Bonn zoological Bulletin (BzB), formerly “Bonner zoologische Beitrage”, is published by the Zoologisches Forschungsmuseum

Alexander Koenig (ZFMK), Bonn. Two regular issues of BzB are published per year; supplements on focus topics are produced

in irregular succession.

Subscription price is 46 € per volume (year), including supplements and shipping costs. For subscription, back issues and insti-

tutional exchange, please contact the ZFMK library (ZFMK, Bibliothek, Frau Diane Steinebach, Adenauerallee 160, D-53113 Bonn,

Germany, tel. +49 228-9122-216, fax: +49 228-9122-212; d.steinebach.zfmk@uni-bonn.de). The online version of BzB is avail-

able free of charge at the ZFMK homepage: http://www.zfmk.de/web/Forschung/Buecher/Beitraege/index.en.html.

Produced by Eva-Maria Levermann, Kaiserstr. 129, D-53113 Bonn, Germany; emlevermann@netcologne.de.

Printed and bound by DCM, Werner-von-Siemens-Str. 13, D-53340 Meckenheim, Germany.

Bonn zoological Bulletin

Editor-in-Chief

Fabian Herder, Zoologisches Forschungsmuseum Alexander

Koenig (ZFMK), Ichthyology Section, Adenauerallee 160,

53113 Bonn, Germany,

tel. +49 228-9122-255, fax: +49 228-9122-212;

f.herder.zfmk@uni-bonn.de

Guest Editor

Philipp Wagner, Zoologisches Forschungsmuseum Alexan-

der Koenig (ZFMK), Herpetology Section, Adenauerallee

160, 53113 Bonn, Germany,

tel. +49 228-9122-254, fax: +49 228-9122-212;

philipp.wagner.zfmk@uni-bonn.de

Editorial Board

Dirk Ahrens, Insects: Coleoptera, ZFMK,

tel. +49 2289122286, fax: +49 228-9122-332:

d.ahrens.zfmk@uni-bonn.de

Wolfgang Bohme, Amphibians and Reptiles, ZFMK,

tel. +49 228-9122-—250, fax: +49 228-9122-212;

w.boehme.zfmk@uni-bonn.de

Netta Dorchin, Insects: Diptera, ZFMK,

tel. +49 228-9122-292, fax: +49 228-9122-212;

n.dorchin.zfmk@uni-bonn.de

Renate van den Elzen, Birds, ZFMK,

tel. +49 228-9122-231, fax: +49 2289122212;

r.elzen.zfmk@uni-bonn.de

Bernhard Huber, Invertebrates except Insects, ZFMK,

tel. +49 2289122294, fax: +49 228-9122-212;

b.huber.zfmk@uni-bonn.de

Rainer Hutterer, Mammals, ZFMK,

tel. +49 228-9122—261, fax: +49 228-9122-212;

r.hutterer.zfmk(@uni-bonn.de

Gustav Peters, Mammals, ZFMK,

tel. +49 2289122262, fax: +49 2289122212:

g.peters.zfmk@uni-bonn.de

Bradley Sinclair, Canadian National Collection of Insects,

Ottawa Plant Laboratory — Entomology, CFIA, K.W. Neat-

by Bldg., C.E.F., 960 Carling Ave., Ottawa, ON, Canada

K1A 0C6, tel. + 1 613-759-1787, fax: + 1 613-759-1927;

bradley.sinclair@inspection.ge.ca

Dieter Stiining, Insects except Coleoptera and Diptera,

ZFMK, tel. +49 228-9122-—220, fax: +49 228-9122-212;

d.stuening.zfmk@uni-bonn.de

Advisory Board

Theo C. M. Bakker, Rheinische Friedrich-Wilhelms-Univer-

sitat, Institut fiir Evolutionsbiologie & Okologie, 53113

Bonn, Germany, tel. +49 228—73-5 130, fax: +49 228-73-

2321; t.bakker@uni-bonn.de

Aaron M. Bauer, Villanova University, Department of Biolo-

gy, 800 Lancaster Avenue, Villanova, PA 19085-1699,

USA, tel. +1 610-519-4857, fax: +1 610-519-7863; aa-

ron.bauer@villanova.edu

Wieslaw Bogdanowicz, Museum and Institute of Zoology,

Polish Academy of Sciences, Wilcza 64, 00-679 Warszawa,

Poland, tel. +48 22628-7304, fax: +48 22629-6302;

wieslawb@miiz.waw.pl

Matthias Glaubrecht, Museum fiir Naturkunde Berlin, Leib-

niz-Institut fiir Evolutions- und Biodiversitatsforschung an

der Humboldt-Universitat zu Berlin, Invalidenstrasse 43,

10115 Berlin, Germany,

tel. +49 30-2093-8504/ 8400, fax: +49 030-—2093-8565;

matthias. glaubrecht@mfn-berlin.de

Jeremy D. Holloway, The Natural History Museum, Depart-

ment of Entomology, Cromwell Road, London, SW7 5BD,

U.K.; j-holloway@nhm.ac.uk

Boris KryStufek, Slovenian Museum of Natural History, P.

O. Box 290, Ljubljana, Slovenia; boris.krystufek@zrs.upr.si

Wolfgang Schawaller, Staatliches Museum ftir Naturkunde,

Rosenstein 1, 70191 Stuttgart, Germany,

tel. +49 711-8936-221, fax: +49 711-8936-100;

schawaller.smns@naturkundemuseum-bw.de

Ulrich K. Schliewen, Department of Ichthyology, Bavarian

State Collection of Zoology, Minchhausenstr. 21, 81247

Munchen, Germany, tel. + 49 89-8107—110;

schliewen@zsm.mwn.de

Michael Schmitt, Ernst-Moritz-Arndt-Universitat, Allge-

meine & Systematische Zoologie, Anklamer Str. 20, 7489

Greifswald, Germany,

tel. +49 3834864242, fax: +49 3834 86-4098:

michael.schmitt@uni-greifswald.de

W. David Sissom, Dept. of Life, Earth and Environmental

Sciences, W. Texas A. & M. University, WITAMU Box

60808, Canyon, Texas 79016, USA, tel. +1 806-651-2578,

fax: +1 806-651-2928; dsissom@mail.wtamu.edu

Miguel Vences, Technical University of Braunschweig, Zoo-

logical Institute, Spielmannstr. 8, 38106 Braunschweig,

Germany, tel. + 49 531-391-3237,

fax: + 49 531-391-8198; m.vences@tu-bs.de

Erich Weber, Eberhard-Karls-Universitat, Zoologische

Schausammlung, Sigwartstr. 3, 72076 Tubingen,

tel. +49 70712972616, fax +49 7071—295170;

erich.weber@uni-tuebingen.de

Editorial

On occasion of his 66th birthday and his retirement from

his position as curator of herpetology after nearly 40 years

at the Museum Alexander Koenig, I had the great pleas-

ure to be the editor of a Festschrift, and the co-ordinator

of a colloquium honouring the work of Wolfgang Bohme.

The title of this special issue of the Bonn zoological Bul-

letin and the colloquium is a combination of Herpetolo-

gia, referring to several symposia (e.g. the two SEH meet-

ings) he organized during his time at this institute, and

Koenigiana, referring to ‘his’ museum.

During his time at curator from 1971 onwards, he in-

creased the at this time ‘sleeping’ herpetological collec-

tion with less than 9500 specimens to one of the leading

collections in Germany and Europe with about 100.000

vouchers. His scientific work 1s documented in more than

530 publications and with his enthusiasm he influenced

and stimulated 32 PhD (ten more candidates are still work-

ing on their theses), 145 diploma and 35 state-examen stu-

dents, some of them working today as scientists in

renowned German and European institutions.

As his student, I was influenced since my first time at the

University of Bonn and the Museum Koenig by his cours-

es and lectures and he positively forced my decision to

work with herpetological systematics and the Afrotropi-

cal region.

These influences Wolfgang B6hme had on many upcom-

ing scientists and his numerous cooperations are in part

reflected by the impressive set of articles about various

topics published in the present issue of Bonn zoological

Bulletin, written by friends, colleagues and former stu-

dents. These articles are partly dealing with his main sci-

entific fields of interests: Africa, chameleons, or monitor

lizards, but also with ‘side’-fields like lacertids, nomen-

clature or the history of herpetology. Many articles are first

descriptions of new amphibian and reptile species named

after Wolfgang Bohme, which are the ‘living manifesta-

tions’ of his impressive work. Moreover, the two non-her-

petological articles show that he has also some impact in

other zoological disciplines.

As guest editor, I would like to thank all the reviewers for

their helpful comments. Without their fast work it would

not have been possible to have this issue ready right in

time. Especially, I would like to thank Brian Sinclair who

did the English in review in some of the articles.

Pe ladear

Philipp Wagner (Guest Editor)

Bonn, November 2010

Pe 0a

PGP TER eit

ph |

iter), Saas

pines ‘ice . Me wn Sa Leth Age oe Wy |

ne es ae ee a Co 5

‘Morita: ine eT TR

pasate ll RE ea

ree ae

es ha

bby

= Mas

Preface

This volume is dedicated to a scientist, who during the past

four decades transformed the herpetology collection of

Museum Koenig into one of the most prominent European

research facilities for reptile systematics and biology. Un-

der his management, the comparatively young collection

of reptiles and amphibians in Bonn has grown tenfold and

became one of the most important ones in Germany. More-

over, he dedicated his time and energy not only to science,

but also to the development of the institute, which has been

his second home. Thanks to his commitment and person-

ality, he became the undisputed head of the vertebrate de-

partment, which he still leads today. He also was, and still

is, the link between the museum and the many experts

among laypersons, who contribute substantially to the

growth of scientific knowledge and otherwise shy from

direct contact with professionals. With the same spirit he

cooperated with the Alexander Koenig Gesellschaft, the

friends of the museum society.

Wolfgang Bohme is a passionate zoologist whose enthu-

siasm infected several generations of students, many of

which later became successful scientists themselves. He

regularly takes students on field courses, where he teach-

es them how to discover, observe and capture snakes,

lizards and frogs, as well as identify other animals such

as grasshoppers and bees. His favourite destination for this

purpose has always been Lake Neusiedl that became a

popular destination among biology students in Bonn.

Wolfgang Bohme frequently invited like-minded zoolo-

gists from other countries to work with him in Bonn or

to attend German conferences, and it was obvious that he

was thrilled for the opportunity to learn of other people’s

discoveries out of pure fascination by animals and with-

out any jealousy.

During the past 40 years, the Museum’s directors were

grateful for his public-relations work. He frequently of-

fered evening lectures for the general public with an en-

joyable combination of adventure, discovery, and BOhme’s

characteristic humour. He authored popular articles for the

media and for the institute’s series “Tier und Museum”

(later “Koenigiana’’), a publication for which he acted as

an editor. Similarly, he was always ready to take part in

non-scientific events, where he participated in activities

such as reading poems by his ancestor Wilhelm Busch,

whose funny bone he obviously inherited.

With this volume on the occasion of his retirement from

official duties, we want to thank him for his outstanding

contribution to herpetology and to the development of Mu-

seum Koenig. I hope this is just the beginning of a new

period of active research, for which we will always have

a space available for him in our institute.

J. Wolfgang Wagele (Director)

Bonn, November 2010

j Sidaniteite

‘ sine

we ak

bia ety

Se)

wee ey wo Wi Te .

Ls “ ie ahi te

F eetlornty ma) ith

A ant ie 10

Greetings from the SEH

I met Wolfgang Bohme for the first time at the very be-

ginning of my carrier, just after my graduation. I remem-

ber that he was extremely friendly when talking about

lizards, the Mediterranean basin and his deep love for

Africa and the tropics, making my first impact with the

international professional herpetological world easy and

smooth. Throughout our long professional relationship,

Wolfgang has always been extraordinarily open to new

ideas, sharing research projects with a number of scien-

tists worldwide and prompting the creation of a network

of enthusiastic believers, such as for the circum-Mediter-

ranean Podarcis fans. | remember very well the begin-

ning of the “saga” of the Symposia on the Lacertids of the

Mediterranean, together with Nicholas E. Arnold, Massi-

mo Capula, Valentin Pérez-Mellado, Efstratios Valakos

and, which 1s still successfully ongoing. In the nineties,

as President of the Societas Europaea Herpetologica,

Wolfgang Bohme put a tremendous effort into establish-

ing collaborations between the national European herpeto-

logical societies. He also opened the doors of the herpeto-

logical collection of the Alexander Koenig Museum to a

multitude of island zoologists, inducing the full scientif-

ic exploitation of such an extraordinary biological treas-

ure. His outstanding scientific activity, together with his

humanity and intellectual generosity make Wolfgang

Bohme one of the reference point in and out my profes-

sional life and Ill always be grateful to him and his love-

ly family for such a warm and positive friendship.

Claudia Corti

(President Societas Europaea Herpetologica)

Bonn, November 2010

Wee ee

Tete eh

iy eae ; “a aii oi nin wi on ees

Rover See ie} it iti: aay, wih ig

oe iowoaanladi dota sal

poenllle, - ry) eaten) at bidil OE

| ned tis Ae dna li weit

hah @ aa Salat Hiriay i ribs rie an

Aly AD quiere fey / hens & wean

Ty LD ET EC eo

Greetings from the DGHT

On the occasion of the retirement of Prof. Dr. Wolfgang

Bohme, curator of herpetology, head of the vertebrate de-

partment, and deputy director of the Zoologisches

Forschungsmuseum Alexander Koenig, we were honoured

with an invitation to direct a few words to the readers of

this special issue of the Bonn Zoological Bulletin.

We sincerely appreciate this opportunity, as the name

Wolfgang Bohme is not only connected to a distinguished

career in herpetology, but also to a person who always

made an effort to keep a close connection between pro-

fessional scientific research and amphibian and reptile am-

ateurs all over the world. Wolfgang Bohme’s achievements

in this particular field of interaction are not less than out-

standing. There is probably no other herpetologist whose

research benefited as much from data supplied by ama-

teurs, and there are countless thankful amateurs whose

pastime has been deeply enriched by the scientific advice

and the stimulating attitude of Wolfgang Bohme. Sharing

data, knowledge and specimens with people operating out-

side the scientific community was paramount for many

spectacular discoveries and the furtherance of knowledge

about the biology and ecology of amphibian and reptile

species, many of which are considered to be well-known

today. Decades ago, it was mainly these amateur enthu-

siasts who travelled to remote and previously unexplored

exotic areas in search of their “pets” and returned with

treasures of data and photographs that gave rise to subse-

quent research projects. It is Wolfgang Bohme’s merit and

strength to have fostered and encouraged this tradition of

interaction for several decades.

Bringing professionals and amateurs together and promot-

ing their dialog is also one main characteristic of the

Deutsche Gesellschaft fiir Herpetologie und Ter-

rarienkunde (DGHT), as is apparent by the society’s name.

As a consequence, there was, and is, some kind of “nat-

ural relationship” between Wolfgang Bohme and the

DGHT, and this relationship has been a sustained and fruit-

ful one. Shortly after he took his position at the Museum

Koenig, he founded the “DGHT Stadtgruppe Bonn” in

1973. Later, Wolfgang B6hme became president of the so-

ciety and held this position from 1983 to 1991. He was

furthermore a founding member of the DGHT Work

Group Literature and History, and a regular member of the

Work Groups Chameleons and Lacertids. In 1994, Bohme

was made an honorary member of the DGHT, and very

recently, the current executive board asked him to join its

advisory council. And so it is for many reasons that

Bohme’s name and personality are closely interlinked with

the DGHT.

The DGHT as a society, DGHT members and associates,

as well as many students and colleagues owe a lot to Wolf-

gang Bohme. Despite facing his ‘official’ retirement as a

herpetologist now, we are convinced that few things will

change and that his fruitful relationships with the DGHT

will continue for many years to come. Dear Wolfgang

Bohme, thank you for everything.

The DGHT executive board

(Peter Buchert, Jorn Kohler, Axel Kwet, Stefan Lotters,

Wolfgang Schmidt, Holger Vetter)

Bonn, November 2010

it i (Aon w

da K cy wile Ws 4 1a a

\ Wyn

my a ni anil teh

ap |) a Toke vubeunite ry

byt if eis Me, eligte’ by A aie

wud rn i tie sal

Curriculum Vitae of Wolfgang Bohme

Born November 21, 1944 at Schdnberg near Kiel

(Schleswig-Holstein, Germany) as the 3rd child of the mu-

sician Ferdinand B6hme (1906-1971) and his wife Hed-

wig, born Stange (1913-1992). Ferdinand Bohme was vi-

olinist of the first desk at the municipal orchestra in the

opera house of Kiel and subject teacher for violine, both

privately and at the Pedagogic College of Kiel.

From a first marriage (1970-1974) father of one daugh-

ter (Judith). Since 1974 married with Roswitha Bohme.

From this marriage two sons (Moritz and Peter).

Wolfgang Bohme finished highschool (“Kieler Gelehrten-

schule”’) in Kiel, April 1965, and subsequently studied zo-

ology, botany and paleontology at the “Christian-Al-

brechts-Universitat” of Kiel. Doctoral degree with a the-

sis on hemipenis morphology in lacertid lizards in June

1971 under supervision of Prof. Dr. Wolf Herre.

From August 1971 until December 2010 head of the Her-

petology Section of the “Zoologisches Forschungsmuse-

um Alexander Koenig” (ZFMK) in Bonn, Germany. Since

then, increase of the herpetological collection from less

than ca. 9.600 specimens to ca. 100.000. From October

1992 to his retirement Head of the Vertebrate Department

and Vice Director of the Forschungsmuseum.

Since winter semester 1980/81 participation in teaching

at the “Rheinische Friedrich-Wilhelms-Universitat” Bonn;

habilitation (thesis on genital morphology in the Sauria)

and venia legendi received in May 1988. Since then reg-

ular teaching and supervision of more than 129 master and

32 doctoral theses, plus 35 theses for state examen. Award-

ed full professorship (“‘apl. Professor’) April 1996.

Fields of Research. Systematics, ecology and biogeog-

raphy of amphibians and reptiles, with taxonomic focus

on lizards (chameleons, monitor lizards) and its Tertiary

and Quaternary predecessors (e.g. lizard amber fossils);

genital morphology of squamates. Geographical focus on

the western Palearctic Region (founder and editor of

“Handbuch der Reptilien und Amphibien Europas’”, edi-

tion of 5 vols. between 1981 and 1999) and West Africa

(six larger field excursions to West/Central Africa, each

with 1—3 months duration: Spring 1973 Cameroon, win-

ter 1973/74 Cameroon, winter 1975/76 Senegal/Gambia,

1993 Guinea, 1998 Cameroon, 1999 crossing the Sahara

in both directions: Morocco, West Sahara, Mauritania,

Senegal). In 2002 an extensive educational trip through

the eastern half of the USA. Currently 530 sci. publica-

tions.

Working group. Members of his ZFMK herpetological

working group were/are active in the tropics of Central

and South America (Costa Rica, Venezuela, Peru, Bolivia,

Chile), Africa (Guinea Bissau, Gambia, Benin, Cameroon,

Gabon, Kenya, Zambia) and Madagascar, and of SE Asia

(Vietnam, Indonesia).

Societies. September 1979 host and founding member of

the “Societas Europaea Herpetologica”, which publishes

“Amphibia-Reptilia’, simultaneously founded at ZFMK,

and today the leading journal of its discipline in Europe.

Elected for president of the society 1993 in Barcelona, re-

elected for another 4 years 1997 in Prague.

From 1983 to 1991 Chairman of the “Deutsche

Gesellschaft fiir Herpetologie und Terrarienkunde”

(DGHT) which during this period grew from ca. 2000 to

over 5000 members, thus becoming the largest associa-

tion of its discipline in the world. Wolfgang Bohme has

the Honorary membership of the DGHT since 1994.

From 2000 to 2002 founding chairman of the working

group “Literatur und Geschichte der Herpetologie” of the

DGHT with its own periodical “Beitrage zur Literatur und

Geschichte der Herpetologie und Terrarienkunde’”, after

two issues, from 2003 onwards, continued as “Sekretar”.

From 2001 to 2005 member of the Commission of the “In-

ternational Committee of Zoological Nomenclature”

(ICZN).

From October 1996 to December 2006 President of the

“European Association of Zoological Nomenclature”

(EAZN).

Elected as ‘Honorary foreign member’ of the American

Society of Ichthyologists and Herpetologists in 2008.

Awarded with the Alexander Koenig Medal in 2010, by

the Alexander-Koenig-Gesellschaft, sponsoring society of

ZFMK.

Ph. Wagar

Philipp Wagner (Guest Editor)

Bonn, November 2010

eT Liars

War Lah F a wu

; See eal al fay

POLED |

i ; Pal wed

rie a he be)

2a} tan

SelveW eet “nai ire

4 be rv 7, v ia ave votive :

Poe

MY — ;

ay ste a 1 ene

peo sis anti

Bonn zoological Bulletin Volume 57

Issue 2 pp. 111-118 Bonn, November 2010

Sharing resources in a tiny Mediterranean island?

Comparative diets of Chalcides ocellatus and Podarcis filfolensis in Lampione

Miguel A. Carretero!*, Pietro Lo Cascio, Claudia Corti3.! & Salvatore Pasta‘

'CIBIO, Centro de Investigag¢ao em Biodiversidade e Recursos Genéticos, Campus Agrario de Vairao,

P-4485-661 Vairao, Portugal; E-mail: carretero@mail.icav.up.pt

2Associazione “Nesos”, Via Vittorio Emanuele 24, 98055 Lipari (ME), Italy; E-mail: plocascio@nesos.org.

3Museo di Storia Naturale dell’ Universita di Firenze, Sezione di Zoologia “La Specola”, Via Romana 17,

I1-50125, Firenze, Italy; E-mail: claudia.corti@unifi.it

4via V.F. 19, 60/A, I-90126, Palermo, Italy; E-mail: salvatore.pasta@alice.it

*corresponding author: E-mail: carretero@mail.icav.up.pt tel.+351252660400 fax.+351252661780

Abstract. The insular lizard microcommunity inhabiting the Lampione islet (Pelagian islands, S Italy) is constituted by

a skink (Chacides ocellatus) and a lacertid lizard (Podarcis filfolensis). Their diet composition (taxa and sizes) during

spring-early summer were analysed based on 131 faecal pellets, which could be individually assigned to a lizard species

and sex (only in P. filfolensis). The diet of C. ocellatus was biased towards hard prey of medium to large sizes (Coleoptera,

insect larvae). Podarcis filfolensis displayed a more diverse prey spectrum including Formicidae, Coleoptera, insect lar-

vae and minor prey not consumed by the skink, but restricted to the small items; differences between sexes were mini-

mal. Both species were partially herbivorous. Evidence of cannibalism was found for P. filfolensis and C. ocellatus preyed

upon P. filfolensis. Pseudocommunity analysis does not support community structure but instead points to convergence

in trophic strategies between both species due to insular conditions. Evolutionary history, rather than resource partition-

ing, seems responsible for the moderate trophic overlaps recorded and even may explain why both species coexist under

the harsh conditions of this tiny islet.

Keywords. Diet; Chacides ocellatus; Podarcis filfolensis; community ecology; islands; Lampione.

INTRODUCTION

For decades, lizards have constituted fruitful model organ-

isms for studies in community ecology, diet being the most

studied ecological dimension (see review by Luiselli

2008). Many of the initial and current studies are focused

on the most complex assemblages, namely those in trop-

ical or desert areas (Arnold 1984; Pianka 1986; Vitt &

Caldwell 1994; Vitt & Carvalho 1995; Vitt & Zani 1998;

Vitt et al. 2000; Akani et al. 2002, amongst many others),

where environmental stability could allow interspecific re-

lationships promoting detectable community structure

(Winemiller & Pianka 1990). In contrast, studies on lizard

assemblages inhabiting temperate regions are less abun-

dant (but see Pérez-Mellado 1982; Strijbosch et al. 1989;

Pollo & Pérez-Mellado 1991; Carretero & Llorente 1993;

Capula & Luiselli 1994; Carretero et al. 2006; Kuranova

et al. 2005; Rouag et al. 2007). This is probably because

these are composed of less species but also because abi-

otic restrictions of seasonal climates overcoming the role

of species interactions would make community structure

less expectable to appear (Barbault 1991). In fact, a

Bonn zoological Bulletin 57 (2): 111-118

recent meta-analysis concluded that lizards of most (80%)

communities worldwide do not partition their food re-

sources but are randomly organised in the trophic niche

axis (Luiselli 2008). Instead, increasing evidence is

demonstrating that the influence of evolutionary history

on the lizard trophic traits is stronger than previously

thought. Specifically, niche conservatism rather than

species interactions accounts for many trophic differences

between the community components (Brooks & McLen-

nan 2002; Webb et al. 2002; Vitt et al. 2003; Vitt & Pi-

anka 2005; Mesquita et al. 2007; Espinoza et al. 2008).

Within this context, lizards inhabiting small Mediterranean

islands constitute an apparent paradigm of simplicity. On

one hand, strong seasonality and impoverished trophic re-

sources impose severe constraints to insular lizards (Pérez-

Mellado & Corti 1993), higher than those in adjacent

mainland, making lizard communities inhabiting Mediter-

ranean islets extremely poor when compared to those on

big islands or on the continent (Mylonas & Valakos 1990).

©OZFMK

112 Miguel A. Carretero et al.

On the other hand, the exposition to less potential com-

petitors and predators and subsequent increase in the con-

specific density (Carretero 2004, 2006) may open new

possibilities for enlarging trophic niche (Pérez-Mellado &

Corti 1993; Carretero 2004). Nevertheless, evidence on

lacertid lizards indicates that the ecological response to

these shifted environmental pressures is not immediate and

some evolutionary time is needed to develop profound

trophic adaptations (Pérez-Mellado & Corti 1993; Car-

retero 2004). Literature on the diet of Mediterranean

lizards in small islands is abundant but usually focused

on a single species (reviewed in Van Damme 1999; Pérez-

Mellado & Traveset 1999; Carretero 2004), studies at mul-

tispecies level being rare (Nouira 1983).

Here, the diet composition of a microinsular community

constituted by two divergent lizard species is analysed dur-

ing spring-summer considering both inter- and intraspe-

cific variation and compared to other populations of the

same species. Moreover, the hypothesis of community

structure at the trophic level is specifically tested against

the null hypothesis of random trophic overlap.

MATERIAL AND METHODS

Study area

Lampione (35°33’00”N—12°19’11”E) is a small islet lo-

cated 17 km off the W coast of Lampedusa (Pelagian Is-

lands) and 110 km off Tunisia, in the Channel of Sicily.

The area is 0.021 km? and the maximum altitude is 36 m

a.s.l. From a geological point of view, the islet is composed

of dolomitised carbonates belonging to formations of the

Tunisian offshore, and its definitive isolation from North

Africa was since 18,000 years B.P. (Pasta 2002). The cli-

mate is arid, characterised by strong drought periods in

summer and by an average annual rainfall lower than 300

mm. The vegetation is mainly dominated by halo-ni-

trophile perennial shrubs. The occurrence of a large colony

of gulls causes a strong level of soil eutrophisation and

nutrient imbalances, which allow the expansion of the ni-

trophile biannual Malva veneta Soldano, Banfi & Galas-

so, 2005 during the late spring on the top of the islet. Lam-

pione is at present-day uninhabited, but late-Roman ru-

ins document an early human presence, though probably

only seasonal (Pasta & Masseti 2002). The invertebrate

assemblage of the islet reflects several features typical of

microinsular and arid environments, namely a low num-

ber of species (about 30, excluding flying insects; Lo Cas-

cio 2004, Lo Cascio unpublished), an over-representation

of some groups (e.g., five species of Coleoptera Tenebri-

onidae; Canzoneri 1972; Lo Cascio unpublished), some

being found at extremely high densities.

Bonn zoological Bulletin 57 (2): 111-118

Study lizards

Two lizard species inhabit the islet: the Maltese wall lizard,

Podarcis filfolensis (Bedriaga, 1876), (Squamata: Lacer-

tidae) and the Ocellated skink, Chalcides ocellatus

(Forskal, 1775) (Squamata: Scincidae). The first is a gen-

uine insular species endemic to the Maltese Archipelago

and two Pelagian islands, Linosa and Lampedusa, where

it is said to be introduced in early or recent time (Capula

2006; Lo Cascio & Corti 2008). The Ocellated Skink,

Chalcides ocellatus, is widely distributed on the Sindian-

Mediterranean area and 1s recorded for all the Pelagian is-

lands (Turrisi & Vaccaro 2006); the origin of the islet pop-

ulation is probably related to the Pleistocene connections

between Lampione and the nearby North-African main-

land (see Grasso et al. 1985). The first data on the occur-

rence of such species in Lampione were reported by Lan-

za & Bruzzone (1961). Population density is extremely

high for both species, only for Podarcis filfolensis being

estimated using standard methods (7500-8000 individu-

als/ha, see Lo Cascio et al. 2006). From field observations,

the ratio of apparent abundance between this species and

Chalcides ocellatus was 3:1 approximately (Lo Cascio un-

published).

Sampling and lab methods

Field sampling was carried out during several visits in late

spring/early summer of 2004 and 2005, when both species

show the peak of annual activity (Corti & Lo Cascio

2002). Faecal pellets were obtained from adult Podarcis

filfolensis and Chalcides ocellatus; all the specimens were

measured (snout-vent length, SVL) to the nearest 0.1 mm

using a digital calliper, sexed (in P. fi/folensis) and released

back in the site of capture. Whereas adult P. filfolensis

could be easily sexed in the field using sexual secondary

characters (Corti & Lo Cascio 2002) and hemipenis ever-

sion, the reduced external differences and the impossibil-

ity for analysing of internal cloaca did not allow identi-

fying the sexes of C. ocellatus in field (see Badir 1959;

Capula & Luiselli 1994).

The faecal contents were examined under stereoscopic mi-

croscope (10-40X). Remains were identified to Opera-

tional Taxonomy Units (OTUs) approximated here to the

order/family level. Item counting was based on cephalic

capsules, wings and legs, following the minimum num-

bers criterion by sample. When possible, prey lengths were

obtained measuring the remains with a micrometer eye-

piece and calculated by using regression equations (H6-

dar 1997) and then assigned to classes of 5 mm in length.

©OZFMK

Diet of Lampione lizards 113

Statistical methods

Three diet descriptors were used: the percentage of pel-

lets containing an OTU (%P), the percentage of numeric

abundance of each OTU (%N), and the use index (IU)

(Jover 1989); the latter is preferred because combines %N

and %P; the importance of a certain OTU in the diet be-

ing estimated by calculation of the homogeneity of its con-

sumption throughout all the individual contents (Carretero

2004). Brillouin’s index was used to estimate the diet di-

versity according to Magurran (2004). For a given sam-

ple, the average individual diversity (Hi) was obtained by

averaging the diversity values of each pellet whereas the

(asymptotic) population diversity (Hp) was estimated

through jack-knife resampling (Jover 1989, Magurran,

2004), that is, recalculating the total diversity missing out

each sample in turn and generating pseudovalues, which

are normally distributed. Whereas Hi and Hp have stan-

dard errors and allow statistical inference, the total accu-

mulated diversity (Hz) of all pellets is a fixed value only

provided for comparing with the literature (Ruiz and Jover

1981).

Overlap between diets was evaluated by means of the Pi-

anka’s index (Pianka 1973) applied on the IU values of

OTUs and size classes (Carretero et al. 2006) using the

Ecosym software (Gotelli & Entsminger 2004). Hypoth-

esis of non-random similarity (Gotelli & Graves 1996) was

tested using the RA2 (niche breadth relaxed / zero states

retained) and RA3 (niche breadth retained / zero states

reshuffled) Monte Carlo randomisation algorithms (Wine-

miller & Pianka 1990) generating 1000 pseudomatrices

considering each OTU equiprobable.

Normality (Lilliefors test) and homoscedasticity (Fisher

test) were assured prior to the application of parametric

tests. Individual diversity and number of prey per pellet

were compared using one-way ANOVA. Population diver-

sity estimations obtained through jack-knife could not be

compared using ANOVAs since the software provides on-

ly mean+SE and diversity is non-additive (Carretero &

Llorente 1993). Instead, t-tests corrected for multiple tests

(using False Discovery Rate, FDR, Benjamini & Hochberg

1995) were applied.

RESULTS

Pellets were obtained from 45 C. ocellatus and 86 P. fil-

folensis (58 males and 28 females). The SVLs in mm,

mean+SE (range) of such specimens were 104.02+2.26

(62.0—140.0) for C. ocellatus, 65.45+0.56 (54.0—72.0) for

male P. filfolensis, and 60.00+0.53 (44.5—67.0) for female

P. filfolensis, The skinks were, in fact, much bigger than

the wall lizards which displayed slight sexual size dimor-

Bonn zoological Bulletin 57 (2): 111-118

phism favourable to males (ANOVA F, jy = 267.58, P <

10-6, Scheffé tests C. ocellatus-P. filfolensis males

P< 10°, C. ocellatus-P. filfolensis females P< 10-6, P. fil-

folensis males-females P = 0.05).

The number of prey items by pellet (Table 1) was simi-

lar between both species and between male and female P.

filfolensis (ANOVA F j53 = 0.45, P = 0.64). However, the

taxonomic composition of the diet (Table 1) showed sub-

stantial interspecific differences, whereas intersexual dif-

ferences within P. filfolensis were minor. Both species con-

sumed important amounts of plant matter (IU = 41.61%

in C. ocellatus and IU = 18.37% in P. filfolensis). With-

in P. filfolensis, males (IU = 22.55%) used this resource

more than females (IU = 9.69%). Moreover, C. ocellatus

also consumed seeds and fruits (IU = 18.31%) but P. fil-

folensis almost did not IU = 1.24%).

Regarding the prey of animal origin (Table 1), the diet of

C. ocellatus was strongly biased towards Coleoptera (IU

= 24.95%) and only secondarily to insect larvae (IU =

7.79%). In contrast, the animal prey consumed by P. fil-

folensis were more evenly distributed between Formici-

dae (IU = 26.73%), Coleoptera (IU = 15.08%) and insect

larvae (IU = 14.27%) with minimal differences between

sexes. Interestingly, the diet of the Maltese wall lizard in-

cluded some minor prey (Araneae, Pseudoscorpiones,

Acarina, Homoptera, Malophaga) that were completely

absent from the diet of the Ocellated skink. Overall, ani-

mal diet was very similar between male and female P. fil-

folensis, the latter consuming more Araneae and Het-

eroptera (Table 1). It is worth noting that tails of juvenile

P. filfolensis were found in adult conspecifics (two in

males and two in females) and also in C. ocellatus (also

two).

Consequently, diet diversity (Table 2) was lower in C.

ocellatus than in P. filfolensis, with no differences between

males and females. This was true when considering either

individuals (ANOVA F, 9g = 9.93, P < 10-4; Scheffé tests

C. ocellatus - P. filfolensis males P = 0.0003, C. ocella-

tus —P. filfolensis females P = 0.0005, P. filfolensis males

- P. filfolensis females P = 0.99) or populations (C. ocel-

latus — P. filfolensis males To, = 4.67, P = 5*10-6, Pepe

<10-4; C. ocellatus — P. filfolensis females T7,; = 4.82, P

= 4*10°6, Pepe < 104; P. filfolensis males — P. filfolensis

females Tg, = 1.59, P = 0.06, Peper = 0.06).

As to the size of the items consumed (Table 3), C. ocel-

latus ate bigger prey than P. filfolensis but males and fe-

males of the latter species did not differ (ANOVA F, 17

= 20.81, P< 10-6, Scheffé tests C. ocellatus-P. filfolensis

males P < 10°, C. ocellatus-P. filfolensis females

P = 5*10°, P. filfolensis males-females P = 0.94). The

modal size class of C. ocellatus was 5-10 mm whereas

©ZFMK

114 Miguel A. Carretero et al.

P. filfolensis was shifted to the 1-5 mm class. In fact, ex-

cept in two females, pellets of P. filfolensis did not con-

tain items larger than 10 mm. No significant correlation

between prey and predator sizes was detected within each

group although those P. filfolensis females eating the

10-15 mm prey were bigger than the rest (ANOVA Fj 35

= 5.35, P= 0.009; Scheffé tets: 1-5 mm — 5—10 mm P=

0.86, 1-5 mm — 10-15 mm P = 0.01, 5-10 mm — 10-15

mm P= 0.01).

Finally, diet overlaps (Table 4) calculated from both tax-

onomical and size classification of prey were very simi-

lar, attaining moderate values between species but high

values between male and female P. filfolensis. Pseudocom-

munity analysis at species level revealed that taxonomi-

cal overlap was higher than simulated in the RA3 matrix

(niche breadth retained, P = 0.02) but similar to the RA2

matrix (zero states retained, P = 0.50). When considering

the three classes (C. ocellatus, male and female P. filfolen-

sis) none of the two algorithms indicated significant de-

viations from random. No significant differences were ei-

ther detected for the size overlap.

DISCUSSION

Differences in lizard diet arise from multiple factors in-

cluding anatomy, sex, reproductive state, body condition,

experience, prey availability, predation pressure, compe-

tition and evolutionary history (Schoener 1974; Dunham

1980; Pianka 1986; Losos 1992; Vitt & Zani 1998; Vitt

et al. 1999; Perry & Pianka 1999; Pitt & Ritchie 2002; Car-

retero 2004). In Lampione, the manifest size differences

between both species constitute the most obvious con-

straint for the prey they consume. Within species, prey

sizes tend to follow a logarithmic distribution, small in-

dividuals simply not been able to consume the biggest

items of the prey spectrum of the large individuals (Pi-

anka 1986). However, between species this pattern can be

altered if drastic divergence in anatomy or foraging tac-

tics occurs (Carretero 2004). This seems to be the case,

since C. ocellatus not only consumed large prey inacces-

sible for P. filfolensis as expected, but also kept the same

number of prey items but biased to medium sizes. This

result suggests that both species may follow different for-

aging strategies (Perry & Pianka 1999). In fact, C. ocel-

latus is described a semi-fossorial, sit-and-wait forager in

plant litter or under stones (Arnold 1984; Capula & Luisel-

li 1994; Kalboussi & Nouira 2004; Lo Cascio et al. 2008)

whereas P. filfolensis as most lacertids actively forages on

the surface (Corti & Lo Cascio 2002; Bombi et al. 2005;

Lo Cascio et al. 2006). Nevertheless, there is also evidence

for anatomical constraints, since ocellated skinks con-

sumed more hard prey (Coleoptera) than the wall lizards.

In lacertids, large species tend to consume more

Bonn zoological Bulletin 57 (2): 111-118

Coleoptera (Carretero et al. 2006) and there is experimen-

tal evidence for inter- and intraspecific differences in bite

force for prey crashing associated with the jaw muscle

mass (Herrel et al. 1999, 2001). Nonetheless, sexually di-

morphic lacertid heads, as intersexual differences in bite

force, primarily derive from sexual selection (Herrel et al.

1999; Kaliontzopoulou et al. 2007), and dietary shifts

(minimal in P. filfolensis) should be interpreted as a by-

product.

While divergent anatomy, foraging tactics and habitat use

between both species accounted for a substantial part of

the interspecific variation found, comparison with other

populations indicates that other factors modified the tax-

onomic composition of their diets. As other insular lacer-

tids in the Mediterranean (Pérez-Mellado & Corti 1993;

Carretero et al. 2001; Corti et al. 2008), P._filfolensis con-

sumed great amounts of ants not only in Lampione but al-

so in Linosa (Sorci 1990; Bombi et al. 2005) and Lampe-

dusa (Lo Cascio & Corti 2008). Since only Podarcis pop-

ulations inhabiting ancient Mediterranean islands (i.e.

Balearics, Mylos) are myrmecophagous, this has been in-

terpreted as a result of long term evolution in insularity

(Pérez-Mellado & Corti 1993; Carretero 2004). The de-

crease in predation pressure, the scarcity of alternative re-

sources, together with the gregarious behaviour and sea-

sonal stability of this prey may compensate for its low

profitability and noxiousness (Carretero 2004). Apparent-

ly, C. ocellatus has not been able to follow a similar strat-

egy since neither continental nor insular populations are

myrmecophagous (Capula & Luiselli 1994; Kalbousssi

2004; Lo Cascio & Corti 2008). Whether this is due to

evolutionary constraints or to recent colonisation of Lam-

pione currently remains under debate.

Cannibalism and, in general, saurophagy seem also to in-

crease in insular conditions due to the scarce resources and

high lizard densities (Pérez-Mellado & Corti 1993; Car-

retero et al. 2001) as is the case of P. filfolensis and C. ocel-

latus (Scalera et al. 2004; Lo Cascio et al. 2006). How-

ever, the predation of P. filfolensis by C. ocellatus consti-

tutes not only an additional food source but also an in-

stance of direct, asymmetric interaction between both

species (Chase et al. 2002).

As in the case of the ants, plants are also low profitable

matter and their consumption seems to be restricted to old

insular lacertid lineages which have developed behaviour-

al and anatomical adaptations for herbivory (Pérez-Mel-

lado & Corti 1993; Carretero 2004). Both P. filfolensis and

C. ocellatus were partially herbivorous in Lampione.

However, other populations of P. filfolensis studied also

consumed substantial amounts of seeds, fruits and other

plant remains (Sorci 1990; Bombi et al. 2005; Lo Cascio

& Corti 2008) and even seed dispersal for some plant

©OZFMK

Diet of Lampione lizards 115

species has been described in Linosa (Fici & Lo Valvo

2004). This suggests niche conservatism for herbivory in

this species. In contrast, herbivory seems to be rare in C.

ocellatus. Only two other microinsular populations, on

Lampedusa and the Conigli islet (Lo Cascio & Corti 2008;

Lo Cascio et al. 2008), were partially herbivorous, where-

as, no or almost no plant remains were found in the pop-

ulations from Sardinia (Capula & Luiselli 1994) and

Tunisia (Kalboussi & Nouira 2004). Nevertheless, even

continental ocellated skinks accept fruits in captivity

(Schleich et al. 1996) suggesting certain exaptation for her-

bivory in this species. Comparing the C. ocellatus popu-

lation from Lampione with those from the other Pelagian

islands (Lo Cascio & Corti 2008; Lo Cascio et al. 2008),

there is an apparent trend for increasing the degree of her-

bivory with isolation and for decreasing it with island area.

The analysis of trophic diversity indicates that P. filfolen-

sis is more euryphagous than C. oce//atus, with minimal

intraspecific variation in the first. Remarkably, for both

species, trophic diversity was much higher in populations

than in individuals, indicating strong interindividual vari-

ation typical of generalist predators (Carretero et al. 2006).

In fact, C. ocellatus displayed even stronger differences

(4x) than P. filfolensis (3x), which is accordance with its

sit-and-wait trend.

Finally, niche overlap summarises the trophic traits of the

community previously exposed. Coincidence between tax-

onomical and size overlaps and higher values between

species than within species indicate that intrinsical mor-

phological constraints constitute the main force for the or-

ganisation of this microinsular community. Pseudocom-

munity analysis does not support community structure but

instead points to enlarged, more overlapped trophic nich-

es.

When compared to other conspecific populations, conver-

gence in trophic strategies (herbivory, saurofagy) between

both species due to insular conditions seems the more fea-

sible hypothesis for explaining these results. Moreover,

evolutionary history at both deep (foraging strategies, Vitt

& Pianka 2005) and shallow (recent or ancient insular

colonisation, see above) levels seems, rather than resource

partitioning, responsible for the moderate trophic overlaps

recorded and even may explain why both species coexist

under the harsh conditions of this tiny islet. Nevertheless,

coincidence of trophic overlap between two species with

the direct predation of one on the other merits further

analyses (see also Castilla 1995).

Acknowledgements. We thank Giuseppina Nicolini, director of

the Natural Reserve “Isola di Lampedusa’,, all the staff of Legam-

biente, and Giuseppe Sorrentino of the Marine Protected Area

of the Pelagie Islands for their irreplaceable assistance during

Bonn zoological Bulletin 57 (2): 111-118

several visits at Lampione. We are also sincerely grateful to

Damiano Sferlazzo, who help us significantly during the field

work. The analysis of the collected samples has been done in

the framework of the scientific research projects of the Associ-

azione Nesos (Lipari). Analytical work was funded by the proj-

ect PTDC/BIA-BDE/67678/2006 and PTDC/BIA-

BEC/101256/2008 (to MAC) of Fundagao para a Ciéncia e a Tec-

nologia, FCT (Portugal). We are thankful to the Italian Minis-

tero dell’ Ambiente e della Tutela del Territorio for having issued

the permits to study these lizard populations (Prot.DPN-

/20/2004/17301).

REFERENCES

Akani GC, Capizzi D, Luiselli L (2002) Community ecology of

scincid lizards in a swamp rainforest of south-eastern Nige-

ria. Russian Journal of Herpetology 9: 125-134

Arnold EN (1984) Ecology of lowland lizards in the eastern Unit-

ed Arab Emirates. J. Zool. Lond. 204: 2—25

Badir N (1959) Seasonal variation of the male urogenital organs

of Scincus scincus L. and Chalcides ocellatus Forsk. Z. Wiss.

Zool. 160: 290-351

Barbault R (1991) Ecological constrains and community dynam-

ics: linking community patterns to organismal ecology. The

case of tropical herpetofaunas. Acta Oecologica 12: 139-163

Benjamini Y, Hochberg Y (1995) Controlling the false discov-

ery rate: A practical and powerful approach to multiple test-

ing. Journal of the Royal Statistical Society B 57: 289-300

Bombi P, Vignoli L, Scalera R, Bologna MA (2005) Food habits

of Podarcis filfolensis (Reptilia, Lacertidae) on a small

Mediterranean island during the dry season. Amphibia-Rep-

tilia 26: 412-417

Brooks DR, McLennan DA (2002) The nature of diversity: an

evolutionary voyage of discovery. University of Chicago

Press, Chicago

Canzoneri S (1972) Nuovi dati sui Tenebrionidae di “piccole

isole” italiane, con descrizione di Alphasida tirelli moltonii n.

ssp. Atti Soc. ital. Sci. nat. Mus. civ. St. nat. Milano 113:

288-296

Capula M (2006) Podarcis filfolensis (Bedriaga, 1876). pp. 466-

469 in: Sindaco R, Doria G, Razzetti E, Bernini F (eds.), At-

lante degli Anfibi e dei Rettili d'Italia. Polistampa, Firenze

Capula M, Luiselli L (1994) Resource partitioning in a Mediter-

ranean lizard community. Boll. Zool. 61: 173-177

Carretero MA, Llorente GA (1993) Feeding of two sympatric

lacertids in a sandy coastal area (Ebro Delta, Spain). Pp.

155-172 in: Bohme W, Pérez-Mellado V, Valakos E, Maragou

P. (eds.), Lacertids of the Mediterranean Region. A Biologi-

cal approach. Hellenic Zoological Society, Athens, Greece

Carretero MA (2004) From set menu to a la carte. Linking is-

sues in trophic ecology of Mediterranean lacertids. Italian

Journal of Zoology 74: 121-13

Carretero MA (2006) Reproductive cycles in Mediterranean lac-

ertids: Plasticity and constraints. Pp. 33-54 in: Corti C, Lo

Cascio P, Biaggini M (wds.) Mainland and insular lizards. A

Mediterranean perspective, Firenze University Press, Florence

Carretero MA, Llorente GA, Santos X, Montori A (2001) The

diet of an introduced population of Podarcis pityusensis. Is

herbivory fixed? Pp. 113—124 in: Vicente L, Crespo EG (eds.)

Mediterranean Basin Lacertid Lizards. A Biological Approach.

ICN, Lisboa

Carretero MA, Perera A, Harris DJ, Batista V, Pinho C (2006)

Spring diet and resource partitioning in an alpine lizard com-

munity from Morocco. African Zoology 41(1): 113-122

OZFMK

116 Miguel A. Carretero et al.

Castilla AM (1995) Interactions between lizards Podarcis his-

panica atrata and scorpions (Buthus occitanus). Bol. Soc. Hist.

Nat. Baleares 38: 47—S0

Chase JM, Abrams A, Grover JP, Diehl S, Chesson P, Holt RD,

Richards SA, Nisbet RM, Case TJ (2002) The interaction be-

tween predation and competition: a review and synthesis.

Ecology Letters 5: 302-315

Corti C, Lo Cascio P (2002) The Lizards of Italy and Adjacent

Areas. Chimaira, Frankfurt am Main

Corti C, Bruschi S, Spano G, Putzu M, Luiselli L, Lo Cascio P,

Navone A (2008) The herpetofauna of the “Area Marina Pro-

tetta di Tavolara-Punta Coda Cavallo” and, morphological and

preliminary ecological observations on Podarcis tiliguerta

ranzii of Molarotto Islet, NE Sardinia, Italy. Pp. 155—162 in:

Herpetologia Sardiniae. Societas Herpetologica Italica/Edi-

zioni Belvedere, Latina, “le scienze” (8), 504 pp

Dunham AE (1980) An experimental study on interspecific com-

petition between the iguanid lizards Sceloporus merriami and

Urosaurus ornatus. Ecological Monographs 50: 309-330

Espinoza RE, Wiens JJ, Tracy CM (2008) Recurrent evolution

of herbivory in small, cold-climate lizards: Breaking the eco-

physiological rules of reptilian herbivory. PNAS 101:

16819-16824

Fici S, Lo Valvo M (2004) Seed dispersal of Capparis spinosa

L. (Capparaceae) by Mediterranean lizards. Naturalista sicil.

28: 1147-1154

Gotelli NJ, Entsminger GL (2004) EcoSim: Null models soft-

ware for ecology. Version 7. Acquired Intelligence Inc. & Ke-

sey-Bear. Jericho, VT 05465. http://garyentsminger.

com/ecosim/index.htm

Gotelli NJ, Graves GR (1996) Null models in ecology. Smith-

sonian Institution Press, Washington

Grasso M, Pedley HM, Reuther CD (1985) The geology of Pela-

gian Islands and their structural setting related to the Pantel-

leria rift (Central Mediterranean Sea). Centro 1: 1-19

Herrel A, Spithoven R, Van Damme R, De Vree F (1999) Sex-

ual dimorphism of head size in Gallotia galloti: testing the

niche divergence hypothesis by functional analyses. Function-

al Ecology 13: 289-297

Herrel A, Van Damme R, Vanhooydonck B, De Vree F (2001)

The implications of bite performance for diet in two species

of lacertid lizards. Canadian Journal of Zoology 79: 662-670

Hodar JA (1997) The use of regression equations for the esti-

mation of prey length and biomass in diet studies of insecti-

vore vertebrates. Miscellania Zool. 20 (2): 1-10

Jover L (1989) Nuevas aportaciones a la tipificacion trofica

poblacional: el caso de Rana perezi en el Delta del Ebro. Ph.D.

Thesis, University of Barcelona, Barcelona

Kalboussi M, Nouira S, (2004) Comparative diet of northern and

southern Tunisian populations of Chalcides ocellatus (Forskal,

1775). Revista Espanola de Herpetologia 18: 29-39

Kaliontzopoulou A, Carretero MA, Llorente GA (2007) Multi-

variate and geometric morphometrics in the analysis of sex-

ual dimorphism variation in Podarcis lizards. Journal of Mor-

phology 268: 152-165

Kuranova VN, Patrakov SV, Bulakhova NA, Krechetova OA

(2005) The study of the ecological niche segregation for sym-

patric species of lizards Lacerta agilis and Zootoca vivipara.

Pp. 171-75 in: Ananjeva N, Tsinenko O. (eds.), Herpetologia

Petropolitana, Proc. 12th Ordinary General Meeting Soc. Eur.

Herpetol. Soc. Eur. Herpetol., Frankfurt am Main

Lanza B, Bruzzone CL (1961) Amphibia, Reptilia. Pp. 286-328

in: Zavattari E (Ed.) Biogeografia delle Isole Pelagie. Rend.

Accad. Naz. Lincei, (4) 11 [1960]

Bonn zoological Bulletin 57 (2): 111-118

Lo Cascio P (2004) Nuovi dati sui coleotteri di Lampione

(Canale di Sicilia). Naturalista sicil. 28: 1229-1231

Lo Cascio P, Corti C (2008) Indagini sull’ecologia dei rettili sauri

della R.N.O. e del S.LC. “Isola di Lampedusa’”’. Naturalista

sicil. 32: 319-354

Lo Cascio P, Corti C, Carretero MA, Pasta S (2008) Dati pre-

liminari sulla dieta di due popolazioni insulari di Chalcides

ocellatus. Pp. 314-317 in: Corti C (ed.), Herpetologia Sardini-

ae. Societas Herpetologica Italica-Edizioni Belvedere, Lati-

Lo Cascio P, Luiselli L, Corti C (2006) Preliminary data on the

ecology of Podarcis filfolensis of Lampione Islet (Pelagian Is-

lands, Channel of Sicily, Italy). Pp.103—110 in: Corti C, Lo

Cascio P, Biaggini M (eds.), Mainland and Insular Lacertid

Lizards: a Mediterranean Perspective. Firenze University

Press, Firenze

Losos JB (1992) The evolution of convergent structure in

Caribbean Anolis lizards. Systematic Biology 41: 403-420

Luiselli L (2008) Do lizard communities partition the trophic

niche? A worldwide meta-analysis using null models. Oikos

117: 321-330

Magurran AE (2004) Measuring biological diversity. Blackwell

Science, Oxford.

Mesquita DO, Colli GR, Vitt LJ (2007) Ecological release in

lizard assemblages of neotropical savannas. Oecologia 153:

185-195

Mylonas M, Valakos ED (1990) Contribution to the biogeograph-

ical analysis of the reptile distribution of the Mediterranean

islands. Revista Espanola de Herpetologia 4: 101-107

Nouira S (1983) Partage des resources alimentaires entre deux

Lacertidae sympatriques des Iles Kerkennah (Tunisie): Acan-

thodactylus pardalis et Eremias alivieri. Bull. Soc. Zool.

France 108: 477-483

Pasta S (2002) Caratteristiche fisico-geografiche. Pp.15—19 in:

Corti C, Lo Cascio P, Masseti M, Pasta S (eds.), Storia natu-

rale delle Isole Pelagie. L’Epos, Palermo

Pasta S, Masseti M (2002) Il popolamento umano. Pp. 123-127

in: Corti C, Lo Cascio P, Masseti M, Pasta S (eds.), Storia na-

turale delle Isole Pelagie. L’Epos, Palermo

Pérez-Mellado V, Corti C (1993) Dietary adaptations and her-

bivory in lacertid lizards of the genus Podarcis from western

Mediterranean island (Reptilia: Sauria). Bonn. zool. Beitr. 44:

193-220

Pérez-Mellado V (1982) Estructura de una taxocenosis de Lac-

ertidae (Sauria, Reptilia) del Sistema Central. Mediterranea

Ser. Biol. 6: 39-64

Pérez-Mellado V, Traveset A (1999) Relationships between

plants and Mediterranean lizards. Nat. Croat. 6: 275—285

Perry G & Pianka ER (1999) Animal foraging: Past, present and

future. Tree 12: 360-364

Pianka ER (1973) The structure of lizard communities. Annual

Review of Ecology and Systematics 4: 53-74

Pianka ER (1986) Ecology and Natural History of Desert

Lizards. Princeton University Press. New Jersey

Pitt WC, Ritchie ME (2002) Influence of prey distribution on

the functional response of lizards. Oikos 96: 157-153

Pollo CJ, Pérez-Mellado V (1991) An analysis of a Mediter-

ranean assemblage of three small lacertid lizards in Central

Spain. Acta Oecologica 12: 655-671

Rouag R, Djilali H, Gueriache H, Luiselli L (2007) Resource par-

titioning patterns between two sympatric lizard species from

Algeria. Journal of Arid Environments 69: 158-168

Ruiz X, Jover L (1981) Sobre la alimentacion otonal de la gar-

cilla bueyera — Bubulcus ibis (L.) en el delta del Ebro, Tarra-

©ZFMK

Diet of Lampione lizards

gona, Espana. Publicaciones del Departamento de Zoologia

de la Universidad de Barcelona 6: 65—72

Scalera R, Capula M, Fornasari L, Zava B, Bombi P, Mariotti-

ni P, Bologna MA (2004). Population structure, genetics and

conservation of the Maltese wall lizard Podarcis filfolensis,

on Linosa island (Reptilia, Lacertidae). Pp: 153-159, in:

Bologna M.A. & La Posta S. (Eds.): The Conservation Sta-

tus of Threatened Amphibian and Reptile Species of Italian

Fauna. Ital. J. Zool. 71 (Suppl.)

Schleich HH, Kastle W, Kabisch K (1996) Amphibians and rep-

tiles of North Africa. Koeltz. Koenigstein

Schoener TW (1974) Resource Partitioning in Ecological Com-

munities. Science 185: 27-39

Sorci G (1990) Nicchia trofica di quattro specie di Lacertidae

in Sicilia. Naturalista sicil. Series 4 24 (suppl.): 83-93

Strijbosch H, Helmer W, Scholte PT (1989) Distribution and

ecology of lizards in the Greek province of Evros. Amphib-

ia-Reptilia 10: 151-174

Turrisi GF, Vaccaro A (2006) Chalcides ocellatus (Forskal,

1775). Pp. 518-521 in: Sindaco R, Doria G, Razzetti E, Berni-

ni F (eds.), Atlante degli Anfibi e dei Rettili d’Italia. Polistam-

pa, Firenze

Van Damme R (1999) Evolution of Herbivory in Lacertid

Lizards: Effects of Insularity and Body Size. J. Herpetol. 33:

663-674

Vitt LJ, Caldwell J (1994). Resource partitioning and guild struc-

ture of small vertebrates in the Amazon forest leaf litter. Jour-

nal of Zoology London (B) 234: 463-476

Appendix

117

Vitt LJ, Carvalho CM (1995) Niche Partitioning in a Tropical

Wet Season: Lizards in the Lavrado Area of Brazil. Copeia

1995: 305-329

Vitt LJ, Pianka ER (2005) Deep history impacts present-day ecol-

ogy and biodiversity. PNAS 102: 7877-7881

Vitt LJ, Pianka ER, Cooper WE jr, Schwenk K (2003) History

and the Global Ecology of Squamate Reptiles. Am. Nat. 162:

44-61

Vitt LJ, Sartorius SS, Avila-Pires MT, Esposito MC, Miles DB

(2000) Niche segregation among sympatric Amazonian teiid

lizards. Oecologia 122: 410-420

Vitt LJ, Zani PA (1998) Ecological relationships among sym-

patric lizards in a transitional forest in the northern Amazon

of Brazil. Journal of Tropical Ecology 14: 63-86

Vitt LJ, Zani PA, Esposito MC (1999) Historical ecology of Ama-

zonian lizards: implications for community ecology. Oikos 87:

286-294

Webb CO, Ackerby DD, McPeek MA, Donoghue MJ (2002)

Phylogenies and Community Ecology. Ann. Rev. Eco. Syst.

33: 475-505

Winemiller KO, Pianka ER (1990) Organization in natural as-

semblages of desert lizards and tropical fishes. Ecological

Monographs 60: 27—55

Received: 08. II. 2010

Accepted: 16.X. 2010

Table 1. Descriptors of the taxonomic composition of the diet for Chalcides ocellatus and Podarcis filfolensis from Lampione is-

land. OTU: Operational taxonomical unit, %P: percentage of presence; %N: percentage of numerical abundance; IU: Resource use

index: — not consumed; 0.00: consumed but index value next to zero.

Chalcides ocellatus Podarcis filfolensis Podarcis filfolensis Podarcis filfolensis

total total males females

OTU %P %N IU %P %N IU %P %N IU %P %N IU

Gastropoda 9.09 1.28 0.65 2.33 0.39 0.09 7.14 1.16 0.42

Isopoda 9.09 1.28 0.65 11.63 1.94 1.47 10.34 1.74 Hall 1429233" 170

Araneae — - - 12.79 2.13 1.68 Sally) 0.87 0.35 28.57 4.65 5.10

Pseudoscorpiones - — - LO eal (2204 52925 2-9) 2.24 7.14 2°33, 0:85

Acarina - — - 2733) 10:39) 10109 3.45 0.58 0.15 - ~ —

Diptera SMS 2255 le 24.42 6.01 5.66 Zi59) 16198 6.51 17.86 4.07 3.20

Coleoptera 66.67 18.30 24.95 55.81 12.40 15.08 56.90 12:21 1498 53.57 12:79 16.48

Hymenoptera - — — 25.58 7.56 6.95 PES eH 6.41 21.43 814 7.04

Formicidae 18.18 4.26 3.19 60.47 23.45 26.73 58:62) 22538 25:18 ~64:29 25:58 3115

Homoptera ~ = — 6.98 1.74 0.97 10.34 2.62 1.60 - — =

Heteroptera 6.06 0.85 0.27 17.44 3.49 2.90 1325/9) 233 eS) DOO” Bes, “5:25

Mallophaga — — = 930 1.55 1.06 10.34 = 1.74 ills) 7.14 1.16 0.42

insect larvae BOBO 8S" AS 37.21 14.15 14.27 34.48 15.70 14.93 42.86 11.05 13.26

Arth ind. 9.09 1.70 0.78 O30 ESS: 106 Sali 0.87 0.35 IASG 229i 24g

Squamata 3.03 0.43 0.00 4.65 0.78 0.35 3.45 0.58 0.15 7.14 1.16 0.42

seeds, fruits MPN Poss) Itsesill 6.98 3.10 1.24 6.90 1.16 0.59 7.14 6.98 2.55

other plant matter 54.55 35.32 41.61 45.35 16.67 18.37 53.45 20.06 22.55 2857 9.88 9.69

Total (mean+SE) 45 pellets, 235 items

5.91+0.83 items/pellet

86 pellets, 516 items

5.19+0.34 items/pellet

58 pellets, 344 items

5.16+0.38 items/pellet

28 pellets, 178 items

5.25+0.70 items/pellet

Bonn zoological Bulletin 57 (2): 111-118

©ZFMK

118 Miguel A. Carretero et al.

Table 2. Diet diversities of Chalcides ocellatus and Podarcis filfolensis from Lampione island. Numbers indicate mean+SE. Hi:

individual diversity; Hp: population diversity; Hz: total accumulated diversity; all using Brillouin’s index.

Species (class) N Hi Hp Hz

Chalcides ocellatus (total) 45 0.61+0.03 2/201 2.44

Podarcis filfolensis (total) 86 0.98+0.02 3.33+0.08 B22

Podarcis filfolensis (males) 58 0.98+0.03 3.19+0.08 3.05

Podarcis filfolensis (females) 28 0.98+0.06 3.43+0.14 Bell 7

Table 3. Descriptors of the prey size composition of the diet for Chalcides ocellatus and Podarcis filfolensis from Lampione is-

land. OTU: Operational taxonomical unit, %P: percentage of presence; %N: percentage of numerical abundance; IU: Resource use

index: — not consumed; 0.00: consumed but index value next to zero.

Chalcides ocellatus Podarcis filfolensis Podarcis filfolensis Podarcis filfolensis

total total males females

OTU %P %N IU %P %N IU %P %N IU %P %N IU

0-5 mm 32.14 24.62 19.09 80.00 67.24 68.92 73.68 64.10 64.41 100.00 73.68 78.66

5-10 mm 85.71 58.46 69.63 84.00 31.03 31.08 84.21 135.90) -35:59 83.33 DOS me 2ies 4

10-15 mm 17.86 7.69 5.31 4.00 7D, O00 16.67 5.26 0.00

> 15mm 17.86 9.23 5.96 = = -

Total (mean+SE) 65 (of 235) items measured 116 (of 516) items measured 78 (of 344) items measured 38 (of 178) items measured

7.42+0.51 mm 4.22+0.24 mm 4.29+0.27 mm 4.0840.47 mm

Table 4. Diet overlaps (Pianka’s index) between the lizard species and classes from Lampione island considering the taxonomi-

cal and size composition of the prey consumed.

taxonomical overlap size overlap

C. ocellatus (total) — P. filfolensis (total) 0.54 0.63

C. ocellatus (total) — P. filfolensis (males) 0.54 0.64

C. ocellatus (total) — P. filfolensis (females) 0.53 0.50

P. filfolensis (males) — P. filfolensis (females) 0.97 0.97

Bonn zoological Bulletin 57 (2): 111-118 ©ZFMK

Bonn zoological Bulletin Volume 57 Issue 2 | pp. 119-126

Bonn, November 2010

Evolutionary reproductive morphology of amphibians: an overview

Susanne Kithnel!, Sandy Reinhard! & Alexander Kupfer!2*

| Institut fiir Spezielle Zoologie und Evolutionsbiologie mit Phyletischem Museum,

Friedrich-Schiller-Universitat Jena, Erbertstr. 1, D-07743 Jena, Germany

2 Biologie und Didaktik, Universitat Siegen, Adolf-Reichwein-Str. 2, D-57068 Siegen

* Correspondence; E-mail: alexander.kupfer@uni-jena.de

Abstract. Reproduction is a crucial trait in the life history of any organism, and vertebrates, whether aquatic or terres-

trial, have evolved an extraordinary diversity of reproductive strategies and morphologies. Among tetrapods, the diver-

sity of reproductive modes is exceptionally high in amphibians, who also show multiple trends towards terrestrialisation

and internal fertilisation. Herein we give a brief overview of the diversity of amphibian reproductive morphology, with

a special emphasis on the cloaca, for all three major lineages, 1.e., anurans, urodeles and caecilians.

Key words. Reproduction, genital morphology, Amphibia.

INTRODUCTION

Reproduction is a crucial trait in the life history of any or-

ganism and scientists have been intrigued and challenged

by this event, and the structures associated with it, ever

since the days of Darwin (1871). Both aquatic and terres-

trial vertebrates have evolved an extraordinary diversity

of reproductive strategies and morphologies, including va-

rieties of oviparity and viviparity (Meisenheimer 1921;

Lombardi 1998). Among tetrapods, the diversity of repro-

ductive modes is exceptionally high in amphibians. In this

group, we also see multiple trends towards terrestrialisa-

tion and internal fertilisation (e.g. Haddad & Prado 2005).

Reproductive modes such as viviparity have evolved in-

dependently in all three lineages of modern amphibians

(e.g. Noble 1927; Wake & Dickie 1998; Wells 2007).

Herein we interpret a reproductive mode as a combina-

tion of several reproductive traits, including oviposition

site, clutch characteristics, stage and size of hatchling, and

type of parental care (sensu Salthe 1969).

Internal fertilization is a precondition for viviparity

(Wourms & Lombardi 1992; Bohme & Ziegler 2008). It

is associated with different strategies of sperm transfer,

which have evolved within all three amphibian orders,

ranging from cloacal apposition in anurans to a true cop-

ula via a male intromittent organ in caecilians (Sever et

al. 2001; Kupfer et al. 2006). Like most other tetrapods,

amphibians have a cloaca, a chamber that receives prod-

ucts from the kidneys, the intestine and the gonads, and

opens to the outside through a cloacal opening or vent

(Kardong 2006).

Bonn zoological Bulletin 57 (2): 119-126

Below we review the diversity of amphibian cloacal mor-

phologies involved in ensuring a secure direct sperm trans-

fer and internal fertilization among anurans, urodeles and

caecilians.

REPRODUCTIVE MORPHOLOGY OF

AMPHIBIANS

Anura

The majority of anurans, currently including almost 6000

species (AmphibiaWeb 2010), practice external fertiliza-

tion, and thus have no special male cloacal arrangements

facilitating direct sperm transfer (recently summarised by

Wells 2007). During copulation, males grasp females firm-

ly with their forearms (termed amplexus). In most cases,

sperm is directly released on the eggs protruding from the

female cloaca, but in some cases fertilisation takes place

without amplexus (e.g. Crump 1974; Kunte 2004). Inter-

nal fertilisation is rare among anurans, and mostly con-

nected to viviparity or other complex parental care mech-

anisms (e.g. Wake 1993; Beck 1998).

Exceptionally, the phylogenetically basal tailed frogs As-

caphus truei and A. montanus are the only anurans known

to have evolved a true intromittent organ in males (see Figs

1A—B). During courtship they practise a combination of

amplexus and copulation called “copulexus” (see Sever

et al. 2001; Stephenson & Verrell 2003). The so-called

©ZFMK

120 Susanne Kiihnel et al.

Fig. 1. | Reproductive morphology of anurans and salamanders. (A) Inguinal amplexus (“copulexus”) of Ascaphus truei. (B) ma-

le Ascaphus truei. The “tail”, a cloacal extension, can be inserted into the cloaca of the female during amplexus, ventrolateral view.

(C) male Mertensophryne micranotis (Anura: Bufonidae), left, dorsal view and its cloaca, right, caudal view (after Grandison 1980).

(D) cephalic amplexus of Notophthalmus viridescens (Urodela: Salamandridae). The male grasps the females’s neck whilst fan-

ning pheromones towards her nostrils. (E) cloacal region of lentic breeding Cynops pyrrhogaster (Urodela: Salamandridae). The

male’s cloaca (left) is heavily swollen compared to that of the female (right). (F) cloacal region of lotic breeding Euproctus mon-

tanus (Urodela: Salamandridae, after Brizzi et al. 1995). Males (left) possess a cloacal protuberance (cp) which bears a protusible

pseudopenis (pp), whereas the female cloaca is slightly conical shaped and its opening is located ventrally (right). (G) amplecting

pair of Calotriton arnoldi (Urodela: Salamandridae). The male grasps the female’s trunk with his tail.

Bonn zoological Bulletin 57 (2): 119-126 ©ZFMK

Amphibian reproductive morphology 121

“tail” resembles the posteriorly extended cloaca, proxi-

mately attended by Nobelian rods and strengthened by

vascularized tissue that is engorged with blood during cop-

ulation. This gives the ventral cloacal surface a pinkish

colour (Noble & Putnam 1931; Duellman & Trueb 1994).

To insert the posterior pointing “tail” into the female vent,

the male first flexes his pelvis at a right angle to the ver-

tebral column. Contraction of the paired Musculi compres-

sores cloacae (Duellman & Trueb 1994) bend the intro-

mittent organ ventrally, with the male vent pointing ante-

riorly (Slater 1931). Keratinised spines are present with-

in the male cloacal orifice, but whether they function to

enhance the attachment of the male to the female remains

unclear (Noble & Putnam 1931; Metter 1964).

Additionally, internal fertilisation including an amplexus

and cloacal apposition occurs in a few anurans, such as

several species of viviparous African dwarf toads Nec-

tophrynoides (Wake 1980; Wake & Dickie 1998) and Nim-

baphrynoides (Sandberger et al. 2010), and in two species

of Caribbean Eleutherodactylus, the viviparous E. jasperi

(Dewry & Kirkland 1976; Wake 1978) and the oviparous-

direct developing E. coqui (Townsend et al. 1981). Mat-

ing has only been observed in couples of E. coqui in a spe-

cial amplectic position called reverse hind leg clasp, that

is initiated by the female (Townsend & Stewart 1986).

Males do not clasp, and the female rests her hind legs on

top of the male’s legs. This behaviour might be correlat-

ed with terrestrial reproduction and internal fertilization.

It is also thought to be present in the viviparous E. jasperi

but has not yet been observed (Wake 1978). Within the

African Bufonidae, all species of Nectophrynoides (and

also Altiphrynoides malcolmi and Nimbaphrynoides oc-

cidentalis, former members of Nectophrynoides, see Frost

et al. 2006) practice internal fertilization. A/tiphrynoides

and Nimbaphrynoides both show a dimorphism of the

male and female vent, and an inguinal amplexus in a

unique belly-to-belly position has been reported as well

(Grandison 1978).

As in the internally fertilising Ascaphus ssp., males of the

East African toad Mertensophryne micranotis (Bufonidae)

exhibit modifications of the cloacal region (Duellman &

Trueb 1994). They have small conical spines around the

rim of the vent and at the entrance to the cloacal tube re-

stricted to the ridges of the puckered vent (Grandison

1980, see also Fig 1C). Males and females keep a very

tight cloacal contact during mating. Although the cloacal

spines play a role to ensure a close apposition of the vents,

to secure internal fertilisation, there is no evidence for a

direct interlocking mechanism in the furrows of the female

vent (Grandison & Ashe 1983).

Another potential record of internal fertilisation is provid-

ed for the neotropical Pumpkin Toadlet Brachycephalus

Bonn zoological Bulletin 57 (2): 119-126

ephippium (Pombal et al. 1994). During mating, males

shift from an inguinal to an axillary amplexus to optimal-

ly allow positioning of the vents, and thus maximize fer-

tilization of the relatively large eggs (5.1 to 5.3 mm). A

further record of viviparity in fanged frogs (Limnonectes

spec.) from Sulawesi probably also involves internal fer-

tilisation(Emerson 2001).

It can be hypothesised that (1) many terrestrially breed-

ing species with large direct-developing clutches are in-

ternal fertilizers and (2) if additional viviparous species

are encountered they will also show internal fertilisation.

Thus, internal fertilisation and viviparity in anurans might

be more widespread than currently recognized (see also

Wake 1978).

Data on the reproductive biology, including the mating be-

haviour, of many species is still lacking (Duellman &

Trueb, 1994; Wells 2007). Life history data from around

23 % of the currently known species is missing, as listed

in the data deficient category of the IUCN (Stuart et al.

2008).

Urodela

The majority of the 590 species of urodeles exhibit inter-

nal fertilization, whilst only males of the basal families

Hynobiidae, Cryptobranchidae, and presumably Sirenidae,

fertilise eggs externally (summarised in Duellmann &

Trueb 1994; Wells 2007). The complex and elaborate

courtship behavior of most salamanders includes the dep-

osition of a spermatophore by the male, which is subse-

quently received by the female. A true intromittent organ

in salamanders is lacking, although direct sperm transfer

can be found in one species — the Corsican brook newt

Euproctus montanus, a lotic breeding endemic of the is-

land of Corsica. The cloaca of the male brook newt re-

sembles a conical protuberance (Fig IF). The cloacal

chamber hosts a “pseudopenis”, a broad conspicuous

papilla, which can be evaginated during mating (Brizzi et

al. 1995; Carranza & Amat 2005). The male grasps the

female during amplexus, holding her tail with his jaws and

wrapping his tail around her trunk, whilst his backward

projecting cloaca is positioned close to that of the female.

A deep groove along the ventral surface of the pseudope-

nis, which is aligned with the cloacal tube, guarantees a

guided, unidirectional flux of cloacal products. Thus,

sperm mixed with secretory products is transferred direct-

ly into the female’s cloaca. The Salamandroidea that prac-

tice internal fertilization possess a distinct set of male cloa-

cal glands necessary for spermatophore production (Sev-

er 2002). The glands are hormonally controlled and hy-

pertrophied during the breeding season, often causing a

sexual dimorphism in cloacal shape. However, in Euproc-

©ZFMK

tus montanus, cloacal glands are reduced or partly lack-

ing (Brizzi et al. 1995; Sever 2002). Males of six salaman-

drid genera possess a so-called “pseudopenis”, a projec-

tion of the dorsal roof which nearly fills the entire ante-

rior chamber of the cloaca. It is involved in shaping and

expulsion of the spermatophore (Halliday 1998), but can-

not be everted as in the Corsican brook newt (Brizzi et al.

1995; Carranza & Amat 2005).

Sexes of most species, regardless of the mode of fertili-

sation, show a sexual dimorphism in cloacal shape (Figs

1E—-F). Usually, the male cloaca appears larger and more

swollen than the female one. This is caused by the activ-

ity of the glands mentioned above (see also Sever 2002).

Species that breed in the water and show elaborate

courtship dances or walks, such as some members of the

family Salamandridae, produce courtship pheromones,

which are fanned towards the female using the tail. Sala-

manders that mate terrestrially also use courtship

pheromones secreted from specialised glands to attract fe-

males. Pheromone-producing cloacal glands are therefore

highly influenced by sexual selection (e.g. Sever 2002;

Houck et al. 2008). Usually, female cloacae are less promi-

nent, but they may also possess up to three types of cloa-

cal glands in Salamandroidea, mainly accounting for

sperm storage (spermathecae), a unique feature among

vertebrates (Sever 1994). Females may retain and mix vi-

able spermatozoa from multiple matings in the spermath-

ecae for longer periods (e.g. Steinfartz et al. 2006). Fe-

male Eurycea fertilise eggs from stored sperm up to eight

months after insemination, female Notophthalmus viri-

descens effectively store sperm for up to six months, and

female Salamandra salamandra are reported to store

sperm for up to two years (Sever et al. 1996; Stebbins &

Cohen 1997; Sever & Brizzi 1998).

Additionally, the shape of female cloacae can be adapted

to a specific substrate for oviposition and type of water

body. Females of stream-breeding species, such as

Calotriton asper, sometimes have a conically shaped cloa-

ca for egg deposition and safe attachment between stones

and in crevices (e.g. Carranza & Amat 2005).

Lotic breeders such as Calotriton ssp. often engage in an

amplexus directly transferring the spermatophore into the

female cloaca (Fig 1G). It ensures direct and rapid sper-

matophore uptake, and thus reduces energy wasting, which

can hardly be avoided during aquatic breeding where the

male and the female often have no physical contact. Breed-

ing patterns including an amplexus are common in sala-

mandrids. Multiple ways of female capture are known,

such as the cephalic capture of Notophthalmus ssp. (see

Fig 1D), the dorsal capture of Zaricha, or the ventral cap-

ture performed by fire salamanders (Stebbins & Cohen

1997). The mating amplexus may last up to several hours,

Bonn zoological Bulletin 57 (2): 119-126

122 Susanne Kiihnel et al.

depending on the species. Salamanders of the family Am-

bystomatidae mate in the water, and the males guide fe-

males to spermatophore-uptake using a “tail-nudging-

walk”, except in Ambystoma gracile, A. laterale, A. jef-

fersonarium and A. macrodactylum, which capture fe-

males in an amplexus (Duellmann & Trueb 1994; Verrell

& Krenz 1998). In contrast, some plethodontids perform

a unique “tail-straddling-walk” behaviour (e.g. Arnold

1977).

Gymnophiona

In contrast to all salamanders (with the exception of Eu-

proctus montanus) and frogs (with the exception of As-

caphus ssp.), the male caecilian cloaca is evertible through

the vent and operates as an intromittent organ or phallus,

a unique structure among tetrapods (Tonutti 1931, see al-

so Fig 2A). Presumably all ca. 190 caecilian species

(oviparous and viviparous) practice internal fertilisation

with the help of the phallodeum (Tonutti 1931; Wake

1972; Gower & Wilkinson 2002), which is inserted into

the female vent during copulation (e.g. Kupfer et al.

2006a).

The caecilian vent is simply surrounded by several folds,

which are variably arranged among the groups and dis-

play sexual dimorphism in some species, such as mem-

bers of the Typhlonectidae (e.g. Taylor 1968; Kupfer

2007). In contrast, the cloaca is highly complex and di-

verse. The male caecilian cloaca is an elongated tube di-

vided into two distinct chambers. The cranial urodeum is

rather simply built, bearing longitudinal ridges, and con-

nects to the intestine and the urogenital ducts, which en-

ter after performing a U-bend (Sawaya 1942; Gower &

Wilkinson 2002). An extraordinary feature is the presence

of Millerian ducts, which become glandular during repro-

ductive activity, and secrete a fluid containing lipids and

sugars necessary for sperm motility (e.g. Wake 1981). The

caudal phallodeum is more broadly built and the inner

structure is very different. The ridges are arranged in a

more complex pattern (running transversely). In adults it

is often equipped with tuberosities or crests, which give

the phallodeum a characteristic morphology and gives rise

to an extraordinary variation in shape (Wiedersheim 1879;

Tonutti 1931, 1933; Wake 1972; Exbrayat 1991; Gower

& Wilkinson 2002, see also Fig 2), that is impotant for

caecilian systematics (Miller et al. 2005). East-African

scolecomorphid caecilians even have cartilaginous

spicules (Wake 1998). In many species, pouchy dorsolat-

eral appendixes — so called “blind sacs” — extend anteri-

or to the phallodeum. During eversion, the luminal sur-

face of the phallodeum represents the outer structure of

the phallus, with the urodeum lying in-between (see Tonut-

ti 1931; Gower & Wilkinson 2002, see also Fig. C right).

©ZFMK

Amphibian reproductive morphology 123

Smm

5mm

2mm

caudal

2mm 2mm

Fig. 2. Genital morphology of caecilian amphibians. (A) male Chthonerpeton indistincum (Gymnophiona: Typhlonectidae) show-

ing an everted phallus, MHNM 09323, right — detail. (B) Geotrypetes seraphini (Gymnophiona: Caeciliidae), lateral (left), dorsal

(central) and ventral (right) view of the everted phallus, AK 01149. (C) Zyphlonectes natans (Gymnophiona: Typhlonectidae), SRuCT-

Scan of the everted phallus. Right — virtual clipping, frontal view. (D) SRuwCT-Scan of female cloaca (/chthyophis cf. kohtaoen-

sis). Dorsolateral view, virtual cut of cloacal sheath, cranial part and blind sacs, green - cloaca, violet — oviducts, yellow — blad-

der. Abbreviations: MHNM = Museo Nacional de Historia Natural Montevideo Uruguay, AK = Alexander Kupfer collection.

Bonn zoological Bulletin 57 (2): 119-126 ©ZFMK

124 Susanne Kihnel et al.

To retract the cloaca within the body after copulation, cae-

cilians possess a specific muscle (musculus retractor cloa-

cae), which is also found in some females (Wilkinson

1990).

The female cloaca of caecilians has received little atten-

tion (e.g. Hypogeophis rostratus Tonutti 1931; Ty-

phlonectes compressicauda, Exbrayat 2006), the only ded-

icated morphological study was presented by Wake

(1972), proposing a functional association between the

specific male and female morphologies. The female cloa-

ca is supposed to be non-eversible (Wilkinson 1990),

therefore displaying a different morphology. Generally it

is shorter than in males, and the urogenital ducts lack a

copulatory loop (see Fig. 2D). There is also evidence for

a bisection of the female cloaca (Exbrayat 1991; Kiihnel

et al. submitted). The cranial chamber is homologous to

the male urodeum. The caudal chamber is marked by a

different arrangement of longitudinal cloacal folds most-

ly lacking tuberosities, and therefore easily recognised.

Nothing 1s at present known about how far the male phal-

lus inserts into the female cloaca, and if special structures

corresponding to the male ornamentation are present, help-

ing in fixation during copulation.

Copulations in caecilians have rarely been observed. Da-

ta are available for two aquatic/semiaquatic species, the

typhlonectids Typhlonectes compressicauda and Chthon-

erpeton indistinctum. Pairs of C. indistinctum copulated

for betwen 30 minutes and 5 hours (Barrio 1969) and those

of 7. compressicauda for between 75 minutes and 3 hours

(Murphy et al. 1977; Billo et al. 1985). Observations on

copulations in terrestrial caecilians have, to the best of our

knowledge, only been presented for the Indian ichthyophi-

id Ichthyophis beddomei (Bhatta 1999) and Ichthyophis

cf. kohtaoensis (Kupfer et al. 2006a). Bhatta reports on a

copulation lasting for about 40 or 45 minutes, an obser-

vation fitting well with the duration time of about 45 min-

utes that was observed in Ichthyophis cf. kohtaoensis

(Kupfer et al. 2006a).

Caecilians show a remarkable diversity of reproductive

modes associated with parental care (e.g. Wake 1977;

Himstedt 1996; Wilkinson & Nussbaum 1998). Oviparous

caecilians guarding egg clutches in terrestrial chambers

(e.g. Sarasin & Sarasin 1887-1890) either have the pre-

sumed ancestral amphibian life cycle with aquatic larvae,

or show direct development of juveniles with no aquatic

larval stage (e.g. Brauer 1897). Females of viviparous

species retain fertilised eggs. Embryogenesis is complet-

ed within the oviducts, and after hatching the foetuses feed

mainly intrauterinely on the hypertrophied oviductal lin-

ing (e.g. Parker 1956; Welsch et al. 1977). After a long

gestation period, the females give birth to fully metamor-

phosed, precocial young with the adult-type morphology

Bonn zoological Bulletin 57 (2): 119-126

(e.g. Billo et al. 1985; Exbrayat & Delsol 1985). Recent-

ly, a novel form of parental investment, maternal derma-

totrophy, a.k.a. skin feeding, where altricial young feed

externally on the mother’s hyperthrophied skin, has been

described (Kupfer et al. 2006b; Wilkinson et al. 2008).

SUMMARY AND PERSPECTIVES

In addition to their remarkable diversity of reproductive

modes, amphibians also show large variation in their re-

productive morphology. Many morphological peculiari-

ties are related to the evolution of internal fertilisation, and

ultimately to viviparity. In relation to fertilisation and

sperm transfer, different strategies have evolved within the

three amphibian orders, ranging from cloacal apposition

in anurans to a true copula via a highly complex male in-

tromittent organ in caecilians. Amphibians offer a prime

system for comparative studies of evolutionary reproduc-

tive biology. Research on the reproductive or genital mor-

phology should include modern methodology, such as 3D

reconstruction and soft tissue synchrotron radiation based

X-ray microtomography (SRuCT, see Fig. 2 C—D). Be-

cause amphibian diversity is steadily increasing (although

at the same time many species are declining or even go-

ing extinct) we envisage that many more unexpected re-

productive strategies and morphologies remain to be dis-

covered.

Acknowledgements. Phillipp Wagner is congratulated for or-

ganising this magnificent Festschrift volume. Many thanks for

giving us the opportunity to contribute. We would like to dedi-

cate our contribution to Wolfgang Bohme for his continuous ef-

fort in studying vertebrate, especially squamate genitalia and

their evolution. Synchrotron radiation based x-ray microtomog-

raphy (SRuCT) of caecilian genitalia was carried out at beam-

line BW2 at the Deutschen Elektronen Synchroton (DESY, Ham-

burg) under experimental projects I-20080054 and I-20090089.

Travel of SK and AK has been generously supported by DESY.

Felix Beckmann (DESY) provided initial 3D reconstructions and

Frank Friedrich (University of Hamburg) and Thomas Kleinte-

ich (University of Washington) aided in the successful process-

ing of 3D models. Alexander Haas (University of Hamburg) gen-

erously provided laboratory space and technical support for SK

during her collections-based research at the Museum fur Zoolo-

gie Hamburg (ZMH). SK is financially supported by the Volk-

swagen Stiftung (grant initiative “evolutionary biology”). An

anonymous referee, Lennart Olsson and Philipp Wagner gave

valuable comments on earlier versions of the manuscript.

REFERENCES

Arnold SJ (1977) The courtship behavior of North American

salamanders with some comments on Old World salamandrids.

Pp. 141-183 in: Taylor D & Guttman S (eds.) The Reproduc-

tive Biology of Amphibians. Plenum Press, New York

Barrio A (1969) Observaciones sobre Chthonerpeton indistinc-

tum (Gymnophiona, Caecilidae) y su reproduccion. Physis 28:

499-503

©ZFMK

Amphibian reproductive morphology 12

Beck CW (1998) Mode of fertilization and parental care in anu-

rans. Animal Behaviour 55: 439-449

Bhatta G (1999) Some aspects of general activity, foraging and

breeding in Ichthyophis beddomei (Peters) and Ichthyophis

malabarensis (Taylor) (Apoda: Ichthyophiidae) in captivity.

Zoos’ Print Journal 14: 23-36

Billo RR, Straub JO, Senn DG (1985) Vivipare Apoda (Amphib-

ia: Gymnophiona), Zyphlonectes compressicaudus (Duméril

& Bibron, 1841): Kopulation, Tragzeit und Geburt. Amphib-

ia-Reptilia 6: 1—9

Bohme W, Ziegler T (2009) A review of iguanian and an-

guimorph lizard genitalia (Squamata: Chamaeleonidae; Vara-

noidea, Shinisauridae, Xenosauridae, Anguidae) and their phy-

logenetic significance: comparisons with molecular data sets.

Journal of Zoological Systematics and Evolutionary Research

47: 189-202

Brauer A (1897) Beitrage zur Kenntnis der Entwicklungs-

geschichte und der Anatomie der Gymnophionen. Zoologis-

che Jahrbiicher, Abteilung fiir Anatomie und Ontogenie der

Thiere. 10: 389-472

Brizzi R, Calloni C, Delfino G, Tanteri G (1995) Notes on the

Male Cloacal Anatomy and Reproductive Biology of Euproc-

tus montanus (Amphibia: Salamandridae). Herpetologica 51:

8-18

Carranza S, Amat F (2005) Taxonomy, biogeography and evo-

lution of Euproctus (Amphibia : Salamandridae), with the res-

urrection of the genus Calotriton and the description of a new

endemic species from the Iberian Peninsula. Zoological Jour-

nal of the Linnean Society 145: 555-582

Crump ML (1972) Territoriality and Mating Behavior in Den-

drobates granuliferus (Anura: Dendrobatidae). Herpetologi-

ca 28: 195-198

Darwin CR (1871) The descent of man, and selection in rela-

tion to sex. John Murray Press, London

Drewry GE, Kirkland LJ (1976) A New Ovoviviparous Frog,

Eleutherodactylus jasperi (Amphibia, Anura, Leptodactyli-

dae), from Puerto Rico. Journal of Herpetology 10: 161—165

Duellman WE & Trueb L (1994) Biology of Amphibians. John

Hopkins, Baltimore

Emerson SB (2001) A macroevolutionary study of historical con-

tingency in the fanged frogs of Southeast Asia. Biological

Journal of the Linnean Society 73: 139-151

Exbrayat J-M & Delsol M (1985) Reproduction and Growth of

Typhlonectes compressicaudus: A Viviparous Gymnophione.

Copeia 1985: 950-955

Exbrayat J-M, Estabel J (2006) Anatomy with particular refer-

ence to the reproductive system. Pp. 79-156 in: Exbrayat J-

M (ed.) Reproductive Biology and Phylogeny of

Gymnophiona (Caecilians). Science Publishers Inc., Enfield,

Exbrayat JM (1991) Anatomie du cloaque chez quelques

Gymnophiones. Bulletin de la Société Herpétologique de

France 58: 30-42

Frost DR, Grant T, Faivovich J, Bain RH, Haas A, Haddad CFB,

De Sa RO, Channing A, Wilkinson M, Donnellan SC, Rax-

worthy CJ, Campbell JA, Blotto BL, Moler P, Drewes RC,

Nussbaum RA, Lynch JD, Green DM, Wheeler WC (2006)

The amphibian tree of life. Bulletin of the American Muse-

um of Natural History 297: 1-370

Gower DJ, Wilkinson M (2002) Phallus morphology in caecil-

ians and its systematic utility. Bulletin of the Natural Histo-

ry Museum, Zoology Series 68: 143-154

Grandison AGC (1978) The occurrence of Nectophrynoides

(Anura: Bufonidae) in Ethiopia. A new concept of the genus

Bonn zoological Bulletin 57 (2): 119-126

with a description of a new species. Monitore zoologico ital-

iano (NS) supplemento 11: 119-172

Grandison AGC (1980) Aspects of breeding morphology in

Mertensophryne micranotis (Anura: Bufonidae): secondary

sexual characters, eggs and tadpole. Bulletin of the British Mu-

seum (Natural History) Zoology 39: 299-304

Grandison AGC, Ashe S (1983) The distribution, behavioural

ecology and breeding strategy of the pygmy toad, Merten-

sophryne micranotis (Lov.). Bulletin of the British Museum

(Natural History) Zoology 45: 85—93

Haddad CFB, Prado CPA (2005) Reproductive modes in frogs

and their unexpected diversity in the Atlantic forest of Brazil.

Bioscience 55: 207-217

Halliday T (1998) Sperm competition in amphibians. Pp.

465-502 in: Birkhead TR & Meller AP (eds.) Sperm Compe-

tition and Sexual Selection. Academic Press, London

Himstedt W (1996) Die Blindwihlen. Westarp Wissenschaften,

Magdeburg

Houck LD, Watts RA, Arnold SJ, Bowen KE, Kiemnec KM,

Godwin HA, Feldhoff PW, Feldhoff RC (2008) A Recombi-

nant Courtship Pheromone Affects Sexual Receptivity in a

Plethodontid Salamander. Chemical Senses 33: 623-631

Kardong KV (2006) Vertebrates: comparative anatomy, function,

evolution. Fourth edition. Mc Graw Hill, New York

Kuhnel S, Herzen J, Kleinteich T, Beckmann F, Kupfer A (ac-

cepted pending revision) The female cloaca of an oviparous

caecilian amphibian (Gymnophiona): functional and season-

al aspects. Acta Zoologica

Kunte K (2004) Natural History and Reproductive Behavior of

Nyctibatrachus ct. humayuni (Anura: Ranidae). Herpetolog-

ical Review 35: 137-140

Kupfer A (2007) Sexual size dimorphism in amphibians: an

overview. in: Fairbairn DJ, Blanckenhorn WU & Szekely T

(eds.) Sex, Size and Gender Roles: Evolutionary Studies of

Sexual Size Dimorphism. Oxford University Press, Oxford

Kupfer A, Kramer A, Himstedt W, Greven H (2006a) Copula-

tion and egg retention in an oviparous Caecilian (Amphibia:

Gymnophiona). Zoologischer Anzeiger 244: 223-228

Kupfer A, Miller H, Antoniazzi MM, Jared C, Greven H, Nuss-

baum RA, Wilkinson M (2006b) Parental investment by skin

feeding in a caecilian amphibian. Nature 440: 926-929

Lombardi J (1998) Comparative vertebrate reproduction. Kluw-

er Academic Publishers, Norwell, Massachusetts USA

Meisenheimer J (1921) Geschlecht und Geschlechter im Tier-

reiche. I. Die natiirlichen Beziehungen. Gustav Fischer, Jena

Metter DE (1964) A Morphological and Ecological Comparison

of Two Populations of the Tailed Frog, Ascaphus truei Ste}-

neger. Copeia 1964: 181-195

Murphy JB, Quinn H, Campbell J (1977) Observations on the

breeding habits of the aquatic caecilian 7yphlonectes compres-

sicaudus. Copeia |: 66-69

Noble GK (1927) The value of life history data in the study of

evolution. Annals of the New York Academy of Sciences 30:

31-128

Noble GK, Putnam PG (1931) Observations on the Life Histo-

ry of Ascaphus truei Stejneger. Copeia 1931: 97-101

Parker HW (1956) Viviparous caecilians and amphibian phyloge-

ny. Nature 178: 250—252

Pombal JP, Jr., Sazima I, Haddad CIFB (1994) Breeding Behav-

ior of the Pumpkin Toadlet, Brachycephalus ephippium

(Brachycephalidae). Journal of Herpetology 28: 516-519

Salthe SN (1969) Reproductive modes and the numbers and size

of ova in the urodeles. American Midland Naturalist 81:

467-490

OZFMK

126 Susanne Kihnel et al.

Sandberger L, Hillers A, Doumbia J, Loua N-S, Brede C, Rodel

M-O (2010) Rediscovery of the Liberian Nimba toad, Nim-

baphrynoides liberiensis (Xavier, 1978) (Amphibia: Anura:

Bufonidae), and reassessment of its taxonomic status. Zootaxa

2355: 56-68

Sarasin P, Sarasin F (1887-1890) Ergebnisse naturwis-

senschaftlicher Forschungen auf Ceylon in den Jahren

1884-1886. Zur Entwicklunggeschichte und Anatomie der

Ceylonesischen Blindwthle /chthyophis glutinosus. C. W.

Kreidel, Wiesbaden

Sawaya MP (1942) Sobre la cloaca dos Siphonops. Boletins da

Faculdade de Filosofia, Ciencias e Letras, Zoologia, Sao Pao-

lo 15: 3-43

Sever DM (1994) Observations on regionalization of secretory

activity in the spermathecae of salamanders and comments on

phylogeny of sperm storage in female amphibians. Herpeto-

logica 50: 383-397

Sever DM (2002) Female sperm storage in amphibians. Journal

of Experimental Zoology 292: 165—179

Sever DM, Brizzi R (1998) Comparative biology of sperm stor-

age in female salamanders. Journal of Experimental Zoology

282: 460-476

Sever DM, Moriarty EC, Rania LC, Hamlett WC (2001) Sperm

storage in the oviduct of the internal fertilizing frog Ascaphus

truei. Journal of Morphology 248: 1-21

Sever DM, Rania LC, Krenz JD (1996) Annual cycle of sperm

storage in spermathecae of the red-spotted newt, Notophthal-

mus viridescens (Amphibia: Salamandridae). Journal of Mor-

phology 227: 155-170

Slater JR (1931) The Mating of Ascaphus truei Steyneger. Copeia

1931: 62-63

Stebbins RC, Cohen NW (1997) A Natural History of Amphib-

ians. Princeton University Press, Princeton, NJ

Steinfartz S, Stemshorn K, Kuesters D, Tautz D (2006) Patterns

of multiple paternity within and between annual reproduction

cycles of the fire salamander (Salamandra salamandra) under

natural conditions. Journal of Zoology 268: 1—8

Stephenson B, Verrell P (2003) Courtship and mating of the tailed

frog (Ascaphus truei). Journal of Zoology 259: 15—22

Stuart S, Hoffmann M, Chanson J, Cox N, Berridge R, Ramani

P, Young B (2008) Threatened Amphibians of the World. Lynx

Edicions, Barcelona

Taylor EH (1968) The Caecilians of the World — A taxonomic

review. University of Kansas Press, Lawrence

Tonutti E (1931) Beitrag zur Kenntnis der Gymnophionen XV.

Das Genitalsystem. Morphologisches Jahrbuch 68: 151—293

Tonutti E (1933) Beitrag zur Kenntnis der Gymnophionen XIX.

Untersuchungen der Kopulationsorgane bei weiteren

Gymnophionenarten. Morphologisches Jahrbuch 72: 156-211

Townsend DS, Stewart MM (1986) Courtship and Mating Be-

havior of a Puerto Rican Frog, Eleutherodactylus coqui. Her-

petologica 42: 165-170

Bonn zoological Bulletin 57 (2): 119-126

Townsend DS, Stewart MM, Pough FH, Brussard PF (1981) In-

ternal Fertilization in an Oviparous Frog. Science 212:

469-47

Verrell PA, Krenz JD (1998) Competition for Mates in the Mole

Salamander, Ambystoma talpoideum: Tactics That May Max-

imize Male Mating Success. Behaviour 135: 121—138

Wake MH (1972) Evolutionary morphology of the caecilian uro-

genital system. IV. The cloaca. Journal of Morphology 136:

353-365

Wake MH (1977) The reproductive biology of caecilians: an evo-

lutionary perspective. Pp. 73-101 in: Taylor DH & Guttman

SI (eds.) The Reproductive Biology of Amphibians. Plenum

Publishing Corporation, New York

Wake MH (1978) The Reproductive Biology of Eleutherodacty-

lus jasperi (Amphibia, Anura, Leptodactylidae), with Com-

ments on the Evolution of Live-Bearing Systems. Journal of

Herpetology 12: 121-133

Wake MH (1980) The Reproductive Biology of Nectophrynoides

malcolmi (Amphibia: Bufonidae), with Comments on the Evo-

lution of Reproductive Modes in the Genus Nectophrynoides.

Copeia 1980: 193-209

Wake MH (1981) Structure and function of the male Mueller-

ian gland in caecilians, with comments on Its evolutionary sig-

nificance. Journal of Herpetology 15: 17—22

Wake MH (1993) Evolution of oviductal gestation in amphib-

ians. Journal of Experimental Zoology 266: 394-413

Wake MH (1998) Cartilage in the cloaca: Phallodeal spicules in

caecilians (Amphibia : Gymnophiona). Journal of Morphol-

ogy 237: 177-186

Wake MH, Dickie R (1998) Oviduct structure and function and

reproductive modes in amphibians. Journal of Experimental

Zoology 282: 477-506

Wells KD (2007) The ecology and behaviour of amphibians. Uni-

versity of Chicago, Chicago and London

Welsch U, Miller M, Schubert C (1977) Elektronenmikroskopis-

che und histochemische Beobachtungen zur Fortpflanzungs-

biologie viviparer Gymnophionen (Chthonerpeton indistinc-

tum). Zoologische Jahrbiicher ftir Anatomie 97: 532-549

Wilkinson M (1990) The presence of a Musculus Retractor Cloa-

cae in female caecilians (Amphibia: Gymnophiona). Amphib-

ia-Reptilia 11: 300-304

Wilkinson M, Kupfer A, Marques-Porto R, Jeffkins H, Antoni-

azzi MM, Jared C (2008) One hundred million years of skin

feeding? Extended parental care in a Neotropical caecilian

(Amphibia : Gymnophiona). Biology Letters 4: 358-361

Wilkinson M, Nussbaum RA (1998) Caecilian viviparity and am-

niote origins. Journal of Natural History 32: 1403—1409

Wourms JP, Lombardi J (1992) Reflections on the evolution of

piscine viviparity. American Zoologist 32: 276-293

Received: 25.1X.2010

Accepted: 16.X.2010

©OZFMK

Bonn zoological Bulletin Volume 57 | Issue 2 i: pp. 127-136 Bonn, November 2010

Updated checklist of the living monitor lizards of the world

(Squamata: Varanidae)

André Koch!, Mark Auliya? & Thomas Ziegler;

! Zoologisches Forschungsmuseum A. Koenig & Leibniz Institute for Animal Biodiversity,

Department of Herpetology, Adenauerallee 160, D-53113 Bonn, Germany;

E-mail: a.koch.zfmk@uni-bonn.de

? Helmholtz Centre for Environmental Research — UFZ, Department of Conservation Biology,

Permoserstr. 15, D-04318 Leipzig; Germany; E-mail: mark.auliya@ufz.de

3 AG Zoologischer Garten K6In, Riehler Strae 173, D-50735 K6lIn, Germany;

E-mail: ziegler@koelnerzoo.de

Abstract. We provide an update of BOhme’s (2003) checklist of the living monitor lizards of the world. Since this con-

tribution, ten new species and one new subspecies have been described. Ten of these taxa were described from the is-

lands of the Indo-Australian Archipelago. One Soterosaurus taxon (macromaculatus) was revalidated to subspecies sta-

tus, whereas the younger melanistic taxon komaini was synonymized with the former. In addition, five taxa (beccarii,

cumingi, marmoratus, nuchalis, and togianus), that were formerly treated as subspecies, were re-elevated to species rank

resulting in 73 extant species (including 21 subspecies). This represents a 20% increase of the world’s varanid diversity

since 2003. In addition, ongoing taxonomic studies on V spinulosus from the Solomon Islands (formerly a member of

the V. indicus species group) indicate that this species most likely represents a new subgenus. Therefore, this taxon is

currently treated incertae sedis. In sum, taxonomic research in monitor lizards remains incomplete. Further studies must

be initiated to fully understand diversity and distribution of these CITES-listed lizards next to implications for sustain-

able conservation measures.

Key words: Reptilia, Varanus, Philippinosaurus, Soterosaurus, Euprepiosaurus, Odatria, checklist.

INTRODUCTION

Monitor lizards are among the largest living squamates of

the world. They inhabit Africa, the Arabian Peninsula,

South and Southeast Asia as well as the Indo-Australian

Archipelago including Australia and several Pacific island

groups. Due to their often large body size and ecological

role as top predators in most environments they inhabit,

monitor lizards have always been a small reptile group

comparable to large placental carnivores (Sweet & Pianka

2007). Nevertheless, the diversity of monitor lizards has

been underestimated for many decades.

One of the latest comprehensive listings of all extant mon-

itor lizards was published by BOhme (2003), who listed

58 different species and 28 subspecies. This checklist was

prepared at the request of the Nomenclature Committee

of the Convention on International Trade in Endangered

Species of Wild Flora and Fauna (CITES), because of the

increase in monitor lizard diversity in the early 1990s. This

caused considerable confusion within trade records,

which made communication about these economically im-

portant lizards in the CITES domain rather difficult.

Bonn zoological Bulletin 57 (2): 127-136

Therefore, BOhme’s (2003) checklist was adopted as the

standard reference for the Varanidae by the 12th Confer-

ence of the Parties to CITES in November 2002.

The need for an updated list only seven years after the last

synopsis by B6hme (2003) derives from ongoing descrip-

tions of new species. This is partly due to the fact, that

the understanding of monitor lizards, their systematics, and

the underlying concepts have been refined in recent years

(e.g. Koch et al. 2009). In addition, the taxonomic status

of several nominal taxa has changed. This involves either

subspecies elevated to species rank or the subgeneric al-

location of species. Also, knowledge of distribution ranges

of some rare monitor lizard species has been advanced by

the examination of new voucher specimens and investi-

gations in the field.

Next to taxonomic and phylogenetic studies on the

Varanidae, those focusing on conservation particularly of

the Indo-Australian realm remain scarce. A summary of

threats monitor lizards are exposed to in this region, cur-

©OZFMK

128 André Koch et al.

rent conservation studies and measures in place, and the

conservation status of all Indo-Australian species will be

outlined in detail elsewhere.

METHODS

In the present paper, we compiled all monitor lizard taxa

that were published after BOhme (2003). This includes al-

so such names where the taxonomic status has changed.

We basically follow the format of this author, which has

earlier been used by Mertens (1963).

The synonymy list of each taxon starts with the original

citation and is then arranged chronologically with the

source of the respective name and its type locality.

Chresonyms are generally not included with the excep-

tion of names with a changed taxonomic status exempli-

fied by subspecies names, that were elevated to species

level or when a new species is separated from a long re-

cognized species. In these cases, the taxon name and the

author(s) are separated by a “—*. In addition, type speci-

mens for valid taxa are provided, if available. Collection

acronyms are as follows: BMNH = British Museum of

Natural History, London, UK; KU = Kansas University,

Museum of Natural History, Lawrence, USA; MNHN =

Muséum national d’Histoire naturelle, Paris, France;

MSNG = Museo Civico die Storia Naturale di Genova Gi-

acomo Doria, Genova, Italy; MZB = Museum Zoologicum

Bogoriense, Bogor, Indonesia; NMW = Naturhistorisches

Museum Wien, Vienna, Austria; PNM = Philippine Na-

tional Museum, Manila, Philippines; RMNH = National

Natural History Museum Naturalis, Leiden, Netherlands;

SMF = Naturmuseum Senckenberg, Frankfurt, Germany;

USNM = National Museum of Natural History, Washing-

ton, USA; WAM = Western Australian Museum, Perth,

Australia, ZFMK = Zoologisches Forschungsmuseum

Alexander Koenig, Bonn, Germany; ZMA = Zoological

Museum, University of Amsterdam, Netherlands; ZMB =

Museum fiir Naturkunde, Berlin, Germany; ZMUC = Zo-

ological Museum, University of Copenhagen, Denmark.

Update of the checklist of extant monitor lizards by

Bohme (2003)

Subgenus Philippinosaurus Mertens, 1959

Varanus bitatawa Welton, Siler, Bennett, Diesmos,

Duya, Dugay, Rico, van Weerd & Brown, 2010

2010 Varanus bitatawa Welton, Siler, Bennett, Diesmos,

Duya, Dugay, Rico, van Weerd & Brown, Biol. Lett., 6:

654. — Type locality: Base of the San Ildefonso Peninsu-

Bonn zoological Bulletin 57 (2): 127-136

la, Sitio Casapsipan, Barangay Casiguran, Municipality of

Casiguran, Aurora Province, Luzon Island, Philippines.

2008 Varanus olivaceus — Eidenmiller & Philippen (in

part), Terralog, 6: 103.

Type specimens: Holotype PNM 9719 (formerly KU

320000), paratypes KU 322188 and PNM 9008.

Distribution: Northern Luzon, Philippines.

Remark: This species was recently separated from V. oli-

vaceus based on minor genetic variation, morphological

differences and biogeographic evidence (Welton et al.

2010).

Subgenus Soterosaurus Ziegler & Béhme, 1997

Varanus s. salvator (Laurenti, 1768)

1768 Stellio salvator Laurenti, Synops. Rept.: 56. — Type

locality: Sri Lanka.

1758 Lacerta monitor part. Linnaeus, Syst. nat., 10 (1):

201. — Type locality: In Indiis (nomen rejectum accord-

ing to ICZN 1959, Opinion 540).

1947 Varanus salvator kabaragoya Deraniyagala, Proc.

3rd ann. Sess. Ceylon Assoc. Sci., 2 (Abstr.): 12. — Type

locality: Ceylon (= Sri Lanka).

Type specimen: Neotype ZFMK 22092, designated by

Koch et al. (2007).

Distribution: Sri Lanka.

Remark: Until recently the nominotypic subspecies had

the widest distribution range within the widespread V. sal-

vator complex. Due to the revalidation of the subspecies

Vs. macromaculatus from continental Southeast Asia, the

nominotypic subspecies is now restricted to Sri Lanka.

Varanus salvator macromaculatus Deraniyagala, 1944

1944 Varanus salvator macromaculatus Derantyagala,

Spol. Zeyl. 24: 60. — Type locality: Siam (= Thailand).

1802 Tupinambis elegans Daudin (in part), Hist. nat. Rept.,

3: 36. — Type locality: Surinam.

1831 Tupinambis exilis Gray in Griffith, Anim. Kingd., 9:

25. — Type locality: India (nomen dubium, fide Koch et

al. 2007).

©ZFMK

Update of B6hme’s (2003) checklist of monitor lizards 129

1834 Varanus vittatus Lesson in Bélanger, Voyage Ind.

Orient. Zool.: 307. — Type locality: Indian subcontinent

and islands at the mouth of the Ganges River (nomen du-

bium fide Koch et al. 2007).

1842 Varanus binotatus Blyth, J. asiat. Soc. Bengal, 11:

867 (Lapsus fide Mertens 1942).

1942 Lacertus tupinambis Mertens (in part, non Lacépede,

1788) Abh. Senckb. Naturf. Ges., 466: 245. — Type loca-

lity: unknown (Lapsus fide Brygoo 1987).

1947 Varanus salvator nicobariensis Deraniyagala, Proc.

3rd ann. Sess. Ceylon Assoc, Sci., 2, Abstr.: 12. — Type

locality: Tillanchong, Nicobar Islands.

1987 Varanus salvator komaini Nutphand, J. Thai. Zool.

Center, 2 (15): 51. — Type locality: Sea shore areas and

small islands in south western Thailand.

2007 Varanus salvator macromaculatus — Koch, Auliya,

Schmitz, Kuch & Bohme, Mertensiella, 16: 136.

Type specimens: Lectotype MNHN 871, paralectotype

MNHN 1884.77, designated by Koch et al. (2007).

Distribution: Thailand, Peninsula Malaysia, Vietnam,

southern China, Hainan, Sumatra, and Borneo and small-

er off-shore islands.

Remark: This subspecies of V. salvator was recently res-

urrected from the synonymy of the nominotypic sub-

species which, due to differences in morphological char-

acters and colour pattern, had to be restricted to Sri Lan-

ka (Koch et al. 2007). At the same time, the melanistic tax-

on komaini from Thailand was identified as a junior syn-

onym of V. s. macromaculatus in the absence of morpho-

logical differences except for the lack of a light colour pat-

tern. Therefore, the remaining subspecies of V. salvator

are: Vs. salvator, V. s. macromaculatus, V. s. andamanen-

sis, and V. s. bivittatus (Koch et al. 2007).

Varanus cumingi Martin, 1838

1838 Varanus cumingi Martin, Proc. Zool. Soc. London

1838: 69. — Type locality: Mindanao, Philippines.

1942 Varanus (Varanus) salvator cumingi— Mertens, Abh.

Senckb. Naturf. Ges., 466: 256.

2007 Varanus (Soterosaurus) cumingi — Koch, Aultya,

Schmitz, Kuch & Bohme, Mertensiella, 16: 168.

Bonn zoological Bulletin 57 (2): 127-136

Distribution: Islands of the Greater Mindanao region (1.e.,

Mindanao, Samar, Leyte, and Bohol), Philippines.

Remark: Recently, % cumingi was demonstrated to be

specifically distinct from V. salvator (Koch et al. 2007).

The species was also shown to be polytypic and a new sub-

species was described from the northern islands within the

species range (Koch et al. 2010).

Varanus c. cumingi Martin, 1838

1838 Varanus cumingi Martin, Proc. Zool. Soc. London

1838: 69. — Type locality: Mindanao, Philippines.

1991 Varanus salvator cumingi — Gaulke (in part), Mer-

tensiella, 2: 154.

Type specimen: Lectotype BMNH 1946.8.31.5, designat-

ed by Koch et al. (2007).

Distribution: Restricted to Mindanao and off-shore islands,

Philippines.

Varanus cumingi samarensis Koch, Gaulke & Bohme,

2010 (Fig. 1D)

2010 Varanus cumingi samarensis Koch, Gaulke &

Bohme, Zootaxa, 2440: 19 — Type locality: San Augustin

near Gandara, Samar Island, Philippines.

1991 Varanus salvator cumingi — Gaulke (in part), Mer-

tensiella, 2: 161.

Type specimens: Holotype ZFMK 64713, paratype

ZFMK 64712.

Distribution: Samar, Bohol, and Leyte, Philippines.

Varanus marmoratus (Wiegmann, 1834)

1834 Hydrosaurus marmoratus Wiegmann, in Meyen,

Reise um die Erde, 3: 446. — Type locality: San Mat(h)eo

village or Talim Island, Laguna Bay, near Manila, Luzon,

Philippines.

1829 M[onitor| marmoratus Cuvier, Regne animal 2(2):

26. (nomen nudum fide Mertens 1942; Good et al. 1993).

1844 Monitor bivittatus philippensis Schlegel, Abb. Am-

phib.: x. — Type locality: Manila, Luzon.

©ZFMK

130 André Koch et al.

Fig. 1. Fig. 1: Some monitor lizards described after Bohme’s (2003) checklist and species where the taxonomic status has changed

since. A: Varanus boehmei Jacobs, 2003 (photo T. Ziegler); B: V. nuchalis, revalidated species status (photo M. Gaulke); C: V. to-

gianus, revalidated species status (photo A. Koch); D: V. cumingi samarensis Koch, Gaulke & Béhme, 2010 (photo M. Gaulke);

E: V. rasmusseni Koch, Gaulke & Bohme, 2010, juvenile paratype ZFMK 89391 (photo A. Koch); F: V. lirungensis Koch, Arida,

Schmitz, Bohme & Ziegler, 2009 (photo M. Auliya); G: V. palawanensis Koch, Gaulke & Béhme, 2010 (photo I. Langlotz).

Bonn zoological Bulletin 57 (2): 127-136 ©ZFMK

Update of BGhme’s (2003) checklist of monitor lizards 131

1876 Varanus manilensis von Martens, PreukB. Exped. Os-

tas. Zool., 1: 196. (Lapsus fide Mertens 1942).

1942 Varanus (Varanus) salvator marmoratus — Mertens,

Abh. Senckb. Naturf. Ges., 466: 254.

1944 Varanus salvator philippinensis Deraniyagala, Spol.

Zeylan., 24: 61. — Type locality: Luzon.

1997 Varanus (Soterosaurus) salvator marmoratus —

Ziegler & Boéhme, Mertensiella, 8: 177.

2007 Varanus (Soterosaurus) marmoratus — Koch, Auliya,

Schmitz, Kuch & Boéhme, Mertensiella, 16: 161.

Type specimen: Lectotype ZMB 470, designated by

Mertens (1942).

Distribution: Restricted to Luzon and some off-shore is-

lands, Philippines.

Remark: Originally, Wiegmann (1834) based his descrip-

tion on two voucher specimens (Koch et al. 2007). The

second larger syntype, however, which should have para-

lectotype status, is missing (Good et al. 1993). Recently,

V. marmoratus was shown to represent a collective species

(Koch et al. 2010). The disjunct island populations of the

Greater Palawan region and the Sulu Archipelago were al-

located to two new species (see below).

Varanus nuchalis (Giinther, 1872) (Fig. 1B)

1872 Hydrosaurus nuchalis Ginther, Proc. Zool. Soc.

London, 1872: 145. — Type locality: Philippines.

1942 Varanus (Varanus) salvator nuchalis — Mertens, Abh.

Senckb. Naturf. Ges., 466: 258.

1997 Varanus (Soterosaurus) salvator nuchalis — Ziegler

& Bohme, Mertensiella, 8: 177.

2007 Varanus (Soterosaurus) nuchalis — Koch, Aultya,

Schmitz, Kuch & Bohme, Mertensiella, 16: 165.

Type specimen: Holotype BMNH 1946.9.1.17.

Distribution: Islands of Negros, Panay, Masbate, Ticao,

and Cebu, Philippines.

Remark: Despite a high variation in colour pattern, a re-

cent study could not document a correlation between

colour pattern and distribution (Koch et al. 2010).

Bonn zoological Bulletin 57 (2): 127-136

Varanus palawanensis Koch, Gaulke & Bohme, 2010

(Fig. 1G)

2010 Varanus palawanensis Koch, Gaulke & Boéhme,

Zootaxa, 2446: 33.—Type locality: Tabon, Palawan Island,

Philippines.

1942 Varanus (Varanus) salvator marmoratus — Mertens

(in part), Abh. Senckb. Naturf. Ges., 466: 254.

1991 Varanus salvator marmoratus — Gaulke (in part),

Mertensiella, 2: 154.

2007 Varanus (Soterosaurus) marmoratus — Koch, Aultya,

Schmitz, Kuch & Bohme (in part), Mertensiella, 16: 161.

Type specimens: Holotype SMF 73912, paratypes SMF

73914-15, BMNH 94.6.30.19, BMNH 94.6.30.20,

MNHN 1884-187, ZMUC E78, and ZFMK 89691 (for-

merly SMF 73913).

Distribution: Islands of Greater Palawan (Palawan, Bal-

abac and the Calamian Island group) and Sibutu Island

within the Sulu Archipelago, Philippines.

Remark: Traditionally, the populations of Palawan and ad-

jacent islands were allocated to V. marmoratus, but recent

investigations confirmed their morphological distinctness

(Koch et al. 2010).

Varanus rasmusseni Koch, Gaulke & Bohme, 2010 (Fig.

1E)

2010 Varanus rasmusseni Koch, Gaulke & Bohme, Zoo-

taxa, 2446: 28. — Type locality: Tarawakan, north of Ba-

tu-Batu, Tawi-Tawi Island, Sulu Archipelago, Philippines.

1992 Varanus salvator marmoratus — Gaulke (in part), Ha-

madryad, 17: 21.

2007 Varanus (Soterosaurus) cf. marmoratus — Koch, Au-

liya, Schmitz, Kuch & Bohme, Mertensiella, 16: 163.

Type specimens: Holotype ZMUC R42151, paratype

ZFMK 89391 (formerly ZMUC R42153).

Distribution: Only known from the type locality, but prob-

ably also on other islands of the Tawi-Tawi island group,

Philippines.

Remark: Recent morphological investigations demonstrat-

ed the specific distinctness of the Tawi-Tawi population

which was formerly assigned to X marmoratus (Koch et

al. 2010).

©ZFMK

132 André Koch et al.

Varanus togianus (Peters, 1872) (Fig. 1C)

1872 Monitor (Hydrosaurus) togianus Peters, Monatb.

Kon. Preuss. Akad. Wiss., 1872: 582. — Type locality: Tim-

otto, Togian (= Togean) Islands, Central Sulawesi, Indone-

sia.

1942 Varanus (Varanus) salvator togianus — Mertens, Abh.

Senckb. Naturf. Ges., 466: 253.

1997 Varanus (Soterosaurus) salvator togianus — Ziegler

& Bohme, Mertensiella, 8: 177.

2007 Varanus (Soterosaurus) togianus — Koch, Auliya,

Schmitz, Kuch & Bohme, Mertensiella, 16: 156.

Type specimens: Lectotype ZMB 7388, paralectotype

ZMB 7389, by designation of Mertens (1942).

Distribution: Sulawesi, except the northern peninsula.

Remark: Recent investigations revealed this endemic Su-

lawesi taxon to be specifically distinct from V. salvator

(Koch et al. 2007) and polytypic (Koch et al. unpubl. da-

ta).

Subgenus Euprepiosaurus Fitzinger, 1843

Varanus indicus species group

Varanus lirungensis Koch, Arida, Schmitz, Bohme &

Ziegler, 2009 (Fig. 1F)

2009 Varanus lirungensis Koch, Arida, Schmitz, Bohme

& Ziegler, Austr. J. Zool., 57: 33. — Type locality: near

Lirung, Salibabu Island, Talaud Islands, Indonesia.

1915 Varanus indicus — de Rooj (in part), Rept. Indo-Aus-

tr. Arch., 1: 149.

1942 Varanus (Varanus) indicus indicus — Mertens (in

part), Abh. Senckb. Naturf. Ges., 466: 263.

Type specimens: Holotype MZB Lac. 5178, paratypes

MZB Lac. 5176-77, 5179-80, ZFMK 87587 (formerly

ZMA 15411a), ZMA 15411b.

Distribution: Only known from the type locality.

Remark: V. lirungensis represents the most north-western

member of the V. indicus species group (Koch et al. 2009).

Bonn zoological Bulletin 57 (2): 127-136

Varanus obor Weijola & Sweet, 2010

2010 Varanus obor Weijola & Sweet, Zootaxa, 2434: 18.

— Type locality: Soela-Bési (= Sanana Island), Sula Is-

lands, Moluccas, Indonesia.

Type specimen: Holotype RMNH 7225.

Distribution: Only known from the type locality.

Remark: V. obor represents the latest discovery of a mem-

ber of the V. indicus species group. Nothing is known

about its conservation status (Weijola & Sweet 2010).

Varanus rainerguentheri Ziegler, Bbhme & Schmitz,

2007

2007 Varanus rainerguentheri Ziegler, Bohme & Schmitz,

Mitt. Mus. Nat.kd. Berlin, Suppl. 83: 110. — Type locali-

ty: Jailolo, Halmahera Island, Moluccas, Indonesia.

2005 Varanus cf. indicus — Bohme & Ziegler, Salaman-

dra, 41: 57.

Type specimens: Holotype ZFMK 85404, paratype

USNM 237438.

Distribution: Northern Moluccan islands of Halmahera,

Ternate, Tidore, Morotai, Bacan, Gebe and Obi.

Remark: Originally, V. rainerguentheri was only known

from its type locality (Ziegler et al. 2007a), but recent field

studies showed that this species occurs over a wider range

in the Moluccas (Weijola 2010).

Varanus zugorum Bohme & Ziegler, 2005

2005 Varanus zugorum Bohme & Ziegler, Salamandra,

41(1/2): 52. — Type locality: Kampung Pasir Putih, Jailo-

lo district, Halmahera Island, Moluccas, Indonesia.

Type specimen: Holotype USNM 237439.

Distribution: Only known from the type locality.

Remark: V. zugorum appears to be the rarest or at least

known monitor lizard of all species described, known on-

ly from the holotype specimen. Recent field work on

Halmahera Island failed to record this secretive species

(Setiadi & Hamidy 2006; Weijola 2010; Awal Riyanto,

Bogor, pers. comm. viii.2010). Only one putative photo-

graph of a live specimen exists (see BOhme & Ziegler

2005).

©ZFMK

Update of B6hme’s (2003) checklist of monitor lizards 13

Varanus prasinus species group

Varanus beccarii (Doria, 1874)

1874 Monitor Beccarii Doria, Ann. Mus. Civ. Stor. Nat.

Genova, 6: 331.—Type locality: Wokam, Aru Islands, In-

donesia.

1942 Varanus (Odatria) prasinus beccarii — Mertens, Abh.

Senckb. Naturf. Ges., 466: 296.

2003 Varanus (Euprepiosaurus) prasinus beccarii —

Bohme, Zool. Verh., 341: 25.

2007 Varanus (Euprepiosaurus) beccarii — Ziegler,

Schmitz, Koch & Bohme, Zootaxa, 1472: 15.

Type specimens: Syntypes ZMB 7993, MSNG 28723.

Distribution: Restricted to the Aru Islands.

Remark: In the past, the taxon beccarii was considered a

subspecies of V. prasinus (e.g. Mertens 1942; Ziegler &

Bohme 1997). Recently, Ziegler et al. (2007b) demonstrat-

ed that V. beccarii is distinct from the latter species. The

species is potentially threatened by the international trade

in live specimens.

Varanus boehmei Jacobs, 2003 (Fig. 1A)

2003 Varanus boehmei Jacobs, Salamandra, 39(2): 66. —

Type locality: Waigeo Island, West Papua, Indonesia.

Type specimens: Holotype ZFMK 77837, paratypes

ZFMK 82826, ZFMK 84000, ZMA 21702 (formerly

ZFMK 79122) and three further specimens which were

still alive and will be deposited in ZFMK after their de-

mise.

Distribution: Only known from the type locality.

Remark: Due to its restricted distribution range and its ex-

ploitation for the international pet trade, Vv boehmei must

be considered threatened.

Varanus reisingeri Eidenmiller & Wicker, 2005

2005 Varanus reisingeri Eidenmiller & Wicker, Sauria,

27(1): 4. — Type locality: Insel Misol (= Misool Island)

off the west coast of West Papua, New Guinea, Indone-

sia.

Bonn zoological Bulletin 57 (2): 127-136

1942 Varanus (Odatria) prasinus prasinus — Mertens (in

part), Abh. Senckb. Naturf. Ges., 466: 292.

Type specimens: Holotype SMF 83679, the two paratypes

are still alive and will be deposited in SMF after their de-

mise (Bernd Eidenmiller, Frankfurt, pers. comm.

x11.2010).

Distribution: Only known from the type locality.

Remark: The taxonomic validity of this species remains

uncertain because diagnostic morphological characters

largely overlap with V. prasinus from New Guinea. As the

former species, V. reisingeri is also potentially threatened

by exploitation for the pet trade.

Subgenus Odatria Gray, 1838

Varanus bushi Aplin, Fitch & King, 2006

2006 Varanus bushi Aplin, Fitch & King, Zootaxa, 1313:

24. — Type locality: Marandoo, Western Australia (22°

S75 S08 4E):

1980 Varanus caudolineatus — Storr (in part), Rec. West.

Austr. Mus., 8: 250.

Type specimens: Holotype WAM R108999, paratypes

WAM R54230, WAM R56834, and WAM R62171.

Distribution: Endemic to the Pilbara region of Western

Australia.

Remark: V. bushi was described as morphologically and

genetically distinct from its closest relatives V. caudoline-

atus and V. gilleni. All three Australian dwarf monitor

lizards display complex patterns of sexual dimorphism

(Aplin et al. 2006).

Subgenus: Incertae sedis

Varanus spinulosus Mertens, 1941

1941 Varanus indicus spinulosus Mertens, Senckenber-

giana, 23: 269. — Type locality: Georgs-Insel (= St. George

Island or San Jorge Island), near Santa Isabel (= Ysabel)

Island, Solomon Islands.

1942 Varanus (Varanus) indicus spinulosus — Mertens,

Abh. Senckb. Naturf. Ges., 466: 271.

1994 Varanus spinulosus — Sprackland, Herpetofauna, 24

(2): 34.

©ZFMK

134 André Koch et al.

1997 Varanus (Euprepiosaurus) spinulosus — Ziegler &

Bohme, Mertensiella, 8: 14.

2007 Varanus (subgen. inc. sed.) spinulosus — Bohme &

Ziegler, Mertensiella, 16: 105.

Type specimen: Holotype NMW 23387 (formerly NMW

3709).

Distribution: San Jorge and Santa Isabel Islands, Solomon

Islands, and Bougainville Island, Papua New Guinea.

Remark: For almost 50 years, this rare monitor lizard

species was only known from the holotype (Sprackland

1993). The former collection number of the type was orig-

inally assigned by Mertens (1941, 1942) and still applied

by de Lisle (2009). Tiedemann et al. (1994) and B6hme

& Koch (2010) provided the current number. Sprackland

(1994) elevated spinulosus to full species status. Recent-

ly, the distribution range of V. spinulosus was extended,

when the species was newly recorded from Bougainville

Island and its occurrence was confirmed on the island of

Santa Isabel (BOhme & Ziegler 2007; Dwyer 2008).

VK. spinulosus was formerly allocated to the V. indicus

species group of the subgenus Euprepiosaurus (see Ziegler

& Bohme 1997), but a new monotypic subgenus is dis-

cussed based on new genital morphological findings

(Bohme & Ziegler 2007).

DISCUSSION

In total, ten new species and one new subspecies were in-

troduced to science since BOhme’s (2003) checklist. Nine

of the species (1.e., 90%) and the subspecies were de-

scribed from islands of the Indo-Australian Archipelago.

Only one new species, V. bushi, was recently identified

from Western Australia (Aplin et al. 2006). In addition,

five taxa (beccarii, cumingi, marmoratus, nuchalis, and

togianus) were re-elevated to full species status due to

morphological (e.g., scale counts, morphometrics, colour

pattern) and/or genetical idiosyncrasies, thus bringing the

global diversity to 73 (including 21 subspecies). This re-

presents an increase in species diversity of 20% since

2003. Particularly 2010 has been a very productive year

for the increase of monitor lizard diversity. Four new

species and one new subspecies were described from In-

donesia and the Philippines within the first half of 2010

(Koch et al. 2010; Weijola & Sweet 2010; Welton et al.

2010).

Descriptions of new monitor lizard species since 2003

mainly refer to two different taxonomic groups, the South-

Bonn zoological Bulletin 57 (2): 127-136

east Asian and Indo-Australian subgenera Soferosaurus

and Euprepiosaurus, with two and six new species, respec-

tively. In addition, the taxonomic status of several mem-

bers of the subgenus Soferosaurus has changed. While this

subgenus was hitherto considered monotypic with V. sal-

vator being the only, albeit polytypic species with eight

recognized subspecies (B6hme 2003), the Philippine sub-

species cumingi, marmoratus, and nuchalis, and togianus

from Sulawesi were re-elevated to their original species

status (Koch et al. 2007), thus resulting in a species com-

plex of closely related allies. Additionally, one subspecies

(V. salvator macromaculatus) of the Southeast Asian wa-

ter monitor lizard was revalidated, whereas the younger

melanistic taxon komaini was synonymized with the for-

mer (Koch et al. 2007).

With currently 22 recognized species, the subgenus Eu-

prepiosaurus has displaced the Australian Odatria as the

most species-rich subgenus of varanids. Within Eupre-

piosaurus, the new species descriptions are unevenly dis-

tributed over the two species groups involved, viz. the Pa-

cific monitors around V. indicus and the tree monitors

around V. prasinus, respectively. The latter group experi-

enced only two new species descriptions (1.e., v boehmei

and V. reisingeri) and currently comprises nine allopatric

species from New Guinea and its offshore islands. On the

other hand, four new species were added to the V. indicus

species group leading to a total of 13 recognized species,

at least four of which occur in sympatry on New Guinea

and Halmahera in the northern Moluccas. Among these

recently described Pacific monitor lizard species, next to

morphologically cryptic taxa, such as V. lirungensis or V.

rainerguentheri, there are also strikingly different species

with idiosyncratic features in morphology and colour pat-

tern, such as the melanistic V. obor and the silver-coloured

V. zugorum. Five years after its formal description and de-

spite repeated field trips to the northern Moluccas (Setia-

di & Hamidy 2006; Weijola 2010; Awal Riyanto, Bogor,

pers. comm. viti.2010), the latter species is still only

known from the holotype specimen and has thus to be re-

garded the rarest and at least known varanid species.

Bohme (2003) already recognized a taxonomic trend to-

wards a reduction of polytypic monitor lizard species by

the elevation of nominal subspecies to species rank. Cer-

tainly, this trend still continues as seen in the V. salvator

complex (Koch et al. 2007). The description of a new sub-

species of V. cumingi from the Philippines (Koch et al.

2010), however, demonstrates that a distinction is still

made between the degree of morphological (e.g., morpho-

metrics and scalation features) and molecular differenti-

ation (i.e. characteristics of the full species category) and

mere geographically correlated differences in colour pat-

tern (i.e. diagnostic features of subspecies).

©ZFMK

Update of B6hme’s (2003) checklist of monitor lizards 135

CONCLUSIONS

Because taxonomy is a dynamic discipline, further

changes and additions to the list of extant monitor lizards

are to be expected in the future. This will include new

species descriptions — either real discoveries or by the

splitting of already recognized species — as well as a

change of the taxonomic status. Therefore, we are aware

that this updated checklist can only represent the latest

state of art and may already be outdated by the time of

publication. In terms of conservation purposes, it is essen-

tial to refer to these most recent checklists, and with the

increase of monitor lizard diversity especially in the In-

do-Australian realm, there is definitely a need to estab-

lish user-friendly identification tools for a vertebrate group

globally sought after within the international pet and rep-

tile leather trade.

We do wish that our contribution will serve as a useful

supplement to the checklist of the living monitor lizards

of the world by B6hme (2003) for all those who are in-

terested in or concerned with the diversity of monitor

lizards.

Acknowledgments. The fact, that Wolfgang Bohme was in-

volved in most of the recent taxonomic changes and additions

to the global checklist of varanids together with the naming of

one new species, viz. V. boehmei, after him, reflect his interna-

tionally renowned competence and eminent position in syste-

matic monitor lizard research. On the occasion of his retirement,

we hereby wish to dedicate this contribution to Professor Dr.

Wolfgang Bohme, Vice Director, Head of the Vertebrate Depart-

ment and Curator of Herpetology for 39 years at the Zoologi-

sches Forschungsmuseum Alexander Koenig in Bonn, Germany.

We are deeply indebted to Wolfgang Béhme, who initiated and

supervised our careers related to varanid research.

Furthermore, we thank Gunter KG6hler (SMF, Frankfurt), Bernd

Eidenmiiler (Frankfurt), and Manfred Reisinger (Landshut), for

information on preserved and live type specimens in their care.

Awal Riyanto (MZB, Bogor) kindly shared his observations on

monitor lizards from the field. The helpful comments of two

anonymous referees improved an earlier version of this contri-

bution.

REFERENCES

Aplin KP, Fitch AJ, King DJ (2006) A new species of Varanus

Merrem (Squamata: Varanidae) from the Pilbara region of

Western Australia, with observations on sexual dimorphism

in closely related species. Zootaxa 1313: 1-38

Bohme W (2003) Checklist of the living monitor lizards of the

world (family Varanidae). Zoologische Verhandelingen 341:

3-43

Bohme W, Koch A (2010) On the type selection and re-typifi-

cation of two monitor lizard taxa (Squamata: Varanidae): Mon-

itor bivittatus celebensis Schlegel, 1844 and Monitor korden-

sis Meyer, 1874; with some comments and corrections on oth-

er name-bearing type specimens. Zootaxa 2440: 60-68

Bonn zoological Bulletin 57 (2): 127-136

Bohme W, Ziegler T (2005) A new monitor lizard from Halma-

hera, Moluccas, Indonesia (Reptilia: Squamata: Varanidae).

Salamandra 41(1/2): 51-59

Bohme W, Ziegler T (2007) Notes on the Distribution, Diet, He-

mipenis Morphology and Systematics of Varanus spinulosus

Mertens, 1941. Pp. 100-108 in: Horn H-G, B6hme W, Krebs

U (eds.) Advances in Monitor Research III. Mertensiella 16,

DGHT, Rheinbach

Brygoo E-R (1987) Les Types de Varanidés (Reptiles, Sauriens)

du Muséum national d’ Histoire naturelle Catalogue critique.

Bulletin du Muséum national d’Histoire naturelle 9: 21—38

Dwyer Q (2008) Field Observations on Varanus spinulosus. Bia-

wak 2: 162—168

Eidenmiiller B, Wicker R (2005) Eine weitere neue Waranart aus

dem Varanus prasinus-Komplex von der Insel Misol, Indone-

sien. Sauria 27(1): 3-8

Good DA, Bauer AM, Giinther R (1993) An annotated Type Cat-

alogue of the anguimorph Lizards (Squamata: Anguidae, Helo-

dermatidae, Varanidae, Xenosauridae) in the Zoological Mu-

seum, Berlin. Mitteilungen des Zoologischen Museum Berlin

69: 45-56

ICZN (1959) Opinion 540. Protection under the plenary power

of the specific names bengalensis Daudin, [1802], as published

in the combination Tupinambis bengalensis, and salvator Lau-

renti 1768, as published in the combination Sve/lio salvator.

Opinions and Declaration of the international Commission of

zoological Nomenclature 20: 77-85

Jacobs H J (2003) A further new emerald tree monitor lizard of

the Varanus prasinus species group from Waigeo, West Irian

(Squamata: Sauria: Varanidae). Salamandra 39 (2): 65—74

Koch A, Arida E, Schmitz A, Bohme W, Ziegler T (2009) Re-

fining the polytypic species concept of mangrove monitors

(Squamata: Varanus indicus group): a new cryptic species

from the Talaud Islands, Indonesia, reveals the underestimat-

ed diversity of Indo-Australian monitor lizards. Australian

Journal of Zoology 57: 29-40

Koch A, Auliya M, Schmitz A, Kuch U, Bohme W (2007) Mor-

phological Studies on the Systematics of South East Asian Wa-

ter Monitors (Varanus salvator Complex): Nominotypic Pop-

ulations and Taxonomic Overview. In: Horn H-G, BOhme W

and Krebs U (eds.) Advances in Monitor Research III. Merten-

siella 16: 109-180

Koch A, Gaulke M, BOhme W (2010) Unravelling the undere-

stimated diversity of Philippine water monitor lizards (Squa-

mata: Varanus salvator complex), with the description of two

new species and a new subspecies. Zootaxa 2446: 1-54

Koch A, Auliya M, Schmitz A, Ziegler T, Bohme W (in prep.)

The Monitor Lizards (Squamata: Varanidae) of Southeast Asia

and the Indo-Australian Archipelago: Updated Checklist and

Key, with notes on Taxonomy, Biogeography and Conserva-

tion.

Mertens R (1941) Zwei neue Warane des Australischen Faunen-

gebietes. Senckenbergiana 23: 266-272

Mertens R (1942) Die Familie der Warane. Abhandlungen der

Senckenbergischen naturforschenden Gesellschaft 462: 1-116;

465: 117-234; 466: 235-391

Mertens R (1959) Liste der Warane Asiens und der Indo-austra-

lischen Inselwelt mit systematischen Bemerkungen. Sencken-

bergiana biologica 40 (5/6): 221-240

Mertens R (1963) Liste der rezenten Amphibien und Reptilien:

Helodermatidae, Varanidae, Lanthanotidae. Pp. 1—26 in: Mer-

tens R, Hennig W (eds.) Das Tierreich. Walter de Gruyter &

Co., Berlin

Setiadi MI, Hamidy A (2006) Jenis-jenis herpetofauna di Pulau

Halmahera. Bogor, Indonesia: Museum Zoologicum Bogo-

©ZFMK

136 André Koch et al.

riense, Puslit Biologi Lembaga IImu Pengetahuan Indonesia

(LIPI), Jakarta

Sprackland RG (1993) Rediscovery of Solomon Islands moni-

tor lizard (Varanus indicus spinulosus) Mertens, 1941. Viva-

rium 4; 25—27

Sprackland RG (1994) Rediscovery and taxonomic review of

Varanus indicus spinulosus Mertens, 1941. herpetofauna 24:

33-39

Sweet SS, Pianka ER (2007) Monitors, Mammals and Wallace’s

Line. Pp. 79-99 in: Horn H-G, B6bhme W & Krebs U (eds.)

Advances in Monitor Research III. Mertensiella, 16.

Tiedemann F, Haupl M, Grillitsch H (1994) Katalog der Typen

der Herpetologischen Sammlung nach dem Stand vom 1. Jan-

ner 1994. Teil II. Reptilia. Naturhistorisches Museum Wien,

Wien

Weijola V (2010) Geographic distribution and habitat use of

monitor lizards of the North Moluccas. Biawak 4: 7-23

Weijola V, Sweet SS (2010) A new melanistic species of mon-

itor lizard (Reptilia: Squamata: Varanidae) from Sanana Island,

Indonesia. Zootaxa 2434: 17-32

Welton LJ, Siler CD, Bennett D, Diesmos A, Duya MR, Dugay

R, Rico ELB, van Weerd M, Brown RM (2010) A spectacu-

lar new Philippine monitor lizard reveals a hidden biogeo-

graphic boundary and a novel flagship species for conserva-

tion. Biology Letters 6: 654-658

Bonn zoological Bulletin 57 (2): 127-136

Wiegmann AFA (1834) Amphibien. Pp. 436-522 in: Meyen FJF

(ed.) Reise um die Erde ausgefiihrt auf dem K6niglich Preus-

sischen Seehandlungsschiffe Prinzess Luise, comandiert von

Capitain W. Wendt, in den Jahren 1830, 1831 und 1832. Drit-

ter Theil. Zoologischer Bericht. Sander’sche Buchhandlung,

C. W. Eichhoff, Berlin

Ziegler T, Bohme W (1997) Genitalstrukturen und Paarungsbio-

logie bei squamaten Reptilien, speziell den Platynota, mit Be-

merkungen zur Systematik. Mertensiella 8: 3-207

Ziegler T, Bohme W, Schmitz A (2007a) A new Varanus (Rep-

tilia, Squamata, Varanidae) from Halmahera, Moluccas: The

eleventh species of the V. indicus group. Mitteilungen aus Mu-

seum ftir Naturkunde in Berlin, Zoologische Reihe Supple-

ment 83: 109-119

Ziegler T, Schmitz A, Koch A, B6hme W (2007b) A review of

the subgenus Euprepiosaurus of Varanus (Squamata:

Varanidae): morphological and molecular phylogeny, distri-

bution and zoogeography, with an identification key for the

members of the V. indicus and the V. prasinus species groups.

Zootaxa 1472: 1-28

Received: 04. VII.2010

Accepted: 21.X.2010

©ZFMK

Bonn zoological Bulletin Volume 57

Issue 2 pp. 137-147

Bonn, November 2010

New discoveries of amphibians and reptiles from Vietnam

Thomas Ziegler! & Truong Quang Nguyen23

1 Cologne Zoo, Riehler StraBe 173, D-50735 Cologne, Germany; E-mail: ziegler@koelnerzoo.de

2 Institute of Ecology and Biological Resources, 18 Hoang Quoc Viet, Hanoi, Vietnam;

E-mail: nqt2@yahoo.com

3 Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, D-53113 Bonn, Germany

Abstract. We provide a list of 21 new amphibian and reptilian species and subspecies discoveries from Vietnam, includ-

ing one new snake genus, published after the comprehensive overview by Nguyen et al. (2009). The new herpetofauna

representatives are introduced inclusive of the original description, type locality, English and Vietnamese names, as well

as current distribution.

Key words. Vietnam, herpetofauna, new species.

INTRODUCTION

Although Vietnam has one of the world’s richest amphib-

ian and reptilian fauna, as revealed particularly through

surveys by Vietnamese scientists and their international

collaborators during the past quarter century, the study of

its herpetofauna was long overshadowed by research in

India, China, and the East Indies (Adler 2009). The first

significant summary of the Vietnamese herpetofauna was

written by Morice (1875), in which 13 amphibians and 114

species of reptiles including the marine species were list-

ed. Ten years later, Tirant (1885) published a 104-pages

book containing 166 species of herpetofauna from Viet-

nam and Cambodia. Subsequently, the following staff

members or associates of the Muséum d’Histoire Na-

turelle, Paris, published specific studies of Vietnamese am-

phibians and reptiles: Léon Vaillant (1834-1914), Francois

Mocquard (1834-1917), Jacques Pellegrin (1873-1944),

Paul Chabanaud (1876-1959), Fernand Angel

(1881-1950), and René Bourret (1884-1957), who was

the only one of the afore mentioned zoologists who ever

set foot in Vietnam (Adler 2009).

It was René Bourret, originally a geologist, who became

the leading authority on Vietnamese herpetofauna. From

1927 until 1947 he published a series of papers and books

Bonn zoological Bulletin 57 (2): 137-147

of Indochinese and specifically on Vietnamese herpetol-

ogy. Besides the publication of several identification man-

uals, he is most famous for a substantial series of mono-

graphs of Indochinese herpetology, which are to date the

most important background on the subject (Bourret 1936a,

b, 1941, 1942). In total, René Bourret reported of 177

lizard taxa (1.e., species and subspecies), 245 snake taxa,

45 turtle taxa and 171 amphibian taxa for the Indochinese

region (Nguyen 2006).

Because of the French Indochina War, no remarkable her-

petological studies were undertaken in the period from

1946 to 1954. In 1954, when northern Vietnam attained

independence from France, Vietnamese herpetologists be-

gan to conduct herpetological field surveys predominant-

ly in northern Vietnam, and the first lists and keys to the

species of Vietnamese amphibians and reptiles were com-

piled by Dao (e.g., 1977, 1978, 1979, 1981, 1982), includ-

ing 363 species in total, but with inaccuracies. Another

noteworthy key to snakes of southern Vietnam was writ-

ten during the Second Indochina War, better known in the

West as Vietnam War, by Campden-Main (1970), who had

served several years as a medic with American forces sta-

tioned in Vietnam.

©ZFMK

138 Thomas Ziegler & Truong Quang Nguyen

The end of the Vietnam War in 1975 marked the begin-

ning of another period of biodiversity research in Vietnam

(Sterling et al. 2006). Thereafter, an increasing engage-

ment in herpetological field work mainly by Russian in-

stitutions was observable, which is still persistent. Even-

tually, in the last 30 years many international herpetolog-

ical cooperations emerged, which led to an enormous in-

crease in new records and species descriptions from Viet-

nam (see overview in Nguyen 2006). As a consequence,

the updated checklist by Nguyen et al. (2005) comprised

458 species, viz., 162 species of amphibians and 296

species of reptiles, which included more than 100 addi-

tional species compared with the previous checklist of the

herpetofauna of Vietnam by Nguyen & Ho (1996). Fur-

thermore, the most actual list (Nguyen et al. 2009) cov-

ers 12 additional species of amphibians and 64 addition-

al species of reptiles compared with Nguyen et al. (2005).

On the occasion of this Proceedings Volume addicted to

Professor Dr. Wolfgang Béhme, Vice Director, Head of

the Vertebrate Department and Curator of Herpetology at

the Zoological Research Museum Alexander Koenig,

Bonn, Germany, we provide a list of new amphibian and

reptilian discoveries from Vietnam that were published

subsequent to the comprehensive overview provided by

Nguyen et al. (2009). We would like to dedicate this pa-

per to Wolfgang Bohme, who supervised the PhD theses

of both authors (T. Ziegler: 1997-2000; T.Q. Nguyen

2007-2011) and thus decisively brought forward herpeto-

diversity research in Vietnam.

MATERIAL AND METHODS

We herein compiled species’ descriptions that were for-

mally published after the appearance of Nguyen et al.

(2009). We therefore followed the style and taxonomic

arrangement provided by the latter authors.

Abbreviations are as follows: AMNH = American Muse-

um of Natural History, New York, USA; AMS = Australian

Museum, Sydney, Australia; IEBR = Institute of Ecolo-

gy and Biological Resources, Hanoi, Vietnam; ITBCZ =

Institute of Tropical Biology, Collection of Zoology, Ho

Chi Minh City, Vietnam; LSUHC = La Sierra Universi-

ty, Herpetological Collection, La Sierra University, River-

side, California, USA; UNS = Zoological Collection of

the University of Natural Sciences, Ho Chi Minh City,

Vietnam; VNMN = Vietnam National Museum of Nature,

Hanoi, Vietnam; ZFMK = Zoologisches Forschungsmu-

seum Alexander Koenig, Bonn, Germany; ZISP = Zoo-

logical Institute, St. Petersburg, Russia; a.s.]. = above sea

level.

Bonn zoological Bulletin 57 (2): 137-147

LIST OF NEW SPECIES AND SUBSPECIES SINCE

NGUYEN ET AL. (2009)

Amphibia

Anura

Megophryidae

Leptolalax applebyi Rowley & Cao, 2009

Leptolalax applebyi J.J.L. Rowley & T.T. Cao, 2009, Zoo-

taxa 2198: 52.

Holotype: AMS R171703.

Type locality: Song Thanh Proposed Nature Reserve,

Phouc Son (Phuoc Son) District, Quang Nam Province,

Vietnam, 1,402 ma.s.l.

English name: Appleby’s Asian Toad.

Vietnamese name: Coc may ap-li-bai.

Distribution: This species is currently known only from

the type locality.

Ranidae

Odorrana geminata Bain, Stuart, Nguyen, Che & Rao,

2009

Odorrana geminata R.H. Bain, B.L. Stuart, T.Q. Nguyen,

J. Che & D.-Q. Rao, 2009, Copeia 2: 355.

Holotype: AMNH 163782.

Type locality: Mount Tay Con Linh II, Cao Bo Commune,

Vi Xuyen District, Ha Giang Province, Vietnam, 1,420 m

a.s.l.

English name: Geminated Cascade Frog.

Vietnamese name: Ech bam da hoa.

Distribution: This species (Fig. 1a) is currently known on-

ly from montane areas in northeastern Vietnam (Ha Gi-

ang and Cao Bang provinces) and southeastern Yunnan

Province, China.

©ZFMK

New amphibians and reptiles from Vietnam 139

Fig. 1.

Rhacophoridae

Theloderma lateriticum Bain, Nguyen & Doan, 2009

Theloderma lateriticum R.H. Bain, T.Q. Nguyen & K.V.

Doan, 2009, Zootaxa 2191: 60.

Holotype: AMNH 168757/IEBR A. 0860.

Type locality: Nam Tha Commune, Van Ban District, Lao

Cai Province, Vietnam, 1,300—1,400 m a.s.l.

English name: Brick-red Bug-eyed Frog.

Vietnamese name: Ech cay san do.

Distribution: This species (Fig. 1b) is currently known on-

ly from the type locality.

Bonn zoological Bulletin 57 (2): 137-147

a) Odorrana geminata from Ha Giang Province, Photo T.Q. Nguyen; b) Theloderma lateriticum from Lao Cai Province,

Photo T.Q. Nguyen; c) Leiolepis ngovantrii from Ba Ria—Vung Tau Province, Photo L.L. Grismer; and d) Pseudocalotes ziegleri

from Kon Tum Province, Photo C.T. Ho.

Reptilia

Squamata

Sauria

Agamidae

Leiolepis ngovantrii Grismer & Grismer, 2010

Leiolepis ngovantrii J.L. Grismer & L.L. Grismer, 2010,

Zootaxa 2433: 52.

Holotype: LSUHC 9234.

Type locality: Binh Chau—Phuoc Buu Nature Reserve,

Xuyen Moc District, Ba Ria—Vung Tau Province, Vietnam,

30 ma.s.l.

©OZFMK

140 Thomas Ziegler & Truong Quang Nguyen

Fig. 2.

English name: Ngovantri’s Butterfly Lizard.

Vietnamese name: Nhong cat ngo van tri.

Distribution: This species (Fig. 1c) is currently known on-

ly from Vietnam (Ba Ria—Vung Tau Province).

Pseudocalotes ziegleri Hallermann, Nguyen, Orlov &

Ananjeva, 2010

Pseudocalotes ziegleri J. Hallermann, T.Q. Nguyen, N.

Orlov & N. Ananjeva, 2010, Russ. J. Herpetol. 17(1): 32.

Holotype: IEBR 330.

Type locality: Nuoc Ka forest, near Mang Canh, Kon

Plong District, Kon Tum Province, Vietnam, ca. 1,200 m

a.s.l.

English name: Ziegler’s Tree Lizard.

Vietnamese name: Nhong zig-lo.

Distribution: This species (Fig. 1d) is currently known on-

ly from Vietnam (Kon Tum Province).

Bonn zoological Bulletin 57 (2): 137-147

a) Cnemaspis psychedelica from Ca Mau Province, Photo L.L. Grismer; b) Cyrtodactylus cattienensis from Dong Nai

Province, Photo P. Geissler; c) Cyrtodactylus roesleri from Quang Binh Province, Photo T. Ziegler; and d) Dixonius aaronbaueri

from Ninh Thuan Province, Photo T.V. Ngo.

Remarks: Specimens identified as Pseudocalotes floweri

from Kon Tum Province (Bain et al. 2007) were subse-

quently re-identified as P. ziegleri by Hallermann et al.

(2010).

Gekkonidae

Cnemaspis psychedelica Grismer, Ngo & Grismer, 2010

Cnemaspis psychedelica L.L. Grismer, T.V. Ngo & J.L.

Grismer, 2010, Zootaxa 2352: 48.

Holotype: UNS 0444.

Type locality: Hon Khoai Island, Ngoc Hien District, Ca

Mau Province, Vietnam.

English name: Psychedelic Gecko.

Vietnamese name: Tac ke duoi vang.

Distribution: This species (Fig. 2a) is currently known on-

ly from the type locality.

©OZFMK

New amphibians and reptiles from Vietnam 14]

Cyrtodactylus cattienensis Geissler, Nazarov, Orlov,

Bohme, Phung, Nguyen & Ziegler, 2009

Cyrtodactylus cattienensis P. Geissler, R. Nazarov, N.L.

Orlov, W. Bohme, T.M. Phung, T.Q. Nguyen & T. Ziegler,

2009, Zootaxa 2161, 21.

Holotype: IEBR A.0856.

Type locality: Cat Tien National Park, Dong Nai Province,

Vietnam, 120 m a.s.1.

English name: Cattien Bent-toed Gecko.

Vietnamese name: Thach sung ngon cat tien.

Distribution: This species (Fig. 2b) is currently known on-

ly from Vietnam (Ba Ria-Vung Tau and Dong Nai

provinces).

Cyrtodactylus roesleri Ziegler, Nazarov, Orlov, Nguyen,

Vu, Dang, Dinh & Schmitz, 2010

Cyrtodactylus roesleri T. Ziegler, R. Nazarov, N. Orlov,

T.Q. Nguyen, T.N. Vu, K.N. Dang, T.-H. Dinh & A.

Schmitz, 2010, Zootaxa, 2413: 24.

Holotype: ZFMK 89377.

Type locality: Phong Nha—Ke Bang National Park, Minh

Hoa District, Quang Binh Province, Vietnam.

English name: Roesler’s Bent-toed Gecko.

Vietnamese name: Thach sung ngon ro-x-lo.

Distribution: This species (Fig. 2c) is currently known on-

ly from the type locality.

Cyrtodactylus yangbayensis Ngo & Chan, 2010

Cyrtodactylus yangbayensis T.V. Ngo & K.O. Chan,

Zootaxa, 2504: 48.

Holotype: UNS 0476.

Type locality: Yang Bay Waterfall, Dien Khanh District,

Khanh Hoa Province, southern Vietnam, 500-600 m a.s.1.

English name: Yangbay Bent-toed Gecko.

Vietnamese name: Than lan chan ngon yang bay.

Bonn zoological Bulletin 57 (2): 137-147

Distribution: This species is currently known only from

the type locality in Khanh Hoa Province.

Dixonius aaronbaueri Ngo & Ziegler, 2009

Dixonius aaronbaueri T.V. Ngo & T. Ziegler, 2009,

Zoosyst. Evol., 85(1): 119.

Holotype: UNS 0284.

Type locality: Binh Tien Forest Station, Ninh Hai District,

Nui Chua National Park, Ninh Thuan Province, southern

Vietnam, 4-5 m a.s.1.

English name: Aaron Bauer’s Leaf-toed Gecko.

Vietnamese name: Than lan chan la a-ron-bau-o.

Distribution: This species (Fig. 2d) is currently known on-

ly from the type locality.

Gekko canhi Rosler, Nguyen, Doan, Ho, Nguyen &

Ziegler, 2010

Gekko canhi H. Résler, T.Q. Nguyen, K.V. Doan, C.T. Ho,

T.T. Nguyen & T. Ziegler, 2009, Zootaxa 2329: 57.

Holotype: IEBR A.0910.

Type locality: Huu Lien, Huu Lung, Lang Son Province,

North Vietnam.

English name: Canh’s Gecko.

Vietnamese name: Tac ke canh.

Distribution: This species (Fig. 3a) is currently known on-

ly from northern Vietnam (Lang Son and Lao Cai

provinces).

Gekko russelltraini Ngo, Bauer, Wood & Grismer, 2009

Gekko russelltraini T.V. Ngo, A.M. Bauer, P.L. Jr. Wood

& J.L. Grismer, 2009, Zootaxa 2238: 34.

Holotype: UNS 0293.

Type locality: Chua Chan Mountain, Suoi Cat Commune,

Xuan Loc District, Dong Nai Province, Vietnam, ca. 100

m a.s.l.

English name: Russell Train’s Marble Gecko.

©ZFMK

142 Thomas Ziegler & Truong Quang Nguyen

Fig. 3.

a) Portrait of preserved Gekko canhi from Lang Son Province, Photo T. Ziegler; b) Gekko russelltraini from Dong Nai

Province, Photo T.V. Ngo; c) Gekko takouensis from Binh Thuan Province, Photo S.N. Nguyen; and d) Gekko vietnamensis from

An Giang Province, Photo S.N. Nguyen.

Vietnamese name: Than lan da ru-xen-tren.

Distribution: This species (Fig. 3b) is currently known on-

ly from Vietnam (Dong Nai Province).

Gekko takouensis Ngo & Gamble, 2010

Gekko takouensis T.V. Ngo & T. Gamble, 2010, Zootaxa

2346: 18.

Holotype: UNS 0491.

Type locality: Ta Kou Mountain, Ham Thuan Nam Dis-

trict, Binh Thuan Province, Vietnam, 425 m a.s.l.

English name: Takou Marbled Gecko.

Vietnamese name: Than lan da ta kou.

Distribution: This species (Fig. 3c) is currently known on-

ly from the type locality.

Bonn zoological Bulletin 57 (2): 137-147

Gekko vietnamensis Nguyen, 2010

Gekko vietnamensis S.N. Nguyen, 2010, Zootaxa 2501:

55:

Holotype: ITBCZ 667.

Type locality: Tuc Dup Hill, An Giang Province, south-

ern Vietnam, 43 m a.s.1.

English name: Vietnam Gecko

Vietnamese name: Tac ke viet nam.

Distribution: This species (Fig. 3d) is currently known on-

ly from the type locality.

Scincidae

Scincella apraefrontalis Nguyen, Nguyen, BOhme &

Ziegler 2010

Scincella apraefrontalis T.Q. Nguyen, S.V. Nguyen, W.

Bohme & T. Ziegler, 2010, Folia. Zool., 59(2): 116.

©ZFMK

New amphibians and reptiles from Vietnam 143

Holotype: IEBR A.0832.

Type locality: Huu Lien Nature Reserve, Huu Lung Dis-

trict, Lang Son Province, Vietnam, ca. 200 m a.s.].

English name: Huulien Ground Skink.

Vietnamese name: Than lan co huu lien.

Distribution: This species is only known from Lang Son

Province, northeastern Vietnam.

Tropidophorus boehmei Nguyen, Nguyen, Schmitz,

Orlov & Ziegler, 2010

Tropidophorus boehmei T.Q. Nguyen, T.T. Nguyen, A.

Schmitz, N.L. Orlov & T. Ziegler, 2010, Zootaxa 2439:

D7,

Holotype: VNMN 822.

Type locality: Hoang Lien Mountain, near Ban Khoang,

Sa Pa District, Lao Cai Province, northern Vietnam,

1,200—1,300 m a.s.l.

English name: Boehme’s Water Skink

Vietnamese name: Than lan tai boe-me

Distribution: This species (Fig. 4a) is currently known on-

ly from Hoang Lien Mountain in Sa Pa and Van Ban dis-

tricts, Lao Cai Province, Vietnam.

Serpentes

Colubridae

Calamaria gialaiensis Ziegler, Nguyen & Nguyen, 2008

Calamaria gialaiensis T. Ziegler, S.V. Nguyen & T.Q.

Nguyen, 2008, Current Herpetol., 27(2): 72.

Holotype: IEBR A.0714.

Type locality: Kon Ka Kinh, K Bang District, Gia Lai

Province, Vietnam, 1300 m a.s.l.

English name: Gialai Reed Snake.

Vietnamese name: Ran mai gam gia lai.

Distribution: This species (Fig. 4b) is currently known on-

ly from Gia Lai Province, Vietnam.

Bonn zoological Bulletin 57 (2): 137-147

Calamaria sangi Nguyen, Koch & Ziegler, 2010 (2009)

Calamaria sangi T.Q. Nguyen, A. Koch & T. Ziegler, 2010

“2009”, Hamadryad 34(1): 2.

Holotype: IEBR 360.

Type locality: Mang Canh Commune, Kon Plong District,

Kon Tum Province, Vietnam, 1,200 m a.s.1.

English name: Sang’s Reed Snake.

Vietnamese name: Ran mai gam sang.

Distribution: This species is currently known only from

Vietnam.

Colubroelaps nguyenvansangi Orlov, Kharin, Ananje-

va, Nguyen & Nguyen, 2009

Colubroelaps nguyenvansangi N.L. Orlov, V.E. Kharin,

N.B. Ananjeva, T.T. Nguyen & T.Q. Nguyen, 2009, Russ.

J- Herpetol. 16(3): 235.

Holotype: ZISP/IEBR 25682.

Type locality: Loc Bac Forest Enterprise, Lam Dong

Province, Vietnam, ca. 720 m a.s.].

English name: Nguyenvansang’s Snake.

Vietnamese name: Ran nguyen van sang.

Distribution: The second record of this species was report-

ed by N. Poyarkov from Bu Gia Map National Park, Binh

Phuoc Province (Fig. 5). Therefore Colubroelaps nguyen-

vansangi 1s currently known from Lam Dong and Binh

Phuoc provinces, Vietnam.

Lycodon ruhstrati abditus Vogel, David, Pauwels,

Sumontha, Norval, Hendrix, Vu & Ziegler, 2009

Lycodon ruhstrati abditus G. Vogel, P. David, O.S.G.

Pauwels, M. Sumontha, G. Norval, R. Hendrix, T.N. Vu

& T. Ziegler, 2009, Tropical Zoology 22(2): 144.

Holotype: ZFMK 86451.

Type locality: U Bo region, Phong Nha — Ke Bang Na-

tional Park, Quang Binh Province, Vietnam.

English name: Hidden Mountain Wolf Snake.

Vietnamese name: Ran khuyet an.

©ZFMK

144 Thomas Ziegler & Truong Quang Nguyen

Fig. 4. a) Tropidophorus boehmei from Lao Cai Province, Photo T.T. Nguyen; b) Portrait of preserved Calamaria gialaiensis

from Gia Lai Province, Photo T. Ziegler; and c) Protobothrops trungkhanhensis from Cao Bang Province, Photo T.T. Nguyen.

SSS

Osi a

ee ae

Fig. 5. | Colubroelaps nguyenvansangi from Binh Phuoc Province, Photo N. Poyarkov.

Bonn zoological Bulletin 57 (2): 137-147 ©ZFMK

New amphibians and reptiles from Vietnam 145

Dao (1977-

1982) Fb (1996) = (2005)

Fig. 6. Species diversity of the herpetofauna of Vietnam.

Distribution: This subspecies is currently known from

Quang Binh and Vinh Phuc provinces in Vietnam, and

from Fujian, Anhui, Zhejiang, Guangdong, Yunnan,

Sichuan and Gansu provinces in China. Because it has of-

ten been confused with other taxa, its range is probably

much wider, both in northern Vietnam and China (prob-

ably also present in Guangxi Province).

Viperidae

Protobothrops trungkhanhensis Orlov, Ryabov &

Nguyen, 2009

Protobothrops trungkhanhensis N.L. Orloy, S.A. Ryabov

& T.T. Nguyen, 2009, Russ. J. Herpetol. 16(1): 71.

Holotype: ZISP 25351.

Type locality: Trung Khanh Nature Reserve, Trung

Khanh District, Cao Bang Province, Vietnam, 600 m a.s.1.

English name: Trungkhanh Pitviper.

Vietnamese name: Ran luc trung khanh.

Distribution: This species (Fig. 4c) is currently known on-

ly from the type locality.

Bonn zoological Bulletin 57 (2): 137-147

® Anphibians

Navan & Nanandal Navandal July 210

(2009)

DISCUSSION

After the publication of the “Herpetofauna of Vietnam”

by Nguyen et al. (2009) 20 new amphibian and reptilian

species, one new subspecies, and a new snake genus have

been described from Vietnam by June 2010. Among them

there were three new amphibians (1 Megophryidae, 1

Ranidae, | Rhacophoridae) and 18 new reptilian taxa (2

Agamidae, 9 Gekkonidae, 2 Scincidae, 4 Colubridae, and

1 Viperidae). In contrast, two species which were listed

as valid and occurring in Vietnam in Nguyen et al. (2009)

were synonymized meanwhile: Gekko ulikovskii Darevsky

& Orlov, 1994 was regarded as a junior synonym of Gekko

badenii Szczerbak & Nekrasova, 1994 by Nguyen et al.

(2010d) and the specimen previously identified as

Pseudocalotes floweri from Kon Tum Province was re-

identified as P. ziegleri by Hallermann et al. (2010). Most

of the recent species’ discoveries affected lizards, with

geckos clearly being the predominant group. In addition

to these new species descriptions, three new country

records were published after the book of Nguyen et al.

(2009): one amphibian species, the megophryid anuran

Leptobrachium promustache, the scincid lizard Scincella

monticola, and the colubrid snake Amphiesmoides ornat-

iceps (Bain et al. 2009b, Nguyen et al. 2010a, b).

The results of this paper clearly exemplify that even af-

ter the comprehensive book provided by Nguyen et al.

©ZFMK

146 Thomas Ziegler & Truong Quang Nguyen

(2009) much research is needed to describe Vietnam’s rich

herpetodiversity. In particular because not only cryptic or

inconspicuous species were discovered and formally de-

scribed in the past months, but also striking and colour-

ful species like Cnemaspis psychedelica (Grismer et al.

2010) or even new genera, as was recently shown by the

description of Colubroelaps (Orlov et al. 2009a). Current-

ly, the herpetofauna of Vietnam comprises 181 species of

amphibians and 385 species of reptiles (Fig. 6). Howev-

er, diversity research and species inventories are only the

first steps, which must be followed by investigations of

the natural history and specific adaptations, which final-

ly are prerequisites for adequate conservation measures.

Acknowledgements. We are indebted to our colleagues Peter

Geissler (Bonn), L. Lee Grismer (Riverside), Ngo Van Tri,

Nguyen Ngoc Sang (Ho Chi Minh City), Nguyen Thien Tao

(Hanoi), Nikolay Poyarkov (Moscow), and Nikolai L. Orlov (St.

Petersburg) who kindly provided photographs.

REFERENCES

Adler K (2009) Herpetological exploration, research, and con-

servation in Vietnam. Pp. 33-56 in: Nguyen VS, Ho TC &

Nguyen QT. Herpetofauna of Vietnam. Edition Chimaira,

Frankfurt am Main

Bain RH, Nguyen QT, Doan VK (2007) New herpetological

records from Vietnam. Herpetol. Rev. 38(1): 107-117

Bain RH, Nguyen QT, Doan VK (2009a) A new species of the

genus Theloderma Tschudi, 1838 (Anura: Rhacophoridae)

from northwestern Vietnam. Zootaxa 2191: 58-68

Bain RH, Nguyen QT, Doan VK (2009b) First record of Lepto-

brachium promustache from Vietnam. Herpetology Notes 2:

27-29

Bain RH, Stuart BL, Nguyen QT, Che J, Rao D-Q (2009c) A

new Odorrana (Amphibia: Ranidae) from Vietnam and Chi-

na. Copeia 2: 348-362

Bourret R (1936a) Les serpents de |’ Indochine. I. Etudes sur la

faune. Henri Basuyau et Cie, Toulouse

Bourret R (1936b) Les serpents de |’ Indochine. II. Catalogue sys-

tématique descriptif. Henri Basuyau et Cie, Toulouse

Bourret R (1941b) Les tortues de I’Indochine. Inst. Océanogr.

de |’Indochine: 1—235

Bourret R (1942) Les batraciens de |’ Indochine. Inst. Océanogr.

de I’Indochine: 1-547

Campden-Main SM (1970) A field guide to the snakes of south

Vietnam. Div. Rept. Amphib., U.S. Nat. Mus., Smiths. Inst.,

Washington

Dao VT (1977) On the identification of the Vietnamese amphib-

ians. J. Bio.-Geol. Hanoi 15(2): 33-40 (in Vietnamese)

Dao VT (1978) On the identification of the Vietnamese turtles

and crocodiles. J. Bio-Geol., Hanoi, 16(1): 1-6 (in Viet-

namese)

Dao VT (1979) On the identification of the Vietnamese lizards.

J. Biol., Hanoi: 2-10 (in Vietnamese)

Dao VT (1981) On the identification of the Vietnamese snakes:

Part 1. J. Biol., Hanoi, 3(4): 1-6 (in Vietnamese)

Dao VT (1982) On the identification of the Vietnamese snakes.

Part 2. J. Biol. Hanoi 4(1): 5—9 (in Vietnamese)

Bonn zoological Bulletin 57 (2): 137-147

Geissler P, Nazarov R, Orlov NL, Bohme W, Phung MT, Nguyen

QT, Ziegler T (2009) A new species of the Cyrtodactylus ir-

regularis complex (Squamata: Gekkonidae) from southern

Vietnam. Zootaxa 2161, 20-32

Grismer JL, Grismer LL (2010) Who’s your mommy? Identify-

ing maternal ancestors of asexual species of Leiolepis Cuvi-

er, 1829 and the description of a new endemic species of asex-

ual Leiolepis Cuvier, 1829 from Southern Vietnam Zootaxa

2433: 47-61

Grismer LL, Ngo VT, Grismer JL (2010) A new colorful new

species of insular rock gecko (Cnemapsis Strauch 1887) from

southern Vietnam. Zootaxa 2352: 46-58

Hallermann J, Nguyen QT, Orlov N, Ananjeva N (2010) A new

species of the genus Pseudocalotes (Squamata: Agamidae)

from Vietnam. Russ. J. Herpetol. 17(1): 31-40

Morice A (1875) Coup d’oeil sur la faune de la Cochinchine

frangaise. Ass. Lyon. A. Sci. Nat., Lyon: 25-121

Ngo VT, Bauer AM, Wood PL Jr, Grismer JL (2009) A new

species of Gekko Laurenti, 1768 (Squamata: Gekkonidae)

from Dong Nai Province, Southeastern Vietnam. Zootaxa

2238: 33-42

Ngo VT, Gamble T (2010) A new species of Gekko (Squamata:

Gekkonidae) from Ta Kou Nature Reserve, Binh Thuan

Province, southern Vietnam. Zootaxa 2346: 17-28

Ngo VT, Onn CK (2010) A new species of Cyrtodactylus Gray,

1826 (Squamata: Gekkonidae) from Khanh Hoa province,

Southern Vietnam. Zootaxa 2504: 47-60

Ngo VT, Ziegler T (2009) A new species of Dixonius from Nui

Chua National Park, Ninh Thuan Province, southern Vietnam

(Squamata, Gekkonidae). Zoosyst. Evol. 85(1), 117-125

Nguyen NS (2010) A new poreless species of Gekko Laurenti,

1768 (Gekkonidae: Squamata) from An Giang Province,

southern Vietnam. Zootaxa 2501: 54-60

Nguyen QT (2006) Herpetological collaboration in Vietnam. Pp.

233-240 in: Vences M, Kohler J, Ziegler T & BOhme W (eds.)

Herpetologia Bonnensis II. Proceedings of the 13th Ordinary

General Meeting of the Societas Europaea Herpetologica,

Bonn

Nguyen QT, David P, Tran TT, Luu QV, Le KQ, Ziegler T

(2010a): Amphiesmoides ornaticeps (Werner, 1924), an addi-

tion to the snake fauna of Vietnam, with a redescription and

comments on the genus Amphiesmoides Malnate, 1961

(Squamata: Natricidae). Rev. Suisse de Zoologie 117(1):

45-56

Nguyen QT, Koch A, Ziegler T (2009) A new species of reed

snake, Calamaria Boie, 1827 (Squamata: Colubridae), from

central Vietnam. Hamadryad 34(1): 1-8

Nguyen QT, Nguyen TT, Bohme W, Ziegler T (2010b) First

record of the mountain ground skink Scincella monticola

(Schmidt, 1925) (Squamata: Scincidae) from Vietnam. Russ.

J. Herpetol. 17(1): 67-69

Nguyen QT, Nguyen TT, Schmitz A, Orlov NL, Ziegler T

(2010c) A new species of the genus Tropidophorus Dumeril

& Bibron, 1839 (Squamata: Sauria: Scincidae) from Vietnam.

Zootaxa 2439: 53-68

Nguyen QT, Schmitz A, BGhme W (2010d) Gekko ulikovskii

Darevsky & Orlov, 1994: a junior synonym of Gekko badenii

Szezerbak & Nekrasova, 1994. Bonn zoological Bulletin

57(1): 15-17

Nguyen VS, Ho TC (1996) Danh luc bo sat va ech nhai Viet

Nam. Nha xuat ban khoa hoc va ky thuat, Hanoi (in Viet-

namese)

Nguyen VS, Ho TC, Nguyen QT (2005) A checklist of amphib-

ians and reptiles of Vietnam. Agricultural Publishing House,

Hanoi (in Vietnamese)

©OZFMK

New amphibians and reptiles from Vietnam 147

Nguyen VS, Ho TC, Nguyen QT (2009) Herpetofauna of Viet-

nam. Edition Chimaira, Frankfurt am Main

Orlov NL, Kharin VE, Ananjeva NB, Nguyen TT, Nguyen QT

(2009a) A new genus and species of colubrid snake (Squama-

ta, Ophidia, Colubridae) from South Vietnam (Lam Dong

Province). Russ. J- Herpetol. 16(3): 228-240

Orlov NL, Ryabov SA, Nguyen TT (2009b) Two new species

of genera Protobothrops Hoge et Romano-Hoge, 1983 and

Viridovipera Malhotra et Thorpe, 2004 (Ophidia: Viperidae:

Crotalinae) from karst region in northeastern Vietnam. Part I).

description of a new species of Protobothrops genus. Russ.

J. Herpetol. 16(1): 69-82

Roésler H, Nguyen QT, Doan VK, Ho TC, Nguyen TT, Ziegler

T (2009) A new species of the genus Gekko Laurenti (Squa-

mata: Sauria: Gekkonidae) from Vietnam with remarks on G.

japonicus (Schlegel). Zootaxa 2329: 56-68

Rowley JJL, Cao TT (2009) A new species of Leptolalax (Anura:

Megophryidae) from central Vietnam. Zootaxa 2198: 51—60

Sterling EJ, Hurley MM, Le DM (2006) Vietnam a natural his-

tory. Yale University Press, New Haven & London

Bonn zoological Bulletin 57 (2): 137-147

Tirant G (1885) Notes sur les reptiles et les batraciens de la

Cochinchine et du Cambodge. Excursions et Reconnaissance,

Saigon 20

Vogel G, David P, Pauwels OSG, Sumontha M, Norval G, Hen-

drix R, Vu NT, Ziegler T (2009) A revision of Lycodon ruh-

strati (Fischer 1886) auctorum (Squamata Colubridae), with

the description of a new species from Thailand and a new sub-

species from the Asian mainland. Tropical Zoology 22(2):

131-182

Ziegler T, Nazarov R, Orlov N, Nguyen QT, Vu NT, Dang NK,

Dinh HT, Schmitz A (2010) A third new Cyrtodactylus (Squa-

mata: Gekkonidae) from Phong Nha-Ke Bang National Park,

Truong Son Range, Vietnam. Zootaxa 2413: 20-36

Ziegler T, Nguyen VS, Nguyen QT (2008) A new reed snake of

the genus Calamaria Boie (Squamata: Colubridae) from Viet-

nam. Current Herpetology 27(2): 71-80

Received: 09. VI.2010

Accepted: 24. VIII.2010

©ZFMK

L Bonn zoological Bulletin Volume 57

Issue 2 pp. 149-171 Bonn, November 2010

The distinction between family-series and class-series nomina

in zoological nomenclature, with emphasis on the nomina

created by Batsch (1788, 1789) and on the higher nomenclature of turtles

Alain Dubois & Roger Bour

Reptiles & Amphibiens, UMR 7205 OSEB, Département de Systématique & Evolution,

Muséum national d’ Histoire naturelle, CP 30, 25 rue Cuvier, F-75005 Paris, France;

E-mails: sapo421@gmail.com, bour@mnhn. fr

Abstract. The Code only regulates the scientific names or nomina of zoological taxa from the rank subspecies to the

rank superfamily, but not those of taxa at ranks above the latter (class-series nomina). It is shown here that its current

Rules are somewhat ambiguous regarding the availability of family-series nomina and the distinction between the latter

and class-series nomina, and it is again suggested that it should be improved in this respect. It should cover the whole

nomenclatural hierarchy in zoology, which requires to expand it in order to incorporate Rules for the nomenclature of

higher taxa. A detailed analysis is devoted to the poorly known work of Batsch (1788, 1789), and it is shown that 17 fam-

ily-series nomina, 16 of which have remained unnoticed until now, are available and should replace the homonymous

junior nomina currently considered valid in zootaxonomy. Particular attention is given to the higher nomenclature of tur-

tles, and it is shown that the nomen 7éSTUDINES Batsch, 1788 is a family-series, not a class-series nomen. This nomen is

therefore the valid one, as TESTUDINIDAE Batsch, 1788, of the family including the genus Jestudo Linnaeus, 1758, but

cannot apply to the order of turtles, tortoises and terrapins.

Key words. Zoological nomenclature, Code, availability, class, family, Batsch, turtles, TESTUDINES, TESTUDINIDAE.

ABBREVIATIONS AND PRINTING CONVEN-

TIONS

In this paper, “ICZN” designates the International Com-

mission on Zoological Nomenclature and “the Code” the

edition currently in force of the /nternational Code of Zo-

ological Nomenclature (Anonymous 1999). For reasons

explained in details elsewhere (Dubois 2000, 2006a), some

terms of the Code are here substituted by other terms, as

follows (in the order of their first appearance in the text,

indicated there by an asterisk*): nomen (plural nomina)

for “scientific name” (Dubois 2000); nominal-series for

“groups of names” (Dubois 2000), with four such series

(“groups”) being discussed here: the species-, genus-, fam-

ily- and class-series (Dubois 2000); anoplonym for a

“nomenclaturally unavailable name” (Dubois 2000); so-

zonym for a nomen that has had a universal or significant

use in non-systematic literature after 31 December 1899

(Dubois 2005a—b); distagmonym for a nomen that has not

had such a use (Dubois 2005a—b); onomatophore for

“type” or “name-bearing type” (Simpson 1940); nucle-

ogenus (plural nucleogenera) for “type genus” (Dubois

2005b); nucleospecies for “type species” (Dubois 2005b);

Bonn zoological Bulletin 57 (2): 149-171

monophory for “monotypy” (Dubois 2005b); neonym for

“new replacement name” or “nomen novum” (Dubois

2000); autoneonym for a neonym being an “unjustified

emendation” (Dubois 2000); archaeonym for the nomen

replaced by a neonym (Dubois 2005a); hyponymous for

“nominotypical” (Dubois 2006c). The nomina belonging

to the species-series and genus-series are printed, as usu-

al, in lower case italics, whereas nomina of higher-ranked

taxa are printed in small capitals, with the following dis-

tinction: family-series nomina are in /74LICS, whereas

class-series nomina are in BOLD. Anoplonyms are print-

ed “between quotation marks”.

FAMILY-SERIES AND CLASS-SERIES NOMEN-

CLATURE IN ZOOLOGY

The Code regulates the nomina* of zoological taxa from

the rank subspecies to the rank superfamily, but not those

of taxa at ranks above the latter. Therefore the use and al-

©OZFMK

150 Alain Dubois & Roger Bour

location of nomina of taxa referred to the higher ranks of

zoological nomenclature (order, class, phylum, etc.) are

left to the freedom and opinions of individual zoologists,

as no Rules exist in the Code for their availability, allo-

cation to taxa and validity, the three basic steps of the

nomenclatural process (Dubois 2005a—c, 2006a).

The nomina covered by the Code are distributed in three

nominal-series*: the species-*, genus-* and family-se-

ries*. Any nomen, to be recognized as nomenclaturally

available, must first be explicitly or implicitly referred to

one of these nominal-series. No difficulty usually arises

regarding the allocation of nomina to the species- and

genus-series, but, in some cases, problems may be encoun-

tered to know whether a given nomen belongs in the fam-

ily-series, and thus is governed by the nomenclatural Rules

of the Code, or to a rank above the family-series, there-

fore in the class-series* and thus is outside the Rules of

the Code.

The Code is not fully clear regarding the conditions of

availability of family-series nomina. Only two conditions

are clear for all nomina, concerning the stem of the nomen

and the reference to a suprageneric taxon. Article 11.7.1.1

states that, to be available in its original publication, a fam-

ily-series nomen must “be a noun in the nominative plu-

ral formed from the stem of an available generic name’,

which is then its nucleogenus* (type-genus). Therefore,

any higher taxon nomen not based on an available gener-

ic nomen is unavailable for a family-series nomen, but

may under certain conditions be available for a class-se-

ries nomen. Article 11.7.1.2 adds that the new nomen must

“be clearly used as a scientific name to denote a supra-

generic taxon and not merely as a plural noun or adjec-

tive referring to the members of a genus”. Therefore, the

explicit use of the rank family, or of another traditional

rank of the family-series (subfamily, superfamily, tribe,

subtribe, etc.), is not required for availability of nomina

in the family-series. Two additional clear conditions, ap-

plying only to nomina published after 1999, are given in

Articles 16.1 (the nomen “must be explicitly indicated as

intentionally new”) and 16.2 (the nomen “must be accom-

panied by citation of the name of the type genus’’). Ac-

cording to Article 11.7.1.1, before 2000, the type-genus

may be indicated “either by express reference to the gener-

ic name or by reference to its stem”, 1.e., by implicit ety-

mological designation (Dubois 1984).

Three conditions are unclear in the current Code regard-

ing the status of new family-series nomina: (C1) the date;

(C2) the requirement for validity of the nomen of the nu-

cleogenus; and (C3) the distinction between family-series

and class-series nomina.

Bonn zoological Bulletin 57 (2): 149-171

(C1) No starting date is given in the Code for the use of

family-series nomina in zoological nomenclature. How-

ever, the rank family and related ones (superfamily, sub-

family, tribe, subtribe, etc.) were not recognized by Lin-

naeus (1758, 1761, 1764, 1766, 1767), although this au-

thor made use of no less than seven ranks above the rank

genus (Dubois 2007). Some authors of the 18 century

used the ranks family and tribe, but not always for taxa

above the rank genus and below the rank order, with fam-

ily as a rank above tribe (Dubois 2006a). For example,

some authors (e.g., De Geer 1778; Goeze & Donndorff

1797) used family as a rank below the rank genus, where-

as others, including some quite recently, used tribe as a

rank above the rank order (e.g., Scopoli 1777; de

Blainville 1816; Huene 1952) or below the rank order but

above the rank family (e.g., Oken 1821, 1833; Fitzinger

1826, 1843; Swainson 1835; Hogg 1841; Bonaparte 1845;

de Blainville 1847; Stannius 1856). In zoological taxon-

omy, the first authors that are traditionally credited with

the creation of family-series nomina for taxa above the

rank genus are authors who published their works in the

early 19th century: e.g., Lamarck (1801), Latreille (1802,

1824, 1825), Oppel (181la—b), Rafinesque-Schmaltz

(1814a—d), Rafinesque (1815), Vieillot (1816), Fischer

(1817), Goldfuss (1820), Gray (1825) or Vigors (1825).

However, a few authors in the second half of the 18" cen-

tury already used the rank family for taxa at ranks between

genus and order. This is the case of Batsch (1788, 1789),

in a rather poorly known work discussed in detail below.

Inasmuch as the familial nomina created by these authors

were clearly based on the stems of available generic nom-

ina considered valid by these authors, there is no reason

for not crediting these authors with the creation of these

familial nomina, even if this was ignored by most subse-

quent authors until now (Dubois 2010: 25).

(C2) Regarding the requirement for validity of the gener-

ic nomen used as stem (nucleogenus), Article 11.7.1.1

states that “the generic name must be a name then used

as valid in the new family-group taxon [Arts. 63, 64] (use

of the stem alone in forming the name is accepted as ev-

idence that the author used the generic name as valid in

the new family-group taxon unless there is evidence to the

contrary)”. There are several questions with this unclear

formulation. First, what does “then” mean in this context?

This word would have a clear sense only if it meant “in

the work where the new family-series nomen is created”,

but then why not write it in full words? If it meant “‘at the

period of this work”, this would be difficult to apply, first

because it is unclear how long the period to be considered

should be (preferably it seems that it should not include

more than ten or 20 years around the creation of the new

family-series nomen), and second because at any given pe-

©ZFMK

Family- and class-series nomina in zoology 151]

riod of taxonomy the same nomen may be accepted as

valid by part of the authors then active, and invalid by oth-

ers, as will be illustrated below with the example of the

nomina Lacerta Linnaeus, 1758 and LAcer7T4E Batsch,

1788. Furthermore, the words “used as valid in the new

family-group taxon” show that this condition cannot ap-

ply to works published before the creation of the latter tax-

on! Therefore, this part of Article 11.7.1.1 would be made

clearer by choosing between the two following formula-

tions: (Fl) “the generic nomen must be used as valid in

the new family-group taxon in the work where its nomen

is created’; (F2) “the generic nomen must be used as valid

by all active taxonomists in the 10 years before and after

creation of the new family-group nomen” (or another

span). Until this choice is made by the ICZN, this Article

is not fully operational, as will be exemplified below. The

French version of Article 11.7.1.1 in the current Code is

not strictly equivalent to its English version, which is prob-

lematic as these two texts are deemed to be “equivalent

in force and meaning” (Anonymous 1999: xiii). As a mat-

ter of fact, the French version of this Article ignores the

term “then” (“alors”). In the previous edition of the Code

(Anonymous 1985: 25), Article 11(f)(i)(1) wrote “then

used as valid for a genus contained in that family-group

taxon’. These elements suggest that formulation (F1)

above corresponds to the real meaning of this article, and

we follow this interpretation below.

(C3) Regarding the distinction between family-series and

class-series nomina, it is unambiguous in the Code only

in the case of suprageneric nomina that are not based on

available generic nomina, which are unavailable in the

family-series, but may be available in the class-series, at

least in some cases (see below). But what is the status of

nomina based on the stem of available generic nomina cre-

ated for taxa at ranks clearly above the family-series (or-

der, class, etc.), or for taxa of unusual ranks, not clearly

referable to the family- or class-series (such as phalanx,

cohort, gens, etc.), or for taxa of unspecified ranks? The

Code does not provide any clue for decision in such cas-

es, all the more that, as reminded above, the explicit use

of the rank family, or of another rank of the family-series,

is not required for availability of nomina in the family-

series. A few clear situations exist: (1) when a nomen is

created for a taxon that is explicitly originally referred to

a rank higher than superfamily, or than order, class or an-

other rank traditionally referred for the class-series in zo-

ology, whatever this rank is, such a nomen belongs in the

class-series; (2) in contrast, when a nomen is created for

a suprageneric taxon of rank lower than superfamily or

than any other traditional rank in the family-series (fam-

ily, subfamily, tribe, etc.), and is based on the stem of a

nucleogenus, it belongs in the family-series. But when-

ever a nomen is proposed for a taxon of any rank above

the rank genus, and without clear hierarchical relationships

Bonn zoological Bulletin 57 (2): 149-171

with other taxa of ranks unambiguously referable either

to the family- or to the class-series, it may be treated e1-

ther as a class-series nomen (this is the case for example

of all suprageneric nomina created by Linnaeus: see

Dubois 2007) or as a family-series nomen. In such cases,

the etymology of the nomen may be a help for the deci-

sion: 1f the nomen is based on the stem of an available

generic nomen, it may be treated as a family-series nomen,

otherwise as a class-series nomen.

Another matter ignored by the Code is what could be

called the consistency problem. In some publications of

the 18th, 19th and even 20 centuries, some authors were

not consistent regarding the mode of formation of their

new familial nomina: some were based on the stem of

available generic nomina, whereas others were not, being

descriptive or geographical terms, terms based on the

names of persons, etc. In such cases, the nomina of the

first category could be accepted as available both as fam-

ily-series and class-series nomina, but those of the second

category can be considered available only in the class-se-

ries. However, a choice has to be made between these two

nominal-series for a// the nomina created together with the

same rank, as it is not logical and conceivable to admit

that the same author, in the same publication, created both

family-series and class-series nomina for taxa of same rank

(for details, see Dubois 2008b). Dubois (2006a: 178) pro-

posed that, in such cases, for reasons of consistency in the

taxonomic hierarchy, all these nomina be referred to the

family-series, but that those which are incorrectly formed

(not being based on available generic nomina, or formed

through addition of a complex suffix unacceptable as a

family-series suffix according to the Code), be considered

nomenclaturally unavailable. These are of two kinds

(Dubois 2006a: 178): arhizonyms are family-series nom-

ina not based on generic nomina, and caconyms are fam-

ily-series nomina based on generic nomina but with a com-

plex suffix (such as -forma, -morpha, etc.). Examples of

arhizonyms include “BATRACINIA”, “GYMNODERMIA” and

‘“PHRYNACINIA”, coined by Rafinesque (1815) for taxa of

ranks family or subfamily, along with available family-

series nomina like HYLARINIA, RANARINIA and TRITONIA. Ex-

amples of caconyms include “RANIFORMES”, “HYLAE-

FORMES”, “BUFONIFORMES” and “PIPAEFORMES’’, coined by

Dumeéril & Bibron (1841) for taxa of rank family, along

with available family-series nomina like CECILIOIDES,

SALAMANDRIDES, AMPHIUMIDES and PROTEIDES.

In his study of class-series nomenclature in zoology,

Dubois (2006a: 228), after a detailed discussion of the

problems mentioned above and others, proposed two new

Rules to clarify this situation and to distinguish between

family-series and class-series nomina in a simple, objec-

tive and automatic manner:

©ZFMK

152 Alain Dubois & Roger Bour

“(R4) Allocation of nomina to the family-series or to the

class-series. Whenever a single new suprageneric nomen

of a given taxonomic rank was established in a publica-

tion, this nomen must be referred to the family-series if

both following conditions are fulfilled: (A) it was proposed

for a taxon of a rank usual within the family-series or of

an unusual rank but clearly presented as being hierarchi-

cally subordinate to a usual rank of that series although

above the genus; and (B) it was coined by addition of a

simple suffix denoting the plural to the stem of an avail-

able genus-series nomen. In all other cases, the nomen

must be referred to the class-series. Whenever several new

suprageneric nomina of the same rank were established

in a publication, they must all be referred to the same nom-

inal-series, if they were treated heterogeneously with re-

gard to the criteria above, they must follow the Rule of

Taxonomic Consistency (R5).

(R5) Rule of Taxonomic Consistency. All suprageneric

nomina created in the same publication for taxa that were

afforded the same taxonomic rank must be referred to the

same nominal-series. In case of conflict between their al-

location to nominal-series according to Rule (R4), the fam-

ily-series takes precedence over the class-series, and nom-

ina that, being incorrectly formed (arhizonyms or ca-

conyms), cannot be considered as belonging to that se-

ries, must be treated as nomenclaturally unavailable

(anoplonyms*).”

These proposed Rules should be studied carefully by the

ICZN and incorporated into the Code, or others Rules

should be proposed, but until this is done, ambiguity will

exist and decisions regarding the status of some nomina

of higher taxa will remain unclear, and will have to rely

on arbitrary decisions on the part of some zoologists, as

will now be shown.

In what follows, these general questions will be concrete-

ly studied in one zoological group: we will examine the

status of the nomina used by the authors until now for (1)

the order of reptiles including the turtles and (2) the fam-

ily of turtles including the genus 7estudo Linnaeus, 1758.

THE HIGHER NOMENCLATURE OF TURTLES

Despite various works dealing with it, the higher nomen-

clature of turtles is not yet stabilized. The nomenclatural

chaos is clearly emphasized by the use of different and

incompatible nomenclatures over very short periods of

times, not only by different authors, but sometimes by the

same one (e.g., Vetter 2002, 2004; Vetter & van Dijk

2006). The last publications in this respect, by Rhodin et

al. (2008, 2009), are not reliable references, as they dis-

play ignorance of several basic nomenclatural Rules of the

Bonn zoological Bulletin 57 (2): 149-171

Code. For example, they do not follow the Code’s Prin-

ciple of Coordination for superfamilies, which are cred-

ited to authors and dates different from those of their hy-

ponymous* families (e.g., KINOSTERNIDAE Agassiz, 1857

and KINOSTERNOIDEA Joyce, Parham & Gauthier, 2004) and

sometimes given incorrect endings (7RIONyCHIA Hummel,

1929). An important nomenclatural flaw, discussed in de-

tail below, is to refer the same nomen (7ESTUDINES Batsch,

1788) both to the family- and the class-series.

Table | (in Appendix 1) provides a survey of various nom-

ina, with their authors and dates when they were speci-

fied, that have been used until now by a number of zool-

ogists for the order of turtles and the family including the

genus Zestudo Linnaeus, 1758.

Several problems can be identified in this table. First, al-

though the family including the genus 7estudo has almost

always been known as TESTUDINIDAE, the author and date

of the latter nomen has not been consensual. Some authors

(e.g., Hunt 1958: 150; Iverson 1992: 3; Xianrui 1994: 4)

have credited a nomen “Testudines” to Linnaeus (1758:

194, 198). However, it is fully clear that, in this and oth-

er works of Linnaeus, the term Jestudines was a plural

noun referring to the members of the genus Jestudo, not

a family-series or class-series nomen (Article 11.7.1.2;

Bour & Dubois 1985). This is stressed by the fact that Lin-

naeus (1758: 198-199) also mentioned this word as 7és-

tudine and Testudinibus. Others have credited the famil-

ial nomen JESTUDINIDAE to Gray (1825), until Bour &

Dubois (1985) drew the attention to the fact that the nomen

TESTUDINES, coined by Batsch (1788: 437) for a family in-

cluding the single genus Zestudo Linnaeus, 1758, was

doubtless available in the family-series, where it has pri-

ority over all subsequent nomina coined on the basis of

the stem of this generic nomen (including 7EsTuUDIA

Rafinesque-Schmaltz, 1814c, a nomen ignored by most

authors until now). Following the Code, this nomen must

simply be emended to TESTUDINIDAE Batsch, 1788 if used

for a taxon of rank family, to TESTUDINOIDEA Batsch, 1788

for a taxon of rank superfamily, 7ESTUDININAE Batsch, 1788

for a subfamily, TESTUDININI Batsch, 1788 for a tribe and

TESTUDININA Batsch, 1788 for a subtribe.

Still more confusion has been exhibited by the authors re-

garding the nomen of the order of turtles. The nomen TEs-

TUDINES was used for this purpose, credited either to Lin-

naeus (1758) or to Batsch (1788), which is incorrect in

both cases for the reasons given above (the former being

a generic nomen in the plural, the latter a family-series

nomen). The first valid creation of a nomen TESTUDINES

for an order was by Wagler (1830: 130, 133), but this is

subsequent to the other nomina discussed below. As a mat-

ter of fact, three other nomina were also widely used for

the order, CHELONI, CHELONIA and TESTUDINATA.

OZFMK

Family- and class-series nomina in zoology 153

Both CHELON and CHELONIA are just subsequent la-

tinizations of CHELONIENS Brongniart, 1800a. The

spelling CHELONIA was first used by Ross & Macartney

(and not Macartney alone, as wrongly stated by Loveridge

1957 or Romer 1966) in their 1802 translation of the work

of Cuvier (1800). This latinization was posterior to that

in CHELONI by Latreille (1800), used by many subsequent

authors in the 19 century (Bour & Dubois 1985: 79) and

resurrected by Bour (1981). Although the Code provides

no guidelines for the authorship and date of class-series

nomina, for reasons discussed in detail by Dubois (2006a,

2009), by simple consistency and parallelism with the

Rules of the Code concerning family-series and genus-se-

ries nomina, it is justified to credit a class-series nomen

published first in a non-latinized form to the author of this

original nomen, so in this case to Brongniart (1800a). The

spelling CHELONII being anterior to CHELONIA, and the

latter being open to confusion because of hemihomonymy

(Starobogatov 1991) with the generic nomen Chelonia

Brongniart, 1800b, the use of CHELONII was supported by

Bour (1981) and Bour & Dubois (1985), who noted that

this nomen had priority over TESTUDINATA, an ordinal

nomen coined by Oppel (1811b). In conclusion, Bour &

Dubois (1985) proposed to use the nomen CHELONII

Brongniart, 1800a for the order of turtles, a suggestion

adopted by various subsequent authors (see Table 1).

As the Code provides no Rules or even guidelines for

class-series nomenclature, this suggestion was based on

the use of the Principle of Onomatophores* (so-called

“Principle of Typification”) in a way similar to its use in

the three lower nominal-series recognized by the Code, a

method explicitly presented by Dubois (1984). However,

as was later shown by Dubois (2004, 2005a—b, 2006a—b,

2009; Dubois & Ohler 2009), because no Principle of Co-

ordination is in force in class-series nomenclature, such

a practice does not allow unambiguous allocation of a

class-series nomen to a taxon as soon as several hierar-

chically subordinated taxa have the same onomatophore,

so that more complete Rules had to be devised (Dubois

2006a). For the precise allocation of nomina to higher taxa,

this system uses both the originally included genera or

conucleogenera of the newly established taxon, and the

genera originally expressly excluded from it, its alieno-

genera. Until these proposed Rules, or others, are incor-

porated into the Code in order to regulate class-series

nomenclature, the latter will remain chaotic and left to

“freedom” and “opinions” of individual zoologists, which

will be a permanent nuisance for proper and unambigu-

ous communication among all biologists.

This problem is made worse by the ambiguity, discussed

above, regarding the distinction between class-series and

family-series nomina in the Code. Although Batsch (1788)

had clearly referred his new taxon TESTUDINES to the rank

Bonn zoological Bulletin 57 (2): 149-171

family, there is nothing in the Code that imposes to refer

this nomen to the family-series, all the more that Batsch

(1788, 1789) was not consistent in his use of etymology

for his familial nomina, some only being based on the

stems of generic nomina he considered valid (see below).

Because of this ambiguity of the Code, it would be pos-

sible to refer the nomen 7ESTUDINES Batsch, 1788 either

to the family-series (which clearly has our preference) or

to the class-series. But it is fully unacceptable and impos-

sible to refer it to both! This would be similar to accept-

ing that a genus-series nomen, such as Ranoidea Tschu-

di, 1838 for example, can be considered available both as

the nomen of a genus and of a superfamily! This is how-

ever what has been done by Fritz & Havas (2006, 2007),

followed by Vetter & van Dijk (2006) and Rhodin et al.

(2008, 2009), who recognized, in the same classification,

an order TESTUDINES Batsch, 1788 and a family 7ésTU-

DINIDAE Batsch, 1788, although both nomina are based on

the one and single appearance of the nomen TESTUDINES

in page 437 of Batsch (1788)! The fact that such incred-

ible nomenclatural treatments can be accepted as valid by

several contemporaneous taxonomists and periodicals

points to the poor interest granted by many colleagues

nowadays to nomenclatural Rules and to the chaotic sit-

uation created in zoological nomenclature by the incom-

pleteness and ambiguity of the Code.

This exemplary case prompted us to undertake a detailed

and complete survey of all suprageneric nomina created

by Batsch (1788, 1789), which fully exemplifies these

problems and allows to propose solutions to them.

BATSCH’S (1788, 1789) SUPRAGENERIC NOMINA

IN ZOOLOGY

Batsch (1788, 1789) was one of the authors who, in the

late 18' century, proposed a comprehensive classification

of the animal kingdom and tried to improve the scheme

of Linnaeus (1758, 1766, 1767) in this respect. In this clas-

sification, he used four ranks above the rank genus: fam-

ily, order, class and an upper unnamed rank that we treat

here for more simplicity as “superclass”. This classifica-

tion is summarized here in our Table 2 (in Appendix 1).

Batsch (1788) was the first author to divide the animal

kingdom in two main groups, his “superclasses” OSSEA

and CRUSTACEA, which exactly correspond to the distinc-

tion between “animaux a vertébres” and “animaux sans

vertébres” first proposed by Lamarck in his lectures

(which were not published until 1801), and which

Cuvier (1800) was the first author to formally name in a

publication as VERTEBRES (VERTEBRATA) and IN-

VERTEBRES (INVERTEBRATA). Although Batsch’s (1788)

©ZFMK

154 Alain Dubois & Roger Bour

OssEaA has priority over VERTEBRATA, it would be inap-

propriate to replace the latter, which has been used mil-

lions of times in the scientific literature and therefore qual-

ifies as a sozonym*, by the former, which has been ignored

and which is therefore a distagmonym* (Dubois 200S5a:

86, 2005b: 412).

In his OsskA, Batsch (1788) recognized four classes,

MAMMALIA, AVES, AMPHIBIA and PISCES, whereas in his

CRUSTACEA he recognized two classes, INSECTA and VER-

MES. Although the nomina of these six classes are iden-

tical to those of the six zoological classes of Linnaeus

(1758, 1766, 1767), their content is not always exactly the

same. For example, Batsch (1789) removed from his VER-

MES the genus Myxine Linnaeus, 1758 placed in this clas-

sis by Linnaeus, and which is in fact a chordate. There-

fore, the nomina used by Batsch for these classes should

be credited to him, not to Linnaeus. They are junior

homonyms of Linnaeus’ identical nomina (see Dubois

2006a).

All genera in Batsch (1788, 1789) are referred to fami-

lies. Families are referred to orders and then to the class

only in one class (MAMMALIA). The nomina of the orders

of mammals also are in part borrowed from Linnaeus, but

here also sometimes with a slightly different content,

which requires to consider them as distinct, junior

homonymous nomina. In the other five classes, the only

rank used above genus is that of family. Because the rank

family is expressly used by Batsch, is situated in the

nomenclatural hierarchy above the rank genus and below

the ranks class and order (when available), and because

some at least of these nomina are coined by addition of

an ending indicating plural to the stem of an available

generic nomen considered valid by Batsch (1788, 1789),

we hereby consider the nomina of Batsch’s “families” to

be indeed family-series nomina, some of which only are

nomenclaturally available.

The available family-series nomina in Batsch (1788,

1789), that appear in Table 2, are the 17 familial nomina

in his work based on available generic nomina listed by

him as valid among the genera of the family. This is for

example the case of TESTUDINES Batsch, 1788, a taxon ex-

pressly mentioned as including the genus Jestudo Lin-

naeus, 1758.

As shown in Table 2, there are two categories of unavail-

able family-series nomina in Batsch (1788, 1789). The first

one consists of arhizonyms, 1.e., family-series that were

not based on any then available zoological generic nomen.

The second one consists of nomina that were indeed based

on then available zoological generic nomina, but these

nomina not being listed by Batsch (1788, 1789) as valid

Bonn zoological Bulletin 57 (2): 149-171

among the members of the family, being presumably con-

sidered invalid synonyms of nomina used by Batsch as

valid. As we here adopted the formulation (F1) above of

Article 11.7.1.1 of the Code, these nomina must be con-

sidered as nomenclaturally unavailable, but if interpreta-

tion (F2) had to be followed these nomina would have to

be treated as available. This small doubt is one of the con-

sequences of the ambiguous writing of Article 11.7.1.1 in

the current version of the Code.

The Code is silent about the nomenclatural status of fa-

milial nomina such as those created by Batsch (1788,

1789) but shown above to be unavailable in the family-

series. In contrast, under the Rules proposed by Dubois

(2006a) for class-series nomenclature, these nomina be-

long unambiguously in the family-series and are therefore

clearly unavailable in the class-series as well, because of

the Rule of Taxonomic Consistency presented above.

Except three, all the generic nomina listed by Batsch

(1788, 1789) in his classification of the animal kingdom

had previously been made available in zoological nomen-

clature by Linnaeus (1758) and in subsequent publications

between 1758 and 1790. The only three exceptions are the

nomina Cylindrus Batsch, 1789, Hydrocantharus Batsch,

1789 and Turris Batsch, 1789. The status of these three

nomina is discussed below in Appendix 2.

Table 3 (in Appendix 1) lists the 17 familial nomina made

nomenclaturally available in zoological nomenclature by

Batsch (1788, 1789). Until now, only one (TESTUDINIDAE)

has been credited to Batsch (1788), and the other 16 are

traditionally credited to other authors at subsequent dates,

but should now be credited to Batsch. This poses no prob-

lem of “nomenclatural stability”, as none of these 16 fa-

milial nomina has to change, the change concerning on-

ly their author and date.

The familial nomen LAceRTIDAE, that had previously

(Dubois 2004; Dubois & Bour 2010) been credited to

Batsch (1788), does not appear in Table 3. This is because

this nomen could be considered available only under in-

terpretation (F2) of Article 11.7.1.1. The genus Lacerta

Linnaeus, 1758 was recognized by most authors of the end

of the 18 century, but not by Laurenti (1768) who had

split it into several genera and had not retained the nomen

Lacerta for any of them (in contrast for what he had done

in other cases, e.g. for Rana). He was apparently followed

in this by Batsch (1788), who did not recognize or even

mention the genus Lacerta. As we here adopted interpre-

tation (F1) of Article 11.7.1.1, the family nomen L4cER-

TIDAE cannot be credited to Batsch (1788). It must there-

fore be credited to the first subsequent author who used

a family nomen based on the generic nomen Lacerta for

©ZFMK

Family- and class-series nomina in zoology 155

a family where the latter generic nomen was considered

valid. This happens to be Oppel (1811b: 16).

Establishing the proper nomen for the order of turtles (or

“turtles, tortoises and terrapins’’), i.e., including all recent

turtles as well as a few additional Triassic groups, is be-

yond the scope of the present paper, and we just provide

here a few comments in this respect. As discussed above,

the nomen 7ESTUDINES Batsch, 1788, being available in the

family-series, is not available in the class-series and can-

not be used for an order. Under the nomenclatural Rules

proposed by Dubois (2006a), the nomina CHELONII

Brongniart, 1800a and TESTUDINATA Oppel, 1811b are

available in the class-series. However, they do not apply

to the order of turtles, but to still higher taxa.

Under these Rules, the nomen CHELONI Brongniart,

1800a applies to the most inclusive class-series taxon con-

taining the genera Che/onia Brongniart, 1800b and Tes-

tudo Linnaeus, 1758, and excluding the 19 nominal gen-

era referred by Brongniart (1800b) to his orders BATRA-

CHIA, OPHIDIA and SAURIA.

As for the nomen TESTUDINATA Oppel, 1811b, it applies

to the most inclusive class-series taxon containing the gen-

era Chelonia Brongniart, 1800b, Chelys Oppel, 1811b,

Emys Dumeril, 1806, TJestudo Linnaeus, 1758 and Trionyx

Geoffroy Saint-Hilaire, 1809, and excluding the 48 nom-

inal genera referred by Oppel (1811b) to his orders SQua-

MATA and NUDA.

Oppel (1811b) credited the nomina of his orders TESTU-

DINATA and NupDaA to Klein (1751), a work which, being

anterior to 1758, is not nomenclaturally available. How-

ever, Joyce et al. (2004: 998) recently drew the attention

to Behn’s (1760) translation and adaptation of Klein’s

(1751) book, which includes all the taxa and nomina of

the latter work. These post-1758 nomina would be avail-

able, with the authorship “Klein in Behn, 1760”, if this

book was nomenclaturally available, but, for reasons ex-

plained in detail in our Appendix 2 below, we consider that

it should not be considered so.

Several other class-series nomina applying to turtles and

related groups have been published after the works just

mentioned. Establishing the class-series taxa to which

these nomina apply under Dubois’s (2006a) proposed

Rules requires a long and detailed survey that would take

us far beyond the purpose of the present paper and will

be presented elsewhere. For the time being, this work is

not urgent, as the phylogenetic relationships among these

groups, and with the other tetrapods, are currently high-

ly controversial (e.g., Werneburg & Sanchez-Villagra

2009, and included references), and it will be possible to

Bonn zoological Bulletin 57 (2): 149-171

settle a robust nomenclature of these groups only when

some consensus emerges on these questions.

CONCLUSION

The analysis presented above and the examples studied

show that the current Rules of the Code are ambiguous

regarding the allocation of nomina of higher zoological

taxa to either the family-series or the class-series of nom-

ina, and regarding the conditions of availability of fami-

ly-series nomina. These Rules should be improved

through modifications of Article 11.7.1.1 as suggested

above, and mostly through incorporation of Rules for

class-series nomina, as proposed in detail by Dubois

(2006a).

A detailed study of all suprageneric nomina in the work

of Batsch (1788, 1789) shows that this author proposed

many family-series nomina, which belong in three cate-

gories: (C1) nomina clearly based on the stems of avail-

able generic nomina that were considered valid in this

work: such nomina are available in the family-series; (C2)

nomina apparently based on the stems of generic nomina

nomenclaturally available at that time, but not treated as

valid in this work: such nomina are unavailable both in

the family-series and in the class-series; (C3) arhizonyms,

i.e., nomina not based on the stems of any generic nomen

nomenclaturally available at that time: such nomina are

also unavailable both in the family-series and in the class-

series. Nomina of the categories (C2) and (C3) are defi-

nitely unavailable and will never have to be used as valid

in zoological nomenclature. But the nomina of category

(C1) compete for priority with all other family-series sub-

sequently proposed in zoological nomenclature. It so hap-

pens that these 17 nomina are identical with family-series

nomina coined later on and based on the same nucleogen-

era. Therefore they must replace them, which entails no

change in the nomina themselves (and therefore no dis-

ruption of nomenclatural stability) but only modifications

regarding their authors and dates. These changes, listed

in Table 3, should be implemented without delay in the

respective zoological groups where they belong.

This analysis contributes to a clarification of the higher

nomenclature of turtles. The nomen 7ESTUDINES Batsch,

1788 is not a class-series, but a family-series nomen. It

cannot be used for the order of turtles, but is the valid

nomen, under the spelling 7esTUDINIDAE, of the family in-

cluding the genus 7estudo Linnaeus, 1758 and of all oth-

er coordinate taxa as recognized in any given classifica-

tion. As for the order of turtles, establishing the valid

nomen of this taxon and of its superordinate taxa under

the Rules proposed by Dubois (2006a) is beyond the scope

©OZFMK

156 Alain Dubois & Roger Bour

of the present paper, but it is shown here that neither TES-

TUDINES Linnaeus, 1758, nor TESTUDINATA Klein in Behn,

1760, nor TESTUDINES Batsch, 1788, nor CHELONII

Brongniart, 1800a, nor TESTUDINATA Oppel, 1811b apply

to this taxon. As long as the Code does not provide for-

mal Rules for the nomenclature of class-series taxa, the

higher nomenclature of turtles (as well as that of all oth-

er zoological groups) will remain a matter of personal or

collective tastes, opinions and arbitrary decisions of

zootaxonomists. At any rate, whatever Rules or guidelines

are followed, it is impossible and unacceptable under any

nomenclatural philosophy to accept that the nomen 7Es-

TUDINES Batsch, 1788 could be available both for the or-

der of turtles and for the family including the genus Tes-

tudo Linnaeus, 1758.

Acknowledgements. We are grateful to Annemarie Ohler (Paris)

for comments on this work while in progress, and to Franco An-

deone (Torino), Myrianne Brival (Paris), Andrea Kourgli

(Wien) and Victoire Koyamba (Paris) for bibliographic research.

REFERENCES

Anonymous [International Commission on Zoological Nomen-

clature] (1954) Opinion 259. Rejection of the names used by

Mark Catesby in the Natural History of Carolina, as republi-

shed by Edwards in the edition of 1771, but acceptance of na-

mes formed in accordance with the Linnean system inserted

by Edwards in that editon. Opinions and Declarations rende-

red by the International Commission on Zoological Nomen-

clature 5 (20): 253-264

Anonymous [International Commission on Zoological Nomen-

clature] (1964) Opinion 701. Pisidia Leach, 1820, designa-

tion of a type-species under the plenary powers; and Cancer

istrianus Scopoh, 1763, suppressed under the plenary pow-

ers (Crustacea, Decapoda). Bulletin of Zoological Nomencla-

ture 21: 108-110

Anonymous [International Commission on Zoological Nomen-

clature] (1985) International code of zoological nomenclature.

Third edition. International Trust for Zoological Nomencla-

ture, London

Anonymous [International Commission on Zoological Nomen-

clature] (1999) International code of zoological nomenclature.

Fourth edition. International Trust for Zoological Nomencla-

ture, London

Anonymous (2010) The Richmond Index. Washington, D.C, Di-

vision of Birds at the National Museum of Natural History.

Online at http://www.zoonomen.net/cit/RI/Genera/RIGenGt.

html (Version 1.06 (2010.07.03).) last accessed 02-09-2010

Abbazzi L, Carboni S, Delfino M, Gallai G, Lecca L, Rook, L

(2008) Fossil vertebrates (Mammalia and Reptilia) from Capo

Mannu formation (late Pliocene, Sardinia, Italy), with descrip-

tion of a new Testudo (Chelonii, Testudinidae) species. Riv-

ista italiana di paleontologia e stratigrafia 114: 119-132, pl. 1

Agassiz L (1857) Contributions to the natural history of the Uni-

ted States of America. First monograph, volume 1. Little,

Brown & Co., Boston, & Triibner & Co., London

Alderton D (1988) Turtles & tortoises of the world. Facts on file

publications, New York

Bonn zoological Bulletin 57 (2): 149-171

Auffenberg W (1974) Checklist of fossil land tortoises (Testu-

dinidae). Bulletin of the Florida State Museum 18 (3):

121-251

Barboza du Bocage JV (1895) Herpétologie d’Angola et du

Congo. Imprimerie Nationale, Lisbonne

Batsch AJGC (1788) Versuch einer Anleitung, zur KenntniB und

Geschichte der Thiere und Mineralien, fiir akademische Vor-

lesungen entworfen, und mit den néthigsten Abbildungen ver-

sehen. Erster Theil. Allgemeine Geschichte der Natur; beson-

dre der Saugthiere, V6gel, Amphibien und Fische. Akademi-

sche Buchhandlung, Jena

Batsch AJGC (1789) Versuch einer Anleitung, zur Kenntni8 und

Geschichte der Thiere und Mineralien, ftir akademische Vor-

lesungen entworfen, und mit den néthigsten Abbildungen ver-

sehen. Zweyter Theil. Besondre Geschichte der Insekten, Ge-

wurme und Mineralien. Akademische Buchhandlung, Jena

Baur G (1887) Osteologische Notizen tiber Reptilien. Fortzung

II. Zoologischer Anzeiger 10: 97-102

Baur G (1892) Notes on some little known American fossil tur-

tles. Proceedings of the Academy of natural sciences of Phi-

ladelphia [1891] 43: 411-430

Behn FD (1760) Jakob Theodor Kleins (...) Classification und

kurze Geschichte der Vierftigigen Thiere (...). Jonas Schmidt,

Liibeck

Bergounioux FM (1955) Testudinata. In: Piveteau J, Traité de

Paléontologie, Tome V, Amphibiens Reptiles Oiseaux, Mas-

son et Cie, Paris: 487-544

Blumenbach JF (1779) Handbuch der Naturgeschichte. Johann

Christian Dieterich, Géttingen

Boettger O (1893) Katalog der Reptilien-Sammlung 1m Museum

der Senckenbergischen naturforschenden Gesellschaft in

Frankfurt am Main. I. Theil (Rhynchocephalen, Schildkréten,

Krokodile, Eidechsen, Chamialeons). Gebriider Knauer, Frank-

furt am Main

Bonaparte CL (1831) Saggio di una distribuzione metodica de-

gli animali vertebrati. Giornale Arcadico di Scienze, Lettere

ed Arti 52: 1-78 + 129-209

Bonaparte, CLJL (1845) Specchio generale dei sistem erpeto-

logico, anfibiologico ed ittiologico. Luigi di Giacomo Pirola,

Milano

Bonaparte, CL (1850) Conspectus systematum herpetologiae et

amphibiologiae. Editio altera reformata. E. J. Brill, Lugduni

Batavorum

Boulenger GA (1889) Catalogue of the chelonians, rhynchoce-

phalians, and crocodiles in the British Museum (Natural His-

tory). Trustees of the British Museum, London

Boulenger GA (1923) Etude sur les batraciens et les reptiles rap-

portés par M. Henri Gadeau de Kerville de son voyage zoo-

logique en Syrie (avril-juin 1908). J. B. Baillére et fils, Paris

Bour R (1981) Etude systématique du genre endémique malga-

che Pyxis Bell, 1827 (Reptilia, Chelonii). Bulletin mensuel de

la Société linnéenne de Lyon 4: 132—144

Bour R, Dubois A (1985) Nomenclature ordinale et familiale des

Tortues (Reptilia). Studia geologica salmanticensia, vol. es-

pecial 1, Studia palaeocheloniologica, I, Salamanca, Edicio-

nes Universidad: 77-86

Boycott R, Bourquin O (2000) The southern African tortoise

book. O. Bourquin, Hilton

Brisson MJ (1760) Ornithologia sive synopsis methodica sistens

avium divisionem in ordines, sectiones, genera, species, ip-

sarumque varietates. Ornithologie ou méthode contenant la di-

vision des oiseaux en ordres, sections, genres, espéces & leurs

varictés. Tome 1. Cl. Joannem-Baptistam Bauche, Paris

©ZFMK

Family- and class-series nomina in zoology 157

Brisson MJ (1762) Regnum animale in classes IX distributum,

sive synopsis methodica sistens generalem animalium distri-

butionem in classes IX, & duarum primarum classium, qua-

drupedum scilicet & cetaceorum, particularem divisionem in

ordines, sectiones, genera & species. Cum brevi cujusque spe-

ciei descriptione, citationibus auctorum de ts tractantium, no-

minibus eis ab ipsis & nationibus impositis, nominibusque vul-

garibus. Editio altera auctior. Theodorum Haak, Lugduni Ba-

tavorum

Brongniart A (1800a) Essai d’une classification naturelle des rep-

tiles. I°"© partie. Etablissement des ordres. Bulletin des Scien-

ces, par la Société philomathique de Paris 2 (35): 81-82

Brongniart A (1800b) Essai d’une classification naturelle des rep-

tiles. II® partie. Formation et disposition des genres. Bulletin

des Sciences, par la Société philomathique de Paris, 2 (36):

89-91, pl. 6

Bruguiére JG (1789) Histoire naturelle des Vers. Encyclopédie

méthodique. Tome sixiéme. [Vol. 1]. Panckouke, Paris &

Plomteux, Liege

Brinnichius MT (1771) Zoologiz fundamenta przlectionibus

academicis accomodata. Frider. Christ. Pelt, Hafniz et Lip-

sle

Bucquoy E, Dautzenberg P, Dollfus GF (1883) Les Mollusques

marins du Roussillon. Tome 1°. Gastropodes. Fascicule 3. J.-

B. Bailli¢re & Fils, Paris

Catesby M (1771a) The natural history of Carolina, Florida, and

the Bahama Islands: containing the figures of birds, beasts,

fishes, serpents, insects, and plants; particularly, those not hi-

therto described, or incorrectly figured by former authors, with

their descriptions in English and French (...). By the late Mark

Catesby; F.R.S. Revised by Mr. Edwards of the Royal Col-

lege of Surgeons, London. To the whole is now added a Lin-

neean Index of the Animals and Plants. Volume the first. His-

toire naturelle de la Caroline, de la Floride, et des Isles de Ba-

hama: contenant les desseins [sic] des oiseaux, des quadru-

pedes, des poissons, des serpens, des insectes, & des plantes,

qui se trouvent dans ces pays-la; et en particulier, de ceux qui

n ont point été decrits jusqu’a present par les auteurs, ou peu

exactement dessinés. Avec leurs descriptions et Francois et en

Anglois (...) Par Feu Monsieur Mark Catesby, de la Société

Royale, reveue [sic] par Monsieur Edwards, du College Royal

des Medicins [sic] de Londres. Tome I. Benjamm White, London

Catesby M (1771b) The natural history of Carolina, Florida, and

the Bahama Islands: containing the figures of birds, beasts,

fishes, serpents, insects, and plants; particularly, those not hi-

therto described, or incorrectly figured by former authors, with

their descriptions in English and French (...). By the late Mark

Catesby; F.R.S. Revised by Mr. Edwards of the Royal Col-

lege of Surgeons, London. To the whole is now added a Lin-

neean Index of the Animals and Plants. Volume the second.

Histoire naturelle de la Caroline, de la Floride, et des Isles de

Bahama: contenant les desseins [sic] des oiseaux, des quadru-

pedes, des poissons, des serpens, des insectes, & des plantes,

qui se trouvent dans ces pays-la; et en particulier, de ceux qui

n’ont point été decrits jusqu’a present par les auteurs, ou peu

exactement dessinés. Avec leurs descriptions et Francois et en

Anglois (...) Par Feu Monsieur Mark Catesby, de la Société

Royale, reveue [sic] par Monsieur Edwards, du College Royal

des Medicins [sic] de Londres. Tome I. Benjamin White, Lon-

don

Ckhikvazde VM (1970) [On the origin of the modern Palaearctic

land tortoises]. Bulletin of the Academy of Sciences of the

Georgian SSR 75 (1): 245-247. [In Russian]

Cope ED (1875) Check-list of North American Batrachia and

Reptilia; with a systematic list of the higher groups, and an

Bonn zoological Bulletin 57 (2): 149-171

essay on geographical distribution. Based on the specimens

contained in the U. S. National Museum. Bulletin of the Unit-

ed States National Museum 1: i-1 + 1-104

Cuvier G (1800) Lecgons d’anatomie comparée. Tome |. Bau-

douin, Paris

Cuvier G (1802) Lectures on comparative anatomy. Translated

from the French of G. Cuvier (...) by William Ross, under the

inspection of James Macartney (...). Vol. 1. On the organs of

motion. Longman & Rees, London

David P (1994) Liste des Reptiles actuels du monde. I. Chelo-

nil. Dumerilia 1: 7-127

De Blainville H (1816) Prodrome d’une nouvelle distribution

systematique du régne animal. Bulletin des Sciences de la So-

ciété philomatique de Paris, juillet 1816: “105-112” [in fact

113-120] + 121-124

De Blainville H (1847) Sur les principes de la zooclassie ou de

la classification des animaux. Roret, Paris

De Broin F (1982) Chelonii. In: Fabre J, de Broin F, Onsburo

L, Wenz S, Les Vertébrés du Berriasien de Canjuers (Var,

France) et leur environnement, Geobios 15 (6): 897-898

De Geer C (1778) Mémoires pour servir a l’histoire des insec-

tes. Tome septieme. Pierre Hesselberg, Stockholm

De Lapparent de Broin F (2000) The European turtle fauna from

the Triassic to the Present: a short review. Dumerilia 4 (3):

155-216

De Rooy N (1915) The reptiles of the Indo-Australian Archipe-

lago. I. Lacertilia, Chelonia, Emydosauria. E. J. Brill, Leiden

Denys de Montfort P (1810) Conchyliologie systématique, et

Classification méthodique des coquilles (...). Coquilles uni-

valves, non cloisonnées. Tome second. F. Scheell, Paris

Deshayes GP (1824) Cylindre. In: Dictionnaire classique d’ His-

toire naturelle, Tome cinqui¢éme, CRA-D, Rey & Gravier, Bau-

douin Freres, Paris: 236

Draparnaud JPR (1805) Histoire naturelle des Mollusques ter-

restres et fluviatiles de la France, ouvrage posthume. Louis

Colas, Paris

Dubois A (1984) La nomenclature supragénérique des Amphi-

biens Anoures. Mémoires du Muséum national d’ Histoire na-

turelle (A) 131: 1-64

Dubois A (2000) Synonymies and related lists in zoology: ge-

neral proposals, with examples in herpetology. Dumerilia 4

(2): 33-98

Dubois A (2004) The higher nomenclature of recent amphibians.

Alytes 22 (1-2): 1-14

Dubois A (2005a) Propositions pour Il’ incorporation des nomina

de taxons de rang supérieur dans le Code international de no-

menclature zoologique. In: Dubois A, Poncy O, Malécot V,

Léger N (eds.), Comment nommer les taxons de rang supé-

rieur en zoologie et en botanique?, Biosystema 23: 73-96

Dubois A (2005b) Proposed Rules for the incorporation of no-

mina of higher-ranked zoological taxa in the /nternational

Code of Zoological Nomenclature. 1. Some general questions,

concepts and terms of biological nomenclature. Zoosystema

27 (2): 365-426

Dubois A (2005c) Proposals for the incorporation of nomina of

higher-ranked taxa into the Code. Bulletin of zoological No-

menclature 62 (4): 200-209

Dubois A (2006a) Proposed Rules for the incorporation of no-

mina of higher-ranked zoological taxa in the International

Code of Zoological Nomenclature. 2. The proposed Rules and

their rationale. Zoosystema 28 (1): 165-258

Dubois A (2006b) Incorporation of nomina of higher-ranked taxa

into the /nternational Code of Zoological Nomenclature: some

basic questions. Zootaxa 1337: 1-37

OZFMK

158 Alain Dubois & Roger Bour

Dubois A (2006c) Naming taxa from cladograms: a cautionary

tale. Molecular Phylogenetics & Evolution 42: 317-330

Dubois A (2007) Nomina zoologica linnaeana. In: Zhang Z-Q,

Shear WA (eds.), Linnaeus tercentenary: progress in inverte-

brate taxonomy, Zootaxa 1668: 81-106

Dubois A (2008a) Authors of zoological publications and nom-

ina are signatures, not persons. Zootaxa 1771: 63-68.

Dubois A (2008b) Phylogenetic hypotheses, taxa and nomina in

zoology. In: Minelli A, Bonato L, Fusco G (eds.), Updating

the Linnaean heritage: names as tools for thinking about ani-

mals and plants, Zootaxa 1950: 51-86

Dubois A (2009) Incorporation of nomina of higher-ranked taxa

into the /nternational Code of Zoological Nomenclature: the

nomenclatural status of class-series zoological nomina publi-

shed in a non-latinized form. Zootaxa 2106: 1-12

Dubois A (2010) Retroactive changes should be introduced in

the Code only with great care: problems related to the spellings

of nomina. Zootaxa 2426: 1-42

Dubois A, Bour R (2010) The nomenclatural status of the no-

mina of amphibians and reptiles created by Garsault (1764),

with a parsimonious solution to an old nomenclatural problem

regarding the genus Bufo (Amphibia, Anura), comments on

the taxonomy of this genus, and comments on some nomina

created by Laurenti (1768). Zootaxa 2447: 1-52

Dubois A, Ohler A (2009) The status of the amphibian nomina

created by Merrem (1820) and Ritgen (1828). Zootaxa 2247:

1-36

Duméril AMC (1806) Zoologie analytique, ou méthode naturelle

de classification des animaux, rendue plus facile a |’aide de

tableaux synoptiques. Allais, Paris

Duméril AMC, Bibron G (1834) Erpétologie générale ou his-

toire naturelle complete des Reptiles. Tome 1. Roret, Paris

Dumeéril AMC, Bibron G (1835) Erpétologie générale ou his-

toire naturelle complete des Reptiles. Tome 2. Roret, Paris

Dumeéril AMC, Bibron G (1841) Erpétologie générale ou his-

toire naturelle complete des Reptiles. Tome 8. Roret, Paris

Dundee HA (1989) Higher category name usage for amphibians

and reptiles. Systematic Zoology 38 (4): 398-406

Ernst CH, Barbour RW (1989) Turtles of the world. Smithso-

nian institution press, Washington

Fabricius JC (1775) Systema Entomologiz, sistens Insectorum

classes, ordines, genera, species. Libraria Kortii, Flensburgi

et Lipsize

Fischer G (1817) Adversaria zoologica. Fasciculus primus. Quae-

dam ad Mammalium systema et genera illustranda. Mémot-

res de la Société impériale des naturalistes de Moscou 5:

357-446

Fitzinger LJ (1826) Neue Classification der Reptilien. Heubner,

Wien

Fitzinger LJ (1833) Systematisches Verzeichnif der im Erzher-

zogthume Oesterreich vorkommenden Weichthiere, als Pro-

drom einer Fauna derselben. In: Beitrage zur Landeskunde

Oesterreich’s unter der Enns, Wien, in Commission der J.

Beck’schen Universitats-Buchhandlung 3: 88—122

Fitzinger L (1835) Entwurf einer systematischen Anordnung der

Schildkréten nach den Grundsatzen der natiirlichen Methode.

Annalen des Wiener Museums der Naturgeschichte 1:

105-128

Fitzinger LJ (1843) Systema Reptilium. Fasc. 1. Amblyglossae.

Braumiiller & Seidel, Vindobonae

Fitzinger LJ (1867) Bilder-Atlas zur wissenschaftlich-popularen

Naturgeschichte der Wirbelthiere. II. Amphibien. K.K. Hof-

und Staatsdruckerei, Wien

Frank C (2006) Plio-pleistozane und holozane Mollusken Oster-

reichs. Mitteilungen der Prahistorischen Kommission der

Bonn zoological Bulletin 57 (2): 149-171

Osterreichischen Akademie der Wissenschaften Plio-pleisto-

zane und Holozine Mollusken Osterreichs, Wien, Verlag der

Osterreichischen Akademie der Wissenschaften 62: i-xv + 1—

860

Freiberg MA (1938) Catalogo sistematico y descriptivo de las

tortugas argentinas. Memorias del Museo de Entre Rios 9,

Zoologia: 3—23, pl. 1-8

Fritz U, Havas P (2006) Checklist of chelonians of the world.

Dresden, Museum of Zoology

Fritz U, Havas P (2007) Checklist of chelonians of the world.

Vertebrate Zoology 57 (2): 149-368

Fuhn IE, Vancea $ (1961) Fauna Republicii Populare Romine.

Reptilia (Testoase, Sopirle, Serpi). Volumul 19 fascicula 2.

Editura Academiei Republicii Populare Romine, Bucuresti

Gaffney ES (1975) A phylogeny and classification of the higher

categories of turtles. Bulletin of the American Museum of na-

tural History 155 (5): 387-436

Garsault FAP de (1764) Les Figures des plantes et animaux

d’usage en médecine, décrits dans la Matiere Médicale de Mr.

Geoffroy Médecin. Paris

Geoffroy EL (1762) Histoire abrégée des Insectes qui se trou-

vent aux environs de Paris. Tome |. Durand, Paris

Geoffroy Saint-Hilaire E (1809) Mémoire sur les tortues mol-

les. Nouveau Bulletin des Sciences, par la Société philoma-

tique | (22): 363-367

Goeze, JAE (1782) Versuch einer Naturgeschichte der Eingewei-

dewiirmer thierischer K6rper. Philipp Adam Pape, Blanken-

burg

Goeze JAE, Donndorff JA (1797) Europaische Fauna oder Na-

turgeschichte des europdischen Thiere. Weidmann, Leipzig

Goin CJ, Goin OB (1962) Introduction to herpetology. W. H.

Freeman, San Francisco

Goldfuss GA (1820) Handbuch der Zoologie. II. Johann Leon-

hard Schrag, Niirnberg

Gray, JE (1821) On the natural arrangement of vertebrose ani-

mals. London Medical Repository 15: 296-310

Gray JE (1825) A synopsis of the genera of Reptiles and Am-

phibia, with a description of some new species. Annals of Phi-

losophy (2) 10: 193-217

Gray JE (1831a) A synopsis of the species of the class Reptilia.

In: Griffith E et al. The animal kingdom arranged in confor-

mity with its organization, by the Baron Cuvier, member of

the Institute of France, &c. &c. &c., with additional descrip-

tions of all the species hitherto named, and of many not be-

fore noticed, Vol. 9, Whittaker, Treacher & Co., London:

1-110

Gray JE (1831b) Synopsis Reptilium or short descriptions of the

species of Reptiles. Part I. Cataphracta. Tortoises, crocodiles

and enaliosaurians. Treuttel, Wirtz & Co., Sowerby & Wood,

London

Gray JE (1844) Catalogue of the tortoises, crocodiles, and am-

phisbzenians, in the collection of the British Museum. Trus-

tees of the British Museum, London

Gray JE (1855) Catalogue of shield reptiles in the collection of

the British Museum. Part I. Testudinata (tortoises). Trustees

of the British Museum, London

Gray JE (1873) Handlist of the specimens of shield reptiles in

the British Museum. Trustees of the British Museum, London

Griffith E, Pidgeon E (1831) The class Reptilia arranged by the

Baron Cuvier, with specific descriptions. In: Griffith E et al.

The animal kingdom arranged in conformity with its organi-

zation, by the Baron Cuvier, member of the Institute of France,

&c. &c. &c., with additional descriptions of all the species

hitherto named, and of many not before noticed, Vol. 9, Whit-

taker, Treacher & Co., London: 1-481

OZFMK

Family- and class-series nomina in zoology 159

Gueldenstaedt AJ (1770) Spalax, novum Glirium Genus. Novi

Commentari Academiz Scientiarum Imperialis Petropoli-

tane,Tome 14, Pars prior: 409-440, pl. 8—9

Gunther ACLG (1859) On sexual differences found in bones of

some recent and fossil species of frogs and fishes. Annals and

Magazine of Natural History (3) 3: 377-387, pl. 15-16

Gunther ACLG (1864) The Reptiles of British India. Ray So-

ciety, London

Hemprich, FW (1820) Grundrif} der Naturgeschichte fiir hohe-

re Lehranstalten. August Rticker, Berlin

Hogg J (1841) On the existence of branchiae in the young cae-

ciliae; and on a modification and extension of the branchial

classification of the Amphibia. Annals and Magazine of na-

tural History (1) 7: 353-363

Huene F von (1952) Die Saurierwelt und ihre geschichtlichen

Zusammenhange. Gustav Fischer, Jena

Hummel K (1929) Die fossilen Weichschildkréten (Trionychia).

Geologische und paleontologische Abhandlungen 16: 359-487

Hunt TJ (1958) The ordinal name for tortoises, terrapins and tur-

tles. Herpetologica 14 (3): 148-150

Illiger, JKW (1815) Ueberblick der Saugthiere nach ihrer Ver-

theilung tiber die Welttheile. Abhandlungen der physikalischen

Klasse der K6niglich-PreuBischen Akademie der Wissenschaf-

ten aus den Jahren 1804-1811 [1]: 39-159

Iverson JB (1992) A revised checklist with distribution maps of

the turtles of the world. J. Iverson, Richmond

Jan G (1830) Scientiae naturalis cultoribus conspectus method-

icus testaceorum in collectione mea exstantium anno 1830.

Parma

Jiufa Z, Ting Z (1992) Chinese chelonians illustrated. Jiangsu

science and technology publishing house, Nanjing

Joyce WG, Parham JF, Gauthier JA (2004) Developing a pro-

tocol for the conversion of rank-based taxon names to phylo-

genetically defined clade names, as exemplified by turtles.

Journal of Paleontology 78 (5): 989-1013

Keen AM (1971) Sea shells of tropical west America: marine

mollusks from Baja California to Peru. Second edition. Stan-

ford University Press, Stanford

Kennard J (1942) The Histoire and Prodrome of Férussac. Part

III. The divisional names. Journal of molluscan Studies 25 (3):

111-118

King FW, Burke RL (1989) Crocodilian, tuatara, and turtle spe-

cies of the world. Association of Systematics Collections,

Washington

Klein IT (1751) Quadrupedum dispositio brevisque historia na-

turalis. lonam Schmidt, Lipsiae

Kuhn O (1967) Amphibien und Reptilien. G. Fischer, Stuttgart

Kuzmin SL (2002) The turtles of Russia and other ex-Soviet Re-

publics. Edition Chimaira, Frankfurt am Main

Lamarck JB Monet de (1801) Systéme [sic] des animaux sans

vertebres, ou tableau général des classes, des ordres et des gen-

res de ces animaux; présentant leurs caractéres essentiels et

leur distribution, d’apreés la considération de leurs rapports na-

turels et de leur organisation. Déterville, Paris

Latreille (1800) Histoire naturelle des salamandres de France,

précédée d’un tableau méthodique des autres reptiles. Villier,

Paris

Latreille PA (1802) Histoire naturelle, générale et particuliére des

crustacés et des insectes. Ouvrage faisant suite a histoire na-

turelle générale et particuli¢re, composée par Leclerc de Buf-

fon, et rédigée par C. S. Sonnini, membre de plusieurs sociétés

savantes. III. F. Dufart, Paris

Latreille (1810) Considérations générales sur |’ ordre naturel des

crustacés, arachnides et insectes. Avec un tableau méthodique

de leurs genres disposés en familles. F. Scheell, Paris

Bonn zoological Bulletin 57 (2): 149-171

Latreille (1824) Esquisse d’une distribution générale du regne

animal. Agasse, Paris

Latreille (1825) Familles naturelles du régne animal. Bailliére,

Paris

Laurenti JN (1768) Specimen medicum, exhibens synopsin Rep-

tilium emendatam cum experimentis circa venena et antidota

Reptilium austriacorum. Joan. Thom. Nob. de Trattnern, Vien-

nae

Linnaeus C (1758) Systema Nature. per regna tria nature, se-

cundum classes, ordines, genera, species, cum characteribus,

differentiis, synonymis, locis. Editio decima, reformata. To-

mus I. Laurentii Salvii, Holmiz

Linnaeus C (1759) Systema Nature per regna tria nature, se-

cundum classes, ordines, genera, species, cum characteribus,

differentiis, synonymis, locis. Editio decima, reformata. To-

mus II. Laurentii Salvi, Holmiz

Linnaeus C (1761) Fauna Svecica. Editio altera, auctior. Lau-

rentii Salvii, Stocholmiz

Linneeus C (1764) Museum S:z R:z M:tis Adolphi Friderici Re-

gis Svecorum, Gothorum, Vandalorumque &c. &c. &c. in quo

Animalia rariora imprimis & exotica: Aves, Amphibia, Pisces

describuntur. Tomi Secundi Prodromus. Laurenti Salvi, Hol-

mize

Linnaeus C (1766) Systema Nature. Editio duodecima, refor-

mata. Tomus I, Pars I. Laurentii Salvii, Holmiz

Linnaeus C (1767) Systema Nature. Editio duodecima, refor-

mata. Tomus I, Pars I. Laurentii Salvii, Holmiz

Loveridge A (1957) Check list of the reptiles and amphibians

of East Africa (Uganda; Kenya; Tanganyika; Zanzibar). Bul-

letin of the Museum of comparative Zoology 117 (2): 151-362

+ 1-XXXVI

Loveridge A, Williams EE (1957) Revision of the African tor-

toises and turtles of the suborder Cryptodira. Bulletin of the

Museum of comparative Zoology 115 (6): 163-557, pl. 1-18

Mendes da Costa E (1776) Elements of Conchology: or, an in-

troduction to the Knowledge of Shells. Benjamin White, Lon-

don

Mendes da Costa E (1778) Historia Naturalis Testaceorum Bri-

tanniz, or The British Conchology. Millan, B. White, Elms-

ley & Robson, London

Merrem B (1820) Versuch eines Systems der Amphibien. Ten-

tamen systematis amphibiorum. Iohann Christian Krieger,

Marburg

Mertens R, Miller L (1928) Liste der Amphibien und Reptilien

Europas. Abhandlungen der senckenbergischen Naturfor-

schenden Gesellschaft 41: 1-62

Mertens R, Wermuth H (1955) Die rezenten Schildkréten, Kro-

kodile und Briickenechsen. Zoologischer Jahrbticher 83 (5):

323-440

Mickoleit G (2004) Phylogenetische Systematik der Wirbeltie-

re. Dr. Friedrich Pfeil, Mtinchen

Mtynarski M (1976) Handbuch der Palaoherpetologie. 7. Testu-

dines. G. Fisher, Stuttgart & New York

Miller OF (1771) Von Wiirmern des stissen und salzigen Was-

sers. Heineck und Faber, Kopenhagen

Miller OF (1773) Vermium terrestrium et fluviatilium, seu ani-

malium infusoriorum, helminthicorum et testaceorum, non

marinorum, succincta historia. Vol. I pars I. Heineck et Fa-

ber, Hauniz et Lipsize

Miiller OF (1776) Zoologiz Danicz prodromus, seu animalium

Daniz et Norvegiz indigenarum characteres, nomina, et sy-

nonyma imprimis popularium. Typis Hallageriis, Haunize

Miller OF (1777) Zoologiz Danicz, seu animalium Danie et

Norvegiz rariorum ac minus notorum icones. Fasciculus pri-

mus. Typis Mart. Hallageri, Hauniz

OZFMK

160 Alain Dubois & Roger Bour

Noriega JI, Manzano AS, De La Fuente M, Tonni EP (2000) Un

Testudinidae gigante (Chelonii: Cryptodira) del Pleistoceno

de la provincia de Corrientes, Argentina. Ameghiniana 37 (3):

321-326

Nutaphand W (1979) The turtles of Thailand. Siamfarm zoolo-

gical garden, Bangkok

Oken L (1821) Esquisse du systeme d’anatomie, de physiolo-

gie et d’histoire naturelle. Béchet Jeune, Paris

Oken L (1833) Allgemeine Naturgeschichte fiir alle Staénde. Vier-

ter Band. Thierreich, erster Band. Carl Hoffmann, Stuttgart

Oppel M (181 1a) Ordre II. Reptiles a écailles. Section 2. Ophi-

diens. Annales du Muséum d’Histoire naturelle [1810] 16:

254-295 + 376-393

Oppel M (1811b) Ordnungen, Familien und Gattungen der Rep-

tilien als Prodrom einer Naturgeschichte derselben. Joseph

Lindauer, Miinchen

Pallas PS (1766a) [March] Elenchus Zoophytorum sistens ge-

nerum adumbrationes generaliores et specierum cognitarum

succinctas descriptiones cum selectis auctorum synonymis.

Franciscum Varrentrapp, Hagee Comitum

Pallas PS (1766b) [November] Miscellanea zoologica quibus

nove imprimis atque obscure animalium species describun-

tur et observationibus iconibusque illustrantur. Petrum Van

Cleef, Hagee Comitum

Peters WCH (1862) Uber die von dem so frith in Afrika verstor-

benen Freiherrn von Barnim und Dr. Hartmann auf ihrer Reise

durch Aegypten, Nubien und dem Sennar gesammelten Am-

phibien. Monatsberichte der kéniglich preussischen Akademie

der Wissenschaften zu Berlin 1862: 271-279, | pl.

Peters WCH (1882) Naturwissenschaftliche Reise nach Mossam-

bique auf Befehl seiner Majestat des K6nigs Friedrich Wil-

helm IV in den Jahren 1842 bis 1848 ausgeftihrt. Zoologie.

IH. Amphibien. G. Reimer, Berlin

Philipsson LM (1788) Dissertatio historico—naturalis sistens nova

testaceorum genera. Quam venia ampliss. Facult. Philoso-

phic preside D. M. Andr. J. Retzio (...) ad publicum exa-

men desert Laurentius Miinter Philipsson scanus. Typis Ber-

lingianis, Lundz

Pitt WD, James MJ, Hixckman CS, Lipps JH, Pittr LJ (1986)

Late Cenozoic marine molluscs from cones in the Galapagos

Islands. Proceedings of the California Academy of Sciences

44 (12): 269-282

Pough FH, Andrews RM, Cadle JE, Crump ML, Savitzky AH,

Wells KD (2004) Herpetology. Third edition. Pearson, Upper

Saddle River (NJ)

Pritchard PCH (1967) Living turtles of the world. T.F.H. publi-

cations, Neptune City (NJ)

Pritchard PCH (2007) Evolutionary relationships, osteology,

morphology, and zoogeography of ridley sea turtles. Pp. 45-57

in: Plotkin PT, Biology and conservation of ridley sea turtles.

The Johns Hopkins University Press, Baltimore (MD)

Pritchard PCH, Trebbau P (1984) The turtles of Venezuela.

SSAR, Athens (OH)

Rafinesque CS (1815) Analyse de la nature ou Tableau de l’uni-

vers et des corps organisés. Jean Barravecchia, Palerme

Rafinesque-Schmaltz CS (1814a) O quadro del metodo sinot-

tico di somiologia. Specchio delle Scienze o Giornale enci-

clopedico di Sicilia 1 (1): 11-15

Rafinesque-Schmaltz CS (1814b) Principes généraux de Somio-

logie ou les loix [sic] de la nomenclature et de la classifica-

tion de l’empire organique ou des animaux et des végétaux,

contenant les régles essentielles de l’art de leur imposer des

noms immuables et de les classer méthodiquement. Franc.

Abate, Palerme

Bonn zoological Bulletin 57 (2): 149-171

Rafinesque-Schmaltz CS (1814c) Prodrono [sic] di Erpetologia

Siciliana. Specchio delle Scienze 0 Giornale enciclopedico di

Sicilia 2 (9): 65-67

Rafinesque-Schmaltz CS (1814d) Fine del Prodromo d’Erpeto-

logia Siciliana. Specchio delle Scienze o Giornale enciclope-

dico di Sicilia 2 (10): 102-104

Rhodin AGJ, Parham JF, van Dik PP, Iverson JB (2009) Tur-

tles of the world: annotated checklist of taxonomy and syno-

nymy, 2009 update, with conservation status summary. Che-

lonian Research Monographs 5: 39-84

Rhodin AGJ, van Dijk PP, Parham JF (2008) Turtles of the world:

annotated checklist of taxonomy and synonymy. Chelonian

Research Monographs 5: 1-38

Richard E (1999) Tortugas de las regiones aridas de Argentina.

LOLA, Buenos Aires

Ritgen FA (1828) Versuch einer nattirlichen Eintheilung der

Voégel. Nova Acta physico-medica Academiae Caesareae

Leopoldino-Carolinae Naturae Curiosorum 14: 245-284.

Réding PF (1798) Museum Boltenianum sive Catalogus cime-

liorum e tribus regnis natures. Pars secunda. Typis Johan.

Christi. Trappii, Hamburgi

Roederer JG (1761) [Untitled]. Géttingische Anzeigen von ge-

lehrten Sachen | (25): 243-246

Romer AS (1956) Osteology of the Reptiles. The University of

Chicago Press, Chicago

Romer AS (1966) Vertebrate paleontology. 3rd edition. The Uni-

versity of Chicago Press, Chicago & London

Rtippel E (1843) Verzeichniss der in dem Museum der Sencken-

bergischen naturforschenden Gesellschaft aufgestellten Samm-

lungen. Dritte Abtheilung: Amphibien. Museum Sencken-

bergianum. Abhandlungen aus dem Gebiete de beschreiben-

den Naturgeschichte 3: 293-316.

Schmidt KP (1953) A check list of North American amphibians

and reptiles. Sixth edition. American Society of Ichthyology

& Herpetology, Chicago

Schultze CF (1760) Betrachtung der versteinerten Seesterne und

ihrer Theile. Michael Groéll, Warschau & Dresden

Scopoli GA (1777) Introductio ad Historiam naturalem sistens

Genera lapidum, plantarum, et animalium. Wolfgangum Gerle,

Bibliopolam, Prage

Sherborn CD (1902) Index animalium sive index nominum quae

ab A.D. MDCCLVIII generibus et speciebus animalium im-

posita sunt. Sectio prima a kalendis ianuariis, MDCCLVIII us-

que ad finem decembris, MDCCC. Typographio Academico,

Cantabrigiae

Siebenrock F (1909) Synopsis der rezenten Schildkroten, mit Be-

riicksichtigung der in historischer Zeit ausgestorbenen Arten.

Zoologische Jarbiicher (Suppl. 10) 3: 427-618

Simpson GG (1940) Types in modern taxonomy. American Jour-

nal of Science 238: 413-431

Smith HM, Taylor EH (1950) An annotated checklist and key

to the reptiles of Mexico exclusive of the snakes. United Sta-

tes National Museum, Bulletin 199: 11—v + 1-253

Smith MA (1933) The fauna of British India, including Ceylon

and Burma. Reptilia and Amphibia. Vol. 1, Loricata, Testudi-

nes. Taylor & Francis, London

Sonnerat (1777) Reise nach Neuguinea, aus dem Franzéschen

tibersazt von J. P. Ebeling, der Arzeygehlarheit Beflissenen.

Weygandschen Buchhandlung, Leipzig

Stannius H (1856) Handbuch der Anatomie der Wirbelthiere. 2.

Zootomie der Amphibien. In: Von Siebold CT, Stannius H,

Handbuch der Zootomie, Vol. 1. von Weit & Comp., Berlin

Starobogatov YI (1991) Problems in the nomenclature of higher

taxonomic categories. Bulletin of zoological Nomenclature 48:

6-18

©OZFMK

Family- and class-series nomina in zoology 161

Statius Miller PL (1766) Delicize Naturze Selecte oder auserle-

senes Naturalien—Cabinet welches aus den drey Reichen der

Natur zeiget, was von curidsen Liebhabern aufbehalten und

gesammelt zu werden verdienet. Ehemals herausgegeben von

Georg Wolfgang Knorr beriihmten Kupferstecher in Niirnberg,

fortgesetzt von dessen Erben, beschrieben von Phillip Lud-

wig Statius Miller (...), und in das Franzésiche tibersetzt von

Matthaus Verdier de la Blaquiere (...). Knorr, Niirnberg

Steyneger L (1907) Herpetology of Japan and adjacent territory.

Bulletin of the United States national Museum 58: 1-xx +

1=577, pl. 1-35

Stejneger L, Barbour T (1917) A check list of North American

amphibians and reptiles. Harvard University Press, Cambridge

Strauch A (1862) Chelonologische Studien, mit besonderer Be-

ziehung auf die Schildkr6tensammlung der kaiserlichen Aka-

demie der Wissenschaften zu St.-Petersburg. Mémoires de

1’ Académie impériale des Sciences de Saint Petersburg (7) 5

(7): 1-196, 1 pl.

Strauch A (1865) Die Vertheilung der Schildkréten tiber den Erd-

ball. Ein zoographischer Versuch. Mémoires de I’ Académie

impériale des Sciences de Saint Petersburg (7) 8 (13): 1-207

Strauch A (1890) Bemerkungen tiber die im zoologischen Mu-

seum Schildkr6tensammlung der kaiserlichen Akademie der

Wissenschaften zu St.-Petersburg. Mémoires de I’ Académie

impériale des Sciences de Saint Petersburg (7) 38 (2): 1-127,

pl. 14

Swainson W (1835) A treatise on the geography and classifica-

tion of animals. In: Lardner D. (ed.), The cabinet cyclopae-

dia, Longman et al., London

Terent’ev PV, Chernov SA (1949) Key to amphibians and rep-

tiles. 3rd, enlarged edition. Translated from Russian [1965].

Israel program for scientific translations, Jerusalem

Troschel FH (1866) Bericht tiber die Leistungen in der Herpe-

tologie wahrend des Jahres 1865. Archiv ftir Naturgeschich-

te 32 (2): 180-192

Tschudi JJ von (1838) Classification der Batrachier, mit Bertick-

sichtigung der fossilen Thiere dieser Abtheilung der Reptilien.

Petitpierre, Neuchatel

Vanni S, Nistri A (2006) Atlante degli anfibi e dei rettili della

Toscana. Museo di storia naturale, Sezione di Zoologia La

Specola, Firenze

Vetter H (2002) Turtles of the World Vol. 1. Schildkréten der Welt

Band 1. Africa, Europe and Eastern Asia — Afrika, Europa und

Westasien. Chimaira, Frankfurt am Main

Vetter H (2004) Turtles of the World Vol. 2. Schildkréten der Welt

Band 2. North Anerica — Nordamerika. Chimaira, Frankfurt

am Main

Vetter H, van Dijk PP (2006) Turtles of the World Vol. 4. Schild-

kroten der Welt Band 4. East und South Asia — Ost- und Siid-

asien. Chimaira, Frankfurt am Main

Vieillot LP (1816) Analyse d’une nouvelle ornithologie élémen-

taire. Déterville, Paris

Bonn zoological Bulletin 57 (2): 149-171

Vigors NA (1825) Sketches in ornithology; or, observations on

the leading affinities of some of the more extensive groups

of birds. Zoological Journal 2: 368—405

Voet JE (1793) Ioannis Eusebii Voetii Icones et Descriptiones

Coleopterorum — Johann Euseb Voets Beschreibungen und Ab-

bildungen hartschaaligter Insecten Coleoptera Linn. Zweyter

Theil. Johann Jakob Palm, Erlangen

Voet JE (1806) Catalogus systematicus Coleopterorum — Cata-

logue systématique des Coléopteres — Systematische naam-

lyst van dat geslacht van Insecten dat men torren noemt. To-

mus primus. G. Bakhuysen, La Haye

Wagler JG (1828) Conspectus Systematis Amphibiorum. Isis von

Oken 21: 859-861

Wagler J (1830) Natiirliches System der Amphibien, mit voran-

gehender Classification der Saugethiere und Vogel. Cotta,

Munchen, Stuttgart & Tubingen

Webb JE, Wallwork JA, Elgood JH (1978) Guide to living rep-

tiles. Macmillan, London

Welch KRG (1982) Herpetology of Africa. Robert E. Krieger,

Malabar (FL)

Wermuth H, Mertens, R (1961) Schildkréten Krokodile Briicke-

nechsen. VEB Gustav Fischer Verlag, Jena

Werneburg I, Sanchez-Villagra MR (2009) Timing of organo-

genesis support basal position of turtles in the amniote tree

of life. BMC Evolutionary Biology 9, 82: 1—9. Online at

http://www.biomedcentral.com/1471-2148/9/82

(doi:10.1186/1471-2148-9-82) last accessed 08-02-2010

Westwood JO (1840) An introduction to the modern classifica-

tion of insects; founded on the natural habits and correspon-

ding organisation of the different families. Longman, Orme,

Brown, Green & Longman, London

Wiegmann AFA, Ruthe JF (1843) Handbuch der Zoologie.

Zweyte Auflage von FH Troschel und JF Ruthe. C. G. Liide-

ritz, Berlin

Wieland F (2010) Gralla Sonnerat, 1777. Goettingen, Animal-

Base. Online at http://www.animalbase.uni-goettingen.de

/zooweb/servlet/AnimalBase/home/genustaxon?id=4111 last

accessed 08-02-2010

Winckworth R (1945) The types of the Boltenian genera. Jour-

nal of molluscan Studies 26: 136-148

Xianrui Y (1994) Fossil and recent turtles of China. Science

Press, Beijing

Yeh HK (1963) Fossil turtles of China. Paleontologica sinica 150

(N.S.C. 18): i-iv + 1-112, pl. 1-21

Zhao E, Adler K (1993) Herpetology of China. Contributions to

Herpetology, Nr. 10. Society for the Study of Amphibians and

Reptiles, Athens (OH)

Zimmermann EAW von (1780) Geographische Geschichte des

Menschen, und der vierftiBigen Thiere. Zweiter Band. Wey-

gandschen Buchhandlung, Leipzig

Received: 10. VII.2010

Accepted: 25.1X.2010

©ZFMK

162

APPENDIX 1

Table 1.

Alain Dubois & Roger Bour

Chronological presentation of the family-series and class-series nomina used in various publications for the order of

turtles and for the family including the genus Zestudo Linnaeus, 1758. The authors and dates are mentioned below only when they

were so in the works cited. Nomina connected by the sign <> are allelonyms (Dubois 2006a), i.e., alternative nomina proposed or

used by an author in the same publication for the same taxon (same content and taxonomic rank), without choosing between them.

Reference

Nomen used for the order (or for a class-series

taxon of another rank) of turtles

Nomen used for the family including

the genus Zestudo Linnaeus, 1758

Batsch 1788: 437

Brongniart 1800a: 81

Latreille 1800: xi

Ross & Macartney in Cuvier 1802: tab. 3

Dumeéril 1806: 76

Oppel 1811b: 4, 6

Rafinesque-Schmaltz 1814c: 66

Rafinesque 1815: 74

Merrem 1820: 6, 7, 12, 17

Latreille 1825: 91

Gray 1825: 194, 210

Fitzinger 1826: 5

Ritgen 1828: 269, 270

Wagler 1828: 861

Wagler 1830: 130

Bonaparte 1831: 63, 68

Griffith & Pidgeon 1831: 4, 6

Gray 183la: 2

Gray 1831b: 3, 7

Duméril & Bibron 1834: 346, 352

Dumeéril & Bibron 1835: 1

Fitzinger 1835: 107

Fitzinger 1843: 29

Ruippel 1843: 297

Wiegmann & Ruthe 1843: 166, 168

Gray 1844: 3

Bonaparte 1845: 3

Bonaparte 1850: pl.

Gray 1855: title page, 1, 4

Agassiz 1857: 235, 249

Gunther 1859: 379

Peters 1862: 271

Strauch 1862: 19, 20

Gunther 1864: x, 1, 3

Strauch 1865: 205

Troschel 1866: 182

Fitzinger 1867: 85

Gray 1873: iv, 1

Cope 1875: 50, 54

Peters 1882: 2

Baur 1887: 96, 101

Boulenger 1889: 4, 48

Strauch 1890: 9, 10

Baur 1892: 419, 420

Boettger 1893: 2, 3

Barboza du Bocage 1895: |

Steyneger 1907: 483, 488

Siebenrock 1909: 429

De Rooij 1915: 285, 288

Stejneger & Barbour 1917: 113

Boulenger 1923: 42

CHELONIENS

CHELONII

CHELONIA

CHELONII

TESTUDINATA Klein, 1751

PEROSTIA

TESTUDINATA Oppel, 1811

CHELONII

CHELONII Latreille, 1800

Monopnoa [including tribe TestupINaATA Klein, 1751]

CHELONII <> STERRICHROTES

CHELYNAE

TESTUDINES

CHELONII

CHELONIA

TESTUDINATA

CHELONII

CHELONIENS Brongniart, 1800

MONOPNOA

TYLOPODA Wagler, 1828

CHELONII

CHELONIA

CHELONII

TESTUDINATA Oppel, 1811 <* CHELONIA Gray, 1835 [sic]

TESTUDINATA Klein, 1751

CHELONII

CHELONIA

CHELONII

TESTUDINATA

CHELONI <> TESTUDINATA

TESTUDINATA

CHELONIA Brongniart, 1800

CHELONIA

TESTUDINATA

CHELONIA

TESTUDINATA Oppel, 1811

CHELONIA

TESTUDINATA Oppel, 1811

CHELONIA

TESTUDINES

AMYDAE

TESTUDIA

CRYPTOPODI

TESTUDINIDAE

TESTUDINOIDEA

CHERSOCHELONES <*> DYSMYDAE

TYLOPODAE

HEDRAEOGLOSSAE

TESTUDINIDAE

TESTUDINIDAE Gray, 1825

“CHERSITES”

TYLOPODA

TESTUDINES

CHERSINAE

TESTUDINIDAE

TESTUDININA Bonaparte, 1831

TESTUDINIDAE

TESTUDINIDA

TESTUDINIDAE

TESTUDINIDA

CHERSINAE

TESTUDINIDAE

TESTUDININA

TESTUDINIDAE

TESTUDINIDA

TESTUDINIDAE

TESTUDINIDAE Gray 1825

TESTUDINIDAE

Bonn zoological Bulletin 57 (2): 149-171

©ZFMK

Reference

Family- and class-series nomina in zoology

Nomen used for the order (or for a class-series

taxon of another rank) of turtles

163

Nomen used for the family including

the genus Zestudo Linnaeus, 1758

Mertens & Miller 1928: 20

Smith 1933: 49, 136

Freiberg 1938: 7, 9

Terente’v & Chernov 1949: 88, 95

Smith & Taylor 1950: 12, 27

Schmidt 1953: 86, 104

Bergounioux 1955: 187, 508

Mertens & Wermuth 1955: 333, 370

Romer 1956: 495, 504

Loveridge 1957: 163

Loveridge & Williams 1957: 175, 181

Hunt 1958: 150

Wermuth & Mertens 1961: 1, 171

Fuhn & Vancea 1961: 157, 158

Goin & Goin 1962: 73, 254

Yeh, 1963: 7, 27

Romer 1966: 365

Kuhn 1967: 114

Pritchard 1967: 27

Ckhikvazde 1970: 245

Auffenberg 1974: 140

Gaffney 1975: 423

Mtynarski 1976: 6

Webb et al. 1978: vii

Nutaphand 1979: 13, 55

Bour 1981: 133

De Broin 1982: 897

Welch 1982: 206, 207

Pritchard & Trebbau 1984: 11, 197

Bour & Dubois 1985: 78

Alderton 1988: 108

Dundee 1989: 403

Ernst & Barbour 1989: 3, 227

King & Burke 1989: 16, 69

Jiufa & Ting, 1992: 1, 4

Iverson, 1992: 3,

Zhao & Adler, 1993: 164, 171

David 1994: 16, 18

Xianrui 1994: 4, 62

Richard 1999: 85

Boycott & Bourquin 2000: 32

De Lapparent de Broin 2001: 166, 187

Noriega et al. 2000: 321

Kuzmin 2002: 17, 84

Vetter 2002: 3, 5

Mickoleit 2004: 282, 294

Pough et al. 2004: 97, 109

Vetter 2004: 3, 8

Vanni & Nistri 2006: 23

Fritz & Havas 2006: 10, 122

Vetter & van Dijk 2006: 3, 8

Fritz & Havas 2007: 163, 265

Pritchard 2007: 46

Abbazzi et al. 2008: 123

Rhodin et al. 2008: 2, 12

Rhodin et al. 2009: 42, 52

TESTUDINATA Oppel, 1811

TESTUDINES Batsch, 1788

TESTUDINATA Oppel, 1811

CHELONIA [in subclass TESTUDINES |

TESTUDINES Batsch, 1788

CHELONIA

CHELONIA [in subclass TESTUDINATA ]

TESTUDINES

CHELONIA <> TESTUDINATA

TESTUDINATA Oppel, 1811

TESTUDINATA

TESTUDINES Linnaeus, 1758

TESTUDINES

TESTUDINES Batsch, 1788

TESTUDINATA

CHELONIA

CHELONIA Macartney, 1802

TESTUDINES Batsch, 1788

CHELONIA

TESTUDINATA Shaw, 1802

TESTUDINES Batsch, 1788

CHELONIA

CHELONIA <> TESTUDINES

CHELONII

CHELONII Brongniart, 1800

CHELONIA

TESTUDINES

CHELONII Brongniart, 1800

CHELONIA

TESTUDINES

TESTUDINES Batsch, 1788

TESTUDINATA

TESTUDINES Linnaeus, 1758

TESTUDINES

CHELONI Brongniart, 1800

TESTUDINES Linnaeus, 1758

CHELONI Brongniart, 1800

CHELONIA <> TESTUDINES

CHELONI Brongniart, 1800

CHELONII

TESTUDINES

TESTUDINES Linnaeus, 1758

CHELONIA «> TESTUDINES

TESTUDINES <> CHELONIA

TESTUDINES Linnaeus, 1758

CHELONI Brongniart, 1800

TESTUDINES Batsch, 1788

CHELONII Latreille, 1800 <* CHELONIA Macartney, 1802

<> TESTUDINES [neither Linnaeus, 1758, nor Batsch, 1788]

CHELONH Brongniart, 1800

TESTUDINES Batsch, 1788

TESTUDINIDAE

TESTUDINIDAE Gray, 1825

TESTUDINIDAE

TESTUDINIDAE Gray, 1825

TESTUDINIDAE

TESTUDINIDAE Gray, 1825

TESTUDINIDAE

TESTUDINIDAE Gray, 1825

TESTUDINIDAE

TESTUDINIDAE Gray, 1825

TESTUDINIDAE

TESTUDINIDAE Gray, 1825

TESTUDINIDAE

TESTUDINIDAE Batsch, 1788

TESTUDINIDAE

TESTUDINIDAE Gray, 1825

TESTUDINIDAE Batsch, 1788

TESTUDINIDAE

TESTUDINIDAE Gray, 1825

TESTUDINIDAE

TESTUDINIDAE Batsch, 1788

TESTUDINIDAE

TESTUDINIDAE Batsch, 1788

TESTUDINIDAE Gray, 1825

TESTUDINIDAE

TESTUDINIDAE Batsch, 1788

TESTUDINIDAE

TESTUDINIDAE Batsch, 1788

TESTUDINIDAE

TESTUDINIDAE Rafinesque, 1815

TESTUDINIDAE Batsch, 1788

Bonn zoological Bulletin 57 (2): 149-171

©ZFMK

164 Alain Dubois & Roger Bour

Table 2. The supraspecific taxa of animals listed in Batsch (1788, 1789). The animals are distributed in two class-series taxa,

OsseA and Crustacea, for which no ranks are given in this book; they are here referred to the rank “superclassis”. All other ranks

are mentioned expressly in Batsch (1788, 1789). Nomina connected by the sign <> are allelonyms (Dubois 2006a), i.e., alternative

nomina proposed by an author in the same publication for the same taxon (same content, onomatophore and taxonomic rank), with-

out choosing between them. The generic nomina are given here under their original spelling (protonym; Dubois 2000), with men-

tion between parenthesis of the subsequent spelling (aponym; Dubois 2000) used by Batsch, whenever relevant. All these generic

nomina had been created by Linnaeus (1758) or in subsequent works published before those of Batsch, except three, followed here

by the sign +, which were made nomenclaturally available by Batsch (1789), and the status of which is discussed below in Appen-

dix 1. This appendix also discusses the status of three post-Linnean generic nomina, followed by the sign ‘¢, which we consider

here nomenclaturally unavailable. The familial nomina created by Batsch (1788, 1789) are of three kinds: (1) a familial nomen un-

derlined in this Table was clearly based on the nomen (also underlined) of a genus expressly referred by Batsch to the familia as

a valid nomen, which is therefore its nucleogenus (type-genus) by implicit etymological designation (Dubois 1984), thus making

this family-series nomen available under Art. 11.7.1.1; (2) a familial nomen followed by an asterisk * can be considered derived

from the nomen of a genus traditionally referred to the same taxonomic group, but not used as valid by Batsch, being probably

considered a synonym of another nomen; this generic nomen is listed between square brackets, also followed by *, after the list

of the valid genera of the family according to Batsch; such a family-series nomen, being based on a generic nomen considered in-

valid by Batsch, is unavailable under Art. 11.7.1.1, thus shown “between quotation marks”; (3) a familial nomen followed by the

sign ° is an arhizonym (Dubois 2006a: 178), 1.e., cannot be construed as being based on a then available generic nomen and is

therefore unavailable under Art. 11.7.1.1, thus also shown “between quotation marks”.

“Superclassis” OssEA Batsch, 1788: 81.

Classis MAMMALIA Batsch, 1788: 87.

Ordo Bruta Batsch, 1788: 103.

Familia “Cozossr’° Batsch, 1788: 107.

Genera (2): Elephas Linnaeus, 1758: 18; Rhinoceros Linnaeus, 1758: 19.

Familia “CaT4PHrAcTA’* Batsch, 1788: 107.

Genera (2): Dasypus Linnaeus, 1758: 18; Manis Linnaeus, 1758: 18. [Cataphractus* Brisson, 1762: 12-13].

Familia BraDyPopa Batsch, 1788: 108.

Genera (2): Bradypus Linnaeus, 1758: 18; Myrmecophaga Linnaeus, 1758: 18.

Ordo Pecora Batsch, 1788: 103.

Familia “Ovina’’* Batsch, 1788: 105.

Genera (2): Camelus Linnaeus, 1758: 19; Capra Linnaeus, 1758: 19. [Ovis* Linnaeus, 1758: 19].

Familia CERVINA Batsch, 1788: 105.

Genera (4): Antilope Pallas, 1766b: 232; Bos Linnaeus, 1758: 19; Cervus Linnaeus, 1758: 19; Moschus Linnaeus, 1758: 19.

Ordo GLIRES Batsch, 1788: 103.

Familia Murina Batsch, 1788: 115.

Genus (1): Mus Linnaeus, 1758: 19.

Familia LEPORINA Batsch, 1788: 115.

Genera (4): Cavia Pallas, 1766b: 30; Lepus Linnaeus, 1758: 19; Marmota Blumenbach, 1779: 79; Spalax Gueldenstaedt, 1770:

409.

Familia SC/URINA Batsch, 1788: 115.

Genera (3): Dipus Zimmermann, 1780: 354; Glis Brisson, 1762: 13, 113; Sciurus Linnaeus, 1758: 19.

Familia C4s7orREA Batsch, 1788: 115.

Genera (2): Castor Linnaeus, 1758: 19; Hystrix Linnaeus, 1758: 19.

Ordo Primates Batsch, 1788: 103.

Familia “PrimaTes’’° Batsch, 1788: 108.

Genera (3): Homo Linnaeus, 1758: 18; Lemur Linnaeus, 1758: 18; Simia Linnaeus, 1758: 18.

Ordo FERAE Batsch, 1788: 103.

Familia FELINA Batsch, 1788: 110.

Genus (1): Fe/is Linnaeus, 1758: 18.

Familia Canina Batsch, 1788: 110.

Genera (2): Canis Linnaeus, 1758: 18; Hyaena Brisson, 1762: 13, 168.

Familia Ursivé Batsch, 1788: 110.

Genus (1): Ursus Linnaeus, 1758: 18.

Familia MUSTELINA Batsch, 1788: 110.

Genera (3): Lutra Brisson, 1762: 13, 201; Mustela Linnaeus, 1758: 18; Viverra Linnaeus, 1758: 18.

Ordo BELLUAE Batsch, 1788: 103.

Familia “BELLUAE”® Batsch, 1788: 105.

Genera (4): Equus Linnaeus, 1758: 19; Hippopotamus Linnaeus, 1758: 19; Hydrochoerus Brisson, 1762: 12, 80 (as Hydrochae-

rus); Sus Linnaeus, 1758: 18.

Ordo Rosores Batsch, 1788: 103.

Familia Z4LPinA Batsch, 1788: 113.

Genera (3): Erinaceus Linnaeus, 1758: 18; Sorex Linnaeus, 1758: 18; Za/pa Linnaeus, 1758: 18.

Familia “PTEROPoDA’* Batsch, 1788: 105.

Genus (1): Vespertilio Linnaeus, 1758: 18. [Pteropus* Brisson, 1762: 13, 153].

Bonn zoological Bulletin 57 (2): 149-171 ©ZFMK

Family- and class-series nomina in zoology 165

Familia “MarsuPidALes”* Batsch, 1788: 105.

Genus (1): Didelphis Linnaeus, 1758: 18 (as Didelphys). [“Marsupiale”*: Edward in Catesby, 1771].

Ordo PINNIPEDA Batsch, 1788: 103.

Familia “P/NN/PEDA’’° Batsch, 1788: 116.

Genera (3): Phoca Linnaeus, 1758: 18; Rosmarus Briinnichius, 1771: 34; Trichechus Linnaeus, 1758: 18 (as Trichecus).

Ordo CETACEA Batsch, 1788: 103.

Familia “Ce74cea”* Batsch, 1788: 116.

Genera (4): Balaena Linnaeus, 1758: 19; Del/phinus Linnaeus, 1758: 19; Monodon Linnaeus, 1758: 19; Physeter Linnaeus, 1758:

19. [Cetus* Brisson, 1762: 225].

Classis AVES Batsch, 1788: 88.

Familia “ANSERES”’* Batsch, 1788: 276.

Genera (11): A/ca Linnaeus, 1758: 84; Anas Linnaeus, 1758: 84; Colymbus Linnaeus, 1758: 135; Diomedea Linnaeus, 1758: 84;

Larus Linnaeus, 1758: 84; Mergus Linnaeus, 1758: 84; Pelecanus Linnaeus, 1758: 84; Phaeton Linnaeus, 1758: 84; Procel-

laria Linnaeus, 1758: 84; Rynchops Linnaeus, 1758: 138 (as Rhynchops); Sterna Linnaeus, 1758: 84. [Anser* Brisson, 1760:

262].

Familia “GrALLAe”* Batsch, 1788: 276.

Genera (11): Ardea Linnaeus, 1758: 84; Charadrius Linnaeus, 1758: 85; Fulica Linnaeus, 1758: 84; Haematopus Linnaeus, 1758:

85; Phoenicopterus Linnaeus, 1758: 84; Platalea Linnaeus, 1758: 84; Rallus Linnaeus, 1758: 84; Recurvirostra Linnaeus,

1758: 84; Scolopax Linnaeus, 1758: 84; Tantalus Linnaeus, 1758: 84; Tringa Linnaeus, 1758: 84. [“Gralla”+: Eberling in

Sonnerat, 1777].

Familia STRUTHIONES Batsch, 1788: 276.

Genera (3): Didus Linnaeus, 1766: 119; Otis Linnaeus, 1758: 85; Struthio Linnaeus, 1758: 85.

Familia “7ENUIROSTRES’”° Batsch, 1788: 276.

Genera (4): Certhia Linnaeus, 1758: 83; Merops Linnaeus, 1758: 83; Trochilus Linnaeus, 1758: 83; Upupa Linnaeus, 1758: 83.

Familia “CUNEIROSTRES’’° Batsch, 1788: 276.

Genera (2): Alcedo Linnaeus, 1758: 83; Picus Linnaeus, 1758: 83.

Familia “G4LLINAE’* Batsch, 1788: 276.

Genera (7): Columba Linnaeus, 1758: 85; Crax Linnaeus, 1758: 85; Meleagris Linnaeus, 1758: 85; Numida Linnaeus, 1764: 27;

Pavo Linnaeus, 1758: 85; Phasianus Linnaeus, 1758: 85; Tetrao Linnaeus, 1758: 85. [Gallus* Brisson, 1760: 45].

Familia “AccipiTres’’* Batsch, 1788: 277.

Genera (3): Falco Linnaeus, 1758: 83; Strix Linnaeus, 1758: 83 (as Stryx); Vultur Linnaeus, 1758: 83. [Accipiter* Brisson, 1760:

310].

Familia “LEVIROSTRES’° Batsch, 1788: 27.

Genera (4): Buceros Linnaeus, 1758: 83; Crotophaga Linnaeus, 1758: 83; Psittacus Linnaeus, 1758: 83; Ramphastos Linnaeus,

1758: 83.

Familia Cordces Batsch, 1788: 277 <> “P4SSERES”’° Batsch, 1788: 277.

Genera (20): Alauda Linnaeus, 1758: 85; Ampelis Linnaeus, 1766: 119; Caprimulgus Linnaeus, 1758: 85; Coracias Linnaeus,

1758: 83; Corvus Linnaeus, 1758: 83; Cuculus Linnaeus, 1758: 83; Emberiza Linnaeus, 1758: 85; Fringilla Linnaeus, 1758:

85; Gracula Linnaeus, 1758: 83; Hirundo Linnaeus, 1758: 85; Jynx Linnaeus, 1758: 83 (as Jynx); Lanius Linnaeus, 1758:

83; Loxia Linnaeus, 1758: 85; Motacilla Linnaeus, 1758: 85; Oriolus Linnaeus, 1766: 117; Paradisaea Linnaeus, 1758: 110;

Parus Linnaeus, 1758: 85; Sitta Linnaeus, 1758: 83; Sturnus Linnaeus, 1758: 85; Turdus Linnaeus, 1758: 85.

Classis AMPHIBIA Batsch, 1788: 88.

Familia TESTUDINES Batsch, 1788: 437.

Genus (1): Zestudo Linnaeus, 1758: 196.

Familia “Barracur’? Batsch, 1788: 437.

Genera (4): Bufo Laurenti, 1768: 25; Hy/a Laurenti, 1768: 32; Pipa Laurenti, 1768: 24; Rana Linnaeus, 1758: 196.

Familia “LACERTAE”* Batsch, 1788: 437.

Genera (13): Basiliscus Laurenti, 1768: 50; Caudiverbera Laurenti, 1768: 43; Chamaeleo Laurenti, 1768: 45 (as Chamaeleon);

Cordylus Laurenti, 1768: 51; Crocodylus Laurenti, 1768: 53; Draco Linnaeus, 1758: 196; Gekko Laurenti, 1768: 43; [Iguana

Laurenti, 1768: 47; Salamandra Laurenti, 1768: 41; Scincus Laurenti, 1768: 55; Seps Laurenti, 1768: 58; Ste//io Laurent,

1768: 56; Triton Laurenti, 1768: 37. [Lacerta* Linnaeus, 1758: 196].

Familia “SERPENTES’* Batsch, 1788: 437.

Genera (16): Amphisbaena Linnaeus, 1758: 196; Anguis Linnaeus, 1758: 196; Aspis Laurenti, 1768: 105; Boa Linnaeus, 1758:

196; Caecilia Linnaeus, 1758: 229; Caudisona Laurenti, 1768: 92; Cerastes Laurenti, 1768: 81; Cobra Laurenti, 1768: 103;

Coluber Linnaeus, 1758: 196; Constrictor Laurenti, 1768: 106; Coronella Laurenti, 1768: 84; Dipsas Laurenti, 1768: 89;

Laticauda Laurenti, 1768: 109; Naja Laurenti, 1768: 90; Natrix Laurenti, 1768: 73; Vipera Laurenti, 1768: 99. [Serpens*

Garsault, 1764: pl. 667].

Classis Pisces Batsch, 1788: 88.

Familia “Muzrirorr’° Batsch, 1788: 483.

Genera (3): Petromyzon Linnaeus, 1758: 196; Raja Linnaeus, 1758: 196; Squalus Linnaeus, 1758: 196.

Familia “Monsrrosr’° Batsch, 1788: 483.

Genera (2): Chimaera Linnaeus, 1758: 196; Lophius Linnaeus, 1758: 196.

Familia “Gzosarr’° Batsch, 1788: 484.

Genera (3): Diodon Linnaeus, 1758: 243; Ostracion Linnaeus, 1758: 243; Tetrodon Linnaeus, 1758: 243.

Familia “ArTicuLATr’? Batsch, 1788: 484.

Bonn zoological Bulletin 57 (2): 149-171 ©OZFMK

166 Alain Dubois & Roger Bour

Genera (3): Fistularia Linnaeus, 1758: 243; Pegasus Linnaeus, 1758: 243; Syngnathus Linnaeus, 1758: 243.

Familia “Lorica7r’® Batsch, 1788: 484.

Genera (4): Acipenser Linnaeus, 1758: 196; Centriscus Linnaeus, 1758: 243; Cyclopterus Linnaeus, 1758: 242; Loricaria Lin-

naeus, 1758: 243.

Familia “SPECULARES”’° Batsch, 1788: 484.

Genera (7): Callionymus Linnaeus, 1758: 242 (as Callyonimus); Cottus Linnaeus, 1758: 242; Gobius Linnaeus, 1758: 242; Scor-

paena Linnaeus, 1758: 242; Trachinus Linnaeus, 1758: 242; Uranoscopus Linnaeus, 1758: 242; Zeus Linnaeus, 1758: 242.

Familia “SoveaTr’* Batsch, 1788: 484.

Genera (3): Balistes Linnaeus, 1758: 243; Chaetodon Linnaeus, 1758: 242; Pleuronectes Linnaeus, 1758: 242. [“Soleas: Ed-

wards in Catesby, 1771].

Familia “Ferr’° Batsch, 1788: 485.

Genera (11): Coryphaena Linnaeus, 1758: 242; Esox Linnaeus, 1758: 243; Gasterosteus Linnaeus, 1758: 242; Labrus Linnaeus,

1758: 242: Mullus Linnaeus, 1758: 243; Perca Linnaeus, 1758: 242; Salmo Linnaeus, 1758: 243; Sciaena Linnaeus, 1758:

242; Scomber Linnaeus, 1758: 243; Sparus Linnaeus, 1758: 242; Trigla Linnaeus, 1758: 243.

Familia “BRACTEATI’® Batsch, 1788: 485.

Genera (5): C/upea Linnaeus, 1758: 243; Cyprinus Linnaeus, 1758: 243; Exocoetus Linnaeus, 1758: 243; Mugil Linnaeus, 1758:

243; Polynemus Linnaeus, 1758: 243.

Familia “Nupr’° Batsch, 1788: 485.

Genera (7): Anarhichas Linnaeus, 1758: 242; Blennius Linnaeus, 1758: 242; Cobitis Linnaeus, 1758: 243; Echeneis Linnaeus,

1758: 242; Gadus Linnaeus, 1758: 242; Silurus Linnaeus, 1758: 243; Xiphias Linnaeus, 1758: 242.

Familia “SERPENTINI’° Batsch, 1788: 485.

Genera (4): Ammodytes Linnaeus, 1758: 242; Gymnotus Linnaeus, 1758: 242; Muraena Linnaeus, 1758: 242; Trichiurus Lin-

naeus, 1758: 242.

“Superclassis” CRUSTACEA Batsch, 1788: 84.

Classis INSECTA Batsch, 1788: 89.

Familia “COLEOPTERA’®° Batsch, 1789: 539.

Genera (21): Attelabus Linnaeus, 1758: 342; Buprestis Linnaeus, 1758: 342; Byrrhus Linnaeus, 1766: 537; Cantharis Linnaeus,

1758: 342; Carabus Linnaeus, 1758: 342; Cassida Linnaeus, 1758: 342; Cerambyx Linnaeus, 1758: 342; Chrysomela Lin-

naeus, 1758: 342; Cicindela Linnaeus, 1758: 342; Coccinella Linnaeus, 1758: 342; Curculio Linnaeus, 1758: 342; Dermestes

Linnaeus, 1758: 342; Elater Linnaeus, 1758: 342; Hydrocantharus+ Batsch, 1789: 550; Lampyris Geoffroy, 1762: 165; Mordel-

la Linnaeus, 1758: 342; Necydalis Linnaeus, 1758: 342; Nicrophorus Fabricius, 1775: 71; Scarabaeus Linnaeus, 1758: 342;

Silpha Linnaeus, 1758: 342; Tenebrio Linnaeus, 1758: 342.

Familia “HEM/pPTERA’® Batsch, 1789: 539.

Genera (5): Blatta Linnaeus, 1758: 342; Forficula Linnaeus, 1758: 342; Gryllus Linnaeus, 1758: 342; Meloe Linnaeus, 1758:

342; Staphylinus Linnaeus, 1758: 342.

Familia “NEvRoPTERA’® Batsch, 1789: 539.

Genera (7): Ephemera Linnaeus, 1758: 343; Hemerobius Linnaeus, 1758: 343; Libellula Linnaeus, 1758: 543; Myrmeleon Lin-

naeus, 1767: 539 (as Myrmeleo); Panorpa Linnaeus, 1758: 343; Phryganea Linnaeus, 1758: 343; Raphidia Linnaeus, 1758:

343.

Familia “Hymenoprera’® Batsch, 1789: 540.

Genera (9): Apis Linnaeus, 1758: 343; Chrysis Linnaeus, 1761: xlii; Cynips Linnaeus, 1758: 343; Formica Linnaeus, 1758: 343;

Ichneumon Linnaeus, 1758: 343; Sirex Linnaeus, 1761: xli; Sphex Linnaeus, 1758: 343; Tenthredo Linnaeus, 1758: 343; Ves-

pa Linnaeus, 1758: 343.

Familia “Diprera’® Batsch, 1789: 540.

Genera (10): Asi/us Linnaeus, 1758: 344 (as Asylus); Bombylius Linnaeus, 1758: 344; Conops Linnaeus, 1758: 344; Culex Lin-

naeus, 1758: 344; Empis Linnaeus, 1758: 344; Hippobosca Linnaeus, 1758: 344; Musca Linnaeus, 1758: 344; Oestrus Lin-

naeus, 1758: 344; Tabanus Linnaeus, 1758: 344; Tipula Linnaeus, 1758: 344.

Familia CivicariA Batsch, 1789: 540.

Genera (3): Cimex Linnaeus, 1758: 343; Nepa Linnaeus, 1758: 343; Notonecta Linnaeus, 1758: 343.

Familia CicabiNa Batsch, 1789: 540.

Genera (6): Aphis Linnaeus, 1758: 343; Chermes Linnaeus, 1758: 343; Cicada Linnaeus, 1758: 343; Coccus Linnaeus, 1758:

343; Fulgora Linnaeus, 1766: 538; Thrips Linnaeus, 1758: 343.

Familia “LEPIDOPTERA”? Batsch, 1789: 540.

Genera (10): Alucita Linnaeus, 1758: 496; Bombyx Linnaeus, 1758: 495; Geometra Linnaeus, 1758: 496; Papilio Linnaeus, 1758:

343; Phalaena Linnaeus, 1758: 343; Pyralis Linnaeus, 1758: 496; Sphinx Linnaeus, 1758: 343 (as Sphynx); Tinea Linnaeus,

1758: 496; Tortrix Linnaeus, 1758: 496; Zygaena Fabricius, 1775: 550.

Familia “Hexv4Popa”’”° Batsch, 1789: 540.

Genera (4): Lepisma Linnaeus, 1758: 344; Pediculus Linnaeus, 1758: 344; Podura Linnaeus, 1758: 344; Pulex Linnaeus, 1758:

344.

Familia “PoLypopa”’® Batsch, 1789: 540.

Genera (10): Acarus Linnaeus, 1758: 344; Aranea Linnaeus, 1758: 344; Cancer Linnaeus, 1758: 344; Gammarus Fabricius, 1775:

418; Julus Linnaeus, 1758: 344 (as ulus); Monoculus Linnaeus, 1758: 344; Oniscus Linnaeus, 1758: 344; Phalangium Lin-

naeus, 1758: 344; Scolopendra Linnaeus, 1758: 344; Scorpio Linnaeus, 1758: 344.

Classis VERMES Batsch, 1788: 89.

Familia “/ivrestina’’° Batsch, 1789: 664.

Bonn zoological Bulletin 57 (2): 149-171 ©ZFMK

Family- and class-series nomina in zoology 167

Genera (8): Ascaris Linnaeus, 1758: 644; Cucullanus Miller, 1777: pl. 38 fig. 1-7; Echinorynchus Muller, 1776: 214 (as Echi-

norhynchus),; Gordius Linnaeus, 1758: 644; Hirudo Linnaeus, 1758: 644; Hydatigena Goeze, 1782: 192; Taenia Linnaeus,

1758: 646; Trichuris Roederer, 1761: 243.

Familia “SETIPEDA”° Batsch, 1789: 664.

Genera (4): Aphrodita Linnaeus, 1758: 644; Lumbricus Linnaeus, 1758: 644; Nais Miller, 1771: 6; Nereis Linnaeus, 1758: 644.

Familia “UBERES”° Batsch, 1789: 665.

Genera (6): Argonauta Linnaeus, 1758: 645; Clio Linnaeus, 1767: 1072; Lernaea Linnaeus, 1758: 644; Nautilus Linnaeus, 1758:

645; Scyllaea Linnaeus, 1758: 644; Sepia Linnaeus, 1758: 644.

Familia Limacina Batsch, 1789: 665.

Genera (25): Aplysia Linnaeus, 1767: 1072 (as Laplysia); Buccinum Linnaeus, 1758: 645; Bulla Linnaeus, 1758: 645; Cassis Scopoli,

1777: 393; Chiton Linnaeus, 1758: 645; Conus Linnaeus, 1758: 645; Cylindrus+ Batsch, 1789: 692; Cymbium Mendes da

Costa, 1776: 182; Cypraea Linnaeus, 1758: 645; Doris Linnaeus, 1758: 644; Fasciola Linnaeus, 1758: 644; Haliotis Lin-

naeus, 1758: 645; Helix Linnaeus, 1758: 645; Limax Linnaeus, 1758: 644; Murex Linnaeus, 1758: 645; Nerita Linnaeus,

1758: 645; Orthoceras Bruguiére, 1789: xvi; Patella Linnaeus, 1758: 645; Purpura Bruguiére, 1789: xv; Serpula Linnaeus,

1758: 645; Strombus Linnaeus, 1758: 645; Tethys Linnaeus, 1758: 644; Turbo Linnaeus, 1758: 645; Turris+ Batsch, 1789:

691; Voluta Linnaeus, 1758: 645.

Familia “SyPHoNATA’’° Batsch, 1789: 665.

Genera (17): Anomia Linnaeus, 1758: 645; Arca Linnaeus, 1758: 645; Ascidia Linnaeus, 1767: 1072; Cardium Linnaeus, 1758:

645; Chama Linnaeus, 1758: 645; Mactra Linnaeus, 1767: 1073; Mya Linnaeus, 1758: 670; Mytilus Linnaeus, 1758: 645;

Ostrea Linnaeus, 1758: 645; Pecten Miller, 1776: 248; Perna Philipsson, 1788: 20; Pholas Linnaeus, 1758: 645; Pinna Lin-

naeus, 1758: 645; Solen Linnaeus, 1758: 645; Spondylus Linnaeus, 1758: 645; Te/lina Linnaeus, 1758: 645; Venus Linnaeus,

1758: 645.

Familia “Cris74T4”’° Batsch, 1789: 665.

Genera (6): Actinia Pallas, 1766b: 152; Balanus Mendes da Costa, 1778: 249; Holothuria Linnaeus, 1758: 644; Lepas Linnaeus,

1758: 645; Medusa Linnaeus, 1758: 644; Triton Linnaeus, 1758: 644.

Familia “Crustosa”° Batsch, 1789: 665.

Genera (2): Asterias Linnaeus, 1758: 644; Echinus Linnaeus, 1758: 644.

Familia “FRoNDOSA’’? Batsch, 1789: 665.

Genera (2): Astrophyton Schultze, 1760: 53; Pennatula Linnaeus, 1758: 646.

Familia “Potypina’’® Batsch, 1789: 666.

Genera (10): Alcyonium Linnaeus, 1758: 646; Eschara Linnaeus, 1758: 646; Gorgonia Linnaeus, 1758: 646; Hydra Linnaeus,

1758: 646; Isis Linnaeus, 1758: 646; Madrepora Linnaeus, 1758: 646; Millepora Linnaeus, 1758: 646; Sertularia Linnaeus,

1758: 646; Spongia Linnaeus, 1759: 1317; Tubularia Linnaeus, 1758: 646.

Familia “FyveriATa’’° Batsch, 1789: 666.

Genera (3): Brachyonus Pallas, 1766a: 89; Trichoda Miller, 1773: 71; Vorticella Linnaeus, 1767: 1074.

Familia “CHa4orica’* Batsch, 1789: 666.

Genera (10): Burfaria Miller, 1773: 62; Cercaria Miller, 1773: 64; Cyclidium Miller, 1773: 49; Enchelis Miller, 1773: 33; Go-

nium Miller, 1773: 60; Kolpoda Miller, 1773: 56; Monas Miller, 1773: 25; Paramaecium Miller, 1773: 54; Vibrio Miller,

1773: 39; Volvox Linnaeus, 1758: 646. [Chaos* Linnaeus, 1767: 1074].

Bonn zoological Bulletin 57 (2): 149-171 ©ZFMK

VUOAINAVD “VIIVNNV]A “VLVGNOH)

SANIGALSAL “VdISdOUNVS ‘VLVGNOHD

VHdYOWNOAOVNINY ‘VITVAINVIA, “VLVGXOHD

SAWUOAINOIHLAULS ‘VAISAOUAVS ‘VLVGYOHD

VILNAGOY ‘VIIVAWVIA, “VLVCXOHD

VUOAINAV ‘VITVINNINV]A] “VLIVGNOHD

VILNAGOY ‘VIIVAWVIA, “VLVGNOHD

VIVNOWT1Ndg ‘VdOdOULSV) ‘VOSATIO[L

VHdaYOWODV’T ‘VITVININVIA, “VLVGQdOH)

Alain Dubois & Roger Bour

VUOAINUVD ‘VITVNWVIA, ‘VLVCaXOHD

SAWNUOALOVUOD “VAISdOUNVS ‘VIVAUOHD

VuALdINAH ‘VLOASN] ‘VdOdOUHLYY

VuaLdINaH{ ‘VLOASNY ‘VaGOdOUHLNY

VIALOVGOILYY ‘VITVAWV]] ‘VIVQXOHD

VILNAGOY ‘VITVAWV]A] ‘VIVGYOHD

VUOAINAVD ‘VITVAINV]A] ‘VLVGaYOHD

VSOTIg ‘VIIVANV]A] ‘VLVQaOHD

S8LI ‘Yyosieg gvaisyQ

S8LI ‘YOsweg IVCINIGNLST

QSLI ‘YOsweg IVCId TKI

B8LI ‘Yosieg FVGINOIHINULS

S8LI Yosieg arvariniog

S8LI ‘Yosweg FraITALSAW

S8LI ‘Yosieg arannpy

68L1 “YOseg APGIOVITT

S8LI “Yosieg @raroddT

S8LI “Yyosyeg araITAY

B8LI ‘Yosieg aVAIOKYOD

68L1 “Yosweg FFAIOINID

68LI “Yosieg IralaVIID

S8LI Yosieg grdiAN7D

SBI “Yosieg JVARIOLSVD

S8LI ‘Yosieg FrdINKD

S8LI ‘Yosieg avaidodsarag

TLE ‘LISI “JOYOSIY INISU)

LEv ‘88L1 Yosweg SINIdALSAL

TLE LIST IOYOSIA INTEL

JOP ‘STR ‘SIOSIA, FVCINOIHLNULS

TLE ‘LIST BOYosty mag

ZLE LIST ‘IOyosty INITILSAW

OF “SIT TOSI] KNIZAY

ZO (ORL “oteule’ 7] SYFIOKNIT

TLE (LIST “JOYOSIY INIIOdTT

TLE ‘LIST FOYOsty INITIY

66€ :ST8I “SIOBIA VNFIOFYOD

OFT :ZOST “ANT SIGIOINID

CTH ‘OPI “POOMISSM FVAKILD

PLe ‘O78 ‘SSNIplOH KNIANTD

€€ (OTSI “Yotduiay VNIYOLSKD

TLE ‘LIST AOydsty ININKD

POE FIT8I ‘ABI avaidsarag

LIST *tULoYypleAA op

IOyOSly,, JVGISYA

«88LI ‘YOsieg FVCINIGALSAL

LIST *WHSYpIeAA eP

JoyOSly,, IVCId TKI

LIST *.WULOYpleA\ ep

JOYOSIy,, JVCINOIHLNULS

LIST ‘.WHoypreM op

JOYOsly,, IFAMAIIS

LIST *.WHoypleM op

JOYOSIJ,, FAITALSAP

SIS] TOs] gran

LOST ‘yoreue] avCIOKNIT

LIST *..WuIoUpleM op

JOIST, TVCIMOdTT

LIST *.CuloypleA ep

JOYOSIy,, IVCITI

CTZ8I ‘SIOSIA FVAIOKYOD

TOSI ‘ay[lo-ne] AVGIOINID

OFS I ‘POOMISAM FFAIGKIID

OZ8I “SSIYP[OH avaiuuTD

OZ8I “Youduiay FraIVOLsKD

LIST *.CuloypleA ep

JOyoSty,, JVCINVD

ITS ‘AvIQ avaidodsarag

QSL] ‘sneeuury snsuQ BBL ‘yosyeg FNISUAQ

SSL ‘SnaeuUry opnisal Bgl ‘Yosweg SINIGALST

SSL] ‘snoeuury vdjny QSLT YOsweg FNIdTKT

BSL] ‘snoeuUry O17n.15 B8/ | “YOSIeY SINOIHLAULS

SSL ‘snoeuury snuniog == ST “Yosieg FNIZAIDS

SSLI Yoseg FNITILSAW

S8LI ‘Yosieg FNIZQW

68L1 “YOsyeg PNIOKWIT

SLI ‘sneeuury vjajsnpy

SSL] ‘ShevuuryT snpy

QSL ‘snoeuury xpuT

SSLI ‘snevuury sndaT — gL { “yosIeg VNIYOdTT

S8LI Yosteg rPNITAY

S8LI “Yosieg s7ory0D

68LI Yosweg FrRIFOINID

68LI “Yosreg FNIGKOID

S8LT “Yosieg KNIAYTD

S8LI ‘Yosieg rAYOLSKD

SSL ‘sneeuury] say

SSL] ‘sheeuury sp1on410)

SLI ‘Snovuury xaw1y

SSL] ‘snovuury vppo1g

SCL] ‘snevuury siasay

SCL] ‘snaeuury 1ojspy

QSL ‘snovuuryT sip) S8LI ‘Yyosieg FNINKD

QSL ‘snevuury snddpoig g8/ | ‘yosieg raodsarag

Opso ‘sisseyo ‘unyAyd :exe) JOYysTy PeUONIpPeLL

A]MuUey SI JO UOWIOU pIeA

ATW} SI} 1OJ pasn A][euoMIpe.y

UdWIOU JO WIAUOJOIg

Awe} SITY} 1OF pasn

A]JeuOn pel) USWION

(68L1 ‘88Z1) yos}eg ul

snuasosjonN Suriwodde uawiou Ayrwey

OZFMK

‘(RQQOT SlOgnd) SWeU Sty} JopuN pojId aq prnoys pue ,.JOYOSTy,, MWe a]SuIs ay} Aq pousdis AT[eNjIOw SI WIOYP]eAA YP JOYOSIJ,, 0} JIS UOSTUIOU

-OXxB], OY} Ul poyposd uOneKo[gnd sy “(/PpIM/S1o'erpadryimus//:dyy) erpodryl Ay OS OY} Ul PoZIUBOda1 SsOU} SAIS OM ‘,,YSLIO}Se UL Aq PIYACUI ‘dJIS STU} UL UDATS JOU de dJep pue diys

-IOYyINe YSIYM JOJ suo ATUO 9} IO ‘(/[UAWOUOXe)] UOSTWOUOXe}//:dyY) UOSTWIOUOXRT, SY} JO IIS IY} Ul PAZIUBOIaI dso} 91B SULUNIOS JseT] PUL PITY] OY} UI USATS exe} JOYSIY pue soiql

-WUJ JO PUTWIOU [BUOTIPe.Y sy], “AWOUOXk}00Z UI WY} 0} Popo1d AT[RUOTIPe.Y Sayep PUR SIOYING OY} YIM “(68/T “VSL 1) YOsie Ur o[quyileae opeUl PUILUIOU SdTIds-ATIWIR] OY, *E BTQUL,

168

Bonn zoological Bulletin 57 (2): 149-171

Family- and class-series nomina in zoology 169

APPENDIX 2

THE NOMENCLATURAL STATUS OF A FEW

PROBLEMATIC ZOOLOGICAL NOMINA

THE ZOOLOGICAL NOMINA CREATED IN THE

BOOK OF BEHN (1760)

Klein (1751) published a comprehensive classification of

his “QUADRUPEDIA”, 1.e., roughly, the tetrapods without the

cecilians, snakes, birds and whales. This book in Latin be-

ing pre-1758, the nomina it contains are nomenclaturally

unavailable. Joyce et al. (2004) pointed out the existence

of Behn’s (1760) German translation and adaptation of

Klein’s (1751) book, where all the taxa and nomina of the

latter work are reproduced. These post-1758 nomina

would be available, with the authorship “Klein in Behn,

1760”, if this book had to be considered nomenclatural-

ly available, but it should not. The nomenclatural hierar-

chy used in this book is unclear and inconsistent. It in-

cludes the ranks ordo (Ordnung) and familia (Familie), the

taxa at these ranks being designated by uninomina (nom-

ina consisting of a single term). The ranks used below the

rank Familie are denominated in German Geschlecht, then

Art, then Gattung. Considering their hierarchy and con-

tent, they could be construed to correspond respectively

to the ranks tribe, genus and species, but this would prob-

ably be misleading. Each of these ranks can contain a var-

ious numbers of unnamed subranks, and the number of

terms used to designate taxa is variable, from one to two

and more, some of these nomina being plurinominal di-

agnoses borrowed without change from various pre-1758

works. This work clearly does not comply with the re-

quirement of Article 11.4 of the Code for the availability

of species-, genus- and family-series nomina. However,

this might not preclude considering the class-series nom-

ina in this work, or some of them, as available, since Ar-

ticle 11.4 implicitly states that “this Article does not ap-

ply to the availability of names of taxa above the family

group”.

If it was possible to establish objectively where lays the

separation between the family-series and the class-series

nomenclature in Behn (1760), and if all these nomina were

uninomina, it could be possible to recognize as available

the class-series nomina proposed in this work, but this is

difficult if not impossible.

The nomina of the three orders of “QUADRUPEDIA” rec-

ognized in Behn (1760) are plurinomina, as follows: (O1)

“Pilosa et Ungulata (vivipara) sive “Zaotoxa”’; (O02) “Pi-

losa et Digitata sive sint tota coriacea, sive cataphracta;

omnia vivipara”’; (O03) “Depilata, sive tecta, sive nuda,

nequicquam pilosa, omnia ovipara, sive “Qotoxa”. Such

designations are in fact diagnoses, and cannot qualify as

Bonn zoological Bulletin 57 (2): 149-171

nomina of zoological taxa. They are unavailable in zoo-

logical nomenclature. It can be noted that, in the original

text of Klein (1751), the same taxa were designated by uni-

nomina (“UNGULATA”, “DIGITATA” and “DEPILATA’’), but

as this text is pre-Linnaean, these nomina also are unavail-

able.

In contrast, the nomina of the 13 “families” recognized

by Behn (1760) are all uninomina. They are distributed

as follows in the three orders: (O1) ‘“MONOCHELON”,

“DICHELON”, “TRICHELON”’, ““TETRACHELON” and “PEN-

TACHELON”; (O2) “DIDACTYLON”, “TRIDACTYLON”,

“TETRADACTYLON’, “PENTADACTYLON” and “ANOMALA-

PES” (instead of “ANOMALOPES” in Klein, 1751); (O3)

‘“TESTUDINATA ”, “CATAPHRACTA” and “NUDA”. Except pos-

sibly for one, these nomina are not based on the stems of

included nominal genera. “TESTUDINATA” could be con-

strued to be based on the stem of the only included genus

of the family, Zestudo Linnaeus, 1758, but this is highly

improbable. The other twelve familial nomina are clear-

ly based on characters that are considered diagnostic for

the taxa they designate, and the nomen “TESTUDINATA” can

also be understood as based on the Latin adjective testu-

dinatus, meaning “of turtle, vaulted, arched”. Therefore,

all nomina of “families” in Behn (1760) appear to be arhi-

zonyms. Under the Rules of Dubois (2006a), such nom-

ina cannot be accepted as family-series nomina and qual-

ify as class-series nomina. This case is not unique. Other

examples were discussed by Dubois (2006a, 2009) and

Dubois & Ohler (2009): for example, the nomina of “fam-

ilies” in Ritgen (1828), which are also arhizonyms, must

be treated as available class-series nomina.

However, in the case of the new familial nomina appear-

ing in Behn (1760), difficulties would arise if they were

to be treated as available class-series nomina. In the sys-

tem of Dubois (2006a), the allocation of class-series nom-

ina to taxa is made through their included (conucleogen-

era) and excluded (alienogenera) nominal genera, and to

be usable in this respect, conucleogenera and alienogen-

era must be nomenclaturally available. If all the nomina

of taxa just below the rank family in Behn (1760), desig-

nating taxa of rank “Geschlecht”, were considered to be

genus-series nomina, part of them could not be used for

taxonomic allocation of their nomina, because they are un-

available in Behn’s (1760) work. In his order (O3), cor-

responding to the traditional amphibians and reptiles, on-

ly three generic nomina then available are mentioned as

valid nomina: 7estudo Linnaeus, 1758 for a “Geschlecht”

of his family “TESTUDINATA”; Lacerta Linnaeus, 1758 for

a “Geschlecht” of his family “NupA”; Rana Linnaeus,

1758 for an “Art” of his “Geschlecht” “Batrachus” (then

an unavailable nomen) of his family “NuDA”’; and none

in his family “CATAPHRACTA”. In order to allocate the

nomen “NuDA” to a class-series taxon, one would have

©ZFMK

170 Alain Dubois & Roger Bour

to take an arbitrary decision, considering that either the

rank “Geschlecht” or the rank “Art” corresponds to the

rank genus in the current Code. If the rank “Geschlecht”

was considered to correspond to the rank genus, and “Art”

to the rank species, the nomen “NUDA” would apply, in a

modern classification, to the most inclusive taxon includ-

ing the genus Lacerta and excluding the genus Jestudo.

But if the rank “Geschlecht” was considered to correspond

to the rank tribe, and “Art” to the rank genus, the nomen

“NuDA” would apply, in a modern classification, to the

most inclusive taxon including the genus Rana and exclud-

ing all the mammalian genera, bearing then available Lin-

naean generic nomina, mentioned by Behn (1760) in his

orders (O1) and (O2). Therefore, according to the arbitrary

decision taken, the same nomen could apply to widely dis-

tinct higher taxa.

Because of these uncertainties, many other examples of

which could be given, we here argue that Behn’s (1760)

should not be considered as an available work in zoolog-

ical nomenclature, even for class-series nomina. We sug-

gest that this book should be invalidated as a whole by

the ICZN, and that all the new nomina it contains should

be considered unavailable in zoological nomenclature.

*Marsupiale” Edwards in Catesby, 1771

According to Sherborn (1902: 593), there exists a genus

Marsupiale, based on the following reference: “G. Ed-

wards in M. Catesby, Carol. I. 1771, xxix”. Actually this

refers to Catesby (177 1a: xxix), in “An account...” added

by George Edwards, where the binomen Marsupiale amer-

icanum appears, with a diagnosis. However, this item fol-

lows another one entitled Vulpi affinis americana and

many others where the nomenclature is not consistently

binominal. Consequently the ICZN (Anonymous 1954)

has suppressed the whole work (Catesby 1771a-b) for

nomenclatural purposes, except for the nomina employed

by Edwards in accordance with the Linnean system in his

“Catalogue of the Animals and Plants” (i.e., Catesby

1771a: 1-2, 1771b: 1-2), usually referred as George Ed-

wards’ “Appendix”.

“Solea” Edwards in Catesby, 1771

According to Sherborn (1902: 593), there exists a genus

Solea, based on the following reference: “G. Edwards in

M. Catesby, Carol. II. 1771, 27”. Actually this refers to

Catesby (1771b: 27), where appears the combination Solea

lunata et punctata, with a diagnosis and a plate; howev-

er, this is not a binomen, and therefore it has no status in

nomenclature. The ICZN (Anonymous 1954) has sup-

pressed the whole work (Catesby 1771a-b) for nomenclat-

Bonn zoological Bulletin 57 (2): 149-171

ural purposes, except for the nomina employed by Ed-

wards in accordance with the Linnean system in his “Cat-

alogue of the Animals and Plants” (i.e., Catesby 1771a:

1-2, 1771b: 1-2), usually referred as George Edwards’

“Appendix”. Edwards (in Catesby 1771b: 1) linked this

description with the binomen Pleuronectes lunatus Lin-

naeus, 1758.

“Gralla” Eberling in Sonnerat, 1777

According to Sherborn (1902: 431), there exists a genus

Gralla, based on the following reference: “J. P. Ebeling

in Sonnerat, Reise Neuguinea, 1777, 31”. Actually this

refers to Sonnerat (1777: 31 [and 45]), where appears the

combinations gralla parra and gralla fulica. Wieland

(2010) admitted the nomenclatural availability of both,

which he treated as binomina, and also of the genus Gral-

la Sonnerat, 1777, but with this comment: “The basic da-

ta of this taxon were not entered consulting the original

description, but from secondary sources”. On the other

hand, The Richmond Index, published by the Division of

Birds at the National Museum of Natural History, Wash-

ington, D.C (Anonymous 2010), states that Gralla Ebel-

ing in Sonnerat is not nomenclaturally a valid generic

name: “Gralla fulica p. 45; Gralla parra p. 31, Ebeling, in

Sonnerat, Reise Neu Guinea, 1777. These have no stand-

ing! being simply Ebeling ’s way of writing Order Gral-

le, Genus Fulica + Parra/!’’. Actually Ebeling (in Son-

nerat 1777) put a capital at the start of the generic name

of his binomina, but neither at gralla parra nor at gralla

fulica. We follow here The Richmond Index statement and

do not recognize the nominal genus “Gralla Ebeling in

Sonnerat, 1777”.

Cylindrus Batsch, 1789: 692

Three homonymous nominal genera Cylindrus are avail-

able in zoological nomenclature: Cylindrus Batsch, 1789:

692; Cylindrus Deshayes, 1824: 236; and Cylindrus

Fitzinger, 1833: 107.

Cylindrus Batsch, 1789 has apparently been ignored by

all authors until now. It was introduced with a diagnosis

that makes it nomenclaturally available and that clearly

points to marine cone shells.

Cylindrus Deshayes, 1824 is an autoneonym* (unjustified

emendation) of Cylinder Denys de Montfort, 1810: 390,

a nomen established for a genus of marine cone shells. Its

nucleospecies* (type-species) is Conus textile Linnaeus,

1758: 717, by original designation. The original nomen

of this genus was preceded in zoological nomenclature by

Cylinder Voet, 1793 and Cylinder Voet, 1806, but both

©ZFMK

Family- and class-series nomina in zoology 171

these nomina are unavailable, as published in books that

are not consistently binominal. Strangely enough howe-

ver, the nomen Cylinder Denys de Montfort, 1810 is cur-

rently not considered valid, but its autoneonym Cylindrus

Deshayes, 1824 is so, being currently treated as a subge-

nus of the genus Conus Linnaeus, 1758 (e.g., Keen 1971;

Pitt et al. 1986).

Cylindrus Fitzinger, 1833 was established with a single

valid species included, Pupa obtusa Draparnaud, 1805: 63,

which is therefore its nucleospecies by original specific

monophory* (monotypy). This generic nomen is current-

ly (e.g., Frank 2006) considered valid for a genus of ter-

restrial snails.

The current nomenclatural situation concerning the use of

the term Cylindrus in zoological nomenclature is not com-

pliant with the Rules of the Code, for two distinct reasons:

(R1) the autoneonym Cylindrus Deshayes, 1824 of Cylin-

der Denys de Montfort, 1810 is considered valid instead

of its archaeonym*, although the latter should be so, not

being preoccupied by an available homonymous generic

nomen; (R2) two homonymous genus-series nomina, Cy-

lindrus Deshayes, 1824 and Cylindrus Fitzinger, 1833, are

currently both considered valid in zoology, although the

second one, being a junior homonym of the former, should

be considered invalid (even if the former one was not so).

The two nomina are listed as valid in several current on-

line databases, but apparently never in the same one: Cy-

lindrus Deshayes, 1824 appears as the valid nomen of a

subgenus of Conus Linnaeus, 1758 in the databases Ca-

talogue of recent and fossil Conus (Alan J. Kohn)

[http://biology.burke.washington.edu/conus/recordview/sp

ecieslist P.html], The sea shells (Nauka Bulgarie)

[http://theseashells.nauka.bg/Conus_Cylindrus_ textile tex

tile-html] and Hardy’s Internet Guide to marine Gastro-

pods (Eddie Hardy) [http://jeh-temp.co.uk/Taxon_pages

/Family CONIDAE CONINAE.shtml], whereas Cylin-

drus Fitzinger, 1833 appears as the valid nomen of a ge-

nus of terrestrial snails in the databases Molluscs of cen-

tral Europe (Dr. Vollrath Wiese, Cismar, D-23743 Gro-

mitz-Cismar) |http://www.mollbase.de/list/liste.php], Ani-

malbase Goettingen [http://www.animalbase.uni-goettin-

gen.de/zooweb/servlet/AnimalBase/search] and Biolib.cz

[http://www.biolib.cz/en/taxon/1d18384].

The rediscovery of the nomen Cylindrus Batsch, 1789,

created for a genus of marine cone shells, allows to cla-

rify this nomenclatural situation. We hereby designate

Conus textile Linnaeus, 1758 as its nucleospecies (type-

species). The nomen Cylindrus Batsch, 1789 therefore re-

places both Cylinder Denys de Montfort, 1810 and Cy-

lindrus Deshayes, 1824 as the valid nomen of the subge-

nus of Conus Linnaeus, 1758 including the latter species.

As for Cylindrus Fitzinger, 1833, it is an invalid junior ho-

Bonn zoological Bulletin 57 (2): 149-171

monym of both Cylindrus Batsch, 1789 and Cylindrus

Deshayes, 1824 and it must be abandoned.

The homonymy between Cylindrus Deshayes, 1824 and

Cylindrus Fitzinger, 1833 was pointed out by Kennard

(1942), in a work that seems to have been overlooked by

most subsequent authors. This author rightly concluded

that the nomen Cy/indrus Fitzinger, 1833 is invalid, and

pointed to the existence of its senior objective synonym

Cochlopupa Jan, 1830: 5. The nucleospecies of this no-

minal genus is Pupa obtusa Draparnaud 1805 by original

specific monophory. The single species currently referred

to the genus Cylindrus Fitzinger, 1833 and known as Cy-

lindrus obtusus, must therefore bear the nomen Cochlo-

pupa obtusa (Draparnaud, 1805).

Hydrocantharus Batsch, 1789: 550

The nomen Hydrocantharus Batsch, 1789, created for an

aquatic beetle (dytiscid) is identical to several pre-1758

uses of the same nomen, which are nomenclaturally una-

vailable. For the same genus, Linnaeus (1758: 342) used

the nomen Dytiscus. In this genus, he listed (p. 411-413)

15 nominal species, among which Latreille (1810: 426)

designated Dytiscus marginalis Linnaeus, 1758: 411 as nu-

cleospecies. We hereby designate the same nominal spe-

cies as nucleospecies (type-species) of Hydrocantharus

Batsch, 1789, which therefore becomes an invalid junior

objective synonym of Dytiscus Linnaeus, 1758.

Turris Batsch, 1789: 691

A generic nomen Jurris was created for a gastropod ge-

nus by Statius Miller (1766: 129), but this nomen is una-

vailable as having been published in a book invalidated

by the ICZN (Anonymous 1964) as not applying the prin-

ciple of binominal nomenclature. A homonymous nomen

Turris was later created by R6ding (1798: 123) also for a

gastropod genus, and this nomen is currently considered

valid. However, the present rediscovery of Zurris Batsch,

1789 makes Turris Roding, 1798 its invalid junior syno-

nym.

As reckoned by Winckworth (1945), the nucleospecies of

Turris Roding, 1798 is Murex babylonius Linnaeus, 1758:

753, by subsequent designation of Bucquoy et al. (1883:

86). In order not to upset nomenclatural stability, we he-

reby designate Murex babylonius Linnaeus, 1758 as nu-

cleospecies (type-species) of Turris Batsch, 1789. The lat-

ter must now replace its junior objective synonym Turris

Roding, 1798 as the valid nomen of the genus.

©OZFMK

i aang iain, rare -

. - —s eae =

ae = act snittiia dander

et, - =r Poe

lel Pa ial > oi pulp od aan

ss 1) one Pipi toceide ulin

| ;

Hl x0 7 i

| H

| | { t fi

| ,

|| ‘vai

if ;

= iiwen won

Teaie! on « ‘xy i

» Leh phim eee a

7 ‘ion

| oii

| aS

| 4

a iG 4 he yale ' hee ee rae et

- KF ; 7 weri¢ ri) te a pili ian ety

r mele Tgeltatiey MOR,

ee fe " ier H4toxnaal

rie hi

Bonn zoological Bulletin | Volume 57 | Issue 2 pp. 173-176

Bonn, November 2010

An addition to the East African herpetofauna: the first record of

Tarentola annularis relicta (Squamata: Gekkonidae) in Uganda

Miloslav Jirkt!, Andrei Daniel Mihalca?, Petr Necas} & David Modry!4

| Biology Centre, Academy of Sciences of the Czech Republic, Ceské Budéjovice, Czech Republic

2 University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca, Romania

3 SvinoSsice, Czech Republic

4 University of Veterinary and Pharmaceutical Sciences, Brno Czech Republic

Abstract. This is the first record of a member of the genus Zarentola from Uganda. Population of Zarentola annularis

relicta was found in Ubbi village on the South-Western foot of Mt. Otzi in northern Uganda, close to the border with Su-

dan. Brief comments on extraordinary biogeographical affinities of the area and characterization of the Mt. Otzi envi-

ronments are provided.

Key words: Zarentola, Uganda, East Africa, Mt. Otzi, new geographic record.

INTRODUCTION

In their account of the East African reptiles, Spawls et al.

(2004) listed 55 species of geckoes in 11 genera for East

Africa including Tanzania, Kenya, Uganda, Rwanda and

Burundi. Although biogeographically, the East African

realm includes also parts of South Sudan and Ethiopia, we

follow the above mentioned political delimitation of East

Africa used throughout literature for practical reasons.

During a short survey of the Mt. Otzi area in the very

North of Uganda on 9.X.2006, we collected specimens of

geckoes, that did not match any known East African genus.

Specimens were collected on buildings of the village

school in Ubbi, a small settlement at the South-Western

foot of Mt. Otzi. Upon collection, the animals were pho-

tographed and released at the original collection site.

The Ubbi village (03°35’07”N, 31°49°42”E, elevation of

690 m a.s.1.) is surrounded by a mosaic of farmland, small

rocky hillocks covered by bushy vegetation and numer-

ous rocky outcrops devoid of vegetation (Fig. 1a). The area

is situated in the Southern Sudanian savanna zone, the nat-

ural vegetation of which is mostly tree and shrub moist

savanna. The dominant geomorphological feature of the

area is the Mt. Otzi massif steeply rising above surround-

ing landscape. The Mt. Otzi located on the Western bank

of the Nile River has an undulating top plateau with

Bonn zoological Bulletin 57 (2): 173-176

several emergent rocky peaks reaching a maximum ele-

vation of 1565 m. Its slopes are covered by bush, while

its upper parts are covered by a mosaic of highland bush,

moist forest and farmland (Fig. 1b). The remaining for-

est patches are mostly degraded by logging and clearing

for agriculture and thus characterized by relatively open

canopy (Fig. 1c). The area south of the Mt. Otzi is dom-

inated by palm- and other moist-savanna types (Fig. Id).

Tarentola specimens

The geckoes were assigned to the genus 7arentola accord-

ing to absence of claws on digits 1, 2 and 5 and presence

of claws on digits 3 and 4 (as seen in Figs 2a—b). The on-

ly Tarentola species occurring thus far in the South-East

of the genus range is Zarentola annularis (Geoffroy, 1809),

in which two subspecies are recognized (Joger 1984). The

nominotypic Zarentola annularis annularis (Geoffroy,

1809) occurs throughout the Saharan region, whereas Tar-

entola annularis relicta Joger, 1984 is known only from

two disjunct areas — the Nile valley in the very south of

Sudan and Mora in the North Cameroon south of the Lake

Chad. Two confirmed Sudan localities include Juba (type

locality of the subspecies) and Nimule (Joger 1984).

©ZFMK

174 Miloslav Jirkt et al.

Fig. 1. | Landscape and vegetation of the Mt. Otzi and adjacent areas. Fig. la. Rocky outcrops in Ubbi village on the foot of Mt.

Otzi. Photograph A. D. Mihalca. Fig. 1b. Forest patch on the Mt. Otzi top plateau with an emergent rocky peak in the background.

Photograph M. Jirkt. Fig. le. Interior of the Mt. Otzi forest showing relatively open canopy and distinct Afromontane floristic el-

ement, the false banana of the genus Ensete in the foreground. Photograph M. Jirku. Fig. 1d. Palm savanna south of the Mt. Otzi

region in the Murchinson Falls NP, Uganda. Photograph M. Jirkd.

Bonn zoological Bulletin 57 (2): 173-176 ©ZFMK

First record of Zarentola from Uganda 175

Fig. 2. Zarentola annularis. Fig. 2a. Adult specimen of Zarentola annularis relicta from Ubbi, Uganda. Photograph D. Modry.

Fig. 2b. Close-up of adult specimen of Zarentola annularis relicta from Ubbi, Uganda. Note the bright red trombiculid mites lo-

calized mainly around eye. Photograph D. Modry. Fig. 2c. Adult specimen of Zarentola annularis annularis from Awash NP, Ethiopia.

Note the four distinct white, dark-rimmed scapular flecks. Photograph P. Necas.

Apart from details in scaling patterns, 7! a. relicta can be

readily distinguished visually by an absence of four white,

dark-rimmed scapular flecks typical for the nominotypic

subspecies (compare Figs 2a—b with Fig. 2c). Based on

Bonn zoological Bulletin 57 (2): 173-176

coloration pattern, the specimens we collected in Ugan-

da can be assigned to the subspecies T. a. relicta. All ob-

served specimens were pale-grey colored with orange to

orange-brown blotches on dorsum of the head and body

©ZFMK

176 Miloslav Jirkt et al.

with intervening irregularly distributed faint whitish flecks

devoid of any dark margin, whereas the tail possessed just

faint grayish transversal bands (Figs 2a—b). As far as we

are aware, the Figs 2a—b are the first published color pho-

tographs of live 7! a. relicta.

BIOGEOGRAPHICAL CONSEQUENCES

To our best knowledge, the presented record of Zarento-

la in Uganda is the first record of the genus in the East

African region as defined above. The genus Zarentola

comprises 20 species distributed throughout the dry re-

gions of the Mediterranean, Middle East, some Atlantic

archipelagos (e.g. Canary and Cape Verde Islands) and

African mainland north of the savanna and forest zones

(see Joger 1984 for review). Three additional species are

known from the West Indies (Diaz & Hedges 2008, Joger

1984). The African-mainland part of the genus geograph-

ic range, 1.e. Saharan region, comprises a total of six

species (including Tarentola chazaliae, still treated by

some authors as the only representative of the monotyp-

ic genus Geckonia — see Carranza et al. 2002) the spe-

ciation of which seems to reflect the relatively recent arid-

ification of the Sahara desert region, which was gradual-

ly colonized from its rather mesic margins by ancestors

of extant species since mid Oligocene. In general, the

southern distribution limit of Zarentola spp. in African

mainland is delimited by an interference zone between the

southern margin of the arid Sahel belt and moist savanna

and forest equatorial zones.

To date, the southernmost confirmed locality of Tarento-

la has been the record of 7 a. relicta from Nimule

(03°35733”N, 32°04’14”E), on the Sudanian side of the

Sudan-Uganda border. The southern records of T a. re-

licta in Sudan and Uganda document an intrusion of Sa-

haran faunistic element into the relatively humid equato-

rial region which is dominated by moist savanna approx-

imately from 9°30’N southwards. Presence of the reptile

species associated with arid habitats here, deep in the sa-

vanna zone might be facilitated by a presence of an ex-

tensive network of huge rocky outcrops and ridges follow-

ing Aswa fault, which extend into this region from far

north-west and of which the Mt. Otzi is a magnificent

southernmost outpost. It is possible, that these exposed

rocky formations, largely devoid of vegetation, might

serve as refuges for Saharan taxa that normally would not

occur thus far south in the otherwise relatively humid re-

gion. Farther to the south from the Mt. Otzi region, the

landscape is dominated by gently undulating plains cov-

ered by various moist-savanna types (Fig. 1d) where pres-

ence of Zarentola seems unlikely due to lack of suitable

habitats.

Bonn zoological Bulletin 57 (2): 173-176

Interestingly, the Mt. Otzi region is the easternmost known

locality of a remarkable West-African savanna element,

the ball python Python regius, which was collected in the

vicinity of Moyo (3°39°14"N, 31°43°22”E), just 13 km

to the north-west from the Ubbi village reported here to

be (together with Nimule) the southernmost locality of

Tarentola.

Apart from the two outstanding herpeto-faunistic ele-

ments, P. regius and T! a. relicta, representatives of the

West African and Saharan realm(s) respectively, the re-

gion is mostly inhabited by East-African herpetofauna as

reflected by distribution maps provided by Spawls et al.

(2004). In addition, there is a relict population of eastern

chimpanzee Pan troglodytes schweinfurthii on the Mt.

Otzi (Caldecott & Miles 2005), which together with

colobus monkey Colobus guereza (pers. obs.) in the Otzi

forest show clear faunistic affinity to the Guineo-Congo-

lian rainforest block. Finally, a presence of false bananas

of the genus Ensete (pers. obs., Fig. 1c) in the Otzi for-

est suggests also presence of Afromontane elements in the

area. In conclusion, the Mt. Otzi region deserves further

attention as a potential biogeographical match point, where

East- and West-African (savanna), Saharan (desert), Cen-

tral-African (forest-savanna) and possibly Afromontane

biotas meet at one place.

Acknowledgements. We are grateful to the local people of the

Mt. Otzi region, the Ubbi village in particular. Philipp Wagner

and Colin McCarthy of the Zoologisches Forschungsmuseum

Alexander Koenig, Bonn (Germany) and the Natural History

Museum London (UK) respectively, helped us with confirma-

tion of the Zarentola locality records mentioned in the paper.

REFERENCES

Caldecott, J. & Miles, L. (eds.). 2005. World Atlas of Great Apes

and their Conservation. University of California Press,

Berkeley, 404 pp.

Carranza, S., Arnold, E. N., Mateo, J. A. & Geniez, P. 2002.

Relationships and evolution of the North African geckos,

Geckonia and Tarentola (Reptilia: Gekkonidae), based on

mitochondrial and nuclear DNA sequences. Molecular

Phylogenetics and Evolution 23: 244-256

Diaz, L. M. & Hedges, S. B. 2008. A new gecko of the genus

Tarentola (Squamata: Gekkonidae) from Eastern Cuba.

Zootaxa 1743: 43-52

Joger, U. 1984. Taxonomische Revision der Gattung Tarentola

(Reptilia: Gekkonidae). Bonner zoologische Beitrage 35:

129-174

Spawls, S., Howell, K., Drewes, R. & Ashe, J. 2004. A field guide

to the reptiles of East Africa. A & C Black Publishers Ltd.,

London, 72 pp.

Received: 30.V1.2010

Accepted: 24. VIII.2010

©ZFMK

Bonn zoological Bulletin Volume 57

Issue 2

pp. 177-188 Bonn, November 2010

The taxonomic status of Hyperolius spatzi Ahi, 1931 and

HAyperolius nitidulus Peters, 1875

(Amphibia: Anura: Hyperoliidae)*

Mark-Oliver Rodel!, Laura Sandberger!, Johannes Penner!, Youssouph Mané? & Annika Hillers!3

! Museum ftir Naturkunde, Leibniz Institute for Research on Evolution and Biodiversity at the Humboldt

University Berlin, Invalidenstrasse 43, D-10115 Berlin, Germany;

E-mail: mo.roedel@mfn-berlin.de; Phone: +49 (0)30 20938571

2 Institut de Recherche pour le Dévelopement, Dakar, Senegal

3 Across the River Project, Royal Society for the Protection of Birds, 164 Dama Road, Kenema, Sierra Leone

* this paper is dedicated to Prof. Dr. Wolfgang BoOhme, who’s 1978 paper on the herpetology of Senegal

induced our investigations presented herein.

Abstract. We herein re-investigate the taxonomic status of Hyperolius nitidulus Peters, 1875 and H. spatzi Ahl, 1931 by

means of morphology, vocalization and genetic data. Both taxa are morphologically distinct, have different advertise-

ment calls and differ genetically from each other by 5.1—5.6% sequence divergence in the investigated 16S rRNA gene.

Based on these data we resurrect H. spatzi as a valid species and designate a lectotype for it. Both species occur in sa-

vannas of western Africa. Hyperolius spatzi is restricted to Senegambia and thus far known from Senegal and The Gam-

bia. Its occurrence in Guinea Bissau and southern Mauritania seems likely. Hyperolius nitidulus ranges from Guinea and

Mali eastwards into Nigeria and Cameroon. Records from the driest savannas in north-eastern Nigerian, Cameroon and

the Central African Republic are doubtful and may actually refer to H. pallidus Mertens, 1940.

Key Words. Bioacoustics, biogeography, genetics, morphology, savanna, West Africa.

INTRODUCTION

Many species of the diverse African reedfrog genus Hy-

perolius Rapp, 1842 exhibit very variable color patterns

(Schigtz 1971, 1975, 1999). Some of these color variations

are age and sex specific (Schiotz 1967, Veith et al. 2009).

As these frogs offer comparatively few other species spe-

cific morphological characters, this variability caused con-

siderable taxonomic confusion in the past and resulted in

the description of many taxa which are now regarded as

synonyms (Frost 2010). One author in particular, Ernst

Ahl, contributed to this chaos by describing many new

species (e.g. Ah] 1931a, b), most of which proved to be

invalid (Laurent 1961, Frost 2010). As the in-depth stud-

ies of Schiotz (1967, 1971, 1975) and others have shown,

color and advertisement calls are the most reliable char-

acters for identification of these species. Unfortunately, al-

cohol preserved Hypervolius specimens quickly loose col-

or (and do not call). Therefore it is often difficult, if not

impossible, to evaluate the status of older museum vouch-

ers. Reliable locality data may be of help in some cases

where taxa show allopatric distributions and/or different

habitat requirements.

Bonn zoological Bulletin 57 (2): 177-188

One group of savanna dwelling reedfrogs proved to be es-

pecially variable and consequently taxonomically compli-

cated: the Hyperolius marmoratus/viridiflavus complex

(Laurent 1951b, c, 1981; Schiotz 1971, 1999). These

amazing reedfrogs have an outstanding natural history

with annual population cycles and spectacular behavioral

(Grafe et al. 2002), morphological and physiological adap-

tations, and altogether a unique life history strategy to sur-

vive the harsh and long dry seasons (Spieler 1997; Lin-

senmair 1998; Lampert & Linsenmair 2002 and literature

cited therein). So far, they are the only tetrapods where

sex change has been documented (Grafe & Linsenmair

1989; for literary use of this knowledge see Crichton

1991). To date, Laurent (195la, 1976, 1983) and Schietz

(1971) undertook the most detailed morphological ap-

proach to disentangle the nomenclatory chaos of these

widespread savanna dwelling frogs, which all share a sim-

ilar morphology (short snout, very large vocal sac in

males, transversal gular fold in females, extensive web-

bing) and call (xylophone like metallic calls; for summa-

ry see Schiovtz 1971, 1999).

©ZFMK

178 Mark-Oliver Rédel et al.

However, the mentioned studies of these frogs, using col-

oration and acoustics, did not provide much insight into

their actual taxonomic status (see review by Wieczorek

et al. 1998). Only more recently Wieczorek & Channing

(1997) and Wieczorek et al. (2000, 2001) started to apply

molecular techniques to disentangle the taxonomic chaos.

In the course of their work in particular one member of

the H. viridiflavus-complex/superspecies/species-group,

Fig. 1.

Bonn zoological Bulletin 57 (2): 177-188

H. nitidulus Peters, 1875, was acknowledged species sta-

tus, a decision previously already applied for mostly prag-

matic reasons by e.g. Schietz (1967), Drewes (1984) and

Rédel (1996, 2000). This widespread West African savan-

na frog was described by Peters (1875) from “Yoruba (La-

gos)”, Nigeria. It was treated as a synonym of H. mar-

moratus by Boulenger (1882), as a synonym of H. pic-

turatus by Loveridge (1955) and as synonym or subspecies

Life coloration of Hyperolius spatzi and H. nitidulus; upper left: calling H. spatzi male from Sabodala, Senegal, remark

uniform yellow color at night; lower left: daytime coloration of H. spatzi from Sabodala, Senegal, with numerous minute black

points; upper right: calling H. nitidulus male from Pendjari National Park, northern Benin, remark dark lateral band; lower right:

H. nitidulus couple from Lamto reserve, Ivory Coast, remark almost uniform yellow color of male and grey mottling on legs and

on the flanks in the female.

©ZFMK

Taxonomy of West African Hyperolius

179

Table 1. Morphological differences between Hyperolius nitidulus and H. spatzi based on data provided in the original descrip-

tions and comments based on type specimens and additional material examined herein. Comments which are already deducible

from types only, are given in italic.

Characters H. nitidulus H. spatzi Comments based on types and additional material

Choanae large, not hidden small, hidden below similar sized and well visible in both species

beneath edge of mandible edge of mandible

Tongue large, broad and unusually small tongue in head width spatzi: 3.3 times;

Snout (dorsal view)

Snout (lateral view)

Position of narins

Position of heals

heart-shaped

roundish pointed

flattened or

roundish truncate

slightly closer to

snout-tip than to eye

cover Or Surpass

rounded

truncated

in mid distance

between eye and

snout-tip

in contact

when hind legs arranged to — each other

body at right angles

Dorsal skin skin smooth, laterally thick,

smooth or

with small warts

almost leathery,

rough, beset with

nitidulus: 1.7 times

truncated in dorsal and lateral view in juveniles,

a bit more rounded in adults of both taxa

truncated in dorsal and lateral view in juveniles,

a bit more rounded in adults of both taxa

in both species narins closer to snout-tip

than to eye

surpass each other in both taxa

both taxa with rough skinned juveniles in

dry season and smooth skinned adults

in wet season

many small smooth

or rough warts

Male gular flap absent

Dorsal color yellow often with dark

indistinct

chalk white or fine

present in both taxa

H. spatzi with white, brown or yellow back,

spots on back speckled with regularly beset with small black spots;

dark-brown H. nitidulus never with such uniform pattern of

black spots

Pattern on flanks dark canthal and lateral No pattern in H. spatzi like on back; H. nitidulus with very

stripe (continuous or distinct to rather indistinct black lateral band and

broken), bordered white dark spots

dorsally; below the

stripe flanks marbled in

dark grey and white

Body-length 28 mm 21mm adults of both species up to about 30 mm

of Hyperolius viridiflavus by many other authors (e.g. Lau-

rent 195la, c, 1961; Schigtz 1971). The latter author al-

so treated frogs described as Hyperolius spatzi Ahl, 1931

from Bakel-Kidira, Senegal (Ahl 1931a, b) as either be-

longing to H. nitidulus (Schietz 1967) or as a “subspecies”

of H. viridiflavus (Schietz 1971). In his book, Schietz

(1999) used the name “spatzi” as a vernacular name, de-

scribing “H. viridiflavus” populations of uncertain taxo-

nomic status from Senegambia, whereas Rédel (2000)

considered H. spatzi to represent a junior synonym of H.

Bonn zoological Bulletin 57 (2): 177-188

nitidulus. However, already in the late seventies, Bohme

(1978) revived the name H. spatzi for reedfrogs from

Senegal, thus emphasizing their distinctiveness from oth-

er West African savanna populations. Recently Emms et

al. (2006) adopted this view and reported H. spatzi from

Gambia. Our recent studies of many Hyperolius popula-

tions at various West African savanna localities are the ba-

sis of a taxonomic reinvestigation of both taxa presented

herein.

OZFMK

180 Mark-Oliver Rodel et al.

Fig. 2.

olius nitidulus (ZMB 7729, holotype, adult female) and right:

H. spatzi (ZMB 32602, lectotype, subadult male).

Dorsal and ventral views of the types of left: Hyper-

MATERIAL & METHODS

Morphological measurements were taken with a dial

caliper (+ 0.1 mm) and are given in millimeters. Webbing

formulae follow the scheme of Rédel (2000). Museum

vouchers originated from the Staatliches Museum fir

Naturkunde Stuttgart (SMNS) and the Museum fiir

Naturkunde Berlin (ZMB; Appendix 2). Calls were record-

ed with a Sony WM-D6C tape recorder and a direction-

al microphone (Sony ECM-Z157 and Sony ECU-959C9)

or an EDIROL R-09 24bit digital recorder (sample rate:

44.1 kHz, record mode: wav_24bit, microphone ECM-

950). These calls were analyzed with the program Avisoft

SAS Lab Pro 4.5 (R. Specht, Berlin, Germany). For se-

quence comparisons, we analyzed 247 base pairs (bp) of

the mitochondrial 16S ribosomal RNA gene from Hyper-

olius spatzi (ZMB 74280, GenBank HQ113098; Senegal,

Sabodala) and Hyperolius nitidulus (ZMB 74884, Gen-

Bonn zoological Bulletin 57 (2): 177-188

Bank HQ113099, Sierra Leone, Tingi Hills; no voucher,

GenBank HQ113100, Ivory Coast, Mont Sangbé Nation-

al Park, tissue without voucher). Further hyperoliid gene

sequences were obtained from GenBank (Tab. 1). DNA

extraction, amplification and sequence alignment followed

the procedures as described in Rédel et al. (2009). Uncor-

rected pairwise sequence divergence was calculated us-

ing PAUP*4b10 (Swofford 2002).

RESULTS & DISCUSSION

Morphological comparison. A major problem in using

external morphological characters for determination of

these frogs is their polymorphism. Schigtz’s (1963, 1967,

1971) described distinct color phases for many Hyperolius

species, i.e. called F or A and J or B, respectively. The

phase F/A of H. nitidulus/spatzi refers to the adult/wet sea-

son pattern, whereas phase J/B is the juvenile or sub-adult

dry season pattern. Young frogs in dry season condition

have a rough, warty dorsal skin which is brown below

35°C and chalk white above this temperature (see figs. in

Spieler 1997 and Rédel 2000). Adult frogs have smooth

skin and a completely different dorsal color pattern (Fig.

1). These morphological differences are part of the amaz-

ing aestivation strategy of these frogs (see Linsenmair

1998; Rédel 2000 and literature cited therein).

According to the descriptions by Ahl (1931b) differences

between Hyperolius nitidulus and H. spatzi would be those

summarized in Tab. 1 (compare also translations of the

original descriptions provided in Appendix 1). Major dif-

ferences between the descriptions of H. nitidulus and H.

spatzi consist in the fact that the description of the for-

mer is based on an adult female, whereas the description

of the latter is based on a series of subadult frogs in dry

season condition (Fig. 2).

Schiotz (1967, 1971, 1999) mentioned differences be-

tween various West African H. nitidulus populations, in-

cluding a cline in pattern from Sierra Leone (few and small

spots on flanks) to Cameroon (broad lateral band; same

cline in pattern on the lower legs). He also observed an

hour-glass pattern and a dark vocal sac in frogs from Sier-

ra Leone (likewise present in some juveniles in northern

Ivory Coast, see Rédel 2000). Our specimens from Sier-

ra Leone neither differed in coloration nor in genetics (see

below) from e.g. H. nitidulus populations from northern

Ivory Coast. Schietz (1971) further mentions that frogs

from drier northern savannas are more uniform grayish

colored, whereas more southern ones, 1.e. from the humid

savanna types, exhibit a distinct pattern. The latter differ-

ences might be related to age. R6del (2000) reported that

older specimens are more distinctly colored. As adult H.

nitidulus are unable to survive the dry season, all popu-

©ZFMK

Taxonomy of West African Hyperolius 181

H. spaizi

H._ nitidulus

Frequency (kHz)

Fig. 3.

Waveforms, spectrograms and energy plots of the advertisement calls of Hyperolius spatzi (above) and H. nitidulus (be-

low; compare Tab. 2). The Hyperolius spatzi male from Sabodala, Senegal, was recorded in a terrarium. The Hyperolius nitidulus

was recorded at a savanna pond in Comoé National Park, Ivory Coast. The background noise is a chorus of other H. nitidulus males.

lations are annual (Linsenmair 1998). In more humid sa-

vannas, the wet season lasts longer and frogs may reach

older ages (and thus potentially a more colorful pattern).

Almost all anatomical differences (position and size of

choanae, position of narins, size, shape, length of extrem-

ities, head width) deducible from Ahl’s (193 1a, b) descrip-

tions (compare Tab. 1) are identical among both taxa (for

specimens investigated see Appendix 2). Both species

have very short, rounded snouts, females posses a typical

gular fold and males have very large vocal sacs with a

large but diffuse whitish yellow gular flap (gland). Juve-

niles are often almost indistinguishable. Hyperolius nitidu-

lus juveniles show clear dorsolateral bands or an hour-

glass pattern shortly after metamorphoses (see figs. in

Rédel 2000). In dry season conditions they are uniform

Bonn zoological Bulletin 57 (2): 177-188

brown or white. Juvenile H. spatzi in dry season condi-

tions are white with many small black dots, the latter

sometimes being indistinct. In contrast, adult frogs are dis-

tinctively colored. The dorsal surfaces of H. spatzi are

chalk-white to yellow, densely beset with tiny black spots,

whereas H. nitidulus is brownish or yellowish with black

spots and has black lateral lines and spots (plate 18 in

Leaché et al. 2006). H. nitidulus has white, yellow or red-

dish ventral surfaces, whereas these surfaces are exclusive-

ly yellow in H. spatzi (see fig. 2f in Emms et al. 2006).

The hidden parts of legs are pinkish to blood red in both

species (Fig. 2 and figs. 430 & 431 in Schiotz 1999, figs.

in Rédel 2000). Generally, females of H. nitidulus have

amore distinct lateral black pattern than males, which can

be almost uniform brown (Fig. | and figs. in R6del 2000).

At night, males of both taxa appear uniform yellowish.

©ZFMK

182 Mark-Oliver Rodel et al.

Table 2. Characteristics of the advertisement calls of Hyperolius spatzi, recorded in Sabodala, Senegal, and H. nitidulus, record-

ed in the Comoé National Park, Ivory Coast and Mount Nimba, Guinea (Fig. 3). Differences of call length, main frequency and

time between calls have been tested by comparing mean values of five males of each species (Wilcoxon test).

Call length [sec]

Frequency [Hz]

Inter-call intervals [sec]

mean 0.08

sd 0.04

H. spatzi

N (males) 5

N (calls) 25

mean 0.02

sd < 0.01

H. nitidulus

N (males) 5

N (calls) 25

W 616

P < 0.0001

2638.0 1

139.6 0.80

5 5

25 25

2927.6 1.01

85.1 0.29

>) 4

25 20

26 218

< 0.0001 0.4756

Usually, the pattern in H. nitidulus remains vaguely vis-

ible. The only morphological difference detected by us

(herein confirming Ahl 1931a, b), is the size and shape of

the tongue. Hyperolius spatzi usually have comparative-

ly smaller and narrower tongues than H. nitidulus, whose

tongue 1s broad and almost heart-shaped. This 1s also vis-

ible in the type specimens of both species.

Acoustics. The advertisement call of both taxa is a sin-

gle, pure, metallic and very loud tone (Fig. 3). Choruses

of both species resemble xylophones or bells. Although

superficially similar, advertisement calls of both taxa

showed significant differences. The call of H. spatzi was

of comparatively longer duration and lower frequency

(Tab. 2). The small sample size and the relatively slight

differences in call characteristics urge for some caution

in their interpretation. However, the acoustic results are

not contradicting the specific distinctiveness of H. nitidu-

lus and H. spatzi.

Genetics. The genetic distances in the investigated frag-

ment of the 16S RNA gene between Hyperolius spatzi (N=

1) and 1. nitidulus (N= 3, originating from Sierra Leone

and Ivory Coast) ranged from 5.1—5.6%. The mean dis-

tance between H. spatzi and various other members of the

H. viridiflavus/marmoratus-complex (N= 33; including H.

nitidulus) was 5.9% (+ 1.1 SD; range: 3.6-8.7%). The low-

est distance was present in comparison to a H. viridiflavus

angolensis, the highest to a H. viridiflavus viridiflavus

sample (sequences from GenBank, compare Tab. 3). Mean

Bonn zoological Bulletin 57 (2): 177-188

genetic distances between H. spatzi and nine other Hyper-

olius species was 18.7% (+ 3.9 sd; range: 11.2—23.2%).

The lowest distance present occurred in comparison to H.

Jusciventris, the highest to a H. cinnamomeoventris sam-

ple (compare Tab. 3).

Based on genetic data (12S and 16S), Wieczorek et al.

(2000, 2001) recognized H. nitidulus as being distinct on

the species level from other members of the H. viridiflavus

group. Altogether they accepted ten species within this

group of which H. nitidulus was most distinct (within in-

traspecific genetic variation 0.7—-4.8%; between clade vari-

ation 2.4-10.0%; Wieczorek et al. 2001). Our data con-

firm their results and speak in favor of likewise recogniz-

ing H. spatzi as a distinct species.

Distribution. Hyperolius nitidulus occurs in humid to dry

savannas of West Africa (Fig. 4; Lamotte 1966; Schietz

1967, 1999; Rédel 2000). Laurent’s (1951c) doubts con-

cerning the type locality of H. nitidulus were rejected by

Schiotz (1963), by explaining that savanna exists at the

type locality, and thus also suitable habitats for H. nitidu-

lus. Records have been published for Benin (Nago et al.

2006), Ghana (Schiotz 1964a, 1967; Hoogmoed 1980;

Hughes 1988; Rédel & Agyei 2003; Leaché 2005; Leaché

et al. 2006), Burkina Faso (this paper), eastern and cen-

tral Guinea (Laurent 1951a, c; Schiotz 1967; Rédel et al.

2004; Hillers et al. 2006, 2008; Greenbaum & Carr 2005),

Ivory Coast (Laurent 1951c; Lamotte & Perret 1963; Bar-

bault 1967, 1972; Lamotte 1967; Schigtz 1967; Vuattoux

©OZFMK

Taxonomy of West African Hyperolius 183

Fig. 4.

: 1

Kilometers

Known distributions of Hyperolius spatzi (circles) and H. nitidulus (squares) based on museum and literature records

(compare text and Appendix 2); stars indicate positions of type localities of H. spatzi (Senegal) and H. nitidulus (Nigeria). The

north-westernmost record of H. nitidulus in Nigeria may refer to H. pallidus, southern and central Cameroonian populations are

usually referred to two H. nitidulus subspecies (compare text and fig. 428 in Schiotz 1999).

1968; Euzet et al. 1969; Rédel 1996, 1998, 2000, 2003;

Spieler 1997; Linsenmair 1998; Rédel & Spieler 2000;

Rodel & Ernst 2003; Adeba et al. 2010), Mali (Schiotz

1967), Nigeria (Schiotz 1963, 1966, 1967; Walker 1968;

Onadeko & Rédel 2009), Sierra Leone (Schiotz 1964b,

1967; Lamotte 1971), and Togo (Bourgat 1979; Segniag-

beto et al. 2007).

Hyperolius spatzi, as defined herein, has been recorded

from Senegal (Boettger 1881, as H. cinctiventris;

Loveridge 1956; Schietz 1967; Lamotte 1969; Miles et al.

1978, listed as H. nitidulus; Ahl 1931a, b; B6hme 1978),

and The Gambia (Andersson 1937 as H. sp., but unam-

biguous description provided; Barnett & Emms 2005 as

H. nitidulus; Emms et al. 2006). A record from Guinea was

actually based on 7. nitidulus (Hillers et al. 2006; see Ap-

pendix 2). Schietz (1971) recognized “H. viridiflavus

spatzi’’ as a taxonomic unit occurring in Senegambia and

provides a map, indicating the distribution of H. spatzi and

H. nitidulus, respectively (fig. 42 in Schietz 1971). Padi-

al & de la Riva (2004) believed that H. nitidulus and H.

viridiflavus may occur in southern Mauritania. Hyperolius

viridiflavus (sensu stricto) certainly does not occur in

western Africa, including Mauritania. Hyperolius nitidu-

lus might reach eastern Mauritania and it seems very like-

ly that H. spatzi might be a part of the Mauritanian fau-

na, as is indicated by the close proximity of the type lo-

cality of this species to the boarder of Mauritania (Fig. 4).

Mountains and rivers can act as potential barriers between

taxa (e.g. Li et al. 2009, for contrasting results see Gas-

con et al. 1998). In this case, the Géba and Corubal rivers

Bonn zoological Bulletin 57 (2): 177-188

along the border between Guinea-Bissau and Guinea,

might fulfill such a role. It is also possible that the north-

ern foothills of the Fouta Djallon serve as an altitudinal

barrier. However, more data from Equatorial Guinea, west-

ernmost Guinea, eastern Senegal, western Mali and Mau-

ritania would be needed to clarify the exact limits of the

species’ ranges.

The distribution of H. nitidulus in Central Africa is more

complicated. The species is listed as 1. viridiflavus (sub-

species H. v. nitidulus, H. v. pallidus) for Cameroon, the

Central African Republic and the Democratic Republic of

Congo by Frétey & Blanc (2000). In northern Cameroon

and adjacent north-eastern Nigeria, Chad and the Central

African Republic (Joger 1990), H. nitidulus may be re-

placed by H. pallidus which was described by Mertens

(1940) from dry northern Cameroon (Poli near Garua) and

which has been treated by Perret (1966) as a full species,

and by Schietz (1971) and Amiet (1973) as a subspecies

of H. nitidulus. From Cameroonian savannas, situated a

bit further south, two H. nitidulus subspecies have been

described by Perret (1966). Hyperolius n. bangwae occurs

in elevated savannas, 1.e. Bamenda, Bamiléké, Adamaoua,

whereas H. n. aureus is said to occur in the drier north-

ern savannas and semi-deserts (Perret 1966; compare e.g.

Bohme & Schneider 1987 for some records). This view

was adopted by Schietz (1971) and Amiet (1973). The lat-

ter provided arguments for the treatment of these taxa as

subspecies of H. nitidulus, i.e. Cameroonian frogs differ

from typical H. nitidulus by slightly smaller size and

slightly duller coloration. The voices are “as good as iden-

tical” (Amiet 1973). More recently, Amiet thought that all

©OZFMK

184 Mark-Oliver Rodel et al.

Table 3. Genetic distances between Hyperolius spatzi (ZMB 74280; GenBank #: HQ113098) and other Hyperolius species. Un-

corrected p-distances are based on 247 base pairs of mitochondrial 16S ribosomal RNA. Values for H. nitidulus are given in bold.

Genus Species subspecies“ GenBank # p-distance

Hyperolius chlorosteus FJ594076 0.214

Hyperolius cinnamomeoventris FJ594077 0.232

Hyperolius concolor FJ594078 0.203

Hyperolius fusciventris FJ594080 0.112

Hyperolius guttulatus FJ594082 0.133

Hyperolius horstocki AF282410 0.199

Hyperolius kivuensis AF282409 0.183

Hyperolius naustus AF215442 0.219

Hyperolius nitidulus HQ113099 0.051

Hyperolius nitidulus HQ113100 0.051

Hyperolius nitidulus AF282435 0.056

Hyperolius picturatus FJ594090 0.186

Hyperolius viridiflavus AF215440 0.056

Hyperolius viridiflavus AF215441 0.061

Hyperolius viridiflavus AY323920 0.077

Hyperolius viridiflavus angolensis AF282411 0.036

Hyperolius viridiflavus albofaciatus AF282433 0.065

Hyperolius viridiflavus aposematicus AF282412 0.051

Hyperolius viridiflavus argentovittis AF282431 0.046

Hyperolius viridiflavus bayoni AF282413 0.082

Hyperolius viridiflavus broadleyi AF282414 0.071

Hyperolius viridiflavus ferniquei AF282416 0.051

Hyperolius viridiflavus ferniquei AY 603987 0.051

Hyperolius viridiflavus glandicolor AF282417 0.066

Hyperolius viridiflavus goetzi AF282418 0.066

Hyperolius viridiflavus mariae AF282419 0.066

Hyperolius viridiflavus mariae AF282420 0.066

Hyperolius viridiflavus marginatus AF282430 0.051

Hyperolius viridiflavus melanoleucus AF282432 0.056

Hyperolius viridiflavus pamtherinus AF282425 0.051

Hyperolius viridiflavus pitmani AF282426 0.066

Hyperolius viridiflavus marmoratus AF282421 0.056

Hyperolius viridiflavus ngorongoro AF282423 0.066

Hyperolius viridiflavus ommatostictus AF282424 0.056

Hyperolius viridiflavus pyrrhodictyon AF282434 0.046

Hyperolius viridiflavus rhodesianus AF282427 0.038

Hyperolius viridiflavus rubripes AF282436 0.062

FHyperolius viridiflavus swymmertoni AF282415 0.071

Hyperolius viridiflavus taeniatus AF282422 0.056

Hyperolius viridiflavus verrucosus AF282428 0.062

Hyperolius viridiflavus viridiflavus AF282429 0.087

Bonn zoological Bulletin 57 (2): 177-188 ©OZFMK

Taxonomy of West African Hyperolius 185

three Cameroonian taxa are subspecies of H. viridiflavus,

i.e. the highlands of western Cameroon and the Adamaoua

plateau being inhabited by H. v. aureus (and possibly H.

v. bangwae), and populations occurring in northern

Cameroon (mid-Sudanian, Sudano-Sahelian and Sahelian

zones) belong to H. v. bangwae and H. v. pallidus (J.-L.

Amiet pers. comm.).

Conclusions. Our investigations on the type specimens,

as well as on additional vouchers, revealed small but dis-

tinct morphological (mostly color pattern; tongue shape

and size), significant acoustic and large genetic differences

(16S gene). Especially the genetic differences are clear-

ly within the range that is thought to be species specific

in anurans (Vences et al. 2005a, b; Rédel et al. 2009;

Vieites et al. 2009). Our results thus speak in favor of rec-

ognizing both taxa as distinct species. A contradicting ar-

gument was seen in the very complicated situation of a

large variation of color patterns between and within pop-

ulations of the Hyperolius viridiflavus/marmoratus species

group(s). Schietz (1999) thus questions an approach where

the taxonomy for only a small part of the continent would

be resolved. However, in West Africa it is possible to as-

sign these frogs to particular names and we thus do not

see a reason for avoiding it. We therefore herein resurrect

the species status of H. spatzi, designate a lectotype from

the series of syntypes and redescribe the species based on

type and new material.

REDESCRIPTION OF HYPEROLIUS SPATZI

AHL, 1931.

ZMB 32602 (lectotype; Fig. 2), 74853-74876 (paralecto-

types, formerly all ZMB 32602), all from Bakel-Kidira,

Senegal, coll. Spatz.

Description of lectotype (all measurements in mm).

Subadult frog (male, vocal sac barely developed?); short,

compact body; snout-vent length 19.2; head width 7.3,

head length 6.9, thus head wider than long; snout short

and truncated in dorsal and lateral view; narins angular

narrow slit, closer to snout-tip than to eye; tympanum hid-

den; transversal gular fold; tongue small, narrow, almost

parallel and notched anteriorly, tongue width 2.3, tongue

length 3.2, tongue 3.3 times in head width; choanae small

and round, close to edge of mandible but well visible; dor-

sal skin slightly granular; belly granular (medially dissect-

ed); ventral skin on thighs near vent granular, remaining

ventral parts of hind limbs smooth; finger and toe tips en-

larged to discs; relative lengths of fingers: 1<2<4<3; basal

webbing between fingers; femur length: 8.4; tibia length:

10.4; foot incl. longest toe: 14.0; relative lengths of toes:

1<2<3<5<4; webbing formula: 1 (0), 2 (1.5-0), 3

(1.5—0.5), 4 (1-0), 5 (0); subarticular tubercles on fingers

Bonn zoological Bulletin 57 (2): 177-188

and toes not very prominent. Dorsal surfaces chalk white,

densely beset with minute black points; ventral skin on

thighs near vent white, remaining parts of thighs and ven-

tral parts of shanks, feet, inner parts of forelimbs, ventral

part of hands and fingers fleshy colored.

Variation. Series of paralectotypes almost indistinguish-

able from lectotype, exclusively subadult frogs in dry sea-

son conditions; dorsal skin partly more or less granular

than in lectotype; black points on white ground sometimes

more distinct or sometimes almost absent. Further mate-

rial (see Appendix 2) exhibit the following variation: Male

snout-vent length: 27.0—-31.3 (N= 6); female snout-vent

length 30.6 (N= 1); snout shape of adult frogs in dorsal

and ventral view slightly more rounded than in juveniles;

adults of both sexes in ethanol with dorsal surfaces (incl.

upper side of thighs) with brownish ground color (com-

posed of small, very dense brownish points), many very

distinct black spots; black spots sometimes a bit more

abundant on flanks than on back; some specimens with

black spots on throat; others with uniform clear ventral

surfaces; tongue in almost all specimens small and com-

paratively narrow (exception: ZMB 74279). Adult animals

in life brownish to yellow with very distinct black spots.

These may be not visible during night. Venter yellow.

Acknowledgements. We thank SRK Consulting (Canada) and

the Oromin Exploration Ltd. for financial and logistic support

for conducting a survey in south-eastern Senegal which enabled

us to collect and sequence several specimens of Hyperolius

spatzi; and the authorities in various West African countries for

the respective research, collection and export permits. J. Koh-

ler provided valuable comments on the manuscript. This study

is part of the BIOLOG-program of the German Ministry of Ed-

ucation and Science (BMB+F; Project BIOTA-West HI, amphib-

ian project, 01LC0617J).

REFERENCES

Adeba PJ, Kouassi P, R6del M-O (2010) Anuran amphibians in

a rapidly changing environment — revisiting Lamto, Cote

d'Ivoire, 40 years after the first herpetofaunal investigations.

African Journal of Herpetology 59: 1-16.

Ahl-E (193 1a) Zur Systematik der afrikanischen Arten der Baum-

froschgattung Hyperolius (Amph. Anur.). Mitteilungen aus

dem zoologischen Museum Berlin 17: 1-132

Ahl E (1931b) Anura HI, Polypedatidae. Pp. I-X VI + 1-477 in:

Schulze FE & Ktikenthal W (eds) Das Tierreich 55. Lieferung.

Walter de Gruyter, Berlin & Leipzig

Amiet J-L (1973) Compte rendu d’une mission batrachologique

dans le Nord-Cameroun. Annales de la Faculté des Sciences

du Cameroun 12: 63-78

Andersson LG (1937) Reptiles and batrachians. Collected in the

Gambia by Gustav Svensson and Birger Rudebeck (Swedish

Expedition 1931). Arkiv for zoologi 29A: 1—28

Barbault R (1967) Recherches écologiques dans la savane de

Lamto (Céte d’Ivoire): Le cycle annuel de la biomasse des am-

phibiens et des lézards. Terre Vie 3: 297-318

©ZFMK

186 Mark-Oliver Rodel et al.

Barbault R (1972) Les peuplements d’amphibiens des savanes

de Lamto (Cote dIvoire). Annales de l’ Université d’ Abidjan

Sér. E 5: 59-142

Barnett LK, Emms C (2005) Common amphibians of the Gam-

bia. Makasutu Wildlife Trust, Serrekunda, The Gambia

Bohme W (1978) Zur Herpetofaunistik des Senegal. Bonner zoo-

logische Beitrage 29: 360-417

Bohme W, Schneider B (1987) Zur Herpetofaunistik Kameruns

(III) mit Beschreibung einer neuen Cardioglossa (Anura: Ar-

throleptidae). Bonner zoologische Beitrage 38: 241-263

Boettger O (1881) Aufzahlung der von Frhrn. H. und Frfr. A.

von Maltzahn im Winter 1880/81 am Cap Verde in Senegam-

bien gesammelten Kriechtiere. Abhandlungen Senckenber-

gisch naturforschenden Gesellschaft Frankfurt a.M. 12: 393—

419 + | plate

Boulenger GA (1882) Catalogue of the Batrachia Salientia s.

Ecaudata in the collection of the British Museum. 2.ed. Bri-

tish Museum, London

Bourgat R (1979) Trématodes d’Amphibiens du Togo. Bulletin

du Muséum d’ Histoire naturelle 3: 597-624

Crichton M (1991) Jurassic Park. Random House Publishing

Group, New York

Drewes RC (1984) A phylogenetic analysis of the Hyperoliidae

(Anura): Treefrogs of Africa, Madagascar, and the Seychelles

Islands. Occasional Papers of the California Academy of Sci-

ences 139: 1-70

Emms C, Jambang MDK, Bah O, Mankali B, Rodel M-O, Bar-

nett L (2006) The amphibian fauna of The Gambia, West

Africa. Herpetological Bulletin 94: 6-16

Euzet L, Combaz C, Knoepffler L-P (1969) Parasites d’amphi-

biens de Cote d’Ivoire et du Liberia: Polystomatidae (Mono-

genea). Biologia Gabonica 3: 217-221

Frétey T, Blanc CP (2000) Liste des Amphibiens d’A frique cen-

trale. Cameroun, Congo, Gabon, Guinée-Equatoriale,

République Centrafricaine, République Démocratique du Con-

go, Sao Tomé et Principe. Les dossiers de |’ ADIE, Série Bio-

diversité N°2: 1-39.

Frost DR (2010) Amphibian species of the World: an online ref-

erence. Version 5.4 (8 April, 2010).

http://research.amnh.org/vz/herpetology/amphibia, American

Museum of Natural History, New York (accessed 12 July

2010)

Gascon C, Lougheed SC, Bogart JP (1998) Patterns of genetic

population differentiation in four species of Amazonian frogs:

A test of the riverine barrier hypothesis. Biotropica 30:

104-119

Grafe TU, Dobler S, Linsenmair KE (2002) Frogs flee from the

sound of fire. Proceedings of the Royal Society of London B

269: 999-1003

Grafe TU, Linsenmair KE (1989) Protogynous sex change in the

reed frog Hyperolius viridiflavus. Copeia 1989: 1024-1029

Greenbaum E, Carr JL (2005) The herpetofauna of Upper Niger

National Park, Guinea, West Africa. Scientific Papers of the

Natural History Museum University of Kansas 37: 1-21

Hillers A, Bangoura MA, Loua N-S, Rédel M-O (2006) Inven-

taire rapide des amphibians et des reptiles dans la région de

Boke dans le nord-ouest de la Guinée. Pp. 59-64, 131-136,

178-181 in: Wright HE, McCulloughn J, Diallo MS (eds) Une

inventaire biologique rapide de la préfecture de Boké dans le

nord-ouest de la Guinée / A rapid biological assessment of

Boke Préfecture, northwestern Guinea. RAP Bull. of Biol. As-

sessment 41, Conservation International, Washington D.C.

Hillers A, Loua N-S, Rédel M-O (2008) A preliminary assess-

ment of the amphibians of the Fouta Djallon, Guinea, West

Africa. Salamandra 44: 113-122

Bonn zoological Bulletin 57 (2): 177-188

Hoogmoed MS (1980) Herpetologische waarnemingen in

Ghana II. Lacerta 38: 10—20

Hughes B (1988) Herpetology in Ghana (West Africa). British

Herpetological Society Bulletin 25: 29-38

Joger U (1990) The herpetofauna of the Central African Repub-

lic, with description of a new species of Rhinotyphlops (Ser-

pentes: Typhlopidae). Pp. 85-102 in: Peters G, Hutterer R

(eds) Vertebrates in the tropics. Museum Alexander Koenig,

Bonn

Joger U, Lambert MRK (2002) Inventory of amphibians and rep-

tiles in SE Senegal, including the Niokola-Koba National Park,

with observations on factors influencing diversity. Tropical

Zoology 15: 165-185

Lamotte M (1966) Types de répartition géographique de quel-

ques batraciens dans l’Ouest Africain. Bulletin de |’Institut

fondamental d’ Afrique noire Sér. A 28: 1140-1148

Lamotte M (1967) Les batraciens de la région de Gpakobo (Cote

d'Ivoire). Bulletin de I’ Institut fondamental d’ Afrique noire

Ser. A 29: 218-294

Lamotte M (1969) Le parc national du Niokolo—Koba, Fasciule

UI; XXX. Amphibiens (deuxi¢me note). Mémoires de |’ Ins-

titut fondamental d’ Afrique noire 84: 420-426

Lamotte M (1971) Le Massif des Monts Loma (Sierra Leone),

Fasciule I; XIX. Amphibiens. Mémoires de |’ Institut fonda-

mental d’ Afrique noire 86: 397-407

Lampert KP, Linsenmair KE (2002) Alternative life cycle stra-

tegies in the West African reed frog Hyperolius nitidulus: the

answer to an unpredictable environment? Oecologia 130:

364-372

Laurent RF (1951a) Catalogue des rainettes africaines (genres

Afrixalus et Hyperolius) de la collection du Muséum Natio-

nal d’Histoire Naturelle de Paris. Annales de la Société Royale

Zoologique de Belgique 82: 23—50

Laurent RF (1951b) Quelques donnes nouvelles sur la systéma-

tique et l’écologie du genre Hyperolius Rapp. Annales de la

Société Royale Zoologique de Belgique 82: 329-337

Laurent RF (1951c) Apercu des formes actuellement reconnais-

sables dans la superespece Hyperolius marmoratus. Annales

de la Société Royale Zoologique de Belgique 82: 379-397

Laurent RF (1961) Note sur les Hyperolius et quelques Afrixa-

lus (Salientia) du Musée de Berlin. Revue de zoologie et de

botanique africaines 64: 65-96.

Laurent RF (1976) Nouveaux commentaires sur la superespéce

Hyperolius viridiflavus (Anura). Musée Royal d’ Afrique Cen-

trale Série IN-8, Science zoologique, 213: 71-114

Laurent RF (1983) La superespéce Hyperolius viridiflavus

(Duméril & Bibron, 1841) (Anura Hyperoliidae) en Afrique

Centrale. Monitore Zoologico Italiano N.S. Suppl. 18: 1-93

Leaché AD (2005) Results of a herpetological survey in Ghana

and a new country record. Herpetological Review 36: 16-19

Leaché AD, Rodel M-O, Linkem CW, Diaz RE, Hillers A, Fu-

jita MK (2006) Biodiversity in a forest island: reptiles and am-

phibians of the West African Togo Hills. Amphibian and Rep-

tile Conservation 4: 22-45

Li R, Chen W, Fu J (2009) Rivers as barriers for high elevation

amphibians: a phylogeographic analysis of the alpine stream

frog of the Hengduan Mountains. Journal of Zoology 277:

309-316

Linsenmair KE (1998) Risk-spreading and risk-reducing tactics

of West African anurans in an unpredictably changing and

stressful environment. Pp. 221—242 in: Newbery DM, Prins

HHT, Brown ND (eds) Dynamics of tropical communities.

Blackwell Science, London

Loveridge A (1955) On Amphibia Salientia from the Ivory Co-

ast. Revue suisse de Zoologie 62: 129-150

©ZFMK

Taxonomy of West African Hyperolius 187

Loveridge A (1956) VI. Amphibiens. In: Le Pare National de

Niokolo-Koba. Mémoires de |’ Institut fondamental d’ A frique

Noires 48: 163—166

Mertens R (1940) Zur Herpetologie Kameruns und Deutsch-Ost-

afrikas. Zoologischer Anzeiger 131: 239-250

Miles MA, Thomson AG, Walters GW (1978) Amphibians and

reptiles from the vicinity of Boughari, Casamance (Senegal),

and the Gambia. Bulletin de l'Institut fondamental d’A frique

noire Sér. A 40: 437-456

Nago SGA, Grell O, Sinsin B, Rédel M-O (2006) The amphib-

ian fauna of the Pendjari National Park and surroundings,

northern Benin. Salamandra 42: 93-108

Onadeko AB, Rédel M-O (2009) Anuran surveys in south-west-

ern Nigeria. Salamandra 45: 1-14

Padial JM, de la Riva I (2004) Annotated checklist of the am-

phibians of Mauritania (West Africa). Revista Espanola de

Herpetologia 18: 89-99

Perret J-L (1966) Les amphibiens du Cameroun. Zoologische

Jahrbticher (Systematik) 8: 289-464

Peters W (1875) Uber die von Hrn. Professor Dr. R. Buchholz

in Westafrika gesammelten Amphibien. Monatsberichte der

K@6niglich PreuBischen Akademie der Wissenschaften zu Ber-

lin Marz: 196-212 + 3 plates

RODEL M-O (1996) Amphibien der westafrikanischen Savanne.

Edition Chimaira, Frankfurt/M.

Rédel M-O (1998) Kaulquappengesellschaften ephemerer Sa-

vannengewasser in Westafrika. Edition Chimaira, Frankfurt/M.

Rédel M-O (2000) Herpetofauna of West Africa, Vol. I: Amphib-

ians of the West African savanna. Edition Chimaira, Frank-

furt/M.

Rédel M-O (2003) The amphibians of Mont Sangbé National

Park, Ivory Coast. Salamandra 39: 91-110

R6édel M-O, Agyei AC (2003) Amphibians of the Togo-Volta

highlands, eastern Ghana. Salamandra 39: 207—234

Rédel M-O, Bangoura MA, Bohme W (2004) The amphibians

of south-eastern Republic of Guinea (Amphibia:

Gymnophiona, Anura). Herpetozoa 17: 99-118

Rédel M-O, Boateng CO, Penner J, Hillers A (2009) A new cryp-

tic Phrynobatrachus species (Amphibia: Anura: Phrynobatra-

chidae) from Ghana, West Africa. Zootaxa 1970: 52-63

R6del M-O, Ernst R (2003) The amphibians of Marahoué and

Mont Péko National Parks, Ivory Coast. Herpetozoa 16: 23-39

Rédel M-O, Spieler M (2000) Trilingual keys to the savannah-

anurans of the Comoé National Park, Ivory Coast. Stuttgar-

ter Beitrage zur Naturkunde Serie A Nr. 620: 1-31

Schietz A (1963) The amphibians of Nigeria. Videnskabelige

Meddelelser fra Dansk Naturhistorisk Forening 125: 1-92 +

4 plates

Schietz A (1964a) A preliminary list of amphibians collected in

Ghana. Videnskabelige Meddelelser fra Dansk Naturhistorisk

Forening 127: 1-17

Schigtz A (1964b) A preliminary list of amphibians collected in

Sierra Leone. Videnskabelige Meddelelser fra Dansk Naturhis-

torisk Forening 127: 19-33 + 1 plate

Bonn zoological Bulletin 57 (2): 177-188

Schiotz A (1966) On a collection of amphibia from Nigeria. Vi-

denskabelige Meddelelser fra Dansk Naturhistorisk Forening

129: 43-48 + 3 plates

Schietz A (1967) The treefrogs (Rhacophoridae) of West A frica.

Spolia Zoologica Musei Hauniensis 25: 1-346

Schiotz A (1971) The superspecies Hyperolius viridiflavus (Anu-

ra). Videnskabelige Meddelelser fra Dansk Naturhistorisk

Forening 134: 21-76

Schiotz A (1975) The treefrogs of Eastern Africa. Steenstrupia,

Copenhagen

Schigtz A (1999) Treefrogs of Africa. Edition Chimaira, Frank-

furt/M

Segniagbeto GH, Bowessidjaou JE, Dubois A, Ohler A (2007)

Les amphibiens du Togo: état actuel des connaissances. Aly-

tes 24: 72-90

Spieler M (1997) Anpassungen westafrikanischer Froschlurche

an TrockenstreB und Réuberdruck in einer westafrikanischen

Savanne. Salamandra 33: 133-152

Swofford DL (2001) Paup*: phylogenetic analysis using parsi-

mony (and other methods), version 4.06b. Sinauer Associates,

Sunderland/Massachusetts

Veith M, Kosuch J, Rédel M-O, Hillers A, Schmitz A, Burger

M, Lotters S (2009) Multiple evolution of sexual dichroma-

tism in African reed frogs. Molecular Phylogenetics and Evo-

lution 51: 388-393

Vences M, Thomas M, Bonett RM, Vieites DR (2005a) Deci-

phering amphibian diversity through DNA barcoding: changes

and challenges. Philosophical Transactions of the Royal So-

ciety B Biological Sciences 360: 1859-1868

Vences M, Thomas M, van der Meijden A, Chiari Y, Vieites DR

(2005b) Comparative performance of the 16S rRNA gene in

DNA barcoding of amphibians. Frontiers in Zoology 2: 5

Vieites DR, Wollenberg KC, Andreone F, Kohler J, Glaw F,

Vences M (2009) Vast underestimation of Madagascar’s bio-

diversity evidenced by an integrative amphibian inventory.

Proceedings of the National Academy of Sciences of the

U.S.A. 106: 8267-8272.

Vuattoux R (1968) Le peuplement du palmier ronier (Borassus

aethiopum) d'une savane de Cote dIvoire. Annales de Il’ Uni-

versité d’ Abidjan, Sér. E, 1: 1-138

Walker RB (1968) The amphibians of Zaria, in the northern

Guinea savannah, Nigeria. Copeia 1968: 164-167

Wieczorek AM, Channing A (1997) The taxonomic status of

Broadley’s reed frog. African Journal of Herpetology 46:

110-116.

Wieczorek AM, Channing A, Drewes RC (1998) A review of the

taxonomy of the Hyperolius viridiflavus complex. Herpeto-

logical Journal 8: 29-34

Wieczorek AM, Drewes RC, Channing A (2000): Biogeography

and evolutionary history of Hyperolius species: application of

molecular phylogeny. Journal of Biogeography 27: 1231—1243

Wieczorek AM, Drewes RC, Channing A (2001) Phylogenetic

relationships within the Hyperolius viridiflavus complex (Anu-

ra: Hyperoliidae), and comments on taxonomic status. Am-

phibia-Reptilia 22: 155-166

©ZFMK

188 Mark-Oliver R6édel et al.

APPENDIX 1.

Translations of the original descriptions of Hyperolius nitidulus

by Peters (1875) and Hyperolius spatzi by Ahl (193 1a):

Hyperolius nitidulus (Fig. 2): “Body shape equals that of H.

marmoratus. Snout same length as eye. Tympanum hidden. Bel-

ly and ventral surfaces of thighs granular. The outer two fingers

and the forth toe, with the exception of the two most distal pha-

langes, webbed. Dorsally purple grey, shanks likewise colored,

whereas the thighs seem to be uncolored. A black band from nose

through eye to belly, there band dissolving into black spots on

white background; upper lip, flanks below this band, anal region,

upper surfaces of forearms, outer and inner edge of shanks and

external side of foot to toe tips (in ethanol) white with black

spots, which plus/minus fuse. Total length 28 mm; head: 8 mm;

head width: 8.5 mm; forearm: 19 mm; hand with 3" finger: 7

mm; hind leg: 44 mm; foot with fifth toe: 20 mm. From Yoru-

ba (Lagos). [comment added: referring to ZMB 7729, holotype]”

Plate 3 (figures 4 and 4a) in Peters (1875) figures the typical wet-

season color pattern of this species.

Hyperolius spatzi (Fig. 1): “stocky body shape; vomerine teeth

absent; choanae very small, hidden below edge of mandible;

tongue unusually small, notched posteriorly; large head, app. 1/3

of body length, wider than long; snout rounded, truncated in lat-

eral view, not or only slightly surpassing mouth, as long as eye,

much shorter than distance between anterior corner of eyes,

slightly longer than high; canthus rostralis rounded but distinct;

loreal region vertical, only slightly concave; narines in mid dis-

tance between eye and snout-tip; inter-narial distance slightly

narrower than inter-orbital distance, the latter twice as wide as

upper eyelid; tympanum hidden beneath skin.

Robust fingers, 1/3 to 1/2 webbed; well developed discs; 15* fin-

ger shorter than second, second shorter than fourth, which is

slightly surpassed by the 3"4 finger; 3" finger as long as snout;

subarticular tubercles moderately large, not prominent. Webbing

on feet complete with the exception of 4" toe where the last pha-

lanx is without webbing; discs as large as those on fingers; 5‘

toe slightly longer than 3'4; external metatarsalia tightly fused,

tarsal fold absent; very small inner metatarsal tubercle; outer

metatarsal tubercle lacking; no tarsal tubercle; subarticular tu-

bercle small, moderately distinct. Tibio-tarsal angle surpasses eye

or reaches snout-tip. Femur shorter than tibia, the latter 3.5—4

times longer than wide and twice or slightly less times in body

length, longer than foot; heals in contact when hind legs arranged

to body at right angles.

Dorsal skin thick, almost leathery, rough, beset with many small

smooth or rough warts; ventrum granular; distinct postgular and

postpectoral folds; no temporotemporal fold; males with subgu-

lar vocal sac and a small, indistinct gular flap.

Coloration in alcohol dorsally chalk white or, rarer, fine speck-

led with dark-brown. Venter white. Ventral parts of thighs and

inner parts of shanks flesh-colored (presumably red in life). No

markings at all.

Body length 21 mm. Bakel-Kidira (Upper Senegal region). 26

specimens, Bakel-Kidira, Spatz leg., types [comment added:

ZMB 32602, lectotype; 74853-74876, paralectotypes; formerly

all ZMB 32602]. The species is named to honor the collector,

the well know researcher Spatz, whose collecting activities re-

sulted in a large number of valuable reptiles and amphibians,

stored in the Berlin museum.”

Bonn zoological Bulletin 57 (2): 177-188

APPENDIX 2.

Voucher specimens, including types, of Hyperolius spatzi and

H. nitidulus in the ZMB and SMNS collections.

Hyperolius nitidulus. Benin: ZMB 74896-74898, Pendjari Na-

tional Park, Sudan savanna, October 2003, coll. Olaf Grell; ZMB

74890, Pendjari National Park, Tangieta, savanna, N 10°38.317’,

E 01°15.746’, 1 September 2004, coll. G.A. Nago & M.-O.

Rodel; Burkina Faso: ZMB 74893-74894, Dano, small river in

savanna, N 11°14’16.8”, W 03°01’24.1”, 22 October 2003, coll.

T. Moritz; Ivory Coast: SMNS 8995.1-2, Ananda, 1993, coll.

M.-O. Rédel; SMNS 9680.1-2, Bondoukou, 1996, coll. K. Koua-

dio; ZMB 74888 & SMNS 8967.1-7, Comoé National Park, sa-

vanna, June 1996, coll. M.-O. Rédel; ZMB 74886, Mont Sang-

bé National Park, Mare Soumarou, island forest in the savanna,

pitfall trap, dry season 2001, coll. G. Gbmalin & Y. Cesar;

Guinea: ZMB 74895, Mont Béro Classified Forest, savanna, N

08°08730.9”, W 08°34’09.6”, 1 December 2003, coll. M.A. Ban-

goura & M.-O. Rédel; ZMB 74891-74892 Nimba Mountains,

savanna Séringbara, with big ponds, close to village, N

07°36.181’, W 08°29.769’, 18 May 2006, coll. T.N.-S. Loua &

A. Hillers; ZMB 74889, Pic de Fon/Simandou range, Banko, sa-

vanna, 11 July 2004, coll. M.A. Bangoura & K. Kamara; ZMB

74882, Boké Préfécture/Kolaboui, swampy area in secondary

forest island, N 10°45.075’, W 14°27.040’, 23 & 24 April 2005,

coll. M.A. Bangoura & A. Hillers (originally listed as H. spatzi

in Hillers et al. 2006); Nigeria: ZMB 7729 (holotype), Yoruba

(Lagos), coll. Krause; Sierra Leone: ZMB 74884-74885, Tin-

gi Hills, big pond with a few trees around and swampy area in

savanna, N 08°51.047’, W 10°46.502’, 427 ma.s.l., 5 June 2007,

coll. J. Johnny & A. Hillers; Togo: ZMB 39028, station Sokode,

coll. Schréder.

Hyperolius spatzi. Gambia: ZMB 74877, Abuko Nature Re-

serve, savanna, 2005, coll. L. Barnett & C. Emms; Senegal:

ZMB 32602 (lectotype), 74853-74876 (paralectotypes, former-

ly all ZMB 32602), Bakel-Kidira, coll. Spatz; ZMB 74279, Sa-

bodala, ponds and puddles in degraded farmbush savanna next

to Oromin camp, N 13°09.368’, W 12°06.882’, 12 September

2009, coll. A. Hillers & Y. Mané; ZMB 74280-74285, Sabodala,

in and around big pond in farmbush savanna/grassland, with

some rocks, N 13°07.259’, W 12°07.622’, 7 September 2009,

coll. A. Hillers & Y. Mané.

Received: 26.VII.2010

Accepted: 24. VIII.2010

©OZFMK

Bonn zoological Bulletin Volume 57 Issue 2 pp. 189-196

Bonn, November 2010

Genetic variability in mainland and insular populations

of Podarcis muralis

(Reptilia: Lacertidae)

Massimo Capula! & Claudia Corti?

'Museo Civico di Zoologia, Via U. Aldrovandi, 18, I-00197 Roma, Italy;

E-Mail: massimo.capula@comune.roma.it

2Museo di Storia Naturale dell’ Universita di Firenze, Sezione di Zoologia “La Specola”’, Via Romana,

1-50125 Firenze, Italy, E-Mail: claudia.corti@unif1.it

Abstract. Allozyme electrophoresis was used to study the distribution of genetic variation within and among mainland

and insular populations of the lacertid lizard Podarcis muralis from western, southern and eastern Europe. Genetic vari-

ability in the species is low and genetic subdivision is high. The highest values of percent polymorphism and heterozy-

gosity were found in the samples from two Tyrrhenian islands (Elba Island, La Scola Islet). The occurrence of higher

levels of genetic variability in insular populations is probably because these populations inhabit marginal environments

characterized by temporal-ecological instability. In these environments high heterozygosity levels can be preserved af-

ter colonization events, unless founder populations are so small that bottleneck effects occur. The genetic heterogeneity

analysis demonstrates a certain amount of genetic differentiation among local populations of P. muralis, with a relative-

ly high level of genetic subdivision. Allozyme data show that genetic variation in P. muralis is distributed into two ma-

jor population groups: the first includes the closely related samples from Spain and SW France, the second the geneti-

cally recognizable samples from Germany, Italy, and Greece. The average genetic distance between the two groups is

relatively high (Ne1’s D = 0.059), with D ranging from 0.043 to 0.100.

Key words. Podarcis muralis, Lacertidae, allozyme electrophoresis, population heterogeneity, Tyrrhenian islands, Eu-

rope.

INTRODUCTION

There have been numerous surveys of the genetic struc-

ture of insular populations of vertebrates, especially rep-

tiles (e.g. Soulé & Yang 1974; Gorman et al. 1975; Pat-

ton et al. 1975). From these studies it became evident that

many demographic, historical, and geographic factors in-

fluence the pattern of genetic variation in the insular pop-

ulations (e.g. Soulé et al. 1973; Soulé 1976).

The Mediterranean lacertid lizards of the genus Podarcis

seem to be particularly useful for this type of investiga-

tion because they are widespread on several Mediterranean

islands and are normally characterized by high inter- and

intra-population morphological and genetic variability

(e.g. Harris & Arnold 1999; Arnold & Ovenden 2002; Cor-

ti & Lo Cascio 2002; Salvi et al. 2009). Although the evo-

lutionary significance of the pattern of variation observed

in these lacertid lizards has been unstudied for most taxa,

in some cases at least it was pointed out that species which

are characterized by a high degree of phenotypic plastic-

ity in the pattern of the upper parts may have levels of ge-

netic variability higher than those found in the morpho-

Bonn zoological Bulletin 57 (2): 189-196

logically low variable species (see e.g. Selander 1976; Ca-

pula 1994a, 1996, 1997; Losos et al. 1997; Capula & Cec-

carelli 2003; Caputo et al. 2008).

In this paper, based primarily on allozyme data, the dis-

tribution of genetic variation within and among mainland

and insular populations of the lacertid lizard Podarcis mu-

ralis from western, southern and eastern parts of its Eu-

ropean range was estimated. Podarcis muralis was cho-

sen as it is a morphologically and ecologically variable

species occurring in a wide variety of habitats over its dis-

tribution range, which extends from the northern border

of the Iberian Peninsula to north-western Turkey, and

throughout central and southern Europe (Arnold &

Ovenden 2002; Corti & Lo Cascio 2002). In the northern

part of its range this lizard is typically a thermophilous

and lowland species, with a reduced variability in the pat-

tern of the upper parts, while in the southern part it is more

often a mountain species, occurs especially in wet and

shady habitats, and is characterized here by high pheno-

typic variability (see Capula et al. 1993, 2009; Corti et al.

©ZFMK

190 Massimo Capula & Claudia Corti

Table 1. Geographic and collecting data for the Podarcis muralis samples used in this study.

Population Locality

Sample size

Guadarrama (Spain)

Anso (Spain)

Ordesa (Spain)

Deba (Spain)

Albaran (Spain)

Bidache (SW France)

Le Chiroulet (SW France)

St. Gaudens (SW France)

Bonn (Germany)

Cavalese (Italy)

Cesena (Italy)

Resceto (Italy)

Chiusdino (Italy)

Populonia (Italy)

Uccellina Mountains (Italy)

Ostia (Italy)

NS <t R So e Cle ny @ ACS) aa Re a nl ee iB, RY eal clesk le). @}. teel Ses

Viotia (Greece)

Elba Island, Tuscan Archipelago (Italy)

Nan nw kW nn

Scoghietto di Portoferraio Islet, Tuscan Archipelago (Italy)

Gorgona Island, Tuscan Archipelago (Italy)

La Scola Islet, Tuscan Archipelago (Italy)

Pianosa Island, Tuscan Archipelago (Italy) 7)

Palmaiola Island, Tuscan Archipelago (Italy) 3

in press). Allozyme variation in some Italian, Spanish and

Austrian populations of P. muralis was studied by Capu-

la (1997), who provided evidence of high level of genet-

ic variability in insular populations. Genetic variation and

differentiation in the Italian populations of the species

were recently investigated also by Caputo et al. (2008) and

Giovannotti et al. (2010), based on the sequencing of a

portion of a mitochondrial gene.

MATERIAL AND METHODS

Sampling. Samples of P. muralis used in this study were

obtained from 17 mainland localities of western, south-

ern and eastern Europe (Spain, SW France, Germany, Italy,

Greece) and six islands of the Tuscan Archipelago in the

Tyrrhenian Sea (Elba, Scoglietto di Portoferraio, Gorgona,

Pianosa, La Scola, Palmaiola). The precise geographic ori-

gin of each sample and the number of individuals analysed

per population are indicated in Table 1.

Bonn zoological Bulletin 57 (2): 189-196

Electrophoresis. The electrophoretic analysis was under-

taken for 134 specimens from all 23 localities. Standard

horizontal starch gel electrophoresis was performed on tail

muscle tissue, parts of which were crushed in 0.1 mL of

distilled water. Gene products for the following 21 pre-

sumptive enzyme loci were analysed: glycerol-3-phos-

phate dehydrogenase (E.C. 1.1.1.8, «Gpd), lactate dehy-

drogenase (E.C. 1.1.1.27, Ldh-1, Ldh-2), malate dehydro-

genase (E.C. 1.1.1.37, Mdh-1, Mdh-2), malic enzyme

(E.C. 1.1.1.40, Me-/, Me-2), isocitrate dehydrogenase

(E.C. 1.1.1.42, Idh-1, Idh-2), 6-phosphogluconate dehy-

drogenase (E.C. 1.1.1.44, 6Pgd), glyceraldehyde-3-phos-

phate dehydrogenase (E.C. 1.2.1.12, Gapd), superoxide

dismutase (E.C. 1.15.1.1, Sod-1), glutamate-oxaloacetate

transaminase (E.C. 2.6.1.1, Got-1, Got-2), creatine kinase

(E.C. 2.7.3.2, Ck), adenosine deaminase (E.C. 3.5.4.4,

Ada), carbonic anhydrase (E.C. 4.2.1.1, Ca), mannose-6-

phosphate isomerase (E.C. 5.3.1.8, Mpi), glucose-6-phos-

phate isomerase (E.C. 5.3.1.9, Gpi), phosphoglucomutase

(E.C. 5.4.2.2, Pgm-1, Pgm-2) (enzymes codes are accord-

©ZFMK

Genetic variation in Podarcis muralis 191

Table 2. Chi-square values resulting from contingency y? ana-

lysis of the polymorphic loci among populations of Podarcis mu-

ralis. d.f. = degree of freedom; NS = nonsignificant.

Locus No. 9 a d.f. P

of alleles

Ldh-1 2 172.417 22 <0.001

Ldh-2 2 33.841 22 <0.05

Me-1 4 462.317 66 <0.001

Me-2 2 32.622 22 NS

6Pgd 4 222.142 66 <0.001

Gapd 2 42.987 22 <0.004

Got-1 D) 63.179 22 <0.001

Pgm-2 2 80.490 22 <0.001

Ca 2 WS .42 22 <0.001

Gp-1 2 24.986 22 NS

Gp-2 2 38.449 22 NS

Gp-3 3 331.439 44 <0.001

Total 1580.010 374 <0.001

ing to Richardson et al., 1986). In addition, three uniden-

tified non-enzymatic proteins were studied: Gp-/, Gp-2,

Gp-3. The buffer systems used, electrophoretic procedures,

staining techniques, and loci and allele designations were

those described by Capula (1990, 1994b).

Analysis. Genotypic and allelic frequencies were deter-

mined by direct counts from allozyme phenotypes, and the

resulting data were analysed by various statistical meth-

ods to describe the genetic structure of the P. muralis pop-

ulations. Genotypic proportions expected on the basis of

Hardy-Weinberg equilibrium were calculated by Levene’s

formula (Levene 1949) for small samples. The statistical

significance of departures from Hardy-Weinberg equilib-

rium was estimated using a test for calculating exact sig-

nificance probabilities, analogous to Fisher’s exact test

(Elston & Forthofer 1977). To determine whether the het-

erogeneity in the genotypic distribution reflects differences

in allele frequencies, the variation in genic proportions

among populations was subjected to a contingency ?

Table 3. Genetic variability parameters in Podarcis muralis populations. A, mean number of alleles per locus; P, mean proporti-

on of polymorphic loci; H,, observed mean heterozygosity; H., expected mean heterozygosity; SE, standard error.

Population A P H, SE H, SE

Guadarrama 1,0 0.0 0.000 0.000 0.000 0.000

Anso 1.0 0.0 0.000 0.000 0.000 0.000

Ordesa 1.0 4.2 0.026 0.026 0.022 0.022

Deba 1.0 4.2 0.010 0.010 0.010 0.010

Albaran 1.0 0.0 0.000 0.000 0.000 0.000

Bidache 1.1 8.3 0.038 0.027 0.038 0.027

Le Chiroulet 1.0 4.2 0.008 0.008 0.008 0.008

St. Gaudens 1.1 4.2 0.031 0.031 0.029 0.029

Bonn 1.0 4.2 0.015 0.015 0.015 0.015

Cavalese 1.0 0.0 0.000 0.000 0.000 0.000

Cesena IF 12.5 0.038 0.023 0.040 0.024

Resceto 1.1 8.3 0.038 0.027 0.042 0.029

Chiusdino 1.2 16.7 0.064 0.032 0.066 0.033

Populonia Itoi 8.3 0.038 0.027 0.036 0.025

Uccellina Mountains 12 12.5 0.038 0.028 0.067 0.039

Ostia ileal 1225 0.031 0.018 0.030 0.017

Elba Island 1.1 12.5 0.077 0.046 0.055 0.031

S.to Portoferraio Islet 1.1 12.5 0.019 0.019 0.077 0.043

Gorgona Island Nell 8.3 0.029 0.021 0.028 0.020

Pianosa Island 1.1 8.3 0.038 0.027 0.042 0.029

La Scola Islet 12 16.7 0.077 0.046 0.097 0.046

Palmaiola Island 1.1 8.3 0.032 0.023 0.024 0.017

Viotia 1.0 0.0 0.000 0.000 0.000 0.000

Bonn zoological Bulletin 57 (2): 189-196

©ZFMK

Massimo Capula & Claudia Corti

192

8c0'0 6S0:0 €r00 re0O0 FrIO0 6s00 I1r00 Of00 sSe00 800 erp00 Sso0 er00 se00 S600 L800 0010 L800 L800 1600 L800 L800 Zh,

— 0c0'0 0000 co00 O0c00 O100 000 cood £000 £000 c000 cIl0O0 cooo0 £700 e800 Sr00 LS0OO0 Srh0O0 9F00 6r00 SrO0 Sr00 A

— 9700 ¢t00 0000 Te00 Lt0O0 P20 sed00 6700 800 IP00 900 LOO 600 £800 L600 7800 £800 L800 7800 7800 ial

— c000 ced00 0000 0000 0000 0000 900°0 0000 0000 0000 Lc0 I800 rr00 9500 £r00 Frr00 LOO f£r00 EF00 L

— Lao 9100 1000 1000 0000 £000 coood0 e100 1000 I100 csoo sro0 LS00 SroO0 sSrO0 s8F00 Sro0 Sro0 S

— croo rt00 LIOO 67200 LIDO LOO LOO 900 6700 1600 7800 9600 7800 £800 L800 7800 7800 qu

~ loo 6000 e100 17200 O100 O100 rI00 cred L900 6800 cLO0 6800 6500 £900 6500 6S50°0 ro)

~ 1000 000°0 s00;0 0000 so000 cood0 cco es00 sro0 LSOO0 SPro0 SrdO0 6r00 SPro0 Srd00 d

~ 0000 0000 1000 7000 8000 9000 1900 €s00 S900 es00 E€s00 LS00 S00 €S0°0 O

~ 1000 0000 £000 000 e100 soo Lr0O0 6s00 9600 LPOO OS00 9600 9F0°0 N

~ 9000 +vIl00 6000 e100 rs00 9F00 8800 9700 9600 6r0'0 9600 94600 W

“1000 000° Lcd0 9F00 rr00 OS00 er00 PrrOO0 er00 er00 £00 al

— 1100 6€00 ¢€900 9500 8900 sso0 9500 6800 sso0 ss0'0 a

-— 9c00 OS00 £700 S00 er00 £700 9F00 er00 £Er00 f

~ 6400 [200 ¢€800 0400 [2400 +200 0200 0200 I

~ L00°0 000°0 = 900°0 L000 000°0 9000 900°0 H

~ 6000 000° 0000 €00:0 0000 0000 D

— 0100 3000 0000 O100 O100 d

— 000°0 £000 0000 000°0 a

— €00°0 000°0 000°0 d

— €00°0 €00°0 8)

— 000°0 d

= Vv

A N L S u re) d O N W all a f I H 3) J d d 2) d Vv

NOILVTOd0d

“| [qe as (Z—V) suonendod jo ulsi10 yeorydes3008 JO ‘syp.inu slasppog Jo suonendod Suoure

20ue}SIp

oouesd paseiqun (8/6]) S,19N JO sonyeA “Pp a[quy

©ZFMK

Bonn zoological Bulletin 57 (2): 189-196

Genetic variation in Podarcis muralis 193

analysis (Workman & Niswander 1970). The genetic vari-

ability of populations was estimated using the following

parameters: mean number of alleles per locus (4); percent-

age of polymorphic loci, at the 99% level (P); observed

mean heterozygosity (H,); expected mean heterozygosi-

ty in Hardy-Weinberg equilibrium (/7,) (unbiased estimate;

Nei 1978). The genetic relationships among the studied

populations were evaluated using Nei’s unbiased genetic

distance (D, Nei 1978). All genetic variability and genet-

ic distance measures were calculated using the computer

program BIOSYS-2 (Swofford & Selander 1999). An es-

timation of phenetic relationships among populations was

obtained by generating a phenogram of all samples by

means of the unweighted pair-group method with arith-

metic averaging (UPGMA) based on the matrix of Nei’s

unbiased genetic distances (Sneath & Sokal 1973).

RESULTS

Of the 24 electrophoretic loci analysed, ten (46%) were

monomorphic and fixed for the same allele in all samples

(Mdh-1, Mdh-2, Idh-2, Gapd, Sod-l, Got-2, Mpi, Gpi,

Pgm-1!, Ada). Fourteen loci (54%) were found to be poly-

morphic («Gpd, Ldh-l, Ldh-2, Me-l, Me-2, Idh-l, 6Pegd,

Got-l, Ck, Pgm-2, Ca, Gp-1, Gp-2, Gp-3). The Me-I and

Pgm-2 loci only were highly polymorphic, while the oth-

er 12 loci were weakly polymorphic. Four samples out of

the 23 analysed were characterized by a unique allele (sen-

su Slatkin 1987): St. Gaudens (6Pgd!!°), Ostia (Gp-1!),

Gorgona Island (Me-2!), Elba Island (Got-1/9#). The re-

sults of the contingency y2 analysis are given in Table 2.

The analysis reveals that 9 out of 12 variable loci exhib-

it statistically significant heterogeneity in the allele fre-

quencies. This result shows that there are significant dif-

ferences among the gene pools of the studied samples, in-

dicating local genetic differentiation and a relatively high

degree of substructuring among populations. Significant

deviations from Hardy-Weinberg equilibrium in the direc-

tion of heterozygote deficiences were found in the follow-

ing populations and loci: Bonn (Me-/, P<0.005), Chius-

dino (Gp-3, P<0.05).

Genetic variability parameters (4, P. H,, H.) are reported

in Table 3. The overall number of alleles per locus (A) was

1.07, ranging from 1.0 to 1.2. The proportion of polymor-

phic loci (P) ranged from 0 (Guadarrama, Anso, Albaran,

Cavalese, Viotia) to 16.7% (Chiusdino, La Scola Islet), av-

eraging 7.25%. The observed heterozygosity (H,,) showed

a similar trend, ranging from 0 (Guadarrama, Anso, Al-

baran, Cavalese, Viotia) to 0.077 (Elba Islands, La Scola

Islet), and averaging 0.028. The samples from Spain, Ger-

many and Greece are characterized by very low levels of

genetic variability (Spain: average P = 1.68%, average H,

= 0.007; Germany: P = 3.8%, H, = 0.015; Greece: P =

Bonn zoological Bulletin 57 (2): 189-196

Oo. QS O. 03 0.02 0.0 \

0.06

Nei’s D

1OMOMVA>SY

<ac

NCHAOXAOZWNZTU!

Fig. 1. |Phenogram generated by UPGMA cluster analysis ba-

sed on Nei’s (1978) unbiased genetic distances among Podar-

cis muralis populations. For geographic origin of populations

(A—Z) see Table 1.

0%, H, = 0) when compared with the ones from France

(average P = 5.57%, average H, = 0.023) and mainland

Italy (average P=10.11%, average H, = 0.036). Howev-

er, it must be noted that Germany and Greece were rep-

resented in the analysis only by a sample respectively. Per-

cent polymorphism and observed heterozygosity detect-

ed in island populations from the Tuscan Archipelago

(Tyrrhenian Sea) were higher than those found in main-

land samples (islands: average P = 9.52%; average H,=

0.045; mainland: average P = 5.89%; average H,= 0.022);

however the differences in polymorphism and heterozy-

gosity values between mainland and insular samples were

not statistically significant (P, P = 0.141; H,, P = 0.029,

t-test). The samples from La Scola and Elba islands show

the highest heterozygosity (H,, = 0.077), and the sample

from La Scola Islet exhibits the greatest genetic variation,

with A = 1.2, P= 16.7%, and H, = 0.077.

The values of genetic distance for each pairwise compar-

ison are given in Table 4. Nei’s genetic distance (D) ranges

from 0 to 0.100, averaging 0.036. Based on the analysis

of genetic distance data, two main population groups can

be recognized: the first includes the samples from Spain

and SW France, which are genetically very close (aver-

age D = 0.003; D ranging from 0 to 0.010), the second

includes all other samples (Germany, Italy, Greece) (av-

erage D= 0.017; D ranging from 0 to 0.059; see Table 4).

The ave-rage genetic distance between the two groups is

relatively high (D = 0.059; D ranging from 0.043 to

0.100). The comparison between the populations from

western Europe (Spain, SW France) and Greece (Viotia)

gives the highest genetic distances (D ranging from 0.087

©OZFMK

194 Massimo Capula & Claudia Corti

to 0.100; see Table 4). Genetic differentiation was rather

low among insular populations from the Tuscan Archipel-

ago (average D = 0.017; D ranging from 0 to 0.042), and

relatively low between insular and mainland populations

(average D = 0.040).

The genetic relationships among the samples studied are

presented in Figure 1. The UPGMA clustering procedure

revealed two main clusters in the phenogram constructed

on the basis of the matrix of Nei’s unbiased genetic dis-

tances. The first cluster includes the closely related sam-

ples from Spain and SW France. Within the second clus-

ter the existence of four subclusters should be noted. The

first subcluster includes the sample from Bonn (Germany),

which is linked to the subcluster containing the closely

grouped samples from Italy and four Tyrrhenian islands

(Elba, Palmaiola, Pianosa, Gorgona), the third includes the

samples from other two Tyrrhenian islands, i.e. Scogliet-

to di Portoferraio and La Scola, the fourth contains the

sample from Viotia (Greece).

DISCUSSION

The results of the allozyme analyses indicate that genet-

ic variability is relatively low in P. muralis. The Common

wall lizard shows values of polymorphism and heterozy-

gosity higher than those estimated by Capula (2004) for

P. raffonei (P = 4.8%; H,= 0.011), similar to those ob-

served by Capula & Ceccarelli (2003) for Italian popula-

tions of P. sicula (P = 10%; H, = 0.029), and lower than

(1) those detected in the phylogenetically related P. wa-

gleriana from Sicily (P= 15%; H,= 0.037; Capula, 1994b)

and P. tiliguerta from Sardinia and Corsica (P= 22%; Hj=

0.066; Capula, 1996), (11) the average ones calculated by

Capula (1990) for nine species of the genus Podarcis (P

= 13%; H,= 0.053), and (111) the average ones calculated

by Nevo (1978) for 17 species of reptiles (P = 22%; H,

= ().047). The highest values of heterozygosity were found

in the samples from Elba Island and La Scola Islet (Tus-

can Archipleago, Tyrrhenian Sea), whereas the lowest ones

were observed in some samples from Spain (Guadarrama,

Anso, Albaran), Italy (Cavalese) and Greece (Viotia).

Based on the theory (see e.g. Nei et al. 1975, Gorman et

al. 1975, 1978) we expected to find low levels of genet-

ic variability in the insular samples of P. muralis. Our re-

sults were in some way not congruent with these expec-

tations, as some samples from the Tuscan Archipelago

(e.g. Elba, La Scola) were characterized by levels of per-

cent polymorphism and heterozygosity higher than those

found in most of the populations from mainland Italy,

Spain, SW France, Germany and Greece. This result in

agreement with the allozyme data provided by Capula

(1997) indicating that the insular P. muralis populations

from Elba Island, Isolotto di Porto Ercole Islet and Argen-

Bonn zoological Bulletin 57 (2): 189-196

tarola Islet (Tyrrhenian islands) are characterized by lev-

els of percent polymorphism and heterozygosity higher

than those found in the populations from the Italian Penin-

sula, and much higher than those observed in the conti-

nental populations from the Italian Alps, Spain and Aus-

tria (Capula 1997). Within the lacertid lizards, levels of

genetic variation are known to be large only in mainland

populations of a few species (e.g. Adriatic populations of

P. sicula: average H,= 0.09 (Gorman et al. 1975); Acan-

thodactylus spp.: average H,= 0.18, average P = 50%;

Blanc & Cariou 1980), while populations living on relict

islands and on tiny fringing islands (1.e. very small islands

that are separated by a short linear distance from the moth-

er island or continent) are usually characterized by very

low values of per cent polymorphism and heterozygosi-

ty (Gorman et al. 1975). However, the investigated

Tyrrhenian islands can be considered as relict islands, as

their lizard populations are genetically differentiated from

the mainland ones. Moreover, one of the islands consid-

ered here (Elba) is a large island (223 km2), while the oth-

er (La Scola) is a tiny island (0.016 km2), and both are

separated by a relatively short geographic distance from

mainland (peninsular Italy).

Among reptiles, high levels of genetic variation found in

populations of some species (e.g. Podarcis sicula, Cne-

midophorus tigris) are ascribed to high vagility and con-

sequent low levels of inbreeding (Gorman et al. 1977).

This does not seem to be true in the genetically highly vari-

able species of Acanthodactylus, as these are territorial

lizards (Blanc & Cariou 1980). Podarcis muralis is a ter-

ritorial lizard as well (Steward 1965), but in this case on-

ly some populations — almost exclusively island popula-

tions (Elba and La Scola: this paper; Elba, Isolotto di Por-

to Ercole, Argentarola: Capula 1997) — exhibit high ge-

netic variability. As suggested by Capula (1997), this is

probably because the insular populations inhabit margin-

al environments characterized by temporal and ecologi-

cal instability. According to Lewontin (1974), in such en-

vironments no particular genotype is favoured for long pe-

riods and natural populations usually show levels of ge-

netic variability higher than those found in more stable en-

vironments. On the basis of these considerations, finding

greater genetic variability in insular populations of P. mu-

ralis could indicate that high heterozygosity levels can be

preserved after colonization events in marginal popula-

tions of vertebrates, unless founder populations are so

small that bottleneck effects occur.

The genetic heterogeneity analysis demonstrates a certain

amount of genetic differentiation among local populations

of P. muralis, with a relatively high level of genetic sub-

division. Allozyme data show that, at the scale of the study,

genetic variation in P. muralis is distributed into two ma-

jor population groups: the first includes the closely relat-

OZFMK

Genetic variation in Podarcis muralis 195

ed samples from Spain and SW France, the second the ge-

netically recognizable samples from Germany, Italy, and

Greece. Genetic distance values found between the two

groups are relatively high (Ne1’s D ranging from 0.043 to

0.100), although falling below those normally encountered

comparing populations of well recognized biological

species of the genus Podarcis (see e.g. Mayer 1981; Thor-

pe 1983; Capula 1994a, b, c, 1996). The high genetic affin-

ity between the French and Spanish samples is congruent

with their geographic origin, as French samples are from

Pyrenean localities (F—H) close to the Spanish ones (A—E).

On the other hand, the large geographic distances sepa-

rating the French localities from the German one (Bonn)

could explain the relatively high genetic differentiation ob-

served between the samples from these countries, which

cluster separately in the UPGMA phenogram (see Fig. 1).

The data presented here are in agreement with the results

of the allozyme investigations carried out by Capula

(1997) on some P. muralis populations from Italy, Spain

and Austria, and are congruent with the results of the mo-

lecular investigations (analysis of mitochondrial DNA se-

quences) carried out by Caputo et al. (2008) and Giovan-

notti et al. (2010) on several Italian samples, which indi-

cate a certain amount of molecular divergence among P.

muralis populations, and a pronounced geographical struc-

ture of the Italian populations.

Acknowledgements. The authors wish to thank Giuseppe

Nascetti for providing facilities, financial support and assistance

during the laboratory analyses, and Wolfgang Bohme and

Valentin Pérez Mellado for their precious help and suggestions.

REFERENCES

Arnold EN, Owenden DW (2002) A field guide to the Reptiles

and Amphibians of Britain and Europe. Harper Collins Pub-

lishers Ltd., London, 288 pp.

Blanc F, Cariou ML (1980) High genetic variability of lizards

of the sand-dwelling lacertid genus Acanthodactylus. Gene-

tica 54: 141-147

Capula M (1990) Ricerche sulla struttura genetica di Podarcis

sicula, P. wagleriana e P. filfolensis (Reptilia: Lacertidae):

aspetti tassonomici ed evolutivi. Ph.D. Thesis, Universita de-

gli studi di Bologna, Bologna

Capula M (1994a) Population genetics of a colonizing lizard: loss

of variability in introduced populations of Podarcis sicula. Ex-

perientia 50: 691-696

Capula M (1994b) Genetic variation and differentiation in the

lizard, Podarcis wagleriana (Reptilia: Lacertidae). Biol. J. Lin-

nean Soc. 52: 177-196

Capula M (1994c) Evolutionary relationships of Podarcis lizards

from Sicily and the Maltese Islands. J. Zool. Syst. Evol. Res.

32: 180-192

Capula M (1996) Evolutionary genetics of the insular lacertid

lizard Podarcis tiliguerta: genetic structure and population het-

erogeneity in a geographically fragmented species. Heredity

77: 518-529

Bonn zoological Bulletin 57 (2): 189-196

Capula M (1997) High genetic variability in insular populations

of the lacertid lizard, Podarcis muralis. Biochemical System-

atics and Ecology 25: 411-417

Capula M (2004) Low genetic variation in a critically endangered

Mediterranean lizard: conservation concerns for Podarcis raf-

fonei (Reptilia, Lacertidae). Italian Journal of Zoology 71 Sup-

pl. 1: 161-166

Capula M, Ceccarelli A (2003) Distribution of genetic variation

and taxonomy of insular and mainland populations of the Ital-

ian wall lizard, Podarcis sicula. Amphibia-Reptilia 24:

483-495

Capula M, Rugiero L, Luiselli L (2009) Ecological correlates

of colour pattern polymorphism along the transition zone be-

tween two morphs of the common wall lizard, Podarcis mu-

ralis. Italian Journal of Zoology 76: 376-380

Caputo V, Giovannotti M, Olmo E (2008) Refugia-within-refu-

gia: the case of Podarcis muralis (Laurenti, 1768) in the Ita-

lian Peninsula. Pp.113—117 in: Corti C (Ed.) Herpetologia Sar-

dinie. Societas Herpetologica Italica/Edizioni Belvedere, La-

tina, “le scienze” 8, 504 pp.

Corti C, Capula M, Luiselli L, Razzetti E, Sindaco R (eds.) (in

press) Fauna d'Italia. Reptilia, Vol XLV, Edizioni Calderini

de Il Sole 24 ORE Editoria Specializzata S.r.1., Bologna

Corti C, Lo Cascio P (2002) The lizards of Italy and adjacent

areas. Edition Chimaira, Frankfurt am Main, 165 pp.

Elston RC, Forthofer R (1977) Testing for Hardy-Weinberg equi-

librium in small samples. Biometrics 33: 536-542

Giovannotti M, Nisi-Cerioni P, Caputo V (2010) Mitochondr-

ial DNA sequence analysis reveals multiple Pleistocene gla-

cial refugia for Podarcis muralis (Laurenti, 1768) in the Ital-

ian Peninsula. Italian Journal of Zoology 77: 277-288

Gorman G C, Kim Y J, Taylor C E (1977) Genetic variation in

irradiated and control populations of Cnemidophorus tigris

(Sauria, Tetidae) from Mercury, Nevada, with a discussion of

genetic variability in lizards. Theor. Appl. Genet. 49: 9-14

Gorman G C, Kim Y J, Yang S Y (1978) The genetics of colo-

nization: loss of variability among introduced populations of

Anolis lizards (Reptilia, Lacertilia, Iguanidae). J. Herpet. 12:

47-51

Gorman G C, Soule M, Yang S Y Nevo E (1975) Evolutionary

genetics of insular Adriatic lizards. Evolution 29: 52—71

Harris D J, Arnold E N, (1999) Relationships of Wall Lizards,

Podarcis (Reptilia: Lacertidae) based on mithocondrial DNA

sequences. Copeia 1999 (3): 749-754

Levene H (1949) On a matching problem arising in genetics.

Ann. Math. Stat. 20: 91-94

Lewontin R C (1974) The Genetic Basis of Evolutionary Change.

Columbia University Press, New York

Losos JB, Warheit KI, Schoener TW (1997) Adaptive differen-

tiation following experimental island colonization in Anolis

lizards. Nature 387: 70—73

Mayer W (1981) Elektrophoretische Untersuchungen an eu-

ropaischen Arten der Gattungen Lacerta und Podarcis, 111.

Podarcis tiliguerta-Art oder Unterart? Zool. Anz. 207:

151-157

Nei M (1978) Estimation of average heterozygosity and genet-

ic distance from a small number of individuals. Genetics 89:

583-590

Nei M, Maruyama T, Chakraborty R (1975) The bottleneck ef-

fect and genetic variability in populations. Evolution 29: 1—10

Nevo E (1978) Genetic variation in natural populations: patterns

and theory. Theor. Pop. Biol. 13: 121-177

Patton JL, Yang SY, Myers P (1975) Genetic and morphologi-

cal divergence among introduced rat populations (Rattus rat-

©OZFMK

196 Massimo Capula & Claudia Corti

tus) of the Galapagos Archipelago. Ecuador Syst. Zool. 24:

296-310

Richardson BJ, Baverstock PR, Adams M (1986) Allozyme elec-

trophoresis. A handbook for animal systematics and popula-

tion studies. Academic Press, London

Salvi D, Capula M, Bombi P, Bologna MA (2009) Genetic vari-

ation and its evolutionary implications in a Mediterranean is-

land endemic lizard. Biological Journal of Linnean Society 98:

661-676

Selander RK (1976) Genic variation in natural populations. Pp.

21-45 in: Ayala FJ (Ed.) Molecular Evolution. Sinauer Asso-

ciates Inc., Sunderland Massachussets

Slatkin M (1987) Gene flow and the geographic structure of nat-

ural populations. Science 236: 787-792

Sneath PHA, Sokal RR (1973) Numerical Taxonomy. W.H. Free-

man & Co., San Francisco

Soulé M (1976) Allozyme variation: its determinants in space

and time. Pp. 60—77 in: Ayala FJ (Ed.) Molecular evolution.

Sinauer Associates Inc., Sunderland Massachussets

Soulé M, Yang SY (1974) Genetic variation in side-blotched

lizards on islands in the Gulf of California. Evolution 27:

593-600

Bonn zoological Bulletin 57 (2): 189-196

Soulé M, Yang SY, Weiler MG, Gorman GC (1974) Island

lizards: the genetic-phenetic variation correlation. Nature 242:

190-192

Steward JW (1965). Territorial behavior in the wall lizard Lac-

erta muralis. Brit. J. Herpetol. 3: 224-229

Swofford DL, Selander RB (1999) BIOSYS-2: A computer pro-

gram for the analysis of allelic variation in population genet-

ics and biochemical systematics. (release 2). University of Ili-

nois, Urbana, Champaign, Illinois

Thorpe JP (1983) Enzyme variation, genetic distance and evo-

lutionary divergence in relation to levels of taxonomic sepa-

ration. . Pp. 131—152 In: Oxford GS, Rollinson D (eds.) Pro-

tein polymorphism: Adaptive and taxonomic significance. Sys-

tematics Association Special Volume 24, Academic Press,

London

Workman PL, Niswander JD (1970) Population studies on south-

western Indian tribes. II. Local genetic differentiation in the

Papago. Am. J. Hum. Genet. 22: 24-49

Received: 05.X.2010

Accepted: 20.10.2010

©ZFMK

Bonn zoological Bulletin Volume 57 | 2 pp. 197-210

Bonn, November 2010

Intraspecific variability of the Carpetane Lizard

([berolacerta cyreni [Muller & Hellmich, 1937|) (Squamata: Lacertidae),

with special reference to the unstudied peripheral populations

from the Sierras de Avila (Paramera, Serrota and Villafranca)

Oscar J. Arribas

Avda. Fco. Cambo 23; E-08003 Barcelona, Spain; E-Mail: oarribas@xtec.cat

Abstract. Canonical Discriminant (CDA), ANOVA and ANOSIM analyses were calculated for all recently known dis-

tribution areas of /berolacerta cyreni including several small and unstudied peripheral populations. The only differenti-

ated sample is Guadarrama (the nominate subspecies), with very limited overlap in the CDA (correct classification > 70%)

and different from nearly all the other samples in ANOSIM. Guadarrama is a recently differentiated but well diagnos-

able (morpho)subspecies (with lower values of dorsalia, ventralia and greater values of circumanalia). Despite the mtD-

NA differences of the Béjar specimens, their morphology is largely equivalent to that of 1. cyreni castiliana (Gredos),

but clearly differ in their female body elongation (near 1 cm) with shorter limbs, a possible strategy to increase clutch

size. Populations from the Sierras de Avila (Villafranca, Serrota and Paramera) are very similar among them. Villafran-

ca (in males) together with Beéjar (in females) are the most connected samples in MST, and the root of the species dif-

ferentiation from a morphological point of view, once discarded geographical and climatic influence on morphology. All

populations except Guadarrama shall be considered as J. c. castiliana by their morphological identity with Gredos. These

morphological similarities probably are the reflect of extensive gene flow among them, responsible of maintaining their

morphology largely equivalent.

Key words. Lacertidae, /berolacerta cyreni, Intraspecific variability, subspecies, Geographical variation, Iberian Penin-

sula.

Resumen. Se ha calculado un Analisis Discriminante Canonico, ANOVA y ANOSIM con toda el area de distribucion de

Iberolacerta cyreni, incluyendo varias poblaciones periféricas no estudiadas hasta la fecha. La unica muestra diferencia-

da es Guadarrama (la subespecie nominal), con muy poco solapamiento en el CDA (clasificacion correcta > 70%) que

difiere de practicamente todas las demas muestras en el ANOSIM. Guadarrama es una poblacion recientemente diferen-

ciada, pero bien diagnosticable como (morfo)subespecie (valores bajos de dorsalia y ventralia, y altos de circumanalia).

A pesar de las diferencias mitocondriales de Béjar, su morfologia es ampliamente asimilable a J. c. castiliana (Gredos),

siendo destacable el relativo elongamiento corporal de las hembras (casi | cm) con miembros proporcionalmente cortos,

una posible estrategia para incrementar el tamafio de puesta. Las poblaciones de las Sierras de Avila (Villafranca, Serro-

ta y Paramera) son muy similares entre si. Villafranca junto con Béjar (en machos y hembras respectivamente) estan mor-

fologicamente en la raiz de la diferenciacion de la especie (MST), una vez descartada cualquier influencia climatica o de

distancia geografica. Excepto Guadarrama, todas deben considerarse como J. c. castiliana por su identidad morfologica

con Gredos, lo que refleja la probable presencia de un flujo genético extensivo y reciente entre ellas.

INTRODUCTION

The Spanish Sistema Central consists of a series of Sier-

ras, more or less aligned in a ENE-WSW direction, which

separate the Duero (to the North) and Tajo (to the South)

river drainages, or what is the same, the Old and New

Castile plateauxes. It runs from the Portuguese Serra da

Estrela (inhabited by a relict population of /berolacerta

monticola |Boulenger, 1905]), across the Spanish Sierra

de Gata (apparently too low and dry for /berolacerta), the

Sierra de Francia with /berolacerta martinezricai (Arribas,

1996) and the main part of the Spanish portion of its range

Bonn zoological Bulletin 57 (2): 197-210

(over 240 km in length), which is inhabited in several

points by populations of the Carpetane Lizard (/berolac-

erta cyreni [Miller & Hellmich, 1937]).

The Carpetane Lizard is widespread through the main

parts of the Sistema Central and is mainly known from

Sierras de Béjar, Gredos and Guadarrama (Fig. 1). It was

raised to species level (Arribas 1996) based on allozymes

(Mayer & Arribas 1996), karyology (heterochromatiniza-

tion of sex-chromosome and localization of the NORs;

OZFMK

198 Oscar J. Arribas

Odierna et al. 1996) and adult and hatchlings pattern and

coloration. Two subspecies were defined, the nominal /.

c. cyreni from Guadarrama (type locality: Puerto de

Navacerrada), and /. cyreni castiliana from Gredos (type

locality: Circo de Gredos, Avila) to which frequently are

assimilated Béjar specimens. This latter subspecies differs

from the nominate one by a reduced dark pattern, more

dorsalia, ventralia, slightly larger diameter of the masse-

teric and hindlimb length, and lower circumanalia (Arribas

1996).

The degree of genetic differentiation between /. c. cyreni

(Guadarrama) and /. c. castiliana (Gredos) was analyzed

by Mayer & Arribas (2003), who found a mtDNA se-

quence divergence of 0.6 % in the 12s rRNA (12s) and

16s rRNA (16s) mitochondrial genes, which corresponds

to approximately 0.6 MY BP. Carranza et al. (2004) sug-

gested that both subspecies diverged approximately

0.8+0.2 MY BP, an estimation mainly based on the Cy-

tochrome b (Cyt b) mitochondrial coding gene (the 12s

and the nuclear gene C-mos were uninformative at this lev-

el), a divergence time almost identical to the one calcu-

lated by Crochet et al. (2004) using also the Cytb gene [1.6

% genetic divergence, which roughly corresponds to 0.6

to 1, with a mean of 0.8 MY BP). These two values were

very similar to the above-mentioned ciphers. The inferred

divergence time increased up to 1.2 (Cyt b) or 1.6 MY BP

(Cyt b+12s) when different terminal taxa evolutionary

models and phylogenetic methods were used (Arribas et

al. 2006; Arnold et al. 2007; respectively).

On the other hand, specimens from Sierra de Béjar

branched at the base of the 7. cyreni clade in some mtD-

NA analyses (Carranza et al. 2004; Arribas & Carranza

2004). It was suggested that the split of this populations

occurred approximately 1.7+0.3 MY BP (Carranza et al.

2004). However, in analyses using the same mtDNA re-

gions but different taxa and other evolutionary models and

phylogenetic methods than above (Arribas et al. 2006;

Arnold et al. 2007), the specimens from Béjar formed a

trichotomy with /. c. castiliana from Sierra de Gredos and

I. c. cyreni from Navacerrada.

Apart from the uninformative C-mos nuclear gene frag-

ment analyzed by Carranza et al. (2004) there is only one

other information about differences at the nuclear level,

the analysis of allozyme data by Almeida et al. (2002),

which showed a Nei’s distance of 0.002 between speci-

mens from Gredos and Guadarrama.

From West to East, the distribution of J. cyreni can be di-

vided into two axes connected by low mountain valleys

(see appendix II), but not clearly interrupted by clear cut

barriers as river valleys. One axis runs across Sierra de

Béjar (summit in La Ceya, 2.425 m) and Gredos (Alman-

Bonn zoological Bulletin 57 (2): 197-210

zor, 2.592 m), whereas the other axis is constituted by the

Sierras de Villafranca (Moros, 2.065 m), La Serrota (Ser-

rota, 2294 m), La Paramera (Zapatero, 2.160 m) and

slightly separated by lower areas, Guadarrama (Penalara,

2.430 m). The two axes greatly overlap longitudinally

leaving the Villafranca, Serrota and Parameras just to the

North of the Sierra de Gredos, but at their orographic shad-

ow for rains, and climatically more continentalised. This

explains the botanical similarities between the Paramera-

Serrota-Villafranca axis and the Sierra de Guadarrama

(Lucefio and Vargas 1991).

In Guadarrama (where Podarcis muralis also exists), I.

cyreni occurs only at the highest areas, from 1.760 m

(Puerto de Cotos, Puerto de Navacerrada) up to the peaks

(2.340 m in Penalara). In Gredos it lives almost from 1.700

to 2.500 m. It was seen in 17. VII. 1986 (own data) in

Puerto del Pico (at 1.352 m close to one of the fountains

of the pass) but recent research in this area has been to-

tally unfruitful. It is possible that these lower stations

favoured by accelerated cold winds in the mountain pass-

es (Venturi effect) had disappeared by climatic or best, by

habitat degradation due to human over-frequentation dur-

ing the last 20 years. In Béjar it has been found between

1.837 m (own data) and 2.443 m (see Lizana et al. 1988,

1992, 1993; and Martin 2005 for general data; own data

corrections for the confirmed lower limits).

Apart from the better known Sierras, the presence of the

Carpetane Lizard in the small parallel mountain ranges

called “Sierras de Avila” or ““Parameras” (composed by

three Sierras: Villafranca, La Serrota, and La Paramera)

was first discovered by the mountaineering group “Valle

de Ambles” (Lizana et al. 1993), but no specimens have

been studied so far. All aspects of morphology, status and

relationships of these small and isolated populations from

the Sierras de Avila are totally unknown. In these Sierras

the species is extremely localized, especially in La Ser-

rota and Paramera. In Sierra de Villafranca, the area with

a relatively more extended suitable area, I have found it

from 1.850 m probably up to the highest areas (Pico Mo-

ros, 2.065 m). In La Serrota it is extremely rare and lo-

calized, also cornered in the highest parts, from 2.284 m

(perhaps 1.935 m where excrements, possibly of this

species, were seen; pers. obs.) to the very summit (Pico

Serrota, 2.294 m):; and in La Paramera from 1.700 m in

the northern slopes to the summit (Pico Zapatero, 2.160

m) (own data).

After a three-year prospection of these parallel ranges, I

gathered data from these localized and barely known pop-

ulations in order to check the relationships of all the Car-

petane Lizards throughout its range. My aim is: a) to re-

assess differences between J. c. cyreni and I. c. castiliana

in the light of the existence of other small and isolated pop-

©OZFMK

Intraspecific variability in Jberolacerta cyreni 199

ulations; b) to ascertain the taxonomic status of the Bejar

populations and to check if these represent a further sub-

species; c) to study both the relationships among the sam-

ples from the Sierras de Avila (=Parameras) massifs, as

well as their similitude and differences with their neigh-

bouring and well known populations from Gredos, or the

more distant populations from Guadarrama and Bejar; and

d) as the type series of /. cyreni was destroyed during the

Second World War (SWW), to choose a Neotype for the

species (see appendix I) in order to fix unequivocally the

type locality (although apparently all lost, there were al-

sO specimens from Gredos in the original type series).

MATERIAL & METHODS

Morphology

A total of 106/92 male specimens, and 136/135 female

specimens of /. cyreni with a complete measurements

dataset and snout-vent length greater than 45 mm, were

included in the univariate (ANOVA) and multivariate (dis-

criminant) analyses, respectively. Given that these popu-

lations present sexual dimorphism (Arribas 1996, 1999a;

Arribas et al. 2006), analyses were carried out for males

and females separately. All material is from Oscar Arribas

(OA) database.

OTUs names, localities and specimens included in the

morphological multivariate analysis were as follows (Fig.

GUADARRAMA: Sierra de Guadarrama (Madrid and

Segovia provinces, Spain). 25 males and 36 females [/.

cyreni cyreni]. MIJARES: Puerto de Miyares (Sierra del

Fig. 1.

Schematic representation of the distribution of /bero-

lacerta cyreni in the Spanish Sistema Central. The different lo-

calities (OTUs) cited in the text are represented. 1: Béjar; 2: Gre-

dos; 3: Villafranca; 4: Serrota; 5: Paramera; 6: Mijares; 7: Gua-

darrama.

Bonn zoological Bulletin 57 (2): 197-210

Cabezo, Gredos Oriental Massif, Avila province, Spain).

6 males and 7 females. GREDOS: Circo de Gredos (Gre-

dos Central Massif, Avila province, Spain). 23 males and

46 females [/. cyreni castiliana]. BEJAR: Sierra de Bé-

jar (Gredos Occidental Massif, also known as Sierra de

Candelario, Salamanca province, Spain). 11 males and 28

females. VILLAFRANCA: Sierra de Villafranca (Avila

province, Spain). 20 males and 14 females. SERROTA:

La Serrota (Avila province, Spain). 3 males and 2 females.

PARAMERA: Sierra de La Paramera (Avila province,

Spain). 4 males and | female.

These populations are discontinuous among them (Appen-

dix IT) and constitute discrete geographical OTUs (Fig. 1).

Due to lower sample, it was necessary to cluster the Ser-

rota and Paramera specimens in the male discriminant

analysis, and these two plus Villafranca (all of them “Sier-

ras de Avila’”’) in the female one. However, reciprocal dis-

tances between each one of these poorly represented sam-

ples to the best represented ones were carefully checked

and commented in the results section. As the three popu-

lations from Sierras de Avila seemed to be largely equiv-

alent in the multivariate analyses, a posteriori, all of them

were treated as a single OTU (S: AVILA) in ANOVA.

Characters studied

Biometric characters. Snout-vent length (SVL); Forelimb

length (FLL); Hindlimb length (HLL); Pileus length (PL);

Pileus width (PW); Parietal length (PaL); Masseteric scale

diameter (DM); Tympanic scale diameter (DT); Anal

width (AW) and Anal length (AL). All linear measure-

ments were made with a digital calliper to the nearest 0.01

mm. These measurements were transformed to the follow-

ing more informative and not dimensional-depending ra-

tios: FLL/SVL (relative forelimb length; “FLL index’);

HLL/SVL (relative hindlinb length, “HLL index”);

PL/PW (pileus shape, ““Pileus index”); DM/PaL (relative

masseteric plate size, ““Masseteric index”); DT/PaL (rel-

ative tympanic size, “Tympanic index”); AL/AW (anal

plate surface, “Anal form index”) and AS/SVL

(V(AL*AW)*100/SVL, relative anal plate size with re-

spect to the total length, “Anal size index”’) (Arribas 1996,

2001). The results of the linear measurements and index-

es yielded largely similar results. All ratios were given

multiplied by 100 to avoid excessive decimal scores.

Scalation characters. Supraciliar Granula (GrS) for the

right and left sides; Gularia (GUL); Collaria (COLL); Dor-

salia (DORS); Ventralia (VENT); Femoralia rigth (FEMr)

and left (FEMI); 4". digit Lamellae (LAM); and Circum-

analia (CIRCA).

©ZFMK

200 Oscar J. Arribas

Statistical Procedures

Statistical analyses used in the morphological study in-

cluded both Univariate (ANOVA for SVL, scalation char-

acters and indexes, with post-hoc Tukey-Kramer tests at

P< 0.05 and P < 0.01 to detect differences among sam-

ples) as well as Multivariate techniques (Canonical Dis-

criminant Analysis, CDA). In this later analysis, each pop-

ulation is represented by a centroid (a hypothetical mid-

dle individual). Minimum-length spanning tree (MST) was

computed from the Mahalanobis’ distance matrix to de-

tect the nearest neighbours based on their position in the

multidimensional space. MST representation also avoids

distortion of UPGMA trees by the reciprocal pairwise dis-

tances recalculation in every step during their construc-

tion. UPGMA frequently clusters samples reflecting sam-

ple sizes than their true relationships. Distances of small

samples or isolated specimens appear greatly exaggerat-

ed with respect to the well represented ones. As a result

of that, the small-sized samples appear ever as the most

external or differentiated in UPGMA derived trees

(Kunkel et al. 1980; Cherry et al. 1982; Arribas 1997).

Moreover, the UPGMA trees based in very unevenly sized

samples also gave very poor Cophenetic Correlation In-

dexes between the tree-derived ultrametric distances ma-

trix and the original Mahalanobis distance matrix and

therefore we have not used them (Arribas et al. 2006).

To test the significance of the differences among pre-es-

tablished groups for the Discriminant Analysis (based in

a geographical origin), we carried out an Analysis of Sim-

ilarity (ANOSIM) (Clark 1988, 1993) that tests if the as-

signed groups are meaningful, this is, more similar with-

in groups than with samples from different groups. The

method uses the Bray-Curtis measure of similarity to con-

struct clusters of specimens. The null hypothesis 1s there-

fore that there are no differences between the members of

the compared groups (they are randomly blended). R-sta-

tistic scales from +1 to -1. Values closer +1 correspond

to a perfect case in which all groups were completely dif-

ferent (all specimens of the same group are more similar

among them than to any specimens of the other groups).

R = 0 occurs if the high and low similarities are perfect-

ly mixed and bear no relationship to the group, a common

situation if some of the groups are largely equivalent. A

value of -1 indicates that the most similar samples are all

outside of the groups (all groups largely equivalent and

randomly formed). To check for significance, pseudorepli-

cation tests (1000 randomizations) were run to test if the

given results can occur by chance. If the value of R is sig-

nificant, there is evidence that the samples within groups

are more similar than would be expected by random

chance. Even more important, pairwise tests among

Bonn zoological Bulletin 57 (2): 197-210

populations permit to test significance of the differences

among the concerned groups and to detect which ones are

really different from the others.

Mahalanobis’ (squared) distance matrices were compared

by means of Mantel Test (with 1000 permutations) with

matrices composed by Euclidean (squared) distances for

the climatic characteristics of localities: a) Precipitation

(mm) during the incubation months (July and August, as

scalation is invariant during lizard’s life); b) Annual pre-

cipitation (mm), c) Temperature (°C) (July and August);

d) Annual average temperature e) Sun radiation (n 10

kJ/(m2*day*micrometer)(July and August), and f) Annu-

al Sun radiation. Data were extracted from Ninyerola et

al. (2005). Also, these Mahalanobis’ distances were com-

pared with (d) the aerial (straight) geographical distances

among the sampling localities.

Multivariate (Discriminant and ANOSIM) analyses were

performed with Community Analysis Package 4.0 (Hen-

derson & Seaby 2007). MST trees and Mantel tests were

calculated with NTSYS 2.1° (Rohlf 2000). Univariate sta-

tistics were processed with NCSS 2001° package (Hintze

2001).

RESULTS

Males

Canonical Discriminant Analysis. The CDA conducted

with 106 male specimens shows three significant axes that

explain an 85 % of the total intersample variation. The two

first axes together explain the main part (70.6 %) and dis-

criminate fairly well the samples, especially the first one,

the unique with an eigenvalue >1. The first discriminant

axis has an Eigenvalue of 1.54 (51.2 % of variance ex-

plained; Chi-Sq. with 85 df= 200.71, P< 0.0001) and dis-

tributes the samples with fairly overlap among them, ex-

cept Guadarrama, that has only a small coincidence with

the other ones (Fig. 2 A). Guadarrama appears in the neg-

ative part of the axis, characterised by the lower values

for DORS (0.441553) and VENT (0.560765) and greater

values of CIRCA (-0.572683). Second and third axes

(eigenvalues < 1) present a considerable overlap among

the samples and do not discriminate populations.

This discriminant analysis applied to the samples reached

a 72.6% of correct classification among the specimens.

The Guadarrama sample (/. cyreni cyreni) reaches a 71.9

% of correct classification in respect to all the other sam-

ples UZ. c. castiliana).

©ZFMK

Intraspecific variability in Jberolacerta cyreni

201

Discriminant Plot - Ib. cyreni MALES

Function 2

Function 1

Discriminant Plot - Ib. cyreni FEMALES

Function 2

Fig. 2.

Function 1

Canonical Discriminant Analysis (CDA) plots for a) males (above) and b) females (below). Specimens, sample centroids

and group perimeters are represented. Guadarrama (inverted triangles), Gredos (triangles), Béjar (irregular circles), Mijares (cross),

Villafranca (asterisk) and Serrota-Paramera (sail). In females, the three last samples are grouped as Sierras de Avila (sail). Sample

centroids are represented by a square. See text for axis characteristics and results.

Minimum-length spanning tree (not represented) connect-

ing the centroid (hypothetical middle specimens) of each

sample is fairly congruent with their geographical posi-

tion, connecting in general neighbouring samples. The

most “central” (most connected) population is Villafran-

ca that connects with Gredos (at Mahalanobis Distance of

3.1870), Béjar (3.2199), Paramera (4.8042) and finally, to

the most isolated one, Guadarrama (6.8412). Two popu-

lations show overestimated distances due to their small

sample sizes: Mijares (East Gredos) that connects with Bé-

jar (7.0951), and Serrota with their neighbouring Param-

era (9.1822).

Bonn zoological Bulletin 57 (2): 197-210

Analysis of Similarity (ANOSIM) (Table 3) shows that

there is a considerable overlap among samples (R-statis-

tic = 0.122088, P < 0.005; 1000 randomizations) as our

value (that can range from | to -1), although positive, is

very small. Very significant differences among the (geo-

graphically) assigned groups, appear only among Guadar-

rama and Bejar, Gredos and Villafranca (P < 0.01) but do

not reach significance with Mijares and Serrota + Para-

mera (both with small samples). The other populations are

not differentiated among them (P > 0.01).

©ZFMK

Fig. 3. [berolacerta cyreni castiliana. a) La Covatilla Sky re-

sort (Sierra de Beéyar), July 2007, Male ; b) El Travieso (S# de

Beéjar), July 2004, Female ; c) El Calvitero (Sierra de Béjar), Ju-

ly 2004, Female (atypical pattern, with diffumination and coa-

lescence in a unique vertebral line); d) Puerto de Miyares (Gre-

dos Oriental Massif), July 2006, Female.

Bonn zoological Bulletin 57 (2): 197-210

Oscar J. Arribas

The Analysis of Variance (ANOVA) (Appendix III, Table

1) indicate that Guadarrama differs from all or nearly all

the other populations in VENT and CIRCA (with the

smaller and greater values for these parameters, respec-

tively, in the former population), but also appeared dif-

ferences between Guadarrama and Beyar in Dors (small-

er in the former), and with Gredos in PV (greater in the

former). An interesting and significant difference appears

in DORS among Gredos and Béjar samples (clearly

greater in the later).

There is no significant correlation among Mahalanobis’

distances and any of the geographic and climatic param-

eters analyzed (all Mantel Tests P > 0.05).

Females

Canonical Discriminant Analysis: The CDA conducted

with 136 female specimens shows three significant axes

that explain a 93.8 % of the total intersample variation.

The two first axes together explain a large part of the vari-

ance (85.7 %), and especially along the first one, that ac-

counts itself for 62.7 % of the total variation and is the

unique with an eigenvalue >1 (1.77), discriminating

Guadarrama specimens from the other neighbour samples

only with a small overlap (Fig. 2B). The other samples

show a considerable overlap among them. Guadarrama

discriminates towards the negative part of the axis, char-

acterised by the lower values of DORS (0.62) and VENT

(0.66) and greater ones of CIRCA (-0.38). Second and

third axes (eigenvalues < 1) present a considerable over-

lap among the samples and do not discriminate popula-

tions.

The discriminant analysis applied to the samples reached

a 74.26% of correct classification among the specimens.

Guadarrama sample (J. c. cyreni) reaches an 87.2 % of cor-

rect classification with respect all the other samples (J. c.

castiliana).

Minimum-length spanning tree (not represented) connect-

ing centroids is very similar to the male one. The most con-

nected sample is Béjar, which clusters with Villafranca (at

2.9), Gredos (3.5) and Mijares (7.38, but here exaggerat-

ed by the scarce sample of the later). Guadarrama connects

with the scarcely represented (and geographically inter-

mediate) Mijares (East Gredos) (at 6.09), and all the Sier-

ras de Avila samples cluster together (Villafranca with Ser-

rota + Paramera at 8.66).

Analysis of Similarity (ANOSIM) (Appendix III, Table

3) shows that there is a considerable overlap among sam-

ples (R-statistic = 0.162588, P < 0.001; 1000 randomiza-

tions), but the results are slightly best than for the male

©OZFMK

Intraspecific variability in /berolacerta cyreni 203

Fig. 4. [berolacerta cyreni castiliana. a) Pico Zapatero (Si-

erra de la Paramera), July 2005, Male; b) Puerto de Pena Negra

(Sierra de Villafranca), July 2006, Male; c) Pico Serrota (La Ser-

rota Massif), July 2005, Female; d) Pico Serrota (La Serrota Mas-

sif), July 2006, Male.

Bonn zoological Bulletin 57 (2): 197-210

analysis. Very significant differences (P < 0.01) appear

among Guadarrama and all the other samples except with

Miares. The other populations are not differentiated

among them (P > 0.01).

The Analysis of Variance (ANOVA) (Appendix II, Table

2), as in the male analysis, it shows that Guadarrama is

the most different one, especially in DORS, VENT and

CIRCA (the first two characters smaller, and the third one

greater in the former population). Guadarrama also dif-

fers from Gredos by its lower GUL, from Béjar by its

greater FLL, HLL, a lower SVL; and from Sierras de Avi-

la by its greater relative anal scale surface.

Also, significant differences appear in SVL between Bé-

jar (clearly the great sized female population) and Gre-

dos, and among this latter (with relative greater FLL and

HLL) with Béjar and Villafranca.

As in male analysis, there is no significant correlation

among Mahalanobis’ distances and the geographic and cli-

matic parameters analyzed (all Mantel Tests P > 0.05).

DISCUSSION

From the Discriminant and ANOVA analyses it appears

that the only differentiated sample is Guadarrama. It ap-

pears with very limited overlap with the other samples in

the CDA graphs (Figs 2 A and B). Diagnostic characters

for this population (nominate subspecies: /. c. cyreni) are

the lower values of DORS (difference more marked in fe-

males), lower values of VENT and greater CIRCA. More-

over, ANOSIM analyses show that Guadarrama is the

unique OTU that is significantly different from nearly all

the other samples, except from the close population of Mi-

jares (in both sexes) and Serrota + Paramera (but these ex-

ceptions occur only in the males and probably due to their

scarce sample size).

Mijares sample (very small) seems in some aspects ap-

proaching to Guadarrama (specially in DORS and VENT

values) but globally are clearly closer to /. c. castiliana

(specially to Béjar in male and female MST).

Populations West from Guadarrama show a great overlap

in CDA and lack differences in ANOSIM, being morpho-

logically fairly equivalent and all of them assimilable to

I. c. castiliana. There are only a few scattered very sig-

nificant differences among them (P < 0.01) in ANOVA,

as for instance among Gredos and Béjar (this latter has

greater DORS and a strikingly greater SVL and propor-

tionally shorter limbs that Gredos, but only in female spec-

imens). The reason of the longer SVL in Béjar females

(from 8 mm to | cm greater than in the other populations)

©ZFMK

204 Oscar J. Arribas

which leaves proportionately shorter limbs, can be a con-

sequence of body elongation that in lacertids appears

linked to a greater clutch size (Brana 1996). This is an in-

teresting question for future study: if Béjar specimens ef-

fectively have greater clutch size that other 1. cyreni pop-

ulations.

Both the MST results (in which Villafranca and Beéjar are

the most connected samples) as well as the presence of

related species further West (/. martinezricai and I. mon-

ticola), suggest an origin of the species towards the west-

ern extreme of their current distribution area. From these

westernmost parts, where it also occurs the higher haplo-

type diversity (see below), /. cyreni spread towards the

East. Despite that the Sierras de Avila (Villafranca, Ser-

rota and Paramera) are slightly more aligned with the

Guadarrama axis than with Gredos one, we cannot be sure

from which of these two mountain ranges the former was

colonized, as MST results in males and females are con-

tradictory. According to the male analysis Guadarrama is

more related to Villafranca, whereas in the female analy-

ses, it is Mijares (Eastern Gredos) the most related one.

The results of the mitochondrial analyses of these sam-

ples (Cyt B and 12s) (unpublished, Carranza, pers. com.)

indicates that the interruption of gene flow 1s fairly recent,

as a common haplotype appears in all populations except

Villafranca and Bejar. All Gredos, Guadarrama and La

Serrota specimens are identical for these two mitochon-

drial fragments. Independent changes in one nucleotide

with respect to the common haplotype appear in Villafran-

ca (the unique change is different in two specimens), Para-

mera, Miares and Béjar specimens, and two changes ac-

cumulate in one Béjar and one Mijares specimen (others

have only one).

The current morphological differences of Guadarrama

specimens seem to be relatively recent, and are possibly

the result of bottleneck effects during the colonization

process, or alternatively of strong selective pressures (or

a combination of both causes). Conversely, the absence

of marked differences among the other populations

(more or less with a similar age) could be due to the main-

tenance of a more continuous gene flow among them, re-

sponsible of maintaining their morphology largely equiv-

alent (nuclear genes remain unstudied). The current larg-

er geographical gap in the distribution of /. cyreni occurs

precisely between Guadarrama and the remaining popu-

lations to the West.

Despite the presumably short isolation time, as comment-

ed above, a considerable selection pressure or a genetic

bottleneck in the expanding populations might have pro-

moted and fixed the morphological differences now seen

in Guadarrama specimens. These factors do not seem to

Bonn zoological Bulletin 57 (2): 197-210

be due to isolation-by-distance processes but by histori-

cal vicariant events (cf. Irwin 2002) as there is no rela-

tionship between morphological differentiation and geo-

graphic distances. Also there is no relationship among the

more obvious climatic parameters (precipitation, temper-

ature and sun radiation) and these differences.

Concerning the position of Béjar populations, only spec-

imens from the west-facing slopes of the massif have been

studied, and therefore it is possible that in other parts of

the massif other haplotypes (the common one with Gre-

dos) could be present. The species was cited from “Puer-

to de Tornavacas, SA” (for Salamanca, sic.!; a mistake as

this locality is in Avila) (Lizana et al. 1992). This is the

natural pass between Béjar and Gredos, but I have been

unable to find it there. This place 1s a sub-Mediterranean

environment with Pyrenean Oak open forest inhabiting

populations of Zimon lepidus, Psammodromus algirus and

even Buthus occitanus, all thermophylous species typical

from dry conditions. The lower height of Puerto de Tor-

navacas (1010m) makes me to suspect that /. cyreni is not

there and the record is possibly a mistake. One possibil-

ity is that it was from the higher neighboring mountains.

An account about the pattern and coloration of [. cyreni

is in Arribas (1996) and it is especially detailed for the

main Sistema Central massifs in Perez-Mellado et al.

(1993). Both colour as well as the dark pattern, seem to

be selected in accordance to the substrate characteristics.

Overall, the background colour is brown in juveniles and

subadult specimens, changing in different percentages to

green in adult specimens (more frequently in males and

becoming more vividly linked to reproductive processes).

In populations inhabiting rocks (plenty of Rhizocarpon gtr.

geographicum lichens) as in Gredos and the upper parts

of Guadarrama (Penalara) green adults are more frequent

(both males and big females). When living in rocky talus

with sands and bare ground (as in Navacerrada area)

brownish adult specimens are more frequent (Arribas

1999b: Figs 9 and 10).

Concerning the reticulate pattern, it also varies in a dif-

ferent degree among the different populations depending

on the substrates inhabited. Juveniles and subadults have

temporal uniform or reticulate bands that coalesce during

growth with dorsal spots (more frequently in males) giv-

ing reticulated-like patterns. Usually, there is a relation-

ship between the size of the granite phanerocrystals (the

granite-rock spotting) and the habitus of the lizards liv-

ing on it. Lizards living on rocks that present large crys-

tals (as for instance the Béjar ones) are more reticulated

than specimens living in places in which the rocks pres-

ent smaller crystals (and thus finely spotted). Coloration

accounts described in Perez Mellado et al. (1993) are fair-

ly precise, especially for Gredos specimens. Concerning

©ZFMK

Intraspecific variability in Jberolacerta cyreni 205

Bejar (=Candelario in Perez Mellado et al. [1993]) the de-

scription should be corrected as, although it is true that

very old specimens are fairly reticulated, especially males,

females more frequently have two paravertebral rows of

distinctive spots (photo 2), as in females of other popu-

lations and in mid-grow specimens of both sexes in all lo-

calities. The statement that “the most common background

colour of the back and flanks is greenish or bluish” prob-

ably is true for fully adult specimens during the breeding

period, but in July and August only some big males con-

serve greenish tones, appearing even fully adult females

more or less brownish.

Concluding: a) /. c. cyreni is a recently differentiated but

well diagnosable (morpho)subspecies, a case paralleling

the relationship of 1. monticola monticola from Serra da

Estrela (Portugal) with repect to 1. m. cantabrica (from

Galicia and Cantabrian Mts.), in this later case, with no

genetic differences, but with singular morphological traits

that distinguishes it from other /. monticola in a multivari-

ate analysis (Arribas & Carranza 2004; Arribas et al.

2006). Highly variable nuclear markers as for instance in-

trons or microsatellites may help to clarify definitively the

status of these well diagnosable (morpho)subspecies.

b) Despite the mtDNA differences of the Béjar specimens

(one or two nucleotides), their morphology is largely

equivalent to /. c. castiliana. Lacking data from other Beé-

jar populations and genetic nuclear markers, I assume that

these morphological similarities reflect the presence of a

very recent gene flow with other neighbouring popula-

tions. The Béjar populations are however outstanding by

their female body elongation (up to near | cm larger), con-

serving proportionately shorter limbs, which can be a strat-

egy to increase clutch size.

c) The Sierras de Avila populations are very similar; the

closer among all the populations compared. One of them,

the Sierra de Villafranca, is together with Béjar, the most

connected sample, and it is, from a morphological point

of view, at the root of the species expansion. Both also

present the unique slightly variant haplotypes. All they

should be considered as /. c. castiliana by their closer iden-

tity with Gredos.

Acknowledgements. Dr. Sergi Pla (Barcelona, Spain), Jesus

Garcia (Huesca, Spain) and Dr. Vicente M. Ortuno (Madrid,

Spain) helped in some prospections. Dr. Salvador Carranza

(Barcelona, Spain) corrected and improved parts of the manu-

script. This study was financed completely by the author and

therefore it did not cost any Euro to the public arks. Prospec-

tions of the small Sierras de Avila and Béjar populations were

carried out under permissions n° 20051630007003 (2005),

20061630024599(2006), 2007167004130 (2007),

20081630020386 (2008), 20092390004760 (2009), issued by the

competent organisms in charge of the wildlife protection (Jun-

ta de Castilla y Leon, Spain)

Bonn zoological Bulletin 57 (2): 197-210

REFERENCES

Almeida AP, Rosa HD, Paulo OS, Crespo EG (2002) Genetic

differenciation of populations of Iberian rock-lizards [bero-

lacerta (Iberolacerta) sensu Arribas (1999). Journal of Zoo-

logical Systematics and Evolutionary Research 40: 57-64

Arnold EN, Arribas O, Carranza S (2007) Systematics of the

Palaearctic and Oriental lizard tribe Lacertini (Squamata: Lac-

ertidae: Lacertinae), with descriptions of eight new genera.

Zootaxa 1430: 1-86

Arribas O (1996) Taxonomic revision of the Iberian ‘Archaeo-

lacertae |: Anew interpretation of the geographical variation

of ‘Lacerta’ monticola Boulenger, 1905 and ‘Lacerta’ cyreni

Miller & Hellmich, 1937 (Squamata: Sauria: Lacertidae).

Herpetozoa 9 (1/2): 31-56

Arribas OJ (1997a) Morfologia, filogenia y biogeografia de las

lagartijas de alta montafia de los Pirineos. Ph. D. Thesis. Uni-

versidad Autonoma de Barcelona. (Bellaterra); 353 pp. (8 pp

and microfiche. Pub. U.A.B.)

Atribas O (1999 a) Taxonomic revision of the Iberian ’Archae-

olacertae’ 2: diagnosis, morphology, and geographic variation

of ’Lacerta’ aurelioi Arribas, 1994 (Squamata: Sauria: Lac-

ertidae). Herpetozoa 11: 155-180

Arribas OJ (1999 b) New data on the Peta de Francia Moun-

tain Lizard ‘Lacerta’ cyreni martinezricai Arribas, 1996. Her-

petozoa, Wien 12 (3/4): 119-128

Arribas OJ & Carranza S (2004) Morphological and genetic ev-

idence of the full species status of Jberolacerta cyreni mar-

tinezricai (Arribas, 1996). Zootaxa, Aucklan 634: 1—24

Atribas O, Carranza S, Odierna G (2006) Description of a new

endemic species of mountain lizard from Northwestern Spain:

Iberolacerta galani sp. nov. (Squamata: Lacertidae). Zootaxa

1240: 1-55

Arribas OJ (2008) Comments about the original description and

type specimens of /berolacerta monticola (Boulenger, 1905).

Herpetozoa 21 (1/2): 94-95

Brana F (1996) Sexual dimorphism in lacertid lizards: male head

increase vs female abdomen increase? Oikos 75: 511-523

Carraza S, Arnold EN, Amat F (2004) DNA phylogeny of Lac-

erta (Iberolacerta) and other lacertine lizards (Reptilia: Lac-

ertidae): did competition cause long-term mountain restric-

tion? Systematics and Biodiversity, London 2: 57-77

Cherry LM, Case MS, Kunkel JD, Wyles JS, Wilson AC (1982)

Body shape metrics and organismal evolution. Evolution 36:

914-933

Clarke KR (1988) Detecting change in benthic community struc-

ture. 131-142 in Oger R (eds.) Proceedings of invited papers,

14th international biometric conference, Namour, Belgium

Clarke KR (1993) Non-parametric multivariate analyses of

changes in community structure. Aust. J. Ecol. 18: 117-143

Crochet PA, Chaline O, Surget-Groba Y, Debain C, Cheylan M

(2004) Speciation in mountains: phylogeography and phyloge-

ny of the rock lizards genus /berolacerta (Reptilia: Lacertidae).

Molecular Phylogenetics and Evolution, Orlando; 30: 860-866

Franzen M, Glaw F (2007) Type catalogue of Reptiles in the Zo-

ologische Staatssamlung Mitinchen. Spixiana 30, 2: 201-274

Henderson PA & Seaby RMH (2007) Community Analysis Pack-

age 4.0 Pisces Conservation Ltd, Lymington, UK. 164 pp.

(www.pisces-conservation.com)

Irwin DE (2002) Phylogeographic breaks without geographic

barriers to gene flow. Evolution 56: 2383-2394

Kunkel JG, Cherry LM, Case SM, Wilson AC (1980) Reply to

W.R. Atchley’s “M-Statistic and Morphometric divergence.

Science 208: 1060-1061

©ZFMK

206 Oscar J. Arribas

PSE Sa dee ow

Custer eer a os

Fig. 5.

Lizana M, Ciudad MJ, Pérez-MelladoV (1988) Distribucion al-

titudinal de la herpetofauna en el Macizo Central de la Sierra

de Gredos. Rev. Esp. Herpetol. 3: 55—67

Lizana M, Ciudad MJ, Gil M, Guerrero F, Pérez-Mellado V,

Martin-Sanchez R (1992) Nuevos datos sobre la distribucion

de los anfibios y reptiles en el macizo central de la Sierra de

Gredos. Rev. Esp.Herpetol. 6: 61-80

Lizana M, Martin-Sanchez R, Morales JJ, Lopez-Gonzalez J,

Gutierrez J (1993) Nuevas poblaciones de la lagartija serrana

(Lacerta monticola cyreni) en las sierras de Avila. Bol. Asoc.

Herp. Esp. 4: 5—6

Martin J (2005) Lagartija carpetana - [berolacerta cyreni. En:

Enciclopedia Virtual de los Vertebrados Espanoles. Carrascal

LM, Salvador A (Eds.) Museo Nacional de Ciencias Natura-

les, Madrid. http://www.vertebradosibericos.org/

Mayer W & Arribas O (1996) Allozyme differentiation and re-

lationship among the Iberian-Pyrenean Mountain Lizards

(Squamata: Sauria: Lacertidae). Herpetozoa 9 (1/2): 57-61

Mayer W & Arribas OJ (2003) Phylogenetic relationships of the

European lacertid genera Archaeolacerta and Iberolacerta and

their relationships to some other ‘Archaeolacertae’ (sensu la-

to) from Near East, derived from mitochondrial DNA se-

quences. Journal of Zoological Systematics & Evolutionary

Research 41: 157-161

Bonn zoological Bulletin 57 (2): 197-210

reset) Cee eees

5o4 pee eeomet

sis aan ee

Iberolacerta cyreni NEOTYPE (here designed). MNCN n. 39934.

Miller L & Hellmich W (1937) Mitteilungen tiber die Herpeto-

fauna der Iberischen Halbinsel. II. zur Kenntnis der Lacerta

monticola. Zool. Anz. 117: 65—73

Ninyerola M, Pons X, Roure JM (2005) Atlas Climatico Digi-

tal de la Peninsula Ibérica. Metodologia y aplicaciones en bio-

climatologia y geobotanica. Universidad Autonoma de Bar-

celona, Bellaterra.<http://www.opengis.uab.es/wms/iberia/

index.htm>

Odierna C, Aprea G, Arribas OJ, Capriglione T, Caputo V, Ol-

mo E (1996) The Karyology of the Iberian Rock Lizards. Her-

petologica 52 (4): 542-550

Pérez-Mellado V, Barbadillo LJ, Barahona F, Brown RP, Corti

C, Guerrero F, and Lanza, B (1993) A systematic survey of

of the Iberian Rock lizard Lacerta (Archaeolacerta) montico-

la. In: Valakos E, Boehme W, Pérez-Mellado V and Maragou

P (eds.) Lacertids of the Mediterranean region. Athens: Hel-

lenic Zoological Society 85—105

Received: 29.VI.2010

Accepted: 15.X.2010

©ZFMK

Intraspecific variability in Jberolacerta cyreni 207

APPENDIX I

Neotype designation for /berolacerta cyreni (Miller & Hellmich,

1937)

The type series of /berolacerta cyreni (Lacerta monticola cyreni

Miiller & Hellmich, 1937) included 66 specimens (not only from

Guadarrama, the species’ type locality, but also some paratypes

from Gredos) formerly deposited in the Zool. Staatssamlung

(Herpet. Samml.) Miinchen. In fact, two syntype specimens,

male and female, respectively numbered “ZSM (SLM) 2329 a”

and “ZSM (SLM) 2329 b”, were originally considered as types

labelled “Guadarrama, Puerto de Navacerrada. W. Hellmich”.

(Miller & Hellmich, 1937).

Although it seems that all the original type series was destroyed

during the Second World War (Franzen & Glaw, 2007), and due

to the fact that in this type series there were included some Gre-

dos specimens (today part of another subspecies; /. c. castiliana),

and also that there was early confusion about the /. monticola

type locality which lead to the description of a new taxon as Lac-

erta estrellensis Cyren, 1928 (Arribas 2008), I design a new type

specimen (neotype) to fix unequivocally the type locality against

any contingence (as could be the highly improbable apparition

of any “surviving” original Gredos paratype).

I designate here as NEOTYPE for the species a specimen from

the Museo Nacional de Ciencias Naturales (Madrid) (MNCN n.

39934) (Fig. 5).

A male labelled as follows:

Left hindleg: (white label, Typewriter letter) MNCN (anverse),

39934 (reverse).

Right hindleg: (white label, pencil handwritten) “Pto. de

Cotos—Pto de Navacerrada. Srra. de Guadarrama (_ )[blank in-

side parenthesis], 21-IV—84, 18,15 h. Sol. Pedriza en pinar con

nieve. Ps=8.5 gr.” (no collector’s data).

Left foreleg: (White label, ink handwritten) Neotypus. O. Ar-

ribas designatio (anverse), “Lacerta monticola cyreni Miller &

Hellmich, 1937” (=/berolacerta cyreni) (reverse).

Right foreleg: (Red plastic label, Dymo® lettering) NEOTYPUS.

Neotype description (Fig. 5):

Biometry: Adult male with snout—vent length of 66.85 mm. Tail

126 mm (intact). Forelimb length 23.34 mm. Hindlimb length

34.52 mm. Pileus length 16.4 mm. Pileus width 8.2 mm. Pari-

etal legth 5.5 mm. Masseteric widest diameter 2.71 mm. Tym-

panic widest diameter 1.94 mm. Anal plate width 5.04 mm. Anal

length 3.19 mm. FLL/SVL (relative forelimb length): 0.349.

HLL/SVL (relative hindlimb length): 0.5163. PL/PW (pileus

Bonn zoological Bulletin 57 (2): 197-210

shape): 2.003. DM/PaL (relative masseteric plate size): 0.491.

DT/PaL (relative tympanic size): 0.352. AL/AW (anal plate sur-

face): 0.6329. AS/SVL (relative anal plate size in respect to to-

tal legth): 5.998.

Scalation: Number of supraciliary granules: 9 (rigth) and 11

(left). Supralabials: 5 (both sides). Sublabials: 6 (right side) and

7 (left side). Submaxillars: 6 (both sides). Gularia: 25. Collar-

ia: 9. Dorsalia: 53. Ventralia: 26. Femoral pores 19 (right) and

18 (left). Lamellae: 25. Circumanal Plates: 8. Rostral in full con-

tact with frontonasal. Supranasal separated from first loreal. One

postnasal (in both sides). First Postocular separated from Pari-

etal plate. Alternate wide and narrow scale rings in the tail. Twen-

ty—six scales across one of these rings.

Coloration: (in alcohol). Dorsal tract and pileus brown (proba-

bly also in life), densely spotted of medium-sized black spots

that in the middle of the dorsum nearly form transverse bands

and connect the two temporal bands. Temporal bands reticulat-

ed fairly dark (black—brown) with traces of clear occelli (bare-

ly visible) inside, also connecting with more light reticulated with

infratemporal band (barely discernible). No blue axillar occel-

li. Traces of blue points in the outermost ventral scales. Only

the outermost ventral scale ranges are clearly black spotted. Bel-

ly light bluish or white—bluish.

APPENDIX II

Barriers and high mountain passes (among parentheses) between

the different /. cyreni populations. All these intermediate areas

are at present apparently devoid of /. cvreni, thus constituting

these OTUs discrete populations:

BEJAR-GREDOS: no barrier (Puerto de Tornavacas, 1275m).

BEJAR-VILLAFRANCA: Tormes River Valley (no pass).

GREDOS-VILLAFRANCA: Tormes River Valley (Collado de

Cepegato, 1550m).

GREDOS-S? AVILA[Serrotat+Paramera]: Alberche River Valley

(no passes).

SERROTA—PARAMERA: no barrier (Puerto de Menga,

1566m).

VILLAFRANCA-SERROTA: no barrier (Puerto de Chia,

1663m).

S* AVILA (as a whole) -GUADARRAMA: no barrier (Puerto

del Boqueron, 1315m).

GREDOS—GUADARRAMA: Alberche River Valley (no pass)

©ZFMK

Oscar J. Arribas

208

IT 6£9-9C ELy

Ch 99S-€P VLy

vy C99-€l 6b

CL 6E9-€S 6bP

89°689-00 9Er

“

6LPEEO'0 rT 80'0FST'E9S 80 OFT'TZS LL OFb7 96S 87'0F89'60S ILOFIE'99S TAS/SV 2

€9£6S0'°0 9€7 PS IL-IL'6r SS89-ETSh = SP I8-18°Or 19° TL-10'SS 99°99-€8' SP iS

600°0F1b'6S ZO'OFEE'8S 10°0+6S'6S €0'0FPS 79 10'0F77'SS MAW/TV

TLy-19'8Z 1'9S-1'67 81 6r-S LZ 9€ 6£-TS ‘TZ €8°8r-18'1Z

8Z00S5°0 LL0 600°0FLE'SE Z0'OFL6'LE 10°060°9€ ZO'OFZT EE 10°0FS7'SE Ted/La

8L'€S-6b 67 98°SS-LS ‘91 p8'€S-O£ TE IZ 9b-L6'0€ 9€ 05-06 °0E

89LS10°0 rT LOOFIL bh €0'0FL6'6£ 10:0FZU' Zr Z0'OF88°LE 600 0FEE SE Ted/ING

C1608E'0 901 88°SET-EST6I O€8EE-BP'LOI I 9ZZ-91OZI O@8TZ-HI'66I PE LET-SP'S6I

ZO OFLY' FIZ ILOFZES7TZ = PO'OFTP'TIZ 70 0F87 FIZ Z0'OFEO'9I1T Md/'1d

6S PS—-68 Lr SLES-10'6bh ~—s6I'SS-€6'Eb 07 1S-6P' 8b re 9S-6£ OF

6£7709'0 690 €000FL8'0S 700'0FZ9'0S + S00'0F96'0S +00°0FLT'0S ro0';0F9r' IS "TAS/TTH

P6 8E-S6'IE IOLE-LLZE = LE-TH-TT'6T 99° SE-E8'TE 16 6418 0€

x 176940'0 7S'Z €00 OFSS'PE POO'OFEO'SE 900'0F9F'SE +00'0FPS FE €00°0FPT'9E TAS/T14

1-0 7-0 Z-0 €-0 €-0

x ek 60S+00'0 LO'Y L0'0¥S8'0 61 OFZL'0 ZL OFEr'O Tr OFEE'I LVOFTU'I Ad

1-0 50-0 0-0 1-0 0-0

P68LTZ1'0 rs'l 70°0L0'0 +0'0++0'0 00 91 0F910 00 107T-ug

1-0 I-0 Z-0 0-0 1-0

786089'0 850 90°0F¢7'0 60° 0FE1'0 60'0FS1'0 OF0 80'°0F7'0 td-0d

(Gal ZI Z-0 7-Z ZI

8L6698'0 1¢0 90'0F88'1 60'0F06'I OL 0FT8'I OFZ 90'0F88' I Ra

6-9 6-9 6-S 8-9 ZI-9

* eo Re ee S $00000'0 S8'8 LUOFP'L 97 OFL 17 0F£9°9 O€ OFE89 07 0F7'8 Would

O€-ITZ 67-47 67-17 67-€7 6C-CZ

9S9IPT'0 Or'l IE OFS8'PT vOFLT9Z Ev OFEI'SZ 96 0F97 E€ OFT ST WV

77-91 r7-91 7-H 07-81 IZ-91

r788L9'0 850 97 OFLO'8I OL OFTL'SI IC OFEL'SI be OFS SI 87 0F9S'81 LWaa

7-SI p7-LI TZ-SI 07-81 7-91

SLEL8T7'0 LTI 67 OFLO'SI SS OF81'61 POOFE SI O€ OFER'8I IC OFTL'SI 1WaA

67-17 87-17 6C-17 LT-STZ 97-€T

ek a pe 010000°0 87'8 77 OFPI'9Z 9€ 0F6'ST ZZOF8O'9T €€'0F99'ST T0F9'PZ INGA

LS-9P b9-0S LS9r LS-0S 9S-Sr

4 ex 60Z000'0 S19 LS OFTS ZZ TF81'SS OL'OFITIS 87 LFS'TS SS0Fb9 6b suoad

L78r00'0 €0'r €I-8 ZI-6 €1=L €I-ll ZI-8 es

ek e * se 61 0FSTOI 87 OFSP'OL IT OFEL OL Or OF9TTZI OT OFFr'OI T1090 =

87-07 67-€Z 1€-€Z S7-@Z ECNG ule

098 10°0 ble EL OFIL EZ Z9'OF9IE'ST br OFOE ST Tr 0F99'ET 9€ OFF0' FT 709 a

LI-8 SI-8 9I-L SI-6 SI-L Be

SUTFbr II 99 0F£9'II oF OF EF'OI S8'OFII 9€ OFTSOI IsI9a

I8Z6LT'0 6c I 91-8 SI-9 8I-L vI-6 €I-9 >

8079190 490 LE OFCT II S8'0F9E TI SS OF9T TI 6L 0F€8'01 LE OFF Ol ISId <

16'PL-ZI'SP 8ELL-€'8p V'TL-6 6P LETL-LU8h SPL-l'SP 3

ZLT8I1'0 06'1 6L 1FEP'E9 ITZ EFET PI LE LFre99 ZLPF60'9S OL 1FS8'19 TAS =

; (Lz=u) (S) (11=u) (pr) (¢7=u) (¢) (9=u) (7) (sz=u) (1) =

CS aS Se aes So Sr GES xa GUM Sexy CS) UU 2 Se) d Lr y V'IIAV «S uvrad Soda SaUVFIN “‘wAvVavAD SATIVIN.S

“SISATBUR SLIOUOYCIOUL SY} Ul PASN SOXOPUL PUK SID}IVILYO JO SUONLIADIQGK IO} 1X9} SpOYI|] pure [RLV]

29g ‘so[duies oper iuasd ‘7 JO SOXOpUl [ROLOWIOIG pue UONL]BdS ‘OLNOWOYdIOW WOT, (LUNLUTXBLU PUL LUINUTIUILU “10a prepuRys ‘URdLL) SISTR}S ODANCLIOSOp puke VAONV “LT eqeh

I XIGNaddV

Bonn zoolog

209

Intraspecific variability in /berolacerta cyreni

©ZFMK

P8'PZ9-90'SIb 8SPEI-EL Shh PE PPS-6S'POP IS OPL-9C9LP LES8S-L’8br

se . x 6br100'0 69> Ol OFT LOS IOOFIZOES 900F6T'PTS LIOFEL' P6r L0'0+09'€SS TAS/SV

66°99-00'0S QUSL-TWSLe 6T'B9-STLE ~—s-ZS9-06'6F ~—S 88 LOI-€0'9

9669L£°0 90'I 10'0FS8°8S €10'0FO1'09 — 800'0FF9'LS Z0'OFSL'8S 10: OFEL'9S MV/TV

9°9b-F8'0€ p8'6P-IE PT €69P-CL'TZ OL 'EP-ET'SE 6 IPI F'7Z

; ee 69r£0'0 rr 10°OF8L'LE 1OOFSP'6E 80 OFOF'SE 10;OFTS'8E L00°0F8L' PE Ted/La

py TS-IS 81 OV LS-PL'bt €O'IS-ES'SZT L9'BP-ZO'8Z 1Z'0S-00'8Z

9876900 ETT ZO'OF8E Ih 10'0FL8°0F 10: OFIL'6E Z0'0FZ0'8E 10'0F9L'9€ Ted/ING

p0'6IZ-O1'061 98'6ZT-OL'THI_ L'VET-H'TZEL OTGIZ-6O'L6I = 8B'LZ7-CT'POI

€£L190'0 I€Z OOFES 907 ZO'OF9P'FIZ OOFEO'ZIZ 7O'OFZE'SOZ 10076807 Md/'Td

IZ'6P-9E SE B0'6P-ESLE SLZS-ZBLE OT'IS-CEbr €€TS-Ol OF

£2 Fe * 6000000 96'L 800°00'br SOO'OFSP' Er SOOOF6I'Lr 800'0FPE9F S00';0Fr6'Sh ~~ TAS/TTH

El'PE-L'97 I8'S€-ThLZ —- 89'6E-EGLZ = HS HE-HS'8Z St'9€-PL 67

+m +e P ee 1000000 Tr6 900 0FE6'0E PrOOOFLSOE COO OFFE'EE 00° OF6ETE COOOFSTEE TAS/TTA

Z-0 €-0 Z-0 1-0 Z-0

S60ILS°0 €L'0 ST OFEH'O 91 0F6£'0 100970 7 OFT LOFLt'0 Ad

1-0 1-0 7-0 S$'0-0 Z-0

OZZIZL'0 ZS‘0 L0'0F71'0 90'°0FF1'0 LO'0FI7'0 60'0F61'0 900+80'0 10J-US

1-0 Z-0 Z-0 1-0 7-0

PSL169°0 950 110F9+'0 OL 0F6¢0 IV0FSS'0 81 0F87'0 IL OF8€0 vd-0d

Z-0 Z-0 7-0 7-0 7-0

€£TZ08'0 Ir'0 8L0F9S I €1'0F09'I 60°0FEL'I 87 OFIL'I ZL OFSS'I ra

6-9 6-9 6-S 6-S OI-L

ex ie +e xx 0000000 SS'II 97 OFST'L 61 0F9b'L ST0F80°L ZS'OFIL'9 ZLOFIP'S Vou

LTC LT-CTZ 67-07 97-€Z LCI

19LS+0'0 0S°7 LEOFIE PZ STOFST —« LT'OFZB"PT Ly OF87'PZ 97 OF16 EZ WV1T

6I-+1 0Z-SI OT-SI 8I-LI ZC-SI

6IZ8ZE0 Blel O€ OFTI'LI ST0F96 LI ZOFIOLI pL OFS8LI LTOFEN'LI 1 Wad

6I-SI IZ-SI Z7-SI SI-LI 17+

6PE189°0 LS‘0 87 OFIE LI €€0FTO'SI ST OFS LI plOFS8'LI 8TOFI6 LI Wad

1€-LZ 1€-LZ 1€-97Z 0€-97 67-ST

ee * ok et re 0000000 = SEST tT OFT9'6T 61 OFTE6Z «YT OFF0'6Z 0S OFS8°LZ OL OFSL'LZ INGA

SS-Sb 6S-Lr 6S-Lr pS-Ly bS-€b S

* He ek 000000°0 ~—LI'FI $9 OFEP'0S ESOFCS SPOFIT'ZS 90° 1FTP'0S ZS OFI9'LP suo 4

€1-6 ZI-8 1-6 11-6 bI-8 S

reoroc 0 €0'l ET OFL8'01 ZT OF87 01 STOFFE OI 97 OFFLO1 6 OFEE OL T1090 5

x * 97-07 67-17 €€-CZ LT-IZ Lt-61 a

ee £91000°0 90'9 Th OFSL ET LEOFIL PZ —- HE'OFS9'ST SL OFKT O€ OFE9' EZ 1nd —

SI-8 91-8 91-S ZI-8 €I-9 wm

* 101SZ0'0 88°7 Lr OF8U IT 1€ 0FP9'01 87'0F80'TI SSOFFI'OI 67 0F88'6 ISD.

bI-8 S1-8 LI-S 11-8 €I-8 2

P P 86£110°0 6E'€ 1S ‘OFST' IT 67 OFES 01 87'0F98'01 Zr OFLS'6 ZT '0F8'6 1819 8

EL18-4S' Lh pL 18-87'0S JEL 6h vETL-IP'8r ZL'6L-@O'8b =

# se * 5 Z£0000'0 €VL 80° €F7S'99 SUIFCOEL —« SB'OFLS'H9 eb CFLS €9 Sh 1F89'b9 TAS &

; (91=u) (s) (gz=u) (p) — (9b=) (¢) (L=u) (2) (9€=u) (1) =

Sr S-£ P= SZ at Sant Ge] OU co] So) a d Our hy V'TIAV ¢S UVrAA soadauDd SAUVETA waAVdVAD saTVNAd S

f=)

faa}

“So[eUUloy Mad J OF yNQ “| BqQui uUlsy °Z 9IqUL

210

Oscar J. Arribas

Table 3. Analysis of Similarity (ANOSIM) results (with 1000 randomizations). Males above diagonal and females below. The

number is the test probability results among each two concerned populations (significant results in bold).

FEM \ MAL BEJAR GREDOS GUAD. MIJARES SERR-PAR VILLAFR.

BEJAR — 0.058 0.001 0.644 0.138 0.064

GREDOS 0.021 — 0.001 0.691 0.867 0.198

GUAD. 0.001 0.001 = 0.097 0.128 0.001

MIJARES 0.53 0.039 0.327 — 0.224 0.513

SERR-PAR OM27, 0.025 0.001 0.217 — 0.86

Bonn zoological Bulletin 57 (2): 197-210 ©ZFMK

[ Bonn zoological Bulletin Volume 57 | Issue 2 pp. 211-229 Bonn, November 2010

Insights into chameleons of the genus Trioceros

(Squamata: Chamaeleonidae) in Cameroon,

with the resurrection of Chamaeleon serratus Mertens, 1922

Michael F. Barej!;*, Ivan Ineich?, Vaclav Gvozdik34, Nathaly Lhermitte-Vallarino>, Nono Legrand

Gonwouo®, Matthew LeBreton’, Ursula Bott’, & Andreas Schmitz?

1 Museum fiir Naturkunde, Leibniz Institute for Research on Evolution and Biodiversity at the Humboldt

University Berlin, Invalidenstrasse 43, D-10115 Berlin, Germany

2 Muséum National d’Histoire Naturelle, Département Systématique et Evolution (Reptiles et Amphibiens),

UMR CNRS 7205, CP 30, 25 rue Cuvier, F-75005 Paris, France

3 Institute of Animal Physiology and Genetics, Academy of Sciences of the Czech Republic, Department of

Vertebrate Evolutionary Biology and Genetics, Rumburska 89, CZ-277 21 Libéchov, Czech Republic

4 National Museum, Department of Zoology, Cirkusova 1740, CZ-19300 Prague, Czech Republic

5 Muséum National d’Histoire Naturelle, USM 30705 Département Ecologie et Gestion de la Biodiversité &

CNRS IFR 101, Parasitologie comparée et Modéles expérimentaux, 61 rue Buffon, 7 CP52, F-75231

Paris cedex 05, France

6 Université of Yaoundé I, Faculty of Science, Laboratory of Zoology, P.O. Box 812, Yaoundé, Cameroon

7 Global Viral Forecasting Initiative, BP 7039, Yaoundé, Cameroon

8 Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, D-53113 Bonn, Germany

° Muséum d’histoire naturelle, Department of Herpetology and Ichthyology, C.P. 6434, CH-1211 Geneva 6,

Switzerland

* Corresponding author: E-mail: michael@pbarej.de

Abstract. Relationships among chameleons of the genus Zrioceros in Cameroon are reviewed on a molecular basis us-

ing mitochondrial genes and by morphology. Trioceros oweni is placed basal to two distinct clades (lowland-submon-

tane species vs. submontane-montane species) and its position is discussed due to high genetic differences to the remain-

ing taxa. Within the lowland-submontane species group, distinct subclades with low genetic differences exist within 7°

montium and T. cristatus. Differing relationships to previously published results are observed within the submontane-

montane species group, resulting in taxonomic changes: 7rioceros eisentrauti 1s grouped with the two 7) quadricornis

subspecies, showing only low genetic differences, which also correlates with the similar overall morphology. The taxon

is thus assigned to a subspecific rank: T. quadricornis eisentrauti. Within the wiedersheimi-group, the former southern

subspecies is elevated to species rank, 7rioceros perreti, and two additional species have been distinguished by molec-

ular and morphological methods in the former nominate taxon. Trioceros wiedersheimi is restricted to northernmost lo-

calities, while remaining populations have been assigned to the revalidated taxon Trioceros serratus (Mertens, 1922).

Differentiating morphological characters for the three species are provided and a neotype of Chamaeleon serratus Mertens,

1922 is designated and described to ensure clarification of its taxonomic status and type locality.

Key words. Reptilia, Chamaeleonidae, Trioceros, Trioceros serratus, Africa, Cameroon, phylogeny, taxonomy.

INTRODUCTION

Only recently, Tilbury & Tolley (2009) provided molec-

ular evidence that the two former subgenera (Chamaeleo

Laurenti, 1768 sensu stricto and Trioceros Swainson,

1839) of the chamaeleonid genus Chamaeleo as recog-

nized by Klaver & BOhme (1986) represent two distinct

and valid genera. For a diagnosis of the two genera see

Klaver & Bohme (1986, 1992) and Tilbury & Tolley

(2009). Klaver & Bohme (1992) additionally provided a

detailed overview of formerly published knowledge on the

Bonn zoological Bulletin 57 (2): 211-229

cristatus-subgroup inside the Trioceros-group from

Cameroon.

The Republic of Cameroon exhibits a very high diversi-

ty of chameleon species compared to adjacent countries,

especially in montane areas (BOhme & Klaver 1981;

Gonwouo et al. 2006; Herrmann et al. 2005, 2006). At

present 14 species of chameleons are known to occur in

Cameroon. They belong to the genera Chamaeleo [five

©ZFMK

212 Michael F. Barej et al.

species: C. africanus Laurenti, 1768; C. dilepis Leach,

1819; C. gracilis Hallowell, 1842; C. quilensis Bocage,

1886; C. senegalensis Daudin, 1802], Rhampholeon [one

species: R. spectrum (Buchholz, 1874)] and Trioceros

[eight species: 7. camerunensis (Miller, 1909); T. crista-

tus (Stutchbury, 1837); 7! eisentrauti (Mertens, 1968); T.

montium (Buchholz, 1874); 7. oweni (Gray, 1831); T. pf-

efferi (Tornier, 1900); 7. quadricornis (Tornier, 1899); T.

wiedersheimi (Nieden, 1910)]. Trioceros quadricornis and

T. wiedersheimi are polytypic, with one more subspecies

[TZ g. gracilior (BOhme & Klaver, 1981), TZ. w. perreti

(Klaver & Bohme, 1992)], resp. (BOhme & Klaver 1981;

Chirio & LeBreton 2007; Gonwouo et al. 2006; Klaver

& Bohme 1986; Tilbury & Tolley 2009). According to

Klaver & Bohme (1997) and Uetz & Hallermann (2010)

one additional species (Chamaeleo laevigatus Gray,

1863) is present in Cameroon, but this species has not been

listed by other recent authors (Chirio & LeBreton 2007;

Gonwouo et al. 2006; Tilbury 2010). While some species

such as Chamaeleo gracilis or Trioceros cristatus show

a large distribution ranging at least from Nigeria to Gabon

and the Congo (Necas 2004), five species are regarded as

montane endemics occupying restricted high elevation ar-

eas along the Cameroon mountain chain, with 7) eisen-

trauti the most restricted, being endemic to the Rumpi

Hills in western Cameroon (Chirio & LeBreton 2007;

Gonwouo et al. 2006; Klaver & BOhme 1992).

Pook & Wild (1997) published a preliminary phylogeny

of Trioceros from Cameroon, and we herein provide ad-

ditional and new insights into this species group based on

additional material.

MATERIAL AND METHODS

In all, 49 combined, mitochondrial 16S and 12S rRNA

gene fragments, sequences (Tab. 1, Appendix II; museum

acronyms see below) comprising 964 bp (lengths refer-

ring to the aligned sequences including gaps) were ob-

tained. One short section (4 bp from the 12S gene) was

too variable to be reliably aligned, and was excluded from

the analyses, resulting in a total of 960 bp which were used

in the analyses. Kinyongia tavetana (AM422414/

AM422433; Mariaux et al. 2008) was used as outgroup.

Its position outside of 7rioceros was demonstrated by

Tilbury & Tolley (2009). DNA was extracted using Qi-

Amp tissue extraction kits (Qiagen) and the peqGold Tis-

sue DNA Mini Kit (PEQLAB Biotechnologie GmbH) (see

Wagner et al. 2009a). The primers l|6sar-L (light chain;

5’— CGC CTG TTT ATC AAA AAC AT - 3’) and 1 6sbr-

H (heavy chain; 5’ - CCG GTC TGA ACT CAG ATC

ACG T — 3’) of Palumbi et al. (1991) were used to am-

plify a portion of the mitochondrial 16S ribosomal RNA

gene. Additionally, a section of the mitochondrial 12S ri-

Bonn zoological Bulletin 57 (2): 211-229

bosomal RNA gene was amplified using the primers

12SA-L (light chain; 5’°- AAA CTG GGA TTA GAT ACC

CCA CTA T — 3’) and 12SB-H (heavy chain; 5’- GAG

GGT GAC GGG CGG TGT GT — 3’) of Kocher et al.

(1989). PCR cycling procedures were as described in

Schmitz et al. (2005). PCR products were purified using

Qiaquick purification kits (Qiagen). Sequences were ob-

tained using an automatic sequencer (ABI 377). Sequences

were aligned using ClustalX (Thompson et al. 1997; de-

fault parameters) and manually checked using the origi-

nal chromatograph data in the program BioEdit (Hall

1999). PAUP* 4.0b10 (Swofford 2002) was used to com-

pute the uncorrected pairwise distances for all sequences

(Tab. 2, Appendix II). We performed neighbour-joining

(NJ), maximum parsimony (MP), maximum likelihood

(ML) and Bayesian reconstructions. For ML and Bayesian

analysis parameters of the model were estimated from the

data set using Modeltest 3.7 (Posada & Crandall 1998) and

MrModeltest 2.3 (Nylander 2002), respectively. For the

MP analysis, we used the “heuristic search” with the “ran-

dom addition” option of PAUP* (Swofford 2002) with 10

replicates, using the TBR (tree bisection-reconnection)

branch swapping option. For the ML tree we used the

PhyML 3.0 computer cluster of the Montpellier bioinfor-

matics platform (http://www.atgc-montpellier.fr/phyml/)

(Guindon & Gascuel 2003). All Bayesian analyses were

performed with MrBayes, version 3.12 (Huelsenbeck &

Ronquist 2001). The exact parameters used for the

Bayesian analyses followed those described in detail by

Reeder (2003). For the Bayesian reconstruction clades

with posterior probabilities (PP) = 95% were considered

strongly (significantly) supported. Additionally, we used

bootstrap analyses with 1000 (for ML), 2000 (for MP) and

20000 (for NJ) pseudoreplicates to evaluate the relative

branch support in the phylogenetic analysis.

In the morphological analysis measurements follow stan-

dard procedures (e.g.Werner 1902; Mariaux et al. 2008)

and were taken on preserved material with an electronic

dial calliper (+ 0.1 mm). All measurements are given in

mm (Tab. 3, Appendix II). Analysis of morphological da-

ta has been performed using PAST software (Version

1.82b; Hammer et al. 2001). If measurements (e.g. femur

length) differed between body sides, mean values were

used. Photos of living specimen have been used to analyse

colouration patterns.

Investigated specimens are deposited in Muséum d’his-

toire naturelle, Geneva (MHNG); Muséum national

d’Histoire naturelle, Paris (MNHN); National Museum,

Museum of Natural History, Prague (NMP6V); Zoologi-

sches Forschungsmuseum Alexander Koenig, Bonn

(ZFMK); Museum fiir Naturkunde, Leibniz-Institut fiir

Evolutions- und Biodiversitatsforschung an der Humboldt-

Universitat zu Berlin (ZMB); Zoologische Staatssamm-

lung Miinchen (ZSM).

OZFMK

Chameleons of the genus Trioceros from Cameroon 21

RESULTS

To date ten taxa belonging to the genus Trioceros have

been recognized in Cameroon (eight species + two sub-

species), but the present phylogenetic analysis is incon-

sistent with this arrangement (Fig. 1). All four used phy-

logenetic methodologies strongly agree in the overall

topology and in all cases support the same terminal clades.

The phylogenetic analyses reveal only a single difference

(discussed below) for the individual analysis of the two

applied gene fragments (not shown), therefore, we only

discuss the results of the combined analysis.

Distances between ingroup and outgroup species averaged

11.48% (10.58%-—12.30%); Tab. 2, Appendix II). Interspe-

cific distances within the ingroup ranged from

3.21%-6.90% excluding 7: oweni.

Trioceros oweni 1s the most basal taxon in respect to all

ingroup taxa, which are grouped within one clade fully

supported in NJ, MP and ML, while still strongly, but not

fully significantly supported in the Bayesian

reconstruction (PP: 0.91). The main clade is divided into

two major subclades with strong statistical support. The

first subclade includes 7. camerunensis, T. cristatus, and

T; montium, but their mutual relationships remain

unresolved. However, partly well supported substructure

can be recognized within the two species, 7. montium and

T. cristatus. Trioceros camerunensis stands in a basal

position to 7’ montium, but this is only significantly

supported by the MP reconstruction. Within 7. montium,

we find a subdivision into three only slightly differentiated

subclades. Overall the uncorrected p-distances of the

included 7 montium vouchers range between 0.00%-

0.75%. Similarly, within 7. cristatus a similar subdivision

into three more distinct subclades is apparent. Here, the

genetic distances between the included 7) cristatus

vouchers ranges between 0.00%—1.28%.

Contrary to the first major ingroup subclade, relationships

of the species of the second major subclade remain unre-

solved and form a basal polytomy. Nonetheless, all ter-

minal clades in this second major subclade are strongly

supported and are well distinct regarding the individual

branch lengths and bootstrap support for each terminal

clade, mostly corresponding to currently accepted species

within Zrioceros. The morphologically very distinct tax-

on 7: eisentrauti is grouped together with the two de-

scribed 7. quadricornis subspecies with uncorrected p-dis-

tance values of between 0.51%-—1.08% between these three

taxa. We found only one haplotype in each of the two sub-

specific taxa, 7. g. quadricornis and T. q. gracilior, while

in T. eisentrauti we uncovered a difference of two nu-

cleotide substitutions in our newly gained sequences in

comparison to the published 12S sequence of Pook & Wild

Bonn zoological Bulletin 57 (2): 211-229

(1997). The distances of 7. eisentrauti to the nominate

form T. q. quadricornis (0.51%-—0.64%) are about equal

in size to the distances of the latter to 7. qguadricornis gra-

cilior (0.63% 0.64%). The distance of 7. eisentrauti to T.

quadricornis gracilior is only moderately higher

(1.02%-—1.08%). These values are clearly within the in-

traspecific distance range of all included Trioceros

species. Contrarily, the remaining taxa of this subclade

show a much higher genetic differentiation between each

other, ranging from 3.18%-—5.00%. These other terminal

clades correspond to the taxa 7! pfefferi and T: wiedershei-

mi. The latter hornless taxon is represented by three ge-

netically well differentiated clades. Two of them corre-

spond to the two so far described subspecies, but we find

a further significant split within the populations current-

ly assigned to the nominate form.

DISCUSSION

Following our molecular and morphological results sev-

eral changes are necessary among Cameroonian

chameleons of the genus Trioceros. The overall number

of Trioceros taxa in Cameroon is raised to eleven and two

already known taxa are revised in their taxonomic rank.

Within the Cameroonian Jrioceros, T. oweni is the most

basal taxon, while the other taxa form two subclades, in

which 7. camerunensis, T. cristatus, T. montium form a

lowland to submontane group while remaining taxa of the

second subclade inhabit submontane to montane habitats

(Pook & Wild 1997). Results and required changes will

be discussed below in separate sections referring to the

relevant species groups.

Trioceros oweni (Gray, 1831) (Fig. 2A)

Trioceros oweni, the type species of the genus Trioceros,

is the most basal in respect to all remaining Cameroon-

ian taxa (Fig. 1). The value of uncorrected p-distance be-

tween 7. oweni and the outgroup taxon Kinyongia tave-

tana (12.21%) is within the genetic distance range of all

included Trioceros taxa to the outgroup (10.58—12.30%,

Tab. 2, Appendix II). However, values of uncorrected p-

distances between 7) oweni and remaining Cameroonian

Trioceros taxa (8.57—10.22%) are significantly higher than

values in-between the remaining ingroup taxa (see Tab.

2, Appendix II), and the maximum distance value is on-

ly marginally lower than the minimum distance of all 7ri-

oceros to the outgroup taxon. Based on molecular data,

Pook & Wild (1997) suggested that 77 oweni might belong

to a distinct species group, being closer related to 7. john-

stoni, an East African species, than to other western 7ri-

oceros. In the past, Werner (1902) grouped 7: oweni to-

gether with 7. johnstoni, T: melleri and T: werneri, while

T. cristatus, T: montium, T. pfefferi and T: quadricornis be-

©OZFMK

214

Michael F. Barej et al.

Kinyongia tavetana AM422414/AM422433

Ea fad

*/*

Trioceros ap

oweni Campo region/Nkoelon E146.15

camerunensis Mt. Cameroon/Njonji E130.1

montium Rumpi Hills/Mofako Balue E179.18

montium Bakossi Mts./Edib Hills E188.19

montium Bakossi Mts./Edib Hills E188.18

montium Mt. Kupe/Nyasoso E180.15

montium Bakossi Mts./Edib Hills E188.20

montium Mt. Kupe E130.5

montium Mt. Kupe E131.3

3| montium Mt. Cameroon E130.4

montium Mt. Cameroon E131.2

cristatus Rumpi Hills/Mofako Balue E180.2

El ie

a/* 3

cnistatus Mt. Cameroon/Njonji E131.1

cristatus Mt. Cameroon/Njonji E130.2

cnstatus Mt. Cameroon/Njonji E130.3

cristatus Campo region/Nkoelon E150.8

cristatus Mamfe region/Amebishu E146.13

cristatus Mamfe region/Amebishu E150.7

quadricomis eisentrauti

gquadricornis eisentrauti Rumpi Hills/Mt. Rata E178.10

7| © quadncornis eisentrauti Rumpi Hills/Mt. Rata E178.11

bl fd

+ /%

*/x

ai fs

*/e

quadricornis quadricomis Mts. Manengouba E131.5

8| quadricornis quadricornis Mts. Manengouba E130.9

quadricornis quadricomis Mts. Manengouba E130.10

quadricornis quadricornis Mts. Manengouba E131.8

H guadncornis gracilior Mt. Oku E130.8

guadnicomis gracilior Mt. Oku E130.7

guadncornis gracilior Oku village E131.4

pfeffen

perreti Mts. Manengouba E131.6

perreti Mts. Manengouba E130.11

perreti Mts. Manengouba E130.12

serratus Mt.Mbam E178.3

serratus Mt.Mbam E178.5

eof fs

tlhe

ake

0.1

serratus Mt.Mbam E178.2

serratus Mt.Mbam E178.4

serratus Big Babanki E188.16

serratus Belo, Mt. Oku [NEOTYPE] E130.17

serratus Big Babanki E189.8

serratus Oku village E131.16

serratus Oku village E131.17

serratus Lake Oku E130.16

serratus Mt. Oku E130.15

serratus Oku village E131.7

wiedersheimi Tchabal Mbabo E91.6

wiedersheimi Tchabal Mbabo E178.1

wiedersheimi Tchabal Gangdaba E188.13

Fig. 1. | Phylogram of the combined analysis of the 16S and 12S rRNA sequence fragments (49 sequences / 960 bp in total). The

star symbol “*” denotes significantly supported nodes. [The values for the internal nodes are as follows (NJ/MP/PP/ML, respec-

tively): 1:(78/61/0.78/73); 2:(95/98/1.00/96); 3:(99/87/0.99/99); 4:(100/98/1.00/100); 5:(100/93/1.00/100); 6:(86/96/1.00/92);

7:(81/89/0.82/86); 8:(97/67/0.56/94); 9:(100/89/0.97/99); 10:(69/83/0.61/63)].

Bonn zoological Bulletin 57 (2): 211-229 OZFMK

Chameleons of the genus 7rioceros from Cameroon 215

longed to a different morphological group. A simple

BLAST search in GenBank, performing a similarity check

of sequences, of the applied 7’ oweni-sequence identified

T. melleri (16S) or T: sternfeldi (12S) to show the high-

est similarity values; both again East African species. Ac-

cording to Townsend & Larson (2002) and Tilbury & Tol-

ley (2009), 7. melleri is related to T. johnstoni. While the

only western 7rioceros (T: feae from Bioko Island, Equa-

torial Guinea) in the study of Tilbury & Tolley (2009) is

placed basal to all other Zrioceros. Similarly, Townsend

& Larson (2002) found that all western 7rioceros (includ-

ing 7: feae) studied by them stand as a sister clade to the

other members of the genus.

Hence, concerning 7: oweni our results support the view

of Pook & Wild (1997) that Trioceros taxa in western Cen-

tral Africa are more closely related to each other than to

T. oweni. The exact position of 7: oweni remains to be as-

sessed in future studies with a wider sampling from the

whole distribution area of this genus.

Lowland-submontane clade

Trioceros camerunensis (Miller, 1909) (Fig. 2B)

In the past Mertens (1964) classified 7) camerunensis as

a subspecies of 7’ montium based on morphological sim-

ilarities and zoogeographical affinity, but Klaver & Bohme

(1992) reclassified the taxon as a valid species. Our mo-

lecular results do support close relationships between 7°

camerunensis and T: montium but also confirmed its full

species status. According to Pook & Wild (1997), 7:

camerunensis 1s more closely related to T. feae (not in-

cluded in our study) than to 7’ montium.

Lowland-submontane clade

Trioceros montium (Buchholz, 1874) (Fig. 2C)

Within the well supported monophyletic 7’ montium-clade,

distinct subclades appear (Fig. 1; Tab. 2, Appendix II).

Buchholz (1874) described T. montium from Bonjongo,

Mt. Cameroon. Later Mertens (1938) described a sub-

species T. montium grafi from Mongonge, on the oppo-

site side of Mt. Cameroon. Klaver & Bohme (1992) re-

garded it only as an aberrant form and moved it in syn-

onymy with the nominate form. Based on dorsal crest

shape, Perret & Mertens (1957) indicated a possible sub-

species from the Manengouba Mts. but, as in 7. m. grafi,

Klaver & Bohme (1992) proved the occurrence of this

character to be more widespread. However, Pook & Wild

(1997) mentioned differences in the courtship livery of 7:

montium between populations. Differences in colouration

are of importance in species recognition and may play a

role in character displacement (Pook & Wild 1997; Rand

Bonn zoological Bulletin 57 (2): 211-229

1961; Wagner et al. 2009b) but further studies on this as-

pect are required. 7rioceros montium inhabits the submon-

tane zone of Mt. Cameroon, Rumpi Hills, Manengouba

Mts. area and parts of the south-western edge of the Ba-

menda Highlands (Gonwouo et al. 2006). At first glance

no morphological characters indicate a separation of pop-

ulations. Hence, we refrain to draw any premature con-

clusions at this point.

Lowland-submontane clade

Trioceros cristatus (Stutchbury, 1837) (Fig. 2D)

A similar situation appears in 7? cristatus and distinct sub-

clades are detectable within this taxon and as in the pre-

ceding case, uncorrected p-distances show only compar-

atively low differences between the clades (Fig. 1; Tab.

2, Appendix II). Stutchbury (1837) described T. cristatus

from Gabon and since then no further subspecies have

been described or taxa synonymised with 7. cristatus. Tri-

oceros cristatus is widespread in the lowland to submon-

tane zone from Nigeria to the Central African Republic,

Gabon and the Republic of the Congo (Klaver & Bohme

1992; Pauwels & Vande weghe 2008). Furthermore, the

species has been reported from Ghana and Togo (see ref-

erences in Klaver & Bohme 1992) but, these localities

must be regarded with caution, as they have not been con-

firmed recently. In contrast to 77 montium the species 1s

more widespread. A more detailed analysis of the overall

distribution must be applied before any conclusions can

be drawn.

Submontane-montane clade

Trioceros quadricornis (Tornier, 1899)-group

(Figs 2E-—G), including Trioceros quadricornis eisen-

trauti (Mertens, 1968) NEW RANK

Molecular results require changes in the former quadri-

cornis-group. Morphological distinctness (body size,

shape of dorsal crest, number and size of rostral horns,

lung morphology) between populations from southern

parts of the Cameroon mountain chain (Mt. Kupe, Manen-

gouba Mts.) and northern parts (Bamenda Highlands to

Obudu Plateau in eastern Nigeria) have already been rec-

ognized by BGhme & Klaver (1981). Uncorrected p-dis-

tance values between the taxa quadricornis and gracilior

(Tab. 2, Appendix II), indicate a very recent split and these

taxa correspond to subspecies. 7. g. gracilior is known

from the Bamboutos Mts, Mbulu Hills, Mt. Lefo, Mt. Oku

and the Obudu Plateau, while 7) g. quadricornis is pres-

ent on Manengouba Mts. and Mt. Kupe (Bohme 1975;

Bohme & Klaver 1981; Gonwouo et al. 2006; Joger 1982;

Klaver & Bohme 1986, 1992).

©ZFMK

216 Michael F. Bare} et al.

—,

Fig. 2. Cameroonian chameleons (in life): A = Trioceros oweni male (Campo region; photo by J.A.M. Wurstner). B = 7. camer-

unensis (Njonji, Mt. Cameroon). C = T. montium male; specimen with an aberrant horn shown (Big Massaka, Rumpi Hills). D =

T. cristatus male (Nkoelon, Campo region). E = 7. g. quadricornis male (Mt. Kupe). F = T. q. gracilior male (Mt. Lefo; photo by

W. Bohme). G = T. q. eisentrauti female (Mt. Rata, Rumpi Hills). H = 7: pfefferi male (Kodmin, Bakossi Mts.).

Bonn zoological Bulletin 57 (2): 211—229 ©ZFMK

Chameleons of the genus Trioceros from Cameroon DG.

We group the morphologically highly distinct taxon 7.

eisentrauti as a distinct subspecies of 7) guadricornis (Fig.

1), a position already indicated by Pook & Wild (1997).

But, while in the latter publication and in our 12S-only

analysis (not shown) eisentrauti is placed as the basal sis-

ter taxon to the two 7! quadricornis subspecies, accord-

ing to our combined results (16S, 12S) this is not the case.

Despite its morphological uniqueness (gular crest formed

of flaps in eisentrauti and a gular crest formed of conical

scales in other 7rioceros taxa), molecular results reveal

close relationships between these three taxa with values

of uncorrected p-distances within intraspecific ranges. Val-

ues of uncorrected p-distances between eisentrauti and T.

q. quadricornis are comparable to values between the 7.

quadricornis subspecies and values are only marginally

higher between eisentrauti and the subspecies T. q. gra-

cilior (Tab. 2, Appendix II). However, the taxa show a dis-

junct distribution with 7 g. quadricornis occurring in the

Manengouba area (see above) and 7! eisentrauti being en-

demic to the Rumpi Hills in western Cameroon (Gonwouo

et al. 2006; Klaver & BOhme 1997). All taxa inhabit pris-

tine montane habitats, 7? g. quadricornis occurring at al-

titudes between 1.800—2.250 maz.s.l., 7. g. gracilior at al-

titudes between 1.800—2.400 ma.s.l. and 7. eisentrauti in

altitudes above 1.150 m a.s.1., respectively (Gonwouo et

al. 2006; Pook & Wild 1997). We have located T. eisen-

trauti on Mt. Rata in the Rumpi Hills only above 1.600

m a.s.l., hence, it is probably even more restricted in its

altitudinal and overall distribution range than previously

indicated. In the original description of 7. eisentrauti

Mertens (1968) had already indicated relatedness to 7.

quadricornis taxa according to body size and shape of the

dorsal and tail crests. Bohme & Klaver (1981) emphasized

the similarities of 7’ g. quadricornis and eisentrauti in

comparison to 7: q. gracilior and remarked that rostral tu-

bercles in eisentrauti might represent reduced rostral

horns, which are present in 7: g. quadricornis (up to two

pairs of rostral horns) and 7. qg. gracilior (up to three pairs

of rostral horns). However, reduction of rostral horns is

also known in T. gq. quadricornis and T. q. gracilior

(Bohme & Klaver 1981; Mertens 1968) and BOhme &

Klaver (1981) assumed that reduced horns represent a

more derived character state. From the genetic point of

view, we are aware that the low genetic differentiation in

mitochondrial DNA might be in some cases caused by in-

trogressive hybridization in the evolutionary history of two

species. However, we believe that the similar overall mor-

phology (body shape and size, shape of the crests) of T.

quadricornis and eisentrauti also further supports our hy-

pothesis of two closely related, but conspecific taxa. Due

to the constant morphological differences between them

and their allopatric distributions we regard the taxa quadri-

cornis and eisentrauti as subspecies of a single species.

Trioceros quadricornis quadricornis (Tornier, 1899)

from the Manengouba area represents the nominate form

Bonn zoological Bulletin 57 (2): 211-229

while the taxon eisentrauti from the Rumpi Hills is giv-

en a new systematic status Trioceros quadricornis eisen-

trauti (Mertens, 1968) NEW RANK. In contrast to the

afore discussed species (7! montium and T. cristatus), any

contact zone between these two allopatric taxa can be ex-

cluded due to their highly restricted altitudinal distribu-

tion. As above, low genetic differences suggest a very re-

cent split presumably connected to the altitudinal range

shifts of the lower-temperature forests up to the mountains

after the end of the Pleistocene Ice Ages (when montane

forests in the tropics expanded to the lower elevations; He-

witt 2004). All three subspecific taxa of 7. guadricornis

could now represent species in statu nascendi.

Submontane-montane clade

Trioceros wiedersheimi (Nieden, 1910)-group

(Figs 3A—-G), including Trioceros perreti (Klaver &

Bohme, 1992) NEW RANK

Further changes are necessary within the former wieder-

sheimi-group. Klaver & Bohme (1992) described the sub-

species 7. w. perreti from Manengouba Mts. Molecular re-

sults however reveal full species status for this taxon, as

the uncorrected p-distances between 7. wiedersheimi pop-

ulations from Manengouba Mts. and populations further

north (Bamenda area, Tchabal Mbabo) are clearly within

the interspecific range of other western Trioceros species

(Tab. 2, Appendix IT). We thus herein elevate the taxon

to the full species rank: Trioceros perreti (Klaver &

Bohme, 1992) NEW RANK. The present distribution of

T: perreti covers the Manengouba Mts. and the Bakossi

Mts. (Euskirchen et al. 2000; Gonwouo et al. 2006).

Regarding the former nominate 7’ w. wiedersheimi, mo-

lecular and morphological results lead to recognition of

two distinct clades with uncorrected p-values within in-

terspecific range of this genus (Tab. 2, Appendix II). For-

merly, 7’ w. wiedersheimi has been thought to occur in

Cameroon north of the Manengouba Mts. (inhabited by

T. perreti (Klaver & Bohme, 1992), see above). It has been

found along the Cameroon mountain chain (Bamboutos

Mts., Mbulu Hills, Mt. Lefo, Mt. Mbam, Mt. Oku and Mt.

Tchabal Mbabo) and in eastern Nigeria (Gotel Mts., Mam-

billa Plateau and Obudu Plateau), where it inhabits mon-

tane savannas and grasslands between 1400 and 2450 m

a.s.l. (BOhme & Nikolaus 1989; Chirio & LeBreton 2007;

Dunger 1967; Gonwouo et al. 2006; Herrmann et al. 2006;

Klaver & Béhme 1992). Nieden’s (1910) description of

T. wiedersheimi is based on two specimens, a female from

Genderogebirge (=Tchabal Mbabo) and a subadult male

from the village Tsch’a (Bekom), Bamenda area. In the

course of describing 7. w. perreti, Klaver & Bohme (1992)

designated the female specimen as lectotype and conse-

quently restricted the type locality to the Genderogebirge

©ZFMK

218 Michael F. Bare et al.

Fig. 3. Cameroonian chameleons (in life): A = Trioceros wiedersheimi male (Mt. Tchabal Gangdaba). B = T. perreti male (Kod-

min, Bakossi Mts.). C = T. serratus male (Kedjom Keku = Big Babanki, Bamenda Highlands). D = T. serratus female (Kedjom

Keku = Big Babanki, Bamenda Highlands). E = Male neotype of 7. serratus (in alcohol; MNHN 2007.1494; Belo, Mt. Oku). F =

Illustration of 7? serratus after Mertens (1922; “Sitidkamerun”’). G = Male neotype of 7. serratus (in life; MNHN 2007.1494, Be-

lo, Mt. Oku) in situ.

Bonn zoological Bulletin 57 (2): 211-229 OZFMK

Chameleons of the genus Trioceros from Cameroon 219

(=Tchabal Mbabo). As one of the uncovered molecular

clades contains specimens from Tchabal Mbabo, topotyp-

ic material, thus this clade should correspond to 7. wieder-

sheimi. The occurrence of ZT. wiedersheimi on Tchabal

Gangdaba has already been assumed in the past (Chirio

& LeBreton 2007; Klaver & B6hme 1992) and we can

confirm its occurrence on this mountain range. Thereafter,

the species is known from the northernmost parts of its

former assumed distribution, while populations of the

southern molecular clade from the Bamenda Highlands,

Mt. Mbam, and Mt. Oku represent a distinct taxon. It is

also very likely that this clade covers populations from the

Mbulu Hills, Mt. Lefo and the Obudu Plateau in south-

ern Nigeria as this would correspond to a bordering range

from other studies (Gonwouo et al. 2006). Solely one lo-

cality in direct proximity north of the Manengouba Mts.

(see map in Gonwouo et al. 2006) appears uncertain, as

T: perreti has been regarded as restricted to the mountain

range, but the specimen was not available to us for this

study.

Mertens (1922) described Chamaeleon serratus from

“Stidkamerun” (= South Cameroon, Fig. 3F), being most

similar to T. wiedersheimi, but differing by size, promi-

nence of the temporal cristae and course of the lateral

cristae (Fig. 3E). The species has been later synonymized

with 7: wiedersheimi by Mertens himself (1940; see be-

low). Klaver & Bohme (1992) argued that 7. serratus is

a synonym of 7: wiedersheimi, as the original description,

especially the low number of scales on the scalloped dor-

sal ridge, is not consistent with 7. perreti from Manengou-

ba Mts. A comparison with the type specimen of 7 ser-

ratus was not possible, as the type specimen was proba-

bly destroyed during the Second World War (H. Wermuth

16.4.1979 in litt., in Klaver & Bohme 1992).

Mertens (1922) rightly suggested that 7’ wiedersheimi 1s

morphologically the most similar species to 7. serratus,

but obviously he only compared his material with

Nieden’s (1910) original description and not with the type

specimen, as he only cited the original sections for com-

parison. Beside the characters cited above, Mertens (1922)

mentioned that no additional distinct characters like the

shape of the dorsal crest, which is at the origin of the spe-

cific name (Mertens 1968), are given in Nieden’s (1910)

description. [Remark: Nieden (1910) stated that a dorsal

crest is lacking but, a dorsal midline is formed of two rows

of tubercle scales which are separated in groups of 3-4

scales in the male specimen from the Bamenda region].

Later, Mertens (1940) reported on a collection delivered

by M. Kohler including chameleons from the Bamenda

Highlands (four males + two females) and concluded that

T. serratus is in fact a junior synonym of T. wiedershei-

mi. His conclusion was based on the fact that males of the

Bonn zoological Bulletin 57 (2): 211-229

new material corresponded to the “paratypoid” (=

paratype) of 7 serratus, while females are consistent with

the female cotype (=syntype) of 7. wiedersheimi and fi-

nally he recognized that the prominence of the lateral and

temporal cristae is subject to individual variation. In a sub-

sequent publication on material collected by Eisentraut at

Lake Oku and Lake Manengouba, Mertens (1968) con-

firmed his former statement and remarked that males in

T. wiedersheimi also do possess a serrated dorsal crest,

while the dorsal crest is straight and simple in females.

With the exception of Lake Manengouba (recognized as

distinct by Klaver & Bohme 1992), all localities of the ma-

terial examined by Mertens belong to the newly discov-

ered southern clade.

Our morphological analysis of material throughout the dis-

tribution range of the former taxon T. w. wiedersheimi re-

vealed that distinguishing characters chosen by Mertens

(1922) are hard to assign to members of one clade, as

many characters are present in members of both clades

(lack of heel spur, lack of occipital lobes, etc.) separating

them from other taxa. Of the three main characters given

by Mertens (1922), two of them seem to be inapplicable.

According to Mertens (1922): (a) T. serratus grows larg-

er than 7) wiedersheimi, but four of ten males from Tch-

abal Mbabo and the Gotel Mts. (= 7? wiedersheimi) pos-

sess a larger body length than the largest member of the

southern clade, and the largest female also belongs to T.

wiedersheimi; (b) temporal cristae are distinct in 7. wieder-

sheimi and indistinct in 7 serratus, but this character

varies within both clades (Fig. 4), which was already men-

tioned for Bamenda populations by Mertens (1940); and

al cristae (in front of the eye first running along the eye

then in a weaker slope to the tip of the snout in 7’ wieder-

sheimi, in contrast to an even slope in direction to the tip

of the snout in 7! serratus) and this character is clearly

more applicable to specimens belonging to the southern,

previously unrecognized clade (Fig. 4). Nonetheless, with

just a few specimens of each clade a determination on this

character alone is difficult. At last, the name-giving char-

acter, a serrated dorsal crest is also present in males of both

clades. The number of scale rows forming the crenulation

is consistent in both clades (being formed of up to three

rows of scales) and the extent of crenulation along the dor-

sum and base of tail also varies in both clades. Accord-

ing to Mertens (1922) each cusp of the crenulation is 3

mm high and 4.5 mm long, but only in one very large spec-

imen of 7. wiedersheimi a comparable size has been

reached, while specimens of similar size to Mertens’

(1922) specimens possess smaller cusps in both clades.

The given type locality “Stidkamerun” does not allow any

direct localization of 7: serratus. Moreover, the subadult

male paralectotype of 7. wiedersheimi originates from the

Bamenda area (part of the southern clade) and might have

OZFMK

220 Michael F. Barej et al.

Fig. 4. | Heads in lateral view. Row 1-3: Trioceros wiedersheimi (from left to right): ZMB 21873 female (lectotype), ZFMK 75744

female, ZFMK 68943 male, ZFMK 75740 male, ZMB 21857 male, ZMB 74805 female, ZFMK 78714 male, MNHN 2005.2753

male, NMP6V 74112 male, ZFMK 75745 female, MHNG 1544.001 male, MHNG 1544.002 male. Row 4—6: T. serratus (from left

to right): MNHN 2007.1494 male (neotype), MNHN 2007.1465 female, NMP6V 74104 male, MHNG 1365.023 female, ZSM 13.1925

subadult male, MNHN 2007.1464 male, ZFMK 5801 male, MNHN 2007.1463 male, MNHN 2007.1461 female, MHNG 1365.024

female, MHNG 1010.049 male, ZFMK 5800 female.

Bonn zoological Bulletin 57 (2): 211—229 ©ZFMK

Chameleons of the genus Trioceros from Cameroon 221

understandably mistaken as part of the distribution of 7.

wiedersheimi. The distribution of the southern clade cov-

ers the main part of former distribution of 7: wiedershei-

mi and makes it more plausible to be termed “Siid-

kamerun” (South Cameroon) in comparison to the Tcha-

bal Mbabo area. Of Mertens (1922), most informative

characters, the only reasonably useful for the recognition

of T. serratus is the course of the lateral cristae. A course

corresponding to Mertens’ (1922) information is present

in members of the southern clade.

According to Article 75 of the International Code of Zo-

ological Nomenclature (ICZN 1999) a neotype is required

when no name-bearing types are believed to be extant and

it is necessary to define a taxon objectively. In our case,

a designation of a neotype is necessary because the holo-

type is lost (H. Wermuth 16.IV.1979 in litt., in Klaver &

Bohme 1992; A. Schliter, herpetological curator of the

SMNS, in litt. 8.I11.2010) and the taxon requires unam-

biguous clarification of its taxonomic status. The type lo-

cality of the taxon is now set as the collecting locality of

the neotype (Article 76 in ICZN 1999). Hence, we here

revalidate 7. serratus and provide a description of the neo-

type at the end of this section.

Submontane-montane clade

Trioceros pfefferi (Tornier, 1900) (Fig. 2H)

According to Townsend & Larson (2002) T: pfefferi is

related to (what these authors termed) 7’ quadricornis and

T: wiedersheimi, but more closely to the latter species.

While the 12S-only analysis of Pook & Wild (1997) also

suggested a grouping of 7: pfefferi and T: wiedersheimi,

an unambiguous position of this rare taxon was not

possible in our analysis with the combined 16S+12S-gene

fragments (see Fig. 1). Further, because of the lack of a

working 12S sequence for the sample of 7: pfefferi that

we used, we used a chimera-sequence consisting of the

original 12S data as published by Pook & Wild (1997; only

available in the original publication, not in GenBank) and

our new 16S data of another specimen. Therefore, all that

can be said for now is that 7: pfefferi is more closely

related to the taxa of the hornless 7. wiedersheimi-complex

than to 7’ montium or T. quadricornis, which share

morphological characters like horns with 7: pfefferi. It is

also interesting to underline that the horned species, 7.

montium, T. quadricornis and T. pfefferi, do not form a

monophyletic clade, and thus, horns evolved several times

in the evolutionary history of the western Jrioceros species

group.

Regarding the overall distribution of 7. pfefferi, this

species shows a similar distribution pattern to two other

species groups (a) 7. perreti—T. serratus — T: wiedershei-

Bonn zoological Bulletin 57 (2): 211-229

mi and (b) T. qg. quadricornis —T. q. gracilior. Both groups

show a rough distribution with one taxon in the Manen-

gouba area and a second one in the Bamenda Highlands

(additionally a third in the northernmost parts in the case

of T. wiedersheimi). As in both these groups former al-

lopatric populations have been recognized as valid taxa,

the recently discovered populations of 7. pfefferi from

Mbulu Hills and Ediango (see Gonwouo et al. 2006)

should be compared to southern populations in future stud-

les, especially as the species also inhabits

submontane/montane altitudes between 1100-1800 m

a.s.l. and might show a disjunct distribution, as well.

Noteworthy is, that present distribution data reveal a dis-

junct partitioning of montane areas in the Cameroon

mountain chain with related taxa (with the exception of

T. pfefferi, but see above) but apparently the highest peak

(Mt. Cameroon) does not posses an endemic montane tax-

on. Only the submontane 7: montium is present on Mt.

Cameroon and elevations further north, but this taxon re-

quires further studies to understand a potential distribu-

tional separation (see above).

Designation of neotype and _ redescription of

Chamaeleon serratus Mertens, 1922 (now considered

as a member of the genus T7rioceros sensu Tilbury &

Tolley 2009)

Holotype (lost). Chamaeleon serratus Mertens (1922),

Zool. Anz., 54: 191. Mus. Stuttgart, Nr. 4640 (male), pro-

bably destroyed during the Second World War (H. Wer-

muth 16.4.1979 in litt., in Klaver & Bohme 1992; A.

Schliiter, herpetological curator of the SMNS, in litt.

8.3.2010), type locality: ,,Stidkamerun™.

Neotype. MNHN 2007.1494, adult male with everted

hemipenes. Collected by Ivan Ineich on 9 May 2007 on

a palm tree near road border of the road from Anyajua to

Belo, close to Belo, Mt. Oku, Cameroon. Coordinates: N

06°10°32” E 10°21°09” (Lat.: 6.17547°, Lon.: 10.35244),

1339 m (4394 feet) a.s.].

Type locality. Belo, Mt. Oku, Cameroon

Distribution. Cameroon, Nigeria

Additional material examined (Appendix I)

Diagnosis. 7rioceros serratus differs from all other 77i-

oceros except T. wiedersheimi and T. perreti by a crest

formed by the canthi rostrales merging above the snout,

forming a depression between the tip of the snout and the

merged crest. Moreover, it can be distinguished from 7:

q. eisentrauti by the absence of gular flaps (Fig. 2D), from

T. montium, T. oweni, T. q. quadricornis, T: q. gracilior

©ZFMK

and 7: pfefferi by the absence of rostral appendages in male

specimens (Figs 2A, 2C, 2E-F, 2H) and from 7:

camerunensis and T. cristatus by the presence of a gular

crest (Figs 2B, 2D).

Trioceros serratus can be differentiated from 7. wieder-

sheimi by a combination of the following characters: 7.

serratus tends to stay smaller than 7? wiedersheimi and the

tail length / body length ratio is lower in T. serratus (Tab.

3, Appendix II): total body length, 77 wiedersheimi (max.

total length in males: 208 mm; in females: 172 mm) grow-

ing larger than 7. serratus (max. total length in males 179

mm; in females 158 mm), but this observation is not sta-

tistically significant (in males: p > 0.05 N,;,,=10,

N;,=27; in females: p > 0.05 Ny,,=8 N;,=15); mean tail

length / body length ratio is significantly higher in 7:

wiedersheimi (in males: p < 0.05 Ny, =10, Nr, =27; in fe-

males: p < 0.05 Ny, =8 N;,=15); the mean numbers of

flank scales at midbody, although values overlap, the num-

ber of flank scales at midbody is significantly higher (p<

0.01) in 7. serratus (N= 44; range: 56—76, mean: 66) than

in T: wiedersheimi (N= 19; range: 57-68, mean: 62); num-

ber of scales between the eye and the end of the head is

significantly higher (p < 0.001) in 7) serratus (N= 44;

range: 6-11, mean: 8) than in 7) wiedersheimi (N= 19;

range: 5—9, mean: 7) and single scales tend to be distinct-

ly larger in 7. wiedersheimi (Fig. 4); the course of the lat-

eral cristae in front of the eye, decreases almost steadily

from the eye to the tip of the snout in 7! serratus, while

it first runs along the eye and then, from a point approx-

imately at the middle of the eye, in a lower slope to the

tip of the snout in 7. wiedersheimi.

Trioceros serratus can be differentiated from 7: perreti by

a combination of the following characters: total body

length of similar size but, although largest specimens be-

long to T. serratus, the mean total length is slightly high-

er in 7. perreti (in males: p > 0.05 Ny, =25, Ny, =27; in

females: p > 0.05 Ny, =10, N;,=15); mean tail length /

body length ratio is significantly higher in 7. serratus in

males (p < 0.05 N;,,=25, Ny, =27) lower, but not signif-

icantly, in females (p > 0.05 N7,=10 N;,=15); mean

numbers of flank scales at midbody, although values clear-

ly overlap, the number of flank scales at midbody is sig-

nificantly lower (p < 0.001) in 7! serratus (N= 44; range:

56-76, mean: 66) than in 7. perreti (N= 36; range: 65-86,

mean: 74; in one single specimen even 93); number of

scales between the eye and the end of the head is signif-

icantly lower (p < 0.001) in 7. serratus (N= 44; range:

6-11, mean: 8) than in 7! perreti (N= 37; range: 9-15,

mean: 11), scales behind the eyes are of similar size to

flank scales in T. perreti and slightly enlarged in 7. ser-

ratus; maximum length of gular crest is significantly high-

er in T. serratus than in T: perreti (in males: p < 0.001

Nz) =25, Ny,=27; i females: p < 0.001 N;,=12,

Bonn zoological Bulletin 57 (2): 211—229

Michael F. Barej et al.

N;,=!7); length of mouth gap / distance mouth gap to tip

of helmet ratio is significantly higher in males of 7: ser-

ratus (p < 0.05; Np, =25, Ny, =27), while the value is not

significant in females (p > 0.05; Ny, =12, Ny. =17); dor-

sal part of the casque flat in 7 serratus (and T: wieder-

sheimi) and convex in T. perreti (BOhme & Klaver 1992).

For morphometrics see Tab. 3, Appendix II.

Description of the neotype. Adult male in good condi-

tion; body shape slender, laterally compressed; body

length (measured from snout tip to cloaca) 83.0 mm; tail

length 76.0 mm; tail base swollen and both hemipenes

everted (Fig. 3F); vertical eye diameter 7.0 mm; canthus

parietalis formed of 7 scales, measuring 6.8 mm (few ad-

ditional slightly rough and ridged scales cranially of the

parietal crest); distance snout tip to tip of helmet 24.3 mm;

rostral crest merging above snout tip; rostral appendages

absent; lateral and temporal crest distinct, both crests fus-

ing posteriorly; occipital lobes absent; length of mouth gap

12.3 mm, mouth slightly opened; throat with fine longi-

tudinal grooves between scale rows; gular crest present,

formed of 24 scales, max. length of gular crest scale 1.7

mm, gular crest passing into ventral crest; lateral head

scales behind eye enlarged in comparison to flank scales;

lateral body scalation subhomogeneous but with inter-

posed enlarged scales; dorsal crest present, serrated,

formed out of 2-4 scales, diminishing in height caudally,

scales of dorsal crest larger than flank scales; scales on

extremities and tail (laterally and ventrally) of similar size

as on body; fingers terminate in a single claw; hind feet

without tarsal spurs.

Colouration in live (Fig. 3G): general body colouration

greenish, enlarged scales on flanks pale brown, lateral and

upper side of head pale bluish, upper eye border bright yel-

low, gular region green, upper most part of flanks and low-

er flank pale blue.

Colouration in alcohol (Fig. 3E): head and body dark grey-

ish, gular crest of the same colour as body, ventral crest

pale grey; sole of foot and palm of hand whitish; everted

hemipenes whitish.

Variation. The number of interposed enlarged scales on

flanks vary in number per line and also in number of lines.

Length of gular crest scales and their number is quite vari-

able (Tab. 3, Appendix I). Comparing the sexes, males

show a higher body length — tail ratio than females and

longer scales forming the gular crest (Tab. 3, Appendix

II). Females generally possess a dorsal ridge, the dorsal

midline is slightly serrated in one specimen (MNHN

1998.0415) forming an indistinctly serrated dorsal crest.

Colouration. The general ground coloration tends to be

greenish or brownish. Enlarged scales on the flanks tend

©ZFMK

Chameleons of the genus Jrioceros from Cameroon 223

toward being brown or blue and more conspicious (Figs

3C—D). A bright stripe of differing colouration runs from

the anterior part of the eye (or even starts in front of the

eye) and splits into rays of colour on the eyelid; one of

them running backwards along the temporal crest or be-

tween the temporal and lateral crest (Figs 3C, G). As in

T. wiedersheimi the venter is brighter than the flanks and

is pale blue or a lighter green / brown in living specimens

(Fig. 3C). Blue colouration may be scattered around the

mouth gap, on the top of the head, and on the flanks. The

ventral line is whitish. In alcohol colourations fade away

and specimens turn either pale grey-bluish (leaving some

of the brighter rays on the eye visible) or turn dark and

colours disappear almost completely.

Distribution. The species is known to occur in Cameroon

and Nigeria. Within Cameroon it inhabits montane savan-

nahs in the Bamenda Highlands and Mt. Mbam, and in

Nigeria it has been reported from the Obudu Plateau

(Bohme 1975; Akani et al. 2001). In contrast, reports from

the Gotel Mts in Nigeria (BOhme & Nikolaus 1989) can

be referred to T. wiedersheimi.

Genetics. The genetic comparison for the uncorrected p-

distances of the combined mitochondrial 16S+12S rRNA

fragments (Tab. 2, Appendix II) with the two morpholog-

ically most similar species 7: wiedersheimi and T: perreti

gave the following results: interspecific comparison be-

tween 7) serratus and T. wiedersheimi ranged between

3.22% 4.08%, while the intraspecific variation within 7°

serratus was much lower at 0.00%-—0.42% (N= 12). The

interspecific difference between 7. serratus and T. perreti

ranges from 4.33%—4.86%, while those between the taxa

T: perreti and T. wiedersheimi reach 3.74%-4.13%.

Natural history remark: Six gravid females contained

the following numbers of eggs: 7, 8 (x2), 9 (x2) and 11.

Size of measured eggs (N=10) ranges between 13.0—15.0

x 7.7—8.3 mm. In contrast, Angel (1940) reported ten eggs

in a gravid female from the Mt. Bamboutos of 8 x 7 mm

in size, which have been most probably not fully devel-

oped.

Acknowledgements. The study was accomplished under the

conditions of the research, collecting and export permits issued

by the Cameroonian Ministry of Forestry and Wildlife and Min-

istry of Scientific Research and Innovation in 2007 and 2009

(Nos. 049/MINRESI/B00/C00/C10/C12; 0836/PRBS/MIN-

FOF/SG/DFAPSDVEF/SC; 0613/PRBS/MINFOF/SG/DFAP/

SDVEF/SC; 0132/MINRESI/B00/C00/C10/C13; 1010/PRBS

/MINFOF/SG/DFAP/SDVEF/SC). The senior author would al-

so like to thank the Federal Agency for Nature Conservation

(BEN) for the import permits (No. E-0997/08, No. E-03454/09).

Thanks are also given to Laurent Chirio, Marcel Talla Kouete,

Ivo Melle Ngwese, Samuel Wanji and Julia A. M. Wurstner for

assistance in fieldwork, and/or logistics, and/or additional tis-

Bonn zoological Bulletin 57 (2): 211-229

sue samples or specimens. Jean Mariaux provided the 16S se-

quence for 7: pfefferi. We thank Philipp Wagner (ZFMK) for his

help regarding the correct interpretation of some specific rules

of the ICZN code. Thanks to Andreas Schliiter and Axel Kwet

(both SMNS) for the effort to get information about A. Diehl

and his collection and to Frank Tillack (ZMB) for fruitful dis-

cussions. II and NLV work was supported by the Agence Na-

tionale de la Recherche Biodiversity Project, Iles Forestic¢res

Africaines, IFORA, 2006-2009. Field work of MFB was sup-

ported by the Alexander Koenig Stiftung. VG is thankful to

Ernest Vunan (SATEC, Big Babank1) for his kind assistance and

hospitality. The work of VG was supported by a grant from the

Ministry of Education, Youth and Sports of the Czech Repub-

lic (No. LC06073; Biodiversity Research Centre) and grants IRP

IAPG AVO0Z 50450515 and MK00002327201.

REFERENCES

Akani GC, Ogbalu OK, Luiselli L (2001) Life-history and eco-

logical distribution of chameleons (Reptilia, Chamaeleonidae)

from the rain forests of Nigeria: conservation implications.

Animal Biodiversity and Conservation 24: 1—15

Angel F (1940) Reptiles et amphibiens recueillis au Cameroun

par la Mission P. Lepesme, R. Paulian et A. Villiers (3° note).

Bulletin du Muséum National d’Histoire Naturelle 12:

390-399

Bohme W (1975) A montane chameleon new to Nigeria. The Ni-

gerian Field 40: 125—129

Boéhme W, Klaver C (1981) Zur innerartlichen Gliederung und

zur Artgeschichte von Chamaeleo quadricornis Tornier, 1899

(Sauria: Chamaeleonidae). Amphibia-Reptilia 10: 313-328

Bohme W, Nikolaus G (1989) Herpetological specimens from

the Gotel Mountains and Mambilla Plateau, Nigeria. Pp. 28—

30 in: Dowsett RJ (ed.) A preliminary natural history survey

of Mambilla Plateau and some lowland forests of eastern Ni-

geria. Tauraco Research Report

Buchholz R (1874) Bemerkungen tiber die im Cameroongebiet

vorkommenden Arten von Chamaeleonen. Monatsbericht der

k6niglich preussischen Akademie der Wissenschaften zu Ber-

lin: 77-89

Chirio L, LeBreton M (2007) Atlas des reptiles du Cameroun.

Muséum national d’Histoire naturelle, IRD editions, Paris

Dunger GT (1967) The lizards and snakes of Nigeria. Part 1 The

chameleons of Nigeria. The Nigerian Field 32: 53-73

Euskirchen O, Schmitz A, Bohme W (2000) Zur Herpetofauna

einer montanen Regenwald-region in SW-Kamerun (Mt. Kupe

und Bakossi-Bergland). IV. Chamaeleonidae, biogeographis-

che Diskussion und Schutzmafinahmen. herpetofauna 22:

21-34

Gonwouo NL, LeBreton M, Wild C, Chirio L, Ngassam P,

Tchamba MN (2006) Geographic and ecological distribution

of the endemic montane chameleons along the Cameroon

mountain range. Salamandra 42: 213-230

Guindon S, Gascuel O (2003) A simple, fast, and accurate al-

gorithm to estimate large phylogenies by maximum likelihood.

Systematic Biology 52: 696-704

Hall TA (1999) BioEdit: a user-friendly biological sequence

alignment editor and analysis program for Windows 95/98/NT.

Nucleic Acids Symposium Series 41: 95—98

Hammer @, Harper DAT, Ryan PD (2001) PAST: Paleontolog-

ical statistics software package for education and data analy-

sis. Palaeontologia Electronica 4: 1—9

©ZFMK

224 Michael F. Barej et al.

Herrmann H-W, Bohme W, Euskirchen O, Herrmann PA,

Schmitz A (2005) African biodiversity hotspots: the reptiles

of Mt. Nlonako, Cameroon. Revue Suisse de Zoologie 112:

1045-1069

Herrmann H-W, Schmitz A, Herrmann PA, B6hme W (2006)

Amphibians and Reptiles of the Tchabal Mbabo Mtns,

Adamaoua Plateau, Cameroon. Bonner zoologische Beitrage

55: 27-35

Hewitt GM (2004) Genetic consequences of climatic oscillations

in the Quaternary. Philosophical Transactions of the Royal So-

ciety London B 359: 183-195

Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian in-

ference of phylogenetic trees. Bioinformatics 17: 754-755

International Commission on Zoological Nomenclature (ICZN)

(1999) International Code of Zoological Nomenclature.

Fourth Edition. The International Trust for Zoological

Nomenclature, c/o The Natural History Museum, Cromwell

Road, London, SW7 5BD UK.

Joger U (1982) Zur Herpetofaunistik Kameruns (II). Bonner zo-

ologische Beitrage 33: 313-324

Klaver C, Bohme W (1986) Phylogeny and classification of the

Chamaeleonidae (Sauria) with special reference to hemipenis

morphology. Bonner Zoologische Monographien 22: 1-64

Klaver C, Bohme W (1992) The species of the Chamaeleo crista-

tus group from Cameroon and adjacent countries, West Africa.

Bonner zoologische Beitrage 43: 433-476

Klaver C, Bohme W (1997) Chamaeleonidae. Walter de Gruyter

& Co, Berlin, New York.

Kocher TD, Thomas WK, Meyer A, Edwards SV, Paabo S, Vil-

lablanca FX, Wilson AC (1989) Dynamics of mitochondrial

DNA evolution in animals: Amplification and sequencing with

conserved primers. Proceedings of the National Academy of

Sciences, USA 86: 6196-6200

Mariaux J, Lutzmann N, Stipala J (2008) The two-horned

chamaeleons of East Africa. Zoological Journal of the Linnean

Society 152: 367-391

Mertens R (1922) Ein neues Chamaleon aus Kamerun. Zoolo-

gischer Anzeiger 54: 191-193

Mertens R (1940) Zur Herpetologie Kameruns und Deutsch-Ost-

afrikas. Zoologischer Anzeiger 131: 239-250

Mertens R (1964) Die Reptilien von Fernando Poo. Bonner zoo-

logische Beitrage 15: 211-238

Mertens R (1968) Zur Kenntnis der Herpetofauna von Kame-

run und Fernando Poo. Bonner zoologische Beitrage 19: 69—

Necas P (2004) Chameleons — Nature’s hidden jewels. 2"4 re-

vised and updated edition. Edition Chimaira

Nieden F (1910) Neue Reptilien und Amphibien aus Kamerun.

Archiv ftir Naturgeschichte 1: 234-246

Palumbi SR, Martin A, Romano S, McMillan WO, Stice L,

Grabowski G (1991) The simple fool’s guide to PCR. Depart-

ment of Zoology and Kewalo Marine Laboratory, Hawaii

Pauwels O, Vande weghe JP (2008) Reptiles du Gabon.

Smithonian Insitution.

Perret J-L, Mertens R (1957) Etude d’une collection herpétolo-

gique faite au Cameroun de 1952 a 1955. Bulletin de |’ Insti-

tut Francais d’Afrique Noire. Série A 19: 548-601

Pook CE, Wild C (1997) The phylogeny of the Chamaeleo (Trio-

ceros) cristatus species-group from Cameroon inferred from

Bonn zoological Bulletin 57 (2): 211—229

sequencing of the mitochondrial 12S ribosomal RNA gene:

evolutionary and palaeobiogeographic implications. Pp. 297—

306 in: Bohme W, Bischoff W, Ziegler T (eds.) Herpetologia

Bonnensis SEH, Bonn

Rand AS (1961) A suggested function of the ornamentation of

East African forest chameleons. Copeia 1961: 411-414

Reeder TW (2003) A phylogeny of the Australian Sphenomor-

phus group (Scincidae: Squamata) and the phylogenetic place-

ment of the crocodile skinks (7ribolonotus): Bayesian ap-

proaches to assessing congruence and obtaining confidence

in maximum likelihood inferred relationships. Molecular Phy-

logenetics and Evolution 27: 384-397

Schmitz A, Ineich I, Chirio L (2005) Molecular review of the

genus Panaspis sensu lato (Reptilia: Scincidae) in Cameroon,

with special reference to the status of the proposed subgen-

era. Zootaxa 863: 1-28

Stutchbury S (1837) Description of a new species of the genus

Chamaeleo. Transactions of the Linnean Society of London

17: 361-362 + Plate X

Swofford DL (2002) PAUP”. Phylogenetic Analysis Using Par-

simony (“and Other Methods). Version 4.0b10. Sinauer As-

sociates, Sunderland, Massachusetts, USA

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins

DG (1997) The ClustalX windows interface: flexible strate-

gies for multiple sequence alignment aided by quality analy-

sis tools. Nucleic Acids Research 24: 4876-4882

Tilbury CR (2010) Chameleons of Africa — An Atlas — Includ-

ing the chameleons of Europe, the Middle East, and Asia. Chi-

maira, Frankfurt am Main.

Tilbury CR, Tolley KA (2009) A re-appraisal of the systemat-

ics of the African genus Chamaeleo (Reptilia:

Chamaeleonidae). Zootaxa 2079: 57-68

Townsend T, Larson A (2002) Molecular phylogenetics and mi-

tochondrial genomic evolution in the Chamaeleonidae (Rep-

tilia, Squamata). Molecular Phylogenetics and Evolution 23:

22-36

Uetz P, Hallermann J (2010) The TIGR Reptile Database, JCVI,

Rockville. Available from: http://www.reptile-database.org/

(July 20th, 2010).

Wagner P, BGhme W, Pauwels OSG, Schmitz A (2009a): A re-

view of the African red-flanked skinks of the Lygosoma fer-

nandi (Burton, 1836) species group (Squamata: Scincidae) and

the role of climate change in their speciation. Zootaxa 2050:

1-30

Wagner P, Barej M, Schmitz A (2009b) Studies on African Aga-

ma VII. A new species of the Agama agama-group (Linna-

eus, 1758) (Sauria: Agamidae) from Cameroon & Gabon, with

comments on Agama mehelyi Tornier, 1902. Bonner zoologi-

sche Beitrage 56: 285-297

Werner F (1902) Prodromus einer Monographie der Chamale-

onten. Zoologische Jahrbticher (Abteilung fur Systematik,

Okologie und Geographie der Tiere) 15: 295-460 + Plates

XV-XXVII

Received: 30. VII.2010

Accepted: 18.X.2010

©OZFMK

Chameleons of the genus Trioceros from Cameroon 225

Appendix I

List of examined specimens

Trioceros serratus (Mertens, 1922)

MNHN 2007.1494 (male neotype), Cameroon, Mt. Oku,

border of the road from Anyajua to Belo (near Belo, at low

altitude), date 9.V.2007, coll. I. Ineich; MHNG 964.037

(male), Cameroon, Bamenda, Kishong, 1.II.1939, coll. J.-

L. Perret & R. Mertens; MHNG 1010.049-50 (2 males),

Cameroon, Bafoussam, Bangwa, 1959, coll. J.-L. Perret;

MHNG 1365.010 (male), Cameroon, Foumban, Mt.

Nkogam, III.1969, coll. J.L. Amiet; MHNG 1365.019

(male), Cameroon, Bamiléké, Foto, X1I.1972, coll. J.L.

Amiet; MHNG 1365.023-24 (2 females), Cameroon,

Dschang, Foto, XI.1972, coll. J.L. Amiet; MNHN

1997.3642 (male), Cameroon, Oku village, V.1997, coll.

L. Chirio; MNHN 1998.0415, Cameroon, Lake Oku, al-

titude 2200 m, 7.VI.1998, coll. L. Chirio; MNHN

1998.0416-19, Cameroon, Mt. Oku, altitude 2000-2500 m,

25.V1.1998, coll. L. Chirio; MNHN 1998.0425, MNHN

1998.0429, Cameroon, Mt. Oku, altitude 2000-2500 m,

25.V1.1998, coll. L. Chirio; MNHN 2005.2781-2787,

MNHN 2005.2900 (5 males + 3 females), Cameroon, Mt.

Oku, Simonkuh, 10.572°E/6.234°N, altitude 2109 m,

8.VII.2002, coll. Programme CamHerp; MNHN

2005.2788 (male), Cameroon, Oku village, 19.1V.2000, al-

titude 2000 m, 10.505°E/6.202°N, coll. Programme

CamHerp; MNHN 2007.1461-64 (2 males + 2 females),

Cameroon, Mt. Oku area, around village of Elak Oku,

6.2441°N/10.5076°E, altitude 6474 ft, 6.V.2007, coll. I.

Ineich & N. Lhermitte-Vallarino; MNHN 2007.1465

(male), Cameroon, Mt. Oku_ area,’ Lake,

6.2019°N/10.4609°E, altitude 7456 ft, 8.V.2007, coll. I.

Ineich & N. Lhermitte-Vallarino; NMUP6V 74104 (male),

Cameroon, Kedjom Keku (= Big Babanki), Bamenda

Highlands, 6°06.968’N 10°15.760’E, 1290 m a.s.l.,

9.X1.2009, coll. V. Gvozdik; ZFMK 5798-5801 (2 males

+2 females), Cameroon, Lake Oku, 20-30.1.1967, coll. M.

Eisentraut; ZFMK 15283 (male), Cameroon, Mt. Lefo, 5.-

11.X.1974, coll. W. Bohme & W. Hartwig; ZFMK 18105-

6, ZFMK 18108 (male + 2 females), Cameroon, Mezam,

Bafout, 1975-76, coll. P. Shu Mfosono; ZMB 21860 (fe-

male), Cameroon, Bamenda, no date; ZMB 24909 (male),

Cameroon, Bamenda, coll. Adametz; ZSM 13/1925

(male), Cameroon, Tsch’a Bekom, Bamenda District, no

date, coll. Glauming.

Trioceros perreti (Klaver & Bohme, 1992)

MHNG 920.068-9 (male paratype + female paratype),

MHNG 964.038 (female paratype), MHNG 965.054 (male

paratype), MHNG 1010.052 (male holotype), MHNG

1010.053 (male paratype) Cameroon, Manengouba Mts.,

1956, coll. J.-L. Perret; MHNG 1365.011 (male paratype),

Cameroon, Manengouba Mts., Mwandong, 26.11.1972,

Bonn zoological Bulletin 57 (2): 211-229

coll. J.L. Amiet; MHNG 1365.012-18 (5 male paratypes

+ 2 female paratypes), Cameroon, Manengouba Mts.,

111.1973, coll. J.L. Amiet; MNHN 2007.1455-57 (3 fe-

males), Cameroon, Manengouba Mts., around Mouame-

na village, 9.796°E/4.984°N, altitude 4450 ft, 28.1'V.2007,

coll. I. Ineich & N. Lhermitte-Vallarino; MNHN

2007.1458-60 (2 males), Cameroon, Manengouba Mts.,

around Mouabi village, 5.0613°N/9.8155°E, altitude

5283 ft, 29.1V.2007, coll. I. Ineich & N. Lhermitte-Val-

larino; MNHN 2007.1460 (male), Cameroon, Manengou-

ba Mts., border of the road going to the lakes,

5.0512°N/9.8069°E, 28.IV.2007, coll. I. Ineich & N. Lher-

mitte-Vallarino; ZFMK 5802-3 (2 male paratypes),

Cameroon, Manengouba Mts., Lake Manengouba,

20.XII1.1966-5.1.1967, coll. M. Eisentraut; ZFMK 55599

(male), Cameroon, Manengouba, river east of Lake Ma-

nengouba, no date, F. Le Berre; ZFMK 58896-7 (2 males),

Cameroon, Manengouba Mts., 1993, coll. E. Wallikewitz;

ZFMK 59030 (male), Cameroon, Manengouba Mts.,

1994, from pet trade; ZFMK 61836 (male), Cameroon,

Manengouba area, no date, F. Le Berre; ZFMK 62571

(male), Cameroon, Manengouba area, no data, coll. un-

known; ZFMK 66579 (female), Cameroon, Manengouba

area, no date, from pet trade; ZFMK 66738, ZFMK 66740

(2 males), Cameroon, Manengouba area, 1998, from pet

trade; ZFMK 69828, ZFMK 69830 (male + female),

Cameroon, Bakossi Mts., 5.1.1998, coll. O. Euskirchen;

ZFMK 69848-51 (male + 3 females), Cameroon, Bakos-

si Mts., 5.1.1998, coll. A. Schmitz.

Trioceros wiedersheimi (Nieden, 1910)

MHNG 1544.1-2 (2 females), Cameroon, Mayo Darlé,

1941, coll. R. de Kalbermatten; MNHN 2005.2753 (fe-

male), Cameroon, Fongoi Village, Tchabal Mbabo,

12.053°E/7.230°N, altitude 1900 m, 12.1.2002, coll. Pro-

gramme CamHerp; NMP6V 74112 (male), Cameroon,

Tchabal Gangdaba, 7°44.678’N 12°42.741’E, 1560 m

a.s.l., 26.X.2009, coll. V. Gvozdik; ZFMK 47941 (male),

Nigeria, Gotel Mts. Gangirwal, app. 2400 m a.s.l.,

15.11.1988, coll. G. Nikolaus; ZFMK 68943 (male),

Cameroon, Tchabal Mbabo, southern slopes, XI.-

5.X1I.1998, coll. George & Johnson; ZFMK 75740-3 (3

males + female), Cameroon, Mayo Kelele, app. 1600 m

a.s.l., 7.1.2000, coll. H.-W. Herrmann & A. Schmitz;

ZFMK 75744-6 (male + 2 females), Cameroon, Tchabal

Mbabo, 25.1.2001, coll. H.-W. Herrmann & A. Schmitz;

ZFMK 78714 (male), Cameroon, Tchabal Mbabo, I.2001,

coll. H.-W. Herrmann & A. Schmitz; ZMB 21857, ZMB

74806 (formerly part of ZMB 21857) (male + female),

Cameroon, Banjo Gebirge, no date, coll. Riggenbach;

ZMB 21861, ZMB 74805 (formerly part of ZMB 21861)

(male + female), Cameroon, Banjo Gebirge, no date,

Riggenbach; ZMB 21873 (female lectotype), Cameroon,

Genderogebirge, 1500 maz.s.1., no date, coll. Riggenbach.

©ZFMK

226 Michael F. Barej et al.

Appendix II

Table 1. List of voucher specimens for each species included in the present study, with their respective localities, collection num-

bers and GenBank accession numbers (16S, 12S) [*sequence from Pook & Wild 1997; not in GenBank; same species but different

vouchers used for 16S and 12S] [**sequence from Pook & Wild 1997, not in GenBank; same voucher used for both sequences].

Species

Locality

Collection number

Accession number

Kinyongia tavetana

Trioceros oweni [E146.15]

Trioceros camerunensis [E130.1]

Trioceros cristatus [E130.2]

Trioceros cristatus [E130.3]

Trioceros cristatus [E131.1]

Trioceros cristatus [E146.13]

Trioceros cristatus [E150.7]

Trioceros cristatus [E150.8]

Trioceros cristatus [E180.2]

Trioceros cristatus [E180.7]

Trioceros montium [E130.4]

Trioceros montium [E130.5]

Trioceros montium [E131.2]

Trioceros montium [E131.3]

Trioceros montium [E179.18

Trioceros montium [E180.15

E188.19

E188.20

Trioceros perreti [E130.11]

Trioceros montium

[ ]

[ |

Trioceros montium [E188.18]

[ ]

Trioceros montium

South Pare, Kilimanjaro, Tanzania

Nkoelon, Campo region

Njonji, Mt. Cameroon

Amebishu, Mamfe region

Nkoelon, Campo region

Mofako Balue, Rump Hills

Big Massaka, Rumpi Hills

Mt. Cameroon

Mt. Kupe

Mt. Cameroon

Mt. Kupe

Mofako Balue, Rumpi Hills

Nyasoso, Mt. Kupe

Edib Hills, Bakossi Mts.

Mts. Manengouba

MHNG 2612.58

ZFMK 87642

MNHN 2007.0037

MNHN 2007.1447

MNHN 2007.1448

MNHN 2007.1449

ZFMK 87646

ZFMK 87647

ZFMK 87649

ZFMK 89455

MNHG 2716.39

MNHN 2007.1429

MNHN 2007.1445

MNHN 2007.1430

MNHN 2007.1446

MNHG 2716.47

MNHG 2716.41

NMPO6V 74130/2

NMPO6V 74130/1

NMP6V 74130/3

MNHN 2007.1458

AM422414 / AM422433

HQ337816 / HQ337864

HQ337798 / HQ337846

HQ337799 / HQ337847

HQ337800 / HQ337848

HQ337801 / HQ337849

HQ337802 / HQ337850

HQ337803 / HQ337851

HQ337804 / HQ337852

HQ337805 / HQ337853

HQ337806 / HQ337854

HQ337807 / HQ337855

HQ337808 / HQ337856

HQ337809 / HQ337857

HQ337810 / HQ337858

HQ337811 / HQ337859

HQ337812 / HQ337860

HQ337813 / HQ337861

HQ337814 / HQ337862

HQ337815 / HQ337863

HQ337828 / HQ337876

Trioceros perreti [E130.12] Mts. Manengouba MNHN 2007.1459 HQ337829 / HQ337877

Trioceros perreti [E131.6] Mts. Manengouba MNHN 2007.1460 HQ337830 / HQ337875

Trioceros pfefferi Afua jim Forest, 10,4°E/6,15°N MNHN 2007.1499 HQ337817 / —*

Trioceros quadricornis eisentrauti Rumpi Hills voucher not collected HQ337820 / She

Trioceros quadricornis eisentrauti [E178.10] Mt. Rata, Rumpi Hills ZFMK 89466 HQ337818 / HQ337866

Trioceros quadricornis eisentrauti [E178.11] Mt. Rata, Rumpi Hills MNHG 2716.40 HQ337819 / HQ337867

Trioceros quadricornis gracilior [E130.7] Oku village, Mt. Oku, Bamenda Highlands MNHN 2007.1426 HQ337821 / HQ337868

Trioceros quadricornis gracilior [E130.8] Oku village, Mt. Oku, Bamenda Highlands MNHN 2007.1423 HQ337822 / HQ337869

Trioceros quadricornis gracilior [E131.4] Oku village, Mt. Oku, Bamenda Highlands MNHN 2007.1424 HQ337823 / HQ337870

Trioceros quadricornis quadricornis [E130.9] | Mts. Manengouba MNHN 2007.1470 HQ337824 / HQ337871

Trioceros quadricornis quadricornis [E130.10] Mts. Manengouba MNHN 2007.1466 HQ337825 / HQ337872

Trioceros quadricornis quadricornis [E131.5] | Mts. Manengouba MNHN 2007.1469 HQ337826 / HQ337873

Trioceros quadricornis quadricornis [E131.8] | Mts. Manengouba MNHN 2007.1468 HQ337827 / HQ337874

Trioceros serratus [E130.15] Oku village, Mt. Oku, Bamenda Highlands MNHN 2007.1463 HQ337831 / HQ337878

Trioceros serratus [E130.16] Lake Oku, Mt. Oku, Bamenda Highlands MNHN 2007.1465 HQ337832 / HQ337879

Trioceros serratus [E130.17] (NEOTYPE) Belo, Mt. Oku MNHN 2007.1494 HQ337833 / HQ337880

Trioceros serratus [E131.7] Oku village, Mt. Oku, Bamenda Highlands MNHN 2007.1464 HQ337834 / HQ337881

Trioceros serratus [E131.16] Oku village, Mt. Oku, Bamenda Highlands MNHN 2007.1461 HQ337835 / HQ337882

Trioceros serratus [E131.17] Oku village, Mt. Oku, Bamenda Highlands MNHN 2007.1462 HQ337836 / HQ337883

Trioceros serratus [E178.2] Mt. Mbam voucher not collected HQ337837 / HQ337884

Trioceros serratus [E178.3] Mt. Mbam voucher not collected HQ337838 / HQ337885

Trioceros serratus [E178.4] Mt. Mbam voucher not collected HQ337839 / HQ337886

Trioceros serratus [E178.5] Mt. Mbam voucher not collected HQ337840 / HQ337887

Trioceros serratus [E188.16]

Trioceros serratus [E189.8]

Trioceros wiedersheimi [E91.6]

Big Babanki, Bamenda Highlands

Tchabal Mbabo

Tchabal Gangdaba

NMP6V 74104 HQ337841 / HQ337888

voucher not collected HQ337842 / HQ337889

ZFMK 75744 HQ337843 / HQ337890

voucher not collected HQ337844 / HQ337891

NMP6V 74112 HQ337845 / HQ337892

Trioceros wiedersheimi [E178.1]

Trioceros wiedersheimi [E188.13]

Bonn zoological Bulletin 57 (2): 211-229 ©OZFMK

Chameleons of the genus Trioceros from Cameroon oy)

Table 2. Uncorrected p-distances between Cameroonian Trioceros taxa based on 960 bp of the 16S + 12S rRNA gene fragments.

1 2 3 4 5 6 7 8 9 10 11 12

1 = Kinyongia tavetana AM422414/AM422433 -

2 oweni Nkoelon, Campo region [E146.15] 0.1221 -

3. camerunensis Mt. Cameroon [E130.1] 0.1230 0.0986 —

4 cristatus Big Massaka, Rumpi Hills [E180.7] 0.1138 0.0868 0.0381 —

5 cristatus Nkoelon, Campo region [E150.8] 0.1109 0.0868 0.0386 0.0086 —

6 — cristatus Amebishu, Mamfe region [E146.13] 0.1083 0.0857 0.0402 0.0095 0.0075 —

7 cristatus Amebishu, Mamfe region [E150.7] 0.1095 0.0868 0.0412 0.0106 0.0086 0.0011 —

8 cristatus Njonji, Mt. Cameroon [E130.2] O.11S1 0.0890 0.0396 0.0011 0.0096 0.0107 0.0118 = —

9 cristatus Njonji, Mt. Cameroon [E130.3] 0.1162 0.0901 0.0407 0.0021 0.0107 0.0118 0.0128 0.0011 —

10 cristatus Njonji, Mt. Cameroon [E131.1] 0.1150 0.0879 0.0391 0.0011 0.0096 0.0105 0.0116 0.0000 0.0011 —

11 cristatus Mofako Balue, Rumpi Hills [E180.2] 0.1138 0.0868 0.0381 0.0000 0.0086 0.0095 0.0106 0.0011 0.0021 0.0011 —

12. montium Edib Hills, Bakossi Mts. [E188.20] 0.1159 0.0958 0.0343 0.0365 0.0326 0.0365 0.0376 0.0380 0.0391 0.0375 0.0365 —

13 montium Edib Hills, Bakossi Mts. [E188.18] 0.1152 0.0943 0.0338 0.0360 0.0321 0.0360 0.0370 0.0375 0.0385 0.0370 0.0360 0.0000

14 montium Edib Hills, Bakossi Mts. [E188.19] 0.1152 0.0943 0.0338 0.0360 0.0321 0.0360 0.0370 0.0375 0.0385 0.0370 0.0360 0.0000

15 montium Mt. Kupe [E130.5] 0.1153 0.0944 0.0374 0.0386 0.0332 0.0375 0.0385 0.0396 0.0407 0.0396 0.0386 0.0032

16 montium Mt. Kupe [E131.3] 0.1153 0.0944 0.0374 0.0386 0.0332 0.0375 0.0385 0.0396 0.0407 0.0396 0.0386 0.0032

17 montium Nyasoso, Mt. Kupe [E180.15] 0.1152 0.0943 0.0338 0.0360 0.0321 0.0360 0.0370 0.0375 0.0385 0.0370 0.0360 0.0000

18 montium Mt. Cameroon [E130.4] 0.1153 0.0964 0.0381 0.0392 0.0364 0.0402 0.0413 0.0407 0.0418 0.0402 0.0392 0.0064

19 montium Mt. Cameroon [E131.2] 0.1153 0.0964 0.0381 0.0392 0.0364 0.0402 0.0413 0.0407 0.0418 0.0402 0.0392 0.0064

20 montium Mofako Balue, Rumpi Hills [E179.18] 0.1141 0.0923 0.0349 0.0360 0.0311 0.0349 0.0360 0.0375 0.0385 0.0370 0.0360 0.0011

21 perreti Mts. Manengouba [E131.6] 0.1194 0.0943 0.0623 0.0528 0.0525 0.0560 0.0571 0.0545 0.0556 0.0539 0.0528 0.0591

22. perreti Mts. Manengouba [E130.11] 0.1227 0.0953 0.0612 0.0517 0.0514 0.0549 0.0560 0.0534 0.0545 0.0528 0.0517 0.0580

23 perreti Mts. Manengouba [E130.12] 0.1227 0.0953 0.0612 0.0517 0.0514 0.0549 0.0560 0.0534 0.0545 0.0528 0.0517 0.0580

24 pfefferi 0.1099 0.0934 0.0627 0.0603 0.0563 0.0588 0.0575 0.0616 0.0629 0.0616 0.0603 0.0538

25 quadricornis eisentrauti Rumpi Hills 0.1058 0.0966 0.0690 0.0639 0.0614 0.0612 0.0626 0.0652 0.0665 0.0652 0.0639 0.0611

26 quadricornis eisentrauti Mt. Rata, Rumpi Hills 0.1118 0.0948 0.0638 0.0605 0.0591 0.0606 0.0617 0.0621 0.0632 0.0616 0.0605 0.0551

{E178.10]

27. quadricornis eisentrauti Mt. Rata, Rumpi Hills 0.1124 0.0957 0.0644 0.0611 0.0598 0.0611 0.0623 0.0629 0.0640 0.0622 0.0611 0.0556

(E178.11]

28 quadricornis gracilior Mt. Oku [E130.7] 0.1117 0.0911 0.0603 0.0539 0.0525 0.0539 0.0550 0.0556 0.0567 0.0550 0.0539 0.0526

29 quadricornis gracilior Mt. Oku [E130.8] 0.1117 0.0911 0.0603 0.0539 0.0525 0.0539 0.0550 0.0556 0.0567 0.0550 0.0539 0.0526

30 © quadricornis gracilior Oku village [E131.4] 0.1118 0.0922 0.0610 0.0545 0.0525 0.0545 0.0557 0.0556 0.0567 0.0556 0.0545 0.0532

31 quadricornis quadricornis Mts. Manengouba 0.1105 0.0933 0.0624 0.0560 0.0547 0.0560 0.0571 0.0577 0.0588 0.0571 0.0560 0.0548

[E130.10]

32 quadricornis quadricornis Mts. Manengouba 0.1105 0.0933 0.0624 0.0560 0.0547 0.0560 0.0571 0.0577 0.0588 0.0571 0.0560 0.0548

[E130.9]

33 quadricornis quadricornis Mts. Manengouba 0.1105 0.0933 0.0624 0.0560 0.0547 0.0560 0.0571 0.0577 0.0588 0.0571 0.0560 0.0548

{E131.5]

34 quadricornis quadricornis Mts. Manengouba 0.1108 0.0944 0.0632 0.0567 0.0546 0.0567 0.0579 0.0578 0.0589 0.0578 0.0567 0.0554

[E131.8]

35 serratus Belo, Mt. Oku [E130.17] 0.1174 0.1008 0.0651 0.0609 0.0601 0.0619 0.0620 0.0621 0.0632 0.0620 0.0609 0.0641

36 serratus Big Babanki, Bamenda Highlands 0.1174 0.0998 0.0646 0.0603 0.0601 0.0614 0.0615 0.0621 0.0632 0.0614 0.0603 0.0635

[E188.16]

37 serratus Big Babanki, Bamenda Highlands 0.1180 0.1014 0.0654 0.0611 0.0609 0.0622 0.0623 0.0629 0.0640 0.0622 0.0611 0.0634

[E189.8]

38 serratus Mt. Mbam [E178.2] 0.1163 0.1000 0.0664 0.0621 0.0612 0.0632 0.0633 0.0632 0.0643 0.0632 0.0621 0.0653

39 serratus Mt. Mbam [E178.3] 0.1165 0.0990 0.0654 0.0611 0.0602 0.0622 0.0622 0.0622 0.0633 0.0622 0.0611 0.0643

40 serratus Mt. Mbam [E178.4] 0.1163 0.0999 0.0664 0.0621 0.0612 0.0632 0.0632 0.0632 0.0643 0.0632 0.0621 0.0653

41 serratus Mt. Mbam [E178.5] 0.1151 0.0977 0.0646 0.0603 0.0601 0.0614 0.0615 0.0621 0.0632 0.0614 0.0603 0.0635

42 serratus Mt. Oku [E130.15] 0.1186 0.1022 0.0664 0.0621 0.0613 0.0632 0.0633 0.0632 0.0643 0.0632 0.0621 0.0654

43 serratus Lake Oku [E130.16] 0.1186 0.1021 0.0663 0.0621 0.0612 0.0632 0.0632 0.0632 0.0643 0.0632 0.0621 0.0653

44 serratus Oku village [E131.16] 0.1175 0.0998 0.0646 0.0604 0.0601 0.0614 0.0626 0.0622 0.0633 0.0615 0.0604 0.0636

45 serratus Oku village [E131.17] 0.1185 0.1009 0.0656 0.0614 0.0612 0.0624 0.0625 0.0632 0.0643 0.0625 0.0614 0.0646

46 serratus Oku village [E131.7] 0.1090 0.0988 0.0680 0.0645 0.0636 0.0633 0.0634 0.0656 0.0667 0.0656 0.0645 0.0670

47 wiedersheimi Tchabal Mbabo [E91.6] 0.1147 0.0923 0.0635 0.0520 0.0529 0.0533 0.0534 0.0538 0.0550 0.0531 0.0520 0.0590

48 wiedersheimi Tchabal Mbabo [E178.1] 0.1163 0.0900 0.0620 0.0508 0.0494 0.0498 0.0498 0.0526 0.0537 0.0519 0.0508 0.0565

49 wiedersheimi Tchabal Gangdaba [E188.13] 0.1146 0.0903 0.0637 0.0519 0.0527 0.0530 0.0541 0.0536 0.0547 0.0530 0.0519 0.0592

Bonn zoological Bulletin 57 (2): 211-229 ©ZFMK

228 Michael F. Bare] et al.

Table 2. Continued.

13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

13 =

14 0.0000 —

15 0.0032 0.0032 -

16 0.0032 0.0032 0.0000 —

17 0.0000 0.0000 0.0032 0.0032 —-

18 0.0063 0.0063 0.0075 0.0075 0.0063 —

19 0.0063 0.0063 0.0075 0.0075 0.0063 0.0000 —

20 0.0011 0.0011 0.0021 0.0021 0.0011 0.0053 0.0053 —

21 0.0582 0.0582 0.0578 0.0578 0.0582 0.0603 0.0603 0.0571 —

22 0.0571 0.0571 0.0567 0.0567 0.0571 0.0592 0.0592 0.0560 0.0032 —

23 0.0571 0.0571 0.0567 0.0567 0.0571 0.0592 0.0592 0.0560 0.0032 0.0000 —

24 0.0535 0.0535 0.0521 0.0521 0.0535 0.0574 0.0574 0.0510 0.0365 0.0378 0.0378 —

25 0.0599 0.0599 0.0587 0.0587 0.0599 0.0613 0.0613 0.0575 0.0370 0.0382 0.0382 0.0392 —

26 0.0542 0.0542 0.0536 0.0536 0.0542 0.0563 0.0563 0.0522 0.0403 0.0435 0.0435 0.0368 0.0026 —

27 0.0547 0.0547 0.0542 0.0542 0.0547 0.0568 0.0568 0.0526 0.0407 0.0439 0.0439 0.0369 0.0027 0.0000 —

28 0.0518 0.0518 0.0513 0.0513 0.0518 0.0539 0.0539 0.0497 0.0433 0.0443 0.0443 0.0366 0.0102 0.0106 0.0107 —

29 0.0518 0.0518 0.0513 0.0513 0.0518 0.0539 0.0539 0.0497 0.0433 0.0443 0.0443 0.0366 0.0102 0.0106 0.0107 0.0000 —

30 0.0524 0.0524 0.0513 0.0513 0.0524 0.0545 0.0545 0.0503 0.0438 0.0448 0.0448 0.0366 0.0103 0.0107 0.0108 0.0000 0.0000 —

31 0.0539 0.0539 0.0535 0.0535 0.0539 0.0560 0.0560 0.0518 0.0422 0.0432 0.0432 0.0367 0.0051 0.0064 0.0064 0.0063 0.0063 0.0064 —

32 0.0539 0.0539 0.0535 0.0535 0.0539 0.0560 0.0560 0.0518 0.0422 0.0432 0.0432 0.0367 0.0051 0.0064 0.0064 0.0063 0.0063 0.0064 0.0000

33 0.0539 0.0539 0.0535 0.0535 0.0539 0.0560 0.0560 0.0518 0.0422 0.0432 0.0432 0.0367 0.0051 0.0064 0.0064 0.0063 0.0063 0.0064 0.0000

34 0.0546 0.0546 0.0535 0.0535 0.0546 0.0567 0.0567 0.0525 0.0427 0.0438 0.0438 0.0367 0.0051 0.0064 0.0065 0.0064 0.0064 0.0064 0.0000

35 0.0630 0.0630 0.0622 0.0622 0.0630 0.0652 0.0652 0.0620 0.0458 0.0447 0.0447 0.0434 0.0435 0.0480 0.0487 0.0426 0.0426 0.0427 0.0437

36 0.0625 0.0625 0.0622 0.0622 0.0625 0.0646 0.0646 0.0614 0.0454 0.0444 0.0444 0.0434 0.0435 0.0478 0.0483 0.0423 0.0423 0.0428 0.0433

37 0.0634 0.0634 0.0631 0.0631 0.0634 0.0655 0.0655 0.0623 0.0461 0.0451 0.0451 0.0437 0.0442 0.0484 0.0489 0.0428 0.0428 0.0433 0.0439

38 0.0643 0.0643 0.0632 0.0632 0.0643 0.0664 0.0664 0.0632 0.0459 0.0448 0.0448 0.0434 0.0435 0.0471 0.0477 0.0416 0.0416 0.0417 0.0427

39 0.0633 0.0633 0.0622 0.0622 0.0633 0.0654 0.0654 0.0622 0.0449 0.0438 0.0438 0.0434 0.0435 0.0460 0.0467 0.0406 0.0406 0.0407 0.0417

40 0.0643 0.0643 0.0632 0.0632 0.0643 0.0664 0.0664 0.0632 0.0459 0.0448 0.0448 0.0434 0.0435 0.0471 0.0477 0.0416 0.0416 0.0417 0.0427

41 0.0625 0.0625 0.0622 0.0622 0.0625 0.0646 0.0646 0.0614 0.0444 0.0433 0.0433 0.0447 0.0448 0.0478 0.0482 0.0423 0.0423 0.0428 0.0433

42 0.0643 0.0643 0.0633 0.0633 0.0643 0.0665 0.0665 0.0633 0.0470 0.0460 0.0460 0.0447 0.0447 0.0493 0.0500 0.0438 0.0438 0.0439 0.0449

43 0.0643 0.0643 0.0632 0.0632 0.0643 0.0664 0.0664 0.0632 0.0470 0.0459 0.0459 0.0447 0.0447 0.0492 0.0499 0.0438 0.0438 0.0438 0.0449

44 0.0626 0.0626 0.0623 0.0623. 0.0626 0.0647 0.0647 0.0615 0.0455 0.0444 0.0444 0.0446 0.0434 0.0479 0.0483 0.0423 0.0423 0.0428 0.0434

45 0.0636 0.0636 0.0633 0.0633 0.0636 0.0657 0.0657 0.0625 0.0465 0.0454 0.0454 0.0447 0.0447 0.0488 0.0493 0.0433 0.0433 0.0439 0.0444

46 0.0658 0.0658 0.0648 0.0648 0.0658 0.0669 0.0669 0.0647 0.0486 0.0475 0.0475 0.0447 0.0447 0.0475 0.0483 0.0419 0.0419 0.0419 0.0429

47 0.0591 0.0591 0.0587 0.0587 0.0591 0.0612 0.0612 0.0568 0.0374 0.0363 0.0363 0.0337 0.0318 0.0342 0.0345 0.0329 0.0329 0.0333 0.0329

48 0.0565 0.0565 0.0562 0.0562 0.0565 0.0609 0.0609 0.0543 0.0388 0.0377 0.0377 0.0340 0.0321 0.0345 0.0348 0.0333 0.0333 0.0337 0.0332

49 0.0583 0.0583 0.0580 0.0580 0.0583 0.0604 0.0604 0.0562 0.0413 0.0403 0.0403 0.0389 0.0341 0.0352 0.0354 0.0350 0.0350 0.0354 0.0360

32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49

32 -

33 0.0000 —

34 0.0000 0.0000 —

35 0.0437 0.0437 0.0438 = —

36 0.0433 0.0433 0.0439 0.0000 —

37 0.0439 0.0439 0.0445 0.0000 0.0000 —

38 0.0427 0.0427 0.0428 0.0011 0.0011 0.0011 —

39 0.0417 0.0417 0.0417 0.0011 0.0011 0.0011 0.0000 —

40 0.0427 0.0427 0.0428 0.0011 0.0011 0.0011 0.0000 0.0000 —

41 0.0433 0.0433 0.0439 0.0021 0.0021 0.0021 0.0011 0.0011 0.0011 —

42 0.0449 0.0449 0.0450 0.0011 0.0011 0.0011 0.0021 0.0021 0.0021 0.0032 —

43 0.0449 0.0449 0.0449 0.0011 0.0011 0.0011 0.0021 0.0021 0.0021 0.0032 0.0000 —

44 0.0434 0.0434 0.0439 0.0021 0.0021 0.0022 0.0032 0.0032 0.0032 0.0042 0.0011 0.0011 —

45 0.0444 = 0.0444 0.0449 0.0011 0.0011 0.0011 0.0021 0.0022 0.0021 0.0032 0.0000 0.0000 0.0011 —

46 0.0429 0.0429 0.0430 0.0011 0.0011 0.0012 0.0023 0.0023 0.0023 0.0034 0.0000 0.0000 0.0011 0.0000 —

47 0.0329 0.0329 0.0334 0.0344 0.0341 0.0340 0.0333 0.0322 0.0333 0.0341 0.0357 0.0356 0.0352 0.0352 0.0378 —

48 0.0332 0.0332 0.0337 0.0369 0.0365 0.0365 0.0359 0.0348 0.0359 0.0365 0.0382 0.0381 0.0377 0.0376 0.0403 0.0045 —

49 0.0360 0.0360 0.0365 0.0375 0.0371 0.0377 0.0365 0.0355 0.0365 0.0371 0.0387 0.0386 0.0372 0.0382 0.0408 0.0068 0.0066 —

Bonn zoological Bulletin 57 (2): 211-229 ©ZFMK

Chameleons of the genus Zrioceros from Cameroon

£00 £0°0 800 £0°0 £0°0 £00 10°0 10°0 900 VV Gil vO 81 Lal vl cl Tl Ve L0 Gla AE € ‘Aap’s 4

6L0 LS'0 Clit LS'0 veo cs'0 910 910 LL0 L9 8 Caesecls Gull vrt vil GL FENG SOE WLS OVE GEG uvoul =

L3'0 £9°0 Lol £9°0 8e0 8S°0 810 810 93°0 OL I] 6T 6¢I SHI Sol Vel €6 8V~ SL “0i0L 30°C6 Te xeul S

0L0 cs'0 10'T cS'0 670 Lv'0 vam) STO £9°0 09 oF 9i0) 2016 o'8 OCI 88 Ss «LT 8I go OSP Oss 61 urur

LI LI LI LI LI LI LI LI I LI LI LI LI LI LI LI LI LI LI sa LI LI N

(So[VUlaJ) SMJDsAAS SOADIOIT,

£00 c0°0 80°0 c0'0 c0'0 c0'0 10:0 100 80°0 ve Le! so. 6 UTT 80 60 OT GO) LA 50 86 L9 € “ASp's

820 890 60'1 850 €€0 cs'0 L10 910 98°0 £9 L CAE Sieles 265 GS -8l= Vile “6K? 69 OL9 68L VE6I uvoul

80 19°0 Ic 19°0 9¢°0 €S'0 810 L10 00'T 89 6 Sc OST 6F€I CO Sl Svs “Se EL 10:98 “ONES €C xXeUl

IL'0 cs'0 L60 cs'0 0c0 870 910 910 9L'0 LS Si OW Orl= 9301 ES viOl= 9:9. Si0¢ G9F {Ores — 20589 cI ur

6 6 6 6 6 6 6 6 8 6 6 6 6 6 6 6 6 6 6 8 6 6 N

(Sa[VUlaJ) 17410 YSAapaIM SOADIONT

£0°0 10°0 90°0 10°0 c0'0 c0°0 10°0 10°0 s0°0 (GS OT HO} =e 60 Lal LO Sid! VAL v0 its VL L “AQp's

9L0 9°50 STI 95°0 ce0 Ts'0 L10 910 T8°0 €L II 80 eel 8Cl 6sl Tcl SEL VASE EQS 0:69 EBL SOG ueoul

c8'0 890 CET 8S°0 peo vs'0 610 810 060 €8 cl OT St OFT G8l Sel $8 CLT SL OL9 0S6 0€ xeul

cL'0 es'0 00'T €s'0 870 670 S10 Sl 0 SL'0 L9 Ge 2910) Sill Sal vrl Dalat EAE EMG GO OivS ‘Oi0L cl ur

cl cl cl Gl cl al al cl Ol cl cl cl cl cl cl cl cl cl cl Ol cl cl N

(sayeulay) Yasdad sosaz01Ay,

700 c0'0 900 c0'0 £0°0 c0'0 100 10'0 90°0 vs (Gul v0, Sal vi I eT 0'l (EG L0 v6 o8 v “AQP'S

9L'0 6S'0 611 6S'0 9¢0 Is0 L10 910 c6'0 $9 eye SIL ORIEL = =) 0 GI Si Salil Oi8= Ace L9 069 6¢L 617 ueoul

98°0 £90 vel $90 tro cs'0 810 L10 £01 OL Ol LiG OSI -v20 Ay Gel Se0l ase 18 O16 088 6c xeul

89°0 cs'0 bO'l cs'0 0c'0 Lv'0 S10 St 0 €8°0 9¢ 9 80 8 c8 OTT G8 1019 Oj) VS $9b O¢S cI ura

LC LC LC LC LE LT LT LT LT LC LT EG ALE LT LT Le Le LC LC LC LC Lo N

(Sa]VUl) $JD449S SOADIOIT

+00 c0'0 L0°0 c0'0 c0'0 c0'0 10'0 100 L0'0 Vc Gil 0), EG OC oT cal SOF Cie 60 oll Prel iS “ASp's

bl 0 19°0 vIT 190 ceo 0s'0 810 L10 cO'l 19 L Sie Cirig See ES Salil 6L CT OL. 978 08 C8I ueoul

€8°0 p90 tcl b9'0 9€0 €s'0 610 810 Ol v9 8 GIG SHB GON SS eel: iG Se:9C c8 S$ LOI S00! €C xeul

69°0 LS0 £01 LS‘0 ce'0 Lv 0 910 m0) 68°0 LS & vl OT 9:01 vel 66 679 «Lel ss $09 O19 val Uru

Or OI Or Ol Ol Ol Ol Ol OI OI Ol Ol Ol Ol Ol Ol Ol Ol Ol Ol Ol OI N

(So[VUl) 1210 YSAAPAIM SOADIONT

70'0 cO'0 L0°0 c0'0 c0'0 c0'0 100 100 800 9°9 Lil co OOT 60 OT SiO) 0) val c0 6s vy 9 “AOp's

€L'0 850 aml 8S°0 e£°0 Is'0 L10 910 L8'0 SL I] 60 8cl OCI Oor 8 Il HE WX Se Oe Gils, WAG uvoul

c8'0 £9°0 scl £9°0 80 cs‘0 070 810 bO'l £6 SI 1S {SSSI Gill EA — 981 L6 09¢ 08 OPrL OT8 LE xeul

89°0 ps0 v6.0 ps0 8c 0 Lv'0 S10 ame) cL'0 $9 6 SO IIl Tol LAVAL © ts)! Se MUG TOSS OES SR OKED Il ura

SC SC ST SC Sc SC Sc SC SC SC SC SG SG SC SC SC Sc Sc Sc Sc SC SC N

(sajeul) Yassad Sosad01N],

JHOW/D OW/daA MA/GH OW/da 3HIS/MH 3HIS/DOW T4/T9d TH/TEL TH/1L WSH AHS TID TH TH JHOW OW MH IHS) Ga IL Wa OO

‘ones yowyoy Jo dy 0} des yynow / des ynow = iOW/OW ‘ones ypIM peoy / Jojowerp sA0 = MH/Ga_ ‘ones des yynour/ 1ajowerp sA0 = OW/C_ ‘ones yourpay Jo dy oj dy nous

/ (PIM peoy = IHIS/MH “ones jourjoy Jo dy o} dy ynous / des yynour = IHIS/OW ‘ones ySua] Apog / yISue] wWueoIO} Tq/ToJ ‘ones ySuo] Apog / yBuo] eign = Tq/THL “ones yISuI]

Apog / yjsus] [1e} = Tq/TL ‘Apogprur ye sayeos yuey = WSJ ‘peoy Jo puoa pure oX9 usamyaq a]kOs JO JoquINU = FHS ‘}Saso Jens Jo YSU] = TH ‘yISuo] wue o10f = TOI ‘ySug] viqn

= TIL owyoy Jo dy 0} de8 yynow sourjsip = IO ‘des now = yyy ‘yIpIM peoy = MH “owyoy Jo dy 0} dy ynous sourysip = HIS “Jo}ourerp dA0 [eoI}IOA = QA ‘[!e} JO dy 0} vovojo

WOT, YISUD] [Ie] = TL “VOVO]D 0} nous Jo dy Woy YSU] Apog = Tg ‘jSo1O Ie[NS BUIULIO} sapeos Jo JoquINU = DN (‘Aop's) UOeIASp plepuejs pue (URoIT) SonjeA UROW “(xeU) WINUITX

-PUL “(UTUT) WINUITUTU “(N{) OZIS o[dues oI UDAID “SNJDAIAS ‘J, Pu IUMaYssapaIM “J ‘Yadssad SOAJIOLAT, B[CUIDJ PUL [LUI W]Npe JO (UIW) SoINseoU [eoIso;oYydiow jo Arewung *¢ sq

Bonn zoological Bulletin 57 (2): 211-229

“

_ ang

rod

nation

Bonn zoological Bulletin Volume 57

Bonn, November 2010

Another new Cophixalus species (Amphibia: Anura: Microhylidae)

from western New Guinea

Rainer Gtinther

Museum ftir Naturkunde Berlin, Leibniz Institute for Research on Evolution and Biodiversity at the

Humboldt-University, Invalidenstr. 43, D-10115 Berlin, Germany

Abstract. Based on external morphological, anatomical, bioacoustic, and molecular traits, a new species in the micro-

hylid genus Cophixalus is described. The new species was discovered in the Fakfak Mountains, northwestern corner of

the Bomberai Peninsula, Papua Province, Indonesia. The new taxon is most closely related to the sympatric Cophixalus

tetzlaffi. It differs from that species in several morphological traits, but primarily by its advertisement call: the new species

utters a single peeping note with a mean duration of less than 200 milliseconds, whereas the advertisement call of C. tetz-

laffi consists of three to four notes, with a mean note duration of more than 400 milliseconds. Molecular data (mitochon-

drial 16S rRNA) support the determination of the specific distinctness of the new species.

Key words. Anura, Asterophryinae, Cophixalus, new species, New Guinea.

INTRODUCTION

Fifty-one species in the microhylid frog genus Cophixalus

are known at present (Frost 2010). Of these, 14 occur in

north-eastern Australia, 30 in Papua New Guinea, three

are known only from the Papua Province of Indonesia,

three are recorded from both Papua New Guinea and the

Papua Province of Indonesia, and one species seems to be

endemic to the Island of Halmahera, located about 300 km

west of the western tip of New Guinea. Although many

new Cophixalus species are expected to be described al-

so from western New Guinea, the distribution centre of

the genus seems to be clearly in eastern New Guinea and

north-eastern Australia. Cophixalus montanus has been

known since 1895 from Halmahera, and the detection of

three new species in the western part of New Guinea (on

Yapen Island, on the Wandammen Peninsula, and on the

Bomberai Peninsula) came as a surprise (Gunther 2003,

2006).

Here I describe another new species from the Fakfak

Mountains on the Bomberai Peninsula (located on the

“throat” of the Vogelkop) found during an expedition in

September 2008. Moreover, a population of Cophixalus

tridactylus and one specimen of a second undescribed

species was observed there. Consequently, at least four

Cophixalus species occur syntopically in the middle and

higher elevations (400-1000 m above sea level, a.s.l.) of

the Fakfak Mountains.

Bonn zoological Bulletin 57 (2): 231-240

MATERIAL AND METHODS

Most frogs were collected at night after locating them by

their advertisement calls. Some specimens were pho-

tographed in life the next day and all specimens were

anaesthetized with chlorobutanol and subsequently fixed

in 2 % formalin. Tissue probes from thigh muscle were

taken from some frogs and stored in about 96 % ethanol

to enable DNA sequencing, before fixing the animals in

formalin. All specimens were transferred to 75 % ethanol

later in the Berlin museum. One specimen was cleared and

stained as an osteological preparation according to a

method modified from Dingerkus & Uhler (1977).

The following measurements were taken with a digital cal-

liper (> 10 mm) or with a binocular dissecting microscope

fitted with an ocular micrometer (< 10 mm) to the near-

est 0.1 mm:

SUL — snout-urostyle length: from tip of snout to distal

tip of urostyle-bone; SUL is about one to two mm

shorter than the snout-vent length (SVL). As the

measurement error is higher in the latter, I prefer to

use the former. In general, both measurements are

more or less identical and are used interchangeably

in this paper.

TL -—tibia length: external distance between knee and an-

kle;

TaL — length of tarsus: external distance, tarsal and ankle

joints held at a right angle;

©ZFMK

232 Rainer Gtinther

10° I i 3]

Fig. 1.

cality (1).

Map of the western part of New Guinea with type lo-

T4L — length of fourth toe: from tip of toe to proximal end

of inner metatarsal tubercle;

T4D — transverse diameter of disc of fourth toe;

F3L — length of third toe;

F3D — transverse diameter of disc of third finger;

F1D — transverse diameter of disc of first finger;

T1D — transverse diameter of disc of first toe;

HL — head length: from tip of snout to posterior margin

of tympanum;

HW — head width, taken in the region of the tympana;

SL — snout length: from an imaginary line that connects

the centres of eyes to tip of snout;

END — distance from anterior corner of orbital opening

to centre of naris;

IND — internarial distance between centres of nares;

ED — eye diameter: from anterior to posterior corner of

orbital opening;

TyD — horizontal diameter of tympanum.

Advertisement calls were recorded under natural condi-

tions with a Sony Digital Audio Tape (DAT) Walkman

TCD-D 100 and a Sennheiser microphone MKE 300 and

analysed with Avisoft-SAS Lab Pro software. All speci-

mens are currently stored in the Museum fiir Naturkunde

Berlin (ZMB) and bear registration numbers of that insti-

tution. Part of the type series will later be transferred to

the Museum Zoologicum Bogoriense (MZB).

RESULTS AND DISCUSSION

Cophixalus monosyllabus sp. n.

Holotype. ZMB 74993 (field number, FN: RG 7888) ;

adult male collected by R. Giinther and A. Piahar 6 km

Bonn zoological Bulletin 57 (2): 231-240

Fig. 2. Holotype of Cophixalus monosyllabus sp. n. head in

lateral view (above); head in dorsal view (below).

direct line NNE of Fakfak town, near the Fakfak-Kokas

road, Bomberai Peninsula (neck of Vogelkop), Papua

Province, Indonesia, 2°53’S and 132°18'E, elevation 500

ma.s.l., 9 September 2008 (Fig. 1).

Paratypes. ZMB 74994 (FN: RG 7889), ZMB 74995

(FN: RG 7890), ZMB 74996 (FN: RG 7912), ZMB 74997

(FN: RG 7915), ZMB 74998 (FN: RG 7916), ZMB 74999

(FN: RG 7926), ZMB 75000 (FN: RG 7927), ZMB 75001

(FN: RG 7951), ZMB 75002 (FN: RG 7952). ZMB 74997

is now an osteological preparation. All nine paratypes are

males. They were collected from 9 to 14 September 2008

along the Fakfak-Kokas road in the southern part of the

Fakfak Mountains, at elevations of from 400 to 700 m

a.s.l. Collectors were R. Giinther, M. Kapisa, and A. and

F. Piahar.

©ZFMK

New Cophixalus from western New Guinea 233

Table 1. Body measurements and body ratios of the type series of Cophixalus monosyllabus sp. n. ZMB-No are the inventory

numbers of the Museum ftir Naturkunde Berlin, FN are the field numbers of the author, SD indicates the standard deviation. ZMB

74993 is the holotype; ZMB 74997 is now an osteological preparation. All specimens are adult males. All measurements are in

mm; abbreviations are explained in “Material and methods”.

ZMB-No 74993 74994 74995 74996 74997 74998 74999 75000 75001 75002 mean SD

FN 7888 7889 7890 7912 PONS OMG, 7926 7927 7951 7952 22.9 1.04

SUL 22.8 DBolk 24.1 22.5 22.4 23.6 20.6 22.8 24.3 23.0

WE 10.9 ey) IEA ele Wes} ES: 10.1 INS 7/ 12.3 USF

TaL 7.4 U2 Yell 6.8 6.9 eZ UP 7.6 7.3 7)

T4L 11.5 11.6 i EG 11.2 11.1 10.5 LE 12.5 10.9

T4D 1.3 1E2'5 1.4 1.0 163 3 1.0 LED: 13'S 1:25

TID 0.7 0.65 OTS “OS 0.7 0.6 0.45 0.7 0.6 0.6

SIE 6.0 6.4 6.8 6.4 6.1 6.5 5)5) 59 6.8 6.0

F3D 1.4 1.4 Ned 1.45 es) 1.3 1.25 1S) 1) 1.4

FID 0.6 0.45 0.50 0.50 0.5 0.4 0.45 0.5 0.5 0.5

HL 7.5 V2) 8.2 Toll es) 8.0 6.8 Wess ES ie

HW 8.5 9.0 9.1 9.0 95 9.8 8.5 9.0 9.6 9.6

SL 3.2 3.3 3.6 33 3.5 3.4 32 33 Shep) 3.6

END 2.2 2.1 2.5 2.0 2.1 De 2.0 2.1 DD 2.0

IND D3} DES) 7) D3 DED 2.4 22 2S 2.5 DED

ED 2.8 2.9 3.1 DRS 2.9 2.8 Dall 2.8 3.0 3.0

TyD 1.2 1.0 12 1.0 1.0 1.1 1.0 0.9 1.0 1.0

TL/SUL 0.48 0.51 0.47 0.51 0.50 0.49 0.49 0.51 0.51 0.51 0.50 0.051

TaL/SUL 0.32 0.31 0.29 0.30 0.31 0.31 0.35 0.33 0.30 0.32 0.31 0.017

T4L/SUL 0.50 0.50 0.49 0.52 0.50 0.47 0.51 0.49 0.51 0.47 0.50 0.016

F3L/SUL 0.26 0.28 0.28 0.28 0.27 0.28 0.27 0.26 0.28 0.26 0.27 0.009

F3D/SUL 0.061 0.060 0.071 0.064 0.067 0.055 0.061 0.066 0.062 0.061 0.063 0.004

FID/SUL 0.026 0.019 0.021 0.022 0.031 0.017 0.022 0.022 0.021 0.022 0.021 0.002

T4D/SUL 0.057 0.054 0.058 0.044 0.058 0.055 0.049 0.053 0.056 0.054 0.054 0.004

TID/SUL 0.031 0.028 0.031 0.022 0.031 0.025 0.022 0.031 0.025 0.026 0.027 0.004

HL/SUL 0.33 0.31 0.34 0.32 0.33 0.34 = 0.33 0.32 0.31 0.33 0.33 0.011

HW/SUL 0.37 0.39 0.38 0.40 0.42 0.42 041 0.39 0.40 0.42 0.40 0.018

HL/HW 0.88 0.80 0.90 0.79 0.77 0.82 0.80 0.81 0.78 0.78 0.81 0.043

END/IND 0.96 0.84 0.84 0.87 0.95 0:92) 0:91 0.84 0.88 0.89 0.89 0.044

ED/SUL 0.123 0.125 0.129 0.111 O29 OMS On3it 0.123 0.120 0.130 0.124 0.006

TyD/ED 0.43 0.34 0.39 0.40 0.34 039.037 0.32 0.33 0.33 0.36 0.037

SL/SUL 0.140 0.143 0.149 0.147 0.156 0.144 0.155 0.145 0.141 0.156 0.148 0.006

Bonn zoological Bulletin 57 (2): 231-240 ©ZFMK

234 Rainer Giinther

Fig. 3. Holotype of Cophixalus monosyllabus sp. n. ventral

view of right hand (left); ventral view of right foot (right).

Diagnosis. With a snout-urostyle length of from 20.6 to

24.3 mm in ten adult males, the new species belongs to

the middle-sized species of the genus. It is obviously a sis-

ter species of the sympatric Cophixalus tetzlaffi and dif-

fers from all other species in the same characters as the

latter. The new species differs from C. fefzlaffi, among

others, by its larger body size, its wider finger and toe

discs, and its advertisement call which consists of only one

peeping syllable (note) that lasts, on average, 196 millisec-

onds (ms). In contrast, the advertisement call of C. tetzlaf-

fi consists of three to four peeping notes, with a mean note

length of more than 400 ms.

Description of the holotype. For measurements see Table

1. Head broader than long (HL/HW ratio 0.88), canthus

rostralis roundish; loreal region straight; snout slightly pro-

truding in profile (Fig. 2, above) and rounded in dorsal

view (Fig. 2, below); horizontal eye diameter greater than

eye-naris distance; borders of tympanum scarcely visible,

its size less than half of the eye diameter (TyD/ED 0.43),

no supratympanic fold; internarial distance slightly

greater than distance between eye and naris (END/IND

0.96); tongue large, posteriorly broadened and without

posterior notch, its posterior and lateral margins free; a

strongly serrated fold present in front of the pharynx; long

Fig. 4.

Bonn zoological Bulletin 57 (2): 231—240

Dorsolateral view of a more brownish coloured paratype of Cophixalus monosyllabus sp. n. (ZMB 74995).

©ZFMK

New Cophixalus from western New Guinea

Fig. 5. Dorsolateral view of a more greyish coloured paratype of Cophixalus monosyllabus sp. n. (ZMB 74999).

Fig. 6. Ventral view of a paratype of Cophixalus monosylla-

bus sp. n. (ZMB 74995).

Bonn zoological Bulletin 57 (2): 231-240

slits on both sides of the tongue are entrances to a subgu-

lar vocal sac. Legs moderately long, no webs between fin-

gers or toes (Fig. 3); tips of fingers wider than tips of toes,

first finger much smaller than other fingers, its tip only

scarcely wider than the penultimate phalanx; relative

length of fingers 3>2=4>1; third toe clearly longer than

the fifth, tip of first toe slightly smaller than tip of the fifth

toe, tips of remaining toes clearly wider than that of first

and fifth toe; all finger and toe tips with terminal grooves;

relative length of toes 4>3>5>2>1, all subarticular tuber-

cles as well as metatarsal and metacarpal tubercles not or

only scarcely developed. With exception of some tuber-

cles on flanks, all dorsal, lateral, and ventral surfaces

smooth.

Dorsum light brown and clearly demarcated against dark

brown upper flanks, dorsal surfaces of legs non-uniform

brown, chevron-shaped mark in scapular region, dorsal

surface of snout lighter than remaining body; dorsal sur-

faces of fingers and toes with yellowish, light brown, and

dark brown pattern; lateral and dorsolateral flanks with

longitudinal rows of blackish spots, a conspicuous black-

ish spot present also above insertion of foreleg and behind

eye; loreal region, tip of snout, and region below and be-

hind eye and underneath tympanum blackish (black face

mask); ventral surface of forelegs yellowish with irregu-

OZFMK

236 Rainer Gtinther

kHz

NO & OOO

0.05 0.10

Fig. 7.

35 ]

304

——

—

eewe

251

erews wae vows rar

otosst

9 kHz

Ol a 2 Ss Ay On Oi mee L ane.

Fig. 8. | Power spectrum of an advertisement call of Cophixa-

lus monosyllabus sp. n.

Bonn zoological Bulletin 57 (2): 231—240

SSAA, ES GSS

FRR ARE RRS. GR RGR SRS.

Ont 0.20 Ss

Wave form (above) and spectrogram (below) of an advertisement call of Cophixalus monosyllabus sp. n..

lar dark brown flecks, ventral surface of hind legs also yel-

lowish with brown flecks but the latter less intense than

on forelegs (ventral skin and muscle tissue of the right

thigh was removed for biochemical studies); belly, chest

and throat yellowish with brown pigmentation, pigmen-

tation most intense on throat and chest and least intense

on abdomen; region around anal opening blackish and re-

gion from behind eye, through tympanum, and up to up-

per arm whitish.

Variation in the type series: Mensural variation for the type

series is shown in Table 1. The basic colour and colour

pattern elements of all preserved types are fairly uniform

and very much resemble those of the holotype. Charac-

teristic elements are a light brown dorsum, which is dif-

ferentiated from dark brown upper flanks, a dark brown

and irregularly pronounced interocular band, a dark

chevron or W-shaped mark in the scapular region, a dark

face mask, a blackish spot behind eye and above inser-

tion of fore leg, a blackish throat which fades posterior-

ly into a diffuse dark brown reticulum, and a pale dorsal

surface of the snout which is the palest part of all the dor-

sal surfaces. Only one specimen (ZMB 74996) has a

whitish middorsal line from snout tip to anal opening and

which continues on to the posterior thighs.

The basic colour in life varies from créme or grey to light

brown. Dorsum rather uniform brownish (Fig. 4) or grey

(Fig. 5); conspicuous is a blackish or dark brown chevron

or W-shaped mark in the scapular region, an irregular dark

brown interocular band between posterior parts of eyes,

and a créme or light brown coloured dorsal part of snout.

Lower flanks are mostly lighter than the remaining later-

al areas (Fig. 4). Upper flanks may be of nearly the same

©ZFMK

New Cophixalus from western New Guinea

Fig. 9.

brown or grey colour as on the dorsum. Conspicuous are

a blackish spot behind the eye, another blackish spot above

the foreleg insertion, and some blackish spots at the bor-

der between the dorsum and flanks. It is notable that the

dorsum in all preserved specimens is clearly lighter than

the upper flanks, whereas the dorsum and upper flanks in

most living specimens differed in colour only slightly. Lo-

real region in all specimens entirely or predominantly

black. In some specimens this black area continues to be-

low the eye and extends up to the upper arm, in others this

black area ends below the eye. The inner margin of the

“upper eyelid” is whitish in most specimens, this colour

merging in a broad and light postocular band.

While there are no or only a few tubercles in the preserved

specimens, most living specimens exhibited tubercles on

the flanks and extremities (rarely on the dorsum). Many

of these tubercles have a blackish base and a orange-red

cap. Most, and the largest, tubercles are arranged in dor-

solateral rows. The yellowish spot posterior of the

chevron sign in ZMB 74999 (Fig. 5), which faded to a

white spot in preservative, is obviously an exception. Or-

ange-red areas were also found on the forelegs of some

specimens. The fine whitish middorsal line in the living

Bonn zoological Bulletin 57 (2): 231-240

—

Habitat of Cophixalus monosyllabus sp. n. in the Fakfak Mountains on the Bomberai Peninsula, 700 m a.s.1.

specimen in Fig. 5 disappeared completely in fixative.

Dorsal sides of legs similarly coloured as other dorsal and

dorsolateral body parts. Ventral sides of forearms créme-

coloured, its anterior and posterior part covered with ir-

regular dark spots. Throat and chest in all specimens dark-

er than on the remaining ventral surfaces. These dark ven-

tral areas are solidly or discontinuously black or dark

brown. Abdomen and ventral sides of hind legs show

greater light areas covered by a more or less dense retic-

ulum of grey-brown. Weakest pigmentation was common-

ly on the posterior abdomen (Fig. 6). Iris yellow-red and

nerved by a dense net of blackish lines.

Osteology. One cartilage-bone preparation (ZMB 74997)

did not show remarkable differences from that of Cophix-

alus tetzlaffi (see Giinther 2003).

Vocalisation. Most calling activities were recorded dur-

ing rain and damp weather from dusk to 9 p.m. All calls

were recorded at temperatures of approximately 21°C.

Calls are uttered in series lasting several minutes. The

shortest time between two successive calls was about 3

s. Each call consists of a single unpulsed and finely tuned

note (Fig. 7). Fifty-six calls (notes) from two males had

©ZFMK

238 Rainer Gtinther

Fig. 10. An undescribed Cophixalus species from the Fakfak Mountains, with a 16.9 mm snout-urostyle-length, which at first

glance resembles Cophixalus misimae recently described by Richards & Oliver (2007) from Misima Island, Louisiade Archipela-

go, Papua New Guinea.

a mean length of 196 ms, with a minimum of 173 ms and

a maximum of 224 ms. Most notes start with a sharp in-

crease in amplitude, and the sound volume may remain

constant during the entire note but may also change, with

the greatest sound volume mostly near the end. The end

of the note occurs more gradually and its exact cessation

is fairly difficult to identify (Fig. 7). The dominant fre-

quency 1s approximately 2.8 kHz (Fig. 8), the fundamen-

tal frequency is approximately 1.4 kHz, and the first (and

most pronounced) upper harmonic band is at about 4.2

kHz.

Distribution. The new species lives on slopes and in val-

leys of the southern part of the Fakfak Mountains. We

found it along the Fakfak town-Kokas road at elevations

of from 250 to 700 m a.s.l. Whether it also occurs in the

northern part of the Fakfak Mountains remains to be de-

termined.

Habitat and habits. Cophixalus monosyllabus sp. n. lives

mostly in the understory (bushes, young trees, and herbs)

of taller trees but also in shrubbery without a canopy cov-

er (Fig. 9). The frogs perched mainly on or between liv-

ing or dead leaves at heights of from one to three meters

above the ground. The species is common: we heard sev-

eral hundred males during a walk of three kilometres along

the Fakfak-Kokas road. Some males called at distances of

Bonn zoological Bulletin 57 (2): 231—240

only two m from one another. At favoured places about

ten males could be heard calling from one point. For bio-

geographical reasons it seems worthwhile to mention that

at elevations of between 500 and 700 m a.s.l., C. mono-

syllabus sp. n. occurs syntopically with C. tetzlaffi, C. tri-

dactylus, and another obviously new Cophixalus species

Cophixalus balbus ZMB 62594 (RG 7434)

Cophixalus balbus ZMB 62596 (RG 7487)

Cophixalus balbus ZMB 62597 (RG 7502)

Cophixalus tetzlaffi ZMB 62598 (RG 7144)

Cophixalus tetzlaffi ZMB 74988 (RG 7839)

Cophixalus monosyllabus ZMB 74994 (RG 7889)

Cophixalus monosyllabus ZMB 74997 (RG 7915)

Fig. 11. Bayesian inference phylogram of 16S rRNA. Numbers

on branches denote posterior probabilities.

OZFMK

New Cophixalus from western New Guinea 239

(Fig. 10). Ecological differences between these four

species are the following: C. monosyllabus sp. n. occurs

at from 250 to 700 m a.s.I. and its calling sites are at be-

tween one and three metres above ground; C. tetzlaffi oc-

curs at from 400 to 900 m a.s.l. (top of the mountains) and

its calling sites are on structures up to one m above the

ground; C. tridactylus was found at from 500 to 900 m

a.s.l. and its calling sites are on the ground; and the ob-

viously new species was found at 860 m a.s.]. in humus

soil below the ground surface.

Etymology. The Latin word “monosyllabus” is derived

from the Greek composite adjective “monosyllabos”

meaning one syllable or monosyllabic, and refers to the

advertisement call of the new species which consists of

only one uniform note. I dedicate this new species to my

dear colleague of many years, Prof. Dr. Wolfgang

Bohme, to acknowledge his extraordinary contributions

to herpetological science and on the occasion of his re-

tirement from official service, although it is well known

that Wolfgang is by no means monosyllabic but rather is

very eloquent.

Molecular evidence. According to B. Stelbrink and T. von

Rintelen (pers. comm., July 2010) DNA isolation and PCR

were done using the protocol of Kohler & Giinther (2008).

Forward and reverse strands were aligned using Codon-

Code Aligner v. 3.0.3 (CodonCode Corporation, Dedham,

MA, USA) and corrected by eye. Sequences were aligned

using MAFFT (Katoh & Toh 2008) and optimized using

ALISCORE (Misof & Misof 2009). Phylogenetic analy-

sis (Bayesian inference) was accomplished as conducted

by Giinther et al (2010).

The analysis of 480 base pairs of the 16S rRNA gene re-

vealed that Cophixalus monosyllabus sp. n. is clearly a

sister species of C. tetz/affi and both are a sister clade of

C. balbus (Fig. 11). C. tridactylus and C. humicola appear

more distant in the molecular tree (see also Kohler & Giin-

ther 2008), and indicate that the present genus Cophixalus

most probably is polyphyletic. The genetic distance (un-

corrected p-distance) between C. monosyllabus sp. n. and

C. tetzlaffi is 4.3 % for the 16S rRNA gene.

Comparison with other species. Cophixalus monosylla-

bus sp. n. is distinct from other Cophixalus species, des-

cribed up to the year 2003, in the same characters as is C.

tetzlaffi (Giinther 2003). All 16 Cophixalus species des-

cribed after 2003 (Hoskin 2004; Kraus & Allison 2006,

2009; Gtnther 2006; Richards & Oliver 2007) differ

clearly from C. monosyllabus sp. n. in body size and al-

so in their advertisement calls. The only species with

which C. monosyllabus sp. n. can be confused morpho-

logically is C. tetzlaffi, especially as both species occur

syntopically.

Bonn zoological Bulletin 57 (2): 231-240

.070

.065

.060

O55

050

O45

A B

Fig. 12. Box-Whisker-Plot of the ratio “diameter of disc of

fourth toe/snout-urostyle-length” (F3D/SUL) in Cophixalus tetz-

laffi (A) compared to that of Cophixalus monosyllabus sp. n. (B).

©ZFMK

240 Rainer Gunther

I compared the measurements of ten male C. monosyllabus

sp. n. with that of eight male C. fetzlaffi and found the fol-

lowing differences: with a mean body size (SUL) of 23.0

mm (range 20.6—24.3 mm), C. monosyllabus sp. n. 1s

somewhat larger than C. fetzlaffi (mean 21.4 mm, range

19.5—22.6 mm), Student’s t-test revealed a significant dif-

ference with t=2.98 and P=0.0046 in this character; C.

monosyllabus sp. n. has significantly shorter tibiae than

C. tetzlaffi (mean of TL/SUL in C. monosyllabus sp. n.

0.50, that in C. tetzlaffi 0.52, t= 3.39, P=0.0019); C. mono-

syllabus sp. n. has a longer third finger than C. tetzlaffi

(mean of F3L/SUL in the former 0.27, in the latter 0.26,

t=3.01, P=0.0041; C. monosyllabus sp. n. has a wider ter-

minal disc on the fourth toe than C. fetzlaffi (mean of

T4D/SUL in the former 0.054, in the latter 0.046, t=3.11,

P=0.0094); C. monosyllabus sp. n. has a wider terminal

disc on first toe than C. tetzlaffi (mean of T1D/SUL in the

former 0.027, in the latter 0.018, t=5.63, P=0.00002); C.

monosyllabus sp. n. has a wider terminal disc on first fin-

ger than C. tetzlaffi (mean of F1D/SUL in the former

0.021, in the latter 0.015, t=5.36, P=0.00003) and, most

significantly, C. monosyllabus sp. n. has a wider terminal

disc on the third finger than C. tetzlaffi (mean of F3D/SUL

in the former 0.063, and in the latter 0.051, t=6.14,

P=0.000007) (Fig. 12). There are continuous dorsolater-

al skin ridges in C. ftetzlaffi, but discontinuous dorsolat-

eral skin glands in C. monosyllabus sp. n.

Apart from these morphological differences, and most im-

portant for species differentiation, are the advertisement

calls: C. monosyllabus sp. n. utters a single peeping note

with a mean duration of 196 ms (range 173-224 ms),

while the call of C. tetzlaffi consists of three to four peep-

ing notes with a mean note duration of 422 ms (range

347-518 ms).

Acknowledgements. Field work and collection of voucher speci-

mens was permitted by representatives of Belai Besar Konser-

vasi Sumber Daya Alam (KSDA), Sorong, Papua Province of

Indonesia (PPI). Marthinus Kapisa (Biak/PPI), Andreas, Frank,

and Apner Piahar (Kampung Lusiperi near Fakfak Town/PPI),

and Christian Bergmann (Berlin/Germany) helped during field

work. The Family Piahar also permitted the collection of frogs

on their property. Rudolf Arndt (Pomona, New Jersey, USA)

carefully read my draft and made a number of helpful comments.

B. Stelbrink and T. von Rintelen (ZMB) “constructed” the mo-

lecular tree. Elisa Forster (Ztirich, Switzerland) prepared Figures

2 and 3, and Frank Tillack (ZMB) provided technical help. To

all of them I am deeply grateful.

Bonn zoological Bulletin 57 (2): 231-240

REFERENCES

Dingerkus G, Uhler LD (1977) Enzyme clearing of alcian blue

stained whole small vertebrates for demonstrating cartilage.

Stain Technology 52: 229-232

Frost DR (2010) Amphibian Species of the World: an online

reference, version 5.4 (8 April 2010). American Museum of

Natural History, New York. Available from:

http://research.amnh.org/herpetology/amphibia/index.php

Giinther R (2003) First record of the microhylid frog genus

Cophixalus from western Papua, Indonesia, with descriptions

of two new species. Herpetozoa 16 (1/2): 3-21

Giinther R (2006) Two new tiny Cophixalus species with reduced

thumbs from the west of New Guinea (Anura: Microhylidae).

Herpetozoa 19 (1/2): 59-75

Giinther R, Stelbrink B, Rintelen T von (2010). Oninia senglaubi,

another new genus and species of frog (Amphibia, Anura, Mi-

crohylidae) from New Guinea. Zoosystematics and Evolution

86 (2): 245-256

Hoskin CJ (2004) Australian microhylid frogs (Cophixalus and

Austrochaperina): phylogeny, taxonomy, calls, distributions

and breeding biology. Australian Journal of Zoology 52: 237—

269

Katoh K, Toh H (2008) Recent developments in the MAFFT

multiple sequence alignment program. Briefings in Bioinfor-

matics 9: 286-298

Kohler F, Giinther R (2008) The radiation of microhylid frogs

(Amphibia: Anura) on New Guinea: A mitochondrial phyloge-

ny reveals parallel evolution of morphological and life histo-

ry traits and disproves the current morphology-based classi-

fication. Molecular Phylogenetics and Evolution 47: 353-365

Kraus F, Allison A (2006) Three new species of Cophixalus

(Anura: Microhylidae) from southeastern New Guinea. Her-

petologica 62: 202—220

Kraus F, Allison A (2009) New species of Cophixalus (Anura:

Microhylidae) from Papua New Guinea. Zootaxa 2128: 1-38

Misof B, Misof K. (2009) A Monte Carlo approach successful-

ly identifies randomness in multiple sequence alignments: A

more objective means of data exclusion. Systematic Biology

58: 21-34

Richards SJ, Oliver PM (2007) A new species of Cophixalus

(Anura: Microhylidae) from Misima Island, Papua New Gui-

nea. Pacific Science 61 (2): 279-287

Received: 27.VII.2010

Accepted: 11.X.2010

OZFMK

Bonn zoological Bulletin | Volume 57

Issue 2

pp. 241-255 Bonn, November 2010 |

High mitochondrial sequence divergence meets morphological and

bioacoustic conservatism: Boophis quasiboehmei sp. n.,

a new cryptic treefrog species from south-eastern Madagascar

Miguel Vences !, Jérn Kohler 2, Angelica Crottini !3 & Frank Glaw 4

! Division of Evolutionary Biology, Zoological Institute, Technical University of Braunschweig,

Spielmannstr. 8, D-38106 Braunschweig, Germany; E-mail: m.vences@tu-bs.de

? Department of Natural History — Zoology, Hessisches Landesmuseum Darmstadt, Friedensplatz 1,

D-64283 Darmstadt, Germany

3 Sezione di Zoologia e Citologia, Dipartimento di Biologia, Universita degli Studi di Milano, Via Celoria 26,

I-20133 Milano, Italy

4 Zoologische Staatssammlung Miinchen, Miinchhausenstr. 21, D-81247 Miinchen, Germany

Abstract. We describe a new species of treefrog from Madagascar that is highly similar in external adult morphology,

bioacoustics and colouration to Boophis boehmei but differs from this species by a remarkable differentiation in a frag-

ment of the mitochondrial 16S rRNA gene. A more detailed analysis revealed that this differentiation is concordant with

the pattern in two nuclear genes (Rag! and POMC) which show no hapiotype sharing of the new species with B. boehmei,

and with a consistent difference in tadpole morphology (third lower row of labial keratodonts reduced in length in the

new species). We conclude that concordance between these independent characters indicates two independent evolution-

ary lineages that should best be considered as separate species, despite their similar adult morphology. The new species,

Boophis quasiboehmei sp. n., is so far known only from an area in the southern central east and south-east of Madagas-

car, south of the Mangoro river, while B. boehmei is known only from the area around Andasibe north of the river Man-

goro. Preliminary data indicate that this group of treefrogs contains several more cryptic species, and a simple explana-

tion assuming the Mangoro river as a barrier being responsible for divergence between them is likely no longer tenable.

Key words. Amphibia, Anura, Mantellidae, Boophis boehmei, Boophis quasiboehmei sp. n., Madagascar.

INTRODUCTION

Treefrogs of the genus Boophis have long been among

Madagascar’s less studied amphibians, but intensified

fieldwork and application of integrative taxonomy proto-

cols have led to a steep increase of knowledge (Blommers-

Schlosser 1979; Cadle 2003; Glaw & Vences 2007; Glaw

et al. 2010). Many Boophis species call from high posi-

tions in the vegetation and intensive nocturnal searches

for calling males are needed to find them. Consequently,

many species have been described on the basis of only

small series or even single individuals, and females are

often unknown. Furthermore, many species of Boophis are

known to be morphologically very similar and a diagno-

sis based on external morphology alone is often unreli-

able (Glaw et al. 2001; Vences et al. 2008). However, be-

cause the advertisement calls of these species are usual-

ly loud and species-specific (Vences et al. 2006), the

Bonn zoological Bulletin 57 (2): 241-255

integration of bioacoustics into their taxonomy has led to

an improved understanding of Boophis species diversity.

Together with an initial screening of molecular diversity,

this has led to the description of many new species of

Boophis (e.g., Andreone 1993, 1996; Andreone et al. 1995;

Cadle 1995; Glaw & Thiesmeier 1993; Glaw & Vences

1992, 1994, 1997b, 2002; Glaw et al. 2001, 2010; Koh-

ler et al. 2007, 2008; Vallan et al. 2003, 2010; Vences &

Glaw 2002, 2005; Vences et al. 2010; Wollenberg et al.

2008) and the identification of a large number of addition-

al, yet undescribed candidate species (Vieites et al. 2009).

Furthermore, tadpoles of Boophis are among the most

commonly encountered anuran larvae in Malagasy rain-

forest streams (Vences et al. 2008), and a large number

of them have recently been described (e.g., Raharivololo-

niaina et al. 2006; Randrianiaina et al. 2009a, b).

©ZFMK

242 Miguel Vences et al.

Taking the latest species descriptions into account, the

genus Boophis, classified in the endemic Malagasy-Co-

moroan family Mantellidae, currently comprises 71 de-

scribed species. The genus is monophyletic and composed

of two main clades that correspond to mainly stream-

breeding (subgenus Boophis) and pond-breeding species

(subgenus Sahona), respectively (Glaw & Vences 2006,

2007). The stream breeders are further divided into eight

phenetic species groups. Most of these species groups

probably are monophyletic units although some are not

(particularly the Boophis majori group).

The Boophis goudoti species group contains 13 small to

large species of largely arboreal frogs that are mainly dis-

tributed in the rainforests and highlands of Madagascar.

A subgroup of small-sized species is characterized by

colourful eyes, usually with red iris colour and a bluish

iris periphery (Glaw & Vences 1997a, b). Several of these

species such as Boophis boehmei, B. burgeri, B. reticula-

tus, and B. rufioculis are known to occur at the same lo-

cality in the Andasibe region in the northern central east

of Madagascar and B. reticulatus, B. sp. aff. rufioculis and

B. sp. aff. boehmei (= B. sp. 8 and B. sp. 16 of Vieites et

al. 2009) in Ranomafana National Park in the southern

central east. Of the various confirmed candidate species

in the B. goudoti group (Glaw & Vences 2007; Vieites et

al. 2009), four have recently been described (or older

names were resurrected for them) on the basis of molec-

ular, morphological, and/or bioacoustic differences (Glaw

et al. 2010). However, no taxonomic conclusions have so

far been drawn for the two candidate species from the Ra-

nomafana region mentioned above (B. sp. 8 and B. sp. 16),

mainly because of their high morphological similarity to

Boophis rufioculis and to B. boehmei, respectively.

Boophis boehmei is the smallest species in the B. goudoti

group and has been originally described from Andasibe,

where it is rather common (Glaw & Vences 1992). Pop-

ulations from more southern localities, initially allocated

to this species (Ranomafana region and Andohahela)

turned out to be genetically highly divergent (Vieites et

al. 2009) and have therefore been considered as Boophis

sp. aff. boehmei (Glaw & Vences 2007) or B. sp. 16

(Vieites et al. 2009), although no reliable morphological

or bioacoustic difference between them had been ob-

served. The recent discovery of differences in the tadpole

labial tooth row arrangements of Boophis boehmei and

Boophis sp. 16 (Randrianiaina et al. 2009b) prompted us

to undertake a more detailed comparison. On the basis of

high mitochondrial divergences, consistent differences in

two nuclear genes, constant differences in tadpole mor-

phology, and subtle differences in iris colour, we conclude

that the central south-eastern populations indeed consti-

tute a distinct species which we describe herein as Boophis

quasiboehmei. It is however worth to note that B. boehmei

Bonn zoological Bulletin 57 (2): 241-255

and the newly described species are indeed among the

morphologically and bioacoustically most cryptic species

pairs so far discovered in Madagascar.

MATERIALS AND METHODS

Frogs were collected at night by opportunistic searching,

using torches and head lamps. Specimens were euthanized

in a chlorobutanol solution, fixed in 95% ethanol, and pre-

served in 70% ethanol. Locality information was record-

ed with GPS receivers. Specimens were deposited in the

collection of Université d’ Antananarivo, Département de

Biologie Animale, Antananarivo (UADBA), Zoologisches

Forschungsmuseum Alexander Koenig, Bonn (ZFMK),

and the Zoologische Staatssammlung Munchen (ZSM).

FGMV, FGZC and ZCMV refer to F. Glaw and M. Vences

field numbers. Terminology for biogeographic regions of

Madagascar follows Boumans et al. (2007).

Morphological measurements (in millimetres) were all

done by M. Vences with a digital caliper (precision 0.01

mm) to the nearest 0.1 mm. Used abbreviations are: SVL

(snout—vent length), HW (greatest head width), HL (head

length), ED (horizontal eye diameter), END (eye—nostril

distance), NSD (nostril-snout tip distance), NND (nos-

tril-nostril distance), TD (horizontal tympanum diameter),

TL (tibia length), HAL (hand length), HIL (hindlimb

length), FOL (foot length), FOTL (foot length including

tarsus), FORL (forelimb length), and RHL (relative

hindlimb length). Terminology and description scheme

follow Glaw et al. (2010). Webbing formulae follow

Blommers-Schloésser (1979). Statistical analyses were per-

formed with Statistica software (Statsoft Corp., Tulsa,

USA).

Vocalizations were recorded in the field using different

types of tape recorders (Sony WM-D6C, Tensai RCR-

3222) and external microphones (Sennheiser Me-80, Vi-

vanco EM 238), and an Edirol R-09 digital recorder with

internal microphones and saved as uncompressed files.

Recordings were sampled (or re-sampled) at 22.05 kHz

and 16-bit resolution and computer-analysed using the

software CoolEdit 98. Frequency information was ob-

tained through Fast Fourier Transformation (FFT; width

1024 points). Spectrograms were obtained at Hanning

window function with 256 bands resolution. Temporal

measurements are given as range, with mean + standard

deviation in parentheses. Terminology in call descriptions

follows Kohler (2000).

Two different molecular data sets were studied:

First, we analyzed sequences of the mitochondrial 16S

tRNA gene of around 500 bp from all Boophis goudoti

OZFMK

Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar

Table 1. Primer sequences and PCR conditions used in the present study. PCR conditions start with temperature (in °C) of each

step followed by the time in seconds.

Gene Primer name Sequence (5’ > 3’) Source PCR conditions

BDNF — BDNF DRV | ACCATCCTTTTCCTKACTATGG Vieites et al. (2007) 94(120), [94(20), 57(45),

BDNF — BDNF DRV 1 CTATCTTCCCCTTTTAATGGTC Vieites et al. (2007) 72(120) 39], 72(600)

Ragl Amp F2 ACNGGNMGICARATCTTYCARCC s. Chiari et al. (2004) = 94(120), [94(20), 50(50),

Ragl Amp R2 GGTGYTTYAACACATCTTCCATYTCRTA — s. Chiari et al. (2004) = 72(180) x 45], 72 (600)

POMC POMCDRVFI ATATGTCATGASCCAYTTYCGCTGGAA Vieites et al. (2007) 95(120), [95(60), 58(60),

POMC POMCDRVRI GGCRITYTTGAAWAGAGTCATTAGWGG _ Vieites et al. (2007) 72(90) x 35], 72(600)

group species and candidate species with reddish iris

colour as obtained by Vieites et al. (2009), Randrianiaina

et al. (2009b) and StrauB8 et al. (2010). After alignment and

removal of incomplete sections at its beginning and end

the data set for analysis had a length of 479 bp. Unparti-

tioned Bayesian inference searches were performed. The

best model of evolution (GTR+G) was determined by AIC

in MrModeltest (Nylander 2002). Bayesian analyses were

performed with MrBayes 3.1.2 (Ronquist & Huelsenbeck

2003). Two runs of 10 million generations (started on ran-

dom trees) and four incrementally heated Markov chains

(using default heating values) each, sampling the Markov

chains at intervals of 1000 generations were used. The last

5001 trees were retained post burn-in and summarized to

generate the majority rule consensus tree.

Second, we used tissue samples of four and one Boophis

boehmei from Andasibe and An’ Ala, respectively, and four

and two tissue samples of B. quasiboehmei from Sa-

hamalaotra (=Samalaotra) and Ambohitsara (Tsitolaka for-

est) for newly determining DNA sequences of various nu-

clear genes. Toe clips or leg muscle tissue samples (pre-

served in 95% ethanol) were used for DNA extraction. To-

tal genomic DNA was extracted from the tissue samples

using proteinase K digestion (10 mg/ml concentration) fol-

lowed by a standard salt extraction protocol (Bruford et

al. 1992). We amplified fragments of three genes from the

nuclear DNA (nuDNA): brain-derived neurotrophic fac-

tor (BDNF), recombination activating gene | (Rag1), and

pro-opiomelanocortin (POMC). Standard Polymerase

chain reactions were performed in a final volume of 11

ul and using 0.3 pl each of 10 pmol primer, 0.25 ul of to-

tal dNTP 10 mM (Promega), 0.08 ul of 5 U/ml GoTagq,

and 2.5 ul 5X Green GoTaq Reaction Buffer (Promega).

Primers and detailed PCR conditions are provided in Table

1. PCR products were then purified through QIAquick pu-

rification kit (Qiagen) according to the manufacturer’s in-

struction. Purified PCR templates were sequenced on an

automated DNA sequencer (Applied Biosystems ABI

3130XL). Chromatographs were checked and sequences

Bonn zoological Bulletin 57 (2): 241-255

were edited using CodonCode Aligner (v. 2.0.6, Codon

Code Corporation). All newly determined sequences have

been deposited in GenBank (HQ380132-HQ380172).

Haplotypes of POMC data were inferred using the PHASE

algorithm (Stephens et al. 2001) implemented in DnaSP

software (Version 5.10.3; Librado & Rozas 2009). Hap-

lotype network reconstruction of phased sequences of the

POMC (Fig. 2A) and Rag! (Fig. 2B) fragments were per-

formed using the software TCS, version 1.21 (Clement et

al. 2000). This software employs the method of Temple-

ton et al. (1992) and it calculates the number of mutation-

al steps by which pairwise haplotypes differ, computing

the probability of parsimony for pairwise differences un-

til the probability exceeds 0.95 (no manual adjustment of

threshold was necessary).

RESULTS

A detailed analysis of all available 16S rRNA sequences

of adults and tadpoles assigned to B. boehmei (GenBank

accession numbers GQ904739-GQ904746,

DQ792470-DQ792471, AY341717, AY848560—

AY 848562) and the candidate species B. sp. 16 (sensu

Vieites et al. 2009) (accession numbers

GQ904717—GQ904738, AY848529—AY 848536) con-

firmed that these two forms are genetically highly diver-

gent. Depending on the length of the sequence available,

the uncorrected pairwise distances were between 8.8% and

11.0% (note that these values are higher than the 6.8% re-

ported by Vieites et al. (2009) because of different lengths

of the sequences, with a different proportion of hypervari-

able sites included in the analysis). Next to single substi-

tutions we also detected one major insertion of seven nu-

cleotides in the candidate species which in this extent was

not present in any of the related species of Boophis (Fig.

1). Pairwise divergences were 0.0—-0.9% within B.

boehmei, 0.0—0.5% within specimens of B. sp. 16 from the

Ranomafana region, and 3.6-4.9% between the single

available sequence of B. sp. 16 from Andohahela

©ZFMK

244 Miguel Vences et al.

Boophis axelmeyeri (Tsaratanana - DQ118669)

Boophis rufioculis (An'Ala - DQ003334)

U——_______-. Boophis sp. 41 (Mahasoa - FJ559156)

** Boophis sp. 8 - aff. rufioculis (Maharira - ZCMV 235 - AY848535)

Boophis sp.8 - aff. rufioculis (Antoetra - FAZC 11465 - AY848553)

Lr Boophis sp. 8 - aff. rufioculis (Antoetra - FAZC 11451 - AY848551)

“ Boophis sp.8 - aff. rufioculis (Antoetra - FAZC 11452 - AY848552)

Boophis sp. 40 (Mahasoa - FJ559155)

lime Boophis boehmei [Ca43 HM631885] (Sahafina - PSG 418)

Lr Boophis boehmei [Ca43 HM631885] (Sahafina - PSG 313)

“ Boophis boehmei [Ca43 HM631885] (Sahafina - PSG 417)

*k* Boophis boehmei (Andasibe - LR 167 - DQ792471)

re Boophis boehmei (Andasibe - FGMV 2001.1206 - AY848560)

Boophis boehmei (Andasibe - MVTIS 2002G39 - AY848562)

[ Boophis boehmei (Andasibe - LR 145 - DQ792470)

Lp Boophis boehmei (Andasibe - FGMV 2001.1205 - AY848559)

** L— Boophis boehmei (Andasibe - FGMV 2001.1205 - AY341717)

Lp Boophis boehmei (Andasibe - MVTIS 2002G38 - AY848561)

“ Boophis boehmei (An'Ala - ZCMV 3508 - GQ904744)

** Boophis boehmei (An'Ala - ZCMV 3571 - GQ904746)

“ Boophis boehmei (An'Ala - ZCMV 3482 - GQ904739)

Boophis boehmei (An'Ala - ZCMV 3445 - GQ904740)

Ly Boophis boehmei (An‘Ala - ZCMV 3555 - GQ904745)

“ Boophis boehmei (An'Ala - ZCMV 3458 - GQ904741)

Boophis quasiboehmei (Andohahela - FGZC 236 - AY848529)

Boophis quasiboehmei (Ranomafana - ZCMV 324 - AY848536)

“ Boophis quasiboehmei (Ranomafana - ZCMV 2690 - GQ904734)

Boophis quasiboehmei (Ranomafana - FGMV 2002.327 - AY848534)

“ Boophis quasiboehmei (Ranomafana - ZCMV 3624 - GQ904729)

-— Boophis quasiboehmei (Ranomafana - ZCMV 3634 - GQ904731)

“ Boophis quasiboehmei (Ranomafana - ZSM 1153/2007 - GQ904725)

*k* Boophis quasiboehmei (Ranomafana - FGMV 2002.328 - AY848533)

“ Boophis quasiboehmei (Ranomafana - FGMV 2002.324 - AY848530)

L— Boophis quasiboehmei (Ranomafana - ZCMV 2688 - GQ904733)

‘ Boophis quasiboehmei (Ranomafana - ZCMV 3767 - GQ904728)

Boophis quasiboehmei (Ranomafana - FGMV 2002.325 - AY848531)

el “ Boophis quasiboehmei (Ranomafana - ZSM 752/2007 - GQ904719)

|. Boophis quasiboehmei (Ranomafana - ZSM 1370/2007 - GQ904724)

0.1 “ Boophis quasiboehmei (Ranomafana - ZSM 1010/2007 - GQ904721)

Boophis quasiboehmei (Ranomafana - ZCMV 4083 - GQ904726)

“ Boophis quasiboehmei (Ranomafana - ZCMV 3045 - FJ559139)

Boophis quasiboehmei (Ranomafana - FGMV 2002.326 - AY848532)

. Boophis quasiboehmei (Ambohitsara - ZCMV 4937 - GQ904735)

Boophis quasiboehmei (Ranomafana - ZSM 684/2007 - GQ904718)

Lr Boophis quasiboehmei (Ranomafana - ZSM 932/2007 - GQ904720)

“ Boophis quasiboehmei (Ranomafana - ZCMV 4491 - GQ904717)

DQ792471 (NTAAA ET ARTE RETA T RATE

0Q792470 |AtAAAT TART ET TAATBATEGRAGA

AY848562 [ATAAATEAR TDD ETAT EATE

AY848561 (MTARATTART TED DARTRATEER AEN

AY848560 [ATARAT TAA TEED TAATATEERABR-------

AY848559 (AGARATTA ATED EM AERATEG HABA. ------

AY341717 HeeeeeeenraaHAnlaniiiata aS

GQ904746 |ATAAA TT ANTE T TTA R EC RAGA

6Q904745 (ATEAREERE RADHA REREAD EAREER- ------

GQ904741 |AEAAAEANTONETANT HATO GEREN

GQ904740 (TMM N TANT TET TAN TAREE ERAGK

GQ904739 ATMA TE AATTTTTA ATE

AY848536 (MTAAATTAM TERT EAATEAGE ERAT ABRRRATAAT CRATERS

AY848534 (KTAAATTAAT TET OMATRAGEER ADAG CAO HOATOAEORESEAAE

AY848533 |ATAAATTARTTTRRAATEARERRATAGEE RATAN TERA TEAM CHARGE ANDRE AECERREEE)

AY848532 (HTAMATTAAT EDD EMATRARE ERAT ACR RRATANT ERAT OAAGRAAG RANA TT AGRE TERED)

AY848531 (ATMAATTAATTTTEAATPARRRRAT AGG ERAT ARTE RA DENNER ARECRAB TA

AY848530 (MPAAATTAAT TDD GAATHAREE RAT AERORATAATERARGAAGRAAGCAABET Bi

AY848529 (MHMAATTAMTEDEDAATRAREE RAT AERGRATAAT ERAT ERAGE GAMERTAG TO REE

Fig. 1. Phylogenetic tree of species and candidate species of the Boophis goudoti group with red iris colour, obtained using Bayesian

inference based on DNA sequences of the mitochondrial 16S rRNA gene (alignment length 479 bp). Bayesian posterior values

>0.95 symbolized by a single asterisk, of 0.99-1.00 by two asterisks. For each sequence, locality, voucher number and Genbank

number are given in parentheses. Boophis goudoti was used as outgroup (not shown). Note that the deeper phylogenetic relation-

ships shown are not reliable due to the limited amount of sequence information used in the analysis, and according to an unpub-

lished multi-gene data set of K. C. Wollenberg, B. boehmei and B. quasiboehmei are probably sister groups. The alignment in the

lower part of the figure shows a section of the 16S alignment, with sequences of Boophis boehmei (upper 13 sequences; numbers

to the left are Genbank accession numbers) and Boophis quasiboehmei (lower seven sequences). The insertion of seven nucleotides

is a synapomorphy of all B. guasiboehmei specimens for which a sequence was obtained, and in this extent is lacking also in all

other species of the B. goudoti group.

Bonn zoological Bulletin 57 (2): 241-255 ©ZFMK

Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar 245

10R

Fig. 2.

Boophis quasiboehmei

® Sahamalaotra

= Ambohitsara

Boophis boehmei

Andasibe

= An'Ala

fe—

R 1\2\ 358

Haplotype networks of the nuclear POMC (A) and Rag! (B) genes fragments in B. boehmei and B. quasiboehmei, each

from two different localities. Haplotypes per each individual were inferred using the Phase algorithm. The networks show com-

plete absence of haplotype sharing among the two taxa.

(AY848529) and those from Ranomafana. Genetically

identified specimens assigned to B. boehmei were from

Andasibe and An’ Ala. Specimens from Sahafina (Gehring

et al. 2010) had quite divergent DNA sequences and their

status is unclarified, but they clustered with B. boehmei

(Fig. 1). Following the scheme suggested by Padial et al.

(2010), this population was considered a new unconfirmed

candidate species Boophis boehmei [Ca43 HM631885] by

Gehring et al. (2010). Probably, specimens from Ankeni-

heny for which no molecular data are available belong to

this species as well. Specimens assigned to B. sp. 16 were

from the Ranomafana area (including Ambatovory, Sa-

hamalaotra, Imaloka, Kidonavo, Vohiparara) and Ambo-

hitsara, as well as from Andohahela.

Besides a simple assessment of molecular divergences be-

tween Boophis sp. 16 and B. boehmei it is also necessary

to comment on its phylogenetic position. The analysis of

Vieites et al. (2009) placed B. boehmei with B. sp. 8 from

Ranomafana and B. sp. 40 from Mahasoa forest, and the

clade made up by these species was sister to B. sp. 16. Our

Bonn zoological Bulletin 57 (2): 241-255

analysis (Fig. 1) included sequences of all these taxa and

confirmed the phylogenetic relationships suggested by

Vieites et al. (2009). However, an unpublished analysis

based on multiple mitochondrial genes by K.C. Wollen-

berg instead suggested a probable sister-group relationship

between B. boehmei and B. sp. 16, confirming that the 16S

rRNA gene alone as used here is insufficient to clarify the

phylogeny among Boophis species. Altogether, the phy-

logenetic relationships among all these species require a

much more detailed analysis which however is beyond the

scope of the present paper.

The results of the mitochondrial marker indicate no or lim-

ited gene flow between B. boehmei and B. sp. 16. This re-

sult was corroborated by the analysis of two nuclear mark-

ers (Fig. 2; the conserved BDNF gene showed no varia-

tion). While in POMC (Fig. 2A), the single included

An’ Ala specimen had a different haplotype not clustering

with those of Andasibe, in Rag! the haplotypes belong-

ing to the two species formed two well-defined clusters

separated from each other by a minimum of six mutation-

©ZFMK

ASUOpI|y

S OO Wel wee ivYs 86 T6l 8€ O€ EG Cv 61l oll SIl s0¢ W ~BYRIOJOY = 66L01 YOU 9007/8LT WSZ

uoIsal

G “A7S| ASI SIG fei v6 Gis fits VC eG OT 61 ¢Il TIl ¢€6c W eueyeuoury Id . C886$ MINAZ

uoIsal

Se 99 Sel “SiGe Sr 9'6 Ors ORE 8ST YT lv Oc SI SIL Coc W euefemoury td = T886S$ MINAZ

(Z) Joa Ajayeury-

& GS» Mel Cig Sei 16 esl 2 Gite [EXG SG OV ol Gly SL0l “6i8G IN vuouey Id plLee AWOZ 9007/77 WSZ

G GV. OGL WG OS V8 She Se LAG OG 6€ Oc OTL SOL 8l7 W PeustiouRy Id 09Ee AWOZ 9007/17 WSZ

G - WS “SG KG tsxor7 v6 (AW Gis LT OT One TZ SIl LOL 8% W Atoaoyequy Id OLO0E AWOZ 9007/07 WSZ

S Sl “SC Mae te ES 9'6 OrG le SIGE VC iG 6£ O07 TIL TIT 98% W Atoaojequy Id 690 AWOZ 9007/6777 WSZ

G GM “Gel OGG ~ Ws 66 SOC VE NG VC rv SI OIL TIL €6% W Atoaoyequy Id TSO€ AIWOZ = 9007/8T7 NSZ

S GM LEl SEG - 50S 9'6 Sisley eae OT Gi 6€ Si Sal AO SiGe an eyoreuy = =td 1$6c AWOZ = 9007/9TT WSZ

y WS Wal IOUG “Gs 88 SLITS Bese ST ST Uv 6T 9IT LOL Sle WeHovjeueyes Id 8860 AWOZ 9007/777T WSZ

C= SiS 6Il 80C O87 06 Wb, YES SC Sie LSE 61 OIL 901 887 W_ ererediyoA Id €9€0-COOTAW/DA £€007Z/SIL WSZ

GS GS TIT 80¢ I18pP 16 [EEN Nee 2G CC Lae O07 TIL 901 L9T W Atoaoyequy LH Sp0e AWOZ = 9007C/LTT WSZ

ea 1awyaogisonh -g

3 G WIG SEI SG GS SIH Ore CY ce LAE Cv 6c VSI 8rl 90b d oqisepuy = = 8009 MINAZ

Ss IL --OWG POU Lee - Wee eel Isc vr tate cae Os Se “orl vl Sip a PIV UV = O00rC AWOZ = 9007/STT WSZ

2 S GWE -_OSIE OG “SQ oul! 6vC OF O€ Lig Os XG GSI AOA AEE oul oqisepuy = 90TT 100C ANWDA = CO0T/ST WSZ

=I ¢ CSI ICE OG SY c8 ILI ens LEG GE CV OFC = Ta 90 OPE CIN ey UV 7 = v8009 MWAZ

GSO WEG. wae Ass £6 Gol s68e IEG VC vv [eG. = VA lS 0S SN oqisepuy a = O0S90S MINAZ

bp 6ST CCl “SiN Gees SiSv. 9°8 VO vas SHG CaG Tv Ge GOK 901 8i8G-IN oqisepuy = = 6790S MINAZ

GC 6ul, VO “BOC” 9iLV L8 OIG HEE EaC VC CV OMG = KOM Si8G SAIN oqisepuy — S6ll100c ANDA = C00C/7T WSZ

G GSI] Sell SG EUS v6 C6l OE SC SC OT GG UG = AS OS AIA oqisepuy — €6ITTO0C ANDA 7O00T/ET WSZ

G Gol Gl Sikes Sey 9'6 ysl O¢€ VT CAC Oh OG “WAI BO SiON oqisepuy — Toll to0c ANDA = CO00T/TT WSZ

EO EGIL IGE. — «GOs C6 Ool TE VC ST vv EG 61 Si ioc = oqisepuy = = 000C/P0E WSZ

Geile SEG Calica GY, £6 y8I O¢ CT GG 9'€ Oc 91 LOI $8 W eqisepuy tid = 6£9CS MINAZ

Go= (oy! SGl WG GO 6'8 GSile 9S WAG EC CV BG VEE ANNE. VGRYG> Al eqisepuy Id = 8£9CS MINAZ

G AgESil Git Gi6l - 997 C8 [eb 038 ‘BG Gil OT Ore= SE Ie SiO S89 IN oqisepuy = Id = LE9cS MINAZ

GC GSI SII 60¢ S$ 9PF S'8 GEA Ws VC EAC 6€ GG - “Vall AGiOM vases sIN oqisepuy = =§Id (€p9ES MINAZ) 6661/€9S WSZ

CVI VO WONG V8 06 Cb Gs fC VC 6€ OG. “OTS ll Vice IN eqisepuy LH = Cr9ES MINAZ

— 1aWYaog ‘@

THY WaIL TOA TLOA WH IVH THOA GNN GSN CNH da GL ‘TH MH TAS XS Ayyevoy adAy, Joquinu plot Joquiny|

‘dy ynous puokag (¢) ‘dy nous (p) ‘dy ynous pure [Lysou ussMjoq (¢) ‘[LNsoU (Z) “IauIOD aAa IOLIO}UR (][) SOyOvoI UONLNOTVAe [esIe}OIqy ‘Apoqg Suoye passoidpe st quitjpury uUsyA\

6 “SMOT[OJ SB PIPOd SI (ISUS] QUIT[PUTY OANLIOI) THY ‘opewoy “y ‘oyeur ‘py ‘odAyered ‘pg ‘adAyopoy ‘LH :suoneiaciqge [euonippy ‘spousal pue syeLiayepy dos suAuOIOe UOTJOATJOO pue

a s}UDWOINSRIW SIIWIOYdIoW Jo suUONeIADIgQge 10, ‘awuYyaoqgispnb ‘g pure iauyaog siydoog jo suawideads JayONOA pouturexd JO (WIL UT [[e) sJuoWIaIMsvoW oLNOWOYdIOPy *7 JIqUL

©ZFMK

Bonn zoological Bulletin 57 (2): 241—255

Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar 247

@ Boophis boehmei

O Boophis quasiboehmei

iS)

-2.0

=2:0 5) -2.0) =125:7=120) -0'5) 010) 1015) 120) AS) 2:0) (215) 13:6

PCA Factor 2

Fig. 3. Scatterplot of individual males of Boophis boehmei

(filled circles) and B. quasiboehmei (open circles) along the sec-

ond and third factor of a Principal Component Analysis (Vari-

max normalized rotation). The PCA was based on measurements

in Table 1. The specimen from Midongy was excluded from

analysis because the species identity of this population is not ful-

ly clarified.

al steps. Although the nuclear data set refers to only a lim-

ited number of specimens, the fact that there is no haplo-

type sharing between the two forms suggests that they rep-

resent independent evolutionary lineages.

Nevertheless, these pronounced genetic divergences were

contrasted by no or low divergences in adult morpholo-

gy and bioacoustics. The calls of the two forms were sim-

ilar, with no detectable differences (see call descriptions

below). In both forms, notes may be combined to short

regular series, and intervals between notes are otherwise

highly variable and mostly irregular. The temporal and

spectral parameters in calls of both forms are somewhat

variable among populations and individuals, but broadly

overlap at inter- and intra-populational level. Even the

pulse rate within notes, a character shown to be evolution-

ary highly dynamic among closely related species (e.g. Pa-

dial et al. 2008), is identical in both forms (see analysis

below). Inter-note intervals outside of regular note series

furthermore seem to depend on calling motivation of the

individual male.

A close examination of adult morphology yielded no dis-

crete characters that would allow a diagnosis between the

two forms. One subtle difference was detected in adult life

Fig. 4. Comparative photographs of oral discs of preserved tadpoles of Boophis quasiboehmei sp. n. (top, A-F) and Boophis boehmei

(bottom, G—I): (A) ZSM 442/2008, Imaloka; (B—C) ZSM 83—84/2008, Ambohitsara; (D) ZSM 509/2008, Ambatolahy; (E) ZSM

1682/2007, Sahalamaotra; (F) ZSM 443/2008, Imaloka; (G-I) ZSM 1738/2007, 1750/2007, 1779/2007, An’Ala. Note the short

third lower (= posterior) keratodont row of Boophis quasiboehmei sp. n. with only few (or even misssing [D]) keratodonts, and

the less reduced legth of this row in B. boehmei (indicated by white arrows). In the tadpoles of other species of the Boophis goudoti

group, the third lower keratodont row is more extended than in the two species shown (see Randrianiaina et al. 2009b).

Bonn zoological Bulletin 57 (2): 241-255

©ZFMK

248 Miguel Vences et al.

Table 3. Factor loadings, Eigenvalues and percent explained

variation from a Principal Component Analysis of morphome-

tric data in Table 2. Factor loadings >0.5 are shown in bold.

Factor 1 Factor 2 Factor3 Factor 4

SVL 0.535637 0.024396 0.278024 0.432915

HW 0.401178 -0.052815 0.722325 0.434988

HL 0.283729 = -0.059521 0.901536 -0.000783

TD -0.451112 0.171742 0.508941 0.315946

ED 0.042109 0.184460 0.248786 0.727413

END 0.263940 0.645782 0.593063 0.078554

NSD -0.058373 0.886713 -0.111786 0.323847

NND 0.169004 0.159007 -0.021443 0.796064

FORL 0.776970 = -0.189957 0.113991 0.209375

HAL 0.936216 0.015471 0.113066 -0.107870

HIL 0.852890 = -0.051712 0.150553 0.154111

FOTL 0.932469 0.147455 0.044485 0.068645

FOL 0.784388 0.333820 0.095038 0.209488

TIBL 0.743402 0.023610 0.266693 0.084073

Eigenvalue 5.977193 2.369640 1.412833 0.905600

% Variance 42.69424 16.92600 10.09166 6.46857

colouration. All specimens of B. boehmei had a bright red

outer iris area and a brownish inner iris area, whereas B.

sp. 16 had no such bright red colour but orange, either as

a more or less uniformly orange iris or as an orange out-

er iris area.

In a search for a possible morphometric differentiation,

we carried out a Principal Component Analysis on the ba-

sis of measurements in Table 2 (males only). The analy-

sis resulted in three factors with Eigenvalues greater than

1 (Table 3) which together explained 70% of the total vari-

ation. Because size of specimens was similar, the first fac-

tor was not representative mainly of body size, but of rel-

ative limb length; the highest factor loadings were for vari-

ables associated with limb length (Table 3). Factors 2 and

3 were associated with the shape of the head: Factor 2 with

END and NSD, and Factor 3 with mainly HW and HL.

While Factor | resulted only marginally in a trend of sep-

aration of the two species (not shown), Factors 2 and es-

pecially 3 separated most specimens of B. boehmei vs. B.

sp. 16 (Fig. 3). However, univariate analyses on the ba-

sis of the variables with highest factor loadings did not

result in a convincing separation (not shown), indicating

that morphometric data cannot serve as diagnostic char-

acters to separate these two forms.

Bonn zoological Bulletin 57 (2): 241—255

The most convincing diagnostic character comes from tad-

pole morphology and has been described in detail by Ran-

drianiaina et al. (2009a, b): all tadpoles of Boophis sp. 16

(from Ranomafana and Ambohitsara; N = 75) examined

had a short (or completely absent) third posterior row of

labial keratodonts (P3), whereas in B. boehmei (from lo-

calities Andasibe and An’ Ala) this row was slightly short-

er than in other species of the B. goudoti group, but still

much longer than in B. sp. 16, with no overlap in num-

bers of labial keratodonts in P3 and almost no overlap in

relative length of P3 (Fig. 4).

Given this constant difference in tadpole morphology

which fully correlates with high mitochondrial divergences

(among the highest observed between closely related man-

tellid frog species), and with fully separated haplotypes

in two nuclear genes, we conclude that B. boehmei and

B. sp. 16 constitute two separate and independent evolu-

tionary lineages. Therefore, they should best be consid-

ered as distinct species, although cryptic in adult morphol-

ogy and advertisement calls. In the following we thus de-

scribe B. sp. 16 as a new species.

Boophis quasiboehmei sp. n.

(Figs 5—6)

Holotype. ZSM 227/2006 (field number ZCMV 3045),

adult male (Fig. 5), collected at Ambatovory, at the edge

of Ranomafana National Park, south-eastern Madagascar,

21°14,279’ S, 47°25,487’ E, 966 m a.s.l., on 26 February

2006 by M. Vences, Y. Chiari, T. Rajoafiarison, E. Raje-

riarison, P. Bora and T. Razafindrabe.

Paratypes. ZFMK 59881-59882, two adult males, col-

lected in the Ranomafana region, south-eastern Madagas-

car, in December 1994 by M. Burger; ZSM 715/2003

(FG/MV 2002-0363), one adult male, collected at Vo-

hiparara (close to the Kidonavo bridge), Ranomafana Na-

tional Park, 21°13’ S, 47°22’ E, ca. 1000 m a.s.1., on 20

January 2003, by F. Glaw, M. Puente, L. Raharivololoni-

aina, M. Thomas and D. R. Vieites; ZSM 228/2006

(ZCMV 3051), ZSM 229/2006 (ZCMV 3069), and ZSM

230/2006 (ZCMV 3070), three adult males, from same lo-

cality and with same collectors and collection date; ZSM

224/2006 (ZCMV 2988), male, collected at Sahamalao-

tra, Ranomafana National Park, south-eastern Madagas-

car, 21°14.113’ S, 47°23.767’ E, south-eastern Madagas-

car, on 25 February 2006 by M. Vences, Y. Chiari, T. Ra-

joafiarison, E. Rajeriarison, P. Bora and T. Razafindrabe;

ZSM 226/2006 (ZCMV 2951), male, collected at Imalo-

ka, Ranomafana National Park, south-eastern Madagas-

car, 21°14,527’ S, 47°27,909’ E; 1020 m a.s.1., on 23 Feb-

ruary 2006 by Y. Chiari, P. Bora, T. Rajoafiarison, E. Ra-

jeriarison, and T. Razafindrabe; ZSM 231/2006 (ZCMV

OZFMK

Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar 249

Fig. 5. Dorsolateral (A) and ventral (B) views of the male holotype of Boophis quasiboehmei sp. n. (ZSM 227/2006) in life.

3360), male, collected at Ranomena, 21°12,736’ S,

47°26,010’ E, Ranomafana National Park, south-eastern

Madagascar, on 28 February 2006, M. Vences, Y. Chiari,

T. Rajoafiarison, and E. Rajeriarison; ZSM 232/2006

(ZCMV 3374) from the Ranomafana region, perhaps col-

lected at Ranomafanakely river but without precise col-

lecting data; ZSM 2322/2007 (ZCMV 5948), male, col-

lected at Sahamalaotra, Ranomafana National Park,

south-eastern Madagascar, 21°14.113’S, 47°23.767’ E, on

5 March 2007 by M. Vences, A. StrauB, R. D. Randriani-

aina, and K. C. Wollenberg.

Bonn zoological Bulletin 57 (2): 241-255

Diagnosis. Assigned to the genus Boophis based on the

presence of an intercalary element between ultimate and

penultimate phalanges of fingers and toes (verified by ex-

ternal examination), presence of nuptial pads and absence

of femoral glands in males, and overall similarity to oth-

er Boophis species. Assigned to the Boophis goudoti group

because of its brownish ground colour, presence of der-

mal flaps or tubercles on heels and elbows, presence of

white tubercles ventrally of the cloacal opening, presence

of a sharp canthus rostralis, absence of red skin colour,

and molecular phylogenetic relationships.

©ZFMK

250 Miguel Vences et al.

Fig. 6. Specimens of Boophis quasiboehmei sp. n. in life: (A) frontal and (B) ventral views of a male from Ambohitsara (field

number ZCMV 5867); (C) dorsolateral and (D) ventral views of a male from Andohahela (deposited in UADBA); (E) male from

Ranomafana (deposited in UADBA); (F) male paratype ZFMK 59882 from Ranomafana (photo by M. Burger).

Together with B. boehmei, the smallest species in the

Boophis goudoti group characterized by a deviant oral

morphology of the tadpole which is unknown from any

other Boophis species. Boophis quasiboehmei sp. n. dif-

fers from all described species in the B. goudoti group by

substantial genetic differentiation (> 6% pairwise diver-

gence in a fragment of the 16S rRNA gene) and further-

Bonn zoological Bulletin 57 (2): 241—255

more from B. goudoti, B. obscurus, B. periegetes, B.

madagascariensis, B. roseipalmatus, B. brachychir, B.

entingae, B. rufioculis, B. burgeri, B. reticulatus, B. ax-

elmeyeri, and B. spinophis by smaller size (SVL of adult

males 28-31 mm versus 31—82 mm) and bioacoustic dif-

ferentiation (see Vences et al. 2006 for details). B. quasi-

boehmei sp. n. is most similar to B. boehmei and differs

©ZFMK

Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar 251

Fig. 7. Male specimens of Boophis boehmei from Andasibe in

life: (A) paratype ZSM 563/1999 (originally ZFMK 53643); (B)

paratype ZFMK 52637.

from this species by an orange (versus red) outer iris ring,

by a very short third posterior keratodont row in the tad-

pole, consisting of only 0-15 keratodonts (versus 23-63

keratodonts in B. boehmei, see Randrianiaina et al. 2009b),

and substantial genetic differentiation.

Description of holotype. Adult male in excellent state of

preservation, muscles of right thigh removed as DNA tis-

sue sample. SVL 26.7 mm. Body moderately slender; head

slightly longer than wide, wider than body; snout point-

ed in dorsal view, obtuse to acuminate in lateral view; nos-

trils directed laterally, eqidistant to eye and to tip of snout;

canthus rostralis sharp, straight in dorsal view from eye

to nostril, slightly curved from nostril to tip of snout; lo-

real region slightly concave; eye large; tympanum distinct,

rounded, TD 54% of ED; supratympanic fold narrow,

prominent; vomerine odontophores distinct, well separat-

ed in two slightly elongated patches, positioned median

between choanae; choanae medium-sized, rounded.

Tongue distinctly bifid and free posteriorly. Arms mod-

erately slender; a small pointed dermal appendage on el-

Bonn zoological Bulletin 57 (2): 241-255

bow; subarticular tubercles single, round; inner palmar tu-

bercle poorly recognizable; fingers poorly webbed and

without lateral dermal fringes; webbing formula 1(—),

21(—), 2e(1), 3111.5), 3e(1.5), 4(1); relative length of fin-

gers 1<2<4<3 (finger 2 distinctly shorter than finger 4);

finger discs enlarged. Hind limbs slender; a pointed der-

mal appendage on heel; tibiotarsal articulation reaching

widely beyond snout tip when hind limb is adpressed

along body; lateral metatarsalia separated by webbing; in-

ner metatarsal tubercle medium-sized, distinct, elongat-

ed; no outer metatarsal tubercle; toes moderately webbed;

webbing formula 1(0), 2i(1), 2e(0), 31(1), 3e(0), 41(2),

4e(2), 5(0.75); relative length of toes 1<2<3=5<4; toe

discs enlarged. Skin smooth on dorsal surfaces, smooth

on throat and chest, coarsely granular on belly, rather

smooth on ventral surface of thighs, prominent scattered

tubercles around cloaca. A worm-like parasite (possibly

a nematode) apparently tried to escape when the frog was

preserved and sticks in the left nostril.

Measurements (in mm): SVL 26.7, HW 10.6, HL 11.2, ED

SH/REND 23. NSD23.NND)3:3, 0D) 2.0, Th 15.2, HAL

9.1, FOL 11.1, FOTL 20.8.

After almost four years in preservative, ground colour of

upper surface of head, dorsum and limbs greyish brown,

with few irregularly scattered and indistinct darker mark-

ings; supratympanic fold and tympanic region not distinct-

ly coloured; upper lip creamy white; dorsal surfaces of

thigh, shank, tarsus and external toe, as well as lower arm,

hand and external finger with distinct dark brown cross-

bands; flanks brown with small pale white spots and dots,

forming a reticulated pattern; several whitish dots below

the cloaca, but no additional single white tubercles in the

cloacal region; posterior surfaces of thighs greyish pale

brown with beige reticulation on the proximal part, light

brown without reticulations in the distal part; ventral sur-

face creamy beige, with some pale greyish mottling along

the lower jaw, the lower arms, hands and feet.

In life, ground colour of upper surface of head, dorsum

and legs light brown (slightly darker on the head), with

few irregularly scattered yellowish spots on the back and

scattered dark dots on back and more densely on the lat-

eral parts of the head; flanks with reticulated pattern of

brown, yellow and white; upper surfaces of hands and feet

mottled with brown and yellowish; outer edge of tarsus

with thin white line and white tarsal tubercle, outer edge

of lower arm with white tubercle; two irregular rows of

white tubercles on shank; dorsal surfaces of limbs with

moderately distinct brown crossbands; posterior surfaces

of thighs white, numerous white tubercles around the cloa-

ca and uniformly brown posteriorly. Throat, chest and ven-

ter creamy white; two irregular bluish spots on throat. Ven-

tral surfaces of limbs only partially with whitish pigment,

©ZFMK

252 Miguel Vences et al.

largest parts of thighs, shanks, hands and feet without

white pigment. Outer iris almost uniformly bright orange,

broadened above; inner iris ring brownish with some ves-

sel-like brown reticulation; iris surrounded by a black ring;

posterior iris periphery blue.

Variation. All paratypes were similar to the holotype in

general morphology. For measurements, see Table 2. Male

SVL ranged from 26.7—29.3 in the Ranomafana region,

and was 30.8 mm in one specimen from Midongy. No fe-

males are known. Colouration was relatively constant in

various localities of Ranomafana National Park, and in

Ambohitsara (Fig. 6). The rather uniform orange eye

colouration in life was typical for most specimens although

at Andohahela (Fig. 6C) specimens tentatively assigned

to this species had a more reddish eye colour.

Distribution. Besides different sites in (1) the Ra-

nomafana region, the species is also known from (2) Tsi-

tolaka forest near Ambohitsara, about 30 km from Ra-

nomafana, and was tentatively identified from (3) Befo-

taka-Midongy Reserve (specimen ZSM 178/2006), and

from (4) Andohahela National Park (Col Tanatana,

24°44’ S, 46°50’ E, 750 m a.s.l.). in the extreme south-

east of Madagascar (GenBank accession number

AY848529; specimen FGZC 236, deposited in UADBA).

Natural history. At Ranomafana National Park, Boophis

quasiboehmei sp. n. was one of the most common species

of frogs and its larvae occurred in 29 out of 30 streams

surveyed for tadpoles (Randrianiaina et al. 2009b; StrauB

et al. 2010). Adult specimens, however, were less com-

monly found, and in some areas occurred only in some

densely clustered demes along small stretches of the

streams. Males were observed calling at night from perch

heights of 2-3 m from bushes and trees close to streams

in primary as well as degraded rainforest.

Vocalization. Generally, calls of Boophis quasiboehmei

sp. n. exhibit a characteristic structure, consisting of short

to moderately long pulsatile notes. However, the pattern

of emission of these notes is highly variable and mostly

irregular. Sometimes, notes are combined to regular se-

ries (2—6 notes), with the initial note being longer than sub-

sequent secondary notes. The calls emitted by the holo-

type (Fig. 8) and recorded on 26 February 2006 at Am-

batovory have the main frequency distributed between

2100 and 3400 Hz, with additional frequency bands of

lower amplitude at 5500-6000 Hz and 8100-8900 Hz. Nu-

merical parameters for the holotype calls are as follows

(range followed by mean + standard deviation): duration

of note series, 335-736 ms (519 + 203; n = 3); number

of notes per series, 3-6 (4.3 + 1.5; n = 3); note duration

(including initial notes within series), 66-79 ms (72.1 +

4.6; n = 8), duration of secondary notes within series,

Bonn zoological Bulletin 57 (2): 241-255

Frequency (kHz)

Relative

amplitude ©

0 250 500 750

1000

Relative

amplitude

0 25 50 75 100

Time (ms)

Fig. 8. Spectrogram, corresponding waveform, and expanded

waveform (bottom) of the initial note of a regular note series

emitted by the holotype of Boophis quasiboehmei sp. n. Record-

ing obtained on 26 February 2006 at Ambatovory, Ranomafana

National Park.

20-34 ms (24.9 + 4.6; n = 8); pulses/note, 5-19 (12.6 +

6.2; n= 15); inter-note intervals, 97-125 ms (109.9 + 7.5;

n= 10); dominant frequency, 2680-2963 Hz (2807 + 86;

n= 10).

A short sequence with three notes recorded on 1 March

1996 at Ranomafana (Vences et al. 2006, CD 1, track 66)

has the following parameters: duration of note series, 373

ms, notes/series, 3; note duration, 18—58 ms; pulses/note,

5—12; inter-note intervals, 139-142 ms; dominant frequen-

cy, 2550-2637 Hz.

Calls of B. quasiboehmei sp. n. from Ambohitsara

recorded on 3 March 2007 generally agree in structure

with those emitted by the holotype, although they have

shorter note duration and more variable, distinctly longer

inter-note intervals. Numerical parameters are as follows:

duration of note series, 527 ms (n = 1); number of notes

per series, 6 (n= 1); note duration (including initial notes

within series), 22-47 ms (35.2 + 7.3; n= 13); pulses/note,

4—12 (7.9 +2.5; n= 18); inter-note intervals, 475—942 ms

(724.4 + 138.8; n= 16); dominant frequency, 2293-2572

Hz (2465 x 90; n= 9).

Comparative call data. The morphologically most sim-

ilar species, Boophis boehmei, has an almost identical call

compared to that of B. quasiboehmei sp. n. A re-analysis

of calls of B. boehmei from Andasibe (type locality)

recorded on 12 January 1992 at 23°C (Fig. 9) revealed the

following parameters: duration of note series, 455—530 ms

©OZFMK

Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar 253

Relative

amplitude ©

0 250 500 750 1000

Relative

amplitude

0 25 50 75 100

Time (ms)

Fig. 9. Spectrogram, corresponding waveform, and expanded

waveform (bottom) of the initial note of a regular note series

emitted by Boophis boehmei. Recording obtained on 12 Janu-

ary 1992 at Andasibe (air temperature 23°C).

(n = 2); number of notes per series, 3—4 (n = 2); note du-

ration, 27-106 ms (62.6 + 23.0; n = 11); pulses/note,

10—24 (15.7 + 4.8; n= 9); inter-note intervals, 93-157 ms

(125.0 + 29.6; n =5); dominant frequency, 2640-3177 Hz

(2835 + 165.6; n= 8).

A second recording from the type locality of B. boehmei

recorded on 7 December 2001 at 24.8°C (Vences et al.

2006, CD 1, track 64) differs from the one described above

by longer inter-note intervals. Numerical parameters are

as follows: note duration, 34-98 ms (62.7 + 19.7; n= 18);

pulses/note, 13—23 (16.7 + 3.6; n = 11); inter-note inter-

vals, 591-1070 ms (766.1 + 210.0; n =7); dominant fre-

quency, 2360-2980 Hz (2760 + 198; n = 12). In this

recording, a single regular series composed of 6 notes 1s

present, exhibiting note durations of 3444 ms and inter-

note intervals within the series of 61—85 ms.

A call recording of B. boehmei from Ankeniheny record-

ed on 20 March 1994 at 22°C air temperature showed note

duration of 16—61 ms, inter-note intervals of 162—164 ms

and a dominant frequency of 2500-2800 Hz.

In conclusion, there are no temporal or spectral call char-

acters that distinguish B. boehmei from B. quasiboehmei

sp. n. (see above).

Etymology. The specific epithet is a combination of the

Latin word ‘quasi’, meaning ‘almost’, and a patronym for

Wolfgang Bohme (ZFMK). It refers to the impressively

Bonn zoological Builetin 57 (2): 241-255

cryptic morphological and bioacoustic similarity of the

new species to Boophis boehmei.

DISCUSSION

The initial detection of a probable species status of

Boophis quasiboehmei sp. n. was based on its large diver-

gence in a single marker of mitochondrial DNA. Due to

the extent of this divergence (>6% to all described

species), Vieites et al. (2009) deviated slightly from their

usual rationale and listed this species as confirmed can-

didate species, despite the lack of concordant indications

by independent taxonomic characters. Although the work

protocol of integrative taxonomy proposed by Padial et

al. (2010) would allow for the description of species based

on single characters if these are deemed to be sufficient-

ly indicative of the existence of independent evolution-

ary lineages, we do not recommend this procedure. In-

stead, we only decided to formally describe B. quasi-

boehmei sp. n. as new species once that independent and

congruent evidence of various taxonomic characters had

accumulated, even if those were subtle at first view: (1)

a weak and not fully constant difference in adult eye

colouration, (2) a slight tendency of morphometric differ-

entiation detectable only by multivariate techniques, (3)

a constant difference in tadpole morphology, and (4) con-

cordance between three independent molecular markers

(two nuclear and one mitochondrial). The molecular con-

cordance alone would be sufficient for species recogni-

tion under the genealogical concordance method of phy-

logenetic species recognition, GCPSR (Avise & Ball

1990), but the further strict concordance with one mor-

phological character (tadpole labial keratodonts) provides

amore convincing evidence, especially because it is based

on large series of individuals (Randrianiaina et al. 2009a,

b). We are therefore convinced that Boophis quasiboehmei

sp. n. and B. boehmei are to be considered as distinct

species under an evolutionary or general lineage species

concept (de Queiroz 2007).

Among the various mechanisms of species diversification

discussed for Madagascar (Vences et al. 2009), two (the

watershed and the river barrier mechanism) might apply

to the species pair B. boehmei and B. quasiboehmei sp. n.

that occur in two different neighbouring centres of en-

demism (CE2 and CE3) as defined by Wilmé et al. (2006),

and because these two CEs are divided by the Mangoro

river that has been invoked as an important river barrier

in eastern Madagascar (see Vences et al. 2009). Discern-

ing between these hypotheses is difficult, but both are con-

tradicted by the fact that B. quasiboehmei sp. n. also oc-

curs in Andohahela, which is in a different CE (CE5) and

separated by a further large river barrier (the Mananara

river). Also, the fact that numerous other red-eyed

©ZFMK

treefrog species and candidate species have been already

identified from eastern Madagascar (see Vieites et all.

2009: B. axelmeyeri, B. rufioculis, B. sp. 8, B. sp. 40, B.

sp. 41), several of which appear to be microendemic to

small areas while others might be more widespread, in-

dicates a more complex situation. Only a more compre-

hensive study of this group, with assessments of the sta-

tus of all candidate species and their phylogenetic rela-

tionships, and a more detailed analysis of their distribu-

tion, will significantly contribute to the understanding of

the diversification mechanisms that may have lead to this

surprising morphological cryptic diversity. However, the

fact that the phylogenetic position of B. boehmei and B.

quasiboehmei 1s unclarified should not be interpreted as

casting doubts on the species status of B. quasiboehmei

since this new species 1s differentiated from topotypical

B. boehmei by a high genetic differentiation and tadpole

mouthparts, and from all other nominal species in the B.

goudoti group by a high genetic differentiation, tadpole

mouthparts, adult morphology, and advertisement calls.

However, clarifying the phylogenetic relationships of all

species and candidate species will be important to under-

stand the status of the various UCS and CCS in the group

and to be able to provide formal descriptions of those for

which the data will confirm the status as distinct species.

Additional data still missing at this time are on tadpole

morphology of the populations from Andohahela, M1-

dongy, Sahafina and Mahasoa that herein we have as-

signed in a preliminary way to B. quasiboehmei (Ando-

hahela, Midongy) or different candidate species (Sahafi-

na, Mahasoa).

At Ranomafana National Park, Boophis quasiboehmei sp.

n. was commonly encountered at least in its tadpole stage,

and its occurrence was confirmed at Andohahela Nation-

al Park and tentatively in Befotaka-Midongy National

Park. Although we never observed the species in second-

ary vegetation formations, it appears to be tolerant to some

degree of rainforest degradation. The relatively large dis-

tribution area (from Ranomafana to Andohahela), its oc-

currence in at least two protected areas and large area of

occupancy at least in the Ranomafana area lead us to pro-

pose an IUCN red list status of Least Concern for this new-

ly described species (compare Andreone et al. 2005, 2008).

Acknowledgements. For assistance in the field we are indebt-

ed to Ylenia Chiari, Parfait Bora, Emile Rajeriarison, Theo Ra-

joafiarison, Tokihery Razafindrabe, Axel StrauB, and Katharina

C. Wollenberg. Marius Burger provided a photo and collected

specimens of the new species. Roger-Daniel Randrianiaina kind-

ly contributed the tadpole photographs. Meike Kondermann and

Gabriele Keunecke helped with lab work. This study was made

possible by collaboration agreements of the author’s institutions

with the Université d’ Antananarivo Département de Biologie An-

imale (UADBA) and the Association Nationale pour la Gestion

des Aires Protegées. We are grateful to the staff of UADBA for

Bonn zoological Bulletin 57 (2): 241-255

254 Miguel Vences et al.

their continuous support, and to the Malagasy authorities for re-

search and export permits. This research was supported by grants

of the Volkswagen Foundation to MV and FG, and of the

Deutsche Forschungsgemeinschaft to MV (grant number

VE247/2-1).

REFERENCES

Andreone F (1993) Two new treefrogs of the genus Boophis

(Anura: Rhacophoridae) from central-eastern Madagascar.

Bollettino del Museo Regionale di Scienze Naturali di Tori-

no 11: 289-313

Andreone F (1996) Another new green treefrog, Boophis anjana-

haribeensis n. sp. (Ranidae: Rhacophorinae), from northeast-

ern Madagascar. Aqua 2: 25—32

Andreone F, Cadle JE, Cox N, Glaw F, Nussbaum RA, Raxwor-

thy CJ, Stuart SN, Vallan D, Vences M (2005) Species review

of amphibian extinction risks in Madagascar: conclusions from

the Global Amphibian Assessment. Conservation Biology 19:

1790-1802

Andreone F, Cox N, Glaw F, Kohler J, Rabibisoa NHC, Ran-

driamahazo H, Randrianasolo H, Raxworthy CJ, Stuart SN,

Vallan D, Vences M. (2008) Update of the Global Amphib-

ian Assessment for Madagascar in light of new species dis-

coveries, nomenclature changes, and new field information.

Monografie del Museo Regionale di Scienze Naturali di Tori-

no 45: 419-438

Andreone F, Nincheri R, Piazza R (1995) Un nouveau Boophis

vert (Ranidae: Rhacophorinae) des foréts pluviales du Sud de

Madagascar. Revue francaise de Aquariologie et Herpetolo-

gie 21: 121-127

Avise JC, Ball RM (1990) Principles of genealogical concor-

dance in species concepts and biological taxonomy. In Sur-

veys in Evolutionary Biology (Futuyma D and Antonovics J,

eds.), Vol. 7, pp. 45-67, Oxford University Press

Blommers-Schlésser RMA (1979) Biosystematics of the Mala-

gasy frogs. H. The genus Boophis (Rhacophoridae). Bijdra-

gen tot de Dierkunde 49: 261-312

Bruford MW, Hanotte O, Brookfield JFY, Burke T (1992) Sin-

gle-locus and multilocus DNA fingerprint. In: Hoelzel, A.R.

(Ed.), Molecular Genetic Analysis of Populations: A Practi-

cal Approach. IRL Press, Oxford, pp. 225-270

Cadle J (1995) A new species of Boophis (Anura: Rhacophori-

dae) with unusual skin glands from Madagascar, and a dis-

cussion of variation and sexual dimorphism in Boophis albi-

labris (Boulenger). Zoological Journal of the Linnean Soci-

ety 115: 313-345

Chiari Y, Vences M, Vieites DR, Rabemananjara F, Bora P,

Ramilijaona Ravoahangimalala O, Meyer A (2004) New ev-

idence for parallel evolution of colour patterns in Malagasy

poison frogs (Mantella). Molecular Ecology 13: 3763-3774.

Clement M, Posada D, Crandall KA (2000) TCS: a computer

program to estimate gene genealogies. Molecular Ecology 9:

1657-1659

de Queiroz K (2007) Species concepts and species delimitation.

Systematic Biology 56: 879-886

Gehring PS, Ratsoavina FM, Vences M (2010) Filling the gaps

— Amphibian and reptile records from lowland rainforests in

eastern Madagascar. Salamandra, In press

Glaw, F, Kohler J, De la Riva I, Vieites DR, Vences M (2010)

Integrative taxonomy of Malagasy treefrogs: combination of

molecular genetics, bioacoustics and comparative morpholo-

gy reveals twelve additional species of Boophis. Zootaxa 2383:

1-82

©ZFMK

Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar 255

Glaw F, Thiesmeier B (1993) Bioakustische Differenzierung in

der Boophis luteus-Gruppe (Anura: Rhacophoridae), mit

Beschreibung einer neuen Art und einer neuen Unterart. Sala-

mandra 28: 258-269

Glaw F, Vences M (1992) A Fieldguide to the Amphibians and

Reptiles of Madagascar. — KéIn, Vences & Glaw, 331 pp.

Glaw F, Vences M (1994) A fieldguide to the amphibians and

reptiles of Madagascar. 2nd edition. Cologne, Vences & Glaw

Verlag, 480 pp.

Glaw F, Vences M (1997a) Anuran eye colouration: definitions,

variation, taxonomic implications and possible functions, pp.

125-138. In: Béhme W, Bischoff W, Ziegler T (eds.) Herpe-

tologia Bonnensis. SEH Proceedings, Bonn

Glaw F, Vences M (1997b) Neue Ergebnisse zur Boophis gou-

doti-Gruppe aus Madagaskar: Bioakustik, Fortpflanzungsstra-

tegien und Beschreibung von Boophis rufioculis sp. nov. Sa-

lamandra 32: 225-242

Glaw F, Vences M (2002) A new cryptic treefrog species of the

Boophis luteus group from Madagascar: bioacoustic and ge-

netic evidence (Amphibia, Anura, Mantellidae). Spixiana 25:

173-181

Glaw F, Vences M (2006) Phylogeny and genus-level classifi-

cation of mantellid frogs. Organisms Diversity & Evolution

6: 236-253

Glaw F, Vences M (2007) A Field Guide to the Amphibians and

Reptiles of Madagascar. Third edition. Cologne, Vences &

Glaw Verlag, 496 pp.

Glaw F, Vences M, Andreone F, Vallan D (2001) Revision of the

Boophis majori group (Amphibia: Mantellidae) from Mada-

gascar, with descriptions of five new species. Zoological Jour-

nal of the Linnean Society 133: 495-529

Kohler J (2000) Amphibian diversity in Bolivia: a study with

special reference to montane forest regions. Bonner zoologis-

che Monographien 48: 1—243

Kohler J, Glaw F, Vences M (2007) A new green treefrog, genus

Boophis Tschudi 1838 (Anura Mantellidae), from arid west-

ern Madagascar: phylogenetic relationships and biogeograph-

ic implications. Tropical Zoology 20: 215-227

Kohler J, Glaw F, Vences M (2008) Two additional treefrogs of

the Boophis ulftunni species group (Anura: Mantellidae) dis-

covered in rainforests of northern and south-eastern Madagas-

car. Zootaxa 1814: 37-48

Librado P, Rozas J (2009) DnaSP v5: A software for compre-

hensive analysis of DNA polymorphism data. Bioinformatics

25: 1451-1452

Nylander JAA (2002) MrModeltest v1.0b. Program distributed

by the author. Available from: <http://www.ebc.uu.se/

systzoo/staff/nylander.html>

Padial JM, Kohler J, Munoz A, De la Riva I (2008) Assessing

the taxonomic status of tropical frogs through bioacoustics:

geographical variation in the advertisement calls in the

Eleutherodactylus discoidalis species group (Anura). Zoolog-

ical Journal of the Linnean Society 152: 353-365

Padial JM, Miralles A, De la Riva I, Vences M (2010) The in-

tegrative future of taxonomy. Frontiers in Zoology 7: art. 16

Randrianiaina RD, Raharivololoniaina L, Preuss C, Straus A,

Glaw F, Teschke M, Glos J, Raminosoa N, Vences M (2009a)

Descriptions of the tadpoles of seven species of Malagasy

treefrogs, genus Boophis. Zootaxa 2021: 23-41

Randrianiaina RD, Navarro Antunez R, Canitz J, Forth F, Lemme

I, Rodriguez B, Rinas H, Thanert R, Troger P, Westphal N,

Willim A, Wollenberg KC, Straul} A, Vences M (2009b) Vogue

or adaptive character? A tadpole’s goatee helps to distinguish

two cryptic treefrog species of the genus Boophis. Herpetol-

ogy Notes 2: 165-173

Bonn zoological Bulletin 57 (2): 241-255

Raharivololoniaina L, Grosjean S, Rasoamampionona

Raminosoa N, Glaw F, Vences M (2006) Molecular identifi-

cation, description and phylogenetic implications of the tad-

poles of 11 species of Malagasy treefrogs, genus Boophis.

Journal of Natural History 40: 1449-1480

Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phy-

logenetic inference under mixed models. Bioinformatics 19:

1572-1574

Stephens M, Smith NJ, Donnelly P (2001) A new statistical

method for haplotype reconstruction from population data.

American Journal of Human Genetics 68: 978-989

StrauR® A, Reeve E, Randrianiaina R, Vences M, Glos J (2010)

The world’s richest tadpole communities show functional re-

dundancy and low functional diversity: ecological data on

Madagascar’s stream-dwelling amphibian larvae. BMC Ecol-

ogy 10: article 12

Templeton AR, Crandall KA, Sing CF (1992) A cladistic analy-

sis of phenotypic associations with haplotypes inferred from

restriction endonuclease mapping and DNA sequence data. IT.

Cladogram estimation. Genetics 132: 619-633

Vallan D, Vences M, Glaw F (2003) Two new species of the

Boophis mandraka complex (Anura, Mantellidae) from the

Andasibe region in eastern Madagascar. Amphibia-Reptilia 24:

305-319

Vallan D, Vences M, Glaw F (2010) Forceps delivery of a new

treefrog species of the genus Boophis from eastern madagas-

car (Amphibia: Mantellidae). Amphibia-Reptilia 31: 1-8

Vences M, Andreone F, Glos J, Glaw F (2010) Molecular and

bioacoustic differentiation of Boophis occidentalis with de-

scription of a new treefrog from north-western Madagascar.

Zootaxa 2544: 54-68

Vences M, Chiari Y, Teschke M, Randrianiaina RD, Raharivo-

loloniaina L, Bora P, Vieites DR, Glaw F (2008) Which frogs

are out there? A preliminary evaluation of survey techniques

and identification reliability of Malagasy amphibians. Mono-

grafie d. Mus. Regio. di Scienze Natur. di Torino 45: 233-253

Vences M, Glaw F (2002) Two new treefrogs of the Boophis rap-

piodes group from eastern Madagascar. Tropical Zoology 15:

141-163

Vences M, Glaw F (2005) A new cryptic frog of the genus

Boophis from the northwestern rainforests of Madagascar.

African Journal of Herpetology 54: 77—84

Vences M, Glaw F, Marquez R (2006) The Calls of the Frogs

of Madagascar. 3 Audio CDs and booklet, 44 pp. Alosa-Fono-

zoo, Barcelona

Vences M, Wollenberg KC, Vieites DR, Lees DC (2009) Mada-

gascar as a model region of species diversification. Trends in

Ecology and Evolution 24: 456-465

Vieites DR, Min MS, Wake DB (2007) Rapid diversification and

dispersal during periods of global warming by plethodontid

salamanders. Proceedings of the National Academy of Sci-

ences of the U.S.A. 104: 19903-19907

Vieites DR, Wollenberg KC, Andreone F, Kohler J, Glaw F,

Vences M (2009) Vast underestimation of Madagascar’s bio-

diversity evidenced by an integrative amphibian inventory.

Proceedings of the National Academy of Sciences of the

U.S.A. 106: 8267-8272

Wilmeé L, Goodman SM, Ganzhorn JU (2006) Biogeographic

evolution of Madagascar’s microendemic biota. Science 312:

1063-1065

Wollenberg KC, Andreone F, Glaw F, Vences M (2008) Pretty

in pink: a new treefrog species of the genus Boophis from

north-eastern Madagascar. Zootaxa 1684: 58-68

Received: 30.VI.2010

Accepted: 10.1X.2010

©ZFMK

(oy an 08 4 SA Sh anh

' ‘ cre : a8, Th

| wei » < i Aimar Ndi eek. «thal Me onal

: oy any i va “Hs y

: j vee 6 M01) 04 epee

4 opty ae

igiy (boy) ae :

' ;

ry a mT an.

Aa A diy m4

i | i & j

;

| | i : : ’ e ’

| | a) cg

| | / i) ;

1 | j

7 ;

‘

= cane

| i aA

fo hoy b

Bie ois

t a j

7 ' 4

inal

| {

| LS

Ue Wvpatllh Seige :

;

aay ‘i i

{) i r

Bonn zoological Bulletin Volume 57 Issue 2 | pp. 257-266 Bonn, November 2010

A new species of Pachydactylus (Squamata: Gekkonidae)

from the Otavi Highlands of northern Namibia

Aaron M. Bauer

Department of Biology, Villanova University, 800 Lancaster Avenue, Villanova, Pennsylvania 19085, USA;

E-mail: aaron.bauer@villanova.edu

Abstract. A new species of the “northwestern clade” of Pachydactylus 1s described from the Otavi Highlands of north-

eastern Namibia. It is distinguishable from all other members of this clade and from the superficially similar members

of the Pachydactylus serval/weberi group on the basis of its inclusion of the rostral in the nostril rim, the possession of

a maximum of only four undivided scansors beneath the digits of the pes, is 16 rows of strongly keeled, rounded, juxta-

posed dorsal trunk tubercles, its projecting, keeled, lanceolate caudal tubercles, and its complex dorsal trunk patterning.

Its probable closest relative is P. otaviensis, also form the Otavi Highlands. These are the only known endemic reptiles

from this dolomitic area and their existence points both to an unappreciated area of diversity and endemism in northeast-

ern Namibia and to the need for additional herpetological work in even well-known parts of the country.

Key words. Gekkonidae, Pachydactylus, Namibia, new species.

INTRODUCTION

Pachydactylus Wiegmann, 1834 is the most species-rich

genus of geckos in southern Africa, with more than 50

species currently recognized (Bauer & Lamb 2005; Bauer

et al. 2006a, 2006b; Branch et al. 2010). Although all parts

of the subcontinent are inhabited by members of this

group, the arid zones of Namibia the adjacent portions of

the Northern Cape Province of South Africa have the high-

est diversity. A minimum of 35 species of Pachydactylus

occur in the Republic of Namibia alone, the majority of

which are endemic (Branch 1998; Bauer et al. 2002,

2006a; Branch et al. 2010). Most of these fall into one of

two species-rich clades that have been previously identi-

fied: the Pachydactylus serval/weberi group and the

“northwestern clade” of Pachydactylus (sensu Bauer &

Lamb 2005). Most species in both clades are relatively

small-bodied, rupicolous species. Most members of the P.

serval/weberi group are restricted to southern Namibia and

the Northern Cape, with the greatest richness along the

lower Orange River Valley and in the Karasberg Moun-

tains, where up to five members of the group occur sym-

patrically. However, five members assigned to the group

have been found north of 21°S latitude: P fasciatus

Boulenger, 1888 — widely distributed in northwestern

Namibia east of the Namib and north of the Swakop Riv-

er, P. waterbergensis Bauer & Lamb, 2003 — endemic to

the immediate vicinity of the Waterberg Plateau.

P. tsodiloensis Haacke, 1966 — in the Tsodilo Hills of

Bonn zoological Bulletin 57 (2): 257-266

northwestern Botswana, and P. otaviensis Bauer, Lamb &

Branch, 2006 and an undescribed species (‘Pachydacty-

lus sp. 2’, Bauer et al. 2006a) — both from the Otavi High-

lands (Otaviberge) of northeastern Namibia. Bauer &

Lamb (2005) and Bauer et al. (2006a) used molecular phy-

logenetic data to confirm that the first three of these

species comprise a monophyletic group that is sister to the

rest of the P. serval/weberi group. However, recent mul-

ti-gene phylogenetic analyses incorporating all but one of

the recognized species of Pachydactylus (Heinicke, Jack-

man & Bauer, unpublished) have demonstrated that P.

otaviensis is not a member of the P. serval/weberi clade

(these phylogenetic results will be presented in their en-

tirety elsewhere), but rather part of the “northwestern

clade”, which otherwise comprises ten morphologically

diverse species that are widely distributed in Namibia and

southern Angola, with a single species, P.- punctatus Pe-

ters, 1854, extending southwards into South Africa and

east to the Indian Ocean coast of Mozambique (Bauer &

Branch 1995).

Excluding P. punctatus, P. otaviensis has the easternmost

distribution of any member of the “northwestern clade”,

being known only from the farms Uithoek and Varianto,

both in the Tsumeb District, Oshikoto Region in the east-

ern Otavi Highlands (quarter degree square 1917Bc; Fig.

1). A second species from the Otavi Highlands was sig-

©ZFMK

Aaron M. Bauer

Table 1. Mensural and labial scale data for the type series of Pachydactylus boehmei sp.n. Abbreviations as in Materials and Me-

thods, all measurements in mm.

Holotype

MCZ R184884 MCZ R184880

Sex female female

SVL 44.4 43.21

ForeaL 6.6 6.8

CrusL 7.9 79

TailL (total) 44.5 6.9

TailL (regen.) = BR

TailW 4.8 4.7

TrunkL 21.0 18.8

HeadL 13.7 14.1

HeadW 8.3 8.3

HeadD 5.0 5.3

OrbD 315 3.8

EyeEar 3.4 Bill

SnEye 4.9 5.0

NarEye Sai) 329.

Interorb 44 4.3

EarL 1.0 0.9

Internar 1.4 1.1

Supralab. (L/R) 10/9 11/10

Infralab. (L/R) TT 8/8

Paratypes

MCZ R184881 MCZ R184882 MCZ R184883

female male female

44.0 35.4 34.8

6.6 5.4 4.7

8.6 ae) 5.9

39.0 35.8 30.3

33.4 — 21.6

47 3.9 3.5

19.0 15.6 13.8

13.0 11.5 12.0

9.0 6.9 V2

5.3 3.8 4.0

3.8 2.8 3.3

3.2 2.9 2.5

4.7 4.2 4.2

3.6 2.9 3.0

3.9 3.6 3.0

1.0 0.7 0.7

1.3 1.0 1.2

10/10 9/9 10/10

7/8 8/8 9/8

naled by Bauer et al. (2006a) as “Pachydactylus sp. 2”,

but was not described as it was known only from one ju-

venile and one hatchling, making meaningful comparisons

with other species difficult. However, Bauer et al.

(2006a) noted that it exhibited some features shared with

the PR. weberi complex sensu stricto and others with the

P. serval complex, and that it possessed a unique and di-

agnostic juvenile color pattern. Subsequent field work on

the Farm Uisib has yielded a series of adult specimens of

this species, permitting its description. Ongoing molecu-

lar phylogenetic work verifies that it too is, in fact, cor-

rectly assigned to the “northwestern clade” of Pachydact-

lyus.

MATERIALS AND METHODS

The following measurements were taken with Brown and

Sharpe Digit-cal Plus digital calipers (to the nearest 0.1

mm) as per Bauer et al. (2006a): snout-vent length (SVL;

from tip of snout to vent), crus length (CrusL; from base

of heel to knee); tail length (TailL; from vent to tip of un-

regenerated tail), tail width (TailW; measured at base of

tail); axilla to groin length (TrunkL); head length (HeadL;

distance retroarticular process of the jaw and snout-tip),

head width (HeadW; measured at angle of jaws), head

depth (HeadD; maximum height of head, from occiput to

Bonn zoological Bulletin 57 (2): 257-266

throat), ear length (EarL; longest dimension of ear); fore-

arm length (ForeaL; from base of palm to elbow); orbital

diameter (OrbD), nostril to eye distance (NarEye; distance

between anteriormost point of eye and nostril), snout to

eye distance (SnEye; distance between anteriormost

point of eye and tip of snout), eye to ear distance (Eye-

Ear; distance from anterior edge of ear opening to poste-

rior corner of eye), and interorbital distance (Interorb;

shortest distance between left and right superciliary scale

rows).

Scale counts and external observations of morphology

were made using a Nikon SMZ-1000 dissecting micro-

scope. Comparisons were made with museum material

(see Appendix) representing all species in the Pachydacty-

lus serval/weberi group and the “northwestern clade” of

Pachydactylus (sensu Bauer & Lamb 2005; Bauer et al.

2006a). Standard codes for museum collections follow

Leviton et al. (1985) except as noted (*): California Acad-

emy of Sciences, San Francisco (CAS), Museum of Com-

parative Zoology, Harvard University, Cambridge, USA

(MCZ), National Museum of Namibia, Windhoek

(NMN*), Naturmuseum und Forschungsinstitut Sencken-

berg, Frankfurt am Main (SMF), South African Museum,

Cape Town (SAM), Transvaal Museum, Pretoria (TM),

Zoologisches Forschungsmuseum Alexander Koenig,

Bonn (ZFMK).

OZFMK

A new Pachydactylus from northern Namibia 259

Fig. 1. Map of Namibia and surrounding countries illustrating

the type locality of Pachydactylus boehmei sp. n. (red star) and

of the related P. ofaviensis (blue circle) in the Otavi Highlands

of northeastern Namibia. Satellite image from NASA MODIS

sensor (available at http://visibleearth.nasa.gov).

RESULTS

Pachydactylus boehmei sp. n.

Pachydactylus sp. 2 Bauer, Lamb & Branch (Bauer et al.

2006a: 684)

Holotype. MCZ R184884 (Figs 2—3): adult male; Namib-

ia, Otjozondjupa Region, Grootfontein District, Farm Uis-

ib, 19°33’06”S, 17°14711”E, 1400 m a.s.l. coll. A.M.

Bauer, J. Marais, T. Jackman, and W.R. Branch, 15 Sep-

tember 2006.

Paratypes. MCZ R184880—81 (adult females), 184883

(subadult/adult female), MCZ R184882 (subadult/adult

male), same data as holotype.

Bonn zoological Bulletin 57 (2): 257-266

Additional material. TM 84999, 85005; Namibia, Otjo-

zondjupa Region, Grootfontein District, Farm Uisib

(IGS WS, LIN),

Diagnosis. Snout-vent length to at least 44.4 mm. A mod-

erate-sized Pachydactylus with a depressed body form.

Trunk with 16 rows of enlarged, keeled tubercles, grad-

ing into prominent conical scales on flanks (Figs 2-4). Or-

bital diameter as great as eye-ear distance. Rostral partic-

ipating 1n nostril rim. Dorsal surface of thighs and shanks

covered by enlarged conical to keeled scales. Tail with

keeled lanceolate tubercles restricted to one scale row per

tail segment. Dorsal pattern with an occipital-nuchal loop,

a “V”-shaped band on posterior of neck, a transverse bar

anterior to hindlimb insertion, and a series of oval mark-

ings or fusions thereof on the trunk (Figs 2—5).

Among its congeners P. boehmei sp n. is superficially sim-

ilar to some members of the P. weberi group, but can be

distinguished from these by its inclusion of the rostral in

the nostril rim and the possession of a maximum of only

four undivided scansors beneath the digits of the pes (ver-

sus at least five on some digits). Among other members

of the “northwestern clade” of Pachydactylus it may be

differentiated from P. bicolor Hewitt, 1926, P. punctatus,

P. scherzi Mertens, 1954, and P. caraculicus FitzSimons,

1959 by its tuberculate (versus atuberculate) dorsum, from

P. angolensis Loveridge, 1944 by its inclusion of the ros-

tral and first supralabial in the nostril border (versus both

excluded), from P. oreophilus McLachlan & Spence, 1967

by its smaller size (maximum SVL < 45 mm versus 57

mm), and lower number of subdigital lamellae (4 versus

5—6 undivided lamellae), from P. gaiasensis Steyn &

Mitchell, 1967 by its smaller size (maximum SVL < 45

mm versus 68 mm), lower number of subdigital lamellae

(4 versus 5—7 undivided lamellae), longer tail (slightly

longer than SVL versus less than SVL), and lack of a ver-

tebral stripe, from P. sansteynae Steyn & Mitchell, 1967

by its much larger dorsal tubercles (4-10 times larger than

other dorsal scales versus less than twice size of dorsal

granules) and presence (versus absence) of tubercles on

the parietal region, from P. parascutatus Bauer, Lamb &

Branch, 2002 by its larger size (to 44.4 mm versus < 40

mm SVL) and presence of a pale dorsal collar (versus no

collar), and from P. scutatus Hewitt, 1927 by is juxtaposed

(versus imbricating) keeled dorsal scales, enlarged coni-

cal (versus small and granular) flank scales, projecting

lanceolate (versus flattened and rounded to oval) caudal

tubercles, and its complex dorsal trunk patterning (versus

patternless or with small, scattered dark markings. Pachy-

dactylus boehmei sp n. is most similar to the geographi-

cally proximal P. otaviensis, but may be distinguished

from this form by its inclusion (versus exclusion) of the

rostral in the nostril rim, the presence of 4 (versus 5) lamel-

lae beneath digit IV of the pes, 16 (versus 18) longitudi-

©OZFMK

260 Aaron M. Bauer

Fig. 2.

Holotype of Pachydactylus boehmei sp. n., MCZ

R184884. Scale bar = 10 mm.

nal rows of keeled dorsal tubercles, and differences in col-

or pattern.

Description of holotype. Adult female. Snout-vent

length (SVL) 44.4 mm. Body relatively depressed, elon-

gate (TrunkL/SVL ratio 0.46). Head elongate, large

(HeadL/SVL ratio 0.31), relatively narrow

(HeadW/HeadL ratio 0.61), depressed (HeadH/HeadL ra-

tio 0.36), distinct from neck. Lores inflated; interorbital

region flat. Snout short (SnEye/HeadL ratio 0.36, longer

than eye diameter (OrbD/SnEye ratio 0.71); scales on

Bonn zoological Bulletin 57 (2): 257-266

snout enlarged, smooth, slightly domed, roughly hexag-

onal; scales on snout much larger than those of interor-

bital region and parietal table. Eye moderately large

(OrbD/HeadL ratio 0.25); orbits without extra-brillar

fringes; posterior superciliary scales bearing five small

spines; pupil vertical, with crenelated margins. Ear open-

ing oval, small (EarL/HeadL ratio 0.07), round; eye to ear

distance approximately equal to diameter of eyes (Eye-

Ear/OrbD ratio 0.97). Rostral approximately 50% as deep

(0.9 mm) as wide (1.9); no rostral groove; contacted by

two enlarged supranasals and first supralabials; nostrils

oval, each surrounded by two postnasals, one supranasal,

first supralabial, and rostral; supranasals in broad contact;

dorsal postnasals separated by two granules from one an-

other; nostril rims weakly inflated; 1—2 rows of scales sep-

arate orbit from supralabials; mental rectangular, only

slightly wider anteriorly than posteriorly, approximately

1.6 times deeper (1.8 mm) than wide (1.1 mm); no en-

larged postmentals or chin shields. Enlarged supralabials

to angle of jaws 9(R)—10(L), 8 to mid-orbit, several gran-

ular scales along labial margin to rictus; enlarged infral-

abials 7; interorbital scale rows between superciliary scale

rows (at midpoint of orbit) 30, 8 across narrowest point

of frontal bone.

Enlarged conical tubercles present from posterior border

of orbit and occiput posteriorly; dorsal trunk tubercles

large (4-10 times size of adjacent scales), rounded, with

a strongly developed median keel, forming approximate-

ly 16 longitudinal rows; tubercles largest on dorsolateral

surfaces of trunk, smaller along vertebral midline, and

grading into enlarged conical scales on flanks; each en-

larged tubercle surrounded by rosette of smaller pyrami-

dal scales, some also keeled, larger keeled tubercles typ-

ically separated from one another by a single smaller scale;

ventral scales flattened, subimbricate, becoming somewhat

larger posteriorly, approximately 40 between lowest tu-

bercular rows at midbody; non-tuberculate scales on dor-

sum at midbody similar in size to those on ventrum at

same level; gular granules less than one half size of ven-

tral scales of chest, increasing abruptly in size on throat.

No precloacal or femoral pores. Scales on palm, sole, and

ventral surface of forelimb small, smooth, granular, jux-

taposed; scales on ventral aspect of hindlimbs smooth, jux-

taposed to subimbricate; scales on dorsal aspect of fore-

limb heterogeneous, with midsized conical to keeled tu-

bercles intermixed with smaller granular to conical

scales; scales on dorsum of thigh and crus greatly enlarged,

conical and keeled, in contact with each other or narrow-

ly separated by much smaller interscales.

Forelimbs moderately short, stout; forearm short (Fore-

aL/SVL ratio 0.15); hindlimbs relatively short, tibia mod-

erately short (CrusL/SVL ratio 0.18); digits relatively

short, claws minute, stylet-like, visible only with difficul-

©ZFMK

A new Pachydactylus from northern Namibia 261

<== —— = - Sea ee es

ae ;

Fig. 3. Life photo of holotype of Pachydactylus boehmei sp. n. Photo by Johan Marais.

ty on some digits of the pes; subdigital scansors, except

for distalmost, entire, present only on distal portion of toes,

approximately 1.5 times wider than more basal (non-scan-

sorial) subdigital scales; interdigital webbing absent. Rel-

ative length of digits (manus): HI > IV > II > V > I; (pes):

IV > ll > V > II >I. Subdigital scansors, exclusive of di-

vided distalmost scansor (manus): I (4), II (4), II (4), 1V

(4), V (4); (pes) I (4), II (4), HI (4), TV (4), V (4).

Tail sub-cylindrical, clearly depressed; original tail approx-

imately snout-vent length (TailL/SVL ratio 1.00); tail con-

stricted basally, then expanded before tapering towards tip,

distinctly segmented; each segment with 5 rows of scales

dorsally and 3 ventrally, dorsal caudal , tail segment; cau-

dal tubercles heterogeneous, medial tubercles more-or-less

recumbent, lateral tubercles projecting, up to 8 keeled tu-

bercles per row basally, decreasing to 4 on distal caudal

segments; subcaudal scales smooth, imbricating, oval to

rectangular; no enlarged postcloacal spurs on side of tail-

base.

Coloration. In preservative (Fig. 2): Ground color of dor-

sum straw to yellowish brown with mid-brown markings.

A broad “V”-shaped nape band and a transverse band an-

terior to hindlimb insertion. Trunk bearing a series if ir-

regular oval markings, darker on their edges than at their

centers, 3 (left) and 4 (right) markings in paravertebral po-

sition, 6 on upper left flank, last fused with transverse

band, 2 on upper right flank followed by an irregular lon-

gitudinal marking representing the fusion of several oval

markings. An additional pair of small dark markings at an-

terior face of hindlimb insertion and an additional cross-

band on dorsum of posterior sacrum.

Bonn zoological Bulletin 57 (2): 257-266

Head with a pale stripe from nostril to anterodorsal rim

of orbit. Dark stripe along loreal region to mid-anterior

of orbit, continuing from midposterior of orbit, above ear,

to meet contralateral stripe to form a complete loop be-

tween the occiput and nape. Crown mottled, a triangular

brown marking with apex at supranasals scales extending

back to anterodorsal orbital rim. Labial scales pale with

diffuse speckling; grayish vertical markings on lateral

edges of rostral.

Limbs mottled with irregular markings. Tail with alternat-

ing irregular bands of grayish-brown and mid-brown, 20

dark bands including tail tip; most caudal tubercles cream

to beige. Body venter beige, soles and palms grayish, tail

venter grayish-brown with irregular darker gray-brown

markings scattered along length of tail.

In life (Fig. 3): Background color of dorsum a pale pink-

ish-gray. Labial scales, canthal stripe, and nape whitish.

Dark markings yellowish-to mid brown, darkest on head

and occiput. Venter white.

Variation. Variation in mensural characters of the holo-

type and paratypes are presented in Table 1. All paratypes

share with the holotype the same number of longitudinal

rows of dorsal tubercles, number of subdigital lamellae,

and configuration of the scales of the nasal region. Labi-

al scale numbers varied across the type series and are al-

so presented in Table 1. The male paratype, MCZ

R184882 has prominent precloacal spurs (Fig. 4A), each

bearing two rows of enlarged, compressed, dorsally-direct-

ed scales. Those of the dorsal row (5 scales on both sides)

larger than those of ventral row (5 scales left, 6 scales

©ZFMK

262 Aaron M. Bauer

Fig. 4.

right). Color pattern variable amongst paratypes (Figs

4-5). Dark occipital and nape bands thinner in MCZ

R184880, R184882 than in holotype. Dorsal oval patterns

largely replaced by coalescent blotches and lines except

in MCZ R184881. Dorsal pattern weakly contrasting in

MCZ R184883.

Etymology. Named for Prof. Dr. Wolfgang BOhme (born

21 November 1944), my longtime friend and colleague

and a leading contributor to African herpetology. It is a

privilege to apply this patronym to a species of one of the

continent’s dominant genera on the occasion of his nom-

inal retirement from his position at the Museum Alexan-

der Koenig. The epithet is formed in the masculine gen-

itive.

Distribution. The species is known only from Farm Uis-

ib in the Grootfontein District of northeastern Namibia

(Fig. 1). This lies in the western portion of the Otaviberge

or Otavi Highlands, 15 km northwest of the town of Otavi.

The distribution of P. boehmei sp n. in the region is un-

known and the closely related P. otaviensis occurs only

50 km to the northeast. These two geckos are relatively

isolated from other members of the “northwestern clade”

of Pachydactylus except the ubiquitous P. punctatus; the

nearest known localities for P. bicolor and P. scutatus be-

ing more than 200 km distant. Other rock-dwelling con-

geners in other clades are also quite remote, with P. wa-

terbergensis approximately 125 km to the south and P.

tsodiloensis almost 400 km to the north-northeast. The

Bonn zoological Bulletin 57 (2): 257-266

Life photos of paratypes of P. boehmei sp. n. (A) MCZ R184882, male — note the raised precloacal spur visible lateral

to the tail base. (B) MCZ R184880, female — note the transition from rounded, keeled dorsal tubercles to enlarged conical flank

scales. Photos by Johan Marais.

Otavi Highlands as a whole has been poorly explored her-

petologically and may harbor other isolated populations

and/or endemic species of lizards. A number of endemic

invertebrates and fish are already known from the Otavi-

Tsumeb-Grootfontein area (Barnard et al. 1998).

Natural history. The area where P. boehmei sp n. occurs

is characterized as mountain savanna and karstveld (Giess

1971). The type series was collected in broadleaf savan-

na on rocky dolomite hills (Fig. 6). Specimens collected

by the author and colleagues were moving on rock faces

or were found in large crevices or cracks between 22:30

and 00:30. The two Transvaal Museum specimens (see

Additional material) referred to this species were collect-

ed in the course of searching for scorpions (E. Scott & L.

Prendini, pers. comm.). Barnards Namib day gecko, Rhop-

tropus barnardi Hewitt, 1926, was also collected at Farm

Uisib, which is one of the easternmost localities for any

member of its genus. Other species observed at the type

locality were the widespread Chondrodactylus turneri

(Gray, 1864), Zrachylepis sulcata (Peters, 1867), and 7:

punctulata (Bocage, 1872). Lygodactylus capensis (Smith,

1849) was collected at the nearby Uisib farmhouse

(192332 Sa 7 ens 00uE):

Two enlarged eggs are visible through the ventral body

wall of the holotype collected in mid-September, suggest-

ing spring breeding and hatching late in the year, corre-

sponding to the rainy season. Trombiculid mites were

found on the specimens, most notably in between the

©ZFMK

A new Pachydactylus from northern Namibia 263

Fig. 5.

scales of the tail base. In the male paratype, MCZ 184882,

the infestation of mites around the tail base and scales of

the precloacal spurs was particularly severe.

Phylogenetic affinities. Pachydactylus boehmei sp n. is

similar in habitus to the other small-bodied, tuberculate

members of the “northwestern clade”. It is superficially

most similar to the neighboring species P. ofaviensis, al-

though the latter species lacks the rostral-nostril contact

that is typical for most members of the clade. Preliminary

molecular results suggest that these two species are indeed

sister taxa.

Conservation status. Pachydactytlus boehmei sp n. does

not occur in any protected areas. At its type locality it is

undisturbed and the jagged, rocky terrain precludes hu-

man encroachment into its specific habitat. However, de-

pending upon the extent of its actual range it may be un-

der some threat from local mining activity in some places.

Until such time as the species’ distribution and threats can

be evaluated more fully, I recommend that it be consid-

ered Data Defficient under the IUCN threat category sys-

tem.

Bonn zoological Bulletin 57 (2): 257-266

Paratype series of Pachydactylus boehmei sp. n. showing variation in the dorsal color pattern and degree of pattern bold-

ness. Scale bar = 10 mm.

DISCUSSION

The discovery of this apparently range-restricted species

highlights Namibia’s high biodiversity and endemism

(Maggs et al. 1998). M. Griffin (1998) identified 55 rep-

tile species as being strictly or primarily endemic to

Namibia, but recent discoveries, particularly in Pachy-

dactylus (Bauer et al. 2002, 2006a; Bauer & Lamb 2003)

have increased this to approximately 70. The “northwest-

ern clade” of Pachydactylus is particularly diverse along

the Northern Namibian Escarpment (sensu Irish 2002),

which corresponds roughly to the Kaokoveld center of

Floral Endemism (Volk 1966; van Wyk & Smith 2001) and

is recognized as a regional center of endemism for rep-

tiles in general (Crowe 1990; Simmons et al. 1998; Grif-

fin 2000). The Otavi Highlands have also been ranked as

an area of high biodiversity importance (Irish 2002), but

like the Waterberg to the south, the relatively low relief

(a maximum of 2155 m in surrounding plains of

1200-1500 m) and accessibility to surrounding areas that

promotes diversity also decreases the prospects for long-

term isolation and, consequently, endemism. Thus, it is

somewhat surprising that two species of Pachydactylus,

©OZFMK

264 Aaron M. Bauer

Fig. 6.

P. otaviensis and P. boehmei sp n., appear to be restrict-

ed to this region. Bauer (1999 [2000]) emphasized the role

of substrate specificity as a cladogeneic agent in Pachy-

dactylus and it seems likely that dependence on microhab-

itats provided by the dolomite outcrops of the Otaviberge

has isolated these species from rest of the “northwestern

clade”. Other groups of organisms that respond similarly

to historical ecological conditions should be expected to

show similar patterns of endemism and indeed this is the

case in scorpions (R.E. Griffin 1998), which include many

substrate specific rupicolous species, such as the bothri-

urid Lisposoma josehermana Lamoral, 1979, which is

largely restricted to the Otavi Highlands (Prendini 2003,

2005).

Despite over 50 years of relatively intense study (e.g.,

Mertens 1955, 1971; Haacke 1965; van den Elzen 1978;

Bauer et al. 1993; Griffin, 2000, 2003), novel herpetolog-

ical taxa continue to be discovered in Namibia on a reg-

ular basis. That Pachydactylus boehmei sp n. occurs in a

densely-populated (by Namibian standards) agricultural

district with excellent road access demonstrates that even

“well known” parts of the country remain understudied.

Acknowledgements. | thank the many colleagues and students

who have accompanied me on trips to Namibia, and in particu-

lar Johan Marais, Todd Jackman and Bill Branch, who partici-

pated on the field trip on which the types of P boehmei were

collected. I am also grateful to Andre Schoeman and his fami-

ly, who made us welcome at Farm Uisib, and to the Ministry of

the Environment and Mike Griffin, who have supported my work

in Namibia for more than 20 years. Specimens were collected

under Namibian Research/Collecting Permit 1068/2006. For ac-

cess to comparative material I thank José Rosado, Jonathan

Losos and James Hanken (MCZ), Lauretta Mahlengu and Wulf

Haacke (TM), Jens Vindum (California Academy of Sciences),

Mathilda Awases (NMN), Wolfgang B6hme (ZFMK), and Gun-

ther K6hler (SMF). Photos were kindly provided by Johan

Marais and Elizabeth Scott. This research was funded by the Na-

Bonn zoological Bulletin 57 (2): 257-266

Habitat of Pachydactylus boehmei sp. n. in the Otavi Highlands: (A) View of typical dolomite hill. (B) Broken dolomi-

te providing cracks and fissures as retreat sites for geckos. Photos by Elizabeth Scott.

tional Science Foundation of the United States through grants

DEB 0515909 and DEB 0844523 to the author. Finally, I thank

Philipp Wagner for inviting me to submit this manuscript, and

Wolfgang Bohme, whose illustrious career has provided the op-

portunity to present these data.

REFERENCES

Barnard P, Bethune S, Kolberg H (1998) Biodiversity of terres-

trial and freshwater habitats. Pp. 57-188 in Barnard P (ed) Bi-

ological Diversity in Namibia — A Country Study. Namibian

National Biodiversity Task Force, Windhoek

Bauer, AM (1999 [2000]) Evolutionary scenarios in the Pachy-

dactylus-group geckos of southern Africa: new hypotheses.

African Journal of Herpetology 48: 53—62

Bauer, AM, Branch WR (1995) Geographic variation in west-

ern populations of the Pachydactylus punctatus complex (Rep-

tila: Gekkonidae). Tropical Zoology 8: 69-84

Bauer AM, Lamb T (2003) A new species of the Pachydactylus

weberi group (Reptilia: Squamata: Gekkonidae) from the Wa-

terberg Plateau, Namibia. Cimbebasia 19: 1-12

Bauer AM, Lamb T (2005) Phylogenetic relationships of south-

ern African geckos in the Pachydactylus Group (Squamata:

Gekkonidae). African Journal of Herpetology 54: 105—129

Bauer AM, Branch WR, Haacke WD (1993) The herpetofauna

of the Kamanjab area and adjacent Damaraland, Namibia.

Madoqua 18: 117-145

Bauer AM, Lamb T, Branch WR (2002) A revision of Pachy-

dactylus scutatus (Reptilia: Squamata: Gekkonidae) with the

description of a new species from northern Namibia. Proceed-

ings of the California Academy of Sciences 53: 23-36

Bauer AM, Lamb T, Branch WR (2006a) A Revision of the

Pachydactylus serval and P. weberi groups (Reptilia: Squa-

mata: Gekkonidae) of Southern Africa, with the description

of eight new species. Proceedings of the California Academy

of Sciences 57: 595-709

Bauer AM, Barts M, Hulbert F (2006b) A new species of the

Pachydactylus weberi group (Reptila: Squamata: Gekkonidae)

from the Orange River, with comments on its natural history.

Salamandra 42: 83-92

Branch WR (1998) Field Guide to the Snakes and Other Rep-

tiles of Southern A frica, 3" ed. Struik Publishers, Cape Town,

399 pp

©OZFMK

A new Pachydactylus from northern Namibia 265

Branch WR, Bauer AM, Jackman TR, Heinicke M (2010) A new

species of the Pachydactylus weberi complex (Reptilia: Squa-

mata: Gekkonidae) from the Namib-Rand Reserve, southern

Namibia. Breviora xx: in press.

Crowe TM (1990) A quantitative analysis of patterns of distri-

bution, species richness and endemism in southern African

vertebrates. Pp. 145—160 in Peters G & Hutterer R (eds.) Ver-

tebrates in the Tropics. Zoologiches Forschungsinstitut und

Museum Koenig, Bonn

Giess W (1971) A preliminary vegetation map of South West

Africa. Dinteria 4: 5-114

Griffin M (1998) Reptile diversity. Pp. 148-154 in Barnard P

(ed) Biological Diversity in Namibia — A Country Study.

Namibian National Biodiversity Task Force, Windhoek

Griffin M (2000) The species diversity, distribution and conser-

vation of Namibian reptiles: a review. Namibia Scientific So-

ciety Journal 48: 116-141

Griffin M (2003) Annotated Checklist and Provisional Nation-

al Conservation Status of Namibian Reptiles. Namibia Scien-

tific Society, Windhoek, [2] + 169 pp

Griffin RE (1998) Species richness and biogeography of non-

acarine arachnids in Namibia. Biodiversity and Conservation

7: 467-481

Haacke WD (1965) Additional notes on the herpetology of South

West Africa with descriptions of two new subspecies of geck-

os. Cimbebasia (11): 1-40

Irish J (2002) Namibian Mountains: Biodiversity Potential Based

on Topography. Report to the Mountain Working Group of the

National Biodiversity Task Force, Windhoek, 42 pp

Leviton AE, Gibbs RH, Heal E, Dawson CE (1985) Standards

in herpetology and ichthyology: Part 1, Standard symbolic

codes for institutional resource collections in herpetology and

ichthyology. Copeia 1985: 802-832

Maggs GL, Craven P, Kolberg HH (1998) Plant species richness,

endemism, and genetic resources in Namibia. Biodiversity and

Conservation 7: 435-446

Mertens R (1955) Die Amphibien und Reptilien Stidwestafrikas,

aus den Ergebnissen einer im Jahre 1952 ausgefihrten Rei-

se. Abhandlungen der Senckenbergischen naturforschenden

Gesellschaft 490: 1-172

Mertens R (1971) Die Herpetofauna Stidwest-A frikas. Abhand-

lungen der Senckenbergischen naturforschenden Gesellschaft

529: 1-110

Prendini L (2003) Revision of the genus Lisposoma Lawrence,

1928 (Scorpiones: Bothriuridae). Insect Systematics and Evo-

lution 34: 241-264

Prendini L (2005) New records and observations on the natural

history of Lisposoma elegans and L. josehermana (Scorpiones:

Bothriuridae). American Museum Novitates 3487: 1-11

Simmons RE, Griffin M, Griffin RE, Marais E, Kolberg H (1998)

Endemism in Namibia: patterns, processes and predictions.

Biodiversity and Conservation 7: 513-530

van den Elzen P (1978) Observations sur l’herpétofaune du Wa-

terberg (Namibie). Bonner zoologische Beitrage 29: 171-182

Van Wyk AE, Smith GF (2001) Regions of Floristic Endemism

in Southern Africa. Umdaus Press, Hatfield, South Africa, viii

+ 199 pp

Volk OH (1966) Die Florengebiete von Siidwestafrika. Journal

der Stidwest Afrikanische Wissenschaftliche Gesellschaft 20:

25-58

Bonn zoological Bulletin 57 (2): 257-266

APPENDIX

Comparative specimens examined

See Bauer et al. (2006ab) for a list of P weberi group, P. otavien-

sis, and P. sansteynae specimens examined, Bauer & Branch

(1995) for a list of P. punctatus and P. scherzi examined, and

Bauer et al. (2002) for a list of P angolensis, P. scutatus and P.

parascutatus examined. Only specimens not included in these

publications are listed below. For localities without precise co-

ordinates quarter degree square (QDS) references have been pro-

vided when possible. Each single degree square is subdivided

into four quarter degrees, designated A-D (A=NW quadrant,

B=NE quadrant, C=SW quadrant, D=SE quadrant). Each quar-

ter degree is in turn divided into four similarly designated divi-

sions, yielding a basic unit one sixteenth of a degree square, or

one quarter of a degree on a side (e.g., 1915Ac represents the

unit bounded by 19°15’S and 19°30’S and 15°00’S and 15°15E).

All QDS references in this paper refer to degrees South and East.

P. angolensis: Angola: Namibe Province: San Nicolau

(1412Ab): TM 25454—55, 25459, 25476, 25478—79; Saco de Gi-

raul: TM 4032830, TM 46558; Lucira (1312Dc): TM 41172,

24406, 24445, 24449; Lungo: TM 24406; Benguela Province:

Hanha, 20 km N of Lobito (1213Ab); 24 km S Benguela: TM

39110—11; 30 km N of Dombe Grande: TM 41266.

P. bicolor: Namibia: Erongo Region: Karibib District: 47 mi

E Hentiesbaai: CAS 126210; 20 km W Karibib: MCZ

R163282—83; Swakopmund District: 29.0 km N of Swakop-

mund (22°25°38"S, 14°27°53”E): CAS 214576; 31.1 km N

Swakopmund on Hentiesbaai Rd. (22°25’42”S, 14°27°43”E):

MCZ R184218-20, 184225; Messum Crater (21°26’25.8’S,

14°13°12.9"E): CAS 214814; Kunene Region: Khorixas Dis-

trict: Torrabaai Rd, 63.4 km W of Kamanjab (19°41’00"S,

14°19°10”E): CAS 223912-15; Torrabaai Rd, 58 km W of Ka-

manjab (19°39°20"S, 14°21°10”E): CAS 223927-28; Torrabaai

Rd, 56.7 km W of Franken entrance: CAS 176284-85: Torrabaai

Rd, 37.8 km W of Franken entrance: CAS 176292—93: Kaman-

jab-Torrabaai Rd, Grootberg Pass (19°50.584’S, 14°07.696’E):

CAS 193675; Kamanjab-Torrabaai Rd, 59.3 km W of Kaman-

jab (19°39.100’S, 14°21.335’E): CAS 193680; Torra Bay Rd,

48 km W of Kamanjab, (19°39714"S, 14°21°03”E): CAS

214661—63; Torra Bay Rd, 68 km W of Kamanjab, (19°43’00"S,

14°18°40”E): CAS 21468-89; Torra Bay Rd, 74.2 km W of Ka-

manyab (19°45’°40"S, 14°17°03”E): CAS 21469396; E side of

Road 3706, 19.3 km N of entrance to Palmwag: CAS 175344;

Torrabaai Rd, 108.9 km W of Kamanjab: CAS 176101—08;

Torrabaai Rd, 101.7 km W of Kamanjab: CAS 176116—19;

Torrabaai Rd, 95.9 km W of Kamanjab: CAS 176126-31;

Torrabaai Rd, 44 km W of Kamanjab: CAS 176151; Henties-

baai-Uis Rd, 24 km W of Hwy C35 (21°18717”S, 14°35714”E):

CAS 206959; 25 km E of Grootberg Pass: CAS 206960; ~60

km W. Kamanjab on Torra Bay Rd. (19°40°57”S, 14°19°09”E):

MCZ R184919; 31.9 km E Grootberg Pass (19°40°57S,

14°19°09”E): MCZ R184197—98; 62.8 km W Kamanjab Rest

Camp on Rd. to Grootberg Pass (19°40’56”S, 14°19°08”E):

MCZ R185753-—55; 67.5 km W Kamanyjab on Torrabaai Rd.

(19°43’00"S, 14°18°44”E): MCZ R183766; Hobatere Lodge, 2.5

km from main gate (19°18’07"S, 14°27°26”E): MCZ

R184934—35; Opuwo District: Kamanjab-Ruacana Rd, 98.4 km

N of Kamanjab: CAS 193719; Opuwo-Okangwati Rd, Otjivize

(17°37.188 S, 13°27.535 E): CAS 193731; Outjo District: 17

mi S of Outjo: CAS 85944; Farm Franken: CAS 175347-S3,

175360-74, 176066—68, 176176—-77; Farm Franken, Haus

Franken: CAS 176261—62; Farm Franken, vic. Haus Franken:

©ZFMK

266 Aaron M. Bauer

CAS 176278; 62.0 km E Kamanjab, Farm Amolinda

(19°48°29"S, 15°22°46”E): MCZ R185745—47; Kamanjab Rest

Camp, 3 km W Kamanjab(19°37’48"S, 14°48°57”E): MCZ

R184887, 18489497.

P. caraculicus: Angola: Namibe Province: 36 mi. northwest of

Mocamedes [Namibe]: CAS 85959; Namibia: Kunene Region:

Opuwo District: Okangwati-Epupa Rd, 43.4 km N of Okang-

wati: CAS 193799; 193804—05; 41.9 km N. of Okanguati on

Epupa Falls Rd: CAS 206980; 32 km S Epupa Falls on Okang-

wati Rd. (17°1409”S, 13°13’45”): MCZ R185767.

P. gaiasensis: Namibia: Kunene Region: Khorixas District:

vic. Gat-as (20°47°18"S, 14°06’44”): CAS 214626—28; 22.4 km

N Ugab River on road to Gai-as (20°46°59”S, 14°06731”, 520

ma.s.l.): AMB 7568-69 (NMN), MCZ R184169-70, R184248;

Gai-As (20°46°45”S, 14°04°30”E, 520 m): AMB 8484 (NMN),

MCZ Z-37873 (NMN), MCZ R184181, R184192—93; Gai-As

(20°46 '46'°S,14°04'29""E): MCZ R185967—75, 185979-80;

“False Gai-As” (20°47°14.9"S, 14°06°44.6"E): MCZ Z-

37853-54 (NMN), MCZ R184185, R184187; 7 km E Gai-as

(20°47’S, 14°07’°E): TM 68962—66; Messem Crater, 21 26.430

S, 14 13.215 E : CAS 214800; Messum Mts. (2114Ac): TM

56346; Farm Twyfelfontein: TM 42182; near Gai-as, ~20 mi N

Brandberg: TM 32868—80 [paratypes].

P. oreophilus: Angola: Namibe Province: Caraculo (15°01’S,

12°40°E): TM 245 19-25, 24452; 20 km W Virei: TM 41011—15;

Tambor: TM 40532—34: 6 km S Rio Coroca towards Iona: TM

40575—76; Mutiambo River on road to Lucira: TM 41088; Fur-

nas: TM 40561—62; Namibe 7 km from Iona towards Oncocau,

Iona Reserve: TM 40762; Assuncao: TM 40152; Saiona River,

25 km NW Cainde: TM 40976—77; Benguela Province: 35 km

S Dombe Grande towards Lucira: TM 41246; Namibia:

Kunene Region: Opuwo District: near Purros (18°46’S,

12°59E); TM 68465-—67; Hoanib River (19°18’S, 13°15’E): TM

64185: Hoanib River, 44 km E Mudorib River (19°18’S,

13°15°E): TM 56889; Epupa Falls (16°59’°S, 13°17’E): TM

38771—72, 71579; 6 km S Ohnborimbonga (1712Bb): TM

49084—85; MarienfluB, 40 mls S Kunene: TM 32532; near Otji-

nende, Kaokoveld (1712Db): TM 49219; Epupa (1613Cc): TM

47775; N Okangwati on Epupa Falls Rd. (17°17'24’'S,

13°09°31°E): MCZ R185769; Paracamp, Sesfontein

Bonn zoological Bulletin 57 (2): 257-266

(19°07'52’’S, 13°35'17’"E): MCZ_ R-184945-47; Paracamp,

Sesfontein (19°07'55”S, 13°35’20”E): MCZ R184290; ca 2 km

N of Sesfontein, Para Camp (19°07’28”S, 13°35’29”E): CAS

214736, 214754; ca 4 km N of Sesfontein, Para Campsite

(19°07’56”S, 13° 35’18”E): CAS 223919-22.

P. otaviensis: Namibia: Oshikoto Region: Tsumeb District:

Farm Varianto (19°22°46"S, 17°44’27°E): MCZ R184867.

P. parascutatus: Namibia: Kunene Region: Opuwo District:

Mudorib River, 12 km from Hoanib River (19°23’S, 13°17’E):

TM 68488—92; Okamungodona, 15 km W Orawanji (18°49’S,

13°39°E): TM 71519-21; Otunungwa, Kaokoveld: TM

32401—03; Kharu-gaiseb River (19°45’S, 13°25’E): TM

68517—18; Bottom of Van Zyl’s Pass (1712Da): TM 71497; 37

km N Sesfontein towards Kaoko Otavi (1813Dc): TM 48876-77;

Otjiu, Kaokoveld: TM 32358; 32858—S9; 18 miles SW Orupem-

be: TM 31494; Otjinungwa, Kaokoveld: TM 32860; 4 km NW

Etenga towards Omborombongo (1712Bd): TM 49060; Nango-

lo Flats (1712Ad): TM 24322; Otjiunongua (1712Ab): TM

32546; Sesfontein (19°07’S, 13°37°E): TM _ 79078;

Ongongo/Kaoko: ZFMK 66434.

P. scutatus: Angola: Namibe Province: Iona, Iona Reserve: TM

40751; Espinheira, Iona Reserve: TM 40615—18; 6 km S Rio

Coroca, Iona: TM 40577; Namibia: Erongo Region: Omaruru

District: Ugab River Bridge near Brandberg W. Mine: TM 36463;

Ugab River (20°58’S, 14°12’E): TM 49708; Tsisab Gorge,

Brandberg (2114Ba): TM 79286; Brandberg: SMF 58564;

Sraussenhohle an der Jochmannswald, Brandberg: SMF 45658;

Kunene Region: Khorixas District: Farm Palmwag (19°53’S,

13°53’E): TM 56865; Farm Paderborn (1914Dd): TM 17302;

Kamanjab (1914Db): TM 17209, 17270, 36372; Damaraland

(20°30’S, 13°49°E): TM 68754; Farm Huab (1914Db): TM

17338; Farm Palmfontein (part of Grootberg): TM 36465; Farm

Blauwpoort (2014cb): TM 49419; Agab Spring (20°05’S,

13°50’E): TM 56936; Opuwo District: Epupa Falls (16°59’S,

13°17°E): TM 7135253; Otjiu, Kaokoveld: TM 32539.

Received: 04.VII.2010

Accepted: 11.X.2010

©ZFMK

Bonn zoological Bulletin | Volume 57 Issu

2 ia pp. 267-274 Bonn, November 2010

A new Tarentola subspecies (Reptilia: Gekkonidae)

endemic to Tunisia

Ulrich Joger & Ismail Bshaenia

Staatliches Naturhistorisches Museum, Pockelsstr. 10, D-38106 Braunschweig, Germany

Abstract. Mitochondrial DNA sequences as well as morphological characters reveal that geckos of the genus Zarentola

from Libya and central Tunisia are a monophyletic group which is different from both 7. mauritanica and T. deserti. Con-

sequently, we elevate the former subspecies 7. mauritanica fascicularis to species rank. Together with 7) neglecta and T.

mindiae, T. fascicularis constitutes the sister group of 7: deserti. Tarentola fascicularis comprises several evolutionary

units, one of which we describe here as a subspecies endemic to south-central Tunisia.

Key words. Zarentola, gecko, Tunisia, Libya, North Africa, taxonomy.

INTRODUCTION

The Mediterranean geckos of the genus Zarentola Gray,

1825 are classified in the nominative subgenus 7arento-

la. The Canary Islands are inhabited by geckos of the sub-

genera Jarentola (Eastern Canaries) and Makariogecko

(western Canaries, Selvagens and Cape Verde Islands)

whereas other subgenera inhabit sub-Saharan Africa and

the Caribbean (Joger 1984a, b). To date, the nominative

subgenus comprises the following species: Zarentola mau-

ritanica (L., 1758), T. deserti Boulenger, 1891, 7. angus-

timentalis Steindachner, 1891, 7. boehmei Joger, 1984. Al-

though no subspecies have been described in the latter

three species, the North African populations of 7) mauri-

tanica have been assigned to a number of subspecies; in-

cluding, 7 m. mauritanica, T. m. fascicularis (Daudin,

1802) from Egypt, 7 m. juliae Joger, 1984, and 7: m. pal-

lida Geniez et al., 1999, both from Morocco. Zarentola

angustimentalis (eastern Canary Islands) and 7: deserti

(northern margin of the Sahara Desert) used to be classi-

fied as subspecies of 7. mauritanica until they were ele-

vated to species rank (Joger 1984b). In the case of 7. de-

serti, sympatric records of 7: deserti and T: mauritanica

in Tunisia and Algeria gave reason to assume that these

were separate biological species.

Tarentola deserti and T. mauritanica can be distinguished

from each other in a number of characters (Table 1, Figs

1 and 2). In the field, 7. deserti is characterized often by

its very large size, pale, often rosy body colour and a yel-

lowish or ochre brown coloured iris, whereas typical 7.

mauritanica is smaller and has a grey body and iris

colouration.

Bonn zoological Bulletin 57 (2): 267-274

In contrast, in south-central Tunisia (Bou Hedma Nation-

al Park and areas to the north of the Chott al Djerid salt

pan) populations of Zarentola were found that show a mix-

ture of characters of both species (Table 1, Fig. 3). Their

size is smaller than 7. deserti, but body and eye colour are

close to 7: deserti (Joger & Bischoff 1989; Joger 2003).

A preliminary study of morphological and electrophoret-

ic characters (Willand 1997; Joger et al. 1998) showed that

these geckos cluster morphologically with 7. mauritani-

ca (yet not with any of its described subspecies), where-

as their dorsal colour and pattern is close to 7 deserti and

their blood plasma protein alleles are distinct and not

shared by neither 7) mauritanica nor T. deserti.

Previous molecular genetic studies (Carranza et al. 2002;

Rato et al. 2010) of North African 7arentola were biased

in that they concentrated on Moroccan populations but

largely neglected Tunisian and Libyan populations. In this

study, we use both morphological and molecular samples

of Tunisian and Libyan Jarentola to determine the affini-

ties and clarify the taxonomy of the enigmatic Zarentola

of south-central Tunisia.

MATERIALS AND METHODS

Animals were collected during several trips to Morocco,

Algeria, Tunisia (U.J.) and Libya (I.B.). Specimens from

Egypt were kindly provided by Sherif Baha El Din and

Adel Ibrahim. Blood samples were taken by heart punc-

ture or from muscle tissue of dead animals and preserved

©ZFMK

268 Ulrich Joger & Ismail Bshaenia

Fig. 1. Zarentola mauritanica (Tunisia).

Operational taxonomic units (OTUs) were defined using

a combination of mitochondrial DNA clades and geo-

graphic proximity. Linear Discriminant Function Analy-

ses (LDFA) were used to find variables that separate the

groups. Principal Component Analyses (PCA) were ap-

plied to see whether groups are distinguishable without

previous definition of OTUs. Significance of character dif-

ferences were tested with t-tests.

DNA was extracted from the preserved samples using

standard procedures. Universal primers were used to am-

plify mitochondrial 12S rRNA (372 bp) and 16s rRNA (2

fragments of 448 and 604 bp). Sequences were determined

using an automated sequencer, and aligned with

CLUSTAL-W omitting gaps. Sequences from Genbank

were added in some cases. A sequence of a paratype of

the new subspecies was submitted to GenBank (IB47:

Table 1. Distinguishing characters of North African Zarento/a (mean + standard deviation). Significant differences from T. sp.

(Tunisia) are highlighted (in bold). Significance values are given for males (first value) and females separately (if different).

*«* P<().001; ** P<0.01; * P<0.05; n.s. not significant.

characters Timauritanica - Tunisia 7T’sp.- Tunisia T:sp.-complex-Libya T'deserti ssp.- Libya T.d.deserti - N-Africa

N=22 N=15 N=139 N=73 N=24

Maximal head 83.5 86 79 Tell 103.3

+ body length

Lamellae under 11.0 + 1.0 10.3 + 0.8 10.9 + 0.6 n.s./*** 11.0 + 0.7 n.s./*** 1257 E See

Ist toe

Lamellae under 16.8 + 1.0 *** 15.3 + 1.0 15.8 + 1.0 15.9 + 0.8 n.s./** 18272 eS ees

4th toe

Lamellae under 20.5 + 1.5 19.7+1.1 20.2 + 1.6 2053 eal 22:8 Eesha

5th toe

Ventral scales 37 £33 34.3 + 2.7 36.6 + 3.2 40.0 + 2.7 *** 40.1 + 2.0 ***

Dorsal tubercles 13.5 + 1.0 12.1+ 0.5 12.8 +1.4 13.4 + 0.9 **/*** 12.2+0.7

Gular scales 41.1+4.7 43.3 + 6.6 43.3+4.7 45.3+5.4 56.0 + 6.9 ***

Interorbitals 14.9 + 1.2 ** 13.7 + 1.0 14.9 + 0.7 **« 14.6 + 0.9 ** 14.5 +0.7

Infralabials 8.0 + 0.7 7.9 + 0.7 7.9 + 0.5 8.0 + 0.5 8.8 + 0.6 ***

Supralabials 7.8 + 0.6 PaO 7.9 +0.5 8.0 + 0.4 8.0 + 0.4

Relative 0.38 + 0.03 0.42 + 0.04 0.36 + 0.04 *** 0.36 + 0.04 *** 0.43 + 0.06

inter-orbital 0.39 + 0.02 0.41 + 0.03 0.37 + 0.04 n.s. 0.37 + 0.05 * 0.42 + 0.04

width

Relative earto 0.84+40.03 0.91 + 0.03 0.66 + 0.07 *** 0.66 + 0.06 *** 0.89 + 0.04

mental distance 0.88 + 0.06 0.90 + 0.03 0.69 + 0.21 ** 0.68 + 0.09 *** 0.88 + 0.03

in 96% ethanol. Voucher specimens were preserved in

80% ethanol.

Morphological data were taken as described by Joger

(1984a). Measurements were taken to the nearest 0.1 mm

and normalized as proportion to body length. Pholidotic

counts were taken unaltered.

Bonn zoological Bulletin 57 (2): 267-274

HQ437282). Phylogenetic trees were constructed using a

Bayesian Markov Chain Monte Carlo inference applying

an evolution model suggested by MODELTEST 3.7. Sta-

tistical support for branches was indicated by posterior

probability values (MrBayes).

©ZFMK

A new Zarentola endemic to Tunisia 269

RESULTS

Morphological comparisons

CDF plots (Figs 4a, b) show that 7. sp. (Tunisia) are dif-

ferent morphologically from 7 deserti as well as from un-

described Zarentola from western Libya (‘7T. sp. com-

plex’). When North African populations of 7) mauritani-

ca are compared with 7. sp. (Tunisia), only males appear

distinct, whereas females cluster with 7 mauritanica from

Tunisia and Morocco (Fig. 5b).

Fig. 2. Zarentola deserti (Biskra, Algeria). Significantly different characters which distinguish

Tunisian 7arentola from Libyan and other North African

populations are shown in Table 1.

Molecular genetic affinities

Mitochondrial gene sequences (12S rRNA, 16s rRNA) re-

veal that 7. sp. (Tunisia) does not cluster with 7? mauri-

tanica but with undescribed Libyan Tarentola (Fig. 8).

These Libyan populations form several geographically re-

stricted, monophyletic clades; the most western ones are

sister to 7’ sp. (Tunisia) — yet with rather low statistical

support. Zarentola deserti, T. mauritanica fascicularis

(Egypt, East Libya), and even 7. neglecta appear more

closely related to the western Libyan-Tunisian group of

clades than 7. m. mauritanica. This 1s highly supported

statistically (1.00 posterior probability). It is noteworthy

that the populations near the (neo-) type locality of 7! m.

Fig. 3. Tarentola sp. (Bou Hedma, Tunisia).

Table 2. Uncorrected “P” distance between main clades, estimated of evolutionary divergence between sequences, based on pair-

wise analysis of 1433 bp mtDNA sequences.

Clade A Clade B Clade C Clade D Clade E Clade F Clade G Clade H

Clade A

Clade B 0.0921

Clade C 0.0972 0.0704

Clade D 0.1180 0.0977 0.0692

Clade E 0.1052 0.0853 0.0562 0.0705

Clade F 0.0974 0.0634 0.0630 0.0802 0.0645

Clade G 0.1145 0.0873 0.0662 0.0665 0.0694 0.0510

Clade H 0.1141 0.0886 0.0691 0.0711 0.0706 0.0578 0.0270

Outgroup 0.1234 0.1407 OMB Si 0.1545 0.1564 0.1422 0.1531 0.1490

Bonn zoological Bulletin 57 (2): 267-274 ©ZFMK

Canonical discriminant function

A &

eu ©

N Ai eian ©3

c Ce oe

9 °K af

ew 0 KGa aA aa

2 ie Nacteavay

s a

Ww 4 e

AL IGA

3 : .a

‘

T T T SS) es

6 3 oO

Function 1

Canonical discriminant function

Function 2

Function 1

Fig. 4. CDF plots for Tarentola sp-Tunisia, Tarentola deserti-

North Africa, Zarentola sp-complex-Libya (western Libyan 7.

Jascicularis), and Tarentola deserti-Libya; males (above) and fe-

males (below).

fascicularis, in East Libyan Cyrenaica, belong to a sepa-

rate clade (clade D).

Genetic distances among Libyan and Tunisian Tarentola

clades are provided in Table 2.

Two of the mitochondrial clades occur sympatrically or

Group Nr:

“1 T. sp-complex-Libya

" 2T. deserti-Libya

° 3ST. sp-Tunisia

04 T. deserti-North Africa

C1 group center

parapatrically: 7: deserti (Libya) and ‘7. sp. complex’

(clade H) at Itwellia (western Libya), clades C and D along

the desert road Tobruk-Ajdabiya in Cyrenaica.

Bonn zoological Bulletin 57 (2): 267-274

Ulrich Joger & Ismail Bshaenia

Canonical discriminant function

Group Nr:

41 T. sp-complex-Libya

¥ 27. deserti-Libya

* 3 T. m. mauntanica-Morocco

4 * 47. m. mauritanica-Tunisia

* 5T. sp-Tunisia

* 6 T. m. meuritanica-Algeria

se 97 T, deserti-North Africa

. O group center

4 o *

a Pia o-

a o

Ps e)

N AGA Sola Bp:

< “a CT or °

i) » So aoe

Ss 4 a4 vattt 4

£ anwar 4 CI

s OED 3

ir Y » 245.5,

y A +o

a 4

T T T UT af

6 3 ° 3 6

Function 1

Canonical discriminant function

o 0

o oo

o° ia

o a

a v

Yah y ad

4” Ang

“ Nene? .

¢ mote ve 4

5 of * *4 eRe

r~ shige af A Fo a

° 3 % Set Y

c hes Oat ae a by

c A aN x “an As

™ 64% 7

Spe mag

3 a ON

+ Sr

T T T

4 3 ° 3 6

Function 1

Fig. 5. CDF plots of different populations of North African Za-

rentola, males (above) and females (below) plotted separately.

DISCUSSION

Parapatric or sympatric occurrence of mitochondrial clades

could be interpreted in different ways: either different bi-

ological species or co-existence of two mitochondrial dis-

tinct populations in a mixed interbreeding organismal pop-

ulation. In the case of 7! deserti in NW Libya, there is ev-

idence of the former explanation, as the molecular differ-

ences coincide with morphological differences.

©ZFMK

A new TJarentola endemic to Tunisia

Table 3. Variation of the Paratypes (part).

Variable Mean Minimum Maximum Standard deviation

Lamellae under 1st toe 10.27 9.00 12.00 0.80

Lamellae under 4 toe 15.27 14.00 17.00 0.96

Lamellae under 5‘ toe 19.67 18.00 21.00 heat

Ventral scales 34.33 28.00 38.00 Did

Supraorbital scales Sole) 5.00 6.00 0.46

Dorsal tubercles WATS 12.00 14.00 0.52

Gular scales 44.21 32.00 55.00 5.82

Interorbital scales S373 12.00 15.00 0.96

Head length 17.18 13.89 21.03 2.16

Head+body length 56.08 44.12 72.33 MOD

Infralabialia 793 7.00 9.00 0.70

Supralabialia Hol) 6.00 9.00 0.70

Relative hindleg length 0.49 0.45 0.51 0.02

Relative head width 0.70 0.62 0.82 0.05

Relative head length 0.31 0.29 0.32 0.01

Relative foreleg length 0.36 0.32 0.40 0.02

Relative ear-snout length 0.90 0.84 0.95 0.03

When a conservative two-species concept (7) mauritani-

ca —T. deserti) is applied, the mitochondrial tree unam-

biguously affiliates all sequenced Libyan OTUs with 7:

deserti, and not with 7) mauritanica. The mitochondrial

genetic distance between the central Tunisian Tarentola,

the Libyan clades and 7: deserti are lower than between

the Tunisian clade and 7. m. mauritanica. This supports

the view that despite some morphological similarity, the

Tunisian and Libyan-Egyptian clades are not subspecies

of 7. mauritanica.

Assigning these OTUs to 7: deserti would, however, cre-

ate a paraphyletic T. deserti, with T. neglecta and T. min-

diae — which are without doubt separate species — with-

in 7: deserti. The most parsimonious taxonomic solution

with regard to the cladogram is to subsume clades C, D,

E, G, and H under one separate species.

Morphological data indicate that several of the mitochon-

drially defined populations, in particular if they occur in

desert areas (Sabha in South Libya, Algerian and Tunisian

but not Libyan deserti, and also a subclade of clade D)

can be distinguished by larger size and higher scale counts.

These size-linked characters may be locally favoured by

Bonn zoological Bulletin 57 (2): 267-274

environmentally triggered selection. On the other hand,

morphological differences do not preclude genetic close-

ness, and genetically distant clades may share morpholog-

ical similarity.

In conclusion, the genetically studied Zarentola from

Libya and Egypt, as well as those from south central

Tunisian, should be assigned to 7! fascicularis (a former

subspecies of 7. mauritanica). Elevation of fascicularis to

species rank is largely consistent with data of Rato et al.

(2010), who distinguished two basal divisions in the sub-

genus Zarentola. One of these branches lead to T. deser-

ti and T. boehmei, another to 7: angustimentalis and T.

mauritanica from Europe, Morocco, Algeria and north-

ern Tunisia on one side, and to 7. (m.) fascicularis and

Tarentola from Lampedusa and Conigli Islands on the oth-

er side. Single individuals of ‘7. mauritanica’ from Alge-

ria and of ‘7: deserti’ from Morocco were loosely connect-

ed to the latter clade, but we do not know which taxa were

really represented by those samples. The Tunisian sam-

ples used by these authors clustered with 7? m. mauritan-

ica, but they were exclusively from northwestern Tunisia.

True 7. mauritanica exist in coastal areas of Tunisia and

western Libya.

OZFMK

Die, Ulrich Joger & Ismail Bshaenia

Males: 25 characters

13° 12

mare?

Factor 2: 19,24%

Factor 1: 24,69%

Females: 25 characters

Factor 2: 15,64

Factor 1: 20,77%

Fig. 6. PCA of Zarentola sp. (Tunisia), 7. m. fascicularis (Li-

bya), and different populations of 7 mauritanica. Males above,

females below.

In Tunisia, 7: deserti exists in the extreme south (south-

southeast of the Chott al Djerid) and a new subspecies of

7: fascicularis in south central Tunisia between the Chott

al Djerid and Djebel Bou Hedma. The description of this

new subspecies is presented below.

Description of a new subspecies of Tarentola fascicu-

laris

Tarentola fascicularis n. comb.

Gecko fascicularis Daudin, 1802

Tarentola mauritanica mauritanica, Loveridge 1947

(partim, non Linnaeus 1768)

Tarentola mauritanica fascicularis, Joger 1984

Terra typica (after designation of a neotype by Joger

[1984]): Ain Teyanah, 20 km south of Benghazi, Libya.

Bonn zoological Bulletin 57 (2): 267-274

Males: 25 characters

Factor 2: 16,79%

Factor 1: 24,15%

Females: 25 characters

Factor 2: 14,57%

- 0

Factor 1: 20,28%

Fig. 7. PCA of Zarentola deserti (Libyan populations), 7. sp.

(western population of 7. fascicularis, Libya) and T. sp. (Tuni-

sia). Males above, females below.

Tarentola fascicularis wolfgangi ssp. n.

Holotype. State Natural History Museum Braunschweig

(SNHM-BS) N 41980, male, collected 19 August 1998 by

Ulrich Joger (Fig. 9).

Terra typica. Bou Hedma National Park, Tunisia

(34.24°N, 9.23’E).

Paratypes. 33 specimens; SNHM-BS 39920-39930,

41981, Bou Hedma; HLMD 2105-2109, 2265-2271, 2363-

2366, Bou Hedma; HLMD 1238-1240, Djebel Orbata/El

Guettar; ZFMK 49525, 49526, Djebel Orbata: El Guettar.

Description of holotype. Measurements (mm). Head +

body 61.0, tail 71.4, head length 19.8, head width 14.7,

head height 10.8, interorbital width 8.4, distance snout-

ear 17.7; foreleg 23.9, hindleg 30.2, distance between fore-

leg and hindleg 25.1, 4* toe length 5.1, toe width 2.0, di-

ameter of eye 4.5.

©ZFMK

A new Zarentola endemic to Tunisia 27

(BL147 T so Tarhunah Libya

{BLISS Tgp Tajura Libye

U0 1BL207 T go Misratah Libya

nee 1BL185 T 90 Awellle Libya

Clade H

2OMV10692 T sp ElPerkat Libya

{BL072 T 3p Rass El Lia Libya

{BL089 Ee Genen Pa

lade G

“BOSE t= ai Hedina Tunisia

18051 Tsp Bou Hedmea Tunisie

18047 T sp Bou Hedma pene

181220 Tsp Ras Lanu Libya

0.88) 1BL219 Tsp Ras Lanuf Libya

0.57; /BL245 T gp Taknis Libya

oe Tsp Taknis el

1.00 184229 Tastm anne rr

1.00 1BL268 T sp Sidi Massod Litya

8EV8968 Tm fasicuctris Egypt

Clade C

2CMV10638 T sp GaberAan Oasis Libya

18055 Tnegbcta E/ Qued Agena

1.00 BEVEOY T mindiae pee

ila oak i ‘00 7014 T maureaaee Meke “ais

{8030 T maurkanica Maliorca

1.00 18021 Tmaurtanica Mallorca

1.00r 18004 Tangustimentalis Lanzarnte ade

esis 8003 T anqustimentatis Fuerteventura

BEV9007 Tannulens annularis Egypt

18018 T boettgen Gran Canana

18019 T boettgen Gran Canaria

18010 T.d.delalandii Tenerife

Clade B

Fig. 8. 50% majority-rule consensus tree obtained from Baye-

sian MCMC analysis, based on 1433 bp mtDNA sequences, de-

picting the relationships among haplotypes. Tarentola delalandii

designated as outgroup and Bayesian posterior probability va-

lues are given near branches.

Pholidosis. 36 longitudinal rows of ventral scales; 12 lon-

gitudinal rows of dorsal tubercles, bearing strong central

keel from which barely visible keels derive laterally; 13

lamellae under 1st toe, 15 lamellae under 4" toe, 20 lamel-

lae under 5'h toe; 15 interorbital scales, 6 supraorbital

scales; gular scales separated from mental by 3 scales, gu-

lar scale count 43; 10 supralabials, 7/8 infralabials; ros-

tral divided, touching nostril; nasal scales separated by one

scale proximally and one scale distally. Colour (in

ethanol) whitish, without any visible pattern.

Fig. 9. Holotype of Zarentola fascicularis wolfgangi ssp. n.

Bonn zoological Bulletin 57 (2): 267-274

Variability of paratypes. Colour (in ethanol) light or

medium grey dorsally, whitish ventrally. Most specimens

bear following pattern: dark line on side of head from eye

to above ear. Paired dark spots, followed posteriorly by

unpaired whitish spot (without clear margins) distributed

on mid-dorsum as follows: one in front of shoulder, one

behind shoulder, two on back, one on pelvic region, one

on base of tail, followed by 9-10 unpaired half-rings

around dorsal part of tail. Scale count variation is shown

in Table 3.

Diagnosis. A small subspecies of 7: fascicularis; maxi-

mum recorded bodythead length in males 72.3 mm, in fe-

males 57.5 mm (up to more than 100 mm in male 7! de-

serti, 81 mm in female 7: deserti; in eastern Libyan T. fas-

cicularis, 97 mm can be attained in males of the Ras Lanuf

population, yet only 79 mm in 7. fascicularis ssp. from

northwestern Libya).

Tail length usually clearly longer than body+head (index

bodythead/tail 0.77-1.00; mean 0.84, as opposed to 0.98

in 7. deserti, 0.96 in T. f. fascicularis, and 0.96 in T. m.

mauritanica). Snout (ear openings to mental) significant-

ly longer than in T. fascicularis and T. deserti subspecies

from Eastern Libya (about 90% of head length as opposed

to 60-70%).

Dorsal tubercles in 11—14 (most often 12) longitudinal

rows, most often simply keeled (multiply keeled in 7. f

fascicularis). 19-46 gular scales (45—59 gular scales in T.

d. deserti). Different from all other Tunisian or Libyan Zar-

entola (except T! neglecta group) by lower number of ven-

tral scales (34.3 +/- 2.7) and lower number of lamellae un-

derneath 1st and 4 toes (1st 10.3 +/- 0.8, 4th 15.3 +/- 1.0).

15—22 scale rows or lamellae underneath 5‘) toes (16-21

in 7. f. fascicularis, 2\—25 in T: deserti). Different from

Tunisian 7. mauritanica by lower number of interorbital

scales (13.7 +/- 1.0 versus 14.9 +/- 1.2); from Libyan 7.

mauritanica by lower number of sublabials (7.9 +/- 0.7

versus 8.7 +/- 0.7); from western Libyan subspecies of 7.

fascicularis by lower number of interorbital scales (13.7

+/- 1.0 versus 14.9 +/- 0.7). Rostral usually separated from

nostril by small scales (in 7! f fascicularis rostral usual-

ly in contact with nostril).

Dorsal colour in life similar to 7. deserti: rosy or yellow-

ish, with yellowish iris (grey in 7! m. mauritanica). Five

dark transverse bands across back, often reduced to paired

spots.

Distribution. Endemic to Central Tunisia; known from

Gafsa (Djebel Orbata) in the West to Bou Hedma in the

East, south to Degache and Tozeur at northern banks of

Chott al Djérid.

©OZFMK

274 Ulrich Joger & Ismail Bshaenia

Fig. 10. Terra typica of Tarentola fascicularis wolfgangi ssp. n., Djebel Bou Hedma, Tunisia.

Habitat. Bou Hedma National Park is famous for its relict

subtropical savanna with Acacia tortilis raddiana as the

dominating tree. The climate is semi-arid, with variable

amounts of rainfall (annual mean about 250 mm) in au-

tumn and winter. On the pediments of Djebel Bou Hed-

ma (Fig. 10) as well as on the slopes of the mountain

chains to the west and south of it, Zarentola fascicularis

wolfgangi ssp. n. is found in rock crevices, on walls and

underneath of road bridges; the geckos are active at night.

Derivatio nominis. The species is dedicated to Wolfgang

Bohme on the occasion of his retirement as the most suc-

cessful German curator of herpetology after Robert

Mertens. The senior author feels, however, also a strong

affinity to the other Wolfgang, Wolfgang Bischoff, who

retired this year, too. His field companionship in North

Africa will be ever remembered.

Acknowledgements. We thank Sherif Baha El] Din and Adel

Ibrahim for providing Egyptian specimens, Wolfgang Bischoff

for field companionship, Ulrich Willand for preliminary data,

Miguel Vences and Susanne Hauswaldt for providing laborato-

ry facilities.

Bonn zoological Bulletin 57 (2): 267-274

REFERENCES

Carranza S, Arnold E N, Mateo J A, Geniez M (2002) Relati-

onships and evolution of the North African geckos, Geckonia

and Tarentola. Mol. Phyl. Evol. 21: 244-256

Joger U (1984a) Morphologische und biochemisch-immunolo-

gische Untersuchungen zur Systematik und Evolution der Gat-

tung Zarentola (Reptilia: Gekkonidae). Zoologische Jahrbu-

cher (Anatomie) 112: 137-256

Joger U (1984b) Taxonomische Revision der Gattung Zarento-

la (Reptilia: Gekkonidae). Bonner zoologische Beitrage 35:

129-174

Joger U (2003) Reptiles and amphibians of southern Tunisia.

Kaupia 12: 71-88

Joger U, Bischoff W (1989): Erste Ergebnisse einer herpetolo-

gischen Forschungsreise nach Nordwest-A frika. Tier und Mu-

seum (Bonn) 1: 99-106

Joger U, Amann T, Lenk P, Willand U (1998) Molekulare Merk-

male und das phylogenetische Artkonzept. Zoologische Ab-

handlungen, Staatliches Museum fiir Tierkunde Dresden,

50/Suppl. ,,100 Jahre Artkonzepte in der Zoologie™: 109-123.

Rato V, Carranza S, Perera A, Carretero, M A & Harris D J (2010,

in press): Conflicting patterns of nucleotide diversity between

mtDNA and nDNA in the Moorish gecko, Tarentola mauri-

tanica. Mol. Phyl. Evol.

Willand U (1997) Revision der Untergattung Zarentola (Reptil-

ia: Sauria: Gekkonidae). Unpublished diploma thesis, Univer-

sity of Darmstadt

Received: 05.X.2010

Accepted: 01.XI.2010

©ZFMK

Bonn zoological Bulletin | Volume 57 Issue 2 pp. 275-280

Bonn, November 2010

A new species of the genus 7ropiocolotes from Central Saudi Arabia

(Reptilia: Sauria: Gekkonidae)

Thomas M. Wilms!;*, Mohammed Shobrak? & Philipp Wagner?

' Zoologischer Garten Frankfurt, Bernhard-Grzimek-Allee 1, D-60316 Frankfurt am Main, Germany;

E-Mail: thomas.wilms@stadt-frankfurt.de

? Biology Department, Science College, Taif University, P.O. Box 888, Taif, Saudi Arabia

3 Zoologisches Forschungsmuseum A. Koenig, Adenauerallee 160, D-53113 Bonn, Germany

“ corresponding author

Abstract. A new species of the genus 7ropiocolotes from central Saudi Arabia is described based on two specimens from

the Ath-Thumamah region. The new species is a member of the subgenus Zropiocolotes and belongs to the clade includ-

ing T. steudneri and T. nattereri.

Key words. Zropiocolotes sp. n., Ath-Thumama, Saudi Arabia.

INTRODUCTION

The genus 7ropiocolotes Peters, 1880 comprises a group

of small, nocturnal and ground dwelling geckos, rarely ex-

ceeding 35 mm snout-vent length. Biogeographically the

distribution of these geckos follows a Saharo-sindian pat-

tern, ranging from Morocco and Mauritania in the west

to western India (Sindaco & Jereméenco 2008; Agarwal

2009). About 13 nominal species are being distinguished

within the genus 7ropiocolotes, but in addition there are

published records of specimens which would possibly de-

serve specific recognition and which are not yet formal-

ly described (Arnold 1980; Kordges 1998; Anderson 1999;

Baha el Din 2001, 2006; Sindaco & Jereméenco 2008).

Beside this the species composition of the genus is under

debate since the taxa of the eastern part of the distribu-

tion area are assigned to Microgecko Nikolsky, 1907 and

Asiocolotes Golubev, 1984 on a generic or subgeneric lev-

el by some authors (Kluge 1983; Kuge 1991; Szcerbak &

Golubev 1996; Sindaco & Jereméenco 2008) while oth-

ers treat all of those taxa as belonging exclusively to the

genus Tropiocolotes (Anderson 1961, 1999). We prefer to

follow the more inclusive interpretation of 7ropiocolotes

and use the name in the broader sense encompassing al-

so the taxa of Iran, Afghanistan, Pakistan and India.

There have been uncertainties concerning the taxonomy

of some of the African and Arabian taxa within the genus,

like 7: tripolitanus algericus Loveridge, 1947, T: t. apok-

lomax Papenfuss, 1969, 7: steudneri (Peters, 1869) and

T. nattereri Steindachner, 1901 (Baha el Din 1994, 2001;

Werner 1998; Shifman et al. 1999). The main taxonomic

issues were related to the validity of certain taxa (e.g.,

Bonn zoological Bulletin 57 (2): 275-280

T. t. apoklomax; Baha E] Din 2001), the taxonomic rank

of certain taxa (e.g., 7) t. algericus which was assigned

specific rank based on a proven sympatric occurrence with

Tt. tripolitanus Peters, 1880; Baha El Din 2001), species

delimitation (e.g., between T. nattereri and T: steudneri,

Shifman et al. 1999; the type material of both species is

untraceable and therefore neotypes should be designated

and a thorough rediscription of both taxa prepared) and

to the existence of hitherto unknown species which were

discovered recently (7? nubicus Baha El Din 1999, T.

bisharicus Baha El Din 2001).

As already stated by Baha El Din (2001) the difficulty in

finding and studying these diminutive animals, combined

with their patchy geographical representation in scientif-

ic collections has led to a less than satisfactory taxonom-

ic evaluation to date.

The specimens described as a new species in the present

paper were collected in the Ath-Thumamah region in cen-

tral Saudi Arabia, approximately 90 km northeast of

Riyadh. According to Arnold (1986) the distribution of

Tropiocolotes in Saudi Arabia is confined to north-west-

ern Saudi Arabia, but already Tilbury (1988) recorded it

from the Riyadh area. Thus the first specimen from Ath-

Thumamah collected by Kordges was not the first pub-

lished record of the genus in central Arabia (contra Ko-

rdges 1998), but nevertheless the first record of the genus

from Ath-Thumamah (contra Cunningham 2010, who list-

ed Tropiocolotes as not yet confirmed for this area).

OZFMK

276 Thomas M. Wilms et al.

MATERIAL

106 specimens of the genus 7ropiocolotes from the col-

lections of the Zoologisches Forschungsmuseum A.

Koenig, Bonn (ZFMK), the Senckenberg Museum Frank-

furt (SMF), the California Academy of Science (CAS) and

the Natural History Museum Geneva (MHNG) belonging

to 7! algericus (n=14), T. depressus (n=3), T. helenae

(n=10), 7. nattereri (n= 14), T. persicus (n=12), T. scortec-

ci (n=4), 7. steudneri (n= 43), T. tripolitanus (n=4) and

the new taxon described herein (n=2) were examined. For

the species not available in the present study (7. bishari-

cus, T: latifi, T: levitoni, T. nubicus) morphological infor-

mation were taken from Leviton & Anderson (1972),

Szezerbak & Golubev (1996), Anderson (1999), Baha El

Din (1999, 2001).

The following characters were collected from 59 speci-

mens from Algeria, Egypt, Israel, Jordan and Saudi Ara-

bia (belonging to 7. nattereri, T. steudneri and the new tax-

on described herein): snout-vent-length, tail length (only

intact tails), number and size of postmental scales, num-

ber of interorbitals (transverse scales across the interor-

bital region at mid orbits, excluding palpebral folds), num-

Fig. 1. Holotype of Tropiocolotes wolfgangboehmei sp. n.

from Ath-Thumamah, Saudi Arabia (Fig. 1a: dorsal view, Fig.

lb: ventral view, Scale: 1mm interline distance).

Bonn zoological Bulletin 57 (2): 275-280

ber of upper and lower labials, number and characteris-

tics of keels on subdigital lamellae, number and identity

of scales bordering the nostril, number of scales around

midbody. Beside this, data on colouration and pattern was

collected. Additional data on morphological characters

were taken from Baha el Din (1999, 2001) and Shifman

et al. (1999). Measurements were taken with a digital cal-

liper to the nearest 0.1 mm.

Material examined

Tropiocolotes algericus: Algeria: SMF 8167, Algerian

Sahara; Mali: MHNG 2678.087, north of Bombax; Mo-

rocco: MHNG 1553.065-067, Tarfaya; MHNG 993.027,

Aouinet-Torkoz; SMF 73082-87, Goulimine; Western Sa-

hara: MHNG 1545.076, El-Aioun. Tropiocolotes depres-

sus: Pakistan: SMF 64490-92, east of Chiltan-Mountains,

Quetta. Tropiocolotes helenae: tran: MHNG 2627.011-

16, MHNG 2641.100, MHNG 2646.056-058, Mehkuyeh.

Tropiocolotes nattereri: Egypt: MHNG 2710.017-018,

Wadi Feran; SMF 8165, NW Sinai; ZFMK 70653-59, Ras

Mohammed; Israel: SMF 47112, Wadi el Hedhira, Cen-

tral Negev; Jordan: ZFMK 64673, Aqaba; Saudi Ara-

bia: CAS 148526, Hagl [29 18 N; 34.57 E]; CAS 148616,

Jabal as Sinfa [27 57 N; 35 47 E]. Tropiocolotes persi-

cus: Pakistan: SMF 63536-47, Hab Chauki. Tropio-

colotes_ scortecci: Yemen: MHNG 2428.065, Al

Mabraz, Wadi Zabid; MHNG 2428.065, MHNG 2553.041,

Mafraq-Mocca; MHNG 2581042, Sayhut. Tropiocolotes

steudneri: Algeria: CAS 138660-63, 3 km. East of

Tamanrasset; ZFMK 19853, 15 km S Terhenanet; ZFMK

33839, 90km S In Salah; Egypt: CAS 156660, Maadi-Wa-

di Gindali Rd. [29 59 N, 31 28 E]; MHNG 2710.019-020,

Oasis Kharga; SMF 22119, Kosseir; ZFMK 2359, ZFMK

64633, Luxor; ZFMK 20537, Cairo, Mokatana Hils;

ZFMK 64641, ZFMK 64643, 10 km NW Cairo; ZFMK

65477, Giza Abu Rawash; ZFMK 77765-67, between Beni

Suef u. Korimat; Sudan: CAS 174014, Assalaya Pump

Station 3; MHNG 1186.078-079, Tabo; ZFMK 33840-59,

Wadi Half; ZFMK 38429, Erkowit. Tropiocolotes tripoli-

tanus: Egypt: SMF 22472, Heliopolis; SMK 22473,

Cairo; Tunisia: MHNG 1335.04, Tozeur; SMF 8166,

Tunisian Sahara. Tropiocolotes sp. n.: Saudi Arabia:

ZFMK 43668, ZFMK 87120, Ath-Thumama.

Despite the overall similarity of the taxa involved and the

generally low level of character displacement, which is

typical for geckoes, it became clear, that the specimens

from central Saudi Arabia differ in several characters from

all known taxa in the genus 7ropiocolotes and will there-

fore be described as a new species.

OZFMK

A new species of the genus 7ropiocolotes from Central Saudi Arabia DTG

Fig. 2.

SPECIES DESCRIPTION

Tropiocolotes wolfgangboehmei sp. n.

Type material: Holotype, ZFMK 43668, Ath-Thumama,

Saudi Arabia, leg. T. Kordges, 1985; Paratype, ZFMK

87120, Ath-Thumama (25° 16’ N, 46° 37’ E), Saudi Ara-

bia, leg. T. Wilms, 09.05.2001, 10:30 hrs

Diagnosis. A small gecko with a maximum snout-vent-

length of 29.4 mm. The species possesses all diagnostic

characters of the genus Tropiocolotes (in the sense of

Kluge 1967) including digits slightly angularly bent, not

dilated, not fringed, not webbed, nor ornamented, covered

below with a single series of transverse lamellae, pupil ver-

tical, dorsal scales uniform, small, homogenous, imbricate

to subimbricate, preanal and femoral pores usually absent.

Tropiocolotes wolfgangboehmei sp. n. has two pairs of

postmental shields and therefore differs from T. latifi (no

postmentals), 7: helenae (one pair of postmentals) and 7.

depressus (no postmentals or only one pair of very small

postmentals). From 7 persicus it differs by having only

four scales in contact with the nostril instead of five.

It differs from T. algericus, T. tripolitanus, T. scorteccii,

T. somalicus and T. bisharicus by its smooth dorsal sca-

lation. 7. wolfgangboehmei sp. n. differs from 7: nattereri

by possessing clearly bi- or tricarinated subdigital scales

(versus smooth subdigital scales) and from T. steudneri

and 7. nubicus by having two pairs of postmental shields

of which the second is roughly a quarter of the size of the

first (both pairs of roughly equal size in 7: steudneri and

T. nubicus).

Bonn zoological Bulletin 57 (2): 275-280

Paratype of Tropiocolotes wolfgangboehmei sp. n. from Ath-Thumamah (25° 16’ N, 46° 37’ E), Saudi Arabia in life.

Description of the Holotype. An adult female with in-

tact tail. Body depressed. Snout-vent-length (SVL) 29.4

mm, Tail length 32.8 mm. Head narrow, 9.3 mm long

(about 31.6 % of SVL). Neck distinct. Right limb 10.8 mm

long. 5‘ digit of left manus lacking claw, all other digits

complete. Tail 1.12 times SVL, cylindrical tapering even-

ly to its tip.

Fig. 3.

Paratype of Tropiocolotes wolfgangboehmei sp. 0.

from Ath-Thumamah, Saudi Arabia (Fig. 3a: dorsal view, Fig.

3b: ventral view, Scale: 1 mm interline distance).

©ZFMK

278 Thomas M. Wilms et al.

Fig. 4. Habitat and Paratype locality of Tropiocolotes wolf-

gangboehmei sp. n. at Ath-Thumamah (25° 16’ N, 46° 37’ E),

Saudi Arabia.

Rostral 1.5 times as wide as high, divided partly by a me-

dian cleft. Nostril bordered by rostral, first upper labial

and two small postnasals, which are separated by two large

internasals. The internasals are followed by one pair of

subequal scales. Snout and upper surface of the head cov-

ered by hexagonal scales which are juxtaposed. Loreal re-

gion covered with slightly swollen scales, which are some-

what smaller than the remaining scales on the head. 16 in-

terorbitals, 10/10 upper labials, 8/8 lower labials. Occip-

italregion covered by juxtaposed scales slightly smaller

than the interorbitals, which become increasingly swollen

in the neck. Mental slightly wider than rostral, pentago-

nal in shape extending posteriorly not to the level of the

suture between first and second lower labials. One pair of

Tropiocolotes nattereri (SMF 47112), Wadi el Hedhi-

ra, Central Negev, Israel (Fig. 5a: dorsal view, Fig. 5b: ventral

view, Scale: 1mm interline distance).

Fig. 5.

Bonn zoological Bulletin 57 (2): 275-280

large postmentals, in contact with mental and the first two

lower labials. Second pair of postmentals only about one

fourth the size of the first postmentals, separated from each

other by four granular scales. The second pair of postmen-

tals is in contact with the second lower labials.

Body scalation homogenous, scales imbricate and smooth.

58 scales around midbody. Chest widely opened by an in-

cision. Dorsal sides of forelimbs covered with imbricate

scales, scales of ventral sides juxtaposed and slightly

swollen, somewhat smaller than scales on dorsal side of

forelimbs. Dorsal and ventral sides of hind limbs covered

with imbricate scales, which are almost equal in size. Pos-

terior surface of thigh with smaller granular scales. Sub-

digital lamellae strongly bi- or tricarinate. Lamellar for-

mula (digit 1 to 5) for left manus: 9, 12, 14, 13, 11.

Dorsal and ventral scales of the tail homogenous and im-

bricate. Scales at tail base not carinate, but becoming in-

creasingly so distally. Postanal sacs weakly developed

with two enlarged tubercular scales on either side. A pair

of slightly enlarged preanal scales present.

Measurements (in mm, from preserved specimen): Snout-

vent-length 29.4; tail length 32.8; head length 9.3; max-

imum head width 5.1; maximum head height 2.7; orbit di-

ameter 2.0; distance orbit — snouth 3.2; distance orbit —

ear 2.3; ear diameter 0.6.

Colouration of preserved specimen: The specimen 1s pre-

served in 70% ethanol and has almost completely lost his

coloration and pattern. Kordges (1998) depicted this spec-

imen in black and white, and its pattern resembles the

paratype almost exactly (in having six dark transverse

bands on the back and twelve on the tail, as well as hav-

ing exactly the same pattern of the head).

Description of the Paratype. Paratype similar in most re-

spects to holotype, except as noted. An adult male with

intact tail, which was broken during preservation near the

tail base. Body depressed. Snout-vent-length 27.3 mm, tail

length 31.1 mm. Head narrow, head length 8.2 mm (about

30 % of SVL). Neck distinct. Right limb 9.3 mm long.

All digits intact. Tail 1.13 times SVL, cylindrical taper-

ing evenly to its tip.

15 interorbitals, 10/10 upper labials, 7/8 lower labials. Sec-

ond pair of postmentals only about one fourth the size of

the first postmentals, separated from each other by three

granular scales. The second pair of postmentals is in full

contact with the second lower labials, and almost reach-

es the third labial on the left.

Body scalation homogenous, scales imbricate and smooth.

59 scales around midbody, 66 scales between a well

©OZFMK

A new species of the genus Tropiocolotes from Central Saudi Arabia 279

Fig. 6.

Tropiocolotes steudneri (ZFMK 33850), Wadi Halfa,

Sudan. (Fig. 6a: dorsal view, Fig. 6b: ventral view, Scale: 1mm

interline distance).

marked interruption between throat and chest and cloacal

slit. Dorsal sides of forelimbs covered with imbricate

scales, some of which show very slight carination, scales

of ventral sides juxtaposed and slightly swollen, somewhat

smaller than scales on dorsal side of forelimbs. Lamellar

formula (digit 1 to 5) for left manus: 9, 11, 15, 13, 10.

Measurements (in mm, from preserved specimen): Snout-

vent-length 27.3; tail length 31.1; head length 8.2; max-

imum head width 4.9; maximum head height 2.9; orbit di-

ameter 1.7; distance orbit — snouth 2.9; distance orbit —

ear 2.0; ear diameter 0.7.

Colour in life: Head light brown with a broad dark brown

band extending from the snout to just above the ear open-

ing. A narrow yellow line extending axially from the ros-

tral to the snout, up to the upper delimitation of the broad

dark brown band. Palpebral fold yellow. Labials and un-

derside of the head white. Dorsum light brown, with six

broad, dark brown transverse bands. Colouration between

those transverse bands yellowish brown. Ground colour

of dorsal sides of limbs light brown. Hind limbs scattered

with dark brown spots. Tail coloration light brown with

ten dark brown transverse bands. Ventral side without any

pattern, white.

Bonn zoological Bulletin 57 (2): 275-280

Derivatio nominis. This species is named after Prof. Dr.

Wolfgang Bohme in honour to his contributions to her-

petology during his 39 years as curator of herpetology at

the Zoological Research Museum A. Koenig, Bonn and

as the academic mentor of two of the authors of the pres-

ent paper.

Habitat. The holotype was found near a small village at

the border of the Ath-Thumamah area (Kordges 1998).

The paratype was found under a stone in a small canyon

within the Buwayb-Escarpment which is a cretaceous

coral reef consisting of sedimentary rock, mainly lime- and

sandstone.

DISCUSSION

Tropiocolotes wolfgangboehmei sp. n. is known only from

central Saudi Arabia. Because of the close proximity of

Ath-Thumamah to the city of Riyadh we consider the 7ro-

piocolotes recorded by Tilbury (1988) likely to be con-

specific with this new taxon. Based on the external mor-

phology 7. wolfgangboehmei sp. n. is a member of the

group consisting of 7) nattereri, T. steudneri and T: nubi-

cus and is most probably the sister taxon of 7. nattereri.

Biogeographically the distribution pattern of the Zropio-

colotes of north-eastern Africa and Arabia is quite puz-

zling, not the least because of the involvement of at least

two taxa which are not yet formally recognized (Guibé

1966, Arnold 1980, Anderson 1999). Due to the clarifi-

cation on the taxonomic identity of 7) nattereri and T.

steudneri (Werner 1998, Shifman et al. 1999) and the de-

scription in the present paper, it is clear, that actually three

nominal 7ropiocolotes species are known to occur on the

Fig. 7. Distribution of Arabian Tropiocolotes: & Tropiocolo-

tes nattereri from Saudi Arabia [upper &: CAS 148526, Hagl

(29° 18’ N; 34° 57’ E); lower A CAS 148616, Jabal as Sinfa (27°

57’ N; 35° 47° E)], @ Tropiocolotes wolfgangboehmei sp. n.,

@ Tropiocolotes spec. from Bandar-e-Lengeh (Anderson 1999),

Iran; Black areas: approx. Distribution of Tropiocolotes scortec-

ci, grey areas: approx. distribution of Tropiocolotes nattereri.

©ZFMK

280 Thomas M. Wilms et al.

Arabian Peninsula (7. nattereri, T. wolfgangboehmei sp.

n. and T. scortecci). T. nattereri is known from north-west-

ern Saudi Arabia and the adjacent areas in Jordan, Israel

and Egypt while 7: scortecci is an endemic species of

southern Arabia (Oman and Yemen). 7? wolfgangboehmei

sp. n. is the only species distributed in central Arabia some

800-1000 km away from the nearest Tropiocolotes local-

ities in north-western Saudi Arabia, Oman/Yemen and

Iran.

In the past, several authors (Tilbury 1988, Schneider 1990,

Baha El] Din 2006, Cunningham 2010) assigned the cen-

tral Arabian Tropiocolotes to T: steudneri or T. nattereri.

Two specimens from Bandar-e Lengeh on the coast of the

Arabian/Persian Gulf in Iran were also tentatively assigned

to T. steudneri (Guibé 1966, Anderson 1999). Based on

the current distribution of Tropiocolotes it would zoogeo-

graphically be extremely unlikely that the [ranian speci-

mens belong to either 7. steudneri or T nattereri. Based

on the morphological data given by Guibé (1966) and An-

derson (1999) and the photograph given by Anderson

(1999) we are sure that these animals do not belong to 7°

wolfgangboehmei sp. n. but to a new, as yet undescribed

taxon. Baha El Din (2001) suggested the investigation of

the relationship of those Iranian specimens to two Tropi-

ocolotes from eastern Dhofar, Oman, which were tenta-

tively assigned to 7. scortecci by Arnold (1980) despite

notable differences from T. scortecci specimens from fur-

ther west in Dhofar and from the type locality of this tax-

on in Hadramaut, Yemen. The taxonomy of the genus Tro-

piocolotes, especially in Arabia, is still in need of a thor-

ough revision, not only to clarify the species composition

within the genus but also to gain more data on the distri-

bution of the respective taxa and to establish a hypothe-

sis on their phylogenetic relationships.

Acknowledgements. We thank H.H. Prince Bandar ibn Saud

(Director General, Saudi Wildlife Commission, Riyadh) for the

support and continuous interest in our herpetological studies in

Saudi Arabia. The study would not have been possible without

the help of many colleagues of which we would like to thank

H.E. Prof. Dr. A. H. Abuzinada (former Director General, NCW-

CD, Riyadh), Prof. Dr. I. Nader (Former Director of KK WRC,

Thumama), and Dr. I. Galal (Riyadh). For the loan of important

material we thank Prof. Dr. W. Bohme (ZFMK, Bonn), Dr. A.

Schmitz (MHNG, Geneva), J. Vindum (CAS, San Francisco) and

Dr. G. Kohler (SMF, Frankfurt).

REFERENCES

Agarwal I. (2009) First record of Tropiocolotes persicus euphor-

biacola Minton, Anderson and Anderson 1970 (Sauria:

Gekkonidae) from the Republic of India, with notes on its

habitat and natural history. Russian Journal of Herpetology 16

(2): 83-87

Anderson SC (1961) A note on the synonymy of Microgecko

Nikolsky with Zropiocolotes Peters. Wassmann Journal of Bi-

ology 19 (2): 287-289

Bonn zoological Bulletin 57 (2): 275-280

Anderson SC (1999) The lizards of Iran. Society for the Study

of Amphibians and Reptiles, Ithaca, 442 pp.

Arnold EN (1980): The reptiles and amphibians of Dhofar,

Southern Arabia. Journal of Oman Studies, Special Report 2:

273-332

Arnold EN (1986) A key and annotated check list to the lizards

and amphisbaenians of Arabia. Fauna of Saudi Arabia 8:

385-435

Baha el Din S (1994) A contribution to the herpetology of Sinai.

British Herpetological Society Bulletin 48: 18—27

Baha el Din S (1999) A new species of Tropiocolotes (Reptilia:

Gekkonidae) from Egypt. Zoology in the Middle East 19:

17-26

Baha el Din S (2001) A synopsis of African and south Arabian

geckos of the genus Tropiocolotes (Reptilia: Gekkonidae) with

a description of a new species from Egypt. Zoology in the

Middle East 22: 45—56

Baha el Din S (2006): A Guide to the Reptiles and Amphibians

of Egypt. The American University in Cairo Press, Cairo, 359

Pp.

Cunningham PL (2010) Checklist of terrestrial reptiles in three

protected areas in the Kingdom of Saudi Arabia. Herpetolo-

gical Review 41 (1): 25-28

Guibé J (1966) Reptiles et amphibiens récoltes par la Mission

Franco-Iranienne. Bulletin du Muséum Natinal d’ Histoire Na-

turelle 38 (2): 97-98

Kluge AG (1967) Higher taxonomic categories of gekkonid

lizards and their evolution. Bulletin of the American Muse-

um of Natural History 135 (1): 1-59

Kluge AG (1983) Cladistic relationships among gekkonid lizards.

Copeia 1983 (2): 465-475

Kluge AG (1991) Checklist of gekkonid lizards. Smithsonian

Herpetological Information Service (85): 1-35

Kordges T (1998) Die Reptilienfauna des Thumama Nature Park

bei Riyadh, Saudi Arabien. Faunistische Abhandlungen

Staatliches Museum ftir Tierkunde Dresden, Band 21/Suppl.

Contribution to a “Herpetologia Arabica” Nr. 7: 67—83

Leviton A, Anderson SC (1972) Description of a new species

of Tropiocolotes (Reptilia: Gekkonidae) with a revised key to

the genus. Occasional Papers of the California Academy of

Sciences 96:1—7

Schneider B (1990) Verbreitung, Unterartgliederung, Okologie

und Schuppenmorphologie der Gekkoniden—Gattung Tropi-

ocolotes aus dem Bereich der Sahara. Mitteilungen Pollichia

77: 409-419

Shifman S, Shacham B, Werner Y (1999): Tropiocolotes nattereri

(Reptilia: Gekkonidae): comments on validity, variation and

distribution. Zoology in the Middle East 17: 51-66

Sindaco R, Jereméenco K (2008) The Reptiles of the Western

Palearctic. Monografie della Societas Herpetologica Italica 1,

Latina, 579 pp.

Szcerback N, Golubev M (1996) Gecko fauna of the USSR and

contiguous regions. Society for the Study of Amphibians and

Reptiles, St. Louis, [IX + 233 pp.

Tilbury C (1988) An annotated checklist of some of the com-

moner reptiles occurring around Riyadh, Kingdom of Saudi

Arabia. African Journal of Herpetology 34: 25-34

Werner Y (1998) The desert herpetofauna in and near Israel: a

personal review of advances (1986-1997), with new data (Am-

phibia; Reptilia). Faunistische Abhandlungen Staatliches

Museum fiir Tierkunde Dresden, Band 21/Suppl. Contributi-

on to a “Herpetologia Arabica” Nr. 14: 149-161

Received: 15.IX.2010

Accepted: 10.X.2010

©ZFMK

Bonn zoological Bulletin Volume 57 Issue 2 pp. 281-288 Bonn, November 2010

Description of a new subspecies of

Kinyongia uthmoelleri (Miller, 1938) (Squamata: Chamaeleonidae)

with notes on its captive propagation

Nicola Lutzmann!, Jan Stipala?, Ralph Lademann}, Patrick Krause+, Thomas Wilms’ & Andreas Schmitz®

'Seitzstrasse 19, D-69120 Heidelberg, Germany, langstrasse@web.de, phone: +4962217298625

2Centre for Ecology and Conservation, University of Exeter, Tremough Campus, Penryn, Cornwall,

TR10 9EZ, England, janstipala@hotmail.com

3Muhlgasse 30, D-71034 Boblingen, Germany, ralph.lademann@web.de

4Lisztstrasse 3, D-53115 Bonn, drpkrause@web.de; 5Zoologischer Garten Frankfurt,

Bernhard-Grzimek-Allee 1, D-60316 Frankfurt am Main, Germany, thomas.wilms@stadt-frankfurt.de

6Department of Herpetology and Ichthyology, Muséum d’histoire naturelle, | route de Malagnou,

CH-1208 Geneva, Switzerland, andreas.schmitz@ville-ge.ch

Abstract. A new population of Kinyvongia uthmoelleri was found in the South Pare Mountains in Tanzania in 2000 by J.

Mariaux of the Natural History Museum of Geneva (MHNG). The morphology of this population corresponds well with

that of other previously known populations of K. uthmoelleri from Mt. Hanang and the Ngorongoro crater highlands.

Specimens from South Pare and Ngorongoro are morphologically very similar and show some distinctive characters which

are divergent from the holotype of K. uthmoelleri and other specimens from Mt. Hanang: smaller size, smooth squama-

tion on head and body, smooth head crests, clearly bi-forked parietal crest (only in males), parietal crest composed of

only a single row of scales, a relatively narrower and longer head and no sexual dimorphism in the tail length. K. uth-

moelleri is known from only few museum specimens but these morphological differences and geographic isolation jus-

tify describing the Ngorongoro and South Pare populations as a new subspecific taxon: Kinyongia uthmoelleri artytor

noy. ssp. The new subspecies has been successfully kept and bred in captivity by one author, and a short description is

given of its captive maintenance.

Key words. Kinyongia uthmoelleri, new subspecies, South Pare Mountains, captive propagation.

INTRODUCTION

Despite several recently described Kinyongia taxa from

East Africa (Menegon et al. 2009; Necas 2009; Necas et

al. 2009) the diversity within this genus has not yet been

completely uncovered. Several publications covering ma-

terial from the Eastern Arc Range have contributed to

knowledge on the systematics and taxonomy of these

chameleons (Mariaux et al. 2008; Tilbury et al. 2006). The

type material of the taxon described in the present paper

was collected in 2000 and was at that time deposited un-

der the name “Bradypodion tavetanum” in the Muséum

histoire naturelle (MHNG) in Geneva.

Kinyongia uthmoelleri was described by Miiller (1938) as

Chamaeleo uthmélleri on the basis of a single specimen

from Mt. Hanang. This specimen was collected at 2300

m asl in montane forest. In Loveridge’s (1957) check list

of East African reptiles and amphibians he designated wth-

moelleri as a subspecies of Ch. fischeri, a two-horned

Bonn zoological Bulletin 57 (2): 281-288

species. Mertens (1966) followed this classification, de-

spite the fact that he treated it as a full species in an ear-

lier publication after discovering the second specimen

known to science in the Staatliches Museum fir

Naturkunde Stuttgart (SMNS) (Mertens 1955). On the ba-

sis of lung and hemipenial morphology Klaver & BOhme

(1986) recognized uthmoelleri as a full species and includ-

ed it in the genus Bradypodion. Bo6hme & Klaver (1990)

discovered a third specimen, the first recorded female of

this species, in the Royal Museum for Central Africa in

Tervuren (MRAC). The above mentioned second and the

third specimens were collected from the locality of Old-

eani in the Ngorongoro crater highlands, a massif sever-

al hundred kilometres north of the type locality on Mt.

Hanang. Price (1996) also mentions statements from lo-

cal people about locations between Babati and Singida (a

road that passes close to Mt. Hanang) and 72 km north-

east of Mt. Hanang but up til now the presence of K. uth-

©ZFMK

282 Nicola Lutzmann et al.

Head view of the holotype of K. u. uthmoelleri (pho-

Fig. 1.

to: G. Vogel).

moelleri at these locations have not been confirmed. Re-

cently the taxon uthmoelleri was placed with all other east

African Bradypodion in a new genus, Kinyongia (Tilbury

et al. 2006). In the last 15 years only two authors have pub-

lished details on the captive husbandry and breeding of

K. uthmoelleri, specimens collected from the Ngorongoro

crater highlands (Price 1996; Necas & Nagy 2009).

Around the year 2000, specimens of “Bradypodion uth-

moelleri” appeared in the international pet trade. These

animals were very small in overall size, more slender and

with smoother scalation than K. uthmoelleri specimens

from Mt. Hanang. Even after six years of keeping some

of these specimens in captivity these distinct characters

have not changed and so ontogenetic change in these char-

acters can be ruled out. Unfortunately, the geographic ori-

gin of these specimens was not known until four similar

specimens were discovered in the collection of the

Muséum d’histoire naturelle in Geneva in 2004, which

suggests they originate from the same locality, the South

Pare Mountains, and belong to the new subspecies de-

scribed in this paper.

MATERIAL AND METHODS

In total 20 specimens of K. uthmoelleri of both subspecies

with a confirmed collection locality were located in mu-

seum collections and investigated: 8 from Mt. Hanang (5

males [ZSM 1/1948 (Holotype), ZFMK 74955, ZFMK

82188 and ZFMK 82189], 3 females [ZFMK74953,

ZFMK 74954 and ZFMK 82191] and one subadult

[ZFMK 82190]), 8 from the Ngorongoro crater highland

area [1 male (SMNS 324), 2 females (ZFMK 58664 and

ZFMK 58665), 1 subadult (MRAC R.G. 21852), 4 em-

bryos (ZFMK 58666-69] and 4 from the South Pare

Mountains [2 males (MHNG 2612.65 and MHNG

2612.66), 1 female (MHNG 2612.67), 1 juvenile (MHNG

2612.64)]. It seems probable that the embryos in the

Bonn zoological Bulletin 57 (2): 281-288

ZFMK collection are the unhatched specimens reported

by Price (1996).

Head-body length (HBL), tail length (TL), total length

(ToL), head length (HL) and head width (HW) were meas-

ured in all specimens except in the embryos. The data of

MRAC R.G. 21852 were taken from Bohme & Klaver

(1990). The ratio of HL to HW and the percentages of HL

to HBL, TL to ToL and TL to HBL were calculated. In

addition, we recorded head crest morphology following

Necas (1994), and the morphology and pattern of body

scalation.

RESULTS

All measurements and investigated morphological char-

acters of the specimens are listed in Tables 1-3. The mor-

phological traits which differentiate the male specimens

of Mt. Hanang from those of the South Pare Mountains

and Ngorongoro crater highlands are: higher measure-

ments, a relatively broader and shorter head, rougher

(more convex) scalation on the head and body, canthus

parietalis (cp) not bi-forked anteriorly but fan-shaped an-

teriorly and the cp composed of two rows of scales (Fig.

Fig. 2.

gel).

Type material of K. u. artytor ssp. n. (photo: G. Vo-

©ZFMK

New subspecies of Kinyongia uthmoelleri

Table 1. Morphological measurements of K. wthmoelleri in mm.

remark

specimen locality sex HBL ToL HW HL

ZFMK 74955 Mt. Hanang m 90.1 Py PARE [Sal 26.6

ZFMK 82188 Mt. Hanang m 85.2 119.6 204.6 15.8 26.0

ZFMK 82189 Mt. Hanang m 92.8 WAST PASS) 16.4 30.0

ZFMK 82190 Mt. Hanang m 69.9 93.1 163.0 12.0 22.7 subadult

ZSM 1/1948 Mt. Hanang m 93.0 134.0 227.0 16.0 32.0 holotype of

K. u. uthmoelleri

SMNS 324 Ngorongoro area m 83.0 116.0 199.0 13.0 31.0

MHNG 2612.64 South Pare Mountains m 40.0 46.0 86.0 6.5 13.5 juvenile; paratype of

K. u. artytor ssp. n.

MHNG 2612.65 South Pare Mountains m 80.0 100.0 = 180.0 13.0 31.0 holotype of

K. u. artytor ssp. n.

MHNG 2612.66 South Pare Mountains m 67.0 86.0 153.0 10.0 24.0 paratype of

K. u. artytor ssp. n.

ZFMK 74953 Mt. Hanang f 86.1 95.3 181.4 13.2 20.2

ZFMK 74954 Mt. Hanang f 82.0 91.5 173.5 13%5 24.1

ZFMK 82191 Mt. Hanang if 78.5 82.9 161.4 12.9 ZS

ZFMK 58664 Ngorongoro area f 78.6 95.1 Sid) 11.4 21.1

ZFMK 58665 Ngorongoro area ie 76.1 92.2 168.3 1222 21.0

MRAC R.G.21852 Ngorongoro area f 54.0 61.0 115.0 8.0 19.0 — subadult

MHNG 2612.067 South Pare Mountains f 70.0 81.0 151.0 10.0 21.0 paratype of

K. u. artytor ssp. n.

1). The females show the same differences between both

populations except that the females from the Mt. Hanang

population show also a fan-shaped cp anteriorly, instead

of no furcation at all in the females from the South Pare

Mountains and Ngorongoro highlands. Additionally, the

Mt. Hanang specimens are sexually dimorphic in tail

length relative to body length (males having relatively

longer tails than females), whereas relative tail length be-

tween the sexes of specimens from the South Pare Moun-

tains and Ngorongoro highlands specimens is more or less

the same. Based on these key characters that differentiate

the two groups, we describe the populations from the

South Pare Mountains and the Ngorongoro crater high-

lands as a new subspecific taxon.

Fig. 3.

Holotype of K. u. artytor ssp. n. (photo: N. Lutzmann).

Bonn zoological Bulletin 57 (2): 281-288

Kinyongia uthmoelleri artytor ssp. n.

We chose the syntopic specimens collected by J. Mariaux

& C. Vaucher in the South Pare Mountains during their

journey in 2000 as the type specimens (Fig. 2).

Diagnosis. A small chameleon, which differs from the

nominate form on Mt. Hanang in the following charac-

ters: less convex scalation on body and head, smooth head

crests, parietal crest distinctly bi-forked anteriorly, the

ridge of the parietal crest contains only one scale row, a

higher ratio of HL to HW and HL to HBL (relatively

longer and narrower heads), smaller total length

[153.0-199.0 mm in males (204.6—227.0 mm in K. u. uth-

moelleri) and 151.0—-173.7 mm in females (161.4—181.4

mm in K. u. uthmoelleri)| and no sexual dimorphism in

the relative tail length.

Description of the Holotype (Figs 3-5). MNHG 2612.65,

adult male, 1840 m asl, South Pare Mountains, North Tan-

zania, leg. J. Mariaux & C. Vaucher, 29. 09. 2000. HBL

80.0 mm, TL 100.0 mm, ToL 180.0 mm, HL 31.0 mm,

HW 13.0 mm, the belly is cut and the intestine removed,

both hemipenes are partly everted, length of lower jaw

21.0 mm, distance from front edge of eye to nostril 9.8

mm, distance from nostril to snout tip 5.4 mm, distance

from lower jaw to the tip of casque 7.5 mm, head width

between eyes 6.5 mm, canthus temporalis from eye to an-

gle 7.7 mm, canthus parietalis (cp) is bi-forked anterior-

ly (Fig. 5), distance from bifurcation of cp to the top of

©ZFMK

284

Nicola Lutzmann et al.

Table 2. Ratios of morphological measurements of K. uthmoelleri.

specimen location sex HL/HW HLas% HBL TLas % ToL TL as % HBL

ZFMK 74955 Mt. Hanang m 1.76 29.52 57.68 136.29

ZFMK 82188 Mt. Hanang m 1.65 30.52 58.46 140.38

ZFMK 82189 Mt. Hanang m 1.83 32.33 S53 135.45

ZFMK 82190 Mt. Hanang m 1.90 32.47 57.12 133.19

ZSM 1/1948 Mt. Hanang m 2.00 34.41 59.03 144.09

SMNS 324 Ngorongoro area m 2.38 37.35 58.29 139.76

MHNG 2612.064 South Pare Mountains m 2.08 33.75 53.49 115.00

MHNG 2612.065 South Pare Mountains m 2.38 38.75 55.56 125.00

MHNG 2612.066 South Pare Mountains m 2.40 35.82 56.21 128.36

ZFMK 74953 Mt. Hanang f 1.53 23.46 52.54 110.69

ZFMK 74954 Mt. Hanang f 1.79 29:39 52.74 111.59

ZFMK 82191 Mt. Hanang f 1.65 27.13 51.36 105.61

ZFMK 58664 Ngorongoro area f 1.85 26.84 54.75 120.99

ZFMK 58665 Ngorongoro area fe a2 27.60 54.78 121.16

MRAC R.G.21852 | Ngorongoro area f 2.38 35.19 53.04 112.96

MHNG 2612.067 South Pare Mountains f P| 30.00 53.64 Seyi

casque 13.1 mm, length of bifurcation of cp 4.4 mm, max-

imum width of bifurcation of cp 4.3 mm, one conical scale

in the neck smaller than 2.0 mm, no ventral or tail crests,

collection and field number (TZ-141) are tied around the

left hind leg. The scales on the head, the head crests and

the body are flat. Only the ridge of the cp is pronounced

though not denticulate. Fig. 6 shows the colouration of the

holotype in life.

Variation on the paratypes (MNHG 2612.64, 2612.66-

67). All measurements of the paratypes and the other spec-

imens of K. wu. artytor ssp. n. are shown in Tables 1-2.

MNHG 2612.64 is a juvenile male, the belly is cut and

the intestines are removed, the colouration after preser-

vation is very dark, collection and field number (TZ-138)

is tied around the right hind leg. MNHG 2612.66 is an

adult male and fits quite well with the description of the

holotype: belly is cut but the intestines are still present, 2

conical scales in the neck, collection and field number

Fig. 4. Portrait of the holotype of K. u.

(photo: N. Lutzmann).

artytor ssp. Nn.

Bonn zoological Bulletin 57 (2): 281-288

(TZ-143) are tied around the right hind leg. The original

colouration is better preserved: head is greyish, red radi-

ations on the eyes, which continue darker on the head

sides, the interstitial skin is red around throat and neck,

the lateral stripe is greyish on dark background, the tail

is greyish. MNHG 2612.67 (Fig. 7) is an adult female with

a flat casque, cut belly without intestines and one conical

scale in the neck. Collection and field number (TZ-144)

are tied around the left hind leg, the colouration after

preservation is very dark with only some greyish flat scales

on the head and body.

Distribution. K. wu. artytor ssp. n. is know only from the

South Pare Mountains and the Ngorongoro crater high-

lands (Fig. 8).

Etymology. The subspecies name “‘artytor” 1s the latinised

substantive of the Greek verb “aptuetv" (artyein), which

can be translated as “to prepare / to make ready requiring

skills”. We name this new subspecies in honour and trib-

ute to Prof. Dr. Wolfgang Bohme and his skills to prepare

dozens of students on their way to scientific careers, which

was also the case for four of the authors of this publica-

tion.

Captive maintenance. All specimens were kept individ-

ually in full gauze terrariums indoor and outdoor in the

same cages in order to minimize the stress of relocation.

The size of the terrartums were for females 50x50x80 cm

and for males 45x50x70 cm (length x width x height). All

specimens were kept outdoor from spring to autumn, if

the temperatures did not fall consistently below 10 °C at

night time. The highest recorded temperature was 35 °C

at noon, the lowest 5 °C at night time. The cages were ex-

posed to the sun in the morning and fell into shade around

©ZFMK

New subspecies of Kinyongia uthmoelleri

Table 3. Morphological characters of K. uthmoelleri.

head scalation

No. scale rows

specimen location SeX body scalation —_bi-forked cp

on the ridge of cp

ZFMK 74955 Mt. Hanang m rough rough no 2

ZFMK 82188 Mt. Hanang m rough rough no 2

ZFMK 82189 Mt. Hanang m rough rough no 2

ZFMK 82190 Mt. Hanang m rough rough no 1-2

ZSM 1/1948 Mt. Hanang m rough rough no 2

SMNS 324 Ngorongoro area m flat flat yes l

MHNG 2612.065 South Pare Mountains m flat flat yes ]

MHNG 2612.066 South Pare Mountains m flat flat yes

ZFMK 74953 Mt. Hanang tg rough rough no 7

ZFMK 74954 Mt. Hanang f rough rough no 2

ZFMK 82191 Mt. Hanang f rough rough no 2

ZFMK 58664 Ngorongoro area f flat flat = |

ZFMK 58665 Ngorongoro area f flat flat = 1

MRAC R.G.21852 Ngorongoro area f flat flat ? ?

MHNG 2612.067 South Pare Mountains =f flat flat - l

noon. In spring and autumn the cages were sprinkled with

water four times per day (in midsummer 6 times) for up

to four minutes in the hottest time of the day. During the

winter the terrariums were illuminated with common ter-

rarium-tubes (T5 with 35 W) 13 hours per day. A halo-

gen spot was activated for 45 minutes three times per day

for basking, so that the ambient temperature stayed be-

tween 22 and 24 °C at day time and between 6 and 16 °C

at night time. The terrariums were completely sprinkled

with water in the morning and evening. The diet consist-

ed of small arthropods, mainly self-bred crickets,

grasshoppers, flies, cockroaches etc. Every second feed-

ing the food was enriched with vitamins and minerals. On-

ly pregnant females were additionally given small pieces

of cuttlebone. To trigger mating behaviour, the males were

transferred into the cages of the females. Immediately, the

males started head bobbing and displayed bright colours.

Fig.5. Head view of the holotype of K. wu. artytor ssp. n.

(photo: N. Lutzmann).

Bonn zoological Builetin 57 (2): 281-288

In all cases the females displayed a colouration of green-

ish-white with small black dots, whereon the males

stopped courtship. Matings have not be observed until

now, but after several days the females started gaining

weight and became visibly rounder. The males were sub-

sequently removed, because it seemed that the females on-

ly lay their eggs if there were no males in their vicinity.

Older females laid their clutches without test excavations,

younger females with test excavations at a depth of 5 to

7 cm into the terrartum substrate. The clutches consisted

of 7 to 12 eggs. The dimensions of the eggs were approx-

imately 8.0x4.0 mm. The eggs were incubated in com-

pletely closed, small plastic boxes in wet vermiculite. Af-

ter approximately 115 days at 19-21 °C during the day

and 15-18 °C at night, the temperatures were increased

to 22 °C during the day and 20 °C at night. At this time

the humidity of the vermiculite was also increased to sim-

ulate the beginning of a rainy season. Hatching started af-

ter 147 to 161 days. After the hatchlings opened the egg

shells, they occasionally paused for up to 3 days to resorb

the yolk. The young chameleons were kept individually

in smaller cages 25x25x40 cm under the same conditions

as the adults. It should be taken into account that the tem-

perature changes should not be as pronounced for the ju-

veniles as for the adults, because it seems that they are un-

able to thermoregulate effectively. The maximum record-

ed lifespan in captivity for this species is six years (Fig.

9).

DISCUSSION

The genus Kinyongia contains currently 17 species, all of

which are restricted to moist montane forests in the East

and Central African highlands. Recently several new

©ZFMK

286 Nicola Lutzmann et al.

Fig. 6.

species have been described from montane forests in

Kenya and Tanzania (Menegon et al. 2009, Necas 2009,

Necas et al. 2009) and several subspecies have also been

raised to species status based on genetic divergence and

detailed morphological studies (Mariaux et al. 2008). No

doubt more species remain to be discovered in the still

poorly surveyed mountain ranges across East Africa. The

discovery of K. uthmoelleri in the South Pare Mountains

also shows that species’ distribution ranges are not well

documented and it is quite likely that K. uwthmoelleri also

occurs on other massifs in-between these now known pop-

ulations, such as Mt. Kilimanjaro and Mt. Meru (Fig. 8).

K. uthmoelleri has a similar distribution to the Trioceros

sternfeldi species complex, including the recently de-

scribed 7. hanangensis (Krause & B6hme 2010). Although

the phylogeography of all 7: sternfeldi populations has not

been investigated, the Mt. Hanang population has been

identified as a divergent sister clade to the Mt. Meru/ Kil-

imanjaro populations. A similar pattern is found in K. uth-

moelleri, the Mt. Hanang populations morphologically di-

Fig. 7.

(photo: J. Mariaux).

Female paratype of K. u. artytor ssp. n. in life

Bonn zoological Bulletin 57 (2): 281-288

Holotype of K. u. artytor ssp. n. in life (photo: J. Mariaux).

vergent from the Ngorongoro/ Pare populations, suggest-

ing that despite its geographically intermediate position,

Mt. Hanang populations have been isolated for a longer

period of time. Volcanic activity in the North of Tanza-

nia, which created these massifs, persisted from

Oligocene (37 myr ago) to the Quaternary. Subsequent

colonisation and population fragmentation of chameleon

populations on these massifs has resulted in their diver-

sification into a number of morphologically similar but

clear divergent (sub-) species.

The rarity of some species of the genus Kinyongia in mu-

seum collections is explainable because they inhabit the

rainforest canopy and their cryptic morphology and be-

haviour (Necas & Nagy 2009). Unfortunately Kinyongia

uthmoelleri is one of the rarest chameleons of East Africa

in museum collections, although Price (1996) mentioned,

that this species is common in the Ngorongoro crater high-

lands. But during eight days of fieldwork he also found

only five specimens. In total, there are only 20 specimens

in museum collections in Europe from three different lo-

calities and more intensive fieldwork is required to bring

to light if this reflects the real situation of population den-

sities, distribution and ecology of this species in the wild.

Further collections will also confirm if the morphologi-

cal variation recorded here, from the relatively few spec-

imens available, is consistent within and between the three

populations.

Nevertheless, there are pronounced morphological differ-

ences between the Ngorongoro and South Pare specimens

and the specimens from the type locality on Mt. Hanang

(Miller 1938). These are sufficiently distinct to justify

their description as a new taxon. This is similar to the sit-

uation where K. boehmei was originally described as a

subspecies of K. tavetana (Lutzmann & Necas 2002) and

later elevated in to full species rank based on genetic di-

vergence from all other two-horned chameleons (Mariaux

OZFMK

New subspecies of Kinvongia uthmoelleri 287

Ngorongoro crater ad

highlands #®

a Mt. Hanang

160 Kilometers

Fig. 8.

and Ngorongoro crater highlands)].

et al. 2008). Molecular studies have revealed numerous

cryptic species among East African chameleons (Matthee

et al. 2004; Tilbury & Mariaux 2006; Mariaux et al. 2008,

Krause & Bohme 2010) and follow-up studies using mo-

lecular data should provide a better insight into the evo-

lutionary relationships and genetic divergence that exists

between the three isolated populations of K. uthmoelleri,

some of which may justify species status.

Acknowledgements. We specially want to thank Jean Mariaux,

Geneva, for providing us the with type material, information on

the type locality and pictures of this new taxon. Thanks also to

the colleagues providing acces to collection and material: Wolf-

gang Bohme and Ulla Bott (ZFMK), Frank Glaw (ZSM), An-

dreas Schliiter and Axel Kwet (SMNS).

REFERENCES

Bohme W, Klaver C (1990) Zur Kenntnis von Bradypodion uth-

moelleri (Miller, 1938). Salamandra 26 (4): 260-266

Klaver C, Bohme W (1986) Phylogeny and classification of the

Chamaeleonidae (Sauria) with special reference to hemipenis

morphology. Bonn. Zool. Monogr. 22: 5—60

Bonn zoological Bulletin 57 (2): 281-288

TANZANIA

Mt. Kilimanjaro

are Mountains

Elevation (metres ak

| 0- 1000

[_] 1000 - 1500

[=>] 1500 - 2000

(5)} 2000 - 2500

(i) 2500 - 3000

ls) 3000 - 6000

Collecting localities of K. uthmoelleri |K. u. uthmoelleri (Mt. Hanang); K. u. artytor ssp. nov. (South Pare Mountains

Krause P, Bohme W (2010) A new chameleon of the 7rioceros

bitaeniatus complex from Mt. Hanang, Tanzania, East Africa

(Squamata: Chamaelonidae). Bonn. Zool. B. 57(1): 19-29

Loveridge A (1957) Check list of the reptiles and amphibians

of East Africa (Uganda, Kenya, Tanganyika, Zanzibar). Bull.

Mus. Comp. Zool. 117: 153-362

Lutzmann N, Necas P (2002) Zum Status von Bradypodion tave-

tanum (Steindachner,1891) aus den Taita Hills, Kenia, mit

Beschreibung einer neuen Unterart (Reptilia: Sauria:

Chamaeleonidae). Salamandra 38 (1): 5-14

Matthee C, Tilbury CR, Townsend T (2004) A phylogenetic re-

view of the African leaf chameleons: genus Rhampholeon

(Chamaeleonidae): the role of vicariance and climate change

in speciation. Proc. Roy. Soc. 271: 1967-1975

Mariaux J, Tilbury CR (2006) The pygmy chameleons of the

Eastern Arc Range (Tanzania): Evolutionary relationships and

the description of three new species of Rhampholeon (Sauria:

Chamaeleonidae). Herpetological Journal 16: 315—331

Mariaux J, Lutzmann N, Stipala J (2008) The two-horned

Chameleons of East Africa. Zool. J. Linn. Soc. 152: 367-391

Menegon M, Tolley K, Jones T, Rovero F, Marshall AR, Tilbury

CR (2009) A new species of chameleon (Sauria:

Chamaeleonidae: Kinyongia) from the Magombera forest and

the Udzungwa Mountains National Park, Tanzania. African

Journal of Herpetology 58 (2): 59-70

©OZFMK

288 Nicola Lutzmann et al.

Fig. 9.

Mertens R (1955) Amphibien und Reptilien aus Ostafrika. Jh.

Ver. Vaterl. Naturk. Wiirtt. 110: 47-61

Mertens R (1966) Liste des rezenten Amphibien und Reptilien:

Chamaeleonidae. Das Tierreich, Berlin

Miiller L (1938) Uber die von den Herren L. Uthmiller und L.

Bohmann im britischen Mandatsgebiet “Tanganyika Territo-

ry” gesammelten Chamialeons. Zoologischer Anzeiger 122:

20-23

Necas P (1994) Bemerkungen zur Chamaleon-Sammlung des

Naturhistorischen Museums in Wien, mit vorlaufiger Beschrei-

bung eines neuen Chamaleons aus Kenia (Squamata:

Chamaeleonidae). Herpetozoa 7 (3/4): 95-108

Necas P (2009) Ein neues Chamaleon der Gattung Kinyongia

(Tilbury, Tolley & Branch 2006) aus den Poroto-Bergen, Stid-

Tansania (Reptilia: Sauria: Chamaeleonidae). Sauria 31 (2):

41-48

Bonn zoological Bulletin 57 (2): 281-288

A six year old K. u. artytor ssp. n. in captivity (photo: R. Lademann).

Necas P, Sindaco R, Koreny L, Kopecna J, Malonza PK, Mod-

ry D (2009) Kinyongia asheorum sp. n., a new montane

chameleon from the Nyiro Range, northern Kenya (Squama-

ta: Chamaeleonidae). Zootaxa 2028: 41—50

Necas P, Nagy P (2009) Ein Beitrag zur Kenntnis von Uthmdllers

Chamialeon, Kinyongia uthmoelleri (Miller, 1938). Sauria 31

(1): 15-21

Price T (1996) Zur weiteren Kenntnis von Bradypodion uthmoel-

leri (Miiller, 1938). Salamandra 32 (3): 199-202

Tilbury CR, Tolley KA, Branch WR (2006) A review of the sys-

tematics of the genus Bradypodion (Sauria: Chamaeleonidae),

with the description of two new genera. Zootaxa 1363: 23-38

Received: 30.VII.2010

Accepted: 15.X.2010

©ZFMK

Bonn zoological Bulletin | Volume 57 Issue 2 pp. 289-296 | Bonn, November 2010

A new species of the genus Lycodon (Boie, 1826)

from Yunnan Province, China

(Serpentes: Colubridae)

Gernot Vogel! & Patrick David?

‘Society for Southeast Asian Herpetology, Im Sand 3, D-69115 Heidelberg, Germany;

E-mail: Gernot. Vogel@t-online.de _

2Muséum national d’ Histoire naturelle, Département Systématique et Evolution, Reptiles & Amphibiens,

UMR 7205 OSEB, Case postale 30, 57 rue Cuvier, F-75231 Paris Cedex 05, France; E-mail: pdavid@mnhn. fr

Abstract. A new species of the genus Lycodon is described from Yunnan Province, People’s Republic of China. It dif-

fers from the superficially similar Lycodon fasciatus by the fact that the loreal is not entering orbit, in colouration, and

lower numbers of subcaudals and infralabials. From the Lycodon ruhstrati group it differs by the colouration of the ven-

ter and the dorsal bands. This new species is only known the Chinese province of Yunnan.

Keywords. Oriental Region, China, Colubrinae, Lycodon fasciatus, taxonomy, Lycodon synaptor sp. n.

INTRODUCTION

Snakes of the species rich genus Lycodon Bole, 1826 re-

ceived considerable attention in most regions of Asia. Six

new species were described form the Philippines (Ota &

Ross 1994; Lanza 1999; Gaulke 2002) and new species

were discovered in Cambodia (Daltry & Wiister 2002), In-

dia (Mukherjee & Bhupathy 2007) and Myanmar (Slowin-

ski et al., 2001). The taxonomy of the Chinese part of the

genus remained unattended until recently. Pope (1935) list-

ed five species, namely Lycodon capucinus Bote, 1827,

Lycodon fasciatus (Anderson, 1879), Lycodon laoensis

Ginther, 1864, Lycodon ruhstrati (Fischer, 1886) and Ly-

codon subcinctus Bote, 1827. This arrangement has not

changed for the next 75 years. Vogel et al. (2010) reviewed

the Lycodon ruhstrati complex and described Lycodon

ruhstrati abditus as a new subspecies from China, and

revalidated Lycodon futsingensis (Pope, 1928). Detailed

examination of banded specimens of the genus led us to

the conclusion, that the diversity is much higher in this

region and that several species await description.

In the course of our ongoing review of the Lycodon fas-

ciatus complex, we came upon two specimens of the genus

Lycodon from Yunnan, China, which seemed to be differ-

ent from L. fasciatus. A detailed examination showed clear

morphological differences which lead us to describe them

as new species.

Bonn zoological Bulletin 57 (2): 289-296

MATERIAL & METHODS

This revision is based on a total of 67 preserved specimens

of Lycodon fasciatus auctorum examined for their exter-

nal morphological characters and on several photographed

specimens. They are listed in the Appendix I. Compara-

tive material of the L. ruhstrati complex is listed under

Vogel et al. (2010).

A total of 53 morphological characters were recorded for

each specimen. The characters and their abbreviations are

listed in Table 1. Not all of these characters have been used

for this study, but all of them were compared.

Measurements, except body and tail lengths, were taken

with a slide-caliper to the nearest 0.1 mm; all body meas-

urements were made to the nearest millimetre. The num-

ber of ventral scales was counted according to Dowling

(1951). Half ventrals were not counted except they were

present on both sides (divided ventrals). The terminal scute

is not included in the number of subcaudals. The dorsal

scale row counts are given at one head length behind head,

at midbody (1.e., at the level of the ventral plate correspon-

ding to a half of the total number of ventrals), and at one

head length before vent. We considered being sublabials

those shields that were completely below a supralabial.

Values for paired head characters are given in left / right

order.

©ZFMK

290

Gernot Vogel & Patrick David

Table 1. List of morphological characters used in this study and

their abbreviation.

Abbreviation Characters

N°

Morphometry

l SVL

2 TaL

3 TL

4 Rel TL

Anatomy

5 TEETH

Scalation

6 DSR

i ASR

8 MSR

9 PSR

10 Keel

11 VEN

12 PreVEN

13. VEN not

14. VEN keel

[S56

16 ANA

17. Lor-l

18 ~ Lor-r

19. Lo touch-l

20 Lo touch-r

21 SL-l

22 SL-r

23 SL/Eye-l

24 SL/Eye-r

25. Larg SL-l

26 _Larg SLrl

29 Vel

28 IL-r

29 ~IL-tot

30“ IL/Ist child

31 = PreOc-l

32 PreOc-r

33 PostOc-l

34 ~=PostOc-r

35. ATem-1

36 =©6©ATem-r

37 =PTem-|

38 PTem-r

39 ~=ParaR

40 ‘Paras

41 Parab

Pattern

42 BODCOL

43 Bands

44 Tail bands

45 Tail venter

46 Bellycol

47 Bellyspeck

48 First band

49 Broad base

50. _ Broad vert

51 Edged

52 Coul throat

Ve throat

Snout-vent length (mm)

Tail length (mm)

Total length (mm)

Relative tail length TaL/TL

Number of upper maxill. teeth (one side)

Dorsal scale rows

Dorsal scale rows at neck

Dorsal scale rows at midbody

Dorsal scale rows before vent

Number of keeled dorsal rows

Ventral plates

Number of preventrals

Ventrals notched or not

Ventrals keeled

Subcaudal plates

Anal plate: 1: single — 2: divided

Number of loreal scale (0 or 1) at left

Number of loreal scale (0 or 1) at right

Loreal scale touches eye at left

Loreal scale touches eye at right

Number of supralabials at left

Number of supralabials at right

Numbers of the SL entering orbit at left

Largest SL left

Largest SL right

Number of infralabials at left

Number of infralabials at right

Total number of infralabials

Number of IL in contact with

anterior chin shield

Number of preoculars at left

Number of preoculars at right

Number of postoculars at left

Number of postoculars at right

Number of anterior temporals at left

Number of anterior temporals at right

Number of posterior temporals at left

Number of posterior temporals at right

Temporal row containing paraparietals

Plates surrounding paraparietals,

see Inger & Marx (1965)

Scales between the paraparietals

Body colour!: grey; 2: brown or ochre

Number of bands on body

Number of bands on tail

Colouration of tail venter

Colouration of belly

Speckling of belly

Number of VEN before the

first band starts, counted left side

Number of VEN that are covered at

the base of the first band

Numbers of vertebral scales that are

covered by the first band

Dorsal bands with light margins

Colour of the throat

Dark VEN on the throat before

the first band

Bonn zoological Bulletin 57 (2): 289-296

Numbers of the SL entering orbit at right

The white or light bands on the body and tail were count-

ed on one side. Hardly visible or incomplete bands were

counted as one, bands that were fused were counted as

two. The collar on the neck was not counted and bands

covering the anal shield were added to the bands of the

body.

Museum abbreviations

BMNH: The Natural History Museum, London, UK. —

BNHS: Bombay Natural History Society, Mumbai, India.

— CAS: California Academy of Sciences, San Francisco,

USA. — CIB: Chengdu Institute of Biology, Chengdu,

People’s Republic of China. — FMNH: Field Museum of

Natural History, Chicago, USA. — KIZ: Kunming Insti-

tute of Zoology, Kunming, People’s Republic of China.

— MNHN: Muséum national d’Histoire naturelle, Paris,

France. — NMW: Naturhistorisches Museum Wien, Aus-

tria. — ZFMK: Zoologisches Forschungsmuseum

Alexander Koenig, Bonn, Germany. — ZMB: Zoologis-

ches Museum fiir Naturkunde der Humboldt-Universitat

zu Berlin, Berlin, Germany. — ZSM: Zoologische

Staatssammlung, Miinchen, Germany.

RESULTS

Lycodon synaptor sp. n.

Holotype. BMNH 1905.1.30.63 adult female (tail dissect-

ed), from “Tongchuan, Yunnan”, today Dongchuan, 100

km north of Kunming, Yunnan Province, People’s Repub-

lic of China (Figs 1—3). Collected by the J. Graham Ex-

pedition, unknown date.

Be 12a Ee D

Fig. 1. Dorsal view of preserved holotype of Lycodon synap-

tor sp.n., BMNH 1905.1.30.63 from Dongchuan, 100 km north

of Kunming, Yunnan Province, People’s Republic of China. Pho-

tograph by Gernot Vogel.

©ZFMK

New Lycodon from Yunnan 29]

Fig. 2. Ventral view of preserved holotype of Lycodon syn-

aptor sp. n., BMNH 1905.1.30.63 from Dongchuan, 100 km

north of Kunming, Yunnan Province, People’s Republic of Chi-

na. Photograph by Gernot Vogel.

Paratype. MNHN 1905.0283, adult female (tail dissect-

ed), from “Tongchuan Fu, Chine”, at present Dongchuan,

Yunnan Province, People’s Republic of China. Collected

by W. F. H. Rosenberg on 21s‘ July 1905.

Diagnosis. A species of the genus Lycodon characterized

by: (1) loreal scale not entering orbit; (2) 15—17 dorsal

scale rows at the forepart of the body and 17 dorsal scale

rows at midbody; (3) upper and vertebral dorsal rows

(6-7) keeled; (4) 201—203 ventrals in females, males un-

known; (5) 68-69 Sc in females, males unknown; (6) a

relative tail length of about 0.189—0.192 in females, males

unknown; (7) 8 supralabials with SL 4—6 touching the or-

bit (7) 30-31 narrow white bands on a dark body; (8)

width of the first band vertebral 0.5—1.0 scales, on the base

3 ventrals; and (9) the belly with discreet bands through-

out.

Fig. 3. Lateral view of the right side of the head of preserved

holotype of Lycodon synaptor sp. n., BMNH 1905.1.30.63 from

Dongchuan, 100 km north of Kunming, Yunnan Province,

People’s Republic of China. Photograph by Gernot Vogel.

Bonn zoological Bulletin 57 (2): 289-296

The new species can be recognized by the combination

of the loreal scale not entering orbit (entering in L. fas-

ciatus sensu stricto), its narrow dorsal bands, with the first

band starting at ventral S—9 (more irregular in L. fascia-

tus [Fig. 4] and species of the L. ruhstrati group, where

they usually start later) and the dark throat, which usual-

ly is light in other species of the L. fasciatus group and

the L. ruhstrati group. Most other characters match with

Lycodon fasciatus.

Detailed comparisons with other species of the genus Ly-

codon appear below in the Discussion.

Fig. 4.

Dorsal view of Lycodon fasciatus. CIB 9804, from

Ruili City, Yunnan. Note the irregular bands. Photograph by Ger-

not Vogel.

Etymology. This species is indirectly named in honour of

Dr. Wolfgang Bohme. It was always a publicized aim of

Wolfgang Bohme to unite professional and amateur her-

petologists. We, both authors have always been amateur

herpetologists, so it is a delight for us to dignify his ef-

forts towards this aim. The specific name synaptor, a noun

in apposition, stems from the Greek word “ovuvonpts”

meaning “a connection”. In this case, this noun underlines

the connection of these two kinds of herpetologists.

We suggest the following common names: Boehme 5 wolf

Snake (English), Bohmes Wolfszahnnatter (German).

Description of the holotype. Habitus. Body elongate,

somewhat laterally compressed; head flattened anterior-

ly, well distinct from the neck; snout depressed and elon-

gate; nostril oval, large, in the middle of the nasal. Eye

moderate, with a vertically elliptic pupil.

SVL 374 mm; TaL 89 mm; TL 463 mm.

©ZFMK

292 Gernot Vogel & Patrick David

Fig. 5.

Ventral view of Lycodon fasciatus. CIB 9804, from

Ruili City, Yunnan. Note he whitish colouration of the anterior

part and te speckling of the posterior part. Photograph by Ger-

not Vogel.

Dentition. A total of 10 maxillary teeth, with the follow-

ing formula: 4 small anterior teeth + 2 strongly enlarged

teeth + a wide gap + 2 small teeth + a small gap + 2 strong-

ly enlarged, posterior teeth.

Body scalation. 201 VEN (+ 2 preventrals), 68 SC, all

paired. Anal single. Dorsal scales in 17—17—15 rows, the

7 upper rows feebly keeled. Vertebral row not enlarged.

No apical pit detected.

Head scalation. Rostral, triangular, hardly visible from

above; nasal vertically divided by a furrow below and

above the nostril; two small, trapezoidal internasals, wide-

ly in contact each with the other and with prefrontals; two

large prefrontals, longer and wider than internasals; a

rather small ogive-shaped frontal, about 1.3 times longer

than wide and about 0.8 time as long as the suture between

the parietals; 2 large parietals, each edged with three large

scales, 2 upper temporals and a larger paraparietal poste-

riorly; | / 1 wide, triangular supraocular; 1 / 1 small pre-

ocular, located above the posterior part of loreal; 2 / 2 pos-

toculars, about the same size; | / 1 subrectangular loreal,

elongateand narrow, not entering orbit, in contact with SL

2 and 3, the large preocular, the prefrontal (long contact)

and the posterior part of nasal; 8 / 8 SL, of which the first

four are higher than long, SL 1—2 in contact with nasal,

SL 3-5 entering orbit, 6 and 7 SL largest; 2+2 / 2+2

temporals, lower anterior temporal a bit broader than up-

per one, posterior temporals smaller; 8 / 8 infralabials, IL

1-4 in contact with the first pair of sublinguals; anterior

and posterior pair of sublinguals of about same length, but

anterior pair wider.

Coloration in preservation. Body and tail dark blackish-

brown, with 31 crossbands on body and 9 on tail, narrow

and cream, not speckled; these crossbands, about | dor-

sal scale long, widen at their ventrolateral limit, up to about

5-7 dorsal scale long; the first crossband, beginning at the

level of VEN 9; the second crossband is 8 scale rows be-

hind the first one; 9 cream crossbands on the tail, also not

speckled.

The head is uniformly blackish-brown, a broad nuchal col-

lar extends from the 6‘ and 7‘ supralabial across the low-

er posterior temporal across the posterior half of the pari-

entals. The underside of the head ist dark in the anterior

half and cream in the posterior one; the throat is cream,

with a dark clowdy spot on the preventrals and the first

ventral.

The venter is dark, with faint cream bands rather regular,

2 ventrals wide and with 34 ventrals in between. With-

in these bands some ventrals are dark on one half and

cream on the other, especially in the posterior part of the

body. The under surface of the tail is banded as the ven-

ter with the cream bands about 1.5 SC wide.

Fig. 6.

Comparison of lateral head scalation of Lycodon synaptor sp. n. (BM 1905.1.30.63 Holotype) and one L. fasciatus (BNHS

1223) where the Lo touches the eye. This is the case only in 6.3% of all cases seen by us. Please note that in L. synaptor sp. n. the

Lo is well separate from the eye by the preocular scale, whereas it is tapering and narrow in the L. fasciatus, where it is more or

less inserted between 2 sales and falls short from the eye. Drawings by Dick Visser.

Bonn zoological Bulletin 57 (2): 289-296

©ZFMK

New Lycodon from Yunnan 293

Table 2. Pholidosis of the two type type specimens of Lycodon synaptor sp. n.

BMNH_ 1905.1.30.63

Characters MNHN_ 1905.0283

holotype paratype

Sex Female Female

SVL 374 395

TaL 87 92

Reine 0.192 0.189

ASR 17 15

MSR 17 Ig)

VEN 201 203

SC 68 69

Lo enters eye no no

Dorsal bands 31 30

Tail bands 9 9

First band at VEN no 9 5)

Broad base [VEN] fi gS}

Broad vertebral [Dorsals] 2 l

Variation. The paratype, MNHN 1905.0283, agrees in

most respects with the description of the holotype with the

throat being dark instead of light. The maxilla are miss-

ing in the paratype. A comparison of the most important

morphological characters is summarized in Table 2.

Distribution. China. Lycodon synaptor sp. n. is current-

ly only known from the region of Dongchuan, Dongchuan

County, in the province of Yunnan, China.

Biology. There is no information available on the biolo-

gy of this species. However, the region of Dongchuan is

highly mountainous. Dongchuan is located between high

mountains of the ranges known as Gongwang Shan and

Liangwang Shan. In the area, the highest point is 4.344

meters high, and lowest is 695 meters asl.

DISCUSSION

Lycodon synaptor sp. n. is superficially similar to L. fas-

ciatus but differs from the whole L. fasciatus group (in-

cluding L. butleri) by the loreal, which does not enter or-

bit in L. synaptor. We have examined six specimens (out

of 35) of Lycodon fasciatus sensu stricto in which the lo-

real does not enter orbit (eight occurrence, three times on

both sides [4.7 %]), but the morphology of the anterior

region of the eye is different. In specimens of L. fascia-

tus in which the loreal does not enter orbit, the posterior

region of this narrow scale is very tapering (Fig. 6). Its

apex is more or less inserted between the preocular and

the 4th SL and falls short from the eye. In contrast, in L.

Bonn zoological Bulletin 57 (2): 289-296

synaptor, the loreal scale is well separated from the orbit

by a broad preocular. The tail is a bit shorter in L. synap-

tor sp. n. (0.189—0.192 vs. 0.190—0.219 in 29 females of

L. fasciatus). There are also differences in the shape of the

bands and the colouration of the belly (compare Figs 2 and

5). L. synaptor sp. n. has eight infralabials, whereas only

one specimen out of 60 specimens of L. fasciatus had eight

infralabials on both sides and rarely that character is seen

on one side (5 %) in L. fasciatus. L. synaptor sp. n. has

less subcaudals than L. fasciatus (68—69, x = 68.5, versus

70-88, x = 79.9 with one outlier having 67 subcaudals).

For a complete comparison of scale counts see Table 3.

L. synaptor sp. n. differs from the other Chinese and In-

dochinese species as follows: from L. subcinctus by the

fact that in L. synaptor sp. n. both a loreal and a preocu-

lar are present. From L. laoensis, L. zawi and L. capuci-

nus it differs by the anal shield which 1s single in L. synap-

tor sp. n. but divided in the latter two species. Furthermore

the colouration is much different. From the L. ruhstrati

group it differs by the colouration of the bands (small, reg-

ular, completely light in L. synaptor sp. n., getting broad-

er posteriorly, irregular and partly speckled with brown

in the L. ruhstrati complex), by the number of infralabi-

als (eight in L. synaptor, nine to ten in the L. ruhstrati

group) and by the colour of the belly, which is speckled

or uniform light in the L. ruhstrati group, but clearly band-

ed in L. synaptor sp. n. From L. paucifasciatus Rendahl,

1943, occurring in Vietnam, L. synaptor sp. n. differs by

the number of anterior dorsal scale rows (15-17 in L.

synaptor sp. n. and 19 in L. paucifasciatus).

©ZFMK

294

Gernot Vogel & Patrick David

Table 2. Important characters in the Lycodon fasciatus / ruhstrati groups.

Lycodon fasciatus synaptor sp.n. ruhstrati futsingensis cardamomensis

n females 35 2 23 6 l

TL, females N=29 N=2 N=22 N=5 N=1

679 487 876 WB 545

Rel TL, females 0.190-0.219 0.189-0.192 0.207—0237 0.205—0.217 0.25

N=29 N=2 N=22 N=11 N=1

VEN, females 180-219 201-203 217-229 198-208 223

N=35 N=2 N=23 N=13 N=1

SC, females (67) 70-88 68-69 90-108 78-85 92

N=29 N=2 N=21 N=5 N=1

IL both sexes 9-10 (8)* 8 10 (9.11) 9-10 (11) 10

N=120 N=2 N=86 N=44 N=4

Bands 19-43 30-31 19-46 19-33 12-13

N=60 N=2 N=45 N=22 N=4

Tail bands 7-21 9 10-23 9-18 6

N=62 N=2 N=43 N=21 N=4

First band 5-18 5-9 8-17 13-23 unknown

N=51 N=2 N=34 N=18

Broad base 3-12 3 5-9 (12) 5-8.5 unknown

N=51 N=2 N=34 N=18

Lo enters orbit Yes (rarely not**) No No (rarely yes***) — No No

N=126 N=4 N=86 N=44 N=4

Belly banded Yes Yes No No No

N=63 N=2 N=25° N=22 N=

“8 in 6 cases (5 %), in one specimen from Shillong on both sides (1.6 %)

“not entering in 8 occurrences (6.3 %), three times on both sides (4.7 %) (see above)

“in 6 specimens, all from Fujian the Lo touched the eye.

FORK

banded in juveniles only

Werner (1922) described Dinodon yunnanensis from Yun-

nanfu, now Kunming, Yunnan Province. This species was

synonymised with Lycodon fasciatus by Pope (1935: 188),

but according to our unpublished data, this taxon might

be valid. In any way this name is available, so we com-

pared Lycodon synaptor sp. n. with Dinodon yunnanen-

sis Werner, 1922 for which we re-examined the holotype

(NMW 23417; adult female). Lycodon synaptor sp. n. dif-

Bonn zoological Bulletin 57 (2): 289-296

fers from D. yunnanensis mainly by the loreal which is

touching the eye in D. yunnanensis, but also by the num-

ber of ventrals (201—203 against 193) and the number of

bands on the body (30-31 vs. 23) and the number of in-

fralabials (eight vs. nine in D. yunnanensis).

While preparing a review for the Lycodon fasciatus group,

we found quite a lot of obviously independent lineages,

©ZFMK

New Lycodon from Yunnan 295

which seem to constitute distinct species. Some of them

are restricted to small areas. A discussion of these lineag-

es will follow in the main review (Vogel & David in prep.).

Lycodon synaptor sp. n. differs so much from other mem-

bers of the group that we decided to describe it separate-

ly. The closest localities we got from Lycodon fasciatus

are from the vicinity of Kunming in Yunnan province,

which lies about 100 km south of Dongchuan. This latter

place (previously Tongchuan or Tongchuan Fu) is the type

locality for several reptile species, as Cuora yunnanensis

(Boulenger 1906), Nanorana yunnanensis (Anderson,

1879), Odorrana grahami (Boulenger 1917) and Bombi-

na maxima (Boulenger 1905). It is a relatively small city

that had about 300.000 inhabitants in 2006.

Revised Key for the genus Lycodon in China

According to our data, there are several unnamed species

of the genus Lycodon living in China. So this should be

regarded as preliminary key.

1. Both a loreal and a preocular scales present ................006+ 2

Either loreal or preocular absent ................0... L. subcinctus

Jao ANTE CRAIGS cocosligenascase08s ants arose sc cICGICE ae TE Coer aE EERE 3

ANTE SITIES. scoedectngseaaboReSERE DEES E ae PREEEL EERE SEER 4

3. Anterior chinshields not more than 1.5 times longer than

posterior ones; loreal in extensive contact with internasal,

when adult no crossbands on body ................- L. capucinus

Anterior chinshields 2 to 3 times longer than posterior ones;

loreal not, or barely in contact with internasal (very rarely a

strong contact), when adult yellow crossbands on forepart

Olt OOGH?. accoonsidoscosteonee noseee Lecce eee MEER cae L. laoensis

G\, TRIG? TORIC IEC scconcsasaccsbaccesco sco udentaaqsosacencecacode oguceciasscnosaere sae 5

IBIS Gt lO eTOVET EC | sce condnscecschoseoodacoae cers aondonoossspacbooosoriaaaeocHnesE 6

5. Lo not touching the eye, 8 lower labials .. L. synaptor sp. n.

Lo usually touching the eye, usually 9-10 lower labials

20000600000600¢00 00 00H IEE DEE ECE: CEE CEE CUR ee ESCs L. fasciatus

GaDorsallmows| keeled «.......2:2--s-ccs-ceeecneso-00e L. ruhstrati abditus

Dorsalirows'SMOOth 2.2. ...c-c.cceccsecsencsestereswees L. futsingensis

Bonn zoological Bulletin 57 (2): 289-296

Acknowledgements. The first author is indebted to Annemarie

Ohler and Alain Dubois (MNHN) for the grants to work in the

Paris collection. We are grateful to Silke Schweiger, NMW for

sending pictures of the type of Dinodon yunnanensis. Ke Jiang

and Jian Luo helped a lot with further information on Chinese

Lycodon. Montri Sumontha provided scalecounts. We also thank

Colin J. McCarthy (BMNH), Varad Giri (BNHS), Robert C.

Drewes and Jens V. Vidum (CAS), Wang Yuezhao, Zeng Xiao-

mao and Ermi Zhao (CIB), Alan Resetar (FMNH), Dingqui Rao

(KIZ), Ivan Ineich and Annemarie Ohler (MNHN), Franz Tiede-

mann and Richard Gemel (NMW), Wolfgang B6hme (ZFMK),

Mark-Oliver Rédel and Frank Tillack (ZMB), Frank Glaw and

Dieter Fuchs (ZSM) for the possibility to examine specimens de-

posited in the collection of their respective institutions. Dick Vis-

sers made the drawings for us. Many thanks for that.

REFERENCES

Daltry JC & Wiister W (2002) A new species of Wolf Snake (Ser-

pentes: Colubridae: Lycodon) from the Cardamon Mountains,

southwestern Cambodia. Herpetologica 58: 498-504

Dowling HG (1951) A proposed standard system of counting

ventrals in snakes. British Journal of Herpetology 1: 97-99

Gaulke M (2002) A new species of Lycodon from Panay Island,

Philippines (Reptilia, Serpentes, Colubridae). Spixiana 25:

85-92

Lanza B (1999) A new species of Lycodon from the Philippines,

with a key to the genus (Reptilia Serpentes Colubridae). Trop-

ical Zoology 12: 89-104

Mukherjee D & Bhupathy S (2007) A new species of Wolf Snake

(Serpentes: Colubridae: Lycodon) from Anaikatti Hills, West-

ern Ghats, Tamil Nadu, India. Russian Journal of Herpetol-

ogy 14: 21-26

Ota H & Ross CA (1994) Four new species of Lycodon (Ser-

pentes: Colubridae) from the Northern Philippines. Copeia

1994: 159-174

Pope CH (1935) The reptiles of China. Turtles, crocodilians,

snakes, lizards. Natural History of central Asia, X. American

Museum of Natural History, New York

Slowinski JB, Pawar SS, Win H, Thin T, Gyi SW, Oo SL, Hla

T (2001) A new Lycodon (Serpentes: Colubridae) from north-

east India and Myanmar (Burma). Proceedings of the Califor-

nia Academy of Sciences 52: 397-405

Vogel G, David P, Pauwels OSG, Sumontha M, Norval G, Hen-

drix R, Thanh VN, Ziegler T (2009) A revision of Lycodon

ruhstrati (Fischer, 1886) auctorum (Squamata: Colubridae),

with the description of a new species from Thailand and a new

subspecies from the Asian mainland. Tropical Zoology 22:

131-182

Werner F (1922) Neue Reptilien aus Stid-China, gesammelt von

Dr. H. Handel-Mazzetti. Anzeiger der Akademie der Wis-

senschaften in Wien 59: 220-222

Received: 24. VIII.2010

Accepted: 10.X.2010

OZFMK

296 Gernot Vogel & Patrick David

APPENDIX I

Additional comparative material of Lycodon fasciatus

India. Shillong, Assam, BMNH 92.1.25.1; BMNH

1908.6.23.6; BMNH 1908.6.23.8; BMNH

1907.12.16.28-29; BMNH 94.10.4.2; BNHS 1219-20,

1229.

Laos. Xieng-Khouang, Laos, MNHN 1928.69.

Myanmar. Maymyo, Burma, BMNH 1925.12.22.15—16;

Mogok, Burma, BMNH_ 1900.9.20.5—7; BMNH

1901.4.26.1Mogkok, Burma, BNHS 1221 “Burma”,

BMNH 1908.6.23.9-11 ; Burma, BNHS 1218; Toungyi,

Shan State, Myanmar, BMNH 91.11.26.31; Bhamo, Bur-

ma, BMNH 1925.4.2.28; Kachin Hills, Burma, BMNH

1925.9.17.10—11; South Shan State, BMNH 1908.6.23.14;

Burma-Siam Border, BMNH 1937.2.1.12; Rangoon, Bur-

ma, BMNH_ 1940.3.3.3; Maymyo, Burma, BNHS

1222-24; Thandung Hills, BNHS 1228.

Bonn zoological Bulletin 57 (2): 289-296

People’s Republic of China. Western China CAS 55147;

Yunnan, MNHN 1919.148; “Yunnan Fu” (holotype of

Dinodon yunnanensis), NMW 23417; Kuantun, ZSM

75/1938; Kunming, Yunnan, BMNH 1930.11.16.4; Ruili

City, Yunnan, CIB 9804; RuiLi, Yunnan,, CIB 9805;

XiShuangBanNa, Yunnan, CIB 9806, CIB 9808, CIB

9809; LongChuan GongWa, Yunnan, KIZ 74 I 0035;

LongChuan HuSa, Yunnan, KIZ 74 I 0145; Tengchong

County, Yunnan KIZ 74 II 0262; Menglian, Yunnan, KIZ

75 1473; TengChong TuanTian, Yunnan, KIZ 74 I 0263;

Kunming, Yunnan, KIZ 73009; Kunming, Yunnan, KIZ

77004; Kunming city, Yunnan, KIZ 83007; Yunnan, KIZ

83017; FMNH 15148; Tibet; MNHN 1921.0465 Tibet;

Yunnan,; ZMB 65453

Thailand. Chiang Mai, Thailand, FMNH 178369; CAS

172715, Southern Thailand ? FMNH 178368, Nan

province Thailand FMNH 270716.

Vietnam. Phong Nha, Vietnam, ZFMK 86448—S0 (Gen-

Bank: EU999214-215); ZFMK 80665; Ziegler unreg.

©ZFMK

Bonn zoological Bulletin | Volume 57 Issue 2

pp. 297-306 Bonn, November 2010

A crowned devil: new species of Cerastes Laurenti, 1768

(Ophidia, Viperidae) from Tunisia,

with two nomenclatural comments

Philipp Wagner!* & Thomas M. Wilms?

' Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, 53113 Bonn, Germany;

philipp.wagner.zfmk@uni-bonn.de

? Zoologischer Garten Frankfurt, Bernhard-Grizmek-Allee 1, 60316 Frankfurt a. Main, Germany;

* corresponding author

Abstract. A distinctive new species of the viperid genus Cerastes is described form Tunisia. It is closely related to Cerastes

vipera but easily distinguishable from this invariably hornless species by having tufts of erected supraocular scales form-

ing little crowns above the eyes. These crown-like tufts consist of several vertically erect, blunt scales which differ dras-

tically from the supraocular horns of C. cerastes or C. gasperettii that consist of one long, pointed scale only. Although

the new species is based on only one single specimen, further specimens had originally been available but were subse-

quently lost in private terraria.

The taxonomic status of the nomen ‘“Cerastes cerastes karlhartli” is discussed and the name is found to be unavailable

(nomen nudum). Also the authorship of “Cerastes cornutus” is discussed and ascribed to Boulenger.

Key words. Cerastes cerastes, Cerastes vipera, Cerastes sp. n., Cerastes c. karlhartli, Cerastes cornutus, horned viper,

North Africa, Tunisia.

INTRODUCTION

The genus Cerastes Laurenti, 1768 includes only five taxa

(three species and two subspecies), which are distributed

in northern Africa and on the Arabian Peninsula. All

species are stout-bodied and, as desert snakes, are char-

acterized by many xeromorphic physiological and mor-

phological adaptations. The most impressive adaptations

are the strongly keeled serrated lateral body scales, a char-

acter they share with their proposed sister taxon Echis

(Joger & Courage 1999, Pook et al. 2009), but not with

the also sand living snakes of the genus Bitis.

The largest member of the genus is Cerastes cerastes (Lin-

naeus, 1758) with a maximum body size of 80 cm and an

average size of 35 to 60 cm. The distribution range of the

nominotypic form includes all Saharan countries with a

southernmost distribution in Sudan (Phelps 2010) and the

northernmost in central Tunisia (Schleich et al. 1996).

Eastwards it reaches the Sinai, Israel and Jordan (Phelps

2010). Cerastes c. cerastes occurs in sandy and rocky

deserts and around well vegetated oases but not in wind-

blown dunes (Phelps 2010). Cerastes c. hoofienii Wern-

er & Sivan 1999, the second subspecies occurs in the ex-

treme southwestern edge of the Arabian Peninsula in

Yemen and Saudi Arabia.

Bonn zoological Bulletin 57 (2): 297-306

The second North African species is C. vipera (Linnaeus,

1758). Its distribution range is very similar to C. cerastes

but more restricted to the Saharan Desert and reaches east-

ward to the Sinai and Israel as it only occurs in dune sys-

tems. Therefore, according to Phelps (2010) both species

were never recognized as locally syntopic, but Joger

(2003) found both species occurring parapatrically at the

edge of the Grand Erg Oriental in Tunisia. Cerastes vipera

is the smallest viper of the genus and grows up to a max-

imum size of under 50 cm with an average about 35 cm.

The remaining species is Cerastes gasperettii Leviton &

Anderson, 1967 with its subspecies gasperettii and C. g.

mendelssohni Werner & Sivan, 1999. It is distributed on

the Arabian Peninsula and eastwards to Iraq and Iran, over-

lapping with other Cerastes species in its distribution on-

ly in the southern Sinai and the northwestern edge of the

Arabian Peninsula.

The common name ‘Horned Vipers’ is misleading as not

all species and not all populations possess supraocular

horns. In C. cerastes and C. g. gasperettii specimens usu-

ally bear horns but several populations are hornless. If

present, the horns are formed by a long, sulcated, single

©ZFMK

298 Philipp Wagner & Thomas M. Wilms

spike above each eye, usually surrounded by a ring of

elongate spinose but non-sulcated scales. This polymor-

phism is also known in other viperid snakes as the

supraocular horns of Bitis caudalis and the supranasal

horns of Bitis gabonica are absent in some specimens

(FitzSimons 1962, Branch 1988). However, C. g.

mendelssohni and C. vipera are strictly hornless as op-

posed to the other taxa.

Gasperetti (1988) described the characters of the genus

Cerastes as (a) the eyes are small to moderate and sepa-

rated from the labial scales by several rows of small scales;

(b) body scales with club or anchor shaped keels, not ex-

tending to the extremity of the scales; (c) lateral body

scales smaller than vertebral scales; (d) anal scale entire;

and (e) ventral scales with an obtuse keel on each side.

For many decades, only two species, C. cerastes and C.

vipera, were recognized but Werner (1987) and Werner

et al. (1991) elevated C. gasperettii to full species status,

which was later accepted by many authors (e.g. Schatti

& Gasperetti 1994, Phelps 2010).

Following Baha el Din (2006) the two African species are

easy to distinguish. In C. vipera, supraocular horns are

never present, there are less than 14 interorbitals and

counts of ventral scales are below 120, whereas in C.

cerastes there are more than 14 interorbitals and more than

130 ventrals. Schleich et al. (1996) distinguished the two

snakes mainly by the position of the eye (lateral in cerastes

and directed upwards in vipera), by the presence or ab-

sence of a supraocular horn and by the number of interor-

bital scales (15—21 in cerastes and 9-13 in vipera). Ge-

niez et al. (2004) distinguished both species by their lon-

gitudinal rows of dorsal scales at midbody (27-35 in

cerastes; 23—27 in vipera), but also mentioned the eyes

on the top of the head in C. vipera.

In the collection of the Zoologisches Forschungsmuseum

Alexander Koenig (ZFMK) a specimen of Cerastes is

present, which is generally similar to C. vipera but clear-

ly distinct in possessing supraocular crown-like scale tufts

instead of horns of a solitary scale. Because of this strik-

ing character, as such tufts or horns are absent in C. vipera,

the specimen was examined and compared with other

Cerastes specimens of the ZFMK collection and with rel-

evant literature.

MATERIAL & METHODS

This description is based on the comparison of 75 pre-

served Cerastes specimens and three vouchers of other

snakes of the ZFMK collection (see below) and the rele-

vant literature (Jooris & Fourmy 1996; Schleich et al.

1996; Geniez et al. 2004; Baha el Din 2006; Phelps 2010).

Bonn zoological Bulletin 57 (2): 297-306

Measurements were taken with a digital-calliper to the

nearest 0.1 mm. The number of ventral scales was count-

ed excluding the anal scale. The number of subcaudals in-

cluded the terminal scale. The dorsal scale row count is

given as (a) fore body: one head length behind head, (b)

midbody at the level of the ventral plate corresponding to

a half of the total number of ventrals), and (c) hind body

one head length before vent.

For SEM images a Hitachi S-2460N was used to compare

the scale morphology of different snake species. Dorsal

body scales from about the middle of the dorsum were

used from the following specimens: Cerastes sp. n.

(ZFMK 58054, Tunisia), Bitis peringueyi (Boulenger,

1888) (ZFMK 44887: Namibia, Swakopmund) and Bitis

schneideri (Boettger, 1886) (ZFMK 88450: Namibia,

without locality). These were compared with SEM-pho-

tographs from C. cerastes and C. vipera published by

Joger & Courage (1999).

Material examined. Cerastes cerastes: ALGERIA: ZFMK

7649-7650, Colomb-Béchar; ZFMK 18082, 60km west of Toug-

gourt; ZFMK_ 18083-084, 20km north of Bou-Saada; ZFMK

18085, Hoggar Mts., Guelta Afiale; ZFMK 23000, south of

Temassinin, Flatters; ZFMK 23001, Bordj-Saada; ZFMK

23002-005, south of Ouargla; ZFMK 38248, 20km south of

Djanet. EGyet: ZFMK 22996, Isna (=Esne); ZFMK 22997,

vicinities of Cairo; ZFMK 50295, Aswan desert; ZFMK 50296,

Faijum desert; ZFMK 50299-300, Nada el Wahda desert; ZFMK

32488, 50297-298, without locality. LiByA: ZFMK 63668, Wa-

di Matendus; Mauretania: ZFMK 17593, Chami. Morocco:

ZFMK 65218, Draa Valley. NIGER: ZFMK 20258, between Ar-

lit and Agadez, 120km south of Arlit; ZFMK 36629, 40km north-

east of Wadi Gougaram. SUDAN: ZFMK 32462, 100km south-

west of Burget Tuyur depression; ZFMK 32463, Dafur, Teiga

Mts., west of Eisa; ZFMK 32464, Darfur, Djebel Rahib; ZFMK

33697, Nubian desert, 130km southeast of Wadi Halfa; ZFMK

33698-700, Wadi Halfa; ZFMK 38410, 80km north of Port Su-

dan. TunistA: ZFMK 18081, 10km west of Tozeur, Oasis Stil;

ZFMK 22998-999, Tunisian desert; ZFMK 29047, El Hamma

du Djerid near Tozeur; ZFMK 29809-812, 29046, Tozeur; ZFMK

47020-024, between Tozeur and Nefta; ZFMK 49858, Oasis Nef-

ta. Cerastes gasperettii: IRAQ: ZFMK 18843-844, vicinities of

Basrah; ZFMK 19414, Basrah. KINGDOM OF JORDAN: ZFMK

44340, Wadi Araba, Fidan. KINGDOM OF SAUDI ARABIA: ZFMK

43659, 100km northeast of Riyadh. UNITED ARAB EMIRATES:

ZFMK 52419, Al-Mundam. Cerastes vipera: ALGERIA: ZFMK

22984, El Alia; ZFMK 41176, Ain Sefra. EGypt: ZFMK 22989-

994, 50339, vicinities of Cairo; ZFMK 22995, Sinai, Wadi Ar-

ish; ZFMK 50301-302, El Wasta, Abwid desert. LipyA: ZFMK

32489, Tripolis. MAURETANIA: ZFMK 17594, Chami. TUNISIA:

ZFMK 22985-988, Tunesian Sahara, without locality. WESTERN

SAHARA: ZFMK_ 83340, Laayoune Plage; Bitis caudalis:

NAMIBIA: ZFMK 65212, Swakopmund; Bitis peringueyi:

NAMIBIA: ZFMK 88453, without locality. Bitis schneideri:

NAMIBIA: ZFMK 88450, without locality.

©ZFMK

A new species of Cerastes from Tunisia

F500 um—4

Ghee NA WT

1mm | PERING,

+ 200 pm 4

Fig. 1. _ SEM images of dorsal body scales of viperid snakes.

1= Cerastes sp. n. from central Tunisia (ZFMK 58054); 2= Cerastes cerastes published by Joger & Courage 1999; 3= Cerastes

vipera published by Joger & Courage 1999; 4= Bitis peringueyi, 4A published by Joger & Courage 1999, 4B & 4C from Namib-

ia (ZFMK 44887), and 4A= published by Joger & Courage 1999; 5= Bitis schneideri from Namibia (ZFMK 88450).

A= dorsal scale, complete; 1B= dorsal scale, verrucate, secondary structure; 2B= dorsal scale, verrucate, secondary structure; 3B=

dorsal scale, liniar, tertiary structure; 4B= dorsal scale, verrucate to cristate, secondary structure; 5B= dorsal scale, cristate, sec-

ondary structure; 1C= dorsal scale, secondary structure in detail; 2C= dorsal scale, secondary structure in detail; 3C= dorsal scale,

secondary structure in detail; 4C= dorsal scale, secondary structure in detail; 5C= dorsal scale, secondary structure in detail.

300 Philipp Wagner & Thomas M. Wilms

RESULTS & DESCRIPTION

The comparison of the fine structure of a dorsal, non-rat-

tling scale of the single specimen with images of lateral,

rattling scales of Cerastes and lateral scales of Bitis (see

fig. 1) shows similarities between the single specimen and

Cerastes. On the other hand, differences of the typical

scale fine structure of Bitis are distinct enough to recog-

nize the single specimen as a non-Bitis species. The struc-

ture typical in Bitis specimens is obvious in Bitis schnei-

deri (fig. 1.5). They possess a structure of slender, elon-

gated bulges, which are very distinct from Cerastes. How-

ever, Bitis peringueyi, (fig. 1.4) also a sand burrowing

snake, is the only species of Bitis showing a similar scale

structure to Cerastes species, but obvious from figure 2,

this species is very distinct from the new species of

Cerastes.

However, all Cerastes species are similar in their verru-

cate secondary structure; cell borders are well visible.

These borders are invisible in the cristate or verrucate sec-

ondary structure of Bitis species.

The comparison of the voucher with C. vipera and C.

cerastes results ina morphological similarity to C. vipera.

Both are similar in body size, shape of the nostril and head

scalation (see fig. 2, tab. 1). However, in other aspects they

are clearly distinct: the specimen has lower scale counts

as in C. vipera in its morphological variation of the en-

tire distribution in northern Africa. The specimen possess-

es supraocular horns, which are absent in C. vipera and

horns, encompassing several scales, are also not known

in C. cerastes. Therefore, we regard this specimen as a

new species of Cerastes:

Cerastes boehmei sp. n.

Holotype. ZFMK 58054. Female specimen from Tunisia,

SW Remada, east of Djebel National Park, close to the

road midway between Beni Kadeche (Bani Kheddache)

and Ksar el Hallouf, leg. T. Holtmann, 1991.

Diagnosis. This new species of Cerastes 1s characterized

by: (a) head depressed, eyes on the lateral part of the head

but slightly directed upwards; (b) supraocular coronets

(crowns) present, consist of several sulcated, medium

sized scales, instead of the supraocular horn formed by a

single sulcated long scale in C. cerastes or C. gasperettii;

scales; (e) 19-26-16 dorsal scale rows around fore-, mid-

and hind body.

Differential diagnosis. The new species differs from (a)

C. vipera in possessing supraocular coronets, a low num-

Bonn zoological Bulletin 57 (2): 297-306

ber of interocular scales (7 instead of 9-13 fide Schleich

et al. [1996], but 6—13 fide Jooris & Fourmy [1996]), a

lower number of circumocular scales (11 instead of 19-29

fide Jooris & Fourmy (1996), a lower number of supral-

abial/infralabial scales (11—12/12-11 instead of

20-33/19-27 fide Jooris & Fourmy [1996]) and a lower

number of subcaudal scales (25 instead of 33—57 fide

Jooris & Fourmy [1996]). Counts of dorsal scale rows

around midbody are ambiguous and depending on the

method of counting (see fig. 3). They differ from C. vipera

(21 instead of 23—27 fide Phelps [2010]) or lie with 26

scale rows within this range; from (b) C. cerastes in a low-

er number of interocular scales (7 instead of 15—21, fide

Schleich et al. [1996]), in its smaller size, in possessing

a slit-shaped nostril, in possessing supraocular coronets

each formed by more than one elongated scale; and final-

ly from (c) C. gasperettii in possessing supraocular coro-

nets each formed by more than one elongate scale and in

possessing a slit-shaped nostril.

From all recognized synonyms of C. vipera (mainly C.

vipera inornatus Werner, 1929 and C. richiei Gray, 1842)

the new species differs in possessing supraocular coronets,

whereas the synonymised taxa are lacking horns or equiv-

alent structures.

From the recognized synonyms of C. cerastes (mainly C.

c. mutila Doumergue, 1901) the new species differs in

possessing supraocular coronets, as all synonymised taxa

are lacking horns or equal structures. Following Boulenger

(1896) Cerastes cornutus Boulenger, 1896 (see also

nomenclatural comment as part of the discussion), regard-

ed as a synonym of C. cerastes following e.g. Schleich et

al. 1996, is also with either horn-bearing or hornless in-

dividuals, but differs from C. boehmei sp. n. in a higher

number of interorbital scales (15 to 21), in possessing

supraocular horns made up of a single scale, a higher num-

ber of scale rows around midbody (27-35) and a higher

number of ventral (130-165) scales.

Description of holotype (fig. 4). Habitus. Body elongate

and slender, somewhat compressed and oval in profile;

head flattened, triangular and well distinct from neck; Eye

small to moderate, with vertically elliptical pupil, on up-

per lateral side, but nearly on top of head; nostril slit-

shaped, slightly longer than first supralabial scale.

Measurements (in mm): Total length: 218.5; head length:

16; head width: 9.4; head height: 5.5; snout-vent length:

195; tail length: 25.5.

Scalation of head: Rostral broader than high, semicircu-

lar, slightly visible from above; menthal scale only in con-

tact and smaller than first infralabial scale, followed by

two large chinshields; nasal scale divided by large scale

©ZFMK

A new species of Cerastes from Tunisia 301

Fig. 2. | Comparison of different viperid snakes from Africa.

1= Cerastes boehmei sp. n.: ZFMK 58054, Tunisia; 2= Cerastes vipera: ZFMK 22985, Tunisia, without locality; 3= Cerastes vipera:

ZFMK 83340, Western Sahara, Laayoune Plage; 4= Cerastes cerastes: ZFMK 63668: Libya, Wadi Matendus; 5= Cerastes cerastes:

ZFMK 65218, Morocco, Draa Valley; 6= Bitis caudalis: ZFMK 65212: Namibia, Swakopmund; 7= Bitis peringueyvi: ZFMK 88453:

Namibia, without locality. A= head in profile; B= head from above; C= head from below.

302 Philipp Wagner & Thomas M. Wilms

Table 1. Comparison of the three Cerastes species occurring in northern Africa.

C. boehmei sp. n.

C. vipera* C. cerastes**

Interorbital scales Vl

Ventral scales 110

Subcaudal scales 2S

Position of the eye lateral

Supraocular horn present

Scale rows around midbody 21 (26)***

Circumocular scales 11

less than 14 (6-13) more than 14 (14-21)

below 120 more than 130

33-57 18-42

directed upwards lateral

absent present/absent

23-37 27-35

19-29 -

*=fide Jooris & Fourmy 1996, Schleich et al. 1996, Baha el Din 2006, Phelps 2010. **= fide Schleich et al. 1996, Baha el

Din 2006, Phelps 2010. ***= see fig. 3

bearing nostril at its upper fringe, with smaller overlay-

ing scale; five, more or less trapezoidal internasal scales,

the two outer scales twice as large as three inner scales,

all keeled; no enlarged prefrontal scales; occipital tuber-

cle absent; supraocular coronets present, consist of elon-

gate, sulcate scales, four on left, five on right side; 11 cir-

cumocular scales on each side; interorbital scales 7 at mi-

dlevel of supraocular coronets; loreals 3 on each side;

supralabial scales: 11 on left, 12 on right side, only first

in contact with nasal scale, three scales between supral-

abial scales and eye (including ocular scale); infralabial

scales: 12 on left, 11 on right side.

Scalation of body: Ventral scales: 110; subcaudal scales:

25; number of scale rows around fore-body: 19, mid-body:

21 or 26 (see fig. 3), hind-body: 16; vertebral row not en-

larged, in 107 scales on body.

Colouration in preservative. After 20 years of preserva-

tion in ethanol, the specimen has more or less uniform

sandy colouration. Head uniform, upper side down to

height of supralabial scales sandy, underside up to height

of infralabial scales dirty white; body sand-coloured, with

irregular pattern of slightly darker blotches; upper fore part

of tail banded dark sand-coloured, underside dirty white,

from mid-tail to tip uniform dark, nearly black on both

sides; belly dirty white.

Colouration in life. Similar to preserved specimen: uni-

form yellowish sand-coloured with shades of some

slightly darker blotches. Head and forepart of body uni-

form yellowish-sandy, without darker pattern (see fig. 5).

Etymology. This new species is named, in deep respect,

after our ‘scientific father’ Prof. Dr Wolfgang Bohme,

deputy director and head of the Herpetology section at the

Zoologisches Forschungsmuseum Alexander Koenig in

Bonn, for his contributions to African herpetology for the

Bonn zoological Bulletin 57 (2): 297-306

past four decades and for the time he invested in his young

students. With his encouraging lectures, discussions, ex-

cursions and fieldtrips he had a significant influence on

the authors leading to their scientific current dedication

with herpetological systematics, ecology and zoogeogra-

phy.

Distribution. So far only known from the type locality,

but an adult male was caught by a local snake hunter near

Beni Kadeche (T. Holtmann pers. comm.). The new

species appears currently to be endemic to Tunisia and is

probably widespread in the area of Bani Kheddache.

Biology. Nearly no information is available on the biol-

ogy of this species. In captivity the adult female gave birth

to living young which reflects the close relationship to C.

vipera. In respect to colouration, a sandy habitat can be

assumed.

Comments. Although the species is described here based

on a single voucher, more specimens were known but be-

came apparently lost. This specimen was one of three ju-

veniles caught together with an adult female at the type

locality. The adult female had five juveniles in captivity.

Additionally, an adult male was caught in the area of the

type locality by a local hunter. All of these specimens have

shown the described character of the unique supraocular

horns.

DISCUSSION

Though described from a single specimen only, the valid-

ity of C. boehmei sp. n. is beyond doubt. As becomes ob-

vious from the comparison of fine structure of body scales,

the new species must be clearly assigned to the genus

Cerastes, being distinct from burrowing Bitis species from

southern Africa. However, the fine structure is similar to

©ZFMK

A new species of Cerastes from Tunisia 303

Fig. 3.

both, C. cerastes and C. vipera but many other characters

(e.g. shape of nostril, position of the eye, pholidosis, re-

productive biology) show that the new species is more

closely related to C. vipera than to C. cerastes. Accept-

ing the results of the morphological analysis of C. vipera

published by Jooris & Fourmy (1996) the new species has

lower counts in circumocular, subcaudal, supralabial, in-

fralabial scales and of ventral and interocular scales are

on the lower limit of morphological variation in C. vipera.

Therefore, C. boehmei sp. n. is clearly distinct from C.

vipera also in pholidosis. Nevertheless, in C. cerastes both

hornless and horned individuals are known but (a) the

morphology of the “crowns” of C. boehmei sp. n. is clear-

ly distinct to all other known horn structures in Cerastes

and (b) the fact that supraocular horns or similar structures

are completely unknown in C. vipera strengthens the va-

lidity of the new taxon as new and full species. Also Jooris

& Fourmy (1996) who analysed 246 specimens compar-

ing pholidosis in relation to a directed distribution did not

mention any individuals with horn-like structures. Also

none of the known synonyms of C. vipera possesses horns

or similar structures. Nevertheless, supraocular horns as

spontaneously mutation are extremely implausible. Only

one case is documented where a specimen of Macrovipera

lebetina possessed a solitary horn only on one side of the

head (Bohme & Wied! 1994).

Nevertheless, in C. cerastes and C. gasperettii hornless

and horn-bearing individuals are known and a taxonom-

ic differentiation is only known from C. gasperettii where

the subspecies mendelsohni is hornless. Therefore, it can

be also assumed that the supraocular scale tufts are sim-

ply a so far unknown variation within of C. vipera. But

first of all, C. vipera is a well known species and e.g.

Jooris & Fourmy (1996) have analysed a high number of

vouchers and no single specimen is known which possess

Bonn zoological Bulletin 57 (2): 297-306

Two different methods to count scale rows of dorsal scales around the midbody region of the holotype of Cerastes boehmei

sp. n., ZFMK 58054.

supraocular tufts and second these supraocular tufts are

strongly abnormal and very distinct to the supraocular

horns of cerastes and gasperettii who possess similar

supraocular horns to each other.

The function of supraocular horns remains unknown.

There were many speculations on the function of the horns

in Crotalus cerastes Hallowell, 1854 from America.

Klauber (1956) mentioned that they serve as radiators of

heat or shaders for the eyes, whereas Cowles (1953) re-

garded them simply as a whim of evolution and Cohen &

Myres (1970) suggest that they have the function of an

eyelid protecting the snake’s eye while passing through

burrows. They supported this hypothesis with an ecolog-

ical comparison between C. cerastes and C. vipera: the

former 1s only known to bury itself partially and frequent

rodent burrows whereas C. vipera is only known to bury

itself fully in sand and is not reported from rodent bur-

rows. However, another, not yet discussed, function could

be a sexual recognition between the two snakes. In many

reptile groups (e.g. Chamaeleonidae, Agamidae) body or-

naments are known for identification during mating time.

Although only males possess in most cases ornaments, it

should be verified if only those population of C. cerastes

(as this species does not strictly possess horns) bear horns,

which occur directly syntopically with the hornless C.

vipera.

Currently the new species is only known from central

Tunisia and a restricted distribution can be assumed. A

similar case is found in Pseudocerastes urarachnoides

Bostanchi, Anderson, Kami & Papenfuss, 2006 which was

described from a small area and a further study (Fathinia

et al. 2009) found a third locality relatively close the lo-

calities of the types only.

©ZFMK

304 Philipp Wagner & Thomas M. Wilms

Fig. 4. Holotype of Cerastes boehmei sp. n.: ZFMK 58054 from SW Remada, Tunisia.

A new species of Cerastes from Tunisia 305

Fig. 5.

The SEM analyses of dorsal scales show that Bitis

peringueyi is different to other Bitis species in its second-

ary structure (Beyerlein 1993, and fig. 1). This structure

is more or less a verrucate structure and not comparable

with the cristate structure of e.g. Bitis schneideri, but sim-

ilar to the Cerastes species. However, it is distinct to

Cerastes as the imprints of borders between Clear layer

cells, which are present in Cerastes, are not visible. Both,

the Cerastes species and B. peringueyi are moreover sim-

ilar in their habitats as B. peringueyi 1s one of the sand-

burrowing Bitis species living in windblown sands of the

Namib desert. Other burrowing Bitis like e.g. B. schnei-

deri (see fig. 1) or B. caudalis (imaged in an unpublished

thesis, see Beyerlein 1993) show the typical cristate sec-

ondary structur of Bitis. B. schneideri occurs in stable veg-

etated sand dunes and not like B. peringueyi and Cerastes

in windblown sands. Therefore, this scale structure could

be interpreted as an adaptation for this special habitat of

windblown sands.

Nomenclatural comment to the nomen ‘Cerastes c.

karlhartli’. Sochurek (1974) ‘described’ a subspecies of

C. cerastes which he called *C. cerastes karlhartli’. How-

ever, the description was done in his privately published

so-called ‘Herpetologische Blatter’, which according to

art. 8.1 of the International Code of zoological Nomen-

clature (ICZN 1999) does not constitute a publication and

therefore the description is not valid. Later, Sochurek

(1979) used the name again in a summary of North African

snakes but failed to provide a diagnosis, description or fig-

Bonn zoological Bulletin 57 (2): 297-306

Living holotype of Cerastes boehmei sp. n. in captivity.

ure and moreover did not designate a holotype. He only

mentioned the distribution and a type locality. Later, Tiede-

mann & Haupl (1980) accepted the name as a valid sub-

species in their herpetological type catalogue of the Nat-

ural History Museum in Vienna. Werner & Sivan (1992)

placed the ‘subspecies’ in the synonymy of C. cerastes,

whereas Golay et al. (1993) placed it in the synonymy of

C. gasperettii. Werner et al. (1999) did not mention the

name, whereas McDiarmid et al. (1999) and Baha el Din

(2006) followed Werner & Sivan (1992). However, all

these authors gave neither a diagnosis nor a figure of a

specimen. Therefore the name ‘Cerastes cerastes karl-

hartli must be recognized as a nomen nudum.

Nomenclatural comment to the nomen Cerastes cornu-

tus Boulenger, 1896. The name is used for the first time

in Forskal (1775, IX), and he is often mentioned as the

author of this taxon name (e.g. Schleich et al. 1996, Ba-

ha el Din 2006). But Petrus Forskal died during the Dan-

ish Arabia expedition, and Carsten Niebuhr published

Forskal’s results after his death. Nevertheless, the name

is part of a summary about different species which Forskal

wanted to describe, but finally never managed to do be-

fore his untimely death. Additionally, this nomen is not

accompanied by either a description or a drawing. There-

fore, Boulenger (1896) who was the first to use the name

together with a description must be recognised as the au-

thor of Cerastes cornutus, despite the fact that Boulenger

himself mentions Forskal as the author of this species.

©ZFMK

306 Philipp Wagner & Thomas M. Wilms

Acknowledgements. We are grateful to Thorsten Holtmann

(Oberhausen) for providing information about the species and

the image of the holotype alive. We are very thankful to Melanie

Strauch (Bonn) who provided SEM specimens of the holotype

and Bitis schneideri. Wolfgang Bohme (Bonn), Andreas Schmitz

(Geneve) and Bradley Sinclair (Ottawa) gave very important

comments to the manuscript and we are thankful for fruitful dis-

cussions with them.

REFERENCES

Baha el Din S (2006) A guide to the reptiles and amphibians of

Egypt. The American University in Cairo Press, Cairo,

359 pp.

Beyerlein P (1993) Systematische Relevanz epidermaler Ultra-

strukturen bei modernen Schlangen (Colubroidea). Unpublis-

hed Thesis, University of Bonn

Bohme W, Wied! H (1994) Status and zoogeography of the

herpetofauna of Cyprus, with taxonomic and natural history

notes on selected species (genera Rana, Coluber, Natrix,

Vipera). Zoology of the Middle East, 10: 31-52

Boulenger GA (1896) Catalogue of the snakes in the British Mu-

seum (Natural History). Vol. 3, XIV, London, 727 pp.

Branch WR (1988) Field guide to the snakes and other reptiles

of southern Africa. Struik Publishers, Cape Town, 326 pp.

Cohen AC, Myers BC (1970) A function of the horns (supraoc-

ular scales) in the sidewinder rattlesnake, Crotalus cerastes,

with comments on other horned snakes. Copeia 3: 574-575

Cowles RB (1953) The sidewinder: master of desert travel. Pa-

cific Discovery 6: 12—15

Fathinia B, Anderson SC, Rastegar-Pouyani N, Jahani H, Mo-

hamadi H (2009) Notes on the natural history of Pseudo-

cerastes urarachnoides (Squamata: Viperidae). Russian Jour-

nal of Herpetology 16 (2): 134-138

FitzSimons VFM (1962) Snakes of southern Africa. Purnell,

Cape Town, 423 pp.

Forskal P (1775) Descriptiones animalium, avium, amphibiorum,

piscium, insectorum, vermium; quae in itinere Orientali ob-

servavit Petrus Forskal. Méller1, Hauniae, xxxiv + 164 pp

Gasperetti J (1988) Snakes of Arabia. Fauna of Arabia 9:

169-450

Geniez P, Mateo JA, Geniez M, Pether J (2004) The Amphib-

ians and Reptiles of Western Sahara: An Atlas and Field Guide.

Frankfurt am Maim, Chimaira

ICZN (International Commission on Zoological Nomenclature)

(1999) International Code of Zoological Nomenclature. 4th

edition, The International Trust for Zoological Nomenclature

Joger U (2003) Reptiles and amphibians of southern Tunisia.

Kaupia 12: 71-88

Joger U, Courage K (1999) Are Palaearctic ‘rattlesnakes’ (Echis

and Cerastes) monophyletic? Kaupia 8: 65-81

Bonn zoological Bulletin 57 (2): 297-306

Jooris R, Fourmy R (1996) An analysis of scutellation in pop-

ulations of Cerastes vipera (Linnaeus, 1758): Scale charac-

ters co-vary with environmental temperature. African Journal

of Herpetology 45 (2): 59-67

Klauber LM (1956) Rattlesnakes. Their habits, life histories, and

influence on mankind. Univ. California Press

McDiarmid RW, Campbell JA, Touré TA (1999) Snake species

of the world. Vol. 1. Herpetologists’ League, 511 pp.

Phelps T (2010) Old world vipers. A natural history of the

Azemiopinae and Viperinae. Chimaira, Frankfurt, 558 pp.

Pook CE, Joger U, Stitmpel N, Wtister W (2009) When conti-

nents collide: Phylogeny, historical biogeography and system-

atics of the medically important viper genus Echis (Squama-

ta: Serpentes: Viperidae). Molecular Phylogenetics and Evo-

lution 53: 792-807

Schatti B, Gasperetti J (1994) A contribution to the herpetofau-

na of Southwest Arabia. Fauna of Saudi Arabia 14: 348-423

Schleich HH, Kastle W, Kabisch K (1996) Amphibians and Rep-

tiles of North Africa. Koeltz, Koenigstein, 627 pp.

Schmidt KP (1939) Reptiles and amphibians from Southwest-

ern Asia. Publ. Field Museum of natural History, zoological

Series 24: 49-92

Sochurek E (1974) Cerastes cerastes karlhartli n. spp. Herpe-

tologische Blatter 1: 3

Sochurek E (1979) Die Schlangen Nordafrikas. Mitteilungen der

Zoologischen Gesellschaft Braunau 3: 219-226

Tiedemann F, Haupl M (1980) Typenkatalog der Herpetologi-

schen Sammlung. Reptilia. Kataloge der wissenschaftlichen

Sammlungen des Naturhistorischen Museums in Wien (Selbst-

verlag Naturhistorisches Museum Wien) 4 (Vertebrata 2): 1—

Werner YL (1987) Ecological zoogeography and Saharo-Arabi-

an, Saharo and Arabia reptiles in the sand deserts of southern

Israel. In: Proceedings of the Symposium on the Fauna and

Zoogeography of the Middle East, Mainz, 1985. Krupp F,

Schnider W, Kinzelbach R (eds.), Beihefte zum TAVO A 28,

272-295

Werner YL, Sivan N (1992) Systematics and zoogeography of

Cerastes (Ophidia: Viperidae) in the Levant: 2, Taxonomy,

ecology, and zoogeography. The Snake 24: 34-49

Werner YL, Sivan N, Kushnir V, Motro U (1999) A statistical

approach to variation in Cerastes (Ophidia: Viperidae), with

the description of two endemic subspecies. Kaupia 8: 83-97

Werner YL, Verdier A, Roseman D, Sivan N (1991) Systemat-

ics and zoogeography of Cerastes (Ophidia: Viperidae) in the

Levant: 1, Distinguishing Arabian from African Cerastes

cerastes. The Snake 23: 90-100

Received: 10.V.2010

Accepted: 29.VI.2010

OZFMK

Bonn zoological Bulletin | Volume 57 Issue 2 | pp. 307-328

Bonn, November 2010

The taxonomic history of the Linnean genus Lacerta

(Squamata: Sauria: Lacertidae)

in the mirror of book-illustration

Josef Friedrich Schmidtler

Oberfohringer Str. 35, D-81925 Miinchen, josef@schmidtler.eu

Abstract. The taxonomic history of the Linnean genus Lacerta illustrates the general taxonomic history in herpetology

and can be visualized by the history of book illustration. There is a cohesive pattern in lumping Lacerta (Linnaeus, 1758;

comprising lizards, crocodiles and salamanders; expanding to almost 100 species in Shaw, 1802) and splitting (Lauren-

ti, 1768; comprising among others his new genus Seps, a part of Linnaeus’ Lacerta), since the creation of binominal nomen-

clature by Linnaeus, and proceeding above all to the controversy of Boulenger and Méhely after 1900. These wavelike

advances through the centuries are also characterized by a slow consolidation of the higher systematic categories (class-

order-family-subfamily, etc.) and by a gradual reduction of the term Lacerta to almost the species level. This develop-

ment ended now in an enormous generic and specific splitting within the family Lacertidae (Arnold et al. 2007), main-

ly based upon mitochondrial DNA research. The remaining “true” Lacerta comprises at present only half a dozen species,

all of them close relatives of the type species, Lacerta agilis.

There is an historical interdepency between verbal descriptions and illustrations in the taxonomic advances of the genus

Lacerta. The first illustrations of lizards (in the 16'® century) are in equal measure characterized by the lack of system-

atic insight and the lack of technical options. Copper engravings (handcoloured) were used a little later. Since the end of

the 18th century, new techniques accompanied and immensely facilitated a better recognisability of taxa: wood engrav-

ings — lithographs — chromolithographs — photos — modern digital colour photographs. The better understanding of the

diagnostic scale structures called for their schematic depiction, and a schema of the dorsal drawing pattern was estab-

lished. Diagrams for identification keys and/or of the phylogenetic relationships have become an indispensable part of

modern taxonomic work. On the contrary, the genetic revolution of the last 20 years caused a great loss in importance

of morphological characters, whereas top-quality digitalized coloured photos have shifted their importance mainly to pop-

ular publications on ecology, ethology, field herpetology and terraristic studies.

Keywords. Genus Lacerta; history; interdepency text/illustrations.

1. INTRODUCTION: SOME COMMENTS ON THE

ZOOLOGICAL TERM GENUS

The history of the Linnean genus Lacerta is likewise a his-

tory of the term “genus”. As Mayr et al. stated in 1953,

the genus is a collective taxonomic unit consisting of a

number of similar or related species. It is distinguished

from all other higher categories by being recognized in

the scientific name. The nomenclature proposed in Lin-

naeus’ Systema Naturae (1758; animals) is binominal, con-

sisting of two names, each with its own function. The func-

tions which Linnaeus visualized for the components of the

scientific name are diametrally opposite. The specific

name signifies singularity and distinctness; the generic

name calls attention to the existence of a group of simi-

lar or related species — it relieves the memory (Mayr et

al. 1953: 48).

Bonn zoological Bulletin 57 (2): 307-328

Even before Linnaeus there was a recognition of the cat-

egories genus and species. So, Plato definitely recognized

two categories, the genus (“genos”’) and the species (“e1-

dos”), and so did his pupil Aristotle. The naturalists of the

pre-Linnean era were not consistent in the Latin names

they gave to plants and animals. These names ranged all

the way from uninominals (a generic name only), and bi-

nominals (a generic and a simple trivial) to polynominals

(a generic name with several trivial epithets). The reason

for this confusion was that they tried to combine two dif-

ferent functions in the name: naming (in the restricted

sense of the word) and describing (Mayr et al. 1953: 202;

see the legends in the images of Gessner and Aldrovandi

Figs 2 and 3 hoc loco).

©ZFMK

308 Josef Friedrich Schmidtler

An objective criterion for the generic rank does not exist

equivalent to the biological species concept (“reproduc-

tive isolation”) in species systematics (see Mayr 1984:

141, 219; Jahn 2004: 237, 397; Joger 1996) as a criteri-

on. It is therefore impossible to give an objective defini-

tion of the genus. So Mayr et al. (1953: 48) came to the

following conclusion: “A genus is a systematic category

including one species or a group of species of presumably

common origin, which is separated from other similar

units by a decided gap”. They suggest for practical rea-

sons that the size of the gap be in inverse ratio to the size

of the unit; the latter qualification should prevent the

recognition of unjustified monotypical genera.

The general view on the definition of the category genus

has not changed much since then, contrary to the differ-

ent species concepts (e.g. Joger 1996). Even Mayr et al.

(1953) had attenuated their clause appearing so strict (“An

objective criterion does not exist ....”; p. 48) when dis-

cussing the presence of an “ecological niche” (p. 50) be-

tween genera. Later on Dubois (1988) and recently Dubois

& Bour (2010) have extensively discussed the demand of

“hybridizability” as a criterion for the definition of gen-

era and subgenera. Additionally, the genetic revolution in

taxonomy since the 1990s has decidedly consolidated the

phylogenetic trees. So Speybroeck et al. (2010), in the in-

troduction to their recent species list of the European her-

petofauna, come to the decision: “As a distinct genus, we

tend to recognize monophyletic clades that are genetical-

ly as divergent as other widely accepted genera in the same

group. This is usually the approach employed by authors

of scientific papers....”. As a conclusion one might assert,

that it was molecular biology which gave rise to a still con-

tinuing revolution in herpetological taxonomy, and —

above all — to an enormous generic splitting, be it of the

old Linnean genera Testudo, Rana, Coluber, or Lacerta,

the latter being discussed here.

2. A BRIEF HISTORY OF THE LINNEAN GENUS

LACERTA

2.1 The “lumper” Linnaeus (1758 / 1766) and his fol-

lowers

The history of the genus Lacerta reflects also a history of

zoological terms and categories, which can be dealt here

only with its basic intentions. The word “Lacerta” (or the

male gender “Lacertus”’) is of Latin origin. One of its three

meanings is the linguistically derived English term

“lizard”. In this sense it is traceable in the Historia Nat-

uralis of Plinius or in some works of the classic Latin po-

ets Ovidius and Virgilius (Scheller, 1796). Since the era

of renaissance this term was renewed by natural scientists

in both the male and female gender (see Figs 1, 2, 4). Thus

Bonn zoological Bulletin 57 (2): 307-328

the term Lacerta / Lacertus had a long history before Lin-

naeus began to use it in the different editons of his “Sys-

tema Naturae” since 1735.

Linnaeus (or “Linné” after nobilitation), in his famous 10th

edition of 1758, divided the class “Amphibia” into three

orders: I. Reptiles, H. Serpentes, HI. Nantes. The “Rep-

tiles” comprise the four genera Testudo, Draco, Lacerta,

Rana; the Serpentes comprise the six genera Crotalus,

Boa, Coluber, Anguis, Amphibaena, Caecilia. The Nantes

comprise six genera, all of them being transferred later on

into the class Pisces. The Linnean Rana, parts of Lacer-

ta and Caecilia constitute the current class Amphibia

whereas the other genera in Linné’s orders Reptiles and

Serpentes are comprised in the present-day — polyphylet-

ic — Reptilia. Linnaeus’ (1758/1766) large genus Lacerta

is an aggregation of 43/49 species, e.g. comprising the cur-

rent Lacertidae (type species of Linnaeus’ Lacerta is Lac-

erta agilis by later designation in Fitzinger 1843: 20),

many other Reptile orders (like the crocodylia) and fam-

ilies, and even amphibians (e.g., salamanders; see Fig. 1).

His genus Lacerta is encompassed by the diagnosis “Cor-

pus, tetrapodum, caudatum, nudum” (body with four legs,

caudate, “naked”; the latter characterization being com-

pletely incomprehensible, since his genus Rana is also

characterized to be “naked”!). It seems that Linnaeus did

not misjudge completely the heterogenity of his genus

Lacerta. He tried to resolve the problem by species groups,

characterized by short diagnoses and different stars. So his

Lacerta agilis is within a group characterized by “** Cau-

da verticillata” (Tail round) and the group with the fire

salamander, “Lacerta salamandra”’,, 1s characterized by

aK Palmis tetradactylis; Corpore alepidoto nudo”

(fore legs with four toes; body without scutes, naked).

Nevertheless the newt “Lacerta vulgaris” (number 25;

now: Lissotriton vulgaris) is grouped together with geck-

os and skinks.

Gmelin (1789) was formally a follower of Linnaeus, but

he undermined his concept in the so called 13 edition of

Linné’s “Systema Naturae” where he accumulated the

number of Lacerta species up to 77. Gmelin introduced

eleven species groups within Lacerta, characterized by

short diagnoses and mostly (but not always!) naming them

(nominative plural of a main species being included, like

“Salamandrae” with five stars ( ), comprising the

Linnean Lacerta salamandra, No. 47) — or his ““Ameivae

s. Sepes” (“‘s.” = sive”; English: “or’”’) comprising the Lin-

nean Lacerta agilis — or the ““Lacerti” (with nine stars) cov-

ering current tailed amphibians and reptiles, except lac-

ertids, like the newt “Lacerta vulgaris” (now: Lissotriton

vulgaris which is therefore not a part of his “Salaman-

drae”’!). It is clearly noticeable that Gmelin, following Lin-

naeus, avoided dividing the genus Lacerta formally, un-

like Laurenti (1768) had executed. The non-scientific rea-

©OZFMK

Taxonomic history of the genus Lacerta

sons may have been similar as described below in the dis-

cussion on Shaw.

Donndorf (1798) followed Gmelin (1789). He used the

German terms “Geschlecht und Gattung” instead of “Gat-

tung und Art” (genus and species; “Vorrede” p. 5). In his

genus Lacerta Gmelin’s system with eleven species

groups, characterized by eleven stars, is comprised; he

added however 14 newer species (“neuere Gattungen”)

within these species groups and nine species of undeter-

mined species groups.

Shaw’s (1802) General Zoology (vol. II, part II], Amphib-

ia) is the last of the great encyclopaedias around 1800

which formally retains the generic name Lacerta in the

broad Linnean sense. Its number of species has increased

up to 86. Like the preceding encyclopaedias Shaw divid-

ed Lacerta into nine “sections or sets” giving them Eng-

lish names. He admitted however: “The above divisions

Linnaeus (1758)

Laurenti (1768)

Wagler (1830)

Dumeéril & Bibron (1839)

Boulenger (1920)

Arnold (1973)

Arnold & al. (2007)

ia")

me)

foe

€

<¢

Testudines

Crocodilia

Fig. 1.

309

neither are, nor can be, perfectly precise...” His “4.

Lizards proper “ comprised also the current day Lacer-

tidae, among them the ’Green lizard” “Lacerta agilis” tak-

ing first place. Smith & David (1999: 12, 13), when dis-

cussing the taxonomic situation then, drew the conclusion:

“The rudimentary level of understanding of herpetologi-

cal classification in Shaw’s time is admirably exemplified

by his treatment of the Division Lacertae, containing on-

ly two genera — Draco and Lacerta — that are extremely

disparate in diversity. Nevertheless, Shaw was much more

aware of the diversity and affinities of members of his

genus Lacerta than is apparent in the assignment to one

genus, inasmuch as he recognized nine distinct groups. To

us it seems strange that such diversity was not reflected

taxonomically when the relatively minor specialization of

Draco received such emphasis. However, although Shaw

boldly named new species or changed names, he reflect-

ed the trepidation widely shared at that time among his

colleagues in splitting Linnean genera. Change then, as

other Squamata

other Lacertini

Gallotiinae

Eremiadini

Zootoca

Podarcis

Serpentes

Anguidae

Lacertidae

Overview of the gradual reduction of the Linnean genus Lacerta (Laurenti’s genus Seps respectively) from selected mo-

nographs: Linnaeus (1758) — Laurenti (1768) — Wagler (1830) — Dumeéril & Bibron (1839) — Boulenger (1920) — Arnold (1973) -

Arnold et al. (2007: fig. 20); displayed upon a current phylogenetic tree (strongly simplified; from Dawkins, 2008, figs. p. 366,

422, 462; Arnold et al. 2007 figs.). The symbols Z or S make clear a quotation of “Lacerta” (or “Seps” by Laurenti) within a gi-

ven current systematical unit; X (no species from this group being described then).

Bonn zoological Bulletin 57 (2): 307-328

©ZFMK

310 Josef Friedrich Schmidtler

362

Det Kohe von den Eydeken foll auch viel

Krafft haben fiir etlicheRrancEheiten dev Augen.

Lcbendig in Del geFocht/ follein gare Gefiche

machen. Dahero Becherus:

Gefnert Thierbuch

Die Eydcy lebendigin Ocl man fochen thut/

Es macht cin weif Geficht/ ift vor die Rehte

gut.

rob SEL SSB- GOST SB SSS SOB BES 0F- U) BEST ES BES OB~ SEBS OR ESF 263

Von der grinen Eyoere.

Lacertus viridis. Grtiner Heydor/Egochs/Sltachs/

oder Eder. :

Fig. 2.

“Lacertus viridis” from Gessner’s (1671) last edition, the so called “Frankfurter Ausgabe”. Wood cut.- The eye-catching

bars across the tail indicate the whorls typical for a Lacertid tail. The text consists of medical and cosmetic advices, the latter in

the form of a verse. The different insights of a painter and a mere engraver as well as the different qualities of a water colour com-

pared with an engraving are shown by a comparison to an Aldrovandi image (Fig. 3).

now, came slowly. Shaw worked in a surprisingly substan-

tial intellectual milieu of peers who would look critical-

ly at any change from established authority”. A compara-

ble thoughtfulness seems to have been widespread in sc1-

ence — at least then (compare the situation of N.M. Op-

pel after his studies in Paris, being surrounded by “natu-

ral philosophers” in Munich since 1811; Schmidtler 2009:

509; Figs 16, 17 hoc loco).

The “Histoire Naturelle des Quadrupédes Ovipares et des

Serpens” by Lacepede (1788/89) is a milestone in the his-

tory of natural science. It highlights the beginning of the

acceptance of Linnaeus’s binominal system also in

France, then leading in natural science. Up to that time

the well known scientific controversies of Linnaeus

(1708-1779) and Buffon (1708-1788) had prevented to

a large extent the application of Latin binominal names

in the French zoological and botanical literature, especial-

ly in the dozens of volumes of Buffon’s “Histoire Na-

turelle” having appeared since 1750. The acceptance of

Linnaeus’ binominal system by Lacepéde appears admit-

tedly in a rather hesitant and concealed manner. It turns

Bonn zoological Bulletin 57 (2): 307-328

up only in the gigantic Latin “Synopsis methodica

Quadrupedum oviparorum” beside the French “Table

méthodique des Quadrupedes ovipares” (see the elaborate

description in David et al. 2002: Fig. 2). Here Lacepéde

accepted two classes. His first class (“Quadrupedes ovipari

caudati”) comprises two genera, 7estudo and Lacertus

(“Corpus absque testa’). The latter, with 56 species, is di-

vided into eight divisions (“divisio”) which are each de-

scribed shortly, but not named. As Spix (1811: 342) point-

ed out there is however a contradiction between La-

cepéde’s (1788) zoological findings in the text and the con-

struction in the “Table méthodique” when stating that the

salamanders are nearly related with the frogs. He accept-

ed two current lacertid species in his third division (Lac-

ertus cinereus and Lacertus viridis; both highly collective

groupings, comprising among others the current genera

Lacerta / Timon and Podarcis / Zootoca respectively; see

also Schmidtler & Béhme, in prep.). The six species of

salamanders are, contrary to Linnaeus and Gmelin, con-

centrated in one division (“VIII. Divisio”). It may be not-

ed that the name with the male gender “Lacertus” La-

cepéde, 1788 is regarded to be an unjustified emendation

©ZFMK

Taxonomic history of the genus Lacerta 311

—

Fig. 3. Podarcis siculus ssp. From the collection of Aldrovan-

di’s natural history images (16'" century), see also Ceregato &

Alessandrini (2007: fig. 462 upper part) and Delfino & Cerega-

to (2008). Water colour (Tempera). — The shapes and colours of

lizards are excellently painted but the head shields are scarcely

indicated. The naming of tail anomalies (especially Lacerta “‘bi-

ceps”!!!) reveals the lack of a species concept and the lack of a

preset nomenclatural terminology. See chapter 3.2.

of Lacerta Linnaeus, 1758 (see David et al. 2002: 24). La-

cepede’s volume | and volume 2 (on the snakes) were re-

jected in general as a non-binominal work. This opinion

remained heavily controversial (see David et al. 2002: 22;

Dubois & Bour 2010). Anyway, one year later many

species were adopted by Bonnaterre (1789) who has there-

fore become the correct author of many of Lacepéde’s

names not being available. On Bonnaterre’s Lacerta see

more in chapter 2.2.

As obvious from the title, Bechstein’s encyclopedia

(1800-1802), “Herrn De la Cepede’s Naturgeschichte der

Amphibien” is first of all a translation from Lacepéde’s

(1788 / 89) Histoire Naturelle, but comprising many ad-

ditions. Bechstein used German terms. In his “Methodis-

che Ubersicht der eyerlegenden vierfiiBigen Thiere” he

translated Lacepede’s system with the terms Classe, Gat-

tung (genus) and Art (species), inserting the term “Fam-

ilie”, apparently in the sense of a species group below his

“Gattung” in some genera, like the “Eidechsen” (lizards).

He neglected Linnaeus’ Latin binominal teminology to a

large extent. His terminological system concerning the cat-

egory “Art” (species) is inconsistent and confusing. In his

“Zweyte Gattung, dritte Familie” (vol. II, like in Lacepéede

1788) some current Lacertidae (“L. cinereus, die graue Ei-

dechse” and “L. viridis, die griine Eidechse’”’) are com-

prised. He gave an excellent picture of the “Graue Ei-

dechse / L. cinereus” (vol. I, Taf. 1; depicting the male

and the female of a present-day Lacerta agilis), and

demonstrating thereby that this important taxon was then

differently understood in different European countries (see

Fig. 4.

Lacerta agilis (male). Left figure: Draft of the right figure; drawer Résel von Rosenhof (Cod. Icon. 48, Bayerische Staats-

bibliothek Miinchen; before 1758). Water colour. — Right figure: Frontispiece in Résel v. Rosenhof (1758). Hand coloured engra-

ving.- The changes in scientific insight by the famous drawer and natural scientist Résel mirror as well his personal “metamor-

phosis” as the changes in general views in differentiating a “salamander” (left: with its nude skin!) from a lizard (right: with its li-

felike scaly skin and pileus scutes; but: occipital and interparietal scutes are still lacking!). Both, salamanders and lizards, became

in the same year parts of the Linnean genus Lacerta.

Bonn zoological Bulletin 57 (2): 307-328

©ZFMK

312 Josef Friedrich Schmidtler

also Schmidtler 2004; Schmidtler & Bohme in prep.). In

his “Anhang” (additions; vol. I, 297-325) however, Bech-

stein on the one hand accepted the modern binominal ter-

minology of Laurenti (1768) and Schneider (1799; e.g.

Stellio phylluros, p. 307) or used Gmelin’s (1789: 1060)

Latin species group terms, (p. 311; like Stelliones =

“Spiegeleidechsen”).

2.2. Early generic splitting after Linnaeus

Laurenti (1768) was the first to subdivide the Linnean gen-

era of amphibians and reptiles (Testudines excluded) in a

comprehensive work, especially Linnaeus’ large genera

Lacerta and Coluber. Laurenti totally suppressed the name

Lacerta, but established instead of 11 new genera within

his order II ““Gradientia” (see Kuzmin 2005: 246), among

them “Seps’’ comprising also the current species of Cen-

tral European Lacerta and Podarcis and some of their syn-

onyms (see chapter 2.4; see Fig. 1). After Steyneger’s

(1936) type species designation (Seps caerulescens = La-

certa agilis; see also Dubois 2010; and Fig. 6 hoc loco)

Laurenti’s Seps became a junior synonym of Lacerta. Seps

Laurenti comprised after all only four current families, all

within the Squamata (Lacertidae, Scincidae, Teiidae,

P1668.

} il Wi)

| I

tll AN AAW

Fig. 5.

Gymnophthalmidae) and appears therefore much more re-

stricted than the Linnean Lacerta.

Laurenti’s splitting had still an earlier forerunner in

Garsault’s (1764) long forgotten and just rediscovered

work “Les Figures des Plantes et Animaux” here concern-

ing in particular the French herpetofauna around Paris in

ten plates (see Welter-Schultes et al. 2008, 2009; Dubois

& Bour 2010; Fig. 5 hoc loco). Garsault (1764) used the

species names Lacertus terrestris (now: Podarcis muralis

(Laurenti); nomen conservandum), Lacertus viridis (now:

Lacerta bilineata Daudin; nomen conservandum), the

genus names Scincus, Salamandra (with the French name

“salamandre” behind; depicting Salamandra salamandra

terrestris Bonnaterre). A certain systematic unstableness

is however unmistakable when depicting the crested newt

(today 7riturus cristatus (Laurenti), nomen conservan-

dum) under the Latin nomen Lacertus aquatilis, but simul-

taneously under its French name “Salamandre d’eau”.

Valmont de Bomare in the second issue of his “Diction-

naire d’ Histoire Naturelle” (1767/68) added for the first

time Latin names to the French names. There appear like-

wise considerable systematic inconsequences: On the one

hand, under the key word and generic name “Lézard / Lac-

' b j | =)

jidse id j j 1}

| |

Mi i

TORING

“Lacertus terrestris” (= Podarcis muralis; western subspecies) from Garsault (1764), a forerunner of Laurenti (1768),

having been rediscovered in the last years (see Dubois & Bour 2010). Copper engraving. — The pattern of the upper head scutel-

lation (right figure) is not yet perfect; the frontal and postfrontals are not executed within the central part of the pileus.

Bonn zoological Bulletin 57 (2): 307-328

©ZFMK

Taxonomic history of the genus Lacerta 313

Tas: I. ,

Fig. 6. Seps caerulescens (= Lacerta agilis; Fig. ID), Seps muralis (= Podarcis muralis; Fig. 1V), Seps argus = a juvenile La-

certa agilis; Fig. V). From Laurenti (1768: Tab. I, upper part). Copper engraving. — Laurenti’s (1768: Tab.I, fig.II]) Seps caerules-

cens has accomplished perfection for the first time in the history of a lacertid engraving: The arrangement and shape of all of the

pileus scutes are accurate. In equal measure the dorsal pattern is very representative for the species. This figure is all the more out-

standing, as Laurenti himself was obviously not yet aware of the enormous impact of head scutellation in species recognition. So

it was the exactness of the drawer and the engraver who were solely responsible for the quality of the figure. Developments like

these demonstrate the prospective relevance of naturalistic figures in book illustration for the scientific progress in reptile syste-

matics about 1800. Otherwise, the quality of the smaller figures IV and V is considerably lower and does scarcely contribute to

species recognition.

ertus” (Vol. III, p. 548, 1768), all the “amphibian species”

in Linnaeus’ (1758) sense are understood. On the other

hand, under the keyword Salamandre / Salamandra, Val-

mont de Bomare (vol. V, p. 441, 1767) described only “re-

al” salamanders, and explicitely the two species Salaman-

dra terrestris (currently: Salamandra salamandra ter-

restris Bonnaterre) and Salamandra aquatica (apparent-

ly a collective species comprising some current species

of water newts, especially 7riturus cristatus). This diction-

ary was however suppressed by the ICZN (Anonymus

1925; Dubois & Bour 2010), its nomenclature not being

always binominal for species.

Although Bonnaterre (1789; see also 2.1), often misun-

derstood as a mere copyist of Lacepede, took over many

details from Lacepede (1788) in his “Tableau Ency-

clopédique”’, he did not follow him (nor indirectly Lin-

naeus) in his generic lumping. On the contrary, he wide-

ly accepted the generic splitting by Laurenti. His first class

(“Reptilia ecaudata”) comprised the three genera of Lau-

renti: Rana, Hyla, Bufo, whereas his second class (Rep-

tilia caudata) with seven genera approached Laurenti’s sec-

ond order (less genera indeed), excluding the snakes as

well, but comprising the turtles (Zestudo). Bonnaterre’s

Lacerta comprised 52 species, among them still some of

Laurenti’s new “lizard” genera, like Basiliscus, Iguana,

Ameiva, Stellio. Bonnaterre suppressed Laurenti’s gener-

Bonn zoological Bulletin 57 (2): 307-328

ic name Seps and the current Lacertidae are comprised in

his genus Lacerta. He also doubted the validity of some

of Laurenti’s new species (e.g. Seps caerulescens, now

Lacerta agilis).

Latreille in Sonnini & Latreille (1801) in gross terms ac-

cepted the generic systematics of Laurenti (1768). Some

of Laurenti’s species of the new genus Seps were includ-

ed in the “Ie genre Lézard, Lacerta’. Latreille anticipat-

ed many of Daudin’s (1801-1803; see chapter 3.3) de-

scriptions and took the opportunity to thank him for his

communications (1801, vol. 1, p. 215; “M. Daudin...a eu

Vamitié de me communiquer, par extrait, les descriptions

qu’il a faites de plusieurs reptiles de la famille des

lézards... Il me sera doux, en le citant, de lui payer a la

fois le tribute de mon estime et celui de l’amitié”’). Harp-

er (1940) named this procedure a certain sort of piracy.

In early regional faunas, which do not cover the whole

family of lacertids, the acceptance of Linnaeus’ lumping

or Laurenti’s splitting was heterogenous. Being one of the

first authors, Schrank (1784 and 1798) completely adopt-

ed Laurenti’s genera (e.g. “Salamandra atra” Laurent,

“Seps viridis” Laurenti), whereas Razoumowsky (1789)

or Wolf in Sturm (1799, 1802, 1805) were using Linnaeus’

terminology system (e.g. “Lacerta agilis” Linnaeus or

Lacerta paradoxa s. helvetica” (n.sp.; now the newt Lis-

©ZFMK

314 Josef Friedrich Schmidtler

THE GREEN LIZARD.

Tux colours of this species are subject to variety,

becoming pale at certain seasons of the year, and

more particularly after the death of the animal.

The upper parts of the body are of a beautiful

green, more or less variegated with yellow, grey,

brown, and even sometimes with red. In warm

regions it grows to a larger size than in more

temperate countries, being sometimes found thirty

inches in length. The inhabitants of Africa eat

the flesh of this animal.

Fig. 7. “Green lizard” (= Lacerta viridis); probably the first

lizard in the renewed wood cut technique by Bewick (1809 —

1816; “wood engraving”; cf. Dance, 1989, Schmidtler, 2007).

As usual then, engravings of the “abhorrent” reptiles (so Linna-

eus 1758:194) were significantly of a lower quality than the birds

or mammals (cf. the images in Bewick 1791). Nevertheless this

green lizard is recognizable here. It was a great advantage of this

printing technique that the images could be printed together with

the text upon the same page (unlike copper engravings or litho-

graphs - these upon separate plates). So, later on, wood engra-

vings proved to be adequate for the popular small English “chap

books”, or the German “Naturgeschichten”. This kind of letter

press was also often used for schematic figures in a text page.

sotriton helveticus) in the former; “Lacerta atra” (Lau-

renti), and “Lacerta agilis” Linnaeus in the latter. In con-

trast Koch in Sturm (1828) made use of Laurenti’s gener-

ic names (“‘Seps stellatus” Schrank, “Triton alpestris” Lau-

renti) in the same “Deutschlands Fauna”.

2.3. An enormous increase of knowledge since 1800

Since about 1800 the knowledge in natural science in-

creased immensely and many new species were described.

Laurenti’s (1768) system of splitting the Linnean genera

began to win recognition. Nonetheless, Laurenti’s total re-

placement of the generic name Lacerta, e.g. by Seps, was

usually not accepted.

Bonn zoological Bulletin 57 (2): 307-328

Some months after the issue of Sonnini & Latreille’s

(1801) encyclopaedia Daudin started his “Histoire Na-

turelle des Reptiles” (“An X” = 1801; see Harper 1940

for the exact data). His “Second ordre. Les Reptiles

Sauriens” approximately conforms with the genus Lacer-

ta lumped by Linnaeus and Lacepéde (1789), but the sala-

manders were transferred to his fourth order “Les Rep-

tiles Batraciens” comprising also the frogs. His genus Lac-

erta is one of 16 genera within these “sauriens”, most of

them being current lacertids except the Ameivas. His

generic systematics resembles Laurenti’s (1768) splitting

system in general. One of the decisive differences was its

essential feature in the formal persistence of a large genus

Lacerta, whereas Laurenti’s generic name Seps was made

use of for only some two- or four-legged saurians.

Daudin’s greatest progress may be the redivision of his

newly split genus Lacerta: It comprised 32 species sub-

divided into seven unnamed “sections”. These sections

presage the present lacertid genera in some very ambigu-

ous outlines. For example, his second section “Lézards

verds” contains Lacerta ocellata (now Timon lepidus) and

Lacerta viridis (now: within Lacerta s. str.) as well, where-

as his fourth section “Lézards tachetés” contains “Lacer-

ta lepida”’ (a young Timon lepidus) and his new Lacerta

maculata (a very cryptic name in some respects). Espe-

cially with Daudin the level of knowledge began to in-

crease immensely. This growth did not only include fur-

ther generic taxa but also an inflation of species names

by naming “real” new species, also individual or local

variations, both sexes or juveniles. Replacement names

took the upperhand more and more. The names for the one

current species Lacerta agilis (three Seps species names

in Laurenti (1768); see Schmidtler 2004 and Kuzmin

2005) were augmented by Daudin to three more names

(male, female, young) in his fifth section “Lézards gris”.

This fifth section comprised also his “lézard gris” with the

Latin name “Lacerta agilis” (currently Podarcis muralis).

Until very recently Oppel (1811, see Fig. 16) was held as

the author of the family Lacertidae (“Lacertini”) (now:

Lacertidae Batsch, 1788; cf. e.g. Speybroeck & al. 2010).

Based upon Dumeéril (1806) he moved ahead the system-

atics in the higher categories and made them clear by trees

as a forerunner of evolutionary ideas (Schmidtler 2009).

Merrem (1820) was the first to publish a schematic im-

age and a terminology of the lacertid head scutellation

(chapter 3, Fig.12). His genus Lacerta comprised 27

species, some of them being new. His systematics is based

in general upon Daudin (1801-1803), Oppel (1811) and

Cuvier (1819). He introduced some new terms and taxa

in the higher categories. So his genus Lacerta is part of

the “stirpes” A. Ascalabotae, the “tribus” 1. Gradientia,

the III. order Squamata and the class 1. Pholidota (the 2.

class is named Batrachia).

©ZFMK

Taxonomic history of the genus Lacerta 315

P,Z.S 1908). Pl. LXVI.

Fig. 8.

Lacerta chlorogaster (= Darevskia chlorogaster) from Boulenger (1909: Pl. LVI). Below one chromolithograph (i.e. an

image printed successively with differently coloured lithograph plates), and above two (pen-) lithographs (scutellation of pileus

and surroundings of the anal region). The highly informative combination of naturalistic and schematic figures upon one lithogra-

phic plate turned up at first in the middle of the 19t" century.

The “Neue Classification der Reptilien nach ihren natiir-

lichen Verwandtschaften” was Fitzinger’s (1826) first im-

portant work (see Mertens, 1973). His “XI. Familia. Lac-

ertoidea. Lacertoiden” comprises three genera, among

them Lacerta with 17 species. It was apparently the first

time in a systematic listing that neither this family nor the

genus Lacerta comprehended any taxa now being ranked

outside the present-day Lacertidae.

It was the age of the great systematic monographs and

shortly afterwards Wagler (1830) published his “Natiirlich-

es System der Amphibien mit vorausgehender Classifica-

tion der Saugethiere und Végel”. Wagler’s monograph is

especially distinguished by comprehensive and progres-

sive morphological and anatomical descriptions and con-

siderations (pp. 211-344). His genus Lacerta only com-

prised lizards belonging to the current genera Lacerta

(s.str.) and Timon. His “Familia III. L. autarchoglossae”

comprehended the Linnean taxa Lacerta and Tachydro-

mus, as well as the new lacertid genera Zootoca, Podar-

cis, Aspistis, Psammuros (the latter two are still synonyms

of Psammodromus Fitzinger), apart from some genera be-

Bonn zoological Bulletin 57 (2): 307-328

longing to other current families. Zootoca and Podarcis

were regarded mostly as synonyms subsequently, but were

revalidated more than 150 years later. All in all Wagler’s

systematics of the genus Lacerta appears rather modern

(Fig. 1).

The “Histoire Naturelle des Reptiles” in eight large vol-

umes by Duméril & Bibron (1834-1854) represents a new

kind of herpetological monograph, compared with

Daudin’s (1801-1803) work. Especially because of the im-

mense growth of knowledge the different species chap-

ters increased, comprising different sub-chapters (e.g. in

Lacerta vivipara: “caractéres, synonymie, déscription”

with “patrie et moeurs” in seven pages). His species chap-

ters on Lacerta were based on many detailed new works,

including also relatively new disciplines (e.g. reproduc-

tion biology) by Milne Edwards (1829), Duges (1835),

Cocteau (1835) and Tschudi (1837). Dumeril & Bibron

(1839) were lumpers, compared with Wagler (1830). Their

genus Lacerta comprised 16 species (some of them new),

subdivided into three species groups. Their genus Lacer-

ta is currently ranked in 14 genera, some of them having

©ZFMK

316 Josef Friedrich Schmidtler

a. Pact AZ

» Be oe

| eee >.

ry.

Qa ry

la. ie i

Fig. 9.

Ventral sides of “Lacerta muralis vars. lilfordi / serpa / brueggemanni”’ (i.e. now three different species of Podarcis),

from Boulenger (1905: pl. XXII). — Hand coloured photos (The combination of hand colouring and photographs was very unusu-

al then in natural science). The spotting and the colouration are of systematic importance in these “varieties”. The diagnostic fea-

tures, especially the sutures of the shields, are not presentable simultaneously in the same figure (See Fig. 8!). — In 1853 the new

technique of photography had been received with enthusiasm after a publication on reptiles (varans and a crocodile) and other ani-

mals (“Even the best painter would not have the patience and ability to make visible all the details and structures. ..”; see Niekisch

2010).

been described before Duméril & Bibron. The present-day

Lacertidae corresponds to Duméril & Bibron’s subfami-

ly “Coelodontes” comprising nine genera. Duméril &

Bibron (1839: 1-19; 181-189) published a substantial his-

torical outline of their family “Lacertiens ou Autosaures”

and their genus Lacerta, respectively.

It is worth mentioning the chapters on “Erpétologie” or

“Lézards” in different French natural science dictionaries,

which are now more or less forgotten. They mirror im-

posingly the general advances in herpetology between

1800 and 1850 and in Lacerta in particular: See Bosc

d’ Antic (1817: 521-528), Cloquet (1819/1823), Bory de

Saint- Vincent (1826/1828), Cocteau (1835) and Meunier

in Guérin (1836).

Contrary to Duméril & Bibron (1839), Fitzinger (1843)

proved to be a splitter. Within his class Reptilia he includ-

ed the categories “Series”, “Ordo”, “Tribus” and ‘“‘Famil-

Bonn zoological Bulletin 57 (2): 307-328

ia”. The present-day Lacertidae were divided into three

families: Lacertae, Tachyscelides and Eremiae. His first

family Lacertae comprised four genera (Scelarcis, Podar-

cis, Chrysolamprus, Lacerta), most of them being subdi-

vided into subgenera. As Mertens (1973: V) stated,

Fitzinger’s (1843) work is of tremendous significance for

the study of amphibians and reptiles, not so much of the

nearly one hundred new generic and subgeneric names

proposed, but because he always cited generic type

species. In the case of Lacerta this tremendous signifi-

cance is manifested in Fitzinger’s (1843: 20) determina-

tion of “Lacerta agilis. Linné” as the type species of Lac-

erta. The excellent coloured engraving by Wolf (1799)

may have been here the decisive motive. Like Kaup (1836;

see also Fig. 17), Fitzinger (1843: 12) was also a follow-

er of the so called, unusual “Naturphilosophie” (natural

philosophy), then distributed above all among German

speaking natural scientists.

©ZFMK

Die Griinen

vom Kaiserstuhl

e Kalserstuhl ist

Y cults irmstes

Weinbaugeblet und vul

kanischen Ursprungs.

Die dortigen LéBberge

sildlicher Lagen erwirmen sich im Hoch:

sommer bis auf 40 °C und darilber. Aber

Gas macht ein vorziigliches Welnbauge-

Diet noch nicht aus — erst die Durch

schnittstemperaturen sind es, die Spitzen:

weine, aber auch seltene Tiere und Pflan

zen gedeihen lassen.

Unsere Smaragdeidechsen

Klimatisch bevorzugte Inmitten kihlerer

Gegenden — der Kalserstuhl liegt zwi

Taxonomic history of the genus Lacerta 317

Text und Fotos von Walther Rohdich

Norden geschoben: flr Orchideen, In

Sekten und Reptilien. Damit kommen im

Kalserstuhl Arten vor, die wir erst wieder,

und da sehr zahlreich, im Mittelmeer

raum antreffen. Dem uns hier am mels:

ten interessierenden Tier wollen wir uns

Ugste Eldechse, die

(Lacerta dilineata), Si

Deutschland, aber

Schwesterart Lace!

einigen Stellen inselartig vor. Die Sma

ragdeidechse ist die Wirmebedtirftgste

unserer Eldechsen. AuGer am Kaiserstuhl

Ein Maikifer ist cin fetter Happen

lebt sie noch In der

und im Donaugel

4) sowie an}

fa), Das Vorkommen

Mark Brandenburg

ten Jahrzehn:

bau der Welnber

hen. Der Bestand

Kurz elnig zu lhrer Biologie: Die

Smaragdeldechse ist dle gréfte Eldechse

Mitteleuropas, mit einer Linge von 40

cm. Sle Ist durchgehend leuchtend

grin gefdrbt, mit ve; enen

Anordnungen dunkler h

nungselemente, wie Punk:

far dieses prachtyolle Mannchen im

schen den ruppigen Gebirgen Schwarz Hochra eid.

wald und Vogesen — sind meistens

Oasen fiir ungewéhniiche Tiere

und Pflanzen. So auch hier:

Hauptlebensriume, die

weiter siidlich lie

gen, haben Aus

MWufer nach

te und Flecken. Die

Mannchen sind in

Fig. 10. Male of Lacerta bilineata from the journal “Reptilia”

(Nr. 20, 2004: 68): A perfect layout and a perfect digital colour

photo have been combined here. The beautiful and viewable pho-

tos serve firstly for keepers (demonstrating feeding habits, etc.)

and field herpetologists (identification in the field / shop) in po-

pular articles. In the light of modern genetic methods the images

have lost their traditional predominance in underlining systema-

tic descriptions.

2.4 The era

(ca. 1880-1920)

of George Albert Boulenger

The end of the 19th century was initially characterised by

new questions and topics as is displayed by Eimer’s (1881)

indication of «darwinism» in the caption of his article.

There infrageneric and infraspecific, geographical re-

searches came to the fore. I should like to emphasize the

basic advances, such as his formation of terminologies in

the dorsal pattern (Fig. 14). We may remember here his

long-standing controversy with Bedriaga concerning the

origin of colouration in insular lizards (see Muller 1994).

In this Darwinian sense Bedriaga (1886) tried to explain

the phylogenetic relations and origins of lacertid taxa (the

genus Lacerta with the five subgenera Lacerta, Algy-

roides, Tropidosaura, Zerzumia, Bettaia) by detailed dis-

cussions. His subgenus Lacerta, however, contained still

Bonn zoological Bulletin 57 (2): 307-328

species of all current subfamilies and tribes. With respect

to book illustration (see chapter 3) it may be regretted that

his descriptions were corroborated by a single lithograph-

ic plate only. The reasons here — as ever — may have been

economical ones.

Simultaneously the time of Boulenger’s great comprehen-

sive catalogues in herpetology commenced. In the intro-

duction of his Catalogue of the Lizards (three volumes)

Boulenger (1887) displayed the immense increase in the

numbers of lacertid species known and characterized:

Dumeéril & Bibron (1839), 43 species — Gray (1845), 57

species — Boulenger (1887), 97 species. Boulenger’s Lac-

ertidae comprised 17 genera and his genus Lacerta com-

prised 21 species, among them species of the whole

Eurasian and African range, i.e. species within the current

subfamilies Gallotiinae and Lacertinae (some species of

the current tribe Eremiadini not excluded; see Figs 1 and

19). The chapter «11 Lacerta muralis» (1887: 28) with

many «varieties» underlines his very typical species con-

cept. Boulenger’s vol. II contains a set of excellent lith-

ographs, among them the new species L. parva (now

Parvilacerta) and L. yayakari (now Omanosaura).

Meéhely (1909) carried out intensive studies on morphol-

ogy and osteology of European and Caucasian lacertids.

Aside from the further development of the terminology

of scutellation, osteology (Fig. 13), and pattern of muralis-

like lacertids, he described the genus Apathya and the «I.

Gruppe: Archaeolacertae» of his genus Lacerta, compris-

ing species of the current genera Anatololacerta, Phoeni-

colacerta, Hellenolacerta, Dinarolacerta, Iberolacerta and

Darevskia. His victorious species concept («species» in-

stead of Boulenger’s L. muralis-varieties) displays his fa-

mous controversy with Boulenger.

Schreiber (1912) adopted the view of Méhely and his

species concept within the European-Caucasian lacertids.

Within the current genus Podarcis he accepted as the first

in a large monograph not less than eight species, most of

them, especially Lacerta muralis and Lacerta serpa (= Po-

darcis siculus), comprising many varieties and subvari-

eties.

Boulenger (1920 / 1921), covered the lacertids in their

whole Eurasian and African range. Irrespective of the ac-

ceptance of six «sections» within Lacerta he insisted up-

on his system of the one muralis-like species, following

his catalogue (Boulenger, 1887) and later papers (1905 and

1913 especially; see Fig. 19). His Lacerta muralis (belong-

ing to his subgenus Podarcis Wagler) covers not less than

31 (!) «varieties». Most of them are presently species or

subspecies or invalid forms within the genus Podarcis, but

there are also taxa of the current genera Archaeolacerta,

Iberolacerta and Darevskia to be found. It seems now that

©OZFMK

318

Tab. IZ.

Tee

87 At Ait

Josef Friedrich Schmidtler

TABOR es:

AMPHIBIA nonmilla fiftens:

1, AMPHISBANA 87. annulis circularibus trur:

cum I—7o 3 caudamque 1—15 cins

gentibus.

a, Caput. b. Anus,

2. COLUBER 89 feuta abdomen tegentia i—8o;

fquame caudam fubtus tegen:

tes I—I7.

a. Caput. b. Anus: c. Apex caude.

9. ANGUIS 88. fquame abdomen tegentes 1-1203

> 1 ?

{quame caudam tegentes 1—17.

a. Caput. b. Anus.

4. CROTALOPHORUS 9%. feuta abdominis

I—903

feuta caude1—1 33

crepitaculi articuli

I—5;

c. Crepitaculum.

a. Caput. b. Anus.

z, DRACO 92. pedes quatuor; cauda; Ale due

cum radiis cartilagineis alarum.

aby

Qs Ps

Fig. 11. Some reptiles and their scale countings depicted by Linnaeus (1756: Tab. III; 94 edition. Copper engraving). The scale

countings refer mostly to the ventrals and subcaudals in snakes and were given especially in the text on the genus Coluber. In the

diagnoses of the genus Lacerta no scutellation features were used then. This is apparently the first attempt of a schematic delinea-

tion and description of body shields in herpetology. The same features were used also, without depictions, in the text of the 10t

and 12th editions (1758 / 1766).

his system was a relatively superficial morphological one,

because he accepted also some (morphologically) conspic-

uously different species besides his «L. muralis», like Lac-

erta taurica (now within Podarcis), or Lacerta chloro-

gaster (now within Darevskia). This was one of

Boulenger’s rare mistakes in which, soon later, the her-

petologists of this time did not follow his exceptional au-

thority.

Mertens & Miller (1928) adopted Boulenger’s (1920) Eu-

ropean subgenera (Archaeolacerta, Podarcis, Zootoca,

Lacerta), but they did not diverge in substance from the

species concept of Méhely (1909) and Schreiber (1912).

They were the first to accept geographical subspecies (see

Wermuth in B6hme 1981), 1.e. a trinominal nomenclature

in European herpetology (e.g. «Lacerta agilis exigua Eich-

wald»). In addition they carried out some changes being

nomenclaturally necessary (e.g. Lacerta lepida Daudin,

1802 - instead of the preoccupied Lacerta ocellata Daudin,

1802).

Bonn zoological Bulletin 57 (2): 307-328

In Mertens & Wermuth (1960) there are considered many

new discoveries of the European herpetofauna (especial-

ly new descriptions of many lizard subspecies of «Lacer-

ta» sicula, L. erhardii, L. melisellensis, L. lilfordi, etc.,

from Mediterranean islands, by Cyrén, Miller, Wettstein,

Radovanovic, Eisentraut, Buchholz, in various papers

each, since the second list of Mertens & Miiller (1940).

Nevertheless this «Dritte Liste» characterizes the relative-

ly stable generic and specific systematics and nomencla-

ture in lizards between 1940 and 1990.

2.5 Towards a final breaking up of the genus Lacerta

by new methods and techniques

The basic works of Arnold (1973, 1989) and Bohme

(1971) broke new ground in the systematics of the Lac-

ertidae. New techniques (genital-morphological, karyolog-

ical, electrophoretical, albumin-immunological, genetic

features) and modern univariate and multivariate statis-

tics were executed.

©ZFMK

Taxonomic history of the genus Lacerta 319

Fig. 12. Schema of the pileus scutellation in Merrem (1820:

p. XII-XII and fig. p. 191 upper part). (Pen-) lithography. —

The decisive step ahead in the schematic depiction of lizards was

made by Merrem (1820). Based upon his similar system in sna-

kes (Merrem 1790 and 1820), he gave names to the pileus shields

of an adult Lacerta ocellata (now: Timon lepidus; see his pages

XI and XII) and depicted their abbreviations in this figure. The

description covered seven types of scutes with the letters A (Wir-

belschilder — Scuta vertebralia), B (Hinterhauptschilder — Scu-

ta occipitalia), C (Augenbrauenschilder — Scuta superciliaria),

E (Stirnschilder — Scuta frontalia posterioria), F (Schnautzen-

schilder — Scuta frontalia anterioria), G (Rtisselschild — Scutum

rostrale, L (Nasenlécherschilder — Scuta nasalia). This system

was later on differentiated and improved by Milne Edwards

(1829: pls. 5—8) who depicted and described also the shields of

the lower sides of head, body and limbs. The concept of Mer-

rem (1820) and Milne Edwards (1829) remain valid today.

The first results of Arnold’s (1973, 1989; see Fig.1) elab-

orate researches, based mainly on morphology were the

revalidation of the old Waglerian genus Podarcis and of

Gallotia Boulenger, 1916 (then a subgenus) besides two

very preliminary groups, named “Lacerta groups [ and II’.

The taxonomic tentativeness at that time found its way in-

to the comprehensive “Handbuch der Reptilien und Am-

phibien Europas” (Bohme in BOhme 1981, Bohme, 1981).

Mayer & Bischoff (1996) (re-) established further sepa-

rations from the so far comprehensive genus Lacerta

(Zootoca, Omanosaura, Timon, Teira). They visualized a

phylogenetic tree of the Lacertidae from the relationships

of their serum albumins.

Bonn zoological Bulletin 57 (2): 307-328

The numerous and very detailed morphological works of

Arribas (1997/1999) resulted in the splitting off of the

mainly SW-European genus /berolacerta Arribas 1997,

and above all of the mainly Caucasian genus Darevskia

Atribas, 1997 from Lacerta. Thereby also a very old con-

troversy (especially of Méhely and Boulenger; see chap-

ter 2.4) on the muralis-like “Archaeolacertae” could be fin-

ished. The name Darevskia was given in honour of the

great Russian herpetologist IS. Darevsky (1925-2009)

who had detected parthenogenesis in these lizards, and

therewith in reptiles (see Darevsky 1967; Schmidtler

2010).

Beginning with the comprehensive work of Harris et al.

(1998) new genetic methods have also been adopted in the

systematics of the lacertids and they have caused here, like

everywhere in systematics, a revolutionary situation. DNA

sequences from parts of the 12S, 16S and cytocrome b mi-

tochondrial genes, together with morphological informa-

tion, were used to estimate the relationships within the

family. This work was continued by Arnold et al. (2007;

Fig. 20 hoc loco). DNA sequences indicated that the Lac-

Fig. 13. Schema of skull bones (“Lacerta horvathi’’= Ibero-

lacerta horvathi) in Méhely (1909: Taf. X, upper part) on the

basis of Siebenrock (1894). — In the middle of the 19" century

important osteological investigations also were executed in la-

certids. They allowed taxonomic research in the higher catego-

ries but also within lacertid genera and species, after a reasona-

ble schematization in osteology, above all in skull terminology,

had been found.

©ZFMK

320 Josef Friedrich Schmidtler

7887.

OTD oa

N erie

iy iv

RTE

“

WE ite n\ Sr a

Laf, XU.

Nema

io Ce

52a,

tee an Ven

a F

Fig. 14. Schema of the dorsal pattern in some Podarcis by Eimer (1881: Taf. XII). Lithograph. It was the research since the middle

of the 18 century which revealed the crucial importance of the dorsal pattern especially in the specific and infraspecific taxono-

my of the current genus Podarcis. Eimer (1881: Taf. XIII) named the different longitudinal zones (“I bis VI erste bis sechste Zo-

ne”) which usually exhibit a system of narrow light longitudinal streaks (nrs. I and IH, ““Grenzlinien”) and dark bands (nrs. II,” in-

neres / 4uBeres Band’). Méhely (1909: Fig. 1) eased his terminology and gave it the presently valid content; the seven light stre-

aks and dark bands were named after their initial points at the pileus shields (like “Supraciliarstreifen” and “Occipitalband”); see

also Schreiber (1912: Fig. 68; p. 333-335) and Mertens (1915: Fig. 3).

ertidae contain two subfamilies, Gallotiinae and Lacerti-

nae, the latter comprising two monophyletic tribes, the

Eremiadini of Africa and arid southwestern and central

Asia, and the Lacertini of Europe, northwestern Africa and

southwestern and eastern Asia. Relationships within the

108 species of Lacertini were explored using mtDNA for

59 nominal species. The morphology of the tribe was re-

viewed and also used to assess relationships. The Lacer-

tini were assigned to 19 monophyletic units of 1 to 27

species. There were described five new Lacertini-genera

out of the old collective genus Lacerta: Dalmatolacerta,

Dinarolacerta, Hellenolacerta, Iranolacerta, Phoenicolac-

erta (see Fig. 20 for a complete listing of current genera).

The new generic concept does not include subgenera ex-

cept in [berolacerta (Pyrenesaura Arribas, 1997). The

genus Lacerta is presently restricted to eight species, the

majority of them being polytypic: Lacerta agilis Linnaeus,

1758 (type species), L. bilineata Daudin, 1802, L. media

Lantz & Cyrén, 1920, L. pamphylica Schmidtler, 1975,

L. schreiberi Bedriaga, 1878, L. strigata Eichwald, 1831,

L. trilineata Bedriaga, 1886, L. viridis Laurenti, 1768.

Bonn zoological Bulletin 57 (2): 307-328

Thus the genus Lacerta appears to have finished its re-

duction through the centuries (Fig. 1) and to have stabi-

lized at a level a little above the species level (according

to the biological species concept). It seems however, that

the species systematics of the eight species of Lacerta has

not yet drawn to a close.

3. THE INTERACTION OF VERBAL DESCRIP-

TIONS AND ILLUSTRATIONS IN LACERTID TAX-

ONOMY

3.1 General notes

Zoological publishing in a modern sense, and together

with it, zoological book illustration, started at the end of

the middle ages, at the beginning of the renaissance era

in the 16' century (Nissen 1978: 113). They included

above all Belon, Gessner, Rondelet and Aldrovandi — all

of them physicians — who did no more than see their cru-

cial challenge in lining up reports and opinions of ancient

OZFMK

Taxonomic history of the genus Lacerta 321

De Animalibus in geuere. 83

Aninalinne Tabula generalis.

Animalia fune vel

{ Sanguinea, eaque vel

Pulmone refpirantia, Corde ventriculis przdito,

{ Duobus,

Vivipara,

[ Aquatica ; Cetaceum genus,

|| Terreftria, Quadrupedia, vel, ut Manat: etiam

< complectamur , pilofa. Animalia hujus

{| generis amphibia terreftribus annnme-

| T Bea

| Ovipara, Aves.

Unico, Quadrupedia Vivipara & Serpentes.

Branchiss. repirantia, Pifces fanguinei preter

i Cetaceos omnes.

LBivang nia

ements AN es

{ Mojora, quz vel

|| € Molliz, Manrdscy Poly pus, Sepia, Loiligo.

ee Maarunsseoxa, Locutta, Aftacus Cancer.

‘ Teftacea, "OsegxoSeeue, que vel univalvia, vel

|! bivalvia, vel eurbinata.

, Minora, Infeca,

Fig. 15. From Ray (1693): First attempt to exhibit affinities

or relationships in animals by a tree-like diagram; comprising

also amphibians and reptiles.

4, Familia.

authors without criticism. They made rather use of these

earlier authors descriptions to identify the indigenous fau-

na. They began to understand the pedagogic function of

images and the importance of accuracy in representing the

natural things in order to objectively describe them. The

most important collection of natural history coloured

paintings, among them 50 tables with amphibians and rep-

tiles, originates from Ulisse Aldrovandi (1522-1605), hav-

ing been detected for science and described in the last

years. “Their number and quality allow this collection of

images to be considered as the first attempt to organize

an iconographic atlas of the Italian and Mediterranean fau-

na and, without any doubt, the first collection of herpeto-

logical images realized with relatively modern criteria”

(Delfino, 2007; Delfino & Alessandro, 2008; Alessandri-

ni & Ceregato, 2007). The lack of a species concept and

the lack of the understanding of the animal organism, as

well as the use of different engraving- and printing tech-

niques (above all wood cuts) caused an excessive simpli-

fication in most contemporary publications and rendered

the figures useless to represent the distinctive character

of a species (cf. Gessner’s figure; Fig. 2 hoc loco). The

different insights of a painter and a mere engraver as well

as the different qualities of a water colour and an engrav-

ing are shown by a comparison of an Aldrovandi water

colour (Fig. 3).

It was about 250 years later, when the zoologist Hermann

Schlegel (see Schmidtler, 2007) delved into the theory of

natural science images (German translation in Nissen,

Lacertini.

Lingua tenuis, furcata, protractilis, scuta abdominalia et caudalia la-

teralibus majora, haec omnia verticillata.

squamae dorealibus sequales; cauda hicavinata —-

Capitis < scuta, dorsalibus

majora; collare

nullum -

Fig. 16.

distinctum 5 poo

Gula non dilatsbilis.

a upmambis,

(quadricarinata - Dracaena.

rotundata - - Lacerta.

- - - - = Tachidromus.

Diagram of the family “Lacertini” in Oppel (1811): Oppel (1811: 20) established the family “Lacertini” (now: Lacerti-

dae), among six families within his order ““Squamata’’. The “Lacertini” comprised four genera, two of them (Zupinambis and Dra-

caena) belonging now to other families, before Duméril (1806: No. 49-51) had established two families only (“Planicaudati” and

“Tereticaudati’’) in his order “Saurii’’.— Similar trees or identification keys like this and Duméril’s were the forerunners of an evo-

lutionary view in herpetology (see Schmidtler 2009).

Bonn zoological Bulletin 57 (2): 307-328

©ZFMK

1 Stannn, Ul. Gtannn.

X. Ordnuna, E. Ovounung,

@®reehkone,

Kialoten. I. Ordnuag,

Hlugeidechfer. ILE. Stamm. IV. Stamne.

LE. Ordmung. Flugeidechfer. Sramn Stat

WEE, Ovdnung, EF. Oronung. — ¥, Ovdnung.

Chamileone, CECidech fen. divokodile. War vive.

IXY, Ordming,

Megalefaurier,

1a. Ordnung. WE. Ordnung.

MeereiDechfen. Bepfe. V. Stain,

Le. Ovtnung, HO. Ovdnung. YF. Ovdnung.

Schildkroten. Schlangen. Srifche.

UWL Ordnung.

Sulawawder,

dT, Ordnung,

Cicilien.

Fig. 17. Diagram from Kaup (1836): His “III. Ordnung E1-

dechsen” (,,Lacertae“, text p. 26) corresponds to the rank of the

present day family Lacertidae, comprising several genera like

the “eigentliche Eidechsen” = Lacerta. His “Stamm” corresponds

nearly to a current order. In this diagram there is exhibited the

famous and strange dead end of “natural philosophy”; display-

ing more a mysticism of numbers than a concept of natural sci-

ence: Like in birds, mammals and amphibians as well, there

exists in Kaup only a strict number of five “Stémme” and in each

there are enclosed strictly three “Ordnungen”! See chapter 3.4.

This mysticism does not proceed in the number of lacertid ge-

nera. See also Fitzinger (1843) and the critique in Mertens

(1973).

acerla

Arico ts

| Notopholis / \

Gtxnyprt

Fig. 18.

Preertidn

Josef Friedrich Schmidtler

1978: 231). According to him it is the function of such a

figure to supersede the subjects difficult to be seen or ex-

amined in nature, in order to recognize them after the de-

piction and to be able to derive their shape, colours, pro-

portions and other features as exact as possible. The per-

fection of this claim calls for a full interaction of text and

illustration in the scientific, artistic and technical aspects

— in this article being demonstrated on the basis of the Lin-

nean genus Lacerta.

When the taxonomic importance of the different struc-

tures, like scales, spotting and colouration had been rec-

ognized about 1800, there originated also the need to dis-

play them separately from each other. The joint — natura-

listic — appearance interfered with their independant per-

ceptibility, for instance because of their poor visibility (e.g.

sutures of scutes), overlapping with spotting, light reflec-

tion (Figs 8, 9), etc. At the same time abstracted figures

(diagrams) were also used to exhibit relationships and /

or identification keys, etc. (Figs 15—20).

—— Puedes

oN Be yi

| Podareis

Nnmon j

orgllalips

From Camerano (1877: Tav. I, excerpt): Another rather popular kind of diagram displaying the relations between taxa.

The small circles within the large circles symbolise related taxa of the four lacertid genera (Lacerta, Podarcis, Notopholis, Timon).

The lines between such encircled taxa designate important morphological resemblances.

Bonn zoological Bulletin 57 (2): 307-328

OZFMK

Taxonomic history of the genus Lacerta 323

The first engraving — and printing — techniques were wood

cuts (15'* century), and shortly later, copper engravings.

Around 1800 copper engraving was refined (etchings) and

the first very expensive and rare colour prints in herpetol-

ogy were based upon them (Daudin 1802; see Schmidtler

2007) after centuries of hand colouring. Lithography (the

first lizards in Schmid 1819) was invented and improved

more and more up to the time of chromolithography (see

Fig. 8). Bewick (e.g. 1809-1816; Fig. 7) renewed the

wood cuts (“Wood engraving”). In the second half of the

19th century the first photographs appeared (see Niekisch,

2010; Fig. 9 hoc loco) and revolutionised the book-illus-

tration also in natural science and herpetology together

with new letterpress printing techniques. These technical

advances were attended by the expansion of some zoo-

logical / herpetological disciplines — or facilitated their

proliferation — like ethology, husbandry, ecology.

It is noteworthy to emphasize that each of the engraving-

and printing techniques displays its technical, artistic and

economical strengths and weaknesses as measured by the

different requirements they have to satisfy (see Schmidtler,

2007). Book illustrations were always expensive and this

was the most important reason why the informative val-

ue of many important works had to suffer immensely.

Greek Archipelago, S. Russia,

Constantinople, Asia Minor,

3.2 Naturalistic figures

As was explained above, the lack of species recognition

was especially responsible for rendering many figures use-

less in representing distinctive characters. This was espe-

cially the case for many of the reptiles, being regarded as

abhorrent or less important (except the venomous snakes),

compared to mammals or birds — up to the Linnean times

and later.

A good example is Gessner’s fabulous creature (Fig. 1),

called “‘Lacertus viridis”, and typically attended with a po-

em advertising a medical and cosmetic prescription. It is

only the indentations across the tail which suggests the

possible belonging to the current Lacertidae.

Shortly before Linnaeus, the “Thesaurus” of the wealthy

pharmacist Seba (1735) described many exotic animals

from Seba’s “Wunderkammer”. This voluminous work de-

picted also many mythical creatures — besides some in-

digenous reptiles, e.g. the male of a “Lacerta viridis” (=

Lacerta agilis), being identifiable only by means of the

distinctive dorsal pattern and the green and brown

colours (see Schmidtler, 2004: Abb. 1).

8 rudss Spanish Peninsula, Baleares,

c mays OA ftaly with Corsica & Malia. i

a portschinskit | dofilippii PaaeecosecocOsoass Sc aE ie ae ee Sei SEAS Dh eanleay RSE

= | ‘ i

Se | saxicola ' ' H

o-2 5 ot “ ' <]

q = 1 horvathi | bedriage sardoa ' hispanica — monticola t >

er , : (South Hungary) ' ES

3 chalybdea . caitcasica ; t =

<= 1 ee

ee Ss

erhard; | siliguerta wa

| ' ea

teroclvphi } ' \

hieroglyphica } : g

ares ee aces toca oe lee Soh = || insulanica nigriveniris _filfolensss a lilfordi =

| is He ky ;

a 6 H | quadrilineata 1 pityusensis | 2

a 3S ’ : j i ;

oe = | | i. brveggemanni AS ees hiolepis bocavii vaucheri ' =

ee 4 S :

2 ES ae

a CP TSR SROs Soca dee see Orne! SEE apa oe eeSoeer nets F Si

3 be serpa eee

wt @ = sateoncese 4

Zi 5

8 } typicg N

» : R

ui Easi Coast & Islainds of the Adriatic, be

Seeds event (31hl laatier | Li (iran?) 9) Sie? @igss-ssee+ La eee ante on RR rp NRE SUE EEA Bote a

> er er er brev ceps S

campestris _ fimane pe —— tieliselle:

Fig. 19.

From Boulenger (1913: 205-206): Linear diagram of the forms of Lacerta muralis: Citation: “The preceding diagram

expresses their affinities, as I conceive them, and also their distribution. It will also enable the reader to see at a glance how my

views on the possible derivation of these forms differ from those advocated by Prof. Méhely.” The “varieties” of Boulenger’s on-

ly species “Lacerta muralis” comprise four current genera (Podarcis, Darevskia, Iberolacerta, Archaeolacerta) with at least 17

current species and some more subspecies.

Bonn zoological Bulletin 57 (2): 307-328

©ZFMK

324

B oe perenne GOMotia galloti

Psammodromus algirus

= Omanosaura jayakari

100 ke eran _— === Omanosaura cyanura

68/51 |

#797 i y

AW cota Re : = Lacerta agilis

0.05 subs./site _

Fig. 20.

0 Podarcis muralis

————— aoe SCelorcis perspicillata

Teira dugesii

=== Timon princeps

== Timon lepidus

100 beens TION pater

Josef Friedrich Schmidtler

Gallotiinae

Eremiadini

ees Lakydromus sexlineatus

> Archaeolacerta bedriagae

Zootoca vivipara

Podarcis taurica

dUpHyAIVy]

1938]

IBUIGAIIV'T

Phoenicolacerta laevis gem. nov.

= Iberolacerta bonnali

Iberolacerta horvathi

Dalmatolacerta oxycephala gen. nov.

——==- Apathya cappadocica

Hellenolacerta graeca gen. nov.

Anatololacerta danfordi gen. nov.

Parvilacerta fraasii gen. nov.

Algyroides marchi

Franolacerta brandtii gen. nov.

Darevskia chiorogaster

— Darevskia saxicola

From Arnold et al. (2007: Fig. 1B): The most actual phylogenetic tree of the Lacertidae comprising in detail the tribe

Lacertini (among them Lacerta and the new genera Phoenicolacerta, Dalmatolacerta, Hellenolacerta, Anatololacerta, Iranolacer-

ta), having been broken up from it). The relationships are indicated by DNA sequences (ML tree from a reanalysis of the mt DNA

data set of Harris et al. (1998) based on cytochrome b, 12 S RNA and 16 S RNA). Different probability values resulting from Baye-

sian analysis are indicated.

The changes in scientific insight are visible by the differ-

ences of the earlier drafts and the final hand coloured en-

graving in Roésel v. Rosenhof’s (1758) famous frontispiece

(see Fig. 4).

Garsault (1764: pl. 688; fig. 5 hoc loco), a forerunner of

Laurenti (1768), and a splitter like him (Chapter 2), moved

an almost correct drawing of lacertids forward. In contrast

to this figure, Laurenti’s (1768: Tab.I, Fig.IID) Seps

caerulescens (= Lacerta agilis) has accomplished perfec-

tion for the first time in the history of a lacertid drawing.

Laurenti’s (1768) image remained unique for some

decades. Even the excellently hand coloured copper en-

Bonn zoological Bulletin 57 (2): 307-328

gravings of male and female specimens of Lacerta agilis

in Wolf in Sturm (1799) and Bechstein (1800) display

some deficiencies in pileus scutellation (cf. also

Schmidtler 2004). The black / white and coloured engrav-

ings in Daudin (1802) are comparably of a very different

quality. The colours of his excellently drawn shape of L.

ocellata (1802: pl. XX XIII; without the blue ocellae) re-

veals that he did not see a live specimen. But the shape

of the adult male is to the point. In Daudin (1801—1803),

part of the so called Sonnini edition, for the first time the

progressive but extremely expensive technique of colour

printing was used in herpetology (see Schmidtler 2007).

©ZFMK

Taxonomic history of the genus Lacerta 325

On the contrary, the hand coloured engravings in Sonni-

ni & Latreille (1801) are very small — and bad; likewise

the figures in the numerous popular editions of the French

natural histories, named “Buffon — Cuvier — Lacepéde’”’,

are out of the question. Their images were cribbed per-

manently and often lost their quality step-by-step up to an

unrecognisable condition.

In the second half of the 19th century research on colours

and patterns, the biological reasons and causes of their

adaptation, became important for the evaluation of infra-

specific variation and biology in general (Eimer, 1881: Taf.

XHI-XV). Subsequently, many subspecies, especially

within the current genus Podarcis (then mostly “Lacerta

lilfordi, Lacerta melisellensis, Lacerta muralis, Lacerta

sicula”), were based upon minute differences in scale

counts, colouration and pattern (see Mertens & Wermuth

1960). As a result of the genetic revolution in the last years

the importance of naturalistic figures in lacertid system-

atics is on the decline. At the same time top-quality pho-

tos (Fig. 10) have gained in importance especially in pop-

ular vivaristic publications.

3.3 Schematic figures

The abstraction of systematically important features, be-

ing more or less hidden to the unprejudiced observer, is

a condition for successful species recognition. The first

noteworthy attempts towards a schematisation of zoolog-

ical / herpetological features were displayed by Linnaeus

in his earlier editions of the “Systema Naturae” (Fig. 11).

It is above all the scale counts of ventrals and subcaudals

in snakes which are explained in his table III (Linnaeus

1756). Only these scale counts are given in the diagnoses

of snakes (see also Linnaeus 1758 and 1766).

The decisive step forward in lizards was made by Mer-

rem (1820). Based upon his similar system in snakes (Mer-

rem 1790, 1820; see Schmidtler 2006) he gave names to

the pileus shields of an adult Lacerta ocellata (now: Ti-

mon lepidus; see his page XI and XII) and depicted their

abbreviations in this figure. This description (see Fig. 12)

covered seven types of scutes with the letters A

(Wirbelschilder — Scuta vertebralia), B (Hinter-

hauptschilder — Scuta occipitalia), C (Augenbrauen-

schilder — Scuta superciliaria), E (Stirnschilder — Scuta

frontalia posterioria), F (Schnautzenschilder — Scuta

frontalia anterioria), G (Rtisselschild — Scutum rostrale,

L (Nasenlécherschilder— Scuta nasalia). This system was

later on differentiated and improved by Milne Edwards

(1829: pls. 5-8) who depicted and described also the

shields of the lower sides of head, body and limbs. The

concept of Merrem (1820) and Milne Edwards is valid up

to now.

Bonn zoological Bulletin 57 (2): 307-328

In the middle of the 19 century important osteological

investigations also were executed in lacertids. They al-

lowed taxonomic research in the higher categories but al-

so within lacertid genera and species, after a reasonable

schematization in osteology, above all in skull terminol-

ogy, had been found (Fig. 13 from Méhely). They brought

about the famous and interminable controversy of L. v.

Mehely (“splitter”) and G.A. Boulenger (“lumper’’) on the

then intractable “Muralis-Frage” (see Méhely 1909;

Boulenger 1920; among others).

It was the research since the middle of the 18" century

which revealed the crucial importance of the dorsal pat-

tern especially in the specific and infraspecific taxonomy

of the current genus Podarcis. Eimer (1881: Taf. XIH; Fig.

14 hoc loco) named the different longitudinal zones (“I

bis VI erste bis sechste Zone”) which usually exhibit a sys-

tem of n narrow longitudinal light streaks (nrs. I and III,

“Grenzlinien”’) and dark bands (nrs. II,” inneres / 4uBeres

Band”). Méhely (1909: Fig. 1) eased his terminology and

gave it the presently valid content. The seven light streaks

and dark bands were named after their initial points at the

pileus shields (like “Supraciliarstreifen” and “‘Occipita-

band”’); see also Schreiber (1912: Fig. 68; p. 333-335) and

Mertens (1915: Fig. 3).

Admittedly, morphological schemata (scutellation, dorsal

pattern) like these have lost their crucial taxonomic im-

portance in the 19th and 20‘ centuries during the last two

decades because of the reasons given above (see Section

252)

3.4 Diagrams

Semi-verbal depictions known in many different shapes

(concerning biology as a whole) are book illustrations in

broader terms. Contrary to naturalistic figures or the

schemata discussed above, phylogenetical trees, based up-

on genetic research, have become indispensable parts of

comprehensive taxonomic work in the last years (Fig. 20).

In many analyses the genetic distances currently have to-

tally replaced the traditional taxonomic decisions based

upon morphology and reproduction biology — be it ap-

propiate or not.

Tree-like diagrams, comprising also reptiles, trace back

to Ray (1693) (see Fig. 15). They have an enormous im-

portance in the history of general biology, not only in

lizards. In the field of herpetology, lizards included, they

became common practice since the basic works of Duméril

(1806) and Oppel (1811; Fig. 16 hoc loco; see also

Schmidtler 2009) and Cuvier in Cloquet (1819). Strange

to say, it was not clear in those pre-evolutionary times, if

the trees should represent identification keys only, or if

©OZFMK

326 Josef Friedrich Schmidtler

they should depict relationships (too) when illustrating the

Linnean hierarchical system by diagrams. Gould (2003:

105) explained the secret of the then triumph of the Lin-

nean categories (from species to class) being nested into

one another, by the circumstance that this system later on

was capable of being converted into a phylogenetic inter-

pretation (see also Schmidtler 2009: 500, Figs 7a—d).

The subsequent diagrams are not yet phylogenetic trees

in a strict sense; especially the one by Kaup (see Fig. 17),

who was a follower of the fanciful “natural philosophy”.

Similar is the quality of Camerano’s diagram (Fig. 18 hoc

loco) with its differently sized circles including the phe-

nomenon of resemblances due to morphology.

Acknowledgements. I thank Kraig Adler who reviewed the ab-

stract and Benno Schmidtler who drawed up Fig. 1.

REFERENCES

Alessandrini A & Ceregato A (eds.) (2007) Ulisse Aldrovandi

Natura Picta. Bologna, Compositori Editore

Arnold E N (1973) Relationships of the Palaearctic Lizards as-

signed to the Genera Lacerta, Algyroides and Psammodromus

(Reptilia: Lacertidae). Bulletin British Museum Natural His-

tory (Zool.) 25 (8): 291-366

Arnold E N (1989) Towards a phylogeny and biogeography of

the Lacertidae: relationships within an Old-World family of

lizards derived from morphology. Bulletin British Museum

Natural History (Zool.) 25 (8) 55 (2): 209 — 257

Arnold EN, Arribas O J & Carranza S (2007) Systematics of

the Palaearctic and Oriental lizards tribe Lacertini (Squama-

ta: Lacertidae, Lacertinae), with descriptions of eight new gen-

era. — Zootaxa 1430: 1-86

Arribas O (1997) Morfologia, filogenia y biogeogegrafia de las

lagartijas de alta Montana de los Pirineos.- Publicacions de

la Universitat Autonoma de Barcelona (Edicié microfotogra-

fica). Bellaterra

Arribas O (1999) Phylogeny and Relationships of the Mountain

Lizards of Europe and Near East (Archaeolacerta Mertens,

1921, sensu lato) and their Relationships among the Eurasian

Lacertid Radiation. Russian Journal Herpetology 6 (1): 1-22

Bedriaga J v. (1886) Beitrage zur Kenntnis der Lacertiden-Fa-

milie (Lacerta, Algiroides, Tropidosaura, Zerzumia und Bet-

taia). Abhandlungen. Senckenberg. Naturforschende Gesell-

schaft Frankfurt a.M. 14 (2): 17-444

Bewick T (1791): A General History of Quadrupeds. S. Hodg-

son & al., Newcastle upon Tyne (2. ed.).

Bewick T (1809-1819): A Natural History of British Quadru-

peds, Foreign Quadrupeds, British Birds, Water Birds, Foreign

Birds, Fishes, Reptiles, Serpents & Insects. Davison, Alnwick

(7 booklets)

Béhme W (1971) Uber das Stachelepithel am Hemipenis lacer-

tider Eidechsen und seine systematische Bedeutung. Zeitschrift

fiir Zoologische Systematik und Evolutionsforschung 9: 187—

223

Bohme W (ed.) (1981) Handbuch der Reptilien und Amphibien

Europas. Band | Echsen (Sauria) I, 2.1.7. Lacertidae — Ech-

Bonn zoological Bulletin 57 (2): 307-328

te Eidechsen, p. 373-375. Akademische Verlagsgesellschaft,

Wiesbaden

Bory de Saint-Vincent JBMG (1826) Lézard. Lacerta Rept. Saur.

In: Bory (ed.): Dictionnaire classique d’ Histoire Naturelle, vol.

9. Rey et Gravier, Paris

Bory de Saint-Vincent JBMG (1828) Précis d’herpétologie ou

histoire naturelle des reptiles. Complété par une iconogra-

phie des reptiles. Encyclopédie Portative

Boulenger GA (1887) Catalogue of the Lizards in the British mu-

seum (Natural history). Vol. IM. Lacertidae, Gerrhosauridae,

Scincidae, Anelytropidae, Diabamidae, Chamaeleontidae,

2nd ed., vol 3. Trustees British Museum XII

Boulenger GA (1905): A Contribution to our Knowledge of the

Varieties of the Wall-Lizard (Lacerta muralis) in Western Eu-

rope and North Africa. Transactions Zoological Society Lon-

don XVII (4): 351-424

Boulenger GA (1909) Description of a new Species of Lacerta

from Persia. Proceedings Zoolical Society London, 1908:

934-936

Boulenger GA (1913) III. Second contribution to our Knowledge

of the varieties of the Wall-Lizard (Lacerta muralis). Trans-

actions Zoological Society London XX (3): 135-230

Boulenger GA (1920/1921) Monograph of the Lacertidae, vol.

1/2. Trustees British Museum, London, England. X, 352 /

X-II, 451 pp.

Bose d’Antic LAG (1817) Lézard, Lacerta; tome 17, p.

521-528. In: Nouveau dictionnaire d’ Histoire Naturelle. Dé-

terville Paris

Camerano L (1877) Considerazioni sul genere Lacerta Linn. e

descrizione di due nuove specie. Estratto dagli Atti R. Aca-

dademia. Scienze. Torino, XIII

Cloquet H (1819) Erpétologie, (p. 217-259). In: Cuvier & Le-

vrault (ed.): Dictionnaire des Sciences Naturelles. Tome Quin-

zieme. Strasbourg

Cocteau T (1835) Sur un genre peu connu de Lézards vivipares

(Zootoca, Wagler), et sur une nouvelle espéce de ce genre. Re-

vue et Magazin de Zoologie

Cuvier G (1819) Table Synoptique de la Méthode erpé-

tologique. In: Cloquet, H. (1819): Erpétologie (p. 217-259).

In: Cuvier & Levrault (eds.): Dictionnaire des Sciences Na-

turelles. Tome Quinziéme. Strasbourg

Dance P (1981) The Art of Natural History. Bracken Books, Lon-

don

Darevsky, I.S. (1967): Skalniye yashtsheritsy Kavkaza. Lenin-

grad, Akademii Nauk

Daudin FM (1802) Histoire Naturelle, Générale et Particuliére

des Reptiles, tome troisiéme. Paris, Dufart

David P, Dubois A, Smith HM (2002) A Corrective Note on the

Authorship of Taxa Credited to Lacepéde and Bonnaterre in

the Introduction to the SSAR’s Reprint of Shaw’s General Zo-

ology. Volume III. Amphibians and Reptiles, with remarks on

some of Lacepéde’s works. International Society History and

Bibliography of Herpetology. Newsletter and Bulletin 3 (2):

16-27

Dawkins R (2008) Geschichten vom Ursprung des Lebens. E1-

ne Zeitreise auf Darwins Spuren (engl.: The ancestor’s Tale.

London 2004). Ullstein, Berlin

Delfino M. (2007) Un piccolo tesoro per gli erpetologi, p.

103-105. In: Alessandrini, A & Ceregato A (eds.) (2007) Ulis-

se Aldrovandi — Natura Picta. Bologna, Compositori Editore.

Delfino M & Ceregato A (2008) Herpetological Iconography

in16‘h century: the Tempera Paintings of Ulisse Aldrovandi.

Bibliotheca Herpetologica, 7 (2): 4-12

©ZFMK

Taxonomic history of the genus Lacerta 327

Donndorf J.A. (1798): Zoologische Beytrage zur XIII. Ausgabe

des linneischen Natursystems. Dritter Band. Amphibien und

Fische. Leipzig, Weidmannsche Buchhandlung

Dubois A (1988) The genus in zoology: a contribution to the the-

ory of evolutionary systematics. Mémoires Muséum d’ Histoire

Naturelle, Zoologie 140: 11-122

Dubois A. (2010): The multiple meanings of ancient zoological

terms. Bionomina | (in press)

Dubois A & Bour R (2010) The nomenclatural status of the no-

mina of amphibians and reptiles created by Garsault (1764),

with an unexpected and elegant solution to an old nomencla-

tural problem regarding the genus Bufo (Amphibia, Anura).

Zootaxa 2447: 1-52

Duméril AMC (1806) Zoologie Analytique ou Méthode Natu-

relle de Classification des Animaux rendue plus facile 4 l'aide

de Tableaux Synoptiques. Allais, Paris

Duméril AMC & Bibron G (1839) Erpétologie Générale ou Hi-

stoire Naturelle compléte des Reptiles. Tome cinquiéme. Pa-

ris, Roret

Eimer T (1881) Untersuchungen tiber das Variiren der Mauerei-

dechse, ein Beitrag zur Theorie von der Entwicklung aus con-

stitutionellen Ursachen, sowie zum Darwinismus. Archiv fiir

Naturgeschichte, Berlin, 47: 239-517

Fitzinger LI (1826) Neue Classification der Reptilien nach ih-

ren natiirlichen Verwandtschaften. J.G. Heubner, Wien

Fitzinger LI (1843) Systema Reptilium. Fasciculus primus Am-

blyglossae. Vindobonae (Wien), Braumiller et Seidel

Garsault FAP de (1764) Les figures des plantes et animaux

d’usage en médécine, décrits dans la matiére médicale de Mr.

Geoffroy médecin, dessinés d’aprés nature par Mr. de Garsault.

(Tome V): (3), pls. 644-729. Paris, chez l’auteur

Gessner K (“1662”, correct: 1671) De serpentibus. Oder

Schlangenbuch. Das ist eine griindliche und vollkommene Be-

schreibung aller Schlangen, so im Meer, siissen Wassern, und

auff Erden ihre Wohnung haben: sampt derselben eigentlichen

Abbildung. Erstlich durch den hochgelehrten und weitberithm-

ten D. Conrad Gefiner zusammen getragen. Und hernacher

durch den wolgelehrten Herrn Jacobum Carronum vermehrt,

und in diese Ordnung gebracht: Anitzo aber mit sonderem

Fleif} verteutschet. Franckfurt am Mayn (Wilhelm Serlin)

Gmelin JF (1789): Caroli a Linné Systema naturae per regna tria

naturae. Tom. I., pars III. Georg Emanuel Beer, Lipsiae, p.

1033-1516

Gould SJ (2003) Die Ltigensteine von Marrakesch. Vorletzte

Erkundungen der Naturgeschichte (engl. The Lying Stones of

Marrakech, 2003). S. Fischer, Frankfurt a. M.

Gray JE (1845) Catalogue of theSpecimens of Lizards in the Col-

lection of the British Museum. Trustees, London, XVIII

Harper F (1940) Some works of Bartram, Daudin, Latreille, and

Sonnini, and their Bearing upon North American Herpetolog-

ical Nomenclature. American Midland Naturalist. An Interna-

tional Journal of Ecology, Evolution, and the Environment.

University of Notre Dame Press, Notre Dame 23(3): 692-723

Harris DJ, Arnold EN, Thomas RH (1998) Relationships of la-

certid lizards (Reptilia: Lacertidae) estimated from mitochon-

drial DNA sequences and morphology. Proceedings Royal So-

ciety London B (1998): 1939-1948

Jahn I (ed.) (2000) Geschichte der Biologie. Theorien, Metho-

den, Institutionen, Kurzbiografien. 3., neu bearbeitete Aufla-

ge. Nikol Verlagsgesellschaft, Hamburg

Joger U (1996) Molekularbiologische Methoden in der phylo-

genetischen Rekonstruktion. Zoologische Beitrage, NF., 37:

77-131

Kaup JJ (1836) Das Thierreich in seinen Hauptformen systema-

tisch beschrieben. Zweiter Band. Naturgeschichte der Vogel.

Bonn zoological Bulletin 57 (2): 307-328

Zweiter Band. Zweiter Theil. Naturgeschichte der Amphibien.

Darmstadt, Johann Philipp Diehl

Koch CL (1828) Seps stellatus. Schr. Rothriickige Eidechse / 7ri-

ton alpestris. Laur. Brunnen-Triton (5 / 4p. + 3 / 4 pls). In: J

Sturm (ed.) Deutschlands Fauna in Abbildungen nach der Na-

tur mit Beschreibungen. Dritte Abtheilung. Die Amphibien.

4. Heft

Kuzmin SL (2005) Comments (to: Laurenti J.N. (1768): Speci-

men medicum, exhibens Synopsin Reptilium. Trattnern, Vien-

nae. Suppl. Zeitschrift fiir Feldherpetologie 7, Bielefeld, p.

237-247

Lacepéde BGE (1788) Histoire Naturelle des Quadupédes Ovi-

pares et des Serpens. Tome premier. Hotel de Thou, Paris

Laurenti, J.N. (1768): Specimen medicum, exhibens Synopsin

Reptilium. Trattnern (Viennae)

Linnaeus C (1756) Systema Naturae sistens regna tria naturae.

Accedunt vocabula Gallica. Editio multo auctior & emenda-

tior. Lugduni Batavorum, apud Theodorum Haak

Linnaeus C (1758) Systema Naturae per regna tria naturae, to-

mus I, editio decima, reformata. Holmiae, Laurentii Salvii.

Linné (Linnaeus), C a (1766) Systema Naturae per regna tria na-

turae, tomus I, editio duodecima, reformata. Holmiae, Lau-

rentil Salvi

Mayer W & Bischoff W (1996) Beitrage zur taxonomischen Re-

vision der Gattung Lacerta (Reptilia: Lacertidae), Teil I: Zooto-

ca, Omanosaura, Timon und Teira als eigenstandige Gattun-

gen. Salamandra, 32 (3): 163-170

Mayr E, Linsley EG, Usinger RL (1953) Methods and Princi-

ples of Zoology. Mc Graw-Hill, New York, Toronto, London

Mayr E (1984) Die Entwicklung der biologischen Gedankenwelt.

Vielfalt, Evolution und Vererbung (engl. The Growth of Bi-

ological Thought), Springer, Berlin, Heidelberg, New York,

Tokyo

Meéhely L v. (1909) Materialien zu einer Systematik und Phy-

logenie der muralis-ahnlichen Lacerten. Annales Musei Na-

tionalis Hungarici, VII: 409-621

Merrem B (1790) Beytraege zur Geshichte [sic!] der Amphibien.

Erstes Heft. Meyersche Buchhandlung, Duisburg, Lemgo

Merrem B (1820) Versuch eines Systems der Amphibien. Ten-

tamen Systematis Amphibiorum. Marburg, J. Ch. Krieger.

Mertens R (1915) Studien zur Systematik der Lacertiden. I. Teil

Untersuhungen tiber die Variabilitat der italienischen Mauerei-

dechsen (Lacerta muralis Laur. und Lacerta serpa Raf.). In-

augural-Dissertation, Leipzig

Mertens R (1973) Leopold Fitzinger: His Life and Herpetolo-

gical Work (Introduction to Fitzinger’s Systema Reptilium).-

Society for the Study of Amphibians and Reptiles. Misc. Pu-

blications. Facsimile Reprints in Herpetology

Mertens R & Miller L (1928) Liste der Amphibien und Repti-

lien Europas. Abhandlungen der Senckenbergischen Naturfor-

schenden Gesellschaft 41 (1): 1-62

Mertens R & Miiller L (1940) Liste der Amphibien und Repti-

lien Europas (Zweite Liste, nach dem Stand vom 1. Januar

1940). Abhandlungen der Senckenbergischen Naturforschen-

den Gesellschaft 451: 1-56

Mertens R & Wermuth H (1960) Liste der Amphibien und Rep-

tilien Europas (Dritte Liste, nach dem Stand vom 1.Januar

1960). Waldemar Kramer, Frankfurt a. M.

Meunier V (1836) Lézard, Lacerta. (Rep.), p. 401-412. In: Gue-

rin F-E (ed.): Dictionnaire Pittoresque d’ Histoire Naturelle et

des Phénoménes de la Nature. Tome Quatriéme. Bureau de

Souscription, Paris

Milne Edwards MH (1829) Recherches zoologiques pour ser-

vir a histoire des Lézards, extraites d’une Monographie de

ce genre. Annales Sciences Naturelles, Paris 16: 50-89

©ZFMK

328 Josef Friedrich Schmidtler

Muller, GH (1994) Zur Kontroverse zwischen Theodor Eimer

und Jacques von Bedriaga tiber die Farbung mediterraner Ei-

dechsen.- Aufsatze u. Reden Senck.naturf. Ges. 41: 101-116

Niekisch M (2010) Very early photographs of Reptiles. Herpe-

tological Rev. 51 (1): 50-51

Nissen C (1978) Die zoologische Buchillustration. Ihre Biblio-

graphie und Geschichte. Band I: Geschichte. Anton Hierse-

mann, Stuttgart

Oppel M (1811) Die Ordnungen, Familien und Gattungen der

Reptilien als Prodrom einer Naturgeschichte derselben. Joseph

Lindauer, Mtinchen

Razoumowsky G de (1789) Histoire Naturelle du Jorat et de ce

ses environs, tome premier. Lausanne, Jean Mourier

Ray (Raius) J (1693) Synopsis Methodica Animalium Quadru-

pedum et Serpentini Generis. Londini, Impensis S. Smith &

B. Walford

Rosel von Rosenhof AJ (1758) Historia Naturalis Ranarum No-

stratium. Die natiirliche Historie der Frésche hiesigen Landes.

Johann Jakob Fleischmann, Nirnberg

Scheller IJG (1796) Lateinisch-deutsches und deutsch-lateini-

sches Handlexicon vornehmlich ftir Schulen. Erster oder la-

teinisch-deutscher Theil. Leipzig, Caspar Fritsch

Schmid K (1819) Naturhistorische Beschreibung der Amphibien.

Lithographische Kunstanstalt, Minchen

Schmidtler JF (2004) Uber die Entwicklung der bildlichen Dar-

stellung bei der Zauneidechse (Lacerta agilis L.) im 18. und

19. Jahrhundert. Die Eidechse, 15 (3): 79-90

Schmidtler JF (2006) Blasius Merrems Beytraege zur Geschich-

te der Amphibien — eine neue Ara in der in der Methodik der

Schlangen-Darstellung. Sekretar. Beitrage zur Literatur und

Geschichte der Herpetologie und Terrarienkunde, Rheinbach,

6 (2): 45-60

Schmidtler JF (2007) Frihe Drucktechniken der zoologischen

und insbesondere herpetologischen Buchillustration (Bewicks

Holzstiche — Inkunabeln der Lithografie — Sonninis Buntkup-

ferdrucke). Sekretar. Beitrage zur Literatur und Geschichte der

Herpetologie und Terrarienkunde, Rheinbach, 7 (2): 16-38

Schmidtler JF (2009) Der ,, Thiermahler“ Nikolaus Michael Op-

pel (1782-1820) und die Anfange der herpetologischen For-

schung an der Bayerischen Akademie der Wissenschaften.

Zeitschrift ftir bayerische Landesgeschichte, Mtinchen 72 (2):

483-512

Schmidtler JF (2010) 50 years with herpetology and herpetolo-

gists in Turkey and the Near East. Cewe Fotobuch, Miinchen

Schmidtler JF & Bohme W (in prep. / press): The synonymy and

nomenclatural history of the Viviparous Lizard — now Zooto-

ca vivipara (Lichtenstein, 1823)

Schneider JG (1799) Historiae Amphibiorum naturalis et liter-

ariae Fasciculus Primus continens Ranas Calamitas, Bufones,

Salamandras et Hydros in genera et species decriptos notisque

suis distinctos. Jenae, Friederici Frommanni

Schneider JG (1801) Historiae Amphibiorum naturalis et litera-

riae Fasciculus Secundus continens Crocodilos, Scincos, Cha-

maesauas, Boas, Pseudoboas, Elapes, Angues, Amphisbaenas,

et Caecilias. Jenae, Friederici Frommanni

Schrank Fv.P (1785) Zwanzigster Brief. Thiere in Berchtesga-

den, p. 296-316. In: Schrank Fv.P & Moll E Ritter v.: Natur-

historische Briefe ttber Oesterreich, Salzburg, Passau und

Berchtesgaden.- Salzburg, Joh. Jos. Mayers seel. Erbinn

Bonn zoological Bulletin 57 (2): 307-328

Schrank Fv.P (1798) Durchgedachte Geschichte der in Baiern

einheimischen und zahmen Thiere. Erster Band. Nurnberg,

Stein’sche Buchhandlung

Schreiber E (1912) Herpetologia Europaea, 2. Aufl. Fischer, Je-

na, 960 S

Shaw G (1802) General Zoology or Systematic Natural Histo-

ry Volume II, Part I. Amphibia. London, G. Kearsley

Siebenrock F (1894) Das Skelet der Lacerta simonyi Steind. Und

der Lacertidenfamilie tiberhaupt. Sitzungsberichte Akad.

Wiss. CI

Smith HM & David P (1999) Introduction. George Shaw and

the Herpetology Volume in His Series, General Zoology. So-

ciety for the Study of Amphibians and Reptiles

Speybroeck J, Beukema W, Crochet P-A (2010) A tentative spe-

cies list of the European herpetofauna (Amphibia and Repti-

lia) — an update. Zootaxa 2492: 1-27

Spix JB (1811) Geschichte und Beurtheilung aller Systeme in

der Zoologie nach ihrer Entwiklungsfolge von Aristoteles bis

auf die gegenwartige Zeit. Schrag’sche Buchhandlung, Nirn-

berg

Valmont de Bomare JC (1767/68) Dictionnaire raisonné univer-

sel d’histoire naturelle contenant |’histoire des animaux, des

végéetaux et de minéraux. Paris, Lacombe, 6 vols

Wagler J (1830) Natiirliches System der Amphibien, mit vor-

angehender Classification der Saugethiere und V6gel.

Miinchen, Stuttgart und Tubingen, J.G. Cotta’sche Buchhand-

lung

Welter-Schultes FW, Klug R, Lutze A (2008) Les ?gures des

plantes et animaux d’usage en médecine, a rare work pub-

lished by F. A. P. de Garsault in 1764. Archives of natural His-

tory, 35(1), 118-127

Welter-Schultes FW & Klug R (2009) Nomenclatural conse-

quences resulting from the rediscovery of Les figures des plan-

tes et animaux d’usage en médecine, a rare work published

by Garsault in 1764, in the zoological literature. Bulletin of

zoological Nomenclature 66 (3): 225-241

Wermuth H (1981) Zum Geleit II (8-11). In: W. Bohme (ed.):

Handbuch der Reptilien und Amphibien Europas. Band 1 Ech-

sen (Sauria) I. Akademische Verlagsgesellschaft, Wiesbaden

Wolf J (1799) Lacerta agilis L. Kleinéugige Eidechse. Gemei-

ne Eidechse (10 p., unpag. + 2 pls.) / Lacerta salamandra L.

Gemeiner Molch. (12 p., unpag. + 2 pls.). In: J Sturm (ed.):

Deutschlands Fauna in Abbildungen nach der Natur mit Be-

schreibungen. Dritte Abtheilung. Die Amphibien. 2. Heft

Wolf J (1802) Lacerta palustris L. Der Wassersalamander / La-

certa taeniata Schneid. Der Teichsalamander. (14/10 p., un-

pag. + 2/2 p.). In: J Sturm (ed.): Deutschlands Fauna in Ab-

bildungen nach der Natur mit Beschreibungen. Dritte Abthei-

lung. Die Amphibien. 3. Heft

Wolf J (1805) Lacerta nigra Mihi. Die schwarze Eidechse (2 p.,

unpaginiert + 1 Tafel) / Lacerta crocea Mihi. Die gelbe Ei-

dechse (3 p., unpaginiert + 3 Tafeln). In: J Sturm (ed.):

Deutschlands Fauna in Abbildungen nach der Natur mit

Beschreibungen. Dritte Abtheilung. Die Amphibien. 4. Heft

Received: 20. VII.2010

Accepted: 20.[X.2010

©ZFMK

Bonn zoological Bulletin | Volume 57 | Issue 2 | pp. 329-345

Bonn, November 2010

A brief history of Greek herpetology

Panayiotis Pafilis !.2

'Section of Zoology and Marine Biology, Department of Biology, University of Athens, Panepistimioupolis,

Ilissia 157—84, Athens, Greece

2School of Natural Resources & Environment, Dana Building, 430 E. University, University of Michigan,

Ann Arbor, MI — 48109, USA; E-mail: ppafil@biol.uoa.gr; pafman@umich.edu

Abstract. The development of Herpetology in Greece is examined in this paper. After a brief look at the first reports on

amphibians and reptiles from antiquity, a short presentation of their deep impact on classical Greek civilization but also

on present day traditions is attempted. The main part of the study is dedicated to the presentation of the major herpetol-

ogists that studied Greek herpetofauna during the last two centuries through a division into Schools according to researchers’

origin. Trends in herpetological research and changes in the anthropogeography of herpetologists are also discussed. Last-

ly the future tasks of Greek herpetology are presented.

Climate, geological history, geographic position and the long human presence in the area are responsible for shaping the

particular features of Greek herpetofauna. Around 15% of the Greek herpetofauna comprises endemic species while 16%

represent the only European populations in their range.

THE STUDY OF REPTILES AND AMPHIBIANS IN

ANTIQUITY

Greeks from quite early started to describe the natural en-

vironment. At the time biological sciences were consid-

ered part of philosophical studies hence it was perfectly

natural for a philosopher such as Democritus to contem-

plate “on the Nature of Man” or to write books like the

“Causes concerned with Animals” (for a presentation of

Democritus’ work on nature see Guthrie 1996). The very

name of the discipline of herpetology derives from the

Greek words epzeto (reptile) and Adyog (science) while the

term amphibian reflects the typical dual (aquatic and ter-

restrial) life style of frogs (from the Greek augi — both—

and Biog — life).

The first formal Greek herpetologist was Aristotle

himself. In his books on animals (History of Animals,

Generation of Animals and On the Parts of Animals) the

father of zoology discussed the morphology, physiology

and classification of reptiles and amphibians. Nicander

was fascinated by the lethal power of snakes, focusing on

the venom of serpents in two of his surviving poems

(Theriaca, Alexipharmaca, see Knoefel & Covi 1991).

In late antiquity Pausanias, though he wasn’t a naturalist,

gave interesting information on the fauna and flora in

various locations in Greece through the ten books of his

notorious Description of Greece (EAAddoc¢ TMeptuiyots).

Bonn zoological Builetin 57 (2): 329-345

Therein one could find citations to the Greek herpetofauna

such as the Seriphian frogs or the tortoises of Arcadia.

REPTILES AND AMPHIBIANS IN GREEK

CULTURE

Snake venom and the ability for ecdysis had deeply im-

pressed ancient Greeks who incorporated reptiles in many

of their myths. Snakes were considered magical creatures,

capable of both good and evil, and were associated with

chthonic religious beliefs. In Minoan Crete snakes repre-

sented the underworld deities and were worshiped. Tens

of statuettes depicting the Goddess of Snakes have been

found in excavations all around the island. Ophion (from

the Greek ophis — oqis meaning serpent), one of the

mighty Titans, was the first ruler of Mount Olympus be-

fore he was cast down by Cronus and Rhea. According to

legend the first king of Athens, Kekrops, was half-snake

half-man (Supvng meaning double nature) and thanks to his

wisdom he decided to offer his city (known as Kekropeia

at the time which afterwards changed to Athens to honor

the patron goddess) to Athina instead of Poseidon when

the two immortals were fighting over its possession. On

the other hand Medusa (or Gorgon) the mythical monster

that had snakes instead of hair, could turn anyone who

©ZFMK

330 Panayiotis Pafilis

looked at her into stone. Perseus, using his shield as mir-

ror, made Medusa look at herself and then decapitated her.

He then offered her head to Athina who put it on her own

shield (known as gorgoneion) so as to petrify her enemies.

A serpent-like dragon, Python, was sent by Hera after

Leto, mother of Apollo and Artemis, to punish her for hav-

ing an affair with Zeus. Young Apollo took revenge for

his mother by killing Python at Delphi, where the serpent

dwelled. Since then the priestess of the oracle was named

Pythia. The etymology of the name derives from the verb

pythein (mbevv, “to rot”), referred to Python’s flesh in the

state of decomposition. The priest of Poseidon Laocoon

warned the Trojans about the Trojan Horse and tried to

convince them to burn it. Athina, who was supporting the

Greek army during the War of Troy, sent two snakes to

strangle and kill Laocoon together with his sons.

Greeks were aware not only of the lethal power of ven-

om but also of its healing properties. In the statues of

Hygeia, the goddess of health (the meaning of the word

in Greek), a snake is lying on her shoulders. Aesculapius,

the god of medicine and son of Apollo, was carrying al-

ways his famous rod, a snake-entwined staff (the species

was Zamenis longissimus). In his most magnificent tem-

ple in Epidaurus, that used to function as a hospital, a

strange construction known as tholos (dome) was erect-

ed. Patients spent the night inside tholos together with tens

of snakes that were believed to heal them. Two small

snakes were coiled around Hermes wand, symbolizing the

wisdom with which he spoke, since he was considered,

together with Athina, god of eloquence.

A fascinating story about the symbolic role of reptiles in

antiquity comes from the island of Aegina. During the pe-

riod of Aegina’s naval acme (6 century B.C.) the is-

landers coined silver staters depicting the sea turtle Caret-

ta caretta. However a terrapin (Zestudo sp.) replaced the

sea turtle when the neighboring Athens inaugurated its

long period of thalassocracy in Greek seas (after 480

B.C.):

Due to the arid climate Greeks were more familiar with

reptiles than amphibians. Thus only few references are

known from antiquity, like the Aristophanes’ comedy

“Frogs” (Batpayot) or the silver stater that Seriphians

coined (ca 530 B.C.) to honor their local hero Perseus

since frogs were associated with his cult (Pausanias, 2nd

century A.D.). Frogs from Serifos Island were famous in

antiquity for not croaking (another story linked to Perseus

legend) and the expression “Seriphian frogs” was used as

a popular proverb during ancient times for people refus-

ing to talk.

With the prevalence of Christianity reptiles become the

personification of evil, starting from the Original Sin. Saint

Bonn zoological Bulletin 57 (2): 329-345

George and Saint Demetrius, the so called militant saints,

are depicted as dragon slayers, symbolizing the triumph

of Good, as expressed by the Greek-Orthodox Church,

over Evil, the former idolatry faith. The Serpentine col-

umn, dedicated by Greeks in 479 B.C. to Apollo’s altar

at Delphi to commemorate the victory over the Persians

at the battle of Plataea, was formed by three intertwined

snakes (Tpixdprnvoc Oguc), meaning three-headed snake).

Constantine the First moved the column to the Hippo-

drome of his new capital. However the people of Constan-

tinople destroyed the higher part of the column (the heads

of the snakes) since they thought it was the representa-

tion of the devil. On the other hand the Apostolic Fathers

recognizing the wisdom of snakes were advising the first

Christians to be “prudent as the serpent” (Ignatius of An-

tioch to Polycarp of Smyrna).

Traces of the ancient beliefs still echo in folklore and

traditions. The presence of geckoes in a house is

considered good fortune. In many households in Cyclades

people used to fill with milk a small cup for the “snake

of the house” (in Greek onitdgid0, Zamenis situlus). The

most amazing case though comes from the island of

Cephalonia where pagan creeds survive together with

christian rituals at the temple of Madonna of the Snakes

(Ilavayta yn gidovoa). According to the legend a

monastery stood at the very same place. When pirates

disembarked close to the spot and tried to conquer and

harry the treasures of the monastery, nuns prayed for help

and Virgin Mary sent snakes that surrounded the building

and scared away the pirates. Every year at August the 15th

(when Greek Orthodox Church celebrates the Dormition

of Holy Mary) locals collect cat snakes (Telescopus fallax)

days prior to the feast and put them by the icon of the

Virgin. Pilgrims touch these snakes and even let them coil

around their shoulders or hands since they believe that they

will protect them from sickness.

GEOGRAPHY, BIOGEOGRAPHY AND SPECIES

RICHNESS

Greece is one of the small European countries with a to-

tal area of around 132,000 km?. However its unique lo-

cation at the biogeographical crossroads of three conti-

nents, each making its distinct biological contribution,

makes the country an invaluable site for biodiversity

(Lymberakis & Poulakakis 2010). The rough geological

mosaic encompassing mountain chains that separate the

country into clearly distinct climatic zones and the large

number of islands (approximately 8000, most of them in

Aegean Sea) have a huge impact on the flora and the fau-

na (Hausdorf & Hennig 2004). Hundreds of endemic

species are hosted in both the mainland and the islands

highlighting the region as a hot spot of endemism.

©OZFMK

A brief history of Greek herpetology 331

The climate is typical Mediterranean with long, dry and

hot summers and mild winters (though in the north and

the mountainous parts of the country winter period could

be harsh). These conditions are ideal for reptiles, which

thrives in the hospitable Greek habitats but also support

various amphibian species and populations. Despite the

small size of the country, Greece is home to one of the

richest herpetofaunas of Europe hosting 64 species of rep-

tiles and 22 of amphibians. Ten of the reptilian species are

endemic and 11 maintain their only European populations

in Greece, whereas the respective figures for amphibians

are 3 and 2, respectively.

The majority of Greek reptiles and amphibians has

Palearctic origin and are common in most of Europe or

the Balkans (e.g. Natrix natrix or Bombina bombina).

However, Greece hosts also species of Asian (e.g. Mon-

tivipera xanthina, Lyciasalamandra luschani) or even

African (Chameleo africanus) origin. Definitely the most

interesting group is the one comprised of the endemic

species, the majority of which are islanders, such as Pelo-

phylax cerigensis, Podarcis levendis or Macrovipera

schweizeri.

The range and particularities of Greek reptiles and amphib-

lans are, in a considerable degree, the result of the recent

geology of the eastern Mediterranean Basin. During the

Messinian salinity crisis, the Mediterranean Sea underwent

long periods of desiccation that, in Aegean Sea, led to the

emergence of landmasses that become islands. The old-

est Greek islands (Crete, Skyros and Karpathos) remain

to this status even after the Zanclean flood. The Ice Age

periods during the Pleistocene with their consecutive

freezing and warming conditions had a strong impact on

the area, shaping glacial refugia that harbored many cold-

intolerant species, which afterwards reinvaded the rest of

the Balkans (e.g. Rana graeca). Many islands were con-

nected either to mainland Greece or Asia Minor as a con-

sequence of the low sea level during the last Ice Age pe-

riod. Nowadays the herpetofauna of these islands still re-

flects this geological incident with islands closer to Greece

having a clearly “European” composition (e.g. Evvoia,

Thassos), whereas those next to Asia Minor show a more

“Asian” character (e.g. Lesvos, Chios, Samos). This sep-

aration between European and Asian herpetofaunas 1s fur-

ther supported by the existence of a deep-water trench run-

ning over the Aegean Sea from southeast to northwest,

separating the eastern “Asian” cluster from the western

“European” one with only few exemptions. Another im-

portant geological factor is the intense volcanism of the

region. The Aegean volcanic arch, spanning the southern

part of the area, was formed during the Pliocene as a con-

sequence of the northward subduction of the African plate

beneath the Aegean one (Fytikas et al. 1984). Milos Arch-

ipelago, a small but extremely important in terms of en-

Bonn zoological Builetin 57 (2): 329-345

demism island group, was separated from the rest of the

Cyclades by middle Pleistocene as a result of volcanic ac-

tivity (Sondaar et al. 1986; Dermitzakis 1990).

In summary, most endemic species are concentrated to the

oldest islands where the long history of isolation provid-

ed the necessary conditions for speciation. The astonish-

ing variety of subspecies in the islands, for instance 19 for

Podarcis erhardii and 13 for Cyrtopodion kotshyi reflects

the importance of insularity in the evolution of different

morphs. In mainland Greece endemic species are located

in the southernmost part of the country, Peloponnese,

thanks to historical biogeographical reasons (glacial

refugia) matched by a fair period of isolation.

Last, but certainly not least, humans had a significant con-

tribution in shaping the Greek herpetofauna. In the Aegean

Sea navigation started quite early (around gth millenium

B.C., Kotsakis 1990; Simmons 1991). Voyagers carried

materials (e.g. marble or pottery) that offered an excellent

opportunity for transportation of small-bodied species or

their hidden eggs (typical examples are Hemidactylus tur-

cicus and Tarentola mauritanica and most probably Lau-

dakia stellio). In some other cases humans may deliber-

ately transport reptiles or amphibians related to religious

beliefs. Apart from dispersal, human activities favored rep-

tiles with the deforestation of the largest part of the coun-

try, providing opportunities for thermoregulation and for-

aging. Thousands of kilometers of dry-stone walls all

around the country, and especially in the Aegean islands,

offer ideal hiding places and support thriving populations.

On the other hand touristic development with its acces-

sory consequences (water over-pumping, wetland

drainage, habitat degradation), over grazing and intensive

agriculture has largely altered the landscape, influencing

negatively upon reptiles and, mostly, amphibians.

THE FRENCH MOREA EXPEDITION

The Morea (the Greek vernacular name for Peloponnese)

Expedition (French: Expédition de Morée) accomplished

by the French Army at the end of the Greek War of Inde-

pendence. After the naval battle of Navarino where the

united Franco-Russo-British fleet destroyed the Ottoman

fleet, French expeditionary corps disembarked at south-

ern Peloponnese to secure the evacuation of the area from

the Turks. Following the example of the successful

Napoleon’s Egyptian Campaign where a scientific com-

mittee accompanied the French troops, a scientific mis-

sion escorted the expedition in Peloponnese. The Head of

the 17 experts of different disciplines that comprised the

mission was the naturalist Jean Baptiste Bory de Saint Vin-

cent. Bory collected hundreds of plants and animals that

were sent to France for further identification and classi-

©ZFMK

fication. It was from these specimens that the herpetology

of Greece began formally in 1833, when the first endem-

ic species to Peloponnese were described by Bory and his

colleague Gabriel Bibron, who also participated in the

Morea expedition. Bibron worked extensively on Her-

petology and helped his mentor Duméril in the publica-

tion of the first herpetological monograph Erpétologie

generale (1834-—-1854) where many species distributed in

Greece were described.

The Morea Expedition covered not only Peloponnese but

also numerous Greek islands. The importance of this mis-

sion was crucial and later studies on Greek herpetofauna

were largely based on the Expedition’s observation.

Bibron and Bory described in total three species (A/gy-

roides moreoticus, Podarcis peloponnesiacus and

Ophiomorus punctatissimus), while later Duméril and

Bibron, using specimens from Corfu, described one

species (Algyroides nigropunctatus).

THE GERMAN SCHOOL

It is widely accepted that Greek herpetology, at least dur-

ing its early period, literally “spoke German”. Eminent

herpetologists from Germany, Austria and Switzerland

worked (and are still working) extensively on Greek rep-

tiles and amphibians, setting the basis for herpetology in

the country. Maybe the underlying reason should be

seeked in the first king after the War of Independence, Ot-

to the First, son of Ludwig of Bavaria (Wittelsbach

House), who brought with him hundreds of Germans to

staff the administration of the new country. In this session

the most important contributions in Greek herpetology

were presented.

The first German naturalists who arrived in the country

and presented information on Greek amphibians and

reptiles were not herpetologists but ornithologists (Erhard,

Reiser) or botanists (Heldreich, Herzog). Hence many of

their first observations proved to be incorrect since they

were not familiar with herpetological systematics.

Jacques von Bedriaga wrote the first major monograph on

Greek reptiles and amphibians in 1881. After receiving his

PhD Thesis from the University of Jena he started to trav-

el very frequently to both Italy and Greece. The fruits of

these trips was his “Die Amphibien und Reptilien

Griechenlands” which was published in Moscow in three

volumes. His special interest on lacertids is best reflect-

ed in the description of four new species, two of which

are endemic to Peloponnese and Milos Island (namely

Hellenolacerta graeca, Podarcis milensis, Lacerta trilin-

eata and P. erhardii). Though Bedriaga was born in Rus-

sia, where he also took his bachelor’s degree at the Uni-

Bonn zoological Bulletin 57 (2): 329-345

332 Panayiotis Pafilis

versity of Moscow, he became scientifically active in Ger-

many and published most of his works in German. That’s

why his name is herein included in the so-called German

School.

Oskar Boettger, though never visited Greece, made the

second important contribution to Greek herpetology. Dur-

ing the years he was infirm and remained at home, he re-

ceived numerous specimens sent by his many friends and

colleagues. Among them von Oertzen shipped him rep-

tiles and amphibians he collected while in Greece.

Boettger worked on this collection and later published his

findings (1888, 1891).

On of the most prominent European herpetologists, Robert

Mertens, worked also on the Greek herpetofauna. He re-

alized at least three herpetological excursions in the coun-

try, which later resulted in a series of paper (1959, 1961,

1968a, 1972). Using types and specimens from the large

collections of the Senckenberg Museum in Frankfurt he

also wrote systematics articles (1955, 1968b). His most

significant contribution though, was the publication, to-

gether with Miiller (1928, 1940) and Wermuth (1960), of

the European checklists of amphibians and reptiles. This

book has been a useful reference for researchers of the

Greek herpetofauna. At this point it is worthy of mention-

ing that Miller himself contributed one of the first her-

petological papers on Greek herpetofauna in 1908.

Karl Buchholz and Ulrich Gruber, both curators of her-

petology in the Zoologisches Forschungsmuseum Alexan-

der Koenig (hereinafter ZFMK), dedicated a large part of

their research on Greek reptiles and especially to the is-

land populations. Buchholz undertook numerous herpeto-

logical excursions to Greece and collected many speci-

mens (being an excellent markeman he shot his targets

from long distance). His collections were published in a

series of paper on the Aegean reptiles (1960, 1961,

1962a,b). Gruber focused also on insular populations (Gru-

ber & Fuchs 1977, Gruber 1979) and following Werner’s

example, specialized in the North Sporades island group

(Gruber & Schultze-Westrum 1971, Gruber 1986).

Hans Schneider, one of the leading researchers of amphib-

ians, worked closely with Sofianidou and Kyriakopoulou-

Sklavounou analyzing the acoustic properties of various

species of frogs (1984, 1985, 1988, 1993). Acknowledg-

ing the impact of his research on Greek herpetology he

was invited as the pleninary speaker at the 10'* Meeting

of Societas Europea Herpetologica in Crete in 1999 (Bioa-

coustic studies in European Anurans).

Many more German herpetologists, professional or ama-

teurs, did research on Greek species and it would be 1m-

possible to mention all of them in this brief paper. In any

©ZFMK

A brief history of Greek herpetology 333

case it would be an omission not to mentioned B. Schnei-

der who reported on the herpetofaunas of many Greek is-

lands (e.g. 1986, 1995), A. Beutler who was interested al-

so in insular populations (1979, Beutler & Froer 1980) and

B. Trapp who investigated the Greek population of

Chamaeleo africanus (e.g. 2003, 2004) and also wrote a

book on Greek amphibians and reptiles in German (2006).

Wolfgang Bohme is maybe the last of the Mohicans of the

one-time all-potent German School. His engagement with

Greek herpetofauna dates back to the time he was a stu-

dent at the Christian-Albrechts University of Kiel. At 1969

he traveled with a friend to the Syrian borders of Turkey.

On their way back they visited Thessaloniki and planned

a field trip to study the endemic species of Peloponnese.

Unfortunately their old Volkswagen “beetle” let them

down in Athens so they had to cancel their excursion un-

til the engine could be fixed. However they didn’t waste

their time and attempted a herpetological survey of the

area surrounding Acropolis. Their persistence was reward-

ed with observations on Chalcides occelatus and Zame-

nis situlus while they also discovered a dense population

of Lacerta trilineata (specimens of this population can be

found in the collections of ZFMK).

In 1971 Wolfgang Bohme took office as Curator of the

Herpetological Collection in ZFMK. His predecessors,

Karl Buchholz and Ulrich Gruber, were keenly interest-

ed in Greek herpetofauna, as mentioned above, and thus

enhanced considerably the collections of the Museum.

Thanks to them the newly appointed BOhme was able to

immerse himself in the Greek collections during his cu-

ratorship. It was in a series of Pseudepidalea viridis spec-

imens collected by Buchholz in Peloponnese that BOhme

discovered two misplaced adult individuals of Pelobates

syriacus, the first record of this species in Greece (1975).

The aborted field trip to Peloponnese finally took place

in 1996, after his participation in the Congress of the Hel-

lenic Zoological Society in Athens where he presented a

paper on the Cypriot herpetofauna. During this trip Bohme

went to Sparta and Mystras and observed many endemic

species in situ. But another chance to visit Peloponnese

would come from the far past.

The former director of ZFMK, the archeozoologist Gtin-

ther Nobis, had a house near Pylos. During his vacations

he shot a black-and-white photo of a chameleon and up-

on his return to Bonn gave it to BOhme. Since morpho-

logical details were not discernible, B6hme assumed it to

be C. chamaeleon and consequently published this record

in a brief note (1989). In 1997 Bohme visited Nobis so

as to have a first-hand examination of the species. Dur-

ing this visit he met Andrea Bonetti and George Chiras

who led him to the chameleon habitat where they soon de-

Bonn zoological Bulletin 57 (2): 329-345

tected the first male individual. To their surprise instead

of the typical small occipital flaps of C. chamaeleon, they

found a tarsal spur, characteristic of the African species

C. africanus. At the time the range of this species was be-

lieved to be restricted only to Africa. Bohme and his col-

leagues assumed that C. africanus was introduced to the

area as result of the trade between Alexandria and Pylos,

since the Gialova lagoon (the only place where the African

chameleon is distributed in the country) is located to the

exact site of the former ancient harbor of Nestor’s Palace

(Bohme et al. 1998). The results were later verified with

mtDNA analysis (Kosuch et al. 1999). This fascinating dis-

covery came to corroborate the human influence on

species dispersal in the Mediterranean Sea.

Together with Evgeny Roitberg and his former PhD stu-

dent Andreas Schmitz, now curator of herpetology in

Geneva, Bohme traveled to Greece once more in 1999 to

attend the 10'* Meeting of SEH in Iraklion, Crete. They

made herpetological observations in Macedonia and at

Mount Olympos. The last SEH Meeting in Kussadasi

(2009) gave another opportunity to visit Greece. On his

way back from Turkey, Bohme stopped, with his phd stu-

dent Philipp Wagner, at various localities in northeastern

Greece (Thrace and Macedonia).

Last, but certainly not least, the impact of the Handbuch

der Amphibien und Reptilien Europas (1981, 1984, 1986,

1993a) in which Bohme edited the volumes for snakes and

lizards (and also contributed personally some species ac-

counts — 1984, 1993b,c), has been catalytic for the devel-

opment of herpetology in Greece. Data on ecology, sys-

tematics, physiology and behavior were for the first time

gathered and accessible to researchers.

Besides the above, Wolfgang Bohme has another, more

“indirect”, nonetheless important, relationship with Greek

herpetology. During all the years he served as Head of the

Herpetology Section in ZFMK (1971—2010) and Vice Di-

rector of the Museum, he facilitated in every possible way

researchers who were working on specimens from

Greece. Many Greek herpetologists visited numerous

times the rich herpetological collections of the Museum

and retrieved valuable information on diet, reproduction,

morphology, ontogeny, intra- and inter-population varia-

tion, anatomy and phylogeny of Greek amphibians and

reptiles. These data led to the publication of various sci-

entific papers that considerably enlarged our knowledge

of the Greek herpetofauna.

THE AUSTRIAN SCHOOL

Franz Werner was one of the most prolific and influential

herpetologists who worked on Greek amphibians and rep-

OZFMK

334 Panayiotis Pafilis

tiles. Starting from 1894 he was an avid and consistent re-

searcher of Greek herpetofauna and remained active till

his death (1939), publishing a series of papers (1912, 1927,

1933, 1937, 1938). He was the first to describe the her-

petofauna of Ioanian islands (1894) and he also expand-

ed his studies to the Aegean Sea. Maybe his most impor-

tant manuscript was the one published in English, some-

thing quite unusual for a German-speaking scientist at the

time, by the University of Michigan (1930). Therein he

describes the findings of the visit he made at some Aegean

Islands in 1927. In this mission he had the chance to col-

laborate with K.H. Rechinger while informative photos

shot by Prof. Schoenwetter illustrated the final paper. In

his long herpetological pursuits in Greece Werner de-

scribed four new species: Lacerta anatolica, L. oertzeni

(a tribute to von Oertzen), Podarcis gaigeae (endemic to

Skyros Archipelago and dedicated to Helen Gaige) and

Macrovipera schweizeri. After his death his sons donat-

ed his huge personal collection to the Natural History Mu-

seum of Vienna, which since then is one of the wealthier

in specimens coming from Greece.

Werner’s pupil Otto von Wettstein followed up with en-

thusiasm the work of his teacher on Greek reptiles. He

took over as Curator of vertebrates at the Natural Histo-

ry Museum of Vienna in 1920 and published his first pa-

per on the herpetofauna of Crete in 1931. In his studies

he emphasized the reptilian and amphibian populations of

the Aegean islands of which he was a regular visitor. In

1942 he participated in a scientific mission to Crete that

was conducted by a German Wehrmacht biological re-

search squad. Without doubt his most important paper was

the emblematic Herpetologia Aegea (1953). In the 182

pages of this landmark effort, Wettstein presented in the

most detailed way, full of knowledge, all the information

on the zoogeography of the Aegean Sea herpetofauna.

The legacy Wettstein left to the Natural History Museum

of Vienna is enormous and, luckily, his interest in Greek

herpetofauna survived among his successors till today.

Heinz Grillitsch, the actual Head of the Herpetological

Collection since 1984, investigated aspects of the Greek

herpetofauna (Grillitsch & Tiedemann 1984, Grillitsch &

Cabela 1990, Grillitsch & Grillitsch 1991). Within his re-

sponsibilities lies the heavy burden to maintain and pre-

serve the huge collection, one of the greatest in Greek

specimens. Werner Mayer from the molecular systemat-

ic lab of the Museum has been working on the ecology

and distribution of reptiles and continues to study the phy-

logenetic relationships of numerous Greek lizards (May-

er 1986, 1993, Mayer & Beyerlein 2002, Mayer & Arribas

2003). Franz Tiedemann, who 1s collaborating closely with

the Museum, has conducted numerous studies on various

aspects of herpetology on Greek species (e.g. Tiedemann

& Haupl 1980, 1982, Tiedemann & Grillitsch 1986).

Bonn zoological Bulletin 57 (2): 329-345

There are many more Austrian herpetologists that need to

be mentioned here like Peter Keymar, who frequently vis-

ited Greece and published papers on Greek amphibians

and reptiles (1984, 1986a, b, 1988) or Thomas Bader and

Christoph Riegler (2004, 2009) who described the herpeto-

fauna composition of Rhodes Island. A special citation

should be made to the very active Austrian herpetologi-

cal group www. herpetofauna.at. In their excellent website

one may find a wide variety of photos of Greek reptiles

and amphibians since the members of the group have re-

peatedly visited Greece.

THE “INTERNATIONAL BRIGADES”

Besides the predominant German and Austrian Schools

that shaped the history of Greek herpetology, researchers

from many other European countries made important con-

tributions to the study of amphibians and reptiles of the

country.

Dodecanese islands during the first decades of the 20th

century were under Italian rule and Italian naturalists de-

scribed the herpetofauna of the region. Enrico Festa of the

Museum of Zoology in Turin made herpetological obser-

vations in the island of Rhodes that later were published

by Calabresi (1923b) who also write his impression of a

survey on Samos Islands (1923b). At the same period Et-

tore Zavattari published a study on the fauna of the “Ital-

ian islands of the Aegean Sea” (1929). Augusto Cattaneo

is one of the most prolific authors on the distribution of

Greek reptiles and amphibians, especially in the insular

country (e.g. 1984, 1997, 1999, 2007). Another Italian her-

petologist who investigated the range of Greek herpeto-

fauna is Pierangelo Crucitti (e.g. 1990).

The United Kingdom is represented by a handful of very

productive herpetologists. Adrian Hailey (now at the Uni-

versity of West Indies, Trinidad and Tobago), who worked

for a long period at the University of Thessaloniki, em-

phasized his research on the tortoise populations in Greece

(e.g. Hailey 2000, Hailey & Willemsen 2003) while he al-

so examined the metabolism of Laudakia stellio in col-

laboration with Nikos Loumbourdis. Richard Clark wins

easily the title of the champion of publications on the dis-

tribution of Greek amphibians and reptiles. Starting from

1967 he wrote over 20 papers (e.g. 1968, 1971, 1989,

1996, 2000) covering most places of the country. Finally

David Buttle traveled around Greece and published many

new localities regarding the distribution of Greek herpeto-

fauna (e.g. 1989, 1994, 1997). Nicholas Arnold with the

different editions of his excellent guide on European am-

phibians and reptiles (1985, 2004) offered an important

reference book to herpetologists working on Greek

species.

©ZFMK

A brief history of Greek herpetolog 335

In the 1970’s Hans Lotze did many field trips in Greece

and gave considerable information about snakes (e.g.

1974, 1977). Peter Beerli of Florida State University stud-

ied Aegean water frogs (Beerli et al. 1996) and even de-

scribed two new endemic species using molecular biolo-

gy tools (Beerli et al. 1994): Pelophylax cerigensis and

Pelophylax cretensis. But the real star of Swiss herpetol-

ogists that involved the study of Greek species was un-

doubtedly Hans Schweizer, the famous “Schlangenhansi”.

Schweizer, an amateur herpetologist with a particular pref-

erence to vipers, had already a reputation among the Eu-

ropean herpetological community when in 1931 visited

Milos Island. After spending considerable time walking

throughout the island and observing lizards and snakes,

he noted the striking differences between the local and

mainland herpetofaunas. He begun to publish his findings

(1932, 1935, 1938, 1957) and also contacted profession-

al herpetologists around Europe, with whom he had a reg-

ular correspondance, and started sending specimens. It was

from one of those samples that Miller described the en-

demic Milos grass snake in 1932 and dedicated it to him

(Natrix natrix schweizeri). Thanks to Schweizer, Milos Is-

land gained its reknown as herpetological hot spot in

Mediterranean. Besides the grass snake, two more species

bear Schlangenhansi’s name: Macrovipera schweizeri and

Lacerta trilineata hansschweizeri.

Otto Cyrén, one of the pioneers of Greek herpetology, was

born in Sweden but spent many years of his life in Ger-

many and consequently wrote in German his papers on

Greek and Balkan herpetofauna (1928, 1933, 1935). Goran

Nilson of Géteborg University, a viper expert, has exam-

ined various aspects of the biology of Macrovipera

schweizeri with his Greek collaborators Dimaki, Ioanni-

dis and Dimitropoulos (Andren et al. 1994, Nilson et al.

1999). A younger representative of Swedish herpetology

is Anna Runemark of Lund University who is doing her

PhD thesis on the sexual isolation between mainland and

inland populations of Podarcis gaigeae (Runemark et al.

2008).

Two herpetologists from the Netherlands have studied the

Greek herpetofauna. Ronald Willemsen focused on the

study of Mediterranean tortoises (e.g. Willemsen 1991,

1999, Willemsen & Hailey 2002) while Henk Strijbosch

examined the distribution and ecology of lacertids (Stri-

jbosch et al. 1989, Strijbosch 2001).

The Czechoslovakian Stepanek traveled to Greece and

published an important contribution to the knowledge of

Greek herpetofauna in 1944, along with two other papers

(1934, 1938). Mario Broggi from Liechtenstein is a reg-

ular visitor to Greece and has published over 15 papers

on local herpetofaunas around the country (e.g. 1978,

1988, 1997, 2009). The Danish Henrik Bringsge is anoth-

Bonn zoological Bulletin 57 (2): 329-345

er researcher that wrote on different species of reptiles and

amphibians (e.g. 1986, 1997, 2004). Jeroen Speybroeck

from Belgium has visited Greece many times and runs a

well organized website with great photographs of Greek

amphibians and reptiles (http:/www.hylawerkgroep.be/jeroen).

GREEKS ON GREEK HERPETOLOGY

Until the late 1960’s only foreign scientists, mostly from

Central Europe, were researching on the Greek herpeto-

fauna. In 1968 John Ondrias of the University of Patras

(which hosts the oldest School of Biology in Greece) pub-

lished the first list of amphibians and reptiles. That was

the starting point that instigated many Greek zoologists

to get involved in herpetological studies. Theodora Sofi-

anidou of the University of Thessaloniki carried out the

first dissertation on herpetology in 1977. Since then 18 re-

searchers defended their PhD theses on herpetological sub-

jects. Namely (in order of seniority): Loumbourdis

(1981), Kyriakopoulou-Sklavounou (1983), Xyda (1983),

Chondropoulos (1984), Tzannetatou-Polymeni (1988),

Valakos (1990), Asimakopoulos (1992), Maragou (1997),

Adamopoulou (1999), Vassara (1999), Kassapidis (2001),

Poulakakis (2003), Pafilis (2003), Tsiora (2003),

Sotiropoulos (2004), Mantziou (2006), Dimaki (2007) and

Simou (2009).

Bassilis Chondropoulos published the checklists of Greek

lizards and snakes in 1986 and 1989 respectively. These

papers remained for a long period the most dependable

source for the distribution of the Greek herpetofauna. Sofi-

anidou wrote the first complete herpetological monograph

in Greek in 1999 on Testudo marginata. In 2000 Achil-

leas Dimitropoulos and Yannis Ioannides published their

work on the reptiles of Greece and Cyprus (in Greek), the

first herpetological book to appear in Greece.

Nowadays Greek herpetologists are working under the

auspices of Universities, non-governmental organizations

and Museums. The major groups of herpetological re-

search are located at three Universities. At the Universi-

ty of Athens (the oldest in the country) Professors of Ecol-

ogy Ioannis Matsakis and Moisis Mylonas though not her-

petologists encourage young people to work in the field

and do indepth research during preparations of their dis-

sertation. Rosa Maria Tzannetatou-Polymeni and Sratis

Valakos, pupils of the aforementioned, became faculty in

1990 and 1992 respectively and with their turn supervised

new herpetological PhD theses. Tzannetatou-Polymeni

(assistant professor) is an expert on both Lyciasalaman-

dra species and is actually supervising a PhD thesis on

the endemic Helversen’s salamander (Karpathos and Kas-

sos islands). Valakos (associate professor) laid a founda-

tion for an active group that has already produced five dis-

OZFMK

336 Panayiotis Pafilis

sertations while two more are in process. Together with

colleagues from other institutions he published an accom-

plished guide for the amphibians and reptiles of Greece

(in English) in 2008. Earlier, with his collaborators, wrote

the first volume on a local herpetofauna (2004, in both

Greek and English). His research focuses on the environ-

mental physiology and phylogeny of lacertid lizards (e.g.

Valakos 1989, Valakos & Mylonas 1992, Valakos et al.

2007). Angeliki Xyda, former faculty (now retired), con-

ducted studies on the ecology of Laudakia stellio (e.g.

1986).

Professor Mylonas moved to the University of Crete at

1992 and set the basis for a new herpetological nucleus.

Three dissertations have been completed so far whereas

more PhD candidates are still working on their theses. Pet-

ros Lymberakis, curator of vertebrates at the Natural His-

tory Museum of Crete (belonging to the University of

Crete) deals with numerous aspects of herpetology (e.g.

Lymberakis et al. 2007, 2008). Nikos Poulakakis (assis-

tant professor) has worked extensively on the reconstruc-

tion of the phylogenetic histories of various amphibians

and reptiles (e.g. Poulakakis et al. 2003, 2005a, b, 2008).

At the Aristotelian University of Thessaloniki the research

group of Sofianidou and Kyriakopoulou-Sklavounou be-

gan a series of papers on frogs in collaboration with Hans

Schneider. Fruit of their work, based on bioacoustics, was

the description of a new species (Pelophylax epeiroticus

— 1984). Sofianidou (now retired) supervised two disser-

tations and worked mainly with amphibians (e.g. Sofian-

idou & Kyriakopoulou-Sklavounou 1983, Sofianidou

1996). She was also one of the editors and main contrib-

utors to the Atlas of Amphibians and Reptiles in Europe

(Gasc et al. 1997). Kyriakopoulou-Sklavounou (associate

professor) supervised one PhD thesis while studying life-

history traits and genetic differentiation of Greek frogs

(e.g. Kyriakopoulou-Sklavounou 1992, Kyriakopoulou-

Sklavounou et al. 2000, 2003). Nikos Loumbourdis (pro-

fessor) studies the metabolism and overall physiology of

amphibians and reptiles (e.g. Loumbourdis & Hailey 1985,

Loumbourdis 1997, 2005, 2007).

Besides the aforementioned foundations the Goulandris

Natural History Museum hosts a group of active herpetol-

ogists: Dimitropoulos who contributed many new locali-

ties for reptiles (e.g. 1986, 1990), Ioannides wrote on the

herpetofaunas of numerous areas and also on the ecolo-

gy of reptiles (e.g. Ioannides et al. 1994, Ioannides &

Bousbouras 1997) and Maria Dimaki, who has focused on

chameleons (e.g. Dimaki et al. 2000a,b). Panayiota

Maragou of the WWF Hellas studies the ecology of lac-

ertids endemic to Peloponnese (e.g. Maragou et al. 1996,

1999), while Chloe Adamopoulou (Zoological Museum

Bonn zoological Bulletin 57 (2): 329-345

of the University of Athens) is emphasizing on Podarcis

milensis (e.g. Adamopoulou et al. 1999, Adamopoulou &

Valakos 2005). Dimitris Margaritoulis of Archelon did an

important work on the conservation of sea turtles (e.g.

Margaritoulis et al. 1986, Margaritoulis 2005).

US based Greek Johannes Foufopoulos (assistant profes-

sor, University of Michigan) is investigating the evolution

and physiological adaptations of lizards on islands of

Aegean Sea (e.g. Foufopoulos 1997, Foufopoulos & Ives

1999) in close collaboration with herpetologists in

Greece. Recently two more members of the Greek her-

petological community became faculty: Konstantinos

Sotiropoulos (University of Ioannina, lecturer) who stud-

ies genetic differentiation and phylogenetic relations in

newts (e.g. Sotiropoulos et al. 2001, 2008a,b, 2009) and

Panayiotis Pafilis (University of Athens, assistant profes-

sor), focusing on functional ecology and conservation

physiology of lacertids (e.g. Pafilis et al. 2005, 2007, 2008,

2009).

The increasing number of people involved in herpetolog-

ical studies in Greece is also reflected in the organization

of three Congresses: the First (1992) and the Sixth (2008)

Symposia on the Lacertids of the Mediterranean Basin

(both held in Lesvos Island) and the 10‘ Ordinary Gen-

eral Meeting of SEH in Crete (1999). Some of the con-

tributions presented during the last were published in a

volume under the general title Hereptologia Candiana

(Lymberakis et al. 2001).

The threatened species of the Greek herpetofauna have

been recorded in the two editions of the Red Data Book

of threatened species of Greece. In the first edition

(Karandinos & Paraschi 1992) eight species (seven rep-

tiles and one salamander) are listed as threatened while

in the second edition (Legakis & Maragou 2009) twelve

reptiles and six amphibians are characterized as critical-

ly endangered, endangered or vulnerable.

An important step in the history of Greek Herpetology was

the foundation of the Hellenic Herpetological Society (So-

cietas Herpetologica Hellenica, EAdnvucy Epretodoyuxy,

Etatpe/a— http://www.elerpe.org) in 2000. The members

of the Society are scientists who are involved in the study

of amphibians and reptiles but also amateur herpetologists

(as non-full members) who are interested in conservation

and natural history. At this point Arche/on, the Sea Tur-

tle Protection Society of Greece (http://www.archelon.gr),

should be mentioned as well. Thanks to the efforts of this

pioneer group (founded on early 1980’s), Greek public

opinion was sensitized towards the conservation of

Caretta caretta.

©ZFMK

A brief history of Greek herpetology 337/

PAST, PRESENT AND FUTURE OF GREEK

HERPETOLOGY

Unlike herpetologies of other European countries, herpeto-

logical publications in Greece up to the 1970’s dealt with

systematics, focusing on the discovery and description of

new species. The majority of studies concerned the dis-

tribution of various taxa and the description of local her-

petofaunas, with emphasis on the islands. Nonetheless,

during the last decade, herpetologists are covering success-

fully a wide spectrum of biological aspects including mo-

lecular biology, genetic differentiation, environmental

physiology, functional ecology, immunology and the over-

all picture has been reversed (Fig. 1).

120 -

| eee

1880- 1900- 1960- 1970-

1900 1960 1970 1980

1980-

1990

1990-

2000

2000-

2010

Fig. 1. Histogram of publications (total 606 papers) made by

foreign (light bar) and Greek herpetologists (spotted bar).

The number of species inhabiting Greece has been raised

throughout the years (see Appendix I). During the first two

decades of 19th century only the species described by the

classical taxonomists (Linnaeus, Laurenti and Pallas) were

known from Greece. The French Morea Expendition led

to the description of the first endemic species and since

then the study of the Greek herpetofauna became method-

ical and continuous. New species are rather rare and their

description is based on cutting edge technology tools, like

molecular inference, paired though with typical anatom-

ical-morphological studies (e.g. Beerli et al. 1994). This

is also the case for the recently described lacertids Podar-

cis cretensis and P. levendis, the first Greek species that

were published by an exclusively Greek group (Lymber-

akis et al. 2008).

Until today foreign researchers were publishing most of

the papers on the Greek herpetofauna. However this trend

has changed during the last 20 years and today the scien-

tific work of Greek herpetologists has yielded a continu-

ously growing number of papers (Fig. 2). It is important

to mention that most Greek researchers are working in col-

laboration with colleagues from Europe and North Amer-

Bonn zoological Bulletin 57 (2): 329-345

ica, keeping alive the international interest for the Greek

herpetofauna and exchanging ideas and methods.

Habitat degradation, environmental pollution, introduced

species and the non-stop, greedy development of tourism

(principal source of money for Greek economy) stress the

imperious need for conservation studies in the immediate

future. Though knowledge of species distribution is in sat-

isfactory level, the evaluation of populations’ status 1s still

very poor. Amphibian and fresh water turtle populations

are known to decrease as a consequence of water pollu-

tion and the desiccation of water bodies. The problem is

much more intense in the islands because of tourism-re-

lated activities (excessive withdrawal of groundwater and

construction projects on wetlands areas). Reptile popula-

tions are threatened by wildfires that the last 10 years de-

stroyed a significant part of Greek forests and also, in the

case of small islets, by overgrazing. Greece hosts some

very important nesting beaches for Caretta caretta, endan-

gered as well by tourism and fishing. In order to protect

and maintain one of the richest European herpetofaunas

special conservation projects should be undertaken short-

ly with the contribution of herpetologists from all fields.

120

100

everwelN ian a

we ilies 1

1880- 1900- 1960- 1970- 1980- 1990- 2000-

1900 1960 1970 1980 1990 2000 2010

Fig. 2. Chart of publications concerning systematics and dis-

tribution (light bar) and non-systematic and distributional records

(spotted bar) of a total of 606 papers.

REFERENCES

Adamopoulou C (1999) Structure and composition of animal

ground communities with an emphasis on the lizard Podar-

cis milensis (Sauria: Lacertidae), in island ecosystems of the

Aegean Sea. Dissertation in Greek. University of Athens,

Athens

Adamopoulou C, ED Valakos, Pafilis P (1999) Summer diet of

Podarcis milensis, P. gaigeae and P. erhardii (Sauria: Lacer-

tidae). Bonner Zoologische Beitraege 48:275—282

Adamopoulou C, Valakos ED (2005) Thermal ecology and ac-

tivity cycle of Podarcis milensis in a sandy coastal area. Is-

rael Journal of Zoology 51: 39-52

Andren C, Nilson G, Dimitropoulos A, Ioannides Y (1994) Con-

servation of the Milos Viper (Macrovipera schweizeri, syn.

Vipera lebetina schweizeri). Preliminary report. Annales Mu-

sei Goulandris 9: 245—252

©ZFMK

338 Panayiotis Pafilis

Aristotle, History of Animals (in ten books). Translated by R.

Cresswell. Original edition Henry G. Bohn, London, reprint-

ed by Elibron Classics.

Aristotle, Generation of Animals. Translated by AL Peck. Loeb

Classical Library Volumes. Cambridge, MA, Harvard Univer-

sity Press; London, William Heinemann Ltd.

Aristotle, On the Parts of Animals I-IV. Translated by JL Lennox.

Clarendon Aristotle Series

Arnold EN (2004) Field Guide to the Reptiles and Amphibians

of Britain and Europe Collins, London

Arnold EN, Burton JA (1985) A Field Guide to the Reptiles and

Amphibians of Britain and Europe. Collins, London

Asimakopoulos V (1992) Geographical distribution and ecolo-

gy of the water frog Rana graeca (Boulenger 1891) in Greece.

Dissertation in Greek. University of Thessaloniki

Bader T, Riegler C (2004) Herpetological observations on

Rhodes (Greece). OGH-Aktuell 13:6—9

Bader T, Riegler C, Grillitsch H (2009) The herpetofauna of the

Island of Rhodes (Dodecanese, Greece). — Herpetozoa,

Wien; 21 (3/4): 147-169

Bedriaga J (1881) Die Amphibien und Reptilien Griechenlands

(Ophidia, Chelonia). 1. Bulletin de la Societé Imperial Natu-

relle de Moscou 56: 243-310

Bedriaga J (1881) Die Amphibien und Reptilien Griechenlands

(Ophidia, Chelonia). 2. Bulletin de la Societé Imperial Natu-

relle de Moscou 56: 43—103

Bedriaga J (1881) Die Amphibien und Reptilien Griechenlands

(Ophidia, Chelonia). 3. Bulletin de la Societé Imperial Natu-

relle de Moscou 56: 278-343

Bedriaga J (1883) Die Amphibien und Reptilien Griechenlands.

Zoologischer Anzeiger 6: 216—220

Beerli P, Hotz H, Tunner H, Heppich S, Uzzell T (1994) Two

new water frog species from the Aegean islands Crete and

Karpathos (Amphibia, Salientia, Ranidae). Notulae Naturae

— The Academy of Natural Sciences of Philadelphia 470: 1-9

Beerli P, Hotz H, Uzzell T (1996) Geologically dated sea barri-

ers calibrate a protein clock for Aegean water frogs. Evolu-

tion 50: 1676-1678

Beutler A (1979) General principles in the distribution of repti-

les and amphibians in the Aegean. Biologia Gallo—Hellenica

8: 337-344

Beutler A, Froer A (1980) Die Amphibien und Reptilien der

Nordkykladen (Griechenland). Mitteilungen der Zoologischen

Gesellschaft Braunau 3: 255-290

Boettger O (1888) Verzeichniss der von Hrn. E. von Oertzen aus

Griechenland und aus Kleinasien mitgebrachten Batrachier

und Reptilien. Verlag der Koeniglichen Akademie der Wissen-

schaften, Berlin 1: 139-186

Boettger O (1891) Reptilien von Euboea. Zoologischer Anze1-

ger 14: 418

Bohme W (1975) Zum Vorkommen von Pelobates syriacus Bo-

ettger, 1890) in Griechenland. Senckenbergiana Biologica 65:

199-202

Bohme W (editor) (1981) Handbuch der Amphibien und Rep-

tilien Europas, Echsen I. Akademische Verlagsgesellschaft,

Wiesbaden, Deutschland

Bohme W (editor) (1984) Handbuch der Amphibien und Rep-

tilien Europas, Echsen II. Akademische Verlagsgesellschaft,

Wiesbaden, Deutschland

Bohme W (editor) (1986) Handbuch der Amphibien und Rep-

tilien Europas, Echsen II. Akademische Verlagsgesellschaft,

Wiesbaden, Deutschland

Bohme W (editor) (1993) Handbuch der Amphibien und Rep-

tililen Europas, Schlangen I. Akademische Verlagsgesellschaft,

Wiesbaden, Deutschland

Bonn zoological Bulletin 57 (2): 329-345

Bohme W (1984) Lacerta graeca Bedriaga 1886 — Taygetos-Ei-

dechse, Griechische Spitzkopfeidechse. Pages 255—264 in W.

Bohme, editor. Echsen I (Lacerta). Handbuch der Reptilien

und Amphibien Europas. Aula-Verlag, Wiesbaden, Germany.

Bohme W (1989) Neuer Nachweis von Chamaleo chamaleon

(Linnaeus,1758) vom Peloponnes, (Griechenland). Herpeto-

fauna 11: 32-34

Bohme W (1993a) Coluber gyarosensis Mertens, 1968. -— Gya-

ros-Pfeilnatter. Pages 111-114 in W. Bohme, editor. Schlan-

gen (Serpentes) I. (Typhlopidae, Boidae, Colubridae 1: Co-

lubrinae). Handbuch der Reptilien und Amphibien Europas.

Aula-Verlag, Wiesbaden, Germany

Bohme W (1993b) Elaphe longissima (Laurenti, 1768) — Asku-

lapnatter. Pages 331-372 in W. Bohme, editor. Schlangen

(Serpentes) I. (Typhlopidae, Boidae, Colubridae 1: Colubri-

nae). Handbuch der Reptilien und Amphibien Europas. Aula-

Verlag, Wiesbaden, Germany

Bohme W, Bonetti A, Chiras G (1998) The chameleons of the

Greek mainland: taxonomic allocation and conservation needs

of a second European species. (Squamata: Sauria:

Chamaeleonidae). Herpetozoa 11: 87-91

Bringsee H (1986) Podarcis peloponnesiaca (Bibron und Bo-

ry, 1833) — Peloponnes-Eidechse. Pages 209-230 in W. Boh-

me, editor. Handbuch der Reptilien und Amphibien Europas.

Echsen (Sauria) HI. Lacertidae HI: Podarcis. Aula-Verlag,

Wiesbaden, Germany

Bringsge H (1997) Turistvenlige Karpenisi 1 Centralgraekenland

et ideelt rejsemal til herpetologiske udflugter. Nordisk Her-

petologisk Forening 40: 38-56

Bringsee H (2004) The swamp turtle Emys orbicularis helleni-

ca in the Strofilia forest on the Peloponnese. Nordisk Herpe-

tologisk Forening 47: 88—95

Broggi MF (1978) Herpetologische Beobachtungen auf der In-

sel Lesbos (Griechenland). Salamandra 14: 161-171

Broggi MF (1988) Herpetologische Beobachtungen auf der In-

sel Lesbos (Griechenland). Berichte der Botanisch-Zool. Ge-

sellschaft Liechtenstein-Sargans-Werdenberg 17: 93-99

Broggi MF (1997) Notizen zur Herpetofauna von Kalymnos und

Leros (Dodekanes, Griechenland). Herpetozoa 10: 135-138

Broggi MF (2009) The herpetofauna of Ithaki (Ithacam Ioania

Islands, Greece). Herpetozoa 22: 87—90

Buchholz KF (1960) Zur Kenntnis von Lacerta peloponnesia-

ca. Bonner Zoologische Beitrage 11: 87-107

Buchholz KF (1961) Uber Elaphe quatuorlineata von der Zykla-

den und das Elaphe-taxon von der Insel Amorgos (Reptilia,

Colubridae). Bonner Zoologische Beitrage 12: 135-148

Buchholz KF (1962a) Die Smaragdeidechse der Kykladeninsel

Tinos. Bonner Zoologische Beitrage 13: 341-352

Buchholz KF (1962b) Die Mauereidechse von Ananes, Milos-

Archipel. Bonner Zoologische Beitrage 13: 216-218

Buttle D (1989) Notes on reptiles and amphibians of northeast-

ern Greece and the island of Samothraki. British Herpetolog-

ical Society bulletin 29: 49-53

Buttle D (1994) An addition to the article “Notes on the herpeto-

fauna of some of the Cyclades islands, Greece’. British Her-

petological Society Bulletin 46: 11

Buttle D (1997) Observations on reptiles and amphibians of An-

dros (Cyclades, Greece). British Herpetological Society Bul-

letin 60: 5—12

Calabresi E (1923a) Escursioni zoologiche del Dr. E. Festa nell’

isola di Rodi. Anfibi e rettili. Bollettino dei Musei di Zoolo-

gia e Anatomia Comparata della Regia Universita di Torino

38: 1-16

Calabresi E (1923b) Anfibi e Rettili dell’isola di Samos. Moni-

tore Zoologico Italiano 34: 75—78

OZFMK

A brief history of Greek herpetology 339

Cattaneo A (1984) Reperti erpetologici nelle Cicladi occidentali:

Testudo marginata a Milos, Hemidactylus turcicus ed Elaphe

situla a Sifnos (Reptilia). Natura (Milan) 75: 75-78

Cattaneo A (1997) L’ erpetofauna dell’ isola greca di Skiathos

(Sporadi settentrional1). Atti della Societa Italiana di Scienze

Naturali e del Museo Civico di Storia Naturale di Milano 136:

145-156

Cattaneo A (1999) Variabilita e sottospecies di Elaphe quatuor-

lineata (Lacepede) nelle piccole isole Egee (Serpentes: Colu-

bridae). Atti della Societa Italiana di Scienze Naturali e del

Museo Civico di Storia Naturale in Milano 140: 127-132

Cattaneo A (2007) Observations on the snakes of the Aegean 1s-

land of Symi (Southern Sporades). Bollettino del Museo Civi-

co de Storia Naturale de Venezia 58: 257-267

Chondropoulos BP (1983) Rectifications to: Anton’s “A note on

the herpetofauna of Greece and its islands”. Bulletin Chica-

go Herpetological Society 18: 43

Chondropoulos BP (1984) Study of the lacertid lizards in west-

ern Greece. A morphological, serological, immunological and

ecological approach. University of Patras

Chondropoulos B.P (1986) A checklist of the Greek reptiles. 1.

The lizards. Amphibia-Reptilia 7: 217-235

Chondropoulos BP (1989) A checklist of Greek reptiles. 2. The

snakes. Herpetozoa 2: 3-36

Clark RJ (1968) A collection of snakes from Greece. British Jour-

nal of Herpetology 4: 45-48

Clark RJ (1971) Further comments on the Aegean 4-lined snake

Elaphe quatuorlineata including a consideration of the

Amorgos Elaphe snakes. British Journal of Herpetology 4:

207-209

Clark RJ (1989) A check list of the herpetofauna of the Argo-

Saronic Gulf district, Greece. British Herpetological Society

Bulletin 28: 8—24

Clark R (1996) Some notes on the reptile fauna of Fournoi,

Ikaria, and Schoinoussa, Aegean Sea, Greece. British Herpeto-

logical Society Bulletin 56: 35-39

Clark R (2000) The herpetology of Samos Island, eastern Aegean

Sea, Greece. Journal of the International Herpetological So-

ciety 25: 172-175

Crucitti P, Campese A, Malori M (1990) Popolazione sintopiche

di Emys orbicularis e Mauremys caspica nella Tracia. Grecia

orientale (Reptilia: Testudines: Emydidae). Bollettino del

Museo Regionale di Scienze Naturali di Torino 8: 187—196

Cyrén O (1928) Herpetologische Berichte von einer Reise nach

Griechenland. Blatter fiir Aquarien- und Terrariener-Kunde,

Stuttgart 1: 8-15

Cyrén O (1933) Lacertiden der stidéstlichen Balkanhalbinsel.

Mitteilungen des KG6niglichen Naturwissenschaftlichen Insti-

tut Sofia 6: 219-240

Cyrén O (1935) Herpetologisches vom Balkan. Blatter fiir Aqua-

rien- und Terrariener-Kunde, Stuttgart 46: 129-135

Dermitzakis MD (1990) Paleogeography, geodynamic process-

es and event stratigraphy during the Late Cenozoic of the

Aegean area. Academia Nazionale di Lincei 85: 263-288

Dimaki M, Valakos ED, Legakis A (2000a) Variation in body

temperatures of the African chameleon Chamaeleo africanus,

Laurenti, 1768 and the Common chameleon Chamaeleo

chamaeleon (Linnaeus, 1758). Belgian Journal of Zoology 130

(Supplement 1): 87-91

Dimaki M, Valakos ED, Chondropoulos BP, Legakis A (2000b)

Morphometric analysis of the African chameleon Chamaeleo

africanus Laurenti (1768) from the southwestern Peloponnese,

Greece. Israel Journal of Zoology 46: 77-83

Bonn zoological Bulletin 57 (2): 329-345

Dimaki M (2007) Ecology and physiology of chameleon

(Chamaeleo sp) in Greece. Dissertation in Greek. University

of Athens

Dimitropoulos A (1986) Some notes on the color and pattern

variation of the Greek snake fauna in relation to geographic

distribution. Biologia Gallo-Hellenica 12: 463-471

Dimitropoulos A (1990) A new locality record of Ottoman viper,

Vipera xanthina (Serpentes, Viperidae) from the Greek island

of Oenousses, N.E. Aegean. Annales Musei Goulandris 8:

245-249

Dimitropoulos A, Ioannidis J (2002) Goulandris’ Natural His-

tory Museum: Reptiles of Greece and Cyprus (in Greek).

KOAN, Athens

Foufopoulos J (1997) The reptile fauna of the northern Dode-

canese (Aegean islands, Greece). Herpetozoa 10: 3—12

Foufopoulos J, Ives AR (1999) Reptile extinctions on land-bridge

islands: life-history attributes and vulnerability to extinction.

American Naturalist 153: 1-25

Fytikas M, Innocenti P, Manetti R, Mazzuoli R, Peccerillo A,

Villari L (1984) Tertiary to Quaternary volcanism in the

Aegean region. In: The geological evolution of the Eastern

Mediterranean. Dixon, J.E., Robertson, A.H.F., Eds., Geolog-

ical Society of London Special Publications 17: 687—699

Gasc JP, Cabela A, Crnobrnja-Isailovic J, Dolmen D, Grossen-

bacher K, Haffner P, Lescure J, Martens H, Martinez Rica JP,

Maurin H, Oliveira ME, Sofianidou TS, Veith M, Zuiderwijk

A (1997) Atlas of Amphibians and Reptiles in Europe. Socie-

tas Europaea Herpetologica & Museum National d’ Histoire

Naturelle (IEGB/SPN), Paris

Grillitsch H, Tiedemann F (1984) Zur Herpetofauna der griechi-

schen Insel Kea, Spanopoula, Kythnos, Sifnos, Kitriani (Cy-

claden), Alonnisos und Piperi (Nordliche Sporaden). Annalen

des Naturhistorischen Museums, Wien 86: 7-28

Grillitsch H, Cabela A (1990) Zum systematischen Status der

Blindschleichen (Squamata: Anguidae) des Peloponnes und

der stidlichen Ionischen Inseln (Griechenland). Herpetozoa 2:

131-153

Grillitsch H, Grillitsch B (1991) Zur Taxonomie und Verbrei-

tung des Feuersalamanders, Salamandra salamandra (Linna-

eus, 1758) (Caudata: Salamandridae), in Griechenland. Her-

petozoa 4: 133-147

Gruber U, Schultze-Westrum T (1971) Zur Taxonomie und Oko-

logie der Cycladen-Eidechse (Lacerta erhardii) von der Nord-

lichen Sporaden. Bonner Zoologische Beitrage 22: 101-130

Gruber U, Fuchs D (1977) Die Herpetofauna des Paros-Archipels

(Zentral-A giis). Salamandra 13: 60-77

Gruber U (1979) Patterns of relationship and ecology of Aegean

snakes. Biologia Gallo-Hellenica 8: 345-348

Gruber U (1986) Podarcis gaigeae (Werner, 1930) — Skyros-

Mauereidechse. Pages 65—70 in W. Bohme, editor. Handbuch

der Reptilien und Amphibien Europas. Echsen (Sauria) III.

Lacertidae II]: Podarcis. Aula-Verlag, Wiesbaden, Germany

Guthrie WKC (1996) A History of Greek Philosophy, Vol. 2: The

Presocratic Tradition from Parmenides to Democritus. Cam-

bridge University Press

Hailey A, Pulford EA, Stubbs D (1984) Summer activity pat-

terns of Testudo hermanni Gmelin in Greece and France. Am-

phibia-Reptilia 5: 69-78

Hailey A (2000) The effects of the fire and mechanical habitat

destruction on survival of the tortoise 7estudo hermanni in

northern Greece. Biological Conservation 92: 321—332

Hailey A, Willemsen RE (2003) Changes in the status of tortoise

populations in Greece 1984-2001. Biodiversity and Conser-

vation 12: 991—1000

OZFMK

340 Panayiotis Pafilis

Hausdorf B, Hennig C (2004) The influence of recent geogra-

phy, palaeogeography and climate on the composition of the

fauna of the central Aegean Islands. Biological Journal of the

Linnean Society 84: 785-795

Ioannides Y, Dimaki M, Dimitropoulos A (1994) The herpeto-

fauna of Samos (Eastern Aegean, Greece). Annales Musei

Goulandris 9: 445-456

Ioannidis Y, Bousbouras D (1997) The space utilization by rep-

tiles in Prespa National Park. Hydrobiologia 351: 135-142

Legakis A, Maragou, P (2009) The Red Data Book of threatened

vertebrates of Greece. Hellenic Zoological Society, Athens

Karandinos M, Paraschi L (1992) The Red Data Book of threat-

ened vertebrates of Greece. Hellenic Zoological Society, Hel-

lenic Ornithological Society, Athens

Kasapidis P (2001) Study of the phylogeography of the geck

Mediodactylus kotschyi (Reptilia: Gekkonidae) in the Aege-

an archipelago and adjacent areas. Dissertation in Greek. Uni-

versity of Crete

Keymar PF (1984) Vorlaufige Ergebnisse herpetologischer Auf-

sammlungen auf den Ionischen Inseln: I.Korfu und Paxos. An-

nalen des Naturhistorischen Museums in Wien Serie B Bota-

nik und Zoologie 86: 285-286

Keymar PF (1986a) Die Amphibien und Reptilien der Ionischen

region (Griechenland). Analyse ihrer rezenten Verbreitungs-

muster und Uberlegungen zu ihrer Ausbreitungsgeschichte.

Osterreichische Gesellschaft fuer Herpetologie-Nachrichten:

8-43

Keymar PF (1986b) Liste der Amphibien und Reptilien der Pe-

loponnes-Halbinsel. Osterreichische Gesellschaft fiir Herpe-

tologie — Nachrichten: 3—26

Keymar PF (1988) Vorlaufige Ergebnisse herpetologischer Auf-

sammlungen auf den Ionischen Inseln: Zakynthos und Mara-

thonisi. Annalen des Naturhistorischen Museums in Wien. Se-

rie B Botanik und Zoologie 90: 17-25

Knoefel PK, Covi MC (1991) A Hellenistic Treatise on Poiso-

nous Animals. The Theriaca of Nicander of Colophon: a Con-

tribution to the History of Toxicology. Edwin Mellen Press

Kotsakis T (1990) Insular and non-insular vertebrate fossil fau-

na in Eastern Mediterranean islands. Atti Convenci Lincei 85:

289-334

Kosuch J, Vences M, B6hme W (1999) Mitochondrial DNA se-

quence data support the allocation of Greek mainland

chameleons to Chamaeleo africanus. Amphibia-Reptilia 20:

440-443

Kyriakopoulou-Sklavounou P (1983) Contribution to the study

of biology of the water frog Rana ridibunda Pallas (Anoura,

Ranidae). Dissertation in Greek. University of Thessaloniki

Kyriakopoulou-Sklavounou P (2000) Adaptations of some am-

phibian species to Mediterranean environmental conditions.

Belgian Journal of Zoology 130: 113-117

Kyriakopoulou-Sklavounou P, Xiromeritis NK, Spyridis HC

(1992) An experimental bioacoustic analysis of mating and ter-

ritorial calls of the frog Rana ridibunda. Acustica 76: 247-252

Kyriakopoulou-Sklavounou P, Xeros G, Charilaou C, Tsiora A

(2003) Preliminary data on the genetic differentiation of po-

pulations of three frog species (Anura, Amphibia) from Cy-

prus and Greece. Belgian Journal of Zoology 113: 191-193

Lotze HU (1974) Eine Vierstreifennatter (Elaphe quatuorlineata)

von den Sporadeninsel Kos. Salamandra 10: 27-30

Lotze HU (1977) Coluber ravergieri non Elaphe quatuorlineata

von der Sporadeninsel Kos (Reptilia, Serpentes, Colubridae).

Salamandra 13: 117

Loumbourdis N (1981) Study of the reproductive biology of the

lizard Agama stellio (L.) (Sauria: Agamidae). Dissertation in

Greek. University of Thessaloniki

Bonn zoological Bulletin 57 (2): 329-345

Loumbourdis NS, Hailey A (1985) Activity metabolism of the

lizard Agama stellio stellio. Comparative Biochemical Phys-

iology (A) 82: 687-691

Loumbourdis NS (1997) Heavy metal contamination in a lizard,

Agama stellio stellio, compared in urban, high altitude and

agricultural, low altitude areas of north Greece. Bulletin of En-

vironmental Contamination and Toxicology 58: 945—952

Loumbourdis NS (2005) Hepatotoxic and nephrotoxic effects of

Cadmium in the frog Rana ridibunda. Archives of Toxicolo-

gy 79: 434-440

Loumbourdis NS (20070 Liver histopathologic alterations in the

frog Rana ridibunda from a small river of Northern Greece.

Archives of Environmental Contamination and Toxicology 53:

418-425

Lymperakis P, Valakos ED, Pafilis P, Mylonas M (2001) [Jer-

petologia Candiana, Societas Herpetologica Europea. Natur-

al History Museum of Crete

Lymberakis P, Poulakakis N, Manthalou G, Mylonas M (2007)

Mitochondrial phylogeography of Rana (Pelophylax) popu-

lations in the Eastern Mediterranean region. Molecular Phy-

logenetics and Evolution 44: 115-125

Lymberakis P, Poulakakis N, Kaliontzopoulou A, Mylonas M,

Valakos ED (2008) Two new species of Podarcis (Squamata:

Lacertidae) from Greece. Systematics and Biodiversity 6:

307-318

Lymberakis P, Poulakakis N (2010) Three Continents Claiming

an Archipelago: The Evolution of Aegean’s Herpetofaunal Di-

versity. Diversity 2: 233-255

Maragou P, Valakos ED, Giannopoulos Z, Stavropoulou A,

Chondropoulos BP (1996) Spring aspect of feeding ecology

in Podarcis peloponnesiaca (Bibron & Bory, 1833) (Squama-

ta: Sauria: Lacertidae). Herpetozoa 9: 105—110

Maragou P (1997) A comparative ecological study of the sym-

patric Peloponnese species Lacerta graeca (Bedriaga, 1886)

and Podarcis peloponnesiaca (Bibron I-E Bory, 1883). Dis-

sertation in Greek. University of Patras

Maragou P, Chondropoulos BP, Valakos ED (1999) Compara-

tive data on reproduction in Podarcis erhardii, Podarcis pelo-

ponnesiaca, and Podarcis taurica (Reptilia, Sauria, Lacer-

tidae). Israel Journal of Zoology 45: 487-496

Mantziou G (2006) Phylogeography and population genetics of

the species Mauremys rivulata (Chelonia — Geomydidae). Dis-

sertation in Greek. University of Crete

Margaritoulis D, Arapis T, Kornaraki E, Mytilineou C (1986)

Three specimens of the sea turtle Chelonia mydas (L.) record-

ed in Greece. Biologia Gallo-Hellenica 12: 237-243

Margaritoulis D (2005) Nesting activity and reproductive out-

put of loggerhead sea turtles, Caretta caretta, over 19 Seasons

(1984-2002) at Laganas Bay, Zakynthos, Greece: the largest

rookery in the Mediterranean. Chelonian Conservation and

Biology 4: 916-929

Mayer W (1986) Proteinelektrophoretische Untersuchungen zur

subspezifischen Gliederung von Lacerta (Podarcis) pelopon-

nesiaca. Bonner Zoologische Beitraege 37: 123-129

Mayer W (1993) Die Lacertiden Griechenlands — eine kritische

Liste. Die Eidechse 10: 8-14

Mayer W, Beyerlein P (2002) Genetische Differenzierung des

Lacerta viridis/bilineata Komplexes und von Lacerta trilin-

eata in Griechenland: mtDNA Sequenzen. Mertensiella 13:

52-59

Mayer W, Arribas O (2003) Phylogenetic relationships of the Eu-

ropean lacertid genera Archaeolacerta and Iberolacerta and

their relationships to some other ‘Archaeolacertae’ (sensu la-

to) from Near East, derived from mitochondrial DNA

©ZFMK

A brief history of Greek herpetology 341

sequences. Journal of Zoological Systematics and Evolutio-

nary Research 41: 157-161

Mertens R, Miller L (1928) Die Amphibien und Reptilien

Europas. Verlag, Frankfurt

Mertens R (1955) Der Typus von Vipera lebetina schweizeri.

Senckenbergiana Biologica 36: 297-299

Mertens R (1959) Zur Kenntnis der Lacerten auf der Insel Rho-

dos. Senckenbergiana Biologica 40: 15-24

Mertens R (1961) Die Amphibien und Reptilien der Insel Kor-

fu. Senckenbergiana Biologica 42: 1-29

Mertens R (1968a) Eine schwarze Zornnatter von den Cycladen:

Columber gemonensis gyarosensis n.subsp. Senckenbergiana

Biologica 49: 181-189

Mertens R (1968b) Nachtrag zur Reptilienfauna der Insel Kor-

fu. Senckenbergiana Biologica 49: 173-180

Mertens R (1972) Zoologische Wandertage auf Korfu, der In-

sel der Phaaken. Natur und Volk 90: 321-339

Mertens R, Wermuth T (1960) Die Amphibien und Reptilien

Europas. Verlag, Frankfurt

Meyer M (1985) Die Reptilienfauna des stidlichen Peleponnes.

Sauria 7: 13-16

Miller L (1908) Eine herpetologische Exkursion in den Tayge-

tos. Bl. F. Aquarium u. Terrarienkunde XIX, pp. 121-122,

138-140, 149-151, 163-166, 180-182, 188-190, 200-202,

250-252, 267-270

Nilson G, Andren C, Ioannides Y, Dimaki M (1999) Ecology and

conservation of the Milos viper, Macrovipera schweizeri (Wer-

ner, 1935). Amphibia-Reptilia 20: 355-375

Ondrias JC (1968) Liste des Amphibiens et des reptiles de la

Grece. Biologia Gallo-Hellenica 2: 111-135

Pafilis P (2003) Adaptations of lacertids based on their thermal

biology, metabolic rate and phylogenetic history. Dissertation

in Greek. University of Athens

Pafilis P, Valakos ED, Foufopoulos J (2005) Comparative post-

autotomy tail activity in six Mediterranean lacertid lizard

species. Physiological and Biochemical Zoology 78(5):

828-838

Pafilis P, Foufopoulos J, Poulakakis N, Lymberakis P, Valakos

ED (2007) Digestive performance in five Mediterranean lizard

species: effects of temperature and insularity. Journal of Com-

parative Physiology B 177: 49-60

Pafilis P, Pérez-Mellado V, Valakos ED (2008) Post autotomy

tail activity in Balearic wall lizard, Podarcis lilfordi. Natur-

wissenschaften 95 (3): 217-221

Pafilis P, Foufopoulos J, Poulakakis N, Lymberakis P, Valakos

ED (2009) Tail shedding in island lizards [Lacertidae, Rep-

tilia]: Decline of antipredator defenses in relaxed predation en-

vironments. Evolution 63(5): 1262—1278

Pausanias, Description of Greece (in ten books). Translated by

WHS Jones and HA Omerod. Loeb Classical Library Volumes.

Cambridge, MA, Harvard University Press; London, William

Heinemann Ltd.

Poulakakis N (20030 Investigation of the phylogenetic proce-

dures in the lizards of the genus Podarcis (Sauria: Lacertidae)

in Greece. Dissertation in Greek. University of Crete

Poulakakis N, Lymberakis P, Antoniou A, Chalkia D, Zouros E,

Mylonas M, Valakos ED (2003) Molecular phylogeny and bio-

geography of the wall-lizard Podarcis erhardii (Squamata :

Lacertidae). Molecular Phylogenetics and Evolution 28: 38-46

Poulakakis N, Lymberakis P, Tsigenopoulos CS, Magoulas A,

Mylonas M (2005a) Phylogenetic relationships and evolution-

ary history of the snake-eyed skink Ablepharus kitaibelii

(Sauria: Scincidae). Molecular Phylogenetics and Evolution

34: 245-256

Bonn zoological Bulletin 57 (2): 329-345

Poulakakis N, Lymberakis P, Valakos ED, Pafilis P, Zouros E,

Mylonas M (2005b) Phylogeography of Balkan wall lizard

(Podarcis taurica) and its relatives inferred from mitochon-

drial DNA sequences. Molecular Ecology 14: 2433-2443

Poulakakis N, Pakaki V, Mylonas M, Lymberakis P (2008) Mol-

ecular phylogeny of the Greek legless skink Ophiomorus

punctatissimus (Squamata : Scincidae): The impact of the Mid-

Aegean trench in its phylogeography. Molecular Phylogenet-

ics and Evolution 47: 396-402

Runemark A, Gabirot M, Bensch S, Svensson E, Martin X, Pa-

filis P, Valakos ED, Hansson B (2008) Identification of poly-

morphic microsatellite loci in Podarcis gaigeae and Podar-

cis hispanica (Squamata: Lacertidae) and assessment of their

utility in three other Podarcis species. Mollecular Ecology Re-

sources 8: 1367-1370

Schneider B (1986) Zur Herpetofauna der Insel Limnos (Helle-

spontische Inseln, Nordagais, Griechenland). Salamandra 22:

276-280

Schneider B (1995) The herpetofauna of Agios Efstratios (Helle-

spontic Islands, northern Aegean Sea, Greece), with remarks

on the zoogeography of this region. Biologia Gallo-Helleni-

ca 22: 49-55

Schneider H, Sofianidou TS, Kyriakopoulou-Sklavounou P

(1984) Bioacoustic and morphometric studies in water frogs

(genus Rana) of Lake Ioannina in Greece, and description of

anew species (Anura, Amphibia). Zeitschrift ftir Zoologische

Systematik und Evolutionsforschung 22: 349-366

Schneider H, Sofianidou TS (1985) The mating call of Rana ridi-

bunda (Amphibia, Anura) in northern Greece as compared

with those of Yugoslavian and Israeli populations: proposal

of a new subspecies. Zoologischer Anzeiger 214: 309-319

Schneider H, Sofianidou TS, Kyriakopoulou-Sklavounou P

(1988) Calling bahaviour and calls of Rana dalmatina (Anu-

ra, Ranidae) in Greece. Zoological Journal of Physiology 92:

231-243

Schneider H, Sinsch U, Sofianidou. TS (1993) The water frogs

of Greece. Bioacoustic evidence for a new species. Zeitschrift

fuer Zoologische Systematik und Evolutionsforschung 31: 47—

Schweizer H (1932) Beitrag zur Kenntnis der Vipera lebetina

Levanteotter auf Milos. Blaetter Aquarien- und Terrarienkun-

de 43: 383-386

Schweizer H (1935) Beitrag zur Reptilienfauna der Inselgrup-

pe von Milos (Cycl.). Blaetter Aquarien- und Terrarienkunde

1935: 8-15

Schweizer H (1938) Weiteres tiber die Reptilienwelt der stidwest-

lichen Kykladen (Vipera lebetina lebetina von Milos eine Ei-

erlegerin). Blaetter Aquarien- und Terrarienkunde 1938: 33—

Schweizer H (1957) Weiteres ueber die Ringelnatter und Lev-

ante-Otter der West-Cycladen. Aquar. Terr. Zeitung Stuttgart

10: 161-164

Simmons A (1991) Humans, island colonization and Pleistocene

extinctions in the Mediterranean: the view from Akrotiri Ae-

tokremnos, Cyprus. Antiquity 65: 857-869

Simou Ch (2009) Tail autotomy in lacertid lizards (Reptilia-

Sauria): mechanisms and adaptations. Dissertation in Greek.

University of Athens

Sofianidou TS (1977) Study of the biology and ecology of Pelo-

bates syriacus, Boettger (Anura: Pelobatidae). Dissertation in

Greek. University of Thessaloniki

Sofianidou TS (1996) Electrophoretic studies of hybrids of Wa-

ter Frogs (Rana epeirotica, R.balcanica) in the Ionian zone of

Greece. Israel Journal of Zoology 42: 149-157

©Z7FMK

342 Panayiotis Pafilis

Sofianidou ThS (1999) Testudo marginata, the endemic turtle

of Greece. Giachoudis Publications, Thessaloniki, Greece

Sofianidou TS, Kyriakopoulou-Sklavounou P (1983) Studies on

the biology of the frog Rana dalmatina Bonaparte, during the

breeding season in Greece (Amphibia: Anura: Ranidae). Am-

phibia-Reptilia 4: 125-136

Sondaar PY, de Vos J, Dermitzakis MD (1986) Late Cenozoic

faunal evolution and palaeogeography of the South Aegean

island arc. Modern Geology 10: 249-259

Sotiropoulos K, Tomovic L, Dzukic G, Kalezic ML (2001) Mor-

phological differentiation of the Alpine Newt (Triturus

alpestris) in the Balkans: Taxonomic implications. Herpeto-

logical Journal 11: 225-231

Sotiropoulos K (2004) Genetic and morphological diversity of

the genus Triturus (Amphibia, Urodela) in Greece: historical

and ecological interpretations. Dissertation in Greek. Univer-

sity of Athens

Sotiropoulos K, Legakis A Tzannetatou-Polymeni R, (2008a)

Patterns of morphometric variation in the smooth newt (Lis-

sotriton vulgaris) from Greece: environmental correlates. Jour-

nal of Natural History 42: 435-450

Sotiropoulos K, Tsaparis D, Eleftherakos K, Tzannetatou-Poly-

meni R, Legakis A (2008b) New polymorphic microsatellite

loci for the Macedonian crested newt, 7riturus macedonicus,

and cross-priming testing in four other crested newt species.

Molecular Ecology Resources 8: 1402—1404

Sotiropoulos K, Eleftherakos K, Tsaparis D, Tzannetatou-Poly-

meni R, Legakis A (2009) New polymorphic microsatellite lo-

ci for the Greek smooth newt, Lissotriton vulgaris graecus,

and their utility in the nominotypical subspecies. Molecular

Ecology Resources 9: 292—295

Stepanek O (1934) Gymnodactylus kotschyi Steindachner und

sein Rassenkreis. Archiv fiir Naturgeschichte, N. F. 6: 258—

280

Stepanek O (1938) Zweiter Beitrag zur Herpetologie der Insel

Kreta (Vorlaufige Mitteilung). Vestn. ceskosl. zool. Spol. 5:

77-19

Stepanek O (1944) Zur Herpetologie Griechenlands. Vestn.

ceskosl. zool. Spol. 9: 123-147

Strijbosch H, Helmer W, Scholte PT (1989) Distribution and

ecology of lizards in the Greek province of Evros. Amphib-

ia-Reptilia 10: 151-174

Strijbosch H (2001) Habitat selection of Lacerta trilineata and

Lacerta viridis in eastern Greece. Mertensiella 13: 159-164

Tiedemann F, Haupl M (1980) Eine neue Unterart von Cyrtod-

actylus kotschyi von den griechischen Insel Nisos Makri und

Nisos Strongili (NW Rhodos). Annalen des Naturhistorischen

Museums Wien 83: 539-542

Tiedemann F, Haupl M (1982) Cyrtodactylus kotschyi (Stein-

dachner, 1870) in the Santorini archipelago. Amphibia-Rep-

tilia 3: 377-381

Tiedemann F, Grillitsch H (1986) Zur Verbreitung von Vipera

xanthina (Gray, 1849) in Griechenland (Serpentes: Viperidae).

Salamandra 22: 272-275

Trapp B (2003) Chamaeleo africanus in Europe: information on

a protection project for extinction avoidance for an endange-

red species in Europe. Reptilia 8: 39

Trapp B (2004) Good news on Greek chameleons. Elaphe 12:

50-54

Trapp B (2006) Die Amphibien und Reptilien des Griechischen

Festlandes. Natur und Tier Verlag.

Tsiora A (2003) Study of the reproductive biology of the water

frog Rana epeirotica (Schneider et al. 1984) in Ioannina Lake.

Dissertation in Greek. University of Thessaloniki

Bonn zoological Bulletin 57 (2): 329-345

Tzannetatou-Polymeni RM (1988) Contribution to the study of

the amphibian species Mertensiella luschani (Steindachner

1891) (Urodela, Salamandridae). Populations and biochemi-

cal data. Dissertation in Greek. University of Athens

Valakos ED (1986) The feeding ecology of Podarcis erhardii

(Reptilia — Lacertidae) in a main insular ecosystem. Herpeto-

logical Journal 1: 118-121

Valakos ED (1989) Thermal ecology of Cyrtodactylus kotschyi

(Steindachner, 1870) (Sauria Gekkonidae) in the insular

ecosystems of the Aegean. Herpetological Journal 1: 396-399

Valakos ED, Mylonas M (1992) Distribution and ecological as-

pects of the herpetofauna of Strofadhes Islands (Ionian Arch-

ipelago, Greece). Herpetozoa 5: 33-39

Valakos ED 1990. The ecology of the lizard Podarcis erhardii

(Bedriaga, 1882) (Sauria: Lacertidae) in a typical island

ecosystem on Naxos. Dissertation in Greek. University of

Athens

Valakos ED, Dimaki M, Pafilis P (2004) Natural History of

Lesvos: Reptiles and Amphipians. Natural History Collection

of Vrissa, Lesvos, University of Athens. Mytilene

Valakos ED, Kourkouli A, Skopeliti M, Pafilis P, Poulakakis N,

Voutsas IF, Lymberakis P, Simou Ch, Voelter W, Tsitsilonis

OE (2007) Combining immunological and molecular data to

assess phylogenetic relations of some Hellenic Podarcis

species. Comparative Biochemistry and Physiology (A) 147:

1-10

Valakos ED, Pafilis P, Sotiropoulos K, Lymberakis P, Marangou

P, Foufopoulos J (2008) Reptiles and Amphibians of Greece,

Chimaira Publications, Frankfurt am Mainz

Vassara E (1999) Intrapopulation study of the frog Bombina va-

riegata (Linnaeus 1758) in Greece. Dissertation in Greek. Uni-

versity of Thessaloniki

Werner F (1894) Die Reptilien- und Batrachierfauna der Ioni-

schen Inseln. Verhandlungen der Zoologisch-Botanischen Ge-

sellschaft in Wien 44: 225-237

Werner F (1912) Beitraege zur Kenntnis der Reptilien und Am-

phibien Griechenlands. Archive fuer Naturgeschichte 78: 167—

180

Werner F (1927) Beitrage zur Kenntnis den Fauna Griechen-

lands. Zoologische Anzeiger LXX, pp. 135-143

Werner F (1930) Contribution to the knowledge of the reptiles

and amphibians of Greece, especially the Aegean islands. Oc-

casional papers of the University of Michigan Museum of Zo-

ology 211: 1-47

Werner F (1933) Ergebnisse einer zoologischen Studien- und

Sammelreise nach den Inseln des Aegaeischen Meeres. I. Rep-

tilien und Amphibien. Sitzungsberichte der Mathematisch-Na-

turwissenschafftlichen Klasse-Abteilung B. 143: 105-131

Werner F (1937) Beitraege zur Kenntnis der Tierwelt des Pelo-

ponnes, der Inseln Kythira und Euboea sowie der kleinen In-

seln im Saronischen Golf. Sitzungsberichte der Mathematisch-

Naturwissenschaftlichen Klasse Abteilung B. 146: 135—153

Werner F (1938) Ergebnisse der achten zoologischen For-

schungsreise nach Griechenland (Euboea, Tinos, Skiathos,

Thasos usw.). Sitzungsberichte der Mathematisch-Naturwis-

senschafftlichen Klasse Abteilung B. 147: 151-173

Wettstein O v (1931) Herpetologie der Insel Kreta. Annalen des

Naturhistorischen Museums Wien 45: 159-172

Wettstein O v (1953) Herpetologia Aegaea. Sitzungsberichte der

Mathematischen-Naturwissenschafftlichen Klasse Abteilung

B. 162: 651-833

Willemsen RE (1991) Differences in thermoregulation between

Testudo hermanni and Testudo marginata and their ecologi-

cal significance. Herpetological Journal 1: 559-567

©ZFMK

A brief history of Greek herpetology 343

Willemsen RE (1999) Variation of adult body size of the tortoise

Testudo hermanni in Greece: proximate and ultimate causes.

Journal of Zoology 248: 379-396

Willemsen RE, Hailey A (2002) Body mass condition in Greek

tortoises: regional and interspecific variation. Herpetological

Journal 12: 105-114

Xyda A (1983) Differentiation between the local Greek and

Cypriot populations of Agama stellio (Reptilia: Agamidae).

Dissertation in Greek. University of Athens

APPENDIX

Xyda A (1986) Supplementary evidence on the biometry and

ecology of the lizard Stellio stellio of Greece and Cyprus. Bi-

ologia Gallo-Hellenica 12: 451-458

Zavattari E (1929) Ricerche faunistiche nelle Isole Italiane dell’

Egeo. Anfibi e Rettili. Archivo Zoologico Italiano 12/13:

161-166

Received: 30.VII.2010

Accepted: 31.VII.2010

Table 1. List of species known from Greece with distribution and date of original description.

Date Species Author Range Group

1758 Anguis fragilis Linnaeus Mainland Greece, Thassos and Corfu islands —_ Rept: Anguidae

1758 Bombina variegata Linnaeus Mainland Greece, not in Peloponnese Amph: Discoglossidae

1758 Bufo bufo Linnaeus Mainland Greece and large Aegean islands Amph: Bufonidae

1758 Caretta caretta Linnaeus All Greek seas Rept: Chelontidae

1758 Chamaeleo chamaeleon Linnaeus Chios and Samos Islands Rept: Chamaeleonidae

1758 Chelonia mydas Linnaeus All Greek seas Rept: Cheloniidae

1758 Dolichophis jugularis Linnaeus Islands of southeastern Aegean Sea Rept: Colubridae

1758 Emys orbicularis Linnaeus Mainland Greece, Samos, Samothraki, Rept: Emydidae

Kos, Lesvos and Evvoia islands

1758 Eryx jaculus Linnaeus Throughout the country excluding Crete Rept: Boidae

1758 Hemidactylus turcicus Linnaeus Throughout the country Rept: Gekkonidae

1758 Hyla arborea Linnaeus Mainland Greece and large islands Amph: Hylidae

1758 Lacerta agilis Linnaeus Northern borders in high elevations Rept: Lacertidae

1758 Laudakia stellio Linnaeus Only European population Rept: Agamidae

Eastern Aegean Sea Islands, Corfu,

Thessaloniki and central Cyclades

1758 Lissotriton vulgaris Linnaeus Mainland Greece and large Ionian islands Amph: Salamandridae

1758 Natrix natrix Linnaeus Throughout the country excluding Crete Rept: Colubridae

1758 Rana temporaria Linnaeus Northern borders with Bulgaria Amph: Ranidae

1758 Salamandra salamandra Linnaeus Mainland Greece Amph: Salamandridae

1758 Tarentola mauritanica Linnaeus Western Peloponnese, Crete and Ionian Islands Rept: Gekkonidae

1758 Testudo graeca Linnaeus Mainland Greece and many islands Rept: Testudinidae

1758 Trionyx triunguis Forsskal Introduced, Kos island Rept: Trionychidae

1758 Trachylepis auratus Linnaeus Rhodes, Kos, Symi and Samos islands Rept: Scincidae

1758 Vipera ammodytes Linnaeus Throughout the country excluding Crete, Rept: Viperidae

Milos Archipelago and eastern Aegean Sea islands

1758 Vipera berus Linnaeus Macedonia and Thrace in high elevations Rept: Viperidae

1758 Zamenis situlus Linnaeus Throughout the country Rept: Colubridae

1761 Bombina bombina Linnaeus Borders with Bulgaria, River Evros Amph: Discoglossidae

1761 Dermochelys coriacea Vandelli All Greek seas Rept: Dermochelyidae

1768 Chamaeleo africanus Laurenti Only European population, Rept: Chamaeleonidae

a restricted zone in southeastern Peloponnese

1768 Coronella austriaca Laurenti Epirus, Macedonia, Thrace, Thassos Rept: Colubridae

and Samothraki islands

1768 Hierophis gemonensis Laurenti Throughout mainland Greece Rept: Colubridae

excluding Macedonia and Epirus,

Ionian islands and Crete

Bonn zoological Bulletin 57 (2): 329-345

©ZFMK

344 Panayiotis Pafilis

Date Species Author Range Group

1768 Lacerta viridis Laurenti Mainland Greece excluding Peloponnese Rept: Lacertidae

1768 Mesotriton alpestris Laurenti Mainland Greece Amph: Salamandridae

1768 Natrix tessellata Laurenti Throughout the mainland country, Rept: Colubridae

Crete and some Aegean and Ionian islands

1768 Podarcis muralis Laurenti Throughout mainland Greece Rept: Lacertidae

and Thassos island

1768 Pseudepidalea viridis Laurenti Mainland and insular Greece Amph: Bufonidae

1768 Triturus carnifex Laurenti Epirus, Macedonia and Corfu island Amph: Salamandridae

1768 Zamenis longissimus Laurenti Throughout the mainland country, Rept: Colubridae

Corfu and Paxoi islands

1774 Pelophylax ridibundus Pallas Eastern Macedonia and Thrace Amph: Ranidae

1775 Chalcides ocellatus Forsskal Attica and close islands, Rept: Scincidae

Crete, eastern Peloponnese

1775 Pseudopus apodus Pallas Mainland Greece and in many large islands Rept: Anguidae

1789 Dolichophis caspius Gmelin Throughout the country excluding Crete, Rept: Colubridae

Rhodes and the majority of Peloponnese

1789 Elaphe quatorlineata Lacepéde Throughout the country excluding Crete Rept: Colubridae

and Rhodes

1789 Eurotestudo hermanni Gmelin Mainland Greece, Zakynthos, Cephalonia, Rept: Testudinidae

Corfu and Evvoia islands

1789 Hierophis viridiflavus Lacepéde Introduced, Gyaros Island Rept: Colubridae

1789 Platyceps najadum Gmelin Throughout the mainland country Rept: Colubridae

and in some Aegean islands

1795 Testudo marginata Schoepff Endemic, Mainland Greece Rept: Testudinidae

excluding Thrace and many Aegean islands

1802 Rana catesbeiana Shaw Introduced, Crete Amph: Ranidae

1804 Malpolon monspessulanus Hermann Throughout the country Rept: Colubridae

excluding Crete and Cyclades

1814 Elaphe sauromates Pallas Thrace and Thassos island Rept: Colubridae

1814 Podarcis tauricus Pallas Throughout mainland Greece Rept: Lacertidae

and Ionian islands

1820 Typhlops vermicularis Merrem Throughout the country excluding Crete Rept: Typhlopidae

1831 Telescopus fallax Fleischmann Throughout the country Rept: Colubridae

1832 Ophisops elegans Ménétriés Only European population, Rept: Lacertidae

islands of northeastern Aegean Sea

1833 Ablepharus kitaibelii Bibron & Bory Throughout the country Rept: Scincidae

/ terra typica in Greece

1833 Algyroides moreoticus Bibron & Bory Endemic, Peloponnese and Rept: Lacertidae

few Ionian Islands

1833 Mauremys rivulata Valenciennes Throughout the country Rept: Geoemydidae

1833 Ophiomorus punctatissimus Bibron & Bory Only European population, Rept: Scincidae

Peloponnese, Kythira and Kastelorizo islands

/ terra typica in Greece

1834 Darevskia praticola Evermann Eastern Thrace near river Evros Rept: Lacertidae

1834 Hemorrhois nummifer Reuss Only European population, Rept: Colubridae

Islands of southeastern Aegean Sea

1833 Podarcis peloponnesiacus Bibron & Bory Endemic, Peloponnese / Rept: Lacertidae

terra typica in Greece

1835 Vipera ursinii Bonaparte Central and northern Greece Rept: Viperidae

in high elevations

1838 Eirenis modestus Martin Only European population, Rept: Colubridae

Thrace and eastern Aegean Sea islands

1839 Algyroides nigropunctatus Duméril & Bibron Western mainland Greece Rept: Lacertidae

(excluding Peloponnese) and Ioanian Islands

/ terra typica in Greece

1840 Rana dalmatina Bonaparte Discontinuous range in mainland Greece Amph: Ranidae

Bonn zoological Bulletin 57 (2): 329-345

©ZFMK

A brief history of Greek herpetology 345

Date Species Author Range Group

1849 Montivipera xanthina Gray Only European population, Rept: Viperidae

Thrace and eastern Aegean Sea islands

1870 Cyrtopodion kotschyi Steindachner Throughout the country Rept: Gekkonidae

1870 Trituris karelinii Strauch Macedonia and Thrace Amph: Salamandridae

1876 Podarcis erhardii Bedriaga Throughout mainland Greece, Rept: Lacertidae

Sporades and Cyclades

/ terra typica in Greece

1881 Hellenolacerta graeca Bedriaga Endemic, Peloponnese Rept: Lacertidae

1882 Pelophylax bedriagae Camerano River Evros, east Aegean Islands Amph: Ranidae

1882 Podarcis milensis Bedriaga Endemic, Milos Arhipelago Rept: Lacertidae

/ terra typica in Greece

1884 Blanus strauchi Bedriaga Only European population, Rept: Amphisbaenidae

Islands of southeastern Aegean Sea

1886 Lacerta trilineata Bedriaga Throughout the country Rept: Lacertidae

/ terra typica in Greece

1889 Pelobates syriacus Boettger Localities in northern Greece Amph: Pelobatidae

and Peloponnese, Lesvos island

1891 Lyciasalamandra luschani Steindachner Only European population, Amph: Salamandridae

Kastellorizo island

1891 Rana graeca Boulenger Mainland Greece Amph: Ranidae

1894 Anguis cephallonicus Werner Endemic, Peloponnese, Rept: Anguidae

Ithaca, Cephalonia and Zakynthos islands

1900 Anatololacerta anatolica | Werner Only European population, Samos island Rept: Lacertidae

/ terra typica in Greece

1904 Anatololacerta oertzeni Werner Only European population, Ikaria, Symi Rept: Lacertidae

and Rhodes islands / terra typica in Greece

1930 Podarcis gaigeae Werner Endemic, Skyros Arhipelago Rept: Lacertidae

/ terra typica in Greece

1935 Macrovipera schweizeri Werner Endemic, Milos Archipelago Rept: Viperidae

and Siphnos island / terra typica in Greece

1940 Pelophylax kurtmuelleri Gayda Mainland Greece, Thassos and Amph: Ranidae

Zakynthos islands, most Cycladic islands

1963 Lyciasalamandra helverseni Pieper Endemic, Karpathos, Kassos Amph: Salamandridae

and Saria islands / terra typica in Greece

1984 Pelophylax epeiroticus Schneider, Western mainland Greece Amph: Ranidae

Sofianidou &

Kyriakopoulou-

Sklavounou

1994

Pelophylax cerigensis

typica in Greece

1994

2008

Pelophylax cretensis

Podarcis cretensis

Beerli, Hotz,

& Uzzell

Beerli, Hotz,

Tunner, Heppich &

Uzzell

Lymberakis,

Poulakakis,

Endemic, Karpathos and

Tunner, Heppich

Endemic, Crete / terra typica in Greece

Amph: Ranidae

Rhodes islands / terra

Amph: Ranidae

Rept: Lacertidae

Kaliontzopoulou,

Mylonas & Valakos

Lymberakis,

Poulakakis,

Kaliontzopoulou,

Mylonas & Valakos

2008 Endemic, islets Pori and Lagouvardos Rept: Lacertidae

close to Antikythira / terra typica in Greece

Podarcis levendis

tal

‘a i

i 3)

{| i

\} i

Hi Hitues

Hi Pee

FSD

Weith y

ae fe

HHI

Bonn zoological Bulletin Volume 57 Issue 2 pp. 347-357 | Bonn, November 2010

The history of reptiles and amphibians at Frankfurt Zoo

Manfred Niekisch

Zoo Frankfurt, Bernhard-Grzimek-Allee 1, D-60316 Frankfurt am Main;

E-mail: manfred.niekisch@stadt-frankfurt.de

Abstract. Reptiles and amphibians were kept in Frankfurt Zoo from the very beginning in 1858. Information on the col-

lection is somewhat fragmentary but still sufficient to draw a picture on its development from then until today. Starting

with just a few reptile cages in the monkey house, reptiles soon became a major attraction for the visitors, and a special

section in the aquarium building was opened for them in 1904. Knowledge about how to keep reptiles and amphibians

was still very poor, but evolved steadily, and shortly before World War II Frankfurt Zoo was famous for its impressive

collection of herps, especially crocodilians. Completely destroyed in 1944, the zoo re-opened only a few months after

the end of war, but it was not until 1957 that the reptile hall on top of the newly erected aquarium building, which now

was called “Exotarium”, could be opened. Having undergone a number of improvements and renovations in the last four

decades, the Frankfurt Exotarium today has a number of remarkable breeding results and is putting — as the whole zoo

—a focus on nature conservation.

Key words: Exotarium, terrarium, herpetological collection, breeding success, nature conservation

THE START WITH A FEW SPECIES

Frankfurt Zoo was opened on 8 August 1858, the second

zoo in Germany after Berlin’s. Reptiles and amphibians

were exhibited here from the beginning. They were shown

in a wing of the monkey house and consisted mainly of

European species. The first Frankfurt Zoo guide published

in 1860 mentions a few tailed amphibians and lizards,

snakes and turtles (see Table 1). That chapter on herps al-

so mentions that there were plans to replace the small “rep-

tiles cage” and aquarium by a bigger facility. The newts

and the salamanders were at that time kept in the aquar-

tum together with the Great Loach (Cobitis fossilis). With

regard to the salamanders, it was stated that the animals

could be found “on the leaves” in the aquarium, but it is

not clear what this means exactly. Were they presented on

leaves floating on the water surface?

Unfortunately, aside from this first small “inventory” of

the reptiles and amphibians kept in Frankfurt Zoo, a sys-

tematic list was started only in the 1950s. Daily reports

contained information on new acquisitions, deaths and

births, and an electronic register for herps has been start-

ed only recently. So there is no detailed, continuous doc-

umentation of the herpetological species kept here from

the beginning until today. Substantial information on rep-

tiles and amphibians in the Frankfurt collection is

Bonn zoological Bulletin 57 (2): 347-357

scattered over a wide range of articles, zoo guides, and

annual reports, allowing one to gain an overall picture with

limited, but nevertheless interesting data.

Despite the growing importance and attractiveness of

Frankfurt Zoo’s herpetological section, not much attention

was paid to it in the zoo publications, as will also be shown

later. For example, the book published on the occasion of

the 100th anniversary of Frankfurt Zoo (Zoologischer

Garten der Stadt Frankfurt am Main 1958) has no picture

of a reptile or amphibian and only one — rather unimpor-

tant — view of the interior of the reptile building from

1957-58.

THE FOUNDING OF THE “DEFINITIVE” ZOO

This first zoo was a huge success as it awoke much inter-

est among the citizens of Frankfurt, but the terrain at the

“Leers’scher Garten” was small and could be rented for

only ten years. As a consequence, the founders of the zoo

decided to find a new location for a bigger and “defini-

tive” zoo. In 1865, the Frankfurt Zoological Society and

the Senate of the City of Frankfurt signed a contract to

establish a new Zoo at the “Pfingstweide”, (then) outside

©ZFMK

348

Manfred Niekisch

Table 1. Herpetological species as mentioned in the first guide to Frankfurt Zoo (Weinland 1860).

Scientific name*

Common name

Remarks (translated from German)

(translated from German)

Lacerta viridis

Pseudopus Pallasii

(scheltopusik, horned serpent)

Tropidonotus natrix var. bilineata

Coronella laevis

Testudo graeca

Testudo polyphemus

Glass snake

Ringed snake

Smooth snake

Greek tortoise

Gopher tortoise

Triton cristatus, igneus, taeniatus

Salamandra maculata

European green lizard

our specimens come from Vienna

eats grass, outside during the summer

on the flamingo meadow during the

summer

Our German water salamanders

Common European salamander

on the leaves

* Note: Scientific names in the whole article, when in quotes, and in this table are given as they are mentioned in the respective

publication and have not been transferred into modern nomenclature.

the City of Frankfurt. Reptiles and fishes had turned out

to be a real attraction for the visitors, and so, from the be-

ginning, the plan for the new zoo included designs for a

herpetological exhibition and aquaria. Due to a number

of complications and especially as a consequence of the

Fig. 1. The ,,romantic Aquarium tower of Frankfurt Zoo abo-

ve the lake in 1880.

Bonn zoological Bulletin 57 (2): 347-357

wars between Prussia and Austria (1866) and France and

Germany (1870-71), this contract never materialized and

the zoo remained — with an extension of the old contract

—at the “Leers’scher Garten” for a few more years. Fi-

nally, under a new contract, the new zoo was opened at

the Pfingstweide on 29 March 1874, at the same place that

had already been envisaged before the wars. Frankfurt Zoo

has remained at this site until today. Thanks to an initia-

tive of Bernhard Grzimek immediately after the Second

World War it was enlarged and now covers eleven

hectares. The city of Frankfurt has grown around it, so to-

day Frankfurt Zoo is in a central location.

SLOW START FOR THE TERRARIUM SECTION

Despite all the plans and good intentions, the construction

of a number of enclosures for mammals and birds and, in

particular, a new aquarium and terrarium building had to

be postponed due to financial and other constraints once

the zoo had moved to its new destination in 1874. But at

least there was substantial planning, and the knowledge

about how to keep fish and herps as well as the develop-

ment of technical means was rapidly increasing right

throughout that period. This is also indicated by the fast

growing number of associations of aquarium and terrari-

um hobbyists in Germany in the last two decades of the

19th century.

To provide the financial means for the aquarium building,

the members of the administrative council and supervi-

sory board provided a loan of 50,000 Reichsmarks. In

1877, the building, comprising two freshwater and 12 sea-

water aquaria and (as far as is known) a few terraria was

©ZFMK

Herpetology at Frankfurt Zoo 349

finally able to be opened. The building was placed inside

an artificial hill, so the walls were insulated and the tem-

perature could be kept relatively constant. The issue of ma-

jor concern and of utmost importance for the aquarium

section, namely water, was solved by erecting a tower with

water tanks inside filled with ground water. This simple

technique, based on gravity, is still functioning today, guar-

anteeing the constant and uniform flow of water into the

filters and aquaria.

The tower was made to look like an old castle or ruin, and,

together with the hill it stands on and the neighbouring

lake, it catered nicely to the romantic taste of that time

(Fig: 1):

An extra entrance fee was charged for the aquarium in or-

der to pay the loan back. So the aquarium had its own en-

trance fee, and only in 1992 was this practice abandoned

and no extra fee was charged any more for visiting the

aquarium.

DIFFICULT TIMES, BUT A STEADY INCREASE IN

EXPERIENCE

The herpetological section had been planned as the sec-

ond storey of the aquarium building and could only be

built later. It finally opened on 15 May 1904. In the ten

years before that, the reptiles seem to have had a rather

difficult life at Frankfurt Zoo. Especially in winter, many

of these animals died because of the poor conditions they

were kept in. It was Wilhelm Haacke, director of the zoo

from 1888 to 1893, in particular, who expanded the rep-

tile collection. During the summer months, when the mon-

keys were kept in outside enclosures, he used the mon-

key house to put boxes with reptiles and amphibians on

exhibit. As can be read in the 1895 zoo guide, the “col-

lection that was outstanding because of its richness ...

[was] usually set up in May, temperatures allowing, and

remained there until October, a few boxes (containing the

giant snakes and bigger lizards) even remaining on show

during the winter”. For that latter purpose, a heated plat-

form (“Warmetisch”’) had been built in 1891.

Fig. 2.

Bonn zoological Bulletin 57 (2): 347-357

In the newly opened “Reptile Hall” sunlight was seen an important factor for the well being of reptiles (1904).

OZFMK

350 Manfred Niekisch

5 Panag) 42 ae .

Fig. 3.

It is plain that mortality was high. The 1895 zoo guide (the

first to be published after ten years!) lists, however, an im-

pressive number of species — or to be more precise: two

crocodiles, eleven turtles, 17 snakes, 22 lizards and ten

Fig. 4.

(1912).

A big specimen of Python reticulatus in its terrarium

Bonn zoological Bulletin 57 (2): 347-357

San

Rit “<

we,

LS W 7h

Mixed life in a tropical jungle environment: Tiliqua rugosa (?), Cordylus giganteus and Macroscincus coctei (1912).

anuran species and three species of urodela. A few of the

comments and specimens are truly remarkable. So

“thanks to the goodness of Mr Schmacker from Shang-

hai”, the collection contained “the first specimen of the

Chinese alligator brought live to Europe” and “two giant

Aldabra turtles (7estudo elephantina)’. With regard to the

latter, the 1895 zoo guide states that “only a few decades

will pass until this turtle of such incredible dimensions will

have become extinct”. “One of the rarest species at the Zo-

ological Garden, the snake-necked turtle, Hydraspis hi-

laire’’”’, was kept together with Chelydra serpentina. “The

Sinai lizard (Uromastix ornatus)” is described as a “very

strange animal. It feeds on rose petals in summer and on

acacia and lettuce in winter; as soon as the sun shines on

its back, it opens certain depressions in the skin and the

body assumes a very beautiful colour”. The lizard species

ranged from Anguis fragilis to “Silubosaurus stokes” and

from “Lacerta muralis” to “Tiliqua gigas”. Aside from

alpine salamander, Japanese giant salamander, bull frog

and Leptodactylus, all amphibians kept at that time were

species that occurred wild in the Frankfurt area.

©ZFMK

Herpetology at Frankfurt Zoo 351

Fig. 5.

(1912).

Tropical jungle landscape made of aquaria and plants

Haake (who by the way had been vividly recommended

by Ernst Haeckel for the post of zoo director) had a well-

developed collector’s mentality but his attempt to estab-

lish systematic collections of birds and herps did not re-

ceive much of a positive response from visitors to the zoo,

and he quit the job in 1893. His immediate successor,

Adalbert Seitz, then started to develop a completely new

concept for a reptile exhibit, recognizing that these ani-

mals needed sunlight. A glasshouse called the “reptile hall”

was erected on top of the aquarium building and inaugu-

rated on 15 May 1904 (Fig. 2). In the venomous snakes

section, increased security measures were introduced in

the year 1906 to offer the keepers better protection. The

number of species had by then risen to twelve turtles, 28

snakes, 25 lizards and 13 amphibians. Evidently there was

some “fluctuation” in the crocodile species, as the 1905

Z00 guide states: “Mostly different species such as the al-

ligator, Nile crocodile, dwarf crocodile etc. are on exhib-

it”. The Chlamydosaurus kingi kept in the collection is said

to be the first specimen “to have reached the European

continent alive”. In 1907, even before becoming zoo di-

rector in 1908, the then zoo assistant, Kurt Priemel, start-

ed changing the concept again. He wanted to show the vis-

itors the diversity of life, abandoning the approach of sys-

tematic collections. He built a second glasshouse next to

the first one, added to the reptile hall 40 aquaria for trop-

ical fish (Fig. 5) and a tropical wetland area for crocodiles

as well as big terraria for giant snakes (Fig. 4) and turned

the reptile house, together with the aquarium, into the

“biggest and most diverse of all such institutions on the

continent” (Scherpner 1983). As visitors to the zoo had

to pay an additional entrance fee for the aquarium and ter-

rarium building, visitor numbers could be easily moni-

tored. The new and enlarged building attracted more than

80,000 people every year.

Bonn zoological Bulletin 57 (2): 347-357

The zoo did not suffer any major physical damage dur-

ing the First World War, but the economically difficult

post-war era obliged director Priemel to be creative. He

made an interesting contract with the animal catcher and

dealer John Hagenbeck. Frankfurt hosted reptiles import-

ed by Hagenbeck and, in exchange, got the pre-emption

rights and a reduced price on the specimens Priemel want-

ed to buy. It is reported that visitors were quite astonished

by a sign saying “for sale” on a big container full of gi-

ant snakes which “none of the visitors managed to count”

(Scherpner 1983).

Soon the reptile collection had reached an impressive di-

mension, and its increasing importance is also document-

ed by a number of articles on it which were published in

the Zoo’s own “Mitteilungen aus dem Frankfurter Zoo”

and elsewhere. One of the authors is Robert Mertens who

did evidently have a close relationship with the zoo, since

he authored seven papers between 1921 and 1925 specif-

ically about the species and specimens kept at Frankfurt

Zoo, and more precisely on the freshwater turtles (1921),

giant snakes (1921, 1924 — the latter one not mentioned

by Schirner 1977), venomous snakes (1925), news from

the reptile house (1922), new animals (1922) and on Cer-

atophrys ornata (1922). An exhaustive paper on the whole

collection of reptiles by Richard Wieschke (1925) gives,

like the articles just mentioned, short notes and comments

on the different species shown and mentions, as a special

attraction, a giant salamander from Japan which was ex-

hibited in an aquarium in the lower basement. From that

description of the collection one can deduce that, in 1925,

there were more than 40 snake species, 28 lizard species,

more than 20 turtles and tortoises (including a loggerhead

sea turtle), and seven crocodile species on exhibit. An in-

teresting detail is the mentioning of a female reticulated

python 8 m in length which, after having undergone “dif-

ficult surgery”, had not taken any food for 16 months be-

fore she finally accepted a piglet. Six anuran and 2 urode-

lan species are specifically mentioned as part of the col-

lection “plus the numerous European frogs, toads, sala-

manders and newts”. Among the amphibians mentioned

are “two giant bull frogs..., and, even more impressive,

two South American horned frogs”, as well as African

clawed frogs “which because of their hopping movements

under water soon got the name ‘water monkeys’”, besides

Pipas, a Japanese giant salamander and a Proteus.

Whereas Robert Mertens 1s well known among herpetol-

ogists even today and does not need to be introduced to

the reader, a few words have to be said about Wieschke.

In one of the articles, his name is given as “Fritz”, in the

other article as “Rich[ard]’”. It was not possible to find out

if Fritz and Rich[ard] Wieschke were the same person —

and “Fritz” a printing error? — or whether and how they

©ZFMK

352 Manfred Niekisch

were related. “Fritz” could not be identified at all, where-

as it is known that Richard was a volunteer assistant, help-

ing out quite actively with many activities in the zoo such

as the administration of the library, keeping the register

of animals and observing them. He published several small

papers in the Mitteilungen, the last one appearing in No-

vember 1928, and, as far as is known, died at the age of

23 ani l929:

A remark in a review authored by zoo director Priemel on

issues | and 2 of Wilhelm Klingelhoffer’s Terrarienkunde

in the Mitteilungen from May 1925 gives an interesting

insight into the concept of reptile keeping. Priemel wel-

comes Klingelhoffer’s approach to arranging the contents

of the terraria in such a way that they resemble the habi-

tat of the species in the wild. Furthermore, he writes that

terraria for schools should always be arranged so that they

imitate nature, but then he goes on to write: “Unfortunate-

ly, the containers in public exhibitions cannot follow this

principle, as so many inhabitants must be kept in them in

order that visitors can observe the major part of them at

any time of the day”.

“ea

Fig. 6.

the nght foreground.

Bonn zoological Bulletin 57 (2): 347-357

In the following years, the collection continued to grow

and attracted more and more visitors. Various publications

talk about anacondas, chameleons, Gila monsters and sea

turtles all becoming part of the collection and, of course,

about “Komo”, the tame Komodo monitor lizard which

came to Frankfurt in 1927, only 15 years after this species

had been discovered. It was brought from Komodo to

Frankfurt by Robert Mertens. Frankfurt already had some

experience in taming monitor lizards. Two Varanus sal-

vator had come to Frankfurt Zoo in 1922—23, when they

were just 25 cm long. They were quite aggressive and,

while one died, the other one had grown to a length of

1.35 m by 1926 and thanks to “persistent, gentle, careful

treatment and care” had become tame. Whenever the door

to his enclosure was opened or his name (“Bubchen’”’, lit-

tle boy) was called, he climbed onto the keeper’s shoul-

der and allowed himself to be carried around (Fig. 7).

In that time before World War II, discussions arose about

the rights and wrongs and justifications of keeping ani-

mals “in captivity”, and, as one of the arguments in favour

of zoos, curator Gustav Lederer (1937) published infor-

mation about the longevity of reptiles at Frankfurt Zoo.

Different species, different sizes: A look into the “world renown” crocodile collection in 1925. Note the Macroclemys in

©ZFMK

Herpetology at Frankfurt Zoo 353

——

Fig. 7. Varauns salvator “Bubchen” and his keeper — in the

truest sense of the word! — in 1929.

In that year, the zoo was home to an Alligator mississip-

piensis, a Trionyx triunguis and two Heloderma suspec-

tum that had been living at the zoo since 1905, 1912 and

1927 respectively, as well as a Chinese alligator. The lat-

ter had moved to Frankfurt in 1910 when the Berlin Aquar-

tum had to be closed because of financial problems and

Frankfurt took over its entire reptile collection. This alli-

gator had come to the Berlin Aquarium in 1886 and so had

lived for 30 years in Frankfurt when he died in 1940.

The already highly diverse collection of crocodiles was

enriched by a Jomistoma schlegeli in 1937, raising the

number of species kept to eight. In addition, young and

old, small and large individuals were all kept together (Fig.

6). This crocodile collection is repeatedly referred to as a

major attraction and as “world renowned” (Lederer 1937),

but, looking at it today, it certainly must be regarded as

highly problematic from a zoological point of view as well

as from the aspects of animal welfare. Wieschke (1927)

mentions, for example, that the “newly created tropical

swamp area for crocodiles” is host to “numerous species,

among others a large number of American alligators (A/-

ligator mississippiensis), one of the few surviving speci-

mens of the Chinese alligator, Nile crocodiles, saltwater

crocodiles and African dwarf crocodiles” — each in the plu-

Bonn zoological Bulletin 57 (2): 347-357

ral! A completely new approach to keeping crocodiles was

only introduced around 1975, when this collection was fi-

nally dissolved to create a larger crocodile enclosure.

With the retirement of Kurt Priemel in March 1938, the

dynamic development of the herp collection came to an

end, as his successor, Georg Steinbacher, was more of a

“bird man” and evidently not much interested in reptiles.

The first bombs hit Frankfurt Zoo in October 1943, caus-

ing some limited damage including to the aquarium build-

ing, but most, if not all, of the reptiles survived. The ven-

omous snakes, however, now had to be put down for se-

curity reasons. A few months later, the disastrous bomb-

ing of Frankfurt on 18 March 1944 completely destroyed

the zoo and the aquarium with all its animals (Fig. 9).

ON THE WAY TO A MODERN ZOO: THE PERIOD

AFTER WORLD WAR II

The reconstruction of the zoo, under its new director Bern-

hard Grzimek, started immediately after the end of the war.

The zoo re-opened on | July 1945, offering its visitors a

few animals and a lot of entertainment in the form of all

kinds of cultural events, circus shows, carousels and so

on. The re-building of the aquarium started in 1951 and

the shell of a “24 m long tropical swamp area destined for

the keeping of crocodiles, turtles and so on” had been com-

pleted in 1952. Precisely | chameleon, four snakes, 26 tur-

tles and seven crocodiles were housed in the preliminary

terraria in 1953. From then on, more and more reptiles and

amphibians were acquired by or donated to the zoo. The

building with the new big reptile hall was opened official-

ly on 27 August 1957 and by the end of that year, it had

had 282,084 visitors. There were “giant crocodiles able

to kill a human being” and “gigantic land tortoises 200

years of age” living in the (altogether eleven) “climatic

landscapes”, with plant arrangements giving the visitor the

illusion of being in a tropical jungle.

As the “aquarium” was now housing fish and other aquat-

ic animals, as well as penguins in an Antarctic environ-

ment and a few other birds in the tropical section, along

with many reptile and amphibian species, it was decided

to give it a new name to better reflect the situation and

intention of the building. Since 1954, this building has

therefore been known as the “Exotarium’”’. The innovative

ideas and plans for the Exotarium were basically devel-

oped by Gustav Lederer, who had already been the key

person for the “pre-war” aquarium under director Priemel.

After the war, he became the zoo’s chief curator. How far-

sighted and innovative his thinking was and how careful-

ly he observed his animals is reflected, for example, in his

paper on the “importance of light in animal keeping” (Le-

derer 1927).

©ZFMK

354 Manfred Niekisch

soe et wh wt Whee PU}

Fig. 8. An unidentified keeper working in the terrarium section (1936).

At the suggestion of Bernhard Grzimek and in recogni-

tion of his merits and the quality of his scientific publi-

cations, he received an honorary doctorate from Frankfurt

University in 1953. He retired on 30 September 1958, af-

ter having served Frankfurt Zoo for 45 years, accompa-

nying it through two world wars and all its ups and downs.

Gustav Lederer died at the age of 69 on 13 February 1962.

THE EXOTARIUM TODAY

Despite all changes, improvements and renovation activ-

ities in the 1980s and 1990s, the concept of the herpeto-

logical section of the Frankfurt Exotarium until today es-

sentially goes back to Gustav Lederer. He was followed

by curator Dieter Backhaus who, in 1973, handed over to

Hartmut Wilke. It was still a time of much “trial and er-

ror’, since knowledge regarding the keeping of reptiles

was still limited. In 1960, a few adult and juvenile spec-

imens of Amblyrhynchus cristatus were even exhibited,

but did not survive the first two years.

Reptiles and amphibians were selected for their “didac-

tic, zoogeographical and ecological aspects” and the zoo

“dispensed with animals which were always hiding away

during opening hours”. Backhaus, as well as his succes-

Fig. 9. | View of the reptile hall after the bombing in 1944.

Herpetology at Frankfurt Zoo 355

Fig. 10. The Exotarium Tower overlooking the “seal cliffs” (2008). Photograph: Sabine Binger.

sor, constantly tried to improve the living conditions of

the animals, trying out all sorts of lamps, heating equip-

ment and other means to improve the climate control of

the terraria. They also did lots of work on nutrition and

disease prevention and carried out the associated physi-

cal changes and improvements to the building, such as spe-

cial rooms to prepare food, raise foraging animals and

raise newly born reptiles and amphibians. Terraria were

equipped with appropriate soil substrate for digging

species as well as stones and trees for climbing species,

in addition to hiding places and other structures, paving

the way to modern reptile keeping. Another remarkable

change was the renovation of the crocodile enclosure

which had made it necessary to give up the crocodile col-

lection in around 1975 and to send the gharial (which had

been living at Frankfurt Zoo since 1958) to the Gharial

Breeding Centre in Orissa, India in 1979. After the reno-

vation of the building had been completed, Nile crocodiles

returned to the zoo in 1977, but the enclosure turned out

to be unsuitable for that aggressive species.

Finally, in 1990, Frankfurt Zoo started keeping Australian

freshwater crocodiles, which started breeding regularly in

1994 and still do so today. This is one of the many breed-

ing successes at the Frankfurt Exotarium since Rudolf

Wicker became its curator in 1984. He took over at a time

when again some necessary renovation work had started,

and so the opportunity to build a big landscape terrartum

Bonn zoological Bulletin 57 (2): 347-357

for freshwater tortoises (1987) was seized. The group of

Cyclura cornuta then consisted of shy and aggressive an-

imals. They had come to the zoo in 1974, but Wicker re-

placed them by ten new animals imported from the zoo

in Santo Domingo. These animals laid eggs for the first

time in 1987, but the keeping facility was not the most

favourable in many aspects, and there was little breeding

success. Just a few weeks after they had been moved to

anewly built enclosure in 1991, they started breeding suc-

cessfully and have done so ever since.

Other remarkable breeding successes of the last two

decades have been the Phelsuma klemmeri from Mada-

gascar, Varanus salvator cumingi and Erymnochelys

madagascariensis, as well as the Laemanctus serratus and

Petrosaurus thalassianus that were all bred in Frankfurt

for the first time ever under human care. Our specimens

of Crocodylus johnsoni form the only breeding group out-

side Australia, and Frankfurt Zoo keeps and breeds

Ctenosaura bakeri, the highly endangered iguana from

Utila island.

Especially as Frankfurt Zoo has made nature conservation

in situ and ex situ one of its top priorities, its close coop-

eration with the Customs Service at Frankfurt Airport must

also be noted. Every year, this results in hundreds of rep-

tiles being seized from travellers or commercial shipments

at Frankfurt Airport and being brought to the Exotarium

OZFMK

oS)

Fig. 11.

(2008). Photograph: Sabine Binger.

— even rare animals such as a few Psammobates from two

different species. Some of the shipments seized contain

quite a number of specimens, for example 300 Geoche-

lone elegans or more than 70 Cordylus mossambicus and

C. rhodesianus and, repeatedly, also large numbers of poi-

son arrow frogs. Particularly with regard to the more com-

mon species and relatively high numbers of specimens, it

is extremely difficult to find appropriate people and in-

stitutions willing and able to take them on. All these an-

imals are lost to the natural world as they cannot usually

be taken back and released into the wild.

One exception was the case of five hawksbill turtles

(Eretmochelys imbricata) in 2009. Dogs trained to detect

CITES species at Frankfurt Airport discovered the eggs

in the luggage of a tourist. The eggs were brought to the

Exotarium, and, as they looked good, were put into an in-

cubator. During the following days, the turtles hatched and

were kept in an aquarium until they had reached a length

of around 20 cm. As it was known from which beach in

the Seychelles they had been collected, they could be sent

Bonn zoological Bulletin 57 (2): 347-357

Manfred Niekisch

sda aoe. “ : ~

The entrance to the Frankfurt Exotarium still preserves the charm and character of the 1950s when it was rebuilt

back and were released into the sea by the local authori-

ties. The media attention was huge, and so this success-

ful, but quite untypical, story could be accompanied by

the message that one should not take home souvenirs of

endangered and protected species.

Generally, species conservation aspects today play an im-

portant role in Frankfurt Zoo, and this, of course, also ap-

plies to the Exotarium. This building, with its long and

interesting history and its rich collection of reptiles and

amphibians, is certainly one of the best places in Frank-

furt Zoo to demonstrate to the visitors the multitude of

forms, colours, adaptations and other expressions of the

diversity of life. Today, there is neither a separate entrance

fee nor any counting of the number of visitors to the Ex-

otarium, but, in all probability, it may be assumed that al-

most all the visitors to Frankfurt Zoo (more than 900,000

per year!) also visit the Exotarium. Showing around 170

adult specimens of 29 amphibian species and more than

400 reptiles from 68 species, it is and remains one of the

main attractions of Frankfurt Zoo.

©ZFMK

Herpetology at Frankfurt Zoo 357

Sabine Binger.

REFERENCES

Anonymous (1895) Fiihrer durch den Zoologischen Garten zu

Frankfurt am Main.

Lederer G (1927) Die Bedeutung des Lichtes in der Tierpflege.

Blatter ftir Aquarien- und Terrarienkunde 37: 36-42, 63-64

Lederer G (1937) Merkwiirdigkeiten und Seltenheiten im

Frankfurter Tiergarten-Aquarium. Frankfurter Zoo-Zeitung 13:

37-38

Mertens R (1921) Die StiRwasserschildkréten des Frankfurter

Zoologischen Gartens. Lacerta 1: 55—56

Mertens R (1921) Die Riesenschlangen des Frankfurter Zoolo-

gischen Gartens. Blatter ftir Aquarien- und Terrarienkunde 32:

277-278

Mertens R (1922) Neues aus dem Reptilienhause des Zoologi-

schen Gartens in Frankfurt am Main. Naturwissenschaftlicher

Beobachter 63: 43-44

Mertens R (1922) Neue Tiere. Naturwissenschaftlicher Beobach-

ter 63: 173

Mertens R (1922) Schmuckhornfrésche (Ceratophrys ornata

Bell) im Frankfurter Zoologischen Garten. Naturwissenschaft-

licher Beobachter 63: 208

Mertens R (1924) Riesenschlangen. Mitteilungen aus dem Frank-

furter Zoo 2: 6—7, 10-11

Mertens R (1925) Giftschlangen. Mitteilungen aus dem Frank-

furter Zoo 4: 6-11

Bonn zoological Bulletin 57 (2): 347-357

Priemel K (1925) Buchbesprechung “Terrarienkunde”. Mittei-

lungen aus dem Frankfurter Zoo 5: 20-21

Scherpner C (1983) Von Burgern ftir Biirger — 125 Jahre Zoo-

logischer Garten Frankfurt am Main

Schirner E. (1977) Die Veroffentlichungen von Robert Mertens.

Courier Forschungsinstitut Senckenberg 20: 12-104. Frank-

furt am Main

Weinland D F (1860) Fiihrer durch den Zoologischen Garten in

Frankfurt am Main. Verlag der Zoologischen Gesellschaft,

Frankfurt

Wieschke F (1924) Echsen des Frankfurter Aquariums — Mit-

teilungen aus dem Frankfurter Zoo 5: 14-16

Wieschke R (1925) Die Reptilienabteilung unseres Zoo. Mittei-

lungen aus dem Frankfurter Zoo 2: 12-13, 20-28

Wieschke R (1927) Die Tropische Sumpfanlage ftir Krokodile.

Mitteilungen aus dem Frankfurter Zoo 4: 2

Zoologischer Garten der Stadt Frankfurt am Main (Ed.) (1958)

Hundertjahriger Zoo in Frankfurt am Main

Zoologischer Garten der Stadt Frankfurt am Main (Ed.) (no year)

Jahresbericht des Zoologischen Gartens der Stadt Frankfurt

a. M. 116-130 fiir 1974-1991. Report of the Zoological Gar-

dens [sic!] of Frankfurt 116-130 for 1974-1991

Received: 25.VIII.2010

Accepted: 25.1X.2010

OZFMK

Bonn zoological Bulletin Volume 57 Issue 2 pp. 359-366 Bonn, November 2010

Tetramorium boehmei sp. n. —

a new ant (Hymenoptera: Formicidae) species

from the Kakamega Forest, Western Kenya

Francisco Hita Garcia, Georg Fischer, Patrick Kick, Birthe Thormann & Marcell K. Peters

Zoological Research Museum Koenig, Adenaueralle 160, D-53113 Bonn, Germany.

E-mails: f.hita.zfmk@uni-bonn.de; Georg.Fischer@gmx.de; patrick_kueck@web.de;

birthe.thormann.zfmk@uni-bonn.de; m.peters.zfmk@uni-bonn.de

Abstract. Tetramorium boehmei Hita Garcia & Fischer sp. n. — a new ant species from the Kakamega Forest in Western

Kenya is described. The new species can be placed in the 7etramorium camerunense species group and differs signifi-

cantly from the other members of the group by its highly reduced sculpturation on head and mesosoma. With only two

available specimens sampled in undisturbed primary forest, Zetramorium boehmei sp. n. seems to be a relatively rare en-

demic species. Additionally, a first key to the Tetramorium species groups found in the Kakamega Forest is provided.

Keywords. Ants, Kakamega Forest, species group key, taxonomy, 7etramorium, Tetramorium camerunense species group.

INTRODUCTION

The ant genus 7etramorium Mayr, 1855 is almost global-

ly distributed, and with over 430 described species one of

the most species-rich genera worldwide (Bolton 1995; B

Bolton, Isle of Wight, pers. comm. 2010). The Afrotrop-

ical zoogeographic region holds the largest diversity with

over 210 listed Tetramorium species (Bolton 1976, 1980,

1985, 1995; Hita Garcia et al. 2010).

The Kakamega Forest, one of the last indigenous forests

in Kenya, and its animal diversity have received consid-

erable scientific attention in the last decades (e.g. Claus-

nitzer 1999, 2005; Copeland et al. 2005; Hita Garcia et

al. 2009; Kitihne 2008; Schick et al. 2005; Tattersfield et

al. 2001; Wagner & Bohme 2007; Zimmermann 1972).

Generally, the forest is considered to be the eastern-most

relict of the equatorial Guineo-Congolian lowland rain for-

est belt (Kokwaro 1988; Wagner et al. 2008; Zimmermann

1972). The strong biogeographic affinities to West and

Central African forests can be clearly seen in some fau-

nal elements like reptiles, dragonflies, and ants (Claus-

nitzer 2005; Hita Garcia et al. 2009; Wagner et al. 2008).

The ant fauna proved to be remarkably diverse with 288

species from 52 genera and 11 subfamilies constituting the

second highest species richness reported for the Afrotrop-

ical zoogeographic region (Hita Garcia et al. 2009). By

far the most species-rich genus in Kakamega Forest was

Tetramorium with more than 40 species belonging to 14

Bonn zoological Bulletin 57 (2): 359-366

species groups (Hita Garcia et al. 2009; FHG, unpub-

lished). The Zetramorium camerunense species group was

well represented with four species: Tetramorium lu-

cayanum Wheeler, W.M., 1905, Tetramorium cf. gegaimi

Forel, 1916, and two undescribed species.

Recent taxonomic work was primarily focused on the

Tetramorium weitzeckeri species group with the descrip-

tion of Tetramorium snellingi Hita Garcia, Fischer & Pe-

ters, 2010 and a species group revision for the whole

Afrotropical region (FHG, unpublished). However, around

10 species or 25% of the Tetramorium fauna of the

Kakamega Forest still remain undescribed. With this work

we present a first preliminary key to the 7etramorium

species groups present in the Kakamega Forest and de-

scribe a new species belonging to the 7’ camerunense

species group.

MATERIAL AND METHODS

The type material has been deposited in the following in-

stitutions:

NMK: National Museums of Kenya, Nairobi, Kenya

ZFMK: Zoological Research Museum Koenig, Bonn, Ger-

many

©ZFMK

360 Fancisco Hita Garcia et al.

Both, holotype and paratype, were measured with an

Olympus SZX 12 stereomicroscope equipped with a dual-

axis optical micrometer at a magnification of 90x. The fol-

lowing measurements and indices, in parts adapted from

Bolton (1980) and Gusten et al. (2006), were used:

Head length (HL): maximum distance from the mid-point

of the anterior clypeal margin to the mid-point of the oc-

cipital margin, measured in full-face view.

Head width (HW): width of head directly behind the eyes

measured in full-face view.

Scape length (SL): maximum scape length excluding basal

condyle and neck.

Eye length (EL): maximum diameter of compound eye

measured in oblique lateral view.

Pronotal width (PW): maximum width of pronotum meas-

ured in dorsal view.

Weber’s length (WL): diagonal length of mesosoma in lat-

eral view from the postero-ventral margin of propodeal

lobe to the anterior-most point of pronotal slope, exclud-

ing the neck.

Propodeal spine length (PSL): in dorsocaudad view, the

tip of the measured spine, its base, and the centre of the

propodeal concavity between the spines must all be in fo-

cus. Using a dual-axis micrometer the spine length is

measured from the tip of the spine to a virtual point at its

base where the spine axis meets orthogonally with a line

leading to the median point of the concavity.

Petiole length (PTL): maximum length of petiolar node

measured in dorsal view.

Petiole height (PTH): maximum height of petiolar node

measured in lateral view from the highest (median) point

of the node to the ventral outline. The measuring line is

placed in an orthogonal angle to the ventral outline of the

node.

Petiole width (PTW): maximum width of petiolar node

measured in dorsal view.

Postpetiole length (PPL): maximum length of postpetiole

measured in dorsal view.

Postpetiole height (PPH): maximum height of the post-

petiole measured in lateral view from the highest (medi-

an) point of the node to the ventral outline. The measur-

ing line is placed in an orthogonal angle to the ventral out-

line of the node.

Bonn zoological Bulletin 57 (2): 359-366

Postpetiole width (PPW): maximum width of postpetiole

measured in dorsal view.

Ocular index (OI): EL / HW * 100

Cephalic index (CI): HW / HL * 100

Scape index (SI): SL/ HW * 100

Propodeal spine index (PSLI): PSL / HL * 100

Petiolar node index (PeNI): PTW / PW * 100

Lateral petiole index (LPel): PTL / PTH * 100

Dorsal petiole index (DPel): PTW / PTL * 100

Postpetiolar node index (PpNI): PTW / PW * 100

Lateral postpetiole index (LPpI): PPL / PPH * 100

Dorsal postpetiole index (DPpI): PPW / PPL * 100

Postpetiole index (PPI): PPW / PTW * 100

Measurements and indices are presented as minimum and

maximum values. Additionally, all measurements are ex-

pressed in mm and presented with three decimal places.

The digital colour images were produced with a QImag-

ing Micropublisher 5.0 RTV camera attached on a LEICA

Z6 APO stereo-microscope and mounted with Syn-

croscopy Auto-Montage software (version 5.03). The

mounted images were processed for publication with

Adobe Photoshop CS2 and ImageJ. All images present-

ed in this work are also online available at Antweb (Fish-

er, 2002). Furthermore, holotype and paratype are unique-

ly identified with specimen-level codes (e.g.

CASENT0217239) affixed to each pin.

Total genomic DNA was extracted from two dissected sin-

gle legs of the holotype, using the Qiagen

DNeasy®Blood&Tissue Kit, following the manufacturers’

protocol. DNA was eluted with 50 ul buffer AE; this step

was repeated once to maximize yield.

A ca. 650 bp long fragment of the 5’-region of the cy-

tochrome c oxidase subunit I (COI), the standard DNA

barcode-marker for animals, was amplified using the

primers LCO 1490 and Nancy (5’-GGT CAA CAA ATC

ATA AAG ATA TTG G-3’ and 5’-CCC GGT AAA ATT

AAA ATA TAA ACT TC -3’; Folmer et al. 1994) and the

Qiagen® Multiplex PCR Kit. Amplification reactions were

carried out in a 20 pl volume containing 10 ul QIAGEN

Multiplex PCR Mastermix, 2 111 Q-Solution, 1.6 pl of each

primer (both 10 pmol/ul), and 2.5 tp] DNA template, and

filled up to 20 ul with sterile HO. The PCR temperature

profile consisted of an initial denaturation at 95° (15 min),

followed by 40 cycles at 94° (35 s, denaturation), 48.5°

(90 s, annealing), 72° (90 s, extension), and a final exten-

sion at 72° (10 min). PCR success was checked by elec-

trophoresis on an 1.5% agarose gel containing ethidium

bromide. The PCR product was purified using 3 pl of the

ExoSAP-IT® PCR purification reagent following the man-

ufacturers’ protocol.

©ZFMK

A new species of Zetramorium from the Kakamega Forest 36]

The sample was bidirectionally sequenced by a commer-

cial company (Macrogen Inc., Seoul, Republic of Korea;

http://www.macrogen.com) using PCR primers. BLAST

search confirmed belonging of the sequence to the genus

Tetramorium. The sequence is deposited in GenBank (ac-

cession number HM753586).

KEY TO THE TETRAMORIUM SPECIES GROUPS

FOUND IN KAKAMEGA

The following key to species groups is adapted from

Bolton (1976, 1980) and specific for the Kakamega For-

est, though it also works for Western Kenya in general:

1. Whole body covered with regularly branched hairs,

either bifid or trifid, giving the ant a woolly or furry

APPS ALAN CE teeter ene aesere oe elaeines. iene Seen ctes 2

— Hairs generally simple, rarely bizarrely modified, but

never regularly branched bifid nor trifid as above . 3

2 Antennae 11-segmented; elongate simple hairs pres-

ent along the antennal scapes and upper borders of the

DROWN CTGTIVEYS, ccsnooseccosasdascocospsecedz0so000 T. ericae group

— Antennae 12-segmented; elongate simple hairs absent

along the antennal scapes and upper borders of the

PO MCaleCARMNAC Heese ceseseee cee eee T. gabonense group

Smeemtcmmac lil =seommemte dees esac eccesecesstesccascrsenessstses 4

SP AMLemmMac I 2-SeCmeMte ds a-..-cresccersceecessce-eeeeeseeeeeree 5

4 Petiolar node squamiform to high nodiform, never

blocky nodiform with sharply defined angles.

paqgacadoodadoOdaed Here reRe nee eee eRe OE Se T. weitzeckeri group

— Petiolar node strongly blocky nodiform, generally

with sharply defined angles. ... 77 angulinode group

5 Lateral portion of clypeus prominent, raised to a tooth

or crest in full-face view; in dorsal view the lateral

clypeal portions rise to a high peak in front of the an-

tennal insertions and then slope down towards the me-

dian part of the clypeus. ............ T. sericeiventre group

— Lateral portion of clypeus not modified as above. . 6

6 Antennal scapes very long (always SI > 120); frontal

carinae weakly developed and short, at most reach-

ing the posterior eye margins. ....... T: aculeatum group

— Antennal scapes distinctly shorter than above (always

SIO) strontalicarinae wantablet eee ssere-eeeeeeee-c- a

7 Propodeum armed with a pair of small triangular teeth

or denticles which at most are as large as the

pro podeallObesh eres c eee eee seer eee senses 8

— Propodeum armed with a pair of medium-sized to

long spines which are noticeably larger than the

propodeallObes: 2s es. vicssscecascn a5. sscasscanckseecess eae hones cose 12

Bonn zoological Bulletin 57 (2): 359-366

8 Anterior clypeal margin with median impression.

Bear cence: Metre ssute ae eniny tnaieess T. dumezi group (in parts)

= AntentorclypealitmareimCmtines <c-.-<.cccc-cecesoeeeeve-ee--s- 9

9 Tibiae with short appressed pubescence. ................ 10

— Tibiae with subdecumbent to erect pilosity or pubes-

(AEINC SS sanacacenrbotenceoshcooneGee neste ecto eae te Dacca ere Tra 11

10 Hairs on dorsal mesosoma and gaster usually sparse,

short, stout, and blunted ............... T. simillimum group

— Hairs on dorsal mesosoma and gaster usually numer-

ous, elongate and fine ........... T. quadridentatum group

11 Frontal carinae long, usually reaching occiput.

BAe Cone TR ene ERT ERT T: dumezi group (in parts)

— Frontal carinae short and weakly developed, ending

BUCVC CVC leet et teres nc tae cies T. convexum group

12 Anterior clypeal margin with median impression. .. 13

— Anterior clypeal margin entire, without a median im-

ORCS SIO Meese eee ene ta ae cea tee Rees ae Sieh shade eaeeaten cs 14

13 Occipital region of head variably rugose, rugulose or

unsculptured, rarely with few anastomoses, without

MU SO=Ne CCUM ees eeseeeeesee ene T. camerunense group

— Occipital region of head distinctly rugo-reticulate.

PS i es cne T. bicarinatum group

14 Eyes larger, at least 9 ommatidia in the longest row.

ee eter cece cucne tere teneeav one ohne eats T. setigerum group

— Eyes smaller, at most 7 to 8 ommatidia in the longest

TON Nio- egeoneacc soncmagnaen tactcceeete ua ace nese T. flabellum group

Tetramorium camerunense species group

Examination of the new species led to the conclusion that

it can be easily placed in the 7 camerunense species

group. Though the species group was well defined in

Bolton (1980) it seems useful to reproduce it here:

1. antennae 12-segmented

antennal scape relatively small to moderate (SI < 90)

3. anterior clypeal margin generally with small median

impression (absent in one species)

4. frontal carinae long and fine, generally reaching pos-

terior eye margin, sometimes running to occipital mar-

gin

5. antennal scrobe weakly developed

6. propodeal spines of varying length, but always

longer than propodeal lobes

7. mandibles generally smooth and shining, rarely fine-

ly striate

clypeus with three longitudinal rugae

9. cephalic dorsum usually finely longitudinally rugu-

OZFMK

362 Fancisco Hita Garcia et al.

Figs 1-2. Tetramorium boehmei sp. n., holotype worker, CASENT0217238. 1 dorsum of body; 2 body in profile.

A new species of Zetramorium from the Kakamega Forest 363

Figs 3-4.

lose, without cross-meshes; occipital rugoreticulum

never developed

10. all dorsal body surfaces with numerous standing hairs

11. dorsal surfaces of hind tibiae generally with decum-

bent to appressed pubescence only, in two species

suberect

12. sting appendage triangular, dentiform or pennant-

shaped

Prior to this study, the 7’ camerunense species group con-

tained 12 species that were subdivided into two species

complexes based on differences in sculpturation (Bolton

1980). The 7 lucayanum complex, containing four

species, can be characterized by the presence of sculptured

mandibles, petiole and postpetiole. One or both of the

waist segments are generally strongly sculptured. The oth-

er and larger complex, the 77 camerunense complex with

eight species, possesses typically unsculptured waist seg-

ments and mandibles.

Tetramorium boehmei Hita Garcia & Fischer sp. n.

(Figs 1—6)

Holotype worker, KENYA, Western Province, Kakamega

Forest, Colobus, 00° 21’ 16” N, 34° 51’ 36” E, 1650 m,

primary rain forest, hand collected, VII.2009, leg. G. Fis-

cher (NMK: CASENT0217238). Paratype worker,

KENYA, Western Province, Kakamega Forest, Salazar,

00° 19° 36” N, 34° 52’ 14.6” E, 1650 m, Kakamega For-

est survey 2007, Transect 6, primary forest, Winkler leaf

litter extraction, 21.V1I.2007, leg. M. Peters (ZFMK:

CASENT0217239).

Bonn zoological Bulletin 57 (2): 359-366

Tetramorium boehmei sp. n.. 3 holotype worker, CASENT0217238, full-face view of head; 4 paratype worker,

CASENT0217239, full-face view of head.

Diagnosis. The highly reduced cephalic and mesosomal

sculpturation renders Tetramorium boehmei straightfor-

wardly recognizable within the 7? camerunense species

group.

DESCRIPTION

HL 0.700-0.772; HW 0.633-0.711; SL 0.533—0.578; EL

0.122-0.139; PW 0.450-0.489; WL 0.822—0.900; PSL

0.150—0.189; PTL 0.194—0.200; PTH 0.211—0.239; PTW

0.178-0.189; PPL 0.189—0.200; PPH 0.194—0.222; PPW

0.250—0.267; CI 90-92; SI 82-84; OI 19-20; PSLI 21-24;

PeNI 39-40; LPel 84-92; DPel 91—94; PpNI 55-56; LP-

pI 90-97; DPpI 132-133; PPI 141 (2 measured).

Head longer than wide (CI 90-92). Anterior clypeal mar-

gin with small but distinct median notch. Frontal carinae

fine and relatively weak, even weaker behind eye level and

significantly not reaching occipital margin. Antennal

scrobe very weakly developed, nearly vestigial. Antennal

scape of moderate length, not reaching posterior margin

of head (SI 82-84). Eyes small to moderate (OI 19-20),

with 8 to 9 ommatidia in longest row. Metanotal groove

not impressed. Propodeal spines moderately sized (PSLI

21-24), relatively thin, spinose and straight. Propodeal

lobes small, elongate-triangular and acute, always short-

er than propodeal spines. Petiolar node nodiform, in pro-

file weakly higher than long (LPel 84—92), in dorsal view

slightly longer than wide (DPel 91—94) and posteriorly

wider than anteriorly. Postpetiole rounded, in dorsal view

around 1.3 times wider than long (DPpI 132-133), and

around 1.4 times wider than petiole (PPI 141); in lateral

view weakly higher than long (LPpI 90-97). Sting ap-

pendage triangular.

OZFMK

364 Fancisco Hita Garcia et al.

Figs 5-6. Tetramorium boehmei sp. n., paratype worker, CASENT0217239. 5 dorsum of body; 6 body in profile.

Bonn zoological Bulletin 57 (2): 359-366

©ZFMK

A new species of Zetramorium from the Kakamega Forest 365

Mandibles either unsculptured, smooth and shining or

finely striate. Clypeus with three longitudinal rugae, me-

dian ruga stronger developed than lateral rugae. Cephal-

ic sculpturation greatly reduced, laterally with only weak

partial rugulation, mostly smooth and shining; cephalic

dorsum with 5—6 very weak and fine, widely spaced lon-

gitudinal rugulae between frontal carina, most of them bro-

ken along their length and never reaching occipital mar-

gin, occipital region unsculptured. Cephalic ground

sculpturation absent, generally smooth and shining. Lat-

eral mesosoma anteriorly mostly unsculptured, smooth and

shiny, posteriorly with weak irregular rugulation; dorsum

of mesosoma unsculptured or with few weak rugulae, or

traces of rugulae only, generally smooth and shining. Peti-

ole either completely unsculptured or with traces of sculp-

ture; postpetiole and gaster completely unsculptured,

smooth and shiny.

All dorsal surfaces of head, mesosoma, both waist seg-

ments and gaster with numerous long, simple, suberect to

erect hairs. Fine pubescence on antennal scapes and tib-

ia appressed to subdecumbent.

Head, mesosoma, waist segments, and gaster very dark

brown to black, antennae, mandibles, and legs of lighter

brownish colour.

Queen and male unknown.

Etymology. The new species is dedicated to Prof. Dr.

Wolfgang Bohme from Bonn, Germany, in honour of his

nearly four decades of passionate herpetological work at

the Zoological Research Museum Koenig in Bonn. Fur-

thermore, with his encouraging, and always interesting,

lectures, courses and excursions he had a significant pos-

itive influence on the authors leading to their scientific

dedication with zoological systematics and the Afrotrop-

ical zoogeographical region.

Notes. Generally, it is not recommendable for large and

diverse genera as 7etramorium to describe single species

based only on few specimens outside a comprehensive

generic revision. Nevertheless, in the case of 7’ boehmei

it seems justified for the following reasons. First, it does

fit all group characters and can therefore easily be iden-

tified as a T. camerunense species group member, either

by using the species group key presented above or the one

in Bolton (1980). Within the 7’ camerunense species group

it obviously belongs to the 7? camerunense species com-

plex because of the unsculptured petiole and postpetiole.

Second, and more importantly, 77 boehmei shows a re-

markable character combination that varies significantly

from the other members of the species group, and allows

an easy and clear identification. The single best diagnos-

tic character to separate T. boehmei from the rest of the

Bonn zoological Bulletin 57 (2): 359-366

group is the almost completely reduced sculpturation on

head and mesosoma. This reduction to a few weak rugu-

lae on the cephalic dorsum, and even less sculpturation

on the mesosomal dorsum, is unique in the species group.

All other species possess a distinctly longitudinally rugose

or rugulose head and mesosoma, though variable from

species to species, and sometimes irregularly shaped.

It has to be mentioned that the holotype and paratype dif-

fer in some aspects that could be considered as sufficient

enough to divide them into two different species. First, the

mandibular sculpturation is completely smooth and shiny

in the holotype while it is longitudinally striate in the

paratype. This character is usually species-specific and

could be considered as a good diagnostic tool to divide

them. Second, the paratype is larger and possesses more

sculpture on head and mesosoma than the holotype which

appears generally much more smooth and shining. Fur-

thermore, the clypeal notch is distinct in both species but

stronger developed in the paratype. However, at present,

the observed variation is considered as intraspecific vari-

ation until more material becomes available. Apart from

the noted differences there is a striking morphological sim-

ilarity between both specimens and also the morphomet-

ric measurements of both are very close. Concluding,

based on the analysis of two specimens, it would be pre-

mature to describe them as different species.

Currently, the new species seems to be endemic to the

Kakamega Forest in Western Kenya where it was sampled

in primary forest sites. Considering the high sampling ef-

fort to assess the ant fauna of the Kakamega Forest (Hi-

ta Garcia et al. 2009), and the only two available speci-

mens of 7. boehmei, it seems to be a rather rare species.

In addition, only little information is available on its bi-

ology. One specimen was found in a Winkler leaf litter ex-

traction sample and one was hand collected from the

ground. Considering this, the new species could be regard-

ed as a rare terrestrial species, living either in the ground

or the leaf litter. Though, it might also be possible that 7°

boehmei lives in the lower vegetation or the canopy, and

the two specimens were only accidentally collected by the

mentioned methods (the canopy ant fauna was consider-

ably less well sampled by the authors than the ground liv-

ing ant fauna). At present, taking into account our knowl-

edge of the leaf litter fauna of the Kakamega Forest, we

consider the leaf litter hypothesis as more likely. The over-

all morphological appearance with small to moderate eyes

and antennal scapes as well as the strongly reduced body

sculpturation are within the genus 7etramorium more of-

ten found in the leaf litter than in the canopy where species

tend to have larger eyes and scapes. However, more spec-

imens from more sampling events are necessary to reveal

the preferred stratum of 7: boehmei. Furthermore, it should

be noted that 7 boehmei was sampled in the two least dis-

©ZFMK

366 Fancisco Hita Garcia et al.

turbed primary forest sites examined in the Kakamega For-

est (FHG, unpublished data). This might indicate that the

new species prefers undisturbed primary forest and reacts

negatively to anthropogenic disturbance like selective log-

ging.

Acknowledgements. First, we want to thank Philipp Wagner,

ZFMK, for making this more entomological and less herpeto-

logical publication possible within the Festschrift. Then, we are

very grateful to Barry Bolton, Isle of Wight, U.K., who was so

kind to review an early draft of the manuscript, and provide help-

ful comments. In addition, we thank Brian Fisher, California

Academy of Sciences, San Francisco, U.S.A., for his coopera-

tion with the images, Antweb, and also for reviewing the man-

uscript and helping to improve it. Furthermore, we would like

to thank Prof. Dr. Johann Wolfgang Wagele, ZFMK, for his gen-

eral help. In addition, we are thankful for the assistance provid-

ed by the invertebrate lab of the National Museums of Kenya

in Nairobi and the Kenya Wildlife Service in Kakamega. This

work was funded by the German Ministry of Education and Re-

search (BMBF) within the BIOLOG programme (BIOTA East

Africa subproject E16 [01LC0625A2}).

REFERENCES

Bolton B (1976) The ant tribe Tetramoriini (Hymenoptera:

Formicidae). Constituent genera, review of smaller genera and

revision of Triglyphothrix Forel. Bulletin of the British Mu-

seum (Natural History) Entomology 34: 281-379

Bolton B (1980) The ant tribe Tetramoriini (Hymenoptera:

Formicidae). The genus Zetramorium Mayr in the Ethiopian

zoogeographical region. Bulletin of the British Museum (Nat-

ural History) Entomology 40: 193-384

Bolton B (1985) The ant genus Trig/yphotrix Forel a synonym

of Tetramorium Mayr (Hymenoptera: Formicidae). Journal of

Natural History 19: 243-248

Bolton B (1995) A new general catalogue of the ants of the world.

Harvard University Press, Cambridge

Clausnitzer V (1999) Dragonfly (Odonata) records of Kakamega

Forest, Western Kenya, with notes on the ecology of rain for-

est species. Journal of East African Natural History 88: 17—23

Clausnitzer V (2005) An updated checklist of the dragonflies

(Odonata) of the Kakamega Forest, Kenya. Journal of East

African Natural History 94: 239-246

Copeland RS, Okeka W, Freidberg A, Merz B, White IM, De

Meyer M, Luke Q (2005) Fruit flies (Diptera: Tephritidae) of

Kakamega Forest, Kenya. Journal of East African Natural His-

tory 94: 247-278

Bonn zoological Bulletin 57 (2): 359-366

Fisher BL (2002) Antweb (California Academy of Sciences, San

Francisco,U.S.A.). Online at http://www.antweb.org last ac-

cessed on July 20, 2010

Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA

primers for amplification of mitochondrial cytochrome c ox-

idase subunit I from diverse metazoan invertebrates. Molec-

ular Marine Biology and Biotechnology 3: 2942299

Hita Garcia F, Fischer G, Peters MK, Wagele JW (2009) A pre-

liminary checklist of the ants (Hymenoptera: Formicidae) of

Kakamega Forest (Kenya). Journal of East African Natural

History 98: 147-165

Hita Garcia F, Fischer G, Peters MK (2010) Zetramorium snellin-

gi sp. n. — a new leaf-litter ant species (Hymenoptera: Form1-

cidae) from a Western Kenyan rain forest. Myrmecological

News 13: 141-146

Giisten R, Schulz A, Sanetra M (2006) Redescription of Tetramo-

rium forte Forel, 1904 (Hymenoptera: Formicidae), a west-

ern Mediterranean ant species. Zootaxa 1310: 1-35

Kokwaro JO (1988) Conservation status of the Kakamega For-

est in Kenya — the easternmost relict of the equatorial rain

forests of Africa. Monographs in Systematic Botany of the

Missouri Botanical Garden 25: 471-489

Kihne L (2008) Butterflies and moth diversity of the Kakame-

ga Forest (Kenya). Brandenburgische Universitatsdruckerei,

Potsdam-Babelsberg

Mayr G (1855) Formicina austriaca. Beschreibung der bisher im

oesterreichischen Kaiserstaate aufgefundenen Ameisen nebst

Hinzufuegung jener in Deutschland, in der Schweiz und in Ita-

lien vorkommenden Ameisen. Verhandlungen des Zoologisch-

Botanischen Vereins in Wien 5: 273-478

Schick S, Veith M, Létters S (2005) Distribution patterns of am-

phibians from the Kakamega Forest, Kenya. African Journal

of Herpetology 54: 185-190

Tattersfield P, Seddon MB, Lange CN (2001) Land-snail faunas

in indigenous rainforest and commercial forestry plantations

in Kakamega Forest, Western Kenya. Biodiversity and Con-

servation 10: 1809-1829

Wagner P, Bohme W (2007) Herpetofauna Kakamegensis — the

amphibians and reptiles of Kakamega Forest, western Kenya.

Bonner zoologische Beitrage 55: 123—150

Wagner P, Kohler J, Schmitz A, Bohme W (2008) The biogeo-

graphical assignment of a west Kenyan rain forest remnant:

further evidence from analysis of its reptile fauna. Journal of

Biogeography 35: 1349-1361

Zimmerman DA (1972) The avifauna of Kakamega Forest, West-

ern Kenya, including a bird population study. Bulletin of the

American Museum of Natural History 149: 257-337

Received: 05.VII.2010

Accepted: 20.VII.2010

©OZFMK

Bonn zoological Bulletin Volume 57 | Issue 2 ‘) pp. 367-373

Bonn, November 2010

Homeless mammals from the Ionian and Aegean islands

Marco Masseti

Dipartimento di Biologia Evoluzionistica “Leo Pardi” dell’ Universita di Firenze,

Via del Proconsolo, 12, I-50122 Firenze, Italia; E-mail: marco.masseti@unifi.it.

Abstract. The paper present information about several mammalian species reported erroneously from the Ionian and Aegean

islands and the occurrence of stuffed specimens in museum collections which reveal intriguing stories about their ori-

gins, especially about the islands from which they were collected. According to scientific and popular literature, these

islands were often not numbered among the original homelands, nor even the territories of the artificial distribution of

the species. So it is almost impossible today to understand why and how certain specimens reached these islands, espe-

cially in the case of those which were dangerous predators for the livestock, and even humans. This is the case, for ex-

ample, of the Asia Minor Leopard, Panthera pardus tulliana Valenciennes, 1856, which today figures among the collec-

tions of the Natural History Museum of the Aegean, in the village of Mytelenii on the island of Samos.

Keywords. museum specimens, Ionian and Aegean islands, continental mammals, Asia Minor leopard.

INTRODUCTION

Scientific travellers and other authors of the past have oc-

casionally reported the diffusion on the Ionian and Aegean

islands of several mammalian species today completely

unknown among the relative faunal assemblages (Fig. 1).

Werner (1928) for example quoted the occurrence of a

kind of squirrel on the island of Skyros (Northern Spo-

rades), where he collected a specimen between the villages

of Skyros and Linaria which he recognized as Sciurus

lilaeus. According to Ellerman & Morrison-Scott (1951),

this taxon is used to define a Greek subspecies of the red

squirrel, Sciurus vulgaris lilaeus Miller, 1907, character-

istic of the region of Mount Parnassus in continental

Greece. Nevertheless, the occurrence of the same species

on Skyros was subsequently also recorded by other au-

thors such as Wettstein (1942) or Cheylan (1988) in re-

cent times. On the basis of the authority of Werner, and

to an even greater extent that of Wettstein, it is very dif-

ficult to refute the truth of these reports, even if red squir-

rels are today completely unknown on Skyros and the oth-

er islands of the Aegean and Ionian basin. Perhaps with

the exception of Euboea, the natural occurrence of these

rodents is, even on the rest of the Mediterranean insular

environments, practically unknown. Their presence on

some of these islands, such as Veli Briyuni (Croatia) (Scot-

ti 1980), is essentially regarded as a consequence of re-

cent human intervention (Masseti 2005). Representatives

of the genus Sciurus Linnaeus, 1758, occur also on Les-

bos (Ondrias 1966; Hecht-Markou 1994, 1999; Gavish &

Gurnell 1999; Thorington & Hoffman 2005) and the

Bonn zoological Bulletin 57 (2): 367-373

Turkish island of Gékceada (Imbros) (Ozkan 1995, 1999;

Gavish & Gurnell 1999). These islands are, however, in-

habited by another species of the genus, the Persian squir-

rel, Sciurus anomalus Gueldenstaedt, 1785, whose west-

ernmost continental distribution extends to far-eastern Eu-

rope and western Anatolia (Gavish & Gurnell 1999). At

the same time, however, there 1s no evidence to exclude

the former diffusion of red squirrels on Skyros, where a

population could have existed up to the first half of the

20th century, later becoming extinct. Red squirrels could

have been imported by man onto the island from the near-

by island of Euboea, where their presence was already re-

ported by Lindermayer (1835). In the light of modern eth-

nozoological enquiry, it would also appear that red squir-

rels figure among those mammal species which have been

the subject of particular human attention for a variety of

cultural purposes. In the Levant, for example, people still

eat Persian squirrels and live specimens are regularly sold

in the markets (Mendelssohn & Yom-Tov 1999).

SPECIES ERRONEOUSLY REPORTED FROM

THE IONIAN AND AEGEAN ARCHIPELAGOS

Travellers of the past have often erroneously reported

certain mammalian species from the Greek islands.

According to Lindermayer (1835), the blind mole Zalpa

caeca Savi, 1822, was dispersed on Euboea. However this

19th century report strikes a false note, since the species

©ZFMK

368 Marco Masseti

{ aad

2 _ iia f

| oF @tassos\__ y = t

Q o LX Se

¢ —) Ga SS

" Gokceada L

(nies) Yy

COR

~. \

SS ey S

Euboea

\ Se Samos j

NB Tinos b

- WO) SUN Bena

Se PS GSP) ee Ikaria. . Ly

\ VSS ¥

D Se00

_ Naxos Q

Si mee OO -- =f a)

p cianass Sane A Cai

eas) aes -O q

OS > es 2 ;

> Santorini ~ x

(Thera) =

0 3 (

ioe Crete j whe

iS)

Fig. 1. | Map with the locations of the Ionian and Aegean is-

lands mentioned in the text.

is limited in its south-eastern European distributional range

to the continental Balkan peninsula. No moles have ever

been reported from the eastern Mediterranean islands, with

the only exception of the Balkan mole Talpa stankovici

V. Martino & E. Martino, 1931 on the islands of Corfu

(Niethammer 1962, 1990; KryStufek 1999a) and

Cephalonia (Catsadorakis 1985; Giagia-Athanassopoulou

1998; Stamatopoulos, in verbis). Wettstein (1942)

observed another species, the crested porcupine Hystrix

cristata Linnaeus, 1758, but mentioned that local people

referred to its presence on the Eastern Aegean islands of

Ikaria and Lesbos. He (Wettstein 1942) added that this

might have been the result of confusion with a hedgehog,

the today dispersed Northern white-breasted hedgehog

Erinaceus roumanicus Barrett-Hamilton, 1900 (Krystufek

et al. 2009). Effectively, the Greek term used to indicate

the hedgehog is skanzohiros, which means “spiny pig”,

which is probably the reason of a confusion with the

English “porcupine” (and/or the Italian “porcospino” and

the French “porc-épic’’). Moreover, the common porcupine

has never been reported from the Balkan peninsula

(Masseti et al. in press), while the Indian crested

porcupine, Hystrix indica Kerr, 1792 is known from

Anatolia with an occurrence further east to the Near East,

including Arabia, Kashmir, Nepal and through peninsular

India to Sri Lanka (Harrison & Bates 1991). These

publications are probably the baseline of several unproven

reports. Cheylan (1988) still quoted the occurrence of

“Hystrix cristata” (sic) on the Eastern Aegean islands of

Rhodes, Ikaria and Lesbos. The occurrence of Microtus

subterraneus (de Sélys-Longchamos, 1836) was reported

from Euboea by Cheylan (1988), while Niethammer

(1982) and Krystufek (1999b) mentioned it as absent from

Bonn zoological Bulletin 57 (2): 367-373

the entire Mediterranean coast and islands (see also

Masseti 2009). A label without specimen, written by

Ioannis C. Ondrias himself, in the mammal collection of

the University of Patras (coll. no. 3158) reports the

occurrence of the common vole Microtus arvalis (Pallas,

1779), from the area of Mytilene in south-eastern Lesbos.

But, according to Stella Fraguedakis Tsolis (in litteris 13th

July 2006), this species does not appear to exist or to have

ever existed on this island. Furthermore, the specimen to

which the label referred has unfortunately been lost.

Contrary, the presence of Gunther’s vole M. guentheri

(Danford & Alston, 1880) is known from Lesbos

(Stamatopoulos & Ondrias 1995), but according to

Krystufek & & Vohralik (2005) this is the only record

from all Mediterranean islands so far.

THE INSULAR EDIBLE DORMICE

Erroneous evaluations, or rather inattentive reading of pub-

lications of early authors have supported cultural models

which are still difficult to eradicate, e.g. the consideration

of the diffusion of several species of glirids in the Greek

islands. One example is the erroneously supposed occur-

rence of the forest dormouse Dryomys nitedula (Pallas,

1778). Erhard (1858) reported the occurrence of Myoxus

nitela Schreber, 1782, a species of glirid, similar in name

to the forest dormouse from Andros, Naxos and Siphnos,

where it occurred in orchards and orange groves. This re-

port supported the assumption that this rodent occurs on

these islands, but in reality the taxonomic classification

does not correspond to that of the forest dormouse. Ac-

cording to Ellerman & Morrison-Scott (1951) Myoxus

nitela is indicated as one of the synonyms of Eliomys

quercinus (Linnaeus, 1766; garden dormouse), a species

currently unknown in the Aegean area and being wide-

spread in the central-western Mediterranean basin. Here

it is not found further east than Dalmatia and the north-

western Balkan Peninsula. Although according to

Krystufek (1999b), this forest dormouse does not occur

on Mediterranean islands, Cheylan (1988) reported it from

Euboea. Recently, the presence of the forest dormouse was

reported on the island of Andros, which is still an uncon-

firmed record (Chondropoulos & Fraguedakis-Tsolis, in

verbis). We have, on the other hand, known for some time

of the presence of the edible dormouse on islands such as

Crete (Zimmermann 1953; Kahmann 1959; Niethammer

& Krapp 1978; Catsadorakis 1994), Euboea (Ondrias

1966), Corfu (Niethammer 1962; Niethammer & Krapp

1978) and Cephalonia (Niethammer & Krapp 1978; Cat-

sadorakis 1985; Giagia-Athanassopoulou 1998). On the

latter island, its occurrence has been recently confirmed

by H. Pieper (in litteris), whereas Dimaki (1999) provid-

ed arguments for the existence of the species on Andros.

According to H. Alivitzatos & A. Lane (in verbis), the ed-

©ZFMK

Homeless mammals from Ionian & Aegean islands

ible dormouse is also present on the island of Thassos

where they mentioned its occurrence in the surroundings

of the village of Panaghia, on 30 August 2000. Wettstein

(1942) reports the occurrence of a dormouse, possibly the

forest dormouse, from Rhodes, but according to other au-

thors the species is still unknown here (cf. Festa 1914; De

Beaux 1929; Zimmermann 1953). A remarkable human

impact on the geographical distribution of some dormouse

species in the Mediterranean region was observed by

Carpaneto & Cristaldi (1994), Colonnelli et al. (2000) and

Masseti (2005). The population density can be document-

ed since antiquity through historical and biogeographical

analyses, supported by paleontological and archaeozoo-

logical data. Furthermore, ethnozoological enquiries doc-

ument the utilisation of dormice for food or medicine,

through traditional captive-breeding techniques, up to very

recent historical times.

HOMELESS GREEK ISLAND CARNIVORES IN

THE EUROPEAN MUSEUMS

Several European natural history museums conserve ma-

terial collected on the Greek islands which create prob-

lems in the attempt to arrive at their origins. This is the

case, in the lynx, Lynx lynx (Linnaeus, 1758), collected

on the island of Corfu and part of the collection of the Mu-

seum Alexander Koenig in Bonn, registered under the col-

lection number ZFMK 93423. The specimen was pur-

chased by Jochen Niethammer during the mammalogical

exploration of the island. But the occurrence of the lynx

on Corfu was very questionable and immediately resolved

by the collector himself. Niethammer reported that he had

bought it at the market, where he had been told that it orig-

inated from northern Greece, more specifically from

Macedonia. In other cases specimens represent species

which are in fact completely unknown to the islands which

they are reported to originate from. In some cases, species

have recently become extinct, like jackals from Corfu rep-

resented in the collections of the Museum Koenig

(ZFMK 61193, 93420). Dispersed in the Balkan and Ana-

tolian peninsulas, the Golden or Asiatic jackal Canis au-

reus Linnaeus, 1758 has been reported from Corfu (Ni-

ethammer 1962; Douma-Petridou 1977; Adamakopoulos

et al. 1991; Demeter & Spassov 1993), Cephalonia (Deme-

ter & Spassov 1993), Lefkada (Douma-Petridou 1977;

Demeter & Spassov 1993) and Kythera (Jameson 1836,

1937), while other authors mentioned its occurrence on

Ikaria (Atanassov 1955) and Skyros (Werner 1928;

Wettstein 1942; Atanassov 1955). Ioannidis & Giannatos

(1991) surveyed with positive results the island of Samos

where jackals exist in the same habitats as in the rest of

the southern Balkan Peninsula. Following the account of

the expedition to the Greek archipelago published by the

botanist Joseph P. de Tournefort (1717), Clarke (1801) ob-

Bonn zoological Bulletin 57 (2): 367-373

369

Fig. 2.

Stuffed specimen of the badger Meles meles collec-

ted on the island of Santorini (Thera) in 1859, and part of the

collection of the Zoological Museum of the University of Athens

(ZMUA 128) (photo Anastasios Legakis; courtesy Zoological

Museum of the University of Athens).

served that “Samos is infested with wolves”. Anyway, this

record should refer to jackals rather than wolves. There

is in fact no evidence for the occurrence of the latter

canides on the Greek islands of the late Holocene. Accord-

ing to Ioannidis & Giannatos (1991), the jackal no longer

exists on Corfu, Kythera, Skyros and Ikaria, where it pos-

sibly became extinct in very recent historical times, but

jackals vanished from Corfu not before 1991-1992

(Grémuillet, in verbis). The only Aegean islands where the

species still survives are Euboea (Demeter & Spassov

1993) and Samos (Laar & Daan 1967; Douma-Petridou

1977; Adamakopoulos et al. 1991; Ioannidis & Giannatos

1991; Demeter & Spassov 1993; Ioannidis et al. 1996;

Dimitropoulos et al. 1998).

Among the collections of the Greek museums, there are

several specimens that provoke questions which are still

far from having been satisfactorily answered. For exam-

ple, there is a stuffed badger, Meles meles (Linnaeus,

1758) today on display at the Zoological Museum of the

University of Athens (ZMUA 128, Fig. 2) and collected

on the island of Santorini (Thera) by K. Bassiliou in 1859.

This specimen is intriguing because of the old age and it

is the only record of the badger from this island. Accord-

ing to Schmalfuss (1991) the species is today unknown

from Santorini. If the origin of the ZMUA specimen is cor-

rect, the species must have become extinct around the end

of the nineteenth century because Douglas (1892) did not

mention the badger in his list of the insular mammals. San-

torini should therefore be added to the distribution areas

of the badger within the Aegean islands. Known in Greek

as asvos, the badger was recorded from Cephalonia (Cat-

sadorakis 1985), Rhodes (Festa 1914; Tortonese 1973) and

Crete (Raulin 1859; Barrett-Hamilton 1899; Bate 1906,

©ZFMK

370 Marco Masseti

Fig. 3.

Detail of the early 16th century wall decoration sho-

wing the “Life of St. Benedict” in the Great Cloister of the mo-

nastery of Monte Oliveto Maggiore (Siena, Italy) painted by the

Italian artist Giovanni Antonio Bazzi.

1913; Miller 1907, 1912; Zimmermann 1953; Ondrias

1965; Ragni et al. 1999) where it is locally indicated by

the vernacular term arkalos. In the course of the present

study, it was possible to confirm its occurrence on the is-

lands of Tinos, where it is locally known as chakalos

(Gaetlich, pers. com.), Euboea, Crete, Rhodes, and pos-

sibly Andros (Gaetlich, pers. com.). There are unconfirmed

records of badgers from Siphnos (Erhard 1858; Heldre-

ich 1978; Cheylan 1988), but this does not exclude a pri-

ori the possibility of a previously more widespread dis-

tribution in the Aegean basin, and more specifically on the

Cyclades. Moreover, the human practice of the 1mporta-

tion of badgers onto the Greek islands is documented since

prehistorical times. On Crete the oldest bones of M. meles

were discovered in the Aceramic Neolithic levels at Knos-

sos, while Ceramic Neolithic and later levels produced nu-

merous remains of the species (Jarman 1996). Other os-

teological material was found on the site of Aghia Tria-

da, and Kavousi-Vroda and has been respectively referred

to the Ancient Minoan period (about 3,000—2,200 B.C.)

(Wilkens 1996), and to the Late Minoan HI C (Klipper &

Snyder 1991; Snyder & Klippel 1996). It is not immedi-

ately apparent why human should have wanted to intro-

duce badgers onto the islands, which is suggested because

otherwise they would not have been able to pass unob-

served on the small boats employed to reach the new ter-

ritories (Vigne 1988, 1995; Masseti 1995). Since very an-

Bonn zoological Bulletin 57 (2): 367-373

cient times, they may have played an important role in hu-

man societies, both symbolically and as food. Badgers

might also have been utilised for their fur (Masseti 1995).

Moreover, in medieval Europe another use of this

mustelid has been documented. Wall paintings from the

early 16th century (Fig. 3) at the monastery of Monte

Oliveto Maggiore (Siena, Italy), painted by the Italian Gio-

vanni Antonio Bazzi, better known as Sodoma, clearly

show badgers as pets, very likely representing an authen-

tic status symbol that underscored the affluence and so-

cial position of their owner, the painter himself (Carli

1980).

LEOPARDS

REMARKS

ON SAMOS - CONCLUDING

A stuffed adult leopard (Fig. 4) is on display at the Natural

History Museum of the Aegean in Mytelenti, on the Greek

island of Samos (Masseti 2000). This specimen previously

belonged to the Town Council (Greek: Nomarkia) and has

been exhibited there for several decades (Ioannidis et al.

1996; Dimitropoulos et al. 1998). On its label it is

classified as kap/ani, with the explanation that this is the

Samian terminology indicating a species of panther.

However, the word derives from the Turkish term kaplan,

commonly used in Anatolia to indicate the tiger, and

erroneously also the leopard (Danford & Alston 1880). On

the basis of available information, it is today not possible

to ascertain the age and the origin the specimen. It is said

that the leopard was killed on the island between 1870 and

1880, but there is no evidence that this is correct. The title

of one of the most famous novels of the contemporary

Samian writer Alki Zei, To kaplani tis vitrinas (~The

kaplani of the showcase), better known however as

Wildcat under glass, was inspired by this leopard.

Speaking of her childhood, the author described this

kaplani, and since she was born in 1936, it can be

presumed that the leopard is older. Unfortunately, the

Samian specimen is of an unnatural shape because it has

been rather inexpertly stuffed, and hardly recalls the form

of a living individual. It has a total length of about 235

cm and tail length of 90 cm, apparently proving that this

specimen is a large one. But since the skin of felids is

extremely elastic, the original dimensions could have been

altered during the taxidermic procedure. The coat colour

has deteriorated due to bad preservation conditions, and

its prolonged display under daylight. The hair of the skin

is worn in patches, but it seems that originally the

colouration was tawny or buff on the back and paler on

the flanks, where it could have merged into the white of

the belly. Today, the entire coat is uniform pale, with dark-

brown rosettes along the flanks and the back, which are

fairly large (about 34 cm in diameter), widely spaced and

thinly rimmed, with the centres slightly darker than the

©ZFMK

Homeless mammals from Ionian & Aegean islands 37]

Fig. 4.

The stuffed specimen of Asia Minor leopard, Panthera pardus tulliana Valenciennes, 1856, shown at the Natural Histo-

ry Museum of the Aegean, Samos (Greece) (photo Marco Masseti; courtesy Natural History Museum of the Aegean, Mytelenii,

Samos).

ground tint. The coat is fairly short and full, the hair on

the nape is long, and the tail is decidedly bushy.

According to the colouration and coat pattern, this

specimen could belong to the Anatolian leopard Panthera

pardus tulliana, as mentioned by Valenciennes (1856),

Pocock (1930) and Leyhausen (1991), and clearly distinct

from other Near Eastern subspecies (Masseti 2000). It has

also been said that the animal arrived at Samos from the

opposite coast of Turkey, swimming across the channel

separating the island from western Anatolia. In fact there

is a deeply-rooted traditional belief on Samos which refer

to leopards swimming from Anatolia in various periods.

This was reported by Tournefort (1717) who confirmed

this legend, observing that: ““‘// y passe quelques tigres

qui viennent de terre ferme par le Petit Boghas’’. Petit

Boghas was the name used at this time to indicate the

above mentioned channel. Clarke (1801) followed this

observation and mentioned that: “tigers sometimes arrive

from the mainland, after crossing the little Boccaze;

thereby confirming all observation made by the author in

the former section, with regard to the existence of triggers

in Asia Minor’. However, Tournefort (1717) report was

probably not based on an own observation, but rather

Bonn zoological Bulletin 57 (2): 367-373

inspired by local people. In any case, since the distance

between the island and the mainland is not more than 1.7

km, it cannot be excluded that leopards could have reached

the island by swimming, at various times. These felids are

good swimmers and could have come e.g. from the

Samsundag area (Masseti 2000) which was until the early

1970s the last western Anatolian stronghold of the species

(Kumerloeve 1971; Avci 1978; Ulrich & Riffel 1993;

Masseti 2000).

Acknowledgements. I would like to express my appreciation

and gratitude to the following friends and colleagues for their

suggestions and assistance while the preparation of the present

paper: Wolfgang Bohme and Rainer Hutterer, Zoologisches

Forschungsmuseum Alexander Koenig, Bonn; Suleyman

Karakaya and Suleyman Kagar, Forest Department of Antalya

(Turkey); Ioannis C. Ondrias, Basil Chondropoulos, Stella

Fraguedakis-Tsolis and A. Stamatopoulos, Department of Biol-

ogy of the University of Patras; Martin Gaetlich, Zoological Mu-

seum of the University of Athens; Xavier Gremillet, SOS Otter

Network Sizun, France; Achilleas Dimitropoulos, Maria Dima-

ki and Yannis Ioannidis, Goulandris Natural History Museum,

Athens; and Anastasios Legakis, Department of Biology of the

University of Athens.

©ZFMK

372. Marco Masseti

REFERENCES

Adamakopoulos P, Adamakopoulos T, Bousbouras D, Giannatos

G, Hatzirvassanis V, Yoannidis Y, Papaioannou DH, Sfougaris

A (1991) Les grand Mamiféres de Gréce (Carnivores et Ar-

tiodactyles): situation actuelle, repartition, habitats - les es-

peces menacees, perspectives de protection. Biologia Gallo-

hellenica 18: 107—126

Atanassov N (1955) The jackal (Canis aureus L.) in Bulgaria.

Comptes Rendus Acad. Bulg. Sci. Sofia 8 (4): 61-63

Avci O (1978) Dilek Yarimadasi Milli Parki. Unpub. MS for

Dilek Yarimadasi Milli Park fiefi. Orman Fakiiltesi, Istanbul

Universitesi, 4 pp.

Barrett-Hamilton G (1899) Note on the Beech Marten and Bad-

ger of Crete. Ann. Mag. Nat. Hist. London 7 (4): 383-384

Bate DMA (1906) On the mammals of Crete. Proc. Zool. Soc.

London 2: 315-323

Bate DMA (1913) The Mammals of Crete. In Trevor-Battye A

(ed.) Camping in Crete. Witherby & Co., London, pp. 254-256

Carli E (1980) Le storie di San Benedetto a Monteoliveto Mag-

giore. Silvana Editoriale/Monte dei Paschi di Siena, Siena, 184

Pp.

Carpaneto GM, Cristaldi M (1994) Dormice and man: a review

of past and present relations. Hystrix The Italian Journal of

Mammalogy 6 (1-2): 303-330

Catsadorakis G (1985) HMpokatapKtky Kkataypagyn tt tavidac

Kat dtagmowmv drayetpittKMV BeuatwV ToL eOvLKOL SpLLLLLOL

Awvot (Kepaanviat). AevOuvon Aaowy Kegaanviat, Cephalo-

nia, 25 pp.

Catsadorakis G (1994) The vertebrate animals of Samaria Na-

tional Park (Crete, Greece). Biologia Gallo-hellenica 22: 9-22

Cheylan G (1988) Compte-rendu de la table ronde: répartition

géographique et statut des mammiferes menaces dans les iles

méditerranéennes. Bull. Ecol. 19 (2-3): 481-484

Clarke ED (1801): Travels in various countries of Europe, Asia

and Africa. / First Part, Russia Tartary and Turkey. 2nd ed.

(1810). Xxviu, T. Cadell and W. Davies, London, 812 pp.

Colonnelli G, Carpaneto GM, Cristalli M (2000) Uso alimenta-

re e allevamento del ghiro (Myoxus glis) presso gli antichi ro-

mani: materiale e documenti. In Atti del 2° Convegno

Nazionale di Archeozoologia. Asti, 14-16 novembre 1997.

Abaco Edizioni, Forli, 315—325

Danford CG, Alston ER (1880) On the Mammals of Asia Mi-

nor. Part I. Proceedings of the Scientific Meetings of the Zo-

ological Society of London 1880: 50-64

De Beaux O (1929) Mammiferi. In Ghigi A. (ed.): Ricerche fau-

nistiche nelle isole italiane dell’ Egeo. Archivio Zoologico Ital-

iano 12-13: 135-154

Demeter A, Spassov N (1993) Canis aureus Linnaeus, 1758 -

Schakal, Goldschakal. In Stubbe M. & Krapp, F. (eds.) Hand-

buch der Saugetiere Europas. Raubsauger 1. Aula Verlag,

Wiesbaden, pp. 107-138

Dimaki M (1999) First record of the edible dormouse Giis glis

(L., 1766) from the Greek island of Andros. Ann. Musei

Goulandris 10: 181-183

Dimitropoulos A, Dimaki M, Ioannidis I. (1998) The animals

and wetlands, close to human settlements. Contribution to is-

land fauna 14, Athens, 180 pp.

Douglas G (1892) Zur Fauna Santorins. Zool. Anz. Leipzig 15:

453-455

Douma-Petridou E (1977) Systematics and geographical distri-

bution of the families Canidae and Mustelidae in the Pelopon-

nese (in Greek). Unpl. Manuscript. University of Patras, 197

pp.

Bonn zoological Bulletin 57 (2): 367-373

Ellerman JR, Morrison-Scott TCS (1951) Checklist of Palaearc-

tic and Indian mammals 1758 to 1946. British Museum (Nat-

ural History), London, 810 pp.

Erhard D (1858) Fauna der Cykladen. Die Wirbelthiere der Cyk-

laden, Nebst einem Anhange tiber deren Pflanzendecke. Voigt

and Gunther, Leipzig, 117 pp.

Festa E (1914) Escursioni del Dr. Enrico Festa nell’ Isola di Ro-

di. Mammiferi. Boll. Mus. Zool. Anat. Comparata R. Univ.

Torino 686: 1-21

Gavish L, Gurnell J (1999) Sciurus anomalus Gildenstaedt,

1785. In Mitchell-Jones AJ et al. (eds.) The Atlas of the Eu-

ropean mammals. Academic Press, London, pp. 176-177

Giagia-Athanassopoulou E (1998) Ta OnAaotika — Mammals.

In Efthymiatou-Katsouni N (ed.) Dedication to the National

Park of Ainos. Museum of Natural History, Cephalonia and

Ithaca, pp. 159-161

Harrison DL, Bates PJJ (1991) The Mammals of Arabia. Har-

rison Zoological Museum, Sevenoaks (England), 354 pp.

Hecht-Markou P (1994) Beschreibung, geografische Verbreitung,

Biotope und Ortswechsel des Sciurus anomalus Gildenstaedt,

1785 auf der Insel Lesbos (Griechenland). Ann. Musei

Goulandris 9: 429-444

Hecht-Markou P (1999) Das Markieren des Lebenraumes von

Sciurus anomalus auf der Insel Lesbos. Ann. Musei Goulan-

dris 10: 201-221

Heldreich T (1878) La faune de la Gréce. Ie Partie. Animaux ver-

tebrés. Expos. Univ. de Paris en 1878

Ioannidis Y, Giannatos G (1991) Preliminary survey on the dis-

tribution and status of jackal (Canis aureus L., 1758) in south-

ern Greece. Biologia Gallo-hellenica 18 (1): 67-74

Ioannidis I, Dimaki M, Dimiropoulos A (1996) Saugetiere auf

Samos. In Samiakes M (ed) Samiotische Studien, B 1995-

1996; Pnevmatiko Idryma Samou “Nikolaos Dimitriou”;

Athen, S. 465-468

Jameson R (1836) Naturgeschichte der Insel Cerigo. Isis (Oken)

1838 (2): 127-130

Jameson R (1837) Notes on the Natural History and Statistics

of the Island of Cerigo et its dependencies. The Edinburgh

New Philosoph. Journal Oct. 1936-Apr. 1937, 22: 62-69

Jarman MR (1996) Human Influence in the Development of the

Cretan Mammalian Fauna. In Reese DS (ed.) Pleistocene and

Holocene Fauna of Crete and its First Settlers. Prehistory

Press, Madison (Wisconsin), pp. 211-239

Kahmann H (1959) Notes sur le statut actuel de quelques mam-

miféres menacés dans la région méditerranéenne. Mammalia

3: 329-331

Klipper WE, Snyder LM (1991) Dark age fauna from Kavousi,

Crete. The vertebrates from the 1987 and 1988 excavations.

Hesperia 60: 179-186

Krystufek B (1999a) Talpa stankovici V. Martino & E. Martino,

1931. In Mitchell-Jones, A.J. et al. (eds.) The Atlas of

European Mammals. Academic Press, London, pp. 88-89

Krystufek B (1999b) Dryomys nitedula (Pallas, 1778). In

Mitchell-Jones, A.J. et al. (eds.) The Atlas of European

mammals. Academic Press, London, pp. 300-301

Krystufek B, Vohralik V (2005) Mammals of Turkey and Cyprus.

Rodentia I: Sciuridae, Dipodidae, Gliridae, Arvicolinae.

University of Primorska, Koper (Slovenia), 292 pp.

Krystufek B, Tvrtkovie N, Paunovice M, Ozkan B (2009) Size

variation in the Northern white-breasted hedgehog, Erinaceus

roumanicus: latitudinal cline and island rule. Mammalia 73:

209-306

Kumerloeve H (1971) Zum Stand des Vorkommens von Pan-

thera pardus tulliana Valenciennes, 1856 in Kleinasiaen. Zo-

ol. Garten N.F., Leipzig 40: 4-22

©ZFMK

Homeless mammals from Ionian & Aegean islands By3

Laar V, Daan S (1967) The Etruscan Shrew, Suncus etruscus

(Savi, 1822), found on Samos, Greece. Zeitschrift ftir

Saugetierkunde 32: 174-175

Leyhausen P (1990) The subspecies question. Cat News 15:

17-18

Lindermayer D (1835) Euboea. Eine naturhistorische Skizze.

Bulletin de la Société Impériale de Naturalistes de Moscou,

XXVIII. Imprimerie de |’ Université Impériale, Moscou: 27-30

Masseti M (1995) Quaternary biogeography of the Mustelidae

family on the Mediterranean islands. Hystrix The Italian Jour-

nal of Mammalogy 7 (1-2): 17-34

Masseti M (2000) Wild cats (Mammalia, Carnivora) of Anato-

lia. With some observations on the former and present occur-

rence of leopards in south-eastern Turkey and on the Greek

island of Samos. Biogeographia 20: 607-618

Masseti M (2005) Natural and anthropochorous squirrels and

dormice of the Mediterranean Region. Hystrix The Italian

Journal of Mammalogy 16 (1): 3-26

Masseti M (2009) Mammals of the Mediterranean islands: ho-

mogenization and the loss of biodiversity. Mammalia 73:

169-202

Masseti M, Albarella U, De Grossi Mazzorin J (in press) The

crested porcupine, Hystrix cristata L., 1758, in Italy. Anthro-

pozoologica

Mendelssohn H, Yom-Tov Y (1999) Fauna Palaestina. Mammalia

of Israel. The Israel Academy of Sciences and Humanities,

Jerusalem, 439 pp.

Miller GS (1907) Some new European Insectivora and Carnivo-

ra. Ann. Mag. N. H. London, Sez. 20: 389-398

Miller G (1912) Catalogue of the mammals of Western Europe

(Europe exclusive of Russia). British Museum (Natural His-

tory), London, 1019 pp.

Mitchell-Jones AJ, Amori G, Bogdanowicz W, Krystufek B, Rei-

jnders PJH, Spitzenberger F, Stubbe M, Thissen JBM, Vohra-

lik V, Zima J (eds) The Atlas of the European mammals. Aca-

demic Press, London, 484 pp.

Niethammer J (1962) Die Saugetiere von Korfu. Bonner zool-

ogische Beitrage 13: 1-49

Niethammer J (1982) Microtus subterraneus (De Sélys-

Longchamps, 1836) — Kurzohrmaus. In Niethammer J,

Krapp F (eds.) Handbuch der Saugetiere Europas. Bd. 2/I Ro-

dentia I]. Akademische Verlagsgesellscahft, Wiesbaden, pp.

397-418

Niethammer J (1990) TYalpa stankovici V. et E. Martino, 1931

— Balkan-Maulwurf. In Niethammer J, Krapp F (eds.) Hand-

buch der Séugetiere Europas. Bd. 3/I (Insektenfresser, Her-

rentiere). AULA-Verlag GmbH, Wiesbaden, pp. 141-144

Niethammer J, Krapp F (1978) Handbuch der Saugetiere Eu-

ropas. Band 1. Rodentia 1. Aula Verlag, Wiesbaden

Ondrias JC (1965) Die Saéugetiere Grienchenlands. Saugetierk.

Mitt. 13: 109-127

Ondrias JC (1966) The taxonomy and geographical distribution

of the rodents of Greece. Saugetierk. Mitt. 14: 1-136

Ozkan B (1995) Gékeada ve Bozcaada Adalarinin Kemiricileri.

Trakya Universitesi, Edirne, unpublished PhD thesis

Ozkan B (1999) Gékceada ve Bozcaada Kemirici Faunasi (Mam-

malia; Rodentia). Turkish Journal of Zoology 23: 133-147

Pocock RI (1930) The Panthers and Ounces of Asia. Journal of

the Bombay Nat. Hist. Soc. 34: 63-82, 307-336

Bonn zoological Bulletin 57 (2): 367-373

Ragni B, Masseti M, Roussos T, Belardinelli A, Cicconi P (1999)

The carnivores of the island of Crete, Greece. Contributions

to the Zoogeography and Ecology of the Eastern Mediter-

ranean Region 1: 117—123

Raulin V (1859) La Crete en 1845. Description physique de l’ile

de Crete. Livre I. Th. Lafargue, Bordeaux (Editions de l’En-

tre-deux-Mers/Entre-deux-Mers - Régions d’Europe, Saint-

Quentin—de-Baron, 2009), 159 pp.

Schmalfuss H (1991) Santorin. Leben auf Schutt und Asche. Ein

naturkundlicher Reiseftihrer. Verlag Josef Margraf-Scientific

Books, Weikersheim, 85 pp.

Scotti G (1980) L’arcipelago del Quarnero. Mursia, Milano, 270

pp.

Snyder ML, Klippel WE (1996) The Cretan badger (Meles

meles) as a food resource at Late Bronze/Early Iron Age

Kavousi-Kastro. In Reese DS (ed.) Pleistocene and Holocene

fauna of Crete and its first settlers. Prehistory Press, Madison

(Wisconsin), pp. 283-293

Stamatopoulos C, Ondrias I (1995) First record of the Levant

vole Microtus guentheri Danford and Alston, 1880 in Lesbos

island, Greece. Saugetierk. Mitt. 36: 53-59

Thorington RW, Hoffman RS (2005) Family Sciuridae. In Wil-

son DE, Reeder DM (eds.) Mammals species of the world. A

taxonomic and geographic reference. The John Hopkins Uni-

versity Press, Baltimora, pp. 754-843

Tortonese E (1973) Appunti faunistici relativi all’isola di Rodi.

Atti del Museo Civico di Storia Naturale-Trieste 28: 269-280

Tournefort de JP (1717) Relation d’un du Levant, Fait par Or-

dre du Roy. 3 Vols. Lyon

Ulrich B, Riffel M (1993) New evidence for the occurrence of

the Anatolian leopard Panthera pardus tulliana (Valenciennes,

1956) in Western Turkey. Zoology in the Middle East 8: 5—14

Valenciennes MA (1856) Sur une nouvelle espéce de Pantheére

tuée par M. Tchihatcheff a Ninfi, village situé a huit lieues Est

de Smyrne. Comptes Rendus Hebdomadaires |’ Académie des

Sciences 42: 1035-1039

Vigne J-D (1988) Les Mammiferes post-glaciares de Corse.

Etude archéozoologique. 26e suppl. Gallia Préhistorie. CNRS,

Paris, 337 pp.

Vigne J-D (1995) Aproximacions arquezoologiques de la rela-

cio’ home-animal en els territoris insulars: l’exemple mediter-

ram. Cota Zero 11: 61-70

Werner F (1928) Beitrage zur Kenntnis der Fauna Griechenlands,

namentlich der agdischen Inseln. Sitzungsberiche d. matem-

naturw. K1., Abt. I, Akademie der Wissenschaften in Wien 137:

284-295

Wettstein von O (1942) Die Saéugetierwelt der Agiis nebst ein-

er Revision des Rassenkreises von Erinaceus europaeus. Ann.

Naturhist. Mus. Wien 52: 245-278

Wilkens B (1996) Faunal remains from the Italian excavations

on Crete. In Reese, D.S. (ed.) Pleistocene and Holocene fau-

na of Crete and its first settlers. Prehistory Press, Madison

(Wisconsin), pp. 241-261

Zimmermann K (1953) Das Gesamtbild der Sauger-Fauna Kre-

tas. Zeitschrift fiir Saugetierkunde 67: 1-72

Received: 01.1X.2010

Accepted: 03.X1.2010

OZFMK

‘ad vey eel ore aay a

it Pl. f ve i j 4 , nia ial irae

‘

th) ab

ribald ah

Bonn zoological Bulletin (BzB)

Instructions to authors

Scope

The Bonn zoological Bulletin (BzB), formerly “Bonner zoologi-

sche Beitrage”, is an international, peer-reviewed, open access jour-

nal publishing original research articles, reviews, and scientific notes

dealing with organismal zoology. Focus of the BzB are (1) taxon-

omy, (2) systematics and evolution, and (3) biodiversity and bio-

geography, all with respect to terrestrial animals. Terrestrial animals

as understood here include those inhabiting fresh or brackish wa-

ters. Contributions from related fields like ecology, morphology,

anatomy, physiology or behaviour are welcome when of clear rel-

evance to the focus topics.

Publication in BzB is free of charge, including colour illustrations

or photographs contributing significantly to quality and / or read-

ability of the manuscript. Authors retain full copyright of their pub-

lished papers, may share them with colleagues, and are encouraged

to post the original pdfs on their personal or institutional website

for non-commercial use. All material must be original, unpublished

work and not under consideration for publication elsewhere.

Research articles: Manuscript preparation and submission

Manuscripts should be written in English. For serving readers from

the organism’s country of origin, bilingual abstracts are welcome.

If you plan to submit a manuscript of more than 50 manuscript pages,

please contact the editor-in-chief in advance. Please submit your

manuscript as electronic file (see paragraph on electronic submis-

sion below). Manuscripts should strictly follow the instructions spec-

ified below. Manuscripts not compatible with these guidelines will

not be taken into consideration.

Format Typing should be double-spaced in 12 pt throughout the text,

including tables, figure legends, and reference list. Pages and lines

should be numbered consecutively. Short subheadings may struc-

ture the text into sections. Do not number headings or subheadings.

Structure Research articles should be organized as follows: Title,

Author(s), Address(es) including email address and telephone, Ab-

stract, Key words, Running Title, Introduction, Material and Meth-

ods, Results, Discussion (or combined Results and Discussion), Con-

clusions (optional), Acknowledgements, References, Tables, Figure

Captions, Figures (separately numbered and identified), Appendices

(if necessary). Footnotes should not be used except in Tables.

Title The title should be brief (30 words limit, ideally shorter) and

indicate clearly the field of study and group of animals investigat-

ed. The systematic position of taxa listed in the title must be indi-

cated (e.g. “Squamata: Colubridae”). A Running Title (maximum 45

characters inclusive of spaces) should describe the paper’s core top-

ic.

Abstract Each manuscript should contain a concise abstract as sin-

gle paragraph (max. 200 words) summarizing the significant find-

ings, followed by not more than six key words.

References In the text, cited sources should be referred to as fol-

lows: Ax (2001), Kim & Lumaret (1989), Holm et al. (1997) — for

three or more authors, or, if cited consecutively: (Ax 2001, 2002;

Holm et al. 1997; Kim & Lumaret 1989) — please follow exactly

the use of commas and semicolons. Do not use commas between

author and year (only exception: taxonomic names, in which a com-

ma is placed between author and year).

The list of references should be arranged alphabetically according

to the surname of the first author; all authors should be included.

Citations of two or more authors should be arranged alphabetical-

ly according to the first- and then the following author’s surname.

When more than one reference is given for a single author or the

same combination of authors, these should be arranged chronolog-

ically. If citing more than one reference by the same author(s) pub-

lished in the same year, use a, b, etc. after the year in both, text and

reference list (e.g. 2006a, b). The names of journals in the

References should be given in full. References “in press” shall on-

ly be cited when they have been accepted for publication. Exam-

ples of reference style are:

Kottelat M, Whitten T, Kartikasari SN, Wirjoatmodjo S (1993)

Freshwater fishes of Western Indonesia and Sulawesi. Periplus

Editions, Hong Kong

Mayr E (2000) The biological species concept. Pp. 17-29 in: Wheel-

er QD & Meier R (eds.) Species Concepts and Phylogenetic The-

ory — A Debate. Columbia University Press, New York

Parenti RP (2008) A phylogenetic analysis and taxonomic revision

of ricefishes, Oryzias and relatives (Beloniformes, Adrianichthyi-

dae). Zoological Journal of the Linnean Society 154: 494-610

Sullivan J (1994) Bufo boreas. In: Fire Effects Information System

(U.S. Department of Agriculture, Forest Service, Rocky Moun-

tain Research Station, Fire Sciences Laboratory). Online at

http://www. fs. fed.us/database/feis/animals/amphibian/bubo/all.ht

ml last accessed on December 28, 2009

Sztencel-Jablonka A, Jones G, Bogdanowicz W (2009) Skull mor-

phology of two cryptic bat species: Pipistrellus pipistrellus and

P. pygmaeus —a 3D geometric morphometrics approach with land-

mark reconstruction. Acta Chiropterologica 11: 113-126

Authors are kindly requested to make sure that sources listed in the

References match those cited in the text. Names of persons who pro-

vided unpublished information should be cited by including the in1-

tial(s) and city as follows: “(JG Frommen, Bonn, pers. comm.

2009)”.

Tables and Figures Tables and Figures should not duplicate infor-

mation provided in the text. Tables should be numbered consecu-

tively in Arabian numbers in order of their mention in the text (Table

1, Tables 1-3; do not abbreviate “Table(s)”). A brief self-explana-

tory title should be typed directly above each table, not on a sepa-

rate page. Do not insert frames, vertical rules, dotted lines or foot-

notes. Figures (maps, graphs, charts, drawings, photographs etc.)

must be numbered consecutively using Arabian numbers in order

of their mention in the text (abbreviate “Fig. 1”, “Figs 1-3” etc. in

the text, but use the full term “Figure(s)” in the captions. If refer-

ring to illustrations in cited sources, use “fig. / figs”. Grouped fig-

ures should be lettered with a lower case block letter in the lower

left corner. Scale should be indicated on figures by a scale bar. A

fully descriptive caption of each figure should contain all relevant

information; captions are to be typed together on a separate page.

Colour figures will be published free of charge if contributing sig-

nificantly to quality and / or readability of the manuscript. The de-

cision to print in colour or black and white any figure submitted in

colour will generally be based on the referee’s and handling editor’s

recommendations, but remains with the editor-in-chief and publish-

er. If appropriate, authors may be asked to group single colour fig-

ures into plates. For review, tables and figures should be enclosed

to text (preferable one electronic file per manuscript), but may al-

ternatively also be submitted as separate files (jpg, pdf, tiff). At this

stage, illustrations of low resolution allowing the referees to follow

the contents are sufficient; high-resolution files (jpg, pdf, tiff of pho-

tographs, maps etc. at > 300 dpi; line artwork etc. at 600 dpi or in

eps format) will be requested after acceptance. Unless otherwise

agreed with the editor, single electronic submissions should not ex-

ceed 6 MB file size.

Appendix Appendices should be numbered consecutively in Roman

numbers, in order of their mention in the text (Appendix I, Appen-

dices I-VI).

Abbreviations Except of very common abbreviations such as mm,

kg etc.; all abbreviations should be explained in the Methods sec-

tion or figure legend if appropriate. Hyphenation or upper case let-

ters for entire words are not permitted. All measurements must be

metric units and given to the same decimal, 1.e., 5.3-6.0 mm (not:

5.3-6 mm).

Instructions to authors

Taxonomy Names of animals and the description of new genera or

species must follow the current version of the International Code

of Zoological Nomenclature (ICZN, available at

http://www.iczn.org/iczn/index.jsp). Type specimens should be de-

posited in recognised institutions; deposition at ZFMK is highly ap-

preciated. Italics are required for species names which are written

in full the first time they appear in the text, e.g. Carassius auratus

(Linnaeus, 1758), but abbreviated at subsequent mention, e.g. C. au-

ratus. List names in synonymies as follows: Attelabus asparagi

Scopohi, 1763 (Scopoli 1763: 36, fig. 113.), and list the source un-

der References. Dichotomous keys are desirable in taxonomic pa-

pers.

Statistics Statistics presented should include the name of the test,

number of observations or degree of freedom, and probability lev-

el (P > 0.05, P < 0.05, P > 0.001, P < 0.001). Values of test statis-

tics are not required.

Scientific Notes

Notes should comply with the instructions given above, but have to

be (1) confined to a single point or issue of progress, (2) must be

short (typically no more than 3 printed pages including illustrations

and references), and (3) do not include headings or subheadings. A

brief abstract of no more than three lines is required.

Review papers

Reviews should be concise, critical and creative, seeking to sum-

marize the state-of-the-art of complex topics, and stimulate debates

and new research initiatives. Review papers should comply with the

instructions for preparation of Research articles, with the exception

that the main body of text may be structured as appropriate.

Electronic submission

Manuscripts should be submitted as text files (*.doc or *.rtf; *.pdf

is welcome for the review process, but for production *.doc or *.rtf

will be required) via e-mail (bzb.zfmk@un1i-bonn.de) to the editor-

in-chief. Alternatively, send a CD. If neither is possible for any rea-

son, please contact the editor-in-chief. The file name must start with

the submitting author’s last name.

Review process

Each manuscript will be peer-reviewed, generally by two or more

referees. Manuscripts should be submitted to the editor-in-chief, and

will be handled by the editor dealing with the respective taxon or

topic (see list of editors). Authors are encouraged to suggest poten-

tial referees for their manuscripts. Final acceptance for publication

is in the responsibility of the editor-in-chief. This decision 1s main-

ly based on the referees’ report and the handling editor’s recommen-

dation. Revised manuscripts received more than 6 months after the

reviewers’ comments had been sent will be treated as new submis-

sions.

Ethical and legal aspects

Authors are obliged to state clearly that they followed the legal reg-

ulations and laws for the collection and ethical treatment of animals.

Publication and reprints

Manuscripts will be published online after acceptance as preprint

version, which will be replaced by the final pdf after publication of

the printed issue of BZB. The corresponding author must clearly state

so if preprint online publication is not desired. In that case, only ti-

tle, authors and the information that this manuscript has been ac-

cepted for publication will be made available at that stage. Imme-

diately after publication, the corresponding author will receive an

e-mail containing the final pdf. On request (see order form submit-

ted with page proofs), 25 reprints are supplied free of charge. Ad-

ditional reprints may be purchased on the author’s expense.

Questions we ask our reviewers

Authors preparing manuscripts for BZB should keep in mind the fol-

lowing questions which referees for the journal are asked:

. Is the paper of interest to the readers of BZB?

. How well does it meet the focus of BZB?

. Is it acceptable for publication, or should it be reconsidered af-

ter revision?

. Please grade originality, quality of data, quality of statistical analy-

ses, and quality of interpretation on a scale from | = low to 5 =

high.

4. Please grade clarity and quality of text, figures and tables from

1 = low to 5 = high.

5. Has the welfare of any experimental animals been adequately tak-

en into account?

. Does the title aptly and correctly describe the paper?

. Does the abstract summarize only the significant findings?

. Is the length of the paper appropriate?

. Are all (colour) figures and tables necessary and appropriate?

WwW

‘Oo OND

Contents

Descriptions of New Taxa

Joger, Ulrich & Bshaenia, Ismail:

A new Tarentola subspecies (Reptilia: Gekkonidae) endemic to Tunisia

Wilms, Thomas M., Shobrak, Mohammed & Wagner, Philipp:

A new species of the genus Tropiocolotes from Central Saudi Arabia

(Reptilia: Sauria: Gekkonidae)

Lutzmann, Nicola, Stipala, Jan, Lademann, Ralph, Krause, Patrick, Wilms, Thomas M. &

Schmitz, Andreas:

Description of a new subspecies of Kinyongia uthmoelleri (Muller, 1938)

(Squamata: Chamaeleonidae) with notes on its captive propagation

Vogel, Gernot & David, Patrick:

A new species of the genus Lycodon (Boie, 1826) from Yunnan Province, China

(Serpentes: Colubridae)

Wagner, Philipp & Wilms, Thomas M.:

A crowned devil: new species of Cerastes Laurenti, 1768 (Ophidia, Viperidae) from Tunesia,

with two nomenclatural comments

History of Herpetology

Schmidtler, Josef Friedrich:

The taxonomic history of the Linnean genus Lacerta (Squamata: Sauria: Lacertidae)

in the mirror of book-illustration

Pafilis, Panayiotes:

A brief history of Greek herpetology

Niekisch, Manfred:

The history of reptiles and amphibians at Frankfurt Zoo

Non-herpetological articles

Hita Garcia, Francisco, Fischer Georg, Ktick, Patrick, Thormann, Birthe & Peters, Marcell K.

Tetramorium boehmei sp. n. — a new ant (Hymenoptera: Formicidae) species

from the Kakamega Forest, Western Kenya

Masseti, Marco:

Homeless mammals from the lonian and Aegean islands

267

275

28)

289

297

307

329

347

359

367

re a es yo

SG Ian eam ae

vol

tone

Contents

567 9293

Ecology & Evolution

Carretero, Miguel A., Cascio, Pietro Lo, Corti, Claudia & Pasta, Salvatore:

Sharing recources in a tiny Mediterranean Island? ;

Comparative diets of Chalcides ocellatus and Podarcis filfolensis in Lampione

Kuhnel, Susanne, Reinhard, Sandy & Kupfer, Andreas:

Evolutionary reproductive morphology of amphibians: an overview

Checklists, Nomenclature & Distribution

Koch, André, Auliya, Mark & Ziegler, Thomas:

Updated checklist of the monitor lizards of the world (Squamata: Varanidae)

111

119

127

Ziegler, Thomas & Nguyen, Truong Quang:

New discoveries of amphibiens and reptiles from Vietnam

Dubois, Alain & Bour, Roger:

The distinction between family-series and class-series nomina in zoological nomenclature,

with emphasis on the nomina created by Batsch (1788, 1789) and on the higher nomencature

of turtels

137

149

Jirkt, Miloslav, Mihalca, Andrei Daniel, Necas, Petr & Modry, David:

An addition to the East African herpetofauna:

the first record of Tarentola annularis relicta (Squamata: Gekkonidae) in Uganda

Taxonomy

Rédel, Mark-Oliver, Sandberger, Laura, Penner, Johannes, Mané, Youssouph & Hillers, Annika:

The taxonomic status of Hyperolius spatzi Ahl, 1931 and Hyperolius nitidulus Peters, 1875

(Amphibia: Anura: Hyperoliidae)

173

177

Capula, Massimo & Corti, Claudia:

Genetic variability in mainland and insular populations of Podarcis muralis (Reptilia: Lacertidae)

189

Arribas, Oscar J.:

Intraspecific variability of the Carpetane Lizard (/berolacerta cyreni [Muller & Hellmich, 1937])

(Squamata: Lacertidae), with special reference to the unstudied peripheral populations

from the Sierras de Avila (Paramera, Serrota and Villafranca)

197

Bare}, Michael F., Ineich, lvan, Gvozdik, Vaclav, Lhermitte-Vallarino, Nathaly, Legrand Gonwouo,

Nono, LeBreton, Matthew, Bott, Ursula & Schmitz, Andreas:

Insights into chameleons of the genus 7rioceros (Squamata: Chamaeleonidae) in Cameroon,

with the resurrection of Chamaeleon serratus Mertens, 192

221

Descriptions of New Taxa

GUnther, Rainer:

Another new Cophixalus species (Amphibia: Anura: Microhylidae) from western New Guinea

231

Vences, Miguel, Kohler, Jorn, Crottini, Angelica & Glaw, Frank:

High mitochondrial sequence divergence meets morphological bioacoustic conservatism:

Boophis quasiboehmei/ sp. n., a new treefrog species from south-eastern Madagascar

Bauer, Aaron M.:

A new species of Pachydactylus (Squamata: Gekkonidae) from the Otavi Highlands of

northern Namibia

241

257

yy Ministerium fiir Innovation, ' ' b

Wissenschaft, Forschung i i

is und Technologie des Landes eh RW. Lei i iz

<@S” Nordrhein-Westfalen @ G emein sch aft