Cover: An adult male of Chamaeleo monachus,

Socotra Island, Wadi Ayheft, 11.2009. 1 ) idem.

2) Pristurus sokotranus, Socotra Island, Wadi

Da’Arho, 11.2009. 3) P. samhaensis, Darsa

Island, 11.2009. (photos by Pietro Lo Cascio

and Flavia Grita)

REPTILES OF SOCOTRA. Chamaeleo monachus was described by the herpetologist John E. Gray in

1865, who indicated “Madagascar” as type-locality for the new species. However, the specimen studied by

Gray came from Socotra, where chameleons were perhaps collected as pets by Arab sailors and successively

sold to Britishs travellers with erroneous information about their provenience, but only after the first

scientific expedition carried out on the island by the botanist Isaac Balfour in 1880 it was possible to

determine its true origin. C. monachus now is appropriately known as one of the several endemic reptile

species of the Socotra Archipelago (Yemen), where it is the only representative of the family

Chamaeleonidae and where it is exclusively distributed on the main island. The archipelago is located about

380 kilometers south-east off the Yemen coast and 100 km east from Cape Guardafui (Somalia), and

includes four islands, whose size ranges from 3,625 (Socotra) to 12 km2 (Darsa). Socotra’s levels of

endemism confer global significance, both in plants and animals; the main island is a fragment of

Gondwana, fistly isolated in the Indian Ocean during Eocene-0 ligocene (34-41 million year's ago), and

palaeogeographic data indicate that all the islands have been definitively isolated from Africa about six

million years ago. Reptiles is undoubtly one of the most important and significant groups among the

vertebrate faunas of these islands in terms of biological diversity. According to the recently updated

checklist given by Razzetti et al. (2011, in Zootaxa 2826: 1-44), the Socotra Archipelago harbours 30

species belonging to 12 different genera, some of which are strictly endemic of the islands: the gekkonid

Haemodracon Bauer et al., 1997, and two snake monotypic genera, the colubrid Hemerophis Schatti &

Utiger, 2001, and the lamprophiid Ditypophis Gunther, 1881. Except for the bizarre story of the homeland

of the Socotran chameleon, the first knowledge on the herpetofauna of the archipelago is mainly due to the

zoological expedition led by the British naturalists Henry O. Forbes and William R. Ogilvie-Grant in the

late 19th century, but investigations on taxonomy and distribution of several species are still in progress, as

evidenced by the recent description of the gekkonid Hemidactylus inintellectus Sindaco et al., 2009, as well

as by the fact that seven other species have been described during the last three decades. The endemicity

rate among reptiles is very high and 90% of occurring species are exclusive of one or more islands;

moreover, some of which are also strictly confined on very small areas: a significant example is given by

Hemidactylus dracaenacolus Rosier & Wranik, 1999, so far known only from few localities of the Diksam

Plateau at Socotra where it inhabits barks and trunks of the renowned dragon blood trees, the relictual

endemic Dracaena cinnabari. Most part of the occurring reptiles (18) belong to the family Gekkonidae and

some genera, such as the diurnal Semaphore geckos Pristurus Ruppell, 1835 or the nocturnal Hemidactylus

Oken, 1817, are interested by remarkable processes of adaptive radiation: both include 7 endemic species

(the latter, also, comprises 3 species introduced on the islands). In particular, Socotra and its satellite islands

harbour one third of the 20 recognised species of Pristurus, a genus distributed in Arabia and north-eastern

Africa with an isolate in Mauritania. These geckos are mainly heliothermic ground- or rock-climbers, but a

small number of taxa is known as free dwelling; among the Socotran representatives, P obsti Rosier &

Wranik, 1999, originally recorded for the mangroves of Shu’ab Gulf, and the closely related P guichardi

Arnold, 1986, known for the mountains of Hajhir Massif, are purely arboreal, while the most common and

widespread P. sokotranus Parker, 1938, as well as P. insignis Blanford, 1881 and P. insignoides Arnold,

1986, are generally associated to rocks and cliffs. P abdelkuri Arnold, 1986 is endemic of the westernmost

island Abd al-Kuri, but some introduced populations of this species have been recently recorded at Socotra.

Finally, P. samhaensis Rosier & Wranik, 1999 replaces P. sokotranus in the small islands of Samha and

Darsa, also called “The Brothers”.

Pietro Lo Cascio, Associazione Nesos, via Vittorio Emanuele 24 - 98055 Lipari (ME) ITALY - plocascio@nesos.org.

Biodiversity Journal, 2011, 2 (2): 53-58

Exotic molluscs (Mollusca, Gastropoda et Bivalvia) in Santa Catarina

State, Southern Brazil region: check list and regional spatial distribution

A. Ignacio Agudo-Padron

Project “Avulsos Malacologicos”, Caixa Postal (PO. Box) 010, 88010-970, Centro, Florianopolis, Santa Catarina, SC, Brasil;

ignacioagudo@gmail.com; http://www.malacologia.com.br

ABSTRACT A total of twenty-one exotic mollusc taxa were assessed for Santa Catarina State (SC), fifteen Gastropoda and

six Bivalvia (twelve terrestrial, five limnic/freshwater - three gastropods and two bivalves, and four marine

bivalves). Of these, fourteen are confirmed as invasive species (nine terrestrial, three limnic/freshwater, and

two marine).

KEY WORDS Biodiversity, Continental mollusc fauna, Exotic and invasive species, Santa Catarina State, Southern Brazil region

Received 18.02.2011; accepted 12.04.2011; printed 30.06.2011

INTRODUCTION

To date, the presence of a total of twenty-one (21)

mollusc species, under the designation of “exotic

introduced species” (48% of the total acknowledged

in Brazil), was confirmed for the territory of Santa

Catarina State (SC), a small central state within the

South Brazil region - of these species, fifteen were

Gastropoda and six Bivalvia (twelve terrestrial, five

limnic/freshwater - three gastropods and two

bivalves - four marine bivalves). The list also

includes the slug Pallifera sp., a species still within

the taxonomic status confirmation process, with

descriptions of the species to be found in Agudo &

Bleicker (2006), Agudo-Padron (2008a) and Agudo-

Padron & Lenhard (2010). Of these species, fourteen

are identified as invading forms in Santa Catarina

State (ten Gastropoda - nine terrestrial and one

freshwater - and four Bivalves - two freshwater and

two marine). In the present work, the current

regional knowledge situation of these molluscs is

briefly revised, including basic maps covering the

distribution of such species in the state.

ANALYSIS OF THE CONTEMPLATED SITUATION

The current survey started in November 2009

and included the organization of official seminars

(Oficial State Program for Listing and Control of

Invasive Exotic Species), organized and driven by

the Official Santa Catarina State Environment

Foundation (Fundagao do Meio Ambiente -

FATMA) jointly with the Horns Institute of

Development and Environmental Conservation

(Instituto Horns de Desenvolvimento e

Conservacao Ambiental). The main goal of such

seminars was the formulation of a “Official State

Fist of Species” (Agudo-Padron 2011a, b).

Of the two participant researchers in the enacted

Mollusc Group, only one worked specifically with

continental species. It is worth highlighting that the

Asian golden mussel, Limnoperna fortunei

(Dunker, 1857), a highly invasive species which is

still localized within Santa Catarina State (Agudo-

Padron 2007, 2008b; Agudo-Padron & Fenhard

2010), received particular attention within such

seminars. On another note, the cultivated mussel

Perna perna (Finnaeus, 1758) was removed from

the list of invasive species for the State since, after

an extensive analysis and technical discussion, it

was concluded that the species is actually being

considered a native one in the State and in the

whole of Brazil (Magalhaes et al., 2007; Schaefer et

al., 2009).

The following is a list of introduced and invading

molluscs in Santa Catarina State (SC) along with

inter-relationships between such species, based

mainly on the taxonomic contributions of Simone

(2006) and Thome et al. (2006, 2007) (Figs 1-17).

A. I. Agudo-Padron

^ A

Arte: Boletim AM

Rumina decollata

Vertigo ovata

Fig-1

Fig-2

Arte: Boletirn AM

Pallifera sp.

Lehmannia valentiana

Fig-3

Fig-4

• •

Baia *

Norte

Baia

Sul

Atlantic

Ocean

• •

Limacus flavus

Limax maximus

Fig-5

Fig-6

• •

Arte: Boletim AM

• •

Baia *

Norte

Baia

Sul

Atlantic

Ocean

• •

Deroceras laeve

Fig-7

Figures 1-8. Regional spatial distribution of exotic molluscs

in Santa Catarina (1).

••

1 *

• •

Baia *

Norte

Baia

Sul

Atlantic

Ocean

• •

Achatina fulica

Fig-8

| | Atlantic rainforest

| 1 Arauncaria forest and Capos

[=□ Subtropical forest of the Uruguay River

Exotic molluscs (Mollusca, Gastropoda et Bivalvia) in Santa Catarina State, Southern Brazil region: check list and regional spatial distribution

: • •

• ••

Baia

Norte

Baia

Sul

• Atlantic

Ocean

• •

Arte: Boletim AM

Bradybaena similaris

Fig-9

Arte: Boletim AM

Helix (Cornu) aspersa

Fig. 10

Arte: Boletim AM

Paralaoma servilis

Arte: Boletim AM

Zonitoides arboreus

Fig. 11

Fig.12

Arte: Boletim AM

Pomacea paludosa

Arte: Boletim AM

Melanoides tuberculatus

Fig.13

Fig. 14

•

Arte: Boletim AM

Aplexa rivalis

Corbicula fluminea

Corbicula largillierti

Fig.15

Fig. 16

Fig. 17

Atlantic rainforest

Figures 9-17. Regional spatial distribution of exotic molluscs

in Santa Catarina (2).

Arauncaria forest and Capos

Subtropical forest of the Uruguay River

A.I. Agudo-Padron

RESULTS

TERRESTRIAL TAXA

Twelve recognized species (26% of the total

confirmed in Brazil). Of these, nine are specific

invading forms.

Class GASTROPODA - Pulmonata

Family SUBULINIDAE Thiele, 1931

Genus Rumina Risso, 1826

Rumina decollate! (Linnaeus, 1758)

Family VERTIGINIDAE Fitzinger, 1833

Genus Vertigo Muller, 1774

Vertigo ovata Say, 1822

Family PHILOMYCIDAE Keferstein, 1866

Genus Pallifera Morse, 1864

Pallifera sp. (Fig. 18)

INVADER

Family LIMACIDAE Rafinesque, 1815

Genus Limacus Lehmann, 1864

Limacus flavus (Linnaeus, 1758) (Fig. 19)

INVADER

Genus Umax Linnaeus, 1758

Limax maximus Linnaeus, 1758 (Fig. 20)

INVADER

Genus Lehmannia Heynemann, 1863

Lehmannia valentiana Ferussac, 1822

INVADER

Family AGRIOLIMACIDAE Wagner, 1935

Genus Deroceras Rafinesque, 1820

Deroceras laeve (Muller, 1774)

INVADER

Family ACHATINIDAE Swainson, 1840

Genus Achatina Lamarck, 1799

Achatina {Lis s achatina) fulica (Bowdich, 1822)

INVADER

Family BRAD YBAENIDAE Pilsbry, 1934

Genus Bradybaena Beck, 1837

Bradybaena similaris (Ferussac, 1821) (Fig. 21)

INVADER

Family HELICIDAE Rafinesque, 1815

Genus Helix Linnaeus, 1758

Helix {Cornu) aspersus (Muller, 1774) (Fig. 22)

INVADER

Family PUNCTIDAE Morse, 1864

Genus Paralaoma Iredale, 1913

Paralaoma servilis (Shuttleworth, 1852)

Family GASTRODONTIDAE Tiyon, 1866

Genus Zonitoides Lehmann, 1862

Zonitoides arboreus (Say, 1817)

INVADER

FRESHWATER/ LIMNIC TAXA

Five recognized species (12% of the total

confirmed in Brazil). Of this, three are specific

invading forms.

Class GASTROPODA

Caenogastropoda

Family AMPULLARIIDAE Gray, 1824

Genus Pomacea Perry, 1811

Pomacea paludosa (Say, 1829)

Family THLARIDAE Troschel, 1857

Genus Melanoides Olivier, 1804

Melanoides tuberculatus (Muller, 1774)

INVADER

Pulmonata

Family PH YSIDAE Fitzinger, 1833

Genus Aplexa Fleming, 1820

Aplexa rivalis (Maton & Rackett, 1807)

Class BIVALVIA - Veneroida

Family CORBICULIDAE Gray, 1847

Genus Corbicula Megerle von Miihlfeld, 1811

Corbicula fluminea (Muller, 1774) (Fig. 23)

INVADER

Corbicula largillierti (Philippi, 1 844)

INVADER

MARINE TAXA

Four recognized species (9% of the total

confirmed in Brazil). Of these, two are specific

invading forms.

Class BIVALVIA

Ostreoida

Family OSTREIDAE Rafinesque, 1815

Genus Crassostrea Sacco, 1897

Crassostrea gigas (Thumberg, 1795)

Crassostrea virginica (Gmelin, 1791)

Exotic molluscs (Mollusca, Gastropoda et Bivalvia) in Santa Catarina State, Southern Brazil region: check list and regional spatial distribution

Fig. 18

Fig. 19

Fig.20

Fig. "21

Fig-22

Fig. 23

Figure 18. Invasive exotic slugs PaUifera sp.

Figure 19. Limacus flavus.

Figure 20. Umax maximus (photo P. Lenhard).

Figure 21. Bradybaena similaris (photo P. Lenhard).

Figure 22. Cornu aspersum (photo P. Lenhard).

Figure 23. Corbicula fluminea.

A.I. Agudo-Padron

Pterioida

Family ISOGNOMONIDAE Woodring, 1925

Genus Isognomon Lightfoot, 1786

Isognomon bicolor (C. B. Adams, 1845)

INVADER

Mytiloida

Family MYTILIDAE Rafinesque, 1815

Genus Lithophaga Roding, 1798

Subgenus Myoforceps P. Fischer, 1886

Lithophaga ( Myoforceps ) aristatus (Dillwyn, 1817)

INVADER

DISCUSSION AND CONCLUSIONS

The official lists of alien and invasive mollusc

species for Santa Catarina State compiled by

regional environment institutions (CONSEMA

2010) overlook or give scant importance to the

species listed in this manuscript, listing only a total

number of six related species, five of them being

recognized as “invasive forms” in the State (two

terrestrial = Achatina fulica , Helix aspersa\ three

freshwater/limnic = Melanoides tuberculatus,

Corbicula fluminea, Corbicula largillierti; and one

marine = Crassostrea gigas ).

It is hoped that soon this situation is properly

reviewed, corrected and updated.

ACKOWLEDGEMENTS

Special very thanks to Dra. Silvia R. Sziller,

executive director and researcher of the “Instituto

Horns de Desenvolvimento e Conservagao

Ambiental” (Florianopolis, SC) and Biologist MsC.

Beloni Terezinha Pauli Marterer, Oficial researcher

of the “Fundagao do Meio Ambiente - FATMA”

(Florianopolis, SC) for their timely help with

informations, bibliographical support, critical

observations/ discussion and suggestions.

REFERENCES

Agudo A.I. & Bleicker M.S., 2006. Moluscos exoticos no

Estado de Santa Catarina. Informativo SBMa, 37: 6-8.

Agudo-Padron A.I., 2007. Diagnostico sobre a potencial

ocorrencia do mexilhao-dourado asiatico, Limnoperna

fortunei (Dunker, 1857), no Estado de Santa Catarina,

Brasil. Informativo SBMa, 38: 4-5.

Agudo-Padron A.I., 2008a. Listagem sistematica dos moluscos

continental ocorrentes no Estado de Santa Catarina,

Brasil. Comunicaciones de la Sociedad Malacologica del

Uruguay, 9: 147-179. Available online at: http://redalyc.

uaemex.mx/redalyc/pdf/524/52412049003.pdf

Agudo-Padron A.I., 2008b. Vulnerabilidade da rede

hidrografica do Estado de Santa Catarina, SC, ante o

avango invasor do mexilhao-dourado, Limnoperna

fortunei (Dunker, 1857). Revista Discente Expressoes

Geograficas, 4: 75-103. Available online at:

http://www.geograficas.cfh.ufsc.br/arquivo/ed04/artigo04.pdf

Agudo-Padron A.I. , 2011a. Mollusc fauna of Santa Catarina

State, Central Southern Brasil: current state of knowledge.

Tentacle, 19: 22-24. Available online at: http://www.hawaii.

edu/cowielab/tentacle/Tentacle_19.pdf

Agudo-Padron A.I., 2011b. Mollusca and environmental

conservation in Santa Catarina State (SC, Southern Brazil):

current situation. Biodiversity Journal, 2: 3-8.

Agudo-Padron A.I. & Lenhard P., 2010. Introduced and

invasive molluscs in Brazil: an brief overview. Tentacle,

18: 37-41. Available online at: http://www. hawaii.

edu/co wielab/tentacle/Tentacle_ 1 8 .pdf

CONSEMA - Conselho Estadual do Meio Ambiente. 2010.

Resolucao CONSEMA no. 11, de 17 de Dezembro de

2010. Reconhece a Lista Oficial de Especies Exoticas

Invasoras no Estado de Santa Catarina e da outras

providencias. Florianopolis, SC: SDS/ CONSEMA.

Available online at: http://www.institutohorus.org.

br/down I oad/marcosjegai s/Resolugao_CON S EM A_SC_

ll_2010.pdf

Magalhaes A.R.M., Schaefer A.L.C. & Fossari T., 2007.

Mexilhao Perna perna (Linnaeus, 1758): nativo sim do

Brasil. Rio de Janeiro, RJ: Resumos XX Encontro

Brasileiro de Malacologia, Biogeografia: 237.

Schaefer A.L.C., Magalhaes A.R.M. & Fossari T.D., 2009.

Evidencias da presenga do mexilhao Perna perna em

Sambaquis pre-coloniais brasileiros. Rio de Janeiro, RJ:

Resumos XXI Encontro Brasileiro de Malacologia,

Arqueologia: 432.

Simone L.R.L., 2006. Land and freshwater molluscs of Brazil.

Sao Paulo, FAPESP, 390 pp.

Thome J.W., Gomes S.R. & Picango J.B., 2006. Guia ilustrado:

Os caracois e as lesmas dos nossos bosques e jardins.

Uniao Sul-Americana de Estudos da Biodiversidade -

USEB, Pelotas, 124 pp.

Thome J.W., Arrada J.O. & Silva L.F. da, 2007. Moluscos

terrestres no Cone Meridional da America do Sul,

diversidade e distribuigao. Ciencia & Ambiente, Ciencia &

Ambiente, Fauna Neotropical Austral, 35: 9-28.

Biodiversity Journal, 2011, 2 (2): 59-66

Threatened freshwater and terrestrial molluscs (Mollusca, Gastropoda

et Bivalvia) of Santa Catarina State, Southern Brazil: check list and

evaluation of regional threats

A. Ignacio Agudo-Padron

Project “Avulsos Malacologicos”, Caixa Postal (PO. Box) 010, 88010-970, Centro, Florianopolis, Santa Catarina, SC, Brasil;

ignacioagudo@gmail.com; http://www.malacologia.com.br

ABSTRACT A total of nineteen continental native mollusc species are confirmed for the Santa Catarina State (SC)

(organized in ten Genera and seven Families), one aquatic Prosobranchia/Caenogastropoda (Ampullariidae),

six Pulmonata terrestrial gastropods (one Ellobiidae, three Megalobulimidae and two micro-snails -

Charopidae and Streptaxidae) and twelve freshwater mussels (eight Mycetopodidae and four Hyriidae). These

species are designated by the International Union for Conservation of the Nature - IUCN as follows: seven as

"Vulnerable", six "In Danger" and six “Without Category Established”. The general regional threats that these

species are subjected to are briefly analyzed.

KEY WORDS Biodiversity, Continental mollusc fauna, Threatened species, Santa Catarina State, Southern Brazil region

Received 18.02.2011; accepted 12.04.2011; printed 30.06.2011

INTRODUCTION

In spite of prodigious scientific and

technological progress in recent years, in

throughout Brazil and other Neotropical

countries, significant difficulties in evaluating

the threats impinging on continental-terrestrial

and freshwater-molluscs species are constantly

being faced by the scientific community,

especially in the geo-political territory of Santa

Catarina State (SC), the smallest space portion of

the Southern Brazil mosaic (Agudo & Bleicker,

2006a; Agudo-Padron, 2006; Agudo, 2007a;

Agudo-Padron, 2007a, 2008a, 2009a, b; Agudo-

Padron & Bleicker, 2009). This state of affairs is

mainly due to the lack of solid population data

and to the small amount of resident limnologists

in this State.

Nowadays, the Santa Catarina State

authorities govern in this territory nine State

Ecological Units of Conservation - six belonging

to the category “Park”, where access to the

public is permitted in most areas, and three

belonging to the category “Reserve”, where

access is quite restricted and permitted only to

researchers; this besides four “National

Ecological Parks” within the jurisdiction of the

same State.

However, do such protected areas truly result

in effective conservation of our known

continental malacological species and of species

which to date have yet to be described?

As previously noticed by local limnologists

(Moraes, 2006), all of the Brazilian native

mollusc species are in imminent threat of

extinction, besides forms that are still awaiting

discovery. Considering the rapid rate of

anthropogenic environmental degradation, it can

be hypothesized that a number of such species

have gone extinct before they were at least

recorded and described scientifically (Simone,

2006).

Besides the environmental degradation

(through deforestation for agricultural ends

and/or mining exploration, pollution of the river

basins with discharges of organic and inorganic

pollutants, indiscriminate application of

agricultural poisons and chemical fertilizers,

A. I. Agudo-Padron

proliferation of the construction of hydroelectric

mills, invasions of natural spaces by town

planning enterprises), the Brazilian terrestrial

mollusc species face stiff competition by

invading forms, that are also responsible for

serious sanitary and agronomic problems, among

others (Agudo, 2007b; Agudo & Bleicker 2006b;

Agudo-Padron 2006, 2007a, b, 2008b, c, d;

Agudo-Padron & Lenhard, 2010). Brought to

Brazil willfully for a variety of purposes, or even

accidentally, those exotic species are alien to the

local ecosystem and for this reason they don’t

possess natural predators, resulting in an

uncontrolled growth of the population, that,

consequently, smothers and even obliterates

native species through the usurpation of their

niches (Simone, 2002).

That scenario is worsened by the absence of

any awareness on the conservation status of these

animals, which are generally not considered

charismatic enough so as to warrant the

declaration of protected natural areas - the

molluscs have a very smaller appeal to the

population than megafaunal species, in spite of

being fundamental for the ecological balance of

ecosystems (Moraes, 2006) (Figs 1-11).

During the course of this study, we also had the

opportunity to document personally the change in

fortunes of some iconic terrestrial mollusc species

- for instance the native giant snail Megalobulimus

gummatus (Hidalgo, 1870) (Fig. 2), found mainly

in the valley of the Uruguay river basin. Abundant

previously at the same location, today it results

difficult to track down in the local environment, as

a result of the increase in regional agricultural

activities (application of pesticides, mainly);

meanwhile invading exotic species, such as the

slug Pallifera sp. (Fig. 1), proliferate and colonise

new areas.

In other cases (very rare), native species resist

and adapt to the anthropological conditions

imposed in their natural environment when this

is invaded becoming themselves, in turn,

agricultural pests in small vegetable cultures. An

example of this situation is presented by the case

of the giant native snail Megalobulimus oblongus

(Muller, 1774) (Fig. 3), in sandbanks of the

“Enseada do Brito”, Palhoga Municipal District

of the Great Florianopolis, a traditional village of

artisanal fishermen located in the proximities of

the “Serra do Tabuleiro Ecological State Park”

(Agudo-Padron & Bleicker, 2009).

Table 1. Santa Catarina State, SC, central portion of the Southern Brazilian country (on the left), and regional geopolitical division showing

physical, socioeconomic and environmental (phytogeographical) characteristics (on the right). Santa Catarina lies between latitudes 25° and

30° S and longitudes 48° and 54° W, extends 377 km from North to South and 547 km from East to West at its most distant points, and has an

area of 95,985 km 2 , which includes 502 km 2 of rivers and lakes. The state constitutes only 1.13% of the total area of Brazil and is divided

geographically into three large parts: the Atlantic Coastal Plains, with several rivers that discharge into the Atlantic Ocean, and two

independent great river basin systems that irrigate the land in the central and western highlands, the Iguazu and the Uruguay.

Threatened freshwater and terrestrial molluscs (Mollusca, Gastropoda et Bivalvia) of Santa Catarina State, Southern Brazil: check list and evaluation of regional threats

Fig-1

Fig.4 Fig.5

Figure 1. Invasive exotic Asian slugs PaUifera sp.

Figure 2. Native giant snail Megalobulimus gummatus, 108 mm.

Figure 3. Native giant snail Megalobulimus oblongus, 70 mm (photos: P. Lenhard).

Figure 4. Native giant snail Megalobulimus grandis, 130 mm (photo: G. Woehl Jr.).

Figure 5. Native snails Megalobulimus proclivis, 86 mm.

A. I. Agudo-Padron

Curious situation comes with the involvement

of the giant freshwater native bivalve

Anodontites trapesialis (Lamarck, 1819) in the

Northern region of the State (Joinville Municipal

District) and other Brazilian localities out of the

State, whose parasitic larvae type “Lasidium” are

undesirable and harmful pests in enterprises fish

farmers (Agudo, 2005, 2008).

According to Mansur et al. (2003) and

Mansur (2008), it just is not enough to place the

native species in lists of those threatened by

extinction: it is necessary to know our native

fauna from the taxonomic, morphologic and

ecological point of view so as to be able to

propose handling and management strategies.

As previously noted, an inefficient

administration and man’s growing need for water

are bringing freshwater ecosystems to the

collapse, making freshwater species the most

threatened of the planet.

The molluscs that live in rivers and lakes are

the most threatened of the Earth, due to the

collapse of aquatic ecosystems mediated by the

construction of dams and through the incessant

siphoning off of water for agriculture and other

purposes. The rates of extinction of species in

freshwater environments are from four to six

times higher than in marine or terrestrial habitats.

Endemic species, such as the small aquatic snail

Potamolithus catharinae Pilsbry, 1911,

representative of the Family Hydrobiidae (Silva

& Veitenheimer-Mendes, 2004), and the tiny

freshwater limpets Burnupia ingae Lanzer, 1991

and Ferrissia gentilis Lanzer, 1991 (Family

Ancylidae), are particularly vulnerable to human

alterations of their environment (Agudo-Padron,

2011a, b).

The freshwater bivalve molluscs are

particularly sensitive to trampling, to organic and

chemical pollution, and other forms of

degradation of the environment. They present

relatively slow growth rates and they don’t

usually occupy disturbed environments.

Endemic species exist for each basin and many

of these are very restricted spatially and present

high rates of extinction due to the countless

environmental alterations provoked recently by

human settlement.

In the present work, the current regional

knowledge situation of these mollusc species is

revised, including IUCN general status and other

information, to promote their effective conservation.

RESULTS

CURRENT SITUATION

Class GASTROPODA

Subclass PROSOBRANCHIA/CAENOGASTRO-

PODA

Family AMPULLARIIDAE

Pomacea sordida Swainson, 1823

Category IUCN: without category established

Included in the “Lista das Especies da Fauna

Ameacadas de Extincao no Estado do Rio de Janeiro

- RJ” (1997), regional category “in danger”.

Subclass PULMONATA

Family ELLOBIIDAE

Melampus coffeus (Linnaeus, 1758)

Category IUCN: without category established

Reported in the “Lista das Especies da Fauna

Ameaqadas de Extingao no Estado do Rio de

Janeiro - RJ” (1997), regional category

“Vulnerable”. Species considered a “marine form

with wide ecological occurrence”.

Family MEGALOBULIMIDAE

Megalobulimus grandis (Martens, 1885) (Fig. 4)

Category IUCN: in danger

Megalobulimus proclivis (Martens, 1888) (Fig. 5)

Category IUCN: in danger

Megalobulimus oblongus (Muller, 1774)

Category IUCN: without category established

Recently included in the “Lista de Especies da

Flora e da Fauna Ameaqadas no Estado do Para -

PA” (2007), regional category “in danger”.

Family CHAROPIDAE

Rotadiscus schuppi (Suter, 1900)

Category IUCN: in danger

Family STREPTAXIDAE

Threatened freshwater and terrestrial molluscs (Mollusca, Gastropoda et Bivalvia) of Santa Catarina State, Southern Brazil: check list and evaluation of regional threats

Fig-7

Fig-9

Fig. 6

Fig. 8

Fig. 10

Fig. 11

Figure 6. Native freshwater mussels Anodontites patagonicus, 70 mm (photo P. Lenhard).

Figure 7. Native freshwater mussel Anodontites trapesialis, 75 mm (photo P. Lenhard).

Figure 8. Native freshwater mussel Leila blainvilleana, 120 mm (photo P. Lenhard).

Figure 9. Native freshwater mussel Mycetopoda legumen, 85 mm (photo P. Lenhard).

Figures 10-11. Regional variations of the native freshwater mussel Rhipidodonta charruana, 30-35 mm (photo P. Lenhard / A.I. Agudo-Padron).

A. I. Agudo-Padron

Rectartemon depressus (Heynemann, 1868)

Category IUCN: without category established

Recently included in the “Livro Vermelho da Fauna

Brasileira Ameagada de Extingao” (2003-2004).

Class BIVALVIA

Order UNIONOIDA

Family MYCETOPODIDAE

Anodontites elongatus (Swainson, 1823)

Category IUCN: without category established

Recently included in the “Livro Vermelho da

Fauna Brasileira Ameagada de Extingao” (2003-

2004).

Anodontites ferrarisi (d’Orbigny, 1835)

Category IUCN: in danger

Anodontites patagonicus (Lamarck, 1819) (Fig. 6)

Category IUCN: in danger

Anodontites tenebricosus (Lea, 1834)

Category IUCN: vulnerable

Anodontites trapesialis (Lamarck, 1819) (Fig. 7)

Category IUCN: vulnerable

Leila blainvilleana (Lea, 1835) (Fig. 8)

Category IUCN: in danger

Mycetopoda legumen (Martens, 1888) (Fig. 9)

Category IUCN: vulnerable

Mycetopoda siliquosa (Spix, 1827)

Category IUCN: vulnerable

Family HYRIIDAE

Diplodon expansus (Kuster, 1856)

Category IUCN: vulnerable

Diplodon multistriatus (Lea, 1834)

Category IUCN: vulnerable

Diplodon rhuacoicus (d’Orbigny, 1835)

Category IUCN: without category established

Recently included in the “Livro Vermelho da Fauna

Brasileira Ameagada de Extingao” (2003-2004).

Rhipidodonta charruana (d’Orbigny, 1835) (Fig. 10)

Category IUCN: vulnerable

Reported in the Brazilian lists (MMA, 2004;

Agudo-Padron, 2009c) under the taxonomic

synonymy Diplodon martensi (Ihering, 1893) -

see Simone (2006).

CONCLUSIONS

The public seminar entitled “IV Forum de

Discussao sobre a Fauna ameagada no Estado de

Santa Catarina” and held in March 2010

concluded that the species considered in this

study appear visibly undervalued in the Official

listing compiled by regional environment

institutions (IGNIS, 2010), with only a total

listing of four related marine species (two

bivalves = Crassostrea brasiliana, Euvola

ziczac; and two gastropods = Hastula cinerea,

Olivancillaria contortuplicata ).

It is hoped that soon this situation is properly

reviewed, corrected and updated.

ACKOWLEDGEMENTS

I am also very obliged to P. Lenhard and G.

Woehl Jr. for the photos.

REFERENCES

Agudo A.I., 2005. Praga de bivalves limnicos em acudes. Sao

Paulo, SP: Conquiliologistas do Brasil - CdB. Available

online at: http://www.conchasbrasil.org.br/materias/

pragas/limnicos.asp

Agudo A.I., 2007a. Continental land and freshwater molluscs

in Santa Catarina State, Southern Brasil: a general review

Threatened freshwater and terrestrial molluscs (Mollusca, Gastropoda et Bivalvia) of Santa Catarina State, Southern Brazil: check list and evaluation of regional threats

of current knowledge. Tentacle, 15: 11-14. Available

online at: http://www.hawaii.edu/cowielab/tentacle/

tentacle_15.pdf

Agudo A.I., 2007b. Moluscos na condigao de Pragas no

Brasil. Sao Paulo, SP: Conquiliologistas do Brasil - CdB.

Available online at: http://www.conchasbrasil.org.br/

materias/pragas/visaogeral/de fault. asp

Agudo A.I., 2008. Manejo e controle de Pragas de bivalves

“naiade” em acudes e viveiros piscicultores. Sao Paulo,

SP: Conquiliologistas do Brasil - CdB. Available online at:

http://www.conchasbrasil.org.br/materias/pragas/manejoe

controle/default.asp

Agudo A.I. & Bleicker M.S., 2006a. First general inventory of

the malacological fauna of Santa Catarina State, Southern

Brazil. Tentacle, 14: 8-10. Available online at:

http ://www.hawaii.edu/cowielab/tentacle/tentacle_ 1 4.pdf

Agudo A.I. & Bleicker M.S., 2006 b. Moluscos exoticos no

Estado de Santa Catarina. Informativo SBMa, 37: 6-8.

Agudo-Padron A.I., 2006. Intermediate host mollusks

(Gastropoda: Pulmonata) of parasitic diseases in Santa

Catarina State, Southern Brazil, with inclusion of new

records to add to regional inventory. Ellipsaria, 8: 11-12.

Agudo-Padron A.I., 2007a. Moluscos e saude publica no

Estado de Santa Catarina. Informativo SBMa, 38: 4-6.

Agudo-Padron A.I., 2007b. Diagnostico sobre a potencial

ocorrencia do mexilhao-dourado asiatico, Limnoperna

fortunei (Dunker, 1857), no Estado de Santa Catarina,

Brasil. Informativo SBMa, 38: 4-5.

Agudo-Padron A.I., 2008a. Levantamento biogeografico de

moluscos no Estado de Santa Catarina, SC, regiao Sul do

Brasil, Vertente Atlantica do Cone Meridional da America

do Sul. Caminhos de Geografia, 9: 126-133. Available

online at: http://www.caminhosdegeografia.ig.ufu.br/

viewarticle.php?id=664&layout=abstract

Agudo-Padron A.I., 2008b. Vulnerabilidade da rede

hidrografica do Estado de Santa Catarina, Sc, ante o

avango invasor do mexilhao-dourado, Limnoperna

fortunei (Dunker, 1857). Revista Discente Expressdes

Geogi'aficas, 4: 75-103. Available online at: http://www.

geograficas.cfh.ufsc.br/arquivo/ed04/artigo04.pdf

Agudo-Padron A.I., 2008c. Occurrence of the invasive exotic

freshwater snail Melanoides tuberculatus (Muller, 1774) in

Santa Catarina State, Southern Brazil, and the potential

impl ications for the local public health. Ellipsaria, 10: 16-17.

Agudo-Padron A.I., 2008d. Ocorrencia confirmada da semi-

lesma exotica europeia Milax valentianus Ferussac, 1821

na regiao Sul do Brasil. Informativo SBMa, 39: 3.

Agudo-Padron A.I., 2009a. Recent terrestrial and freshwater

molluscs of Santa Catarina State, Sc, Southern Brazil

region: a comprehensive synthesis and check list.

VISAYA, April 20 2009: 1-12. Available online at:

http://www.conchology.be/?t=4 1

Agudo-Padron A.I., 2009b. Recent continental malacological

researches and inventory in the Southern Brazil and the

general “Atlantic Slope of the South Cone” region, South

America: a comparative relationship addenda. VISAYA,

April 20 2009: 1-4. Available online at: http://www

,conchology.be/?t=4 1

Agudo-Padron A.I., 2009c. Endangered continental mollusks

of Santa Catarina State, Southern Brazil: an overview.

Ellipsaria, 11: 7-8.

Agudo-Padron A.I., 2011a. Mollusc fauna of Santa Catarina

State, Central Southern Brazil: current state of knowledge.

Tentacle, 19: 22-24. Available online at: http://www.hawaii.

edu/cowielab/tentacle/Tentacle_ 1 9.pdf

Agudo-Padron A.I. , 2011b. The continental molluscs of Santa

Catarina State, Central Southern Brasil: need for more

population studies. Tentacle, 19: 24-26. Available online at:

http://www.hawaii.edu/cowielab/tentacle/Tentacle_ 1 9.pdf

Agudo-Padron A.I. & Bleicker M.S., 2009. Malacological

research in the Serra do Tabuleiro Ecological State Park,

Santa Catarina’s State, SC, Southern Brasil. Tentacle, 17:

9-12. Available online at: http://www.hawaii.edu/

cowielab/tentacle/tentacle_ 1 7.pdf

Agudo-Padron A.I. & Lenhard P., 2010. Introduced and

invasive mollusc in Brazil: brief overview. Tentacle, 18:

37-41. Available online at: http://www. hawaii.edu/

co wielab/tentacle/Tentacle_ 1 8 .pdf

IGNIS - Planejamento e In-formagao Ambiental. 2010. Lista

das Especies da fauna ameagadas de Extingao em Santa

Catarina. Itajai, SC: IGNIS. Available online at:

http://ignis.org.br/lista/

Lista de Especies da Flora e da Fauna Ameagadas no Estado

do Para - PA (2007). Species List of the Flora and Fauna

Threatened in the State of Para - PA, SEMA - Secretaria

de Estado de Meio Ambiente, Resolugao 054/2007,

24/10/2007, Belem/Para”

Lista Oficial das Especies da Flora e Fauna Ameagadas de

Extingao na Cidade do Rio de Janeiro, 1997. Rio de Janeiro

(Municipio). Decreto n.° 15.793, de 4 de junho de 1997.

Mansur M.C.D., 2008. Bivalves Sul- Americanos: uma

diversidade ameagada. Curitiba, Parana: XXVII Congresso

Brasileiro de Zoologia, Resumo de Palestra. Available

online at: http://www.cbz2008.com.br/ palestras/Maria%

20Cristina%20Mansur%20_%20malacologia.pdf

Mansur M.C.D., Heydrich I., Pereira D„ Richinitti L.M.Z.,

Tarasconi J.C. & RIOS E. de C., 2003. Moluscos. hr.

Fontana C.S., Bencke G.A. & Reis R.E., Livro vermelho

da fauna ameagada de extingao no Rio Grande do Sul.

Porto Alegre, RS: EDIPUCRS, pp. 49-71.

MMA - Ministerio do Meio Ambiente. 2004. Lista Nacional

das Especies de Invertebrados Aquaticos e Peixes

Ameagadas de Extingao. Instrugao Normativa No. 5 de 2 1

Maio 2004. Brasilia, DF: Diario Oficial da Uniao, Segao

1, No. 102, 28/05/2004, pp.136-138.

A. I. Agudo-Padron

Ministerio do Meio Ambiente, 2008. Livro Vermelho da Fauna

Brasileira Amcacada de Extingao, Vol. 1 . Biodiversidade

19, Ed.: A. Barbosa Monteiro Machado, G. Moreira

Drummond, A. Pereira Paglia; Brasilia, 510 pp.)

Moraes M.S., 2006. O manual dos moluscos do Brasil. Jomal

da USP, 22 7. Available online at: http://www.usp.br/

jomsp/arquivo/ 2006/jusp783/pag07.htm

Silva M.C.P. & Veitenheimer-Mendes I.L., 2004. Rcdescricao

de Potamolithus catharinae com base em topotipos

(Gastropoda, Hydrobiidae), rio Hercilio, Santa Catarina,

Brasil. Iheringia, Serie Zoologia, 94: 83-88. Available

online at: http://www.scielo.br/pdEisz/v94nl/20466.pdf

Simone L.R.L., 2002. Terminado o levantamento sobre a

biodiversidade de moluscos continentais do Brasil.

Informativo SBMa, 33: 6.

Simone L.R.L., 2006. Land and freshwater molluscs of Brazil.

Sao Paulo, FAPESP, 390 pp.

Biodiversity Journal, 2011, 2 (2): 67-72

Contribution to the Knowledge of longhorn beetles (Coleoptera,

Cerambycidae) from Kenya

Vladimir Sakalian 1 & Georgi Georgiev 2

1 Institute of Biodiversity and Ecosystem Research of Bulgarian Academy of Sciences 1 Tzar Osvoboditel Blvd., 1000, Sofia, Bulgaria; e-mail:

sakalian@online.bg. - 2 Forest Research Institute of Bulgarian Academy of Sciences 132 St. Kliment Ohridski Blvd., 1756 Sofia, Bulgaria; e-

mail: ggeorgiev_fri@mail.bg

ABSTRACT As a result of expeditions of the first author in Kenya during the period 2003-2006, 40 species and subspecies

of longhorn beetles were collected and later determined by Dr. Karl Adlbauer. The faunistic list reports on

recent nomenclature, localities of collection as well as geographical distribution of established taxa.

KEY WORDS Cerambycidae, longhorn beetles, Kenia.

Received 09.03.2011; accepted 20.04.2011; printed 30.06.2011

INTRODUCTION

The cerambycid fauna of Ethiopian zoogeo-

graphical region includes over 3,000 valid species,

but its actual number is undoubtedly greater due to

the insufficient knowledge about longhorn beetles

in the tropics and subtropics (Plavilstshikov,

1936). During the period 2003-2006, the first

author collected many different insect species in

Kenya. Among the other coleopterological

material, a total number of 40 longhorn beetles

were established. The main purpose of this note is

to announce the species collected and to give

some data about their distribution.

MATERIALS AND METHODS

The study was conducted in different regions

of Kenya during the period 2003-2006 (Figs. 1-

6). The longhorn beetles were collected by

traditional entomological methods:

• Hand collection of cerambycids on flowers

and food plants (Fig. 7);

• Collection of cerambycids on grass and

bushes by entomological bag;

• Shaking of tree branches and crowns and

collection of fallen insects;

• Collection of cerambycids in sticky traps;

• Attracting cerambycids to lamp light;

• Rearing of adults in laboratory conditions

from infested parts of food plants.

Collected cerambicids were identified by Dr.

Karl Adlbauer.

Studied material is deposited in the Institute

of Biodiversity and Ecosystem Research of

Bulgarian Academy of Sciences Scientific Found

(Sofia, Bulgaria). Single specimens are kept in

K. Adlbauer ’s collection.

RESULTS AND DISCUSSION

PRIONINAE

Macrotomini

Macrotoma palmata (Fabricius, 1792)

Kenya, Elementeita Lake (00°28 , 31 ,, S,

36°15’46 ,, E), 1820 m, 14/15.IV.2006, 10 exx.;

North-east Kenya, Lower Tana River, Gamba

Guest House, stickly traps, 20/23. IV.2006, 1 ex.

Distribution: From Marocco to Saudi Arabia

and RSA, Mauritius (Adlbauer et al., 2008).

Prionotoma jordani (Lameere, 1903)

Kenya, Bogoria Lake, 11.04.2004, 1 ex.

Distribution: From Senegal to Burundi and

Angola (Delahaye et al., 2006).

V. Sakalian & G. Georgiev

Fig. 5

Fig. 6

Figure 1. Kenia, Arabuko-Sokoke forest (photo Eduard Jendek).

Figure 2. Kenia, Elementeita lake (photo Eduard Jendek).

Figure 3. Kenia, dead trunk of Acacia sp. near Elementeita lake - habitat of Macrotoma palmata (photo Eduard Jendek).

Figure 4. Kenia, Taita hills forest (photo Eduard Jendek).

Figure 5. Tana river (photo Gianfranco Curletti).

Figure 6. Kenia, Acacia lahai forest in Ngong hills - favorite place for many coleopteran species (photo Eduard Jendek).

Fig. 1

Fig. 3

Contribution to the Knowledge of Longhorn Beetles (Coleoptera, Cerambycidcie) from Kenya

CERAMBYCINAE

Xystrocerini

Xystrocera dispar Fahraeus,1872

Kenya, Nyanza District, Ruma National Park,

1050 m, 04.VII.2003, 1 ex.; Kenya, Lower Tana

River, Gamba, 25/27.X.2005, 3 exx.

Distribution: Tschad, Sudan, Saudi Arabia,

Namibia and RSA (Adlbauer et al., 2008).

Cerambycini

Neoplocaederus spinicornis (Fabricius, 1781)

Kenya, Lower Tana River, Gamba Guest

House, stickly traps, 20/23. IV.2006, 2 exx.

Distribution: Mauretania, Zimbabwe (Adlbauer

et al., 2008).

Figure 7. Oligosmerus sp. (photo Eduard Jendek).

Molorchini

Merionoeda africana Distant, 1899

NE Kenya, Arabuko - Sokoke Forest,

24/25. IV.2006, 1 ex.

Distribution: Congo-Kinshasa, Kenya, RSA

(Adlbauer, 1995).

Callichromatini

Litopus geniculatus Harold, 1880

Kenya, Road Nairobi-Namanga, Nikobe,

1500 m, 04.XII.2003, 1 ex.

Distribution: Ethiopia, Tanzania (Adlbauer et

al., 2008).

Litopus kenyensis Adlbauer, 2002

Kenya, Malindi, Kipepeo farm, (03°13’S,

40°06’E), 30 m, 24/25.VI.2006, 2 exx. (+ 1 ex. in

K. Adlbauer’s collection) (Adlbauer, 2002).

Distribution: Kenya.

Paracolobizus bicolor (Schmidt, 1922)

Kenya, Malindi, Kipepeo farm, (03°13’S,

40°06’E), 30 m, 24/25. VI.2006, 2 exx.

Distribution: Kenya, Tanzania (Juhel, 2010).

Cloniophorus nyassae (Bates, 1878)

Kenya, Shimba Hills, 150-200 m, 20.IV.2004,

1 ex.

Distribution: Kenya, Malawi (Schmidt, 1922).

Closteromerus claviger laevipes Fairmaire, 1887

Kenya, Nairobi, 20.IV.2004, 6 exx.; Kenya,

Ngong Hills Kiserian Distr. (01°26’56”S,

36°38’19”E), 1940 m, 17.IV.2006, 6 exx.

Distribution: Cameron, Eritrea, Somalia,

Tanzania (Adlbauer et al., 2008).

Rhopalomeces fulgurans Schmidt, 1922

Kenya, Nyanza Province, Mbita, (0°24’S,

34°12’E), 1050 m, 18.V.2003, 1 ex.; Kenya, Rifl

Valley, Province N Kiserian, 1700 m, 10.VI.2003,

3 exx.; Kenya, Nairobi, 25.XI-20.XII.2003, 2

exx.; Kenya, Nairobi, 20.IV.2004, 3 exx.; Kenya,

Narolc, 1750 m, 12.V.2004, 1 ex.; Kenya, Nairobi,

10.V.2004, 1 ex.; Central Kenya, Elementeita

Lake 1700 m, 12.V.2005, 1 ex.; Kenya, Ngong

Hills, Kiserian Distr. (01°26’56”S, 36°38 , 19”E),

1940 m, 17.IV.2006, 11 exx.

Distribution: Tanzania (Schmidt, 1922).

Rhopalomeces gracilis (Fahraeus, 1872)

NE Kenya, Arabuko - Sokoke Forest,

24/25. IV.2006, 1 ex.; Kenya, Malindi, Kipepeo farm

(03°13’S, 40°06’E), 30 m, 24/25 .VI.2006, 3 exx.

Distribution: Congo-Kinshasa, RSA (Adlbauer,

1995).

Promeces longipes (Olivier, 1795)

Kenya, Shimba Hills, 150-200 m, 20.IV.2004,

1 ex.

Distribution: Mocambique, RSA (Adlbauer,

2001 ).

V. Sakalian & G. Georgiev

Promeces suturalis (Harold, 1878)

Kenya, Gamba Distr., 14.0IV.2006, 1 ex.;

Kenya, Elementeita Lake (00 o 28’31”S,

36°15 , 46”E), 1820 m, 14/15.IV.2006, 1 ex.

Distribution: Kenya, Tanzania (Schmidt, 1922).

Hypargyra albilateris ssp. typ. (Harold, 1880)

Kenya, Rifl Valley, Province N Kiserian,

1700 m, 10.VI.2003, 2 exx.; Kenya, Nairobi,

20.IV.2004, 1 ex.; Kenya, Ngong Hills, Kiserian

Distr. (01 o 26’56”S, 36 0 38’19”E), 1940 m,

17.IV.2006, 4 exx.; NE Kenya, Malindi, Kipepeo

Farm, 24.IV.2006, 1 ex.

Distribution: Ethiopia, Kenya, Tanzania

(Juhel & Bentanachs, 2009).

Clytini

Calanthemis subcruciatus (White, 1855)

Kenya, Shimba Hills, 150-200 m, 20.IV.2004,

3 exx.; NE Kenya, Arabuko - Sokoke Forest,

24/25. IV.2006, 1 ex.

Distribution: Somalia, RSA (Adlbauer, 1995).

LAMIINAE

Phantasini

Phantasis avernica Thomson, 1865

Kenya, Elementeita Lake (00°28’31”S,

36°15’46 ,, E), 1820 m, 14/1 5. IV.2006, 1 ex.

Distribution: Sudan, RSA (Sudre & Teocchi,

2000).

Lamiini

Monochamus spectabilis (Perroud, 1855)

NE Kenya, Malindi, Kipepeo Farm, 24.IV.2006,

1 ex.

Distribution: Ethiopia, Congo-Brazzaville,

RSA, Madagascar, Comores (Adlbauer et al.,

2008).

Morimopsini

Monoxenus infraflavescens Breuning, 1949

Kenya, Ngangao Forest, (03°2r59”S,

38°20’26”E), 1850 m, 4.XI.2005, 1 ex.

Distribution: Kenya (Breuning, 1950).

Mesosini

Coptops aedificator (Fabricius, 1792)

Kenya, Lower Tana River, Sailoni,

25.X.2005, 1 ex.

Distribution: Africa (including Seychelles,

Comores, Madagascar), Saudi Arabia, SE-Asia,

Hawaii (Adlbauer et ah, 2008).

Tragocephalini

Spilotragus guttatus (Jordan, 1903)

Kenya, Road Nairobi-Namanga, Nikobe,

1500 m, 04. XII. 2003, 1 ex.; Central Kenya, Road

Kiserian to Oltepesi, 1770 m, 05.V.2005, 1 ex.

Distribution: Kenya (Breuning, 1934).

Pseudochariesthes nigroguttata (Aurivillius, 1908)

Central Kenya, Road Kiserian to Oltepesi,

1770 m, 05.V.2005, 1 ex.

Distribution: Kenya, Tanzania (Breuning, 1934).

Prosopocerini

Prosopocera peeli (Gahan, 1910)

Central Kenya, Elementeita Lake 1700 m,

12.V.2005, 1 ex.

Distribution: Ethiopia, Somalia, Kenya,

Tanzania (Adlbauer et ah, 2008).

Ceroplesini, Subtribus Crossotina

Frea marmorata Gerstaecker, 1871

NE Kenya, Arabuko - Sokoke Forest, ex.

Albicia sp., 24/25. IV.2006, 1 ex.

Distribution: Kenya, Zimbabwe (Breuning, 1942).

Frea aedificatoria Hintz, 1910 =Frea sublineata

Breuning, 1956

Kenya, Shimba Hills, 150-200 m, 20.IV.2004,

3 exx.

Distribution: Kenya, RSA (Breuning, 1942).

Crossotus plumicornis Serville, 1835

Kenya, Nyanza District, Ruma National Park,

1050 m, 04.VII.2003, 1 ex.; Kenya, Lower Tana

River, ex. Acacia sp., 25.X.2005, 1 ex.

Distribution: Mauritania, RSA (Sudre et ah,

2007).

Contribution to the Knowledge of Longhorn Beetles (Coleoptera, Cerambycidcie) from Kenya

Crossotus barbatus Gerstaecker, 1871

Kenya, Road Nairobi-Namanga, Nikobe,

1500 m, 04.XII.2003, 1 ex.

Distribution: Sudan, Somalia, Kenya, ?Malawi

(Sudre et al., 2007).

Ceroplesini, Subtribus Ceroplesina

Ceroplesis revoili pauli Fairmaire, 1884

South Kenya, Jipe Lake Forest, ex. Acacia

sp., 1 ex.

Distribution: Somalia, Kenya, Tanzania

(Breuning, 1937).

Ceroplesis bicincta (Fabricius,1798) (Fig. 8)

Kenya, Ngong Hills, Kiserian Distr.

(01°26’56”S, 36°38’19”E), 1940 m, 17.IV.2006,

1 ex.

Distribution: Congo-Kinshasa, RSA (Adlbauer,

2001).

Ceroplesis strandi Breuning, 1935

Western Kenya, Narok, 1750 m, 12.V.2004, 1

ex.; Western Kenya, Narok, 1716 m, 18.V.2005,

2 exx. (+ 1 ex. in K. Adlbauer’s collection).

Distribution: Zambia, Kenya (Breuning, 1937).

Apomecynini

Enaretta caudata (Fahraeus, 1872)

Central Kenya, Bogoria Lake, 900 m,

31.XI.2005, 1 ex.

Distribution: Uganda, RSA (Adlbauer, 2001).

Eunidiini

Eunidia brunneopunctata strigatoides Breuning, 1939

Kenya, Road Nairobi-Namanga, Nikobe,

1500 m, 04.XII.2003, 1 ex.; Kenya, Lower Tana

River, Sailoni Forest (02°09’18”S, 40 o lL04”E),

22/23. IV.2006, 1 ex.; Kenya, Road Voi to Taveta,

Border of Tsavo West N. P. (03°30’10”S,

38°16’25”E), 28/30. IV.2006, 1 ex.

Distribution: Senegal, Ethiopia, RSA

(Adlbauer et al., 2008).

Figure 8. Ceroplesis bicincta on Acacia sp. (photo Eduard Jendek)

Pteropliini

Pterolophia variolosa Kolbe, 1894

NE Kenya, Arabuko-Sokoke Forest,

24/25. IV.2006, 1 ex.

Distribution: Kenya, Tanzania (Breuning,

1961a).

Saperdini

Glenea apicalis westermanni (Thomson, 1860)

Kenya, Gilgil Distr., 14. IV.2006, 1 ex.

Distribution: Togo, RSA (Adlbauer, 2001).

Glenea arida Thomson, 1865

NE Kenya, Arabuko-Sokoke Forest,

24/25. IV.2006, 1 ex.

Distribution: Kenya, RSA (Breuning, 1958).

Phytoecia (Plepisanis) neavei Aurivillius, 1914

Kenya, Narok, 1750 m, 12.V.2004, 1 ex.

Distribution: Kongo-Kinshasa, Uganda,

Malawi (Breuning, 1951).

Phytoecia (Plepisanis) suturevittata Breuning, 1951

NE Kenya, Arabuko-Sokoke Forest,

24/2 5. IV. 2 006, 2 exx. (+ 1 ex. in K. Adlbauer’s

collection).

Distribution: Kenya (Breuning, 1951).

Phytoecia (Psendoplepisanis) somereni Breuning, 1951

Kenya, Narok, 1750 m, 12.V.2004, 1 ex.

Distribution: Kenya (Breuning, 1951).

V. Sakalian & G. Georgiev

Oberea pagana Harold, 1880

Central Kenya, Road Kiserian to Oltepesi,

1750-1770 m, 05.V.2005, 1 ex.

Distribution: Ethiopia, Kenya (Adlbauer et

al., 2008).

Oberea cingulata Aurivillius, 1914

Kenya, Ngong Hills, Kiserian Distr., (01°26’56”S,

36°38’19”E), 1940 m, 17.IV.2006, 1 ex.

Distribution: Lake Victoria, Kenya, Tanzania

(Breuning, 1961b).

CONCLUSIONS

Four species found in this study are known

with limited distribution only in Kenya -

Monoxenus infraflvescens, Spilotragus guttatus,

Phytoecia suturevittata and P. somereni - which

make them potential endemics for this country.

Other five cerambycids appear to be most

probably new for Kenya: Prionotoma jordani,

Rhopalomeces fulgurans , Rhopalomeces

gracilis , Promeces longipes and Ceroplesis

bicincta. It could be noted that new records

enlarge our knowledge on these species

distribution and increase species diversity of

Kenyan fauna. As a main conclusion we have to

underline that the Kenyan longhorn beetles fauna

is partially and incompletely studied that is why

any new contribution is very important to enrich

our learning of this fauna.

ACKNOWLEDGEMENTS

We are very grateful to Dr. Karl Adlbauer

(Graz, Austria) for determination and comments

on the collected species.

REFERENCES

Adlbauer K., 1995. Bockkafer aus Zimbabwe und

Transvaal, Teil II. Cerambycinae (Coleoptera,

Cerambycidae). Lambillionea, 95: 477-496.

Adlbauer K., 2001. Katalog und Fotoatlas der Bockkafer

Namibias (Cerambycidae). Taita Publishers, Hradec

Kralove, 80 pp.

Adlbauer K., 2002. Neue Cerambyciden aus Afrika sowie

neue Synonymien (Coleoptera, Cerambycidae). Les

Cahiers Magellanes, 13: 1-10.

Adlbauer K., Ayalew A., Beck R. & Drumont A., 2008.

Cerambyciden aus Athiopien (Coleoptera,

Cerambycidae). Linzer biologische Beitrage, 40: 1153-

1191.

Breuning S., 1934-1935. Etudes sur les Lamiaires (Coleop.

Cerambycidae). Premiere Tribu: Tragocephalini

Thomson. Novitates Entomologicae, Suppl. 2-3: 7-98.

Breuning S., 1937. Quadrieme Tribu: Ceroplesini Thomson.

Novitates Entomologicae, Suppl. 3: 231-270.

Breuning S., 1942. Dixieme tribu: Crossotini Thoms.

Novitates Entomologicae, Supp. 3, Fasc. 73-84: 8-101.

Breuning S., 1950. Revision des “Morimopsini”.

Longicornia, 1: 161-262.

Breuning S., 1951. Revision du genre Phytoecia (Col.

Cerambycidae). Entomologische Arbeiten aus dem

Museum Frey, 2: 1-103 and 353-460.

Breuning S., 1958. Revision der Gattung Glenea Newm.

(Col. Ceramb.) (3. Fortsetzung und SchluB).

Entomlogische Arbeiten des Museums Frey, 9: 804-907.

Breuning S., 1961a. Revision des Pteropliini de l’Afrique

noire (Troisieme partie). Bulletin de FI.F.A.N., 23, ser.

A: 1054-1097.

Breuning S., 1961b. Revision systematique des especes du

genre Oberea Mulsant du globe (Coleoptera

Cerambycidae) (2 me partie). Frustula Entomologica, 4:

61-140.

Delahaye N., Drumont A. & Sudre J., 2006. Catalogue des

Prioninae du Gabon (Coleoptera, Cerambycidae).

Lambillionea, 106, supp.: 1-32.

Juhel P., 2010. Troisieme contribution a l’etude des

Callichromatini africains: a propos du genre Colobizus

Schmidt, 1922 (Coleoptera, Cerambycidae, Cerambycinae).

Les Cahiers Magellanes, NS, 2: 31-38.

Juhel P. & Bentanachs J., 2009. Revision du genre

Helymaeus Thomson, 1864 et les genres voisins

(Coleoptera, Cerambycidae, Cerambycinae). Magellanes,

Collection systematique, 22: 1-81.

Plavilstshikov N., 1936. Faune de l’URSS. Insectes

Coleopteres. 21. Cerambycydae (P. 1), Moscou-

Leningrad, Edition de l’Academie des Sciences de F

URSS. 612 pp.

Schmidt M., 1922. Die afrilcanischen Callichrominen (Col.

Ceramb.). Archiv far Naturgeschichte, 6: 61-232.

Sudre J. & Teocchi P., 2000. Revision de la tribu des

Phantasini (Col. Cerambycidae, Lamiinae). Magellanes,

Collection systematique, 4: 1-81.

Sudre J., Teocchi P., Sama G. & Rousset F., 2007. Les

genres Crossotus , Biobessoides et Epidicho states

(Coleoptera, Cerambycidae, Lamiinae, Crossotini).

Magellanes, Collection systematique, 15: 1-78.

Biodiversity Journal, 2011, 2 (2): 73-84

Genetic diversity analysis of the durum wheat Graziella Ra,

Triticum turgidum L. subsp. durum (Desf.) Husn. (Poales, Poaceae)

M. Stella Colomba & Armando Gregorini 1

1 Dipartimento di Scienze della Terra, della Vita e dell’ Ambiente (DiSTeVA), Universita di Urbino “Carlo Bo”, Via Maggetti 22, 61029 Urbino

(PU), Italy ^Corresponding author, email: mariastella.colomba@uniurb.it

ABSTRACT For the first time, the durum wheat Graziella Ra was compared to four Italian durum wheat varieties (Cappelli,

Grazia, Flaminio and Svevo) and to Kamut in order to preliminary characterize its genome and to investigate

genetic diversity among and within the accessions by Amplified Fragment Length Polymorphisms (AFLPs),

Simple Sequence Repeats (SSRs) and a-gliadin gene sequence analysis. The main aim of the study was an

attempt to determine the relationship between the historic accession Graziella Ra and Kamut which is

considered an ancient relative of the durum subspecies. In addition, nutritional factors of Graziella Ra were

reported. Obtained results showed that (i) both AFLP and SSR molecular markers detected highly congruent

patterns of genetic diversity among the accessions showing nearly similar efficiency; (ii) for AFLPs,

percentage of polymorphic loci within accession ranged from 6.57% to 19.71% (mean 12.77%) and, for SSRs,

from 0% to 57.14% (mean 28.57%); (iii) principal component analysis (PC A) of genetic distance among

accessions showed the first two axes accounting for 58.03% (for AFLPs) and 61.60% (for SSRs) of the total

variability; (iv) for AFLPs, molecular variance was partitioned into 80% (variance among accessions) and 20%

(within accession) and, for SSRs, into 73% (variance among accessions) and 27% (within accession); (v)

cluster analysis of AFLP and SSR datasets displayed Graziella Ra and Kamut into the same cluster; and (vi)

molecular comparison of a-gliadin gene sequences showed Graziella Ra and Kamut in separate clusters. All

these findings indicate that Graziella Ra, although being very similar to Kamut, at least in the little part of the

genome herein investigated by molecular markers, may be considered a distinct accession showing appreciable

levels of genetic diversity and medium-high nutritional qualities.

KEY WORDS AFLP, a-gliadin gene, durum wheat; genetic diversity analysis, nutritional qualities, SSR; Triticum.

Received 12.04.2011; accepted 20.05.2011; printed 30.06.2011

INTRODUCTION

Durum wheat ( Triticum turgidum L. subsp.

durum) is the only tetraploid (AABB, 2n=4x=28)

species of wheat of commercial importance that

is widely cultivated today. It originated

thousands of years ago from a hybridization

(pollen exchange) of the wild diploid T.

monococcum L. (A genome) and the donor of the

B genome which, according to morphological,

geographical and cytological evidence, has

recently been recognized as T. speltoides

(Tausch) Gren. or a closely related species (von

Buren, 2001). In the last decades, a huge number

of durum wheat cultivars have been obtained by

artificial selection, generally based on high yield,

disease resistance and technological qualities

(e.g. bread- or pasta-making qualities) with little

emphasis on taste or dietary components. On the

other hand, at the same time, traditional local

varieties have been considerably reduced as a

result of the diffusion of new varieties of wheat.

To preserve genetic variability and reduce

genetic erosion it is extremely important

developing and maintaining local collections,

including old cultivars and landraces, which - at

least in some cases - may be employed for niche

cereal-based typical products. This was the case

of Graziella Ra, an ancient accession (not a

cultivar) of durum wheat which, thanks to its

M. Stella Colomba & Armando Gregorini

good taste and fine pasta-making qualities,

recently appeared on the market as Graziella

Ra®, an Italian trademark used in marketing

products made with the homonymous grain.

Currently, it is organically grown in Marches

(central Italy) by Alee Nero Cooperative

(Urbino, PU) mainly with the aims to contribute

to the preservation of local biodiversity and

increase the interest for ancient crops which are

at the basis of the Mediterranean diet.

This study was designed with the intent of

providing a preliminary characterization of

Graziella Ra genome, analysed for the first time.

To this aim, other five accessions chosen as

representatives of modern (Grazia, Flaminio,

Svevo), traditional (Cappelli) and ancient

(Graziella Ra, Kamut) wheats were selected to

obtain a small set of three modem and three older

durum accessions. Comparative analysis was

carried out by AFLPs (Amplified Fragment

Length Polymorphisms), microsatellites (SSRs,

Simple Sequence Repeats) and the a-gliadin

gene sequence to evaluate genetic diversity

within and among wheats under study.

MATERIALS AND METHODS

Accessions

Figure 1. Spike morphology of Graziella Ra (la) and Kamut (lb)

durum wheats.

lax with long narrow white glumes. The spikelet

lemmas have long and strong, more or less

deciduous, white or black awns (Fig. lb). The

grains are very large - up to twice the size of

bread wheat kernels - narrow, vitreous, and flinty

with a characteristic hump. The correct

subspecies is still in dispute; in fact, according to

Stallknecht et al. (1996), Kamut has been

classified, from time to time, as T. turgidum

polonicum , T. turgidum turanicum or T. turgidum

durum. Although its taxonomy is contentious, it is

considered an ancient relative of durum subspecies.

All wheats were provided by Alee Nero

Cooperative, with the exception of Kamut, kindly

supplied by Molini del Conero (Osimo, AN, Italy).

Graziella Ra (Fig. la) is a type of durum

wheat characterized by low yield (15-20 quintals

per hectare), medium-long cycle, tall size (about

120 cm) and a phenotype very similar to Kamut’ s

(see below) with large ears and long aristas. It

was brought to Italy at the end of ‘70s (see

http://www.alcenerocooperativa.it/pagina.asp7pa

g=443), forgotten for a long time and

rediscovered a few years ago due to its fine pasta-

making qualities. Cappelli is an Italian traditional

strain of durum wheat which deserves a

privileged place among the varieties of old

established durum wheat for being the very first

selected variety. Svevo, Grazia and Flaminio are

modern cultivars, with a great commercial

importance, employed for pasta or bread-making.

Kamut is a registered trademark of Kamut

International, Ltd., used in marketing products

made with the variety QK-77. It is characterized

by erect young shoots with very narrow

pubescent leaves, the plants tiller very little and

the straw thin. The spikes are narrow, lax or very

DNA extraction

Several seeds of each line were germinated in

the dark for two days. The seedlings were grown

in daylight for seven days. Leaf tissues -

sampled at the four-leaf stage from twenty

different plants per accession - were immediately

frozen in liquid nitrogen and ground in a mortar

with a pestle. Thirty mg of powder were used for

DNA extraction following the cetyltrimethylam-

monium bromide (CTAB) protocol (Doyle &

Doyle, 1990) with slight modifications. DNA

quality was tested by a 0.8% agarose gel

electrophoresis.

AFLP

AFLP genotyping was performed at Keygene

NV (Wageningen, The Nertherlands) using their

standard in-house developed protocols (Vos et

al., 1995). Briefly, DNA extracted from four

different plants for each parental line (for a total

Genetic diversity analysis of the durum wheat Graziella Ra, Triticum turgidum L. subsp. durum (Desf) Husn. (Poales, Poaceae) 75

of twenty-four samples) was fingerprinted using

ten AFLP primers, five Pstl (indicated as P35,

P36, P39, P41, P42) and five Taql (T40, T41,

T42, T44, T46) (Table 1) arranged in eight

primer combinations (P35/T44; P35/T46;

P36/T46; P39/T41; P39/T42; P41/T40; P41/T41

and P42/T41) (Table 2).

Micro satellite gen oty ping

Twelve different plants per accession

(seventy-two individuals) were employed. Nine

Simple Sequence Repeat (SSR) markers were

selected from several ones tested on the grounds

of their Tm, length and degree of polymorphism.

Primers are listed in Table 3 . A tailed PCR primer

was used for SSR analysis by adding a 19-base

Ml 3 oligo sequence (Ml 3 tail) to the 5' end of

each forward SSR primer. Thus, each SSR

reaction used three primers: two unlabelled SSR

primers one of which having an attached M13

sequence tail (5’-CACGACGTTGTAAAACG

AC-3’), and one universal FAM-labelled Ml 3

primer with the same sequence as the Ml 3 tail

(Schuelke, 2000; Boutin- Ganache et al., 2001;

Fukatsu et al., 2005). PCR reactions were carried

out in 10 pi of a solution containing 10 ng

genomic DNA, lx Mg-free PCR buffer solution,

0.25 mM dNTPs, 1 .5 mM MgCl 2 , 50 nM forward

primer, 5.0 nM reverse primer, 500 nM Ml 3-

labelled primer, 0.5 U AmpliTaq Gold DNA

polymerase (Applied Biosystems) and nuclease-

free water. Amplification was performed as

follows: 5 min at 95 °C; 20 sec at 94 °C, 30 sec

at 55 °C, 30 sec at 72 °C (42 cycles); and a final

extension stage of 5 min at 72 °C. PCR products

were separated with an ABI 3730 DNA

sequencer (Applied Biosystems) and the

fragments were sized by means of a ladder

labelled with a fluorochrome VIZ (LIZ500,

Applied Biosystems). Data were analysed with

GeneMapper 3.0 (Applied Biosystems).

A-gliadin gene Amplification, Cloning, Sequencing

and Analysis

DNA from two plants per accession (total of

twelve samples, different from samples

employed for molecular markers) was used for

PCR amplifications of the a-gliadin gene. Both

forward (5 ’-ATGAAGACCTTTCTCATCC-3 ’)

and reverse (5 ’-YYAGTTRGTACCGAAGATG

CC-3’) primers were designed on the conserved

5’ and 3’ ends of the coding region of the a-

gliadin gene sequences downloaded from the

GenBank database (ID: DQ296195, DQ296196

and AJ870965). PCR amplifications were carried

out - using a high fidelity Pfu DNA Polymerase

(Promega) - as follows: 95 °C for 2 min; 95 °C

for 1 min, 60 °C for 30 sec, 72 °C for 2 min (30

cycles); 72 °C for 5 min. Reaction products were

visualized by electrophoresis on a 1.2% agarose

gel containing TBE IX buffer and ethidium

bromide (0.5 pg/ml). An aliquot (1 pi) of the

PCR product was inserted into a pCR 4-TOPO

vector by the TA-cloning system and

transformation was performed on E. coli TOP 10

cells following the manufacturer’s instructions

(Invitrogen). Selected transformants were

analysed for presence of the insert by PCR,

grown in LB medium overnight and purified by

the Wizard Plus SV minipreps kit (Promega).

Finally, sequencing of plasmid inserts was done

by using automated DNA sequencers at Eurofms

MWG Operon. Sequences were visualized with

BioEdit Sequence Alignment Editor 7 (Hall,

1999), aligned with the ClustalW option included

in this software and double checked by eye.

Standard measures of nucleotide polymorphism

[mean pairwise differences (k), nucleotide

diversity (n = Pi and 7i JC = Pi corrected according

to Jukes and Cantor) and nucleotide divergence

(D xy ) between accessions] using the full set of all

sequences were computed by DNAsp 5 (Librado

& Rozas, 2009).

Statistical analysis

For AFLP and SSR datasets, analyses were

performed within GenAlEx 6.4 (Peakall &

Smouse, 2006), a user-friendly package with an

intuitive and consistent interface that allows to

analyse a wide range of population genetic data,

including both dominant (AFLP) and

codominant (SSR) datasets, within MS Excel.

For each accession, allele number (Na),

heterozygosity (He), number and frequency of

genotypes and percentages of polymorphic loci

were obtained by the software. Polymorphism

information content (PIC) of each SSR was

computed according to Botstein et al. (1980).

Nei’s unbiased genetic distance (Nei, 1978) was

M. Stella Colomba & Armando Gregorini

Primer name

sequence

P35

5 ’-GACTGCGTACATGCAG ACA-3 ’

P36

5 ’-GACTGCGTACATGCAG ACC-3’

P39

5’ -GACTGCGTACATGCAG AGA-3 ’

P41

5’ -GACTGCGTACATGCAG AGG-3’

P42

5 ’-GACTGCGTACATGCAG AGT-3’

T40

5’-GATGAGTCCTGACCGA AGC-3’

T41

5 ’-GATGAGTCCTGACCGA AGG-3’

T42

5’-GATGAGTCCTGACCGA AGT-3’

T44

5 ’-GATGAGTCCTGACCGA ATC-3’

T46

5-GATGAGTCCTGACCGA ATT-3’

Table 1.

P.st] (P) and Taql (T) primers employed for AFLP analysis

Primer combinations

No. of polymorphic bands

Mean diversity index (He)

Marker index*

P35/T44

0.082

1.56

P35/T46

0.018

0.20

P36/T46

0.087

1.39

P39/T41

0.044

1.01

P39/T42

0.003

0.04

P41/T40

0.010

0.17

P41/T41

0.029

0.38

P42/T41

0.032

0.80

*MI = (no. of polymorphic loci/PC) x (mean diversity index/PC); for details, see Powell et al. (1996).

Table 2. Polymorphism features of the eight AFLP primer combinations (PCs) used to estimate genetic

similarities among wheat accessions under study.

SSR

Primer sequence

Bare 174

For 5’ - TGGCATTTTTCTAGCACCAATACAT

Rev 5’ - GCGAACTGGACCAGCCTTCTATCTGTTC

DuPw2 1 7

For 5’ -CGAATTACACTTCCTTCTTCCG

Rev 5’ -CGAGCGTGTCTAACAAGTGC

Xgwm750

For 5’ - CTTGCACAGAGACGATGCAT

Rev 5 ’-TGAGTCAGTCTCACAACCGG

Xgwml045

For 5’ - ATCACAAGGAGTTTATCGCT

Rev 5’- GTCAATGGACCATGGGATTC

Xgwml038

For 5’ - GTGCTCCATGGCGTCTG

Rev 5’ - AGTCCAGCAAACATTCTCCA

Xgwml26

For 5’ - CACACGCTCCACCATGAC

Rev 5’ - GTTGAGTTGATGCGGGAGG

Xgwml027

For 5’ - CAGTTCTCCCGGCATGTATT

Rev 5’ - TTCACATTGTCGCGTTGAAT

Table 3. List of primers used for SSR analysis

Genetic diversity analysis of the durum wheat Graziella Ra, Triticum turgidum L. subsp. durum (Desf) Husn. (Poales, Poaceae) 77

calculated in the TFPGA program (Miller, 1997).

For both AFLPs and SSRs, phenetic diagrams

were constructed on corresponding pairwise

genetic distance matrices by the Unweighted

Pair-Group Method using Arithmetic averages

(UPGMA) (Sneath & Sokal, 1973) with the

UPGMA tree searching algorithm of the

software. A thousand replicate distance matrices

were bootstrapped to evaluate the robustness of

the trees. For both datasets, analysis of molecular

variance (AMOVA) was carried out to examine

total genetic variation among and within

accessions; in addition, Principal Component

Analysis (PC A) was performed in order to more

effectively view the patterns of genetic distance.

A Mantel test was used to detect the possible

correlation between AFLP and SSR accession

matrices. Statistical significance was determined

by random permutations, with the number of

permutations set to 9,999.

Phylogenetic analysis

Phylogenetic analyses were conducted in

MEGA 5 (Tamura et al., 2011) and BEAST 1.4.8

(Drummond & Rambaut, 2007) by Maximum

Likelihood (ML) and Bayesian Inference (BI).

For maximum likelihood analyses, the most

appropriate model of DNA substitution resulted

HKY (Hasegawa Kishino Yano). Bayesian

analysis was conducted by BEAST where the

topology and divergence times can be estimated

simultaneously from the data and therefore a

starting tree topology is not required, making it

particularly appropriate for groups with

uncertain phylogenies. BEAST input files were

generated with BEAUTi (v 1.4.8) using the a-

gliadin gene dataset (nexus format) and a HKY

substitution model. For partition into codon

positions, the SRD06 model (Shapiro et ah,

2006) was selected; this model links 1st and 2nd

codon positions but allows the 3rd positions to

have a different relative rate of substitution,

transition-transversion ratio and gamma

distributed rate heterogeneity and has been found

to provide a better fit for protein-coding

nucleotide data. BEAST was run for 1,000,000

generations with samples taken every 100

generations. Five independent Markov Chain

Monte Carlo (MCMC) runs were conducted and

the log and tree files were combined using

LogCombiner (v 1.4.8). The results were

examined by Tracer (v 1.5) to confirm stationary

distribution and adequate effective sample sizes

(i.e. ESS>200) for all parameters, indicating that

the sampled generations were uncorrelated and

the posterior distribution of the parameter was

long and accurate. TreeAnnotator (v 1.4.8) was

then used to summarize a best supported tree and

annotate the tree with posterior probabilities of

the nodes under investigation. FigTree (v 1.3.1)

was used to display the 95% confidence

intervals. BEAST, BEAUTi, LogCombiner,

Tracer, TreeAnnotator and FigTree were

downloaded from http://beast.bio.edu.ac.uk.

Support for the internodes was assessed by

bootstrap percentages (100 replicates for ML),

whereas for Bayesian inference tree, the

Bayesian posterior probability was computed. A-

gliadin gene sequences from Triticum aestivum

L. (GenBank ID: DQ 1663 77) and T. dicoccoides

Korn. (GenBank ID: DQ 1403 52) were employed

as outgroups.

Nutritional quality

Graziella Ra was investigated by Eurofins

Biolab srl (an Italian company specialized in

assays and controls, and in biological,

microbiological and chemical determinations)

using their standard in-house developed

protocols; each analysis was made in triplicates.

For Kamut, we report nutritional values available

at http://www.kamut.com.

RESULTS AND DISCUSSION

Molecular marker variation

A total of twenty-four individuals were

investigated using eight AFLP primer

combinations. One sample (from Svevo) didn’t

generate reliable fingerprintings and was

excluded from the analysis which, therefore,

resulted in twenty-three individuals showing a

total of 137 markers. For each AFLP primer

combination, number of polymorphic bands,

mean heterozygosity and marker index are

reported in Table 2. The presence/absence of

each fragment was encoded as a 1/0 score,

generating a binary data matrix. Within each

accession, mean heterozygosity ± standard error

M. Stella Colomba & Armando Gregorini

SSR

Chromosome

Allele 1

Allele 2

Allele 3

Allele 4

Allele 5

Allele 6

PIC

Mean He

MI*

Xgwml26

203

206

212

214

0.60

0.111

0.44

Barcl74

200

201

216

0.45

0.030

0.09

Xgwml045

192

198

202

0.61

0.058

0.17

Xgwml038

235

241

242

252

254

274

0.35

0.072

0.43

Xgwm750

230

234

236

249

0.68

0.102

0.41

Xgwml027

125

129

138

0.67

0.074

0.22

DuPw2 1 7

232

241

242

0.30

0.025

0.07

MI = (no. of polymorphic bands/SSR) x (mean diversity index/SSR); for details see Powell et al. (1996).

Table 4. List of all the alleles revealed by the microsatellites in the six accessions. Chromosome mapping, PIC, Polymorphism Information

Content; He, heterozygosity (also called diversity index); MI, Marker index are reported. Please note that alleles are expressed in nucleotide

length (bp = base pairs).

and percentage of polymorphism resulted

specifically: 0.024±0.008, 6,57% (Svevo);

0.081±0.014, 22.63% (Flaminio); 0.027±0.008,

8.03% (Kamut); 0.051±0.012, 11.68% (Graziella

Ra); 0.034±0.010, 8.03% (Cappelli); and

0.083±0.015, 19.71% (Grazia). Percentage of

polymorphism was, on average, 12.77%.

SSR data were classified according to a

qualitative scale, with scores ranging from 1 to 5,

describing the complexity of the amplification

profile for each primer (Stephenson et al., 1998).

Out of nine markers considered, seven [Bare 174,

Xgwm750, Xgwml038, Xgwml26 and

Xgwml027 (score 1, 2); Xgwml045 and

DuPw217 (score 3)] were included in the

analysis; whereas two (Xgwmll36 and

Xgwml009) failed to give rise to any

amplification products. SSRs revealed a total of

26 alleles in the six accessions. The number of

alleles per locus varied among these markers,

ranging from three (DuPw217, Bare 174,

Xgwml027, Xgwml045) to six (Xgwml038)

with an average of 3.7. As a measure of the

informativeness of microsatellites, the average

PIC (Polymorphism Information Content) value

was 0.53, ranging from 0.30 (DuPw217) to 0.68

(Xgwm750). For each marker, number of alleles,

PIC value, mean heterozygosity and marker index

(MI), a universal metric to represent the amount

of information obtained per experiment, are

reported in Table 4. As shown, marker index

values are not very high but, on the other hand,

considering that a PIC value >0.5 accounts for a

highly informative marker, 0.5 > PIC > 0.25 for

Accession

SSR

Allele (in bp)

Freq (%)

Svevo

Xgwml26

203

66.7

Svevo

Xgwml26

212

16.7

Svevo

Xgwml038

235

4.2

Svevo

Xgwml038

252

95.8

Flaminio

Bare 174

216

Graziella Ra

Xgwm750

249

9.1

Cappelli

Xgwm750

236

33.3

Cappelli

DuPw2 1 7

242

8.3

Grazia

Xgwml038

241

4.2

Grazia

Xgwml038

254

12.5

Grazia

Xgwml038

274

4.2

Grazia

DuPw217

232

100

Table 5. Unique alleles observed by SSR molecular markers. Rare

(frequency < 5%) and diagnostic alleles (frequency = 100%) are in bold.

an informative marker, and PIC < 0.25 for a

slightly informative marker (Botstein et al.,

1980), PIC values suggest that SSRs employed in

the present study resulted adequate and efficient.

With reference to the percentage of polymorphism

within each accession, observed values ranged

between 0% (Kamut) and 57.14% (Svevo and

Graziella Ra), going through 14.29% (Flaminio

and Grazia) and 28.87% (Cappelli), with an

average value of 28.57%. Based on SSR markers

herein reported along with the limited number of

accessions under investigation, Table 5 sum-

marizes private alleles observed in this study,

which may be used as a simple indirect measure

Genetic diversity analysis of the durum wheat Graziella Ra, Triticum turgidum L. subsp. durum (Desf) Husn. (Poales, Poaceae) 79

of genetic diversity. As shown, Grazia and Svevo

have the greatest number (four) of accession-

specific alleles; moreover, in Grazia the 232 bp

allele is monomorphic and hence could be

considered as diagnostic for the identification of

the variety; private alleles were observed in

nearly all the accessions, though three of them

were rare, with a percentage below 5%.

Average heterozygosities for AFLPs and SSRs

were not significantly different ( t test, p > 0.05).

Cluster analysis

Genetic distance was calculated using Nei’s

index. Cluster analysis applied to genetic distance

matrices produced the phenetic diagrams shown

in figures 2a and 2b. In both cases, Kamut and

Graziella Ra resulted very similar.

For both AFLPs and SSRs, patterns of PC A

revealed by the first two principal coordinate

axes accounted for the most of the variation in

the data, and so only the first two dimensions

were plotted in this paper. With reference to

pairwise individual genetic distance matrices, the

first two axes accounted for 63.15% (38.56% and

24.59%) of the AFLPs and 64.42% (42.26% and

22.16%) of the SSRs variation (Figs. 3a and 3b);

taking into account PCA of genetic distances

among accessions, the first two axes explained

58.03% (34.95% and 23.08%) of the AFLPs and

61.60% (36.11% and 25.49%) of the SSRs

variation. As shown in figures 3c and 3d, a high

degree of similarity between Graziella Ra and

Kamut was confirmed also by PCA.

Analysis of molecular variance (AMOVA)

Analysis of molecular variance partitioned the

total genetic variance into variance among

populations and within population. For AFLPs,

total variance was partitioned into 80% (variance

among populations) and 20% (within population)

(Fig. 4a); for SSRs, into 73% (among populations)

and 27% (within population) (Fig. 4b).

Correlation between AFLPs and SSRs

A strong correlation (r 2 = 0.92) between AFLP

and SSR population data matrices was obtained

by the Mantel test (Fig. 5). This finding suggests

that both types of molecular markers detected

highly congruent patterns of genetic diversity, at

the accession level, showing nearly similar

efficiency. In fact, AFLP and SSR average

heterozygosities were not significantly different

and observed values of MI or polymorphism

levels were in line with distinctive nature of these

markers. In particular, a higher MI for AFLPs

(0.69 vs\ 0.26) was the result of a higher

multiplex ratio component, due to the

simultaneous detection of several polymorphic

markers per single reaction. On the contrary, a

lower number of total bands was obtained for

SSRs, but all of these were polymorphic, thus

giving a higher average percentage of

polymorphism (28.57% vs. 12.77%) and

providing higher genetic diversity within a given

accession and lower genetic differentiation

among accessions than AFLP markers, which

was confirmed by AMOVA results as well.

A-gliadin gene

A-gliadin is a very important storage protein

widely studied for its implication in coeliac disease

(i.e. Koning, 2005; Gregorini et al., 2009 and

references therein). In this study molecular analysis

of the a- gliadin gene sequence was employed

either to analyse diversity at the gene level or to

provide a possible reconstruction of phylogenetic

relationships among wheats under study.

A-gliadin gene complete sequences obtained

in this study are available at GenBank as

GQ999807 (Cappelli, 903 bp), GQ999809

(Flaminio, 942 bp), GQ999811 (Grazia, 963

bp), GQ999813 (Graziella Ra, 909 bp),

GQ999815 (Kamut, 942 bp), GQ999817

(Svevo, 942 bp). Sequences alignment showed

78 variable sites, 79 mutations (S = 78, Eta =

79) and 75 insertions/deletions. Nucleotide

diversity ( 71 ) was 0.032 ± 0.011 and 0.033 when

corrected according to Jukes and Cantor ( 7 c JC ).

The average number of nucleotide differences

(k) was 28.867. Assessed mean sequence

identity was 91.5%; in particular, a-gliadin

genes from Graziella Ra and Kamut were 95%

identical. Deduced a-gliadin protein sequences

showed a mean identity of 89.4%; a-gliadins

from Graziella Ra and Kamut were 94.3%

identical. Maximum likelihood and Bayesian

Inference phylogenetic reconstructions

produced nearly identical results. ML and BI

M. Stella Colomba & Armando Gregorini

2a 2b

Figure 2. 2a. Dendrograms of the six wheat accessions based on Nei’s genetic distance calculated using 137 amplified fragment length

polymorphisms (AFLPs); 2b. Dendrograms of the six wheat accessions based on Nei’s genetic distance calculated using seven simple

sequence repeats (SSRs). 1, Svevo; 2, Flaminio; 3, Kamut; 4, Graziella Ra; 5, Cappelli; 6, Grazia. Bootstrap supporting values (1,000

replicates) are reported on the nodes.

Principal Coordinates

4 Svevo

■ Flaminio

a Kamut

Graziella

4 Cappelli

Grazia

Principal Coordinates

■ ■

■ ■ ,

•

♦♦ ♦

■ ■

. ■ •

• A *

•

* a*

Coord. 1

4 Svevo

■ Flaminio

A Kamut

4 Graziella

4 Cappelli

Grazia

Principal Coordinates

4 .Flam iruo

4 Cabpelli

4 Grazia

4 Svevo

Coord. 1

4 Cappelli

4 Svevo

♦ Graziella

« Kamut

* Flam inio

* Grazia

Coord. 1

Figure 3. Principal Component Analysis (PCA) plots of the first two axes based on genetic distance matrices among individuals for AFLP (3 a)

and SSR (3b) datasets; PCA plots of the first two axes based on genetic distance matrices among accessions for AFLP (3c) and SSR (3d)

datasets.

4a 4b

Percentages of Molecular Variance

Within Pops

VWthin Pops

20%

27%

N- ^Among Pops

Among Pops

73%

80%

Figure 4. Results of Analysis of Molecular variance (AMOVA) for the total AFLPs (4a) and SSRs (4b) showing the percentage of variation

among and within accessions.

Genetic diversity analysis of the durum wheat Graziella Ra, Triticum turgidum L. subsp. durum (Desf) Husn. (Poales, Poaceae) 81

PhiPTP SSRs vs PhiPTP AFLPS

PhiPTP SSRs

Figure 5. Output of Mantel test comparing the AFLP and SSR genetic distance matrices at accession level.

CappelliL

100

Taestiv

Tdicoccoides

100

GraziaL

- SvevoL

FlaminioL

KamutL

GraziellaL

GraziaL

FlaminioL

KamutL

SvevoL

GraziellaL

Figure 6. 6a. 50% majority rule Maximum Likelihood consensus tree inferred from the a-gliadin gene sequence alignment. Numbers above

branches represent bootstrap values (100 replicates). 6b. Bayesian consensus tree inferred from the a-gliadin gene sequence alignment. Numbers

above branches represent Bayesian posterior probabilities. T. aestivum and T. dicoccoides were employed as outgroups to root the trees.

M. Stella Colomba & Armando Gregorini

Common wheat *

Kamut

Graziella Ra

Water

11.5%

9.8%

10.8%

Protein**

14%

19.6%

11.80%

Total lipid (fat)

1.9%

2.6%

2.91%

Carbohydrate

72.7%

68.2%

61.23%

Crude fiber

2.1%

1.8%

2.7%

Ash

1.66%

1.82%

2.02%

MINERALS (mg/lOOg)

Calcium

31.2

Iron

3.9

4.2

2.5

Magnesium

117

153

85.3

Phosphorus

396

411

450

Potassium

400

446

379.1

Sodium

2.0

3.8

5.8

Zinc

3.2

4.3

Copper

0.44

0.46

0.5

Manganese

3.8

3.2

2.2

Selenium (mg/kg)

1.6-7

VITAMINS (mg/lOOg)

Thiamine (Bl)

0.42

0.45

>0.05

Riboflavin (B2)

0.11

0.12

0.02

Niacin

5.31

5.54

7.83

Panthotenic acid

0.91

0.23

0.04

Vitamin B6

0.35

0.08

0.94

Folacin

0.0405

0.0375

0.031

Vitamin E

1.2

1.7

0.43

AMINO ACIDS (g/100g)

Tryptophan

0.194

0.117

Threonine

0.403

0.540

0.42

Isoleucine

0.630

0.600

0.78

Leucine

0.964

1.23

0.86

Lysine

0.361

0.440

0.34

Methionine

0.222

0.250

Cystine

0.348

0.58

Phenylalanine

0.675

0.85

0.36

Tyrosine

0.404

0.430

0.21

Valine

0.624

0.800

0.46

Arginine

0.610

0.860

0.69

Histidine

0.321

0.430

0.29

Alanine

0.491

0.630

0.45

Aspartic acid

0.700

0.980

0.65

Glutamic acid

4.68

5.97

4.09

Glycine

0.560

0.650

0.47

Proline

1.50

1.44

1.31

Serine

0.662

0.930

0.51

an average number for all the wheats in the USD A report was used; **European scale on dry matter

Table 6. Nutritional values for common wheat*, Kamut® brand wheat (both available at www. kamut.com) and

Graziella Ra wheat (present paper).

Genetic diversity analysis of the durum wheat Graziella Ra, Triticum turgidum L. subsp. durum (Desf) Husn. (Poales, Poaceae) 83

consensus trees (Figs. 6a and 6b) showed that

molecular clustering disagreed with mor-

phological clustering, in fact, contrary to AFLPs

and SSRs, phylogenetic analyses of a-gliadin

gene sequences showed Graziella Ra and

Kamut in separate clusters. This finding not

only confirms that the two wheats are related

but also supports the hypothesis that, although

being similar - at least in the little part of the

genome investigated by molecular markers

employed in this study - Graziella Ra and

Kamut may be considered distinct accessions.

Nutritional quality

Given that all parameters linked to

nutritional qualities are affected by the

environment and that we compared Graziella

Ra (analysed in triplicates) with Kamut (whose

nutritional quality is reported in the Kamut web

site, without any descriptions of how each

parameter was assessed) a real comparison

(including statistics) was not possible.

Nevertheless, it is noticeable that all values of

dietary components of Graziella Ra are in line

with mean values reported for Kamut and other

commercially available durum wheats (Table

6). Hence, our results corroborate the idea that

Graziella Ra may be considered an accession

distinct from Kamut endowed by appreciable

levels of genetic diversity and medium-high

nutritional qualities.

ACKNOWLEDGEMENTS

We are grateful to R Bianchi for figure 1. This

research was supported by CIPE 20/04 - DGR

438/2005 to M.S. Colomba and A. Gregorini.

REFERENCES

Botstein D., White R.L., Skolnick M. & Davis R.W., 1980.

Construction of a genetic linkage map in man using

restriction fragment length polymorphisms. The

American Journal of Human Genetics, 32: 314-331.

Boutin-Ganache I., Raposo M., Raymond M. & Deschepper

C.F., 2001. M13-tailed primers improve the readability

and usability of microsatellite analyses performed with

two different allele-sizing methods. Biotechniques, 3 1 :

24-28.

Drummond A.J. & Rambaut A., 2007. BEAST: Bayesian

evolutionary analysis by sampling trees. BMC

Evolutionary Biology, 7: 1214-1257.

Doyle J.J. & Doyle J.L., 1990. Isolation of plant DNA from

fresh tissue. Focus, 12: 13-15.

Fukatsu E., Isoda K., Hirao T., Takahashi M. & Watanabe

A., 2005. Development and characterization of simple

sequence repeat DNA markers for Zelkova serrata.

Molecular Ecology Notes, 5: 378-380.

Gregorini A., Colomba M.S., Ellis H.J. & Ciclitira P.J.,

2009. Immunogenicity characterization of two ancient

wheat a-gliadin peptides related to coeliac disease.

Nutrients, 1: 276-290.

Hall T.A., 1999. BioEdit: a user-friendly biological

sequence alignment editor and analysis program for

Windows 95/98/NT. Nucleic Acids Symposium Series,

41: 95-98.

Koning F., 2005. Celiac disease: caught between a rock and

a hard place. Gastroenterology, 129: 1294-1301.

Librado R & Rozas J., 2009. DnaSP v5: a software for

comprehensive analysis of DNA polymorphism data.

Bioinformatics, 25: 1451-1452.

Miller M.P., 1997. Tools for population genetic analyses

(TFPGA 1.3): A windows program for the analysis of

allozyme and molecular population genetic data.

Available at http://www.marksgeneticsoftware.net/.

Nei M., 1978. Estimation of average heterozygosity and

genetic distance from a small number of individuals.

Genetics, 89: 583-590.

Peakall R. & Smouse P.E., 2006. GenAlEx6: genetic

analysis in Excel. Population genetic software for

teaching and research. Molecular Ecology Notes, 6:

288-295.

Powell W., Morgante M., Andre C., Hanafey M., Vogel J.,

Tingey S. & Rafalsky A., 1996. The comparison of

RFLP, RAPD, AFLP and SSR (microsatellite) markers

for germplasm analysis. Molecular Breeding, 2: 225-

238.

Schuelke M., 2000. An economic method for the fluorescent

labelling ofPCR fragments. Nature Biotechnology, 18:

233-234.

Shapiro B., Rambaut A. & Drummond A.J. , 2006. Choosing

appropriate substitution models for the phylogenetic

analysis of protein-coding sequences. Molecular

Biology and Evolution, 22: 7-9.

Sneath P.H.A. & Solcal R.R., 1973. Numerical taxonomy -

the principles and practice of numerical classification.

WH Freeman, San Francisco.

Stallknecht G.F., Gilbertson K.M. & Ranney J.E., 1996.

Alternative wheat cereals as food grains: Einkorn,

Emmer, Spelt, Kamut, and Triticale. In: Janick J (ed.)

Progress in new crops, ASHS Press, Alexandria, VA, pp.

156-170.

Stephenson P., Glenn B., Kirby J., Collins A., Devosk K.,

Busso C. & Gale M., 1998. Fifty new microsatellite loci

for the wheat genetic map. Theoretical and Applied

Genetics, 97: 946-949.

Tamura K., Peterson D., Peterson N., Stecher G., Nei M. &

Kumar S., 2011. MEGA5: Molecular Evolutionary

Genetics Analysis using Maximum Likelihood,

M. Stella Colomba & Armando Gregorini

Evolutionary Distance, and Maximum Parsimony

Methods. Molecular Biology and Evolution, doi:

10.1093/molbev/msrl21. First published online: May 4

2011 [Epub ahead of print], pdf available at

http://www.kumarlab.net/publications.

Von Buren M., 2001. Polymorphism in two homeologous

gamma-gliadin genes and the evolution of cultivated

wheat. Genetic Resources and Crop Evolution, 48:

205-220.

Vos P., Elogers R., Bleeker M., Reijans M., van der Lee

T.H., Hornes M., Frijters A., Pot J., Peleman J., Kuiper

M. & Zabeau M., 1995. AFLP: a new technique for

DNA fingerprinting. Nucleic Acids Research, 23:

4407-4414.

Biodiversity Journal, 2011, 2 (2): 85-88

Description of three new species of longhorn beetles (Coleoptera,

Cerambycidae) from Turkey and Syria

Gianfranco Sama 1 & Pierpaolo Rapuzzi 2

1 Via Raffaello Sanzio 84 - 47023 Cesena (FC), Italy. E-mail: francosama@gmail.com

2 Via Cialla, 48 - 33040 Prepotto (UD), Italy. E-mail: info@ronchidicialla.it

ABSTRACT The following new taxa are described and illustrated: Chlorophorus grosser i n. sp. from Southern and Eastern

Turkey, close to C. adelii Holzschuh, 1974 from Western Iran; Chlorophorus oezdikmeni n. sp. from Turkey

compared to C. hungaricus Seidlitz, 1891 and Leiopus wrzecionkoi n. sp. from North-Eastern Syria, compared

to L. syriacus (Ganglbauer, 1884).

KEY WORDS Cerambycidae, longhorn beetles, new species, Turkey, Syria.

Received 04.05.2011; accepted 24.05.2011; printed 30.06.2011

INTRODUCTION

Thanks to the courtesy of some colleagues we

were able to study the Cerambycidae collected

by them during their trips in Near Orient,

including new taxa which have recently been

published by ourselves (Rapuzzi & Sama, 2010;

Rapuzzi et al., 2011). The aim of this article is to

describe two new species belonging to the genus

Chlorophorus Chevrolat, 1863 (Cerambycidae,

Clytini) discovered in Turkey by our colleague

Semra Turgut (entomologist at the Gazi

University, Ankara) and by the Czech

entomologist Walter Grosser respectively, as

well as a new species of Leiopus Audinet-

Serville, 1835 (Cerambycidae, Acanthocinini)

collected by Antonin Wrzecionko.

Chlorophorus grossed n. sp.

Material examined. Holotype female (Fig.

1): Turkey, Sirnak prov.: Mesindagi geg., 25 Km

NW Sirnak, 1600 m, 37°67’N 42°31’E,

23 .VI. 20 10, Walter Grosser legit; paratypes: 1

male (not available for detailed study): same data

as the holotype; 1 female: Hakkari prov., 25 Km

E Giizeldere, 37°32’N 43°49’E, 930 m,

22. VI. 20 10, Walter Grosser legit; 7 males and 8

females (immature adults just emerged ex larvae

and pupae): same locality as the holotype,

15.V.2011, ex larvae and pupae in Quercus sp., R

Rapuzzi & G. Sama legit. Holotype in P. Rapuzzi

collection; paratypes in W. Grosser, P. Rapuzzi,

G. Sama and J. Vofiselc collections.

Description of the holotype. body length

9 mm. Integument reddish brown, the apical

third of elytra, the hind legs and the ventral

face of body black-brown. Front with a distinct

median groove between the antennal tubercles.

Pronotum strongly globose, as long as wide,

discal surface with quite denser rasp-like

punctures and sparsely clothed with fine

greyish recumbent pubescence; this

pubescence is chiefly condensed at sides as

well as on front and, more widely, on basal

margin. Scutellum densely clothed with white

pubescence. Elytra moderately short and wide,

apex truncate with a small tooth on the outer

side; surface predominantly reddish-brown

(black-brown on apical third only) with a

pattern of distinctly contrasting stripes of

white pubescence (see Fig. 1); discal surface

very densely and finely punctate and clothed

with short recumbent black pubescence.

G. Sam a & P. Rapuzzi

Figure 1. Chlorophorus grosseri n. sp. holotype female.

Ventral side of body brownish-black, meso-

and metepisterna, base of the metasternum and

base of the first and second visible sternites

densely clothed with contrasting white

pubescence. Antennae reddish-brown, short,

hardly extending to the middle of elytra, third

to fifth joints sparsely clothed with erect hairs

on latero-ventral surface. Front legs reddish

brown, middle femora with claws blackish,

hind legs black.

Variability. The male (Fig. 2) differs from

the female by its more elongate pronotum,

similar to C. adelii Holzschuh, 1974; the female

paratype does not show difference except the

length, 10 mm.

Etimology. the new species is named in

honour of our friend Walter Grosser from Czech

Republic, who collected the first specimens.

Figure 2. Chlorophorus grosseri n. sp. paratype male.

Distribution and ecology. At present, the

new species is known from Southern and Eastern

Turkey. Larval bionomics similar to C. adelii , C.

ringenbachi Sama, 2004 from Libya and C.

favieri Fairmaire, 1873 from Morocco;

oviposition takes place on dead apical part of

small living branches or stumps (2-5 cm in

diameter) cut by people the previous year or

girdled by other Cerambycidae.

Comparative notes. C. grosseri n. sp. is

closely related to C. adelii Holzschuh, 1974 from

Zagros Mountains (western Iran) (male and

female paratypes examined). This latter can be

easily distinguished as follows: pronotum, in both

sexes, longer than wide, sub parallel-sided, elytral

integument predominantly black, brown on basal

third only, antennae somewhat more robust, with

proximal segments in average more elongate and

distal segments evidently shortened.

Description of three new species of longhorn beetles (Coleoptera, Cerambycidae) from Turkey and Syria

Cholorophorus oezdikmeni n. sp.

Material examined. Holotype male (Fig. 3)

and three paratypes males: Karaman Marash

prov., Andirin, 15. VII. 2003, S. Turgut legit.

Holotype in P. Rapuzzi collection; paratypes in

H. Ozdikmen (Gazi University, Ankara) and G.

Sama collections.

Description of the holotype. Body length

10 mm, entirely black except two dark-red

spots on the pronotal disc and the elytral

pattern. Front subquadrate with an unpunctate

median area with a thin median groove.

Pronotum as long as wide, globose, densely

clothed with irregular vermiculate punctures

and long white erect hairs, entirely black

except one small, indistinct reddish spot on

each side of the middle of the disc. Scutellum

rounded, bordered with dense white

pubescence. Elytra sub parallel-sided, black-

brown, clothed on basal third with numerous

erect white hairs and a pattern of whitish

pubescence similar to C. hungaricus Seidlitz,

1891. Antennae short, hardly exceeding the

middle of elytra.

Variability. Female unknown. Paratypes

males: length varies from 9 to 12 mm; the red

pronotal spots varies in size and shape: they can

be very reduced like in the holotype, fused in a

discal “M” shaped drawing or extended as a thin

oblique line on each side of the disc.

Etimology. we are pleased to dedicate the

new species to our friend and colleague Huseyin

Ozdikmen (Gazi University, Ankara), for the

authorisation to study the material belonging to

his collection and for various help during our

research on Turkish Cerambycidae.

Distribution and ecology. C. oezdikmeni n.

sp. was collected in South-Western Turkey.

Larval biology is unknown.

Comparative notes. C. oezdikmeni n. sp.

belongs to the C. trifasciatus (Fabricius, 1781)

species group; because of its pronotum and

elytral base clothed with long erect hairs it is

similar to Chlorophorus hungaricus Seidlitz,

1891, from which it can be immediately

distinguished by its almost entirely black

pronotum.

Leiopus wrzecionkoi n. sp.

Material examined. Holotypus male (Fig.

4): Syria, Slinfah, Jabal An Nusayriyah [written

as “Jabal An Nusaynyah” on labels], 1,300-1,800

m, 18.IV.2010, ex larva from Alnus sp., A.

Wrzecionlco legit; paratypes: eighteen males,

five females: same data as the holotype; sixteen

males, two females: Syria, Jabal An Nusayryah,

Slinfah, 1,300-1,800 m, 27.IV.2008, A.

Wrzecionko legit; one male: Slinfah; “the ridge

above the town”, 25.V.2005, D. Sane legit, “The

imago was beaten from the dry oak twig attached

to the living tree”. Holotype in P. Rapuzzi

collection, paratypes in P. Rapuzzi, G. Sama, D.

Sane, A. Wrzecionko and Z. Kostal collections.

Description of the holotype. Body length

8 mm. Integument black, pronotum and elytra

densely clothed with greyish recumbent

pubescence, third to tenth antennal joints more

or less widely reddish at base. Head black with

front sparsely clothed with white hairs, vertex

with a deep impression between the antennal

insertions. Pronotum transverse with an acute

short tooth directed backward on each side just

behind the middle, discal surface marked with

numerous spots of black pubescence. Elytra

short, somewhat flattened chiefly toward the

apex and the sides, attenuate apically; discal

surface clothed with short cinereous

pubescence not masking the ground punctation

and marked with a distinctly contrasting

pattern consisting of numerous black round

spots (each one originating a very short oblique

seta) irregularly distributed on the basal and the

apical quarter and along the suture, a median

large black band narrowly interrupted near the

suture and a longitudinal band entirely

covering the epipleurae and the lateral margin

of elytra. Legs and tarsi black, sparsely clothed

with whitish pubescence locally condensed

forming a median ring on tibiae and tarsi.

Antennae long, exceeding the elytral apices

with six segments.

Variability. The specimens we could study

show a range of length between 9 to 11 mm.

Pronotal and elytral black spots and stripes are

sometimes more extended or reduced like in

other species of the genus.

G. Sam a & P. Rapuzzi

Figure 3. Chlorophorus oezdikmeni n. sp. holotype male.

Etymology. We are pleased to dedicate this

new species to our friend Antonin Wrzecionko

who discovered it.

Distribution and ecology. L. wrzecionkoi n.

sp. was collected from North-Eastern Syria. Most

specimens were collected in dead branches of Alnus

sp. or by beating dried oak twigs.

Comparative notes. Despite its resemblance

to L. punctulatus (Paykull, 1800) from Europe,

due to its black body and its elytral pattern,

Leiopus wrzecionkoi n. sp. belongs to the L.

syriacus (Ganglbauer, 1884) species group. It is

chiefly similar to L. syriacus abieticola Sama &

Rapuzzi, 2010 from southern Turkey which can

be distinguished from the new species by the

integument constantly light-brown instead of

piceous-black and the elytra distinctly convex.

ACKNOWLEDGEMENTS

We wish to thank our colleagues and friends

Antonin Wrzecionko (Horni Sucha, Czech

Republic), Walter Grosser (Opava, Czech

Republic), Huseyin Ozdikmen and Semra

Turgut (Gazi Universitesi, Fen-Edebiyat

Fakultesi, Biyoloji Bolumii, Ankara) who

kindly sent material of their collections for

identification.

REFERENCES

Rapuzzi P. & Sama G., 2010. Description of new

Cerambycidae from Greece, Turkey, Northern Syria and

China. Quaderno di Studi e Notizie di Storia Naturale

della Romagna, 29 (2009): 181-188.

Rapuzzi P., Sama G. & Tichy T., 2011. Description of a new

species of Poecilium Fairmaire, 1864 from Syria. Munis

Entomology & Zoology, 6: 673-675.

Biodiversity Journal, 2011, 2 (2): 89-96

Does diet in lacertid lizards reflect prey availability? Evidence for

selective predation in the Aeolian wall lizard, Podarcis raffone

(Mertens, 1952) (Reptilia, Lacertidae)

Pietro Lo Cascio 1 & Massimo Capula 2

1 Associazione Nesos, via Vittorio Emanuele 24, 98055 Lipari (ME), Italy; e-mail: plocascio@nesos.org.

2 Museo Civico di Zoologia, Via Aldrovandi 18, 00197 Roma, Italy; e-mail: massimo.capula@comune.roma.it.

ABSTRACT In this paper the invertebrate fauna occurring on Scoglio Faraglione, a tiny Aeolian island (Aeolian

Archipelago, NE Sicily) inhabited by a population of the critically endangered lacertid lizard Podarcis raffonei

(Mertens, 1952), was censused at different seasons and the resulting data were then compared with data

obtained analysing prey composition and prey abundance in the diet of the lizards occurring on the same islet.

The diet of Podarcis raffonei was mainly based on insects and other arthropods. The results indicate that diet

composition is not directly influenced by prey availability and temporal prey abundance, and that there is

strong evidence indicating selective predation. Lizards prey upon a number of arthropod categories fewer than

that recorded in field. Some invertebrate taxa (e.g. Diptera and Gastropoda) are really less attractive for lizards

and are rarely preyed or not preyed at all despite their spatial and/or temporal abundance. This suggests that

Podarcis raffonei is able to operate a hierarchical choice within the range of prey items constituting its prey

spectrum, probably through the ability to discriminate between prey chemicals or visually oriented predation.

KEY WORDS Podarcis raffonei; Lacertidae; predator selectivity; prey availability; feeding behavior; Aeolian Islands.

Received 10.05.2011; accepted 30.05.2011; printed 30.06.2011

INTRODUCTION

Most lacertid lizards of the Mediterranean area

are known to be active foragers and generalist

predators (see e.g. Podarcis siculus : Kabisch &

Engelmann, 1969; Perez-Mellado & Corti,

1993). They prey on a wide variety of

invertebrates, mainly on arthropods (e.g.

Arachnidae, Insects larvae, Diptera, Coleoptera,

Heteroptera, Hymenoptera, Orthoptera, Gastropoda)

(see e.g. Capula et al., 1993; Rugiero, 1994;

Corti & Lo Cascio, 2002; Bonacci et al., 2008;

Corti et al., 2011), while occasionally small

vertebrates and vegetal matter can be also eaten

(Sorci, 1990; Sicilia et al., 2001; Capula &

Aloise, in press). The feeding behavior of some

lacertid lizards seems to be opportunistic, as

indicated by the consumption of different preys

in different habitats and/or geographic areas by

the same species. However, few data are

available on predator selectivity and prey choice

as well as prey availability in the field (see e.g.

Heulin, 1986; Dominguez & Salvador, 1990;

Maragou et al., 1996; Adamopoulou & Legakis,

2002; Perez-Mellado et al., 2003; Bonacci et al.,

2008). Hence special attention should be devoted

to study selective predation and how diets of

lacertid lizards relate to changes in the

abundance of their prey, especially in micro-

insular habitats, which are generally affected by

extreme poorness of trophic resources and where

lizards are usually assumed to be adapted to

exploit the widest range of preys, alternatively

adopting opportunistic or generalist feeding

strategies (Perez-Mellado & Corti, 1993;

Carretero, 2004; Luiselli, 2008).

Podarcis raffonei (Mertens, 1952) is a

lacertid lizard endemic to the Aeolian

Archipelago (NE Sicily), where it occurs with

four relict populations on three tiny islets

P. Lo Cascio & M. Capula

(Strombolicchio, Scoglio Faraglione, La Canna)

and on a very small area of Vulcano Island (Lo

Cascio, 2010; Capula & Lo Cascio, 2011). The

conservation status of this species has recently

received attention because it is likely threatened

with extinction (Capula et al., 2002; Capula,

2006; Lo Cascio, 2010; Capula & Lo Cascio,

2011). As most of Mediterranean island lacertid

lizards (see e.g. Perez-Mellado & Corti, 1993;

Van Damme, 1999), the diet of the Aeolian wall

lizard is known to be based mainly on insects and

other arthropods, but also includes variable

percentages of vegetal matter (Luiselli et al.,

2004; Lo Cascio, 2006; Capula & Lo Cascio,

2011). However, no data are available concerning

prey choice and prey availability for the species.

The main aim of this study was to explore

whether P. raffonei selects preys in accordance

with their availability in the environment. To test

this, the invertebrate fauna occurring on Scoglio

Faraglione, which is an Aeolian tiny islet

inhabited by P. raffonei , was censused at

different seasons, and the resulting data were

then compared with data obtained analysing prey

composition and prey abundance in the diet of

the lizards occurring on the same islet.

MATERIALS AND METHODS

Study area

Scoglio Faraglione (38°34’77” N - 14 o 48’08”

E of Greenwich) is an uninhabited tiny islet of

the Aeolian Archipelago. It lies in the Pollara

Bay, 300 m off the western coast of Salina Island.

The surface is 5,765 m 2 and the maximum

altitude is 33 m a.s.l. The islet is composed by

basaltic lavas, and was definitively isolated from

the main island about 15,000-10,000 years ago,

due to erosive processes, changes in eustatic sea

level which occurred after the Last Glacial

Maximum, and catastrophic eruption of the

Pollara crater (13,000 yrs B.P.), which involved

most part of the western slope of Salina Island

and destroyed its original extension (Calanchi et

al., 2007). Average annual rainfall (on the main

island) is about 600 mm, with a peak in

December and a minimum in July; average

temperatures range from 13.3 °C (January) to

29.8 °C (August). The top of the Scoglio

Faraglione islet is covered by dense shrub

vegetation, which is characterized by the

occurrence of Senecio cineraria ssp. bicolor ,

Dianthus rupicola ssp. aeolicus , and Lotus

cytisoides , while the rocky slopes of the basal

belt harbour halo-chasmophytic plant communities

dominated by Limonium minutiflonim and Inula

crithmoides. Apart from the lizards, the only

vertebrates that inhabit the islet are the Moorish

gecko, Tarentola mauritanica , a small colony of

Yellow-legged gull, Larus michahellis, and few

pairs of other seabird species. As to the

invertebrate fauna of Scoglio Faraglione, a non-

exhaustive list is given by Lo Cascio & Navarra

(2003).

Study lizards

The population of Podarcis raffonei

occurring on Scoglio Faraglione islet is

characterized by medium-sized lizards with

brownish dorsal coloration and ventral parts

pearl-grey; it is referred to the ssp. alvearioi and

is morphologically relatively differentiated from

the populations of the same subspecies occurring

on La Canna islet and Vulcano Island (Capula et

al., 2009). Lizards are observed especially on the

top of the islet, and are active mainly from March

to November; however, occasional activity may

be recorded also in sunny days during Winter.

The activity pattern is unimodal in Spring and

Autumn, and bimodal in Summer (Lo Cascio,

2006). The density of lizards ranges from 0.18 to

0.37 individuals/m 2 , and the estimated

population size is about 300 individuals (Lo

Cascio, 2006; Capula & Lo Cascio, 2011).

Sampling and taxonomic identification

Field sampling was carried out during three

visits in May, July, and October 2005. For the

invertebrates, two sampling areas per session

were selected on the top of the islet; each was 1

x 1 m sized. A better procedure would have

required to seal completely the sample-area,

using a biocenometer of 1 m 3 (see Perez-Mellado

et al., 2003), in order to collect all the animals

occurring on soil, on vegetation and aerial parts

inside the box. However, taking into account the

fragility of the studied ecosystem, the peculiar

vegetation pattern, and the morphology of the

islet, a different methodological protocol was

Does diet in lacertid lizards reflect prey availability? Evidence for selective predation in the Aeolian wall lizard, Podarcis raffonei 91

adopted, following some of the proposals

summarized by Disney (1986) and Ausden

(1996). Into each sampling area invertebrates

were collected i) by direct searching on substrate,

under stones and on plants, using a pooter; ii)

taking samples of soil and plant debris up to 10-

15 cm depth, which were then examined and

hand sorted in laboratory; iii) by sweep netting

and beating on foliage; also, a plastic yellow

Moericke trap (40 cm of diameter, filled by water

and detergent to decrease the surface tension)

was placed at the same level of the higher layer

of vegetation for 5-6 hours, corresponding to the

timeframe of lizards’ activity. All the collected

specimens were preserved in alcohol, except for

Coleoptera, which were stored as dry material in

the collection of one of the authors (PLC) and

used for further studies. The taxonomic

identification of the invertebrate fauna samples

collected was performed comparing material

preserved in the entomological collections of the

Zoological Museum of Florence “La Specola”.

In the present analysis, the representatives of the

invertebrate fauna were identified to OTUs

(Operative Taxonomic Units: see Sneath &

Sokal, 1973; Carretero, 2004), approximated to

class/order level; the identification to OTUs at

the family level was only performed for

Coleoptera Melyridae and Hymenoptera

Formicidae, because of the importance of these

taxa in the diet of the local population of P.

raffonei (Lo Cascio, 2006). The following

abbreviations were used to indicate the OTUs in

the text and figures: AC A, Acarina; ARA,

Araneae; ART, unidentified Arthropoda; CHI,

Chilopoda; CLB, Collembola; COL, Coleoptera;

DPL, Diplopoda; DPT, Diptera; FOR,

Hymenoptera Formicidae; GAS, Gastropoda;

HET, Heteroptera; HOM, Homoptera; HYM,

Hymenoptera; ISO, Crustacea Isopoda; LAR,

insect larvae; LEP, Lepidoptera; MEL,

Coleoptera Melyridae; NEM, Nematoda; NEU,

Neuroptera; ODO, Odonata; PSE,

Pseudoscorpiones.

Invertebrate fauna biomass was assessed

using the following protocol: to each OTU was

assigned a value (ranging from 0 to 10) which

was estimated on the basis of its average size.

For instance, the coleopterans occurring on the

islet include about ten species, whose length

ranges from 4 to 15 mm; the average size

calculated for that taxon was 5.5. The value

assigned to each OTU was then multiplied with

the total number of specimens collected in the

field for each OTU. The diet of lizards (adult

individuals only; snout- vent length (SVL) > 40

mm) was studied on the basis of faecal pellets

analysis. Faecal pellets were obtained from

individuals captured in the field; after faecal

pellets collecting, lizards were released in the site

of capture (see Lo Cascio, 2006). Faecal contents

were examined in the laboratory under

stereoscope (10-40 X); item counting was based

on the analysis of cephalic capsulae, wings, and

legs, following the minimum numbers criterion

by sample. The invertebrate remains were

identified to OTUs at class/order/family level, as

above mentioned.

Statistical analysis

The diversity of prey item OTUs and

invertebrate fauna OTUs collected in the field

was calculated using Shannon Index (Shannon,

1948; see also Chao & Shen, 2003). Statistical

analyses were performed using SPSS 0 version

11.5 for Windows PC package, with alpha set at

5% and all test being two tailed.

RESULTS

The diet of lizards was composed mainly by

arthropods, although plant matter was also

recorded. A total number of 95 remains of

arthropod preys were obtained from 34 faecal

pellets of lizards at the study area. The

composition and abundance of prey items and

their temporal variations are summarized in

Table 1. The identifiable preys (i.p.) were 2.94 ±

1.87 per faecal pellet; the i.p. number differed

significantly among seasons (May: 4.18 ± 2.08;

July: 2.75 ± 1.98; October: 1.92 ± 0.90; F 20g =

5.22, P = 0.01). The prey spectrum also varied in

a statistically significant way among seasons (x 2

= 47.59, df = 26, P = 0.006), and the diet of lizards

was more diversified in October (77 = 2.146) and

May (// = 2.058) than in July (// = 1.898);

however, in the latter comparison prey diversity

was estimated analysing total amount of

consumed preys only, without considering their

seasonal variation. Overall, N = 696 invertebrates

P. Lo Cascio & M. Capula

belonging to 21 different OTUs were collected

into the sampling areas (see Fig. 1). Sixty seven

percent of the OTUs collected in the sampling

areas (14 out of 21) were found as prey items of

lizards (see Table 1). Formicidae (FOR),

Coleoptera (COL+MEL), Hymenoptera (HYM)

and Diplopoda (DPL) accounted for the great

part of the dietary spectrum. FOR, HYM, ART

and HET were found in the diet of lizards from

May to October, while DPL were found in July

and October, and COL+MEL in May and July

only. The other preyed OTUs (ARA, DPT, GAS,

HOM, ISO, LAR, PSE) occurred with low

frequency in the diet of lizards. The following

OTUs were never found as prey items: AC A,

CLB, CHI, LEP, NEM, NEU, ODO. Among the

highly preyed taxa, Coleptera and Heteroptera

were represented in the diet with a percentage

higher than that observed in the field (COL, diet:

12.6%, field: 7.8%; HET, diet: 4.2%, field:

1.8%). Hymenoptera were represented in the diet

with a percentage (11.6%) close to that observed

in the field (13.4%), and Formicidae occurred

with relatively high frequency in the diet of

lizards regardless of the season. Some taxa were

represented in the diet with low or very low

frequency despite their spatial/temporal

abundance in the field. This is the case of

Diptera, which constitute the 4.2% of the diet

although representing the 19.5% of the

invertebrate biomass on the islet, and

Gastropoda, which constitute the 1% of the diet

only although being the 5.1% of the invertebrate

biomass at the study area. Moreover, some

invertebrates which are widespread and abundant

in the field, such as e.g. Acarina and Collembola,

were not present at all in the diet of lizards.

To test any relationship between the

biomass of both prey items really hunted by

lizards and potential prey items occurring in

the field, the estimated biomass of the OTUs

constituting the prey spectrum of lizards was

compared with that of the OTUs sampled in the

field. The comparison shows that the two

groups are significantly different to each other

(% 2 = 34.20, df = 13, P = 0.001), thus suggesting

little or no relationship. The estimation of the

Shannon index gives similar values for both

groups (hunted prey items: H s = 2.265;

potential prey items: H = 2.269), indicating a

relatively high amount of diversity within each

group.

Taxon

May

July

October

Araneae

Arthropoda (unidentified)

Coleoptera s.l.

Coleoptera Melyridae

Diptera

Diplopoda

Gastropoda

Heteroptera

Homoptera

Hymenoptera s.l.

Hymenoptera Formicidae

Insect larvae

Isopoda

Pseudoscorpiones

Table 1. Diet composition (in %) of Podarcis raffonei at Scoglio Faraglione Islet during 2005.

Does diet in lacertid lizards reflect prey availability? Evidence for selective predation in the Aeolian wall lizard, Podarcis raffonei 93

75 n

GAS NEM ISO PSE ARA ACA DPL CHI LAR CLB ODO HOM HET COL MEL LEP NEU DPT HYM FOR

Figure 1. Frequency and estimated biomass of invertebrate fauna at the sampling areas during May (white histograms), July (grey)

and October (black). Above: number of specimens collected in the field; below: estimated biomass of OTUs (see Material and methods

for explanations).

DISCUSSION

This study shows that in P. raffonei diet

compositon is not directly influenced by prey

availability and temporal prey abundance, and

that there is strong evidence indicating selective

predation. These results suggest the occurrence

of a food preference strategy similar to that

observed in some lacertid lizard species (see

e.g. Heulin, 1986; Dominguez & Salvador,

1990; Maragou et al., 1996; Adamopoulou &

Legakis, 2002). Although caution should be

exercised when inferring diet composition by

faecal pellets analysis, as this methodology

probably under-estimates the number of prey

items and results depend on the number of

samples collected and the subjectivity and

taxonomic knowledge of the investigator, our

data indicate that some OTUs are really less

attractive for lizards and are rarely preyed or not

preyed at all despite their spatial and/or

temporal abundance, probably because of prey

chemicals or visual discrimination by lizards

among possible prey items. This is the case of

Diptera and Gastropoda, which were clearly

neglected or rarely preyed by lizards,

regardless of their abundance in the field, and

Acarina and Collembola, which were never

preyed by lizards, possibly because of the very

small size (often less than 1 mm) of these

arthropods, which cannot be considered as

suitable preys for a medium-sized predator

such as Podarcis raffonei (adult SVL of lizards

ranging from ca. 40 to 80 mm).

Based on our results, it can be inferred that

the Aeolian wall lizard is able to operate a

P. Lo Cascio & M. Capula

hierarchical choice within the range of prey

items constituting its prey spectrum, probably

through (i) the ability to discriminate between

prey chemicals, or (ii) visually oriented

predation. For instance, among the 14 OTUs

usually preyed by the Aeolian wall lizard,

Coleptera, Heteroptera, Hymenoptera s.l. and

Hymenoptera Formicidae can be clearly

considered as preferred prey items by the

species. In the case of Formicidae, it must be

noted that myrmecophagy is a well-known

feeding preference habit in island lizard

populations (Perez-Mellado & Corti, 1993;

Adamopoulou et al., 1999; Carretero, 2004;

Bombi et al., 2005; Lo Cascio & Pasta, 2006;

Carretero et al., 2010). Diplopoda, which are

known to produce a wide array of chemical

defenses (see e.g. Blum & Porter Woodring,

1962; Duffey et al., 1977; Eisner et al., 1978;

Kuwahara et al., 2002), apparently should not

be considered as appetible preys by lizards.

However, these arthropods can be found in the

diet of Aeolian wall lizards from July to

October with relatively high frequencies (see

Table 1), and are completely missing as prey

items in the periods of higher availability of

most “appetible” preys, such as e.g.

Coleoptera Melyridae, which not by chance

are highly represented in the diet (and in the

field) during Spring.

The analysis of the dietary spectrum of

Podarcis raffonei clearly indicates that the

species - differently from several Podarcis

lizards occurring on western Mediterranean

islands (Perez-Mellado & Traverset, 1999; Van

Damme, 1999) - consumes a low amount of

plant matter (see also Luiselli et al., 2004; Lo

Cascio, 2006) and can be considered as an

opportunistic and mainly insectivorous

predator. Although our results allow to

hypothesize the occurrence of both visual and

chemical discrimination of preys by the

Aeolian wall lizard, at present we cannot say

anything about the behavioral responses to the

different kinds of prey and the chemicals

involved in prey discrimination by P. raffonei.

Further studies should thus be needed to

investigate on the ability of the species to

discriminate repellent chemicals and/or

warning odours produced by several kinds of

prey, and the senses that mediate this ability.

ACKNOWLEDGMENTS

A significant part of the field work was

performed in the frame of the Research Project

“Studio dell’erpetofauna della R.N.O. Le

Montagne delle Felci e dei Porri e di altre aree

dell’Isola di Salina”, which was funded by the

Regional Province of Messina (D.P. n. 167,

30/12/2004). The authors wish to express their

gratitude to Dr. Maria Letizia Molino, director of

the Natural Reserve of Salina Island, for her

enthusiastic support and assistance during field

work.

REFERENCES

Adamopoulou C. & Legakis A., 2002. Diet of a Lacertid

lizard ( Podarcis milensis ) in an insular dune ecosystem.

Israel Journal of Zoology, 48: 207-219.

Adamopoulou C., Valakos E.D. & Pafilis P., 1999. Summer

diet of Podarcis milensis, P. gaigeae and P erhardii

(Sauria: Lacertidae). Bonner zoologische Beitrage, 48:

275-282.

Ausden M., 1996. Invertebrates. In: Sutherland W.J. (ed.).

Ecological Census Techniques. Cambridge University

Press, Cambridge, 139-177.

Blum M.S. & Porter Woodring J., 1962. Secretion of

Benzaldehyde and Hydrogen Cyanide by the Millipede

Pachydesmus crassicutis (Wood). Science, 138: 512-

513.

Bombi P., Vignoli L., Scalera R. & Bologna M.A., 2005.

Food habits of Podarcis fdfolensis (Reptilia, Lacertidae)

on a small Mediterranean island during the dry season.

Amphibia-Reptilia, 26: 412-417.

Bonacci T., Aloise G., Brandmayr P., Zetto Brandmayr T. &

Capula M., 2008. Testing the predatory behavior of

Podarcis sicula (Reptilia: Lacertidae) towards

aposematic and non-aposematic prey. Amphibia-

Reptilia, 29: 449-453.

Calanchi N., Lo Cascio P., Lucchi F., Rossi P.L. & Tranne

C.A., 2007. Guida ai vulcani e alia natura delle Isole

Eolie. L.A.C., Firenze, 467 pp.

Capula M., 2006. Population heterogeneity and

conservation of the Aeolian wall lizard, Podarcis

raffonei. In: Corti C., Lo Cascio P. & Biaggini M. (eds.).

Mainland and Insular Lizards: A Mediterranean

Perspective. Firenze University Press, Firenze, 23-32.

Capula M. & Aloise G., in press. Extreme feeding

behaviours in the Italian wall lizard, Podarcis siculus.

Acta Herpetologica, 6.

Capula M., Chiantini S., Luiselli L. & Loy A., 2009. Size and

shape in Mediterranean insular lizards: pattern of

variation in Podarcis raffonei, P sicula and P. wagleriana

Does diet in lacertid lizards reflect prey availability? Evidence for selective predation in the Aeolian wall lizard, Podarcis raffonei 95

(Reptilia, Squamata: Lacertidae). Aldrovandia, 5: 217-

227.

Capula M. & Lo Cascio R, 2011. Podarcis raffonei

(Mertens, 1952). In: Corti C., Capula M., Luiselli L.,

Razzetti E. & Sindaco R. (eds.). Fauna d’ltalia. XLV.

Reptilia. Calderini - Edizioni Calderini de II Sole 24

ORE, Bologna, 401-407.

Capula M., Luiselli L., Bologna M.A. & Ceccarelli A.,

2002. The decline of Aeolian wall lizard, Podarcis

raffonei'. causes and conservation proposals. Oryx, 36:

66-72.

Capula M., Luiselli L. & Rugiero L., 1993. Comparative

ecology in sympatric Podarcis muralis and P. sicula

(Reptilia: Lacertidae) from the historical centre of

Rome: what about competition and niche segregation in

an urban habitat? Bollettino di Zoologia, 60: 287-291.

Carretero M.A., 2004. From set menu to a la carte. Linking

issues in trophic ecology of Mediterranean lizards.

Italian Journal of Zoology, 71: 121-133.

Carretero M.A., Lo Cascio R, Corti C. & Pasta S., 2010.

Sharing resources in a tiny Mediterranean island?

Comparative diets of Chalcides ocellatus and Podarcis

fdfolensis in Lampione. Bonn Zoological Bulletin, 57:

111-118.

Chao A. & Shen T.J., 2003. Nonparametric estimation of

Shannon’s index diversity when there are unseen

species in sample. Environmental and Ecological

Statistics, 10: 429-443.

Corti C. & Lo Cascio P., 2002. The Lizards of Italy and

Adjacent Areas. Chimaira Verlag, Frankfurt am Main,

165 pp.

Corti C., Capula M., Luiselli L., Razzetti E. & Sindaco R.

(eds.), 2011. Fauna dTtalia. XLV. Reptilia. Calderini -

Edizioni Calderini de II Sole 24 ORE, Bologna, XII +

869 pp.

Disney R.H.L., 1986. Assessments using invertebrates:

posing the problem. In: Ussher M.B. (ed.). Wildlife

Conservation Evaluation. Chapman & Hall, London,

271-293.

Dominguez J.F. & Salvador A., 1990. Disponibilidad y

uso de recursos troficos por Lacerta schreiberi y

Podarcis bocagei en simpatria en una localidad de la

Cordillera Cantabrica, Espana. Amphibia-Reptilia,

11: 237-246.

Duffey S.S., Blum M.S., Fales H.M., Evans S.L., Roncadori

R.W., Tiemann D.L. & Nakagawa Y., 1977. Benzoyl

cyanide and mandelonitrile benzoate in the defensive

secretions of millipedes. Journal of Chemical Ecology,

3: 101-113.

Eisner T., Alsop D., Hicks K. & Meinwald J., 1978.

Defensive secretions of millipeds. In: Bettini S. (ed.).

Arthropod Venoms. Springer, Berlin, 41-72.

Heulin B., 1986. Regime alimentaire estival et utilisation

des ressources trophiques dans trois populations de

Lacerta vivipara. Acta Oecologica, 7: 135-150.

Kabisch K. & Engelmann W.E., 1969. Zur Nahrung von

Lacerta muralis (Laurenti) in Ostbulgarien.

Zoologische Abhandlungen, 30: 89-92.

Kuwahara Y., Omura H. & Tanabe T., 2002. 2-

Nitroethenylbenzenes as natural products in millepede

defense secretions. Naturwissenschaften, 89: 308-310.

Lo Cascio R, 2006. Aspetti ecologici e problemi di

conservazione di una popolazione di Podarcis raffonei

(Mertens, 1952) (Reptilia: Lacertidae). II Naturalista

siciliano, 30: 495-521.

Lo Cascio R, 2010. Attuali conoscenze e misure di

conservazione per le popolazioni relitte dell’endemica

lucertola delle Eolie, Podarcis raffonei (Squamata

Sauria). II Naturalista siciliano, 34: 295-317.

Lo Cascio R & Navarra E., 2003. Guida naturalistica alle

Isole Eolie. La vita in un arcipelago vulcanico. L’Epos,

Palermo, 261 pp.

Lo Cascio P. & Pasta S., 2006. Preliminary data on the

biometry and the diet of a micro-insular population of

Podarcis wagleriana (Reptilia: Lacertidae). Acta

Herpetologica, 1: 147-152.

Luiselli L., 2008. Do lizard communities partition the

trophic niche? A worldwide meta-analysis using null

models. Oikos, 117: 321-330.

Luiselli L., Capula M., Corti C., Lo Cascio P. & Perez-

Mellado V., 2004. Preliminary data on the feeding

ecology of Podarcis raffonei (Reptilia, Lacertidae), a

threatened endemic lizard of the Aeolian Islands

(Mediterranean Sea). In: Perez-Mellado V., Riera N. &

Perera A. (eds.). The Biology of Lacertid Lizards.

Evolutionary and Ecological Perspectives. Institut

Menorqui d’Etudis, Mao, 223-229.

Maragou P, Valakos E.D., Giannopoulos Z., Stavropoulou A. &

Chondropoulos B., 1996. Spring aspect of feeding ecology

in Podarcis peloponnesiaca (Bibron & Bory, 1833)

(Squamata: Sauria: Lacertidae). Herpetozoa, 9: 105-110.

Perez-Mellado V. & Corti C., 1993. Dietary adaptations and

herb ivory in Lacertid lizards of the genus Podarcis from

western Mediterranean islands (Reptilia: Sauria).

Bonner zoologische Beitrage, 44: 193-220.

Perez-Mellado V. & Traverset A., 1999. Relationships

between plants and Mediterranean lizards. Natura

Croatica, 8: 275-285.

Perez-Mellado V., Perera A. & Cortazar G., 2003. La Lagartija

balear, Podarcis lilfordi (Gunther, 1884), de 1’Hla d’en

Colom, Parc Natural de s’Albufera des Grau (Menorca):

situacion actual y estado de conservacion. Butlleti

Cientific dels Parcs Naturals de les Balears, 3: 23-34.

Rugiero L., 1994. Food habits of the Ruin Lizard, Podarcis

sicula (Rafmesque-Schmaltz, 1810), from a coastal

dune in Central Italy (Squamata: Sauria: Lacertidae).

Herpetozoa, 7: 71-73.

Shannon C.E., 1948. A Mathematical Theory of

Communication. The Bell System Technical Journal,

27: 379-423, 623-656.

P. Lo Cascio & M. Capula

Sicilia A., Violani C. & Zava B., 2001. Predazione di

Podarcis sicula su Discoglossus pictus. Atti 3° Congresso

Nazionale della Societas Herpetologica Italica (Pavia, 14-

16 settembre 2000), Pianura, 13: 283-284.

Sneath P.H. & Sokal R.R., 1973. Numerical Taxonomy.

Freeman, San Francisco, 576 pp.

Sorci G., 1990. Nicchia trofica di quattro specie di

Lacertidae in Sicilia. II Naturalista siciliano, 14

(Suppl.): 83-93.

Van Damme R., 1999. Evolution of herbivory in Lacertid

Lizards: Effects of Insularity and Body Size. Journal of

Herpetology, 33: 663-674.

Biodiversity Journal, 2011, 2 (2): 97-102

Observations on the genus Athis Hi bner, [1819] and description of

a new species from Peru (Lepidoptera, Castniidae)

Roberto Vinciguerra

Via XX settembre, 64 - 90141 Palermo, Italy - e-mail: rob.vinciguerra@tiscali.it

ABSTRACT One new species of the genus Athis Hubner, [1819] from Peru (Athis pirrelloi n. sp.) is described and

illustrated. The male, the preimaginal stages and the host plant are still unknown. Some additional informations

about the genus Athis Hubner, [1819] and the congeneric species/subspecies are given.

KEY WORDS Lepidoptera, Castniidae, Athis, new species, Peru

Received 28.05.2011; accepted 15.06.2011; printed 30.06.2011

INTRODUCTION

The recent studies on Neotropical Castniidae

have provided many significant contributions to

our knowledge of their eco-ethology, systematics

and biogeography. In particular, these in-depth

studies have also contributed to extend our

knowledge of the Australian genus Synemon

Doubleday, 1846, with twenty new specific

entities currently being described (Gonzalez et

al., 2010), while the data available on the

distribution and natural history of the only Asian

genus ( Tascinia Westwood, 1877), made up of

four species, remain scant.

The majority of the studies have concerned

mainly the distribution of the Neotropical taxa,

especially in Venezuela (Gonzalez, 1998, 1999,

2003; Gonzalez & Romero, 1997; Gonzalez et

al., 2006), Trinidad and Tobago (Gonzalez &

Cock, 2004), Colombia (Gonzalez & Salazar,

2003), Mexico (Miller, 2000; Gonzalez et al.,

2008), Peru (Vinciguerra & Racheli, 2006;

Vinciguerra, 2008a; 2008b, 2008c), Ecuador

(Racheli & Vinciguerra, 2006; Vinciguerra,

2010) and Hispaniola (Vinciguerra, 2008a).

A further contribution has been the description

of two interesting endemisms: Insigniocastnia

taisae Miller, 2007 (Ecuador, Esmeraldas), and

Zegara polymorpha Miller, 2008, currently

known only in Colombia (Otanche). The latter

displays a marked polymorphism and is

“involved” in complex mimetic chains with

Heliconius wallacei, the Danaids of the Lycorea

genus and the heterocera of the Pericopis and

Dysschema genera ( D . unifasciata , bivittata,

formossimia, and joiceyi ) (Miller, 2008).

Frequently in the Castniid, in fact, the imago is

characterized by bright or aposematic (rarely

cryptic) coloration and “mimics” the Lepidoptera

of the Papilionidae, Danaidae, Ithomiidae,

Hesperiidae, Lycaenidae and Pericopidae families,

relationships that would deserve further analyses.

However, the difficulty in locating the

Castniid makes it hard to carry out systematic

and faunistic studies on them: owing to the

behaviours tied to the eco-ethology of the imago

(brief flying activity, extreme localization and

territoriality, adults only sporadically

approaching the ground), the Castniid are in fact

heterocera that are notoriously “under-

represented” in the museum and private

collections (Lamas, 1995; Gonzalez, 1999;

Vinciguerra & Racheli, 2006).

Commenting their capture, Strand wrote (see

Seitz, 1913): “ Dans la plupart des cas la capture

des Castnies comme papillon est egalem assez

difficile; c ’est sur les fleurs qu ’on la prend le plus

facilement. Sur des arbres en fleurs j ’ai pris assez

R. VlNCIGUERRA

souvent de bons expl. C. pallasia et quelques

decussata. Une fois dans le filet I’insecte se

demene si energiquement que c’est bien rare

qu ’on russi a rapporter tin expl. immacule

The Athis Hiibner, [1819] genus (Figs. 1-10)

which the species currently being described is

ascribable to includes, according to Lamas (1995),

approximately fourteen - fifteen taxa, making it

the largest member of the Castniidae family, which

includes a total of eighty known species divided

into thirty genera (Gonzalez et al., 2010). The

distribution is Neotropical (Mexico, Bolivia,

Brazil, Peru, Panama, Venezuela and Trinidad)

with three significant endemisms present in the

Caraibic area, including Athis pinchoni Pierre,

2003 (Martinica), and Athis axaqua Femandez-

Yepez, 1992 (Margarita Island, Venezuela).

In the Island of Cuba, Athis Hiibner, [1819],

appears to be absent. The Athis inca orizabensis

(Strand, 1913), specimens preserved at the Field

Museum of Natural History (Chicago) as part of

the Herman Strecker collection, and labelled as

originating from Cuba, were actually introduced

accidentally from Mexico with the introduction

of vegetable species containing chrysalides

(Gonzalez et al., 2010).

The Athis imago has triangular-shaped

forewings, with two (or three) hyaline ocelli

located in the sub-apical area, the apex is pointed

or rounded, while the hindwings are brightly-

coloured, in contrast with the fore wings, which

are, usually, cryptic or dark brown (Figs. 4-10).

The adults appear to have selectively diurnal

habits.

From a morphological point of view, the most

similar genera are the Insigniocastnia Miller,

2007 and Hista Oiticica, 1955. The latter has

been the subject of a recent systematic review

(Moraes et al., 2010), and includes two taxa:

Hista fabricii (Swainson, 1823), and H. hegemon

(Kollar, 1839). The Hista species, in fact, were

originally included by Houlbert in the Athis

genus and subsequently appended to the Hista

genus by Oiticica (1955), the founder of the

genus, who had christened it Hista using the

anagram of Athis , expressly to highlight the

similarities between the two.

Little is known about the eco-ethology of

Athis and the larval stages are virtually unknown,

as are the host plants on which the worms evolve,

albeit two recent studies have shed light on its

distribution and systematic: the first by Gonzalez

(2004) and concerning Venezuela, and the

second on the inca “group” (Miller, 1972).

Gonzalez et al. (2008) have also analyzed a

probable hybrid between Athis inca orizabensis

(Strand, 1913) and Athis inca inca (Walker,

1854), proof of the hybridization, occurring in

nature, of the two sub-specific entities.

New research has been carried out on the

distribution of Athis fuscorubra (Houlbert, 1917)

(Fig. 9), found in the Island of Trinidad (Gonzalez

& Cock, 2004) and of Athis palatinus staudingeri

(Vinciguerra & Gonzalez, 2011 currently in press)

discovered in Costa Rica and previously known to

exist only in Panama. The taxonomic rank of the

latter is unclear since Lamas (1995) considers it a

sub-specific entity of A. palatinus , while Miller

(1995), a valid species. The status of Athis

thysanete (Dyar, 1912) (Fig. 8), endemic to Mexico

and only seldomly captured, is equally uncertain.

Owing to some considerable morphological

differences, this taxon is presumably not ascribable

to Athis (Gonzalez, personal communication).

Athis pirrelloi n. sp.

Examined material. Holotypus female

(Figs. 1, 2): Peru, Huanuco, Cueva de las Pavas,

21. III. 1998, 650 m, local collector legit, in the

author’s collection.

Description of the holotypus. Head and

thorax, in the dorsal part, are light brown in colour

and light yellow in the ventral part. The antennae

are dark brown. Abdomen: in the dorsal part, grey-

brown in the first three urites, then yellow-ochre;

in the ventral part extremely light yellow. Upper

surface. Forewings: Length of the forewing: 52

mm, triangular-shaped wings, straight margin and

rounded apex. The cost, in proximity of the apical

area, is clearly characterized by a “depression”

rendering the aforementioned area considerably

elongated. Presence of two hyaline ocelli (one of

which is larger than the other), whose boundaries

are marked in black, and that are located in the sub-

apical area. General coloration: light brown,

slightly darker in proximity of the costal area (on

the internal margin). Two ocelli (joined) are

located: one in the discal area and the other in the

costal area. Postdiscal band (wavy): scarcely

visible, with four darker spots parallel to the edge.

Upper surface. Hindwings: dark brown basal area;

Observations on the genus Athis Hiibner, [1819] and description of a new species from Peru (Lepidoptera, Castniidae)

Figure 1. Athis pirrelloi holotypus female (recto): Peru, Huanuco, Cueva de las Pavas.

Figure 2. Athis pirrelloi holotypus female (verso): Peru, Huanuco, Cueva de las Pavas.

100

R. VlNCIGUERRA

Figure 3. A this rutila female: Pern, Tingo Maria, Huanuco.

Figure 4. Athis flavimaculata male: Mexico, Jalisco, Tuxcacuesco.

Figure 5. A this palatinus staudingeri male: Costa Rica, Corcovado.

Figure 6. A this palatinus fermginosa female: Peru, Tingo Maria, Huanuco.

extremely light yellow discal and postdiscal areas,

marginal and costal areas orange-colored. Eight

ocelli (the first two orange and the others dark

brown) run parallel to the wing margin.

Lower surface. Forewings: yellow-ochre

general coloration, darker compared to the upper

surface, one ocellus is located in the discal area

and another extends towards the costal area. On

the lower surface, the postdiscal band is not

visible. Hindwings: Uniform light yellow

coloration. The eight ocelli, located on the upper

surface, are barely discernible on the lower

surface, except for the last two, which are located

in proximity of the anal angle.

Variability. Male and other females are

unknown, at present.

ETIMOLOGY. The species is dedicated to

Roberto Pirrello (Trapani, December 24 th , 1963),

eminent surgeon, a Plastic and Reconstructive

Surgery specialist, and a researcher and lecturer at

the Faculty of Medicine and Surgery of the

University of Palermo.

Distribution and ecology. Found only in

its typical locality. The preimaginal stages and

the host plant are still unknown.

Comparative notes. Athis pirrelloi n. sp.

shares morphological and wing pattern similarities

with the species of the palatinus “group” (Figs. 5-6).

Clear analogies can be established with Athis

palatinus staudingeri (Dmce, 1896) (Panama and

Observations on the genus Athis Hiibner, [1819] and description of a new species from Peru (Lepidoptera, Castniidae)

101

Figure 7. A this superba female: Peru, Tingo Maria, Huanuco.

Figure 8. Athis thysanete male: Mexico, Puebla, Teuacan.

Figure 9. Athis fuscorubra male: Pem, Satipo, Prov. Junin.

Figure 10. A this therapon male: Brazil, Santa Catarina, Joinville.

Costa Rica), which it differentiates itself from in

terms of colouring and forewing shape.

The cost of A. pirrelloi n. sp., in proximity of

the apical area, is clearly characterized by a

“depression” considerably elongated, a pecu-

liarity distinguishing it from all the other

congeneric species and relating it to the female

Athis rutila (Felder, 1874) (Fig. 3), which

displays the same morphological characteristic.

In contrast with the other congeneric taxa,

Athis pirrelloi has a considerably “elongated”

forewing shape, a peculiarity it “shares” with

Athis therapon (Kollar, 1839) (Fig. 10).

Kollar (1839) highlighted said peculiarity in

the description of the therapon holotype, writing:

'Alls superioribus elongatis, supra flavescenti -

rufis [ ] ”, and also: “Alae superiores baud

consuetae plurimarum Castniarum formae, sed

magis elongatae ...”.

There are no other taxa with which to

establish further comparisons, however, the hairs

of the forewings and the study of the wing

venation lead us to classify the species under the

aforementioned genus.

CONCLUSIONS

Athis pirrelloi constitutes an important

naturalistic find worthy of further in-depth

studies, which we intend to carry out when other

specimens will be made available (extraction of

DNA sequences, analysis of the genital

102

R. VlNCIGUERRA

apparatus, study of the biogeographical

distribution and of the variability of the species).

The holotype described and depicted below,

and the specimens of the Athis genus shown,

derive entirely from the author’s collection.

ACKNOWLEDGEMENTS

I am grateful to: Michael Buche (Tenerife) for

helping me find the material examined; to J. M.

Gonzalez (Texas) and to the staff of the Natural

History Museum (former British Museum, London)

for sending me the bibliographical material.

REFERENCES

Gonzalez J.M., 1998. Castniinae (Lepidoptera: Castniidae)

de Venezuela. IV: El genero Haemonides. Boletln del

Centro de Investigaciones Biologicas Universidad del

Zulia, 32: 195-201.

Gonzalez J.M., 1999. Castniinae (Lepidoptera: Castniidae)

from Venezuela. Ill: Genera represented by only one

known species. Diagnosis and comments. Ciencia, 7:

229-235.

Gonzalez J.M., 2003. Castniinae (Lepidoptera: Castniidae)

from Venezuela. V: Castnia Labricius and Telchin

Hiibner. Boletin del Centro de Investigaciones

Biologicas Universidad del Zulia, 37: 191-201.

Gonzalez J.M., 2004. Castniinae (Lepidoptera: Castniidae)

from Venezuela. VI. The genus Athis. Diagnosis and

comments. Caribbean Journal of Science, 40: 408-413.

Gonzalez J.M. & Romero R, 1997. Confirmacion de la

presencia de Haemonides cronis (Cramer) (Lepidoptera:

Castniidae) en el Parque Nacional “Henri Pittier”.

Boletin de Entomologia Venezolana, 12: 119.

Gonzalez J.M. & Salazar J. A., 2003. Adicion a la lista de

castnidos (Lepidoptera: Castniidae: Castniinae)

conocidos de Colombia. Boletin Cientifico. Centro de

Museos. Museo de Historia Natural Universidad de

Caldas, 7: 47-56.

Gonzalez J.M. & Cock M.J.W., 2004. A sinopsis of the

Castniidae (Lepidoptera) of Trinidad and Tobago.

Zootaxa, 762: 1-19.

Gonzalez J.M, Ayala J.M. & Alnaudez J.L., 2006. Notes on

Castniinae (Lepidoptera: Castniidae) of Margarita

Island Venezuela. Boletin del Centro de Investigaciones

Biologicas Universidad del Zulia, 40: 347-355.

Gonzalez J.M., Hemandez-Baz R & Vinciguerra R., 2008.

Notes on some Athis inca ssp. collected in Mexico

(Lepidoptera: Castniidae). Shilap Revista de

Lepidopterologia, 36: 473-476.

Gonzalez J.M., Boone G.H., Brilmyer G.M. & Le D.,

2010. The Gigant Butterfly-moths of the Lield Museum

of Natural History, Chicago, with notes on the Herman

Streclcer collection (Lepidoptera: Castniidae). Shilap

Revista de Lepidopterologia, 38: 385-409.

Kollar V., 1839. LepidopterommBrasiliae Species Novae. Annalen

des Wiener Museums der Naturgeschichte, 2: 215-218.

Lamas G., 1995. A critical review of J. Y. Miller’s Checklist

of the Neotropical Castniidae (Lepidoptera). Revista

Peruana de Entomologia, 37: 73-87.

Miller J.Y., 1972. Review of the Central American Castnia

inca complex (Castniidae). Bulletin of the Allyn

Museum, 6: 1-3.

Miller J.Y., 1995. Castniidae. In: Heppner, J.B. (Ed.),

Checklist: Part 2. Hyblaeoidea-Pyraloidea-Tortricoidea.

Atlas of Neotropical Lepidoptera. Association for

Neotropical Lepidoptera/Scientific Publishers,

Gainesville, pp. 133-137, 176-177.

Miller J.Y., 2000. Castniidae (Lepidoptera). In: B.J.

Llorente, J.M. Gonzalez & N. Papavero (Eds.).

Biodiversidad, taxonomia y biogeografia de artropodos

de Mexico: Hacia una sintesis de su conocimiento, 2:

527-531.

Miller J.Y., 2008. Studies in the Castniidae. V. Description

of a new species of Zegara. Bullettin of the Allyn

Museum, 160: 1-13.

Moraes S.S., Duarte M., & Gonzalez J. M., 2010. Revision

of Hista Oiticica (Lepidoptera: Castniidae) and

discussion on the validity of its subspecies. Zootaxa,

2421: 1-27.

Oiticica J., 1955. Revisao dos nomes genericos sul-

americanos da subfamilia Castniinae (Lepidoptera

Castniidae). Re vista Brasileira de Entomologia, 3, 137-

167.

Racheli L. & Vinciguerra R., 2006. Notes on three Castniid

species from Ecuador (Lepidoptera, Castniidae).

Entomologische Zeitschrift, 116: 169-170.

Strand E., 1913. Gattung: Castnia. In: Seitz, A. (Ed.). Die

Gross Schmetterlinge der Erde 6. Vol 1. A. Kemen,

Stuttgart, pp. 7-17.

Vinciguerra R. & Racheli L., 2006. Note sulla distribuzione

di alcuni Castnidi in Peru (Lepidoptera, Castniidae),

Berichte des Kreises Numberger Entomologen V, 22:

27-39.

Vinciguerra R., 2008a. Osservazioni su Ircila hecate

(Herrich-Schaffer, [1854]) (Lepidoptera: Castniidae).

Shilap Revista de Lepidopterologia, 36, 205-208.

Vinciguerra R., 2008b. Osservazioni su alcuni taxa dei

generi: Corybantes Hiibner, [1819], Athis Hiibner,

[1819], Zegara Oiticica, 1955, Mirocastnia Miller, 1980

e Insigniocastnia Miller, 2007 (Lepidoptera:

Castniidae). Shilap Revista de Lepidopterologia, 36:

491-499.

Vinciguerra R., 2008c. Descrizione della femmina di

Eupalamides preissi (Staudinger, 1899) (Lepidoptera,

Castniidae). Shilap Revista de Lepidopterologia, 36:

487-490.

Vinciguerra R., 2010. Osservazioni sulla distribuzione di

Divana diva hoppi (Herinh, 1923) (Lepidoptera:

Castniidae). Shilap Re vista de Lepidopterologia, 38:

379-383.

Vinciguerra R. & Gonzalez J.M., 2011. Observations on

distribution of Athis palatinus staudingeri (Druce,

1896) (Lepidoptera: Castniidae). Shilap Revista de

Lepidopterologia, in press.