Upper: Dwarf snakehead, Channel cf. gachua (Hamilton,

1822) Petchaburi, West Thailand

Lower:Striped snakehead, Channel striata (Bloch, 1 793)

Rayong, East Thailand

Photos by Ekkapan Ubonrach

Biodiversity of Snakehcads genus Channel Scopoli 1777 in Thailand. The family

Channidae comprises more than 30 species of freshwater fishes (Snakeheads) and two extant

genera, Parachanna Teugels et Daget, 1984 (Africa), and Channa Scopoli, 1777 (Asia:

South Asia to the Far East). In Thailand, the genus Channa includes 6 species, C. Indus

(Cuvier, 1831), C. marulius (Hamilton, 1 822), C. melasoma { Blcckcr, 1851), C. micropeltes

(Cuvier, 1 83 1 ), C. striata (Bloch, 1 793) and C ef. gachua (Hamilton, 1 822). However, many

of them still have an unclear taxonomic status, especially the populations of Mekong Basin.

Snakeheads can be found mostly in all regions of Thailand, except for Black snakehead (C.

melasoma) that occurs only in the southern part of the country. Their habitat embraces head

water streams and mainstreams or flood areas such as canals, rice fields, swamps or still

waters. Some species, i.c. Black snakehead (C. melasoma). Giant snakehead (C. micropeltes)

and Striped snakehead (C. striata ), can also live in peat swamps or acidic waters. Dwarf

snakehead (C cf. gachua) can be found only in mountain-stream ecosystem; moreover, all

snakeheads can live in waters with low oxygen levels thanks to supra-branchial organs in

circulatory system which can enable fish to air-breathing. This ability can be helpful for

hibernating underground during the dry season. Snakeheads, in Thailand, occur all year

round but reproduction period is only in rainy or flood season. Striped snakehead (C.

striata ), Blotched snakehead (C. Indus), Bullseye snakehead (C. marulius). Black

snakehead (C melasoma) and Giant snakehead (C. micropeltes) show nesting behavior prior

to breeding time. Fish use caudal fin to swing or waving on aquatic plants to build the nest, but

nesting patterns are different in each species: eggs are laid into the nest and one parent or both

will take care of them to the juvenile stage. Only Dwarf snakehead (C. cf. gachua) has a

mouth-brooding behavior. Snakeheads are top-level predators, including also cannibalism.

Sltthi Kulabtong, Save wild life volunteer Thailand, Wangnoi District, Ayuttaya Province

13170, Thailand; e-mail: kulabtong201 l@hotmail.com

Ekkapan Ubonrach, 5/1 Watpapradoo Road, Tapradoo Subdistrict, Muang District, Rayong

Province 2 1 000, Thailand; e-mail: fisherman_ton@hotmail.com

Biodiversity Journal, 2013, 4 (1): 3-104

Monograph

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Paolo Pantini 1 *, Antonio Sassu 2 & Giuseppe Serra 3

'Museo civico di Scienze Naturali “E. Caffi”. Piazza Cittadella, 10 - 24129, Bergamo (BG), Italy; e-mail: ppantini@comune.bg.it

2 Via Europa, 59 - 09070, Bonarcado (OR), Italy; e-mail: a.sassu77@gmail.com

3 CNR, Istituto per lo Studio degli Ecosistemi - sede di Sassari. Traversa La Crucca, 3 - 07100, Sassari-Li Punti (SS), Italy; e-mail:

g.serra@ise.cnr.it

^Corresponding author

ABSTRACT This catalogue summarizes and critically reviews araneological knowledge about Sardinian

fauna. 140 publications from 1868 to 2012 were considered and about 4800 specimens be-

longing to 254 species were directly examined. The list report 495 species belonging to 229

genera divided into 43 families. For each species, literature, chorotype, regional distribution,

and, where possible, habitats are indicated. Among the listed species Philodromus bosmansi

Muster et Thaler, 2004 (Philodromidae) is new for Europe and the family of Prodidomidae

with the species Zimirina brevipes Perez et Blasco, 1986 is new for Italy. Also Setaphis par-

vula (Lucas, 1846) (Gnaphosidae), Centromerus succinus (Simon, 1884) and Hybocoptus

corrugis (O. P.-Cambridge, 1875) (Linyphiidae) are new records for the Italian fauna and

further 37 species are new for Sardinia. The genitalia of Phrurolithus corsicus (Simon, 1878),

Zimirina brevipes, Drassodes luteomicans (Simon, 1878) and Zelotes dentatidens Simon,

1914 are illustrated.

KEY WORDS biodiversity; distribution; endemic species.

Received 05.04.2012; accepted 30.11.2012; printed 30.03.2013

INTRODUCTION

The knowledge of biodiversity of an area means

to how much and what taxa live in it. This informa-

tion is crucial in order to realize an appropriate pro-

tection and management of the territory or also

further in-depth ecological and biological research.

Italy was the first country in Europe to organize

a census of its national fauna publishing a Checklist

between 1993 and 1995 (Minelli, Ruffo & La Posta,

1993-1995). With the aim of better quantifying the

faunistic resources of our country and to check their

distribution throughout the territory, between 2001

and 2005 following the CKmap project in which the

specialists compiled three tables for each species:

1) a species-index card including taxonomic, choro-

logical and ecological data such as habitat, food,

conservation status and indicator value; 2) a distri-

bution-table including all species records with co-

ordinates added by a simplified software method,

localities were automatically geo-referenced in the

UTM grid (10 x 10 km grid cells); 3) a reference-

table storing the list of literature sources and col-

lections examined. (Ruffo & Stoch, 2005; Letardi

& Pantaleoni, 2007).

Despite this effort, our knowledge of Italian

fauna is still far from complete, especially if we

consider invertebrates (Ruffo & Vigna Taglianti,

2002). Among these, spiders are a particularly in-

teresting group, rich in species, many of which are

endemic. Information about the ecology and distri-

bution of Araneae in Italy is still sketchy and frag-

mentary, often limited to some families, spread

across a large number of publications, few of which

P. Pantini, A. Sassu & G. Serra

give us a unified picture of the situation in smaller

or larger areas of our peninsula. A recent analysis

of the state of knowledge on Italian araneofauna

(Pantini, in press) demonstrated how much effort is

still needed to reach a satisfactory level. From 1995

to 2012, 238 scientific publications with data re-

garding Italian spider fauna was published. Overall

1200 species are mentioned, 229 of which were new

for Italy. This means an increase of 17,4% compared

to the Checklist (Pesarini, 1 994), bringing the num-

ber of Italian spiders above 1600. In this period of

time, 61 new species have been described from

specimens coming from Italy, among which, as far

as we know, 52 are endemic or sub-endemic. The

publications examined can be classified into 5 diffe-

rent groups: faunal (40%), taxonomic (26%), ecolo-

gical (17%), bio-speleological (10%) and various

(7%). Re- garding faunal aspects, some works

must be mentioned which analyze Italian spider

fauna, both as a whole (Trotta, 2005; Pantini & Isaia,

2008) and in some regions such as Alto Adige (No-

flatscher, 1996), Valle d’ Aosta (Isaia, 2005), Pied-

mont and Lombardy (Isaia et al., 2007) and Veneto

(Ballarin et al., 2011). However, a great part of the

southern regions of our country are still almost unex-

plored, or at least little is known about them.

With the publication of this catalogue, we

summarize and critically review the araneological

knowledge regarding Sardinia, an extremely inter-

esting Italian region from a faunal and bio-geogra-

phical point of view, grouping into one text a large

amount of data from literature and from an analysis

of a vast quantity of new material.

ARANEOLOGICAL RESEARCH IN SARDINIA

In 1868, Giovanni Canestrini and Pietro Pavesi

published “Araneidi italiani”, the first, and even

now, only catalogue of Italian spiders. The two au-

thors, who we can consider the fathers of Italian

arachnology, introduce the work with a long and le-

arned analysis of the literature and authors who,

from Pliny the Elder onwards, had anything to do

with Italian araneofauna. There then follows the ac-

tual catalogue which reports for every species ob-

served its regional distribution (based mostly on

material collected or studied by the authors) and its

bibliographical reference. The catalogue reports

only three species in Sardinia: Argiope bruennichi

(Scopoli, 1772), Latrodectus tredecimguttatus

(Rossi, 1790), and Eresus ruficapdlus C.L. Koch,

1 846. Even in the updated version in 1 870, the data

about Sardinia does not change, while on the whole,

data referring to 41 families and 327 species of spi-

der was reported. The records, as we can see from

the map in figure 1 , were concentrated mostly in the

north of Italy where the two authors lived and wor-

ked. At the time Canestrini (bom and raised in Val

di Non, Trento) was a Professor at the University

of Modena while Pavesi (bom in Pavia) was a tea-

cher at Lugano High School. Sardinia and most of

southern Italy were much less known except Cam-

pania (where Prof. Panceri worked) and Sicily.

However, the first studies on Sardinian araneo-

fauna, with the description of Zelotes sardus (sub

Prothesima sardd) a new species of Gnaphosidae,

were made by Canestrini (1873; 1876). Later Pavesi

(1876; 1878) published two papers on the collec-

tions deriving from the cmises of the “Violante”, he

listed a total of 22 species mostly from the small is-

lands surrounding Sardinia. Successively Magretti

(1878; 1880) published accounts of two zoological

excursions in Sardinia, in which he cites 1 8 species

of spiders (Table 1) while De Carlini (1885) in his “Ar-

tropodi dell’Isola di San Pietro” reports 19 species.

But the first consistent set of data is due to the na-

turalistic Sardinian explorations of Achille Costa

(1882; 1983; 1984; 1985; 1986) who reports 135

species in his “Notizie ed osservazioni sulla geo-

fauna sarda” (Table 1).

In the first years of the 20th century the most

complete contribution on Sardinian spiders was

published by Gameri (1902). In his “Contribuzione

alia fauna sarda”, the author reports a long list of

species, as many as 235, arising partly from biblio-

graphical research and partly from material from Sar-

dinia preserved in the University of Pavia. Fifty years

follow with a complete absence of publications about

Sardinian fauna, only some works by Gozo (1908)

and by Simon (1914; 1926; 1929; 1932) report sparse

data. In the second half of the 20th century there was

new interest: Roewer (1953, 1956) published on Sar-

dinian cave-dwelling arachnids and Krauss (1955)

on the spiders of Corsica, Sardinia and Elba. The lat-

ter reports 51 species, of which 16 are new to the is-

land, while Dresco (1956) described Tegenaria

henroti. The work of Paolo Marcello Brignoli de-

serves, as usual, special attention. He published as

many as 22 works in which he reports a large

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Figure 1. Number of spider species reported in Italy by Canestrini & Pavesi (1870) divided into regions.

amount of original data about Sardinia. In particu-

lar, we remember his contributions on Onoopidae

(Brignoli, 1967a), on Leptonetidae (Brignoli,

1967b; 1969) and on cave dwellers (Brignoli,

1974), dedicated specifically to Sardinian fauna.

From the 1970s on, bio-speleological research car-

ried out on the island also led to the publication of

several works. In particular, regarding spider fauna,

we should mention the contributions of Thermes

(1972) and Puddu & Pirotta (1974) with the “Cata-

logo sistematico ragionato della fauna cavemicola

della Sardegna”. Another important contribution is

that of Giuseppe Grafitti, a tireless researcher and

great expert on the hypogean fauna of the island

(see Table 1).

Papers on Sardinian spiders over the last twenty

years are relatively scarce and is almost exclusively

the result of faunal or taxonomic contributions:

P. Pantini, A. Sassu & G. Serra

Citations

Species

cited

(n.)

New

species

(n.)

Canestrini & Pavesi, 1868

Canestrini & Pavesi, 1870

Canestrini, 1873

Canestrini, 1876

Pavesi, 1876

Magretti, 1878

Pavesi, 1878

Magretti, 1880

Costa, 1882

Costa, 1883

Costa, 1884

Simon, 1884

Costa, 1885

de Carlini, 1885

Costa, 1886

Garneri, 1902

229

107

Gozo, 1908

Simon, 1914

Simon, 1926

Simon, 1929

Simon, 1932

Roewer, 1953

Krauss, 1955

Dresco, 1956

Roewer, 1956

Grasshoff, 1959

Lugetti & Tongiorgi, 1965

Alicata, 1966

Tongiorgi, 1966

Brignoli, 1967a

Brignoli, 1967b

Altara, 1968

Cerruti, 1968

Brignoli, 1969a

Brignoli, 1969b

Brignoli, 1969c

Dresco & Hubert, 1969

Helsdingen, 1969

Lugetti & Tongiorgi, 1969

Argiolas et al., 1970

Puddu, 1970

Brignoli, 1971a

Brignoli, 1971b

Brignoli, 1971c

Puddu, 1971

Bartolo et al., 1972

Casale, 1972

Sannaetal., 1972

Thermes, 1972

Bartolo et al., 1973

Brignoli, 1973

Wunderlich, 1973

Baum, 1974

Brignoli, 1974

Puddu & Pirodda, 1974

Tongiorgi, 1974

Brignoli, 1975

Brignoli, 1976a

Brignoli, 1976b

Brignoli, 1977

Brignoli & Gaddini, 1979

Brignoli, 1979a

Brignoli, 1979b

Brignoli, 1979c

Brignoli, 1979d

Grafitti, 1979

Brignoli, 1980

Puddu, 1980

Brignoli, 1982

Cannas, 1972 [1982]

Grasshoff, 1983

Loerbroks, 1983

Puddu, 1983

Brignoli & Murphy, 1984

Brignoli, 1984

continuec

Table 1 . List of publications where data on Sardinian ara-

neofauna is present. For each article, the number of species

mentioned and the new reports for Sardinia are indicated.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Citations

Species

cited

(n.)

New

species

(n.)

Grafitti, 1984

Grimm, 1985

Grimm, 1986

Hansen, 1986

Deeleman-Reinhold &

Deeleman, 1988

Tongiorgi & Sola, 1991

Platnick & Di Franco, 1 992

Grafitti, 1993

Pons, 1993

Pesarini, 1994

225

Buchar & Thaler, 1995

Wunderlich, 1995a

Wunderlich, 1995b

Wunderlich, 1995c

Wunderlich, 1995d

Wunderlich, 1995e

Fontana et ah, 1996

Knoflach, 1996

Bosmans, 1997

Arno et al., 1998

Thaler & Knoflach, 1998

Bosmans & Van Keer, 1 999

Gasparo, 1999

Knoflach, 1999

100

Metzner, 1999

101

Knoflach & Thaler, 2000

102

Pesarini, 2000

103

Grafitti, 2001

104

Muccedda et al.,2002

105

Grafitti, 2003

106

Casale et ah, 2004

107

Knoflach & Pfaller, 2004

108

Knoflach, 2004

109

Logunov, 2004

110

Muster & Thaler, 2004

111

Senglet, 2004

112

Thaler & Knoflach, 2004

113

Thaler et al., 2004

114

Grill et al, 2005

115

Hansen, 2005

116

Helsdingen, 2005

117

Buchar et al.,2006

118

Burger et al., 2006

119

Lana et al., 2006

120

Logunov & Azarkina, 2006

121

Grafitti, 2007a

122

Grafitti, 2007b

123

Muster et al., 2007

124

Bolzem et al., 2008

125

Bosmans, 2008

126

Grafitti & Merella, 2008

127

Lorn et al., 2008

128

Amedo et al., 2009

129

Colombo & Manunza, 2009

130

Knoflach et al., 2009

131

Muster, 2009

132

Pantini & Sassu, 2009

133

Trotta, 2009

134

Marras et al., 2011

135

Tanasevitch, 20 1 1

136

Wunderlich, 20 1 1

137

Senglet, 20 1 1

138

Di Pompeo et al., 2011

139

Trotta, 2011

140

Kulczycki et al., 2012

Total

1417

453

Collection of Bergamo

Museum (MBG)

144

Collection ofCNR-lSE

Sassari (ISE)

216

Collection of Cagliari

University (UCA)

Total

369

Table 1 (continued). List of publications where data on Sar-

dinian araneofauna is present. For each article, the number

of species mentioned and the new reports for Sardinia are in-

dicated.

P. Pantini, A. Sassu & G. Serra

Tongiorgi & Sola (1991) report the presence of

Pardosa gefsana in Sardinia, Wunderlich (1995a,

1995b) describes a new species of Thomisidae and

carries out a bio-geographical analysis on Sardo-

Corsican araneofauna. Amo et al. (1998) analyze

the spiders on lime trees of a small tree-lined town

in Sassari. Grill et al. (2005) publish an ecological

work on butterflies, spiders and plants in different

environments, van Helsdingen (2005) reports data

on some collections he made on the island, Bolzem

et al. (2008) report interesting data about Tegenaria

and Malthonica, Lom et al. (2008) list the species

of spider collected in Sardinian hazelnut orchards,

Amedo et al. (2009) describe two new species of

Dysdera, Colombo & Manunza (2009) report the

first sighting of Cyrtarachne ixoides, Pantini &

Sassu (2009) and Trotta (2009) report data on the

spiders of the islands surrounding Sardinia, Di

Pompeo et al. (2011) report the presence of Argiope

trifasciata in Sardinia and Marras et al. (2011) ana-

lyze the influence of the exclusion of ants on the

quantity of four groups of generalist predators, in-

cluding spiders, in a citms orchard. Trotta (2011)

supplies some faunal data on Sardinian spiders and

Kulczycki et al. (2012) report the first sighting of

Steatoda nobilis. In figure 2 the growth in arane-

logical knowledge in Sardinia from 1868 to today

is reported.

Finally, we must point out that in the checklist

of the species of Italian fauna, each species indi-

cates whether it is present in Sardinia. Pesarini

(1994) reported 229 species on the island, some of

which were very probably based on new material

as they had not been cited previously. A final

source that reports general data on the araneofauna

of Sardinia is “Fauna Europaea” (Helsdingen,

2012) which reports 353 species for Sardinia.

Research on araneofauna in Sardinia over the

last 20 years does not stop with that listed above.

In fact, from the early 1990s a working group from

the Institute of Ecosystem Study (ISE-CNR) in

Sassari has been involved in faunal studies of vari-

ous natural and anthropized ecosystems (Fresi et

al, 2002). This activity has allowed them to collect

a considerable quantity of spiders. The collected

material, only a small part of which has been

published, is the principal source of unpublished

material presented in this catalogue.

MATERIALS AND METHODS

In order to create the catalogue which covers a

time period from 1868 to 2012, 140 publications

were examined. The starting point is in 1 868 when

Canestrini and Pavesi published “Araneidi italiani”,

the first catalogue of Italian spiders. The catalogue

was then updated in 1870 by the same authors. For

the bibliography included between 1870 and 1939

the first volume of the “Bibliographia Araneorum”

by Pierre Bonnet (1945) was consulted, while for

later publications, accurate research was carried out

into their bibliographical sources. The complete list

of publications consulted is in table 1 . The works are

listed in chronological order indicating the number

of the species and the new sightings for the region.

A fair number of species are reported in the cata-

logue exclusively thanks to sightings made over a

century ago and which therefore require further

confirmation. However, this problem is often over-

come for the most common species through a series

of successive citations.

To avoid an excessive amount of data, each

time that it was possible the citations of other cita-

tions were excluded, reporting only records based

on the direct examination of the specimens except

for the data from the checklist by Pesarini (1994)

and from Garneri’s catalogue (1902). Excluded

from the catalogue are: nomina dubia, species in-

quirendae, citations where the author expresses

doubt about the identification and the few species

whose nomenclature was not easily identifiable

under current nomenclature. When adequate con-

firmation was missing, the subspecies were

grouped with the nominal species. The taxa or the

citations excluded from the catalogue are still com-

mented on in the notes relating to their respective

families. Nomenclature follows the “The World

Spider Catalog, Version 12.5” by Norman Platnick

(2012), which was referred to also for synonymy.

An asterisk next to the name indicates that the

species was reported for the first time in Sardinia.

Our research included data from literature and re-

ports from approximately 1900 notifications regar-

ding 254 species deriving from the study of new

material kept in the collections of the ISE-CNR at

its Sassari headquarters, at the Civic Natural

Science Museum “E. Caffi” of Bergamo (MBG)

and the University of Cagliari (UCA).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

year

Figure 2. The growth in aranelogical knowledge in Sardinia from 1869 to today.

Most of this new material was collected over 20

years of faunal studies carried out by the ISE-CNR

in Sardinia. First of all they were concerned with the

arthropod fauna of the olive grove ecosystem in

1992-1994 and in vineyards in 1994-1996, both in

North Sardinia. Studies continued on urban tree-lined

avenues of the city of Sassari between 1993 and 1996

(Arno et al., 1998). Other collections/observations

were carried out in mixed fruit orchards (pomaceous,

drupaceous) of the Province of Sassari in 1997-1998

and in a forest of cork oak in North-East Sardinia in

1999-2000. In 2003-2004 research was carried out

on the araneofauna of the island of Asinara Pantini

& Sassu (2009) and continued in Central Sardinia on

the peaks of the Gennargentu Range (2006-2007)

and in different mountainous fruit orchard ecosys-

tems such as the hazelnut in 2004-2006 (Lorn et al.,

2008) and the cheny and walnut in 2007-2008. Fi-

nally, recently systematic sampling was carried out

in the disused mining area of Montevecchio-Ingur-

tosu in South-West Sardinia (2009). The analysis of

this material (over 7000 adult specimens) has al-

lowed us to confirm the presence of a large quantity

of species, to widen the area of their distribution and

to identify new species for Sardinia.

For each species examined, the following infor-

mation is supplied:

i) Chorotype. Referring to the works of Vigna

Taglianti et al. (1992, 1999) each species is assigned

a chorotype with the purpose of precisely defining

its distribution. For the assigning of chorological

categories, several specialist works were consulted

relating to the genera or to the single species in

question. In addition, the following websites were

used: Fauna Europaea [http://www.faunaeur.org/]

(Helsdingen, 2011), Araneae Spiders of Europe

[http://www.araneae.unibe.ch] (Nentwig et al., 2011),

Biodiversity of Russia [http://www.zin.ru/BioDiv/ara-

nei.asp]. Sometimes limited knowledge about the

distribution of some species made it difficult to at-

tribute a chorotype. In this case, the chorotype is

followed by a question mark. For subspecies, the

chorotype of the nominal species is indicated in

square brackets.

ii) References. In this field the publications in

which the species has been cited for Sardinia are

listed. A reference number has been assigned to

each work in increasing order starting from the old-

est ones (Tab. 1). Works containing citations of data

which was previously published have been ex-

cluded while specimens seen again personally by

the authors in revision works were considered. Next

to the publication, the original identification of the

species is indicated if different from the present one.

P. Pantini, A. Sassu & G. Serra

iii) Province. In order to have an idea of the di-

stribution of the araneological collections in Sardi-

nia, the province where each item was found is

included. In cases where the bibliography indicates

only the region, a definite province has not been at-

tributed and this data is shown by a hyphen. If the

area indicated is on the border between provinces,

these are indicated and separated by a bar. The cur-

rent eight Sardinian provinces have been conside-

red: Cagliari, Carbonia-Iglesias, Medio Campidano,

Nuoro, Ogliastra, Olbia-Tempio, Oristano and Sas-

sari (Fig. 3). The list of boroughs (APPENDIX 1)

belonging to the new provinces is available on- lin e

at the link: http://www.biodiversityjoumal.com/pdf/

4%281%29_3-104_appendix.pdf and for each of

these the original province it belonged to is mentio-

ned (Cagliari Oristano, Nuoro and Sassari).

iv) Habitat. When indicated in literature, for each

species the environment where specimens were col-

lected is reported. This information is listed in al-

phabetical order including in brackets the number

of the publication it was taken from.

v) Examined material. The following is indicated

for the new checked material: province, borough (in

underlined characters) in which the specimens were

sampled, number and sex of each specimen. Where

possible we also indicated: location, altitude (m asl),

habitat, date of sampling and the capturing technique

(pitfall traps etc.), if different from direct collection.

Figure 3. Number of species reported for

each province.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

LIST OF SPECIES

Family CTENIZIDAE

Cteniza brevidens (Doleschall, 1871)

Chorotype. Tyrrhenian endemic.

References. (10) Costa, 1885 (sub Aepicepha-

lus brevidens ); (13) Gameri, 1902 (sub Aepicepha-

lus brevidens)', (84) Pesarini, 1994 (sub

Aepycephalus brevidens ).

Provinces. (84); Oristano (10, 13).

Remarks. Cited only for Sicily (Ausserer, 1871)

and Sardinia. Species insufficently described, most

probably, should be named Aepicephalus sp. (fam.

Cyrtaucheniidae). Mediterranean Cytaucheniidae

are easily confused with Cteniza (all large stocky

black spiders). Aepychephalus has been incorrectly

synonymized with Cyrtauchenius by Raven 1985.

Aepicephalus is common in SW Italy (Campania,

Basilicata, Calabria) and in both Sicily and Sardi-

nia. Probably there are several different species of

Aepicephalus in Italy and the Sardinian species then

would be a new and as yet undescribed species;

hence Aepicephalus sp. (Decae A. pers. comm.).

Cteniza moggridgei O.P.-Cambridge, 1874

Chorotype. Mediterranean.

References. (139) Trotta, 2011.

Province. Carbonia-Iglesias (139).

Cteniza sauvagesi (Rossi, 1788)

Chorotype. Tyrrhenian endemic.

References. (3) Pavesi, 1876 (sub C. Sauvagii);

(6) Magretti, 1880 (sub C. sauvagei); (7a) Costa,

1882 (sub Migale fodiens); (8) Costa, 1884 (sub

My gale fodiens); (13) Gameri, 1902 (sub Nemesia

fodiens).

Province. (8); Cagliari (6, 7a); Carbonia-Igle-

sias (3, 6); Oristano/Nuoro (13).

Family NEMESIIDAE

Nemesia fertoni Simon, 1914

Chorotype. Sardo-Corsican endemic.

References. (15) Simon, 1914; (84) Pesarini,

1994; (132) Pantini & Sassu, 2009.

Provinces. (84); Sassari (15, 132).

Nemesia kahmanni Kraus, 1955

Chorotype. Sardinian endemic.

References. (20) Krauss, 1955; (84) Pesarini,

1994.

Provinces. (84); Sassari (20).

Nemesia maculatipes Ausserer, 1871

Chorotype. W-Mediterranean.

References. (13) Garneri, 1902; (15) Simon,

1914; (132) Pantini & Sassu, 2009.

Provinces. (15); Carbonia-Iglesias (13); Sassari

(132).

Remarks. This probably is a good species and

endemic to Sardinia. The idea that it is widely

spread in the western Mediterranean is incorrect

(Decae & Di Franco 2005).

Nemesia meridionalis (Costa, 1835)

Chorotype. W-Mediterranean.

References. (13) Gameri, 1902; (84) Pesarini,

1994 (sub N. badia).

Province. (84); Carbonia-Iglesias (13).

Remarks on family Nemesiidae. A revision of

the Sardinian Nemesia fauna (and also the Corsican

Nemesia fauna) is badly needed. A check of type ma-

terial, and the analysis of topotypical material is ne-

cessary. Regarding our poor state of knowledge of

the genus Nemesia in the Mediterranean area see

Decae & Di Franco (2005: 133). Nemesia africana

was cited by Gameri (1902) and Pesarini (1994). It

is very unlikely that this species really occurs in Sar-

dinia. The species itself is insufficiently described to

make a diagnosis without checking possible type ma-

terial (Decae A. pers. comm.). It is not reported in

the catalogue. The citations of N. caementaria (Ma-

gretti, 1880; Gameri, 1902 (sub N. coementaria); Pe-

sarini, 1994), N. cellicola (Pesarini, 1994) and N.

manderstjernae (Gameri, 1902; Pesarini, 1994) are

based on misidentifications (Decae A. pers. comm.)

and so they are not reported in the catalogue.

P. Pantini, A. Sassu & G. Serra

Family FILISTATIDAE

Filistata insidiatrix (Forskal, 1775)

Chorotype. Mediterranean.

References. (6) Magretti, 1880 (sub F. testa-

cea ); (10) Costa, 1885 (sub F. testacea ); (13) Gar-

neri, 1902 (sub F. testacea ); (42) Puddu,1971 (sub

Filistrata insidiatrix ); (45) Sanna et al., 1972; (68)

Brignoli, 1982; (83) Pons, 1993; (84) Pesarini,

1994; (94) Amo et al., 1998; (133) Trotta, 2009.

Province. (13, 84); Cagliari (42); Carbonia-

Iglesias (6, 45, 133); Nuoro (68, 83); Olbia-Tempio

(68); Sassari (10, 94, ined.).

Habitat. Avenue of lime trees (94); hypogean

habitat (42, 45, 83).

Examined material. OLBIA-TEMPIO: Olbia .

Isola Tavolara, 1 juv. 24.11.1966, 1 juv. 25.IV. 1966

leg. Gmppo Isole C.N.R. (MBG).

*Pritha nana (Simon, 1868)

Chorotype. Mediterranean.

Habitat. Garrigue (ined.); mining landfills co-

vered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining land-

fills covered by pioneer vegetation 1 male 5-

19.V.2009, 3 males 19.V-4.VI.2009, 3 males, 1

female 29.VI-14.VII.2009, 3 males 4-16.VI.2009,

2 males 16-29.VI.2009, 1 female 14-28.VII.2009

(ISE); m 200, garrigue, 3 males 19.V-4.VI.2009, 2

males 29.VI-14.VII.2009, 2 males 16-29.VI.2009,

2 males 4-16.VI.2009 (ISE), 2 males 4-16.VI.2009,

1 female 14-28.VII.2009 (MBG), 1 male 14-

28.VII.2009 (ISE) (all pitfall traps and leg. Sassu

A., Verdinelli M.). Guspini . Montevecchio, Picca-

linna, m 235, garrigue, pitfall traps, 1 male 15-

30.VI.2009 leg. Sassu A., Verdinelli M. (ISE).

Family SICARIDAE

Loxosceles rufescens (Dufour, 1820)

Chorotype. Cosmopolitan.

References. (6) Magretti, 1880 (subL. erythro-

cephala ); (10) Costa, 1885; (13) Garneri, 1902 (sub

L. erytrocephala ); (31) Brignoli, 1969a; (32) Bri-

gnoli, 1969b; (34) Dresco & Hubert, 1969; (46)

Thermes, 1972; (57) Brignoli, 1976a; (84) Pesarini,

1994; (126) Grafitti & Merella, 2008; (133) Trotta,

2009; (139) Trotta, 2011.

Province. (84); Cagliari (10, 13, 31, 32, 46, 57,

139); Carbonia-Iglesias (6, 13, 46, 126, 133, 139);

Medio Campidano (139, ined.); Nuoro (31, 34);

Olbia-Tempio (31, 32, 133); Oristano (ined.); Sas-

sari (6, 13, 57, 133, ined.).

Habitat. Hypogean habitat (31, 34, 46, 126);

orchard (ined.); garrigue (ined.); inside house

(ined.); mediterranean maquis (ined.); mining land-

fills covered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediter-

ranean maquis, 1 male and 1 female 19.V-

4. VI. 2009, 1 male 16-29.VI.2009, 1 female 14-

28.VII.2009 (ISE); m 170, mining landfills

covered by pioneer plants, 1 female 5-19. V.2009,

1 male 19.V-4.VI.2009, 1 male and 1 female 4-

16.VI.2009, 2 males 16-29.VI.2009, 6 males and

1 female 29.VI-14.VII.2009 (ISE), 2 males 4-

16. VI. 2009 (MBG), 1 male, 2 females and 1 juv.

14-28.VII.2009, 2 males 28.VII-10.VIII.2009, 2

males and 1 female 6-20.X.2009 (ISE); m 200,

garrigue, 2 males and 3 females 19.V-4.VI.2009

(MBG), 1 male and 1 female 19.V-4.VI.2009, 1

male 4- 16. VI. 2009, 3 males and 1 female 14-

28.VII.2009 (ISE), 1 male 28.VII-10.VIII.2009

(MBG), 1 male 28.VII-10.VIII.2009, 1 male

25.VIII-8.IX.2009, 1 male 10-25.VIII.2009 (ISE)

(all pitfall traps and leg. Sassu A., Verdinelli M.).

Guspini . Montevecchio, Piccalinna, m 225, mi-

ning landfills covered by pioneer plants, 1 female

5-18. V.2009, 1 male 30.VI-13.VII.2009, 2 males

3-15. VI. 2009 (ISE); m 235, garrigue, 1 male

18.V-3.VI.2009 (ISE), 1 female 15-30.VI.2009

(MBG), 1 male 15-30.VI.2009, 1 male 13-

27.VII.2009 (ISE), 1 female 13-27.VII.2009

(MBG), 1 male 6-20.X.2009 (ISE) (all pitfall

traps and leg. Sassu A., Verdinelli M.).

OLBIA-TEMPIO: Olbia . Isola Molara, 1 female

25.11.1966; near little church, 1 female 3. XI. 1965;

Isola Tavolara, 24.11.1966 (MBG) (all leg. Gruppo

Isole C.N.R.).

ORISTANO: Bonarcado . inside house, 1 juv

5.1.2009 leg. Sassu A. (ISE).

SASSARI: Sorso, Pianu Mannu, Nali farm, or-

chard, pitfall traps, 1 male 24-3 l.VII. 1997 leg. 1st.

Ent. SS (ISE).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Family SCYTODIDAE

Scytodes thoracica (Latreille, 1802)

Chorotype. Flolarctic.

References. (13) Gameri, 1902; (31) Brignoli,

1969a; (84) Pesarini, 1994; (94) Amo et al., 1998.

Province. (84); Cagliari (ined.); Carbonia-Igle-

sias (13, 31); Olbia-Tempio (31); Oristano (ined.);

Sassari (94, ined.).

Habitat. Avenue of lime trees (94); inside house

(ined.); pinewood (ined.).

Examined material. CAGLIARI: Pula . Pixina

Manna, m 140, pinewood, emergence cages, 1 fe-

male 25.V.2009 leg. 1st. Ent. SS (ISE).

ORISTANO: Bonarcado . inside house, 1 female

5.1.2009 leg. SassuA. (ISE).

OLBIA-TEMPIO: Olbia . Isola Molara, 2 fema-

les 25.11.1966 leg. Valle A., Bianchi R. (MBG).

Scytodes velutina Heineken et Lowe, 1832

Chorotype. Mediterranean.

References. (13) Gameri, 1902 (sub S. delica-

tula ); (31) Brignoli, 1969a (sub S. delicatula ); (57)

Brignoli, 1976a; (133) Trotta, 2009.

Province. Cagliari (13); Carbonia-Iglesias (31);

Medio Campidano (ined.); Nuoro (31, 57); Olbia-

Tempio (133); Sassari (ined.).

Habitat. Garrigue (ined.); mediterranean maquis

(ined.); mining landfills covered by pioneer plants

(ined.); vineyard (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, 1 female 28.VII-10.VIII.2009, 2 males 10-

25.VIII.2009 (MBG); m 170, mining landfills cov-

ered by pioneer plants, 1 male and 1 juv.

5- 19.V.2009, 6 males 19.V-4.VI.2009, 2 males and

1 juv. 16-29. VI. 2009, 4 males 4- 16. VI. 2009, 1 male

29. VI- 14. VII. 2009, 2 males and 3 females 14-

28. VII.2009, 2 males and 1 females 28. VII-

10.VIII.2009, 2 females 8-22.IX.2009, 2 males

6- 20.X.2009 (ISE); m 200, garrigue, 4 males 19.V-

4. VI. 2009, 1 male 5-19.V.2009, 1 male 16-

29. VI.2009, 2 males 29.VI-14.VII.2009, 1 male

14-28.VII.2009 (ISE) (all pitfall traps and leg. Sassu

A., Verdinelli M.). Guspini . Montevecchio, Picca-

linna, m 225, mining landfills covered by pioneer

plants, 2 males 15-30.VI.2009, 6 males and 1 female

3-15.VI.2009, 1 male30.VI-13.VII.2009, 1 male and

1 female 13-27. VII. 2009, 2 males and 1 female

27.VII-10.VIII.2009, 1 female 10-25.VIII.2009

(ISE); m 235, garrigue, 1 male 18.V-3.VI.2009, 1

male 3-15.VI.2009 (ISE), 1 male and 1 female

30.VI-13.VII.2009 (MBG), 1 female 15-30.VI.2009,

2 males 27.VII-10.VIII.2009 (ISE), 1 female 13-

27.VII.2009 (MBG), 1 male 10-25.VIII.2009 (ISE);

m 260, mediterranean maquis, 1 male and 1 juv. 5-

18.V.2009, 4 males, 1 female and 1 juv. 18.V-

3.VI.2009, 3 males and 1 female, 30.VI-13.VII.2009,

2 males and 1 female 15-30.VI.2009, 5 males and 1

female 3-15.VI.2009, 1 male27.VII-10.VIII.2009, 1

male, 2 females and 1 juv 13-27.VII.2009, 1 male

and 1 female 13-27.VII.2009, 1 male 25.VIII-

8.IX.2009, 2 females 10-25.VIII.2009 (ISE), 1 male

and 1 female 22.IX-6.X.2009 (MBG), 1 male and 1

female 22.IX-6.X.2009 (ISE) (all pitfall traps and

leg. SassuA., Verdinelli M.).

SASSARI: Torralba . vineyard. 1 male l.VII. 1995,

leg. 1st. Ent. SS (ISE).

Family LEPTONETIDAE

Leptoneta insularis Roewer, 1953

Chorotype. Sard ini an endemic.

References. (19) Roewer, 1953; (28) Brignoli,

1967b; (30) Cerruti, 1968; (84) Pesarini, 1994.

Province. (84); Sassari (19, 28, 30).

Habitat. Hypogean habitat (19, 28, 30).

Leptoneta patrizii Roewer, 1953

Chorotype. Sardinian endemic.

References. (19) Roewer, 1953; (30) Cerruti,

1968; (41) Brignoli, 1971c; (51) Brignoli, 1974;

(84) Pesarini, 1994.

Province. (84); Carbonia-Iglesias (19, 30, 41, 51).

Habitat. Hypogean habitat (19, 30, 41, 51).

Leptoneta serbariuana Roewer, 1953

Chorotype. Sardinian endemic.

References. (19) Roewer, 1953; (29) Altara,

1968; (30) Cerruti, 1968; (33) Brignoli, 1969c; (38)

Puddu, 1970; (52) Puddu & Pirodda, 1974; (84)

Pesarini, 1994.

P. Pantini, A. Sassu & G. Serra

Province. (84); Carbonia-Iglesias (19, 30);

Ogliastra (29, 33, 38, 52).

Habitat. Hypogean habitat (19, 29, 30, 33,

38, 52).

Leptoneta taramellii Roewer, 1956

Chorotype. Sardinian endemic.

References. (22) Roewer, 1956; (84) Pesarini,

1994.

Province. (84); Nuoro (22).

Habitat. Hypogean habitat (22).

Paraleptoneta spinimana (Simon, 1884)

Chorotype. W-Mediterranean.

References. (19) Roewer, 1953 (sub P. fagei );

(28) Brignoli, 1967b (sub P. pasquinii ); (30) Cer-

ruti, 1968 (sub P. fagei); (33) Brignoli, 1969c (sub

P fagei); (41) Brignoli, 1971c (sub P. spinimana

fagei); (52) Puddu & Pirodda, 1974 (sub Segrea

sardiniensis); (64) Brignoli, 1979d; (67)

Puddu, 1980; (84) Pesarini, 1994; (121) Grafitti,

2007a (sub Segrea sardiniensis).

Province. (84); Cagliari (33, 41); Cagliari/Nuoro

(67); Carbonia-Iglesias (28, 33, 41, 52, 64); Oglia-

stra (64); Sassari (19, 30, 121).

Habitat. Hypogean habitat (19, 28, 30, 33, 41,

52, 64, 67, 121).

Family PHOLCIDAE

Holocnemus pluchei (Scopoli, 1763)

Chorotype. Mediterranean.

References. (3) Pavesi, 1876 (sub Pholcus ri-

vulatus); (13) Gameri, 1902 (sub H. rivulatus); (20)

Krauss, 1955 (sub H. pulchii); (40) Brignoli, 1971b;

(54) Brignoli, 1975; (84) Pesarini, 1994.

Province. (20, 84); Cagliari (13, 54); Carbonia-

Iglesias (3, 13, 40, 54); Nuoro (40); Olbia-Tempio

(54); Sassari (40, 54).

Pholcus opilionoides (Schrank, 1781)

Chorotype. Holarctic.

References. (13) Gameri, 1902; (84) Pesarini,

1994.

Province. (84); Cagliari (13).

Pholcus phalangioides (Fuesslin, 1775)

Chorotype. Cosmopolitan.

References. (5) Pavesi, 1878; (6) Magretti,

1880; (10) Costa, 1885; (13) Gameri, 1902; (14)

Gozo, 1908; (19) Roewer, 1953; (22) Roewer,

1956; (30) Cerruti, 1968; (34) Dresco & Hubert,

1969; (37) Argiolas et al., 1970; (38) Puddu, 1970;

(40) Brignoli, 1971b; (41) Brignoli, 1971c; (44) Ca-

sale, 1972; (46) Thermes, 1972; (47) Bartolo et al.,

1973; (51) Brignoli, 1974; (64) Brignoli, 1979d;

(83) Pons, 1993; (84) Pesarini, 1994; (105) Grafitti,

2003; (121) Grafitti, 2007a; (122) Grafitti, 2007b;

(126) Grafitti & Merella, 2008.

Province. (84); Cagliari (6, 10, 13, 14, 37, 40,

46, 64); Carbonia-Iglesias (14, 19, 30, 40, 41, 46,

47, 64, 83, 105, 126); Nuoro (22, 34, 41, 44, 51, 83);

Ogliastra (38, 64); Olbia-Tempio (5, 13, 40, ined.);

Oristano (64, 122); Sassari (51, 64, 83, 121, ined.).

Habitat. Hypogean habitat (14, 19, 22, 30, 34,

37, 38, 40, 41, 44, 46, 47, 51, 64, 83, 105, 121, 126,

ined.); inside house (ined.).

Examined material. OLBIA-TEMPIO: Olbia .

Isola Molara, 3 females 25.11.1966 leg. Valle A.

(MBG); Isola Tavolara, Grotta del Papa, 1 female

26.11.1966 leg. Gmppo Isole C.N.R. (MBG).

SASSARI: Sassari . inside house, 1 female

2.X.2007 leg. Sassu A. (ISE).

Psilochorus simoni (Berland, 1911)

Chorotype. European.

References. (64) Brignoli, 1979d.

Province. Cagliari (64).

Habitat. Hypogean habitat (64).

Spermophora senoculata (Duges, 1836)

Chorotype. Holarctic.

References. (34) Dresco & Hubert, 1969; (37)

Argiolas et al., 1970; (40) Brignoli, 1971b; (45) Sanna

et al., 1972; (64) Brignoli, 1979d; (84) Pesarini, 1994.

Province. (84); Cagliari (37); Carbonia-Iglesias

(45, 64); Nuoro (34, 40).

Habitat. Hypogean habitat (34, 37, 45, 64).

Spermophorides baunei Wunderlich, 1995

Chorotype. Sardinian endemic.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

References. (87) Wunderlich, 1995b.

Province. Nuoro/Ogliastra (87); Ogliastra (87).

Habitat. Under stones (87).

Spermophorides elevata (Simon, 1873)

Chorotype. Tyrrhenian endemic.

References. (40) Brignoli, 1971b (sub Spermo-

phora elevata).

Province. Cagliari (40); Carbonia-Iglesias (40);

Medio Campidano (40); Nuoro (40); Olbia-Tempio

(40, ined.); Sassari (40).

Examined material. OLBIA-TEMPIO: Olbia .

Isola Molarotto, 1 juv. 25.11.1966 (MBG); Isola Ta-

volara, 1 male 5.XI.1965 (MBG) (all leg. Gruppo

Isole C.N.R.).

Family SEGESTRIDAE

Ariadna brignolii Wunderlich, 2011

Chorotype. Tyrrhenian endemic.

References. (136) Wunderlich, 2011.

Province. Medio-Campidano (136).

Remarks. The citation is based only on female

specimens and requires further confirmation.

Segestria bavarica C.L. Koch, 1843

Chorotype. Palearctic.

References. (127) Lorn et al., 2008.

Province. (127); Nuoro (ined.).

Habitat. Hazelnut-orchard (127, ined.).

Examined material. NUORO: Tiana . m 522,

hazelnut-orchard, bark traps, 1 juv 19-27.' VII. 2005

(ISE), 1 juv 31.VIII-7.IX.2005 (MBG) (all leg.

I.S.E.).

Segestria florentina (Rossi, 1790)

Chorotype. European.

References. (8) Costa, 1884; (13) Garneri,

1902; (58) Brignoli, 1976b; (84) Pesarini, 1994;

(94) Arno et al., 1998; (132) Pantini & Sassu, 2009.

Province. (84); Cagliari (58); Carbonia-Iglesias

(58); Nuoro (8, 13); Olbia-Tempio (8, 13); Sassari

(8, 94, 132, ined.).

Habitat. Avenue of lime trees (94).

Examined material. SASSARI: Sassari .

Giordano, m 40, 1 female 6. III. 2009, leg. Molinu

A. (ISE).

Segestria senoculata (Linnaeus, 1758)

Chorotype. Palearctic.

References. (13) Garneri, 1902; (94) Arno et

al., 1998; (127) Lorn et al., 2008.

Province. (127); Cagliari (13); Nuoro (ined.);

Sassari (94).

Habitat. Avenue of lime trees (94); hazelnut-

orchard (127, ined.).

Examined material. NUORO: Belvi . Su Ajone,

m 585, hazelnut-orchard, bark traps, 1 juv. 1-

8. VI. 2005 (ISE), 1 juv. 1-8.VI.2005 (MBG), 1 juv.

14-19.VII.2005 (MBG), 1 juv. 19-27.VII.2005

(MBG), 1 juv. 10-17.VIII.2005 (MBG), 1 juv. 10-

17.VIII.2005 (ISE), 1 male 13-20.X.2004 (MBG)

(all leg. I.S.E.).

Remarks on family Segestridae. Wunderlich

(2011) illustrates the complex nomenclature and taxo-

nomic issues to do with the genus Ariadna Audouin,

1 826 in the Mediterranean. He claims that A. insi-

diatrix is a species limitated to North Africa, ther-

fore the citation of this species in Sardinia by Trotta

(2009) refers very probably to another taxon,

maybe A. brignolii. While awaiting further data

about the distribution of this genus, it was thought

better not to include A. insidiatrix in the catalogue.

Family DYSDERIDAE

Dysdera ancora Grasshoff, 1959

Chorotype. Tyrrhenian endemic.

References. (23) Grasshoff, 1959; (84) Pesa-

rini, 1994.

Province. (84); Cagliari (23); Medio Campi-

dano (23); Oristano (23).

Remarks. It would be necessary to re-examine

Grasshoff’s material in order to define the real iden-

tity of the species. (Gasparo F. pers. comm.).

P. Pantini, A. Sassu & G. Serra

Dysdera crocata C.L. Koch, 1838

Chorotype. Cosmopolitan.

References. (3) Pavesi, 1876 (sub D. crocota );

(4) Magretti, 1878 (sub D. crocota ); (6) Magretti,

1880 (sub D. crocota ); (10) Costa, 1885; (13) Gar-

neri, 1902 (sub D. crocota ); (20) Krauss, 1955; (23)

Grasshoff, 1959; (79) Deeleman-Reinhold & Dee-

leman, 1988; (84) Pesarini, 1994.

Province. (13, 20, 23, 84); Cagliari (6, 13, 23,

79); Carbonia-Iglesias (3, 6, 13, 23); Medio-Cam-

pidano (ined.); Nuoro (ined.); Oristano (4, 6, 13,

23); Sassari (6, 10, 13, ined.).

Habitat. Cherry-orchard (ined.); orchard

(ined.); river (23); mediterranean maquis (ined.);

hazelnut-orchard (ined.); near a cave (23); under Ju-

mp erus sp. (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, pitfall traps, 1 female 29.VI-14.VII.2009

leg. Sassu A., Verdinelli M. (ISE). Guspini . Mon-

tevecchio, Piccalinna, m 260, mediterranean ma-

quis, pitfall traps, 1 female 30.VI-13.VII.2009 leg.

Sassu A., Verdinelli M. (ISE).

NUORO: Belvi, Antonitzo, m 683, cherry-

orchard, 2 males 11-18.IV.2007, 2 males 18-

26.IV.2007, 4 males 16-23.V.2007, 3 males and 3

females 2 1-28. VI. 2007, 1 male and 1 female 17-

24.VII.2007, 1 female 24-30.VIII.2007 (ISE); Su

Enazzu, m 550, hazelnut-orchard, 4 males and 2 fe-

males 27. VII-8. VIII. 2006, 1 male and 1 female 13-

27.VII.2006 (MBG), 3 males 13-27.VII.2006 (ISE),

1 male 8-24. VIII. 2006, 1 male and 2 females 21. IX-

5.X. 2006, 1 female 31.X-21.XI.2006, 1 male 5-

16.X.2006, 1 female 21.XI.2006-8.I.2007, 1 male

21.II-19.III.2007 (MBG), 4 males 19.III-26.IV.2007

(MBG), 1 female 26.IV-30.V.2007 (ISE), 1 male

and 1 juv. 30.V-4.VII.2007 (MBG) (all pitfall traps

and leg. I.S.E.).

SASSARI: Sorso, Pianu Mannu, Nali farm, or-

chard, pitfall traps, 1 male and 1 female 24-

3 l.VII. 1997 leg. 1st. Ent. SS (ISE).

Dysdera jana Gasparo et Arnedo, 2009

Chorotype. Sardinian endemic.

References. (128) Arnedo et al., 2009.

Province. Nuoro (128).

Habitat. Under Pinus (128); under Quercus

ilex (128).

Dysdera shardana Opatova et Arnedo, 2009

Chorotype. Sardinian endemic.

References. (23) Grasshoff, 1959 (sub Dysdera

kollari misidentification) (128) Arnedo et al., 2009.

Province. Cagliari (128); Nuoro (128, ined.);

Oristano (23, 128); Sassari (23).

Habitat. Castaneus and Quercus suber forest

(127); dry, open Quercus forest (127); mixed Pinus

and Quercus forest (127); old crops and open forest

Quercus and Rubus (127); open Quercus forest

w/mosses (127); Quercus pubescens forest (127);

under Quercus ilex (127); walnut- orchard (ined.).

Examined material. NUORO: Tonara. Su Az-

zime, m 682, walnut-orchard, pitfall traps, 1 male

11-18.IV.2007, 1 male 16-23.V.2007 (MBG) (all

leg. I.S.E.).

Dysdera ventricosa Grasshoff, 1959

Chorotype. Tyrrhenian endemic.

References. (23) Grasshoff, 1959; (84) Pesa-

rini, 1994.

Province. (84); Cagliari (23).

Remarks. A species to re-examine. From Gra-

sshoff’s drawing it is unclear how the “bulb” is

formed, which seems to lack all the apical structures

typical of the genus Dysdera. The holotype could

be a defective specimen (Gasparo F. pers. comm.).

Harpactea alicatai Brignoli, 1979

Chorotype. Sardinian endemic.

References. (62) Brignoli, 1979b; (84) Pesa-

rini, 1994.

Province. (84); Sassari (62).

Harpactea gennargentu Wunderlich, 1995

Chorotype. Sardinian endemic.

References. (87) Wunderlich, 1995b.

Province. Nuoro (ined.); Nuoro/Ogliastra (87).

Habitat. Hazelnut-orchard (ined.); alder grove

(ined.); under Juniperus sp. (ined.); under stones in

a forest (87).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, pitfall traps, 1

male 30.V-4.VII.2007 (ISE), 6 males 30.V-

4. VII. 2007 (MBG) (all leg. I.S.E.). Desulo . Gen-

nargentu, mountain refuge, m 1500, under

Juniperus sp., 1 female 11 -25. VII. 2006 (ISE),

alder-grove, 1 female 23.VIII-5.IX.2006, 1 female

19.IX-3.X.2006, 3 males and 1 female 10-

24.V.2007 (ISE) (all pitfall traps and leg. Fiori F.).

Fonni, Gennargentu, mountain refuge, m 1550,

under Juniperus sp., pitfall traps, 1 male 5-

19.VI.2007 leg. Fiori F. (ISE).

Harpactea nuragica Alicata, 1966

Chorotype. Sardinian endemic.

References. (25) Alicata, 1966; (84) Pesarini,

1994.

Province. (84); Medio-Campidano (ined.);

Nuoro (25).

Habitat. Quercus ilex forest, under stones (25);

mediterranean maquis (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, pitfall traps, 2 males 7-21.IV.2009, 2 males

19.V-4.VI.2009, 1 male 5-19.V.2009 leg. Sassu A.,

Verdinelli M. (ISE). Guspini . Montevecchio, Pic-

calinna, m 260, mediterranean maquis, pitfall traps,

2 males 21.IV-5.V.2009, 2 males 7-21.IV.2009 leg.

Sassu A., Verdinelli M. (ISE).

Harpactea sardoa Alicata, 1966

Chorotype. Tyrrhenian endemic.

References. (25) Alicata, 1966; (84) Pesarini,

1994.

Province. (84); Nuoro (25, ined.).

Habitat. Cherry-orchard (ined.); Quercus ilex

forest (25); walnut-orchard (ined.).

Examined material. NUORO: Belvi . Anto-

nitzo, m 683, cherry-orchard, 1 male 18-26.IV.2007

(ISE); Canale e' Figu, m 576, walnut-orchard, 1

male 16-23.V.2007 (ISE); Mannaritzo, m 706,

cherry-orchard, 1 male 11-18.IV.2007, 3 males 18-

26.IV.2007 (ISE) (all pitfall traps and leg. I.S.E.).

Tonara, Su Azzime, m 682, walnut-orchard, pitfall

traps, 1 male 18-26.IV.2007, 1 male 16-23.V.2007

leg. I.S.E. (ISE).

Parachtes inaequipes (Simon, 1882)

Chorotype. Sardo-Corsican endemic.

References. (54) Brignoli, 1975; (84) Pesarini,

1994.

Provinces. (84); Olbia-Tempio (54); Sassari

(54).

Parachtes limbarae (Kraus, 1955)

Chorotype. Sardinian endemic.

References. (20) Krauss, 1955 (sub Harpacto-

crates limbarae ); (84) Pesarini, 1994.

Province. (84); Medio Campidano (ined.);

Nuoro (ined.); Sassari (20).

Habitat. Cherry-orchard (ined.); mediterranean

maquis (ined.); hazelnut-orchard (ined.); alder-

grove (ined.).

Examined material. MEDIO CAMPIDANO:

Guspini . Montevecchio, Piccalinna, m 260, medi-

terranean maquis, pitfall traps, 1 male 5-18.V.2009

(MBG), 2 males 5-18.V.2009, 1 male 13-

27.VII.2009 (ISE) (all leg. Sassu A., Verdinelli M.).

NUORO: Belvi . Antonitzo, m 683, cherry-or-

chard, 1 male 11-18.1.2008 (ISE); Su Enazzu, m

550, hazelnut-orchard, 1 male 21. II- 19. III. 2007

(ISE) (all pitfall traps and leg. I.S.E.). Desulo . Gen-

nargentu, mountain refuge, m 1500, alder-grove,

pitfall traps, 1 female and 3 males 10-24.V.2007 leg.

Fiori F. (ISE). Fonni . Gennargentu, mountain re-

fuge, m 1550, alder-grove, pitfall traps, 2 males 5-

19.VI.2007 leg. Fiori F. (ISE).

Sardostalita patrizii (Roewer, 1956)

Chorotype. Sardinian endemic.

References. (22) Roewer, 1956 (sub Stalita pa-

trizii); (30) Cerruti, 1968 (sub Stalita patrizii ); (84)

Pesarini, 1994; (98) Gasparo, 1999; (103) Grafitti,

2001; (106) Casale et al., 2004.

Province. (84); Nuoro (22, 30, 98); Ogliastra

(98, 103, 106).

Habitat. Hypogean habitat (22, 30, 98, 103, 106).

Remarks on family Dysderidae. Citations of

Dysdera erythrina (Costa, 1885; Gameri, 1902) and

D. nicaeensis (Roewer, 1953; Cerruti, 1968) are

P. Pantini, A. Sassu & G. Serra

considered unreliable (Gasparo F. pers. comm.) and

therefore excluded from the catalogue.

Family OONOPIDAE

Oonops placidus corsicus Dalmas, 1916

Chorotype. W-Mediterranean (?).

References. (27) Brignoli, 1967a; (54) Bri-

gnoli, 1975; (84) Pesarini, 1994 (sub O. placidus).

Provinces. (84); Nuoro (27); Oristano (27, 54);

Sassari (27).

Remarks. Pesarini (1994) cites only O. placidus

in the checklist without indicating the subspecies.

In Sardinia only the subspecies corsicus is cited.

Orchestina pavesii (Simon, 1873)

Chorotype. Mediterranean.

References. (27) Brignoli, 1967a; (54) Bri-

gnoli, 1975; (84) Pesarini, 1994.

Province. (84); Sassari (27, 54, ined.).

Habitat. Olive-grove (ined.).

Examined material. SASSARI: Sassari . Lu

Buttangaru, olive-grove, chemical knockdown, 1

male 20.X.2008 leg. 1st. Ent. SS (MBG).

Orchestina setosa Dalmas, 1916

Chorotype. W-Mediterranean (?).

References. (27) Brignoli, 1967a.

Province. Sassari (27).

Orchestina simoni Dalmas, 1916

Chorotype. S-European.

References. (27) Brignoli, 1967a.

Province. Sassari (27).

Silhouettella loricatula (Roewer, 1942)

Chorotype. Turano-Europeo-Mediterranean.

References. (27) Brignoli, 1967a (sub Dysde-

rina loricatula ); (84) Pesarini, 1994 (sub Dysde-

rina loricata); (118) Burger et al., 2006; (133)

Trotta, 2009.

PROVINCE: (84); Cagliari (133); Carbonia-

Iglesias (133); Medio Campidano (27, ined.);

Nuoro (27, 118); Olbia-Tempio (133); Sassari (27,

ined.).

Habitat. Garrigue (ined.); mediterranean maquis

(ined.); mining landfills covered by pioneer plants

(ined.); vineyard (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, 1 female 16-29.VI.2009, 3 females 14-

28.VII.2009, 1 female 8-22.IX.2009 (ISE); m 170,

mining landfills covered by pioneer plants, 1 female

5-19.V.2009 (ISE) (all pitfall traps and leg. Sassu A.,

Verdinelli M.). Guspini . Montevecchio, Piccalinna,

m 235, garrigue, 1 female 13-27.VII.2009 (ISE); m

260, mediterranean maquis, 1 female 13-27.VII.2009

(MBG), 1 female 22.IX-6.X.2009 (ISE) (all pitfall

traps and leg. Sassu A., Verdinelli M.).

SASSARI: Torralba . vineyard, 1 female

29.IV. 1995 leg. 1st. Ent. SS (ISE).

Family PALPIMANIDAE

Palpimanus gibbulus Dufour, 1820

Chorotype. Mediterranean.

References. (8) Costa, 1884; (13) Gameri,

1902; (20) Krauss, 1955; (84) Pesarini, 1994; (133)

Trotta, 2009; (139) Trotta, 2011.

Province. (84); Cagliari (8, 13, ined.); Carbo-

nia-Iglesias (13, 133); Medio Campidano (139,

ined.); Sassari (20).

Habitat. Garrigue (ined.); pinewood (ined.);

mining landfills covered by pioneer plants (ined.).

Examined material. CAGLIARI: Pula . Pixina

Manna, m 140, pinewood, emergence cages, 1 fe-

male 29.IV.2009, 1 male, 2 females, 1 juv

25.V.2009 leg. 1st. Ent. SS (ISE).

MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-

cauli, m 170, mining landfills covered by pioneer

plants, 1 male 21.IV-5.V.2009, 1 male4-16.VI.2009

(ISE); m 200, garrigue, 1 male 19.V-4.VI.2009

(MBG), 1 female 25.VIII-8.IX.2009 (ISE) (all pit-

fall traps and leg. Sassu A., Verdinelli M.). Guspini .

Montevecchio, Piccalinna, m 235, garni gue, pitfall

traps, 1 female 18.V-3.VI.2009 (MBG), 1 male

18.V-3.VI.2009, 1 male 3-15.VI.2009 (ISE) (all leg.

Sassu A., Verdinelli M.).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Family MIMETIDAE

Ero aphana (Walckenaer, 1802)

Chorotype. European.

References. (13) Gameri, 1902; (112) Thaler

& Knoflach, 2004; (113) Thaler et al., 2004.

Province. Cagliari (13); Ogliastra (112, 113);

Oristano (ined.); Sassari (ined.).

Habitat. Orchard (ined.); olive-grove (ined.);

vineyard (ined.).

Examined material. ORISTANO: Cabras .

Sinis, at sea level, 1 male 20.IV.2003 leg. Pantini

R, Magnati F. (MBG).

SASSARI: Sorso, Pianu Mannu, Nali farm,

olive-grove, 1 female 25.VI.1993 (ISE); orchard, 1

female 26. VI. 1997 (ISE) (all beating tray and leg. 1st.

Ent. SS). Torralba . vineyard, 1 female 17.VI.1995

leg. 1st. Ent. SS (ISE).

Ero tuberculata (De Geer, 1778)

Chorotype. Palearctic.

References. (12) Costa, 1886; (13) Garneri,

1902; (127) Lorn et al., 2008.

Province. (13, 127); Cagliari (ined.); Medio

Campidano (12); Nuoro (ined.); Sassari (ined.).

Habitat. Citrus-grove (ined.); marshland (12);

hazelnut-orchard (127, ined.); vineyard (ined.).

Examined material. CAGLIARI: Uta, S'Appas-

siu, Agris farm, citrus-grove, beating tray, 1 female

23.X. 2000 leg. CRAS (ISE).

NUORO: Belyi, Su Ajone, m 585, hazelnut-

orchard, bark traps, 1 female 21-29.IX.2005 leg.

I.S.E. (ISE). Tiana, m 522, hazelnut-orchard, beat-

ing tray, 1 female 21.IX.2005 leg. I.S.E. (ISE).

SASSARI: Torralba . vineyard, 1 female

15.X. 1994 leg. 1st. Ent. SS (ISE).

Mimetus laevigatus (Keyserling, 1863)

Chorotype. Centralasiatic-Mediterranean.

References. (13) Garneri, 1902 (sub M. inter-

fector Simon, 1881 misidentification).

Province. Cagliari (13).

Family ERESIDAE

Eresus kollari Rossi, 1 846

Chorotype. Sibero-European.

References. (7a) Costa, 1882 (sub E. quatuor-

guttatus ); (8) Costa, 1884 (sub E. quatuorguttatus );

(13) Gameri, 1902 (sub Eresus cinnaberinus ) (Ere-

sus cinnaberinus).

Province. Nuoro/Ogliastra (7a, 8, 13); Ogliastra

(ined.).

Examined material. OGLIASTRA: Arzana .

near Punta La Marmora, 1 male 1 .X.2007 leg. Mar-

rosu M. (ISE).

Eresus ruficapillus C.L. Koch, 1846

Chorotype. S-European.

References. (1) Canestrini & Pavesi, 1868; (2a)

Canestrini & Pavesi, 1870; (8) Costa, 1884; (13)

Gameri, 1902.

Provinces. (1, 2a); Nuoro/Ogliastra (8); Oglia-

stra (13).

Habitat. Under stones (8).

Family OECOBIIDAE

Oecobius maculatus Simon, 1870

Chorotype. Turano-Mediterranean.

References. (90) Wunderlich, 1995e; (116)

Helsdingen, 2005.

Province. Medio Campidano (ined.); Nuoro

(90, 116); Ogliastra (116); Sassari (90).

Habitat. Garrigue (ined.); inside house (116);

under stones (90); mining landfills covered by pio-

neer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining land-

fills covered by pioneer plants, 4 males and 1 fe-

male 19.V-4.VI.2009, 4 males 4-16.VI.2009, 1

female 16-29.VI.2009, 3 males and 1 female

28.VII-10.VIII.2009, 4 males and 1 female 10-

25.VIII.2009 (ISE), 1 female 25.VIII-8.IX.2009

(MBG); m 200, garrigue, 1 female 4-16.VI.2009, 1

male 28.VII-10.VIII.2009 (ISE) (all pitfall traps and

leg. Sassu A., Verdinelli M.). Guspini . Montevec-

chio, Piccalinna, m 225, mining landfills covered

by pioneer plants, pitfall traps, 3 males 5-

18.V.2009, 12 males and 1 female 18.V-3.VI.2009,

3 males and 2 females 15-30. VI. 2009 (ISE), 6

males 3- 15. VI. 2009 (MBG), 1 male and 1 female

30.VI-13.VII.2009, 10 males, 2 females and 1 juv.

3-15.VI.2009, 6 males, 2 females and 3 juv. 13-

27.VII.2009, 14 males and 5 females 27.VII-

P. Pantini, A. Sassu & G. Serra

10.VIII.2009, 2 males and 1 female 10-

25.VIII.2009, 2 females 25.VIII-8.IX.2009 (ISE),

1 male and 4 females 10-25.VIII.2009 (MBG) (all

leg. Sassu A., Verdinelli M.).

Oecobius navus Blackwall, 1859

Chorotype. Cosmopolitan.

References. (37) Argiolas et al., 1970 (sub O. an-

nulipes ); (46) Thermes, 1972 (sub O. annulipes ); (50)

Baum, 1974 (sub O. annulipes ); (52) Puddu & Pi-

rodda, 1974 (sub O. annulipes ); (94) Arno et al., 1998

(sub O. annulipes ); (132) Pantini & Sassu, 2009.

Provinces. Cagliari (37, 46, 52); Medio Cam-

pidano (ined.); Nuoro (50); Sassari (94, 132).

Habitat. Avenue of lime trees (94); hypogean

habitat (37, 46, 52); garrigue (ined.); mediterra-

nean maquis (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediter-

ranean maquis, pitfall traps, 1 male 19.V-

4. VI. 2009 (ISE), 1 male and 1 female, 16-

29.VI.2009 (MBG), 4 males 29.VI-14.VII.2009,

6 males 4-16.VI.2009, 2 males 16-29.VI.2009

(ISE), 1 male 14-28.VII.2009 (MBG), 1 female

14-28.VII.2009 (ISE) (all leg. Sassu A., Verdinelli

M.). Guspini . Montevecchio, Piccalinna, m 235,

garrigue, pitfall traps, 1 male 18.V-3.VI.2009 leg.

Sassu A., Verdinelli M. (ISE).

Uroctea durandi (Latreille, 1809)

Chorotype. Mediterranean.

References. (13) Gameri, 1902.

Province. Nuoro/Ogliastra (13).

Family ULOBORIDAE

Hyptiotes paradoxus (C.L. Koch, 1834)

Chorotype. Palearctic.

References. (127) Lom et al., 2008.

Province. (127); Nuoro (ined.); Sassari (ined.).

Habitat. Hazelnut-orchard (127, ined.); olive-

grove (ined.); vineyard (ined.).

Examined material. NUORO: Tiana . m 522,

hazelnut-orchard, beating tray, 1 male 7.IX.2005

leg. I.S.E. (ISE).

SASSARI: Alghero . Mamuntanas, olive-grove,

chemical knockdown, 1 male 13.X.2009, 1 female

20.X.2009 leg. 1st. Ent. SS (ISE). Torralba . vine-

yard, beating tray, 1 female 30.IX.1995 leg. 1st.

Ent. SS (ISE).

Polenecia producta (Simon, 1873)

Chorotype. Mediterranean.

References. (61) Brignoli, 1979a.

Provinces. Olbia-Tempio (61).

Uloborus plumipes Lucas, 1 846

Chorotype. Mediterranean.

References. (46) Thermes, 1972; (52) Puddu

& Pirodda, 1974; (83) Pons, 1993.

Province. Cagliari (46, 52, ined.); Nuoro (83);

Sassari (83, ined.).

Habitat. Hypogean habitat (46, 52, 83).

Examined material. CAGLIARI: Domus de

Maria . Punta su Pisu, m 14, 2 males, 2 females,

XII. 2006 leg. Ruzzante (MBG).

SASSARI: Sorso, Platamona, at sea level, 1 fe-

male 4.VIII.1994 leg. 1st. Ent. SS (ISE).

Uloborus walckenaerius Latreille, 1806

Chorotype. Palearctic.

References. (8) Costa, 1884; (13) Gameri,

1902; (127) Lom et al., 2008.

Province. (127); Nuoro (ined.); Olbia-Tempio

(8, 13); Sassari (ined.).

Habitat. Hazelnut-orchard (127, ined.); vine-

yard (ined.).

Examined material. NUORO: Belvi . Su Ajone,

m 585, hazelnut-orchard, beating tray, 1 female

10.VIII.2005 leg. I.S.E. (ISE).

SASSARI: Sassari . Platamona, at sea level, 1

male, 22.V.2008 leg. Sassu A. (ISE). Torralba . vine-

yard, beating tray, 1 female 6.VIII.1994 leg. 1st.

Ent. SS (ISE).

Family NESTICIDAE

Nesticus eremita Simon, 1879

Chorotype. S-European.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

References. (38) Puddu, 1970; (64) Brignoli,

1979d; (83) Pons, 1993; (104) Muccedda et al.,

2002; (139) Trotta, 2011.

Province. Cagliari (64); Ogliastra (38); Sassari

(83, 104, 139, ined.).

Habitat. Hypogean habitat (38, 64, 83, 104,

ined.).

Examined material. SASSARI: Cossoine . cave

Sa Ucca e Mammuscone, 1 female 22.VII.1993 leg.

Giachino P.M. (MBG).

Family THERIDIIDAE

Anelosimus pulchellus (Walckenaer, 1802)

Chorotype. European.

References. (10) Costa, 1885 (sub Theridion

pulchellum).

Province. Cagliari (10); Sassari (ined.).

Examined material. SASSARI: Sassari . Plata-

mona, at sea level, 1 male and 1 female 22.V.2008

leg. Sassu A. (ISE).

Anelosimus vittatus (C.L. Koch, 1836)

Chorotype. European.

References. (10) Costa, 1885 (sub Theridion

vittatum ); (67) Puddu, 1980; (116) Helsdingen,

2005; (127) Lorn et al., 2008.

Province. (127); Cagliari/Nuoro (67); Nuoro

(116, ined.); Olbia-Tempio (ined.); Oristano (10);

Sassari (ined.).

Habitat. Hypogean habitat (67); orchard (ined.);

hazelnut-orchard (127, ined.); olive-grove (ined.);

grassland (ined.); forest of Quercus suber (ined.).

Examined material. NUORO: Belyi, Su Ajone,

m 585, hazelnut-orchard, beating tray, 1 male

1. VI. 2005 leg. I.S.E. (ISE). Bolotana . Badde e'Sa-

lighes, m 850, grassland, 2 males 27.V.2006 leg.

Sassu A. (ISE). Tiana . m 522, hazelnut-orchard,

beating tray, 1 female 19.V.2005 leg. I.S.E. (ISE).

OLBIA-TEMPIO: Budduso . near Nuraghe Lo-

elle, forest of Quercus suber, beating tray, 1 male

and 1 female 24.V.1999 leg. 1st. Ent. SS (ISE).

SASSARI: Sorso, Pianu Mannu, Nali farm,

olive-grove, 1 male and 1 female 21.V.1993 (ISE);

olive-grove, beating tray, 1 female 9.VI.1993, 1 fe-

male 18.VI.1993 (ISE); orchard, beating tray, 1

male 27.V.1998 (ISE) (all leg. 1st. Ent. SS).

Argyrodes argyrodes (Walckenaer, 1 842)

Chorotype. Mediterranean.

References. (3) Pavesi, 1876 (sub A. gibbosa );

(11) de Carlini, 1885 (sub A. gibbosus ); (13) Gar-

neri, 1902; (84) Pesarini, 1994.

Province. (84); Cagliari (3, 13); Carbonia-Igle-

sias (3, 11, 13); Sassari (ined.).

Habitat. Olive-grove (ined.).

Examined material. SASSARI: Alghero . Ma-

muntanas, olive-grove, chemical knockdown, 1

male 7.IX.2009 leg. 1st. Ent. SS (ISE).

Asagena phalerata (Panzer, 1801)

Chorotype. Palearctic.

References. (13) Gameri, 1902; (92) Knoflach,

1996 (sub Steatoda phalerata).

Province. (13); Nuoro/Ogliastra (13); Ogliastra

(92).

Crustulina scabripes Simon, 1881

Chorotype. Mediterranean.

References. (133) Trotta, 2009.

Province. Olbia-Tempio (133).

Cryptachaea riparia (Blackwall, 1 834)

Chorotype. Palearctic.

References. (10) Costa, 1885 (sub Theridion ri-

parium).

Province. Cagliari (10).

*Dipoena coracina (C.L. Koch, 1837)

Chorotype. European.

Habitat. Vineyard (ined.).

Examined material. SASSARI: Torralba . vine-

yard, 1 female 28.X.1995 leg. 1st. Ent. SS (ISE).

Dipoena melanogaster (C.L. Koch, 1837)

Chorotype. European.

References. (127) Lorn et al., 2008.

P. Pantini, A. Sassu & G. Serra

Province. (127); Nuoro (ined.).

Habitat. Hazelnut-orchard (127, ined.).

Examined material. NUORO: Tiana . m 522,

hazelnut-orchard, beating tray, 1 male and 1 female

19.V.2005 leg. I.S.E. (ISE).

Dipoena torva (Thorell, 1875)

Chorotype. Holarctic.

References. (94) Arno et al., 1998.

Province. Sassari (94).

Habitat. Avenue of lime trees (94).

Enoplognatha afrodite Hippa et Oksala, 1983

Chorotype. S-European.

References. (96) Bosnians & Van Keer, 1999;

(102) Pesarini, 2000; (127) Lorn et al., 2008.

Province. (127); Carbonia-Iglesias (102);

Nuoro (ined.); Olbia-Tempio (96).

Habitat. Hazelnut-orchard (127, ined.); park

area (96); Quercus suber forest (96).

Examined material. NUORO: Belvi . Su Ajone,

m 585, hazelnut-orchard, beating tray, 1 female

16.VI.2005 leg. I.S.E. (MBG).

Enoplognatha gemina Bosmans et Van Keer, 1999

Chorotype. Mediterranean.

References. (96) Bosmans & Van Keer, 1999.

Province. Ogliastra (96); Olbia-Tempio (96);

Oristano (96); Nuoro (ined.).

Habitat. Stones (96); stones in grassland (96);

under stones (96).

Examined material. NUORO: Gavoi . S'eremu

e sa mela, m 1000, 1 male 30.XII.2006 leg. Mulas

A. (MBG).

Enoplognatha latimana Hippa et Oksala, 1982

Chorotype. Palearctic.

References. (108) Knoflach, 2004.

Provinces. Ogliastra (108).

Enoplognatha mandibularis (Lucas, 1 846)

Chorotype. Sibero-European.

References. (10) Costa, 1885; (13) Garneri,

1902; (88) Wunderlich, 1995c (sub E. nigrocin-

cta ); (96) Bosmans & Van Keer, 1999; (132) Pan-

tini & Sassu, 2009; (133) Trotta, 2009; (139)

Trotta, 2011.

Provinces. Cagliari (13); Carbonia-Iglesias

(139); Nuoro (96); Ogliastra (88, 96); Olbia-Tempio

(133); Oristano (10, 13); Sassari (132).

Habitat. In a stream (88); under stones (96).

Enoplognatha nigromarginata (Lucas, 1846)

Chorotype. W-Mediterranean.

References. (13) Gameri, 1902; (96) Bosmans

& Van Keer, 1999.

Province. Cagliari (13); Ogliastra (96).

Habitat. Stones along rivulet (96).

Enoplognatha ovata (Clerck, 1757)

Chorotype. Holarctic.

References. (8) Costa, 1884 (sub Theridion li-

neatum ); (13) Gameri, 1902 (sub Theridion linea-

tum ); (84) Pesarini, 1994; (127) Lom et al., 2008.

Provinces. - (84, 127); Cagliari (13); Nuoro (8,

13, ined.); Ogliastra (13).

Habitat. Hazelnut-orchard (127, ined.); walnut-

orchard (ined.).

Examined material. NUORO: Belvi . Su Ajone,

m 585, hazelnut-orchard, beating tray, 1 male and 3

juv. 16.VI.2005, 6 males, 4 females and 3 juv.

29.VI.2005 (MBG), 2 males and 1 female

13.VII.2005 (ISE), 2 males, 1 female and 1 juv.

13.VII.2005, 2 males and 8 juv. 16.VI.2005, 2 males,

3 females and 2 juv. 29.VI.2005 (MBG), 1 male and

2 females 29.VI.2005 (ISE), 1 female 7.IX.2005, 1

female 21.IX.2005 (MBG) (all leg. I.S.E.). Tonara .

Su Azzime, m 682, walnut-orchard, pitfall traps, 1

female 17-24.VIII.2007 leg. I.S.E. (ISE).

Enoplognatha testae ea Simon, 1884

Chorotype. Holarctic.

References. (66) Brignoli, 1980 (sub Robertas

arganoi n.sp.); (84) Pesarini, 1994 (sub Robertus

arganoi ); (96) Bosmans & Van Keer, 1999.

Province. (84); Ogliastra (66); Olbia-Tempio

(96); Oristano (96).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Habitat. Hypogean habitat (66); stones along

cliff (96).

Enoplognatha thoracica (Hahn, 1833)

Chorotype. Holarctic.

References. (96) Bosnians & Van Keer, 1999.

Province. Nuoro (96, ined.); Ogliastra (96);

Olbia-Tempio (96).

Habitat. Along a river (96); cherry-orchard

(ined.); in Quercus suber forest (96); walnut-

orchard (ined.); under stones (96).

Examined material. NUORO: Belyi, Antonitzo,

m 683, cherry-orchard, 1 male 21-28.VI.2007 (ISE);

Canale e' Figu, m 576, walnut-orchard, 1 female 24-

30.VIII.2007 (ISE) (all pitfall traps and leg. I.S.E.).

Tonara . Su Azzime, m 682, walnut-orchard, pitfall

traps, 1 female 17-24.VII.2007 leg. I.S.E. (ISE).

Enoplognatha verae Bosmans et Van Keer, 1999

Chorotype. Mediterranean.

References. (96) Bosmans & Van Keer, 1999;

(133) Trotta, 2009.

Province. Carbonia-Iglesias (133); Medio

Campidano (96); Oristano (96).

Habitat. Under stone near cost (96).

Episinus algiricus Lucas, 1 846

Chorotype. W-Mediterranean.

References. (101) Knoflach & Thaler, 2000;

(130) Knoflach et al., 2009.

Province. Carbonia-Iglesias (101); Ogliastra

(130); Sassari (ined.).

Habitat. From Quercus (130); inside house

(ined.); in oak forest with rocky, bare ground (130);

pasture plateau, beating from Cistus (130).

Examined material. SASSARI: Sassari . Li

Punti, inside house, 1 male 31.V.2010 (MBG).

Episinus maculipes Cavanna, 1876

Chorotype. S-European.

References. (108) Knoflach, 2004; (130) Kno-

flach et al., 2009; (132) Pantini & Sassu, 2009.

Provinces. Ogliastra (108, 130); Sassari (132).

Habitat. From scrub and oak (130).

Episinus theridioides Simon, 1873

Chorotype. W-Mediterranean.

References. (15) Simon, 1914 (sub Plocamis

theridioides ).

Province. Sassari (15).

Episinus truncatus Latreille, 1809

Chorotype. European.

References. (8) Costa, 1884; (13) Gameri,

1902; (84) Pesarini, 1994.

Province. (84); Cagliari (13); Nuoro (8, 13);

Ogliastra (13); Oristano (8, 13).

Euryopis episinoides (Walckenaer, 1 847)

Chorotype. Mediterranean.

References. (2c) Canestrini, 1876 (sub Theri-

dium acuminatum)-, (10) Costa, 1885 (sub E. acu-

minata ); (13) Garneri, 1902 (sub E. acuminata );

(84) Pesarini, 1994 (sub E. acuminata)-, (94) Amo

et al., 1998 (sub E. tarsalis); (132) Pantini & Sassu,

2009; (133) Trotta, 2009.

Province. (2c, 84); Cagliari (ined.); Nuoro (10,

ined.); Olbia-Tempio (133); Oristano (13); Sassari

(10, 94, 132, ined.).

Habitat, citms-grove (ined.); avenue of lime trees

(94); cherry-orchard (ined.); orchard (ined.); walnut-

orchard (ined.); olive-grove (ined.); pinewood (ined.);

vineyard (ined.).

Examined material. CAGLIARI: Pula . Pixina

Manna, m 140, pinewood, emergence cages, 1 fe-

male, 21.IV.2009, leg. 1st. Ent. SS (ISE). Uta, S’Ap-

passiu, Agris farm, citms-grove, beating tray, 1

female 23.XI.2000 leg. CRAS (ISE).

NUORO: Belyi, Antonitzo, m 683, cherry-or-

chard, bark traps, 1 female 24-30.VIII.2007 (ISE);

Canale e' Figu, m 576, walnut-orchard, bark traps, 1

female 27.IX-4.X.2007 (ISE); Mannaritzo, m 706,

cherry-orchard, pitfall traps, 1 female 16-23.V.2007,

1 female 17-24.VII.2007 (ISE); bark traps, 2 females

24-30.VIII.2007 (ISE) (all leg. I.S.E.).

SASSARI: Alghero . Mamuntanas, olive-grove,

chemical knockdown, 1 female 21. VIII. 2009, 3

males and 3 females 6.VIII.2009, 1 male

P. Pantini, A. Sassu & G. Serra

30.IX.2009, 1 female, 13.X.2009 leg. 1st. Ent. SS

(ISE). Sassari, Gioscari, olive-grove, chemical

knockdown, 9 males and 2 females 6.VIII.2008, 1

female 20.VIII.2008, 1 male 4.IX.2008 (ISE); Lu

Buttangaru, olive-grove, 1 male 30.IX.2008, 3 males

13. X. 2008, 1 male 29.IX.2009 leg. 1st. Ent. SS

(ISE); Li Punti, Baldinca, m 110, 1 male

14. VII.2008 leg. Pantaleoni R.A. (ISE). Sorso,

Pianu Mannu, Nali farm, orchard, pitfall traps, 1 fe-

male 26.VI-2. VII. 1997; orchard, bark traps, 1 male

24-3 l.VII. 1997 leg. 1st. Ent. SS (ISE). Torralba .

vineyard, 1 female 23.IV. 1994, 1 male 21.V.1994,

1 male 25.VI.1994, 1 male 15.VII.1995, 1 female

19.VIII.1995, 1 female 12.VIII.1995 leg. 1st. Ent.

SS (ISE).

Kochiura aulica (C.L. Koch, 1838)

Chorotype. Turano-Mediterranean.

References. (10) Costa, 1885 (sub Theridion

aulicum ); (11) de Carlini, 1885 (sub Theridion au-

licum); (13) Gameri, 1902 (sub Theridion aulicum)-,

(84) Pesarini, 1994 (sub Anelosimus aulicus ); (94)

Amo et al., 1998 (sub Anelosimus aulicus ); (114)

Grill et al., 2005 (sub Anelosimus aulicus ); (133)

Trotta, 2009; (134) Marras et al., 2011.

Provinces. (84, 114, 134); Cagliari (13, ined.);

Carbonia-Iglesias (11, 13); Nuoro/Ogliastra (13);

Ogliastra (13); Olbia-Tempio (10, 133); Oristano

(13); Sassari (94, ined.).

Habitat. Citrus-grove (ined.); avenue of lime

trees (94); orchard (134); olive-grove (ined.); shurb-

lands and trees, agricultural land (114); vineyard

(ined.).

Examined material. CAGLIARI: Uta, S’Ap-

passiu, Agris farm, citrus-grove, beating tray, 1

male 19.VI.2000 leg. CRAS (ISE).

OLBIA-TEMPIO: Olbia . Isola Tavolara - peni-

solotto, 23.IV. 1966 leg. Gruppo Isole C.N.R.

(MBG).

SASSARI: Alghero . Mamuntanas, olive-grove,

chemical knockdown, 1 female 7. IX. 2009, 1 male

27.X.2009, 1 male and 1 female 7.X.2009, 2 males

6.X.2009 (ISE). Sassari . Gioscari, olive-grove, 1 fe-

male 21. VIII. 2009, Lu Buttangam, olive-grove,

chemical knockdown, 1 male 20.X.2008 leg. 1st.

Ent. SS. Sorso . Pianu Mannu, Nali farm, olive-

grove, 1 female 21. IX. 1992, leg. 1st. Ent. SS (ISE).

Torralba . vineyard, 1 male 16.VII.1994 leg. 1st. Ent.

SS (ISE).

Latrodectus tredecimguttatus (Rossi, 1790)

Chorotype. Centralasiatic-Mediterranean.

References. (1) Canestrini & Pavesi, 1868 (sub

Latrodectes malmignathus ); (2a) Canestrini & Pa-

vesi, 1870 (sub Latrodectes malmignathus ); (6) Ma-

gretti, 1880 (sub L. 13 guttatus ); (8) Costa, 1884 (L.

tredecimguttatus, Ross var. lugubris, L.); (13) Gar-

neri, 1902; (84) Pesarini, 1994; (133) Trotta, 2009.

Province. (1, 2a, 84); Cagliari (8, 13); Carbo-

nia-Iglesias (13); Medio Campidano (6); Olbia-

Tempio (8, 13); Sassari (8, 13, 133, ined.).

Habitat. Under stones (8).

Examined material. SASSARI: Ozieri . Chili-

vani, 1 female 18.XI.1981 leg. Meloni (MBG).

Neottiura bimaculata (Linnaeus, 1767)

Chorotype. Holarctic.

References. (10) Costa, 1885 (sub Theridion

bimaculatum Var. pellucidum ); (84) Pesarini, 1994.

Province. (84); Olbia-Tempio (10).

Neottiura herbigrada (Simon, 1873)

Chorotype. Mediterranean.

References. (116) Helsdingen, 2005.

Province. Ogliastra (116).

Habitat. Wasteland plot (116).

Neottiura uncinata (Lucas, 1 846)

Chorotype. Mediterranean.

References. (12) Costa, 1886 (sub Theridion

uncinatum); (99) Knoflach, 1999.

Province. Cagliari (12); Medio Campidano

(12); Oristano (99); Sassari (ined.).

Habitat. Wetland (12); in grassland near lagoon

(99); pinewood (ined.); vineyard (ined.).

Examined material. SASSARI: Alghero .

Pinewood Maria Pia, pinewood, 1 male 4.V.2008

leg. Cesaroni C. (ISE). Sassari . Li Punti, Baldinca,

m 110, 1 male 23.V.2008 (MBG). Torralba . vine-

yard, 1 female 18.VI.1994 leg. 1st. Ent. SS (ISE).

Paidiscura pallens (Blackwall, 1834)

Chorotype. Sibero-European.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

References. (127) Lorn et al., 2008.

Province. (127); Nuoro (ined.); Sassari

(ined.).

Habitat. Hazelnut-orchard (127, ined.); olive-

grove (ined.).

Examined material. NUORO: Belvi . Su Ajone,

m 585, hazelnut-orchard, beating tray, 8 females

19.V.2005, 4 males and 14 females 4.V.2005, 1 fe-

male 29.VI.2005 (MBG), 5 females 1.VI.2005

(ISE), 2 females 1.VI.2005, 2 females 16.VI.2005,

3 males and 9 females 4.V.2005, 1 female

16.VI.2005, 2 females 1.VI.2005, 1 female

27.VII.2005 (MBG) (all leg. I.S.E.). Tiana. m 522,

hazelnut-orchard, beating tray, 1 female 4.V.2005

(MBG), 1 male and 1 female 19.V.2005 (ISE), 1

male and 1 female 19.V.2005, 1 male 16.VI.2005

(MBG) (all leg. I.S.E.).

SASSARI: Sorso, PianuMannu, Nali farm, olive-

grove, 1 male and 2 females 6.V.1993, 1 male and 1

female 18.III.1994, 2 males and 1 juv. 4.III.1994;

olive-grove, beating tray, 2 males 17.III.1993, 12

males, 3 females and 3 juv. 29.III.1993, 14 males, 14

females and 6 juv. 6.IV.1993, 1 female 9.VII.1993

(ISE) (all leg. 1st. Ent. SS).

Parasteatoda lunata (Clerck, 1757)

Chorotype. Palearctic.

References. (107) Knoflach & Pfaller, 2004

(sub Achaearanea lunata)', (127) Lorn et al., 2008

(sub Achaearanea lunata).

Provinces. (127); Nuoro (107, ined.).

Habitat. Hazelnut-orchard (127, ined.).

Examined material. NUORO: Belvi . Su Ajone,

m 585, hazelnut-orchard, beating tray, 2 females,

16.VI.2005 leg. I.S.E. (ISE).

Parasteatoda tepidariorum (C.L. Koch, 1841)

Chorotype. Cosmopolitan.

References. (19) Roewer, 1953 (sub Theridion

tepidariorum)', (30) Cerruti, 1968 (sub Theridion te-

pidariorum).

Provinces. Sassari (19, 30).

Habitat. Hypogean habitat (19, 30).

Pholcomma gibbum (Westring, 1851)

Chorotype. European.

References. (13) Gameri, 1902; (51) Brignoli,

1974.

Province. Cagliari (13); Carbonia-Iglesias (51).

Habitat. Hypogean habitat (51).

Phylloneta impressa (L. Koch, 1881)

Chorotype. Holarctic.

References. (108) Knoflach, 2004 (sub Theri-

dion impressum); (127) Lorn et al., 2008 (sub The-

ridion impressum); (139) Trotta, 2011.

Province. (127); Carbonia-Iglesias (139); Nuoro

(ined.); Ogliastra (108); Olbia-Tempio (ined.).

Habitat. Hazelnut-orchard (127, ined.); forest

of Quercus suber (ined.).

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, beating tray, 1 fe-

male 29.VI.2005 leg. I.S.E. (ISE).

OLBIA-TEMPIO: Budduso . near Nuraghe Lo-

elle, forest of Quercus suber, beating tray, 1 male

28.VI.1999 leg. 1st. Ent. SS (ISE).

Phylloneta sisyphia (Clerck, 1757)

Chorotype. Palearctic.

References. (8) Costa, 1884 (sub Theridion

sisyphium); (13) Garneri, 1902 (sub Theridion si-

syphium).

Provinces. Cagliari (13); Nuoro (8, 13); Ori-

stano (13).

Platnickia tincta (Walckenaer, 1 802)

Chorotype. Holarctic.

References. (10) Costa, 1885 (sub Theridion

tincutm); (13) Garneri, 1902 (sub Theridion tin-

ctum); (127) Lorn et al., 2008 (sub Keijia tincta)',

(132) Pantini & Sassu, 2009 (sub Keijia tincta)',

(139) Trotta, 2011.

Province. (127); Cagliari (13); Carbonia-Igle-

sias (139); Nuoro (ined.); Olbia-Tempio (ined.);

Oristano (10); Sassari (132, ined.).

Habitat. Hazelnut-orchard (127, ined.); olive-

grove (ined.); forest of Quercus suber (ined.).

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, beating tray, 1

male 16.VI.2005, 1 female 29.VI.2005 leg. I.S.E.

P. Pantini, A. Sassu & G. Serra

(MBG). Tiana, m 522, hazelnut-orchard, beating tray,

1 male and 2 females, 16.VI.2005 (MBG), 1 male

1.VL2005, 1 female 10.VIII.2005 leg. I.S.E. (ISE).

OLBIA-TEMPIO: Budduso . nearNuraghe Loelle,

forest of Quercus suber, beating tray, 1 female

24.V.1999, 1 male 28.VI.1999, leg. 1st. Ent. SS (ISE).

S AS SARI: Alghero . Mamuntanas, olive-grove,

chemical knockdown, 1 male 6. VIII. 2009 leg. 1st.

Ent. SS (ISE). Sassari . Platamona, at sea level, 1

male and 1 female, 22.V.2008 leg. Sassu A. (ISE).

Sorso, Pianu Mannu, Nali farm, olive-grove, 1 male

and 1 female 6.V.1993, 1 male 9.VII.1993 (ISE);

olive-grove, beating tray, 1 male, 1 female and 2

juv. 15.III.1993, 2 females and 1 juv. 29.IV. 1993, 2

males, 3 females and 11 juv. 25.VI.1993, 5 males

and 4 females 18.VI.1993, 2 females and 2 juv.

22.VII.1993, 3 females and 18 juv. 1.VII.1993, 2

males, 5 females and 3 juv. 9.VII.1993, 2 males

30. VII.1993, 1 male 12.VIII.1993, 1 female

26.VIII.1993 (ISE) (all leg. 1st. Ent. SS).

*Rhomphaea nasica (Simon, 1873)

Chorotype. Mediterranean.

Habitat. Citrus-grove (ined.); olive-grove (ined.)

Examined material. CAGLIARI: Uta, S’Appas-

siu, Agris farm, citrus-grove, beating tray, 1 male

31. VII.2000, 1 juv. 21.IX.2000 leg. CRAS (ISE).

SASSARI: Sorso . Pianu Mannu, Nali farm,

olive-grove, beating tray, 1 male 15.VII.1993 leg.

1st. Ent. SS (ISE).

Robertus arundineti (O.P.-Cambridge, 1871)

Chorotype. Palearctic.

References. (66) Brignoli, 1980; (84) Pesa-

rini, 1994.

Province. (84); Ogliastra (66).

Habitat. Hypogean habitat (66).

Ruborridion musivum (Simon, 1873)

Chorotype. Mediterranean.

References. (10) Costa, 1885 (sub Theridion

musivum)-, (107) Knoflach & Pfaller, 2004 (sub

Theridion musivum); (127) Lorn et al., 2008 (sub

Theridion musivum); (130) Knoflach et al., 2009

(sub Theridion musivum).

Province. (127); Cagliari (130); Carbonia-Igle-

sias (130); Nuoro (ined.); Ogliastra (107, 130); Ori-

stano (130); Sassari (10).

Habitat. Hazelnut-orchard (127, ined.); pasture

plateau, beating from Cistus sp. (130).

Examined material. NUORO: Belvi . Su Ajone,

m 585, hazelnut-orchard, beating tray, 1 male

16.VI.2005 leg. I.S.E. (ISE).

Sardinion blackwalli (O.P.-Cambridge, 1871)

Chorotype. European.

References. (86) Wunderlich, 1995a (sub S.

perplexum); (87) Wunderlich, 1995b (sub Sardini-

dion perplexum).

Province. (87); Ogliastra (86); Sassari (ined.).

Habitat. On a tree (86); orchard (ined.).

Examined material. SASSARI: Sorso . Pianu

Mannu, Nali farm, orchard, beating tray, 1 female

3 l.VII. 1997, 1 male 2.VII.1997 leg. 1st. Ent. SS

(ISE).

Simitidion simile (C.L. Koch, 1836)

Chorotype. Holarctic.

References. (13) Gameri, 1902 (sub Therodion

simile); (114) Grill et al., 2005; (116) Helsdingen,

2005; (127) Lorn et al., 2008.

Province. (114, 127); Cagliari (ined.); Nuoro

(116, ined.); Ogliastra (13); Olbia-Tempio (ined.);

Sassari (ined.).

Habitat. Citrus-grove (ined.); low shurbs, shur-

blands and trees, agricultural land (114); hazelnut-

orchard (127, ined.); pinewood (ined.); forest of

Quercus suber (ined.).

Examined material. CAGLIARI: Uta . S’Ap-

passiu, Agris farm, citrus-grove, beating tray, 1 fe-

male 19.VI.2000 leg. CRAS (ISE).

NUORO: Belvi . Su Ajone, m 585, hazelnut-or-

chard, 1 male 19.V.2005, 1 female 1.VI.2005 (ISE);

Su Enazzu, m 550, hazelnut-orchard, 1 male

1.VI.2005 (MBG) (all beating tray and leg. I.S.E.).

OLBIA-TEMPIO: Budduso , near Nuraghe Lo-

elle, forest of Quercus suber, beating tray, 1 female

31.V.1999 leg. 1st. Ent. SS (ISE). Tempio . Curado-

reddu, m 580, pinewood, emergence cages, 1 fe-

male 15.V.2009 leg. 1st. Ent. SS (ISE).

SASSARI: Bonnannaro . Cannisones, 1 male

28.V.2002 leg. Nuvoli T. (ISE).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Steatoda albomaculata (De Geer, 1778)

Chorotype. Cosmopolitan.

References. (8) Costa, 1884 (sub Lithyphantes

corollatus ); (13) Gameri, 1902 (sub Lithyphantes

corollatus ); (84) Pesarini, 1994.

Province. (13, 84); Cagliari (13); Nuoro/Ogliastra

(8, 13).

Habitat. Under stones (8).

Steatoda grossa (C.L. Koch, 1838)

Chorotype. Cosmopolitan.

References. (13) Gameri, 1902 (sub Teutana

grossa ); (34) Dresco & Hubert, 1969 (sub Teutana

grossa ); (42) Puddu,1971 (sub Teutana grossa );

(51) Brignoli, 1974; (64) Brignoli, 1979d; (83)

Pons, 1993; (133) Trotta, 2009; (139) Trotta, 2011.

Province. Cagliari (13, 42); Carbonia-Iglesias

(64, 133, 139); Nuoro (34, 83); Olbia-Tempio

(133); Oristano (133); Sassari (51, 83, ined.).

Habitat. Hypogean habitat (34, 42, 51, 64, 83);

inside house (ined.).

Examined material. SASSARI: Alghero . inside

house, 1 female 18.1.2000, 1 male 25.III.2000 leg.

Pantaleoni R.A. (ISE). Sassari . inside house, 1 fe-

male 23.1.2007 (ISE).

Steatoda nobilis (Thorell, 1875)

Chorotype. W-Mediterranean (?).

References. (140) Kulczycki et al., 2012.

Province. Cagliari (140); Olbia-Tempio (140);

Sassari (140, ined).

Habitat. Inside house (ined.).

Examined material. SASSARI: Alghero . inside

house, 1 male 6.1.2009 leg. Pantaleoni R.A. (ISE).

Sassari . Giordano, m 40, 1 female 21.IV.2004, 1 fe-

male 15.11.2009 leg. Molinu A. (ISE).

Steatoda paykulliana (Walckenaer, 1805)

Chorotype. Centralasiatic-European.

References. (5) Pavesi, 1878 (sub Lithyphantes

paykullianus ); (6) Magretti, 1880 (sub Lityphantes

paykullianus ); (7a) Costa, 1882 (sub Phrurolithus

hamatus ); (8) Costa, 1884 (sub Phrurolitus hama-

tus ); (13) Gameri, 1902 (sub Lithyphantes paykul-

lianus ); (84) Pesarini, 1994; (132) Pantini & Sassu,

2009; (133) Trotta, 2009; (139) Trotta, 2011.

Province. (13, 84); Cagliari (6, 13); Carbonia-

Iglesias (6, 13, 139); Medio Campidano (6); Oglia-

stra (13); Olbia-Tempio (5, 7a, 8, 13); Oristano (6,

13); Oristano/Nuoro (6); Sassari (6, 13, 132, 133).

Steatoda triangulosa (Walckenaer, 1 802)

Chorotype. Cosmopolitan.

References. (10) Costa, 1885 (sub Teutana

triangulosa ); (13) Gameri, 1902 (sub Teutana trian-

gulosa ); (37) Argiolas et al., 1970 (sub Teutana

triangulosa ).

Province. Cagliari (13, 37); Nuoro/Ogliastra

(13); Oristano (10, 13); Sassari (ined.).

Habitat. Hypogean habitat (37); in house (ined.).

Examined material. SASSARI: Sassari . in

house, Dept, of Plant Protection, 1 female

4.IV.2004 leg. Sassu A. (ISE).

Theridion familiar e O.P.-Cambridge, 1871

Chorotype. European.

References. (13) Gameri, 1902; (84) Pesarini,

1994.

Province. (84); Cagliari (13).

Theridion genistae Simon, 1873

Chorotype. W-Mediterranean.

References. (127) Lorn et al., 2008; (130) Kno-

flach et al., 2009.

Province. (127); Nuoro (ined.); Ogliastra (130).

Habitat. In oak forest (130); hazelnut-orchard

(127, ined.).

Examined material. NUORO: Belyi, Su

Enazzu, m 550, hazelnut-orchard, beating tray, 1

male 1.VI.2005 leg. I.S.E. (ISE).

* Theridion hannoniae Denis, 1944

Chorotype. European.

Habitat, garrigue (ined.); mining landfills cov-

ered by pioneer plants (ined.); olive-grove (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining land-

fills covered by pioneer plants, 1 female 19.V-

P. Pantini, A. Sassu & G. Serra

4.VI.2009; m 200, garrigue, 1 male 4-16.VI.2009,

1 male 25.VIII-8.IX.2009 (ISE) (all pitfall traps and

leg. Sassu A., Verdinelli M.). Guspini . Montevec-

chio, Piccalinna, m 225, mining landfills covered

by pioneer plants, 1 male 18.V-3.VI.2009, 1 male

15-30.VI.2009; m 235, garrigue, 1 male 25. VIII-

8.IX.2009 (ISE) (all pitfall traps and leg. Sassu A.,

Verdinelli M.).

S AS SARI: Sassari . Gioscari, olive-grove, chemical

knockdown, 1 male 4.IX.2009 leg. 1st. Ent. SS (ISE).

Theridion malagaense Wunderlich, 2011

Chorotype. W-Mediterranean.

References. (136) Wunderlich, 2011.

Province. Sassari (136).

Theridion melanurum Hahn, 1831

Chorotype. Holarctic.

References. (13) Gameri, 1902 (sub T. denti-

culatum).

Province. (13); Sassari (ined.).

Habitat. Olive-grove (ined.).

Examined material. SASSARI: Sorso, Pianu

Mannu, Nali farm, olive-grove, beating tray, 1 fe-

male 18.VI.1993 leg. 1st. Ent. SS (ISE).

Theridion mystaceum L. Koch, 1870

Chorotype. Asiatic-European.

References. (94) Arno et al., 1998; (116) Hel-

sdingen, 2005; (127) Lorn et al., 2008.

Province. (127); Cagliari (ined.); Nuoro (ined.);

Ogliastra (116); Olbia-Tempio (ined.); Sassari (94).

Habitat. Citrus-grove (ined.); avenue of lime

trees (94); inside house (116); hazelnut-orchard

(127, ined.); pinewood (ined.); forest of Quercus

suber (ined.).

Examined material. CAGLIARI: Pula . Pixina

Manna, m 140, pinewood, emergence cages, 2

males, 16.IV.2009, 1 male 29.IV.2009, 1 female

25.V.2009 leg. 1st. Ent. SS (ISE). Uta, S’Appassiu,

Agris farm, citrus-grove, beating tray, 1 female

19.VI.2000, 1 female 10.VII.2000 leg. CRAS (ISE).

NUORO: Belyi, Su Ajone, m 585, hazelnut-or-

chard, beating tray, 1 female 19.V.2005 (MBG), 1

female 4.V.2005 (ISE) (all leg. I.S.E.).

OLBIA-TEMPIO: Budduso . near Nuraghe Lo-

elle, forest of Quercus suber, beating tray, 1 male,

24.V.1999, leg. 1st. Ent. SS (ISE).

Theridion nasutum Wunderlich, 1995

Chorotype. Sardinian endemic.

References. (87) Wunderlich, 1995b.

Province. Nuoro/Ogliastra (87); Ogliastra (87).

Habitat. Shrubs (87); under stones (87); under

the bark (87).

Theridion pinastri L. Koch, 1872

Chorotype. Palearctic.

References. (127) Lorn et al., 2008.

Province. (127); Nuoro (ined.); Olbia-Tempio

(ined.); Sassari (ined.).

Habitat. Hazelnut-orchard (127, ined.); olive-

grove (ined.); forest of Quercus suber (ined.).

Examined material. NUORO: Belvi . Su Ajone,

m 585, hazelnut-orchard, beating tray, 1 male

29.VI.2005 leg. I.S.E. (ISE).

OLBIA-TEMPIO: Budduso . near Nuraghe Lo-

elle, forest of Quercus suber, beating tray, 1 female

31. V.l 999, 1 male and 1 female 21. VI. 1999 leg. 1st.

Ent. SS (ISE).

SASSARI: Sorso . Pianu Mannu, Nali farm,

olive-grove, 1 female 9 .VI. 1993 (ISE), olive-grove,

beating tray, 1 male and 1 female 9.VI.1993, 2

males and 1 female, 18.VI.1993 leg. 1st. Ent. SS

(ISE) (all leg. 1st. Ent. SS).

Theridion varians Hahn, 1833

Chorotype. Holarctic.

References. (12) Costa, 1886 (sub T. rusticum)-,

(13) Garneri, 1902; (127) Lorn et al., 2008.

Province. (127); Cagliari (13, ined.); Medio

Campidano (12); Nuoro (ined.); Ogliastra (13);

Sassari (ined.).

Habitat. Citrus-grove (ined.); wetland (12); or-

chard (ined.); hazelnut-orchard (127, ined.); olive-

grove (ined.).

Examined material. CAGLIARI: Uta, S’Appas-

siu, Agris farm, citrus-grove, beating tray, 13 fe-

males 19.VI.2000, 11 females 29.VI.2000, 2 females

31.VII.2000, 9 females 10.VII.2000, 1 female

20.VII.2000, 1 female 11.IX.2000 leg. CRAS (ISE).

NUORO: Belvi . Su Ajone, m 585, hazelnut-or-

Catalogue of the spiders (Arachnida Araneae) of Sardinia

chard, beating tray, 2 males 16. VI. 2005, 2 males

13.VII.2005 (MBG), hazelnut-orchard, bark traps,

1 female 5-10.VIII.2005 (ISE); Su Enazzu, m 550,

hazelnut-orchard, beating tray, 4 females 16.VI.2005,

1 female 29.VI.2005, 1 female 27.VII.2005 (MBG)

(all leg. I.S.E.). Tiana . m 522, hazelnut-orchard, beat-

ing tray, 1 male and 1 female 16.VI.2005 (ISE), 1 fe-

males 13.VII.2005 (MBG) (all leg. I.S.E.).

SASSARI: Sorso, Pianu Mannu, Nali farm,

olive-grove, 4 males 3.VI.1993, orchard, 1 male

and 2 females 27.V.1998 (ISE) (all beating tray and

leg. 1st. Ent. SS).

Family MYSMENIDAE

Mysmenella jobi (Kraus, 1967)

Chorotype. Palearctic.

References. (127) Lorn et al., 2008.

Province. (127); Nuoro (ined.).

Habitat. Hazelnut-orchard (127, ined.).

Examined material. NUORO: Belvh Su

Enazzu, m 550, hazelnut-orchard, beating tray, 1

male 19.V.2005 leg. I.S.E. (ISE).

Family LINYPHIIDAE

Acartauchenius sardiniensis Wunderlich, 1995

Chorotype. Sardinian endemic.

References. (87) Wunderlich, 1995b.

Province. Ogliastra (87).

Habitat. Under stones (87).

Araeoncus longiusculus (O.P.-Cambridge, 1875)

Chorotype. Sardo-Corsican endemic.

References. (87) Wunderlich, 1995b; (132)

Pantini & Sassu, 2009.

Province. Nuoro (ined.); Ogliastra (87); Sas-

sari (132).

Habitat. Cherry-orchard (ined.).

Examined material. NUORO: Belvi . Antonitzo,

m 683, cherry-orchard, 1 male 16-23.V.2007 (ISE);

Mannaritzo, m 706, cherry-orchard, 1 male 18-

26.IV.2007 (ISE) (all pitfall traps and leg. I.S.E.).

Bolyphantes nigropictus Simon, 1884

Chorotype. W-Mediterranean.

References. (9) Simon, 1884; (13) Gameri,

1902; (17) Simon, 1929.

Province. (17); Sassari (9, 13).

Centromerus bonaeviae Brignoli, 1979

Chorotype. Sardinian endemic.

References. (64) Brignoli, 1979d; (84) Pesa-

rini, 1994.

Province. (84); Carbonia-Iglesias (64).

Habitat. Hypogean habitat (64).

Centromerus puddui Brignoli, 1979

Chorotype. Sardinian endemic.

References. (64) Brignoli, 1979d; (84) Pesa-

rini, 1994.

Province. (64, 84).

Habitat. Hypogean habitat (64).

* Centromerus subalpinus Lessert, 1907

Chorotype. S-European.

Habitat. Hazelnut-orchard (ined.).

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, pitfall traps, 1

male 30.V-4.VII.2007 leg. I.S.E. (MBG).

* Centromerus succinus (Simon, 1884)

Chorotype. W-Mediterranean.

Habitat. Hazelnut-orchard (ined.).

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, pitfall traps, 1 fe-

male, 8-24.VIII.2006, leg. I.S.E. (MBG).

Remarks. This data represents the first record

for Italian fauna.

Cresmatoneta eleonorae (Costa, 1883)

Chorotype. Sardinian endemic.

References. (7b) Costa, 1883 (sub Formicina

eleonorae)', (8) Costa, 1884 (sub Formicina Eleo-

norae); (13) Gameri, 1902 (sub Formicina eleono-

rae); (84) Pesarini, 1994.

P. Pantini, A. Sassu & G. Serra

Provinces. (84); Sassari (7b, 8, 13).

Remarks. Species described from a female in

1883 and never found since. The validity of the

species requires further confirmation.

Cresmatoneta mutinensis (Canestrini, 1868)

Chorotype. Asiatic-European.

References. (127) Lorn et al., 2008.

Province. (127); Nuoro (ined.); Sassari (ined.).

Habitat. Hazelnut-orchard (127, ined.); olive-

grove (ined.).

Examined material. NUORO: Belvh Su

Enazzu, m 550, hazelnut-orchard, beating tray, 1

male, 4.X.2005 leg. I.S.E. (ISE).

SASSARI: Alghero . Mamuntanas, olive-grove,

chemical knockdown, 1 male and 4 females,

6.VIII.2009, 1 female 7.X.2009 leg. 1st. Ent. SS (ISE).

Diplocephalus graecus (O.P. -Cambridge, 1872)

Chorotype. Mediterranean.

References. (127) Lorn et al., 2008; (132) Pan-

tini & Sassu, 2009.

Province. (127); Cagliari (ined.); Medio Campi-

dano (ined.); Nuoro (ined.); Sassari (132, ined.).

Habitat. Citrus-grove (ined.); cherry-orchard

(ined.); garrigue (ined.); hazelnut- orchard (127,

ined.); olive-grove (ined.); under Juniperus sp.

(ined.); mining landfills covered by pioneer plants

(ined.).

Examined material. CAGLIARI: Uta, S’Ap-

passiu, Agris farm, citrus-grove, beating tray, 1

male, 2.XI.2000, 1 female, 13.XI.2000, 1 male

4.XII.2000, leg. CRAS (ISE).

MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-

cauli, m 170, mining landfills covered by pioneer

plants, 1 male 2 1 .IV-5 . V.2009, 1 female 6-20.X.2009;

m 200, garrigue, 1 male 19.V-4.VI.2009 (ISE) (all pit-

fall traps and leg. Sassu A., Verdinelli M.). Guspini .

Montevecchio, Piccalinna, m 225, mining landfills

covered by pioneer plants, 1 male 6-20.X.2009 (ISE);

m 235, garrigue, 1 female 6-20.X.2009 (MBG) (all

pitfall haps and leg. Sassu A., Verdinelli M.).

NUORO: Belvh Antonitzo, m 683, cherry-or-

chard, pitfall traps, 1 male 11-18.IV.2007 (ISE);

Mannaritzo, m 706, cherry-orchard, pitfall traps, 1

male and 1 female, 16-23.V.2007 (ISE); Su Ajone,

m 585, hazelnut-orchard, beating tray, 1 male

1.VI.2005 (MBG); Su Enazzu, m 550, hazelnut-or-

chard, pitfall traps, 1 male 26.IV-30.V.2007 (MBG),

1 male and 1 female, 30.V-4.VII.2007 (ISE) (all leg.

I.S.E.). Fonni . Gennargentu, mountain refuge, m

1550, under Juniperus sp., pitfall traps, 1 male

19. VI-1.VII.2007, leg. Fiori F. (ISE).

SASSARI: Alghero . Mamuntanas, olive-grove,

chemical knockdown, 1 male 30.IX.2009, 2 females

20. X.2009, 1 female 13.X.2009, 1 female 27.X.2009

leg. 1st. Ent. SS (ISE). Sorso . Pianu Mannu, Nali

farm, olive-grove, beating tray, 2 males and 2 fe-

males 13.V.1993 leg. 1st. Ent. SS (ISE).

*Diplostyla concolor (Wider, 1834)

Chorotype. Holarctic.

Habitat. Hazelnut-orchard (ined.).

Examined material. NUORO: Belyi, Su

Enazzu, m 550, hazelnut-orchard, pitfall traps, 1 fe-

male 13-27.VII.2006 (MBG), 1 female 24.VIII-

5. IX. 2006 (ISE) 1 female 24.VIII-5.IX.2006

(MBG), 1 male 19.III-26.IV.2007 leg. I.S.E. (ISE).

Entelecara acuminata (Wider, 1834)

Chorotype. Holarctic.

References. (127) Lorn et al., 2008.

Province. (127); Nuoro (ined.).

Habitat. Hazelnut-orchard (127, ined.).

Examined material. NUORO: Belvh Su

Enazzu, m 550, hazelnut-orchard, beating tray, 1 fe-

male, 19.V.2005, 1 female 1.VI.2005 (MBG), 1 fe-

male 29.VI.2005 (ISE), 1 female 27.VII.2005

(MBG) (all leg. I.S.E.).

Erigone dentipalpis (Wider, 1 834)

Chorotype. Holarctic.

References. (132) Pantini & Sassu, 2009.

Province. Medio-Campidano (ined.); Nuoro

(ined.); Sassari (132).

Habitat. Cherry-orchard (ined.); hazelnut-

orchard (ined.); mining landfills covered by pioneer

plants (ined.).

Examined material. MEDIO CAMPIDANO:

Guspini. Montevecchio, Piccalinna, m 225, mining

landfills covered by pioneer plants, pitfall traps, 1

male 21. IV-5 .V.2009, 1 female 18.V-3.VI.2009 leg.

Sassu A., Verdinelli M. (ISE).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

NUORO: Belvi, Mannaritzo, m 706, cherry-or-

chard, 1 female 11-18.IV.2007 (ISE); SuEnazzu, m

550, hazelnut-orchard, 1 male 13-27. VII. 2006

(MBG), 3 males 30.V-4.VII.2007, 3 males 30.V-

4.VII.2007 (MBG) (all pitfall traps and leg. I.S.E.).

Frontinellina frutetorum (C.L. Koch, 1834)

Chorotype. Sibero-European.

References. (10) Costa, 1885 (sub Linyphia fru-

tetorum ); (13) Gameri, 1902 (sub Linyphia f rut eto-

rum ); (116) Helsdingen, 2005; (139) Trotta, 2011.

Province. (10); Cagliari (13); Carbonia-Iglesias

(139); Nuoro (116); Ogliastra (13).

Habitat. Shurbs and lower branches of trees

(116).

Gnathonarium dentatum (Wider, 1834)

Chorotype. Palearctic.

Reference. (135) Tanasevitch, 2011.

Province. Oristano (135).

Gonatium biimpressum Simon, 1884

Chorotype. Tyrrhenian endemic.

References. (13) Gameri, 1902; (16) Simon,

1926; (84) Pesarini, 1994.

Province. (84); Sassari (13, 16).

Gonatium nemorivagum (O. P.-Cambridge, 1875)

Chorotype. Mediterranean.

References. (10) Costa, 1885 (sub G. nemo-

rivaga).

Province. Nuoro (10).

*Hybocoptus corrugis (O.P.-Cambridge, 1875)

Chorotype. S-European.

Habitat. Forest of Quercus suber (ined.).

Examined material. OLBIA-TEMPIO: Budduso .

near Nuraghe Loelle, forest of Quercus suber, beat-

ing tray, 1 male 20.XI.1999 leg. 1st. Ent. SS (ISE).

Remarks. This data represents the first record

for Italian fauna.

Incestophantes crucifer (Menge, 1866)

Chorotype. Sibero-European.

References. (13) Garneri, 1902 (sub Lepty-

phantes crucifer ).

Province. (13); Cagliari (13).

Lepthyphantes eleonorae Wunderlich, 1995

Chorotype. Sardinian endemic.

References. (87) Wunderlich, 1995b.

Province. (87); Ogliastra (87).

Habitat. Under stones along a stream (87).

Lepthyphantes minutus (Blackwall, 1833)

Chorotype. Holarctic.

References. (139) Trotta, 2011.

Province. Carbonia-Iglesias (139).

Lepthyphantes paoloi Wunderlich, 1995

Chorotype. Sardinian endemic.

References. (87) Wunderlich, 1995b.

Province. Nuoro/Ogliastra (87); Ogliastra (87);

Olbia-Tempio (87).

Habitat. Under stones along a stream (87).

Lepthyphantes sardous Gozo, 1908

Chorotype. Sardinian endemic.

References. (14) Gozo, 1908 (sub L. sardoa

Gozo, 1908); (30) Cermti, 1968 (sub L. sardoa );

(84) Pesarini, 1994; (119) Lana et al., 2006.

Province. (84); Ogliastra (14, 30, 119).

Habitat. Hypogean habitat (14, 30, 119).

Lessertia dentichelis (Simon, 1884)

Chorotype. Cosmopolitan.

References. (41) Brignoli, 1971c; (52) Puddu

& Pirodda, 1974; (84) Pesarini, 1994.

Province. (84); Sassari (41, 52).

Habitat. Hypogean habitat (41, 52).

Linyphia hortensis Sundevall, 1830

Chorotype. Palearctic.

P. Pantini, A. Sassu & G. Serra

References. (7a) Costa, 1882 (sub L. praten-

sis ); (8) Costa, 1884 (sub L. pratensis).

Province. Sassari (7a, 8).

Linyphia triangularis (Clerck, 1757)

Chorotype. Palearctic.

References. (10) Costa, 1885; (13) Garneri,

1902 (sub L. montana) ; (139) Trotta, 2011.

Province. Carbonia-Iglesias (139); Medio

Campidano (139); Nuoro (10, 139); Nuoro/Oglia-

stra (13); Ogliastra (13, 139); Sassari (ined.).

Habitat. Olive-grove (ined.).

Examined material. SASSARI: Alghero . Ma-

muntanas, olive-grove, chemical knockdown, 1 male

27.X.2009 leg. 1st. Ent. SS (ISE). Sassari . Gioscari,

olive-grove, 1 male 13.X.2009 leg. 1st. Ent. SS (ISE).

Maso gallicus Simon, 1894

Chorotype. European.

References. (116) Helsdingen, 2005.

Province. Nuoro (116).

Habitat. Grassland along the mouth of the

river (116).

Mecopisthes millidgei Wunderlich, 1995

Chorotype. Sardinian endemic.

References. (87) Wunderlich, 1995b; (94)

Amo et al., 1998 (sub M. silus )

Province. Ogliastra (87); Sassari (94).

Habitat. Under stones (87); avenue of lime

trees (94).

Remarks. After re-examination of the material

on M. silus from Amo et al. (1998) it was attributed

to M. millidgei.

*Meioneta mollis (O.P.-Cambridge, 1871)

Chorotype. Asiatic-European.

Habitat. Hazelnut-orchard (ined.).

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, pitfall traps, 1 fe-

male 27.VII-8.VIII.2006 (ISE), 1 male, 8.1-

21.11.2007, 4 males 30.V-4.VII.2007 (MBG), 3

males 30.V-4.VII.2007 (ISE) (all leg. I.S.E.).

Meioneta pseudorurestris Wunderlich, 1980

Chorotype. S-European.

References. (87) Wunderlich, 1995b (sub Agy-

neta pseudorurestris ); (132) Pantini & Sassu, 2009;

(134) Marras et al., 2011.

Province. (134); Cagliari (ined.); Medio Cam-

pidano (ined.); Nuoro (ined.); Ogliastra (87); Sas-

sari (132, ined.).

Habitat. Citrus-grove (ined.); cherry-orchard

(ined.); orchard (134); garrigue (ined.); mediter-

ranean maquis (ined.); hazelnut-orchard (ined.);

walnut- orchard (ined.); olive-grove (ined.); under

Juniperus sp. (ined.); under stones (87); mining

landfills covered by pioneer plants (ined.).

Examined material. CAGLIARI: Uta, S’Ap-

passiu, Agris farm, citrus-grove, beating tray, 1

male 29. VI. 2000, 1 male and 1 female 19.VI.2000,

1 male 10.VII.2000 leg. CRAS (ISE).

MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-

cauli, m 120, mediterranean maquis, 2 males lb-

29. VI. 2009; m 170, mining landfills covered by

pioneer plants, 1 female 19.V-4.VI.2009; m 200,

garrigue, 2 males and 3 females 19.V-4.VI.2009, 1

male 5-19.V.2009 (ISE), 1 male and 1 female 19.V-

4. VI. 2009 (MBG), 1 female 6-20.X.2009 (ISE) (all

pitfall traps and leg. Sassu A., Verdinelli M.). Gu-

spini. Montevecchio, Piccalinna, m 235, garrigue,

pitfall traps, 2 males 18.V-3.VI.2009, leg. Sassu A.,

Verdinelli M. (ISE).

NUORO: Belvi . Antonitzo, m 683, cherry-or-

chard, 3 females 18-26. IV.2007, 1 male 16-

23.V.2007, 1 female 11-18.1.2008 (ISE); Canale e'

Figu, m 576, walnut-orchard, 1 female 26. IV-

4.V.2007, 1 female 16-23.V.2007, 1 female 21-

28.VI.2007, 1 female 17-24.VII.2007 (ISE);

Mannaritzo, m 706, cherry-orchard, 1 male 16-

23.V.2007, 1 male 4-11.X.2007, 2 males and 1 fe-

male, 19-26.XI.2007, 1 female 11-18.1.2008 (ISE);

Su Enazzu, m 550, hazelnut-orchard, 1 male 30.V-

4. VII. 2007 (ISE) (all pitfall traps and leg. I.S.E.).

Desulo . Gennargentu, mountain refuge, m 1500,

under Juniperus sp., pitfall traps, 1 male 17. VI-

1.VII.2007, leg. Fiori F. (ISE). Tonara . Su Azzime,

m 682, walnut- orchard, pitfall traps, 1 male, 18-

26.IV.2007, 1 male 16-23.V.2007 leg. I.S.E. (ISE).

SASSARI: Sassari . Gioscari, olive-grove, che-

mical knockdown, 1 female 22.IX.2008, 1 female

14.X.2008 leg. 1st. Ent. SS (ISE).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

*Micrargus subaequalis (Westring, 1851)

Chorotype. Asiatic-European.

Habitat. Under Juniperus sp. (ined.).

Examined material. NUORO: Fonni . Gennar-

gentu, mountain refuge, m 1550, under Juniperus

sp., pitfall traps, 1 male 5- 19. VI. 2007 leg. Fiori

F. (MBG).

Microctenonyx subitaneus (O.P.-Cambridge, 1875)

CHOROTYPE.Holarctic.

References. (46) Thermes, 1972 (sub A ulaco-

cyba subitanea ); (52) Puddu & Pirodda, 1974 (sub

Aulacocyba subitanea ); (67) Puddu, 1980 (sub Au-

lacocyba subitanea ); (84) Pesarini, 1994; (94) Amo

et al., 1998; (104) Muccedda et al.,2002 (sub Aula-

cocyba subitanea ); (132) Pantini & Sassu, 2009;

(135) Tanasevitch, 201 1.

Province. (84); Cagliari (135); Cagliari/Nuoro

(67); Carbonia-Iglesias (46, 52); Nuoro (ined.); Sas-

sari (94, 104, 132, ined.).

Habitat. Avenue of lime trees (94); hypogean

habitat (46, 52, 67, 104); cherry-orchard (ined.);

hazelnut-orchard (ined.); walnut-orchard (ined.);

olive-grove (ined.).

Examined material. NUORO: Belvi . Anto-

nitzo, m 683, cherry-orchard, 1 male 18-

26.IV.2007, 8 male 19-26.XI.2007, 2 males

22-29.11.2008 (ISE); Canale e' Figu, m 576, wal-

nut-orchard, 2 males 11-18.1.2008 (ISE); Manna-

ritzo, m 706, cherry-orchard, 1 male 11-18.IV.2007,

1 male 18-26.IV.2007, 1 male 16-23.V.2007, 1 male

19-26.XI.2007 (ISE); Su Enazzu, m 550, hazel-

nut-orchard, 1 male 24.VIII-5.IX.2006, 2 females

30.V-4.VII.2007 (MBG), 1 male, 1 female 30.V-

4. VII. 2007 (ISE) (all pitfall traps and leg. I.S.E.).

Tonara, Su Azzime, m 682, walnut-orchard, pitfall

traps, 1 male 19-26.XI.2007 leg. I.S.E. (ISE).

S AS SARI: Alghero . Mamuntanas, olive-grove,

chemical knockdown, 1 male 6. VIII. 2009 leg. 1st.

Ent. SS (ISE). Sorso, Pianu Mannu, Nali farm,

olive-grove, beating tray, 1 female 29.III.1993 leg.

1st. Ent. SS (ISE).

Microlinyphia pusilla (Sundevall, 1830)

Chorotype. Holarctic.

References. (8) Costa, 1884 (sub Linyphia pu-

silla ); (13) Gameri, 1902 (sub Linyphia pusilla).

Province. (8); Cagliari (13); Carbonia-Iglesias

(13); Sassari (13).

*Nematogmus sanguinolentus (Walckenaer, 1841)

Chorotype. Palearctic.

Habitat. Olive-grove (ined.).

Examined material. SASSARI: Sassari . Lu

Buttangam, olive-grove, chemical knockdown, 1

male 13.X.2008 leg. 1st. Ent. SS (MBG).

Neriene clathrata (Sundevall, 1830)

Chorotype. Holarctic.

References. (35) Helsdingen, 1969.

Province. Sassari (35).

Neriene furtiva (O.P.-Cambridge, 1871)

Chorotype. European.

References. (116) Helsdingen, 2005.

Province. Ogliastra (116).

Habitat. In shurbs along a little stram (116).

Ouedia rufithorax (Simon, 1881)

Chorotype. W-Mediterranean.

References. (132) Pantini & Sassu, 2009.

Province. Sassari (132, ined.).

Habitat. Olive-grove (ined.).

Examined material. SASSARI: Alghero . Ma-

muntanas, olive-grove, chemical knockdown, 1 fe-

male 20.X.2009, 2 males 27.X.2009, 1 male

7.X.2009 leg. 1st. Ent. SS (ISE).

Palliduphantes angustiformis (Simon, 1884)

Chorotype. Sardo-Corsican endemic.

References. (9) Simon, 1884; (13) Gameri,

1902; (17) Simon, 1929; (41) Brignoli, 1971c; (52)

Puddu & Pirodda, 1974; (64) Brignoli, 1979d; (84)

Pesarini, 1994 (all sub Leptyphantes angustiformis );

(132) Pantini & Sassu, 2009; (139) Trotta, 2011.

Province. (17); (84); Carbonia-Iglesias (41, 52,

64, 139); Medio Campidano (ined.); Nuoro (ined.);

Sassari (9, 13, 64, 132, ined.).

Habitat. Hypogean habitat (41, 52, 64); cherry-

orchard (ined.); garrigue (ined.); mediterranean

P. Pantini, A. Sassu & G. Serra

maquis (ined.); hazelnut- orchard (ined.); walnut-

orchard (ined.); alder-grove (ined.); mining land-

fills covered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, 1 male and 2 females 19.V-4.VI.2009

(MBG), 2 females 29.VI-14.VII.2009, 1 female 4-

16.VI.2009, 1 female 22.IX-6.X.2009, 1 male 6-

20.X.2009; m 170, mining landfills covered by

pioneer plants, 1 female 22.IX-6.X.2009 (ISE) (all

pitfall traps and leg. Sassu A., Verdinelli M.). Guspini .

Montevecchio, Piccalinna, m 225, mining landfills

covered by pioneer plants, 1 female 5-18.V.2009, 1

male 8-22.IX.2009, 1 male 6-20.X.2009, m 235; gar-

rigue, 2 femals 22.IX-6.X.2009; m 260, mediter-

ranean maquis, 1 female 21.IV-5.V.2009, 3 females

18.V-3.VI.2009, 2 females 5-18.V.2009, 1 female 15-

30.VI.2009, 1 male, 1 female 13-27.VII.2009, 1 fe-

male 22.IX-6.X.2009 (ISE) (all pitfall traps and leg.

Sassu A., Verdinelli M.).

NUORO: Belvi, Antonitzo, m 683, cherry-or-

chard, 1 male and 2 females 16-23.V.2007 (ISE);

Canale e' Figu, m 576, walnut-orchard, pitfall traps,

4 females 16-23.V.2007, 1 female 19-26.XI.2007

(ISE); Mannaritzo, m 706, cherry-orchard, 3 females

16-23.V.2007, 2 males and 1 female 21-28.VI.2007,

1 female 4-1 1.X.2007, 1 male 19-26.XI.2007 (ISE);

Su Enazzu, m 550, hazelnut-orchard, 1 female

27.VII-8.VIII.2006, 1 female 8-24.VIII.2006, 1

male 21.IX-5.X.2006, 1 female 8.1-2 1 .11.2007, 1

male and 3 females 30.V-4.VII.2007 (MBG), 1 male

and 2 females 30.V-4.VII.2007 (ISE) (all pitfall

traps and leg. I.S.E.). Fonni . Gennargentu, mountain

refuge, m 1550, alder-grove, pitfall traps, 1 female

5-19.VI.2007 leg. Fiori F. (ISE). Tonara . Su Azzime,

m 682, walnut-orchard, pitfall traps, 2 males 11-

18.IV.2007, 1 male, 3 females 21-28.VI.2007, 2

males and 1 female 24-30. VIII. 2007, 1 male 19-

26.XI.2007, 1 female 1 1 .1- 1 8.1.2008, 1 female 22-

29.11.2008 leg. I.S.E. (ISE).

OLBIA-TEMPIO: Olbia . Isola Molarotto, 1 fe-

male 23.III. 1966 leg. Gmppo Isole C.N.R. (MBG).

Pelecopsis bucephala (O.P. -Cambridge, 1875)

Chorotype. W-Mediterranean.

References. (116) Helsdingen, 2005.

Province. Ogliastra (116).

Habitat. Wasteland plot (116).

Pelecopsis elongata (Wider, 1834)

Chorotype. European.

References. (127) Lorn et al., 2008.

Province. (127); Nuoro (ined.).

Habitat. Cherry-orchard (ined.); hazelnut-or-

chard (127, ined.); walnut-orchard (ined.).

Examined material. NUORO: Belvi . Anto-

nitzd, m 683, cheny-orchard, bark traps, 1 female

4.X-26.XI.2007 (ISE); Canale e' Figu, m 576, wal-

nut-orchard, bark traps, 1 female 19-26.XI.2007, 1

female 11-18.1.2008 (ISE); Su Ajone, m 585, hazel-

nut-orchard, beating tray, 1 female 4.V.2005 (ISE);

Su Enazzu, m 550, hazelnut-orchard, pitfall traps,

1 male 21.IX.2006-8.I.2007 (ISE) (all leg. I.S.E.).

Tonara . Su Azzime, m 682, walnut- orchard, bark

traps, 1 female 18-26. IV.2007, 1 female 11-

18.IV.2007 leg. I.S.E. (ISE).

Pelecopsis inedita (O.P.-Cambridge, 1875)

Chorotype. Mediterranean.

References. (127) Lorn et al., 2008; (132) Pan-

tini & Sassu, 2009.

Province. (127); Cagliari (ined.); Nuoro (ined.);

Sassari (132, ined.).

Habitat. Citrus-grove (ined.); cherry- orchard

(ined.); hazelnut-orchard (127, ined.); olive-grove

(ined.); pinewood (ined.).

Examined material. CAGLIARI: Uta, S’Ap-

passiu, Agris farm, citrus-grove, beating tray, 1 fe-

male 23.XI.2000, 2 males 4.XII.2000 leg. CRAS

(ISE).

NUORO: Belvi . Antonitzo, m 683, cherry-or-

chard, 1 male 19-26.XI.2007 (ISE); Mannaritzo, m

706, cherry- orchard, 2 males and 3 females, 18-

26.IV.2007, 4 males, 4 females 16-23.V.2007, 1

male and 2 females 16-23.V.2007, 2 females 21-

28.VI.2007 (ISE); Su Enazzu, m 550, hazelnut-or-

chard, 1 male 21.II-19.III.2007 (ISE), 1 male

21. 11-19. III. 2007 (MBG) (all pitfall traps and leg.

I.S.E.). Tiana, m 522, hazelnut-orchard, beating

tray, 1 female 4.V.2005 leg. I.S.E. (ISE).

SASSARI: Alghero . Porto Conte, m 35, pine-

wood, emergence cages, 1 female 13.IV.2009, 2 fe-

males 15.V.2009, leg. 1st. Ent. SS (ISE);

Mamuntanas, olive-grove, chemical knockdown, 1

female 21. VIII. 2009, 2 males and 1 female

Catalogue of the spiders (Arachnida Araneae) of Sardinia

6.IX.2009, 1 female 7.IX.2009, 1 male and 3 fe-

males 30.IX.2009 leg. 1st. Ent. SS (ISE).

Pelecopsis mengei (Simon, 1884)

Chorotype. Palearctic.

References. (132) Pantini & Sassu, 2009.

Province. Sassari (132, ined.).

Habitat. Orchard (ined.).

Examined material. SASSARI: Sorso, Pianu

Mannu, Nali farm, orchard, pitfall traps, 1 male and

1 female 1 1-1 8.III. 1998 leg. 1st. Ent. SS (ISE).

Pityohyphantes phrygianus (C.L. Koch, 1836)

Chorotype. Asiatic-European.

References. (10) Costa, 1885 (sub Linyphia

phrygiana ).

Province. Carbonia-Iglesias (10); Sassari (10).

*Pocadicnemis juncea Locket et Millidge, 1953

Chorotype. Asiatic-European.

Habitat. Hazelnut-orchard (ined.).

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, pitfall traps, 1

male 30.V-4.VII.2007 leg. I.S.E. (ISE).

Porrhomma convexum (Westring, 1851)

Chorotype. Palearctic.

References. (64) Brignoli, 1979d.

Province. Nuoro (64).

Habitat. Hypogean habitat (64).

Prinerigone vagans (Audouin, 1826)

Chorotype. Palearctic.

References. (13) Garneri, 1902 (sub Erigone

vagans ); (84) Pesarini, 1994 (sub Erigone vagans ).

Province. (84); Cagliari (ined.); Medio-Campi-

dano (ined.); Nuoro (ined.); Ogliastra (13).

Habitat. Citrus-grove (ined.); hazelnut-orchard

(ined.); alder-grove (ined.); mining landfills cov-

ered by pioneer plants (ined.).

Examined material. CAGLIARI: Uta, S’Ap-

passiu, Agris farm, citrus-grove, beating tray, 1

male 14.XII.2000 leg. CRAS (ISE).

MEDIO CAMPIDANO: Guspini . Montevec-

chio, Piccalinna, m 225, mining landfills covered

by pioneer plants, pitfall traps, 1 male 18.V-

3.VI.2009 leg. Sassu A., Verdinelli M. (ISE).

NUORO: Belvi . Su Enazzu, m 550, hazelnut-

orchard, pitfall traps, 3 males 30.V-4. VII. 2007

(MBG), 2 males 30.V-4.VII.2007 (ISE) (all leg.

I.S.E. ). Fonni, Gennargentu, mountain refuge, m

1550, alder-grove, pitfall traps, 1 male 19. VI-

1. VII. 2007 leg. Fiori F. (ISE).

Sintula retroversus (O.P.- Cambridge, 1875)

Chorotype. Turano-European.

References. (64) Brignoli, 1979d.

Province. Nuoro (ined.); Ogliastra (64); Olbia-

Tempio (ined.).

Habitat. Hypogean habitat (64); cherry-or-

chard (ined.); hazelnut-orchard (ined.); walnut-or-

chard (ined.).

Examined material. NUORO: Belvi . Antonitzo,

m683, cherry-orchard, 2 males 19-26.XI.2007, 1 fe-

male 22-29.11.2008 (ISE); Canale e' Figu, m 576,

walnut- orchard, 1 male 26.XI-3.XII.2007, 1 male

19-26.XI.2007, 1 male 1 1 .1- 1 8.1.2008, 1 male 22-

29.11.2008 (ISE); Mannaritzo, m 706, cherry-or-

chard, 1 female 11-18.IV.2007 (ISE); Su Enazzu, m

550, hazelnut-orchard, 1 female 21. II- 19. III. 2007

(ISE) (all pitfall traps and leg. I.S.E.). Tonara, Su

Azzime, m 682, walnut-orchard, pitfall traps, 3

males 19-26.XI.2007 leg. I.S.E. (ISE).

OLBIA-TEMPIO: Monte Limbara, Punta Bali-

steri, m 1310, 1 female 10.XII.2004 leg. Lodovici

O., Pantini P. (MBG).

*Syedra nigrotibialis Simon, 1884

Chorotype. Tyrrhenian endemic.

Habitat. Walnut-orchard (ined.); under Junipe-

rus sp. (ined.).

Examined material. NUORO: Belvi . Canale e'

Figu, m 576, walnut-orchard, 1 female 21-

28.VI.2007, 1 female 17-24.VII.2007 leg. I.S.E.

(MBG). Desulo, Gennargentu, mountain refuge, m

1500, alder-grove, 1 female 17-23.VIII.2006 (ISE);

under Juniperus sp., 2 females 2- 17. VIII. 2006

(ISE), 1 male 9-15.1.2007 (MBG) (all pitfall traps

and leg. Fiori F.).

P. Pantini, A. Sassu & G. Serra

Tenuiphantes flavipes (Blackwall, 1854)

Chorotype. Palearctic.

References. (127) Lorn et al., 2008.

Province. (127); Nuoro (ined.).

Habitat. Cherry-orchard (ined.); hazelnut-or-

chard (127, ined.); under Juniperus sp. (ined.).

Examined material. NUORO: Belvh Anto-

nitzo, m 683, cherry-orchard, pitfall traps, 1 male

16-23.V.2007 leg. I.S.E. (MBG); SuEnazzu, m 550,

hazelnut-orchard, beating tray, 1 male 4. V.2005 leg.

I.S.E. (ISE). Desulo, Gennargentu, mountain re-

fuge, m 1500, under Juniperus sp., pitfall traps, 1

female 10-24.V.2007 leg. Fiori F. (ISE).

Tenuiphantes herbicola (Simon, 1884)

Chorotype. Mediterranean.

References. (132) Pantini & Sassu, 2009.

Province. Medio Campidano (ined.); Nuoro

(ined.); Sassari (132).

Habitat. Mediterranean maquis (ined.); hazel-

nut-orchard (ined.); walnut- orchard (ined.); alder-

grove (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, pitfall traps, 1 male and 1 female 7-

21.IV.2009 (MBG), 2 females 21.IV-5.V.2009, 2

females 7-21.IV.2009, 1 female 5-19.V.2009, 2

males, 3 females and 1 juv. 19.V-4.VI.2009, 1 fe-

male 4-16.VI.2009, 2 females 16-29.VI.2009, 1

female 29.VI-14.VII.2009, 1 female 28.VII-

10.VIII.2009, 1 male 10-25.VIII.2009, 1 female

22.IX-6.X.2009, 1 male and 1 female 8-22.IX.2009

leg. Sassu A., Verdinelli M. (ISE). Guspini . Monte-

vecchio, Piccalinna, m 260, mediterranean maquis,

pitfall traps, 2 females 7-21.IV.2009, 2 females

18. V-3.VI.2009, 1 male and 1 female 15-

30.VI.2009, 3 females 30.VI-13.VII.2009, 2 males

8-22.IX.2009, 2 females 22.IX-6.X.2009 leg. Sassu

A., Verdinelli M. (ISE).

NUORO: Belvh Su Enazzu, m 550, hazelnut-or-

chard, pitfall traps, 1 female 5-16.X.2006 (ISE), 1

female 8.1-21. 11.2007 (MBG) (all leg. I.S.E.).

Fonni, Gennargentu, mountain refuge, m 1550,

alder- grove, pitfall traps, 1 female 19. VII-

2. VIII. 2006, 1 female 17-30.VIII.2006, 1 female

19. VI-1.VII.2007 leg. Fiori F. (ISE). Tonara . Su Az-

zime, m 682, walnut-orchard, pitfall traps, 1 female

11-18.1.2008 leg. I.S.E. (ISE).

Tenuiphantes mengei (Kulczynski, 1887)

Chorotype. Palearctic.

References. (114) Grill et al., 2005 (sub Lep-

thyphantes mengei).

Province. (114).

Habitat. Low shurbs (114).

Tenuiphantes tenebricola (Wider, 1834)

Chorotype. Sibero-European.

References. (13) Garneri, 1902 (sub Lepty-

phantes tenebricola).

Province. Cagliari (13).

Tenuiphantes tenuis (Blackwall, 1852)

Chorotype. Turano-European.

References. (94) Amo et al., 1998 (sub Lepthy-

phantes tenuis); (127) Lom et al., 2008; (132) Pan-

tini & Sassu, 2009.

Province. (127); Cagliari (ined.); Medio-Cam-

pidano (ined.); Nuoro (ined.); Olbia-Tempio (ined.);

Sassari (94, 132, ined.).

Habitat. Citrus-grove (ined.); avenue of lime

trees (94); cherry-orchard (ined.); orchard (ined.);

mediterranean maquis (ined.); hazelnut-orchard

(127, ined.); walnut- orchard (ined.); olive-grove

(ined.); alder-grove (ined.); under Juniperus (ined.);

forest of Quercus suber (ined.); vineyard (ined.).

Examined material. CAGLIARI: Uta, S’Appas-

siu, Agris farm, citms-grove, beating tray, 2 females

19.VI.2000, 1 male 10.VII.2000 leg. GRAS (ISE).

MEDIO CAMPIDANO: Guspini . Monte vecchio,

Piccalinna, m 260, mediterranean maquis, pitfall

traps, 1 female 30. VI-13. VII.2009, 1 male 15-

30.VI.2009, 2 females 3-15.VI.2009 leg. Sassu A.,

Verdinelli M. (ISE).

NUORO: Belyi, Antonitzo, m 683, cherry-or-

chard, pitfall traps, 1 female 18-26.IV.2007, 1 male

and 1 female 11-18.IV.2007, 1 female 16-23.V.2007

(ISE); Canale e' Figu, m 576, walnut-orchard, pitfall

traps, 1 female 27.IX-4.X.2007 (ISE); Mannaritzo, m

706, cherry-orchard, pitfall traps, 2 males and 1 fe-

male 16-23.V.2007 (ISE); Su Ajone, m 585, hazelnut-

orchard, beating tray, 1 female 19. V.2005, 2 females

29.VI.2005, 1 female 16.VI.2005 (MBG); SuEnazzu,

m 550, hazelnut-orchard, beating tray, 1 female and

Catalogue of the spiders (Arachnida Araneae) of Sardinia

2 juv. 16.VI.2005, 3 females and 1 juv. 29.VI.2005

(MBG); hazelnut-orchard, pitfall traps, 1 female

27.VII-8.VIII.2006, 1 female 8-24.VIII.2006, 1 fe-

male 24. VIII-5.IX.2006, 1 female 21.IX-5.X.2006, 2

females 8. 1-21. 11.2007, 1 male and 2 females 21.11-

19.III.2007, 1 male and 1 female 19.III-26.IV.2007,

4 females 26.IV-30.V.2007, 3 males, 13 females and

1 juv. 30.V-4.VII.2007, 4 females and 1 juv. 30.V-

4. VII. 2007 (ISE) (all leg. I.S.E.). Desulo . Gennar-

gentu, mountain refuge, m 1500, under Juniperus sp.,

3 males and 1 female 10-24.V.2007, alder-grove, 1

male and 2 females 10-24.V.2007 (ISE) (all pitfall

traps and leg. Fiori F.). Fonni . Gennargentu, mountain

refuge, m 1550, alder-grove, 1 female, 30. VIII-

12.IX.2006, 11 males and 1 female 5-19.VI.2007, 2

males and 1 female 19.VI-1.VII.2007 (ISE), under

Juniperus sp., 1 female, 2-17.VIII.2006, 3 males and

3 females 5-19.VI.2007, 4 males and 2 females

19.VI-1.VII.2007 (ISE) (all pitfall traps and leg. Fiori

F.). Tiana, m 522, hazelnut-orchard, beating tray, 1

male 16.VI.2005 leg. I.S.E. (ISE). Tonara . Su Az-

zime, m 682, walnut-orchard, pitfall traps, 1 female

11-18.IV.2007, 1 male and 2 females 21-28.VI.2007,

1 female 24-30.VIII.2007, 1 male 17.VIII.2007-

24.VIII.2007, 1 female 19-26.XI.2007, 1 female 22-

29.11.2008 leg. I.S.E. (ISE).

OLBIA-TEMPIO: Budduso . near Nuraghe Lo-

elle, forest of Quercus suber, beating tray, 1 male

31.V.1999, 1 female 28.VI.1999 leg. 1st. Ent. SS

(ISE)._Otbia, Isola Tavolara, macchia alta Nord, 1

female 4.XI.1965 leg. Gruppo Isole C.N.R. (MBG).

S AS SARI: Sassari . Gioscari, olive-grove, che-

mical knockdown, 2 females 22. IX. 2008 leg. 1st.

Ent. SS (ISE). Sorso, Pianu Mannu, Nali farm,

olive-grove, beating tray, 1 female 13.V.1993 (ISE);

orchard, beating tray, 1 female 18.III.1998 (ISE);

orchard, pitfall traps, 2 males 1 1- 1 8.III. 1 998 (ISE)

(all leg. Ist.Ent.SS). Torralba . vineyard, 1 mal,

l.VII. 1995 leg. 1st. Ent. SS (ISE).

Tenuiphantes zimmermanni (Bertaku, 1884)

Chorotype. European.

References. (139) Trotta, 2011.

Province. Carbonia-Iglesias (139).

Tiso vagans (Blackwall, 1834)

Chorotype. European.

References. (127) Lorn et al., 2008.

Province. (127); Nuoro (ined.).

Habitat. Hazelnut-orchard (127, ined.).

Examined material. NUORO: Belvi, Su Enazzu,

m 550, hazelnut-orchard, beating tray, 1 female

4.V.2005 (MBG); m 550, hazelnut-orchard, pitfall

traps, 4 females 13-27.VII.2006 (ISE), 1 female

27.VII-8.VIII.2006, 5 females 13-27.VII.2006, 1

male and 1 female, 24.VIII-5.IX.2006, 1 female 8-

24. VIII. 2006, 2 males and 2 females 16-31.X.2006

(MBG), 2 males 16-31.X.2006 (ISE), 1 female 5-

16.X.2006, 1 male and 2 females 2 1. XI. 2006-

8.1.2007, 9 males and 1 female, 8. 1-21. 11.2007, 9

males 21.II-19.III.2007, 3 females 19.III-26.IV.2007,

6 males and 2 females, 26.IV-30. V.2007, 3 males and

51 females 30.V-4.VII.2007 (MBG) (all leg. I.S.E.).

Typhochrestus sardus Bosmans, 2008

Chorotype. Sardinian endemic.

References. (125) Bosmans, 2008.

Province. Cagliari (125).

Habitat. In litter (125).

*Walckenaeria antica (Wider, 1834)

Chorotype. Asiatic-European.

Habitat. Hazelnut-orchard (ined.).

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, pitfall traps, 1 fe-

male 27.VII-8.VIII.2006 (MBG), 1 female 30.V-

4. VII. 2007 (ISE) (all leg. I.S.E.).

*Walckenaeria stylifrons (O.P. -Cambridge, 1875)

Chorotype. S-European.

Habitat. Cherry-orchard (ined.).

Examined material. NUORO: Belvi . Anto-

nitzo, m 683, cherry-orchard, pitfall traps, 1 male

22-29.11.2008 leg. I.S.E. (ISE).

Family TETRAGNATHIDAE

Meta bourneti Simon, 1922

Chorotype. European.

References. (34) Dresco & Hubert, 1969; (41)

P. Pantini, A. Sassu & G. Serra

Brignoli, 1971c; (45) Sanna et al., 1972; (46) Ther-

mes, 1972; (64) Brignoli, 1979d; (69) Cannas,

1972; (84) Pesarini, 1994; (105) Grafitti, 2003;

(119) Lana et al., 2006; (121) Grafitti, 2007a; (122)

Grafitti, 2007b; (126) Grafitti & Merella, 2008.

Province. (84); Cagliari (46, 69); Carbonia-

Iglesias (41, 45, 46, 64, 105, 119, 126); Nuoro (34,

41); Ogliastra (34, 46); Oristano (122); Sassari (41,

121, ined.).

Habitat. Hypogean habitat (34, 41, 45, 46, 64,

69, 105, 119, 121, 126).

Examined material. SASSARI: Sassari . La

Corte, 1 female 23.XI.2003 (ISE).

Meta menardi (Latreille, 1804)

Chorotype. Palearctic.

References. (38) Puddu, 1970.

Province. Ogliastra (38).

Habitat. Hypogean habitat (38).

Metellina mengei (Blackwall, 1870)

Chorotype. European.

References. (64) Brignoli, 1979d (sub Meta

mengei)', (139) Trotta, 2011.

Province. Carbonia-Iglesias (64, 139).

Habitat. Hypogean habitat (64).

Metellina merianae (Scopoli, 1763)

Chorotype. European.

References. (8) Costa, 1884 (sub Meta meria-

nae ); (13) Gameri, 1902 (sub Meta Merianae)', (14)

Gozo, 1908 (sub Meta merianae)', (19) Roewer,

1953 (sub Meta merianae)', (22) Roewer, 1956 (sub

Meta merianae)', (30) Cerruti, 1968 (sub Meta me-

rianae)', (34) Dresco & Hubert, 1969 (sub Meta

merianae)', (38) Puddu, 1970 (sub Meta merianae)',

(41) Brignoli, 1971c (sub Meta merianae)', (44)

Casale, 1972 (sub Meta merianae)', (46) Thermes,

1972 (sub Meta merianae)', (47) Bartolo et al.,

1973 (sub Meta merianae)', (64) Brignoli, 1979d

(sub Meta merianae)', (65) Grafitti, 1979 (sub Meta

merianae ); (69) Cannas, 1972 (sub Meta boumeti

merianae)', (75) Grafitti, 1984 (sub Meta meria-

nae)', (82) Grafitti, 1993 (sub Meta merianae)', (83)

Pons, 1993 (sub Meta merianae)', (84) Pesarini,

1994 (sub Meta merianae)', (121) Grafitti, 2007a

(sub Meta merianae)', (126) Grafitti & Merella,

2008; (139) Trotta, 2011.

Province. (13, 84); Cagliari (13, 46, 69); Carbo-

nia-Iglesias (14, 41, 46, 47, 64, 83, 126, 139); Nuoro

(22, 34, 41, 44, 64, 83); Ogliastra (13, 38, 41, 46);

Sassari (8, 13, 14, 19, 30, 41, 65, 75, 82, 121, 139).

Habitat. Hypogean habitat (14, 19, 22, 30, 34,

38, 41, 44, 46, 47, 64, 65, 69, 75, 82, 83, 121, 126).

Examined material. NUORO: Dorgali . Cave

Su Anzu, 1 male VII. 1983 leg. Giachino P.M.

(MBG).

Metellina segmentata (Clerck, 1757)

Chorotype. Holarctic.

References. (8) Costa, 1884 (sub Meta segmen-

tata)', (13) Garneri, 1902 (sub Meta segmentata)',

(19) Roewer, 1953 (sub Meta segmentata); (30) Cer-

ruti, 1968 (sub Meta segmentata); (46) Thermes,

1972 (sub Meta segmentata); (84) Pesarini, 1994

(sub Meta segmentata); (127) Lom et al., 2008.

Province. (84, 127); Cagliari (8, 13); Nuoro

(ined.); Ogliastra (46); Sassari (19, 30, ined.).

Habitat. Hypogean habitat (19, 30, 46); hazel-

nut-orchard (127, ined.); olive-grove (ined.).

Examined material. NUORO: Belvi . Su Ajone,

m 585, hazelnut-orchard, beating tray, 1 female,

21.IX.2005 (MBG), 1 female, 21.IX.2005 (ISE) (all

leg. I.S.E.). Tiana, m 522, hazelnut- orchard, beating

tray, 1 male 4.X.2005 leg. I.S.E. (ISE).

SASSARI: Sorso . Pianu Mannu, Nali farm,

olive-grove, beating tray, 1 male 18.III.1994 leg. 1st.

Ent. SS (ISE).

Pachygnatha clercki Sundevall, 1 823

Chorotype. Holarctic.

References. (10) Costa, 1885; (13) Gameri, 1902.

Province. Cagliari (13); Oristano (10); Sassari (10).

Pachygnatha degeeri Sundevall, 1830

Chorotype. Palearctic.

References. (10) Costa, 1885.

Province. Nuoro (ined.); Sassari (10, ined.).

Habitat. Hazelnut-orchard (ined.).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Examined material. NUORO: Belyi, Su

Enazzu, m 550, hazelnut-orchard, pitfall traps, 3 fe-

males 13-27.VII.2006, 1 male and 3 females,

24. VIII-5.IX.2006, 2 males 8-24.Vm.2006, 1 fe-

male 5-16.X.2006, 1 female 8.I-21.II.2007 (MBG),

1 male and 3 females, 21 .11-1 9.III.2007 (ISE), 1

male and 2 females, 21.II-19.III.2007, 1 male and 2

juv. 19.III-26.IV.2007, 3 females 26.IV-30.V.2007,

2 females 30.V-4.VI.2007 (MBG) (all leg. I.S.E.).

OLBIA-TEMPIO: Olbia . Isola Molara, 1 male

13.VI.1967 leg. Gruppo Isole C.N.R. (MBG).

Tetragnatha externa (Linnaeus, 1758)

Chorotype. Holarctic.

References. (6) Magretti, 1880; (7a) Costa,

1882; (8) Costa, 1884; (13) Gameri, 1902; (84) Pe-

sarini, 1994; (133) Trotta, 2009.

Province. (84); Cagliari (13); Ogliastra (13);

Olbia-Tempio (133); Oristano (6, 13); Orista-

no/Nuoro (7a, 8).

Tetragnatha intermedia Kulczynski, 1891

Chorotype. S-European.

References. (136) Wunderlich, 2011.

Province. (136); Cagliari (ined.); Sassari (ined.).

Habitat. Between rocks (136); citrus -grove

(ined.); orchard (ined.); olive-grove (ined.).

Examined material. CAGLIARI: Uta, S’Ap-

passiu, Agris farm, citrus-grove, 1 male 21.IX.2005

leg. CRAS (MBG).

SASSARI: Sorso, Pianu Mannu, Nali farm,

olive-grove, 1 male 21. V. 1993 (ISE); olive-grove,

beating tray, 1 male 18.VI.1993, 4 males, 1 female

and 1 juv. 3. VI. 1993, 3 males and 2 juv.

25. VI.1993, 1 male and 1 female, 9.VII.1993, 1

male 26.VIII.1993, 1 male and 6 juv. 6.VIII.1993,

1 male 19.VIII.1993 (ISE); orchard, beating tray, 1

male 3 l.VII. 1997 (ISE) (all leg. 1st. Ent. SS).

Tetragnatha montana Simon, 1874

Chorotype. Palearctic.

References. (13) Gameri, 1902; (127) Lom et

al., 2008.

Province. (127); Cagliari (13); Nuoro (ined.);

Ogliastra (13); Olbia-Tempio (ined.); Oristano (13);

Sassari (ined.).

Habitat. Hazelnut-orchard (127, ined.); olive-

grove (ined.).

Examined material. NUORO: Belvi . Scala Ce-

rasia, m 660, 1 male, 1 female 21.V.2008 leg. Pan-

taleoni R.A. (ISE); Su Ajone, m 585,

hazelnut-orchard, beating tray, 1 male 29.VI.2005

(ISE), 1 male and 8 juv. 29.VI.2005 (MBG), 1 fe-

male 1. VI. 2005 leg. I.S.E. (ISE) (all leg I.S.E.).

OLBIA-TEMPIO: Telti . Rio Almiddina, 1 male

20.V.2008 leg. Sassu A. (ISE).

SASSARI: Alghero . Mamuntanas, olive-grove,

chemical knockdown, 2 males and 1 juv. 6. VIII.2008,

2 males 21.VIII.2009 leg. 1st. Ent. SS (ISE).

Tetragnatha nitens (Audouin, 1 826)

Chorotype. Cosmopolitan.

References. (13) Garneri, 1902; (84) Pesa-

rini, 1994.

Province. (84); Cagliari (13); Carbonia-Iglesias

(13); Ogliastra (13).

Remarks on family Tetragnathidae. Tetra-

gnatha chrysochlora (Audouin, 1 826) cited by de

Carlini (1885) and Garneri (1902) is an unknown

species in our fauna, the citations should be linked

to one of the cited species.

FAMILY ARANEIDAE

Aculepeira armida (Audouin, 1 826)

Chorotype. Asiatic-European.

References. (10) Costa, 1885 (sub Epeira ar-

mida); (11) de Carlini, 1885 (sub Epeira armida );

(13) Garneri, 1902 (sub Epeira armida); (63) Bri-

gnoli, 1979c; (84) Pesarini, 1994.

Province. (63, 84); Carbonia-Iglesias (11, 13);

Oristano (10); Sassari (ined.).

Examined material. SASSARI: Sassari . Monte

Bianchinu, 1 female 24.VI.2008 leg. Cossu S. (ISE).

Aculepeira ceropegia (Walckenaer, 1802)

Chorotype. Palearctic.

References. (10) Costa, 1885 (sub Epeira ce-

ropegia); (63) Brignoli, 1979c; (84) Pesarini, 1994.

P. Pantini, A. Sassu & G. Serra

Province. (10, 63, 84); Nuoro (ined.).

Habitat. Grassland (ined.).

Examined material. NUORO: Bolotana . Badde

'e Salighes, m 850, grassland, 1 male and 3 females

27.V.2006 leg. Sassu A. (ISE).

Agalenatea redii (Scopoli, 1763)

Chorotype. Palearctic.

References. (10) Costa, 1885 (sub Epeira

Redii); (11) de Carlini, 1885 (sub Epeira redii); (13)

Garneri, 1902 (sub Epeira Redii); (63) Brignoli,

1979c; (84) Pesarini, 1994; (132) Pantini & Sassu,

2009; (139) Trotta, 2011.

Province. (84); Cagliari (10, 13, 63); Carbonia-

Iglesias (11, 13, 139); Medio Campidano (139);

Ogliastra (13, 63, 139); Olbia-Tempio (ined.); Ori-

stano (10, 13); Sassari (132).

Examined material. OLBIA-TEMPIO: Olbia .

Isola Tavolara, high plateau, 1 male 27.IV. 1966 leg.

Gruppo Isole CNR (MBG).

Araneus diadematus Clerck, 1757

Chorotype. Holarctic.

References. (8) Costa, 1884 (sub Epeira dia-

demata); (13) Garneri, 1902 (sub Epeira diade-

mata); (63) Brignoli, 1979c; (84) Pesarini, 1994;

(139) Trotta, 2011.

Province. (8, 84); Cagliari (13); Carbonia-Igle-

sias (139); Ogliastra (63); Sassari (ined.).

Habitat. Vineyard (ined.).

Examined material. SASSARI: Sorso . Lu Tu-

varaggiu, m 25, 1 female 24.XI.2009 leg. Lorn L.

(ISE). Torralba . vineyard, 1 male 15.X.1994 leg. 1st.

Ent. SS (ISE).

* Araneus marmoreus Clerck, 1757

Chorotype. Holarctic.

Habitat. Orchard (ined.).

Examined material. SASSARI: Sorso . Pianu

Mannu, Nali farm, orchard, beating tray, 1 male

26.VI.1997 leg. 1st. Ent. SS (ISE).

* Araneus quadratus Clerck, 1757

Chorotype. Palearctic.

Examined material. NUORO: Belyi, Scala

Cerasia, m 660, 1 male 28.VIII.2000 leg. Molinu

A. (ISE).

Araniella alpica (L. Koch, 1869)

Chorotype. European.

References. (13) Garneri, 1902 (sub Epeira al-

pica); (84) Pesarini, 1994.

Province. (84); Ogliastra (13).

Araniella cucurbitina (Clerck, 1757)

Chorotype. Palearctic.

References. (8) Costa, 1884 (sub Epeira cur-

cubitina); (13) Garneri, 1902 (sub Epeira cucurbi-

tina); (84) Pesarini, 1994; (114) Grill et al., 2005;

(127) Lorn et al., 2008; (139) Trotta, 2011.

Province. (84, 114, 127); Carbonia-Iglesias (13,

139); Nuoro (8, 13, ined.); Ogliastra (13); Olbia-

Tempio (8, 13); Oristano (8, 13); Sassari (ined.).

Habitat. Low shurbs, grass and shurbland,

shurblands and trees (114); hazelnut-orchard (127,

ined.); grassland (ined.); vineyard (ined.).

Examined material. NUORO: Belvi, Su

Enazzu, m 550, hazelnut-orchard, beating tray, 1 fe-

male 1. VI. 2005, 1 male 16.VI.2005 (ISE), 1 male

16.VI.2005 (MBG) (all leg. I.S.E.). Bolotana .

Badde e'Salighes, m 850, grassland, 1 male

27.V.2007 leg. Sassu A. (ISE). Tiana . m 522, hazel-

nut-orchard, beating tray, 1 male 16. VI. 2005, 1

male 1. VI. 2005, 1 female 29. VI. 2005, 1 female

27.VII.2005 leg. I.S.E. (MBG).

SASSARI: Torralba . vineyard, 1 female

8. VII. 1995 leg. 1st. Ent. SS (ISE).

Argiope bruennichi (Scopoli, 1772)

Chorotype. Palearctic.

References. (1) Canestrini & Pavesi, 1868

(sub Nephila fas data); (2a) Canestrini & Pavesi,

1870 (sub Nephila fas data); (3) Pavesi, 1876;

(13) Garneri, 1902; (84) Pesarini, 1994; (133)

Trotta, 2009.

Province. (1, 2a, 84); Cagliari (3, 13); Olbia-

Tempio (133); Oristano (13); Sassari (ined.).

Examined material. SASSARI: Sassari . 1 fe-

male 30.IX.2008 leg. Cabula P. (ISE).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Argiope lobata (Pallas, 1772)

Chorotype. Palearctic.

References. (3) Pavesi, 1876; (5) Pavesi, 1878;

(8) Costa, 1884; (13) Gameri, 1902; (84) Pesarini,

1994; (114) Grill etal., 2005.

Province. (8, 84, 114); Cagliari (13); Carbonia-

Iglesias (3, 13); Nuoro (ined.); Olbia-Tempio (5, 13).

Habitat. Agricultural land (114).

Examined material. NUORO: Siniscola . Monte

Albo, cant, di S. Anna, m 600, 1 female

27.VII.1999 leg. Fontana P. (MBG).

Argiope trifasciata (Forskal, 1775)

Chorotype. Subcosmopolitan.

References. (138) Di Pompeo et al., 2011.

Province. Cagliari (138).

Habitat. Costal areas (138).

Cercidia prominens (Westring, 1851)

Chorotype. Holarctic.

References. (13) Garneri, 1902; (84) Pesa-

rini, 1994.

Province. (84); Cagliari (13).

Cyclosa conica (Pallas, 1772)

Chorotype. Holarctic.

References. (8) Costa, 1884; (13) Garneri,

1902; (84) Pesarini, 1994; (127) Fora et al., 2008.

Province. (84, 127); Cagliari (13); Nuoro

(ined.); Oristano (8, 13).

Habitat. Hazelnut-orchard (127, ined.).

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, beating tray, 1 fe-

male 4.V.2005 leg. I.S.E. (ISE).

Cyclosa insulana (Costa, 1834)

Chorotype. Afrotropico-Indo-Mediterranean.

References. (3) Pavesi, 1876; (5) Pavesi, 1878

(sub Cyrtophora or Cyclosa insulana)', (7a) Costa,

1882 (sub Epeira insulana ); (8) Costa, 1884 sub Ci-

closa insulana (tritub erco lata Fuc.); (13) Gameri,

1902; (84) Pesarini, 1994; (114) Grill et al., 2005.

Province. (84, 114); Cagliari (3, 13); Carbonia-

Iglesias (7a, 8, 13); Olbia-Tempio (5); Oristano (8,

13); Sassari (ined.).

Habitat. Agricultural land (114); olive-grove

(ined.); on marsh plants (8).

Examined material. SASSARI: Sassari . Gio-

scari, olive-grove, chemical knockdown, 1 female

4.IX.2008, 1 male 6.VIII.2009 leg. 1st. Ent. SS (ISE).

Cyclosa oculata (Walckenaer, 1802)

Chorotype. Asiatic-European.

References. (134) Marras et al., 2011.

Province. (134); Cagliari (ined.).

Habitat. Citms-grove (ined.); orchard (134).

Examined material. CAGLIARI: Uta . S’Ap-

passiu, Agris farm, citms-grove, beating tray, 1 fe-

male, 19. VI. 2000, 2 males and 1 female,

29.VI.2000, 5 males and 4 females 20.VII.2000, 6

males and 1 female 10. VII. 2000, 1 male and 1 fe-

male, 31.VII.2000, 1 female 31.VIII.2000, 2 fe-

males 10. VIII. 2000, 3 males and 1 female

21.VIII.2000, 1 male 21.IX.2000, 1 female

11. IX. 2000, 2 females 4. X. 2000, 1 female

12. X.2000, leg. CRAS (ISE).

Cyclosa sierrae Simon, 1870

Chorotype. Mediterranean.

References. (13) Gameri, 1902; (84) Pesarini,

1994; (139) Trotta, 2011.

Province. (84); Cagliari (13); Carbonia-Iglesias

(139).

Cyrtarachne ixoides (Simon, 1870)

Chorotype. Mediterranean.

References. (129) Colombo & Manunza, 2009.

Province. Cagliari (ined.); Sassari (129, ined.).

Habitat. Citms-grove (ined.); bushes and hed-

ges inside a private garden (129); orchard (ined.);

olive-grove (ined.).

Examined material. CAGLIARI: Uta . S’Ap-

passiu, Agris farm, citms-grove, beating tray, 1 iuv

13. XI.2000 leg. CRAS (ISE).

SASSARI: Sorso, Pianu Mannu, Nali farm,

olive-grove, 1 male l.VII. 1993, 1 male 22.VII.1993

P. Pantini, A. Sassu & G. Serra

(ISE); orchard, 1 female 27.V.1998 (ISE) (all bea-

ting tray and leg. 1st. Ent. SS).

Cyrtophora citric ola (Forskal, 1775)

Chorotype. Afrotropico-Indo-Mediterranean.

References. (3) Pavesi, 1876; (7a) Costa, 1882

(sub Epeira cajetana ); (8) Costa, 1884 (sub C.

opuntiae ); (11) de Carlini, 1885; (13) Gameri, 1902

(sub Cyrtaphora citricola ); (84) Pesarini, 1994.

Province. (13, 84); Cagliari (8, 13, ined.); Car-

bonia-Iglesias (3, 11, 13); Oristano (7a, 8, 13).

Habitat. On agaves (8).

Examined material. CAGLIARI: Villasimius .

around the village, 1 female 25.VI.2010 leg. Zuc-

chelli D. (MBG).

Gibbaranea bituberculata (Walckenaer, 1802)

Chorotype. Palearctic.

References. (8) Costa, 1884 (sub Epeira dro-

medaria ); (13) Gameri, 1902 (sub Epeira drome-

daria ); (63) Brignoli, 1979c; (84) Pesarini, 1994;

(139) Trotta, 2011.

Province. (8, 63, 84); Cagliari (13); Carbonia-

Iglesias (139); Ogliastra (13).

Gibbaranea gibbosa (Walckenaer, 1 802)

Chorotype. European.

References. (10) Costa, 1885 (sub Epeira gib-

bosa); (84) Pesarini, 1994; (132) Pantini & Sassu,

2009; (139) Trotta, 2011.

Province. (84); Carbonia-Iglesias (139); Nuoro

(10); Sassari (132).

Gibbaranea omodea (Thorell, 1870)

Chorotype. Sibero-European.

References. (139) Trotta, 2011.

Province. Carbonia-Iglesias (139).

Hypsosinga albovittata (Westring, 1851)

Chorotype. Sibero-European.

References. (10) Costa, 1885 (sub Singa albo-

vittata); (84) Pesarini, 1994.

Province. (84); Oristano (10).

Hypsosinga pygmaea (Sundevall, 1831)

Chorotype. Holarctic.

References. (10) Costa, 1885 (sub Singa pyg-

maea); (84) Pesarini, 1994.

Province. (84); Cagliari (10); Oristano (10).

Hypsosinga sanguinea (C.L. Koch, 1844)

Chorotype. Palearctic.

References. (10) Costa, 1885 (sub Singa san-

guinea).

Province. Carbonia-Iglesias (10).

Larinioides cornutus (Clerck, 1757)

Chorotype. Holarctic.

References. (8) Costa, 1884 (sub Epeira cor-

nuta); (13) Gameri, 1902 (sub Epeira cornuta); (84)

Pesarini, 1994; (139) Trotta, 2011.

Province. (84); Cagliari (8, 13); Oristano (139).

Larinioides patagiatus (Clerck, 1757)

Chorotype. Holarctic.

References. (10) Costa, 1885 (sub Epeira pa-

tagiata ( dumetorum hbn.).); (13) Gameri, 1902 (sub

Epeira patagiata); (84) Pesarini, 1994.

Province. (84); Cagliari (13); Oristano (10, 13).

Larinioides suspicax (O.P. -Cambridge, 1876)

Chorotype. European.

References. (70) Grasshoff, 1983 (sub L. fo-

lium); (116) Helsdingen, 2005.

Province. Nuoro (116); Olbia-Tempio (70).

Habitat. In the centre of the city (116).

Leviellus kochi (Thorell, 1870)

Chorotype. S-European.

References.(41) Brignoli, 1971c (sub Zygiella

kochi); (46) Thermes, 1972 (sub Zygiella kochi);

(52) Puddu & Pirodda, 1974 (sub Zygiella kochi);

(63) Brignoli, 1979c (sub Zygiella kochi); (83)

Pons, 1993 (sub Zygiella kochi); (84) Pesarini, 1994

(sub Zygiella kochi).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Province. (63, 84); Carbonia-Iglesias (41, 46,

52, 83).

Habitat. Hypogean habitat (41, 46, 52, 83).

Mangora acalypha (Walckenaer, 1802)

Chorotype. Palearctic.

References. (10) Costa, 1885 (sub Epeira aca-

lypha ); (13) Gameri, 1902 (sub Epeira acalypha );

(63) Brignoli, 1979c; (84) Pesarini, 1994; (114) Grill

et al., 2005; (127) Lorn et al., 2008; (132) Pantini &

Sassu, 2009; (133) Trotta, 2009; (139) Trotta, 2011.

Province. (84, 114, 127); Cagliari (13, 63); Car-

bonia-Iglesias (10, 13, 139); Medio Campidano

(139); Nuoro (10, 63, ined.); Ogliastra (13, 63);

Olbia-Tempio (10, 133); Oristano (10, 63); Sassari

(63, 132, ined.).

Habitat. Grass and shurbland, shurblands and

trees, agricultural land (114); hazelnut-orchard

(127, ined.).

Examined material. NUORO: Tiana . m 522,

hazelnut-orchard, beating tray, 1 female 16.VI.2005,

1 male 1.VI.2005 leg. I.S.E. (ISE).

OLBIA-TEMPIO: Olbia . Isola Tavolara, macchia

alta, 2 males, 2 females and 11 juv. 24.IV. 1966 leg.

Gruppo Isole CNR (MBG).

SASSARI: Sassari . Platamona, at sea level, 1

male and 1 female 22.V.2008 leg. Sassu A. (ISE).

Neoscona adianta (Walckenaer, 1802)

Chorotype. Palearctic.

References. (5) Pavesi, 1878 (sub Epeira

adianta)', (8) Costa, 1884 (sub Epeira adianta)', (13)

Gameri, 1902 (sub Epeira adianta)', (63) Brignoli,

1979c; (84) Pesarini, 1994; (114) Grill et al., 2005;

(132) Pantini & Sassu, 2009; (139) Trotta, 2011.

Province. (84, 114); Cagliari (13, 63); Carbo-

nia-Iglesias (13, 139); Medio Campidano (139);

Nuoro (63, 139); Ogliastra (63); Olbia-Tempio (5,

13, ined.); Oristano (13, 63); Oristano/Nuoro (8);

Sassari (63, 132, ined.).

Habitat. Low shurbs, grass and shurbland

(114); vineyard (ined.).

Examined material. OLBIA-TEMPIO: Telti . Rio

Almiddina, 1 male 20. V.2008 leg. Sassu A. (ISE).

SASSARI: Torralba . vineyard, 2 juv.

21.V.1994, 1 female and 1 juv. 4.VI.1994, 1 fe-

male 17.VI.1995, 1 male 24.VI.1995 leg. 1st. Ent.

SS (ISE).

Neoscona subfusca (C.L. Koch, 1837)

Chorotype. Turano-European.

References. (10) Costa, 1885 (sub Epeira dal-

matica); (63) Brignoli, 1979c (sub " Araneus " sub-

fuscus); (127) Lom etal., 2008; (139) Trotta, 2011.

Province. (63, 127); Cagliari (10); Carbonia-

Iglesias (139); Nuoro (139, ined.); Olbia-Tempio

(ined.); Sassari (ined.).

Habitat. Hazelnut-orchard (127, ined.); olive-

grove (ined.); forest of Quercus suber (ined.); vine-

yard (ined.).

Examined material. NUORO: Belvi . Su Ajone,

m 585, hazelnut-orchard, beating tray, 1 male

13.VII.2005, leg. I.S.E. (ISE).

OLBIA-TEMPIO: Budduso . near Nuraghe Loelle,

forest of Quercus suber, beating tray, 1 female

16.VII.1999, leg. 1st. Ent. SS (ISE).

SASSARI: Alghero . Mamuntanas, olive-grove,

chemical knockdown, 1 male, 13.X.2009, leg. 1st.

Ent. SS (ISE). Sorso, Pianu Mannu, Nali farm,

olive-grove, beating tray, 1 male 25.VI.1993, 1 male

l.VII. 1993 leg. 1st. Ent. SS (ISE). Torralba . vine-

yard, 1 female 16.VII.1994, 1 male 2.VII.1994, 1

male 15.VII.1995, leg. 1st. Ent. SS (ISE); vineyard,

beating tray, 1 male 6.VIII.1994 leg. Pirisi (ISE).

Parazygiella montana (C.L. Koch, 1834)

Chorotype. S -European.

References. (13) Gameri, 1902 (sub Zilla Mon-

tana)', (63) Brignoli, 1979c (sub Zygiella Montana)',

(84) Pesarini, 1994 (sub Zygiella Montana).

Province. (63, 84); Nuoro/Ogliastra (13).

Singa hamata (Clerck, 1757)

Chorotype. Palearctic.

References. (13) Gameri, 1902; (63) Brignoli,

1979c; (84) Pesarini, 1994.

Province. (63, 84); Cagliari (13); Carbonia-

Iglesias (13).

Zilla diodia (Walckenaer, 1 802)

Chorotype. Sibero-European.

P. Pantini, A. Sassu & G. Serra

References. (10) Costa, 1885 (sub Epeira dioi-

dia ); (13) Gameri, 1902 (sub Epeira diodia ); (63)

Brignoli, 1979c; (84) Pesarini, 1994; (114) Grill et

al., 2005; (127) Lorn et al., 2008.

Province. (84, 114, 127); Cagliari (13, 63); Car-

bonia-Iglesias (10, 13); Nuoro (ined.); Ogliastra

(13); Olbia-Tempio (10); Sassari (ined.).

Habitat. Orchard (ined.); low shrubs (14); ha-

zelnut-orchard (127, ined.).

Examined material. NUORO: Belvh Su

Enazzu, m 550, hazelnut-orchard, beating tray, 1

male 19.V.2005 leg. I.S.E. (ISE).

SASSARI: Sassari . Platamona, at sea level, 1 fe-

male 22.V.2008 leg. Sassu A. (ISE). Sorso . Pianu

Mannu, Nali farm, orchard, beating tray, 1 male

22.IV. 1998 leg. 1st. Ent. SS (ISE).

Zygiella atrica (C.L. Koch, 1845)

Chorotype. European.

References. (10) Costa, 1885 (sub Zilla atrica)-,

(11) de Carlini, 1885 (sub Zilla atrica ); (13) Gar-

neri, 1902 (sub Zilla atrica ); (63) Brignoli, 1979c;

(84) Pesarini, 1994.

Province. (63, 84); Cagliari (10); Carbonia-

Iglesias (11, 13); Ogliastra (13).

Zygiella x-notata (Clerck, 1757)

Chorotype. Holarctic.

References. (13) Gameri, 1902 (sub Zilla x-no-

tata); (41) Brignoli, 1971c; (46) Thermes, 1972;

(63) Brignoli, 1979c; (72) Puddu,1983; (83) Pons,

1993; (84) Pesarini, 1994; (94) Amo et al., 1998;

(127) Lorn et al., 2008; (132) Pantini & Sassu,

2009; (139) Trotta, 2011.

Province. (63, 84, 127); Cagliari (ined.); Car-

bonia-Iglesias (41, 139); Medio Campidano (139);

Nuoro (ined.); Ogliastra (13, 46, 72); Sassari (83,

94, 132, ined.).

Habitat. Citrus-grove (ined.); avenue of lime

trees (94); hypogean habitat (41, 46, 72, 83);

cherry-orchard (ined.); orchard (ined.); inside house

(ined.); in orto (ined.); hazelnut-orchard (127,

ined.); olive-grove (ined.); vineyard (ined.).

Examined material. CAGLIARI: Uta, S’Appas-

siu, Agris farm, citms-grove, beating tray, 2 males

31.VIII.2000, 1 male and 1 female 21.IX.2000, 4 fe-

males 4.X.2000, 1 female 12.X.2000, 6 females

23.X.2000, 1 female 2.XI.2000, 2 females

23.XI.2000, 2 females 4.XII.2000 leg. CRAS (ISE).

NUORO: Belvh Antonitzo, m 683, cherry-or-

chard, 1 female 4.X-26.XI.2007, 1 female 22-

29.11.2008 (ISE); Su Enazzu, m 550,

hazelnut-orchard, 1 female 8- 15. XI. 2004 (MBG)

(all in bark traps and leg. I.S.E.). Tiana . m 522,

hazelnut-orchard, beating tray, 1 female

21.IX.2005, 1 male 4.X.2005, leg. I.S.E. (ISE).

SASSARI: Alghero . inside house, 1 male

21. XII. 1999 leg. Pantaleoni R.A. (ISE); Mamunta-

nas, olive-grove, chemical knockdown, 1 male

6.IX.2009, 1 male 7.X.2009 leg. 1st. Ent. SS (ISE).

OsUo, in a vegetable garden, 1 male 20.X.1999

(ISE). Sassari . Li Punti, Baldinca, m 110, inside

house, 1 female 23.V.2008 leg. Sassu A. (ISE); Lu

Buttangam, olive-grove, chemical knockdown, 1

male 29.IX.2009 leg. 1st. Ent. SS (ISE). Sorso .

Pianu Mannu, Nali farm, orchard, bark traps, 1 fe-

male 2-9.XII.1997 leg. 1st. Ent. SS (ISE). Torralba .

vineyard, 1 male 9.IX.1995, 1 female 7.X.1995 leg.

1st. Ent. SS (ISE); vineyard, beating tray, 2 males

30.IX.1995 leg. Pirisi (ISE).

Remarks on family Araneidae. Sing a ausse-

reri Thorell, 1873 cited by Costa (1884, sub S. ru-

fula ); Garneri (1902, sub S. rufula ); Brignoli

(1979c, sub Hypsosinga aussereri ) e Pesarini (1994,

sub Hypsosinga aussereri) was considered a species

inquirenda by Thaler & Knoflach (2003) and the-

refore excluded from the catalogue. Singa simo-

niana Costa, 1885 described by Costa in the

Campidano Cagliari area is a species inquirenda

(Brignoli, 1979: 27) and therefore excluded from

the catalogue.

Family LYCOSIDAE

Allocosa oculata (Simon, 1876)

Chorotype. W-Mediterranean.

References. (13) Garneri, 1902 (sub Lycosa

oculata).

Province. Oristano (13).

Alopecosa accentuata (Latreille, 1817)

Chorotype. Sibero-European.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

References. (13) Gameri, 1902 (sub Lycosa ac-

centuata ); (84) Pesarini, 1994.

Province. (84); Nuoro/Ogliastra (13).

Alopecosa albofasciata (Brulle, 1832)

Chorotype. Turano-Mediterranean.

References. (10) Costa, 1885 [sub Lycosa al-

bofasciata (sagittata K.)]; (13) Gameri, 1902 (sub

Lycosa albofasciata ); (20) Krauss, 1955 (sub Xero-

lycosa albofasciata)', (36) Lugetti & Tongiorgi,

1969; (84) Pesarini, 1994; (132) Pantini & Sassu,

2009; (139) Trotta, 2011.

Province. - (20, 84); Cagliari (10, 13, 36); Car-

bonia-Iglesias (10, 13, 139); Medio-Campidano

(ined.); Nuoro (36, ined.); Nuoro/Ogliastra (36);

Ogliastra (13); Olbia-Tempio (36); Sassari (36, 132).

Habitat. Cherry-orchard (ined.); garrigue

(ined.); mediterranean maquis (ined.); hazelnut-or-

chard (ined.); walnut-orchard (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, 1 male 19.V-4.VI.2009. (ISE); m200, gar-

rigue, 1 male 5-19.V.2009 (ISE) (all pitfall traps

and leg. Sassu A., Verdinelli M.). Guspini . Monte-

vecchio, Piccalinna, m 235, garrigue, pitfall traps,

2 males 21.IV-5.V.2009, 3 males 5-18.V.2009, 1

male and 1 female 18.V-3.VI.2009 leg. Sassu A.,

Verdinelli M. (ISE).

NUORO: Belvi, Antonitzo, m 683, cherry-or-

chard, 1 male 16-23.V.2007 (ISE); Canale e' Figu,

m 576, walnut-orchard, 1 male 26.IV-4.V.2007, 4

males and 1 female 16-23.V.2007, 2 females 21-

28.VI.2007 (ISE); Mannaritzo, m 706, cherry-or-

chard, 3 males and 3 females 18-26.IV.2007, 4

males and 6 females 11-18.IV.2007, 11 males 16-

23.V.2007 (ISE); Su Enazzu, m 550, hazelnut-or-

chard, 6 males and 2 females 19.III-26.IV.2007

(MBG), 2 males and 1 female, 19.III-26.IV.2007

(ISE), 17 males and 1 female, 30.V-4.VII.2007

(MBG) (all pitfall traps and leg. I.S.E.). Tonara, Su

Azzime, m 682, walnut-orchard, pitfall traps, 3

males 16-23.V.2007 leg. I.S.E. (ISE).

Alopecosa fabrilis (Clerck, 1757)

Chorotype. Palearctic.

References. (13) Gameri, 1902 (sub Lycosa fa-

brilis)', (84) Pesarini, 1994.

Province. (84); Cagliari (13); Nuoro (ined.);

Ogliastra (13); Oristano (13).

Habitat. Under Juniperus sp. (ined.).

Examined material. NUORO: Fonni . Gennar-

gentu, mountain refuge, m 1550, under Juniperus

sp., pitfall traps, 1 male 26.IX-10.X.2006 leg.

Fiori F. (ISE).

Alopecosa laciniosa (Simon, 1876)

Chorotype. W-Mediterranean.

References. (13) Gameri, 1902 (sub Lycosa la-

ciniosa)', (84) Pesarini, 1994.

Province. (84); Cagliari (13).

Remarks. The presence of this species in Italy

requires further confirmation as stated by Lugetti &

Tongiorgi (1969: 76).

Alopecosa pulverulenta (Clerck, 1757)

Chorotype. Palearctic.

References. (6) Magretti, 1880 (sub Tarentula

pulverulenta)', (10) Costa, 1885 [sub Lycosa pulve-

rulenta ( cuineata , K.)]; (13) Gameri, 1902 (sub Ly-

cosa pulverulenta)', (84) Pesarini, 1994.

Province. (84); Cagliari (10); Carbonia-Iglesias

(13); Ogliastra (13); Oristano (6, 13).

Arctosa cinerea (Fabricius, 1777)

Chorotype. Palearctic.

References. (8) Costa, 1884 (sub Lycosa cine-

rea); (13) Garneri, 1902 (sub Lycosa cinerea); (20)

Krauss, 1955; (84) Pesarini, 1994; (132) Pantini &

Sassu, 2009.

Province. (8, 20, 84); Cagliari (13); Carbonia-

Iglesias (13); Ogliastra (13); Oristano (13); Sas-

sari (132).

Habitat. Common on the banks of rivers (8).

Arctosa fulvolineata (Lucas, 1846)

Chorotype. European-Mediterranean.

References. (84) Pesarini, 1994.

Province. (84).

Arctosa lacustris (Simon, 1876)

Chorotype. S-European.

P. Pantini, A. Sassu & G. Serra

References. (24) Lugetti & Tongiorgi, 1965;

(84) Pesarini, 1994; (139) Trotta, 2011.

Province. (84); Cagliari (24); Medio Campi-

dano (139).

Arctosa leopardus (Sundevall, 1833)

Chorotype. Asiatic-European.

References. (10) Costa, 1885 (sub Lycosa leo-

pardus ); (13) Gameri, 1902 (sub Lycosa leopar-

dus); (20) Krauss, 1955 (sub Megarctosa

leopardus); (24) Lugetti & Tongiorgi, 1965; (84)

Pesarini, 1994.

Province. (20, 24, 84); Cagliari (13);

Cagliari/Oristano (13); Carbonia-Iglesias (10);

Ogliastra (13).

Arctosa perita (Latreille, 1799)

Chorotype. Holarctic.

References. (13) Gameri, 1902 (sub Lycosa pe-

rita); (84) Pesarini, 1994; (117) Buchar et al., 2006.

Province. (84); Cagliari (13); Carbonia-Iglesias

(13); Ogliastra (13); Olbia-Tempio (117).

Arctosa personata (L. Koch, 1872)

Chorotype. Mediterranean.

References. (10) Costa, 1885 (sub Lycosa per-

sonata).

Province. Cagliari (10); Sassari (10).

Arctosa similis Schenkel, 1938

Chorotype. Mediterranean.

References. (117) Buchar et al., 2006; (132)

Pantini & Sassu, 2009; (139) Trotta, 2011.

Province. Cagliari (117); Carbonia-Iglesias

(139); Sassari (132).

Habitat. Riverbank with gravel (117).

Arctosa variana C.L. Koch, 1847

Chorotype. Turano-Mediterranean.

References. (24) Lugetti & Tongiorgi, 1965;

(24) Lugetti & Tongiorgi, 1965 (sub A. perita

latitorax); (84) Pesarini, 1994; (117) Buchar et

al., 2006.

Province. (24, 84); Cagliari (24); Medio Cam-

pidano (117).

Habitat. On muddy shore (117).

Aulonia albimana (Walckenaer, 1805)

Chorotype. European.

References. (13) Gameri, 1902.

Province. Nuoro/Ogliastra (13).

Hogna radiata (Latreille, 1817)

Chorotype. Centralasiatic-European.

References. (3) Pavesi, 1876 (sub Tarentula ra-

diata var. liguriensis); (8) Costa, 1884 (sub Lycosa

radiata); (11) de Carlini, 1885 (sub Tarentula ra-

diata); (13) Gameri, 1902 (sub Lycosa balearica);

(20) Krauss, 1955; (41) Brignoli, 1971c (sub Lycosa

radiata); (84) Pesarini, 1994; (132) Pantini &

Sassu, 2009; (133) Trotta, 2009.

Province. (20, 84); Cagliari (13); Carbonia-

Iglesias (3, 11, 13); Medio-Campidano (ined.);

Nuoro (8, 13, ined.); Olbia-Tempio (13, 41); Ori-

stano (13); Sassari (132, 133, ined.).

Habitat. Hypogean habitat (41); cherry-orchard

(ined.); garrigue (ined.); mediterranean maquis

(ined.); hazelnut- orchard (ined.); walnut- orchard

(ined.); under Juniperus sp. (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, 1 male and 1 female 28.VII-10.VIII.2009,

1 male 10-25. VIII. 2009 (ISE); m 200, garrigue, 1

female 10-25. VIII. 2009 (ISE) (all pitfall traps and

leg. Sassu A., Verdinelli M.). Guspini . Montevec-

chio, Piccalinna, m 235, garrigue, pitfall traps, 1

male 25.VIII-8.IX.2009, 3 males 10-25.VIII.2009

leg. Sassu A., Verdinelli M. (ISE).

NUORO: Belvi, Canale e' Figu, m 576, walnut-

orchard, 1 male 24-30.VIII.2007 (ISE); Mannaritzo,

m 706, cherry-orchard, 1 male 24-30. VIII. 2007

(ISE); Su Enazzu, m 550, hazelnut-orchard, 2 fe-

males 27.VII-8.VIII.2006 (ISE), 1 male, 13-

27.VII.2006, 1 male 27.VII-8.VIII.2006, 2 males

8-24.VIII.2006 (MBG) (all pitfall traps and leg.

I.S.E.). Fonni . Gennargentu, mountain refuge, m

1550, under Juniperus sp., pitfall traps, 1 male

19.VII-2.VIII.2006 leg. Fiori F. (ISE). Tonara . Su

Azzime, m 682, walnut-orchard, pitfall traps, 1 male

and 1 female, 17-24.VII.2007, leg. I.S.E. (ISE).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

OLBIA-TEMPIO: Olbia . Isola Tavolara, 1 fe-

male 24.11.1966 leg. Gruppo Isole C.N.R. (MBG).

Lycosa narbonensis Walckenaer, 1806

Chorotype. Mediterranean.

References. (13) Gameri, 1902; (46) Thermes,

1972.

Province. Ogliastra (46); Sassari (13).

Habitat. Hypogean habitat (46).

Pardos a cribrata Simon, 1876

Chorotype. S-European.

References. (26) Tongiorgi, 1966; (84) Pesa-

rini, 1994.

Province. (26, 84).

Pardosa gefsana Roewer, 1959

Chorotype. W-Mediterranean.

References. (26) Tongiorgi, 1966 (sub P. nae-

via ); (80) Tongiorgi & Sola, 1991 (sub P. nigrister-

nis ); (84) Pesarini, 1994.

Province. (84); Cagliari (80); Medio Campi-

dano (26); Oristano (80).

Habitat. Edge of brackish pond (80); salt

marshes (80).

Remarks. The citation of P. naevia around the

Guspini area (Tongiorgi, 1966) is later corrected in

P nigristernis (Tongiorgi & Sola, 1991: 241). Pe-

sarini reports P. naevia in his Checklist maybe be-

cause he was not aware of the publication or maybe

deceived by a printing error. On page 241 Tongiorgi

& Sola’s article states in fact: “A revision of the Ital-

ian Wolf Spiders of the Genus Pardosa by Ton-

giorgi (1966) had assigned, with reserve, three

female specimens of a species collected in Sardinia

to Pardosa naevia . . . thus, our specimens are now

more correctly assigned to the closely related Par-

dosa naevia Denis, 1966 (figure 1).” It seems evident

(even from the subtitle of the figure) that it is actually

assigned to P nigristernis later synonimised with P

gefsana (Alderweireldt & Jocque, 1992)

Pardosa hortensis (Thorell, 1872)

Chorotype. Palearctic.

References. (6) Magretti, 1880 (sub Lycosa

hortensis)', (13) Gameri, 1902.

Province. Cagliari (13); Medio Campidano (6);

Nuoro (ined.); Oristano (6, 13).

Habitat. Alder-grove (ined.); under Juniperus

sp. (ined.).

Examined material. NUORO: Desulo . Gennar-

gentu, mountain refuge, m 1500, alder-grove, pitfall

traps, 2 males 11-25.VII.2006 leg. Fiori F. (ISE).

Fonni . Gennargentu, mountain refuge, m 1550,

under Juniperus sp., pitfall traps, 1 male 19. VI-

1. VII. 2007 leg. Fiori F. (ISE).

Pardosa nigra (C.L. Koch, 1834)

Chorotype. European.

References. (13) Gameri, 1902.

Province. Nuoro/Ogliastra (13).

Pardosa occidentalis Simon, 1881

Chorotype. W-Mediterranean.

References. (53) Tongiorgi, 1974.

Province. Medio Campidano (53).

Pardosa prativaga (L. Koch, 1870)

Chorotype. Sibero-European.

References. (13) Gameri, 1902 (sub P.fervida).

Province. Cagliari (13); Nuoro (ined.).

Habitat. Hazelnut-orchard (ined.).

Examined material. NUORO: Belyi, Su

Enazzu, m 550, hazelnut-orchard, pitfall traps, 1

male 19.III-26.IV.2007 leg. I.S.E. (ISE).

Pardosa proxima (C.L. Koch, 1847)

Chorotype. Sibero-European.

References. (5) Pavesi, 1878 (sub Lycosa pro-

ximo ); (8) Costa, 1884; (13) Gameri, 1902; (20)

Krauss, 1955; (84) Pesarini, 1994; (132) Pantini &

Sassu, 2009.

Province. (20, 84); Cagliari (8, 13); Carbonia-

Iglesias (13); Medio-Campidano (ined.); Nuoro

(ined.); Olbia-Tempio (5, 13); Sassari (132).

Habitat. Cherry- orchard (ined.); garrigue

(ined.); hazelnut- orchard (ined.); walnut- orchard

(ined.); alder-grove (ined.).

P. Pantini, A. Sassu & G. Serra

Examined material. MEDIO CAMPIDANO:

Guspini . Montevecchio, Piccalinna, m 235, gar-

rigue, pitfall traps, 1 male and 1 female 18.V-

3. VI. 2009 leg. Sassu A., Verdinelli M. (ISE).

NUORO: Belyi, Antonitzo, m 683, cherry-or-

chard, 2 males and 2 females, 11-18.IV.2007 (ISE);

Canale e' Figu, m 576, walnut-orchard, 1 female

17-24.VII.2007 (ISE); Mannaritzo, m 706, cherry-

orchard, 1 female 11-18.IV.2007, 6 males and 4 fe-

males 2 1-28. VI. 2007, 3 males and 1 female,

17-24.VII.2007, 1 male 24-30. VIII.2007, 6 males

and 3 females 22-29.11.2008 (ISE); Su Enazzu, m

550, hazelnut-orchard, 3 females 27. VII-

8. VIII. 2006, 1 male and 4 females, 13-

27.VII.2006, 5 males 21.II-19.III.2007, 1 male and

1 female, 19.III-26.IV.2007, 1 male and 3 females,

26.IV-30.V.2007, 1 female 30.V-4.VII.2007

(MBG), 2 males and 3 females, 30.V-4.VII.2007

(ISE) (all pitfall traps and leg. I.S.E.). Fonni, Gen-

nargentu, mountain refuge, m 1550, alder-grove,

pitfall traps, 1 female 19.VII-2.VIII.2006, 1 female

17-30.VIII.2006 leg. Fiori F. (ISE).

Remarks. P. proxima is easily confused with

the similar species P. vlijmi known in France and

recently found in Northern Italy. The separation of

the two species is very clear when considering

courtship displays while from a morphological

point of view, only the males are identifiable (Isaia

in litteris). While awaiting the results of current re-

search, all specimens examined have been assigned

to P. proxima.

Pardosa pullata (Clerck, 1757)

Chorotype. Sibero-European.

References. (13) Gameri, 1902.

Province. Ogliastra (13).

Pardosa tatarica (Thorell, 1875)

Chorotype. Palearctic.

References. (13) Gameri, 1902 (sub P. strigil-

lata ); (26) Tongiorgi, 1966 (sub P. strigillata ); (84)

Pesarini, 1994 (sub Pardosa strigillata).

Province. (84); Cagliari (13, 26); Carbonia-

Iglesias (13); Ogliastra (13); Sassari (26).

Remarks. Buchar & Thaler (2002: 446) consi-

der this species and P. strigillata as synonyms of P.

atomaria.

Pirata knorri (Scopoli, 1763)

Chorotype. Palearctic.

References. (13) Gameri, 1902.

Province. Ogliastra (13).

Pirata latitans (Blackwall, 1841)

Chorotype. European.

References. (13) Garneri, 1902; (139) Trotta,

2011.

Province. Carbonia-Iglesias (139); Nuoro

(ined.); Ogliastra (13).

Habitat. Hazelnut-orchard (ined.).

Examined material. NUORO: Belvi, Su

Enazzu, m 550, hazelnut-orchard, pitfall traps, 1

male 30.V-4.VII.2007 leg. I.S.E. (ISE).

Pirata piraticus (Clerck, 1757)

Chorotype. Holarctic.

References. (10) Costa, 1885; (13) Gameri,

1902; (20) Krauss, 1955 (sub P. piratica); (139)

Trotta, 2011.

Province. Cagliari (ined.); Carbonia-Iglesias

(13, 139); Oristano (10); Sassari (20).

Examined material. CAGLIARI: Pula , m 715, 1

female 18.VIII.2006 leg. Ruzzante Wilkin J. (MBG).

Pirata piscatorius (Clerck, 1757)

Chorotype. Sibero-European.

References. (10) Costa, 1885; (13) Gameri,

1902.

Province. Cagliari (13); Carbonia-Iglesias (10);

Oristano (13).

*Pirata tenuitarsis Simon, 1876

Chorotype. Asiatic-European.

Habitat. Alder-grove (ined.).

Examined material. NUORO: Desulo, Gennar-

gentu, mountain refuge, m 1500, alder-grove, pitfall

traps, 2 females 11-25.VII.2006, 1 female 25. VII-

9.VIII.2006 leg. Fiori F. (ISE). Fonni . Gennargentu,

mountain refuge, m 1550, alder-grove, pitfall traps,

1 female 17-30.VIII.2006, 1 female 2-17. VIII.2006,

3 males 19.VI-1.VII.2007 leg. Fiori F. (ISE).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Trochosa hispanica Simon, 1870

Chorotype. Turano-Mediterranean.

References. (13) Gameri, 1902 (sub Lycosa ca-

liginosa ); (20) Krauss, 1955; (84) Pesarini, 1994.

Province. (20, 84); Carbonia-Iglesias (13);

Nuoro (ined.).

Habitat. Cherry-orchard (ined.); hazelnut-or-

chard (ined.).

Examined material. NUORO: Belvl Antonitzo,

m683, cherry-orchard, 1 male 11-18.IV.2007, 1 male

18-26.IV.2007 (ISE); Su Enazzu, m 550, hazelnut-or-

chard, 3 males, 1 female and 1 juv. 24.VIII-5.IX.2006

(MBG), 2 males 8-24. VIII.2006 (ISE), 3 males, 1 fe-

male and 1 juv. 5-21.IX.2006, 4 males and 1 juv.

21.IX-5.X.2006, 1 male and 1 female 5-16.X.2006, 1

male 16-31.X.2006, 1 male 21.II-19.III.2007, 71

males and 2 females 19.III-26.IV.2007, 26 males

26.IV-30.V.2007 (MBG), 13 males and 1 female

30.V-4.VII.2007 (ISE), 86 males 30.V-4.VII.2007

(MBG) (all pitfall traps and leg. I.S.E.).

Trochosa ruricola (De Geer, 1778)

Chorotype. Holarctic.

References. (13) Gameri, 1902 (sub Lycosa ru-

ricola).

Province. Cagliari (13); Nuoro/Ogliastra (13);

Oristano (13).

Trochosa terricola Thorell, 1856

Chorotype. Holarctic.

References. (13) Garneri, 1902 (sub Lycosa

terricola ).

Province. Cagliari (13); Cagliari/Oristano (13);

Ogliastra (13).

Xerolycosa nemoralis (Westring, 1861)

Chorotype. Palearctic.

References. (13) Gameri, 1902 (sub Lycosa ne-

moralis).

Province. Cagliari (13); Cagliari/Oristano (13);

Ogliastra (13).

Remarks on family Lycosidae. Pardosa agri-

cola (Thorell, 1856) is cited in Sardinia by Gameri

(1902). The presence of this species in Italy is very

doubtful, Tongiorgi (1966: 284) has never seen Ita-

lian specimens of this species and there have not

been recent reports. It is possible that old reports are

due to mistaken identification of other species of

Pardosa of the monticola group. It was decided

therefore not to include this species in the catalogue.

Family PISAURIDAE

Dolomedes plantarius (Clerck, 1757)

Chorotype. Sibero-European.

References. (20) Krauss, 1955 (sub D. clercki);

(84) Pesarini, 1994.

Province. (84); Sassari (20).

Pisaura mirabilis (Clerck, 1757)

Chorotype. Asiatic-European.

References. (8) Costa, 1884 (sub Ocyale mira-

bilis); (13) Garneri, 1902 (sub Ocyale mirabilis);

(20) Krauss, 1955; (59) Brignoli, 1977; (74) Bri-

gnoli, 1984 (sub "Form A"); (84) Pesarini, 1994;

(127) Lorn et al., 2008; (139) Trotta, 2011.

Province. (13, 20, 84, 127); Cagliari (59, 74);

Carbonia-Iglesias (59, 139); Medio Campidano (59,

139); Nuoro (59, ined.); Ogliastra (59); Olbia-Tem-

pio (59); Oristano/Nuoro (8); Sassari (59, ined.).

Habitat. Orchard (ined.); hazelnut-orchard

(127, ined.).

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, beating tray, 1 fe-

male 16.VI.2005 leg. I.S.E. (ISE).

OLBIA-TEMPIO: Loiri-Porto San Paolo . Porto

S. Paolo, 1 juv. 27.XI.1966 leg. Gruppo Isole

C.N.R. (MBG). Olbia . Isola Tavolara, 1 juv.

24.IV. 1966 leg. Gmppo Isole C.N.R. (MBG).

SASSARI: Sorso, Pianu Mannu, Nali farm, or-

chard, pitfall traps, 1 male 15-22.IV. 1998 leg. 1st.

Ent. SS (ISE).

Pisaura quadrilineata (Lucas, 1838)

Chorotype. Mediterranean.

References. (74) Brignoli, 1984 (sub "Form

D"); (84) Pesarini, 1994 (sub P. maderiana); (132)

Pantini & Sassu, 2009.

Province. (84); Ogliastra (74); Sassari (132).

P. Pantini, A. Sassu & G. Serra

Family OXYOPIDAE

Oxyopes heterophthalmus (Latreille, 1804)

Chorotype. Palearctic.

References. (8) Costa, 1884; (11) de Carlini,

1885; (13) Gameri, 1902; (59) Brignoli, 1977; (84)

Pesarini, 1994; (114) Grill et al., 2005; (132) Pantini

& Sassu, 2009; (139) Trotta, 2011.

Province. (8, 84, 114); Cagliari (13); Carbonia-

Iglesias (11, 13, 139); Medio Campidano (139);

Ogliastra (13); Olbia-Tempio (59); Oristano (13);

Sassari (132, ined.).

Habitat. Low shurbs, shurblands and trees, agri-

cultural land (114).

Examined material. OLBIA-TEMPIO: Loiri-

Porto San Paolo . Porto S. Paolo, 2 males 1.V.1964

leg. Gruppo Isole C.N.R. (MBG).

Oxyopes lineatus Latreille, 1806

Chorotype. Turano-European.

References. (8) Costa, 1884; (13) Garneri,

1902; (84) Pesarini, 1994.

Province. (8, 84); Cagliari (13); Nuoro (ined.).

Habitat. Hazelnut-orchard (ined.).

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, pitfall traps, 1 fe-

male 27.VII-8.VIIL2006 leg. I.S.E. (ISE).

Oxyopes nigripalpis Kulczynski, 1891

Chorotype. Mediterranean.

References. (127) Lorn et al., 2008; (139)

Trotta, 2011.

Province. (127); Carbonia-Iglesias (139);

Nuoro (ined.); Sassari (ined.).

Habitat. Hazelnut-orchard (127, ined.).

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, beating tray, 2 fe-

males 27.VII.2005 leg. I.S.E. (ISE).

SASSARI: Sassari . Platamona, at sea level, 1

male 22.V.2008 leg. Sassu A. (ISE).

Family ZOROPSIDAE

Zoropsis media Simon, 1878

Chorotype. W-Mediterranean.

References. (13) Gameri, 1902.

Province. Cagliari (13).

Zoropsis spinimana (Dufour, 1 820)

Chorotype. Mediterranean.

References. (8) Costa, 1884 (sub Z. ocreata );

(13) Gameri, 1902 (sub Z. ocreata ); (84) Pesarini,

1994; (94) Arno et al., 1998; (95) Thaler & Kno-

flach, 1998; (127) Lorn et al., 2008; (133) Trotta,

2009; (139) Trotta, 2011.

Province. (84, 127); Cagliari (13, 139); Carbo-

nia-Iglesias (13, 139); Medio-Campidano (ined.);

Nuoro (95, ined.); Olbia-Tempio (133); Oristano (8,

13); Sassari (94, ined.).

Habitat. Avenue of lime trees (94); orchard

(ined.); inside house (ined.); mediterranean maquis

(ined.); hazelnut-orchard (127, ined.).

Examined material. MEDIO CAMPIDANO:

Guspini . Montevecchio, Piccalinna, m 260, mediter-

ranean maquis, pitfall traps, 1 male 21.IV-5.V.2009,

1 male and 2 females 18.V-3.VI.2009, 1 female 15-

30.VI.2009 leg. Sassu A., Verdinelli M. (ISE).

NUORO: Belvi . Su Ajone, m 585, hazelnut-or-

chard, bark traps, 1 female 16-23. VI. 2005, 1 juv.

14.VII.2005, 1 female 21-29.IX.2005, 1 female

29.IX-6.X.2005 (MBG), 1 male 29.IX-6.X.2005

(ISE), 2 males 6-12.X.2005. (MBG) (all leg. I.S.E.).

Tiana, m 522, hazelnut- orchard, bark traps, 1 fe-

male 17-26.VIII.2005 leg. I.S.E. (ISE).

SASSARI: Sassari . inside house, 1 male,

6. II. 2008, 1 female 1.2004 leg. Sassu A. (ISE).

Sorso . Pianu Mannu, Nali farm, orchard, bark

traps, 1 male and 1 female 24.XI-2.XII. 1997 leg.

1st. Ent. SS (ISE).

Family ZORIDAE

*Zor« manicata Simon, 1878

Chorotype. Europeo-Mediterranean.

Habitat. Walnut-orchard (ined.).

Examined material. NUORO: Belvi . Canale e’

Figu, m 576, walnut-orchard, pitfall traps, 1 male

26.IV-4.V.2007 leg. I.S.E. (ISE).

Zora spinimana (Sundevall, 1833)

Chorotype. Palearctic.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

References. (20) Krauss, 1955.

Province. (20).

Family AGELENIDAE

Agelena labyrinthica (Clerck, 1757)

Chorotype. Palearctic.

References. (8) Costa, 1884; (13) Garneri,

1902; (20) Krauss, 1955; (84) Pesarini, 1994; (139)

Trotta, 2011.

Province. (20, 84); Cagliari (13); Carbonia-

Iglesias (13, 139); Oristano (8, 13).

Allagelena gracilens (C.L. Koch, 1841)

Chorotype. Sibero-European.

Reeerences. (13) Garneri, 1902 (sub Agelena

similis ); (84) Pesarini, 1994.

Province. (84); Cagliari (13).

Aterigena soriculata (Simon, 1873)

Chorotype. Sardo-Corsican endemic.

References. (13) Garneri, 1902 (sub Tegenaria

soriculata ); (84) Pesarini, 1994 (sub Tegenaria so-

riculata).

Province. (13, 84); Nuoro/Ogliastra (13); Sas-

sari (20).

Remarks. The presence in Sardinia of this species

is doubtful, the citation by Krauss (1955) concerns

T. parietina (Bolzem et al., 20: 776).

Lycosoides coarctata (Dufour, 1831)

Chorotype. Mediterranean.

References. (3) Pavesi, 1876 (sub Textrix coar-

ctata ); (6) Magretti, 1880 (sub Textrix coarctata );

(10) Costa, 1885 (sub Textrix coarctata)', (11) de

Carlini, 1885 (sub Textrix coactata ); (13) Garneri,

1902 (sub Textrix Coarctata)', (20) Krauss, 1955

(sub Textrix Coarctata)', (37) Argiolas et al., 1970

(sub Textrix coarctata)', (59) Brignoli, 1977 (sub

Textrix coarctata)', (84) Pesarini, 1994; (132) Pan-

tini & Sassu, 2009.

Province. (84); Cagliari (6, 13, 37, 59, ined.);

Carbonia-Iglesias (3, 6, 11, 13, 59); Medio Campi-

dano (ined.); Olbia-Tempio (59); Oristano (10, 13,

ined.); Sassari (6, 13, 20, 59, 132, ined.).

Habitat. Hypogean habitat (20, 37); orchard

(ined.); garrigue (ined.); garden (ined.); inside

house (ined.); mining landfills covered by pioneer

plants (ined.).

Examined material. CAGLIARI: Domus de

Maria . Punta su Pisu, m 14, 2 males and 2 females

XII. 2006 leg. Ruzzante (MBG).

MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-

cauli, m 170, mining landfills covered by pioneer

plants, 2 males 6-20.X.2009 (ISE); m 200, garrigue,

1 male 6-20.X.2009 (MBG) (all pitfall traps and

leg. Sassu A., Verdinelli M.).

ORISTANO: Bonarcado . residential area, m 283,

garden, 1 male 25.X.2008 leg. Sassu A. (ISE).

OLBIA-TEMPIO: Olbia . Isola Molara, 8 female

25.11.1966, 1 female, 20.IV. 1966, 11 females,

25. XI.1966 (MBG); Isola Tavolara, 2 females,

26. XI.1966 (MBG) (all leg. Gruppo Isole C.N.R.).

SASSARI: Alghero . 1 male, leg. Pantaleoni R.A.

(ISE). Ozieri, 1 female 21. III. 1978 leg. Bianchi R.,

Moretti G. (MBG). Sassari . inside house, 1 male

9.X.2007 leg. Cesaroni C. (ISE). Sorso . Pianu

Mannu, Nali farm, orchard, pitfall traps, 1 male 20-

27. X. 1997 (ISE); orchard, bark traps, 1 female 2-

9.XII.1997 (ISE) (all leg. 1st. Ent. SS).

Malthonica campestris (C.L. Koch, 1834)

Chorotype. European.

References. (13) Garneri, 1902 (sub Tegenaria

campestris)', (84) Pesarini, 1994 (sub Tegenaria

campestris).

Province. (84); Nuoro/Ogliastra (13).

Malthonica dalmatica (Kulczynski, 1906)

Chorotype. Turano-European-Mediterranean.

References. (20) Krauss, 1955 (sub Tegenaria

pagana)', (39) Brignoli, 1971a (sub Tegenaria dre-

scoi); (84) Pesarini, 1994 (sub Tegenaria drescoi);

(87) Wunderlich, 1995b (sub Tegenaria henroti);

(124) Bolzem et al., 2008.

Province. (84); Nuoro (ined.); Ogliastra (87,

124); Sassari (20, 39, 124).

Habitat. Hypogean habitat (20, 39, 124); hazel-

nut-orchard (ined.).

Examined material. NUORO: Belvi . Su

P. Pantini, A. Sassu & G. Serra

Enazzu, m 550, hazelnut-orchard, pitfall traps, 1

male 10-31.X.2006 leg. I.S.E. (ISE).

Malthonica eleonorae Brignoli, 1974

Chorotype. Sardinian endemic.

References. (39) Brignoli, 1971a (sub Tegena-

ria henroti ); (51) Brignoli, 1974 (sub Tegenaria

eleonorae ); (59) Brignoli, 1977 (sub Tegenaria

eleonorae)', (83) Pons, 1993 (sub Tegenaria elea-

norae); (84) Pesarini, 1994 (sub Tegenaria eleono-

rae ); (124) Bolzem et al., 2008.

Province. (84); Carbonia-Iglesias (39, 51, 59,

83, 124); Ogliastra (59, 124).

Habitat. Hypogean habitat (39, 51, 83, 124).

Malthonica pagana (C.L. Koch, 1840)

Chorotype. Subcosmopolitan.

References. (6) Magretti, 1880 (sub Tegenaria

pagana)', (13) Garneri, 1902 (sub Tegenaria pa-

gana)', (30) Cerruti, 1968 (sub Tegenaria pagana)',

(39) Brignoli, 1971a (sub Tegenaria pagana)', (59)

Brignoli, 1977 (sub Tegenaria pagana)', (84) Pesa-

rini, 1994 (sub Tegenaria pagana).

Province. (84); Cagliari (6, 13, 39, 59); Sassari

(30, 39).

Habitat. Hypogean habitat (30, 39).

Malthonica sardoa Brignoli, 1977

Chorotype. Sardinian endemic.

References. (59) Brignoli, 1977; (83) Pons,

1993; (84) Pesarini, 1994; (124) Bolzern et al.,

2008.

Province. (124); (84); Carbonia-Iglesias (59,

124); Medio Campidano (ined.); Nuoro (59, 83, 124,

ined.); Olbia-Tempio (59, 124); Oristano (59, 124).

Habitat. Hypogean habitat (83, 124); garrigue

(ined.); mediterranean maquis (ined.); walnut-or-

chard (ined.); open Quercus forest with mosses

(124); Quercus pubescens, humid (124); under Ju-

niperus sp. (ined.); mining landfills covered by pio-

neer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, 1 female 19.V-4.VI.2009, 1 female 4-

16.VI.2009, 1 female 14-28.VII.2009, 2 females

28.VII-10.VIII.2009 (ISE); m 170, mining landfills

covered by pioneer plants, 1 female 19.V-4.VI.2009

(ISE); m 200, garrigue, 1 female 5-19.V.2009 (ISE),

1 female 19.V-4.VI.2009 (MBG) (all pitfall traps

and leg. Sassu A., Verdinelli M.). Guspini . Monte-

vecchio, Piccalinna, m 225, mining landfills cove-

red by pioneer plants, 1 female 15-30. VI. 2009

(ISE); m235, garrigue, 1 female 18.V-3.VI.2009, 2

females 30.VI-13.VII.2009 (ISE); m 260, mediter-

ranean maquis, 1 female 30.VI-13.VII.2009 (ISE),

1 female 13-27. VII. 2009 (MBG) (all pitfall traps

and leg. Sassu A., Verdinelli M.).

NUORO: Fonni . Gennargentu, mountain refuge,

m 1550, under Juniperus sp., pitfall traps, 1 female

19.VI-1.VII.2007 leg. Fiori F. (ISE). Tonara . Su Az-

zime, m 682, walnut-orchard, pitfall traps 2 males

22-29.11.2008 leg. I.S.E. (ISE).

Malthonica sicana Brignoli, 1976

Chorotype. Tyrrhenian endemic.

References. (124) Bolzem et al., 2008.

Province. Oristano (124).

Habitat. Open Quercus forest, rich leaf litter

(124); Quercus forest open, not wet (124).

Tegenaria agrestis (Walckenaer, 1802)

Chorotype. Holarctic.

References. (14) Gozo, 1908; (59) Brignoli,

1977; (84) Pesarini, 1994.

Province. (84); Carbonia-Iglesias (14); Sassari

(59).

Habitat. Hypogean habitat (14).

Tegenaria armigera Simon, 1873

Chorotype. Sardo-Corsican endemic.

References. (19) Roewer, 1953; (30) Cerruti,

1968; (39) Brignoli, 1971a; (84) Pesarini, 1994.

Province. (84); Ogliastra (39); Sassari (19, 30).

Habitat. Hypogean habitat (19, 30, 39).

Tegenaria domestica (Clerck, 1757)

Chorotype. Cosmopolitan.

References. (8) Costa, 1884; (13) Gameri,

1902; (30) Cerruti, 1968; (84) Pesarini, 1994.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Province. (84); Cagliari (13); Nuoro (30); Sas-

sari (8, 13).

Habitat. Hypogean habitat (30).

Tegenaria henroti Dresco, 1956

Chorotype. Sardinian endemic.

References. (21) Dresco, 1956; (22) Roewer,

1956 sub T. domestica (Clerck, 1757); (30) Cerruti,

1968; (51) Brignoli, 1974; (52) Puddu & Pirodda,

1974; (83) Pons, 1993; (84) Pesarini, 1994; (124)

Bolzern et al., 2008.

Province. (124); (84); Carbonia-Iglesias (52);

Nuoro (21, 22, 30, 51, 83, 124); Ogliastra (124).

Habitat. Hypogean habitat (21, 22, 30, 51, 52,

83, 124).

Tegenaria parietina (Fourcroy, 1785)

Chorotype. Subcosmopolitan.

References. (13) Garneri, 1902; (20) Krauss,

1955; (37) Argiolas et al., 1970; (38) Puddu, 1970;

(39) Brignoli, 1971a; (42) Puddu, 1971; (43) Bartolo

et al., 1972; (46) Thermes, 1972; (84) Pesarini,

1994; (139) Trotta, 2011.

Province. (84); Cagliari (13, 37, 42, 46); Car-

bonia-Iglesias (39, 43); Medio Campidano (139);

Ogliastra (38); Olbia-Tempio (20); Sassari (39).

Habitat. Hypogean habitat (37, 38, 39, 42, 43, 46).

Textrix caudata L. Koch, 1872

Chorotype. S-European.

References. (5) Pavesi, 1878 (sub T. violan-

tis ); (13) Garneri, 1902 (sub T. violantis ); (84) Pe-

sarini, 1994.

Province. (84); Cagliari (ined.); Medio Campi-

dano (ined.); Olbia-Tempio (5, 13).

Habitat. Mediterranean maquis (ined.).

Examined material. CAGLIARI: Pula, Is Can-

noneris, m 715, 1 female 18. VIII. 2006 leg. Ruz-

zante -Wilkins (MBG).

MEDIO CAMPIDANO: Guspini . Montevecchio,

Piccalinna, m 260, mediterranean maquis, pitfall

traps, 2 males 18.V-3.VI.2009 (MBG), 2 males

18.V-3.VI.2009, 6 males and 1 female 3-

15.VI.2009 (ISE), 3 males 3-15.VI.2009, 3 males

30.VI-13.VII.2009 (MBG), 5 males and 1 female

15-30. VI. 2009 (ISE), 2 males and 1 female 15-

30.VI.2009 (MBG), 6 males and 2 females 30.VI-

13.VII.2009, 1 female 27.VII-10.VIII.2009 (ISE),

1 male 13-27.VII.2009 (MBG), 1 male 13-

27.VII.2009 (ISE) (all leg. Sassu A., Verdinelli M.).

Textrix denticulata (Olivier, 1789)

Chorotype. European.

References. (13) Garneri, 1902; (84) Pesarini,

1994.

Province. (84); Nuoro/Ogliastra (13); Ogliastra

(13).

* Textrix pinicola Simon, 1875

Chorotype. W-Mediterranean.

Habitat. Mediterranean maquis (ined.).

Examined material. MEDIO CAMPIDANO:

Guspini . Montevecchio, Piccalinna, m 260, mediter-

ranean maquis, pitfall traps, 1 male 18.V-3.VI.2009

(ISE), 1 male 18.V-3.VI.2009 (MBG), 4 males 15-

30.VI.2009, 15 males 3-15.VI.2009 (ISE), 7 males

15-30.VI.2009, 1 male 15-30.VI.2009 (MBG), 7

males 30.VI-13.VII.2009 (ISE), 3 males 3-

15.VI.2009, 1 male 13-27.VII.2009 (MBG) (all leg.

Sassu A., Verdinelli M.).

Family HAHNIIDAE

Hahnia Candida Simon, 1875

Chorotype. European.

References. (48) Brignoli, 1973.

Province. Nuoro (48), Medio Campidano

(ined.).

Habitat. Mining landfills covered by pioneer

plants (ined.).

Examined material. MEDIO CAMPIDANO: Gu-

spini . Montevecchio, Piccalinna, m 260, mining land-

fills covered by pioneer plants, pitfall traps, 1 female

21.IV-5.V.2009 leg. Sassu A., Verdinelli M. (MBG).

Family DICTYNIDAE

Argenna patula (Simon, 1 874)

Chorotype. Palearctic.

P. Pantini, A. Sassu & G. Serra

References. (132) Pantini & Sassu, 2009.

Province. Sassari (132).

Dictyna arundinacea (Linnaeus, 1758)

Chorotype. Holarctic.

References. (13) Gameri, 1902.

Province. Ogliastra (13); Oristano (13).

Dictyna civica (Lucas, 1850)

Chorotype. Holarctic.

References. (94) Arno et al., 1998 (sub Brigit-

tea civica).

Province. Olbia-Tempio (ined.); Sassari (94).

Habitat. Avenue of lime trees (94); forest of

Quercus suber (ined.).

Examined material. OLBIA-TEMPIO: Bud-

duso, near Nuraghe Loelle, forest of Quercus

suber, beating tray, 2 females 7.VI.1999 leg. 1st.

Ent. SS (ISE).

Dictyna latens (Fabricius, 1775)

Chorotype. Sibero-European.

References. (13) Gameri, 1902.

Province. Cagliari (13); Sassari (ined.).

Habitat. Olive-grove (ined.).

Examined material. SASSARI: Sorso, Pianu

Mannu, Nali farm, olive-grove, beating tray, 1 fe-

male 29.IV. 1993 leg. 1st. Ent. SS (ISE).

Lathys humilis (Blackwall, 1855)

Chorotype. Palearctic.

References. (94) Arno et al., 1998; (127) Lom

et al., 2008.

Province. (127); Nuoro (ined.); Olbia-Tempio

(ined.); Sassari (94).

Habitat. Avenue of lime trees (94); cherry-or-

chard (ined.); hazelnut-orchard (127, ined.); forest

of Quercus suber (ined.).

Examined material. NUORO: Belyi, Antonitzd,

m 683, cherry-orchard, 1 female, 11-18.IV.2007

(ISE); Su Ajone, m 585, hazelnut-orchard, 1 female

25.V-1.VI.2005 (ISE); SuEnazzu, m 550, hazelnut-

orchard, 1 female 13-20.X.2004 (ISE) (all bark traps

and leg. I.S.E.).

OLBIA-TEMPIO: Budduso . near Nuraghe Lo-

elle, forest of Quercus suber, beating tray, 1 female

24.V.1999 leg. 1st. Ent. SS (ISE).

Marilynia bicolor (Simon, 1870)

Chorotype. Centralasiatic-European.

References. (116) Helsdingen, 2005.

Province. Ogliastra (116).

Habitat. In debris on the sandydeposits at the

mouth of the Rio Girasole (116).

Nigma puella (Simon, 1870)

Chorotype. European.

References. (10) Costa, 1885 (sub Dictyna

puella)', (13) Gameri, 1902 (sub Dictyna puella)',

(116) Helsdingen, 2005; (127) Lom et al., 2008.

Province. (127); Cagliari (10, 13); Nuoro (116,

ined.); Ogliastra (116); Olbia-Tempio (ined.); Ori-

stano (ined.); Sassari (ined.).

Habitat. In shurbs along a little stream (116);

hazelnut-orchard (127, ined.); olive-grove (ined.);

forest of Quercus suber (ined.); vineyard (ined.).

Examined material. NUORO: Belyi, Su Ajone,

m 585, hazelnut-orchard, 1 male 16.VI.2005 (MBG),

1 female 13.VII.2005 (ISE); Su Enazzu, m 550, ha-

zelnut-orchard, beating tray, 1 male 19.V.2005 (ISE),

3 males and 1 female, 19.V.2005 leg. I.S.E. (MBG)

(all beating tray and leg. I.S.E.). Tiana . m 522, ha-

zelnut-orchard, beating tray, 1 male 19.V.2005, 4

males and 2 females, 1.VI.2005, 1 female,

13.VII.2005, 1 female and 1 juv., 26.VIII.2005 leg.

I.S.E. (MBG).

OLBIA-TEMPIO: Budduso . near Nuraghe Lo-

elle, forest of Quercus suber, beating tray, 1 female,

31.V.1999, 1 male 24.V.1999 leg. 1st. Ent. SS (ISE).

ORISTANO: Fondorgianus . Tirso river, m 35, 1

male 22.IV.2003 leg. Pantini P., Magnati F. (MBG).

SASSARI: Bonnannaro . Cannisones, 2 males

17.V.2002, 2 males 28.V.2002 leg. Nuvoli T.

(ISE). Sorso . Pianu Mannu, Nali farm, olive-

grove, 1 female 23.III.1993 leg. 1st. Ent. SS (ISE).

Torralba . vineyard, 1 female 27. V. 1995 leg. 1st.

Ent. SS (ISE).

Nigma walckenaeri (Roewer, 1951)

Chorotype. European.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

References. (10) Costa, 1885 (sub Dictyna viri-

dissima ); (13) Gameri, 1902 (sub Dictyna vividis-

sima ); (94) Amo et al, 1998; (116) Helsdingen, 2005.

Province. Cagliari (13, ined.); Nuoro (10);

Ogliastra (116); Sassari (94, ined.).

Habitat. Citrus-grove (ined.); avenue of lime

trees (94); on trees lining a street (ined.); in the val-

ley of the rio (116).

Examined material. CAGLIARI: Uta, S’Ap-

passiu, Agris farm, citrus-grove, beating tray, 1

male 2.XI.2000, 5 males 13. XI. 2000, 1 male and 1

female 4.XII.2000 leg. CRAS (ISE).

SASSARI: Sassari . on trees lining a street, 1 fe-

male 29.IX.1994 leg. 1st. Ent. SS (ISE).

Family AMAUROBIIDAE

Amaurobius erberi (Keyserling, 1863)

Chorotype. European.

References. (41) Brignoli, 1971c; (52) Puddu

& Pirodda, 1974; (139) Trotta, 2011.

Province. Carbonia-Iglesias (41, 52, 139); Sas-

sari (ined.).

Habitat. Hypogean habitat (41, 52); orchard

(ined.).

Examined material. SASSARI: Sorso, Pianu

Mannu, Nali farm, orchard, bark traps, 1 female

20-27. X.1997 leg. 1st. Ent. SS (ISE).

Amaurobius fenestralis (Strom, 1768)

Chorotype. European.

References. (13) Gameri, 1902.

Province. Cagliari (13); Oristano (13).

Amaurobius fer ox (Walckenaer, 1830)

Chorotype. Holarctic.

References. (13) Gameri, 1902.

Province. Sassari (13).

Family TITANOECIDAE

Nurscia albomaculata (Lucas, 1 846)

Chorotype. Turano-European.

References. (10) Costa, 1885 (sub Titanoeca

albomaculata)', (13) Gameri, 1902 (sub Titanoeca

albo-maculata ); (84) Pesarini, 1994 (sub Titanoeca

albomaculata ); (94) Arno et al., 1998 (sub Tita-

noeca albomaculata)', (133) Trotta, 2009.

Province. (84); Cagliari (13); Nuoro (ined.);

Ogliastra (13); Olbia-Tempio (10, 133); Oristano

(13); Sassari (94, ined.).

Habitat. Avenue of lime trees (94); cherry-or-

chard (ined.); orchard (ined.).

Examined material. NUORO: Belyi, Antonitzo,

m 683, cherry-orchard, pitfall traps, 1 male, 1 female,

17-24.VII.2007, leg. I.S.E. (ISE).

SASSARI: Sorso . Pianu Mannu, Nali farm, or-

chard, pitfall traps, 1 male 26.VI-2.VII. 1997 leg. 1st.

Ent. SS (ISE).

Family MITURGIDAE

Cheiracanthium angulitarse Simon, 1878

Chorotype. S-European.

References. (132) Pantini & Sassu, 2009.

Province. Olbia-Tempio (ined.); Sassari (132).

Examined material. OLBIA-TEMPIO: Olbia .

Murta Maria, light trap, 1 male 17.V.1994 leg. Co-

motti G., Pantini P. (MBG).

Cheiracanthium mildei L. Koch, 1 864

Chorotype. Holarctic.

References. (10) Costa, 1885; (13) Gameri,

1902; (94) Amo etal., 1998; (116) Helsdingen, 2005;

(132) Pantini & Sassu, 2009; (139) Trotta, 2011.

Province, (ined.); Cagliari (13, ined.); Carbo-

nia-Iglesias (139); Medio-Campidano (139, ined.);

Nuoro (10); Ogliastra (116); Oristano (10, ined.);

Sassari (94, 132, ined.).

Habitat. Citrus-grove (ined.); avenue of lime

trees (94); orchard (ined.); inside house (ined.);

mediterranean maquis (ined.); olive-grove (ined.);

vineyard (ined.); wasteland plot (116).

Examined material. CAGLIARI: Uta . SAp-

passiu, Agris farm, citrus-grove, beating tray, 3

males 19.VI.2000, 1 male and 1 female 29.VI.2000,

2 males 20.VII.2000, 1 female 31.VII.2000, 1 fe-

male 10.VIII.2000 leg. CRAS (ISE).

MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-

P. Pantini, A. Sassu & G. Serra

cauli, m 120, mediterranean maquis, pitfall traps, 1

female 14-28.VII.2009, 1 female 10-25.VIII.2009

leg. Sassu A., Verdinelli M. (ISE). Guspini . Monte-

vecchio, Piccalinna, m 260, mediterranean maquis,

pitfall traps, 1 male 15-30. VI.2009 leg. Sassu A.,

Verdinelli M. (ISE).

ORISTANO: Bonarcado . inside house, 1 female

6. VI. 2007 leg. Sassu M. (ISE).

SASSARI: Sorso, Pianu Mannu, Nali farm,

olive-grove, 1 male 21.V.1993 (ISE); olive-grove,

beating tray, 2 males and 2 females 9.VII.1993, 1

male 1.VII.1993, 1 female 22.VII.1993, 1 female

26.VIII.1993 (ISE); orchard, bark traps, 1 female

10-17.VII.1997 (ISE); orchard, beating tray, 1 male

20.X. 1997 (ISE) (all leg. Ist.Ent.SS). Torralba . vine-

yard, 1 female 13.V.1995, 1 male 24.V.1995, 1 male

24.VI.1995 leg. 1st. Ent. SS (ISE).

Cheiracanthium pelasgicum (C.L. Koch, 1837)

Chorotype. Turano-European.

References. (10) Costa, 1885; (13) Gameri, 1902.

Province. Ogliastra (13); Oristano (10).

Cheiracanthium pennyi O. P.-Cambridge, 1873

Chorotype. Palearctic.

References. (116) Helsdingen, 2005.

Province. Ogliastra (116).

Habitat. Wasteland plot (116).

Cheiracanthium punctorium (Villers, 1789)

Chorotype. Turano-European.

References. (13) Gameri, 1902 (sub Chiracan-

thiun nutrix).

Province. Cagliari (13); Nuoro/Ogliastra (13).

Cheiracanthium seidlitzi L. Koch, 1864

Chorotype. Centralasiatic-Mediterranean.

References. (10) Costa, 1885; (13) Garneri,

1902; (18) Simon, 1932; (84) Pesarini, 1994.

Province. (18, 84); Cagliari (13); Oristano (10).

Cheiracanthium striolatum Simon, 1878

Chorotype. W-Mediterranean.

References. (10) Costa, 1885; (114) Grill et

al., 2005.

Province. (114); Cagliari (10).

Habitat. Shurblands and trees (114).

Family ANYPHAENIDAE

Anyphaena accentuata (Walckenaer, 1 802)

Chorotype. Turano-European.

References. (8) Costa, 1884; (13) Gameri,

1902; (84) Pesarini, 1994; (127) Lorn et al., 2008.

Province. (84, 127); Nuoro (8, 13, ined.).

Habitat. Cherry-orchard (ined.); hazelnut-or-

chard (127, ined.).

Examined material. NUORO: Belvl Manna-

ritzd, m 706, cherry-orchard, bark traps, 1 male 18-

26.IV.2007 (ISE); Su Ajone, m 585,

hazelnut-orchard, beating tray, 9 males, 2 females

and 1 juv. 4.V.2005 (MBG), 1 male 1 female,

4.V.2005, 1 male and 2 females 19.V.2005 (ISE), 5

females, 19.V.2005, 1 male 1.VI.2005 (MBG); Su

Enazzu, m 550, hazelnut-orchard, bark traps, 1 fe-

male 15-22. III. 2005, 1 female 27.IV-4.V.2005, 1 fe-

male 4-11.V.2005 (MBG); m 550, hazelnut-orchard,

beating tray, 2 males and 2 females 4.V.2005, 2

males, 5 females and 1 juv. 19.V.2005, 1 female and

2 juv. 16.VI.2005, 3 females 1.VI.2005, 1 female

29.VI.2005, 2 females and 40 juv. 10.VIII.2005

(MBG) (all leg. 1st. Ent. SS).

Anyphaena sabina L. Koch, 1 866

Chorotype. Turano-European.

References. (13) Gameri, 1902; (84) Pesarini,

1994; (94) Amo et al., 1998; (127) Lom et al., 2008;

(132) Pantini & Sassu, 2009; (139) Trotta, 2011.

Province. (84, 127); Cagliari (13, 139); Carbo-

nia-Iglesias (139); Medio-Campidano (139, ined.);

Nuoro (ined.); Oristano (ined.); Sassari (94, 132,

ined.).

Habitat. Avenue of lime trees (94); orchard

(ined.); mediterranean maquis (ined.); hazelnut-or-

chard (127, ined.); olive-grove (ined.); artichoke

field (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, pitfall traps, 1 male 19.V-4.VI.2009 leg.

Sassu A., Verdinelli M. (ISE). Guspini . Montevec-

chio, Piccalinna, m 260, mediterranean maquis, pit-

Catalogue of the spiders (Arachnida Araneae) of Sardinia

fall traps, 1 female 15-30.VI.2009 leg. Sassu A.,

Verdinelli M. (ISE).

NUORO: Belvi . Su Enazzu, m 550, hazelnut-or-

chard, beating tray, 1 female 4.V.2005 leg. I.S.E.

(MBG). Tiana . m 522, hazelnut- orchard, beating

tray, 1 female 4. V.2005 (MBG), 1 female 1.VI.2005

(ISE); hazelnut-orchard, bark traps, 1 female 4-

11. V.2005 (MBG) (all leg. 1st. Ent. SS).

ORISTANO: Bosa, artichoke field, 1 female

4.III.2009 leg. Padiglia P. (ISE).

OLBIA-TEMPIO: Olbia . Isola Tavolara, peniso-

lotto, 1 male 23.IV. 1966 leg. Gruppo Isole C.N.R.

(MBG).

S AS SARI: Sorso, Pianu Mannu, Nali farm,

olive-grove, beating tray, 1 male, 23.III.1993 (ISE),

olive-grove, 1 female 6.V.1993 (ISE); orchard, beat-

ing tray, 1 male and 1 female 22.IV. 1998 (ISE) (all

leg. 1st. Ent. SS).

Family LIOCRANIDAE

*Agraecina lineata (Simon, 1878)

Chorotype. W-Mediterranean.

Habitat. Garrigue (ined.).

Examined material. MEDIO CAMPIDANO:

Guspini . Montevecchio, Piccalinna, m 235, garri-

gue, pitfall traps, 1 male 18.V-3.VI.2009, 1 male 3-

15.VI.2009 (ISE), 1 male 30.VI-13.VII.2009

(MBG), 1 male 15-30.VI.2009 leg. Sassu A., Ver-

dinelli M. (ISE).

Agroeca annulipes Simon, 1878

Chorotype. W-Mediterranean.

References. (18) Simon, 1932.

Province. (18).

Agroeca inopina O.P.- Cambridge, 1886

CHOROTYPE.European.

References. (139) Trotta, 2011.

Province. Carbonia-Iglesias (139); Nuoro (ined.).

Habitat. Alder-grove (ined.); cherry-orchard

(ined.); hazelnut-orchard (ined.); under Juniperus

sp. (ined.); walnut-orchard (ined.).

Examined material. NUORO: Belvi . Anto-

nitzo, m 683, cherry-orchard, 1 female 16-

23.V.2007, 1 female 21-28.VI.2007, 1 male 11-

18.1.2008 (ISE); Canale e' Figu, m 576, walnut-or-

chard, 1 female 21-28.VI.2007 (ISE); Mannaritzo,

m 706, cherry-orchard, 1 male 19-26.XI.2007

(ISE); Su Enazzu, m 550, hazelnut-orchard, 1 fe-

male 13-27.VII.2006, 1 female 27.VII-8.VIII.2006,

4 juv. 8-24.VIII.2006, 6 males 24.VIII-5.IX.2006, 1

male and 1 female 5-21.IX.2006, 7 males and 1 fe-

male 21. IX-5.X.2006, 2 males 5-16.X.2006, 3 males

31.X-21.XI.2006 (MBG), 1 male and 1 female 5-

16. X.2006 (ISE), 3 males 16-31.X.2006, 4 males and

1 female, 21.XI.2006-8.I.2007 (MBG), 1 male and

1 female 21.XI.2006-8.I.2007 (ISE), 1 female 8.1-

21.11.2007, 1 female 21.II-19.III.2007, 2 females

19.III-26.IV.2007, 3 females 26.IV-30.V.2007, 3 fe-

males 30.V-4.VII.2007 (MBG) (all pitfall traps and

leg. I.S.E.). Desulo, Gennargentu, mountain refuge,

m 1500, under Juniperus sp., 2 males 19.IX-

3.X.2006 (ISE); alder-grove, 1 male, 5-19.IX.2006,

1 male, 3-17.X.2006 (ISE) (all pitfall traps and leg.

Fiori F.). Fonni . Gennargentu, mountain refuge, m

1550, alder-grove, 1 female, 19.VII-2.VIII.2006, 1

male, 17-30.VIII.2006, 6 males and 2 females 2-

17. VIII.2006, 14 males and 1 female 30. VIII-

12.IX.2006, 11 males 12-26.IX.2006, 1 female

29.XI.2006-9.I.2007 (ISE); under Juniperus sp. 1

male 17-30.VIII.2006, 3 males 30.VIII-12.IX.2006,

2 females 15-29.XI.2006, 1 female 5-19.VI.2007

(ISE) (all pitfall traps and leg. Fiori F.). Tonara, Su

Azzime, m 682, walnut-orchard, pitfall traps, 1 fe-

male 11-18.IV.2007, 1 male 4-11.X.2007, 1 male 19-

26.XI.2007, 1 male 11-18.1.2008 leg. I.S.E. (ISE).

Cybaeodes sardus Platnick et Di Franco, 1992

Chorotype. Sardinian endemic.

References. (81) Platnick & Di Franco, 1992.

Province. Oristano (81).

Liocranum giersbergi Kraus, 1955

Chorotype. Sardinian endemic.

References. (20) Krauss, 1955; (46) Thermes,

1972; (52) Puddu & Pirodda, 1974; (60) Brignoli &

Gaddini, 1979; (64) Brignoli, 1979d; (84) Pesarini,

1994; (87) Wunderlich, 1995b; (127) Lorn et al.,

2008; (139) Trotta, 2011.

Province. (84, 127); Cagliari (46, 52, 139,

ined.); Carbonia-Iglesias (139); Medio Campidano

(139, ined.); Nuoro (60, 64, ined.); Nuoro/Ogliastra

(87); Ogliastra (87); Sassari (20).

P. Pantini, A. Sassu & G. Serra

Habitat. Hypogean habitat (46, 52, 64);

cherry-orchard (ined.); mediterranean maquis

(ined.); hazelnut-orchard (127, ined.); walnut-or-

chard (ined.); under the bark (87).

Examined material. CAGLIARI: Pula . Is Can-

noneris, m 715, 1 female 18. VIII. 2006, 1 female

1. XII. 2006 leg. Ruzzante-Wilkins (MBG).

MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-

cauli, m 120, mediterranean maquis, pitfall traps, 1

male 19.V-4.VI.2009, 1 male 4-16.VI.2009 (ISE), 1

male 16-29.VI.2009, 2 females 29.VI-14.VII.2009

(MBG), 1 female 16-29.VI.2009, 1 female 29.VI-

14.VII.2009, 1 female 14-28.VII.2009, 1 male 8-

22.IX.2009, 1 male 6-20.X.2009 (ISE) (all leg.

Sassu A., Verdinelli M.). Guspini . Montevecchio,

Piccalinna, m 260, mediterranean maquis, pitfall

traps, 1 female 7-21.IV.2009, 3 females 5-

18.V.2009, 2 females 30.VI-13.VII.2009, 2 females

15-30.VI.2009, 1 female 13-27.VII.2009 (ISE), 1

male 22.IX-6.X.2009 (MBG), 1 male 8-22.IX.2009,

1 male, 1 female 22.IX-6.X.2009, 1 male 6-

20.X.2009 (ISE) (all leg. Sassu A., Verdinelli M.).

NUORO: Belvi, Mannaritzo, m 706, cherry-or-

chard, pitfall traps, 1 female 17-24. VII. 2007 leg.

I.S.E. (ISE). Tiana. m 522, hazelnut-orchard, bark

traps, 1 female 11-18.V.2005 leg. I.S.E. (ISE). To-

nara, light trap, 1 male 8.IX.2006 leg. Fiori F. (ISE);

Su Azzime, m 682, walnut-orchard, pitfall traps, 1

female 17-24.VIII.2007 leg. I.S.E. (ISE).

Liocranum rupicola (Walckenaer, 1830)

Chorotype. European.

References. (13) Gameri, 1902; (77) Grimm,

1986; (139) Trotta, 2011.

Province. (13); Nuoro (77); Ogliastra (139).

Habitat. Under bark (77).

Mesiotelus tenuissimus (L. Koch, 1866)

Chorotype. Mediterranean.

References. (20) Krauss, 1955; (84) Pesarini,

1994.

Province. (84); Sassari (20).

Scotina celans (Blackwall, 1841)

Chorotype. European.

References. (139) Trotta, 2011.

Province. Carbonia-Iglesias (139); Nuoro

(ined.).

Habitat. Hazelnut-orchard (ined.); walnut-or-

chard (ined.).

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, pitfall traps, 1

male 30.X-21.XI.2006 leg. I.S.E. (MBG). Tonara .

Su Azzime, m 682, walnut-orchard, 1 male 22-

29.11.2008 leg. I.S.E. (MBG).

Family CLUBIONIDAE

Clubiona comta C.L. Koch, 1839

Chorotype. European.

References. (127) Loru et al., 2008; (139)

Trotta, 2011.

Province. (127); Carbonia-Iglesias (139); Medio

Campidano (ined.); Nuoro (ined.); Sassari (ined.).

Habitat. Orchard (ined.); garrigue (ined.); ha-

zelnut-orchard (127, ined.); walnut- orchard (ined.).

Examined material. MEDIO CAMPIDANO:

Guspini . Montevecchio, Piccalinna, m 235, gar-

rigue, pitfall traps, 1 female 30.VI-13.VII.2009 leg.

Sassu A., Verdinelli M. (ISE).

NUORO: Belvi . Canale e' Figu, m 576, walnut-

orchard, 2 females 28.V-4.VI.2007 (ISE); Su

Enazzu, m 550, hazelnut-orchard, 1 female, 27.IV-

4.V.2005 1 female 4-11.V.2005, 1 female 7-

14.VII.2005, 1 female 14-21. IX.2005 (ISE) (all

bark traps and leg. I.S.E.).

SASSARI: Sorso . Pianu Mannu, Nali farm, or-

chard, pitfall traps, 1 female 24-3 l.VII. 1997 leg.

1st. Ent. SS (ISE).

Clubiona genevensis L. Koch, 1866

Chorotype. Palearctic.

References. (94) Arno et al., 1998.

Province. Sassari (94).

Habitat. Avenue of lime trees (94).

Clubiona leucaspis Simon, 1932

Chorotype. S-European.

References. (127) Loru et al., 2008; (139)

Trotta, 2011.

Province. (127); Cagliari (ined.); Carbonia-

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Iglesias (139); Nuoro (ined.); Olbia-Tempio (ined.);

Sassari (ined.).

Habitat. Citrus-grove (ined.); cherry-orchard

(ined.); orchard (ined.); hazelnut-orchard (127,

ined.); walnut-orchard (ined.); olive-grove (ined.);

pine wood (ined.); forest of Quercus suber (ined.);

vineyard (ined.).

Examined material. CAGLIARI: Uta, S’Ap-

passiu, Agris farm, citrus-grove, beating tray, 1 fe-

male 29.VI.2000, 1 female 10.VII.2000, 1 female

20.VII.2000 leg. CRAS (ISE).

NUORO: Belyi, Antonitzo, m 683, cherry-or-

chard, bark traps, 5 males, 11-18.IV.2007, 4 fe-

males, 16-24.V.2007, 1 female, 21-28.VI.2007

(ISE); Canale e' Figu, m 576, walnut-orchard,

bark traps, 1 female, 26.IV-4.V.2007, 2 females 17-

24. VII.2007, 1 male 19-26.XI.2007 (ISE); Manna-

ritzo, m 706, cherry-orchard, bark traps, 6 males and

1 female 18-26.IV.2007, 3 females 16-23.V.2007, 4

males 1 1 .1-1 8.1.2008, 1 male 22-29.11.2008 (ISE);

Su Ajone, m 585, hazelnut-orchard, bark traps, 1

male 27.IV-4.V.2005 (ISE), 1 female 4-11.V.2005,

3 females 25.V-1.VI.2005 (MBG), 1 female 25. V-

1. VI. 2005 (ISE) 2 females 14-19. VII.2005 (MBG);

Su Ajone, m 585, hazelnut-orchard, beating tray, 1

female 1.VI.2005, 1 female, 19.V.2005 (MBG); Su

Enazzu, m 550, hazelnut-orchard, bark traps, 1 fe-

male 13-20.X.2004, 3 females 8-15.XI.2004, 1 male

27.IV-4.V.2005, 1 female 25. V-1.VI.2005, 2 females

18-25.V.2005, 1 female, 29.VI-6.VII.2005, 1 female

16-23.VI.2005, 2 females 1-8.VI.2005 (MBG); ha-

zelnut-orchard, beating tray, 1 male, 3 females and

1 juv. 19.V.2005, 1 female 1.VI.2005 (MBG) (all

leg. I.S.E.). Tiana, m 522, hazelnut-orchard, bark

traps, 1 male 27.IV-4.V.2005, 2 females 18-

25. V.2005, 4 females 11-18.V.2005, 1 male and 3 fe-

males, 4-11.V.2005, 1 female 6-12.X.2005 leg.

I.S.E. (MBG). Tonara, Su Azzime, m 682, walnut-

orchard, bark traps, 1 female 11-18.IV.2007, 1 fe-

male 16-23.V.2007 leg. I.S.E. (ISE).

OLBIA-TEMPIO: Budduso . near Nuraghe Lo-

elle, forest of Quercus suber , beating tray, 1 female

24.V.1999 leg. 1st. Ent. SS (ISE).

SASSARI: Alghero . Porto Conte, m 35, pine-

wood, emergence cages, 1 female, 1 3. IV.2009 leg. 1st.

Ent. SS (ISE). Sorso, Pianu Mannu, Nali farm, olive-

grove, beating tray, 1 female 29.III.1993, 1 male and

1 female 21. IV. 1993 (ISE); olive-grove, 1 female

18.VI.1993 (ISE); orchard, bark traps, 1 male 2-

9.XII.1997 (ISE) (all leg. I.S.E.). Torralba . vineyard,

1 female 23.IV. 1994, 1 female 18.VI.1994, 1 male

and 3 juv. 19.XI.1994, 3 males 12.XI.1994, 1 female

and 9 juv. 26.VIII.1995, 1 male 21.X.1995 leg. 1st.

Ent. SS (ISE).

Clubiona neglecta O.P.- Cambridge, 1862

Chorotype. Palearctic.

References. (10) Costa, 1885.

Province. Nuoro (10).

Clubiona pallidula (Clerck, 1757)

Chorotype. Holarctic.

References. (13) Gameri, 1902.

Province. Nuoro/Ogliastra (13).

Clubiona phragmitis C.L. Koch, 1843

Chorotype. Palearctic.

References. (8) Costa, 1884; (13) Gameri, 1902.

Province. (13); Olbia-Tempio (8).

Clubiona subsultans Thorell, 1875

Chorotype. Palearctic.

References. (13) Gameri, 1902 (sub C. erratica ).

Province. Cagliari (13).

Clubiona terrestris Westring, 1851

Chorotype. European.

References. (127) Lom et al., 2008.

Province. (127); Nuoro (ined.).

HABiTAT.Hazelnut-orchard (127, ined.).

Examined material. NUORO: Belvl Su Ajone,

m 585, hazelnut-orchard, bark traps, 1 female,

27.IV-4.V.2005, 1 male 1-8.VI.2005, 1 female 17-

26.VIII.2005, 1 female 5-10.VIII.2005 (ISE), 1 fe-

male 20-27. X. 2004, 1 female 6-13.X.2004 leg.

I.S.E. (MBG).

Clubiona vegeta Simon, 1918

Chorotype. S-European.

References. (116) Helsdingen, 2005; (132)

Pantini & Sassu, 2009.

Province. Ogliastra (116); Sassari (132).

Habitat. Wasteland plot (116).

P. Pantini, A. Sassu & G. Serra

Family CORINNIDAE

Cetonana laticeps (Canestrini, 1868)

Chorotype. European-Mediterranean.

References. (77) Grimm, 1986 (sub Ceto lati-

ceps ); (84) Pesarini, 1994 (sub Ceto laticeps ).

Province. (84); Nuoro (77, ined.).

FIabitat. Walnut-orchard (ined.).

Examined material. NUORO: Tonara . Su Az-

zime, m 682, walnut- orchard, bark traps, 1 female

11-18.IV.2007 leg. I.S.E. (ISE).

Liophrurillus flavitarsis (Lucas, 1 846)

Chorotype. W-Mediterranean.

References. (60) Brignoli & Gaddini, 1979

(sub Phrurolitus flavitarsis); (84) Pesarini, 1994

(sub Phrurolitus flavitarsis); (139) Trotta, 2011.

Province. (84); Cagliari (60, ined.); Carbonia-

Iglesias (139); Medio Campidano (60, ined.);

Olbia-Tempio (139); Nuoro (60, ined.); Oristano

(60); Sassari (60, 139).

Habitat. Cherry-orchard (ined.); garrigue

(ined.); mediterranean maquis (ined.); hazelnut-or-

chard (ined.); walnut-orchard (ined.); mining land-

fills covered by pioneer plants (ined.).

Examined material. CARBONIA-IGLESIAS:

Gonnesa . 1 male 24.IV.2003 leg. Ferrario E. (MBG).

MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-

cauli, m 120, mediterranean maquis, 1 male 21.IV-

5.V.2009, 1 female, 19.V-4.VI.2009, 2 males

5-19.V.2009, 1 female, 29.VI-14.VII.2009 (ISE); m

170, mining landfills covered by pioneer plants, 1 fe-

male 5-19.V.2009 (ISE); m 200, garrigue, 2 males

21 .IV-5.V.2009 (ISE) (all pitfall traps and leg. Sassu

A., Verdinelli M.). Guspini . Montevecchio, Picca-

linna, m 235, garrigue, 2 males 7-21.IV.2009, 2

males, 21.IV-5.V.2009, 3 males and 1 female 5-

18.V.2009, 1 male and 1 female, 18.V-3.VI.2009

(ISE); m 260, mediterranean maquis, 5 males and 1

female 21.IV-5.V.2009, 18 males and 3 females 5-

18.V.2009, 6 males and 14 females 18.V-3.VI.2009,

6 females 3-15.VI.2009, 1 female 15-30.VI.2009, 1

female 30.VI-13.VII.2009 (ISE) (all pitfall traps and

leg. Sassu A., Verdinelli M.).

NUORO: Belyi, Antonitzo, m 683, cherry-or-

chard, 17 males 18-26.IV.2007, 1 male 11-

18.IV.2007, 2 males and 4 females 16-23.V.2007, 1

male, 1 female 21-28.VI.2007 (ISE); Canale e'

Figu, m 576, walnut-orchard, 2 females 16-

23. V.2007, 4 females, 21-28.VI.2007, 1 female 17-

24. VII.2007 (ISE); Mannaritzo, m 706,

cheny-orchard, 6 males and 1 female 18-26.IV.2007,

12 males and 1 female 1 1-18.IV.2007, 1 male and 13

females 16-23.V.2007, 5 females 21-28.VI.2007, 2

females 17-24.VII.2007 (ISE); Su Enazzu, m 550,

hazelnut-orchard, 1 male and 16 females 27. VII-

8. VIII. 2006 (MBG), 13 female 13-27.VII.2006

(ISE), 15 female 13-27.VII.2006, 2 females and 1

juv. 8-24.VIII.2006, 1 juv. 31.X-21.XI.2006, 3 juv.

16-31.X.2006, 1 juv. 8.1-21. 11.2007, 1 female 19.III-

26.IV.2007, 5 males and 13 females 30.V-4.VII.2007

(MBG), 1 male 30.V-4.VII.2007 (ISE) (all pitfall

traps and leg. I.S.E.). Tonara . Su Azzime, m 682,

walnut-orchard, pitfall traps, 1 male and 1 female 18-

26.IV.2007, 2 males and 2 females 16-23.V.2007, 2

females 21-28.VI.2007 leg. I.S.E. (ISE).

Phrurolithus corsicus (Simon, 1878)

Chorotype. S-European.

References. (116) Helsdingen, 2005.

Province. Nuoro (116, ined.).

Habitat. At the margin of a field with stones

and shurbs (116); under Juniperus sp. (ined.).

Examined material. NUORO: Desulo . Gennar-

gentu, mountain refuge, m 1500, under Juniperus

sp., pitfall traps, 1 female 10-24.V.2007 leg. Fiori

F. (MBG). Fonni . Gennargentu, mountain refuge,

m 1550, under Juniperus sp., pitfall traps, 2 males

5-19.VI.2007 leg. Fiori F. (MBG).

Remarks. The male palp of P. corsicus is illu-

strated in figures 4-5.

Trachelas minor O.P.-Cambridge, 1872

Chorotype. W-Palearctic.

References. (116) Helsdingen, 2005.

Province. Nuoro (116).

Habitat. In grassland along the mouth of the

river (116).

Family ZODARIIDAE

Selamia reticulata (Simon, 1870)

Chorotype. W-Mediterranean.

References. (133) Trotta, 2009.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Figures 4, 5. Phrurolithus corsicus (Simon, 1878) - Fonni (NU) Gennargentu m 1550, 5-19.VI.2007 leg. Fiori F. (scale

0.2 mm): (4) retrolateral view of left male pedipalp; (5) ventral view of left male pedipalp.

Province. Carbonia-Iglesias (133); Oristano

(ined.).

Examined material. ORISTANO: San Vero

Milis, Mandriola, 1 female 28.V.2005 leg. Mulas

A. (UCA).

Zodarion elegans (Simon, 1873)

Chorotype. S-European.

References. (13) Gameri, 1902 (sub Enyo ele-

gans ); (84) Pesarini, 1994; (93) Bosnians, 1997;

(112) Thaler & Knoflach, 2004; (132) Pantini &

Sassu, 2009; (139) Trotta, 2011.

Province. (84); Cagliari (13); Carbonia-Iglesias

(13, 93, 139); Medio Campidano (ined.); Nuoro

(93, ined.); Ogliastra (112); Oristano (ined.); Sassari

(132, ined.).

Habitat. Cherry-orchard (ined.); orchard

(ined.); garrigue (ined.); mediterranean maquis

(ined.); hazelnut- orchard (ined.); walnut-orchard

(ined.); mining landfills covered by pioneer

plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, 1 female 14-28. VII.2009, 1 female 19.V-

4. VI. 2009, 1 male 5-19.V.2009 (ISE); m 170, mi-

ning landfills covered by pioneer plants, 1 female

29.VI-14.VII.2009, 1 male and 1 female 16-

29.VI.2009, 1 female 4-16.VI.2009, 2 males and 5

females 28. VII- 10. VIII. 2009, 2 males and 2 fema-

les 14-28.VII.2009, 1 female 10-25.VIII.2009, 1

female 25.VIII-8.IX.2009 (ISE), m 200, garrigue,

3 males 19.V-4.VI.2009, 2 females 16-29.VI.2009,

3 males and 1 female 14-28.VII.2009, 5 males and

5 females 28.VII-10.VIII.2009, 1 male 10-

25.VIII.2009 (ISE) (all pitfall traps and leg. Sassu

A., Verdinelli M.). Guspini . Montevecchio, Picca-

linna, m 225, mining landfills covered by pioneer

plants, 2 males, 13-27. VII.2009 (ISE); m 235, gar-

rigue, 1 female and 5 juv. 21.IV-5.V.2009, 17 males

and 6 juv. 5-18.V.2009, 30 males, 5 females and 1

juv. 18.V-3.VI.2009, 2 females 15-30.VI.2009, 1

male and 7 females 30. VI- 13. VII.2009, 5 males and

1 female 3- 15. VI. 2009, 32 males and 39 females

13-27.VII.2009, 33 males and 27 females 27.VII-

10.VIII.2009, 5 males and 16 females 10-

25.VIII.2009, 5 females 25.VIII-8.IX.2009 (ISE),

P. Pantini, A. Sassu & G. Serra

16 males and 23 females 10-25.VIII.2009 (MBG),

4 females 8-22.IX.2009 (ISE) (all pitfall traps and

leg. Sassu A., Verdinelli M.).

NUORO: Belvi . Antonitzd, m 683, cherry-or-

chard, 1 female 16-23.V.2007, 6 males 21-

28.VI.2007, 1 male 17-24.VII.2007, 1 female

27.IX-4.X.2007 (ISE); Canale e' Figu, m 576, wal-

nut-orchard, 1 female, 16-23.V.2007, 3 males and

2 females 21-28.VI.2007, 1 female 24-30.VIII.2007

(ISE), Su Enazzu, m 550, hazelnut-orchard, 1 fe-

male 27.VII-8.VIII.2006, 1 male 8-24.VIII.2006

(ISE) (all pitfall traps and leg. I.S.E.).

S AS SARI: Sorso, Pianu Mannu, Nali farm, or-

chard, pitfall traps, 2 males, 1 female and 1 juv. 24-

3 l.VII. 1997 leg. 1st. Ent. SS (ISE).

ORISTANO: Cabras, Isola Mai di Ventre, 1

male, 1 female, IV.2006, leg. Mulas A. (UCA).

*Zodarion gallicum (Simon, 1873)

Chorotype. S-European.

Habitat. Mediterranean maquis (ined.).

Examined material. MEDIO CAMPIDANO:

Guspini . Montevecchio, Piccalinna, m 260, mediter-

ranean maquis, pitfall traps, 1 female 30. VI-

13.VII.2009 leg. Sassu A., Verdinelli M. (MBG).

Zodarion italicum (Canestrini, 1868)

Chorotype. European.

References. (13) Gameri, 1902 (sub Enyo italica).

Province. Cagliari (13).

Zodarion nigriceps (Simon, 1873)

Chorotype. Sardo-Corsican endemic.

References. (3) Pavesi, 1876 (sub Enyo nigri-

ceps); (13) Garneri, 1902 (sub Enyo nigriceps);

(15) Simon, 1914; (84) Pesarini, 1994; (93) Bo-

snians, 1997.

Province. (15, 84); Cagliari (13); Carbonia-

Iglesias (3, 13); Nuoro (ined.); Ogliastra (13, 93);

Oristano (93).

Habitat. Cherry-orchard (ined.); walnut-or-

chard (ined.); under Juniperus sp. (ined.).

Examined material. NUORO: Belvi . Anto-

nitzo, m 683, cherry-orchard, 6 male, 1 female 16-

23.V.2007, 1 male and 1 female 21-28.VI.2007, 1

male 27.IX-4.X.2007 (ISE); Canale e' Figu, m 576,

walnut-orchard, 1 male 21-28.VI.2007 (ISE); Man-

naritzo, m 706, cherry-orchard, 1 male 18-

26.IV.2007, 1 female 16-23.V.2007, 2 males

2 1-28. VI. 2007 (ISE) (all pitfall traps and leg.

1.5. E.). Desulo . Gennargentu, mountain refuge, m

1500, under Juniperus sp., pitfall traps, 1 male 9-

23.VIII.2006 leg. Fiori F. (ISE). Tonara, Su Azzime,

m 682, walnut-orchard, pitfall traps, 1 male 18-

26.IV.2007, 1 male 16-23.V.2007, 2 males and 3 fe-

males 21-28.VI.2007, 2 males 24-30. VIII.2007 leg.

1.5. E. (ISE).

Zodarion ruffoi Caporiacco, 1951

Chorotype. Italian endemic.

References. (93) Bosmans, 1997.

Province. Medio Campidano (ined.); Nuoro

(ined.); Ogliastra (93).

Habitat. Garrigue (ined.); mediterranean maquis

(ined.); under Juniperus sp. (ined.); mining landfills

covered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, 1 male 4-16.VI.2009 (MBG); m 200, gar-

rigue, 1 female 14-28.VII.2009 (MBG) (all pitfall

traps and leg. Sassu A., Verdinelli M.). Guspini .

Montevecchio, Piccalinna, m 225, mining landfills

covered by pioneer plants, 1 female 10-25.VIII.2009

(MBG); m 235, garrigue, 16 males 5-18.V.2009, 1

female 6-20.X.2009 (MBG) (all pitfall traps and leg.

Sassu A., Verdinelli M.).

NUORO: Fonni . Gennargentu, mountain refuge,

m 1550, under Juniperus sp., pitfall traps, 1 male

5-19.VI.2007 leg. Fiori F. (ISE).

Zodarion sardum Bosmans, 1997

Chorotype. Sardinian endemic.

References. (49) Wunderlich, 1973 (sub Zoda-

rion (?) vicinum); (93) Bosmans, 1997.

Province. (49, 93).

Family PRODIDOMIDAE

*Zimirina brevipes Perez et Blasco, 1986

Chorotype. W-Mediterranean.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Habitat. Mining landfills covered by pioneer

plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining landfills

covered by pioneer plants, pitfall traps, 1 female

19.V-4.VI.2009 leg. Sassu A., Verdinelli M. (MBG).

Remarks, a new record for Italy of this family

and this species known only from Southern Spain.

The epigynum is illustrated in figure 6.

Family GNAPHOSIDAE

Aphantaulax cincta (L. Koch, 1866)

Chorotype. Europeo-Mediterranean.

References. (76) Grimm, 1985; (84) Pesarini,

1994; (127) Lorn et al., 2008; (139) Trotta, 2011.

Province. (84, 127); Carbonia-Iglesias (139);

Nuoro (ined.); Olbia-Tempio (76).

Habitat. Hazelnut-orchard (127, ined.); sand-

strand (76).

Examined material. NUORO: Belvi . Su Ajone,

m 585, hazelnut-orchard, bark traps, 1 female 4-

1 1 . V.2005 leg. I.S.E. (ISE). Tiana . m 522, hazelnut-

orchard, beating tray, 1 female 19. V.2005, 1 male

16.VI.2005 leg. I.S.E. (ISE).

Aphantaulax trifasciata (O.P. -Cambridge, 1872)

Chorotype. Palearctic.

References. (8) Costa, 1884 (sub A. seminiger );

(13) Garneri, 1902 (sub A. semi-niger ); (76) Grimm,

1985 (sub A. seminigra ); (84) Pesarini, 1994 (sub A.

seminigra ); (132) Pantini & Sassu, 2009.

Province. (84); Cagliari (8, 13); Medio-Campi-

dano (ined.); Nuoro (8, 13, 76, ined.); Olbia-Tempio

(8, 13); Sassari (8, 13, 132, ined.).

Habitat. Garrigue (ined.); inside house (ined.);

grassland (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 200, garrigue, pit-

fall traps, 1 male 5-19.V.2009 leg. Sassu A., Ver-

dinelli M. (ISE).

NUORO: Bolotana . Badde e'Salighes, m 850,

grassland, 1 male 27.V.2007 leg. Sassu A. (ISE).

SASSARI: Sassari . Li Punti, Baldinca, m 110,

inside house, 1 male 2.VII.2008 leg. Cossu S. (ISE).

Figure 6. Zimirina brevipes Perez & Blasco, 1986 - epigyne,

ventral view (scale 0.1 mm), Arbus (VS), Ingurtosu, Nara-

cauli m 120, 4.VI.2009 leg. Sassu A., Verdinelli M.

Drassodes lapidosus (Walckenaer, 1 802)

Chorotype. Palearctic.

References. (5) Pavesi, 1878 (sub Drassus la-

pidicola); (8) Costa, 1884 (sub Drassus lapidosus)',

(13) Garneri, 1902 (sub Drassus lapidosus)', (20)

Krauss, 1955; (84) Pesarini, 1994; (127) Lorn et al.,

2008; (132) Pantini & Sassu, 2009; (133) Trotta,

2009; (139) Trotta, 2011.

Province. (20, 84, 127); Cagliari (13); Carbo-

nia-Iglesias (139); Medio Campidano (ined.); Nuoro

(8, 13, ined.); Nuoro/Ogliastra (13); Olbia-Tempio

(5, 8, 13, 133); Oristano (ined.); Sassari (132, 133).

Habitat. Cherry-orchard (ined.); hazelnut-or-

chard (127, ined.); alder-grove (ined.); under Juni-

perus sp. (ined.); mining landfills covered by

pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining landfills

covered by pioneer plants, pitfall traps, 1 male 5-

19.V.2009 (MBG), 1 male 5-19.V.2009 (ISE) (all

leg. Sassu A., Verdinelli M.). Guspini . Montevec-

chio, Piccalinna, m 225, mining landfills covered by

pioneer plants, pitfall traps, 1 male 21.IV-5.V.2009

(ISE), 2 males 18.V-3.VI.2009 (MBG), 1 male 3-

15.VI.2009 (ISE) (all leg. Sassu A., Verdinelli M.).

NUORO: Belvi . Mannaritzo, m 706, cherry-or-

chard, pitfall traps, 1 male 16-23.V.2007, 1 female

P. Pantini, A. Sassu & G. Serra

17-24.VII.2007 (ISE); SuEnazzu, m 550, hazelnut-

orchard, bark traps, 1 male 18-25.V.2005, 1 female

14-19.VII.2005 (ISE) (all leg. I.S.E.). Desulo . Gen-

nargentu, mountain refuge, m 1500, alder-grove,

bark traps, 1 female 25. VI-2. VII. 2007 leg. Fiori F.

(ISE). Fonni, Gennargentu, mountain refuge, m

1550, alder-grove, 1 female 19.VII-2.VIII.2006, 1

female 19.VI-1.VII.2007 (ISE); under Juniperus sp.,

2 females 5-19.VI.2007 (ISE) (all pitfall traps and

leg. Fiori F.). Ohena, Cedrino lake, m 80, light trap,

1 male 20.V.1994 leg. Pantini P., Valle M. (MBG).

ORISTANO: Cabras, Isola Mai di Ventre, 3

males 1 female 14-18. IV.2006 leg. Mulas A. (UCA).

*Drassodes luteomicans (Simon, 1878)

Chorotype. S-European.

Habitat. Garrigue (ined.); mediterranean ma-

quis (ined.); mining landfills covered by pioneer

plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, 1 male 16-29.VI.2009 1, 1 female 4-

16. VI. 2009 (MBG); m 170, mining landfills covered

by pioneer plants, 1 female 21. IV-5.V.2009, 1 female

28.VII-10.VIII.2009 (MBG); m 200, garrigue, 1 fe-

male 19.V-4.VI.2009, 1 female 29.VI-14.VII.2009,

1 female 6-20.X.2009 (ISE) (all pitfall traps and leg.

Sassu A., Verdinelli M.). Guspini . Montevecchio,

Piccalinna, m 260, mediterranean maquis, pitfall

traps, 1 female 18.V-3.VI.2009 (ISE), 1 female 3-

15.VI.2009 (MBG) (all leg. Sassu A., Verdinelli M.).

Remarks. The male palp, the epigynum and the

vulva of this species are illustrated in figures 7-11.

Drassodes lutescens (C.L. Koch, 1839)

Chorotype. Turano-European-Mediterranean.

References. (13) Gameri, 1902 (sub Drassus

lutescens ); (20) Krauss, 1955; (84) Pesarini, 1994;

(139) Trotta, 2011.

Province. (20, 84); Carbonia-Iglesias (139); Medio

Campidano (ined.); Nuoro (ined.); Nuoro/Ogliastra

(13); Ogliastra (13); Oristano (ined.).

Habitat. Garrigue (ined.); mediterranean ma-

quis (ined.); alder-grove (ined.); under Juniperus

sp. (ined.); mining landfills covered by pioneer

plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, 1 male 5-19.V.2009, 1 male 29. VI-

14.VII.2009, 1 male, 14-28.VII.2009 (ISE); m 170,

mining landfills covered by pioneer plants, 1 male

and 1 female 21.IV-5.V.2009, 1 male 7-21.IV.2009

(ISE); m 200, garrigue, 1 male 21.IV-5.V.2009, 2

males 7-21.IV.2009, 3 males and 2 females 19.V-

4. VI.2009 (ISE), 3 males and 3 females 5-19.V.2009

(MBG), 1 male 5-19.V.2009 (ISE) (all pitfall traps

and leg. Sassu A., Verdinelli M.). Guspini . Monte-

vecchio, Piccalinna, m 225, mining landfills covered

by pioneer plants, pitfall traps, 1 female 21.IV-

5. V.2009, 1 male 18.V-3.VI.2009, 1 female 15-

30.VI.2009, 1 male 18.V-3.VI.2009 leg. Sassu A.,

Verdinelli M. (ISE).

NUORO: Desulo . Gennargentu, mountain refuge,

m 1500, alder-grove, bark traps, 1 female 29. VIII-

5.IX.2006, 1 female and 1 juv. 26.IX-3.X.2006, 3

females 13-19.IX.2006, 1 male and 1 female 24. IV-

1.V.2007 leg. Fiori F. (ISE). Fonni . Gennargentu,

mountain refuge, m 1550, alder-grove, pitfall traps,

1 female 17-30.VIII.2006 (ISE); alder-grove, bark

traps, 1 female 24.IV-1.V.2007 (ISE); under Junipe-

rus sp., pitfall traps, 1 female 19.VI-1.VII.2007, 2

males 5-19.VI.2007 (ISE) (all leg. Fiori F.).

ORISTANO: Cabras . Isola Mai di Ventre, 1 male,

2 females 12-21.11.2005, 5 females 17.IV.2006 leg.

Mulas A. (UCA).

Drassodes rubidus (Simon, 1878)

Chorotype. W-Mediterranean.

References. (13) Garneri, 1902 (sub Drassus

rubidus ); (84) Pesarini, 1994.

Province. (84); Carbonia-Iglesias (13); Nuoro/

Ogliastra (13); Ogliastra (13).

Drassodex hispanus (L. Koch, 1 866)

Chorotype. European.

References. (13) Garneri, 1902 (sub Drassus

hispanus ); (84) Pesarini, 1994 (sub Drassodes hi-

spanus).

Province. (84); Cagliari (13).

Drassodex hypocrita (Simon, 1878)

Chorotype. European.

References. (13) Garneri, 1902 (sub Drassus

hypocrita).

Province. Ogliastra (13).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Figures 7-9. Drassodes luteomicans (Simon, 1878), Ingurtosu, Naracauli, m 120, 16-29.VI.2009 leg. Sassu A., Verdinelli

M. (scale 0.5 mm): (7) retrolateral view of left male pedipalp; (8) ventral view of left male pedipalp; (9) chelicerae, posterior

view. Figures 10-11. D. luteomicans (Simon, 1878), Ingurtosu, Naracauli, m 170, 28.VII-10.VIII.2009 leg. Sassu A., Ver-

dinelli M. (scale 0.2 mm): (10) epigyne, ventral view; (11) vulva, ventral view.

Gnaphosa alacris Simon, 1878

Chorotype. Mediterranean.

References. (13) Gameri, 1902.

Province. Medio Campidano (ined.); Nuoro

(ined.); Ogliastra (13); Sassari (ined.).

Habitat. Orchard (ined.); garrigue (ined.); wal-

nut-orchard (ined.); mining landfills covered by

pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining

landfills covered by pioneer plants, 1 male 4-

16. VI. 2009, 1 male and 3 females 29. VI-

14.VII.2009 (ISE), 1 female 16-29.VI.2009

(MBG), 1 female 28.VII-10.VIII.2009 (ISE); m

200, garrigue, 1 male 29.VI-14.VII.2009 (ISE)

(all pitfall traps and leg. Sassu A., Verdinelli M.).

Guspini . Montevecchio, Piccalinna, m 225, mining

landfills covered by pioneer plants, 1 male 13-

27.VII.2009, 1 female 27.VII-10.VIII.2009, 1 male

8-22.IX.2009 (ISE); m 235, garrigue, 1 male 13-

27.VII.2009 (MBG) (all pitfall traps and leg. Sassu

A., Verdinelli M.).

NUORO: Belvi . Canale e' Figu, m 576, walnut-

orchard, pitfall traps, 1 male 17-24. VII. 2007 leg.

I.S.E. (ISE).

SASSARI: Sorso, Pianu Mannu, Nali farm, or-

chard, pitfall traps, 1 female 26.VI-2.VII. 1997 leg.

1st. Ent. SS (ISE).

Gnaphosa bicolor (Hahn, 1833)

Chorotype. Sibero-European.

References. (13) Gameri, 1902.

Province. Cagliari (13); Nuoro/Ogliastra (13).

P. Pantini, A. Sassu & G. Serra

Gnaphosa lucifuga (Walckenaer, 1802)

Chorotype. Palearctic.

References. (13) Gameri, 1902; (84) Pesarini,

1994.

Province. (84); Cagliari (13); Carbonia-Igle-

sias (13).

Gnaphosa lugubris (C.L. Koch, 1839)

Chorotype. Sibero-European.

References. (13) Gameri, 1902.

Province. Cagliari (13).

Haplodrassus dalmatensis (L. Koch, 1866)

Chorotype. Palearctic.

References. (13) Gameri, 1902 (sub Drassus

minus cuius); (20) Krauss, 1955; (116) Helsdingen,

2005; (132) Pantini & Sassu, 2009.

Province. (20); Cagliari (13); Medio Campi-

dano (ined.); Ogliastra (116); Sassari (132).

Habitat. Garrigue (ined.); in coastal drift on the

shore (116); mining landfills covered by pioneer

plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining land-

fills covered by pioneer plants, pitfall traps, 1 male

7-21.IV.2009, 2 males and 1 female 21.IV-5.V.2009

(ISE), 2 males and 1 female 5-19.V.2009 (MBG), 2

females 5-19.V.2009, 1 female 16-29.VI.2009, 2

males 7-21.IV.2009 (ISE) (all leg. Sassu A., Verdi-

nelli M.). Guspini . Montevecchio, Piccalinna, m

225, mining landfills covered by pioneer plants, 1

male 7-21.IV.2009, 2 males and 3 females 21.IV-

5.V.2009, 3 females 18.V-3.VI.2009, 1 male and 1

female 5-18.V.2009, 2 females 15-30.VI.2009

(ISE); m 235, garrigue, 2 males 18.V-3.VI.2009 (all

pitfall traps and leg. Sassu A., Verdinelli M.).

Haplodrassus macellinus (Thorell, 1871)

Chorotype. Mediterranean.

References. (11) de Carlini, 1885 (sub Drassus

macellinus ); (13) Gameri, 1902 (sub Drassus ma-

cellinus); (20) Krauss, 1955; (84) Pesarini, 1994.

Province. (84); Carbonia-Iglesias (11, 13); Sas-

sari (20).

Haplodrassus severus (C.L. Koch, 1839)

Chorotype. Mediterranean.

References. (10) Costa, 1885 (sub Drassus se-

verus); (20) Krauss, 1955; (30) Cerruti, 1968; (84)

Pesarini, 1994; (132) Pantini & Sassu, 2009.

Province. (20, 30, 84); Cagliari (10); Nuoro

(ined.); Sassari (132).

Habitat. Hypogean habitat (30).

Examined material. NUORO: Gavoi . S'eremu

e sa mela, m 1000, 1 male 13.VI.2006 leg. Mulas

A. (UCA).

Haplodrassus signifer (C.L. Koch, 1839)

Chorotype. Holarctic.

References. (6) Magretti, 1880 (sub Drassus

troglodytes); (8) Costa, 1884 (sub Drassus troglo-

dytes); (13) Gameri, 1902 (sub Drassus troglody-

tes); (20) Krauss, 1955; (84) Pesarini, 1994; (116)

Helsdingen, 2005; (133) Trotta, 2009.

Province. (20, 84); Cagliari (13); Carbonia-

Iglesias (6); Nuoro (116, ined.); Nuoro/Ogliastra (8,

13); Olbia-Tempio (133).

Habitat. At the margin of a field with stones and

shurbs (116); cherry-orchard (ined.).

Examined material. NUORO: Belyi, Manna-

ritzo, m 706, cherry-orchard, pitfall traps, 1 female

18-26.IV.2007 leg. I.S.E. (ISE).

*Leptodrassus femineus (Simon, 1873)

Chorotype. W-Mediterranean.

Habitat. Garrigue (ined.); mining landfills co-

vered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Guspini . Montevecchio, Piccalinna, m 225, mining

landfills covered by pioneer plants, 1 female

27.VII-10.VIII.2009 (ISE); m 235, garrigue, 1 fe-

male 25.VIII-8.IX.2009 (ISE) (all pitfall traps and

leg. Sassu A., Verdinelli M.).

*Micaria albovittata (Lucas, 1 846)

Chorotype. Palearctic.

Habitat. Under Juniperus sp. (ined.); walnut-

orchard (ined.).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Examined material. NUORO: Fonni . Gennar-

gentu, mountain refuge, m 1550, under Juniperus sp.,

pitfall traps, 1 male 19.VI-1.VII.2007 leg. Fiori F.

(ISE). Tonara, Su Azzime, m 682, walnut-orchard,

pitfall traps, 1 female 21-28.VI.2007 leg. I.S.E. (ISE).

Micaria coarctata (Lucas, 1 846)

Chorotype. Centralasiatic-Mediterranean.

References. (8) Costa, 1884 (sub M. smarag-

dula ); (13) Gameri, 1902 (sub M. smaragdula ).

Province. Medio Campidano (ined.); Nuoro

(ined.); Sassari (8, 13).

Habitat. Cherry-orchard (ined.); garrigue (ined.);

mining landfills covered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining landfills

covered by pioneer plants, 1 female 29. VI-

14.VII.2009, 1 male 4-16.VI.2009 (ISE); m 200,

garrigue, 1 male 16-29.VI.2009 (ISE) (all pitfall

traps and leg. Sassu A., Verdinelli M.). Guspini .

Montevecchio, Piccalinna, m 235, garrigue, pitfall

traps, 1 male 15-30.VI.2009 (ISE), 1 male 15-

30.VI.2009 (MBG) (all leg. Sassu A., Verdinelli M.).

NUORO: Belvi, Antonitzo, m 683, cherry-or-

chard, pitfall traps, 1 female 17-24. VII. 2007 leg.

I.S.E. (ISE).

* Micaria cyrnea Brignoli, 1983

Chorotype. Mediterranean.

Habitat. Forest of Quercus suber (ined.); wal-

nut-orchard (ined.).

Examined material. NUORO: Belvi . Canale e'

Figu, m 576, walnut- orchard, bark traps, 1 male

26.IV-4.V.2007 leg. I.S.E. (ISE).

OLBIA-TEMPIO: Budduso . near Nuraghe Lo-

elle, forest of Quercus suber , beating tray, 1 female,

24. V. 1999, leg. 1st. Ent. SS (ISE).

Micaria pulicaria (Sundevall, 1831)

Chorotype. Holarctic.

References. (13) Gameri, 1902.

Province. Cagliari (13).

Nomisia aussereri (L. Koch, 1872)

Chorotype. Palearctic.

References. (20) Krauss, 1955; (76) Grimm,

1985; (84) Pesarini, 1994.

Province. (76, 84); Nuoro (76); Sassari (20).

Nomisia exornata (C.L. Koch, 1839)

Chorotype. Turano-European.

References. (13) Gameri, 1902 (sub Pythonissa

exornata)', (76) Grimm, 1985; (84) Pesarini, 1994.

Province. (13, 84); Cagliari (13); Carbonia-

Iglesias (76); Medio Campidano (ined.); Nuoro

(ined.); Nuoro/Ogliastra (13).

Habitat. Road verge (6); garrigue (ined.); mediter-

ranean maquis (ined.); walnut-orchard (ined.); mi-

ning landfills covered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, 1 male 4- 16. VI. 2009, 1 female 10-

25. VIII. 2009 (ISE); m 170, mining landfills cov-

ered by pioneer plants, 8 males, 3 females and 2 juv.

19.V-4.VI.2009 (ISE), 1 male and 1 female 4-

16.VI.2009 (MBG), 7 males and 2 females 4-

16.VI.2009, 4 females 16-29.VI.2009, 3 females

29.VI-14.VII.2009 (ISE); m 200, garrigue, 6 males

and 2 females 19.V-4.VI.2009, 1 female 29. VI-

14. VII.2009, 2 males 4-16.VI.2009 (ISE) (all pit-

fall traps and leg. Sassu A., Verdinelli M.). Guspini .

Montevecchio, Piccalinna, m 225, mining landfills

covered by pioneer plants, 1 female 30. VI-

13.VII.2009, 1 male 3-15.VI.2009 (ISE); m 235,

garrigue, pitfall traps, 3 males 18.V-3.VI.2009 (ISE)

(all pitfall traps and leg. Sassu A., Verdinelli M.).

NUORO: Belvi . Canale e' Figu, m 576, walnut-

orchard, pitfall traps, 2 males 2 1-28. VI. 2007 leg.

I.S.E. (ISE).

* Nomisia recepta (Pavesi, 1880)

Chorotype. W-Mediterranean.

Habitat. Garrigue (ined.); mediterranean maquis

(ined.); mining landfills covered by pioneer plants

(ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, 1 female 14-28. VII.2009 (ISE), m 170; mi-

ning landfills covered by pioneer plants, 1 male 4-

16.VI.2009, 1 male 16-29.VI.2009, 4 females

29. VI- 14. VII.2009, 1 female 14-28.VII.2009, 2 fe-

males 10-25. VIII. 2009 (ISE); m 200, garrigue, 2

P. Pantini, A. Sassu & G. Serra

males and 1 female, 19.V-4.VI.2009, 2 males and 1

female 16-29.VI.2009, 2 females 14-28.VII.2009,

1 female 10-25.VIII.2009 (ISE) (all pitfall traps and

leg. Sassu A., Verdinelli M.). Guspini . Montevec-

chio, Piccalinna, m 225, mining landfills covered

by pioneer plants, 1 male 3-15.VI.2009 (ISE); m

260, mediterranean maquis, 1 male 18.V-3.VI.2009,

1 female 15-30.VI.2009, 1 male, 30.VI-

13.VII.2009, 1 male 3-15.VI.2009 (ISE), 1 male

and 1 female 15-30.VI.2009 (MBG), 1 female 13-

27.VII.2009, 1 female 27.VII-10.VIII.2009, 1 fe-

male 10-25. VIII. 2009 (ISE) (all pitfall traps and

leg. Sassu A., Verdinelli M.).

*Phaeocedus braccatus (L. Koch, 1866)

Chorotype. Palearctic.

Habitat. Mining landfills covered by pioneer

plants (ined.).

Examined material. MEDIO CAMPIDANO:

Guspini . Montevecchio, Piccalinna, m 225, mining

landfills covered by pioneer plants, pitfall traps, 1 fe-

male 3-15.VI.2009 leg. Sassu A., Verdinelli M. (ISE).

Poecilochroa albomaculata (Lucas, 1 846)

Chorotype. W-Mediterranean.

References. (13) Garneri, 1902 (sub Poecilo-

chroa picta ); (84) Pesarini, 1994.

Province. (84); Cagliari (13); Ogliastra (13);

Oristano (13).

Scotophaeus blackwalli (Thorell, 1871)

Chorotype. Subcosmopolitan.

References. (94) Amo et al., 1998; (127) Lom

et al., 2008.

Province. (127); Cagliari (ined.); Medio-Cam-

pidano (ined.); Nuoro (ined.); Olbia-Tempio (ined.);

Sassari (94, ined.).

Habitat. Citrus-grove (ined.); avenue of lime

trees (94); orchard (ined.); mediterranean maquis

(ined.); hazelnut-orchard (127, ined.); pinewood

(ined.); forest of Quercus suber (ined.).

Examined material. CAGLIARI: Pula . Pixina

Manna, m 140, pinewood, emergence cages, 1 male,

30.VI.2009 leg. 1st. Ent. SS (ISE). Uta, S’Appassiu,

Agris farm, citms-grove, beating tray, 1 female

23.X.2000, 1 female, 2.XI.2000 leg. CRAS (ISE).

MEDIO CAMPIDANO: Guspini . Montevecchio,

Piccalinna, m 260, mediterranean maquis, pitfall

traps, 1 male, 18.V-3.VI.2009, leg. Sassu A., Ver-

dinelli M. (ISE).

NUORO: Belvi, Su Enazzu, m 550, hazelnut-or-

chard, bark traps, 1 female 25.V-1.VI.2005 leg.

I.S.E. (ISE).

OLBIA-TEMPIO: Budduso . near Nuraghe Lo-

elle, forest of Quercus suber , beating tray, 1 female

31.V.1999 leg. 1st. Ent. SS (ISE).

SASSARI: Sorso . Pianu Mannu, Nali farm, or-

chard, bark traps, 1 male and 1 female 24-

3 l.VII. 1997 leg. 1st. Ent. SS (ISE).

Scotophaeus scutulatus (L. Koch, 1866)

Chorotype. Sibero-European.

References. (133) Trotta, 2009.

Province. Cagliari (ined.); Nuoro (ined.);

Olbia-Tempio (133); Oristano (ined.); Sassari

(ined.).

Habitat. Citms-grove (ined.); on trees lining a

street (ined.); orchard (ined.); hazelnut-orchard

(ined.).

Examined material. CAGLIARI: Uta, S’Appas-

siu, Agris farm, citms-grove, beating tray, 1 female,

2.XI.2000, 1 female 13.XI.2000 leg. CRAS (ISE).

NUORO: Belvi . Su Enazzu, m 550, hazelnut-or-

chard, bark traps, 1 female 20-27. X.2004 leg. I.S.E.

(ISE). Gavoi, 1 male 14.IX.2009 leg. Mulas A.

(UCA).

ORISTANO: San Vero Milis . Mandriola, 1 fe-

male 29.V.2005, 1 female 21.VIII.2008 leg. Mulas

A. (UCA).

SASSARI: Alghero . inside house, at sea level, 1

male 31. IX. 1998 leg. Pantaleoni R.A. (ISE). Sas-

sari . m 522, on trees lining a street, bark traps, 1 fe-

male 10.XI.1993 leg. 1st. Ent. SS (ISE). Sorso .

Pianu Mannu, Nali farm, orchard, bark traps, 1

male, 18-25.IX.1997, 1 female 24.XI-2.XII. 1997

leg. 1st. Ent. SS (ISE).

Scotophaeus validus (Lucas, 1 846)

Chorotype. Mediterranean.

References. (20) Krauss, 1955; (84) Pesarini,

1994; (127) Lom et al., 2008.

Province. (20, 84, 127); Nuoro (ined.).

Habitat. Hazelnut-orchard (127, ined.).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, bark traps, 1 fe-

male 29.IX-6.X.2005 leg. I.S.E. (ISE).

Setaphis carmeli (O.P.-Cambridge, 1872)

Chorotype. Mediterranean.

References. (2b) Canestrini, 1873 (sub Mela-

nophora latipes ); (11) de Carlini, 1885 (sub Pro-

sthesima latipes ); (13) Gameri, 1902 (sub

Prosthesima latipes and sub Prosthesima brachia-

lis, n. sp.); (20) Krauss, 1955 (sub Zelotes carmeli)',

(84) Pesarini, 1994 (sub Zelotes carmeli ).

Province. (20, 2b, 84); Carbonia-Iglesias (11,

13); Medio Campidano (ined.); Nuoro (ined.);

Ogliastra (13).

Habitat. Cheny-orchard (ined.); garrigue (ined.);

hazelnut-orchard (ined.); walnut-orchard (ined.);

mining landfills covered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining lan-

dfills covered by pioneer plants, 1 male 21.IV-

5.V.2009 (ISE), 1 male 5-19.V.2009 (MBG), 1

male, 5-19.V.2009 (ISE); m 200, garrigue, 1 male

and 1 female, 19.V-4.VI.2009 (ISE) (all pitfall traps

and leg. Sassu A., Verdinelli M.). Guspini . Monte-

vecchio, Piccalinna, m 235, garrigue, pitfall traps,

4 males, 5-18.V.2009 (ISE), 1 female, 18.V-

3. VI. 2009. (MBG), 1 female, 30.VI-13.VII.2009

(ISE) (all leg. Sassu A., Verdinelli M.).

NUORO: Belvi, Antonitzo, m 683, cherry-or-

chard, 1 male 21-28.VI.2007 (ISE); Canale e' Figu,

m 576, walnut-orchard, 1 male and 1 female 16-

23.V.2007, 2 females 21-28.VI.2007 (ISE); Manna-

ritzo, m 706, cherry-orchard, 1 male 18-26.IV.2007,

4 males 16-23.V.2007, 2 males and 1 female 21-

28.VI.2007 (ISE); Su Enazzu, m 550, hazelnut-or-

chard, 1 female 27.VII-8.VIII.2006, 2 females

13-27.VII.2006 (MBG), 3 females 13-27.VII.2006

(ISE), 1 female 8-24.VIII.2006 (MBG) (all pitfall

traps and leg. I.S.E.).

* Setaphis parvula (Lucas, 1846)

Chorotype. W-Mediterranean.

Habitat. Garrigue (ined.); mining landfills cov-

ered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus, Ingurtosu, Naracauli, m 170, mining land-

fills covered by pioneer plants, 1 male 19.V-

4. VI. 2009 (MBG), 1 male 5-19.V.2009 (ISE); m

200, garrigue, 1 male 19.V-4.VI.2009 (ISE) (all pit-

fall traps and leg. Sassu A., Verdinelli M.).

Remarks. This data represents the first record

for Italian fauna.

Trachyzelotes barbatus (L. Koch, 1866)

Chorotype. Holarctic.

References. (10) Costa, 1885 (sub Prosthesima

barb at a).

Province. Carbonia-Iglesias (10); Medio Cam-

pidano (ined.); Nuoro (ined.).

Habitat. Cherry-orchard (ined.); garrigue (ined.);

mining landfills covered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining land-

fills covered by pioneer plants, 1 male 19.V-

4. VI. 2009 (MBG), m 200; garrigue, 1 male

21.IV-5.V.2009, 5 males 5-19.V.2009, 1 male and

1 female 19.V-4.VI.2009, 1 female 4-16.VI.2009

(ISE) (all pitfall traps and leg. Sassu A., Verdinelli

M.). Guspini . Montevecchio, Piccalinna, m 235,

garrigue, pitfall traps, 1 male 21.IV-5.V.2009, 1

male 18.V-3.VI.2009 (ISE), 1 male and 3 females,

30.VI-13.VII.2009 (MBG), 2 females 30.VI-

13.VII.2009, 2 males 3-15.VI.2009, 2 males and

1 female 15-30.VI.2009, 3 females 27. VII-

10.VIII.2009, 1 female 13-27.VII.2009, 1 male 6-

20.X.2009 (ISE) (all leg. Sassu A., Verdinelli M.).

NUORO: Belvi . Antonitzo, m 683, cherry-or-

chard, 1 male, 17-24.VII.2007 (ISE); Mannaritzo,

m 706, cherry-orchard, 1 male 2 1-28. VI. 2007

(ISE) (all pitfall traps and leg. I.S.E.).

Trachyzelotes f us cipes (L. Koch, 1866)

Chorotype. Centralasiatic-European.

References. (13) Garneri, 1902 (sub Prosthe-

sima fus cipes).

Province. Cagliari (13).

* Trachyzelotes pedestris (C.L. Koch, 1837)

Chorotype. European.

Habitat. Orchard (ined.).

Examined material. S AS SARI: Sorso . Pianu

Mannu, Nali farm, orchard, pitfall traps, 1 male and

P. Pantini, A. Sassu & G. Serra

1 female, 26.VI-2.VII. 1997, 1 male 10-17.VII.1997,

1 male 11-19.VI.1998 leg. 1st. Ent. SS (ISE).

Urozelotes rusticus (L. Koch, 1872)

Chorotype. Cosmopolitan.

References. (10) Costa, 1885 (sub Prosthesima

rustica).

Province. Cagliari (10).

*Zelotes dentatidens Simon, 1914

Chorotype. W-Mediterranean.

Habitat. Mining landfills covered by pioneer

plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining

landfills covered by pioneer plants, pitfall traps,

2 females 5-19.V.2009, 1 female 19.V-4.VI.2009

(ISE), 1 male and 1 female 19.V-4.VI.2009 (MBG),

1 male and 1 female 4- 16. VI. 2009, 2 females 16-

29.VI.2009 (ISE) (all leg. Sassu A., Verdinelli M.).

Guspini . Montevecchio, Piccalinna, m 225, mining

landfills covered by pioneer plants, pitfall traps, 1

male 21.IV-5.V.2009, 1 male 5-18.V.2009. (MBG),

1 male and 2 females, 18.V-3.VI.2009, 3 females

30.VI-13.VII.2009, 1 male and 3 females 15-

30.VI.2009 (ISE), 2 females 30.VI-13.VII.2009

(MBG), 1 male and 1 female 3-15.VI.2009 (ISE),

1 male and 2 females 3-15.VI.2009 (MBG), 2 fe-

males 27.VII-10.VIII.2009 (ISE), 1 female 13-

27.VII.2009, 1 female 25.VIII-8.IX.2009 (MBG),

1 female 10-25.VIII.2009 (ISE) (all leg. Sassu A.,

Verdinelli M.).

Remarks. The epigynum and the male palp of

this species are illustrated in figures 12, 13.

*Zelotes egregius Simon, 1914

Chorotype. W-Mediterranean.

Habitat. Under Juniperus sp. (ined.).

Examined material. NUORO: Desulo . Gennar-

gentu, mountain refuge, m 1500, under Juniperus

sp., pitfall traps, 1 male 23.VIII-5.IX.2006 leg. Fiori

F. (ISE). Fonni . Gennargentu, mountain refuge, m

1550, under Juniperus sp., pitfall traps, 1 male 2-

17.VIII.2006 leg. Fiori F. (ISE).

Figures 12, 13. Zelotes dentatidens Simon, 1914 (scale 0.2 mm): (12) epigyne, ventral view, Guspini (VS), Montevecchio,

Piccalinna m 225, 3-15.VI.2009 leg. Sassu A., Verdinelli M.; (13) ventral view of left male pedipalp, Arbus (VS), Ingurtosu,

Naracauli m 120, 19.V-4.VI.2009 leg. Sassu A., Verdinelli M.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Zelotes femellus (L. Koch, 1866)

Chorotype. S-European.

References. (20) Krauss, 1955; (111) Senglet,

2004.

Province. (20); Cagliari (111); Nuoro (ined.);

Ogliastra (111); Olbia-Tempio (111); Sassari (111).

Habitat. Hazelnut-orchard (ined.); walnut-or-

chard (ined.).

Examined material. NUORO: Belvi . Canale e'

Figu, m 576, walnut-orchard, 3 males, 27. IX-

4.X.2007 (ISE), Su Enazzu, m 550, hazelnut-or-

chard, 1 male, 21.IX-5.X.2006 (ISE) (all pitfall

traps and leg. I.S.E.). Gavoi, S'eremu e sa mela, m

1000, 1 female 10.V.2005, 1 female 16.11.2006, 1

female 13.III.2006, 1 female 18.IX.2006 leg.

Mulas A. (UCA).

Zelotes fuscorufus (Simon, 1878)

Chorotype. W-Mediterranean.

References. (Ill) Senglet, 2004; (139) Trotta,

2011.

Province. Medio Campidano (ined.); Oristano

(111); Sassari (111, 139).

Habitat. Dry litter on sand (111); dry litter,

barks (111); garrigue (ined.); mediterranean maquis

(ined.); mining landfills covered by pioneer plants

(ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, 2 males, 16-29.VI.2009, 3 males and 1 fe-

male 29.VI-14.VII.2009, 2 females 28.VII-

10.VIII.2009, 1 male and 2 females, 14-28.VII.2009,

1 female 10-25.VIII.2009, 1 female 25. VIII-

8.IX.2009 (ISE); m 170, mining landfills covered by

pioneer plants, 1 female 16-29. VI. 2009, 1 female

29. VI-14.VII.2009, 1 male and 2 females 14-

28.VII.2009 (ISE); m 200, garrigue, 1 female 29.VI-

14.VII.2009 (ISE), 1 female 28.VII-10.VIII.2009

(MBG), 1 female 14-28.VII.2009 (ISE) (all pitfall

traps and leg. Sassu A., Verdinelli M.). Guspini .

Montevecchio, Piccalinna, m 225, mining landfills

covered by pioneer plants, 2 males and 2 females

30. VI-13.VII.2009, 1 male 15-30.VI.2009, 2 fema-

les 27.VII-10.VIII.2009, 1 male and 1 female 13-

27.VII.2009 (ISE); m 235, garrigue, 1 female

13-27. VII. 2009 (ISE); m 260, mediterranean ma-

quis, 3 males 15-30.VI.2009 (ISE), 1 female 30.VI-

13.VII.2009 (MBG), 1 male 3-15.VI.2009 (ISE), 2

males 3-15.VI.2009 (MBG), 1 female 30.VI-

13. VII.2009, 4 females 13-27.VII.2009, 1 female

27. VII-10.VIII.2009 (ISE) (all pitfall traps and leg.

Sassu A., Verdinelli M.).

Zelotes nilicola (O.P. -Cambridge, 1874)

Chorotype. Holarctic.

References. (132) Pantini & Sassu, 2009.

Province. Medio-Campidano (ined.); Nuoro

(ined.); Sassari (132, ined.).

Habitat. Cherry-orchard (ined.); orchard (ined.);

walnut-orchard (ined.); mining landfills covered by

pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining landfills

covered by pioneer plants, pitfall traps, 2 females

29.VI-14.VII.2009 leg. Sassu A., Verdinelli M. (ISE).

NUORO: Belvi . Canale e' Figu, m 576, walnut-

orchard, 1 male and 3 females 21-28.VI.2007, 2 fe-

males 17-24. VII. 2007 (ISE); Mannaritzo, m 706,

cherry-orchard, 1 male 21-28.VI.2007 (ISE) (all pit-

fall traps and leg. I.S.E.).

SASSARI: Sorso . Pianu Mannu, Nali farm, or-

chard, pitfall traps, 1 male 26.VI-2.VII. 1997 leg.

1st. Ent. SS (ISE).

Zelotes ruscinensis Simon, 1914

Chorotype. W-Mediterranean.

References. (Ill) Senglet, 2004; (139) Trotta,

2011.

Province. Carbonia-Iglesias (139); Medio

Campidano (ined.); Oristano (ined.); Sassari (111).

Habitat. Garrigue (ined.); mining landfills co-

vered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining landfills

covered by pioneer plants, 1 male 16-29.VI.2009,

12 males 29.VI-14.VII.2009, 7 females 28.VII-

10.VIII.2009, 7 males and 1 female, 14-

28. VII.2009, 2 females 10-25.VIII.2009 (ISE), 2

females 10-25.VIII.2009 (MBG), 2 females 25. VIII-

8.IX.2009, 1 female 8-22.IX.2009 (ISE); m 200,

garrigue, 23 males 29.VI-14.VII.2009, 1 male 16-

29. VI.2009 (ISE), 5 males and 1 female, 29.VI-

14. VII. 2009 (MBG), 1 male and 20 females

28.VII-10.VIII.2009, 22 males and 11 females 14-

P. Pantini, A. Sassu & G. Serra

28.VII.2009, 7 females 25.VIII-8.IX.2009, 13 fe-

males 10-25.VIII.2009, 1 female 22.IX-6.X.2009

(ISE) (all pitfall traps and leg. Sassu A., Verdinelli

M.). Guspini . Montevecchio, Piccalinna, m 225, mi-

ning landfills covered by pioneer plants, 1 male

30.VI-13.VII.2009 (ISE); m 235, garrigue, 2 males

15-30.VI.2009, 9 males 30.VI-13.VII.2009, 4 males

and 6 females, 27.VII-10.VIII.2009, 14 males and 5

females 13-27.VII.2009 (ISE), 3 females 10-

25.VIII.2009 (MBG), 8 females 10-25.VIII.2009, 2

females 25.VIII-8.IX.2009, 2 females 22. IX-

6. X.2009, 4 females 8-22.IX.2009 (ISE) (all pitfall

traps and leg. Sassu A., Verdinelli M.).

ORISTANO: San Vero Milis . Mandriola, 1 male

7. VIII. 2004; Spinarbas 1 male 1.VII.2004 leg.

MulasA. (UCA).

Zelotes sardus (Canestrini, 1873)

Chorotype. Tyrrhenian endemic.

References. (2b) Canestrini, 1873 (sub Prosthe-

sima sarda ); (2c) Canestrini, 1876 (sub Prosthesima

sarda); (3) Pavesi, 1876 (sub Prosthesima sarda);

(13) Gameri, 1902 (sub Prosthesima sarda); (73)

Brignoli & Muiphy, 1984; (84) Pesarini, 1994; (111)

Senglet, 2004; (133) Trotta, 2009; (139) Trotta, 2011.

Province. (13, 2b, 2c, 84); Cagliari (13, 73);

Carbonia-Iglesias (3, 13, 139); Medio Campidano

(73, ined.); Nuoro (73, 111, ined.); Nuoro/Ogliastra

(13); Ogliastra (13, 111); Olbia-Tempio (73, 133);

Oristano (13, 111, ined.); Sassari (73, 111, ined.).

Habitat. Cherry- orchard (ined.); garrigue

(ined.); mediterranean maquis (ined.); walnut-or-

chard (ined.); under Juniperus sp. (ined.); mining

landfills covered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining landfills

covered by pioneer plants, 1 female 2 1 .IV-5 . V.2009,

1 female 19.V-4.VI.2009, 2 males 25.VIII-

8.IX.2009, 2 males 8-22.IX.2009, 1 male and 1 fe-

male 22.IX-6.X.2009 (ISE); m 200, garrigue, 5

females 21. IV-5. V.2009, 3 females 19.V-4.VI.2009,

2 females 5-19.V.2009, 1 female 16-29.VI.2009, 1

female 14-28.VII.2009, 1 male 25.VIII-8.IX.2009,

3 males 8-22.IX.2009, 7 males 22.IX-6.X.2009, 5

males 6-20.X.2009 (ISE) (all pitfall traps and leg.

Sassu A., Verdinelli M.). Guspini . Montevecchio,

Piccalinna, m 225, mining landfills covered by pio-

neer plants, 2 females 21. IV-5 .V.2009, 2 females 5-

18. V.2009, 1 female 18.V-3.VI.2009, 2 females 15-

30.VI.2009, 1 male 10-25.VIII.2009, 2 males

25.VIII-8.IX.2009, 1 male 6-20.X.2009 (ISE); m

235, garrigue, 4 females 21. IV-5. V.2009, 2 females

5-18. V.2009, 1 female 3-15.VI.2009, 2 males 10-

25.VIII.2009, 14 males 25.VIII-8.IX.2009, 10 males

and 1 female 8-22. IX. 2009, 6 males 22. IX-

6.X.2009, 1 male and 1 female 6-20.X.2009 (ISE);

m 260, mediterranean maquis, 1 female 3-

15.VI.2009 (ISE) (all pitfall traps and leg. Sassu A.,

Verdinelli M.).

NUORO: Belyi, Antonitzo, m 683, cherry-or-

chard, 4 males 24-30.VIII.2007, 2 males 27.IX-

4.X.2007 (ISE); Canale e' Figu, m 576,

walnut-orchard, 1 male 24-30.VIII.2007 (ISE); Man-

naritzo, m 706, cherry-orchard, 1 female 11-

18.IV.2007, 1 female 16-23.V.2007, 2 males

24-30. VIII.2007, 2 males 4-11.X.2007 (all pitfall

traps and leg. I.S.E.). Desulo, Gennargentu, mountain

refuge, m 1500, under Juniperus sp., pitfall traps, 1

male 11-25.VII.2006, 1 male 25.VII-9.VIII.2006

leg. Fiori F. (ISE). Fonni . Gennargentu, mountain re-

fuge, m 1550, under Juniperus sp., pitfall traps, 1

male 19.VII-2.VIII.2006, 3 males 2-17.VIII.2006, 1

female 5-19.VI.2007, leg. Fiori F. (ISE). Siniscola .

Monte Albo, on the road to Lula, m 800, pitfall traps,

1 female 1 9-26.1 V.2003, leg. Pantini P, Magnati F.

(MBG). Tonara, Su Azzime, m 682, walnut-orchard,

pitfall traps, 2 females 16-23.V.2007, 1 female 21-

28.VI.2007, 1 female 17-24.VII.2007, 1 female 24-

30.VIII.2007, 1 female 4-1 1.X.2007 leg. I.S.E. (ISE).

OLBIA-TEMPIO: Olbia . Isola Molarotto, 1 fe-

male 18.V.1966 leg. Gruppo Isole C.N.R. (MBG).

ORISTANO: Cabras, Isola Mai di Ventre, 5 fe-

males 17-18.IV.2006 leg. MulasA. (UCA).

Zelotes tenuis (L. Koch, 1866)

Chorotype. Holarctic.

References. (133) Trotta, 2009; (137) Senglet,

2011.

Province. Cagliari (137); Medio- Campidano

(ined.); Nuoro (137, ined.); Ogliastra (137); Olbia-

Tempio (133); Sassari (137).

Habitat. Cherry-orchard (ined.); dam leaf litter

(137); lagoon (137); hazelnut-orchard (ined.); wal-

nut-orchard (ined.); under Juncus (137); mining

landfills covered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Guspini , Montevecchio, Piccalinna, m 225, mining

landfills covered by pioneer plants, pitfall traps, 2

females 30.VI-13.VII.2009, 3 males and 2 females

15-30.VI.2009, 1 male 3-15.VI.2009, 2 females 13-

27.VII.2009 leg. Sassu A., Verdinelli M. (ISE).

NUORO: Belvi, Antonitzo, m 683, cherry-or-

chard, 4 males 2 1-28. VI. 2007, 1 female 17-

24.VII.2007 (ISE); Canale e' Figu, m 576,

walnut-orchard, 2 males 21-28.VI.2007, 2 males and

1 female 17-24.VII.2007, 1 female 24-30. VIII.2007

(ISE); Mannaritzo, m 706, cherry-orchard, 1 female

21-28.VI.2007 (ISE); Su Enazzu, m 550, hazelnut-

orchard, 1 female 27. VII-8. VIII. 2006, 1 male and 1

female 13-27.VII.2006 (MBG), 1 male and 1 female

13-27.VII.2006 (ISE), 1 female 8-24.VIII.2006

(MBG) (all pitfall traps and leg. I.S.E.).

Family SPARASSIDAE

Micrommata ligurina (C.L. Koch, 1845)

Chorotype. Mediterranean.

References. (6) Magretti, 1880; (10) Costa,

1885; (13) Garneri, 1902; (20) Krauss, 1955; (84)

Pesarini, 1994; (114) Grill et al., 2005; (139)

Trotta, 2011.

Province. (20, 84, 114); Cagliari (13); Carbo-

nia-Iglesias (6, 13, 139); Nuoro (ined.); Ogliastra

(13); Oristano (10).

Habitat. Grass and shurbland (114); walnut-or-

chard (ined.).

Examined material. NUORO: Tonara, Su Az-

zime, m 682, walnut-orchard, pitfall traps, 1 male

18-26.IV.2007 leg. I.S.E. (ISE).

Micrommata virescens (Clerck, 1757)

Chorotype. Palearctic.

References. (6) Magretti, 1880; (10) Costa,

1885; (13) Gameri, 1902; (84) Pesarini, 1994; (132)

Pantini & Sassu, 2009.

Province. (10, 84); Oristano (13); Orista-

no/Nuoro (6); Sassari (13, 132).

Olios argelasius (Walckenaer, 1805)

Chorotype. Mediterranean.

References. (8) Costa, 1884 (sub O. spongitar-

sis ); (13) Gameri, 1902 (sub Sparassus spongitar-

tis ); (127) Lom et al., 2008; (132) Pantini & Sassu,

2009; (139) Trotta, 2011.

Province. (127); Cagliari (13, ined.); Carbonia-

Iglesias (139); Medio Campidano (139, ined.);

Nuoro (8); Oristano (8, ined.); Sassari (132).

Habitat. Citms-grove (ined.); mediterranean

maquis (ined.); hazelnut-orchard (127).

Examined material. CAGLIARI: Domus de

Maria . Punta su Pisu, m 14, 1 male and 1 female

XII. 2006 leg. Ruzzante-Wilkins J. (MBG). Uta,

S’Appassiu, Agris farm, citms-grove, beating tray,

1 female, 29.VI.2000, 1 female 10.VIII.2000, 1 fe-

male 1. IX. 2000, 2 males 21. IX. 2000, 1 female

12.X.2000, 1 male 4.X.2000, 1 female 2.XI.2000,

1 female 13.XI.2000 leg. CRAS (ISE).

MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-

cauli, m 120, mediterranean maquis, pitfall traps, 1

male 21.IV-5.V.2009 leg. Sassu A., Verdinelli M.

(ISE). Guspini . Montevecchio, Piccalinna, m 260,

mediterranean maquis, pitfall traps, 1 male 3-

15.VI.2009 leg. Sassu A., Verdinelli M. (ISE).

ORISTANO: Cabras . San Giovanni in Sinis, 1

male, 26.IV.2003, leg. Pantini P., Magnati F. (MBG).

Family PHILODROMIDAE

Philodromus aureolus (Clerck, 1757)

Chorotype. Palearctic.

References. (8) Costa, 1884; (13) Gameri,

1902; (84) Pesarini, 1994; (110) Muster & Thaler,

2004; (139) Trotta, 2011.

Province. (84); Cagliari (13); Carbonia-Igle-

sias (13, 139); Nuoro (8, 13); Ogliastra (13, 110).

Philodromus bistigma Simon, 1870

Chorotype. Mediterranean.

References. (10) Costa, 1885; (13) Gameri,

1902; (123) Muster et al., 2007; (132) Pantini &

Sassu, 2009.

Province. Cagliari (13, 123, ined.); Medio-

Campidano (ined.); Nuoro (123, ined.);

Nuoro/Ogliastra (123); Ogliastra (13, 123); Ori-

stano (10, 123); Sassari (132, ined.).

Habitat. Cherry-orchard (ined.); mediterranean

maquis (ined.); hazelnut-orchard (ined.).

P. Pantini, A. Sassu & G. Serra

Examined material. CAGLIARI: Pula . Is Can-

noneris, m 715, 1 female, 18.VIII.2006, leg. Ruz-

zante-Wilkins (MBG).

MEDIO CAMPIDANO: Arbus . Ingurtosu, Nara-

cauli, m 120, mediterranean maquis, pitfall traps, 1

male 4-16.VI.2009 leg. Sassu A., Verdinelli M. (ISE).

NUORO: Belvi, Mannaritzo, m 706, cherry-or-

chard, 1 female 21-28.VI.2007 (ISE); Su Enazzu,

m 550, hazelnut-orchard, 1 female 27. VII-

8. VIII. 2006, 1 male 30.V-4.VII.2007 (MBG), 2

males and 1 female 30.V-4.VII.2007 (ISE) (all pit-

fall traps and leg. I.S.E.).

S AS SARI: Olmedo . Pulpazos, Perlina farm, 1

male 8.V.2008 leg. R.A. Pantaleoni (ISE).

Philodromus blanckei (Wunderlich, 1995)

Chorotype. Sardinian endemic.

References. (87) Wunderlich, 1995b (sub Ar-

tanes blanckei)', (131) Muster, 2009.

Province. Nuoro (131, ined.); Ogliastra (87,

131); Olbia-Tempio (131); Oristano (131).

Habitat. Under the bark (87), hazelnut-orchard

(ined.).

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, beating tray, 1 fe-

male 4.V.2005 leg. I.S.E. (MBG).

* Philodromus bosmansi Muster & Thaler, 2004

Chorotype. W-Mediterranean.

Habitat. Citrus-grove (ined.).

Examined material. CAGLIARI: Uta, S’Ap-

passiu, Agris farm, citrus-grove, beating tray, 1 fe-

male 29.VI.2000 leg. CRAS (MBG).

Remarks. This data represents the first record

of this species for Italian and European fauna.

Philodromus buchari Kubcova, 2004

Chorotype. S-European.

References. (132) Pantini & Sassu, 2009.

Province. Sassari (132, ined.).

Examined material. SASSARI: Sassari . Li

Punti, Baldinca, m 110, 1 male 15. VI. 2008 leg.

Sassu A. (MBG).

* Philodromus buxi Simon, 1884

Chorotype. Sibero-European.

Habitat. Alder- grove (ined.).

Examined material. NUORO: Desulo, Gen-

nargentu, mountain refuge, m 1500, alder-grove,

bark traps, 3 females 25.VI-2.VII.2007 leg. Fiori

F. (ISE).

Philodromus dispar Walckenaer, 1 826

Chorotype. Holarctic.

References. (13) Gameri, 1902; (139) Trotta, 2011.

Province. Cagliari (13); Carbonia-Iglesias(139).

Philodromus emarginatus (Schrank, 1 803)

Chorotype. Palearctic.

References. (13) Gameri, 1902.

Province. (13); Ogliastra (13).

Philodromus fuscolimbatus Lucas, 1846

Chorotype. Mediterranean.

References. (10) Costa, 1885 (sub P. constel-

latus).

Province. Carbonia-Iglesias (10); Olbia-Tem-

pio (10).

Philodromus glaucinus Simon, 1870

Chorotype. European.

References. (10) Costa, 1885; (11) de Carlini,

1885; (13) Gameri, 1902; (123) Muster et al., 2007.

Province. Cagliari (13); Carbonia-Iglesias (10,

11, 13); Medio Campidano (123); Oristano (13);

Sassari (123).

Philodromus histrio (Latreille, 1819)

Chorotype. Holarctic.

References. (13) Gameri, 1902; (84) Pesarini,

1994.

Province. (13, 84); Sassari (ined.).

Habitat. Orchard (ined.).

Examined material. SASSARI: Sorso, Pianu

Mannu, Nali farm, orchard, bark traps, 1 male and

1 female 20-27.V.1998 leg. 1st. Ent. SS (ISE).

Philodromus lividus Simon, 1875

Chorotype. Mediterranean.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

References. (10) Costa, 1885; (13) Garneri,

1902; (110) Muster & Thaler, 2004; (114) Grill et

al., 2005; (127) Lorn et al., 2008; (132) Pantini &

Sassu, 2009; (139) Trotta, 2011.

Province. (114, 127); Cagliari (13, 110); Car-

bonia-Iglesias (10, 13, 139); Nuoro (ined.); Oglia-

stra (13, 110); Sassari (132, ined.).

Habitat. Low shurbs, grass and shurbland,

shurblands and trees (114); hazelnut-orchard (127,

ined.); olive-grove (ined.).

Examined material. NUORO: Belvh Su

Enazzu, m 550, hazelnut-orchard, beating tray, 1

male 29.VI.2005 leg. I.S.E. (MBG). Tiana . m 522,

hazelnut- orchard, beating tray, 1 male and 1 juv.

29. VI. 2005, 1 female and 2 juv. 16. VI. 2005 leg.

I.S.E. (ISE).

SASSARI: Sorso, Pianu Mannu, Nali farm,

olive -grove, beating tray, 1 male 3 .VI. 1993 leg. 1st.

Ent. SS (ISE).

Philodromus margaritatus (Clerck, 1757)

Chorotype. Palearctic.

References. (2c) Canestrini, 1876 (sub P. ele-

gans ); (131) Muster, 2009; (139) Trotta, 2011.

Province. (2c); Medio Campidano (139);

Nuoro (131).

Remarks. For the correct assignment of Cane-

strini’s citation (1876) see Muster (2009: 149).

Philodromus praedatus O.P. -Cambridge, 1871

Chorotype. Sibero-European.

References. (94) Arno et al., 1998; (110) Mu-

ster & Thaler, 2004; (132) Pantini & Sassu, 2009.

Province. Medio-Campidano (ined.); Nuoro

(110); Ogliastra (110); Sassari (94, 132, ined.).

Habitat. Avenue of lime trees (94); orchard

(ined.); mediterranean maquis (ined.); vineyard

(ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 120, mediterranean

maquis, pitfall traps, 1 male, 16-29. VI. 2009, leg.

Sassu A., Verdinelli M. (ISE).

SASSARI: Sorso . Pianu Mannu, Nali farm, or-

chard, beating tray, 1 female 17.VII.1997 leg. 1st.

Ent. SS (ISE). Torralba . vineyard, 1 male and 1 fe-

male 24.V.1999 leg. 1st. Ent. SS (ISE).

Philodromus pulchellus Lucas, 1 846

Chorotype. Mediterranean.

References. (2c) Canestrini, 1876; (13) Gameri,

1902; (84) Pesarini, 1994; (123) Muster et al., 2007;

(127) Lorn et al., 2008; (132) Pantini & Sassu, 2009.

Province. (84, 127); Cagliari (2c, 13); Medio

Campidano (123); Nuoro (123, ined.); Olbia-Tem-

pio (123); Oristano (123); Sassari (123, 132).

Habitat. Hazelnut-orchard (127, ined.).

Examined material. NUORO: Tiana . m 522,

hazelnut-orchard, beating tray, 1 male 16.VI.2005

leg. I.S.E. (ISE).

Philodromus rufus Walckenaer, 1 826

Chorotype. Holarctic.

References. (94) Arno et al., 1998; (127) Lorn

et al., 2008.

Province. (127); Nuoro (ined.); Sassari (94,

ined.).

Habitat. Avenue of lime trees (94); orchard

(ined.); hazelnut-orchard (127, ined.); olive-grove

(ined.); vineyard (ined.).

Examined material. NUORO: Belvi, Su

Enazzu, m 550, hazelnut-orchard, beating tray, 2 fe-

males 1. VI. 2005 leg. I.S.E. (MBG). Tiana . m 522,

hazelnut-orchard, beating tray, 1 female 1.VI.2005

leg. I.S.E. (ISE).

SASSARI: Sorso . Pianu Mannu, Nali farm, olive-

grove, 1 male 29.IV. 1993 (ISE); olive-grove, beating

tray, 1 female 21.V.1993, 2 females and 4 juv.

25. VI.1993 (ISE); orchard, beating tray, 1 female

26. VI.1997 (ISE) (all leg. 1st. Ent. SS). Torralba . vine-

yard, 1 female 18.VI.1994, 1 female 15.VII.1995, 1

male and 1 female 24.V.1999 leg. 1st. Ent. SS (ISE).

Thanatus formicinus (Clerck, 1757)

Chorotype. Holarctic.

References. (13) Gameri, 1902.

Province. (13).

Thanatus oblongiusculus (Lucas, 1 846)

Chorotype. Sibero-European.

References. (10) Costa, 1885 (sub T. oblongiu-

sculus ); (84) Pesarini, 1994 (sub Paratibellus

oblongiusculus).

P. Pantini, A. Sassu & G. Serra

Province. (84); Cagliari (10).

Thanatus vulgaris Simon, 1870

Chorotype. Holarctic.

References. (8) Costa, 1884; (13) Gameri, 1902;

(84) Pesarini, 1994; (132) Pantini & Sassu, 2009.

Province. (84); Cagliari (13); Medio-Campi-

dano (ined.); Ogliastra (13); Sassari (8, 13, 132).

Habitat. Under stones on the beach (8); mining

landfills covered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining landfills

covered by pioneer plants, pitfall traps, 2 males,

19.V-4.VI.2009, 1 female 29.VI-14.VII.2009, 1 fe-

male 4-16.VI.2009 leg. Sassu A., Verdinelli M. (ISE).

Tibellus oblongus (Walckenaer, 1802)

Chorotype. Holarctic.

References. (10) Costa, 1885; (13) Garneri,

1902.

Province. Cagliari (10, 13); Oristano (13); Sas-

sari (10).

Family THOMISIDAE

Cozyptila blackwalli (Simon, 1875)

Chorotype. Sibero-European.

References. (13) Gameri, 1902 (sub Oxyptila

blackwalli ); (84) Pesarini, 1994 (sub Ozyptila

blackwalli Simon, 1875).

Province. (84); Cagliari (13); Sassari (ined.).

Habitat. Olive-grove (ined.).

Examined material. SASSARI: Sorso, Pianu

Mannu, Nali farm, olive-grove, beating tray, 1 fe-

male l.VII. 1993 leg. 1st. Ent. SS (ISE).

Diaea dorsata (Fabricius, 1777)

Chorotype. Sibero-European.

References. (13) Garneri, 1902.

Province. Cagliari (13).

Heriaeus hirtus (Latreille, 1819)

Chorotype. European.

References. (10) Costa, 1885 (sub H. hirsutus );

(11) de Carlini, 1885 (sub Misumena savignyi ); (13)

Gameri, 1902 (sub H. savignyi ); (20) Krauss, 1955;

(71) Loerbroks, 1983; (84) Pesarini, 1994.

Province. (20, 84); Cagliari (13); Carbonia-

Iglesias (11, 13); Nuoro (10, 71).

Misumena vatia (Clerclc, 1757)

Chorotype. Holarctic.

References. (11) de Carlini, 1885; (13) Gameri,

1902; (84) Pesarini, 1994; (127) Lorn et al., 2008.

Province. (84, 127); Carbonia-Iglesias (11, 13).

Habitat. Hazelnut-orchard (127).

Monaeses paradoxus (Lucas, 1 846)

Chorotype. S-European.

References. (114) Grill et al., 2005.

Province. (114).

Habitat. Agricultural land (114).

Ozyptila atomaria (Panzer, 1801)

Chorotype. Palearctic.

References. (13) Gameri, 1902 (sub Oxyptila

horticola ); (84) Pesarini, 1994.

Province. (84); Cagliari (13).

Ozyptila bicuspis Simon, 1932

Chorotype. W-Mediterranean.

References. (116) Helsdingen, 2005.

Province. Nuoro (116).

Habitat. Grassland along the mouth of the river

(116).

Ozyptila brevipes (Hahn, 1 826)

Chorotype. Sibero-European.

References. (13) Gameri, 1902 (sub Oxyptila

brevipes ); (84) Pesarini, 1994.

Province. (84); Cagliari (13); Oristano (13).

Ozyptila confluens (C.L. Koch, 1845)

Chorotype. S-European.

References. (3) Pavesi, 1876 (sub Oxyptila gut-

Catalogue of the spiders (Arachnida Araneae) of Sardinia

tulata ); (13) Gameri, 1902 (sub Oxyptila grata); (20)

Krauss, 1955; (84) Pesarini, 1994; (132) Pantini &

Sassu, 2009; (133) Trotta, 2009; (139) Trotta, 2011.

Province. (20, 84); Carbonia-Iglesias (139);

Medio Campidano (139, ined.); Nuoro (ined.); Olbia-

Tempio (3, 133); Oristano (13); Sassari (132, 133).

Habitat. Cheny-orchard (ined.); garrigue (ined.);

hazelnut-orchard (ined.); walnut-orchard (ined.);

minning landfills covered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining lan-

dfills covered by pioneer plants, 3 males 6-

20.X.2009 (ISE); m 200, garrigue, 2 males,

22.IX-6.X.2009 (ISE), 2 males and 1 female 6-

20.X.2009 (MBG), 1 male and 3 females 6-

20.X.2009 (ISE) (all pitfall traps and leg. Sassu A.,

Verdinelli M.). Guspini . Montevecchio, Piccalinna,

m 235, garrigue, pitfall traps, 5 males 22. IX-

6.X. 2009, 5 males 6-20.X.2009 (ISE), 2 males and

1 female 6-20.X.2009 (MBG) (all leg. Sassu A.,

Verdinelli M.).

NUORO: Belvi, Antonitzo, m 683, cherry-or-

chard, 2 males 24-30.VIII.2007, 1 male 27.IX-

4.X. 2007 (ISE); Canale e' Figu, m 576,

walnut-orchard, 1 female 26.IV-4.V.2007 (ISE); Su

Enazzu, m 550, hazelnut-orchard, 1 male 24.VIII-

5. IX. 2006 (MBG), 2 males 21.IX-5.X.2006 1. (ISE)

(all pitfall traps and eg. I.S.E.). Tonara, Su Azzime,

m 682, walnut-orchard, pitfall traps, 1 female 17-

24.VII.2007, 2 males 4-11.X.2007 leg. I.S.E. (ISE).

Ozyptila pauxilla (Simon, 1870)

Chorotype. W-Mediterranean.

References. (139) Trotta, 2011.

Province. Carbonia-Iglesias (139).

Ozyptila praticola (C.L. Koch, 1837)

Chorotype. Holarctic.

References. (13) Gameri, 1902.

Province. Cagliari (13).

*Ozyptila sanctuaria (O.P. -Cambridge, 1871)

Chorotype. European.

Habitat. Cherry-orchard (ined.); garrigue

(ined.); mining landfills covered by pioneer plants

(ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining land-

fills covered by pioneer plants, pitfall traps, 1 fe-

male 6-20.X.2009 leg. Sassu A., Verdinelli M.

(ISE). Guspini . Montevecchio, Piccalinna, m 225,

mining landfills covered by pioneer plants, 1 female

5-18.V.2009 (ISE); m 235, garrigue, 1 female 15-

30.VI.2009, 5 males 6-20.X.2009 (ISE) (all pitfall

traps and leg. Sassu A., Verdinelli M.).

NUORO: Belvi . Mannaritzo, m 706, cherry-or-

chard, pitfall traps, 1 male 19-26.XI.2007 leg. I.S.E.

(ISE).

Pistius truncatus (Pallas, 1772)

Chorotype. Sibero-European.

References. (85) Buchar & Thaler, 1995; (127)

Lom et al., 2008.

Province. (127); Nuoro (85); Olbia-Tempio

(ined.).

Habitat. Hazelnut-orchard (127); forest of

Quercus suber (ined.).

Examined material. OLBIA-TEMPIO: Bud-

duso, near Nuraghe Loelle, forest of Quercus suber,

beating tray, 1 female 24.V.1999 leg. 1st. Ent. SS

(ISE). Telti . Rio Almiddina, 1 male 20.V.2008 leg.

Sassu A. (ISE).

Runcinia grammica (C.L. Koch, 1837)

Chorotype. Subcosmopolitan.

References. (8) Costa, 1884 (sub R. lateralis );

(11) de Carlini, 1885 (sub R. lateralis); (13) Gar-

neri, 1902 (sub R. lateralis); (84) Pesarini, 1994

(sub R. lateralis); (114) Grill et al., 2005 (sub R. la-

teralis); (139) Trotta, 2011.

Province. (84, 114); Cagliari (8, 13); Carbonia-

Iglesias (11, 13, 139); Sassari (ined.).

Habitat. Shurblands and trees, agricultural land

(114); vineyard (ined.).

Examined material. SASSARI: Torralba . vine-

yard, 1 female 30. VII. 1994 leg. 1st. Ent. SS (ISE).

Synema globosum (Fabricius, 1775)

Chorotype. Palearctic.

References. (8) Costa, 1884 (sub S. globosa);

(11) de Carlini, 1885 (sub Diaea globosa); (13) Gar-

neri, 1902 (sub S. globosa); (20) Krauss, 1955; (46)

P. Pantini, A. Sassu & G. Serra

Themies, 1972; (84) Pesarini, 1994; (94) Amo et al.,

1998 (sub Synaema globosum ); (112) Thaler & Kno-

flach, 2004; (114) Grill et al., 2005; (127) Lora et

al., 2008; (132) Pantini & Sassu, 2009 (sub Synaema

globosum)', (133) Trotta, 2009; (139) Trotta, 2011.

Province. (13, 20, 84, 114, 127); Cagliari (139);

Carbonia-Iglesias (11, 46, 139); Medio Campidano

(139); Nuoro (ined.); Ogliastra (112, 139); Olbia-

Tempio (133, ined.); Oristano/Nuoro (8); Sassari

(94, 132, 133, ined.).

Habitat. Avenue of lime trees (94); hypogean

habitat (46); low shurbs, grass and shurbland,

shurblands and trees (114); hazelnut-orchard (127,

ined.); grassland (ined.); vineyard (ined.).

Examined material. NUORO: Belyi, Su

Enazzu, m 550, hazelnut-orchard, beating tray, 1 fe-

male 19.V.2005 leg. I.S.E. (MBG). Bolotana . Badde

e'Salighes, m 850, grassland, 1 female 27.V.2007

leg. Sassu A. (ISE).

OLBIA-TEMPIO: Telth Rio Almiddina, 1 male

20.V.2008 leg. Sassu A. (ISE).

SASSARI: Sassari . Platamona, at sea level, 1

male and 1 female 22. V.2008 leg. Sassu A. (ISE).

Torralba . vineyard, 1 male 28.V.1994 leg. 1st. Ent.

SS (ISE).

Thomisus onustus Walckenaer, 1805

Chorotype. Palearctic.

References. (8) Costa, 1884; (11) de Carlini,

1885; (13) Garneri, 1902 (sub T. albus Nomina

dubia); (20) Krauss, 1955; (84) Pesarini, 1994; (94)

Amo et al., 1998; (114) Grill et al., 2005; (132) Pan-

tini & Sassu, 2009.

Province. (13, 20, 84, 114); Carbonia-Iglesias

(11); Oristano/Nuoro (8); Sassari (94, 132, ined.).

Habitat. Avenue of lime trees (94); shurblands

and trees (114); vineyard (ined.).

Examined material. SASSARI: Sassari . Plata-

mona, at sea level, 2 males and 1 female 22. V.2008

leg. Sassu A. (ISE). Torralba . vineyard, 1 male

17.VI.1995 leg. 1st. Ent. SS (ISE).

Tmarus piochardi (Simon, 1866)

Chorotype. W-Mediterranean.

References. (114) Grill et al., 2005.

Province. (114).

Habitat. Shurblands and trees (114).

Tmarus staintoni (O.P.-Cambridge, 1873)

Chorotype. W-Mediterranean.

References. (127) Lora et al., 2008.

Province. (127); Cagliari (ined.); Nuoro (ined.);

Sassari (ined.).

Habitat. Orchard (ined.); hazelnut-orchard

(127, ined.); olive-grove (ined.).

Examined material. CAGLIARI: Pula . Is Can-

noneris, m 715, 1 female 18. VIII. 2006 leg. Ruz-

zante- Wilkins (MBG).

NUORO: Tiana . m 522, hazelnut-orchard, bea-

ting tray, 1 female 1. VI. 2005 (MBG), 1 female

29.VI.2005 (ISE) (all leg. I.S.E.).

SASSARI: Alghero . Mamuntanas, olivegrove,

chemical knockdown, 1 male 6.VIII.2009 (MBG),

1 male and 1 female 27. VIII. 2009, 2 females,

7.IX.2009 (ISE), 2 females, 3.X.2009 (MBG), 2 fe-

males 27.X.2009 (ISE) all leg. 1st. Ent. SS. Sassari .

Lu Buttangara, olive-grove, 3 females 30.IX.2008

leg. 1st. Ent. SS (ISE). Sorso . Pianu Mannu, Nali

farm, olive-grove, 1 female, 9.VII.1993, 1 female

6.VIII.1993 (ISE); orchard, 1 female 26.VI.1997

(ISE) (all beating tray and leg. 1st. Ent. SS).

Xysticus acerbus Thorell, 1872

Chorotype. Sibero-European.

References. (10) Costa, 1885.

Province. Cagliari (10); Nuoro (10, ined.).

Habitat. Cherry-orchard (ined.); hazelnut-or-

chard (ined.).

Examined material. NUORO: Belvi . Manna-

ritzo, m 706, cherry-orchard, 1 male 11-18.IV.2007

(ISE); Su Enazzu, m 550, hazelnut-orchard, 1 male

26.IV-30.V.2007 (ISE) (all pitfall traps and leg.

I.S.E.).

Xysticus audax (Schrank, 1803)

Chorotype. Palearctic.

References. (13) Garneri, 1902 (sub X. pini);

(84) Pesarini, 1994.

Province. (84); Cagliari (13); Ogliastra (13).

Xysticus bifasciatus C.L. Koch, 1837

Chorotype. Palearctic.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

References. (13) Gameri, 1902; (84) Pesarini,

1994.

Province. (84); Cagliari (13).

Xysticus bliteus (Simon, 1875)

Chorotype. Mediterranean.

References. (5) Pavesi, 1878; (13) Garneri,

1902; (84) Pesarini, 1994 (sub Ozyptila bliteo );

(132) Pantini & Sassu, 2009.

Province. (84); Medio Campidano (ined.);

Olbia-Tempio (5, 13); Sassari (132).

Habitat. Mining landfills covered by pioneer

plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining land-

fills covered by pioneer plants, pitfall traps, 2

males, 22.IX-6.X.2009 (ISE) 1 male 22.IX-

6.X.2009 (MBG), 1 male and 1 juv. 8-22.IX.2009

(ISE) (all leg. Sassu A., Verdinelli M.).

Xysticus bufo (Dufour, 1 820)

Chorotype. Mediterranean.

References. (3) Pavesi, 1876 (sub Oxyptila albi-

mana ); (13) Gameri, 1902 (sub Oxyptila bufo ); (84)

Pesarini, 1994; (89) Wunderlich, 1995d (sub Psam-

mitis bufo); (133) Trotta, 2009; (139) Trotta, 2011.

Province. (84); Cagliari (13); Carbonia-Iglesias

(3, 13, 133, 139); Medio Campidano (ined.); Nuoro

(ined.); Sassari (89, ined.).

Habitat. Cherry-orchard (ined.); garrigue

(ined.); olive-grove (ined.); mining landfills cov-

ered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining lan-

dfills covered by pioneer plants, pitfall traps, 1

male, 22.IX-6.X.2009, leg. Sassu A., Verdinelli M.

(MBG). Guspini . Montevecchio, Piccalinna, m

235, garrigue, pitfall traps, 1 male 22. IX-

6.X. 2009, 1 male 6-20.X.2009 leg. Sassu A., Ver-

dinelli M. (ISE).

NUORO: Belvi, Mannaritzd, m 706, cherry-or-

chard, pitfall traps, 1 male 4-11.X.2007 leg. I.S.E.

(ISE). Gavoi . S'eremu e sa mela, m 1000, 1 female

30.XII.2006 leg. Mulas A. (MBG).

SASSARI: Alghero . Mamuntanas, olivegrove,

chemical knockdown, 1 male 13.X.2009 leg. 1st.

Ent. SS (ISE). Sassari . Lu Buttangam, olive-grove,

chemical knockdown, 1 male 29. IX. 2008 leg. 1st.

Ent. SS (ISE).

Xysticus caperatus Simon, 1875

Chorotype. Mediterranean.

References. (10) Costa, 1885; (84) Pesarini,

1994.

Province. (84); Olbia-Tempio (10).

Xysticus cor Canestrini, 1873

Chorotype. S -European.

References. (2b) Canestrini, 1873; (2c) Cane-

strini, 1876; (13) Gameri, 1902; (18) Simon, 1932;

(84) Pesarini, 1994.

Province. (2b, 2c, 13, 18, 84).

Xysticus cristatus (Clerck, 1757)

Chorotype. Palearctic.

References. (13) Gameri, 1902; (84) Pesarini,

1994.

Province. (84); Cagliari (13).

*Xysticus erraticus (Blackwall, 1834)

Chorotype. European.

Habitat. Hazelnut-orchard (ined.); alder-grove

(ined.).

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, pitfall traps, 1 fe-

male 30.V-4.VII.2007 leg. I.S.E. (ISE). Fonni . Gen-

nargentu, mountain refuge, m 1550, alder-grove,

pitfall traps, 1 female 26.IX-10.X.2006, 7 males and

2 females 5-19.VI.2007, 1 male 19.VI-1.VII.2007

leg. Fiori F. (ISE).

Xysticus graecus C.L. Koch, 1837

Chorotype. Turano-European.

References. (84) Pesarini, 1994; (139) Trotta,

2011.

Province. (84); Nuoro (139).

Xysticus grallator Simon, 1932

Chorotype. Sardo-Corsican endemic.

P. Pantini, A. Sassu & G. Serra

References. (20) Krauss, 1955; (84) Pesarini,

1994; (139) Trotta, 2011.

Province. (84); Medio Campidano (139);

Olbia-Tempio (20).

*Xysticus ibex Simon, 1875

Chorotype. Centro-European.

Habitat. Orchard (ined.).

Examined material. S AS SARI: Sorso, Pianu

Mannu, Nali farm, orchard, pitfall traps, 1 male 10-

18.11.1998 leg. 1st. Ent. SS (ISE).

Xysticus kochi Thorell, 1872

Chorotype. Sibero-European.

References. (8) Costa, 1884; (13) Garneri,

1902; (20) Krauss, 1955; (84) Pesarini, 1994; (127)

Lorn et al., 2008.

Province. (20, 84, 127); Cagliari (8, 13); Nuoro

(8, 13, ined.); Oristano (13); Sassari (ined.).

Habitat. Cherry-orchard (ined.); orchard

(ined.); hazelnut-orchard (127, ined.).

Examined material. NUORO: Belyi, Manna-

ritzo, m 706, cherry- orchard, pitfall traps, 1 male

18-26.IV.2007, 2 males 16-23.V.2007 (ISE); Su

Ajone, m 585, hazelnut-orchard, beating tray, 1 fe-

male and 6 juv. 29. VI. 2005 (MBG), 1 female and 2

juv. E VI. 2005 (ISE) (all leg. I.S.E.).

OLBIA-TEMPIO: Olbia . Isola Molara, 2 fe-

males 25.11.1966 (MBG); Isola Tavolara, 1 female

24.11.1966 (MBG) (all leg. Gruppo Isole C.N.R.).

SASSARI: Sorso . Pianu Mannu, Nali farm, or-

chard, pitfall traps, 1 male 15-22.IV. 1998 leg. 1st.

Ent. SS (ISE).

Xysticus lanio C.L. Koch, 1835

Chorotype. Sibero-European.

References. (8) Costa, 1884; (13) Garneri,

1902; (84) Pesarini, 1994; (127) Lorn et al., 2008;

(139) Trotta, 2011.

Province. (8, 13, 84, 127); Carbonia-Iglesias

(139); Nuoro (ined.).

Habitat. Hazelnut-orchard (127, ined.).

Examined material. NUORO: Belyi, Su

Ajone, m 585, hazelnut-orchard, 1 male and 1 juv.

19.V.2005 (MBG), 1 male and 2 juv. 1.VI.2005,

1 female and 2 juv. 29. VI. 2005 (ISE), 1 male

1. VI. 2005 (MBG); Su Enazzu, m 550, hazelnut-

orchard, 2 females and 1 juv. 16. VI. 2005 (MBG)

(all beating tray and leg. I.S.E.). Fonni, Talesso,

1 male 21.V.2008 leg. Pantaleoni R.A. and Lorn

L. (ISE).

Xysticus luctuosus (Blackwall, 1836)

Chorotype. Holarctic.

References. (46) Thermes, 1972; (84) Pesarini,

1994.

Province. (84); Cagliari (46).

Habitat. Hypogean habitat (46).

Xysticus nubilus Simon, 1875

Chorotype. Mediterranean.

References. (18) Simon, 1932; (20) Krauss,

1955; (84) Pesarini, 1994.

Province. (18, 20, 84).

Xysticus parallelus Simon, 1873

Chorotype. Sardo-Corsican endemic.

References. (18) Simon, 1932.

Province. (18).

Xysticus sardiniensis (Wunderlich, 1995)

Chorotype. Sardinian endemic.

References. (8 9) Wunderlich, 1995d (sub

Psammitis sardiniensis).

Province. Nuoro (89).

Family SALTICIDAE

Aelurillus monardi (Lucas, 1 846)

Chorotype. Mediterranean.

References. (13) Garneri, 1902 (sub A. Mo-

nardi); (84) Pesarini, 1994; (115) Hansen, 2005;

(132) Pantini & Sassu, 2009.

Province. (84); Cagliari (13); Carbonia-Iglesias

(13); Nuoro (115); Olbia-Tempio (115); Sassari

(115, 132).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Aelurillus v-insignitus (Clerck, 1757)

Chorotype. Palearctic.

References. (13) Gameri, 1902 (sub Aelurops

insignita ); (84) Pesarini, 1994.

Province. (13, 84).

Asianellus festivus (C.L. Koch, 1834)

Chorotype. Palearctic.

References. (13) Garneri, 1902 (sub Aelu-

rops j estiva)', (84) Pesarini, 1994 (sub Aelurillus

festivus).

Province. (84); Cagliari (13).

Ballus armadillo (Simon, 1871)

Chorotype. W-Mediterranean.

References. (13) Gameri, 1902; (84) Pesarini,

1994; (127) Lom etal., 2008.

Province. (84, 127); Carbonia-Iglesias (13);

Nuoro (ined.).

Habitat. Hazelnut-orchard (127, ined.).

Examined material. NUORO: Belvi . Su Ajone,

m 585, hazelnut-orchard, 1 female 19.V.2005 (ISE),

1 female 29.VI.2005, 1 female 27.VII.2005 (MBG);

Su Enazzu, m 550, hazelnut-orchard, 1 female

19.V.2005 (ISE), 1 female 19.V.2005 (MBG) (all

beating tray and leg. I.S.E.).

Ballus chalybeius (Walckenaer, 1802)

Chorotype. European.

References. (13) Gameri, 1902 (sub B. depres-

sus); (84) Pesarini, 1994 (sub B. depressusf, (115)

Hansen, 2005 (sub B. depressusf, (127) Lom et al.,

2008; (132) Pantini & Sassu, 2009.

Province. (84, 127); Nuoro (ined.); Ogliastra

(13); Sassari (115, 132, ined.).

Habitat. Hazelnut-orchard (127, ined.); olive-

grove (ined.).

Examined material. NUORO: Belvi . Su Ajone,

m 585, hazelnut-orchard, beating tray, 1 female

1. VI. 2005 leg. I.S.E. (ISE).

SASSARI: Sorso, Pianu Mannu, Nali farm,

olive-grove, beating tray, 1 female l.VII. 1993 leg.

1st. Ent. SS (ISE).

Bianor albobimaculatus (Lucas, 1 846)

Chorotype. Afrotropico-Indo-Mediterranean.

References. (8) Costa, 1884 (sub Eris albobi-

maculata ); (13) Gameri, 1902 (sub Eris albo-bima-

culata); (20) Krauss, 1955; (84) Pesarini, 1994; (91)

Fontana et al., 1996; (115) Hansen, 2005.

Province. (20, 84, 91); Cagliari (8, 13); Nuoro

(115).

Habitat. Damp area (91).

Carrhotus xanthogramma (Latreille, 1819)

Chorotype. Palearctic.

References. (115) Hansen, 2005; (127) Lom et

al., 2008.

Province. (127); Cagliari (115); Nuoro (ined.).

Habitat. Hazelnut-orchard (127, ined.).

Examined material. NUORO: Belvi . Su Ajone,

m 585, hazelnut- orchard, 1 male 1.VI.2005 (ISE);

Su Enazzu, m 550, hazelnut-orchard, 1 male and 2

females 19.V.2005 (MBG) (all beating tray and leg.

I.S.E. ). Tiana, m 522, hazelnut-orchard, beating

tray, 1 female 4.V.2005 (MBG), 1 female 19.V.2005

(ISE) (all leg. I.S.E.).

Chalcoscirtus infimus (Simon, 1868)

Chorotype. Turano-European.

References. (115) Hansen, 2005; (116) Hel-

sdingen, 2005; (132) Pantini & Sassu, 2009.

Province. Medio Campidano (ined.); Nuoro

(116, ined.); Ogliastra (115, 116); Olbia-Tempio

(ined.); Oristano (ined.); Sassari (132, ined.).

Habitat. Coastal dunes (ined.); garrigue (ined.);

in drift (116); walnut- orchard (ined.); forest of

Quercus suber (ined.); vineyard (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 200, garrigue, pitfall

traps, 1 male 5-19.V.2009, 1 female 4-16.VI.2009

leg. Sassu A., Verdinelli M. (MBG).

NUORO: Belvi . Canale e' Figu, m 576, walnut-

orchard, 1 male, 21-28.VI.2007, leg. I.S.E. (MBG).

ORISTANO: Cabras . Sinis, at sea level, coastal

dunes, 4 males 20.IV.2003 leg. Pantini P, Magnati

F. (MBG).

OLBIA-TEMPIO: Budduso . near Nuraghe Loelle,

forest of Quercus suber, beating tray, 1 male

24.V.1999, leg. 1st. Ent. SS (ISE).

P. Pantini, A. Sassu & G. Serra

SASSARI: Torralba . vineyard, 1 male 6.V.1995,

1 female 20.V.1995 leg. 1st. Ent. SS (ISE).

Cyrba algerina (Lucas, 1846)

Chorotype. Afrotropico-Indo-Mediterranean.

References. (13) Gameri, 1902; (84) Pesarini,

1994; (115) Hansen, 2005; (139) Trotta, 2011.

Province. (84); Cagliari (115, 139); Nuoro

(ined.); Oristano (13); Sassari (115, ined.).

Examined material. NUORO: Dorgali . Cala Si-

sine, 1 male 21.IV.2003 leg. Ferrario E. (MBG).

SASSARI: Sassari . Li Punti, Baldinca, m 110, 1

male 23.V.2008 leg. Sassu A. (ISE).

*Dendryphantes hastatus (Clerck, 1757)

Chorotype. Sibero-European.

Examined material. SASSARI: Sassari, Plata-

mona, at sea level, 2 females, 22.V.2008, leg. Sassu

A. (ISE).

Euophrys frontalis (Walckenaer, 1802)

Chorotype. Palearctic.

References. (13) Gameri, 1902; (84) Pesarini,

1994.

Province. (84); Olbia-Tempio (13).

Euophrys gambosa (Simon, 1868)

Chorotype. Mediterranean.

References. (83) Pons, 1993; (116) Helsdin-

gen, 2005; (132) Pantini & Sassu, 2009.

Province. Medio Campidano (ined.); Nuoro

(83, 116); Sassari (132, ined.).

Habitat. Hypogean habitat (83); orchard

(ined.); garrigue (ined.); grassland along the mouth

of the river (116); olive-grove (ined.); mining land-

fills covered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining land-

fills covered by pioneer plants, pitfall traps, 1 male

19.V-4.VI.2009 leg. Sassu A., Verdinelli M.

(MBG). Guspini . Montevecchio, Piccalinna, m 225,

mining landfills covered by pioneer plants, 1 male

3-15.VI.2009 (MBG); m 235, garrigue, 1 male

18.V-3.VI.2009, 2 males 3-15.VI.2009 (MBG) (all

pitfall traps and leg. Sassu A., Verdinelli M.).

SASSARI: Sassari . Gioscari, olive-grove, che-

mical knockdown, 2 males and 1 female 14.X.2008,

leg. 1st. Ent. SS (ISE). Sorso . Pianu Mannu, Nali

farm, orchard, beating tray, 1 male 16.V.1997 leg.

1st. Ent. SS (ISE).

* Euophrys herbigrada (Simon, 1871)

Chorotype. European.

Habitat. Walnut-orchard (ined.).

Examined material. NUORO: Belvi . Canale e'

Figu, m 576, walnut-orchard, 1 male 16-23.V.2007,

1 female 28.VI-24.VII.2007, 1 female 24.VII-

30.VIII.2007 (MBG) (all pitfall traps and leg. I.S.E.).

Tonara . Su Azzime, m 682, walnut-orchard, 1 female

23.V-28.VI.2007, 1 female 24.VII-30.VIII.2007

(MBG) (all pitfall traps and leg. I.S.E.).

Euophrys rufibarbis (Simon, 1 868)

Chorotype. Centralasiatic-European-Mediter-

ranean.

References. (3) Pavesi, 1876; (13) Garneri,

1902; (84) Pesarini, 1994.

Province. (84); Cagliari (13); Carbonia-Iglesias

(3, 13); Medio Campidano (ined.).

Habitat. Garrigue (ined.); mining landfills cov-

ered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining land-

fills covered by pioneer plants, pitfall traps, 1 male

22.IX-6.X.2009, 1 male 6-20.X.2009 leg. Sassu A.,

Verdinelli M. (MBG). Guspini . Montevecchio, Pic-

calinna, m 235, garrigue, pitfall traps, 1 female 15-

30.VI.2009 leg. Sassu A., Verdinelli M. (MBG).

Euophrys sulphurea (L. Koch, 1867)

Chorotype. E-Mediterranean.

References. (10) Costa, 1885; (84) Pesarini,

1994.

Province. (84); Nuoro (ined.); Olbia-Tempio

(10); Sassari (ined.).

Habitat. Olive-grove (ined.); walnut- orchard

(ined.).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Examined material. NUORO: Belvi . Canale e'

Figu, m 576, walnut-orchard, pitfall traps, 1 male

16-23.V.2007 leg. I.S.E. (MBG).

S AS SARI: Sassari . Gioscari, olive-grove, che-

mical knockdown, 1 female 6. VIII. 2008 leg. 1st.

Ent. SS (MBG).

Euophrys terrestris (Simon, 1871)

Chorotype. Mediterranean.

References. (6) Magretti, 1880 (sub Attus ter-

restris ); (13) Gameri, 1902; (84) Pesarini, 1994.

Province. (84); Nuoro (13); Oristano/Nuoro (6);

Sassari (13).

Evarcha falcata (Clerck, 1757)

Chorotype. Palearctic.

References. (13) Gameri, 1902 (sub Hasarius

falcatus ); (84) Pesarini, 1994.

Province. (84); Cagliari (13).

Evarcha jucunda (Lucas, 1 846)

Chorotype. Mediterranean.

References. (8) Costa, 1884 (sub Hasarius ju-

cundus ); (13) Gameri, 1902 (sub Hasarius jucun-

dus ); (20) Krauss, 1955; (84) Pesarini, 1994; (114)

Grill et al., 2005; (115) Hansen, 2005; (127) Lorn

et al., 2008; (139) Trotta, 2011.

Province. (84, 114, 127); Cagliari (115, ined.);

Carbonia-Iglesias (139); Nuoro (8, 13, 115, ined.);

Ogliastra (13); Olbia-Tempio (20, 115); Sassari

(ined.).

Habitat. Citrus-grove (ined.); cherry- orchard

(ined.); hazelnut-orchard (127, ined.); olive-grove

(ined.); shurblands and trees (114); vineyard (ined.).

Examined material. CAGLIARI: Uta, S’Ap-

passiu, Agris farm, citms-grove, beating tray, 1 fe-

male 11. IX. 2000, 1 male 23. X. 2000, 1 female

13.XI.2000 leg. CRAS (ISE).

NUORO: Belvi . Mannaritzd, m 706, cherry-or-

chard, 1 male and 1 female 16-23.V.2007 (ISE); Su

Enazzu, m 550, hazelnut-orchard, 1 male 5-

21.IX.2006 (ISE) (all pitfall traps and leg. I.S.E.).

Tiana, m 522, hazelnut-orchard, beating tray, 1 male

19.V.2005 leg. I.S.E. (ISE).

SASSARI: Alghero . Mamuntanas, olive-grove,

chemical knockdown, 1 male 6.VIII.2009, 1 male

30.IX.2009, 1 male 7.X.2009 leg. 1st. Ent. SS (ISE).

Torralba . vineyard, 1 male and 1 female 23. VII. 1994,

1 female 1.X.1994, 1 female 29.VII.1995, 1 male

22.VII.1995, 1 male and 1 female 23.IX.1995 leg. 1st.

Ent. SS (ISE).

Heliophanus apiatus Simon, 1868

Chorotype. S-European.

References. (20) Krauss, 1955; (46) Thermes,

1972; (84) Pesarini, 1994; (94) Arno et al., 1998;

(115) Hansen, 2005; (127) Lorn et al., 2008; (132)

Pantini & Sassu, 2009; (139) Trotta, 2011.

Province. (84, 127); Cagliari (46, 139); Carbo-

nia-Iglesias (139); Medio Campidano (139); Nuoro

(ined.); Ogliastra (115); Olbia-Tempio (115); Sas-

sari (20, 94, 132, ined.).

Habitat. Avenue of lime trees (94); hypogean

habitat (46); cherry-orchard (ined.); orchard (ined.);

hazelnut-orchard (127, ined.); walnut- orchard

(ined.); olive-grove (ined.); vineyard (ined.).

Examined material. NUORO: Belvi . Antonitzo,

m683, cheny-orchard, 1 male 11-18.IV.2007, 1 male

27.IX-4.X.2007 (ISE); Canale e' Figu, m 576, wal-

nut-orchard, 1 male 22-29.11.2008 (ISE); Manna-

ritzd, m 706, cherry-orchard, 2 males 18-26.IV.2007

(ISE); Su Ajone, m 585, hazelnut-orchard, 1 female

19-27. VII. 2005 (ISE) (all in bark traps and leg.

I.S.E.). Tonara . Su Azzime, m 682, walnut-orchard,

bark traps, 1 male 18-26.IV.2007 leg. I.S.E. (ISE).

SASSARI: Alghero . Mamuntanas, olive-grove,

chemical knockdown, 1 male 7.X.2009 leg. 1st. Ent.

SS (ISE). Sorso . Pianu Mannu, Nali farm, orchard,

bark traps, 1 female 26.VI-2.VII. 1997, 1 male 2-

9.XII.1997 leg. 1st. Ent. SS (ISE). Torralba . vine-

yard, 1 male 14.V.1994, 2 females 4.VI.1994, 1

female and 4 juv. 9.VII.1994, 1 male and 1 juv.

24.IX.1994, 1 female 6.V.1995, 1 male 17.VI.1995,

1 female l.VII. 1995, 4 males and 6 juv.

26.VIII.1995, 1 female 5.VIII.1995, 4 males 12

juv., 9.IX.1995, 1 male and 15 juv., 2.IX.1995, 2

males and 10 juv. 16.IX.1995, 10 males and 4 juv.

30.IX.1995, 8 males and 2 juv. 23.IX.1995, 13

males, 1 female and 3 juv. 7.X.1995, 1 male and 1

juv. 14.X.1995 leg. 1st. Ent. SS (ISE).

Heliophanus auratus C.L. Koch, 1835

Chorotype. Asiatic-European.

P. Pantini, A. Sassu & G. Serra

References. (13) Gameri, 1902; (84) Pesarini,

1994.

Province. (84); Oristano (13).

Heliophanus cupreus (Walckenaer, 1802)

Chorotype. Sibero-European.

References. (10) Costa, 1885; (13) Gameri,

1902; (20) Krauss, 1955; (30) Cerruti, 1968; (84)

Pesarini, 1994; (115) Hansen, 2005; (127) Lom et

al., 2008.

Province. (84, 127); Cagliari (13, 30); Nuoro

(ined.); Ogliastra (115); Oristano (10); Sassari (20).

Habitat. Hypogean habitat (20, 30); hazelnut-

orchard (127, ined.).

Examined material. NUORO: Belvi . Su Ajone,

m 585, hazelnut-orchard, beating tray, 1 male

4.V.2005 (ISE), 1 male 29.VI.2005 (MBG); Su

Enazzu, m 550, hazelnut- orchard, bark traps, 1 fe-

male, 16-23.VI.2005 (MBG), 1 female 16-

23.VI.2005 (ISE) (all leg. I.S.E.). Tiana . m 522,

hazelnut-orchard, beating tray, 1 female 19.V.2005,

1 female 1.VI.2005 leg. I.S.E. (MBG).

Heliophanus flavipes (Hahn, 1832)

Chorotype. Palearctic.

References. (13) Gameri, 1902; (84) Pesarini,

1994; (115) Hansen, 2005.

Province. (84); Cagliari (13); Nuoro/Ogliastra

(13); Ogliastra (13); Olbia-Tempio (115).

Heliophanus kochii Simon, 1868

Chorotype. European-Mediterranean.

References. (13) Gameri, 1902; (84) Pesarini,

1994; (109) Logunov, 2004; (114) Grill et al., 2005;

(133) Trotta, 2009; (139) Trotta, 2011.

Province. (84, 114); Cagliari (13); Carbonia-

Iglesias (13, 139); Medio Campidano (139); Oglia-

stra (13); Olbia-Tempio (109, 133); Sassari (ined.).

Habitat. Shurblands and trees (114).

Examined material. OLBIA-TEMPIO: Olbia .

Murta Maria, 1 female 28.VI.1993 leg. Gusmini

(MBG).

Heliophanus melinus L. Koch, 1867

Chorotype. Centralasiatic-European.

References. (13) Gameri, 1902; (84) Pesarini,

1994.

Province. (84); Cagliari (13); Oristano (13).

Heliophanus rufithorax Simon, 1868

Chorotype. Mediterranean.

References. (10) Costa, 1885; (84) Pesarini,

1994; (115) Hansen, 2005.

Province. (10, 84); Cagliari (ined.); Nuoro

(115, ined.); Ogliastra (115); Olbia-Tempio (115);

Sassari (115, ined.).

Habitat. Walnut-orchard (ined.); pinewood

(ined.); vineyard (ined.).

Examined material. CAGLIARI: Pula . Pixina

Manna, m 140, pinewood, emergence cages, 1

male 21.IV.2009, 1 female 25.V.2009 leg. 1st. Ent.

SS (ISE).

NUORO: Belvi . Canale e' Figu, m 576, walnut-

orchard, pitfall traps, 1 female 2 1-28. VI. 2007 leg.

I.S.E. (ISE).

SASSARI: Torralba . vineyard, 1 male 24.VI.1995

leg. 1st. Ent. SS (ISE).

Heliophanus tribulosus Simon, 1868

Chorotype. Sibero-European.

References. (78) Hansen, 1986.

Province. (78).

Icius congener Simon, 1871

Chorotype. W-Mediterranean.

References. (20) Krauss, 1955 (sub I. nebulo-

sus); (84) Pesarini, 1994.

Province. (20, 84).

Icius hamatus (C.L. Koch, 1846)

Chorotype. Mediterranean.

References. (10) Costa, 1885 (sub I. striatus );

(13) Gameri, 1902 (sub I. striatus ); (78) Hansen,

1986; (84) Pesarini, 1994; (94) Arno et al., 1998;

(115) Hansen, 2005; (127) Lom et al., 2008; (134);

Marras et al., 2011.

Province. (78, 84, 127, 134); Cagliari (13,

ined.); Nuoro (ined.); Oristano (10); Sassari (94,

115, ined.).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Habitat. Citrus-grove (ined.); avenue of lime

trees (94); cherry- orchard (ined.); orchard (134,

ined.); hazelnut-orchard (127, ined.); walnut-or-

chard (ined.); olive-grove (ined.); alder-grove

(ined.); vineyard (ined.).

Examined material. CAGLIARI: Uta, S’Ap-

passiu, Agris farm, citrus-grove, beating tray, 2

males and 5 females 19.VI.2000, 1 male and 3 fe-

males, 29.VI.2000, 2 females 3 1.VII.2000, 5 fe-

males 20.VII.2000, 2 males and 6 females

31.VIII.2000, 3 females 10.VIII.2000, 2 females

21.VIII.2000, 3 males and 2 females 21.IX.2000, 1

male and 1 female 1 1 .IX.2000, 1 female 20.X.2000,

3 males and 5 females 23.X.2000, 3 males and 3 fe-

males 12.X.2000, 1 male and 2 females 4.X.2000,

1 male and 1 female 2.XI.2000, 1 male 23.XI.2000,

1 female 4.XII.2000 leg. CRAS (ISE).

NUORO: Belvi, Mannaritzo, m 706, cherry-or-

chard, bark traps, 1 male 18-26.IV.2007, 1 male

and 1 female 4-11.X.2007 (ISE); Su Ajone, m 585,

hazelnut-orchard, beating tray, 1 male 1.VI.2005

(ISE); Su Enazzu, m 550, hazelnut-orchard, bark

traps, 1 female 29.IX-6.X.2005 (MBG) (all leg.

I.S.E.). Fonni, Gennargentu, mountain refuge, m

1550, alder-grove, bark traps, 1 male 25. VII-

2. VIII. 2006 leg. Fiori F. (ISE). Tiana . m 522, hazel-

nut-orchard, bark traps, 1 female 11-18.V.2005

(MBG), 1 female 23-29.VI.2005 (ISE), 2 females

23-29.VI.2005, 1 male 8-16.VI.2005 (MBG), 1 male

8-16.VI.2005 (ISE), 1 female 27. VII-5.VIII.2005, 1

female 19-27.VII.2005, 1 female 10-17.VIII.2005,

1 female 5-10.VIII.2005, 1 male 29.IX-6.X.2005, 1

female 6-12.X.2005 (MBG) (all leg. I.S.E.). Tonara .

Su Azzime, m 682, walnut-orchard, bark traps, 1

male 4-11.X.2007 leg. I.S.E. (ISE).

S AS SARI: Sorso, Pianu Mannu, Nali farm,

olive-grove, beating tray, 1 male, 29.III.1993, 1

male, 1 female and 8 juv. 29.IV. 1993, 1 male

3. VI. 1993, 1 male and 2 females 25.VI.1993, 1

male, 2 females and 3 juv. 9.VII.1993, 2 males, 1

female and 7 juv. 16.IX.1993, 1 male 9. IX. 1993, 1

male, 1 female and 23 juv. 2.IX.1993, 1 male and 1

juv. 11. XI. 1993 (ISE), olive-grove, 1 male and 1 fe-

male 6.V.1993 (ISE); orchard, bark traps, 2 males

24.XI-2.XII. 1997 (ISE); orchard, 1 female

2.XII.1997 (ISE) (all leg. 1st. Ent. SS). Torralba .

vineyard, 1 male and 1 juv. 14.V.1994, 1 male, 2 fe-

males and 8 juv. 9.VII.1994, 1 male, 1 female and

1 juv. 3.VI.1995, 3 males and 1 female 24.VI.1995,

1 female 29.VII.1995, 1 male 22.VII.1995, 1 male

15.VII.1995, 1 male and 2 females 8.VII.1995, 1

female and 23 juv. 26. VIII. 1995, 1 male, 2 females

and 17 juv. 16.IX.1995, 1 male and 18 juv.

2.IX.1995, 1 male and 14 juv. 14.X.1995, 2 males

and 2 females 7.X.1995, 2 males, 2 females and 7

juv. 21.X. 1995 (ISE); vineyard, beating tray, 1 fe-

male 6.VIII.1994, 1 male and 11 juv. 10.IX.1994

(ISE) (all leg. 1st. Ent. SS).

Icius subinermis Simon, 1937

Chorotype. Mediterranean.

References. (8) Costa, 1884 (sub I. Notebilis );

(13) Gameri, 1902 (sub I. Notebilis ); (20) Krauss,

1955 (sub I. Notebilis ); (84) Pesarini, 1994.

Province. (84); Nuoro (8, 13, ined.); Sassari (20).

Examined material. NUORO: Dorgali. on the

pathway to Su Gorroppu, m 200, 1 female

23.IV.2003 leg. Pantini P, Magnati F. (MBG).

Leptorchestes mutilloides (Lucas, 1846)

Chorotype. Mediterranean.

References. (20) Krauss, 1955; (84) Pesarini,

1994; (115) Hansen, 2005.

Province. (84); Sassari (20, 115).

Macaroeris nidicolens (Walckenaer, 1802)

Chorotype. S-European.

References. (10) Costa, 1885 (sub Dendry-

phantes nidicolens)-, (84) Pesarini, 1994 (sub Eris

nidicolens ); (132) Pantini & Sassu, 2009.

Province. (84); Olbia-Tempio (10, ined.); Sas-

sari (132, ined.).

Habitat. Olive-grove (ined.).

Examined material. OLBIA-TEMPIO: Telti . Rio

Almiddina, 1 male 20.V.2008 leg. Sassu A. (ISE).

SASSARI: Alghero . Mamuntanas, olive-grove,

chemical knockdown, 1 female 6.IX.2009 leg. 1st.

Ent. SS (ISE). Sorso . Pianu Mannu, Nali farm,

olive-grove, beating tray, 1 female 22.VII.1993 leg.

1st. Ent. SS (ISE).

Marpissa muscosa (Clerck, 1757)

Chorotype. Sibero-European.

References. (13) Gameri, 1902; (84) Pesarini,

1994; (127) Lom et al., 2008.

P. Pantini, A. Sassu & G. Serra

Province. (84, 127); Carbonia-Iglesias (13);

Nuoro (ined.).

Habitat. Hazelnut-orchard (127, ined.); wal-

nut-orchard (ined.).

Examined material. NUORO: Belvi . Su

Enazzu, m 550, hazelnut-orchard, bark traps, 5

males, 5 females and 16 juv. 6-13.X.2004, 2 males

13-20.X.2004, 1 male, 2 females and 1 juv. 20-

27.X.2004, 2 males, 1 female and 7 juv. 15-

22. III. 2005 leg. I.S.E. (MBG). Tonara . Su Azzime,

m 682, walnut-orchard, bark traps, 1 female 24-

30.VIII.2007 leg. I.S.E. (ISE).

Marpissa pomatia (Walckenaer, 1802)

Chorotype. Palearctic.

References.(13) Gameri, 1902; (84) Pesarini,

1994.

Province. (84); Cagliari (13).

Mendoza canestrinii (Ninnii, 1868)

Chorotype. Palearctic.

References. (10) Costa, 1885 (sub Hyctia Ca-

nestrinii ); (13) Gameri, 1902 (sub Hyctia Canestri-

nii ); (84) Pesarini, 1994 (sub Mithion canestrinii ).

Province. (13, 84); Oristano (10).

Menemerus semilimbatus (Hahn, 1 829)

Chorotype. Holarctic.

References. (10) Costa, 1885 (subM. semilim-

bactus ); (11) de Carlini, 1885; (13) Gameri, 1902;

(84) Pesarini, 1994; (94) Amo et al., 1998.

Province. (84); Cagliari (13); Carbonia-Iglesias

(11, 13); Nuoro (10); Ogliastra (13); Sassari (94).

Habitat. Avenue of lime trees (94).

Mogrus frontosus (Simon, 1871)

Chorotype. Sardo-Corsican endemic.

References. (84) Pesarini, 1994.

Province. (84).

Remarks. Species known in Corse, Pesarini re-

cords it in his checklist without supplying any other

information, its presence in Sardinia needs further

confirmation.

Myrmarachne formicaria (De Geer, 1778)

Chorotype. Palearctic.

References. (13) Garneri, 1902 (sub Salticus

formicarius ); (84) Pesarini, 1994; (139) Trotta,

2011.

Province. (13, 84); Carbonia-Iglesias (139).

Neaetha membrosa (Simon, 1868)

Chorotype. S -European.

References. (20) Krauss, 1955 (sub N. mem-

branosa ); (84) Pesarini, 1994.

Province. (84); Medio Campidano (ined.);

Nuoro (ined.); Olbia-Tempio (20).

Habitat. Cherry-orchard (ined.); mining land-

fills covered by pioneer plants (ined.).

Examined material. MEDIO CAMPIDANO:

Arbus . Ingurtosu, Naracauli, m 170, mining land-

fills covered by pioneer plants, pitfall traps, 1 fe-

male 4-16.VI.2009, 1 female 29.VI-14.VII.2009

leg. Sassu A., Verdinelli M. (MBG). Guspini . Mon-

tevecchio, Piccalinna, m 225, mining landfills cov-

ered by pioneer plants, pitfall traps, 1 male

18.V-3.VI.2009, 1 male 3-15.VI.2009 leg. Sassu A.,

Verdinelli M. (MBG).

NUORO: Belvi . Mannaritzo, m 706, cherry-or-

chard, pitfall traps, 1 female 2 1-28. VI. 2007 leg.

I.S.E. (ISE).

Pellenes arciger (Walckenaer, 1837)

Chorotype. S-European.

References. (10) Costa, 1885 (sub P. arcige-

rus ); (13) Gameri, 1902 (sub P. arcigerus ); (84) Pe-

sarini, 1994; (100) Metzner, 1999.

Province. (84); Cagliari (10); Nuoro (10);

Ogliastra (13, 100); Sassari (ined.).

Habitat. Olive-grove (ined.); Strand (100).

Examined material. SASSARI: Sassari . Gio-

scari, olive-grove, 1 male 20.VIII.2009 (MBG); Lu

Buttangam, olive-grove, 2 males 29.IX.2009, 1 fe-

male 13.X. 2009 (MBG) (all chemical knockdown

and leg. 1st. Ent. SS).

Pellenes geniculatus (Simon, 1868)

Chorotype. Centralasiatic-Mediterranean.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

References. (13) Gameri, 1902; (84) Pesarini,

1994.

Province. (84); Cagliari (13).

Pellenes nigrociliatus (Simon, 1875)

Chorotype. Palearctic.

References. (91) Fontana et al., 1996.

Province. Olbia-Tempio (91).

Philaeus chrysops (Poda, 1761)

Chorotype. Palearctic.

References. (10) Costa, 1885; (13) Garneri,

1902; (84) Pesarini, 1994; (115) Hansen, 2005.

Province. (84); Cagliari (13, 115); Nuoro (10);

Oristano (10).

Phlegra bresnieri (Lucas, 1 846)

Chorotype. Afrotropico-Mediterranean.

References. (7a) Costa, 1882 (sub Attus bre-

snieri ); (8) Costa, 1884 [sub P. (Attus) Bresnieri ];

(13) Gameri, 1902; (20) Krauss, 1955; (84) Pesa-

rini, 1994; (100) Metzner, 1999; (115) Hansen,

2005; (120) Logunov & Azarkina, 2006; (132) Pan-

tini & Sassu, 2009.

Province. (20, 84); Cagliari (8, 13); Medio

Campidano (120); Nuoro (ined.); Ogliastra (100,

115); Oristano (7a, 8, 13, 120); Sassari (132, ined.).

Habitat. Cultivated land, olive and almond

trees, with grass Euphorbia and Cirsium (under

Granite rocks) (120); marshy grassland with Cir-

sium (under stone) (120); walnut-orchard (ined.);

olive trees with grass, sheep pasture and slightly

moist grass (120); olive-grove (ined.); stony pas-

tures with stonewalls, Rubus fruticosus, Juniperus

communis (120); Strand (100).

Examined material. NUORO: Tonara, Su Az-

zime, m 682, walnut-orchard, pitfall traps, 1 female

16-23.V.2007 leg. I.S.E. (ISE).

SASSARI: Sassari . Gioscari, olive-grove, 1 male

22.IX.2008 1 (MBG); Lu Buttangam, olive-grove,

3 males and 1 female 29. IX. 2009 (MBG) (all che-

mical knockdown and leg. 1st. Ent. SS).

Phlegra lineata (C.L. Koch, 1846)

Chorotype. Mediterranean.

References. (13) Gameri, 1902; (84) Pesarini,

1994.

Province. (13, 84).

Plexippus paykulli (Audouin, 1826)

Chorotype. Subcosmopolitan.

References. (13) Gameri, 1902 (sub Hasarius

Paykulli ); (84) Pesarini, 1994.

Province. (84); Cagliari (13); Oristano (13).

Pseudeuophrys erratica (Walckenaer, 1 826)

Chorotype. Holarctic.

References. (13) Gameri, 1902 (sub Euophrys

erratica)', (84) Pesarini, 1994 (sub Euophrys erra-

tica ); (127) Lom et al., 2008.

Province. (84, 127); Cagliari (13); Nuoro

(ined.); Ogliastra (13).

Habitat. Hazelnut-orchard (127); walnut-or-

chard (ined.); alder-grove (ined.).

Examined material. NUORO: Fonni . Gennar-

gentu, mountain refuge, m 1550, alder-grove,

bark traps, 1 female 27-4. X. 2006 leg. Fiori F.

(ISE). Tonara . Su Azzime, m 682, walnut-orchard,

bark traps, 1 female 16-23. V.2007 leg. I.S.E. (ISE).

* Pseudeuophrys nebrodensis Alicata et Can-

tarella, 2000

Chorotype. Tyrrhenian endemic.

Habitat. Alder-grove (ined.); hazelnut-orchard

(ined.); under Juniperus sp. (ined.).

Examined material. NUORO: Belvi . Su Ajone,

m 585, hazelnut-orchard, bark traps, 1 female 18-

25.V.2005, 1 female 23-29.VI.2005, 2 females 1-

8. VI. 2005, 1 female 8-16.VI.2005, 1 female

19-27.VII.2005 leg. I.S.E. (MBG). Desulo . Gennar-

gentu, mountain refuge, m 1500, alder- grove, bark

traps, 2 females and 1 juv. 26.IX-3.X.2006, 1 fe-

male 5-13.IX.2006, 2 females 3-10.X.2006 (ISE);

under Juniperus sp., pitfall traps, 1 male 10-

24. V.2007 (ISE) (all leg. Fiori F.).

Pseudeuophrys vafra (Blackwall, 1867)

Chorotype. European-mediterranean.

References. (100) Metzner, 1999; (115) Han-

sen, 2005; (116) Helsdingen, 2005.

P. Pantini, A. Sassu & G. Serra

Province. Medio Campidano (ined.); Nuoro

(116, ined.); Ogliastra (100, 115, 116).

Habitat. Inside house (116); mediterranean

maquis (ined.); walnut-orchard (ined.); Strand (100).

Examined material. MEDIO CAMPIDANO:

Guspini . Montevecchio, Piccalinna, m 260, mediter-

ranean maquis, pitfall traps, 2 males 15-30.VI.2009,

2 females 13-27.VII.2009 leg. Sassu A., Verdinelli

M. (MBG).

NUORO: Belyi, Canale e' Figu, m 576, walnut-

orchard, 1 female 17-24.VII.2007 leg. I.S.E. (MBG).

Pseudicius encarpatus (Walckenaer, 1 802)

Chorotype. European.

References. (84) Pesarini, 1994; (94) Arno et

al., 1998; (127) Lorn et al., 2008.

Province. (84, 127); Nuoro (ined.); Sassari (94,

ined.).

Habitat. Avenue of lime trees (94); cherry-or-

chard (ined.); orchard (ined.); hazelnut- orchard

(127); olive-grove (ined.).

Examined material. NUORO: Belvi . Anto-

nitzo, m 683, cherry-orchard, 1 female 17-

24.VII.2007 (ISE); Mannaritzo, m 706,

cherry-orchard, 1 female 4-11.X.2007 (ISE) (all in

bark traps and leg. I.S.E.).

SASSARI: Sorso, Pianu Mannu, Nali farm,

olive-grove, beating tray, 1 male l.VII. 1993 (ISE);

orchard, bark traps, 1 female 24-3 l.VII. 1997, 1

male and 1 juv. 11-19.VI.1998 (ISE) (all leg. 1st.

Ent. SS).

Saitis barbipes (Simon, 1868)

Chorotype. Mediterranean.

References. (115) Hansen, 2005.

Province. Sassari (115, ined.).

Examined material. SASSARI: Sassari . Li

Punti, Baldinca, m 110, 1 male 15. VI. 2008 leg.

Sassu A. (ISE).

Salticus conjonctus (Simon, 1868)

Chorotype. S-European.

References. (20) Krauss, 1955; (84) Pesarini,

1994; (115) Hansen, 2005.

Province. (20, 84); Olbia-Tempio (115).

Salticus mutabilis (Lucas, 1846)

Chorotype. Turano-European.

References. (13) Garneri, 1902 (sub Callie-

thera mutabilis ); (84) Pesarini, 1994; (94) Amo et

al., 1998; (115) Hansen, 2005; (132) Pantini &

Sassu, 2009; (133) Trotta, 2009.

Province. (84); Cagliari (13); Carbonia-Iglesias

(133, ined.); Ogliastra (115); Oristano (ined.), Sas-

sari (94, 115, 132, ined.).

Habitat. Avenue of lime trees (94); orchard

(ined.); olive-grove (ined.); vineyard (ined.).

Examined material. CARBONIA-IGLESIAS:

Sant’Antioco . 1 male 25.IV.2003 leg. Ferrario E.

(MBG).

ORISTANO: Cabras, San Giovanni in Sinis, 2

males and 1 juv. 26.IV.2003 leg Pantini P., Magnati

F. (MBG).

SASSARI: Sorso . Pianu Mannu, Nali farm,

olive-grove, beating tray, 1 male 9.VI.1993 (ISE);

orchard, bark traps, 1 male 15-22.IV. 1998, 1 female

11-19.VI.1998 (ISE) (all leg. 1st. Ent. SS). Torralba .

vineyard, 1 female 17.VI.1995 leg. 1st. Ent. SS (ISE).

Salticus scenicus (Clerck, 1757)

Chorotype. Holarctic.

References. (6) Magretti, 1880 (sub Epible-

mum scenicum ); (8) Costa, 1884 (sub Callethera

scenica ); (13) Garneri, 1902 (sub Calliethera sce-

nica ); (84) Pesarini, 1994.

Province. (8, 84); Oristano (6, 13).

Habitat. Common inside houses (8).

Salticus zebraneus (C.L. Koch, 1837)

Chorotype. Palearctic.

References. (94) Arno et al., 1998.

Province. Nuoro (ined.); Sassari (94).

Habitat. Avenue of lime trees (94); cherry-or-

chard (ined.).

Examined material. NUORO: Belvi . Anto-

nitzo, m 683, cherry-orchard, bark traps, 1 male 21-

28.VI.2007 leg. I.S.E. (ISE).

Sitticus pubescens (Fabricius, 1775)

Chorotype. Holarctic.

References. (84) Pesarini, 1994.

Province. (84).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Synageles albotrimaculatus (Lucas, 1846)

Chorotype. W-Mediterranean.

References. (13) Gameri, 1902; (84) Pesarini,

1994.

Province. (84); Carbonia-Iglesias (13); Sassari

(ined.).

Habitat. Vineyard (ined.).

Examined material. SASSARI: Torralba . vine-

yard, 1 female 24.VI.1995, 1 female 3.VI.1995 leg.

1st. Ent. SS (ISE).

Synageles Venator (Lucas, 1836)

Chorotype. Palearctic.

References. (10) Costa, 1885; (84) Pesarini,

1994.

Province. (84); Cagliari (10).

*Talavera aequipes (O.P -Cambridge, 1871)

Chorotype. Palearctic.

Habitat. Orchard (ined.).

Examined material. SASSARI: Sorso, Pianu

Mannu, Nali farm, orchard, pitfall traps, 1 female

24-3 l.VII. 1997 leg. 1st. Ent. SS (ISE).

Thyene imperialis (Rossi, 1 846)

Chorotype. Indo-Mediterranean.

References. (8) Costa, 1884 (sub Thya impe-

rialis ); (13) Gameri, 1902; (20) Krauss, 1955; (84)

Pesarini, 1994; (114) Grill et al., 2005.

Province. (84, 114); Cagliari (8, 13); Olbia-

Tempio (20).

Habitat. Agricultural land (114).

Yllenus univittatus (Simon, 1871)

Chorotype. European (?).

References. (10) Costa, 1885; (84) Pesarini,

1994;

Province. (84); Cagliari (10)

Remarks. Species known only in France, Pesa-

rini records it in his checklist probably on the basis

of Costa’s old citation (1885), its presence in Sar-

dinia needs further confirmation.

CONSIDERATIONS ABOUT SARDINIAN

ARANEOFAUNA

In this work, 495 species are reported (30.6% of

those known in Italy) which belong to 229 genera

divided into 43 families. Among these, the Philo-

dromidae Philodromus bosmansi is reported for the

first time in Europe, while the following are re-

ported for the first time in Italy: the Gnaphosidae

Setaphis parvula, the Linyphiidae Centromerus

succinus and Hybocoptus corrugis and the Prodi-

domidae Zimirina brevipes. For the latter species

and for its family, this is the first sighting in Italy.

As well as these 6 species, a further 37 species are

reported for the first time in Sardinia (Table 2).

Regarding distribution (Fig. 3), Cagliari, Sas-

sari and Nuoro are the provinces with the highest

number of species reported. In the Cagliari area,

the 218 species reported are related to 50 publica-

tions, however most of the data are linked to the old

works of Gameri (1902) and Costa (1884, 1885).

No specific studies have been carried out in the pro-

vince of Cagliari but among the most recent contri-

butions which report data about Sardinian

araneofauna, those by Argiolas et al. (1970), Thermes

(1972) and Trotta (2011) deserve a mention. A good

number of species were also reported on the basis of

newly examined material. Regarding the province of

Sassari (52 publications, 213 species) and the pro-

vince of Nuoro (46 publications, 212 species),

newly examined material from studies in olive

groves, vineyards and fruit orchards in the Sassari

area and from studies in the mountainous environ-

ment of the Nuoro area was cmcial. It was collected

by the Sassari section of the ISE and is published

in this catalogue. For the Sassari province we can

also mention the analysis of tree spiders collected

in a tree-lined street in Sassari (Arno et al., 1998)

and the study of the spiders on the Island of Asinara

(Pantini & Sassu, 2009). We know less about the

other provinces: for Carbonia-Iglesias (39 publica-

tions, 141 species) Trotta’s recent contribution

(2011) is important as well as data from old publi-

cations; for Ogliastra area (43 publications, 133

species) contributions by Gameri ( 1 902) and Hel-

sdingen (2005) are useful; the newly examined ma-

terial from studies in cork-oak forests and Trotta’s

publication (2009) on the islands around Sardinia

are important for Olbia-Tempio province (32 publi-

cations, 103 species); for Medio Campidano (16 pu-

P. Pantini, A. Sassu & G. Serra

Family and species

ZODARIIDAE

Zodarion gallicum

PRODIDOMIDAE

Zimirina brevipes *

GNAPHOS1DAE

Drassodes luteomicans

Leptodrassus femineus

Micaria albovittata

Micaria cyrnea

Nomisia recepta

Plmeocedus braccatus

Setaphis parvula *

Trachyzelotes pedestris

Zelotes dentatidens

Zelotes egregius

PHILODROMIDAE

Philodromus bosmansi *

Philo dromus buxi

THOMISIDAE

Ozyptila sanctuaria

Xysticus erratic us

Xysticus ibex

SALTICIDAE

Dendryphantes hastatus

Euophrys herbigrada

Pseudeuophrys nebrodensis

Talavera aequipes

Family and species

FILISTAT1DAE

Pritha nana

THERIDIIDAE

Dipoena coracina

Rhomphaea nasica

Theridion hannoniae

LINYPHIIDAE

Centromerus subalpinus

Centromerus succinus *

Diplostyla concolor

Hybocoptus corrugis *

Meioneta mollis

Micrargus subaequalis

Nematogmus sanguinolentus

Pocadicnemis juncea

Syedra nigrotibialis

Walckenaeria antica

Walckenaeria stylifrons

ARANEIDAE

Araneus marmoreus

Araneus quadratus

LYCOS1DAE

Pirata tenuitarsis

ZORIDAE

Zora manicata

AGELENIDAE

Textrix pinicola

LIOCRANIDAE

Agraecina lineata

Table 2. List of the species which appear to be newly re-

ported for Sardinian araneofauna. Marked with an asterisk

are those newly reported for Italy.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

blications, 101 species) the outstanding new material

examined from studies in a disused mining area and

Trotta’s recent contribution (2011) are fundamental

while for the province of Oristano (30 publications;

Chorotype

n. sp.

Cosmopolitan

2,40

Subcosmopolitan

1,20

Holarctic

11,90

Widely spread in the Palearctic Region

171

34,50

Paleartic

17,20

W-Paleartic

0,20

Asiatic-European

2,60

Sibero-European

6,90

Centralasiatic-Europeo-Mediterranean

0,20

Centralasiatic-European

1,00

Centralasiatic-Mediterranean

1,00

Turano-Europeo-Mediterranean

0,60

Turano-European

2,60

Turano-Mediterranean

1,00

Europeo-Mediterranean

1,20

Table 3. List of chorotypes for

100 species) reports mostly come from old works.

The chorotypes of the species discovered are

listed in table 3 and reproduced, in uniform groups

in figure 14. Together with a small percentage of

European

17,00

European

10,30

Centraleuropean

0,20

S-European

6,50

Mediterranean

109

22,00

Mediterranean

12,10

W-Mediterranean

8,70

Afrotropicals

1,20

Afrotropico-Indo-Mediterranean

0,80

Afrotropico-Mediterranean

0,20

Indo-Mediterranean

0,20

Endemic

10,90

Italian endemic

0,20

Tyrrhenian endemic

2,40

Sardo-Corsican endemic

2,00

Sardinian endemic

6,30

species present in Sardinia.

Endemic

10,9%

Cosmopolitan

3,6%

Afrotropicals

1 , 2 %

European

17,0%

Figure 14. Chorological spectrum of Sardinian araneofauna.

P. Pantini, A. Sassu & G. Serra

Cosmopolitan or Sub-cosmopolitan species, more

than half of the species present in the Region have

a wide distribution divided into: prevalently Pale-

arctic species (41 .3%), Holartic and a small amount

of Afro-Tropical elements. The rest of them are di-

vided into Mediterranean (20.8%) and Southern Eu-

ropean (6.5%) elements. There is a remarkable

number of endemic species (10.9%) which involves

54 species. In figures 15-18 the Sardinian distribu-

tions of 38 of the 41 Sardinian and Sardo-Corsican

endemism are shown (only Zodarion sardum, Mo-

grus frontosus and Xysticus parallelus are generic

cited for Sardinia and no indicates localities)

while the distribution of the remaining 13 ende-

mic species can be found in table 4.

CONCLUSIONS

It is possible that during our bibliographical re-

search, some publications have been overlooked,

however we believe that the data presented provides

us with a detailed and updated view of what is

known about Sardinian araneofauna. Examination

of the material kept at the Museum of Bergamo and

that collected and kept at the Institute of Ecosystem

Study in Sassari has allowed us to insert a lot of

new data into the catalogue: as well as the 43 new

species reported on the island, we were able to con-

firm the presence of 21 1 other species in the region

and provide new information about their distribu-

tion throughout Sardinia.

The analysis of this material has also allowed

us to detect several species which were difficult

to attribute and can probably be considered as

new taxa belonging to the following genera: Har-

pactea, Rhode, Zodarion, Cybaeodes, Haplodras-

sus and Zelotes. Finally, the genitalia of

Phrurolithus corsicus, Zimirina brevipes, Dras-

sodes luteomicans and Zelotes dentatidens are il-

lustrated (Figs. 4-13).

The level of knowledge about the araneological

fauna of Sardinia can surely still be greatly im-

proved. Compared with other Northern Italian re-

gions (Table 5) such as Alto Adige (Noflatscher,

1996), Piedmont and Lombardy (Isaia et al., 2007)

and Veneto (Ballarin et al. 2011), which have re-

cently been the object of similar catalogues, Sardinia

Species

Distribution

Ariadna brignoli

Described from Lazio (Isola di

Ponza), cited from Sardinia and

Sicily only for female specimens

Cteniza brevidens

Tyrrhenian endemic (see also the

remark on page 11)

Cteniza sauvagesi

Tyrrhenian endemic

Spermophorides

elevata

Tyrrhenian endemic

Dysdera ancora

Sardinia and Sicily

Dysdera ventricosa

Sardinia and Sicily. Only known

from its original description

Harpactea sardoa

Sardinia and Lazio

Gonatium

biimpressum

Rare species known from Sardi-

nia, Corse (Bonifacio) and Lazio

(Isola di Ponza)

Syedra nigrotibialis

Rare species known from Sardi-

nia, Corse and Lazio

Maltlionica sicana

Sardinia and Sicily

Zodarion rujfoi

Sardinia and Apulia (Isole Tre-

miti)

Zelotes sardus

Sardinia and Tuscany (Isola di

Capraia)

Pseudeuophrys

nebrodensis

Sardinia and Sicily

Table 4. Distribution of the endemic species which are not

exclusive to the Sardinian-Corsican area.

Italian Region

Families (n.)

Species (n.)

Veneto

738

Lombardy

679

Alto Adige

606

Piedmont

546

Valle d’Aosta

261

Sardinia

495

Table 5. Number of species and families known in some

Italian regions.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

O Nemesia fertoni

□ Nemesia kahmanni

O Dysdera Jana

□ Dysdera shardana

V'.

□ liarpactea alien mi O Harpactea gennatgenru

A Parachies inaeqmpes O Sardostalita patrizii

id liarpactea nuragica

O Parachres limbarae

Figure 15. Distribution of Sardinian and Sardo-Corsican endemism of the family Nemesiidae (top left) and Dysderiidae

(top right, down left, down right).

P. Pantini, A. Sassu & G. Serra

O Leptoneta patrizii A Lepton era in sit laris

□ Leptoneta serhonriana 'Ct Leptoneta taramelli

O Spermophorides baunei

O Cybaeodes sordus O Zodarion tu'griceps

□ Llocramm giersbeigl

Figure 16. Distribution of some Sardinian and Sardo-Corsican endemism of the family Leptonetidae (top left), Pholcidae

(top right), Liocranidae (down left) and Zodaridae (down right) ( Zodarion sardum is not reported because is generic cited

for Sardinia and no indicates localities).

Catalogue of the spiders (Arachnida Araneae) of Sardinia

• Aten gen a soriCUl&tQ □ Tegenaria armigera

O Malthonica eleonorae & Tegenaria hen roti

A Malthonica sardoa

O Lepthyphantes eleonorae A Lepthyphantes sardous

□ Lepthyphantes paoloi iX Palliditphantes angitstiformis

A Centivmerus boneviae

'id Ceatromerus pudditi

O Acartauchenius sardiniensis O Cresmatoneta eleonorae A TyphocrestUS $ardn$

□ Araeoncus longin$cnln$ □ Mecopistes miUidgei

Figure 17. Distribution Sardinian and Sardo-Corsican endemism of the family Agelenidae (top left) and Linyphiidae (top

right, down left, down right).

P. Pantini, A. Sassu & G. Serra

O Theridion nasutum

O Philodromus blanckei □ Xystictts sardiniensis

A Xysticus gt a I la tor

Figure 18. Distribution of some Sardinian and Sardo-Corsican endemism of the family Theridiidae (left) and Philodro-

midae plus Thomisidae (right) ( Xysticus parallelus is not reported because is generic cited for Sardinia and no indicates

localities).

appears to be the region with the fewest species. In

our opinion, this situation is not due to the paleo-

bio-geographical events and/or environmental

characteristics of the island but to a lack of speci-

fic research, which is demonstrated by the absence

of several species with a wide distribution. On this

topic, it is interesting to make a comparison with

the fauna of nearby Corsica (Table 6). In fact, the

number of species in the Sardinian-Corsican area

totals 700 species and the number present on each

island is nearly the same, but actually the simila-

rity between the two faunas is not very high (So-

rensen’s index of similarity = 0.63).

On the whole, what strikes us most is the

lack of research into the araneocenosis of the

main Sardinian environments carried out with

adequate timings and methods. Most of the data

comes from general faunal or taxonomic publi-

cation, many of which are now outdated. To

prove this, there are 94 species, slightly less

than 20% of the total, whose latest citation

comes from Garneri (1902) or previously, a

good 110 or more years ago. We hope therefore

that further research into Sardinian araneofauna

will allow us to update and complete this cata-

logue.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Family

Sardi-

nian

species

(n.)

Corsi-

can

species

(n.)

Shared

species

(n.)

Total

Ctenizidae

Nemesiidae

Filistatidae

Sicaridae

Scytodidae

Leptonetidae

Pholcidae

Segestriidae

Dysderidae

Oonopidae

Palpimanidae

Mimetidae

Eresidae

Oecobiidae

Uloboridae

Nesticidae

Theridiidae

Theridio somatidae

Mysmenidae

Linyphiidae

108

Tetragnathidae

Araneidae

Lycosidae

Pisauridae

Family

Sardi-

nian

species

(n.)

Corsi-

can

species

(n.)

Shared

species

(n.)

Total

Oxyopidae

Zoropsidae

Zoridae

Agelenidae

Hahniidae

Dictynidae

Amaurobiidae

Titanoecidae

Miturgidae

Anyphaenidae

Liocranidae

Clubionidae

Corinnidae

Zodariidae

Prodidomidae

Gnaphosidae

Sparassidae

Philodromidae

Thomisidae

Salticidae

TOTAL

495

522

319

698

Table 6. Comparison between Sardinian and Corsican ara-

neofauna. The data for Corsican fauna comes from “Fauna

Europaea” (Helsdingen, 2011).

P. Pantini, A. Sassu & G. Serra

ACKNOWLEDGEMENTS

The authors wish to thank Roberto A. Pantaleoni

for pressing and encouraging us even during the

most critical drafting phases of the catalogue, for

his patience and for allowing us to examine the vast

amount of material of the ISE Institute.

We would also like to thank Fulvio Gasparo and

Arthur Decae for their valuable advice. Thanks also

go to Aldo Mulas, Gianpaolo Ruzzante and Paolo

Fontana for their collected material. Heartfelt

thanks to Elena Pelizzoli for her illustrations and

Emanuele Biggi for the cover photos.

Our thanks also go to Marcello Verdinelli,

Maria Feonarda Fadda, Laura Loru, Alessandro

Molinu, Francesca Fiori, Piera Marras and Tiziana

Nuvoli who, together with the staff of the ISE and

the Department of Plant Protection of the Univer-

sity of Sassari contributed greatly to the collection

of new material.

REFERENCES

Alicata P., 1966. Le Harpactea (Araneae, Dysderidae)

della fauna italiana e considerazioni sulla loro ori-

gine. Atti dell'Accademia Gioenia di Scienze Natu-

rali, 18: 190-221.

Alderweireldt M. & Jocque R., 1992. A review of the ne-

bulosa- group of Pardosa Koch 1847 in Africa, a

complex with some highly variable species (Araneae

Lycosidae). Tropical Zoology, 5: 73-113.

Altara E., 1968. Ricerche biologiche in Sardegna. Sotto-

terra, Rivista del Gruppo speleologico bolognese CAI

e Speleo Club Bologna Esagono ENAL, 7: 23-27.

Argiolas M., Bartolo G. & Puddu S., 1970. II Monte del

Castello di Quirra e le sue grotte. Ed. Tipografia

I.B.S., Cagliari, 56 pp.

Arnedo M.A., Gasparo F. & Opatova V., 2009. Systema-

tics and phylogeography of the Dysdera erythrina

species complex (Araneae, Dysderidae) in Sardinia.

ZooKeys, 16: 319-345.

Arno C., Luciano P. & Pantaleoni R.A., 1998. La tasso-

cenosi a ragni sui tigli di un'alberata cittadina a Sas-

sari. In: Bologna M.A., Carpaneto G.M. & Cignini

B. (eds.) 1998, Atti 1° Convegno Nazionale sulla

Fauna Urbana. Roma, 12 aprile 1997. Fratelli Pa-

lombi editori, Roma, 87-89.

Ausserer A., 1871. Beitrage zur Kenntniss der Arachni-

den-Familie der Territelariae Thorell (Mygalidae

Autor). Verhandlungen zoologisch-botanische Gesel-

lschaft in Wien, 21:11 7-224.

Ballarin F., Pantini P. & Hansen H., 2011. Catalogo ra-

gionato dei ragni (Arachnida, Araneae) del Veneto.

Memorie del Museo Civico di Storia Naturale di Ve-

rona - 2. Serie. Sezione Scienze della Vita 21, 151 pp.

Bonnet P, 1945. Bibliographia araneorum; analyse me-

thodique de toute la litterature araneologique

jusqu‘en 1939. Douladore, Tolouse, 1: 832 pp.

Bartolo G., Bmscu E. & Dore M., 1973. Sa Fossa de Per-

d’e Cerbu. A cura dello Speleo Club di Cagliari. Ed.

Fossataro, Cagliari, 20 pp.

Bartolo G., Dore M. & Trincas G., 1972. Sa Fossa de su

Fenu Trainu (Terza voragine della Sardegna). A cura

dello Speleo Club di Cagliari. Ed. Fossataro, Cagliari,

39 pp.

Baum S., 1974. Zum "Cribellaten-Problem": Die Geni-

talstrukturen der Oecobiinae und Urocteinae

(Arach.: Aran.: Oecobiidae). Abhandlungen des Na-

turwissenschaftlichen Vereins in Hamburg, 16

(N.F.): 101-153.

Bolzern A., Hanggi A. & Burckhardt D., 2008. Funnel

web spiders from Sardinia: Taxonomical notes on

some Tegenaria and Malthonica spp. (Araneae: Age-

lenidae). Revue suisse de Zoologie, 115: 759-778.

Bosmans R., 1997. Revision of the genus Zodarion

Walckenaer, 1833, part II. Western and Central Eu-

rope, including Italy (Araneae: Zodariidae). Bulle-

tin of the British Arachnological Society, 10:

265-294.

Bosmans R., 2008. Anew contribution to the knowledge

of the genus Typhochrestus Simon in Europe and

North Africa (Araneae: Linyphiidae). Revista Iberica

de Arachnologia, 16: 83-92.

Bosmans R. & Van Keer J., 1999. The genus Enoplogna-

tha Pavesi, 1880 in the mediterranean region (Ara-

neae: Theridiidae). Bulletin of the British

Arachnological Society, 11: 209-241.

Brignoli P.M., 1967a. Oonopidae di Sardegna e Puglie

(Araneae). Rendiconti dell'Istituto lombardo di

Scienze e Lettere (B), 101: 360-368.

Brignoli P.M., 1967b. Su alcuni Leptonetidae della Sar-

degna (Araneae). Rendiconti dell'Istituto lombardo

di Scienze e Lettere (B), 101: 352-359.

Brignoli P.M., 1969a. Note sugli Scytodidae d'ltalia e

Malta (Araneae). Fragmenta Entomologica, 6: 121-

166.

Brignoli P.M., 1969b. Osservazioni su alcuni casi di ri-

generazione delle zampe in Loxosceles rufescens

(Doufur) (Araneae, Scytodidae). Fragmenta Entomo-

logica, 6: 115-119.

Brignoli P.M., 1969c. Secondo contributo alia cono-

scenza dei Leptonetidae della Sardegna (Araneae).

Archivio Zoologico italiano, 54: 11-31.

Brignoli P.M., 1971a. Contributo alia conoscenza degli

Agelenidae italiani (Araneae). Fragmenta entomolo-

gica, 8: 57-142.

Brignoli P.M., 1971b. Note sui Pholcidae d'ltalia. Frag-

menta Entomologica, 7: 79-101.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

Brignoli P.M., 1971c. Note sui ragni cavemicoli italiani.

Fragmenta Entomologica, 7: 121-229.

Brignoli P.M., 1973. Ragni d'ltalia XX. Note sugli Hah-

niidae (Araneae). Fragmenta Entomologica, 8: 265-

274.

Brignoli P.M., 1974. Ragni d'ltalia XXI. Settimo contri-

bute alia conoscenza dei ragni cavernicoli di Sarde-

gna e descrizione di una nuova specie di Corsica

(Araneae). Revue suisse de Zoologie, 81: 387-395.

Brignoli P.M., 1975. Ragni d'ltalia XXIII. Nuovi dati su

alcuni Haplogynae. Bollettino della Societa Entomo-

logica Italiana, 107: 170-178.

Brignoli P.M., 1976a. Beitrage zur Kenntnis der Scyto-

didae (Araneae). Revue suisse de Zoologie, 83: 125-

191.

Brignoli P.M., 1976b. Ragni d'ltalia XXIV. Note sulla

morfologia dei genitali intemi dei Segestridae e cenni

sulle specie italiane (Araneae). Fragmenta Entomo-

logica, 12: 19-62.

Brignoli P.M., 1977. Ragni d'ltalia XXVII. Nuovi dati su

Agelenidae, Argyronetidae, Hahniidae, Oxyopidae e

Pisauridae, cavemicoli ed epigei (Araneae). Quaderni

del Museo di Speleologia "V. Rivera" L'Aquila, 2:3-

118.

Brignoli P.M., 1979a. Contribution a la connaissance des

Uloboridae palearctiques (Araneae). Revue Arachno-

logique, 2: 275-282.

Brignoli P.M., 1979b. Ragni d'ltalia XXIX. Dysderidae

nuovi o interessanti. Bollettino della Societa Ento-

mologica Italiana, 111: 17-26.

Brignoli P.M., 1979c. Ragni d'ltalia XXX. Nuovi dati

corologici ed ecologici su alcune specie di araneidae.

(Araneae). Fragmenta Entomologica, 15: 17-41.

Brignoli P.M., 1979d. Ragni d'ltalia XXXI. Specie ca-

vernicole nuove o interessanti (Araneae). Quaderni

del Museo di Speleologia "V. Rivera" L'Aquila, 10:

3-48.

Brignoli P.M., 1980. Ragni d'ltalia XXXIII. II genere Ro-

bertus (Araneae, Theridiidae). Fragmenta Entomolo-

gica, 15:259-265.

Brignoli P.M., 1982. Contribution a la connaissance des

Filistatidae paleartiques (Araneae). Revue Arachno-

logique, 4: 65-75.

Brignoli P.M., 1984. Zur Problematik der mediterranen

Pisaura - Arten (Arachnida, Araneae, Pisauridae).

Zoologischer Anzeiger, Jena, 213 (1/2): 33-43.

Brignoli P.M. & Gaddini A., 1979. Nuovi dati su alcuni

Anyphenidae, Liocranidae e Gnaphosidae italiani

(Araneae). Bollettino dell'Associazione Romana di

Entomologia, 34: 10-15.

Brignoli P.M. & Murphy J., 1984. Nuovi dati su alcuni

Gnaphosidae italiani (Araneae). Bollettino dell'As-

sociazione Romana di Entomologia, 38 (1983): 1-4.

Buchar J., Knoflach B. & Thaler K., 2006. On the iden-

tity of Arctosa variana C.L. Koch and Arctosa similis

Schenkel, with notes on related species (Araneae: Ly-

cosidae). Bulletin of the British Arachnological So-

ciety, 13: 329-336.

Buchar J. & Thaler K., 1995. Zur Variation der Kopula-

tionsorgane von Pistius truncatus (Pallas) (Araneida,

Thomisidae) in Mitteleuropa. Linzer biologische Bei-

trage, 27: 653-663.

Burger M., Graber W., Michalik P. & Kropf C., 2006. Sil-

houettella loricatula (Arachnida, Araneae, Oonopi-

dae): A Haplogyne Spider With Complex Female

Genitalia. Journal of Morphology, 267: 663-677.

Canestrini G. & Pavesi P., 1868. Araneidi italiani. Atti

della Societa Italiana di Scienze Naturali, 11: 738-872.

Canestrini G. & Pavesi P., 1870. Catalogo sistematico

degli Araneidi italiani. Archivio per la Zoologia,

l'Anatomia e la Fisiologia, 2: 1-44.

Canestrini G., 1873. Nuove specie italiane di Aracnidi.

Atti della Societa Veneto-Trentina di Scienze Natu-

rali, 2: 45-52.

Canestrini G., 1876. Osservazione aracnologiche. Atti

della Societa Veneto-Trentina di Scienze Naturali, 3:

206-232.

Cannas V.M., 1982. Visioni di un paesaggio carsico. Sa-

dali. Storia e aspetti naturali del suo territorio. Ettore

Gasperini ed., Cagliari, 46-49.

Casale A., 1972. Visione d'insieme del complesso ecolo-

gico e faunistico della Grotta del Bue Marino (Cala

Gonone, Dorgali, NU). Bollettino della Societa Sarda

di Scienze Naturali, 10: 111-136.

Casale A., Grafitti G. & Onnis C., 2004. Sardaphae-

nops adelphus, il nuovo coleottero ipogeo dedicato

a tutti gli speleologi sardi. Antheo, Bolletino

Gruppo speleo-archeologico Giovanni Spano, Ca-

gliari, 8: 30-36.

Cermti M., 1968. Materiali per un primo elenco degli Ar-

tropodi speleobii della Sardegna. Fragmenta Entomo-

logica, 5: 207-257.

Colombo M. & Manunza B., 2009. First record of Cyr-

tarachne ixoides (Simon, 1870) (Araneae: Araneidae)

from Sardinia. Revista Iberica de Aracnologia, 17:

67-70.

Costa A., 1882. Notizie ed osservazioni sulla geofauna

sarda - Memoria Prima. Atti della Reale Accademia

delle Scienze Fisiche e Matematiche di Napoli, 9:

1-42.

Costa A., 1883. Notizie ed osservazioni sulla geofauna

sarda - Memoria Seconda. Atti della Reale Accade-

mia delle Scienze Fisiche e Matematiche di Napoli,

1 serie 2: 1-109.

Costa A., 1884. Notizie ed osservazioni sulla geofauna

sarda - Memoria Terza. Atti della Reale Accademia

delle Scienze Fisiche e Matematiche di Napoli, 1

serie 2: 1-64.

Costa A., 1885. Notizie ed osservazioni sulla geofauna

sarda - Memoria Quarta. Atti della Reale Accademia

100

P. Pantini, A. Sassu & G. Serra

delle Scienze Fisiche e Matematiche di Napoli, 1

serie 2: 1-31.

Costa A., 1886. Notizie ed osservazioni sulla geofauna

sarda - Memoria Quinta. Atti della Reale Accademia

delle Scienze Fisiche e Matematiche di Napoli, 2

serie 2: 1-24.

de Carlini A., 1885. Artropodi dell'isola di S. Pietro. Bol-

lettino della Societa Entomologica Italiana, 17: 192-

196.

Decae A.E. & Di Franco F., 2005. Nemesia sanzoi Fage,

1917 (Araneae, Nemesiidae): first description of the

male and some additional information on the fe-

male, distribution and biology of the species. Bul-

letin of the British Arachnological Society, 13:

133-137.

Deeleman-Reinhold C.L. & Deeleman P.R., 1988. Revision

des Dysderinae (Araneae, Dysderidae), les especes me-

diterraneennes occidentales exceptees. Tijdschrift voor

Entomologie, 131: 141-269.

Di Pompeo P., Kulczycki A., Legittimo C.M. & Simeon

E., 2011. New records for Europe: Argiope trifasciata

(Forsskal, 1775) from Italy and Malta (Araneae, Ara-

neidae). Bulletin of the British Arachnological So-

ciety, 15: 205-208.

Dresco E., 1956. Tegenaria henroti, espece nouvelle des

grottes de Sardaigne. Fragmenta Entomologica, 6:

167-181.

Dresco E. & Hubert M., 1969. Araneae Speluncarum Ita-

liae I. Fragmenta Entomologica, 2: 115-119.

Fontana R., Cantarella T., Sala L. & Tongiorgi P., 1996.

Acolletion of Italian salticids (Araneae), mainly from

the Tuscan-Emilian Apennines. Revue suisse de Zoo-

logie, hors serie: 211-222.

Fresi G., Amo C. & Pantaleoni R. A., 2002. 1 Ragni negli

ecosistemi: prime ricerche in Sardegna. Notiziario

Forestale, Cagliari, 20: 30-33.

Garneri G.A., 1902. Contribuzione alia fauna sarda.

Aracnidi. Bollettino della Societa Zoologica italiana,

serie 2, 3: 57-103.

Gasparo F., 1999. Ridescrizione di Stalita patrizii Rower,

1956, specie tipo del nuovo genere Sardostalita (Ara

Dysderidae). Bollettino del Museo regionale di

Scienze naturali di Torino, 16: 59-76.

Gozo A., 1908. Gli Aracnidi di caveme italiane. Bollettino

della Societa Entomologica Italiana, 38: 109-139.

Grafitti G., 1979. Primi dati sulla fauna di Sa Ucca de Su

Tintirriolu. Bollettino del Gmppo speleologico Sas-

sarese, 5: 32-37.

Grafitti G., 1984. Ricerche faunistiche nelle grotte di

Monte Majore. Bollettino del Gmppo speleologico

Sassarese, 8: 36-44.

Grafitti G., 1993. La fauna della Grotta Sa Rocca Ulari

(Bomtta, Prov. di Sassari). Bollettino del Gmppo spe-

leologico Sassarese, 14: 17-27.

Grafitti G., 2001. Note speleofaunistiche. In: De Waele

J., Onnis C. & Robin Y. 2001. Lovettecannas, dove

le dolomie incontrano i graniti. Speleologia, Rivista

della Societa speleologica Italiana, 45: 26-29.

Grafitti G., 2003. Ricerche faunistiche nella Grotta Is

Zuddas (Santadi-Sardegna sud-occidentale). Sarde-

gna Speleologica, 20: 64-68.

Grafitti G., 2007a. La fauna cavernicola. In: Mucedda

M. & Grafitti G. (eds.) 2007. Le grotte di Bonu

Ighinu nel Comune di Mara. Ed. Segnavia, Sassari,

65-75.

Grafitti G., 2007b. La fauna delle grotte. In: Piras V. (ed.)

2007. Gmttas e Pelciones. Grotte e caverne di terra e

di mare della Planargia e del Montiferm occidentale.

Geologia, geomorfologia, biologia. Ed. Grafiche Edi-

toriali Solinas, Nuoro, 219-227.

Grafitti G. & Merella G., 2008. Ricerche faunistiche in

grotte del Sulcis - Iglesiente. Atti del XX Congresso

Nazionale di Speleologia, Iglesias 27-30 aprile 2007.

Memorie dell’Istituto Italiano di Speleologia, serie

11,21: 83-95.

Grasshoff M., 1959. Dysdera- Arten von Inseln des Mit-

telmeergebietes (Arach., Araneae). Senckenbergiana

biologica, 40: 209-220.

Grasshoff M., 1983. Larinioides Caporiacco 1934, der

korrekte Name fur die sogennante Araneus cornu-

to-Gruppe. Senckenbergiana biologica, 64: 225-

229.

Grill A., Knoflach B., Cleary D.F.R. & Kati V., 2005.

Butterfly, spider, and plant communities in different

land-use types in Sardinia, Italy. Biodiversity and

Conservation, 14: 1281-1300.

Grimm U., 1985. Die Gnaphosidae Mitteleuropas (Ara-

chnida, Araneae). Abhandlungen des Naturwissen-

schaftlichen Vereins in Hamburg, 26 (NF): 5-318.

Grimm U., 1986. Die Clubionidae Mitteleuropas: Corin-

ninae und Liocraninae (Arachnida, Araneae). Abhan-

dlungen des Naturwissenschaftlichen Vereins in

Hamburg, 27 (NF): 3-91.

Hansen H., 1985. Contribute alia conoscenza dei Salti-

cidae italiani (Arachnida: Araneae). Bollettino del

Museo civico di Storia naturale di Venezia, 34(1983):

241-322.

Hansen H., 1986. Die salticidae der coll. Canestrini (Ara-

chnidae: Araneae). Lavori - Societa Veneziana di

Scienze Naturali, 11: 97-120.

Hansen H., 2005. Arachnida Araneae Salticidae + CD-

ROM. In: Ruffo S. & Stoch F. (eds) 2005, Checklist

e distribuzione della fauna italiana. Memorie del

Museo civico di Storia naturale di Verona, 2 Serie,

Sezione Scienze della Vita, 16: 77-78.

Helsdingen P.J. van, 1969. A reclassification of the spe-

cies of Linyphia Latreille based on the functioning of

the genitalia (Araneida, Linyphiidae), I. Zoologische

Verhandelingen, 105: 3-303.

Helsdingen P.J. van, 2005. New spider species records

for Sardinia (Arachnida: Araneae). Nieuwsbrief SPI-

NED, 20: 13-20.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

101

Helsdingen P.J. van, 2012. Araneae. In: Fauna Europaea,

Database European spiders and their distribution - Di-

stribution - Version 2012.1, http://www.faunaeur.org.

Isaia M., 2005. Check-list delle specie di ragni (Ara-

chnida, Araneae) della Val d’ Aosta con una nuova se-

gnalazione per la fauna Italiana. Revue Valdotaine

d’Histoire Naturelle, 59:25-43.

Isaia M., Pantini P., Beikes S. & Badino G., 2007. Cata-

logo ragionato dei ragni (Arachnida, Araneae) del

Piemonte e della Lombardia. Memorie dell’Associa-

zione naturalistica piemontese, 9, 161 pp.

Knoflach B., 1996. Die Arten der Steatoda phalerata-

Gruppe in Europa (Arachnida: Araneae, Theridiidae).

Mitteilungen der Schweizerischen Entomologischen

Gesellschaft - Bulletin de la Societe Entomologique

Suisse, 69: 377-404.

Knoflach B., 1999. The comb-footed spider genera Neot-

tiura and Coleosoma in Europe (Araneae, Theridiidae).

Mitteilungen der Schweizerischen entomologischen

Gesellschaft - Bulletin de la Societe Entomologique

Suisse, 72: 341-371.

Knoflach B., 2004. Diversity in the copulatory behaviour

of comb-footed spiders (Araneae, Theridiidae). De-

nisia 12, zugleich Kataloge der OO. Landesmuseen,

Neue Serie 14: 161-256.

Knoflach B. & Pfaller K., 2004. Kugelspinnen - eine Ein-

fuhrung (Araneae, Theridiidae). Denisia 12, zugleich

Kataloge der OO. Landesmuseen, Neue Serie 14:

111-160.

Knoflach B., Rollard C. & Thaler K., 2009. Notes on Me-

diterranean Theridiidae (Araneae) - II. ZooKeys, 16:

227-264.

Knoflach B. & Thaler K., 2000. Notes on the mediterra-

nean Theridiidae (Araneae). I. Memorie della Societa

Entomologica Italiana, 78: 411-442.

Krauss O., 1955. Spinnen von Korsika, Sardinien und

Elba (Arach., Araneae). Senckenbergiana biologica,

36 (5/6): 371-394.

Kulczycki A., Legittimo C.M., Simeon E. & Di Pom-

peo P., 2012. New records of Steatoda nobilis (Tho-

rell, 1875) (Araneae, Theridiidae), an introduced

species on the Italian mainland and in Sardinia.

Bulletin of the British Arachnological Society, 15:

269-272.

Lana E., Casale A., Giachino P.M. & Grafitti G., 2006.

Attivita biospeleologica anni 2004-2005. Grotte, Bol-

lettino del Gruppo speleologico piemontese CAI-

UGET, Torino, (49) 145: 38-47.

Letardi A. & Pantaleoni R.A., 2007. Survey towards an

inventory of Italian Neuropterida. In: Pantaleoni

R.A., Letardi A. & Corazza C. (ed). Proceedings of

the IX International Symposium on Neuropterology,

Ferrara 20-23 June 2005 [with a Tribute to Maria Ma-

tilde Principi], Annali del Museo civico di Storia na-

turale di Ferrara, 8: 87-93.

Loerbroks A., 1983. Revision der Krabbenspinnen-Gat-

tung Heriaeus Simon (Arachnida: Araneae: Thomi-

sidae). Verhandlungen des Naturwissenschaftlichen

Vereins in Hamburg, 26 (NF): 85-139.

Logunov D., 2004. Notes on the collection of Salticidae

(Araneae) from the Museum of Natural History "En-

rico Gaffi" in Bergamo, Italy. Revista Iberica de

Aracnologia, 9: 271-275.

Logunov D. & Azarkina G.N., 2006. New species and

records of Phlegm from Africa (Araneae, Salticidae).

Revue suisse de Zoologie, 113: 727-746.

Lorn L., Marras P.M., Guidone L., Sassu A., Verdinelli

M., Tavella L. & Pantaleoni R.A., 2008. Importanza

dei predatori generalisti in noccioleti piemontesi e

sardi. In: Scortichini M. (ed.) 2008. La corilicoltura

biologica in Italia. Ed. CRA Centro di Ricerca per la

Frutticoltura, Roma, 111-136.

Lugetti G. & Tongiorgi P., 1965. Revisione delle specie

italiane dei generi Arctosa C.L. Koch e Tricca

Simon con note su una Acantholycosa delle Alpi

Giulie (Araneae, Lycosidae). Redia, 49 (1964-

1965): 165-229.

Lugetti G. & Tongiorgi P., 1969. Ricerche sul genere Alo-

pecosa Simon (Araneae, Lycosidae). Atti della So-

cieta Toscana di Scienze Naturali Memorie, serie B

76: 1-100.

Magretti P., 1878. Rapporto su di un'escursione nella Sar-

degna compiuta nel dicembre 1877. Atti della Societa

Italiana di Scienze Naturali, 21: 451-463.

Magretti P., 1880. Una seconda escursione zoologica al-

fisola di Sardegna. Atti della Societa Italiana di

Scienze Naturali, 23: 18-41.

Marras P.M., Lorn L., Sassu A., Sanna F. & Pantaleoni

R.A., 2011. Influence of ant-exclusion on generalist

predators in a citrus orchard. IOBC/wprs Bulletin Vol

62, 2011: 345-350.

Metzner H., 1999. Die Springspinnen (Araneae, Saltici-

dae) Griechenlands. Andrias, 14: 3-279.

Minelli A., Ruffo S. & La Posta S. (eds.), 1993-1995.

Checklist delle specie della fauna italiana. Edizioni

Calderini, Bologna.

Muccedda M., Grafitti G. & Dore G., 2002. Grotte della

provincia di Sassari. La Celere Editrice, Alghero:

208 pp.

Muster C., 2009. Phylogenetic relationships within Phi-

lodromidae, with a taxonomic revision of Philodro-

mus subgenus Artanes in the western Palearctic

(Arachnida: Araneae). Invertebrate Systematics, 23:

135-169.

Muster C., Bosmans R. & Thaler K., 2007. The Philo-

dromus pulchellus- group in the Mediterranean: taxo-

nomic revision, phylogenetic analysis and

biogeography (Araneae: Philodromidae). Inverte-

brate Systematics, 21: 39-72.

Muster C. & Thaler K., 2004. New species and records

of Mediterranean Philodromidae (Arachnida, Ara-

102

P. Pantini, A. Sassu & G. Serra

neae): I. Philodromus aureolus group. Denisia, 14:

305-326.

Nentwig W., Blick T., Gloor D., Hanggi A. & Kropf C.,

2011. Araneae Spiders of Europe, Version 6.2011.

Web site at http://www.araneae.unibe.ch/

Noflatscher M.T., 1996. Aranei - Spinnen, Webspinnen.

In: Hellrigl K. (ed.) 1996, Die Tierwelt Sudtirols. Ve-

ro ffentlichungen des Naturmuseums Sudtirol, Bozen,

211-228.

Pantini P., in press. Italian araneofauna: the state of our

knowledge. XXXVIII Congresso della Societa Ita-

liana di Biogeografia. Biogeographia vol. XXXI.

Pantini P. & Isaia M., 2008. New records for the Italian

spider fauna (Arachnida, Araneae). Arthropoda Se-

lecta, 17: 133-144.

Pantini P. & Sassu A., 2009. I ragni dell’Isola dell’Asi-

nara (Sardegna NW) (Arachnida, Araneae). Annali

del Museo civico di storia naturale di Genova, 100:

619-647.

Pavesi R, 1876. Le prime crociere del Violante, coman-

dato dal Capitano-Armatore Enrico d' Albertis. Risul-

tati aracnologici. Annali del Museo civico di storia

naturale di Genova, 8: 407-451.

Pavesi R, 1878. Nuovi risultati aracnologici delle Cro-

ciere del "Violante". Aggiunto un catalogo sistema-

tico degli Aracnidi di Grecia. Annali del Museo

civico di storia naturale di Genova, 11: 337-396.

Pesarini C., 1994. Arachnida Araneae. In: Minelli A.,

Ruffo S. & La Posta S. (eds.) 1994. Checklist delle

specie della fauna italiana. Edizioni Calderini, Bolo-

gna, 23, 1-42.

Pesarini C., 2000. Contributo alia conoscenza della fauna

araneologica italiana (Araneae). Memorie della So-

cieta Entomologica Italiana, 78: 379-393.

Platnick N.I., 2012. The world spider catalog, version

12.5. American Museum of Natural History, online

at http://research.amnh.org/iz/spiders/catalog. DOI:

10.5531/db.iz.0001.

Platnick N.I. & Di Franco F., 1992. On the relationships

of the spider genus Cybaeodes (Araneae, Dionycha).

American Museum Novitates, 3053: 1-9.

Pons G., 1993. Noves dades sobre biospeleologia de Sar-

denya: (Arachnida, Araneae). Endins (Palma de Mal-

lorca), 19: 43-47.

Puddu S., 1970. La fauna. In: Bartolo G. & Di Paola A.

1970. Ussassai. Gairo. Osini. Attuali conoscenze spe-

leologiche. A cura dello Speleo Club di Cagliari. Ed.

Sarda Fossataro, Cagliari, 79-93.

Puddu S., 1971. La fauna. In: Bartolo G. & Ferrara R.

197 1 . II Promontorio di S. Elia e le sue grotte. A cura

dello Speleo Club di Cagliari. Ed. Sarda Fossataro,

Cagliari, 67-68.

Puddu S., 1980. La fauna. In: Bartolo G., Dore M. &

Lecis A. 1980. Is Angurtidorgius (La cavita piu vasta

della Sardegna). A cura dello Speleo Club Cagliari.

Ed. GIA, Cagliari, 41-56.

Puddu S., 1983. Attuali conoscenze speleofaunistiche. In:

Bartolo G., Coroneo M. & Lecis A. (eds.) 1983. Su

Marmori (Perla di Ulassai). A cura dello Speleo Club

Cagliari. Ed. Guido Bartolo, Cagliari, 33-40.

Puddu S. & Pirodda G., 1974. Catalogo sistematico ra-

gionato della fauna cavernicola della Sardegna. Ren-

diconti del Seminario della Facolta di Scienze

delTUniversita di Cagliari, 43 (3-4), (1973): 151-205.

Raven R.J., 1985. The spider infraorder Mygalomor-

phae (Araneae): Cladistics and systematics. Bulletin

of the American Museum of Natural History, 182:

1-180.

Roewer C.F., 1953. Cavernicole Arachniden aus Sardi-

nien. Notes biospeleologiques, 8: 39-49.

Roewer C.F., 1956. Cavernicole Arachniden aus Sardi-

nien. II. Fragmenta Entomologica, 2 (9): 97-104.

Ruffo S. & Stoch F., 2005. Checklist e distribuzione della

fauna italiana. Memorie del Museo Civico di Storia

Naturale di Verona, 2a serie, Sezione Scienze della

Vita, 16, 307 pp.

Ruffo S. & Vigna Taglianti A., 2002. Generalita sulla

fauna italiana. In: Minelli A., Chemini C., Argano R.

& Ruffo S. (eds) 2002, La fauna in Italia, Touring

Editore, Milano e Ministero dell’Ambiente e della

Tutela del Territorio, Roma, 24-28.

Sanna B., Puddu S. & Bartolo G., 1972. Su Mannau. Ed.

Fossataro, Cagliari, 97-114.

Senglet A., 2004. Copulatory mechanism in Zelotes,

Drassyllus and Trachyzelotes (Araneae, Gnaphosi-

dae), with additional faunistic and taxonomic data on

Southwest Europe. Mitteilungen der Schweizerischen

entomologischen Gesellschaft - Bulletin de la Societe

Entomologique Suisse, 77: 87-119.

Senglet A., 2011. New species in the Zelotes tenuis-gxovep

and new or little known species in other Zelotes

groups (Gnaphosidae, Araneae). Revue suisse de

Zoologie, 118: 513-559.

Simon E., 1884. Les arachnides de France. La famille des

Theridionidae (suite). Paris, Enciclopedie Roret, L.

Mulo, tomo 5 (2 parte), 180-420.

Simon E., 1914. Les arachnides de France. Synopsis ge-

nerate et catalogue des especes frangaises de l'ordre

des Araneae. Paris, Enciclopedie Roret, L. Mulo,

tomo 6 (1 parte), 1-308.

Simon E., 1926. Les arachnides de France. Synopsis ge-

nerate et catalogue des especes frangaises de l'ordre

des Araneae (suite). Paris, Enciclopedie Roret, L.

Mulo, tomo 6 (2 parte), 309-532.

Simon E., 1929. Les arachnides de France. Synopsis ge-

nerate et catalogue des especes frangaises de l'ordre

des Araneae (suite). Paris, Enciclopedie Roret, L.

Mulo, tomo 6 (3 parte), 533-772.

Simon E., 1932. Les arachnides de France. Synopsis ge-

nerate et catalogue des especes frangaises de l'ordre

des Araneae (suite). Paris, Enciclopedie Roret, L.

Mulo, tomo 6 (4 parte), 773-978.

Catalogue of the spiders (Arachnida Araneae) of Sardinia

103

Tanasevitch A.V., 2011. On linyphiid spiders (Araneae)

from the Eastern and Central Mediterranean kept at

the Museum d’histoire naturelle, Geneva. Revue

suisse de Zoologie, Geneve, 118: 49-91.

Thaler K. & Knoflach B., 1998. Zoropsis spinimana (Du-

four), eine fur Osterreich neue Adventivart (Araneae,

Zoropsidae). Berichte des Naturwissenschaftlich-Me-

dizinischen Vereins in Innsbruck, 85: 173-185.

Thaler K. & Knoflach B., 2003. Zur Faunistik der Spin-

nen (Araneae) von Osterreich: Orbiculariae p.p.

(Araneidae, Tetragnathidae, Theridiosomatidae,

Uloboridae). Linzer biologische Beitrage, 35: 613-

655.

Thaler K. & Knoflach B., 2004. Fauna Austriaca: Web-

spinnen - zur Einfuhrung (Arachnida, Araneae). De-

nisia 12, zugleich Kataloge der OO. Eandesmuseen,

Neue Serie 14: 357-380.

Thaler K., van Harten A. & Knoflach B., 2004. Pirate

spiders of the genus Em C.E. Koch from southern

Europe, Yemen, and Ivory Coast, with two new spe-

cies (Arachnida, Araneae, Mimetidae). Denisia, 13:

359-398.

Thermes G., 1972. Primo contributo alia conoscenza

della fauna araneologica della Sardegna (Fauna ipo-

gea ed epigea). Bollettino della Societa Sarda di

Scienze Naturali, 11: 29-48.

Tongiorgi P., 1966. Italian Wolf Spiders of the Genus

Pardosa (Araneae, Lycosidae). Bulletin of the Mu-

seum of Comparative Zoology, 134: 275-334.

Tongiorgi P., 1974. Some notes on Pardosa occidental is

Simon (Araneae, Lycosidae). Bulletin of the British

Arachnological Society, 3: 62-63.

Tongiorgi P. & Sola C., 1991. Pardosa nigristemis Denis,

1966. A North African component of the Italian and

Spanish arachnofauna. XHIe Colloque Europeen

d’Arachnologie Neuchatel 2-6 sept. 1991, Bulletin de

la Societe neuchateloise des Sciences Naturelles, 116:

241-244.

Trotta A., 2005. Introduzione ai Ragni italiani (Arachnida

Araneae). Memorie della Societa Entomologica Ita-

liana, 83: 3-178.

Trotta A., 2009. Ricerche zoologiche della nave oceano-

grafica “Minerva” (C.N.R.) sidle isole circumsarde.

XXXII. Araneae. Annali del Museo Civico di Storia

Naturale "Giacomo Doria", 100: 481-500.

Trotta A., 2011. Second contribution to the knowledge

of the spiders of Sardinia (Arachnida, Araneae). In:

Nardi G., Whitmore D., Bardiani M., Birtele D.,

Mason F., Spada I. & Cerretti P. (eds) 2011. Biodi-

versity of Marganai and Montimannu (Sardinia). Re-

search in the framework of the ICP Forest network.

Conservazione Habitat Invertebrati, 5: 137-161.

Vigna Taglianti A., Audisio P.A., Belfiore C., Biondi M.,

Bologna M.A., Carpaneto G.M., De Biase A., De Fe-

lici S., Piattella E., Racheli T., Zapparoli M. & Zoia

S., 1992. Riflessioni di gruppo sui corotipi fondamen-

tali della fauna W-Paleartica ed in particolare italiana.

Biogeographia, 16: 159-179.

Vigna Taglianti A., Audisio P.A., Biondi M., Bologna

M.A., Carpaneto G.M., De Biase A., Fattorini S.,

Piattella E., Sindaco R.,Venchi A. & Zapparoli M.,

1999. A proposal for a chorotype classification of the

Near East fauna in the framework of the Western Pa-

leartic region. Biogeographia, 20: 31-59.

Wunderlich J., 1973. Beschreibung einiger bisher unbe-

kannter Arten der Gattung Zodarion Walckenaer aus

Siideuropa (Arachnida: Araneae: Zodariidae). Sen-

ckenbergiana biologica, 54: 171-176.

Wunderlich J., 1995a. Sardinion perplexum n. gen. n. sp.,

eine bisher unbekannte Spinnenart von Sardinien

(Arachnida: Araneae: Theridiidae). Beitrage zur Ara-

neologie, 4 (1994): 687-690.

Wunderlich J., 1995b. Zur kenntnis der Endemiten, zur

evolution und zur Biogegraphie der Spinnen Corsi-

cas und Sardiniens, mit neubeschreibungen (Ara-

chnida: Araneae). Beitrage zur Araneologie, 4

(1994): 353-383.

Wunderlich J., 1995c. Zur kenntnis mediterraner Arten

der Gattung Enoplognatha Pavesi 1880, mit einer

neubeschreibung (Arachnida: Araneae: Theridiidae).

Beitrage zur Araneologie, 4 (1994): 703-713.

Wunderlich J., 1995d. Zur kenntnis West-Palaarktischer

Arten der Gattungen Psammitis Menge 1875, Xysti-

cus C.L. Koch 1835 und Ozyptila Simon 1864 (Ara-

chnida: Araneae: Thomisidae). Beitrage zur

Araneologie, 4 (1994): 749-774.

Wunderlich J., 1995e. Zur taxonomie und Biogeogra-

phie der Arten der Gattung Oecobius Lucas 1846,

mit neubeschreibungen aus der mediterraneis und

von der arabischen Halbinsel (Arachnida: Araneae:

Oecobiidae). Beitrage zur Araneologie, 4 (1994):

585-608.

Wunderlich J., 2011. Extant and fossil spiders (Araneae).

Beitrage zur Areneologie, 6: 1-640.

104

P. Pantini, A. Sassu & G. Serra

INDEX

Family Tetragnathidae

Family Araneidae

Family Lycosidae

ABSTRACT

Family Pisauridae

Family Oxyopidae

INTRODUCTION

Family Zoropsidae

Family Zoridae

ARANEOLOGICAL RESEARCH

Family Agelenidae

IN SARDINIA

Family Hahniidae

Family Dictynidae

MATERIALS AND METHODS

Family Amaurobiidae

Family Titanoecidae

LIST OF SPECIES

Family Miturgidae

Family Anyphaenidae

Family Ctenizidae

Family Liocranidae

Family Nemesiidae

Family Clubionidae

Family Filistatidae

Family Corinnidae

Family Sicariidae

Family Zodariidae

Family Scytodidae

Family Prodidomidae

Family Leptonetidae

Family Gnaphosidae

Family Pholcidae

Family Sparassidae

Family Segestriidae

Family Philodromidae

Family Dysderidae

Family Thomisidae

Family Oonopidae

Family Salticidae

Family Palpimanidae

Family Mimetidae

CONSIDERATIONS ABOUT

Family Eresidae

SARDINIAN ARANEOFAUNA

Family Oecobiidae

Family Uloboridae

CONCLUSIONS

Family Nesticidae

Family Theridiidae

ACKNOWLEDGEMENTS

Family Mysmenidae

Family Linyphiidae

REFERENCES

APPENDIX 1. List of municipalities of the current eight Sardinian provinces. For each

borough the belonging historical province when different from the current is indicated

in brackets. Historical provinces (until 2005) are: Cagliari (CA), Nuoro (NU), Oristano

(OR) and Sassari (SS).

CAGLIARI (CA)

Armungia

Assemini

Ballao

Barrali

Burcei

Cagliari

Capoterra

Castiadas

Decimomannu

Decimoputzu

Dolianova

Domus De Maria

Donori

Ehnas

Escalaplano (NU)

Escolca (NU)

Esterzili (NU)

Gergei (NU)

Gesico

Goni

Guamaggiore

Guasila

Isili NU

Mandas

Maracalagonis

Monastir

Monserrato

Muravera

Nuragus (NU)

Nurallao (NU)

Nuraminis

Nurri (NU)

Orroli (NU)

Ortacesus

Pimentel

Pula

Quartu Sant'Elena

Quartucciu

Sadali(NU)

Samatzai

San Basilio

San Nicolo Gerrei

San Sperate

San Vito

Sant Andrea Frius

Sarroch

Selargius

Selegas

Senorbi

Serdiana

Serri (NU)

Sestu

Settimo San Pietro

Seulo (NU)

Siliqua

Silius

Sinnai

Siurgus Donigala

Soleminis

Suelli

Teulada

Ussana

Uta

Vallermosa

Villa San Pietro

Villanovatulo (NU)

Villaputzu

Villasalto

Villasimius

Villasor

Villaspeeiosa

CARBON I A-IGLESIAS (Cl)

Buggerru(CA)

Calasetta(CA)

Carbonia(CA)

Carloforte(CA)

Domusnovas(CA)

Fluminimaggiore(CA)

Giba(CA)

Gonnesa(CA)

Iglesias(CA)

Masainas(CA)

Musei(CA)

Narcao(CA)

Nuxis(CA)

Perdaxius(CA)

Piscinas(CA)

Portoscuso(CA)

San Giovanni Suergiu(CA)

SantAnna Arresi(CA)

SantAntioco(CA)

Santadi(CA)

Tratalias(CA)

Villamassargia(CA)

V illaperuccio(C A)

MEDIO CAMPIDANO (VS)

Arbus (CA)

Barumini (CA)

Collinas (CA)

Furtei (CA)

Genuri (CA)

Gesturi (CA)

Gonnosfanadiga (CA)

Guspini (CA)

Las Plassas (CA)

Lunamatrona (CA)

Pabillonis (CA)

Pauli Arbarei (CA)

Samassi (CA)

San Gavino Monreale (CA)

Sanluri (CA)

Sardara (CA)

Segariu (CA)

Serramanna CA

Serrenti (CA)

Setzu (CA)

Siddi (CA)

Tuili (CA)

Turri (CA)

Ussaramanna (CA)

Villacidro (CA)

Villamar (CA)

Villanovaforru (CA)

Villanovafranca (CA)

NUORO (NU)

Aritzo

Atzara

Austis

Belvi

Birori

Bitti

Bolotana

Borore

Bortigali

Desulo

Dorgali

Dualchi

Fonni

Gadoni

Galtelli

Gavoi

Irgoli

Lei

Loculi

Lode

Lodine

Lula

Macomer

Mamoiada

Meana Sardo

Noragugume

Nuoro

Oliena

Ollolai

Olzai

Onani

Onifai

Oniferi

Orani

Orgosolo

Orosei

Orotelli

Ortueri

Orune

Osidda

Ottana

Ovodda

Posada

Sarule

Silanus

Sindia

Siniscola

Sorgono

Teti

Tiana

Tonara

Torpe

OGLIASTRA (OG)

Arzana(NU)

Barisardo(NU)

Baunei(NU)

Cardedu(NU)

Elini(NU)

Gairo(NU)

Girasole(NU)

Ilbono(NU)

Jerzu(NU)

Lanusei(NU)

Loceri(NU)

Lotzorai(NLJ)

Osini(NU)

Perdasdefogu(NU)

Seui(NU)

Talana(NU)

Tertenia(NU)

Tortoli(NU)

Triei(NU)

Ulassai(NU)

Urzulei(NU)

Ussassai(NU)

Villagrande Strisaili(NU)

OLBIA-TEMPIO (OT)

Aggius (SS)

Aglientu (SS)

Ala Dei Sardi (SS)

Arzachena (SS)

Badesi (SS)

Berchidda (SS)

Bortigiadas (SS)

Budduso (SS)

Budoni (NU)

Calangianus (SS)

Golfo Aranci (SS)

La Maddalena (SS)

Loiri Porto San Paolo (SS)

Luogosanto (SS)

Luras (SS)

Monti (SS)

Olbia (SS)

Oschiri (SS)

Padru (SS)

Palau (SS)

San Teodoro (NU)

Sant’ Antonio di Gallura (SS)

Santa Teresa di Gallura (SS)

Telti (SS)

Tempio Pausania (SS)

Trinita d’Agultu- Vignola (SS)

ORISTANO (OR)

Abbasanta

Aidomaggiore

Albagiara

Ales

Allai

Arborea

Ardauli

Assolo

Asuni

Baradili

Baratili San Pietro

Baressa

Bauladu

Bidoni

Bonarcado

Boroneddu

Bosa

Busachi

Cabras

Cuglieri

Curcuris

Flussio (NU)

Fordongianus

Genoni (NU)

Ghilarza

Gonnoscodina

Gonnosno

Gonnostramatza

Laconi (NU)

Magomadas (NU)

Marrubiu

Masullas

Milis

Modolo (NU)

Mogorella

Mogoro

Montresta (NU)

Morgongiori

Narbolia

Neoneli

Norbello

Nughedu Santa Vittoria

Nurachi

Nureci

Ollastra Simaxis

Oristano

Palmas Arborea

Pau

Pauli latino

Pompu

Riola Sardo

Ruinas

Sagama (NU)

Samugheo

San Nicolo d'Arcidano

San Vero Milis

Sant'Antonio Ruinas

Santa Giusta

Santulussurgiu

Scano di Montiferro

Sedilo

Seneghe

Senis

Sennariolo

Siamaggiore

Siamanna

Siapiccia

Simala

Simaxis

Sini

Siris

Soddi

Solamssa

Sorradile

Suni (NU)

Tadasuni

Terralba

Tinnura (NU)

Tramatza

Tresnuraghes

Ula Tirso

Uras

Usellus

Villa Verde

Villanova Truschedu

Villaurbana

Zeddiani

Zerfaliu

SASSARI (SS)

Alghero

Anela

Ardara

Banari

Benetutti

Bessude

Bonnannaro

Bono

Bonorva

Borutta

Bottidda

Bultei

Bulzi

Burgos

Cargeghe

Castelsardo

Cheremule

Chiaramonti

Codrongianos

Cossoine

Erula

Esporlatu

Florinas

Giave

Illorai

Ittireddu

Ittiri

Laerru

Mara

Martis

Monteleone Rocca Doria

Muros

Nughedu Di San Nicolo

Nule

Nulvi

Olmedo

Osilo

Ossi

Ozieri

Padria

Pattada

Perfugas

Ploaghe

Porto Torres

Pozzomaggiore

Putifigari

Romana

Santa Maria Coghinas

Sassari

Sedini

Semestene

Sennori

Siligo

Sorso

Stintino

Tergu

Thiesi

Tissi

Torralba

Tula

Uri

Usini

Valledoria

Viddalba

Villanova Monteleone

Biodiversity Journal, 2013, 4 (1): 105-110

Diversity and distribution of seaweeds in the Muttom coastal

waters, south-west coast of India

Cosman Domettila',Thankappan Sarasabai Shynin Brintha 1 , Selvamony Sukumaran 2 & Solomon Jeeva

'Department of Botany, Scott Christian College (Autonomous), Nagercoil - 629 003, Kanyakumari, Tamilnadu, India; e-mail:

solomonjeeva@gmail.com

department of Botany, Nesamony Memorial Christian College, Marthandam - 629 165, Tamilnadu, India

* Corresponding author

ABSTRACT Seaweeds are found in the coastal region between high and low tide, and in the sub-tidal

region up to a depth where 0.01% photosynthetic light is available. Plant pigments, light,

exposure, depth, temperature, tides and the characteristics of the shore combine to create

different environments that determine the distribution and variety of seaweeds. The present

study was conducted at Muttom, formed of different inter-tidal rock shores with rich algal

vegetation. During the study period (January to December 20 1 1 ), a total of 3 8 species of sea-

weeds were recorded. Among them, Ulva fasciata and U. lactuca (green algae); Sargassum

wightii, S. duplicata and Padina tetrastomatica (brown algae); Gracilaria corticata and G.

pygmaea (red algae), were present throughout the study period.

KEY WORDS Diversity; Muttom; Seaweeds; South West Coast of India.

Received 13.08.2012; accepted 09.12.2012; printed 30.03.2013

INTRODUCTION

In the vast ocean realm, several forms of life,

starting from unicellular to multi-cellular flourish,

multiply and disintegrate. It is believed that the first

living cell that appeared on the planet Earth emer-

ged from the ocean. In all its forms, Life has deve-

loped from the growth of mono-cellular algae

(Dhargalkar & Pereira, 2005). It was estimated that

about 90% of the species of marine plants are algae

and about 40% of the global photosynthesis is con-

tributed from algae (Andersen, 1992).

Seaweeds, known as macroalgae, are among the

most important primary producers and act as ecolo-

gical engineers on rocky coasts of the world's oceans.

They are primary producers, shelter, nursery

grounds and food sources for marine organisms.

Seaweeds are not only of high ecological, but also

of great economic importance. Dried thalli are di-

rectly used as human and animal food and also as

fertilizer. Extracted seaweed substances are used as

stabilizers and stiffeners in food industry, cosme-

tics, pharmaceutical industry, and biotechnology

(Jeeva & Kimba, 2009; Wiencke & Bischof, 2012).

Recent research has pointed to new opportunities,

particularly in the field of medicine, associated with

bioactive molecules extracted from seaweeds (Baby

et al., 2012; Jeeva et al., 2012). Moreover, due to

their habitats and biology, seaweeds are relatively

easy to observe, manipulate and measure. There-

fore, they have been widely used as model orga-

nisms for studying biogeographic patterns and

testing various ecological theories, both in intertidal

and subtidal habitats (Murray & Littler, 1984; Bol-

ton et al., 2004; Prathep, 2005).

India has a vast coastline of more than 7000 km,

which harbours a large diversity of marine algal

species (Sahoo et al., 2003). The seaweed flora of

106

C. Domettila,T.S. Shynin Brintha, S. Sukumaran & S.Jeeva

Figures 1-6. Seaweeds from Muttom coastal waters of southwest coast of India. Fig. 1 : Caulerpa racemosa. Fig. 2: Gracilaria

fergusonii. Fig. 3: Gracilaria pygmaea. Fig. 4: Hypnea musciformis. Fig. 5: Padina pavonica. Fig. 6: Sargassum duplication.

Diversity and distribution of seaweeds in the Muttom coastal waters, south-west coast of India

107

INDIA

INDIA ^

Tamil Nadu

•

Muttom coast

•

Indian Ocean

Figure 7. Map showing the study site: Muttom coastal waters, south-west coast of India.

India is highly diversified and comprises mostly of

tropical species, but boreal, temperate and subtro-

pical elements have also been reported. 1153 taxa

of marine algae, including forms and varieties be-

longing to 27 1 genera have been enumerated till

date from the Indian waters. Many of the rocky

beaches, mudflats, estuaries, coral reefs and lagoons

along the Indian coast provide ideal habitats for the

growth of seaweeds (Rao & Mantri, 2006); rich sea-

weed beds occur around Visakhapatnam in the ea-

stern coast, Mahabalipuram, Gulf of Mannar,

Timchendur, Tuticorin, Kanyakumari and Kerala in

the southern coast; Veraval and Gulf of Kutch in

the western coast; Andaman and Nicobar Islands

and Lakshadweep (Kaliaperumal & Pandian, 1984;

Selvaraj & Selvaraj, 1997; Sahoo, 2001; James et

al., 2004; Manilal et al., 2009; Christobel & Jeeva,

2009; Paul & Raja, 2011; Jeeva et al., 2012; Satheesh

& Wesley, 2012).

Southwest coast of India is a unique marine

habitat infested with diverse seaweeds. In recent

years, only a few investigations have been carried

out on various applications and uses of macroalgae

in Kanyakumari district (Bai et al., 2007; Christo-

bel, 2008; Christobel et al., 2011; Jeeva et al.,

2012). However, more studies on various aspects of

macroalgae are still needed, especially, on diversity

and species ric hn ess. Such information could pro-

vide a baseline for future more complex ecological

studies and coastal management, as well as applied

aspects of the uses of seaweed. Therefore, the pre-

sent study was initiated to explore the richness of

seaweeds in Muttom coastal waters of southwest

coast of India.

MATERIALS AND METHODS

The present study was carried out at Muttom

coast in southwest coast of India (Fig. 7), in the Ara-

bian Sea. Muttom sports a beautiful and tidy beach

with rocky shores showing an astonishing biodiver-

sity. Huge rocks standing at either sides of the beach

give it a pristine look. Since the shore is usually no

108

C. Domettila,T.S. Shynin Brintha, S. Sukumaran & S.Jeeva

BOTANICAL NAME

PHYLUM

CLASS

FAMILY

Amphiroa anceps (Lamarck) Decaisne

Rhodophyta

Florideophyceae

Corallinaceae

Asparagopsis taxiformis (Delile) Trevisan de Saint-Leon

Rhodophyta

Florideophyceae

B onnemai soniac e a e

Caulerpa peltata J.V.Lamouroux

Chlorophyta

Bryopsidophyceae

Caulerpaceae

Caulerpa racemosa (Forsskal) C. Agardh (Fig. 1)

Chlorophyta

Bryopsidophyceae

Caulerpaceae

Caulerpa scalpelliformis (R. Brown ex Turner) C.Agardh

Chlorophyta

Bryopsidophyceae

Caulerpaceae

Centroceras clavulatum ( C. Agardh) Montagne

Rhodophyta

Florideophyceae

Ceramiaceae

Ceratodictyon variablile (C. Agardh) R. E. Norris

Rhodophyta

Florideophyceae

Lomentariaceae

Chaetomorpha antennina (Bory de Saint- Vincent) Kutzing

Chlorophyta

Ulvophyceae

Cladophoraceae

Chnoospora implexa C. Agardh

Ochrophyta

Phaeophyceae

S cyto siphonaceae

Chondrophycus ceylanicus (C. Agardh) M.J.Wynne,

Serio, Cormaci et G. Fumari

Rhodophyta

Florideophyceae

Rhodomelaceae

Dictyota bartayresiana J. V. Lamouroux

Ochrophyta

Phaeophyceae

Dictyotaceae

Dictyota ciliata C. Agardh

Ochrophyta

Phaeophyceae

Dictyotaceae

Dictyota dichotoma (Hudson) J. V. Lamouroux

Ochrophyta

Phaeophyceae

Dictyotaceae

Enantiocladia prolifer a Falkenberg

Rhodophyta

Florideophyceae

Rhodomelaceae

Gelidiella indica Sreenivasa Rao

Rhodophyta

Florideophyceae

Gelidiellaceae

Gelidium pusillum (Stackhouse) Le Jolis

Rhodophyta

Florideophyceae

Gelidiaceae

Gracilaria corticata (C. Agardh) C. Agardh

Rhodophyta

Florideophyceae

Gracilariaceae

Gracilaria fergusonii C. Agardh (Fig. 2)

Rhodophyta

Florideophyceae

Gracilariaceae

Gracilaria foliifera (Forsskal) Borgesen

Rhodophyta

Florideophyceae

Gracilariaceae

Gracilaria pygmaea Borgesen (Fig. 3)

Rhodophyta

Florideophyceae

Gracilariaceae

Grateloupia lithophila Borgesen

Rhodophyta

Florideophyceae

Halymeniaceae

Hypnea musciformis (Wulfen) J. V. Lamouroux (Fig. 4)

Rhodophyta

Florideophyceae

Cystocloniaceae

Hypnea valentiae (Turner) Montagne

Rhodophyta

Florideophyceae

Cystocloniaceae

Laurencia poitei (J. V. Lamouroux) M. A. Howe

Rhodophyta

Florideophyceae

Rhodomelaceae

Neurymenia fraxinifolia (Mertens ex Turner) C. Agardh

Rhodophyta

Florideophyceae

Rhodomelaceae

Padiiia pavonica (Linnaeus) Thivv (Fig. 5)

Ochrophyta

Phaeophyceae

Dictyotaceae

Padina tetrastomatica Hauck

Ochrophyta

Phaeophyceae

Dictyotaceae

Palisada flagellifera (C. Agardh) K.W.Nam

Rhodophyta

Florideophyceae

Rhodomelaceae

Portieria hornemannii (Lyngbye) R C. Silva

Rhodophyta

Florideophyceae

Rhizophyllidaceae

Sargassum duplication (C. Agardh) C. Agardh (Fig. 6)

Ochrophyta

Phaeophyceae

Sargassaceae

Sargassum linearifolium (Turner) C. Agardh

Ochrophyta

Phaeophyceae

Sargassaceae

Sargassum poly cy stum C. Agardh

Ochrophyta

Phaeophyceae

Sargassaceae

Sargassum swartzii C. Agardh

Ochrophyta

Phaeophyceae

Sargassaceae

Sargassum wightii Greville ex C. Agardh

Ochrophyta

Phaeophyceae

Sargassaceae

Trichosolen mucronatus (Borgesen) W. R. Taylor

Chlorophyta

Bryopsidophyceae

Bryopsidaceae

Ulva fasciata S. G. Gray

Chlorophyta

Ulvophyceae

Ulvaceae

Ulva lactuca Linnaeus

Chlorophyta

Ulvophyceae

Ulvaceae

Ulva reticulata Forsskal

Chlorophyta

Ulvophyceae

Ulvaceae

Table 1 . List of species found in the study area with their scientific names, class and family.

Diversity and distribution of seaweeds in the Muttom coastal waters, south-west coast of India

109

■ Bryopsidophyceae

■ Florideophyceae

■ Phaeophyceae

■ Ulvophyceae

Of the 38 species, 19 were from the class of Flo-

rideophyceae (50%), 11 species from Phaeophyceae

(28.9%), while the remaining eight species from

Bryopsidophyceae and Ulvophyceae (10% and

11% each) (Fig. 8). Finally, the seaweeds observed

in the present study are similar to those reported

from the nearby Kudankulam coast (Satheesh &

Wesley, 2012); and the very high richness of sea-

weeds species in Muttom coastal waters may be due

to the presence of intertidal rocky reefs.

Figure 8. Class-wise distribution percentage of species ri-

chness in the study area.

crowded, it is an excellent spot for tourists to enjoy

its beauty.

Field surveys were undertaken in the selected

sampling stations of the Muttom coast over a period

of twelve months from January to December 2011.

The algal samples were collected in every season

during the study period by detaching a portion

from the seaweed bed, keeping it in polythene bags

with fresh seawater, transporting to the laboratory

and fixing in 4% formaldeyde for further studies.

The seaweeds were identified using the taxonomic

keys provided by Srinivasan (1969; 1973), and the

nomenclature was updated using Appeltans et al.

(2012) and Guiry & Guiry (2012).

RESULTS AND DISCUSSION

Taxonomically, a total of 38 taxa belonging to

3 phyla (Chlorophyta, Ochrophyta and Rhodo-

phyta), 4 classes (Bryopsidaceae, Florideophy-

ceae, Phaeophyceae and Ulvophyceae), 23 genera

and 1 8 families were inventoried in the Muttom

coastal waters (Table 1). Among the 18 families,

Dictyotaceae, Rhodomelaceae and Sargassaceae

were the most richest ones (5 species each), fol-

lowed by Gracilariaceae (4 species), Caulerpaceae

and Ulvaceae (3 species each) and Cystoclonia-

ceae (2 species), whereas the remaining families

(Bonnemaisoniaceae, Bryopsidaceae, Ceramia-

ceae, Cladophoraceae, Corallinaceae, Gelidiaceae,

Gelidiellaceae, Halymeniaceae, Lomentariaceae,

Rhozophyllidaceae and Scytosiphonaceae) were

monospecific.

ACKNOWLEDGEMENTS

The authors are thankful to Dr. P. Charles, Head,

Department of Botany, Scott Christian College (Au-

tonomous), Nagercoil for providing necessary faci-

lities and encouragement.

REFERENCES

Andersen R. A., 1992. Diversity of eukaryotic algae. Bio-

diversity and Conservation, 1: 267-292.

Appeltans W., Bouchet P., Boxshall, G.A., De Broyer, C.,

de Voogd, N.J., Gordon, D.P., Hoeksema, B. W., Hor-

ton, T., Kennedy, M., Mees, J., Poore, G.C.B., Read,

G., Stohr, S., Walter, T.C. & Costello, M.J. (Eds.),

2012. World Register of Marine Species.

http://www.marinespecies.org.

Baby V.A., Appavoo M.R. & Huxley V.A.J., 2012. Anti-

bacterial effects of Ulva faciata extracts on nosoco-

mial pathogen Pseudomonas aeruginosa. Journal of

Basic and Applied Biology, 5: 204-208.

Bai N.R., Banu N.L., Prakash J.W. & Goldi S.J., 2007.

Effects of Asparagopsis taxiformis extract on the

Growth and Yield of Phaseolus aureus. Journal of

Basic and Applied Biology, 1: 6-11.

Bolton J.J., Leliaert F., De Clerk O., Anderson R.J., Ste-

genga H., Engledow H.E. & Coppejans, E., 2004.

Where is the western limit of the tropical Indian

Ocean seaweed flora? An analysis of intertidal sea-

weed biogeography on the east coast of South Africa.

Marine Biology, 144: 51-59.

Christobel G.J., 2008. Effect of seaweed ( Sargassum wi-

ghtii L.) on the germination and growth of green

gram {Phaseolus aureus L.). Journal of Basic and

Applied Biology, 2: 105-108.

Christobel G.J. & Jeeva S., 2009. The diversity and di-

stribution of the seaweeds of Manavalakurichi, south

west coast of India. In: Abstracts of the National Se-

minar on Marine Resources: Sustainable Utilization

and Conservation, Organized by Department of Plant

110

C. Domettila,T.S. Shynin Brintha, S. Sukumaran & S.Jeeva

Biology and Biotechnology, St. Mary’s College,

Thoothukudi, p. 37.

Christobel G.J., Lipton A.P., Aishwarya M.S., Sarika

A.R. & Udayakumar A., 2011. Antibacterial activity

of aqueous extract from selected macroalgae of sou-

thwest coast of India. Seaweed Research and Utili-

zation, 33: 67-75.

Dhargalkar V.K. & Pereira N., 2005. Seaweeds: promi-

sing plants of the millennium. Science and Culture,

71: 60-66.

Guiry M.D. & Guiry G.M., 2012. Algaebase. World-wide

electronic publication, National University of Ireland,

Galway, http://algaebase.org

James J.E., Kumar R.A.S. & Raj A.D.S., 2004. Marine

algal flora from some localities of south east coast of

Tamilnadu. Seaweed Research and Utilization, 26:

33-39.

Jeeva S. & Kiruba S., 2009. Bioremediating and biome-

diating potential of seaweeds. In: Abstracts of the Na-

tional Seminar on Marine Resources: Sustainable

Utilization and Conservation, Organized by Depar-

tment of Plant Biology and Biotechnology, St. Mary’s

College, Thoothukudi, p. 38.

Jeeva S., Johnson M., Domettila C., Babu A. & Mahesh

M., 2012. Preliminary phytochemical studies on

some selected seaweeds from Gulf of Mannar, India.

Asian Pacific Journal of Tropical Biomedicine, 2

(SI): S30-S33.

Kaliaperumal N. & Pandian G., 1984. Marine algal flora

from some localities of south Tamilnadu coast. Jour-

nal of the Marine Biological Association of India, 26:

159-164.

Manilal A., Sujith S., Kiran G.S., Selvin J., Shakir C.,

Gandhimathi R. & Panikkar M.V.N., 2009. Biopoten-

tials of seaweeds collected from southwest coast of

India. Journal of Marine Science and Technology, 17:

67-73.

Murray S.N. & Littler M.M., 1984. Analysis of seaweed

communities in a disturbed rocky intertidal environ-

ment near Whites Point, Los Angeles, Calif., U.S.A.

Hydrobiologia, 116/117: 374-382.

Paul J.J.P. & Raja D.P, 2011. Studies on the distribution

of seaweed resources in Kanyakumari region, the

south east coast of Tamilnadu. Journal of Basic and

Applied Biology, 5: 246-251.

Prathep A., 2005. Spatial and temporal variations in di-

versity and percentage cover of macroalgae at Siri-

nart marine national park, Phuket provine, Thailand.

Science Asia, 31: 225-233.

Rao P.V.S. & Mantri V.A., 2006. Indian seaweed resour-

ces and sustainable utilization: scenario at the dawn

of a new century. Current Science, 91: 161-174.

Sahoo D., 2001. Seaweeds of Indian coast. A.P.H. Publi-

shing Corporation, New Delhi, 283 pp.

Sahoo D., Sahu N. & Sahoo D., 2003. A critical survey

of seaweed diversity of Chilika lake, India. Algae, 18:

1 - 12 .

Satheesh S. & Wesley S.G., 2012. Diversity and distri-

bution of seaweeds in the Kudankulam coastal wa-

ters, south-eastern coast of India. Biodiversity

Journal, 3: 79-84.

Selvaraj R. & Selvaraj R., 1997. Distribution and diver-

sity of seaweeds in Tiruchendur and Idianthakarai.

Seaweed Research and Utilization, 19: 115-123.

Srinivasan K.S., 1969. Phycologia Indica, Vol. I. Bota-

nical Survey of India, Culcutta, 52 pp.

Srinivasan K.S., 1973. Phycologia Indica, Vol. II. Bota-

nical Survey of India, Culcutta, 60 pp.

Wiencke C. & Bischof K. (Eds.), 2012. Seaweed Bio-

logy. Springer- Verlag, Berlin, Heidelberg.

Biodiversity Journal, 2013, 4 (1): 111-116

Assessment of existing mangrove plantation along Kuwait

coastline

Laila Almulla*, Narayana Bhat, Binson Thomas, Lekha Rajesh, Sasni AN & Preetha George

Aridland Agriculture and Greenery Department, Kuwait Institute for Scientific Research, Kuwait

■"Corresponding author: lmulla@kisr.edu.kw

ABSTRACT A survey was conducted to study the quantitative and qualitative assessment of the existing

mangrove plantations of Kuwait and their chances of settlement and development in this

area. The study suggests that the Kuwait coastline has many good potential sites for man-

groves, however the fast developmental activities and human interference pose a threat to

their existence. These sites should be properly protected and designed to better assess the

growth and development of mangrove plantations.

KEY WORDS Avicennia marina', anaerobic condition; marine ecosystems; marine fauna; pneumatophores.

Received 22.8.2012; accepted 2.12.2012; printed 30.03.2013

INTRODUCTION

Avicennia marina (Forsk.) Vierh are salt-tolerant

halophytic mangrove trees that grow in intertidal

zones and form habitats for many marine species.

Mangrove communities have always been regarded

as an important component of renewable natural re-

sources in coastal regions. As coastal and marine

resources are of significant importance to Kuwait,

any improvement in the coastal vegetation would

significantly enhance the ecological and economic

sustainability of such resources.

The fact that mangroves previously existed in

Kuwait, and the fact that the prevailing climatic and

soil conditions in the northern part of Kuwait are

comparable with those of mangrove-growing areas

in Bahrain and Saudi Arabia (Subandar et al., 2001),

support the expectation that Kuwait could establish

mangrove plantations to rehabilitate its coastal envi-

ronment. Previous research efforts at the Kuwait In-

stitute for Scientific Research (KISR) clearly

established technical and environmental feasibility

of growing mangroves successfully in Kuwait (Abu

El-Nil, 1994; Abu El-Nil et al., 2001; Bhat et al.,

2002, 2003, 2004, 2007).

It has been reported that extensive intertidal

planting of mangroves could produce fertile nursery

grounds, and increase yields of fish species and ma-

rine fauna (Bhat et al., 2007; Al-Nafisi et al., 2009).

The Kuwait bay experienced a massive fish kill du-

ring August and September 2001, due to bacteria

Streptococcus agalactiae (Gilbert et al., 2002), re-

sulted in poor water quality and hypoxic condition

due to high rate of fish decomposition affecting the

mangrove plantations in the coastal area.

Mangrove plantations along coastal areas are

beneficial to scale down the impact of the natural

disasters like tsunamis, storm and erosion. The root

systems of mangroves slow down wave energy of

tidal water and the sediments carried by the tides

are deposited here enriching environment for ma-

rine species. Hence, mangrove communities play a

great role in maintaining biodiversity. They consti-

tute an important component of the renewable na-

tural vegetative resources of the coastal zones in

many tropical and subtropical parts of the world.

112

L.Almulla, N.R. Bhat, B.M. Thomas, L. Rajesh, S.Ali & P. George

Figure 1. Young healthy mangrove plant. Figure 2. Full-grown mangrove plant flowering profusely. Figure 3. Progressive

drying in an established mangrove plantation. Figure 4. Measuring the height and canopy spread of an existing mangrove

plant. Figure 5. Counting the leaves of an existing mangrove plant. Figure 6. Established mangrove plantation with profuse

pneumatophores.

Assessment of existing mangrove plantation along Kuwait coastline

113

Figure 7. Close up view of healthy pneumatophores.

They are the most prominent salt-tolerant fo-

rest trees of intertidal regions; they grow in saline,

anoxic soils under conditions characterized by a

combination of high temperature and irradiance

(Stewart & Popp, 1987; Medina, 1999). The man-

groves have become the center of discussions in

many coastal, environmental and pollution issues.

As part of a greenery program, mangrove planta-

tions being highly salt-tolerant, offer best chance

for enhancing greenery along Kuwait’s coastline

depending on the natural high-low tide of seawater

(Bhat et al., 2002).

KISR has been involved in research on man-

groves since 1992. Over the past several years,

KISR has perfected techniques of mass propaga-

tion, hardening and growing mangrove plants

(Avicennia marina ) under Kuwait's environmental

conditions. It has successfully established expe-

rimental plantations along Kuwait's coastline, and

demonstrated the positive impacts of mangrove

plantations in coastal and marine ecosystems

(Bhat et al., 2002, 2007; Bhat & Suleiman, 2004;

Al-Nafisi et al., 2009).

The study as a part of the Biodiversity of Ter-

restrial Ecosystems Program, was implemented

by the Aridland Agriculture and Greenery Depar-

tment (AAD) of Kuwait Institute for scientific re-

search (KISR) to evaluate the status of existing

mangrove plantations at different locations along

the coastal bay.

MATERIALS AND METHODS

A survey was conducted by the project team

along the coastline of Kuwait in November 2011,

to locate and enumerate the existing mangrove

plantations. Seven mangrove plantations were iden-

tified during that survey and the field evaluation of

the existing mangrove plantations along Kuwait

Bay was assessed (Fig.l). The main objective was

to study the growth of the nearly 15-y-old man-

grove plants amidst the man-made adversities and

vagaries of nature present in Kuwait.

Those seven plantations were identified, and

then assessed qualitatively and quantitatively to

evaluate their physical and physiological status

(Fig. 2). Each plantation was provided with an iden-

tification code, and the GPS coordinates were re-

corded for future reference. Each mangrove

plantation was subdivided into smaller groups to fa-

cilitate access and to ensure accurate observations.

Each plantation was assessed visually for the pa-

rameters like plant mortality, dieback, leaf scorching,

branching, pneumatophores presence, establi-

shment, and rated on a scale from zero to five.

The total score was computed to assess the overall

performance of the plantation. Quantitative evalua-

tion included number of trees, average number of

leaves of apical shoot one-foot length, maximum

plant height, plantation height, canopy spread and

number of pneumatophores per square foot (Figs.

3-7).

RESULTS AND DISCUSSION

Mangrove plantations were found to thrive best

in fine-textured soils composed of muddy clay

loam. To a great extent, the height and frequency

of tides determine the texture and composition of

soils in coastal sites. Only those sites where tides

regularly cover the entire area were found ideal for

mangrove plantation. Mangrove plantations cannot

be established in every available site or vacant mud-

flat, as site and environmental conditions largely

determine the successful establishment, producti-

vity and sustainability of mangrove ecosystems.

The quantitative observations recorded to assess

the existing mangrove plantations are presented in

114

L.Almulla, N.R. Bhat, B.M. Thomas, L. Rajesh, S.Ali & P. George

Site

Code

GPS Coordinates

No. of

Tree

Group

No.

Trees

Average

No.of

Leaves/

Shoot

MP-1

29° 20’ 11.6" N

47°54' 17.0” E

80.0

MP-2

29° 20' 00.2" N

47°54' 09.1" E

61.0

MP-3

29° 20’ 03.1" N

47 °54' 07.0" E

50.0

MP-4

29° 19' 02.0" N

47° 51’ 40.7" E

100

39.9

MP-5

29° 19' 02.1 "N

47° 51' 03.0" E

48.0

MP-6

29° 19’ 09.9" N

47° 50’ 14.0" E

225

39.5

MP-7

29° 35' 58.3" N

48° 09' 21.9" E

32.0

Table 1. Quantitative assessment of mangrove {Avicennia

marina ) plantations in Kuwait- January 2012.

Site

Code

Max.

Plant

Height

(m)

Average

Plantation

Height

(m)

Canopy

Spread

(m 2 )

Pneu-

mato-

phore

(No./ Ft 2 )

MP-1

3.8

1.88

600.0

30.0

MP-2

7.4

3.50

489.0

30.4

MP-3

4.5

2.35

647.0

16.4

MP-4

4.0

1.80

571.2

15.1

MP-5

4.0

2.00

68.8

52.0

MP-6

4.0

2.50

577.8

63.5

MP-7

3.5

1.70

90.0

32.0

Physiological Expression

Site code

Mortality

Dieback

Leaf

Scorching

Branches

MP-1

High

Moderate

High

MP-2

Moderate

Low

Moderate

MP-3

Nil

Moderate

MP-4

Low

Moderate

MP-5

Low

Moderate

MP-6

High

Moderate

MP-7

High

Moderate

Table 3. Qualitative assessment of physiological expression

of existing mangrove plantations in Kuwait- January 2012.

Pneumatophores

Site code

Establis-

hment

Presence

Health

Total

Score

(Max 50)

MP-1

Excellent

Moderate

Good

MP-2

Very Good

Moderate

Fair

MP-3

Good

High

Good

MP-4

Excellent

Moderate

Fair

MP-5

Poor

High

Fair

MP-6

Good

Profuse

Very Good

MP-7

Fair

Moderate

Good

Table 2. Vegetative assessment of mangrove ( Avicennia

marina ) plantations in Kuwait- January 2012.

Table 4. Qualitative assessment of existing mangrove

plantations in Kuwait- January 2012.

Assessment of existing mangrove plantation along Kuwait coastline

115

tables 1 and 2, respectively. Based on the quantita-

tive data on Tables 3 and 4 among the seven plan-

tations identified, two plantations had above

average establishment, scoring 37 points out of 50;

whereas three plantations had average performance

and establishment despite no active management

or protection. Two plantations exhibited below

average establishment, scoring below 30.

The study revealed that few sites along Kuwait

Bay appear to have excellent establishment of man-

grove plantation. These areas were found to have

periodical flushing of tidal water and not contami-

nated by any human activities. The major reasons

for poor performance of established mangrove plan-

tations were due to lack of proper management and

the lack of favourable atmosphere for the healthy

growth of pneumatophores. Fast developemental

activities along the coastal area pose severe threat

to mangrove plantations in the existing areas. The

textural composition, salinity of the surface layer and

occurrence of anaerobic condition play a major role

in the establishment and growth of mangrove see-

dlings (Bhat & Suleiman, 2004). Many researchers

have reported that rapid and poorly planned coa-

stal development programs have contributed to

the destruction of suitable habitats for mangrove

and its disappearance from Kuwait (Abu El-Nil et

al., 2001). Salinity has been recognized as a critical

factor in regulating survival growth, regeneration

and zonation in mangrove species (Semeniuk,

1983).

The satisfactory establishment in most of the

existing mangrove plantations, despite the harsh cli-

matic conditions supports the idea for further large-

scale establishment of mangrove plantations in

Kuwait. This finding needs to be confirmed through

evaluation of the physical and chemical properties

of the soils. Providing good habitat and proper ma-

nagement can provide good mangrove plantations

along Kuwait coastline.

ACKNOWLEDGEMENTS

The authors would like to thank the Kuwait In-

stitute for Scientific Research (KISR) for con-

tinued interest in and encouragement of the scien-

tific research.

REFERENCES

Abu El-Nil M., 1994. Mangrove introduction along Ku-

waits’s seashore. Proceedings of the Workshop on the

Use of Sea Water in Irrigation. Kuwait Institute for

Scientific Research, Kuwait, pp. 68-101.

Abu El-Nil M., Al-Sabah L., Al-Menaie H., Hussain J.,

Al-Melhem S., Al-Mattar S. & Al-Ajeel A., 2001. In-

troduction of mangroves to the coastline of Kuwait.

In: Bhat N.R., Taha F.K. & Nasser A. Y. (Eds.). Man-

grove Ecosystems: Natural Distribution, Biology and

Management. Kuwait Institute for Scientific Rese-

arch, pp. 181-194.

Al-Nafisi R. S., Al-Gharib A., Gharib I. & Bhat N.R.,

2009. Positive impacts of mangrove plantations on

Kuwait's coastal environment. European Journal of

Scientific Research, 26: 510-521.

Bhat N.R. & Suleiman M.K., 2004. Classification of soils

supporting mangrove plantation in Kuwait. Archives

of Agronomy and Soil Science, 50: 535-551.

Bhat N.R., Al-Menaie H. & Shahid S.A., 2002. Esta-

blishment of mangrove plantations for protection

and enrichment of Kuwait coastlines. Proceedings

of the International Symposium on Mangroves and

Salt Marsh Ecosystems. Environmental Research

and Wildlife Development Agency, Abu Dhabi,

UAE.

BhatN.R., Al-Nasser A., Suleiman M.K. &Al-MullaL.,

2003. Growing Mangroves for Enrichment of Kuwai-

t's Coastline: Guidelines and Recommendations. Ku-

wait: Kuwait Institute for Scientific Research,

Kuwait, 25 pp.

Bhat N.R., Al-Nasser A., Suleiman M.K. & Al-Mulla

L. , 2007. Growing Mangroves for Enrichment of

Kuwait's Coastline: Guidelines and Recommenda-

tions. 2nd ed. Kuwait: Kuwait Institute for Scientific

Research.

Bhat N.R., Al-Ali E. H., Suleiman M.K., Al-Menaie H.,

Al-Mulla L., Christopher A. & Ferrin J., 2004. Use

of hydrophilic polymers and mulches for water con-

servation in greenery projects in Kuwait. Kuwait In-

stitute for Scientific Research, Report No. KISR

7287, Kuwait.

Gilbert P.M., Landsberg J.H., Evans. J.J., Al-Sarawi

M. A., Faraj M., Al-Jarallah M.A., Haywood A.,

Ibrahem S., Klesius P., Powell C. & Shoemaker C.,

2002. A fish kill of massive proportion in Kuwait

Bay, Arabian Gulf, 2001: the roles of bacterial di-

sease, harmful algae, and eutrophication. Harmful

Algae 1: 215-231.

Medina E., 1999. Mangrove physiology: the challenge

of salt, heat, and light stress under recurrent flooding.

In: Yanez-Arancibia A. & Lara-Dominguez A. L.

(Eds.). Ecosistemas de Manglar en America Tropical.

116

L.Almulla, N.R. Bhat, B.M. Thomas, L. Rajesh, S.Ali & P. George

Instituto de Ecologia. A.C. UICN/ORMA, Costa

Rica, NOAA/NMFS Silver Spring MD USA, pp.

109-126.

Semeniuk V., 1983. Mangrove distribution in Northwe-

stern Australia in relationship to regional and local

freshwater seepages. Vegetatio, 53: 11-31.

Stewart G.R. & Popp M., 1987. The ecophysiology of

mangroves. In: R.M. Crawford (Ed.). Plant life in

aquatic and amphibious habitats. Academic Press,

London, 333-345 pp.

Subandar A., Alhazeem S. & Alsaffar A.H., 2001. Man-

grove planting scheme in Kuwait: An evaluation and

advantages. In: Bhat N.R., Taha F.K. & Nasser A. Y.

(Eds.). Mangrove Ecosystems: Natural Distribution,

Biology and Management. Kuwait Institute for

Scientific Research, pp. 219-234.

Biodiversity Journal, 2013, 4 (1): 117-124

Breeding biology of Eleonora’s Falcon, Fa/co eleonorae Gene,

1 839 (Accipitriformes Falconidae), in Northeast Algeria at

Serigina Island

SalahTelailia 1 , Menouar Saheb 2 , Lamia Boutabia 1 , Mourad-Abdelkrim Bensouilah 3 & Moussa Houhamdi 4 *

1 Dcpartcmcnt d’ Agronomie, Universite d’El-Tarf, Algerie

2 Departement de Biologie, Faculte des Sciences, Universite d’Oum El-Bouaghi, Algerie

’Departement des Sciences de la mer, Faculte des Sciences, Universite d’Annaba, Algerie

4 Departement des Sciences de la Nature et de la Vie, Faculte SNV-STU, Universite 8 Mai 1945 de Guelma, Algerie; email:

houhamdimoussa@yahoo.fr

"■Corresponding author

ABSTRACT The Eleonora’s Falcon, Falco eleonorae Gene, 1 839 (Accipitriformes Falconidae), is a long

migrant and a seabird of conservation concern. After discovering the Serigina colony in

Northeast Algeria, data on laying period, reproductive success, and nestling growth were

collected. A total of 18 nests were located and surveyed during the breeding season of 2006.

The species started to lay eggs in late July and the majority of nests contained 3 eggs. There

was no variation in the mean eggs volume and weight between different clutches. The mean

clutch size was 2.39 ± 0.78 eggs and the hatching success was 53.5%. Productivity per nest

was 0.39 ± 0.40 chick, lower than previous published works. Inclement weather and avian

predation was thought to be the main sources of chicks’ mortality. Nestling growth for both

body mass and wing span fitted a linear fashion during the first 25 days in nestling life. The

accelerated chick growth suggested food availability and high parental provisioning. Finally,

we think that Algerian’s coast could support other large colonies that should be discovered,

surveyed, and conserved.

KEY WORDS Breeding biology; breeding success; Eleonora’s Falcon; marine bird; nestling.

Received 06.09.2012; accepted 06.12.2012; printed 30.03.2013

INTRODUCTION

The global breeding population of the Eleo-

nora’s Falcon, Falco eleonorae Gene, 1839 (Acci-

pitriformes Falconidae), was recently updated by

Dimalexis et al. (2008) giving a number of more

than 13,500 pairs over the Mediterranean region,

Atlantic Morocco, and the Canary Islands. This

long migrant raptor covers a distance of more than

9,000 km from its breeding areas to its wintering

ground mainly in Madagascar by crossing the

whole African continent including the Sahara (Del-

gado & Quilis, 1990; Gschweng et al., 2008;

Fopez-Fopez et al., 2009; Fopez-Fopez et al.,

2010). Although the main global breeding popula-

tion occurs in Greece (Dimalexis et al., 2008), sub-

stantial and probably underestimated proportion

also nests in North Africa.

In Tunisia, most breeding pairs reproduce in the

Galite Archipelago, North of the country off coast

(Hamrouni, 2007). Breeding records in Algerian co-

lonies have been started in the mid twentieth cen-

tury (Faferrere & Mayaud, 1960), followed by

subsequent counts made mainly in islands near

Skikda (East coast) and the Habibas Islands (West

coast) but the numbers recorded have never excee-

118

S.Telailia, M. Saheb, L. Boutabia, M.-A. Bensouilah & M. Houhamdi

Figure 1. Map presenting the study site: Serigina island, Northeast Algeria.

Figures 2-4. Serigina island

Breeding biology of Eleonora’s Falcon, Falco eleonorae Gene, 1839, in Northeast Algeria at Serigina Island

119

ded 50 breeding pairs (Le Fur, 1975; Michelot &

Laurent, 1988; Michelot & Laurent, 1993; Rguibi et

al., 2012). In Morocco, the breeding range is restric-

ted to two colonies (Essaouira’s islands and Sale’s

sea cliff) situated on the Atlantic coast (Walter, 1979;

Bergier, 1987; Thevenot et al., 2003). However, se-

veral coastal islands of the three countries hosting

eventual suitable breeding habitats remain still unex-

plored. Most works have focused on the diet and mi-

gration of the species (Walter, 1979; Delgado &

Quilis, 1990; Gschweng et al., 2008; Lopez-Lopez

et al., 2009; Diaz-Portero et al., 2009). Breeding bio-

logy and ecology were also well studied in different

geographic areas within the species breeding range;

however, reproductive parameters of Algerian co-

lonies have never been investigated.

This study was conducted on an Eleonora’s Fal-

con colony in the Algerian East coast (Figs. 1-4)

and provides the first contribution on its breeding

biology in the country.

MATERIALS AND METHODS

Study area

Serigina is a 2.4 ha island situated in Northeast

Algeria (36°56’ N, 6°53’ E), 700 m from the coast

of Skikda. Sparse vegetation dominated by shrubs

Chamaerops humilis L., Opuntia ficus-indica (L.)

Mill., 1768 and grasses Malva veneta (Mill.) Sol-

dano, Banfi et Galasso, 2005, Melilotus sp., Carpo-

brotus acinaciformis (L.) L. Bolus, 1927 covers its

southern half while is absent in the north. A li-

ghthouse of 20 m height occupies the center of the

island. In addition to the Eleonora’s Falcon, Yellow-

legged Gull, Larus michahellis Naumann, 1840,

and Cory's Shearwater, Calonectris diomedea (Sco-

poli, 1769), were also nesting at the island.

Data collection and analysis

We started to visit weekly the island in early

July 2006 and checked for potential egg laying. In

the breeding season we also collected weekly data

from each Eleonora’s falcon nest encountered in the

Serigina Island. Nests were marked by fixing small

numbered flags on the ground near the nest.

After being individually marked using perma-

nent markers, eggs lengths and breadths were mea-

sured with a Vernier calliper to the nearest 0.1 mm

and their weights were measured using a Pesola

spring balance to the nearest 1 g. Chicks were also

marked by non-toxic permanent markers (Kaihon-

gyu model KH8012) using coloration codes. Nests

Figure 5. Frequency distribution of clutch sizes of the Eleonora’s Falcon in the Serigina island.

120

S.Telailia, M. Saheb, L. Boutabia, M.-A. Bensouilah & M. Houhamdi

Age

Figure 6. Growth of (a) body weight and (b) wing span of

Eleonora’s Falcon nestlings.

were checked weekly and the number of eggs was

counted and surveyed for hatching and fledging in

order to calculate the clutch size, hatching success

(the proportion of eggs that hatched to chicks) and the

number of chicks surviving to 15 days. Mortality and

losses of eggs and chicks were also recorded. From

hatching, we measured the wing span length and

weight of nestlings weekly until the age of 25 days.

At this age, chicks became usually very mobile

and aggressive which made their capture difficult.

We estimated chick age based on their appearance.

Growth curves were developed for the two morpho-

Mean ± S.D

Egg length (mm)

42.57 ± 1.62

Egg breath (mm)

33.48 ± 1.12

Egg volume (cm 3 )

24.38 ±2.14

Egg weight (g)

25.67 ±2.37

Table 1. Egg dimensions of Eleonora’s Falcon breeding at

Serigina island.

Success (%)

Eggs laid

Eggs hatched

53.5

Chicks that survived to

25 days

39.5

Table 2. Reproductive success parameters of Eleonora’s

Falcon breeding at Serigina island.

Mean

Intercept

r 2

Body

mass (g)

18.82

35.41

0.96

<0.0001

Wing

span len-

gth (cm)

2.80

12.00

0.94

<0.0001

Table 3. Growth rate of Eleonora’s Falcon in Serigina island.

metrics recorded for nestling Eleonora’s Falcon. All

growth data were modeled with the linear function

by Kuusela & Solonen (1984):

Y = at ± b

where Y is a morphometric trait (body mass or wing

span length), t the nestling’s age in days, and a and

b the linear growth parameters. The latter coeffi-

cients were calculated using least squares linear re-

gressions of body measurements.

We put values of 350 g as the adult body mass

(Newton, 2009) to determine the age when did

nestlings reach adult size. In contrast, young ne-

Breeding biology of Eleonora’s Falcon, Falco eleonorae Gene, 1839, in Northeast Algeria at Serigina Island

121

stlings do not have fully developed feathers as

adults, thus a comparison between them could be

highly biased. Statistical analyses were carried out

using SPSS (2009) with values reported as mean ±

S.D. and p < 0.05 used as significance level. When

data did not conform to a normal distribution, we

used non-parametric tests.

RESULTS

Breeding parameters

Table 1 summarizes data of eggs measurements

at the Serigina island. After the calculation of the

mean egg volume and weight for each nest containing

more than one egg, we found that there was no si-

gnificant difference between the mean eggs volume

and mean eggs weight of different clutches (Kru-

skal- Wallis: f = 1.598, df = 2, P = 0.45; ANOVA:

F = 0.882, df = 2, P = 0.417 respectively).

The laying period of Eleonora’s Falco was quite

long and it lasted 34 days from July 24 (the first

egg laid) to August 27. The mean and median egg-

laying time was August 7 and 15, respectively. Egg

hatching started on 21 st August and ended on Octo-

ber 8. Two thirds (67%) of clutches hatched in the

three first weeks of the hatching period showing a

peak on September 4. The frequency distribution of

clutch sizes is showed in Figure 5. The mean clutch

size was 2.39 ± 0.78 eggs (N = 18 nests). More

than half (53.5%) of clutches contained 3 eggs, all

clutches ranging from 1 to 3 eggs. A substantial pro-

portion of nests (38.8%) have failed to hatch a single

egg and 4 cases of nest desertion were found du-

ring the study period. Eggs hatched asynchronou-

sly within a clutch and the total hatching success

was 53.5% (Table 2). The percentage survivorship

(to 15 days) from eggs was 39.5% while percentage

survivorship from hatch was 74 % (n = 18 clutches).

The mean net productivity per nest (up to fifteen

days of age) was 0.39 ± 0.40 (n = 18 clutches).

Figure 7. Serigina island: a nest of Eleonora’s Falcon containing 3 eggs. Figure 8. Young chicks of Eleonora’s Falcon

(7 days). Figure 9. A feathered chick of Eleonora’s Falcon (28 days).

122

S.Telailia, M. Saheb, L. Boutabia, M.-A. Bensouilah & M. Houhamdi

Growth of nestlings

We obtained growth curves of 1 7 nestlings from

1 1 broods for the body mass and wing span length

respectively (Figs. 6 a, b). Linear growth parame-

ters of both traits are presented in Table 3.

Mean body mass of Eleonora’s Falcon nestlings

at day 0 was 22.9 ± 4.25 g (n = 8) corresponding to

6.5% of the adult mass, while mean wing span

length was 10.1 ± 0.33 cm (n = 4) which represents

8.4% of the adult wing span. Usually, chicks be-

came very mobile and hard to capture when they

reached the age of 20 days and the older nestling

captured had an age of 25 days.

Nestlings reached 50% of the adult wing span

length at the age of 1 6 days and half of adult body

mass at 4 days of age. Also, chicks have never

reached 100% of wing span length before fledging

but they exceeded 1 00% of adult mass at the age of

15 days and attained 143% at 22 days of age.

DISCUSSION

Little is known about the breeding biology and

distribution of Eleonora’s Falcon in North Africa,

and new data on egg laying phenology, growth rates

and breeding success are important to shed light on

the life-history strategies and conservation needs of

this long migrant bird. The Serigina island carried

about 20 breeding pairs which is more or less simi-

lar to others yet reported in Algeria (Laferrere &

Mayaud, 1960; Le Fur, 1975; Michelot & Laurent,

1988; Michelot & Laurent, 1993). We suppose that

this is not consistent with an actual population

growth but rather with an early underestimation of

the actual breeding population due to the lack of

monitoring scheme. This work constitutes the first

contribution on the breeding biology of the Eleono-

ra’s Falcon in Algeria (Figs. 7-9).

Eleonora’s Falcon is known to be one of the latest

breeder birds in the Mediterranean region. In late

June, Eleonora’s Falcon has started to arrive and

displayed courtship behaviors. The laying period

of the Serigina colony initiated on July 24 and

lasted until August 27. Considering previous

works on the species, our study showed a slightly

later first laying date and a quite longer laying pe-

riod as observed by Wink & Ristow (2000).

Vaughan (1961) made a synthesis on the egg-la-

ying of different colonies in the species breeding

range and concluded that the laying period begins at

July 15-20 and continues to early August. Moreover,

Badami (1998) observed a similar laying date (July

22) in South West Sardinia in the breeding seasons

of 1993 and 1994 but the laying ended in early Au-

gust. In the same way, hatching period was similar

to that observed by Badami (1998). However, we

believe that comparisons should consider population

density and island occupancy phenology when deal-

ing with laying and hatching periods.

Our data of egg dimensions were veiy similar to

those given by Wink et al. (1985). We found that

there was no significant difference in egg size be-

tween eggs of different clutches which also was the

case for the Common Kestrel, Falco tinnunculus

Linnaeus 1758, breeding in Finland (Valkama et al.,

2002). Since the colony was situated next to one of

the main flyways of passerine migration (birds that

cross the Mediterranean through Sardinia) which is

the principal prey during the species breeding sea-

son, the absence of egg size variation could be ex-

plained by food availability.

In addition, we could expect that there were

small variations in the females’ age in the study co-

lony or also that the laying period was quite short

(compared to other Falcon species) to produce a si-

gnificant effect on eggs’ dimensions. Both of these

factors are known to be correlated with egg size in

many species of birds (Shanawany, 1987; Williams,

1994; Goth & Evans, 2004).

The mean clutch size was similar to that re-

ported by Badami (1998) in South-west Sardinia,

Mayol (1977) in Balearic Islands, and Wink & Ri-

stow (2000) in South Aegean Sea. The majority of

nests contained 3 eggs as observed in Morocco

(Walter, 1979) and South-west Sardinia (Badami,

1998). We did not observe any nest containing

more than 3 eggs during this study but the species

was recorded to lay 4 or even 5 eggs per clutch in

other colonies (Vaughan, 1961; Walter, 1979; Ba-

dami, 1998). The breeding success was very low,

less than 1 chick per nest, such as has been observed

in South-west Sardinia colony during the breeding

season of 1994 (Badami, 1998). We think that mor-

tality of young resulted primarily from climatic fac-

tors (exposition to sun and heavy winds) but, most

likely, it might be due to sibling aggression and can-

nibalism of the oldest chick towards younger ones.

Breeding biology of Eleonora’s Falcon, Falco eleonorae Gene, 1839, in Northeast Algeria at Serigina Island

123

Regarding nestling growth, both body mass and

wing span showed a linear growth from hatching

to the age of 25 days. Similarly, Walter (1979)

found the same curve fashion for body mass du-

ring the same period of nestling life, but leveled

off and reached the asymptote just after. We did not

find this trend because we were only able to survey

nestlings until the age of 25 days but we may expect

the same result for the Serigina chicks. The rapid

growth in the first month of nestlings’ life probably

reflects a high performance of parental care re-

garding food provisioning. When we regularly chec-

ked the Eleonora’s Falcon nests, we noted, from dead

birds or pieces of bodies like feathers and wings near

nests, that the Robin, Erithacus rubecula (Linnaeus,

1758), was the principal prey of the species.

Serigina island represents an interesting breed-

ing site carrying a substantial number of Eleonora’s

Falcon breeding pairs and and is one of the most

important in Algeria. Improvement in monitoring

scheme is necessary to reveal the exact status of

the species and set an effective national conserva-

tion plan.

ACKNOWLEDGMENTS

We are grateful to Smain Berramdane, Riad

Nedjah, Abdelnour Bouchekeur and Ala Rehahli for

field assistance.

REFERENCES

Badami A., 1998. Breeding biology and conservation of

the Eleonora’s Falcon Falco eleonorae in south-west

Sardinia, Italy. In: Chancellor R.D., Meyburg B.-U.

& J.J. Ferrero (Eds.). Holarctic Birds of Prey. Tow-

cester: Adenex-WWGBP, pp. 149-156.

Bergier P., 1987. Fes rapaces diumes du Maroc. Statut,

repartition et ecologie. Annales du Centre d'Etude sur

les Ecosystemes de Provence (C.E.E.P.). Aix en Pro-

vence 3: 160 pp.

Delgado G. & Quilis V., 1990. New data concerning the

migration of Eleonora’s Falcon Falco eleonorae.

Ringing and Migration, 11: 111-112.

Diaz-Portero M.A., Ramos J.J., de la Rocha, J.L.P., Jodar

P.A., Alvarez B., Mancera J.A., Delgado G. & Ron-

don J.L., 2009. Observations of Eleonora’s Falcon

Falco eleonorae at Oukaimeden (High Atlas, Mo-

rocco). Go-South Bulletin, 6: 128-129.

Dimalexis A., Xirouchakis S., Portolou D., Latsoudis P.,

Karris G., Fric J., Georgiakakis P., Barboutis C.,

Bourdakis S., Ivovic M., Kominos T. & Kakalis E.,

2008. The status of Eleonora’s Falcon ( Falco eleono-

rae) in Greece. Journal of Ornithology, 149: 23-30.

Goth A. & Evans C.S., 2004. Egg size predicts motor per-

formance and postnatal weight gain of Australian

brush-turkey ( Alectura lathami ) hatchlings. Canadian

Journal of Zoology, 82: 972-979.

Gschweng M., Kalko E.K.V., Querner U., Fiedler W. &

Berthold P., 2008. All across Africa: highly individual

migration routes of Eleonora’s Falcon. Proceedings

of the Royal Society B, 275: 2887-2896.

Hamrouni H., 2007. La migration du faucon concolore

( Falco concolor) et du faucon d’Eleonore ( Falco

eleonorae) en Tunisie. Ostrich, 78: 333-335.

Kuusela S. & Solonen T., 1984. The growth of Krestrel

nestlings in southern Finland. Annales Zoologici Fen-

nici, 2 1 : 309-312.

LaFerrere M. & Mayaud N., 1960. Le faucon d’Eleo-

nore Falco eleonorae nicheur en Algerie. Alauda,

28: 68-69.

Le Fur R., 1 975. Notes sur l’avifaune Algerienne. Alauda

49 : 295-299.

Lopez-Lopez P., Liminana R., Mellone U. & Urios V.,

2010. From the Mediterranean Sea to Madagascar:

Are there ecological barriers for the long-distance mi-

grant Eleonora’s Falcon? Landscape Ecology, 25:

803-813.

Lopez-Lopez P., Limirana R. & Urios V., 2009. Autumn

migration of Eleonora’s Falcon Falco eleonorae trac-

ked bay satellite telemetry. Zoological Studies, 48:

485-491.

Mayol J., 1996. El halcon de Eleonora ( Falco eleonorae ):

situacion de la especie y de su conocimiento. In: Bio-

logia y Conservacion de las Rapaces Mediterraneas,

Proceedings of the VI Congress on biology and con-

servation of Mediterranean raptors, Palma de Mal-

lorca, 22-25 September 1994. Muntaner J and Mayol

J (Eds.). Monografia n° 4, SEO/BirdLife, Madrid, pp.

117-125.

Michelot J.L. & Laurent L., 1988. Observations estivales

d’oiseaux marins en mer Mediterraneenne occiden-

tale. L'Oiseau et la Revue Frangaise d'Ornithologie,

58: 18-27.

Michelot J.L. & Laurent L., 1993. Observations estivales

d’oiseaux marins sur les plages Algeriennes et Ma-

rocaines. Le Bievre, 31: 109-117.

Rguibi H., Qninba A. & Benjoussa A., 2012, Eleonora’s

Falcon, Falco eleonorae , Updated state of knowledge

and conservation of the nesting populations of the

Mediterranean Small Islands, 19 pp. DOI:

http://www.initiative-pim.org/sites/default/files/fi-

chier/documents/Falco%20Eleonorae Final_%20En-

glish.pdf

Ristow D. & Wink M., 1985. Breeding success and con-

servation management of Eleonora’s Falcon. ICBP

Technical Publication No. 5: 147-152.

124

S.Telailia, M. Saheb, L. Boutabia, M.-A. Bensouilah & M. Houhamdi

Shanawany M.M., 1987. Hatching weight in relation to

egg weight in domestic birds. Poultry Science, 43:

107-115.

Thevenot M., Vernon J.D.R. & Bergier P., 2003. The

birds of Morocco. British Ornithologist Union Chec-

klist Series no. 20. Tring, U.K. British Ornithologists'

Union (BOU Checklist No. 16), 295 pp.

Valkama J., Korpimaki E., Wiehn J. & Pakkanen T.,

2002. Inter-clutch egg size variation in kestrels

Falco tinnunculus : seasonal decline under fluctua-

ting food conditions. Journal of Avian Biology, 33:

426-432.

Vaughan R., 1961. Falco eleonorae. Ibis, 103:114-128.

Walter H., 1979. Eleonora's Falcon: adaptations to prey

and habitat in a social raptor. University of Chicago

Press, Chicago and London. 410 pp.

Williams T.D., 1994. Intraspecific variation in egg size

and egg composition in birds: effects on offspring fit-

ness. Biological Reviews of the Cambridge Philoso-

phical Society, 68: 35-59.

Wink M. & Ristow D., 2000. Biology and molecular ge-

netics of Eleonora’s Falcon Falco eleonorae, a colo-

nial raptor of Mediterranean islands. In: Chancellor

R.D. & Meyburg B-U (Eds.). Raptors at risk. World

Working Group on Birds of Prey. Hancock House,

Surrey, pp. 653-668.

Wink M., Ristow D. & Wink C., 1985. Biology of Eleo-

nora's Falcon (Falco eleonorae)'. 1. Variability of

clutch sizes, egg dimensions and egg coloring. Raptor

Research, 19: 8-14.

Biodiversity Journal, 2013, 4 (1): 125-128

Gavilea araucana (Phil.) M.N. Correa: first record of an orchid

for Chile on Sphagnum peatland in Magallanes

Erwin Dominguez* & Nelson Bahamonde

Institute) de Investigaciones Agropecuarias, INIA-CRI, Kampenaike, Casilla 277, Punta Arenas, Chile

* Corresponding author: edominguez@inia.cl

ABSTRACT We report the first historical record of the orchid Gavilea araucana (Phil.) M.N., for a Spha-

gnum peatland in Chile, close to Torres del Paine National Park. Moreover, a brief description

of the peatland and information about associated flora are provided.

KEY WORDS Southern Patagonia; Sphagnum moss; peatland.

Received 22.09.2012; accepted 24.01.2013; printed 30.03.2013

INTRODUCTION

In Chile the Orchidaceae family comprises 52

species distributed from the Andean highlands to

the Cape Horn (Novoa et al., 2006). The Magal-

lanes region has a diversity of orchids represented

by 1 1 species. Chilean orchids occupy diverse habi-

tats, such as deciduous and evergreen forest, scrub

and also the Patagonian steppe (Dominguez,

2003; 2010; 2012), but there are no reports of it

in Sphagnum peatlands (Pisano, 1977; Moore,

1983; Pisano, 1983; Roig & Roig, 2004; Kleine-

becker et al., 2010; Iturraspe, 2010). However,

there have been at least five species reported for

North America ( Arethusa hulbosa L., Colopogon

tuberosus (L.) Britton, Pogonia ophiglossoides

(L.) Ker. Gawl., Platanthera blephariglottis

(Willd.) Lindl. and P. clavellata (Michaux) Luer.)

growing in Sphagnum peatbogs (Boland & Scott,

1992; Brown & Scott, 1997; Davis, 2011; Laro-

che, 2011). P. blephariglottis is considered a bio-

indicator of the ecological integrity of peatlands

because the abundance of this orchid is negatively

affected by anthropogenic disturbances (Laroche,

2011 ).

Sphagnum L. is a genus of between 1510 and

3500 species of mosses (Bryophyta Sphagnopsida

Sphagnaceae) commonly called peat moss. Spha-

gnum peatlands are freshwater wetlands with a par-

ticular biodiversity and play an important influence

on the subantarctic water cycle (Iturraspe, 2010), in

addition to contributing to global carbon storage

(Grootjans et al., 2010) through slow production and

accumulation of organic matter as peat. These wet-

lands are mainly distributed in the northern hemi-

sphere. While only 4% of peatlands are located in

South America, mainly in Chile and Argentina (Diaz

et al., 2008; Landiy et al., 2010), they constitute habi-

tats for rare and endemic species (Charman, 2002).

Peatlands in Southern Chile are distributed from the

Region de Los Rios to the Region de Magallanes y

Antartica Chilena, covering approximately

10,684,000 hectares (Pliscoff & Luebert, 2006) and

2.74 million hectars in Magallanes (Ruiz & Doberti,

2005), representing the largest deposit and sink of

terrestrial carbon in the Southern Hemisphere.

There are several historical studies in pristine

peatlands in Chile, but none have reported the

presence of orchids (Skottsberg, 1909; Roivainen,

1954; Pisano, 1977; Moore, 1983; Boelclce et al.,

1985). Recent studies in the regions of Los Rios and

Los Lagos, have given new contributions to the

knowledge of the region’s flora succession and hy-

drology of peatlands, but in that research the

126

Erwin Dominguez & Nelson Bahamonde

presence of orchids is not reported (San Martin et

al., 1999; Diaz et al., 2008; Teneb et al., 2008). The

same results are evident for studies in the Region

de Magallanes and the Provincia de Tierra del

Fuego Argentina (Henriquez, 2004; Roig & Roig,

2004; Roig et al., 2004; Teneb & Dollenz, 2004;

Kleinebecker, 2007; Larrain, 2011).

This paper presents the findings of an orchid po-

pulation, located in a Sphagnum peatland, and its

habitat description and distribution in order to pro-

vide information about biodiversity of these wet-

lands in Southern Chile.

Study site

The study site is located 20 km far from the Par-

que Nacional Torres del Paine (PNTP) in the muni-

cipality of Torres del Paine, provincia de Ultima

Esperanza, Region de Magallanes y Antartica Chi-

lena (51° 16' 18.69"S - 72° 51' 56.41" W). With an

area of approximately 5 hectares, it is surrounded

by four lagoons, the largest of which is the Lago

Toro (202 km 2 ) (Fig. 1). In particular, the peatland

called “the Frog” is characterized by (1) an om-

brotrophic Sphagnum peatbog; (2) a transitional

zone with Pilgerodendrum uviferum; and (3) a

minerotrophic zone in the margins, surrounded by

Patagonian Subantarctic Forest dominated by No-

thofagus betuloides (Gajardo, 1994).

MATERIALS AND METHODS

ARGENTINA

IRuerto

b Laguna Cristobal

Ilk t til t;

JL * l . ''4

Laguna el Pul le p

tevTlv "c#beraEISapo

CHILE

Figure 1 . Geographical location of the Gavilea araucana fin-

ding in a Sphagnum peatland in the Magallanes Region, Chile.

Fieldwork was carried out in December 2011.

For quantitative sampling, plots of 0.25 m 2 were ar-

ranged every 5 meters along a 250 m transect, across

the largest longitude (maximum longitude) over the

center of the peatland. Forty quadrants were evalu-

ated and the taxonomic determination for orchids fol-

lowed Correa (1969) and Novoa et al. (2006).

RESULTS AND DISCUSSION

Gavilea araucana is a terrestrial orchid, erect up

to 70 cm in height. Leaves lanceolate, acute. Inflo-

rescences lax, up to 8 pale yellow to whitish flowers.

Bracts lanceolate, acute, slightly surpassing the

ovary. Dorsal sepal 18 x 5 mm, oval-lanceolate,

acute. Lateral sepals up to 27 x 6 mm, oval-lanceo-

late, with thin caudicule up to 12 mm. Petals with va-

ricose veins, at base. Labellum 3-lobed, lateral lobes

forming an obtuse angle with the central lob, noto-

rious rounded veins, apical margin slightly sinuose,

central lob elongated, more or less triangular, with

veins cross over by few flakes with thicken mar-

gins, margin laciniate or merlon-shaped. Column 5

to 6 mm, with 2 folds at the contact place with the

labellum. Fruits capsules, globose and cylindrical.

Flowering in December, fruiting in December and

January. For the Region de Magallanes, its presence

has been cited in the Torres del Paine National Park

and the Milodon Cave Natural Monument (Domin-

guez, 2003; 2010) in clear forest sites, usually on

the banks of Great Lakes.

This orchid has also been found in small popula-

tions in sites affected by forest fires at the Lago

Pehoe areas and on the slopes of Mount Ferrier (Do-

minguez, 2012). This population of five G. arau-

cana individuals with flowers, located in a

Gavilea araucana (Phil.) M.N. Correa: first record of an orchid for Chile on Sphagnum peatland in Magallanes 127

Figure 2. Gavilea araucana in inflorescence and vegetative state in a Sphagnum peatland in the Magallanes Region,

Chile (Photo Erwin Dominguez, 2008).

Sphagnum peatbog next to Torres del Paine National

Park, represents the first record for Chile (Fig. 2).

The orchids are growing from the Sphagnum carpet

(lawns and humock) reaching between 0.25 to 0.5

m tall. Several herbaceous species are coexisting

under the Sphagnum magellanicum Brid domina-

tion, including Cortaderia egmontiana (Roem. &

Schult.) M. Lyle ex Connor, Senecio trifurcatus (G.

Forst.) Less, Symphyotrichum vahlii (Gaudich.) GL

Nesom., Hypochaeris arenaria Gaudich, Marsip-

pospermum grandiflorum (Lf) Hook., Tetroncium

magellanicum Willd., and the carnivorous plant

Drosera uniflora Willd. Rhizomatous species such

as Myrteola nummularia (Poir.) O. Berg and Nano-

dea muscosa Banks ex C.F. Gaertn. with other

woody plants such as Empetrum rubrum Vahl ex

Willd and Nothofagus antarctica (G. Forst.) Oerst

were also present. In these environments S. magel-

lanicum represents 70% coverage, and grows as

hummock-lawns shape with at least a two-meter

peat depth and a shallow water table. This finding

may provide new information about habitat types

for an orchid not previously described for the rest

of the country. Research on peatlands in Chile are

mostly focused on flora descriptions, but this is not

an adequate characterization of these ecosystems,

and further studies are required to describe and

quantify the Sphagnum peatland flora. Therefore,

the results of these studies would not show the cur-

rent state of the structure and floristic composition

of peatlands, at least for the Region de Magallanes.

ACKNOWLEDGEMENTS

Authors wish to thank Juan Larrain B. who as-

sisted in the fieldwork. This work was funded by

the Program: Bases ambientales, juridicas, comer-

ciales para el desarrollo sustentable de las turberas

en Magallanes. FONDEMACODE: 501548-20.

REFERENCES

Boland T. & Scott P.J., 1992. Ecological aspects of Are-

thusa bulbosa, Calopogon tuberosus and Pogonia

ophioglossoides (Orchidaceae) in eastern Newfoun-

dland. II. Partitioning of the microhabitat. Rhodora,

94: 374-380.

Brown C.J. & Scott P.J., 1997. Environmental parameters

influencing the distribution of Platanthera blephari-

glottis and Platanthera clavellata (Orchidaceae) in

peatlands on the Avalon Peninsula, Newfoundland.

Canadian Journal of Botany, 75: 974-980.

Boelcke O., Moore D.M. & Roig F.A. (Eds.), 1985. Tran-

secta Botanica de la Patagonia Austral. Consejo Na-

cional de Investigacion Cientifica y Tecnica

(Argentina). Buenos Aires. XXVIII, 733 pp.

128

Erwin Dominguez & Nelson Bahamonde

Charman D.J., 2002. Peatlands and environmental

change. Wiley, Chichester, 312 pp.

Correa M.M., 1969. Chloraea, genero sudamericano de

Orchidaceae. Darwiniana, 15: 374-500.

Davis T., 2011. Pennsylvania Natural Heritage Program.

Sphagnum - Beak-rush Peatland Factsheet. Online at:

http://www.naturalheritage.state.pa.us/CommSum-

mary.aspx?= 160 12 Accessed on September 10, 2012.

Dominguez E., 2003. Catalogo de orquideas del Parque

Nacional Torres del Paine. Chloris Chilensis Ano 7.

N° 1. http://www.chlorischile.cl.

Dominguez E., 2010. Diversity des orchidees du Monu-

ment Naturel Cueva del Milodon, Magellan (Chili).

Richardiana, 11: 34-54.

Dominguez E., 2012. Flora Nativa Torres del Paine. San-

tiago, Ocho Libros Editores, Primera edicion, 343 pp.

Diaz, F., Larrain J., Zegers G. & Tapia C., 2008. Carac-

terizacion floristica e hidrologica de turberas de la

Isla Grande de Chiloe, Chile. Revista Chilena de Hi-

storia Natural, 81: 455-468.

Gajardo R., 1994. La Vegetacion Natural de Chile: Cla-

sificacion y distribucion geografica. Editorial Uni-

versitaria. Santiago, 165 pp.

Grootjans A., Iturraspe R., Lanting A., Fritz C. & Joosten

H., 2010. Ecohydrological features of some contra-

sting mires in Tierra del Fuego, Argentina. Mires &

Peat, 6: 1-15.

Henriquez J.M., 2004. Estado de la turba esfagnosa en

Magallanes. In: Blanco D. & de la Baize V. (Eds.).

Los turbales de la Patagonia - Bases para su inventa-

rio y conservacion de su biodiversidad. Wetlands in-

temacional (Buenos Aires) Publication 19: 93-104.

Iturraspe R., 2010. Las turberas de Tierra del Fuego y el

cambio climatico global. Fundacion Humedales / We-

tlands International. Buenos Aires, Argentina, 26 pp.

Kleinebecker T., Holzel N. & Vogel A., 2007. Gradients

of continentality and moisture in South Patagonian

ombro trophic peatland vegetation. Folia Geobota-

nica, 42: 363-382.

Kleinebecker T., Holzel N. & Vogel A., 2010. Patterns

and gradients of diversity in South Patagonian om-

brotrophic peat bogs. Austral Ecology, 35: 1-12.

Landry J., Bahamonde N., Garcia Huidobro J., Tapia C.

& Rochefort L., 2010. Canadian peatland restoration

framework: A Restoration experience in Chilean peat

bogs. Peatlands Interntional, 2: 50-53.

Laroche V., 2011. Platanthera blephariglottis: une

espece indicatrice de l'integrite ecologique des tour-

bieres ombrotrophes au Quebec. Memoire presente a

la Faculte des arts et sciences en vue de Tobtention

du grade de M. Sc. en sciences biologiques. Univer-

sity de Montreal, 53 pp.

Larrain J., 20 1 1 . Caracterizacion floristica de turberas de

la Region de Magallanes, Chile. Informe Tecnico.

INIA-Kampenaike, 12 pp.

Novoa P., Espejo J., Cistemas M., Rubio M. & Domin-

guez E., 2006. Guia de Campo de las Orquideas Chi-

lenas. Edicion Corporacion Chilena de la Madera,

CORMA, Concepcion, Chile, 120 pp.

Moore D.M., 1983. Flora of Tierra del Fuego. Anthony

Nelson, Oswestry, England, 338 pp.

Pisano E., 1977. Fitogeografia de Fuego-Patagonia chi-

lena. I. Comunidades vegetales entre las latitudes

52° y 56°. Anales del instituto de la Patagonia, 8:

121-250.

Pisano E., 1983. The Magellanic Complex Tundra. In:

Gore A.J.P. (Ed.). Mires, swamps, bog, fen and moor,

B Regional studies. (Ecosistems of the world 4B),

Amsterdam, 295-329.

Pliscoff P. & LuebertF., 2006. Ecosistemas terrestres. In:

Biodiversidad de Chile: Patrimonio y desafios. Comi-

sion Nacional del Medio Ambiente, Santiago, 74-87.

Roig C. & Roig F., 2004. Consideraciones generales. In:

Blanco D. & de la Baize V. (Eds.). Los turbales de la

Patagonia - Bases para su inventario y conservacion

de su biodiversidad. Wetlands internacional (Buenos

Aires) Publication 19: 5-21.

Roig, C., Roig F. & Martinez Carretero E., 2004. Ventana

5: Tolhuin, provincia de Tierra del Fuego (Anexo II-

E). In: Blanco D. & de la Baize V. (eds.). Los turbales

de la Patagonia - Bases para su inventario y conser-

vacion de su biodiversidad. Wetlands internacional

(Buenos Aires) Publication 19: 55-61.

Roivainen H., 1954. Studien uber die Moore Feuerlands.

Annales Botanici Societatis Zoologicae Botanicae

Fennicae Vanamo, 28: 1-205.

Ruiz J. & Doberti M., 2005. Catastro y caracterizacion de

los turbales de Magallanes. Programa Fondema.Co-

digo BIPN°20 19640 1-0, 123 pp.

San Martin C., Ramirez C. & Figueroa H., 1999. Analisis

multivariable de la vegetacion de un complejo de tur-

beras de la Cordillera Pelada (Valdivia, Chile). Laza-

roa, 20: 95-106.

Skottsberg C., 1909. Pflanzen Physiognomische beoba-

chtungen aus dem Feuerlande. Wissenschaftliche Er-

gebnisse der Schwedischen Siidpolar-Expedition

1901-1903. Stockholm, 63 pp. + 4 Plates.

Teneb E. & Dollenz O., 2004. Distribucion espacial de la

flora vascular, la humedad y el pH en un turbal de esfa-

gno ( Sphagnum magellanicum Brid.), Magallanes,

Chile. Anales del instituto de la Patagonia, 32: 5-12.

Teneb E., Gomez P. & Gonzalez M., 2008. Observacio-

nes sobre la flora y vegetacion de dos turberas en la

Region de Aisen, Patagonia Chilena. Gayana Bota-

nica, 65: 229-232.

Biodiversity Journal, 2013, 4 (1): 129-134

A new species of false spider crab of the genus Elamena H.

Milne Edwards, 1 837 from Upper Gulf of Thailand (Decapoda

Hymenosomatidae)

Sitthi Kulabtong 1 *, Sawika Kunlapapuk 2 & Suvijak Sottiyothin 3

'Save wildlife volunteer Thailand, Wangnoi District, Ayuttaya Province 13170, Thailand; e-mail: kulabtong201 l@hotmail.com

2 Aquatic Animal Production Technology Program, Faculty of An imal Sciences and Agricultural Technology, Silpakom University, Phet-

chaburi IT campus, Sampraya, Cha-am, Phetchaburi, 76120 Thailand; e-mail: sawika@su.ac.th

3 358/6 Sukumvit Rd. Paknum Subdistrict, Muang District, Samutprakan Province, Thailand; e-mail: suvijak_358@hotmail.com

‘ Corresponding author

ABSTRACT A new species of false spider crab (Decapoda Hymenosomatidae), Elamena soonthronkitti

n. sp. from Upper Gulf of Thailand, is described. This species is distinguished from other

species of the genus Elamena H. Milne Edwards, 1837 by the combination of the following

characters: carapace longer than broad; dorsal surface smooth with deep gastrocardiac, cer-

vical and thoracic grooves; rostrum truncated; no ventral rostral keel; abdomen octagonal

with the tip rounded; chelipeds palm plump; both fingers equal or slightly shorter than palm

with small setae; dactylus of the third ambulatory legs with no subterminal teeth. Biological

features and current distribution of the new species and comparative notes are also reported.

KEY WORDS Elamena', Decapoda; Hymenosomatidae; Bangpu; Thailand.

Received 4.11.2012; accepted 22.12.2012; printed 30.03.2013

INTRODUCTION

The false spider crab family Hymenosomatidae

is different from other crabs in many characters:

the 4 pairs of ambulatory legs are longer (i.e. spi-

der-like) than in other crabs, abdominal segments

and telson are clearly different from other bra-

chyuran crabs (Lucas, 1980; Dudgeon, 1999). Ge-

nerally speaking, crabs are wildly distributed and

comprise more than 100 species worldwide

(Chuang & Ng, 1994; Naruse et al., 2008). In

Southeast Asia more than 1 0 species are recorded;

in Thailand there are 4 species (Kemp, 1917;

Niyanetr, 1980; Chuang & Ng, 1994; Ng &

Chuang, 1996) including:

Hymenicoides naiyanetri (Chuang et Ng, 1991)

Elamena magna Ng et Chuang, 1996

Halicarcinus coralicola (Rathbun, 1909)

Neorhynchoplax exigue (Kemp, 1917)

In a survey project involving two of the authors

(KSi and SS) in Bangpu mangrove area, Samutpra-

kan Province, Upper Gulf of Thailand (Figs. 1-2)

carried out during November-December 2010, we

found two specimens of false spider crab which

were reported by us, at that time, as Hymenicoides

cf. naiyanetri (Sottiyothin, & Kulabtong, 2011; Ku-

labtong & Sottiyothin, 2012).

Subsequently, a re-examination of those speci-

mens, carried out by KSi and KSa revealed that

they belong to a new species of the genus Elamena

H. Milne Edwards, 1837 which is described in the

present paper.

ACRONYMS AND ABBRE VATION S . Refe-

rence Collection of Aquatic Ecology, Silpakorn

130

S. Kulabtong, S. Kunlapapuk & S. Sottiyothin

University, Phetchaburi IT campus = RAESUP; Su-

vijak Sottiyothin = SS; Sawika Kunlapapuk = KSa;

Sitthi Kulabtong = KSi

RESULTS

Order DEC APOD A Latreille, 1802

Family HYMENOSOMATIDAE Macleay, 1838

Elamena soonthronkitti n. sp.

Hymenicoides cf. naiyanetri; Kulabtong & Sottiyo-

thin, 2012 (Samutprakan Province, Thailand)

Examined material. Holotypus male, RAESUP

132: Bangpu mangrove area, Bangpu Mai Subdi-

strict, Muang District, Samutprakan Province,

Upper Gulf of Thailand, 29.XII.2010, legit Sitthi

Kulabtong and Suvijak Sottiyothin (Fig. 3); Para-

typus female, RAESUP 133, 1 specimen, same data

of holotypus.

Description of Holotypus. The carapace of

this species is vase-like and longer than broad.

Dorsal surface slightly concave, smooth with deep

gastrocardiac, cervical and thoracic grooves, all

branching. Rostrum unilobate, tmncated, no ventral

rostral keel. The eyes can be seen from the dorsal

view (Figs. 4-6). Abdomen is octagonal and the tip

is rounded (Fig. 11). Third maxillipeds cover almost

three-quarters of the mouth area; ischium shorter

than merus in outer lateral margins; carpus longer

than propodus and dactyl; long setae on inner lateral

margins of merus, propodus and dactyl; exopod lon-

ger than ischium and merus, with a long flagellum

on the tip (Fig. 7). Chelipeds slightly larger than

ambulatory legs; short setae along chelipeds;

palm plump; immovable finger larger than mova-

ble finger; both fingers with 4-5 serrated-like teeth;

both fingers equal or slightly shorter than palm with

small setae; tips of both fingers slightly hooked-like

(Fig. 9). Ambulatory legs very long and slender;

small setae along the legs; tip of legs hooked-like.

Dactylus of the third ambulatory legs with no sub-

terminal teeth (Fig. 10).

Coloration in fresh specimen is light yellow,

transparent along the body, legs and chelipeds. The

carapace shows a clear dark V-shaped strip and

many small brown dots (Fig. 3).

Figures 1, 2. Bangpu mangrove area, Samutprakan

Province, Upper Gulf of Thailand.

Variability. Males (Figs. 3-11) differ from fe-

males by the abdomen shape and size (narrower in

males) (Figs. 11-12).

Etymology. The specific name refers to Yana-

nan Soonthronkit, Rajamangala University of Te-

chnology Tawan-ok: Chantaburi Campus, Thailand,

who was the first teacher of taxonomy and aquatic

ecology of KSi.

Biology and Distribution. E. soonthronkitti

n. sp. was found only in the rocky shore ecosystem

of Bangpu mangrove area, Upper Gulf of Thailand.

This crab lives under the rocks and its habitat is

A new species of false spider crab of the genus Elamena H. Milne Edwards, 1 837 from Upper Gulf of Thailand 131

characterized by large rocks and a sandy mud bot-

tom. In this area tidal fluctuations and salinity

change frequently during all day. In the flood tide,

these organisms move up to the rocky dam, whereas

they reach the shore only in the neap tide, thus re-

vealing, in our opinion, poor swimming skills. In the

same area, we falso found many snapping shrimps

(Decapoda Alpheidae) living under the large rocks

too, known only from Bangpu mangrove area, Sa-

mutprakan Province, Upper Gulf of Thailand.

Comparative notes, hi Southeast Asia, 7 species

of false spider crabs belonging to the genus Ela-

mena H. Milne Edwards, 1837 were recorded by

Chuang & Ng (1991, 1994) and Ng & Chuang

(1996) namely E. cristatipes Gravely, 1927 from

India and Malay Peninsula, E. globosa Chuang et

Ng, 1991 from Singapore, E. mendosa Chuang et

Ng, 1991 from Malaysia and Singapore, E. simpli-

denta Ng et Chuang, 1996 from Indonesia, E. sun-

daica Ng et Chuang, 1 996 from Indonesia, E. cf.

Figure 3. Holotypus of Elamena soonthronkitti n. sp. from Upper Gulf of Thailand.

132

S. Kulabtong, S. Kunlapapuk & S. Sottiyothin

Figures 4-12 Elamena soonthronkitti n. sp. Fig. 4: carapace. Fig. 5: dorsal view of rostrum. Fig. 6: ventral view of

rostrum. Fig. 7: third maxilliped. Fig. 8: flagellum of antenna. Fig. 9: cheliped. Fig. 10: third ambulatory leg.

Fig. 1 1 : abdomen of male. Fig. 12: abdomen of female.

A new species of genus Elamena H. Milne Edwards, 1837 false spider crab from Upper Gulf of Thailand

133

truncata (Stimpson, 1858) from Indonesia and Viet-

nam and E. magna Ng et Chuang, 1996 which was

the only one found in Thailand.

Particularly, E. soonthronkitti n. sp. is clearly

different from E. magna in many characters: cara-

pace is vase-like and rostrum truncated (in E.

magna both carapace and rostrum are triangular);

dorsal surface with deep gastrocardiac, cervical and

thoracic grooves (in E. magna dorsal surface with-

out grooves); dactylus of the third ambulatory legs

with no subterminal teeth (in E. magna with 2 sub-

terminal teeth); chelipeds plump (in if magna slen-

der and elongate); fingers of chelipeds equal or

slightly shorter than palm (in E. magna longer than

palm); abdomen octagonal (in E. magna triangular)

(Ng & Chuang, 1996).

E. soonthronkitti n. sp. is different from E. cri-

statipes in many characters: rostrum truncated (in

E. cristatipes is rounded); dorsal surface with deep

gastrocardiac, cervical and thoracic grooves (in E.

cristatipes the cervical and thoracic grooves do not

reach the anterolateral and posterolateral margins);

rostrum with no ventral rostral keel (in E. cristati-

pes one rectangular ventral keel); long setae on

inner lateral margins of merus (short setae in E. cri-

statipes ); fingers of chelipeds equal or slightly

shorter than palm (in E. cristatipes much shorter

than palm); dactylus of the third ambulatory legs

with no subterminal teeth (in E. cristatipes with 1

subterminal tooth); abdomen octagonal (in E. cri-

statipes is triangular) (Ng & Chuang, 1996).

E. soonthronkitti n. sp. is different from E. glo-

bosa in many characters: rostrum truncated (in E.

globosa is triangular); dactylus of the third ambu-

latory legs with no subterminal teeth (in E. globosa

with 3 subterminal teeth); abdomen octagonal (in

E. globosa is triangular) (Chuang & Ng, 1991).

E. soonthronkitti n. sp. is clearly different from

other species of the genus Elamena of Indonesia by

the combination of the following characters: cara-

pace is longer than broad (in E. simplidenta and E.

sundaica is broader than long); rostrum with no

ventral rostral keel (in E. simplidenta and E. sun-

daica with keel); dactylus of the third ambulatory

legs with no subterminal teeth (E. simplidenta with

one subterminal tooh and E. sundaica with 2 sub-

terminal teeth) (Ng & Chuang, 1996).

E. soonthronkitti n. sp. differs from E. mendosa

in many characters: rostrum tmncated (in E. men-

dosa is triangular); dorsal surface with deep gastro-

cardiac, cervical and thoracic grooves (no distinct

grooves in E. mendosa)', chelipeds plump (slender

and elongate in E. mendosa ); dactylus of the third

ambulatory legs with no subterminal teeth (in E.

mendosa 2 subterminal teeth); abdomen octagonal

(in E. mendosa is triangular) (Chuang & Ng, 1991).

E. cf. truncata from Indonesia and Vietnam, still

has an unclear taxonomic status. E. soonthronkitti

n. sp. is different from this taxon in many charac-

ters: chelipeds plump (in E. cf. truncata slender and

elongate); dactylus of the third ambulatory legs

with no subterminal teeth (in E. cf. truncata 2 sub-

terminal teeth) (Ng & Chuang, 1996).

ACKNOWLEDGEMENTS

The authors are grateful to reviewers for review-

ing this manuscript. A special thank to Miss Jun-

thima Chatngern, who helped collecting the

specimens employed in this study (based on the Sur-

vey project in Bangpu mangrove area, Upper Gulf

of Thailand). We also wish to thank the Bangpu Na-

ture Education Centre for supporting the survey

project.

REFERENCES

Chuang C.T.N. & Ng P.K.L., 1991. Preliminary descrip-

tions of one new genus and three new species of hy-

menosomatid crabs from Southeast Asia (Crustacea:

Decapoda: Brachyura). The Raffles Bulletin of Zoo-

logy, 39: 363-368.

Chuang C.T.N. & Ng P.K.L., 1994. The ecology and bio-

logy of Southeast Asian false spider crabs (Crustacea:

Decapoda: Brachyura: Hymenosomatidae). Hydro-

biologia, 285: 85-92.

Dudgeon D., 1999. Tropical Asian stream: zoobenthos,

ecology and conservation. Hong Kong University

Press, Hong Kong, 830 pp.

Kemp S., 1917. Notes on Crustacea Decapoda in the

Indian Museum: Hymenosomidae. Records of the In-

dian Museum, 13: 243-279.

Kulabtong S. & Sottiyothin S., 2012. False spider crabs

(Hymenosomatidae) in Thailand. Journal of Faculty

of Animal Science and Agricultural Technology Sil-

pakorn University, 3: 1-6.

Lucas J.S., 1980. Spider crabs of the family Hymenoso-

matidae (Crustacea; Brachyura) with particular refe-

rence to Australian species: systematics and biology.

Records of the Australian Museum, 33: 148-247.

134

S. Kulabtong, S. Kunlapapuk & S. Sottiyothin

Narase T., Ng P.K.L. & Guinot D., 2008. Two new ge-

nera and two new species of troglobitic false spider

crabs (Crustacea: Decapoda: Brachyura: Hymenoso-

matidae) from Indonesia, with notes on Cancrocaeca

Ng, 1991. Zootaxa, 1739: 21-40.

Ng P.K. L. & Chuang C.T.N., 1996. The Hymenosoma-

tidae (Crustacea: Decapoda: Brachyura) of Southeast

Asia, with note on other species. The Raffles Bulletin

of Zoology, Supplement No. 3, p. 82.

Niyanetr P., 1980. Crustacean fauna of Thailand (Deca-

poda and Stomatopoda). Department of biology, Fac.

Sci., Chulalongkom Univ., 196 pp.

Sottiyothin S. & Kulabtong S., 2011. Species diversity

of blackish mollusk in Bang-poo Mangrove, Samut-

prakarn Province. Veridian e-Joumal Silpakorn Uni-

versity, 4: 911-916.

Biodiversity Journal, 2013, 4 (1): 135-178

Monograph

Contribution to the knowledge of the freshwater algae of

Sierra Leone (Tropical West Africa): diatoms from Loma

Mountains and Bumbuna Falls, the Northern Province

Silvia Alfinito 1 * & Horst Lange- Be rtalot 2

'Department of Environmental Biology, Sapienza, University of Rome. 00185 Rome, Italy

2 Institut far Okologie, Evolution, Diversitat, Goethe-Universitat und Forschungsinstitut Senckenberg D-60439 Frankfort am Main,

Germany

*Corresponding author, e-mail: silvia.alfmito@uniromal.it

ABSTRACT The freshwater flora of Sierra Leone, in particular the northern province, is still poorly in-

vestigated. We describe here the diatoms found in small pools in two locations of the northern

province: Peak Bintimani (Loma Mountains) and Bumbuna Falls. Altogether 65 taxa, be-

longing to 31 genera are described. About 32 dubious Holarctic taxa, suspected to be new to

science, are noted as “cf. ”, expecting a differential diagnosis later on after further SEM ob-

servations. This is the case of very interesting taxa belonging to the genera Eunotia, Luticola,

Frustulia and Brachysira.

KEY WORDS Diatoms; Bacillariophyceae; tropical freshwaters; Sierra Leone; West Africa.

Received 05.11.2012; accepted 13.01.2013; printed 30.03.2013

INTRODUCTION

The freshwater diatom flora of Tropical West

Africa is still poorly investigated, the most com-

prehensive papers being those of Zanon (1941,

French West Africa), Foged (1966, Ghana; 1986,

Gambia), Compere (1991, Senegal) and Compere

& Riaux-Gobin (2009, Guinea).

In Sierra Leone, the most significant studies are

those of Carter & Denny (1982; 1987; 1992) in

which many new species were described. Fumanti

et al. (1990), Fumanti (1994) and Alfinito et al.

(1994) have published some contributions on the

diatom flora of three locations in the Western Area.

The Northern Province, where the samples object

of this study were collected, is also rather poorly re-

searched: Molder (1962), Sula Hills, few scattered

samples; Mazzoni (1986) River Dankale; Alfinito

et al. (1989), pond near Kania; Carter & Denny

(1992), Lake Sonfon.

In this paper, we describe the diatoms found in

two locations of the Northern Province: Peak Bin-

timani (Loma Mountains) and Bumbuna Falls,

River Seli.

MATERIALS AND METHODS

Study area

Sierra Leone is a small country located in the

south western part of West Africa, bordered by Gui-

nea, Liberia and the Atlantic Ocean. It is divided

into four geographical regions: the Northern Pro-

vince, Eastern Province, Southern Province and the

Western Area. Sierra Leone has a tropical climate,

136

Silvia Alfinito & Horst Lange-Bertalot

with a wet season from May to October and a dry

season from November to April.

The Northern Province, in which the samples,

object of this study, were collected, is composed of

interior plateaux and mountains which rise to form

Tingi Hills and Loma Mountains. The Loma

Mountains Forest Reserve covers approximately

396 km 2 and is the largest montane forest in Sierra

Leone. Peak Bintimani (1945 m a.s.l.) is the high-

est in West Africa.

Bumbuna Falls are just few kilometers from the

city of Bumbuna (Tonkolili District). About 2,5 km

downstream of Bumbuna Falls is located the Bum-

buna dam, the first Sierra Leone hydropower dam,

in the valley of the Sula Mountains.

Materials

Samplings were carried out in November 1984,

just at the beginning of the rainy season, by Prof.

Walter Rossi. The first sample was collected on the

NE slope of Peak Bintimani, Loma Mountains,

about 1650 m a.s.l. in very small pools formed by

tuft of grass on granitic rock (some images of the

sampling area are shown in Alfinito, 2011); the

pools were very rich in filamentous green algae,

mosses and in higher plants characteristic of these

swampy areas, such as Utricularia pubes cens

Smith, Utricularia micropetala Smith v. macrokei-

los P. Taylor and Drosera pilosa Exell et Laundon.

The second sample comes from Bumbuna Falls,

River Seli and was collected in small but relatively

deep pools formed in large granitic rocks emerging

from the dried river.

The material was treated with a mix of sul-

phuric and nitric acid and rinsed several times with

distilled water. The cleaned material was mounted

in Hyrax for light microscope (LM) studies with a

Zeiss Axioscope. For scanning electron microscope

(SEM) investigations, the material was coated with

gold and observed with a Cambridge 250 Scanning

Electron Microscope.

Terminology used in this paper follows that sug-

gested by Anonymous (1975), Krammer & Lange-

Bertalot (1986; 1988; 1991a; 1991b; 2000) and

Round et al. (1990). The classification follows Si-

monsen (1979), Round et al. (1990) and Krammer

& Lange-Bertalot (2000).

For each taxon a reference to the author we fol-

lowed for identification, valve dimensions, striae

density and other LM or SEM characteristics are

given, together with the distribution in Sierra

Leone.

RESULTS

Taxonomic account

B ACILLARIOPHY CEAE

CENTRALES

Familia TH AL AS S IO S IRACE AE Lebour, 1930

emend. Hasle, 1973

Aulacoseira Thwaites, 1848

Aulacoseira granulata (Ehr.) Simonsen v. valida

(Hustedt) Simonsen, 1979

Simonsen (1987) PL 278: 1-4

Description. Diameter 14-18 pm; 8-9 rows of

areolae in 10 pm; 8-10 elliptic areolae in 10 pm

(Fig. 1).

Distribution. Bumbuna Falls, Peak Bintimani,

quite frequent. New record for Sierra Leone.

Cyclotella (Kiitz.) Brebisson, 1838

Cyclotella meneghiniana Kiitzing, 1 844

Krammer & Lange-Bertalot (1991a) PI. 44: 1-10

Synonym: Cyclotella kuetzingiana Thwaites, 1 848

Description. Diameter 17-19 pm; 8-9 striae in

10 pm (Figs. 4-6).

Distribution. Bumbuna Falls, rare. Other

records: Sula Hills (Molder, 1962); River Jong

(Carter & Denny, 1982); River Dankale (Mazzoni,

1986, sub C. kuetzingiana Thwaites); Bathurst Falls

(Fumanti, 1994).

Fam. MELOSIRACEAE Kiitzing, 1844

Orthoseira Thwaites, 1849

Orthoseira roeseana (Rabenh.) O’Meara, 1876

Krammer & Lange-Bertalot (1991) PI. 10: 1-11

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

137

Synonym: Melosira roeseana Rabenhorst, 1852

Description. Diameter 12-30 |am; 15-18 striae

in 10 |am (Figs. 2-3).

Distribution. Bumbuna Falls, common. Other

records, sub Melosira roeseana Rabenhorst: Sula

Hills (Molder, 1962); River Jong (Carter & Denny,

1982); Lake Sonfon (Carter & Denny, 1992).

PENNALES

Familia F RAGIL ARI ACE AE Hustedt, 1930

Fragilaria Lyngbye, 1819

Fragilaria cf. javanica Hustedt, 1938

Metzeltin & Lange-Bertalot (1998) PL 1: 1-6;

Simonsen (1987) PI. 322: 1-6

Description. Length 47 gm; breadth 4.5 gm; c.

22 striae in 10 gm (Fig. 13).

Distribution. Bumbuna Falls, only one speci-

men observed.

Remarks, the only observed specimen is very

very close to Hustedt’ s taxon, unless the presence

of marginal spines. The species Fragilaria telum,

described by Carter in Carter & Denny (1987) for

Lake Mabesi, Sierra Leone, is clearly related to F.

javanica Hustedt, but lacks the marginal spines. As

far as we know, F. telum was no more reported.

Later on Metzeltin & Lange-Bertalot (1998) found

F. javanica Hustedt in a spring stream near Santos

(Brazil) and the specimens shown in their PI. 1 :

1-6 have no marginal spines. A more detailed ana-

lysis of the original material, involving SEM com-

parison, should be required in order to fully

understand the taxonomical identity of both taxa.

Ctenophora (Grunow) Williams et Round, 1986

Ctenophora pulchella (Ralfs ex Kiitzing) Williams

et Round, 1986

Hofmann et al. (2011) PI. 4: 13-17

Synonym: Synedra pulchella Ralfs ex Kiitzing, 1 844

Description. Length 45-70 gm; breadth 5-5.5

gm; 15-16 striae in 10 gm (Figs. 7-9).

Distribution. Bumbuna Falls, quite common.

Other records, sub Synedra pulchella Ralfs ex Kiit-

zing: Sula Hills (Molder, 1962); Lake Mabesi (Car-

ter & Denny, 1987); Lake Sonfon, Lake Mabesi

(Carter & Denny, 1992).

Staurosira Ehrenberg, 1843

Staurosira cf. longirostris (Frenguelli) Metzeltin,

Lange-Bertalot et Garcia-Rodriguez, 2005

Sar et al. (2009) p. 152 fig. 21

Metzeltin et al. (2005) PL 13:4-13

Description. Length 15-18 gm; breadth 8-8.5

gm (Fig. 11).

Distribution. Peak Bintimani, rare.

Remarks, this species, described by Fren-

guelli (1941) from the coastal lagoon of Mar Chi-

quita (Argentina), was reported also by Metzeltin

et al. (2005) for Rio de la Plata and Laguna Merin

(Uruguay).

Staurosira construens Ehrenberg, 1 843

Hofmann et al. (2011) Pl. 10: 1-6

Synonym: Fragilaria construens (Ehr.) Grunow,

1862

Description. Length 10-12 gm; breadth 6 gm;

c. 12 striae in 10 gm (Fig. 10).

Distribution. Bumbuna Falls, rare. Other

records, sub Fragilaria construens (Ehr.) Grunow:

Sula Hills (Molder, 1962); River Jong (Carter &

Denny, 1982); Lake Mabesi, Lake Mape (Carter &

Denny, 1987).

Staurosira venter (Ehr.) Grunow in Pantocsek,

1889

Hofmann et al. (2011) Pl. 10: 18-24

Synonym: Fragilaria construens Ehr. v. construens

f. venter (Ehr.) Hustedt, 1957

Description, length 6-7 gm; breadth 5-6 gm;

12-14 striae in 10 gm (Fig. 12).

Distribution. Bumbuna Falls, rare. Other

records: Lake Sonfon (Carter & Denny, 1992) sub

138

Silvia Alfinito & Horst Lange-Bertalot

Fragilaria construens Ehr. v. construens f. venter

(Ehr.) Hustedt.

Ulnaria (Nitzsch) Compere, 2001

Ulnaria cf. ulna (Nitzsch) Compere, 2001

Synonym: Synedra ulna (Nitzsch) Ehrenberg, 1832

Description. Length 57-60 pm; breadth 5-6

pm; c. 11 striae in 10 pm (Fig. 14).

Distribution. Bumbuna Falls, quite common.

Records for U. ulna sensu lato, sub Synedra ulna

(Nitzsch) Ehrenberg: Sula Hills (Molder, 1962);

River Danlcale (Mazzoni, 1986); Lake Sonfon (Car-

ter & Denny, 1992).

Remarks. Krammer & Lange-Bertalot (1991)

and Hofmann et al. (2011) regard this taxon as a

“sippenkomplex” that needs further thorough stud-

ies. Our specimens bear some resemblance to Sy-

nedra ulna (Nitzsch) Ehrenberg f. impressa (Hust.)

Hustedt, 1957 as reported in Simonsen (1987) PI.

54 fig. 3.

Familia EUNOTIACEAE Kiitzing, 1944

Actinella F. W. Lewis, 1863

Actinella brasiliensis Grunow in Van Heurck, 1881

Metzeltin & Lange-Bertalot (2007) PL 35: 1-7

Description. Length 77-140 pm; breadth 6-8.5

pm; 12-17 striae in 10 pm (Figs. 36-39; Figs 40-

41; Fig. 51).

Distribution. Bumbuna Falls, rare; Peak Binti-

mani, quite common. Other records: River Jong (Car-

ter & Denny, 1982); Lake Mape, Lake Mabesi, River

Waanje (Carter & Denny, 1987); Guma Dam (Fu-

manti et al., 1990); Lake Sonfon, Lake Popei (Carter

& Denny, 1992); Bathurst Falls (Fumanti, 1994).

Eunotia Ehrenberg, 1837

Eunotia cf. crassula Metzeltin et Lange-Bertalot,

1998

Description. Length 50-78 pm; breadth 8-11

pm; c. 14 striae in 10 pm (Figs. 42-46).

Distribution. Peak Bintimani, quite frequent.

Eunotia cf. crista-galli Cleve, 1891 and cf. tecta

Krasske, 1939

Description. Length 29-33 pm; breadth 7-8

pm; 15-16 striae in 10 pm (Figs. 16-17).

Distribution. Bumbuna Falls, rare; Peak Bin-

timani, rare. Records for E. crista-galli Cleve: Ba-

thurst Falls (Fumanti, 1994); records for E. tecta

Krasske: Lake Sonfon (Carter & Denny, 1992).

Remarks. Both of the cf. are hardly similar.

Eunotia cf. minor (Kiitz.) Grunow in Van Heurck,

1881

Synonym: : E. pectinalis (Kiitz.) Rabenh. v. minor

(Kiitz.) Rabenhorst, 1864

E. pectinalis (Kiitz.) Rabenh. v. minor (Kiitz.) Ra-

benh. f. impressa (Ehr.) Hustedt, 1930

Description. Length 22-42 pm; breadth 3.5-5

pm; 12-14 striae in 10 pm (Figs. 25-26).

Distribution. Bumbuna Falls, quite common;

Peak Bintimani, rare. Records for Eunotia minor

(Kiitz.) Grunow in Van Heurck (sub E. pectinalis

(Kiitz.) Rabenh. v. minor (Kiitz.) Rabenhorst, 1864

and E. pectinalis (Kiitz.) Rabenh. v. minor (Kiitz.)

Rabenh. f. impressa (Ehr.) Hustedt): Sula Hills

(Molder, 1962); River Jong (Carter & Denny,

1982); River Dankale (Mazzoni, 1986); Lake Popei

(Carter & Denny, 1992).

Eunotia naegelii Migula in Thome, 1907

Krammer & Lange-Bertalot (1991) PI. 140: 1-6

Synonym: E. alpina (Nageli) Hustedt in Schmidt et

al., 1913

Description. Length 32-68 pm; breadth 2-2.5

pm; 25-28 striae in 10 pm (Figs. 28-34).

Distribution. Peak Bintimani, common. Other

records: Sula Hills (Molder, 1962), River Jong

(Carter & Denny, 1982), Lake Mape (Carter &

Denny, 1987) and Lake Popei (Carter & Denny,

1992) sub E. alpina (Nageli) Hustedt in Schmidt et

al., 1913; Bathurst Falls (Fumanti, 1994).

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

139

Eunotia rabenhorstiana (Grunow) Hustedt, 1 949

Metzeltin & Lange -Bertalot (1998) PL 10: 1-13

Description. Length 63-87 gm; breadth 7-8

gm; 16-17 striae in 10 gm (Fig. 35).

Distribution. Bumbuna Falls, rare. New record

for Sierra Leone.

Eunotia rabenhorstii Cleve et Grunow v. triodon

Grunow in Van Heurck, 1881

Metzeltin et al. (2005) PL 20: 1-7

Description, length 33-35 gm; breadth 7 gm;

16-17 striae in 10 gm (Fig. 15).

Distribution. Bumbuna Falls, rare. New record

for Sierra Leone.

Eunotia rhomboidea Hustedt, 1950

Simonsen (1987) Pl. 546: 3-8

Lange-Bertalot et al. (2011) PL 42: 1-8; PL 43: 12-14

Metzeltin & Lange-Bertalot (2002) PL 9: 1-4

Description. Length 8-18 gm; breadth 2-4.5

gm; 18-24 striae in 10 gm and c. 40 areolae in 10

gm(Figs. 18-24).

Distribution. Bumbuna Falls, Peak Bintimani,

frequent. Other records: River Jong (Carter &

Denny, 1982); Lake Sonfon (Carter & Denny,

1992); Bathurst Falls (Fumanti, 1994).

Eunotia vumbae Cholnoky, 1954

Cholnoky (1954) Figs. 54-58

Description. Length 15 gm; breadth 4 gm;

more than 20 striae in 10 gm (Fig. 27).

Distribution. Bumbuna Falls, only one speci-

men observed. New record for Sierra Leone.

Familia ACHNANTHACEAE Kiitzing, 1844

Achnanthes Bory, 1822

Achnanthes inflata (Kiitzing) Grunow in Cleve &

Grunow, 1880

Krammer & Lange-Bertalot (1991) PL 2: 9-10

Description. Length 35-64 gm, breadth 10-16

gm; c. 12 striae in 10 gm in both valvae (Figs. 62-

64).

Distribution. Bumbuna Falls, quite rare. Other

records: Kangari Sula (Molder, 1962); River Dan-

kale (Mazzoni, 1986).

Familia ACHNANTHIDIACEAE D. G. Mann

1990

Achnanthidium KAtzing , 1844

Achnanthidium subhudsonis (Hustedt) Kobayasi

in Kobayasi et al., 2006

Simonsen (1987) Pl. 68: 1-9

Description, length 18-26 gm, breadth 4-5 gm;

striae in the raphe valve 18-20 in 10 gm and in the

rapheless valve 22-23 in 10 gm (Figs. 52-57; Figs.

58-59).

Distribution. Bumbuna Falls, frequent. New

record for Sierra Leone.

Achnanthidium taiaense (Carter in Carter &

Denny) J. Taylor, Morales et Ector, 2011

Lange-Bertalot & Krammer (1989) PL 67: 25-28

(Holotypus, BM 78107, Sierra Leone)

Description. Length 14-16 gm; breadth 3 gm;

more than 30 striae in 10 gm in the raphe valve and

more than 40 in 10 gm in the rapheless valve (Figs.

47-50).

Distribution. Bumbuna Falls, rare. Other re-

cords: River Jong (Carter & Denny, 1982); Lake

Mape, River Waanje, River Malen (Carter &

Denny, 1987); Guma Dam (Fumanti et al., 1990);

Lake Sonfon (Carter & Denny, 1992); Bathurst

Falls (Fumanti, 1994).

Remarks. Carter in Carter & Denny (1982) de-

scribed this species from the River Jong, Sierra

Leone (as Achnanthes taiaensis).

Fam. COCCONEIDACEAE Kiitzing, 1844

Cocconeis Ehrenberg, 1838

140

Silvia Alfinito & Horst Lange-Bertalot

Cocconeis pediculus Ehrenberg, 1838

Krammer & Lange-Bertalot (1991b) PL 57:1-4

Description. Length 26-28 jam; breadth 22-23

pm; striae in the raphe valve c. 18 in 10 pm; puncta

20-22 in 10 pm; striae in the rapheless valve about

18 in 10 pm; puncta elongated, c. 10 in 10 pm

(Fig. 60).

Distribution. Bumbuna Palls, rare. Other

records: River Jong (Carter & Denny, 1982); Lake

Sonfon, Lake Popei (Carter & Denny, 1992).

Cocconeis placentula Ehrenberg, 1938

Krammer & Lange-Bertalot (1991b) PI. 51: 1-5

Description. Length 20 pm; breadth 13 pm; c.

25 striae in 10 pm in the raphe valve (Pig. 61).

Distribution. Bumbuna Palls, only one valve

found. Other records: Sula Hills (Molder, 1962);

River Jong (Carter & Denny, 1982); Lake Sonfon,

Lake Popei (Carter & Denny, 1992).

Pamilia BRACHYSIRACEAE D. G. Mann, 1990

Brachysira (Kiitzing) Round et Mann, 1981

Brachysira cf. brebissonii Ross in Hartley, 1986

Synonym: Anomoeoneis brachysira (Breb.) Gru-

now in Cleve, 1895

Synonym: A. serians (Breb.) Cleve v. brachysira

(Breb.) Cleve in Cleve et Moller, 1882

Description. Length 20-24 pm; breadth 6-7

pm; 35-40 striae in 10 pm (Figs. 68-74; Pig. 75).

Distribution. Bumbuna Palls, Peak Bintimani,

quite frequent. Records for A. brachysira (Breb.)

Grunow sensu lato: Sula Hills (Molder, 1962);

River Jong (Carter & Denny, 1982); Lake Mabesi

(Carter & Denny, 1987); Kania (Alfinito et al.,

1989); Guma Dam (Pumanti et al., 1990); Lake

Sonfon (Carter & Denny, 1992); Bathurst Palls (Pu-

manti, 1994).

Brachysira cf. metzeltinii Lange-Bertalot in Lange-

Bertalot & Moser, 1994

Description. Length 35-36 pm; breadth 6-6.5

pm; c. 28 striae in 10 pm (Figs. 76-78).

Distribution. Peak Bintimani, rare.

Brachysira cf. wygaschii Lange-Bertalot in Lange-

Bertalot & Moser, 1994

Description. Length 39-45 pm; breadth 9-10

pm; 22-24 striae in 10 pm. Compare Lange-Berta-

lot & Moser (1994, Pig. 13: 1-11).

Distribution. Bumbuna Palls, Peak Bintimani,

quite frequent (Figs. 79-83).

Pamilia CYMBELLACEAE Greville, 1833

Cymbella C. Agardh, 1830

Cymbella kappii (Cholnoky) Cholnoky, 1956

Krammer (2002) PL 52: 1-15

Description. Length 28-32 pm; breadth 8-9

pm; 14 striae and c. 24 puncta in 10 pm (Figs. 92-

95).

Distribution. Bumbuna Palls, quite common.

New record for Sierra Leone.

Encyonema Kiitzing, 1833

Encyonema cf. auerswaldii Rabenhorst, 1853

Description. Length 13-30 pm; breadth 6-10

pm; 11-14 striae and c. 24 puncta in 10 pm (Figs.

98-101).

Distribution. Bumbuna Palls, Peak Bintimani,

frequent.

Encyonema cf. javanicum (Hustedt) D. G. Mann,

1990

Synonym: Cymbella javanica Hustedt, 1938

Description. Length 18 pm; breadth 6 pm; c.

10 striae in 10 pm (Pig. 102).

Distribution. Bumbuna Palls, only one speci-

men observed. Records for E. javanicum (Hustedt)

D. G. Mann: River Jong (Carter & Denny, 1982)

sub Cymbella javanica Hustedt, 1938.

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

141

Encyonema neogracile Krammer var. tenuipun-

ctata Krammer, 1997

Krammer (1997) PL 85: 1-6

Description. Length 50-55 pm; breadth 7 pm;

14 striae and 30-32 puncta in 10 pm (Fig. 97).

Distribution. Bumbuna Falls, rare. New record

for Sierra Leone.

Encyonema neomesianum Krammer, 1997

Krammer (1997) PL 40: 6-9

Description. Length 32-36 pm; breadth 9-9.5

pm; 9-10 striae in 10 pm (Fig. 96).

Distribution. Peak Bintimani, rare. New record

for Sierra Leone.

Encyonema cf. subelginense Krammer, 1997

Description. Length 24 pm; breadth 8 pm; c.

10 striae and 25-26 puncta in 10 pm (Fig. 105).

Distribution. Bumbuna Falls, only one speci-

men observed.

Encyonema cf. ventricosum (Ag.) Grunow in

Schmidt et al., 1885

Morphotype 3 in Krammer (1997) Pl. 6: 14-18

Description. Length 15 pm; breadth 4.5 pm; c.

14 striae in 10 pm (Fig. 104).

Distribution. Bumbuna Falls, only one speci-

men observed.

Remarks. Very often in the literature more or

less similar taxa are errouneously identified as E.

ventricosum such as, for instance, Encyonema sp. 4

in Kulikowskiy et al., 2012 PL 8: 6-7).

Encyonopsis Krammer, 1997

Encyonopsis cf. schubartii (Hustedt) Krammer,

1997

Description. Length 19-22.5 pm; breadth 5-5.5

pm; 11-12 striae in 10 pm (Fig. 103).

Distribution. Bumbuna Falls, rare.

Familia AMPHIPLEURACEAE Grunow, 1862

Frustulia Rabenhorst, 1853

Frustulia cf. crassinervia (Breb.) Lange-Bertalot

et Krammer in Lange-Bertalot & Metzeltin, 1996

Lange-Bertalot & Metzeltin (1996) PL 38: 7-9

Synonym: F. rhomboides (Ehr.) De Toni v. crassi-

nervia (Breb.) Ross, 1947

Description. Length 58-60 pm; breadth 16 pm;

striae very fine, c. 35 in 10 pm (Figs. 115-118).

Distribution. Peak Bintimani, frequent; Bum-

buna Falls, quite common. Other records for F.

crassinervia (Breb.) Lange-Bertalot et Krammer:

Bathurst Falls (Fumanti, 1994) sub F. rhomboides

(Ehr.) de Toni v. crassinervia (Breb.) Ross.

Frustulia cf. saxonica Rabenhorst, 1853

Lange-Bertalot & Metzeltin (1996) PL 39: 10 from

Julma Olkky (Finland)

Synonym: F. rhomboides (Ehr.) De Toni v. saxonica

(Rabenh.) Pfitzer, 1872

Description. Length 69-70.5 pm; breadth 15

pm; c. 27 striae in 10 pm and 24-25 areolae in 10

pm (Figs. 111-114).

Distribution. Peak Bintimani, Bumbuna Falls,

quite frequent. Other records for F. saxonica Raben-

horst, sub F. rhomboides (Ehr.) de Toni v. saxonica

(Rabenh.) Pfitzer: Sula Hills (Molder, 1962); Guma

Dam (Fumanti et al., 1990); Bathurst Falls (Fu-

manti, 1994).

Frustulia cf. undosa Metzeltin et Lange-Bertalot,

1998

Metzeltin & Lange-Bertalot (1998) PL 116: 14-18

Description. Length 34-43 pm; breadth 8-9 pm;

striae very fine, difficult to count by LM, c. 40 in

10 pm; 50-52 areolae in 10 pm (Figs. 119-123;

Figs. 124-126).

Distribution. Peak Bintimani, Bumbuna Falls,

quite frequent.

142

Silvia Alfinito & Horst Lange-Bertalot

Familia GOMPHONEMATACEAE Kiitzing, 1844

Gomphonema Ehrenberg, 1832

Gomphonema pseudoaugur Lange-Bertalot, 1979

Krammer & Lange-Bertalot (1986) PL 159: 1-4

Description. Length 15-25 gm; breadth 5. 5-7. 5

gm, c. 13-14 striae in 10 gm (Figs. 109-110) .

Distribution. Bumbuna Falls, quite common.

New record for Sierra Leone.

Gomphonema cf. lagenula Kiitzing, 1 844

Synonym: Gomphonema parvulum Kiitz. v. lage-

nula (Kiitz.) Frenguelli, 1923

Description. Length 22-29 gm; breadth 6-8.5

gm; 14-16 striae in 10 gm (Fig. 108).

Distribution. Bumbuna Falls, quite common.

Records for G. lagenula , sub G. parvulum Kiitz. v.

lagenula (Kiitz.) Frenguelli: River Jong (Carter &

Denny, 1982); River Dankale (Mazzoni, 1986);

River Waanje (Carter & Denny, 1987).

Familia CATENULACEAE Mereschkowsky, 1902

Halamphora (Cleve) Levkov, 2009

Halamphora veneta (Kiitz.) Levkov, 2009

Hofmann et al. (2011) PL 92: 20-25

Synonym: Amphora veneta Kiitzing, 1 844

Description. Length 20 gm; breadth 4 gm; c.

24 striae in 10 gm (Fig. 106).

Distribution. Bumbuna Falls, only one speci-

men observed. Other records (sub Amphora veneta

Kiitzing): Lake Sonfon (Carter & Denny, 1992);

York (Alfinito et al., 1994).

FAMILY NOT DESIGNATED

Kobayasiella Lange-Bertalot, 1999

Kobayasiella cf. subtilissima (Cleve) Lange-Berta-

lot, 1999

Synonym: Navicula subtilissima Cleve, 1891

Description. Length 31-38 gm; breadth 4.5-5

gm. Striae very delicate, difficult to resolve by LM

(Fig. 107).

Distribution. Peak Bintimani, not common.

Other records for Kobayasella subtilissima (Cleve)

Lange-Bertalot (sub Navicula subtilissima Cleve):

Sula Hills (Molder, 1962); River Jong (Carter &

Denny, 1982); Lake Mape, Lake Mabesi (Carter &

Denny, 1987); Kania (Alfinito et al., 1989); Guma

Dam (Fumanti et al., 1990); Bathurst Falls (Fu-

manti, 1994).

Familia DIADESMIDIACEAE D. G. Mann, 1990

Luticola D. G. Mann in Round et al., 1990

Luticola aequatorialis (Heiden) Lange-Bertalot et

Ohtsuka in Ohtsuka, 2002

Simonsen (1992) PL 56: 8-11

Rumrich et al. (2000) PL 61: 15

Description. Length 16-17 gm; breadth 6.5-7

gm; c. 14 striae in 10 gm (Fig. 131).

Distribution. Bumbuna Falls, rare. First record

for Sierra Leone.

Luticola muticoides (Hustedt) D. G. Mann in

Round et al., 1990

Rumrich et al. (2000) PL 62: 9-12

Synonym: Navicula muticoides Hustedt, 1949

Description. Length 17-18 gm; breadth 8-8.5

gm; 30-32 striae in 10 gm (Figs. 129-130).

Distribution. Peak Bintimani, Bumbuna Falls,

rare. Other records (sub Navicula muticoides Hu-

stedt): Sula Hills (Molder, 1962); River Jong (Car-

ter & Denny, 1982); Lake Mabesi (Carter & Denny,

1987); Guma Dam (Fumanti et al., 1990); Lake

Sonfon, Lake Popei (Carter & Denny, 1992); York

(Alfinito et al., 1994).

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

143

Luticola cf. mutica (Kiitz.) D. G. Mann in Round

et al., 1990

Synonym: Navicula mutica Kiitzing, 1 844

Description. Length 26-31 jam; breadth 8-8.5

gm; 20-22 striae in 10 gm (Fig. 132).

Distribution. Peak Bintimani, Bumbuna Falls,

rare. Other records for L. mutica (Kiitz.) D. G.

Mann (sub Navicula mutica Kiitz.): Sula Hills

(Molder, 1962); River Dankale (Mazzoni, 1986);

Lake Mabesi (Carter & Denny, 1987); Guma Dam

(Fumanti et al., 1990); Lake Sonfon, Lake Popei

(Carter & Denny, 1992).

Luticola cf. muticopsis (Van Heurck) D. G. Mann

in Round et al., 1990

Synonym: Navicula muticopsis Van Heurck, 1909

Description. Length 24-25 gm; breadth 9 gm,

19-20 striae in 10 gm (Figs. 127-128).

Distribution. Peak Bintimani, very rare. Other

records for L. muticopsis (Van Heurck) D. G. Mann:

Kania (Alfmito et al., 1989) sub Navicula muticop-

sis Van Heurck.

Remarks. Luticola muticopsis s. str. is known

from Antarctic and sub- Antarctic regions, not from

tropical zones. Other similar taxa are L. ventricosa

(Kiitzing) D. G. Mann in Round et al., 1990 and L.

ventriconfusa Lange-Bertalot in Lange-Bertalot et

al., 2003, both from Europe and possessing lower

size dimensions (Lange-Bertalot et al., 2003, pp.

72-74, PL 73). The just two specimens observed are

very similar to Luticola species cf. muticopsis in

Rumrich et al. (2000), PI. 61: 9-12.

Luticola cf. terminata (Hustedt) Johansen in Johan-

sen et al., 2004

Description. Length 43-45 gm; breadth 9-9.5

gm; c. 20 striae in 10 gm at the centre and 24-25

towards the apices (Fig. 134).

Distribution. Bumbuna Falls, rare.

Familia MASTOGLOIACEAE Mereschkowsky,

1903

Mastogloia Thwaites in W. Smith, 1856

Mastogloia cf. smithii Thwaites in W. Smith, 1856

Description. Length 37-39 gm; breadth 8-8.5

gm; c. 20 striae in 10 gm (Figs. 139-140).

Distribution. Bumbuna Falls, rare.

Remarks. This is very probably not a homoge-

neous taxon; the common concepts are much too

broad, it needs a fundamental revision.

Familia NEIDI ACE AE Mereschkowsky, 1903

Neidium Pfitzer, 1871

Neidium cf. hercynicum Mayer, 1915 v. hercyni-

cum f. subrostratum Wallace in Reimer, 1959

Description. Length 32-33 gm; breadth 7.5-8

gm; 25-27 striae in 10 gm (Figs. 135-136).

Distribution. Bumbuna Falls, rare. Records for

N. hercynicum Mayer f. subrostratum Wallace:

River Waanje (Carter & Denny, 1987).

FAMILY NOT DESIGNATED

Nupela Vyverman et Compere, 1991

Nupela cf. encyonopsis Metzeltin et Lange-Berta-

lot, 1998

Metzeltin & Lange-Bertalot (1998) PI. 72: 35-37

Description. Length 17 gm; breadth 4 gm;

striae too fine to be resolved by LM (Fig. 67).

Distribution. Bumbuna Falls.

Remarks. As only one specimen was observed,

we were not able to carry out SEM examination.

Nupela cf. vyvermanii Moser, Lange-Bertalot et

Metzeltin, 1998

Moser etal. (1998) PI. 31 : 7-10

Description. Length 14-15 gm; breadth 4-5

gm; c. 30 striae in 10 gm (Figs. 65-66).

144

Silvia Alfinito & Horst Lange-Bertalot

Distribution. Bumbuna Falls, rare.

Remarks. Very rare, only two specimens obser-

ved, SEM examination is needed.

Familia PINNULARIACEAE D. G. Mann, 1990

Pinnularia Ehrenberg, 1843

Pinnularia borealis Ehrenberg, 1 843

Krammer (2000) PI. 7: 6-13

Description. Length 31-32 pm ; breadth 8 pm;

c. 6 striae in 10 pm (Fig. 146).

Distribution. Bumbuna Falls, rare. Other

records: River Dankale (Mazzoni, 1986).

Pinnularia cf. borealis Ehrenberg, 1 843

Description. Length 37-38 pm; breadth 6-7

pm; c. 5 striae in 10 pm (Figs. 147-149).

Distribution. Bumbuna Falls, only two speci-

mens observed.

Pinnularia divergens W. Smith, 1853 v. divergens

sensu lato

Description. Length 50-72 pm; breadth 10-12

pm; c. 10 striae in 10 pm (Fig. 137).

Distribution. Bumbuna Falls, not rare. Other

records: Sula Hills (Molder, 1962); Lake Mabesi

(Carter & Denny, 1987); Lake Popei (Carter &

Denny, 1992).

Pinnularia cf. gibbiformis Krammer, 1992

Description. Length 82 pm; breadth 8,5 pm; c.

11 striae in 10 pm (Fig. 138).

Distribution. Bumbuna Falls, only one speci-

men observed.

Pinnularia cf. graciloides Hustedt, 1937

Description. Length 52-69 pm; breadth 8-10

pm; 12-13 striae in 10 pm (Figs. 141-144; Figs.

150-151; Figs. 152-153).

Distribution. Bumbuna Falls, not common.

Records for P. graciloides Hustedt: Sula Hills

(Molder, 1962); River Jong (Carter & Denny,

1982); Lake Popei (Carter & Denny, 1992).

Pinnularia graphica Carter in Carter & Denny,

1992

Carter & Denny (1992) PL 8: 5

Description. Length 39-50 pm; breadth 5-7

pm; 12-14 striae in 10 pm (Figs. 154-155; Figs.

156-159).

Distribution. Bumbuna Falls, common; Peak

Bintimani, rare. Other records: Lake Sonfon (Carter

& Denny, 1992).

Remarks. Carter in Carter & Denny (1992) de-

scribed this species from a stream entering Lake

Sonfon in S.E. Sector.

Pinnularia cf. stricta Hustedt, 1937

Description. Length 23-27 pm; breadth 5-5.5

pm; 15-16 striae in 10 pm (Fig. 133).

Distribution. Bumbuna Falls, rare.

Familia RHOICOSPHENIACEAE Chen et Zhu,

1983

Rhoicosphenia Grunow, 1860

Rhoicosphenia abbreviata (Agardh) Lange-Berta-

lot, 1980

Krammer & Lange-Bertalot (1986) PI. 91: 20-28

Synonym: R. curvata (Kiitz.) Grunow in Raben-

horst, 1864

Description. Length 26-29 pm. Only seen in

girdle view (Figs. 166-167).

Distribution. Bumbuna Falls, rare. Other

records sub R. curvata (Kiitz.) Grunow: Sula Hills

(Molder, 1962); River Jong (Carter & Denny,

1982); Lake Mabesi (Carter & Denny, 1987).

Familia STAURONEIDACEAE D. G. Mann, 1990

Stauroneis Ehrenberg, 1843

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

145

Stauroneis legumen sensu auct. nonnull, non

S. legumen (Ehr.) Kiitzing, 1 844

Description. Length 52 jam; breadth 13 (am; c.

28 striae in 10 |am (Fig. 145).

Distribution. Only one specimen observed in

Bumbuna Falls samples. Other records for S. legu-

men (Ehr.) Kiitzing: Lake Mabesi (Carter & Denny,

1987).

Stauroneis resoluta Moser, Lange-Bertalot et

Metzeltin, 1998

Moser et al. (1998) PI. 31: 15; PI. 32: 1-6.

Metzeltin & Lange-Bertalot (2002) PI. 46: 6-7

Description. Length 30-35 pm; breadth 7.5-8

pm; c. 28 striae in 10 pm (Figs. 160-165; Figs. 168-

169).

Distribution. Bumbuna Falls, not common.

New record for Sierra Leone.

Remarks. The size range is slightly higher than

that mentioned by Moser et al. (1998).

Familia BACILLAR! ACE AE Ehrenberg, 1840

Nitzschia Hassall 1845

Nitzschia cf. microcephala Grunow in Van Heurck,

1881

Description. Length 11-12 pm; breadth 2.5-3

pm; c. 18 fibulae in 10 pm (Figs. 170-171).

Distribution. Bumbuna Falls, rare. Records for

N. microcephala Grunow in Van Heurck: Sula Hills

(Molder, 1962).

Familia RHOPALODIACEAE (Karsten) Topa-

chevskyi et Oksiyuk, 1 960

Synonym: Epithemiaceae sensu Karsten in Engler

& Prantl, 1928

Epithemia Brebisson ex Kiitzing, 1844

Epithemia adnata (Kiitz.) Brebisson, 1838

Hofmann et al. (2011) PL 119: 5-9

Synonym: Epithemia zebra (Ehr.) Kiitzing, 1 844

Description. Length 49-50 pm; breadth 8-10

pm; striae 13-15 in 10 pm and 3. 5 -4. 5 transapical

ribs in 10 pm (Fig. 173).

Distribution. Bumbuna Falls, rare. Other

records: Lake Sonfon (Carter & Denny, 1992)

sub Epithemia zebra (Ehr.) Kiitzing.

Epithemia sorex Kiitzing, 1 844

Hofmann et al. (2011) PL 121: 1-7

Description. Length 30 pm; breadth 8.5 pm; c.

14 striae in 10 pm and c. 8 transapical ribs in 10 pm

(Fig. 172).

Distribution. Bumbuna Falls, only one speci-

men observed. New record for Sierra Leone.

Familia SURIRELLACEAE Kiitzing, 1844

Stenopterobia Brebisson ex Van Heurck, 1896

Stenopterobia cf. delicatissima (Lewis) Brebisson

ex Van Heurck, 1896

Krammer & Lange-Bertalot (1988) PL 174: 1-12

Metzeltin & Lange-Bertalot (2002) PL 86: 3-4

Synonym: Surirella delicatissima Lewis, 1864

Description. Length 38-76 pm; breadth 4-5

pm; c. 28-30 striae in 10 pm (Figs. 174-177; Figs.

178-180).

Distribution. Peak Bintimani, rare; Bumbuna

Falls, quite frequent. Other records: Kangari Sula

(Molder, 1962), River Jong (Carter & Denny,

1982), Carter & Denny, 1987 (without localities),

Guma Dam (Fumanti et al., 1990), Lake Sonfon,

Lake Popei (Carter & Denny, 1992) sub Surirella

delicatissima Lewis; Bathurst Falls (Fumanti,

1994).

Surirella Turpin, 1828

Surirella linearis W. Smith, 1853 v. constricta

Grunow, 1862

146

Silvia Alfinito & Horst Lange-Bertalot

Huber-Pestalozzi (1942) Fig. 602 c

Description. Length 71-73 pm; breadth 16-17

pm; c. 25-26 alar canals in 100 gm (Figs. 181-183;

Figs. 184-185).

Distribution. Bumbuna Falls, not common.

Other records: Kangari Sula (Molder, 1962); River

Jong (Carter & Denny, 1982); River Dankale (Maz-

zoni, 1986); Lake Mabesi (Carter & Denny, 1987);

Lake Sonfon (Carter & Denny, 1992).

Remarks. It is not unlikely that this African

population is heterospecific vs. holarctic S. linea-

ris (compare Werum & Lange-Bertalot, 2004, Pis.

98-99).

TAXONOMICAL AND BIOGEOGRAPHIC

CONCLUSION

During the present study a total of 65 taxa, be-

loging to 31 genera, were identified. Of these, 12

are reported for the first time in Sierra Leone. Con-

sidering the two sites, Bumbuna Falls is signifi-

cantly richer, with 58 taxa, while diversity in the

samples from Peak Bintimani is much lower, with

only 22 Taxa. Numerous dubious holarctic taxa,

marked with cf. that need further SEM observa-

tions, are very probably new to science.

It is a matter of fact that in tropical regions not

only the vascular plants but likewise the diatom

flora of higher mountains differs fundamentally

from that of plains and lower to medium altitude

mountain ranges. This was shown for instance for

the Neotropics in a strict sense in comparison to the

High Andes (Metzeltin & Lange-Bertalot, 1998;

2007; Rumrich et al., 2000). In West Africa, be-

longing to the Paleotropics, the situation is as yet

less well known. In particular a critical analysis of

diatom records for the highlands is necessary here.

Checklists of various authors (Woodhead & Tweed,

1958; Alfinito, 2011) record numerous taxa com-

monly known from Holartic regions of Eurasia and

North America, together with a minor number of

geographically restricted West African taxa which

were described during later decades of the 20th

century, mainly by Carter & Denny (1982; 1987;

1992). Some others have been noted which were

described originally from subtropical areas of South

Africa by Cholnoky (e.g. 1957; 1958; 1960; 1962;

1966). Whilst occurrence of African indigenous

taxa is widely incontestable mainly identifications

as Holarctic species appear doubtful and need a

critical revision. Since description of new taxa is

not the aim of this preliminary paper such dubious

Holarctic species, suspected to be new to science,

are noted here as “cf.” (species to compare to) ex-

pecting a differential diagnosis later on. Appropriate

examples are the illustrated species (LM and SEM)

of the genera Frustulia and Brachysira that roughly

resemble “prominent” Holarctic species concerning

valve outlines and size dimensions but clearly differ

when the entire set of morphological characters is

compared (see Figs. 65-91 and 111-126).

Without doubt, cosmopolitan taxa do exist, par-

ticularly in intermittently dry/wet habitats as rock-

pools. Common examples are Orthoseira roeseana,

Achnanthes inflata , Pinnularia borealis sensu lato,

Luticola spp. or halophilous taxa like Ctenophora

pulchella. Moreover, the true identity of rarely oc-

curring Epithemia adnata , E. sorex or Cocconeis

pediculus is barely questionable. However, a ma-

jority of the frequent and / or abundant diatoms is

as yet unknown; many may represent “elements”

either of the tropical African flora or of the

Paleotropics more generally, both insufficiently in-

vestigated up to recently. Frustulia cf. undosa

(Figs. 119 - 126) appears rather closely related to

that Neotropical taxon. It is an example among

few other ones which shows more or less resem-

blance to “sister taxa” from the Neotropics. Cym-

bella kappii, originally widespread only in Africa

could be observed later on likewise in a lake of

Bosnia, the Balkans (Krammer, 2002, p. 71).

Actinella brasiliensis may serve as an example

for a Pantropical taxon of the Eunotiaceae but it has

to be taken into consideration that a heterogeneous

species complex is concerned in this case including

the questionable variety sierra-leonensis Woodhead

et Tweed, 1957.

The majority of the observed Eunotia species of

the investigated montaneous areas of Sierra Leone

seem to be undescribed from elsewhere. They may

represent endemicities of tropical Africa or prove

as more widespread taxa of the Paleotropics, pro-

vided that more detailed knowledge can be achieved

in the future from this, specifically for diatoms,

widely neglected plant realm.

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

147

Figures 1-13. LM: xl500. Fig. 1: Aulacoseira granulata v. valida. Figs. 2, 3: Orthoseira roeseana. Figs. 4-6: Cyclotella me-

neghiniana. Figs. 5, 6: idem, SEM, valve outside (5: scale bar = 2 gm; 6: scale bar = 1 gm). Figs. 7-9: Ctenophora pulchella.

Fig. 10: Staurosira construens. Fig. 11: Staurosira cf. longirostris. Fig. 12: Staurosira venter. Fig. 13: Fragilaria cf. javanica.

148

Silvia Alfinito & Horst Lange-Bertalot

Figures 14-27. LM: xl500; SEM: Figs. 22-24 scale bar = 2 gm. Fig. 14: Ulnaria cf. ulna. Fig. 15: Eunotia rabenhorstii v.

triodon. Figs. 16, 17: E. cf. cristagalli and cf. tecta. Figs. 18-24: E. rhomboidea (Figs. 22, 23 valve outside; Fig. 24 valve

inside). Figs. 25-26: E. cf. minor. Fig. 27: E. vumbae.

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

149

Figures 28-35. LM: xl500. SEM: Fig. 32 scale bar = 2 gm; Fig. 34 scale bar = 5 gm; Fig. 33 scale bar = 1 gm. Figs. 28-

34: Eunotia naegelii (Figs. 32, 34 valve inside; Fig. 33 valve outside). Fig. 35: E. rabenhorstiana.

150

Silvia Alfinito & Horst Lange-Bertalot

Figures 36-39. LM: Fig. 36 xlOOO; Fig. 37 xl500; SEM: Fig. 38 scale bar = 10 gm; Fig. 39 scale bar= 5 gm. Figs. 36-

39: Actinella brasiliensis (Figs. 38, 39 valve outside).

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

151

Figures 40, 41 . Actinella brasiliensis, valve outside, SEM, scale bar = 5 jim.

152

Silvia Alfinito & Horst Lange-Bertalot

Figures 42-51. LM: xl500; SEM: scale bar = 2 pm. Figs. 42-46: Eunotia cf. crassula. Figs. 47, 48: Achnanthidium taia-

ense. Figs. 49, 50, idem, possible post-initial cell. Fig. 51 : Actinella brasiliensis, valve inside.

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

153

Figures 52-57. LM: xl500; SEM: Fig 55 scale bar = 5 pm; Fig. 56 scale bar = 2 pm; Fig. 57 scale bar = 1 |im. Figs. 52-

57: Achnanthidium subhudsonis. Fig. 55: rapheless valve outside. Figs. 56-57: raphe valve outside.

154

Silvia Alfinito & Horst Lange-Bertalot

Figures 58-64. LM: xl500; SEM: Fig. 58 scale bar = 2 pm; Fig. 59 scale bar = 1 pm; Fig. 64 scale bar = 5 gm. Figs. 58,

59: Achnanthidium subhudsonis (Fig. 58: rapheless valve outside; Fig. 59: raphe valve outside). Fig. 60: Cocconeis pediculus.

Fig. 61: Cocconeis placentula. Figs. 62-64: Achnanthes inflata. (Fig. 64: rapheless valve inside).

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

155

Figures 65-74. LM: xl500; SEM: scale bar = 5 |im. Figs. 65, 66: Nupela cf. vyvermanii. Fig. 67: Nupela cf. encyonopsis.

Figs. 68-74: Brachysira cf. brebissonii (Figs. 72-74: valve outside).

156

Silvia Alfinito & Horst Lange-Bertalot

Figures 75-78. LM: xl500; SEM: scale bar = 5 |im. Fig. 75: Brachysira cf. brebissonii, valve inside. Figs. 76-78: Bra-

chysira cf. metzeltinii (Fig. 78: valve inside).

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

157

Figures 79-83. LM:xl500; SEM: scale bar = 10 gm. Figs. 79-83: Brachysira cf. wygaschii (Fig. 83: valve outside)

158

Silvia Alfinito & Horst Lange-Bertalot

84-86

Figures 84-86. SEM: Fig. 84 scale bar =10 gm; Fig. 85 scale bar = 2 (am; Fig. 86 scale bar = 1 jam. Figs. 84-86: Brachy-

sira cf. wygaschii, valve outside.

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

159

Figures 87-88. SEM: Fig. 87 scale bar = 5 |im; Fig. 88 scale bar = 2 |im. Figs. 87, 88: Brachysira cf. wygaschii, valve

outside.

160

Silvia Alfinito & Horst Lange-Bertalot

Figures 89-91. SEM: Fig. 89 scale bar = 5 |im; Figs. 90, 91 scale bar = 2 gm. Figs. 89-91: Brachysira cf. wygaschii,

valve inside.

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

161

Figures 92-110. LM: xl500. Figs. 92-95: Cymbella kappii. Fig. 96: Encyonema neomesianum. Fig. 97: E. neogracile var.

tenuipunctata. Figs. 98-101: E. cf. auerswaldii. Fig. 102: E. cf. javanicum. Fig. 103: Encyonopsis cf. schubartii. Fig. 104:

Encyonema cf. ventricosum. Fig. 105: Encyonema cf. subelginense. Fig. 106: Elalamphora veneta. Fig. 107: Kobayasiella

cf. subtilissima. Fig. 108: Gomphonema cf. lagenula. Figs. 109-110: G. pseudo augur.

162

Silvia Alfinito & Horst Lange-Bertalot

Figures 111-114. LM: xl500; SEM: Fig. 1 12 scale bar = 10 jam; Fig. 113 scale bar = 5 gm; Fig. 114 scale bar = 2 gm.

Figs. 111-114: Frustulia cf. saxonica (Figs. 112-114: valve outside).

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

163

Figures 115-118. LM:xl500; SEM: Fig.

lia cf.

116 scale bar = 10 gm; Figs. 117, 1 1 8 scale bar = 2 gm. Figs. 115-118: Frustu-

crassinervia (Figs. 116-118: valve inside).

164

Silvia Alfinito & Horst Lange-Bertalot

Figures 119-123. LM: xl500; SEM: Fig. 121 scale bar = 10 jim; Figs. 122, 123 scale bar = 2 |im. Figs. 119-123: Frustu-

lia cf. undosa (Figs. 121-123: valve inside).

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

165

Figures 124-126. SEM: Fig. 124 scale bar = 5 gm; Figs. 125, 126 scale bar = 2 gm. Figs. 124-126: Frustulia cf. undosa,

valve outside.

166

Silvia Alfinito & Horst Lange-Bertalot

Figs. 127-140. LM: xl500. Figs. 127, 128: Luticola cf. muticopsis. Figs. 129, 130: Luticola muticoides. Fig. 131: L. ae-

quatorialis. Fig. 132: L. cf. mutica. Fig. 133: Pinnularia cf. stricta. Fig. 134: Luticola cf. terminata. Figs. 135, 136: Neidium

cf. hercynicum v. hercynicum f. subrostratum. Fig. 137: Pinnularia divergens v. divergens sensu lato. Fig. 138: P. cf. gibbi-

formis. Figs. 139, 140: Mastogloia cf. smithii.

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

167

Figures 141-149. LM: xl500. Figs. 141-144: Pinnularia cf. graciloides. Fig. 145: Stauroneis legumen sensu auct. non-

null., non S. legumen (Ehr.) Kiitzing, 1844. Fig. 146: Pinnularia borealis. Figs. 147-149: P. cf. borealis.

168

Silvia Alfinito & Horst Lange-Bertalot

Figures 150, 151. SEM: Fig. 150 scale bar =10 |im; Fig. 151 scale bar = 2 |im. Figs. 150, 151: Pinnularia cf. graciloi-

des , valve outside.

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

169

Figures 152-155. LM: xl500; SEM: Figs. 152, 153 scale bar = 2 gm; Fig. 155 scale bar = 10 gm. Figs. 152, 153: Pinnu-

laria cf. graciloides, valve outside. Figs. 154, 155: P. graphica (Fig. 155: valve outside).

170

Silvia Alfinito & Horst Lange-Bertalot

Figures 156-159. SEM: Figs 156, 158, 159 scale bar = 2 |im; Fig.

phica (Figs. 156-158: valve outside;

157 scale bar = 1 |im. Figs. 156-159: Pinnularia gra-

Fig. 159: valve inside).

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

171

Figures 164-167. LM: xl500; SEM: Fig. 163 scale bar = 10 |im; Figs. 164, 165 scale bar = 1 |im. Figs. 160-165: Stauro-

neis resoluta (Figs. 163, 164: valve outside; Fig. 165: valve inside). Figs. 166, 167: Rhoicosphenia abbreviata.

172

Silvia Alfinito & Horst Lange-Bertalot

Figures 168, 173. LM: xl500; SEM: Fig. 168 scale bar = 2 gm; Fig. 169 scale bar = 5 |im. Figs. 168, 169: Stauroneis re-

soluta (Fig. 168: valve outside; Fig. 169: valve inside). Figs. 170, 171: Nitzschia cf. microcephala. Fig. 172: Epithemia

sorex. Fig. 173: E. adnata.

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

173

Figures 174-177. LM: xl500; SEM: Fig. 176: scale bar 5 |im; Fig. 177: scale bar = 2 |im. Figs. 174-177: Stenopterobia

cf. delicatissima (Fig. 176 left: valve outside; Fig. 176 right: valve inside; Fig. 177: valve inside).

174

Silvia Alfinito & Horst Lange-Bertalot

Figures 178-180. SEM: Fig. 178: scale bar = 2 |im; Figs. 179, 180: scale bar = l|im. Figs. 178-180: Stenopterobia cf. de-

licatissima (Figs. 178, 179: valve outside; Fig. 180 valve inside).

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

175

Figures 181-183. LM: xl500; SEM: Fig. 182: scale bar = 10 jim; Fig. 183: scale bar = 2 gm. Figs. 181-183: Surirella li-

nearis v. constricta; Figs. 182, 183: valve outside.

176

Silvia Alfinito & Horst Lange-Bertalot

Figures 184-185. SEM. Fig. 184. scale bar = 20 |im; Fig. 185: scale bar = 5 |im. Figs. 184, 185: Surirella linearis v. con-

strict a, valve outside.

Freshwater algae of Sierra Leone (Tropical West Africa): diatoms from Loma Mountains and Bumbuna Falls

177

REFERENCES

Alfmito S., 20 1 1 . A check list of the freshwater algal flora

of Sierra Leone, Tropical West Africa. I. Cyanophy-

ceae to Conjugatophyceae (exclusive of Bacillario-

phyceae). Biodiversity Journal, 2: 121-144.

Alfinito S., Fumanti B. & Ricci S., 1989. Freshwater

algae from Kania (Sierra Leone, West Tropical

Africa). Ri vista di Idrobiologia, 28: 167-178.

Alfinito S., Fumanti B. & Ricci S., 1994. Diatoms from

York, Sierra Leone (West Africa). Quademi Accade-

mia Nazionale dei Lincei, 267: 65-79.

Anonymous, 1975. Proposals for a standardization of

diatom terminology and diagnoses. Beihefte zur

Nova Hedwigia, 53: 323-354.

Carter J.R. & Denny P., 1982. Freshwater algae of Sierra

Leone IV. Bacillariophyceae; Part (i) diatoms from

the river Jong (Taia) at Njala. Beihefte zur Nova

Hedwigia, 73: 281-331.

Carter J.R. & Denny P, 1987. Freshwater algae of Sierra

Leone IV. Bacillariophyceae; Part (ii) diatoms from

the coastal region of the southern province. Nova

Hedwigia, 44: 229-275.

Carter J.R. & Denny P, 1992. Freshwater algae of Sierra

Leone IV. Bacillariophyceae; Part (iii) diatoms from

the lake Sonfon region and from Lake Popei. Nova

Hedwigia, 54: 159-211.

Cholnoky B.J., 1954. Diatomeen aus Sud-Rhodesien.

Portugaliae Acta Biologica (B), 4: 197-226.

Cholnoky B.J., 1957. Beitrage zur Kenntnis der Sudafri-

kanischen Diatomeenflora. Portugaliae Acta Biolo-

gica (B), 6: 53-93.

Cholnoky B.J., 1958. Beitrage zur Kenntnis der Sudafri-

kanischen Diatomeenflora II. Einige Gewasser im

Waterberg-Gebiet, Transvaal. Portugaliae Acta Bio-

logica (B), 6: 99-160.

Cholnoky B.J., 1960. Beitrage zur Kenntnis der Diato-

meenflora von Natal. Nova Hedwigia, 2: 1-128.

Cholnoky B.J., 1962. Beitrage zur Kenntnis der Sudafri-

kanischen Diatomeenflora III. Diatomeen aus der

Kaap-Provinz. Revista de Biologia, 3: 1-80.

Cholnoky B.J., 1966. Die Diatomeen im Unterlaufe des

Okawango-Flusses. Nova Hedwigia Beihefte, 21:

1 - 120 .

Compere P, 1991. Contribution a F etude des algues du

Senegal. 1. Algues du lac de Guiers et du Bas-Sene-

gal. Bulletin du Jardin Botanique Nationale de Bel-

gique, 61: 171-267.

Compere P. & Riaux-Gobin C., 2009. Diatomees de quel-

ques biotopes marins, saumatres et dulgaquicoles de

Guinee (Afrique occidentale). Systematics and Geo-

graphy of Plants, 79: 33-66.

Foged N., 1966. Freshwater diatoms from Ghana. Bio-

logiske Skrifter Det Kongelige Danske Videnskaber-

nes Selskab, 15: 1-169 + 25 Pis.

Foged N., 1986. Diatoms in Gambia. Bibliotheca Diato-

mologia, 12: 1-153.

Frenguelli J., 1941. XVI Contribucion al conocimiento

de las diatomeas argentinas. Diatomeas del Rio de la

Plata. Revista del Museo de la Plata (n.s.) 3, Botanica

15: 213- 334.

Fumanti B., 1994. Freshwater algae from Sierra Leone:

diatoms from Bathurst Falls (Western Area). Qua-

derni Accademia Nazionale dei Lincei, 267: 51-64.

Fumanti B., Ricci S. & Alfinito S., 1990. Freshwater algae

from Sierra Leone: Diatoms from Guma Valley. Qua-

derni Accademia Nazionale dei Lincei, 265: 27-47.

Hofmann G., Werum M. & Lange-Bertalot H., 2011. Dia-

tomeen im Siisswasser-Benthos von Mitteleuropa. A.

R.G. Gantner Verlag K.G., 908 pp.

Huber-Pestalozzi G., 1942. Das Phytoplankton des Siis-

swassers, Systematik und Biologie. 2 Teil, 2 Halfte,

Diatomeen. In: Die Binnengewasser, Band 16: 367-

549. Schweizerbarf sche Verlagsbuchhandlung.

Stuttgart.

Krammer K., 1997. Die cymbelloiden Diatomeen. Eine

Monographic der weltweit bekannten Taxa. Teil 1 .

Allgemeines un Encyonema Part. Bibliotheca Diato-

mologica, 36: 1-382.

Krammer K., 2000. The genus Pinnularia. Diatoms of

Europe, 1: 1-703.

Krammer K., 2002. Cymbella. Diatoms of Europe 3: 1-584.

Krammer K. & Lange-Bertalot H., 1986. Bacillariophy-

ceae. 1. Teil: Naviculaceae. In: Ettl H., Gerloff J., Hey-

nig H. & Mollenhaurer D. (Eds.), Susswasserflora von

Mitteleuropa, Band 2/1. VEB G. Fischer. Jena. 876 pp.

Krammer K. & Lange-Bertalot H., 1988. Bacillariophy-

ceae. 2. Teil: Bacillariaceae, Epithemiaceae, Surirel-

laceae. In: Ettl H., Gerloff J., Heynig H. &

Mollenhaurer D. (Eds.), Susswasserflora von Mitte-

leuropa, Band 2/2. VEB G. Fischer. Jena, 596 pp.

Krammer K. & Lange-Bertalot H., 1991a. Bacillariophy-

ceae. 3. Teil: Centrales, Fragilariaceae, Eunotiaceae.

In: Ettl H., Gerloff J., Heynig H. & Mollenhaurer D.,

Susswasserflora von Mitteleuropa, Band 2/3. VEB G.

Fischer. Jena, 576 pp.

Krammer K. & Lange-Bertalot H., 1991b. Bacillariophy-

ceae. 4. Teil: Achnanthaceae, Kritische Erganzungen

zu Navicula (Lineolatae) und Gomphonema Gesam-

tliteraturverzeichnis Teil 1-4. In: Ettl H., Gerloff J.,

Heynig H. & Mollenhaurer D. (Eds.), Susswasserflora

von Mitteleuropa, Band 2/4. VEB G. Fischer. Jena,

437 pp.

Krammer K. & Lange-Bertalot H., 2000. Bacillariophy-

ceae. Part 5: English and French translation of the

keys. In: Biidel B., Gartner G., Krienitz L. & Lo-

khorst G.M. (Eds.), Susswasserflora von Mitteleu-

ropa, Band 2/5. Spektrum Akademischer Verlag

Heidelberg. Berlin.

178

Silvia Alfinito & Horst Lange-Bertalot

Kulikovskiy M., Lange-Bertalot H., Metzeltin D. & Wit-

kowski A., 2012. Lake Baikal: hotspot of endemic

diatoms. Iconographia Diatomologica, 23: 1-607.

Lange-Bertalot H. & Krammer K., 1989. Achnanthes

eine Monographic der Gattung. Bibliotheca Diato-

mologica, 18: 1-393.

Lange-Bertalot H. & Metzeltin D., 1996. Indicators of

Oligotrophy. 800 taxa representative of three ecolo-

gically distinct lake types. Iconographia Diatomolo-

gica, 2: 1-390.

Lange-Bertalot H. & Moser G., 1994. Brachysira. Mo-

nographic der Gattung. Bibliotheca Diatomologica,

29: 1-212.

Lange-Bertalot H., Bak M. & Witkowski A., 2011. Eu-

notia and related genera. Diatoms of Europe, 6: 1-

908.

Lange-Bertalot EL, Cavacini P., Tagliaventi N. & Alfinito

S., 2003. Diatoms of Sardinia. Rare an 76 new spe-

cies in rock pools and other ephemeral waters. Ico-

nographia Diatomologica, 12: 1-438.

Mazzoni A., 1986. Freshwater diatoms from Dankale

River (Sierra Leone). Quaderni Accademia Nazionale

dei Lincei, 260: 105-119.

Metzeltin D. & Lange-Bertalot EL, 1998. Tropical Dia-

toms of South America I. About 700 predominantly

rarely known or new taxa representative of the neo-

tropical flora. Iconographia Diatomologica, 5: 1-695.

Metzeltin D. & Lange-Bertalot H., 2002. Diatoms from

the “Island Continent’ ’ Madagascar. Iconographia

Diatomologica, 11: 1-286.

Metzeltin D. & Lange-Bertalot EL, 2007. Tropical Dia-

toms of South America II. Special remarks on bio-

geographic disjunction. Iconographia Diatomologica,

18: 1-877.

Metzeltin D., Lange-Bertalot H. & Garcia-Rodriguez F.,

2005. Diatoms of Uruguay, compared with other taxa

from South America and elsewhere. Iconographia

Diatomologica, 15: 1-736.

Molder K., 1962. Diatomeen aus den Gebirgen Sula und

Kangari in Sierra Leone, Westafrika. Bulletin de la

Commission Geologique de Finlande, 198: 7-48.

Moser G., Lange-Bertalot H. & Metzeltin D., 1998. Insel

der Endemiten. Geobotanisches Phanomen Neukale-

donien. Bibliotheca Diatomologica, 38: 1-464.

Reichardt E., 1999. Zur Revision der Gattung Gompho-

nema. Die Arten um G. affine/ ins igne, G. angusta-

tum/micropus, G. acuminatum sowie gomphonemoide

Diatomeen aus dem Oberoligozan in Bohmen. Icono-

graphia Diatomologica, 8: 1-203.

Round F., Crawford R. & Mann D., 1990. The Diatoms.

Biology & morphology of the genera. Cambridge

University Press, 747 pp.

Rumrich U., Lange-Bertalot H. & Rumrich M., 2000.

Diatoms of the Andes. From Venezuela to Patago-

nia/Tierra del Fuego. Iconographia Diatomologica, 9:

1-673.

Sar E., Sala S., Sunesen I., Henninger M. & Montastruc

M., 2009. Catalogue of the genera, species, and in-

fraspecific taxa erected by J. Frenguelli. Diatom Mo-

nograph, 10: 419 pp.

Simonsen R., 1979. The diatom system: ideas on phylo-

geny. Bacillaria, 2: 9-71.

Simonsen R., 1987. Atlas and Catalogue of the Diatom

Types of Friedrich Hustedt. Vol. I, II, III. J. Cramer,

Berlin, Stuttgart. 525 pp. + 772 pis.

Simonsen R., 1992. The diatom types of Heinrich Heiden

in Heiden & Kolbe, 1928. Bibliotheca Diatomolo-

gica, 24: 1-100 + 86 plates.

Werum M. & Lange-Bertalot H., 2004. Diatoms in

Springs from Central Europe and elsewhere under the

influence of hydrogeology and anthropogenic im-

pacts. Iconographia Diatomologica 13: 1-479.

WoodheadN. & Tweed R.D., 1958. A check list of tropi-

cal West African Algae. Hydrobiologia, 11: 299-395.

Zanon V., 1941. Diatomee delT Africa Occidentale Fran-

cese. Commentationes Pontificia Academia Scientia-

rum, 5: 1-60.

Biodiversity Journal, 2013, 4 (1): 179-182

Ascalaphus festivus (Rambur, 1 842) in Sardinia, a new genus of

Ascalaphidae for Europe (Neuroptera)

Roberto A. Pantaleoni 1,2 *, Davide Badano 1,2,6 , Ulrike Aspock 3 ’ 4 & Horst Aspock 5

1 Istituto per lo Studio degli Ecosistemi, Consiglio Nazionale delle Ricerche (ISE-CNR), Traversa la Crucca 3, Regione Baldinca,

07100 Li Punti (SS), Italy; e-mail: r.pantaleoni@ise. cm.it

2 Dipartimento di Agraria, Entomologia, Universita degli Studi di Sassari, Via Enrico de Nicola, 07100 Sassari, Italy; e-mail:

pantaleo@uniss.it

3 Natural History Museum, Vienna, Entomology, Burgring 7, A-1010 Vienna, Austria; e-mail: ulrike. aspoeck@nhm-wien.ac. at

4 University of Vienna, Department of Integrative Zoology, Althanstr. 14, A-1090 Vienna, Austria

institute of Specific Prophylaxis and Tropical Medicine, Medical Parasitology, Medical University of Vienna, Kinderspitalgasse

15, A-1095 Vienna, Austria; e-mail: horst.aspoeck@meduniwien.ac.at

6 Actual address: davide.badano@gmail.com

’Corresponding author

ABSTRACT Ascalaphus festivus (Rambur, 1 842), a widespread polytypic species in Africa and Middle

East, was collected for the first time in southern Sardinia in the 1990s in two independent oc-

casions. Subsequent specific surveys proved the existence of a stable breeding population in

at least one coastal locality of Sardinia, thus allowing to fully consider this genus a member

of the European fauna.

KEY WORDS Faunistic; Biogeography; Mediterranean; Owl-flies.

Received 6.11.2012; accepted 18.1.2013; printed 30.03.2013

The European Ascalaphidae are usually con-

sidered to be well known, at least from a faunistic

point of view (Aspock H. et al., 1980). Therefore it

was very unexpected when several years ago three

of us (R.A.R, H.A., and U.A.) independently and

almost simultaneously received two specimens of a

species belonging to the genus Ascalaphus Fabri-

cius, 1775, collected in two localities (su Feraxi:

Muravera and Porto Pino: Sant’ Anna Arresi) in Sar-

dinia (Italy) (Fig. 1). V. Haeseler found a specimen

in Porto Pino in 1994 which he gave to H.A. a few

years later. Moreover, a second specimen, commu-

nicated to R.A.P., was collected near Muravera in

1999 during a sampling carried out by a team of or-

thopterists led by Paolo Fontana (then University

of Padua). These were the first records of Asca-

laphus in Europe. Due to the importance of the

findings, extensive and accurate field research was

repeatedly performed in su Feraxi: Muravera be-

tween 1999 and 2004 by R.A.P. and in 2005 by

R.A.P., H.A. & U.A., although no other specimen

of this interesting species was further observed in

this locality. Instead a specific survey conducted in

2005 in Porto Pino, successfully verified the actual

presence of this owl-fly in Southern Sardinia.

In the following years, 2007 and 2009 respec-

tively, subsequent field research conducted in the

same area confirmed again the existence of a stable

breeding population in Sardinia and dismissed the

hypothesis of the arrival of single specimens there

by wind dispersal from Tunisia, where the genus is

known (Aspock H. et al., 2001; Giisten, 2003).

In both the Sardinian sites, the owl-flies were

observed in coastal salt-marshes in back dunal en-

180

R.A. Pantaleoni, D. Badano, U. Aspock & H. Aspock

vironment with luxuriant Juncus vegetation. Almost

all the specimens were collected with an entomolo-

gical net; light trapping does not seem to be parti-

cularly effective on this species.

List of known specimens from Sardinia

DATA LABELS

ITALY: S-Sardinien, 15 km W Teluada:

Salz-wiesen bei Pto. Pino, 24.9.1994, Haeseler, 1

female (H. Aspock & U. Aspock coll.); Stagno d.

Leraxi-S // 8-VIII-1999-2 // UTM 05515/43529 //

leg. R. Kleukers, 1 female (R. A. Pantaleoni coll.);

S. A. Arresi: Porto Pino (CA) // 25.VIII.2005 R.

A. Pantaleoni legit, 1 female (R. A. Pantaleoni

coll.); Italia, Sardinia, Porto Pino, SAR 05/5,

25.8.2005, A. Molinuleg., 1 female (NHM Vienna

coll.); Italia, Sardinia, Porto Pino, SAR 05/5,

25.8.2005, A. Molinu leg. 1 male (H. Aspock &

U. Aspock coll.); S. A. Arresi: Porto Pino (CA) //

alia luce (at light) 29.VIII.2005 A. Sassu legit, 1

male (R. A. Pantaleoni coll.); Sardegna, Porto

Pino, 29. VIII. 2005, A. Molinu leg. 1 male (H.

Aspock & U. Aspock coll.); S. A. Arresi: Porto

Pino (CA) // retroduna (back dune) 30. VIII. 2005

A. Molinu legit, 1 male (R. A. Pantaleoni coll.);

Italia, Sardinia, Porto Pino, SAR 05/ 6, 26.8. -30.8.

2005, H. & U. Aspock leg., 2 males (H. Aspock &

U. Aspock coll, and NHM Vienna coll.) Sant’ Anna

Arresi: Porto Pino (CA) // 28.VIII.2007 A. Molinu

legit, 1 male 1 female (R. A. Pantaleoni coll.);

IT - SARDEGNA - Sant’ Anna Arresi: Porto Pino

// 2. IX. 2009 R. A. Pantaleoni, D. Badano, A. Le-

tardi legit, 1 female (D. Badano coll.).

According to the present sense, the genus Asca-

laphus comprises over fifteen species from Africa

and Asia, five of which are reported from North

Africa and Middle East in areas still included in the

Western Palearctic biogeographic region (Aspock

H. et al., 2001). However, this taxon is in need of

revision and it is possible that a split into different

genera will necessarily result. In any case, the

genus was previously unknown from the Northern

coasts of the Mediterranean Sea. The Sardinian spe-

cimens coincide largely with A. festivus (Rambur,

1842) (Fig. 2), a polytypic species reported from al-

most all of the African continent, including Mada-

gascar, the Middle East (Israel, Saudi Arabia and

Oman) and the Cape Verde Islands. Nevertheless,

the exact distribution of this species now appears

to be uncertain and in need of confirmation due to

the complex taxonomic history of this taxon. Origi-

nally, van der Weele (1907; 1909) considered it a

single, very variable and widespread species, after-

wards Kimmins (1949) demonstrated the presence

of several, previously confused, related African

species; this was also confirmed by Tjeder (1980)

and Prost (2011).

For definite clarification, a revision of A. festi-

vus in the present sense from various ecologically

different areas is necessary. The Sardinian popula-

tions are apparently confined to salt-marshes with

Juncus vegetation (Fig. 3), while in Africa it is

mainly recorded in savannah-like biotopes. The

species is very difficult to detect in the field: the

adults are present for few weeks at the end of sum-

mer and are markedly crepuscular, being observed

only for a brief period during sunset, moreover

they are seldom attracted to light. Exceptionally the

specimen collected in Muravera was observed

flying with two other individuals at midday with a

very hot and dark cloudy weather (Fontana, pers.

comm.). It is worth noting that these reports repre-

sent the most remarkable discovery of the Euro-

pean Ascalaphidae since the description of

Bubopsis andromache Aspock U., Aspock H. et

Holzel, 1979 and the rediscovery of Puer macula-

tus (Olivier, 1789) in the 1980s (Aspock U. &

Aspock H., 1987).

ACKNOWLEDGEMENTS

Grateful thanks to Prof. Dr. Volker Haeseler

(University Oldenburg, Germany), Dr. Roy Kleu-

kers (European Invertebrate Survey - The Nether-

lands / Naturalis Biodiversity Center Leiden,

Holland), Dr. Baudewijn Ode (Amsterdam, Hol-

land) and Dr. Paolo Fontana (Fondazione Edmund

Mach, Casalino di Pergine Valsugana, Italy) who

found the first two specimens and initiated field

work and the clarification of the occurrence of

Ascalaphus in Europe several years later. Special

thanks are due to Alessandro Molinu, Antonio

Sassu and Agostino Letardi for their participation

in the field research, Bruno Michel for interesting

discussions on African Ascalaphidae and Andre

Prost for precious suggestions. Finally we thank Dr.

John Plant (Vienna) for the linguistic improvement.

Ascalaphus festivus (Rambur, 1842) in Sardinia, a new genus of Ascalaphidae for Europe (Neuroptera)

181

L’ESTATK 2009

VIII i.'CMom; sarim

Cultura

In roostwalsili

I sonza terra

di Salgado

Alla ricerca

dell’ Ascalaphus

Gli entomotogi setaedano Porto Pino dopo

I'awRlamenlo di un msetto afroasiatico

mai sbarcato prima in Europa

Jntarno dai bosdto del Genrwgentu safcano

fuori due edeotteri sconosdub

Gli esperti: negli ullimi diea anni

in Sardegna sono stati scopeft,

annualmente, in media died insetti nuovi

mai pcima desoirt e nominaji dagli

studiosi, e c> ancora lanto da esplorare

Figures 1-4. Ascalaphus festivus (Rambur, 1842). Fig. 1: Localities of Sardinia (Italy) where the species has been recorded:

Porto Pino, Sant’Anna Arresi (south-west coast) and su Feraxi, Muravera (east coast). Fig. 2: Habitus of a male specimen

(Porto Pino, Sant’Anna Arresi, Sardinia, Italy), photo Davide Badano/ISE CNR. Fig. 3: Female specimen resting on a

Juncus twig in its natural environment, a coastal salt marsh, at sunset (Porto Pino, Sant’Anna Arresi, Sardinia, Italy), photo

Alessandro Molinu/ISE CNR. Fig. 4: Local newspaper (L’Unione Sarda, Cagliari) reporting the presence of the species in

Southern Sardinia, published on occasion of the 2009 expedition conducted by R. A. Pantaleoni, D. Badano and A. Letardi.

182

R.A. Pantaleoni, D. Badano, U. Aspock & H. Aspock

Notice

The finding of Ascalaphus in Sardinia was the

subject of an official press release of the National

Research Council (CNR) picked up by some major

Italian news-agencies in October 2005. As a result,

the news appeared many times in newspapers (Fig.

4), magazines and web (Pantaleoni, 2005). The first

scientific communication on this topic was a poster

exposed during the XI International Symposium on

Neuropterology in 2011 mentioned in the index of

the “Book of Abstracts” and in few cases cited as

Pantaleoni et al. (2011). However, this note is the

first complete, technical article published on the

presence of Ascalaphus in Sardinia.

REFERENCES

Aspock H., Aspock U. & Holzel H., 1980. Die Neurop-

teren Europas. Eine zusammenfassende Darstellung

der Systematik, Okologie und Chorologie der Neu-

ropteroidea (Megaloptera, Raphidioptera, Planipen-

nia) Europas. Goecke & Evers, Krefeld, Germany,

495+355 pp.

Aspock H., Holzel H. & Aspock U., 2001 . Kommentier-

ter Katalog der Neuropterida (Insecta: Raphidioptera,

Megaloptera, Neuroptera) der Westpalaarktis. Deni-

sia, 2: 1-606.

Aspock U. & Aspock H., 1987. Wiederentdeckung von

Puer maculatus (Olivier) in Europa (Neuropteroi-

dea: Planipennia: Ascalaphidae). Zeitschrift der Ar-

beitsgemeinschaft Osterreichischer Entomologen,

39: 5-11.

Glisten R., 2003. A checklist and new species records of

Neuropterida (Insecta) for Tunisia. Kaupia: Darm-

stadter Beitrage zur Naturgeschichte, 12: 129-149.

Kimmins D. E., 1949. Notes on Ascalaphidae in the Bri-

tish Museum collections, with descriptions of new

species. Annals and Magazine of Natural History,

(12)2: 1-29.

Pantaleoni R.A., 2005. Nuovi Insetti di Sardegna. Scien-

zaonline, 23(3) http://www.scienzaonline.com/zoo-

logia/nuovi-insetti-sardegna.html [now unavailable].

Pantaleoni R.A., Badano D., Aspock U. & Aspock H.,

2011. Ascalaphus cf. festivus (Rambur, 1 842) in Sar-

dinia, a new genus of Ascalaphidae for Europe. Book

of Abstracts, XI International Symposium on Neu-

ropterology, Ponta Delgada, Azores, Portugal, 12-15

June 2011, 3.

Prost A., 2011. The genus Ascalaphus Fabricius, 1775

(Myrmeleontidae, Ascalaphidae) in Africa. Book of

Abstracts, XI International Symposium on Neurop-

terology, Ponta Delgada, Agores, Portugal, 12-15

June 2011, 10.

Tjeder B., 1980. Ascalaphidae (Neuroptera) from Sene-

gal and the Gambia. Entomologica Scandinavica, 1 1 :

401-412.

van der Weele H.W., 1907. Note on the Ascalaphidae

(Planipennia) described by Linnaeus. Notes from the

Leyden Museum, 28: 153-157.

van der Weele H.W., 1909. Ascalaphiden, monographisch

bearbeitet. Collections Zoologiques du Baron Edm.

de Selys Longchamps, Catalogue Systematique et

Descriptif, fasc. VIII, 1908, 1-326.

Biodiversity Journal, 2013, 4 (1): 183-208

The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhai-

dae) in the italian Plio-Pleistocene

Mauro M. Brunetti 1 & Maurizio Forli 2

'Via 28 Settembre 1944 n. 2, 40036 Rioveggio (BO), Italy; e-mail: mbmnetti45@gmail.com

2 Via Grocco n. 16, 59100 Prato (PO), Italy; e-mail: info@dodoline.eu

ABSTRACT The species of the genus Aporrhais Da Costa, 1778 (Gastropoda, Aporrhaidae) of the italian

Plio-Pleistocene are described and illustrated. To the three species known, A. pespelecani

pespelecani (Linnaeus, 1758), A. uttingeriana (Risso, 1826) and A. peralata (Sacco, 1893),

the new species A. etrusca n. sp., reported only for the Zanclean period of Tuscany (central

Italy) and A. pliorara (Sacco, 1893), distributed from the Piacenzian to the Lower Pleis-

tocene (Calabrian), elevated to species, are added; moreover, A. pespelecani var. crenatulina

(Sacco, 1893), the most common in the italian lower-middle Pliocene, widespread from the

Tortonian to the Piacenzian, is elevated to subspecies. A. serresiana (Michaud, 1827) is

considered to have occurred in the Mediterranean basin only in very recent times. The exa-

mined species were compared either with extant taxa of Mediterranean (A. pespelecani pe-

spelecani, A. serresiana) and Afro-Atlantic origin (A. pesgallinae Barnard, 1963 A.

senegalensis Gray, 1838) or with species of the European Neogene: A. burdigalensis (d'Or-

bigny, 1852), A. meridionalis (Basterot, 1825), A. alata (Von Eichwald, 1830), A. dingde-

nensis Marquet, Grigis et Landau, 2002, A. scaldensis Van Regteren Altena, 1954 and A.

thersites Brives, 1897.

KEY WORDS Gastropoda; Aporrhaidae; Aporrhais', Pliocene; Pleistocene; Italy.

Received 13.12.2012; accepted 18.02.2012; printed 30.03.2013

INTRODUCTION

The genus Aporrhais Da Costa, 1778 exists with

certainty since the Eocene and, in the Oligocene,

underwent a significant increase in the number of

species. During the Miocene there were at least a

dozen species in the European basins (Landau et al.,

2004), while during the Pliocene a significant re-

duction in the number of species, that continued

throughout the Pleistocene, occurred. Currently the

genus Aporrhais, comprising five species, is pre-

sent exclusively in the North Atlantic, the Mediter-

ranean (including the Black Sea) and along the

West African coast. A. occidentalis (Beck, 1836) of

western and North-Eastern Atlantic has been attrib-

uted by some authors to different genera, namely

Arrhoges Gabb, 1868 and Drepanocheilus Vaught,

1989, both currently considered synonyms of Apor-

rhais, or Chenopus Philippi, 1836 and Pelecanus

Piette, 1876 (not Linnaeus, 1758). The main feature

of this genus is the development of external digits

from the peristome. The characteristics of the pro-

toconch of extant species suggest a planktotrophic

development (Bouchet & Waren, 1990).

MATERIALS AND METHODS

The examined material, collected during field

researches, comes from Pliocene and Pleistocene

184

Mauro M. Brunetti & Maurizio Forli

deposits (Table 1). For most taxa under study, more

than 200 specimens were examined. For all speci-

mens, the height of the shell was measured (on sam-

ples with well formed digits) and the number of

tubercles in the penultimate whorl (NTG) counted

(Table 2). Systematic nomenclature is according to

Manganelli et al. (2008).

ACRONYMS AND ABBREVIATIONS. CB =

M.M. Brunetti collection, Rioveggio, Bologna,

Italy; CD A = B. Dell’ Angelo collection, Genova,

Italy; CD = G. Della Bella collection, Monterenzio,

Bologna, Italy; CF = M. Forli collection, Prato,

Italy; H = maximum height of the shell, measured

from the apex or the end of the first digit until the

front end of the siphonal canal or at the end of the

last type, coll. = collection; ex = specimen; exx =

specimens; MZB = Museum of Zoology, University

of Bologna; MSNF = Museum of Natural Sciences

in Florence; MRSNT = Regional Museum of Natu-

ral Sciences of Turin; MSNM = Museum of Natural

Sciences of Milan; NMB = Naturhistorisches Mu-

seum Basel; NHMW = Naturhistorisches Museum,

Geologisch - Palaontologische Abteilung, Wien.

SISTEMATIC

Classe GASTROPODA Cuvier, 1797

Ordine Neotaenioglossa Haller, 1882

Superfamily STROMBOIDEA, Rafmesque, 1815

Family APORRHAIDAE, Gray J.E., 1850

Genus Aporrha is Da Costa, 1778

type species: Aporrhais quadrifidus Da Costa, 1778

= Strombus pespelecani Linneus, 1758

Aporrhais pespelecani pespelecani (Linnaeus,

1758) (Figs. 1-10,70,71)

Strombus pes pelicani - Linnaeus, 1758: 742

Aporrhais quadrifidus - Da Costa, 1778: 136-138,

pi. 7, fig. 7

Rostellaria ala-draconis - Perry, 1811: 11, fig. 6

Murex gracilis - Brocchi 1814: 437, pi. 9, fig. 16

Fusus fragilis - Risso, 1826: 206, pi. 6, fig. 75

Aporrhais pes -pelicani - Wood, 1848: 25, pi. 2, fig. 4

Chenopus anglicus - d'Orbignyi, 1852: 38

Chenopus pespelicani var. minor - Bucquoy et al.,

1884: 220, pi. 23, fig. 11

Chenopus pespelicani var. oceanica - Bucquoy et al.,

1884: 220, pi. 24 ,figs. 4-5

Aporrhais michaudi - Locard, 1888: 11

Aporrhais pelecanipes - Locard, 1892: 123, fig. 109

Chenopus pespelecani - Cerulli-Irelli, 1911: 275,

pi. 26, figs. 29-31

Aporrhais pespelecani - Harmer, 1918: 432, pi. 41,

figs. 26-30

Aporrhais pespelecani quadrifidus - Glibert, 1958:

25, pi. 2, fig. 21

Aporrhais ( Aporrahis ) pespelecani - Malatesta,

1960: 113, pi. 6, fig. 4

Aporrhais pespelecani - Settepassi, 1971: 1, pi. 1-8,

figs. 1-68

Aporrhais michaudi - Settepassi, 1971: 14, pi. 8,

fig. 69

Aporrhais pespelecani quadrifida - Geys & Mar-

quet, 1979: 22, pi. 28, fig. 1

Aporrhais pespelecani - Macri, 1983: pi. 2, fig. 4

Aporrhais (A.) pespelecani - Brambilla & Lualdi,

1988: pi. 12, fig. 1

Aporrhais ( Aporrahis ) pespelecani - Travaglini,

1988: 5, figs. 2-3

Aporrhais {. Aporrahis ) pespelecani - Gonzales Del-

gado, 1988: 130, pi. 3, figs. 5-7

Aporrhais pespelecani - Marques da Silva, 1993:

157, pi. 3, fig. 5

Aporrhais pespelecani - Saunders, 1995: 42, fig. 8

Aporrhais pespelecani - Giannuzzi-Savelli et al.,

1996: 132, figs. 573-587

Aporrhais pespelecani quadrifida - Marquet, 1998:

74, fig. 49

Aporrhais pespelecani - Solsona et al., 2000: 83, pi.

1, figs. 1-2

Aporrhais pespelecani - Nielsen et al., 2007: 187 fig. H

Aporrhais pespelecani - Chirli, 2007: 8, pi. 3, fig. 6

Examined Material. Chiusa di Codrignano (Bolo-

gna), Gelasian-Calabrian, 104 exx. (CB, CD); Tor-

rente Stirone (Parma), Calabrian, 42 exx (CB, CD);

Porto Corsini (Ravenna), modern, 40 exx (CB,

CD); Cava Lustrelle (Lecce), Calabrian, 39 exx

(CB, CF); Ca' Meldola (Bologna). Calabrian 33 exx

(coll. Della Bella); Spicchio (Firenze), Zanclean-

Piacenzian, 32 exx (CB, CD, CF); Riparbella (Pisa),

Calabrian 20 exx (CB, CF); Calambrone (Pisa), mo-

dem, 17 exx (CF); Portoazzurro (Livorno) -80, mo-

dern, 12 exx (CD); Torrente Arda (Piacenza),

Calabrian, 12 exx (CB, CD, CF); Fauglia (Pisa),

Calabrian 10 exx (CF); Rodi Garganico (Foggia),

modern, 6 exx (CB); Lucena del Porto (Huelva -

Spain), Zanclean, 5 exx (CB); Moronico (Ravenna),

The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene

185

LOCALITIES

AGE OF DEPOSITS

REFERENCES

Acate (Ragusa)

Calabrian

Armaiolo (Siena, Italy)

Zanclean-Piacenzian*

Baschi (Terni, Italy)

Piacenzian

Malatesta, 1974

Bibbiano (Siena, Italy)

Zanclean*

Campino (Siena, Italy)

Zanclean

Laghi, 1984

Ca Bianca (Bologna, Italy)

Zanclean

Della Bella & Scarponi, 2004

Ca Lametta (Bologna, Italy)

Piacenzian

Della Bella & Scarponi, 2004

Ca Meldola (Bologna, Italy)

Calabrian

Della Bella & Scarponi, 2007

Casciana Terme (Pisa, Italy)

Gelasian

Castelnuovo Berardenga Scalo (Siena, I)

Zanclean

Manganelli et al., 2008

Cava Campore (Parma, Italy)

Piacenzian

Cerergato, 200 1

Cava Certaldo (Firenze, Italy)

Piacenzian*

Cava Lustrelle (Lecce, Italy)

Calabrian

Deir Angelo et al., 2007

Cava Lugagnano (Piacenza, Italy)

Zanclean

Rio et. al., 1988

Cava Signorella (Lecce, Italy)

Calabrian

Macri, 1983

Cava Tacconi (Roma, Italy)

Calabrian

Malatesta & Zarlenga, 1985

Cedda (Siena, Italy)

Zanclean-Piacenzian

Brunetti M. & Della Bella, 2006

Chianello (Siena, Italy)

Zanclean-Piacenzian*

Chiusa di Codrignano (Bologna, Italy)

Gelasian-Calabrian

Ruggieri, 1962

Ciuciano (Siena, Italy)

Zanclean

Forli & Dell’Angelo, 2000

Cossato (Biella, Italy)

Piacenzian

Aimone & Ferrero Mortara, 1983

Fauglia (Pisa, Italy)

Calabrian

Brunetti M. et al., 2008

Ficulle (Terni, Italy)

Zanclean-Piacenzian

Brunetti M. & Della Bella, 2006

Fosso della Possessione (Ravenna, Italy)

Gelasian

Della Bella & Scarponi, 2010

Guidonia (Roma, Italy)

Piacenzian

Mancini (1997)

Guistrigona (Siena, Italy)

Zanclean-Piacenzian

Bogi et al., 2002

Lagune (Bologna, Italy)

Zanclean*

Latsia (Cyprus)

Gelasian

Leognan (France)

Burdigalian

Cauzac et al., 1993

Letkes (Hungary)

Badenian

Csepreghy-Meeznerics, 1956

Linari (Siena, Italy)

Piacenzian

Bogi et al., 2002

Lucena del Porto (Huelva, Spain)

Zanclean

Gonzales Delgado, 1988

Luciana (Pisa, Italy)

Zanclean

Maglie (Lecce, Italy)

Calabrian

Marzeno (Bologna, Italy)

Piacenzian*

Masserano (Biella, Italy)

Piacenzian*

Miste (Netherlands)

Middle Miocene

Janseen, 1984

Montecatone (Bologna, Italy)

Calabrian*

Montegibbio (Modena, Italy)

Tortonian

Davoli, 1982

Monte Padova (Piacenza, Italy)

Piacenzian

Rio et. al., 1988

186

Mauro M. Brunetti & Maurizio Forli

LOCALITIES

AGE OF DEPOSITS

REFERENCES

Moronico (Bologna, Italy)

Calabrian*

Orciano Pisano (Pisa, Italy)

Piacenzian

Gatto, 1997

Pianella (Siena, Italy)

Zanclean

Poggio alia Staffa (Siena, Italy)

Zanclean

Della Bella & Scarponi, 2004

Ponte a Elsa (Pisa, Italy)

Piacenzian

Benvenuti et al., 1997

Pradalbino (Bologna, Italy)

Piacenzian

Della Bella & Scarponi, 2007

Rio Albonello (Ravenna, Italy)

Piacenzian

Tabanelli, 1994

Rio Carbonaro (Piacenza, Italy)

Piacenzian

Della Bella & Scarponi, 2007

Rio Crevalese (Piacenza, Italy)

Piacenzian

Brunetti M. & Vecchi, 2005

Rio Merli (Ravenna, Italy)

Piacenzian

Tabanelli, 2008

Rio Stramonte (Piacenza, Italy)

Piacenzian

Brunetti M. & Vecchi, 2003

Rio Torsero (Savona, Italy)

Zanclean

Violanti, 1997

Riparbella (Pisa, Italy)

Calabrian

Dell'Angelo & Forli, 1995

San Faustino (Temi, Italy)

Zanclean-Piacenzian

Malatesta, 1974

San Lorenzo in collina (Bologna, I)

Piacenzian

Brunetti M. & Soccio, 2006

San Martino a Maiano (Firenze, Italy)

Zanclean*

Spicchio (Firenze, Italy)

Zanclean-Piacenzian

Dominici et. al., 1997

Strolla (Siena, Italy)

Zanclean-Piacenzian

Bossio et al., 1992

Szob (Pest, Hungary)

Badenian

Csepreghy-Meeznerics, 1956.

Sentjemej (Slovenia)

Tortonian*

Tabiano Bagni (Parma, Italy)

Zanclean

Pelosio, 1967

Tabiano Castello (Parma, Italy)

Zanclean-Piacenzian*

Torrente Arda (Piacenza, Italy)

Gelasian-Calabrian

Brunetti M. & Vecchi, 2005

Torrente Stirone (Parma, Italy)

Zanclean-Gelasian-Calabrian

Papani & Pelosio, 1962

Treppie (Siena, Italy)

Zanclean

Pantoli & Raffi, 1981

Vignola (Modena, Italy)

Piacenzian

Della Bella & Scarponi, 2004

Table 1. Localities from which the present study material comes, age of deposits and references (when available). Age indications

marked with a star are proposed by the authors of the present work basing on the malacological assemblage.

Calabrian, 5 exx (CB); Castiglione della Pescaia

(Grosseto), modern, 4 exx (CD); Cava Tacconi

(Roma), Calabrian, 4 exx (CB); Ciuciano (Siena),

Zanclean, 3 exx (CD); Poggio alia Staffa (Siena),

Zanclean, 3 exx (CB); Acate (Ragusa) Calabrian, 2

exx (CF); Camaret sur Mer (France), modem, 2 exx

(CF); Casciana Terme (Pisa), Gelasian, 2 exx (CF);

Bibbiano (Siena), Zanclean 1 ex (CB); Cecilia (Li-

vorno), modem, 1 ex (CB); Lagune (Bologna), Pia-

cenzian, 1 es., (CD); Maglie (Lecce) Calabrian, 1

ex (CD); Malaga (Spain), modem, 1 ex (CB); Ponza

(Latina), modem, 1 ex (CB).

Aporrhais burdigalensis (d'Orbigny, 1852), Leo-

gnan (France), Burdigalian, 12 exx (CB, CF).

Description. Shell medium sized (average H =

28.5-36.6 mm), spindle-shaped loop consisting of

9 to 10 whorls. Protoconch smooth, of 2.5 whorls;

the beginning of the teleoconch is characterized by

a dense spiral sculpture consisting of ten equally-

spaced spiral tracks, in the next whorl there are nu-

merous ribs that, crossing the tracks, form a thin

spiral cancelled sculpture. In the subsequent whorls,

ribs increase in thickness and decrease in number

up to 13-15 on the penultimate whorl, forming ver-

The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene

187

tical pleats that, starting at the adapical suture, sub-

side and eventually disappear before the abapical

suture. These ribs, first straight, become more and

more inclined and protruding into the abapical part

of the whorls, forming a tubercular keel; it is often

present a small pre-sutural thread more or less no-

ticeable. The last whorl, which occupies about half

of the total, is crossed by two nodulose hulls, plus

a third one, little noticeable in the rear part of the

whorl, and by numerous spiral, sub-equal threads.

Aperture elongated, very large, lip expanded with

four digits, the first of which separate and divergent;

basal digit folded forward. The second and third di-

gits generally elongate. Operculum homy, elliptical.

Distribution. Based on available data, A. pespele-

cani pespelecani is a species living in the Mediter-

ranean and north-eastern Atlantic, with stratigraphic

distribution from the Zanclean to present. A. pespe-

lecani pespelecani inhabits sandy-muddy circalit-

toral bottoms (Sabelli & Spada, 1977).

Remarks. In this species, as in the whole Stromboi-

dea Superfamily, the development of keystrokes

outside the peristome shows the successful sexual

maturity of the individual. Juvenile specimens ana-

lyzed herein have no digits and correspond to

Murex gracilis Brocchi, 1814 (Figs. 1,2) and Fusus

fragilis Risso, 1826. A. pespelecani pespelecani

shows variability in shape and, sometimes, in the

number of digits (see Settepassi, 1971; Filippi,

1984; Giannuzzi Savelli et al., 1996), while the

sculpture of the teleoconch and the shape of the

mouth are overall pretty constant.

In line with Bouchet & Waren (1990, p. 708) we

consider A. michaudi Locard, 1890 as a simple form

of A. pespelecani pespelecani with five digits. With

respect to A. pespelecani minor Bucquoy, Dautzen-

berg et Dollfus, 1884, the examination of the origi-

nal iconography (Bucquoy, Dautzenberg & Dollfus,

1884, p. 220, pi. 23, fig. 11) shows clearly that it is

a juvenile specimen. There are many reports in the

literature of A. pespelecani pespelecani relating

to the italian Plio-Pleistocene, most of these may,

however, be referring to A. pesp. crenatulina Sacco

(see below), especially those relating to the Zan-

clean period. In the lands of Pleistocenic origin A.

pespelecani pespelecani is very common from Nor-

way to the Mediterranean. Currently, in the North

Atlantic there is a morph, rather rare in the Mediter-

ranean, A. pespelecani var. bilobata Clement, 1873

[= var. oceanica Bucquoy, Dautzenberg et Dollfus,

1884, see illustrations by Wood (1848, pi. 2, fig. 4),

Saunders, (1995, p. 42, fig.8) Settepassi, (1971, p.

8, pi. 3, figs. 17-18), Malatesta, (1960, p. 113, pi. 6,

Aporrhais species

min.

max

med.

NTG

min.

NTG

max

NTG

med

A. pespelecani pespelecani - Pliocene

28,5

12,5

▲

A. pespelecani pespelecani - Pleistocene

25,5

36,6

13,2

▲

A. pespelecani pespelecani - modem

27,5

48,5

39,4

11,9

▲

A. pespelecani crenatulina

14,5

24,4

•

▲

A. etrusca n. sp.

14,5

21,4

13,8

▲

A. uttingeriana - Pliocene

18,5

39,5

29,2

▲

A. uttingeriana - Pleistocene

31,5

44,6

▲

A. peralata

▲

A. pliorara

28,5

38,8

▲

A. serresiana

▲

Table 2. Morphological characteristics and stratigraphic distribution of the species treated. Abbreviation: Nd = numero digitazioni,

NTG = numero dei tubercoli sul penultimo giro, T = Tortonian, Z = Zanclean, P = Piacenzian, G = Gelasian, C = Calabrian, A =

modern.

188

Mauro M. Brunetti & Maurizio Forli

fig. 4)] characterized by the second and third digits

partially fused and little expanded. This morph is

quite common in the early Pleistocene of Nor-

thern Italy (Fig. 10) and, while not being able to

consider it as a valid species or subspecies, never-

theless, it may be some sort of paleoclimate indica-

tor - i.e. a " Nordic guest " (sensu Ruggieri, 1967).

This morph corresponds to the populations of the

Pliocene of Northern Europe known as A. pespele-

cani quadrifidus Da Costa, 1778 (Wood, 1848; Har-

mer, 1918; Glibert, 1959; Geys & Marquet, 1979;

Marquet, 1998).

Reports of A. pespelecani pespelecani of the Mio-

cene (Friedberg, 1914; Baluk, 1975; Marquet et al.,

2002; Landau et al., 2004), are thought to be all re-

ferable to different species. Among the noticeable

miocenic examined species, A. burdigalensis

(d'Orbigny, 1852), as understood in Marquet et

al. (2002), (Fig. 11), while similar to A. pespele-

cani pespelecani , shows however very distinct

characters including: smaller size, a more elaborate

sculpture of the loop and different shape of digits.

Therefore, we do not agree with Solsona (1998)

who considers both A. burdigalensis and A. meri-

dionalis (Basterot, 1825) identical to A. pespelecani

pespelecani. We also noted that specimens in

MRSNT, catalogued by Sacco as both A. meridio-

nalis (Basterot, 1825) (Fig. 30) and A. meridionalis

var. taurinensis Sacco, 1893 (Fig. 32), are likely to

refer to a different species with sculpture and shape

of digits that differ markedly from the typical speci-

mens of French Miocene (Fig. 31). In the italian

Pliocene A. pespelecani pespelecani consists of

rather small populations that coexist with the sub-

species treated below, significantly more widespread.

Finally, We emphasize an increase in the average size

of specimens from the Zanclean to the Present.

Aporrhais pespelecani crenatulina (Sacco,

1893) (Figs. 12-14, 18-22, 23-26, 72)

Chenopus pes-pelicani - Fontannes, 1879: 153, pi.

9, fig. 3

Chenopus pespelicani var. crenatulina - Sacco,

1893:30, pi. 2, fig. 32

Chenopus pespelicani var. parvecincta - Sacco

1893: 30, pi. 2, fig. 33

Chenopus pespelicani var. turritolonga - Sacco,

1893:30, pi. 2, fig. 34

Chenopus pespelicani var. variecincta - Sacco

1893:30, pi. 2, fig. 35

Chenopus pespelicani var. basicincta - Sacco, 1893:

31, pi. 2, fig. 36

Chenopus pespelicani var. apicevoluta - Sacco,

1893: 31, pi. 2, fig. 34

Aporrhais pes-pelicani minor - Glibert, 1949: 208,

pi. 12, fig. 19

Aporrhais uttingeriana miosubulatus - Settepassi

1971: 18, pi. 17, figs. 52-63

Aporrhais pespelecani - Malatesta, 1974: 215, pi.

16, fig. 2

Aporrhais pespelecani - Chirli, 1988: 17, pi. 3, fig. 8

Aporrhais pespelecani - Cavallo & Repetto, 1992:

61, fig. 102

Aporrhais pespelecani crenatulina - Segurini & Ta-

banelli 1994: 9, pi. 1, fig. 3

Aporrhais pespelecani - Solsona et al., 2000: 83, pi.

1, fig. 3, 5-6

Aporrhais ( Aporrhais ) pespelecani - Landau et. al.,

2004: 65, pi. 14, figs. 7a-7b

Aporrhais pespelecani - Chirli, 2007: 8, pi. 3, figs.

1-5, 7-9

Aporrhais pespelecani - Manganelli et al., 2008:

509, figs. 17-18, 34-45

Examined Material. Lagune (Bologna), Zanclean,

40 exx (CD); 35 exx (CB, CF); Rio Carbonaro (Pia-

cenza), Piacenzian, 30 exx (CB, CD); Poggio alia

Staffa (Siena), Zanclean, 18 exx (CB, CF); SanFau-

stino (Temi) Zanclean-Piacenzian, 22 exx (CB, CF);

Cossato (Biella), Piacenzian, 21 exx (CF); Ciuciano

(Siena) Zanclean, 1 1 exx, (CB, CF); Rio Crevalese

(Piacenza), Piacenzian, 10 exx (CB, CD); Linari

(Siena), Piacenzian, 10 exx (CB, CD, CF); Masse-

rano (Biella), Piacenzian, 9 exx (CB); Guistrigona

(Siena), Zanclean-Piacenzian, 5 exx (CB); Ponte a

Elsa (Firenze), Piacenzian, 5 exx (CD); Baschi

(Temi), Piacenzian, 4 exx (CB); Campino (Siena),

Zanclean 4 exx (CB); Rio Stramonte (Piacenza),

Piacenzian, 4 exx (CB); Vignola (Modena), Piacen-

zian, 3 exx (CD); Ficulle (Temi), Zanclean-Piacen-

zian, 2 exx (CB); Pradalbino (Bologna), Piacenzian,

2 exx (CB); Bibbiano (Siena), Zanclean, 1 ex (CD);

San Martino a Maiano (Firenze), Zanclean, 1 ex

(CB); Rio Torsero (Savona), Zanclean, 1 ex (CB).

A. senegalensis Gray, 1838. Senegal, modern, 4 exx

(CD, CF).

A. meridionalis (Basterot, 1825). Leognan (France),

Burdigalian, 12 exx (CB).

The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene

189

A. dingdenensis Marquet, Grigis et Landau, 2002.

Miste (Netherlands), Middle Miocene, 20 exx

(CB, CF).

A. alata (Eichwald, 1829). Szob (Hungary), Bade-

nian, 3 exx (CB); Letkes (Hungary), Badenian, 2

exx (CD A).

Description. Shell small to medium sized (average

H = 24.4 mm), spindle-shaped loop composed of

eight whorls. Protoconch smooth, compressed supe-

riorly, of 2.5 whorls. The beginning of the teleoconch

is characterized by a dense spiral sculpture consisting

of ten equally-spaced spiral tracks, in the next whorls

there are numerous ribs that, by crossing the tracks,

form a thin spiral, cancelled sculpture. In subsequent

whorls ribs increase in thickness and decrease in

number, up to 18 on the penultimate whorl, forming

vertical substraight pleats which, starting from the

upper suture, subside and eventually disappear be-

fore the rear suture forming a tuberculate hull; there

is always an evident pre-sutural thread. Pronounced

spiral sculpture including threads separated by wider

gaps that, on the penultimate whorl, amount to about

twenty. The last whorl, which occupies about half of

the total height of the loop, is crossed by two nodu-

lose hulls plus a third one, little noticeable in the rear

part of the whorl. Aperture elongated, narrow, with

typical crenulations on both sides of the mouth. Lip

expanded formed by four digits, usually leaf-like, the

first of which separate and divergent; basal digit bent

forward.

Distribution. Based on available data, A. pespele-

cani crenatulina is a species with an infralittoral-

circalittoral bathymetry and a stratigraphic

distribution from the Zanclean to the Piacenzian.

Remarks. Sacco (1893, p. 30) relates the variety

crenatulina, both with the var. minor Sacco, 1893

(in turn, according to the Author, in relation with

A. pespelecani minor Bucquoy, Dautzenberg et

Dollfus, 1884) and the var. dertominor Sacco,

1893 (Figs. 15,16). This latter is, in our opinion,

a completely different species, with the first digit

fused to the loop, most probably related to the

miocenic A. alata (Von Eichwald, 1830) as the

var. taurominor Sacco, 1893 (Fig. 17). Sacco

(1893) gave little importance both to difference in

size and typical crenulations of the aperture and con-

sidered A. pespelecani crenatulina as a simple form

of A. pespelecani pespelecani noting, however, that:

"among the living forms, C. senegalensis GRAY

presents this character very accentuated." We be-

lieve A. pespelecani crenatulina shows constant

features that differentiate it from A. pespelecani

pespelecani : smaller size, different and more pro-

nounced spiral sculpture, shape of the nodes on the

hulls of the last whorls, hulls not tilted but sub-

straight; never elongated digits, but flat and leaf-

shaped (as already noted by Sacco, 1893, p. 30);

first whorls considerably less elongated, proto-

conch larger and less flattened, aperture narrower

and, above all, denticles more or less developed

but always present on both sides of the mouth

(Fig. 25), which is never the case in A. pespele-

cani pespelecani neither in living nor in fossil

specimens.

As regards the chronostratigraphic distribution

of A. pespelecani crenatulina, it begins to appear

with certainty only in the Zanclean and seems not

to go beyond the Middle Piacenzian (unit

MPMU2, Monegatti & Raffi, 1993). Based on

these considerations, we therefore propose to ele-

vate to subspecies the variety described by Sacco,

and indicate as its lectotype the specimen deposi-

ted in the coll. Bellardi-Sacco, MRSNT, catalogue

no. BS. 041. 01. 021 (Figs. 12-13).

To A. pespelecani crenatulina corresponds A.

pespelecani var. parvecincta Sacco, 1893 (Fig.

1 8) , reported by the same author for several places

of the Ligurian-Piedmont basin: Astigiana (Asti),

Volpedo (Alessandria), Masserano (Biella), Rio

Torsero (Savona), Bordighera (Savona), Bussana

(Savona), Albenga (Savona). Sacco (1893) de-

scribes and illustrates several pliocenic varieties

all corresponding to A. pespelecani crenatulina

amidst which are included Chenopus pespelecani

var. apicevoluta (Fig. 22), C. pespelecani var. ba-

sicincta (Fig. 21), C. pespelecani var. variecincta

(Fig. 20), C. pespelecani var. turritolonga (Fig.

19) , and the var. anglica (d'Orbigny, 1852) (Fig.

23), which are, according to the author, pretty rare.

As for A. pespelecani, A. pespelecani crenatulina

is reported and depicted by Fontannes (1880) for

the French Pliocene and by Malatesta (1974) for

the Umbrian. Segurini & Tabanelli (1994) report

A. pespelecani crenatulina for the Piacenzian of

Rio Albonello (Ravenna) and are the first to prop-

erly illustrate the species. More recently, Marquet

et al. (2002) consider A. pespelecani crenatulina,

A. pespelecani parvecincta (Sacco, 1893), A.

190

Mauro M. Brunetti & Maurizio Forli

Figures. 1-6. Aporrhais pespelecani pespelecani. Figs. 1, 2. Murex gracilis Brocchi, 1814, holotypus, Piacentino, Neogene, H =

13,1 mm (MSNM, Brocchi coll., i5430). Figs. 3, 4. Spicchio (Firenze), Zanclean-Piacenzian, H = 30 mm (CB). Figs. 5, 6. Torrente

Arda (Piacenza), Calabrian, H = 48 mm (CB).

The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene

191

Figures. 7-10. Aporrhais pespelecani pespelecani. Figs. 7, 8. Cecina (Livorno), modern, H= 52 mm, (CB) Fig. 9: bilobed shape,

Chiusa di Codrignano (Bologna), Calabrian, (CB). Fig. 10: apical whorls, Torrente Arda (Piacenza), Calabrian, (CB) (Scale bar

100 pm ). Fig. 11. Aporrhais burdigalensis, Leognan (France), Burdigalian, H = 24,2 mm (CB).

192

Mauro M. Brunetti & Maurizio Forli

Figures. 12-14. Aporrhais pespelecani crenatulina. Figs. 12, 13: Lectotypus, Colli Astesi (Asti), Zanclean-Piacenzian, H = 19

mm, (MRSNT, Bellardi and Sacco coll., BS. 041. 01. 021). Fig. 14: apical whorls, Rio Carbonaro (Piacenza), Piacenzian, (CB) (Scale

bar 100 pm). Figs. 15, 16. Chenopus pespelicani dertominor, Stazzano (Alessandria), Tortonian, H = 16,5 mm, (MRSNT, Bellardi

and Sacco coll., BS. 041. 01. 019). Fig. 17. C. pespelicani taurominor, Baldissero Torinese (Torino) Middle Miocene, FI = 18 mm,

(MRSNT, Bellardi and Sacco coll., BS.041.01.018).

The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene

193

Figures. 18-22. Aporrhais pespelecani crenatulina. Fig. 18. Chenopus pespelicani var. parvecincta, Rio Torsero (Imperia), Zanclean,

FI = 16,8 mm, (MRSNT, Bellardi and Sacco coll., BS. 041. 01. 022). Fig. 19. C. pespelicani var. turritolonga Sacco, 1893, Colli Astesi

(Asti), Zanclean-Piacenzian, H = 36,9 mm, (MRSNT, Bellardi and Sacco coll., BS. 04 1.0 1.025). Fig. 20. C. pespelicani var. variecincta,

Colli Astesi (Asti), Zanclean-Piacenzian, H = 29 mm, (MRSNT, Bellardi and Sacco coll., BS. 04 1.0 1.024). Fig. 21. C. pespelicani

var. basicincta, Volpedo (Alessandria), Piacenzian, H = 32,4 mm, (MRSNT, Bellardi and Sacco coll., BS. 04 1.0 1.024). Fig. 22. C. pe-

spelicani var. apicevoluta, Colli Astesi (Asti), Zanclean-Piacenzian, H = 30,3 mm, (MRSNT, Bellardi and Sacco coll., BS. 04 1.0 1.026).

194

Mauro M. Brunetti & Maurizio Forli

Figures 23-26. Aporrhais pespelecani crenatulina. Fig. 23: Chenopus pespelicani var. anglica , Rocca d'Arazzo (Asti), Piacenzian,

FI = 33,2 mm, (MRSNT, Bellardi and Sacco coll., BS. 041. 01. 027). Fig. 24: Rio Carbonaro (Piacenza), Piacenzian, FI = 31 mm

(CB). Fig. 25: Particular of the aperture, Rio Carbonaro (Piacenza), Piacenzian, (CB) (scala = 5 mm). Fig. 26: Rio Carbonaro

(Piacenza), Piacenzian, FI = 17 mm (CB). Fig. 27. A. pespelecani pespelecani, depth form, Fauglia (Pisa), Calabrian, H = 50 mm

(CB). Fig. 28. A. senegalensis, Senegal, modem, H = 26 mm (CB). Fig. 29. A. scaldensis, Kallo (Belgium), Piacenzian, H = 27,2

mm (CB). Fig. 30. C. meridionalis, Monte Capuccini (Torino), H = 27,6 mm (MRSNT, Bellardi and Sacco coll., BS. 041. 01. 001).

Fig. 31. A. meridionalis, Leognan (France), Burdigalian, FT = 13 mm. Fig. 32. C. meridionalis var. taurinensis. Colli Torinesi (To-

rino), H = 27 mm (MRSNT, Bellardi and Sacco coll., BS. 04 1.0 1.002).

The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene

195

pespelecani taurominor (Sacco, 1893) (Fig. 17)

and A. pespelecani dertominor (Sacco, 1893)

(Figs. 15, 16) as forms of A. pespelecani pespele-

cani, since "these all, however have a tendency to

form an extra digit between the third and the aba-

pical digit" which is a character certainly present,

but of little significance when compared to the nu-

merous differences mentioned above.

The specimens reported by Settepassi (1971) as A.

uttingeriana miosubulatus Sacco, 1893, of the

Pliocene of Orvieto are identical to A. pespelecani

crenatulina. Cossmann & Peyrot (1922) depict a

A. pespelecani mut. dertominor Sacco, that, in our

opinion, seems closer to A. meridionalis . Glibert

(1949) reports a sample similar to A. pespelecani

crenatulina of the Middle Miocene of the Loire

basin (France) as A. pespelecani minor Bucquoy,

Dautzenberg et Dollfus, 1884 which may suggest

the presence of A. pespelecani crenatulina in the

Middle Miocene as well. These data need further

confirmation, however, not having been able to

examine directly the material.

A. pespelecani crenatulina presents a remarkable

constancy of characters, the only real variation con-

sisting in the size of some specimens that may be

significantly below the average height (Fig. 26). We

have been able to examine other species of the Eu-

ropean Miocene showing nearly the same size as A.

pespelecani crenatulina including A. burdigalensis

(d'Orbigny, 1852) (Fig. 11), A. meridionalis (Baste-

rot, 1825) (Fig. 30) and A. dingdenensis Marquet,

Grigis et Landau, 2002 (Fig. 55). All these taxa

show spiral sculpture and digits completely dif-

ferent from the species in question, and, in addi-

tion, they lack of crenulations inside the mouth as

is the case of A. scaldensis Van Regteren Altena,

1 954 (= Chenopus pespelicani var. anglica in Nyst,

1878, pi. 6 fig. 11) (Fig. 29) from Belgium.

A. senegalensis Gray, 1838 (Fig. 28), currently dis-

tributed from Senegal to Gabon on sandy bottoms

(Ardovini & Cossignani, 2004), presents crenula-

tions similar to A. pespelecani crenatulina, but dif-

ferent shape and sculpture (large and rounded

tubercles, first digit fused to the loop). Previous re-

ports of A. senegalensis for the italian Pliocene

(Settepassi, 1971) are wrong and probably attribu-

table to this subspecies. Notably, different pleis-

tocenic populations attributable to A. pespelecani

pespelecani (Fig. 27), found in sediments corre-

sponding to the deep circalittoral, show characters

that lead partly to A. pespelecani crenatulina (nar-

row aperture, very light crenulations) and partly to

A. pespelecani pespelecani. This could be inter-

preted as a retention of primitive characters in

depth-populations .

Aporrhais etrusca n. sp.

(Figs. 33-40, 73)

Examined Material. Holotypus (Figs. 33-35), H =

30 mm, Cedda (Siena, Tuscany, Italy), Zanclean-

Piacenzian, 43° 23’ 44 ”N, 11°11 , 52 ,, E (MZB). Pa-

ratypi same locality of the holotypus: paratypus 1

(Fig. 36), H =30 mm (MZB); paratypus 2 (Fig. 37),

H = 32 mm (MSNF); paratypus 3 (Fig. 38), H = 32

mm (MSNF); paratypus 4 (Fig. 39), H = 27 mm

(MSNF); paratypus 5 (Fig. 40), H = 31 mm

(MSNF).

Other material examined. Cedda (Siena), Zanclean,

120 exx (CB, CD, CF); Chianello (Siena), Zan-

clean, 100 exx (CB, CD); 67 exx Strolla (Siena)

Zanclean, (CB); Treppie (Siena), Zanclean, 35 exx

(CB, CD, CF).

Description of holotype. Shell small to medium

sized (H = 30 mm), spindle-shaped loop consisting

of eight whorls. The beginning of the teleoconch is

characterized, in the first two whorls, by a dense

spiral sculpture consisting of ten equally-spaced

spiral tracks. In subsequent whorls appear nu-

merous nodulose ribs, sharp, sub-straight, 14 on the

penultimate whorl, forming a hull with sharp nodu-

les; always present a pre-sutural thread. The spiral

sculpture is pronounced consisting of several

threads separated by sub-equal interspaces, 10 on

the penultimate whorl. The last whorl, which occu-

pies half of the total height of the loop, is crossed

by two nodulose hulls plus a third one, little no-

ticeable in the rear part of the whorl. Aperture elon-

gated. Lip expanded consisting of five digits, the

second and third of which, and sometimes the

fourth, fused together and thick; the first digit

weakly developed, separate and divergent; basal

digit very short, slightly bent forward.

Variability. The adult specimens, with outer lip

formed, can vary in size and number of tubercles

on the penultimate whorl (see tab. 2), while keeping

constant the morphological characteristics of the te-

leoconca. Only very old specimens show the se-

cond, third and fourth digits welded.

196

Mauro M. Brunetti & Maurizio Forli

Etimology. The name derives from the ancient in-

habitants of the region of discovery, the Etruscans.

Distribution. Based on available data, A. etrusca

n. sp. occurred at depths between the infralittoral

and the circalittoral with stratigraphic distribution

limited to the Zanclean.

Remarks. In all specimens examined the proto-

conch was not complete for which it was not possi-

ble to describe it. A. etrusca n. sp. differs

significantly from both A. pespelecani pespelecani,

for the largest number of digits, the sculpture of the

teleoconch and for big, pointed tubercles, while dif-

fers from A. pespelecani crenatulina for the lack of

crenulations on the aperture and the shape and num-

ber of digits. There are no forms of transition to the

one or other subspecies. At the moment it is known

only for the Zanclean from a narrow area of Central

Tuscany.

Aporrhais uttingeriana (Risso, 1826)

(Figs. 41-47,49,50,74)

Rostellaria uttingeriana - Risso, 1826: p. 225

Rostellaria brongniartianus Risso, 1 826 226

Rostellaria pes ardeae - Sassi, 1827: 480

Chenopus Uttingeriana - Fontannes, 1880: 155, pi.

9 fig. 4

Chenopus uttingerianus - Sacco, 1893: 23, pi. 2,

figs. 21-22

Chenopus uttingeriana var. crassulosa - Sacco,

1893: 25

Chenopus uttingeriana var. peraraneosa - Sacco,

1893:26, pi. 2, fig. 23

Chenopus uttingeriana var. percarinata - Sacco,

1893:24, pi. 2, fig. 24

Chenopus serresiana var. pliotransiens - Sacco,

1893:27, pi. 2, fig. 26

Figures. 33-40. Aporrhais etrusca n. sp. from Cedda (Siena, Tuscany, Italy), Zanclean-Piacenzian. Figs. 33-35: Holotypus, H = 30

mm (MZB-). Fig. 36: Paratypus 1, FI = 30 mm (MZB-). Fig. 37: Paratypus 2, H = 32 mm (MSNF-). Fig. 38: Paratypus 3, H = 32

mm (MSNF). Fig. 39: Paratypus 4, H = 27 mm (MSNF). Fig. 40: Paratypus 5, H = 31 mm (MSNF).

The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene

197

Aporrhais uttingeriana var. mutica - Almera & Bo-

fill 1898: 64, pi. 4, fig. 2

Chenopus pespelecani - Cerulli Irelli, 1911: 275, pi.

26, figs. 26-28

Chenopus uttingeriana - Dieni & Omenetto, 1960:

614, pi. 62, figs. 7a-b

Aporrhais (A.) uttingeriana - Papani & Pelosio,

1962: 305, pi. 2, fig. 2.

Aporrhais ( Aporrhais ) uttingeriana (Risso) - Pelo-

sio, 1967: 109, pi. 37, figs. 2-4.

? Aporrhais uttingeriana peraraneosa - Settepassi,

1971, pi. 15, fig. 39.

Aporrhais uttingeriana mioaustriacus Sacco - Set-

tepassi, 1971, pi. 15, fig. 40

Aporrhais uttingeriana longidigitatus Settepassi,

1971, pi. 17, figs. 52-63

Aporrhais uttingeriana - Settepassi, 1971, pi. 16,

figs. 42-47

Aporrhais uttingeriana major - Settepassi, 1971, pi.

16, figs. 48-49

Aporrhais ( Aporrhais ) uttingeriana - Malatesta,

1974: 215, pi. 16, figs. 3 a-c

Aporrhais uttingeriana - Caprotti, 1976: 8, pi. 14,

figs. 2-8

Aporrhais uttingeriana - Chirli, 1988: 17, pi. 3, fig. 2

Aporrhais (A.) uttingeriana - Brambilla & Lualdi,

1988, pi. 12, fig. 3

Aporrhais ( Aporrhais ) uttingeriana - Travaglini,

1988: 9, figs. 7-9

Aporrhais uttingeriana uttingeriana - Cavallo &

Repetto, 1992: 61, fig. 103

Aporrhais uttingeriana - Piccioli Resta & Prete,

2003: 50, fig. 7a-b

Aporrhais ( Aporrhais ) uttingeriana - Landau et al.,

2004: 67, pi. 14 fig. 8

Aporrhais uttingeriana - Manganelli et. al. , 2008:

507, figs. 15-16, 20-31

Examined Material. Rio Carbonaro (Piacenza),

Piacenzian, 60 exx (CB, CD, CF); Tabiano Castello

(Parma), Zanclean-Piacenzian, 47 exx (CD); Pra-

dalbino (Bologna), Piacenzian, 27 exx (CB); Ciu-

ciano (Siena), Zanclean, 36 exx (CB, CD, CF); San

Lorenzo in collina (Bologna), Zanclean-Piacenzian,

18 exx (CD); Chiusa di Codrignano (Bologna), Ge-

lasian - Calabrian, 18 exx (CB, CD); Ca Lametta

(Bologna), Piacenzian, 17 exx (CB, CD); Cava Cam-

pore (Parma), Zanclean, 16 exx (CB, CD); Ca'

Bianca (Bologna), Zanclean 15 exx (CB, CD); Ar-

maiolo (Siena), Piacenzian, 12 exx (CB); Monte Pa-

dova (Piacenza), Piacenzian, 23 exx (CB, CD, CF);

Orciano Pisano (Pisa), Zanclean-Piacenzian, 20 exx

(CF); Cava Tacconi (Roma), Emilian, 10 exx (CB);

Rio Torsero (Savona), Zanclean, 10 exx (CF); Spic-

chio (Firenze), Zanclean-Piacenzian, 10 exx (CD,

CF); Torrente Stirone (Parma), Calabrian, 10 exx

(CB, CD); Tabiano Bagni (Parma), Zanclean, 7 exx

(CD); Cava Certaldo (Firenze), Piacenzian, 6 exx

(CB); Linari (Siena), Piacenzian, 5 exx (CB, CD);

Rio Crevalese (Piacenza), Piacenzian, 4 exx (CB,

CD); Lagune (Bologna), Zanclean 4 exx (CD); San

Faustino (Temi), Zanclean, 8 exx (CB, CF); Latsia

(Cyprus), Gelasian, 4 exx (CF); Pianella (Siena),

Zanclean, 4 exx (CF); Riparbella (Pisa), Calabrian,

4 exx (CF); Strolla (Siena), Zanclean, 4 exx (CB);

Torrente Arda (Piacenza), Calabrian, 4 exx (CB);

Cava Lugagnano (Piacenza), Zanclean, 4 exx (CB,

CD); Rio Merli (Ravenna), Zanclean, 3 exx (CD);

Fauglia (Pisa), Calabrian, 2 exx (CF);

A. alata (Eichwald, 1829), Szob (Hungary), Bade-

nian, 3 exx (CB); Letkes (Hungary), Badenian, 2 exx

(CD A).

A. pesgallinae Barnard, 1963, Morocco, modem, 2

exx (CD); Guinea Bissau, modem, 2 exx (CB).

Description. Shell medium-large sized (average H

= 29.2-44.6 mm), loop sharply angular consisting of

8-9 whorls. The teleoconch is characterized by a

dense spiral sculpture made by threads of equal

thickness (about fifteen on the penultimate whorl).

Evident striae of growth wiggly, intersecting with the

spiral threads forming, in the early whorls, a reticu-

lated surface with a parallelogram or mmble mesh.

Presutural spiral chord not grainy. Carinate, angular

whorls, with very small and numerous nodules

(about 28 on the penultimate whorl). The last whorl,

which occupies about half of the total height of the

loop, is crossed by two nodulose hulls plus a third

one, little noticeable in the rear part of the whorl.

Elongated aperture; lip expanded formed by four

very elongated and narrow digits, the first of which

is adherent and parallel to the loop; basal digit long

and almost straight, without expansions.

Distribution. According to the locality of discovery,

A. uttingeriana occurred at depths corresponding to

the circalittoral/deep circalittoral. Stratigraphic dis-

tribution seems to go from the Tortonian to the Ca-

labrian.

Remarks. In all specimens examined the proto-

conch was not complete for which it was not possi-

198

Mauro M. Brunetti & Maurizio Forli

ble to describe it. This species, reported for the

Mediterranean basin from the Tortonian (late

Miocene) to the Sicilian baseline (lower Pleistocene),

is extraordinarily abundant in the Piacenzian. The

real presence of this taxon during the Miocene

should anyway be best investigated, indeed in the

Tortonian is also present a similar species: A. ther-

sites (Brives, 1897) (see the material of the coll.

Mayer-Eymar of Stazzano deposited in NMB, avai-

lable at http://www.stromboidea.de/?n=Species.

AporrhaisThersites.), characterized by a marked

columellar callus and a more pronounced spiral

sculpture; to this species also seem to correspond

the specimens reported by Settepassi (1971, figs.

79-80) as A. zancleanus Monterosato ms. Friedberg

(1914, pi. 8 fig. 2) describes for the Polish Miocene

A. uttingeriana which we believe can be referred to

another species.

As with all species of the genus, including A. uttin-

geriana, the number of digits may exceptionally be

different from the norm, Travaglini (1988) depicts

an example of the Calabrian from the Stirone tor-

rent (Parma), with five digits while another, found

in the Piacenzian of Rio Carbonaro (Piacenza), pre-

sents only three digits (Fig. 45). Also the length of

digits can be variable, Sacco (1893) described the

var. peraraneosa (Fig. 43) characterized by long

digits. The var. percarinata Sacco, 1893 (Fig. 44)

with more pronounced fairing, falls within the range

of variability of the species.

The specimen illustrated by Sacco (1893) as Che-

nopus serresiana var. pliotransiens (Fig. 47), ex-

amined by us, is attributable to a teratological form

of A. uttingeriana.

The varieties crassulosa Sacco, 1893 (Fig. 50) and

ornatissima Sacco, 1893 (Fig. 51) are, according to

the author, identical to the specimens figured by

Hornes (1856) as A. pespelecani. By the direct ex-

amination of the material it was found that, while

Chenopus uttingeriana var. crassulosa Sacco, 1 893

falls into the variability of A. uttingeriana, the va-

riety ornatissima is closely related to A. alata as

well as the examined samples of the Austrian Mio-

cene. The var. mutica Almera & Bofill, 1898 of the

Spanish Pliocene falls into the variability of A. ut-

tingeriana. Marquet et al. (2002), consider the

miocenic A. alata (Von Eichwald, 1 829) identical

to A. uttingeriana', on the contrary, the same species

is considered by Strausz (1966) and, more recently,

by Baluk (1995) attributable to A. pespelecani. In

our opinion there are several morphological dif-

ferences between these species and we disagree

with the beliefs of these Authors. Even with all the

precautions due to the scantiness of examined ma-

terial, we believe that A. alata, as we understood it,

presents obvious differences from A. uttingeriana

including in particular the sculpture of the fairings

made up of elongated tubercles and short digits, the

first of which is welded to the loop always not ex-

ceeding half of the second whorl.

Beyrich (1853, pi. 11 fig. 8), Sorgenfrei (1958, pi.

17 fig. 143), Schultz (1998, pi. 23, fig. 8), Marquet

et al. (2002) report as A. uttingeriana various sam-

ples of the Middle Miocene of Central Europe all,

we believe, referable to A. alata. While presenting

an undeniable affinity with A. uttingeriana, we are

inclined to believe that A. alata is to be intended as

a distinct species, or perhaps as a "species group",

probably related to A. uttingeriana, which began to

spread with certainty only from the Tortonian. We

do not agree with the theory of Vinassa de Regny

(1896) who relates A. meridionalis to A. uttinge-

riana, considering the first progenitor of the second,

in fact, as mentioned above, A. meridionalis (Fig.

31) shows dimensions, shape and sculpture com-

pletely different.

During the Pleistocene, there is a considerable in-

crease of size of the shell of A. uttingeriana. Count-

less are the reports of A. uttingeriana for the italian

Plio-Pleistocene, see for example, Sacco (1893) for

several Pliocene localities, Fontannes (1880) for

the French Pliocene, Cerulli-Irelli (1911) for the

Gelasian of Monte Mario (Roma), Dieni & Ome-

netto (1960) for the Zanclean of Orosei (Nuoro), Di

Geronimo (1969) for the Calabrian of Monte Na-

vone (Enna), Marasti & Raffi (1976) for the Piacen-

zian of Maiatico (Parma), Caprotti (1976) for the

Piacenzian of Castell'Arquato (Piacenza), Cavallo

& Repetto (1992) for the Pliocene of Roero

(Cuneo), Segurini & Tabanelli (1994) for the Zan-

clean of rio Albonello (Ravenna), Piccioli Resta &

Prete (2000) for the Fower Sicilian of Nardo

(Fecce), Fandau et al. (2004) for the Zanclean of

Estepona (Spagna), just to say a few.

In Morocco and Western Atlantic, there is a similar

species, A. pesgallinae Barnard, 1963 (Fig. 48), dis-

tributed, according to Ardovini & Cossignani (2004),

from Morocco to Namibia on sandy bottoms; Mala-

testa (1974), Mienis (1976) and Kronenberg (1991)

consider instead A. pesgallinae (=A. elegantissima

The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene

199

Pareiizan, 1970 and A. pseudoserresiana procerus

Settepassi, 1971) subspecies of A. uttingeriana or

even conspecific with this species (Solsona et al.,

2000; Marquet et. al., (2002). Although we do not

want to get in on the issue, due to the small number

of specimens examined, we point out that either dif-

ferences in teleoconch shape (rounded and without

keeled whorls), or the different arrangement of digits

(first digit separate and divergent in A. pesgallinae,

adherent and parallel to the loop in A. uttingeriana )

make us consider, in line with Manganelli et at.

(2008), A. pesgallinae as a valid species, probably

derived from A. uttingeriana from which is well dif-

ferentiated (Forli, 1988, 1989).

Aporrhais peralata (Sacco, 1893)

(Figs. 56-59, 75)

Chenopus uttingeriana war. peralata - Sacco, 1893:

26, pi. 2, fig. 25

Aporrhais pespelecani peralata - Marquet et al.,

2002: 156, figs. 38-39

Aporrhais peralata - Manganelli et al., 2008: 499,

figs. 4-14.

Examined Material. Tabiano Castello (Parma),

Zanclean-Piacenzian, 66 exx (coll. Della Bella);

Cava Campore (Parma), Piacenzian, 58 exx (CB,

CD); Castelnuovo Berardenga Scalo (Siena), Zan-

clean, 25 exx (CF); Marzeno (Ravenna), Piacenzian,

21 exx (CD); Rio Merli (Ravenna), Piacenzian, 10

exx (CD); Luciana (Pisa), Zanclean, 8 exx (CF); Or-

ciano Pisano (Pisa), Zanclean, 6 exx (CF); Pradal-

bino (Bologna), Piacenzian, 2 exx (CD); Rio

Albonello (Ravenna), Piacenzian, 2 exx (CB);

Monte Padova (Piacenza), Piacenzian 1 ex (CD).

Description. Shell small to medium sized (av-

erage H = 20 mm), spindle-shaped loop consisting

of 7-8 whorls. The beginning of the teleoconch is

characterized by a spiral sculpture consisting of ten

spiral threads of equal thickness. The teleoconch is

characterized by a dense spiral sculpture consisting

of ten spiral threads of equal thickness (about 1 5 on

the penultimate whorl). Striae of growth evident,

wiggly, intersecting the threads so that the first

whorls have a reticulated surface with a parallelo-

gram mesh. Whorls carinated, angular, with very

tiny, pointy and numerous nodules (approximately

25 on the penultimate whorl). The last whorl, which

occupies about half of the total height of the loop,

is crossed by two angolose hulls plus a third one,

little noticeable in the rear part of the whorl. Aper-

ture elongated. Lip expanded consisting of five dig-

its, the second, third and fourth of which welded

into a single flat and thin expansion; the first digit

separate, partly adhering to the loop; basal digit

short with a slight expansion.

Distribution. According to the locality of discoveiy,

A. peralata was living at depths corresponding to the

deep circalittoral. Certain stratigraphic distribution

seems to go from the Zanclean to the Piacenzian.

Remarks. In all specimens examined the protoconch

was not complete, for which it was not possible to

describe it. Sacco (1893), with reference to his A. ut-

tingeriana var. peralata (Figs. 56, 57), says: “It is a

form that one might say anomalous, with adult cha-

racters although not yet fully developed". Actually,

at a first glance, A. peralata may resemble a small-

sized A. uttingeriana , looking good, though, there are

some important differences between the two: no-

tably the first digit is never completely welded to

the loop as in A. uttingeriana, but always slightly

separate; the second, third and fourth digits are

welded together to form a wing; the basal digit is

never veiy elongated and the striae of growth are

much pronounced and visible. Some of these featu-

res, according to Landau et al. (2004), make A. pe-

ralata come close to A. pespelecani pespelecani.

Given the substantial differences between the two in

the early whorls, in our opinion, this hypothesis is

entirely inappropriate; we think, instead, that A. pe-

ralata should be considered a valid species, well

typical, as recently suggested by Manganelli et al.,

(2008). A. peralata is limited to the Zanclean and the

Piacenzian of North-Central Italy, surely living at

considerable deepths. A. peralata is reported for the

Piacenzian of Bordighera (Imperia) (Sacco, 1893)

and of Cava Campore (Parma) (Landau et al., 2004).

Aporrhais pliorara (Sacco, 1893)

(Figs. 60-66, 76)

Chenopus serresiana ? var. pliorara - Sacco, 1893:

26, pi. 2, fig. 27

Aporrhais sarsi - Settepassi, 1971: 21, pi. 11, figs.

13-15

Aporrhais sarsi palmipes - Settepassi, 1971: 21, pi.

11, figs. 16-18, 21, pi. 12, fig. 23

200

Mauro M. Brunetti & Maurizio Forli

Aporrhais sarsi minor - Settepassi, 1971: 22, pi. 11,

figs. 19-21

Aporrhais sarsi - Macri, 1983: 112, pi. 2, fig. 4

Aporrhais sarsi - Travaglini, 1988: 7, figs. 4-5

Aporrhais serresiana pliorara - Segurini & Taba-

nelli, 1994: 9, pi. 1, figs. 1-2

Examined Material. Cava Lustrelle (Lecce), Cala-

brian, 30 exx (CB, CD); Cava Signorella (Lecce),

Calabrian, 30 exx (CL); Chiusa di Codrignano (Bo-

logna), Gelasian - Calabrian 15 exx (CB, CD); Mon-

tecatone (Bologna), Calabrian, 4 exx (CB); Losso

della Possessione (Ravenna) Gelasian, lex (CD).

Description. Shell medium-large sized (average H

= 38.8 mm), consisting of eight to nine whorls. Pro-

toconch flat, smooth, of about 2.5 whorls, with a

small core (nucleus). The beginning of the teleo-

conch is characterized by a dozen spiral threads more

or less equally spaced; from about the middle of the

second whorl appear striae of growth opistocirte with

a moderately deep notch, which, by crossing the spi-

ral cords, form a reticulate of elongated rhomboid

meshes. Prom about half loop the axial ribs decrease

and rise in thickness forming a hull made of at first

13-15 tubercles little elongated, and then about 20 on

the last whorl. Prom about mid-loop there is a thread

near the abapicale suture, with the same number of

tubercles of the hull, but smaller, giving rise, on the

last whorl, to the second hull. The last whorl, about

half of the total length, is adorned with three hulls,

the most obvious of which is the adapical one. Spiral

sculpture made up of flattened threads more or less

similar in size, separated by narrow grooves, axial

sculpture absent or little evident. Aperture elongated

and rather large, lip wide forming five digits inter-

nally flattened and crossed in the middle by a crease

that forms in the opposite side a hull for each digit,

first digit separate and divergent from the loop, se-

cond in length, compared to the other digits. The se-

cond digit is the longest one, and the third is a little

bit longer than the fourth. Abapical digit a little

shorter than the opposite first adapical digit, slightly

bent towards the aperture.

Distribution. According to the locality of dis-

covery, A. pliorara was living at depths correspond-

ing to the circalittoral/deep circalittoral. Certain

stratigraphic distribution seems to go from the Zan-

clean to the Calabrian.

Remarks. Chenopus serresiana var. pliorara (Pigs.

60, 61) has been described for the Pliocene of the

“Astigiana” (Asti). We propose herein to elevate to

the species level the variety described by Sacco due

to the peculiar characteristics of the shell sculpture

or shape and number of digits. We consider as lec-

totype the specimen of the coll. Bellardi-Sacco at

the MRSNT, catalogue no. BS. 04 1.0 1.021. The

species with which A. pliorara has more affinity is

definitely A. serresiana (Pigs. 67-69) that differs for

shell heavier, loop more stretched, digits thinner,

elongated, less in number but more prominent, and

tubercles on the penultimate whorl. Strong are also

affinities with A. peralata from which A. pliorara

stands out mostly for larger size, angle of the major

loop, shape of the digits and the ornamentation

with tubercles which tend to form hulls. For the

Pliocene, in addition to that of Sacco (1893, p. 26),

the only report of A. pliorara is by Segurini & Ta-

banelli (1994, pi. 1, figs. 1-2), for the Piacenzian of

Rio Albonello (Ravenna). For the Gelasian and the

Calabrian, the species is found most frequently in the

deep sediments of Romagna and into those of South-

ern Italy. To these populations, in our opinion, are

attributable the reports of A. serresiana by Tabanelli

(1981) for the Pliocene of Monte Gebolo (Ravenna),

by Palazzi & Villari (1994), for the Lower Pleisto-

cene of Venetico Marina (Messina) and by Vazzana

(1996) for Vallone Catrica (Reggio Calabria). The

largest number of reports of this species refers to the

Calabrian (Emilian) of Southern Italy. To A. pliorara

correspond the morphs named by various authors

(Settepassi, 1971, Macri, 1983, Travaglini, 1988) as

A. sars/ Kobelt, 1908.

Settepassi (1971) considers A. sarsi a valid species

and reports its presence in the collection of Monte-

rosato from the Lower Pleistocene of Ficarazzi (Pa-

lermo) and Monte Pellegrino (Palermo); according

to his thesis, A. sarsi is currently living in the North

Sea and belongs to the stocks of Northern species

that inhabited the Pleistocenic seas during the cold

periods. Interestingly, Settepassi (1971) indicates A.

sarsi palmipes as corresponding to the pliocenic A.

pliorara. According to Bouchet & Waren (1990, p.

708), which we agree with, A. sarsi , an exlusively

extant species, falls perfectly in the range of varia-

bility of A. serresiana. It is noteworthy that in pleis-

tocenic populations examined, no specimens of the

typical form of A. serresiana were found. A. serre-

siana would be present in the Mediterranean basin

only since very recent times. The hypothesis of

Sacco (1893) of a phyletic relationship between

The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene

201

A. uttingeriana and A. serresiana lacks any foun-

dation, as well evidenced by Malatesta (1974).

Aporrhais serresiana (Michaud, 1827)

(Figs. 67-69, 77)

Aporrhais macandreae - Jeffreys, 1867: 253

Aporrhais pes-carbonis - Sowerby, 1842: 21, pi. 5,

fig. 1 (non Brongniart, 1 823)

Aporrhais pes pelecani sarsii - Kobelt, 1908: 17,

pi. 102, figs. 3, 4

Aporrhais serreseanus borealis -Kobelt, 1888: 155

Aporrhais serreseanus hexapoda - Nordsieck,

1968:97, pi. 15, figs. 57,17

Examined Material. Isola Capraia (Livorno) - 80,

modem, 36 exx (CD, CF); Isola Elba (Livorno),

modern, 10 exx (CD); Portoferraio (Livorno) - 80 /

- 90, modern, 8 exx (CD); Tarragona (Spain) - 14,

modern, 1 ex (CB).

Description. Shell medium-sized (average H = 36

mm), teleoconch made of 8-9 whorls. Protoconch

flat, smooth, of about 2.75 whorls, with a small

core. The beginning of the teleoconch is characte-

rized by a dozen spiral threads more or less

equally spaced and equivalent in size. From about

half of the second whorl appear the striae of

growth, opistocirte, with a medium-deep hollow,

fewer than in the previous species that, crossing

with spirals chords, form a reticulate with a very

elongated rhomboid-meshed grid. From about half

loop, the axial ribs rise in thickness and decrease

in number forming an abapical hull, at about two-

thirds of the total height of the whorl, consisting

of fifteen sickle tubercles, which become approxi-

mately 18 on the last whorl. From about the half

of the loop there are, in the lower part of the main

upper knots, in correspondence of the suture, small

thickenings that make a little more evident the last

two abapical tracks, which will form, on the last

whorl, the second hull. The last whorl is about half

the total length, decorated with three hulls the

most evident of which is the adapical one, whereas

the abapicale is the least one. Spiral sculpture

made up of flattened threads more or less similar

in size, separated by narrow grooves, axial sculpture

formed by the striae of growth, opistocirte, sinuous

towards the anterior digit. Aperture elongated and

narrow, with expanded lip forming five digits, the

first, second and fifth of which are similar in

length, while the third is nearly double the fourth

which is also the one with the labial groove absent

or barely noticeable.

Distribution. To our knowledge, the only speci-

mens of Aporrhais serresiana fossil are those re-

ported for the Wurmian of the Northern Tyrrhenian

Sea by Cecalupo (1988). Currently, A. serresiana

is living in the Mediterranean on the circalittoral

seabed at greater depths than A. pespelecani pe-

spelecani (Sabelli & Spada, 1977).

Remarks. The species differs from A. pliorara for

a more robust shell with the columellar edge less

broad, and interdigital plan less extended. As

mentioned above, there are no fossil records of

the species prior to the Wurmian, and even these

populations slightly differ from the living species

(Cecalupo, 1988).

CONCLUSIONS

The Aporrhaidae fossils, found in the italian

Plio-Pleistocene, consist of five species and one

subspecies. Together with the two known and uni-

versally accepted species (Aporrhais pespelecani

pespelecani , A. uttingeriana ) there also are three

species and one subspecies often confused with

the previous ones (A. pliorara , A. peralata, A.

etrusca n. sp.). With the beginning of climate de-

terioration, begun during the Piacenzian, the latter

three went extinct. During the late Piacenzian and

the early Calabrian appear several populations at-

tributable to the depth-morph of A. pespelecani

and A. pliorara.

The relationships between plio-pleistocenic and

miocenic species are still all to define. On the one

hand, the relationships among A. alata of the Mid-

dle Miocene, as we intend it, A. uttingeriana of the

Tortonian-early Pliocene-Pleistocene and the ex-

tant A. pesgallinae of West Africa appear pretty

clear; moreover, no doubt there is a link between

the Plio-Pleistocenic A. pliorara and the extant A.

serresiana. On the other hand, the phyletic rela-

tionships of A. pespelecani group with the other

species of the Miocene of Europe remain to be clar-

ified, which, however, is definitively beyond the

aim of this work.

202

Mauro M. Brunetti & Maurizio Forli

Figures. 41-47. Aporrhais uttingeriana. Figs. 41-42: Bordighera (Imperia), Piacenzian, FI = 32 mm (MRSNT, Bellardi and Sacco

coll., BS. 041. 01. 005). Fig. 43: Chenopus uttingeriana var. peraraneosa, Albenga (Savona), Zanclean, H = 34 mm (MRSNT, Bel-

lardi and Sacco coll., BS. 041. 01. Oil). Fig. 44: C. uttingeriana var. percarinata, Carru (Cuneo), Piacenzian, H=30,3 mm (MRSNT,

Bellardi and Sacco coll., BS. 041. 01. 012). Fig. 45: Rio Carbonaro (Piacenza) Piacenzian, H=34 mm (CB). Fig. 46: Torrente Arda

(Piacenza) Calabrian, H=80 mm, (CB). Fig. 47: C. serresiana (an Chenopus uttingeriana ?) var. pliotransiens, Bordighera (Im-

peria), Piacenzian, H = 19,5 mm (MRSN, Bellardi and Sacco coll., BS. 041. 01. 015). Fig. 48: Aporrhais pesgallinae, Guinea

Bissau, modern, H=39 mm.

The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene

203

Figures. 49-50. Aporrhais uttingeriana. Fig. 49: Chenopus uttingeriana var. brogniartiana, Colli Astesi, Zanclean-Piacenzian, H = 36

mm (MRSNT, Bellardi and Sacco coll., BS. 041. 01. 010). Fig. 50: C. uttingeriana var. crassulosa, Stazzano (Alessandria), H = 38 mm

(MRSNT, Bellardi and Sacco coll., BS. 04 1.0 1.007). Figs. 51-54 .Aporhhais cf. alata. Fig. 51: C. uttingeriana var. ornatissima, Monte

Cappucini (Torino), Middle Miocene, H = 18,3 mm (MRSNT, Bellardi and Sacco coll., BS. 041. 01. 008). Fig. 52: C. pes pelecani (in

Floemes 1856 pi. 18 fig. 2a), Gainfahren (Austria), Tortonian, H = 37,5 mm (NHMW, 1846/0037/0190). Figs. 53-54: C. pes pelecani

(in Floemes 1856 pi. 18 fig. 3a), Baden (Austria), Tortonian, H = 34 mm (NHMW, 1846/0037/0190). Fig. 55. A. dingdenensis, Miste

(Netherlands), Middle Miocene, H = 14 mm (CB). Figs. 56-59. A. peralata. Figs. 56, 57. Lectotypus, Bordighera (Imperia), Piacenzian,

H = 21,5 mm (MRSNT, Bellardi and Sacco coll., BS.041.01.013). Figs. 58, 59. Campore (Parma), Piacenzian, H = 20,5 mm (CB).

204

Mauro M. Brunetti & Maurizio Forli

Figures. 60-66. Aporrhais pliorara. Figs. 60, 61: Lectotypus, Colli Astesi (Asti), Zanclean-Piacenzian, H = 28,5 mm (MRSNT,

Bellardi and Sacco coll., BS. 041. 01. 014). Figs. 62, 63. Cava Lustrelle (Lecce), Lower Pleistocene, H = 40 mm (CB). Figs. 64, 65:

Cava Lustrelle (Lecce), Lower Pleistocene, H = 44 mm (CB). Fig. 66: apical whorls, Cava Lustrelle (Lecce), Lower Pleistocene,

(CB) Scale bar 100 pm. Figs. 67-69. A. serresiana. Figs. 67, 68: Isola d'Elba (Livorno), modern, H = 32 mm. Fig. 69: apical

whorls, Anzio (Roma), (CF) Scale bar 100 pm.

The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene

205

Figures. 70-77. Aporrhais apical whorls. Fig. 70. A. pespelecani pespelecani, Rodi Garganico (Foggia), modem, H = 48

mm (CB). Fig. 71. A. pespelecani pespelecani , depth form, Fauglia (Pisa), Calabrian, H = 50 mm (CB). Fig. 72. A. pespe-

lecani crenatulina, Guidonia (Roma), Piacenzian, 36 mm. (CB). Fig. 73. A. etrusca n. sp., Cedda (Siena), Zanclean-

Piacenzian, H = 34 mm (CB). Fig. 74. A. uttingeriana, Rio Carbonaro (Piacenza), Piacenzian, H = 44 mm (CB). Fig. 75.

A. peralata, Campore (Parma), Piacenzian, H = 23 mm (CB). Fig. 76. A. pliorara, Cava Lustrelle (Lecce), Lower Pleistocene

, H = 44 mm (CB). Fig. 77. A. serresiana, Isola d'Elba (Livorno), modern, H = 37 mm (CB). Scale bar = 5 mm.

ACKNOWLEDGEMENTS

Grateful thanks to Paolo Magenes (Milano,

Italy), Maurizio Sosso (Genova, Italy), Bruno

Dell'Angelo (Genova, Italy), Ulrich Wieneke

(Murnau, Germany), M. Harzhauser (NMHW),

and S. Dominici (MSNF).

REFERENCES

Aimone S. & Ferrero Mortara E., 1983. Malacofaune

plioceniche di Cossato e Candelo (Biellese, Italia

NW). Bollettino del Museo regionale di Scienze Na-

turali di Torino, 1: 279-328.

Ardovini R. & Cossignani T., 2004. Conchiglie dell'Africa

Occidentale. L'lnformatore Piceno, Ancona, 319 pp.

Baluk W., 1975. Lower Tortonian gastropods from Ko-

rytnica, Poland, Part 1, Paleontologia Polonica, 32:

1-186.

Baluk W., 1995. Middle Miocene (Badenian) gastropods

from Korytnica, Poland Part II. Actca Geologica Po-

lonica 45: 153-255

Benvenuti M., Bertini A., Conti C., Dominici S. & Fal-

cone D., 1997. Analisi stratigrafica e paleoambientale

integrata del Pliocene dei dintorni di San Miniato.

Quaderni del Museo di Storia Naturale di Livorno,

14: 28-49.

Bogi C., Cauli L., Pagli A. & Pagli F., 2002. Le Archi-

tectonicidae Gray, J.E., 1840 del Pliocene Toscano.

Bollettino Malacologico, 38: 31-40.

206

Mauro M. Brunetti & Maurizio Forli

Bossio A., Mazzanti R., Salvatorini G., 1992. Nuovi dati

sui depositi miocenici del settore meridionale del ba-

cino del flume Elsa Loc. Poggibonsi-La Strolla. Pa-

leopelagos, 2: 104-112.

Brunetti M. & Vecchi G., 2003. Sul ritrovamento di Te-

retia elegantissima (Foresti, 1868) in terreni plioce-

nici delTEmilia e della Toscana. Bollettino della

Societa Paleontologica Italiana, 42: 49-57.

Brunetti M. & Vecchi G., 2005. Nuove specie di Gastero-

podi del Piacenziano di rio Crevalese, CastelTArquato

(Piacenza, Italia), Bollettino Malacologico, 41: 1-22.

Brunetti M. & Della Bella G., 2006. Jujubinus astraea-

formis nuova specie per il Pliocene italiano, Bollet-

tino Malacologico, 41: 75-78.

Brunetti M. & Soccio S., 2006. Osservazioni su Nassa-

rius strobelianus (Cocconi, 1873), specie poco nota

del Pliocene italiano, Bollettino Malacologico, 41:

85-88.

Brunetti M., Forli M. & Vecchi G., 2008. Una nuova spe-

cie di Gibbula ( Forskalena ) per il Pleistocene italiano

(Gastropoda: Trochidae). Bollettino Malacologico,

44: 5-9.

Brunetti M. & Della Bella G., 2006. Leufroyia ferrierii:

una nuova specie per il Pliocene toscano (Gastropoda:

Conidae). Bollettino Malacologico, 42: 118-120.

Bucquoy E., Dautzenberg P. & Dollfuss G., 1882. Les

mollusques marins du Roussillon Tome 1 Gastero-

podes. Paris, J.B. Bailllliere & Fils, 570 pp.

Beyrich E., 1853-1857. Die Conchylien des norddeut-

schen Tertiargebirges. Berlin, 36 pp.

Bouchet P. & Waren A., 1993. Revision of the North-East

Atlantic bathyal and abyssal Mesogastropoda. Bol-

lettino Malacologico, (Suppl. 3): 579-840.

Cahuzac B., Cluzaud A., Lesport J. F. & Ringeade M.,

1993. Etude de populations de Glycymeris (Bivalvia,

Glycymerididae) du Miocene dAquitaine, Sud-Ouest

de la France. Ciencias da Terra (UNL), 12: 91-109.

Caprotti E. 1976. Malacofauna dello stratotipo piacenziano

(Pliocene di CastelfArquato). Conchiglie, 12: 1-56.

Cavallo O. & Repetto G., 1992. Conchiglie fossili del

Roero. Associazione naturalistica piemontese amici

del Museo “F.Eusebio”, Studio grafico Athena, Alba,

251 pp.

Cecalupo A., 1988. Rinvenimento di specie rare al largo

della Sardegna sud-orientale (contributo IV). Bollet-

tino Malacologico, 24: 33-39.

Ceregato A., 2001. Paleocomunita batiali a molluschi del

Pliocene del Bacino Padano.Tesi di Dottorato, Uni-

versity degli Studi di Modena e Reggio Emilia, 52 pp.

Cerulli-Irelli S., 1910. Fauna Malacologica Mariana,

parte IV. Scaphopoda: Dentaliidae; - Gastropoda: Ste-

nogyridae, Gadinidae, Acteonidae, Tornatinidae, Sca-

phandridae, Bullidae, Ringiculidae, Philinidae,

Umbrellidae, Conidae, Pleurotomidae. Paleontogra-

phia italica, 16: 23-70.

Chirli C., 1988. Malacofauna Pliocenica Poggibonsi,

cava delle Piaggiole. Firenze, Lalli Editore, 89 pp.

Chirli C., 2007. Malacofauna pliocenica toscana vol. 6

Neotaenioglossa. C. Chirli, Firenze, 128 + 76 pp.

Cossmann M. & Peyrot A., 1922. Conchologie neogeni-

que de 1' Aquitaine. Extrait des Actes de la Societe

Linneenne de Bordeaux, Bordeaux, 4: 323-610.

Csepreghy-Meznerics I.,. 1956. Die Molluskenfauna von

Szob und Letkes. Annales Instituti Geologici Publici

Hungarici, 45, 443-477.

Davoli F., 1982. Cancellariidae (Gastropoda) in E. Mon-

tanaro Gallitelli (ed.). Studi monografici sulla mala-

cologia miocenica modenese. Parte I - I molluschi

tortoniani di Montegibbio. Paleontographia Italica,

72: 5-73.

Della Bella G. & Scarponi D., 2004. Molluschi Marini

del Plio-Pleistocene delT Emilia-Romagna e della To-

scana, Conoidea Vol. 1 Drillidae e Turridae. Museo

Geologico G. Capellini, Editografica, Rastignano

(Bologna), 92 pp.

Della Bella G. & Scarponi D., 2007. Molluschi Marini

del Plio-Pleistocene delT Emilia-Romagna e della To-

scana, Conoidea Vol. 2 Conidae 1. Museo Geologico

G. Capellini, Tipografia moderna, Bologna, 93 pp.

Della Bella G. & Scarponi D., 2010. Molluschi Marini

del Plio-Pleistocene delT Emilia-Romagna e della To-

scana, Conoidea Vol. 3 Conidae 1. Museo Geologico

G. Capellini, Grafiche Scarponi, Osimo, 128 pp.

Dell'Angelo B. & Forli M., 1995. I Polyplacophora del

Pleistocene inferiore di Riparbella (Pisa) con elenco

dei molluschi ritrovati. Bollettino Malacologico, 30:

221-252.

Dell’Angelo B., Piccioli Resta G. & Bonfitto A., 2007.

Notes on Fossil Chitons. 3. A new species of Lepto-

chiton (Mollusca: Polyplacophora) from the Pleisto-

cene of South Italy. Bollettino Malacologico, 43:

139-142.

Dieni I. & Omenetto P., 1960. Studio di una macro-

fauna del Pliocene inferiore di Orosei (Sardegna).

Rivista Italiana di paleontologia e stratigrafia, 66:

605-618.

Dominici S., Mazzanti R. & Nencini C., 1997. Geologia

dei dintorni di San Miniato tra TArno, TElsa e l’Era.

Quaderni del Museo di Storia Naturale di Livorno,

14: 1-35.

Filippi M., 1984. Sul polimorfismo di Aporrhais pespe-

lecani (L., 1758), nota preliminare. Thalassia Salen-

tina, 14: 39-45.

Fontannes M., 1 879. Les invertebre du bassin tertiaire du

sudest de la France. Les mollusques pliocenes de la

vallee du Rhone et du Rousillon. Vol 1 , Gasteropo-

des. Georg Libraire, Lyon, 276 pp.

Forli M., 1988. Considerazioni filogenetiche su alcune

specie del genere Aporrhais da Costa, 1778 (Mollu-

sca: Gastropoda), I parte. Argonauta, 4: 4-12.

The genus Aporrhais Da Costa, 1 778 (Gastropoda Aporrhaidae) in the Italian Plio-Pleistocene

207

Forli M., 1989. Considerazioni filogenetiche su alcune

specie del genere Aporrhais da Costa, 1778 (Mollu-

sca: Gastropoda), ultima parte. Argonauta, 5: 49-54.

Forli M. & Dell’Angelo B., 2000. Anew species of Mar-

ginella (Mollusca, Gastropoda) from the Italian Plio-

cene. Bollettino Malacologico, 36: 93-98.

Friedberg W., 1914. Miqczaki Miocenskie ziem Polskich

(Mollusca Miocaenica Poloniae), Czesc I. Slimaki i

Lodkonigi (Pars I. Gastropoda et Scaphopoda). Mu-

zeum Imiena Dzieduszyckich (Muzeum Dzieduszyc-

kianum), vol. 3: 241-360.

Gatto R., 1997. Systematic revision of the Conoidean

species of the genus Asthenotoma Harris and Bur-

rows, 1891 from the Italian Neogene. Memorie di

Scienze Geologiche, 49: 37-64.

Geys J. F. & Marquet R. , 1979. Veldatlas Cenozoische

fossielen van Belgie. Deel 1. Neogeen. Publicatie van

de Belgische Vereniging voor Paleontologie, 2: 1-123.

Giannuzzi Savelli R., Pusateri F., Palmeri a. & Ebreo C.,

1996. Atlante delle conchiglie marine del Mediterraneo

vol. 2. Edizioni de "La Conchiglia", Roma, 258 pp.

Glibert M., 1949. Gastropodes du Miocene moyen de

bassin de la Loire. Memoires de FIstitut Royal de

Sciences Naturelles de Belgique, 30 : 1-240.

Glibert M., 1958. Gastropodes du Diestien, du Scaldisien

et du Merxemien de la Belgique. Duexieme note.

Bullettin de l'lnstitut royal des Sciences naturelles de

Belgique, 34: 1-36.

Gonzalez Delgado J.A., 1988. Estudio sistematico de los

Gasteropodos del Plioceno de Huelva (SW de

Espana). 3. Mesogastropoda (Scalacea-Tonnacea).

Studia Geologica Salmanticensia, 25: 109-160.

Harmer F. W., 1918. The Pliocene mollusca of Great Bri-

tain, being supplementary to S. V. Wood’s Mono-

graph of the Crag Mollusca. Vol. 1 . Monograph of

Paleontographical Society London, 67: 303-461.

Hornes M., 1856. Die fossilen Mollusken des Tertiar-

Beckens von Wien. Abhandlungen der Kaiserlich-

Koniglichen Geologischen Reichsanstaldt. 3, 1-736.

Kobelt W., 1908. Iconographie der schalentragenden eu-

ropaischen Meeresconchylien, 4. C. W. Kreidel, Wie-

sbaden, 172 pp.

Kronenberg, G. C., 1991. The recent species of the family

Aporrhaidae. Vita Marina, 41: 73-84.

Janssen, A.W., 1984. An account of the Cancellariidae

(Gastropoda) of Winterswijk-Miste (Miocene, Hem-

moorian), The Netherlands. Scripta Geologica, 68:

1-39.

Laghi G. F. 1984. Sorprendente densita di Chiton sae-

niensis n. sp. in sabbie gialle plioceniche dei dintorni

di Serre di Rapolano, Siena. Bollettino Museo Regio-

nal di Scienze Naturali di Torino, 2: 555-564.

Locard A., 1890. Contributions a la faune malacologique

frangaise, XVI. Les coquilles marines vivant de la

faune frangaise decrites par G. Michaud. Etude criti-

ques d'apres les types de ses collections. Baillieer et

fils, Paris, 46 pp.

Locard A., 1892. Les coquilles marines des cotes de

France. Description des families, genres et especes.

Paris, Librairie J.-B. Bailliere, 384 pp.

Landau B., Marquet R. & Grigis M., 2004. The Early

Pliocene Gastropoda (Mollusca) of Estepona Sou-

thern Spain. Parth 2: Orthogastropoda, Neotaenio-

glossa. Palaeontos, 4: 1-108.

Maori G., 1983. Contributo alia conoscenza delle argille

di Cutrofiano (Lecce). La malacofauna di cava Si-

gnorella. Quaderni del Museo comunale di Paleonto-

logia di Maglie, Ed. Salentina 112 pp.

Malatesta A., 1960. Malacofauna pleistocenica di Gram-

michele (Sicilia). Memorie per servire alia descri-

zione della carta Geologica Italiana, XII. Servizio

Geologico d'ltalia, Roma, 392 pp.

Malatesta A., 1974. Malacofauna pliocenica umbra. Me-

morie per servire alia descrizione della carta Geolo-

gica Italiana, XIII. Servizio Geologico D'ltalia Tip.

Pinto, Roma, 498 pp.

Malatesta A. & Zarlenga F., 1985. II Quaternario di Po-

mezia (Roma) e la sua fauna marina. Bollettino della

Societa Geologica Italiana, 104: 503-514.

Mancini A., 1997. Molluschi fossili della cava di For-

mello (Guidonia - Roma). Annali Associazione No-

mentana di Storia e Archeologia, 3: 35-44.

Manganelli G., Spadini V. & Fiorentino V., 2008. The lost

Aporrahais species from the italian Pliocene: A. pe-

ralata (Sacco, 1893) (Gastropoda, Caenogastropoda).

Journal of Conchology, 39: 493-516.

Marasti R. & Raffi S., 1976. Osservazioni biostratigrafi-

che e paleoecologiche sulla malacofauna del Piacen-

ziano di Maiatico (Parma, Emilia occidentale).

Bollettino della Societa Paleontologica Italiana, 15:

189-214.

Marquet R., 1998. De Pliocene Gastropodenfauna van

Kallo (Oost-Vlaanderen, Belgie). Belgische Vereni-

ging voor Paleontologie, 17: 1-246.

Marquet R., Grigis M. & Landau B. M., 2002. Aporrhais

dingdensis, a new species from the Miocene of the

North Sea Basin (Gastropoda, Caenogastropoda,

Aporrhaidae). Basteria, 66: 149-161

Marques Da Silva Pires C.A., 1993. Gastropodes plioce-

nicos Marinhos de Vale de Freixo (Pombal, Portugal).

Lisboa, Facultade de Ciencias de Universidade de Li-

sboa, 313 pp.

Mienis H.K., 1976. On the identity and distribution of

Aporrhais elegantissima. Conchiglie, 12: 89-92.

Raffi S. & Monegatti P., 1993. Bivalve taxonomic diver-

sity throughout the Italian Pliocene as a tool for cli-

matic-oceanographic and stratigraphic inferences.

Ciencias de terra (UNL), 12: 45-50.

Nielsen J.K., Hanken N.M., Nielsen J.K. & Hansen K.S.,

2006. Bio stratigraphy and paleoecology of the ma-

208

Mauro M. Brunetti & Maurizio Forli

rine Pleistocene of Rhodes, Greece: Scleractinia, Ser-

pulidae, Mollusca and Brachiopoda. Bullettin of Geo-

science, 81: 173-196.

Nyst P.H., 1878. Conchyliologie des terrains Tertiaires

de la Belgique. F. Hayez Editeur, Bruxelles, 263 pp.

Palazzi S. & Villari A., 1994. Malacofaune batiali Plio-

pleistoceniche del Messinese. 1 : Venetico Marina. II

Naturalista siciliano, 18: 73-106.

Pantoli D. & Raffi S., 1981. Presenza del genere Tugonia

(Myidae, Bivalvia) nel Pliocene mediterraneo. Bol-

lettino della Societa Paleontologica Italiana, 20: 73-

80.

Papani G. & Pelosio G., 1962. La serie Plio-Pleistocenica

del T. Stirone (Parmense occidentale). 2° contributo

alia conoscenza dei nuovi affioramenti fossiliferi del

Calabriano nel Preapennino Parmense. Bollettino

della Societa Geologica Italiana, 81: 293-361.

Pelosio G. 1967. La malacofauna dello stratotipo del Ta-

bianiano (Pliocene inferiore) di Tabiano Bagni

(Parma). Bollettino della Societa Paleontologica Ita-

liana, 5: 101-183.

Piccioli Resta G. & Prete B., 2000. Segnalazione di un gia-

cimento di molluschi marini pleistocenici nel comune

di Nardo (Lecce, Italy). La Conchiglia, 308: 47-54.

Rio D., Sprovieri R., Raffi I. & Valleri G., 1988. Biostra-

tigrafia e paleoecologia della sezione stratotipica del

Piacenziano. Bollettino della Societa Paleontologica

Italiana, 27: 213-238.

Ruggieri G., 1962. La serie marina pliocenica e quater-

nary della Romagna. Camera di Commercio e del-

Flndustria agricola di Forli, Forli, 79 pp.

Ruggieri G., 1967. Un raro lamellibranchio nordico nel

Quatemario (Siciliano) di Gela. Natura, 58: 120-124.

Sabelli B. & Spada G., 1977. Guida illustrata all'identi-

ficazione delle conchiglie del Mediterraneo. Calyp-

traeidae, Xenophoridae e Aporrhaidae. Suppl.

"Conchiglie”, 13:9-10.

Sacco F., 1893. I Molluschi dei terreni terziarii del Pie-

monte e della Liguria. Parte XIV, Carlo Clauser, To-

rino, 42 pp.

Settepassi F., 1971. Atlante malacologico I molluschi

marini viventi nel Mediterraneo. Inivag Roma II vol,

290 pp.

Saunders G.D., 1995. Note sulle popolazioni di Mollu-

schi di Portland ed aree adiacenti (Gran Bretagna).

La Conchiglia, 276: 40-44.

Schultz O., 1998. Tertiarfossilien Osterreichs. Gol-

dschneck-Verlag, Frieburg, 160 pp.

Solsona M., 1998. Paleobiologia dels Mesogasteropodes

del Plioce del Mediterrani nord-occidental. Tesis

Doctorales, Universitat de Barcellona, Spain.

Solsona M., Gili C. & Martinell J., 2000. Patterns of

change in the biogeographic distribution of Atlanto-

Mediterranean Aporrhaidae (Gastropoda) from the

Neogene to the Present. Palaeogeography, Palaeocli-

matology, Palaeoecology, 158: 83-97.

Sorgenfrei, T., 1958. Molluscan Assemblages from the

marine middle miocene of South Jutland and their en-

vironments. Danmarks Geoogiske Undersogelse, 79:

356-503.

Strausz L., 1966. Die Miozan-Meiterranen Gastropoden

Ungarns. Akaideimiai Koido, Budapest, 693 pp.

Tabanelli C., 1981. II genere Ringicula Deshayes, 1838

nei depositi profondi del Pleistocene basale in Roma-

gna. Bollettino Malacologico, 17: 211-222.

Tabanelli C. & Segurini R., 1994. Nota preliminare alia

malacofauna pliocenica di Rio Albonello (Faenza).

Quaderni di studi e notizie di Storia Naturale della

Romagna, 3: 3-22.

Tabanelli C., 2008. Associazioni di Paleocomunita batiali

a Molluschi bentonici nel Pliocene della Romagna.

Metodologie e indicazioni per nuove tematiche. Qua-

derni di studi e notizie di Storia Naturale della Ro-

magna, 26: 1-20.

Travaglini A., 1988. Gli Aporraidi del Mediterraneo e i

loro antenati fossili. Notiziario di Mineralogia e Pa-

leontologia, 56: 2-10.

Vazzana A., 1995. Malacofauna batiale del Pleistocene

inferiore del Vallone Catrica (Reggio Calabria, Italia).

Bollettino Malacologico, 3 1 (5-8): 143-162.

Vinassa de Regny P.E., 1896. II Chenopus uttingeriana

Risso e il Chenopus pespelecani L. del Pliocene ita-

liano. Bullettino della Societa Malacologica Italiana,

20: 21-44.

Violanti D., 1987. Analisi paleoambientali e tassonomi-

che di associazioni a foramminiferi del Pliocene li-

gure (Rio Torsero). Bollettino del Museo Regionale

di Scienze Naturali, 5: 239-293.

Wood S.V., 1848. A monograph of the Crag Mollusca,

with descriptions of shells from the upper Tertiaries

of the British Isles. Vol 1 Univalves. The Palaeonto-

graphical Society of London, London, 209 pp.

Biodiversity Journal, 2013, 4 (1): 209-218

The Carabini from different altitudes of Changbai mountain,

Jilin Province, North-Eastern China (Coleoptera Carabidae

Carabinae)

Zhang Xueping 1 , Ivan Rapuzzi 2 *, Gao Meixiang 1 , Li Jingke 3 ,Vongkhampha Manola 3 , Lin Lin 1 & Huang Lirong 4

‘Key Laboratory of remote sensing monitoring of geographic environment. College of Heilongjiang Province, Harbin Normal

University, Harbin, 1 50025, P.R. China

2 V ia Cialla 47, 33040 Prepotto (Udine), Italy; email: info@ ronchidicialla.it

3 P. O. Box 22, Vientiane, Laos

4 College of Environm ental Sciences, Liaoning University Chongshan Road No. 66, Shenyang City 110036, Liaoning Province,

C hina

* C orresponding author

ABSTRACT In the present paper the Carabini fauna of different altitudes and habitats of Changbai

Shan Mountains, Jilin Province, North-eastern China was investigated. After examination

of the collected specimens we describe one new CavabllS taxon: CciKClbllS (CcirabuS) SZeli

changbai CHS Rapuzzi et Li n. s s p . ; C. ( AulonOCarabuS ) rufinus Beheim et Breuning, 1943

was elevated to the specific status. Six CarabllS taxa were recorded for the first time for

the Chinese fauna: C. ( CarabuS ) manifeStUS pyotlganicola Deuve et Li, 1998; C. ( Mor -

phocarabus) venustus cf. kaesongensis im ura, 1 9 9 3 ; C. ( Diocarabus ) caustomarginatus

Imura et Mizusawa, 1994; C. (Scambocambus) kruberi cf. chaos Im ura, 1 993; C. (Acop-

tolabrus) schrencki minpongsanensis d euve et Li, 2003 and C. (Fulgenticarabus) flutschi

coreus Deuve, 2006. C. ( AcoptolabrilS ) constricticollis jilinicus Deuve, 1992 was treated

as a valid subspecies.

KEY WORDS Carabus ■ North-Eastern China; new subspecies; faunistic; taxonomy.

Received 28.12.2012; accepted 11.02.2013; printed 30.03.2013

INTRODUCTION

Changbai Mountain Chain is located in Antu

county, Jilin province, North-Eastern China. The

Mountains are on the border between China and

North Korea (41° 35 '- 42° 25’NL; 127° 40 ’- 128°

16' EL); the highest peak (White Rock Pk.) is 2749

m and it is the highest ofNorth-Eastern China. It is

composed by trachyte, white rock exposed in the

summer; in winter the mountain is covered with

pure white snow formed by the repeatedly volcanic

eruptions. It is the head stream of Tumen river, Yalu

river and Song-hua river. This mountain is heavily

forested, there are mainly PitlUS kOTCliensis S ieb old

et Zucc., yezo spruce, Abies holophylld Maxim.,

hornbeam and maple at elevations between 500-

1 200 m; at 1200-1 800 m above sea level there are

spruce and fir forests; at the elevation of 1 800 m

mainly there is E rm an s B irch forest, which is one of

the China's most important forest areas. Sika deer,

marten, Amur Tigers and other rare animals live in

this forest. Till 19 60 it is a nature reserve w ith an area

of 215,0 0 0 hectares. Changbai Shan mountain is lo -

cated in a temperate continental mountain climate

zone, it is characterized by a long and cold winter,

short and cool summer and the weather is rainy and

210

Z. XUEPING ET ALII

windy in spring, foggy in autumn. The annual aver-

age oftemperature is between -7 °C and + 3 °C . The

aim of the research was to study the Carabini fauna

from Changbai Mountain at different altitudes and

different habitats. We used sets of pitfall traps (50

plastic cups for each location) between June 13th-

15th 2012. To attract and collect Carabini we used a

mixture of granulated sugar, rice vinegar, white wine

and w a ter.

Four different altitudes and habitats were inve-

stigated: 1) Ql. Er-dao-bai-he, elevation 800 m.

Theropencedry m ion ; 2) Q2. H u an g - s o n g -p u - lin -

chang, elevation 1 300 m. Coniferous forest; 3) Q3.

B ai- sh an -sh an g -fan g , elevation 1 850 m. Ermans

Birch forest zone; 4) Q4. Nearby Tianchi weather

station, elevation 2100 m. Tundra belt.

The examination of the collected Carabini

spec-imens permited us to have great results: 1) one

new CarabltS taxon is described and figured: C.

( Carabus ) szeli changbaicus Rapuzzi et Li n. spp.

2) the cohabitation of two different subspecies of

C. {Aulono carabus) canaliculatus a d a m s , 1 8 1 2 : C.

(A.) canaliculatus rufinus Beheim et Breuning,

194 3 and C. (A.) canaliculatus vojnitsi M andl, 19 79

permited us to elevate as valid species C. (A.) rufi-

nUS. 3 ) six Carabus taxa were recorded for the first

time for the Chinese fauna: C. ( Scambocarabus )

kruberi cf. chaos imura, 1 993; C. ( Tomocarabus )

caustomarginatus Imura et Mizusawa, 1994; C.

( Carabus ) manifestus pyonganicola d euve e t Li,

1998; C. (Morphocarabus) venustus cf. kaesongen-

sis imura, 1 993; C. ( Acoptolabrus ) schrencki

minpongsanensis Deuve et Li, 2003 and C. ( Ful -

genticarabus) flutschi koreus Deuve, 2006 . 4) C.

( Acoptolabrus ) constricticollis jilinicus d euve,

1992 was treated as a valid subspecies in the present

paper: C. (Acoptolabrus) constricticollis jilinicus

Deuve, 1992 stat. rest.

The adopted systematic order for the listed spe-

cies of genus Carabus is in accord to Deuve (2012).

RESULTS

Alt. Changbai Shan, Antu county, Jilin pro-

vince, China. 13 1 15. VI. 2012. Ql: Er-dao-bai-he,

elevation 800 m. Theropencedrymion

- Carabus {Aulonocarabus) rufinus b e h e i m et

Breuning, 1943 Status novo (Fig. 1). C. rufinus is

widespread in Liaoning Province, a single locality

was recorded from Jilin (Dongfeng, Xiaogyuedin-

gzi) nearby the border with Liaoning (Deuve et

al., 2011). The new locality on Changbai Moun-

tain is of great interest. On the same mountain but

at higher altitude (see Q3, 1850 m) we observed the

cohabitation with C. ( Aulonocarabus ) canaliculatus

Vojnitsi Mandl, 1979 (Figs. 4, 7, 8). In that case the

two taxa must belong to two different species and

C. (A.) rufinus must be treated as a different species:

Carabus { Aulonocarabus ) rufinus b eheim et b re li-

ning, 1943 stat. nov. The aedeagus of C. rujinUS is

very characteristic (Figs. 2, 3), the median lobe is

expanded and angled in the ventral side, the apex is

enlarged, spatula like. The aedeagus of C. Canal-

CulatUS Vojnitsi is smaller in general, without the

expansion of the median lobe and with the apex

shorter and simple (Figs. 5, 6, 9, 10); the aedeagus

is in general similar to the edeagus of C. ( Aulono -

carabus) canaliculatus Adams, 1 8 1 2 . C. rufinus is

a polimorphic species with several subspecies wide-

spread in North-Eastern China: Liaoning Province,

Jilin Province (marginal) and North-Western Korea.

The subspecies are: Carabus {Aulonocarabus) ru-

finus Beheim & Breuning, 1 943 C. (A.) ruflUUS pap -

pianus Mandl, 1980 comb. nov. C. (A.) rufinus

beizhenensis Deuve et Li, 2000 comb. nov.

- C. {Lepto carabus) seishinensis elongatipennis

Imura et Yamaya, 1994 (Fig. 11), a common species

in Korea Peninsula, is very local in North-Eastern

China known from only very few localities nearby

the border with North Korea (Deuve & Li, 2000a;

Deuve et al., 2011).

- C. (Scambocarabus) kruberi cf. chaos imura,

1993 (Fig. 12) By the shape of male aedeagus and

the sculpture of elytra the collected specimens are

close to the subspecies chaos Imura, 1993 from

North Korea. New subspecies for Chinese fauna.

- C. ( Tomocarabus ) fraterculus gaixianensis

Deuve etLi, 1998 (Fig. 13) By the cordate shape of

the pronotum and slightly blu elytra collected speci-

mens belong to gaixianensis Deuve et Li, 1998.

- C. ( Carabus) granulatus telluris b ates, 1883

(Fig. 16) The species is very constant in North-

E astern C hina.

- C. ( Carabus) manifestus pyonganicola Deuve

et Li, 1998 (Fig. 18) The species is very common

and widespread through Shanxi Province in the

North China to North Korea with some valid sub-

species. The specimens from Changbai Shan cor-

The Carabini from different altitudes of Changbai mountain, Jilin Province, North-Eastern China

211

okxypu*

Him

Ch./

Cattal

KOJUU,

Rjhtag-giutg:

Chwin-Pay

Stt-ii- r *n.l700 -s

i9,?aii.

jbij im

1»(. *. p*pp

tt A* fojdit*

Fig . 1 . C. (A.) rufinUS, locality Q 1 , 28.5 mm. Fig. 2. Idem, aedeagus frontal view. Fig. 3. Idem, aedeagus lateral view. Fig. 4. C.

(A.) canaliculatus vojnitsi, locality Q3, 29 mm. Fig. 5. Idem, aedeagus frontal view. Fig. 6. Idem, aedeagus lateral view. Fig. 7.

Idem , holo type , 25 m m , w ith lab el. Fig. 8. Idem , holotype, details ofhead and pro no turn . Fig. 9. Idem , holotype, aedeagus frontal

view. Fig. 10. Idem, holotype, male aedeagus lateral view. Fig. 11. C. ( L .) seishinensis elongdtipeiVlis , locality Q 1 , 25 .2 mm.

212

Z. XUEPING ET ALII

Fig. 12. C. (S.) krubericf. chaos . locality Ql, 23.3 mm. Fig. 13. C. (T.) f rater cuius gaixianensis, locality Ql, 21mm. Fig.

14. C. (T.) fraterculus neochinensis, locality Q3, i 6 . 8 mm. Fig. 15. C. ( D .) caustomarginatus, locality Q2, 20 mm. Fig. 16.

C. (C.) granulatus telluris , locality q 1, 22.9 mm. Fig. 17. C. (C.) arvensis faldermanni, locality Q3, 1 9 . 1 mm.

The Carabini from different altitudes of Changbai mountain, Jilin Province, North-Eastern China

213

respond with the ssp. pyOTIgCITlicolci Deuve et Li,

1998 diffused not far in North Korea. New subspe-

cies for Chinese fauna.

- C. ( Morphocarabus ) hummeli pusongensis

Imura, 1 993 (Fig. 22) Very variable species with

a number of subspecies described through North-

Eastern Europe (Polar Ural), Siberia to the Pacific

Ocean (including Sakhalin and some sm all Islands

of Peter the Great Gulf). The very polychromus

specimens with green-violet pronotum and green

elytra margined with violet belong to the ssp. pu-

songensis Imura, 19 9 3.

- C. ( Morphocarabus ) wulffiusi dekraatzi k raatz,

1881 (Fig. 23) The species is widely distributed and

common in North-Eastern China.

- C. ( Megodontus ) vietinghoffi caesareus Seme-

nov, 1906 (Fig. 25) The subspecies is widely distri-

buted in North-Eastern China (Deuve & Li, 2000 b).

- C. ( Acoptolabrus ) schrencki schrencki m ot-

schulsky, 1 860 (Fig. 26) The collected speci-

mens belong to the typical form widespread in

North-Eastern China and adjacent area of Far

East Russia.

- C. ( Acoptolabrus ) constricticollis jilinicus

Deuve, 1992 stat. rest. (Fig. 28). The two collected

specimens correspond well with the specimens

from Antu County area from where was originally

described C. C. jilinensis Li, 1992 (name changed

in C. (A.) C. jilinicUS Deuve, 1 992) by general

morphology and size, also the elytra sculpture is

much more interrupted with less elevated tuber-

cles. The subspecies jilinicus was considerated as

a mere synonym of C. constricticollis COYlStricti-

Collis Kraatz, 1886 by Deuve & Li (2000 b). In

our opinion, the collected specimens from the new

locality confirm the differences between the two

subspecies; the nominal subspecies is widespread

in a large area of Heilongjiang, Jilin and Liaoning

Provinces, and jilinicus is more localized on the

mountain area of East Jilin near the border with

N orth K orea.

- C. ( Damaster) jankowskii lii d e u v e , 1 9 9 8 (Fig.

3 0). By the green lu stre of ely tra th e pop u la t ion w ell

corresponds to the ssp. Hi Deuve, 1998.

- C. ( Damaster, smaragdinus liaodongensis l i ,

1 992 (Fig. 31) The specimens show very shiny

cold-green elytra without any cupper color. The

pronotum is cupper-greenish, elongate (ratio L/l =

1.12) and the head very elongate.

Q2: Huang-song-pu-lin-chang, elevation 1300

m. Coniferous forest

- Calosoma (Calosoma) inquisitor cyanescens

Motschulsky, 1 859.

- C. ( Aulonocarabus ) rufinus Beheim et Breu-

n in g , 1943.

- C. ( Diocarabus ) caustomarginatus imura et

Mizusawa, 1994 (Fig. 15) This beautiful taxon d e -

scribed from North Korea for the first time is indi-

cated from China. New species for the Chinese

f au n a .

- C. ( Carabus) manifestus pyonganicola d eu ve

et Li, 1998.

- C. ( Carabus ) szeli changbaicus Rapuzzi et Li

n. ssp. (Fig. 19) In this locality as well as at higher

altitude (see Q3, 1 850 m) we found a small size Ca-

rabuS s. str. close to C. angUStUS Roeschke, 1898

species group typical from North Korea. After exa-

mination and comparison of the collected speci-

mens with the closest taxa, we found that they

belong to a new subspecies close to C. ( Carabus )

SZeli Deuve, 1994. See description below.

- C. ( Acoptolabrus ) schrencki minpongsanensis

Deuve et Li, 2003 (Fig. 27) By the small size, small

and tiny head, shape of pronotum, sculpture of ely-

tra, the collected specimens belong to the subspe-

cies m inpongsanenis Deuve et Li, 2003 described

and known not far in the Northern part of North

Korea. It is the first locality recorded to China. New

subspecies for the Chinese fauna.

- C. ( Acoptolabrus ) constricticollis jilinicus

Deuve, 1992.

- C. ( Damaster ) jankowskii jankowskii Oberthur,

1 8 8 3 (Fig. 29) The elytra are black with a luster

green margin and well correspond to the typical

form widespread in North Korea.

- C. (Damaster) smaragdinus coreicus Hauser,

1921. The species is widespread in North-Eastern

China with several subspecies described, most of

them are with green or blue-green color of elytra.

The specimens collected at low altitude of Chan-

gbai Shan (Ql, 800 m) well correspond to the ssp.

liaodongensis Li, 1992 by the green elytra color.

The specimens from Changbai Shan from medium

and high altitudes belong to the subspecies coreicus

known from North Korea and they are very diffe-

rent from the low altitude specimens. These speci-

mens are of large size (37.3 mm, male fig. 32),

orange-red color, and larger pronotum and head;

214

Z. XUEPING ET ALII

also the aedeagus is different: larger and more regu-

larly curved. Further investigations will be neces-

sary to better understand the systematic position of

C. S ITlCircl gditlUS on Changbai Shan Mountains. If

not any transition forms between liaodongensis and

COVeicUS w ill found at interm ediate altitude, the tw o

forms must be treated as valid species. Under that

consideration it will be possible that C. ( Darnaster )

smaragdinus and C. ( Damns ten branickii represent

two different species.

- C. ( Fulgenticarabus ) flutschi coreus d e u v e ,

2006 (Fig. 33) The collected specimens belong to

the subspecies COreUS Deuve, 2006 described and

known from a single locality in North Korea (Yan-

ggang, M t. Samjiyon San) not far from Changbai

Shan. New subspecies for the Chinese fauna.

Q3. Bai-shan-shang-fang, elevation 1850

m. Ermans Birch forest

- Calosoma ( Calosoma ) inquisitor cyanescens

Motschulsky, 1859.

- C. ( Aulonocarabus ) canaliculatus vojnitsi

Mandl, 1979 (Fig. A). As written above, in this lo -

cality we observed the cohabitation of two CarcibuS

C Aulonocarabus ) tax a: C. ( Aulonocarabus ) rufinus

Beheim et Breuning, 1943 and C. (A.) CCinClliculcitUS

Vojnitsi M an dl, 1979: the specimens with elongate

body, brown elytra and very dilated apex of aedea-

gus are C. (A.) rufinuS; the specimens with black

elytra, shorter body, larger pronotum and tiny apex

of aedeagus are C. (A.) CanaliculatUS Vojnitsi.

- C. ( Aulonocarabus ) rufinus B eheim et Breu-

ning, 194 3

- C. ( Tomocarabus ) fraterculus neochinensis

Deuve et Li, 1998 (Fig. 14). By the smaller body

size, the more regular elytral sculpture and the black

color, the specimens correspond exactly with the

subspecies neochinensis Deuve et Li, 1 998.

- C. ( Carabus ) arvensis faldermanni Dejean,

1 829 (Fig. 17). The taxon is known from different

localities of North-Eastern China, Far East Russia

North Korea; few localities are reported from South

Korea (Kwon & Li, 1984).

- C. ( Carabus ) szeli changbaicus n . ssp. See de-

scription below .

Fig. 18. C. (C.) manifestus pyonganicola, locality Ql, 22.4 mm. Fig. 19. C. (C.) szeli changbaicus n. ssp., holotype male,

21 mm. Fig. 20. Idem, aedeagus frontal view. Fig. 21. Idem, aedeagus lateral view.

The Carabini from different altitudes of Changbai mountain, Jilin Province, North-Eastern China

215

Fig. 22. C. (M.) hummeli pusongensis, locality Q 1, 25.2 mm. Fig. 23. C. (M.) wulffiusi dekraatzi, locality Q 1, 22 mm. Fig.

24. C. (M) venustus cf. kaesotlgensis, locality Q4, 1 6 .8 mm. Fig. 25. C. (M) vietinghoffi caesareus, locality Ql, 28.9 mm.

Fig. 26. C. (A.) schrencki schrencki, locality q 1 , 24,5 mm . Fig. 27. C. (A.) schrencki minpongsanensis, locality Q2, 24 mm .

216

Z. XUEPING ET ALII

B Sjk nk

w & y

JoBl ,

: 'K' _ Sfr

< § \ / Oa

Fig. 28. C. (A.) constricticollis jilinicus, locality Ql, 28.8 mm. Fig. 29. C. (D.) jankowskii jankowskii, locality Q 2 , 32.7

mm. Fig . 30. C. ( D .) jankowskii lii, locality Q 1 , 3 6 .5 m m . Fig . 3 1 . C. (D.) SmaragdinUS liaodongensis , locality Q 1 , 3 3 mm.

Fig. 32. C. ( D .) SmaragdinUS coreicus, locality Q3, 37.7 mm. Fig. 33. C. (F.) flutschi coreus, locality Q 2 , 20.6 mm.

The Carabini from different altitudes of Changbai mountain, Jilin Province, North-Eastern China

217

- C. ( Morphocarabus ) venustus cf. kaesongensis

Imura, 1993. The specimens collected on the high

altitude of the Changbai Shan are very similar to the

specimens from the adjacent areas of North Korea.

By the morphological characters they belong to C.

(M.) venustus kaesongensis Imura, 1993. New sub-

species for the Chinese fauna.

- C. ( Damaster) smaragdinus coreicus Hauser,

192 1 (Fig. 32).

Q4. Nearby Tianchi weather station, ele-

vation 2100 m. Tundra belt

- C. ( Aulonocarabus ) rufinus Beheim etBreu-

nin g , 1 943.

- C. (Tomocarabus) fraterculus neochinensis

Deuve et Li, 1998 New subspecies for the Chinese

fau n a .

- C. ( Morphocarabus ) venustus cf. kaesongensis

Imura, 1 993 (Fig. 24).

New taxon

Carabus (Carabus) szeli changbaicus

Rapuzzi et Li n. ssp.

Holotype: 1 male, H u an g -so n g -p u -lin -ch an g ,

13 0 0 m., Mt. Changbai Shan, Antu county, Jilin

province, China. 13/15. VI. 2012 (Coniferous fo-

rest); preserved in Ivan Rapuzzi collection, Pre-

potto (UD), Italy. Paratype: 1 male, Bai-

shan-shang-fang, 1850 m., Mt. Changbai Shan,

Antu county, Jilin province, China. 1 3/1 5 .V 1.20 1 2

(Ermans Birch forest); preserved in Key Labora-

tory of remote sensing monitoring of geographic

environment, Harbin, China.

Description of holotype male. Length in-

cluding mandibles: 21 mm (Fig. 19), maximum

width of elytra: 7.1 mm. Color black with metallic

luster on head, dorsum and pronotum cupped with

margin of elytra green. Very close to C. (Carabus)

SZeli Deuve, 1 994 but separate by ticked head,

more parallel elytra with stronger elevated inter-

vals. Aedeagus (Figs. 20, 21) longer and thin; apex

more regular curved in frontal view. In lateral view

the apex is a little larger and more curved on the left.

Variability. In general very little variability: the

length of the body is 20.3 mm. The color is more

green and shiny.

Q1 locality

N-E China

Korea

Peninsula

l ) C. rufinus

2 ) C. seishinensis elongatipennis

3 ) C. kruberi c f . chaos

4) C. fraterculus gaixianensis

5 ) C. hummeli pusongensis

6 ) C. wulffiusi dekraatzi

7 ) C. granulatus telluris

8 ) C. manifestus pyonganicola

9 ) C. vietinghoffi caesareus

1 0 ) C. schrencki

1 1 ) C. constricticollis jilinicus

1 2 ) C. jankowskii lii

1 3) C. smaragdinus liaodongensis

10 taxa

5 taxa

Q2 locality

l ) C. rufinus

2 ) C. caustomarginatus

3 ) C. manifestus pyonganicola

4) C. szeli changbaicus n. ssp.

5) C. schrencki minpongsanensis

6 ) C. constricticollis jilinicus

7) C. jankowskii

8 ) C. smaragdinus coreicus

9) C. flutschi coreus

3 taxa

6 taxa

Q3 locality

l ) C. canaliculatus vojnitsi

2 ) C. rufinus

3 ) C. fraterculus neochinensis

4) C. arvensis faldermanni

5) C. szeli changbaicus n. ssp.

6) C. venustus cf. kaesongensis

7 ) C. smaragdinus coreicus

5 taxa

Q4 locality

l ) C. rufinus

2 ) C. fraterculus neochinensis

3) C. venustus cf. kaesongensis

2 taxa

Table 1 . The Carabus fauna of Changbai Shan.

218

Z. XUEPING ET ALII

CONCLUSIONS

The Carabini fauna of Changbai Shan Mountain

is of a great interest. The study of the collected speci-

mens from different altitudes and habitats permitted

us to (i) describe one new CdVdbuS taxon: C. SZeli

chdngbdicus n . ssp., (ii) record for the first time six

new CdTdbllS taxa for the Chinese fauna; and (iii)

better understand the system a tic position of CdTdbuS

(. Aulonocdmbus ) CdUdliculdtUS Adams, 1812 species

group and the status of C. (. AcoptoldbruS ) COYlStricti-

Collis jilinicUS Deuve, 1992. Further investigations

will be necessary to clarify the status of C. ( CoptO -

Idbrus) smdrdgdinus/bmnickii group that will be

possibly to be treated as separate species.

The Carabini fauna of Changbai Shan is very

rich: 23 CdVdbuS taxa and 1 CdloSOMd species were

recorded. In general the CdVdbuS fauna is some-

thing intermediate between the "classic" fauna of

North-Eastern China (9 taxa) and Korean Peninsula

fauna (11 taxa); one taxon seems to be endemic (C.

szeli chdngbdicus n . ssp .) b u t it b elo n g s to a typical

species group from Korean Peninsula (C. dngUStUS

species group) and 3 species are widespread in

North-Eastern China and Korean Peninsula. We

also found some differences in the Carabus fauna

from the four investigated areas of the Changbai

Shan Mountains. In fact many of the CdTdbuS spe-

cies collected at the lower altitude on the Western

slope of the mountain (locality Q 1, 800 m) belong

to the classic species known from North-Eastern

China. Instead the CdVdbuS from medium-high al-

titudes on Changbai Shan Mountain (localities

from Q2 to Q4, 1 300/2 100 m) are mainly the typi-

cal species from the North Korea fauna.

The table 1 report the collected CdTdbuS taxa

from every investigated localities and their main di-

stribution .

ACKNOWLEDGEMENTS

We wish to thank Dr. Thierry Deuve (Paris,

France) and Dr. Otto M erkl (Budapest, Hungary)

for loaning to one of us (I.R.) the holotypes of dif-

ferent Cdmbus ( Aulonocdmbus ) taxa necessary to

determinate the collected specimens. This work was

supported by a grant from the National Science

Foundation of China (No. 4 1 07 1 033; No.

411 0 1049), Innovation Talents Fund for Science

and Techno logy of Ha rb in: 2011RFXXN039. S up -

ported by China Postdoctoral Science Foundation

(20 1 2M 5 1 1 3 6 1 ).

REFERENCES

D euve Th., 2012. Une nouvelle classification du genre

CarabllS L ., 1 758. Association Magellanes: 1-56.

Deuve Th. & Li J. K., 2000a. Diagnoses des trois nouve-

aux CarabllS L. de la Chine, de la Coree et du Paki-

stan (Coleoptera, Carabidae). Coleopteres, 6: 55-76.

Deuve Th. & Li J. K., 2000b. Esquisse pour la connais-

sance du genre CarabuS L. en Chine du Nord-Est

(Carabidae). L am b illion ea, 100: 502-530.

Deuve Th., LiJ.K. & Zhang X.P., 2011. Surquelques Ca-

rabinae du Nord-East de la Chine (Coleoptera, Cara-

bidae). Les C oleopteriste, 14: 55-61.

Kwon Y.J. & Lee S.-M., 1984. Classification of the sub -

family Carabinae from Korea (Coleoptera: Carabi-

dae). Insecta koreana, 4: 1 -148, 107 pi.

Biodiversity Journal, 2013, 4 (1): 219-228

The Giant Butterfly-Moths (Lepidoptera Castniidae) of the

Upper Silesian Museum (Muzeum Gornoslqskie) in Bytom,

Poland, with notes on the history of the Museum

Jorge M. Gonzalez 1 , Pawel Domagala 2 & Adam Larysz 3

'Research Associate, McGuire Center for Lepidoptera & Biodiversity. California State University, Fresno, Department of Plant

Sciences, Fresno CA 93740-8033, USA

2 ul. Wolnosci 2, 42-713 Kochanowice, Poland

3 Upper Silesian Museum, Natural History Department, Sobieskiego 2, 41-902 Bytom, Poland

Corresponding author: gonzalez.jorge.m@gmail.com

ABSTRACT The Upper Silesian Museum was founded in 1910, and besides the struggles and restrictions

suffered during World War II it still remains as a relevant showcase for culture and science of

Silesia, its surrounding regions, the country and even the world. Its Natural History collections

are recognized as one of the largest and most important in the country. In an effort to revise

and curate the Lepidoptera collection, we found an interesting and well maintained group of

giant butterfly moths (Castniidae). Besides providing historical information on the Museum

and its origins, we also include a list with notes about the Castniidae under their care.

KEY WORDS Giant Butterfly-Moths; Castniidae; Biodiversity; Natural History.

Received 13.01.2013; accepted 19.02.2013; printed 30.03.2013

INTRODUCTION

It was 1910 when a group of history enthusiasts

founded the Bytom Historical-Museum Society

(Beuthener Geschichts-und Museumsverein). A

Museum was created with the private collections of

Mr. Simon Mach and the teacher Kurt Bimler, as

well as some city memorabilia and archival mate-

rials donated by the Bytom municipality. The law-

yer William Immerwahr, the priest Emanuel Bu-

chwald and the architect Carl Brugger were also

among the founders of the association. The holdings

of the museum were exhibited in two rooms as-

signed by the school (Oberrealschule) at Kloster-

straBe (now Szymanowski Street) in the present

Sikorski square. One of the rooms housed the col-

lections donated by the founders, while the other

showed a collection of minerals supervised by the

Upper Silesian Association of Technical and Mi-

ning Officials (Verein Bergtechnische Beamten

Oberschlesiens).

During the years 1929-1930 a new building

(where the Museum still stands today) (Fig. 1) was

built to host the collections, but the then named “Na-

tional Museum of the Upper Silesian” (Oberschle-

sisches Landesmuseum) officially opened its doors

the 24th of October 1932 (Fig. 2). The new Museum

included a Natural History Department after acqui-

ring a large collection of animal specimens, but

mainly birds, from the keen ornithologist Major Jo-

hann Nepomuk Walter Eberhard Drescher (1872-

1 938), a landowner near the Figota Otmuchow who

actively collected in the vicinities of Paczkow and

Otmuchow in Upper Silesia (Cempulik & Hadas,

220

J.M. GonzAlez, P. Domagala & A. Larysz

Figure 1. Upper Silesian Museum, Bytom, Poland (1940).

Figure 2. Hall of the Museum exhibiting mounted birds.

The Giant Butterfly-Moths (Lepidoptera Castniidae) of the Upper Silesian Museum in Bytom, Poland

221

1995). The first curator of the Department was Hu-

bert Emanuel Kotzias (1892-1941) (Fig. 3).

In October 1939, slightly over a month after the

German invasion, the Silesian Museum in Katowice

(which was in the Polish part of Silesia) was closed

and its entire collection was transported to Bytom’s

Museum and placed in storage. By 1943-1944 the

most valuable collections (including those from Ka-

towice) were moved to the western part of Upper

Silesia. As a result of the war, the activities of So-

viet war commissioner and looters, the Bytom’s

Museum building was damaged and the remains of

the collection were destroyed and dispersed. During

the stressful times of the World War II the curator

of the Natural History Department was the widely

recognized entomologist Sergiusz Toll (1893-1961)

(Reisser, 1962) (Fig. 4).

By March 1945, a group of people that were

members of the staff of the Silesian Museum helped

rescue and recover parts of the Katowice and By-

tom’s collections. These collections became the

basis for the reactivation of the museum in Bytom,

aiming to continue pre-war Museum traditions esta-

blished at the Silesian Museum. On May 10th,

1 946, the Museum of Silesia in Bytom opened its

first post-war exhibition which was devoted to the

Silesian uprisings. Permanent exhibitions dedicated

to natural, archaeological, and ethnographic issues

and a Polish art gallery opened to the public later in

1946 and in 1947. By this time, the museum had the

following departments: Archaeology, Ethnography,

History, History and Culture of Fviv, Nature and

Art. A library was also established, and it hosts

today over 50,000 volumes.

The Natural History Department inventory re-

vealed the presence of 54,320 objects by that time.

Included were also nature collections owned by

the museum but hosted in the cities of Gliwice,

Chorzow, Cieszyn and Pszczyna. Those, which

were also called “abandoned property” of the De-

partment of Natural History, included insect col-

lections assembled by both the renowned

coleopterologist Theodor Franz Wilhelm Kirsch

(1818-1889) (Anonymous, 1889; Kraatz, 1889)

and the entomologist Hans Nowotny (1897-1971).

Witold Niesiolowski (1866-1954), a retired mili-

tary man but knowledgeable amateur who volun-

teered as an entomologist after retirement from the

Austrian Army, was then in charge of the Depart-

ment (Feliksiak, 1987).

3 4

Figure 3 . Hubert Emanuel Kotzias ( 1 892- 1941), first curator

of the Natural History Department.

Figure 4. Sergiusz Toll (1893-1961), curator of the Natural

History Department during the World War II years.

Today, the Natural History Department has

one of Poland’s largest natural sciences collec-

tions, with 700,000 insects and about 150,000 only

in the order Fepidoptera. The entire nature collec-

tion was created after those taken from the Ober-

schlesisches Fandesmuseum, the former Silesian

Museum. These collections document the flora

and fauna of Silesia and other regions of Poland

and worldwide. The entomological (mainly butter-

flies and moths, beetles, dragonflies, wasps, lace-

wings) and the ornithological (bird dermoplasties,

nests, eggs) collections are the most valuable and

largest at the Bytom’s museum today. Noteworthy

are also the collections of mammals, arachnids,

mollusks and the more than 12,000 herbarium

sheets of vascular plants.

The Bytom’s collection of Castniidae is a part

of the newly created entomological collection of the

Museum, which gathered specimens from different

collections. After a detailed investigation of the ar-

chives of the museum we found a total of 20 speci-

mens belonging to 14 species and 17 taxa of Giant

Butterfly-moths (Figs. 5-16). However, we could

not find any information on how they were ob-

tained. Even though all pre-war archives were de-

stroyed during the war, we are certain that all

specimens were probably bought during pre-war

times, after the German Occupation of Poland, as

evidenced by the labels written in German. Fortu-

nately enough, the specimens have been maintained

well and are in very good to excellent condition.

222

J.M. GonzAlez, P. Domagala & A. Larysz

ANNOTATED LIST OF CASTNIIDAE OF

THE UPPER SILESIAN MUSEUM SPECI-

MENS

Eupalamides cyparissias amazonensis

(Houlbert, 1917)

This crepuscular species is known as pest of se-

veral Palms (Arecaceae) including some crops (i.e.

Coccos nucifera L., Elaeis guineensis L.), and it is

distributed along the Amazon basin, in Northern

Brazil, Colombia and Peru (Houlbert, 1917; Miller,

1986; Gonzalez et al., 2010; Hemandez-Baz at al.,

2012). The Bytom’s specimen is in very good con-

dition, except for a light damage in its left hind

wing (Fig. 1) which was repaired by using a piece

of wing from an unknown Lepidoptera.

Examined material. 1 male, Iquitos, Omaguas,

150 m. [Peru], 360, Castnia daedalus Am, 5959/

3286, coll. Upper Silesian Museum (USMB)

Bytom, Poland.

Amauta cacica angusta (Druce, 1907) (Fig. 7)

Described originally from Ecuador (as Castnia

angusta ), not much is known about this subspecies

(Druce, 1907; Miller & Sourakov, 2009). Larvae of

this subspecies are associated with Heliconia (He-

liconiaceae) and Musa (Musaceae) plants in Ecua-

dor (Suarez-Capello et al., 2002; Miller &

Sourakov, 2009).

Examined material. 1 male, Macas, Ecuador

or., 359, Castnia angusta Am, 5959/ 32960, coll.

Upper Silesian Museum (USMB) Bytom, Poland.

Amauta cacica procera (Boisduval, [1875])

(Fig. 5)

This large species is distributed from Guate-

mala to Panama, but very few specimens with ade-

quate data are known from museum collections

(Miller, 1986; Gonzalez & Stunning, 2007; Miller

& Sourakov, 2009; Gonzalez & Hernandez-Baz,

2012). This subspecies has been observed feeding

on flowers of Heliconia pogonantha Cuf. (Helico-

niaceae), which is also a possible larval hostplant

(Miller & Sourakov, 2009).

Examined material. 1 male, Chiriqui, Panama,

358, Castnia cacica Am., 5959/ 32176, coll. Upper

Silesian Museum (USMB) Bytom, Poland.

Amauta papilionaris velutina (Houlbert, 1917)

This beautiful subspecies, was originally descri-

bed (as Castnia velutina) based on a female from

Ecuador (Houbert, 1917). It has only subtle diffe-

rences from the nominate species which is of Co-

lombian distribution (Miller, 1986). It has been

suggested that all four supposed subspecies of A.

papilionaris could be nothing more than simple se-

xual dimorphisms or local geographic variations

(Miller, 1986).

Examined material. 1 male, Riobamba, Ecua-

dor, 2000 m., 357, Castnia papilionaris Am, 5959/

32763, coll. Upper Silesian Museum (USMB)

Bytom, Poland.

Hista fabricii (Swainson, 1823) (Figs. 8, 9)

This species used to be considered as two to four

different ones by some authors, while others consi-

dered it to have several subspecies (Dalla Torre,

1913; Houlbert, 1918; Lamas, 1995; Miller, 1995).

Those treatments where mainly based on simple in-

trapopulational variations but its real status has been

clarified and the species is actually considered mo-

notypic (Moraes et al., 2010). The scarcity of col-

lection information is likely one of primary factors

limiting our understanding of the morphological-

geographical variations of the species (Moraes et

al., 2010). It was, however, interesting to find that

both sexes of the species collected from the same

region are in Bytom’s Museum collection.

Examined material. 1 male, Brasilien, Santa

Catharina, Timbo-Blumenau, 400 m., 347, Dez.-Ja-

nuar., Castnia boisduvali Am, 5959/32823, coll.

Upper Silesian Museum (USMB) Bytom, Poland;

1 male, Brasil, Castuia[ sic] basckei[ sic] leg.,

5959/30745, coll. Upper Silesian Museum (USMB)

Bytom, Poland [beheaded specimen]; 1 female,

idem, 5959/32869, coll. Upper Silesian Museum

(USMB) Bytom, Poland.

Imara pallasia (Eschscholtz, 1821) (Fig. 10)

This species is restricted to South-Eastern Brasil

(Miller, 1986; Gonzalez & Stunning, 2007; Gonza-

lez et al., 2010). It is a species found within the

cloud forests ecosystem (Miller, 1986). Unfortu-

nately not much more is known about the ecology

and biology of this species.

The Giant Butterfly-Moths (Lepidoptera Castniidae) of the Upper Silesian Museum in Bytom, Poland

223

Figures 5-16. Castniidae of the Upper Silesian Museum, Bytom, Poland. Fig. 5: Amauta cacica procera, Chiriqui,

Panama. Fig. 6: Geyeria hubneri, Santa Catharina, Brasil. Fig. 7: Amauta cacica angusta, Macas, Ecuador. Fig. 8:

Hista fabricii male, Brasil. Fig. 9: Hista fabricii female, Brasil. Fig. 10: Imam pallasia, Rio de Janeiro, Brasil. Fig.

11: Castnia invaria volitans, Magdalena, Colombia. Fig. 12: Prometheus cochrus, Riobamba, Ecuador. Fig. 13:

Divana diva diva , St. Laurent, French Guiana (?). Fig. 14: Telchin licus magdalena, Caqueta, Colombia. Fig. 15: Ga-

zera heliconioides, Amazonas, Brasil. Fig. 16: Xanthocastnia evalthe evalthoides, Riobamba, Ecuador. Scale: 10 mm.

224

J.M. GonzAlez, P. Domagala & A. Larysz

Examined material. 1 female, Rio [de] Ja-

neiro, [Brasil], 361, Castnia umbratula Am,

5959/32535, coll. Upper Silesian Museum

(USMB) Bytom, Poland.

Imara satrapes (Kollar, 1839)

This beautiful species is sympatric with the

above mentioned I. pallasia and it is commonly

found in the southeastern region of Brazil. The

fore wing patterns of both species are very different,

but the hindwing markings are highly variable in

I. satrapes and in some specimens they might re-

semble those of I. pallasia (Gonzalez & Stunning,

2007; Rios & Gonzalez, 2011). Its larvae are bo-

rers of Bromeliaceae (Biezanko, 1961a,b; Miller,

1986; Rios & Gonzalez, 2011). The Bytom’s spe-

cimen was originally collected and determined by

the Polish Entomologist Czeslaw Marian Biezanko

(1895-1986). Biezanco (1961a,b) mentions that the

species is common in Pelotas, Brasil, and that it

flies in December and January, from 1 1 :00 to 1 5:00

along wood clearings. He also named the “form”

found in Pelotas as “ Castnia satrapes catharina ”

(Biezanko, 1961a,b) (=Imara satrapes catharina ),

which is now synonymized under I. satrapes (see

Rios & Gonzalez, 2011).

Examined material. 1 male, Pelotas [Rio

Grande do Sul, Brasil], 23.1.[19]52, C. Biezanko

leg.; Castnia satrapes Kollar, 1839, C. Biezanko

det., 5959/31825, coll. Upper Silesian Museum

(USMB) Bytom, Poland.

Castnia invaria volitans Lamas, 1995 (Fig. 11)

A subspecies commonly found in northern re-

gions of South America, north of the Amazon, and

along the Orinoco River basin, from Colombia,

through Venezuela and east to the Guianas (Gon-

zalez & Stunning, 2007; Gonzalez et al., 2010).

This singular specimen clearly confirms the pre-

sence of the species in Colombia, however several

specimens belonging to this ssp. are known from

the country (J. Salazar, pers. comm.).

Examined material. 1 female, Rio Magda-

lena, Aipe, Columbien, 600 m, Castnia icarus Am,

Castnia icarus Brm female, 5959/32625, coll.

Upper Silesian Museum (USMB) Bytom, Poland.

Telchin licus (Drury, 1773)

The species T. licus (Drury, 1773) is one of the

most common Castniidae found in Lepidoptera col-

lections worldwide, mainly because it is a pest of

Sugarcane ( Saccharum officinarum L., Poaceae),

bananas ( Musa spp., Musaceae) and heliconias (He-

liconiaceae) (Gonzalez & Cock, 2004; Gonzalez

&FemandezYepez, 1993; Gonzalez & Stunning,

2007; Gonzalez et al., 2010; Miller, 1987;Moraes &

Duarte, 2009; Silva-Brandao et al., 2013). The taxo-

nomy of the several associated subspecies is confu-

sing since many specific and subspecific epithets

have been proposed based sometimes in simple va-

riations of wing color patterns (Miller, 1986; Gon-

zalez & Stunning, 2007). Lamas (1995) would

consider this as the ssp. T. licus licoidella (Strand,

1913). However, Silva-Brandao et al. (2013) studied

several specimens from different regions of Brazil,

and found that T. licus albomaculata (Houlbert,

1917) genetically corresponds well with those in the

Amazon region including the Peruvian Amazon,

where this specimen comes from. Could the suppo-

sed ssp. “ licoidella ” remain valid after a genetic

comparison? Since specimens with these phenotypic

characters have been found with more typical

“licus” populations (Miller, 1986, 1995; Gonzalez

& Cock, 2004) we prefer to follow Gonzalez &

Stunning, ’s (2007) approach and not include the By-

tom’s specimen in any other subspecies herein.

Examined material. 1 male, Ob. Hualaga, N.

Peru, Castnia licoidella Am, Castn. Licoidella 80

Pfg., 5959/32911, coll. Upper Silesian Museum

(USMB) Bytom, Poland.

Telchin licus magdalena (Joicey et Talbot, 1925)

(Fig. 14)

This subspecies was originally described by

Joicey & Talbot (1925) based on a large series of

male and female specimens originally collected

in Villavicencio, Colombia. However, it appears

that the subspecies has a wider distribution in the

country (Julian Salazar, pers. comm.). Other than

the fact that this ssp. might be a pest of sugarcane

in the region where it occurs, not much else is

known (Julian Salazar, pers. comm.).

Examined material. 1 female, Castnia licus,

MottaTeff. Caqueta, Columbia[sic], 5959/34325,

coll. Upper Silesian Museum (USMB) Bytom,

Poland.

The Giant Butterfly-Moths (Lepidoptera Castniidae) of the Upper Silesian Museum in Bytom, Poland

225

Xanthocastnia evalthe evalthoides (Strand, 1913)

(Fig. 16)

This subspecies was described from Bolivia (as

Castnia evalthoides ) by Strand (1913). However,

specimens have been collected in the high Amazon

and effluents from the Andes piedmonts in several

localities from Bolivia, Brazil, Ecuador and Peru

(Houlbert, 1918). Even though not much is known

about the species and its supposed several subspe-

cies it appears that their larvae feed on terrestrial

Bromeliaceae (Miller, 1986).

Examined material. 1 male, Riobamba, Ecua-

dor, 2000 m., Castnia evalthoides Am, 5959/33092,

coll. Upper Silesian Museum (USMB) Bytom, Po-

land.

Geyeria hubneri (Gray, 1838) (Fig. 6)

Some researchers still mention “Latreille, 1830”

as author of this species (Miller, 1986, 1995), based

on text and image presented by Pierre Andre La-

treille in Cuvier (1830). However, Lamas (1995)

has clearly stated that “ Castnia hubneri Latreille,

1830” should be considered a ghost name since the

name “ Castnia hubneri ” was first made available

by Gray (1838). Virtually nothing is known of this

species, except that they are found in some areas of

South East Brasil (Gray, 1838; Bucheker, [1880];

Miller, 1986; Gonzalez et al., 2010).

Examined material. 1 female, Brasilien, Santa

Catharina, Timbo-Blumenau, 400 m. Dez.-Januar,

630, Castnia sp. Am, 5959/32375, coll. Upper Si-

lesian Museum (USMB) Bytom, Poland.

Prometheus cochrus (Fabricius, 1787) (Fig. 12)

This species is also distributed throughout Sou-

theast Brazil (Gonzalez et al., 2010). It resembles

Parides ascanius (Papilionidae) behaviorally, and

they both might be copying some other model and

be all part of a larger mimetic ring (Miller, 1986).

Its larvae have been found feeding on Bromelia an-

tiacantha Bertol, and Tillandsia aeranthos (Loisel)

L.B. Smith, as well as other bromeliads (Brome-

liaceae) (Biezanko, 1961a; Miller, 1986; Gonzalez

et al., 2010).

Examined material. 1 female, C. garbei Fott.

female Brasil. Collection Niepelt, 5959/31706, coll.

Upper Silesian Museum (USMB) Bytom, Poland

[this is very interesting specimen. It appears that it

was collected by Jose G. Foetterle (18??- 1929), a

well-known lepidopterist from Brasil. The speci-

men was traded with Friedrich Wilhelm Niepelt

(1862-1936) who placed it in his collection. Since

most of Niepelt’s collection was scattered to seve-

ral European Museums during and after WWII it

is not surprising that this particular specimen

ended up in Bytom’s]; 1 female, Riobamba, Ecua-

dor, 2000 m., 364, Castnia garbei Am, Castnia

garbei female, 5959/32306, coll. Upper Silesian

Museum (USMB) Bytom, Poland.

Divana diva diva (Butler, 1870) (Fig. 13)

The unusual wing maculation and coloration of

the species and its ssp., makes them one of the most

beautiful Castniidae. Even though not much is

known about the species, collection records seem

to indicate that the genus is bivoltine, with crepu-

scular flight periods during December- January and

July- August (Miller, 1986). This polytypic species

is distributed from Mexico, throughout Central

America, and to Colombia and Ecuador (Lamas,

1995; Miller, 1995; Vinciguerra, 2010). Specimens

from the nominal ssp. have been collected in Co-

lombia and Ecuador (Vinciguerra, 2010). The spe-

cimen owned by the Bytom’s Museum is clearly

the ssp. diva, which is commonly found from Me-

xico to Ecuador (Vinciguerra, 2010). It is even

more curious that this specimen bears a label that

clearly states that it was collected in French

Guyana (see Material examined below). Beneluz

& Gallard (2012) report the presence of 19 taxa of

Castniidae in French Guyana after carefully stu-

dying several collections from the country. Howe-

ver, not a single specimen of D. diva is mentioned.

In addition, our (J.M.G.) revising of several

Castniidae collections worldwide has not revealed

evidence of any specimen of this species collected

in French Guyana. Curiously enough, Gonzalez et

al. (2010) report a specimen of D. diva (actually D.

diva chiriquiensis ) from Brazil at the Field Mu-

seum of Natural History, Chicago, Illinois, USA,

which was originally traded or exchanged by Her-

man Strecker with Otto Staudinger. Since the ssp.

chiriquiensis is Colombian-Panamanian in distri-

bution (Strand, 1913; Salazar, 1999; Vinciguerra,

226

J.M. GonzAlez, P. Domagala & A. Larysz

2010) , the authors suspected that the specimen was

mislabeled (Gonzalez et al., 2010). Could it be that

this supposedly French-Guy anan specimen of D.

diva diva was also mislabeled?

Examined material. 1 male, St. Laurent, Ma-

roni Fluff Franz Guayana, 300 m, Januar-Marz,

Castnia diva Am., 5959/32944, coll. Upper Silesian

Museum (USMB) Bytom, Poland.

Divana diva tricolor (Felder, 1874)

As with all subspecies in the group, not much

is known of its biology and ecology. Even though

Felder (1874) reported (and illustrated) this sub-

species from specimens collected in Bogota and

Chiriqui, it is more commonly found in the central

regions of Colombia (Houlbert, 1918; Salazar,

1999; Vinciguerra, 2010).

Examined material. 1 male, Cartago, Caucatal,

[Cauca Valley], Columbien, 600 m, Castnia diva

Am, 5959/33094, coll. Upper Silesian Museum

(USMB) Bytom, Poland.

Gazera heliconioides Flerrich- Schaffer, [1853]

(Fig. 15)

Members of this genus are easily recognized by

a coloration pattern that resembles the genera Ly-

corea (Nymphalidae Danaidae) and Thyridia and

Methona (Nymphalidae Ithominae), as well as the

species Notophyson heliconides (Erebidae Arctii-

nae), and their interactions and possible mimetic

significance have been studied (Lamas, 1973; Mil-

ler, 1986; Contreras, 2009; Rios & Gonzalez,

2011) . The genus appears to be bivoltine, espe-

cially in the Amazon Basin (Miller, 1986). Several

subspecies have been described from various re-

gions in South America, from Venezuela and Co-

lombia, southward to Bolivia, Paraguay and

Southern Brazil (Miller, 1986; Contreras, 2009;

Rios & Gonzalez, 2011). Even though their host is

not known, suspect abounds about the possibility

that its larvae feed on Bromeliaceae (Contreras

2009; Rios & Gonzalez, 2011).

Examined material. 1 female, Manacapuru,

Amazonenstrom, [Brasil], 39 m. Febr - Marz, 316,

heliconoides [sic]?, Castnia heliconoides [sic] Am,

5959/32191, coll. Upper Silesian Museum (USMB)

Bytom, Poland.

Paysandisia arch on (Burmeister, 1918)

This species was originally restricted to nor-

thern Argentina, South East Brasil, western Uru-

guay and Paraguay, but it was introduced in

Europe sometime between 1985 and 1995 where it

is now considered an important pest of ornamental

palms (Arecaceae) (Aguilar et al., 2001; Sarto I

Monteys, 2002; Gonzalez & Stunning, 2007; Rios

& Gonzalez, 2011).

Examined material. 1 female, Kongo, 1952, T.

Spalstenstein, Coll. Tadeusz Spaltenstein. [The lo-

cality appears to refer to the Republic of the Congo

(Kongo in German) in central Africa. Paysandisia

archon was introduced in Europe sometime bet-

ween the mid 80’s and mid 90’s (Aguilar et al.,

2001) and as far as we know there are no reports of

the species in any African country. We assume that

the specimen was mislabeled.]

ACKNOWLEDGEMENTS

We are greatly indebted to John T. Bushoven

(California State University, Fresno, USA), Julian

Salazar (Museo de Historia Natural Universidad de

Caldas, Colombia) and Roberto Vinciguerra (Pa-

lermo, Italy) for their insightful comments and ad-

ditions that help us improve the original manuscript.

REFERENCES

Aguilar L., Miller J.Y., & Sarto I Monteys, V., 2001. A

new Lepidopteran family for the European fauna.

SHILAP Revista de Lepidopterologia, 29: 86-88.

Anonymous, 1889. [Kirsch, Th. F. W.]. Entomology

Monthly Magazine, (3)25: 402.

Beneluz F. & Gallard J.-Y., 2012. Les Castniidae de

Guyane Frangaise (Lepidoptera: Castniidae). In: La-

comme D. & Manil L. (Eds.). Lepidopteres de

Guyane - Tome 6: Castniidae, Erebidae (Letis), Sa-

turniidae (Eacles), pp. 14-38.

Biezanko C.M., 1961a. Castniidae, Zygaenidae, Dalce-

ridae, Eucleidae, Megalopygidae, Cossidae et Hepia-

lidae da Zona Sueste do Rio Grande do Sul.

Archivosde Entomologia da Escola de Agronomia

“Eliseu Maciel” (Pelotas) (A), 14: 1-13.

Biezanko C.M., 1961b. Castniidae, Zygaenidae, Dalce-

ridae, Eucleidae, Megalopygidae, Cossidae et Hepia-

lidae da Zona Sueste do Rio Grande do Sul.

The Giant Butterfly-Moths (Lepidoptera Castniidae) of the Upper Silesian Museum in Bytom, Poland

227

Archivosde Entomologia da Escola de Agronomia

“Eliseu Maciel” (Pelotas) (B), 14: 1-12.

Bucheker H., [1880]. Systema entomologiae sistens in-

sectorum Classes, Genera, Species. Pars 6: 2+ 30 pis.

Munchen, Author.

Cempulik P. & Hadas, T.B., 1995. Eberhard Drescher.

Przyrodnik i kolekcjoner. Przyroda Gomego SI ask a,

1: 11.

Contreras A. O., 2009. Registros de Gazera heliconioides

micha (Druce, 1 896) (Lepidoptera: Castniidae) en la

Ecoregion del Neembucu, Paraguay. Azariana, 1:18-

22 .

Cuvier [G.], 1830. Le Regne Animal Distribue D’Apres

son Organisation pour servir de base a L’Histoire na-

turelle des Animaux et D’ Introduction a L’Anatomie

Comparee. Nouvelle Edition, Revue et Augmentee.

Tome III. Paris: Chez D’eterville, Libraire, 504 pp.

Dalla Torre K.W., 1913. Castniidae: subfam. Castniinae,

Neocastniinae, Pemphigostolinae. Lepidopteroram

Catalogus, 15: 1-28.

Druce H., 1907. Descriptions of five new species of He-

terocera. Annals and Magazine of Natural History,

20: 505-506.

Felder C., 1874. Reise der osterreichischen Fregatte No-

vara um die Erde in den Jahren 1857, 1858, 1859

unter den Befehlen des Commodore B. von Wiiller-

storf-Urbair. Zoologischer Theil. Zweiter Band.

Zweite Abtheilung: Lepidoptera: 4: 1-10. pis. 75-107.

Wien: C. Gerald’s Sohn.

Feliksiak S., 1987. Witold Niesiolowski. Slownik Biolo-

gow Polskich. Warszawa: Panstwowe Wydawn,

Nauk, 390 pp.

Gonzalez J.M., Boone J.H., Brilmyer G.M. & Le D.,

2010. The Giant Butterfly-moths of the Field Mu-

seum of Natural History, Chicago, with notes on the

Herman Strecker Collection (Lepidoptera: Castnii-

dae). SHILAP Revista de Lepidopterologia, 38:

385-409.

Gonzalez J.M. & Cock M.J.W., 2004. A synopsis of the

Castniidae (Lepidoptera) of Trinidad and Tobago,

Zootaxa, 762: 1-19.

Gonzalez J.M. & Hemandez-Baz. 2012. Polillas y tala-

dradores gigantes de la familia Castniidae (Lepidop-

tera) de Guatemala. In: Cano E.B. & Schuster J.C.

(Eds.). Biodiversidad de Guatemala, Volumen 2.

Guatemala: Universidad del Valle de Guatemala, pp.

145-153.

Gonzalez J.M. & Fernandez Yepez F., 1993. Lista pre-

liminar de las especies de Castniinae (lepidoptera:

Castniidae) del Parque Nacional “Henri Pittier”,

Venezuela. Diagnosis y comentarios. Memorias de

la Sociedad de Ciencias Naturales La Salle, 53:

47-53.

Gonzalez J.M. & Stunning D., 2007. The Castniinae at

the Zoologisches Forschungsmuseum Alexander

Koenig, Bonn (Lepidoptera: Castniidae). Entomolo-

gische Zeitschrift, 117: 89-93.

Gray G.R., 1838. Synopsis of the species belonging to

the genus Castnia. Transactions of the Entomological

Society of London, 2: 140-149.

Houlbert C., 1917. Diagnoses de Castnies nouvelles et

rectification de quelques noms indumenta employes.

Etudes de Lepidopterologie Comparee, 13: 49-87.

Houlbert C., 1918. Revision monographique de la sous-

famille des Castniinae. Etudes de Lepidopterologie

Comparee, 15: 1-730.

Joicey J.J. & Talbot G., 1925. Notes on some Lepidop-

tera, with descriptions of new forms. Annals and Ma-

gazine of Natural History, (9)16(96): 633-653.

Kraatz G., 1889. [Kirsch, Th. F. W.]. Deutsches Entomo-

logische Zeitschrift, 4: 8.

Lamas G., 1973. Taxonomia e Evolucao dos generos Ituna,

Doubleday (Danainae) e Paititia , gen. n., Thyridia

Hubner e Methona Doubleday (Ithominae). Ph.D. the-

sis. Universidade de Sao Paulo, Brazil. 225 pp.

Lamas G., 1995. A critical review of J. Y. Miller’s chec-

klist of the Neotropical Castniidae (Lepidoptera). Re-

vista Peruana de Entomologia, 37: 73-87.

Miller J.Y., 1986. The Taxonomy, Phylogeny, and Zoo-

geography of the Neotropical Castniinae (Lepidop-

tera: Castnioidea: Castniidae), Ph.D. Thesis.

University of Florida, Gainesville. 571 pp.

Miller J.Y., 1987. Castniidae (Castnioidea). In: Stehr F.

W. (Ed.), Immature Insects. Dubuque, Iowa: Ken-

dall/Hunt Publishing Company, pp. 417-419

Miller J.Y., 1995.- Castnioidea: Castniidae: Castniinae:

In: Heppner J.B. (Ed.). Checklist: part 2. Hyblaeoi-

dea-Pyraloidea-Tortricoidea. Atlas of Neotropical Le-

pidoptera.- Gainesville, Florida: Association for

Tropical Lepidoptera and Scientific Publishers, pp.

133-137.

Miller J.Y. & Sourakov A., 2009. Scientific note: some

observations on Amauta cacica procera (Boisduval)

(Castniidae: Castniinae) in Costa Rica. Tropical Le-

pidoptera Research, 19: 113-114.

Moraes S.S. & Duarte M., 2009. Morfologia externa

comparada das tres especies do complexo Telchin

liens (Drury) (Lepidoptera, Castniidae) com uma si-

nonimia. Revista Brasileira de Entomologia, 53: 245-

265.

Moraes S.S., Duarte M. & Gonzalez J.M., 2010. Revision

of Hista Oiticica (Lepidoptera: Castniidae) and di-

scusion on the validity of its subspecies. Zootaxa,

2421: 1-27.

Reisser H., 1962. Dr. Sergiusz (Graf von) Toll. Zeitschrift

Wiener Entomologische Gesselschaft, 47: 79-85.

Rios S.D. & Gonzalez J.M., 2011. A synopsis of the Ca-

stniidae (Lepidoptera) of Paraguay. Zootaxa, 3055:

43-61.

228

J.M. GonzAlez, P. Domagala & A. Larysz

Salazar J.A., 1999. Datos de recoleccion para 16 especies

de castnidos colombianos (Lepidoptera: Castniidae).

Boletln Cientlfico del Museo de Historia Natural,

Universidad de Caldas, Manizales, 3: 43-51.

Sarto i Monteys, V., 2002. The discovery, description

and taxonomy of Paysandisia archon (Burmeister,

1880), a castniid species recently found in south-we-

stern Europe (Castniidae). Nota Lepidopterologica,

25: 3-15.

Silva-Brandao K.L., Almeida L.C., Moraes S.S. & Con-

soli F.L., 2013. Using population genetic methods to

identify the origin of an invasive population and to

diagnose cryptic subspecies of Telchinlicus (Lepidop-

tera: Castniidae). Bulletin of Entomological Rese-

arch, 103: 89-97.

Strand E., 1913. Gattung: Castnia F. In: Seitz A. (Ed.).

Die Gross-Schmetterlinge der Erde, 6: 7-17. A. Ker-

nen, Stuttgart.

Suarez-Capello C., Belezaca C., Flowers W., Echeverria F.,

Carroll R.R., Williams R., Ellis M., Norton G., Alwang

J. & Justicia., 2002. IPM for plantain/coffee agro fore-

stry system in northwestern Ecuador: a land use

alternative to low-quality pasture within a

fragile agro-ecosystem. The Integrated Pest manage-

ment Collaborative Research Support Program

(IPM CRSP). Ninth Annual Report, 2002.

http://www.oired.vt.edu/ipmcrsp/Publications/An-

nualReports/2002/Ecuador/ecuador topic 1 5 .pdf

Vinciguerra R., 2010. Observazioni sulla distribuzione di

Divana diva hoppi (Hering, 1923) (Lepidoptera: Ca-

stniidae). SHILAP Revista de Lepidopterologia, 38:

379-383.

Biodiversity Journal, 2013, 4 (1): 229-234

Gastrointestinal helminths in the local chicken Gallus gallus

domesticus (Linnaeus, 1 758) in traditional breeding of North-

Western Algeria

FouziaYousfi, Kheira Senouci*, llyes Medjoual, Hanene Djellil &Touria Hadj Slimane

Department of Biology, Faculty of Sciences, University of Oran, Algeria

’Corresponding author, email: kheirasenouci@yahoo.fr

ABSTRACT This study was aimed to identify the gastrointestinal helminths of local chicken, Gallus gallus

domesticus (Linnaeus, 1758), in traditional breeding of North-Western Algeria and to deter-

mine their prevalence and average abundance. For this purpose, 114 local chickens were ex-

amined between November 2010 and May 2012. The results show an overall prevalence of

100%, with a mean intensity of infection of 124 parasites per chicken. The birds were infected

whatever the sex, weight and season. The parasitic fauna was composed of four taxonomic

groups with prevalence significantly different (P<0.05): cestodes (95.61%), nematodes

(93.86%), trematodes (18.42%) and acanthocephalan (1.75%). The most prevalent cestode

species encountered were: Raillietina echinobothrida (85.09%), R. cesticillus (30.70%) and

Hymenolepis carioca (28.95%). The predominant nematode species were Heterakis gallina-

rum (78.07%), Subulura brumpti (62.28%), Ascaridia galli (39.47%) and Capillaria cau-

dinflata (35.96%). The trematode species recorded were Postharmostomum gallinum

(18.42%) and Brachylaema sp. (2.63%). Finally, only one acanthocephalan, Prosthorhynchus

sp. (1.75%), was found. Among these helminths, the highest average abundance occurred

with Heterakis gallinarum (39.04) and Subulura brumpti (35.88). This study revealed the im-

portance of helminthic parasitism in traditional breeding of NW Algeria, and the need to use

preventive and therapeutic measures for a better profitability of poultry algerian production.

KEY WORDS Chicken; digestive tract; helminths; North-Western Algeria; traditional breeding.

Received 03.01.2013; accepted 09.03.2013; printed 30.03.2013

INTRODUCTION

In Africa, 80% of chicken populations are raised

under the extensive system (Gueye, 1998; 2001).

This is based on a traditional undemanding mode

of exploitation and it is considered as an important

source of protein and income for rural communities.

However, in this type of production system the

chickens are with higher risk of infection by a wide

variety of parasites. Helminth parasites are a major

cause of the decline in poultry productivity (delay

of growth, reduced egg production, death of young

birds). The recording of gastrointestinal hel min thes

was reported in several studies conducted on back-

yard poultry from different regions of Africa (Sse-

nyonga, 1982; Fatihu et al., 1991; Poulsen et al.,

2000; Hassouni & Belghyti, 2006; Phiri et al., 2007;

Mungube et al., 2008).

In Algeria, there is insufficient information on

parasitism in chickens although their exploitation

under various systems of breeding prevails on that

of the other poultries. According to OFIAAL

230

F. Yousfi, K. Senouci, I. Medjoual, H. Djellil &T. Hadj Slimane

(2011), 29,316 exploitations of broilers and laying

breeding reproducers were inventoried against

150,000 exploitations of domestic chicken under

the extensive system. The aim of this study was to

evaluate the prevalence and average abundance of

helminths identified in the digestive tract of chick-

ens raised under traditional system.

MATERIALS AND METHODS

This study was done on 1 14 adult local chickens

from eight communes in the area of Oran. This re-

gion, located in the North-West of Algeria, is cha-

racterized by a Mediterranean climate with warm

winter and long hot summer. The mean annual mi-

nimum and maximum temperature is 12°C and

22°C, respectively and the annual rainfall is of

about 420 mm.

The sampling was carried out monthly (from

November 2010 to May 2012) and was random be-

cause no parameters (i.e. age and/or sex) were taken

into account. The chickens were bought from farms

in which the traditional breeding is practiced. They

were of both sexes and their weight ranged from

0.516 to 2.250 kg.

The birds were slaughtered and post-mortem

examination was performed immediately. The di-

gestive tract was removed from the abdominal

cavity and different portions (esophagus, crop, pro-

ventriculus, gizzard, small intestine and caecum)

were opened separately and longitudinally, then

rinsed with physiological saline. Mucosa and con-

tents of these fragments were placed in Petri dishes

containing water. They were then examined under

a binocular magnifying glass with a black bottom

for the search of adult helminth parasites. The col-

lected worms were counted, fixed and stored in

70°ethanol.

Segments of cestodes (tapeworms) and trema-

todes (flatworms) were stained with aceto car-

mine, dehydrated and mounted in Canada balsam.

The scolex of cestodes and acanthocephala (spiny-

headed worms) were cleared and mounted in Ho-

yer's fluid. Nematodes (roundworms) were cleared

in lacto phenol and mounted in glycerin. All worms

were observed under a light microscope (with 40-

100x magnification) and identified using the char-

acters described by Euzeby (1961; 1963; 1966),

Yamaguti (1963) and Gibson et al. (2002).

Comparative analysis of prevalence and average

abundance of collected helminths in chickens and

their distribution in the digestive tract, was perfor-

med using the Kruskal-Wallis test (XLSTAT soft-

ware. 3.1. 2012). A P-value <0.05 was considered

statistically significative.

RESULTS

The present study revealed that all the examined

chickens (100%) were infected with gastrointestinal

helminths. The birds were infected by at least two

species of helminths whatever the sex, weight and

season. Multiple infections associated 4 or more

species in 90.27% of cases. The mean intensity of in-

fection was 124 worms per chicken. The collected

helminths and their prevalence were: cestodes

(95.61%), nematodes (93.86%), trematodes (18.42%)

and acanthocephalan (1 .75%). The difference in these

prevalence rates was significant (P<0.05). A total of

7 cestode species, 8 nematode species, 2 trematode

species and one acanthocephalan species were iden-

tified (Table 1).

The dominant helminth group was cestodes, of

the 114 examined chickens, 109 (95.61%) were

found to harbor diverse species. The most prevalent

species was Raillietina echinobothrida (85.09%)

followed by R. cesticillus (30.70%) and by Hyme-

nolepis carioca (28.95). The least common were

Raillietina tetragona (21.93%) and Choanotaenia

infundibulum (20.17%). Others species, Davainea

proglottina (7.89%) and Amoebotaenia cuneata

(0.88%) were the least frequently recorded (Fig. 1)

The highest average abundance was seen in

Raillietina echinobothrida (8.24) and the lowest

average abundance was noted in Amoebotaenia cu-

neata (0.04) (Fig. 1). The nematodes were iden-

tified in 107 (93.86%) chickens, the most prevalent

species being Heterakis gallinarum (78.07%) and

Subulura brumpti (62.28%). Three species, Ascari-

diagalli (39.47%), Capillaria caudinflata (35.96%)

and Cheilospirura hamulosa (31.58%) were also

frequently identified followed by Capillaria annu-

lata (28.07%) and C. anatis (20.17%); Gongylo-

nema ingluvicola was rarely observed (0.88%) (Fig.

1). Among these species, Heterakis gallinarum

(39.04) and Subulura brumpti (35.88) were the

most abundant. Gongylonema ingluvicola was the

least average abundant species (0.02) (Fig. 1).

Gastrointestinal helminths in the local chicken Gallus gallus domesticus in traditional breeding of North-Western Algeria 23 1

Helminth species

Sites of

predilection

CESTODES

Raillietina echinobothrida

Megnin, 1881

Small intestine

Raillietina cesticillus Molin, 1858

Small intestine

Hymenolepis carioca Magalhaes, 1898

Small intestine

Raillietina tetragona Molin, 1885

Jejunum-ileum

Choanotaen ia in fun dibit l urn

Bloch, 1779

Small intestine

Davainea proglottina Davaine, 1860

Duodenum

Amoebotaenia cuneata Linstow, 1972

Duodenum

NEMATODES

Heterakis gallinarum Schrank, 1788

Caecum

Subulura brumpti Lopez-Neyra, 1922

Caecum

Ascaridia galli Schrank, 1788

Small intestine

Capillaria caudinflata Molin, 1858

Small intestine

Cheilospirura hamulosa Diesing, 1851

Gizzard

Capillaria annulata Molin, 1858

Esophagus-Crop

Capillaria anatis Schrank, 1790

Caecum

Gongylonema ingluvicola

Ransom, 1904

Esophagus-Crop

TREMATODES

Postharmostomum gallinum

Witenberg, 1923

Caecum

Brachylaema sp.

Jejunum

ACANTHOCEPHALAN

Prosthorhynchus sp.

Small intestine

Table 1. Sites of predilection of helminth species in the di-

gestive tract of chickens.

No statistically significant difference in hel min th

species prevalence was observed according to the

sex and the season.

Table 1 shows a heterogeneous dispersion (sig-

nificant P<0.05) of helminth species in relation to

their predilection sites. All segments of the dige-

stive tract examined, except for the pro ventriculus,

were parasitized. Worms were more often located

in the small intestine where the mixed helminth in-

fections were common. The most prevalent cestode

species, Raillietina echinobothrida and R. cesticil-

lus, occupied different parts of this organ. The most

common nematode species, Heterakis gallinarum

and Subulura brumpti, colonized the caecum.

DISCUSSION

This study indicated a high prevalence (100%)

of gastrointestinal helminths in local chickens in

traditional breeding in North-Western Algeria, sug-

gesting that domestic poultry kept under this type

of production system are strongly parasitized. High

prevalence of gastrointestinal helminths was al-

ready observed in free-range chickens from dif-

ferent African countries. The prevalence rate was

reported to be 100% in Tanzania (Magwisha et al.,

2002) and in Eastern Ghana (Poulsen et al., 2000).

These results are comparable with those of Sse-

nyonga (1982), Fatihu et al. (1991), Phiri et al.

(2007), Mungube et al. (2008) and Hassouni & Bel-

ghyti (2006). These authors reported 97% preva-

lence in Uganda, 95.7% in Nigeria, 95.2% in central

Zambia, 93.3% in Eastern Kenya and 89.9% in

Gharb-region of Morocco, respectively. These stud-

ies indicated also multiple infections with hel min th

parasites, which is in agreement with our observa-

tions.

The recording of high prevalence of gastroin-

testinal helminthes and multiple infections in the

present study might be attributed to environmental

conditions and traditional breeding which were suit-

able for infections. The chickens seek their food in

the soil and this one is frequently contaminated with

infective stages of parasites and living organisms

(earthworms, insects and mollusks) which serve as

intermediate hosts.

This work revealed also the richness of the

helminth fauna. The helminth species (eighteen)

identified were compared to those recorded by

232

F. Yousfi, K. Senouci, I. Medjoual, H. Djellil &T. Hadj Slimane

many authors such as Phiri et al. (2007), Ashenafi

& Eshetu (2004), Hassouni & Belghyti (2006) and

Mungube et al. (2008).

Seven species of cestodes were identified in this

study and the predominant species was Raillietina

echinobothrida with a markedly higher prevalence

(85.09%). This finding is comparable with 81%

prevalence observed in Eastern Ghana (Poulsen et

al., 2000) and 65.26% determined in central Ethio-

pia (Ashenafi & Eshetu, 2004). According to Has-

souni & Belghyti (2006), this prevalence was lower

(5.7%). In the study area, the environmental condi-

tions appear to be favorable for the survival of Rail-

lietina echinobothrida eggs and the development of

insects (Hymenoptera) which serve as an interme-

diate hosts for this parasite. The insects are very

spread in the ground and their contact with the chick-

ens is almost permanent. R. cesticillus was the sec-

ond most prevalent cestode recorded (30.70%) in

this work. In their studies, Ashenafi & Eshetu

(2004), and Hassouni & Belghyti (2006) indicated

a prevalence of 19% and 12% respectively. We rarely

found Davainea proglottina (7.89%) which is the

most pathogen cestode of chickens; Mungube et al.

(2008) observed it with a prevalence of 19.4%. On

the other hand, several other authors did not record

this parasite. The nematodes observed in this study

comprised eight species. The prevalence of Hetera-

kis gallinarum (78.07%) was the highest. This is in

agreement with previous observations although

with lower values, 39.62%, in North Gondar (Ethio-

pia) (Molla et al., 2012) and 32.8% in central Zam-

bia (Phiri et al., 2007). Another nematode species

detected with an important prevalence was Subulura

brumpti (62.28%); Ashenafi & Eshetu (2004) found

a comparable result (55.3%) in central Ethiopia.

Figure 1. Prevalence and average abundance of helminth species.

Gastrointestinal helminths in the local chicken Gallus gallus domesticus in traditional breeding of North-Western Algeria 233

The higher prevalence of these two nematode

species can be explained by the presence in the

study area, of favorable conditions (temperature,

hygrometric degree) for the development of Hete-

rakis gallinarum eggs and of insects (Coleoptera)

that may be an intermediate host for Subulura

brumpti. The prevalence of Gongylonema ingluvi-

cola (0.88%) was the lowest in this study. Whereas,

this species was found with a higher prevalence

(50%) by Phiri et al. (2007).

Trematodes detected during our study were Po-

stharmostomum gallinum (18.42%), identified in

Uganda by Ssenyonga (1982), and Brachylaima sp.

(2.63%). This one has a wide range of hosts in-

cluding birds and mammals (Cribb & O’ Callaghan,

1992). Poulsen et al. (2000) reported one unidenti-

fied trematode (1%). The only acanthocephalan

found, Prosthorhynchus sp. (1 .75%) occurred rarely

in examined chickens. The infection of the domestic

chicken and turkey by this acanthocephalan was

demonstrated experimentally (Schmidt & Olsen,

1964). According to Smales (2003) and Dimitrova

et al. (2000), Prosthorhynchus sp. occupies the in-

testines of many birds, especially that of Passerifor-

mes. According to studies conducted in Africa, the

trematodes and acanthocephalan were rarely ob-

served in the local chicken. This can be explained

by the complexity of their life cycle and inaccessi-

bility of intermediates hosts. Otherwise, the varia-

tions in prevalence of gastrointestinal helminths of

local chickens from different regions of Africa is in

relation to the geographic factors and climatic con-

ditions that influence the life cycle of worms.

CONCLUSIONS

This is the first study done in the North-West Al-

geria on helminthic parasitism of the digestive tract

in the local chickens kept under traditional breeding

system. The recording of high prevalence and mul-

tiple helminth infections highlighted in the present

study requires therapeutic measurements with the

adequate use of multi-purpose anti-helminthic treat-

ments. These latters need to be combined with pre-

ventive actions based on (i) assuring and

maintaining hygienic conditions of the buildings;

(ii) the improvement of nutrition quality and of

techniques of breeding; and (iii) a regular health

control. Chickens of local origin are generally resi-

stant to hostile conditions but various pathogens

and precisely parasites represent a major obstacle

for their development.

REFERENCES

Ashenafi H. & Eshetu Y., 2004. Study on gastrointestinal

helminths of local chickens in Central Ethiopia.

Revue Medecine Veterinaire, 155: 504-507.

Cribb T.H. & O’Callaghan M., 1992. An unusual trema-

tode infecting domestic chickens. Australian Veteri-

nary Journal, 69: 69-70.

Dimitrova Z., Georgiev B. & Genov T., 2000. Review of

the avian acanthocephalans from Bulgaria. Acta Zoo-

logica Bulgarica, 52: 3-22.

Euzeby J., 1961. Les maladies vermineuses des animaux

domestiques et leurs incidences sur la pathologie hu-

maine, Tome I, Maladies dues aux nemathelminthes,

fascicule 1. Edition Vigot Freres, Paris, 473 pp.

Euzeby J., 1963. Les maladies vermineuses des animaux

domestiques et leurs incidences sur la pathologie hu-

maine, Tome I, Maladies dues aux nemathelminthes,

fascicule 2. Edition Vigot Freres, Paris, 830 pp.

Euzeby J., 1966. Les maladies vermineuses des animaux

domestiques et leurs incidences sur la pathologie hu-

maine, Tome II, Maladies dues aux nemathelminthes,

fascicule 12. Edition Vigot Freres, Paris, 660 pp.

Fatihu M.Y., Ogbogu V.C., Njoku C.O. & Saror D.I.,

1991. Etudes comparatives des helminthes gastroin-

testinaux chez les poulets a Zaria, Nigeria. Revue

d’elevage et de Medecine Veterinaire des Pays Tro-

picaux, 44: 175-177.

Gibson D.I., Jones A. & Bray R.A., 2002. Keys to the

Trematoda, Vol. 1. CABI Publishing and The Natural

History Museum, Wallingford, 521 pp.

Gueye E.F., 1998. Village egg and fowl meat production

in Africa. World’s Poultry, Science Journal, 54: 73-

86 .

Gueye E. F., 2001. The role of family poultry in poverty

alleviation, food security and the promotion of gender

equality in rural Africa. Outlook on Agriculture, 29

(2000): 129-136.

Hassouni T. & Belghyti D., 2006. Distribution of gastroin-

testinal helminths in chicken farms in the Gharb re-

gion, Morocco. Parasitology Research, 99: 181-183.

Magwisha H.B., Kassuku A.A., Kyvsgaard N.C & Per-

min A., 2002. A comparison of the prevalence and

burdens of helminth infections in growers and adult

free-range chickens. Tropical Animal Health and Pro-

duction, 34: 205-214.

Molla W., Haile H., Almaw G. & Temesgen W., 2012.

Gastrointestinal helminths of local backyard chickens

in North Gondar Administrative Zone, Ethiopia.

Revue Medecine Veterinaire, 163: 362-367.

234

F. Yousfi, K. Senouci, I. Medjoual, H. Djellil &T. Hadj Slimane

Mungube E.O., Bauni S.M., Tenhagen B.A., Wamae

L.W., Nzioka S.M., Muhammed L. & Nginyi J.M.,

2008. Prevalence of parasites of the local scavenging

chickens in a selected semi-arid zone of Eastern

Kenya. Tropical Animal Health and Production, 40:

101-109.

OFIAAL (Observatoire des filieres avicoles en Algerie),

Rapport 2011. Edition Institut de Technologie des Pe-

ches et de T Aquaculture, Alger.

Phiri I.K., Phiri A.M., Ziela M., Chota A., Masuku M. &

Monrad J., 2007. Prevalence and distribution of ga-

strointestinal helminthes and their effects on weight

gain in free-range chickens in Central Zambia. Tro-

pical Animal Health and Production, 39: 309-315.

Poulsen J., Permin A., Hindsbo O., Yelifari L., Nansen

P.& Bloch P, 2000. Prevalence and distribution of

gastrointestinal helminthes and haemoparasites in

young scavenging chickens in upper eastern region

of Ghana, West Africa. Preventive Veterinary Medi-

cine, 45: 237-245.

Schmidt G.D. & Olsen O.W., 1964. Life cycle and deve-

lopment of Prosthorhynchus formosus (Van Cleave,

1918) Travassos, 1926, an acanthocephalan parasite

of birds. The Journal of Parasitology, 50: 721-730.

Smales L.R., 2003. An annotated checklist of the Au-

stralian Acanthocephala from mammalian and bird

hosts. Records of the South Australian Museum, 36:

59-82.

Ssenyonga G.S.Z., 1982. Prevalence of helminth parasi-

tes of domestic fowl ( Gallus domesticus ) in Uganda.

Tropical Animal Health and Production, 14: 201-204.

Yamaguti S., 1963. Systema helminthum, Acanthoce-

phala. Interscience Publishers John Wiley and Sons,

New York- London, 423 pp.

Biodiversity Journal, 2013, 4 (1): 235-242

Diversity and richness of bird species in newly formed habitats

of Chandoli National Park in Western Ghats, Maharashtra

State, India

Abdar Mohan Ramchandra

Department of Zoology, Krantisinh Nana Patil College Walwa Dist. Sangli, 416313, Maharashtra State, India; email:

abdarmohanO 1 @gmail.com

ABSTRACT The study of bird species diversity and richness in newly formed habitats of Chandoli National

Park in Western Ghats (now declared as international heritage), Maharashtra State, India was

carried out in early wet and dry seasons. Since richness and diversity of bird species are good

indicators of the ecosystem quality, this paper focused on providing some information on the

abundance, diversity and activities of various bird species occurring in Chandoli National

Park. To this aim, line transect survey was used to generate data for ecological analysis. Birds

observed incuded resident, migratory and palearctic species. A total of 151 species repre-

senting 15 orders and 45 families were recorded from September 2009 to August 2011, and

a high value calculated for the Simpson’s Index of Diversity (0.8291) indicated a marked

richness and diversity of bird species in the area under examination.

KEY WORDS Birds; Diversity; Richness; Western Ghats; Chandoli National Park.

Received 16.01.2013; accepted 02.03.2013; printed 30.03.2013

INTRODUCTION

The south-north hill range of Western Ghats lies

on the Western side of Maharashtra state (India)

from the border of Gujarat up to Kerala. It harbours,

in its heart, the Chandoli National Park and Reser-

voir, recently declared as World heritage, which is

very rich in biodiversity. The Western Ghats include

several man-made reservoirs with the majority of

streams running through it ultimately joining the

Krishna and Kaveri rivers.

This area is also recognized internationally as the

Western Ghats Endemic bird area and is known to

host some rare and globally threatened bird species.

It is one of the best briding hot spots in India for va-

riety, beauty and ecofriendliness. About 508 bird

species have been recorded recently. The Indian re-

gion is incredibly rich in birdlife. Over 1200 of the

worlds 8650 species of birds are found in the re-

gion. This number rises to over 2000 with sub-

species included which makes the Indian check list

twice the size of those of Europe and North Amer-

ica. This abundance is due to the variety of habitats

and prevalent climate; altitude ranges from the sea

level to the peak of the Himalaya.

Birds and their diversity constitute a main part

of the natural environment and play a functional

role as agents of flower pollination, seed dispersal,

source of food chain and agents in breaking seed

dormancy (Nason, 1992). Birds are good environ-

mental indicators revealing the state of the ecosys-

tems such as forest edges, wetlands and major river

basins. They also act as dispersal agents in transfer-

ring nutrients and spores from one place to another

during their migration and local movements

(Niemi, 1985). The avian habitat is roughly divided

into forest, scrub and wetlands, although many

236

Abdar Mohan Ramchandra

species require a mixed type of habitat. After the

snow fall, birds coming from sub tropical temperate

region migrate in thousands up to North West comer

of India and then radiate into local aquatic network

of reservoirs of Western Ghats according to food

availability in each habitat. Although this region is

considered an important spot of biodiversity, never-

theless still little is known about the migrations of

birds that inhabit the reserve throughtout the year.

Hence, this study was set out to obtain information

on the presence, richness, diversity and activities of

various bird species in Chandoli National Park both

in favourable and adverse climatic conditions.

MATERIAL AND METHODS

Study area

The newly formed habitat of Chandoli National

Park (Fig. 1) is at the junction area of four districts

(Sangli, Kolhapur, Satara and Ratnagiri). It lies be-

tween longitudes 73°40' and 73°53'E and latitudes

17°03' and 17°20'N near Sangli in Western Mahara-

shtra. A very distinct feature is the presence of nu-

merous barren rocky lateritic plateaus locally called

‘Sadas’ devoid of any perennial vegetation and nu-

Figure.l Map of Chandoli National Park, India.

merous fallen boulders with dense thorny secondary

vegetation. The area is about 308.97 Knr.The maxi-

mum temperature during day time ranges from 30 °C

to 38 °C. From October both day and night tempera-

tures decrease progressively. In December or January

the temperature often is up to 26 °C in day time. Dur-

ing rainy season maximum and minimum tempera-

ture range remains between 11-28 °C. The all area is

characterized by humid and mild climate, there are

heavy rains during the South West monsoon season,

from June to September. Premonsoon starts in April.

Therefore, this area has no notable dry season.

The cold season is from December to February,

followed by the pleasant summer season from

March to May. The forest types are tropical hill for-

est, semi- evergreen forest and mixed deciduous fo-

rest. Anjan ( Memecylon umbellatum), Jambhual

(Syzygium cumini ) and Pisa (Actinodaphna angu-

stifolia ) are the most common species of this area.

Due to high altitude, perennial snow, reservoirs and

presence of evergreen vegetation, general climatic

conditions are cool and humid, which provides a

good habitat for wild fauna.

Methods

Some of the basic methods used in this study as

described by Bibby et al. (1992) are: a) point

counts: to determine abundance by undertaking a

bird count from a fixed location for a fixed period

of time. The bird species seen or heard are recorded,

b)line transect: suitable for estimating density and

abundance which involves moving along a fixed

route (transect) and recording the bird species seen

and heard on both sides of the transect.

The study was conducted from September 2009

to August 2011. The bird counts were carried out in

the morning from 7.00 am to 10.00 am. and in the

evening from 4.00 pm to 6.00 pm. A binocular

(Olympus ) was used to confirm the identification of

the birds; nests were located by sight. For every bird

species the following parameters were recorded: (i)

activity of the bird when first sighted; (ii) the number

of bird species at eveiy sighting; (iii) location of nests

and species involved; all the numbers were noted.

Data analysis

a. Species composition: abundance for each

species was calculated by summing up the number

of individuals recorded in all the transect.

Diversity and richness of bird species in newly formed habitats of Chandoli National Park, India

237

b. Species diversity using Simpson index (D),

Simpson Diversity index (1-D) and Simpsons Re-

ciprocal index (1/D).

c. Activities of birds recorded during the survey

period included calling, overflying, perching, walk-

ing, mobbing, bissy in the construction of nest, col-

lection of grass materials, feeding and loafing. The

frequency of each activity was summed up to give

the activity rating and the percentages values of the

frequence of each activity were calculated.

RESULTS AND DISCUSSION

A total of 151 species distributed in 15 orders

and 45 families were recorded during the survey

period. Sixteen families were represented only by

one species each. Passerifomes was the most rich

of species (63 species ) followed by Ciconiiformes

(39 species). Rosy starling (Sturnus roseus ) was re-

corded in the months of January, February and

March; whereas Baya Weaver ( Ploceus philippinus )

was more abundant in the months of July, August

and September.

The Simpson’s index (i.e. the probability that

two randomly selected individuals in the commu-

nity belong to the same category) was 0.1709 and

the Simpson’s diversity index (i.e. the probability

that two randomly selected individuals in a commu-

nity belong to different species) was 0.8291. A

value of 5.8 was obtained as the reciprocal of Simp-

son index; a total number of 1 5 1 species was recor-

ded during the survey.

A total of 253 nests belonging to species of 15

families were recorded, most of which were of

House Swift (Apus nipalensis, 200 nests) and Baya

Weaver {Ploceus philippinus , 180) (see Table 2).

Figure 2. Activities of birds of the Chandoli National Park,

India.

ACTIVITIES OF BIRD

SPECIES

FREQUENCY %

FEEDING

68%

BREEDING

27%

LOAFING

Table 1. Activities of bird species in newly formed habitat

Chandoli National Park.

Bird species

Nest

condition

Nests

Birds

recorded

at nest

Red Vented

Bulbul

New and Old

Hoopoe

New and Old

Oriental white

eye

New

Baya Weaver

New

180

Paddy field

Warbler

New

House Swift

New

200

Jungle Crow

New

Woolly-necked

Stork

New

Glossy Ibis

New

Woodpecker

New and Old

Grey Hornbill

New

Spotted Dove

New

Black Kite

New

Table 2. Bird nests recorded in the newly formed habitat of

Chandoli National Park, India.

BIRD SURVEY RESULTS

GALLIFORMES - PHASIANIDAE

Coturnix coturnix (Linnaeus, 1758)

Common Quail

Perdicula asiatica (Latham, 1790)

Jungle Bush Quail

238

Abdar Mohan Ramchandra

■ No. of birds recorded at nests

■ No. of nests

Figure 3. Number of nests and number of birds of the Chandoli National Park, India.

Francolinus pondicerianus (Gmelin J.F., 1789)

Grey Partridge

Pavo muticus Linnaeus, 1758

Indian Peafowl

ANSERIFORMES - ANATIDAE

Tadorna ferruginea Pallas, 1764

Ruddy Shelduck

Anas crecca Linnaeus, 1758

Common Teal

Anas acuta Linnaeus ,1758

Northern Pintail

Nettapus coromandelianus Gmelin, 1789

Cotton Teal

Anas poecdorhyncha J. R. Forster, 1781

Spot-billed Duck

Ay thy a ferina Linnaeus, 1758

Common Pochard

Anas clypeata Linnaeus, 1758

Shoveler

PICIFORMES - PICIDAE

Dinopium javanense (Ljungh, 1797)

Woodpecker (Indian Golden-backed)

MEGALAIMIDAE

Megalaima haemacephala (Statius Muller, 1776)

Coppersmith Barbet

Megalaima asiatica (Latham, 1790)

Blue throated Barbet

BUCEROTIFORMES - BUCEROTIDAE

Ocyceros hirostris (Scopoli, 1786)

Indian Grey Hornbill

UPUPIFORMES - UPUPIDAE

Upupa epops Linnaeus, 1758

Common Hoopoe

CORACIIFORMES - CORACIIDAE

Coracias henghalensisis (Linnaeus, 1758)

Indian Roller

ALCEDINIDAE

Alcedo atthis Linnaeus, 1758

Common Kingfisher

HALCYONIDAE

Halcyon smyrnensis (Linnaeus, 1758)

White-throated Kingfisher

CERLIDAE

Ceryle rudis (Linnaeus, 1758)

Pied Kingfisher

Diversity and richness of bird species in newly formed habitats of Chandoli National Park, India

239

MEROPIDAE

Merops orientalis Latham, 1802

Green Bee-eater

Merops leschenaulti Vieillot, 1817

Chestnut headed Bee eater

Merops persicus Pallas, 1773

Blue-cheeked Bee-eater

CUCULIF ORME S - CUCULIDAE

Cuculus micropterus Gould, 1838

Indian Cuckoo

Surniculus lugubris (Horsfield, 1821)

Drongo Cuckoo

Eudynamys scolopacea (Linnaeus, 1758)

Asian Koel

CENTROPODIDAE

Centropus sinensis (Stephens, 1815)

Greater Coucal

Centropus bengalensis (Gmelin, 1788)

Lesser Coucal

PSITTACIFORMES - PSITTACIDAE

Psittacula krameri (Scopoli, 1769)

Rose-ringed Parakeet

Psittacula columboides (Vigors, 1830)

Malabar Parakeet

APODIFORMES - APOD1DAE

Collocalia unicolor (Jerdon, 1840)

Indian Swiftlet

Apus affinis (Gray J.E., 1830)

House Swift

ACCIPITRIF ORMES - ACCIPITRIDAE

Milvus migrans (Boddaert, 1783)

Black Kite

Haliastur indus (Boddaert, 1783)

Tyto capensis (Smith, A, 1834)

Grass Owl

STRIGIDAE

Glaucidium radiatum (Tickell, 1833)

Jungle Owlet

COLUMBIF ORMES - COLUMBIDAE

Columba livia Gmelin, JF, 1789

Rock Pigeon

Streptopelia senegalensis (Linnaeus, 1766)

Little Brown Dove

Streptopelia chinensis (Scopoli, 1786)

Spotted Dove

Streptopelia decaocto (Frivaldszky, 1838)

Eurasian Collared-Dove

GRUIFORMES - GRUIDAE

Grus virgo (Linnaeus, 1758)

Demoiselle Crane

RALLIDAE

Porphyrio porphyrio (Linnaeus, 1758)

Purple Moorhen

Gallinula chloropus (Linnaeus, 1758)

Common Moorhen

Fulica atra Linnaeus, 1758

Common Coot

Amaurornis phoenicurus (Pennant, 1769)

White-breasted waterhen

Gallicrex cinerea (Gmelin, 1789)

Watercock

CICONIIFORMES - PTEROCLIDAE

Pterocles exustus Temminck, 1 825

Indian Sandgrouse

Brahminy Kite

Circus aeruginosus (Linnaeus, 1758)

Marsh Hamer

Accipiter badius (Gmelin J.F., 1788)

Shikra

STRIGIFORMES - TYTONIDAE

Tyto alba Scopoli, 1769

Bam Owl

S COLOPACID AE

Gallinago gallinago (Linnaeus, 1758)

Common Snipe

Limosa limosa (Linnaeus, 1758)

Black-tailed Godwit

Limosa lapponica (Linnaeus, 1758)

Bar-tailed Godwit

Tringa erythropus (Pallas, 1764)

Spotted Redshank

240

Abdar Mohan Ramchandra

Tringa stagnatilis (Bechstein, 1803)

Marsh Sandpiper

Tringa glareola Linnaeus, 1758

Wood Sandpiper

Calidris minuta (Leisler, 1812)

Little Stint

Philomachus pugnax (Linnaeus, 1758)

Ruff

CHARADRIIDAE

Himantopus bimantopus (Linnaeus, 1758)

Black-winged Stilt

Charadrius dubius Scopoli, 1786

Little Ringed Plover

Charadrius alexandrinus Linnaeus, 1758

Kentish Plover

Vanellus malabaricus (Boddaert, 1783)

Yellow-wattled Lapwing

Vanellus gregarius (Pallas, 1771)

Red- wattled Lapwing

Cursorius coromandelicus (Gmelin, 1789)

Indian Courser

LAR1DAE

Sterna aurantia Gray,JE, 1831

River Tern

Sterna hirundo Linnaeus 1758

Common Tern

PODICIPEDIDAE

Tachybaptus ruficollis (Pallas, 1764)

Little Grebe

ARDEIDAE

Egretta garzetta (Linnaeus, 1766)

Little Egret

Egretta gularis (Bose, 1792)

Indian Reef ITeron

Ardea cinerea Limiaeus, 1758

Grey Heron

Ardea goliath Cretzschmar, 1829

Giant Heron

Ardea purpurea Linnaeus, 1766

Purple Heron

Casmerodius albus Linnaeus, 1758

Great Egret

Mesophoyx intermedia (Wagler, 1829)

Intermediate Egret

Bubulcus ibis (Linnaeus, 1758)

Cattle Egret

Ardeola grayii (Sykes, 1832)

Indian Pond Heron

Nycticorax nycticorax (Linnaeus, 1758)

Black-crowned Night Heron

THRESKIORNITHIDAE

Plegadis falcinellus (Linnaeus, 1766)

Glossy Ibis

Threskiornis melanocephalus (Latham, 1790)

Black-headed Ibis

Pseudibis papillosa (Temminclc, 1 824)

Black Ibis

Platalea leucorodia Linnaeus, 1758

Spoonbill

CICONIIDAE

Mycteria leucocephala (Pennant, 1769)

Painted Stork

Anastomus oscitans (Boddaert, 1783)

Asian openbill

Ciconia episcopus (Boddaert, 1783)

Woolly-necked Stork

Ciconia ciconia (Linnaeus, 1758)

White Stork

PHALACROCORACIDAE

Phalacrocorax niger (Vieillot, 1817)

Little Cormorant

Phalacrocorax fuscicollis Stephens, 1 826

Indian Cormorant

Phalacrocorax carbo (Linnaeus, 1758)

Great Cormorant

PASSERILORMES - PITTIDAE

Pitta brachyura (Linnaeus, 1766)

Indian Pitta

LANIIDAE

Lanius isabellinus Hemprich et Ehrenberg, 1833

Rufous -tailed shrike

Lanius vittatus Valenciennes, 1 826

Bay backed shrike

Diversity and richness of bird species in newly formed habitats of Chandoli National Park, India

241

CORVIDAE

Corvus splendens Vieillot, 1817

House Crow

Corvus macrorhynchos Wagler, 1 827

Large -billed Crow

Pericrocotus roseus (Vieillot, 1818)

Rosy Minivet

Pericrocotus cinnamomeus (Linnaeus, 1766)

Small Minivet

Pericrocotus erythropygius (Jerdon, 1 840)

White-bellied Minivet

Rhipidura hypoxantha Blyth, 1 843

White-throated Lantail

Dicrurus macrocercus Vieillot, 1817

Black Drongo

Tephrodornis pondicerianus (Gmelin, JL, 1789)

Common Woodshrike

Aegithina tiphia (Linnaeus, 1758)

Common Iora

MUSCICAPIDAE

Monticola solitarius (Linnaeus, 1758)

Blue Rock Thrush

Zo other a citrina (Latham, 1790)

Orange-headed Thrush

Muscicapa muttui (Layard, EL, 1854)

Brown-breasted Llycatcher

Luscinia brunnea (Hodgson, 1837)

Indian Blue Robin

Copsychus saularis (Linnaeus, 1758)

Oriental Magpie-Robin

Saxicoloides fulicata (Linnaeus, 1766)

Indian Robin

Saxicola torquata (Linnaeus, 1766)

Common Stonechat

Oenanthe oenanthe (Linnaeus, 1758)

Pied Chat

STURNIDAE

Sturnus roseus (Linnaeus, 1758)

Rosy Starling

Acridotheres tristis (Linnaeus, 1766)

Common Myna

Acridotheres ginginianus (Latham, 1790)

Bank Myna

Acridotheres fuscus (Wagler, 1 827)

Jungle Myna

Sturnus pagodarum (Gmelin, JL, 1789)

Black Headed Myna

PARIDAE

Parus major Linnaeus, 1758

Great Tit

HIRUDINIDAE

Hirundo smithii Leach, 1818

Wire -tailed Swallow

Hirundo daurica (Laxmann, 1769)

Red-rumped Swallow

Hirundo fluvicola (Blyth, 1855)

Indian Cliff Swallow

PY CNONOTIDAE

Pycnonotus cafer (Linnaeus, 1766)

Red-vented Bulbul

CISTICOLIDAE

Prinia hodgsonii Blyth, 1844

Lranklin’s Wren Warbler

Prinia gracilis (Lichtenstein, 1823)

Streaked Wren Warbler

Prinia sylvatica Jerdon, 1840

Jungle Prinia

ZOSTEROPIDAE

Zosterops palpebrosus (Temminck, 1824)

Oriental White-eye

SYLVIIDAE

Acrocephalus bistrigiceps Swinhoe, 1860

Paddy field Warbler

Acrocephalus stentoreus (Hemprich et Ehrenberg, 1 833)

Indian Great Reed Warbler

Orthotomus sutorius (Pennant, 1769)

Common Tailorbird

Graminicola bengalensis Jerdon, 1863

Large Grass Warbler

Macronous gularis (Horsfield, 1 822)

Yellow-breasted Babbler

Turdoides caudatus (Dumont, 1 823)

Common Babbler

Turdoides striatus (Dumont, 1 823)

Jungle Babbler

Alcippe poioicephala (Jerdon, 1841)

Quaker Babbler

242

Abdar Mohan Ramchandra

ALAUDIDAE

Mirafra erythroptera Blyth, 1 845

Lonchura punctulata (Linnaeus, 1758)

Spotted Munia

Indian Bush lark

Calandrella raytal (Blyth, 1 845)

LRINGILLIDAE

Sand lark

NECTARINIIDAE

Melophus lathami (Gray J.E., 1831)

Crested Bunting

Nectarinia zeylonica (Linnaeus, 1766)

Purple rumped Sunbird

CONCLUSION

Nectarinia minima (Sykes, 1832)

Crimson-backed Sunbird

Nectarinia asiatica (Latham, 1790)

Purple Sunbird

Nectarinia lotenia (Linnaeus, 1766)

Loten’s Sunbird

Aethopyga siparaja (Raffles, 1 822)

Crimson Sunbird

Arachnothera longirostra (Latham, 1790)

Little Spiderhunter

PASSER1DAE

Passer domesticus (Linnaeus, 1758)

House Sparrow

Dendronanthus indicus (Gmelin, 1789)

Lorest Wagtail

The high value of the Simpson’s index of diver-

sity (0.8291) is an indication of richness of bird di-

versity in the Chandoli National Park. Some

endemic species were recorded in this area such as

Green Barbet ( Stactolaema olivacea), Lorest War-

bler (Artisornis moreaui ), Small Sunbird ( Lepto -

coma minima ) and Rock Pigeon. Such a richness

in birds species can largely be explained by the par-

ticular characteristics of the area. In fact, it includes

a network of man-made reservoirs as feeding

ground for both migratory and residential birds in

the winter period. In addition, the secure and dense

mixed forest made of big and thick trees provide

good habitat and forage for bird species; and, fi-

nally, some sugar factories provide shelter for

Swifts and Red vented Bulbuls (Nason, 1992).

Motacilla alba Linnaeus, 1758

White Wagtail

ACKNOWLEDGEMENTS

Motacilla citreola Pallas, 1776

Yellow headed Wagtail

Motacilla flava Linnaeus, 1758

Yellow Wagtail

Anthus hodgsoni Richmond, 1907

Indian Tree Pipit

Ploceus benghalensis (Linnaeus, 1766)

Black- throated Weaver

The Maharashtra State Lorest Department is

gratefully aknowledged for granting me the permis-

sion to study the Avian fauna of Chandoli National

Park and nearby areas. This study was funded by a

grant in aid of Minor research project from Univer-

sity Grants Commission WRO Pune.

Ploceus philippinus (Linnaeus, 1766)

REFERENCES

Baya Weaver

Ploceus megarhynchus Hume, 1869

Linns Baya

Amandava amandava (Linnaeus, 1758)

Red Munia

Lonchura malabarica (Linnaeus, 1758)

Indian Silverbill

Bibby C.J., Burgess N.D. & Hill D.A., 1992. Bird Census

Techniques. Academic Press, London, pp. 67-84.

Nason I., 1992. Discovering birds. Pisces Publication, pp.

67-69.

Niemi G.J., 1985. Patterns of morphological evolution in

bird genera of New World and Old World Peatlands.

Ecology, 66: 1215-1228.

Biodiversity Journal, 2013, 4 (1): 243-252

Molecular variation of Iranian local and exotic strawberry

(Fragaria x ananassa Duch.) varieties using SSR markers

Seyed Arman Hosseini 1 , Ezzat Karami 2 & RezaTalebi 2 *

'College of Agriculture, Islamic Azad University, Kermanshah Branch, Kermanshah, Iran

2 College of Agriculture, Islamic Azad University, Sanandaj Branch, Sanandaj, Iran

*Corresponding author: srtalebi@yahoo.com

ABSTRACT In this study, we report the genetic diversity in a collection of 1 7 local strawberry cultivars

collected from ‘Kurdistan’ province north-west of Iran with 13 exotic cultivars, using 20 SSR

markers. The 20 SSR loci analysed produced 118 alleles with an average 5.9 alleles per mar-

ker. The number of alleles ranged from 3 to 16, whereas the maximum was observed in

UAFv7648. The effective allelic number (ne) was 3.03 on average of and ranged from 1.22

to 6.98. The genetic diversity (GD) and PIC values ranged from 0.22 to 0.88 and 0. 19 to 0.87,

with an average of 0.63 and 0.60, respectively. Cluster analysis grouped genotypes in four

clusters. Local cultivars grouped in two distinct clusters and other exotic cultivars grouped

in other two clusters. Results of cluster analysis suggested that the local cultivars may ori-

ginated from Queen, Missionary, Ventana and Fresho or may share a same pedigree sources

with these cultivars. This is first information on commercially grown local and exotic

strawberry cultivars from different origins in Iran using SSR markers.

KEY WORDS Strawberry; Genetic diversity; SSR markers; population structure.

Received 18.01.2013; accepted 20.2.2013; printed 30.03.2013

INTRODUCTION

Assessment of genetic diversity is important in

plant breeding to foresee improvement by selection.

The commercially important strawberries {Fragaria

x ananassa Duch.) belong to the family Rosaceae

and the genus Fragaria L., which comprises 23 spe-

cies (Rousseau-Gueutin et al., 2009). With its high

nutritional value, the strawberry is one of the most

popular berry fruits in the world. All of these

strawberries have seven basic types of chromoso-

mes. However, they exhibit a series of ploidy le-

vels, ranging from diploid species such as Fragaria

vesca (2n = 2x = 14), to decaploid species, such as

some accessions of F. iturupensis (2n = lOx = 70).

The cultivated strawberry, F. x ananassa , is an octo-

ploid (2n = 8x = 56) (Nathewet et al., 2010).

Because of this, it is difficult to breed it suc-

cessfully to develop new varieties with differing

genetic characteristics. The verification of straw-

berry cultivar identity is essential for fanners and

plant breeders, as part of certification programs, to

prevent mixtures or misidentiflcation of cultivars

and to protect breeder’s rights. Because of the large

number of strawbeny cultivars grown today, there

is a pressing need for the development of reliable

methods for identify ing/distinguishing strawberry

cultivars and for assessing genetic diversity in

strawbeny germplasm for breeding purposes. The

cultivated strawberry, F. x ananassa has a nanow

genetic pool (Sjulin & Dale, 1987). Efforts to in-

crease the germplasm diversity of the cultivated

strawberry have focused on wild species and adapted

local germplasm, as parents (Luby et al., 2008).

244

S.A. Hosseini, E. Karami & R.Talebi

Strawberry was imported into Iran about 100

years ago from France. Its cultivation area in Iran

is about 3000 ha and the total production averages

about 2 1 Kt yearly. Strawberry can be grown suc-

cessfully in different parts of Iran. Strawberry cul-

tivation and production in Iran has doubled in the

last two decades. At present the two main regions

of the country producing strawberries are Kurdi-

stan (North-west) and Golestan (North) provinces

(Eshghi et al., 2007). Kurdistan province grows

about 80% of the total strawberry production in

the Iran (Fig. 1).

Currently, morphological traits are used to cer-

tify the identity of strawberry cultivars, but this in-

formation often does not yield clear answers

concerning discrimination of a plant variety, due to

ambiguous differences or phenotypic modifications

caused by environmental factors (Garcia et al.,

2002). For these reasons, as molecular marker tech-

nologies become available, they are being evaluated

for their usefulness in strawberry cultivar identifi-

cation and assessing genetic diversity. With respect

to genetic diversity, the overriding question is how

well do estimates based on molecular marker data

correspond to actual levels of genetic diversity

and/or to assessments of diversity based on pedi-

gree. Microsatellites, or simple sequence repeats

(SSRs) have proved to be locus-specific, codomi-

nant, highly reproducible and usually highly poly-

morphic molecular markers (Powell et al., 1996).

Many simple sequence repeat (SSR) markers were

developed for Fragaria from A vesca (James et al.,

2003; Cipriani & Testolin, 2004; Hadonou et al.,

2004; Bassil et al., 2006a; Davis et al., 2006; Mon-

fort et al., 2006), F. x ananassa (Lewers et al. 2005;

Bassil et al., 2006b; Gil-Ariza et al., 2006), F. vir-

giniana (Ashley et al., 2003), F. bucharica Losinsk.

(Sargent et al., 2006), and F. viridis Weston (Sar-

gent et al., 2003). A major drawback of SSRs, the

high cost of microsatellite development (Gupta &

Varshney, 2000), was eliminated by high levels of

cross-species transferability within Fragaria

(Ashley et al., 2003; Sargent et al., 2003; Lewers et

al., 2005; Bassil et al., 2006a; Davis et al., 2006;

Monfort et al., 2006). This has facilitated the use of

SSRs in Fragaria for fingerprinting (Govan et al.,

2008), linkage mapping (Sargent et al., 2006; 2009),

and genetic diversity analysis (Hadonou et al.,

2004; Gil-Ariza et al., 2006). Expressed sequence

tag (EST) projects have generated a vast amount of

Figure 1. Map of Iran showing the approximate areas of collection site of the 17 local strawberry varieties used in this study.

Molecular variation of Iranian local and exotic strawberry (Fragaria * ananassa Duch.) varieties using SSR markers 245

No.

Genotype

Source

No.

Genotype

Source

NashurVasat

Local (Kurdistan province-Iran)

Sanandaj2

Local (Kurdistan province)

Barkulan

Local (Kurdistan province)

Sanandaj 1

Local (Kurdistan province)

Yaminan

Local (Kurdistan province)

Missionary

Exotic (Europe)

NashurSafli

Local (Kurdistan province)

Ventana

Exotic (Europe)

Yaminan2

Local (Kurdistan province)

Fresho

Exotic (Europe)

Toriverl

Local (Kurdistan province)

Karcy

Exotic (Europe)

Karabad

Local (Kurdistan province)

Marak

Exotic (Europe)

Toriver2

Local (Kurdistan province)

Gaviota

Exotic (Europe)

Qalaji

Local (Kurdistan province)

Camarosa

Exotic (Europe)

Danikesh

Local (Kurdistan province)

Diamant

Exotic (Europe)

Sanandaj3

Local (Kurdistan province)

Paroos

Exotic (Europe)

Sanandaj4

Local (Kurdistan province)

Classica

Exotic (Europe)

Drileh

Local (Kurdistan province)

Pajaro

Exotic (Europe)

Dorood

Local (Kurdistan province)

Selva

Exotic (Europe)

Shian

Local (Kurdistan province)

Queen

Exotic (Europe)

Table 1. List of 30 strawberry ( Fragaria x ananassa Duch.) varieties used for SSR fingerprinting.

publicly available sequence data from plant spe-

cies; these data can be mined for simple sequence

repeats (SSRs). These SSRs are useful as molecu-

lar markers because their development is inexpen-

sive, they represent transcribed genes and a

putative function can often be deduced by a ho-

mology search. Because they are derived from tran-

scripts, they are useful for assaying the functional

diversity in natural populations or germplasm col-

lections (Varshney et al., 2005).

The objective of this study was to use genomic

SSR and EST-derived SSR markers for genetic di-

versity analysis in some local and exotic strawberry

genotypes available in north-west of Iran.

MATERIALS AND METHODS

Thirty genotypes of strawberry, 17 of which col-

lected from different villages of Kurdistan province,

north-west of Iran, were examined. All of these ge-

notypes are named as ‘Kurdistan’ variety, while

huge morphological differences exist between

them. The additional thirteen genotypes under

study are famous exotic varieties that grow in most

strawberry production zones of Iran (Table 1).

Genomic DNAs were extracted from approxi-

mately 2 g of young leaves tissue. Leaf tissue was

ground to a fine powder in liquid nitrogen and sto-

red at -70 °C until total genomic DNA was isolated.

DNA was extracted using the CTAB method accor-

ding to Lassner et al. (1989) with the modification

described by Torres et al. (1993). The DNA final

concentration was determined by agarose-gel elec-

trophoresis using a known concentration of uncut X

DNA as a standard. Twenty-eight of 82 previously

published SSR primer pairs (Lewers et al., 2005;

Bassil et al., 2006a, b) were selected based on am-

plification of expected size fragments and allelic di-

versity reported by previous studies.

246

S.A. Hosseini, E. Karami & R.Talebi

Primer

pair

SSR type

sequ ence

Repeat motif

Reference

Forward

reverse

FAC-001

Genomic

AAATCCTGTTCCTGCCAGTG

TGGTGACGTATTGGGTGATG

(AAAAT)7

Lewers et al., 2005

FAC-008

Genomic

TACTGTGCACGCAACAACAG

CTCTCCAATCCTTCATTGAT

(CT)5A(TC)4

Lewers et al., 2005

FAC-011

Genomic

GTTTT C AGGCGGTCA ATT CTA

GCTTCAAGCAAAATGCATCATC

(TA)7A(AT)6

Lewers et al., 2005

FAC-012

Genomic

TACACGTGTCCTAGGGTTTTCA

AGCGGAGAATGAGTGACGATAG

(CCT)6

Lewers et al., 2005

UAFv7648

EST

AACCAGAGCCAGAGCCAG

CGACAGTGATGTAGAGGAAGA

(CT)12

Bassil et al., 2006a

UAFv8204

EST

CTCTGCCTTTCTCTACCC

CCCAAGTCTATGAGTGGAAC

(CT)ll

Bassil et al., 2006a

UAFv8936

EST

GTGACTTTGACGCTGACC

TGAGAGTGGTTCTGTTCCTC

(TA)7

Bassil et al., 2006a

UFFa01H05

EST

GGGAGCTTGCTAGCTAGATTTG

AGATCCAAGTGTGGAAGATGCT

(CT)8

Bassil et al., 2006a

UFFa02A03

EST

GAGCTACACAATGCCATCAAAA

GCGCATTCGACTCTGTAACTCT

(AG) 12

Bassil et al., 2006a

UFFa02G01

EST

ACGAGGTGGGTTTTGTGTTGT

CCCAGATGAAGAAACCGATCTA

(AG)6

Bassil et al., 2006a

UFFa03Dll

EST

TACCTTCTGCATTCACCATGAC

GCCTTGATGTCTCGTTGAGTAG

(AG A) 5

Bassil et al., 2006a

UFFa09Bll

EST

CTTGGGAGAGAACCAGAAAAAC

TCAGAACCAACTCCAGAGAAGC

(AG)6

Bassil et al., 2006a

UFFal4F08

EST

GTTTCTCTCAGGGCCAAAAT

CTTGAGTAGTCCTCTCACCATTG

(TC)9, (TA)5

Bassil et al., 2006a

UFFal9B10

EST

ATTTCTGTTGTCTCCCTCCTTC

GCTCGATCTCTAGCTTTCTCTCT

(CT)10, (TC)6

Bassil et al., 2006a

UFFa20G06

EST

ACTCAACCACCACATTTCACAC

GAGAAGTTGTCAATAGTCCAGGTG

(CT)ll

Bassil et al., 2006a

UFFal6H07

EST

CTCTACCACCATTCAAAACCTC

CACTGGAGACATCTAGCTCAAAC

(CT)ll

Bassil et al., 2006a

SF- 2H12

EST

CCTGCATATCTTCTGCAACAAC

AAGCAGCACCACCTTCAGTAGT

(TC)15

Bassil et al., 2006b

SF-1B07

EST

GGAGAGACAGACCTCAAAGGTG

GAGGGGTTCTGTTTTTGACAAG

CTs (AG) 7

Bassil et al., 2006b

SF-4B12

EST

GCAAAGTCGGAGAGAGATAGA

CTGAAGAAGGTGTTGAGGAA

(CT)8

Bassil et al., 2006b

SF-5G02

EST

CTTTTGCTGCTAGCTCTTTGTG

TACGTACTCCACATCCCATTTG

(TC)ll

Bassil et al., 2006b

Table 2. List of 20 SSR primer pairs, including the type of SSR (EST or genomic), primer sequences (F-forward, R-re-

verse), and repeat motifs, used for genetic diversity assessment of strawberry varieties.

These twenty-eight SSRs were tested for ampli-

fication by 3% agarose gel electrophoresis in 10 ge-

notypes and identified 20 well-amplified SSR

primer pairs (Table 2). These SSR primer pairs were

chosen for this study based on polymorphism and

ease of scoring after fragment analysis.

These SSRs consisted of 16 expressed sequence

tag (EST) SSRs and four genomic SSRs. PCRs

were performed in 20 pi total reaction volumes con-

taining: 1 x PCR buffer, 2 mM MgC12, 0.2 mM each

dNTP, 0.3 pM of each primer, 1 U of Taq polyme-

rase enzyme (Cinagen, Iran) and 15 ng of DNA

Molecular variation of Iranian local and exotic strawberry (Fragaria * ananassa Duch.) varieties using SSR markers 247

Microsatellite

Expected

size

N e

c i

D j

PIC

FAC-001

212

1.95

0.53

0.22

0.78

0.50

FAC-008

138

1.22

0.22

0.39

0.61

0.19

FAC-011

298

3.36

0.74

0.15

0.85

0.71

FAC-012

169

2.99

0.69

0.16

0.84

0.68

UAFv7648

235

6.98

0.88

0.06

0.94

0.87

UAFv8204

238

2.17

0.59

0.27

0.77

0.55

UAFv8936

310

1.41

0.34

0.35

0.65

0.30

UFFa01H05

246

2.18

0.60

0.20

0.80

0.55

UFFa02A03

168

4.12

0.79

0.13

0.77

UFFa02G01

159

2.16

0.57

0.28

0.72

0.55

UFFa03Dll

189

2.11

0.58

0.19

0.71

0.54

UFFa09Bll

197

3.46

0.74

0.14

0.86

0.72

UFFal4F08

137

2.96

0.69

0.17

0.73

0.67

UFFal9B10

183

3.09

0.72

0.18

0.82

0.69

UFFa20G06

154

1.9

0.50

0.25

0.75

0.53

UFFal6H07

248

2.54

0.66

0.18

0.82

0.62

SF- 2H12

240

5.44

0.88

0.09

0.91

0.83

SF-1B07

163

3.8

0.77

0.14

0.86

0.75

SF-4B12

355

1.62

0.42

0.31

0.69

0.39

SF-5G02

229

5.17

0.85

0.09

0.91

0.82

Table 3. List of 20 SSR primer pairs, including the type of SSR (EST or genomic), primer sequences (F-forward, R-re-

verse), and repeat motifs, used for genetic diversity assessment of strawberry varieties.

template. PCR products were analyzed using 3%

methaphor agarose electrophoresis gels stained with

ethidium bromide. Alleles were scored as present

(1) or absent (0) for each marker and a binary data

matrix was created. DARwin version 5.0 was used

for calculating pair-wise genetic distances and for

constructing the dissimilarity matrix (Perrier et al.,

2003). The dissimilarity matrix thus obtained was

subjected to cluster analysis using the un-weighted

neighbour-joining (UNJ) method (Gascuel, 1997),

followed by bootstrap analysis with 1 ,000 permu-

tations to obtain a dendrogram for all the 30 acces-

sions (Perrier et al., 2003). Frequencies of incidence

of all polymorphic alleles for each SSR markers

were calculated and used for determining statistical

parameters. Confusion probability (Cj) and discri-

248

S.A. Hosseini, E. Karami & R.Talebi

minating power (Dj) of each SSR were estimated

according to Tessier et al. (1999) and polymorphic

information content (PIC) following Botstein et al.

(1980).

RESULTS

SSR polymorphisms

In the present study, a total of 20 SSR loci (4 ge-

nomic and 16 EST-derived SSRs) (Table 2) were

used to analyze genetic diversity among 17 local

varieties collected from ‘Kurdistan’ province

(North-west of Iran) and 13 exotic cultivars. All

SSR markers showed a high level of polymor-

phisms, display a total of 1 1 8 different alleles with

fragment size ~ 130 to 300 bp (Table 3). The num-

ber of alleles per locus varied from 3 to 16, with an

average value of 6 alleles. FAC-008, UAFv8936

and UFFal6H07 amplified minimum number of al-

leles (3), whereas the maximum was observed at

UAFv7648, with 16 different alleles. The effective

allelic number (ne) was 3.03 on average and ranged

from 1.22 to 6.98 (Table 3). The gene diversity

(GD) and PIC values ranged from 0.22 to 0.88 and

0.19 to 0.87, with an average of 0.63 and 0.60, re-

spectively (Table 3). Fligh value of discriminating

power (Dj> 0.70) and PIC>0.50, and low values of

confusion probability (Cj<0.30) were obtained for

all SSR markers evaluated except for FAC-008,

UAFv8936 and SF-4B12 (Table 3), thus indicating

the usefulness and power of these SSR markers for

genetic identification in strawberries.

Cultivar identification

The genetic similarity matrix was analysed using

un- weighted neighbor joining (UNJ) clustering al-

gorithm by software programme DARwin 5.0 (Fig.

2). The radial branching clearly delineated the ge-

notypes in four major clusters (Fig. 2). Group 1

was further divided in two subgroups. This cluster

contained eight genotypes three of which (Fresho,

Ventana and Missionary) were exotic cultivars and

the remaining ones were local cultivars collected

from southern parts of ‘Kurdistan’ province. In

group 2, only two exotic cultivars (Karcy and

Marak) were placed with two local cultivars origi-

nated from central zone of ‘Kurdistan’ province.

Eight cultivars grouped in cluster 3 including all

exotic cultivars. Cluster 4 contained ten genotypes

all of which were local cultivars mostly collected

from the southern part of ‘Kurdistan’ province (Fig.

2). Most of the local cultivars grouped in clusters 1

and 4, and four exotic cultivars (Queen, Missionary,

Ventana and Fresho) were the closest cultivars to

these local varieties. In cluster 3 were grouped

most of the remained exotic cultivars, significantly

distant from local varieties. These results suggested

that the local cultivars in Kurdistan province may

be originated from Queen, Missionary, Ventana and

Fresho or may share the pedigree sources with these

cultivars. In order to determine the ability of SSR

markers to display genetic relationships among

strawberry cultivars, principle co-ordinate analysis

(PCoA) was carried out and cultivars were plotted

in the coordinate system for the first two coordi-

nates which accounted for 45% and 30% of the va-

riation, respectively (Fig. 3). Most of the cultivars

are separated by the first or second PCoA (Fig. 3)

which demonstrated distinct groups of cultivars cor-

responding to cluster analysis (Fig. 2).

DISCUSSION AND CONCLUSIONS

Whereas phenotypic descriptors may vary with

climate, geography or cultural practices, forensic

tools based on genetic material allow cultivar au-

thentication with great certainty. DNA markers

provide a robust, rapid, and relatively inexpensive

means to differentiate closely related plant mate-

rials. Strawberry plants are propagated vegetative ly

and can be easily misidentified based on phenotype

(Bassil et al., 2006b). Being a vegetative propaga-

ted species, collected strawberry accessions show

considerable levels of genetic divergence. Despite

its economic value, the polyploid constitution of

the strawberry has been a major barrier to the ge-

netic characterization of the cultivated species and

limited information on the genome structure has

been published.

In this study, 20 SSR primers that bracket well-con-

served and readily amplifiable regions of strawberry

genomic DNA were used to assay the strawberry ger-

mplasm typically grown by farmers in ‘Kurdistan’

province (North-west of Fan) and the exotic cultivars

available in the collection of agricultural research

station of Kurdistan. SSR markers have the advan-

Molecular variation of Iranian local and exotic strawberry (Fragaria * ananassa Duch.) varieties using SSR markers 249

NasluirSafli

Yaniiium 2

Dri Leh

Saimaa

Pajaro

Classics

Dorood

&31iaiulaj 4

NashurVasat Barkulan

Queen*—

Sanaiidaj 1

Sauandaj 2

Freslio

Shi an*

Toriver 1

i an Li] Lin i

\ entana

Marak

Missionary

Kara bad

Selva

Danikesh

Toriver 2

Gaviofa

CaniancKia

Diamanl

Figure 2. Un-weighted pair grouping method of arithmetic averages dendrogram of 30 strawberry varieties based on ge-

netic distances computed from SSR markers.

Coord. 1

Figure 3. Two-dimensional representation of genetic relations among 30 strawberry varieties using SSR data.

250

S.A. Hosseini, E. Karami & R.Talebi

tage over arbitrary marker systems in using pri-

mer pairs of a defined sequence, and are therefore

highly reproducible and in the case of EST-SSRs,

are developed directly from the sequence of genes

of known function. Thus, SSR markers could cor-

respond to candidate sequences relevant to horti-

cultural traits. In addition, SSRs can be genotyped

with a high degree of precision, permitting the

standardization of fingerprint data between labo-

ratories providing a reference cultivar set which

can be used in all experiments. This is the first

known report on the use of SSR markers for

creating genetic fingerprints and determining ge-

netic relationships among Iranian strawberry ge-

notypes.

The results clearly demonstrate that SSR markers

can be used in a genetic diversity study as well as

in genotypic identification of strawberries, as al-

ready noted by Bmnings et al. (2010) and Njuguna

et al. (2011). In the current study, a total number

of 118 alleles, detected using 20 SSR selective

markers, with an average of 5.9 allele per locus,

suggested the presence of a considerable polymor-

phism at studied microsatellite loci and revealed a

high level of genetic diversity in the existing straw-

berry germplasm (Table 3) which is close to results

obtained by Bmnings et al. (2010) and Njuguna et

al. (2011). Moreover we demonstrate that a low

number of polymorphic SSR markers could be ap-

plied to differentiate a large number of strawberry

genotypes and that SSR markers potentially detect

a higher level of DNA polymorphism than do other

DNA markers in strawberries. The effective number

of allele (ne) was taken into account for both the

number of alleles and their frequencies. It allowed

us to compare populations where the number and

distributions of alleles differ drastically. We also

tried to assess the effective number of alleles as a

corollary to the expected heterozygosity. PIC values

estimate the discriminatory power of a marker. The

mean PIC value for markers used in present study

was 0.60 and it ranged from 0.19 for locus FAC-

008 to 0.87 for locus UAFv7648 (Table 3).

Markers with high PIC values could be effecti-

vely used in genetic diversity studies in strawberry.

Despite the high number of alleles observed in most

SSR loci, a high number of alleles was observed in

exotic cultivars in comparison to local cultivars.

There are fewer alleles present in the local cultivars,

suggesting that the resource was constmcted from

a narrower genetic set than that which comprises

the bulk of the exotic cultivars. This finding is

somewhat anticipated as the exotic cultivars as-

sayed represent plant materials arising from many

different origins and breeding programs. Still, fu-

ture breeding efforts might benefit from a parallel

introgression of additional diversity from ranging

sources. SSR-based fingerprinting can guide the in-

crease in genetic diversity by selection of genoty-

pes with different alleles than those present in

existing breeding programs.

The existing genetic diversity observed in

studied cultivar, indicated the efforts underway

to widen the genetic base of strawberry for va-

rious traits. Information about current genetic di-

versity permits the classification of our available

germplasm into various/heterotic groups, which is

particularly important to hybrid/cross-breeding

programs in strawberry. Even though the genetic

mechanisms that explain heterosis are not fully un-

derstood, it is well documented that crosses bet-

ween unrelated and genetically distant parents,

show a greater hybrid-vigor than crosses between

closely related parents (Stuber 1994; Hallauer,

1999). There could be a possibility to exploit hy-

brid in strawberry. The previous crossing pro-

grams in most research centers of Iran were based

on only phenotypic characters.

The current study confirmed the importance of

molecular studies beside the morphological data in

detecting genetic variation among genotypes in se-

lecting diverse parents to carry out a new crossing

program successfully.

REFERENCES

Ashley M.V., Wilk J.A., Styan S.M.N., Craft K.J., Jones

K.L., Feldheim K.A., Lewers K.S. & Ashman T.L.,

2003. High variability and disomic segregation of mi-

crosatellites in the octoploid Fragaria virginiana Mill

(Rosaceae). Theoretical and Applied Genetics, 107:

1201-1207.

Bassil N.V., Njuguna W. & Slovin J.P., 2006a. EST-SSR

markers from Fragaria vesca L. cv. Yellow Wonder.

Molecular Ecology Notes, 6: 806-809.

Bassil N.V., Gunn M., Folta K. & Lewers K., 2006b. Mi-

crosatellite markers for Fragaria from ‘Strawberry

Festival’ expressed sequence tags. Molecular Eco-

logy Notes, 6: 473-476.

Botstein D., Withe R.L., Skolnick M. & Davis R.W.,

1980. Construction of genetix linkage map in man

Molecular variation of Iranian local and exotic strawberry (Fragaria * ananassa Duch.) varieties using SSR markers 25 1

using restriction fragment length polymorphisms.

American Journal of Human Genetics, 32: 314-331.

Brunings A.M., Moyer C., Peres N. & Folta K.M., 2010.

Implementation of simple sequence repeat markers

to genotype Florida strawberry varieties. Euphytica,

173: 63-75.

Cipriani G. & Testolin R., 2004. Isolation and characte-

rization of microsatellite loci in Fragaria. Molecular

Ecology Notes, 4: 366-368.

Davis T.M., Dimeglio L.M., Yang R., Styan S.M.N. & Le-

wers K.S., 2006. Assessment of SSR marker transfer

from the cultivated strawberry to diploid strawberry

species: functionality, linkage group assignment, and

use in diversity analysis. Journal of American Society

of Horticultural Science, 131: 506-512.

Eshghi S., Abdi G., Tafazoli E. & Yavari S., 2007. Straw-

berry Research and Biotechnology in Iran. Middle

Eastern and Russian Journal of Plant Science and

Biotechnology, 1: 39-41.

Garcia M.G., Ontivero M., Diaz Ricci J.C. & Castagnaro

A., 2002. Morphological traits and high resolution

RAPD markers for the identification of the main

strawberry varieties cultivated in Argentina. Plant

Breeding, 121: 76-80.

Gascuel O., 1997. BIONJ: an improved version of the NJ

algorithm based on a simple model of sequence data.

Molecular Biology and Evolution, 14: 685-695.

Gil-Ariza D.J., Amaya I., Botella M.A., Munoz Blanc J.,

Caballero J.L., Lopez-Aranda J.M., Valpuesta V. &

Sanchez-Sevilla J.F., 2006. EST-derived polymorphic

microsatellites from cultivated strawberry (Fragaria

x ananassa ) are useful for diversity studies and varie-

tal identification among Fragaria species. Molecular

Ecology Notes, 6:1195-1197.

Govan C.L., Simpson D.W., Johnson A. W., Tobutt KR..

& Sargent D.J., 2008. A reliable multiplexed micro-

satellite set for genotyping Fragaria and its use in a

survey of 60 F. x ananassa cultivars. Molecular

Breeding, 22: 649-661.

Gupta P.K. & Varshney R.K., 2000. The development

and use of microsatellite markers for genetic analysis

and plant breeding with emphasis on bread wheat.

Euphytica, 113: 163-185.

Hadonou A.M., Sargent D.J., Wilson F., James C.M. &

Simpson D.W., 2004. Development of microsatellite

markers in Fragaria , their use in genetic diversity

analysis, and their potential for genetic linkage map-

ping. Genome, 47: 429-438.

Hallauer A.R., 1999. Temperate maize and heterosis. In:

Coors J. and Pandey S. (Eds.). The Genetics and ex-

ploitation of heterosis in crops, CIMMYT, Mexico

City 17-22 Aug. 1997 ASA, Madison, WI. pp. 353-361.

James C.M., Wilson F., Hadonou A.M. & Tobutt K.R.,

2003. Isolation and characterization of polymorphic

microsatellites in diploid strawberry (Fragaria vesca

L.) for mapping, diversity studies and clone identifi-

cation. Molecular Ecology Notes, 3:171-173.

Lassner M.W., Peterson P. & Yoder J.I., 1989. Simulta-

neous amplification of multiple DNA fragments by

polymerase chain reaction in the analysis of transge-

nic plants and their progeny. Plant Molecular Biology

Reporter, 7: 116-128.

Lewers K.S., Styan S.M.N. , Hokanson S.C. & Bassil

N.V., 2005. Strawberry GenBank-derived and geno-

mic simple sequence repeat (SSR) markers and their

utility with strawberry, blackberry, and red and black

raspberry. Journal of American Society of Horticul-

tural Science, 130:102-115.

Luby J.J., Hancock J.F., Dale A. & Serge S., 2008. Re-

constructing Fragaria x ananassa utilizing wild F.

virginiana and F chiloensis\ inheritance of winter in-

jury, photoperiod sensitivity, fruit size, female ferti-

lity and disease resistance in hybrid progenies.

Euphytica, 163: 57-65.

Monfort A., Vilanova S., Davis T.M. & Arus P, 2006. A

new set of polymorphic simple sequence repeat

(SSR) markers from a wild strawberry (Fragaria

vesca) are transferable to other diploid Fragaria spe-

cies and to Fragaria x ananassa. Molecular Ecology

Notes, 6: 197-200.

Nathewet P„ Hummer K.E., Yanagi T., Iwatsubo Y. &

Sone K., 2010. Karyotype analysis in octoploid and

decaploid wild strawberries in Fragaria (Rosaceae).

Cytologia, 75: 277-288.

Njuguna W., Hummer K.E., Richards C.M., Davis T.M.

& Bassil N.V., 2011. Genetic diversity of diploid Ja-

panese strawberry species based on microsatellite

markers. Genetic Resources & Crop Evolution, 58:

1187-1198.

Perrier X., Flori A. & Bonnot F., 2003. Data analysis me-

thods. In: Hamon P., Seguin M., Perrier X. & Gla-

szmann J.C. (Eds.). Genetic diversity of cultivated

tropical plants. Science Publishers, Montpellier, pp.

43-76.

Powell W., Morgante M., Andre C., Hanafey M., Vogel

J., Tingey S. & Rafalski A., 1996. The comparison of

RFLP, RAPD, AFLP and SSR (microsatellite) mar-

kers for germplasm analysis. Molecular Breeding, 2:

225-238.

Rousseau-Gueutin M., Gaston A., Ai'nouche A., A'inou-

che M.L., Olbricht K., Staudt G., Richard L. & De-

noyes-Rothan B., 2009. Tracking the evolutionary

history of polyploidy in Fragaria L. (strawberry):

new insights from phylogenetic analyses of low-copy

nuclear genes. Molecular Phylogenetics & Evolution,

51: 515-530.

Sargent D., Fernandez-Fernandez F., Ruiz-Roja J., Su-

therland B., Passey A., Whitehouse A. & Simpson D.,

2009. A genetic linkage map of the cultivated straw-

berry (Fragaria x ananassa ) and its comparison to

252

S.A. Hosseini, E. Karami & R.Talebi

the diploid Fragaria reference map. Molecular Bree-

ding, 24: 293-303.

Sargent D.J., Clark J., Simpson D.W., Tobutt K.R., Arus P.,

Monfort A., Vilanova S., Denoyes-Rothan B., Rous-

seau M., Folta K.M., Bassil N.V. & Battey N.H., 2006.

An enhanced microsatellite map of diploid Fragaria.

Theoretical and Applied Genetics, 112: 1349-1359.

Sargent D.J., Hadonou A.M. & Simpson D.W., 2003. De-

velopment and characterization of polymorphic micro-

satellite markers from Fragaria viridis, a wild diploid

strawberry. Molecular Ecology Notes, 3: 550-552.

Sjulin T. & Dale A., 1987. Genetic diversity of North

American strawberry cultivars. Journal of American

Society of Horticultural Science, 112: 375-385.

Stuber C.W., 1994. Heterosis In Plant Breeding. Plant

Breeding Review, 12: 227-251.

Tessier C,, David J., This P., Boursiquot J.M. & Charrier

A., 1999. Optimization of the choice of molecular

markers for varietal identification in Vitis vinifera L.

Theoretical and Applied Genetics, 98: 171-177.

Torres A.M., Weeden N.F. & Marin A., 1993. Linkage

among isozyme, RFLP and RAPD markers in Vicia

faba. Theoretical and Applied Genetics, 85: 937-945.

Varshney R.K., Graner A. & Sorrels M.E., 2005. Genic

microsatellite markers in plants: Features and appli-

cations. Trends in Biotechnology, 23: 48-55.

Biodiversity Journal, 2013, 4 (1): 253-259

Fields survey of freshwater fishes in Upper Moei River, Sal

ween Basin, frontier of Thailand and Myanmar

Sitthi Kulabtong 1 *, Sawika Kunlapapuk 2 , Parin/a Pawangkanant 3 , Cha/ajit Deekrachang 4 ,Thiti Ruangsu-

wan 4 , Domes Limpivadhana 4 , Supapong Patarapongpan 4 & Chaiyapat Pramoolpol 4

'Save wildlife volunteer Thailand, Wangnoi District, Ayuttaya Province 13170, Thailand, e-mail: kulabtong201 l@hotmail.com

2 Aquatic Animal Production Technology Program, Faculty of Animal Sciences and Agricultural Technology, Silpakom University,

Phetchaburi IT campus, Petchaburi 76120, Thailand

3 Bansomdejchaopraya Rajabhat University, Bangkok 10600, Thailand

4 Department of Marine science, Faculty of Fisheries, Kasetsart University, Bangkok 10900, Thailand

Corresponding author

ABSTRACT The present paper reports on a field survey in Upper Moei River, at Phop Phra District, Tak

Province, Northwest Thailand, carried out in January and June 2010. Specimens encountered

belong to 5 orders, 8 families and 20 species of freshwater fishes. In particular, Schistura

waltoni, S. vinciguerrae, Lepidocephalichthys micropogon, Neonoemacheilus labeosus and

Gagata dolichonema are new records for Moei River; two species remain not fully identified

and, at the moment are reported as Devario sp. and Channa cf. gachua. The Thai local names

and distribution data of freshwater fishes are provided.

KEY WORDS freshwater fishes; Moei River; Salween Basin; Thailand.

Received 13.08.2012; accepted 09.12.2012; printed 30.03.2013

INTRODUCTION

Salween River System originates at the Hima-

laya mountain range and flows from the Tibetan

Plateau into the Andaman Sea. It drains a narrow

and mountainous watershed of 324,000 square kilo-

metres that extends into the countries of China,

Burma and Thailand.

In Thailand, Salween Basin has three large tribu-

taries namely Pai River, Suriya - Maekasat River and

Moei River (Vidthayanon et ah, 1997). Moei River,

at the frontier between Thailand and Myanmar, Tak

Province, is characterized by its own ecological fea-

tures which differentiate it from the other river sy-

stems of the Indo-Bunnese Province. Although it is

certainly of interest, nevertheless is poorly investi-

gated and little is known about freshwater fishes oc-

curring in this area. For this reason, a survey project

on freshwater fishes of the Upper Moei River at Phop

Phra District, Tak Province, Northwest Thailand

(Fig. 3) was carried out in January and June 2010.

We separated this area into 3 regions in accordance

to the ecosystems; namely:

1) Pool of the headwater stream. The average

width of the pool is about 5-10 m, average depth less

than 1 m, the bottom is a combination of clay and

sand, the stream is transparent and running slowly.

2) Small tributary streams, in the foothill. Ave-

rage width is about 5 m or less, depth is less than 1

m, the bottom is sandy, the stream is turbid and run-

ning fast.

3) Main stream of Upper Moei River, at the

frontier of Thailand and Myanmar. Average width

is about 100 m, average depth is about 1-2 m, the

bottom is sandy with clay, the stream is turbid and

running fast.

254

S. Kulabtong et alii

RESULTS

Order CYPRINIFORMES Bleeker, 1859

Family CYPRINIDAE Cuvier, 1817

Devario sp.

Distribution. This species (Fig. 3) is known

exclusively from Upper Moei River, Tak Province,

Thailand.

Habitat. Devario sp. was found in the pool of

the headwater stream.

Remarks. Body side and all fins of specimens

observed in this study are dark red, which in our

opinion, could be referred to mature males. In Thai-

land, many species of cyprinid fish of the genus De-

vario still have unclear identifications. Although

further studies are certainly needed, nevertheless we

believe this taxon to be different from other Devario

species of Thailand.

Thai local name. Pla seel bai pai.

Barilius infrafasciatus Fowler, 1934

Distribution. This species (Fig. 4) is known

from Chao Phraya River and Mekong basins, Thai-

land.

Habitat. B. infrafasciatus was found in the

small tributary streams.

Remarks. While alive, the specimens show

many clearly blue upright strips along the body.

Thai local name. Pla num murk.

Mystacoleucus argenteus (Day, 1888)

Distribution. This species (Fig. 5) is known

only from Salween Basin, frontier of Thailand and

Myanmar; Tenasserim Basin in Myanmar.

Habitat. M. argenteus was found in headwater

of the main stream.

Thai local name. Pla kee yok or Pla num lung.

Pethia stolitzkaenus (Day, 1869)

Distribution. This species (Fig. 6) is known

from Meklong River and Chao Phraya River, Thai-

land; Mekong Basin, Thailand and Laos; Salween

Basin, Thailand and Myanmar; Irrawaddy Basin in

Myanmar; Bengal, India.

Habitat. P. stolitzkaenus was found in the

headwater of the main stream.

Thai local name. Pla ma phai.

Systomus orphoides (Valenciennes, 1842)

Distribution. This species (Fig. 7) is native

Figures 1 , 2. Study area: Upper Moei River, Salween Basin, frontier of Thailand and Myanmar.

Fields survey of freshwater fishes in Upper Moei River, Salween Basin, frontier of Thailand and Myanmar

255

Figure 3. Devario sp., 55 mmSL. Figure 4. Barilius infrafasciatus, 38 mmSL. Figure 5. Mystacoleucus argenteus, 52 mmSL.

Figure 6. Pethia stoliczkana, 35 mmSL. Figure 7. Systomus orphoides , 48 mmSL. Figure 8. Neolissochilus stracheyi, 92

mmSL. Figure 9. Homaloptera bilineata, 43 mmSL. Figure 10. Acanthocobitis zonalternans, 29 mmSL. Figure 11. Neo-

noemacheilus labeosus, 66 mmSL. Figure 12. Schistura waltoni, 27 mmSL.

256

S. Kulabtong et alii

species from Myanmar, Thailand, Laos, Cambodia,

Viet Nam, Malaysia and Indonesia; introduced in

Europe and India.

Remarks. In this study, only one specimen was

found in the pool of the headwater stream.

Thai local name. Pla gam chum.

Neolissochilus stracheyi (Day, 1871)

Distribution. This species (Fig. 8) is known from

Meklong River, Chao Phraya River, Southeast

Basin and Peninsular Thailand; Mekong Basin in

Thailand, Laos, Cambodia and Viet Nam; Salween

Basin, Thailand and Myanmar.

Habitat. N. stracheyi was found in the pool of

the headwater stream.

Remarks. Juveniles show a clearly black blot

on the caudal peduncle which was never observed

in the adults.

Thai local name. Pla plong.

Family BALITORIDAE Swainson, 1839

Homaloptera bilineata Blyth, 1860

Distribution. H. bilineata (Fig. 9) is known

from Himalayan waters, Nepal; India; Tenasserim

Basin, Myanmar; Salween Basin, Thailand and

Myanmar.

Habitat. In this study, only one specimen of H.

bilineata was found in small tributary stream.

Thai local name. Pla jing jok.

Acanthocobitis zonalternans (Blyth, 1860)

Distribution. A. zonalternans (Fig. 10) is known

from Manipur, India; Irrawaddy Basin, Chindwin

Basin, Tenasserim Basin, Myanmar; Salween Basin,

Thailand and Myanmar; Mekong Basin and Penin-

sular Thailand; Peninsular Malaysia.

Habitat. This species was found in the head-

water of the main stream.

Thai local name. Pla kor ta narm.

Neonoemacheilus labeosus (Kottelat, 1982)

Distribution. In Thailand, N. labeosus (Fig.

11) is recorded only in Salween River at Mae

Sahm Leap, Mae Hong Son Province, Thailand.

New record for Moei River.

Habitat. In this study, only one specimen was

found in the main stream.

Remarks. In the genus Neonoemacheilus ex-

ternal characters are similar to those of many

loach-like fishes, i.e. Nemacheilus and Schistura.

But this genus is distinguished from the other ones

by the combination of the following characters: the

upper lip of the mouth is thick and fringed, adult

males show a suborbital flap (Kottelat, 1990).

Thai local name. Pla kor.

Schistura waltoni (Fowler, 1937)

Distribution. S. waltoni (Fig. 12) is known

from the Upper Chao Phraya River system. New

record for Moei River.

Habitat. This species was found in the pool of

the headwater stream.

Thai local name. Pla kor.

Schistura vinciguerrae (Hora, 1935)

Distribution. S. vinciguerrae (Fig. 13) is

known from India; Irrawaddy and Salween basins

in Myanmar and China. In Thailand, this species

was known only in Salween Basin. New record for

Moei River.

Habitat. This species was found in the pool of

the headwater stream.

Thai local name. Pla kor.

Family COBITIDAE Swainson, 1839

Acanthopsoides delphax Siebert, 1991

Distribution. This species (Fig. 14) is known

from Mekong, Salween and Chao Phraya basins,

Thailand.

Habitat. A. delphax was found in the main

stream.

Remarks. A. delphax is distinguished from A.

gracilentus by the combination of the following

characters: eye almost wholly in posterior half of

the head (in A. gracilentus eye almost wholly in

Fields survey of freshwater fishes in Upper Moei River, Salween Basin, frontier ofThailand and Myanmar

257

Figure 13. Schistura vinciguerrae, 58 mmSL. Figure 14. Acanthopsoides delphax , 40 mmSL. Figure 15. Lepidocephalichthys

berdmorei, 71 mmSL. Figure 16. Lepidocephalichthys micropogon, 68 mmSL. Figure 17 . Xenentodon cancila, 117 mmSL.

Figure 18. Mastacembelus armatus, 142 mmSL. Figure 19. Parambasis vollmeri, 34 mmSL. Figure 20. Channa cf. gachua,

136 mmSL. Figure 21. Channa striata, 129 mmSL.

258

S. Kulabtong et alii

anterior half of the head), snout long 2 times or less

than head length (in A. gracilentus is short), verte-

bral number is 37 or more (in A. gracilentus is

usually less than 37) (Siebert, 1991).

Thai local name. Pla rak kluy kae.

Lepidocephalichthys berdmorei (Blyth, 1860)

Distribution. L. berdmorei (Fig. 15) is known

from India; Bangladesh; Myanmar; China; Thai-

land; Laos; Peninsular Malaysia.

Habitat. This species was found in the pool of

the headwater stream.

Remarks. Two species of this genus, were

found in the study area. L. berdmorei in the head-

water stream and L. micropogon (Fig. 16) in the

main stream. Although the two species are very

similar, L. berdmorei is distinguished fromL. mi-

cropogon by the combination of the following

characters: caudal fin is truncate (in L. micropo-

gon is strongly forked), dorsal-fin origin usually

posterior to pelvic-fin origin (Vidthayanon et al.,

2005).

Thai local name. Pla eed.

Lepidocephalichthys micropogon (Blyth, 1 860)

Distribution. It is known from India, Bangla-

desh and Myanmar; It is a new record for Moei

River.

Habitat. L. micropogon was found in the main

stream.

Thai local name. Pla eed.

Order SILURIFORMES Cuvier, 1817

Family SISORIDAE Bleeker, 1858

Gagata dolichonema He, 1996

Distribution. This species is known from

Chindwin Basin, Manipur, India; Irrawaddy Basin,

Tenasserim Basin, Salween Basin in Myanmar; in

Thailand, this species was known only in Salween

Basin and is a new record for Moei River.

Habitat. G. dolichonema was found in the main

stream.

Thai local name. Pla ya kui.

Order BELONIFORMES Berg, 1940

Family BELONIDAE Bonaparte, 1832

Xenentodon cancila (F. Hamilton, 1 822)

Distribution. X. cancila (Fig. 17) is known

from India Sub-continent to Southeast Asia. Intro-

duced in America.

Habitat. This species was found in a small tri-

butary of the main stream.

Thai local name. Pla kra tung hav.

Order SYNBRANCHIFORMES Bonaparte, 1838

Family MASTACEMBELIDAE Bleeker, 1870

Mastacembelus armatus (Lacepede, 1800)

Distribution. M. armatus (Fig. 18) is known

from India Sub-continent to Southeast Asia.

Habitat. This species was found in the headwater

of the main stream

Thai local name. Pla kra ting.

Order PERCIFORMES Bleeker, 1859

Family AMB AS SID AE Bonaparte, 1832

Parambassis vollmeri Roberts, 1994

Distribution. This species (Fig. 19) is known

from Salween Basin, Thailand and Myanmar.

Habitat. P. vollmeri was found in a small tribu-

tary of the main stream.

Thai local name. Pla pan ghav.

Family CHANNIDAE Berg, 1940

Channa cf. gachua (Hamilton, 1 822)

Distribution. C. cf. gachua (Fig. 20) is known

from India Sub-continent to Southeast Asia.

Habitat. This species was found in the main

stream.

Remarks. In Thailand, the taxonomic status of

this taxon is still unclear, being reported from time

to time as C. gachua or C. limb at a.

Fields survey of freshwater fishes in Upper Moei River, Salween Basin, frontier ofThailand and Myanmar

259

Thai local name. Pla gung.

Channa striata (Bloch, 1793)

Distribution. C . striata (Fig. 21) is known from

Pakistan, India Sub-continent to Southeast Asia and

China; introduced in Europe, Africa, America, Phi-

lippines, Papua New Guinea and Korea.

Habitat. This species was found in the main

stream.

Thai local name. Pla chon.

ACKNOWLEDGEMENTS

The authors are grateful to two anonymous

referees for reviewing this manuscript, and to all

rangers of the Namtok Pha Charoen National Park,

Tak Province, Thailand for providing help during

the field survey. A very special thank to Dr. Cha-

valit Vidthayanon, Mr. Chaiwut Grudpan and Mr.

Anuratana tejavej for providing the identification

of some species; and to the Siamensis Team for

helping in collecting the specimens employed in

this study.

REFERENCES

Kottelat M., 1990. Indochinese nemacheilines. A revi-

sion of nemacheiline loaches (Pisces: Cyprinifor-

mes) of Thailand, Burma, Laos, Cambodia and

southern Viet Nam. Verlag Dr. Friedrich Pfeil, Miin-

chen, 262 pp.

Siebert D.J., 1991. Revision of Acanthopsoides Fowler,

1934 (Cypriniformes: Cobitidae), with the descrip-

tion of new species. Japanese Journal of Ichthyology,

38: 97-114.

Vidthayanon C., Kamasuta J. & Nabhitabhata J., 1997.

Diversity of freshwater fishes in Thailand. Office of

Environmental and Planning, Bangkok, 120 pp.

Vidthayanon C., Termvidchakorn A. & Pe M., 2005. In-

land fishes of Myanmar. Southeast Asian fisheries de-

velopment center, 160 pp.