Ie

s = qe oe gees

ry +,* ¥ yt .

+o pat = tae

ress *

. asm, se

whe zs « 7 + z

aoe ie Faye &

ott + i

ark 4g ¥

7% Fee t *

Weay FO *ane +

7 + +

1, = Lt 4

4 * 4°4*F ig

ba a ita tata * '

1 * f

Lae ant ae

ref 44 the

ms t

: * sed

e Fy & + x ¥E

' ae

ot + - #.

. bea

ett Teeny F =

x ate “abt pas

ee ee

Co a al

Fig. 1. A-D: Micromyrtus delicata. A, flower x 8, B. abaxial surface of petal x 32. C. hypanthium lobe x 32. D. abaxial

surface of leaf x 16. E—-H: M. patula. E. flower x 8. F. abaxial surface of petal x 32. G. hypanthium lobe x 32, H. abaxial

surface of leaf x 16. I~L: M. rotundifolia. 1, flower x 8. J. abaxial surface of petal x 32. K. hypanthium lobe x 32. L. abaxial

surface of leaf x 16. M-—P: M. leptocalyx. M. flower x 8, N. abaxial surface of petal x 16. O. hypanthium lobe x 16. P.

abaxial surface of leaf x 16. A—D, Forster 14719; E-H, Bean 7563; I-L, Bean 7495 & Forster; M—P, Bean 2219,

460

Specimens examined: Queensland. BuRNETT District:

Barakula State Forest Waaje (near Quandong), Sep 1980,

Byrnes 3952 (BRI, Kk, MO, PERTH), Waaje, Sep 1994,

Hando s.n. (BRI).

Distribution and habitat: M. patula is known

only from the type locality in the Barakula State

Korest (Map 2) where it grows in heathland on

an almost flat rocky platform of laterised

sandstone, on skeletal soil. It 1s associated with

stunted specimens of Eucalyptus exserta

F.Muell. and E. tenuipes (Maiden & Blakely)

Blakely & C.T.White, as well as Babingtonia

jucunda (S.T.Blake) A.R.Bean, Acacia julifera

Benth. subsp. julifera, Keraudrenia corollata

(Steetz) Druce and Melaleuca thymifolia Sm.

Phenology: Flowers have been collected in

March and September,

Affinities: M. patula 1s closely related to

M. delicata, but differs from that by its straight

hypanthium, perpendicular floral disc, calyx

lobes with entire margins and its mostly 8-

ovular flowers. M. patula is the only species of

the M. leptocalyx group which has 8 ovules per

flower in the majority of flowers.

Note: This species was first collected by

Mrs Val Hando of Chinchilla in 1973, then

again tn 1978. These specimens were sent to

BRI, but were not retained. Hando (1988: 141)

gives a brief description of M. patula as

‘Micromyrtus sp.’.

Conservation status: The risk category for

Micromyrtus patula, according to the criteria of

Chalson & Keith (1995) is ‘critical’ (criteria

B2, B5, Cl and D2). At the type locality, there

are about 200 plants ofreproductive age covering

an area of about 0.5 hectares. It seems unlikely

that sizeable populations will be found

elsewhere, as the habitatis very specialised. The

species is under threat from roadworks and

changing fire regimes.

Therecommended conservation status for

this species as defined by the Queensland Nature

Conservation Act 1992 1s ‘endangered’.

Etymology: The specific epithet is from the

Latin patulus, meaning ‘open’ or ‘wide’, given

inreference to the spreading habit of the species.

Austrobaileya 4(4): 455-476 (1997)

Micromyrtus rotundifolia A.R.Bean sp. nov.

affinis Micromyrto leptocalyci sed

differens cortice squamato priseo, foliis

fere orbicularibus, floribus saepe

hexameris, hypanthio breviore et petalis

carinatis minoribus. Typus: Queensland.

SOUTH KENNEDY District: 14 km SW of

‘Bowie’, near Lake Buchanan, 21°54’S,

145°50’E, 27 February 1994, A.R, Bean

7495 & P.J.Forster (holo: BRI; iso:

CANB, DNA, HO, K, L, MEL, NSW,

PERTH, distribuend1).

Shrub 0.4—2.5 m high, branchlets not pendulous.

Bark grey, loose and fibrous at base of large

plants; otherwise closely adhering, with shallow

longitudinal fissures. Stem flanges prey, convex,

not winged, not warty, margins entire. Leaves

not imbricate, more or less orbicular, 0.9—1.2 x

O.7—1.0 mm, concavo-convex or plano-convex,

not keeled on dorsal surface, glabrous, oil glands

few per leaf; apex obtuse; margins entire or

rarely denticulate; petioles absent. Flowers

2,.5-3.5 mm across, solitary, axillary, with

peduncles 0.5—1.5 mm long; bracteoles 2,

conduplicate, 0.5—0.9 mm long, membranous,

deciduous. Hypanthium not compressed,

obconical, 1-1.5 mm long, curved; ribs 5—6 in

proximal half, often dividing at distal end. Calyx

lobes 5—6, semiorbicular, 0.3 x 0.5—0.6 mm,

transparent, margins entire or slightly fimbriate.

Petals 5—6, obovate to orbicular, 1.0-1.5 x

!.0—1.5 mm, keeled, white, oil glands present or

absent; margins conspicuously fimbriate. Disc

flat, slightly oblique. Stamens 5—6, antepetalous;

filaments terete, 0.6—-0.8 mm long; anthers

versatile, bilocular, stomia linear, parallel;

connective gland small, brown, < half length of

anther, with two lateral lobes. Style 0.4—0.5 mm

long, terete; stigma capitate. Ovules 6, radially

arranged around a small apical placenta. Fruits

and seeds not seen. Fig. 1 I-L.

Spectens examined: Queensland. SouTH KENNEDY

District: 8.5 km N of ‘Kyong’ HS, Apr 1992, Thompson

BUCIS4 & Simon (BRI, NSW); 39 km NNE of Jericho, Jul

1993, Thompson JER81 & Fige (BRI); 23 km SE of

Jericho, Jul 1993, Thompson JER82 & Figg (BRI); Alpha-

‘Mantuan Downs’ road, 8.1 km S of ‘Glen Avon’, Sep

1990, Bean 2237 (AD, BRD. Mircuece Districr: 40 km S

of Jericho, Aug 1993, Thompson JER80 & Fies (BRI).

Distribution and habitat: M. rotundifolia

extends from near Lake Buchanan to south of

DO SMOE ANDI ieee er gep it ape ake am tye iranetinn

Bean, Micromyrtus

% §

142

Map I. Distribution of Micromyrtus spp.

A M. sessilis.

144 146 148

M. capricornia, * M, delicata, ® M, hexamera, %M. rotundifolia,

461

462

Alpha, a total distance of 275 km, but it is rare

within its range (Map 1). It grows either in

shrubland with Calytrix spp. and Acacia julifera

subsp. curvinervia (Maiden) Pedley or tn

woodland with Acacia catenulata C.T.White,

Eucalyptus exsertaP Muell. and £. trachyphloia

F.Muell. on ‘breakaways’ associated with the

Great Dividing Range. In both cases, the soils

are shallow and sandy.

Phenology: Flowers are recorded for February,

August and September.

Affinities: M. rotundifolia differs from all other

species in the M. leptocalyx group by the

following features: its leaves are only slightly

longer than they are wide, both the petals and

calyx lobes are fimbriate, and its flowers are

frequently hexamerous.

Conservation status: The risk category for

Micromyrtus rotundifolia, according to the

criteria of Chalson & Keith (1995), 1s

‘vulnerable’ (criteria Bl, B2 and Cl). The

recommended conservation status for this

species as defined by the Queensland Nature

Conservation Act 1992 is ‘vulnerable’.

Etymology: The specific epithet is from the

Latin rotundus, meaning ‘round’, and folium,

meaning ‘leaf’, and refers to the leaves which

are almost circular in outline.

Micromyrtus leptocalyx (F.Muell.) Benth.,

FI. Austral. 3: 65 (1867); Baeckea

leptocalyx F.Muell., Fragm. 1:30 (1858);

Thryptomene leptocalyx (F.Muell.)

F.Muell., Syst. census Austral. pl. 53

(1883). Type: Queensland. LEICHHARDT

District: near Mount Pluto, [06 October

1846], 7. Mitchell s.n. (holo: MEL; iso:

BRI).

Illustration: Williams, Native PI. Queensl.

3: 206-7 (1987), as Micromyrtus sp.

Shrub to 3m high, branchlets erect or spreading.

Bark orangy-brown, loose, flaky, shedding in

small curved strips. Stem flanges grey, flat, not

winged, not warty; margins entire. Leaves

imbricate, linear, 2—3.5 x 0.5—0.6 mm, concavo-

convex, distinctly keeled below, glabrous, oil

glands numerous; apex obtuse; margins minutely

denticulate; petioles absent or up to 0.3 mm

Austrobaileya 4(4): 455-476 (1997)

long. Flowers axillary, solitary, 4.5—5 mm across,

with peduncles 1-1.5 mm long; bracteoles 2,

conduplicate, acute, to0.7 mm long, deciduous.

Hypanthium dorsiventrally compressed-

obconical, 1.5—2.5 mm long, somewhat curved,

ribs 5, longitudinal, irregularly spaced, often

branching obtusely near distal end. Calyx lobes

5, semiorbicular, c. 0.5 x 0.8 mm, translucent,

margins fimbriate. Petals 5, orbicular, 2—2.5 x

2—2.5 mm, not keeled, thin, white, oil glands

not visible; margins entire or fimbriate. Disc

concave, oblique. Stamens 5, antepetalous;

filaments terete, c.0.3 mm long; anthers versatile,

bilocular, stomia linear, parallel; connective

gland ovoid, compound, c. half length of

anthers. Style terete, c. 0.25 mm long. Ovules 6,

radially arranged around a small apical

placenta. Fruit and seeds not seen. Fig. 1 M—P.

Specinens examined: Queensland. SoutH KENNEDY

District: 10.5 km NE of Lennox HS, Jul 1993, Thompson

GALI76 & Figg (BRI). LercHHarpt District: Riverside,

west of Springsure, Sep 1987, O’ Keeffe 873 (BISH, BRI,

CANB, MQ); Dam Gorge, Sep 1984, O’ Keeffe 609 (BRI);

Salvator Rosa NP, 170km SW of Springsure, Sep 1987,

Thomas 237 (BRI, CANB); Carnarvon NP, Jul 1976,

Morieys.n. (BRD; Bull Creek Gorge, Sep 1990, Bean 2219

(BRD. Maranoa District: Enniskillen, Nov 1943, White

12381 (BRD; Chesterton Range, c.30km N of Mungallala,

Sep 1992, O'Malley s.n. (BRD; Kookaburra Cave, Mt

Moffatt NP, Sep 1986, Williams 86045 (BRI). WARREGO

Districr: Mt Mobil holding, 15-20 km W of Umberiil HS,

Nov 1990, Grimshaw CHR3I (BRD.

Distribution and habitat: M. leptocalyx is

confined to deeply weathered sandstone hills in

the central Queensland area, particularly between

Springsure and Tambo, but extends to north of

Alpha and south towards the towns of Mitchell

and Morven (Map 3). Associated species include

Eucalyptus decorticans (F.M.Bailey) Maiden,

Acacia shirleyt Maiden, Leptospermum

sericatum Lindl. and Mirbelia speciosa DC.

Phenology: Flowers have been recorded for

most months, with peak flowering period around

September.

Affinities: M. leptocalyxisreadily distinguished

from other species in the group because of its

large flower size (4.5—5.0 mm across) and

relatively long leaves (2.0-3.5 mm long).

Furthermore, M. leptocalyx, and to a lesser

extent M. vernicosa, are the only species to

possess the conspicuous and attractive orangy-

brown flaky ‘minniritchi’ bark.

SRA RO BD a NN SN eee tee! Per

Ds. ek a. SS ene Eee ce

Bean, Micromyrtus

Conservation status: No conservation coding

is considered necessary for M. leptocalyx. It is

well conserved in Salvator Rosa National Park,

and is present in Mount Moffatt National Park

and possibly elsewhere. Destruction of plants

which are not on reserves is unlikely because of

its rocky habitat.

Micromyrtus albicans A.R.Bean sp. nov.

_aftinis Micromyrto carinatae aqua petalis

majoribus albis ecarinatis (in illa flavis

carinatisque), disco florali obliquo,

bracteolis longioribus et praesentia calycis

loborum differt. Typus: Queensland.

DARLING Downs District: SF 302

Barakula, north of Chinchilla, 26°12’S,

150°27’E, 24 April 1994, PL. Forster PIF

15169 & P.Machin (holo: BRI; iso: AD,

CANB, DNA, K, MEL, MO, NSW,

distribuendi).

Slender shrub to 3 m high and 0.5 m wide;

branchlets pendulous. Bark grey, closely

adhering, with shallow longitudinal fissures.

Stem flanges grey, flat, not winged, not warty;

margins entire. Leaves imbricate, obovate,

1 .2—2.5 x0.6—-0.9 mm, plano-convex to concayo-

convex, somewhat keeled on dorsal surface,

glabrous, oi! glands visible; apex obtuse; margins

entire; petioles absent. Flowers with peduncles

0.5—-1.0 mm long, 2.5-3.0 mm across, solitary,

axillary; bracteoles 2, conduplicate, acute, c.

0.9mm long, somewhatpersistent. Hypanthium

strongly dorsiventrally compressed-cylindrical,

1.0-1.3 mm long on adaxial side, 1.3-1.6 mm

long on abaxial side, straight; ribs 5, conspicuous,

unbranched or branching obtusely near distal

end. Calyx lobes 5, orbicular, semi-orbicular or

oblong, 0.4-0.8 x 0.4—-0.8 mm, transparent or

translucent, margins entire. Petals 5, orbicular

to obovate, 1.0—1.4 x 1.0—-1,3 mm, not keeled,

white; oil glands prominent on outer surface;

margins entire. Disc concave or flat, strongly

oblique. Stamens 5, antepetalous; filaments c.

0.3 mm long; anthers versatile, bilocular, stomia

linear, parallel; connective gland ellipsoidal,

almost as long as anthers, with globular lateral

lobes. Style c, 0.25 mm long, stigma capitate.

Ovules 6, radially arranged around a small

apical placenta. Fruit indehiscent, not enlarged.

Seeds not seen. Fig, 2 A—D.

463

Specimens examined: Queensland. BurNETT District:

Waaye, north-west corner of Barakula SF, Mar 1994, Bean

7564 (BRI). DARLING Downs District: Chinchilla-Aubura

road, 28 miles [45 km] N of Chinchilla, Sep 1963, Johnson

2685 (BRI, NSW); 41.4 km by road NNW of Chinchilla

towards Auburn, Aug 1975, Coveny 6818 & Hind (BRI,

NSW); SF 302 Barakula, Apr 1994, Forster PIF 15165 &

Machin (AD, BRI, DNA, K, MEL, NSW); Barakula SF,

north of the Barakula Forestry Office, Mar 1994, Bean

7548 (BRI, MEL); north of Chinchilla, Jun 1971, Nielsen

4 (BRI); Barakula State Forest, NW of Chinchilla, Sep

1968, Coaldrake 282 (BRI, CANB, MEL, NSW); Barakula

SF, Oct 1977, Green 4676 (BRI, NSW, PERTH); c. 4 km

N of Hellhole Creek, 35 km N of Chinchilla, Feb 1979,

Sharpe 2545 & Simon (BRD; Barakula SF, Aug 1971,

Nielsen 28 (BRI); SF 302 Barakula, Mar 1993, Richards

s.n. (BRD; Barakula Forestry, north of Chinchilla, Aug

1962, Cockburn s.n. (BRI); R16 Malcolm, N of Chinchilla,

1958, Cameron s.n. (BRD; Barakula, s.dat., Young s.n.

(BRI); Barakula State Forest, May 1981, Hando 225 (BRI).

Distribution and habitat: M. albicans 1s

confined to the Barakula State Forest north of

Chinchilla, and occurs only in the north-western

quarter of that state forest (Map 3). It grows in

woodland (rarely in heathland) in deep sandy

soils. Commonly associated species include

Eucalyptus bloxsomeit Maiden, E. crebra

F.Muell., Callitris glaucophylla Joy Thomps.

& L.A.S.Johnson, Acacia caroleae Pedley and

Melaleuca decora (Salisb.) Britten.

Phenology: Flowers and fruits have been

collected throughout the year.

Affinities: M. albicans is closely related to

M. capricornia but differs by its longer calyx

lobes and petals with conspicuous oil glands.

M., albicans is also related to M. carinata but

differs from that by its larger white petals without

a keel, oblique floral disc, longer bracteoles and

the presence of calyx lobes.

Conservation status: The risk category for

Micromyrtus albicans, according to the criteria

of Chalson & Keith (1995), is ‘susceptible’

(criterion B). This species is confined to an area

of about 25 x 40 km, where itis locally common.

Therecommended conservation status for

this species as defined by the Queensland Nature

Conservation Act 1992 is ‘rare’.

Etymology: The species epithet is from the

Latin albicans, ‘white’ or ‘becoming white’,

and refers to its white flowers, which contrast

with the yellow flowers of M. carinata.

464

Micromyrtus capricornia A.R.Bean sp. nov.

affinis Micromyrto littorali sed petalis

orbicularibus sine glandibus oleosis,

bracteolis longioribus, costis hypanthii

inconspicuis, marginibus foliorum tantum

raro denticulatis differens. Typus:

Queensland. LEICHHARDT DISTRICT:

Capricorn Highway, 14.2 km E of Comet,

23°36’S 148°41’S, 15 November 1993,

A.R. Bean 6930 (holo: BRI; iso: CANB,

MEL, NSW, QRS, distribuend1).

Shrub to 2.5 m high, branchlets somewhat

pendulous. Bark grey, loose and fibrous at base

of large plants; otherwise closely adhering,

with shallow longitudinal fissures. Stem flanges

grey, convex, not winged, not warty, margins

entire. Leaves imbricate, narrowly obovate,

1.5—2.5 x 0.5—-1.0 mm, concavo-convex or

plano-convex, dorsal surface sometimes keeled

near apex, glabrous, oul glands prominent; apex

obtuse, margins entire or rarely denticulate;

petioles 0.2-0.25 mm long. Flowers 2.3-—2.8

mm across, solitary, axillary, with peduncles

0.5—1(1.5) mm long; bracteoles 2, conduplicate,

translucent, acute, c. 0.8 mm long, deciduous.

Hypanthium dorsiventrally compressed,

obconical, slightly curved, 1.2-1.6 mm long;

ribs 5, branching towards calyx lobes, Calyx

lobes 5, semtorbicular or obtuse, 0.2—0.25 x

0.5—0.6 mm, transparent; margins entire. Petals

5, orbicular, 1~1.25 x 1—1.1 mm, not keeled,

thin, white, oil glands not visible; margins entire

or fimbriate, Disc concave, oblique. Stamens 5,

antepetalous; filaments terete, c. 0.5 mm long;

anthers versatile, bilocular, stomia linear,

parallel; connective gland compound, ovoid,

almost as long as anthers. Style c. 0.2 mm long,

stigma distinctly capitate. Ovules 6-7, radially

arranged around a small apical placenta. Fruit

indehiscent, not enlarged. Seeds solitary, ovoid,

filling the cavity. Fig. 2 E—-H.

Specimens examined; Queensland. SouTtH KENNEDY

District: c. 25 km from Mt Coolon towards Collinsville,

Nov 1978, Stanley 78370 & Ross (BRI); 72 km from

Collinsville on Mt Coolon road, Feb 1994, Bean 7350 &

Forster (A, AD, BRI, CANB, K, MEL, NSW). LercHyarpt

District: 78 km from Nebo on Nebo-Clermont road, May

1962, Jofnson 2372 (BRI, CANB, NSW); c. 80km NE of

Emerald, 10 km SSW of ‘Booroondara’, Oct 1978, Jones

5 (BRI, CANB); 7 miles [11 km] N of Norwich Park HS,

Jui 1962, Story & Yapp 177 (BRI, CANB, MEL, NSW);

‘Foxleigh’, 50 miles [80 km] N of Blackwater, Oct 1966,

Johnsen 2865 (BRI, CANB); Mount Flora-Dingo road, 6

Austrobaileya 4(4): 455-476 (1997)

km S of May Downs T/O, Jul 1992, Bean 4673 (BRI, K,

MEL, PERTH); South Blackwater Mine, Laleham, Jan

1986, Thompson s.n. (BRI); Comet-Rolleston road, May

1994, O'Keeffe 1024 (BRI). Locality unknown: Blackwater

Creek, s.dat., Bowman s.n. (MEL); Copperfield, 1869,

Slatter s.n. (MEL).

Distribution and habitat: M. capricornia is

distributed in a narrow band stretching from

north-east of Mt Coolon, to north of Rolleston,

a total distance of about 325 km. This band ts

roughly parallel to the coast and about 150km

from it (Map 1). The species inhabits the tops

of laterised ridges, on shallow to deep, yellow

or red sands. It is commonly associated

with Acacia catenulata, Eucalyptus exserta,

KE. trachyphloia, Melaleuca tamariscina Hook.

and Acacia shirleyt.

Phenology: Flowers and fruits have beenrecorded

in January, February, May, July, October and

November.

Affinities: M. capricornia is closely related to

M. littoralis but differs from that by its orbicular

petals without oil glands, longer bracteoles,

mostly entire leaf margins and inconspicuous

ribbing on the hypanthium. M. capricornia

differs from M. vernicosa by its curved

hypanthium with branched ribs.

Conservation status: No conservation code is

considered necessary. Although the species 1s

not present in any reserve, it is relatively

widespread and under no immediate threat.

Etymology: The specific epithet refers to the

distribution of the species which straddles the

Tropic of Capricorn.

Micromyrtus carinata A.R.Bean sp. nov.

affinis Micromyrto albicanti a qua petalis

flavis carinatis (inilla albis ecarinatisque),

disco florali haud obliquo et absentia

calycis loborum differt. Typus:

Queensland. DARLING Downs DIsTRICT:

Gurulmundi, 26°25’S 149°58’E , 04

September 1994, K.Sparshott KMS310

& P.Sparshott (holo: BRI; iso: A, K, L,

MEL, MO, NSW, distribuendi).

Slender shrub to 2.5 m high and 0.5 m wide;

branchlets pendulous. Bark grey, closely

adhering, with shallow longitudinal fissures.

Stem flanges grey, slightly convex, not winged,

Bean, Micromyrtus

465

"bk «+

+p asp ak +*

a . +

av * *4

+ i

pals

«a

A 9

bal"

matt

= 43

*i.*

= Fas =

ws AF, a _t

a tuts a at

=! faves =

: 4

7 +

=_—

tT?

= Bae ta tes tant

tt ea Rensehe.

*3] aay Fig gettteeer te

= tee oh ae ares teet icy

= =

ter + etm ores . =

at = © a

t % “a az = =F Fae

ibn eis tures tiring ito ke 3

‘+e to + iwe f eg yee ug tF tatite leit tee

3 tape ted te aie sate ot . tpt tat et rp ta hit ts on

od at Le ee eee getter rag ey taal OP

: tate, xy efit ee Ree Si f

7 4F at jt Joe Pte.

“st tt et “ait * A aayt ert al

=i = = ft | = 4 a

* *

* j E +, if} Z *

amd

“t

=" ;

Ce ee

for tet re

* Fae,

Sibens

4 ma wear Eo

an” ytuaat

J oe ped te Mgt

‘Sy tte. tte Hi res

* 4 ~s bd : . *

+ + a, — A

+ 4* Pa hd = a * ae 1 mn i.

+ ' “

sorte tee Stiue is 4 i_

Ye pF ine Fare ree = ee

hes i a st a4 7 : =

+ m* bs 4 Pa rt r

arr on tee

4 att tou

4475 +

a” St

wa td ¥

* hr a

+ +

+ od 7

aT + Tha

epi

aes

abe e

oe op ate ow

Ph - ath

+ +t ‘oF +

ee ee

te Heth ep t

aay a= +h*

rf tybaky? 3

Vale +}

Later a fal

Tit a} fs

Fig, 2, A—D: Micromyrtus albicans. A. flower x 8. B. abaxial surface of petal x 32. C. hypanthium lobe x 32, D. abaxial

surface of leaf x 16. E-H: M. capricornia, E. flower x 8, F. abaxial surface of petal x 32. G. hypanthium lobe x 32. H.

abaxial surface of leaf x 16. I-K: M, carinata. 1. flower x 8. J. abaxial surface of petal x 32. K. abaxial surface of leaf

x 16. L-N: M. gracilis. L. flower x 8, M. abaxial surface of petal x 32, N. abaxial surface of leaf x 16. A—D, Forster 15165

& Machin; E~H, Bean 4673; I-K, Althofer 8426; L-N, Bean 7508.

466

not warty; margins entire. Leaves imbricate,

obovate to oblanceolate, 1.1—-1.5 x 0.5—0.7 mm,

plano-convex to concavo-convex, not keeled

on dorsal surface, glabrous, oil glands prominent;

apex obtuse; margins entire or occasionally

denticulate; petioles c. 0.25 mm long. Flowers

1,5—1.8mm across, solitary, axillary; peduncles

0.5-1.3 mm long; bracteoles 2, conduplicate,

white to pale green, acute, c. 0.5 mm long,

deciduous. Hypanthium dorsiventrally

compressed, obconical, straight, 0.9-1.3 mm

long; ribs 5, conspicuous, branching obtusely

near distal end. Calyx lobes absent. Petals 5,

orbicular, 0.8-—0.9 x 0.9-1.0 mm, with a

prominent central longitudinal keel, thick, pale

yellow, oil glands prominent on lower surface;

margins entire. Disc flat, perpendicular. Stamens

5, antepetalous; filaments flattened, 0.3-0.4

mm long; connective gland compound, almost

as long as anthers. Style c. 0.2 mm long, stigma

capitate. Ovules 6, radially arranged around a

small apical placenta. Fruit indehiscent, not

enlarged. Seeds not seen. Fig. 2 I-K.

Specimens examined: Queensland. DARLING Downs

District: Gurulmundi-Wooleebee road, 13 km W of

Gurulmundi, Oct 1975, Williams 75049 (BR); Gurulmundi,

Jun 1978, Althofer 8426 (BRI); Dividing Range, Miles, Jul

1954, Gordon DMG909 (BRD; Gurulmund: area, Sep

1971, Birbeck 50 (BRI); between Giligulgul and

Gurulmundi, Sep 1959, Henderson s.n. (BRI); west of

Gurulmundi, May 1977, Olsen & Byrnes 3578 (BRD; 15

km NW of Gurulmundi, Jul 1981, Olsen s.n. (BRI, NSW);

S9km W of Gurulmundi, Oct 1977, Green 4674 (BRI,

PERTH); c. LO miles [16 km] W of Gurulmundi, May 1960,

Blake 21276 (BRI, MEL, NSW); Gurulmundi, Aug 1961,

Phillips sn. (BRI, CANB); 6miles {10 km] W of

Gurulmundi, Sep 1961, Pedley 868 (BRD; 17.7 km N of

Gurulmundi on Mill Road, Sep 1973, Trapnell & Williams

302 (BRI); between Miles and Gurulmundi, Sep 1974,

Johnson 35/74 (NSW); 14 km NW of Gurulmundi, Apr

1980, Briges 466 (CANB, MEL, PERTH); 9.6 km from

Gurulmundi railway siding on the Gurulmundi-Woleebee

Road, Sep 1988, Richardson 269 & Meredith (CANB);

Miles, Jul 1964, Ward s.n. (NSW). Cultivated: Myall

Park, Glenmorgan, May 1960, Blake 21236 (NSW).

Distribution and habitat: M. carinatais endemic

to asmall area to the north-west of Gurulmundi,

on the crest of the Great Dividing Range (Map

2). Itgrows in heathland or woodland in shallow

sandy soils. Associated species include

Bucalyptus tenutpes, E. trachyphloia, Acacia

julifera subsp. julifera, Grevillea longistyla

Hook. and Calytrix gurulmundensts Craven.

Austrobaileya 4(4): 455-476 (1997)

Phenology: Flowers and fruits have been

collected between May and October, but it

probably flowers at any time of year, inresponse

to rain.

Affinities: M. carinata 1s closely allied to

M. gracilis and M. albicans. M. carinata differs

from M. gracilis by its smaller flowers and the

shorter hypanthium, and the thick, prominently

keeled, yellow petals. M. carinata differs from

M. albicans by the absence of calyx lobes,

perpendicular disc, and keeled yellow petals.

Conservation status: The risk category for

Micromyrtus carinata, according to the criteria

of Chalson & Keith (1995), is ‘endangered’

(criteria C2 and D1). M. carinata is confined to

avery small area near Gurulmundi. This area is

subject to mining activity and gravel extraction.

The recommended conservation status

for this species as defined by the Queensland

Nature Conservation Act 1992 is ‘endangered’.

Etymology: The specific epithet is from

the Latin carinatus, meaning ‘keeled’, and

refers to the conspicuously keeled petals

of this species.

Micromyrtus gracilis A.R.Bean sp. nov. affinis

Micromyrto carinatae abqua differt

hypanthio longiore, petalis albis

tenuioribus leviter carinatis vel ecarinatis

et diametro corollae majore. Typus:

Queensland. DARLING Downs DISTRICT:

5 km W of Westmar, 27°54’S 149°46’E,

14 August 1989, L.Pedley 5433 (holo:

BRI; iso: BISH, LAE, MO, NSW).

Slender shrub to 3 m high and 0.5 m wide,

branchlets pendulous. Bark grey, loose and

fibrous at base of large plants, otherwise closely

adhering, with shallow longitudinal fissures.

Stem flanges grey, flat, not winged, not warty,

margins entire. Leaves imbricate, ovate to

obovate, 1.I-1.7 x 0.6-1.0 mm, concavo-

convex, somewhat keeled on dorsal surface,

glabrous, oil glands prominent; apex obtuse;

margins entire or denticulate; petioles absent or

up to 0.6 mm long. Flowers 2.2—2.9 mm across,

solitary, axillary; peduncles 0.5-1.1 mm long;

bracteoles 2, conduplicate, white, acute, c. 0.6

mim long, deciduous. Hypanthium dorsiventrally

Bean, Micromniyrtus

compressed, obconical, straight, 1.4-1.7 mm

long; ribs 5, conspicuous, sometimes branching

obtusely near distal end. Calyx lobes absent.

Petals 5, elliptical or orbicular, 1.0-1.3 x 1.0-1.5

mm, with or without a faint central longitudinal

keel, white, oil glands obscure or prominent on

outer surface; margins entire. Disc concave or

flat, perpendicular. Stamens 5, antepetalous;

filaments flattened, 0.4-0.5 mm long; anthers

versatile, bilocular, stomia linear, parallel;

connective gland ovoid, aboutas long as anthers,

with 2 lateral lobes. Stylec. 0.2 mm long, stigma

capitate. Ovules 6, radially arranged around a

small apical placenta. Fruit indehiscent, not

enlarged. Seeds usually solitary, broadly ovoid,

filling the cavity. Fig. 2 L—-N.

Selected specimens: Queensland, SOUTH KENNEDY DISTRICT:

8 km NW of Sayah Park HS, Mar 1992, Cumming 11568

(BRD; 12km SW of Mt Douglas HS, Jun 1992, Thompson

BUCI6 & Sharpe (BRI, CANB, NSW, PR); 53 km NNEof

Jericho, Jun 1993, Thompson JERS9 & Figg (BRD; 31km

NE of Jericho, Jul 1993, Thompson JER63 & Figg (BRI);

37 km S of Alpha, Aug 1993, Thompson JERT9 & Figg

(BRI). MircHeti District: 22 km from Jericho, towards

Blackall, Feb 1994, Bean 7508 & Forster (BRI, MEL,

NSW); |4 miles [23 km] from Jericho towards Biackall,

Nov 1968, Althofer s.n. (NSW); Joycedale, c, 14 miles [23

km] S of Jericho, Oct 1940, Smith & Everist 968 (BRI,

CANB, MEL); 12 miles [19 km] S of Jericho, Apr 1971,

Hockings s.n. (BRI). DARLING Downs Districr: c. 110 km

E of St George, Sep 1973, Henderson H1977 & Boyland

(BRI, CANB, NSW); Moonie Hwy, c. 80 miles [129 km]

ENE of St George, Sep 1959, Everist 6095 (BRI, MEL);

124 miles [200 km] SW of Dalby on Moonie Highway, Sep

1956, Burbidge 5473 (CANB); 47 miles [76 km] E of St

George along Moonie Highway, Sep 1963, Phillips 149

(BRI, CANB); 18.2 km W of Westmar, Oct 1984, Forster

1914 (BRD; 17.7 km W of Westmar, Oct 1984, Ballingall

[736 (BRI, MEL, NSW); 2 miles [38 km] W of Westmar,

Nov 1958, Pedley 338 (BRI); Moonie Hwy, c. 100 miles

[L61 km] WSW of Dalby, Sep 1963, Everist 7556 (BRD;

13 miles [21 km] from Westmar, along Moonie Highway,

Sep 1964, Shoobridge s.n, (CANB); 30 miles [48 km] from

Meandarra towards Westmar, Sep 1964, Shoobridge s.n.

(BRI, CANB); 17 km W of Westmar, Sep 1988, Richardson

274 & Meredith (CANB).

Distribution and habitat: M, gracilishas avery

wide though patchy distribution extending from

south of Charters ‘Towers to Westmar, a total

distance of more than 800km (Map 2). The best

known and most collected population is that

around Westmar. There is a large apparent

disjunction then until the Jericho area, with

northern outhers near Mt Douglas and Sayah

Park. M. gracilis inhabits flat sites with yellow

or red sandy soil, and may be associated with a

467

wide range of shrubby genera such as Calytrix,

Prostanthera, Acacia and Rulingia, and tree

generasuchas Eucalyptus, Lysicarpus, Callitris

and Casuarina. In the north of its range,

Melaleuca spp. and Eucalyptus setosa Schauer

may be present.

Phenology: Herbarium specimens indicate that

M. gracilis may flower at any time of year,

probably in response to rain.

Note: M. gracilis and M. carinata both lack

calyx lobes. This characteristic is uncommon in

Micromyrtus and is otherwise known only inthe

Western Australian species M. elobata

(F.Muell.) Benth.

Affinities: M. gracilis is closely related to

M. carinata and M. albicans. These species are

similar in habitat and habit. M. gracilis differs

from M. albicans by its lack of calyx lobes and

broader leaves. M. gracilis differs from

M. carinata by its larger white petals which lack

a conspicuous Keel, and thie longer hypanthia.

Conservation status: No conservation coding

is considered necessary for this species, While

some individual populations are small, it is

widely distributed, and is under no immediate

threat.

Etymology: The specific epithet is derived from

the Latin gracilis, meaning ‘slender’, and refers

to the habit of the plant.

Micromyrtus littoralis A.R.Bean sp. nov.

affinis Micromyrto gracilit sed petalis

ellipticis, glande connectivi minore, et

praesentia calycis loborum differens.

Typus: Queensland. WIDE Bay District:

halfway between Bundaberg and Childers,

29°0-’S 152°1-’E, 26 August 1963,

S.T. Blake 22120 (holo: BRI; iso: CANB,

CHR, K).

Shrub 0.3—1.6m high; branchlets not pendulous,

except in large plants. Bark grey, closely

adhering, with shallow longitudinal fissures.

Stem flanges grey, slightly convex, not winged,

not warty; margins entire. Leaves imbricate,

ovate to lanceolate, 1.5—3 x 0.5—0.9 mm,

concavo-convex, keeled on dorsal surface

towards apex, glabrous, oil glands prominent;

apex acute; margins denticulate; petioles absent

468 Austrobaileya 4(4): 455-476 (1997)

24 |

142 444——O1 46 148

Map 2. Distribution of Micromyrtus spp. * M. carinata, ® M. gracilis, 4 M. patula, @ M, vernicosa.

Bean, Micromyrtus

or up to 0.2 mm long. Flowers 2—2.5 mm across,

solitary, axillary; peduncles 0,3-0.9 mm long;

bracteoles 2, conduplicate, translucent, acute,

c. 0.5 mm long, deciduous. Hypanthium

dorsiventrally compressed, obconical, straight,

1.5—-2.0 mm long; ribs 5, often branching

obtusely near distal end. Calyx lobes 5, obtuse,

0.2—-0.3 x 0.6-0.7 mm, transparent to translucent,

margins entire or fimbriate. Petals 5, elliptical,

0.8—1 x 0.5-0.7 mm, not keeled, thick, white,

oil glands prominent on outer surface; margins

entire. Disc flat, perpendicular. Stamens 5,

antepetalous; filaments terete, 0.40.5 mm long;

anthers versatile, bilocular; stomia linear,

parallel; connective gland compound, elliptical,

less than half length of anthers. Style terete, c.

0.25 mm long, stigma slightly capitate. Ovules

6, radially arranged around a small apical

placenta. Fruit indehiscent, not enlarged. Seed

solitary, broadly ovoid, filling cavity. Fig. 3

A—D.

Selected specimens: Queensland. WipE Bay District:

near Bingera, Sep 1955, Cooper QFD 56/53 (BRI); Alloway

area, near Bundaberg, Jun 1965, Scarth-Johinsons.n.(BRD;

Coonarr Beach, S of Bundaberg, Jul 1983, Young 653

(BRD; 26 km SW of Bundaberg along Isis Highway, May

1977, Telford 5368 & Ellyard (BRI, CANB, MEL, NSW,

PERTH); about midway between Childers and Bundaberg,

Apr 1945, Blake 15515 & Webb (BRI, NSW); about 17

miles [27 km] SW of Bundaberg on Childers road, Dec

1939, Smith 700 (BRD; Bruce Highway between Elliot and

Gregory Rivers, Mar 1969, Bisset B91 (BRI); Goodwood,

Jun 1915, Bick s.n. (BRD; 3 km W of Woodgate, on

Goodwood road, May 1971, Briggs 4262 & Johnson

(NSW); Wocdgate National Park, Sep 1993, Forster PIF

13964 (BRI, CANB, MEL, NSW); Isis Junction, Oct 1912,

Kenny s.n. (BRI); Isis River, end of Barrett’s road, Nov

1992, Forster PIF 12314 & Machin (BRI, MEL); Burrum

Heads road, Sep 1965, Gittins 1124 (BRI, CANB, NSW);

16 km from Old Bruce Highway, towards Burrum Heads,

Aug 1994, Bean 7816 (BRI); Double Island Point, Oct

1946, Clemens sn. (BRD; Wide Bay Military Training

Area, Sep 1980, Adams 3611 (BRI, CANB); Cooloolah

Sandhills, May 1959, Thorne 21427 (CANB); 2 kmeast of

Teewah Creek, Cooloola NP, Sep 1993, Bean 6454 (BRI,

NSW); Noosa R., Cooloola NP, c.3kmS of Harry Springs

Hut, Nov 1984, Sharpe 3605 & Harrold (BRI. Cultivated:

The Gap, Brisbane, Oct 1966, Blake 22765 (CANB).

Distribution and habitat: M. littoralts is

distributed in coastal areas of the mainland

between Bundaberg and Cooloola National Park

(east of Gympie), a total distance of about 170

km (Map 3). It inhabits coastal heathland

communities known locally as ‘wallum’, on

white sandy soils. Associated species include

469

Eucalyptus umbra R.T.Baker, Melaleuca

quinquenervia (Cav.)S.T. Blake, Leptospermum

semibaccatum Cheel, and species of Epacris

and Banksia.

Phenology: Flowers and fruits have been

collected throughout the year.

Affinities: M. littoralis is most closely related to

M. gracilis but can be distinguished from that by

its smaller stature, consistently elliptical petals

and the presence of calyx lobes. M. littoralis 1s

also close to M. vernicosa, but differs from that

by its scaly grey bark, dull leaf surface,

denticulate leaf margins, longer hypanthia and

shorter peduncles.

Conservation status: The risk category for

Micromyrtus littoralis, according to the criteria

of Chalson & Keith (1995), is ‘susceptible’

(criterion D), Although M. littoralis can be

locally common, the species is nevertheless

rare with only scattered areas of occurrence,

with many areas under continued threat from

agricultural and urban developments. It is

present in Woodgate National Park and Cooloola

National Park.

The recommended conservation status for

this species as defined by the Queensland Nature

Conservation Act 1992 1s ‘rare’.

Etymology: The specific epithet /ittoralis 1s

from the Latin meaning ‘of the sea shore’ and

alludes to the fact that it is the only Queensland

species of Micromyrtus having a coastal

distribution.

Micromyrtus vernicosa A.R.Bean sp. nov.

atfinis Micromyrto capricorniae sed

cortice fibroso brunneo, hypanthio recto

costis haud ramosis, petalis minoribus

glandes oleosas prominentes ferentibus et

disco florali haud obliquo differens.

Typus: Queensland. Wipg BAy DIsTRICT:

Mount Walsh National Park, south of

Biggenden, 25°34’S 152°03’E, 21 May

1994, A.R. Bean 7702 & PI. Forster (holo:

BRI; iso: CANB, K, MEL, NSW, PERTH,

distribuend1)

Spreading shrubto 2 x 2m; branchlets somewhat

pendulous. Bark brown to orange, weathering

470

to grey, loose, rather fibrous. Stem flanges grey,

convex, not winged, not warty, margins entire.

Leaves imbricate, oblanceolate, 1.5—2.5 x

Q.5—0.6 mm, concavo-convex, keeled on dorsal

surface, glabrous, very glossy, oil glands

prominent; apex obtuse; margins entire; petioles

c. 0.25 mm long. Flowers 1.9-2.1 mm across,

solitary, axillary; peduncles 0.5—1 mm long;

bracteoles 2, conduplicate, translucent, c. 0.7

mm long, deciduous. Hypanthium dorsiventrally

compressed, obconical, straight, 1.3-1.5 mm

long; ribs 5, antesepalous, unbranched or

branching very close to the calyx lobes. Calyx

lobes 5, semiorbicular, 0.3-0.4 x 0.5-0.6 mm,

translucent, margins entire. Petals 5, elliptical,

0.8—I x 0.6-0.7 mm, not keeled, thick, creamy-

white, oi! glands prominent on outer surface,

margins entire. Disc flat, perpendicular. Stamens

5, antepetalous; filaments terete, c. 0.4 mm

long; anthers versatile, bilocular; stomia linear,

parallel; connective gland compound, ovoid, c.

half length of anthers. Style terete, c. 0.3 mm

long; stigma capitate. Ovules 6 or sometimes 7,

radially arranged around asmall apical placenta.

Fruits and seeds not seen. Fig. 3 E-J.

Specimens examined: Queensland, WibE BAy DISTRICT:

Mount Walsh, near Biggenden, Jun 1983, Bean 25 (BRI);

rocky gorge base of Biggenden Bluff, May 1931, White

7736 (BRI); Mt Walsh, 6.5 km S of Biggenden, 28 May

L977, Telford 5312 & Ellyard (AD, BRI, CANB, MEL,

NSW, PERTH).

Distribution and habitat: M. vernicosa is

endemic to Mt Walsh near the town of Biggenden

in south-east Queensland (Map 2). It grows on

rocky slopes in heathland. Associated species

include Kunzea flavescens C.T.White &

W.D.Francis, Leucopogon rupicola C.T.White

and Grevillea whiteana McGill.

Phenology: Flowering and fruiting have been

recorded for the months of May and June.

Affinities: M. vernicosa 1s closely related to

M. capricornia and M., littoralis. {t differs from

M. capricornia by its brown fibrous bark, smaller

petals with oil glands, and hypanthium with

unbranched ribs. M. vernicosa differs from

M. littoralis by its brown fibrous bark, glossy

leaves and hypanthia, denticulate leaf margins

and longer peduncles.

Conservation status: The risk category for

Micromyrtus vernicosa, according to the criteria

Austrobaileya 4(4): 455-476 (1997)

of Chalson & Keith (1995), is ‘vulnerable’

(criterion B1).

Therecommended conservation status for

this species as defined by the Queensland

Nature Conservation Act 1992 is ‘vulnerable’.

Etymology: The specific epithet is derived from

the Latin vernicosus, meaning ‘varnished’, 1n

reference to the glossy leaves and hypanthia.

Micromyrtus sessilis J.W.Green, Nuytsia4(3):

322—4 (1983). Type: Queensland.

DARLING Downs District: 2kmS of Miles,

[2 October 1977, J. W.Green 4675 (holo:

BRI; iso: NSW, PERTH).

Spreading shrub to 1.5 x 1.5 m, branchlets

not pendulous. Bark brown to orange, loose,

fibrous. Stem flanges grey, slightly convex, not

winged, not warty; margins entire. Leaves

imbricate, obovate to oblanceolate, 1.5—2.6 x

0.7—1.0 mm, concavo-convex, keeled on dorsal

surtace, glabrous, glossy, oil glands prominent;

apex obtuse or acute; margins denticulate;

petioles c.0.2 mm long. Flowers c.2 mm across,

solitary, axillary; peduncles O-0.3 mm long;

bracteoles 2, conduplicate, translucent or

opaque, c. 1.5 mm long, persistent. Hypanthium

not compressed, obconical, straight, 1.1—1.5

mm long; ribs 5, antesepalous, unbranched or

branching very close to the calyx lobes. Calyx

lobes 5, semiorbicular, 0.5—0.8 x 0.8—1.1 mm,

translucent to transparent, margins ciliate.

Petals 5, orbicular to elliptical, 0.8-1.5 x

Q.6-1.0 mm, not keeled, thick, creamy-white or

tinged with pink, oil glands visible on outer

surface; margins entire. Disc flat, perpendicular,

Stamens 5, antepetalous; filaments terete, c. 1.0

mm long; anthers versatile, bilocular; stomia

linear, subparallel; connective gland simple,

globular, less than half length of anthers. Style

terete, c. 1.0 mm long; stigma capitate. Ovules

4, radially arranged around a small apical

placenta. Fruits scarcely enlarged. Seeds solitary,

ovoid, filling cavity.

Selected specimens: Queensland. Burnetr District:

Glencoe, 13 miles [21 km] ESE of Camboon, Sep 1969,

Pedley 2885 (BRI). Maranoa District: 35 miles [56 km]

SW of Roma, Sep 1967, Ped/ey 2411 (BRI, CANB, NSW);

Yuleba-Jackson road, 5 miles [8 km] west of Yuleba, Nov

1958, Johnson 683 (BRI); Combidiban Creek, east of

Yuleba, Aug 1978, Williams 78107 (BRI). DarLinc Downs

Bean, Micromtyrtus

District; Miles-Condamine road, 5 km S of Miles, Aug

1977, Williams 77181 (BRD; Gurulmundi, Sep 1994,

Sparshott KMS315 & Sparshott (BRI, MEL, NSW);

Barakula State Forest, Aug 1971, Nielsen 9 (BRD); just

south of Castle Rock, Girraween NP, Sep 1993, Bean 6346

(BRI). |

Distribution and habitat: M. sessilis is

widespread in southern Queensland from west

of Eidsvold to Girraween National Park (Map

1). It also occurs in New South Wales as far

south as Griffith. It grows in heathland or low

eucalypt woodland, on shallow sandy soils.

Associated species include Eucalyptus deanei

Maiden, &. exserta F.Muell., &. prava

L.A.S Johnson & K.D.Hill, Acacia triptera

Benth., Melichrus urceolatus R.Br. and Calytrix

tetragona Labill.

Phenology: Flowers and fruits have been

recorded for most months of the year but

with greatest frequency in the period August-

September.

Affinities: M. sessilis is closely related to

M. striata but differs from that by its 5-ribbed

hypanthium (7-9 ribbed for M. striata).

Conservation status: A widespread and

moderately common species.

Micromyrtus striata J.W.Green, Nuytsia4(3):

324—7 (1983). Type: New South Wales.

SOUTH WESTERN PLAINS: 5,5 miles [8.8km]

S of Tottenham, 7 September 1962, 7. &

S.Whaite 2525 (holo: NSW),

Spreading shrub to 1.2 x 1.2 m; branchlets

not pendulous. Bark brown to orange, loose,

fibrous. Stem flanges grey, slightly convex,

not winged, not warty; margins entire. Leaves

imbricate, obovate to oblanceolate, 1.2—2.6 x

O.7-—1.2 mm, concavo-convex, keeled on dorsal

surface, glabrous, glossy, oil glands prominent;

apex obtuse or acute; margins denticulate;

petioles absent or c. 0.2 mm long. Flowers c, 2

mm across, solitary, axillary; peduncles 0-0.3

mm long; bracteoles 2, conduplicate, translucent

or opaque, c. 1.2 mm long, persistent.

Hypanthium notcompressed, obconical, straight,

1,.2-1.6 mm long; ribs 7-9, unbranched or

joining close to base ofhypanthium, Calyx lobes

5, semiorbicular, 0.5-0.8 x O0.8—1.1 mm,

translucent to transparent, margins ciliate. Petals

471

5, orbicular to elliptical, 0.8—1.7 x 0.6-1.3 mm,

not keeled, thick, creamy-white or tinged with

pink, oil glands visible on outer surface;

margins entire. Disc flat, oblique or

perpendicular. Stamens 5, antepetalous;

filaments terete, c. 1.0mm long; anthers versatile,

bilocular; stomia linear, subparallel; connective

gland simple, globular, less than half length of

anthers. Style terete, c. 1.0 mm long; stigma

capitate. Ovules 4, radially arranged around a

small apical placenta. Fruits scarcely enlarged.

Seeds solitary, ovoid, filling cavity.

Specimens examined: Queensland. DARLING Downs

District: Wondul Range, SF 1898, NW of Inglewood, Aug

1993, Bean 6335 & Forster (BRI, DNA); Headwaters of

Pariagara Creek, 7 km W of Bringalily Forestry lookout

tower, Sep 1992, Forster PIF 11662 & Machin (BRI,

CANB, DNA, K, MEL, NSW, PERTH).

Distribution and habitat: M. striata is

widespread in central New South Wales from

north of Bourke to Griffith. In Queensland, it is

apparently confined to the Inglewood area(Map

3). It grows in mallee, heathland or woodland on

shallow sandy soils in association with such

species aS Eucalyptus exserta and Callitris

endlicheri (Parl.) F.M.Bailey.

Phenology: Flowering or fruiting specimens

have been collected in August and September.

Note: These specimens represent the first record

of this species for Queensland.

Affinities: M. striata is very closely related to

M, sessilis and can be reliably distinguished |

only by the ribbing of the floral hypanthium.

M. striata has a 7- or 9-ribbed hypanthium,

while the hypanthium of M. sessilis is 5-ribbed.

Conservation status: A widespread and

reasonably common species.

Micromyrtus forsteri A.R.Bean sp. nov. affinis

Micromyrto fimbrisepalae sed hypanthio

breviore costas 7—10 ferente, lobis calycis

semiorbicularibus minoribus, petalis

minoribus et filamentis fere teretibus

differens. T'ypus: Queensland. Cook

District: 8/ km along Bulimba Station

road, off the Chillagoe to Wrotham Park

road, 16°54’S, 143°36’E, O05 February

1994, P.I. Forster PIF14741 (holo: BRI

472 Austrobaileya 4(4): 455-476 (1997)

& §

142 144 146 148

Map 3. Distribution of Micromyrtus spp. ™ M. albicans, A M. forsteri, © M. leptocalyx, x M. littoralis,

% MM, striata.

Bean, Micromtyrtus

(3 sheets + spirit); iso: A, AD, BISH,

CANB, DNA, K, L, MEL, NSW, P, QRS,

distribuend1).

Shrub to 2.5 m high; branchlets erect or

spreading. Bark grey, closely adhering, except

at base, where loose and fibrous. Stem flanges

grey, convex, not winged, not warty; margins

entire. Leaves imbricate, ovate, 1.0-1.5 x

0.5—0.7 mm, plano-convex or concavo-convex,

not keeled on dorsal surface, glabrous, oil glands

numerous, evenly scattered; apex obtuse;

margins denticulate; petioles absent. Flowers

44.5 mm across, solitary, axillary; peduncles

short, thick, up to 0.5 mm long; bracteoles 2,

conduplicate, acute, c. 0.8-1 x 0.5 mm,

deciduous. Hypanthium obconical, not

compressed, straight, 1.0-1.5 mm long; tube 7-

or 8-ribbed at base, some ribs dividing distally;

10 ribbed at top opposite the petals and calyx

lobes, antepetalous ribs extending onto petals.

Calyx lobes 5, semiorbicular, 0.5—0.7 x 0.8-1.1

mm, translucent or transparent, margins

fimbriate. Petals 5, orbicular, 1.4—1.5 x 1.2—1.5

mm, not keeled, thin, white to yellow, oil glands

visible on outer surface; margins fimbriate.

Disc flat, perpendicular. Stamens 10, opposite

the petals and calyx lobes; filaments slightly

flattened, tapering, c. 1 mm long; anthers

versatile, bilocular, stomia linear, parallel;

connective gland globular, simple, less than

half length of anther. Style terete, somewhat

tapering, 0.8—1 mm long, stigmacapitate. Ovules

6-7, radially arranged around a small apical

placenta. Fruit indehiscent, scarcely

enlarged. Seed solitary, ovoid to spherical, filling

the cavity. Fig. 3 K-N.

Specimen examined: Queensland. Coox District: 87 km

from Chillagoe-Wrotham Park road, towards ‘Bulimba’,

Jan 1993, Bean 5664 & Forster (BRD; North Head, 18°46’S,

143°(9 E, Apr 1996, Forster PIF19027 & Ryan (BRI,

DNA, MEL, QRS).

Distribution and habitat: M. forsteriis known

from only two localities, both in north

Queensland (Map 3). It grows in open rocky

areas associated with species such as Acacia

Shirleyt, Acacia multisiliqua (Benth.)

Maconochie and Myrtella retusa (Endl.)

A.J. Scott.

Phenology: Flowers and fruits have been

recorded in January, February and April.

473

Notes: At 16°54’S latitude, the type locality of

M. forsteri is the most northerly known

occurrence for the genus Micromyrtus.

Furthermore, M. forsteriand M. delicata are the

only species known to occur north of 20°S

latitude.

M. forsteriis the only Micromyrtus species

from the eastern states of Australia to have

flowers with 10 stamens.

Affinities: M. forsteri is closely related to

M. hymenonema and M. fimbrisepala, as all

three have flowers which possess 10 stamens

and 6—7 ovules. However, M. forsteri differs

from the others by its 7- 10-ribbed hypanthium

(vs. 5-ribbed), smaller calyx lobes and petals,

and the only slightiy flattened filaments (vs.

conspicuously lorate). M. hexamera is also

related to M. forsteri, but M. hexamera has 6

petals and calyx lobes, and 12 stamens.

Conservation status: The risk category for

Micromyrtus forstert, according to the criteria

of Chalson & Keith (1995) is ‘priority for

investigation’ (criterion A). The known

populations comprise afew hundred plants over

an area of several hectares, However, the area 1s

poorly explored botanically and it seems likely

that more stands will be found.

The recommended conservation status

for this species as defined by the Queensland

Nature Conservation Act 1992 1s ‘rare’.

Etymology: The species is named for Paul Irwin

Forster, collector of the type specimen and

prolific collector of, and publisher on the

Queensland flora.

Micromyrtus hexamera (Maiden & Betche)

Maiden & Betche, Census N.S.W. pl. 157

(1916); Thryptomene hexamera Maiden

& Betche, Proc. Linn, Soc. New South

Wales 26: 82 (1901). Type: New South

Wales. NoRTH WESTERN PLAINS: Road from

Bourke to Goombalie, Warrego River,

sep 1900, #.Betche s.n. (lecto: NSW;

isolecto: MEL), fide Green (1980b),

Illustration. A. Clemson, Honey & Pollen

Flora p, 121 (1985), as M. ciliata.

Shrub to 2 m high; branchlets arching. Bark

brown to orange, loose, rather fibrous. Stem

474 Austrobaileya 4(4): 455-476 (1997)

Sette

ae fae oa a

4 dee i=

ak ta a ae was

ara a ee a he

Sma Sagi teare LEE Ee hy Pett

Fig, 3. A—D: Micromyrtus litforalis. A. flower x 8. B. abaxial surface of petal x 32. C. hypanthium lobe x 32, D., abaxial

surface of leaf x 16. E—-H: M. vernicosa. E. flowerx 8. F. abaxial surface of petal x 32. G. hypanthium lobe x 32. H. abaxial

surface of leaf x 16. I-L: M. forsteri. I. flower x 8. J. abaxial surface of petal x 16, K. hypanthium lobe x 16. L. abaxial

surface ofleafx 16. General characteristics of Micromyrtus. M. Stamens and petals from above x 16, N. Ovule arrangement

x 16. A~D, Bean 7816; E-H, M, N Bean 7702 & Forster; I-L, Forster 14741.

Bean, Micromyrtus

flanges grey, flat, not warty, not winged, margins

entire. Leaves not or scarcely imbricate, obovate,

1.1-1.9 x 0.8-1.0 mm, concavo-convex, not

keeled on dorsal surface, glabrous, oil glands

few, prominent, evenly scattered; apex obtuse;

margins entire or denticulate; petioles absent or

up to 0.2 mm long. Flowers 5-6 mm across,

solitary, axillary; peduncles 0.7—1.2 mm long;

bracteoles 2, conduplicate, acute, c. 1.0 x 0.3

mm, deciduous. Hypanthium obconical, not

compressed, straight, 1.7-2.0 mm long; tube

6-ribbed at base, some ribs dividing distally.

Calyx lobes 6, semiorbicular, 0.6—0.7 x 1.0-1.1

mm, translucent or transparent, margins

fimbriate. Petals 6, orbicular, 1.7—2.1 x 1.7-2.1

mm, not keeled, thin, white, oi! glands absent;

margins fimbriate. Disc flat, perpendicular or

oblique. Stamens 12, opposite the petals and

calyx lobes; filaments slightly flattened, tapering,

c. 1.0 mm long; anthers versatile, bilocular,

stomia linear, parallel; connective gland

ellipsoidal, compound, diameter c. 0.75 times

length of anther, Style terete, c. 1.0 mm long,

stigma capitate. Ovules 7-8, radially arranged

around asmall apical placenta. Fruit indehiscent,

scarcely enlarged. Seed solitary, ovoid to

spherical, filling the cavity.

Specunens examined: Queensland. WArREGO DISTRICT:

north-western section of Chesterton Range NP, Sep 1995,

Bean 8996 & Grimshaw (BRD); east of Wyandra toward

Elverston station, Sep 1963, Cockburn 22 (BRD; near

Alpha station, 27°i-’ S, 146°0—’ E, Fun 1955, Smith 6414

(BRI); 48 km W of Cunnamulla, Nov 1954, Smiiti: 6004

(BRD; N of Balonne Highway on Linden road, 8 km N of

road junction, Aug 1978, Williams 78231 (AD, BRI, MQ);

Cunnamulla Bollon road, 32 km E of Bourke turnoff, Apr

1962, Gordon DMG4762 (BRI); Cunnamulla, Jul 1949,

Gordon DMG36 (BRD; Gilruth Plains, Apr 1963, McKee

10346 (BRI). MARANOA District: 78 km W of Bollon, on

road to Cunnamulla, Sep 1988, Thomas s.n, (BRI, NSW);

Boatman road, 84 miles [135 km] SE of Charleville, Sep

1968, Williams 72 (BRI); c. 70 km W of Bollon, Sep 1973,

Henderson H2014 & Boyland (BRD; on Balonne Hwy, 75

km W of Bollon, Aug 1981, Whaite 3821 & Whaite (BRI);

62 km SE of Charleville along Boatman road, Mar 1976,

Purdie & Boyland 98 (BRI); Dingwall, c. 97 miles SSE of

Charleville, Aug 1963, Everist 7502 (BRI).

Distribution and habitat: M. hexamera 1s

distributed in the Cunnamulla and Charleville

areas In Queensland (Map 1). It also occurs

near Bourke in northern New South Wales. It

grows in heathland or Acacia shrubland

communities on red or yellow sandy loam.

Associated species include Acacia aneura

475

Benth., Eremophila gilesti F.Muell. , Eucalyptus

melanophloia F.Muell. and Triodia sp.

Phenology: Flowering has been recorded for

most months of the year with an apparent peak

around August and September.

Affinities: M. hexamera ts related to M. forsteri

but differs from that by its hexamerous flowers

with 12 stamens (10 stamens for M. forsteri),

hypanthia which are 6-ribbed near their bases

(7-8-ribbed for M. forsteri), and petals 1.7—2.1

mm long (1.4-1.5 mm for M. forstert).

Conservation status: This is arelatively common

species within its range, and no conservation

coding is considered necessary at this time.

Note: L.S.Smith collected a specimen of

Micromyrtus hexamera from ‘near Alpha

station’ in 1955. Smith did not indicate the

latitude or longitude of the collection or any

other locational data. When the Queensland

Herbarium began databasing label records in

the 1970s, technical staff were required to

allocate approximate latitude and longitude data

to vague localities. In the case of L.S.Smith

6414, it was assumed that the Alpha station

involved was the one south of the town of Alpha,

in the South Kennedy pastoral district. The

distribution map of Green (1980b) reported this

in good faith, with the Alpha site shown as a

quite remote northern outlier.

Examination of specimens collected by

Smith during the same week as the one in

question reveal that he was in the Charleville-

Cunnamulla area at the time, and that the Alpha

station on which Smith in fact collected was and

is located near Wyandra, between Charleville

and Cunnamulla. M. hexamerais well known in

areas around these towns. With the removal of

the anomalous South Kennedy record, it can be

stated that, 1n Queensland, the species is confined

to the Warrego and Maranoa pastoral districts.

Acknowledgements

Paul Forster has contributed greatly to this

project by facilitating my field work, and

undertaking to collect specimens for me, at

times a long way from his intended route. I also

thank John Thompson for his collections and

enthusiasm, Will Smith for the illustrations and

476

maps, Roy and Val Hando for assisting me to

locate M. patula, Beverly O’ Keeffe for

collecting specimens, Bruce Gray for directions

on how to find M. delicata, Peter Bostock for

the Latin diagnoses, and the Directors of CANB,

NSW and MEL for the loan of specimens.

References

BENTHAM, G. (1865). In Bentham & Hooker, Genera

Plantarum p. 700. London: Lovell Reeve & Co.

—— (1867). Micronryrtus. In Flora Australiensis 3: 63-6.

London: Lovell Reeve & Co.

CHALSON, J.M, & Kerry, D.A. (1995). A Risk Assessment

Scheme for Vascular Plants: Pilot Application to the

Flora of New South Waies. Hurstville: National

Parks and Witidltfe Service.

Austrobaileya 4(4): 455-476 (1997)

GREEN, J.W. (1980a). A Revised Terminology for the

Spore-containing Parts of Anthers. New Phytologist

84: 401-6.

— (1980b). Thryptomene and Micromyrtus (Myrtaceae)

in Arid and Semi-arid Australia. Nuytsia 3(2):

183-209.

——(1983), Taxonomy of Micromyrtus ciliata (Myrtaceae)

and allied species including three new species of

Micremyrtus from eastern Australia and

lectotypification of M. minutiflora. Nuytsia 43):

317-31.

Hanbo, V. (1988). Plants of Western Darling Downs,

Barakula-Gurulmundi and South-west Burnett. pp.

96-171. In R. Hando (ed.), Going Bush with

Chinchilla Nats. Chinchilla: Chinchilla Field

Naturalists Club Inc.

em ys epee vy ee og ee hiaiene

A taxonomic revision of Drypetes Vahl (Kuphorbiaceae) in

Australia

Paul I.Forster

Summary

Forster, Paul I. (1997). A taxonomic revision of Drypetes Vahl (Euphorbiaceae) in Australia, Austrobaileya

4(4): 477-494. The genus Drypetes is revised for Australia, Four species are recognised, Drypetes

acuminata P.I.Forst., sp. nov., D. deplanchei (Brongn. & Gris) Merr., D. iodoformis L.S,Sm, ex P.I.Forst.,

sp. nov. and D, vernicosa P.I.Forst., sp. nov, All species are described and illustrated and notes are

provided on their distribution, habitat and conservation status, The name Cyclostemon subcubicus J.J.Sm.

is lectotypified. The name Drypetes subcubica (.J.Sm.) Pax & K.Hoffm. has been misapplied to the

Australian taxon here named D. iodoforimis.

Key words: Euphorbiaceae; Drypetes - Australia, Cyclostemon subcubicus, Drypetes acuminata,

Drypetes deplanchei, Drypetes iodoformis, Drypetes subcubica, Drypetes vernicosa.

Paul I. Forster, Queensland Herbarium, Meiers Road, Indooroopilly Queensland 4068, Australia

Introduction

The genus Drypetes was named by Vahl (1807)

based on material fromthe New World. Drypetes

comprises approximately 200 species (Webster

1994) and is widely distributed in the tropics

and subtropics with the greatest concentration

of species in the neotropics. The majority of

Species are trees or shrubs which occur in

rainforest or communities with a significant

level of rainforest elements.

The genus was included by Webster (1994)

in Euphorbiaceae, subfamily Phyllanthoideae,

tribe Drypeteae (Griseb.)Hurusawa together

with the genera Lingelsheimia Pax, Sibangea

Oliver and Putranjiva Wallich. Drypetes 1s

distinctive in this tribe by its combination of

1 or 2-locular ovary, drupaceous fruit, presence

of a disk in the flowers, and the pistillate sepals

imbricate in bud and deciduous in the fruit

(Webster 1994). No modern monograph of

Drypetes is available and recent work has

concentrated on regional flora accounts (e.g.

Radcliffe-Smith 1987; McPherson 1991),

In Australia, one or two species of Drypetes

have beenrecognised in flora accounts (Mueller

1866; Bentham 1873; Bailey 1902). The most

recent accounts of the genus in Australia by

Accepted for publication 22 March 1996

Airy Shaw (1980b) and Hyland & Whiffin

(1993) recognise two species, D. lasiogyna

(F.Muell.) Pax & K.Hoffm. (syn. D. australasica

(Miull.Arg.) Pax & K.Hoffm.) and D, subcubica

(J.J.Sm.) Pax & K.Hoffm.

The former species is a widely distributed

and well known plantof the ‘dry’ rainforests and

thickets and has undergone continual name

changes in recent times (Airy Shaw 1980b;

Green 1986, 1990, 1994). Green (1990) first

pointed out that D. lasiogyna was conspecific

with D. deplanchei (Brongn. & Gris) Merr., the

latter name being based on a type from New

Caledonia.

The taxon known as D. subcubica is a

rarely encountered rainforest plant from the

‘Wet Tropics’ of north-east Queensland. The

Australian plants known as D. subcubica are not

conspecific with the type of that name and

belong to anew species described in this paper.

In addition, two new endemic species, both

from rainforest communities, are recognisable

and are also described herein. Hence the genus

Drypetes now comprises four species in

Australia.

‘T'wo groups may be recognised for the

Australian species of Drypetes. One group may

be distinguished by the presence of entire

stigmas and the disk in the male flowers being

478

cupuliform or reduced to small lobes. This

group comprises D, deplanchei and the new

species D, acuminata and D. vernicosa. The

second group may be distinguished by the

presence of bifid stigmas and the disk in the

male flowers being comprised of numerous

irregular, oblong to subulate processes. ‘This

second group comprises only D. todoformis.

Whether these two groups form natural units

within the genus can only be determined by

monographic study.

Materials and methods

This work is based on herbarium collections in

AD, BO, BRI, CANB, CBG, DNA, MEL, NSW,

PERTH and QRS, photographs of types at K

and P, and field collections and observations by

the author.

Floral descriptions were prepared from

material preserved in spirit (FAA or 70%

alcohol and 5% glycerol) or reconstituted by

boiling in water and detergent. Fruit descriptions

were prepared from material preserved in spirit

or dried. Foliage and inflorescence descriptions

were prepared from dried material. Indumentum

cover 1s described using the terminology of

Hewson (1988), except that ‘scattered’ 1s used

instead of ‘isolated’. Indumentum in Australian

Drypetes species comprises uniseriate,

multicellular hairs. Descriptions of seedlings are

based on specimens preserved at QRS.

The ‘Wet Tropics’ is defined as that area

of north-eastern Queensland that encompasses

the ‘hot, humid, vine forests’ from near

Cooktown in the north to Paluma in the south

(Webb & Tracey 1981; Barlow & Hyland 1988).

Rainforest typology follows Webb (1978).

Taxonomy

Drypetes Vahl, Eclog. Amer. 3: 49 (1807).

Type: D. glauca Vahl.

Derivation of name: from the Greek drupetes,

meaning fully ripe.

Austrobaileya 4(4): 477-494 (1997)

Cyclostemon Blume, Bidjr. 597 (1826).

Type: Cyclostemon macrophyllum Blume

(= Drypetes macrophylla (Blume) Pax &

K.Hoftfm.), fide Webster (1994; 47).

Hemecyclia Wight & Arn., Edinburgh New

Philos. J. 14: 297 (1833). Type:

Hemicyclia sepiaria Wight & Arn. (=

Drypetes sepiaria (Wight & Arn.) Pax &

K.Hoffm.

Further generic synonyms are listed by Webster

(1994), but have not been used for Australian

taxa,

Shrubs or trees, deciduous or evergreen,

perennial, dioecious or rarely monoecious; stems

and foliage without conspicuous latex.

Indumentum of simple, multicellular trichomes;

glandular trichomes absent; stinging trichomes

absent. Stipules entire, inconspicuous,

deciduous. Leaves alternate, petiolate to sessile,

elobate, penninerved, entire to crenate or serrate,

with glands absent. Inflorescences terminal or

axillary, racemose or spicate, solitary, generally

unisexual, with flowers in bracteate clusters.

Male flowers pedicellate; sepals 4 or 5, imbricate,

cucullate; petals absent; stamens 3-50, filaments

free and attached to slightly convex receptacle;

anthers dorstfixed, bilobate, introrse, with thecae

oblong and longitudinally dehiscent; disk

cupuliform, + entire, lobed or lacinate,

sometimes much reduced; pistillodes absent or

minute. Female flowers pedicellate; sepals 4 or

5, imbricate, cucullate; petals absent; disk

hypogynous, annular, cupular, of several lobes

or rarely + absent; ovary 1—2-locular; ovules

biloculate; styles short; stigmas flattened, bifid

or entire. Fruit drupaceous, unt-, bi- or trilobate,

globose, ovoid or ellipsoid; pericarp fleshy;

endocarp coriaceous or papery. Seeds solitary

by abortion, ecarunculate; testa crustaceous;

albumen fleshy; cotyledons broad, flat.

A pantropical genus of c. 200 species.

Four species in Australia.

DTT a Re Sere renee ic A SIU sees see eee aete

Forster, Drypetes

479

Key to the Australian species of Drypetes

1. Stipules and floral bracts linear-lanceolate; male flower sepals 1.5—2.5 mm

FOR hacen iste cestode ence oe elec gS

Stipules and floral bracts lanceolate-triangular; male flower sepals 2.5—4 mm

LONE hich eh ee Ree Pw aw s AO eee yee

2. Cutstem with iodoform scent; stipules c. | mm long and 0.5 mm wide; stigmas

bifid; male flower pedicels 1.5-2 mm long; stamen filaments 1-2 mm

LYE cee hes sor hh ten A eae: eo ae Bagi Bes Peers

Oe See. ry 4, D. todoformis

Cut stem without iodoform scent; stipules 0.4—0.6 mm long, 0.2—0.3 mm

wide; stigmas entire; male flower pedicels 3.2-8 mm long; stamen

filaments 0.3-0.7 mm long............

3. Leaf lamina oblanceolate, with tip acuminate; male flower pedicels

3,2—4.5 mm long; disk in male flower much reduced to small lobes ....

2 D. acuminata

Leaf lamina elliptic, elliptic-lanceolate, ovate-elliptic, oblong or orbicular,

with tip acute, rounded or obtuse; male flower pedicels 5—8 mm long; disk

in male flower cupuliform or of irregular lobes .................05. 1. D. deplanchei

1, Drypetes deplanchei (Brongn. & Gris) Merr.,

J. Arnold Arbor. 32: 199 (1951);

Elaeocarpus deplanchei Brongn. & Gris,

Bull. Soc. Bot. France 10: 477 (1863);

Hemicyclia deplanchei (Brongn. & Gris)

Baill. ex Guillaumin, Ann. Mus. Colon.

Marseille, Ser. 2, 9: 224 (1911). Type:

New Caledonia, Deplanche 463 (holo: P

n.v., photo at BRI; fide McPherson (1991;

12)).

Hemicyclia lasiogyna F.Muell., Fragm. 4:

119(1864); Drypetes lasiogyna(F.Muell.)

Pax & K.Hoffm. in Engl. Pflanzenr. 25:

272 (1922). Type: Northern Territory.

Port Essington, Leichhardt (holo: 7MEL

n.v.).

Hemicyclia sepiaria vat. oblongifolia

Benth., Fl. Austral. 6: 117 (1873). Type:

Northern Territory. Port Darwin, on the

beach, Schultz 746 (holo: K n.v., photo at

BRI).

Hemicyclia australasica Miill.Arg. in DC.,

Prodr. 15(2): 487 (1866); Hemicyclia

sepiaria var. australasica (Miull.Arg.)

Baill., Adansonia 6: 330 (1866), in obs.;

Drypetes australasica (Mill.Arg.) Pax

& K.Hoffm. in Engl., Pflanzenr. 15: 270

(1922); Drypetes lasiogyna var.

australasica (Mull.Arg.) Airy Shaw, Kew

Bull. 35: 628 (1980). Type: Queensland.

NortuH Kennepy District: Burdekin River,

F. Mueller (holo: G-DC n.v., fiche at BRI;

iso: K n.v., photo at BRD).

Drypetes affinis Pax & K.Hoffm. in Engler,

Pflanzenr. [V. 147XV (Heft 81): 271

(1922); D. lasiogyna subsp. affinis (Pax

& K.Hoffm.) P.S.Green, J. Arnold Arbor.

67: lil (1986); D. deplanchei subsp.

affinis (Pax & K.Hoffm.) P.S.Green, Kew

Bull. 45: 239 (1990). Type: Lord Howe

Island, ‘F.Mueller’ [C. Moore] (holo: B

n.v., destroyed).

Illustrations: Francis (1981: 220, 221);

Williams (1987: 111); Brock (1988: 144);

Floyd (1989: 145); Hauser (1992: 152),

Shrub or small tree to 12 m high, perennial,

dioecious, fleetingly deciduous. Bark patchy

grey and white, + flaky; blaze distinctly layered

and pale amber and yellowish; trunk sometimes

weakly fluted. Leaf-bearing stems up to 2 mm

diameter, + rounded, lenticellate, glabrous or

with sparse hairs. Stipules lanceolate-triangular,

0.4-0.5 mm long, 0.2—0.3 mm wide, glabrous or

with scattered to sparse hairs. Leaves

petiolate, discolorous, glabrous; petioles 2-7

(15) mm long, 0.4—1.5 mm wide, flattened and

usually channelled on top, with scattered hairs;

juvenile lamina toothed with up to 12 teeth per

480

side of midrib on margin, each tooth up to

$ mm long; mature lamina coriaceous, elliptic,

elliptic-lanceolate, ovate-elliptic, +orbicular or

oblong, 8—150 mm long, 6-60 mm wide; margins

entire or slightly sinuate, slightly revolute; tip

acute, rounded or obtuse; base cuneate, rounded

or truncate; midrib prominently raised below,

yellowish; venation comprising 9-12 lateral

veins per side of midrib and reticulate interlateral

tertiary veins; upper surface dark matt green,

with venation distinct but not prominent; lower

surface pale matt green, with venation prominent.

Male inflorescences rarely branched and up to

[5 mm long, comprising fascicles of 3-many

flowers; peduncle 3-4 mm long; bracts

lanceolate-triangular, 0.5—1 mm long, 0.2—0.4

mm wide, with scattered hats. Male flowers

2—3 mm long, 4—6 mm diameter; pedicels 5—8

mm long, 0.4—-0.5 mm diameter, glabrous or

with scattered hairs; sepals 4, imbricate,

orbicular-ovate, 2.5-4 mm long, 1.5—-3.5 mm

wide, glabrous or with scattered hairs externally;

stamens 6-10, with filaments 0.3—0.7 mm long,

c. 0.1mm diameter, glabrous; anthers oblong in

outline, 0.7-1.5 mm long, 0.5—-1 mm wide,

glabrous ot with an occasional hair; disk

cupuliform or irregularly lobed, 0.5—0.8 mm

long, glabrous or with occasional hair. Female

inflorescence up to 10 mm long, comprising

solitary flowers or with axis branching several

times; peduncle up to 5 mm long; bracts

lanceolate-triangular, 0.3—-0.7 mm long, 0.2—0.4

mm wide, with scattered hairs. Female flowers

2—-3.5 mm long, 4-6 mm diameter; pedicels

3-10 mm long, 0.5—0.6 mm diameter, with

scattered to sparse hairs; sepals 4, imbricate,

orbicular-ovate, cucullate, 2.2—-3.5 mm long,

1.5—2.5 mm wide, with scattered hairs externally;

disk cupuliform, 0.4—0.8 mm long, glabrous or

with scattered hairs; ovary 1.5—2.5 mm long,

[.5-2 mm diameter, glabrous or with dense

hairs; styles much reduced with stigmas

flabellate, adpressed to top of ovary, [—1.5 mm

long, entire. Fruit ellipsoid 10-25 mm long,

7-15 mm diameter, orange to red, glabrous.

Seedlings (cotyledon stage): cotyledon petioles

up to 1.5 mm long and 0.5 mm wide; lamina

ovate, 20-24 mm long, 17-19 mm wide with tip

rounded and base truncate to + cordate, 3-

nerved from base. Seedlings (three-leaf stage):

leaves petiolate; petioles 1.5—2 mm long, c. 1

mm wide; lamina ovate, strongly dentate, 22—34

Austrobaileya 4(4): 477-494 (1997)

mm long, 15-25 mm wide, with 6 or 7 lateral

veins; tip acute; base cuneate. Yellow Tulip.

Fig. 1.

Selected additional specimens examined: Western

Australia, Anjo Peninsula, Sharp Point, 13°56’S, 126°32’E,

May 1984, Forbes 2263 (MEL, PERTH); SE coast of

Osborne Island, Admiralty Gulf, 14°23’S, 125°57’E, Apr

1991, Willing 320 (PERTH); Naturalist Island in Prince

Frederick Harbour, W of entrance to Hunter River, W.

Kimberley coast, 15°02’S, 125°21’E, May 1987, Kenneally

9911 (PERTH, QRS). Northern Territory, Casuarina

Beach, near Darwin, 12°21’S, 130°53’E, Nov 1989, Forster

5932 (BRI, DNA); Channel Point, 13°09’S, 130°07’E, Nov

[990, Russell-Smith 8361 & Petherick (BRI,CANB, DNA,

MEL); Mt Ranken, Walker River, 13°35’S, 135°35’E, Nov

1987, Russell-Smith 4293 & Lucas (BRI, DNA); 2kmN of

mouth of Emerald River, Groote Eylandt, 14°03’S, 136°25’E,

Mar 1988, Russell-Smith 5095 & Lucas (BRI, DNA); 55

km N of Ngukurr, 14°14’S, 134°43’E, Nov 1987, Russell-

Smith 4209 & Lucas (BRI, DNA). Queensland. Coox

District: Weipa area, 12°40’S, 141°50’E, Jan 1990, O'Reilly

572. (BRI, QRS). NortH Kennepy Districr: Daydream

Island, near Molle Island, 20°15’S, 148°S1’E, Apr 1990,

Batianoff 12272 (BRI). Sours Kennepy District: Shaw

Island, 20°29’S, 149°09°E, Nov 1985, Batianoff 3204

(BRI). LercHHArpT District: Lake Elphinstone, 21°33’S,

148°13°E, Nov 1987, Champion 314 (BRI). Port Curtis

District: Moores Creek, 23°20’S, 150°35’E, Oct 1976,

Hyland RFK4336 (BRI, QRS). Burnett Districr: Coalstoun

Lakes N.P., 25°35’S, £51°54’E, Mar 1991, Forster 7831

(BRI, K, L, MEL, QRS). Wipe Bay District: Stony Creek,

4km E of Didcot, 25°29’S, [51°54’E, Oct 1990, Forster

7523 (BRI, K, L, MEL, QRS); Fairlies Knob, 10 km

NNE of Brooweena, 25°30’S, 152°12’E, Dec 1990,

Forster 7679 (BRI, K, L, MEL, MO, PERTH, QRS, SAR);

MtGlastonbury, S.F, 242 Glastonbury, 26°14’S, 152°27’E,

Dec 1991, Forster 9283 & Sharpe (BRI, K, L, MEL, QRS).

Moreton District: World’s End Pocket, N of Ipswich,

27°31'S, 152°5’E, Sep 1985, Bird [AQ398854] (BRI,

CANB, MEL); Mt Blaine, 25 km S of Ipswich, 27°47’S,

152°48’E, Apr 1993, Bird [AQ566755] (BRI). New South

Wales. Wilson Park, Lismore, 28°49’S, 153°16’E, Jul

1981, Harden & Williams 81292 (BRI, NSW).

Distribution and habitat: Drypetes deplanchei

is widespread in northern Western Australia,

the Northern Territory and eastern Queensland,

with a few records from north-east New South

Wales (Map 1). The species also occurs in New

Caledonia, southern New Guinea and Lord Howe

Island. Plants are usually encountered in

microphyll and notophyll vine thickets and vine

forests of various types (especially hoop-pine

rainforest, softwood scrub, beach scrubs), but

may also occur in sheltered gullies in open

forest or woodland.

The species is bird dispersed (Floyd 1989;

Innis 1989; Russell-Smith & Lee 1992) with

Saiipisaie se rane aL eeE CELE TON Eonar PED E Ar Le Car ERS ere PELE UIE ORE FART rr EE ROR CERES Pica PoE OPCCEE CLIT PTTL EEL OI CE EIR PAT COPE REECE EPOELE TSE PPrOET EEE RPC PRET mC eRe er

Forster, Drypetes 481

ipo.

‘

Bes uF

at ‘

* on ae:

ahs a ay ¥ “a!

* &

+ fe 4

‘ .

Sa ¥5 rity

Stet

aan eee water

' pbpeetly, of. whee ©

at arett ‘ “é

* whe f

SS Se

+¥

ie 3

a at

-— qi

Tle 3?

wh: “3

1 -

‘ =

Fig. 1. Drypetes deplanchei, A, fruiting twig x 0.5, B & C. adultleaves x 0,75. D. juvenile leaf x 0.75. E. male inflorescence

x 3.5. F. male flower x 7. G, stamen x 14. H. female flower x 7. I. lateral view of fruit x 1.7. J. apical view of fruit x

1.7. A,C from Russell-Smith 5109 & Lucas (BRD; B from Forster 3247 (BRD; D from Harden & Williams 81292 (BRD;

E-G from Forster 12140 (BRI); H from Forster 7679 (BRI); I-J from Forster 7831(BRI). Del. W. Smith.

482

a oe

115 120 125 130

SREESZ enn — tT

CEREEECE RECT EEE ERR poe

Zz gust ne esane BAT

EEE Nis

CO -FEe nas

cE Ee tt

Austrobaileya 4(4): 477-494 (1997)

Ta}

weeny

4A TTT

HH SeeR TT

135 140 145 150 155

Map 1. Distribution of Drypetes in Australia, A D. deplanchei,

Torres Strait Pigeons known to feed on it at

Weipa (label data of O’Reilly 572) and Emerald

Doves, Topknot Pigeons and Wompoo Fruit-

Doves in New South Wales (Floyd 1989), This

apparent vagility is reflected by its ubiquity

throughout its known range. A good example

of this 1s its presence in 91.8% of 232 localities

of vine forest in south- east Queensland (Forster

et al. 1991).

Notes: This plant has a chequered and

potentially confusing nomenclatural history,

excerbated in recent times by renaming and

transfers (Airy Shaw 1980b; Green 1986, 1990,

1994), Peter Green proposed an infraspecific

classification for the species, with one

subspecies (as D. deplanchei subsp. affinis in

his 1994 account) restricted to Lord Howe

Island and the other (as D. deplanchei subsp.

deplanchei) in Australia, New Caledonia

and New Guinea. These subspecies were

distinguished only by fruit size, being 10-14

mm long in D. deplanchet subsp. deplanchei

and 20-25 mm long in D. deplanchei subsp.

affinis. Green’s decisions were based on a

restricted set of collections (mainly those at K)

and his distinctions disappear when a much

larger set of collections is examined. Although

there appears to be continuous variation in fruit

size, there are nevertheless some general trends

based on a geographic basis that can be

determined. Collections from Lord Howe Island,

the Northern Territory and Western Australia

tend to have large fruits (>15 mm long).

Collections from north-east New South Wales

and eastern Queensland tend to have small fruits

(< 15 mm long). There are however, many and

several notable exceptions to these trends, e.g.

Bird {|AQ566755] (BRI) from south-east

Queensland has fruit over 20 mm long and wide.

It is probable that fruit size in D. deplanchei is

determined to some extent by environmental

variables and, if used alone as a distinguishing

character state, appears to be of dubious value in

the recognition of infraspecific variants.

The presence of only pubescent ovaries in

collections from the Northern Territory and

Western Australia as opposed to only glabrous

ovaries from eastern Australia and Lord Howe

Forster, Drypetes

Island appears to be consistent. However, there

are few collections of female matertal from the

Northern Territory and Western Australia, and

more are required before taxonomic decisions

can be made on this character state variation. As

seedlings appear to be useful in providing

diagnostic characters in Drypetes, future workers

may wish to pursue this apparent discontinuity

from biosystematic or other approaches. For the

time being, therefore, a single variable taxon,

D. deplanchet, is recognised throughout the

species’ range.

Uses: The timber of this species was used for

printer’s engraving blocks and for turning or

carving (Francis 1981) and is suitable for joinery

and flooring (Floyd 1989). Young stems were

used for stockwhip handles (Floyd 1989).

Phenology: The main flowering period for this

species is August to December, although there

are occasional records for the rest of the year.

Plants tend to be at least partially deciduous for

a short period of time following spring/early

summer storms and flower on older wood that

is producing a flush of new foliage. Fruiting

occurs throughout the year.

Conservation status: Drypetes deplanchei is

widespread and common throughout its range.

Itis present in thirty-nine conservation reserves

in south-east Queensland alone (Korster et al.

1991).

Ethnobotanical use: No uses have been

recorded for D. deplanchei in the literature,

although the species is known as ‘Masal’ on

Dauan Island and ‘Ak’ on Yorke Island in

Torres Strait (label data of Lawrie [AQ004004

& AQ003935]).

2. Drypetes acuminata P.I.Forst., sp. nov.

affinis D. deplanchei (Brongn. & Gris)

Merr. a qua lamina foli maturt

oblanceolata apice acuminato, floribus

masculinis pedicello breviore (3.2-4.5 mm

vice 5-8 mm longo) et disco in lobos

parvos multum reducto differt. Typus:

Queensland. NorTH KENNEDY DISTRICT:

Koolmoon Creek near Tully Falls [male

plant], Oct 1953, K./. White [AQ410313]

(holo: BRI [2 sheets]; iso: K, MEL, QRS

distribuend1).

483

| Drypetes lastogyna var. australasica auct.

non (Miull.Arg.) Airy Shaw; Airy Shaw

(1981: 627 [pertaining to Volck 4386]);

Hyland & Whiffin (1993 [pertaining to

Gray 2939]).}

Illustration: Christophel & Hyland (1993:

103a [as D. lastogyna var. australasica]).

Tree to 12 m high, dioecious, evergreen, Bark

light brown, with irregular shallow, rounded

flakes; blaze distinctly layered, cream and

yellow-brown; trunk fluted. Leaf-bearing stems

up to 3 mm diameter, +rounded, with scattered

hairs but soon glabrescent. Stipules lanceolate-

triangular, O0.5—0.6 mm long, 0.2—0.3 mm wide,

with sparse hairs. Leaves petiolate, discolorous,

glabrous; petioles 5~8 mm long, c. 1 mm wide,

channelled on top, glabrous or with scattered

hairs; juvenile lamina entire; mature lamina

coriaceous, oblanceolate, 37-120 mm long,

13-50 mm wide; margins slightly sinuate, weakly

revolute; tip acute, short to long acuminate;

base rounded or truncate, often unequal; midrib

prominently raised below, yellowish; venation

comprising 7—12 lateral veins per side of midrib

and reticulate interlateral tertiary veins; upper

surface dark matt green, venation indistinct;

lower surface pale matt green, with venation

distinct but not prominent. Male inflorescences

up to 13 mm long, comprising fascicles of 5-

many flowers, borne on older wood, with axis

simple or rarely branched; peduncle up to 2mm

long; bracts lanceolate-triangular, 0.5—-0.6 mm

long, 0.2—0.4 mm wide, with sparse hairs. Male

flowers 2,5—3 mm long, 3.5—4 mm diameter;

pedicels 3.24.5 mm long, c. 0.2 mm diameter,

with scattered hairs; sepals 4, imbricate,

orbicular-ovate, 2.5-3 mm long, 2—2.5 mm

wide, glabrous or with scattered hairs externally;

stamens 6—9, with filaments 0.3—0.6 mm long,

c. 0.1 mm diameter, glabrous; anthers oblongin

outline, 1.2-1.5 mm long, 0.8-1.3 mm wide,

glabrous; disk much reduced to small lobes, c.

0.5 mm long, glabrous. Female inflorescence of

solitary flowers; peduncles obsolete; bracts not

seen. Female flowers not seen; pedicels 9-18

mm long, 0.4—1 mm diameter, glabrous or with

scattered hairs; ovary 2-locular, 3.54 mm long,

c. 3 mm diameter, with dense antrorse yellow

hairs; styles much reduced, with stigmas

flabellate, adpressed to top of ovary, c. 1.5 mm

A484

long, entire. Fruit obloid-ovoid, 21—22 mm

long, 9-11 mm diameter, red. Seedlings

(cotyledon stage): cotyledons with petioles up

to 2 mm long and 0.5 mm wide; lamina ovate,

37-30 mm long, 20-24 mm wide, with tip acute

and base rounded, 3-nerved from base. Seedlings

(three-leaf stage): leaves petiolate; petioles c. 4

mm long and | mm wide; lamina lanceolate-

ovate, dentate, 54-70 mm long, 21-28 mm

wide, with 8 or 9 lateral veins, with tip

acuminate and base cuneate. Fig. 2.

Additional specimens examined: Queensland. Cook

District: Leichhardt L.A., 12.5 km along Mt Lewis road,

16°35’S, 145° £6’ E, Jul 1994, Forster 15622 et al. (BRD;

S.F.R. 194 (R263), 17°15’S, 145°25’E, Oct 1963, Hyland

RFK484 (QRS); ditto, Nov 1963, Hyland RFK626 (QRS);

ditto, Sep 1969, Hyland RFK2410 (QRS); S.F.R. [94

Western, Compartment 59, E.P. 36, [7°19S, 145°26’E,

Aug (977, Unwin 477 (QRS); E.P. 43, S.F.R. (94, [7°19’S,

145°26°E, May 1979, Sanderson 1602 (QRS); R.194

Western, SW of Atherton, 17°20’S, 145°25’E, s.dat., Voalck

4386 (BRI); S.F_R. 194, East Barron, E.P. 38, 17°25’S,

145°29°E, Dec 1977, Unwin 523 (QRS), Nort KENNEDY

Districr: S.F.R,756, 17°40’S, 145°40’E, Nov 1963, Hyland

RFK540 (QRS); S.F.R. 605, Dawson L.A., 17°59’S,

145°37’E, Jan 1983, Gray 2939 (QRS); Koolmoon Creek,

c. 1] miles SSE of Ravenshoe, Sep 1950, Snuth 4690A

115

a — ft.

mT A

‘

—!

Austrobaileya 4(4): 477-494 (1997)

(BRI); Kirrama Range, between Soctety Flat & Yuccabine

Creek, Aug 1947, Sinith 3230 & Webb (BRD; N slope of MI

Thorn, S.F. 461, Meunga L..A., 23.1 km W of Cardwell,

18°l6’S, [45°17°E, Oct 1988, Jessup et al, GIM2253

(BRI); Mt Spec forestry camp, Nov 1933, Francis

[AQ387275] (BRI); Mt Spec, Paluma Range, Oct 1965,

Birch [AQ202313] (BRD; Mt Spec, 18°55’S, 146°12’E, Jul

1968, Hyland RFK1573 (QRS); Cloudy Creek, Mt Spec

N.P., 19°00’S, [46° 13°E, Mar 1988, Fell 677 (BRI);

Benham’s Lookout, MtSpec N.P., Paluma Range, 19°00’S,

146°13’E, Dec 1993, Forster 14309 (BRI, QRS).

Distribution and habitat: Drypetes acuminata

is restricted to the “Wet Tropics’ of north-east

Queensland between Mt Lewis in the north to

Paluma Range in the south (Map 2). Plants

grow on ridges or along creek banks in simple

notophyll evergreen vine forest on granite at

altitudes between 600 and [000 m.

Notes: Drypetes acuminata was firstrecognised

as being specifically distinct by L.S. Smith who

also made the first fertile collections of the

species. Smith’s material and the K./. White

collection remained unnamed at BRI. Airy Shaw

determined several sterile specimens of this

plant as D. australasica (now a synonym of

ae alee

i 4

coco}

SUUSERERBEES

Map 2. Distribution of Drypefes in Australia. A D. vernicosa, ¥ D. acuminata.

485

Forster, Drypetes

f SGbR deletes ean sesaaeed ated

in he

a *

in, ‘n a,

Oe ig ee te

“he * ial ee a

We ee hy

es ot oe ee i

me “a. wo ht ey

i hee Mig oe

“3 heal ne een

eo, i ii sal a ne

™

~ . mgr

-_ _

is - Cal

tao a all -—

" il Fay = “ il wee

oF ule y teat Trees el Ff

’

i a)

opel a all al to ”

7) ee yt el

ke ak at

- Par cs

pat pe

1 pa ty ey

Peek ae ee exe

a r Le Ae aa

+ ae hee may 4,4 hl * Pi

ph ee wee

yeh pe ae er ee oe

OP en iy al

. Are Fad * a?

ee ee ag

itx 2, AC,G

I—-H from Winter s.n.

fru

D-F from White [AQ410313] (BRD

ie leaf x i. C. adult leaf x 1, D. male inflorescence x 4.

. juveni

og ae

: A ia Ll ee ae

a “> wt ee >

. Lt whe pe +

0.5. B

ig x

ting tw

B from Forster 14309 (BRI)

‘,

Tai, a

+ oe

fa, A. fr

E. male flower x 8. F. stamen x 16, G. female flower x 4. H. basal view of fruit x 2. I. lateral view of

q7a *

aan

CUHUAG

. Ul

+4 Fp tyt

Fea

watt

[AQ387275] (BRD

(BRI). Del. W. Smith,

GHCIS

~ *

eek py Pre hy ot teh eet >

Fig. 2, Drypetes a

from Fi

AS6

D. vernicosa.

D. acuminata

Character

lanceolate-ftriangular

0.5—-0.6x0.2—0.3 mm

stipules

upper leat surface dark matt-green

leaf lamina shape oblanceolate

leaf lamina tip acuminate

male floral bracts lanceolate-triangular

0.5-0.6x 0.2—-0.4 mm

male flower pedicel

length (nm) 3,2-4.5

male flower sepals 2.9—-3X 2-2.5

lengthx width (mm)

male flower disk

juvenile leaves dentate

D. deplanchei) and even mentioned the Volck

collection as being the first record of this

species from the Atherton Tableland. Hyland

& Whiffin’s (1993) account for D. lasiogyna

var. australasica pertains to D. acuminata.

A comparison of diagnostic character

states for D. acuminata, D. deplanchei

and D. vernicosa 1s made in Table 1.

D. acuminata differs most noticeably from

D. deplanchei in the leaf lamina being

oblanceolate with an acuminate tip and the male

flowers with longer pedicels and the disk much

reduced.

Conservation status: Drypetes acuminata has

rarely been collected, and its distribution and

abundance in the field remains to be accurately

determined. It is present in a number of State

Forests and National Parks and is not thought to

‘e rare or threatened.

reduced to small lobes

Austrobaileya 4(4): 477-494 (1997)

Table 1. Comparison of diagnostic character states for Drypetes acuminata, D, deplanchei and

D. deplanchei

lanceolate-triangular

0.4—0.5x0.2—0.3 mm

dark matt-green

elliptic, elliptic-

lanceolate, elliptic-

ovate, orbicular,

or oblong

acute, rounded or

obtuse

lanceolate-triangular

0.5—Ix 0.2—0.4 mm

5—8

2.39-4& 1.5-3.5

cupuliform or

irregularly lobed

strongly dentate

D. vernicosa

linear-lanceolate

0.5—0.9x0.2—0.3 mm

varnished glossy-

green

oblong, ovate-

elliptic, or

orbicular

acute or

rounded

linear-lanceolate

1.2—1.5x 0.2—0.3

1.53.8

1.5-2.5x 1.4-—2

reduced to

irregular lobes

strongly dentate

Etymology: ‘The specific epithet is derived

from Latin acuminatus and refers to the

distinctly acuminate leaf tips of this species.

3. Drypetes vernicosa P.I.Forst., sp. nov.

affinis D. deplanchei (Brongn. & Gris)

Merr. a qua foliis adaxialiter nitidi-

vernicosis, stipulis et bracteis

lineari-lanceolatis, floribus masculinis

pedicello breviore (1.5—3.8 mm vice 5-8

mm longo), sepalis brevioribus (1.5—2.5

mm vice 2.5-4 mm longis) et disco

multum reducto differt. Typus:

Queensland, Cook District: 3.5 km NNE

of Massy Creek Crossing, Silver Plains,

13°53’S, 143°31’E, [male plant], 15 Jul

1993, P.L. Forster 13615, G.Sankowsky

& M.C.Tucker (holo: BRI [2 sheets +

spirit]; iso: QRS).

487

petes

HKorster, Dry

aia

Pe at ee a =“! ™ ,

AN all De CRED rr fics (5

* - :

Shard es a

o . IB} Le er |

hy Ns

te ‘ae

"e .

=. urea

tear *

Soa:

” »

* rs * ate)

+, ST te a “a ite Ar v4

ep pee ee EE ey h

oy * Fe

a * » * re

a ’

"sy 4,

reg ¥

wit

tye

and

2 e+

‘ae

: +

ts =

Fite

aon

% uke ]

4 tt the

EE,

eee ee eee cece ee eee eee eee rere eke eee eee riitite et i ee ee ee ee ee ee ee Le ee ee ee ce a . PETS

tx 2.5, A-B, E-G from Forster PIF13615 (BRD;

H-I from Webb & Tracey 9718 (BRI). Del. W. Smith.

f fru

icgW O

;

D from Forster PIF8982 (BRD

.apica

Fig. 3. Drypetes vernicosa, A, flowering male twig x 1. B-D, adult leaves x 1.5, E. male inflorescence x 5. F. male flower

x 10, G. stamen x 20. H. lateral view of fruit x 2.5. I

C from Tracey 14445 (BRI)

a a i

488

Subshrub or shrub to 4 m high, perennial,

dioecious, evergreen. Bark white, nondescript;

blaze distinctly layered and pale pink and

yellowish; trunk often rather crooked. Leaf-

bearing stems up to 3 mm diameter, + rounded,

with scattered to sparse hairs. Stipules linear-

lanceolate, 0.5—0.9 mm long, 0.2—0.3 mm wide,

with sparse hairs. Leaves petiolate, discolorous;

petioles [1-5 mm long, 0.5-1 mm wide,

channelled on top, with scattered hatrs; juvenile

lamina toothed; mature lamina coriaceous,

oblong, ovate-elliptic or +orbicular, 25~85 mm

long, 8-40 mm wide; margins entire or strongly

toothed with 4—9 teeth per side of midrib with

each tooth 1-5 mm long and spine-tipped, weakly

revolute; tip acute, rounded; base cuneate,

rounded, + equal; midrib prominently raised

below, yellowish; venation comprising 7—10

lateral veins per side of midrib and reticulate

interlateral tertiary veins; upper surface dark

glossy green, with venation distinct but not

prominent; lower surface pale matt green, with

venation prominent. Male inflorescences much

reduced, comprising fascicles of 1-3 flowers

from old wood; peduncle up to | mm long;

bracts linear-lanceolate, 1.2-1.5 mm long,

Q,2—0.3 mm wide, with sparse hairs. Male flowers

2—3 mm long, 3-4 mm diameter; pedicels 1.5—3.8

mm long, 0.2—0.5 mm diameter, with scattered

to sparse hairs; sepals 4 (or rarely 5), imbricate,

orbicular, 1.5— 2.5 mm long, 1.4-2 mm wide,

with scattered hairs externally; stamens 6, with

filaments 0.5—0.7 mm long, c. 0.1 mm diameter,

with scattered hairs; anthers oblong in outline,

0.5—I mm long, 0.3-0.5 mm wide, glabrous;

disk much reduced to irregular lobes to 0.4 mm

long, with scattered to sparse hairs. Female

inflorescence and flowers not seen. Fruit

globose-ovoid, [0-15 mm long, 10-12 mm

diameter, orange to red, glabrous. Seedlings

(cotyledon stage): cotyledons + sessile; lamina

narrow-ovate, 17-19 mm long, 13—16mm wide,

with tip rounded and base + truncate, 5-nerved

from base. Seedlings (three-leaf stage): leaves

petiolate; petioles 2-3 mm long, c. 0.5 mm

wide; lamina narrow- ovate, strongly dentate,

17-33 mm long, [0-23 mm wide, with 5 or 6

lateral veins, with tip acute and base truncate.

Fig. 3.

Additional speciinens examined: Queensland, Cook

District: 1.5 km from Captain Billy Landing, 11°37’S,

142°50’E, Jun 1994, Forster 15368 (BRI, MEL, QRS);

Austrobaileya 4(4): 477-494 (1997)

2km S of Captain Billy Landing, 11°39’S, 142°51’E, Oct

1993, Fell 3800 et al. (BRD; North of Olive River near

mouth, 12°07’S, £43°0S’E, Sep 1974, Tracey 14473" (BRD;

N bank of Pascoe River c. | km inland from river mouth,

12°30’°S, 143°15°E, Nov 1977, Tracey 1440L’ (BRI); 3 km

NW of Bolt Head, Temple Bay, 12°14’S, 143°04’E, Jul

1991, Forster 8962° (BRD; 4.5 km WSW of the Nesbit

River mouth, Silver Plains, 13°33’S, 143°32’E, Aug 1993,

Feil 3445 et al. (BRI); Near lake to the east of Double Hill,

13°45°S, 143°30°E, Sep 1973, Dockrill 722 (BRI, QRS);

Silver Plains, south of Scrubby Creek & west of Colmer

Point, 13°46’S, 143°29’E, Jun 1995, Forster 17044 (BRI,

DNA, MEL, NSW, QRS); 5 miles [8 km] N of crossing on

Massy Creek on road between Silver Plains Station &

Rocky River, 13°50’S, 143°29°E, Oct 1969, Webb &

Tracey 9718 (BRD; 4 km NNE of Massy Creek Crossing,

Silver Plains Station, 13°53’ S, 143°30’E, Jun 1992, Forster

[0572 et al. (BRI, QRS); 3 km NNE of Massy Creek

Crossing, Silver Plains, [3°53’S, 143°31’E, Jul 1993, Forster

13607 et al. (BRI, QRS); Between Massy Creek & Rocky

River, 13°55’S, 143°30’°E, Sep 1971, Hyland 5492 (BRI,

ORS); Starcke - Cape Flattery road, 15°04’S, 145°17’E, Jul

1976, Tracey 14445 (BRI); Abor. Res. 1, between McIvor

River & Cape Flattery, 15°05’S, 145°15°E, Nov 1972,

Hyland 6498 (BRI, QRS); road to Cape Flattery, c. 0.5 km

W of beach, {5°07’S, 145°13’ E, Jun 1992, Le Cussan 108

(QRS); 0.5 km W of the beach on the track from the McIvor

River to Starcke Station, 15°07’S, 14S5°14’E, Aug 1984,

Clarkson 5472 (BRI, MEL, NSW, QRS); 0.5 km from the

beach on the track from Starcke Station to the mouth of the

Mclvor River, [5°07’S, 145°14’E, Feb 1984, Clarkson

5195 (BRI).

Distribution and habitat: Drypetes vernicosa

is endemic to eastern Cape York Peninsula from

near Captain Billy Landing tn the north to Cape

Flattery in the south (Map 2). Plants grow in

semi-evergreen microphyll vine thickets on fine

white sand with a thin layer of organically

stained topsoil at altitudes between 20 and 70m.

Notes: Drypetes vernicosa was first collected

by Len Webb & Jeff Tracey in their pioneering

study of the rainforests of eastern Australia;

however, this and subsequent collections have

usually been identified as D. deplanchei or one

of its synonyms. The species is distinctive in its

small shrubby stature, varnished upper leaf

surfaces, linear-lanceolate stipules and bracts,

and the male flowers with short pedicels and

sepals (Table 1). Most collections are also

distinctive in the well developed marginal teeth

on adult leaf laminas, although those collections

marked * have entire leaf laminas and some

(e.g. Forster 8962) have leaf laminas that are +

orbicular in shape. Unlike D. deplanchei, the

species most likely to be confused with

D. vernicosa, flowers of this species are borne

on old growth without shedding of the foliage.

Forster, Drypetes

Conservation status: Drypetes vernicosa 1s

restricted in its occurrence and is sympatric

with several other locally endemic species. At

the Silver Plains locality these endemics include

Croton stockeri (Airy Shaw) Airy Shaw and

Syzygium argyropedicum B.Hyland. At Bolt

Head and the Nesbit River mouth these

include Xanthostemon youngii C.T.White &

W.D.Francis and S. argyropedicum. At present

D. vernicosa, although restricted in its

occurrence, is not rare or endangered.

Etymology: The specific name is derived from

Latin vernicosus (varnished) and alludes to the

varnished appearance of the upper leaf lamina

surface.

4, Drypetes iodoformis L.S.Sm. ex P.L.Forst.,

sp. nov. affinis D. subcubicae (J.J.Sm.)

Pax & K.Hoffm. a qua floribus femineis

singulis in quaque axilla, disco glabro,

stylis bifidis lineari-flabellatis, ovario

ovoideo, et fructu ellipsoidei-ovoideo

differt. Typus: Queensland. Cook

District: State Forest Reserve 607, West

Logging Area, 17°00’S, 145°40’E, 11 Dec

1974, B.Hyland 7901 (holo: QRS; 1so:

BRI, CANB).

Drypetes sp. (=AFO/780; Hyland 1971: 64).

| Drypetes subcubica auct. non VJ.J.Sm.) Pax

& K.Hoffm.; Airy Shaw (1976: 365,

1980a: 78, 1980b: 628); Hyland & Whiffin

(1993: 281)]

Illustration: Christophel & Hyland (1993:

103b fas D. subcubica)).

Tree to 20 m high, dioecious, evergreen. Bark

grey, corky with whitish lenticels; blaze distinctly

layered, greenish and yellowish, with a distinct

‘1odiform’ scent; trunks «straight. Leaf-bearing

stems up to3 mm diameter, + rounded, glabrous,

sometimes with a zig-zag appearance. Stipules

lanceolate-triangular, c. | mm long and 0.5 mm

wide, glabrous. Leaves petiolate, discolorous,

glabrous; petioles 3-6 mm long, !—1.5 mm wide,

channelled on top, sometimes twisted | or2 times,

with scattered hairs; juvenile lamina entire; mature

lamina coriaceous, elliptic, lanceolate, ovate,

40-170 mm long, 15-70 mm wide; margins

entire, slightly revolute; tip acute to short

acuminate; base cuneate; midrib prominently

489

raised above & below, yellowish; venation

comprising 7—9 lateral veins per side of midrib

and reticulate interlateral tertiary veins; upper

surface dark glossy green, venation indistinct;

lower surface pale matt green, venation

prominent. Male inflorescences up to 1 mm

long, comprising fascicles of I|—3 flowers;

peduncles up to | mm long; bracts lanceolate-

triangular, 0.9-1.2 mm long, 0.5—0.6 mm wide,

glabrous. Male flowers 2-4 mm long, 4-8 mm

diameter; pedicels 1.5—2 mm long, 0.5—0.7 mm

diameter, glabrous; sepals 4, imbricate,

orbicular-ovate, 2.5—3.2 mm long, 1.8—-3.2 mm

wide, with scattered hairs externally; stamens 6,

with filaments 1-2 mm long, 0.1-0.2 mm

diameter, glabrous; anthers oblong in outline,

1-1.7 mm long, 0.6-1.3 mm wide, glabrous;

disk of numerous irregular oblong to subulate

processes, 1-1.5 mm long, glabrous. Female

inflorescence of solitary flowers; peduncle

obsolete; bracts lanceolate-triangular, 1-2 mm

long, 0.5—0.7 mm wide, with sparse hairs. Female

flowers 3-4 mm long, 5—8 mm diameter; pedicels

3—4 mm long, 0.8—1 mm diameter, with sparse

hairs; sepals 4, imbricate, orbicular-ovate, 3-4

mm long, 2.3-4 mm wide, with scattered hairs

externally; disk cupuliform, 0.5-1 mm long,

glabrous; ovary 2-celled, 2~2.5 mm long, | .7—2.2

mm diameter, with dense silver hairs; styles

much reduced; stigmas 2, linear-flabellate,

adpressed to top of ovary, 0.8-1.5 mm long,

bifid for + entire length. Fruit ellipsoid-ovoid,

20-25 mm long, 12-15 mm diameter, orange to

red, glabrous. Seedlings (cotyledon stage):

cotyledons with petioles 1.5—3 mm long, 05-1

mm wide; lamina narrow-ovate, 42—52 mm

long, 24-30 mm wide, with tip acute and base

truncate to + cordate, 3-nerved from base.

Seedlings (three-leaf stage): leaves petiolate;

petioles c. 3 mm long and 2 mm wide; lamina

lanceolate-elliptic, crenate, 50-110 mm long,

17-32 mm wide, with 7-9 lateral veins; tip long

acuminate; base attenuate. Fig. 4.

Selected additional specimens examined: Queensland,

Cook District: T.R. 176 Monkhouse, Lorna Doona L.A.,

15°48’S, 145°17’E, Feb 1983, Hyland 12601, 12604 (BRI,

ORS); Mt Finnegan, 15°49’S, 145°18’E, Aug 1972, Tracey

14771 (BRI; Gold Hill, near Chima Camp between

McDowall Range & Bloomfield, 16°03’S, 145°12’E, Jul

1973, Tracey 14801 (BRD; Mt Hemmant, just N of Noah

Creek in Cape Tribulation area, 16°06’S, 145°26’E, Jul

1973, Webb & Tracey 11706(BRI); V.C.L. Noah, 16°10°S,

145°25’E, Jun 1975, Irvine 1454 (BRI, CANB, QRS);

Turpentine road, Little Cooper Creek, 16°10’S, 145°25’E,

Nov 1989, Jessup et al, GJD2818 (BRI); Forest Reserve

477-494 (1997)

Austrobaileya 4(4)

490

—==

Sate

awit

he al

af rt a

fs wha tard fe ‘ rf Fee

at Ty an a

rea"

thr 4 a

éf | shal RC fa

a nie Ft aa! nA : at

Pet Ch ninn SP ait wn : ve

a +

escalate + |e Viet SS

Matty ‘ k a ye ta .

a a eee ek pete "

cht ae 4 vat f ari : Ve 4

La ea +t t . “hy

ae ttle ry Py ‘4 + “ 4 ya k 1

Rye ft oe * ak, ’ ae ni , :

** ‘ , Rt +, we h

wre : ‘ esl |: IG: He, Ht

Wa . ‘

tie Fe Ri _ ‘3 te La

hl t a4 * : ae e

Pia 1 , *] a s “ed 4 ;

wa lf LY in) Ho va, ‘

ae yt ts Doane :

+e ‘ ‘ a taf ' " 4

wh oh vet

ve » fale eth :

ae : ; um se \ “a i, + gt ¥

a“ wa bee ‘ etebed ph ee

‘ a oy pee a hetegte ; ;

ms at ‘te t any tytag! he

hoa, aerate Marri cn 1 $4 bo:

iy + «4 4 its ' 4 ait i #

SIS T0101:

wee ve +4 As ee a ae ni :

a a at el fey \ a,ai sat ‘e, *

f fruit x 2, A-B from Hyland 12604

G-H from Hyland 7901 (BRI). Del. W. Smith.

ICW O

f fruit x 2. H. lateral v

iew o

. apica

F from Jessup 2818 (BRI)

Fig. 4, Drypetes iodoformis, A. flowering male twig x 0.5. B. adult leaf x 0.7, C. male inflorescence x 4, D. male flower

x 5. E. stamen x10. F female flower x5. G

C-E from Hyland 12601 (BRD

(BRD

PTET? CrccLiie br eee ira cdttre cia rdnncd ty byte CF or LUCE Sweet F CRE St ey ECE EU st eRe Aree ree ee eee te

Forster, Drypetes

1073, c. 10 miles [16.7 km] N of Cairns, Jan 1961, Dansie

1994(BRD; T.R. 315, N of Kuranda, Aug 1954, White 780

(BRD; ditto, Aug 1954, Smith 5314 (BRD; Kuranda area,

Jan 1961, Dansie 1788 (BRI); ditto, Apr 1955, Voick 1109

(BRI); S.F.R. 607 West L.A., 17°00’S, 145°40’E, Dec

1974, Hyland 7902 (BRI, CANB, QRS); S.F.R. 607, Bridle

L.A., 17°00’S, 145°40°E, Dec 1974, Hyland 7897 (BRI,

CANB, QRS).

Distribution and habitat: Drypetes todoformis

is endemic in the ‘Wet Tropics’ region of north-

east Queensland with a small number of

populations from near Mt Finnegan in the north

to near Kuranda in the south (Map 3). Plants

grow as Canopy trees in mesophyll or notophyll

vine forest on metamorphic or granite substrates.

Notes: Hyland (1971) first mentioned

D. iodoformis as D. sp. AFO/780. The late

L.S.Smith annotated a number of specimens at

BRI as ‘D. todiformis L.S.sm. sp. nov.’ and left

a manuscript description but his work was never

published. Airy Shaw (1976, 1980a, 198Qb)

considered that this Australian taxon was a

highly disjunct occurrence of D. subcubica

(J.J.sm.) Pax & K.Hoffm.

D. subcubica occurs in Java and the Lesser

Sunda Islands in Malesia. Airy Shaw (198Qa)

considered the specimen van Royen 3551 from

491

Batanta Island, Irian Jaya (New Guinea) to be

D. subcubica and his record of the species for

the New Guinea flora appears to be based on

this. The BRI duplicate of this collection differs

from typical D, subcubica in the greater number

of stamens (12 as opposed to 6) and appears to

be a more robust plant with broader elliptic

leaves, The record of D. subcubica from New

Guinea is therefore discounted.

The Australian plant is superficially

similar, but differs in a number of significant

ways from typical D. subcubica (Table 2) and

is described here as a new species. I have taken

up Smith’s unpublished name, as the 1odoform

scent (iodine) in the cut bark is distinctive,

having been noted by many collectors, and is

useful as a diagnostic character (Hyland &

Whiffin 1993),

Airy Shaw never lectotypified

D. subcubica, and although there are duplicates

of some of the syntypes at K, the majority are at

BO and were not seen by him as he never visited

that institution (A. Kostermans, pers. comm.

1992). D. subcubica 1s lectotypified at the end

of this paper.

Table 2. Comparison of Drypetes subcubica and D. todoformis.

Character D. subcubica

Female flowers 2—4 per axil

Female floral disk densely hairy

D.iodoformis

I per axil

glabrous

Stigmas entire, flabellate bifid, linear-flabellate

Ovary cubic-globose ovoid

Fruit cubic-globose, with 4 ellipsoid-ovoid

marked longitudinal!

grooves

Conservation status: Drypetes iodoformis 1s a

rarely collected plant, but one that is probably

not endangered or threatened. It 1s present in

National Parks at Cape Tribulation (Noah

Creek), Mt Hemmant and Mt Finnegan.

without marked

longitudinal grooves

Etymology: The specific epithet refers to the

‘iodiform’ (iodine) scent to the wood when it is

cut.

492

Specimens of uncertain status: There may be

an additional unnamed taxon of Drypeftes that is

endemic to Cape York Peninsula. As yet no

fertile material has been collected to ascertain

this.

Drypetes sp.

Specimens examined: Queensland. Coox DIstTRICctT:

Lockerbie Scrub, 10°45’S, 142°32’E, Jun 1994, Forster

15297 & Tucker (BRI); Tron Range airstrip, 12°40’S,

143°20’°B, Nov 1974, Robinson [AQ202297] (BRD; Ham

Hill, Iron Range, 12°43’S, 143°18’E, Jul 1993, Forster

13589 et al. (BRD; Iron Range N.P.#8, 1.3 km NE of Mt

Tozer, 12°44’S, 143°13’E, May 1994, Fel] DGF4081 etal.

(BRI); Chester River, Silver Plains, 13°41’S, 143°28’E, Jul

1993, Forster 13640 et al. (BRI); 31 km along road to Leo

Creek Mine, Mcliwraith Range, 13°42’S, 143°19’E, Jun

1995, Forster 16819 (BRD; MclIlwraith Range, NE of

Coen, 1962, Webb & Tracey 7362 (BRD; Rocky River on

eastern foothills of Mcllwraith Range, 13°47’S, 143° 25’E,

Oct 1969, Webb & Trucey 9392 (BRD); Goanna Creek, E of

Mcll wraith Range, Nov 1956, Webb 3151 (BRI).

Distribution and habitat: Known from Cape

Y ork and the McIl wraith and Iron Ranges where

it grows in evergreen notophyll vine forest.

Austrobatleya 4(4): 477-494 (1997)

Notes: These sterile collections may represent

a further undescribed species of Drypetes.

They are most similar to D. acuminata but are

markedly geographically disjunct from that

species and occur in vine forests with a different

structure and floristic composition. Material

of this taxon was first collected by Webb and

Tracey who also had doubts as to its

conspecificity with typical D. deplanchei. Airy

Shaw determined some BRI sheets of these

collections as D, australasica, butundoubtedly

failed to appreciate the ecological differences

between the habitat of each taxon.

Lectotypification of Cyclostemon subcubicus

Drypetes subcubica (J.J.sm.) Pax &

K.Hoftm, tn Engl., Pflanzenr. 15 : 250

(1922); Cyclostemon subcubicus J.J.Sm.

in Koord. & Valet., Meded. Dep. Landb.

10: 216 (1910). Type: Java. 12 Sep

1896, Koorders 25289 (ecto [here

designated]: K n.y., photo at BRI;

isolecto: BO).

= — in A Oe et | ee es ee a os ee fF

Sanenauaesucuenets tt scnece7annsecsesaee

CCE eee San

CE ---CeECe ST

CCCP et eet GS # ga

CCCP eR Ran =En

CCCP CC set yt =

CCCEAARC EC EEET ECCS H

CECE CREE EERE EEE

CCS Cee Pr x

CAREC ere won

EEE ee ENT

ACCOR ECE EE HEE

CECE CECE HART

CCEE eC Bway

CECE CECE TTY

PCE Zeng >

COTE CCE Ee im

SCE CEE ECE CEE Fe

CEE ECC aie

COREE ETS San

CNC Cee PR Fy

CHEE -EEE CECE Pr iy

CCR eC as a

CURA PECE Teg ang

ane ERREDE EE UEREVSRERS weaae ag

CCE -EEECEC CE BY

COCCI ECC eRe

COCR E CREE 4 Th

CCEEEEEECECCE CECE rr th

@ FECL EEE MEH «

eeeeee SHSGRESEEERSSOREE

eCEEEEEEE EEE HH aenan

ECE EEE EHH RPT

1i5 120 125 130

i ssl ale etd

Map 3. Distribution of Drypefes in Australia, & D. iodoformis.

Forster, Drypetes

Additional specimens examined: Java: 29 Aug

1889, Koorders 2145 (lectopara: BO); [5 Mar

1892, Koorders 2140 (lectopara: BO); May

1892, Koorders 2148 (lectopara: BO); 27 Oct

1896, Koorders 26179 (lectopara: BO); 18 Mar

1900, Koorders 37987 (lectopara: BO).

Notes: Smith (1910) cited six syntypes in the

protologue of Cyclostemon subcubicus. The

best of these is undoubtedly a fruiting specimen

(Koorders 25289) demonstrating the distinctive

cubic nature of the fruit. This collection is

present at both K and BO, and the specimen at

the former is here selected as lectotype of the

name.

Acknowledgements

The illustrations were prepared by W.Smith

(BRI. This work benefitted from assistance

with field collection of specimens over the

years, notably by L.H.Bird, P.D.Bostock,

D.G.Fell, G.Kenning, D, & ILiddle, G. & N.

Sankowsky, P.R.Sharpe, G.Smyrell and M.C.

Tucker. The diagnoses were translated into

Latin by L.A.Craven (CANB), Comments on a

draft of the manuscript were provided by

A.R.Bean (BRI). The Directors/Curators of the

cited herbaria allowed access fo collections in

their care, either in situ or on loan. D.Liddle

assisted with the visit to BO. B.Hyland and staff

at QRS provided facilities for drying specimens

over the years. Permits to collect and traverse in

State Forests and Timber Reserves were issued

by the Queensland Forest Service, Queensland

Department of Primary Industries, This work

was funded by ABRS as a preferred objective

research project during 1992-1995. Additional

funds for fieldwork in the ‘Wet Tropics’ was

provided by a grant from the Wet Tropics

Management Authority during 1993-1994 for

work on ‘Endangered Euphorbiaceae of the

Wet Tropics’.

References

Airy SHAW, H.K. (1976). New or noteworthy Australian

Euphorbiaceae, Kew Bulletin 31: 341-398.

-—— (1980a). The Euphorbiaceae of New Guinea. Kew

Bulletin Additional Series VIII, London: Royal

Botanic Gardens, Kew.

493

-—~- (1980b). A partial synopsis of the Euphorbiaceae -

Platylobeae of Australia (excluding Phyllanthus,

Euphorbia and Calycopeplus). Kew Bulletin 35:

577-700.

BAILEY, F,M. (1902). Euphorbiaceae. In Queensland Flora

5: 392-1457. London: L, Reeve & Co.

Bar.ow, B.A, & HyLanp, B.P.M. (1988). The origins of the

flora of Australia’s wet tropics. Proceedings of the

Ecological Society of Australia 15: 1-17.

BENTHAM, G. (1873). Euphorbiaceae. In Flora Australiensis

6: 41-153. London: L. Reeve & Co.

Brock, J, (1988). Top End Native Plants. Darwin: J. Brock.

CHRISTOPHEL, D.C, & HyYLAND, B.P.M. (1993). Leaf Atlas of

Australian Tropical Rain Forest Trees. Melbourne:

CSIRO Publications.

FLoyp, A.G. (1989), Rainforest Trees of Mainland South-

eastern Australia. Melbourne & Sydney: Inkata

Press.

Forster, P.I., Bostock, P.D., Birp, L.H. & BEAN, A.R.

(1991). Vineforest Plant Atlas for South-east

Queensland. Queensland Herbarium: Brisbane.

Francis, W.D, (1981). Australian Rain-forest Trees. (4th.

Ed.) Canberra: Australian Government Publishing

Service,

GREEN, P.S. (1986). Notes relating to the floras of Norfolk

and Lord Howe Islands, HW. Journal of the Arnold

Arboretum 67: LO9— 122.

— (i990). Notes relating to the floras of Norfolk and Lord

Howe Islands, II. Kew Bulletin 45: 235~255,

—— (1994), Euphorbiaceae. Flora of Australia 49: 227-

238,

HAuseR, J, (1992), Fragments of Green. Bardon (Brisbane):

Rainforest Conservation Society Inc.

Hewson, H. (1988). Plant Indumentum. A Handbook of

Terminology. Australian Flora & Fauna Series No.

9, Canberra: Australian Government Publishing

Service.

HYLAND, B.P.M, (1971). A key to the common Rainforest

Trees between Townsville and Cooktown, based on

leaf and bark features, Brisbane: Dept. of Forestry.

HYLAND, B.P.M. & WuiFFIN, T, (1993). Australian Tropical

Rain Forest Trees - An Interactive Identification

System. Melbourne: CSIRO Publications.

Innis, G.J, (1989). Feeding ecology of fruit pigeons in

subtropical rainforests of south-eastern Queensland.

Australian Wildlife Research 16: 365-394.

494

McPuerson, G. (1991). Drypetes Vahl. In Euphorbiaceae

~ Phyllanthoideae. Flore de la Nouvelle-Calédonie

et Depéndances 17: 12-14. Paris: Muséum National

d’ Histoire Naturelle.

MUELLER, J, (1866). Euphorbiaceae, In A.L.L.P. de Candolle

(ed.), Prodromus Systematis Naturalis Regni

Vegetabilis 15¢2): 189-1260. Paris: Masson.

RADCLIFFE-SMITH, A, (1987). Flora of Tropical East Africa.

Euphorbiaceae (Part 1). Rotterdam/Boston: A.A.

Balkema.

RUSSELL-SMITH, J. & Lee, A.H. (1992), Plant populations

and monsoon rain forest in the Northern Territory,

Australia. Biotropica 24: 471-487,

SMITH, J.J. (1910). In Bijdrage No. 12 tot de Kennis der

Boomsoorten op Java door Dr. S.H. Koorders en Dr,

Th, Valeton, J.J. Smith elab. Mededeclingen

Uitgaande van het Departement van Landbouw No.

10.

Austrobaileya 4(4); 477-494 (1997)

VAHL, M. (1807). Eclogae Americanae. Copenhagen: N.

Miiller.

Wess, LJ. (1978). A general classification of Australian

rainforests. Australian Plants 9: 349-363.

Wess, LJ. & Tracey, J.G, (1981). Australian rainforests:

pattern and change. In A. Keast (ed.), Ecological

Biogeography of Australia. pp. 605-694. The Hague:

W. Junk.

Wesster, G.L. (1994). Synopsis of the genera and

suprageneric taxa of Euphorbiaceae. Annals of the

Missouri Botanical Garden 81: 33-144,

WILLIAMS, K.A.W. (1987). Native Plants of Queensland,

Vol. 3. Ipswich: K.A.W. Williams.

Notes on Tiliaceae in Australia, 3: A revision of the genus

Triumfetta L.

D.A.Halford

Abstract

Halford, D.A. Notes on Tiliaceae in Australia, 3; A revision of the genus Triumfetta L. Austrobaileya 4(4):

495-587 (1997). The genus Triumfetta is revised for Australia. A generic description based on Australian

material is given. Sixty one species are recognised as occurring in Australia including three introduced

species, Forty species are described as new and one variety (Triumfetta micracantha var. albida Domin)

is raised to specific rank. Lectotypes are selected for 7. bradshawii F. Muell., T. denticulataR.Br. ex Benth.,

T. glaucescens R.Br. ex Benth,, T. micracantha F.Muell, and T. triandra Sprague & Hutch. All species are

described and illustrated and information on their habitat and distribution is provided. A key to identify the

species is also provided.

Keywords: Tiliaceae, Triumfetta, Triumfetta micracantha var. albida, Triumfetta bradshawii, Triumfetta

denticulata, Triumfetta glaucescens, Triumfetta micracantha, Triumfetta triandra.

D.A.Halford, Queensland Herbarium, Meiers Road, Indooroopilly Queensland 4068, Australia

Introduction

The genus Triumfetta L. is distributed throughout

the tropical and subtropical regions of the world

and contains, on current estimates, between 100

(Mabberley 1989) and 160 species (DuPuy &

Telford 1993). The last major comprehensive

treatment of the genus was by de Candolle (1824),

Since then, Sprague and Hutchinson (1909a) and

Lay (1950) have provided important regional

treatments of the genus in Africa and America

respectively. For a discussion on the generic

history I refer the reader to Lay (1950).

In Australia, the first collections of

Triumfetta were made by Robert Brownin northern

Australia when he accompanied Flinders on his

circumnavigation of Australia in 1801-1805.

However, the first 77iumfetta species based on

Australian material was not described until 1856

when Mueller published 7. plumigera (Mueller

1856). Another two species (7. appendiculata

and 7. micracantha) were described later by

Mueller (1862) in his “Fragmenta Phytographiae

Australiae’. Bentham (1863) recognised seven

species in Australia including the above three

endemic species, three other endemic species

(T. parviflora, T. glaucescens and T, denticulata)

Accepted for publication 14 June 1996

based on Brown’s earlier collections and the

more widespread 7. procumbens G.Forst. Mueller

(1879, 1885, 1892) continued to describe additional

species as more material became available

from northern Australia. Since Mueller, other

authors Bailey, (1899); Sprague & Hutchinson,

(1909b); Fitzgerald, (1918); Domin, (1927)

have described even more new taxa based on

Australian material,

Hnatiuk (1990) listed eighteen Triumfetta

species for Australia. Rye (1992) estimated that

there were some thirty five species of this genus in

Western Australia including some twenty two

undescribed species in the Kimberley region. In

the present paper, sixty-one species of Triumfetta

are recognised in Australia. There are still several

species and species-groups that require further

study in order to clarify taxa. Particular attention

should be given to 7) parviflora, T. micracantha,

the T. appenadiculata-T, propingqua-T. chaetocarpa

group, and the 7. ryeae-T. simulans-T. brevi-

aculeata group.

Materials and methods

This revision is based on the examination of

herbarium specimens in AD, BM, BRI, CANB,

DNA, K, MEL, NSW and PERTH together with

field work in Queensland, Northern Territory and

the Kimberley Region of Western Australia.

496

Flowering and fruiting times recorded here are

based solely on information from herbartum

specimens, Unless otherwise stated, all specimens

cited in this paper have been seen by the author.

Where a list of duplicates has been noted on the

label of herbarium species these have been noted

here. Those that have not been seen by the author

have ‘n.v.’ after the Herbarium acronym.

Discussion of some morphological characters

The following notes relate solely to the Austrahan

Triumfetta species referred toin this paper. Flower

and fruit characters have several readily observed

features and have been drawn upon as a source of

characters for identification.

Habitand life form. Allnative species are perennial

subshrubs or shrubs. The most common life

form is an open spreading shrub up to 1.5 m tall

(eg. T. appendiculata, T. chaetocarpa and

T. arnhemica). However, some species are

prostrate creepers with stems up to 2 m long (eg.

T. repens, T. prostrata, and T, procumbens). Most

species exhibit a single life form. However,

T. pannosa has two life forms, a procumbent form

which commonly occurs on coastal sand dunes

and an erect form that usually occurs on alluvial

soils along river terraces. The introduced species,

T. rhomboidea has annual and perennial shrub

forms and 7. pentandra 1s an annual shrub,

Indumentum. In all species the vegetative parts,

peduncles, pedicels and the abaxial surface of the

sepals are sparsely to densely covered with an

indumentum. The indumentum is frequently two-

layered. The two layers consist of hairs of differing

sizes and texture. This 1s particularly evident on

the stems and leaf surfaces of a number of species

(eg. T. longipedunculata, T. arnhemica and

T. ryeae). However, in some species (eg. 7. nutans

and 7. appendiculata) the layers grade into one

another. Stellate hairs are the principal hatr-type

encountered and comprise the majority of hair

coverings. However, a diversity of hair types are

present from minute simple glandular hairs to

stellate hairs. 7

The indumentum on the fruit bodies is less

variable than that on the vegetative parts. The fruit

bodies of most species are covered with an

indumentum of stellate hairs. Notable exceptions

tothisareT. pilosa, T. procumbens, T. leptacantha,

Austrobaileya 4(4): 495-587 (1997)

T. longipedunculata and T. pustulata which have

glabrous fruit bodies.

The prickles or bristles on the fruit are

mostly partially or completely covered with an

indumentum. Although, a few species do have

glabrous prickles or bristles (eg. T. repens and

7. cladara). The most frequent hair-types present

include nonglandular simple unicellular hairs,

bifid and stellate hairs.

Hatr-types

Stellate hairs: There is a wide range of forms of the

basic multiangulate stellate hair. They differ by

the number, rigidity, length and orientation ofrays

and whether they are sessile, on multicellular

stalks or on raised tuberculate bases.

The term “brfid hairs’ is used in the present

paper to refer to 2-rayed stellate hairs. Stellate

hairs with very short appressed rays that are fused

together for most of the length are referred to as

‘scale-like stellate hairs’.

Simple hairs: Non-glandular and glandular

simple hairs are found in Triumfetta. Simple

unicellular non-glandular hairs are common on

the fruit prickles or bristles of many species (eg.

T. pilosa, T. plumigera and T. ramosa). They are

also present on the stems (eg. 7. bradshawii) and

leaves (eg. 7. rhomboidea) of some species.

Minute glandular hairs are found on young

buds and shoots, and on the fruit prickles or

bristles of a few species.

There is considerable intra- and inter

specific variation in the indumentum on the

vegetative part, although hair-type on vegetative

parts sometimes offers good primary characters

for certain specites-groups. For example, 7.

bradshawit and the closely related species (T.

longipedunculata, T. pustulata and T. cladara)

have stellate hairs on the stems with tuberculate

bases and erect to ascending rays up to 5 mm long.

The hair-type on emergences can also be useful in

distinguishing between a number of species (eg.

7. deserticola and T. chaetocarpa).

Leaves. All leaves are petiolate. The petioles are

circular tn cross section and vary in length from 2

to 90 mm long. Petiole characters have not been

utilised for species identification in this study. In

Halford, Australian Tiltaceae, 3

most species the leaves are entire or shallowly 3-

or 5-palmatifid. However, there are a number of

notable exceptions. The leaves of 7. repens and

T. procumbens are mostly deeply 3-palmatifid,

whilst those of T. trisecta are mostly deeply 3-

palmatisect. T. mitchellii has the upper leaves

entire and the lower leaves deeply 3-palmatifid.

The overall lamina outline is variable and may be

ovate, obovate, oblong, elliptic or orbicular. ‘This

character is useful in varying degrees in

identification.

Leaf venation is actinodromous. The mid-

vein is the most strongly developed but | or 2

additional pairs of veins radiate from the lamina

base, This character is of no use in distinguishing

between the species.

Stipules. In general the stipules of Triumfetta

species are similar in size and shape. No diagnostic

use has been made of them in this study

Inflorescence. The standard inflorescence unit in

Triumfetta consists of afew-flowered, umbel-like

cymule. The cymules are usually borne at the

nodes and are either axillary, lateral or leaf-

opposed. Thenotable exceptiontothisis 7. repens

which sometimes has terminal cymules. In the

simplest inflorescences the cymules are solitary

and usually leaf-opposed. In the more complex

inflorescences there are two or more cymules at

each node. In many species the reduction of

subtending leaves produce terminal and axillary

spicate or paniculate inflorescences. Inflorescence

characters have not been utilised for species

identification in this study.

Flowers. All Australian species have bisexual

flowers, except for T. deserticola which has

unisexual flowers borne on separate plants. The

staminate flowers possess a rudimentary

gynoecium, while carpellate flowers possess

stamens with rudimentary anthers.

The flowers have never been noted as having

any floral scent.

Calyx. The calyx is composed of five free sepals

that are valvate in bud. The sepals are relatively

constant in shape, but vary in size and degree of

persistence after anthesis, The length ofthe sepals

varies considerably between species. The extremes

of sepal length are Wlustrated by 7. kenneallyi in

497

which sepal length ranges between 2.5-5.0 mm,

while those of 7. bradshawit are 20-25 mm long.

Since the range in sepal length in most species

overlaps, size alone is of limited use for species

identification.

In most species the sepals fall off soon after

anthesis but those of T. marsuptata, T. saccata, T.

nutans, T. hapala and T. bradshawii persist and

enclose the base of the mature fruit.

A distinctive feature of the sepals of

Triumfetta 1s the more or less conspicuous

appendage on the abaxial surface. The orientation,

position of attachment on the sepal, shape and to

a lesser extent the size of these appendages are

useful diagnostic characters. In orientation, they

range from erect (eg. 7. clementii), spreading (eg.

T. micracantha) to reflexed or recurved (eg. T.

reflexa). In most cases the appendages are attached

near the apex of the sepals. However, in T.

marsuptata, T. hapala and T. saccata they are

attached approximately halfway along the sepals.

The appendages are variously subulate, linear,

ovate, obovate, obtriangular or triangular in

outline. In most cases, the appendages are

relatively simple flat structures, but in T.

marsuptata, T. saccata and T. hapala they have

developed into relatively large pouch-like

structures. This feature clearly distinguishes these

species from all other Triumfetta species in

Australia. In general, the appendage margins are

entire for the full length of the appendage or entire

towards the base and erose, toothed or deeply

lobed towards the apex.

Corolla. The corolla is composed of five free

alternisepalous petals that are imbricate in bud. In

general, most species possess petals, but some

species may be apetalous (eg. 7. albida, T. centralis

and 7. longipedunculata). The petals consist of a

short claw and usually a well developed yellow to

orange-yellow lamina.

The petal laminae are glabrous and vary in

shape from linear-obovate through narrowly.

obovate, obovate, broadly obovate to orbicular

and are usually four or more times longer than the

claw. However, there is a tendency in anumber of

species (eg. T. breviaculeata) to have very

rudimentary petal laminas which are linear or

triangular in outline and are approximately the

same length as the claw.

498

The claws are usually hairy on the margins,

on the abaxial surface and sometimes have a

transverse band of hatrs on the adaxtal surface.

In the majority of species, the petals (if

present) at anthesis spread horizontally fully

exposing the stamens and pistil to pollinators.

However, in 7. marsupiata and T. hapala the

petals remain tightly wrapped around the stamens

and pistil at anthesis, with only the stigma lobes

protruding above the petals. This variation may

indicate differences in the pollination mechanisms.

Androgynophore. The androgynophore consists

of ashort stalk bearing five antepetalous glands

on its surface and a membranous extrastamtinal

disc at its apex. All Triumfetta species in

Australia except T. pentandra have a well

developed androgynophore, In 7. pentandra

the androgynophore is very short and not

easily observed. The five glands on the

androgynophore exhibit minor variation in shape

and size. The extrastaminal disc is ciliolate,

ciliate or tomentose on the margin.

Androecium. The stamens are free, mostly the

same colour as the petals and arranged in one to

several rows. The number of stamens in each

flower varies considerably between species. The

majority of species have 30 or more stamens per

flower. A number of species have less than 30

(eg.7. rhomboidea (10-15), T. pentandra (S), T.

triandra (3-6), T. plumigera (9-12) and

T. mitchellti (20-25)). The number of stamens

is useful in distinguishing between some species

(eg. T. pentandra and T. rhomboidea).

| The filaments are glabrous or hairy near the

base. This character was consistent within most

species. T. denticulata and T. ryeae were the only

two species to have both character states.

The filaments are mostly terete, although

some are dorsiventrally compressed near the base

(eg. 7. aguila and T. antrorsa).

The anthers lack any characters of diagnostic

value.

Ovary. The ovary is usually globular in shape and

densely covered with either slightly curved, rigid,

or straight, pliable hairs. It is 2-5 locular, with an

axile placenta bearing 2 collateral ovules in each

locule.

Austrobaileya 4(4): 495-587 (1997)

Fruits. The fruits are especially important for

identification to species. All species have

indehiscent fruits, except for 7. pilosa which has

loculicidally dehiscent fruits. Seeds in indehiscent

fruits are released through the decay of the fruiting

body.

The number of cells per fruitmay beconstant

or vary within a limited range for any given

species. The number of cells per fruit usually

corresponds to the number of locules in the ovary

(ie, 2~5), However, some species appear 6- to 10-

celled (eg. T. bradshawii) through the development

of a false vertical partition between the collateral

seeds. The fruits of 7. plumigera, T. triandra,

1. coronata, T. parvifloraand T. hapalaare always

1-celled and 1-seeded, although the ovaries are 3-

celled.

The fruits of most species range in shape

from ovoid to globose, while those of T. fissurata

are globose-obloid. Fruit size ranges from 2—50

mm diameter, with T: parviflorahaving the smallest

fruits (2-4 mm diameter) and 7. echinata and

7. tenuiseta having the largest (30-50 mm

diameter). All fruit measurements include the

emergences unless otherwise specified.

Triumfetta fruits are usually equipped with

a covering of epidermal emergences. After

fertilisation of the ovary, the emergences develop

from the pericarp at the base of the hairs on the

ovary. The terms ‘prickle’ and ‘bristle’ have been

used here to refer to the emergences on the fruit.

The terms as used in this paper are defined as:

Prickle: A strong, rigid and somewhat ligneous

emergence,

Bristle: A weak, flexible and non-ligneous

emergence.

‘The type of emergence is constant for a particular

species. The majority of species have aculeate

fruit. T. plumigera, T. coronata, T. triandra, T.

hapala, T. ramosa,T. tenuisetaandT. bradshawiti

have bristles on the fruit. Prickles or bristles are

absent on the fruit of 7. pustulata and T. inermis.

The fruit of 7. inermis lacks any emergence

development, whilst 7. pustulatahas hemispherical

structures on the fruit.

The orientation, length, shape, distribution

and the density of the emergences is reasonably

Halford, Australian Tiliaceae, 3

constant for each species and are useful in

identification. Fruit emergences in most species

are erect, butin 7. arnhemicaand T. antrorsathey

are more or less obliquely ascending or somewhat

appressed. Those of T. nutans maybe erect or

appressed. The length of the emergences range in

size from c. 0.5 mm long in T. denticulata to

15-25 mm long in T. tenuiseta. Bristles are terete

or filiform in shape, whilst the prickles are mostly

subterete or terete. ‘The prickles of 7. reflexa,

T. monstrosa, T. incana, T. carteri, T. clivorum,

T. antrorsa and T. breviaculeata are distinctly

thickened at the base and are described here as

being more orless conical, whilethoseofT. pilosa,

T. repens, and T. procumbens are subterete and

buttressed at the base.

Subgeneric Classification

The most recent subgeneric classification is that

of Sprague and Hutchinson (1909a). They divided

499

the genus into foursections based oncharacteristics

of the inflorescences, fruits, the nature of the

emergences on the fruits, and some characters

derived from the flowers (Table 1). The majority

of Australian species belong to the section Lappula

but 7. repens and T. procumbens belong to the

section Propa and T. plumigera, T. triandra,

T. coronata, T. ramosa,T. hapalaand T. tenuiseta

belong to the section Lasiothrix.

Since Sprague and Hutchinson proposed

their classification, there have been immense

advances in techniques for the study of

morphology, cytology, palaeontology and flower

ontogeny. A critical study of the subgeneric

classification of Triumfetta would be appropriate

in connection with acomplete review of the genus

worldwide.

Table 1. Major characteristics of the sections of 7rinmfetta from Sprague and Hutchinson (1909a),

? character states unknown.

Propa

Inflorescences 2-many cymes at the cymes solitary at

nodes, primary cyme __ the nodes, leaf-

leaf-opposed opposed

Iiowers

indumentum of calyx | scaly not scaly

no. of stamens

numerous 25-60

numerous, 25-60

ceils/ovary 10 6-10

ovules/cell I ‘|

Fruits

shape spheroid spheroid

texture woody woody

Emergences fusiform constricted at the

Distribution

base and the tip

Lastothrix

cymes solitary at the

nodes, leaf-opposed

sometimes terminal

not scaly

numerous, 20-50,

spheroid

not woody

weak, with plumose

tip

Lappula

many cymes at the

nodes, primary

cyme leaf-opposed

not scaly

numerous or few

rarely few

spheroid or ovoid

not woody

rigid, the tips rarely

plumose

The majority of Australian Triunifetta species (58

species) represent an autochthonous element of

the flora. These fall into two categories: endemic

species (56); and widely distributed Indo-Mayalan

species (T. repens and T. procumbens). The

remaining three species are recent introductions

(T. ptlosa, T. rhomboidea and T. pentandra).

500

The geographical distribution of Triumfetta in

Australia is shown in Map 1. The figures within

the one-degree squares are the number of

species recorded. The genus occurs throughout

northern Australia, extending from 29°S latitude

northwards, from the Pilbara in Western

Australia to the east coast of Queensland. The

highest concentration of species is centred in the

western Kimberley region of Western Australia.

Other centres of species richness occurin Arnhem

Land in the Northern Territory, the Pilbara,

Western Australia, Keep River-Victoria River

area in the Northern Territory and McArthur

River-Gregory River area on the Northern

128 i25 130

LIS

ee ; 1900 a a Ae ee ee ee ee ee ee r—j—4—fo ft fF | FFL

EEE REECE tte HACE

is 120 125 130

wee e Seeeeeeeene SeRRREEE im

CBEEEHEEETOCEEE EERE rr eH

135 140 145 150 155

Austrobatleya 4(4): 495-587 (1997)

Territory/Queensland border. There is a notable

absence of 7riumfettaspecies recorded from Cape

York Peninsula. This aberration does not relate to

low levels of collecting as considerable time and

effort have been put into vegetation surveys of

Cape York Peninsulain recent years (Neldner and

Clarkson. 1995),

The Triumfetta species on the east coast

from Cape York to northern New South Wales are

either recent introductions or indigenous species

that are widely distributed in the Indo-Malayan

region, whilst the majority of species in the north

and north-west Australia are endemic.

135 #40 145 [50 155

Map 1. Number of Triumfetta species in Australia within geographic 1° squares.

Taxonomy

Triumfetta L., Sp. pl. 444 (1753). Type: T.

lappula L.

Dertvation of name: after Giovanni Battista

Triumfetti (1658-1707), doctor of physics and

philosophy at Bononia, who wrote on the life of

plants.

Woody annuals or perennial subshrubs or

shrubs, Plants with an obvious indumentum of

mostly stellate hairs. Leaves alternate or spirally

arranged, petiolate, simple, 3 or 5 palmatifid or

palmatisect, serrate-crenate or dentate, frequently

with glands on basal teeth. Stipules small, caducous.

Inflorescences umbel-like cymules, axillary, leaf-

opposed or lateral, bracteate, shortly pedunculate,

Halford, Australian Tiliaceae, 3

often forming terminal interrupted spicate panicles

by reduction ofsubtending leaves. Flowers bisexual

rarely unisexual. Sepals 5, free, valvate, and each

with an abaxial appendage. Petals 5, sometimes

absent, imbricate, yellow or orange-yellow,

unguiculate; claw often hairy, never glandular.

Androgynophore present, rarely absent, bearing 5

antipetalous glands on its surface, sometimes

forming acontinuous glandular ring, extrastaminal

disc at its apex; disc membranous, entire or

shallowly lobed, with ciliate, ciliolate or tomentose

margins. Stamens (rarely 2-4) 5 to numerous

(30+), free, terete or dorsiventrally compressed

501

proximally, glabrous or sometimes proximally

hairy; anthers dorsifixed, longitudinally dehiscent.

Ovary setose or hiruste, 2— to 5-locular or falsely

up to 10-locular by intrusion of longitudinal false

septa; ovules 2 per loculus, collateral; style terete,

glabrous or hairy in proximal half; stigma minutely

toothed or 2—to 5-lobed. Fruit dry, indehiscent or

rarely loculicidally dehiscent capsule, 2— to 5-

celled, the cells usually 2 seeded, sometimes

falsely 4— to [0-celled, the cells 1 seeded or 1-

celled and | seeded by abortion, densely covered

with epidermal emergences or rarely without.

Key to species of Triumfetta in Australia

7, ~Dlaminal TEMG STAOOUS: 5 con yd EaealAd ea} Rew ee nea Ges A HAS Le RG be eS 2

Siaminal Blaments airy proxmmwgly” yo votes teace bance y bee kyr bine ped ee pees 45

2. Sepal appendages attached approximately halfway along sepal ............... 0.00.04 3

Sepal appendages attached near apex Of sepals )

3. Fruit densely covered with bristles; bristles 7-10 mm long, hirsute, terminated

by a single straight seta0.5—-1 mm long ....

Fruit densely covered with prickles; prickles 3-7 mm long, hirsutellous in

proximal two thirds, terminated by a single hooked seta 0.2 mm long.................. 4

4. Fruit [8-20 mm long, 16-20 mm diameter; prickles 5-7 mm long

iy Maple eAtnd att yOu Se daha tee 15. T. marsupiata

Fruit 10-12 mm long, 13-15 mm diameter; prickles 34 mm long

ae Lethe eh ate Basa aaa H ea etn ar Aa Bete eons eg haath Ps 25 OLE ay ty SPLIT Hoe pa 16. TI. saccata

5. Body of fruit and prickles glabrous or with minute glandular hairs 0.1 mm

lone; ‘stellate hairs NEVer Present b....5-4dqsq Slatin car a dotse te prencgee wt mayo arena ghia annie gabe dow Sees 6

Body of fruit and/or prickles with stellate or simple hairs. .... 0.0.0.0. cece eee 8

6. Prickles on fruit< 1.5 mmlong............

»: * BF FF &® © © 8 8 #& 8 & FF HF FF £ FF £ £ HF #F

Prickles on irl 2m ION. cw 3 Skd este als cee bentyl ede ob MR) SEH. gtd ated Ree fs

7. Stems ascending to erect; leaves entire with lamina ovate to very broadly

ovate; sepal appendages 2~3 mm long, stellate-hairy ............... . 26. T, leptacantha

Stems procumbent or trailing; leaves mostly 3- or 5-lobed with lamina |

orbicular-ovate; sepal appendages up to | mm long, glabrous............... 8. 1. repens

8. Bristles or prickles on fruit<4mmlong.................... sete tice) Ss avin ee Keon 9

Bristles or prickles on fruit< 4mm long or absent... 0... 0... cece eee eee teens 18

9, Stems procumbent or trailing ............

Stems ascending or erect, rarely decumbent. .

10. Fruit densely covered with bristles ........

Fruit densely covered with prickles. .......

s f+ #8 #@ © © @ #@ 8 &© © 8 © € © © 8 8 8 &£ © 8 @ &§ 8 SF #8 TF 8 © BB # £ HF HF 10

milly se Mi ne ee ans 9 hel a BRE e in dA, 11

LEE Regan Fel et oo: tece Moko AED yp eh All AE Bell 13

502 Austrobaileya 4(4): 495-587 (1997)

11. Leaves narrowly obovate or oblong-elliptic; sepals 4-6 mm long; fruit 1-

Geliéd, LQ=65 miiiicHanmicter xx 2.0e 5 lei SE EN Wo By SA aR Ree Bee et 4, T. plumigera

Leaves ovate to very broadly ovate or orbicular; sepals 7-15 mm long; fruit

S-Ce led 20-30 min Granieter 0: x ous pee eee pee ee a ot Ae eo PE OE 12

{2. Fruit 30-50 mm diameter; bristles on fruit 15-25 mm long................ 19, T. tenuiseta

Fruit 20—30 mm diameter; bristles on fruit5-12 mmlong.................. 18. ‘T. ramosa

13. Leaves acuminate at apex; sepal appendages subulate, < 1.0 mm long, erect;

ful deliscetit, SIADLOUS o6 ayo 0s 5 ae 2 6 cero ek aad heared ed nd ee 1. T. pilosa

Leaves obtuse to rounded at apex; sepals appendages depressed obtriangular

broadly obovate, ovate, 0.5-6.0 mm long or if linear then > 1.5 mm long,

spreading to erect; fruit indehiscent, densely hairy. ........ 00.00 cece eee eee ees 14

14. Prickles glabrous or with a few stellate hairs at base ................. 25. T. winneckeana

Prickles densely hairy for at least half their length... 0... 0.0.0.0... ccc ee eee ean 15

15, Leaves velvety to the touch; prickles on fruit 3-4 mm long; sepal appendages

Dee ULES vce ideas fcege oe 8 PF nea Seve hs: 98 Ak PT Eley egw poe Eafe 3 20. I. appendiculata

Leaves felt-like to the touch; prickles on fruit 4-20 mm long; sepal appendages

Pen TERED TRS > otis eraten ie iewernis x eee Specs tw ver se Preesca a aacecds Casket fe Bam e tee sat Behe ye EE, desteas! we oe

16. Fruit 30-50 mm diameter; prickles 10-20 mm long ................0000. 24. T. echinata

Fruit 10-25 mm diameter; prickles 4-1lOmm long .... 0... . cc ee ees 17

17. Sepal appendages 3-6 mm Jong narrowly ovate to broadly ovate or broadly

obovate, spreading to slightly recurved,......... 0.0... cc eee e ee eee 21. I’. propinqua

Sepal appendages up to 2 mm long, narrowly ovate to ovate, erect to

SPMCACHIG 1. 6 oa bce hols eet acetal a wad ae ho aryl a's Gla ase ne nee bp AGS 22. U. chaetocarpa

18. Bristles or prickles present on fruit, at least some terminated by 2 or more

NOGKEC OF SIWAIPNESBIBES hn bcs“ tat edeee inn acti b lk sce pb gs ect deol deny acatdl eH: Mancddveret aedoars 19

Prickles or bristles absent or if present never terminated by more than a single

HOOKS OF SIPAIONE SEES 5. cyt Soe ti, ip Sie eR WE SSG bee dove dd Hagens lel ate & OA ® Sea Glnle anh 22

19, Stamens 10 per flower; fruit6-15 mm diameter... 0.0... ee 24)

Stamens 3 to 8 per flower; fruit2—5 mm diameter .... 0.0... ee eee 21

20, Stems procumbent; leaves ovate to broadly ovate; stamens > 20; fruit ovoid-

globose, 10-13 mm diameter, densely prickly; prickles 2-3 mm long,

coarsely stellate-hatry on proximal half... 0.0.0.0... 0.0 c cee ees 14. T. litticola

Stems erect or ascending; leaves narrowly elliptic or narrowly obovate to

obovate; stamens 10-15; fruit globose, 7-10 mm diameter, with a sparse

covering of prickles; prickles 1.0-2.5 mm long, glabrous or with a few

minute simple and stellate hairs on proximal half................ 31, IT. maconochieana

21. Fruit ellipsoid-globose, circular in transverse section, c. 2 mm diameter;

bristles arranged in 2 rows at the fruit apex... 0... 2... cee eee ees 6. T. coronata

Fruit ellipsoidal, trigonal in transverse section, 3-4 mm diameter; bristles

arranged in longitudinal rows on angles... 0... 0.00.0 cee cee ee eens 5. I’. triandra

22. sepal appendaces recurved or Terlexed jc cece nce end a Woea cg ag el ea ag he Dasa se aseedl a os 23

Sepal appendages spreading or erect........ Takiaa dosnt lal al beg Latent eA rs ated nets lenanm Meee 29

TET RT CR tren Ree CREO E EELS CE), EO ERTS TN EA eri et Me Sn a

Halford, Australian Tiliaceae, 3 503

2 Se SS (ERIS OL OREO CINE ona urd fe dets nner he, das} Ligeea earn stale eranodec, aokn Gd Geticd Menge Lo Go eth Sng myn Wine 24

SSlStaS ASCENT LO ELE CE tenn es ahg ke enemas th og x area Dev ee eR a Rl dewee ek a8 Sw bees a A eR 25

24. Leaves ovate to broadly ovate; fruit globose, 8-12 mm diameter; prickles

SILOS Ee Secs, erect scag, ves Spee on 3 chy anind Behe, wedea goat a! wpkueen Pov ead mtd Keres. 13. T. prostrata

Leaves narrowly oblong to oblong-ovate; fruit ovoid to ovoid-globose,

5—7 mm diameter; prickles conoidal or hemispherical .................05. 9. T. reflexa

25. Prickles conoidal or hemispherical, c. 1 mm diameter, or 1f prickles absent

Sn E SC UAT BOSE risa gy oko ps, watersheds ooh de etd dane Poe htg atu ann bd Seema bene 26

Prickles always present, either evenly terete throughout or only slightly

Dreadenine Towards Te DASE. yas a6 yee otc ooh vee We + Etats, dwt Vere k) acs Sd ab ates OSE Pe 27

26. Fruit ovoid to ovoid-globose, 7-9 mm long, 5—/ mm diameter; leaves green,

narrowly oblong to oblong-ovate, 2—5 cm long, 0.4-1.2 em wide............ 9. 'T. reflexa

Fruit depressed globose, 4-6 mm long, 5—8 mm diameter; leaves greyish-

white, narrowly ovate, 5.0-9.5 cm long, 0.7-3.0 cm wide ............. 10. T. monstrosa

27. Fruit8—-12 mm diameter; prickles 1.5—2.5 mm long, covered on the proximal two

thirds with simple and stellate hairs 0.3-1.0 mm long................. 11. T. johnstonii

Fruit <7 mm diameter; prickles < 1 mm long, glabrous......... 0... 000 cece eee eee 28

28, Leaves oblong to obovate-oblong, 2-4 cm long, c. | cm wide; fruit globose-

obloid with distinct cleft atapex 2... eee eee 34, T. fissurata

Leaves narrowly ovate to ovate, 4-12 cm long, 2-6 cm wide; fruit ovoid-

globose, evenly rounded atapex 2... 0... cece eee eee eee eee 33. I’. cinerea

29. Stamens > 20 PIES O WEE eee scx we Aaa epeaecetor a ob pasta ede Skins ape eb ale, aed Set fla R Ses fob cen 30

Stamens < 17, usually 5—10 per flower ..... aise Maca po weg Via celeb ele: alle Te AL wid whe Aged body 38

30. Basal leaves deeply divided, 3-lobed; sepals 5—7 mm long; prickles on fruit

CTE TOITOS. cae Fath the ackh Poets lek | GRITS os asreP eth & 2 "el eda leith 408 ws 9) BF. ISAS Glew be DE 31

Leaves all simple or if shallowly 3- or 5-lobed then sepals 8-15 mm long and

DHICKIES Ot Delt I S222 OO oo car ne wep letecn et He poe eth ana ae daa dee Mes dana the i a bo 32

31. All leaves lobed; lobes linear to narrowly obovate, obtuse to rounded at apex; |

prickles on fruit LO-LSmmlong ... 0... 0... cece ees 39. T. trisecta

Only lower leaves lobed; lobes narrowly ovate, acute at apex; upper leaves

simple, narrowly ovate; prickles on fruit 0.5—1.5 mmlong.............. 38, T’. mitchellii

32. Fruit depressed globose, 2~7 mm diameter, black or dark reddish-brown,

glabrous or sparsely stellate-puberulous; prickles c. 0.5 mm long, glabrous

IS Oe aye Re teh epee mere era ge ed es pte De gigi en da pundin ts 56. T. denticulata

Fruit globose, ovoid or broadly ovoid, 6-20 mm diameter, light brown,

densely stellate-hairy; prickles 0.5—-4 mm long, hairy on proximal half................ 33

33, Leaves and stems densely stellate-villous, soft fo the touch; prickles on fruit

3—4 mm long, covered on proximal half with long, soft, stellate hairs... 20. T. appendiculata

Leaves and stems densely stellate-hispid, stellate-pubescent or stellate-

hirsute, usually harsh to the touch; prickles on fruit 0.5—3 mm long, covered

on proximal half with short stiff stellate or simple hairs .. 0... 0.0... cece ee eee 34

24) SPEUISPOCUMIDENL. © f.1% acd clan asnthhes Sa ar bles emer cd cpa eh Wie Popanart. & A Bie pete 14. T. litticola

SLOTS EEC HOR ASCENT > «91 veya: 4 spec tehaeay » vob cue baad bce le, erence a aca oa, 4 aoe alte acthal a aceon eS fs)

504 Austrobaileya 4(4): 495-587 (1997)

35. Sepal appendages spreading, up to 2 mm long and rounded to obtuse at

TEV Re cr at afew x Sah av eg al WK 's tg ake Waa Nd Sees Parade nl! SEEN OP el a Mg em CEU VARY aes ts eee Gg ae en 36

36. Leaves greyish-white; stellate hairs c. 0.5 mm diameter; fruit ovoid-ellipsoid,

6-8 mm diameter, with a moderate covering of prickles; prickles subterete,

distinctly wider towards the base, 1-2 mm long... ........ 0.00. c eee eee 36. T. incana

Leaves pale green; stellate hairs up to 1.5 mm diameter; fruit globose to

broadly ovoid, 8-12 mm diameter, with a dense covering of prickles;

prickles evenly terete throughout, 1.5-2.5 mmlong................... 11. T. johnstonii

37. Fruit 8-10 mm diameter; prickles 0.5-1.0 mm long ........... 0... 00000 ee 48. T. ryeae

Fruit 12-15 mm diameter; prickles 2-3 mm long ........... 0.0000 cues 12. T. aspera

Dod VOWELS UAISCRUAL 5... ee Gad Vay Gey(E ool Ned Otel Cb aces Mee © pela % yep hates lle 3 23. I. deserticola

PIGWELES’ BISEXUMP «. ood Gans 4 aon ds rN Ob od Wee ai a die Eee ork Wand, Earl way Sto O ite tN 39

39, Leaves at least 4 times as long as wide, narrowly elliptic or obovate; fruit 2-

ASIP CEATIOROE cp grane ancestral cee erst oh Kacthrtenwta na Wile need da oe ding ites 32. T. parviflora

Leaves up to 3 times as long as wide, narrowly ovate to broadly ovate,

rhomboid-ovate or if elliptic or ovate-elliptic then fruits 5-9 mm diameter............. 4()

4Q. Sepals hooded towards apex; sepal appendages subulate, erect, c. 0.5 mm

long; leaves entire or obscurely 3-lobed, ovate to broadly ovate or

rhomboid-ovate; upper leaf surface with simple and stellate hairs ................05. 41

Sepals slightly incurved towards apex, never hooded; sepal appendages

narrowly to broadly ovate, depressed obovate or linear, 0.5—1.0 mm long,

erect to spreading; leaves entire, narrowly ovate to broadly ovate or

elliptic; upper leaf surface with stellate hairs only .. 0... 0.0... ccc cee ee ees 42

4]. Fruit ovoid, prickles ciliate on one side; stamens 5 per flower............. 2. I, pentandra

Fruit globose, rarely ovoid, prickles glabrous; stamens 10-15 per flower

3. T. rhomboidea

+, * & & &¢ © © 8&8 #£§ © &®& © &© © F&F F&F FF F&F FF *&* © © © *€ #8 © £€ &€ *#£ & &£ 8 © &© © © #£ &© © & FF F ££ ££ £F & # #8 FS & FE £F & F&F FF &

42. Leaves obtuse to rounded at apex;sepals 5-6 mm long; petals narrowly obovate,

4—5 mm long; stamens [5 per flower. .... 0.0.0.0... cae eee ee eee eee 30. T. clementii

Leaves acute to acuminate at apex; sepals 2.5—5 mm long; petals linear-

oblong or linear obovate, 2-4 mm long; stamens < 11 perflower ................... 43

43. Fruit sparsely to densely covered with slender stellate hairs; base of prickles

not obscured by hairs; stamens 4-6 per flower... 0.0... 00... ce eee ee 29. ‘T’. kenneallyi

Fruit densely covered with stout stellate hairs; base of prickles obscured by

hair's: stamens S—U1 perHower pn ee sete ese ewe le LRA ek Bye aoe ee MA Ae 44

44.Stems brown; cymules 1-3 flowered; prickles densely covered with

stout simple hairs on proximal half 2... 0.0.0... 0c cece cee ees . 27, 'T. sylvicola

Stems brownish-red; cymules 6—12 flowered; prickles sparsely covered with

stout stellate and simple hairs on proximal half ..................00. 28. T. rubigmosa

45. Sepal appendages reflexed or recurved... 0... 0... ce eee teen tenes 46

Sepal appetidages spreading or rect. e ay gy cee eae ee ew Ns oa EAs eon 53

46, Piickties O01 Tre > 3 MA ONE ties a cceealicch, eral tra etl mpegs ach ELS Le we heel mica bee chiens 47

Prickles on fruit <2 mm long, or absent... 0... ce cee ee eee ean 48

Halford, Australian Tiliaceae, 3 505

47. Fruit 8-12(-15) mm diameter; prickles antrorse, 3-5 mm long, not readily

WPCA INS ORE ARUN sorters steered Jia Sei KW SCN Oe BS AINE Ae PN EEE on Worle , 45, T. antrorsa

Fruit 15-20 mm diameter; prickles erect, 4-6 mm long, brittle, readily

BEGAN O OTT ITIHE +, Slee Sc): Siesng ates tare cles att anette a cad ae ee atte edb eeteens _ $31. T. mellina

48. Fruit lacking prickles, sparsely covered with stalked stellate hairs ............ 54, T. inermis

Fruit with prickles; prickles glabrous or hairy on proximal half, terminated

By Sole OGKEISELA cr. wee heed & Now 9 Fer Seater dole Whe yh ot 9,38 ck SR es Petit anaes le Ste ae 49

49, Body of fruit glabrous or sparsely puberulous, usually black or dark reddish

brown; prickles < 1 mm long, glabrous ........ 0.0.00. c eee eee 55, I. oenpelliensis

Body of fruit densely hairy, light brown; prickles 1-2 mm long, glabrous or

Hairy: On proximal Halts, «45 Wace niin te: wteate ee hoe eee ictdted oe pach dig x he eG, ¥ gn Where boa 5(}

50. Leaves glaucous; body of fruit covered with coarse scale-like stellate hairs

Q, SAT ainelter; DC RIES ELEC E eyo yee eck HEAP Ae ee a ee ES 35. T’. glaucescens

Leaves green or yellow green; body of fruit covered with stellate hairs >

0.3 mm diameter; prickles antrorse or erect 0... eee eee teens 51

51. Prickles on fruit sparse, antrorse or somewhat appressed ..............-. 46. T. arnhemica

Prickles ontriit moderately dense, €fécia. <2 come ese Mia of a PAA ak ne A En ob ae 52

52. Sepal appendages c. 1 mm long, slightly recurved; prickles on fruit conoidal,

stout at base, distinctly tapering to apex, densely hairy on proximal third totwo

thitds with-stout stellate Natts:. cscs eats va ule ee hace We aM eee oe ae ek 44, 'T. clivorum

Sepal appendages 2.5—5 mm long, reflexed; prickles on fruit subterete, slender

at base, slightly tapering towards apex, glabrous or with scattered minute

STRUTT LCN AUS oe nen nei ckch eee deltleg, eee pall vaca EUR cho cals ane ee ay eiechoad antoasay ech tery ey oka a 43. T. viridis

Jo. OOP Al ADD ENMGAGOS ETE CE ys mez 'st hv sels Healey hth Mok ag hs Si begs chats on iin dash Naw od Aly Wu haee yc Paes 54

SCP al TOPCACUBES SHTBAGING 5 n.5 4. se 4 a Sega ew idee b Rachel oe RE EMH Me ded ous Gy wale ee Be 61

Bete UU Re APPR ITIOTESD ns ispeny oh visio catape S datat det wir teed lan aitiecatl WS RON “Quce Ni eerC hae Vis aye opera 55

Brit 3 tin -Cinineter 5.95 asskotie caw Ker wR a A LNT ble seen kink ahs oe hed Bee MOR x 58

55. Fruit depressed globose, blackish or dark reddish brown, - glabrous or

sparsely stellate-puberulous .. 0.0.0... ccc cee eee 56. ‘T. denticulata

Fruit globose, globose-ovoid or broadly ovoid, greyish white, densely

Ste llAbe sre SGe My co, tinct wee: ere aN cde peek ee, sta Hk ape gape oie, Be, eid 4 Dade Neen tg Hoe A gadis 56

56. Stellate hairs on stems and sepals with rays 2-4 mm long .............058. 49, T. simulans

Stellate hairs on stems and sepals withrays< I mmlong..... 0.0... 0... cee eee 57

57, Leaves green, narrowly ovate to ovate, 3~8 cm long, 0.8—2.5 cm wide; petals

5—6 mm long; sepals 10-12 mm long... 2.0.0... ee eee 40. T. carteri

Leaves greyish white, ovate to ovate-elliptic, 4-10 cm long, 2—5 cm wide; petals

< 2.5 mm long or absent; sepals 6-lO mm long ....... 0.0.0... 00 cc e eee ee 37. T. albida

SO. TOMETRTIMSER UAL... 5.2 ere at Gee a ay Bb did FRE Re Ered euler gd be ols Saar Le g ow Ay 23. T. deserticola

PEO WVSOS: OER IE Utara ty etcencnige ce Bic avn a Sriuedes teas a yb y crt ri Wore A aE pour ane ee eee ahekep ay Sacsindey 59

59. Inner surface of sepals glabrous; sepals persistent; fruit on reflexed pedicels;

prickles'sparSe; 1027S TM HOHE a oaths Soe me area ders ated erect weet gael 47, V. nutans

Inner surface of sepals densely hairy on proximal third; sepals deciduous; |

fruit on erect or spreading pedicels; prickles dense, 0.8-2.0 mm long................ 60

506 Austrobaileya 4(4): 495-587 (1997)

60. Prickles on fruit 1—2 mm long, dense, obscuring fruit surface ................ 48, T. ryeae

Prickles on fruit 0.5—0.8 mm long, sparse to moderately dense, not obscuring

PPEHESSUITE ACE v soca saece. Ge ool x. a. SOR a Nel eth adie Seo! eS est he antes eaten y, oh 6 50. T. breviaculeata

61. Rays of stellate hairs on stems 3—5 mm long; stems usually reddish-brown .............. 62

Rays of stellate hairs on stems mostly < 3 mm long; stems usually light blown ........... 65

62. Fruit covered with bladder-like bodies, without prickles or bristles ......... 61. T. pustulata

Praitawith prieKles-or Wristies acc, ¥ scr see 8, cn odin Hah sy wa rece a air lee gM gh each ed ele anh, 8 63

63. Fruit covered with slender, brittle, flexuose bristles, 4-6 mm long; sepals 20—

ZONE ETDS = Ae ss cores a as Caw ag aoe Si HOS Uw EE speed Gar he aL, ev eared eh 60. T. bradshawii

Fruit covered with slender, strong, erect prickles, 1.5—3.0 mm long; sepals

SUS THAT IONS fon urnatecre arden tn ween aoe tete tes eh tania etic Wea ime keeps tatese 64

64). PHCRIES O1ADIGUS:... 1.5. wna ks & he aed sa A cen ate bp AEG & & eee Te ES 59. T. cladara

Prickles hairy at least on proximal half........ 0... 0.2... cee eee 58. T. longipedunculata

65. Petals absent or 1f present then petal lamina linear or narrowly triangular,

Sy AMALID TOTES, pyre y.recsacs paruug tate Ua cevav th ven ar span bee: een Cees gsc Ae be seks os ar ee Mra Se WS see Calne ke 66

Petals always present, obovate to broadly obovate, usually >3 mmlong................ 69

66, Fruit blackish in colour, glabrous or with a few scattered stellate hairs

gh oe eng. Oct om vised Pe Ie aetna ee eyr dca ra: REA ta eye TE he Match aaqueeor Eee Shee) aie Tel 97. T. aquila

Fruit greyish-white in colour, densely stellate-hatry......... 0.0.0... cece eee eee 67

OF Siamensre2G pet LOWED: 5. ce eovcgtuecvcarh Hp 8 deo th ce gtey 4 Highs Vela eh wera 4 Gal emi cee 42. T. centralis

LATHES SEBO EL A LOMEED o. 5 secre pie iv.0e aheliety lel wrlechien elcsold- a) a Eavlap yg fet ata IS baad ally ab ad y Mahe Rmée Dale 5c 68

68. Fruit 5-7 mm diameter; prickles 0.5—1.0 mm long; sepals 6-10 mm long;

stellate hairs on stems 1.0—1.5 mm diameter ....... 00.0 0. eee ee eee 37. T. albida

Fruit 10-15 mm diameter; prickles 2-3 mm long; sepals 12-14 mm long;

stellate hairs on stems 2-4 mm diameter ......... 0.0.00. c eee eee 53. T. rupestris

69) FO WersIISE RUAN oo howe + Shere sayenby: Lihor ds nb doa aeodi eda ke eecp eee nate | 23. T. deserticola

FUHOWMEL GS ISEERIL AI erikc wens caSecapor dee a se jot ye seaten Praha heen deb wading sky erences dere: dna gates aber gms ao 70

70. Fruit 10-17 mm diameter, with prickles obscuring fruit surface; prickles

EF AETTTSN SEOPV IS EE sacetserek Fe oso Beye Sake 9 rhs od He. Dene, A ay tase Bre Be esa ete Dacteth euro bande A Pecant Te eben lovey dittetatleen 71

Fruit 1.5-10 mm diameter, with prickles not obscuring fruit surface; prickles

£9 EZ OMG nea oe a Site bos asain a Be GODHG Cae Gy bel gees aaa te yD rd & Gee le Ai dee WEEEE Lae Minn Barge ees & oc We Sd? lH 72

71.Sepal appendages 1-2 mm long; indumentum on stems moderately dense

with stellate hairs up to 2 mm diameter; fruit globose, 12~17 mm diameter;

DEIGKICS 3 =A 1TITE LONE esas: wosepnd a ccm pe Moen ety ew ae! ater Bef akan dem eaakb ete 52, I. pannosa

Sepal appendages 2-4 mm long; indumentum on stems dense to very dense

with stellate hairs 2-4 mm diameter; fruit ovoid-globose, 10-15 mm

diameter; prickles 2-3 mm long ..... 0.0... eee ee ees 53. T. rupestris

72. Fruit < 4 mm long, blackish or dark reddish brown, glabrous or sparsely

stellate-puberulous; prickles c.O.5 mm long ........ 00.0000 56. I’. denticulata

Fruit > 5 mm Jong , greyish-white, densely stellate-pubescent; prickles 1 mm

long ......... Bent ice ine, tat AS eee a kira es ale eT at Lah Se are he dP emberss citer pleat S Sn lOl al Saalil MEARE GRE LU Bed 73

ate: ret SRA eg oe ee dedi nen atid ue age ere Waa al OIA yy ee yy ee ee! ane

Halford, Australian Tiliaceae, 3

507

73. Leaves greyish-white; indumentum on leaves and stem soft, felt-like to the

OIC es Sele Mtl pl ec ieee La eters tows ee Barend,

PESTICIDE 8k bee od eres w be OEE we De tue Ped wee

Ty he ee ne eer A 36. T. incana

74. Prickles on fruit subterete, evenly terete throughout or slightly tapering towards

apex, |-l.Smmlong...............55

Prickles on fruit conoidal, 1-2 mm long ....

1, Triumfetta pilosa Roth, Nov. Pl. Spec. 223

(1821). Type: India, Heyne (holo: B

[destroyed (fide Stafleu and Cowan 1983)];

iso: K—W(?) n.v.; Gide Wild 1984), IDC

7394-3, 125: . 8 (B—1077.5)(BRD).

Triumfetta nigricans F.M. Bailey, FI.

Queensland 1: 156 (1900). Type:

[Queensland] Herberton and Tully River,

JF. Bailey [AQ 24310] (holo: BRI).

Corchorus rothti F.Muell., Second Syst.

Census Austral. Pl. 30 (1889), nom. illeg.

[Triumfetta suffruticosa auct. non Blume,

Bijdr. 113 (1825); C.T. White, Proc. Roy.

Soc. Queensland 47: 54 (1936)}.

Annual shrub to 1.5 m high, sparingly branched;

branches ascending to erect. Indumentum on

branchlets, petioles, peduncles and pedicels

moderately dense to dense, rough; hairs stellate,

of two size classes; class | hairs 1.0-1.5 mm

diameter, with tuberculate base, and with straight,

stiff, spreading to erectrays; class 2 hairs sometimes

absent, 0.5—1.0mm diameter, with pliable, curved,

spreading to appressed rays. Leaves discolorous,

entire, narrowly to broadly ovate, (6.0-)8.0-11.0

cm long, (3.0-) 4.0-8.0 cm wide; base rounded to

cordate; apex acuminate; margin serrate;

indumentum adaxtally sparse to moderately dense,

abaxially dense; hairs stellate, rarely simple,

0.5—1.5 mm diameter, with straight, stiff, spreading

to erect rays. Petioles 1O-70 mm long. Stipules

triangular, 4-8 mm long, hirsutellous. Flowers 2

or 3, in leaf-opposed or lateral cymules; cymules

1—5 per node; peduncles 4-6 mm long; pedicels

2—3 mm long; bracts linear-lanceolate, 3—3 mm

long, hirsutellous, Sepals linear-obovate,

10.0—12.0 mm long, 1.0-1.5 mm wide;

indumentum on abaxial surface sparse to

moderately dense, with stellate hams 1.0-1.5 mm

diameter, the adaxial surface glabrous; appendages

subapical, erect, subulate, 0.5—1.0mm long, entire,

Fog Mid BRIA Aen ae Aan ees Gs AS 41. T. micracantha

By Flat be ante REE ee ca ite by wenn oo 44, T. clivorum

with indumentum as for abaxial surface of sepal.

Petals linear-obovate, 8.0-10.0 mm long, 2.0-3.5

mm wide; claw 1.0-2.0 mm long, ciliolate on

margin. Androgynophore 0. 1—0.2 mm long; glands

orbicular, annulus c. 0.5 mm long, tomentose on

margin, Stamens 10-30; filaments 7.0~-9.0 mm

long, glabrous; anthers oblong, c. 0.5 mm long.

Ovary globose, 1.0-1.5 mmdiameter,4—6-locular,

setose; style 7.0—-10.0 mm long, glabrous; stigma

minutely toothed, Fruit globose, 20-25 mm

diameter, glabrous, densely aculeate, dehiscent;

prickles terete, 8.0-10.0 mm long, erect, pliable,

buttressed at base, sparsely to densely covered

with simple hairs 1.0-1.5 mm long, terminated by

a single hooked seta c. 0.4 mm long. Fig. 1A.

Selected specimens: Queensland. Cook District: Malanda,

May 1917, collector unknown [AQ 86952] (BRD. Nortu

KENNEDY Districr: Dunk Island, Aug (951, Blake 18872

(BRI, CANB); Palm Island, May 1926, Sonmunerville [AQ

87070] (BRD; Euramo, Jul 1956, Henry [AQ 397416]

(BRI); Mount Elliot, undated, Fitzalan & Dallachy [MEL

1599002] (MEL); western summit ridge of Mount Elliot, 8

of Townsville, Aug 1991, Bean 3577 (BRI); Port Denison,

undated, Dietrich 2744 (MEL). SoutH KENNEDY DIsTRICT:

Clarke Range, W of Cathu, Apr 1978, Byrnes & Clarkson

3840 (BRD).

Distribution and habitat: T. pilosa is widely

distributed in Africa, India, Malaysia, China, New

Guinea and Australia. In Australia it occurs in

north eastern Queensland from Malanda to

Proserpine (Map 2). Ithas been recorded growing

in disturbed habitats in notophyll vine forest and

sclerophyl! forest usually on roadsides and also in

pastures. I believe T. pilosa to be a fairly recent

introduction to Australia.

Phenology: Flowers have been recorded in April,

May and July, fruits throughout the year.

Notes: In the Queensland Herbarium there are

Specimens identified by W.D. Francis 1n 1930s as

T. suffruticosa BI, and T. pilosa Roth based on the

comparison of Queensland material at Kew. J

508

have not observed any discernable differences

between the material previously placed under

these two names in the Queensland Herbarium.

For the present, therefore, I have placed all relevant

Australian material under the older name T. pilosa.

Investigations are required to clarify any

differences between the two species.

2. Triumfetta pentandra A. Rich., Fl. Seneg.

Tent. 1:93 t 19 (1831). Syntypes: [Africa]

Senegal, Perrofttet (P, n.v.); Leprieur (P,

n.v.), Gide Wild 1984).

Triumfetta sp. C, Rye 1992: 175.

Annual shrub to 1.5 m high, sparingly branched;

branches erect. Indumentum on branchlets,

petioles, peduncles and pedicels moderately dense,

of simple and stellate hairs; stmple hairs 1.0—2.0

mm long, erect; stellate hairs O.5—1.Ommdiameter,

with pliable or stiff, curved spreading rays. Leaves

discolorous, entire or sometimes obscurely 3-

lobed, broadly ovate or rhomboid-ovate, 3.0-6.0

cm long, 3.0-6.0 cm wide; base rounded or

truncate; apex acute; margin irregularly serrate;

indumentum adaxially sparse with a mixture of

stiff, simple hairs 0.5-0.8 mm long, and stellate

hans 0.5-1.0 mm diameter, abaxially sparse to

moderately dense with stiff, stellate hatrs 1.0-1.5

mm diameter. Petioles 10-40 mm long. Stipules

triangular, 3-5 mm long, hirsutellous. Flowers

1-4, in leaf-opposed or lateral cymules; cymules

2—4 per node, often forming terminal interrupted

spiciform inflorescences by reduction of

subtending leaves; peduncles 3-6 mm long;

pedicels 1-3 mm long; bracts triangular or linear,

{[—2 mm long, hirsutellous. Sepals linear, 3.0—3.5

mm long, c. 0.5 mm wide, cucullate; indumentum

on abaxial surface dense, with stellate hairs c. 0.5

mm diameter, the adaxial surface glabrous;

appendages subapical, erect, subulate, c. 0.5 mm

long, entue, with indumentum as for abaxial

surface of sepal. Petals narrowly obovate, 2.0—2.5

mm long, c. 0.5 mm wide; claw indistinct, glabrous.

Androgynophorec. 0.2 mm long; glands orbicular;

annulus obsolete. Stamens 5; filaments c. 2 mm

long, glabrous; anthers oblong, c. 0.5 mm long.

Ovary globose, c. 0.7 mm diameter, 2-locular,

setose; style 1.5—2.0mm long, glabrous; stigma 2-

lobed. Fruit ovoid, S—7 mm Jong,4-6 mm diameter,

glabrous or densely covered with slender stellate

hans c. 0.3 mm diameter, moderately aculeate;

prickles subterete, tapering towards the apex,

Austrobaileya 4(4): 495-587 (1997)

[.Q—2.0mm long, erect, densely ciliate on adaxial

surface with simple erect hairs, terminated by a

single hooked seta c. 0.2 mm long. Fig. 2B.

Selectedspecimens; Western Australia. GARDNER DISTRICT:

unnamed creek of Calder River, 4 km S of Neville Creek,

Eastern Walcott Inlet, May 1983, Edinger 17 (PERTH); 2

km E of junction of Charnley and Calder Rivers, Eastern

Walcott Inlet, May 1983, Milewski [PERTH 1535889]

(PERTH). Firzceratp District: Beverley Springs Station

Homestead, May 1988, Cranfield 6629 (PERTH). DAMPIER

District: 4 km S of James Price Point, Moorak Bore, Apr

1988, Crater 243 (DNA). Northern Territory, Darwin

AND GULF REGION: Progress Drive, Nightcliff, Darwin, Jun

1964, Nelson 1207 (AD, BRI, DNA); Kapalgaref 1312, Apr

1977, Collins BC390 (BRI, CANB); site 23, c. 40 km SW

of Jabiru, Mar 1981, Craven & Whitbread 7705 (DNA);

Kakadu N.P., Baroalba Springs, Apr 1992, Halford Q1L10

(BRI, DNA, K, L, MEL); 2 miles [3.2 km] N [of] Adelaide

River Hotel, Apr 1962, Nelson 314 (BRI, CANB, DNA,

PERTH); King Ash Bay, McArthur River, Bing Bong

Station, May 1984, Halford 845156 CDNA). Queensland.

Cook District: 86km W of Georgetown on road to Croydon,

Fanneys Creek crossing, Apr 1992, Halford Q971 (BRI, K,

MEL); Black Rock, The Lynd, Apr 1988, Horsup 67 (BRI).

NortTH Kennepy District: Townsville, Mar 1933, White

882i (BRI). SourH KENNEDY District: Collinsville Coal

Company lease area, Apr 1984, Thompson C49 (BRI).

Distribution and habitat: T. pentandrais anative

of southern Africa. In Australia it is naturalised in

the Kimberley of Western Australia, inthe Darwin

and Gulf Region of the Northern Territory and

north eastern Queensland (Map 4), usually in

disturbed habitats.

Phenology: Flowers have beenrecorded in March

and April, fruits from March to July.

Notes: In Australia, 7. pentandra has been

previously misidentified as T. rhomboidea.

7. pentandra can be distinguished from

1. rhomboidea by its ovoid fruit with, subterete

prickles which are densely ciliate on the upper

side whereas the fruitof 7: rhomboidea are globose

or rarely ovoid-globose and have terete prickles

which are glabrous or rarely have a few hairs near

base.

3. Triumfetta rhomboidea Jacg., Enum. Syst.

Pl. Carib. 22 (1760). Type: West Indies n.v.

Triumfetta velutina Vahl., Symb. Bot. 3: 62

(1794). Type: “Habitat in Insula Franciae,

Dn. Thou nv.

Annual or perennial shrub to 1.5 m high, sparingly

or much branched; branches ascending to erect.

Halford, Australian Tiliaceae, 3

Indumentum on branchlets, petioles, peduncles

and pedicels moderately dense, of simple and

stellate hairs; simple hairs sometimes absent,

0.5—1.0 mm long, erect; stellate hairs of two size

classes; class 1 hairs 0.2—0.5 mm diameter, with

pliable, curved, spreadingrays; class 2 hairsO.5—1.5

mim diameter, sometimes with tuberculate base,

and with stiff, straight, spreading rays. Leaves

discolorous, entire or shallowly 3-lobed, ovate to

broadly ovate or rhomboid-ovate, 4.0—-13.0 cm

long, 3.0-11.0cm wide; base rounded; apex acute

or acuminate; margin irregularly serrate;

indumentum adaxially sparse to moderately dense

with a mixture of stiff, simple hairs 0.5—0.8 mm

long, and stellate hairs 0.5-1.0 mm diameter,

abaxially moderately dense to dense sometimes

velvety with simple hairs 0.5-1.0 mm long, and

stiff, stellate hairs O.5S—1.0 mm diameter. Petioles

20-90 mm long. Stipules triangular, 1-6 mm

long, hirsutellous. Flowers 1—3, in leaf-opposed

or lateral cymules; cymules 2 or more per node,

often forming terminal interrupted spiciform

inflorescences by reduction of subtending leaves;

peduncles 0.5-4 mm long; pedicels 0.5-4 mm

long; bracts narrowly ovate, 3-4 mm long,

hirsutellous. Sepals linear, 4.0-7.0 mm long, c. |

mm wide, cucullate; indumentum on abaxial

surface sparse, with stellate hairs c. 0.5 mm.

diameter, the adaxial surface glabrous; appendages

subapical, erect, subulate, c. 0.5 mm long, entire,

with indumentum as for abaxial surface of sepal.

Petals linear-obovate, 3.0-6.0 mm long, 1.5—2.0

mim wide; clawc. 1 mm long, ciliolate on margin.

Androgynophore c. 0.3 mm long; glands oblong

to orbicular; annulus c. 0.3 mm long, ciliate on

margin. Stamens 10-15; filaments 3.0 -5.0 mm

long, glabrous; anthers oblong, c. 0.5 mm long.

Ovary globose, c. | mm diameter, 2-locular,

setose; style 3.0-5.0mm long, glabrous; stigma 2-

lobed. Fruit globose, rarely ovoid-globose, 5-9

mm long, 5—8mm diameter, moderately to densely

covered with slender stellate hairs 0.3 mm diameter,

moderately aculeate; prickles terete, 1.9-2.3 mm

long, erect, glabrous or with a few stellate hairs

near base, terminated by a single hooked seta c.

0.4 mm long, Fig, 2A.

Selected specimens: Northern Territory. DARWIN AND

GuLF District: Warangaiyu Lagoon, Elcho Island, Jul 1975,

Dunlop 3959 (CANB, DNA); Holmes Jungle, 8 miles [13

km} E. [of] Darwin, Mar 1961, Chippendale 7900 (DNA,

MEL); Black Jungle area, ESE of Darwin, Apr 1987, Purdie

3081 (CBG, DNA); Kemp Arrstrip, Apr 1977, Parker 721

S09

(CANB, CBG, DNA); Queensland. Coox District: lower

reaches of Isabelia Creek, NW of Cooktown, Jul 1990, Bear

1992 (BRI); Cairns, Jun 1935, Blake 9341 (BRI, CANB

nv., MOn.yv., Kn.v.), Nortu Kennepy District: beside old

Dairymple track near Cardwell, May 1975, Andrews &

Sunon 180 (BRI, CANB); Upper Stone via Ingham, Oct

1957, Toner [AQ 87084] (BRD; base of Mt Fox, 70 km SW

of Ingham, Jun 1989, Jobson 576 (BRI, MEL), Sout

KENNEDY District: Mid Repulse Island N.P., May 1985,

Warrian CW420 (BRI). Porr Curtis Districr: Middle

Percy Island, 87 miles [140 km] SE of Mackay, Apr 1956,

Lazarides 5641 (AD, CANB, BRI, MEL, PERTH); Couti-

Outi, 70 miles [113 km] NNW of Rockhampton, Jun 1960,

Johnson 2015 (BRD. Wipe Bay Districr: Moore Park

Creek, about9 km NW of Fairymead Sugar Mill, about8 km

N of Bundaberg, Apr 1977, Sharpe 2213 (BRI). Moreron

Districr: Ormeau, about 7 miles [11 km] S of Beenleigh,

Apr 1970, Thomson (BRI). New South Wales. Norts

Coast Division: Kingscliff, Aug 1973, Coveny 5064 (BRI).

Distribution and habitat: T. rhomboidea occurs

as a Widespread weed in the subtropics and tropics

around the world. Its place of origin is unknown.

In Australia, 7. rhomboidea occurs from Darwin

to Arnhem Land in the Northern Territory, and

along the east coast from Cape York, Queensland

to Kingscliif, New South Wales (Map 3). It grows

in a Wide range of habitats usually in disturbed

sites. |

Phenology: Flowers and truits have been recorded

throughout the year but mainly in March to July.

Notes: T. rhomboidea 1s similar morphologically

to T. pentandra. For distinguishing features see

notes under 7. pentandra.

T. rhomboidea exhibits considerable

variation in leaf shape and size, and the density of

its indumentum. There are also annual and

perennial forms recorded for Australia. In

Queensland, the perennial form with a densely

hairy lower leaf surface has, in the past, been

identified as T. velutina Vahl. |

4, Triumfetta plumigera F. Muell. in Hooker’s

J. Bot. Kew Gard. Misc. 8: 323 (1856).

Type: [Northern Territory]. between

Fitzmaurice and Victoria River[s], Oct 1855,

Ferd. Mueller |MEL 223688 - element on

the left] (holo: MEL ).

Perennial shrub to 1.5 m high, unbranched or with

several branches arising from the base; branches

ascending to erect. Indumentum on branchlets,

petioles, peduncles and pedicels dense, rough;

hairs stellate, 1.0-2.0 mm diameter, with stiff

510

spreading rays. Leaves concolorous, entire,

narrowly obovate or oblong-elliptic, 3.5-9.0 cm

long, 1.0-3.0 cm wide; base cuneate; apex obtuse

torounded; margin serrate-crenulate; indumentum

adaxially and abaxially moderately dense to dense;

hairs stellate, 1.0-2.0 mm diameter, with stiff,

spreading rays. Petioles 7-25 mm long. Stipules

linear, c. 5 mm long, hirsutellous. Flowers 2 or 3,

in axillary or lateral cymules, cymules 1-4 per

node, often forming terminal interrupted spiciform

inflorescences by reduction of subtending leaves;

peduncles 2-5 mm long; pedicels up to | mm

long; bracts ovate, up to 2 mm long, hirsutellous.

Sepals linear-ovate, 5.0-6.0 mm long, c. 1 mm

wide; indumentum on abaxial surface dense, with

coarse stellate hairs up to 0.5 mm diameter, the

adaxial surface glabrous; appendages subapical,

erect, subulate, [.Q—-1.5 mm long, entire, glabrous.

Petals linear-obovate, 3.0-5.0 mm long, 1.0—-1.5

mm wide; clawc. | mm long, ciliolate on margin.

Androgynophore 0.1—0.2 mm long; glands

transversely oblong; annulus c. 0.5 mm long,

ciliateon margin. Stamens 9-12; filaments 3.0-4.0

mm long, glabrous; anthers oblong, c. 0.3 mm

long. Ovary globose, 1.0-1.5 mm diameter, 3-

locular, densely hirsute; style 2.5-3.5 mm long,

glabrous; stigma 3-lobed. Fruit globose, 10-15

mm diameter, densely covered with stellate hairs

c. 1 mmdiameter, densely setose; bristles filiform,

7.0-10.0 mm long, erect, pliable, plumose with

simple hairs 1-2 mm long, terminated by 2—5

straight setae up to 0.7 mm long. Fig. 1E.

Selected specimens: Western Australia, GARDNER DISTRICT:

Boiga Falls, Drysdale N.P., Aug 1975, Kenneally 3037

(CANB, PERTH). Firzceracp Districr: 29 miles [47 km]

NW of Springvale Station, Apr 1955, Lazarides 5073 (BRI,

CANB, DNA, MEL, PERTH); Mabel Downs Station,

Winnama Gorge, May 1984, Chesterfield 220 (CANB,

MEL). DAmpter District: on Broome - Derby road, c. 115

km NE of Broome, Apr 1983, Fryxell 3858 (CANB, MEL,

PERTH). Muetter Districr: Wolf Creek Meteor Crater,

May 1985, Fryxell etal, 4538 (CANB, DNA, MEL, PERTH).

Northern Territory, DARWIN AND GULF REGION: c. 63 miles

[101 km] NE of Maranboy Police Station, Mar 1965,

Lazarides & Adains 68 (BRI, CANB, DNA, MEL); Stuart

Highway, c. 6 miles [10 km] NNW of Edith River Siding,

Mar 1965, Lazarides & Adams 138 (CANB, DNA); c. 37

km SW of ‘Calvert Hills’ on the road to ‘Creswell Downs’,

May 1974, Pullen 9261 (BRI, CANB, DNA). Vicroria

RIVER REGION: 35.5 miles [57 km]S [oft] Willeroo Homestead,

May 1960, Chippendale 6883 (BRI, CANB, DNA, MEL,

PERTH); Gardiner Range, NW Tanami Desert, Apr 1981,

Latz8635 (BRI). CENTRAL NORTHERN REGION: Elkedra Station,

Davenport Range, May 1977, Latz 6960 (CANB, DNA),

Queensland. Burke Disrricr: Lawn Hill N.P., 26 May

Austrobaileya 4(4): 495~587 (1997)

1989, O’ Keefe [AQ 456638] (BRI); Calton Hills, c. 45 miles

[72.4 km] N of Mt Isa, May 1963, Giffens 763 (BRD; ridge

W of Hilton, 20 km N of Mt Isa, Apr 1983, Schinid 633

(BRI); 11 kmEof Lake Julius, on road towards Kajabbi, Jun

[991, Halford Q509 (BRI, DNA, K, MEL).

Distribution and habitat: T. plumigera occurs

widely in northern Australia from the Kimberley,

Western Australia, through the Northern Territory

to north western Queensland (Map 2). It grows in

hummock grasslands and woodlands tn skeletal,

usually sandy or rocky, soils on quartzite or

sandstone hills.

Phenology: Flowers and fruits have been recorded

between February and October.

Notes: Mueller’s description of this species in his

Fragmenta (1859) ts predated by a letter dated 18

June 1856 he sent to Hooker that was published in

late 1856. In the letter he states ‘Triumfetta (T.

plumigera) is remarkable for a capsule which is

not woody, and long plumose setae on the fruit,

characters that may entitle it to generic distinction’.

Under the current ICBN, this 1s sufficient for valid

publication of the name which, thereby, dates

from 1856. On the MEL sheet of the type material

[MEL 223688] there are two labels, here referred

to as labels A and B, both in Mueller’s hand and.

two branchlets, here refer to branchlets 1 and 2.

Branchlet 1, the left one, has leaves and one fruit

while branchlet 2, therightone, has leaves, flowers

and smallimmature fruit. There is also a fragment

packet on the sheet containing mature fruit and

flowers which appear to have come from both

branchlets. The information on label A is given as

“Triumfetta plumigera (plumisctr) Gravelly banks

of rivulets between the Fitzmaurice and Victoria

River[s], Oct 55, Ferd. Mueller.’ and that on label

B *Rulinga 30, 356., Depot Creek [illegible word]

Suffrutrex strictus [illegible word] 2-3’, Calyx

flavescens, corolla lutes’, It is clear that label B

belongs with branchlet 2 as it makes reference to

the sepal and petal colour. Therefore, itis assumed

that label A belongs with branchlet 1. Although

both branchlets were collected by Mueller before

he sent his letter to Hooker, I believe he did not

refer to branchlet 2 in describing T. plumigera in

that letter because at the time he considered it to

belong toa Rulingia species. Therefore branchlet

[is the sole element used by Mueller in describing

this species and should be considered the holotype

for the name T. plumigera.

RS ye a Rn aa ev eV eV ey ee

we ee oe

Halford, Australian Tiliaceae, 3

5. Triumfetta triandra Sprague & Hutch., Bull.

Misc. Inform. (6): 258 (1909). Type:

[Western Australia]. N. West coast of

Australia, Bynoe (lecto, designated here:

Kx).

Perennial shrub to 2 m high, unbranched or

sparingly branched; branches erect. Indumentum

on branchlets, petioles, peduncles and pedicels

moderately dense to dense; hairs stellate, Q.5—1.5

tam diameter, with stiff rarely pliable, spreading

rays. Leaves concolorous, entire, narrowly elliptic

or narrowly linear-ovate, 3.0--5.0(-7.0) cm long,

0.8—1.7(-2.7) cm wide; base acute; apex acute;

margin serrulate; indumentum adaxially sparse to

moderately dense, abaxially dense to very dense;

hairs stellate, 0.5—1.0 mm diameter, with stiff,

spreading rays. Petioles 3-4¢-15) mm long.

Stipules narrowly triangular, 4-6 mm long,

hirsutellous. Flowers 3, in axillary cymules;

cymules I-4 per node, often forming terminal

interrupted spiciform inflorescences by reduction

of subtending leaves; peduncles |—3 mm long;

pedicels 2~4 mm long; bracts ovate or narrowly

ovate, [~5 mm long, hirsutellous. Sepals linear-

ovate, 3.5-5.5 mm long, 0.5—1.0 mm wide;

indumentum on abaxial surface dense, with stellate

hairs c. 0.3 mm diameter, the adaxial surface

glabrous; appendages subapical, erect, subulate,

c. O.S mm long, entire, glabrous. Petals linear-

obovate, 2.0-3.0 mm long, 0.5-1.5 mm wide;

claw Q.5—1.O0mm long, ciliolate. Androgynophore

0.4--0.5 mm long; glands ovate; annulusc.0.5 mm

long, ciliate on margin. Stamens 3-6; filaments

2.0--3.5 mm long, glabrous; anthers oblong, c, 0.3

mm long. Ovary subglobose, c. 0.7 mm diameter,

3-locular, hirsute; style 1.5—3.5 mm long, glabrous;

stigma 3-lobed. Fruit ellipsoid, trigonal in cross

section, 4-5 mm long, 3-4 mm wide, sparsely to

densely covered with slender stellate hairs c, 0,3

mm diameter, densely setose; bristles terete,

1.0-2.0 mm long, erect, phable, arranged in

longitudinal rows, sparsely to densely covered

witha mixture of simple and stellate hairs up to0.5

mm long, terminated by 4-6 erect setae c. 0.3 mm

long. Fig. 1C.

Selectedspecimens: Western Australia, GARDNER DistTRIcT:

Sic Graham Moore Is., Jun 1973, Wilson | {202 (PERTH);

Fenelon Island, off Admiralty Gulf, Jul 1977, Kenneally

6437 (CANB, PERTH); c, 15 kmN of Kalumburu Mission,

May 1983, ffryxell & Craven 4128 (AD, BRI, DNA, MEL,

PERTH); Osborne Is. (south west island}, Bonaparte

Archipelago, Jun 1973, Wilson 11157 (PERTH); above

Mitchell Falls, Mitchell Plateau, Jun 1976, Kenneally 5033

(PERTH); Surveyors Falls, Mitchell Plateau, Jun 1976,

Kenneally 5068 (PERTH); Camp Creek, Mitchell Plateau,

Jun 1976, Kenneally 4820 (PERTH); Coucal Gorge, Carson

Escarpment, Drysdaje River N.P., Aug 1975, George 13865

(PERTH); Uwins Is., Brunswick Bay, Jul 1973, Wilson

11433 (PERTH); Augustus Is., Bonaparte Archipelago,

May 1972, Wilson 10814 (PERTH); Artesian Range, Aug

1905, Fitzgerald 1363 (PERTH). FirzGerAtp Dusrricr:

Manning Gorge, ncar Mt Barnett Homestead, May 1983,

Fryxell & Craven 3968 (BRI, CANB, DNA, MEL, PERTH);

King Leopold Range, Fern Creek, Dunlop 7779 & Simon

(BRI). Dampier District: North Hunter Creek, E of Cape

Leveque, May 1985, Foulkes 243A (PERTH); Cygnet Bay,

22 km SSE of Cape Leveque, Apr 1988, Kenneally 10680

(PERTH), HALL Disrricr: Osmond Valley Station, Bream

Gorge, Nov 1989, Menkhorst799 (DNA, PERTH). Northern

Territory. VicrortA RivER REGION: Keep River, Sep 1975,

Mitchell 317 GDNA).

Distribution and habitat: T. triandra occurs

widely in the Kimberley of Western Australia and

extends tothe Keep Riverin the Northern Territory

(Map 3). It grows in hummock grasslands,

woodlands and open forests in shallow sandy soils

on rocky sandstone hills and outcrops.

Phenology: Flowers have been recorded from

January to July, fruits from January to August.

Notes: In their protologue of 7. triandra, Sprague

and Hutchinson cited two specimens, namely

‘Montague Sound, Cunningham, 236’ and ‘without

precise locality, Bynoe’, Both specimens have

been located at K on a single sheet. The Bynoe

specimen 1s chosen as lectotype as it is in a better

state of preservation.

This species exhibits some variation in the

density and length of indumentum on its leaves

and bristles,

6. Triumfetta coronata Halford sp. nov. attinis

T. triandrae qua fructus ellipsoideos 4—5

mm longos, 3-4 mm latos setis in columnis

longitudinalibus ornatos, folia anguste

elliptica vel anguste in linearo-ovata 3-5

cm longa 0.8--1.7 cm lata habet aut ab ea

fructus parvioribus ellipsoido-globosois 2—3

mm longis |.5—2 mm diam. apice fasciculls

setarum brevium praeditis, foliis anguste

obovatis vel oblongis 1.5—3 cm longis 0.5—1

cm latis haud aegre distinguitur. Typus:

Western Australia. FITZGERALD DISTRICT:

House 70, Koolan Island, 16°09’S,

[23°47 14, Mar 1984, Lee Vernon 39 (holo:

PERTH; 1so: BRI).

Triumfetta sp. (L. Vernon 39), Rye (1994:

419).

512

Perennial low shrub much branched from the

base; branches procumbent. Indumentum on

branchlets, petioles, peduncles and pedicels sparse

to moderately dense; hairs stellate, 0.5—1.5(¢-2.0)

mm diameter, with either flaccid and somewhat

appressed or stiff and spreading rays. Leaves

concolorous, entire, narrowly obovate or oblong,

1,5—3.0 cm long, 0.5—-1.0 cm wide; base cuneate;

apex obtuse or rounded; margin denticulate;

indumentum adaxially and abaxtally sparse to

dense; hairs stellate, 0.5—1.5 mm diameter, with

stiff, spreading rays, Petioles 5~8 mm long. Stipules

linear to narrowly triangular, 3~4 mm long,

hirsutellous. Flowers 2 or 3, in axillary cymules;

cymules 3-8 per node, usually arranged along a

very reduced axillary branch and forming short,

paniculate inflorescences by reduction of

subtending leaves; peduncles 0.5—1 mm long;

pedicels 0.5—1 mm long; bracts linear or narrowly

ovate, 0.5—1 mm long, hirsutellous. Sepals linear,

3.5-4.0mm long,c.0.5 mm wide; indumentum on

abaxial surface dense, with stellate hairs up to 0.5

mm diameter, the adaxial surface glabrous;

appendages subapical, erect, subulate, c. 0.5 mm

long, entire, glabrous or with scattered minute

hairs, Petals linear, 2.0-3.0 mm long, 0.5 mm

wide; claw c. 1 mm long, ciliolate on margin.

Androgynophorec. 0.2 mm long; glands orbicular;

annulus c. 0.3 mm long, ciliolate on margin.

Stamens 5; filaments 1.5—-3.0mm long, glabrous;

anthers oblong, c. 0.3 mm long. Ovary globose, c.

0.5 mm diameter, 2-locular, stellate-puberulous;

style 2.5—3.0 mm iong, glabrous; stigma minutely

toothed. Fruit ellipsoid-globose, 2-3 mm long,

15-2 mm diameter with a moderately dense

covering of slender stellate hairs c. 0.4 mm

diameter, crowned by 2 rows 10-12 bristles near

apex, rarely with much shorter isolated bristles

over body; bristles terete, c. | mm long, erect,

pliable, densely covered by stellate hairs c. 0.2

mm diameter, terminated by 3-6 spreading setae

c. 0.2 mm long. Fig. 1F.

Selected specimens: Western Australia, GARDNER DISTRICT:

2km Eofjunction of Charnley and Calder River[s], Eastern

Walcott Inlet, May 1983, Milewski204 (PERTH). FitzGerALp

District: Bindoola Creek, Gibb River-El Questro Road, +

SskmSW of Wyndham, May 1976, Beauglehole ACB51377

(PERTH); Koolan Island, western end, on road to waterfall,

SW of Jap Bay, Jun 1985, Fryxell etal. 4616 (CANB, MEL,

PERTH); Koolan Island, May 1983, Fryxell & Craven 3919

(CANB, MEL, PERTH).

Austrobaileya 4(4): 495-587 (1997)

Distribution and habitat: T. coronata occurs in

the Kimberley of Western Australia (Map 5). It

grows mostly in open woodlands in shallow sandy

sous on sandstone outcrops and hills.

Phenology: Flowers have beenrecorded in March

and April, fruits in May and June.

Notes: T. coronataisrelated to T. triandra butcan

be readily distinguished by its ellipsoid-globose

fruits (2—3 mm long, 1.5—2.0mm diameter) which

have a cluster of short bristles at the apex, and its

narrowly obovate or oblong leaves (1.5—3.0 cm

long, 0.5—1.0cm wide), Incomparison, 7. triandra

has ellipsoid fruits (4-5 mm long, 3-4 mm wide)

with bristles arranged in longitudinal rows and

narrowly elliptic or narrowly linear-ovate leaves

(3-5 cm long, 0.8-1.7 mm wide).

Etymology: The specific epithet refers to the

crown of bristles at the apex of the fruit; Latin

coronatus, crowned.

7, Triumfetta procumbens G. Forst., Prodr. 35

(1786). Type: Society Islands, JR. Forst.

& G. Forst. (lecto: BM, fide Smith 1981),

Perennial shrub much branched from the base;

branches procumbent, up to2 mlong. Indumentum

on branchlets, petioles, peduncles, pedicels and

stipules dense; hairs stellate, 0.5—1.0 mm diameter,

with pliable, appressed rays. Leaves discolorous,

entire, shallowly or deeply 3-lobed; lobes ovate or

oblong; lamina ovate to broadly ovate or

suborbicular, 2,0-2.5 cm long, 2.04.5 cm wide;

base cordate; apex obtuse; margin crenate-

serrate; indumentum adaxially sparse, abaxially

moderately dense; hairs stellate, 0.5-1.5 mm

diameter, with pliable, spreading rays. Petioles

15—45 mm long. Stipules narrowly triangular, 3—7

mm long. Flowers 2—5, in leaf-opposed cymules;

cymules solitary at nodes; peduncles 5—10(-35)

mm long; pedicels 4-10 mm long; bracts narrowly

ovate, 46 mm long, sparsely pubescent. Sepals

linear, 9.0-13.0 mm long, 2.0-2.5 mm wide;

indumentum on abaxial surface moderately dense,

with slender, stellate hans up to 0.7 mm diameter,

on adaxial surface densely stellate-tomentose near

base; appendages subapical, erect, subulate,

!.O—2.0 mm long, entire, glabrous. Petals linear-

obovate, 7.5—9.0 mm long, c. 4 mm wide; claw

1,0—1.5 mm long, tomentose. Androgynophorec.

0.5 mm long; glands depressed ovate; annulus c.

Halford, Austrahan Tiliaceae, 3

0.5 mm long, ciliolate on margin. Stamens 20-35;

filaments 5.0-8.0 mm long, glabrous; anthers

‘oblong, c. 0.5 mm long. Ovary globose, c. | mm

diameter, 3—5-locular, setose; style 5.0-8.0 mm.

long, glabrous; stigma 3— to5-lobed. Fruit globose,

{5-20 mm diameter, glabrous or with scattered

slender stellate hairs, moderately aculeate; prickles

subterete, tapering towards the apex, 4.0-5.0 mm

long, erect, buttressed at base, sparsely to

moderately dense hirsutellous with simple hairs

up to 0,7 mm long and stellate hairs up to 0.5 mm

diameter, terminated by a single erect or inflexed

seta c, 0.2 mm long. Fig. 1B.

Selected specimens: Queensland, Cook DISTRICT:

Cairncross Islet West, Great Barrier Reef, Jul 1969, Done

{AQ 6587] (BRI); Temple Bay, Cape York Peninsula, Jul

1923, Joung [AQ 86978] (BRD; Lizard Island N.P., Dec

1985, Beesley 556 (CBG); Lizard Island, May 1975, Byrnes

3254A (BRI); Green Island, 16 miles [26 km] from Cairns,

Jun 1972, Wrigley & Telford NQ1784 (CBQG); Green Island,

Jun 1935, flecker 635 (AD). SourH K&eNNeDy District:

Bushy Island, Sep 1986, Chaloupka | (BRI); ditto, Sep

1989, Walker |AQ 457563] (BRI). Port Curtis District:

Swain Reefs, undated, Heatwole [AQ 454388] (BRD; Lady

Elliott Island, Sep 1981, Zlsol 810904 (BRI).

Distribution and habitat: T. procumbensis widely

distributed from the Seychelles, Diego Garciaand

Keeling Islands, through Malesia to Western

Micronesia, Polynesiaand Australia, In Australia,

it occurs on the islands along the east coast of

Queensland from Cape York to Gladstone with a

single record from the mainland at ‘Temple Bay,

Cape York Peninsula (Map 4). It grows on coral

cays, sandy seashores and coastal dunes.

Phenology: Flowers have been recorded in May

and September, fruits in July and September.

Notes: T. procumbens is sometimes confused

with 7. repens with which it shares a similar habit

and habitat. Itcan be distinguished trom that by its

stellate-velutinous indumentum on the lower leaf

surtace, the globose fruit and the stellate-hirsute

prickles 4—5 mm long on fruit. In comparison,

7. repens has astellate-hirsute indumentum on the

lower leaf surface, depressed-globose fruit and

glabrous prickles 3-4 mm long on the fruit.

§. Triumfetta repens (Blume) Merr. & Rolfe,

Philip. Journ. Sci. (Bot.) 3: ILL (1908).

Porpa repens Blume, Bydr. 198 (1825).

Type: Java, Blume, H.L.B.908, 254-1456

(holo: L). |

513

Triumfetta subpalmata Sol. ex Hems1L., J. Bot.

28: 2 (1890). Type: [Australia]. New

Holland, in 1770, Banks & Solander (holo:

BM).

Illustrations: Bot. Cook’s Voyage tab.23, p.

II.

Perennial shrub much branched from the base:

branches procumbent, up to 3(-8) m long.

Indumentum on branchlets, petioles, peduncles

and pedicels sparse to moderately dense; hairs

stellate, 0.5--1.0 mm diameter, with tuberculate

base, and with pliable, spreading rays. Leaves

concolorous, entire or deeply 3—or 5-lobed; lobes

oblong-ovate; lamina orbicular-ovate, 0.8-3.0cm

long, 0.8-3.0 cm wide; base obtuse; apex obtuse;

margin coarsely serrate; indumentum adaxially

and abaxially sparse; hairs stellate, 0.5—1.0 mm

diameter, with stiff, appressed-spreading rays.

Petioles 2~I15 mm long. Stipules narrowly

triangular, |-4 mm long, sparsely stellate-hairy.

Flowers 1-3, in leaf-opposed or terminal cymules;

cymules solitary at nodes; peduncles 4-10 mm

long; pedicels 4-6 mm long; bracts narrowly

ovate, 4—6 mm long, glabrous or sparsely

pubescent. Sepals linear, 9.0-10.0 mm long,

1.5—2.0mm wide; indumentum on abaxial surface

moderately dense, with coarse, scale-like stellate

hairs c. 0.2 mm diameter, on adaxial surface

densely stellate-villous near base; appendages

subapical, erect, subulate, c. 1 mm long, entire,

glabrous. Petals linear-obovate, 7.0-8.0 mm long,

1.5-3.0 mm wide; claw 1.0-1.5 mm long,

pubescent. Androgynophore c. 0.3 mm long;

glands depressed ovate; annulus c. 0.5 mm long,

ciliolate on margin, Stamens 30-40; filaments

4.0~7,0 mm long, glabrous; anthers oblong, c. 0.5

mm long. Ovary globose, c. 1 mm diameter, 3—5-

locular, sctose; style 5.0-7.0 mm long, glabrous;

stigma 3— or 5-lobed. Fruit depressed globose,

17-22 mm long, [5-20 mm diameter, glabrous,

moderately aculeate; prickles subterete, tapering

towards the apex, 3.0-4.0 mm long, erect,

buttressed at base, glabrous, terminated by a

single erect or slightly bent seta c. 0.1 mm long.

Fig. 1D.

Selected specimens; Queensland. Cook Districr: Temple

Bay,c.4kmNwW of Glennie Inlet, Jun 1978, Clarkson 2167

(BRI, CANB); Quintell Beach, Lockhart Mission, E of [ron

Range airport, Sep 1976, Henderson H2425 (BRD; Eagle

Island, Oct 1973, Stoddart 4811 (BRD; sand dune 12 km

SW of Cape Flattery, Aug 1978, Paijmans 2793 (CANB);

514

Bloomfield Beach, c. 1.6 km N of Bloomfield River mouth,

Sep 1960, Smith 11001 (BRI); Noah Beach, Cape Tribulation,

Jul 1990, Bean 2015 (BRD; Pinnacle Village, [7 km N of

Mossman on Daintree road, Jul 1981, Sharpe 2949 (BRD;

4 Mile Beach, | mile [1.6 km] S of Port Douglas, Jun 1972,

Wrigley & Telford NQ912 (CBG); beach between Half

Moon Creek and Yorkeys Point, near Cairns, Oct 1979,

Batianoff& McDonald 1313 (BRI, CANB), NoRTH KENNEDY

District: Hinchinbrook Island, W of Kirkville Hills, Aug

1970, Everist 9656 (BRI); Hinchinbrook Island, Shepherd

Bay, Aug 1970, Everist 9671 (BRD; Hinchinbrook Island,

Nina Beach, Aug 1975, Sharpe 1765 (BRD; mouth of

Athaus Creek, about 4 miles [6.5 km] NW of Yabulu, Sep

1942, Smith T142 (BRI); Hayman Island, Jun 1934, White

10089 (BRI). SourH KENNEDY District: Far Beach, Mackay,

Apr 1975, McDonald & Batianoff 1300 (BRI), Port Curtis

Distrricr: Nine Mile Beach, 2 km N of Waterpark Point, 25

km N of Yeppoon, Jul 1977, Batianoff & McDonald 487

(BRD; beach between Emu Point and Rocky Point at Emu

Park, Jul 1977, Batianoff & McDonald 116 (BRI); Emu

Park, Mar 1935, Blake 7865 (BRI); Main Beach, Tannum

Sands, Nov 1987, Batianoff & Dillewaard 9314 (BRD.

Distribution and habitat: T. repens occurs in

Madagascar, Keeling Islands, Southeast Asia,

Malesia and Australia. In Australia, 1f occurs

along the east coast of Queensland from Temple

Bay to Yeppoon (Map 5). It grows on coral cays

and exposed coastal dunes as a pioneer species or

in shrubland communities.

Phenology: The main flowering and fruiting period

is from April to October. However, there are some

collections in January with flowers and fruits.

Notes: This species is often confused with

T. procumbens. For distinguishing features see

notes under T. procumbens.

9, Triumfetta reflexa W. Fitzg., J. Roy. Soc. W.

Aust. 3: 170 (1918). Type: Western

Australia, Isdel River, near Grace’s Knob,

W.V.F. (W.V.Fitzgerald| (holo: PERTH;

iso: NSW).

Perennial shrub to 0.8 m high, much branched

from the base; branches procumbent or spreading.

Indumentum on branchlets, petioles, peduncles

and pedicels moderately dense; hairs stellate,

0.5—1.0 mm diameter, with stiff, spreading rays.

Leaves concolorous, entire, narrowly oblong to

oblong-ovate, 2.0-5.0 cm long, 0.4—1.2 cm wide,

base cuneate to obtuse; apex obtuse rarely acute;

margin serrulate; indumentum adaxially

moderately dense to dense, abaxially dense to

very dense; hairs stellate, O.5—1.0 mm diameter,

with stiff, spreading rays. Petioles 2-4 mm long.

Austrobatileya 4(4): 495-587 (1997)

Stipules narrowly ovate, 2-3 mm long, sparsely

stellate-hairy. Flowers 1-3, in lateral or leaf-

opposed cymules; cymules | or 2 per node;

peduncles 2—7 mm long; pedicels 1—2 mm long;

bracts narrowly ovate, 1-3 mm long, hirsutellous.

Sepals linear, 6.0-8.0 mm long, 1.0-1.5 mm

wide; indumentum on abaxial surface dense, with

stellate hairs c. 0.5 mm diameter, the adaxial

surface glabrous; appendages subapical, reflexed,

obovate, 2.0-4.0 mm long, distally laciniate,

with indumentum as for abaxial surface of sepal.

Petals obovate, 5.0-6.0 mm long, 2.0—3.0 mm

wide; claw 1.0—-1.5 mm long, pubescent.

Androgynophore c. 0.2 mm iong; glands

transversely elliptic; annulus c. 0.4 mm long,

ciliolate on margin. Stamens 40-45; filaments

3.0-5.0 mm long, glabrous; anthers oblong, c.0.5

mm long. Ovary globose, c. 0.5 mm diameter, 2-

or 3-locular, setose; style 5.0-6.0 mm long,

glabrous; stigma 2- or 3-lobed. Fruit ovoid to

ovoid-globose, 7—9 mm long, 5~7 mm diameter,

densely covered with scale-like stellate hairs c.0.5

mm diameter, sparsely aculeate; prickles conoidal

to hemispherical, 1.0-1.5 mm long, erect, densely

covered with stellate hairs c. 0.5 mm diameter,

terminated by a single slightly curved seta c. 0.4

mm long. Fig. 2C,

Selected specimens: Western Australia. GARDNER District:

nearjunction of Drysdale River & Mogurnda Creek, Drysdale

River N.P., Aug 1975, George 13492 (CANB); 7 km NE of

Beverley Springs Homestead, May 1979, Muir et al. 693

(PERTH); 60 km S of Drysdale River Homestead along

Gibb River-Kalumburu Road, Gibb River crossing, Jun

1992, Halford Q1434 (BRI, DNA, PERTH). FirzGeractp

District: New York Jumps Ups, [5 miles [24 km] W of

Bindelong[Bindoola] Creek, May [967, Bennett 1795

(PERTH); New York Jump Ups, about 90 km SW of

Wyndham, May 1967, Jackson 882 (AD); Barnett River

Gorge, 35 km S of Gibb River Homestead, Jun 1992,

Halford Q1437 (BRI, DNA, K, MEL, PERTH); Karunjie

Station, Durack River, about 140kmSW of Wyndham, May

1967, Jackson 911 (AD); Karunjie Station, Jan 1955, Rust

67 (CANB). Fortescue Districr: Hamersley Range, Weano

Gorge, May 1992, Telford 11757 (BRI, CBG),

Distribution and habitat; T. reflexa occurs in

Western Australia from Grace’s Knob to Rust

Range in the Kimberley, with a single disjunct

collection from Weano Gorge, Hamersley Range

in the Pilbara (Map 8). It grows in shrublands and

woodlands in shallow sandy sous over sandstone

on ridges or on stream margins.

Phenology: Flowers have beenrecorded in January

and May, fruits in May and August.

eA ed Se Dn De

Se an eee

Halford, Australian Tilaceae, 3

Notes: T. reflexa is a very distinctive species

showing no close relationship to any other

Australian Triumfetta species. Itis characterised

by its small ovoid to ovoid-globose fruit, short

conoidal to hemispherical prickles, reflexed

subapical sepal appendages and narrowly oblong

to oblong-ovate leaves.

10. Triumfetta monstrosa Halford sp. nov.

proprea affinitatem speciebus Australianis

ceteris non praebens, quoad appendices

sepalinas valde reflexas similis 7. reflexae

autem ab ea habitu erectiore, indumento

tenui molli ferrugineo usque cinarescenti

partem majorem plante tegente, foltis

anguste ovatis 59.5 cm longis 0.7—3 cm

latis, fructibus formae irregularis facile

distinguitur. Typus: Western Australia.

GARDNER DIsTRICT: SW shore of Vansittart

Bay, 4 km SW of Jar Island, 14°11’S,

126°13’B, 15 June 1985, P.A. Fryxell,

L.A.Craven & J. McD. Stewart 4807 (holo:

PERTH; iso: AD, BRI, CANB, MEL).

Triumfetta sp. E, Rye (1992: 175).

Perennial shrub to 3 m high, sparingly or much

branched from the base; branches spreading or

erect. Indumentum on branchlets, petioles,

peduncles, pedicels, stipules and bracts very dense,

ferruginous to greyish, soft; hairs stellate, 0.2-0.5

mm diameter, with pliable, spreadingrays. Leaves

concolorous, entire, narrowly ovate, 5.0-9.5 cm

long, 0.7-3.0 cm wide; base obtuse or cuneate;

apex acute or obtuse; margin serrulate-crenulate;

indumentum adaxially and abaxially dense, grey,

usually ferruginous along midrib; hairs as for

branchlets. Petioles 5-20 mm long. Stipules

triangular, 5-7 mm long. Flowers 3—5, tn leaf-

opposed or lateral cymules; cymules 1-3 per

node; peduncles 2-10 mm long; pedicels 1-3 mm

long; bracts linear, 1-3 mm long. Sepals linear-

ovate, 5.0-13.0 mm long, 1.5-2.0 mm wide;

indumentum on abaxial surface moderately dense,

with hatrs as for branchlets, the adaxial surface

glabrous; appendages subapical, reflexed, ovate,

1.0-3.0 mm long, entire or shallowly divided

distally, with indumentum as for abaxial surface

of sepal. Petals obovate, 3.0—1 1.Ommlong, 2.0-4.0

mm wide; claw 0.5—1.5 mm long, pubescent.

Androgynophore 0,2—0.6mm long; glands broadly

oblong; annulus 0.7-1.5 mm long, ciliate on

margin. Stamens 30-40; filaments 3.0-8.0 mm

S15

long, glabrous; anthers oblong, c. 0.7 mm long.

Ovary subglobose, 0.5-1.0 mm diameter, 3-

locular, stellate-pubescent, sparsely setose; style

4.0-12.0 mm long, glabrous; stigma 3-lobed.

Fruit depressed globose, 5-8 mm diameter,

irregularly rugose, moderately dense to densely

covered with slender stellate hairs up to 0.7 mm

diameter, sparsely aculeate; prickles conoidal, c.

0.5 mm long, erect or appressed, densely covered

with stellate hairs up to 0.7 mm diameter,

terminated by a single hooked setac. 0.2 mm long.

Fig, 12B.

Additional specimens examined: Western Australia.

GARDNER District: 2.6 km Eof Davidson Point, near Voltaire

Passage, Jun 1987, Kenneally 10305 & Hyland (PERTH);

on peninsula between Montague Sound & Admiralty Gulf,

Jun 1985, Fryxell, Craven & McD.Stewart 4660 (CANB,

DNA, MEL, PERTH); base of Anjo Peninsula east of

Vansittart Bay, May 1984, Chesterfield et al. 296A (MEL);

S shore of Deep Bay off Napier Broome Bay, Jun 1985,

Fryxell, Craven & McD. Stewart 48 ii (CANB, DNA, MEL,

PERTH); 2 km N of ford crossing on King Edward River,

along Mitchell Plateau Road, Jun 1987, Koch 590 (PERTH).

Distribution and habitat: T. monstrosais restricted

to the Kimberley of Western Australia, from

Davidson Pointeastward to Anjo Peninsula (Map

6). It grows in hummock grasslands, open

woodlands and shrublands on stony or sandy soils

on sandstone outcrops and pavements,

Phenology: Flowers have beenrecorded in March

and June, fruits in March, April and June.

Notes: T, monstrosa is a very distinctive species

showing no close relationship to any other

Australian Triumfetta species. It is similar to

T. reflexa in that it has strongly reflexed sepal

appendages, but can be readily distinguished by

its more erect habit, fine, soft, ferruginous to

greyish indumentum that is present over much of

the plant, narrowly ovate leaves 5.0-9.5 cm long

and 0.7—3.0 cm wide, and irregular-shaped fruit.

Etymology: The specific epithet refers to the

irregularly grotesque shape of the fruit; Latin

monstrosus, strange, grotesque, unnatural.

11. Triumfetta johnstonii F, Muell., Australas.

Chem. & Druggist 7: 78 (1885). Type:

[Western Australia}. near the Ord River, in

1884, AF. Johnston [MEL 1530388] (holo:

MEL; iso: K n.v., photo BRD).

516

Perennial shrub to 1 m high, sparingly branched;

branches ascending. Indumentum on branchlets,

petioles, peduncles and pedicels moderately dense

to dense, rough; hairs stellate, 0.7-1.5 mm

diameter, subsessile, with stiff, spreading rays.

Leaves concolorous, entire or shallowly 3- or 5-

lobed, narrowly ovate, 2.0—6.0 cm long, 0.8-2.5

cm wide; base truncate; apex obtuse to acute;

margin irregularly serrulate; indumentum adaxially

and abaxially dense, rough; hairs stellate, | .Q—2.0

mm diameter, with stiff, spreading rays. Petioles

5-10 mm long. Stipules triangular, 2—5 mm long,

densely stellate-hairy. Flowers 2 or 3, 1n leaf-

opposed or lateral cymules; cymules [—3 per

node; peduncles 3—7 mm long; pedicels 3-12 mm

long; bracts linear-lanceolate, 1-4 mm long,

hirsutellous. Sepals linear—ovate, 7.0-11.0 mm

long, 1.5—3.0 mm wide; indumentum on abaxial

surface dense, with coarse, stellate hairs up to 1.5

mm diameter, the adaxial surface glabrous;

appendages subapical, recurved or spreading,

depressed obovate orrarely broadly ovate, 1.0-2.0

mm long, erose, with indumentum as for abaxial

surface of sepal. Petals obovate to broadly obovate,

4.0-9.0mm long, 4.0-7.0mm wide; claw | .0-2.0

mm long, pubescent. Androgynophore c. 0.5 mm

long; glands depressed obovate; annulus c. 0.5

mm long, ciliolate on margin. Stamens 30 or

more; filaments 4,0-7.0mm long, glabrous; anthers

oblong, c. 0.5 mm long. Ovary globose, 1.0—1.5

mm diameter, 2—or 3-locular, setose; style 3.0-6.0

mm long, glabrous; stigma 2— or 3-lobed. Fruit

globose to broadly ovoid, 10-15 mm long, 8-12

mm diameter, densely covered with stout stellate

hairs c.O.5 mm diameter, densely aculeate; prickles

terete, 1.5~2.5 mm long, erect, brittle, with a

mixture of simple and stellate hairs 0.3—-1.0 mm

long on lower two thirds, terminated by a single

hooked seta c. 0.2 mm long. Fig. 3B.

Selected spectmens:; Western Australia, DAMPIER DISTRICT:

Erskine Range, 126 km SE of Derby along Great Northern

Highway, Jun 1992, Halford Q1463 (BRI, DNA, MEL,

PERTH); 8-10 mifes [13-16 km] SE of Myroodah

Homestead, Apr 1972 Aplin 4602 (PERTH); La Grange

Mission, SW of Broome, Apr 1985, Foulkes 171 (CANB).

CANNING District: Anketell Ridge, Great Sandy Desert,

May 1979, Mitchell 1192 (AD, DNA), Fortescue District:

28 km S of ‘Warrawagine’ Homestead, c, 90 km SE of Shay

Gap, Jul 1984, Newbey 10518 (CCANB, PERTH). Northern

Territory. Vicroria River Recion: Tanami Sanctuary, Mar

1973, Henry 660 (DNA). BARKLY TABLELAND REGION: 59

miles {95 km] N of Tennant Creek, Nov 1970, Dunlop 2041

(DNA); Gibson Creek, c. 56 km N of Tennant Creek, Jul

1968, Orchard 889 (AD, DNA); Barkly Tableland, Stuart

Highway, 24 km N of Barkly Highway Junction, Jul 1974,

Austrobaileya 4(4): 495-587 (1997)

Carr 2522 & Beauglehole 46301 (MEL); 7 miles [11 km]

N of Tennant Creek Township, Apr 1948, Perry 524(CANB).

CENTRAL NORTHERN REGION: 4 mile {0.8 km] S fof] The

Devils Marbles, Apr 1970, Parker 145 (DNA); c. 25 km

NNW of Yuendumu, Aug 1981, Latz 8800 (BRI, DNA);

Pulka Currinya, Mt Wedge Station, Jun 1968, Nicholls 891

(AD, BRI, CANB, DNA, MEL); 5 miles [8 km] NW [of]

Auleron, Aug 1962, Nelson 389 (AD, BRI, DNA, MEL).

CENTRAL SOUTHERN REGION: MacDonald Downs Station, c.

255 km NE of Alice Springs, Jul 1936, Ising [AD

966021337}(AD); Mt Liebig area, Apr 1972, Muconochie

1362 (CANB, DNA). Queensland. Burke District: 58 km

S of Gregory Downs on road to Camooweal, Apr 1992,

Hatford Q1023 (BRI, DNA, K, MEL); 23 km SW of Mt Isa

on road to Dajarra, Apr 1992, Halford Q989 (BRI, DNA, K,

MEL); Sybella Creek, between Mt Isa and Dajarra, Jun

1978, Althofer 8535 (BRD.

Distribution and habitat: T. johnstonii occurs

sporadically across northern Australia from near

Shay Gap, Western Australia, through the southern

regions of the Northern Territory to Georgetown,

Queensland (Map 7). It grows in hummock

grassland, shrubland and open woodland

communities in sandy soils on plains and along

watercourses or in skeletal soils onrocky hillsides.

Phenology: Flowers have been recorded from

March to July and November, fruits from March

to August.

Notes: T. johnstonii is characterised by having

glabrous staminal filaments, globose to broadly

ovoid fruit 10-15 mm long and 8—12 mm diameter,

short recurved subapical sepal appendages, and

short, terete prickles with coarse hairs on the lower

two thirds and terminated by a single hooked seta.

T. johnstonitcan be confused with T. aspera,

7. prostrata, T. litticola, T. marsupiata or

7. saccata. For distinguishing features see notes

under each of those species.

12. ‘Triumfetta aspera Halford, sp. noy. similis

T. johnstonii qua appendices sepalinas

depresso-obovatas vel late ovatas [-2 mm

longas recurvatas erosas truncatas et fructus

10-15 mm longos 8—12 mm diam. habet

autem ab ea appendicibus sepalinis c. 4mm

longis erectis integris acutis fructibus parum

majoribus 14-18 mm longis 12-15 mm

diam. differt. Typus: Western Australia.

HALL District: 17 km S of Bungle Bungle

Outcamp at base of Bungle Bungle

Range, 17°30’S, 128°20°E, 7 July 1984,

K.F. Kenneally 9240 (holo: PERTH; iso:

CANB).

Triumfetta sp. G, Rye (1992: 176).

ee Seas gg ace eet eee leeee te Molde eg tees ec seeeeee ee TF hoe

Halford, Australian Tiliaceae, 3

Perennial shrub to | m high, sparingly branched;

branches ascending. Indumentum on branchlets,

petioles, peduncles and pedicels moderately dense,

rough; hairs stellate, 1.0-1.5 mm diameter, with

tuberculate base, and with stiff, spreading rays.

Leaves concolorous, entire, ovate, 4.0-6.0 cm

long, 1.5~—2.5 cm wide; base obtuse; apex obtuse;

margin irregularly serrulate; indumentum adaxiailly

and abaxtally dense, rough; hairs stellate, |.0O—1.5

mim diameter, with stiff, spreading rays. Petioles

5—10 mm long. Stipules triangular, 3-4 mm long,

sparsely to densely stellate-hairy. Flowers 3, in

leaf-opposed or lateral cymules; cymules |~3 per

node; peduncles 4-6 mm long; pedicels 4-6 mm

long; bracts linear or narrowly triangular, 3-4 mm

long, hirsutellous. Sepals linear, c. 10 mm long, c.

2 mm wide; indumentum on abaxial surface

dense, with coarse, stellate hairs c. 0.7 mm diameter,

the adaxial surface glabrous; appendages

subapical, erect, ovate, c.4 mm long, entire, acute,

with indumentum as for abaxial surface of sepal.

Petals obovate, c.6 mm long, c. 4 mm wide; claw

c. | mmlong, tomentose. Androgynophorec. 0.5

mm long; glands quadrangular; annulus c.0.5 mm

long, ciliate on margin. Stamens 30 or more;

filaments 6.0-7.0 mm long, glabrous; anthers

oblong, c. 0.5 mm long. Ovary not seen. Fruit

ovoid, 14-18 mm long, 12-15 mm diameter,

densely covered with stout stellate hairs c.0.5 mm

diameter, densely aculeate; prickles terete, c, 3

nm long, erect, with a mixture of stmple and

stellate hairs 0.5—0.7 mm long on lower two thirds,

terminated by a single hooked seta 0.2 mm long.

Fig. 2D.

Distribution and habitat: T. aspera is known

only from the type collection from the Bungle

Bungle Ranges, east of Halls Creek, Western

Austraha (Map 6). It is recorded as occurring in

reddish sandy clay at the base of a massif.

Phenology: Flowers not seen, fruits have been —

recorded in July.

Notes: T. aspera is very similar morphologically

to T. johnstonii but is distinguished by tts ovate,

subapical sepal appendages which are c. 4 mm

long, erect, entire and acute. In comparison, the

subapical sepal appendages of 7. johnstonii are

depressed obovate or broadly ovate, 1-2 mm

long, recurved, erose and truncate. The fruit of

T. aspera 1s also slightly larger than that of

T. johnstonii 14-18 mm long, 12—15 mm diameter

compared to 10-15 mm long, 8-12 mm diameter).

317

Etymology: The specific epithet refers to the

rough indumentum on the leaves and stems of this

species; Latin asper, rough, uneven, harsh, rugged.

13. Triumfetta prostrata Halford, sp. nov. arte

affinis 7. fitticolae qua aculeos 2~3 mm

longos et appendicem sepalinam

Subapicalem erectam ovatam usque late

ovatam habetautem abeaaculeis breviortbus

{1-1.5 mm longis et appendice reflexa

Obovata differt; propter similitudines

fructuum cum T. johnstonii contundi potest

autem ab ea bene distincta habitu prostrato

floribus parvioribus sepalis 6-8 mm longis

appendicibus reflexis longioribus 2-3 mm

longis ornata (non habitu ascendente usque

erecto, sepalis 7-11 mm _ longis),

appendicibus in T. johnstonii manifeste

distinguitur. Typus: Northern Territory.

DARWIN AND GULF REGION: LOO km FE of

Borroloola on road to Wollogorang

Homestead, 0.6 km E of Foelsche River

crossing, 16°12’S, 136°55’E, 9 April 1992,

D. Halford Q\O55 (holo: DNA; iso: BRI,

CANB, K, L, MEL, MO, PERTH),

Perennial shrub much branched from the base;

branches procumbent, 0.2—1.0 m long.

Indumentum on branchlets, petioles, peduncles

and pedicels moderately dense, rough; hairs

stellate, 0.3—1.0mm diameter, withstiff, appressed

or spreading rays. Leaves concolorous, entire or

occasionally shallowly 3-lobed, ovate to broadly

ovate, 3.0-5.0 cm long, 2.5—3.5 cm wide; base

obtuse; apex obtuse or acute; margin irregularly

serrate; indumentum adaxially and abaxtially sparse

fo moderately dense; hairs stellate, 0.2—0.7 mm

diameter, with suff, appressed rays. Petioles 5—15

mm long. Stipules narrowly triangular, 3-5 mm

long, densely stellate-hairy. Flowers 2 or 3, inleaf-

opposed or lateral cymules; cymules | or 2 per

node; peduncles 1—2 mm long; pedicels 2-4 mm

long; bracts triangular, 1-3 mm long, hirsutellous.

Sepals linear, 6.0-8.0 mm long, c. 1 mm wide;

indumentum on abaxial surface dense, withcoarse,

stellate hairs c. 0.7 mm diameter, the adaxial

surface glabrous; appendages subapical, reflexed,

obovate, 2.0-3.0 mm long, distally lacerate, with

indumentum as for abaxial surface of sepal. Petals

obovate, 4.0-6.0 mm long, 1.5~-2.0 min wide;

clawc. 0.7 mim long, tomentose. Androgynophore

c.0.5 mm long; glands depressed elliptic; annulus

c.0.5 mm long, ciliolate on margin. Stamensc. 40;

518

filaments 3.0-4.0 mm long, glabrous; anthers

oblong, c. 0.5 mm long. Ovary globose, c. 1 mm

diameter, 2-locular, setose; style 4.0-6.0 mm

long, glabrous; stigma minutely toothed. Fruit

globose, 8-12 mm diameter, densely covered

with stout stellate hairs c. 0.5 mm diameter,

densely aculeate; prickles subterete, tapering

towards the apex, 1.0-1.5 mm long, erect, with a

moderately dense covering of simple and stellate

hairs c. 0.5 mm long on lower third, terminated by

a single hooked seta c. 0.2 mm long. Fig. 6A.

Additional specimens examined: Northern Territory.

DARWIN AND GULF REGION: McArthur River area, Jun 1976,

Craven 4153 (CANB); Nicholson River, Nicholson Block,

May 1984, Strong 248 (DNA).

Distribution and habitat: T. prostrata occurs in

the Northern Territory, from Borroloola to

Wollogorang Homestead (Map 6). It grows in

eucalypt forests on sandy soils near watercourses.

Phenology: Flowers have been recorded in April,

fruits in May and June.

Notes: T. prostratais closely related to 7. litticola

but can be readily distinguished by its shorter

prickles (i—1.5 mm long compared to2.0-3.0 mm

long) and reflexed, obovate rather than erect,

ovate to broadly ovate subapical sepal appendages.

T. prostrata could be confused with 7. johnstonii

because of similarities in the fruits. However,

T. prostratais well distinguished from 7. johnstonii

by its prostrate habit (ascending to erect habit in

7. johnstonit), smaller flowers (sepals 6.0—-8.0

mm long compared to 7.0-11.0 mm long) and

longer, reflexed, subapical sepal appendages

(2.0-3.0 mm long compared to 1.0-2.0mm long).

Etymology: The specific epithet refers to the

species habit; Latin prostratus, prostrate.

14, Triumfetta litticola Halford, sp. nov. arte

affinis 7. prostratae qua aculeos 1—1.5 mm

longos et appendicem sepalinam reflexam

obovatam habet autem ab ea aculeis

longioribus 2-3 mm longis et appendice

erecta ovata usque late-ovata differt; propter

similitudines fructuum confundi potest

autem ab ea bene distincta habitu prostrata

(non habitu ascendente usque erecto) et

appendicibus sepalinis subapicalibus erectis.

Typus: Northern Territory. DARWIN AND

GuLF ReGion: c. 15 km SE from Cape

Cockburn, 11°24’S, 132°58’E, | June 1988,

JZ. Weber 10005 (holo: DNA; iso: AD).

Austrobatleya 4(4): 495-587 (1997)

Perennial shrub; branches procumbent up to 2 m

long. Indumentum on branchlets, petioles,

peduncles and pedicels sparse to moderately dense,

rough; hairs stellate, 0.5~-1.0 mm diameter,

subsessile, and with stiff, brittle, spreading rays.

Leaves concolorous, entire or shallowly 3-lobed,

ovate to broadly ovate, 2.0-4.0 cm long, 1.5-2.5

cm wide; base truncate or slightly cordate; apex

obtuse; margin serrulate; indumentum adaxially

and abaxially sparse to moderately dense; hairs

stellate, 0.40.7 mm diameter, with stiff, brittle,

spreading to appressed rays. Petioles 5-8 mm

long. Stipules narrowly triangular, 3-5 mm long,

sparsely stellate-hairy. Flowers 3, in leaf-opposed

cymules; cymules solitary at nodes; peduncles

6—10 mm long; pedicels 3-5 mm long; bracts not

seen. Sepals linear, c. 9 mm long, 1.5-—2.0 mm

wide; indumentum on abaxial surface, with coarse,

stellate hairsc. 1 mm diameter, the adaxial surface

glabrous; appendages subapical, erect, ovate to

broadly ovate, c. 2 mm long, entire or erose,

glabrous or with scattered stellate hairs c. 0.7 mm

diameter. Petals obovate, c.5 mm long, 2.5~3.0

mm wide; claw c. 0.5 mm long, with afew hairs on

margin. Androgynophore c. 0.4 mm long; glands

depressed obovate; annulus c. 0.5 mm long,

ciliolate on margin. Stamens 55-60; filaments

2.—).0mm long, glabrous; anthers oblong, c. 0.5

mm long. Ovary globose, 1.0-1.5 mm diameter,

3-locular, setose; style4.0—-5.0mm long, glabrous;

stigma 3-lobed. Fruit ovoid-globose, 10-13 mm

long, 10-13 mm diameter, densely covered with

stout stellate hairs c. 0.5 mm diameter, densely

aculeate; prickles subterete, 2.0-3.0 mm long,

erect, with a dense covering of stellate hairs up to

0.4 mm long on lower two thirds, terminated

either by a single hooked seta or rarely by 2—5

recurved setae c. 0.1 mm long. Fig. 2E.

Selected specimens: Northern Territory. DARWIN AND

GULF ReGcion: Cape Shield, Blue Mud Bay, May 1993,

Leach 3636 & Cowie (BRI).

Distribution and habitat: T. litticola is know

from near Cape Cockburn and Cape Shield,

Arnhem Land, in the Northern Territory (Map 5).

It has been recorded on a sandy foreshore and in

coarse lateritic sand on a rocky headland.

Phenology: Flowers have been recorded in May

and June, fruits in June.

Notes: T. litticolais closely related to T: prostrata

but can be readily distinguished by its longer

SE TSAR BOSS WEEE SEAS TTL EUROS ve econ even ne en eee ee

Halford, Australian Tiliaceae, 3

prickles (2.0-3.0 mm long compared to 1.0—1.5

mm long) and erect, ovate to broadly ovate

rather than reflexed, obovate subapical sepal

appendages, 7. litticola can be confused with

T. johnstonii because of similarities in the fruits.

However, T. litticola is clearly distinguishable

from 7. johnstonii by its prostrate habitrather than

as ascending to erect habit and erect subapical

sepal appendages.

Pullen 9363 (CANB, DNA) from Bulman

Station, Arnhem Land, resembles T. litticola in

vegetative and floral characters, but differs from

thatin having oblong-ellipsoidal fruit and a sparser

covering of shorter prickles on the fruit. This

situation requires further investigation and the

specimen may represent a distinct taxon.

Etymology: The specific epithet refers to the

habitat in which the species has been recorded;

Latin littus sea-shore, and -cola dweller.

15, Triumfetta marsupiata Halford, sp. nov.

arte affinis 7. saccatae qua fructus 10-12

mm longos 13-15 mm diam. et aculeos 3-4

mm longos habet autem ab ea fructibus

amplioribus 18-20 mm longis 16-20 mm

diam. et aculeis longioribus 5—7 mm longis

differt. Quoad habitum 7) marsupiatasiunilis

T. johnstonii autem ab ea appendicibus

amplis marsupiatis ad circa dimidium secus

sepala affixis, aculeis longioribus 5-7 mm

longis (non 1.5—2.5 mm longis) et fructibus

grandioribus 18-20 mm longis 16-20 mm

diam. (non 10-15 mm longis 8-12 mm

diam.) facile distinguitur. Typus:

Queensland. BurKE District: L1Okm NW of

Kajabbi, along dismantled railway line to

Mt Cuthbert Mine, 20°00’S, 139°58’E,

6 April 1992, D. Halford Q994 (holo: BRI;

iso: CANB, DNA, K, L, MEL, PERTH).

Perennial shrub to 1 m high, much branched;

branches ascending. Indumentum on branchlets,

petioles, peduncles, pedicels, stipules and bracts

sparse to dense, rough; hairs stellate, 1.0-2.0 mm

diameter, sometimes with tuberculate base, and

with pliable to stiff, spreading toerectrays. Leaves

concolorous, entire or shallowly 3-lobed, ovate to

broadly ovate, 3.0-8.0cm long, 2.0-4.0. cm wide;

base rounded or slightly truncate; apex obtuse or

acute; margin irregularly serrulate; indumentum

adaxially and abaxially moderately dense to dense

519

rarely sparse; hairs stellate, 0.5—1.5 mm diameter,

with pliable to stiff, spreading toerectrays. Petioles

5~20 mm long. Stipules narrowly triangular, 3—5

mm long. Flowers 2 or3, in leaf-opposed or lateral

cymules; cymules solitary at nodes; peduncles

5—10 mm long; pedicels 5-10 mm long; bracts

narrowly ovate, 4—6 mm long. Sepals persistent,

linear, 14.0-16.0 mm long, 2.0-3.0 mm wide;

indumentum on abaxial surface dense, with coarse,

stellate hairs up to 1.5 mm diameter, the adaxial

surface glabrous; appendages attached halfway

along sepal, inflexed, pouch-like, narrowly ovate

in outline, 8.0-10.0 mm long, entire, withincurved

margins, and with indumentum as for abaxial

surface of sepal. Petals broadly obovate, 8.0—10.0

mm long, 8.0-10.0 mm wide; claw 1.0-2.0 mm

long, tomentose. Androgynophore c, 0.5 mm

long, with one continuous gland covering whole

surface; annulus c. 0.5 mm long, ciliolate on

margin. Stamens 30 or more; filaments 3.0-8.0

mm long, glabrous; anthers oblong, c. 0.6 mm

long. Ovary globose, c.2 mm diameter, 3-locular,

setose; style 10.0—12.0mm long, glabrous; stigma

minutely toothed. Fruit ovoid to globose-ovoid,

18—20 mm long, 16-20 mm diameter, densely

covered with stout stellate hairsc. 1 mm diameter,

densely aculeate; prickles terete, 5.0-7.0 mm

long, erect, brittle, with adense covering of stellate

hairs 0.5-1.5 mm long on lower two thirds,

terminated by single hooked seta c. 0.2 mm long.

Fig. 8A.

Selected specimens: Queensland. Burke Disrricr: 52 km

E of Croydon along road to Georgetown, Little River

crossing, Apr 1992, Halford Q974 (BRI, CANB, DNA, K,

L, MEL, PERTH); near (17 miles [27 km] SE of) Croydon,

Jul 1954, Blake 19574A (BRI, DNA); Kamilarol, about 100

miles [161 km] NNW of Cloncurry, Apr 1954, Everist 5277

(BRI, DNA n.v.); Mount Cuthbert, 13 km W of Kajabbi, Jun

L991, Harris 670 (BRD. Cook Districr: ‘Mt Surprise’

Elizabeth Creek area between creek and Six Mile Road, Apr

1992, Champion 648 (BRI, DNA).

Distribution and habitat: T. marsupiata occurs

in north western Queensland from Mt Isa east to

the Great Dividing Range (Map 8). [t grows in

low open woodlands in shallow rocky soils on

ridges or in sandy soils along watercourses.

Phenology: Flowers have been recorded in April,

fruits in April, June and July.

Notes: T. marsupiata is closely related to

7. saccata but can be distinguished by its larger

fruit (8-20 mm long x 16-20 mm diameter

520

compared to 10-12 mm long x 13-15 mm

diameter) and longer prickles (5.0-7.0 mm jong

compared to 3.0-4.0 mm long). 7. marsupiata

resembles 7. johnstonii in its habit. However, itis

easily distinguishable from that by having large

pouch-like appendages attached approximately

halfway along the sepal, longer prickles (5.0-7.0

mm long compared to 1.5-2.5 mm long) and

larger fruit(18—-20 mm long x 16-20 mm diameter

compared to 10-15 mmlong x 8-12mm diameter).

Etymology: The specific epithet refers to the

pouched sepal appendage; Latin marsupiatus

pouched.

16. Triumfetta saccata Halford sp. nov. similis

T. marsupiatae qua fructus 18-20 mm

longos 16-20 mm diam. et aculeos 5~7 mm

longos habet autem ab ea fructibus

parvioribus 10-12 mm longis [3-15 mm

diam. et aculeis brevioribus 3-4 mm longis

differt. Quoad formam foliorum

fructuumque 7. saccata cum T. johnstonii

confundi potest autem ab ea aculeis

longioribus et appendicibus sepalinis

iarsupiatis facile distinguitur. Typus:

Western Australia. FirzGeRALD DISTRICT:

43.3 km N of Springvale Homestead, + 40

km W of Great Northern Highway, +84 km

N of Halls Creek, June 1976, A.C.

Beauglehole ACB53465 (holo: PERTH).

Triumfetta sp. A, Rye (1992: 174).

Perennial shrub. Indumentum on branchlets,

petioles, peduncles, pedicels, stipules and bracts

dense, rough; hairs stellate, 1.5—2.0 mm diameter,

with tuberculate base, and with stiff, spreading to

erect rays. Leaves concolorous, entire, narrowly

ovate, 3.0-6.0 cm Jong, 1.0-1.5 cm wide; base

rounded or slightly truncate; apex obtuse or acute;

margin irregularly serrulate; indumentum adaxially

and abaxially dense; hairs stellate, 0.5-1.7 mm

diameter, with stiff, spreading toerectrays. Petioles

5—8 mm long. Stipules narrowly triangular, 5-6

mm long. Flowers 2 or 3, in leaf-opposed or lateral

cymules; cymules solitary at nodes; peduncles

5—8 mm long; pedicels 10-15 mm long; bracts

narrowly triangular, 4-5 mm long. Flowers not

seen except for persistent sepals. Sepals somewhat

persistent, linear, c. 12 mm long, c.2 mm wide;

indumentum on abaxial surface dense, with stellate

hairs c. 1.5 mm diameter, the adaxial surface

Austrobaileya 4(4): 495-587 (1997)

glabrous; appendages attached halfway along

sepal, inflexed, pouch-like, narrowly ovate in

outline, 10.0-12.0 mm long, entire, with incurved

margins, and with indumentum as for abaxial

surface of sepal. Petals notseen, Androgynophore

not seen. Stamens not seen. Ovary not seen. Fruit

globose-ovoid, [0-12 mm long, 13-15 mm

diameter, densely covered with stout stellate hairs

c. | mm diameter, densely aculeate; prickles

terete, 3.0-4.0mm long, erect, brittle, with adense

covering of stellate hairs 0.5-1.5 mm long on

lower two thirds, terminated by single hooked seta

c. 0.2 mm long. Fig. 2F.

Distribution and habitat: T. saccata is known

only from the single specimen from Springvale

Station, east Kimberley, Western Australia (Map

7). No habitat information is available.

Phenology: Flowering period unknown, fruits

have been recorded in June.

Notes: T. saccata resembles 7. marsuptata but

can be distinguished by its smaller fruit (10-12

mm long x [3-I5 mm diameter compared to

18-20 mm long x 16-20 mm diameter) and

shorter prickles (3.0-4.0 mm long compared to

5.0-7.0 mm long). 7. saccata can be confused

with 7) johnstonii as ithas similarly shaped leaves

and fruits. 7. saccafais readily distinguished from

that by its longer prickles and pouched sepal

appendages.

Etymology: The specific epithet refers to the

pouched sepal appendage; Latin saccus pouched,

bag-shaped.

17. Triumfetta hapala Halford, sp. nov.

affinitatem claram cum speciebus

Australianis ceteris non praebens; quoad

fructus setis longis filiformibus confertim

obtectos maxime prope apicem sepali

affixas habet autem ab ea appendicibus

amplis marsupiatis ad circa dimidium

secus sepala affixis et indumento longo

molli ramulorum foliorumque facile

distinguitur; quoad appendices sepalinas

marsuplatas 7. marsupiatae et 7. saccatae

similis autem ab eis fructibus setis longis

filiformibus obtectis et indumento longo

molli ramulorum foliorumque differt.

Typus: Western Australia. FirzGERALD

District: Louisa Downs Station, 150 km

mee eee SLE CUE ip gh EEE DE va ve eevee etn DLL a eee eeeee en ener nen Ta ne ye gee

Halford, Australian Tiliaceae, 3

Eof Fitzroy Crossing along Great Northern

Highway, 18°45’S, 126°38’E, 5 June 1992,

D.Halford Q1472 (holo: PERTH; iso:

BRI, CANB, DNA, MEL, K).

Perennial shrub to 0.5 m high, much branched;

branches ascending to erect, Indumentum on

branchlets, petioles, peduncles, pedicels, stipules

and bracts dense, soft; hairs stellate, 2.0-3.0 mm

diameter, shortly stalked, with pliable, erect to

spreading rays, Leaves concolorous, entire, ovate,

5.0-8.0cm long, 2.5-4.0cm wide; base cordate to

truncate; apex acute; margin serrate; indumentum

adaxially and abaxially dense; hairs stellate,

2.0-3.0 mm diameter, with pliable, erect to

spreading rays. Petioles 15-20 mm long. Stipules

linear-subulate, 7-10 mm long. Flowers 2 or 3, in

leaf-opposed cymules; cymules solitary at nodes;

peduncles 5—8 mm long; pedicels 15-18 mm

long; bracts linear-filiform, 7—10mm long. Sepals

persistent in fruit, narrowly triangular, 8.0-15.0

mm long, c.2 mm wide; indumentum on abaxial

surface dense, with stellate hairsc.2 mmdiameter,

the adaxial surface glabrous; appendages attached

on lower third of sepal, inflexed, pouch-like,

narrowly ovate in outline, 7.0-15.0 mm long,

entire, with incurved margins, and with

indumentum as from abaxial surface of sepal.

Petals obovate, 7.0-11.0 mm long, 5.0-9.0 mm

wide; claw c. 1 mm long, pubescent.

Androgynophorec. 0.2mm long; glands depressed

ovate; annulusc. 0.5 mm long, ciliolateon margin.

Stamens 30 or more; filaments 4.0-9.0 mm long,

glabrous; anthers oblong, c. 0.5 mm long. Ovary

globose, c. | mm diameter, 3-locular, setose; style

9,0-11.0 mm long, glabrous; stigma 3-lobed.

Fruit globose, 10-20 mm diameter, densely

covered with slender stellate hairs c. 1.5 mm

diameter, densely setose; bristles filiform, 7.0-10.0

mm long, weakly ascending, brittle, densely

covered with simple and stellate hairs 1-2 mm

long, terminated by asingle erect seta 0.5—1.0 mm

long. Fig. 1G.

Additional specimens examined; Western Australia.

FitzGeRALD District: Rocky Springs, Louisa Downs Station,

Jul 1990, Handyasyde 9 (PERTH).

Distribution and habitat: T. hapala is known

from two collections from Louisa Downs Station

in the Kimberley, Western Australia (Map 4). It

grows in open shrublands in coarse sandy granitic

soils on low hills.

521

Phenology: Hlowers have been recorded in May,

fruits in May and July.

Notes: T. hapala is a very distinctive species

showing no clear relationship to any other

Australian 7riumfetta species. It resembles

T. plumigera in having fruit densely covered

with long filiform bristles, but it is easily

distinguishable by its large, pouched-like sepal

appendages that are attached approximately

halfway along the sepal rather than small,

subulate sepal appendages that are attached

very close to the sepal apex, and the long, soft

indumentum on its branchlets and leaves. T

hapalais similar to 7. marsupiataand T. saccata

in having pouched sepal appendages but differs

from that by the dense covering of long filiform

bristles on its fruit, and long, soft indumentum

on its branchlets and leaves.

Etymology: The specific epithet is from the Latin

hapalus meaning ‘soft to the touch’, in reference

to the softness of the whole plant.

18. Triumfetta ramosa Sprague & Hutch., Bull.

Misc. Inform. (6):257~—258 (1909). Type:

[Western Australia]. Nicol Bay and De

Grey River, [undated], Ridley’s Expedition

(holo: K).

Perennial shrub to 1 m high, sparingly branched;

branches spreading to erect. Indumentum on

branchlets, petioles, peduncles, pedicels and

stipules dense; hairs stellate, of two size classes;

class 1 hairs c. 0.3 mm diameter, with pliable,

appressed rays; class 2 hairs c. 1 mm diameter,

with stiff, spreading rays. Leaves discolorous,

entire or shallowly 3-lobed, broadly to very broadly

ovate or orbicular, |.5-4.5 cm long, 1.04.5 cm

wide; base cordate; apex rounded or obtuse; margin

erose; indumentum adaxially and abaxially dense

to very dense; hairs stellate, of two size classes;

class | hairs c. 0.5 mm diameter, with pliable,

appressed rays; class 2 hairs particularly on veins,

Q.5—1.0 mm diameter, with stiff, spreading rays.

Petioles 5-10 mm long. Stipules narrowly

triangular, 2-3 mm long. Flowers 2-4, in leaf-

opposed or lateral cymules; cymules 1 or 2 per

node; peduncles 3-5 mm long; pedicels 5—15 mm

long; bracts ovate, 1.5—3 mm long, hirsutellous.

Sepals linear, 8.0-12.0 mm long, 1.0-2.0 mm

wide; indumentum on abaxial surface dense, with

coarse, stellate hairs c. 0.7 mm diameter, on

522

adaxial surface densely stellate-villous near base;

appendages subapical, spreading to erect, narrowly

ovate to ovate, 2.0-4.0 mm long, entire, with

indumentum as for abaxial surface of sepal. Petals

very broadly obovate, 5.0-7.0 mm long, 4.0-6.0

mm wide; claw 1.0-2.0 mm long, tomentose.

Androgynophore c. 0.5 mm long; glands

quadrangular covering whole surface; annulus

c.0.3 mm long, ciliolate on margin. Stamens 30

or more; filaments 3.0-6.0 mm long, glabrous;

anthers oblong, c. 0.5 mm long. Ovary globose,

c. [mm diameter, 3-locular, densely hirsutellous;

style 8.0-9.0 mm long, glabrous; stigma 3-

lobed. Fruit globose, 20-30 mm diameter,

densely covered with slender stellate hairs c. 0.4

mm diameter, densely setose; bristles subterete,

5.0-12.0 mm long, erect, pliable, densely

covered with simple, bifid and stellate hairs

0.5—2.0 mm long, terminated by 2—5 curved or

flexed setae up to 0.5 mm long. Fig. 4C.

Selected specimens; Western Australia. CARNARVON

District: 3 miles [4.8 km] N of Exmouth, Sep 1970, George

10323 (PERTH); Cranks Well on the North-West Coastal

Highway, Oct 1975, Weber 4874 (AD, PERTH); 30 km E

of Yanrey Homestead, Jun 1976, Mitchell 76/144 (PERTH).

FortTescug Districr: Barrow Island, Jul 1964, Geodall 1538

(PERTH); Boodardee, about {5 miles [24 km] W of Port

Hedland, Sep 1969, Everist 9188 (BRD; Port Hedland,

undated, Cleland B.1824 (PERTH); 44 miles [71 km] from

Port Headland [to] Wittenoom, Aug 1967, Giftins 1468

(PERTH); Mundabullangana Station, S of Port Hedland,

Apr 1958, Burbidge 5797 (AD, CANB, PERTH); 6 km

along Great Northern Highway-Shellborough track, 33 km

NW of Goldsworthy, Aug 1977, Telford 6513 (CBG,

PERTH); Callawa Creek, Callawa Station, Jun 1947, Royce

1943a (PERTH).

Distribution and habitat: T. ramosais widespread

in near-coastal areas of the Pilbararegion, Western

Australia (Map 5), It grows in open shrublands

and hummock grasslands in stony or sandy soils

on hills, sandplains and along watercourses.

Phenology: Flowers have been recorded from

April to June and August, fruits in April and from

June to October.

Notes: T. ramosa is characterised by having

glabrous staminal filaments, globose fruit 20-30

mm diameter, narrowly ovate to ovate, spreading

toerectsubapical sepal appendages, and numerous

slender bristles with hairs along their full length

and terminated by 2 to 5 setae.

Demarz D5742 (PERTH) and Beard 2852

(PERTH) resemble specimens of T. ramosa in

Austrobaileya 4(4): 495-587 (1997)

general leaf morphology but differ from them in

fruit and sepal appendage characters. The bristles

on the fruit are terminated by a single hooked seta

and the sepal appendages are spreading and

obovate with an acuminate apex. These are

somewhat intermediate between 7. ramosa and

forms of T. propinqua. Further material is required

before a decision can be made as to whether this

material represents a distinct taxon.

19, Triumfetta tenuiseta Halford, sp. nov. valde

affinis T. ramosae qua fructus 20-30 mm

diam. setis 5-12 mm longis obtectos habet

autem ab ea fructus amplioribus 30-50 mm

diam. setis 15~25 mm longis obtectis et

indumento minus denso ex pilis sessilibus et

breviter stipitatis constanti in ramulis

foltisque differt. Typus: Western Australia.

CARNARVON District: behind Harold E. Holt

Communication Centre, Exmouth, 6

September 1970, K.M. Allan 472 (holo:

PERTH; iso: CANB, MEL).

Perennial shrub to 1 m high; branches spreading

or ascending. Jndumentum onbranchlets, petioles,

peduncles, pedicels and stipules moderately dense

to dense; hairs stellate, 0.5—0.8 mm diameter,

sessile or shortly stalked, with pliable, spreading

rays. Leaves discolorous, entire, ovate to very

broadly ovate or orbicular, 2.0-3.0 cm long,

1.5—3.0 cm wide; base rounded; apex obtuse to

rounded; margin serrulate; indumentum adaxially

and abaxially dense to very dense; hairs stellate,

0.5—0.8 mm diameter, shortly stalked, with stuf,

spreading rays. Petioles 8-15 mm long. Stipules

triangular, 1~2 mm long. Flowers 2 or 3, in leaf-

opposed cymules; cymules solitary at nodes;

peduncles 4-8 mm long; pedicels 7-10 mm long;

bracts ovate, 1-2 mm long, hirsutellous. Sepals

linear, 9.0-10.0 mm long, c. 2 mm wide;

indumentum on abaxial surface dense, with minute,

stellate hairs c. 0.3 mm diameter, on abaxial

surface densely stellate-villous towards base;

appendages subapical, spreading, oblong or

obovate, c. 2 mm long, entire or erose, with

indumentum as for abaxial surface of sepal. Petals

obovate, 6.0-8.0 mm long; claw 0,7—1.0 mm

long, pubescent. Androgynophorec. 0.5 mm long;

glands covering whole surface; annulus c.0.5 mm

long, ciliolate on margin. Stamens 60—/0; filaments

4,0-5.0 mm long, glabrous; anthers oblong, c. 0.5

mm long. Ovary globose, c. 1.5 mm diameter, 3-

Halford, Australian Tiliaceae, 3

locular, setose; style 6-7 mm long, glabrous;

stigma 3-toothed. Fruit globose, 30-50 mm

diameter, densely covered with slender stellate

hairs c. 1 mm diameter, densely setose; bristles

filiform, 15.0-25.0 mm long, weakly ascending,

pliable, with a moderately dense covering of bifid

and stellate (rarely simple) hairsO.5—1.0 mmlong,

terminated by 1—8 hooked or slightly curved setae

c. 0.3 mm long. Fig. 4E.

Additional specimens examined: Western Australia.

CARNARVON District: Exmouth, May 1965, George 6700

(PERTH); 186 km from Ashburton River crossing along

North West Coastal Highway towards Carnarvon, Aug

1977, Telford 6627 & Butler (PERTH); c. 160 km from

Carmarvon, Gascoyne River Road junction, North West

Coastal Highway, Aug 1969, Ashby 2949 (AD, CANB,

MEL); 20 miles [32 km] S of Minilya River, NW Coast

Highway, Sep 1960, George 1458 (PERTH); Roebourne—

Carnarvon, undated, Clyne 60 (NSW),

Distribution and habitat: T. tenuisetais confined

to the Pilbara region, Western Australia, from

North West Cape south to Minilya River (Map 2).

It grows in shrublands on red sand dunes.

Phenology: Flowers have been recorded in May,

fruits in August and September.

Notes: T. tenuiseta is closely related to T. ramosa

but can be distinguishd by its much larger fruit

(30-50 mm diameter compared with 20-30 mm

diameter) and longer bristles (bristles 15—25 mm

long compared to 5-12 mm long), the shorter

indumentum on the bristles and by theindumentum

on the leaves and branchlets which ts less dense

and consists of sessile and shortly stalked hairs.

Etymology: The specitic epithet refers to the long

slender bristles on the fruit; Latin fenuis slender,

seta bristle.

20. Triumfetta appendiculata F. Muell., Fragm.

3: 7 (1862) Type: [Western Australia].

Nichol Bay, P. Walcott [MEL 223679]

(holo: MEL ; iso(?): K n.v., photo BRD).

Perennial shrubto 1.5 mhigh; branches decumbent,

spreading or ascending. Indumentum on

branchlets, petioles, peduncles, pedicels, stipules

and bracts very dense, soft; hairs stellate, of two

size Classes: class 1 hairs 0.5—1.0 mm diameter,

subsessile, with flaccid, spreading rays; class 2

hairs 2.0-4.0 mm diameter, on stalks c. 0.2 mm

long, and with flaccid, spreading rays. Leaves

523

discolorous, entire, ovate to very broadly ovate,

3,0-5.0 cm long, 3.0-5.0 cm wide; base cordate;

apex obtuse to rounded; margin irregularly

serrulate; indumentum adaxially and abaxially

dense to very dense; hairs stellate, of two size

classes although notalways readily distinguishable;

class | hairs 0.5—1.0 mm diameter, subsessile,

with flaccid, spreading rays; class 2 hairs 2.0-4.0

mim diameter, with flaccid, spreading rays. Petioles

10-30 mm long. Stipules narrowly triangular,

5—12 mm long. Flowers 2 or 3, in leaf-opposed or

lateral cymules;cymules | or2 pernode; peduncles

5—10 mm long; pedicels 10-15 mm long; bracts

narrowly triangular, 4-7 mm long. Sepals linear,

11.0-15.0 mm long, 2.0~3.0 mm wide;

indumentum on abaxial surface dense, with shortly

stalked stellate hairs up to 2 mm diameter, on

adaxial surface densely stellate-villous on proximal

fifth; appendages subapical, spreading, broadly

obovate, 2.0-3.0 mm long, usually shallowly

divided distally, with indumentum as for abaxial

surface of sepal. Petals very broadly obovate,

6.0—7.0 mm long, 5.0-6.0 mm wide; claw 1.0-2.0

mm long, pubescent. Androgynophore c. 0.5 mm

long; glands depressed obovate; annulus c, 0.5

mm long, ciliolate on margin. Stamens 40 or

more; filaments 4.0—-7.0 mm long, glabrous;

anthers oblong, c. 0.7 mm long. Ovary globose,

c. | mm diameter, 3-locular, setose; style c. &

mim long, glabrous; stigma 3-lobed. Fruit ovoid,

12-20 mm long, 10-15 mm diameter,

moderately to densely covered with slender

stellate hairsc.2 mm diameter, densely aculeate;

prickles subterete, tapering towards the apex,

3.0-4.0 mm long, erect, with a moderately dense

covering of stellate hairs 0.5—1.5 mm long on

lower half, terminated by a single hooked seta c.

0.2 mm long. Fig. 3A.

Selected specimens: Western Australia. Fortescue

District: Dolphin Island, Dampier Archipelago, Jun 1962,

Royce 7165(PERTH); H.E. Lookout, Dampier Island, Burrup

Peninsula, Aug 1984, Glennon 335 (PERTH); Lewis Island,

Dampier Archipelago, Jun 1962, Royce 7380 (PERTH);

near sewerage tanks, Bullgarra cell, Karratha, Jan 1987,

Glennon 301 (PERTH); Devils Creek, Oct 1985, Demarz

10845 (PERTH); North-West Coastal Highway, c. 65 kmby

road WSW of main Dampier turnoff, c. 7 km by road NE of

Spotwell Creek bridge, Aug 1977, Jackson 3042 (AD, BRI);

Fortescue River, Oct 1941, Gardner 6253 (PERTH);

Hamersley Range, in 1938, Barnett [PERTH 01533630]

(PERTH).

Distribution and habitat: T. appendiculata

is restricted to the Pilbara region of Western

524

Australia. It occurs on islands of the Dampier

Archipelago and in the Karratha district with a

single disjunct location in the Hamersley Range

(Map 4). It grows in stony or red clay soils on

rocky hillsides.

Phenology: Flowers have been recorded tn June,

fruits in June, August and October.

Notes: This species name has been misapplied

across northern Australia for many years. This is

largely due to Bentham’s (1863) broad concept of

the species.

There are three flowering specimens in

MEL collected in the 1870s (Sherlock and Yule

River, Forrest [MEL 227276]; Nicol Bay,

Crouch [MEL 227277]; near Jones Creek and

George River, south of Roebourne, Forest

[MEL 227269]) that superficially resemble

T. appendiculata but differ by having a much

longer indumentum on the stems and leaves,

and much larger flowers. I have not seen any

recent material that matches these collections.

They appear to represent an undescribed taxon

from the Pilbara. However, more material of

this taxon is required before a definite conclusion

on its status can be drawn.

21. Triumfetta propinqua Halford, sp. nov.

valde affinis 7. appendiculatae qua fructus

12-20 mm longos, 10-15 mm diam. et

aculeos 3-4 mm longos et appendices

sepalinas 2—3 mm longas habet autem ab ea

fructibus grandioribus 20-25 mm longis

20-25 mm diam. et aculeis longioribus 6-7

mm longis et appendicibus amplioribus 3-6

mm longis differt. Typus: Western

Australia. ForTescug District: Hancock

Gorge, 350 m from Gordon Oxer Lookout,

Hamersley Range National Park, 26

September 1979, M. Trudgen 1118 (holo:

PERTH).

Perennial shrub up to 2 m high, much branched;

branches ascending. Indumentum on branchlets,

petioles, peduncles and pedicels dense, usually

felt-like; hairs stellate, of two size classes; class |

hairs up to0.8 mm diameter, with flaccid, spreading

rays; class 2 hairs 1.0-2.0 mmdiameter, sometimes

shortly stalked, and with flaccid to pliable,

spreading rays. Leaves discolorous, entire or

shallowly 3-lobed, ovate to very broadly ovate,

Austrobaileya 4(4): 495-587 (1997)

3.0-7.0 cm long, 2.0-6.0 cm wide; base cordate;

apex obtuse to rounded; margin erose or serrulate;

indumentum adaxially and abaxially dense to very

dense; hairs as for branchlets. Petioles 5~30 mm

long. Stipules narrowly triangular, 5-10 mm long,

densely stellate-hairy. Flowers 2 or 3, in leaf-

opposed or lateral cymules; cymules |—3 per

node, sometimes forming lax paniculate

inflorescences by reduction of subtending leaves;

peduncles 8-20 mm long; pedicels 5-10 mm

long; bracts narrowly ovate, 4-7 mm long,

hirsutellous. Sepals linear, 10.0-18.0 mm long,

|.0-3.0mm wide; indumentum on abaxial surface

dense, with shortly stalked stellate hairs 1.0—2.0

mm diameter, on adaxial surface densely stellate-

villous near base; appendages subapical, spreading

to slightly recurved, narrowly ovate to broadly

ovate or broadly obovate, 3.0-6.0 mm long, entire,

erose or minutely toothed, truncate or acuminate

at apex, with indumentum as for adaxial surface of

sepal, Petals broadly obovate, 6.0-10.0 mm long,

5.0-9.0 mm wide; claw 2.0-4.0 mm long,

tomentose. Androgynophore 0.5—1.0 mm long,

with onecontinuous gland covering whole surface;

annulus 0.5—1.0 mm long, ciliate on margin.

Stamens 30 or more; filaments 4.0-12.0mm long,

glabrous; anthers oblong, c. 0.7 mm long. Ovary

globose, 1.0-2.0 mm diameter, 3-locular, setose;

style9.0—14.0 mm long, glabrous; stigma 3-lobed.

Fruit ovoid-globose, 20~25 mm long, 18-25 mm

diameter, densely covered with slender stellate

hairs up to 1.0 mm diameter, densely aculeate;

prickles subterete, 6.0-8.0 mm long, erect, brittle,

with a dense covering of bifid and stellate hairs

1.0-2.0 mm long on lower two thirds, terminated

by asingle hooked setac. 0.4 mm long. Fig. 10G.

Additional specinens examined: Western Australia.

ForTEscuE District: 14 km N of Whim Creek, Oct 1985,

Demarz 10861 (PERTH); 26 km E of Mt Dove, Mar 1984,

Newbey LOOOL (PERTH); Turner River, Abydos Station, S

of Port Hedland, Apr 1958, Burbidge 5862 (AD, PERTH);

Wittenoom Gorge, Apr 1966, Blockley 146 (PERTH); Kittys

Gap, eastern end of Eginbah Station, Jun 1941, Burbidge

974 (PERTH); among rocks, Soda Creek Gap, Eginbah

Station, Jun 1941, Burbidge 1002 (PERTH); Warralong

Station, May 1941, Burbidge 816 (PERTH); no locality

data, 20°42’S, 120°15’E, May 1979, Davis 2 (PERTH);

Nullagine Road, south of Mount Edgar Station, Jun 1941,

Burbidge 1182 (PERTH); west edge of Gregory Range,

gorge of Yonama creek, Aug 1977, Barker 2072 (AD); near

Carawine Pool, Oakover River, c. i140 km SE of Shay Gap,

Jul 1984, Newbey 10331 (PERTH).

Distribution and habitat: T. propinquais restricted

to the Pilbara region of Western Australia, from

Halford, Australian Tiliaceae, 3

near Whim Creek south to the Hamersley Range

and eastto Shay Gap (Map 2). It grows in shallow

loam or stony soils on rocky hillsides and in

sandy soils on plains and along watercourses,

Phenology: Flowers have been recorded from

Match and June, fruits from June to October.

Notes: T. propingua is closely related to

T. appendiculata butis distinguished by its larger

fruit (20-25 mm long x 20-25 mm diameter

compared to 12-20 mm long x 10-15 mm

diameter), with longer prickles (6—-/ mm long

compared to 3-4 mm long), and larger sepal

appendages (3.0-6.0 mm long compared to 2.03.0

mm long).

I have adopted a rather broad concept for

this species which exhibits considerable variability

in sepal appendage shape, indumentum and prickle

morphology. I have been unable to find any clear

characters to divide this complex.

Burbidge 817, 974, 1182 and 1002, and

Davis 2, all from Eginbah Station, have very long,

narrowly ovate sepal appendages, long slender

indumentum on the stems and leaves, and long, —

slender prickles. These may warrant recognition

as belonging to a distinct species. This complex

needs to be examined in more detail when more

material becomes available.

Etymology: The specific epithet refers to the

close relationship of this species with others

in the Pilbara, particularly T. appendiculata

and 7. chaetocarpa; Latin propinguus near,

neighbouring.

22. Triumfetta chaetocarpa F. Muell., Fragm.

2: 61-62 (1879) Type: [Western Australia].

Fortescue River, June 1878,/. Forrest} MEL.

223683} (holo: MEL; tso: K n.v., photo

BRI).

Perennial shrub to 1.5 m high; branches

spreading to ascending. Indumentum on

branchlets, petioles, peduncles, pedicels and

stipules dense; hairs stellate, of two size classes;

class 1 hairs sometimes absent, c. 0.5 mm

diameter, sessile, with pliable, appressed to

spreading rays; class 2 hairs c 1.0 mm diameter,

with tuberculate base, and with stiff, spreading

rays. Leaves discolorous, entire or shallowly 3-

lobed, broadly ovate to orbicular, 1.0-4.0 cm

525

long, 2.0-3.5 cm wide; base cordate; apex obtuse

to rounded; margin irregularly serrulate;

indumentum adaxially and abaxially moderately

dense to dense; hairs stellate, of two size classes

although not always readily distinguishable; class

1 hairs c. 0.5 mm diameter, with pliable, appressed

to spreading rays; class 2 hairs 0.5—-1.0 mm

diameter, with stiff, spreading rays. Petioles 3-12

mm long. Stipules narrowly ovate, 1-3 mm long.

Flowers 2 or 3, in leaf-opposed or lateral cymules:

cymules | or 2 per node; peduncles 2—5 mm long;

pedicels 1—2 mm long; bracts narrowly ovate, 1—2

mm long, hirsutellous. Sepals linear, 7.0—-11.0

mm long, 1.5-2.0 mm wide, indumentum on

abaxial surface dense, with coarse stellate hairs up

to 1 mm diameter, on adaxial surface densely

Stellate-pubescent near base; appendages,

subapical, erect to spreading, narrowly ovate to

ovate or rarely depressed obovate, 1.0—-2.0 mm

long, mostly entire, with indumentum as for abaxial

surface of sepal. Petals broadly obovate-orbicular,

6.0-9.0 mm long, 4.0-9.0 mm wide; claw c. 1.5

mm long, pubescent. Androgynophore c. 0.5 mm

long, with one continuous gland covering whole

surface; annulusc. 0.5 mm long, ciliate on margin.

Stamens 30 or more, rarely 20-30; filaments

4.0-7.0mm long, glabrous; anthers oblong, c. 0.7

mm long. Ovary globose, 1.0—1.5 mm diameter,

3-locular, setose; style 6.0-7.0 mm long, glabrous;

stigma 3-lobed. Fruit globose or ovoid-globose,

12—17(-25) mm long, 12—15(-25) mm diameter,

densely covered with slender stellate hairs c. 0.7

mm diameter, densely aculeate; prickles subterete,

tapering towards the apex, 4.0-10.0 mm long,

erect, with moderately dense covering of simple,

bifid and stellate hairs 0.5—1.5 mm long on the

lower two thirds, terminated by a single hooked

seta c. 0.3 mm long. Fig. 4F.

Selected specimens: Western Australia. FoRTESCUE

District: Roebourne, 1896, Cusack [MEL 227268] (MEL);

Pier Creek, Warralong Station, May 1941, Burbidge 736

(PERTH); near construction camp, Shay Gap, c. 160 kmE

of Port Hedland, Jul 1984, Newbey 10276(CANB, PERTH);

Abydos Station, S of Port Hedland, Sep 1968, Richardson

25 (PERTH); 14 miles (22 km] W of Marble Bar Pool, Oct

1975, Demarz D5726 (PERTH); c. 160 km S of Port

Hedland towards Wittenoom, Apr 1977, Pullen 10.914

(BRI, CANB, PERTH); Channar area, east of Paraburdoo,

Jun 1985, Trudgen 4945 (PERTH); Sandy Creek, 12 miles

[19 km] N of Jigalong Depot, May 1947, Royce 1605

(PERTH); Barlee Range, Henry River, Aug 1961, Royce

6576 (PERTH). CARNARVON Districr: + | mile [1.6 km] E

of Yanrie [Yanrey] Homestead, Aug 1960, George 1168

(PERTH); c. 1/4—-1/2 km upstream from Yannarie River

526

crossing by North-West Coastal Highway at Barradale

Roadhouse, Aug 1977, Jackson 3070 (AD). ASHBURTON

District: White Hill paddock, Lyndon, Aug 1981, Cranfield

1751 (PERTH). KearTLAND District: Rudall River, Aug

1971, Wilson 10552 (PERTH); near Rudall River, May

1971, George 10680 (CANB, PERTH). Northern

Territory, BARKLY TABLELAND REGION: about 55 miles [88

km] W of Muckety Homestead, May 1965, Johnson [DNA

11758] (DNA), CenTRALNorTHERN Recion: Neutral Junction

Station, Jul 1974, Latz5623 (AD, BRD; 4kmNW ofStirling

Homestead, Nov 1992, Latz 12989 (BRI, DNA n.v.);

MacDonald Downs Station, Aug 1933, /sing [AD 97418078]

(AD).

Distribution and habitat: T. chaetocarpa is

widespread in the Pilbara region, Western

Australia, from the eastern shore of Exmouth

Gulf east to Rudall River, with four additional

records from central Northern Territory (Map 3).

It grows in open woodlands or spinifex-shrub

steppes on sandy, sandy clay or gravelly soils on

hillslopes and along watercourses.

Phenology: Flowers have been recorded tn April,

May and August, fruits in April, May and from

July to September.

Notes: T. chaetocarpa is related to T.

appendiculata and T. deserticola but is

distinguishable from the former by its shorter,

harsher indumentum and longer prickles and

from the latter by its longer prickles,

hermaphrodite flowers, leaf shape and the

numerous Stellate hairs on the prickles.

This species exhibits considerable variability

in its fruit shape which varies from globose to

ovoid, the thickness of the prickles, and the colour

of the prickles which varies from straw-coloured

to dark maroon. The species as circumscribed

here may warrant further research.

Johnson [NT1L1758] from west of Muckety,

N.T., (DNA) appears to be this species but the

prickles are shorter than normal and are not as

hairy as is typical in T. chaetocarpa.

23. Triumfetta deserticola Halford, sp. nov.

valde affinis 7. chaetocarpae qua aculeos

4-10 mm longos pilis simplicibus bifidis

stellaribusque praeditos et folia late ovata

usque orbicularia habet autern ab ea aculeis

brevioribus 2—3 mm longis pilis simplicibus

bifidisque non stellaribus praeditis et foltis

ovatis usque late ovatis differt. Typus:

Western Australia. CANNING District: NW

Austrobaileya 4(4): 495-587 (1997)

of Lake Auld, Great Sandy Desert, 21°20’S,

123°30’E, 9 May 1979, A.S. George 15670

(holo: PERTH; iso: DNA).

Triumfetta sp. H, Rye (1992: 176).

Perennial shrub to 1 m high, dioecious, sparingly

branched; branches decumbent to ascending.

Indumentum on branchlets, petioles, peduncles,

pedicels and stipules moderately dense to dense,

rough; hairs stellate, c.0.5 mm diameter, subsessile,

with stiff, spreading to erect rays. Leaves

discolorous, enttre, ovate to broadly ovate, (1.3-)

2.0—5.0 cm long, (0.8-)2.0-4.5 cm wide, base

rounded; apex obtuse; margin irregularly serrulate;

indumentum adaxially and abaxially moderately

dense to dense; hairs stellate, 0. 5—1.0mm diameter,

with stiff, spreading rays. Petioles [0-15 mm

long. Stipules narrowly triangular, 2~—3 mm long.

Flowers 1-3, in leaf-opposed or lateral cymules;

cymules 1 or 2 per node; peduncles 5-10 mm

long; pedicels 3-6 mm long; bracts ovate, 1.5—3

mm long, hirsutellous. Sepals linear or narrowly

obovate, 6.0-7.0 mm long, 1.0~2.0 mm wide;

indumentum on abaxial surface dense, with stellate

hairs c. 0.5 mm diameter, the adaxial surface

glabrous or pubescent near base; appendages

subapical, erect to spreading, linear to narrowly

ovate, c. 1 mm long, entire, with indumentum as

for abaxial surface of sepal. Petals obovate, 4.0-6.0

mm long, 1.5—3.0 mm wide; claw c. 1 mm long,

tomentose. Androgynophore 0.3-0.5 mm long,

with onecontinuous gland covering whole surface;

annulus 0.3-0.5 mm long, ciliolate on margin.

Female flowers with c. 15 staminodes; filaments

2~3 mm long, glabrous; anthers depressed obovate,

c, 0.2 mm long. Male flowers with stamens 30 or

more; filaments 3.0-3.0mm long, glabrous; anthers

oblong, c. 0.5 mm long. Ovary globose, c. 1 mm

diameter, 2-locular, setose; style c. 3 mm long,

glabrous; stigma 2-lobed. Fruit globose to ovoid-

globose, 10-14 mm long, 9-15 mm diameter,

densely covered with stout stellate hairs c.0.5 mm

diameter, densely aculeate; prickles subterete,

tapering towards the apex, 2.0-3.0 mm long,

erect, with a sparse to moderately dense covering

of simple or bifid (rarely stellate) hairs 1,.0-1.5

mm long on lower half, terminated by a single

hooked seta c. 0.2 mm long. Fig. 4G.

Selected specimens: Western Australia, DAmpigr District:

Fitzroy River, c. 300 km east of Broome, Mar 1897, Calvert

Exped, [AD 97607586} (AD); site DI, Red Dune, near

eae Di eta PO .

Haiford, Australian Tiliaceae, 3

Edgar Range, SE of Broome, Aug 1976, Kenneally 5610

(PERTH). CANNninG District: McLarty Hills, Great Sandy

Desert, Aug 1977, George 14704 (PERTH); Great Sandy

Desert, May 1984, Fatchen 892 (AD); Great Sandy Desert,

Bruce’s Field, May 1982, Harris 53 (AD); Anketell Ridge,

Great Sandy Desert, May 1979, Mitchell 1116 (AD, DNA,

PERTH); 2 km E of Well 49, Canning Stock Route, Apr

1979, George 15437 CDNA, PERTH); Great Sandy Desert,

Apr 1964, Beard 3224 (PERTH). Carnecis Districr: 36

miles [57.9 km] W of Jupiter Well, Jul 1967, George 9083

(PERTH). Northern Territory, CENTRAL NoRTHERN REGION:

near False Mt Russell, Aug 1970, Parker 268 (AD, DNA);

Argadargada Station, 5 km Ealong track to No, 18 Bore from

homestead entrance road, Aug 1979, Morton 164 (DNA,

MEL); 10 miles [16 km] NE Argadargada Homestead, Sep

1954, Chippendale 384 (DNA).

Distribution and habitat; T. deserticola occurs in

northern central Australia, from the Great Sandy

and Gibson Deserts, in Western Australia, to

False Mt Russell and Davenport Range in the

Northern Territory (Map 9), It grows inhummock

grasslands and open acacia shrublands on red

sandy soils.

Phenology: Flowers have been recorded in April

and May, fruits from March to September.

Notes: T. deserticola is closely related to

T. chaetocarpa but is easily distinguished by its

shorter prickles (2.0-3.0 mm long compared to

4.0Q—10.0), its leaf shape which is ovate to broadly

ovate rather than broadly ovate to orbicular, the

simple and bifid hairs on the prickles rather than

simple, bifid and stellate hairs on the prickles, and

its unisexual rather than hermaphrodite flowers.

All specimens examined with flowers and

maturing fruit on them had functionally unisexual

flowers (e.g. George 15437; Mitchell 1116;

George 15670), Fatchen 892 has two separate

branchlets on the sheet. The branchlet nearest to

the lower edge of the sheet has fruits and flowers,

The stamens in these flowers have poorly

developed anthers which lack pollen. The other

branchlet has flowers with well developed anthers

and pollen but no maturing fruit, although the

Ovaries appear to be well developed. ‘This is the

only species of Triumfetta in Australia that is

presently recorded to have functionally unisexual

flowers.

Etymology: The specific epithet refers to the

habitat in which the species has been recorded;

Latin desertum desert, -cola dweller.

327

24. Triumfetta echinata Halford, sp. nov. valde

affinis T, winneckeanae qua aculeos 6-12

mm longos et fructus 10-20 mm diam.

habet autem abeaaculeis longioribus 10-20

mm longis per multam longitudinem

pubescentibus distinguitur; similis T.

fenuisetae autem aculeisrigidis rectis differt.

Typus: Western Australia. FoRTESCUE

District; 25,2 km SE of Onslow, 21°44’S,

115°14’E, 30 August 1977, RJ. Chinnock

3842 (holo: AD).

Perennial shrub to 0.3 m high; branches spreading.

Indumentum on branchlets, petioles, peduncles

and pedicels moderately dense; hairs stellate, c.

0.5 mm diameter, with tuberculate base, and with

stiff, brittle, spreading to erect rays. Leaves

discolorous, entire, very broadly ovate or broadly

elliptic to orbicular, 1.5—5.0 cm long, 1.5-4.0cm

wide; base truncate or slightly cordate; apex

rounded to obtuse; margin irregularly serrulate;

indumentum adaxially and abaxially dense to very

dense; hairs as for branchlets, Petioles 6-18 mm

long. Stipules triangular, c.3mm long, hirsutellous.

Flowers 2 or 3, in lateral cymules; cymules solitary

at nodes; peduncles 5—6 mm long; pedicels 6-12

long; bracts triangular, 1—2 mm long, hirsutellous.

Sepals linear, 10.0-13.0 mm long, c.2 mm wide;

indumentum on abaxial surface as for branchlet,

on adaxial surface densely stellate-pubescent near

base; appendages subapical, spreading to erect,

linear or depressed obovate, 1.5—2.0 mm long,

entire or erose, with indumentum as for abaxial

surface of sepal. Petals obovate, 6.0—-7.0mm long,

3.04.0 mm wide; claw c.2 mm long, pubescent.

Androgynophorec. 0.5 mm long; glands covering

whole surface; annulus c. 0.5 mm long, ciliolate

on margin. Stamens 30 or more; filaments 4.0—7,0

mm long, glabrous; anthers oblong, c. 0.6 mm

long. Ovary globose, 1.5—2.0 mm diameter, 4-

locular, setose; style 11.0-12.0mm long, glabrous;

stigma4-lobed. Fruit globose, 30-50 mm diameter,

densely covered with stout stellate hairs c. 0.5 mm

diameter, densely aculeate; prickles subterete,

tapering towards the apex, 10.0—20.0 mm long,

erect, with amoderately dense covering of stellate

hairs c. 0.5 mm long on the lower five sixths,

terminated mostly by a single hooked seta c. 0.2

mim long or occasionally by numerous spreading

setae c. 0.2 mm long. Fig. 4D.

Additional specimens examined: Western Australia.

CARNARVON District: 20 km E [of] Onslow, Oct 1980,

528

Mitchell NQ656 (PERTH). Asxaurton Districr: Uaro,

Ashburton River, Oct 1905, Morrison [PERTH 01540106]

(PERTH). UNpLacep District: Ashburton River, 1885, Carey

[MEL [599372](MEL); ditto, Carey [MEL 1599371]

(MEL).

Distribution and habitat: T. echinatais restricted

to the Pilbara region of Western Australia, from

Onslow to the Ashburton River (Map 6). It grows

in hummock grasslands on sand dunes.

Phenology: Flowers have beenrecordedin August,

fruits in August and October.

Notes: TI. echinata is closely related to

T. winneckeana but can be distinguished by tts

larger fruit (20-30 mm diameter compared to

{OQ~20 mm diameter) and longer prickles (10-20

mm long compared to 6-12 mm long) which are

hairy along most of their length. 7. echinata

resembles 7. tenuiseta morphologically but is

easily distinguished from that by its straight prickles

rather than weak bristles on its fruit.

Etymology: The specific epithet refers to the

fruits which resemble a sea-urchin in appearance;

Latin echinatus, echinate, armed with numerous

rigid hairs or straight prickles or spines, from

Latin echinus, hedgehog, sea-urchin.

25. Triumfetta winneckeana F, Muell., Pl. Coll.

Central Australia — Winnecke’s Explor.

1883: 15 (1884). Type: Central Australia,

lin] 1883, C. Winnecke [MEL 223689]

(holo: MEL; iso: K n.v., photo BRD.

Perennial shrub to 0.7 m high; branches prostrate

or spreading. Indumentum on branchlets, petioles,

peduncles and pedicels moderately dense; hairs

stellate, up to 0.5 mm diameter, subsessile, with

stiif, erect to spreading rays. Leaves concolorous,

entire, orbicularto very broadly ovate, 2.0-4.0cm

long, 1.0-4.0 cm wide; base cordate; apex obtuse

to rounded; margin irregularly serrulate;

indumentum adaxially and abaxially moderately

dense to dense; hatrs stellate, 0.5—1.0 mm diameter,

subsessile, with stiff, erect to spreading rays.

Petioles 10-20 mm long. Stipules triangular, 1-3

mmm long, sparsely todensely stellate-hairy. Flowers

2 or 3, in leaf-opposed cymules; cymules solitary

at nodes; peduncles 10-20 mm long; pedicels

3-10 mm long; bracts ovate, 1-2 mm long,

pubescent. Sepals linear-ovate, 14.0-15.0 mm

long, 2.0—2.5 mm wide; indumentum on abaxial

Austrobaileya 4(4): 495-587 (1997)

surface dense, with coarse, stellate hairs up to

0.5 mm diameter, the adaxial surface glabrous;

appendages subapical, spreading, depressed

obovate, up to 1.0 mm long, erose, with

indumentum as for abaxial surface of sepal.

Petals linear-obovate, 6.0-7.0 mm long, 3.0

mm wide; claw 2.0—-3.0 mm long, pubescent.

Androgynophore c. 0.5 mm long; glands

quadrate, covering whole surface; annulus c.

0.2 mm long, ciliate on margin. Stamens 30 or

more; filaments4.0-6.0 mm long, glabrous; anthers

oblong, c. 0.5 mm long. Ovary globose, 1.5—2.0

mm diameter, 3-locular, setose; style c. 10 mm

long, glabrous; stigma 3-lobed. Fruit globose,

20—30 mm diameter, densely covered with slender

stellate hats up to 0.5 mm diameter, densely

aculeate; prickles subterete, tapering towards the

apex, 6.0—-12.0 mm long, erect, glabrous except

for asparse covering of stellate hairs up to0.4 mm

long near the base, terminated by a single hooked

seta c. 0.3 mm long. Fig. 4A.

Additional specinens examined: Western Australia.

KEARTLAND District: NW of Calvert Range, Jun 1984,

Morse 190(CBG). Northern Territory, CenrRAL NORTHERN

ReGion: 22 km NNE of Mongrel Downs Station, Jun 1980,

Latz8452 (DNA); 8kmS of Sangsters Bore, Tanami Desert,

Aug 1982, Latz 9387 (DNA); 6 miles [10 km] NE [of] Lake

Mackay, Jun 1957, Chippendale 3390(AD, DNA, PERTH);

c. 20 miles [32 km] E [of] Lake White, Aug 1970, Parker

297 (DNA); Lagorchestes Sandhills, May 1970, Parker 204

& Maconochie (AD, DNA, MEL), CEentrAL SOUTHERN

ReGcion: NW Simpson Desert, Sep 1973, Latz 4377 (AD,

BRI, CANB); ditto, Aug 1977, Latz 7467 (DNA); East of

Iilogwa, Jul 1979, O’Byrne C9 (DNA); north-western

Simpson Desert, The Madigan Line, Camp 10, Jul 1981,

Copley 584 (AD). Queensland, Grecory Sour District:

Montara Bore, Sandringham Station, Jul 1984, Atherton

[AQ 395925](BRD; Simpson Desert, N of Poeppel’s Corner,

The Madigan Line, Camp 15-16, Jul 1981, Copley 649

(AD).

Distribution and habitat: T. winneckeana

occurs sporadically across Central Australia in

the Gibson, Tanami and Simpson Deserts (Map

10). It grows in open shrublands and grasslands

on sand dune crests.

Phenology: Flowers have been recorded in

September, fruits from June to September.

Notes: T. winneckeanais related to T. leptacantha

and 7. echinata. It differs from 7. leptacantha in

having densely hairy fruits, longer prickles

(6.0-12.0 mm long compared to 4.0-5.0 mm

long), and a dense, coarse indumentum on its

Halford, Australian Tiliaceae, 3

leaves. For distinguishing features between

T. winneckeana and T. echinata, see notes under

T. echinata.

26. Triumfetta leptacantha F. Muell., Fragm

11: 62 (1879). Type: [Western Australia.

FORTESCUE District]: Mt Pyrten [Pyrton],

2500’, Hamersley’s Range, [in| 1878,

J. Forrest [MEL 223684] (holo: MEL; iso:

K n.v., photo BRI).

Perennial shrub to 0.5 m high; branches spreading.

Indumentum on branchlets, petioles, peduncles,

pedicels and stipules moderately dense; hairs

stellate, 1.5—-2.5 mm diameter, subsessile,

sometimes with tuberculate base, and with pliable,

spreading rays. Leaves concolorous, entire very

broadly ovate, 2.5—5.5 cm long, 3.0-4.5 cm wide;

base cordate; apex rounded; margin irregularly

serrate; indumentum adaxially and abaxially

moderately dense; hairs as for branchlets. Petioles

10-20 mm long. Stipules linear, 4-6 mm long.

Flowers 2 or 3, in leaf-opposed cymules; cymules

solitary at nodes; peduncles 10-15 mm long;

pedicels 7-10 mm long; bracts narrowly ovate,

3—6 mm long, hirsute. Sepals linear, 8.0-10.0 mm

long, c.1.0 mm wide; indumentum on abaxial

surface dense, with coarse, stellate hairs c. | mm

diameter, the adaxial surface glabrous; appendages

subapical, erect, linear-subulate, 2.0-3.0mm long,

entire, with indumentum as for abaxial surface of

sepal, Petals obovate, 4.0-5.0 mm long, 3.0-4.0

mm wide; claw 1.5-2.0 mm long, pubescent.

Androgynophore c. 0.5 mm long; glands broadly

obovate, covering whole surface; annulus c. 0.3

mm long, ciliate on margin. Stamens c. 50;

filaments 5.0-6.0 mm long, glabrous; anthers

oblong, c. 0.5 mm long. Ovary globose, c. 1.5 mm

diameter, 3-locular, setose; style c. 5 -mm long,

glabrous; stigma 3-lobed. Fruit ovoid-globose,

12—15 mm long, 12—15mm diameter, glabrous or

with isolated small glandular hairs, densely

aculeate; prickles terete, 4.0-5.0 mm long, erect,

glabrous or with isolated minute glandular hairs,

terminated by a single hooked setac. 0.3 mm long.

Fig. 4B.

Additional specimens examined: Western Australia.

Fortescue Districr: Hamersley Range, Wittenoom Gorge,

May 1992, Telford 11748 (BRI, CBG); ”% way along

Hancock Gorge, Hamersley Range N.P., Jun 1975, Trudgen

1375 (PERTH); NW of Mt Bruce, Jun 1975, Trudgen 1323

(PERTH); gully on north side of flat topped hill SW of Mt

Bruce, Hamersley Range N.P., Jun 1975, Trudgen 1320

(PERTH).

529

Distribution and habitat: T. leptacantha is

restricted to the Hamersley Range in the Pilbara

Region of Western Australia (Map 9). It grows in

open woodlands in shallow red loams on stony

hillsides.

Phenology: Flowers have been recorded in May,

fruits in May and June.

Notes: T. leptacanthais related to T. winneckeana

but differs from that in having glabrous rather

than densely hairy fruits, shorter prickles (4.0-5.0

mm long compared with 6.0-12.0 mm long),

anda less dense and finer indumentum on its

leaves.

27, Triumfetta sylvicola Halford sp. nov, affinis

ZT. clementt, T. rubiginosae, T. kenneallyi

autem ab eis pilis grossis rigidis simplicibus

in trientt inferno usque dimidio inferno

aculeorum praeditis et ovariis 3-loculis (non

2-loculis) differt; a 7. rubiginosa ramulis

viridi-brunneis (non rubiginosis) differt; a

T. kenneallyi floribus parum amplioribus

etstaminbus 9-11 (mon 4-6) differt.

Specimena T, sylvicolae ad T. micracantham

Olim relata sunt autem 7. sylvicola a

ZT. micracanthae fructibus globosis (non

ovoideus) et aculeis longioribus 1-3 mm

longis (non 1-1.5 mm) in trienti inferno

pilis grossis rigentibus simplicibus obtecis

et indumento in ramulis foltisque minus

denso differt. Typus: Northern Territory.

DARWIN AND GULF ReGION: Nourlangie

Camp, 12°46’S, 132°39’E, 15 March 1982,

C.R. Dunlop 6312 & JA. Taylor (holo: DNA;

iso: MEL).

Perennial shrub to | m high, much branched;

branches spreading or ascending. Indumentum on

branchlets, petioles, peduncles and pedicels

moderately dense; hairs of two size classes; class

1 hairs c. 0.5 mm diameter, with pliable, curved

rays; Class 2 hairs 1.0-2.0 mm diameter, with stiff,

spreading rays. Leaves concolorous, entire, ovate

or ovate-elliptic, 4.0-11.0 cm long, 2.0—-7.0 cm

wide; base rounded to obtuse; apex acute; margin

serrate-crenate; indumentum adaxially and

abaxially moderately dense to dense, very dense

on young leaves; hairs stellate, 1.0-2.0 mm

diameter, with stiff, spreading rays. Petioles 6-25

mm long. Stipules linear-subulate, 3-5 mm long,

hirsutellous. Flowers 1—3, in leaf-opposed or lateral

530

cymules; cymules I1—3 per node, often forming

terminal interrupted paniculate spiciform

inflorescences by reduction of subtending leaves;

peduncles 3-4 cm long; pedicels 1~2 mm long;

bracts narrowly ovate to ovate 1-3 mm long,

hirsutellous. Sepals linear-ovate, 4.0-6.0mm long,

O,.7—1.0 mm wide; indumentum on abaxial surface

dense, with coarse, scale-like hairs up to 0.5 mm

diameter, the adaxial surface glabrous; appendages

subapical, erect, narrowly ovate, 0.7—1.0 mm

long, entire, glabrous or with scattered hairs c. 0.3

mm diameter. Petals linear-obovate, 3.0-4.0 mm

long, 1.0-1.5 mm wide; claw c. 1 mm long,

pubescent. Androgynophore c. 0.2 mm long;

glands orbicular; annulus c. 0.3 mm long, ciliolate

on margin. Stamens 9-11; filaments 3.0-4.0 mm

long, glabrous; anthers oblong, c. 0.4 mm long.

Ovary globose, c. | mm diameter, 3-locular,

setose; style 3.0-4.0 mm long, glabrous; stigma 3-

lobed. Fruit globose, 5—9 mm diameter, densely

covered with stout stellate hairs c. 0.5 mm diameter,

densely aculeate; prickles subterete, tapering

towards the apex, 1.0-3.0 mm long, erect, with a

dense covering of simple hairs c. 0.5 mm long on

the lower half, terminated by a single hooked seta

c, 0.1 mm long. Fig. 5H.

Selected specimens: Northern Territory. DARWIN AND

GuLF Recion: Wessel Islands, Oct 1972, Latz 2487 (CANB,

DNA, MEL); walking trail, Obir1 Rocks, Apr 1987, Purdie

3176 (CBG); Cahills crossing, Kakadu N.P., Apr 1992,

Halford Q1138 (BRI, DNA, K); East Alligator River, [O0km

south of Cannon Hill Ranger Station, May 1980, Craven

5996 (CANB); Cannon Hill area, Nauradj Warde Djobkeng,

Mar 1983, Russell-Smith 518 (DNA); c. LO km SSE of

Mt Brockman, Feb 1973, Adams & Craven 3118

(CANB[273768], DNA); Baroalba Springs, Kakadu N.P.,

May 1983, Fryxell & Craven 4271 (CANB, DNA, MEL);

upper East Alligator River, Arnhem Land, Apr 1988, Russell-

Smith 5366 & Lucas (DNA); East Alligator River area, Mar

1973, Dunlop 3420 (DNA); upper Magela Creek valley,

Arnhem Land, May 1991, Russell-Smith 8473 & Brock

(BRI); Litchfield N.P., 200 m along road to Florence Falls

from junction with road to Batchelor, Apr 1992, Halford

Q1186 (BRI, DNA, MEL); gorge near Plum Tree Creek, c.

47 miles [76 km] ENE of Pine Creek Township, Mar 1965,

Lazarides & Adams 179 (CANB, DNA, NSW); Kakadu

N.P., 14kmE of Sleisbeck, Apr 1990, Leach 2764 & Cowie

(BRI); Groote Eylandt, 9.9 km ESE [of] Emerald River Xing

[crossing], Apr 1992, Cowie 2678 (BRD. |

Distribution and habitat: T. sylvicola occurs in

the “Top End’ of the Northern Territory, from

near Batchelor to Groote Eylandt (Miap 10). It

erows in open sclerophyll forests and monsoon

forests on sandy soils on sandstone outcrops.

Austrobaileya 4(4): 495-587 (1997)

Phenology: Flowers have been recorded in

February, April and May, fruits from March to

May and October.

Notes: T. sylvicola is related to T. clementii, T.

rubiginosa and T. kenneallyi but differs from

these species by its coarse, simple hairs on the

lower third to half of the prickles and by having 3-

celled rather than 2-celled ovaries. In addition,

T. sylvicola differs from T, rubiginosa in having

greenish-brown rather that rusty-red branchlets,

and from 7. kenneallyi in having slightly larger

flowers and 9-11 rather than 4-6 stamens.

Specimens of 7. sylvicola have previously

been referred to 7. micracantha. However,

T. sylvicola ditfers from 7. micracantha in its

globose rather than ovoid fruits, longer prickles

(1.0-3.0mm long compared to 1.0-1.5 mm long)

that are densely covered in the lower third with

coarse, simple hairs, and its less dense indumentum

on branchlets and leaves.

Etymology: ‘The specific epithet refers to the

habitat of the species; Latin sylvaforest, woodland,

and -cola dweller.

28. Triumfetta rubiginosa Halford, sp. nov. arte

affinis T. kenneallyi a qua floribus 8-10

staminibus (non 4—6), ramis pallide brunneis

(non rubiginosis) et in corpore fructus

indumento tenutore minus denso ornato,

fructibus parum parvioribus 5—7 mm diam.

et aculeis brevioribus 1.5—2 mm longis.

T. kenneallyi fractum 6—9 diam. et aculeos

1.5—3 mm longos habet. Fide Rye (1992)

aliquantum similis Africanae T. eriophlebiae

Hook.f. autem ab ea fructibus parvioribus

5-7 mm diam. (non 8-10 mm diam.) et

carentibus pilos simplices tn foltis et sepala

cucullata faciledistinguitur. [ypus: Western

Australia. GARDNER District: King Cascade,

Prince Regent River, 15°37°S, 125°18’E,

31 May 1992, K.F. Kenneally 11163 (holo:

PERTH; iso: BRD).

Triumfetta sp. D, Rye (1992: 175).

Perennial shrub to I m high; branchlets brownish-

red, ascending. Indumentum on branchlets and

pedicels sparse to moderately dense, of simple

and stellate hairs; simple hairs glandular, red, up

to 0.2 mm long; stellate hairs 0.5—1.5 mm long,

Halford, Australian Tiltaceae, 3

with tuberculate base, and with stiff, spreading

rays. Leaves discolorous, entire, narrowly ovate

to ovate, 6.0-9.0 cm long, 3.0-4.0 cm wide;

base cordate; apex acute to slightly acuminate;

margin serrulate; indumentum adaxially

moderately dense, abaxially dense; hairs stellate,

O.5—1.5 mm diameter, with stiff, spreading

rays. Petioles 10-20 mm long, indumentum as

for lower leaf surface. Stipules linear-subulate,

3—4 mm long, densely stellate-hairy. Flowers

6-12, in lateral or leaf-opposed cymules;

cymules 1 or 2 per node, often forming axillary

paniculate inflorescences by reduction of

subtending leaves; peduncles 4-5 mm long, with

a moderately dense covering of small stellate

hairs; pedicels 2-3 mm long; bracts linear, 1—2

mm long, hirsutellous, Sepals ovate, 4.0-5.0 mm

long, 1.0-1.5 mm wide; indumentum on abaxial

surface dense, with slender, stellate hairs up to 0.5

mm diameter, the adaxial surface glabrous;

appendages subapical, spreading, narrowly to

broadly obovate, 0.5—-1.0 mm long, entire or

irregularly lobed distally, with indumentum as for

abaxial surface of sepal. Petals linear-oblong,

1.0-1.5 mm long; claw 0.5—1.0 mm long,

pubescent. Androgynophore c. 0.3 mm long;

glands depressed obovate; annulus c. 0.5 mm

long, ciliolate on margin. Stamens 8—10; filaments

2.0-3.0 mm long, glabrous; anthers oblong, c. 0.3

mm long. Ovary globose, 0.7—1.0 mm diameter,

2-locular, setose; style c. 2 mm long, glabrous;

stigma 2-lobed. Fruit globose, 5—7 mm diameter,

densely covered with stout stellate hairs c. 0.6mm

diameter, densely aculeate; prickles subterete,

tapering towards the apex, 1.0-2.0 mm long,

erect, with asparse covering of stellate and simple

hairs c. 0.5 mm long on lower half, terminated by

a single hooked seta c. 0.2 mm long, Fig. 5G &

ob.

Additional specimen examined: Western Australia.

GARDNER District: Blyxa Creek, Prince Regent River

Reserve, Aug 1974, George 12493 (PERTH).

Distribution and habitat: T. rubiginosa 1s

restricted to the West Kimberley of Western

Australia where it is known from two collections

from the Prince Regent River area (Map 10). It

has been recorded as growing amongst sandstone

boulders.

Phenology: Flowers have been collected in May,

fruits in May and August.

531

Notes: T. rubiginosa 1s closely related to

T. kenneallyi but is distinguished by its

8-10 stamens rather than 4-6 stamens per flower,

rust-red rather than light brown branches, adenser,

coarser indumentum on the body of the fruit, and

slightly smaller fruit with shorter prickles (fruit

5—/ mm diameter compared with 6-9 mm diameter

and prickles 1.5—2.0 mm long compared with

1,5—3.0 mm long).

Rye (1992) commented that this species is

somewhat similar to the African species

T. ertophlebia Hook f. T. rubiginosa differs from

T. eriophlebia in lacking simple hairs on leaves,

lacking cucullate sepals, and having smaller fruit

(S-7 mm diameter compared to 8-10 mm

diameter).

Etymology: The specific epithet refers to the

colour of the stems; Latin rubiginosus rusty-red.

29, ‘Triumfetta kenneallyi Halford, sp. nov, arte

affinis 7. rubiginosae qua 8—10 stamina in

quoque flore, ramulos rubiginosos, fructus

5—7 mm diam., aculeos 1.5—2 mm longos

habet autem ab ea 4-6 staminibus in quoque

flore, ramulis pallide brunneis fructibus

amplioribus 6-9 mm diam. indumento

tenuiore minus denso in corpore ornato,

aculeis 1.5—3 mm longis differt, ut videtur

similis 1. rhomboideae qua 10-15 stamina

in quoque flore et sepala 4-7 mm longa

unumquidque appendice anguste conica et

apice cucullato praeditum habet autem ab

ea 4—6 staminibus in quoque flore parviore

et sepalis 2.5-5 mm longis non apice

cucullatis unumquidque appendice ovata

vel depresse obovata praeditum differt.

Typus: Western Australia. GARDNER

DISTRICT: gauging station, Camp Creek, c. 2

km SW of mining camp, 14°53’10"S,

125°45’05”E, 30 April 1982, KF. Kenneally

$186 (holo: PERTH; iso: distribuendi).

Triumfetta rhomboidea auct. non Jacq.: Rye

1992: 174.

Perennial shrub to 3 m high, much branched;

branches spreading or erect. Indumentum on

branchlets, petioles, peduncles, pedicels, and

stipules sparse to moderately dense, rough; hairs

stellate, O.2-1.0 mm diameter, sometimes with

tuberculate base, and with stiff, appressed rays.

532

Leaves discolorous, entire, narrowly ovate to

ovate, 4.5~9.5 cm long, 1.5—5.5 cm wide; base

rounded to slightly cordate; apex acute to

slightly acuminate; margin crenulate-serrulate;

indumentum adaxially sparse to moderately

dense, abaxially moderately dense to dense;

hairs stellate, 0.5-1.0 mm diameter, with stiff,

spreading rays. Petioles 7-20 mm long. Stipules

narrowly triangular, 2-3 mm long. Flowers 2-9,

in axillary cymules; cymules 1-3 per node,

occasionally arising well above node, oftenforming

axillary paniculate inflorescences by reduction of

subtending leaves; peduncles 3—7 mm long;

pedicels 2-4 mm long; bracts narrowly triangular,

1—2 mm long, hirsutellous. Sepals linear-ovate,

2.5—5.0 mm long, 0.5—1.0 mm wide; indumentum

on abaxial surface dense, with stellate hairs c. 0.5

mm diameter, on adaxial surface densely stellate-

villous near base; appendages subapical, erect,

ovate or depressed obovate, c. 0.5 mm long,

entire, glabrous or with scattered steilate hairs c.

0.2 mm diameter. Petals linear-oblong, 1.53.0

mim long, 0.5—0.7 mm wide; claw 0.5—1.0 mm

long, pubescent. Androgynophorec. 0.3 mm long;

glands ovate; annulus c.0.5 mm long, ciliolate on

margin. Stamens 46; filaments 2.0-3.0 mm long,

glabrous; anthers oblong, c. 0.5 mm long. Ovary

subglobose, c. 1 mm diameter, 2-locular, setose;

style 1.5—2.5 mm long, glabrous; stigma 2-lobed.

Fruit globose, 6-9 mm diameter, sparsely to

densely covered with slender stellate hairs c. 0.5

mim diameter sparsely aculeate; prickles subterete,

tapering towards the apex, 1.5-3.0 mm long,

erect, with a sparse covering of stellate hairs c. 0.5

mm diameter near the base, terminated by a single

hooked seta c. 0.5 mm long. Fig. SD.

Additional specimens examined; Western Australia.

GARDNER District: 3.4 km SW of Manning Peak, Prince

Frederick Harbour, Jun 1987, Kenneally 10269 & Hyland

(CANB, PERTH); Boongarrie Island, 18.3 km NE of Mt

Knight, Mar 1989, Keighery 10693 (PERTH); 29.2 km

WSW of Mt French, Jun 1987, Kenneally 10494 & Hyland

(CANB, PERTH); Point Springs, 29 miles [47 km] E of

Carlton Station, Jul 1949, Perry 2650 (CANB, DNA, MEL,

PERTH).

Distribution and habitat: T, kenneallyiis restricted

to the Kimberley of Western Australia, from near

Mt French to the Mitchell Plateau and at Carlton

Station near Kununurra (Map 11). It has been

recorded in a vine thicket in peaty sand along a

watercourse, in shallow soil on a rocky ledge

amongst massive sandstone outcropping and ona

steep rocky slope.

Austrobaileya 4(4): 495-587 (1997)

Phenology: Flowers have been recorded between

March and June, fruits in April and July.

Notes: T. kenneallyi is closely related to T.

rubiginosa. For distinguishing features see notes

under 7. rubiginosa. T. kenneallyiis superficially

similar to T. rhomboidea butis easily distinguished

from that by its smaller flowers (sepals 2.5—-5.0

mm long compared to 4.0-7.0 mm long), 4-6

rather than 10-15 stamens per flower, ovate or

depressed obovate rather than subulate sepal

appendages, and slightly incurved rather than

cucullate apices of the sepals.

Etymology: This species is named in honour of

Kevin F.Kenneally, botanist at the Western

Australian Herbarium, who has collected

extensively in the Kimberley Region and is the

collector of the type specimen.

30. Triumfetta clementii (Domin) Rye, Nuytsia

9(3): 417 (1994). Triumfetta bartramia

var. clementit Domin, Biblioth. Bot. 89:

379 (1927). Type: [Western Australia].

Ashburton and De Grey River|[s], undated,

FE. Clement (holo: K n.v., photo BRI).

Perennial shrub to 0.4 m high, much branched

from the base; branches spreading to erect.

Indumentum on branchlets, petioles, peduncles

and pedicels sparse to moderately dense; hairs

stellate, 1.0-2.0 mm diameter, with pliable,

spreading rays. Leaves concolorous, entire, ovate

to broadly ovate or elliptic, 2.5-4.0 cm long,

1.5—6.0 cm wide; base truncate; apex obtuse;

margin serrate or serrate-dentate; indumentum

adaxially and abaxially sparse to moderately dense;

hairs stellate, 0.5-1.0 mm long, with pliable, erect

to spreading rays. Petioles 10—-20(-30) mm long.

Stipules narrowly triangular, [-3 mm _ long,

hirsutellous, Flowers 3, in lateral or leaf-opposed

cymules; cymules 1 or 2 per node, occasionally

arising well above node, often forming interrupted

spicate inflorescences by reduction of subtending

leaves; peduncles 0.5-1.5 mm long; pedicels

2.0-3.0 mm long; bracts narrowly ovate, 2-3 mm

long, hirsutellous. Sepals linear-ovate, 5.0-6.0

mm long,c. 1 mm wide; indumentum on abaxial

surface dense, with rigid, stellate hairs up to 0.7

mm diameter, the adaxial surface glabrous;

appendages subapical, erect, linear or narrowly

ovate, 0.5~1.0 mm long, entire, glabrous or with

scattered simple hairs c. 0.3 mm long. Petals

Halford, Australian Tiliaceae, 3

narrowly obovate, 3.0-4.0 mm long, 1.0-1.5 mm

wide; claw c. 1 mm long, ciliolate on margin.

Androgynophore c. 0.3mm long; glands orbicular;

annulus c. 0.5 mm long, ciliolate on margin.

Stamens 15; filaments 4.0-5.0mm long, glabrous;

anthers oblong, c. 0.4 mm long. Ovary globose, c.

| mm diameter, 2-locular, setose; style c.4 mm

long, glabrous; stigma 2-lobed. Fruit globose to

ovoid-globose, 6-8 mm long, 6-9 mm diameter,

covered with slender stellate hairs c. 0.5 mm

diameter, densely aculeate; prickles subterete,

tapering towards the apex, 1.0—-2.0 mm long,

erect, with asparse covering of simple and stellate

hairs c. 0.2 mm long on lower third, terminated by

a single hooked seta c. 0.2 mm long. Fig. 9G.

Selected specimens: Western Australia, CARNARVON

District: 3.5 miles [5.6 km] S of Exmouth, May 1965,

George 6592 (PERTH). Fortescue Districr: Dolphin Island,

Dampier Archipelago, Jun 1962, Royce 7205 (PERTH);

Maitiand River, at North West Coastal Highway crossing,

24 km SE of Dampier, Aug 1977, Telford 6583 (CBG,

PERTH n.v.); Harding River, Roebourne, Oct 1941, Gardner

6320 (PERTH); Harding River, in 1895, Cussack 134

(MEL); Warrambie, S of Roebourne, Oct 1941, Gardner

6268 (PERTH); 2 km SE of Shay Gap, c. [00 km E of Port

Hedland, Jul 1984, Newbey 10294 (PERTH); 3 km NE of

Three Peak Hills, Panawonica Road, Mar 1984, Newbey

9885 (PERTH); Mt Edgar Station, Jun 1941, Burbidge 1161

(PERTH); 25 km ESE of Quarry Hull, c. 110 km W of Tom

Price, Aug 1984, Newbey 10726 (PERTH); N base of Mt

Bruce, Hamersley Range N.P., May 1977, George 14578

(CANB, PERTH).

Distribution and habitat: T. clementii is

widespread in the Pilbara region of Western

Australia including coastal islands (Map 11). It

grows in Shrublands, hummock grasslands and

open woodlands in red clay loams or sandy loams

on rocky hillsides or on colluvial flats. It is also

recorded in coarse shelly sand on foreshore.

Phenology: Flowers have been recorded from

March to May and July, fruits in March, May to

August and October.

Notes: T. clementti is characterised by the small

globose to globose-ovoid fruit with shortsubterete

prickles, the small, erect, linear or narrowly ovate

subapical sepal appendages, the glabrous stamina]

filaments, ovate to broadly ovate or elliptic leaves

and the terminal interrupted paniculate spiciform

inflorescence.

31, Triumfetta maconochieana Halford, sp.

nov. similis 7, parviflorae qua fructus 2-4

533

mm diam., flores sepalis 2~3.5 mm longis,

petalis 1.5—4 mm longis, staminibus 5

praeditos habet autem ab ea fructibus

amplioribus 7-10 mm diam., floribus

amplioribus sepalis 5-6 mm longis petalis

2.s—3 mm longis staminibus 10-15 praeditis

et aculeis seta terminali vel setis 5-9

patentibus ornatis distinguitur; quoad

formam foliorum et appendicum

sepalinarum T. plumigerae similis autem ab

ea fructibus aculeis rigidis ornatis non setis

gracilibus plumosis ornatisutin 7. plumigera

distinguitur. Typus: Northern Territory.

CENTRAL SOUTHERN REGION: Mt Liebig

Ranges area, 23°17’S, 131°18’E, 5 April

1972, J. Maconochie 1363 (holo: DNA;

iso; CANB, PERTH).

Perennial shrub up to | m high sparingly or much

branched from the base; branches spreading or

erect. Indumentum on branchlets, petioles,

peduncles and pedicels dense; hairs stellate,

0.1-0.5 mm diameter, with pliable, spreading

rays. Leaves concolorous, entire, narrowly elliptic

or narrowly obovate to obovate, (1.5-)3.0—7.5 cm

long, 0.5—2.0 cm wide; base rounded; apex obtuse

or rounded; margin serrulate; indumentum

adaxially and abaxially dense; hairs stellate, of

twosizeclasses; class | hairsO.1-0.5 mmdiameter,

with flaccid, spreading rays; class 2 hairs 0.5-1.0

mm diameter, with stiff, spreading rays. Petioles

10-25 mm long. Stipules linear-subulate or

narrowly triangular, 3-5 mm long, hirsutellous or

puberulous. Flowers 2 or 3, in axillary or lateral

cymules; cymules 1-3 per node, sometimes

forming terminal interrupted spiciform

inflorescences by reduction of subtending leaves;

peduncles 2—3 mm long; pedicels 1-2 mm long;

bracts ovate, sometimes lobed, 1-3 mm long,

sparsely pubescent. Sepals linear, 5.0-6.0 mm

long, 0.5—O0.7 mm wide; indumentum on abaxial

surface dense, with stellate hairs up to 0.5 mm

diameter, the adaxial surface glabrous; appendages

subapical, erect, narrowly ovate, 1.0-1.5 mm

long, entire, with indumentum proximally dense,

distally sparse, consisting of stellate hairs 0.5-0,7

mm diameter. Petals narrowly obovate to obovate,

2.9—3.0mm long, 1.0-1.5mm wide; clawc. 1 mm

long, tomentose. Androgynophore c. 0.3 mm

long; glands quadrangular; annulus c. 0.5 mm

long, ciliolateon margin, Stamens 10-15; filaments

3,.0-4.0 mm long, glabrous; anthers oblong, c. 0.4

534

mm long. Ovary globose, c. 1 mm diameter, 3—or

4-locular, setose; style2.0—-2.5 mm long, giabrous;

stigma 3— or 4-lobed. Fruit globose, 7-10 mm

diameter, densely covered with scale-like stellate

hairs up to c. 0.3 mm diameter, densely aculeate;

prickles subterete, tapering towards the apex,

1.0-2.5 mm long, erect, mostly glabrous except

for afew minute sumple and stellate hairs on lower

half, terminated either by a single hooked seta c.

0.2 mm long or by 5—9 spreading setae c. 0.5 mm

long. Fig. SF.

Selected specimens: Western Australia. ForTESCUE

Districr. Peeawah Creek, E of Whim Creek, Feb 1962,

George 3413 (PERTH); Kitty’s Gap, eastern end of Eginbah

Station, Jun 1941, Burbidge 986 (PERTH); Yathalla Creek

near Mt Rica, Hamersley Range, Oct 1941, Gardner 6417

(PERTH); Woodstock Station, undated, Kaley E164

(CANB); ‘Ram Granite’, Woodstock Station, S of Port

Hedland, Apr 1958, Burbidge 5812 (AD, PERTH); Marble

Bar, May 1953, Broadbent 768 (PERTH); 12 km SSW of

Tanguin Hill, Gregory Range, c. 130km SE of Shay Gap, Jul

1984, Newbey 10370 (PERTH). Canninc Districr: McLarty

Hills, Great Sandy Desert, Aug 1977, George 14661 (CANB,

PERTH). KEARTLAND Districr: near upper Rudall River,

May 1971, George 10834 (CANB, PERTH). CARNEGIE

District: Walter James Range, Jul 1967, George 8886

(PERTH). Northern Territory. CENTRAL NORTHERN REGION:

25 km ENE of Devils Marbles, Apr 1983, Latz9734 (DNA);

Mt Doreen Station, Jan 1972, Henry 353 (AD, CANB,

CBG, DNA, MEL). CENTRAL SOUTHERN REGION: Trephina

Gorge, MacDonnell Ranges, +55 km ENE of Alice Springs

Post Office, Jun 1974, Beauglehole 44830 (MEL);

MacDonnell Ranges, in 1889, Schwarz [MEL 227262]

(MEL).

Distribution and habitat; T. maconochieana

occurs from the Pilbararegion of Western Australia

tosouthern Northern Territory (Map 12). It grows

in low open woodlands and hummock grasslands

in skeletal soils on rocky hills.

Phenology: Flowers and fruits have been recorded

from throughout the year.

Notes: T. maconochieanaresembles 7. parviflora,

butcan bedistinguished byits larger fruit(7.0-10.0

mm diameter compared to 2.0-4.0 mm diameter),

10-15 rather than 5 stamens per flower, larger

flowers (sepals 5.0-6.0mm long and petals 2.5—3.0

mm long compared with sepals 2.0-3.5 mm long

and petals 1.5-4.0 mm long). 7. maconochieana

is similar to T. plumigera in leaf shape and sepal

appendages but is easily distinguished from that

by the rigid prickles rather than slender, plumose

bristles on its fruit.

Austrobaileya 4(4): 495-587 (1997)

Etymology: The species 1s named in honour of the

late John R. Maconochie (1941-1984), botanist

atthe Northern Territory Herbarium, Alice Springs

from 1967-1984.

32. Triumfetta parviflora Benth., Fl. Austral. 1:

271 (1863). Type: [Northern Territory.

DARWIN AND GULF REGION:] Carpentaria

Island p [Winchelsea Island], 7 January

1803, R. Brown (holo: BM).

Perennial shrub to 1(1.5) m high; branches

ascending to erect. Indumentum on branchlets,

petioles, peduncles and pedicels sparse to

moderately dense; hairs stellate, of two size

classes; class 1 hairs c. 0.5 mm diameter, with

pliable, appressed rays; class 2 hairs 1.0-1.5 mm

diameter, with tuberculate base, and with stiff,

Spreading rays. Leaves concolorous, entire,

narrowly elliptic, obovate orrarely narrowly ovate,

2.0-7.0 cm long, 0.4—1.5 cm wide; base obtuse or

cuneate; apex rounded, obtuse or acute; margin

serrulate; indumentum adaxially and abaxially

sparse todense; hairs stellate, 0.5—1.0mm diameter,

with stiff, spreading rays. Petioles 2-10 mm long.

Stipules narrowly triangular, 3-5 mm _ long,

hirsutellous. Flowers 2 or 3, in axillary cymules;

cymules 2—5 per node, often forming terminal

interrupted spiciform inflorescences by reduction

of subtending leaves; peduncles 1—2 mm long;

pedicels 1-2 mm long; bracts narrowly ovate to

ovate, c. | mm long, hirsutellous. Sepals linear-

ovate, 2.0-3.5 mm long, 0.5-0.7 mm wide;

indumentum on abaxial surface dense, with coarse,

stellate hairs up to 0.7 mm diameter, the adaxial

surface glabrous; appendages subapical, erect,

subulate, c. 0.5 mm long, entire, glabrous or with

scattered stellate hairs c. 0.2 mm diameter. Petals

narrowly obovate, 1.5-4.0 mm long, 0.5—1.0 mm

wide; claw c. 0.5 mm long, tomentose.

Androgynophore c. 0.2 mm long; glands broadly

elliptic; annulus c. 0.3 mm long, ciliolate on

margin. Stamens 5; filaments 2.0-3.0 mm long,

glabrous; anthers oblong, c. 0.3 mm long. Ovary

globose, c. 0.5 mm diameter, 3-locular, setose;

style 2.0-3.5 mm long, glabrous; stigma 3-lobed.

Fruit ovoid-globose, 2-4 mm diameter, densely

covered with slender stellate hairs c. 0.3 mm

diameter, densely aculeate; prickles subterete,

tapering towards the apex, 0.5—2.0 mm long,

erect, glabrous or sparsely covered with minute

simple hairs, terminated by a single hooked or

slightly curved seta 0.3—0.5 mm long. Fig. 5E.

Halford, Australian Tiltaceae, 3

Additional specimens examined; Northern Territory.

DARWIN AND GULF Rgcion: 20 km E of Kakadu Highway

along road to Waterfall Creek Falls (Guniom), Apr 1992,

Halford Q1165 (BRI, DNA, MEL); Plum Tree Creek

crossing, Kakadu, Feb 1989, Menhorst 24 (MEL); Plum

Tree Creek, Feb 1969, Byrnes NB1368B (AD, DNA, MEL);

ec. 70 km NE [of] Pine Creek, El Sharana Road, Mar 1985,

Dunlop 6754 & Wightinan (BRI, CANB, MEL); Macadam

Range, Mar 1989, Russell-Smith 7479 & Lucas (DNA); Cox

River Station, Jul 1977, Henshall 1657 (BRI). Victoria

River REGION: Jasper Gorge, 83 km SE of Timber Creek on

road to Victoria River Downs Homestead, May 1992,

Halford Q1371 (BRI). Queensland, Burke Districr: 53 km

Eof Wollogorang Homestead on road to Doomadgee, 1 i km

W of Hells Gate Roadhouse, Apr 1992, Halford Q1040

(BRI, DNA, K, L, MEL).

Distribution and habitat: T. parviflora occurs

sporadically in the “Top End’ of the Northern

Territory and into north-western Queensland

(Map 12), It has been recorded growing in

Eucalyptus low open woodland with hummock

grass understorey on skeletal sandy soils on a

sandstone plateau, in Eucalyptus miniata open

forest on asandstone outcrop, inanAcaciashirleyi

community on a jump-up and in a watercourse in

a sandstone gorge.

Phenology: Flowers have been recorded between

February and May, fruits from April and July.

Notes: As presently accepted T. parviflora is a

variable species that requires further investigation.

The collection Dunlop 6754 & Wightman is

somewhat atypical of this species in having very

slender long branchlets and large leaves. The

collection Adams & Craven 3118 (CANB

[273767]) has fruit that resembles those of

T. parviflora. However, it differs from that species

by having ovate rather than narrowly elliptic or

obovate leaves, 15—20 rather than 5 stamens per

flower, and somewhat spreading, ovate rather

fhan erect, subulate sepal appendages. This

specimen appears to represent a distinct species

but more material of this taxon is required to

resolve its taxonomic status.

33. Triumfetta cinerea Halford sp. nov. arte

similis 7. glaucesenti qua fructus 5-8 mm

diam., aculeos 1-1.5 mm longos, stamina

35—50 in quoque flore habet autem ab ea

fructibus parvioribus 3—5 mm diam., aculeis

parvioribus 0.5—1 mm longis, staminibus

10-17 in quoque flore differt. Typus:

Northern Territory. DARWIN AND GULF

REGION: BaroalbaSprings, Kakadu National

535

Park, 16 April 1992, D.Halford Q1105

(holo: DNA; iso: BRI, CANB, K, MEL).

Perennial shrub to 2 m high, sparingly or much

branched; branches erect or ascending.

Indumentum on branchlets, petioles, peduncles,

pedicels, stipules and bracts moderately dense to

dense; hairs stellate, of two size classes; class |

hairs c. 0.5 mm diameter, with pliable appressed

to spreading rays; class 2 hairs c. 1 mm diameter,

with stiff, spreading rays. Leaves discolorous,

entire, narrowly ovate to ovate, 4.0-12.0.cm long,

2.0-6.0cm wide; baserounded; apex acute; margin

irregularly serrate-crenulate; indumentum

adaxially moderately dense to dense, abaxially

very dense; hairs stellate 0.3-0.7 mm diameter,

with pliable, spreading rays. Petioles 7~20 mm

long. Stipules narrowly ovate, 3.04.0 mm long.

Flowers 4—8, in leaf-opposed or lateral umbellate

or paniculate cymules; cymules 1-3 per node;

peduncles 2—5 mm long; pedicels 1-2 mm long;

bracts narrowly ovate, 1-2 mm long. Sepals linear-

ovate, 5.0-7.0 mm long, 0.7-1.5 mm wide;

indumentum on abaxial surface moderately dense,

with stellate hairs c. 0.5 mm diameter, the adaxial

surface glabrous or sparsely pubescent;

appendages subapical, recurved, broadly obovate

or ovate, 0.5—1.0 mm long, entire or occasionally

shallowly lobed, with a sparse covering of stellate

hairs c. 0.5 mm diameter. Petals obovate, 4.0~7.0

mm long, 0.7-1.5 mm wide; claw 0.5—1.0 mm

long, pubescent. Androgynophorec. 0.2mm long;

elands oblate; annulus c. 0.3 mm long, ciliate on

margin. Stamens 1O—17; filaments 4.0-8.0 mm

long, glabrous; anthers oblong, c. 0.5 mm long.

Ovary globose, 1.0—-1.5 mm diameter, 2- or 4-

locular, setose; style 2,5-4.5 mm long, glabrous;

stigma 2- or 4-lobed. Fruit ovoid-globose, 3—5

mm diameter, body black, sparsely to moderately

covered with slender stellate hairs c. 0.2 mm

diameter, moderately aculeate; prickles subterete,

tapering towards the apex, 0.5-1.0 mm long,

erect, glabrous, terminated by asingle hooked seta

c. 0.2 mm long. Fig. 9E.

Selected specimens: Northern Territory, DARWIN AND

GuLF REGIon: c. 30 km NNEof Jabiru, Mar 1981, Craven &

Whitbread 7711 (CANB); Cahills crossing, Kakadu N.P.,

Wurdidiileed}i walk, Apr 1992, Halford Q1139(BRI, CANB,

DNA, MEL); Jabiluka mining area, May 1988, Weber 9836

(AD, DNA); Baroalba Springs, Kakadu N.P., Apr 1992,

Halford Q1109(BRI,CANB, DNA, MEL); Little Nourlangie

Rock, Apr 1980, Telford 7837 & Wrigley (CBG); ditto, Mar

1979, Dunlop 4749 (DNA); ditto, Apr 1992, Halford Q1175

536

(BRI, CANB, DNA, K, L, MEL); Nabarlek, Mar 1989, Hinz

469 (DNA); Goomadeer River, Oct 1987, Dunlop 7197 &

Munns (DNA); headwaters of East Alligator River, Mar

1948, Wightman 1369 & Craven (BRI, CANB, MEL,

PERTH); Saw Tooth Gorge, near (south east of) Jabiru

Mine, Mar 1973, Lazarides 8015 (BRI, CANB, DNA); 1.5

km S of Nourlangie Rock, Kakadu N.P., May 1988, Munir

5690 (AD, DNA).

Distribution and habitat: T. cinerea is restricted

to western Arnhem Land, Northern Territory,

from East Alligator River to the South Alligator

River (Map 11). It grows along the sandstone

escarpment in sandy soils on sandy flats, on rocky

sandstone outcrops, along stream margins in open

eucalypt woodlands and rarely in monsoon forests

and pandanus scrubs,

Phenology: Flowers have been recorded from

March to May and August, fruits from February to

May, August and October.

Notes: T. cinerea is closely related to

T. glaucescens but can be distinguished by

its smaller fruit 3-5 mm diameter compared to

5—8 mm diameter), smaller prickles on its fruit

(0.5—1.0 compared to 1.0—-1.5 mm long), and a

smaller number of stamens per flower (LO—17

compared to 35—50).

There 1s a form of this species in Kakadu

National Park that extends from the escarpment at

Jim Jim Falls to Gumlom Falls. Dunlop 6217 &

Taylor (BRI, DNA) 1s an example of this form. It

differs from the typical form of 7. cinerea in

having smaller flowers and smaller, subcylindrical

fruit.

Etymology: The specific epithet refers to the ash

grey appearance of the whole plant; Latin cinereus

ash grey.

34, Triumfetta fissurata Halford, sp. nov. quoad

aculeorum magnitudem indumentum

ornamentationemque 7. albidae similis

autem ab ea fructibus globoso-obloideis

fissura manifesta ad apicem praeditis (non

globoso-ovoideis sine fissura ad apicem),

foliis obovato-oblongis (non ovatis usque

ovato-ellipticis) petalis obovatis (non

absentibus vel valderedactis) differt. Typus:

Western Australia. GARDNER DistTrRIcT: 218

km SW of the Great Northern Highway

along Gibb River Road, 46 km W of

Ellenbrae turnoff, 16°05’S, 126°42’E,

Austrobaileya 4(4): 495-587 (1997)

28 May 1992, D.Halford Q1416 (holo:

PERTH; iso: BRI, DNA, K, MEL).

Perennial shrub to 0.5 m high, sparingly or much

branched from the base; branches erect or

ascending. Indumentum on branchlets, petioles,

peduncles, pedicels, stipules and bracts dense;

hairs stellate, c. 0.5 mm diameter, with pliable,

spreading rays. Leaves usually discolorous, entire,

oblong to obovate-oblong, 2.0-4.0 cm long, c. 1

cm wide; base obtuse or rounded; apex rounded;

margin serrulate; indumentum adaxially and

abaxially dense; hairs stellate, c. 0.5 mm diameter,

with pliable to stiff, spreading rays. Petioles 3—5

mm long. Stipules narrowly triangular, 2-3 mm

long. Flowers 2 or 3, in leaf-opposed or lateral

cymules; cymules | or 2 per node; peduncles 1~3

mm long; pedicels 2-5 mm long; bracts ovate or

narrowly ovate, 1-2 mm long. Sepals linear,

5.0-7.0 mm long, 1.0—2.0 mm wide; indumentum

on abaxial surface dense, with slender, stellate

hairs up to 0.8 mm diameter, the adaxial surface

glabrous; appendages subapcial, spreading to

recurved, depressed obovate, c. 1 mm long, entire

or shallowly lobed, with indumentum as for abaxial

surface of sepal. Petals obovate, 4.0-5.0mm long,

c. 3mm wide; claw 0.5—1.0 mm long, tomentose.

Androgynophorec. 0.2mm long; glands depressed

obovate; annulus c. 0.5 mm long, ciliolate on

margin. Stamens 20-25, filaments 3.0-4.0 mm

long, glabrous; anthers oblong, c. 0.5 mm long.

Ovary globose, 1.0-1.5 mm diameter, 2-locular,

setose; style 2.0-3.0 mm long, scattered simple

hairs at base; stigma 2-lobed. Fruit globose-obloid,

6—7 mm long, 6-7 mm wide, 4-5 mm thick, with

distinct cleft at apex, densely covered with minute

scale-like stellate hairs c. 0.2 mm diameter,

moderately aculeate; prickles subterete, tapering

towards the apex, O.5—1.0mm long, erect, glabrous,

terminated by single hooked seta c. 0.3 mm long.

Fig, 5B.

Selected specimens: Western Australia. FirzGeRALD

District: Gibb River Road, 39 km W of Ellenbrae turnoff,

May 1992, Halford Q1415 (BRI, DNA, K, MEL, PERTH);

‘Galvans’ Gorge, Phillips Range, 20 km SW of Mt Barnett

Homestead along Gibb River Road, Jun 1992, Halford

Q1440 (BRI). Northern Territory. DARWIN AND GULF

ReEGIon: Cox River, Tanumbirini Creek, Jul 1977, Latz7305

(DNA).

Distribution and habitat: T. fissurata occurs in

the Phillips Range and in the Durack River area in

the Kimberley of Western Australia and near the

ee ee De St nee ee Te

ws joven daghierva reitinintres en ad ar i hea Td Seba Soe et

TOES MSOC ORE DA gp py

SESS vo eo ecco Re EN a ed De

Halford, Australian Tiltaceae, 3

Cox River, Northern Territory (Map 12). In

Western Australia, T. fissurata grows in eucalypt

open woodlands in shallow sandy soils along

stream margins and on sandstone hills. In the

Northern Territory, ithas been recorded in spinifex

grasslands on skeletal soils on quartzite hills.

Phenology: Flowers have been recorded in May,

fruits from May to July. |

Notes: The fruit of 7. fissurata and T. albida are

similar in size, indumentum and prickle

ornamentation. However, 7. fissurata is easily

distinguished by its globose-obloid fruit with a

distinct cleft at the apex rather than globose-ovoid

fruit evenly rounded at the apex. T. fissurata also

differs from that by its oblong to obovate-oblong

rather than ovate to ovate-elliptic leaves, and

petals obovate rather than absent or much reduced.

Etymology: Yhe specific epithet refers to the

fissure or cleft at the apex of the fruit; Latin

fissuratus fissured.

35. Triumfetta glaucescens R. Br. ex Benth., FI.

Austral. 1: 273 (1863). Type: [Northern

Territory. DARWIN AND GULF REGION:]

Carpentaria Island s [Morgan Island], [20

January 1803], Rk. Brown (lecto, designated

here: K (top centre element); isolecto(’):

BM, BRI, NSW, MEL ).

Perennial shrub to 0.5 mhigh, sparingly branched;

branches erect to ascending. Indumentum on

branchlets, petioles, peduncles, pedicels, stipules

and bracts dense; hairs stellate, 0.5-1.0 mm

diameter, sometimes with tuberculate base, and

with stiff to pliable, spreading rays. Leaves

discolorous, entire, ovate, 4.0-8.0cm long, 2.04.0

cm wide; base rounded; apex obtuse; margin

irregularly serrulate; indumentum adaxially

moderately dense to dense, abaxially dense; hairs

stellate, c. 0.5 mm diameter, with pliable to stiff,

spreading rays. Petioles 1O-20 mm long. Stipules

triangular, 2-3 mm long. Flowers 3—5, in leaf-

opposed or lateral cymules; cymules | or 2 per

node; peduncles 2—5 mm long; pedicels 1-3 mm

long; bracts triangular, 1-3 mm long. Sepals

linear, 6.0-8.0 mm long, [.0-1.5 mm wide;

indumentum on abaxial surface dense, with stellate

hairs up to 0.5 mm diameter, on adaxial surface

densely stellate-pubescent near base; appendages

subapical, reflexed, ovate to broadly obovate, c. |

mm long, entire or sometimes shallowly lobed,

537

with indumentum proximally dense, distally

sparse, consisting of stellate hairs up to 0.5 mm

diameter. Petals obovate, 2.5—3.O0mmlong, 1.0-1.5

mm wide, with minute glandular hairs on margin;

claw c. | mm long, tomentose. Androgynophore

c.0.2mm long; glands depressed obovate; annulus

c.0.5mm long, ciliate onmargin. Stamens 35-50;

filaments 3.0-5.0 mm long, sparsely pilose near

base; anthers oblong, c. 0.5 mm long. Ovary

globose, c. 0.5 mm diameter, 2— or 3-locular,

setose; style c. 5 mm long, glabrous or stellate-

hirsutellous at base; stigma 2— or 3-lobed. Fruit

globose, 5-8 mm diameter, densely covered with

scale-like stellate hairs c. 0.3 mm diameter,

moderately aculeate; prickles subterete, tapering

towards the apex, 1.0-1.5mm long, erect, glabrous

except for a few stellate hairs near the base,

terminated by single hooked seta c. 0.2 mm long.

Fig. 9D.

Additional specimens examined: Northern Territory,

DARWIN AND GULF Recion: Blue Mud Bay, Morgan Island,

Apr 1993, Leach 3522 & Cowie (BRI); ditto, May 1993,

Egan 2401 (BRD; 70 km E of Stuart Highway on road to

Roper Bar, Apr 1992, Halford Q1089 (BRI, DNA, MEL);

98 km E of Stuart Highway on road to Roper Bar, Apr 1992,

Halford Q1LO87 (BRI, CANB, DNA, K, MEL).

Distribution and habitat: T. glaucescens is

known from the Roper River area and on Morgan

Island in the Northern Territory (Map 13). It

has been recorded occurring in Acacia woodland

in shallow sandy soil on a sandstone hill, on top

ofarocky cliff, and amongstrocks on asandstone

slope.

Phenology: Flowers and fruits have been recorded

in April.

Notes: There are a number of syntypes available

for selection of alectotype. The top centre element

of the Kew sheet with the label “Triumfetta

glaucescens No.31 desc Carpentaria Island s’ is

chosen as lectotype as it is part of the original

material, has flower buds and agrees with the

protologue. There are a number of possible

duplicates of this material collected by R. Brown

atanumber of institutions (BM, BRI, MEL, NSW

and K) with varying label details, As there is no

way of ascertaining whether these specimens are

from the one collection itis not possible to say with

any certainty whether they are isolectotypes.

538

36. Triumfetta incana Halford, sp. nov. arte

atfinis 7: albidae quafructus S—/ mm longos,

aculeos 0.5—1 mm longos, folia ovata usque

ovato-elliptica 2—5 mm lata, petala absentia

vel laminis linearibus usque triangularibus

habet et similis 7. glaucescenti qua fructus

globosos 5—8 mm longos, folia 2—5 cm lata

appendices sepalinas reflexas habet; ab illa

fructibus parum amplioribus 8-10 mm

longis, aculets longioribus crassioribus |—2

mm longis, follis angustioribus anguste

ovatis 1—2 cm latis, petalis laminis anguste

ovatis 3-4 mm longis et a hac fructibus

ovoideis 8-10 mm longis, foliis

angustioribus 1-2 cm latis, appendicibus

sepalinis erectis differt. ‘Tlypus: Western

Australia, DAMPIER District: Yammera Gap,

Napier Range, 127 km Eof Derby, 17°20’S,

124°49’E, 2 June 1992, D. Halford Q1452

(holo: PERTH; iso: BRI, DNA, K, MEL).

Triumfetta sp. J, Rye (1992: 178).

Perennial shrub to | m high, sparingly to much

branched from the base; branches ascending to

erect. Indumentum on branchlets, petioles,

peduncles, pedicels and stipules moderately dense

to dense: hairs stellate, O.5—1.0 mm diameter,

subsessile, sometimes with tuberculate base, and

with pliable to stiff, spreading rays. Leaves

concolorous, entire, narrowly ovate, 3.0-8.0 cm

long, 1.0-2.0 cm wide; base obtuse; apex acute;

margin serrulate; indumentum adaxially and

abaxially dense; hairs stellate, of two size classes;

class | hairs c. 0.5 mm diameter, with pliable,

Spreading rays; class 2 hairs particularly on veins,

Q.5-1.0 mm diameter, with pliable to stiff,

spreading rays. Petioles 5-10 mm long. Stipules

narrowly ovate, 3-5 mm long. Flowers 3—5, in

leaf-opposed cymules; cymules |—3 per node;

peduncles 3-4 mm long; pedicels 2 mm long;

bracts linear, 1-2 mm long, hirsutellous. Sepals

linear-ovate, 5.0-10.0 mm long, 1.0-2.0 mm

wide; indumentum on abaxial surface dense, with

Stellate hairs 0.2—0.8 mm diameter, on adaxial

surface densely stellate-villous near base;

appendages subapical, spreading, broadly ovate

or depressed obovate, 0.5—1.0 mm long, entire or

shallowly lobed, with indumentum as for abaxial

surface of sepal. Petals narrowly obovate, (1.5-)

3.0-4.0 mm long, (0.5-)1.0-1.5 mm wide; claw

Q.5—1.0 mm long, tomentose. Androgynophorec.

Austrobaileya 4(4): 495-587 (1997)

0.3 mm long; glands depressed elliptic; annulus c.

0.5 mm long, ciliate on margin. Stamens 30 or

more, rarely 10; filaments 3.0-7.0 mm long,

sparsely pilose near base; anthers oblong, c. 0.5

mim long. Ovary globose, c. 1 mm diameter, 2-

locular, setose; style 4.0—7.0 mm long, glabrous

or stellate-puberulous at base; stigma 2-lobed.

Fruit ovoid-ellipsoid, 8-10 mm long, 6-8 mm

diameter, densely covered with stout stellate hairs

c.0.7 mm diameter, moderately aculeate; prickles

subterete, tapering towards apex, 1.0-2.0 mm

long, erect, with a dense covering of stellate hairs

c. 0.2 mm diameter on lower half, terminated by

a single hooked seta c. 0.2 mm long. Fig. 5C.

Selected specimens: Western Australia. FIiTzGERALD

District: c. 35 km NE of Napier Downs Homestead along

Derby-Gibb River Road, c. 150 km E of Derby, Jun 1992,

Halford Q1450 (BRI, DNA, K, MEL, PERTH); Lennard

River Gorge, 2km N of Gorge towards Gibb River Road, Jun

1992, Halford Q1444 (BRI, PERTH); Eva Creek and slope

leading to Bold Bluff, Apr 1988, Cranfield 6600 (PERTH);

Mount Campbell, Gogo Station, Apr 1951, Gardner 10055

(PERTH); Fossil Downs [Station], Apr 1957, Gardner

10072 (PERTH); King Leopold Range, Diamond Gorge

Road, 15 km E of Fitzroy, + 170 km WNW of Halls Creek,

+ 70 km NE of Fitzroy Crossing, Jun 1976, Beauglehole

ACB53871 (PERTH); 93 km SW of Hall Creek along the

Great Northern Highway, near Margaret River Homestead

turnoff, Jun 1992, Halford Q1476 (BRI, MEL, PERTH).

Damprer District: Meda Station, May 1962, Royce 6861

(CANB, PERTH); between Derby and Inglis Gap, King

Leopold Range, on Beef Road, May 1967, Power [PERTH

1549499](PERTH); Windjina Gorge, Napier Range, Jul

1974, Carr 3915 & Beauglehole 47693 (PERTH); 20km E

of Windjana Gorge along Fairfield Downs-Leopold Downs

road, 150 km E of Derby, Jun 1992, Halford Q1454 (BRI,

DNA, PERTH); Erskine Range, 126 km SE of Derby along

the Great Northern Highway, Jun 1992, Halford Q1461

(BRI, K, MEL, PERTH); E facing slopes of the Napier

Range, just N of Wombarella Gap, May 1988, Goble-

Garratt 564 (PERTH); Mount Marmion, Mar 1922, Edwards

[185a (PERTH); Oscar Range, Apr 1972, Aplin 4908

(PERTH); Geike Gorge, Fitzroy River, NE of Fitzroy

Crossing, Beauglehole ACB11198 (MEL, PERTH). HALL

District: 150 km E of Fitzroy Crossing along the Great

Northern Highway, Jun 1992, Halford Q1472 (BRI, DNA,

K, MEL, PERTH).

Distribution and habitat: T. incana 1s restricted

to the Kimberley of Western Australia, in the

mountain ranges between Derby and Halls Creek

(Map 16). It grows in tussock and hummock

grasslands, shrublands and open woodlands, on

sandy, clayey sand and cracking clay soils derived

from limestone and quartzite sandstone on scree

slopes, hills and along creek margins.

Phenology: Flowers have been recorded from

April to August, fruit from March to August.

Halford, Australian Tiliaceae, 3

Notes: T. incanais closely related to T. albidaand

T. glaucescens, it differs from the former by

having slightly larger fruit (8-10 mm long

compared to 5—7 mm long), longer, stouter prickles

on the fruit (1—2 mm long compared to 0.5—1.0

mm long), narrower leaves (narrowly ovate,

1.Q-2.0 cm wide compared to ovate or ovate-

elliptic, 2.0-5.0 mm wide), and petals with a

narrowly obovate lamina, 3.0-4.0 mm long rather

than absent or with linear to triangular lamina, up

to 1.5 mmilong. 7. incana differs trom the latter by

its fruit shape and size (ovoid, 8-10 mm long

compared to globose, 5-8 mm long), narrower

leaves (1.0-2.0 cm wide compared to 2.0-5.0 cm

wide), and erect rather than reflexed sepal

appendages, |

Etymology: The specific epithet alludes to the

overall greyish white colour of the whole plant;

Latin gicanus hoary.

37. Triumfetta albida (Domin) Halford, comb,

nov., Triumfetta micracantha var. albida

Domin, Biblioth. Bot. 89: 378 (1927) Type:

Sturt’s Creek, F. Mueller(holo: K; iso: MEL

[MEL 223685]).

Triumfetta sp. L, Rye (1992: 178).

Perennial shrub to 1 m high glaucous, sparingly or

much branched; branches decumbent, ascending

or erect. Indumentum on branchlets, petioles,

peduncles, pedicels and stipules dense; hairs

stellate, of two size classes; class | hairs up to 0.5

nm diameter, with pliable, spreading rays; class 2

hairs |.O—1.5 mm diameter, subsessile, sometimes

with tuberculate base, and with stiff to pliable,

spreading rays. Leaves discolorous, entire, ovate

or ovate-elliptic, 4.0-10.0 cm long, 2.0-5.0 cm

wide; base rounded or slightly cordate; apex

obtuse or acute; margin serrulate; indumentum

adaxially and abaxtally dense; hairs stellate, of

two size classes: class | hairs as for branchlets;

class 2 hairs sparse or sometimes absent, c. | mm

diameter, with stiff, spreading rays. Petioles 5—20

mm long. Stipules triangular, 2~3 mm long.

Flowers 3 or 4, in lateral or leaf-opposed cymules;

cymules | or2 per node, often forming lax terminal

spiciform inflorescences by reduction of

subtending leaves; peduncles 2~3 mm long;

pedicels 1-2 mm long; bracts linear, 1-3 mm

long, pubescent. Sepals linear-ovate, 6.0—-10.0

mm Jong; 1.5-2.5 mm wide; indumentum on

539

abaxial surface very dense, with hairs as for

branchlets, on adaxial surface densely stellate-

villous on proximal fifth; appendages subapical,

spreading toerect, ovate ornarrowly ovate, 0.5—1.0

mm long, entire or occasionally shallowly toothed,

with indumentum as for abaxial surface of sepal.

Petals absent or with lamina muchreduced; lamina

linear to narrowly triangular, c. 1.5 mmlonge.0.3

mm wide; claw c. | mm long, tomentose.

Androgynophorec, 0.2mm long; glands depressed

obovate; annulus 0.5—1.0 mm long, ciliate on

margin. Stamens 30 or more; filaments 5.0—7.0

mm long, pilose near base; anthers oblong, c. 0.5

mim long. Ovary globose, 1.0-1.5 mm diameter,

2-locular, setose; style 5.0-7.0 mm _ long,

puberulous at base; stigma 2-lobed. Fruit globose-

ovoid, 5-7 mm long, 5—7 mm diameter, densely

covered with scale-like stellate hairs 0.2 mm

diameter, moderately aculeate; prickles subterete,

tapering towards the apex, 0.5-1.0 mm long,

erect, with a dense covering of scale-like stellate

hairs 0.2 mm diameter on lower half, terminated

by hooked seta c, 0.2 mm long. Fig. 5A.

Selected specimens: Western Australia, GARDNER DisTRICT:

Anjo Peninsula, Sharp Point (separating Vansittart Bay and

Napier Broome Bay), May 1984, Forbes 2259 (CANB,

MEL, PERTH); 1 km E of Mitchell Falls, Mitchel] Plateau,

May 1992, Halford Q1432; Cracticus Falls, Aug 1975,

Kenneally 4193 (PERTH); upper reaches of Roe River, May

1987, Kenneally 9979 (CANB, PERTH); creek entering

inlet of Talbot Bay, 23 km SE of Cockatoo Island, May

1983, Pryxell & Craven 3904 (CANB), FirzGERALD District:

between Stewart River and Cone Bay, NE of Derby, 1& km

NNW of ‘Kimbolton’ Homestead, Aug 1977, Telford 6367

(CBG); King Leopold Ranges, Fern Creek, Apr 1988,

Dunlop TT7\ & Stmon (BRI, MEL), DAmpter District:

Dampier Hill, 26 km duc N of Great Northern Highway, 92

km E of Broome on Derby Road, Dampier Peninsula, Jun

1981, Kenneally 7671 (PERTH). Northern Territory,

DARWIN AND GULF ReGion: headwaters of Hayward Creek,

May 1990, Cowie 1216 & Leach (BRI, DNA, MEL); Mt

Nancar, 6 km SE of Daly River crossing, Feb 1989, Brock

520 (BRI); Umbarrawarra Gorge, 22 km W of Pine Creek,

Apr 1992, Halford Qt 88 (BRI, DNA, K, MEL); Koolendong

Range, Mar 1989, Dunlop 8296 & Leach (DNA); Edith

Falls, Feb 1987, Bownian 387 (BRI). Vicrorta RIVER REGION:

Samantha Spring, Spirit Hill Station, May 1987, Strong 997

(DNA); Keep River N.P., Feb 1981, Duniop 5813 (DNA);

Timber Creek, 2.5 km SE [of] Timber Creek Police Station,

Mar 1989, Brack 639 (DNA); Jasper Gorge, Jul 1974, Carr

2826 & Beauglehole 46607 (MEL).

Distribution and habitat: T. albida occurs in

northern Australia from Anjo Peninsula 1n the

Kimberley, Western Australia, to the western

islands of the Gulf of Carpentaria, in the Northern

540

Territory (Map 14). It grows in open woodlands

and monsoonforests, in sandy souls amongstrocks

mostly on sandstone pavements, screes and rocky

hillsides.

Phenology: Flowers have been recorded from

February, April and May, fruits from March to

July.

Notes: This species was originally included by

Muellerinhisconceptot 7: micracantha. Bentham

(1863) commented on the two forms of

T. micracantha herecognised but did notformally

namethem. Domin (1927) distinguished this taxon

as a variety of T. micracantha. I believe that it is

worthy of specific rank. It can be distinguished

from the variable 7. micracantha in having a

dense, greyish-whiteindumentum, slightly smailer

fruit, shorter prickles on the fruit, and petals

with a linear to triangular lamina or lacking

petals altogether. 7. albida is closely related to

T. glaucescens but can be distinguished by its

spreading to erect rather than reflexed sepal

appendages, and lack of petals or having petals

with a linear to triangular rather than obovate

lamina.

38. Triumfetta mitchellii Halford sp. nov. similis

T. carteri qua folia integra flores sepalis

10-12 mm longis petalis 5-6 mm longis

staminum filamentis 5—9 mm longis basi

ciliatis praeditos habet autem ab ea foltis

basalibus bene lobatis divisisve floribus

parvioribus sepalis 5-7 mm longis petalis

3-4 mm longis staminum filamentis 5-9

mm longis praeditis differt; quoad fructus

parvos globosos T. micracanthae similis

et quoad folia divisa et fructus parvos

globosos 7. trisectae similis autem ab hac

ramis erectis usque ascendentibus non

horizontalibus, foliorum lobis anguste

ovatis non linearibus usque anguste

obovatis et ab illa aculeis crassioribus

anguste conicis foliis divisis, appendice

sepalina erecta distinguitur. Typus:

Western Australia. GARDNER DISTRICT: SW

of Amax basecamp, Mitchell Plateau, 9

February 1979, K.F. Kenneally 7139 (holo:

PERTH; iso: CANB).

Triumfetta sp. I, Rye (1992: 176) in part.

Perennial shrub to 1.5 m high, much branched;

branches spreading. Indumentum on branchlets,

Austrobaileya 4(4): 495-587 (1997)

petioles, peduncles, pedicels moderately dense;

hairs stellate, 1.0-2.0 mm diameter, with

tuberculate base, and with spreading to erectrays.

Upper leaves concolorous, entire, narrowly ovate,

2.0-4.5 cm long, 1.0—1.5 cm wide, lower leaves

concolorous, deeply 3-lobed; lobes narrowly ovate,

4.0-7.0cm long, 1—1.5 cm wide; base rounded to

slightly cordate; apex acute; margin serrulate;

indumentum adaxially and abaxially moderately

dense; hairs as for branchlets. Petioles 1O—20 mm

long. Stipules narrowly triangular, 4-6 mm long,

sparsely stellate-hairy. Flowers 2 or 3, in leaf-

opposed or lateral cymules;, cymules 1 or 2 per

node; peduncles 2~3 mm long; pedicels 2-3 mm

long; bracts linear, 2-3 mm long, hirsutellous.

Sepals linear, 5.0-7.0 mm long, L.0-1.5 mm

wide; indumentum on abaxial surface dense, with

slender, stellate hairs up to 1.0 mm diameter, the

adaxial surface glabrous; appendages subapical,

erect, ovate, 1.0-2.0mm long, entire or sometimes

shallowly toothed, glabrous or with scattered

stellate hairs c. 0.5 mm diameter. Petals obovate,

3.0-4.0 mm long, c.2 mm wide; claw c. 1 mm

long, tomentose. Androgynophore c. 0.1 mm

long; glands depressed obovate; annulus c. 0.3

mm long, ciliolate on margin. Stamens 20-25;

filaments 3.04.0 mm long, glabrous; anthers

oblong, c. 0.5 mm long. Ovary globose, c. | mm

diameter, 2-locular, setose; style c. 3 mm long,

glabrous; stigma 2-lobed. Fruit globose, 5-7 mm

diameter, densely covered with stout stellate hairs

c. 1 mm diameter, densely aculeate; prickles

conoidal, 0.51.0 mm long, erect, with scattered

stellate hairs 0.3 mm long, terminated by a single

hooked seta c. 0.2 mm long. Fig. 7A.

Additional specinen examined: Western Australia.

GARDNER Districr: adjacent to small creek, 14°1 1’31"S,

[27°39°29"E, Mar 1993, Mitchell 2999 (BRI, PERTH).

Distribution and habitat: T. mitchellitis a poorly

known species from the Kimberley of Western

Australia (Map 12). It has been recorded in a

hummock grassland on sandstone.

Phenology: Flowers have been recorded in March,

fruits in February and March.

Notes. T. mitchellit 1s similar to 7. carteri but

differs by its glabrous staminal filaments rather

than ciliate near base, basal leaves distinctly lobed

or divided rather than entire, and smaller flowers

(sepals S—7 mm long, petals 3.0-4.0 mm long, and

staminal filaments 3.0-4.0 mm long compared

SOE a STAD a SA AA ATA Wa ATT Bo VAS DSM ng pe a eae ee ee ete te

Halford, Australian Tiltaceae, 3

with sepals 10.0-12.0 mm long, petals 5.0-6.0

mm long, and staminal filaments 5.0-9.0 mm

long).

T. mitchelliiresembles T. trisecta in having

divided leaves and small! globose fruit but is

distinguishable from that species by its erect to

ascending rather than horizontal branches, and

narrowly ovate rather than linear to narrowly

obovate lobes on its leaves, 7. mitchellu also

resembles 7. micracanthainhaving small globular

fruit but is distinguished from that by its stouter,

conoidal rather than slender, subterete prickles on

its fruit, divided rather than entire leaves, and erect

rather than spreading sepal appendages.

Etymology: This species is named in honour of

Andrew A. Mitchell, Western Australia

Department of Agriculture, whose collections

from the Kimberley region have greatly assisted in

understanding this genus in this region of Western

Australia,

39, Triumfetta trisecta Halford, sp. nov. foliis in

lobis dissectis propria, a 7. mitchellti ramis

horizontalibus (erectis usque ascendentibus

in 7. mitchellit), foliorum lobis linearibus

usque ovatis(anguste ovatisin 7. mitchellii)

differt. Typus: Western Australia, GARNDER

District: King Edward River, 14°54’S,

126°12’E, 29 February 1980, C.R. Dunlop

5369 (holo: PERTH; iso: CANB, DNA,

MEL),

Triumfetta sp. B, Rye (1992: 174).

Perennial low shrub; branches spreading

horizontally. Indumentum on branchlets, petioles,

peduncles and pedicels moderately dense; hairs

stellate, 1.5-2.0 mm diameter, with pliable,

appressed to spreading rays. Leaves concolorous,

deeply 3-lobed; lobes linear to narrowly obovate;

2.5-4.5 cm long, 3.0-5.0 cm wide; base rounded;

apex obtuse; margin crenulate; indumentum

adaxially and abaxially sparse to moderately dense;

hairs stellate, 1.5—2.0 mm diameter, with pliable,

appressed to spreading rays. Petioles 5-15 mm

long. Stipules narrowly triangular, 4-5 mm long,

densely stellate-hairy. Flowers 2 or 3, in lateral or

leaf-opposed cymules; cymules | or 2 per node;

peduncles !—3 mm long; pedicels 1-2 mm wide;

bracts narrowly triangular, 1-2 mm long,

hirsutellous. Sepals linear, 5.0-6.0 mm long, c. 1

mm wide; indumentum on abaxial surface dense,

541

with slender, stellate hairs up to 1.0 mm diameter,

the adaxial surface glabrous; appendages

subapical, erect, ovate, c 1.0 mm long, entire,

glabrous or with scattered stellate hairs c, 0.2 mm

diameter. Petals narrowly obovate, 3.5-4.0 mm

long, 1.0-1.5 mm wide; claw c. 0.7 mm long,

pubescent. Androgynophore c. 0.2 mm long;

glands depressed obovate; annulus c. 0.2 mm

long, ciliolate on margin. Stamens 30 or more;

filaments 3.0-4.0 mm long, glabrous; anthers

oblong, c.0.5 mm long. Ovary globose, c.0.5 mm

diameter, 2-locular, setose; style and stigma not

seen. Fruit globose, 6-8 mm diameter, densely

covered with scale-like stellate hairs c. 0.5 mm

diameter, densely aculeate; prickles conoidal,

1.0-1.5 mm long, erect, with scattered stellate

hairs c.6 mm long on lower two thirds, terminated

by a single hooked seta c. 0.3 mm long. Fig. 7B.

Distribution and habitat: T. trisecta is known

only from the type locality on the banks of the

King Edward River, Kimberley, Western Australia

(Map 7). It is recorded there as occurring in

shallow sand on sandstone pavements.

Phenology: Flowers and fruits have been recorded

in February.

Notes: T. trisecta is a distinctive species with its

leaves deeply dissected into three lobes. It is

distinguished from 7. mitchellii by its horizontal

rather than erect to ascending branches, and linear

to narrowly obovate rather than narrowly ovate

lobes on its leaves.

Etymology: The specific epithet refers to the leaf

of this species being divided into three segments;

Latin tri- three, and sectus divided to the base.

40). Triumfetta carteri Halford sp. nov. arte

affinis 7. micracanthae quatructus 7-9 mm

longos, 5-8 mm diam., acueleos 1-1.5 mm

longos, sepala5—10 mm longa, appendicem

sepalinam depresso-ovatum habet autem

ab ea fructibus parvioribus 4—7 mm longis

4-6 mm diam., aculeis brevioribus 0.5-1

mm longis, appendice sepalina ovata usque

late ovata differt. T'ypus: Western Australia.

Dampier District: One Arm Point airstrip,

16°26’S, 123°04’E, 18 June 1993, BJ. Carter

655 (holo: PERTH; iso: distribuendi).

Triumfetta sp. 1, Rye (1992: 176), in part.

542

Perennial shrub to 0.5(1) m high, much branched;

branches reddish-brown, decumbentto spreading,

up to 1.5 m long. Indumentum on branchlets,

petioles, peduncles, pedicels, stipules and bracts

moderately dense; hairs stellate, 0.5-1.0 mm

diameter, with stiff, appressed to spreading rays.

Leaves concolorous, entire, narrowly ovate to

ovate, 3.0-8.0 cm long, 0.8-2.5 cm wide; base

truncate or shallowly cordate; apex acute; margin

serrulate; indumentum adaxially and abaxially

sparse to dense; hairs stellate, of two size classes;

class 1 hairs sometimes absent, 0.2-—0.5 mm

diameter, with flaccid to pliable, spreading rays;

class 2 hairs particularly on veins, 0.5~2.0 mm

diameter, with stiff, appressed to spreading rays.

Petioles 6-10 mm long. Stipules triangular, 2—3

mm long. Flowers 3-5, in leaf-opposed or lateral

cymules;cymules | or 2 per node; peduncles 5—10

mm long; pedicels 3-6 mm long; bracts linear,

2~—3 mm long. Sepals linear, 10,0-12.0 mm long,

1.0-1.5 mm wide; indumentum on abaxial surface

moderately dense, with coarse, stellate hairs up to

0.8 mm diameter, the adaxial surface glabrous;

appendages subapical, erect, ovate to broadly

ovate, 1.0-2.0mm long, entire or shallowly lobed,

glabrous or with scattered stellate hairs c. 0.2 mm

diameter. Petals obovate, 5.0-6.0 mm long, c. 3

mm wide; claw c. 1.5 mm long, tomentose.

Androgynophorec. 0.2 mm long; glands orbicular;

annulus c. 0.5 mm long, ciliate on margin. Stamens

30 or more; filaments 5,0-9.0 mm long, pilose

near base; anthers oblong, c. 0.5 mm long. Ovary

globose, c. | mm diameter, 2-locular, setose; style

5,0-10.0 mm long, glabrous; stigma 2-lobed.,

Fruit globose, 4-7 mm long, 5-6 mm diameter,

densely covered with slender stellate hairs c. 1

mm diameter, densely aculeate; prickles conoidal,

O.5—1.0 mm long, erect, with a dense covering of

stellate hairs c. 0.8 mm diameter on lower third,

terminated by a single hooked setac. 0.3 mm long.

Fig. 9F.

Selected specimens: Western Australia. FitzGERALD

District: east end of Cockatoo Island townsite, May 1993,

Mitchel] 3122 (BRI, PERTH); Sunday Island, Jun 1982,

Kenneally 8298 (BRI, PERTH); ditto, Aug 1993, Mitchell

3288 (BRI, PERTH). DAmpier Districr: One Arm Point

township, Jun 1992, Carter 587 (BRI); One Arm Point, NE

tip of Dampierland, Jul 1987, Carter 50 (PERTH); One Arm

Point, Aug 1993, Carter 660 (PERTH).

Distribution and habitat: T. carteriisrestricted to

the west of the Kimberley, Western Australta,

from One Arm Point east to Cockatoo Island,

Austrobaileya 4(4): 495-587 (1997)

Buccaneer Archipelago (Map 13). It grows in

grasslands or woodlands on shallow sandy soils

on rocky sandstone rises.

Phenology: Flowers have been recorded in August,

fruits from February to April and June to August.

Notes: T. cartert is closely related to T. micracantha

butcan bedistinguished by its smaller fruit (4-7 mm

long, 4-6 mm diameter compared to 7-9 mm

long, 5-8 mm diameter), shorter prickles on its

fruit (0,5—1.0 mm long compared to 1.0-1.5 mm

long), longer sepals (10-12 mm long compared to

5-10 mmlong) and the ovate to broadly ovate

rather than depressed obovate sepal appendages.

Etymology: This species is named in honour of

Brian J. Carter, member of the Broome Botanical

Society, who has made many useful herbarium

collections of many Triumfetta species on the

Dampierland Peninsula.

41, Triumfetta micracantha F. Muell., Fragm.

3:7 (1862). Triumfetta micrantha F.Muell.

var. micrantha, Domin, Biblioth. Bot. 89:

378 (1927). Type: Sturts Creek, February

1856, F.Mueller [MEL 223687] (lecto,

designated here: MEL; isolecto: K, MEL

[MEL 223686]).

Perenntal shrub to | m high, much branched;

branches erect to ascending. Indumentum on

branchlets, petioles, peduncles, pedicels, stipules

and bracts dense, rough; hairs stellate, 1.0-1.5

mm diameter, sometimes with tuberculate base,

and with stiff, spreading rays, Leaves concolorous,

entire, ovate, 3.0—-6.0 cm long, 1.5—3.0 cm wide;

base truncate, rounded or slightly cordate; apex

acute; margin serrulate; indumentum adaxially

moderately dense to dense, abaxially dense to

very dense; hairs stellate, of two size classes; class

! hairs mostly absent adaxially, 0.3-0.7 mm long,

with pliable, spreading rays; class 2 hairs

particularly on veins, 0.5—1.5 mm diameter, with

stiff, erect to spreading rays. Petioles 5-10 mm

long. Stipules ovate, 2~3 mm long. Flowers 3—5,

in leaf-opposed or lateral cymules; cymules 2 or3

per node, sometimes forming lax terminal

paniculate inflorescences by reduction of

subtending leaves; peduncles 4~7 mm long;

pedicels 1-3 mm long; bracts narrowly triangular,

I|~3 mm long. Sepals linear, 5.0-10.0 mm long,

[.Q—2,.0mm wide; indumentum on abaxial surface

Halford, Australian Tiliaceae, 3

dense, withrigid, stellate hairs up to 1 mm diameter,

on adaxial surface densely stellate-villous near

base; appendages subapical, spreading, depressed

obovate, 0.5—1.0 mm long, shallowly lobed,

glabrous or with scattered stellate hairs c. 0.4 mm

diameter. Petals obovate, 2.0-8.0mm long, 1.0-3.0

mm wide; claw 1.0-1.5 mm long, tomentose.

Androgynophorec. 0.5 mm long; glands depressed

obovate; annulusc.0.5 mmlong, ciliate on margin.

Stamens 20-40; filaments 4.0-7.0mm long, pilose

near base; anthers oblong, c. 0.5 mm long. Ovary

globose or ovoid-globose, c. 1 mm diameter, 2-

or 3-locular, setose; style 3.0-8.0 mm long,

glabrous or with a few stellate hairs at the base;

stigma 2- or 3-lobed. Fruit ovoid, 7—9 mm long,

5—8.mm diameter, densely covered with slender

stellate hairs c. 0.7 mm diameter, sparsely to

moderately aculeate; prickles subterete, tapering

towards the apex, | .O—1.5 mmlong, erect, glabrous

or with scattered stellate hairs c. 0.7 mm diameter

on lower fifth, terminated by a single hooked seta

c. 0.2 mm long. Fig. 3B.

Selected specimens: Western Australia, DAMPIER DISTRICT:

42 miles [68 km] WNW of Fitzroy Crossing township, Sep

1959, Lazarides 6499 (CANB, MEL, PERTH). CANNING

District: below Kunningarra Rockhole, south Esk

Tablelands, Apr 1979, George 15511 (CANB, DNA,

PERTH), MUELLER Districr: Gorden Downs Station, 50km

by road S of junction of Duncan Highway and Gordon

Downs Station road, Apr 1985, Ap/in et al. 335 (PERTH).

Northern Territory. DARWIN AND GULF REGION: 74 km Eof

Stuart Highway on road to Roper Bar, Apr 1992, Halford

Q1086 (BRI, DNA); North-West corner [of] Cox’s River

Station, May 1988, Wilson 1268 (DNA); 22 miles [35 km]

NNE of New Tanumbirini Station, Jun 1971, Zatz 1397

(DNA, MEL); O:T., Station, May 1947, Blake 17657 (BRI,

MEL), Vicrorta River Recion: Victoria River, Gregory

N.P., Feb 1986, Clark 3773 & Wightman CDNA). BARKLY

TABLELAND ReGion: Stuart Highway, turnoff to Beetaloo

Station, Feb 1969, Must 394 (CANB, DNA); 81 km S of

Dunmarra on Stuart Highway, May 1985, Fryxel/etal.4443

(CANB, DNA, MEL), CeNTrRAL SOUTHERN REGION: Mt Liebig

area, Apr 1972, Maconochie 1358 (AD, CANB).

Queensland, Burke District: Adel’s Grove, via Camooweal,

Mar 1947, de Lestang 333 (BRD; 41 km W of Gregory

Downs on road to Adel’s Grove, Apr 1992, Halford Q1020

(BRI, CANB, DNA, MEL, K); 12 km Eof Croydon on road

to Georgetown, Laycock Creek crossing, Apr 1992, Halford

Q985 (BRI, DNA, K, MEL); near (12 miles [19 km] SE of)

Croydon, Jul 1954, Blake 19574(BRI, DNA), Coox District:

‘Mt Surprise’, Lower O’ Briens Creek, Apr 1992, Champion

707 (BRI); Fanneys Creek crossing, 86 km W of Georgetown,

Apr 1992, Halford Q970 (BRI, CANB, DNA, K, MEL),

Distribution and habitat: T. micracantha is

widespread across northern Australia from Fitzroy

Crossing, Western Australia, through central

543

Northern Territory to Georgetown, Queensland

(Map 15). It grows in open woodlands and

hummock grasslands on sandy or rocky soils on

sandstone or quartzite hills, in lateritic gravelly

soils on undulating plains and in gravelly and

sandy soils along stream margins.

Phenology: Flowers have been recorded from

February to May and September, fruits from

February to July.

Notes: T. micracantha 1s characterised by its

small ovoid fruit, short subterete prickles which

are glabrous or with a dense covering of slender

stellate hairs near the base, hairy staminal filaments,

and small, spreading, depressed obovate sepal

appendages.

Mueller, in his protologue, refers to material

that he collected on the Gregory expedition to

northern Australia from Victoria River, and

Hooker’s and Sturt’s Creek. At MEL, there are

two specimens (MEL 223687 and MEL 223685)

from Sturt’s Creek labelled in Mueller’s hand as

‘Triumfetta micracantha’ and ‘Triumfetta

micracanthaB cinerea’. Thereis another specimen

in MEL from Sturt’s Creek which once was part

of the Herbarium of O.W. Sonder (MEL 223686)

that appears to be part of the same collection as

MEL 223687. Mueller described T. micracantha

as having petals. MEL 223687 has petals in its

flowers while MEL 223685 has no petals in the

flowers. The second specimen matches his *Variat

tomento tenuissimo cano velutina’. The specimen

MEL 223687 is here chosen as lectotype because

it is part of the original material and matches the

description 1n the protologue.

42, Triumfetta centralis Halford, sp. nov. arte

affinis 7. micracanthae fructibus aculeis

densis tectis aculeiscrassioribus staminibus

paucioribus [0-15 in quoque flore (non

20-40) petalis absentibus differt; quoad

petala absentia 7. albidae similis autem

aculeis amplioribus |—2 mm longis (non

QO.5~—1 mm longis), fructibus amplioribus

7-10 mm diam. (non 5—7 mm diam.)

indumento grosso vestito, plerumque foltis

parvioribus 3—5 cm longis 2—3 cm latis (non

4-10 cm longis et 2—5 cm latis) differt.

Typus: Northern Territory. CENTRAL

NORTHERN REGION: Davenport Ranges,

544

Elkedra Station, 21°14’S, 135°05’E, 6 May

1977, T.S. Henshall 1731 (holo: DNA; 1so:

AD, MEL).

Perennial shrub to 0.6 m high, sparingly branched;

branches erect or ascending. Indumentum on

branchlets, petioles, peduncles, pedicels, stipules

and bracts moderately dense to dense; harrs stellate,

c.l mm diameter, sometimes with tuberculate

base, and with stiff to pliable, spreading rays.

Leaves somewhat discolorous, entire, ovate,

3.05.0 cm long, 2.0-3.0 cm wide; base truncate

or slightly cordate; apex acute; margin serrulate;

indumentum adaxially moderately dense to dense,

abaxially moderately dense to very dense; hairs

stellate, of two size classes; class 1 hairs 0.5—1.0

mim diameter, with flaccid or stiff, spreading rays;

class 2 hairs particularly on veins, 0.5-1.0 mm

diameter, with stiff, spreading rays. Petioles 6-10

mim long. Stipules narrowly triangular, 3-4 mm

long. Flowers 3 or 4, in leaf-opposed or lateral

cymules; cymules | or 2 per node; peduncles 1-3

mm long; pedicels 2~3 mm long; bracts linear-

subulate, 1-2 mm long. Sepals linear-ovate,

6.0-7.0mmlong,c. 1.5 mm wide; indumentum on

abaxial surface dense, with coarse, stellate hairs

up to 0.7 mm diameter, on adaxial surface densely

stellate-villous near base; appendages subapical,

spreading, depressed obovate, 0.5—1.0 mm long,

shallowly lobed distally, with indumentum as for

abaxial surface of sepal. Petals absent.

Androgynophorec. 0.3 mm long; glands orbicular

to very broadly obovate; annulus c. 0.5 mm long,

ciliate on margin. Stamens 10-15; filaments

4.0-5.0mm long, pilose near base; anthers oblong,

c.0.8 mmlong. Ovary globose, c. 1 mm diameter,

2-locular, setose; style 3.0-4.0 mm long,

hirsutellous on lower third; stigma minutely

toothed. Fruit ovoid-globose, 7-10 mm long,

7-10 mm diameter, densely covered with stout

stellate hairs c. 0.7 mm diameter, densely aculeate;

prickles subterete, tapering towards the apex,

1.0-2.0 mm long, erect, with a dense covering of

stellate hairs c. 0.7 mm diameter on lower third,

terminated by asingle hooked setac. 0.2 mm long.

Fig. 9A,

Additional specinens examined: Western Australia.

KEARTLAND District: Little Sandy Desert, Apr 1979, Mitchell

688 (DNA). Northern Territory. VicroriA RIVER REGION:

337 km W of the Stuart Highway on the track to Lajamanu,

Mar 1988, Leach 1756 (DNA). BARKLY TABLELAND REGION:

7 miles [11.3 km] N of Tennant Creek township, Apr 1948,

Austrobaileya 4(4): 495-587 (1997)

Perry 524 (BRI, DNA); 36 miles [57.9 km] W [of] Soudan,

Jun 1960, Chippendale 7315 (DNA); about 19°55’S,

136°25’E, May 1947, Blake {7901 (BRI), CeNTRALNORTHERN

REGION: 5 miles [8 km] NW [of] Aileron, Aug 1962, Nelson

388 (AD, DNA, MEL). CENTRAL SOUTHERN REGION:

Simpson’s Gap N.P., Mar 1976, Latzs.n. (DNA); ditto, Dec

1976, Latz 6721 (DNA, MEL).

Distribution and habitat: T. centralis occurs

mainly in southern Northern Territory, from the

Tanami Desert east to near Soudan Station and

south to Alice Springs, with a single disjunct

record from the Little Sandy Desert in Western

Australia (Map 14). It grows in grasslands and

shrublands on skeletal sandy soils onrocky hills or

sometimes in sandy souls along watercourses.

Phenology: Flowers have beenrecordedin March,

fruits from March to June, August and December.

Notes: T. centralis is closely related to 7.

micracantha but 1s distinguished by having a

denser covering of prickles on the fruit, stouter

prickles, a smaller number of stamens per flower

(10-15 compared with 20-40), and no petals. T-

centralis is similar to T. albida in lacking petals

but differs in having generally smaller leaves

(3.0-5.0cm long x 2.0-3.0 cm wide compared to

4.0-10.0 mm long x 2.0-5.0 mm wide), larger

fruit (7-10 mm diameter compared to 5~7 mm

diameter), larger prickles on the fruit (1.0—-2.0 mm

long compared to 0.5—1.0 mm long), and coarser

indumentum on the fruit.

Etymology: The specific epithet refers to the

species occurring in Central Australia; Latin

centralis central.

43, Triumfetta viridis Halford, sp. nov. arte

affinis T. micracanthae qua foha albentia

aureave petiolos 5-10 mm longos, sepala

5—l10mm longa, appendices sepalinas 0.5-1

mm longas habet autem ab ea foltis vivide

viridibus, petiolis longioribus 10-20 mm

longis, sepalis amplioribus 10-14 mm

longis, appendicibus longioribus 2.5—5 mm

longis differt. Typus: Northern Territory.

VICTORIA RIVER REGION: 112km W of Timber

Creek along Victoria Highway, Desmonds

Passage, 15°56’S, 129°36’E, 24 May 1992,

D. Halford Q1379 (holo: DNA; itso: BRI,

MEL, K).

Perennial shrub to 1 m high, much branched;

branches ascending. Indumentum on branchlets,

ye ead a yet ete ae eh ag BB aoa as eS a RAE SEE Pe STB SE TENS SAL gigi ap

Halford, Australian Tiliaceae, 3 -

petioles, peduncles, pedicels, stipules and bracts —

moderately dense; hairs stellate, 1.0—2.0 mm

diameter, sometimes with tuberculate base, and

with pliable to stiff, spreading rays. Leaves

discolorous, entire or sometimes shallowly 3-

lobed, ovate to broadly ovate, 5.0-9.0 cm long,

3.5—5.0cm wide; baserounded or slightly cordate;

apex acute; margin irregularly serrulate;

indumentum adaxially moderately dense, abaxially

dense; hairs stellate, 1.0-1.5 mm diameter, with

pliable to stiff, erect to spreading rays. Petioles

10-20 mm long. Stipules narrowly triangular, S—7

mm long. Flowers 3-5, in leaf-opposed or lateral

cymules; cymules | or 2 per node; peduncles 2—5

mim long; pedicels 2-5 mm long; bracts linear,

2-4 mm long. Sepals linear, [O.0O-14.0 mm long,

c.2 mm wide; indumentum on abaxial surface

dense, with stellate haus up to |.0 mm diameter,

on adaxial surface densely stellate-villous near

base; appendages subapical, reflexed, broadly

obovate-obtriangular, 2.5—5.0mm long, irregularly

lacerate or lobed distally, with indumentum similar

to abaxial surface of sepal but not as dense. Petals

absent or present, obovate, 6.0—7.0 mm long, c. 3

mm wide; claw c. 2 mm long, tomentose.

Androgynophorec. 0.1 mm long; glands depressed

obovate; annulusc. 0.5mm long, ciliateon margin.

Stamens 50-60; filaments 5.0—11.0 mm long,

pilose near base; anthers oblong, c. 0.5 mm tong.

Ovary globose, c, 1 mm diameter, 3- or 4-locular,

setose; style 8.0-13.0 mm long, stellate-

hirsutellous near base; stigma 3- or 4-lobed. Fruit

ovold-globose, 7-8 mm long, 7-~10mm diameter,

densely covered with slender stellate hairs up to 1

mm diameter, moderately aculeate; prickles

subterete, tapering towards the apex, |.Q—1.5 mm

long, erect, glabrous or with a few simple hairs

near base, terminated by a single hooked seta c.

0.2 mm long. Fig. 9B.

Additional specimens examined: Northern Territory,

VICTORIA RIVER REGION: 45 km SSW [of] Legume Station,

Mar 1989, Russell-Smith 7567 & Brock (BRI, DNA nv.);

Keep River N.P., Gurrandaing, May 1992, Halford Q1383

(BRI, DNA, MEL); Bulla Community, Apr 1988, Smith

1070 (DNA).

Distribution and habitat: T. viridis is restricted to

the north-western Northern ‘Territory from Keep

River N.P. to near the Pinkerton Range (Map 13),

Ithas been recorded growing in low woodlands on

sandy sos on sandstone plateaus, hillslopes and

rocky outcrops.

545

Phenology: Flowers have been recorded in March

and May, fruits from March to May and August.

Notes: JT. viridis is closely related to

T. micracantha but ts distinguished from that by

having larger sepals (10.0-14.0 mm long

compared to 5.0-10.0 mm long), larger sepal

appendages (2.5—5.0 mmlong compared to0.5—1.0

mm long), longer petioles (10-20 mm long

compared to 5-10 mm long), and bright green

rather than whitish or golden-yellow leaves.

Etymology: The specific epithet alludes to the

ereen colour of the species leaves; Latin viridis

ereen. :

44, Triumfetta clivorum Halford, sp. nov. arte

affinis 7 micracanthae autem aculeiscrassis

anguste conicis non aculeis gracilibus

teretibus utin 7. micracantha differt. Typus:

Western Australia, GARDNER Districr:6km

NW of Kununurra on road to Wyndham,

Bandicoot Range, 15°46’S, 128°41’E,

7 June 1992, D. Halford Q1485 (holo:

PERTH; iso: BRI, DNA, PERTH).

Perennial shrub to 1.5 m high; branches erect to

ascending. Indumentum on branchlets, petioles,

peduncles, pedicels, stipules and bracts moderately

dense to dense, rough, of stellate hairs and

sometimes simple hairs on young branchlets;

simple hairs slender, erect, 2.0-3.0 mm long;

stellate haus 0.7-2.0 mm diameter, sometimes

with tuberculate base, and with stiff, spreading

rays, Leaves discolorous, entire, narrowly ovate

to broadly ovate, 4.5—9.0(-13.0) cm long, 1.5-6.0

(-12.0) cm wide; base truncate or cordate; apex

acute; margin irregularly serrulate; indumentum

adaxially sparse to moderately dense, abaxially

moderately dense to dense; hairs stellate, 1.0-2.0

mm diameter, with mostly stiff, spreading rays.

Petioles 8-20(¢-50) mm long. Stipules triangular,

2-3 mm long. Flowers 3-5, in leaf-opposed or

lateralcymules; cymules | or2 per node; peduncles

2—8(-12) mm long; pedicels 2—5 mm long; bracts

linear-subulate, 1-3 mm long. Sepals linear,

7.0-13.0mm long, |.5—2.0mm wide; indumentum

on abaxial surface dense, with coarse, stellate

hairs up to [ mm diameter, on adaxial surface

densely stellate-pubescent on proximal third;

appendages subapical, spreading, depressed

obovate-depressedc. | mmlong, shallowly lobed,

with scattered stellate hairs c. 0.5 mm diameter.

546

Petals obovate to broadly obovate, 2.0-11.0 mm

long, 0.7-6.0 mm wide; claw 1.5—2.0 mm long,

pubescent. Androgynophore c. 0.1 mm long;

glands depressed obovate; annulus c. 0.5 mm

long, ciliate on margin. Stamens 30 or more;

filaments 4.0—-7.0 mm long, sparsely pilose near

base; anthers oblong, c. 0.6 mm long. Ovary

globose, 1.0-2.0 mm diameter, 2- or 3-locular,

setose; style 5.0-8.0 mm long, stellate-pubescent

at base; stigma 3-lobed. Fruit ovoid-globose, 7-9

mm diameter, densely covered with stout stellate

hairs 0.5 mm diameter, densely aculeate; prickles

conoidal, 1.0-1.7 mm long, erect, with a dense

Two subspecies are recognisable,

Austrobaileya 4(4): 495--587 (1997)

covering of stellate hairs c. 0.5 mm long on the

lower half, terminated by a single hooked seta c.

Q,22 mm long.

Affinities: T. clivorum 1s closely related to T.

micracantha but can be distinguished by the

conoidal rather than subterete prickles on its fruit.

Etymology: The specific epithet refers to the

habitat, i.e. hillsides and slopes on which this

species has been recorded; Latin clivorum of the

slopes, growing on the slopes.

Leaves ovate to broadly ovate, 5—9(-13) cm long, 3-6(- 12) cm wide; petals broadly

obovate, 5-11 mm long, 3.5-6.0 mm wide

5 8 F F © © 8 © 8 @® &© F # #£ #£ #£ & © & *# ££ ££ *#£ * F

subsp. clivorum

Leaves narrowly ovate to ovate, 4.5-6.0 cm long, 1.5—2.5 cm wide; petals obovate,

2-5 mm long, 0.7-2.5 mm wide .........

44a, Triumfetta clivorum subsp. clivorum.

Frutex 1.5m altus. Folia ovata usque late

ovata 5—9(-13) cm longa, 3—6(-12) cm lata.

Petala late obovata 5—11 mm longa, 3.5—-6

mm lata; unguis 1.5—2 mm longus.

Triumfetta sp. K, Rye (1992: 178).

Shrub 1.5 m high. Leaves ovate to broadly ovate,

5—9(-13) cm long, 3-6(-12) cm wide. Petals

broadly obovate, 5-11 mm long, 3.5—6.0 mm

wide; claw 1.5—2.0 mm long. Fig. 9C.

Selected specimens: Western Australia. GARDNER DISTRICT:

c. 12km W of Kununurra on the Wyndham road, at NE foot

of the Bandicoot Range, Apr 1977, Pullen 10.642 (BRI,

CANB, LE n.v., PERTH n.v.); [2 km W of Kununurra on

Duncan Highway, Bandicoot Range, May 1992, Halford

01387 (BRI); headwaters of Packsaddle Creek, Northern

Carr Boyd Ranges, Mar 1978, Hartley 14339 (CANB,

DNA, PERTH); Kimberley Research Station, Feb 1950,

Drysdale 198 (CANB); 36 km SW of Victoria Highway

along Lake Argyle road, between Dead Horse Spring and

Spillway turnoff, May 1992, Halford Q1387 (BRI, DNA,

MEL, PERTH).

Distribution and habitat: T. clivorum subsp.

clivorum 1s restricted to the Bandicoot and Carr

Boyd Ranges near Kununurra, Western Australia

(Map 15). [t has been recorded growing in low

open woodlands-and hummock grasslands on

ss 6 6 & © & © F&F FF F&F B&B F&F BO BF BF ££ & &£ ££ HF ££ F

subsp. brevipetala

skeletal soils on rocky hills and in gravelly soils

along watercourses.

Phenology: Flowers have been recorded between

February and June, fruits from March to June.

44b, Triumfetta clivorum subsp. brevipetala

Halford, subsp. nov. a 7. clivorum subsp.

clivorum petalus parvioribus, foliis anguste

Ovatis usque ovatis infra indumento

cinarescenti differt. Frutex usque 0.6 m

altus, Folia anguste ovata usque ovata, 4.5-6

cm longa, 1.5—2.5 cm lata. Petala obovata

2-5 mm longa, 0.7—2.5 mm lata; unguis

1-1.5 mm longus. Typus: Western

Australia. FITZGERALD District: S [south of]

Turkey Creek, near Telecom ‘Tower,

LP’O7'S, 128° 15’, 18 July 1991, 2D. Cowie

1874 (holo: PERTH; iso: DNA).

Shrub to 60 cm high. Leaves narrowly ovate to

ovate, 4.5—6,0 cm long, 1.5—-2.5 cm wide. Petals

obovate, 2~—5 mm long, 0.7—2.5 mm wide; claw

1,.0-1.5 mm long.

Additional specimens examined: Western Australia, HALL

District: | km N of Smoke Creek on Galloping Creek Track,

SW of Lake Argyle, Apr 1980, Weston 12173 (PERTH);

Bungle Bungle N.P., Jun 1989, Cowie 947 & Menkhorst

(CANB, DNA); White Mountatn Hills, near Ord River

Sleateital talented ce ei ne Pe en Rd

Halford, Australian Tiliaceae, 3

Station, Apr 1977, Pullen 10.828 (CANB, PERTH).

Northern Territory. DARWIN AND GULF REGION: Gregory

N.P., Feb 1992, Cowie 2215 & Brocklehurst(BRI). VICTORIA

River REGION: Blackfellow Creek, Newry Station, Mar

1989, Leach 2323 & Dunlop (BRI, CANB, DNA n.v.);

Negri River, 3.5 km E of Duncan Highway, near Mistake

Creek Homestead, + 328 km WSW of Victoria River

Downs, Jul 1976, Beauglehole 54380 (MEL); 2 km § [of]

White Hill, Pine Hill Station, May 1983, Thomson 323

(DNA).

Distribution and habitat; T. clivorum subsp.

brevipetala occurs from the mountain ranges

south of Lake Argyle, Western Australia east to

Newcastle Range near Timber Creek witha single

disjunct record from Pine Hill Station in the

Northern Territory (Map 16). Ithas beenrecorded

erowing in eucalypt woodland among rocks on

the rim of a mesa, on the edge of a granite slab in

moist soil, in sandy soil onan openrocky sandstone

platform, in woodland on a creek levee and in

granitic soil at the base of rocks.

Phenology: Flowers have been recorded in April

and June, fruits in March and from May to July,

Notes: T. clivorum subsp. brevipetala can be

distinguished from T. clivorum subsp. clivorum

by its smaller petals, greyish indumentum on the

lower surface of the leaf and narrowly ovate to

ovate leaves.

Etymology: The subspecific epithet refers to the

much reduced lamina ofthe petal in this subspecies;

Latin brevi- short, petalum petal.

45, Triumfetta antrorsa Halford, sp. nov. arte

affinis 7. arnhemicae qua aculeos 1,5—2

mim longos etfructus 6—8 mm longos, 6-9

mim diam. habet ab ea aculeis longioribus

3—5 mm longis et fructibus amplioribus

8—12 mm longis, 8-15 mm diam. differt.

Olim 7. antrorsa relata est ad 7.

appendiculatam qua aculeos erectos,

staminum filamenta glabra, appendices

sepalinas patentes habet autem ab ea

indumento grosso, aculeis antrorsis,

staminum filamentis pubescentibus,

appendices sepalinis reflexis distinguitur.

Typus: Western Australia, HALL District:

Palm Springs, Black Elvire River, 42 km

EK of Halls Creek along the Duncan

Highway, June 1992, D. Halford Q1478

(holo: PERTH; iso: BRI, DNA, KK, MEL).

Triumfetta sp. Q & sp. R, Rye (1992: 181).

547

Perennial shrub to 2 m high; sparingly or much

branched; branches ascending to erect.

Indumentum on branchlets, petioles, peduncles

and pedicels dense to very dense, rough; hairs

stellate, of two size classes; class | hairs sometimes

absent, up to 0.5 mm diameter, with flaccid to

pliable, spreading rays; class 2 hairs 1.0-3.0 mm

diameter, subsessile, with stiffto pliable, spreading

rays. Leaves discolorous, entire, narrowly to

broadly ovate, (3.0-)5.0-12.0 cm long, (1.5-)

2.5-8.0cm wide; base slightly cordate; apex acute

Or sometimes acuminate; margin serrate;

indumentum adaxially and abaxially dense; hairs

stellate, of two size classes; class | hairs c. 0.5 mm

diameter, with pliable to stiff, spreading rays;

class 2 hairs particularly on veins, 1.5—2.0 mm

diameter, with stiff, spreading rays. Petioles 5—25

mm long. Stipules triangular, 4-7 mm long,

sparsely stellate-hairy. Flowers 2-4, in leaf-

opposed or axillary cymules; cymules | or 2 per

node, often forming lax terminal paniculate

inflorescences by reduction of subtending leaves;

peduncles 7—20 mm long; pedicels 3-9 mm long;

bracts narrowly triangular, 5-8 mm long, hirsute.

Sepals linear, 9.0-17.0 mm long, 2.0—-3.0 mm

wide; indumentum on abaxial surface dense, with

coarse, stellate hairs up to 2.0 mm diameter; on

adaxial surface densely stellate-villous near base;

appendages, subapical, reflexed, obovate to

broadly obovate, 1.0—-5.0 mm long, entire, erose

or deeply divided into 2 to 6 slender lobes, with

indumentum as for abaxial surface of sepal. Petals

obovate to broadly ovate, 5.0-10.0 mm long,

2.0-6.0 mm wide; clawc.2 mm long, tomentose.

Androgynophorec. 0.1 mm long; glands depressed

obovate; annulus c. 1 mm long, ciliate on margin.

Stamens 30 or more; filaments, 6.0-8.0 mm long,

pilose near base; anthers oblong, c. 0.5 mm long.

Ovary globose, c. 1 mm diameter, 3-locular,

setose; style 9.0-10.0 mm long, stellate-hairy at

base; stigma 3-lobed. Fruit ovoid-globose, 8-12

mm long, 8—15 mm diameter, densely covered

with stout stellate hairs up to 1.0 mm diameter,

densely aculeate; prickles subterete, distinctly

tapering towards the apex, 3.0-5.0 mm long,

antrorse, obliquely ascending, with a dense

covering of simple and stellate hairs 0.5—1.5 mm

long on lower third, terminated by asingle hooked

seta c. 0.4mm long. Fig, 12A.

Selected specimens: Western Australia. FirzGERALD

District: 39 km N of Halls Creek along the Great Northern

Highway, Jun 1992, Halford Q1482 (BRI, PERTH); {7 km

548

N of Halls Creek along the Great Northern Highway, Jun

1992, Halford Q1481 (BRI, DNA, MEL, PERTH); & miles

(12.8 km) SE of Halls Creek, May 1944, Gardner 7164

(PERTH). Hatt Districr: Bungle Bungle N.P., Jun 1989,

Menkhorst 879 (DNA); between Njitparriya and Dilmartyu,

3 km SE [of] Bungie Bungle Outcamp, Jul 1984, Forbes

2585 (PERTH); Bungle Bungle N.P., Bluehole Yard, Ord

River, Jul 1989, Menkhorst 843 (DNA, PERTH); Blue Hole,

Ord River, Jul 1991, Cowie 1959 (DNA); 26 miles [42 km]

N of Nicholson Station, Jul 1949, Perry 2388 (AD, BRI,

CANB, DNA, MEL); 39 km S of Forrest River crossing on

Duncan Highway, Apr 1977, George 14451 (PERTH);

Bungle Bungle N.P., NW of Turner Homestead, Jul 1989,

Menkhorst 839 (DNA); Ord River, Oct 1906, Fitzgerald

1621 (PERTH); 100 km E of Fitzroy Crossing along Great

Northern Highway, Ngumban Cliff, Jun 1992, Halford

Q1466 (BRI, PERTH); between Christmas Creek turnoff

and homestead, Apr 1972, Aplin 4753 (PERTH); China

Wall, 6 km E of Halls Creek along the Duncan Highway, Jun

1992, Halford Q1477 (BRI, DNA, K, MEL, PERTH); Date

Palm Creek, Duncan Highway, 25.7 km by road SE of Halls

Creek, Jun 1976, Beauglehole ACB53339 (PERTH); Sawpit

Gorge, 3.5 km S of Duncan Highway, 29,2 km by road SE

of Halls Creek, Jun 1976, Beauglehole ACB53400 (PERTH).

Northern Territory. VICTORIA River Recion: 74km SW of

Victoria River Homestead, Jun 1974, Latz 8210 (DNA); 114

miles [183 km] N of Hookers Creek, May 1971, Taylor 26

(DNA).

Distribution and habitat: T. antrorsa occurs

from near Fitzroy Crossing, Western Australia,

east to Hookers Creek in the Victoria River Region

of the Northern Territory (Map 20). It has been

recorded growing in spinifex grassland and open

woodland on rocky skeletal soils on scraps,

quartzite ridges and limestone outcrops, in

Eucalyptus collina open woodland on a sand

plain, in Melaleuca viridiflora low open woodland

in sandy loam beside a ephemeral watercourse

and on a basalt ridge with kucalyptus brevifolia.,

Phenology: Flowers have been recorded from

April to June, fruits from April to July and October.

Notes: T. antrorsaiscloselyrelatedto T. arnhemica

butcan be distinguished by having longer prickles

(3.0-5.0mm long compared to 1.5-2.0 mmlong),

and larger fruit (8-12 mm long x 8-I5 mm

diameter compared to 6-8 mm long x 6-9 mm

diameter). 7. antrorsa has previously beenreferred

to 7. appendiculata but can be distinguished from

that by having a coarser indumentum, antrorse

rather than erect prickles on its fruit, hairy rather

than glabrous staminal filaments, and reflexed

rather than spreading sepal appendages.

‘This species exhibits considerable variation

in its indumentum. Rye (1992) recognised two

taxa (species Q and species R) which I have

Austrobaileya 4(4): 495-587 (1997)

included in 7. antrorsa, She distinguished her taxa

on the length of the hairs on their sepals. More

collections may reveal that this split is justified.

The collection Forbes 2585 is somewhat

atypical of this species in having slightly larger

fruitthan 1s normal and prickles on its fruit that are

more erect than is typical for this species.

Etymology: The specific epithet refers to the

direction the prickles on the fruit point; Latin

antrorsus antrorse, directed upwards, towards the

apex.

46. Triumfetta arnhemica Halford, sp. nov. arte

affinis J. antrorsae qua aculeos 3—3 mm

longos et fructus 8-12 mm longos 8-15 mm

diam. habet autem ab ea aculeis brevioribus

1.5—2 mm longis et fructibus parvioribus

6-8 mm longis 6-9 mm diam. differt.

Quondam 7. arnhemica relata est ad

T. micracantham autem fructibus aculeis

Sparsius obtectis, aculeis antrorsis (non

erectis), sepalorum appendicibus reflexis

1-3 mm longis (non 0.5—-1 mm _ longis)

differt. Typus: Northern Territory, DARWIN

AND GULF REGION: gorge between ‘Twin

Falls and Jim Jim Falls, 12°19’S, 132°52’E,

24 March 1984, G.Wightman 1309 &

L.Craven (holo: BRI; iso: CANB, DNA

n.v., MEL, NSW n.v.).

Perennial shrub to 1.5 m high, sparingly or much

branched; branches ascending. Indumentum on

branchlets, petioles, peduncles, pedicels, stipules

and bracts moderately dense to dense, rough; hairs

stellate, 1.0-2.0 mm diameter, subsessile,

sometimes with tuberculate base, and with stiff,

spreading rays. Leaves discolorous, entire, ovate

or narrowly ovate, 5.0-12.0 cm long, 2.5-6.0 cm

wide; base truncate or shallowly cordate; apex

acute; margin irregularly serrulate; ndumentum

adaxially dense to very dense, abaxially very

dense; hairs stellate, of two size classes; class I

hairs O.2—0.5 mm diameter, with pliable, spreading

rays; Class 2 hairs particularly on veins, 1.0—2.0

mm diameter, with stiff, spreading rays. Petioles

10-15 mmlong. Stipules linear-subulate, 3-6 mm

long. Flowers 2—5, in leaf-opposed or lateral

cymules;cymules | or2 per node; peduncles 5—15

mm long; pedicels 2-4 mm long; bracts narrowly

linear up to 4 mm long. Sepals linear-lanceolate,

§.0—-15.0mm long, |.0-2.0mm wide; indumentum

on abaxial surface dense, with coarse, stellate

Halford, Australian Tiliaceae, 3

hairs up to 1.0 mm diameter, on adaxial surface

densely stellate-villous near base; appendages

subapical, reflexed, obovate, |.0-3.0 mm long,

lacerate, with indumentum proximally dense,

distally sparse, consisting of stellate hairs up to 0.6

mm diameter. Petals obovate to broadly obovate,

4,.0-8.0 mm long, 2.0-5.0mm wide; claw 1.0-2.0

mm long, tomentose. Androgynophore c. 0.3 mm

long; glands orbicular; annulus c, 0.5 mm long,

ciliate on margin. Stamens 30 or more; filaments

5.0-8.0mm long, pilose near base; anthers oblong,

c.0.5 mmlong. Ovary globose, c. 0.5 mm diameter,

3-locular, setose; style 6,0—10.0 mm long, glabrous

except a few hairs at base; stigma 3-lobed. Fruit

ovoid-globose, 6-8 mm long, 6-9 mm diameter

(not including prickles), densely covered with

stellate hairs c. 0.8 mm diameter, sparsely aculeate;

prickles subterete, distinctly tapering towards the

apex, 1.5-2.0 mm long, antrorse, obliquely

ascending to somewhat appressed, with a dense

covering of stellate hairs c. 0.8 mm long on lower

half, terminated by single hooked seta c. 0.2 mm

long, Fig. 12D.

Selected specimens: Northern Territory, DARWIN AND

GuLF ReGion: East Alligator River, 2 km S of Cahills

crossing, May 1983, Russell-Smith 635 & Lucas(DNA); SE

[of] Mt Howship, Arnhem Land, Feb 1984, Dunlop 6643

(DNA); upper East Alligator River, W Arnhem Land, Feb

1991, Brock 772 & Russeli-Smith CONA); headwaters of

Liverpool River, Apr 1984, Wightman 1416 & Craven

(BRI, CANB, MEL, DNA nw, K nv, NSW n.vy.); Jim Jim

Falis, Kakadu N.P., Apr 1992, Halford Q1157 (BRI, CANB,

DNA, K, L, MEL); Kakadu N.P., 14 km E of Sleisbeck, Apr

1990, Leach & Cowte 2750 (BRI, DNAn.v., MEL); Arnhem

Land, Flinders Peninsula, May 1992, Cowie 2763 (BRD;

Wessel Islands, Raragala Island, Jul 1992, Leach 3117

(BRD).

Distribution and habitat: T. arnhemica 1s

restricted to Arnhem Land in the Northern

Territory, from East Alligator River east to the

Wessel Islands (Map 16). It grows in shrublands,

woodlands and open forests on shallow sandy

soils on sandstone scree slopes and dissected

sandstone plateaux, and in deep sandy alluvium

on stream margins draining the sandstone

escarpment

Phenology: Flowers have been recorded from

February to April, fruits from March to May.

Notes: T. arnhemicaisclosely related to T. antrorsa

butcan be distinguished by having shorter prickles

(1.5—-2.0mm long compared to 3.0-5.0mm long),

and smaller fruit (6—8 mm long x 6-9 mm diameter

549

compared to 8-12 mm long x 8-15 mm diameter).

In the past, T. arnhemica has been referred to T-

micracantha but differs by having a sparser

covering of prickles on the fruit, antrorse rather

than erect prickles on its fruit, and larger sepal

appendages (1-3 mm long compared to 0.5—1 mm

long).

Etymology: The specific epithet refers to the

species’ localised distribution in Arnhem Land,

Northern Tetritory.

47. Triumfetta nutans Halford, sp. nov. ut videtur

non arte affinis 7riumfettae speciei ullae

Australianae antea discriptae. Ea staminum

filamenta pubescentia, appendices sepalinas

erectas, petalorum laminem perdiminutam

el T. breviaculeae similem habet autem

fructibus aculeis sparsim obtectis, pedicellis

reflexis, sepalis glabris intrinsecus

distinguitur, Typus: Western Australia.

GARDNER District: near Drysdale River

along small creek, 14°05’S, 125°57’E,

16 May 1983, P.A. Fryxell & L.A.Craven

4145 (holo: PERTH; iso: CANB, DNA,

MEL).

Triumfetta sp. N, Rye (1992: 180).

Perennial shrub to2.5 m high, sparingly branched;

branches erect to ascending. Indumentum on

branchlets, petioles, peduncles, pedicels, stipules

-and bracts dense, rough; hairs stellate, 1.0—-1.5

mm diameter, with stiff, brittle, spreading rays.

Leaves concolorous, entire, narrowly ovate to

ovate, 4.0-9.0 cm long, 1.55.0 cm wide; base

truncate; apex acute; margin irregularly dentate-

serrulate; indumentum adaxially moderately dense

to dense, abaxially dense to very dense; hairs

stellate, of two size classes although not always

readily distinguishable; class | hairs sometimes

absent adaxially, 0.5-1.0 mm diameter, with

pliable, spreading rays; class 2 hairs particularly

on veins, 0.5—1.5 mm long, with stiff, spreading

rays. Petioles 10-15 mm long. Stipules narrowly

triangular, 5-6 mm long. Flowers 2 or 3, in leaf-

opposed or lateral cymules; cymules | or 2 per

node; peduncles 5-10 mm long; pedicels 5-8 mm

long, reflexed with fruit; bracts narrowly ovate,

I~—2 mm long. Sepals persistent in fruit, Imear,

12.0-17.0 mm long, c. 2 mm wide; indumentum

on abaxial surface dense, with coarse stellate hairs

upto 1.5 mmdiameter, the adaxial surface glabrous;

MSEAEEN ERG RS NTN TERETE ARM

550

appendages subapical, erect, ovate to broadly

ovate, 2.0-3.0mm long, lacerate, withindumentum

similar to abaxial surface of sepal butnotas dense.

Petals with lamina much reduced; laminanarrowly

ovate, 1.0-3.0 mm long, c. 0.4 mm wide; claw

1.0-2.0 mm long, tomentose. Androgynophorec.

0.5 mm long, with one continuous gland covering

whole surface; annulus c. 1 mm long, ciliate on

margin. Stamens 30 or more; filaments 6.0-10.0

mm long, pilose near base; anthers oblong, c. 0.5

mm long. Ovary globose, c. 1 mm diameter, 3- or

4-locular, setose; style 6.0-13.0 mm long,

pubescent at base; stigma minutely toothed. Fruit

subglobose, sometimes irregularly lobed, 8—12

mm long, 10-12 mm diameter, densely covered

with scale-like stellate hairs up to0.5 mm diameter,

sparsely aculeate; prickles subterete, distinctly

tapering towards the apex, [.O—2.5 mm long, erect

or appressed, with broad base, and with a dense

covering of scale-like stellate hairs c. 0.2 mm long

on lower half, terminated by a hooked seta up to

0.4 mm long. Fig. 11A.

Additional specimens examined: Western Australia.

GARDNER District: 13 km S of Kalumburu, King Edward

River, Mar 1989, Keighery 10681 (PERTH); 24 km W of

Bindoola Creek crossing on the Gibb River-W yndham road,

May 1992, Halford Q1412 (BRI, CANB, DNA, K, MEL,

PERTH).

Distribution and habitat: T. nutans is restricted to

the northern Kimberley, Western Australia, from

the King Edward River to the Durack River (Map

16) It has been recorded growing in riverine

monsoon vine forest on brown sandy loam clay, in

sandy pockets in exposed sandstone with

Eucalyptus sp. and Livistona inermis, and in

eucalypt woodland in shallow sandy soil on

sandstone hills.

Phenology: Flowers have beenrecorded in March,

fruits in May.

Notes: T, nutans does not appear to be closely

related to any previously described Australian

/riumfettaspecies, Ithas hairy staminal filaments,

erect sepal appendages and a extremely reduced

petal lamina similar to thatin 7. breviaculeata, but

is Clearly distinguished from that by its sparse

covering of prickles on the fruit, reflexed pedicels

and glabrous inner surface of the sepals.

Etymology: The specific epithet refers to the fruit

of this species betng borne on reflexed pedicels;

Latin nutans, nodding.

Austrobaileya 4(4): 495-587 (1997)

48. Triumfetta ryeae Halford, sp. nov. affinis 7.

simulantietT. breviaculeae abeisindumento

grossiore longioreque infructibus, aculeis

teretibus longioribus (1-2 mm longis nonc.

0.8 mm longis). Nomen 7. appendiculata

pro ea olim adhitum autem ab illa aculeis

brevioribus 1-2 mm longis (2.5-4:mm longis

in 7. appendiculata), foliis amplioribus,

indumento grossiore clare distinguitur.

Typus: Western Australia. GARDNER

District: on E edge of Kununurra on NE

side of Mt Cyril (Hidden Valley), 15°47’S,

128°45’E, 18 May 1983, P.A.Fryxell &

L.A. Craven 4189 (holo: PERTH; iso: BRI,

CANB, DNA, MEL).

Perennial shrub to 1.5 m high; branches ascending.

Indumentum on branchlets, petioles, peduncles,

pedicels, stipules and bracts sparse to dense; hairs

stellate, 0.5—3.0 mm diameter, subsessile,

sometimes with tuberculate base, and with stiff to

pliable, spreading rays. Leaves discolorous, entire

or shallowly 3-lobed, ovate to broadly ovate,

8.0—-13.0cm long, 5.0-7.0cm wide; base cordate;

apex acute or obtuse; margin irregularly serrulate;

indumentum adaxially moderately dense to dense,

abaxially dense to very dense; hairs stellate, of two

size classes; class | hairsc. 0.5 mm diameter, with

flaccid to pliable, spreading rays; class 2 hairs

particularly on veins, 1.0—2.0 mm diameter, with

stiffto pliable, spreading rays. Petioles 15-40 mm

long. Stipules linear-subulate, 4-7 mm long.

Flowers 2-4, in leaf-opposed or lateral cymules;

cymules 1 or 2 per node, sometimes forming lax

terminal paniculate inflorescences by reduction

of subtending leaves; peduncles 10-40 mm long;

pedicels 4-6 mm long; bracts linear, 4-5 mm

long. Sepals linear, 8.0-20.0 mm long, 1.0-2.0

mm wide; indumentum on abaxial surface dense,

with coarse, stellate hairs up to 2 mm long, on

adaxial surface densely stellate-villous on proximal

third; appendages subapical, erect, ovateto broadly

ovate, 2.0-5.0 mm long, entire or erose, with

indumentum as for abaxial surface of sepal. Petals

oblong-obovate, 5.0—-8.0 mm long, 1.0-2.0 mm

wide or linear-ovate, c. | mm long, c. 0.4 mm

wide; claw 1.0-2.0 mm long, tomentose.

Androgynophorec. 0.5 mm long; glands depressed

obovate; annulusc. 1 mm long, ciliate on margin.

Stamens 40 or more; filaments 5.0—-12.0 mm long,

glabrous or pilose near base; anthers oblong, c.0.5

mm long. Ovary globose, c. 1.5 mm diameter, 3-

Cote U Agua ya ee os oon ees eee ee ong dine NE

Halford, Australian Tillaceae, 3

or 4-locular, setose; style 8.0-10.0 mm long,

hirsutellous at base; stigma 3- or 4-lobed. Fruit

globose-ovoid, slightly constricted near middle,

7—10mm long, 8—10mm diameter, densely covered

with stout stellate hairs 0.5-1.0 mm diameter,

densely aculeate; prickles subterete, tapering

towards the base, 1.0-2.0 mm long, erect, with a

dense covering of simple and stellate hairs 0.5—1.0

mm long on the lower two thirds, terminated by a

single hooked seta c. 0.3 mm long.

Affinities: 7. ryeae has affinities with T. simulans

and T. breviaculeata but differs in having fruit

with acoarser and longerindumentum, and prickles

that are longer (1—2 mm long compared to c. 0.8

mm long). The name 7. appendiculata has

551

previously been applied to this species but it is

clearly distinguished from T. appendiculata by its

shorter prickles (1.0-2.0 mm long compared to

2.5-4.0 mm long), larger leaves and coarser

indumentum.

Etymology: This species is named in honour of

Barbara L. Rye, author of the Tiliaceae treatment

in the Flora of the Kimberley Region (1992).

Notes: T. ryeae occurs in the Kimberley of Western

Australia and in north-western Northern Territory.

This species 1s very variable in the length of its

indumentum and size and shape of its petals.

Three subspecies are recognised here as follows.

Key to subspecies

1. Petal lamina oblong-obovate, 4-8 mm long, always distinctly longer thanclaw........... 2

Petal lamina ovate, up to 2 mm long, usually no longer thanclaw ........ subsp. brevipetala

2. Stems and leaves moderately to very densely stellate-hirsute; hairs up to 3 mm

long; sepal appendages broadly ovate .....

Qe ene 4 cece eae ey AL Ts ae SO ae subsp. hirsuta

Stems and leaves moderately to densely stellate-hirsutellous; hairs up to 1.5mm

long; sepal appendages narrowly ovate ....

48a. Triumfetta ryeae subsp. ryeae. Frutex

caeruleo-griseus indumento in ramis

petiolisque usque 1.5 mm crasso. Folia

ovata usque late ovata, 8-13 cm longa, 5—/

cm lata. Pedunculi 1-2 cm longi. Sepala

10-15 mm longa, 1.2-1.5 mm lata,

appendice anguste ovata. Petalorum laminae

oblongo-ovatae, 4-7 mm longae. Staminum

filamenta basi pilosa. T. ryeae subsp. ryeae

aceteris subspecibus 7. ryeae indumento in

ramis petiolisque breviore et a 7. ryeae

subsp. brevipetalae petalorum laminis

longioribus differt.

Triumfetta sp. U, Rye (1992: 182).

Blue-grey shrub with indumentum on branchlets

and petioles up to 1.5 mm long. Leaves ovate to

broadly ovate, 8-13 cm long, 5-7 cm wide.

Peduncles 1—2 cm long. Sepals 10-15 mm long,

1.2—-1.5 mm wide; appendages narrowly ovate.

Petal lamina oblong-obovate, 4-7 mm long.

Staminal filaments pilose near base. Fig. 10A.

Nereis tea veeeeeeess. SUbsp. ryeae

Selectedspecimens: Western Australia. GARDNER DisTRICT:

Black Rock Pool, 23 km N of Kununurra, Jun 1992, Halford

Q1488 (BRI, PERTH); Valentine Springs, 17 km N of

Kununurra, Jun 1992, Halford Q1487 (BRI, DNA, PERTH);

near entrance to Hidden Valley, Mar 1982, Done 589

(PERTH); Hidden Valley, 3.2km E of Kununurra, Jul 1976,

Beauglehole ACB54197 (PERTH); + 32 km WSW of

Kununurra, Aboriginal Paintings area, Jul 1976, Beauglehole

ACBS54286 (PERTH). Northern Territory. Vicroria RIVER

REGION: Keep River Gorge, Keep River N.P., May 1990,

Menkhorst 1015 (DNA, MEL). |

Distribution and habitat: T. ryeae subsp. ryeae

occurs from the Carr Boyd Ranges in the

Kimberley, Western Australia, to the Keep River,

Northern Territory (Map 17). It grows in open

~ woodlands and open shrublands mostly on sandy

soils on sandstone hillsides, rocky outcrops and

escarpmenis.

Phenology: Flowers have been recorded from

March to May, fruits in May and June.

Notes: T. ryeae subsp. ryeae is distinguished from

the other two subspecies by its shorter indumentum

on stems and petioles. Itis also separable from 7:

ryeae subsp. brevipetalaby its longer petal lamina.

552

48b. Triumfetta ryeae subsp. hirsuta Halford,

subsp. nov. a 7. ryeae subsp. brevipetalae

petalorum laminis longioribus 6-8 mm

longis (in illa 1.5—2 mm longis) et 7. ryeae

subsp. ryeae indumento crassiore in

caulibusque petiolisque et appendice

sepalina late ovata distinguitur. Frutex

pallide viridis vel caeruleo-griseus

indumento usque 3 mm crasso in ramulis

petiolisque. Foliis ovatis usque late ovatis

10-12 cm longis, 8-9 cm latis. Pedunculi

2-5 cm longi. Sepala 10-20 mm longa,

1.5—2 mm lata, appendice lata ovata.

Petalorum lamina oblongo-ovata 6-8 mm

longa. Staminum filamenta basi glabra

pilosave. Typus: Western Australia.

FITZGERALD District: Manning Gorge, near

Mt Barnett Homestead, near mouth of gorge,

5 May 1969, P.A.Fryxell & LA.Craven

3969 (holo: PERTH; iso: AD, BRI, CANB,

DNA, MEL).

Triumfetta sp. F, Rye (1992: 176).

Pale green or blue-grey shrub with indumentum

on branchlets and petioles up to 3 mm long.

Leaves ovate to broadly ovate, 10-12 cm long,

8—9 mm wide. Peduncles 2—5 cm long. Sepals

10-20 mm long, 1.5—2.0 mm wide; appendages

broadly ovate. Petal lamina oblong-obovate, 6-8

mm long. Staminal filaments glabrous or pilose at

base.

Selected specimens: Western Australia, GARDNER DISTRICT:

The Grotto, near Kimberley Research Station, Jul 1952,

Perry 3069 (BRI, CANB, DNA); 2 km E of Charnley and

Calder Rivers, Eastern Walcott Inlet, May 1983, Milewski

200 (PERTH). FirzceraLp Districr: Manning Gorge, + 275

km SW of Wyndham, Jun 1976, Beauglehole ACB52532

(PERTH).

Distribution and habitat: T. ryeae subsp.

hirsuta occurs from near Mt Talbot to Erskine

Range in the Kimberley of Western Australia

(Map 18). It grows in open woodlands on

sandy soils amongst boulders on sandstone

plateaux, along watercourses and in black peaty

_, loams in riverine vine forests.

7 Phenology: Flowers have been recorded in March,

fruits from May fo July.

Notes: T. ryeae subsp. hirsuta is distinguished

from T. ryeae subsp. brevipetala by its longer

Austrobaileya 4(4): 495-587 (1997)

petal lamina (6-8 mm long compared to 1.5—2.0

mm long). It is separable from T. ryeae subsp.

ryeae by the denser indumentum on its stems and

petioles and its broadly ovate sepal appendages.

Etymology: The subspecific epithet refers to the

coarser longer hairs found in this subspecies;

Latin hirsutus, covered with moderately coarse

and stiff long, ascending hairs.

48c. Triumfetta ryeae subsp. brevipetala

Halford, subsp. nov. a ceteris subspecibus

T. ryeae petalorum lamina multo redacta

{.5—2 mm longa (non 4—8 mm longa) et in

locis rupestribus crescens, in habitatiore

differt. Frutex pallide viridis indumento

1-2 mm crasso inramulis petiolisque. Folia

ovata 6-7 cm longa 4—5 cm lata. Peduncult

1-2. cm longt. Sepala 8-13 mm longa, 1—-1.5

mm. lata. Petalorum lamina lineari-ovata

1,5—2 mm longa. Staminum filamenta bas!

pilosa, Typus: Western Australia. DAMPIER

District: 141 km W of Fitzroy Crossing

along the Great Northern Highway, 17°51’S,

124°2.1’E, 4 June 1992, D. Halford Q1462

(holo: PERTH; iso: BRI, DNA, K, MEL).

Triumfetta sp. T, Rye (1992: 182).

Pale green shrub with indumentum on branchlets

and petioles 1-2 mm long. Leaves ovate, 6—7 cm

long, 4-5 cm wide. Peduncles 1—2 cm long.

Sepals 8-13 mm long, 1.0-1.5 mm wide. Petal

lamina linear ovate, 1.5-2 mm long. Staminal

filaments pilose near base.

Selected specimens: Western Australia, DAMPIER DisTRICT:

Grant Range, Camballin Road, 28.7 km (by road) S of

junction [of] Derby-Fitzroy Crossing road, Apr 1985, Aplin

etal. [52(PERTH); Liveringa Station, Fitzroy River, undated,

Royce 6888 (PERTH); Upper Liveringa, Fitzroy River, Aug

1906, Fitzgerald 1579 (PERTH), Firzceracp District: King

Creek Gorge, + 15 km SW of Bedford Downs Homestead,

+65 km W of Great Northern Highway, + 102 km NNW of

Halls Creek, Jun 1976, Beauglehole ACB53605 (PERTH).

Distribution and habitat: T. ryeae subsp.

brevipetala occurs from Grant Range to Durack

Range in the Kimberley of Western Australia

(Map 17). It grows in hummock grasslands on

Skeletal soils on rocky sandstone and shale

hillslopes.

Phenology: Flowers have beenrecorded1in March,

April and September, fruits in April and June.

Halford, Australian Tiliaceae, 3

Notes: T. ryeae subsp. brevipetala differs from

the other subspecies of 7: ryeae in having a much

reduced petal lamina (1.5—2.0mm long compared

to 4-8 mm long).

Etymology: The subspecific epithet refers to the

reduced petal lamina in this subspecies; Latin

brevi-, short and petalum, petal.

49, Triumfetta simulans Halford, sp. nov. arte

affinis 7. ryeae subsp. hirsutae autem ab ea

aculeis anguste conicis 0.5—0.8 mm longis

(non teretibus 1—2 mm longis) distinguitur.

Aliquae formae 7. stmulantis stimulant 7.

breviaculeam autem illa fructibus

parvioribus 7—8 mm longis, 6-8 mm diam.

(non (7-)8-11 mm longis, (7-)8-13 mm

diam.) indumento praesertim in caulibus

sepalisque longiore, appendicibus sepalinis

longioribus 4-6 mm longis (non 2—3 mm

longis) plerumque distinguitur. Nomen T.

appendiculatapro hac specie olim abhibitum

autem ab ea 7: simulans aculeis brevioribus

0.5—0.8 mm longis (non 2.5-4 mm longis),

sepalis amplioribus, indumento crassiore

manifeste distinguitur. Typus: Western

Australia. FirzGeRALD District: Koolan

Island, 16°08’S, 123°47°E, 1 June 1985,

P.A. Fryxell, L.A. Craven & J. McD. Stewart

4581 (holo: PERTH; iso: CANB, DNA,

[MEL ]).

Triumfetta sp. S, Rye (1992: 181).

Perennial shrub to 1.5 m high; branches erect or

ascending. Indumentum on branchlets, petioles,

stipules, peduncles, pedicels, stipules and bracts

dense; hairs stellate, 2.0-4.0 mm diameter, usually

with a tuberculate base, and with stiff to pliable,

spreading rays. Leaves discolorous, entire, ovate

to broadly ovate, 9.0-16.0 cm long, 7.0—-13.0 cm

wide; base cordate orrounded; apex acute; margin

irregularly serrate; indumentum adaxially

moderately dense, abaxially very dense; hairs

stellate, of two size classes; class | hairs 0,.2-0.7

mm diameter, with flaccid to pliable, spreading

rays; class 2 hairs particularly on veins, 1.5—3.0

mm diameter, with stiff to pliable, spreading rays.

Petioles 30-50 mm long. Stipules linear-subulate

or narrowly ovate, 6-8 mm long. Flowers 2-4, in

lateral or leaf-opposed cymules; cymules 2 or 3

per node, usually forming lax terminal paniculate

inflorescences by reduction of subtending leaves;

553

peduncles 12~—25 mm long; pedicels 7-10 mm

long; bracts linear or narrowly ovate, 5-7 mm

long. Sepals linear-ovate, 14.0-16.0 mm long, c.

3mm wide; indumentum on abaxial surface dense,

with stellate hatrs 2.0-3.0 mm diameter, on adaxial

surface densely stellate-villous on proximal third;

appendages subapical, erect, triangular, 4.0-6.0

mm long, decurrent, lacerate, with indumentum

as for abaxial surface of sepal. Petals absent or with

lamina much reduced, c. 2 mm long, c. 0.3 mm

wide; clawc.4mm long, villous. Androgynophore

c. 0.5 mm long; glands depressed elliptic; annulus

c. 0.5 mm long, ciliate on margin. Stamens 40 or

more; filaments 8.0-13.0 mm long, pilose near

base; anthers oblong, c. 0.5 mm long. Ovary

globose, c. | mm diameter, 3- or 4-locular, setose;

Style 10.0-13.0 mm long, hirsutellous at base;

stigma 3- or 4-lobed. Fruit broadly ovoid, 7-8 mm

long, 6-8 mm diameter, densely covered with

scale-like stellate hairs c.0.5 mm diameter, densely

aculeate; prickles subterete, tapering towards the

apex, 0.5—0.8 mm long, erect, withadense covering

of simple and stellate hairs c. 0.2 mm diameter on

lower half, terminated by a single hooked seta c.

Q.2 mm long. Fig. 10B.

Additional specimens examined: Western Australia.

GARDNER District: 4 km S of Mouth of Isdell River with

Walcott Inlet, May 1992, Kenneally 11149 (PERTH).

FirzGERALD District: Koolan Island, May 1983, Fryxell &

Craven 3921 (CANB, MEL, PERTH); Water Bore Guily

Road, Koolan Island, Jun 1984, Vernon 63 (PERTH); Wood

Island, [Buccaneer Archipelago}, Jul 1973, Wilson 11534

(PERTH); Napier Range, Baker River, Apr 1952, Gardner

10348 (PERTH); Barker River, Apr 1952, Gardner 10355

(PERTH), DAmprer District: Robinson River, 8.8 km E of

Stuart River, Oobagooma road, +74 km NNE of Derby, Jun

1976, Beauglehole ACB52956 (PERTH),

Distribution and habitat: T. simulans occurs in

the Kimberley of Western Australia, from Koolan

Island south eastto Napier Range (Map 10). Ithas

been recorded growing ina eucalypt woodland on

broken sandstone, on a rocky sandstone slope in

brown soilamongstscattered eucalypts and grasses,

in alluvial sand over sandstone on the edge of a

river and on a beach.

Phenology: Flowers have been recorded in

February and from April to June, fruits from April

to June.

Notes: T. stmulans 1s closely related to T. ryeae

subsp. firsuta; but can be distinguished by the

length of the prickles of its fruit(O.S—O0.8 mm long

compared to 1.0-2.0 mm long). Some forms of

554

T. simulans resemble T. breviaculeata but can be

usually distinguished by its slightly smaller fruit

(7-8 mm long x 6-8 mm diameter compared to (7/-

)8—11 mm long x (7-)8—13 mm diameter), longer

indumentum especially on stems and sepals,

and the longer sepal appendages (4-6 mm

long compared to 2-3 mm long). The name

T. appendiculata has previously been applied to

this species but it is clearly distinguished from

T. appendicalata by its shorter prickles (0.5—0.8

mm long compared to 2.5-4.0 mm long), larger

sepals and coarser indumentum.

Etymology: The specific epithet refers to the

similarity of this species to T. ryeae and

T. breviaculeata; Latin simulans, resembling.

50. Triumfetta breviaculeata Halford, sp. nov.

arte affinis 7. simulanti et T. ryeae autem ab

illa fructibus parum amplioribus (7-)8—11

mm longis (7-)8-13 mm diam. (non 7-8

longis, 6-8 mm diam.) indumento praesertim

in caulibus sepalisque breviore,

appendicibus sepalinis brevioribus, 2-3 mm

longis (non 4-6 mm longis) distinguitur; ab

hac aculeis in fructibus brevioribus,

indumento in caulibus sepalis fructibusque

breviore crassiore recedit. Nomen 7.

appendiculatapor hac specie olim abhibitum

autem ab ea 7. breviaculeata aculeis

brevioribus 0.5—0.8 mm longis (nullo modo

2.5.4 mm longis), tndumento breviore

crassioreque distinguitur. Typus: Western

Australia. GARDNER Districr: The Grotto,

7Okm W of Kununurra onroadto Wyndham,

15°43’ S, 128°16’E, 27 May 1992, D. Halford

QO1402 (holo: PERTH; iso: BRI, DNA, K,

L, MEL).

Triumfetta sp. M, Rye (1992: 179).

Perennial shrubto 1.5 mhigh; branches ascending.

Indumentum on branchlets, petioles, peduncles,

pedicels, stipules and bracts dense, rough; hairs

Stellate, 0.5—1.0 mm diameter, sometimes with

tuberculate base, and with stiffto pliable, spreading

rays. Leaves discolorous, entire, ovate, 5.0-10.0

cm long, 2.5—8.5 cm wide; base truncate or slightly

cordate; apex obtuse; margin irregularly serrate;

indumentum adaxtially sparse to moderately dense,

abaxially dense to very dense; hairs stellate, of two

size classes; class 1 hairs sometimes absent

adaxially, c. 0.5 mm diameter, with flaccid to

Austrobaileya 4(4); 495-587 (1997)

pliable, spreading rays; class 2 hairs particularly

on veins, 0.5—1.0mm diameter, with stiff, spreading

rays. Petioles 15-25 mm long. Stipules narrowly

triangular, 2-5 mm long. Flowers 2 or 3, in lateral

or leaf-opposed cymules; cymules | or 2 per node,

often forming axillary paniculate inflorescences

by reduction of subtending leaves; peduncles

8—20 mm long; pedicels 1-3 mm long; bracts

ovate, |-3 mm long. Sepals lmear-ovate, 9.0-16.0

mm long, 1.5-2.5 mm wide; indumentum on

abaxial surface dense, with coarse, stellate hairs

up toc. | mm long, on adaxial surface densely

stellate-villous on proximal half; appendages

subapical, erect, ovate, 2.0-3.0mm long, decurrent,

entire or shallowly lobed, with indumentum as for

abaxial surface of sepal. Petals absent or with

lamina much reduced, c. 0.5 mm long, c. 0.3 mm

wide; claw c. 1.5 mm long, tomentose.

Androgynophorec. 0.5 mm long; glands depressed

obovate; annulusc. 0.5 mm long, ciliateon margin.

Stamens 30 or more; filaments 5.0-9.0 mm long,

pilose near base; anthers oblong, c. 0.5 mm long.

Ovary globose, 1.0-1.5 mm diameter, 3- or 4-

locular, setose; style 5.0-10.0 mm long,

hirsutellous at base; stigma 3- or 4-lobed. Fruit

broadly obloid-ovoid, (7-)8—-11 mm long, (7-)

8—13 mm diameter, densely covered with scale-

like stellate hairs c. 0.5 mm diameter, densely

aculeate; prickles conoidal, up to 0.8 mm long,

erect, with a dense covering of scale-like stellate

hairs c. 0.1 mm long on lower two thirds, terminated

by a single hooked seta c. 0.2 mm long. Fig. 10C.

Selected specimens: Western Australia. GARDNER DISTRICT:

Langit, 5 km S of Prior Point, May 1992, Kenneally 11155

(PERTH); 60km along Gibb River Road from Great Northern

Highway, 3 km W of Pentecost River crossing, Apr 1992,

Halford Q1406 (BRI, PERTH); Edkins Range, Sep 1921,

Gardner 1369 (PERTH). Firzceracp District: El Questro-

Gibb River road, 7.6 km by road E of Bindoola Creek, + 50

km SW of Wyndham, May 1976, Beauglehole ACB51343

(PERTH); Bluey O’Malley’s crossing, Bindoola Creek,

Gibb River Road, c. 55 km SW of Wyndham, May 1992,

Halford Q1409 (BRI, DNA, PERTH); ‘Galvans Gorge’,

Phillips Range, 20 km SW of Mt Barnett Homestead, Jun

1992, Halford Q1439 (BRI, DNA, MEL, PERTH); King

Leopold Range, 6 km E of Mt Bell, Jun 1992, Halford

Q1443 (BRI, DNA, K, MEL, PERTH); 13.5 miles [ 21.7

km] NW of Elgie Cliffs Station, Apr 1995, Lazarides 5100

(AD, BRI, CANB, MEL, PERTH). Dampter Districr: One

Arm Point, SE tip of Dampierland, May 1987, Carter 14

(PERTH); Meda-Oobagooma road, 80 km by road N of

Gibb River Road, + 70 km NE of Derby, Jun 1976,

Beauglehole ACB52762 (PERTH); Wonganut Spring, 19

km ESE of Coulomb Pt, Jun 1984, Kenneally 9038 (CANB,

PERTH); 19 km ESE of Coulomb Point, Wonganut Spring

Halford, Australian Tiltaceae, 3

Creek, Jun 1984, Forbes 2360 (MEL, PERTH); near junction

of Lennard and Barker Rivers, May 1905, Fitzgerald 524

(PERTH).

Distribution and habitat: T. breviaculeata is

widespread in the Kimberley of Western Australia,

from Broome east to Kununurra (Map 19). It

grows in open woodlands on sandy soils on

sandstone hillslopes and along watercourses, and

rarely on coastal beaches. —

Phenology: Flowers have been recorded from

April to July and September, fruits from April to

June and September.

Notes: T. breviaculeata 1s closely related to T.

stmulans and T. ryeae. Itis distinguished from the

former by its slightly larger fruit ((7-)8—11 mm

long x (7-)8—-13 mm diameter compared to 7-8

mm long x 6—8 mm diameter), shorterindumentum

especially on stems and sepals, and the shorter

sepal appendages (2-3 mm long compared to 4—6

mm long). It is separable from 7. ryeae by its

shorter prickles on the fruit and shorter coarser

indumentum on the stems, sepals and fruit. The

name 7. appendiculatahas previously been applied

to this species but this species is clearly

distinguished from 7. appendiculataby its shorter

prickles on the fruit (0.5—0.8 mm long compared

to 2.5-4.0 mm long) and shorter coarser

indumentum.

Thecollections Kenneally 11155 (PERTH),

Carter 14(PERTH) and Beard & Coate|PERTH

1549995 |(PERTH) have somewhat smaller fruit

than what is typical for this species,

Etymology: The specific epithet refers to the very

short prickles on the fruit of this species; Latin

brevis, short and aculeatus prickled.

51. Triumfetta mellina Halford, sp. nov.

affinitatibus incertis confundi potest cum

T. pannosa qua folia ovata usque late ovata

apice obtusa usque rotundata, aculeos 3-4

mm longos, appendices sepalinas patentes

| .5—2 mm longas, fructus 12—17 mm longos

habet autem abeafoltis anguste ovatis apice

acutis, aculeis longioribus 4-6 mm longis,

appendicibus sepalinis recurvatis usque

reflexis longioribus 6-8 mm longis, fructibus

parum amplioribus 15-20 mm longis

distinguitur. Nomen 7. appendiculata pro

555

hac specie olim adhibitum autem ab ea

T. mellina forma fructus foliorumque,

aculeis longioribus, forma habituque

appendicum sepalinorum, indumento

ramorum foliorumque crassiore differt.

Typus: Queensland. Burke District: 73

km E of Wollogorang Homestead, on road

to Doomadgee, 17°36’S, 138°27°E, 9 April

1992, D.Halford Q1034 (holo: BRI; iso:

DNA, MEL, Ks).

Perennial shrub to 1.5 m high, much branched

from the base; branches spreading or ascending.

Indumentum on branchlets, petioles, peduncles,

pedicels, stipules and bracts dense to very dense;

hairs stellate, 2.0-4.0 mm diameter, subsessile,

sometimes with tuberculate base, and with pliable

tostiff, spreading rays. Leaves concolorous, entire,

narrowly ovate to ovate, 4,0-8.0 cm long, 2.5-6.0

cm wide; base cordate; apex acute; margin

irregularly serrulate; indumentum adaxially and

abaxially dense; hairs stellate, of two size classes;

class | hairs up to 0.5 mm diameter, with flaccid,

spreading rays; class 2 hairs 1.0-3.0 mm diameter,

with pliable to stiff, erect to spreading rays. Petioles

10-20 mm long. Stipules narrowly triangular,

5—10 mm long. Flowers 2 or 3, in lateral or leaf-

opposed cymules; cymules | or 2 per node, often

forming lax terminal paniculate inflorescences by

reduction of subtending leaves; peduncles 6—10

mm long; pedicels 6-10 mm long; bracts linear,

3-6 mm long. Sepals linear-ovate, 10.0-14.0 mm

long, 2.5—3.0 mm wide; indumentum on abaxial

surface dense, with slender stellate hairs up to 2.0

mm diameter, on adaxial surface densely stellate-

villous near base; appendages subapical, recurved,

obovate, 6-8 mm long, deeply lobed distally,

with indumentum as for abaxial surface of sepal.

Petals obovate, 5.0-6.0 mm long, 1.5—2.5 mm

wide; claw 2.0—-3.0 mm long, tomentose.

Androgynophorec. 0.3 mm long; glands depressed

obovate; annulusc. 1 mm long, ciliate on margin.

Stamens 30 or more; filaments 5.0-10.0 mm long,

pilose near base; anthers oblong, c. 0.5 mm long.

Ovary globose, 1.0-1.5 mm diameter, 3- or 4-

locular, setose; style 8.0-12.0 mm long, stellate-

hirsutellous at base; stigma 3- or 4-lobed. Fruit

globose, 15-20 mm diameter, densely covered

with stout stellate hairs c. 0.5 mm diameter,

densely aculeate; prickles subterete, 4.0-6.0 mm

long, erect, brittle, withadense covering of simple

and stellate hairs 0,5-2.0 mm long on lower four

fifths, terminated by a single hooked seta c. 0.2

mm long. Fig. 10D.

556

Additional specimens examined: Western Australia. HALL

District: 18 miles [29 km] WSW of Lissadell Station, Aug

1949, Perry 2679 (DNA). Northern Territory. BARKLY

TABLELAND ReGIoN: China Wall, south of Calvert Hills

Station, Jun 1973, Henry 816 (DNA, MEL); Nicholson

River area, Fish River, Jun 1974, Maconochie 1976 (DNA).

Queensland. Burke District: Settlement Creek, Feb 1923,

Brass 293 (BRD; Branch Creek, 7 km E of Wollogorang

Homestead, on road to Doomadgee, Apr 1992, Halford

Q1045 (BRI, DNA, MEL); 50km Eof Wollogorang on road

to Burketown, Jun 1991, Halford Q603 (BRI, DNA, MEL);

c. 44 km NW of old ‘Corinda’ outstation, at Camp Oven

Lagoon, on road from Doomadgee to Wollogorang, May

1974, Pullen 9156 (BRI, CANB),.

Distribution and habitat: T. mellina occurs around

the Gulf of Carpentaria from the Nicholson River,

Northern Territory to near Doomadgee,

Queensland with a single disjunct record from

Lissadell Station in the eastern Kimberley of

Western Australia (Map 17). It grows in open

eucalypt woodlands in sandy, loamy orrocky soils

onrocky sandstone outcrops, hillslopes, plains or

on stream margins.

Phenology: Flowers have been recorded in

February and April, fruits from April to June and

August.

Notes: The affinities of T. mellina are unclear. It

can be confused with 7. pannosa but ts

distinguished by its narrowly ovate rather than

ovate to broadly ovate leaves with acute rather

than obtuse to rounded apex, longer prickles (4-6

mm long compared to 3-4 mm long), sepai

appendage length and orientation (6—8 mm long

and recurved to reflexed compared to 1.5—-2.0 mm

long and spreading) and slightly larger fruit 1 5—20

mm longcompared to 12—17 mm long). The name

T. appendiculata has previously been applied to

this species but it is easily distinguished from T-

appendiculata by its fruit shape, longer prickles

onits fruit, leaf shape, sepal appendage length and

orientation, and the coarser indumentum on its

branches and leaves.

Etymology: The specific epithet refers to the

colour of the plant; Latin mellinus, honey-colour.

52. Triumfetta pannosa R. Br, ex Halford, sp.

nov. inclusa a Benthamo in ejus

circumscriptionem 7. appendiculatam F,

Muell. qua in forma foliorum et in

amplitudine fructuum ei similis autem abea

T. pannosa indumento crassiore, fructibus

ovoido-globosis, stipulis parvioribus 2—3

Austrobaileya 4(4): 495-587 (1997)

mm longis (non 5—12 mm longis),

appendicibus sepalinis depresse obovato-

triangularibus (non late obovatis), staminum

filamentus pubescentibus distinguitur, 7:

pannosa arte affinis T. rupestri autem ab ea

indumento in ramis foliisque breviore,

aculeis longioribus 3-4 mm longis (non 2~—3

mm longis), appendicibus sepalinis

brevioribus 1.5~2 mm longis (non 2-5 mm

longis) differt. Aliquot formae T. pannosae

cum 7. ryeae subsp, ryeae confundi possunt

autem eae fructibus amplioribus 12-17 mm

diam. (non 8-10 mm diam.) aculeis

longioribus 3-4 mm longis (non 1-2 mm

longis) appendicibus — sepalinis-

obtriangularis (non late obovatis) differunt.

Typus: Northern Territory. DARWIN AND

GULF REGION: 95 km W of Wollogorang on

road to Borroloola, Surprise Creek crossing,

9 April 1992, D.HalfordQ1061 (holo: DNA;

iso: BRI, CANB, K, L, MEL).

Perennial shrub to | m high, sparingly or much

branched; branches prostrate, ascending or erect.

Indumentum on branchlets, petioles, peduncles,

pedicels, stipules and bracts moderately dense;

hairs stellate, 0.5—2.0 mm diameter, sometimes

with tuberculate base, and with pliable to stiff,

appressed to spreading rays. Leaves somewhat

discolorous, entire, ovate to broadly ovate,

3,0—10.0 cm long, 2.5-9.0 cm wide; base truncate

or slightly cordate; apex obtuse orrounded; margin

crenate-serrulate or irregularly serrulate,

indumentum adaxially and abaxially moderately

dense to dense; hairs stellate, of two size classes:

class | hairs up to 0.5 mm diameter, with flaccid,

spreading rays; class 2 hairs 0.S—1.0 mm diameter,

with stiff, spreading to erect rays. Petioles [Q—20

mm long. Stipules ovate, 2~3 mm long. Flowers

2—5, in leaf-opposed or lateral cymules; cymules

2 or 3 per node; peduncles 5-30 mm long; pedicels

5—7 mm long; bracts linear-subulate, 2-3 mm

long. Sepals linear, 8.0—-15.0 mm long, 1.5—3.0

mm wide; indumentum on abaxial surface dense,

with stellate hairs c. 1.5 mm diameter, on adaxial

surface densely stellate-villous near base;

appendages subapical, spreading, depressed

obovate-obtriangular, 1.5-2.0 mm long, erose,

with indumentum as for abaxial surface of sepal.

Petals obovate, 4.0-5.0 mm long, 2.5—3.5 mm

wide; clawc. 2 mm long, villose. Androgynophore

c.0.5 mm long; glands depressed obovate; annulus

aa TNR NRHN

Halford, Australian Tiliaceae, 3

0.5—1.0mm long, ciliate on margin. Stamens 30 or

more; filaments 5.0-9.0 mm long, pilose near

base; anthers oblong, c. 0.5 mm long. Ovary

globose, 1.0-1.5 mm diameter, 3- or 4-locular,

setose; style 9.0-14.0 mm long, stellate-

hirsutellous at base; stigma 3- or 4-lobed. Fruit

depressed globose, 12-17 mm diameter, densely

covered with stout stellate hairsc. 0.5 mm diameter,

densely aculeate; prickles subterete, tapering

towards the apex, 3.0-4.0 mm long, erect, with a

dense covering of simple, bifid and stellate hairs

Q.5—1.0 mm long on lower two thirds, terminated

by a single hooked seta c. 0.2 mm long. Fig. 10F.

Selected specimens: Northern Territory. DARWIN AND

GutF REGION: Wessel Islands, Oct 1972, Latz 3427 (DNA);

10 miles [16 km] S of Cape Arnhem, Jun 1972, Maconochie

1534 (MEL); Port Bradshaw, Jul 1948, Specht ‘701 CAD,

BRI, MEL); Kakadu N.P., 14km E of Sletsbeck, Apr 1990,

Leach 2754 & Cowie (BRI, MEL); Sleisbeck, Jun 1969,

Byrnes 1652 (BRI, DNA); Arnhem Land, Lane Island, NE

[of] Groote Eylandt, Jun 1988, Wightman 4448 (DNA);

Hemple Bay, Groote Eylandt, in the Gulf of Carpentaria,

May 1948, Specht 379 (AD, BRI, MEL); Katherine Gorge

N.P., May 1983, Fryxell & Craven 4216 (CANB, DNA,

MEL); Nitmiluk/Katherine Gorge N.P., Feb 1990, Evans

2936 (BRI, CANB, MEL); 74 km E of Stuart Highway on

road to Roper Bar, Apr 1992, Halford Q1084 (BRI, CANB,

DNA, K, MEL); Gulfof Carpentaria, Marta Island, Jul 1972,

Dunlop 2806 (DNA), Lake Eames area, 2km NE Vanderlin

Island, Sir Edward Pellew Group, Jul 1988, Thomson 2523

(DNA); 50 km E of Borroloola on road to Wollogorang

Homestead, Poison Creek crossing, Apr 1992, Halford

Q1051 (BRI, DNA, MEL); 57 km & of Borroloola on road

to Wollogorang Homestead, Wearyn River crossing, Apr

1992, Halford Q1060 (BRI, DNA, MEL); 60 miles [96 km]

N of Wollogorang Station, near coast, Jun 1948, Perry 1219

(CANB, DNA, MEL, PERTH). Queensland. Burke

District: Mornington Island, Wellesley Islands, May 1963,

Tindale (AD 97806319) (AD); between turn-off Lagoon

and Wollogorang, May 1940, Jensen 55 (BRI); Doomadgee

Aboriginal Reserve, between Bayley Point and Point Parker

on the Gulf of Carpentaria, Sep 1983, Taylor 48 (BRD; 77

km N of Escott Homestead by track towards Point Parker,

Jul 1987, Dalliston HC280 (BRD; 13 miles [21 km] SW of

Croydon Township, Aug 1953, Perry 3926 (BRI, CANB).

Distribution and habitat; T. pannosa occurs in

northern Australia from near Katherine, Northern

Territory, to Croydon, Queensland, including

islands in the west of the Gulf of Carpentaria

(Map 19). It grows in riverine and coastal sand

dune communities mostly in sandy soils.

Phenology: Flowers have beenrecorded between

January and July, fruits from April to October.

Notes: Bentham (1863) included this species in

his concept of Mueller’s 7. appendiculata.

357

T. pannosa resembles T. appendiculata in its leaf

shape and fruit size but it can be distinguished by

its coarser indumentum, ovoid-globose rather than

ovoid fruit, smaller stipules (2-3 mm long

compared to 5-12 mm long), depressed obovate-

obtriangular rather than broadly obovate sepal

appendages, and hairy rather than glabrous

staminal filaments. 7. parnosa is closely related

to T. rupestris but can be distinguished by the

shorter indumentum on its branches and leaves,

longer prickles on its fruit (3.04.0 mm long

compared to 2.0-3.0 mm long), and shorter sepal

appendages (1.5~2.0 mm long compared to2.0—5.0

mm long).

Some forms of T. pannosa may beconfused

with 7. ryeae subsp. ryeae but differ from that in

having larger fruit (12—17 mm diameter compared

to 8-10 mm diameter), longer prickles on its fruit

(3.0-4.0 mm long compared to |.0-2.0mm long),

and depressed obovate-obtriangular rather than

ovate to broadly ovate sepal appendages.

T. pannosahastwomorphologically distinct

habits, aprocumbentform whichcommonly grows

on coastal sand dunes and an erect form that

usually occurs on alluvial soils along river terraces.

_ Etymology: The specific epithet refers to the

texture of the leaves; Latin pannosus, with

appearance or texture of felt.

53. Triumfetta rupestris Halford, sp. nov. affinis

T. pannosae autem indumento in ramis

foliisque longiore, aculeis brevioribus 2—3

mm longis (non 3-4 mm longis),

appendicibus sepalinis longioribus 2—5 mm

longis (non 1.5—2 mm longis) differt. Nomen

7. appendiculata pro hac specie olim

abhibitum autem ab ea J. rupestris

indumentocrassiore, fructibus globosis (non

ovoideis), aculeis brevioribus 2—3 mm longis

(non 3—4 mm longts) facile distinguitur. T.

rupestris cum T. mellina confundi potest

autem ab ea fructus parvioribus 10-15 mm

diam. (non [5-20 mm diam.), aculeis

brevioribus 2-3 mm longis (non 4-6 mm

longis), appendicibus sepalinis patentibus

brevioribus 2—5 mm longis (non recurvatis

usque reflexis 6-8 mm longis, Habitationes

duarum differunt; T. rupestrisin solis saxois

collinis autem 7. mellina in alluvione in

ripis crescit. Typus: Queensland. BURKE

rime EMER:

LODE TOR

Tera TT nd rr ne rnc

558

District: 25 km W of Cloncurry on road to

Mt Isa, 20°45’S, 139°16’E, 28 April 1992,

D. Halford Q1210 (holo: BRI; iso: DNA,

MEL).

Perennial shrub to 1.5 m high, sparingly or much

branched; branches spreading or ascending.

Indumentum on branchlets, petioles, peduncles,

pedicels, stipules and bracts dense to very dense;

hairs stellate, 2.0-4.0 mm diameter, with

tuberculate base, and withstiffto pliable, spreading

rays. Leaves concolorous, entire, narrowly ovate

to broadly ovate, 6.0-10.0 cm Iong, 2.5-6.0 cm

wide; base obtuse or slightly cordate; apex acute

or acuminate; margin irregularly serrulate;

indumentum adaxially dense, abaxially dense to

very dense; hairs stellate, of two size classes; class

| hairs up to 0.5 mm diameter, with flaccid,

spreading rays; class 2 hairs 1.0-3.0 mm

diameter, with stiff to pliable, erect to spreading

rays. Petioles 1O-20 mm long. Stipules narrowly

triangular, 5-10 mm long. Flowers 3-5, in

lateral or leaf-opposed cymules; cymules | or 2

per node, sometimes forming lax terminal

paniculate inflorescences by reduction of

subtending leaves; peduncles 5-15 mm long;

pedicels 3-7 mm long; bracts linear, 4~7 mm

long. Sepals linear-ovate, 12.0-14.0 mm long,

2,9~3.0mm wide; indumentum on abaxial surface

dense, with slender, stellate hairs 1.0-3.0 mm

diameter, on adaxial surface densely stellate-

villous near base; appendages subapical, spreading,

obovate to broadly obovate, 2.0-5.0 mm long,

erose, with indumentum as for abaxial surface of

sepal. Petals (rarely absent) narrowly oblong-

obovate, 4.0-6.0 mm long, 1.5—2.5 mm wide;

claw c. 3 mm long, tomentose. Androgynophore

c.0.3 mm long; glands depressed obovate; annulus

c. | mm long, ciliate on margin. Stamens 30 or

more; filaments 6.0-13.0 mm long, pilose near

base; anthers oblong, c. 0.5 mm long. Ovary

globose, |.0-2.0 mm diameter, 3-locular, setose;

style 9.0-11.0 mm long, stellate-hirsutellous on

lower half; stigma 3-lobed. Fruit globose, 10—15

mm diameter, densely covered with stout stellate

hairs up to 2.0 mm diameter, densely aculeate,

prickles subterete, tapering towards the apex,

2.0~-3.0 mm long, erect, with a dense covering of

simple and stellate hairs 0.5-1.0 mm long on

lower two thirds, terminated by single hooked seta

c. 0.3 mm long. Fig. 10E. |

Austrobaileya 4(4); 495-587 (1997)

Selected specimens; Western Australia, HALi District: |

mile [1.6 km] E of Turner River Station, Jul 1949, Perry

2406 (AD, BRI, CANB, DNA, MEL, PERTH). Queensland.

Burke District: Lawn Hill N.P., Jul 1985, Willianis 85083

(BRD; 2 km E of Lawn Hill N.P. on track to Adel’s Grove,

Apr 1992, Halford Q1016(BRI, CANB, DNA, K, L, MEL);

15 miles (24 km] NNE of Riversleigh Station, May 1948,

Perry 1088 (BRI, CANB, DNA); Calton Hills, 45 miles {72

km] N of Mt Isa, May 1963, Gittins 764 (BRI, NSW);

Leichhardt River crossing, Coolullah Station, 2 km S of

homestead, Apr 1992, Halford Q990 (BRI, DNA, K, MEL);

[0 km NW of Kajabbi along dismantled railway line to Mt

Cuthbert Mine, Apr 1992, Halford Q999 (BRI, DNA, K);

Mt Isa, Apr 1935, Blake 8801 (BRI); Paroo Range, 35 km

N of Mt Isa, Jan 1990, Harris 441 (BRD; Mt Isa, May 1952,

Morris [AQ 86932] (BRI); Mt Isa, No. 8 Tailings Dam, Mar

1977, Schmid 86 (CANB),.

Distribution and habitat: T. rupestris occurs in

north-western Queensland from the Queensland /

Northern Territory border to Cloncurry with a

single disjunct collection from Hardman Range in

the Kimberley of Western Australia (Map 18). It

has been recorded growing in low open Eucalyptus

leucophloia woodlands, in skeletal soils on rocky

sandstone or quartzite hills, and rarely in open

Eucalyptus camaldulensis forests in gravelly well-

drained soils on stream margins.

Phenology: Flowers have beenrecorded between

January and June, fruits in April, May and August.

Notes: T. rupestrisis closely related to 7. pannosa

but can be distinguished by a longer indumentum

on its branches and leaves, shorter prickles on its

fruit (2.0-3.0 mm long compared to 3.04.0 mm

long), and longer sepal appendages (2.0-5.0 mm

long compared to 1.5—-2.0mm long). The name 7.

appendiculata has previously been applied to 7:

rupestris but it is easily distinguished from 7.

appendiculataby 1ts coarser indumentum, globose

rather than ovoid fruit, and shorter prickles (2.0~3.0

mm long compared to 3.0-4.0 mm long).

T. rupestris can be confused with 7: mellina

butis distinguished by having smaller fruits 10-15

mm diameter compared to 15-20 mm diameter),

shorter prickles (2.0-3.0 mm long compared

4.0-6.0 mm long), and shorter sepal appendages

(2—5 mm long compared to 6-8 mm long) which

are spreading rather than recurved to reflexed.

There are differences in habitat where these species

occur as well. T. rupestris grows onrocky skeletal

soils on hillsides while 7. mellina grows mainly on

alluvial soils on river terraces.

eo RRNer sree

Halford, Australian Tiltaceae, 3

Etymology: The specific epithet refers to the

rocky hills on which the species grows; Latin

rupestris, rock-dwelling.

S54. Triumfetta inermis Halford, sp. nov.

insignisior ex affinatate non statim manifesta,

fructibus pilis stellaribus stipitatis modice

dense obtectis, aculeos setasoe in specibus

omnibus ceteris Australianis praeter

T. pustulata qua fabricas vesicarias habet

carentibus instructa; habito foltis facieque

T. viride similis autem ab ea appendicibus

sepalinis subapicalibus in 2 lobos distinctos,

unum erectum alterum reflexum, divisis

(appendicibus sepalinis 7. viridis omnino

reflexis), petalis amplis orbicularo-obovatis

(petalis 7. viridis parvis obovatis vel penitus

absentibus) fructibus aculeorum expertibus

distinguitur. Typus: Northern Territory.

VICTORIA RIVER REGION: Keep River, c.30

km Eof Kununutra, 15°48’S, 129°04’E, 28

June 1985, P.A Fryxell, L.A.Craven &

J.McD.Stewart 4863 (holo: DNA; 1so:

CANB, MEL).

Perennial shrub to 2.5 m high, much branched;

branches ascending. Indumentum on branchlets,

petioles, peduncles, pedicels, stipules and bracts

dense; hairs stellate, c. | mm diameter, with

pliable, erectto spreading rays. Leaves discolorous,

entire or shallowly 3-lobed, ovate to broadly

ovate, 6.0-9.0 cm long, 5.59.0 cm wide; base

cordate; apex acute; margin irregularly serrate;

indumentum adaxially moderately dense, abaxially

dense: hairs stellate, 1.0-2.0 mm diameter, with

stiff to pliable, erect to spreading rays. Pettoles

10-15 mm long. Stipules linear, 7—10 mm long.

Flowers 2 or 3, in leaf-opposed cymules; cymules

1 or 2 per node; peduncles 5—10mm long; pedicels

c.5 mm long; bracts filiform, 4—6 mm long. Sepals

linear-lanceolate, 12.0-15.0 mm long, 2.0-3.0

mm wide; indumentum on abaxial surface dense,

with soft, slender, stellate hairs up to 2.0 mm

diameter, on adaxial surface densely stellate-

puberulous near base; appendages subapical,

divided at base into 2 lobes; lobe 1 erect, subulate,

| .5—2.5 mm long; lobe 2 reflexed, obtriangular, c.

5 mm long, laciniate, with indumentum as for

abaxial surface of sepal. Petals orbicular-obovate,

c.9mm long, c.9 mm wide; clawc.2 mm long,

pubescent. Androgynophore c. 0.5 mm long;

glands broadly obovate; annulus c. | mm long,

ciliolate on margin. Stamens 30 or more; filaments

559

8.0-9.0 mm long, pilosenear base; anthers oblong,

c. 0.5 mm long. Ovary subglobose, 1.0-2.0 mm

long, 3-locular, densely stellate puberulous; style

10.0-12,.0 mm long, glabrous; stigma 3-lobed.

Fruit broadly ovoid-globose, 6-7 mm diameter,

with a sparse to moderately dense covering of

sessile and stalked stellate hairs c. 0.5 mm diameter,

surface irregular, without prickles or bristles. Fig.

13A.

Specimens examined: Known only from type specimen.

Distribution and habitat: T. inermis is confined

to the north west of the Northern Territory in the

Keep River National Park (Map 19). It has been

recorded growing in light brown sand on dissected

sandstone hills.

Phenology: Flowers and fruit have been recorded

in June.

Notes: T. inermis is a very distinctive species

whose affinities are notimmediately obvious. The

fruitof T. inermis has amoderately dense covering

of stalked stellate hairs with stalks c. 0.5 mm long

but lacks the prickles or bristles found in all other

Australian Triumfetta species except T°. pustulata

which has bladder-like structures on its fruits. It 1s

similar in habit, leaves and general appearance to

7. viridis but can be distinguishd by having

subapical sepal appendages divided into two

distinct lobes, one of which is erect and the other

is reflexed, rather than irregularly lacerate or

lobed and totally reflexed, large orbicular-obovate

rather than small, obovate or absent petals, and

lacking prickles on the fruit.

Etymology: The specific epithet refers to the lack

of prickles or bristles on the fruit; Latin inermis,

unarmed, without spines, prickles or stings.

55. Triumfetta oenpelliensis Halford, sp. nov.

affinis 7. denticulatae a qua floribus

amplioribus sepalis 8-10 mm longis (non

6~8 mm longis) petalis 4-6 mm longis (non

2—4 mm longis), fructus amplioribus 8-10

mm diam. (non4~-/ mm diam.) appendicibus

sepalinis amplioribus 1.5—2.5 mm longis

(nonc. 0.5 mm longis) indumento in caulibus

foliisque crassiore differt. T'ypus: Northern

‘Territory, DARWIN AND GULF REGION: 1O km

S of Oenpelli, 12°23’S, 133°10°E, 24 May

1988, AA. Munir 5821 (holo: DNA; iso:

AD, BRD.

560

Perennial shrub to 1.5 mhigh; branches ascending

to erect. Indumentum on branchlets, petioles,

peduncles, pedicels, stipules and bracts moderately

densetodense; hairs stellate, 1.0—2.0 mm diameter,

with stiff to pliable, spreading rays. Leaves

discolorous, entire, ovate, 2.5—9.0cm long, |.5—5.0

cm wide; base truncate or slightly cordate; apex

acute; margin serrulate; indumentum adaxially

sparse to moderately dense, abaxially dense; hairs

stellate, of two sizeclasses; class 1 hairs sometimes

absent adaxially, up to 0.5 mm diameter, with

flaccid, spreading rays; class 2 hairs particularly

on veins, 0.5—1.0 mm diameter, with stiff, spreading

rays. Petioles 5-12 mm long. Stipules linear-

lanceolate, 3-4 mm long. Flowers 3—5, in leaf-

opposed or lateral cymules; cymules 2-4 per

node; peduncles 2-4 mm long; pedicels 1—2 mm

long; bracts filiform, 1-3 mm long. Sepals linear-

ovate, 8.0-10.0 mm long, c. 2 mm wide;

indumentum on abaxial surface dense, with coarse,

stellate hairs up to 1.0 mm diameter, on adaxial

surface densely stellate-villous on proximal fifth;

appendages subapical, reflexed, ovate or broadly

obovate, 1.5—2.5 mm long, regularly lobed, with

scattered stellate hams up to 0.5 mm diameter.

Petals obovate-orbicular, 4.0-6.0 mm long, c. 3

mm wide; claw c. 1.5 mm long, tomentose.

Androgynophorec. 0.5 mm long; glands orbicular;

annulus 0.5—1.0 mm long, ciltolate on margin.

Stamens 30 or more; filaments 5.0—7.0 mm long,

pilose near base; anthers oblong, c. 0.5 mm long.

Ovary globose, c. 1 mm diameter, 3- or 4-locular,

setose; style 8.0-10.0mm long, stellate-pubescent

at base; stigma 3- or 4-lobed. Fruit depressed

globose, 8-10 mm diameter, c. 6 mm long, body

black, sparsely covered with slender steilate hairs

c. 0.2 mm diameter, sparsely aculeate; prickles

subterete, tapering towards apex, 0.5-1.0 mm

long, erect, glabrous or with scattered minute

simple hairs, terminated by a single hooked setac.

0.1 mm long. Fig. I3B.

Additional specimens examined: Northern Territory.

DARWIN AND GULF REGION: Headwaters of the Liverpool

River, Apr 1984, Craven & Wightman 3848 (BRI).

Distribution and habitat: T. oenpelliensis occurs

near Oenpelli, Northern Territory(Map 18), Ithas

been recorded srowing on rocky sandstone scree

slopes.

Phenology: Flowers have been recorded in

February and May, fruits in May.

Austrobaileya 4(4): 495-587 (1997)

Notes: T. oenpelliensts ts related to T. denticulata

from which it differs by having larger flowers

(sepals 8-10 mm long and petals 4-6 mm long

compared to sepals 6-8 mm long and petals 2-4

mm long), larger fruits (8-10 mm diameter

compared to 4-7 mm diameter), longer sepal

appendages (1.5—2.5 mm long compared toc. 0.5

mm long), and a coarser indumentum on the stem

and leaves.

Etymology: The specific epithet is derived from

the name of the township of Oenpelli near where

the species occurs.

56. Triumfetta denticulata R. Br. ex Benth., FI.

Austral. 1: 274 (1863) Type: [Northern

Territory. DARWIN AND GULF REGION:|

Carpentaria, Groote Eylandt, [January

1803], Rk. Brown Clecto, designated here: K;

isolecto(?): BM n.v. (photo BRD, BRI, K,

MEL, NSW).

Perennial shrub to 1.5 m high; branches erect to

ascending. Indumentum on branchlets, petioles,

peduncles, pedicels, stipules and bracts moderately

dense, rough; hairs stellate, 1.0-1.5 mm diameter,

with tuberculate base, and with stiff, spreading

rays. Leaves discolorous, entire, narrowly ovate

to ovate, 3.0-10.0cm long, 1.5—4.0cm wide; base

truncate or rounded; apex acufe; margin serrulate-

dentate; indumentum adaxially moderately dense,

abaxially dense to very dense; hairs stellate, 0.5—1.0

mm diameter, with pliable to stiif, erect to spreading

rays 0.5—1.0 mm long. Petioles 5-17 mm long.

Stipules narrowly triangular, 2-4 mm long. Flowers

3—5, in leaf-opposed or lateral cymules; cymules

| or 2 per node; peduncles 0.5-5 mm long;

pedicels 2-3 mm long; bracts subulate, c. 1 mm

long. Sepals linear-ovate, 6.0-8.0 mm long,

1.0-2.0mm wide; indumentum on abaxial surface

dense, with coarse, stellate hairs up to 0.5 mm

diameter, on adaxial surface densely stellate-

puberulous on proximal third; appendages

subapical, erect or spreading, ovate or depressed

obovate, up to 0.5 mm long, entire or sometimes

irregularly lobed, with scattered stellate hairs up

to 0.5 mm diameter. Petals obovate, 2.0-4.0 mm

long, 1.0-2.5 mm wide; claw 1.0-1.5 mm long,

tomentose. Androgynophore c. 0.3 mm long;

glands oblate; annulus c. 0.3 mm long, ciltolate on

margin, Stamens 30 or more; filaments 3.04.0

mm long, glabrous or sparsely pilose near base;

Haiford, Australian Tiliaceae, 3

anthers oblong, c. 0.5 mm long, Ovary globose, c.

1 mm diameter, 2—-4-locular, setulose; style c. 5

mm long, glabrous; stigma 2- or 4-lobed. Fruit

depressed globose, 1.5—7 mm diameter, 2-4 mm

long, glabrous or with asparse covering of slender

stellate hairs c. 0.1 mm diameter, sparsely aculeate;

prickles subterete, tapering towards apex, c. 0.5

mm long, erect, mostly glabrous, terminated by a

single hooked seta c. 0.1 mm long. Fig, 13C.

Additional specimens examined: Northern Territory.

DARWIN AND GutF REGION: Baroalba Springs (Kubarra),

Kakadu N.P., Apr 1992, Halford Q1133 (BRI); Mt Sauders,

Nhulunbuy, Jun 1985, Cleminson 75 (DNA); South Bay,

Bickerton Island, Gulf of Carpentaria, Jun 1948, Specht619

(AD, BRI, MEL); Mirrijija, Groote Eylandt, Apr 1977,

Waddy 657 (DNA); Groote Eylandt, 8 km SW of

Umbakumba, Jul 1987, Russell-Smith2775 & Lucas(DNA);

Winchelsea Island, May 1993, Egan 2450(BRI); 4 kin W of

Koolendong Valley, May 1994, Cowie 4965 & Albrecht

(BRI).

Distribution and habitat: T. denticulata occurs in

the Northern Territory from Koolendong Valley,

east through Arnhem Land, to the Islands of the

Gulf of the Carpentaria (Map 17). It grows in

open sclerophyl! forests or Allosyncarpta forests,

on sandy soils, usually amongst sandstone boulders

on sandstone screes, deeply dissected sandstone

outcrops and on stream margins.

Phenology: Flowers have been recorded tn April

and June, fruits in March, April, June and July.

Notes; There are a number of syntypes that are

available for the selection ofalectotype. The sheet

at Kew labelled: “Triumfetta ? No.29 desc,

Carpentaria Groote Eylandt [illegible letters]” is

chosen as lectotype as it 1s part of the original

material, has flowers and fruit attached and agrees

with Benthem’s protologue. There are a number

of possible duplicates of this material collected by

R.Brown at a number of institutions (BM, BRI,

MEL, NSW and K) which have varying label

details. As there ts no way of ascertaining now

whether these specimens are indeed from the one

collection, 1t is not possible to say with any

certainty whether they are isolectotypes.

7. denticulata is characterised by its small,

dark, almost glabrous fruit, the minute uncinate

prickles on these fruits, and the small erect or

spreading, ovate or broadly obovate sepal

appendages.

561

57, Triumfetta aquila Halford sp. nov. specimina

7. aquilae olmrelatasuntad T. denticulatam

a qua species arte cognata autem a T.

denticulata sepalis amplioribus 9-11 mm

longis (non 6-8 mm longis) petalis multum

redactis vel absentibus, fructus comparate

amplioribus 6-8 mm diam. (non 4~7 mm

diam.) differt. Typus: Western Australia.

GARDNER District: site 4 (Brunswick), 19

km NE [of] Kunmunya Hill, 15°19’40"S,

124°49’25"E, 12 June 1987, K.F. Kenneally

10370 & B.P.M. Hyland (holo: PERTH;

iso: BRI, DNA, CANB, QRS n.v.).

[V. denticulata auct. non R. Br. ex Benth.: Rye

(1992: 171)]. |

Perennial shrub to 1(-2) m high, much branched;

branches ascending. Indumentum on branchlets,

petioles, peduncles, pedicels, stipules and bracts

dense; hairs stellate, of two size classes; class 1

hairs c. 0.5 mm diameter, with pliable to stiff,

appressed or spreading rays; class 2 hairs

sometimes absent, 1.0-1.5 mm diameter,

sometimes with tuberculate base, and with stiff,

spreading rays. Leaves discolorous, entire orrarely

shallowly 3-lobed, ovate, 7.0-10.0 cm long,

5.0-7.0 cm wide; base cordate; apex acute or

obtuse; margin irregularly serrulate; indumentum

adaxially and abaxially sparse to very dense; hairs

stellate, of two size classes; class | hairs c. 0.3 mm

diameter, with flaccid to pliable, appressed to

spreading rays; class 2 hairs particularly on veins,

O.5—1.5 mm diameter, with stiff, spreading rays.

Petioles 10-30 mm long. Stipules linear, 1-3 mm

long. Flowers 3-7, in leaf-opposed or lateral

umbellate or paniculatecymules; cymules 24 per

node; usually forming interrupted paniculate

inflorescences by reduction of subtending leaves;

peduncles 7-30 mm long, pedicels 2—3 mm long;

bracts ovate or linear, 1~2 mm long. Sepals linear,

9,0-11.0mmlong, |.5—2.0mm wide; indumentum

on abaxial surface dense, with coarse, stellate

hairs up to 0.5 mm diameter, on adaxial surface

densely stellate-pubescent on proximal third;

appendages subapical, spreading, broadly to very

broadly ovate, c. 0.5 mm long, entire or

occasionally lobed, with scattered stellate hairs up

to 0.5 mm diameter. Petals absent or with lamina

much reduced; lamina linear, c. 1 mm long, c. 0.4

mm wide; claw 1.0-1.5 mm long, pubescent.

Androgynophore short; glands depressed obovate;

annulusc.0.5 mm long, ciliate on margin. Stamens

562

30 or more; filaments 7.0-12.0 mm long, pilose

near base; anthers oblong, c. 0.5 mm long. Ovary

globose, c. 1 mm diameter, 2—4-locular, setulose,

stylec.8 mmlong, pubescent at base; stigma 2—4-

lobed. Fruit depressed globose to globose, 6-8

mm diameter, 5~7 mm long, body black, rugose,

glabrous or with a few scattered slender stellate

hairsc.0.2mm diameter, sparsely aculeate; prickles

subterete, tapering towards the apex, c. 0.5 mm

long, erect, glabrous, terminated by asingle hooked

seta c. 0.2 mm long. Fig. 13D.

Selected specimens: Western Australia, GARDNER DISTRICT:

AugustusIsland,B onaparte Archipelago, May 1972, Wilson

10762(PERTH); ditto, May 1972, Wilson 10871 (PERTH);

Fern Gully, Gariyeli Creek, Prince Regent River Reserve,

Aug 1974, George 12836 (PERTH); on creek approx. 1 km

above campsite on unnamed tributary of Prince Regent

River, 19 km SE of mouth, Jun 1984, Kenneally 8902

(PERTH); site 3, 4 km W of King Cascade, Jun 1987,

Kenneally 10552 & Hyland (PERTH); TalbotCreek, tabutary

of Barker River, 3 km SE of Mt Hart Homestead, Jun 1987,

Edinger 409 (BRI, PERTH). Northern Territory. Darwin

AND GULF REGION: Melville Island, Soldier Point, Jun 1987,

Clark 1099 (DNA).

Distribution and habitat: T. aquila is known

from the Bonaparte Archipelago, Prince Regent

River district and the King Leopold Ranges in the

western Kimberley region of Western Australia,

and from Melville Island, Northern Territory

(Map 15). It has been recorded growing in damp

black loam over sandstone in a thicket in open

woodland, amongst loose sandstone boulders and

sravel adjacent to a river, on the edge of a vine

thicket, in open woodland with Triodia sp. on

sandstone, and on a lateritic coastal headland.

Phenology; Flowers have been recorded in

February, May and June, fruits in May, June and

August.

Notes: Specimens of T. aquila have previously

been referred to 7. denticulata with which it is

closely related. 7. aquila is distinguished from

T. denticulata by having larger sepals O-11 mm

long compared to 6-8 mm long), petals which are

much reduced or absent and relatively larger fruit

(6-8 mm diameter compared to 4~7 mm long).

Etymology: The specific epithet refers to the dark

colour of the fruit; Latin aguilus, dark coloured,

blackish.

Austrobaileya 4(4): 495-587 (1997)

58. Triumfetta longipedunculata Halford, sp.

nov, atte affinis 7. cladarae, T. bradshawit,

T. pustulatae. Pro maxima parte T.

longipedunculata simulat T. cladaram a

qua aculeis pilis simplicibus stellaribusque

usque I mm Jongis dense obtectis differt; a

T. bradshawii fructibus parvioribus 12-14

mm longis (non 18-25 mm longis), aculeis

parvioribus 2—3 mm longis (non 4-5 mm

longis) floribus parvioribus sepalis 8—15

mm longis, petalis 1-3 mm longis vel

absentibus, filamentis staminum 6—12 mm

longis praeditis (non floribus sepalis 20—25

mm longis, petalis4—5 mm longis, filamentis

12-16 mm longis praeditis) differt; a

T. pustulata fructibus aculeis non fabricis

vesicariis ut in 7. pustulata ornatis

distinguitur. Typus: Western Australia.

FITZGERALD District: Manning Gorge, near

MtBarnett Homestead, near mouth of gorge,

16°39’S, 125°56’E, 6 May 1983, P.A. Fryxell

& L.A.Craven 3972 (holo: PERTH; 1so:

BRI, CANB, DNA, MEL).

Triumfetta sp. P, Rye (1992: 180).

Perennial shrub to 3 m high; branches reddish

brown, spreading, ascending orerect. Indumentum

on branchlets, petioles, peduncles, pedicels,

stipules and bracts sparse to dense, of simple and

stellate hairs; simple hairs 3.04.0 mm long, erect,

with tuberculate base; stellate hairs of two size

classes; class I hairs c. 0.2 mm diameter, with

pliable, spreading rays; class 2 hairs 1.0—2.0 mm

diameter, with tuberculate base, and with pliable,

erect rays 3.0-4.0 mm long. Leaves discolorous,

entire or shallowly 3-lobed, narrowly ovate to

ovate, 7.0-12.0 cm long, 3.0-6.0 cm wide; base

obtuse or cordate; apex acuteto acuminate; margin

regularly serrate; indumentum adaxially sparse

to dense, abaxially dense to very dense; hairs

stellate, of two size classes; class 1 hairs 0.5--1.0

mm diameter, with flaccid to pliable, spreading

rays; class 2 hairs particularly on veins, 2.0—4.0

mm diameter, with stiff, spreading to erect rays.

Petioles 12-30 mm long. Stipules linear-subulate,

8—15 mm long. Flowers 2—4, in leaf-opposed or

lateral cymules;cymules 1 or2 pernode;, peduncles

1.5—5 cm long; pedicels 2—5 mm long; bracts

linear-subulate, 5-10 mm long. Sepals linear,

8.0-15.0mm long, 2.0-2.5 mm wide; indumentum

on abaxial surface dense, with stellate hairs of two

size classes; class | hairs as for branchlet; class 2

Fae eI Rett tered Gran en ean Pree ne Pa Pee ee Cer a ee cee eCeee Te atcha tt anee

Halford, Australian Tiliaceae, 3

hairs 2.0-3.0 mm diameter, on stalks upto 1.0mm

long; indumentum on adaxial surface densely

stellate-pubescent near base; appendages

subapical, spreading or slightly recurved, broadly

obovate, 3.0-5.0 mm long, deeply lacerate, with

indumentum as for abaxial surface of sepal. Petals

absent or with lamina much reduced; lamina

linear, 1.0-3.0 mm long, c. 5 mm wide; claw

1.0-2.0 mm long, tomentose. Androgynophorec.

0.2 mm long; glands obdeltate; annulus c. 1 mm

long, ciliate on margin. Stamens c. 60; filaments

6.0-12.0 mm long, pilose near base; anthers

oblong, c. 0.6 mm long. Ovary globose, c. | mm

diameter, 3-locular, setose; style 6.0-12.0 mm

long, glabrous or stellate-pubescentat base; stigma

3-lobed. Fruit ovoid to broadly ovoid, 12-14 mm

long, 10-13 mm diameter, glabrous, densely

aculeate; prickles subterete, tapering towards the

apex, 2-3 mm long, erect, brittle, with amoderately

dense covering of simple and stellate hairs up to 1

mm long, terminated by single hooked seta c. 0.4

mm long. Fig. 12K.

Additional specimens examined: Western Australia,

GARDNER District: Planigale Creek, Drysdale River N.P.,

Aug 1975, Kenneally 4508 (PERTH); ditto, Kenneally

4215 (PERTH); Nymphaea Creek, Drysdale River N.P.,

Aug 1975, Kenneally 4274 (PERTH); near junction of

Drysdale River & Mogurnda Creek, Drysdale River N.P.,

Aug 1975, George 13501 (PERTH); Cambridge Gulf,

1887, Wright [MEL 1599258]. (MEL); 18 km S along King

River Road from Great Northern Highway, 15 km S of

Wyndham, May 1992, Halford Q1395 (BRI, DNA, K, L,

MEL, PERTH); The Grotto, 2 km W of Great Northern

Highway, +30kmSSEof Wyndham, Jun 1976, Beauglehole

ACB54073 (PERTH); banks of the Ord River, Apr 1975,

Mc Landish [PERTH 1540688] (PERTH); Spillway Creek

area, outflow of Lake Argyle, Jul 1974, Carr 3107 &

Beauglehole 46869 (PERTH). Northern Territory, DARWIN

AND GULF Recion: 26 km N Hodgson Downs Homestead,

Feb 1989, Thomson 3257 (BRI, DNA n.v., NT n.v.); 13

miles [21 km] W of Borroloola, Jun 1971, Henry 048 (AD,

BRI, DNA, PERTH).

Distribution and habitat: T. longipedunculata

occurs in the Kimberley of Western Australia,

from Barnett Range to the Carr Boyd Range, and

in the Northern Territory from the Daly Waters-

Borroloola district Map 9). Itgrowsinsclerophyll

woodlands on shallow sandy soils over sandstone

along stream margins and on sandstone scree

slopes.

Phenology: Flowers have been recorded in

February, May and June, fruits from April to

August.

563

Notes: T. longipedunculata is closely related to

T. bradshawii, T. pustulata and T. cladara. T.

longipedunculataclosely resembles T. cladarain

most respects but can be distinguished by having

a dense covering of simple and stellate hairs up to

| mm long on the prickles on its fruit. From

T. bradshawii it may be distinguished by having

smaller fruits (12—14 mm long compared to 18-25

mm long), prickles rather than bristles on its fruit

(2-3 mm long compared to 4-6 mm long), and

smaller flowers (sepals 8-15 mm long, petals I-3

mm long or absent and staminal filaments 6-12

mm long compared to sepals 20-25 mm long,

petals 4—5 mm long and staminal filaments 12-16

mm long). From T. pustulata it may be

distinguished by having prickles rather than

pustule-like appendages on the fruit.

Etymology: Thespecific epithetrefers torelatively

long peduncles observed in this species; Latin

longi-, long and pedunculatus, provided with a

peduncle.

59, Triumfetta cladara Halford sp. nov. habitu

folis morphologia florum T.

longipedunculatam, T. bradshawit, T.

pustulatam simulat. T. longipedunculatae

artissime affinis autem ab ea aculeis glabris

differt. A 7. bradshawii fractibus parvioribus

14—20 mm longis (non 18-25 mm longis),

aculeis glabris parvioribus 1.5-—2.5 mm

longis (non 4—5 mm longis) floribus

parvioribus sepalis | 1-15 mm longis petalis

2—4 mm longis filamentis staminalibus c, 10

mm longis praeditis (non floribus sepalis

20-25 mm longis petalis 4-5 mm longis

filamentis 12-16 mm longis praeditis)

distinguitur. A 7. pustulata fructibus aculeis

non fabricis vesicariis ornatis distinguitur.

Typus: Western Australia. GARDNER

District: King Edward River, 14°54’S,

126°12’E, | March 1980, C_LR. Dunlop5377

(holo: PERTH; 1so: BRI, CANB, DNA,

MEL).

Triumfetta sp. O, Rye (1992: 180), in part.

Perennial shrub to 1.5 m high; branches dark red,

Spreading, ascending or erect. Indumentum on

branchlets, petioles, peduncles, pedicels, stipules

and bracts sparse to moderately dense, of simple

and stellate hairs; simple hairs 2.0-4.0 mm long,

erect, with tuberculate base; stellate hairs of two

564

size classes; class | hairsc. 0.2 mm diameter, with

pliable, spreading rays; class 2 hairs 3.04.0 mm

diameter, with tuberculate base, and with pliable,

erect rays 2.0-4.0 mm long. Leaves discolorous,

entire or sometimes shallowly 3-lobed; lamina

ovate to broadly ovate, 6.0-12.0 cm long,

4.0-8.0 cm wide; base cordate; apex acute to

acuminate; margin irregularly serrate; indumentum

adaxially moderately dense, abaxtally dense; hairs

stellate, of two size classes; class 1 hatrsc. 0.2 mm

diameter, with pliable, spreading rays; class 2

hairs 1.0-4.0 mm diameter, with stiff, spreading

rays. Petioles 20-50(-60) mm long. Stipules

subulate, 6~-10 mm long. Flowers 2 or 3, 1n leaf-

opposed or lateral cymules; cymules | or 2 per

node; peduncles 20-50 mm long; pedicels 5-10

mm long; bracts subulate, 3-9 mm long. Sepals

linear, 11.0-15.0 mm long, 1.0-2.0 mm wide;

indumentum on abaxial surface dense, with stellate

hairs of two size classes; class 1 hairs as for

branchlet; class 2 hairs 2.0—3.0 mm diameter, on

stalks up to | mm long; indumentum on adaxial

surface densely stellate-pubescent near base;

appendages subapical, spreading, broadly obovate,

2.0-5.0 mm long, divided distally, with

indumentum as for abaxial surface of sepal. Petals

with lamina much reduced, linear, 2.0-4.0 mm

long,c.0.4mm wide; clawc.2mmlong, tomentose.

Androgynophore c. 0.5 mm long; glands broadly

ovate; annulus 1.0—1.5 mm long, ciliate on margin.

Stamens 30 or more; filaments c. 10 mm long,

nodose, pilose near base; anthers oblong, c. 0.6

mm long. Ovary globose, c. | mm diameter, 3- or

4-locular, setose; style 1O-15 mm long; strigose at

base; stigma 3- or 4-lobed. Fruit ovoid to broadly

ovoid, 14-20 mm long; 10-20 mm diameter (not

including prickles), glabrous, densely aculeate;

prickles subterete, tapering towards the apex,

1.5-2.5 mm long, erect, brittle, glabrous,

terminated by single hooked seta c. 0.2 mm long.

Fig. 12F.

Additional specimens examined: Western Australia.

GARDNER District: Kalumburu Mission, May 1971,

Maconochie 1250 (DNA); Woppinbie Creek, 4 km east of

Cone Mountain, c. 4 km south-west from mouth, in Napier

Broome Bay, May [984, Forbes 2145 (CANB, MEL,

PERTH); 3.6 km by road north of Kalumburu on road to

Pago Mission, May 1985, Aplin et al. 868 (PERTH); 7 km

W of Mitchell Plateau turnoff from Gibb River - Mitchell

road, May 1981, Tracey 13919 (BRI); 10 km W of Gibb

River - Kalumburu road on track to Mitchell Plateau, King

Edward River crossing, May 1992, Halford Q1418 (BRI,

CANB, DNA, MEL, K, PERTH).

Austrobaileya 4(4): 495-587 (1997)

Distribution and habitat: T, cladarais restricted

to the Kimberley of Western Australia, from King

Edward River to near Kalumburu (Map 18). It

grows In open eucalypt woodlands on shallow

sandy soils in dissected sandstone country or on

sandstone pavements near watercourses.

Phenology: Flowers have been recorded in

December and March, fruits in March and May.

Notes: T. cladara resembles T. bradshawit,

T. longipedunculata and T. pustulata in habit,

leaves and flower morphology. It is most closely

related to 7. longipedunculata trom which it

differs in having glabrous prickles. From

T. bradshawii it may be distinguished by the

smaller fruits (14—20mm long compared to 18~25

mm long), glabrous prickles rather than hairy

bristles on its fruit, and smaller flowers (sepais

11-15 mm long, petals 2-4 mm long and staminal

filaments c. 10 mm long compared to sepals

20-25 mm long, petals 4-5 mm long and staminal

filaments 12—16 mm long). From T. pustiulata it

may be distinguished by having prickles rather

than bladder-like appendages on the fruit.

Etymology: The specific epithet refers to the

prickles on the fruit which are slender and brittle

and easily broken; Greek kladaros, frail, easily

broken.

60. Triumfetta bradshawii F. Muell., Proc. Linn.

Soc. N.S.W. Ser. 1 6: 460-461 (18972)

Type: [Western Australia. GARDNER

Disrrict:] Prince’s Regent River, in 1891,

J. Bradshaw & W.T.Allen [MEL 223681}

(lecto, designated here: MEL; isolecto: MEL

[MEL 223680], K n.v. (photo BRD).

Perennial shrub to 2 m high, much branched;

branches dark red, ascending toerect. Indumentum

on branchlets, petioles, peduncles, pedicels,

stipules and bracts sparse to dense, of simple and

stellate hairs; simple hairs 3.0-5.0 mm long, erect,

with tuberculate base; stellate hairs of two size

classes; class 1 hairs sometimes absent, c. 0.2 mm

diameter, with flaccid to stiff, appressed rays;

class 2 hams 1.0-3.0 diameter, with tuberculate

base, and with pliable, erect rays 3.0-5.0 mm

long. Leaves discolorous, entire, ovate, 6.0-12.0

cm long, 3.0-8.0 cm wide; base cordate; apex

acute to acuminate; margin regularly serrate;

indumentum adaxtally and abaxially dense to

Halford, Australian Tiliaceae, 3

very dense; hairs stellate, of two size classes; class

1 hairs 0.5-1.0 mm diameter, with flaccid to

pliable, spreading rays; class 2 hairs particularly

on veins, 2.0-4.0 mm diameter, with pliable,

spreading to erect rays 2.0-4.0 mm long. Petioles

10-30 mm long. Stipules linear-subulate, 10-20

mm long. Flowers 1~3, in leaf-opposed cymules;

cymules solitary at nodes; peduncles 5—17 mm

long; pedicels 5-10 mm long; bracts linear-

subulate, 10-20 mm long. Sepals persistent in

fruit, linear, 20.0-25.0 mm long, 2.0-3.0 mm

wide; indumentum on abaxial surface dense, with

stellate haus of two sizeclasses; class | hairs as for

branchlet; class 2 hairs 2.0~3.0 mm diameter, on

stalks up to 1.5 mm long; indumentum on adaxial

surface densely stellate-tomentose near base;

appendages subapical, spreading, broadly obovate,

6.0—8.0 mm long, lacerate distally, with

indumentum as for abaxial surface of sepal. Petals

with lamina much reduced, linear, 4.0-5.0 mm

long, 0.5—-1.0 mm wide; claw 2.0-3.0 mm long,

pubescent. Androgynophore c. 1.5 mm long;

glands orbicular; annulus c. 1.5 mm long, ciliate

on margin. Stamens 30 or more; filaments

12.0-16.0 mm long, pilose near base; anthers

oblong, c. 0.7 mm long. Ovary globose, c. 3 mm

diameter, 5-locular, hispid; style and stigma not

seen. Fruit broadly ovoid to globose, 18-25 mm

long, 15-22 mm diameter (notincluding bristles),

glabrous, densely aculeate; bristles filiform,

4.0-6.0 mm long, brittle, flexuous, with a dense

covering of simple and stellate hairs !.0-2.0 mm

long, terminated by a single slightly curved seta

1.0-2.0 mm long. Fig. 12C.

Additional speciinens examined:. Western Australia.

GARDNER District: Prince Regent River Reserve, Aug 1974,

Kenneally 2032 (CANB); permanent creek joining Prince

Regent River estuary justabove tidal limit, Jul 1990, Willing

206 (PERTH); 25.3 km WSW of Mt Blythe on Charnley

River, Feb 1989, Kenneally 10926 & Hyland (BRI, DNA,

PERTH); Barnett Gorge, + 250 km SW of Wyndham, Jun

1976, Beauglehole ACB52445 (PERTH),

Distribution and habitat: T. bradshawii 1s

restricted to the Kimberley of Western Australia,

from the Prince Regent Rivertonear the Cambridge

Gulf (Map 20). It grows in hummock grasslands

on sandy alluvium along watercourses in rugged

sandstone country.

Phenology: Flowering period unknown, fruits have

been recorded between January and August.

Notes: Mueller cited two collecttons (‘near

Cambridge Gulf, 1887, Keiller’ [MEL 223682]

565

and “Prince’s Regent River, 1891, /. Bradshaw &

W.T. Allen’ [MEL 223681]) in his protologue of

7. bradshawtt. MEL 223681 is here selected as

lectotype of this name because it is the best

preserved of the type material available and

matches the description in the protologue.

61. Triumfetta pustulata Halford, sp. nov. arte

affinis 7. cladarae, T. bradshawit,

T. longipedunculatae autem ab eis fabricis

vesicariis (non aculeis) fructus tegentibus

distinguitur. I'ypus: Western Australia.

GARDNER District: Hunter River, 14°59’S,

[25°29°R, 3 June 1992, K.F. Kenneally

11203 (holo: PERTH; iso: PERTH).

Triumfetta sp. O, Rye (1992: 180), in part.

Perennial shrub to 2 m high. Indumentum on

branchlets, petioles, peduncles, pedicels, stipules

and bracts sparse to dense, of simple and stellate

hairs; simple hairs 3.0-5.0 mm long, erect, with

tuberculate base; stellate hairs of two size classes;

Class 1 hairs 0.2-0.3 mm diameter, with pliable,

spreading rays; class 2 hairs 3.0-4.0 mm diameter,

with tuberculate base, and with pliable, erect rays

3,0-5.0 mm long. Leaves entire or shallowly

3-(5-)lobed; lobes triangular; lamina ovate,

90-27. Ocm long, 5.0-15.0cm wide; base cordate;

apex acute; margin irregularly serrulate;

indumentum adaxially and abaxially dense; hairs

Stellate, of two size classes: class 1 hairsc.0.5 mm

diameter, with flaccid to pliable, spreading rays;

Class 2 hairs particularly on veins 1.0-3.0 mm

diameter, with pliable to stiff, spreading rays.

Petioles 25-80 mm long. Stipules linear-subulate,

6-15 mm long. Flowers 3-6, in leaf-opposed

cymules; cymules | or2 per node; peduncles 1-10

mim long; pedicels 5—10 mm long; bracts linear to

narrowly ovate, 8-10 mm long. Sepals linear,

20-25 mm long, 1.5—3.0 mm wide; indumentum

on abaxial surface dense, with stellate hairs of two

size classes; class | hairs 0.2—1.0 mm diameter,

with coarse, spreading rays; class 2 hairs 2.0-5.0

mm diameter, on stalks up to 0.2 mm long;

indumentum on adaxial surface densely stellate-

villous near base; appendages subapical, spreading,

ovate or broadly obovate, 2,0-5.0 mm long, entire

or irregularly divided, with indumentum similar

to abaxial surface of sepal but not as dense. Petals

with lamina much reduced, linear, 1.0-3.0 mm

long, c. 0.5 mm wide; claw 2.0-3.0 mm long;

tomentose. Androgynophore c. 0.5 mm long;

566

glands transversely elliptic; annulusc. | mmlong,

ciliate on margin. Stamens 30 or more; filaments

12,.0-17.0 mm long, pilose near base; anthers

oblong, c. 0.6 mm long. Ovary ovoid, c. | mm

diameter, 3- or 4-locular, papillose; style20.0—23.0

mm long, hirsute at base; stigma 3- or 4-lobed.

Fruit oblong or broadly ovate in outline, sometimes

with a distinct constriction in the middle, trigonous

or tetragonous in sectional view, 8—10 mm long,

9-10 mm diameter, glabrous, covered with

bladder-like bodies 1—1.5 mm diameter, with a

single minute seta at apex. Fig. 11B.

Additional specimen examined: Western Australia.

GARDNER District: E of the Mitchell River near the river

mouth, Jun 1985, Fryxell, Craven & McD.Stewart 4724

(CANB, MEL, PERTH).

Distribution and habitat: T. pustulatais restricted

to the Kimberley of Western Australia, near the

mouths of the Mitchell and Hunter Rivers (Map

20), [thas been recorded growing ina Eucalyptus

tetradonta-E. miniata woodland in sandy soils

amongst boulders on a sandstone outcrop and in

alluvial sand beside a watercourse.

Phenology: Flowers and fruits have been recorded

in June.

Notes: T. pustulata 1s closely related to

T. bradshawit, T. longipedunculataand T. cladara

but can be distinguished from them by the pustule-

like structures covering the fruit.

Etymology: The specific epithet refers to the

pustule-like covering on the fruit; Latin pustulatus,

having pustules.

Acknowledgements

I am grateful to the Directors/Curators of the

following herbaria for the loan of herbartum

material including types and photographs used in

this study - AD, BM, BRI, CANB, CBG, DNA, K,

MEL, NSW, PERTH and PR, Mr W.Smith and

Ms M.Saul for the tlustrations, Mr L.Pedley

for the Latin diagnoses, Mr. L.Jessup and

Dr G.Leach for assistance while they were

Australia Botanical Liaison Officers at K,

Ms Y.Smith for assistance in the preparation of

the maps. This work was supported by a grant

from the Australian Biological Resource Study,

Commonwealth Department of Arts, Sports, The

Environment, Tourism, and Territories in 1991,

1992 and 1994.

Austrobatleya 4(4): 495~—587 (1997)

References

BaiLtey, F.M. (1899). Contributions to the flora of

Queensland. Queensland Agricultural Journal S(A):

387-390,

BENTHAM, G. (1863). Tiliaceae. In Flora Australiensis.

Volume |: 267-282. London: L. Reeve & Co.

DE CANDOLLE, A.P. (1824). Prodromus systematis naturalis

regni vegetabilis. Volume |: 506-508. Paris: Treuttel

& Wiirtz.

Domin, K, (1927, ‘1926°). Tiliaceae. In Beitraige zur Flora

und Pflanzengeographie Australiens. Bibliotheca

Botanica 89: 374-382.

DuPuy, DJ. & Telford, L.R.H. (£993). Tiliaceae, Flora of

Australia, 50: 135-140.

FITZGERALD, W.V, (1918). The botany of the Kimberleys,

North-West Australia. Journal and Proceedings of

fhe Royal Society of Western Australia 3: 1-123.

HNATIUK, R.J. (1990). Census of Australian Vascular Plants.

Canberra: Australian Government Publishing

Service.

Lay, K.K. (1950). The American species of Triumfetta L.

Annals of the Missouri Botanical Garden. 37(3):

315-3985.

LINNAEUS, C. (1753). Species plantarum. Volume 1: 444,

1957 fascimile. London: Ray Society.

MABBERLEY, D.J. (1989). The plant book. Cambridge:

Cambridge University Press.

MUBLLER, F.(1 856). Observations on north Australian botany.

Hooker’s Journal of Botany and Kew Gardens

Miscellany. 8: 321-331.

—— (1859). Fragmenta Phytographiae Australiae 1: 69.

Melbourne: Victorian Government.

—~ (1862). Fragmenta Phytographiae Australiae 3: 7-8.

Melbourne: Victorian Government.

——(1879). Fragmenta Phytographiae Australiae 11:61-62.

Melbourne: Victorian Government.

——(1885). Description ofa new Triumfetta from Arnhem’ s

Land, The Australasian Chemist and Drugegist. 7:

78,

— (1892). Observations on plants collected during Mr

Joseph Bradshaw’s expedition to the Prince Regents

River. The Proceedings of the Linnean Society of

New South Wales. series 11, 6: 457-478.

ete ec eee ar en ee a EE ae a a A MAHAR AAA Danaea rte

Halford, Australian Tiliaceae, 3

NELDNER, V.J. & CLARKSON, J.R. (1995), Vegetation survey

and mapping of Cape York Peninsula, Cape York

Peninsula Land Use Strategy, Office of the Co-

ordinator General of Queensland, Brisbane,

Department of the Environment, Sport and Territories,

Canberra and Queesland Department of Environment

and Heritage, Brisbane,

Rye, B.L, (1992). Tiltaceae. In J.R. Wheeler et al., Flora of

the Kimberley Region, Perth: Department of

Conservation and Land Management.

— (1994), A contribution to the taxonomy of the Tiliaceae

of Western Australia, Nuytsia 9(3):; 415420.

SPRAGUE, T.A. & Hutcuinson, J.(1909a). The Triumfettas of

Africa. The Journal of the Linnean Society, Botany.

39; 231-276.

— (1909b). Decades Kewenses: LII-LIII. Bulletin of

Miscellaneous Information, 1909: 257-258.

567

568 Austrobaileya 4(4): 495-587 (1997)

bet >i

41)

wi” +

eo”

7 1%.

pel.

Ly .™

* wy

‘

aces 4

Ls |

flak

at:

* + Pog Te

en. ate

Tia eae tee be

a ’ he o coe

ay ir .

“TAR

Fe oad dee ate

sh 4“ af e

Fig.l, Triumfetta species. A. T. pilosa; A,. fruitx 1.5, A,. prickle x7. A,. sepal x 3, A,. sepal appendage x 7.B.T. procumbens:

B,. fruit x 1.5. B,. prickle x 7. B,. sepal x 3. B,. sepal appendage x 7. C. 7. triandra: C,. fruit x 10. C,. bristlex 14. C,, sepal

x 7. C,. sepal appendage x 14, C.. apical view of fruitx 7. D, T. repens: D,. fruit x 1.5. D,. prickle x 7. D,. sepal x 3. D,. sepal

appendage x 7. E. T. plumigera: E,. fruit x 1.5. E,. bristle x 7. E,. sepal x 3. E,. sepal appendage x 7. F. f. coronata: F,. fruit

x 10. F,, bristle x 14. F,. sepal x 7. F,. sepal appendage x 14. G, T. hapala: G., fruit x 1.5. G,. bristle x 7. G,. sepal x 3. G,.

sepal appendage x 5. A,» Byrnes & Clarkson 3840 (BRD; A, » Bean 3577 (BRD); B 38 Chaloupka 1 (BRD; B, p Brynes 3254

(BRD;C, ., Halford Q1429 (BRD; D, » Bean 2015 (BRD; Diy: Batianoff & McDonald 487 (BRD; E,_,, Halford Q991 (BRD;

Bas Fryxell & Craven 3919 (MEL); F, 4 Vernon 39 (PERTH); G,_,, Halford Q1472 (BRD.

AES eA he RSAC SEs I STP ie nc is pe ae eevee ed

ISSA A Sg oA EE,

27 PEs nen cae cits hae lector head

Halford, Australian Tiliaceae, 3

et Te

at at

44 ~

4 os fa és

eye ed

tah

4«

ages ™

fe Pak.

" il

Sora oy

“Se *“

= + oy, a a

re ees ae

., ae a

‘he ae f

acetal" he ‘ot “

oe tT TE

_—e

wee

ot itn

CAL : SE a

‘ > a . ‘T ve ae - Fe i" 7 i¥

Soy A ‘i PSN AER: :

PaaS te 7 ys +4 aan ry h at ti & oe "s

"+ my + sa at — | ahd iy ie 3 S L, = '

pate a yeh —_, oy yy ax F Be te a %

Sass hi! BEOSALS. aN ae ay

ZARSISETE RO LS BR ALI Oe GH

“ie if arate , r ieee d gare) + F : :

ae .

vat

if # |

! oe =f

ae | "

ae aN

if 1 1 ™—— on, fi

i ‘ = i * ao

. +t E3 a 'o

Vi os Yi

ea a/R

ta 4

Fig, 2. Triumfetta species. A. T. rhomboidea: A,. fruit x 7. A,. prickle x 14. A,. sepal x 7. A,. sepal appendage x 14. B. T.

pentandra: B,, fruit x 7. B,. prickle x 14. B,. sepal x 14. B,. sepal appendage x 28. C. T. reflexa: C,. fruit x 3. C,. prickle x

7, C,. sepal x 7. C,. sepal appendage x 7, D. T. aspera: D,. fruit x 1.5. D,, prickle x 14, D,. sepal x 3. D,. sepal appendage

x 3. E. 7. litticola: E,, fruit x 1.5. E,, prickle x 14. E,. sepal x 7. E,. sepal appendage x 7. F. 7. saccata: F.. fruit x 1.5. F,.

prickle x 14. F,. sepal x 3. F,. sepal appendage x 3, A,_,, Blake 23380 (BRI); B,_,, Halford Q963 (BRI); C,_,, Halford Q1419

(BRD; D_, Kenneally 9240 (PERTH); E, ,, Weber 1005 (AD); F_, Beauglehole 53465 (PERTH).

1-4"

1-4? 14? 1-4?

: a7 ‘i ale on! |

trot he byiemdntes shat? draie is reintes oa

495-587 (1997)

Austrobaileya 4(4)

bebe deg ten ier a achn eat pitied erg)

eS ae ee ee

va”

+* +

eet

‘a6 Fae,

ore ¥ +4 re

Se pe tee

tee?

- F

Boe #

570

>B,., Halford Q989

A, y Glennon 225 (PERTH)

B,. branchlets with flowers and fruit x 1. B,. fruit x 1.5. B,. prickle

HW:

A,. branchlet with flowers and fruit x 0.7. A,. fruit x 1.5. A,. prickles x 7.

culata

A,. sepal x 3. A,. sepal appendage x 3. B. T. johnston

_A.T. append

I€s

fetta spec

3. Trim

x7. B,. sepal x 3. B,. sepal appendage x 3. A, ,,, Royce 7165 (PERTH)

Fig

(BRD.

571

ay =

it ee ee em ee

ra oe 24 eee

*, * le al a ral

sk ‘a 4 ys

Tm x * a Hh,

St3r7 oh Pech aty

betes 1 * ‘ woah * ‘

EEE cy CR Nor QO

otis UN

Nic! n mT vA ake > 1

SILAS Site

Naber’ es tie oe Me Ana te a

rete mnie

a i *

bane

jay

Halford, Australian Tiliaceae, 3

ea ete ta tee

= en FT NES

sce ort "- {* SK yes SY J

+ / :

Scand

: C, 4: Royce 1943a (PERTH); Di»

Triumfetta species, A. T, winneckeana. A,. fruit x 1. A,. prickle x 7. A,. sepal x 3. A,. sepal appendage x 7. B. T,

Chinnock 3842 (AD), E, ,, Ashby 2949 (MEL); Eyl elford 6627 (PERTH). F,_, George 10680 (PERTH); G, »» Parker 268

leptacantha: B.. fruit x |, B,. pricklex 7. B,. sepai x 3, B,. sepal appendage x 7. C. T. ramosa: C,. fruit x 1. C,. bristle x 7,

C,. sepal x 3. C,. sepal appendage x 7. D. T. echinata: D.. fruit x 1. D,. prickle x 7. D,. sepal x 3. D,, sepal appendage x 7,

ip, 4,

E. T, tenuiseta: B,. fruit x |. E,. bristle x 7, E, sepal x 3. E,. sepal appendage x 7. F. T. chaetocarpa: F.. fruit x 1. F.,. prickle

x 7. F,. sepal x 3. F,. sepal appendage x 7. G. T. deserticola: G.. fruit x 1; G,. prickle x 7. G,. sepal x 3. G,. sepal appendage

x 7. A_,, Latz 4377 (BRI); B,,, Trudgen 1320 (PERTH); C, ,, Everist 9188 (BRD

(DNA); G, ,, George 15670 (PERTH).

Austrobaileya 4(4): 495-587 (1997)

“J

res

Fig. 5. Triumfetta species. A. T. albida: A,. fruit x 3. A,. prickle x 14. A,. sepal x 7. A,. sepal appendage x 14. B. T. fissurata:

B.. fruit x 3. B,. prickle x 14. B,. sepal x 7. B,. sepal appendage x 7. C. T. incana: C,. fruit x 3. C,. prickle x 14. C,. sepal

x 7. C,, sepal appendage x 7. D, T. kennealllyi: D.. fruit x 3. D,. prickle x 14. D,. sepal x 14. D,. sepal appendage x 28, E.

T. parviflora: E.. fruit x 7, E,. prickle x 14. E,. sepal x 14. E,. sepal appendage x 28. F. 7. maconochieana: F.. fruit x 3. F,,

prickle x 14. F,. sepal x 7. F,. sepal appendage x 14, G. T. rubiginosa: G,. fruit x 3. G,. prickle x 14. G,. sepal x 7. G,. sepal

appendage x 14. H. T, syivicola: H,. fruit x 3. H,. prickle x 14, H,. sepal x 7. H,. sepal appendage x 14. A,,, Cowre 1216

& Leach (BRD; A, ,, Wightman 2794 & Clark (DNA); B,_,, Halford Q1415 (BRI); C, ,, Halford Q1452 (BRD): C, , Halford

Q1447 (BRI): D__,, Kenneally 8186 (PERTH): E, _,, Halford Q1040 (BRI): F ,,, Burbidge 986 (PERTH); Fa Burbidge E164

(CANB); G, ,, Kenneally 11163 (BRD; H__,, Halford Q1107 (BRD.

}-4? i?

RT nn ey et Wc YY A ard pe cate pag ED ee eee . : ba pacha taint oi 4 ee ee ae

Halford, Australian Tiliaceae, 3

573

saa ae

Pa”

1 ‘ ry

et Va

| + *

+ a hate

« L ad

Sy, “alts titled

# He ate nana t fH ¢

te : q é

«ar *

+ .

a+ tak

Fig. 6. Triumfetta species, A. T. prostrata: A,. branchlet with flowers and fruit x 0.7. A,, fruit x 3. A,. prickle x 20. A,. sepal

x7.A,., sepal appendage x 10.B.7. rubiginosa: B,. branchlets with flowers and fruitx 0.7, B,.flowerx7.A, ., Halford Q1055

(BRD; B.., Kenneally 11163 (PERTH).

i-5?

Li)

574 Austrobaileya 4(4); 495-587 (1997)

Fig. 7. Triumfetta species. A. T. mitchellit: A,. leaf from upper branchlet x 1.5, A,. leaf from near base of plant x 1.5. A.. fruit

x 3. A,. prickle x14. A,. sepal x7. A,. sepal appendage x 14. B. T. trisecta: B,. branchlets with fruit x 1. B,. leaf x 1.5. B,.

fruit x 3. B,. prickle x14. B.. sepal x 7. B,. sepal appendage x14. A,_,, Mitchell 2999 (BRI); A, ., Kenneally 7139 (CANB);

B_., Dunlop 5369 (DNA).

i-4? 5,6°

1-6?

fe SERA UY eg ace SRV OLIV DOSNT eee te ne ele ee eee eee Dee

Halford, Australian Tiliaceae, 3 575

ae at

ina

~.-

Wor

at 2

Fig. 8. Triumfetta species, A. T. marsupiata: A,. branchlet with flowers and fruit x 1. A,. flower x 1.5. A,. sepal x 1,5. A,,.

sepal appendage x 3. A,, fruit x 1.5, A,. prickle x 7. B. T. micracantha: B,. branchlet with fruit x 1. B,. flower x 3. B,. sepal

x 7.B,.sepal appendage x 7.B.. fruitx 3. B,. pricklex 14.A, , ., Halford Q994 (BRD; A,_,, HalfordQ974(BRI;B, .,, Halford

Q970 (BRD; B, ,, Halford Q1358 (BRI).

15,6? 2-4? 1,35,4°

2-4?

576 Austrobaileya 4(4): 495-587 (1997)

fy a ft if iy

BINH VE

’ . Tats AC ® iF i?

ee ff

Fig. 9. Triumfetta species, A. T. centralis: A, fruitx 3. A,. prickle x 14, A,. sepal x7. A,. sepal appendage x 14. B. T. viridis:

B . fruit x 3. B,. prickle x 14. B,. sepal x 3. B,. sepal appendage x 7. C. T. clivorum subsp. clivorum: C,. fruit x 3. C,. prickle

x 14, C,. sepal x 7.C,, sepal appendage x 7. D.T. glaucescens: D,. fruitx 5. D,. prickle x 14, D,. sepal x 7. D,, sepal appendage

x 14. E. T. cinerea: E,. fruit x 5. E,. prickle x 14, E, sepal x 7. E,. sepal appendage x 14. F. 7. carteri: F,. fruit x 5. F,. prickle

x 14, F,. sepal x 7. F,. sepal appendage x 14. G. 7. clement: G,. fruit x 5. G,, prickle x [4. G,. sepal x 7. G,, sepal appendage

x 14, Aas Henshall {1371 (DNA); A, Leach 1756 (DNA); B,_,, Halford Q1379 (BRD); C,_,, Halford Q1485 (BRD); D__,,

Egan 2401 (BRI); E,_,, Halford Q1125 (BRD; F_,, Carter 587 (PERTH): G, ,, Newbey 10294 (PERTH).

i-4? 4? i4?

Halford, Australian Tiliaceae, 3 S77

ane: *

cae

' a

fe hal +

" ee

aff at mA

ry fore

“T

bathed wh

ita

ane

7 ite

ee”

seat

4! at:

¥ a

+ TF

f ' {

Md d ot 1

Se hY be

aren

a - . i ‘i

*, +3 xe .t Ta

Ad,

NEY

z ‘3 ay - .

Fig, 10, Triumfetta species. A. T. ryeae: A,, fruitx 3. A,. prickle x 14, A,, sepal x 3. A,. sepal appendage x 7. B. 7. simulans:

B.. fruit x 3. B,. prickle x 14. B,. sepal x 3, B,. sepal appendage x 7. C. T. breviaculeata: C,. fruit x 3. C,, prickle x 14. C,.

sepal x 3. C,, sepal appendage x 7. D. T. mellina: D,. fruit x 1.5. D,. prickle x 7. D,. sepal x 3, D,. sepal appendage x 3, E.

T. rupestra: E., fruit x 1.5. E,. prickle x 7, E,. sepal x 3. E,. sepal appendage x 3. F. T. pannosa: F, fruit x 1.5. F,. prickle

x 7, F,. sepal x 3, F,, sepal appendage x 3, G. 7. propingua:G.. fruit x 1.5. G,. prickle x 3. G,. sepal x 3. G,. sepal appendage

x3. A, ,, Halford Q1393 (BRI); B,,, Fryxell, Craven & McD.Stewart 4581 (PERTH); C,_,, Halford Q1402 (BRD; D,__,

Halford Q1034 (BRD); E, ,, Halford Q507 (BRD; E, ,, Halford Q1016 (BRD; F_, Halford Q1061 (BRD.G, ,, Trudgen 1118

(PERTH); G, , Newbey 10001 (PERTH).

44? |?

1,2?

: 495-587 (1997)

Austrobaileya 4(4)

578

thes

tp da r

+ i i 2

aa! a*el ag

er te

7 *

ay : | =

™ 4

ot, + wt r*

is .* a+ ee *

oy + * 4

Pgs se] oo

eereg — 4 Rg

Prt +; tow J +

el ae oe Gg

- 7 + *

r + ry 7 fey '

ig lene

— ~~

Fa a i, A, aaah ee

a al

a eidlatllaneed ean

a ©

47s

*,*

Frat ees

te +

oe ee ky

~ * a

ar hae Ph

a lt

» = *, bd aod .

+p oe li Fa, os

aed i a

a7" .

mt, © ah

a ae, Se

i ad

* wadeay

+ ae VES

adel

tor

an fa

a 4 7

AUL

f aa

: atten

= * *

a Pe ne a, ae

~ ate ote ee ae

ri +, eae ee tee

att + * reat Pan ee Lee ios

" “ “ru ee ete ate ga tee

Lad . ee el ket e F

# rl fae at ae

- ot nS

F 7. F eet al

* Load 1 *

* as 1 * t

* a@et

' >the * ae

"baa ra ane

ae o™ a . we*

aed Sie :

toe ‘ag thy ++ ry

a 7 Hy tty i ‘*

*. en mat +h a

. Bees Sng ot

* *

ey hen threat tara Ik warner

1 ST er ee ue

+a ' ere

* a a Cr | vt eat

* i“ Mam 7 Wie

r re a bd weet

* wh tu 4

ig t* +

aah + To at

a? M

i ot ia

eee

"Fie

we #,%

’ a

a al

F Verve ity pan

id 4

of eal ats ae

_ Perate y

date T4 |

a7 pia™ tt a al

a eal

, ayhete td na gh

wag te he

i al auity

ve Le, Liane gee, ee ole hi pia oe ae oe My,

Oo irri a lg eT oT dy

SS aa

Lite) ee \

,. sepal

kle x 28. A,. sepal x 3.A

. fruit surface x 7. B,, sepal x 3. B.. sepal

B,_., Pryxell, Craven & McD.Stewart 4724 (CANB, MEL, PERTH).

. pric

A. branchlets with fruit x 0.7. A,. fruitx2.A

B,. branchiet with fruit x 0.3. B,. fruit x 2. B

’

‘

es. A. 7. nutans

fefta spec

LL, Friuin

Fig

‘

‘d Qi412 (BRD

lfor

appendage x 5. B. T. pustulata

appendage x 5. A, ., Ha

SPT EA DSU VLE I a OVE Le Da vee va vl ve vse tv eva i ecvevvavvavv a evseverva ire reer vv ev a a a eee eee le

Halford, Australian Tiliaceae, 3 579

A3 ANxK N

ye ON “I ys .

ate = ate oO. % ay ‘- TAM

ve wht Wry SR ge Pps

J SY ESS

S14 TONE Os

Fig, 12. Triumfetta species. A. T. antrorsa: A,. fruit x 1.5. A,. prickle x 7, A,. sepal x 3. A,. sepal appendage x 3, B.

T. monstrosa:B.. fruitx 1,5. B,. prickle x 7. B,. sepal x 3. B,, sepal appendage x 3. C. T. bradshawii: C,. fruit x 1.5. C,. bristle

x 7, C,. sepal x 1.5. C,, sepal appendage x 1.5, D. 7. arnhemica: D,. fruit x 1.5, D,. prickle x 7. D,. sepal x 3. D,. sepal

appendage x 3. E. T. longipedunculata: E.. fruit x 1.5, E.. prickle x 7, E,. sepal x 3. E,. sepal appendage x 3. F. f, cladara:

F., fruit x 1.5. F,. prickle x 7, F,. sepal x 3. F,. sepal appendage x 3. A,_,, Halford Q1478 (BRD; B,_,, Fryxell, Craven &

McD. Stewart 4807 (BRD); C,_,, Kenneally & Hyland 10926 (BRI); D, ,, Wightman 1309 & Craven (CANB); D, ,, Halford

QL1t57 (BRD; E, ,, Halford Q1395 (BRD; F,,, Maconochie 1250 (DNA); F,,, Halford Q1418 (BRD.

34?

3,4’

i? 2?

580 Austrobaileya 4(4): 495-587 (1997)

Fig. 13. Triumfetta species. A. T, inermis: A,. fruitx 3. A,. hairx 28. A,. sepal x3, A,. sepal appendage x 3.B. 7, oenpelliensis:

B.. fruit x 3. B,. prickle x 28. B,. sepal x 3. B,. sepal appendage x [4. C. T. denticulata: C,. fruit x 5. C,. prickle x 28. C,.

sepal x 3. C,. sepal appendage x 14. D, T. aquila: D,,. fruit x 3. D,. prickle x 28. D,. sepal x 3. D,. sepal appendage x 14, A,_,

Fryxell, Craven & McD. Stewart 4863 (DNA); B_,, Munir5821 (BRD; C,_,, Bean 2450 (BRN); D, _4 Halford O1427(CANB).

1-4? i?

Halford, Australian Tilaceae, 3 581

120 125 40

em i

Biizr,

AlA\ Al

L15 120 125 130 135 140

125

Ban

Hee

ere

eee.

tas x

bat | Se

‘nae r

CECE ae

Ace

anaes th

ACC

PCC

ccee

ere

PEC

CEE

avEUG

WEEE

FGRRRR RELAPSE RW

115

Map 3. Distribution of Triumfetta spp. @ T: rhomboidea; * T. triandra; A T. chaetocarpa.

115 120 125 130 135 140 45 150

Bee eee | eee ee ee ee

ween’. eles eh iy HH

a6 i eH

2 S0eee

BO Ra i x x

115 145 130 155

Map 4, Distribution of Triumfetta spp. @ T. pentandra,; ¢@ T. procumbens, * T. hapala; A T. appendiculata.

582

CEPA ec ee

FEE CE EEE eee

4 sanean

Austrobaileya 4(4): 495-587 (1997)

SHEE Eee

ey tt

++ Tet ti

#20

415

125

2 i ae se ee

FECT

CCAR ETE aes

BeReEe

SERA

sonar

140

sets

eo + =

HS --H8+-4%

seer et atts

Gece Eee eet Coe

SGRGSEEE Sees

=H EEC

AS AECEEEEE

be Ts a : ZEShe

15 120

135

145

Map 7, Distribution of Triumfetta spp. @ T) johnstonii; + T. saccata; A T, trisecta.

anaes Seo Edt

2 Re.

PSLRERE EGA

CCAS

ASCP Te

PPT TS

SCC HE

Sannn CTs

CHercee

155

Map 6, Distribution of Triumfetta spp. @ 7: monstrosa; AT. aspera; T. prostrata; * T. echinata.

wilnha

EERE

aes

PCE

SSI See Se

130

140 145

156

a Os ee t-F—ET

Prag he ie

145

e an

PCOOTAH

150 155

wid a pre rt eeseseneneaicg “ types ee ae ay bef eneea eee ee eweeessssesseeeeeen et

Sp filer ggg er ea

Halford, Australian Tiliaceae, 3 583

115 120 125 130 135 140 145 150 155

Sa eanseeaeucengeNsstuss uses 7eeiensseezen

CEE --E CECE RH

het “HCO CE Te ce ETH

EEEEEEErEEE med BEET

“Hy ga C

CCCP Ag an

gages asneue

euee aaeerenee

Tt oy

Sesecceueeete

se dseeueaeee FEECEECEE CEH EH seen ry

EHEC EEE EE EERE HEE

GA CEEE EEC EE EEE ee EEE

JT __|

HS 120 125 130 135 140 145 130 155

Map 8. Distribution of Triumfetta spp. ®@T. reflexa; @ T. marsupiata.

#15 120 125 [30 {35 140 145 [50

eR ie ae a ae ee ee ee es cael ee es De ee ne Se er Se OP sep orem

EEEEE CECT EE Hab ct EEE REC *

PT te aa ae SR end <2 Ripe

aeeeee ArT Tee REHEAT

eng

CEE Hot HH

chee vel Shee eee

seeeeeaeays 20, tuenet ty cease emiiae

CEE ECE EEC EEC EEE EEE EEE

ease aaaere nee Era tH

SECC Ae ECC BA i ss

CECE SRR ae CE SOCCER

aaer x ce

ECE EEE EEE

CEE EEC FEE HH

RSC EE EE EEE CEE CECE EEE PEE EEE

135 120 125 130 135 140 145 156 155

Map 9, Distribution of Triumfetta spp. *% T: deserticola; & T. leptacantha; @T. longipedunculata.

mi | PET EET ETT

115 120 125 130 135 140 145 150 155

Map 10. Distribution of Triumfetta spp. ¢ T. winneckeana; * T. sylvicola; AT. rubiginosa; @ T. simulans.

584 Austrobaileya 4(4): 495-587 (1997)

j15 120 125 130 135 140 145 150

——— an 2 ee ee ee ee ee ee ee T_T

ERECT pct Ee

Ge, Se Pn A |

a we SEP

SEE ECE EE %

¥,

Pee-CCeteo um

aT |

CEE CCE CREAR

SaReeeuenn BEREENGE

CEE CECE EEE EEE A

115 120 125 130 135 140 145 150 135

}20 125 145 150

=a 6 a aa TRA

CEE Auoe cea a i

gasses F PRE

saeeetaasee lel. ECCT aE

ware PEELE

+ abd te et be MOLE PSS SESRitumE LET

aan

SEERA SHA

SEER

a q

be a PA

ay SCE EEA]

Cae FEEEEHEEEEEE REECE

ARS CECE EE PC CeC ce EEC e rere HEE

TES 120 125 130 135 140 145 150 155

Map 12. Distribution of Triumfetta spp. A T. maconochieana; * T. parviflora; @ T. fissurata; @ T. mitchellii

= jaaneen PULL ==SS00wan

CCEEEEEEEE EEE EPP a

peueseee coo E #

ae a :

o NER On |

L Atala CT

eee eee LEPC Ser

“EEE RERCE EECCA

Bene serene H- SRSSRERS oa a

ge anne oa aa See Ree ae

ae naones pee ARRAS ae : ~

eaz-s CCECEEP EEE roe

ayannee PEELE EEE Es

AREER EEE EHEC

saeeee PERE rere HEA

- PE ye

Map 13. Distribution of Triumfetta spp. @ T. glaucescens; @ T. carteri; & T. viridis.

anctandeataanens

eee AAA EERE a PACER tat NAA, ah in att ELEN INCE ANE AENEAN TE ME ROMEO ESE LESRLEOEEEAEEE NECA EN COREE tol EEEOMENEAEENEEE EAE ae A MACELAEEAESAA AT ANNE IEN ABREEN AE NERA MEM data MA sheneedaas

eighty ita eae See Meo lm yo hoy pe yo mmm" mney yyy oe ighaae ena a ee ee ee ae La ne er ae

Shade UE et ee AA ARH A EAGER Ae ee renee Cart arc ar a a ae rh eS Cena aw Se CRC Lh

Pereereer ert et st MQ LSA Seabed ced EE

PMA REHEAT OPPO EU NOP LL SEMUMS NCR OC CI NCETM OE : : lt

se URANE HEU She Lehn aac PA a Vn at 0 Rte BP a eh AS SER ISIE OE ee A te eee eet see eee eee ae ete een ete EE eee A TS eT ae tears FT Ear EI RS

Austrobaileya 4(4): 495-587 (1997)

its 120 [25 130 135 i40 145

BCE

EERE EEE Bee HEE

CLEE err et iit SERRE

--ECE Ee SoA

| {eeeien seie | TT N ae

eee eeeey, uaSee SRESEEER GE AEmeL ees

an% eCOCLOrs; aan

eotneea( ssceete eure ans eaecerreltar

CCC ee RE

-BeeCEEECEEEEEEEE CEE HALLE PEE

OCR ACCEEECEC Ear

CECEEEECEECE EEE EPEC EEE

TAA iT

AACE EE HH

115 120 125 130 135 140 145 150

Map 14. Distribution of Triumfetta spp.@ T. albida; & T. centralis,

120 125

TLE ee

140 145

fF,

See ibeeee EEE

“ane

nea

sett saseae PEEHE

115 120 135

ne ae Fe aa as Se oe a a

ECOL EC ech tea

Cha te aim

ae an = me 4

naa Guaat

x a ETP

cos te Saeenen

CCE COREE CEE CEE CECE

REVEL EREFRRS

Ceeeccee He AH

115 120 125 130 135 140 145

Map 16, Distribution of Triumfetta spp. @ T. incana; @T. clivorum subsp. brevipetala; A T. arnhemica; * T. nutans.

Halford, Australian Tiltaceae, 3

Seb TH

ane

a is

eed

eal

eat

me rs

Oi Wate

dal

eal

mia

ee.

i is i ag

a a

bbe

Rdg

heed

Hae

dsl 1)

}

ele ie

ial

PCE RET

= t

CCC EH TT

140 145 150 155

ae LEE LL

115 #20 125 130

pee

tad

Map 17. Distribution of Triumfetta spp. @ T. ryeae subsp. ryeae; * T. ryeae subsp. brevipetala; } T. mellina;

A T. denticulata.

120 125 130 135 idG 145 150

FECES

EEEECEEECEE EEE CCAR

CCEA HeeSC EEC REE

CE EEE ER ACCOR HAE

CCC ieee HE

CECE LASS ECCBCCCECT CCT Serre RET re

ECE MEE CREE EC EEA

EEE CECE EEE EEC ae Re

CCE CCE ala HERBST

AH z Seuetsee SERPASARURERe se ake aa

ZC ECE ee Et

EECEEE EEE EERE ECE EEE EEE TTS

CEE EEE EEE EEE EEE EEE

REECE CCE CECT CEE EE

eb EEE ee

115 126 125 {30 135 140 145 i30

ee eee ree: eS ree” ere eee eee 2

rT —— oa jot oS SS SS a = I cj

ECEE EE CEE EET eer eH EEE

CEE ECE err enue

CEC rere iar ie Se mein gy

CEE LBP Aist le SShene

CC eae Clan Sat sore

cc aa Peet

yar SNE ae

CU gaa aor PH

CEE ACEC eee METS

Cee eee Ee EAA

(eee eo Sune

7 eee CoH

13 suaeen ia | a

ECeeEEE Eee E TH

EECCA CEE SRreuayes

ECE EEE H-HEeN

JAA HTTP Ep

i15 120 i25 i30

—_

habe

rey

aie

145 150 {55

Map 19, Distribution of Triumfetta spp. A T. breviaculeata; ® T. pannosa; *® T. inermis.

Halford, Australian Tiliaceae, 3

EET is ich,

| Be we

see cetaceans EEE

ace seeeeeee HEC

CECE EEE oer PREC

FAYE rr

145 126 125 130 135 140 Id45 150

Map 20, Distribution of Triumfetta spp. T. antrorsa; *T. bradshawii; @T. pustulata.

587

ge cep emmy SLA Aeterna a ee eg ee feyeeee eee Eee a ee ee EH HT Ce ee Le

Two new species of Eucryphia Cav. (Cunoniaceae) from

Queensland

Paul I.Forster & B.P.M.Hyland

Summary

Forster, P.I. & Hyland, B.P.M. (1997). Two new species of Eucryphia Cav. (Cunoniaceae) from

Queensland. Austrobaileya 4(4): 589-596, Eucryphia jinksii P.I.Forst, and E. wilkiei B. Hyland are newly

described and illustrated. Notes are provided on their affinities, distribution, habitats and conservation

status, A key to the Australian species of Eucryphia is provided.

Keywords: Queensland - Cunontaceae; Eucryphia jinksit; Eucryphia wilkiet.

Paul 1.Forster, Queensland Herbarium, Meiers Road, Indooroopilly Queensland 4068, Australia

B.P.M.Hyland, Australian National Herbarium, CSIRO Division of Plant Industry, P.O. Box 780,

Atherton Queensland 4853, Australia

Introduction

The genus Eucryphia Cav. occurs in Austrahia

and Chile (Bausch 1938; Dress 1956; Barnsley

1983) and has been included in its own family

Eucryphiaceae (Cronquist 1981; Thorne 1983;

Takhtajan 1987) or in Cunontaceae (Hufford &

Dickison 1992) as is supported herein. Five

species of Eucryphia have been recognised

previously with two endemic to Chile and

three endemic to Australia (Bausch 1938:

Dress 1956), The three Australian species are

temperate in their distribution with FE. moorei

F.Muell. occurring in southern New South Wales

and Victoria (Harden 1991) and £. milliganii

Hook.f. and E. lucida (Labill.) Baill. restricted

to Tasmania (Curtis 1956).

Nearly twenty-five years ago, a fourth

species of Eucryphia was discovered in north-

east Queensland by Jack Wilkie. This species

has been alluded to or recorded in the literature

for some time (e.g. Harden 1991; Hyland et al.

1994; Jessup 1994) but has remained

undescribed despite adequate fertile material

in various Australian herbaria. In 1994, a fifth

species of Eucryphia was discovered in south-

east Queensland by David Jinks. This fifth

Species was subsequently collected in flower

and fruitin early 1995, Both of these species are

described as new in the current paper.

Accepted for publication 3 May 1996

The formal recognition of these two species

alters considerably the geographical distribution

of the genus. Eucryphia has previously been

considered a typical element of the southern

temperate rainforest flora of Australia (e.g.

Bausch 1938; Helman 1987; Jarman etal. 1987)

and Chile (Bausch 1938), but now is shown to

occur in subtropical and tropical areas as well.

Albeit both &. jinksti and E. wilkiei occur in

locations where the community types and the

flora composing them experience weather

patterns somewhat similar to those in southern

temperate Australia. These communities show

strong floristic linkages to the southern temperate

assemblages and are structurally similar (Webb

& Tracey 1981). Such communities were

undoubtedly more widespread throughout

Australia in times gone by. Pollen identified as

belonging to Eucryphia has been identified

from Oligocene (37—23.5 Ma) deposits (Hill &

Macphail 1983). Fossil leaves from Tertiary

deposits in south-eastern Australia have been

described and named as EF. falcata R.S.Hill, E.

microstoma R.S.Hull and E. aberensis R.S.Hill

(Hill 1991). Both of these living, new species of

Eucryphia should be regarded as relictual taxa

that are persisting in narrow ecological niches in

otherwise unsuitable climatic zones.

590

Materials and methods

This paper is based on herbarium holdings at

BRI and QRS and field examination of E. jinksii.

Descriptions have been compiled from dried

and spirit-preserved material.

Taxonomy

Eucryphia wilkiei B.Hyland sp.nov., affinis E.

moorel F.Muell. a qua stipulis lanceolatis

(non ovatis) longioribus (4—5.5 mmcontra

2.5—3 mm), foliolis venis lateralibus in

parvibus paucioribus (12-20 contra

22-25) et marginibus recurvatis (non

planis) ornatis differt. Typus: Queensland.

Cook District: southeastern slopes of Mt

Bartle Frere, Jan 1970, /. Wilkie s.n. (holo:

ORS; iso: BRI distribuendi).

Eucryphia sp. (Mt Bartle Frere M.Godwin

C1158) (Hyland etal. 1994; Jessup 1994),

Shrub 3-4 m tall, with a dense rounded crown;

indumentum of simple ginger-coloured hairs.

Twigs villous, glabrescent, never resinous.

Stipules lanceolate, acuminate at the apex, 4-5.5

mm long, 2.5—3 mm wide, connate, caducous,

with a longitudinal strigose band on the median

abaxial surface. Leaves opposite, simple,

bifoliate or trifoliate, rarely 5-foliate; petioles

0.3-—5 mm long, 0.5—1 mm wide, villous; lamina/

leaflets elliptic-oblong to lanceolate-oblong,

19-43 mm long, 3-12 mm wide, sericeous

when young becoming glabrescent on both

surfaces, base attenuate, apex acute and

mucronate; margins slightly recurved; midrib

slightly depressed on the upper surface; main

lateral veins 12—20 pairs at an angle of 60-—80°

to the midrib, distinct on the glaucous underside,

but obscured by the fine reticulate veins on the

dark glossy green upper surface. Flowers

axillary; peduncles 2~3 mm long, with dense

indumentum; bracts 4 or 5, imbricate, orbicular

or reniform, 3—4 mm long, 3-5 mm wide, ciliate

on margins, sericeous on both the inner and

outer surfaces, with outermost pair of bracts

persisting to the early fruiting stage and more

densely pubescent on the keel area, brown;

pedicels short at bud stage but elongating to

6—10 mm long at anthesis and c. 15 mm at the

fruiting stage, + glabrescent at fruiting stage;

sepals 4, imbricate, decussate, lanceolate, 8-9

Austrobaileya 4(4): 589-596 (1997)

mm long, 4—5 mm wide, the outermost pair with

dense woolly indumentum on outer surface, the

innermost pair with dense sericeous indumentum

on outer surface, the inner surfaces of all sepals

glabrous; petals 4, broadly ovate, 12-15 mm

long, 12-15 mm wide, with apex rounded and

entire; stamens numerous (c. 150), multiseriate,

with filaments 5-8 mm long, free, glabrous but

surrounded at the base by short hairy scales

which cause the filaments to adhere and be shed

en masse; anthers globular, 0.3-0.5 mm long,

0.3-0.5 mm wide, biloculate, longitudinally

dehiscent, dorsifixed and versatile; ovary ovoid

to ovoid-ellipsoid, 2—3.5 mm long, 1.5—3 mm

wide, 7—9-locular, with densely appressed

tomentose indumentum; styles 7— 9, 1.5—3 mm

long, glabrous, Capsule 7—9-locular, somewhat

woody, c. 10 mm long, 7~8 mm diameter,

septicidally 7—9-valved; each valve glabrous

and flat on the sides and villous on the back.

Seeds lacrimiform in outline, c. 3.5 mm long

and 1.5 mm wide, narrowly winged atthe broad —

end, dark shiny brown. Fig. 1.

Additional specimens examined: Queensland. Coox

District: Mt Bartle Frere, Mar 1980, Godwin C1158

(QRS); Upper Eastern Bartle Frere, Nov 1986, Godwin

C2956 (BRI, QRS); ditto, Dec 1986, Godwin C2959 &

Stanton (BRI, QRS).

Distribution and habitat: Eucryphia wilkiei is

known only from the eastern summit area of Mt

Bartle Frere in north-east Queensland (Map 1)

where it occurs from 1200-1400 m altitude in

microphyll vine thicket amongst large granite

boulders.

Notes: Eucryphia wilkiei is notable for being

the only tropical species of the genus. It has a

similar habit to the species from southern

Australia but differs from all of these in numerous

ways (Lable 1). The closest apparent relatives

to £&. wilkiet on morphological grounds appear

to be E. jinksit and E. moorei.

Conservation status: Eucryphia wilkieiis known

only from the type locality on the eastern side of

Mt Bartle Frere. This locality 1s wholly within

National Park but is subject to irregular damage

fromcyclones and storms. A conservation coding

of *V’ (Vulnerable) has been previously allocated

to the species under the Queensland Nature

Conservation Act 1992 (lessup 1994).

Es had vin av nee pe eg gee ce cen sewer cn a i pe

LEEDS Rhee Te BA LC TE

att fel -.

Zeesauemeyetian NN bape nin eae IY

—_=

——1

eo ere a

Seen POO nese

Forster & Hyland, EZucrypita 591

‘=

“fh Geo

r,*

= ¢

wz +} - £8 FT

Fig. 1. Eucryphia wilkiei, A. flowering twig x 1. B. group of stamens x 6. C. group of hairy scales at base of stamen x

12. D, abaxial view of anther x 20, E, adaxial view of anther x 20. F. lateral view of anther x 20. G, dehiscing fruit x 3.

H, seed x 5, All from Wilkie s.n. (QRS), Del. T.J.AHyland.

592

Etymology: Named in honour of John (Jack)

Henry Wilkie (1902—x), an expert orchidologist

and explorer of the Bellenden Ker— Bartle Frere

mountain range. Jack discovered and made the

first herbarium collections of EF. wilkiei.

Eucryphia jinksii P.I.Forst., sp.nov. affinis

E. wilkiei B.Hyland autem statura grandi,

arbore ad 25 m alta, stipulis multo

grandioribus (12-15 mm vice 4—5.5 mm

longis), petiolis longioribus (S—i53 mm

vice Q.3—5 mm longis), foliolis marginibus

planis et venis lateralibus pluribus

principalibus (22~—30 vice 12—20) praeditis

differt. Typus: Queensland. MORETON

District: Natural Arch National Park 752,

McPherson Range, 5 Mar 1995,

P.I. Forster PIF16391, D.Jinks & G.Leiper

(holo: BRI [3 sheets + spirit]; iso: AD,

CANB, HO, K,L, MEL, NSW, NY, QRS,

WELT distribuend}1).

Tree to 25 m tall, often multistemmed;

indumentum of simple yellow to yellow-ginger-

coloured hairs. Bark nondescript, pale brown,

sometimes slightly lenticellate; blaze pale pink

with faint pumpkin-like scent, wood straw-

coloured. Twigs villous, glabrescent, never

resinous. Stipules lanceolate, acuminate at the

apex, 12-15 mm long, 1.5—2 mm wide, connate,

caducous, with dense indumentum on margins.

Leaves opposite, simple, bifoliate or trifoliate,

new growth bright pink; petioles 5-15 mm long,

0.7-1 mm wide, villous, soon glabrescent;

lamina/leaflets elliptic-oblong to lanceolate-

oblong, 25-100 mm long, 8-28 mm wide,

sericeous when young becoming glabrescent on

both surfaces; margins + flat; midrib slightly

raised on the upper surface; main lateral veins

22—30 pairs at an angle of 45—50° to the midrib,

distinct on the glaucous underside but less so on

the dark glossy green upper surface; base cuneate

to attenuate; apex acute to acuminate. Flowers

axillary; peduncles 2—3 mm long, with dense

indumentum; bracts 4 or 5, imbricate, orbicular

or ovate, 3-4 mm long, 2—3 mm wide, ciliate on

margins, sericeous on both the inner and outer

surfaces, outermost pair of bracts persisting to

the early fruiting stage and more densely

pubescent on the keel area, brown; pedicels

short at bud stage but elongating to4—5 mm long

at anthesis and 10-13 mm long at the fruiting

Austrobaileya 4(4): 589-596 (1997)

stage, + glabrescent at fruiting stage; sepals 4,

imbricate, decussate, lanceolate, 9-10mm long,

4-5 mm wide, the outermost and innermost

pairs with dense sericeous indumentum on outer

surface, the inner surface of outermost pair with

dense sericeous indumentum near apex, the

inner surface of innermost pair glabrous; petals

4, obovate, 15-17 mm long, 14-15 mm wide,

with apex rounded and entire; stamens numerous

(130-140), multiseriate, filaments 8—11 mm

long, free, glabrous but surrounded at the base

by short hairy scales which cause the filaments

to adhere and be shed en masse; anthers globular,

0.5~—0.8 mm long, 0.5—0.8 mm wide, biloculate,

longitudinally dehiscent, dorsifixed and

versatile; ovary ovoid to ovoid- ellipsoid, 3.5—5

mm long, 3.5-4 mm wide, 6-9-locular, with

densely adpressed tomentose indumentum;

styles 6-9, 2—2.5 mm long, glabrous. Capsule

6-9-locular, somewhat woody, 11-13 mm long,

8—9 mm diameter, septicidally 6-9-valved; each

valve glabrous and flat on the sides and sparsely

villous onthe back. Seeds lacrimiform in outline,

4—5 mm long, 1.5—2 mm wide, narrowly winged

at the broad end, pale brown. Fig. 2.

Additional specimens examined: Queensland. MorETON

DistricT: near Natural Arch N.P., Nov 1994, Jinks

[AQ632334] (BRI).

Distribution and habitat: Eucryphia jinksii is

restricted to south-east Queensland where it

occurs near Springbrook in the McPherson

Range (Map 1). The single known population

occurs at an altitude of 770-800 m in complex

notophyll vine forest on rhyolite.

Notes: Eucryphia jinksii appears to be more

Closely related to FE. wilkiei rather than the

other southern Australian species (Table 1),

particularly because of the similar appearance

of the foliage. E. jinksti differs most noticeably

from £, wilkiei in being a large tree to 25 m tall,

with much larger stipules (12-15 mm long as

opposed to 4—5.5 mm long), longer petioles

(S—15 mm long as opposed to 0.3-5 mm long),

leaflets with flat margins, and a greater number

of lateral vein pairs in the leaflets (22-30 as

opposed to 12-20).

Conservation status; The single known

population of #. jinksii comprises several

hundred mature individuals over an area of c. 2

yr ee

Forster & Hyland, Eucryphia

ha concentrated in a narrow band along a steep

rocky watercourse. Despite the copious fruit set

observed at the time of collection of the type,

there was no evidence of recent past seedling

recruitment. Nearly all of the individuals occur

within Natural Arch National Park (now

Springbrook National Park), but afew are present

on adjacent private land.

There are no immediate threats to this

species; however, it has a restricted area of

occurrence andis unlikely to be more widespread

as the Springbrook area is relatively well-

120 12 130

i] "|

7 ee oe eee ae ee ee ee ee ee ee

Secaceeesteetncersccr0FE

mn fain eee

CECE eg

CCE EHEC

Re i

CCEEEE- psec eerie

ARC CCR

nee

ween.

sea

Linde

rac i

ona

Pati

Sie

ean

SiG

ree

Piet

593

explored. The species is susceptible to damage

from changes in catchment structure which could

occur if future development of the private land

in the water catchment above the population

proceeds. A conservation coding of ‘E’

(Endangered) is suggested for listing under the

Queensland Nature Conservation Act 1992,

Etymology: Named in honour of David Jinks

of Springbrook who discovered this species,

recognised its significance, and whose tree-

climbing prowess enabled the type to be

collected.

—

aco

Wpblea

eat

Iles

Le)

pane

naa

Lt Td

Sap

FER

| c

See a

ia gi

ial

|_|

air

nan

BRANES ye

EEE

CEEEH-ECETTP

15 120 {25 130 135 140 145 150

wa sue

\paaeee PEPE

ECE ECE ee

—:

Map 1. Distribution of Eucryphia jinksii A and E. wilkiei * .

Key to the Australian species of Eucryphia

!. Twigs and buds resinous; leaves always simple ...... 0... 0. eee ee cee eee eee

Twigs and buds notresinous; leaves sometimes simple, but generally bifoliate,

Ore arrpiiiale- Wi 3 0S Tea Pets we sec vee Phi tre lene tba aeatpan of bettas ord aed ae age

2. otipules ovate; leaves 2.5-4.5 cm long with 14-16 lateral vein pairs

pedi Tn ict, 0 enka eA ed hers Uettels HEE dae yA eRe nd ee de eer Leg E. lucida (Labill.) Baill.

.. E. milliganti Hook.f.

Stipules lanceolate; leaves 1-2 cm long with 7-9 lateral vein pairs .

3. Leatlets with 12~20 lateral vein pairs and recurved margins ......... K. wilkiei B.Hyland

Leaflets with 22-30 lateral vein pairs and flat margins... 1... 0.0... 0.00. cee ee ee een

4. Stipules lanceolate, 12—15 mm long; leaflets 1-3, tips acute to acuminate

vat Mp ere Be Stel 08 Gly Mt ees log. 58 mares eager tinc BS esa be SA rota! tol yietese 16 aot ok onevig te thadeea mee EN EK, jinksii P.I.Forst.

Stipules ovate, 2.5—3 mm long; leaflets (1,2)3—13, tips mucronate..... E. moore F.Muell.

594

Acknowledgements

Paul Forster wishes to thank D.Jinks for his

assistance with the collection of &. jinksii

and G.Leiper for photographing material.

Austrobaileya 4(4): 589-596 (1997)

T.J.Hyland prepared Fig. 1. W.Smith (BRD

prepared Fig. 2. Y.Smith (BRI) prepared Map

1. L.Pedley (BRI) kindly provided the

translations of the diagnoses into Latin.

Table 1. Comparison of diagnostic features of Australian species of Eucryphia

Character state E. jinksiti E. lucida E. milliganit E. moorei — E. wilkiei

Twigs & buds resinous no yes yes no no

Stipule shape lanceolate ovate lanceolate ovate lanceolate

Stipule length (mm) 12-15 2.5—4 3-5 2.9—3 4—5.5

Leaf arrangement

simple (1)

bifoliate (2)

imparipinnate (3-13 1,2,3 ] ] (1,2)3-13 1,2,3(5)

leaflets)

Petiole length (mm) 5-15 2-6 1-3 3-17 0,.3—5

No. lateral vein pairs 22-30 14-16 7-9 22-25 12—20

in leaf/leaflet lamina

Leaflet margins

flat (-) — + + — +

or recurved (+)

Leaflet shape

elliptic-lanceolate (1) 1,2,4 1,2,3 2,23 1,2,3 23,4

elliptic-oblong (2)

elliptic-ovate (3)

lanceolate-oblong (4}

Leaflet length (mm) 25—1L00 15-45 6-20 9-65 25-100

Leaflet tip shape acute retuse retuse mucronate acute

acuminate rounded rounded mucronate

Pedicel length (mm) 4-13 5—10 6—10 10-15 6—15

Petal width (mm) 14—15 10-18 Fit 11-13 12-15

ng ene ny SS I Ane ae et ees

tinnitus prereset

Iw. GS FERe i gece ercnands etn ane coh int a el ede Leola d oa

Forster & Hyland, Eucryphia 595

=r *

ha" =*

pts at et

a tete +*

Shee =

ony

L de -

” ag *

WT!

* TH

aly

+ r

T her

45% *

ayt> ‘

‘2:

#17

' agit a5

t .

ith

Coe

. th

4 a ll

& 4 at

et.

* to

* an

; iy

¥ t |

if bd ic:

nha # *~. aN

ae |S

‘

+ 7

44 Z Hi ”

1 f

+, at Je

ia + P 3,

il may d

wit

ara

tf.

Fig. 2. Eucryphia jinksit. A, fruiting twig x 0.5, B. trifoliolate leaf x 0.8. C. lateral view of flower x 1.5, D. apical view

of flower x 1,5. E. lateral view of flower with perianth and stamens removed x 4. F. stamen x 8. G. lateral view of fruit

x 2, H. dehiscing fruit x 2. All from Forster 16391 et al. (BRI), Del. W. Smith.

596

References

BARNSLEY, B. (1983), Eucryphiaceae. In B.D.Morley &

H.R.Toelken (eds.), Flowering Plants in Australia,

pp. 137-138. Adelaide: Rigby Publishers.

Bauscu, J. (1938). A revision of the Eucryphiaceae. Kew

Bulletin 1938: 317-349.

Cronousst, A. (1981). An integrated system of classification

of flowering plants. New Y ork: Columbia University

Press.

Curtis, W.M. (1956). Eucryphiaceae. In The Student's

Flora of Tasmania, Part |, p. 180. Hobart:

Government Printer.

Dress, W.J. (1956). A review of the genus Eucryphia.

Baileya 4: 116-122.

Harpen, G.J, (1991), Eucryphiaceae. In G.J.Harden (ed.)

Flora of New South Wales 1: 523-524, Kensington:

New South Wales University Press,

HeLMAN, C. (£987). Rainforest in southern New South

Wales. In G.L.Werren & A.P.Kershaw (eds.), The

Rainforest Legacy. Australian National Rainforests

Study 1: 47-70, Canberra: Australian Government

Publishing Service.

Hit, R.S. (1991), Leaves of Eucryphia (Eucryphiaceae)

from tertiary sediments in south-eastern Australia.

Australian Systematic Botany 4: 481-497.

Hint, R.S. & Macpnalt, M.K. (1983). Reconstruction of the

Oligocene vegetation at Pioneer, North East

Tasmania. A/cheringa 7: 281-299.

Austrobaileya 4(4): 589-596 (1997)

Hurrorp, L. & Dickison, W.C. (1992). A phylogenetic

analysis of Cunoniaceae. Systematic Botany (7:

181-200,

Hy LAnpb, B.P.M., Gray, B. & Exick, R.W. (1994). Appendix

I. Provisional species list. In W.Cooper &

W.T.Cooper, Fruits of the Rain Forest. Surrey

Hills: RD Press.

JARMAN, S.J., Brown, M.J. & Kanrvitas, G. (1987). The

classification, distribution and conservation status

of Tasmanian rainforests. In G.L.Werren &

A.P.Kershaw (eds.), The Rainforest Legacy.

Australian National Rainforests Study tl: 9-22,

Canberra: Australian Government Publishing

Service.

Jessup, L.W. (1994). Eucryphiaceae. In R.J.F. Henderson

(ed.) Queensland Vascular Plants, Names and

Distribution p. 106. Brisbane: Queensland

Department of Environment é& Heritage,

TAKHTAJAN, A.L. (1987). Systema Magnoliophytorum.

Leningrad: Nauka.

THORNE, R.F. (1983). Proposed realignments in the

angiosperms. Nordic Journal of Botany 3: 85-117.

Wess, L.J. & Tracey, J.G. (1981). Australian rainforests:

patterns and change. In A. Keast (ed.) Ecological

Biogeography of Australia, pp. 605-694, The

Hague: W. Junk.

P.io 1 LLL hemi eyes eed nsegaeg seed ode tee ely ae ck EE

Borya inopinata (Anthericaceae), a new species of resurrection

plant from north Queensland

Paul I, Forster & E, John Thompson

Summary

Forster, Paul I. & Thompson, E, John (1997). Borya inopinata (Anthericaceae), a new species of

resurrection plant from north Queensland. Austrobaileya 4(4):; 597-600. Borya inopinata is described

and illustrated. Notes are given on the species’ distribution, habitat, affinities and conservation status.

A Conservation Coding of rare (R) is recommended. A key to the species of Borya in Queensland is

provided.

Keywords: Anthericaceae, Liliaceae, Borya - Queensland, Borya inopinata.

Paul I. Forster & E. John Thompson, Queensland Herbarium, Meiers Road, Indooroopilly Queensland

4068, Australia

Introduction

The genus Borya Labill.is endemic in Australia

and has been monographed by Churchill (1987)

who recognised ten species. ‘The genus was

classified in the Liliaceae sensu lato in the

‘Flora of Australia’ but is otherwise included in

the Anthericaceae with reservations by

Dahlgren et al. (1985). The species of Borya

are distributed in south-west Western Australia

(6 species), northern Western Australia and

the Northern Territory (2 species), Victoria (1

species) and north-east Queensland (2 species).

Most species of Borya are drought-

tolerant ‘resurrection plants’ where the foliage

can rehydrate and recommence photosynthesis

after periods of water deficit in the habitat

(Gaff 1981). Two species are drought-avoiders

(B. laciniata Churchill and B. scirpoidea

Lindley) and shed their foliage during periods

of water deficit (Churchill 1987). Most species

occur in open areas of bare rock pavements

and outcrops where there is little associated

vegetation, Some species form small tussock-

mounds whereas others could be termed as

‘micro stilt plants’ where the stems straggle and

are partially supported by stilt roots (cf. Pate

1989).

The tussock-mound forming and drought-

tolerant B, septentrionalis F.Muell. is restricted

Accepted for publication 22 March 1996

to granite rock outcrops in the ‘Wet Tropics’

region of north-eastern Queensland (Map 1).

This species is considerably disjunct from

others in the genus, although the genus as a

whole is characterised by a very fragmented

pattern of species distribution. Hence it is of

considerable phytogeographic significance that

a second species B, inopinata has recently been

recorded for northern Queensland. B. inopinata-

is also a tussock-mound and drought-tolerant

species, The new species was discovered near

Charters Towers by E.John Thompson during

the Queensland Herbarium’s ‘Desert Uplands

Vegetation Mapping’ project, and appears to

have a very restricted distribution.

Taxonomy

Borya inopinata P.I.Forst. & E.J.Thomps., sp.

nov, affinis B. septentrionalit F.Muell. et

B. jabirabela Churchill sed ab utraque

foliis multo brevioribus (14-18 mm longis

vice 20—25 mm longis) marginibus minute

scabris secus omnem longitudinem (vice

laevibus vel ciliatis vel scabris non nisi

apicem), scapis multobrevioribus (1.1-1.3

cm longis vice 4—25 cm longis), bracteis

floralibus inflexis differt. Typus:

Queensland. NorTH KENNEDY DISTRICT:

Mt Stewart Range, 16 May 1995,

PI.Forster 16583 & S.J. Figg (holo: BRI

[1 sheet + spirit]; iso: DNA, K, MEL,

NSW, QRS).

398

Py tt .

: | ||

“PACE 5

eeQeeee sees

125

lis 120) 130}

aha

—-

135

140 145 [55

COTTE HAA

[Vtteal dy FEECH | tS EEE 10

mt hd tT TAA I] ae%

pr aeestiigt euseeastae

ALT TPH

pressor ies HEE

a €a

Scceeceeee Phy

STC EER |

BREE HH

SERRE ee

HEE

SCE i Nan

Oe 2 a a ae LL TY fy 2s

CE He

CECH ¥

SCEEEEEREEE EE

140 145 154

150)

_—_

Map I. Distribution of Borya inopinata @ , B. jabirabela * and B. septentrionalis A.

Smal] tufted perennial forming tussock

mounds up to I m across; stems erect or weakly

reclining, up to 16 cm high, often with stilt-

roots. Leaves rigid, linear, 14-18 mm long,

0.6-0.8 mm wide, persistent during drought,

with apex needle-like or acuminate, black-

varnished for 2~2.3 mm from tip; margins

minutely scabrous with antrorse hairs for entire

length; leaf- base margins widening to sheath,

pale straw-coloured to medium-brown,

glabrous or with scattered hairs, with

disarticulating joint near base. Scapes 1.1—1.3

cm jong, unjointed, usually persistent; head

4—10 mm long, 5-8 mm diameter, with 10-15

flowers; outer bracts of involucre 3-6, needle-

like, 6-9 mm long, 0.8-1 mm wide, smooth,

green with a black-varnished tip (straw-

coloured on drying); wings entire, cream; inner

bracts of involucre 3-6, needle-like, 5-6 mm

long, 0.50.8 mm wide, smooth, green with a

black- varnished tip (straw-coloured on drying).

Floral bracts imbricate, lanceolate-ovate, 4.5—5

mm long, 2~2.2 mm wide, white to cream with

brown inflexed acute tip. Flowers 11-12 mm

long, 10-12 mm diameter, white; tube 7-8 mm

long, 1.3—1.5 mm diameter; perianth lobes

linear, 5.3-5.8 mm long, 1.4-1.6 mm wide;

filaments 3—5 mm long, c. 0.4 mm diameter at

base, c. 0.1 mm diameter at tip; anthers oblong,

c. 0.9 mm long and 0.5 mm wide, golden; style

cylindrical, 5-10 mm long, 0.2—0.3 mm

diameter, with apex bluntly capitate. Seeds not

seen. Fig, I.

Additional specimens examined: Queensland. Norrn

KENNEDY District: Mt Stewart Range, Sep 1991, Thompson

327 & Dillewaard (BRI); ditto, May 1995, Forster 16614

& Fige (BRI). Cultivated. Cult. at St Johns Wood, Brisbane

(ex Mt Stewart Range), Dec 1994, Thompson 398 (BRD).

Distribution and habitat: Borya inopinata

occurs in shallow depressions on rock pavements

with shallow gravelly soil derived from granitic

rocks on the upper slopes of hilly terrain at

altitudes of 780 to 860 m. The vegetation type

is mostly open-shrubland to low open-woodland.

Other species commonly present there include

the shrubs Callistemon chisholmii Cheel,

Grevillea sessilis C.T.White & W.D.Francis,

KunzeacalidaP.Muell., Thryptomene parviflora

(F.Muell. ex Benth.) Domin, and herbs and

grasses such as Aristida thompsonii B.K.Simon,

Gonocarpus acanthocarpus (Brongn.) Orchard,

Plectrachne pungens (R.Br.) C.E.Hubb.,

Trachymene montana A.E.Holland and

T, hookeri (Domin) A.E.Holland. Rainfall is c.

S00 mm per annum and predominantly in

summer, although it ts often highly irregular in

occutrence. 6, inopinata apparently occurs in

the driest known habitat for any Borya species.

Borya septentrionalis occurs in a similar

habitat, albeit with a totally dissimilar associated

flora and with much higher and more regular

rainfall of c. 800 to 2000 mm per annum.

No habitat description was provided for

B. jabirabela Churchill by either Churchill

(1987) or Rye (1992). The habitatof B. jabirabela

Forster & Thompson, Borya inopinata 599

Fig. 1. Borya inopinata, A, habit of flowering plant demonstrating stilt roots x 1, B. stem with flower head x 2. C. lateral

view of flower x 5. outer involucre bract x 5, D. inner involucre bract x 5. E. floral bract x 5. All from live material of

E.J.Thompson 398 (BRD. Del. W, Smith.

600

isdescribed by C.R.Dunlop (pers. comm. 1995)

as being on top of sandstone plateaux in

lenses of white sand. ‘The vegetation type there

is an open shrubland or low open-woodland,

usually with spinifex (7riodia and/or Plectrachne

species) and widely spaced shrubs such as

species of Acacia and Pityrodia. Annual rainfall

over the distribution of B. jabirabela is c. 1000

mm per annum.

Notes: Borya inopinata appears to be allied

to B. septentrionalis, the closest species

geographically, and to B. jabirabela from

Western Australia and the Northern Territory

(Churchill 1987; Rye 1992). It will key to

B. jabirabela in Churchill’s (1987) key.

B, inopinata differs from both of these species

by the much shorter leaves (14-18 mm long

versus 20-50 mm long) with the edges minutely

Austrobaileya 4(4): 597-600 (1997)

scabrous along the entire length (versus smooth,

ciliate or scabrous towards the apex only), the

much shorter scapes (1.1—-1.3 cm long versus

4—24 cm long) and the inflexed floral bracts. It

also differs from B. septentrionalis in the much

longer perianth tube (7-8 mm long versus

3,.5-4.5 mm long) and the fewer flowers per

head (10-15 versus 18-30). The material of

B. jabirabela at BRI is insufficient to enable

comparison of these latter characters with those

of that species.

The most striking of the outlined

differences are undoubtedly the much shorter

scapes and shorter leaves of B. inopinata when

compared to the other two species, as these

characters impart a distinctive appearance to

the plants.

Key to Queensland species of Borya

1, Leaves 25-50 mm long, minutely scabrous towards apex; scapes 10-24 cm

long; flower heads 18—30-flowered......

ye tras 9 fer tertile alist occu cis este ee B. septentrionalis

Leaves |4—18 mm long, minutely scabrous for entire length; scapes 1.1—1.3

cm long; flower heads 10-15-flowered...

Conservation status: There are no perceivable

threats to Borya inopinata at the current time,

although it is not known to occur in any

conservation reserve. Due to its restricted

occurrence a conservation coding of rare (R), as

defined by the Queensland Nature Conservation

Act 1992 is recommended.

Etymology: The specific epithet ts derived from

the Latin inopinatus (unexpected) and refers to

the unexpected discovery of this new species.

Acknowledgements

Thanks to W. Smith (BRI) for the illustrations,

Y. Smith (BRI) for Map 1, H.A.Dillewaard and

S.J.Fige (both formerly BRI) for assistance in

the field, L.Pedley (BRI) for translation of the

diagnosis into Latin and the owners of Mt

Stewart Range for access.

Peseta nareA ete aptee peat teenies Bb. inopinata

References

CHuRCHILL, D.M. (1987). Borya, InA.S. George (exec. ed.,),

Flora of Australia 45: 268~-279, Canberra:

Australian Government Publishing Service.

DAHLGREN, R.M.T., Cuirrorp, H.T. & YEo, P.F, (1985). The

families of the Monocotyledons, Berlin: Springer-

Verlag.

Garr, D.F. (1981). The biology of resurrection plants. In

J.S. Pate & A.J. McComb (eds.), The Biology of

Australian Plants pp. 114-146. Nedlands:

University of Western Australia Press.

Pate, J.S. (1989). Australian micro stilt plants. Trends in

Ecology and Evolution 4: 45-49.

Rye, B.L, (1992), Family [50 Anthericaceae. In J.R. Wheeler

(ed,), Flora of the Kimberley Region pp. 994-999.

Como: Western Australian Herbarium,

The use of rubisco DNA sequences to examine the systematic

position of Hernandia albiflora (C.T.White) Kubitzki

(Hernandiaceae), and relationships among the Laurales

Effie M. Ablett,! Julia Playford? and Stephanie Mills!

Summary

Ablett,Effie M., Playford,Julia and Muls,Stephanie (1997). The use of rubisco DNA sequences to

examine the systematic position of Hernandia albiflora (C.T.White) Kubitzki and relationships among

the Laurales. Austrobaileya 4(4): 601-607. The DNA sequence of the large subunit of the chloroplast

enzyme, ribulose-1,5-bisphosphate carboxylase/oxygenase (rbcL), has been determined for Hernandia

albiflora and Doryphora aromatica (F.M.Batley) L.S.Sm. (Monimiaceae), Bootstrap analyses of these

sequences and those from related species were carried out using parsimony, distance, and maximum

likelihood methods. Hernandia albiflora 1s very strongly grouped with Hernandia ovigera L. (100%)

in all three analyses, This supports its placement in the Hernandiaceae and not in the Lauraceae. The

analyses also supported traditionally recognised phylogenies. For example, the Laurales are distinct from

other magnoliid orders which are represented in our analyses by Eupomatia and Amborella. Within the

Laurales Hernandiaceae, Lauraceae, Calycanthaceae and Monimiaceae are distinct clades. The molecular

analyses differ from Cronquist (1988) in the inclusion of Idiospermum with the Calycanthaceae

(supported by 99—100% of bootstrap replicates in our analyses), and the weak association of Gyrocarpus

with the Hernandiaceae (supported in less than 65% of bootstrap replicates). Our analyses also suggest

that Doryphora may be in a separate clade from Hedycarya, but this needs to be examined further by the

inclusion of sequence data from more species of Monimiaceae.

Keywords: Calycanthaceae, Hernandiaceae, Lauraceae, Monimiaceae, Doryphora, Hernandia albiflora,

Hernandia ovigera, Eupomatia , Amborella, Gyrocarpus, Hedycarya.

‘Centre for Molecular and Cellular Biology, University of Queensland (current address for EMA:

Queensland Institute of Medical Research)

?Cooperative Research Centre for Tropical Rainforest Ecology and Management and Department

of Botany, University of Queensland.

Introduction

Recently, there has been a blossoming of DNA-

based analyses in studies of plant systematics

and evolutionary genetics. Because of its

fundamental importance in photosynthesis, the

chloroplast enzyme ribulose-1,5-bisphosphate

carboxylase/oxygenase (rubisco), has been

studied extensively throughout the plant

kingdom. The DNA sequence of the large subunit

chloroplast gene (rbcL) has been used to infer

phylogeny in higher plants (Palmer et al. 1988;

Martin and Dowd 1991). Many laboratories

have concentrated their efforts on coordinated

rbcL, sequencing studies (Olmstead et al. 1992;

Duvall etal. 1993: Soltis etal. 1990; and Martin

and Dowd 1991), resulting in a large-scale

analysis of 500 seed plant species (Chase et al.

1993). The results of two separate analyses

show good agreement with the morphological

Accepted for publication 10 April 1996

classification in the placement of taxa in familial

groups.

Hernandiaalbiflora(C.T. White) Kubitzki

is arare plant of north Queensland rainforests.

In the past there has been some doubt as to the

classification of Hernandia albiflora based on

morphological criteria. Hernandia albiflora was

first described by White (1935) as Valvanthera

albiflora (C.T.White), The new monotypic

genus, Valvanthera, was tentatively placed in

the Hernandiaceae, with some reservation,

as some features suggested affinities with

the Lauraceae. It has since been placed in

the Lauraceae (Hutchinson 1964) and

Hernandiaceae (Kubitzki 1969).

We have determined the sequence of the

rbcL gene in Hernandia albiflora and

Doryphora aromatica (F.M.Bailey) L.S.Sm. to

provide information on the position of

Hernandia albiflora. These sequences were

602

analysed using cladistic methods to determine

whether investigation of the evolutionary

changes in DNA will result in a more precise

definition of the phylogenetic position of

Hernandia albiflora and to see if additional

sequences will give more information on the

relationships among the Laurales.

Materials and methods

The phylogenetic position of Hernandia

albiflora and Doryphora aromatica tn relation

to the other Laurales was examined by analysing

the DNA sequences we obtained along with

those obtained by other workers (see Table 1).

Other Magnoliid species (1.e. Eupomatia

bennettii F.Muell and Amborella trichopoda

Baill. sensu Chase et al. 1993) were included to

see if the Laurales were a distinct group, and

Podocarpus gracilior Pilg. was selected as a

remote outgroup.

Sources of DNA samples: DNA was extracted

from leaves of Hernandia albiflora and

Doryphora aromatica, which had been

transported as voucher specimens for up to one

week, and then frozen at -80°C. Additional

leaves from the same samples were identified

and stored as vouchers at the Queensland

Herbarium (see Table | for AQ numbers). Total

cellular DNA was purified using cetyl

trimethylammonium bromide (CTAB) buffer,

chloroform:isoamy! alcohol extraction, and

alcohol precipitation (Doyle and Dickson 1987).

DNA sequencing: The coding sequence of the

rbcL gene was amplified using PCR and primers

based on known conserved regions as described

by Olmstead et al. (1992). In the case of

Doryphora aromatica, these primers gave non-

specific products, and the reverse primer 5’

CTTCACAAGCAGCAGCTAGTTCAGGACTCC

3' (sequence supplied by M.Chase, personal

comm.) was used to amplify 1325 bp of the

coding sequence.

The PCR products were purified using

‘Gene Clean’ (Bresatec) or ‘Magic PCR Preps’

(Promega), and subjected to direct double

stranded dideoxy sequencing using Zurawski

rbcL. sequencing primers (Zurawaski pers. com.

DNAX Research Institute of Molecular and

Cellular Biology). The reverse primers 153R,

346R, 674R, 1020R, and 1375R did not work

Austrobaileya 4(2): 601-607 (1997)

well for these species and the new reverse

primers shown in Table 2 were used for either

manual sequencing with ‘Sequenase Version 2’

kits (U.S. Biologicals) or automated sequencing

with Applied Biosystems ‘model 373A’ and

‘Tag Dye Deoxy Terminator Cycle Sequencing

Kit’. The modified manual protocol involved

heating the annealing mix to 100°C and cooling

in ice (rather than NaOH denaturation), labelling

at O°C with increased concentrations of *°S-

labelled ATP and reduced concentrations of the

other nucleotides; and extension at 45°C. For

automated sequencing, increasing the PCR

annealing temperature from 50°C to 58 °C or 60

°C was found to improve the sequence profile

obtained using reverse primers from 686 to the

3‘ end,

All sequences were aligned by comparison

to the sequence for Hernandia ovigera L. using

‘AssemblyLIGN’ (version 1.0.3, International

Biotechnologies Inc.), and confirmed by reverse

strand sequencing using different PCR

preparations.

Phylogenetic analysis: Three separate analyses

were carried out using completely different

methods to derive trees. Parsimony analyses

were performed using PAUP version 3.1.1

(Swofford 1993). The branch and bound

bootstrap search was used with the following

settings: no upper bound, furthest data addition

sequence, an initial maxtrees setting of 100,

branches having maximum length zero were

collapsed and no topological constraints were

used, Maximum likelihood and distance analyses

were carried out using PHYLIP (Felsenstein

1989) and the Australian National Genomic

Information Service’s Sun 4/670 computer.

Bootstrap analyses (Felsenstein 1985) were

carried out to place confidence levels on the

inferred phylogenies. Bootstrap replicates of

data were generated using ‘seqboot’, and subject

to analysis by “dnadist’ and ‘neighbour’ using

the default settings (with ‘m’ set at 100),

Results of phylogenetic analyses

The results of bootstrap analyses using

parsimony (PAUP), distance (PHYLIP), and

maximum likelihood (PHYLIP) are shown in

Figures |, 2 and 3 respectively.

Ablett, Effie M. et al., Molecular phylogenetics of Hernandia albiflora 603

Table 1. DNA sequences used in this study.

see se cra de id Se oc cca Ee Sa ete en ee at te cenee a ge wnnnee TEESE CESSES cece aeeeeee ee eon Hn de stamina [eh 4

Species Family Voucher No. RbcL sequence source

Start-stop

Amborella trichopoda Amborellaceae A 29-1428 A

Calycanthus chinensis Calycanthaceae A 29-1428 A

Calycanthus floridus Calycanthaceae A 27-1428 A

Chimonanthus praecox Calycanthaceae A 29-1428 A

Eupomatia bennettii Eupomatiaceae A 29-1428 A

Gyrocarpus sp. Hernandiaceae A 27-1428 A

Hernandia ovigera Hernandiaceae A 29-1428 © A

Valvanthera albiflora Hernandiaceae AQ546699 = 27-1428 L77210*

[diospermum australiense Idiospermaceae A 29-1428 A

Cinnamomum camphora Lauraceae A 29-1428 A

Persea americana Lauraceae A 1-1428 A

Doryphora aromatica Monimiaceae AQS546705 = 31-1370 L77211*

Hedycarya arborea Monimiaceae A 29-1428 A

Podocarpus gracilior Podocarpaceae A 1-1428 A

A = see Chase et al. 1993

* = Genebank sequence number

AQ numbers are shown for voucher specimens held at Queensland Herbarium (BRD.

Table 2, New rbcL sequencing primers. New primers based on the sequence of a more closely

related species, Hernandia ovigera. (Genebank L12650).

235R 3S CTC GAT GTG GTA GCA TCG TCC TTT GTA ACG 3'

686R S'TGT CCT TTG ATT TCA CCT GTT TCG GCC 3'

4360R S' ATG CCA TGA GGG CGG CCT TGG AAA GTT 3’

1131R5' TAT GCC AAA CGT GAA TAC CCC CTG AAG 3’

604

All of the analyses gave similar

cladograms. In each case Amborella and

Podocarpus were excluded from the Laurales

group in 98% or 100% of the bootstrap replicates.

Austrobaileya 4(2): 601-607 (1997)

When Eupomatia was included (Figs 1, 2) it

was only loosely associated with the Laurales,

and this reflects the taxonomic classification of

the Magnoliales and the Laurales in

Magnolitidae.

a ee Aupomatia

___100_p>~ Hernandia ovigera

59 —— Hernandia alb iflor a

7 98 soit Gy rocarpus

a - Calycanthus floridius

100 | Calycanthus chinensis

a 100 Chimonanthus

- [diospermum

100 -- Cinnamomum

— Popseg

— Doryphora

——_——_—— Amborella

Podocarpus

Fig. 1, Parsimony analysis of rbcL sequences, The 50% majority tree of a 100 replicate bootstrap analysis is shown.

Confidence estimates of groups are indicated by the numbers (percentage of bootstrap replicates with that particular group).

See Table | for species information.

100 ~~ Hernandia ovigera

Hernandia albiflora

100 Sine

_ 100 ———— Gyrocarpus

ar Calycanthus floridus

100 | Calycanthus chinensis

91} 100 . Chimonanthus

—— [dig spermnun

93 -- Cinnamomum

| L_—_ Persea

| Periticin

ee ee edycarya

— Amborella

Podocarpus

Fig, 2, Distance analysis of rbcL sequences, The 50% majority tree of a 100 replicate bootstrap analysis is shown.

Confidence estimates of groups are indicated by the numbers (percentage of bootstrap replicates with that particular group).

See Table 1 for species information.

sella Sur si line ety egg nae a? 3 tibbettibte dette dedodeHedede desis. hg

Ablett, Effie M. et al., Molecular phylogenetics of Hernandia albiflora 605

Within the Laurales, similar associations

resulted from all three analyses.

As in the analyses of Qui et al. (1993), the

Laurales fall into four distinct clades which also

reflect traditional classification: (1) Hernandta/

Gyrocarpus, (11) Calycanthaceae (Calycanthus

floridus L., Calycanthus chinensis Cheng.

& S.T.Chang and Chimonanthus praecox (L.)

Link/ldiospermum australiense (Diels)

S.T. Blake), Git) the Lauraceae (Cinnamomum

camphora (L.) T.Nees & Eberm. and Persea

americana Mill.) and (iv) Hedycarya. In our

parsimony and maximum likelihood analyses,

Doryphora appeared as a fifth clade distinct

from the other Monimiaceae species, Hedycarya.

The association of Doryphora with the

Lauraceae in the distance analysis is only weakly

supported (719%).

Hernandia albiflora 1s very strongly

grouped with Hernandia ovigera (100%) in all

three analyses, This strongly contradicts its

placement in the Lauraceae.

Discussion and implications

Evolution is ultimately a process resulting from

changes in the sequence of DNA in the genome.

Until recently, genetic alterations could be

inferred only from the phenotype. Now, with the

advent of molecular taxonomy, changesin DNA

sequence can be used to monitor evolutionary

changes directly, rather than inferring changes

from the resultant morphological end-points.

Molecular systematics has the potential to infer

phylogeny where there are gaps in the gradation

of morphological features in living and fossil

Species.

Using this approach, we have analysed

DNA sequence data from relic species to

investigate relationships within the Laurales.

All analyses presented here provide strong

evidence (100% of bootstrap replicates) that

Hernandia albiflora belongs in Hernandiaceae

and notin Lauraceae. We have undertaken three

different types of analysis (parsimony, distance,

and maximum likelihood), and obtained

concordant results, both for the placement of

Hernanaia albiflora and the groupings within

the Laurales. These analyses are also concordant

with those of Chase et al. (1993) and Qui et al.

(1993), which reflect traditionally recognised

phylogenies. For example, the Laurales

are distinct from other Magnoliid orders

(represented in our analyses by Eupomatia

and Amborella). Within the Laurales the

Hernandtaceae, Lauraceae, Calycanthaceae and

Monimiaceae are distinct clades. Also, with a

small set of species we were able to use much

more rigorous analyses and present further

verification of the large analyses of Chase et al.

(1993) and Qui et al. (1993).

The molecular analyses digress from

Cronquist (1988) in the inclusion of

[diospermum with the Calycanthaceae

(supported by 99% to 100% of bootstrap

replicates in our analyses), and the weak

association of Gyrocarpus with the

Hernandiaceae (supported 1n less than 65% of

bootstrap replicates). This indicates that

Gyrocarpus could be a sister group to the

Hernandiaceae.

Our analyses also suggest that Doryphora

aromatica may be in a separate clade from

Hedycarya arborea J.R.Forst & G.Forst., and

raise the possibility that the Atherospermataceae

are more closely related to the Lauraceae than

to the other Monimiaceae sub-groups. This

needs to be examined further by the inclusion

of sequence data from more species of

Monimiaceae.

We have presented some preliminary

findings that indicate analysis of rubisco DNA

sequences can be used to define the systematic

position of species such as Hernandia albiflora

where the classification is in doubt. Rubisco

sequencing can also be used to investigate

relationships among relic species.

This approach should be particularly useful

when dealing with primitive taxa extinction

because of species makes it difficult to interpret

evolutionary relationships using morphological

features. Phylogenetic relationships may be

better understood by molecular analysis of the

remaining taxa.

It is important to sequence the remaining

relic taxa in order to investigate their

phylogenetic relationships.

606 Austrobaileya 4(2): 601-607 (1997)

Amborella

100 Hernandia ovigera

65. —. Hernandia albiflora

Gyrocarpus

Doryphora

100 Persea

100 Cinnamomum

Hedycarya

Calycanthus floridus

- [diospermunt

Podocarpus

Fig. 3, Maximum likelihood analysis of rbcL sequences, The 50% majority free of a 100 replicate bootstrap analysis is

shown, Confidence estimates of groups are indicated by the numbers (percentage of bootstrap replicates with that particular

group). See Table 1 for species information,

Acknowledgments

We thank Rupert Russell (Q.NPWS, Mossman)

and Brisbane Botanic Gardens for help in

obtaining plant material, Gordon Guymer for

his advice on the selection of species, the

Queensland Herbarium for identification and

storage of voucher specimens, Gerard Zurawski

and the DNAX Research Institute of Molecular

and Cellular Biology Inc. for their generous gift

of sequencing primers, and Mark Chase for

access to unpublished manuscripts, DNA

sequences and technical advice. This research

was supported by a University of Queensland

Re-entrance Scholarship.

References

CHASE,M.W., etal. (1993). Phylogenetics of seed plants: an

analysis of nucleotide sequences from the plastid

gene rbcL. Annals of the Missourt Botanical Garden

80: 528-580.

CRONQUIST, A. (1988). The Evolution and Classification of

Flowering Plants. The New York Botanical Garden,

New York.

Doy _e, J.J., & Dickson, E.E. (1987). Preservation of plant

samples for DNA restriction endonuclease analysis.

Taxon 36: 715-772.

Duvatt, M.R., et al. (1993). Phylogenetic hypotheses for

the monocotyledons constructed from rbcLsequence

data. Annals of the Missouri Botanical Garden 80:

607-619,

FELSENSTEIN, J. (1985). Confidence limits on phylogenies:

an approach using the bootstrap. Evolution 39:

783-79 1.

—— (1989), PHYLIP — Phylogeny Inference Package

(version 3.2) Cladistics 5: 164-166,

Hurcuinson, J. (1964). Valvanthera. In The Genera of

Flowering Plants. Volume [:, pl43. (Oxford

University Press: Oxford)

Kusitzkt, K. (1969), Monographie der Hernandiaceen. Bot.

Jahrb. Syst, Pflanzengesch. Pflanzengogr. 89:

78-148,

Martin, P.G., & Down, J.M. (1991). A Comparison of [8s

Ribosomal RNA and Rubisco Large Subunit

Sequences for Studying Angiosperm Phylogeny.

Journal of Molecular Evolution 33 (3): 274-282.

fede eset ccc ve 4 vt Dees ey slp re ea eV YS sheen

Ablett, Effie M. et al., Molecular phylogenetics of Hernandia albiflora 607

OLMSTEAD, R.G., MICHAELS, H.J., Scotr, K.M., & PALMER,

1.D.(1992). Monophyly of the Asteridae and

identification of their major lineages inferred from

DNA sequences of rbcL. Annals of the Missouri

Botanical Garden 79: 249-265.

PALMER, J.D., JANSEN, R.K., MICHAELS, H.J., CHASE, M,W.,,

& MANHART, J.R, (1988). Chloroplast DNA variation

and plant phylogeny. Annals of the Missouri

Botanical Garden 75: { 180-1206.

Qui, Y.L., CHASE, M.W., Les, D.H., & Parkss, C.R., (1993).

Molecular phylogenetics of the Magnoliideae: A

cladistic analysis of nucleotide sequences of the

plastid gene rbcL, Annals of the Missourt Botanical

Garden 80: 587-606.

Sots, D.E., Soitis, P.S., CLecc, M.T., & EpGerron, M.L.,

(1990). rbcL sequence divergence and phylogenetic

relationships in Saxifragaceae sensu lato.

Proceedings of the National Academy of Sciences

U.S.A, 87: 4640-4644,

SWOFFORD, D.L., (1993), PAUP: Phylogenetic Analysis

Using Parsimony, Version 3.1. Computer program

distributed by the Illinois Natural History Survey,

Champaign, Illinois.

Wuirte, C.T. (1935). Contribution to the Queensland Flora,

No, 5. Proceedings of the Royal Society of

Queensland 47: 76-77.

petbbbscibea siete aise aie ta ate ate fe remeuaies eta ted f Tete we bd owe Be ee et ie tte

Acomis bella (Asteraceae: Gnaphalieae), a new species from

north Queensland

Ailsa E.Holland

Summary

Holland, Ailsa E. (1997), Acomis bella (Asteraceae, Gnaphalieae), anew species from north Queensland.

Austrobaileya 4(4): 609-612. Acomis bella is described and illustrated, notes are provided on its habitat

and distribution, and a key to all species of Acomis F.Muell. recognised is provided.

Keywords: Asteraceae. Gnaphalieae, Acomtis bella, Acomis macra, Acomis kakadu, Acomis lesteri,

Acomis acoma.

Ailsa E. Holland, Queensland Herbarium, Meiers Road, Indooroopilly Queensland 4068, Australia

Introduction

Acomis F.Muell. is an Australian genus of 4

species, namely A. acoma (F.Muell) Druce,

A. macra F.Muell., A. kakadu Paul G.Wilson

and the new species, A. bella (A. lesteri Burkhill,

is here considered to be conspecific with

A. macra). According to Paul G. Wilson (1992),

‘the name Acomis was published by F.Mueller

in 1864 and validated along with Acomts macra

by a genero-specific description...’ and so the

type of the genus 1s Acomis macra. The new

species A. bella is most closely related to

A. macra and A. kakadu (see notes and key to

species). The problem of generic limits, as

noted by Anderberg (1991) and Paul C. Wilson

(1992), will be dealt with elsewhere.

Acomis bella A.E.Holland, sp. nov. affinis

Acomidi macrae F.Muell. a qua foliis et

bracteis involucralibus latioribus,

stylorum apicibus elongatis, absentia

flosculorum femineorum et cypselae

pagina minute conice papillosa,

differt. Typus: Queensland. CooKk

District: 2.5 km from Dixie Station on

the track to the Laura to Musgrave road,

15°OS’S, 143°19°E, 4 June 1989,

JR. Clarkson 8138 & V.J.Neldner (holo:

BRI; iso: AD, BRI [spirit], DNA, K, L,

MBA, MEL, MO, NSW, QRS).

Erect or ascending annual herb. Stem initially

very short with a rosette of leaves and erect

Accepted for publication 26 April 1996

peduncles, later elongating and ascending to

17 cm long. Branches slender, densely white

cobwebby hairy. Leaves sessile, initially forming

a rosette, later alternate and reducing in size

towards apex, linear, |1.4—10.0cm long, 1.0-2.2

mm wide, entire, subulate at apex with both

surfaces densely white cobwebby hairy, 1-

veined. Inflorescence mainly in upper axils;

peduncles 2—22 cm long, densely white

cobwebby hairy, withoutscales; capitula solitary,

hemispherical, 7.0-13.0 mm diam., with 3 or 4

rows of involucral bracts and 60-80 florets.

Involucral bracts homomorphic, clawed; claw

oblong, woolly hairy except on innermost bracts,

sparsely covered with short glandular hairs,

completely filled with a brown flat stereome,

0.8—1.2 mm long, 0.7—1.4 mm wide, with c. 3

vascular strands branched and looped at apex;

lamina separated from claw by a fold, obovate,

2.5-4.0 mm long, 1.2—3.0 mm wide, obtuse,

entire, scarious, glabrous, pale yellow-brown,

translucent. Receptacle a hemispherical dome,

1.5 mm high, 2.2-3.0 mm diam., glabrous.

Florets all bisexual, actinomorphic, equalling

the involucre. Corolla4.0-4.6 mm long, yellow;

proximally cylindrical, 2.4—-2.6 mm long,

moderately glandular hairy; distally

campanulate, 1.6—2.0mm long, with 5 triangular

lobes c. | mm long; vascular strands extending

nearly to tips. Anthers c. 1.5 mm long; apex

narrowly triangular, c. 0.5 mm long, subacute;

collar c. 0.2 mm long; tails absent. Style arms

elongate and tapered at apex, 1.0-1.3 mm long,

prominently papillose in distal 2/3; stigmatic

patches in proximal 1/3. Cypsela obovoid,

610

0.9-1.2 mm long, c. 1 mm wide, rounded at

apex; pericarp densely covered with minute

conical dark brown papillae interspersed with

large clear globose 2-celled tubercles; vascular

strands 2; seed free from pericarp; testa

membranous; pappus absent. Fig. 1.

Additional specimens examined: Queensland. Cook

District: c. 8 km SE Bramwell, 12°11’S, 142°40°E, Aug

1991, Clarkson 9111 (BRI, QRS); Bramwell turnoff on the

Cape York Development road, 12°13’S, 142°35’E, Aug

1987, Clarkson 7340 (BRI + spirit, QRS); just E of Myall

Creek on the road from Weipa to Sudley, [2°39’S, 142°16’E,

Aug 1983, Clarkson 4889 (BRI, QRS); 2.5 km from

Lakefield to Musgrave road, on the track to Low Lake,

14°37’°S, 143°54°E, Aug 1987, Clarkson 7325 (BRI,

QRS); 8.6 km W of the Morehead River crossing on the

track west from Breeza Plains to Fifteen Mile Creek,

14°49’S, 143°50’°E, Sep 1983, Clarkson 5016 (BRI, QRS);

4.9km NW of Alice River crossing on the track from Kimba

to the New Dixie-Oroners road, [5°24’S, 143°15’E, Jun

1981, Clarkson 3756 (BRI, QRS). 31 miles [49.6 km] from

Moreton Telegraph Stn, Aug 1968, Giffins 1871 (BRI).

Distribution and habitat: Queensland. Cook

District: A. bella occurs on Cape York

Peninsula from as far north as Bramwell south

to the Alice River. A. bella occurs on pink or

white sand or fine sandy loam tn open woodland

dominated by Melaleuca viridiflora Sol. ex

Austrobaileya 4(4): 609-612 (1997)

Gaertn., M. leucadendra (L.)L., Corymbia

confertiflora (F.Muell.) K.D.Hill &

L.A.Johnson, £. tetrodonta F.Muell. or

Corymbia clarksoniana (D.J.Carr &

§.G.M.Carr) K.D.Hill & L.A.S Johnson. It often

appears after fire.

Notes: A. macra and A. kakadu are similar to

A. bellainthe annual habit, the linear leaves, the

hemispherical receptacle, the glandular hairy

corolla tube and the absence of anther tails.

Differences are given in the key.

Phenology: Flowers from June through to

September. The plant flowers profusely from an

early stage before the stem begins to elongate,

and continues to do so throughout its life.

Conservation status: ‘This species is locally

common although presently known only from

seven localities. [tis not considered to be rare or

threatened.

Etymology: The species epithet is derived from

the Greek bella meaning ‘beautiful’, areference

to the beautiful yellow flowers which carpet the

ground in spring.

Key to species of the genus Acomis

1. Subshrubs; leaves ovate to lanceolate; receptacle slightly convex; corolla

tube glabrous (SE QLD, NENSW) .....

Annuals; leaves linear or filiform; receptacle conical or hemispherical;

corolla tube glandular hairy ...........

2. Bracts white, opaque; receptacle white-villous; inflorescence corymbose

CN ay a u28 pole eu aruak A oon tieh ewe eann tuple ate

¥ Fy §&©§ © © &6© &© #© #§ #£ 48 &£¢ & #£ © &£ &£& © ££ ££ FF ££ #£ #£ #£ #£ ££ &

Bracts pale yellow or brown, translucent; receptacle minutely hairy or

glabrous; capitula solitary (QLD).......

3. Leaves filiform, less than | mm wide; female florets present; style apices

truncate; cypsela surface shiny, tuberculate (SW QLD) ...................

Leaves linear, 12.2 mm wide; female florets absent; style apices tapered;

cypsela surface covered with minute conical papillae interspersed with

large globose tubercles (N QLD) .......

6l!

+ aa

ee ol

La aa

ee)

* — on

— uh owe

* a i

eel - a

”

* ha -yi home=— M, ~

HO a alien melas lial te ee

0 ph me ell lg

* *

+ ” * Pr)

* we *

* -

a i

LAO ee

ate Th ooh ae ar, _

ad)

ld Md

;’" dae ey eee eee Pe a ig a hy

or te wae ek tao ills il AA iden Hy Hay z

7” erie +e ree h * Sa te ed

Le Weta Ce at LLM of adele dete ol lade dat tie madd honk Lael

"TSS EP tte TL] Poet ates ie ee ee ee eae

ad > ie > or .

a ow mo a ee ee <= St,

hd %.

* * cee

a +

s bella

Pel Lie a

Pageant PT ee te ee eee ed 1288 geet al a

Vig. 1. Acomis bella, A. habit x 0.4. B. capitula x 4. C, receptacle x 8. D. intermediate involucral bract x 8. E. floret x 20.

F, anther x 20, G. style arms x 40, H. cypsela surface x 48. All drawn from the type specimen. Del. W.Smith.

Holland, Acom

612

Note: Burkill (1901) distinguished his species

A. lesteri from A. macra by its moderately

tomentose branches. A. macra has nearly

glabrous branches. Domin (1929) judged that

Acomis lesteri Burkill was a variety of A. macra,

distinguished only by the more dense

indumentum (but never very dense) and the

shorter leaves. I have examined the type

specimen of A. /esferi and specimens of both

taxa at BRI. The specimens are variously hairy,

glabrescent or glabrous except for a few hairs in

the axils and I have found no other differences.

I therefore agree with Domin that A. /esteri 1s

conspecific with A. macra.

Acknowledgements

Iam grateful to John Clarkson for bringing this

new species to my attention and for providing

habitat information. I also thank Will Smith for

the illustrations and Peter Bostock for the Latin

diagnosis.

Austrobaileya 4(4): 609-612 (1997)

References

ANDERBERG, A, (1991). Taxonomy and phylogeny of the

tribe Gnaphalieae (Asteraceae), Opera Bot. 104:

[—195.

Burkiu, LH. (1901), Decades Kewensts 34-35 Bull, Misc.

Inform. 140-141.

Domin, C. (1929). Acomis, Biblioth. Bot. 22 (89): 1230.

WILson, Paul G, (1992). A new species of Acomis from the

Northern Territory and a new combinatton in the

genus Tiseltonia (Ateraceae: Gnaphalieae). Nuytsia

8(3): 479-483.

pita antar tater te naa nme ncaa Ra

as a wh ss tn A NMA A tt tm a 0

A new subspecies of Caustis blaket Kuk. in Queensland

Margaret E. Johnston, John T. Swarbrick, Alan H. Wearing &

Julie H. Webber

Summary

Johnston, Margaret E., Swarbrick, John T., Wearing, Alan H. and Webber, Julie H. (£997). A new

subspecies of Caustis blakei Kiik. in Queensland. Austrobaileya 4(4): 613-617. Caustis blakei Kiik. ts

divided into two subspecies that are geographically isolated. C. blakei subsp. ntacrantha subsp. nov.,

occurs inland near Murphy’s Creek and Heltdon, south-east Queensland. It has larger anthers, spikelets

and fruit than C. blakei subspecies blakei, which occurs in coastal districts and on islands in south-east

Queensland. Notes on distribution and conservation status are provided,

Keywords: Caustis blakei, Caustis blakei subsp. macrantha, Caustis blaket subsp. blakei.

Margaret E. Johnston, John T. Swarbrick, Alan H. Wearing and Julie H. Webber, Department of Plant

Production, The University of Queensland Gatton College Lawes Queensland 4343, Australia

Introduction

The original description of C. blakei was a

verbatim manuscript description written by

Ktikenthal and published by Blake (1943).

Kiikenthal (1944) subsequently published a more

detailed description and corrected some of the

errors made earlier. However, all specimens

examined by Kiikenthal (1944) were collected

from coastal areas of south-east Queensland.

Brief descriptions of C. blakei and keys to the

Queensland and New South Wales spectes of

Caustis have since been presented by Sharpe

(1986), Beadle (1987), Stanley and Ross (1989)

and Wilson (1993).

Materials and methods

Vegetative morphology of C. blakei was studied

in five mature plants that were collected at

random at each of 12 sites in south-east

Queensland in October 1991. Ten sites were

located on the Sunshine Coast and there were

two inland sites: Murphy’s Creek and Helidon.

Spikelets were collected from plants at each of

these sites in early February 1992. Stem pieces

with spikelets were collected from four randomly

selected plants at each site and from two

individual stems on each plant, one with young

and one with old spikelets. Stem pieces were

stored in 95% ethanol mixed with 5% glycerol

a a F

Accepted for publication 19 April 1996

until examined. Three spikelets from each stem

were dissected and measured. Data was collected

on the length of the spikelet and the number of

glumes it possessed together with the lengths of

its style, stigma, anther, ovary and gynophore.

Spikelet morphology was further studied

in January 1994 using the material collected in

February 1992. Six spikelets with protruding

anthers were selected from each of four stems

trom each of the [2 sites. Lengths of spikelets

and anthers (with apical appendage) were

measured.

A total of twenty mature fruit was collected

from plants at five sites in October 1992, The

total weight of 10 fruits was recorded and the

lengths of 20 fruit were measured with and

without the beak (base of the style).

Analyses of variance were computed for

each character at each site using the general

linear model analysis of variance. The

association between floral characters and sites

was investigated using the Bray and Curtis

Option in the statistical package PATN (Belbin

1990a & 1990b).

Results

Distribution of Caustis blakei

Figure 1 shows the distribution of C. blakei,

based on the localities listed on specimens from

614

452°

Bundaberg o

QUEENSLAND -¢ 26°

bet, 4

x baovd Brisbane

ooOWOOMDAS "Helidon W

(

28°

NEW

SOUTH °. 30°

WALES

Kempseyo

32°

Gosford

Fig. 1. Distribution of Caustis blakei subsp. blakei « ;

C. blakei subsp. macranthay .

Austrobaileya 4(4): 613-617 (1997)

all State herbaria. Caustis blaket occurs on

mainland Australia from Toolara near

Maryborough in Queensland to Crowdy Bay or

possibly Gosford in New South Wales. It also

occurs on Fraser, Moreton and Stradbroke

Islands, Queensland. There are inland

populations of this species at Murphy’s Creek

and Helidon in Queensland. These are

geographically isolated from coastal populations

of C. blakei. Another population of it, at

Diana’s Bath near Esk in Queensland, is

geographically between the inland and coastal

populations. However, a recent inspection of

the Diana’s Bath population has shown it to be

similar morphologically to the coastal form

with its small spikelets and anthers.

Floral morphology

A study of floral morphology in specimens of

C. blakei collected from 12 sites in south-east

Queensland showed the spikelets collected from

the inland populations at Murphy’s Creek and

Helidon, east of Toowoomba, had significantly

larger (P<0.01) spikelets and anthers than those

collected from coastal sites (Table 1, Figure 2).

The mature fruit collected from the Murphy’s

Creek site were significantly larger (P<0.01)

and heavier than those collected from coastal

sites at Fraser Island heath or State Forest 451,

Tuan and Coop’s Bridge (Table 1, Figure 2).

No fruit were collected at the Helidon site.

The association between floral characters

and sites was investigated using the Bray and

Curtis option in the statistical package PATN

(Belbin 1990a &1990b). The dendrogram

obtained (Figure 3) suggested that spikelets

collected from Murphy’s Creek and Helidon

were morphologically similar to each other but

different from spikelets collected from any

coastal site.

The differences in the lengths of spikelets,

anthers and fruit of C. blakei collected from

coastal and inland populations cannot be clearly

observed by examination of herbarium

specimens, as anthers and spikelets on dry

specimens deteriorate over time. Some immature

fruit can be seen on herbarium specimens of

C. blakei but fruit fall from plants when mature,

so are not widely represented in any herbarium

specimen we have seen.

Johnston, et al., Caustis blakei

Taxonomy

Caustis blakei Ktik. in Blake, Proc. R. Soc. Od

54(8):71 (1943). Type: Queensland.

Moreton District: On Moreton Island

near The Big Sandhill, on hillside on sand,

in mixed open forest, 11 September 1938,

Blake 13845 Gso:BRD.

Stems rigid, erect, smooth, with 10-28 nodes,

up to 2 m tall, 2.5-5.0 mm in diameter. Leaves

of mature plants reduced to dark brown sheathing

scales with pointed apices. Vegetative nodes

10-18 per stem, each with 1-6 lateral branches,

615

the ultimate branchlets (sterile pedicels) straight

or slightly flexuose, rarely more than 0.4 mm

wide, either dense and hiding the rachis or

sparse and open. Young flowering branches

contracted, flexuose, narrow; branches and

branchlets eventually expanding; spikelets 1 to

about 1000 per inflorescence, 6-11 mm long,

usually 1-flowered, bisexual; glumes 3-6, dark

brown, long acuminate; stamens 3; anthers 3-6.5

mm long; style 3-fid. Mature nut black to dark

brown, including beak 6-9 mm long, without

beak c. 4-6 mm long.

The species is represented by two subspecies.

Key to the subspecies of Caustis blakei

|. Spikelets 6—8 mm long, anthers including appendage 2.5-4.5 mm long;

fruit including base of the style 6-7.5 mm long.......... C. blakei Kiik. subsp. blakei

Spikelets 8.5—11 mm long, anthers including appendage 4.5-6.5 mm long;

fruit including base of style) 7-9 mm long............... C. blakei subsp. macrantha

Caustis blakei Ktik. subsp. blakei

Selected specinens examined: Queensland. WIDE Bay

District: Cooloola National Park, 16 km north of Noosa

Heads and 3 km north of track leading to Teewah Landing

Stage to beach, October 1978, Sharpe 2430, (BRI). Wine

Bay District: Knifeblade sandblow, c. 1.5 km south-east of

Deep Water Lake Fraser Island, July 1986 Briggs 7995,

(BRD.

Habitat: C. blakei subsp. blakei occurs in tall

to very tall Eucalyptus forests with sparse to

closed canopies, on sandy soils or soils derived

from weathered sandstone. The canopy

species usually included Eucalyptus pilularis

Sm. (= &£. racemosa Cav.), Corymbia intermedia

(R.Baker)K.D.Hill & L.A.S. Johnson and/or

E. signata F.Muell.

Caustis blakei subsp.macrantha M.E. Johnston

& J.H.Webber, subspecies nova a Caustis

blakei Kuk. subsp. blaket spiculis 8.5—11

(non 6-8) mm longis, antheris 4.5-6.5

(non 2.5—4.5) mm longis, et fructibus 7—9

(non 6-7.5) mm longis differt. Typus:

Queensland. Moreron District: College

Timber Reserve, Murphy’s Creek,

(27°26'’S, 152°06’E) 08 January 1996,

M.E.Johnston & J.H. Webber [AQ597234}

(holo:BRI; iso:NSW).

Habitat: C. blakeisubsp. macranthaoccurs in tall

Eucalyptus forests with sparse canopy on soils

derived from weathered sandstone. The canopy

Species are Eucalyptus acmenoides Schauer,

E, baitleyana F.Muell. and Corymbiatrachyphloia

(F.Muell.)K.D.Hill & L.A.S.Johnson or

FE, pilularis and E. planchoniana F.Muell..

Conservation status: Substantial quantities of

C. blakei are bush-harvested from both coastal

and inland populations and exported as cut

foliage. Caustis blakei is fire-sensitive and

regenerates from soil-stored seed. Whereas

C. blakei subsp. blakei is common in coastal

areas, with large populations in World Heritage

areas and national parks, there are no national

parks in the Murphy’s Creek or Helidon areas

Where C. blakei subsp. macrantha occurs.

Furthermore, inland areas have much lower

rainfall and this lowers growth rates and increases

fire risk, The inland subspecies is under pressure

from urban and quarry developments, frequent

bushfires and harvesting and warrants a

conservation coding of 2Vi according to the

criteria of Briggs & Leigh (1988).

616 Austrobaileya 4(4): 613-617 (1997)

X Y. % 17t8 a x y

Fig. 2. A~D. Caustis blakei, A comparison of spikelets, anthers and fruit from Murphy's Creek and Fraser Island heath (7.5

times actual size); A-B. C, blakei subsp. macrantha, C-D. C. blakei subsp. blaket,

0.0267 0.0407 0.0546 0.0686 0.0825 0.0965

! | ! |

1) _

4) }

2)_

5) |

3 ) !

9) !

1D}

7) !

8 ) |

11) of

12) | :

t i § j

0.0267 0.0407 0.0546 0.0686 0.0825 0.0965

Fig. 3. Caustis blakei. The association between floral characters and sites of collection. Spikelets collected from the

inland sites of Murphy’s Creek and Helidon (listed as sites 11 and 12 on the y-axis) were similar to each other but

dissimilar to spikelets collected from any coastal sites (listed as sites 1 to 10 on the y-axis).

Johnston, et al., Caustis blakei 617

Table 1. Caustis blaket Mean length of mature spikelets and anthers (with apical appendage)

of plants collected from all sites and mean length of mature fruit (with and without a beak).

Site Mean Mean Mean Mean Weight of

a ep ee ee eee ee

tiie br ddeiiu ele pete * whee" ale d

The authors acknowledge the generous

assistance of Philip Sharpe and Rod Henderson

of the Queensland Herbarium, the capable

technical assistance of Sherrie Hill, and Lester

Pahl who assisted with the analysis.

References

BEADLE, N.C. W, (1987). Students Flora of North Eastern

New South Wales Part VI -Angiosperms: Families

171-214. University of New England: Armidale.

BELBIN, L. (1990a). PATN: A User’s Guide. Division of

Wildlife and Ecology, Commonwealth Scientific

and Industrial Research Organisation: Canberra.

— (1990b),. PATN: A Technical Reference. Division of

Wildlife and Ecology, Commonwealth Scientific

and Industrial Research Organisation: Canberra.

BLAKE, 5.1. (1943). Notes on Australian Cyperaceae, VI.

Proceedings of the Royal Society of Queensland

54(8):69-772.

length of length of anthers length of length of ten fruit (g)

spikelets (with apical fruit(Qmm) fruit without

(mm) appendage (mm) beak (mm)

Fraser Is. heath 7.38 3.97 6.68 4.60 0.149

Fraser Is. forest 5 7.30 3.59 - - -

Fraser Is. forest 4 7.49 3.48 - - -

State Forest 451 7.80 3.69 7.50 ».10 0.152

Tuan 7.61 4.13 6.88 4.75 0.146

Dinna Creek 7 A2 3.77 “ - -

Toolara 741 3.60 - - -

Coop’s Bridge 7.91 3.72 7.03 5.25 0.152

Noosa Parklands 1.29 3.29 - - -

Landsborough Rd = 7.49 4.12 - - -

Murphy’s Creek 939 5.81 7.95 5.35 0.235

Helidon 9.66 5.92 - - -

LSD 0.05 0.32 0.30 0.30 0.44 -

LSD 0.01 0.42 0.40 0.40 Q.59 -

Acknowledgements

Briaos, J.D, and Letcu, J.H. (1988). Rare or Threatened

Australian Plants. Revised Edition, Australian

National Parks and Wildlife Service Special

Publication No, 14. Canberra: Australian National

Parks and Wildlife Service,

KUKENTHAL, G, (1944), Vorarbeiten zu einer Monographie

der Rhynchosporoideae. XIV. Feddes Repertorium

53:85—100.

SHARPE, P.R. (1986). Keys to Cyperaceue, Restionaceae

and Juncaceae of Queensland. (Queensland

Department of Primary Industries: Brisbane).

STANLEY, T.D. and Ross, E.M. (1989). Flora of South

Eastern Queensland, Vol, 3. Queensland

Department of Primary Industries: Brisbane,

Wizson, K.L. (1993), Cyperaceae. In Flora of New South

Wales Voi 4. (Ed. G.J. Harden), NSW University

Press: Kensington, NSW.

A taxonomic revision of Austrobuxus Miq. (Euphorbiaceae:

Dissiliartinae) in Australia

Paul I. Forster

Summary

Forster, Paul I, (1997). A taxonomic revision of Austrobuxus Miq. (Euphorbiaceae: Dissiliartinae) in

Australia. Austrobaileya 4(4): 619-626, The genus Austrobuxus Miq. in Australiais revised, Two species

are recognised, A, swainii (Beuzev. & C.T.White) Airy Shaw and A. megacarpus P.I.Forst., sp. nov. The

name A. nitidus Miq. has been misapplied to A. megacarpus.

Keywords: Austrobuxus megacarpus, Austrobuxus nitidus, Austrobuxus swaintt, Euphorbiaceae;

Australia; Malesia.

Paul I. Forster, Queensland Herbarium, Meiers Road, Indooroopilly Queensland 4068, Australia

Introduction

The genus Austrobuxus was described by Miquel

(1861) and based on the Malesian species

A. nitidus Mig. Taxa of Austrobuxus have been

found subsequently elsewhere in Malesia,

Australia and Melanesia, with the greatest

concentration of taxa presentin New Caledonia

(Airy Shaw 1971, 1974; Smith 1981; McPherson

& Tirel 1987). Plants of this genus are dioecious

trees or rarely shrubs. Austrobuxus was included

both by Levin & Simpson (1994) and Webster

(1994) in Euphorbiaceae subfamily

Oldfieldioideae K6hler & Webster, tribe

Caletieae Mill.Arg., subtribe Dissiliariinae Pax

& Hoffm., together with Canaca Guillaumin

Gncluded within Austrobuxus by Levin and

Simpson (1994)), Choriceras Baill., Dissiliaria

F.Muell. ex Baill., Longetia Baill. and

Whyanbeelia Airy Shaw & B.Hyland. This

subtribe also includes Sankowskya P.I.Forst.

(Forster 1995).

A macromorphological comparison of

Austrobuxus with the other genera in the subtribe

has been given by Forster (1995). Austrobuxus

is distinctive within the Dissiliarlinae most

notably by the conspicuous arilloid caruncle on

its seed. Levin & Simpson (1994) performed a

number of cladistic analyses of Austrobuxus,

Choriceras, Dissiliaria, Longetia and

Accepted for publication 22 March 1996

Whyanbeelia based on palynological,

vegetative and reproductive characters and

found that Austrobuxus was most closely

related to Dissiliaria within the Dissiliariinae.

The current distribution of the extant

species of Austrobuxus indicates that the genus

is of ancient origin with the extant species found

inrainforestrefugia (Australia, New Caledonia,

New Guinea) or derived habitats (e.g. ultramafic

soils in Malesia and New Caledonia) (Airy

Shaw 1971, 1974; McPherson & Tirel 1987).

The genus was undoubtedly more widespread

in Australia as some fossil Euphorbiaceous

pollen from tertiary deposits in south-east

Australia is thought to belong to the genus

(Martin 1974).

The first Australian species described that

is now referable to Austrobuxus is that by de

Beuzeville and White (1946) as Longetiaswainii

from north-eastern New South Wales material.

Longetia was subsequently restricted in its

circumscription to the single species L. buxoides,

whichis endemic in New Caledonia (Airy Shaw

1971; McPherson & Tirel 1987), by transfer of

L. swaini to Austrobuxus by Airy Shaw (1971).

A second species, referred to as A. nitidus, was

later added to the Australian flora by Airy Shaw

(1980) with the comment ‘I cannot distinguish

this plant from narrow-leaved forms of the

common A. nitidus of Malaya, Sumatra and

Borneo. The disjunction in distribution of nearly

620

3840 km between East Indonesian Borneo, the

nearest otherwise known locality, and this

North Queensland population is remarkable’.

Airy Shaw (1981) subsequently provided

descriptions of both taxa for his conspectus of

Australian Euphorbiaceae; however, much of

his descriptive detail for “A. nitidus’ appears to

be based on Malesian collections. The north-

east Queensland populations of Austrobuxus

are not conspecific with A. nitidus and are

described as a new Species 1n this paper.

Materials and methods

This revision is based on herbarium material in

AD, BO, BRI, CANB, CBG, L, MEL, NSW and

ORS, and field observations and collections by

the author.

Indumentum cover is described herein

using the terminology of Hewson (1988), except

that ‘scattered’ is preferred to ‘isolated’.

Common abbreviations in the specimen

citations are N.P. (National Park), L.A. (Logging

Area), S.F. or S.F.R. (State Forest or State

Forest Reserve) and T.R. (Timber Reserve).

AQ numbers refer to the computerised collection

number situated on the sheet and/or the label of

specimens housed in the Queensland Herbarium

(BRI).

Rainforest terminology follows Webb

(1978). The ‘Wet Tropics’ is defined as that part

of north-eastern Queensland which encompasses

the ‘hot, humid vine forests’ from near Cooktown

in the north to Paluma tn the south (Webb &

Tracey 1981; Barlow & Hyland 1988).

Austrobaileya 4(4): 619-626 (1997)

Taxonomy

Austrobuxus Mig., Fl. Ind. Bat. Suppl. 444

(1861). Type: A. nitidus Mia.

Derivation of name: From the Latin Austro and

buxus meaning southern box.

Shrubs or trees, dioecious, evergreen, perennial;

stems and foliage without latex. Indumentum of

simple, multicellular trichomes; glandular

trichomes absent; stinging trichomes absent.

Stipules entire, small or + obsolete, deciduous.

Leaves opposite or alternate, petiolate, elobate,

penninerved; margins entire orrarely denticulate

to crenulate. Inflorescences axillary, racemose,

solitary, unisexual with flowers in bracteate

clusters. Female flowers pedicellate; sepals

imbricate, 2+2 or 3+3; petals absent; disk shortly

cupular or obsolete; ovary 2- or 3-locular, with

loculi biovulate or rarely uniovulate; styles 2 or

3, subsessile, ovate-subulate, transversely

reniform or linear-subulate, usually free. Male

flowers pedicellate; sepals imbricate, 2+2 or

3+3; petals absent; receptacle convex; stamens

2—25, with filaments free and arising from pits

in the receptacle; anthers dorsifixed, bilobate,

with thecae oblong, longitudinally dehiscent;

pistillodes absent. Fruits capsular, 2- or 3-locular,

smooth, dehiscing into bivalved cocci. Seeds

obloid or ovoid; testa crustaceous; albumen

fleshy; caruncle conspicuously arillate;

cotyledons broad, flat.

A genus of 22 species occurring in Malesia

(4 species), Melanesia (16 species) and Australia

(2 species). Both Australian species are endemic.

Key to the Australian species of Austrobuxus

|, Leaves elliptic or cuneate-obovate, entire; ovary and capsule 3-locular; seed

PIPE) CEC ALE Urs s.n ice ee nae ed, uel

pees Sy ehle cunes Sele da bees I eagles 2. A. Megacarpus

Leaves narrow-elliptic to lanceolate, crenulate-dentate; ovary and capsule

2-locular; seed with yellow aril.........

1. Austrobuxus swainii (Beuzev. & C.T. White)

Airy Shaw, Kew Bull. 25: 508 (1971);

Longetia swaintt Beuzev. & C.T.White,

Proc. Linn. Soc. N.S.W. 71: 236 (1946).

Type: New South Wales. East Dorrigo,

ee a ee eT . 1. A. swaimii

Mar 1944, Rosling s.n. (holo: 7SYD [not

found]; iso: BRD).

Illustrations: de Beuzeville & White (1946:

237); Floyd (1989: 136).

Forster, Austrobuxus

Tree up to 40 m high, but often much smaller.

Indumentum of simple, ferruginous-brown

trichomes. Trunk flanged, slightly buttressed at

base; bark grey to brown, scaly, shedding in

patches; blaze bright pink to red. Branchlets +

rounded, with dense trichomes when young,

glabrescent. Stipules absent. Leaves petiolate;

petioles 7-8 mm long, c. 1.5 mm wide, with

dense trichomes when young, glabrescent;

lamina lanceolate to narrow-elliptic, 25-130

mm long, 12-40 mm wide, discolorous, with

venation comprising 13-15 lateral veins per

side of midrib and reticulate tertiary veins;

margins denticulate to weakly crenate with

30-40 minute teeth per side of midrib; tip acute

or obtuse; base cuneate; upper surface dark

slossy green, glabrous, with venation obscure;

lower surface pale green, glabrous, with venation

prominent. Male inflorescences axillary, up to

30 mm long; peduncle up to 7 mm long, with

dense trichomes; bracts triangular, 0.6-1 mm

long, c. 0.4 mm wide, with dense trichomes.

Male flowers 2.5—3 mm long, 5—7 mm wide;

pedicels 1.6—3 mm long, c. 0.4 mm diameter,

with sparse trichomes; sepals 2+2, + orbicular,

2—2.3 mm long, 1.8-2 mm wide, glabrous;

receptacle c. 0.8 mm long and | mm diameter;

stamens 9, with filaments 1.5—2.8 mm long, c.

Q.1 mm diameter, glabrous; anthers c. 0.7 mm

long and 0.5 mm wide. Female inflorescences

up to 10 mm long; peduncle up to 3 mm long,

with dense trichomes; bracts lanceolate, | .5—2

mm long, 0.7—1 mm wide, with dense trichomes.

Female flowers 3-4 mm long, c.3 mm diameter;

pedicels 1—-1.5 mm long, c. | mm diameter, with

dense trichomes; sepals 242, lanceolate-ovate,

1.5—2 mm long, 1.4—-1.8 mm wide, with dense

trichomes abaxially; ovary bilocular, 1.8—2 mm

long, 1.2—2 mm diameter, with dense trichomes;

styles 2, ovate-subulate, |-1.8 mm long, 0.5-0.6

mm wide, entire, papillose on top and with

dense trichomes on back. Fruits bilocular, ovoid,

9-15 mm long, 7-12 mm diameter. Seeds ovoid,

7-8 mm long, 4.5-—6 mm wide, 2.8-3 mm thick,

brown; caruncle arilloid, yellow. .

Selected additional specimens examined: Queensland.

Moreton District: Tallebudgera Mt, Mar 1979, McDonald

2809 & Whiteman (BRI); Purlingbrook Falls, end of Carricks

road, Aug 1990, Catchpaole [AQ473153] (BRD;

Springbrook, Sep 1952, Gresty 1555 (BRI); Warrie N.P.,

Springbrook, Jun 1978, McDonald 2032 & Jessup (BRD;

621

Banksia road, Springbrook, Sep 1993, Forster 13861 &

Leiper (BRI, QRS); Mungora Creek, Springbrook N.P.,

Sep 1993, Forster 13860 & Leiper (BRI, QRS); below

Panorama View estate, Springbrook, Sep 1993, Forster

13859 & Leiper (BRI); The Cougals, Springbrook N.P., Mt

Cougal section, Oct 1994, Forster 15833 & Leiper (BRI,

NSW). New South Wales. Terranora area, SW of Tweed

Heads, May 1984, Davidson [AQ440566] (BRI); Terania

Creek, 10 km NNE of The Shannon, Feb 1980, Coveny

10646 (BRI, NSW); Downfall Creek, Megan, Jan 1980,

Floyd 1422 (BRI); Head of Wilson’s Creek via

Murwillumbah, Jun 1944, Hayes (BRD; Whian Whian

S.F., Jun £945, White 12785 (BRD; Dorrigo, Mar 1946,

King {AQ201312] (BRD; ditto, Mar 1946, Hewitt

[NSW 137146] (BRI, NSW), Bellingen, Mar 1940, Rickerby

[INSW155225] (NSW).

Distribution and habitat: Austrobuxus swainii

is restricted to the area from ‘Tallebudgera Creek.

in Queensland to Bellingen in New South Wales

and occurs over four 1° grid squares (Map 1).

Plants grow above 700 m altitude in warm

temperate rainforests (notophyll vineforests,

microphyll fern forest/thickets) or adjacent

eucalypt forest, often in association with

Ceratopetalum apetalum D.Don (coachwood).

Notes: This species first came to note in the

1940’s when it was harvested for timber under

the trade name of ‘Pink Cherry’ (De Beuzeville

& White 1946), although other names such as

‘Hairybark” and ‘Pinkwood’ have also been

used (Floyd 1989),

Austrobuxus swainii is unique in the

genus for its crenulate leaf margins, the

consistently bilocular ovary and more or less

linear styles. Toothed leaves are rare in

Euphorbiaceae subtribe Dissiliariinae but also

occur elsewhere in some species of Choriceras,

Dissiliaria and Sankowskya (Forster 1995). This

character is thought to be plesiomorphic within

Euphorbiaceae subfamily Oldfieldioideae

(Hayden 1994),

The whereabouts of the holotype of this

species name has not been ascertained. The

specimen was stated by de Beuzeville and White

(1946) to be deposited at the ‘Herbarium,

University of Sydney’ (SYD). Enquiries toS YD

revealed that most type collections had been

donated to NSW after the retirement of

R.C, Carolin; however, this particular type could

not be located at either institution (A. Ford,

pers. comm. Oct. 1993),

622

Austrobaileya 4(4): 619-626 (1997)

Map 1. Distribution of Austrobuxus megacarpus @ and A. swainit A.

Conservation status: Austrobuxus swainii 1s

arare tree in Queensland with few known

localities of occurrence, nearly all of which are

in the Springbrook area, and in New South

Wales is known from 22 fragmented and

disjunct localities (Floyd 1989). The species is

present in Cougal and Warrie National Parks in

Queensland (Thomas & McDonald 1989) and

in the Dorrigo and Border Ranges National

Parks in New South Wales (Floyd 1989),

The conservation coding of 3RC given by

Briggs & Leigh (1988) and Thomas & McDonald

(1989) appears appropriate.

2. Austrobuxus megacarpus P.I.Forst., sp.

nov. affinis A. nitido Miq. aquaindumento

hyalino usque flavo, floris masculini

pedicello Jongiore (4.5-6 mm longo),

sepalis 2 et 2 et majoribus (3-4 mm longis,

2—2.2 mm latis), fructu ovoideo et majore

(18-23 mm longo, c. 18 mm diam.) et

semine majore (c. 10 mm longo, 5-6 mm

lato et c. 6 mm crasso), differt. Typus:

Queensland. Cook District: State Forest

Reserve 310, Bora Logging Area, 23 Jun

1982, B. Gray 2632 (holo: QRS; iso: BRD).

[Austrobuxus nitidus auct. non Miq.: Airy

Shaw (1971: 506; 1980: 219; 1981: 597);

Christophel & Hyland (1993); Hyland &

Whiffin (1993)]

Illustration: Christophel & Hyland (1993:

98, Plate 36a) [as A. nitidus].

Small shrub or a tree up to 30 m high.

Indumentum of simple, hyaline to yellow

trichomes. Trunk gnarled, slightly fluted at base;

bark brown, somewhat flaky; blaze pale pink.

Branchlets + rounded, glabrous. Stipules

subulate, 1-1.3 mm long, c. 0.3 mm diameter,

with scattered trichomes, deciduous. Leaves

petiolate; petioles 4-10 mm long, 1-1.3 mm

wide, glabrous; lamina cuneate-obovate to

elliptic, 22-110 mm long, 10-36 mm wide,

discolorous, with venation comprising 7—10

weakly developed lateral veins per side of midrib

and reticulate tertiary veins; margins + entire

or weakly sinuate, often slightly revolute, tip

acute or obtuse; base cuneate to almost attenuate;

Forster, Austrobuxus |

upper surface dark green, glabrous, with venation

+ obscure; lower surface pale green, glabrous,

with venation visible but not prominent. Male

inflorescences axillary, up to 40 mm long;

peduncle up to 5 mm long, with scattered

trichomes; bracts lanceolate, 0.8—1.8 mm long,

0.4-0.6 mm wide, with scattered trichomes.

Male flowers 3— 4 mm long, 4—5.5 mm wide;

pedicels 4.5—8 mm long, 0.3—0.5 mm diameter,

with scattered trichomes; sepals 2+2, narrow-

ovate to suborbicular, 3-4 mm long, 2—2.2 mm

wide, glabrous; receptacle raised-convex, c. 1.6

mm long and 2 mm diameter, glabrous; stamens

7-9, with filaments |,7—2.2 mm long, c. 0.2 mm

diameter, glabrous; anthers 1—-1.8 mm long and

0.9-1.1 mm wide. Female inflorescences up to

15 mm long; peduncle up to 4 mm long, with

scattered trichomes; bracts lanceolate, 1.8—2

mm long, 1-1.2 mm wide, with scattered

trichomes, Female flowers 3-3.5 mm long, 2.53

mm diameter; pedicels 2-5 mm long, 1.5-1.8

mm diameter, with scattered trichomes; sepals

2+2, ovate, 2—2.5 mm long, 2—2.2 mm wide,

glabrous; ovary trilocular, 2-3 mm long, 2—3.5

mm diameter, glabrous; styles 3, subsessile,

transversely reniform, |.4—1.5 mmlong, 1.2-1.3

mm wide, entire, papillose on top, glabrous or

with occasional scattered trichomes abaxially.

Fruit trilocular, ovoid, 18-23 mm long, c. 18

mm diameter. Seed ovoid, c. 10 mm long, 5-6

mm wide andc. 6mm thick, red-brown; caruncle

arilloid, red. Fig. 1.

623

Selected additional specinens examined: Queensland.

Cook District: S.F.R. 143, North Mary L.A., Jul 1988,

Gray 4899 (BRI, QRS); ditto, Mar 1984, Hyland 12936

(BRI, QRS); ditto, Dec 1982, Gray 2874 (BRI, QRS); Mt

Lewis road, Jan 1987, Jessup 285 & Clarkson (BRI,

-CANB, NSW); ditto, Aug 1957, Smith 10095 (BRD; ditto,

Jul 1994, Forster 15634 et al. (BRI, MEL); Forest Reserve.

755, North Johnstone L.A., Jun 1966, Dansie 4007 (BRD;

S.F.R.310, Sep 1973, Dansies.n. (QRS); S.F.R. 310, Bora

L.A., Oct 1973, Hyland 6917 (QRS); ditto, Oct 1973,

Hyland 6918 (QRS); Swipers L.A., Jun 1972, Risley 59

(ORS).

Distribution and habitat: Austrobuxus

megacarpus 1s endemic in the ‘Wet Tropics’ of

north-east Queensland where it has been

collected in the Mt Lewis area and west of

Babinda (Map 1). Plants grow on ridgetops

from 750 to 1150 m altitude in simple microphyll

fern-moss thicket or simple microphyll

vineforest on souls derived from granite.

Notes: Airy Shaw (1980, 1981) considered that

this plant was conspecific with Austrobuxus

nitidus from the Malay Peninsula, Borneo and

Sumatra. This view is understandable as the two

taxa are superficially similar and little fertile

material of the Australian plant was available to

Airy Shaw at the time. Subsequent collections

of fertile material of the Australian plant by

B.Gray and B.Hyland (QRS) have revealed

numerous differences from the Malesian plants.

These differences are summarised in Table 1.

Bibliographic and voucher details for A. nitidus

are given in Appendix 1.

Table 1. Morphological comparison between Austrobuxus nitidus and A. megacarpus.

Character

Indumentum colour

A. nitidus

ferruginous-brown

A, megacarpus

hyaline to yellow

Male flower pedicel length (mm) 2.9—-3 45-6

Male flower sepals 3+3 2+2

Male flower sepal size (mm) 1.8—2 x 1.7-2 34 x 2-2,2

fruit shape | obovoid, ovoid,

& size (mm) 7-16 x 7—12 18-23 xc. 18

seed size (mm) c. 10 x 5-6 x 6

6-8.5 x 2.5-4 x 4.5-5

624 Austrobaileya 4(4): 619-626 (1997)

tl feraa rin PAA San BBRAL Sens i

Fig, 1. Austrobuxus megacarpus. A. twig with female inflorescence x 0,5. B. lower leaf surface showing venation x 1,

C. male inflorescence x 10, D. male flower x 20. E. female inflorescence x 10. F. female flower x 20. G. lateral view

of fruit x 4. H. apical view of fruit x 4. I. single seed attached to central columella of fruit and with caruncle covering upper

portion x 10, A,B, G-I from Hyland 12936 (BRI,QRS),; C,D from Gray 2632 (QRS); E,F from Hyland 13521 (QRS). Del.

W.Smith.

Forster, Austrobuxus

Conservation status: Austrobuxus megacarpus

is a rarely collected plant with a restricted

distribution. The known localities where it occurs

are not under any immediate threat; however,

the Conservation Coding of 2R given for this

species (as A. nitidus) by Briggs & Leigh (19838)

and Thomas & McDonald (1989) is probably

justifiable pending further survey.

Etymology: The specific epithet 1s from Greek

mega (large) and carpos (fruit) and alludes to

the much larger fruit of this species in comparison

with those of A. nitidus and A. swamit.

Acknowledgements

W. Smith (BRI) provided the drawings. Field

assistance when collections of Austrobuxus

were made was provided by G.Leiper,

G. & N.Sankowsky and M.C.Tucker. The

Directors/Curators of the cited herbaria

allowed access to collections in their care,

either in situ or on loan. Translation of the

diagnosis into Latin was kindly undertaken by

L.A.Craven (CANB). Comments on a draft of

the manuscript were provided by A.R.Bean |

(BRI). This work was funded by the Australian

Biological Resources Study (ABRS) as a

preferred objective research project in

1992-1994, A grant from the Wet Tropics

Management Agency for the project ‘Rare and

Endangered Euphorbiaceae of the Wet Tropics’

enabled extended time in the “Wet Tropics’ and

at ORS. Access to State Forests and Timber

Reserves was facilitated by relevant permits

from the Queensland Forest Service, Department

of Primary Industries.

References

Airy SHaw, H.K. (1971). Notes on Malesian and other

Asiatic Euphorbiaceae. Kew Bulletin 25: 473-553.

—-— (1974), Notes on Malesian and other Asiatic

Euphorbiaceae. Kew Bulletin 29; 281-331,

—(1980). New ornoteworthy Australian Euphorbiaceae

- Il. Muelleria 4: 207-241,

— (1981). A partial synopsis of the Euphorbiaceae—

Platylobeae of Australia (excluding Phyllanthus,

Euphorbia and Calycopeplus). Kew Bulletin 35:

577-700.

625

BARLOW, B.A, & HyLanp, B.P.M. (1988). The origins of the

flora of Australia’s wet tropics. Proceedings of the

Ecological Soctety of Australia 15: 1-17.

Briccs, J.D. & Leicy, J.H. (1988). Rare or Threatened

Australian Plants. Revised Edition. Australian

National Parks and Wildlife Service Special

Publication No. 14. Canberra: Australian National

Parks & Wildlife Service.

CHRISTOPHEL, D.C, & HYLAND, B.P.M. (1993). LeafAtas of

Australian Tropical Rain ForestTrees. Melbourne:

CSIRO Publications.

De BeuzevitLe, W.A.W. & Wuire, C.T. (1946), A new

species of Longetia: the botanical identity of

the “Pink Cherry” of Dorrigo timber-getters.

Proceedings of the Linnean Society of New South

Wales 71: 236-238.

FLoyp, A.G. (1989), Rainforest Trees of South-eastern

Australia, Melbourne & Sydney: Inkata Press.

Forster, P.I, (1995). Sankowskya, a new genus of

Euphorbiaceae (Dissiliariinae) from the Australian

Wet Tropics. Austrobaileya 4: 329-335.

Haypen, W.J. (1994). Systematic anatomy of Euphorbiaceae

subfamily Oldfieldioideae, I. Overview, Annals of

the Missouri Botanical Garden 81: 18Q—202.

Hewson, H. (1988). Plant Indumentum. A Handbook of

Terminology, Australian Flora and Fauna Series

No. 9, Canberra: Australian Government Publishing

Service,

HyYLAnD, B.P.M. & Wuirrin, T, (1993). Australian Tropical

Rain Forest Trees: An Interactive Identification

System. Melbourne: CSIRO Publications,

Levin, G.A. & Simpson, M.G. (1994). Phylogenetic

implications of pollen ultrastructure in the

Oldfieldioideae (Euphorbiaceae). Annals of the

Missouri Botanical Garden 81: 203-238.

Martin, H.A, (1974). The identification of some Tertiary

Pollen belonging to the family Euphorbiaceae.

Australian Journal of Botany 22: 271-291.

McPuerson, G. & TireL, C. (1987). Euphorbiaceae I.

Euphorbioideae, Crotonoideae, Acalyphoideae,

Oldfieldioideac. Flore de la Nouvelle-Calédonie et

Dépendances, 14. Paris: Muséum National

d’ Histoire Naturelle.

Migue., F.A.W. (1861). Flora Indiae Batavae.

Supplementuml, Prodromus Florae Sumatranae.

Amsterdam: C.G. van der Post.

SMITH, A.C. (1981), Euphorbiaceae. Flora Vitiensis Nova

2: 439-575, Lawai, Hawaii: Pacific Tropical

Botanical Garden.

626

THomas, M.B. & McDona.p, W.J.F, (1989), Rare and

Threatened Plants of Queensland. 2nd Edition.

Brisbane: Queensland Department of Primary

Industries.

Wess, L.J. (1978). A general classification of Australian

rainforests. Australian Plants 9: 349-363.

Wess, L.J. & Tracey, J.G. (1981). Australian rainforests:

pattern and change. /n A.Keast (ed.), Ecological

Biogeography of Australia. pp. 605-94. The Hague:

W. Junk.

Wester, G.L. (1994). Synopsis of the genera and

suprageneric taxa of Euphorbiaceae. Annals of the

Missouri Botanical Garden 81: 33-144.

Appendix 1. Austrobuxus nitidus:

Bibliographic data and Selected Specimens

Examined

Austrobuxus nitidus Mig., Fl. Ind. Bat., Suppl.

445 (1861); Longetia nitida (Miq.) Steenis,

Blumea 12: 362 (1964). Type: Sumatra.

“W.IS. Sumatra, ad litt. Sibogae....769

HB” [1.963240581] Gso: L).

Choriophyllum malayanum Benth., Hook.

Icon. Pl. 13: 62, t. 1280 (1879); Longetia

malayana (Benth.) Pax & K.Hoffm. in

Enegl., Pflanzenr. 15: 292 (1922). Type:

Borneo. Sarawak, Beccari 3329 (lecto: K

n.v., fide Airy Shaw (1981: 597).

Selected specimens examined: Malaysia, Penang Hill,

tunnel road, May 1938, Henderson [SING21440] (BRD;

Gunong Jerah, Kedah, Feb 1973, Shukor58 (BRI); Gombak

Forest Reserve, Selangor, Nov 1981, Saleh [FRI28793]

(BRI). Sumatra. Mt Sago near Pajakumbuh, Jun 1957,

Meijer 5889 (L); Bengkalis Tamansari, Aug 1919, Beguin

264 (L); Res. Taptannoeli and. afd. Padang Lawas, Jan

1923, Beumée (924 (L); Banka, Aug 1864, Berkhout 981

(L); [unlocalised}] Korthals [L90954117] (L.). Sulawesi

(Celebes). Batu Besi between Tabarano & Larona River,

Jul ?, van Balgooy 4089 (BRD.

Austrobaileya 4(4): 619-626 (1997)

SRL SU i

beecth .. UAVS aye,

Reinstatement of the genus Babingtonia Lindl. (Myrtaceae,

Leptospermoideae)

A.R.Bean

Summary

Bean, A.R. (1997). Reinstatement of the genus Babingtonia Lindl. (Myrtaceae, Leptospermoideae.

Austrobaileya 4(4): 627-645, The genus Babingtonia is reinstated for a large group of species

previously included in Baeckea L. sens. lat. Sixteen species are recorded for Malesia, New Caledonia

and eastern Australia, Five new species: Babingtonia tozerensis A.R.Bean, B. granitica A.R.Bean,

B, odontocalyx A.R.Bean, B. silvestris A.R.Bean and B. prominens A.R.Bean are described and

illustrated. Nine new combinations are made; Babingtonia taxifolia (Merr.) A.R.Bean, B. procera

(J,.W.Dawson) A.R.Bean, B. leratii Schlitr.) A.R.Bean, &. pinifolia (Labill.) A.R.Bean, B. crenulata

(F.Muell.) A.R.Bean, &. behrii (Schitdl.) A.R.Bean, B. cunninghamii (Schauer) A.R.Bean, B, jucunda

(S.T.Blake) A.R.Bean and B, squarrulosa (Domin) A.R. Bean. Anillustration and English description

of Babingtonia squarrulosa are provided for the first time. Distribution maps are provided for all

eastern Australian species, Keys are included for the genera previously included in Baeckea, and for

the species of Babingtonia occurring in eastern Australia and Malesia.

Key words: taxonomy, Myrtaceae; Australia, New Caledonia, Malesia, Babingtonia, Baeckea,

Babingtonia tozerensis, Babingtonia granitica, Babingtonia odontocalyx, Babingtonia silvestris,

Babingtonia prominens,

A.R. Bean, Queensland Herbarium, Meiers Road, Indooroopilly Queensland 4068, Australia

Introduction

A broad circumscription for the genus Baeckea

L. was established by Bentham (1867), and this

was unchallenged until recent years. It is now

recognised (Johnson & Briggs 1985; Trudgen

1987; Bean 1995) that Baeckea sens, \at. is a

polyphyletic group. Based on their ovule

and anther characteristics, taxa such as

Ochrosperma and Babingtonia, historically

included within Baeckea, are more closely

related to Hypocalymma (Endl.) Endl. and

Astartea DC. (respectively) than they are to each

other. The option of reducing Hypocalymma,

Astartea and other genera to synonymy under

Baeckea is an untenable solution, as similar

treatment of taxa elsewhere in the family would

result in the reduction of many well-known and

long established genera. Hence the alternative

is chosen i.e. the raising of groups within

Baeckea sens. lat. to generic status. In eastern

Australia, New Caledonia and Malesia, five

genera are recognised (Bean 1995).

Accepted for publication 15 April 1996

The largest 1s Babingtonia Lindl.,

established in 1842 and based on Baeckea

camphorosmae Endl. Lindley regarded

Babingtonia camphorosmae as being distinct

from Baeckea because of its stamens forming

groups opposite the sepals, and because of the

dehiscence of the anthers by terminal pores.

Schauer (1843) accepted Lindley’s genus

and described several other related genera,

including Harmogia, Tetrapora and

Oxymyrrhine, all of which were apparently

distinguished from Babingtonia by their mode

of anther dehiscence. Oxymyrrhine and

Tetrapora were not widely accepted by later

botanists. Their types do not appear to differ in

any significant way from that of Babingtonia.

By contrast, Harmogia was taken up by several

botanists, notably Mueller (1864), who

transferred several eastern Australian Baeckea

species to Harmogia.

The several species originally included by

Schauer under Harmogia do differ from

Babingtonia camphorosmae (the type species

of Babingtonia Lindl.) in their mode of anther

dehiscence, being by poresin B. camphorosmae

or by short slits in the original Harmogia spp.,

628

which are all eastern Australian species. Bentham

(1865) reduced both Babingtonia and Harmogia

to sectional status under Baeckea, applying

sect. Babingtonia to Western Australian species

and sect. Harmogia to the eastern Australian

species, thus maintaining the perception that

the western and eastern Australian taxa were

fundamentally different.

However, both eastern and western

species exhibit considerable variation for

this character; some eastern species have

anthers dehiscing by pores and others by short

divergent slits, as do western species.

Furthermore, several other characters e.g. stamen

arrangement, the often compound sepals and

pedunculate inflorescences, are shared by

western and eastern species. Therefore the

maintenance of Harmogia Schauer as a

separate genus is not supported here.

A key to the five genera comprising

Baeckea sens. lat. in eastern Australia, New

Caledonia and Malesia is presented below.

The genus Babingtonia Lind1. is reinstated and

revised for species occurring in eastern

Australia and Malesia, except for the species

complex including Babingtonia virgata which

will be treated in a future paper.

For the purposes of this paper, eastern

Australia 1s defined as the area comprising

the States of Queensland, New South Wales,

Victoria and Tasmania, as well as the

Australian Capital Territory.

Materials and methods

This paper is based on amorphological study of

herbarium material from A, BM, BRI, GH,

HAL, K, MEL, NE, NSW, P, PR and UC. In

addition, microfiche of type specimens in LINN

have been seen. Most species have been -

examined in the field to determine ecological

preferences and to collect spirit material.

Measurements of vegetative parts are

based on herbarium material, and floral and

fruiting measurements are based on spirit

material or reconstituted dried specimens.

The species are arranged in perceived

systematic order, which is based on the authors’

informal weighting of characters according to

Austrobaileya 4(4): 627-645 (1997)

their importance in delimiting taxa above the

level of species.

Taxonomic and ecological characteristics

Babingtonia is characterised (in eastern

Australia, New Caledonia and Malesia) within

Subtribe Baeckeinae Benth. by its pedunculate,

1—7-flowered inflorescences; 3—15 stamens that

are in(commonly loose) groups of 1-3 opposite

the sepals, and not opposite the petals; usually

geniculate filaments; adnate anthers dehiscing

by pores or short divergent slits; sepals

commonly compound; 3-locular ovary; 4—18

ovules per loculus; and angular, discoid to

cuboid seeds.

Compound sepals are a feature of many

species of Babingtonia. They consist of an inner

lobe which is thin-textured and obtuse, and

an outer or dorsal lobe which is thick and

commonly acute or acuminate (Fig. 2,J). These

outer lobes may be short and inconspicuous, as

in 6B. jucunda, or long and prominent, as in

B, odontocalyx. Compound sepals are rare 1n

Myrtaceae but also occur in Lophostemon

confertus (R.Br.) Peter G.Wilson & J.T.Waterh.

The taxonomic arrangement used here 1s

based primarily on ovule arrangement. Species

1-10 are characterised by a radial arrangement

of ovules around the placenta. In species 1 1—16,

the ovules are arranged in two parallel rows on

the distal side of the placenta.

Within these groups, species affinities are

based on ovule number, peduncle and pedicel

length, and leaf morphology.

Babingtonia is the largest and most

widespread of the genera comprising Baeckea

sens. lat. There are numerous Babingtonia

species in Western Australia and two in South

Australia. In the area under consideration

(eastern Australia, Malesia, New Caledonia),

Babingtonia is best represented in New South

Wales and Queensland. It is represented by

two species in Victoria and 1s absent from

Tasmania.

There are four species in New Caledonia

(Dawson 1992) and one in Borneo (Merrill

1928).

629

Bean, Babingtonia

- =

ye" oh gteeert

baat

eepu

ors

o * iy

* .

ste

Wek he

Fr ow We

= Em,

Patt eq" 5

= 5

££ &

ae WU

pane

3 4

“at OSD

me SS

iy) So

oO 1S

x SS

dlobes x 6.C, leaf'x 3.D. fi

tx 6.H.seedx 12.1. leafx 6.J-N

lum an

J, hypanthium and lobes x 6. K, flower x 6. L. bracteoles x 6. M. leaf x 6.N. fruitx 6, A-C, Bean 7196

E-I, Bean 7672

dlobes x 6, G. fru

1Wm an

tonia tozerensis, A, flower x 6. B, hypanth

ing

Bab

_E, flower x 6. F, hypanth

‘

pronunens

Fig. 1.A-D

D, Bean 7634;

J-N, Bean 8221.

sbteenoei ype pirat SM MERE SRS IE FERRER SES SN aaa NUS AREER OS

630

The habitat favoured by Babingtonia

species is hillsides and mountainsides, on

shallow soils derived from serpentinite,

eranite, sandstone or trachyte, although some

taxa allied to B. virgata inhabit creek banks and

Taxonomy

Austrobaileya 4(4): 627-645 (1997)

valleys with deep soil. No species occur in

swampy sites. Most species have small

xeromorphic leaves, though some members of

the B. virgata group have larger and thinner

leaves than most Babingtonia species.

Key to the genera previously included within Baeckea L. sens. lat. in eastern Australia,

New Caledonia and Malesia

EL; ‘Ovaryand irints-locular «4 «ave ne ee les nak ee nike te nae pete re b pete ee tres BAG Z

Vay ANG Tre IOCUIAR 4 h.n oA 4 Bae oh dig ee tind gf is Breer kat. eempracaeen uated eee Baeckea

2. Anthers versatile, dehiscing by long parallel slits... 0.0... ec ee eee 3

Anthers adnate, dehiscing by pores or short divergent slits ................ Babingtonia

3. Ovules and seeds D-shaped, angular. .... 00... cc eee eee Baeckea

Ovules and seeds reniform, not angular . 0.0... 0... ce ec eee ee eee ene nes 4

4. Some stamens opposite centre of petals ....

No stamens opposite centre of petals ......

5. Ovules 2 per loculus, stamens 5-8 ........

Ovules 8—13 per loculus, stamens 14-18 ...

Babingtonia Lindl., Bot. Reg. 28: t.10 (1842);

Baeckeasect. Babingtonia (Lindl.) Benth.

& Hook.f., Gen. Pl. 1: 702 (1865). Type:

Babingtonia camphorosmae (Endl.)

Lind.

Harmogia Schauer, Linnaea 17: 238 (1843);

Baeckea sect. Harmogia (Schauer) Benth.

& Hook.f., Gen. Pl. 1: 701 (1865). Type:

Harmogia densifolia(Sm.) Schauer (lecto:

here designated).

Oxymyrrhine Schauer, Linnaea 17: 240

(1843); Baeckea sect. Oxymyrrhine

(Schauer) Benth. & Hook.f., Gen. PI. I:

701 (1865). Type: Oxymyrrhine gracilis

Schauer.

Tetrapora Schauer, Linnaea 17:238 (1843).

Type: Tetrapora preissiana Schauer.

Shrubs, prostrate or to 5 m high, all parts

glabrous. Bark grey, scaly or fibrous, persistent.

Stem flanges prominent, flat or convex, winged

or not winged, entire or laciniate, sometimes

Site rats aha st erdie vlsce) 4 ree Ochrosperma Trudgen

ict Lat Oey Goch &. SLOG ted eh x OE Triplarina Raf.

with tuberculate glands. Leaves opposite,

exstipulate; linear, oblanceolate or elliptic,

glabrous, concavo-convex, plano-convex or

flat; oil glands obscure on adaxial surface,

conspicuous (or rarely obscure) on abaxial

surface, scattered; margins entire, minutely

denticulate, crenulate or rarely irregularly lobed,

sometimes recurved; venation not visible or

midrib faintly visible, apex acute or obtuse;

base cuneate or obtuse. Inflorescences axillary,

anthotelic, with monads, or 3-7 flowered

umbellasters. Flowers actinomorphic, bisexual,

5-merous. Peduncles terete or flattened: bracts

absent; pedicels terete, short, sometimes

absent; bracteoles 2, opposite, conduplicate,

ovate to linear or triangular, caducous or

somewhat persistent. Sepals usually compound;

inner lobes obtuse, thin, entire or fimbriate;

outer lobes obtuse, acute or acuminate, thick,

entire, absent in some species. Petals caducous,

white, orbicular or almost so, 1-6 mm wide,

margins entire or fimbriate. Stamens 3—15(25),

free, in a single whorl, shorter than the petals,

usually one opposite each sepal and the rest

sesame ed she enapontecg ge ee a a ee a a a ee ee noe ge

1 SASSIE ony etna iain Ghat eek NT Se ES RR

crt es

Bean, Babingtonia

scattered but not opposite a petal; antesepalous

stamens often shorter than other stamens;

filaments terete, geniculate, with the connective

gland fused to the top of the filament at the

bend; anthers adnate, dorsifixed, bilocular, with

cells fused or free, dehiscing by pores or short

divergent slits. Ovary inferior, 3-locular or rarely

2-locular; ovules (2)4—-18 per loculus, arranged

radially around placenta or tn two longitudinal

rows; placenta furrowed, peltate. Style simple,

631

terete, emerging through, but free from the

floral disc; stigma capitate. Fruits capsular,

hemispherical to bowl-shaped, woody,

crowned by persistent sepals, dehiscing

loculicidally. Seeds discoid or cuboid, with

rounded outer surface and flat sides, angular,

surface finely reticulate or smooth, not arillate.

Embryo with small cotyledons on a slender

neck attached to a large radicle.

ot feeb ah

Fn ae

meet ee i

Red Cte, Ao

Lhatity yeas ied

Ret ete ene

EN CIES

othe

“an

Pied

= 7.

< Te

™ tert

« .

! a

Fig, 2, A-D: Babingtonia squarrulosa, A. flower x 8. B. hypanthium and lobes x 8. C, fruit x 8, D, leaf x 8. E~G:

Babinegtonia granitica. E. flower x 8. F, hypanthium and lobes x 8. G. leaf x 8. H-L: Babingtonia odontocalyx, H.

fiower x 8. I. hypanthium and lobes x 8. J. compound sepal x 16. K. fruit x 8. L. leaf x 8. A, B, D, Bean 7490 & Forster;

C, Forster 16489 & Figg; E~G, Bean 7263; H-L, Bean 7261,

632 Austrobaileya 4(4):; 627-645 (1997)

Key to the eastern Australian and Malesian species of Babingtonia

(Note: A key to the New Caledonian species is given by Dawson (1992)).

|, Leaf margins crenulate or conspicuously trregular.... 0... ec eee en Z

Leaf margins entire or minutely denticulate ...... 00... ccc ce eee een 3

2. Leaves 4.2-6.1 mm long, crenulate. Mt Buffalo, Victoria ............... 7. B. crenulata

Leaves 1.2—2.4 mm long, conspicuously irregular, Central-northern NSW

bid Hert RELI WY Natu ethos of Uede p Ueb nine Gin de eh cd EE ne, 4bgh DE Te ede thd A eae 10. B. cunninghamii

3) Jeeves amore Tait LOM WHE suo Genk tess a KH hand PM ele ew ay Labo. aed Ce Ka Dae 4

PSCAVES LESS TE Es DT TE gic ohn ore oo! pnctlrd w 9hs o E OEe Oe NS e ah Saat eid ee aA -

A. JIM flGrescences: 3= OF-7 IG WIE | «nde ec eho HA a ben le ea A ea Cle Rh ee eS ao

FHELOFESCENCES TA TIOWETEO «3 2. oS ure of a tom Sore an 6 eMA PE h aE Sib NeU EINE Chk Aw tbe Poe LL ae 6

5. Stem flanges warty; leaves with length:breadth ratio of 1.8-2.5:1, obtuse... 6. B. tozerensis

Stem flanges not warty; leaves with length:breadth ratio of 3—9:1, acute or

EIS Ce tay coh ick aR yet y)-tpe cathy wy eae arocls os ceoonkh oly ssechos kent Mttant toe 5. B. virgata sens. lat.

6. Petals 2.6—3.0 mm wide; hypanthium muricate; leaf length:breadth ratio

PAPE PES Rev oo eet eweg teil reson vee o dtc ns tae aah tote seh s Wl eine ve Wy Felacedne npr Shaka | 12. B prominens

Petals 1.5-2.3 mm wide; hypanthium smooth; leaf length:breadth ratio

De Reda nlc Rhea Bape alo, shh Spode talasthe 2 te x Stbrad olluntad Gehl e Moved Saris t 13. B. silvestris

7. Outer sepals acute or acuminate, 0.8-1.8 mmlong ...... 0.0... ccc een 8

Outer sepals obtuse, up to 0.3 mm long, or absent ..... 0... ce ee ns 1]

8. Leaves broadly ovate, 0.9-1.5 mm long; hypanthium smooth ......... 14, B. squarrulosa

Leaves linear to lanceolate, 2.5—6.5 mm long; hypanthium smooth or muricate ......... 9

9, Pedicels absent; hypanthium smooth ....... 0.0... ee ees 1. B. taxifolia

Pedicels 0.5—2.0 mm long; hypanthium muricate ......... 00... cece ee een 10

10. Stamens 5~9; ovules 8—9/loculus; leaves 0.7—-1.4 mm wide............. 15. B. granitica

Stamens 11-13; ovules 12—14/loculus; leaves 0.5—0.8 mm wide...... 16. B. odontocalyx

IC aApeX MMOL: sg aed wept ete ais oe daep dhe sy) tate, Moet ot shark eer t abcd ak 9. B. behrii

sea apex ACULCIOE-QOUISE: oa ji sa veld so ire Mop tere Fed Diy Aw fe og Bowen deine Os Geena a 12

12. Inflorescence 3- or 7-flowered .. 0.0... 0. ccc eee ee ee eee en 5. B. virgata sens. lat.

HITHORERCBNCE 1 HOWETSRD 225 se ci. we peace 9 OE poet eS, poe ep WER gk ne Os Medea tes gh aul Sake aha EEO 13

13. Leaves obovate; pedicels 2.0—4.2 mm long; outer sepals present; hypanthium

SHEL OCU 5, 13h 5 an pein euce ed beaks doth 4 tee teh = len dd ates: hie renee is Wem Wace as SE yh 11. B. jucunda

Leaves linear; pedicels 0.4-1.0 mm long; outer sepals

absent; hypanthitum smooth.................0008. Dye atot Lura en avenue aps 8. B.densifolia

1. Babingtonia taxifolia (Merr.) A.R.Bean Murud, October 1922, #. Mjoberg 111

comb. nov. (lecto (here chosen): UC; isolecto: BM,

K).

Baeckea taxifolita Merr., Sarawak Mus. J. 3:

534, 537 (1928). Type: Borneo. Mt

Bean, Babingtonia

Shrub, prostrate or up to 1.3 m high. Bark on

branchlets persistent, brown with papery

layers. Stem flanges grey, convex, not winged,

not warty, entire. Leaves widely spreading,

linear, 3.0-6.5 mm long, 0.6-0.8 mm wide,

Straight or curved, plano-convex, obtuse, not

keeled, entire; oil glands very small, visible

only with microscope; veins not visible, petiole

1.2—-1.5 mm long. Inflorescence axillary, 1-

flowered; peduncles thick, c. 0.6 mm long;

pedicels absent, bracteoles persistent, linear, c.

3.0 x 0.5 mm, obtuse. Hypanthium obconical,

more or less smooth, 2.0—2.5 mm long, fused to

the ovary except at top. Sepals compound;

inner lobes obtuse, thin, c. 0.4 x 1.0 mm,

margins entire; outer lobes acute, thick, c. 0.9

mm long, erect. Corolla white, 5-6 mm across;

petals orbicular, 1.5—2.2 x 1.5—2.0 mm, entire

or fimbriate; oil glands present. Stamens [5, 3

opposite each sepal, of slightly varying length;

filaments terete, O.7—-1.1 mm long, geniculate,

with a black or brown connective gland fused to

upper part of filament at bend; anthers adnate,

c. 0.2 mm long, dehiscing by elliptic pores or

short slits; anther loculi free. Style c. 0.8 mm

long, setinto a pit; stigma slightly broader than

style. Ovary 3-locular; floral disc flat; ovules c.

6 per loculus, radially arranged around a small

placenta near apex of chamber. Fruit

hemispherical-truncate, 1.5—1.8 x3.2-3.5 mm;

valves triangular, woody, at about rim level.

Seeds cuboid, c. 0.7 mm long, with flatsides and

rounded backs, smooth to shallowly reticulate,

pale brown; hilum terminal.

Specimens examined: Borneo. Mt Murud, Kalabit

Highlands, Sarawak, Apr 1970, Neoteboom 2016 & Chai

(L.); Gunung Klam, in 1893, Hallier 2308 (L); Mt Murut

(sic), Lawas, Sarawak, Oct 1967, Pale S26456 (L); Mt

Murud, Oct 1922, Mjoberg 84 (A, UC).

Distribution and habitat: Babingtonia taxifolia

is endemic on the mountains of northern

Sarawak on the island of Borneo, between

altitudes of 2100 and 2400 metres. It grows in

open shrubland communities on rocky slopes

with little soil.

Phenology: Flowers and fruits have been

recorded for the months of April and October.

Affinities: While clearly belonging to

Babingtontia, B. taxtifolia 1s a very distinctive

species with no close relatives. The spreading

633

leaves with long petioles and lacking obvious

oil glands are unusual, as are the regularly

arranged stamens, in groups of three opposite

each sepal.

Typification: Two specimens collected by

Myoberg (Numbers 86 and i111) were seen by

Merrill. Mjoberg 111 is chosen as the lectotype

as itis amore complete specimen and matches

the description given in the protologue.

2. Babingtonia procera (J.W.Dawson)

A.R.Bean comb. nov.

Baeckea procera J.W.Dawson, FI. Nouv.

Caledon. et Dep. 18: 22 (1992). Type:

New Caledonia. Paagoumene, 26 October

1977, MacKee 34140 (holo: P).

See Dawson (1992) for a description,

illustration and notes on distribution.

3, Babingtonialerati (Schitr.) A.R.Bean comb.

nov.

Baeckea leratii Schltr., Bot. Jahrb. Syst. 40,

Betbl. 92: 32 (1908). Type: New

Caledonia. Mt Mou, s. dat., Le Rat 563

(neo: P, fide Dawson (1992)).

Baeckea ericoides Brongn. & Gris, Bull.

Soc. Bot. France 11: 184 (1864),

nom.illeg., non Schlechtendal (1846).

Type: New Caledonia. Mt Dore, s.dat.,

Vieillard 440 (P n.v., photo BRD).

See Dawson (1992) for a description,

illustration and notes on distribution.

4, Babingtonia pinifolia (Labill.) A.R.Bean

comb. nov.

Leptospermum pinifoltum Labull., Sert.

Austro-Caledon. 63, t.62 (1825); Baeckea

pinifolia (Labill.) DC., Prodr. 3: 229

(1828). Type: New Caledonia. Balade, in

1793, Labillardiere s.n. (holo: FI n.v.;

iso: BM, photo BRI; K n.v., fide Dawson

(1992)),

See Dawson (1992) for a description,

illustration and notes on distribution.

634

§,. Babingtonia virgata (J.R.Forst. & G.Forst.)

F.Muell., Fragm. 4: 74 (1864).

Leptospermum virgatum J.R.Forst. &

G.Forst., Char. Gen. Pl. 48 (1776);

Melaleuca virgata (J.R.Forst. & G.Forst.)

L.f., Supp. Pl. 343 (1781); Baeckea virgata

(J.R.Forst. & G.Forst.) Andrews, Bot.

Repos. 9:t.598 (1810); Harmogia virgata

(J.R.Forst. & G.Forst.) Schauer, Linnaea

17: 238 (1843). Type: New Caledonia, in

1774, /.R. & G. Forster s.n. holo: Knvv.,

photo BRI).

Note: A revision of the Babingtonia virgata

species complex is in preparation.

6. Babingtonia tozerensis A.R.Bean sp. nov.,

B. crenulatae affinis a qua foltis

longioribus marginibus integris, pedicellis

brevioribus, et lobis calycis simplicibus

differt. Typus: Queensland. Cook

District: Tozer Range, northern end, 29

June 1948, L./. Brass 19348 (holo: BRI;

iso: A, CANB).

_Baeckeasp. (Tozer Range L.J/. Brass 19348)

in Henderson (1994),

Shrub to 2 m high. Bark grey, scaly, persistent.

Stem flanges brown, flat, not winged, warty,

margins entire. Leaves elliptic to obovate,

7.2—11.5 mm long, 3.0-6.5 mm wide, straight,

flat, obtuse, not keeled, entire; oil glands

visible on both surfaces; midrib visible; petiole

1.5—1.8mm long, yellow. Inflorescence axillary,

3- or 7- flowered; peduncle 5—11.5 mm long;

pedicels 3.5—5 mm long; bracteoles numerous

at top of peduncle, caducous, triangular, 0.5—0.9

x 0.2-0.3 mm, acute. Hypanthium obconical,

smooth, c. 2 mm long, fused to the ovary

throughout. Sepals simple, obtuse, thin, c. 0.8

x 1.8 mm, margins entire. Corolla white, up to

9.5 mm across; petals orbicular, 3.0-3.5 mm

across, entire or fimbriate; oil glands present.

Stamens 10—12(-14), irregularly arranged, very

rarely opposite a petal, stamens opposite sepals

shorter than remainder; filaments terete, c. 0.7

mm long, geniculate, with prominent brown

connective gland fused to upper part of

filament at the bend; anthers adnate, c. 0.3 mm

long, dehiscing by elliptical pores, anther loculi

partly fused. Style 0.3-0.9 mm long, lengthening

Austrobaileya 4(4): 627-645 (1997)

after anthesis, set into a pit; stigma broadly

capitate. Ovary 3-locular; floral disc concave

or flat; ovules 17-19 per loculus, arranged

radially around placenta. Fruit hemispherical,

c. 2 x 4 mm; valves triangular, somewhat

woody, at about rim level. Seeds D-shaped,

with flat sides and rounded backs, c. 0.6 mm

long, smooth, brown; hilum terminal. Fig. 1

A-D.

Specimens examined: Queensland. Cook District: 0.5

km SE of Mt Tozer, Sep 1976, Lavarack 1015 (BRD;

summit of Mt Tozer, Iron Range, Jul 1988, Thomas 300

(BRI). Cultivated: Currumbin Valley, Sep 1976, Jones

s.n. (PERTH); Atherton, Jan 1993, Bean 5730 (BRD;

Kilcoy, Jun 1993, Bean 6124 (BRI); Yandina, Dee 1993,

Bean 7196 (BRI); Swann Rd, Taringa, Brisbane, Mar

1995, Bean 8402 (A, BRI, K, L, MEL, NSW),

Distribution and habitat: B. tozerensis is known

only from granite rock crevices on the

windswept mountaintop and upper slopes of

Mt Tozer on Cape York Peninsula, Queensland

(Map 3). Some associated species are

Philotheca sp. (Mt Tozer L.J.Brass 19483),

Leptospermum purpurascens Joy Thomps. and

Grevillea pteridifolia Knight.

Phenology: Unknown for wild populations.

Cultivated plants may flower throughout the

year, except in winter.

Affinities: B. tozerensis is related most closely

to B. crenulata (see notes under that species).

It is also allied to B. virgata, because of its

ovules arranged radially around the placenta,

and the 3—7- flowered inflorescence.

Notes: This species was introduced into

cultivation as an ornamental in the early 1970s

by Bruce Gray (QRS) and David Jones (CANB),

and is now areasonably common garden subject

in Queensland. It is likely that all cultivated

plants are of the same genotype as the initial

plant grown. It is interesting to note that all

cultivated material examined has 7-flowered

umbellasters, while all of the wild-collected

Specimens seen have 3-flowered umbellasters.

Conservation status: The risk category for

Babingtonia tozerensis, according to the criteria

of Chalson & Keith (1995) is ‘endangered’

(criterion D). The species is known only from

the type locality. [tis under threat from its small

population size and specialised habitat.

D 2 TEER eg a a es le so econ ec ee Ui IM

Bean, Babingtonia

The recommended conservation status for

this species as defined by the Queensland Nature

Conservation Act 1992 is ‘endangered’.

Etymology: The species epithet, tozerensis,

refers to the locality (Mt Tozer) where the

Species OCCUTrS,

7, Babingtonia crenulata (F.Muell.) A.R.Bean

comb, nov.

Camphoromyrtus crenulata F.Muell., Trans.

& Proc. Victorian Inst. Advancem. Sci.

123 (1855); Baeckea crenatifolia

F.Muell., Fragm. 4:70 (1864), nom. nov,;

Baeckeacrenulata (F.Muell.) Druce, Bot.

Exch. Club Soc. Brit. Isles Supp. 2, p. 608

(1917), nom. illeg., non (Sm.) DC. Type:

Victoria. Buffalo Range, undated,

F,Muellers.n. ecto: MEL [MEL 72636]

(here chosen); isolecto: BM, K).

Harmogia crenulata Mig., Ned. Kruidk.

Arch, 4: 148 (1856). Type: Victoria. On

the Buffalo Creek and in the rocky valleys

towards Mt, Aberdeen, 28 February 1853,

F Muellers.n. (holo: MEL [MEL72635]).

Hlustration: L. Costermans, Native Trees &

Shrubs of S.E. Austral. p. 242 (1983) as

Baeckea crenatifolia.

Shrub to 2.5 m high. Bark unknown. Stem

flanges white to grey, flat, slightly winged,

warty, margins irregular, Leaves obovate,

4,2—6.1 mm long, 2.0-4.2 mm wide, straight,

flat in cross-section, obtuse, not keeled,

margins crenulate; oil glands visible on both

surfaces; midrib faintly visible; petiole 0.6—-0.9

mm long. Inflorescence axillary, 3-flowered,

rarely 4—7 flowered; peduncle 4.0-10.5 mm

long; pedicels 5.3-8.5 mm long; bracteoles

numerous at top of peduncle, caducous,

lanceolate, c. 1.4 x 0.3 mm, acute. Hypanthium

obconical, 1.6—1.9 mm long, smooth or faintly

5-ribbed, fused to the ovary throughout. Sepals

compound; inner lobe semiorbicular, 0.6-0.9

x 1.5—1.6 mm, thin, entire; outer lobe acute,

thick, 0.2—0.6 mm long, erect. Corolla white,

up to 9 mm across; petals orbicular, 3.0-3.5

mm across, entire; oil glands present. Stamens

12~—14, 1n groups of 1--3(4) opposite each sepal,

stamen opposite sepals shorter than remainder;

635

filaments terete, 0.6—-0.9 mm long, geniculate,

with brown connective gland fused to upper

part of filament at the bend; anthers adnate, c.

0,2 mm long, dehiscing by short divergent slits,

anther loculi free. Style c. 0.5 mm long, set

into a pit; stigma broadly capitate. Ovary 3-

locular; floral disc flat; ovules 16-18 per loculus,

arranged radially around placenta. Fruit

hemispherical, c, 2 x 3.5 mm; valves obtuse,

not woody, more or less at rim level. Seeds not

seen.

Specimens examined: Victoria. Buffalo Ranges, Mar

1853, Muellers.n. (MEL); Mt Aberdeen, undated, Mueller

s.n. (NSW); Buffalo Mountains, Jan 1892, Walter s.n.

(MEL); Buffalo Mts, Nov [903, Walter s.n. (MEL);

Rollasons Falls, on Buffalo Creek, Mt Buffalo NP, Jan

1982, Walsh 663 (MEL); Eurobin Creek, Buffalo, Dec

1902, Weindorfer 551 (MEL); Eurobin Creek Camp, Jan

1950, Robbins s.n. (MEL); Mt Hotham, Jan 1900, Maiden

s.n. (NSW).

Distribution and habitat: B. crenulata is

apparently confined to the Mt Buffalo National

Park and adjacent areas in southern Victoria

(Map 2) where it is known from two small

populations. There is also an old record from

Mt Hotham. It grows on creek banks in sandy

soil derived from granite.

Phenology: Flowers have been recorded from

November to March.

Affinities: B. crenulata is most closely related

to B. tozerensis, a species which inhabits the

Opposite end of the continent. B. crenulata

differs by its somewhat smaller leaves, crenulate

leaf margins and its compound sepals.

Conservation Status: The risk category for

Babingtonia crenulata according to the

criteria of Chalson & Keith (1995) is

‘endangered’ (criteria A, B1, B2 and D). Two

small populations are known; the Rollasons

Falls population lies entirely within Mt Buffalo

National Park, while only part of the Eurobin

Creek population lies inside the National Park

(Neville Walsh, Peter Jenkins, pers. comm.

1995). |

8. Babingtonia densifolia (Sm.) F.Muell.,

Fragm. 4: 74 (1864). Baeckea densifolia

Sm., Trans. Linn. Soc. London 3: 260

(1797); Harmogia densifolia (Sm.)

schauer, Linnaea 17: 238 (1843). Type:

636

New South Wales. Port Jackson, s. dat.,

White s.n. (holo:LINN, n.v., BRI

microfiche).

Baeckea fasciculata Spreng., Syst. Veg. 4:

Curae Posteriores 149 (1827). Type: Nov.

Holl., [in 1823], F.Steber 279 Caso: KB).

Harmogia propinqua Schauer, Repert. Bot.

Syst. 2: 921 (1843). Type: New South

Wales. Fork of Croker’s Range, W from

Wellington Valley and near Bathurst, Nov

1825, A. Cunningham 32/1825 Gso: BM,

K @G sheets)).

Harmogia bauertana Schauer, Repert.

Bot. Syst. 2: 921 (1843). Type: Nova

Hollandia, s. dat., F. Bauers.n. (holo: 7W,

n.v.).

Baeckea nova-anglica F.Muell., Fragm. 4:

71 (1864); Babingtonia nova-anglica

(F.Muell.) F.Muell., Fragm. 4: 74 (1864).

Type: New South Wales. near Tenterfield,

New England, s. dat., C. Stuart s.n. (iso:

Ks).

Illustration: K.A.W.Wiilhams, Native PI.

Queensl. 3: 36 (1987), as Baeckea

densifolia.

Shrub to 1.5 mhigh. Bark grey, scaly, persistent.

Stem flanges grey, flat, not winged, not warty,

entire. Leaves linear, |.8-4.5 mm long, 0.5—0.6

mm wide, straight, plano-convex, uncinate, not

keeled, entire; o1! glands visible on lower

surface; no veins visible; petiole c. 0.3 mm

long. Inflorescence axillary, 1-flowered;

peduncle 1.2—2.5 mm long; pedicels 0.4—1.0

mm long; bracteoles 2, narrowly triangular, c.

1.1 x 0.4 mm, caducous, acute. Hypanthium

smooth, obconical, 1.5—1.7 mm long, fused to

the ovary throughout. Sepals simple, obtuse,

O.4-0.6 x 1.2—1.5 mm, thin, entire. Corolla

white, up to 7.5 mm across; petals orbicular,

2.5—3.1 mm wide, entire; oil glands absent.

Stamens 7—10, opposite sepals or scattered,

stamens opposite sepals shorter than remainder;

filaments terete, c. 0.75 mm long, geniculate,

with black connective gland fused to upper part

of filament at bend; anthers adnate, c. 0.2 mm

long, dehiscing by elliptical pores; anther loculi

fused. Style c. 0.5 mm long, set into a pit;

stigma capitate. Ovary 3-locular; floral disc

concave; ovules 11-13 per loculus, arranged

Austrobaileya 4(4): 627-645 (1997)

radially on placenta. Fruit hemispherical,

1.5—1.8 x 2.2-2.5 mm; valves triangular, not

woody, exserted. Seeds cuboid, with flat sides

and rounded backs, surface smooth, c. 0.8 mm

long, brown; hilum terminal.

Selected specimens: Queensland. NortH KENNDEY

Districr: Mount Stewart Range, 14km NW of Homestead,

Sep 1991, Thompson 333 & Dillewaard (BISH, BRI).

SOUTH KENNEDY District: 53 km N of Jericho, Jun 1993,

Thompson JER78 & Fige (BRI). Mircreiyt District: on

Jericho-Blackall road, 20 km SW of Jericho, Jul 1989,

McKenzie (BRI). LetcHHarpt District: ‘Wallaroo’, 68 km

N of Injune, Nov 1993, Bean 6891 (BRI). MaRANoA

District: 6.6 km N of ‘Yoothapinna’, Injune district, Sep

1974, Gittins 2759 (BRI). Burnerr District: ‘Melrose’, 15

km W of Eidsvold, Aug 1990, Bean 2109 (BRD); SF 130,

2 km NW of Nantglyn, Oct 1988, Forster PIF4792 (BRI,

CANB, K, MEL, MO, NSW). Wipe Bay District: Timber

reserve 375 Boompa, south of Mt Walsh, Nov 1978,

Stanton s.n. (BRD, Dartinc Downs District: North Dulacca,

25 miles [42 km] NW of Miles, Sep 1955, Jackson s.n.

(BRI); Barakula State Forest, Oct 1984, Williams 84171

(BRI); headwaters of Pariagara Creek, 7 km W of Bringalily

Forestry lookout tower, Sep 1992, Forster PIF11664 &

Machin (BRI, MEL, PERTH); Lyra, Nov 1959, Blake

21087 (BRI, K, MO, NSW). New South Wales. Nort

WESTERN SLOPES: Fiagstone Hill, Howell, SSE of Inverell,

Powell 1114 & Armstrong (BRI, NSW); Pilligascrub,c.38

mules [61 km] N of Coonabarabran on Newell Highway,

Oct 1972, Williams s.n. (NE). CENTRAL TABLELANDS: Newnes

Junction, Blue Mtns, Dec 1911, Hamilton s.n. (A, NSW),

CENTRAL WESTERN SLopgS: Bumberry, Nov 1906, Boorman

s.n. (GH, NSW); Giants Creek, 28 km SE of Merriwa, Dec

1973, Streimann sn. (A, BRI, CANB, K, L); Harvey

Ranges, Peak Hill, Nov 1905, Boorman s.n. (A, BM).

CENTRAL Coast: Wedderburn, Sydney, Jan 1983, Lambley

s.n. (NE); 2 miles [3 km] from Marulan-Tallong road on the

Long Point lockout road, May 1954, Briggs s.n. (NE).

Distribution and habitat: B. densifolia has

a broad distribution extending from near

Charters Towers in north Queensland, south to

near Nowra in New South Wales, but usually

away from the coast (Map 2).

It inhabits heathland or open woodland

communities on rocky sites or in shallow sands.

Some associated species include Calytrix

tetragona Labill., Melaleuca tamariscina

Hook., Lophostemon confertus and Eucalyptus

petalophylla Brooker & A.R.Bean.

Phenology: Flowers have been recorded

between July and December; fruits have been

recorded between August and December.

Affinities: B. densifolia shows some affinity

with B. virgata in fruit morphology, and

STS SS DU ee ee en eg ee ee

Bean, Babingtonia

because the ovules are radially arranged around

the placenta. However, B. densifolia has 1-

flowered inflorescences while B&. virgata has

3—7 flowered inflorescences.

Conservation status; A widespread species

which is not rare or threatened.

9. Babingtonia behrii (Schitdl.) A.R.Bean

comb, nov.

Camphoromyrtus behrii Schlitdl., Linnaea

20: 651 (1847); Baeckea behrii (Schltdl.)

F.Muell., Fragm. 4: 68 (1864). Type:

South Australia. near Bethanien, 10

January 1845, H.H.Behrs.n. (holo: HAL).

Illustration: L.Costermans, Native Trees &

Shrubs of S.E. Austral. p. 242 (1983), as

Baeckea behrit.

Shrub to 2 m high. Bark light-grey, flaking,

persistent. Stem flanges pink or grey, flat, not

or slightly winged, warty, entire. Leaves linear,

3.3-9.0 mm long, 0.5—0.8 mm wide, straight,

plano-convex, uncinate, not keeled, entire; oil

glands prominent on lower surface, often

tuberculate on dried material; no veins visible;

petiole 0.5—O0.8 mm long. Inflorescence axillary,

3-flowered, but 1 or both lateral flowers

usually aborting before maturity; peduncle

3.5—5.2 mm long; pedicels |.2—2.6 mm long;

bracteoles 2, linear, c. 2.0 x 0.2 mm, acuminate,

caducous. Hypanthium obconical, 1.5-2.2 mm

long, smooth, fused to the ovary except at top.

Sepals simple, obtuse, 0.4-0.9 x 0.8-1.5 mm,

thin, entire. Corolla white, up to 10 mm across;

petals orbicular, 3.0-4.0 mm across, entire, oil

glands present. Stamens 9-12, not opposite

centre of petals, all about same length; filaments

terete, 0.6—1.2 mm long, geniculate, with yellow

connective gland fused to upper part of filament

at bend; anthers adnate, c. 0.4 mm long,

dehiscing by pores; anther loculi fused. Stylec.

0.8 mm long, set into a pit; stigma capitate.

Ovary 3-locular; floral disc flat; ovules 11-13

per loculus, arranged radially around placenta.

Fruit hemispherical, 1/7—2.2 x 3.0—-3.6 mm;

valves triangular, woody, atrim level or slightly

exserted. Seeds D-shaped, c. 0.8 mm long, with

flat sides and rounded backs, finely reticulate,

brown; hilum terminal.

Specimens examined: Victoria: Pink Lakes State Park,

Nov 1986, Chesterfield 1829 & Williamson (MEL); east

campground, Little Desert NP, Oct 1988, Overton 1061

637

(MEL); Winiam, Little Desert, Oct 1978, Errey 1495

(MEL); Red Bluff, Big Desert, Oct 1984, Albrecht 1206

(MEL); 100 m east of Border track, Big Desert, Apr 1985,

Ashburner 391 (AD, CANB, MEL, NSW); South park

area, Hattah Lakes NP, Sep 1969, Anderson 18 (MEL); NW

corner of Kiata~-Lowan sanctuary, Little Desert NP, Nov

1978, Cooke 214 (MEL); Sunset country, 91 km 209° from

Mildura, Oct 1977, Cununings 214 et al. (CANB, MEL,

PERTH); along Sunset track south of Rocket Lake, Nov

1980, Luly ANU30095 (MEL); Dimboola shire, Dec 1890,

Reader s.n. (MEL); 10 km south on track from Murrayville

to Nhill, Apr 1991, Spencer 1125 & Worbays (MEL); 14

km W of Nhill, Nov 1989, Nordenstam & Anderberg 1102

(MEL); Kingower, next to Gold Mine entrance, Apr 1991,

Spencer 876 & Worboys (MEL); W. Wimmera, Sep 1888,

French s.n. (GH); Mt Thackeray, Grampian Mtns, Nov

1921, Audas s.n, (A); Murrayville, Oct 1912, Williamson

s.n. (A); Dimboola, Oct 1911, Williamson s.n. (A);

Tarnagulla Flora Reserve, 0.8 km west of Tarnagulla, Nov

{989, Cheers 112 (MEL).

Distribution and habitat: B. behrii occurs in

north-western Victoria, especially in the Big

Desert and Little Desert, and with a disjunct

occutrence near Kingower NW of Bendigo

(Map 2). It also extends into South Australia

and Western Australia. It grows in heathlands,

shrublands and open mallee communities, in

sandy soils, often on sand dunes or ridges.

Associated species include Eucalyptus socialis

Miq., EE. incrassata Labill., Leptospermum

coriaceum (Mig.) Cheel, Melaleuca wilsonii

F.Muell., M. uncinata R.Br. and Micromyrtus

ciliata (Sm.) Druce.

Phenology: Flowers are recorded from

September to December, with one record in

February. Fruits are recorded from November

to April.

Note: The type locality of Camphoromyrtus

behrii, Bethanien, was asmall pioneer German.

settlement in South Australia, 3 km east of

Tanunda township. [tis now known as Bethany

(Kraehenbuehl 1981). Kraehenbuehl recorded

finding a small remnant ‘sand scrub’, on the

sandplain north-east of Tanunda, and close

to Bethany. This is likely to be where Behr

collected the type material of C. behrii.

Affinities: B. behrii is related to B. densifolia

and B. cunninghamil. From B. densifolia,

it differs by the uncinate leaf apex and the

otten 2- or 3- flowered inflorescence. From

B. cunninghamii, it differs by the linear leaves

with entire margins and the simple sepals.

638

Conservation status: A widespread and

common species; conserved in Little Desert

National Park.

10. Babingtonia cunninghamii (Schauer)

A.R.Bean comb. nov.

Harmogia cunningham Schauer, Repert.

Bot. Syst. 2: 921 (1843); Baeckea

cunninghamit (Schauer) Benth., FI.

Austral. 3: 82 (1867). Type: New South

Wales. west from Wellington Valley, in

1825,A. Cunningham 23/1825 (holo: BM,

photo BRD.

Shrub to | mhigh. Bark unknown. Stem flanges

grey or reddish, flat, not winged, not warty,

margins laciniate. Leaves triangular, obovate,

orbicular or oblong, |.2—2.4 mm long, 0.9—2.5

mm wide, straight, flat, obtuse, not keeled,

margins irregularly lobed or denticulate, rarely

entire; oil glands visible on lower surface; no

veins visible; petiole 0.4-0.7 mm long.

Inflorescence axillary, [1-3 flowered;

peduncle 1.0—3.8 mm long; pedicels 2.5-3.8

mm long, bracteoles 2-4, narrowly ovate, c.

0.4 x 0.1 mm, acute, caducous. Hypanthium

smooth, obconical, 1.2—-1.5 mm long, fused to

the ovary except at top. Sepals compound;

inner lobe obtuse, 0.4-0.5 x 0.7—1.1 mm, thin,

entire; outer lobe acuminate, 0.8—1.1 mm long,

thin, erect or spreading. Corolla white, up to

7mm across; petals orbicular, 1.6—2.5 mm

across, margins entire; oil glands present.

Stamens 7-9, scattered, all about same length;

filaments terete, c. 0.6 mm long, geniculate,

with brown connective gland fused to upper

part of filament at the bend; anthers adnate, c.

0.2 mm long, dehiscing by short divergent slits;

anther loculi fused. Style 0.4-0.8 mm long, set

into a pit; stigma capitate. Ovary 3-locular;

floral disc concave; ovules 12—14 per loculus,

arranged radially around placenta. Fruit

hemispherical, 1.5—1.9 x 2.1—2.5 mm; valves

triangular, chartaceous, at rim level or

enclosed. Seeds D-shaped, c. 0.6 mm long, with

flat sides and rounded backs, finely reticulate,

brown; hilum terminal.

Specimens examined: New South Wales, NorRTH WESTERN

PLAINS: 30 miles [48 km] from Narrabri on the

Coonabarabran road, Nov 1964, McReadie s.n. (NSW);

Bohena Creek to Boggabni, Aug 1911, Jensen s.n. (NSW).

Austrobaileya 4(4): 627-645 (1997)

NortH WESTERN SLopes: Pilliga Nature Reserve, 2.7 km

along No | break road off highway, Nov 1993, Forster PIF

14204 & Machin (AD, BRI, CANB, MEL, NSW); Pilliga

East SF, on Newell Highway, Nov 1985, Mackay 408 (NE,

NSW); Timallallee SF, old Baradine road, Nov 1985,

Mackay 416 (NE, NSW); Timallallee Creek at Newell

Highway, Nov 1976, Fox s.n. (NSW). CENTRAL WESTERN

SLopEs: Bumberry, Nov 1906, Boorman s.n. (GH, NSW);

0,7 km S of road from Sandy Hollow to Bylong, 2.6 km

from Baerami, Sep 1985, Abell 154 (BRI, NSW); c. 12 km

from Rylstone on Breakfast Creek road, W of Breakfast

Creek on Rylstone-Bylong road, Oct 1987, Coveny 12754

(NSW, PERTH); Killonbutta S.F., Forbes district, Nov

1968, Turner s.n. (NSW); Reedy Creek, Rylstone, Sep

1938, Cross s.n. (NSW); Lue near Mudgee, Apr 1901,

Boorman s.n. (NSW); Lower Dingo Creek, Goulburn River

valley, c.4km W of Baerami, Nov 1984, James 6041 et al.

(K, NSW, PERTH); Baldry, Aug 1964, Debenham s.n.,

(NSW); Bearbong road, Nov 1961, McReadie s.n. (NSW);

Goulburn River, 35 miles [56 km] NW of Rylstone, Aug

1969, Ryan s.n. (NSW); Fern-Tree Gully, c. 25 km NNW

of Kandos, Dec 1990, Ford 183 (NSW); near Cobbarah,

Oct 1907, Forsyth s.n. (NSW); Home Rule near Gulgong,

Dec 1916, Boorman s.n. (NSW); Manildra ‘Claremont’,

Nov 1992, Schinid s.n. (NSW).

Distribution and habitat: B. cunninghamii 1s

endemic to New South Wales and occurs west

of the Great Dividing Range between Pilliga

State Forest and Cowra (Map 1). It grows in

shrubby eucalypt woodland in sand or sandy

loam, and may be associated with Eucalyptus

fibrosa subsp. nubila (Maiden & Blakely)

L.A.S.Johnson, &. rossitR.T. Baker & H.G.Sm.,

Callitris endlicheri (Parl.) F.M.Bailey,

Melaleuca thymifolia Sm. and Leucopogon

spp.

Phenology: Flowers are recorded between

September and December, and fruits from

November to April.

Affinities: B. cunninghamii 1s a distinctive

species by virtue of its small irregularly lobed

leaves. It is related to B, behrii but differs

greatly in leaf morphology and by its

compound sepals. B. cunninghamii 1s also

related to B. jucunda but differs from that by

the ovules radially arranged around the placenta,

and the often 3-flowered inflorescence (1-

flowered in B. jucunda).

Conservation status: A widespread species

which is not rare or threatened.

nh TEATS ELE SL En ey tie so sh ULE ett 7s a a OPO

Bean, Babingtonia

11. Babingtonia jucunda (S.T.Blake)

A.R.Bean comb. nov.

Baeckea jucundaS.V.Blake, Proc, Roy. Soc.

Queensland 69: 75 (1958). Type:

Queensland. DARLING Downs DISTRICT:

Glenmorgan, October 1957, D.Gordon

s.n. (holo: BRI; iso: A, CANB, MEL).

Illustration: K.A.W.Williams, Native PI.

Queens]. 2:52 (1984), as Baeckea Jucunda.

Shrub to 2.5 m high. Bark grey, rough, with

shallow vertical fissures. Stem flanges grey,

flat, not winged, not warty, entire. Leaves

obovate, 1.5—3.0 mm long, 0.9-1.2 mm wide,

recurved, concavo-convex, apex acute, not

keeled, entire or denticulate; oil glands

prominent on lower surface; no veins visible;

petiole 0.25—0.5 mm long, black. Inflorescence

axillary, 1-flowered; peduncle 1.5—2.2 mm long;

pedicels 2.0-4.2 mm long; bracteoles 2,.

cymbiform, c. 0.8 x 0.2 mm, acute, persistent.

Hypanthium campanulate, 1.9-2.0 mm long,

5-ribbed, otherwise smooth, fused to the ovary

except at top. Sepals compound; inner lobe

obtuse, c. 0.5 x 1.0 mm, thin, fimbriate; outer

lobe obtuse, c. 0.3 mm long, thick, erect.

Corolla white, up to 7 mm across; petals

orbicular, 2.0-2.8 mm across, margins

fimbriate; oil glands present. Stamens (3)4—5,

mostly opposite the sepals, all about the same

length; filaments terete, c. 0.5 mm long,

geniculate, with brown to black connective

_ gland fused to upper part of filament at the

bend; anthers adnate, c. 0.25 mm long, dehiscing

by short divergent slits; anther loculi fused.

Style c. 0.5 mm long, set into a pit; stigma

broadly capitate. Ovary 3-locular; floral disc

concave; Ovules 8—9 per loculus, arranged in

two longitudinal rows on placenta. Fruit

broadly-obconical, c. 1.5 x 3.5 mm, 5-ribbed;

valves woody, exserted. Seeds cuboid, with flat

sides and rounded backs,c. 1.0 mm long,

reticulate, brown; hilum terminal.

Specimens examined; Queensland. MARANOoA DISTRICT:

Silver Springs, c,35kmS of Surat, Aug 1992, Schefe CMW

1320 (BRI). LetcuHarpt District: Woleebee road, 15 km

W of Gurulmundi, Aug {977, Williams 77166 (BRI).

Burnett District: Waaje, north-west corner of Barakula

SF, Mar 1994, Bean 7561 (BRI, NSW). DarLinc Downs

District: 45 km NW of Chinchilla, Aug 1982, Dillewaard

943 (BRI, NSW); near Miles, Aug 1978, Noswortlry s.n,

639

(BRI); Chinchilla-Tararoad, 24kmS ofcross-road junction

of Condamine Highway, Oct 1975, Williams 75073 (BRD;

2.7 km NW of Kogan, Nov 1993, Bean 6844 (BRI, MEL,

NSW); 6.4 miles [10.3 km] SW of Kogan on Tara road, May

1961, Smith 11352 (BRD; Moonie Highway, 61 km from

road junction to Lake Broadwater, May 1989, Williams

89012(AD, BRD; Western Creek SF, c. 8 km W of Western

Creek Forestry Station, Jul 1994, Grimshaw PG851 &

Taylor (BRD; 40 miles [64 km] north of Goondiwindi, Jul

1958, Johnson 546 (BRD. New South Wales. Nortu

WESTERN PLains: Pilliga East SF, County Line road, 1 km

N Cubbo Creek SF, Dec 1987, Mackay 507 (NSW),

Distribution and habitat: In Queensland,

B, jucunda occurs as far north as the Great

Dividing Range, north of Chinchilla and Miles.

It is otherwise scattered through the western

Darling Downs, and appears to be quite

common around Kogan. In New South Wales

there is asinglerecord ofitfrom the Pilliga area

(Map 3). The species grows in heathland or

woodland on rocky lateritic pavements with

gravelly loam or red sandy soil. Associated

species include Acacia catenulata C.T.White,

Casuarina inophlota F.Muell. & F.M.Bailey,

Eucalyptus trachyphloia F.Muell. and

Homalocalyx polyandrus (F.Muell.) Benth.

Phenology: Flowers have been recorded

between May and December, but Hando (1988)

suggested that it may flower at any time, in

response to rain, Fruits can be found at most

times of the year.

Affinities: B. jucunda is most closely related to

B. prominens and B. silvestris but differs from

these species by its fewer stamens, smaller

leaves and the 5-ribbed hypanthium. B. jucunda

differs from B. cunninghamit by the strictly 1-

flowered inflorescences and the ovules arranged

in 2 rows on the placenta.

Note: Blake (1958) recorded 3 to 6 stamens in

the flowers of B. jucunda. The presence of six

Stamens in a flower must be a rare occurrence

as I was unable to find any such flowers.

Conservation status: Although this species is

sporadically distributed, it is not considered to

be rare or threatened. No conservation coding

is watranted at this time.

12. Babingtonia prominens A.R.Bean sp. nov.

B. jucundae atfinis a qua folus majoribus,

bracteolis longioribus, hypanthio muricato

et staminibus pluribus differt. Typus: New

640

South Wales. Nortu Coast: 1 km north-

east of Nymboida, 25 April 1994,

A.R.Bean 7672 (holo: BRI; iso: A, K,

MEL, NSW).

Shrub to 2.5 m high. Bark grey, scaly and

persistent. Stem flanges grey, flat, winged, not

warty, entire. Leaves elliptic, 3.5-4.1 mm long,

1.8—2.1 mm wide, straight or somewhatcurved,

flat, obtuse, not keeled, entire; oil glands

prominent on lower surface, evenly scattered;

midrib not or faintly visible; petiole c. 0.5 mm

long. Inflorescence axillary, 1-flowered;

peduncle 1.0—2.5 mm long; pedicels 2.5—6.0

mm long; bracteoles 2, linear, 1.5—2.5 x 0.40.5

mm, acute, persistent. Hypanthium obconical,

2.0—2.5 mm long, muricate, fused to the ovary

except at top. Sepals compound; inner lobe

obtuse, 0.3-0.5 x 1.0-1.3 mm, thick, entire;

outer lobe acuminate, 1.0-1.3 mm long, thick,

erect. Corolla white, up to 6 mm across; petals

orbicular, 2.6—3.0 mm across, fimbriate, oil

glands absent. Stamens 8-10, one stamen

opposite each sepal, the remainder scattered,

but never opposite a petal; filaments terete, not

geniculate, sepaline filaments c. 0.5 mm long,

other filaments c. 0.8 mm long, with brown

connective gland; anthers adnate, c. 0.3 mm

long, dehiscing by small slits; anther locult

fused. Style c. 0.5 mm long, set into a pit;

stigma broadly capitate. Ovary 3-locular;

floral disc concave; ovules 10-11 per loculus,

arranged in two longitudinal rows on placenta.

Fruit hemispherical, 2.0-2.2 x 3.5-4.0 mm;

valves woody, slightly exserted. Seeds D-

shaped, with flat sides and rounded backs, c.

1.0 mm long, minutely reticulate, pale brown;

hilum terminal. Fig. 1 E-L.

Specimens examined: New South Wales. NortH Coast:

Wild Cattle Creek SF, Dorrigo district, Sep 1993, Binns

4325 (BRI, NSW); | km north-east of Nymboida, Nov

1994, Bean 8039 (BRI, MEL, NE, NSW).

Distribution and habitat: B. prominens is

apparently confined to the Nymboida area of New

South Wales where it is known from two

populations (Map 1). It grows on steep hillsides,

on shallow sandy soils derived from sandstone

or granite, in association with Eucalyptus

pyrocarpa L.A.S.Johnson & Blaxell or E.

acmenoides Schauer.

Austrobaileya 4(4): 627-645 (1997)

Sereeasraariae

Canes 10

COPS HE

ERE

145 150 [55

Map 1, Distribution of Babingtontia spp.

A B. prominens.

Phenology: Flowers have been recorded in

April, September and November; fruits have

been found in April and November.

Affinities: B. prominens differs from B. jucunda

by its larger leaves, muricate hypanthium and

more numerous stamens. B. prominens

differs from 8B. silvestris by its muricate

hypanthium (smooth for B. silvestris); leaves

with a length:breadth ratio of 1.7—2.2:]

(1.2—1.7:1 for B. silvestris); petals without oil

glands, petals 2.6—3.0 mm long (1.5—2.3 mm

Shy py nyyiniiote sec on une Lu Mh en ng 4 ai Sei gh aft eo ee er ee eee ee ee ee i eT

Bean, Babingtonia

for B. silvestris);and 10 or 11 ovules per loculus

(7 or 8 for B. silvestris).

Conservation status: The risk category for

Babingtonia prominens according to the

criteria of Chalson & Keith (1995) is

‘endangered’ (criterion Cl). The species is

known from two populations. The population

of B. prominens at the type locality 1s large,

with over athousand plants. At the other known

locality, there are less than 50 plants.

Etymology: The epithet prominens ts Latin for

prominent and refers to the relatively large

flowers which are conspicuously displayed on

long peduncles.

13. Babingtonia silvestris A.R.Bean sp. nov.

B. prominenti atfinis aqua hypanthio laevi,

petalis minoribus glandulis oleosis

ferentibus et ovulis paucioribus in quoque

loculo differt. Typus: Queensland.

DARLING Downs District: Bald Mountain,

SW section of Girraween National Park,

27 January 1995, A.R.Bean 8221 (holo:

BRI; iso: AD, CANB, K, L, MEL, NSW,

PERTH).

Shrub to 2.5 m high. Bark grey, finely lined or

grooved, to slightly fibrous, furrowed. Stem

flanges grey, flat, not winged, not warty, entire.

Leaves ovate to elliptic, 3.0-4.5 mm long,

1.5-3.3 mm wide, straight, flat, obtuse, not

keeled, entire; oil glands visible on lower

surface, scattered; midrib not or faintly visible;

petiole 0.6—1.0 mm long. Inflorescence axillary,

1-flowered, rarely 3-flowered; peduncle 1.2—2.5

mm long; pedicels 2,.7~4.0 mm long; bracteoles

2, ovate, c. 2.5 x 1.2 mm, persistent,. obtuse.

Hypanthium smooth, obconical, 2.2—2.8 mm

long, fused to the ovary except at top. Sepals

compound; inner lobe obtuse, c. 0.3 « 1.0 mm,

thin, margins entire; outer lobe acuminate,

|.3-1.7 mm long, thick, erect or spreading.

Corolla white, up to 8 mm across; petals

orbicular to elliptic, 1.5—2.3 x 2.0-2.4 mm,

margins fimbriate; oil glands present. Stamens

8—10, none opposite the petals, stamens

opposite sepals slightly shorter than remainder;

filaments terete, c. 0.8 mm long, geniculate,

with brown connective gland fused to upper

part of filament at bend; anthers adnate, c. 0.3

mm long, dehiscing by short divergent slits;

641

anther loculi fused. Style c. 0.2 mm long, set

into a pit; stigma broadly capitate. Ovary 3-

locular; floral disc concave; ovules 7-8 per

loculus, arranged in two longitudinal rows on

placenta. Fruit hemispherical, 2.0-2.5 x 4.5—-5.0

mm; valves triangular, woody, exserted. Seeds

cuboid, with flat sides and rounded backs, c. 1

mm long, minutely reticulate, brown; hilum

terminal. Fig. 1 J-N.

Specimens examined: Queensland. DARLING Downs

DistricT: south-western side of Girraween N.P., near Bald

Mountain, Sep 1974, McDonald 447 (BRI); Girraween

N.P., highridges N.E. of Castle Rock, Mar 1976, Grimshaw

s.n. (BRI); southern slope of Bald Mountain, SW section of

Girraween NP, Sep 1994, Grimshaw G979 & Turpin (BRI).

New South Wales. NortH Coast: Dibbs Head, about 8

miles [13 km] east of Dorrigo, Aug 1972, Williams 72-204

(BRI, NE). Cultivated: Coffs Harbour, ex Mobong Falls,

NW of Dorrigo, Feb 1995, Nef! s.n. (NE).

Distribution and habitat: B. silvestris is

known from a few scattered localities, namely

the Girraween National Park near the

Queensland-New South Wales border, Mobong

Falls near Dorrigo, and the Dorrigo National

Park east of Dorrigo. (Map 3). It grows in

mixed shrublands in pockets of soil amongst

bare granite or rhyolite rock outcrops, associated

with species such as Eucalyptus prava

L.A.S.Johnson & K.D.Hill, Leptospermum

brevipes F.Muell., Leucopogon melaleucoides

DC. and Lepidosperma laterale R.Br. Nearby

areas support forest tree species, including

Eucalyptus campanulataR.T.Baker & H.G.sm.

and E. saligna Sm.

Phenology: It apparently flowers sporadically

over several months of the year (pers. obs.)

Affinities: B. silvestris is closely related to

B. prominens (see notes under that species).

B, silvestris differs from B. jucunda by its

larger leaves, longer bracteoles, entire margins

of its inner sepals, and the greater number of

Stamens.

Conservation status: The risk category for

Babingtontia silvestris according to the criteria

of Chalson & Keith (1995) is ‘endangered’

(criteria Bl and B2). The species is known

from three populations. At the type locality,

between 55 and 75 plants of reproductive age

have been counted. The population sizes for

642

the other localities are not known, but they are

probably not larger than the type population.

The recommended conservation status for

this species as defined by the Queensland

Nature Conservation Act 1992 is ‘endangered.

Etymology: The epithet, Latin for of the forest,

or woods, refers to the species’ habitat.

14. Babingtonia squarrulosa (Domin)

A.R.Bean comb. nov.

Baeckea squarrulosa Domin, Biblioth. Bot.

89: 450 (1928). Type: Queensland. NorTH

KENNEDY District: sandstone of Dividing

Range near Pentland, February 1910,

K.Domin s.n. (holo: PR (2 sheets)).

Shrub to 1.4 m high. Bark grey, persistent,

furrowed. Stem flanges grey, flat, not winged,

not warty, entire. Leaves broadly ovate to

orbicular, 0.9-1.5 mm long, 0.6—1.4 mm wide,

recurved, concavo-convex, acute or obtuse,

keeled, entire or minutely denticulate, oil glands

visible on lower surface, scattered; no

veins visible; petiole 0.1-0.25 mm long.

Inflorescence axillary, 1-flowered; peduncle

absent; pedicels absent; bracteoles 2, ovate, c.

1.5 x 1.0 mm, persistent, acute. Hypanthium

smooth, broadly obconical, 1.5—1.6 mm long,

fused to the ovary throughout. Sepals compound;

inner lobe obtuse, 0.4—0.5 x 1.0-1.1 mm, thin,

margins fimbriate; outer lobe acuminate,

0.7~—1.2 mm long, thick, spreading or erect.

Corolla white, up to 6 mm across; petals

orbicular, 1.8-2.0 mm across, margins

fimbriate, oil glands present. Stamens 8-10,

scattered, but never opposite centre of petals,

antesepalous stamens slightly shorter than

remainder; filaments terete, c. 0.5 mm long,

geniculate, with brown connective gland fused

to upper part of filament at the bend; anthers

adnate, c. 0.2 mm long, dehiscing by short

divergent slits; anther loculi fused. Style c. 0.6

mim long, set into a pit; stigma capitate, trilobed.

Ovary 3-locular; floral disc flat or concave;

ovules 6-8 per loculus, arranged in two

longitudinal rows on placenta. Fruit

hemispherical, 1.3~—1.8 x 2.3—3.5 mm; valves

obtuse, not woody, exserted after dehiscence.

Seeds D-shaped, with flat sides and rounded

backs, c. 1.2 mm long, tuberculate, pale brown;

hilum terminal. Fig, 2 A-D.

Austrobaileya 4(4): 627-645 (1997)

Specimens examined: Queensland, Norty KENNEDY

District: Burra Range lookout, SW of Pentland, Feb 1994,

Bean 7490 & Forster (A, BRI, K, L, MO, NSW); Burra

Range Lookout, White Mountains NP, May 1995, Forster

PIF16489 & Figg (BRI, CANB, MEL, NSW). MitcHELt

District: Upper Torrens Creek area, Flinders shire, Nov

1983, Lawrie s.n. (BRI); near Old Poison Valley road,

White Mountains NP, Apr 1992, Bean 4323 (BRI, DNA,

MEL, NSW, PERTH); 22 km NE of Torrens Creek, Apr

1993, Thompson HUG386 et al. (BRD; 17.5 km NE of

Torrens Creek, Apr 1993, Thompson HUG4O00 etal. (BRD.

Distribution and habitat: B. squarrulosa is

known from a restricted area west of Pentland

on and near the Great Dividing Range (Map 3).

It inhabits heathland on sandstone outcrops,

adjacent to stunted specimens of Eucalyptus

trachyphloia, E. leichhardtit F.M.Batley or

Acacia shirleyi Maiden.

Phenology: Flowers have been collected in

February, April and November; fruits have

been collected in April.

Affinities: B. squarrulosa is similar to

B. jucunda, but is readily distinguished by its

sessile flowers (pedicellate in B. jucunda),

acuminate outer sepals (obtuse in B. jucunda)

and its 8-10 stamens (3-5 for B. jucunda). Its

small imbricate leaves are reminiscent of the

genus Micromyrtus, aS was pointed out by

Domin (1928).

Conservation status: The risk category for

Babingtonia squarrulosa according to the

criteria of Chalson & Keith (1995) 1s

‘vulnerable’ (criteria Bl, B2 and D1). The

Species is currently known from six populations

within an area of about 40 x 20 km.

The recommended conservation status for

this species as defined by the Queensland

Nature Conservation Act 1992 is ‘vulnerable’.

15. Babingtonia granitica A.R.Bean sp. nov.

B. odontocalyci affinis a qua foliis

latioribus, petalis minoribus, ovulis

paucioribus in quoque loculo et staminibus

paucioribus differt. Typus: Queensland.

DaRLING Downs District: The Pyramid,

Girraween National Park, 2 January 1994,

A.R. Bean 7263 (holo: BRI; iso: CANB,

K, MEL).

Baeckea sp. 3, Stanley & Ross, Flora S.E.

Queensl. 2: 127 (1986).

anita hse Una bos eva sun gi t DLS DO ist an a RN a a a OS chek, Ja tie Gade Ga Se

Bean, Babingtonia

140 145 150 155

COREE

a. | aie

ORY

HERE

Cope eA

145 150° 155

Map 2. Distribution of Babingtonia spp.

@ B. densifolia, a B. behrii, * B, crenulata.

Baeckea sp. (Wyberba F.D. Hockings AQ

$305) in Henderson (1994).

Shrub to 2 m high. Bark grey, longitudinally

fissured, Stem flanges white to grey, flat, not

winged, not warty, entire. Leaves oblanceolate,

2.9—-3.3 mm long, 0.7/-1.4 mm wide, straight,

plano-convex, acute, not keeled, entire or

minutely denticulate; oil glands conspicuous

on lower surface; no veins visible; petiole

0.5—O.7 mm long. Inflorescence axillary, 1-

flowered; peduncle 0.5—1.1 mm long; pedicels

0.6-1.5 mm long; bracteoles 2, narrowly-

643

conical, cymbiform,c. 1.6 x 0.5 mm, persistent,

apex acute. Hypanthium obconical, 1.5—-1.9

mm long, papillose, fused to the ovary except

at top. Sepals compound; inner lobe obtuse,

0.4—0.5 x 0.8-0.9 mm, thin, margins fimbriate;

outer lobe triangular, 1.0—-1.5 mm long, thick,

apex acuminate. Corolla white, up to 6 mm

across; petals orbicular, 1.8-2.2 mm across,

margins fimbriate; oil glands present. Stamens

5-9, often 7, some opposite sepals and others

placed between sepals and petals, stamens

opposite sepals shorter than remainder;

filaments terete, 0.3-0.5 mm long, geniculate,

with a brown connective gland fused to the

upper part of filament at bend; anthers adnate,

c. 0.2 mm long, dehiscing by elliptical pores;

anther loculi fused. Style c. 0.6 mm long, set

into a pit; stigma broadly capitate. Ovary 3-

locular; floral disc concave; ovules 8—9 per

loculus, arranged in two longitudinal rows on

placenta. Fruits and seeds not seen. Fig, 2 E~G.

Specimens examined: Queensland. DARLING Downs

District: W yberba, around the top of the first Pyramid, Dec

1972, Hockings s.n, (BRD; near Doctors Creek, 4 km NE

of Lyra, Jan 1995, Bean 8216 (BRI, NSW); Portion 130, 7.5

km NW of Ballandean, Nov 1994, Halford Q2339 (BRI,

MEL),

Distribution and habitat: B. granitica is

endemic to the ‘Granite Belt’ in the extreme

south of Queensland near Stanthorpe (Map 1)

where itis known from three small! populations.

it grows in shallow peaty soil associated with

crevices in extensive granite outcrops.

Phenology: The species flowers between

November and January.

Affinities: B. graniticais mostclosely related to

B. odontocalyx as both species have papillose

hypanthia with acuminate outer lobes, and

relatively narrow leaves. B. granitica differs

from B. odontocalyx by its 5—9 stamens (11-13

in B. odontocalyx), broader leaves, smaller

petals and 8~9 ovules per loculus (12-14 in

B. odontocalyx). B. granitica 1s also similar

in appearance to B. densifolia, but is readily

distinguished by its muricate hypanthium with

acuminate outer lobes.

Conservation status: The risk category for

Babingtonia granitica according to the

criteria of Chalson & Keith (1995) is

644

‘critical’ (criterion A). The species is known

from three populations; nine plants have been

observed at the type locality, and one plant at

the Doctor’s Creek locality. The Ballandean

population is on leasehold land and has fewer

than 20 plants (D. Halford pers. comm.)

The recommended conservation status for

this species as defined by the Queensland

Nature Conservation Act 1992 is ‘endangered’.

Etymology: The epithet granitica refers to the

eranite substrate upon which this species is

found.

16. Babingtonia odontocalyx A.R.Bean sp.

nov. B. graniticae affinis a qua foliis

angustioribus, petalis majoribus, ovulis

numerosioribus et staminibus 11-13

differt. Typus: New South Wales. NortH

WESTERN SLOPES: 24 km NNW of

Emmaville, along road to “The Gulf’, |

January 1994, A.R. Bean 7261 (holo: BRI;

iso: MEL, NSW).

Baeckeasp. A, Flora of New South Wales 2:

184 (1991).

Shrub to 2 m high. Bark grey, fibrous, persistent.

Stem flanges grey to white, flat, not winged, not

warty, entire. Leaves linear, 3.1-4.5 mm long,

0.5-0.8 mm wide, straight, plano-convex to

concavo-convex, obtuse, not keeled, entire; ol

glands conspicuous on lower surface; no veins

visible; petiole c. 0.5 mm long. Inflorescence

axillary, l-flowered; peduncle 0.6—1.0mm long;

pedicels 0.5—2.0 mm long; bracteoles 2, linear,

c.2.5 x 0.4 mm, persistent, acute. Hypanthium

obconical to hemispherical, 1.5—1.8 mm long,

papillose, fused to the ovary except at top.

Sepals compound; inner lobe semiorbicular, c.

0.5 x 0.7 mm, thin, margins fimbriate; outer

lobes triangular, [.3-1.6 mm long, thick,

acuminate. Corolla white, up to 8 mm across;

petals orbicular, 2.6—3.1 mm across, margins

fimbriate, oil glands present. Stamens 11-13,

with one short stamen opposite each petal,

others longer; filaments terete, c. 0.25 mm or

0.5 mm long, geniculate, with brownconnective

gland fused to upper part of filament at bend;

anthers adnate, c. 0.2 mm long, dehiscing by

elliptical pores; anther loculi fused. Stylec. 0.4

mm long, setinto a pit; stigma broadly capitate.

Ovary 3-locular; floral disc flat; ovules 12—14

Austrobaileya 4(4): 627-645 (1997)

Tp HTT

ERE Th

145 i350 155

Map 3, Distribution of Babingtonia spp. @ B. tozerensis,

A B. silvestris, @ B. Jucunda, * B. squarrulosa.

per ioculus, arranged in two longitudinal rows

on placenta. Fruit hemispherical, c. 1.7 x 3.2

mm; valves triangular, woody, slightly exserted.

Seeds D-shaped, with flat sides and rounded

backs, c. 0.8 mm long, surface reticulate, pale

brown; hilum terminal. Fig. 2 H—L.

Specimens examined; New South Wales. NorTHERN

TABLELANDS: Dingo Creek, 14 km NW of Torrington, Jan

1968, Wissmanns.n. (BRI, NE); 3.9kmE of the Torrington-

Silent Grove road, turnoff 17.7 km N of Torrington, Oct

1990, Coveny 14685 et al. (BRI, NSW, PERTH). Nort

WESTERN Scopes: 2.7 km E along the Flagstone Creek track

from the Gulf Road, c. 18 km (direct) just W of N of

Emmaville, Oct 1990, Coveny 14626 etal. (BRI, CBG, NE,

Bean, Babingtonia

NSW); 25 km NNW of Emmaville, towards ‘The Gulf,

Dec 1990, Bean 2781 (BRI, NSW); 4.8 km along Flagstone

Creek road, off Emmaville to The Gulf road, Apr 1995,

Forster PIF 16413 (BRI, K,SMEL, NSW).

Distribution and habitat: B. odontocalyx is

confined to a relatively small area of granite

hills around Torrington and north of Emmaville

in far northern New South Wales (Map 4), It

occurs in pockets of soil on bare granite outcrops

in association with Leptospermum novae-

angliae Joy Thomps., Eucalyptus prava and

Callitris sp.

Phenology: Flowers are borne in December

and January, and fruits shortly afterwards.

Affinities: B, odontocalyx is most closely

related to B. granitica. See affinities section

under that species.

Conservation status: The risk category for

Babingtonia odontocalyx, according to the

criteria of Chalson & Keith (1995), is

‘vulnerable’ (criteria B1 and D1). The species

is known from several scattered populations

over a distance of about 35 km.

Etymology: The epithet is derived from the

Greek odontos-tooth and calyx-calyx, in

reference to the prominently acuminate sepals

of this species.

Acknowledgements

I am grateful to Paul Grimshaw for his

persistent and ultimately successful efforts to

relocate B. silvestris in Girraween National

Park, to John Williams for supplying material

of B. silvestris from New South Wales; to the

Directors of A, BM, GH, HAL, K, MEL, NE,

NSW, P, PERTH, PR and UC for the loan of

specimens and/or access to their collections, to

Laurie Jessup and Barry Conn for locating and

photographing types during their time as

Australian Botanical Liaison Officer at Kew, to

lan Brooker for the Latin diagnoses, to Will

smith for the illustrations and to Paul Forster

for making collections and for comments on a

draft of this paper.

645

References

BEAN, A.R. (1995). Reinstatement and Revision of

Triplarina Raf. (Myrtaceae). Austrobaileya 4:

353-67.

BENTHAM, G. (1865). In Bentham & Hooker, Genera

Plantarum p. 702, London: Lovell Reeve & Co.

— (1867), Baeckea. In Flora Australiensis 3: 71-89.

Lovell Reeve & Co: London.

BLAKE, S.T. (1958). New and Critical Genera and Species

of Myrtaceae subfamily Leptospermoideae from

eastern Australia. Proceedings of the Royal Society

of Queensland, 69: 75-88.

CHALSON, J.M. & KerrH, D.A. (1995). A Risk Assessment

Scheme for Vascular Plants: Pilot Application to

the Flora of New South Wales. Hurstville: National

Parks and Wildlife Service.

Dawson, J.W. (1992). Flora de la Nouvelle-Caledonie et

Dependances, 15, Myrtaceae-Leptospermoideae.

Museum National d’ Histoire Naturelle: Paris.

DomIN, K. (1928). Beitrige zur Flora und

Pflanzengeographie Australiens. Bibliotheca

Botanica 89, E. Schweizerbart: Stuttgart.

HaAnbo, V, (1988). Plants of Western Darling Downs,

Barakula-Gurulmundi and South-west Burnett. In

R. Hando (ed.), Going Bush with Chinchilla Nats

pp. 96-171. Chinchilla: Chinchilla Field Naturalists

Club Ine.

HENDERSON, R.J.F. (ed.) (1994). Queensland Vascular

Plants: Names and Distribution. Brisbane:

Queensland Department of Environment & Heritage.

JOHNSON, L.A.S. & Bricas, B.G. (1985). Myrtales and

Myrtaceae—A Phylogenetic Analysis. Annals of the

Missouri Botanical Garden 71: 700-56.

KRAEHENBUEHL, D.N. (1981). Dr H.H. Behr’s two visits to

South Australia in 1844-45 and 1848-49. Journal

of the Adelaide Botanic Gardens 3: 101-23.

Merrit, E.D, (1928). A Collection of Plants from Sarawak.

Sarawak Museum Journal 3: 513-46.

MUELLER, F, (1864), Baeckea. In Fragmenta Phytographiae

Australiae 4: 68-74, Government Printer:

Melbourne.

SCHAUER, J.C, (1843), Genera Myrtacearum Nova vel Denuo

recognita. Linnaea 17; 235-44.

TRUDGEN, M.E, (1987). Ochrosperma, a new genus of

Myrtaceae (Leptospermeae, Baeckeinae) from New

South Wales and Queensland. Nurytsia 6: 9-17.

one enna ry ep vt Lev ies nnn

A new species of Thryptomene Endl. and a new species

of Ochrosperma ‘Yrudgen (Myrtaceae) from the

Northern Territory, Australia

A.R.Bean

Summary

Bean, A.R. (1997). A new species of Thryptomene Endl, and a new species of Ochrosperma Trudgen

(Myrtaceae) from the Northern Territory, Australia. Austrobaileya 4(4); 647-65 |. Thryptomene remota

A.R.Bean and Ochrosperma sulcatum A.R.Bean are described and illustrated. Notes on distribution,

affinities and conservation status are given, A key to all species of Ochrosperma is included.

Keywords: taxonomy, Myrtaceae, Tiryptomene, Thryptomene remota, Ochrosperma, Ochrosperma

sulcatum, Northern Territory, Australia.

A.R. Bean, Queensland Herbarium, Meiers Road, Indooreepilly Queensland 4068, Australia

Introduction

Numerous new plant taxa from the Kakadu

National Park and adjacent areas of the

Northern Territory have been discovered and

named in recent years. Many of them are rare

and apparently relictual in distribution. The

species named in this paper, Thryptomene

remota and Ochrosperma sulcatum, ate two

such species. T. remota was first collected in the

{960s and there have been many collections of

it since, from a number of localities, In contrast,

O. sulcatum was discovered by Kym Brennan

of Jabiru in December 1990, and is currently

known from just one small population.

Thryptomene is an endemic Australian

genus established by Endlicher in 1838 with a

single species, 7. australis Endl. Numerous

species belonging to it were named in the

following decades, and Bentham (1867)

recorded 17 species for Australia. A sectional

classification of Thryptomene was provided by

Stapf (1924), Green (1986) accepted 32 species

for the genus.

The genus Ochrosperma was crected

by Trudgen (1987) to accommodate some

species previously included under Baeckea L.

All previously described Ochrosperma species

are from eastern Australia (Trudgen 1987, Bean

1995).

Accepted for publication 15 April 1996

Taxonomy

1. ThryptomeneremotaA.R.Beansp. nov. affinis

T. stenophyllae autemin florescentiis

pedunculatis, petalis cremeis albisve

orbicularibus calycis lobis majoribus

auriculatis, antheris poris dehiscentibus

differt. Typus: Northern Territory. Top of

Jim Jim Falls, 13°17°S 132°5 VE, 29 January

1981, CR. Dunlop 5642 (holo: BRI; iso:

AD, CANB, DNA, MEL, NSW, PERTH).

Baeckea sp., Lazarides et al. (1988).

Erect shrub 0.3—3 m high, glabrous. Bark grey,

rough, finely fibrous. Stem flanges grey, flat,

not warty, not winged, with margins entire.

Leaves opposite, spreading, linear to

oblanceolate, 3.3-6.0 mm long, 0.71.0 mm

wide, plano-convex, not keeled, with apex

obtuse or with a tiny mucro; oil glands

prominent, scattered; margins entire; petioles

0.5—0.8 mm long. Flowers 5-merous; peduncles

0.9-1.3 mm long, solitary, axillary. Bracts

absent; bracteoles 2, persistent, cymbiform,

1.5—1.8 x 1.3-1.5 mm, connate at base, with

thick central longitudinal ridge and thin

transparent lateral zones, apex acute, margins

entire. Floral hypanthium obconical, 0.9-[.2

mm long, muricate; calyx lobes 5, obtuse or

sometimes mucronate, 0.9-1.0 x 1.4—1.5 mm,

persistent in fruit, thick and opaque towards

centre, thin and transparent near edges, with

648

small auricles extending below top of

hypanthium, margins entire or minutely

fimbriate. Petals 5, orbicular, 1.5-—1.8 mm across,

white or cream, folded back over top of ovary

after anthesis; oil glands present; margins

minutely fimbriate. Stamens 10, | opposite

each calyx-lobe and petal; filaments terete,

straight, 0.4—0.5 mm long; anthers versatile,

dorsifixed, c. 0.15 mm long, bilocular, dehiscing

by small pores; gland on the connective truncate

or compressed-urceolate, compound, about as

long as anther. Floral disc concave. Style terete,

c.0.5 mm long, c. 0.1 mm wide; stigma capitate,

papillose. Ovary inferior, I-locular, fused to

hypanthium almost throughout; ovules 2,

collateral, laterally attached to a small basal

placenta. Fruit indehiscent, not expanded. Seeds

not seen. Fig. 1 F—J.

Specimens examined: Northern Territory, Upper Magela

Creek, Jul 1972, Byrnes 2700 (CANB, DNA, K); 10 miles

[16km}S of Yaimanyi Ck, Jun 1972, Byrnes 2689 (CANB,

DNA, K, NSW); 42 km SEof Oenpelli, Jun 1978, Latz7773

(CANB, DNA); 21 km N of Jim Jim Falls, near entrance to

Deaf Adder Gorge, May 1980, Lazarides 9074 (CANB,

DNA); 23.5 km WSW of Twin Falls, May 1980, Craven

6199 (CANB, DNA); 6 km ESE of Twin Falls, May [980,

Craven 5836 (CANB, DNA); Deaf Adder Gorge, Feb

1977, Fox 2501 (BRI, CANB, DNA, K, MEL, NE, NSW);

Mt Gilruth, Mar 1984, Craven & Wightman 8328 (CANB,

MEL); Kakadu N.P., Apr 1990, Dunlop 8597 & Munns

(AD, CANB, DNA, MEL, NSW); Kakadu N.P., 14km Eof

Sleisbeck, Apr 1990, Leach 2745 & Cowie (BRI, DNA,

MEL, NSW, PERTH); Kakadu N.P., c. 4 km S of El

Sharana, Apr 1990, Slee & Craven 2645 (CANB, MEL).

Jim Jim Falis, Barrk Malam Walk, Dec 1989, Forster

PIF6125(BRD.

Distribution and habitat: T. remota is

distributed in the Northern Territory, in the

Kakadu National Park and adjacent areas of

Arnhem Land to its east, between the latitudes

12° and 14°S. It inhabits shrubland or shrubby

open woodland on sandstone rock pavements. If

is associated with species such as Eucalyptus

phoenicea F.Muell., Pityrodia spp., Triodia

microstachya R.Br., Micratraspp., Homalocalyx

ericaeus F.Muell. and Calycopeplus collinus

P.1.Forst.

Phenology: Fertile specimens have been

collected between November and July.

Affinities: T. remota belongs to Thryptomene

sect. Astraea Stapf as defined by Stapf (1924)

because of its flowers with 10 stamens, rugose

Austrobaileya 4(4): 647-651 (1997)

hypanthia and anthers dehiscing by pores or

short slits. It is most closely related to

T. baeckeacea F.Muell. and 7. stenophylla

E.Pritzel from south-western Western Australia.

It differs from T. baeckeacea by its longer

leaves which lack a keel, and the often fimbriate

margins of the calyx lobes. T: remota differs from

T. stenophylla by the pedunculate inflorescences,

creamy or white orbicular petals, larger auriculate

calyx lobes and anthers dehiscing by pores.

Conservation status: The risk category for

Thryptomene remota according to the criteria

of Chalson & Keith (1995) is ‘low risk’.

T. remotaisreportedly common within its range

which is partly within the Kakadu National

Park.

Etymology: The specific epithet remota refers

to the geographical remoteness of the new

species from its nearest relatives in south-

western Western Australia.

2. Ochrosperma sulcatum A.R.Bean sp. nov.

affinis O. lineari autem folus sessilibus

longitudinaliter striatis, hypanthio ante

anthesin dorsiventraliter compresso

floribus sessilibus, calycis lobis rigidis

acuminatis differt. Typus: Northern

Territory. Hollow Rock, 17 km ENE of

Jabiru airstrip, 12°37’S, 133°03’E, 26

November 1994, K. Brennan 2955 (holo:

BRI; iso: DNA, K, MEL, NSW, PERTH

distribuend1).

Shrub to 30 cm, glabrous, stems pendulous.

Bark brown, flaky to papery. Stem flanges grey,

not warty, not winged, margins entire. Leaves

sessile, opposite, spreading, linear, 3.5-5.5 mm

long, 0.4—0.5 mm wide, longitudinally striate,

concavo-convex, usually somewhat curved over

its length, oil glands very small and obscure,

scattered; margins entire. Flowers 5-merous,

sessile, axillary, solitary; flower buds completely

enclosed by leafy bracts and bracteoles; bracts

2, persistent, pale green with white membranous

margins, lanceolate, c. 2.5 x 0.6 mm, keeled,

conduplicate; bracteoles 2, identical to bracts

except slightly shorter. Floral hypanthium

slightly dorsiventrally compressed, c. 1.5 mm

long, irregularly ribbed; calyx-lobes 5, narrowly-

triangular, 1.0-1.3 mm long, rigid, erect,

acuminate, with shallow irregular lobes at base.

seen dene nine deni hi ebieidtn ddd ees ee eee te PEERED eee ee tt

sai

Bean , Thryptomene and Ochrosperma 649

hte ha!

toe ae

*+*

Pre so eas

gol Jp ete

= 4

= * *

ae NG

#* oe

+ fa

‘

+ ‘S %.

SaPE

vi ‘a ol =

eee

= . +

arid &

oot ao,

H Ta é Ee

4-34a4 Toy:

my Ee

eater “~ wy teh

wh’

ney

eden es

ff.

: ae

* +*_ F

ark =

“* us + aS, 4 ei

a Catt dae ny A,

* 4 4 eat*e shen i* Les

+ ow

tadd Sets

ae te

ay ori

*v ® '

let

a ae

+ give

ae pie

age Ea

+ ad

a¥

pra

a tnt eS

a | il ¥ 244

. pa Fi.

‘2 * aahae™ 5 1+ +

sake pal sdaet ttt as t, Ey 4 re

*) etsy Th eight irkted ery +.

et ede tee pees tere

Cg 1

* “yt oa. ay! ni ety +, a,” _

Fail ta ed weet Pea te

+ + an

‘fin kgs Ayan tg ts

Fig, 1. A—E: Ochrosperma sulcatum, A. flowering branchlet x 5. B. flower with bracts and bracteoles x 10, C. transverse

SUS st ee Se

Shapes

PP Ltr Ted bh tel lle ttt tt tt tt hr rite t iti tie

. Sorte rir ob A

a Silat

section of flower x 15. D. leaf x 15, E, seed x 30. P-J: Thryptomene remota. F, branchlet showing axillary flower x 10. G.

lateral view of flower x 15, H. leaf x 5. L. petal x 20. J. stamen x 40. A-E, Brennan 2955; F—J, Forster PIF6125.

650

Petals 5, elliptical to orbicular, 0.9—1.0 x 0.6-0.9

mm, pale brown when dry, erect, not spreading,

broad-based, oil glands visible, margins entire.

Stamens 5, antesepalous; filaments slightly

flattened at base, straight, 0.5—0.6 mm long;

anthers versatile, dorsifixed, c. 0.25 mm long,

bilocular, dehiscing by longitudinal slits; gland

on connective globular, stmple, c. half length of

anthers. Floral disc concave. Style cylindrical,

not tapering, 0.8—1.0 mm long, 0.25—-0.4 mm

wide, inserted shortly into the ovary, not

exceeding the calyx-lobes or stamens, flat-

topped; stigma indistinguishable from style.

Ovary inferior, 3-locular, fused to hypanthium

throughout; ovules 2 per loculus, collateral.

Fruit capsular, actinomorphic; hypanthtum

cylindrical, 1.8—2.0 mm long, 1.5-1.9 mm in

diameter; surface smooth, grey. Calyx lobes

erect, rigid, persistent, 1.0-1.4 mm long,

acuminate, not keeled; fruiting valves small,

inconspicuous. Seeds brown, turgid, reniform,

c. 1.0mm long, arillate; aril white, clasping hilar

region; hilum in centre of concave side, testa

crustaceous, shiny, tuberculate, with tubercles

in longitudinal rows. Aborted ovules flattened,

translucent, brown, not developing as chaff.

Fig. 1 A-E.

Additional specimen examined: Northern Territory. 17

km ENE of Jabiru Airstrip, Dec 1991, Brennan 1655 (BRI,

DNA, MEL, NSW).

Distribution and habttat: O. sulcatumis known

only from the type locality east of Darwin in

the Northern Territory. It grows on sandstone

cliff-faces in association with Mitrasacme

geniculosa Dunlop (K.Brennan, pers. comm.).

Phenology: Flowers and fruits have been

recorded in November and December.

Affinities: This species is placed in

Ochrosperma because of the 3-locular ovary,

hypanthium adnate to the ovary almost

throughout, arillate reniform seeds, 2 collateral

ovules per loculus and 5 almost-terete

antesepalous stamens.

A closely related genus 1s Rinzia Schauer,

which shares with this species the character

of reniform, arillate ovules and seeds. Some

species of Rinzia have 2 collateral ovules per

loculus but all Rinzia species have 10 stamens

Austrobaileya 4(4): 647-651 (1997)

(one opposite each sepal and petal) with broad,

flattened filaments. Most species of Scholtzia

Schauer have 2 ovules per loculus, but they

are superposed and are not reniform in shape;

furthermore the inflorescence of Scholtzia is

nearly always cymose (solitary and axillary in

Ochrosperma).Ochrosperma sulcatum differs

from all other species in Ochrosperma by its

dorsiventrally flattened and wrinkled floral

hypanthium, smooth cylindrical fruiting

hypanthium, thick cylindrical style, rigid

acuminate calyx-lobes, sessile flowers and erect

petals which are shorter than the calyx-lobes.

Conservation status: The risk category for

Ochrosperma sulcatum, according to the

criteria of Chalson & Keith (1995) is

‘critical’ (criteria D and B2). 100-200 plants

have been observed at the type locality, which

is just outside the present eastern boundary of

Kakadu National Park.

ktymology: The species epithet is derived from

the Latin word sulcatus, meaning furrowed or

grooved, inreference to the prominent striations

on the leaves of this species.

Note: O. sulcatum conforms to all of the eight

distinguishing characters for Ochrosperma listed

by Trudgen (1987), except ‘fruit opening very

widely’. In O. sulcatum, the hypanthium retains

its cylindrical shape even after the seeds are

shed. This and the erect rigid calyx lobes and

wrinkled floral hypanthium are very distinctive

in Ochrosperma.

To the eight characters listed by Trudgen,

I would add a ninth, namely “foliar oil glands

very small, obscure’. This character holds for

all five species of Ochrosperma, and is in marked

contrast to most or all other Baeckea-like plants

from eastern Australia which have conspicuous

oil glands, at least on the abaxial surface of the

leaves.

med ae ee en i eee te ree Terre tes ce cee a tt nt nae .

VASSN Ramapo sa Sod valent nd pitt

Bean, Thryptomene and Ochrosperma 651

Key to the species of Ochrosperma

1. Leaves obovate or elliptical, 1.0-3 mm wide ........... cc cece ee ee eee eee 2

eaves SHeat SO Wide oc oe eserves te bares etna Gre a eternal $9 woes Gu dt etate ys wees 3

2. Leaves lemon-scented; petals 0.8-1.0 mm across ......... 0.00 eee QO. citriodorum

Leaves not lemon-scented; petals 1.8-2.2 mm across .............00005 QO, oligomerum

3. Stamens 6—8 per flower; fruits 3.3-4.0 mm wide .......... 000 eee eee QO. adpressum

Statics) per Hower! Tuite 4 S=257 wii Wide 2. gs ha cea ee nee nabs ee eee 4

4, Calyx lobes acuminate, rigid, 1.0-1.3 mmlong ................05. sete Wee re QO. sulcatum

Calyx lobes obtuse, soft, 0.3-O0.5 mm long ..... 0... cece ees Q. lineare

Acknowledgements

Iam very grateful to Kym Brennan for collecting

material of O. sulcatum under difficult conditions

at the hottest time of the year. | would also like

to thank the Directors of MEL, NSW and DNA

for access to their herbaria and/or specimen

loans, Les Pedley for the Latin diagnoses and

Will Smith for the illustrations.

References

Bean, A.R. (1995). A New Species and New Combination

in Ochrosperma Trudgen (Myrtaceae).

Austrobatleya 4(3): 387-90,

BENTHAM, G. (1867). Thryptomene, In Flora Australiensis

3: 57-63. Lovell Reeve: London.

CHALSON, J.M. & KerrH, D.A. (1995). A Risk Assessment

scheme for Vascular Plants: Pilot Application to

the Flora of New South Wales. Hurstville: National

Parks and Wildlife Service.

Green, J.W. (1980). Thryptomene and Micromyrtus

(Myrtaceae) in arid and semi-arid Australia. Nuytsia

3: 183-209.

—- (1986). Thryptomene, In Flora of South Australia 2:

948-50, South Australian Government Printing

Division: Adelaide.

LAZARIDES, M., CRAVEN, L.A., DUNLOP, C.R., ADAMS, L.G.

& Byrnes, N. (1988). A Checklist of the Flora of

Kakadu National Park and Environs, Northern

Territory, Australia. Australian National Parks and

Wildlife Service: Canberra.

StTaPF, O. (1924). Thryptomene thymifolia. Curtis’s

Botanical Magazine 149: t, 8995.

TrupGEN, M.E. (1987). Ochrosperma, a new genus of

Myrtaceae (Leptospermeae, Baeckeinae) trom New

South Wales and Queensland. Nuytsia 6; 9-17.

Plectranthus amoenus and P. thalassoscopicus (Lamiaceae),

new species from north-eastern Queensland, Australia

Paul [. Forster

Summary

Forster, Paul I. (1997). Plectranthus amoenus and P. thalassoscopicus (Lamiaceae), new species from

north-eastern Queensland, Australia. Austrobaileya 4(4): 653-660. Plectranthus amoenus and

P. thalassoscopicus are described and illustrated, Affinities and conservation status of both species are

discussed, P, amoenus is considered a Vulnerable species and P. thalassoscopicus a Rare species under

the Queensland Nature Conservation Act 1992.

Keywords: Plectranthus amoenus; Plectranthus thalassoscopicus; Lamiaceae; Australia; Queensland,

Paul I. Forster, Queensland Herbarium, Meiers Road, Indooroopilly Queensland 4068, Australia

Introduction

New taxa of Plectranthus L’ Herit. continue

to be discovered in Queensland and the

opportunity is taken here to describe two

new species subsequent to those previously

enumerated (Forster 1994). Exploration of new

areas and the small islands of suitable substrate

that occur within them are likely to result in

further discoveries as is the case with both of

the taxa named herein. As discussed previously,

speciation in Plectranthus has occurred

repeatedly in these sorts of habitats (Forster

1994), The description of so many novelties in

recent years for Queensland Plectranthus has

resulted in occasional scepticism by referees

and botanists who restrict their studies to dried

specimens without recourse to field studies or

examination of live material cultivated under

similar conditions. While the process of gradual

publication of these new taxa may have resulted

in the impresston that most taxa are extremely

restricted in distribution, it may have partially

obscured the reality that there are also many

species that are wide ranging in distribution

(e.2.P. eraveolens R.Br., P. parviflorus Willd.,

P, argentatus S.V.Blake and P. suaveolens

S.T.Blake). These wide ranging species are also

restricted in their occurrence to particular

habitats, but because the islands of habitat are

relatively widespread and not too disjunct from

aT a I el

Accepted for publication 15 April 1996

one another, they cover more geographical area.

The genus Plectranthus is still poorly collected

within Australia and further new taxa can be

expected.

1, Plectranthus thalassoscopicus

In 1993, Keith Halfpapp of Mareeba discovered

and collected cuttings of a succulent species of

Plectranthus ona ‘bushwalk’ at Mt Bell, Malbon

Thompson Range, east of Gordonvale in north-

eastern Queensland. This material was cultivated

both at Mareeba and Brisbane where

examination of subsequent flowering material

revealed it to be undescribed. Description of

P. thalassoscopicus, prior to an eventual full

revision of the Australian taxa, is necessary to

enable its inclusion in an account of the world’s

succulents being published by the International

Organisation for Succulent Plant Study (IOS) in

Zurich.

Plectranthus thalassoscopicus P.I.Forst., sp.

noy. affinis P. aprepto S.T.Blake et

P, pulchello P.I.Forst. autem ab illo foltis

succulentis non nitidis, lamina foliorum

sine trichomatibus glandulosis infra, cum

glandulis sessilibus aurantiacis, ab hoc

foliis dentibus [3 vel 141n quoque margine

praeditis, lamina foliorum cum glandulis

sessilibus auranttacis, ab uterque bracteis

triangulari-ovatis, 2.2-2.4 mm longis,

2.2-2.5 mm latis, differt. Typus:

Queensland: Cook Disrrictr: North Bell

654

Peak summit area, Malbon Thompson

Range, 17°05S’S, 145°52’E, 12 Nov 1995,

PI. Forster 18048, R.L. Jago & R. Jensen

(holo: BRI[2 sheets]; iso: K, MEL, QRS).

Subshrub to 60 cm high; foliage slightly

aromatic when crushed; non-glandular and

glandular trichomes colourless; sessile glands

8-celled, orange. Roots fleshy-fibrous. Stems

square in cross-section, semi-erect to straggling,

succulent, the lower parts up to 20 mm diameter,

pink-purple; seedling-derived stems without

thickened tuberous base, with non-glandular

trichomes antrorse, sparse, 2~8-celled and up to

2mm long, glandular trichomes scattered and

sessile glands absent. Leaves discolorous,

petiolate; petioles 10-35 mm long, 2.5-4 mm

wide, + flattened on top with non-glandular

trichomes antrorse, sparse, 2—8-celled and up to

2 mm long, glandular trichomes scattered and

sessile glands absent; lamina narrow-ovate to

ovate, succulent, 20-100 mm long, 14-80 mm

wide, crenate with 13 or 14 teeth up to 4 mm

long on each margin, secondary teeth present;

tip acute; base rounded to truncate; upper surface

grey-green with veins impressed, non-glandular

trichomes divaricate, sparse, 4—8-celled and up

to 1.5 mm long, glandular trichomes dense,

sessile glands absent; lower surface pale green,

veins raised, with non-glandular trichomes

antrorse, sparse to dense, 4—8-celled and up to

1.5 mm long, glandular trichomes absent

and orange-coloured sessile glands dense.

Inflorescence up to 350 mm long, 1—5-branched

from near base; verticillasters 8—14-flowered,

up to 17 mm apart; pedicels 3-4 mm long, c. 0.2

mm diameter with non-glandular trichomes

antrorse, sparse, 2—4-celled and up to 0.2 mm

long, glandular trichomes scattered and sessile

glands generally absent although there may be

an occasional scattered one; cymes sessile; axis

Square in cross-section with non-glandular

trichomes sparse, antrorse, 2—8-celled and up to

I mm long, glandular trichomes scattered and

sessile glands absent; bracts triangular-ovate,

2.2—2.4mm long, 2.2—2.5 mm wide, not forming

a coma with non- glandular trichomes antrorse,

sparse, 4—6-celled and up to 1 mm Jong, glandular

trichomes absent and sessile glands scattered.

Flowering calyx 2.8-3 mm long, with non-

glandular trichomes antrorse, sparse, 2—4-celled

and up to 0.4 mm long, glandular trichomes

Austrobaileya 4(4): 653-660 (1997)

scattered and sessile glands sparse. Fruiting

calyx 44.6 mm long; upper lobe orbicular-

ovate, 2.6-3 mm long, 2.8-3 mm wide; lateral

lobes lanceolate, 2~2.2 mm long, 1.2—1.4 mm

wide; lower lobes lanceolate-falcate, 2—2.4 mm

long, 0.8—1 mm wide. Corolla 9-11 mm long,

lilac; tube 4.5—5 mm long, curved at 90—100°

2—2.3 mm from base, slightly inflated upwards,

glabrous apart from scattered, divaricate 2—4-

celled non-glandular trichomes up to 0.2 mm

long; upper lobes +orbicular, erect to recurved,

2,2—2.8 mm long, 2.5—3 mm wide, non-glandular

trichomes sparse, divaricate, 2—-4-celled and up

to 0.4 mm long, glandular trichomes absent,

sessile glands sparse; lateral lobes oblong, 2—2.5

mm long, [—-1.2 mm wide, glabrous apart from

an occasional sessile gland; lower lobe ovate,

5—6 mm long, 4-5.5 mm long, non-glandular

trichomes sparse, divaricate, 2—4-celled and up

to 0.4 mm long, glandular trichomes absent,

sessile glands sparse. Filaments filtform, 7—9

mm long, c. 0.2 mm diameter, lilac, fused for

44.5 mm from base; anthers c. 0.4mm long and

0.3 mm wide. Style filiform, 7—9 mm long, lilac,

bifid for c. 0.4 mm. Nutlets +circular in outline,

+ flattened, 0.9-1 mm long, 0.9-1 mm wide,

0.6—0.7 mm thick, glossy brown, smooth. Fig.

Additional specimens examined: Queensland. Cook

District: Bell Peak, 17°0S’S, 145°52’E, 1993, Halfpapp

s.n. (BRI, QRS); ditto, Jul 1995, Jago 3533 (BRD.

Distribution and habitat: Plectranthus

thalassoscopicus 1s known only from the

type locality at 800-950 m altitude. While much

of the natural vegetation in this areais composed

of rainforest, many of the higher mountain

peaks have small areas of rock outcrops and

pavements, often with a highly endemic flora.

P. thalassoscopicus, as with most Plectranthus

species in Australia, grows on rock outcrops

and pavement. The rock 1s grantte at the type

locality.

Notes: P. thalassoscopicus belongs to the

most highly diverse group of Plectranthus in

Australia, 1.e. those that are perennial subshrubs

or shrubs, with inflorescences branched 1-7

times near the base, sessile cymes, and bracts

not forming aconspicuous woolly coma (Group

5 of Forster 1994). Species morphologically

similar to P. thalassoscopicus in this group are

655

Forster, Plectranthus

* " “45

a 7 ."

sr *

Rea 4% *

1 *

ant, it

Jt,

a ea

bier

eet

ra!

rere eee nee ee ee an tat

Fig. 1. Plectranthus thalassoscopicus. A. flowering stem x 0.5, B. adaxial leaf surface x 1. C. abaxial leaf surface x I.

D. verticillaster x 2. E. side view of flower x 5, F. face view of flower x 5. G. side view of calyx x 5, All from live material

of Halfpapp s.n. (BRI). Del. W.Smith.

i ETE EN PI iv A EB PRE BERS PRRINT rend cri

656

P. apreptus S.T.Blake and P. pulchellus

P.].Forst. P. apreptus occurs in moist lowland

sites (up to 550 m altitude according to Blake

1971) on granite near Cairns and differs most

noticeably from P. thalassoscopicus in its habit

(a herb to 40 cm high with fleshy stems and

fleshy leaves), leaf morphology (thin, upper

surface glossy), leaf indumentum (lower leaf

surface with glandular trichomes, sessile glands

yellow) and bracts (orbicular-ovate to ovate,

1.2—1.8 mm long). P. pulchellus occurs on

sandstone clifflines some 650 km north-north-

west to the locality of P. thalassoscopicus

and differs noticeably in habit (aherb or subshrub

to 40 cm high), leaf morphology (margins with

6—12 teeth), indumentum cover (lower surface

without sessile glands) and bracts (broadly ovate,

1.7—2 mm long, 1.5—1.7 mm wide).

Austrobaileya 4(4): 653-660 (1997)

Conservation status: As yet P. thalassoscopicus

appears to be an uncommon plant in nature.

Mt Bell is an isolated peak in the Malbon

Thompson Range and had not been botanically

explored prior to 1993. Other high points to the

north and south in this range remain unexplored

botanically and it is possible that the species 1s

not restricted to this single locality. At present

there are no obvious threats to this plant. An

appropriate conservation coding is “R’ (Rare) as

defined by the Queensland Nature Conservation

Act 1992.

Etymology: Named from the Greek thalassa

‘the sea’ and skopos ‘a watcher’ (cf. Johnson

1989), referring to the habitat of this species

facing the sea.

In my key to the species of Plectranthus in Queensland (Forster 1994), P. thalassoscopicus will key

to couplet 29 where its combination of characters will contradict the key. P. thalassoscopicus can

be keyed if another couplet 1s added -

29. Stems, leaves and racemes with dense glandular trichomes ..............

Stems, leaves and racemes with scattered glandular trichomes ................005 29a

29a. Leaf undersurface with glandular trichomes....... 0.00.0 e eee eee P, apreptus

Leaf undersurface without glandular trichomes ...... 0.0.00. cece ee ee tee tees 30

30. Leaf undersurface without sessile glands

re Pe eo eA ee P. pulchellus

Leaf undersurface with dense, orange-coloured sessile glands....... P, thalassoscopicus

2. Plectranthus amoenus

It seems remarkable that this species, which

occurs in such close proximity to Atherton and

Herberton, has escaped notice until relatively

recently.

Plectranthus amoenus P.I.Forst., sp. nov.

affinis P. graveolenti R.Br. a qua foltis

marginibus crenatis cum dentibus 32-44

(non serratis cum dentibus 10-30),

trichomatibus glandulosis in foliorum

pagina supera absentibus (non

trichomatibus sparsis usque dispersis),

bracteis rhomboideis (non obovatis usque

late obovatis) et multo majoribus (8—10.5

mm longis et5.5—7.5 mm latis non 1.5-4.8

mm longis et 1.5—4 mm latis), corollae

lobis superioribus amplioribus (3—3.8 mm

longis et 2.5-3.2 mm latis non 1—2.2 mm

longis et 1-2.2 mm latis) corollae lobo

inferiore suborbiculare (non oblongo-

ovato) latiorique (5.8-8 mm lato non

2.4—-5.5 mm lato), differt. Typus:

Queensland. Cook District: Baldy Mt,

Atherton, Jun 1991, P. I. Forster 8488

(holo: BRI [2 sheets]; iso: MEL, QRS).

657

Forster, Plectranthus

eT as | +

mg ot to Te Prey -

ee ga a ee he papers mi ® -. — We 2 - as ha *

Babee LAE EUR aE Cer ae Bors Sat ete, Triviner rica, ESS Tet 3

: ee, Seay Ae _# by Pa aftutae Pict ing . ar “a t

+ Ted a hol ae fi *, + + — a

.e EES eae ee Ee matte ret te me ratte irae 3 rette Pt see dal tis

a 1s - on hk a site mh 1a fat \ el a = te aye Rat a - neh tedoy * ta

1% 34 eee et SAS

4 + Pe +} = * *

kw ort at ' oo * ono

“sas Fi en Fe Lae eet ty rate CAs etal . et: 1. qe + he * “* L aha =

fi erst pre pat Satie i. ye Te « in Ba TS wt &

a + See Seer yet a Tae " wie. tt et pai 2 bat vot yee

is Hj “ repel se oe a eva ett +i; = ar vat i. atta et war . atiate or

re ; eats ga aot aearé ASN tg 2a a TF -_ =, ht 4% La . **

cE i erat Bek eas Se ear Bp aeeesgths rose SrtA s et

et Pa Fea tape LE ee ai | a ae Fh get te te ‘

ene be

PT ol hh

7 hey

4qcf

be att

SIE aTedtt

ants

beer

aau8

ane

ord tee

eee a lt

SE, ead elt slate Aeaiditlal dietdielted. i ane

+1, ee ca ae id cd »! Tope ark rae

> o a*

esa es tet Fi eee

hin

* Pt fa

* * et L dad * r

se Teh He Le BS

+ / + ra ta ge aa

a ea ~~» * at Mand eh Ae Mig at

et rey i Le i La att Oe afte “

i ale A Fe FS ™ id a ee ee

wre TA BE De Us

“ny oe ao ates er 8 t's a es a*

ra oo ee F oFen, ar “o i) Tit. hares -"t, * pn, ~“ iar lie Lee “

ater ee ei tel ae = sO “ete ho ae af 3 "ar

twp. * = r ee el we gh tee oe tte ate F

aay ‘te ie i r FJ aap Pt La ™, “ a mj

Oe Hy ee we te te t a ee pos fe

b Pe ee Lal he to, et eee ae ‘ay “s+ Pe * * ) ae

* va St ile te ee ie a ee Pe ete he

Pay Tee bbe yee ts wots, te SST fe, eee ae ES 4p,

faa geht 7 paes ee ed Ce en * a

5 cal “ OT a Ae der oe te Seat mit ty ee a", :* Ps, abe ie

LL Th ee wate FAs set oe MS Rea a a ty

verticillaster x 2. E. floral bract x 4. F. side view of flower x 4. G. face view of flower x 4. All from live material of Forster

Fig, 2, Plectranthus amoenus. A. flowering stem x 0.6. B. adaxial leaf surface x 1. C. abaxial leaf surface x |. D.

8488 (BRI), Del. W.Smith.

oe en ee LE

ce ee eee eeeet eden eaneeee dt UOC Te OOe ete ETRE teeny pee meen ir ci i eg OP ME Vin a SS LET SES STS ES POMS SE Meek ee 7B argh oo BS PSS Ee EE ace aah tans teen pope

658

Subshrub to 50 cm high; foliage with faint sweet

scent when crushed, clammy to touch; non-

glandular and glandular trichomes colourless,

sessile glands 8-celled and orange coloured.

Roots fibrous. Stems square in cross-section,

erect, fleshy with the lower parts + woody

and up to 10 mm diameter, green, with non-

glandular trichomes divaricate, scattered, 6-8-

celled and up to 1.5 mm long, glandular trichomes

sparse and sessile glands scattered. Leaves

discolorous, petiolate; petioles 2-14 mm long,

1.8-3 mm wide, grooved on top with non-

glandular trichomes divaricate, scattered,

6—10-celled and up to 2 mm long, glandular

trichomes dense and sessile glands scattered;

lamina ovate, fleshy, 10-95 mm long, 9-60 mm

wide, crenate with 16~22 teeth 1.5-3.5 mm

long on each margin, widest above middle,

secondary teeth usually present; tip acute; base

cuneate to rounded; upper surface green, veins

impressed, with non-glandular trichomes

antrorse, dense, 4—6-celled and up to 0.5 mm

long, glandular trichomes absent and sessile

glands sparse; lower surface silver- green, veins

raised, with non-glandular trichomes divaricate,

dense, 4-6-celled and up to | mm long, glandular

trichomes sparse and sessile glands dense.

Inflorescence up to 180 mm long, comprising

1-3 branches from near the base; verticillasters

18—20-flowered, up to 15 mm apart; pedicels

2.5—3 mm long, 0.4—0.5 mm diameter with non-

glandular trichomes absent, glandular trichomes

sparse and sessile glands absent; cymes sessile

to shortly pedunculate to 2 mm long; axis square

in cross-section, with non-glandular trichomes

divaricate, scattered, 4-6-celled and up to 2.5

mm long, glandular trichomes dense and sessile

glands scattered; bracts rhomboid, 8—10.5 mm

long, 5.5-7.5 mm wide, not forming a coma,

with non-glandular trichomes divaricate,

scattered, 4—8-celled and up to | mm long,

glandular trichomes dense and sessile glands

scattered. Flowering calyx 3.5-4.5 mm long,

with non-glandular trichomes divaricate, sparse,

4_6-celled and up to 0.4 mm long, glandular

trichomes dense and sessile glands scattered.

Fruiting calyx 4-4.8 mm long; upper lobe

broadly ovate, 2.8-3 mm long, 2.4—2.6 mm

wide; lateral lobes lanceolate, 2—2.2 mm long,

1-1.2 mm wide; lower lobes lanceolate, 2.5—3

mm long, 0.5—0.7 mm wide. Corolla 9-15 mm

long, lilac- purple; tube 4.6-5.5 mm long,

Austrobaileya 4(4): 653-660 (1997)

strongly curved at 90—120° 2—-2.5 mm from

base, slightly inflated upwards, glabrous; upper

lobes suborbicular to ovate, + erect, 3—3.8 mm

long, 2.5-3.2 mm wide, with non-glandular

trichomes divaricate, sparse, 2—-4-celled and up

to 0.2 mm long, glandular trichomes sparse and

sessile glands scattered; lateral lobes oblong,

2.8-3 mm long, 1.3—-1.5 mm wide, glabrous;

lower lobe suborbicular, 6-8 mm long, 5.8-8

mm wide, with non-glandular trichomes

divaricate, scattered, 2—4-celled and up to 0.2

mm long, glandular trichomes scattered and

sessile glands scattered. Filaments filiform, 7—13

mm long, c. 0.3 mm diameter, lilac, fused for

3—4.5 mm from base; anthers c. 0.5 mm long and

0.4 mm wide. Style filiform, 12-13 mm long,

lilac, bifid for c. 0.3 mm. Nutlets + circular in

outline, + flattened, 0.9-1 mm long, 0.9~1 mm

wide, c. 0.5 mm thick, dark brown, smooth. Fig.

Additional specimens examined: Queensland. Cook

District: Carrington Falls, Herberton Range, May 1991,

Forster 8366 (BRI, MEL, QRS); Herberton Weir, Jan

1993, Forster 12815 & Bean (BRI). Cultivated:

Indooroopilly (ex Toy Creek, W of Herberton), Nov 1994,

Forster 15892 (BRI).

Distribution and habitat: Plectranthus amoenus

is known from the area between Atherton and

Herberton on the Atherton Tableland in the

‘Wet Tropics’ of north-east Queensland. Plants

grow on granite rock outcrops and pavements in

open forest dominated by Syncarpia glomulifera

(Sm.) Nied. and Eucalyptus resinifera Sm.

Other Plectranthus species in the habitat are

P, glabriflorus P.I.Forst. and P. amicorum

S.T.Blake.

Notes: Plectranthus amoenus also belongs to

Group 5 of Forster (1994) and is closely allied

to P. graveolens R.Br. but differs in anumber of

important vegetative and floral characters. These

are listed in Table 1.

P. graveolens and P. amoenus are closely

distributed but allopatric 1n the ‘Wet Tropics’

with populations of the former near Davies

Creek (Voucher: Forster 17347(BRD) and

Danbulla (Voucher: Forster 15593(BRI)). Both

taxa are distinctive in vegetative appearance

and have a different scent to the crushed foliage.

These differences, as well as the floral ones, are

maintained when the plants. are grown in

cultivation under similar conditions.

Tetisehtt Seven in erga sen ye Oo neg le ha se Eb

Forster, Plectrantlitus

Conservation status: Plectranthus amoenus

has rarely been collected and appears to be

restricted to a relatively small geographic area.

At the Herberton Weir locality, this species

was uncommon whereas it was relatively

659

P. glabriflorus P.1.Forst. and Tylophora

rupicola P.I.Forst. (Forster 1992). A proposed

conservation coding for P. amoenus species is

‘V’ (Vulnerable) as defined under the

Queensland Nature Conservation Act 1992.

common at the other two cited localities above.

There is continuing development of this area

for housing, quarrying and water storage dams

and these activities threaten not only P. amoenus

but other rare or threatened taxa such as

Etymology: Vhe specific epithet is derived from

Latin amoenus ‘pleasant, delightful’ and refers

to the attractive form of this species.

Table 1. Important morphological differences between Plectranthus amoenus and P. graveolens

Character P. amoenus P. graveolens

leaf lamina margins -crenate serrate

32-44 teeth 10-30 teeth

glandular trichomes on absent scattered to

upper leaf lamina surface sparse

bract shape rhomboid obovate to broadly obovate

bract size (mm) 8-10.5 x 5,5-7.5 1.5-4.8 x 1.5-4

corolla upper lobes size (mm) 3—3.8 x 2.5-3.2 1—2.2 x 1-2.2

corolla lower lobe shape suborbicular oblong-ovate

width (mm) 5.5-8 2.4-5.5

P. amoenus will key to couplet 9 in the key of Forster (1994) if the sparse density of glandular

trichomes on the stem and lower leaf surfaces is accounted for in couplet 4 which lists alternatives

as dense or scattered. To distinguish P. amoenus from P. torrenticola P.1.Forst. and P. graveolens,

couplet 9 should be replaced with the following -

Q, Trichomes silver-coloured; verticillasters 10—12-flowered.............. P. torrenticola

Trichomes uncoloured; verticillasters 12—20-flowered ... 0.0.0.0... 00.0 cee ee ene eae 9a

Oa. Leaf lamina margins with 32-44 teeth; floral bracts rhomboid.............. P, amoenus

Leaf lamina margins with 10-30 teeth; floral bracts obovate to broadly

UVES tena aa tabetes Oe basterance Coste manta eee ices sese dram sagen Sereceem bate ea Gen he aes P. graveolens

Acknowledgements

Thanks to K. Halfpapp for bringing P.

thalassoscopicus to my attention. R.L. Jago for

a further collection of P. thalassoscopicus and

G. and N. Sankowsky for a collection of P.

amoenus, W. Smith (BRI) for the illustrations

and L. Pedley (BRD for translating the diagnoses

into Latin.

660

References

BLAKE, S.T. (1971). A revision of Plectranthus (Labtatae)

in Australasia. Contributions from the Queensland

Herbarium No. 9: [-120.

Forster, P.I. (1992). A taxonomic revision of Tylophora

R.Br. (Asclepiadaceae: Marsdenieae) in Australia.

Australian Systematic Botany 5; 29-51,

Forster, P.I. (1994), Ten new species of Plectranthus

L’ Her, (Lamiaceae) from Queensland. Austrobaileya

4: {59—1 86.

Jounson, L.A.S. (1989). APPENDIX. New taxa,

combinations and lectotypifications. Casuarinaceae:

Allocasuarina, Flora of Australia 3: 191-199,

Canberra: Australian Government Publishing

Service.

Austrobaileya 4(4): 653-660 (1997)

Siefeen edi tade coi acaunndovned ee Sadan

Four new rare species of Sauropus Blume (Euphorbiaceae:

Phyllantheae) from north Queensland

John T,Hunter and Jeremy J.Bruhl

Summary

Hunter,J.T. & Bruhl,J.J. (1997). Four new rare species of Sauropus Blume (Euphorbiaceae: Phyllantheae)

from north Queensland. Austrobaileya. 4(4): 661-672. Sauropus anemoniflorus J.T, Hunter & J.I.Bruhl,

S. aphylius J.T.Hunter & J.J.Bruhl, S. convallarioides J.T. Hunter & J.J.Bruhl and §, decrescentifolia

J.T.Hunter & J.J.Bruhl are described and notes are provided on their distribution, habitat and conservation

status. A key to the Queensland species of Sauropus is also provided,

Keywords: Sauropus, Sauropus anemoniflorus, 8S. aphyllus, S, convallarioides, S. decrescentifolia —

Phyllantheae - north Queensland.

John T.Hunter & Jeremy J.Bruhl, Department of Botany, University of New England, Armidale, NSW

2351], Australia

Introduction

The genus Sauropus Blume has had a tortuous

history. In Australia, it 1s only relatively

recently that the genus has been accepted.

Previously, most species conforming to the

circumscription of this genus have been placed

in various genera including Synostemon

F.Muell., Glochidion Forster & G.Forster,

Diasperus Kuntze and, most commonly,

Phyllanthus L., (see Bentham 1873; Webster

1956; Eichler 1965; Stanley 1983). Blume

described the genus in 1825 (Blume 1825), but

in Australia it appears to have been accepted

only after Airy Shaw (1980) renamed various

Australian species of Phyllanthus and

Synostemon under Sauropus.

During our revision of Sauropus for the

Flora of Australia project, four new and rare

species have been identified. These are endemic

in north Queensland. This paper presents full

descriptions of these species along with notes

on their distribution, habitat and conservation

status.

Methods

Sampling and Organisation of Data

Significant proportions of the Sauropus

specimens held by the herbaria AD, BRI, CANB,

Accepted for publication 18 April 1996

DNA, HO, MEL, NSW, PERTH and QRS, and

historically important Sauropus specimens

from A and GH were provisionally sorted into

taxa. Close inspection of these taxa and

subsequent re-sorting of specimens formed the

basis for our decisions on the status of these

taxa. Ten representative specimens (where

available) of these taxa were chosen for detailed

analysis of numeric characters. Other characters

were scored in all available material. Selection

of the ten specimens for study was based on

specimen quality in terms of the amount and

number of developmental stages displayed. Full

variation in character states studied was included,

for example, specimens with the longest and

shortest leaves seen were scored.

A DELTA (Dallwitz 1980; Dallwitz et al.

1993) list of 395 characters and their states

has been created by the authors for the

Phyllantheae (Bruhl & Hunter unpublished).

This was used to score attributes measured in

selected specimens, together with those

measured in all available material.

Fresh material was used where possible,

but in most instances floral measurements were

based on re-hydrated material. Mature leaves

only were used for scoring leaf characters.

662

Terminology

For purposes of consistency across the

members of the Phyllantheae, the perianth

segments of Sauropus are referred to as sepals.

Further developmental investigations need to

be carried out to confirm this interpretation

(Webster 1993, pers. comm.).

Terminology for seed surface characters

follows that of Stearn (1992). A bordered hilum

is indicated by a discoloured and often raised

region surrounding the hilum (best seen in

Phyllanthus fuernrohrii F.Muell.; Hunter &

Bruhl 1996, Fig. 1A, C).

Leaves are sometimes different between

branches and ultimate branchlets. Those of

branches are referred to as “branch leaves’ and

those on branchlets as ‘branchlet leaves’.

Phyllanthoid branching 1s indicated by a

reduction of the leaf that subtends a branch/

branchelet to ascale-like structure, as illustrated

by Webster (1970). Branch leaves exhibiting

intermediate reduction in size, but still clearly

laminate, are referred to as ‘reduced’. Care

should be taken where leaves may have fallen,

to check for a leaf scar which will always be

present.

Citation

Type specimens of all relevant taxa have been

seen by one or both of the authors. Photographs

of type specimens examined at BM and K are

held at NE, together with photographs taken of

type specimens on loan to NE.

Specimens are cited with collector and

collector number, Locality statements are direct

quotes from labels and are unmodified.

A list of all specimens studied will be

deposited at NE. An INTKEY dataset for

interactive identification will be made available

on completion of our study of the Australian

Phyllantheae.

Taxonomy

Sauropus anemoniflorus J.T.Hunter &

J.J.Bruhl, sp. nov.; aomnibus congeneribus

sepalis masculinis laceratis et a speciebus

Austrobaileya 4(4): 657-668 (1996)

Australianis androecio ex cupulain sepalis

exorienti differt. Typus: Queensland:

NorTH KENNEDY District: Taravale near

Hell Hole Creek, 0.5-1.5 km E of

homestead, 22 March 1987, Jackes 8740

(holo: BRI [AQ450983]; specimen lower

left hand side of sheet).

Monoecious herbaceous perennial, c. 0.3 m tall.

Branch leaves sometimes ‘reduced’ in size.

Branchlets persistent, angular or ellipsoid,

ribbed, 10.5-12.5 cm long, 0.7-0.8 mm wide,

glabrous, sometimes papillose. Stipules

persistent, free, lanceolate to ovate to triangular,

0.5—0.8 mm long, cream or green, with bases

truncate to obtuse, with apices acute to obtuse,

membranous to chartaceous, with entire

margins, papillose. Petioles 0.3-0.7 mm long,

0.1-0.3 mm wide, papillose. Branchlet

leaves alternate, distichous, jointed; laminae

asymmetrical, concave, elliptical to obovate;

light-green to mid-green, chartaceous to sub-

coriaceous, obscurely veined, papillose to

scabrous, 1.5-4.7 mm long, 0.9—2.1 mm wide;

bases oblique, obtuse to cuneate; apices erect,

acuminate to apiculate or mucronate; margins

involute. Inflorescences with flowers of both

sexes, indeterminate, axillary, sessile. Bracts

and bracteoles persistent, glabrous. Male

flowers solitary; buds ovoid to globose; pedicels

0.3-0.7 mm long, glabrous; sepals 6, although

difficult to distinguish as such due to their

lacerate to erose nature, free, ascending to

divergent, 0.3—-0.6 mm long, 0.4—0.8 mm wide,

red, fleshy, scabrous; stamens 3, 1-whorled,

arising from a central cup, symmetrical, erect;

filaments wholly connate, erect, terete, 0.2—0.5

mm long; anthers extrorse, ascending to

erect,oblong to circular in outline, 0.3-0.4 mm

long, with locules parallel. Female flowers

solitary, appearing sessile at anthesis; buds ovoid

to obloid to ellipsoid; pedicels in fruit 0.3-0.8

mim long, 0.1-0.3 mm wide, glabrous; sepals 6,

free, 0.3-0.6 mm long, 0.3—0.4 mm wide, ovate,

ascending to divergent, red-brown, chartaceous,

without a distinct white margin, acute; with

papillose margins; midrib branched, not raised;

styles 3, free, undivided, ascending, white to

green, narrow-terete, glabrous; Ovary not seen.

Fruit a capsule, circular, septicidal. Seeds c. 5.8

mm long, c. 4 mm wide. Fig. 1.

JANE EW te nce atelier deevleee eeeeeed

STARR

Hunter & Bruhl, Saurepus

: Pts ast CHEER REAL NE

3 Panis famosas a

pettus he ates a f 4 mo cissliaus

SHALL aT

Hn 8 R HACKED QFE areas

3 é an Pena. . Hurh, BRE

VL TH ate |

ee race BS tHe ee Rees

: SParavale’ peat ' te! A Niktaisads p. RANE te in Eva

Pisbimiat hab ak a

: Gp lates h aod hd ston

; durnved takotetar falliniund

Mart te Jorm

LEN ETE tee eave NS os eau im

: Pet

| “hay be clad a5 computer sed collection number 40 450983

te:

Phe)

alt

Ham

Seuropos PS, anemeonts

COO

Dates Mi/I94 AE

Vig. 1. Sauropus anemoniflorus: Photograph of holotype. (Jackes 8740, BRD.

so wee

&ASGod 5

Bldecrsy

ved

ial | “tT

Tre

| s-

664

Distribution & habitat: Sauropus anemoniflorus

is known only from the type locality in open

forest and woodland on granite derived soil.

Phenology: Flowering: March. Fruiting: March.

Specimens seen: Queensland: NORTH KENNEDY DisTRICT:

Taravale near Hell Hole Creek, 0.5—1.5 km Eof homestead,

Jackes 8740 (BRD).

Notes: At anthesis, the androecium in

S. anemoniflorus is barely visible, surrounded

by the imbricate sepals that form a ‘cup’. In

Australia, this feature 1s only seen in one other

species of Sauropus, S. androgynus (L.) Merr.,

which is naturalised on Christmas and Cocus

(Keeling) Islands (Du Puy & Telford 1993).

Conservation status: As this species is known

only from the type locality, which is on private

property, an initial coding of 2VQ according

to the criteria of Briggs and Leigh (1988) 1s

suggested here.

Etymology: The specific epithet alludes to the

appearance of the male flowers which somewhat

resemble a sea anemone.

Sauropus aphyllus J.T. Hunter & J.J.Bruhl. sp.

nov.;acognato S. ramosissimo (F.Muell.)

Airy Shaw planta non viscida et aphylla

differt. Typus: Queensland: NorRTH

KENNEDY District: Near Irvinebank, about

10 miles W of Herberton, in Eucalyptus

cloeziana, E. citriodora, E. melanophloia

community, 25 April 1967, L. Pedley 2316

(holo: BRI [AQ204798]; male specimen

upper left hand side of sheet),

Dioecious herbaceous perennial. Branch leaves

scale-like, red-brown, chartaceous, glabrous.

Branchlets persistent, rounded, ribbed, 7.5—i4

cm long, 0.6-0.8 mm wide, glabrous. Stipules

persistent, free or fused to scale leaves,

narrowly triangular to triangular, 0.4—1.6 mm

long, red-brown, with bases truncate, with

apices acuminate to acute, membranous, with

margins entire, glabrous. Branchlet leaves all

reduced to scales when present, alternate,

distichous, brown when dry. /nflorescences

indeterminate, axillary, sessile. Bracts and

bracteoles deciduous, glabrous. Male flowers

1-2 per axil; pedicels 0.3-0.6 mm long,

Austrobaileya 4(4): 657-668 (1996)

glabrous; sepals 6, free, erect to ascending,

0.7—-1.3 mm long, 0.6—0.8 mm wide, white to

yellow and sometimes tinged pink, ovate to

obovate and sometimes clawed, rounded to

obtuse, membranous, glabrous; stamens 3,

|-whorled, symmetrical, erect to declinate;

filaments wholly connate, erect, terete, 0.3—0.4

mm long; anthers extrorse, ascending, oblong

to elliptical in outline, 0.2-0.5 mm long, with

locules parallel to divergent. Female flowers

solitary; pedicels jointed, at anthesis 0.2—0.5

mm long, 0.2—0.4 mm wide, in fruit 0.5—1.4 mm

long, 0.2—0.4 mm wide, glabrous; sepals free, 6,

at anthesis erect to ascending, in fruit ascending

to divergent, white to red-brown and sometimes

tinged pink, sometimes with a distinct white

margin, obtuse to acute, membranous, glabrous,

0.9-1.8 mm long, 0.5-1.2 mm wide, elliptical,

ovate to obovate, midrib unbranched; styles 3,

divided for about half their length or less, erect,

ascending to divergent, white to green, 0,3-0.8

mm long, 0.2-0.4 mm wide, clavate to narrow-

terete, glabrous, branches entire, clavate to linear,

with stigmatic surface papillate; ovary 0.3-1

mm long, 0.6—1 mm wide, ovoid to ellipsoid,

smooth, glabrous. Fruit a capsule, ovoid to

ellipsoid, septicidal, 2.5-4.8 mm long, 2-4 mm

wide, yellow-brown to green, crustaceous,

smooth, glabrous, grooved septicidally, apex

obtuse; column persistent, angular-ovoid,

1.2-2.1 mm long. Seeds red-brown,

crescentiform, laterally compressed, 3-3.6 mm

long, |.7—2.1 mm wide, prominently rugose to

ruminate; Ailum markedly depressed, bordered,

circular to ovate, with cavity basal. Fig. 2.

Distribution & habitat: Sauropus aphyllus is

restricted to the Dimbulah—Herberton—

Ravenshoe area of north Queensland. It has

been found on open rocky slopes in savannah

woodland between 580-800 m altitude.

Phenology: Flowering: January, April, May,

and June. Fruiting: January, April, May, and

June.

Specimens seen: Queensland: Cook Districr: Spring Mount

Station, about £3 km from Mareeba—Dimbulah road on the

road to Collins weir, Clarkson 4647 (BRD; | km from

Lappa, Junction on road to Petford, Clarkson 4249 (QRS).

NortH KENNEDY District: Near Irvinebank, about 10 miles

W of Herberton, Pedley 2316 (BRI, type); road from

Herberton to Irvinebank, van der Werff £1541 (QRS);

DU ee eee ee Eee ee ee ee

VOTE pn yates

Hunter & Bruhl, Sauropus

a ! 1 ad. ec" .*

WUE Pest ABR DIEARELIAL Sb pS ABT

beers ary ee

i ehérhta , Et ] “

Phyiisntius vangeulusinus Gf Yueld, ) Wuell, v¥Q Dale Si 1390 bAisets. ESEH

Arts

Hear Trviueberk ., on. (0 miden WF or Preliminary sorting

Harverton di Rucniyptus cluegianns,

E, adtriadoma, E. nolaneptideia goreundby,

Le Fedloy 2416 25 April 4967

F F r

dy aff ty fhe aoe

. FF

Peake Aa WLS,

? Por,.

: : of Rho A # os,

Date, 70 67°F PA Oo. Herb WE

eos

waco

is a

‘ Fen. Se

/ pes Pam ia

a a

wiry aor

ees

Hrect poremdeal to t tte

nor

felon see

Ks Hata

a a i = on

Trl Yan

on ai )

DUE beak be pe eh

hit wv

Poa he

PILES eg (fl ! wi

fede Af nePer iff i. oak , le

PE PLUME EE UY, / hae

Vig. 2. Sauropus aphyllus: Photograph of holotype. (Pedley 2316, BRI).

AQ AVYE

7 T

PALA

reer

fae ti

Peds tl

ween

foo

605

666

along road from Watsonville to Irvinebank, van der Werff

[i618 (QRS); Innot Hot Springs, about 30 km W of

Ravenshoe, van der Werff 11682 (QRS); Innot Hot Springs,

about 30 km W of Ravenshoe, van der Werff 11676 (QRS).

Notes: Leaves on plants of this species are all

scale-like. Other species of Sauropus are known

to have scale-like branch leaves (1.e. possess

Phyllanthoid branching; see Webster 1970), but

none of these species exhibit this reduction tn

leaves on branchlets as well. Sauropus aphyllus

differs from the superficially morphologically

similar S. ramosissimus in that all leaves of

S. aphyllus are reduced to scales, male sepals

are free, and no part of the plant is viscid. By

contrast, plants of S. ramosissimus possess

laminate branchlet leaves, male sepals that are

connate for most of their length, and leaves and

branchlets that are viscid.

Conservation status: Because of the restricted

distribution and paucity of known specimens,

most of which are from a single collector,

we suggest an initial ROTAP coding of 2EQ

according to the criteria of Briggs and Leigh

(1988).

Etymology: The specific epithet alludes to the

leafless nature of plants of this species.

Sauropus convallarioides J.T.Hunter &

J.J.Bruhl. sp. nov.; a cognato S. hirtellus

(Muell. Arg.) Airy Shaw planta monoecia

et foliis ramorum squamosis differt.

Typus: Queensland. Coox DISTRIcT:

South Pap, Tozer Gap area, Cape York

Peninsula, 16 September 1983, D.L. Jones

1244 (holo: BRI [AQ452404]).

Monoecious perennial shrub, 0.2—0.4 m tall.

Branch leaves scale-like, white, membranous,

glabrous. Branchlets persistent, rounded,

2.9~4.5 cm long, 0.4-0.7 mm wide, glabrous.

Stipules persistent, free, triangular, bases

truncate to rounded, 0.40.8 mm long, cream,

with apices acute, membranous, with margins

entire, glabrous. Petioles 0.6-1.5 mm long,

0.2—-0.7 mm wide, glabrous. Branchlet leaves

alternate, distichous, jointed, brown when dry

or remaining green; laminae asymmetrical,

plane, 7.3—23.6 mm long, 2.7—15.5 mm wide,

elliptical to obovate, light-green to mid-green,

paler below, sub-coriaceous, abaxially pinnately

veined, glabrous; bases oblique, rounded to

Austrobaileya 4(4): 657-668 (1996)

obtuse; apices erect, obtuse to rounded,

mucronate to apiculate; margins revolute to

plane, thickened; midrib abaxially raised with

3-7 lateral parallel veins. Inflorescences with

male and female flowers mixed proximally while

females flowers occur alone distally,

indeterminate, axillary, sessile. Bracts and

bracteoles persistent, glabrous. Male flowers

1-10 per axil; buds ovoid to barrel-shaped;

pedicels [.5~3 mm long, glabrous; sepals 6,

connate shortly or for half their length, ascending

to divergent, 1.5-3.6 mm long, 0.9-1.8 mm

wide, white, elliptical to ovate, rounded to obtuse,

fleshy, glabrous; stamens 3, 1-whorled,

symmetrical, erect; filaments wholly connate,

erect, terete, c. 0.5 mm long; anthers extrorse,

erect, oblong to linear in outline, c. 1 mm long,

with locules parallel; apiculum c. 0.1 mm long,

cream. Female flowers solitary; buds conical,

obloid to ellipsoid; pedicels jointed, at anthesis

1.54.5 mm long, 0.2—0.5 mm wide, in fruit

4.3-6.2 mm long, 0.3-0.6 mm wide; sepals free,

6, elliptical to obovate, at anthesis 1.8—5.5 mm

long, 1.4—2.4 mm wide, erect to ascending, in

fruit 5-6 mm long, 1.9—2.7 mm wide, erect,

ascending torecurved, white, rounded to obtuse,

fleshy, glabrous; styles 3, free, undivided or

merely notched, ascending to recurved, white,

0.4-I1 mm long, 0.2—-0.3 mm wide, clavate to

obloid, glabrous; ovary 1-1.2 mm long, c. 1 mm

wide, ovoid to ellipsoid, smooth, glabrous. Fruit

a capsule, ovoid to ellipsoid, septicidal, 5.2—5.6

mm long, 5.5—5.8 mm wide, green, cartilaginous,

smooth, glabrous, grooved septicidally, apex

rounded to obtuse; column persistent, angular-

ovoid, 2—2.1 mm long. Seeds yellow-brown

to pallid-brown, crescentiform, laterally

compressed, c. 4.6 mm long, c. 2.5 mm wide,

smooth; hilum slightly depressed, ovate to

elliptic, with cavity central. Fig. 3.

Distribution & habitat: Sauropus convallarioides

isknown only from heath communities in the

Iron Range area including Mt Tozer, Cape York

Peninsula in north Queensland.

Phenology: Flowering: July, August and

September. Fruiting: August and September.

Specimens seen: Queensland:Coox District: 4km NW of

Mt Tozer, Iron Range, Briggs 7329 (NSW); South Pap,

Tozer Gap area, Cape York Peninsula, Jones 1244 (BRI,

type); [7 km NE of Browns Creek towards Iron Range, 189

aN ue a la el et,

se hidaclidiamndadd

“a

Yate yee

ore

nae

ag teat

nga ta iene tat:

STAN MeR

se tec

Hebi eiticicitaccet

SOAR Done A eueee ioe

eee

Hunter & Bruhl, Sauropus

me QUEENRLANO HERBARIUM (OTM,

” Flora of QUEENSLAND COOK Bistast

f Phyttanthug

Coll. DLL JONES 1244 IGSEPIGR3

(W 4F8 148 139'E aH. oom

Soyth Pap, Tozer Gap arca, Cane York Peninsula

Ptase molst forest bordering on rainforest.

Straggly shrub ¢ 40cm tal, leayas dark green,

Hawers white

Get Euphorplecese

Cups.

*May be ciled as computerised callaction number AG 452404

| + Preliminary sorting — - : (soe Sa ee

Savropus sp. @ 1. aff, ochrephiytlus)

Fig. 3. Sauropus convallarioides: Photog

7) MERBARIUAM OF THE UNIVERSITY OF

NEW ENGLAND INE}

$ Cauvalla vies dec

« €Bub/ (7g

Noes

ot ar

canis

ore.

tr peaval ts

mag

el ie Ts

te tte

iat

raph of holotype. (D.L. Jones 1244, BRI),

corecr

Tut

“

668

km N of Coen by road, Coveny 7137 & Hind (NSW); Tozer

Gap, Tozer Range [sic], n.d. Brass 19415 (CBG).

Conservation status: Because of the restricted

distribution and habitat of this species, an initial

ROTAP coding of 3VCQ according to the

criteria of Briggs and Leigh (1988) is suggested

here. °

Etymology: This species has been colloquially

called ‘Lily of the Valley’ while awaiting

formal description. The specific epithet refers

to this by stating that the species is like

Convallaria majalis L., Lily of the Valley.

Sauropus decrescentifolia J.T.Hunter &

J.J.Bruhl. sp. nov.; similis S. elachophyllo

(F.Muell. ex Benth.) Airy Shaw a qua

foliis caulinis planis, in amplitudinee basi

usque apicum decrescentibus differt.

Typus: Queensland. Cook District: about

38 km S of Mutchilba towards Stannary

Hills, Conn & De Campo 1240 (holo:

MEL).

Dioecious shrub with a woody taproot,

0.05—0.3 m long. Branchlets persistent, rounded

to ellipsoid, 2-6 cm long, 0.35—0.7 mm wide,

smooth or papillose, glabrous to antrorsely

scabrous. Stipules persistent, free, narrowly

triangular to triangular, 0.3—-1.2 mm long, cream

when fresh and red-brown to black when dry,

with bases cordate, with apices acuminate to

acute, chartaceous, margin entire or erose,

glabrous. Branch leaves \aminate. Petioles

O0.3—1 mm long, 0.3-0.6 mm wide, glabrous or

with persistent indumentum. Branchlet leaves

alternate, distichous, jointed, brown when

dry; slightly asymmetrical, plane to concave,

elliptical, obovate to oblanceolate, 4—21 mm

long, 0.7-11.5 mm wide, light-green to mid-

green when fresh, sub-coriaceous, very wrinkled

when dry, obscurely veined, sometimes

papillate, glabrous or scabrous; bases slightly

oblique, rounded to obtuse; apices erect, acute,

obtuse to rounded, mucronate to apiculate;

margins plane, thickened. Inflorescences

indeterminate, axillary, sessile. Bracts and

bracteoles deciduous, glabrous. Female flowers

solitary; buds ovoid, globose, obloid to ellipsoid;

pedicels jointed, at anthesis 0.8—1.7 mm long,

0.3—0.7 mm wide, in fruit 1.4—2 mm long, 0.31

mm wide, + distally dilated, glabrous or

Austrobaileya 4(4): 657-668 (1996)

sometimes indumented; sepals free, 6, elliptical

to oblanceolate, 1.2—-2.3 mm long, 0.4—1.2 mm

wide, possessing inter-sepalar stipules, at

anthesis erect, divergent to recurved, in fruit

divergent to recurved, white to green when fresh

and turning grey on drying, rounded to obtuse,

fleshy, glabrous; styles 3, free on opposing sides

of the ovary, undivided or notched, erect to

divergent, white to green when fresh and turning

grey when dry, 0.6—1 mm long, 0.3—0.5 mm

wide, clavate, glabrous; stigmatic surface

papillate; ovary 0.5—1.1 mm long, 0.3—1.4 mm

wide, ovoid to ellipsoid, smooth, glabrous. Fruit

a capsule, ovoid, septicidal, 9.5—11.5 mm long,

6—7 mm wide, red-brown to green, smooth,

glabrous, grooved septicidally, apex rounded to

obtuse; column persistent, angular-ovoid, 2.9-4

mm long. Seeds yellow to red-brown, prismatic

to falcoid, laterally compressed, 3.8-5.2 mm

long, 2—2.8 mm wide, smooth, with a minor

marginal wing; Ailum slightly depressed, elliptic,

cavity more or less basal. Fig. 4.

Distribution & habitat: Only three collections

of S. decrescentifolia are known and these

are all from the Herberton—Irvinebank area in

north Queensland. They were collected in

savannah woodland.

Phenology: Flowering: April. Fruiting: April.

Specimens seen: Queensland: Cook District: about 38 km

south of Mutchilba towards Stannary Hills, Conn & De

Campo 1240 (MEL, type). NorTH KENNEDY DISTRICT: on

Silver Valley road, 3.4 km from Mt Misery, Forster 3973

(BRI); road from Herberton to Irvinebank, van der Werff

11540 (QRS).

Notes: Sauropus decrescentifolia is very similar

to S. elachophyllus (Benth.) Airy Shaw and

could be confused with that species. The nature

of four characters can be used to separate these

species. In S. decrescentifolia the branch leaves

are not reduced to scales (no Phyllanthoid

branching); the leaves decrease dramatically in

size distally over the plant over a series of

branches, but not over each branchlet, the leaves

are only slightly asymmetrical and leaf bases are

only slightly oblique, and the larger leaves are

obovate with a distinct rounded to obtuse apex.

By contrast, S. elachophyllus has scale-like

branch leaves (Phyllanthoid branching), the

leaves decrease in size along each branchlet but

not in a single series along the length of the

This content downloaded from 136.154.23.253 on Tue, 18 Jul 2023 23:00:20 +00:00

All use subject to https://about.jstor.org/terms

Hunter & Bruhl, Sauropus

NATIONAL HERBABRTL M OF VICTORIACMEL)

LLP VAT reap eeakAMEt VE Ot

cy LOCOMIA CNEETD), Al puATLI*

Fig. 4. Sauropus decrescentifolia: Photograph of holotype. (Conn 1240 & De Campo MEL).

This content downloaded from 136.154.23.253 on Tue, 18 Jul 2023 23:00:20 +00:00

All use subject to https://about.jstor.org/terms

669

670

plant, the leaves are noticeably asymmetrical

and the leaf bases are very oblique, only some

leaves are obovate but then the apex ts acute.

Unfortunately, only female specimens of

S. decrescentifolia are known at present so

attributes of male organs are unknown.

Currently Sauropus decrescentifolia and

S. elachophyllus are the only two species of this

genus known to possess inter-sepalar stipules

(cf.. Weberling 1989), The nature of these

structures in Sauropus is currently under

investigation and will be elaborated on in a

subsequent publication.

Austrobaileya 4(4): 657-668 (1996)

Conservation status: Only three specimens are

known of S. decrescentifolia and no male plants

have been seen. Furthermore, its distribution

appears to be very limited. We therefore

suggest an initial ROTAP coding of 2EQ

according to the criteria of Briggs and Leigh

(1988).

Etymology: The epithet, Latin for ‘decreasing

leaves’, alludes to the noticeable progressive

reduction in leaf size distally on the plant. It is

a plural substantive in apposition.

Key to Queensland species of Sauropus Blume

bye (RATS CHGBCTOUS. co oe cp eed ae & ER we, Sa MEE eer ln oS ELEM Ree oT oh MA AT a eS Be 2

PIAS TOMI CHOMS> .. 9. 5: 5.7 Set as ad ob oF Dota Ea ea we Sap AA pieked 4 fee USER oh eect Mek 5

2. Leaves present and prominently wrinkled when dry; stipule bases cordate;

inter-sepalar stipules present on female flowers; seeds smooth and with a

Stall Wie On-ie wMarenys: bs ban = goths Sv eet ws ele oi breled pbaN & WR EGE ee WIE AIR ae 3

Leaves when laminate (scale-like in 8. aphyllus), not prominantly wrinkled

when dry; stipule bases various but not cordate; inter-sepalar stipules

absent; seeds prominently rugose or ruminate, and without any wings............... 4

3. Branch leaves laminate; leaves decreasing dramatically in size distally on the

plant, slightly asymmetrical, with base slightly oblique

Pease ee Sauropus decrescentifolia

Branch leaves reduced to scales; leaves not dramatically decreasing in size

distally on plant, conspicuously asymmetrical, with base conspicuously

GDIQUE sis 4 shi este se ahead Qanee

oats doe bb. dao ay ae wet Sauropus elachophyllus

4. Branchlets ribbed; stipules triangular to narrowly triangular; branch leaves

scale-like: branchlets leafless or with leaves reduced to scales; male

pedicel 0.3-0.6 mm long; male sepals free; female pedicel at anthesis

0.2-0.5 mm long, in fruit 0.5-1.4 mm long; female sepals free; style

undivided; fruit 2-4 mm wide; seeds 1.7—2.1 mm wide

Sauropus aphyllus

Branchlets smooth; stipules ovate; branch leaves ‘reduced’ leat-like; branchlet

leaves present and laminate; male pedicel 0.9-9.8 mm long; male sepals

connate; female pedicels at anthesis 0,8—6 mm long, in fruit 1.5~-8.5 mm

long; female sepals connate; style variously divided; fruit 4—6.7 mm wide;

seeds 2.4-3.4 mm wide............000.

best F aediin teach faint ebtgto ke alee) Sauropus hirtellus

5. Leaves 0.8-45 mm long; petioles 0.2—1.8 mm long; stipules without distinct

margins; branchlets not winged; seeds 2.5-6.8 mm long ...... 0.0... cece ee ees 6

Leaves 55-115 mm long; petioles 2-5.5 mm long; stipules with a distinct

white margin; branchlets winged; seeds 7-9 mm long .......... Sauropus micranthus

Hunter & Bruhl, Sauropus 671

6. Male sepals connate (sometimes shortly so in S. convallarioides) 0.0... 06. eee 7

DLE SEDALS TCC 6 ans r sl coy ctanye tales des eile se sesh ea bere ame We eld tp SORE a Menara hyn ee LR ind Laing 9

7. Leaves flat; margins thickened; female sepals connate to about half their

length; staminal filaments <1 mm long; seeds smooth

sihasSs Nha pa Palen leh elt ope UAE AS heh Hartnett es Cannell Sauropus convallarioides

Leaves concave, margins not thickened; female sepals connate for most of

their length; staminal filaments >1 mm long; seeds prominently sculptured ........... 8

8. Branchlets ribbed, not sptnose; stipules triangular; female sepals connate;

SU SSCS a vo we etinyysnte 4k eke eee eee ernest ania amet enn. Fem Sauropus ramosissimus

Branchlets smooth, spinose; stipules ovate; female sepals free; styles connate

NSASSOYE aoc, Gye ORES Duh Ea thal ao eeiy a TaP Ness. 8) OReaeee, GAB ct tate, cichie eI OETA NINE Ra ot sats Sauropus rigens

9. Leaves flat to convex and sometimes conduplicate; female pedicels distally

dilated; styles notched or divided to half way

BS ech et hele she, tel wove Laclar earns Weed She Be ap, ce Roe BE Regt TAME er ad se CR ite Sauropus trachyspermus

Leaves flat to concave, never conduplicate; female pedicels uniform through

out; styles undivided or merely notched... 2... ce eee ees 10

10. Branchlet leaves <5 mm long, <2 mm wide, margins not thickened,

concolourous; male sepals <1 mm long, red in colour, with margins

lacerate to erose; female pedicels <1 mm long; female sepals acute, <1 mm ,

long; anthers <SAMP ONE foe kee eo ee ee ee Sauropus anemoniflorus

Branchlet leaves >5 mm long, >2 mm wide, with margins thickened, paler

abaxially; male sepals >1 mm long, white or green in colour, margins

entire; female pedicels >| mm long; female sepals obtuse to rounded, >1

11. Plants 0.5—2 m tall; branchlets <6 cm long; stipules red-brown in colour;

branch leaves only ever scale-like; branchlet leaves adaxially obscurely

veined, abaxially smooth; inflorescence at least sometimes with both male

and female flowers; male pedicels 1.6-10 mm long; female pedicels in fruit

S24 2 nh lOte ve Styles 204 cs ea tae ao foo weed wk oes Ys oo Sauropus albiflorus

Plants <0.5 m tall; branchlets >6 cm long; stipules green in colour; branch

leaves laminate, ‘reduced’ or scale-like; leaves adaxially visibly

veined,abaxially papillate; inflorescence with only male or female flowers;

male pedicels 0.2—-1.8 mm long; female pedicels in fruit 2-4 mm long;

SUVIGS SS ma th A dat ua anton be oh eect oe tet eth gPitas mee ae hae! Sauropus podenzanae

Acknowledgments

The authors wish to thank the heads of the following

herbaria for loan of specimens: A, AD, BM, BRI,

CANB, CBG, DAV, DNA, GH, HO, K, MEL,

NSW, PERTH, ORS. Thanks also to the heads of

A, BM, BRI, CANB, CBG, DNA, G,.GH, K,

LINN, MBA, MEL, NSW, QRS for access to

facilities and specimens; Frances Quinn (NE) and

Grady Webster (DAV) for assistance with field

work; Grady Webster and Frances Quinn for

helpful comments; Lyn Craven (CANB) and

Frances Quinn for the Latin diagnoses;

the director of the Queensland NationalParks

and Wildlife Service, for permission to collect

in service areas. This project was supported

by funding from the Australian Biological

Resources Study.

672

References

Airy Suaw, H.K. (1980). A partial synopsis of the

Euphorbiaceae-Platylobeae of Australia (Excluding

Phyllanthus, Euphorbia and Calycopeplus). Kew

Bulletin 35: 577-700.

BENTHAM, G. (1873). Flora Australiensis vol. 6. London: L.

Reeve,

BLuME, C.L. (1825). Budragen tot de Flora van

Nederlandsch Indié. Batavia: Ter Lands Drukker.

Bricas, J.D. & Leicu, J.H. (1988). Rare or Threatened

Australian Plants. Special Publication No. 14.

Canberra: Australian National Parks and Wildlife

Service,

DatLwitz, M.J. (1980). A general system for coding

taxonomic descriptions, Taxon 29: 41-46.

DaLLwitz, M.J., PAmve, T.A. & ZURCHER, B.J. (1993).

User’s guide to the DELTA system. Canberra:

Division of Entomology, CSIRO.

Du Puy, D.J. & TELForp, I.R.H. (1993). Euphorbiaceae in

Flora of Australia 30: 260-278.

EICHLER, Hj. (1965). Supplement to J.M. Black's Flora of

South Australia ed. 2 Adelaide: Government Printer.

Austrobaileya 4(4): 657-668 (1996)

Hunter, J.T. & Brunt, J.J. (1996), Three new species of

Phyllanthus in South Australia (Euphorbiaceae:

Phyllantheae). Journal of the Adelaide Botanic

Gardens 17:127--136.

STANLEY, T.D, (1983), Euphorbiaceae. in T,D. Stanley &

E.M. Ross (ed), Flora of south-eastern Queensland

[: 406-439, Brisbane: Queensland Department of

Primary Industries.

STEARN, W.T. (1992), Botanical Latin, 4" Ed. Melksham:

David & Charles.

WEBERLING, F. (1989), Morphology of flowers and

inflorescences. Cambridge: Cambridge University

Press.

Weester, G.L. (1956). Studies of the Euphorbiaceae,

Phyllanthotdeae. II]. The American species of

Phyllanthus described by Linnaeus. Journal of the

Arnold Arboretum. 37: 1-14.

— (1970) A revision of Phyllanthius (Euphorbiaceae) in

the continental United States. Brittonia 22: 44—76.

- AWNING Egat ich edna chit ved dee nateentithweant oii ee ed dadddd die erected he Dee tt ne EEE ba

Dubouzetia saxatilis Klaeocarpaceae), a new species from north

Queensland, Australia

A.R.Bean and L.W.Jessup

Summary

Bean, A.R. & Jessup, L.W. (1997). Dubouzetia saxatilis (Elaeocarpaceae), a new species from north

Queensland, Australia. Austrobaileya 4(4): 673-675. Dubouzetia saxatilis A.KR.Bean & Jessup is

described, illustrated and compared with related species. A key to the Australian species of Dubouzetia

is presented,

Keywords: taxonomy, Elaeocarpaceae, Dubouzetia, Dubouzetia saxatilis, Australian flora.

A.R. Bean, Queensland Herbaritwn, Meiers Road, Indooroopilly, Queensland 4068, Australia

L.W. Jessup, Queensland Herbarium, Meters Road, Indooroopilly, Queensland 4066, Australia

Introduction

Dubouzetia Pancher ex Brongn. & Gris is a

genus of woody shrubs and trees which was first

validly described tn 1861 with one species. A

second species was described in 1863 by the

same authors. The first generic revision was

provided by Sprague (1907) who enumerated

five species, all endemic to New Caledonia. The

genus was first recorded for New Guinea by

Smith (1944) who named two additional species.

The New Caledonian species were revised by

Virot & Guillaumin (1963). Coode (1978)

recorded the genus from West Ceram in the

Moluccas and named two further species from

New Guinea.

In the most recent revision of the genus,

Coode (1987) named D. australiensis from the

Northern Territory, thus providing the first

record of the genus from Australia. In all, he

recognised 10 species with most occurring in

New Guinea and New Caledonia but also the

Moluccas (1 sp.) and northern Australia (1 sp.).

This paper describes a second Australian

species from near Townsville tn northern

Queensland.

It is notable that both Australian species

are shrubby cliff dwellers, whereas the remaining

species in the genus are plants of low to tall

forest, and are not associated with cliffs.

Accepted for publication 3 May 1996

Taxonomy

Dubouzetia saxatilis A.R.Bean & Jessup sp.

nov. Dubouzetiae australiensi atfinis a

qua folis brevioribus angustioribus saepe

crenulatis, sepalis brevioribus obtusis,

antheris brevioribus, disco sparsim piloso

profundius lobato et ovario piloso inter

lobos differt. Typus: Queensland. Nortu

KENNEDY District: | km NNW of

Frederick Peak, 25 km SW of Townsville,

19°24’S 146°37°E, 5 May 1991,A.R. Bean

3094 (holo: BRI (1 sheet + spirit); iso: K,

MEL, distribuend1).

Shrub c. 50 cm diameter, growing horizontally

from vertical cliff-faces. Branchlets terete,

shortly pubescent. Stipules deltate, c. 0.5 mm

long, caducous. Leaves spirally arranged;

petioles 3-5 mm long, pubescent, channeled

above; blades ovate or elliptic, 3.1—6.8 x 1.5—2.6

cm, |.7—3.4 times as long as broad with apex

acute and base cuneate to obtuse, glabrous on

upper surface, pubescent on lower surface

principally along veins, with numerous papilla-

like hair-bases throughout; venation

penninerved, with 7~9 pairs of lateral veins

branching towards margin; reticulate venation

well developed; intramarginal vein absent; leaf

margins crenulate or denticulate, sinuate or

rarely entire. Flowers 5-merous, bisexual, borne

in condensed axillary racemes; flowers 3-6 per

inflorescence, each subtended by a pale reddish-

674

brown pubescent, caducous bract, {.5—2 xc.0.5

mm. Pedicels 12—21 mm long, hairy; sepals

white, broadly-ovate to orbicular, 3-5.5 x

2.1-4.5 mm, shortly pubescent on both sides,

apex obtuse; petals white, elliptical or narrowly-

obovate, 8-10.5 x 3.8-4.5 mm, entire, each

with 2 pockets at the base, pubescent on the

adaxial surface; disc sparsely pilose, annular,

deeply lobed, the lobes intruding into the petal

pockets. Stamens 38—44, inserted on the disc

near the base of the lobes and towards the inner

margin near the ovary; filaments usually sinuous,

2—2.6 mm long, with numerous spreading hairs;

anthers oblong, 1.25—1.5 mm long, puberulent,

4-lobed in section, opening by a terminal pore.

Ovary superior, ovoid to globular, very shallowly

3- or 4- lobed, 2—2.5 mm long, glabrous on

outside except for 3 or 4 longitudinal lines of

hairs between the locular lobes, 3(4)-locular,

locules 7-ovulate, sparsely or scattered-pilose

on the inside. Style single, terete or tapered,

shallowly grooved near apex, often twisted,

4.5-—5 mm long; stigma inconspicuous, pointed.

Fruit a thin-walled, 3(4)-lobed capsule c. 9 mm

long and c. 1 1 mm indiameter. Seeds ellipsoidal,

3—3.5 mm long, c. 2 mm in diameter, brown,

sparsely pilose, with a waxy terminal strophiole.

Additional specimens examined: Queensland. Nort

Kennebpy Districr: 1 km NNW of Frederick Peak, 25 km

SW of Townsville, Jun 1991, Bean 3283 (AD, BRI, DNA,

K, MEL); ditto, Jun £991, Bean 3282, 3284 (BRD; Frederick

Peak, The Pinnacles, Dec 1993, Cumming 12576 (BRD.

Distribution and habitat: D. saxatilis is known

only from the type locality, 25 km south-west of

Townsville in north Queensland. It grows on the

sheer faces of two adjacent unnamed rhyolite

peaks, close to, but separated from Frederick

Peak. It occurs on all sides of these peaks, taking

root in crevices. It is associated with other

shrubs and herbs, including Rhedomyrtus

trineura (F.Muell.) Benth. subsp. trineura,

Austrobatleya 4(4): 673-675 (1997)

Leptospermum neglectuin Joy Thomps. and

Polycarpaea_ sptrostylis F.Muell. The

surrounding vegetation type is mostly open

eucalypt forest, but includes small areas of

closed forest.

Phenology: Flowers and fruits have been

collected in May, June and December, but full

phenology is unknown. Possibly the species

bears flowers and fruits throughout the year.

Affinities: D. saxatilis is closely related to

D. australiensis Coode but differs by its shorter

and narrower, often crenulate leaves, shorter

obtuse sepals, shorter anthers, more deeply lobed

disc and the ovary with lines of hairs between

the locular lobes. From all other Dubouzetia

species, it can be distinguished by its relatively

small petals and mostly glabrous ovary.

It belongs to D. sect. Oligovula Coode

(Coode 1987), because of the relatively few

(<8) ovules per loculus and the relatively smal]

petals and fruits.

Conservation Status: The risk category for

Dubouzetia saxatilis, according to the criteria

of Chalson & Keith (1995) is ‘endangered’

(criteria B2, BS and D2). The species is known

only from the type locality. It 1s under threat

because of its small population size (less than

1000 plants have been observed) and its

specialised habitat.

The recommended conservation coding

for this species as defined by the Queensland

Nature Conservation Act 1992 1s ‘endangered’.

Etymology: The specific epithet is from the

Latin saxatilis, meaning ‘dwelling or found

among rocks’, in reference to the habitat

occupied by the species.

Key to Australian species of Dubouzetia

I, Leaves 7.5-13 cm long; sepals deltate to narrowly-ovate, 6-7.5 mm

long, with apex acute; anthers 1.5—2.1 mm long; ovary glabrous. ...... D. australiensis

Leaves 3,1~-6.8 cm long; sepals broadly ovate to orbicular, 3—5.5 mm long,

with apex obtuse; anthers 1.25~1.5 mm long; ovary with lines of hairs

between the locular lobes .............

oy oe he Er ee ee aes Be FOE Ih 8 ao EIB Mg . D. saxatilis

ESSE SUSY EE EA ha reg eye ae en a ed Datta eaten ee ttieeeeenecereseaeeaaa ss eene eens ene see

PORTERS eg

EMS

note a cst eae Le

TAS a

Cle ee te ee

SOM Ss

Bean & Jessup, Dubouzetia saxatilis

Pe ee he

se Me ge ae er ps a

pene et

a ™

vets ape

wie t

Fem ote ee tool oh hol

a eee on

Se ee ee

675

Fig. 1. A-E: Dubouzetia saxatilis A. flowering branchlet x |. B. longitudinal section of flower x 4. C. sepal x 4, D. fruit

in early stages of dehiscence, x 2. E. lateral view of seed x 8. A, Bean 3283; B—-D, Bean 3094; E, Bean 3282,

Acknowledgements

We thank the Director of DNA for the loan of

specimens of D. australiensis, lan Brooker for

the Latin diagnosis, and Will Smith for the

illustration.

References

CHALSON, J.M. & Kerry, D.A. (1995). A Risk Assessment

scheme for Vascular Plants: Pilot Application to

the Flora of New South Wales, Hurstville: National

Parks and Wildlife Service,

Coope, M.J.E. (1978). A Conspectus of Elaeocarpaceae in

Papuasta, Brunonia 1: 131-302.

— (1987), Crinedendron, Dubouzetia and Peripentadenia,

closely related genera in Elaeocarpaceae. Kew Bul-

letin 42: 777-814.

SMITH, A.C, (1944). Studies of Papuasian Plants V1., Jour-

nal of the Arnold Arboretum 25: 271-98.

SPRAGUE, T.A. (1907). A Revision of Dubouzetia, Bulletin

of Miscellaneous Information Kew, Article 25:

125-8.

Virort, R. & GuiLLAuMIN, A. (1963). Revision du Genre

Dubozetia Panch. mss. Brongn. et Gris

(Elaeocarpacees). Adansonia 3: 260-86.

A revision of Rubus subg. Idaeobatus (Focke) Focke (Rosaceae)

in Australia

A.R. Bean

Summary

Bean, A.R. (1997). A Revision of Rubus subg. Idaeobatus (Focke) Focke (Rosaceae) in Australia.

Austrobaileya 4(4): 677-689. Rubus subg. Idaeobatus is revised for Australia. Five species, including

one with two varieties are recognised; Rubus queenslandicus A.R.Bean sp. nov., R. probus L.H.Bailey,

R. rosifolius Sm. var. rosifolius, R, rosifolius var, conmersonii (Poir.) Tirveng., &. ellipticus Sm. and R,

parvifolius L. All taxa are described in full and their distributions mapped. R. queenslandicus is

illustrated. A key to the Australian taxa is presented.

Keywords: taxonomy, Rosaceae, Rubus, Australian flora, Rubus subg. [daeobatus, Rubus queenslandicus,

Rubus probus, Rubus rosifolius, Rubus rosifolius var. commersonii, Rubus ellipticus, Rubus parvifolius.

A.R. Bean, Queensland Herbarium, Meiers Road, Indooroopilly, Queensland, Australia, 4068

Introduction

Rubus subg. Idaeobatus (Focke) Focke is one

of four subgenera indigenous to Australia (Bean

1995). Its members are characterised by their

shrubby habit, trifoliolate or imparipinnate

leaves (some non-Australian species are

bipinnate) with persistent stipules adnate to the

petiole. Many species have sessile or stalked

glands on various parts of the plant.

The subgenus has a broad distribution

centred on continental Asia where the

greatest species diversity occurs. In addition,

representatives occur in Malesia, Africa and

Central America, and one species, R. idaeus L.,

occurs in Europe. Australia has four indigenous

Species, one with two varieties, plus one

introduced species belonging to this subgenus.

Rubus parvifolius was one of several

species of Rubus described by Linnaeus in

1753, based on a Specimen originating in

southern China.

R. rosifoltus Sm. was described by

J.E. Smith in 1791 from specimens collected in

Mauritius, and soon after was collected from

Australia by Robert Brown and others.

Accepted for publication 15 April 1996

A third Australian representative of Rubus

subg. [daeobatus, R. muelleri F.M.Bailey, was

described by Bailey (1884), who compared it

with R. rosifolius. However, in recent years

R. muellert has been included within the

Malesian species A. fraxinifolius Poir. (Stanley

dé Ross 1983; Henderson 1994). In the present

study, it is shown that these two taxa are

specifically distinct. Unfortunately the name

R. muellert F.M.Batley is illegitimate so is

replaced here by the next available name,

R. probus L.H.Bailey.

Collections of R. gqueenslandicus

A.R.Bean have previously been identified as R.

rosifolius, R. fraxinifolius or R. muelleri (= R.

probus), but it 1s distinct from all of these

species.

R. rostfolius var. commersonitit (Poir)

Tirveng. is newly recognised for Australia here.

It is apparently sporadically distributed

throughout the range of R. rosifolius.

The naturalised species, R. ellipticusSm.,

is confined to south-eastern Queensland and

north-eastern New South Wales.

R. idaeus L. and R. phoenicolasius Maxim.

were listed by Ewart (1931) as being naturalised

in Victoria. However, there is only one specimen

of R. idaeus at MEL, collected in 1925, and

678

there are no specimens of R. phoenicolasius at

MEL. As there is no other evidence that either

species is currently naturalised in Australia,

they are not included in this treatment.

Materials and Methods

This study is based on herbarium material of

Australian and non-Australian taxa from AD,

BH, BRI, HO, MEL, NE, NSW, P, QRS, Tland

UPRRP. In addition, microfiche of type

specimens in LINN and P-JU have been seen.

Most species have been examined in the field to

establish ecological requirements and to collect

spirit material for later study.

Austrobaileya 4(4): 677-689 (1997)

Measurements of vegetative parts are based on

herbarium material, while floral and fruiting

measurements are based on spirit material or

reconstituted dried specimens.

Taxonomy

Rubus subg. I[daeobatus (Rocke) Focke,

Biblioth. Bot. 72: 128 (1911); Rubus sect.

Idaeobatus Focke, Abh. Naturwiss.

Vereine Bremen 4: 147 (1874). Type: R.

idaeus L.

c. 75 species in the world, 5 spp. indigenous

or naturalised in Australia

Key to Australian taxa of Rubus subg. Idaeobatus

1. Leaflets white or yellowish underneath, due to dense cover of short hairs

obscuring the leaflet surface ...........

Leaflets green underneath, glabrous or hairy, surface of leaflets not obscured

INTIMAL ES op 52 dete obras, sara TNey Sgccad edlery tin ths oy ana serene he

2. Branchlets with erect, reddish hairs; leaflets not lobed; petals white; fruits

MCLLOWE 0.00 lactase? eX 8 B Siutnn Bolles Gs CAPR lp PSOE

eines I Satch ste Fete Silda’ nested a eles ot 4. R. ellipticus

Branchlets with appressed, white hairs; leaflets usually lobed; petals pink or

PEC ATUIES TEC, cepa ne ew een whee eee es

5. R. parvifolius

3. Branchlets glabrous; leaflets glabrous, or sparsely hairy on veins ...........-..00008. A

Branchlets hairy; leaflets uniformly hairy throughout........... 0.0.00 c cee ee eee eee 5

4. Most carpels glandular; leaflets 14-27 mm wide; petals hairy on both

SUTEACES oe Loh 0 Mann ele ee ate Ng Slatatn ene

Birig ESS TEs of ORRIN Lica beth 3. R. queenslandicus

No carpels glandular; leaflets 20-48 mm wide; petals glabrous on inner

SUE ACE as FET se, ee Cider ee lace retah ee ier yr,

5. Flowers with 5 petals ...............06.

Flowers with 9-13 petals ...............

1. Rubus probus L.H.Bailey, Gentes Herb.

1(4): 150 (1923). Type: cultivated at Rio

Piedras, Porto Rico [Puerto Rico],

undated, J. Griffith s.n. (holo: BH).

Rubus muelleri F.M.Bailey, Proc. Roy. Soc.

Queensland 1: 9 (1884), nom. illeg., non

Lefevre (1859). Type: Queensland.

MorETON DISTRICT: near waterfalls,

Helidon, undated, F.M. Bailey s.n. (holo:

BRI; iso: MEL).

Illustrations: S. & A. Pearson, Pl. of Central

Queensl., p.356 (1989) as RK. fraxinofolius

(sic); H. Dick, Aust. Plants 18: 76 (1995)

as R. rosifolius.

Erect shrubs, sometimes semi-scandent, up to 3

m high. Stems glabrous, with stout, curved to

almost straight prickles to 4mm long. Leaves of

mature stems up to 120 mm long, imparipinnate,

with 5 or 7 (rarely 9) leaflets on canes, but with

unifoliolate or trifoliolate leaves adjacent to

Bean, Rubus

inflorescences. Petioles 30-60 mm long,

grooved on upper surface, glabrous, with a few

stout prickles. Rachis glabrous exceptat junction

with lateral leaflets. Petiolules of lateral leaflets

1.5—4mm long, grooved, hairy at base; petiolules

of terminal leaflets 8-25 mm long, grooved

above, glabrous. Stipules persistent, linear, ’7—12

mm long,c.0.5 mm wide, entire, acute, attached

to petiole 2-4 mm above petiole base. Blades of

leaflets ovate, 36—95 x 20-48 mm, the terminal

leaflet often slightly larger than the lateral ones;

glabrous or sometimes with sparse hairs on

midrib or throughout lamina; base broadly

cuneate or obtuse, sometimes oblique tn lateral

leaflets; apex acute to acuminate; margins

biserrate, with serrations 1.5-3.5 mm deep;

glands on abaxial surface sessile, yellow or

brown, sparse (65-200/sq. cm). Leaflets

penninerved with 7—10 pairs of lateral veins,

terminating ata major tooth; venation reticulate,

with midrib and lateral veins impressed above,

raised below; prickles occasionally present.

Inflorescence terminal or in upper leaf axils, up

to 110 mm long, with up to 30 flowers. Bracts

and bracteoles entire or tripartite, to 9 mm long;

segments linear, acute. Pedicels terete, 6-23

mm long, glabrous; sessile glands present.

Flower buds deltoid; hypanthia shallowly-

convex to almost flat, glabrous, unarmed; sessile

glands present. Sepals persistent, deltate, 6-13

x 2.5-4.5 mm, including a 1.5-5.0 mm long

acumen, entire, recurved after anthesis, inside

with dense white hairs throughout, outside

glabrous; prickles absent. Petals 5, deciduous,

obovate to orbicular, 7-12 x 5-10 mm, not

clawed, sparsely hairy on both surfaces, white.

Stamens 100—150, glabrous; filaments up to 4

mm long; anthers c. 0.7 mm long. Carpels

300-500, glabrous or with sparse filamentous

hairs, glands absent; ovaries c. 0.4 mm long;

styles c. 1.4 mm long. Carpels extending to base

of torus, annulus of hairs present at base of

torus. Aggregate fruit ellipsoidal to ovoid, 10-15

mm long and |Q—17 mm in diameter when dried,

c. 17 mm long and 26 mm diameter when fresh;

exocarp red at maturity. Endocarpids ellipsoidal,

lacunose, c. 1.4 = 1.1 x 1.0 mm.

Selected specimens: New Guinea. Strickland River, in

1885, Baeuerlen sn. (BRI). Bougainville. Kupei Gold

field, Apr 1930, Kajewski 1629 (BRI). Queensland, Cook

District: Mt Lewis road, 28.1 km from Rex Hwy, Aug

1986, Weston 773 et al. (BRI, NSW); Swipers Flat,

679

Wooroonooran N.P., Jul 1995, Forster PIF 17149 & Figg

(BRI, MEL); Parish of Jordan, Lower Downey L.A., Sep

1992, Gray 5535 (QRS); Mourilyan harbour, Eof Innisfail,

sep 1970, Whiting s.n. (BRI). NortH KENNEDY District: 6

km W of Paluma, Jul 1992, Jobson 1700 et al. (BRI, MEL);

Strathdickie near Proserpine, undated, Michael s.n. (BRD.

SOUTH Kenneby District: Mt McCartney, SF 652 Cawley,

Apr 1991, Forster PIF8169 & McDonald (BRI); Swampy

Ridge, W of Eungella township, May 1992, Bean 4465

(BRD; East Funnel Creek, between Ist and 2nd road

crossings, Sep 1993, Champion 865 (BRI). Porr Curtis

District: Byfield, near Keppel Bay, Sep 1931, White 8210

(BRD); Mt Archer, c. 2 km NE of Rockhampton, Jun 1985,

Anderson 3998 (BRI); Blackman Gap, 18 km SW of

Miriam Vale, May 1976, Rodd 3047 & Jacobs (BRI,

NSW). Burnetr District: headwaters of Pine Mountain

Creek, N of Monto, Jul 1995, Bean 8773 (BRI, MEL,

QRS), WibE Bay District: upper reaches of Broken Ck, SE

of Builyan, Sep 1995, Bean 8943 & Robins (BRI, MEL);

Imbil, Dec 1958, Curtis 3 (BRI). Moreron District:

Whitecross property, Camp Flat road, Bli Bli, Aug 1994,

Bean 7782 (BRI); Palmwoods, May 1907, White s.n.

(BRD); near Vinegar Hill, [4 km NE of Helidon, Aug 1995,

Bean 8887 (BRI, MEL).Puerto Rico: Toro Negro Forest

Reserve, Rt 143, Mar 1992, Axelrod 4278 & Chavez

(UPRRP); Mpio. de Ponce, rte 143 at Cerro de ia Punta,

May 1988, Taylor 8112 CUPRRP).

Distribution and habitat: R. probus is widely

but discontinuously distributed in coastal areas

of Queensland extending from Mt Lewis

(16°30’S) in the north, to Helidon (27°30’S) in

the south (Map 1), Itis also newly recorded here

tor New Guinea and Bougainville. R. probus is

naturalised in high altitude areas of Puerto Rico

(Axelrod pers. comm.).

In Australia it inhabits rainforest margins

and clearings or shady gullies in dense eucalypt

forest on fertile soils. In southern Queensland,

altitudes range from Q-550 metres, while in

north Queensland they range from 160-1100

metres.

Phenology: Flowers and fruits have been

recorded between April and December.

Affinities: R. probus is most closely related to

R. fraxinifolius Poir. from Malesia, but differs

from that by its leaflets with 7-10 pairs of lateral

veins (10-15 for R. fraxinifolius), biserrate

leaflet margins (serrate for R. fraxinifolius),

and petals with sparse hairs (glabrous for

R. fraxinifolius).

Kk, probus differs from R. rostfolius by its

larger stature, non-glandular carpels (glandular

ink. rosifolius); leaflets 20-48 mm wide (9-20

680

120 125 i30

lis #20 125 130

Map 1. Distribution of Rubus probus.

mm widein &. rosifolius); leaflet length:breadth

ratio 1.8-2.7:1(2.5—4:1 in R. rosifolius); leaves

and stems glabrous (hairy in R. rosifolius); and

the petiolules of the lateral leaflets 1.5—4 mm

long (O-1 mm in RX. rostfolius).

R. probus differs from Rk. chrysogaeus

P.Royen by its non-glandular carpels and leaflets

with 7-10 pairs of lateral veins (12-13 pairs for

R. chrysogaeus) and its distinctly biserrate

leaflets.

Conservation status; Acommon and widespread

species.

Notes: The name ‘Rubus miillerii’ was validly

published by L.V.Lefevre in P.J.Miiller’s

account of European Rubi in 1859, honouring

P.J.Miiller. According to Article 60 of the

International Code of Botanical Nomenclature

(Greuter 1994), the ending of the specific epithet

must be corrected to ‘-i’, and furthermore, the

‘i’ of the German language is to be transcribed

to ‘we’ in Latin epithets, making the correct

spelling of the epithet ‘muelleri’. Itfollows then

that R. muelleri F.M.Bailey (1884) is a later

homonym and therefore an illegitimate name.

135

Austrobatleya 4(4): 677-689 (1997)

[55

POL

148 145 156 i355

The type of R. probus was collected in

Puerto Rico. Seeds of a Rubus taxon were sent

there in 1908 by James Pink of Wellington

Point, Queensland. Mr Pink, in a letter now

lodged at BH, said that these seeds belonged to

a plant he developed which, he claimed, was a

hybrid between KR. ellipticus and R. rosifolius.

However, this is clearly not the case, as the

plants subsequently cultivated in Puerto Rico

(of which I have examined specimens) are

conspecific with the taxon described by F.M.

Bailey as R. muelleri, and match the type of

R, probus L.H.Bailey.

Corrie (1907) describes collecting fruits

of a wild raspberry from Raspberry Creek, a

tributary of Monal Creek, north of Monto in

1906, and bringing the seeds back to Brisbane

to be propagated. Corrie later states that the

Monal Creek ‘variety’ was no different from

‘Pink’s hybrid’. It is possible that the Puerto

Rican populations were derived from the Monal

Creek provenance.

F.Mueller labelled several specimens of

R. probus at MEL as ‘R. rosifolius var.

eglandulosus’ but this name was never validly

published.

a MRT DPI et ia dat ie i ee LLL ee enuvard 4s fhe ci ce

SF a a ae ee a MAGNE TRT ENA RRNA BASU PLS pe

Bean, Rubus

2. Rubus rosifolius Sm., Pl. icon. ined. 3 (1791)

t. 60. Type: Mauritius, 1769-1773, P.

Commersons.n. (holo: LINN Smith herb.

no. 902.63), BRI microfiche).

Rubus eglanteria Tratt., Rosac, monogr. 3:

9 (1823). Type: Nova Hollandia, rv.

For additional synonymy of Rubus rosifolius,

see Zandee & Kalkman (1981).

Erect shrubs, sometimes semi-scandent, up to

1.2 m high. Stems hairy, with stout, curved to

almost straight prickles to 5 mm long. Leaves of

mature stems up to 160 mm long, imparipinnate,

with 5 or 7 leaflets on canes, but with unifoliolate

or trifoliolate leaves adjacent to inflorescences.

Petioles 15—35 mm long, grooved on upper

surface, hairy, with a few stout prickles. Rachis

hairy. Petiolules of lateral leaflets O-1 mm long,

grooved, hairy; petiolules of terminal leaflets

5-12 mm long, grooved above, hairy. Stipules

persistent, narrowly lanceolate to linear, 5—11

mm long, 0.5—1 mm wide, entire; apex acute,

attached to petiole O-2.5 mm above petiole

base. Blades of leaflets lanceolate, 30-—65(78) x

9—20(27) mm, the terminal leaflet often larger

than the lateral ones; hairy on both surfaces,

base broadly cuneate to cordate, sometimes

oblique in lateral leaflets; apex acute to

acuminate; margins biserrate, with serrations

1—2 mm deep; glands on abaxial surface sessile,

yellow or brown, dense (400-800/sq. cm).

Leaflets penninerved with 6—14 pairs of lateral

veins, terminating at a major tooth; venation

reticulate, midrib and lateral veins impressed

above, raised below, prickles occasionally

present. Inflorescence terminal or in upper leaf

axils, up to 60 mm long, with up to 3 flowers.

Bracts and bracteoles entire to tripartite, to 8

mm long, segments linear, acute. Pedicels terete,

18—32 mm long, hairy, sessile glands present.

Flower buds globular, hypanthia shallowly-

convex to almost flat, hairy, unarmed, glands

present; sessile. Sepals persistent, deltate, 6-13

x 2.54 mm, including a 1.5—6mm long acumen,

entire, recurved after anthesis; inside with dense

white hairs throughout, outside sparsely hairy,

prickles absent. Petals 5-13, deciduous, elliptical

to orbicular, not clawed, 6.5—13 x 7-10 mm,

hairy on outer surface, white. Stamens 100-200,

glabrous; filaments up to 4 mm long, anthers c.

0.5 mm long. Carpels c. 400, glabrous, glands

681

shortly stalked, 4-10 per carpel; ovaries c. 0.6

mm long, styles c. 1.3 mm long. Carpels

extending to base of torus, annulus of hairs

present at base of torus. Aggregate fruit

ellipsoidal to globose, 13-18 mm long and

11-15 mm in diameter when dried, c. 20 mm

long and c. 14 mm in diameter when fresh,

exocarp red at maturity. Endocarpids ellipsoidal,

lacunose, c. 1.5 x 1.0 x 0.6 mm.

Phenology: Flowers have been recorded from

June to December; fruits from July to December.

Notes: The type of RK. rosifolius was collected at

Mauritius, an island in the Indian Ocean. Baker

(1877) was clearly of the opinion that

R. rosifolius was introduced to that island, saying

that it ‘is established abundantly ...’ and that it

‘was brought from the Malay Isles by

Commerson’,

The type of Rubus eglanteria Tratt. is not

present at W, nor at BM, FI, G or K. However,

from the description given, it appears this name

is applicable to R. rosifolius.

Based on petal numbers in the flowers,

two varieties of this species are recognisable in

Australta.

2a. Rubus rosifolius Sm. var. rosifolius

Illustration: K.A.W, Williams, Native Pl. of

Queensl, 3: 275 (1987).

Petals 5

Selected specimens: Queensland. Port Curtis District:

SF 218, Kroombit Tops, Jun 1982, Gibson 446 (BRI);

Bulburin SF, Jul 1959, Therne 22436 & Tracey (BRD.

WipE Bay District: Imbil, Dec 1958, Curtis (BRD;

Conondale Range, Sep 1980, Dillewaard 162 & Olsen

(BRI). DARLING Downs District: Bunya Mountains, Oct

L919, White s.n. (BRI); near Moss Gardens, Aug 1995,

Forster PIF17429 et al. (BRI, MEL, NSW), Moreton

District: Mt Glorious, Nov 1972, Lebler & Durrington s.n.

(BRI, MEL); foothills of Mt Ballow, downstream from

Grace's Hut, Dec 1989, Bean 1286 (BRI). New South

Wales. NortH Coast: Tooloom scrub, 15 mls [24 km} SW

of Urbenville, Dec 1965, Constable 6647 (BRI, NSW);

Gibraltar Range, 48 mls [77 km] from Glen Innes, Aug

1960, Caichiolo sn. (NE). NORTHERN TABLELANDS: Mt

Banda Banda Reserve, 45 km NW of Wauchope in Mt Boss

S.F., May 1975, Coveny 6374 et al. (NSW). CENTRAL

TABLELANDS: Running Stream Creek, c. 3 mls [5 km] ENE

of Glen Davis, Sep 1964, Constable 5128 (NSW); Mt

Wilson, Jan 1982, Medd 160348 (NSW); Robertson, Jul

682

115 120 i25 t30

Is 120 125 130

Map 2. Distribution of Rubus rosifolius var, rosifoliis.

1985, Stiles s.n, (NE), CENTRAL CoAsT: Royal N.P., 5 km

along Bulli road from Audley turnoff, Oct 1982, James 217

& Parris (NSW); Kurrajong, adjacent to the Grose R.,

undated, Atkinson 22 (MEL). Soutu Coast: Tantawangalo

SF, McCarthys Ck, Dec 1990, Crawford 1242 (CANB,

MEL, NSW); Egan Rocks Nature Reserve, Sep 1984,

Albrecht 882 (MEL, NSW). Victoria. Alfred N.P., Nov

1969, Beauglehole ACB 32057 & Finck (MEL); Kalimna

Gully near Lakes Entrance, Aug 1944, Willis s.n. (MEL).

Distribution and habitat: R. rosifolius var.

rosifolius 1s indigenous to many areas of south-

east Asia, including Sri Lanka, Cambodia,

Taiwan, Borneo and New Guinea. It 1s also

indigenous to south-eastern Australia where it

extends from Kroombit Tops (near Gladstone)

in central Queensland throughout eastern New

South Wales to eastern Victoria (Map 2). It

prows on rainforest margins or in wet eucalypt

forest, often in disturbed areas.

Conservation status; Acommon and widespread

taxon in Australia. No conservation coding is

necessary for it.

2b. Rubus rosifolius var. commersonii (Poir. )

Tirveng., Rev. Handb. Fl. Ceylon, 3: 344

(1981); Rubus commersonii Poir.inLam.,

PCR

PEEP HEE

as anne

k a7 mH

cee EEEE EE EE SUSEETE ran ceeeain

ECE RE

ry TL SEUUSaeannneeenn N

ACEC EEE EEE

135

Austrobaileya 4(4): 677-689 (1997)

135 140 145 150 155

r as ek a ae as oe Se a eT P++-f

EECCA OEE EERE

SP PN,

CCE CeCe rere

CEE CEC Cera

ama ae = | Te Ed Bs

aeR Lz

SEEEEEE ECE HE Hi

PE aT

LAG 40

ia MEETTH

ido 145 150 155

Encycl. 6: 240 (1804). Type: Java,

1766-1769, P. Commerson s.n. (holo:

P-JU n.v., BRI microfiche).

Illustration: Harden (ed.), Fl. of N.S.W. 1:

plate 32 (1990).

Petals 9-13

Selected specimens; Queensland. Wipe Bay DIsTrRICcT:

Ironstone Creek road, SE of Kandanga, Nov 1993, Bean

7048 (BRI). Moreton District: Mt Mee Forest Office, 8

km W of Mt Mee, Jul 1995, Bean 8766 (BRD); 3 mile scrub,

Jul 1874, Bailey s.n. (BRD. New South Wales. Nortu

Coast: east of Gibraltar Range, Apr 1968, Thomas s.n.

(NE); Clarence River, undated, Becklers.n. (MEL); Hortons

Creek, on Grafton-Armidale road, Apr 1994, Bean 7662

(BRI, NSW); Bellingen, Aug 1980, Pearson s.n. (NSW).

CENTRAL Coast: Point Clare, Jun 1897, Forsyths.n. (NSW);

Yellow Rock, Jul 1942, McBarron 667 (NSW).

Distribution and habitat: R. rosifolius var.

commersonit has a broad but sporadic

distribution. Outside Australia, it is recorded

for Java, Mauritius, China and Brazil. In

Australia, itis known from a few localities from

southern Queensland to central New South Wales

(Map 3). It grows on rainforest margins or in

wet eucalypt forest, often in disturbed areas.

Bean, Rubus

It5 120 125 130

115 120 125 130

Hf)

Lad

Yall

Map 3. Distribution of Rubus rosifolius var. commersonit.

Affinities; R. rosifolius var, commersonii is

distinguished from R. rosifolius var. rosifolius

by its 9-13 petals per flower, compared to 5

petals in the type variety. There appear to be no

other differences.

Conservation status: A taxon of sporadic

occurrence, but not rare or threatened in

Australia. No conservation coding is necessary

for it.

3. Rubus queenslandicus A.R.Bean sp. nov.

affinis R, rosifolio, aquo foltis caulibusque

glabris, petiolulis foliolorum lateralium

longioribus, foliolis omnibus glandes

sessiles sparsas ferentibus et petalis

utrinque pubescentibus differt. Typus:

Queensland. Cook District: South

Mary L.A., S.F. 143, 21 km along Mt

Lewis road, 16°32’S 145°16’E, 15 June

1995, P.L. Forster PIF16808 (holo: BRI:

iso: MEL, NSW, QRS).

Erect shrubs, sometimes semi-scandent,

up to | m high. Stems glabrous, with stout,

curved to almost straight prickles to 3 mm long.

Leaves of mature stems up to 155 mm long,

$35

EERE EEE EE

at bates al | TT

VyAlad fale toma

Tied ||

EEECCEEEEL ee

rt ttt rt tL Res

eC CLE EE TCT SCOPE RE TT

135

BARE

683

140 145 130 155

az Seeman

Cl | A

eae

ial oy

ete

a0 8

ae ky

Say

140 145 150 135

imparipinnate, mostly with 5 or 7 leaflets on

canes, but with unifoliolate or trifoliolate leaves

adjacent to inflorescences. Petioles 24-48 mm

long, grooved on upper surface, glabrous, with

a few stout prickles. Rachis glabrous, except at

junction with lateral leaflets. Petiolules of lateral

leaflets 1-3 mm long, grooved, hairy at base;

petiolules of terminal leaflets 5-14 mm long,

grooved above, glabrous. Stipules persistent,

linear, 5—10 mm long, 0.25—0.5 mm wide, entire:

apex acute, attached to petiole 1-2.5 mm above

petiole base. Blades of leaflets narrowly ovate,

43-80 x 14-277 mm, the terminal leaflet often

larger than the lateral ones; glabrous or with

sparse hairs, base obtuse, sometimes oblique in

lateral leaflets; apex acute to acuminate; margins

biserrate or triserrate, with serrations 1.5—3 mm

deep; glands on abaxial surface sessile, yellow,

sparse (100-—200/sq. cm). Leaflets penninerved

with 8-9 pairs of lateral veins, terminating ata

major tooth; venation reticulate, midrib and

lateral veins impressed above, slightly

raised below, prickles occasionally present.

{ntlorescence terminal or in upper leaf axils, up

to 90 mm long, with up to 6 flowers. Bracts and

bracteoles tripartite, to 3 mm long, segments

linear, acute. Pedicels terete, 14-36 mm long,

684

glabrous, sessile glands present or absent. Flower

buds deltoid, hypanthia shallowly convex to

almost flat, glabrous, unarmed, sessile glands

present. Sepals persistent, deltate, 6-11 x 2-3.5

mim, including a 1.5—6 mm long acumen, entire,

recurved after anthesis; inside with dense white

hairs throughout, outside glabrous except along

margins, prickles absent. Petals 5, deciduous,

elliptical to obovate, not clawed, 9-11 x 5-8

mm, with sparse hairs on both surfaces, white.

Stamens 100-200, glabrous; filaments up to3.5

mm long, anthers c. 0.5 mm long. Carpels

400-600, glabrous; glands shortly stalked, 1—5

per carpel, or absent from some carpels; ovaries

c. 0.8 mm long, styles c. 1.5 mm long. Carpels

extending to base of torus, annulus of hairs

present at base of torus. Aggregate fruit ovoid to

cylindrical, 12-15 mm long and 8-12 mm in

diameter when dried, c. 18 mm long and c. 13

mm in diameter when fresh, exocarp red at

maturity. Endocarpids ellipsoidal, lacunose, c.

14x 10x 0.4 mm. Fig. 1.

Specimens examined: Queensland. Cook District: 1.2

km before W Spencer Ck Forestry Camp, SF 144, Mt

Windsor Tableland, Nov 1988, Jessup GJMI349 et al.

(BRI); SF 144, Mt Windsor Tableland, Jul 1995, Forster

Austrobaileya 4(4): 677-689 (1997)

PIF17268 & Figy (BRI, QRS); Leichhardt Logging Area,

Timber Reserve 66, 13 km along Mt Lewis road, Jun 1995S,

Forster PIF16800 (BRI, K, L, MEL, MO, NSW, QRS); Mt

Lewis road, 9 km W of the junction with the main highway,

Aug 1990, Luckow 3804 (BH, QRS); Mt Lewis, Aug 1979,

Clarkson 2491 (BRI); Baldy Mountain, S.F. 194, Jun 1995,

Forster PIF16788 (BRI, MEL, NSW, QRS); Gadgarra,

Atherton Tableland, Jul 1929, Kajewski 1146 (BRD; near

Mt Hatg, Tinaroo Creek road, 4.5 km NNW of Danbulla,

Nov 1979, Clarkson 2723 (BRI); Lamb Range c. 6 km N

of Danbulla forestry camp, Nov 1979, Clarkson 2729

(BRD; Tinaroo Range, Noel LA, north of Tinaroo Falls

dam, Nov 1981, Kanis 2151 (BRI); EP14, Python L.A.,

S.F.R. 185, Danbulla, Aug 1976, Stocker 1506 (QRS);

S.F.R. 194, Parish of Western, Oct 1991, Gray 5330

(QRS); McGuire property, P.E.I. Road, Glen Allyn, Sep

1992, Cooper & Cooper 374 (QRS); Crater N.P. margin,

Jun 1991, Elick 99 (QRS); Palmerston Highway near

Beatrice River crossing, Nov 1979, Clarkson 2732 (BRI).

NortH Kennepy District: Mt Fox, Nov 1949, Clemens s.n.

(BRD.

Distribution and habitat: Rubus queenslandicus

is endemic to north Queensland from Windsor

Tableland to Mt Fox, with most specimens

collected from the Atherton Tableland (Map

4). Altitudes range between 680-1200 metres.

Rk. queenslandicus grows on rainforest margins

or in disturbed rainforest, in areas with an

annual rainfall greater than about 1500 mm.

Vig. 1. Rubus queenslandicus: A. flower x 2, B, carpid x 8, showing style and gland. C. aggregate fruit x 2. D. leaf x 0.6.

A-~-B, Forster PIF16788; C, Forster PIF16792; D, Forster PIF16800.

Bean, Rubus

Phenology: Flowers have been recorded

between June and November; fruits from

between August and November.

Affinities: R. queenslandicus is closely related

to R. rosifolius but differs from that by its

glabrous stems and glabrous or sparsely hairy

leaves, petiolules of lateral leaflets 1-3 mm

long (O-1 mm long for R. rostfolius), sparse

sessile glands on leaves (dense for XK. rosifolius)

and petals hairy on both surfaces (hairy on outer

surface only for R. rosifolius), R. queenslandicus

differs from R. probus by its glandular carpels

(non-glandular for R. probus), up to 6 flowered

inflorescences (up to 30 flowered for RK. probus),

and narrower leaflets.

R. queenslandicus differs from R.

chrysogaeus by its leaflets with 8~9 pairs of

lateral veins (12—13 pairs for R. chrysogaeus)

and fruits with 1-5 glands per carpel (S—30

glands per carpel for R. chrysogaeus).

Conservation status: Locally common, and not

rare or endangered.

Etymology: The specific epithet refers to the

Australian state of Queensland where the species

is endemic.

4. Rubus ellipticus Sm. in Rees, Cycl. 30:

no.16 (1815). Type: Nepal, April 1802,

F. Buchanan s.n. (holo: LINN (Smith

herb. no. 902.71), BRI microfiche).

Erect shrubs with arching canes, up to 2.5 m

high. Stems hairy, with stout, curved prickles to

4 mm long, and with a dense covering of stiff

reddish bristles, to 4mm long. Leaves up to 125

mim long and trifoliolate on canes, butsometimes

unifoliolate adjacent to inflorescence. Petioles

27-40 mm long, terete, hairy, with a few stout

prickles, reddish bristles present. Rachis hairy,

reddish bristles present. Petiolules of lateral

leaflets 1.5—-3 mm long, terete, hairy; petiolules

of terminal leaflets 9-25 mm long, terete, hairy.

Stipules rather deciduous, linear, 4.5-8 mm

long,c. 0.3 mm wide, entire; apex acute, attached

to petiole 1~2.5 mm above petiole base. Blades

of lateral leaflets ovate to elliptical, 19-45 x

18—32 mm, the terminal leaflet often larger than

the lateral ones, 33-68 x 27-45 mm; sparsely

hairy on upper surface, densely tomentose below,

base broadly cuneate or obtuse, not oblique in

lateral leaflets; apex obtuse or rarely acute;

margins uniserrate, with serrations 1-1.5 mm

685

deep; glands absent. Leaflets penninerved with

7-9 pairs of lateral veins, terminating at a major

tooth; venation reticulate, midrib and lateral

veins impressed above, raised below, prickles

_ occasionally present. Inflorescence terminal or

in upper leaf axils, up to 50 mm long, with up to

16 flowers. Bracts entire or tripartite, to 7 mm

long, segments linear, acute. Pedicels terete,

5—12 mm long, hairy, glands absent, reddish

bristles present. Flower buds globular, hypanthia

shallowly convex to almost flat, hairy, unarmed,

reddish bristles present, glands absent. Sepals

persistent, ovate, 4.5-5.5 x 3-5 mm, without an

acumen, entire, not recurved after anthesis; both

surfaces with dense white hairs throughout,

prickles absent, reddish bristles present. Petals

5, deciduous, elliptical, not clawed, 7-10 x 5-8

mm, hairy, white. Stamens 110-190, glabrous;

filaments up to 4 mm long, lorate; anthers c. 0.7

mm long. Carpels c. 120, hairy, glands absent;

ovaries c. 0.8 mm long, styles c. 2.5 mm long.

Carpels extending to base of torus, whole of

torus hairy. Aggregate fruit oblate to globular,

c.9 mm long and 10 mm diameter when dried,

c.9 mm long and 12 mm diameter when fresh,

exocarp yellow at maturity. Endocarpids

ellipsoidal, lacunose, c. 1.7 x 1.2 x 0.8 mm.

Speciinens examined: Queensland. WipE Bay DISTRICT:

Maryborough, Fairley Estate, Nov 1948, Clemens s.n.

(BRI); East Deep Creek, via Gympie, Sep 1964, Setchell

sn. (BRI); Imbil, Jan 1962, Brimblecombe s.n. (BRD;

Mothar Mountain SF, south-east of Gympie, Oct 1993,

Bean 6817 (BRI); Noosa shire, Nov 1920, Edwards s.n.

(BRI); near Mapleton, Jul 1952; Blake 18957 (BRI); Flaxton,

Montville, Dec 1955, Bundesen s.n. (BRD; Obi Obi Creek,

Baroon Pocket, 3 km SW of Montville, Aug 1983, Sharpe

3353 (BRI); Cork Pocket road, 8 km west of Maleny, Jul

1993, Bean 6239 (BRI, NSW); Obi Obi Ck weir, 2 km SW

of Maleny, Jun 1995, Bean 8714 (BRI, MEL, NSW).

Moreton Districr: Eumundi, Jun 1912, White s.n. (BRI);

between Nambour and Mapleton, c. 95 km N of Brisbane,

Nov 1956, Eichler 13161 (AD, BRD; Blackall Range, Dec

1916, White s.n. (BRD; Montville, Jul 1954, Mann s.n.

(BRI); Upper Cedar Ck, Mt Glorious, Aug 1985, Batianoff

4885A (BRI, NSW, SP, US); Upper Brookfield near Bris-

bane, Jun 1926, White s.n. (BRI); Mt Cotton, Dec 1977,

Fischs.n, (BRD; Hotham Creek, 2kmS of Pacific Highway

near Pimpama, Jul 1995, Bean 8733 (BRI, MEL, NSW);

Upper Coomera, Jul 1959, Marshalls.n.(BRD. NewSouth

Wales. Nortx Coast: Norville’s property, Bilambil, Jul

1978, Floyd 993 (BRI).

Distribution and habitat: Rubus ellipticus is

indigenous to south-east Asia including India,

Sri Lanka, Burma, Thailand, Laos, Vietnam,

China and the Philippines (Zandee & Kalkman

1981). In Australia, it is naturalised in coastal

686

126 125 130

Lis

15 120 125 130

CLE OOOELO

SeeuResaneenan ttt ta A 2 a

ne =m = od Ae ~

CCE CCE ea x

ECECEEECE ECC RE ti

REECCOEELEEEECC CEE eH

PEE

CCC RET

“Ae COE Na HE

Pee eT

Austrobaileya 4(4): 677-689 (1997)

35 140 145 150 155

ats

PEEEEEEEEEEC EH

135 140 145 150 155

Map 4. Distribution of Rubus queenslandicus e, Rubus ellipticus a.

areas of southern Queensland and northern New

South Wales (Map 4). It grows in high rainfall

areas with fertile soil, on rainforest margins or

in cleared or disturbed areas which formerly

supported rainforest.

Phenology: Flowers have been recorded from

July-October, with onerecord in January. Fruits

are recorded from July to December.

Note: R. ellipticus was first introduced into

Australia under the name R. flavus in 1891, in

the form of seeds received from the Botanical

Gardens, Saharanpur, India (Soutter 1892).

Plants were propagated in Brisbane and

distributed to various parts of Queensland. It

was first recorded as naturalised in 1912 at

Eumundi, Queensland. While populations are

now known up to 100 km north and 200 km

south of this point, the species is nowhere

common except along the Blackall Range, to

the south-west of Eumundi.

Affinities: R. ellipticus is a distinctive species

quite unlike any indigenous Australian species.

It is readily distinguished from them by its

elliptical leaflets and long red bristles on the

stems and petioles, and yellow fruits.

5. R. parvifolius L., Sp. Pl. 1197 (1753). Type:

China. near Canton, undated, Osbeck s.n.

(LINN n.v., BRI microfiche).

Rubus macropodus Ser. in DC., Prodr. 2:

557 (1825). Type: New South Wales. ‘in

Botany Bay’, n.v.

[Rubus ribesifolius Sieber No. 192, nomen

nudum |

Rubus zahlbrucknerianus Endl., Atakta bot.

t. 35 (1835). Type: the illustration.

Rubus boormanii Gand., Bull. Soc. Bot.

France 65: 25 (1918). Type:New South

Wales. Awaba, Oct 1899, J.L. Boorman

s.n. (holo: LY n.v.; iso: NSW).

Rubus stmsonianus Gand., Bull. Soc. Bot.

France 65: 25 (1918). Type:Tasmania.

Oceania, in 1875, Simson s.n. (holo: LY

n.v., photo at NSW).

Rubus tasmanicus Gand., Bull. Soc. Bot.

France 65: 25 (1918). Type: Tasmania.

Oceania, in 1875, Simson s.n. (holo: LY

n.v., photo at NSW).

a ee ae ee ee ae re

Bean, Rubus

Rubus walterianus Gand., Bull. Soc. Bot.

France 65: 25 (1918). Type: Victoria.

Wandong Ranges, in 1898, C. Walter s.n.

(holo: LY n.v., photo at NSW).

lllustrations: Cochrane et al., Fl. & Plants of

Victoria & Tasmania p. 87 (1980); B.A.

Auld & R.W. Medd, Weeds - An Illust.

Bot. Guide to the weeds of Austral. p. 218

(1987); D.L. Jones & B. Gray, Climbing

Pl. in Austral. t.333 (1988), Harden (ed.),

Fl. of N.S.W. 1: plate 32 (1990).

Prostrate to semi-scandent shrubs, up to 0.5 m

high. Stems hairy, with stout, curved to almost

straight prickles to 3.5 mm long. Leaves of

mature stems up to 75 mm long, imparipinnate,

mostly with 3 or 5 leaflets on canes, but with

unifoliolate leaves on juvenile material or

adjacent to inflorescence. Petioles 11-30 mm

long, grooved on upper surface, hairy, with a

few stout prickles. Rachis hairy, Petiolules of

lateral leaflets O-2 mm long, grooved, hairy;

petiolules of terminal leaflets 1-19 mm long,

grooved above, hairy. Stipules persistent, linear,

5.5—12 mm long, c. 0.6 mm wide, entire or with

short acuminate lobes; apex acute, attached to

petiole |—2.5 mm above petiole base. Blades of

lateral leaflets ovate to rhomboidal, 10-26 x

7—22 mm, the terminal leaflet distinctly larger

than the lateral ones, 19-40 x 17-42 mm;

sparsely hairy on adaxial surface, densely

tomentose on abaxial surface; base broadly

cuneate or obtuse, sometimes oblique in lateral

leaflets; apex acute to obtuse; margins biserrate,

with serrations 1-5 mm deep; glands absent.

Leaflets penninerved with 3-5 pairs of lateral

veins, terminating at a major tooth; venation

reticulate, midrib and lateral veins impressed

above, raised below, prickles occasionally

present. Inflorescence terminal or in upper leaf

axils, up to 50 mm long, with up to 7 flowers.

Bracts and bracteoles tripartite, to 6 mm long,

segments linear, acute. Pedicels terete, 12-33

mm long, hairy, glands absent. Flower buds

deltoid, hypanthia shallowly convex to almost

flat, hairy, prickles present, glands absent or

rarely stalked glands present. Sepals persistent,

deltate, 8-14 x 3—5 mm, including a 0-3 mm

long acumen, entire or with small lateral lobes,

recurved after anthesis; inside and outside with

dense white hairs throughout, prickles present.

Petals 5, deciduous, orbicular to obovate, clawed,

687

4—6,5 x 3-5 mm, with sparse erect hairs on both

surfaces, pink to red. Stamens 60—75, glabrous;

filaments up to 5 mm long, anthers c. 0.6 mm

long. Carpels 26-38, glabrous or hairy, glands

absent; ovaries c. 0.8 mm long, styles c. 4.5 mm

long. Carpels extending to base of torus, torus

glabrous. Aggregate fruit ellipsoidal to globular,

c. 12mm long and 10 mm diameter when dried,

c, 14mm long and 12 mm diameter when fresh,

exocarp red atmaturity. Endocarpids ellipsoidal,

lacunose, 2.5~-3.3 xc. 1.5 xc. 1.5 mm.

Selected specimens: Queensland, SouTH KENNEDY DISs-

TRICT: Swampy Ridge, W of Eungella township, May 1992,

Bean 4464 (BRI). LercyyaArpt District: Dawson River, 61

km N of Injune, Nov 1993, Bean 6858 (BRI, CANB). Port

Curtis District: Kroombit SF 316, 45 km SW of Calliope,

Oct 1988, Gibson TOI391 (BRD; Mt Archer, Rockhampton,

Feb 1980, Stanley 595 (BRI), Burnerr District: Boyne

River, c. 15 mls [24km] W of Kingaroy, Oct 1954, Johnson

& Pedley (BRI). Wide Bay District: Hasthorpe road, 2 km

E of Kandanga, Nov 1993, Bean 7101 (BRI, MEL, NSW).

DARLING Downs District: 32 km NE of Jandowae on

‘Russell Park’, Nov 1973, Barben s.n. (BRD. Moreton

District: Serpentine Creek, c. 11 km NE of Brisbane, Sep

1972, Durrington 470 (BRD; c. 8 km S of Boonah, Nov

1972, Carmichael s.n. (BRD. New South Wales. Nortu

WESTERN SLOPES: Oxley Park, Tamworth, Nov 1985, Hosking

s.n. (NSW), NorTHERN TABLELANDS: Little Llangothlin Lake

Nature Reserve, NNE of Guyra, Jan 1995, Bean 8280(BRI,

NSW). NortH Coast: Coopernook SF near Taree, Mar

1936, Bailey 16( BRI). CenTraL WESTERN SLOPES: Manildra,

Nov 1906, Boorman s.n. (NSW), CENTRAL TABLELANDS!

Jenolan Caves, Nov 1899, Blakely s.n. (NSW), CENTRAL

Coast: | km SW of Minamurra, May 1977, Pickard 3483

(NSW). SourH WESTERN SLopes: Lankey’s Creek, Jan 1947,

McBarron311 (NSW). SOUTHERN TABLELANDS: Nimmitabel,

Feb 1908, Cambage 1849 (NSW); Thredbo escarpment

beyond Prussian Ck, Kosciusko NP, Feb 1980, Thompson

4011 (NSW). Soutu Coast: Bombala River, c. 17 km NE

of Bibbenluke, Dec 1987, Crawford 783 (CANB, MEL).

Australian Capital Territory, Midway between Mt Ginini

and Mt Gingera, Feb 1975, Orchard 4519 (AD). South

Australia. Strangway waterfalls, c. iS km NW of Victor

Harbour, Dec 1958, Schodde 1043 (AD, CANB, K, P); 6

mls {10 km] SE of Cape Banks, near Lake Bonney, Feb

1945, Cleland sn. (AD); Dudley Peninsula, Kangaroo

Island, Nov 1883, Tate s.n. (AD). Victoria. | km NW of

Princetown, Dec 1992, Clarke 2183 (AD, CANB, MEL,

NSW); Hopkins Fails, Warrnambool district, Dec 1981,

Corrick 7920 (HO, MEL); Wabonga Plateau State Park,

Jan 1987, Piesse 719 (MEL). Tasmania, Barkers Beach,

Dec 1984, Collier 79 (HO, MEL); Lyell Highway near west

turnoff to Tarraleah, Feb 1981, Orchard 5352 (AD, HO,

MEL, NSW); Somerset, Feb 1948, Curtis s.n. (HO);

Eaglehawk Neck, Jan 1928, Cleland s.n. (AD).

Distribution and habitat: R. parvifoliusis widely

distributed in south-eastern Australia from

central Queensland (west of Mackay) to

688

{15 120 125 136

nek a

CEE

SCE

saesaeneententets

asauee CERES

[

“EEE

iS 120 125 130

Map 5. Distribution of Rubus parvifolius.

Tasmania, including eastern New South Wales,

the Australian Capital Territory, southern

Victoria, and south-eastern South Australia

(Map 3). Outside Australia, 1t occurs in Japan,

China, Taiwan and northern Vietnam. In

Australia, it inhabits open forests and woodlands

dominated by Eucalyptus spp., over a broad

climatic range and on a wide range of soil types.

Phenology: Flowers have been recorded for all

months of the year; fruits have been recorded

from November to April.

Affinities: R. parvifolius differs significantly

from all other Australian members of R.subg.

I[daeobatus by its flowers with comparatively

few carpels and stamens, the dense woolly

(omentum on the undersides of the leaflets, and

the lack of glands on any part of the plant. In

these features, it 1s close to Rubus moluccanus

of Rk. subg. Malachobatus.

The name Rubus macropodus was used

for Australian populations in the first half of the

[9th century, until it was placed in synonymy

with RX. parvifolius L. by Bentham (1864). Asian

specimens have flowers with hairy carpels. In

135 140 145 15

PCLT TT

EC aeaee CORREO CAE

HEC

a aC

ane a

ELE ETE Sanam

SECC EERE

gages TTT Re

135 i40 145 150 155

Austrobaileya 4(4): 677-689 (1997)

most cases, Australian plants have flowers with

glabrous carpels, but they are occasionally hairy.

Typification: No type specimen for

R. macropodus could be located at G, where

Stafleu and Cowan (1985) indicated Seringe’s

types for De Candolle’s Prodromus are located.

Potential type specimens were also sought from

BM, G—DC, K, L, LY, P and W, but without

success.

Conservation status: R. parvifoliusis widespread

and common.

Acknowledgements

I am grateful to the Directors of AD, BH, HO,

NE, NSW, MEL, QRS, TI and UPRRP for the

loan of specimens and/or access to their herbaria,

Australian Botanical Liaison Officers Laurie

Jessup (1993-94) and Barry Conn (1994—95)

who searched for types on my behalf, Dr W.

Greuter (B) for nomenclatural advice, Franklin

Axelrod (UPRRP) for information on R. probus

in Puerto Rico, Paul Forster (BRI) for making

Rubus collections and for comments on a draft

of this paper, Will Smith (BRI) for the

illustrations, and Peter Bostock (BRI) for the

Latin diagnosis.

Bean, Rubus

References

BAILEY, F.M. (1884). Contributions to the Queensland

Flora, Proceedings of the Royal Society of Queens-

land 1; 8-19.

BAKER, J.G. (1877). Flora of Mauritius and the Seychelles,

London: L. Reeve & Co.

BEAN, A.R. (1995). A Revision of Rubus subgenus

Micranthobatus (Focke) Kalkman (Rosaceae) in

Australia. Austrobaileya 4: 321-8.

BENTHAM, G. (1864). Rubus. In Flora Australiensis 2:

429-32. London: L. Reeve & Co,

Corrik, L.G. (1907). Queensland Acclimatisation Society,

44th Annual Report. Brisbane: H. Pole & Co,

Ewart, A.J. (1931). Flora of Victoria, Melbourne: Govern-

ment Printer.

Focke, W.O. (1910). Species Ruborum., Monographiae

Generis Rubi Prodromus part J. Stuttgart: Nagele

& Dr. Sproesser.

GREUTER, W., chm. (1994), International Code of Botanical

Nomenclature adopted by the Fifteenth Interna-

tional Botanical Congress, Yokohama,

August-September 1993. Konigstein, Germany:

Koeltz Scientific Books.

HENDERSON, R.J.F. (ed.) (1994). Queensland Vascular

Plants, Names and Distribution. Brisbane: Queens-

land Department of Environment and Heritage.

SOuTTER, W. (1892). Queensland Acclimatisation Society,

29th Annual Report. Brisbane: Pole, Outridge &

Co.

STAFLEU, F.A. & Cowan, R.S. (1985), Taxonomic Litera-

ture Volume 5, Sal-Ste. Utrecht: Bohn, Scheltema &

Holkema.

STANLEY, T.D, & Ross, E.M. (1983). Flora of South-

eastern Queensland, Volume 17. Brisbane:

Queensland Department of Primary Industries.

ZANDEE, M. & KALKMAN, C. (1981). The genus Rubus

(Rosaceae) in Malesia 1, Subgenera Chamaebatus

and fdaeobatus. Blumea 27, 75-113.

689

eae cee eae ea eens

Behe WMV RVRU ec era ab

Austrobaileya 4(4): 691-694 (1997)

Note

Significant range extensions for 10 species of vascular plants in

northern New South Wales

During an intensive survey of the granitic

outcrop flora of the New England Batholith,

New South Wales (Hunter, unpublished)

between March 1994 and September 1995,

many new distributional records were noted.

Some of these records have been dealt with

previously, for example additional records of

Astrotricha roddii Makinson (Nadolny, Benson

& Hunter 1996) for New South Wales and new

occurrences of Leucopogon cicatricatus

J.Powell and Muehlenbeckia costata

K.L. Wilson & Makinson ms (see Wilson 1990;

Hunter 1995, 1996) in Queensland. Notification

of other records comprising either large

disjunctions over botanical and state divisions,

or those considered important due to the taxa

being restricted 1s warranted. Notes on the

locality and habitat of such species are given

along with estimates of population sizes.

Voucher specimens for all of the species and

localities discussed here are housed at the New

England Herbarium (NE).

In addition to the extensive field survey by

one of us (Hunter), the information presented

here has been substantiated by checking the

relevant holdings at the National Herbarium

of NSW (NSW) and NE. Where relevant,

the extensive records of collections of

Euphorbiaceae in Queensland (Forster &

Henderson 1994) have been checked.

1, Pseudanthus divaricatissiinus Benth.

(Euphorbiaceae)

Distribution and notes: This taxon till now has

been recorded in the rocky sandstone areas of

the higher parts of the Blue Mountains near

Sydney, and locations encompassing the South

Coast, Central Tablelands and the Central

Western Slopes of New South Wales (James &

Harden 1990, Carolin & Tindale 1994).

Accepted for publication - 24 April 1996

In our study, a small population of this

species was discovered on private property

north east of Guyra on the Northern Tablelands

of New South Wales. Individuals were found

growing in heath and mallee between rocks and

boulders on leucoadamellite rock outcrops.

Populations were found on two separate outcrops

on the same property. Less than 50

individuals were thought to be on these outcrops.

Associated species include Eucalyptus

codonocarpa Blakely & McKie, Brachyloma

saxicola J.Y Hunter, Acacta venulosa Benth.,

Kunzea obovata Byrnes, Allocasuarina rigida

(Miq.) L.Johnson subsp, rigida, Leucopogon

neo-anglicus F.Muell. ex Benth. and Mirbelia

confertiflora Pedley. Most granite outcrops

within the region were searched over 10 days,

but no further populations of this species were

found.

New South Wales. NorTHERN TABLELANDS: Wattleridge,

north east of Guyra, 30°02’ S 151°53’ E, Nov. 1994, Hunter

s.n. GNE).

2. Pseudanthus ovalifolius F. Muell.

(Kuphorbiaceae)

Distribution and notes: This species till now

has been recorded mainly in Tasmania and

Victoria.

Early reports included New South Wales

and Queensland (Moore & Betche 1893, Curtis

1967, Willis 1972). However, the records for

Queensland and New South Wales were

unsubstantiated (Stanley 1983, James & Harden

1990), the putative New South Wales record

being from the south coast James, T. 1995,

pers. comm.).

In our study a population of this species

was discovered on the North Western Slopes of

New South Wales. Plants were growing in heath

amongst granite boulders on a small outcrop of

about half a hectare in area. The plants were

restricted to crevices between boulders. The

population size was estimated at less than 30

692

individuals. Associated species include

Prostanthera staurophylla F.Muell.,

Leucopogon neo-anglicus F.Muell. ex Benth.,

Kunzea bracteolata Maiden & E.Betche,

Melichrus erubescens Cunn. ex DC. and Acacia

granitica Maiden. Despite rigorous searching

of nearby outcrops and others within the reserve

over 6 days, no other populations of this species

were found.

New South Wales: NortH WESTERN SLopes: Torrington

Regional Reserve, 29°13’ S 151°41’ E, Sep 1995, Hunter

s.n. (BRI, NE, NSW).

3, Micrantheum ericoides Desf.

(Euphorbiaceae)

Distribution and notes: Tillnow Micrantheum

ericoides was known from rocky areas in the

coastal districts of New South Wales and

Queensland (James & Harden 1990, Forster &

Henderson 1994),

In our study, this species was found on the

North Western Slopes of New South Wales in

heath on rocky outcrops. While the plants were

notcommon, they were found in many scattered

localities.

Associated species include Acacia

granitica Maiden, A. ftorringtonensis Tind.,

Boronia granitica F.Muell., Prostanthera

staurophylla F.Muell., Kunzea bracteolata

Maiden & E.Betche and Leucopogon neo-

anglicus F.Muell. ex Benth.

New South Wales: NorTH WESTERN SLOPES: Torrington

Regional Reserve, 29°13’ S [51°41 E, Sep 1995, Hunter

s.n. (BRI, NE, NSW),

4. Monotaxus macrophylla Benth.

(Euphorbiaceae)

Distribution and notes: Monotaxus

macrophylla is an Endangered Species under

Schedule | of the Threatened Species

Conservation Act (New South Wales

Government 1995). Till now it has been recorded

as a species of rocky areas of the North Western

Slopes and Plains of New South Wales, at a

locality in the South Coast of New South Wales,

and more commonly in south east and central

Queensland (James & Harden 1990, Forster &

Henderson 1994),

Austrobaileya 4(4); 691-694 (1997)

In our study, very large numbers of this

species were found on the Northern Tablelands

of New South Wales. Many hundreds of plants

were observed growing with Muehlenbeckia

costata on recently burnt leucoadamellite

rock outcrops throughout State Forest and Flora

Reserves. No germination of Monotaxus

macrophyllaseed was noted on adjacent unburnt

areas of the same outcrops. This suggests that

Monotaxus macrophylla, like the associated

Muehlenbeckia costata (Hunter, unpublished),

is a fire follower.

New South Wales: NoRTHERN TABLELANDS: Warra State

Forest, Crown Mt Flora Reserve, 30°00’ S [51°54’ E, Feb

1995, Hunter s.n. (BRI, NE, NSW).

5, Gompholobtum sp. B (Fabaceae) (James

& Harden 1990)

Distribution and notes: Gompholobium sp. B

is an undescribed taxon till now recorded as

occutring in rocky areas south of the Blue

Mountains in New South Wales and also in

Victoria (Wiecek 1991).

In our study, a small number of plants of

this taxon was found on the North Coast of

New South Wales (Sheringham & Westaway

1995 p.112: ‘Mann River Nature Reserve’,

which should read ‘Gibraltar Range National

Park’). These plants were growing in dry

sclerophyll forest on granitic soil. Subsequently,

plants were found in wet heath near the same

locality (Williams, P. 1995, pers. comm.).

Despite further survey work in the Gibraltar

Range National Park over 6 days, no further

populations of it were found.

New South Wales: Nortu Coast: Tin Ore Creek, Gibraltar

Range National Park, 29°31’ S 152°18’ E, Aug 1994,

Hunter s.n. (NEB)

6. Rapanea howittiana Mez (Myrsinaceae)

Distribution and notes: Rapanea howittiana

till now is recorded as common in coastal and

nearby hinterland areas of south eastern New

South Wales and Victoria. While the species

was known to extend to the North Coast of New

South Wales and south-eastern Queensland

south of Noosa Heads, it was thought to be

uncommon there (Harden 1990).

Hunter & Bruhl, Range extensions for species in northern New South Wales 693

In our study, this species was found on the

Northern Tablelands of New South Wales. A

stand of 10 plants was found growing amongst

large boulders on a leucoadamellite outcrop.

Associated plants include Quintinia sieberi

A. DC. and Notelaea sp. A (see Harden 1992),

New South Wales: NORTHERN TABLELANDS: flank of Crown

Mountain, Crown Mountain Flora Reserve, Warra State

Forest, north east of Guyra, 29°59’ § 151°5SS’ E, Mar 1994,

Hunter 1823 (NE).

7. Eucalyptus exserta F, Muell. (Myrtaceae)

Distribution and notes: This species is

common in Queensland but has been recorded

only in the far north of the North Western Slopes

and Plains of New South Wales above Ashford

(Hill 1991),

In our study, a small stand of this species

was found in the central portion of the

North Western Slopes of New South Wales.

This presents a significant southern extension

of range (Hill, K 1996 pers. comm.). No other

stands of this species were seen during

subsequent survey work over 8 days in the

vicinity.

New South Wales: NortH WeEsTERN SLopes: ‘Clayton

Chase’, north west of Glen Innes, 29°27’S 151°20’E,

[4 Jun 1995, Hunter s.n, (NE)

8. Homoranthus prolixus Craven &

S.R.Jones (Myrtaceae)

Distribution and notes: Till now, Homoranthus

prolixus has been recorded as restricted to the

Howell district of the North Western Slopes of

New South Wales (Harden 1993).

During our study, this species was found

on two adamellite rock outcrops on the Northern

Tablelands of New South Wales. Each of these

outcrops was on adjacent private

properties. While both properties are grazed,

the populations of this species there were

untouched and considered healthy.

Approximately 300 plants were estimated to be

on these outcrops. Despite four further days

surveying the range, no further populations

were detected. However, many other outcrops

were not surveyed and further localities of

occurrence of this species may be found.

Associated species include Acacia nertifolia

Cunn. ex Benth., A. granitica Maiden, Olearia

elliptica DC., Cryptandra amara Smith and

Callitris endlicheri (Parl.) Bailey.

New South Wales; NorTHERN TABLELANDS: ‘Longford

Station’, north east of Bendemeer, 30°45’S 151°08’E, Jul

1995, Hunter s.n, (NE, NSW),

9, Boronia granitica Maiden & E. Betche

(Rutaceae)

Distribution and notes: Vill now, Boronia

granitica has been recorded as a species with a

ROTAP code (Briggs & Leigh 1988) of 3VC,

which occurs commonly among granite

boulders along the North Western Slopes north

from Howell in New South Wales, and in the

Stanthorpe area of Queensland (Quinn et al.

1995).

In our study, three specimens of

B. granitica were found on a leucoadamellite

outcrop in the Northern Tablelands of New

South Wales. These plants were growing in

heath amongst boulders.

Two of the plants had been eaten by goats,

while the third was protected from grazing by

the rocks and was uneaten. Two further days

were spent surveying the area, but no more

plants of this species were found.

New South Wales: NorTHERN TABLELANDS : ‘Brookvale’,

Parlour Mountains, north west of Armidale, 30°17’S

151°26’E, Mar 1995, Hunter s.n. (NE)

10. Zieria sp. P (Rutaceae) (Armstrong 1991)

Distribution and notes: Till now Zieria sp. P

has been known from rocky outcrops in the

Warrumbungle and Nandewar Ranges and at

Howell on the western edge of the Northern

Tablelands and in the North Western Slopes of

New South Wales (Armstrong 1991),

In our study, this species was found on

private property on the Northern Tablelands of

New South Wales and on the North Western

Slopes of New South Wales. At all these

localities, low numbers of the plants were

seen scattered on porphyritic rock outcrops.

New South Wales: NorTHERN TABLELANDS: ‘Brookvale’,

Parlour Mountains, north west of Armidaie, Mar 1995

Hunter s.n. (NE): NorTH WESTERN SLOPES: “The Willows’,

north west of Glen Innes, 29°27’ S 151°27’ E, Apr 1995

Hunter s.n, (NE); ‘Rocky Glen’, north west of Glen Innes,

29°31 S 151°26’ E, 4 Apr 1995 Hunter s.n. (NE).

694

Acknowledgments

The directors of the New South Wales (NSW

NPWS) and Queensland National Parks and

Wildlife Services are thanked for permission to

collect in service areas. The staff of the Glenn

Innes District Office of the NSW NPWS and

Girraween National Park (Queensland) are

thanked for their assistance to J.T.Hunter.

Thanks are also due to the Torrington Regional

Trust for allowing research to be carried out

inthe Torrington Regional Reserve. The

owners of many private properties are thanked

for allowing access to their respective lands.

John Hunter acknowledges the receipt of an

Australian Postgraduate Award.

References

ARMSTRONG, J.A. (1991) Zieria. Pp. 236-246 in G.J. Harden

(ed.), Flora of New South Wales. vol 2. Sydney:

New South Wales University Press.

Briccs & LeicH (1988) Rare or Threatened Australian

Plants. Special Publication No. 14. Canberra:

Australian National Parks and Wildlife Service.

CAROLIN, R.C, & TINDALE, M. (1994) Flora of the Sydney

Region. Sydney: Reed.

Curtis, W.M. (1967) Students Flora of Tasmania, Part 3.

Hobart: Government Printer.

Forster, P.I. & HENDERSON, R.J.F. (1994) Euphorbiaceae,

In R.J.F. Henderson (ed.) Queensland Vascular

Plants: Names and. Distribution. Brisbane:

Queensland Department of Environment & Heritage.

Harden, G.J. (1990) Myrsinaceae. Pp. 501-504 in G.J.

Harden (ed), Flora of New South Wales, vol. t.

Sydney: New South Wales University Press.

—— (1990-1993) Flora of New South Wales, vol. 1+.

Sydney: New South Wales University Press.

Hit, K.D. (1991) Eucalyptus. Pp.76—142 in G.J. Harden,

(ed), Flora of New South Wales, vol. 2, Sydney:

New South Wales University Press.

John TI. Hunter and Jeremy J. Bruhl

Austrobaileya 4(4); 691-694 (1997)

Hunter, J.T. (1995) Some observations on the fire responses

of two rare species in the Girraween and Bald Rock

National Parks. Queensland Naturalist. 33:

146-147.

— (i996) A further record of Leucopogon cicatricatus J.

Powell (Epacridaceae) for Queensland. Queensland

Naturalist. 34: 20-21.

JAMES, T. & Harpben, G.J. (1990) Euphorbiaceae. Pp.

389-430 in G.J. Harden, (ed.), Flora of New South

Wales. vol. |. Sydney: New South Wales University

Press.

Moors, C, & Betcue, E. (1893) Handbook of the Flora of

New South Wales, Sydney: Government Printer.

NADOLNY, C, BENSON, J. & Hunter, J.T. (1996) Astrotricha

roddii Recovery Plan. Sydney: New South Wales

National Parks & Wildlife Service.

Quinn, F.C., WILLIAMS, J.B., Gross, C.L. & Brunt, J.J.

(1995) Report on Rare and Threatened Plants of

North-eastern New South Wales. Report prepared

for New South Wales National Parks and Wildlife

Service and Australian Nature Conservation Agency.

292 p.

SHERINGHAM, P, & WEsSTAWAY, J. (1995) Significant Vascular

Plants of Upper North East New South Wales, A

Report by the New South Wales National Parks and

Wildlife Service for the Nation Resources Audit

Council, 147 p. )

STANLEY, 1.D. (1983) Euphorbiaceae. Pp, 406-439 in T.D.

Stanley & E.M. Ross, Flora of South Eastern

Queensland, Brisbane: Queensland Department of

Primary Industries,

Wiecex, G. (1991) Gompholobium. Pp. 468-470 in G.J.

Harden (ed), Flora of New South Wales. vol, 2.

Sydney: New South Wales University Press.

Wiius, J.H. (1972) A Handbook of Plants in Victoria, vol.

2. Melbourne: Melbourne University Press.

Witson, K.L. (1990) Polygonaceae. Pp. 278-293 in GJ.

Harden (ed), Flora of New South Wales. vol. 1.

Sydney: New South Wales University Press.

Department of Botany, University of New England, Armidale, NSW 2351, Australia

Austrobaileya 4(4): 695-696 (1997)

Book Review

M.LH.Brooker and D.A.Kleinig (1994). Field

Guide to Eucalypts: Volume 3, Northern

Australia, Pp. 383. Inkata Press, Sydney.

Price. c. $145. ISBN 0 909605 67 X.

The correct identification of eucalypts in northern

Australia has been wrought with difficulties in

recent years. A considerable number of new

eucalypt taxa have been named since the ‘Flora of

Australia’ account (Chippendale 1988) and while

many of the new names apply to well circumscribed

and recognisable taxa, some are dubious to say the

least. To the non-eucalypt specialist the situation

with identifications had become almost

unmanageable with an unknown number of

unnamed taxa and no clear definitions of existing

entities.

Hence the arrival of the long-awaited third

volume of the Brooker and Kleinig fieldguide

trilogy on eucalypts could be greeted with

considerable anticipation. The third and final

volume in the set deals with “Northern Australia’

which is all of Queensland (some slight overlap

with Vol. 1), the Northern Territory, and Western

Australia south to latitude 26°. Ideally this volume

should have the following attributes to enable the

user to achieve their identification and information

objectives.

(1) enable identification of material (fertile) of

known origin

(2) indicate relationships amongst the taxa

(3) indicate patterns of variation within and

between taxa

(4) illustrate the taxa

(5) provide essential synonymy and

misapplications of names

(6) provide information on distribution

(7) provide information on habitat preferences

The first part of the book (pp. 1-20) deals

with a short introduction to eucalypt history,

morphology, hybrids and variation. The various

sections on morphology are well illustrated with

both colour photographs and line drawings. The

novice should gain a good working knowledge of

what a eucalypt can possibly look like from these

sections.

The second part of the book (pp. 21-45)

provides keys to the taxa covered in the book. The

authors have sensibly split these into nineregional

groupings (a point that should be noted by

publishers of major floras), ‘These keys are

relatively unambiguous and the five for Queensland

work most of the time if used in conjunction with

the digests and illustrations later in the book.

Some groups of taxa, e.g. stringybarks in the

Eucalyptus youmanti Blakely & McKie, E.

caliginosa Blakely & McKieand E£. williamsianus

L.A.S.Johnson & K.D.Hill complex and most of

the red bloodwoods, are difficult to key (even if

out in the field with complete material). The

treatment of the red bloodwoods appears

incomplete, as many of the new taxa recently

recognised by Hill & Johnson (1995) are not

included. In some other groups that have been

recently revised (e.g. yellow bloodwoods and

someironbark groups) there are few orno problems

in key use.

The third and major part of the book

(pp. 47-370) comprises digests and plates of

species, In this part the individual taxa are arranged

within the Pryor and Johnson classification and

closely related taxa tend to be located sequentially.

For each taxon the following are provided —

botanical name and author, common name(s)

(where known), adescription, distribution (written

and map), some limited information on synonymy

and past misapplications, and between three and

six colour photographs that illustrate habit, leaf

venation, bark, buds, flowers, fruit.

The descriptions are variable in their content

and length. Some taxa are compared to closely

related taxa(e.g. E. williamsianato E. youmanii),

whereas it may have been better to have had a full

description as well. Mostly they are easy to

follow, particularly ifthe useris thoroughly familiar

with the earlier section on eucalypt morphology.

The written distribution information and maps

appear current and arerelatively detailed, although

other workers in eucalypt systematics would

strongly disagree with this (Hill & Johnson 1995:

495-499),

696

The information on synonymy is a little

scant. Given all of the name changes and

misapplications of recent times a little more detail

would have been helpful. Some recently named

taxa (e.g. E. subtilior L.Johnson & K.D.Hill) are

placed in synonymy of others, but without any

explanation whatsoever. Other “well known’ taxa

such as £. drepanophylla F.Muell. ex Benth. are

subsumed, but there is no explanation for this. In

some cases an explanation may be complicated,

but this could be achieved in an appendix similar

to that for the new taxa named in the volume,

Some essential synonymy is omitted, e.g. E.

codonocarpa Blakely & McKie has been widely

known as £. approximans subsp. codonocarpa

(Blakely & McKie) L.A.S.Johnson & Blaxell

(Henderson 1994), yetnowherein this book (either

in the index or in the account of E. codonocarpa)

can mention of E. approximans be found. Some

names don’t make it at all, notably &. kabiana

L.A.S.Johnson & K.D.Hill, although the taxon is

recognised and included as Eucalyptus sp. TT.

Author citation is woefully non-standard, e.g.

‘Carr & Carr’ instead of ‘D.J.Carr &

S.G.M.Carr’, and ‘L.Johnson & K.Hill’ instead

of “L.A.S.Johnson & K.D.HiIl’.

The photographs are generally excellent

but it would have been useful to have more of

seedling foliage. There is no information on

localities (or vouchers!) for the various photos.

Hence it is not determinable whether all of the

photos relate to material from a single locality or

whether they comprise an amalgam of collections.

Some photographs show extremes of variations

(e.g. the buds of BE. rhodops D.J.Carr &S.G.M.Carr

are more commonly conical rather than beaked).

The various unnamed taxa would be better

indicated using a locality and voucher (cf.

Henderson 1994) thus enabling the user to

corroborate their specimens with those of

established identity.

No information in the species digests is

provided on variation within species, hybridisation

with other species or habitat preferences. Despite

the relatively narrow circumscription of many

Paul I. Forster

Austrobaileya 4(4): 695-696 (1997)

eucalypt taxa there 1s still considerable

morphological variation in some species.

Conversely some species (e.g. E. crebra F.Muell.)

comprise complexes (but how many users would

know this?) and the material illustrated shows a

minorcomponent of the known variation. Acursory

examination of the eucalypt literature indicates

that there are hybrids, introgression and clines

common within the group. An indication of the

taxa in which this occurs would be helpful and in

this respect the book conveys the incorrect

impression that the taxa covered are all clear-cut

and unambiguous. Any field botanist will soon

tell you that this is far from the actual situation.

Strangely enough there is no information on habitat

preferences, and only a limited amount of datacan

be gleaned from the single habitat photograph for

each species. Many eucalypts may be closely

allopatric but separated by particular ecological

preferences such as moisture and substrate. It

would be useful to have some general information

on this.

In summation this book delivers well on

attributes 1,2, 4 and 6, but fails on attributes 3,5

and 7. Despite these failings the book is most

useful, well presented, easy to read and is visually

attractive. The great number of colour photographs

make it value for money, although its size limits

use to other than laboratory or vehicle based

exercises.

It is recommended and essential to anyone

that needs to identify eucalypts in northern

Australia. A revised edition that incorporates all

of the subsequent changes and corrections will be

even more so.

References

CHIPPENDALE, G.M. (1988). Flora of Australia Vol. 19.

(Exec, Ed. A.S.George.) Canberra: Australian

Government Publishing Service.

HENDERSON, R.J.F. (ed.) (1994). Queensland Vascular Plants:

Names and Distribution. Brisbane: Queensland

Department of Environment & Heritage.

Hitt, K.D. &Jounson, L.A.S. (1995). Systematic studies in

the eucalypts. 7. Arevision of the bloodwoods, genus

Corymbia (Myrtaceae). Telopea 6: 173-505.

Queensland Herbarium, Meiers Road, Indooroopilly Queensland 4068, Australia

ore ene ae mee RTT UE Per era eT EEE EOE EOS Perera

Referees consulted for Volume 4

Acceptance of papers has depended on the outcome of review by external referees.

Apart from afew who did not wish to be listed, those consulted during the past four

years are named below. Several were consulted on more than one occasion. Sincere

thanks are extended to all these people whose expertise has helped to maintain journal

standards.

Bean, A.R. Jackes, B.R.

Benson, J.S. Jacobs, S.W.L.

Bruhl, J.J. Jessup, L.W.

Bruyns, P.V. Jones, D.L.

Clifford, H.T. Makinson, R.O.

Conn, BJ, McIntyre, L.

Conran, J.G.

Coode, M.J.E. Paton, A.

Cowle, I. Pedley, L..

Craven L.A. Puttock, C.F.

Cribb, P.J.

Crisp, M.D. Renvoise, S.A.

Reynolds, S.T.

Dawson, J.W. Ross, E.M.

Dunlop, C.R. Rye, B.L.

Foreman, D.B. Short, P.S.

Forster, P.I. Siepen, G.

Simon, B.K.

George, A.S. Sturm, R.A.

Goyder, D.J.

Telford, LR.

Halford, D.A. :

Harden G.J. Walsh, N.G.

Henderson, R.J.F. Webster, G.L.

Hill, K.D. Welzen, P.C. van

Hyland, B.P.M. Wheeler, J.R.

Wilson, K.L.

697

Notes for Authors

Austrobaileya publishes the results of original research and informed discussion on a variety of

aspects of plant systematics, such as taxonomy, phytogeography, evolution, numerical taxonomy,

cytology. Manuscripts reporting research on plants from Queensland, tropical Australia or nearby

areas Will be given preference.

Submission of a manuscript is taken to mean that the results reported have not been published and

are not being considered for publication elsewhere. The Editorial Committee assumes that all

authors of a multi-authored paper agree to its submission.

It 1s editorial policy to give preference to publication of revisions of entire genera or sizable groups

of related species. However, species described in isolation will be considered if such a course of

action can be Justified (e.g. the need for names to be used in other publications, vegetation maps,

applied research etc.) and if they are satisfactorily set in context with related, previously described

species, either by means of a comparative table, a detailed discussion or a Key to related species.

Manuscripts must be submitted in duplicate to The Editor, Austrobaileya Queensland Herbarium,

Department of Environment, Meiers Road, Indooroopilly, Qld 4068, AUSTRALIA. They must be

double-spaced typewritten, with 2.5 cm margins in the first instance, After refereeing, the final

manuscript may alternatively be submitted on an MSDOS disk as an unformatted ASCH file, Word

2, Word 6, WordPerfect to version 5.1, accompanied by a printed copy. For style and layout the most

recent number of Austrobaileya should be followed.

Title

The title should be concise and appropriately informative and should contain all key words to

facilitate retrieval by modern searching techniques. An abridged title suitable for use as a running

head and not exceeding 30-40 letter spaces should also be supplied.

The title and author should be set out as shown:

The genus Ancana F.Muell. (Annonaceae) in Australia

L.W.Jessup Queensland Herbarium, Meiers Road, Indooroopilly, Queensland 4068, Australia

with a running head: Jessup, Ancana

or:

Secamone R.Br. (Asclepiadaceae: Secamonoideae)

Summary

Keywords:

Paull. Forster, Queensland Herbarium, Meiers Road, Indooroopilly, Queensland 4066, Australia

_K. Harold, 6 Woodland Rise Wakefeld, WF2 ODL, England

with a running head: Bocas & Harold, Secamone elliptica

Note that the author’s address has sufficient detail for the author to be contacted by readers who wish

to obtain reprints or further information. Normally the author’s initials and surname are given;

however, the manner in which the author’s name is cited is the author’s prerogative.

Pe ee ee ee ae ont hoa

Headings

Manuscripts are usually divided into the following major sections.

Summary (= Abstract), Introduction, Taxonomy, Acknowledgements, References.

Sections on Materials and Methods, Results, Discussion and Conclusions may be more appropriate

in some cases,

Subheadings

The order of subheadings in the Taxonomy section is normally: Description, Specimens examined,

Distribution and habitat, Phenology, Affinities/Relationships/Distinguishing features, Conserva-

tion status, Vernacular name/ethnobotanical studies/uses, Etymology, General notes/typification.

Authors are encouraged to discuss newly described taxa under these headings, though it is not

necessary to use them all. If the author wishes to discuss additional aspects of taxa, extra categories

may be necessary.

Square brackets [ ] are used in the synonymy only for misapplied names. References should not

separate the name and publication data from the type citation of that name but should be appended

in a separate paragraph: | |

A standard and consistent order should be used to describe species to ensure that species can be

compared and that distinguishing features are contained in every description.

In the descriptions and discussion metric units arerequired. Measurements of structures such as large

leaves can be given in centimetres rather than millimetres and distances in miles etc. on the labels

should have a kilometre equivalent inserted in square brackets [ ] in distributional discussions.

Reference to Figures (illustrations) should be given at the end of the En slish description. Reference

to distribution maps should be included in the “Distribution and habitat’ section. |

Keys should be of the bracketed type, not the indented type:

I. Flowers solitary ........ Led Binley & td (a w0et Te xy oa te We Pe eee AAAS Pe We hel I sh ate Sed

PIOWEES ZS VeraPaIn ASTRO 5: det g hebarctnn b atusnoes notte ta Be we sabe tees mete aysiieteaa Kee face a

2. Leaflets linear, 0.5-l mm wide .......... 00. ce eee ete eens ll. Z. ramosa

Leaflets ovate, 3-5 mm Wide....... ccc cee ee ee ete ee eee eens 12. Z. pedunculata

New Taxa

Newly described taxa must be set in context with existing related species as outlined above. All

requirements of the current International Code of Botanical Nomenclature (CBN) should be met.

A Latin diagnosis and detailed English description is preferable to a detailed Latin description.

Though the ICBN recommends a full Latin description in addition to a diagnosis this 1s not essential.

W.T. Stearn’s ‘Botanical Latin’ is considered the standard Latin text and examples of diagnoses are

contained in that book. Botanical Latin 1s a specialist subject and it is strongly recommended that

all diagnoses are either written or checked by a specialist BEFORE the manuscript is submitted for

publication.

The type citation should be given in detailed form with the diagnosis so that there is sufficient label

information to be able to unmistakably identify the specimen. However, if desired an abbreviated

form can also be listed in the “Specimens examined’ section to place it in context in the distributional

range of the taxon.

Typus: Queensland. Coox District: Henrietta Creek, Palmerston Highway, 173°6'S, 145°46'E, 15

November 1982, Jessup 512 (holo: BRI; iso: BRL.CBG,K,L,MEL,NSW,QRS,U).

or: Typus: Northern Territory. Katherine Gorge above Edith Falls 14°11’ S, 132°14’ E, 25 February

1982, S. King 59 (holo: DNA).

Synonyms are usually given in chronological order, for example:

Finlaysonia obovata Wallich, Pl. asiat. rar. 2: 48, t. 162 (1831).

Tabernaemontana cirrhosa Blanco, FI. Filip. 115 (1837). Type: not designated.

Finlaysonia maritima auct. non Backer ex K. Heyne: Heyne, Nutt. pl. Ned.-Ind. ed. 2, 2: 1293

(1927). ]

All homotypic synonyms should be grouped together in separate run-on paragraphs:

A maximum of 20 specimens is permitted in the “Specimens examined’ section. If more have been

examined a selection of specimens should be given or an index to collectors should be included as

an appendix. Specimens cited should be chosen to represent the geographical and morphological

variation of the taxon; these preferably should be widely distributed collections, 1.e. those with

duplicates in several herbaria. |

The specimen citation should be exactly as it 1s written on the label, with the exception of the

following abbreviations. The date is abbreviated to the first three letters of the month and the year

in full. The collector’s name 1s abbreviated to surname only and collecting number. Where there are

more than two collectors the surname of the first is given followed by et al. If the specimen is held

at the Queensland Herbarium (BRI), an AQ number should be quoted if there is no collecting number.

In previous. volumes of Austrobaileya specimens were cited in a geographical order from West to

East and North to South. With the widespread use of specimen databases it is now often more

convenient and acceptable to cite specimens alphabetically by collector within each region or

district. Pastoral Districts are used for grouping Queensland specimens, and where other states have

similar District divisions the use of these units is encouraged. Acronyms for herbaria are to be listed

in alphabetical order.

Acknowledgements

Acknowledgements should be kept brief.

References

Citation of references in the text and in the ‘References’ section are as per the examples quoted. Note

that names of journals and other publications are given in full in the ‘References’ but are abbreviated

in the nomenclatural sections of a taxonomic paper (as shown in the example headed ‘Secamone’

in the section on New Taxa). Titles of journals cited in nomenclatural parts of the text should be

abbreviated according to Botanico-Periodicum-Huntianum (Hunt botanical Library, 1986) while

names of books should be abbreviated 1n accordance with F.A.Stafleu and R.S. Cowan Taxonomic

Literature, edn 2 (W. Junk, 1976-1988).

Text reference examples:

‘The degree and shape of lobing is variable and has been discussed at length by a number of authors

(Leach 1985; Bruyns 1986, 1987), and Field and Collenette (1984) have expressed similar views to

Dyer (1983). The species is a popular subject for experimental studies in embryology (Devi &

Lakshminarayana 1977), chemistry (Trevedi et al. 1988), and floral anatomy (Rao & Ganguli 1963;

Puri & Shiam 1966; Tsiang 1939, p. 47)

Sh kia dee seeeet oy elitediu dade eee ek a ‘ we LE tee tte eeee eee eee et Ot Dn tone

SAYS b he uni a7 elearning entaay

‘References’ examples:

BoyLAND, D.E. & STANLEY, T.D. (1981). Umbelliferae. In J. Jessup (ed.), Flora of Central Australia,

pp. 266-271. Sydney: A.H. & A.W. Reed Pty. Ltd.

Brown, R. (1811). On the Asclepiadeae, a natural order of plants separated from the Apocineae of

Jussieu. Memoirs of the Wernerian Natural History Society. 1: 12-78.

De WEr, J.M.J. (1978). Hybridization and Polyploidy in the Poaceae, pp. 188-194. In T.R.

Soderstrom, K.W. Hilu, C.S. Campbell and M.E. Barkworth (eds), Grass Systematics and

Evolution. Washington D.C. and London: Smithsonian Institution Press.

Forster, P.]. & THONGPUKDEE, A. (1988). Studies on the Australasian Asclepiadaceae, Ill. A new

species of Cynanchum L, and a new name in Marsdenia R. Br. Austrobaileya 2: 451 -457.

PuHiLups, E.P. (1951). The Genera of South African Flowering Plants. 2nd Edition. Cape Town:

Government Printer.

WILLIAMS, J.B. (1984). Asclepiadaceae. In N.C.W.Beadle, Student’s Flora of North eastern New

South Wales. Part V: 719-736. Armidale: University of New England.

Consideration should be given to the inclusion of an index to taxa in large revisions.

Tables should be set out in columns using tabs. Each should have a title, and horizontal lines should

be used to separate headings from the body of the table. .

Table 2. Comparison of E. decolor, E. paniculata and E. melanoleuca

Character E. decolor E paniculata _E. wielonalenen :

Extent of small branches rough-barked small branches

rough bark smooth throughout smooth

Seedling leaves 92x18cm 8.0 x 5.0 cm 5.0 x 1.0 cm

Adult leaves discolorous discolorous concolorous

lustrations, photographs and maps to be used in the text should be of the best possible quality.

Where possible illustrations should be submitted in a size suitable for reproduction without

reduction in size. The maximum size of a printed illustration is 18 cm x 13.5 cm. Illustrations should

be submitted in black ink on drafting film or a high quality copy. Do not put lettering on the

illustration but indicate separately on a photocopy or overlay. Photographs must display good

definition and contrast, and a good range of tones. Maps should be informative and reflect

accurately the known distribution of taxa. |

Remember that illustrations are not improved by the printing process but rather are downgraded in

quality.

Captions for illustrations should be concise but informative. Voucher specimens from which the

illustration was prepared must be cited at the end of the caption.

Fig. 1. Ancana stenopetala: A. branchlet with mature flower x 1. B. detail of flower with 1 outer

and 1 inner petal removed x 3. C. inner surface of inner petal x 3. D. open flower x 1. E. mature

monocarps x 1. A-C, Jessup 837; D,E, Jessup 838. |

Fig. 1. Kailarsenia jardinet: A. flowering branchlet x 0.67. B. mature fruit x 1. C. T.S. of mature

fruit x 1. D. style x 3. E. anther, 2 views x 3. F. T.S. of polleniferous anther x 6. G. seed, 2 views

x 3. H. sttpule crowning branch tip x 5. I. embryo x 10. K. ochreata. J. flowering branchlets x 0.67.

K. style x 3. L. anther, 2 views x 3. M. T.S. of pollentferous anther x 6. N. T.S. of mature fruit x 1.

O. Mature fruit x 1. P. seed, 2 views x 3. Q. stipule crowning branch tip x 5.R. embryo x 10. A, Puttock

UNSW 14260; D-F, Puttock UNS W 15822; B,C,G,I, Puttock UNSW 15809; H, Puttock UNSW 14494:

J, Wyatt s.n.j5 K-M, Clarkson 5032: N.O.P R, Puttock UNSW13326 & Wilson; Q Puttock

UNSW 15833.

In addition to being supplied as a separately typed list with the manuscript, a copy of the caption

should be adhered to the back of the original illustration/photograph/graph etc., unless the

illustration is supplied on drafting film. Do NOT write directly on illustrations but place any

instructions on an overlay.

All illustrations should be cited in the text. Published illustrations remain the property of the

Queensland Herbarium.

Proofs

Page proofs will be sent to the principal author. Alterations must be marked using the standard

editorial marks supplied with the proofs, and returned promptly.

Offprints

Twenty (20) offprints are supplied free of charge to the principal author of each paper.

Standard Abbreviations

Standard abbreviations for journals and books are dealt with in the section on ‘References’. All

entries in the ‘References’ section should be referred to in the text and all references to papers and

books in narrative text should be referred to in the ‘References’ section. .

Author abbreviations should follow the Authors of Plant Names edited by R.K.Brummitt and

C.E.Powell at the Royal Botanic Gardens, Kew (1992). Acronyms used for herbaria cited in the text

should be in accordance with P.K.Holmgren, N.H.Holgren and L.C.Barnett (1990), Index

Herbariorum Pt 1, edn 8, Regnum Vegetabile v. 120.

INDEX

New names are in bold, all others are in italics. Page numbers in bold refer to the principal

description, those in italics refer to an illustration.

ABLETT, Effie M., PLAYFORD, Julia & Mitts, Stephanie. The indica

use of rubisco DNA sequences to examine the systematic var. australis F.M.Bailey 209, 212, 217

Bijshobdepcepereee sections eee ee te pF OEE vis AR ANS AAR Tae Chace dae babactele nba ebedebed loeb yet ta Giagh Me tig tage a

position of Hernandia albiflora (C.R.White) Kubitzi

(Hernandiaceae), and relationships among the Laurales

601

Acacia Miller 467, 537, 600

Acacia aneura F.Muell, ex Benth. 475

var, aneura 135, 136, 475

var. ayersiana (Maconochie) Pedley 136

var. macrocarpa Randell 136

var. latifolia ].M.Black 136

var. conifera Randell 135, 136

ayersiana Maconochie 136

bancroftit Maiden 191

brachystachya Benth. 136

calamifolia Lindl. 135

cambagei R.T.Baker 135

caroleae Pedley 463

catenulata C.T. White 462, 464, 639.

cibaria F.Muell. 135, 136

conferta Benth. 277

crassicarpa A,Cunn. ex Benth, 122

cupularis Domin 135

cyclops A.Cunn, ex G.Don 135, 136

dodonaeifolia (Pers.) Balb. 135

fimbriata A-Cunn. ex G.Don 272

georginae F.M.Bailey 135

granitica Maiden 692, 693

humifusa A.Cunn. ex Benth. 166

imbricata F.Muell. 135

julifera Benth.

subsp. julifera 460, 466

subsp. curvinervia (Maiden) Pedley 462

ligulata Benth. 135

lineata A.Cunn. ex G.Don 272

mearnsit E.Wilde 135

merrallit P.Muell, 135

microcarpa F.Muell, 135

minyura Randell 135

multisiligua (Benth.) Maconochte 473

neritfolia Cann. ex Benth, 693

~ platycarpa F.Muell. 122

rhodoxyion Maiden 206

saligna (Labill.) H.L.Wendl. 135

shirleyi Maiden 462, 464, 473, 535, 642

solandri Benth. 168

stowardii Maiden 135

torringtonensis Tind. 692

torulosa F.Muell. 122

triptera Benth. 471

triguetra Benth, 135

venulosa Benth. 69]

spp. 123

Acalypha L, 209, 210, 217

australis L, 209, 210, 211, 212, 213, 219

capillipes Muell.Arg. 209, 211, 212, 213, 214, 275,

216, 217

compacta C.T, White 224

cunninghamii Muell. Arg, 209, 219, 222

eremorum Muell,Arg, 209, 214, 214, 2/5, 216, 217,

223

var, capillipes Baill. 212

var, sessilis Baill. 214

lanceolata Willd, 209, 210, 212, 213, 217, 219, 220

lyonsii P.[.Forst. 141, 209, 211, 213, 216, 217, 2/8

nemorum F,Muell, ex Muell.Are. 209, 211, 219, 220,

221, 223

pubiflora Baill, 211, 222

subsp. australica Radel. -Sm, 209, 222, 223, 225

spinescens Benth, 214

wilkesiana Muell.Arg. 209, 211, 223. 224, 225

Acalypheae Dumort 209

Acalyphinae Griseb, 209

Acanthaceae 3

Acomis F.Muell. 609

acoma (F.Muell.)} Druce 609, 610

bella A.E.Holland 609, 610, 67/

kakadu Paul G.Wilson 609, 610

lesteri Burkhill 609, 612

macra F.Muell, 609, 610, 612

Actinokentia Dammer 228

Alchornea Sw. 139, 140

Alchorneinae Hurus. 139

Alchornieae (Hurus.) Hutch, 139

Aleurites sp. (Hazlewood Gorge, $.G.Pearson SP439) 381

Alexfloydia B.K.Simon 369, 370. 372, 374

Alismatiflorae 2, 4

Allamanda 18

Allocasuarina

inophlota (F.Muell. & F.M.Bailey) L.A.S. Johnson

275,277

rigida (Mig.) L.Johnson .

subsp. rigida 691

torulosa (Aiton) L.A.S.Johnson 175

Allosyncarpia 561

Alstonia 18

Althoffia 79

pletostigma (F.Mueli. )B Bueret St

sp, 251

Alyxia 18, 19

orophila Domin 251

spicata R.Br, 122

Amaranthaceae 3

Amborellaceae 603

Amborella 601, 604, 605, 606

trichopoda Baill. 602, 603

Andropogoneae 105

Angophora

leiocarpa (L.A.S.Johnson ex G.J.Leach) K.R.Thiele &

Ladiges 277, 360

woodsiana F.M.Batley 189

Anthericaceae 597

Anthosteminae (Baill.) Webster 417

Antrophyum

calliffolium Blume 449

plantagineum (Cav.) Kaulf. 449

Apiaceae 3, 155

Apocynaceae 3, 13, 14, 109, 110, 251

Araliaceae 407

Araliifiorae 2, 3,4

Araucaria 70

Archontophoenicinae 228

Archontophoenix H.Wendl, & Drude 227, 229

alexandrae (P.Muell.) H.Wendl. & Drude 227, 228,

229, 230, 231, 233, 235, 237, 238, 242

var. beatriceae (F.Muell.) C.T. White 227, 232, 233

var, schizanthera H.Wendl. & Drude 227, 231, 233

beatriceae (F.Muell.) F.M.Baitley 227, 232

cunninghamiana (H. Wendl.) H.Wendl. 227, 228, 230,

231, 233, 235, 238, 239, 242

elegans H.Wendl. & Drude ex Rock 242

jardinei F.M.Bailey 227, 242

maxima Dowe 227, 228, 230, 231, 235, 236, 24/

myolensis Dowe 227, 228, 229, 230, 231, 237, 238,

241

purpurea Hodel & Dowe 227, 228, 230, 231, 238,

239, 241, 242

subtribe Archontophoenicinae 228

tuckeri Dowe 227, 228, 230, 231, 240, 247, 242

veitchii H.Wendi. & Drude 232, 233

sp. (Myola ].Dowe 106) 227

sp. (Mt Lewis V.K.Moriarty 833) 227

sp. (Rocky River J.Dowe 108) 227

Arecaceae 227

Areciflorae 1, 2,3, 4,6

Argopliyllum verae P.LForst. 184

Areyrodendron 141,217

Ariflorae 2, 4

Aristida 145

forsteri B.K.Simon 145, 147, /48

muricata Henrard 145, 147

section Streptachne 145

section Calycinae 145

spuria Domin 145, 147

thompsonii B.K.Simon 145, /46, 147, 598

spp. 122

Aristideae 145

Aristotelia L’ Her. 75

Arthropogzen Nees 369

Arundineae 145

Asclepiadaceae 3, 51, 67, 113, 129, 289, 401, 418

Astartea DC. 627

Asteraceae 3, 87, 199, 609

Asteriflorae 1, 2, 3,4

Asteromyrtus

brassti (Byrnes) Craven 126

symphyocarpa (F.Muell.) Craven 122, 123

Astraea Stapf 648

Astrotricha 407

biddulphiana F.Muell. 407, 408

paucifiora A.R.Bean 407, 408

roddii Makinson 407, 409, 691

Atherospermataceae 605

Austrobuxus Mig. 330, 332, 619, 620

megacarpus P.I.Forst. 619, 620, 622, 623, 624, 625

nitidus Mig. 619, 620, 623, 625, 626

swainti (Beuzey. & C.T. White) Airy Shaw 619, 620,

621, 622

Babinetonia Lindl. 353, 355, 627, 628, 630, 632

behrit (Schitdl.} A.R.Bean 627, 632, 637, 643

camphorosmae (Endl.) Lindl, 627, 630

crenulata (F.Muell.) A.R.Bean 627, 632, 634, 635,

643

cunninghamit (Schauer) A.R.Bean 627, 632, 637,

638, 640

densifolia (Sm.) F.Muell. 632, 635, 636, 637, 643

eranitica A.R.Bean 627, 631, 632, 640, 642, 643

jucunda (S.T.Blake) A.R.Bean 460, 627, 628, 632,

638, 639, 640, 642, 644

leratii (Schitr.) A.R.Bean 627, 633

nova-anglica (F.Muell.) F.Muell. 636

odontocalyx A.R.Bean 627, 628, 631, 632, 640, 643,

644, 645

pinifolia (Labill.) A.R.Bean 627, 633

procera (J.W.Dawson) A.R.Bean 627, 633

prominens A.R.Bean 627, 629, 632, 639, 640, 641

silvestris A.R.Bean 627, 629, 632, 639, 640, 641, 644,

645 |

squarrulosa (Domin) A.R.Bean 627, 631, 632, 642,

644

taxifolia (Merr.) A.R.Bean 627, 632, 633

tozerensis A.R.Bean 627, 629, 632, 634, 635, 644

virgata sens. lat. 632

virgata (J.R.Forst. & G.Forst.) F.Muelil. 630, 634, 636

Backhousia myrtifolia Hook. 363

Baeckea L. 353, 355, 627, 630, 647

behrii (Schitdl.) F.Mueil. 637

camphorata R.Br. ex Sims 353, 354, 356, 362, 363,

364

cainphorosmae Endl, Lindley 627

citriodora Penfold & J.H. Willis 389

cunninghamii (Schauer) Benth. 638

densifolia Sm. 635, 636

ericoides Brongn. & Gris 633

Jasciculata Spreng. 636

frutescens L, 353

imbricata (Gaertn.) Druce 363

jucunda S.T.Blake 639

leptocalyx F.Muell, 462

leratii Schltr, 633

linearis C.T, White 389

nova-anglica F.Muelil. 636

oligomera Radlk, 387, 389, 390

procera J W.Dawson 633

section Oxymyrrhine (Schauer) Benth. & Hook.f. 630

section Pausomyrtus Radlk. 387

section Harmogia (Schauer) Benth. & Hook.f. 630

section Babingtonia (Lind].) Benth. 630

faxifolia Merr. 632

virgata (J.R.Forst. & G.Forst.) Andrews 364, 634

sp. 2 361 )

sp. (Mt Ngungun S.T.Blake) 21216 361

sp. Mt Minda 387

sp. “Stony Creek Falls’ 358

sp. 634

sp. 3 642

sp. A 644

Balanophoriflorae 2, 4

Bambusa moreheadiana F.M.Bailey 131, 132

Banksia 469

oblongifolia Cav. 360

Batesanthus purpureus N.E.Br. 68

BEAN, A.R. & Brooker, M.I.H.: Four new species of

ironbark Eucalyptus L’ Herit., Myrtaceae) from southern

Queensland 187

BEAN, A.R. Eucalyptus clandestina (Myrtaceae), a new

bloodwood from central Queensland 205

BEAN, A.R, Revision of Rubus L. subgenus Micranthobatus

(Fritsch) Kalkman (Rosaceae) in Australia 321

BEAN, A.R. A Revision of Syncarpia Ten. (Myrtaceae) 337

BEAN, A.R. Reinstatement and revision of Triplarina Raf.

(Myrtaceae) 353

BEAN, A.R. A new species and new combination in

Ochrosperma Trudgen (Myrtaceae) 387

BEAN, A.R, A new species and a new record for Astrotricha

DC, (Araliaceae) in Queensland 407

BEAN, A.R. A Revision of Micromyrtus Benth. (Myrtaceae)

in Queensland 455

BEAN, A.R. Reinstatement of the genus Babingtonia Lindl.

(Myrtaceae, Leptospermoideae) 627

BEAN, A.R. A new species of Thryptomene Endl, and a new

species of Ochrosperma Trudgen (Myrtaceae) from the

Northern Territory, Australia 647

ee aig eens eee cee eee eee eee eee yon ee ye .

BEAN, A.R. & Jessup, L.W. Dubouzetia saxatilis

(Elaeocarpaceae), a new species from north Queensland,

Australia 673 :

Bean, A.R. A revision of Rubus subg. ldaeobatus (Focke)

Focke (Rosaceae) in Australia 677

Behnia 391

Berrya 75,76

anunonilla Roxb. 76, 77

var. rotundifolia Benth. 77

cordifolia CWilld.) Burret 76

javanica (Turcz.) Burret 75, 76, 79, 80, 85

gquinquelocularis Tysm, & Binnend. ex Koord. 79

rotundifolia Domin 75, 76,77, 75, 85

Beyeria viscosa

var. obovata C.T, White 366

Blepharocarya involucrigera F.Muell. 242

Boraginaceae 451

Boronia

granitica Maiden & E.Betche 693

granitica F.Muell, 692

rosmarinifolia Endl. 363

Borreria

gilllesae Specht 117

suffruticosa Specht 117

Borya Labill. 597

inopinata P.I.Forst. & E.J.Thomps, 597, 599, 600

jabirabela Churchill 598, 600

laciniata Churchill 597

scirpoidea Lindley 597

septentrionalis F.Muell. 458, 597, 598, 600

Bossiaea rhombifolia Sieber ex DC.

subsp. rhombifolia 283

Bostock, P.D. & Forster, P.I. Distribution, habitat, and

conservation status of Peperomia bellendenkerensis

(Piperaceae) a rare endemic from the Wet Tropics of

north-eastern Queensland 449

Brachyloma_ -

daphnoides (Sm.) Benth. 279, 283, 360

saxicola J.T.Hunter 691

microcarpa F.Muell, 283

Brassicaceae 3

Brooker, M.I.H. with Bean, A.R. Four new species of

ironbark Eucalyptus L’ Herit., Myrtaceae) from southern

Queensland 187

Brooker, M.I.H. & Stee, A.V. A new species of red gum

(Eucalyptus subser. Phaeoxyla Blakely) from central and

southern Queensland 265

Brownlowta 76 7

Brun, Jeremy J, with Hunter, John T. Significant range

extensions for species of vascular plants in northern New

South Wales 691

Bursaria tenuifolia F.M.Bailey 358

Caldcluvia paniculosa (F.Muell.} Hoogland 327

Callistemon chisholmii Cheel 598

Callitris 467

endlicheri (C.Parl.) F.M.Bailey. 277, 471, 638, 693

glaucophylla J.Thomps. & L.A.S Johnson 277, 409,

463

sp. 645

Calothamnus gilestt F.Muell, 424

Calpicarpum G.Don 13

Calycanthaceae 601, 603, 605

Calycanthus

chinensis Cheng. & S.T.Chang 603, 695

floridus L. 603, 604, 605, 606

Calycopeplus 417,418

casuarinoides L.S.Sm. 417, 418, 419, 420, 42/7, 427

collinus P.[.Forst. 417, 418, 419, 420, 427, 422, 648

ephedroides Planch 417, 418, 423, 424

helmsti F.Muell. & Tate 423, 424

marginatus Benth. 417, 419, 424, 425, 426

oligandrus P.].Forst. 417, 419, 425, 426, 427

paucifolius (Klotzsch) Baill. 417, 419, 423, 424, 425,

426

Calytrix 467

eurulmundensis Craven 466

leptophylla Benth. 166

longiflora (F.Muell.) Benth. 267

fetragona Labill. 362, 471, 636

spp. 462

Campanulaceae 3

Camphoromyrtus Schauer 354, 356, 363

behrii Schltdl. 637

crenulata F.Muell, 635

Canaca Guillaumin 330, 332, 619

Capparaceae 3

Carissa 18

Caryophyllaceae 3

Caryophyllifforae 2,3, 4,5

Cascabela 19

Castanopsis sp, 247

Castanospora alphandii (F.Muell.) F.Muell, 32

Casuarina 467

campestris Diels 424 es

inophloia F.Muell. & F.M.Bailey 191,639

littoralis Salisb. 340

forulosa Aiton 360, 340

Catharanthus 19

Caustis blakei Kuk, 617

subsp. blakei 613, 614, 615, 6/6

subsp, macrantha M.E. Johnston & J.HJ.Webber

613,614, 615, 6/6

Ceratopetalum apetalum D.Don 327, 621

Ceratozamia 269

Cerbera 19

Chambeyronia Vieill, 228

Chenopodiaceae 3

Chimonanthus 604

praecox (L.) Link 603, 605

Chloridoideae 57

Choricarpia :

leptopetala (F.Muell.) Domin 343

subargentea (C.T.White) L.A.S.Johnson 152, 343

Choriceras Batli, 330, 332, 619, 621

Choriophyllum malayanum Benth. 626

Cinnamomum 604, 606

camphora (L.) T.Nees & Eberm. 603, 605

CLARKSON, J.R, Nomenclatural changes in Spermacoce L.

(Rubiaceae) 117

Cleidion Blume 139, 140

CuirrorD, H.T, Bainbusa moreheadiana F.M.Bailey

(Magnoliophyta; Poaceae) 131

Cliffordiochloa B.K.Simon 369, 370, 372, 374

Combretaceae 149

Combretum Loefl, 149

Commeliniflorae 1, 2, 3, 4, 5, 6

Convallaria majalis L. 668

Corchorus 75, 297, 298, 310, 313, 315, 318

acutangulus Lam, 297, 302

var. acutangulus, Domin 302

var. brachycarpus Domin, 302

aestuans L, 297, 299, 307, 302, 304, 313

capsularis L., 297, 299, 300, 301

cunninghamii F.Muell, 297, 299, 308, 310, 37/7, 312,

313, 315

echinatus Benth., 316

fascicularis Lam. 297, 299, 306, 308,

hirsutus 297

hygrophilus A.Cunn, ex Benth, 297, 299, 310, 313,

314,315

macropetalus CF, Muell.) Domin 297, 299, 374, 316,

318

macropterus G.J, Leach & Cheek 297, 299, 3/7, 312,

313

olitorius L. 297, 298, 299, 300, 307, 302

var. australiensis Domin 300

pachyphyllus 298

pascuorum Domin 297, 298, 299, 314, 316, 318

reynoldsiae Halford, 297, 299, 3/4, 315

rigidiusculus Domin 305

rothti P.Muell, 507

siliquosus 297

thozetii Halford 297, 299, 377, 312, 313,315

tridens L. 297, 299, 305, 306, 307, 308

var. euryphiyllus Domin 307

var, fridens Domin 305

trilocularis L. 297, 299, 304, 305, 306, 307, 308

vernticularis F. Muell, 298

Corniflorae 2, 3, 4, 6

Corymbia

Clarksoniana (D.J.Carr & S.G.M.Carr) K.D.Hill &

L.A.S.Johnson 610

confertifiora (F.Muell.) K.D.Hill & L.A.S Johnson 610

intermedia (R.Baker) K.D.Hill & L.A.S. Johnson 615

trachyphloia (F.Muell.) K.D.Huill & L.A.S.Johnson

615

CRAVEN, L.A, with WILSON, F.D. Two new species of

Hibiscus section Furcaria DC.CMalvaceae) from

Northern Queensland 439

Croton stockeri (Airy Shaw) Airy Shaw 489

Cryptandra amara Smith 693

sp. 458

Cryptolepis Blume 67

bifida (Blume) P.I.Forst. 67, 69

buchananti Roemer & Schultes 67

javanica (Blume) Blume 67, 69

lancifolia P...Forst. 67, 69, 72

montetroae N.E.Br. 68

multinervosa P.I.Forst. 67, 69. 70, 7/

aymanit (K.Schum.) P.LForst. 67, 69, 72

papillata PI.Forst. 67, 69, 70, 72

perakensis (Gamble) P.I.Forst. 67, 70

subgenus Phyllanthera (Blume) P.I.Forst. 67, 68, 69

subgenus Cryptolepis 68, 69

Cunoniaceae 589

Cupaniopsis anarcardiodes (A.Rich.) Radlk. 235, 242

Cyathea

exilis Holttuam 184

leichhardtiana (F.Mueli,) Copel 327

Cycadaceae 345

Cycas 269, 345, 346

brunnea K.D.Hill. 346

cairnstana F.Muell. 345, 346, 348

couttsiana K.D.HIl 346

desolata P.E.Forst. 345, 346, 347, 348, 349, 350, 352

megacarpa K.D.Hill 345, 346

ophiolitica K.D.Hill 345

platyphylla K.D.Hill 345, 346, 348

Cyclostemon Blume 478

macrophyllum Blame 478

subcubicus 477, 492, 493

Cyperaceae 3

Dallwatsonia B.K.Simon 369, 370, 372, 374

Dampiera purpurea R.Br, 279

Dansiea 149

elliptica Byrnes 151

grandiflora Pedley 149, 750, 151

Decaschistia

peninsularis Craven & Fryx. 125, 126, 127

sp. Rokeby 126

Diasperus Kuntze 661

Dilleniaceae 3

Dioon 269

Dischidia 113, 114

bengalensis Colebr. 113

littoralis Schltr. 113, 775, 116

major (Vahl) Merr. 114

nummularia R.Br, 116

ovata Benth. 114

Dissiliaria F.Muell. ex Baill, 329, 330, 331, 332, 619, 621

Dissiliartinae 329, 330, 619

Doryphora 604, 606

aromatica (F.M.Bailey) L.S.Sm. 601, 602, 603, 605

sassafras Endl, 327

Dowe, John L. & Hope, Donald R. Revision of

Archontophoenix H. Wendl. & Drude (Arecaceae) 227

Drynaria quercifolia (..)J.Sm, 174

Drypetes Vahi 477, 478

acuminata P.I.Forst. 477, 478, 479, 483, 484, 485,

486, 492

affinis Pax & K.Hoffim. 479

australasica (Muell.Arg.) Pax & K.Hoffm, 477, 479,

484, 492

deplanchei (Brongn. & Gris) Merr. 477, 478, 479,

480, 48], 482, 483, 486, 488, 492

subsp. affinis (Pax & K.Hoffm.) P.S. 479, 482

subsp. deplanchei 482

glauca Vani, 478

iodoformis L.S.Sm. ex P.I.Forst., 477, 478, 479, 489,

490, 491, 492

lasiogyna (F.Muell.) Pax & K.Hoffm. 477, 479

var. australasica (Muell.Arg.) Airy Shaw 479, 483,

486

var, australasica auct, non (Muell.Arg.) Airy Shaw

483

subsp, affinis (Pax & K.Hoffm.) P.S.Green 479

inacrophylla (Biume) Pax & K.Hoffm. 478

sepiaria (Wight & Arn.) Pax & K,Hoffm. 478

subcubica (3.J.Sm.) Pax & K.Hoffm. 477, 489, 491,

492

vernicosa P.I.Forst. 477 478, 479, 484, 486, 487, 488,

489

sp. 492

Duboisia myoporoides R.Br., 324

Dubouzefia Pancher ex Brongn. & Gris 673

australiensis 673, 674

saxatilis A.R.Bean & Jessup 673, 674, 675

section Oligovila Coade 674

Echinocarpus Bl 75

Ectadiopsis oblongifolia (Meisn.) Schltr. 68

Ectadium oblongifoliuin Meisn. 68

Ectrosia leporina R.Br. 122

Ehretia

grahamii Randell 451, 452

membranifolia R.Br 451, 452

saligna

var. membranifolia (R.Br.) Randell 451

Elachanthera 391

Elaeocarpaceae 673

Elaeocarpus L. 75

deplanchei Brongn, & Gris 479

ELsoL, James A. Aspects of rarity in the Australian flora 1

Encephalartos 269

Endospermum

medullosum L.S.Sm,. 384

myrmecophilun L.S.Sm. 384

SERN ee Saeed bs peeag hips eins g a Lt usd ascensesenece icici tet eb re ever es pyar _

Epacridaceae 3

Epacris 469 :

Ephedra arborea F.Muelil ex Parlatore 419, 420

Eragrostis 61

parviflora (R.Br,) Trin. 59

Eremophila gilesii F.Muell. 475

Eremopyxis Baillon 354, 356

camphorata (R.Br. ex Sims) Baillon 356, 363

Eriachne spp. 122

Eryngium L. 155

expansum F/Muell. 157, 158

fontanum A.E.Holland & E.J,Thompson 155, /56,

157

plantagineum F.Muell. 155, 157, 158

supinum J.M,Black 157

vesiculosum Labill. 157

Erythrophleum chlorostachyus (F.Muell.) Baill, 123, 124

Eucalyptus 122, 124. 187, 205, 235, 273, 355, 467

abergiana F.Muell. 357, 458

acmenoides Schauer 189, 341, 357, 615, 640

ammophila 265, 266, 267, 268

apothalassica L.A.S.Johnson & K,D.Hill 188, 277

approximans 696

subsp, codonocarpa (Blakely & McKie)

L.A.S.Johnson & Blaxell 696

arnhemensis D.J.Carr & S.G.M.Carr. 206, 207

baileyana F.Muell. 189, 191, 615

beaniana L.A.S.Johnson & K.D.Hill 193

bloxsomei Maiden 463

brevifolia 548

bunites Brooker & A.R.Bean 360

caleyi Maiden 193

caliginosa Blakely & McKie 695

camaldulensis 558

campanulata R.T. Baker & H.G.Sm. 641

carneda R.T.Baker 340

chloroclada (Blakely) L.A.S.Johnson & K.D,Hill 267

citriodora Hook. 281, 340, 357, 664

clandestina A.R.Bean 205, 206, 207

cliftoniana W.Fitzg. ex Maiden 422

cloeziana F.Muelil. 189, 191, 664

codonocarpa Blakely & McKie 691, 696

collina 548

corynodes A.R.Bean & Brooker 187, /90, 191, 192,

193

crebra F.Muell. 191, 193, 206, 272, 346, 463, 696

cullenii Cambage 126

dealbata Schauer 409

deanei Maiden 471

decolor A.R.Bean & Brooker 193

decorticans (F.M.Bailey) Maiden 193, 462

drepanophylia F.Muell. ex Benth. 192, 696

dunnii Maiden 235

dura L.A.S.Johnson & K,D.Hill 189, 191, 193, 275,

341 |

erythrophioia Blakely 346

exserta F.Muell. 265, 266, 267, 268, 340, 460, 462,

464, 471, 693

fibrosa F.Muell, 189, 272, 281

subsp. fibrosa 188, 193

subsp. nubila (Maiden & Blakely) L.A.S. Johnson

193, 638

grandis W. Hill ex. Maiden 236

gununifera (Sol. ex Gaertn.) Hochr. 189, 362

henryi S.T.Blake 189

frylandii D.J,Carr & $.G.M.Carr 124, 126, 442, 444

incrassata Labill, 637

intermedia R.T.Baker 340

jensenii Maiden 187

kabiana L.AS.Johnson & K.D.Hill 696

lamprophylia Brooker & A.R.Bean 205, 206, 207

leichhardtii F.M.Batley 189, 642, 388

leptophleba F.Muell, 126 —

leucophloia 558

macilata Hook, 272

melanoleuca S.T. Blake 193 |

melanophloia F.Muell. 192, 206, 475, 664

melliodora A.Cunn., ex Schauer 272

microtheca F.Muell 420

miniata A.Cunn. ex Schauer 422, 535, 566

moluccana Roxb, 272

morrisii R.T. Baker 265, 267, 268

nesophila Blakely 126, 439, 442

pachycalyx Maiden & Blakely 191

panda S.T.Blake 192, 277

papuana F,Muell. 126, 206

petalophylla Brooker & A.R.Bean 275, 636

phoenica F.Muell. 422, 648

pilularis Sm. 340, 615

planchoniana F.Muell. 615

prava L.A.S.Johnson & K.D.Hill 279, 471, 641, 645

propinqua H.Deane & Maiden 341

pyrocarpa L.A.S.Johnson & Blaxell 640

quadricostata Brooker 188

racemosa Cay, 615

resinifera Sm. 357, 658

rhodops DJ.Carr & 8.G.M.Carr 696

rhombica A.R.Bean & Brooker 187, 188, 790, 192,

193

rossit R.T, Baker & H.G.Sm. 638

saligna Sm. 641

series Siderophioiae 187

section Rufaria 205

series Rhodoxyla 187, i91

series Siderophloiae 187, 188

series Terminaliptera 205

series Paniculatae 187

series Pruinosae 187

series Gummiferae 205

series Melliodorae 187

setosa Schauer 124, 467

shirleyi Maiden 168

stcilifolia L.A.S Johnson & K.D.Hill 193

siderophloia Benth. 187, 192, 193 |

sideroxylon A.Cunn, ex Woolls 188, 193, 279 .

signata F.Muellj. 615

socialis Mig. 637

sphaerocarpa L.A.S Johnson & Blaxell 360

subgenus Corymbia 205

subseries Phaeoxyla Blakely 265, 267

subtilior L.Johnson & K.D.Hill 696

suffuleens L.A.S Johnson & K.D.Hiil 193, 200

taurina A.R.Bean & Brooker 187, 189, 790, 191, 192,

193

fenutipes (Maiden & Blakely) Blakely & C.T, White

188, 191, 200, 460, 466

fetrodonta F.Muell. 122, 123, 124, 125, 126, 439, 442,

444, 566, 610

tholiformis A.R.Bean & Brooker 188, 187, 189, 790,

191, 192, 193

trachyphioia F.Muell. 188, 189, 200, 207, 275, 360,

362, 388, 462, 464, 466, 639, 642

tricarpa (L.A.S.Johnson) L.A.S Johnson 188

umbra R,T.Baker 469

virens Brooker & A.R.Bean 188, 192

watsoniana F.Muell, 275

subsp, watsoniana 191

williamsianus L.A.S Johnson & K.D.Hill 695

xanthoclada Brooker & A.R.Bean 346

youmanti Blakely & McKie 695

sp. 550, 688, 696

spp. 123, 190, 192

Eucryphia Cav. 589

aberensis R.S.Hill 589

falcata R.S.Hill 589

jinksti P.I.Forst. 589, 590, 592, 593, 594, 595

lucida CLabill.) Baill, 589, 593, 594

inicrostoma R.S.Hill 589

milliganit Hook.f, 589, 593, 594

mooret F.Muell, 589, 590, 593, 594

wilktei B.Hyland 589, 590, 597, 592, 594

sp. 251, 417, 590

Euphorbia

brassii P.I.Forst. 245, 246, 247, 248, 254

buxoides Radcl.-Sm. 245, 246, 247, 250, 256, 262

corynoclada F.Muell. 260

exonymoclada Croizat 245, 246, 249, 251, 252, 253

fidjiana Boiss. 245, 260, 262

heyligersiana P.I.Forst. 245, 246, 251, 254, 255

indistincta P.J.Forst. 245, 246, 251, 254, 256, 257

kanalensis Boiss, 245, 246, 247, 254, 256, 258, 259,

260

macrocarpa Boiss. ex B.L.Robinson & J.M.Greenman

246

norfolkiana Boiss. 245, 246, 258, 260, 26/

novo-guineensis Kaneh. & Hat. 249

paucifelia Klotzsch 417, 423, 424

plumnerioides sensu stricta 258

plumerioides Teijsm. ex Hassk, 245, 246, 256, 260,

262, 263

var. acuminata J.J. Sm. 245, 254, 258

var. Hiacrocarpa Radcl.-Sm, 245, 246

var. micropliylla Radcl.-Sm, 254, 258

sarcostemmoides J.H.Willis 417, 418

section Balsamis Webb & Berth, 245

section Calycopeplus (Planch.) Boiss. 417

section Pachycladae Boiss, 245

Euphorbiaceae 3, 139, 209, 245, 329, 333, 417, 381, 477,

619, 661, 691

subfamily Euphorbioideae 417

subfamily Leptospermoideae 337

subfamily Oldfieldiaideae Kohier & Webster 329, 619,

621

subfamily Phyllanthoideae 477

subtribe Dissiliariinae Pax & Hoffm. 329, 330, 619

subtribe Neoguillauminiinae 417

tribe Caletieae Muell.Arg, 329, 619

tribe Drypeteae (Griseb.) Hurusawa 477

tribe Euphorbieae Pax. & K.Hoffm. 417

Euphorbiinae 417

Eupomatia 601, 604, 605

bennettii F.Muell. 602, 603

Eupomatiaceae 603

Euryomyrtus Schauer 353, 354, 355, 630

Eustrephus 391

anpustifohus 391

latifolius 391, 392

var, brownii 391

watsonianus 391

Fabaceae 3, 362

Fabiflorae 1, 2, 3,4, 5,6

Fasciculochloa B.K.Simon & C.M.Weiller 369, 370, 372,

374, 378

sparshottiorum B.K.Simon & C.M.Weiller 369, 373,

374, 375, 376, 377

Ficus 119

aculeata Mig. 119

var. aculeafa Bentham 119

var, micracantha (Miq.) Benth 119

leichhardtii (Miq.) Miq 119

var. angustata Mig 119, 120

var, leichhardtii 119, 120

micracantha Miq 119

opposita ;

var. aculeata (Miq.) R.LF. Hend., 119

var. micracantha (Miq.) Corner 119

platypoda (Miq.) A.Cunn, ex Mig. 120, 163

var, angustata (Mig.) Corner 119

var. fachnocaulos (Mig.) Benth. 120

var. leichhardtit (Miq.) R.J.F. Hend. 119, 120

Finlaysonia obovata Wallich 129

Flindersia australis R.Br, 152

Forster, Paul [. A taxonomic revision of Neisosperma Raf.

(Apocynaceae) in Australia, together with a key to

Australian genera of Apocynaceae 13

ForSTER, Paul I. Conspectus of Cryptolepis R.Br.

(Asclepiadaceae: Periplocoideae) in Malesia 67

Forster, Paul I, A taxonomic revision of the genus

Peperomia Ruiz & Pav. (Piperaceae) in mainland

Australia 93

Forster, Paul I, Resurrection of Wrig/tia versicolor

S.T.Blake (Apocynaceae) 109

Forster, Paul J, Additional records for some species of

Finlaysonia Wallich, Gymnanthera R.Br., Heterostemma

Wight & Arn, and Sarcolobus R.Br. (Asclepiadaceae) in

Melanesia and Papuasia 129

Forster, P.I. Wetria australiensis sp. nov. (Euphorbiaceae),

anew generic record for Australia 139

Forster, PJ, Notes on Dansiea Brynes and

Macropteranthes F.Muell. (Combretaceae) 149

Forster, P.I. Ten new species of Plectranthus L’ Her.

(Lamiaceae) from Queensland 159

ForSTER, P.I. A taxonomic revision of Acalypha L.

(Euphorbiaceae) in Australia 209

Forster, P.I. Revision of Euphorbia plumerivides Teijsm.

ex Hassk, (Euphorbiaceae) and allies 245

Forster, P.I. Typification of Tweedia coerulea and T.

versicolor (Asciepiadaceae) 289

Forster, Paul I. Sankowskya, a new genus of Euphorbiaceae

(Dissiliariinae) from the Australian Wet Tropics 329

Forster, Paul I. Cycas desolata (Cyadaceae) a new species

from north Queensland 345

Forster, Paul 1. Omphatlea celata, a new species of

Euphorbiaceae from central Queensland 381

Forster, Paul I. A taxonomic revision of Calycopeplus

Planch. (Euphorbiaceae) 417

Forster, Paul I. Ehretia grahamii (Boraginaceae), notes on

distribution, habit, variation and conservation status 451

Forster, Paul I, A taxonomic revision of Drypetes Vahl

(Euphorbiaceae) in Australia 477

FORSTER, Paul I. & HyLanp, B.P.M. Two new species of

Eucryphia Cay, (Cunoniaceae) from Queensland 589

Forster, Paul I, A taxonomic revision of Austrobuxus Mig.

(Euphorbiaceae: Dissiliartinae) in Australia 619

ForsTerR, Paul I, Plectranthus amoenus and P.

thalassoscopicus (Lamiaceae), new species from north-

eastern Queensland, Australia 653

Forster, Paul I. reviewer. Field Guide to Eucalypts: Volume

3, Northern Australia by M.J.H.Brooker & D.A.Kleinig

695

Forster, P.J. with Bostock, P.D, Distribution, habitat, and

conservation status of Peperomia bellendenkerensis

(Piperaceae) a rare endemic from the Wet Tropics of

north-eastern Queensland 449

Forster, Paul I. with Jones, David L. Seven new species of

Macrozamia section Parazamia (Mig.) Mig. (Zamiaceae

section Parazamia) from Queensland 269

Forster, Paul 1. & Lippe, David J. Taxonomic studies on

the genus Hoya R.Br. (Asclepiadaceae: Marsdenieae) in

Papuasia, 6 51

Forster, Paul I. & Lippe, David J. Resurrection of

Dischidia littoralis Schitr. (Asclepiadaceae) 113

Forster, Paul I., LippLe, David J. & Lippte, Irts M.

Taxonomic studies on the genus Hoya R.Br.

(Asclepiadaceae: Marsdenieae) in Papuasia, 7 401

Forster, Paul I, & THompson, E.John. Borya inopinata

(Anthericaceae), a new species of resurrection plant from

north Queensland 597

Geitonoplesiaceae 391

Geitonoplesium 391, 396

asperum 391

cymosum 391, 392, 397

subsp. angustifolium 391

subsp. angustifolium var, fimorense 392

subsp. macrophyllum var. timorense 392

Gentianiflorae 2,3, 4

Glochidion Forster & G.Forster 661

Gnaphalteae 199, 609

Gompholobium sp. B 692

Gonocarpus acanthocarpus (Brongn.) Orchard 598

Goodenia

delicata Carolin 279

racemosa F.Muelil. 388

Goodeniaceae 3

Gouania 411

australiana F. Muell 411, 412, 413, 414, 415

exilis K.Thiele 411, 473, 414, 415

hillii F.Muell 411, 412, 414, 416

javanica Mig. 411, 412

leptostachya DC, 412, 414

microcarpa DC, 412

polygama (Jacq.) Urban 411

fomentosa Jacq. 411

Gray, B. & Jones, D.L. Nervilia peltata (Orchidaceae), a

new species from north-eastern Queensland and the

Northern Territory 195

Grevillea

juncifolia Hook, 267

longistyla Hook. 466

pteridifolia Knight. 122, 123, 166, 634

sessilis C.T. White & Francis 388, 598

whiteana McGill. 470

sp. 422

Grewia 75

sraniticola Halford 75, 83, 84, 85

pleiostizma F.Muell. 79, 81

retusifolia Kurz 83

scabrella Benth. 83

Gymnanthera R.Br. 129

nitida R.Br. 129

oblonga (Burm.f.) P.S. Green 129

Gymnolaema newii Benth, 68

Gyrocarpus 601, 603, 604, 605, 606

Hacrorp, D.A. Notes on Tiliaceae in Australia, 1 75

HALForD, D.A, Notes on Tiliaceae in Australia, 2, 297

HALForD, D.A. Notes on Tillaceae in Australia, 3: A

revision of the genus Triumfetta L. 495

Harmogia Schauer 627, 628, 630

baueriana Schauer 636

crentulata Mig. 635

cunninghamii Schauer 638

densifolia (Sm.) Schauer 630, 635

propinqua Schauer 636

virgata (J.R.Forst. & G.Forst.) Schauer 634

Hedycarya 601, 604, 605, 606

arborea J.R.Forst & G.Forst. 603, 605

Hedyscepe H. Wendl. & Drude 228

Hemecyclia Wight & Arm, 478

australasica Muell. Arg. 479

deplanchei (Brongn, & Gris) Baill, ex Guillaumin 479

lasiogyna F.Muell. 479

sepiaria Wight & Arn. 478

var. australasica (Muell. Arg.) Baill. 479

var. oblongifolia Benth, 479

HENDERSON, Rodney J.F. The correct names for two

Australian varieties of Ficus L. (Moraceae) 119

Hernandia 605

albiflora (C.T. White) Kubitzki 601, 602, 604, 605,

606

ovigera L. 601, 602, 603, 604, 605, 606

Hernandiaceae 601, 603, 605

Heterostemma Wight & Arn. 129

acuminatum Decne 129

samoense (A.Gray) P. Forster 129

Hibbertia

dentata R.Br, 389

laurana S.T.Reynolds 166

stricta (DC.) R.Br. ex F.Muell, 279

Hibiscus 439

amaliae Domin 445

divaricatus Graham 439, 444, 445

diverstfolius Jacq. 439, 444, 445

subsp. rivularis (Bremek. & Oberm.,) Exel! 445

forsteri F.D.Wilson 439, 44/7, 442, 443, 444

heterophyllus Vent. 439, 444, 445

subsp. feterophyllus 445

subsp. luteus (Hochr.) F.D, Wilson 439, 445

x H. splendens 445

meraukensis Hochr. 122, 439, 444

saponarius Craven 439, 442, 443, 444, 446

section Furcaria DC 439, 442, 445

splendens Fraser ex Graham 439, 444, 445

Hops., Donald R. with DoweE, John L. Revision of

Archontophoenix H. Wendl. & Drude (Arecaceae) 227

Hounen, Caroline reviewer: Australian Tropical Rain Forest

Trees - an interactive identification system, including

Leaf Atlas of Australian Tropical Rain Forest Trees by

D.C, Christophel et af. 291

HOLLAND, Ailsa E, & THompson, E, John. Eryngium

fontanum A.E, Holland & EJ. Thompson, (Apiaceae), a

new species from Central Queensland 155

HOoLanb, Ailsa E. Two new species of Rutidosis DC.

(Asteraceae: Gnaphalieae) from Queensland 199

Ho.ianp, Ailsa E, Acomis beila (Asteraceae: Gnaphalieae),

anew species from north Queensland 609

Homalocalyx

ericaeus F.Muell, 648

polyandris (F.Muell.) Benth. 639

prolixus Craven & S.R.Jones 693

fhomasit (F Muell.) Craven & S.R.Jones 388

fropicus Byrnes 166

Hoya 31, 401

anulata Schltr. 55

archboldiana C.Norman 401, 402, 404, 405, 406

australis

subsp. fennipes (K.D.Hill) P.I.Forst, & D.J.Liddle

174

Chlorantha Rech, 53

dennisii P.1.Forst, & D.J,Liddle 51, 52, 53

flavida P.I.Forst. & D.J.Liddle 51, 53, 54, 55

macegillivrayi F.M.Bailey 401. 402,

mepalaster Warb. 401, 402, 404

onychoides P.f.Forst., D.J. Liddle & LM.Liddle 401,

402, 403, 404

patella Schltr. 406

section Piysostelma (Wight) Blume 401, 406

subcalya Burk. 404

venusta Schltr. 53

sp 404

sp. Mt Gailego 51,55

Hunter, John T. & Bruxt, Jeremy J. Four new rare species

of Sauropus Blume (Euphorbiaceae: Phyllantheae) from

north Queensland 661

Hunter, John T. & BruuL, Jeremy J. Significant range

extensions for species of vascular plants in northera New

South Wales 691

HyLanD, B.P.M. with Forster, Paul I. Two new species of

Eucryphia Cay. (Cunoniaceae) from Queensland 589

Hypocalymma (Endl.) Endl. 627

Ichnocarpus 18

Idiospermum 601, 604, 605, 606

australiense (Diels) S.T.Blake), 605

Ischaeminae 105

lxora 21, 23

obovata 37,38

pavetta Roxb. 21

pavetta auct, non Roxb. 26

section Pavetta (L.) Benth, 22

fomentosa Roxb. 21

tomentosa auct. non Roxb, Benth. 35, 37

Jacksonia

scoparia R.Br. 272, 281

thesioides A.Cunn. ex Benth. 122

Jessenia 227

amazonum Drude 233

glazioviana Dammer 232

Jessup, L.W. Two new species of Syaiplocos Jacquin

(Symplocaceae) from Queensland 7

Jessup, L.W. with Bean, A.R. Dubouzetia saxatilis

(Elaeocarpaceae), a new species from north Queensland,

Australia 673

JOHNSTON, Margaret E,, SwArsBrRIcK, John T., WEARING, Alan

H, & WesBeErR, Julie H. A new subspecies of Caustis

blakei Kuk. in Queensland 613

Jones, David L. & Forster, Paul I. Seven new species of

Macrozamia section Parazamia (Mig.) Mig. (Zamiaceae

section Parazamia) from Queensland 269

Jones, D.L. with Gray, G. Nervilia pelfata (Orchidaceae), a

new species form north-eastern Queensland and the

Northern Territory 195

Jungia imbricata Gaertn. 363

Kaimptzia Nees albens (DC.) Nees 337, 338, 339

Kentiopsis Brongn. 228

Keraudrenia corollata (Steetz) Druce 460

Kopsia 19

Kunzea

ambigia (Sm.) Druce 364

bracteolata Maiden & E.Betche 692

calida F.Muell. 145, 598

flavescens C.T.White & Francis 362, 470

obovata Byrnes 691

Labichea nitida Benth. 358

Lactaria kilneri (F.Muelil.) Kuntze 15

LAFERRIERE, Joseph E. Nomenclature and type specimens in

Eustrephus R.Br. and Geitonoplesium Hook.

(Geitonoplesiaceae) 391

Lamiaceae 3, 159, 653

Lamuflorae 2, 3, 4

Lantana camara L. 364

Laportea sp. 251

Lappiula 499

Lasiothrix 499

Lauraceae 601, 603, 605

Laurales 601, 604, 605

Lepidacalyx 499

Lepidosperma laterale R.Br. 641

Lepistoma javanica (Blume) Blume 68, 69

Leposma javanica Blume 68, 69

Leptospermoideae 627

Leptospermum 122

brachyandrum (F.Mueil.) Druce 166

brevipes F.Muell. 409, 641

coriaceum (Mig.) Cheel 637

imbricatum Sm. 354, 362

luehimannii F.M.Batley 362

microcarpum Cheel 179, 362

neglectum Joy Thomps. 360, 674

novae-angliae Joy Thomps. 645

pinifolium Labill, 633

polygalifolium Salisb, 364

purpurascens Joy Thomps. 634

semibaccatum Cheel 469

sericatum Lindl. 462

venustum A.R.Bean 360

virgatum J.R.Forst, & G.Forst, 634

Leucopogon cicatricatus J.Powell 691

inelaleucoides A.Cunn. ex DC. 279, 283, 641

muticus R.Br. 279

neo-anglicus F.Muell. ex Benth 691, 692

rupicola C.T.White 362, 470

spp. 638

Licuala ramsayi (F.Muell,.) Domin 333

Lipptz, David J. with Forster, Paul I, Taxonomic studies on

the genus Hoya R.Br, (Asclepiadaceae: Marsdenieae) in

Papuasia, 6 51

LIpDLE, David J. with Forster, Paul I, Resurrection of

Dischidia littoralis Schitr.(Asclepiadaceae) 113

Lippe, David J. with LIppLE, Iris M. & Forster, Paul I.

Taxonomic studies on the genus Hoya R.Br.

(Asclepiadaceae: Marsdenieae) in Papuasia, 7 401

Ligustrum sinense Lour, 363, 364

Liliaceae 3, 391

Liliiflorae 1, 2,3, 4,6

Lingelsheimia Pax 477

Livistona inerinis 350

Loasiflorae 1, 2, 3

Longetia Baill. ex Muell.Arg. 331, 329, 332, 333, 619

buxoides 619

malayana (Benth.} Pax & K.Hoffm. 626

nitida (Miq.) Steenis 626

swainti Beuzev. & C.T.White 619, 620

Lophostemon Schott 337

confertus (R.Br.) Peter G. Wilson & J.T.Waterh. 168,

358, 360, 628, 636

suaveolens Peter G. Wilson & J.T.Water 360, 366

suballiance 337

Lorema 227, 229

amethystina O.F.Cook 229, 233

cunninghamiana (H.Wendil.) O.F.Cook 242

Loudetia 369

Luzuriaga montana 39]

Luzuriagaceae 391

Lysicarpus 467

aneustifolius (Hook.) Druce 275, 277

Mackeea H.E.Moore 228

Macropteranthes 149, 152

fitzalanii P.Muell. 151, 152

kekwickii F.Muell. ex Benth, 152

leichhardtii F.sMuell. ex Benth, 152

leiocaulis P.E.Forst, 149, 7/50, 151, 152

montana (F.Muell.) F.Muell. ex Benth. 152

Macrozamia 269

conferta D.L.Jones & P.LForst. 269, 271, 272, 273,

285, 286

cranei D.L.Jones & P.I.Forst. 269, 273, 274, 278, 279,

285, 287, 288

crassifolia P.[.Forst. & D.L.Jones 269, 270, 275, 276,

283, 288

fearnsidei D.L.Jones 269, 285

lomandroides D.L.Jones 285

machinii P.I.Forst. & D.L.Jones 269, 270, 276, 277,

278, 285, 286, 287, 288

miquelii (F.Muell.) A. DC 270

occidua D.L.Jones & P...Forst. 269, 270, 274, 278,

279, 280, 285

parcifolia P.L.Forst. & D.L.Jones 270, 279, 281, 282,

283, 288

pauli-guilielmi W Hill & F.Muell. 269, 270, 271, 275,

279, 281, 283

platyrachis F.M,Bailey 270, 283

Plurinervia (L.A.S.Johnson) D.L.Jones 269, 270, 273,

274, 276, 277, 281, 283

section Parazamia (Miq.) Mig. 269

section Macrozainia 270

viridis D.L.Jones & P.I.Forst. 269, 270, 281, 283, 284,

283

sp. 271, 273, 275, 277, 279, 281

Magnoliales 604

Magnoliidae 604

Magnoliiflorae 2, 4, 6

Magnoliophyta 131

Malvaceae 3, 125, 439

Malviflorae 1, 2,3, 4, 5,6

Marsdenieae 51, 401

Melaleuca 122

citrolens Barlow 122

decora (Salisb.) Britten. 463

leucadendra (L.) L. 122, 610

linaritfolia Sm. 364, 374, 375

quinquenervia (Cav.) S.T.Blake 235, 469

saligna Schauer 122

stenostachya S.T.Blake 122, 124

tamariscina Hook. 464, 636

thymifolia Sm. 364, 460, 638

uncinata R.Br. 388, 637

virgata (J,.R.Forst. & G.Forst.) L.f. 634

viridiflora Sol, ex Gaertn. 122, 125, 420, 548, 610

wilsonti F.Muell, 637

spp. 123, 467

Melichrus erubescens Cunn, ex DC, 692

urceolatus R.Br. 272, 279, 471

Melinis P.Beauv. 369, 374

Melodinus 18

Metrosideros 337

glomulifera Sm. 337, 338

var. elabra (Benth.) C.Moore & Betche 339

procera Salisb. 342

section Sarcynpia Baill. 338

section Kamptzia (Nees) Baill. 338

vera Roxb. 343

Micractis DC 88

Micraira subulifolia F.Muell, 358

spp. 648

Micrantheum ericoides Desf. 692

Micromyrtus Benth. 455, 456, 642

albicans 455, 456, 457, 463, 465, 466, 472

blakelyi 456

capricornia A.R.Bean 455, 456, 457, 461, 464, 465,

470

carinata A.R.Bean 455, 456, 457, 463, 464, 465, 466,

467, 468

ciliata (Sm.) Druce. 456, 473, 637

delicata A.R.Bean 455, 456, 457, 458, 459, 460, 461,

473, 476

¢lobata (F.Muell.) Benth. 467

fimbrisepala J.W.Green 455, 456, 473

forster] A.R.Bean 455, 456, 457, 471, 472, 473, 474

gracilis A.R.Bean 455, 456, 457, 465, 466, 467, 468,

469

heimsti 456

hexamera (Maiden & Betche) Maiden & Betche 455,

456, 457, 461, 473, 475

hymenonema (F.Muell.) C.A.Gardner 455, 456, 473

leptocalyx (PF.Muell.) Benth. 455, 456, 457, 459, 460,

462, 463, 472

littoralis A.R.Bean 455, 456, 457, 464, 467, 469, 470,

472, 474

patula A. R.Bean 455, 456, 457, 458, 459, 460, 468,

476

rotundifolia A.R.Bean 455, 456, 457, 459, 460, 461,

462

sessilis ]. W.Green 455, 456, 457, 461, 470, 471

striata J.W.Green 455, 456, 457, 471, 472

vernicosa A.R.Bean 455, 456, 457, 462, 464, 468,

469, 470, 474

sp. 462

Microsorum membranifolium (R.Br.) Ching 449.

MILLs, Stephanie with AsLetr, Effie M. & PLAyForD, Julia,

The use of rubisco DNA sequences to examine the

systematic position of Hernandia albiflora (C.R. White)

Kubitzi (Hernandiaceae), and relationships among the

Laurales 601

Mirbelia

confertiflora Pedley 691

spectosa DC, 462

Mitrasacme geniculosa Dunlop 650

Monimiaceae 601, 603, 605

Monotaxus macroplylla Benth. 692

Moraceae 119

Muehlenbeckia costata K.L.Wilson & Makinson 691, 692

Muntingia 75

Myrsinaceae 692

Myrtaceae 3, 122, 124,152, 187, 205, 353, 337, 387, 627,

628, 647, 693

Myrtella retusa (Endl.) A.J.Scott. 473

Myrtifiorae 1, 2,3, 4, 5,6

Narnia

glomulifera (Sm.) Kuntze 338

section Syncarpia (Ten.) Kuntze 338

Netsosperma 13, 14, 15, 19

kilnert (F.Mueil.) Fosberg & Sachet 13, 14, 15,-16, 17,

18, 20

muricata Raf, 13, 14

oppositifolia CLam.) Fosberg & Sachet 14

poweri (F.M.Batley) Fosberg & Sachet 13, 14, 15, J6,

17, 18, 20

spp. 20

Nevpner, V.J. The distribution and habitats of three

presumed rare species from Cape York Peninsula 121

Neofabricia

mjoebergii (Cheel) Joy Thomps, 122, 123, 124, 127

myrtifolia (Gaertn.) Joy Thomps. 125, 126

sericisepala J.Clarkson & Joy Thomps. 124, 125, 127

sp, 124

Neogsuillauminia Croiz. 417

Nerium 18

Nervilia Comm, ex Gaudich. 195

aragoana Gaudich, 197, 198

crociformis (Zoli. et Moritzi) Seidenf. 195, 197, 198

holochila (F.Muell.) Schltr. 197, 198

peltata B.Gray & D.L.Jones 195, 196, 197, 198

plicata (Andrews) Schitr, 197, 198

unifiora (F.Mueli.) Schltr. 197, 198

Nettoa crezophorifolia Baill, 298

Notelaea sp. A 693

Nothofagus 70, 247

Nymphaeiflorae 2, 4

Ochrosia 13, 14, 15, 19

elliptica Labill. 15

kiineri F. Muell. 13, 15, 17

mcdowalliana F.M.Bailey 14, 15

minima (Marker.) Fosberg & Boiteau 15, 18

moore? (F.Muell.) F.Muell. ex Benth. 15

newelliana F.M.Batley 14, 17

power! F.M.Bailey 13, 17

Ochrosperma Trudgen 353, 354, 355, 387, 627, 630, 647,

650

adpressum A.R.Bean 387, 385, 390, 651

citriodorum (A.R.Penfold & J.H.Willis}) 389, 390, 651

lineare (C.T, White) Trudgen 387, 388, 389, 390, 651

monticola Trudgen 387, 389

oligomerum (Radik.) A.R.Bean 387, 389, 390, 651

sulcatum A.R.Bean 647, 648, 649, 650, 651

Olearia elliptica DC, 693 |

microphylla (Vent.) Maiden & Betche 279

Omphalea 381

celata P.I.Forst, 381, 382, 383, 384

papuana Pax & K.Hoffm, 381, 384

queenslandiae F.M.Batley 381, 384

Orchidaceae 3, 95, 195

Oxymnyrrhine Schauer 627, 630

gracilis Schauer, 630

Oxypetalum R.Br. coeruleum (D.Don) Decne. in DC. 289

Paniceae 369

Panicum 369, 370

Parinari nonda F.Muell. ex Benth. [22

Parsonsia 14, 18

Pavetia 21, 22, 23,29

australiensis Bremek. 21, 22, 23, 24, 26, 27, 28, 29,

var. australiensis 27, 28, 38

yar. pubigera §.T.Reynolds 21, 28 29

brownii Bremek, 21, 22, 24, 25, 26, 29, 33, 34, 35, 38,

var. brownti 21, 32, 37, 38, 39

var. glabra Bremek. 21, 37, 38, 39

var. glabrata S.T. Reynolds 21, 38, 39

var. pubescens Bremek. 21, 37, 38, 39

auct. non Bremek. Koeh in Wheeler 33

conferta S.T.Reynolds 21, 25, 44

granitica Bremek. 21, 22, 24, 28, 29, 30, 36

indica L. 21, 22

auct. non L. 26

var. obovata Domin 37

var. stenophylla Domin 29, 30

var. tomentosa 34

var. tomentosa auct. non (Roxb.) J.D.Hook, 29, 33

var. fypica nom. inval. 26

insuiana Bremek. 21, 22, 37, 38, 39

kimberileyana S.T.Reynolds 21, 25, 26, 33, 34

modesta Bremek, 21, 22, 29, 30

mollis 37

moluccana Bremek. 22

mueller? Bremek. 21, 22, 25, 30, 31, 32, 33, 34

opulina (I,R.Forst.) DC 22, 28

platyclada Laut. et K.Schum, 22, 28, 29

var. puberula Valeton 28

rupicola S.T.Reynolds 21, 24, 30, 40

section Pavettaster 23

series Austro-orientales Bremek. 23

speciosa S.T.Reynoids 21, 26, 42, 43

subgenus eupavetta 23

tenella S.T.Reynolds 21, 22, 25, 26, 36

fenuipila C, DC, 103

fomentosa 21

fomentosa auct. non Roxb, ex Smith: F.Muell. 35, 37

tomentosa auct. non Roxb. ex Smith: Bailey 29

tribe Pavetteae Dumort 23

vaga S.T.Reynolds 21, 25, 45

valetoni? Bremek. 28, 29

sp. 242

Peb_ey, L. Sigesbeckia fubax and Tetramolopium vagans,

new Asteraceae from Queensland 87

Pepcey, L. reviewer: Acacias of South Australia, Second

Edition revised by D.E. Symon 135

Pennisetum clandestinum Hochst. ex Chiov. 260

Peperomia 93, 94, 95, 103

affinis Domin 93, 99, 101

arabica

var. floribunda Miq. 97

baueriana

var. brisbaniana C. DC 97

bellendenkerensis Domin. 93, 94, 95, 96, 449

blanda (Jacq.) Kunth 97

var. floribunda (Miq.) H.Huber 93, 94, 97, 98, 99,

100, 174

var. leptostachya (Hook., & Arn.) Dill 97

. dindygulensis Mig. 97

eneryis C. DC, & F.Muell. 93, 94, 101, 102, 103, 449

humilis A.Dietr, 97

johnsonii C. DC 101, 103

leptostachya

var. leptostachya Miq. 97

leptostachya Hook.. & Arn 93, 97

var. laxiflora Miq. 97, 99

leptostachya (Nutt.) Chapman 97

pellucida (L.) Kunth, 93, 94, 95, 97

reflexa Knuth 99

reflexa (L.£.) A.Dietr. 93, 99

secunda Ruiz & Pav. 94

fetraphylla 93, 94, 95, 98, 99, 101, 702, 103

urvilleana A.Rich, 93

Peperomiaceae 93

Periplocoideae 67

Persea 604, 606

antericana Mill. 603, 605

Persoonia sericea A.Cunn. ex R.Br, 279

subtilis PH.Weston & L.A.S Johnson 360

fenuifolia R.Br. 283

Petalostigma pubescens Domin 122

Philesia 391

Philesiaceae 391

Philotheca sp, 634

Phyliantheae 661, 662

Phyllanthera 67, 68, 69

bifida Blume 67, 68, 69

perakensis Gamble 67, 70, 72

Phyllanthus L. 661 .

fuernrohrti F.Muell. 662

Piliostigina matabaricium (Roxb.) Benth. 105, 107

Piper 94

pellucidum L, 95

reflexa Lf, 99

fetraphyllum G.Forst. 99, 101

Piperaceae 93, 449

Pityrodia 600

spp. 648

Platysace ericoides (Sieber ex Spreng.) C. Norman 283

PLAYFORD, Julia with MILLs, Stephanie & ABLETT, Effie M..,.

The use of rubisco DNA sequences to examine the

systematic position of Hernandia albiflora (C.R. White)

Kubitzi (Hernandiaceae), and relationships among the

Laurales 601 Plectrachne 600

pungens (R.Br.) C.E.Hubb. 598

Plectranthus L’ Herit. 159, 160, 163, £66, 168, 170, 175,

181, 184, 653, 654

actites P.LForst. 159, 160, 162, 163, /64, 165

alloplectus S.T.Blake 160, 161

amboinicus (Lour.) Spreng. 161

amicorum S.T.Blake 160, 161, 175, 658

amoenus 653, 656, 657, 658, 659

apreptus S.T.Blake 160, 162, 168, 170, 184, 656

apricus P.].Forst. 159, 160, 162, 165, 166, 167, 168

arenicola P.I.Forst. 159, 162, 182, 184

argentatus S.T.Blake 160, 161, 653

blakei P.1.Forst. 159, 160, 162

congestus Benth. 160, 162, 168, 170

cyanophyllus P.].Forst. 159, 162, 166, 168, 769

diversus S.T.Blake 160, 161, 165, 172, 174

dumicola P.I.Forst. 159, 160, 162, 168, 170, /7/, 656

excelsus P.].Forst. 159, 160, 161, 165, 172, £73, 174

foetidus R.Br. 160, 161

slabriflorus P.1.Forst. 159, 160, 162, 174, 175, 176,

658, 659

graniticola P.L.Forst. 159, 160, 161

gratus S.T.Blake 160, 162, 165, 166, 181, 182

graveolens R.Br. 160, 161, 165, 168, 179, 653, 658,

659

habrophyllus P.I.Forst. 159, 160, 162,175, 177, 778

leiperi P.[.Forst. 159, 160, 161, 177, 179, 780, 181

megadontus P.j.Forst. 159, 160, 162, 181, 182, 783

minutus P.i.Forst. 159, 160, 162

mirus S.T.Blake 160, 16!

nitidus P.T.Forst. 159, 160, 162

omissus PJ.Forst. 159, 160, 161

parviflorus Willd. 160, 162, 166, 174, 175, 177,, 653

pulchellus P.I.Forst. 159, 160, 162, 182, 184, /85,

656

scutellarioides (L.) R.Br 159, 160

spectabilis S.T.Blake 160, 162

suaveolens S.T.Blake 160, 162, 175, 177, 179, 653

thalassoscopicus 653, 654, 655, 656, 659,

torrenticola P.I.Forst. 159, 160, 161, 659

sp, 179

Pleiogynium timorense (DC.) Leenh, 242

Poaceae 3, 57, 131, 369

Podocarpaceae 603

Podocarpus 604, 606

gracilior Pilg. 602, 603

Podolepis arachnoidea (Hook.) Druce 279

Podostemiflorae 2, 3, 4

Polycarpaea spirostylis F.Muell. 674

Polygoniflorae 2, 3, 4

Primuliflorae 2, 4

Propa 499

Prostanthera 467

staurophylla F.Muell. 692

Proteaceae 3

Proteiflorae 2, 3, 4, 5,6

Pseudanthus

divaricatissimus Benth. 691

ovalifolius F.Muell. 691

Pseudoraphis paradoxa 374

Psychotria daphnoides A.Cunn. 281

Pterocoellion javanicum Turez, 79

Ptychosperma

alexandrae F.Muell. 231, 233

beatriceae F,Muell. 232

cunninghamianum H.Wendi, 233, 235

elegans (R.Br.) Blume 235, 242

veitchii H.Wendl, 232

Putranjiva Wallich. 477

Ouintinia

sieberi A, DC, 693

verdonit F.Muell. 324

sp. 242

Racosperma 135

Ranunculiflorae 2, 4

Rapanea howittiana Mez 692

Rauvolfia 19

Reynaudia Kunth 369

REYNOLDs, S.T, The genus Pavetta L, (Rubiaceae) in

Australia 21

Rhamnaceae 411

Rhodomyrius trineura (P.Muell,) Benth.

subsp. trineura 674

Rhopalostylis H.Wendl, & Drude 228

Rhynchelytrum Nees 369

Ricinocarpus

capillipes (Mueli.Arg.) Kuntze 212

cunninghamii (Muell.Arg.) Kuntze 219

eremorum (Muell.Arg.) Kuntze 214

nemorum (F.Muell. ex Muell.Arg.) Kuntze 219

Rinzia Schauer 353, 650

Rosaceae 321, 677

Rosiflorae 2, 4

Rottboellia cochinchinensis 107

Rubiaceae 3, 117

Rubus 321

australis G.Forst. 324, 327

boormanti Gand. 686

chrysogaeus P.Royen 680, 685

commersonti Poir 682

eglanteria Tratt. 681

ellipticus Sm, 677, 678, 680, 685, 686

flavus 686

fraxinifolius Potr. 677, 678, 679

idaeus L. 677, 678

macropodus Ser. in DC, 686, 688

moluccanus 688 ,

moore? F.Muell. 321, 322, 323, 324, 325

var. leichhardtianus Domin 322

var. moore? Domin 322

var. tryonti Shirley 322, 324

var. typica Domin 322

forma elabra C.T. White 321, 325

forma moorei 322

forma sericea C.T.White 322

muelleri F.M.Batley 677, 678, 680

nebulosus A.R.Bean 321, 322, 323, 324, 325, 327

novoguineensis Merr, & Perry 324

parvifolius L. 677, 678, 686, 687, 688

Phoenicolasius Maxim 677, 678

probus L.H.Batley 677, 678, 679, 680, 685

queensiandicus A.R.Bean 677, 678, 683, 684, 685,

686

rosifolius Sm 677, 678, 679, 680, 681, 685

var. commersonti (Poir.) Tirveng. 677, 678, 682, 683

var. eglandulosus 680

var. rosifolius 677, 678, 681, 682, 683

royenii Kalkman

var. royentt 321, 327

section Micranthobatus Fritsch 322

section /daegobatus Focke 678

sasonianus Gand, 686

subgenus Micranthobatus (Fritsch) Kaikman 321, 322

subgenus Dalibarda (L.) Focke 321

subgenus Malachobatus (Focke) Focke 321, 688

subgenus Idaeobatus (Focke) Focke 321, 677, 678,

688

tasmmanicus Gand, 686

walferianus Gand. 687

zahibrucknerianus Endl. 686

sp. A 325

Rulingia 467

Rutaceae 3, 152, 693

Rutidosis 199

crispata A.E.Holland 199, 200, 203

helichrysoides DC. 203

lanata A.E.Holland 199, 200, 202, 203

leucantha F.Muell. 199, 200, 201, 203

leucantha auct. non F.Muell. 201

murchisontt F.Mueli, 203

Rutiflorae 2,3, 4, 6

Ne)

Sankowskya P.[.Forst. 329, 331, 332, 619, 621

stipularis P.J.Forst. 329, 330, 331, 333, 334

Santaliflorae 2, 4

Sapindaceae 3

Sarcolobus 129 :

secamonoides (Schltr.) P.Forster 130

vitfatus P.Forster 130

Sarcastemma 418

Sauropus Blume 661, 662, 666, 670

androgynus (L.) Merr. 664

anemonifiorus J.T.Hunter & I.J.Bruhl 661, 662. 663,

664, 671

aphylius J.T.Hunter & J.J.Bruhi, 661, 664, 665, 666,

670

convallarioides J.T.Hunter & J.J.Bruhl 661, 666,

667, 671

decrescentifolia J.T. Hunter & J.J.Bruhl 661, 668, 669,

670

elachophylius (Benth.) Airy Shaw 668, 670

hirtellus 670

micranthus 670

podenzanae 671

ramosissimus 666, 671

rigens 671

frachyspermus 671

Schizachyrium Nees 444

spp. 122

“Schleffera” spp. 174

Scholtzia Schauer 650

Schoutenia 76

Scorpia simplicifolia Ewart & A.H.K.Petrie 298

Scrophulariaceae 3 :

Seaforthia

cunninghamii sensu P.M.Bailey 242

elegans sensu Hook.. 233

elegans R.Br. 235

nobilis sensu J, Lhotsky 242

Sibangea Oliver 477

SIEPEN, Greg reviewer: Ground Rules, Perspectives on Land

Stewardship by Brian Roberts 293

Sigesbeckia 87

australiensis D. Schulz 87, 88, 89

fugax Pedley 87, 88, 89

microcephala DC. 88

orientalis L. 87, 88. &9

section Sigesbeckia 87, 88

subtribe Melampodiinae 88

SIMON, Bryan K. Studies in Australian grasses, 7. Four new

species of Sporobolus R.Br. (Poaceae, Chloridoideae,

Sporoboleae) from Australia 57

SIMON, Bryan K. Studies in Australian grasses 8. A new

species of Thelepogon (Andropogoneae: Ischaeminae)

for Australia 105

SIMON, Bryan K. Studies in Australian Grasses 9, Two new

species of Aristida (Arundineae: Aristideae) from

Queensiand 145

SIMON, Bryan K., reviewer: Western Grasses: a Grazier’s

Guide to the Grasses of South West Queensland by B.R.

Roberts ef al, 292

SIMON, Bryan K. & WEeILLer, Carolyn M. Fasciculochioa, a

new grass genus (Poaceae: Paniceae) from south-eastern

Queensiand 369

SLEE, A.V. with BRooxer, M.I.H. A new species of red gum

(Eucalyptus subser, Phaeoxyla Blakely) from central and

southern Queensland 265

Saulax 391

Solanaceae 3, 429

Solanifiorae 2,3, 4

Solanum 429

campanilatum 437

cinereum 437

coracinum D.E.Symon 429, 430, 431, 433

densevestitum F. Muell, 435

dioicum 429

dissectum D.E.Symon 429, 431, 432, 432, 433

ferocissimum 429, 433

glomulifera (Sm.) Nied. 338

subsp. glabra (Benth.) A.R.Bean 337, 340

subsp. glomulifera 337, 340, 341, 342

gympiense D.E.Symon 429, 433, 434, 435

incanum 429

melongena 429

nemophilunt 435

pugiunculiferum 433

semtarmatum 431

stupefactum D.E.Symon 429, 435, 436, 437

subgenus Leptostemonum 429

sp.4 437

sp. 431, 433, 437

sp. 3 431, 433

sp. Q2 435

Salenostemon 160

Sorghum laxiflorum F.M Bailey 107

Sorghum sp, 222

Spermacoce 117

gilliesiae (Specht) J, Clarkson comb. nov. 117

omissa J. Clarkson 117

suffruticosa R.Br, ex Benth. 117

suffruticosa Loefl, 117

suffruticosa Sprengel 117

suffruticosa Hill 117

Spiranthera ovata 391

Sporoboleae 57

Sporobolus 57, 61, 64

actinocladus Domin 64

blakei De Nardi ex B.K.Simon 57, 58, 59, 66

disjunctus R.Mills ex B.K.Simon 57, 59, 60, 61, 66

élongatus R.Br. 59

indicus (L.) R.Br. 61

mutchellii (Trin.) C.E.Hubb. ex S.T Blake 61

myrianthus Benth. 64

pamelae B.K.Simon 57, 61, 62, 64, 65, 66,155, 157

partimpatens R.Mills ex B.K.Simon 57, 63, 64, 65,

subtilis Kunth 61

subtribe Sporobolinae 61

THOMPSON, KE, John with HouLanp, Ailsa E. Eryngium

fontanum A.E. Holland & E.J. Thompson, (Apiaceae), a

new species from central Queensland 155

Thryptomene Endl. 354, 455, 647

hexamera Maiden & Betche 473

leptocalyx (F.Muell.) F.Mueil, 462

oligandra F.Muell. 122, 123, 124

parviflora (F.Muell. ex Benth.) Domin 267, 598

remota A.R.Bean 647, 648, 649

section Astraea Stapf 648

Tiltaceae 75, 297, 495

Trachymene montana A.E.Holland 598

tribe Sporoboleae 61

Stenocarpus sinuatus Endl 324

Stomatostemma monteiroae (Oliver) N.E.Br. 68

Streptomanes nymanii K.Schum, 68, 72.

Strlidium graminifolium Sw. 283

SWARBRICK, John T. with WEARING, Alan H., WEBBER, Julie

H, & Jounston, Margaret E. A new subspecies of Caustis

blake? Kuk. in Queensland 613

SYMON, David E. Four new species of Solanum L.

(Solanaceae) from south east Queensland 429

symplocaceae 7

Symplocos 7

Jesedenee no Wieden dabdeee die on Leese read dA iiv ed uisicuserewac susie? ncveneesdi , y P . a Btls oy pA S BA ee

a ee Se SS St ee Se So a EE

eo betes Seniesa em ss ney Siem teecen

baeuerlenti R.T.Baker 7,9 Trewia

cochinchinensis CLour.) S.Moore 7

subsp. thwaitesti

var. montana 7

cyanocarpa C.T. White 9, 11

graniticola Jessup 7, 9, /0

harrolditi Jessup 7, 8, 9

sp. Mt Lewis 9

sp. Bahrs Scrub sp. Q3 (aff. baeuerlenii-Bahrs Scrub)

sp. 1 7

sp. nov,?, Nooteboom 9

Syncarpta 337, 338

glomulifera (Sm.) Nied. 357, 337, 338, 658

subsp. glabra (Benth.) A.R.Bean 337, 339

subsp. glomulifera 339, 340

hillii F.M.Batley 337, 338, 341, 342

laurifolia Ten. 337, 338, 339, 343

var. glabra Benth. 339

leptopetala F.Muell. 343

procera (Salisb,) Domin 342

var. glabra (Benth.} Domin 339

subargentea C.T.White 343

var. latifolia C.T.White 343

verecunda A.R.Bean 337, 338, 340, 341, 343

vertholenii Teijsm. & Binn. 343

sp. (Ravensbourne J.A.Gresty 2053) 340

Synostemon F.Muell. 661

Syzyerun

argyropedicum B,Hyland 489

eucalyptoides 122, 123

labernaemontana 1&8

Tarenna Gaertner 23

Tetrameles nudiflora 174

Tetramolopium 92

bicolor Koster 92

humile (A.Gray) Hilleb. 92

kKlosstt 92

section Alpinum Lowrey 87, 91, 92

yagans Pedley 87, 90, 9/, 92

Tetrapora Schauer 627, 630

preissiana Schauer 630

Thaumastochloa spp. 122

Theiflorae 2, 4

Thelepogon 105, 107

australiensis B.K,Simon 105, 706, 107

elegans Roth 105, 107

Thellungia 61

Themeda arguens (L.) Hack. 107

THIELE, K.R. & West, J.G. Gouania exilis (Rhamnaceae), a

new species from northern Australia and Papua New

Guinea, with notes on the identity of Gouania hillii

F.Muell, 411

THompson, E.John with Forster, Paul |. Borya inopinata

(Anthericaceae), a new species of resurrection plant from

north Queensland 597

insignis Steud. 139

macrophylla Blume 139

Trichospermum pleiostigma (F.Muell.) Kosterm. 75, 79,

81,82, 85

Triodia 147

longiceps J.M.Black 64

microstachya R.Br, 648

mitchellii Benth. 267

sp, 422, 475, 562, 600

Triplarina 354, 355, 359, 362, 630

bancroftii A.R.Bean 353, 356, 358, 360, 361, 365

calophylla A.R.Bean 353, 356, 357, 358, 361, 363,

365

camphorata (R.Br. ex Sims) Raf. 356, 362

imbricata (Sm.) A.R.Bean 353, 356, 358, 359, 360,

362, 363, 364

nitchaga A.R.Bean 353, 356, 357, 360, 365, 366

nowraensis A.R.Bean 353, 356, 359, 363, 364, 366

paludosa A.R.Bean 353, 354, 356, 357, 358, 360, 365

voleanica A.R.Bean 353, 357, 361

subsp. borealis A.R.Bean 353, 356, 362

subsp. voleanica 356, 359, 362

sp, 366

Tristania albens DC, 337, 339

Tristaniopsis laurina (Sm.) Peter G.Wilson & J,T.Waterh.

363

Triunifetta L. 73, 495, 499, 500, 515

albida (Domin) Halford 497, 505, 506, 537, 539, 544,

572, 586

antrorsa Halford 498, 499, 505, 548, 547, 549, 579,

587

appendiculata F.Muell. 495, 496, 502, 503, 523, 525,

526, 548, 551, 554, 555, 556, 557, 570, 581

aquila Halford 498, 506, 561, 562, 580, 586

arnhemica Halford 496, 499, 505, 548, 549, 579, 586

aspera Halford 504, 516, 517, 569, 582 :

australis Endl. 647

baeckeacea F.Muell. 648

bartramia

var. clementit Domin 532.

bradshawti F.Muell. 495, 496, 497, 498, 506, 563,

564, 565, 566, 579, 587

breviaculeata Halford 495, 497, 499, 506, 550, 551,

554, 555, 577, 585

carteri Halford 499, 505, 540, 541, 542, 576, 584

centralis Halford 497, 506, 543, 544, 576, 586

Chaetocarpa F, Muell. 495, 496, 502, 525, 526, 527,

571, 581

cinerea Halford 503, 535, 536, 576, 584

Cladara Halford 496, 506, 563, 564, 566, 579, 585

clementii (Domin) Rye 497, 504, 530, 532, 533, 576,

584

clivorum Halford 499, 505, 507, 545, 546

subsp. brevipetala Halford 546, 547, 551, 586

subsp. clivorum 546, 547, 576, 586

coronata Halford 498, 499, 502, 511, 512, 568, 582

denticulata R.Br. ex Benth. 495, 498, 499, 501, 503,

505, 506, 560, 561, 562, 580, 585

deserticola Halford 496, 497, 504, 505, 506, 526, 527,

$71, 583

echinata Halford 498, 502, 528, §27, 529, 57], 582

eriophlebia Hook f, 531

fissurata Halford 498, 503, 536, 537, 572, 584

glaucescens R.Br. ex Benth. 495, 505, 536, 537, 539,

576, 584

hapala 497, 498, 499, SOI, 568, 581

hookeri (Domin) A.E.Holland 598

incana Halford 499, 504, 507, 538, 539, 572, 586

inermis Halford 498, 505, 559, 580, 585

johnstonii F. Mueli. 503, 504, 515, 516, 517, 519, 570,

582

kenneallyi Halford 497, 504, 530, 531, 532, 572, 584

lappula L. 500

leptacantha F. Muell. 496, 501, 528, 529, 57/, 583

litticola Halford 502, 503, 516, 518, 519, 569, 582

longipedunculata Halford 496, 497, 506, 562, 563,

564, 566, 579, 583

maconochieana Halford 502, 533, 534, 572, 584

macropetala F.Mueil. 297, 316

marsupiata Halford 497, 498, 501, 516, 519, 520, 575,

583

mellina Halford 505, 555, 556, 558, 577, 585

micracantha F.Muell. 495, 497, 507, 530, 540, 541,

542, 543, 544, 545, 546,575, 586

var, albida Domin 495

mitchellii Halford 497, 498, 503, 540, 541, 574, 584

monstrosa Halford 499, 503, 515, 579, 582

nigricans F.M. Bailey 507

nutans Halford 497, 499, 505, 549, 550, 3578, 586

oenpelliensis Halford 505, 559, 560, 580, 585

pannosa R.Br. ex Halford 496, 506, 556, 557, 558,

577, 585

parviflora Benth. 495, 498, 504, 534, 535, 572, 384

pentandra A, Rich. 496, 498, 499, 504, 508, S09, 569,

581

pilosa Roth 496, 498, 499, 502, 507, 508, 568, 581

plumigera F.Muell. 495, 496, 498, 499, 502, 509, 534,

568, 581

procumbens G.Forst. 495, 496, 497, 499, 512, 513,

~—s«- $514, $68, 581

propinqua Halford 495, 502, 522, 524, 525, 577. 581

prostrata Halford 496, 503, 516, 517, 518, 573, 582

pustulata Halford 496, 498, 506, 559, 563, 564, 565,

566, 578, 587

ramosa Sprague & Hutch. 496, 498, 499, 502, 521,

522, 523, 571, 582

reflexa W.Fitzg. 497, 499, 503, 514, 515, 569, 583

repens (Blume) Merr. & Rolfe 496, 497, 499, SQ],

§13, 514, 568, 582

rhomboidea Jacq. 496, 498, 499, 504, 508, 509, 532,

569, 581

rubiginosa Halford 504, 530, 531, 532, 572, 573, 583

rupestris Halford 506, 558, 577, 585

ryeae Halford 495, 496, 498, 504, 506, 550, 551, 553,

555, 577

subsp. brevipetala Halford 551, 552, 553, 585

subsp. hirsuta Halford 551, 552, 553, 585

subsp. ryeae 551, 558, 585

saceata Halford 497, 501, 516, 519, 520, 521, 569, 582

section Lasiothrix 499

section Lepidocalyx 499

section Lappula 499

section Propa 499

simulans Halford 495, 505, 551, 553, 554, 555. 577,

583

stenophylla E.Pritzel 648

subpalmata Sol. ex Hemsl. 513

suffruticosa Blume 507

suffruticosa auct. non Blume 507

sylvicola Halford 504, 529, 530, 572, 583

tenuiseta Halford 498, 499, 502, 522, 523, 528, 577,

581

triandra Sprague & Hutch., 495, 511, 498, 499, 502,

511, 512, 568, 581

trisecta Halford 497, 503, 541, 574, 582

velutina Vahl, 508, 509

viridis Halford 505, 544, 545, 559, 576, 584

winneckeana F.Mueli. 502, 528, $29, 57/7, 583

sp. 508, 511, 515

Triuridiflorae 2, 4

Tweedia 289

coerulea D, Don 289

versicolor Hook. 289

Tylophora rupicola P.I.Forst. 175, 659

Urostigma leichhardtti Mig. 119

Valvanthera albiflora (C.T. White), 601, 603

Verbenaceae 3

Villebrunnea sp. 251

Vinca 19

Violiflorae 2,3, 4

Voacanga 19

WwW

Wearinc, Alan H, with Wesper, Julie H., JonnstTon,

Margaret E. & Swarsrick, John T, A new subspecies of

Caustis blakei Kuk. in Queensland 613

Wesser, Julie H. with Jounston, Margaret E., SwARBRICK,

John T, & Wearinc, Alan H. A new subspecies of

Caustis blakei Kuk. in Queensland 613

Welchiodendron Peter G. Wilson & J.T.Waterh, 337, 442

Wetria 139, 140

australiensis P.I.Forst. 139, 140, 141, 742, 143

insignis (Blume) Airy Shaw 139, 140, 141

subtribe Cleidiinae 139

trewioides Baill. nom. illeg. 139

tribe Acalypheae 139

WEILLER, Carolyn M. with Simon, Bryan K. Fasciculochloa,

anew grass genus (Poaceae: Paniceae) from south-

eastern Queensland 369

West, J.G. with Totete, K.R. Gouania exilis (Rhamnaceae),

anew species from northern Australia and Papua New

Guinea, with notes on the identity of Gouania hillti

F.Muell. 411

Whyanbeelia Airy Shaw & B.Hyland 331, 332, 619

WItson, F.D, & CrAvEN, L.A. Two new species of Hibiscus

section Furcaria DC.(Malvaceae) from Northern

Queensland 439

Wrightia 18, 109

laevis

subsp. millgar (F.M.Bailey) Ngan 110

pubescens R.Br. 109, 110

subsp. penicillata (Batley) Nean 109

saligena (R.Br.) F.Muell. ex Benth. 110

versicolor S.T.Blake 109, L1O, 772

Xanthorrhoea johnsonii A.T.Lee 267, 458

Xanthostemon youngii C.T.White & W.D.Francis 489

Zamia 2069

Zamiaceae 269

Zamiaceae section Parazamia 269

Zieria sp. P 693

Zingiberiflorae 2, 4, 6

a a ASL A Pate LT v 1 BI SS SS ee er Pe bd ee Od ee 4

a tee ee le ee ee eee 2 ESL SPT ye ah Sw wen Se Perr See ee TO

Queensland Herbarium

Publications for sale

Floras

A Key to Australian Grasses by B.K. Simon (1990), 150pp., card cover,

Ferns of Queensland by S.B. Andrews (1990), 427pp., illustrated, hard cover.

Honey Flora of Queensland, 3rd edition by S.T. Blake and C. Roff (1988), 224 pp., illustrated,

card cover.

Acacias in Queensland by L. Pedley (1988), 275 pp., illustrated, card cover.

Keys to Cyperaceae, Restionaceae and Juncaceae of Queensland. Botany Bulletin No. 5 by P.R.

Sharpe (1986), 47pp., illustrated, card cover.

Flora of South-eastern Queensland by T.D. Stanley and E.M. Ross.

Volume 1 (1983), 545 pp., illustrated, hard cover.

Volume 2 (1986), 623 pp., illustrated, hard cover,

Volume 3 (1989), 532 pp., illustrated, hard cover.

The Flora of Lamington National Park, 3rd edition by W.J.F. McDonald and M.B. Thomas

(1989), 25 pp., card cover.

Vegetation Surveys

Vegetation Survey of Queensland: South West Queensland. Queensland Botany Bulletin No. 4

by D.E. Boyland (1984), 151 pp., illustrated, including a map, card cover.

Vegetation Survey of Queensland: South Central Queensland. Queensland Botany Bulletin

No. 3 by V.J. Neldner (1984), 291 pp., illustrated, including a map, card cover.

Vegetation Survey of Queensland: Central Western Queensland. Queensland Botany Bulletin

No. 9 by V.J. Neldner (1991), 230 pp., illustrated, including a map, card cover.

Vascular Plants of Western Queensland. Queensland Botany Bulletin No. 11 by V.J. Neldner

(1992), 176 pp., illustrated, card cover.

Vegetation of the Sunshine Coast: Description and Management. Queensland Botany Bulletin

No. 7 by G.N. Batianoff and J.A. Elsol (1989), 107pp., illustrated, including maps, card cover.

Vegetation Map and Description, Warwick, South-eastern Queensland. Queensland Botany

Bulletin No. 8 by P.A.R. Young and T.J. McDonald (1989), 47pp., illustrated, including a

map, card cover.

Vegetation Description and Map: Ipswich, South-eastern Queensland. Queensland Botany

Bulletin No. 10 (1991), by James A. Elsol, 61 pp., maps, card cover.

Vegetation Survey and Mapping in Queensland: Its Relevance and Future, and the Contribution

of the Queensland Herbarium. Queensland Botany Bulletin NO. 12 by V.J. Neldner (1993),

76 pp., card cover.

Economic Interest

Suburban Weeds, Second edition by Harry Kleinschmidt, 86 pp., illustrated, card cover.

Weeds of Queensland by H.E. Kleinschmidt and R.W. Johnson (1979), 469 pp., illustrated, hard

cover, reprinted with corrections 1987.

Use of Fodder Trees and Shrubs by S.L. Everist (1986), 72 pp., illustrated, card cover.

Poisonous Plants - a field guide by R.M. Dowling and R.A. McKenzie (1993), 175 pp., colour

illustrations and maps, card cover.

Special Interest

The Flora of Girraween and Bald Rock National Parks by Bill McDonald, Colleen Gravatt,

Paul Grimshaw and John Williams (1995), 100 pp., colour and line drawing illustrations and

maps, card cover,

Queensland Vascular Plants: Names and Distribution edited by R.J.F.Henderson, (1993),

361pp., soft cover.

Wildflowers of South-eastern Queensland by B.A. Lebler.

Volume 1 (1977) 108 pp., illustrated, soft cover.

Volume 2 (1981) 8&3 pp., illustrated, soft cover.

Enquiries regarding the cost and ordering of these publications should be directed to Queensland

Herbarium, Department of Environment, Meiers Road, Indooroopilly, Qld 4068, Australia.

Austrobaileya 4 (1-4): 1-696 (1993-1997)

Contents

Aspects of rarity in the Australian flora

FPPIES= A ESL CN ere sey fo ae eth aight BANE ce, Beane he Ee, 2 tle. dg deel Macs a HUN. a Re QS 4mtaiice, nM Alea se 1

Two new species of Symplocos Jacquin (Symplocaceae) from Queensland

MV ESS Sear vin st pai cheer A pretin ch Maas ¥ O39 Ce ene Pregl, grea OTe MN -tida: dt th aaah 5 oe wdaagle Mititie a4) i

A taxonomic revision of Neisosperma Raf. (Apocynaceae) in Australia, together

with a key to Australian genera of Apocynaceae

Patil RPGR ce Es cde 46 cca bie Wace she Fi dk Darth atvwehs lees Dal id pal 4 J ude he Ge u bee ch Ron enw ly 13

The genus Pavetta L. (Rubiaceae) tn Australia

Oe Lh MOE Se hy Taken, Geet WD 955 & chan ds deh & uc veld oilasid. & Sy TRS ER a Eslbay u bah Hodes) Ss 4. balla bod ge ar HE Redo GAH Ee at was 21

Taxonomic studies on the penis Hoya R.Br. (Asclepiadaceae: Marsdenieae)

in Papuasia, 6

Pail 1 Porters David Jib nadle noo. erpanengcrace acetic eae tines & feneee e wed abso eres tae ig bevy ane Dil

Studies in Australian grasses, 7. Four new species of Sporobolus R.Br.

(Poaceae, Chloridoideae, Sporoboleae) from Australia

PST ai Ke SAO <4 joo. § baie tiers oaks ha, ¢ Mo ed ete age tae ect, p Anis TILE aa, vor 57

Conspectus of Cryptolepis R.Br. (Asclepiadaceae: Periplocoideae) in Malesia |

Ptr bale OTST OR, ffm Foie taswparg ecu shaserenve dey Mt, sense lO. Neier Pastsdicaoet rec abil: o-5io44 WEE Roda hack ic aka ieee areal 67

Notes on Tiliaceae in Australia, 1 ~

EAA OTE tir cahea isd sige Sissies Bat sos Qed hans iylet ot Bb Icpvo SPRY aM tle Sead Ode ania BEEN eee 75

Segesbeckia fubax and Tetramolopium vagans, new Asteraceae from Queensland

By RECS. se Sey pepe edn 6 Wl dase tote 4B alcd tak oh god We RUD a Recor degrades oeLstive ak aA muita as ine ect 87

A taxonomic revision of the genus Peperomia Ruiz & Pav. ayer: in

mainland Australia

PiU DEES LOD at rcan chu torte gt fords (V2 lacia w SacaBryuld GORE AN e260 8 ea cy ege hg eae New abe eee ale aoe at a Muon ie 93

Studies in Australian grasses 8. A new Species of Thelepogon(Andropogoneae:

Ischaeminae) for Australia

Bryan: KASimiont aia ni avis rete sala Ste dee AE F-Pt bh lk ZEA hee Wal Re EL ne RE 105

Resurrection of Wrightia versicolor S..Blake (Apocynaceae)

PE ds POEStEDS 5 any toe anna te dS ume let aid ¢ GR Gee UR SR? GUNA PEED bee kid ios wD wd a pete cleat 109

Resurrection of Dischidia littoralis Schltr. (Asclepiadaceae)

Paul Dp Porster de avid JAG le, 22. pice lanes worere brea Vie hoe ea eh ee eR Boe or 113

Notes

Nomenclatural changes in Spermacoce L. (Rubiaceae)

} ARC SEATS OM: yee cas asec ss eevicis tn ech ce lysine: Gea nratcidgahk 1 ydee tas neces tone cnin whagaieenl de ued dae de a decace & 117

The correct names for two Australian varieties of Ficus L. (Moraceae)

ROCe el AE CMU SrGOIT & Bie b. a. ad eM ane net ah fee Meath cP cate noe Weaan els ote nah week oe Rt 119

The distribution and habitats of three presumed rare species from Cape York

Peninsula

SEN CACIOES syo5. 9 ates a? oti dnics Mosc npc Ws ees is hak ape ae. septs ch tds lpn tere Repaid, Bae cola A gigas eee sano 121

Additional records for some species of Finlaysonia Wallich, Gymnanthera

R.Br., Heferostemma Wight & Arn. and Sarcolobus R.Br. (Asclepiadaceae)

in Melanesia and Papuasia

PATI POUSTCIS ov vermct ene My Wn eer aan qe bates dares eee weegetars aioe eng gene 4s 129

Plant Profile

Bambusa moreheadiana F.M.Bailey (Magnoliophyta: Poaceae)

Fe BEC IE TOMEI otis eras gacee peat he Pek ee Se EEE Agel sales hun Aly SEU OING BRS 28s Abel SOR Otol G. Gh 8 Beas! 131

Austrobaileya 4 (1-4): 1-696 (1993-1997)

SONG Ras VT ok Se EA oon gS rt sp AU ac woe hE laele ON g EUEE seruet A lmdys Rental, S a Bes, Sn ey Ene 135

COEPECTIONE Sw x5al v kbits nie w deel ae Fee Gig oe & a ey ellie ols g ede Fo eee W eGle wR Ao 137

Wetria australiensis sp. nov. (Euphorbiaceae), a new generic record for

Australia

ee ELSE SECIS x contests teas ra A shares ie ne aN nee Pee A eee ae gees egg ony eat Aarits EulnlLe 139

Studies in Australian Grasses 9. ‘T'wo new species of Aristida (Arundineae:

Aristideae) from Queensland

ESTEVE IGS OEN 2 rice Pore pent ek re eek co ee cya noel eee by 4c Begg een encen hides hand. US. sabe bat ces defer ed Satish Pe pds 145

Notes on Dansiea Brynes and Macropteranthes F.Muell. (Combretaceae)

PATI OT Stele tp earks Skt Bisley ts exgantene ossoruectce Potaderstnactce ene sis Dl) ete hicg tee ccegmrath fie fons Se seg beatae 3 149

Eryngium fontanum A.E.Holland & E.J.Thompson, (Apiaceae), a new species

from Central Queensland

Ailsa E.Holland & E. John Thompson ...... 0... . ccc cee ee ete eens [55

Ten new species of Plectranthus L'Her. (Lamiaceae) from Queensland

PAE LAA GESCELS oe Fetes oe fee ie food ATG DANS By Mi Sh BOS BECO AE alegre A SAL EL, ar pow ae Pe ls 159

Four new species of ironback (Eucalyptus L.Herit., Myrtaceae) from southern

Queensland

ARI Bealicte tvs EB TOG Rebs neat gna We area cite tend ath che Pin pees aly berg g eae bee a (187

Nervilia peltata (Orchidaceae), a new species from north-eastern Queensland

and the Northern Territory

I Tee cD POSEN el hs coon cathe ice gacet as Pe lana so euseanbe gibt ds usi-ree. meal uct cc'hen ter anton op eins nae 195

Two new species of Rutidosis DC. (Asteraceae: Gnaphalieae) from Queensland |

POUCA OT AMAGES eeicacca ds Oia: cos oscns casrhecks tasty ORAL RE gees eaten nae a IS gem cael ts header tea cy ePteng at ee .... 199

Eucalyptus clandestina (Myrtaceae), a new bloodwood from central Queensland

PAR Stas Lota s Bsns Sosa renege lends bueantelens See etn Oecd Cor nabast Pe ig steet sce cedyr aeons Pein 9% what lore CE eB aes 205

A taxonomic revision of Acalypha L. (Euphorbiaceae) in Australia |

DE OUR Tia Pete hina cas Notes UCT Rag wee ee bacth! ia cpesed tes oath cece bad tbasr ee atcacneinioe teat era onde Asatte tenn es 209

Revision of Archontophoenix H.Wendl. & Drude (Arecaceae)

John L.Dowe & Donald R.Hodel ........... 0... .000 000 ee een 227

Revision of Euphorbia plumerioides Tetjsm. ex Hassk. (Euphorbiaceae) and

allies

PPAR ORSESE ee iiss Suet Reng. ob yal tat Sewers 2 PRRe 4a tied ,8, ae kel hacen er Wek ane ee 245

A new species of red gum (Eucalyptus subser. Phaeoxyla Blakely) from central

and southern Queensland

MATH BY ODIGE 0 Bute ie vs frien. once Batt teva dew ate Holy alta arié ante Alsd oid GM warned BODE TG MALE 265

Seven new species of Macrozamia sectionParazamia (Mig.) Miq. (Zamiaceae

section Parazamia) from Queensland

Davy ic iLones- Pan | mOrstete 2 25.06 $08 Unie erect s certs cog uteri t, a oee ees Bae Re Rae beds 269

Notes

Typification of Tweedia coerulea and T. versicolor (Asclepiadaceae)

POAUEL, PASOES COE? Fo a88 PUR a tetoe aN apes gn aeetehc ase nec ci Oe Cia sinay aap agence et ae EE Son ball ol 289

DOO. CCV IC Ss Fei ea tect tetty MAP ada vark dtnte ced le Sh fast Cake a dwe a UE eo baa egeeena ers 291

Notes on Tiliaceae in Australia, 2. A revision of the simple-haired species of

the genus Corchorus L.

Led Pee AED OUR op coct dite els Se ae pa Y to. calle Vd fue Sy rss bad be aac rEa yl ieee toe Wheat aches a ie aia 297]

4“ vf wtee tee oT Pereerer? corer ferre er reste errr rire! A ehitess +e i Z t ba S tine, +g RPS SSE Se teint ates te nee ees *

Austrobaileya 4 (1-4): 1-696 (1993-1997)

Revision of Rubus L. subgenus Micranthobatus (Fritsch) Kalkman (Rosaceae)

in Australia

PY TR ESAT Ac. yt wos Abe, et OPRER MS Fee Aye Z eearGhe Yoga, F Wows BY, GE ahh BOG Tee Zs weal heel Ne & PEE oD beh |

Sankowskya, a new genus Euphorbiaceae (Dissiliariinae) from the Australian

Wet Tropics

Par Ms OES TSE” 6 eat bene Seashell Mapes po rns 4 sited pnathh toasts toieieale 0 gene Sete

A Revision of Syncarpia Ten. (Myrtaceae)

Fatty ESCA 2-5 okt 4 occa cat pF tech he Sie ae eden ae ARE beeen te wears gece Rope Sete g

Cycas desolata (Cyadaceae) a new species from north Queensland

PTE: SAPS TG tee oy coo i ice Be Ae epost hep tw ctl pice ae eh Se See wee Dilan MIEN ee a ph Coat eee

Reinstatement and revision of Triplarina Raf. (Myrtaceae)

Fan SO ce oes 4 Se Weed se ate E-elOuye Viana, Tim Ba hy ea Og Me, wha eet he AD Be cr 8 hen ab litiee Gap wi See ten Ble B

Fasciculochloa, a new grass genus (Poaceae: Paniceae) from south-eastern

Queensland

Bryat-K. Simon & Carolyn Vl, Weiler. yea y ed a A OA ea eh are

Omphalea celata, a new species of Euphorbiaceae from central Queensland

Pal [AIP OSC fal y ave celecyaes Bae oe ae ee Pe Se Bee ae ele a) eo ee SPO eR beh

A new species and new combination tn Ochrosperma Trudgen (Myrtaceae)

Pole SAND cpp yb ott Sia cach ire! Set aPatie pee eae tehe tera s eh aaa oe cate So Rew yates none a tenes

Nomenclature and type specimens tn Kustrephus and Geitonoplesium

(Geitonoplesiaceae)

OSSD ee ATCT SES: + 6 ses a tarevals, Frelahd al Gla @al hE & Abd bad ee RETA CORE otk oe a IG a

Taxonomic studies on the genus Hoya R. Br. (Asclepiadaceae: Marsdenieae) in

Papuasia, /.

Paul I. Forster, David J. Liddle & Iris M. Liddle ........................00.0005

A new species and a new record for Astrotricha (Araliaceae) in Queensland

AVI, ABSGATIE © 0 Ripefrachtinssuc. bets ietsiete sete aitatarmchire a agceeeta rede Rtas ete Dasiet ons a7 Ps Stila nt sebies pte 3 “SO hens

Gouania exilis (Rhamnaceae), a new species from northern Australia and Papua

New Guinea, with notes on the identity of Gouania hilltt F.Muell.

Ie Pele rses I Gre WeOSe 5 hate in haat tp eee vaneyeiv te shel tcmin, Sao eo Byhr eons efi pun bon ¢ Meoseheit ae Vows

A taxonomic revision of Calycopeplus Planch. (Euphorbiaceae)

PRU DISNOTSIOT eb ccras ga telat rare dk uerbe bint hae tore AWE apt aCe Ed ate aah phn ale Rea ea a So

Four new species of Solanum (Solanaceae) from south east Queensland

PA ANECNE SV ETON’ ono ales we cea ere: ately tne oa eh arcatae aeeractacetige tt ee mrbnes LN ach Segesiits Wate siete aitee ee entbiese Wal?

Two New Species of Hibiscus section Furcaria (Malvaceae) from Northern

Queensland

FETSeW 11S Oe 1A OC LAVET: ole coo Bde cere Ratcedl sade, Rebeacat ligt haber alacad awelie la dangete a ast hus 2

Notes

Distribution, habitat, and conservation status of Peperomia

bellendenkerensis (Piperaceae) a rare endemic from the Wet

Tropics of north-eastern Queensland

Peter a Bostock ce: Paul T POtstet cae sce. Sk behtaph aan Soe 2 Sale ger ee he Ey ante a

Ehretia grahamii (Boraginaceae), notes on distribution, habit, variation and

conservation status

FPA eE Ds POSE ox a ass have el etic he ha to Suan doandeien Mime tan Mae weg JRE oP Sena) a mul eae Ae

A Revision of Micromyrtus Benth. (Myrtaceae) in Queensland

Pvciss Oatie,. buys neg SAL yard eed pea Bok uinigln Aes bk Seehe k abl ieee etn a, & baka dander Set betel

451

Austrobaileya 4(3): 297-453 (1995)

A taxonomic revision of Drypetes Vahl (Euphorbiaceae) 1n Australia

PATTER LOE SCC au Bl i ch Seo t nied oe CVU t Fahhs Bap talele ty saben tin RPoRY Bal sedctdd Mach andes: Haare! Set Me analuen ted

Notes on Tiliaceae in Australia, 3: A revision of the genus 7riumfetta L.

BG UOC, ance atid, tox: view thse setae tareepe yee dense eyactontetamaenvstdega sm hire celiac et hatate dart a

Two new species of Eucryphia Cav. (Cunoniaceae) from Queensland

Paul J:-Porster he 18¢P V0 BE Lani se 2 neice Ate Read weeds = Wag seins -« byace argh bles delish Se

Borya inopinata (Anthericaceae), a new species of resurrection plant from

north Queensiand

Pauld. Forster & E, John THOMpSon sc. + sae eee peed Ko See eR ET CBE ERA

The use of rubisco DNA sequences to examine the systematic position of

Hernandia albiflora (C.R.White) Kubitzi (Hernandiaceae), and relation

ships among the Laurales

Effie M. Ablett, Julia Playford & Stephanie Mills ... 0... 0... cece eee ee

Acomius bella (Asteraceae: Gnaphalieae), a new species from north Queensland

Par bwet EN EE OUIGRIEL: of. le 080-4 one wecebe. oud of. aaatdoBS. actadeose. nites Metvgy So negy ved. ota. gat. Reaeee a MARE ads Read

A new subspecies of Caustis blakei Kiik. in Queensland

Margaret E. Johnston, John T. Swarbrick, Alan H. Wearing &

TEL WV COREY sk gezccceck,eccie ota pice 2 gale! Seb ie'Wees Be MSc: DEN VL vtec tre cael MY a tele cable,

A taxonomic revision of Austrobuxus Mig. (Euphorbiaceae: Dissiliariinae) in

Australia |

Pat LPORSter a = 4.5 & oa Groth hips DR heen Bek Ee Bie a Fed ash A Eb RUS Ade AED GLE PG

Reinstatement of the genus Babingtonia Lindl. (Myrtaceae, Leptospermoideae)

PRR EPEC 1, -F 8 260 So onthe iel w Sliees ow Soe) anh ey hu vtve al ha ah Te pod ve anlas ac Excel! oa a: veh oe lab Sladen Sle lb aha: Ges ac fits

A new species of Thryptomene Endl. and a new species of Ochrosperma

Trudgen (Myrtaceae) from the Northern Territory, Australia

AGRB BAR, o6 4c aadetr a joa Lg ete 2 bed acer nie Wane eek See aon a oat Were eh ataue amt quand

Plectranthus amoenus and P. thalassoscopicus (Lamiaceae), new species from

north-eastern Queensland, Australia

4222) 69 WO) ARS S94 0 cl ee RE a ee RO eRe ee ea Ee ON ra Oe

Four new rare species of Sauropus Blume (Euphorbiaceae: Phyllantheae) from

north Queensland

John -T, Hunterand Jeremy J Bruhll 165 se ves a hoe Be nh ele we eso cont ed OM BNG

Dubouzetia saxatilis (Elaeocarpaceae), a new species from north Queensland,

Australia

A RBC AT SE En W543 CSSUPE ic rey pote 4 de EGTA A IAS EU Ge Rk

A revision of Rubus subg. Idaeobatus (Focke) Focke (Rosaceae) in Australia —

FA Fa bos 1s ae eT OP ee ee Le Se ee in le Ene Le) Seen BP ca oa ane: oat

Note

Significant range extensions for species of vascular plants in northern New

South Wales

Johny Euniter de Terenry sb B guns 44k eee aye cdc Reece Geese ap eee an bee en ee

GO ER OVE occ bers one th le cx ate earn nbn ine eco Ba taleees ¢ acean ee Soe: facil atc Bau wy dina a eetetn Cease n Gael