FORSCHUNGS

Bonn zoological Bulletin 68 (1): 1-12

2019 - Sharma B.K. & Sharma S.

https://doi.org/10.20363/BZB-2019.68.1.001

Research article

urn:|sid:zoobank.org:pub:839E82A A-0807-47C 1-B21E-CS5DE2098C 146

The biodiverse rotifer assemblages (Rotifera: Eurotatoria)

of Arunachal Pradesh, the eastern Himalayas:

alpha diversity, distribution and interesting features

Bhushan Kumar Sharma’’ & Sumita Sharma’

'2 Department of Zoology, North-Eastern Hill University, Shillong — 793 022, Meghalaya, India

* Corresponding author: Email: profbksharma@gmail.com

'urn:lsid:zoobank.org:author:FD069583-6E7 1-46D6-8F45-90A87F35BEFE

?urn:Isid:zoobank.org:author:668EQFEO-C474-4 D0D-9339-F01ADFD239D1

Abstract. The present assessment of Rotifera biodiversity of the eastern Himalayas reveals a total of 172 species belonging

to 39 genera and 19 families from Arunachal Pradesh, the northeastern-most state of India. The richness forms ~59% and

~40% of the rotifer species known till date from northeast India (NEI) and India, respectively. Three species are new to the

Indian sub-region, four species are new to NEI and 89 species are new to Arunachal Pradesh; 27 species indicate global

distribution importance and 25 species reported exclusively from NEI merit regional interest. The rich and diverse alpha di-

versity and biogeographic interest of Rotifera of this Himalayan biodiversity hot-spot is noteworthy in light of predominance

of the small lentic ecosystems. Lecanidae > Brachionidae > Lepadellidae > Trichocercidae collectively comprise ~71% of

total rotifer species. Brachionidae records the highest richness known from any state of India. This study indicates the role of

thermophiles with overall importance of “tropic-centered’ genera Lecane and Brachionus, and particularly at lower altitudes;

species of ‘temperate-centered’ genera Keratella, Notholca and Synchaeta are notable in our collections at middle and higher

altitudes, while 7richocerca and Lepadella are other species-rich genera. The rotifer fauna shows a mixture of ‘tropical’ and

‘cold-water’ elements, depicts the littoral-periphytonic character, and records a large component of cosmopolitan species.

The study of more collections from middle and higher altitudes of Arunachal Pradesh are desired for an update on Rotifera

ISSN 2190-7307

http://www.zoologicalbulletin.de

from the eastern Himalayas.

Key words. Biodiversity, biogeography, habitat heterogeneity, Himalayan hot-spot, interesting species.

INTRODUCTION

Rotifera, an important group of aquatic metazoans and an

integral link of aquatic food-webs, have been inadequate-

ly documented from several states of India in spite of over

120 years of taxonomic contributions (Sharma & Shar-

ma 2017, 2018a). This generalization holds valid for the

eastern-most hill state of Arunachal Pradesh of northeast

India (NEI) with an earlier report of 76 species (Sharma

& Sharma 2014a). On the other hand, a recent document

on ‘Faunal diversity of Indian Himalayas’ (Chandra et

al. 2018) listed only 24 species without taking due cog-

nizance of our report in spite of its citation, and Sinha

(2018) enlisted 45 rotifer species while collating infor-

mation on zooplankton fauna of Arunachal Pradesh. The

present study is thus an endeavor to augment the status of

Rotifera biodiversity of the eastern Himalayas and NEI

in particular as well as our work on Fauna volume on the

Indian Freshwater Rotifera.

Arunachal Pradesh, “the land of dawn-lit mountains”,

is the northeastern-most state of India. Geographically, it

is the largest amongst eight sister states of NEI and more

importantly, it forms a part of the Himalayan biodiversity

Received: 11.09.2018

Accepted: 23.01.2019

hot-spot. This eastern Himalayan hill state is character-

ized predominantly by small lentic biotopes located un-

der varied climatic regimes that range from the low alti-

tude humid subtropical climate to high altitude and very

high altitude areas with subtropical highland climate and

alpine climate. We hypothesize the lentic ecosystems of

Arunachal Pradesh to harbor biodiverse Rotifera in view

of likely habitat heterogeneity under varied ecological re-

gimes. Our plankton and semi-plankton collections from

different districts and largely from small lentic ecosystems

of this state interestingly reveal rich and diverse Rotifera

assemblages. We present an inventory of the rotifer spe-

cies observed from Arunachal Pradesh with illustrations

of interesting elements. Comments are made on the rotifer

alpha diversity with emphasis on the nature and compo-

sition, new records, elements of global and regional bio-

geographic interest and other salient features. This study

marks a notable contribution to biodiversity and biogeog-

raphy of the Indian and Asian Rotifera and that of the east-

ern Himalayas in particular.

Corresponding editor: B. Huber

Published: 30.01.2019

2 Bhushan Kumar Sharma & Sumita Sharma

Af,

92°0'0"E 93°0'0"E 94°0'0"E 95°0'0"E 96°0'0"E 97°0'0"E

es)

30°0'0"N

= =

) >?

2 a

z 2 5

“4 ; i

2 f a

Fa ©

2 >

o nd

RK NN

92°0°0"E 93°0'0"E 94°0'0"E 95°0'0"E 96°0'0"E 97°0'0"E

Fig. 1A—B. A. Map of India indicating the state of Arunachal Pradesh; B. District map of Arunachal Pradesh.

Bonn zoological Bulletin 68 (1): 1-12 ©ZFMK

The biodiverse rotifer assemblages (Rotifera: Eurotatoria) of Arunachal Pradesh, the eastern Himalayas 3

MATERIALS & METHODS

The present study is based on analysis of our plankton

and semi-plankton samples collected during January and

March, 2013; February, August and November, 2013;

February, 2014 from different districts of Arunachal

Pradesh (26.28°—29 30° N latitude; 91.20°—97.30° E lon-

gitude) as well as during September, 2013 and June, 2014

from Twang and East Kameng districts. A total of 419

samples collected from scattered localities of Tawang,

East Kameng, Lower Subansiri, Upper Subansiri, West

Siang, Lower Siang, East Siang, Upper Dibang Valley,

Lower Dibang Valley, Namsai, Lohit, Changlang and

Tirap districts were examined (Fig. 1, A—B). The collec-

tions largely covered the localities from the lower alti-

tudes particularly from the districts adjoining the state of

Assam with limited samples from middle altitudes and

higher altitudes because of logistic difficulties for sam-

pling namely restricted area and lack of access; infra-

structure, difficult terrain and financial support constrains

for intensive sampling. The small lentic ecosystems were

mainly sampled while the collections were also examined

from certain floodplain wetlands from lower altitudes.

Water samples were taken from various aquatic bio-

topes; water temperature, pH and specific conductivity

were recorded with the relevant field probes to provide

information on some basic abiotic attributes. The plankton

samples were collected by towing a nylobolt plankton net

(No. 25; # 50um)) and were preserved in 5% formalin. In-

dividual samples were screened with a Wild stereoscopic

binocular microscope; the rotifer taxa were isolated and

mounted in Polyvinyl alcohol-lactophenol, and were ob-

served with Leica (DM 1000) stereoscopic phase contrast

microscope fitted with an image analyzer. The micro-pho-

tographs were provided for interesting species and mea-

surements were given in micrometers (um). The rotifer

taxa were identified following Koste (1978), Koste and

Shiel (1987, 1989, 1990), Shiel and Koste (1992, 1993),

Segers (1995), Sharma (1983, 1987, 1998) and Sharma &

Sharma (1999, 2000, 2008, 2013) and Jersabek & Leitner

(2013). Segers (2007) and Jersabek & Leitner (2013) were

followed for distributional records of various taxa. The

percentage similarities between the rotifer communities

were calculated vide Sorenson’s index (Sorenson 1948).

The voucher collections are deposited in the holdings of

Zoological Survey of India, Kolkata.

RESULTS

The plankton and semi-plankton collections from

Arunachal Pradesh reveal 172 species of Rotifera be-

longing to 39 genera and 19 families. A detailed system-

atic list of the recorded taxa is presented below:

Bonn zoological Bulletin 68 (1): 1-12

Systematic list of Rotifera recorded from Arunachal

Pradesh

Phylum: Rotifera

Class: Eurotatoria

Subclass: Monogononta

Order: Ploima

Family: Brachionidae

Anuraeopsis coelata De Beauchamp, 1932

A. fissa Gosse, 1851

Brachionus angularis Gosse, 1851

B. bennini Leissling, 1924 **

B. bidentatus Anderson, 1889

B. budapestinensis Daday, 1885 **

B. calyciflorus Pallas, 1766

B. caudatus Barrois & Daday, 1894

B. dichotomus reductus Koste & Shiel, 1980 **

10. B. dimidiatus Bryce, 1931 *

11. B. diversicornis (Daday, 1883) **

12. B. falcatus Zacharias, 1898

13. B. forficula Wierzejski, 1891

14. B. kostei Shiel, 1983 **

15. B. lyratus Shephard, 1911 #

16. B. mirabilis Daday, 1897 **

17. B. murphyi Sudzuki, 1989 **

18. B. quadridentatus Hermann, 1783

19. B. rubens Ehrenberg, 1838 **

20. Keratella cochlearis Gosse, 1851

21. K. edmondsoni Ahlstrom, 1943 **

22. K. javana Hauer, 1937 **

23. K. lenzi Hauer, 1953 **

24. K. serrulata (Ehrenberg, 1838)

25. K. tecta (Gosse, 1851) **

26. K. ticinensis (Callerio, 1921) *

27. K. tropica (Apstein, 1907)

28. Notholca acuminata (Ehrenberg, 1832)

29. N. labis Gosse, 1887 *

30. N. squamula (O.F. Muller, 1786)

31. Plationus patulus (O.F. Miller, 1786)

32. Platyias leloupi Gillard, 1957 **

33. P. quadricornis (Ehrenberg, 1832)

Meee Oe Se

Family: Epiphanidae

34. Epiphanes brachionus (Ehrenberg, 1837) **

Family: Euchlanidae

35. Beauchampiella eudactylota (Gosse, 1886)

36. Dipleuchlanis propatula (Gosse, 1886)

37. Euchlanis dilatata Ehrenberg, 1832

38. E. incisa Carlin, 1939

39. E. triquetra Ehrenberg, 1838 **

AQ. Tripleuchlanis plicata (Levander, 1894) **

Family: Mytilinidae

41. Lophocharis salpina (Ehrenberg, 1834) **

42. Mytilina acanthophora Hauer, 1938 **

©ZFMK

4 Bhushan Kumar Sharma & Sumita Sharma

43. M. bisulcata (Lucks, 1912) **

44. M. brevispina (Ehrenberg, 1830) **

45. M. michelangellii Reid & Turner, 1988 **

46. M. ventralis (Ehrenberg, 1830)

Family: Trichotriidae

47. Macrochaetus danneelae Koste & Shiel, 1983 **

48. M. longipes Myers, 1934 **

49. M. sericus (Thorpe, 1893)

50. Trichotria tetractis (Ehrenberg, 1830)

51. Wolga spinifera (Western, 1894) **

Family: Lepadellidae

52. Colurella adriatica Ehrenberg, 1831 **

53. C. obtusa (Gosse, 1886)

54. C. sulcata (Stenroos, 1898) **

55. C. uncinata (O.F. Miller, 1773)

56. Lepadella acuminata (Ehrenberg, 1834)

57. L. apsicora Myers, 1934

58. L. apsida Harring, 1916 **

59. L. benjamini Harring, 1916 **

60. L. biloba Hauer, 1938 **

61. L. costatoides Segers, 1992 **

62. L. dactyliseta (Stenroos, 1898) **

63. L. discoidea Segers, 1993 **

64. L. ehrenbergi (Perty, 1850)

65. L. heterostyla (Murray, 1913)

66. L. minuta (Weber & Montet, 1918) **

67. L. ovalis (O. F. Muller, 1786)

68. L. patella (O.F. Muller, 1773)

69. L. quinquecostata (Lucks, 1912) **

70. L. rhomboides (Gosse, 1886)

71. L. triba Myers, 1934 **

72. L. triptera Ehrenberg, 1830

73. L. vandenbrandei Gillard, 1952 **

74. Squatinella lamellaris (O. F. Muller, 1786) **

Family: Lecanidae

75. Lecane aculeata (Jakubski, 1912)

76. L. aeganea Harring, 1914 **

77. L. arcula Harring, 1914

78. L. bifurca (Bryce, 1892) **

79. L. blachei Berzins, 1973 **

80. L. bulla (Gosse, 1851)

81. L. closterocerca (Schmarda, 1898)

82. L. crepida Harring, 1914

83. L. curvicornis (Murray, 1913)

84. L. decipiens (Murray, 1913)

85. L. dorysimilis Trinh Dang, Segers & Sanoamuang, 2015 **

86. L. doryssa Harring, 1914 **

87. L. elegans Harring, 1914 **

88. L. flexilis (Gosse, 1886) **

89. L. furcata (Murray, 1913)

90. L. haliclysta Harring & Myers, 1926 **

91. L. hastata (Murray, 1913) **

92. L. hamata (Stokes, 1896)

Bonn zoological Bulletin 68 (1): 1-12

93. L. hornemanni (Ehrenberg, 1834) **

94. L. inermis (Bryce, 1892) **

95. L. inopinata Harring & Myers, 1926 **

96. L. lateralis Sharma, 1978 **

97. L. leontina (Turner, 1892)

98. L. ludwigii (Eckstein, 1883)

99. L. luna(O.F .Miller, 1776)

100. L. /unaris (Ehrenberg, 1982)

101. L. monostyla (Daday, 1897) **

102. L. nitida (Murray, 1913) **

103. L. niwati Segers, Kotethip & Sanoamuang, 2004 **

104. L. obtusa (Murray, 1913) **

105. L. papuana (Murray, 1913)

106. L. paxiana Hauer, 1940 **

107. L. ploenensis (Voigt, 1902)

108. L. pusilla Harring, 1914 **

109. L. pyriformis (Daday, 1905)

110. L. quadridentata (Ehrenberg, 1830)

111. L. rhenana Hauer, 1929 **

112. L. rhytida Harring & Myers, 1926**

113. L. signifera (Jennings, 1896)

114. L. stenroosi (Meissner, 1908) **

115. L. stichoclysta Segers, 1993 #

116. L. superaculeata Sanoamuang & Segers, 1997 **

117. L. undulata Hauer, 1938 **

118. L. unguitata (Fadeev, 1925)

119. L. ungulata (Gosse, 1887)

Family: Notommatidae

120. Cephalodella forficula (Ehrenberg, 1832)

121. C. gibba (Ehrenberg, 1830)

122. C. intuta Myers, 1924 **

123. C. mucronata Myers, 1934

124. C. trigona (Rousselet, 1895) **

125. Monommata longiseta (O.F. Miller, 1786) **

126. Notommata pachyura (Harring & Myers, 1924) **

Family: Scaridiidae

127. Scaridium longicaudum (O.F. Muller, 1786)

Family: Trichocercidae

128. Trichocerca bidens (Lucks, 1912) **

129. T. bicristata (Gosse, 1887) **

130. T. capucina (Wierzejski & Zacharias, 1893) **

131. T cylindrica (Imhof, 1891)

132. T. edmondsoni (Myers, 1936) **

133. T. elongata (Gosse, 1886)

134. T flagellata Hauer, 1938 **

135. T hollaerti De Smet, 1990 **

136. T. insignis (Herrick, 1886) **

137. T: longiseta (Schrank, 1802)

138. T maior Hauer, 1936 **

139. T. mus Hauer, 1938 #

140. T: pusilla (Lauterborn, 1898) **

141. T rattus (O.F. Miller, 1786)

142. T. similis (Wierzejski, 1893)

©ZFMK

The biodiverse rotifer assemblages (Rotifera: Eurotatoria) of Arunachal Pradesh, the eastern Himalayas 5

Figs. 2A—I. New Rotifera records and species of biogeographic interest. A. Brachionus lyratus Shephard (ventral view); B. Lecane

stichoclysta Segers (ventral view); C. Trichocerca mus Hauer (lateral view); D. Brachionus dimidiatus Bryce (ventral view); E. Ker-

atella ticinensis (Callerio) (dorsal view); F. Notholca acuminata (Ehrenberg) (dorsal view); G. Notholca labis Gosse (ventral view);

H. Brachionus dichotomus reductus Koste & Shiel (ventral view); I. Brachionus murphyi Sudzuki (dorsal view).

Bonn zoological Bulletin 68 (1): 1-12 ©ZFMK

6 Bhushan Kumar Sharma & Sumita Sharma

Figs. 3A—J. Rotifera species of biogeographic interest. A. Cephalodella trigona (Rousselet) (lateral view); B. Keratella edmondsoni

Ahlstrom (dorsal view); C. Keratella javana Hauer (ventral view); D. Keratella serrulata (Ehrenberg) (ventral view), E. Lecane

blachei Berzins (ventral view); F. Lecane lateralis Sharma (ventral view); G. Lecane niwati Segers, Kotethip & Sanoamuang (ventral

view), H. Lecane superaculeata Sanoamuang & Segers (ventral view); I. Lepadella discoidea Segers (ventral view); J. Lepadella

vandenbrandei Gillard (ventral view).

Bonn zoological Bulletin 68 (1): 1-12 ©ZFMK

The biodiverse rotifer assemblages (Rotifera: Eurotatoria) of Arunachal Pradesh, the eastern Himalayas 7

PCA

aig Pe &

a es =

a, ea

He,

Ohh ees ‘a Pap Sy ate

Figs. 4A—H. Rotifera species of biogeographic interest. A. Macrochaetus danneelae Koste & Shiel (ventral view); B. Notholca squa-

mula (O.F. Muller) (dorsal view); C. Testudinella amphora Hauer (ventral view); D. Testudinella brevicaudata Yamamoto (ventral

view); E. Testudinella greeni Koste (dorsal view); FK. Trichocerca edmondsoni (Myers) (lateral view); G. Trichocerca hollaerti De

Smet (lateral view); H. Trichocerca maior Hauer (lateral view).

Bonn zoological Bulletin 68 (1): 1-12 ©ZFMK

8 Bhushan Kumar Sharma & Sumita Sharma

143. T tigris (O.F. Muller, 1786) **

144. T stylata (Gosse, 1851) **

145. T. uncinata (Voigt, 1902) **

146. T: weberi (Jennings, 1903) **

Family: Asplanchnidae

147. Asplanchna priodonta Gosse, 1850

Family: Synchaetidae

148. Ploesoma lenticulare Herrick, 1885 **

149. Polyarthra vulgaris Carlin, 1943

150. Synchaeta oblonga Ehrenberg, 1832 **

151. S. longipes Gosse, 1887

152. S. pectinata Ehrenberg, 1832

Family: Dicranophoridae

153. Dicranophoroides caudatus (Ehrenberg, 1834)

154. Dicranophorus forcipatus (O.F. Miller, 1786) **

Order. Flosculariaceae

Family: Floscularidae

155. Sinantherina semibullata (Thorpe, 1893) **

156. S. spinosa (Thorpe, 1893)

Family: Hexarthridae

157. Hexarthra mira (Hudson, 1871)

Family: Testudinellidae

158. Pompholyx sulcata Hudson, 1885

159. Testudinella amphora Hauer, 1938 **

160. 7: dendradena de Beauchamp, 1955 **

161. T. brevicaudata Yamamoto, 1851 **

162. T. emarginula (Stenroos, 1898)

163. T. greeni Koste, 1981 **

164. T. parva (Ternetz, 1892) **

165. T. patina (Hermann, 1783)

166. T. tridentata Smirnov, 1931 **

Family: Trochosphaeridae

167. Filinia camasecla Myers, 1938 **

168. F longiseta (Ehrenberg, 1834)

169. F opoliensis (Zacharias, 1898)

Order. Collothecaceae

Family: Collothecidae

170. Collotheca ornata (Ehrenberg, 1832) **

Subclass: Bdelloidea

Order: Philodinida

Family: Philodinidae

171. Dissotrocha aculeata (Ehrenberg, 1832)

172. Rotaria neptunia (Ehrenberg, 1832)

# New record from India; * new record from northeast

India (NEI); ** new record from Arunachal Pradesh

Bonn zoological Bulletin 68 (1): 1-12

Water temperature of the sampled water bodies ranged

between 8—23 °C, pH ranged between 5.3—7.4 and specif-

ic conductivity varied between 18.5—89.7 uS/cm.

Brachionus lyratus (Fig. 2A), Lecane_ stichoclysta

(Fig. 2B) and Trichocerca mus (Fig. 2C) are new records

from India. Brachionus dimidiatus (Fig. 2D), Keratella

ticinensis (Fig. 2E) and Notholca acuminata (Fig. 2F)

and N. /abis (Fig. 2G) are new records from northeast

India (NEI), and 89 species (marked by **) are additions

to the rotifer fauna of Arunachal Pradesh. Various other

interesting species observed in our collections include

Brachionus dichotomus reductus (Fig. 2H), B. murphyi

(Fig. 21), Cephalodella trigona, (Fig. 3A), Keratella ed-

mondsoni (Fig. 3B), K. javana (Fig. 3C), K. serrulata

(Fig. 3D), Lecane blachei (Fig. 3E), L. lateralis (Fig. 3F),

L. niwati (Fig. 3G), L. superaculeata (Fig. 3H), Lep-

adella discoidea (Fig. 31), L. vandenbrandei (Fig. 35),

Macrochaetus danneelae (Fig. 4A), Notholca squamula

(Fig. 4B), Zestudinella amphora (Fig. 4C), T. brevicau-

data (Fig. 4D), 7: greeni (Fig. 4E), Trichocerca edmond-

soni (Fig. 4F), T. hollaerti (Fig. 4G), T. maior (Fig. 4H),

and 7? uncinata. Lecane (Lecanidae) indicates 45 spe-

cies; Brachionidae records 33 species with 17 species of

Brachionus, Colurellidae (23 species) includes 18 spe-

cies of Lepadella, Trichocerca (Trichocercidae) indicates

19 species while Keratella and Testudinella include eight

species each.

DISCUSSION

The water bodies of Arunachal Pradesh depict “sub-trop-

ical to temperate’ nature concurrent with their altitudi-

nal locations and are characterized by ‘slightly acidic—

circum neutral—slightly alkaline waters’ while specific

conductivity highlights general ‘soft-water nature with

distinctly low ionic concentrations’. The last feature war-

rants inclusion of the sampled lentic ecosystems under

‘Class I’ category of trophic classification vides Talling

& Talling (1965).

The present report of total richness (S) of 172 Rotifera

species from Arunachal Pradesh, belonging to 39 genera

and 19 families, comprises ~59% and ~40% of the spe-

cies of the phylum known till date from NEI and India, re-

spectively. The biodiverse rotifer assemblage is hypoth-

esized to function of habitat heterogeneity of small lentic

biotopes of this hill state located under varied ecological

regimes and also to certain extent to the ‘rotiferologist ef-

fect’ vide Fontaneto et al. (2012) though we are aware of

the sampling limitations. The results endorse our hypoth-

esis on importance of small lentic environs as one of the

rotifer diverse habitats (Sharma & Kensibo 2017; Sharma

et al. 2017) of the Indian sub-region. This study marks

a significant increase (~126%) of the rotifer tally of the

eastern Himalayas than 76 species recorded by Sharma

& Sharma (2014a) but is contrastingly higher than 24

©ZFMK

The biodiverse rotifer assemblages (Rotifera: Eurotatoria) of Arunachal Pradesh, the eastern Himalayas 9

and 45 species listed by Chandra et al. (2018) and Sinha

(2018), respectively. Our results record richer alpha di-

versity than 162 (Sharma & Sharma 2015), 161 (Sharma

unpublished) and 150 (Sharma et al. 2017) rotifer species

known from hill states of NEI namely Mizoram, Megha-

laya and Nagaland, respectively. On the other hand, the

richness is relatively lower than 189 species observed

from the floodplain wetlands of Manipur (Sharma &

Sharma 2018a) state of NEI. The rotifer species exam-

ined from the eastern Himalayas register higher affini-

ty (83.8% community similarity vide Sorenson’s index)

with the fauna of adjacent hill state of Nagaland; these

indicate 71.0% and 74.8% similarities with the faunas

of Manipur and Mizoram, respectively but records more

divergence in species composition (66.7% similarity)

than the rotifers known from Meghalaya. We caution on

the stated comparisons in view of our yet limited collec-

tions particularly from the higher altitudes of Arunachal

Pradesh. Further, our report from the eastern Himalayas

though concurs with 173 species known from Jammu

& Kashmir state of the western Himalayas (Sharma &

Sharma 2018b) but is characterized by only 53.3% com-

munity similarity (vide Sorenson’s index) thus reflecting

notable divergence in species composition than the latter.

Brachionus lyratus, Lecane stichoclysta and Trichocer-

ca mus are new records from the Indian sub-region; these

species are known elsewhere from the Oriental region

from Thailand (Sa-Ardrit et al. 2013). Brachionus lyra-

tus, described from Australia, resembles with B. angularis

but 1s differentiated from the latter by its short foot-open-

ing flanked by blunt spines. We opine wider distribution

of the former brachionid in India because of its likely

over-looking as B. angularis. L. stichoclysta, described

from Oguta Lake of Nigeria (Segers 1993), is diagnosed

by completely separated claws, nearly square and cov-

ered foot pseudosegment, and relatively short toes. Be-

sides, 7’ mus, originally described from Indonesia, is now

categorized as thermophilic pan (sub) tropical species

vide Segers (2003).

Brachionus dimidiatus, Keratella_ticinensis, Not-

holca acuminata and N. labis are new records from

NEI. B. dimidiatus is validly known from India from

Delhi (Sarma, 1988) while we consider its report from

Rajasthan (Nayar 1968) as unverifiable due to lack of

any validation. K. ticinensis 1s examined from Dal Lake

(Kashmir) by Sarma (1988) while its other un-authenti-

cated Indian reports are categorized as dubious (Sharma

& Sharma 2014b). N. acuminata is listed from Jammu &

Kashmir (Sharma & Sharma 2018b) but without any val-

idation while its indiscriminate reports elsewhere from

India are considered dubious (Sharma & Sharma 201 4b).

N. labis is known from Yamuna River, Delhi (Sarma

1988; Arora & Mehra 2003). The present report of these

four brachionid species extends their distribution to the

eastern Himalayas. In addition, our study adds 89 species

as new records to the rotifer fauna of Arunachal Pradesh

Bonn zoological Bulletin 68 (1): 1-12

and thus marks significant update to Rotifera biodiversity

of the eastern Himalayas.

Our collections from Arunachal Pradesh indicate 27

species (~15.7% of S) of global biogeographic impor-

tance. These include the Australasian Brachionus dichot-

omus reductus, B. lyratus and Macrochaetus danneelae;

the Oriental endemics Brachionus murphyi, Keratella

edmondsoni, Filinia camasecla, Lecane blachei, L. ni-

wati and L. superaculeata, the Indo-Chinese Lecane do-

rysimilis, the Paleotropical Keratella javana, Lepadella

discoidea, L. vandenbrandei, Lecane lateralis, L. sticho-

clysta, L. unguitata, Testudinella brevicaudata, T: gree-

ni and Trichocerca hollaerti;, the Holarctic Trichocerca

uncinata, and seven other species with restricted glob-

al occurrence namely Brachionus kostei, Cephalodella

trigona, Notholca acuminata, N. labis, Trichocerca ed-

mondsoni, T: maior, and Testudinella amphora. Overall

richness of the globally notable elements outnumbers

the reports of such taxa from the states of Meghalaya,

Mizoram, Nagaland and Tripura of NEI (Sharma & Shar-

ma 2014a, 2017) and elsewhere from India (Sharma &

Sharma 2017). Interestingly, 25 species (~14% of S)

namely Brachionus kostei, B. lyratus, B. murphyi, Ceph-

alodella trigona, Keratella javana, Lecane aeganea, L

dorysimilis, L. niwati, L. rhenana, L. rhytida, L. sticho-

clysta, Macrochaetus danneelae, Mytilina michelangellii,

L. superaculeata, Lepadella benjamini, L. vandenbrandei,

Testudinella amphora, T: brevicaudata, T: dendrade-

na, T. tridentata, Trichocerca edmondsoni, T. hollaer-

ti, T. maior, T: mus and T. uncinata are notable for their

Indian distribution restricted till date exclusively to NEI

(Sharma & Sharma 2017). The species of the two catego-

ries impart global and regional biogeographic interest to

the rotifer fauna of Arunachal Pradesh. The regional im-

portance of the eastern Himalayan Rotifera is augmented

by occurrence of more species of restricted distribution

in India 1.e., Brachionus bennini, Colurella adriatica,

Keratella serrulata, Lepadella costatoides, L. dactylise-

ta, L. quinquecostata, Lecane bifurca, L elegans, L. hal-

iclysta, L. hastata, L. paxiana, L. pusilla, Trichocerca

bidens, T: insignis, T. stylata, T: tigris, Testudinella parva,

Platyias leloupi, and Wolga spinifera. We attribute siz-

able fractions of species of biogeographic interest in the

eastern Himalayas to the fact that our collections largely

covered the localities from the lower and middle altitudes

from the districts adjoining the state of Assam of NEI. The

latter itself assumes interest as ‘the Assam-gateway’ — an

important phase in the biogeographic evolution of India

and a vital corridor that facilitated extensive interchang-

es between the Indian and Asian biota (Mani 1974), thus

changing the modern biotic composition of the epigean

ecosystems of India (Ranga Reddy 2013).

Lecanidae > Brachionidae > Lepadellidae > Trichocer-

cidae collectively comprise ~71% of the rotifers species

of Arunachal Pradesh. The dominance pattern concurs

with that of the Indian Rotifera (Sharma & Sharma 2017)

©ZFMK

10 Bhushan Kumar Sharma & Sumita Sharma

but differs from the composition of NEI rotifers partic-

ularly with regards Brachionidae. The latter is interest-

ingly notable for the highest richness (33 species) known

from any state of India which even exceeds our report

of maximum diversity of 32 species from Assam state

of NEI (Sharma & Sharma 2014b). In fact, our collec-

tions indicate ~72% and ~92% of the brachionid species

known till date from India and NEI, respectively. This

feature is attributed to Brachionus richness (17 species),

the record number of eight species of Kerate/la out of 11

species of the brachionid genus known from India (Shar-

ma & Sharma 2014b) and three species of Notholca.

Overall richness importance of Brachionidae as well as

Brachionus spp. marks a salient departure than the rela-

tive paucity of these taxa indicated from the states of Me-

ghalaya (Sharma & Sharma 1999; Sharma unpublished),

Mizoram (Sharma & Sharma 2015), Nagaland (Sharma

et al. 2017) and Manipur (Sharma & Sharma 2018) of

NEI.

Lecane (45 species) > Trichocerca (19 species) >

Lepadella (18 species) are species-rich genera while

Brachionus (17 species) also deserves attention. The

collective role of first three genera (~48 % of S) assigns

the littoral-periphytic character to the rotifer fauna of

Arunachal Pradesh. The richness importance of Lecane,

Trichocerca and Lepadella endorses possibility of rules

for composition of the periphytic rotifer assemblages as

hypothesized by Green (2003) and affirmed by the re-

ports of Sharma (2014), Sharma & Sharma (2014a, 2015,

2017, 2018) and Sharma et al. (2018). The richness of

Testudinella, Colurella, Cephalodella and Mytilina, and

even several non-planktonic brachionids as well as the

paucity of the planktonic genera Hexarthra and Filinia,

and lack of Conochilus species in particular endorse our

remarks on the littoral-periphytic nature of Rotifera of

Arunachal Pradesh. The rotifer fauna indicates a number

of small-sized species of Colurella, Lecane, Lepadella

and Trichocerca concurrent with the reports of Sharma

(2005, 2014), Sharma & Sharma (2014a, 2015, 2018a,

2018b); this feature is hypothesized to predation influ-

ence of juvenile fish and invertebrates (Baumgartner et

al. 1997). Though morphological variability is inherent

in all natural populations of metazoans, the extant of

variations noted in Brachionus angularis, B. bidentatus,

B. caudatus, Lecane bulla, L. curvicornis, L. hamata,

L. leontina, L. luna, L. lunaris, L. ludwigii, L. papuana,

L. quadridentata, L. signifera, L. unguitata, L. ungulata,

Lepadella costatoides, L. ovalis, L. patella, Testudinella

emarginula, T: patina, T: tridentata and Plationus patulus

populations from Arunachal Pradesh needs attention for

cryptic diversity analysis.

Segers (2001) remarked on the role of thermophiles

in the rotifer fauna of Southeast Asia while Sharma &

Sharma (2005, 2008, 2014a, 2015, 2017, 2018a) extend-

ed this generalization to the rotifer assemblages of India.

Our collections from Arunachal Pradesh highlight overall

Bonn zoological Bulletin 68 (1): 1-12

importance of species of the ‘tropic-centered’ Lecane and

Brachionus and particularly in water bodies at lower al-

titudes, while species of ‘temperate-centered’ Keratella,

Notholca and Synchaeta are notable in collections from

middle and higher altitudes with the notable reports of

‘cold-water’ K. serrulata, Notholca acuminata, N. labis

and N. squamula in particular from the eastern Himala-

yas. Intensive future collections from middle and high-

er reaches of Arunachal Pradesh are likely to add more

species of the second category. The rotifer fauna of the

eastern Himalayas shows a combination of ‘tropical’ and

‘cold-water’ elements and thus marks a distinct departure

from other states of NEI (Sharma & Sharma 2014a, 2015,

2017) except the Sikkim Himalayas which is yet nearly

un-explored. Further, cosmopolitan species form a notable

fraction (~64%) of the rotifer assemblages in our collec-

tions while tropical and subtropical species comprise 18%

of total richness; overall importance of the stated taxa en-

dorses the reports of Sharma & Sharma (2014a, 2017).

To sum up, the rich and diverse Rotifera assemblage

of the eastern Himalayas observed vide this study is hy-

pothesized to function of habitat heterogeneity which, in

turn, highlights overall biodiverse nature of small lentic

biotopes of Arunachal Pradesh located under different

ecological regimes. The reports of several new records;

notable fraction of species of global and regional bio-

geographic interest, the littoral-periphytic nature of the

rotifer fauna, several small-sized species, the mixture of

‘tropical and temperate’ elements, and high richness of

Brachionidae elements are notable features. This study

marks a significant contribution to biodiversity and bio-

geography of the Indian and Asian Rotifera and that of

the eastern Himalayas in particular. Our collections are

yet biased towards planktonic and semi-planktonic taxa

and thus specific analysis of sessile, colonial and benthic

taxa, and of cryptic diversity in certain species-groups

merit interest for future Rotifera biodiversity update of

the eastern Himalayas.

Acknowledgements. The senior author (BKS) is thankful to

the Ministry of Environment & Forests (Govt. of India) for AI-

COPTAX research project which facilitated the sampling, and to

Messer’s J. Mali and N. Noroh for the field collections. Thanks

are due to the Head, Department of Zoology, North-Eastern

Hill University, Shillong for laboratory facilities. We thank

our anonymous peers for valuable comments and Dr. Bernhard

Huber (Bonn zoological Bulletin) for useful suggestions during

the peer review. The authors have no conflict of interests.

REFERENCES

Arora J, Mehra NK (2003) Species diversity of planktonic and

epiphytic rotifers in the backwaters of the Delhi segment of

the Yamuna River, with remarks on new records from India.

Zoological Studies 42 (2): 239-247

Baumgartner G, Nakataki KM, Cavicchiolo M, Baugartner

MS (1997) Some aspects of the ecology of fish larvae in the

©ZFMK

The biodiverse rotifer assemblages (Rotifera: Eurotatoria) of Arunachal Pradesh, the eastern Himalayas 1]

floodplain of the high Parana river, Brazil. Review Brazilian

Zoology 14: 551-563

Chandra K, Gopi KC, Rao DV, Valarmathi K, Alfred JRB (eds)

(2018) Current status of freshwater faunal diversity in India.

Zoological Survey of India, Kolkata

Fontaneto D, Marcia Barbosa A, Segers H, Pautasso M (2012)

The ‘rotiferologist’ effect and the other global correlates of

species richness in rotifers. Ecography 35: 174-182

Green J (2003) Associations of planktonic and periphytic roti-

fers in a tropical swamp, the Okavango Delta, Southern A fri-

ca. Hydrobiologia 490: 197—209

Jersabek CD, Leitner MF (2013) The Rotifer World Catalog.

World Wide Web electronic publication. http://www.rotifera.

hausdernatur.at/accessed {17.07.2018}

Koste W (1978) Rotatoria. Die Radertiere Mitteleuropas, be-

griindet von Max Voigt. Uberordnung Monogononta. Gebrii-

der Borntaeger, Berlin, Stuttgart. I. 673 pp U. II. Tafelbd. (T.

234)

Koste W, Shiel RJ (1987) Rotifera from Australian inland

waters. II. Epiphanidae and Brachionidae (Rotifera: Mono-

gononta). Invertebrate Taxonomy 7: 949-1021

Koste W, Shiel RJ (1989) Rotifera from Australian inland wa-

ters. IV. Colurellidae (Rotifera: Monogononta). Transactions

of the Royal Society of South Australia 113: 119-143

Koste W, Shiel RJ (1990) Rotifera from Australian inland wa-

ters V. Lecanidae (Rotifera: Monogononta). Transactions of

the Royal Society of South Australia 114 (1): 1-36

Mani MS (1974) Biogeographical evolution in India, In: Mani

MS (ed.) Ecology and Biogeography in India. Dr. W. Junk

b.v. Publishers, The Hague. pp. 698—724

Nayar CKG (1968) Rotifers fauna of Rajasthan, India. Hydro-

biologia 31 (2): 168-185

Ranga Reddy Y (2013) Neodiaptomus prateek n. sp., a new

freshwater copepod from Assam, India, with critical review

of generic assignment of Neodiaptomus spp. and a note on di-

aptomid species richness (Calanoida: Diaptomidae). Journal

of Crustacean Biology 33 (6): 849-865

Sa-Ardrit P. Pholpunthin P. Segers H (2013) A checklist of the

freshwater rotifer fauna of Thailand (Rotifera, Monogononta,

Bdelloidea). Journal of Limnology 72 (2): 361-375

Sarma SSS (1988) New records of fresh water rotifers (Rotif-

era) from Indian waters. Hydrobiologia 160: 263-269

Segers H (1993) Rotifera of some lakes in the floodplain of the

river Niger (Imo State, Nigeria). I. New species and other

taxonomic considerations. Hydrobiologia 250: 39-61

Segers H (1995) Rotifera 2: Lecanidae. 6. pp: 1-226. In: Du-

mont HJ, Nogrady T (eds) Guides to identification of the Mi-

croinvertebrates of the Continental waters of the world. SPB

Academic Publishing. Amsterdam, the Netherlands.

Segers H (2001) Zoogeography of the Southeast Asian Rotifera.

Hydrobiologia 446/447: 233-246

Segers H (2003) A biogeographical analysis of rotifers of the ge-

nus Trichocerca Lamarck, 1801 (Trichocercidae, Monogon-

onta, Rotifera), with notes on taxonomy. Hydrobiologia 500:

103-114

Segers H (2007) Annotated checklist of the rotifers (Phylum

Rotifera), with notes on nomenclature, taxonomy and distri-

bution. Zootaxa 1564: 1-104

Sharma BK (1983) The Indian species of the genus Brachionus

(Eurotatoria: Monogononta: Brachionidae). Hydrobiologia

104: 31-39

Sharma BK (1987) Indian Brachionidae (Eurotatoria: Mono-

gononta) and their distribution. Hydrobiologia 144: 269-275

Bonn zoological Bulletin 68 (1): 1-12

Sharma BK (1998) Freshwater Rotifers (Rotifera: Eurotatoria).

In: Fauna of West Bengal. State Fauna Series 3 (11): 341-

461. Zoological Survey of India, Calcutta.

Sharma BK (2005) Rotifer communities of floodplain lakes of

the Brahmaputra basin of lower Assam (N. E. India): biodi-

versity, distribution and ecology. Hydrobiologia 533: 209-—

Sharma BK (2014) Rotifers (Rotifera: Eurotatoria) from wet-

lands of Majuli — the largest river island, the Brahmaputra

river basin of upper Assam, northeast India. Check List 10

(2): 292-298

Sharma BK, Khan SI, Sharma S (2018) Biodiverse rotifer as-

semblage (Rotifera: Eurotatoria) of floodplain lakes of the

Brahmaputra basin of lower Assam, northeast India: compo-

sition and ecosystem diversity. Journal of Oceanology and

Limnology 36 (2): 362-375

Sharma BK, Kensibo (2017) Rotifer assemblages (Rotifera:

Eurotatoria) of two wetlands of Nagaland, northeast India:

ecosystem diversity and interesting features. International

Journal of Fisheries and Aquatic Studies 5 (2): 609-617

Sharma BK, Kensibo, Sharma S (2017) Biodiversity of roti-

fers (Rotifera: Eurotatoria) of Nagaland, northeast India;

richness, composition and ecosystem diversity. International

Journal of Fisheries and Aquatic Studies 5 (5): 180-187

Sharma BK, Raghunathan C, Sharma S (2017) Rich freshwater

Rotifer (Rotifera: Eurotatoria) fauna of small lentic ecosys-

tems of south Andaman, India. Opuscula Zoologica, Buda-

pest 48 (2): 185-192

Sharma BK, Sharma S (1999) Freshwater Rotifers (Rotifera:

Eurotatoria). In: Fauna of Meghalaya. State Fauna Series

4(9): 11-161. Zoological Survey of India, Calcutta

Sharma BK, Sharma S (2000). Freshwater Rotifers (Rotifera:

Eurotatoria). In: Fauna of Tripura: State Fauna Series 7 (4):

163-224. Zoological Survey of India, Calcutta

Sharma BK, Sharma S (2005) Biodiversity of freshwater roti-

fers (Rotifera: Eurotatoria) from North-Eastern India. Mit-

teilungen aus dem Museum fiir Naturkunde Berlin, Zoolo-

gische Reihe 81: 81-88

Sharma BK, Sharma S (2014a) Northeast India — An important

region with a rich biodiversity of Rotifera. In: Sharma BK,

Dumont HJ, Wallace RL (eds) Rotifera XII: Rotifer Biology

— A structural and functional Approach. International Review

of Hydrobiology 99 (1-2): 20-37

Sharma BK, Sharma S (2014b) The diversity of Indian Bra-

chionidae (Rotifera: Eurotatoria: Monogononta) and their

distribution Opuscula Zoologica, Budapest 45(2):165—180

Sharma BK, Sharma S (2015) Biodiversity of freshwater ro-

tifers (Rotifera: Eurotatoria) of Mizoram, Northeast India:

composition, new records and interesting features. Interna-

tional Journal of Aquatic Biology 3 (5): 301-313

Sharma BK, Sharma S (2017) Rotifera: Eurotatoria (Rotifers).

Chapter 7: 93-113. In: Kailash Chandra, Gopi KC, Rao DV,

Valarmathi K, Alfred JRB (eds) Current status of freshwater

faunal diversity in India. Zoological Survey of India, Kolkata

Sharma BK, Sharma S (2018a) Loktak Lake, Manipur revisited:

A Ramsar site as the rotifer (Rotifera: Eurotatoria) biodiver-

sity hot-spot of the Indian sub-region. Bonn zoological Bul-

letin 67 (1): 5-13.

Sharma BK, Sharma S (2018b) The rotifers (Rotifera: Eurota-

toria) from the Kashmir Himalayan floodplains and Rotifera

biodiversity of Jammu & Kashmir, north India. International

Journal of Aquatic Biology 6 (4): 208-220.

Sharma S, Sharma BK (2008) Zooplankton diversity in flood-

plain lakes of Assam. Records of the Zoological Survey of In-

dia, Occasional Paper No. 290: 1-307

©ZFMK

12 Bhushan Kumar Sharma & Sumita Sharma

Sharma S, Sharma BK (2013) Faunal diversity of aquatic in-

vertebrates of Deepor Beel (a Ramsar site), Assam, northeast

India. Wetland Ecosystem Series, 17: 1-226

Shiel RJ, Koste W (1992) Rotifera from Australian inland wa-

ters VIII. Trichocercidae (Monogononta). Transactions of

Royal Society of South Australia 116 (1): 1-27

Shiel RJ, Koste W (1993) Rotifera from Australian inland wa-

ters. IX. Gastropodidae, Synchaetidae, Asplanchnidae (Roti-

fera: Monogononta). Transactions of Royal Society of South

Australia 117 (1): 111-139

Bonn zoological Bulletin 68 (1): 1-12

Sinha B (2018) Status of studies on zooplankton fauna of

Arunachal Pradesh, India. Journal of Threatened Taxa 10

(11): 12552-12560

Sorensen T (1948) A method of establishing group of equal am-

plitude in plant sociology based on similarity of species con-

tent and its application to analyse the vegetation of Danish

Commons. Biologiske Skrifter 5: 1-34

Talling JF, Talling IB (1965) The chemical composition of Af-

rican lake waters. Internationale Revue der gesamten Hydro-

biologie 50: 421-463

©ZFMK

Bonn zoological Bulletin 68 (1): 13-19

2019 - Ntoungwa Ebague G.M. et al.

https://doi.org/10.20363/BZB-2019.68.1.013

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:|sid:zoobank.org:pub: D3C8DAAF-4F7A-4BB4-97A 1 -384C6E3D889D

Terrestrial small mammal assemblage from pellets of three sympatric owl

species in the Mount Oku area (Northwest Cameroon), with implications for

conservation

Guy Martial Ntoungwa Ebague’, Alain Didier Missoup”*, Ernest Keming Chung’,

Maurice Tindo* & Christiane Denys*

' 2.4 Zoology Unit, Laboratory of Biology and Physiology of Animal Organisms, Faculty of Science, University of Douala,

POBox 24157 Douala, Cameroon

3Kilum-Ijim Forest Project, PO Box: 119, Kumbo, Cameroon

> Institut de Systématique, Evolution, Biodiversité, ISYEB —UMR 7205 — CNRS, MNHN, UPMC, EPHE,

Muséum National d’Histoire Naturelle, Sorbonne Universités, F-Paris, France

* Corresponding author: Email: admissoup@ymail.com, ORCID: http://orcid.org/0000-0002-3018-9188

'urn:Isid:zoobank. org: author: 80FEO7CD-3F95-47C7-8B4B-A A7C5D03AC64

7urn:|sid:zoobank. org:author:946A07D5-4A F2-453A-A579-7D22D0092E3B

>urn:lsid:zoobank. org:author:27FD377D-34EC-4634-A 5 10-DF279254191C

“urn:|sid:zoobank.org:author:4BF 1 8523-4634-4A 8D-A8CF-2A4A A 85DBD33

>urn:|sid:zoobank.org:author:FCD37439-1E9D-4FD2-A 845-E311603D45EF

Abstract. Mount Oku is well known for its exceptional species diversity for both animals and plants. A total number of

27 species of rodents and six species of shrews are reported from the area. Ten of these species are endemic at local or

regional level and are considered as endangered or vulnerable, with a decreasing population trend. They are thus conside-

red as having a high conservation importance. We sampled terrestrial small mammals from owl pellets during a period of

22 months in different areas near the village Oku, in order to assess the importance of these taxa in the diet of owl species

present in the area. The 236 pellets attributed to three sympatric owl species (Barn owl, Tyto alba, the African wood owl,

Strix woodfordii, Northern white-faced owl, Ptilopsis leucotis), yielded a total number of 543 specimens of rodents and

shrews, belonging to 22 species (16 species of rodents and six species of shrews). They represented respectively 69.06%

and 30.94% of the total assemblage, the species Dasymys sp., with a final score of 18.23%, having the highest relative

abundance. Of the ten species with a high conservation importance, only Lemniscomys mittendorfi was missing. All

constituted about 27.62% of all specimens collected, with a relative abundance of 4.23% for species strictly restricted to

Mount Oku. This study confirms the position of Mount Oku as an important conservation area for rodents and shrews,

and highlights the evidence that terrestrial small mammal predation by owls cannot be considered a threat to species of

conservation concern at Mount Oku.

Key words. Mount Oku, owl pellets, rodents, shrews, owls, conservation.

INTRODUCTION

The montane forests of the Cameroon Highlands’ re-

gion are considered as priority conservation areas at a

global scale (Oates et al. 2004) and are one of the most

important centres of endemism on the African continent

(Zimkus & Gvozdik 2013). The Kilum-Ijim forest in the

massif of Mount Oku (3100 m asl), the second highest

mountain after Mount Cameroon, is relatively well-stud-

ied for many taxa including animals and plants (Cheek

et al. 2000; Doherty-Bones & Gvozdik 2017; Ineich et

al. 2015; Momo 2017). It represents the largest remain-

ing part of afromontane forest in West Africa (Cheek et

al. 2000). Several studies have been carried out on small

mammals of Mount Oku, most of them using trapping

Received: 15.01.2019

Accepted: 24.01.2019

methods, which enabled the publication of an updated list

of 27 species of rodents (24 terrestrial and three arboreal)

and six species of shrews (Maisels et al. 2001; Denys et

al. 2014).

It has been recently demonstrated that the use of owl

pellets is amore effective alternative to conventional trap-

ping for broad-scale studies of small mammals’ commu-

nities (Heisler et al. 2016). However, very little attention

has been focussed on the study of small mammal commu-

nities using owl pellets in tropical Africa. Indeed, most

of data available are from the northern part of the conti-

nent, mainly from the country Algeria (Baziz et al. 2002,

2005; Sekour et al. 2010, 2011, 2014; Alia et al. 2012;

Hadjoudj et al. 2012; Idouhar-Saadi et al. 2014; Tergou

et al. 2014; Souttou et al. 2015; Bounaceur et al. 2016;

Corresponding editor: J. Decher

Published: 30.01.2019

14 Guy Martial Ntoungwa Ebague et al.

Djilali et al. 2016; Ouarab & Doumandyji 2017); few are

from Morocco (Rihane et al. 2015), Tunisia (Leonardi &

Del-Arte 2006) and Egypt (Sandor & Moldovan 2012).

For tropical Africa, some studies were made in the South

African region, including the countries Malawi (Hap-

pold & Happold 1986; Ngonda 1991; Denys et al. 1999),

Botswana (Denys 1985) and South Africa (Grindley et al.

1973; Dean & Dowsett 1986; Mendelsohn 1989; Avery

1992; Avery et al. 2005). The few data available for West

Africa are mainly from Senegal (Ba et al. 2000; Thiam

et al. 2008), Mauritania (Bruderer & Denys 1999) and

Nigeria (Lekunze et al. 2001). Previous works in the East

African region include the two countries Ethiopia (De-

meter 1982) and Tanzania (Andrews 1990). In Central

Africa, only one study from the area of Bambilli (NW

Cameroon), based on the diet of the African grass owl

(Tyto capensis) and the spotted eagle owl (Bubo afri-

canus) is known from the literature (Riegert et al. 2007).

However, Denys et al. (2014) used owl pellets collected

by O. Filling in 1990 and 1991 in the lake Oku cave

and for the first time verified the presence of Mylomys

dybowskii at Oku.

Of the 27 species of rodents reported from Mount Oku

(Denys et al. 2014), four are known as strictly endem-

ic (Lamottemys okuensis, Hylomyscus grandis, Lophu-

romys dieterleni and Lemniscomys mittendorfi) to the

mountain, and three others (Praomys hartwigi, Hybomys

eisentrauti and Otomys occidentalis) have a distribu-

tion range that is limited to the Banso-Bamenda High-

lands. Two of the six species of shrews reported from

Oku (Myosorex okuensis and Sylvisorex camerunensis)

6,25321 N

o study area

Fig. 1. Map showing the location of the study area.

Bonn zoological Bulletin 68 (1): 13-19

are restricted to the Banso-Bamenda Highlands and one

(Sy/visorex isabella) extends to the southern part of Cam-

eroon Highlands in Bioko. All these species are consid-

ered as endangered or vulnerable on the IUCN Red List,

with a decreasing population trend (IUCN 2016). Mount

Oku is thus an important area for the conservation of ter-

restrial small mammals. The effect of owl predation on

small mammal populations’ abundance has already been

reported and their importance in rodent pest species man-

agement has been repeatedly highlighted (Baleiauskiene

2005; Previtali et al. 2009; Sekour et al. 2014), suggest-

ing a possible influence on rodent population dynamics

at the local level. From 2015 to 2016 we conducted op-

portunistic sampling of pellets in areas near the village

Oku, from 2000 up to 2900 m asl, in order to assess the

importance of species with high conservation value in the

diet of owl species present in the area. This paper reports

data on small mammal assemblages sampled from three

owl species (Barn owl, Zyto alba, the African wood owl,

Strix woodfordii, and the Northern white-faced owl, Pti-

lopsis leucotis), with an emphasis on the conservation of

rodent species endemic to Mount Oku or to the whole

Banso-Bamenda Highland region.

MATERIAL & METHODS

Study area

Belonging to Banso-Bamenda Highlands within the

Cameroon Highlands’ region, Mount Oku (Fig. 1) is

- Oku village

Kilum-ljim forest

Lake Oku

©ZFMK

Terrestrial small mammal assemblage from pellets of three sympatric owl species in the Mount Oku area (NW Cameroon) 15

covered by a small montane forest, the Kilum Ijim forest

massif which extends from 2200 m to 2800 m asl (Mais-

els et al. 2001). It is dominated by Carapa grandiflora

(Meliaceae), Nuxia congesta (Loganiaceae), Syzygium

staudtii (Myrtaceae) and Arundinaria alpina (Poaceae).

An afroalpine vegetation is found from 2800 m up to the

summit (3011 m), and mostly constitutes of the grass

species Gnidia glauca, Hypericum revolutum and Erica

mannii (Momo 2017). Lower altitudes (below 2200 m

asl) are widely used for agriculture. The Oku village is

situated at about 2000 m asl in Mount Oku, close to the

Kilum forest. Mount Oku is dominated by equatorial

climate, characterised by a wet season of seven to eight

months and a dry season of four to five months; months

of August and March being respectively the most wet

and dry. The average annual rainfall is about 2427 mm

and the temperature ranges between about 10 °C and

25-28 °C (Forboseh & Ikfuingei 2001).

Owl pellet sampling

From March 2015 to December 2016, opportunistic

sampling of pellets (97 complete and about 139 dam-

aged) was done in different habitats near the village Oku

(6°24’ N—10°50’ E), including montane forests, montane

grasslands and crop plantations. The sampling was done

between 2000 m and 2900 m asl. On each occasion, the

samples collected were kept together in a dry plastic bag.

They were later attributed to three owl species known

from the area, the Barn owl (7yto alba), the African wood

owl (Strix woodfordii), and the Northern white-faced owl

(Ptilopsis leucotis), based on direct observations and

feather remains, following the field guide by Borrow &

Demey (2008).

Owl pellet treatment and small mammal species iden-

tification

In the laboratory, each pellet was softened in hot wa-

ter during five to ten minutes and disinfected later in a

10% diluted solution of chlorinated water. Pellets were

then opened and the bones were cleaned using a pair of

forceps. After rinsing with water and drying, skulls and

other remaining bones were placed in separate tubes for

further observations.

Species identifications of rodents and shrews were

mostly based on the mandibles, the upper molar row

and skull morphology, following the criteria provided

in Denys et al. (2014) as well as reference collections

housed at the MNHN. We also followed identification

keys of Monadjem et al. (2015). For shrews, we also

used cranio-dental characters, and followed character

descriptions reported in Heim de Balsac (1968, 1975),

Meester & Setzer (1971) and Hutterer & Happold (1983).

In two cases (rodents and shrews), morphological char-

acters of teeth were checked by using a Pierron® binocu-

Bonn zoological Bulletin 68 (1): 13-19

lar magnifier at 10x. All specimens are currently housed

at the Zoology Unit of the Laboratory of Biology and

Physiology of Animal Organisms, Faculty of Science,

University Douala.

Small mammal relative abundance estimates

As skulls were not present in all pellets collected, the

total number of small mammals was estimated in each

pellet based on a tally of paired mandibles as proposed

by Bueno & Motta-Junior (2008). After pairing, unpaired

mandibles were counted as additional individuals. The

same approach was also used to evaluate the total num-

ber of individuals in the whole sample, and finally for an

estimation of the relative abundance.

RESULTS

The entire sample examined yielded a total number of

543 specimens of rodents (Order Rodentia) and shrews

(Order Soricomorpha), belonging to 22 species, 18 gen-

era and three families (Table 1). Rodents were repre-

sented by 16 species from 14 genera and two families.

Shrews included six species belonging to four genera

and one family. Rodents represented 69.06% of the small

mammal assemblage, while shrews constituted 30.94%

of the entire sample. The Shaggy rat (Dasymys sp.) was

the most abundant species found (18.23%), followed by

the Hun shrew (Crocidura attila Dollman, 1915), with

12.34% of the total assemblage. The less represented

species of our sample were the Mount Oku Hylomyscus,

Hylomyscus grandis Eisentraut, 1969 (0.55%), the Roof

rat, Rattus rattus (Linnaeus, 1758) and the Mount Oku

rat, Lamottemys okuensis Petter, 1986 (each with 1.1 %).

Of the ten species with a high conservation importance,

only one species, Lemniscomys mittendorfi, was missing.

The nine other species represented together a total num-

ber of 150 specimens, out of the 543 individuals counted,

corresponding to a relative abundance of about 27.62%.

From the whole sample, the relative abundance of each

of these species varied from 0.55% (three specimens of

Hylomyscus grandis) to 7.18% (33 individuals of Otomys

occidentalis).

DISCUSSION

With a total number of 236 pellets collected in the study

area, our sample represents important material, which

can help to complement our knowledge on small mam-

mal diversity from the Oku area. Of the 543 specimens

counted from the pellets, 22 species of terrestrial small

mammals, including 16 species of rodents and six spe-

cies of shrews were finally identified. All of these newly

©ZFMK

16 Guy Martial Ntoungwa Ebague et al.

Table 1. Relative abundance (RA) of rodent and shrew species found in owl pellets collected in Oku (N: Number of specimens).

collected species of rodents were previously sampled at

Oku (Eisentraut 1968, 1969; Bowden 1986; Hutterer &

Fulling 1994; Maisels et al. 2001; Denys et al. 2014),

as well as the six species of shrews found in our sample

(Maisels et al. 2001). Of the 24 species of terrestrial ro-

dents reported by Denys et al. (2014), eight were missing

from our sample. Some of these taxa are known by only a

low number of specimens from Oku (H. alleni cf. montis,

H. walterverheyeni, Lemniscomys mittendorfi, Mylomys

dybowskii, Gerbilliscus kempi). The others are members

of genera currently under revision, in which the identi-

fication solely using morphology is not obvious (Gram-

momys sp., L. sikapusi). Moreover, species of the genus

Cricetomys, with a mean weight of 500 grams (Monad-

Bonn zoological Bulletin 68 (1): 13-19

Orders Subfamilies Species N RA

Rodentia Dendromurinae | Dendromus sp. 13- | 2.39

Muridae Deomyinae Lophuromys dieterleni Verheyen, Hulselmans, Colyn & Hut-

terer, 1997 14 | 2.58

Murinae Dasymys sp. 99 | 18.23

Grammomys poensis Eisentraut, 1965 1.47

Hybomys rufocanus (Tulberg, 1893) 1.29

Hylomyscus grandis Eisentraut, 1969 0.55

Lamottemys okuensis Petter, 1986 1.10

Lemniscomys striatus (Linnaeus, 1758) 29 | 5.34

Mastomys sp. 36 | 6.63

Mus musculus Linnaeus, 1758 11 | 2.03

Mus setulosus Peters, 1876 19 | 3.50

Mus sp. 22 | 4.05

Oenomys hypoxanthus Eisentraut, 1968 9 1.66

Otomys occidentalis Dieterlen & Van der Straeten, 1992 39 | 7.18

Praomys hartwigi Eisentraut, 1968 22 | 4.05

Praomys jacksoni (de Winton, 1897) 19 | 3.50

Rattus rattus Linnaeus, 1758 6 1.10

Undetermined murines 13, #2339

Total Rodents 375 | 69.06

Soricomorpha | Soricidae Crocidurinae Crocidura attila Dollman, 1915 67 | 12.34

Crocidura olivieri Lesson, 1827 15 | 2.76

Suncus megalura Jentink, 1888 16! | 2295

Sylvisorex camerunensis Heim de Balsac, 1968 14 | 2.58

Sylvisorex isabellae Heim de Balsac, 1968 10 | 1.84

Myosoricinae | Myosorex okuensis Heim de Balsac, 1968 35 | 6.45

Undetermined shrews 11 | 2.03

Total Shrews 168 | 30.94

Total general 543 | 100

jem et al. 2015) are likely not suitable prey in the diet of

the three species of owls involved tn this study.

The predominance of rodents, compared to shrews, in

small mammal assemblages using owl pellets has been

previously reported from different areas of the African

continent (Demeter 1982; Dean & Dowsett 1986; Men-

delsohn 1989; Ngonda 1991; Riegert et al. 2007; San-

dor & Moldovan 2010; Hadjoudj et al. 2011; Alia et al.,

2012; Sekour et al. 2014; Ouarab & Doumandji 2017).

However, some studies documented the abundance of

birds (Hamani et al. 2011), amphibians (Tergou et al.

2014) or insects (Doumandji et al. 1997). With pellets of

the African grass owl, Riegert et al. (2007) reported more

shrew specimens (about 70.41% of the total prey items),

compared to rodents. Data from other areas also suggest-

©ZFMK

Terrestrial small mammal assemblage from pellets of three sympatric owl species in the Mount Oku area (NW Cameroon) 17

ed an abundance of shrew items in the diet of 7Zyto alba

(Love et al. 2000; Mahmood-Ul-Hassan et al. 2007).

Many studies have highlighted the evidence of a seasonal

variation in the diet composition of different owl species

(Bose & Guidali, 2000; Mahmood-UlI-Hassan et al. 2007;

Sekour et al. 2011). Other works suggested the existence

of a shift in the trophic habits of these birds, depending

on prey availability (Bueno & Motta-Junior 2008; San-

dor & Moldovan, 2010). In this study, we used specimens

collected from pellets from a period of 22 months, sug-

gesting that we report here a general trend in the preda-

tion of small mammals by owls at Oku. In Bambili, less

than 50 km from Oku, Riegert et al. (2007) reported a

dominance of Dasymys (with about 27% of rodent and

shrew samples), Otomys occidentalis (15%) and Masto-

mys sp. (12%) specimens in the diet of the Spotted eagle

owl, which ts very close to our findings.

Our study confirms the presence of nearly all the spe-

cies with a high conservation importance at Oku, except

Lemniscomys mittendorfi. All represented about 27.62%

of the total small mammal assemblage. The three spe-

cies Lamottemys okuensis (1.10%), Hylomyscus grandis

(0.55%) and Lophuromys dieterleni (2.58%), that are re-

stricted to Oku, together constituted only 4.23% of all

the specimens identified. Using both Sherman, snap and

traditional traps, specimens of Lamottemys okuensis rep-

resented about 18.66% of all the rodents trapped (Denys

et al. 2014). Thus, the abundance of this species as re-

vealed by owl pellets is not representative of its popu-

lation size in the study area. Otherwise, from our final

sample of species with high conservation importance, the

three taxa having a high abundance, Otomys occidentalis

(7.18%), Myosorex okuensis (6.45%), Praomys hartwi-

gi (4.05%), are widely distributed in the whole area of

the Banso-Bamenda highlands. Riegert et al. (2007) ob-

tained between 2.0% (Myosorex okuensis) and 11.4%

(Otomys occidentalis) of total prey items in their study.

All these findings together highlight the fact that (1) ter-

restrial small mammal species with high conservation

importance do not constitute the main diet of owl species

in the Oku area, (11) those with a predation rate that can

be considered as relatively high (eg. Otomys occidenta-

lis. from 3.0 to 11.4% depending on the owl species) are

widely distributed in Banso-Bamenda Highlands, sug-

gesting a lower pressure at the level of their entire area

of distribution. In conclusion, terrestrial small mammal

predation by owls cannot be considered a threat to their

conservation at Mount Oku. Many other threats, mainly

relating to high human pressure on natural environments

of Mount Oku have been reported before, with a partic-

ular emphasis on local rodent trapping levels (Denys et

al. 2014; Maisels et al. 2001). With nine of the ten small

mammal species having a high conservation importance,

this study confirms the place of Mount Oku as an import-

ant conservation area for rodents and shrews.

Bonn zoological Bulletin 68 (1): 13-19

Acknowledgments. The authors would like to express their

gratitude to local people of Oku that helped for pellets sampling

during the study period. They are also grateful to authorities of

the University of Douala for the deliverance of a research cer-

tificate to G.M. Ntoungwa Ebague (Ref. LBPOA/05/2015), as

part of its PhD project, and for the specimen transportation cer-

tificate delivered to A.D. Missoup (Ref. LBPOA/01/2018) that

was used to export specimens at the MNHN in Paris in March

2018. The authors would finally like to thank the reviewers who

improved the earlier draft of this manuscript.

REFERENCES

Alia Z, Sekour M, Ould El Hadj MD (2012) Importance des

rongeurs dans le menu trophique de Zyto alba (Scopoli,

1759) dans la région de Souf (Algérie). Revue des BioRes-

sources 2 (2): 37-47

Andrews P (1990) Owl, Caves and Fossils. Natural History

Museum publications, London, 231 pp.

Avery DM (1992) Ecological data on micromammals collect-

ed by Barn owls 7yto alba in the West Coast National Park,

South Africa. Israel Journal of Zoology 38: 385-397

Avery DM, Avery G, Palmer NG (2005) Micromammalian dis-

tribution and abundance in the Western Cape Province, South

Africa, as evidenced by Barn owls 7yto alba (Scopoli). Jour-

nal of Natural History 39 (22): 2047-2071

Ba K, Granjon L, Hutterer R, Duplantier J-M (2000) Les micro-

mammiféres du Djoudj (delta du Sénégal) par l’analyse du

régime alimentaire de la chouette effraie, Zyto alba. Bonner

Zoologische Beitrdge 49: 31-38

Balciauskiené L, Jovaidas A, Narudevieius V, Petradka A, Sku-

ja S (2006) Diet of tawny owl (Strix aluco) and long-eared

owl (Asio otus) in Lithuania as found from pellet. Acta Zoo-

logica Lituanica 16 (1): 37-45

Baziz B, Doumandji S, Denys C, Khemici M (2002) Répartition

en Algérie du Pachyure étrusque Suncus etruscus (Insectivo-

ra, Soricidae). Premiere observation dans le Nord-Est du

Sahara, a Biskra. Mammalia 66: 133-137

Baziz B, Sekour M, Doumandji S, Denys C, Metref S, Bendja-

ballah S, Nadji FZ (2005) Données sur le régime alimentaire

de la Chouette chevéche (Athene noctua) en Algérie. Aves 42

(1-2): 149-157

Bounaceur F, Bissaad FZ, Marniche F, Boutheldja H, Abaiter

N, Khellil K, Saad A (2016) Ecologie trophique du hibou

grand-duc du désert Bubo ascalaphus (Savigny, 1809) dans

la région de I’Ahaggar, sud algérien. Revue Ivoirienne des

Sciences Technologiques 27: 175-189

Borrow N, Demey R (2008) Guide des Oiseaux de I’ Afrique de

l’Ouest. Paris, France.

Bose M, Guidali F (2001) Seasonal and geographic differences

in the diet of the barn owl in an agro-ecosystem in northern

Italy. Journal of Raptor Research 35 (3): 240-246

Bowden, C. G. R. (1986) Small mammal research in western

Cameroon. Pp 196-200 in Stuart S (ed.) Conservation of

Cameroon Montane Forests. International Council for Bird

Preservation, Cambridge.

Bruderer C, Denys C (1999) Inventaire taxonomique et tapho-

nomique d’un assemblage de pelotes d’un site de nidification

de 7: alba de Mauritanie. Bonner Zoologische Beitrage 48

(3-4): 245-257

Bueno AA, Motta-Junior JC (2008) Small mammal prey selec-

tion by two owl species in southeastern Brazil. Journal of

Raptor Research 42 (4): 248-255

©ZFMK

18 Guy Martial Ntoungwa Ebague et al.

Cheek M, Onana JM, Pollard BJ (2000) The plants of Mount

Oku and the Ijim Ridge, Cameroon: a conservation checklist.

Royal Botanic Gardens, Kew

Dean WRJ, Dowsett RJ (1986) A nest of the Grass-owl Tyto

capensis in the Southern Cape. Ostrich 57: 187-188

Demeter A (1982) Prey of the Spotted Eagle-Owl Bubo afri-

canus in the Awash National Park, Ethiopia. Bonner Zoolo-

gische Beitrage 33: 283-292

Denys C (1985) Nouveaux critéres de reconnaissance des con-

centrations de microvertébrés d’apres |’étude des pelotes

de chouette du Botswana (Afrique australe). Bulletin du

Muséum National d’Histoire Naturelle de Paris, Section A

(Zoologie) 7 (4): 879-933

Denys C, Chitaukali W, Mfune JK, Combrexelle M, Cacciani

F (1999) Diversity of small mammals in owl pellet assem-

blages of Karonga district, northern Malawi, Acta Zoologica

Cracoviencia 42: 393-396

Denys C, Missoup AD, Nicolas V, Filling O, Delapré A, Bilong

Bilong CF, Taylor JP, Hutterer R (2014) African highlands

as mammal diversity hotspots: new records of Lamottemys

okuensis (Rodentia: Muridae) and other endemic rodents

from Mount Oku, Cameroon. Zoosystema 36 (3): 647-690

Djilali K, Sekour M, Souttou K, Ababsa L, Guezoul O, Denys

C, Doumandji S (2016) Diet of Short-eared Owl Asio flam-

meus (Pontoppidan, 1763) in desert area at Hassi El Gara (El

Golea, Algeria), Zoology and Ecology 26 (3): 159-165

Doumandyji S, Doumandji-Mitiche B, Cisse O (1997) Régime

alimentaire de la Chouette hulotte Strix aluco Linné, 1758

(Aves, Strigidae) en milieu suburbain pres d’ Alger. Annales

de I’ Institut National Agronomique de El-Harrach 18: 1-8

Doherty-Bone TM, Gvozdik V (2017) The Amphibians of

Mount Oku, Cameroon: an updated species inventory and

conservation review. ZooKeys 643: 109-139

Eisentraut M (1969) Die tiergeographische Bedeutung des

Oku-Gebirges 1m Bamenda-Banso-Hochland (Westkame-

run). Bonner Zoologische Beitrage 19: 170-175

Eisentraut M (1969) Die Verbreitung der Muriden Gattung Hy-

lomyscus auf Fernando Poo und in Westkamerun. Zeitschrift

fur Sdugetierkunde 34: 296-307

Forboseh PK, Ikfuingei RN (2001) Estimating the population

densities of Zauraco-bannermani in the Kilum-Ijim Forests,

North Western Cameroon. Ostrich 15: 114-118

Grindley J, Siegfried WR, Vernon CJ (1973) Diet of the Barn

owl in the Cape Province. Ostrich 44: 266—267

Hadjoudj M, Manaa A, Merzouki Y, Sekour M, Doumandji S

(2011) Place des rongeurs dans le régime trophique de la

Chouette effraie 7yto alba dans la région de Touggourt. Re-

vue des BioRessources 2 (1): 33-40

Hamani A, Denys C, Doumandji S (2011) Nouvelles données

sur le régime alimentaire de la Chouette effraie Tyto alba aux

abords du barrage de Boughzoul. In: Séminaire internation-

al de protection végétale, Département de Zoologie agricole

et forestiere, Ecole Nationale Supérieure d’agronomie, El

Harrach, Algerie

Happold DCD, Happold M (1986) Small mammals of Zomba

Plateau, Malawi, as assessed by their presence in pellets of

the Grass-owl, Tyto capensis, and by live-trapping. African

Journal of Ecology 24: 77-87

Heim de Balsac H (1968) Contribution a I’ étude des Soricidae

de Fernando Po et du Cameroun. Bonner Zoologische Bei-

trage 19: 15-42

Heim de Balsac H (1975) Nouvelles données sur la faune sori-

cidienne du Cameroun. Bonner Zoologische Beitrage 26:

94-99

Bonn zoological Bulletin 68 (1): 13-19

Heisler LM, Somers CM, Poulin RG (2016) Owl pellets: a more

effective alternative to conventional trapping for broad-scale

studies of small mammal communities. Methods in Ecology

and Evolution 7: 96-103

Hutterer R, Filling O (1994) Mammal diversity in the Oku

Mountains, Cameroon. In: International Symposium on Bio-

diversity and Systematics in Tropical Ecosystems. Museum

Koenig, Bonn, Germany.

Hutterer R, Happold DCD (1983) The shrews of Nigeria (Mam-

malia: Soricidae). Bonner Zoologische Monographien 18:

1-79

Idouhar-Saadi H, Moulai R, Souttou K, Baziz-Neffah F, Smai

A, Zenia S, Doumandji S (2014) Diet comparison between

fledgling and adult tawny owl Strix aluco Linné, 1758 (Aves;

Strigidae) in suburban area of El Harrach (Algiers, Algeria).

International Journal of Zoology and Research 4 (4): 59-66

Ineich I, LeBreton M, Lhermitte-Vallarino N, Chirio L (2015)

The reptiles of the summits of Mont Oku and the Bamenda

Highlands, Cameroon. Amphibian & Reptile Conservation 9

(2): 15-38

IUCN, 2016. IUCN Red List of threatened species 2018.

HTTP://www.iucnredlist.org. Last access 22 Nov 2018

Lekunze LM, Ezealor AU, Aken’ Ova T (2001) Prey groups in

the pellets of the barn owl 7yto alba (Scopoli) in the Nigerian

savanna. African Journal of Ecology 39: 38-44

Leonardi G, Dell’ Arte GL (2006) Food habits of the Barn Owl

(Zyto alba) in a steppe area of Tunisia. Journal of Arid Envi-

ronments 65: 677-681

Love RA, Webon C, Glue DE, Harris S, Harris S (2000) Chang-

es in the food of British Barn Owls (Zyto alba) between 1974

and 1997. Mammal Review 30 (2): 107-129

Mahmood-UI-Hassan M, Beg MA, Ali H (2007) Seasonal vari-

ation in the diet of the barn owl 7yto alba stertens in central

Punjab, Pakistan. Current Zoology 53 (3): 431-436

Maisels FG, Keming E, Kemei M, Toh C (2001) The extirpa-

tion of large mammals and implications for mountain for-

est conservation: the case of Kilum-Ijim Forest, Northwest

Province, Cameroon. Oryx 35 (4): 322-331

Meester J, Setzer HW (1971) The Mammals of Africa. An Iden-

tification Manual. Smithsonian Institution Press, Washington.

Mendelsohn JM (1989) Habitat preferences, population size,

food and breeding of six owls species in the Springbok Flats,

South Africa. Ostrich 60: 183-190

Momo SMC (2017) Plant assemblages along an altitudinal gra-

dient of Mount Oku forests (Cameroon). Journal of Agricul-

ture and Ecology Research International 11 (2): 1-10

Monadjem A, Taylor PJ, Denys C, Cotterill FPD (2015) Ro-

dents of Sub-Saharan Africa: a biogeographic and taxonomic

synthesis. De Gruyter, Berlin

Ngonda JB (1991) Food Choice of the Spotted Eagle Owl

(Bubo africanus) at Kachulu. Bacheolor thesis, Chanco Col-

lege University of Malawi

Oates JF, Berg] RA, Linder JM (2004) Africa’s Gulf of Guinea

Forests: Biodiversity Patterns and Conservation Priorities.

Advances in Applied Biodiversity Science. Conservation In-

ternational, Washington D. C.

Ouarab S, Doumandji S (2017) Ecologie trophique De la chou-

ette effraie Tyto alba (Scopoli, 1769) Dans la réserve na-

turelle De la zone humide de Réghaia. Bulletin de la Société

zoologique de France 142(1): 13-28

Previtali MA, Lima M, Meserve PL, Kelt DA, Gutirrez JR

(2009) Population dynamics of two sympatric rodents in a

variable environment: rainfall, resource availability, and pre-

dation. Ecology 90 (7): 1996-2006

©ZFMK

Terrestrial small mammal assemblage from pellets of three sympatric owl species in the Mount Oku area (NW Cameroon) 19

Riegert J, Sedlacek O, Hutterer R (2007) Diet of sympatric Af-

rican grass owl (Zyto capensis) and spotted eagle owl (Bubo

africanus) in the Bamenda Highlands NW Cameroon. Afri-

can Journal of Ecology 46: 428-431

Rihane A, Lahrouz S, El Hamoumi R (2015) Etude du régime

alimentaire de la Chouette effraie Zyto alba (Strigiforme, Ty-

tonidae) dans la région de Lalla Mimouna dans la plaine du

Gharb (plaine du Maroc atlantique). Afrique Science 11 (2):

116-126

Sandor AD, Moldovan I (2010) Heading to the city. Diet se-

lection of urban breeding Desert Eagle Owls (Bubo ascala-

phus) in Hurghada, Egypt. Journal of Arid Environments 74:

1146-1148

Sekour M, Baziz B, Denys C, Doumandji S, Souttou K,

Guezoul O (2010) Régime alimentaire de la Chevéche

d’ Athena Athene noctua, de |’ Effraie des clochers Tyto alba,

du Hibou moyen-duc Asio otus et du Grand-duc Ascalaphe

Bubo ascalaphus: Réserve naturelle de Mergueb (Algérie).

Alauda 78 (2): 103-117

Sekour M, Beddiaf R, Souttou K, Guezoul O, Denys C, Dou-

mandji S (2011) Variation saisonniere du régime alimentaire

de la Chouette chevéche (Athene noctua) (Scopoli, 1769)

dans I’extréme Sud-Est du Sahara algérien (Dyanet, Algérie).

Revue Ecologique (Terre Vie) 66: 2011

Bonn zoological Bulletin 68 (1): 13-19

Sekour M, Guerzou A, Benbouzid N, Guezoul O, Ababsa L,

Denys C, Doumandji S (2014). Importance de la Mérione de

Shaw Meriones shawii au sein des composantes trophiques

de la Chouette effraie 7Zyto alba en milieux steppiques de

l’ Algérie. Comptes Rendus de Biologies 337: 405-415

Souttou K, Manaa A, Sekour M, Ababsa L, Guezoul O, Bakria

M, Doumandji S, Denys C (2015) Sélection des proies par la

chouette effraie 7yto alba et le hibou moyen-duc Asio otus

dans un milieu agricole a El Maalba (Djelfa, Algérie). Leba-

nese Science Journal 16 (2): 3-17

Tergou S, Boukhemza M, Marniche F, Milla A, Doumandji S

(2014) Dietary distinctive Features of Tawny Owl, Strix alu-

co (Linn 1758) and Barn Owl, Jyto alba (Scopoli 1759) in

Gardens of Algerian Sahel, El Harrach, Jardin D’essai Du

Hamma. Pakistan Journal of Zoology 46 (4): 1013-1022

Thiam M, Ba K, Duplantier J-M (2008) Impacts of climatic

changes on small mammal communities in the Sahel (West

Africa) as evidenced by owl pellet analysis. African Zoology

43 (2): 135-143

Zimkus BM, GvoZzdik V (2013) Sky Islands of the Cameroon

Volcanic Line: a diversification hot spot for puddle frogs

(Phrynobatrachidae: Phrynobatrachus). Zoologica Scripta

42: 591-611

©ZFMK

BHL

Blank Page Digitally Inserted

Bonn zoological Bulletin 68 (1): 21-29

2019 - Ahrens D. & et al.

https://doi.org/10.20363/BZB-2019.68.1.021

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:lsid:zoobank.org:pub:0A3BF492-C 1 ED-4241-A1D9-68D9E63AAAD7

On the identity of some taxa of Sericinae described by

C. P. Thunberg and L. Gyllenhal

(Coleoptera, Scarabaeidae)

Dirk Ahrens", Silvia Fabrizi’?, Katharina Nikolaev’, Lisa Knechtges* & Jonas Eberle*

"234° Centre of Taxonomy and Evolutionary Research, Zoologisches Forschungsmuseum A. Koenig, Adenauerallee 160,

D-53113 Bonn, Germany

* Corresponding author: Email: ahrens.dirk_col@gmx.de; d.ahrens@zfmk.de

'urn:lsid:zoobank. org: author: DEDCESCF-AA 11-4BBF-A2C6-D7C8 15019714

urn: lsid:zoobank.org: author: D88C5 EOB-9E32-430A-909C-CED1C3075471

urn: lsid:zoobank.org: author: E4D2CD82-843A-45 1D-9F BB-D0A49E0A 4260

urn: lsid:zoobank. org: author: 92DF02BE-9465-455A-ASBE-299BA 7 180E80

> urn: lsid:zoobank.org: author: 3A048DF B-D6E1-4F17-9705-9B2EB2753B94

Abstract. The type specimens of a number of species of Sericinae described by C.P. Thunberg and L. Gyllenhal were

revised. The study of the type material of the Zoological Museum of the Uppsala University revealed the identity of these

forgotten species and resulted in five new combinations and four new synonymies: Ablaberoides fuliginosus (Thunberg,

1818) comb. n., Ablabera haemorrhoa (Thunberg, 1818) comb. n.; Camenta caffra (Thunberg, 1818) comb. n., Maladera

setifera (Gyllenhal, 1817) comb. n., and Microserica pusilla (Thunberg, 1818) comb. n. [= Microserica compressipes

(Wiedemann, 1823) syn. n.; Microserica brenskei Reitter, 1896 syn. n.; Microserica pulchella Brenske, 1899 syn. n.;

Microserica leopoldiana Balthasar, 1932 syn. n.|. Melolontha fuliginosa Thunberg, 1818 resulted to be a senior primary

homonym of Melolontha fuliginosa Fairmaire, 1889 (now Exolontha fuliginosa) for which a replacement name is pro-

posed, Exolontha neofuliginosa Ahrens, nom. nov. Ablabera clypeata (Gyllenhal, 1817) and Ablabera totta (Thunberg,

1818) were removed from synonymy with Ablabera splendida (Fabricius, 1781). We designated lectotypes for Melo-

lontha setifera Gyllenhal, 1817, Trichius pusillus Thunberg, 1818, Melolontha fuliginosa Thunberg, 1818, Melolontha

analis Thunberg, 1818, Melolontha haemorrhoa Thunberg, 1818, Melolontha clypeata Gyllenhal, 1817, Melolontha totta

Thunberg, 1818, and Melolontha caffra Thunberg, 1818.

Key words. Sericini, Ablaberini, species taxonomy, South Africa, Indonesia.

INTRODUCTION

During a research visit of the first author in the Stock-

holm Museum of Natural History in 2007, part of the

type specimens of Sericinae (tribes Sericini and Ablaber-

ini) described by the Swedish entomologists Carl Peter

Thunberg and Leonard Gyllenhal preserved at Uppsala

University were examined. In the preparation of further

taxonomic revisions, the findings of that visit merit be-

ing published separately here since some of the species

described by the two authors were forgotten or misun-

derstood. One reason for this 1s the fact that part of Thun-

berg’s species were neglected ever since, as they did not

appear in subsequent works of Blanchard (1850) and

Burmeister (1855), or the first comprehensive world cat-

alogue (Dalla Torre 1912). Thus, they were not regarded

also by subsequent authors. A similar situation applies to

a number of species described by L. Gyllenhal; types of

Oriental species were never again examined by any of

the subsequent authors, and thus, their exact geographical

Received: 15.11.2018

Accepted: 20.03.2019

provenience was never really understood. The taxonomic

revision of these types resulted in some unexpected syn-

onyms, lectotype designations for eight species, correc-

tions and refinement of knowledge of the type localities,

as well as new combinations, a new name and one new

primary homonymy.

MATERIAL AND METHODS

The terminology and methods used for measurements,

specimen dissection and genital preparation follow

Ahrens (2004). Data from specimens examined are cited

in the text with original label contents given in quota-

tion marks (“ “), multiple labels are separated by a slash

(/ ). Male genitalia were detached and glued to a small

pointed card and photographed in both lateral and dorsal

view using a stereomicroscope Leica M125 with a Leica

DC420C digital camera. Stacks of single focussed im-

ages were combined with the automontage software as

Corresponding editor: X. Mengual

Published: 02.04.2019

22 Dirk Ahrens et al.

implemented in Leica Application Suite (V3.3.0). The

resulting entirely focussed images were subsequently

digitally edited.

ABBREVIATIONS

TMSA = Transvaal Museum (now Ditsong Museum),

Pretoria, South Africa

SMNS = Staatliches Museum fiir Naturkunde Stuttgart,

Germany

UUZM = Uppsala University, Zoological Museum,

Sweden

ZFMK = Zoologisches Forschungsmuseum Alexander

Koenig, Bonn, Germany

SUBFAMILY SERICINAE

Tribe Sericini

Maladera setifera (Gylenhal, 1817) comb. n.

(Fig. 1A—F)

Melolontha setifera Gyllenhal, 1817: 95; Wallin 1994: 9.

Serica setifera. Brenske 1898: 218; Dalla Torre 1912: 15;

Krajcik 2012: 243; Ahrens & Fabrizi 2016: 273.

Type material examined. Lectotype (here designated).

S “Uppsala Univ. Zool. Mus. Gyllenhal saml. Typ nr.

1467/ c” (UUZM). Paralectotypes: 1 2 “Uppsala Univ.

Zool. Mus. Gyllenhal saml. Typ nr. 1467/ b” (UUZM),

1 9 “Uppsala Univ. Zool. Mus. Gyllenhal saml. Typ nr.

1467/ a” (UUZM).

Additional material examined. | 3, 3 29 “Indonesia

C. Java Mt. Sumbing, VI.2006 St. Jakl leg.” (ZFMK),

1 3 “Indonesia W. Java Puncak near Boggor, 1500m,

8 —10.1V.1992, Eddi Samin leg.” (ZFMK).

Lectotype redescription. Length: 7.3 mm, length of el-

ytra: 5.8 mm, width: 4.9 mm. Body oblong-oval, yellow-

ish brown, antenna yellowish, dull, labroclypeus shiny,

with a few robust setae on head, otherwise glabrous.

Labroclypeus short, wide and subrectangular, widest

at base, lateral margins slightly convex, slightly conver-

gent anteriorly, anterior angles strongly rounded, ante-

rior margin straight, margins strongly reflexed; lateral

margin and ocular canthus produce an indistinct angle:

surface convexly elevated medially, finely, densely punc-

tate, with a few erect, long setae;_frontoclypeal suture

distinctly incised and elevated, angled medially; smooth

area anterior to eye convex, twice as wide as long; oc-

ular canthus short and narrow (1/3 of ocular diameter),

finely densely punctate, with a terminal seta. Frons dull,

with moderately dense, coarse punctures, with a few sin-

Bonn zoological Bulletin 68 (1): 21-29

gle setae beside eyes and behind frontoclypeal suture.

Eyes moderately large, ratio diameter/ interocular width:

0.62. Antenna with ten antennomeres; club with three an-

tennomeres and straight, slightly longer than remaining

antennomeres combined. Mentum elevated and slightly

flattened anteriorly.

Pronotum moderately transverse, widest at middle, lat-

eral margins moderately evenly convex and convergent

anteriorly as well as posteriorly, anterior angles distinct-

ly produced and sharp, posterior angles blunt, slightly

rounded at tip; anterior margin straight, with fine margin-

al line, base without marginal line; surface moderately

densely and finely punctate, with minute setae in punc-

tures; anterior and lateral margin finely sparsely setose;

hypomeron carinate, not produced ventrally. Scutellum

wide, triangular, with fine, moderately dense punctures,

impunctate on midline.

Elytra widest at middle, striae finely impressed, finely

and densely punctate, intervals slightly convex, with fine,

moderately dense punctures concentrated along striae

and with minute setae in punctures, odd intervals (most

abraded) with a few single long setae in robust punctures;

epipleural edge fine, ending at anterior third of elytra,

epipleura sparsely setose; apical border of elytra mem-

braneous, with a fine rim of microtrichomes (visible at ca

100x magnification).

Ventral surface dull, finely and densely punctate, near-

ly glabrous, metasternal disc sparsely covered with fine,

short setae; metacoxa with a few longer setae laterally.

Abdominal sternites finely and densely punctate, punc-

tures with minute setae, each sternite with a transverse

row of punctures each bearing a fine seta. Mesoster-

num between mesocoxae as wide as mesofemur. Ratio

of length of metepisternum/metacoxa: 1/1.95. Pygidium

moderately convex, dull, finely and densely punctate,

with narrow smooth midline, with numerous long setae

along apical margin.

Legs short and wide, dull; femora with two longitudinal

rows of setae, finely and sparsely punctate. Anterior mar-

gin of metafemur acute, without adjacent serrated line,

anterior row of setae complete; posterior ventral margin

smooth, moderately widened at ventral apex, dorsal pos-

terior edge smooth, neither serrate, glabrous. Metatibia

short and wide, widest at middle, ratio of width/length:

1/2.25, sharply carinate dorsally, with two groups of

spines, basal group shortly behind middle, apical group

at three quarters of metatibial length, in basal half with

a few short single setae subparallel to dorsal margin; lat-

eral face longitudinally convex, superficially and sparse-

ly punctate, along midline broadly smooth, with minute

setae in punctures; ventral margin finely serrate, with

five equidistant robust setae; medial face smooth and

glabrous; apex finely serrate, shallowly sinuate interiorly

near tarsal articulation._Tarsomeres dorsally impunctate,

glabrous, neither laterally nor dorsally carinate, moder-

ately setose ventrally; metatarsomeres with a strongly

©ZFMK

On the identity of some taxa of Sericinae described by C. P. Thunberg and L. Gyllenhal 23

‘\ |Uppsala Univ. Zool. Mus.

Gylkenhals saml. TYP nr.

1467

Uppsala Univ. Zool. Mus.

Thunbergsaml. ne. 4040

Hoplia pusilia

Cap. TY

Uppsala Univ. Zool. Mus.

unbergsaml. nr. 3802

Melolontha fuliginosa

Cap. TYP L

Fig. 1. A-F. Maladera setifera (Gyllenhal, 1817) (lectotype); G—J. Microserica pusilla (Thunberg, 1818) (lectotype); K—N. Ab-

laberoides fuliginosus (Thunberg, 1818) (lectotype). A. Aedeagus, left side lateral view; D. Aedeagus, right side lateral view; B.

Parameres, dorsal view; C. Parameres, ventral view; G, K. Head, dorsal view; E, J, M. Habitus, dorsal view, I, N. Habitus, lateral

view; F, H, L. Specimen labels. Scale: 0.5 mm.

Bonn zoological Bulletin 68 (1): 21-29 ©ZFMK

24 Dirk Ahrens et al.

serrated ridge ventrally and a smooth subventral longitu-

dinal carina, glabrous; first metatarsomere slightly short-

er than following two tarsomeres combined and slightly

longer than dorsal tibial spur. Protibia moderately long,

bidentate; anterior claws symmetrical, basal tooth of both

claws bluntly truncate at apex.

Remarks. The designated lectotype is the only male

specimen of the syntype series. The paralectotypes nr.

1467a and 1467b belong to clearly different species,

however, their identity remains unclear because they are

female. Type nr. 1467a somewhat resembles Maladera

subspinosa (Brenske, 1898) from northeastern India,

while type nr. 1467b 1s very similar to Maladera holoser-

icea (Scopoli, 1772), which definitively would not occur

at the presumptive type locality in Asia. Originally, there

were syntypes in the Schonherr collection too, however,

none was presently found in the Stockholm Museum of

Natural History.

In contrast to that, the original description mentions

only two variants, one corresponding to the lectotype

(var. §), and the other one to type nr. 1467a (nominal

form). None of the characters of the latter contain species

specific traits that are useful without the exact geographic

provenience of the specimens, and, it cannot be excluded

that the specimens of the type series have been collected

in two completely different areas, as also the potential

presence of M. holosericea in the labelled syntypes series

suggests.

For long time it was believed that the species originat-

ed from India (Brenske 1898; Dalla Torre 1912) because

the type locality was originally given as India orientalis

(“habitat in India orientali”; Gyllenhal 1817). Since the

designed lectotype fits to 100% recently collected and

geographically well-defined material, the type locality

could be more strictly circumscribed to Java. Indeed, the

most important ports on the East India route were Cape,

Batavia and Canton, and thus the two latter are the com-

pletely dominant places of origin for specimens labelled

“India orientalis” in Swedish collections, and supporting

the identification of the type locality as being Java (Mat-

tias Forschage, pers. com.). This is further supported by

geographically rather restricted distributions of species

of the M. thomsoni species group, which includes M. se-

tifera.

Microserica pusilla (Thunberg, 1818) comb. n.

(Fig. 1G—J)

Trichius pusillus Thunberg, 1818: 437.

Melolontha compressipes Wiedemann, 1823: 91, syn. n.

Microserica compressipes. Brenske 1899: 186; Ahrens

2004: 53.

Microserica brenskei Reitter, 1896: 186, Ahrens 2004:

53, Syn. n.

Bonn zoological Bulletin 68 (1): 21-29

Microserica pulchella Brenske, 1899: 161, Ahrens 2004:

53, Syn. n.

Microserica leopoldiana Balthasar, 1932: 113, Ahrens

2004: 53, syn. n.

Type material examined. Lectotype (here designated).

9 “Uppsala Univ. Zool. Mus. Thunbergsaml. nr. 4040

Hoplia pusilla Cap. TYP” (UUZM).

Remarks. This species was redescribed by Ahrens

(2004). The here designated lectotype specimen was the

only available syntype specimen. The lectotype is virtu-

ally identical in morphology and shape with female spec-

imens of Microserica compressipes (Wiedemann, 1823),

which was originally described form Java, and later rec-

ognized as a wider distributed species also occurring in

Sumatra (Ahrens 2004). Although the lectotype of M

pusilla is a female specimen, the shape and punctation

of the labroclypeus and the shiny and sparsely punctate

surface of the pygidium are very typical for this species,

while in the entire Africa there 1s no species with these

morphological characteristics. Thus, we consider the

type locality (Cape of Good Hope; Thunberg 1818) er-

roneous, rather being from Indonesia than from southern

Africa. The confusion between Cape and Java is not very

unlikely, since these two ports on the East India route are

the two main places where Thunberg collected on his trip

abroad, staying in Cape for three years 1772-1775 and in

Batavia for one month in 1775 (Mattias Forschage, pers.

com. ).

The lectotype is nearly entirely yellowish brown, with-

out the lateral paired stains on the elytra, which often

occur in females of M. compressipes. The entirely shiny

and sparsely punctate pygidium is a key feature of all

Microserica sensu stricto species, which occur only in

the Oriental region.

Ablaberoides fuliginosus (Thunberg, 1818) comb. n.

(Figs 1K—L, 2A—D)

Melolontha fuliginosa Thunberg, 1818: 426, not Fair-

maire 1889: 22.

Type material examined. Lectotype (here designated).

9 “Uppsala Univ. Zool. Mus. Thunbergsaml. Nr. 3802

Melolontha fuliginosa Cap. TYP” (UUZM).

Additional material examined. | < “X-DA4037-—South

Africa, W. Cape: Goukamma Nat. Res. Dunes near Ron-

davell Chalet, 10m, 34°04'02.9"S; 22°56'50.8"E, 24 —26.

xi.2013, lg. Ahrens, Eberle, Fabrizi” (ZFMK), 2 3, 1 2

“S.Afr.; Namaqualand Stallberg pass 30.27 S — 18.04 E

/5.9.1977; E-Y: 1384 grass netting leg. Endrédy- Youn-

ga” (TMSA), 1 3 “S.Afr.; W Cape Gamkaberg Nat. Res.

33.43 S — 21.56 E/ 8.12.1995; E-Y: 3176 fymbos flow-

©ZFMK

On the identity of some taxa of Sericinae described by C. P. Thunberg and L. Gyllenhal 25

Fig. 2. A-D. Ablaberoides fuliginosus (Thunberg, 1818) (S. Afr.; W Cape, Gamkaberg Nat. Res.); A. aedeagus, left side lateral

view; C. aedeagus, right side lateral view; B. parameres, dorsal view; D. habitus, dorsal view. Scale: 0.5 mm.

er leg. CL Bellamy“ (TMSA), 5 3 “S.Afr.; Little Karoo

Gamkaberg Nat. Res. 33.42 S — 21.54 E / 8-9.12.1995:

E-Y: 3175 beating leg. CL Bellamy” (TMSA), 1 ¢

“S.Affr.; Cape Prov Tsitsikama 33.58 S — 24.10 E/ For.

& Coastal Nat. Park 9.3.1992; dung Janssen & Le Roux“

(TMSA), 2 3 “S.Afr., S.W. Cape Ryspuntstrand 34.36 S

— 20.19 E / 30.9.1984; E-Y: 2130 ground & vegetation

leg. R. Muller” (TMSA), 1 3 “S.Afr., Cape-Karoo Farm

Zwaartskraal 33.10S — 22.32E / 8.11.1978; E-Y: 1539

ground traps, 69 days leg. R. Oosthuizen A / ground traps

with ferm. Banana bait‘ (TMSA), 1 ¢ “Assengaibos, La

Motte, C.P.X 40 G. van Son” (TMSA), 1 ¢@ “Uitenhage

IX. 1950 K. Dickson” (TMSA), 2 3 “S.Afr., S.W. Cape

Waenhuiskrans 34.39 S — 20.14 E / 30.9.1984; E-Y:

2129 grass netting leg. R. Miller” (TMSA), 1 ¢ “S.Afr;

Little Karoo Gamka Mt., 1000m 33.43 S — 21.56 E /

25.10.1993; E-Y:2901 flow. Karoo veget. Leg. En-

droédy-Younga” (TMSA), | ¢@ “S. Afr; LittleKaroo Gam-

ka Nat. Res. 33.43 S — 21.46 E/ 8.11.1993; E-Y: 2950

flower. Vegetation leg. Endrédy-Younga” (TMSA), 2 ¢

“S.Afr., S.W. Cape Arniston, dunes 34.39 S — 20.13 E/

26.10.1983; E-Y: 2021 grass netting leg. Endrédy- Youn-

ga” (TMSA), 1 6 “WILDERNIS SE 34 23 Aa 3 - X -

1981 C. H. SCHOLTZ” (TMSA), 3 6, 1 9 “RSA, W

Cape, Greyton env., 22.XI.2002, leg. M. Snizek, ex.

Coll. Ahrens” (ZFMK), 1 3 “SOUTH AFRICA: Eastern

Cape, R337, 43 km NE of Willowmore, 33°08’S 23°50’E

650m, 18.X1.1999 leg. M. Hauser” (SMNS).

Lectotype redescription. Length: 5.5 mm, length of el-

ytra: 3.4 mm, width: 3.2 mm. Body short-oval, blackish,

antenna black, surface with iridescent shine, with a few

robust setae on head, otherwise glabrous.

Bonn zoological Bulletin 68 (1): 21-29

Labroclypeus short, narrow and trapezoidal, widest at

base, lateral margins convex and strongly convergent an-

teriorly but between labrum and clypeus deeply concave-

ly sinuated,_anterior angles sharp and reflexed, anterior

margin bluntly sinuated medially and strongly reflexed:

lateral margin of clypeus and ocular canthus produce

an indistinct angle; surface flat, with a transverse carina

shortly behind the lateral incision between labrum and

clypeus, surface finely, very densely punctate, with a few

erect setae in front of the carina; frontoclypeal suture dis-

tinctly incised and flat, angled medially and sublaterally;

smooth area anterior to eye flat, as wide as long; ocular

canthus moderately long and narrow, finely densely punc-

tate, with a terminal seta; at apex touching the strongly

produce posterior eye keel (which is as long as the ocu-

lar canthus). Frons shiny, with dense, coarse punctures,

with a single seta beside each eye. Eyes very small, ratio

diameter/interocular width: 0.24. Antenna with ten an-

tennomeres; club with three antennomeres and straight,

as long as remaining antennomeres combined. Mentum

elevated and slightly convex anteriorly.

Pronotum moderately transverse, widest at base, lat-

eral margins moderately evenly convex and convergent

anteriorly, anterior angles distinctly produced and sharp,

posterior angles blunt, slightly rounded at tip; anterior

margin weakly convex, with robust marginal line, base

with robust marginal line that is widely interrupted medi-

ally by nearly twice scutellar widths; surface densely and

finely punctate, with minute setae in punctures; lateral

margin finely sparsely setose; hypomeron carinate, not

produced ventrally. Scutellum dull, wide, triangular, with

fine, moderately dense punctures.

©ZFMK

26 Dirk Ahrens et al.

Fig. 3. A-D. Ablabera analis (Thunberg, 1818) (lectotype), E-H. Ab/abera totta (Thunberg, 1818) (lectotype); I-N. Ablabera

haemorrhoa (Thunberg, 1818) (lectotype); A, E, L. Head, dorsal view; C, H. Habitus, lateral view; D, G, N. Habitus, dorsal view;

I. Aedeagus, left side lateral view; K. Aedeagus, right side lateral view; J. Parameres, dorsal view; B, F, M. Specimen labels. Scale:

0.5 mm.

Bonn zoological Bulletin 68 (1): 21-29 ©ZFMK

On the identity of some taxa of Sericinae described by C. P. Thunberg and L. Gyllenhal 21.

Elytra widest at middle, striae finely impressed, finely

and densely punctate, intervals flat, with fine, moderate-

ly dense punctures and with minute setae in punctures;

epipleural edge fine, ending at blunt external apical angle

of elytra, epipleura sparsely setose; apical border of ely-

tra chitinous, without rim of microtrichomes (visible at

ca 100x magnification).

Ventral surface dull, finely and densely punctate, near-

ly glabrous, metasternal disc sparsely covered with fine,

short setae; metacoxa with a few longer setae laterally.

Abdominal sternites finely and densely punctate, punc-

tures with minute setae, each sternite with a transverse

row of punctures each bearing a fine seta. Mesoster-

num between mesocoxae as wide as mesofemur. Ratio

of length of metepisternum/metacoxa: 1/2.13. Pygidium

moderately convex, dull, weakly shiny in apical half,

coarsely and densely punctate, without smooth midline,

with numerous short setae along apical margin.

Legs short and wide, dull; femora with two longitudi-

nal rows of setae, finely and sparsely punctate, of which

the posterior one 1s nearly completely reduced. Anterior

margin of metafemur acute, without adjacent serrated

line, anterior row of setae complete; posterior ventral

margin smooth, strongly widened at ventral apex, dorsal

posterior edge smooth, neither serrate, glabrous. Metatib-

ia short and wide, widest at middle, ratio of width/length:

1/2.55, sharply carinate dorsally, with two groups of

spines, basal group shortly before neterior quarter, apical

group shortly behind middle of metatibial length; later-

al face longitudinally convex, finely and sparsely punc-

tate, along midline broadly smooth, with minute setae in

punctures; ventral margin finely serrate, with four equi-

distant robust setae; medial face smooth and glabrous;

apex finely serrate, distinctly concavely sinuate interiorly

near tarsal articulation. Tarsomeres dorsally impunctate,

glabrous, neither laterally nor dorsally carinate, moder-

ately setose ventrally; metatarsomeres with a strongly

serrated ridge ventrally and a smooth subventral longitu-

dinal carina, with a few short setae; first metatarsomere

as long as following tarsomere and slightly shorter than

dorsal tibial spur. Protibia moderately long, tridentate:

anterior claws symmetrical, basal tooth of both claws

bluntly truncate at apex.

Remarks. The here designated lectotype specimen was

the only available syntype specimen. The name is a pri-

mary senior homonym of Melolontha fuliginosa Fatr-

maire, 1889, currently placed under a different genus

name as Exolontha fuliginosa (Fairmare, 1889) (Li et

al. 2010; Bezdek 2016). Given the rare use of the latter

name, we see no reason to make a case to advocate a

conservation of Melolontha fuliginosa Fairmaire, 1899.

In consequence, we propose here a replacement name for

the latter, Exolontha neofuliginosa Ahrens, nom. nov.

Bonn zoological Bulletin 68 (1): 21-29

Tribe Ablaberini

Among the type material of Ablaberini described by C.P.

Thunberg and L. Gyllenhal in the Stockholm Museum of

Natural History, only species of the genera Camenta Er-

ichson, 1847 and Ablabera Erichson, 1847 were found.

Species of both genera await a comprehensive taxonom-

ic revision and consequently, little can be said about the

current status of the species at this moment. Thus, we de-

cided to not include any redescription because a broader

taxonomic knowledge of these genera is needed.

Ablabera analis (Thunberg, 1818)

(Fig. 3A—D)

Melolontha analis Thunberg, 1818: 427.

Ablabera analis: Blanchard 1850: 101; Péringuey 1904:

86; Dalla Torre 1912: 75.

Type material examined. Lectotype (here designated).

9° “Uppsala Univ. Zool. Mus. Thunbergsaml. nr. 14777

Hoplia analis TYP” (UUZM).

Additional material examined. | 9 “Uppsala Univ.

Zool. Mus. Thunbergsaml. nr. 3326 Hoplia analis TYP”

(UUZM).

Remarks. The exact identity of this species and its po-

tential synonymy is difficult to establish as male speci-

mens are not available.

The specimen nr. 3326 of the supposed type series was

not designated as paralectotype as not an Ablabera spe-

cies, but appears to be a female of Maladera holosericea

(Scopoli) which was mislabeled and which possibly is

not part of the type series.

Ablabera clypeata (Gyllenhal, 1817) stat. rev.

(Fig. 4A—E)

Melolontha clypeata Gyl\lenhal, 1817: 70.

Ablabera clypeata. Blanchard 1850: 101; Burmeister

1855: 137; Péringuey 1904: 78; Dalla Torre 1912: 76.

Type material examined. Lectotype (here designated).

9 “Uppsala Univ. Zool. Mus. Gyllenhal saml. Typ nr.

1453/ a” (UUZM).

Remarks. The here designated lectotype specimen was

the only available syntype specimen. No other syntype

specimen was present in the Stockholm Museum.

Ablabera clypeata and A. totta (Thunberg, 1818) were

listed by Péringuey (1904) as junior synonyms of Ab-

labera splendida (Fabricius, 1781). However, the exam-

ination of both Thunberg’s type specimens revealed that

the types belong to different species and they are not A.

©ZFMK

28 Dirk Ahrens et al.

Fig. 4. A-E. Ablabera clypeata (Gyllenhal, 1817) (lectotype); F-I. Camenta caffra (Thunberg, 1818) (lectotype). A, G. Habitus,

lateral view; B, H. Habitus, dorsal view; F, C. Head, dorsal view; D. Metatibia: lateral view; E, I. Specimen labels. Scale: 0.5 mm.

splendida. Since there is no evidence in previous works

that either Péringuey (1904) or other authors examined

the type of any of the tree species, it seems reasonable

to treat them as valid taxa until the group is comprehen-

sively revised.

Ablabera haemorrhoa (Thunberg, 1818) comb. n.

(Fig. 3I-N)

Melolontha haemorrhoa Thunberg, 1818: 427.

Type material examined. Lectotype (here designated).

3 “Uppsala Univ. Zool. Mus. Thunbergsaml. nr. 3805

Melolontha haemorrhoa Cap. TYP” (UUZM).

Bonn zoological Bulletin 68 (1): 21-29

Remarks. The here designated lectotype specimen was

the only available syntype specimen.

Ablabera totta (Thunberg, 1818) stat. rev.

(Fig. 3E—H)

Melolontha totta Thunberg, 1818: 428.

Ablabera totta: Péringuey 1904: 78; Dalla Torre 1912:

76.

Type material examined. Lectotype (here designated).

9° “Uppsala Univ. Zool. Mus. Thunbergsaml. nr. 3812

Melolontha totta Cap. TYP” (UUZM).

©ZFMK

On the identity of some taxa of Sericinae described by C. P. Thunberg and L. Gyllenhal 29

Remarks. See Remarks under A. clypeata (Gyllenhal,

1817). The here designated lectotype specimen was the

only available syntype specimen.

Camenta caffra (Thunberg, 1818) comb. n.

(Fig. 4F-I)

Melolontha caffra Thunberg, 1818: 427.

Type material examined. Lectotype (here designated).

9 “Uppsala Univ. Zool. Mus. Thunbergsaml. nr. 3804

Melolontha caffra Cap. TYP” (UUZM).

Remarks. The here designated lectotype specimen was

the only available syntype specimen.

Acknowledgements. We are grateful to Hans Mejlon for the

loan of the type specimens from Uppsala University and to

Mattias Forshage (Stockholm) for his help with the loan of the

Uppsala type specimens as well as his hints towards these valu-

able specimens. AleS Bezdék and Mattias Forshage provided

helpful comments on the manuscript. Part of this research was

supported by grants from the German Science Association to D.

A. (DFG/AH175/1 and AH175/3) and by SYNTHESYS (SE-

TAF-3424).

REFERENCES

Ahrens D (2004) New species of the genus Microserica Bren-

ske, 1894 from Sumatra and the Malay Peninsula, with notes

on synonymy (Coleoptera, Scarabaeoidea, Melolonthidae).

Annali del Museo Civico di Storia Naturale “G. Doria” 95:

35-63

Ahrens D & Fabrizi S (2016) A Monograph of the Sericini of

India (Coleoptera: Scarabaeidae). Bonn Zoological Bulletin

65: 1-355

Balthasar V (1932) Une contribution a la connaissance des

Scarabaeidae de la région Orientale. Annales de la Société

entomologique de Belgique 72: 113-117

Bezdék A (2016) Melolonthini. p. 226—236. In: Lobl, I. & Lobl,

D. (Eds.), Catalogue of Palaearctic Coleoptera. Volume 3.

Bonn zoological Bulletin 68 (1): 21-29

Scarabaeoidea — Scirtoidea — Dascilloidea — Buprestoidea

— Byrrhoidea. Revised and Updated Edition (2™ Edition).

Leiden: Brill.

Blanchard ME (1850) Catalogue de la collection Ento-

mologique. Classes des Insectes. Ordre des Coléopteres.

part.: Melolonthidae, Tome I. Muséum d’ Histoire Naturelle

de Paris, 128.pp

Brenske E (1898) Die Serica-Arten der Erde. II. Berliner Ento-

mologische Zeitschrift 43: 205-403

Brenske E (1899) Die Serica-Arten der Erde. HI. Berliner Ento-

mologische Zeitschrift 44: 161-272

Burmeister H (1855) Handbuch der Entomologie. 4. Band. Be-

sondere Entomologie, Fortsetzung. 2. Abteilung, Coleoptera

Lamellicornia Phyllophaga chaenochela. Theodor Christian

Friedrich Enslin, Berlin, 467pp.

Dalla Torre KW (1912) Scarabaeidae: Melolonthinae I. In: Junk

W & Schenkling S (eds): Coleopterorum Catalogus 45: 1-84

Fairmaire L (1889) Coléopteres de l’intérieur de la Chine (5

partie). Annales de la Societe Entomologique de France 6:

5—84

Krajcik M (2012) Checklist of the World Scarabaeoidea. Anim-

ma.x, supplement 5: 1-278

Gyllenhal L (1817) In: Schonherr CJ (1817) Appendix ad C.

J. Schoenherr synonymia insectorum. Vol. 1, Part 3, sistens

descriptiones novarum specierum, Scaris, 266pp.

Li C-L, Yang P-S, Wang C-C (2010) Revision of the Me/olon-

tha guttigera Group (Coleoptera: Scarabaeidae) With a Key

and an Annotated Checklist of the East and South-East Asian

Melolontha Groups. Annals of the Entomological Society of

America 103(3): 341-359

Péringuey L (1904) Descriptive catalogue of the Coleoptera of

South Africa. (Lucanidae and Scarabaeidae). Transactions of

the South African Philosophical Society 13: 1-293

Reitter E (1896) Uebersicht der mir bekannten palaearktischen,

mit der Coleopteren-Gattung Serica verwandten Gattungen

und Arten. Wiener Entomologische Zeitung 15: 180-188

Thunberg CP (1818) Coleoptera Capensia, antennis lamellatis,

sive clave fissili instructa. Mémoires de Il’ Académie impéri-

ale des sciences de St. Pétersbourg 6: 395-450

Wallin L (1994) Catalogue of type specimens. 3. Entomology.

Uppsala University, Museum of Evolution, Zoology section,

S6pp.

Wiedemann CRW (1823) Zweihundert neue Kafer von Java,

Bengalen und dem Vorgebirge der guten Hoffnung. Zoolo-

gisches Magazin 2: 1-135

©ZFMK

BHL

Blank Page Digitally Inserted

Bonn zoological Bulletin 68 (1): 31-60

2019 - Kehlmaier C. et al.

https://do1.org/10.20363/BZB-2019.68.1.031

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:lsid:zoobank.org: pub: DC3BA 949-1 88E-465C-92C8-A B61 B4EABC3A

New records of big-headed flies (Diptera: Pipunculidae)

from the Mediterranean Basin

Christian Kehlmaier'*, David J. Gibbs? & Phil Withers*

'Senckenberg Natural History Collections Dresden, Museum of Zoology, Konigsbriicker LandstraBe 159, D-01109 Dresden,

ry. Z SY, &

ermany

? Orchard Cottage, Cecil Road, Weston-super-Mare, Somerset BS23 2NF, United Kingdom

3 Montée du Cimetiére, Sainte Euphémie, F-01600, France

* Corresponding author: Email: kehlmaier@Qweb.de

'urn:Isid:zoobank.org:author:3 BD2A72C-A 88E-4B2F-A22C-7CF522DE6F4D

? urn:Isid:zoobank.org:author:6DF4A27A-C5CA-4D2E-A910-4B5C373306B2

3 urn:Isid:zoobank.org:author:3F23770A-94DC-4A C0-8F33-F917B04A62C9

Abstract. Despite great progress in Pipunculidae (Insecta: Diptera) systematics during the past decades, the Mediterrane-

an fauna of big-headed flies remains largely unknown. Here, we present new faunistic and taxonomic data for 98 named

species from Cyprus, Egypt, France, Greece, Italy, Malta, Morocco, Portugal, Spain, Tunisia, and Turkey, based on our

own collecting efforts and museum specimens. Besides 56 first national records, the paper includes the description of

Cephalops (Semicephalops) brachium Kehlmaier & Withers sp. n. from France and Spain, and of Zomosvaryella osito

Kehlmaier, Gibbs & Withers sp. n. and Zomosvaryella pugiunculus Kehlmaier & Gibbs sp. n. from the Balear Islands

(Spain). Furthermore, two new synonymies are proposed: 7Zomosvaryella lyneborgi (Coe, 1969) = Tomosvaryella cilitar-

sis (Strobl, 1910); and Zomosvaryella glabrum (Adams, 1905) = Tomosvaryella pilosiventris (Becker, 1900). Lectotypes

are designated for Jomosvaryella pilosiventris (Becker, 1900) and Tomosvaryella vicina (Becker, 1900). The following

species need to be deleted from the Spanish checklist due to misidentifications: Cephalops subultimus Collin, 1956, Eu-

dorylas montium (Becker, 1897), and Tomosvaryella nigronitida Collin, 1958.

Key words. Diptera, Pipunculidae, Mediterranean Basin, taxonomy, faunistics, new species.

INTRODUCTION

Pipunculidae (Insecta: Diptera), commonly known as

big-headed flies, are brachycerous flies whose endopar-

asitic larvae develop within larval and adult Auchenor-

rhyncha (Insecta: Hemiptera) and adult Tipulidae (Insec-

ta: Diptera) (see Rafael & Skevington 2010 for a brief

review of the family's biology). Currently, four subfam-

ilies are recognized (Kehlmaier et al. 2014) and slightly

more than 1,400 valid species are described (Rafael &

Skevington 2010). Whereas pipunculids can readily be

recognized by their large compound eyes, occupying al-

most the entire globular head (Fig. 1), species identifi-

cation is primarily based on male genitalic features and

the piercer-like shape of the female ovipositor used for

penetrating the intersegmental skin of their larval hosts;

and thus, it requires some experience.

Regarding taxonomy and systematics, vast progress

has been achieved during the past three decades. Many

revisionary works, covering all biogeographic regions,

have more than doubled the number of described spe-

cies (Skevington & De Meyer 2004: fig. 1). Although the

Received: 07.05.2018

Accepted: 20.05.2019

western Palaearctic can be considered the most thorough-

ly studied region worldwide, knowledge of the fauna of

the Mediterranean Basin is still fragmentary. Being lo-

cated at the intersection of the African and the Eurasian

landmasses the Mediterranean Basin is considered one of

the world's biodiversity hotspots (Cuttelod et al. 2008).

It stretches from Portugal to Jordan (W to E) and from

northern Italy to Morocco (N to S), including around

five thousand islands scattered around the Mediterranean

Sea, plus the Macaronesian archipelagos of the Canaries,

Madeira, the Selvages (Selvagens), the Azores, and Cape

Verde. In this study, however, the Macaronesian archipel-

agos are not considered.

Although no absolute figures exist, the high degree of

plant endemism — approx. 52% of all 22,500 vascular

plant species, mainly concentrated on islands, peninsulas,

rocky cliffs, and mountain peaks (International 2011) —

has undoubtedly triggered radiations within many groups

of arthropods, including endoparasitoids. Although much

of the Mediterranean hotspot was once covered in ever-

green oak forests, deciduous and conifer forests, eight

thousand years of human settlement and habitat modifica-

Corresponding editor: X. Mengual

Published: 02.06.2019

32 Christian Kehlmaier et al.

tion have distinctly altered the characteristic vegetation

(International 2011). Today, the most widespread veg-

etation type is hard-leafed or sclerophyllus shrublands

called maquis or matorral, which include representatives

from the plant genera Juniperus L., Myrtus L., Olea L.,

Phillyrea L., Pistacia L., and Quercus L. (International

2011).

Of all countries situated in the Mediterranean Basin,

only France (Withers 2006), Israel (De Meyer 1995),

Italy (Kozanek & Belcari 1995; Kehlmaier 2008a;

Kehlmaier 2010a), Malta (Ebejer 2012), Portugal

(KehIlmaier & Andrade 2016), and Spain (De Meyer

1997; Kehlmaier 2001, 2003, 2005a; Kehlmaier & Ass-

mann 2008; Kehlmaier & Alonso-Zarazaga 2018) have

received more substantial attention in the past, resulting

in well documented, yet far from complete species lists.

During the past years, the authors had the opportunity to

collect new material as well as to study specimens depos-

ited in various institutional and private collections. The

results of these efforts are presented in this paper, and in-

clude, amongst others, the description of three new spe-

cies (1.e., Cephalops (Semicephalops) brachium Kehl-

maier & Withers sp. n., Jomosvaryella osito Kehlmaier,

Gibbs & Withers sp. n., and Zomosvaryella pugiunculus

Kehlmaier & Gibbs sp. n.) and new records and findings

for Cyprus, Egypt, France, Greece, Italy, Malta, Mo-

rocco, Portugal, Spain, Tunisia, and Turkey. Moreover,

lectotypes are designated for Zomosvaryella pilosiventris

(Becker, 1900) and 7Zomosvaryella vicina (Becker, 1900),

and two new synonymies are proposed: 7omosvaryella

lyneborgi (Coe, 1969) = Tomosvaryella cilitarsis (Strobl,

1910), and Tomosvaryella glabrum (Adams, 1905) = To-

mosvaryella pilosiventris (Becker, 1900).

MATERIAL AND METHODS

Morphological terminology in the descriptive part fol-

lows recent systematic papers (e.g., Kehlmaier et al.

2014). Note that in contrast to previous papers (e.g.,

Kehlmaier 2005a) using the terms ‘inner’ and ‘outer’ to

differentiate between the position of surstyli, gonopods

and sides of the epandrium, the terms ‘left’ and ‘right’ are

used in accordance with Skevington (2002), representing

the actual morphological location of these structures.

As no comprehensive work exists for identifying Pi-

punculidae from the Mediterranean Basin, various pub-

lications need to be consulted for species identification,

Fig. 1. Male holotype of Zomosvaryella osito Kehlmaier, Gibbs & Withers sp. n. prior to dissection. A. Left lateral view. B. Dorsal

view.

Bonn zoological Bulletin 68 (1): 31-60

©ZFMK

New data on Mediterranean Pipunculidae oo

i.e., for Chalarinae (Kehlmaier 2006; Kehlmaier &

Assmann 2008; Kehlmaier 2010b); for Nephrocerinae

(Grootaert & De Meyer 1986); for Pipunculini (Kehl-

maier 2008b, 2010a); for Cephalopsini and Microceph-

alopsini (Ackland 1993; De Meyer 1989; Kehlmaier &

Andrade 2016); for Eudorylini (Kehlmaier 2005a, b);

and for Tomosvaryellini (Albrecht 1990; De Meyer 1993,

1995; Foldvari & De Meyer 2000; Kehlmaier 2008a, b).

An identification key to the world genera is included in

Skevington & Yeates (2001). If not otherwise stated, the

material was identified by the senior author.

For selected specimens, DNA-barcodes of the mito-

chondrial coding gene cytochrome oxidase subunit I

(CO1) were generated using the protocol by Kehlmaier

et al. (2012) at the molecular laboratory at Senckenberg

Naturhistorische Sammlungen Dresden, Museum fir

Tierkunde, Dresden, Germany (SGN-SNSD-Mol-Lab).

Specimens sequenced received an additional label stat-

ing an individual lab number “DNA CKxxx”. Sequence

accession numbers issued by the European Nucleotide

Archive (ENA) are provided in the individual species

section.

In the faunistic listing below, genera and species are

arranged alphabetically within their corresponding sub-

family. First national records are indicated by an asterisk

(*) after the country’s name.

Abbreviations used for collections and equivalents

BMNH = British Museum of Natural History,

London, United Kingdom

MNCN = Museum Nacional de Ciencias Naturales,

Madrid, Spain

MNHN = Muséum National d'Histoire Naturelle,

Paris, France

MNHU = Museum fir Naturkunde, Berlin,

Germany

SMTD =_ Senckenberg Naturhistorische Sammlun-

gen Dresden, Museum fir Tierkunde,

Dresden, Germany

MVHN = Museu Valencia d'Historia Natural,

Fundacion Entomologica Torres Sala,

Valencia, Spain

OUMNH = Oxford University Museum of Natural

History, Oxford, United Kingdom

PCCK = _ Personal collection Christian Kehlmaier,

Dresden, Germany

PCCP = Personal collection Chris J. Palmer,

Hampshire, United Kingdom

PCDG = Personal collection David J. Gibbs,

Weston-super-Mare, United Kingdom

PCJC = Personal collection Jocelyn Claude,

Labergement-Sainte-Marie, France.

PCME = Personal collection Martin J. Ebejer,

Cowbridge, United Kingdom

Bonn zoological Bulletin 68 (1): 31-60

PCNV = Personal collection Nikita Vikhrev,

Moscow, Russia.

PCPC = Personal collection Peter J. Chandler,

Melksham, United Kingdom

PCPW- = Personal collection Phil Withers,

Sainte Euphémie, France.

ZMUC = Zoological Museum, University of

Copenhagen, Denmark.

Other abbreviations used in the text

MT = Malaise trap

ZMCE = Zoological Museum Copenhagen Expedition

In order to study the ventral aspect of the male termi-

nalia, the syntergosternite 8 was separated from the ab-

domen and placed on a microscope slide in a drop of

glycerine. Illustrations were prepared by merging several

microphotographs, taken with a Nikon Coolpix 990 in

different planes at a magnification of 250 times, using

CombineZP (by Alan Hadley; http://www.hadleyweb.

pwp.blueyonder.co.uk), before redrawing them with Ink-

scape (Inkscape Community; http://www. inkscape.org).

The studied material originates from our own collect-

ing efforts or has been compiled by various institutions

or individuals during Malaise trap projects or collecting

trips, e.g., the Wetland Kerkini Biodiversity Study (cour-

tesy of Gordon J. Ramel, http://www.ramel.org/lake-ker-

kini/, 41°10'46"N 23°9'20"E) in Kendriki Makedonia,

Greece, and The Albufera International Biodiversity

Project (TAIB, courtesy of Nick J. Riddiford, https://

www.taib.info/en/, 39°47'50"N 3°6'22.5"E) in Mallorca,

Spain. These and additional localities are listed in more

detail (where available) in Appendix I.

Species records formerly presented in so-called “grey

literature”, e.g., the Annual Reports of the TAIB project

(Riddiford 2006; Riddiford & Férriz 2007), are included

in this study whereas records published in scientific jour-

nals holding an “International Standard Serial Number“

(ISSN) are referred to in Appendix II.

RESULTS

Description of new species

Cephalops (Semicephalops) brachium Kehlmaier &

Withers sp. n.

urn: |sid:zoobank. org: act: 24A74A 42-654C-4F8F-BA59-6F C428 984B4C

Figs 2A—G

Differential diagnosis. The species can be differentiat-

ed by the male genitalia with its elongated surstyli and

the long dorsal arm of the phallic guide. The female is

characterised by its small ovipositor that 1s pointing away

from the sternites. It 1s not clear at present to which spe-

©ZFMK

34 Christian Kehlmaier et al.

cies C. brachium is closely related to, as the long dorso-

medial arm of the phallic guide and the elongated sursty-

li are unique within Cephalops (Semicephalops) Fallén,

1810.

Description. MALE. Body length: about 3.6—3.7 mm

(head and terminalia detached in holotype). Head. Scape

and pedicel dark brown, flagellum yellowish. Pedicel

with three short dorsal bristles and 3-4 longer ventral

bristles, the longest almost reaching the tip of flagellum,

which is pointed below. Arista dark brown with broad-

ened base. Eyes meeting for length of frons (14 ommatid-

ial facets), which is silver pollinose. Occiput brown polli-

nose in upper quarter, otherwise grey pollinose. Thorax.

Postpronotal lobe same colour as scutum. Prescutum,

scutum and scutellum dark brown and brown pollinose.

Propleural hair fringe with six long hairs. Prescutum

and scutum with two dorsocentral rows of minute hairs.

Posterior hair fringe of scutellum minute. Wing length:

3.9-4.2 mm. Wing width: 1.3—1.4 mm. Length of third

costal section (LTC) 1.1—1.3 times length of fourth costal

section (LFC). Pterostigma as long as LTC. Wing cov-

ered with microtrichia. Only small basal cells of wing,

e.g., bc, and beginning of cells sc, c, r,, br and bm with

reduced microtrichia. Crossvein r-m reaches cell dm at

basal third of the cell’s length. Halter white but narrow-

ly brownish at base and partly dorsally on knob. Coxae

dark brown. Trochanters yellow. Fore and mid femora

Fig. 2. Cephalops (Semicephalops) brachium Kehlmaier & Withers sp. n. A. Right lateral view of male terminalia. B. Strictly

dorsal view of surstyli. C. Left lateral view of male terminalia. D. Dorsal view of syntergosternite 8 with membraneous area, ep-

andrium and surstyli. E. Dorsal view of ovipositor. F. Ventral view of phallic guide and phallus. G. Left lateral view of ovipositor.

Bonn zoological Bulletin 68 (1): 31-60

©ZFMK

New data on Mediterranean Pipunculidae 35

yellow with weak brownish tinge anterodorsally in bas-

al half. Hind femur yellow with stronger brownish tinge

in anterior half (anterior, dorsal and ventral). Fore femur

with antero- and posteroventral rows of black spines at

apex consisting of one to four spines. Mid femur with

antero- and posteroventral rows of black spines consist-

ing of 7-10 spines in apical two thirds. Hind femur with

anteroventral row of four peglike spines in anterior third.

Hind femur shining posteroventrally. Tibiae yellow. Hind

tibia with four longer hairs anteromedially. Tarsi yellow

with dititarsus brown. Pulvilli shorter than distitarsus.

Abdomen. All tergites dark brown, lacking distinct hairs

except tergite 1 with 3-4 hairs laterally. Genitalia: Dark

brown. Membranous area narrowly reaching epandrium

(Fig. 2D). Surstyli in strictly dorsal view elongated, rath-

er symmetric; right surstylus slightly longer (Fig. 2B).

In lateral view gently bent towards sternites (Figs 2A,

2C). Phallus trifid with one short and two longer ejacu-

latory ducts with cupular apices (Fig. 2F). Phallic guide

ankyroid with a long dorsomedial arm wrapping around

the ejaculatory ducts (Fig. 2F). FEMALE. Body length:

3.0 mm. Differing from male by eyes separated, with en-

larged anterior facets. Frons broadest at its middle where

four times wider than diameter of largest ommatidial fac-

et. Wing length: 3.7 mm. Wing width: 1.6—1.7 mm. Legs

can be entirely yellow. Femora with slightly reduced ven-

tral rows of dark peg-like spines. Pulvilli on fore and mid

leg as long as distitarsus, slightly shorter on hind Genita-

lia: Ovipositor in dorsal view (Fig. 2E) with base (tergite

7) dark brown, almost quadratic, and piercer (tergite 9)

yellow, as long as base and with triangular lateral flanges.

In lateral view (Fig. 2G), base with convex dorsal and

ventral margin; piercer straight and pointing away from

sternites; reaching to posterior margin of sternite 4.

Type material. HOLOTYPE 3 (DNA CK914, ENA

LT999991), FRANCE: Département Ardéche, Réserve

Naturelle Nationale des Gorges de |’Ardeche, TM n°12,

Malaise, 19.v1.2016, J. Claude [SMTD]. PARATYPES:

same data as holotype [1¢, PCJC]; Département Ar-

déche, Granzon, river bank, 25.v—27.vi.2010, P. Withers

[1¢, PCPW]. Additional material. SPAIN: “VD19”, D.

Ventura [12, SMTD]; same data as previous [2¢'¢ 19,

PECK

Remarks. The additional material from Spain was ex-

cluded from the type series due to the fragmentary lo-

cality data.

Etymology. The species epithet brachium is Latin for

‘arm’ or ‘forearm’, referring to the long arm or dorsome-

dian projection of the phallic guide. The specific epithet

is to be treated as a noun in apposition.

Bonn zoological Bulletin 68 (1): 31-60

Tomosvaryella osito Kehimaier, Gibbs & Withers sp. n.

urn: 1sid:zoobank. org: act: 2F DE06C2-3A B5-42C7-937B-AC7508CD3334

Figs 1A—B, 3A-—G

Differential diagnosis. The new species is unique within

Tomosvaryella Aczél, 1939 for its pilose appearance in

both sexes (Figs 1A—B). Based on the male terminalia,

T! osito sp. n. belongs to the minima species group that

comprise 7. minima (Becker, 1897), 7: hortobagyien-

sis Foldvari & De Meyer, 2000, 7’ resurgens De Meyer

(1997), and 7. sepulta De Meyer (1997). The latter two

Species were originally described from mainland Spain

and the shape of the surstyli resembles especially to

T! sepulta. However, the lateral shape of both surstyli is

distinctly more angular in 7: osito sp. n. (Figs 3A and

3C) compared to 7? sepulta. (De Meyer 1997: figs 12a

and 12c).

Description. MALE. Body length: 4.0 mm (prior to dis-

section). Head. Scape and pedicel dark brown, the latter

with some minute dorsal and ventral bristles. Flagellum

yellowish brown and long tapering. Arista with yellowish

broadened base, otherwise dark brown. Eyes meeting for

less then length of ocellar triangle (four facets). Frons

and face densely silver pollinose. Palpus yellowish. Lat-

erally, occiput silver pollinose with some weak brownish

pollinosity intermingled in anterior half; upper half twice

as broad as lower half. Thorax. Postpronotal lobe yellow,

densely silver pollinose, with about twelve long hairs.

Prescutum and scutum black, weakly silver pollinose,

covered with long white hairs along anterior and later-

al margins and with two dorsocentral rows that broaden

considerably in posterior third. Scutellum black, dense-

ly silver pollinose and entirely covered with long white

hairs. Subscutellum black and densely silver pollinose.

Pleura black, bare, weakly silver pollinose. Wing length:

3.8 mm; width: 1.1 mm. Length of third costal section

(LTC) 0.3 times length of fourth costal section (LFC).

Pterostigma absent. Wing covered with microtrichia ex-

cept partly bare in small basal cells, e.g., bc, and begin-

ning of cells sc, c, r,, br and bm. Crossvein r-m reaches

cell dm shortly after the middle of the cell's length. Hal-

ter narrowly brown at base, otherwise white. Legs dark

brown except yellow at tip of femur and in basal quar-

ter of tibia; silver pollinose except hind femur shining

posteroventrally. Hind trochanter without any distinct

protuberance or spines. Femora without ventral spines,

with posterodorsal and posteroventral row of white hairs,

complemented by an anterior row on hind femur. Hind

basitarsus flattened. Pulvilli slightly shorter than disti-

tarsus. Abdomen. Tergites black, shining but with an-

terolateral triangular patches of grey pollinosity; even-

ly covered with long white hairs (Figs 1A—B). Viewed

caudally, membranous area placed to the right (Fig. 3E).

Genitalia: Surstyli in strictly dorsal view rather sym-

metric, left one slightly longer; both with broad base and

©ZFMK

36 Christian Kehlmaier et al.

inward bent tips (Fig. 3B). In lateral view, both surstyli

are hunchbacked and bent towards sternites (Figs 3A &

C). Epandrium elongated, longer than surstyli (Fig. 3B).

Phallus with three short ejaculatory ducts; one duct bar-

ing five distinct spines pointing towards the phallic guide

(Fig. 3D). Phallic guide inconspicuous, rather long and

slim with a slight curve towards the epandrium in lat-

eral view (Fig. 3D). FEMALE. Body length: 3.7 mm.

Differing from male by eyes separated, with enlarged

anterior facets. Frons entirely silver pollinose except in

upper quarter, broadest in its middle, five times wider

than largest ommatidial facet. Occiput silver pollinose

in lower, weakly silver pollinose in upper half. Pleura

densely silver pollinose. Wing length: 3.4-3.5 mm. Wing

width: 1.1-1.2 mm. LTC 0.5 times LFC. Leg densely

silver pollinose. Anterior femur with two white bristles

at base. Tibiae yellow in basal third. Pulvilli as long as

distitarsus. Tergite 1—6 laterally silver pollinose, broadest

towards anterior margin. Genitalia: Ovipositor in dorsal

view (Fig. 3G) with base (tergite 7) dark brown, ovate,

longer than broad, weakly silver pollinose. Piercer with

tergite 8 (around anal opening) dark brown and shining;

tergite 9 (the actual piercer) thin, yellowish, shining.

Fig. 3. Zomosvaryella osito Kehlmaier, Gibbs & Withers sp. n. A. Lateral view of right surstylus. B. Strictly dorsal view of surstyli.

C. Lateral view of left surstylus. D. Right lateral view of phallus and phallic guide. E. Caudal view of syntergosternite 8. F. Right

lateral view of ovipositor. G. Dorsal view of ovipositor.

Bonn zoological Bulletin 68 (1): 31-60

©ZFMK

New data on Mediterranean Pipunculidae 37

Piercer twice length of base. In lateral view (Fig. 3F),

piercer straight, reaching posterior margin of sternite 3.

Type material HOLOTYPE <, SPAIN: Mallorca,

S’Albufera, Es Comu, 39°46'34"N 3°08'27"E, 20.v.2007,

D.J. Gibbs [SMTD]. PARATYPES: same data as holo-

type [14 (dissected), 22 9, PCDG]; same data as holo-

type [1¢, BMNH (not dissected); 2¢'4', OUMNH (not

dissected)]; same data as holotype [12, PCDG; 19,

BMNH; 12, OUMNH]; same data as holotype, 18.v.2007

[13 PCDG; 1412, BMNH (not dissected)]. FRANCE:

Aude, Narbonne, Gruissan, dunes a 7Jamarix, 13.v1.2006,

B. Nusillard [14', PCPW].

Etymology. The species epithet osito is Spanish for ‘lit-

tle bear’ and refers to the Teddybear-like appearance of

the new species. The specific epithet is to be treated as a

noun in apposition.

Tomosvaryella pugiunculus Kehlmaier & Gibbs sp. n.

urn: |sid:zoobank. org: act: 2C8CB334-3692-4A66-BOBS-0734D16AA9F2

Figs 4A-I, SA-C.

Differential diagnosis. The species cannot be attributed

to any specific species group at present. Important exter-

nal features to diagnose this species are the shape of the

flagellum in both sexes, with its filiform tip; the shape

of the male hind leg with the hollow femur base and the

bent tibia; the female ovipositor with its long, straight

piercer having weak lateral flanges; and the male termi-

nalia with a peculiar ventrocaudal aspect of the surstyli

(rather angular, their distal margin forming a horizontal

line; right gonopod larger than left one in ventral view;

phallus with three short ducts, one baring a small hook

at its base).

Description. MALE. Length from head to tip of scutel-

lum: 2.1 mm (abdomen missing due to dissection). Head.

Scape and pedicel dark brown, the latter with some

minute dorsal and ventral bristles. Flagellum yellowish

brown with a whitish filiform tip that is almost half the

length of flagellum (Fig. 4J). Arista dark brown with

broadened base. Eyes meeting for about twice length of

ocellar triangle (7-8 facets). Frons shining black; face

densely silver pollinose; palpus not assessable. Lateral-

ly, occiput weakly grey pollinose in lower and weakly

brown pollinose in upper half; the latter twice as broad as

lower half. Thorax. Postpronotal lobe yellowish white,

weakly grey pollinose, without distinct longer hairs. Pres-

cutum and scutum black, weakly brown pollinose, with

two dorsocentral rows of short hairs. Scutellum black,

weakly brown pollinose and with short hairs along pos-

terior margin. Subscutellum black, laterally densely, cen-

trally weakly silver pollinose. Pleura black, bare, weak-

ly silver pollinose. Wing length: 3.8 mm; wing width:

1.2 mm. Length of third costal section (LTC) about 0.3

Bonn zoological Bulletin 68 (1): 31-60

times length of fourth costal section (LFC). Pterostigma

absent. Wing covered with microtrichia except partly

bare in small basal cells, e.g., bc, and beginning of cells

sc, c, ,, br and bm. Crossvein r-m reaches cell dm at

the middle of the cell's length. Halter narrowly brown at

base, otherwise white. Legs with coxae and trochanters

dark brown. Hind trochanter without a distinct protuber-

ance or spines. Femura dark brown except yellow at tip:

silver pollinose except hind femur shining posteroven-

trally. Only mid femur with posterodorsal and postero-

ventral row of black ventral spines in apical half. Hind

femur ventrally hollowed in basal third, about two-thirds

the height as at its middle (Fig. 5C). Tibiae yellow but

with a brown tinge medially, especially dorsally, and ex-

tending towards the apex, more extensive and blackish

in One specimen. Hind tibia considerably bent (Fig. 5C).

Tarsal segments yellow. Hind basitarsus flattened. Pul-

villi slightly longer (front leg) or slightly shorter than

distitarsus (mid and hind leg). Abdomen. Tergites black,

shining but tergite 1 grey pollinosity; evenly covered

with short black hairs, tergite 1 with hairs paler, espe-

cially laterally where thy form a distinct, mono-serial fan

of longer bristly hairs. Tergite 3 latero-ventrally tapering

to a point clearly extended below the adjacent tergites.

Genitalia: Large, giving the abdomen a very clubbed

appearance. Viewed caudally, membranous area placed

to the right, narrow and sickle-shaped (Figs 4B, 4D).

Viewed ventrocaudally, surstyli rather angular, their dis-

tal margin forming a horizontal line (Fig. 4D). Strictly

dorsal, surstyli with broad base (broader on right sursty-

lus) and fingerlike apex; left surstylus slightly longer and

apically curved inwards (Fig. 4B). In lateral view base

of right sustylus considerably broader than on left sur-

stylus; fingerlike apex rather straight (Figs 4A, 4C). Ep-

andrium small, only slightly longer than surstyli. Viewed

ventrally, right gonopod larger than left one (Fig. 4B).

Phallus with three short ducts, one baring a small hook

at its base (Fig. 4F). FEMALE. Body length: 3.0 mm.

Differing from male by eyes separated, with distinctly

enlarged anterior facets. Frons entirely silver pollinose

in lower half, but shining in upper half, broadest in its

middle, four times largest ommatidial facet. Filiform tip

of flagellum slighty shorter. Wing length: 3.3 mm. Wing

width: 1.0 mm. Front femur with two white bristles at

base. Hind leg with femur not hollowed basally and tibia

less strongly bent. Pulvilli on fore and mid leg distinctly

longer than distitarsus; on hind leg shorter than distitar-

sus. Tergite 1 dark brown, weakly silver pollinose; with

lateral hair fan consisting of about twelve hairs reach-

ing on dorsal surface but diminishing in length towards

center. Tergite 2-6 dark brown, weakly silver pollinose,

laterally with short pale hairs that extend onto dorsal

surface along posterior margin. Genitalia: Ovipositor in

dorsal view (Fig. 41) with base (tergite 7) dark brown,

ovate, longer than broad, weakly silver pollinose. Pierc-

er (tergites 8 & 9) yellowish and shining. Transition be-

©ZFMK

38 Christian Kehlmaier et al.

Pupyy

)

Fig. 4. Zomosvaryella pugiunculus Kehlmaier & Gibbs sp. n. A. Lateral view of right surstylus. B. Strictly dorsal view of surstyli.

C. Lateral view of left surstylus. D. Dorso-caudal view of syntergosternite 8. E. Caudal view of syntergosternite 8. F. Left lateral

view of phallus and phallic guide. G. Ventral view of syntergosternite 8 without phallus. H. Left lateral view of ovipositor. I. Dorsal

view of ovipositor.

Bonn zoological Bulletin 68 (1): 31-60 ©ZFMK

New data on Mediterranean Pipunculidae 39

Fig. 5. Male 7? pugiunculus Kehlmaier & Gibbs sp. n. A. Left lateral view; paratype. B. Dorsal view; paratype. C. Anterior view

of left hind leg; holotype.

tween tergite 7 and 8 constricted. Tergite 9 with weak

lateral flanges in its middle. Piercer almost three times

length of base. In lateral view (Fig. 4H), piercer straight,

reaching posterior margin of sternite 3.

Type material HOLOTYPE <, SPAIN: Mallorca,

Cala Figuera, 39°56'56"N 3°10'18"E, 92 m, 21.v.2007,

D.J. Gibbs [SMTD]. PARATYPES: same data as ho-

lotype [1¢, PCDG; 14, BMNH; 1, OUMNH]; same

Table 1. Species list of Pipunculidae of The Albufera Interna-

tional Biodiversity Project (TAIB) (Spain, Mallorca). The list is

based on the herein presented records, partly published in Rid-

diford (2006 — records from 2001), Riddiford & Férriz (2007

— records from 2006) and previously unpublished records from

2007. Total: 20 species.

Cephalops vittipes (Zetterstedt, 1844)

Clistoabdominalis dilatatus (De Meyer, 1997)

Clistoabdominalis imitator (De Meyer, 1995)

Eudorylas bermeri Kehlmaier, 2005

Eudorylas mediterraneus De Meyer & Ackland, 1997

Eudorylas obliquus Coe, 1966

Eudorylas venturai Kehlmaier, 2005

Eudorylas wahisi De Meyer, 1997

Pipunculus aff. carlestolrai Kuznetzov, 1993

Pipunculus lenis Kuznetzov, 1991

Tomosvaryella cilitarsis (Strobl, 1910)

Tomosvaryella frontata (Becker, 1897)

Tomosvaryella geniculata (Meigen, 1824)

Tomosvaryella kuthyi (Aczél, 1944)

Tomosvaryella osito KehImaier, Gibbs & Withers sp. n.

Tomosvaryella pugiunculus Kehlmaier & Gibbs sp. n.

Tomosvaryella resurgens De Meyer, 1997

Tomosvaryella sepulta De Meyer, 1997

Tomosvaryella trichotibialis De Meyer, 1995

Verrallia aucta (Fallén, 1817)

Bonn zoological Bulletin 68 (1): 31-60

data as holotype [12, PCDG]; same data as holotype

[12, SMTD]; Mallorca, Puig de Sant Marti, 39°49'29"N

3°05'51"E, 19.v.2007, D.J. Gibbs [14', PCDG]; same

data as previous, 23.iv.2006 [14, PCDG]; Mallorca, Sa

Moleta, 712 m, 39°49'41"N 2°49'03"E, 21.v.2007, D.J.

Gibbs [14, PCDG; 14, BMNH; 1<', OUMNH]; Mallor-

ca, Sa Coveta Negra, 39°47'24"N 2°53'28"E, 21.v.2007,

D.J. Gibbs [14, PCDG; 14, BMNH].

Table 2. Species list of Pipunculidae of the Wetland Kerkini

Biodiversity Study (Greece) based on the herein presented re-

cords. Total: 22 species.

Chalarus brevicaudis Jervis, 1992

Chalarus indistinctus Jervis, 1992

Chalarus spurius (Fallén, 1816)

Verrallia aucta (Fallén, 1817)

Nephrocerus scutellatus (Macquart, 1834)

Cephalops (Semicephalops) straminipes (Becker, 1900)

Clistoabdominalis ruralis (Meigen, 1824)

Dorylomorpha imparata (Collin, 1937)

Dorylomorpha lautereri Albrecht, 1990

Eudorylas fluviatilis (Becker, 1900)

Eudorylas obliquus Coe, 1966

Eudorylas pannonicus (Becker, 1897)

Eudorylas trigonus (Becker, 1921)

Eudorylas unicolor (Zetterstedt, 1844)

Eudorylas zermattensis (Becker, 1897)

Tomosvaryella cilifemorata (Becker, 1907)

Tomosvaryella coquilletti (Kertész, 1907)

Tomosvaryella freidbergi De Meyer, 1995

Tomosvaryella geniculata (Meigen, 1824)

Tomosvaryella inermis De Meyer, 1995

Tomosvaryella israelensis De Meyer, 1995

Tomosvaryella kuthyi Aczél, 1944

©ZFMK

40 Christian Kehlmaier et al.

Etymology. The species epithet pugiunculus is Latin for

‘stiletto’, a little dagger, referring to the dorsal shape of

the ovipositor. The specific epithet is to be treated as a

noun in apposition.

FAUNISTICS

In this section we report the new material collected from

field excursions and new material studied from the col-

lections mentioned above, listed alphabetically following

the current subfamily and tribal classification (KehImai-

er et al. 2014, Raffael & De Meyer 1992). In the course

of this study, the presence of many species could be es-

tablished for various countries for the first time (marked

with an asterisk (*) after the country’s name). Appendix

II summarises these findings, providing species lists for

those countries, whose pipunculid fauna has not been

summarised in the past years, 1.e., Cyprus, Egypt, Greece,

Malta, Morocco, Tunisia, and Turkey. Tables 1—2 provide

species lists for two biodiversity studies, one conducted

at S’Albufera Natural Park (Mallorca, Spain) (Table 1)

and the second at Lake Kerkini and its associated Nature

Reserves (northern Greece) (Table 2).

CHALARINAE

Chalarus brevicaudis Jervis, 1992

GREECE*: Kendriki Makedonia, Kerkini, Ecotourism

site, 41°08'15.6"N 23°13'01.2"E, 45 m, 11-17.vii.2006,

G. Ramel, det. D.J. Gibbs [1 2, BMNH]. SPAIN: Madrid,

Monte de El Pardo, El Goloso, 40°31'14"N 3°44'42"W,

750 m, MT, 9-16.vi.1991, J.L. Nieves & C. Rey [16,

MNCN].

Chalarus exiguus (Haliday, 1833)

SPAIN: Madrid, Sierra de Guadarrama, Cercedil-

la, Estacion Bioldgica El Ventorrillo, 40°45'16.5"N

4°01'15.5"W, 1450 m, MT, 1-6.vi.1990, J.L. Nieves &

C. Rey [12, MNCN].

Chalarus fimbriatus Coe, 1966

FRANCE: Corsica, Forét d’Agnone, Vizzavona, 910 m,

30-31.v.2000, A.C. Pont, det. D.J. Gibbs [19, BMNH].

Chalarus indistinctus Jervis, 1992

FRANCE: Pyrénées-Orientales, forét de la Massane,

Col del Pal, 20.viii.2009, J. Garrigue, det. P. Withers [16',

PCPW]. GREECE*: Kendriki Makedonia, Kerkini, Be-

les, 41°17'19.5"N 23°12'18.4"E, 550 m, 11—17.1v.2005,

G. Ramel, det. D.J. Gibbs [12, BMNH]. SPAIN: Canta-

Bonn zoological Bulletin 68 (1): 31-60

bria, San Pedro de Bedoya, MT, 17—30.vu1i.1990, C. Rey

[329, MNCN].

Chalarus juliae Jervis, 1992

SPAIN: Madrid, Sierra de Guadarrama, Cercedil-

la, Estacion Bioldgica El Ventorrillo, 40°45'16.5'N

4°01'15.5'W, 1450 m, MT, 18—25.vili.1989, J.L.

Nieves & C. Rey [14¢, MNCN].

Chalarus latifrons Hardy, 1943

FRANCE: Alpes-Maritimes, Col du Méercantour,

29 viii.2010, P. Withers, det. P. Withers [1<', PCPW].

Chalarus spurius (Fallén, 1816)

FRANCE: Ardeéche, forét de Paiolive, Bildon, 29.vi—

21.vii.2011, M. Speight & E. Castella, det. P. Withers

[14, PCPW]; Pyrénées Orientales, forét de la Massane,

Ripisylve, 10.vi.2009, J. Garrigue, det. P. Withers [1¢,

PCPW]; Corsica, Forét d’Agnone, Vizzavona, 910 m,

30-31.v.2000, A.C. Pont, det. D.J. Gibbs [19, BMNH];

same data as previous, 1—2.vi.2000 [229, BMNH].

GREECE*: Kendriki Makedonia, Kerkini, Beles,

41°17'19"N 23°12'18"E, 25.1v—1.v.2005, G. Ramel, det.

D.J. Gibbs [19, PCDG]; same data as previous, 30.v—5.

v1.2005 [22 2, PCDG]. SPAIN: Madrid, Sierra de Gua-

darrama, Cercedilla, Estacion Bioldgica El Ventorrillo,

40°45'16.5"N 4°01'15.5''W, 1450 m, MT, 1-7.v.1990,

J.L. Nieves & C. Rey [192, MNCN]; same data as previ-

ous, 7-15.v.1990 [49 9, MNCN]; same data as previous,

15-22.v.1990 [429°, MNCN]; same data as previous,

23-31.v.1990 [329, MNCN]; same data as previous,

9-16.vi.1989 [229, MNCN]; same data as previous,

30.vi-6.vii.1989 [14, MNCN]; same data as previous,

10.vi1.1991 [12, MNCN]; same data as previous, 21—28.

1x.1989 [12, MNCN]; Gerona, Caralps, 1200-1300 m,

13-17.v1.1982, S. Andersen, L. Lyneborg, V. Michelsen

[14, ZMUC].

Chalarus zyginae Jervis, 1992

SPAIN*: Madrid, Monte de El Pardo, El Goloso,

40°31'14"N 3°44'42"W, 750 m, MT, 24-31.vii.1991, J.L.

Nieves & C. Rey [12, MNCN]; same data as previous,

1-8 viii.1991 [1¢ 399, MNCN; 19, PCCK]; Cantabria,

San Pedro de Bedoya, MT, 17—30.viii.1990, C. Rey [19,

MNCN].

Remarks. Previously C. zyginae has only been recorded

from the type specimens, reared from Zygina suavis Rey,

1891 (Hemiptera: Cicadellidae: Typhlocybinae) collect-

ed in Italy. The total body size of the specimens studied

here lies between 1.7 and 2.3 mm, fitting well to the spe-

cies concept presented in Jervis (1992).

©ZFMK

New data on Mediterranean Pipunculidae 4]

Jassidophaga pilosa (Zetterstedt, 1838)

FRANCE*: Pyrénées-Orientales, forét de la Massane,

réserve intégrale, 14.v.2009, J. Garrigue, det. P. Withers

[329, PCPW].

Jassidophaga villosa (von Roser, 1840)

FRANCE: Ardeche, forét de Paiolive, Langarneyre,

28.iv—25.v.2010, M. Speight & E. Castella, det. P. With-

ers [39 2, PCPW]; Ardeche, forét de Paiolive, Combe de

Bouse, 8—28.1v.2010, M. Speight & E. Castella, det. P.

Withers [1¢, PCPW]; Ardéche, forét de Paiolive, Gran-

zon, 28.1v—25.v.2010, M. Speight & E. Castella, det. P.

Withers [19, PCPW]. SPAIN: Gerona, Caralps, 1200-

1300 m, 13—17.v1.1982, S. Andersen, L. Lyneborg, V.

Michelsen [19, ZMUC].

Remarks. First French records with locality data. Previ-

ously, only a country record of unknown provenance was

published (De Meyer 1992; Withers 2006).

Verrallia aucta (Fallén, 1817)

CYPRUS*: Diarizos Valley, Nikoklela, 70 m, 23.iv.2002,

M.J. Ebejer, det. D.J. Gibbs [1¢, PCME]. FRANCE: Ar-

déche, forét de Paiolive, Hermitage, 28.1v—23.v.2010, M.

Speight & E. Castella, det. P. Withers [19, PCPW]; Ar-

deche, forét de Paiolive, 23.v—26.v1.2010, M. Speight &

E. Castella, det. P. Withers [1¢, PCPW]; Ardéche, forét

de Paiolive, Combe des Bouses, 28.1v—25.v.2010, M.

Speight & E. Castella, det. P. Withers [1¢', PCPW]; Ar-

deche, forét de Paiolive, Montchamp, 24.v—31.v1.2009,

M. Speight & E. Castella, det. P. Withers [1¢, PCPW];

Ardeéche, forét de Paiolive, Langarneyre, 26.vi—10.

vii.2010, M. Speight & E. Castella, det. P. Withers [1¢,

PCPW]; Ardeéche, forét de Paiolive, Chibasse, 25.v—27.

vi.2010 M. Speight & E. Castella, det. P. Withers [1¢,

PCPW]. GREECE*: Peloponnisos, Taiyetos mountains,

950-1800 m, 15—19.v.1990, ZMCE [12 (DNA CKS583,

ENA LT999989), ZMUC]; Kendriki Makedonia, Kerki-

ni, Ecotourism site, 41°08'15.6"N 23°13'01.2"E, 45 m,

16—22.v.2006, G. Ramel, det. D.J. Gibbs [19, BMNH];

Kendriki Makedonia, Kerkini, Kerkini marsh site,

41°13'32.8"N 23°05'04.2"E, 45 m, 25.iv—1.v.2007, G.

Ramel, det. D.J. Gibbs [12, BMNH]. PORTUGAL: Al-

garve, Albufeira, 27.11—4.111.1988, A.E. Stubbs, det. D.J.

Gibbs [1', PCDG]. SPAIN: Salamanca, Villar de Cier-

vo, Las Coronas, 17—21.v.2005, H.-P. Tschorsnig [1<,

PCCK]; Gerona, Caralps, 1200-1300 m, 13-16.vi.1982,

S. Andersen, L. Lyneborg, V. Michelsen [19, ZMUC];

Madrid, Sierra de Guadarrama, Cercedilla, Estacion

Biologica El Ventorrillo, 40°45'16.5"N 4°01'15.5'"W,

1450 m, MT, 1-6.v1.1990, J.L. Nieves & C. Rey [18,

MNCN]; same data as previous, 16—22.vi.1989 [19,

MNCN]; same data as previous, 22—30.vi.1989 [29°,

Bonn zoological Bulletin 68 (1): 31-60

MNCN]; same data as previous, 30.vi-6.vii.1989

[329, MNCN]; same data as previous, 6—14.v11.1989

[12, MNCN]; same data as previous, 12.vii.1991 [19,

MNCN]; same data as previous, 14—21 .vii.1989 [29 9,

MNCN]; same data as previous, 20—28.vii.1989 [19,

MNCN]; same data as previous, 28 .vii-4.vili.1989 [19,

MNCN]; Mallorca, Puig de Sant Marti, 39°49'29"N

3°05'S1"E, 23.1v.2006, D.J. Gibbs, det. D.J. Gibbs [72 8,

PCDG]; 16.1v.2001, Mallorca, S’Albufera, Es Comu,

M.J. Ebejer, det. M.J. Ebejer [14, PCME]. TUNISIA*:

Tabarka area, 7—-18.v.1988, ZMCE [2° 2 (Jeff Skeving-

ton specimen # 8542 & 8543; 192 DNA CK582, ENA

LT999990), ZMUC].

NEPHROCERINAE

Nephrocerus scutellatus (Macquart, 1834)

FRANCE: Ardéche, forét de Paiolive, Combe de Bouse,

25.v—26.v1.2010, M. Speight & E. Castella, det. P. With-

ers [1¢, PCPW]; Ardéche, forét de Paiolive, Bildon,

6—28.iv.2010, M. Speight & E. Castella, det. P. Withers

[14, PCPW]; Ardéche, forét de Paiolive, Montchamp,

28.iv—22.v.2010, M. Speight & E. Castella, det. P. Withers

[14, PCPW]; same data as previous, 6.v—29.vi.2011, M.

Speight & E. Castella, det. P. Withers [1', PCPW]; Ar-

deche, forét de Paiolive, Langarneyre, 28.1v—25.v.2010,

M. Speight & E. Castella, det. P. Withers [1¢, PCPW];

same data as previous, 26.vi-10.vil.2010, M. Speight &

E. Castella, det. P. Withers [1¢, PCPW]; Ardéche, forét

de Paiolive, Hermitage, 8—28.1v.2010, M. Speight & E.

Castella, det. P. Withers [14, PCPW]; same data as pre-

vious, 28.1v—23.v.2010, M. Speight & E. Castella, det. P.

Withers [1<, PCPW]; Granzon, 8—28.iv.2010, M. Spei-

ght & E. Castella, det. P. Withers [1<, PCPW]; same data

as previous, 28.1v—25.v.2010, M. Speight & E. Castella,

det. P. Withers [1', PCPW]; Granzon, 25.v—27.vi.2010,

M. Speight & E. Castella, det. P. Withers [22 9, PCPW];

Ardeche, forét de Paiolive, Chibasse, 25.v—27.v1.2010,

M. Speight & E. Castella, det. P. Withers [1¢, PCPW];

Ardeche, Réserve Naturelle Nationale des Gorges de

lArdéche, 15.iv.2015, J. Claude, det. P. Withers [1¢,

PCPW]; Pyrénées-Orientales, forét de la Massane, Rip1,

3.vi.2009, J. Garrigue, det. P. Withers [1', PCPW]; Var,

Vidauban, 7.v.2014, T. Ramage, det. P. Withers [19,

PCPW]. GREECE*: Peloponnisos, 15 km N Leonidhion,

27.iv.1998, V. Michelsen [1<', ZMUC]; Thessaly, Volos,

Platania, 12.v.2005, L. & K. Standfuss [1¢, PCCK];

same data as previous, 18.v.2005 [1', PCCK]; Pelopon-

nisos, Taiyetos mountains, 950-1800 m, 15—19.v.1990,

ZMCE [43:3 ZMUC]; Ipiros, Smolikas mountains,

700-1500 m, 21—22.v.1994, V. Michelsen [19°, ZMUC];

Ipiros, Peristéri mountains, 1200-1700 m, 24—28 .v.1994,

S. Andersen [19, ZMUC]; Kendriki Makedonia, Ker-

kini, Kerkini marsh site, 41°13'32.8"N 23°05'04.2"E,

45 m, 25.iv—1.v.2007, G. Ramel, det. D.J. Gibbs [19,

©ZFMK

42 Christian Kehlmaier et al.

BMNH]; Kendriki Makedonia, Kerkini, Krousia mts.

site, 41°11'32.4'N 23°03'59.5"E, 190 m, 30.v—5.v1.2007,

G. Ramel, det. D.J. Gibbs [1 9, BMNH]; Kendriki Make-

donia, Kerkini, Ramna site, 41°17'43’N 23°11'33"E

750 m, 16—22.vi.2008, G. Ramel, det. D.J. Gibbs [1¢,

PCDG]. SPAIN: Lerida, Sorpe, 1200-1300 m, 19-22.

vi.1982, S. Andersen, L. Lyneborg, V. Michelsen [724

coll. ZMUC].

PIPUNCULINAE

PIPUNCULINI

Pipunculus campestris Latreille, 1802

SPAIN: Pontevedra, Sanxenxo, 42°24'53.1'"N,

8°52'04.7"'W, 6 m, 24.viii.2008, R. Andrade [1,

PCCK]; Gerona, Caralps, 1200-1300 m, 13—17.vi.1982,

S. Andersen, L. Lyneborg, V. Michelsen [44'3', ZMUC].

Pipunculus aff. carlestolrai Kuznetzov, 1993

FRANCE: Ardeéche, forét de Paiolive Bildon, 25.vui.2010,

M. Speight & E. Castella [14', SMTD]; Ardéche, forét

de Paiolive Bildon, Granzon, 25.vii.10, M. Speight & E.

Castella, det. P. Withers [14, PCPW]. SPAIN: Mallorca,

Puig de Sant Marti, 39°49'29"N 3°05'51"E, 23.iv.2006,

D.J. Gibbs [14 299, SMTD].

Remarks. A final taxonomic conclusion could not be es-

tablished yet. The specimens from Mallorca have been

published previously as P. carlestolrai in Riddiford &

Férriz (2007).

Pipunculus elegans Egger, 1860

FRANCE*: Ardeéche, forét de Paiolive, Langarneyre,

28.1v—25.v.2010, M. Speight & E. Castella, det. P. With-

ers [14 PCPW].

Pipunculus lenis Kuznetzov, 1991

FRANCE: Ardeéche, forét de Paiolive, Combe des Bous-

es, 25.v—26.v.2010, M. Speight & E. Castella, det. P.

Withers [12, PCPW]. SPAIN: Mallorca, S’Oliveret

d’Abaix, Alaré, 28.v.2007, J. Lilla, det. D.J. Gibbs [19,

PCDG]; Burgos, near Ona, 19.vi.1980, P.J. Chandler, det.

P.J. Chandler [1', PCPC].

Pipunculus oldenbergi Collin, 1956

SPAIN*: Asturias, Covadonga, 11.v.1928, J. Dusmet

[14, MNCN].

Bonn zoological Bulletin 68 (1): 31-60

Pipunculus tenuirostis Kozanek, 1981

FRANCE: Ardeche, forét de Paiolive, Hermitage, 9-28.

iv.2010, M. Speight & E. Castella, det. P. Withers [2° 9,

PCPW].

Pipunculus tumbarinus Kehlmaier, 2010

TUNISIA*: 13 km N Ain Draham, 22—24.111.1986,

ZMCE [1¢, ZMUC]; 5 km E Tamera, 21-25 .iii.1986,

ZMCE [14,, ZMUC]; Ain Draham area, 5—18.v.1988,

ZMCE [14 (DNA CK581, ENA LT999988), ZMUC].

Remarks. Species only known previously from its type

locality on Sardinia, Italy.

Pipunculus zugmayeriae Kowarz, 1887

SPAIN*: Logrofio, Villanueva de Cameros, 20.v1.1980,

PJ. Chandler, det. PJ. Chandler, vid. D.J. Gibbs [1-,

PERCH

CEPHALOPSINI

Cephalops (Cephalops) aeneus Fallen, 1810

FRANCE: Ardeéche, forét de Paiolive, Montchamp,

30.vill—29.1x.2011, M. Speight & E. Castella, det. P.

Withers [12, PCPW]. ITALY: Sicily, Catania, Etna, Pia-

no della Donne, 1450 m, 5.v1.1999, M.J. Ebejer, det. M.J.

Ebejer [1<, PCME].

Cephalops (Cephalops) conjunctivus Coe, 1958

FRANCE: Ardeche, forét de Paiolive, Langarneyre,

30.ix.10, M. Speight & E. Castella, det. P. Withers [16',

PCPW]; Granzon, 25.v—27.v1.2010, M. Speight & E.

Castella, det. P. Withers [1¢, PCPW]. SPAIN: Malaga,

Sierra de Tejeda, Maro, 19.1v.1997, C.J. Palmer, det. D.J.

Gibbs [192, C.J. Palmer]; Valencia, Fuente del Abrulla-

dor, Chella, 39°02'32"'N 0°40'50"'W, 25.v.2006, S. Mon-

tagud et al. [1¢, MVHN (Cod. 280308MP22)]; Andalu-

cia, W of Capilerilla, 36°56'21"N 3°20'26"W, 1480 m,

7.vi.2008, D.J. Gibbs, det. D.J. Gibbs [1¢, PCDG];

Madrid, Monte de El Pardo, El Goloso, 40°31'14"N

3°44'42"W, 750 m, 1-8.vi.1991, J.L. Nieves & C. Rey

[12, MNCN]; same data as previous, 9-16.vi.1991 [1¢,

MNCN]; Madrid, El Boalo, 40°43'19"N 3°55'03"W,

940 m, 22-28 .vi.1998, F. Fontal [1d 192, MNCN]; Jaén,

Sierra de Cazorla, Roblehondo, 1300 m, 23—29.v1.1993,

J.L. Nieves [19, MNCN]; Madrid, Monte de El Pardo, El

Goloso, 40°31'14"N 3°44'42"W, 750 m, 17—23.1x.1991,

J.L. Nieves & C. Rey [2¢'4, MNCN]; same data as pre-

vious, 1—8.x.1991 [22 2, PCCK]; same data as previous,

9-17.x.1991 [14 PCCK]. TURKEY: Antalya, 40 km

©ZFMK

New data on Mediterranean Pipunculidae 43

N of Akseki, 1700 m, 28.ix.2006, N. Vikhrev, det. DJ.

Gibbs [13, PCNV].

Cephalops (Cephalops) vittipes (Zetterstedt, 1844)

FRANCE: Ardeéche, forét de Paiolive, Baildon,

25.vili.2010, M. Speight & E. Castella, det. P. Withers

[12, PCPW]. SPAIN*: Mallorca, S’Albufera, Es Comu,

39°46'34"N 3°08'27"E, 2 m, 18.v.2007, D.J. Gibbs, det.

D.J. Gibbs [1¢, PCDG]; Mallorca, Puig de Sant Marti,

39°49'29"N 3°05'51"E, 19.v.2007, D.J. Gibbs, det. D.J.

Gibbs [19°, PCDG].

Cephalops (Parabeckerias) obtusinervis (Zetterstedt,

1844)

GREECE*: Peloponnisos, Taiyetos mountains, 950-

1800 m, 15—19.v.1990, ZMCE [12, ZMUC].

Cephalops (Semicephalops) grandimembranus De Mey-

erlOsg

FRANCE*: Ardéche, forét de Paiolive, Chibassse,

28.iv—25.v.2010, M. Speight & E. Castella, det. P. With-

ers [14,, PCPW]; Bildon, 28.vii-31.viii.2010, M. Spei-

ght & E. Castella, det. P. Withers [14, PCPW].

Remarks. This species was formerly only known from

its type locality in southern Germany (Bavaria, Hohena-

schau im Chiemgau).

Cephalops (Semicephalops) penultimus Ackland, 1993

SPAIN*: Madrid, Sierra de Guadarrama, Cercedil-

la, Estacion Biologica El Ventorrillo, 40°45'16.5"N

4°01'15.5"W, 1450 m, 6-14.vii.1989, J.L. Nieves &

C. Rey [1¢, MNCN]; same data as previous, 20-28.

vii. 1989 [12, MNCN]; same data as previous, 28.vii-4.

viii. 1989 [1¢ 12, PCCK; 12, MNCN]; same data as pre-

vious, 11—18.viii.1989 [1<, MNCN]; same data as previ-

ous, 25.—31.vili.1989 [12, MNCN].

Remarks. The specimens cited in Kehlmaier (2001) un-

der the name Cephalops subultimus Collin, 1956 were

misidentified and actually belong to C. penultimus.

Cephalops subultimus must be deleted from the Span-

ish checklist as no other Spanish record of this species

is known or published. Cephalops penultimus has only

recently been described and detailed figures and a key

for identification are provided by Ackland (1993). So far,

C. penultimus is known from Belgium, France, Germany,

Great Britain, Portugal, and Spain.

Bonn zoological Bulletin 68 (1): 31-60

Cephalops (Semicephalops) perspicuus (de Meijere, 1907)

GREECE*: Peloponnisos, 5 km S Monemvasia,

17.vi.1984, G. Christensen [1.<', ZMUC].

Cephalops (Semicephalops) straminipes (Becker, 1900)

GREECE®*: Kendriki Makedonia, Kerkini, Kerkini lake

site, 41°09'06.5"N 23°11'55.0"E, 75 m, 9-15.v.2005, G.

Ramel, det. D.J. Gibbs [12, BMNH].

Cephalops (Semicephalops) subultimus Collin, 1956

FRANCE: Ardeéche, forét de Paiolive, Granzon, 25.v—

27.vi.2010, M. Speight & E. Castella, det. P. Withers

[14, PCPW]; Chibasse, 28.iv—25.v.2010, M. Speight &

E. Castella, det. P. Withers [14¢, PCPW].

Cephalops (Semicephalops) ultimus (Becker, 1900)

FRANCE: Ardeéche, forét de Paiolive, Granzon,

30.1x.2010, M. Speight & E. Castella, det. P. With-

ers [1¢, PCPW]. SPAIN: Madrid, Sierra de Guadar-

rama, Cercedilla, Estacion Biologica El Ventorrillo,

40°45'16.5'"N 4°01'15.5"W, 1450 m, 6-14. vii.1989, J.L.

Nieves & C. Rey [2¢'¢, MNCN]; same data as previ-

ous, 14—21.vii.1989 [19, MNCN]; Asturias, Tanda, 2—9.

vill. 1993, C. Rey [12, MNCN]; Madrid, Sierra de Gua-

darrama, Cercedilla, Estacion Bioldgica El Ventorrillo,

40°45'16.5"N 4°01'15.5'"W, 1450 m, 21—28.1x.1989, J.L.

Nieves & C. Rey [12, MNCN]. TURKEY*: Isparta,

Kovada, 7.vii.1997, M.J. Ebejer, det. D.J. Gibbs [1¢,

PCME]; Mugla, Marmaris, 14.v11.1997, M.J. Ebejer, det.

D.J. Gibbs [344 M.J. Ebejer].

Remarks. The recently described Cephalops lusitan-

icus Kehlmaier & Andrade, 2016 from Portugal stands

very close to C. u/timus. A separation of these species

based on external morphology and genitalic characters is

provided in Kehlmaier & Andrade (2016). Female speci-

mens of C. ultimus from the Mediterranean tend to have

yellowish abdominal markings as seen in C. perspicuus.

Hence, a closer look at the female ovipositor is necessary

to distinguish the C. u/timus from C. perspicuus (see Ke-

hlmaier & Andrade 2016).

Cephalops (Semicephalops) varipes (Meigen, 1824)

SPAIN: Madrid, Sierra de Guadarrama, Cercedil-

la, Estacion Biologica El Ventorrillo, 40°45'16.5"N

4°01'15.5"W, 1450 m, 28. vil-4.vill.1989, J.L. Nieves &

C. Rey [12, MNCN]; same data as previous, 11-18.

vill. 1989 [19, MNCN].

Remarks. The holotype of Pipunculus varipes Meigen,

1824 was recently studied and found to be the senior syn-

©ZFMK

44 Christian Kehlmaier et al.

onym of Pipunculus semifumosus Kowarz, 1887 (Kehl-

maier 2008b).

Cephalosphaera (Cephalosphaera) furcata (Egger, 1860)

FRANCE: Corsica, Forét d’Agnone, Vizzavona, 910 m,

28-29 v.2000, A.C. Pont, det. D.J. Gibbs [16', BMNH].

Cephalosphaera (Cephalosphaera) germanica Aczél, 1940

FRANCE: Ardéche, forét de Paiolive, Chibasse, 8-28.

iv.2010, M. Speight & E. Castella, det. P. Withers [19,

PCPW]; Pyrénées-Orientales, forét de la Massane, ré-

serve intégrale, 14.v.2009, J. Garrigue, det. P. Withers

[12, PCPW]. SPAIN: Jaén, Sierra de Cazorla, Ro-

blehondo, 1300 m, 28.v—15.vi.1993, J.L. Nieves [19,

MNCN]; Soria, San Leonardo de Yagtie, 15.v1.1991, C.

Rey [12, MNCN]; Madrid, Sierra de Guadarrama, Cer-

cedilla, Estacion Bioldgica El Ventorrillo, 40°45'16.5'"N

4°01'15.5''W, 1450 m, 9-16.vi.1989, J.L. Nieves & C.

Rey [1¢, MNCN]; Jaén, Sierra de Cazorla, Roblehondo,

1300 m, 23—29.v1.1993, J.L. Nieves [192, MNCN]; Ma-

drid, Sierra de Guadarrama, Cercedilla, Estacion Biologi-

ca El Ventorrillo, 40°45'16.5"N 4°01'15.5"W, 1450 m,

6—14.vii.1989, J.L. Nieves & C. Rey [1¢, MNCN].

EUDORYLINI

Claraeola conjuncta (Collin, 1949)

TUNISIA*: 15 km NW Kebili, 17.iii. 1986, ZMCE [1¢,

ZMUC].

Remarks. The species was redescribed by Kehlmaier

(2005b).

Clistoabdominalis dilatatus (De Meyer, 1997)

FRANCE: Ardeéche, forét de Paiolive, Combe de Bouse,

28.iv—25.v.2010, M. Speight & E. Castella, det. P. With-

ers [1<, PCPW]; Pyrénées-Orientales, forét de la Mas-

sane, Col del Pal, 8.vii.2009, J. Garrigue, det. P. With-

ers [1¢, PCPW]; same data as previous, 20.viii.2009, J.

Garrigue, det. P. Withers [1¢', PCPW]. SPAIN: Valen-

cia, Losa del Obispo, 39°42'02'"'N 0°52'09""W, 3.iv.2008,

S. Teruel [14, MVHN (Cod. 270308SM38)]; Asturias,

Corros (de Parcal), 10.v.1990, C. Rey [14', MNCN]; Sal-

amanca, Villar de Ciervo, Las Coronas, 17—21.v.2005,

H.-P. Tschorsnig [1<, PCCK]; Mallorca, S’Albufera,

Es Comu, 39°46'34"N 3°08'27”E, 2 m, 20.iv.2006, D.J.

Gibbs, det. D.J. Gibbs [46'3' 299, PCDG]; Mallorca,

Puig de Sant Marti, 39°49'29"N 3°05'51"E, 23.iv.2006,

D.J. Gibbs, det. D.J. Gibbs [1', PCDG]; Mallorca, S’ Al-

bufera, Es Comu, dunes, 39°46'34"N 3°08'27”"E, 2 m,

25.iv.2006, D.J. Gibbs, det. D.J. Gibbs [1 2, PCDG].

Bonn zoological Bulletin 68 (1): 31-60

Clistoabdominalis imitator (De Meyer, 1995)

SPAIN: Mallorca, Puig de Sant Marti, 39°49'29"N

3°05'51"E, 19.v.2007, D.J. Gibbs, det. D.J. Gibbs [13

12, PCDG].

Clistoabdominalis ruralis (Meigen, 1824)

FRANCE: Alpes-Maritimes, Biot, 20—26.1x.2010, A.

Piton, det. P. Withers [1<4, PCPW]; Ardéche, forét de

Paiolive, Montchamp, 28.vii—31.viil.2010, M. Speight &

E. Castella, det. P. Withers [1', PCPW]. GREECE: Chi-

os, Thimiana, 38°17'87"N 26°07'89"E, 6—16.v.2003, C.J.

Palmer, det. D.J. Gibbs [2¢'3', C.J. Palmer]; Kendriki

Makedonia, Kerkini, Pumping station site, 41°12'48.7'"N

23°06'11.9"E, 40 m, 13—19.vi.2007, G. Ramel, det. D.J.

Gibbs [24'3', BMNH]; Kendriki Makedonia, Kerkini,

Kerkini lake site, 41°09'06.5"N 23°11'55.0"E, 75 m,

9-15.v.2005, G. Ramel, det. D.J. Gibbs [14, BMNH];

Kendriki Makedonia, Kerkini, Krousia Mts. site,

41°11'32.4"N 23°03'59.5"E, 190 m, 4—10.vil.2007, G.

Ramel, D.J. Gibbs [1<', BMNH]; Kendriki Makedonia,

Kerkini, Krousia Mts. site, 41°11'32.4""N 23°03'59.5"E,

190 m, 30.v—5.vi.2007, G. Ramel, det. D.J. Gibbs [14,

BMNH]; Peloponnisos, Monemvasia, 8.xi1.1984, G.

Christensen [16', ZMUC]. MALTA: Buskelt, 9.vii.1993,

M.J. Ebejer, det. D.J. Gibbs [14', PCDG]. TURKEY: An-

talya, Side, dunes, 30.1x.2007, N. Vikhrev, det. D.J.Gibbs

[1¢, PCDG].

Clistoabdominalis trochanteratus (Becker, 1900)

EGYPT: Safaga, 27.1.2007, N. Vikhrev, det. D.J. Gibbs

(344, PCDG]. TUNISIA*: Nefta area, 1-4.v.1988,

ZMCE [14, ZMUC].

Remarks. Clistoabdominalis trochanteratus 1s widely

distributed and most likely represents a species complex

(Skevington et al. 2007). The type locality is “Assiut,

Luxor” in Egypt. From the Palaearctic, it has also been

cited from Portugal (Kehlmaier & Andrade 2016), the

Asian part of Turkey (Kehlmaier 2005a), and Iran (Ma-

jnon Jahromi et al. 2017a).

Clistoabdominalis tumidus (De Meyer, 1997)

FRANCE: Ardéche, forét de Paiolive, Chibasse, 25.v—

27.v1.2010, M. Speight & E. Castella, det. P. Withers

[14, PCPW]; Ardéche, forét de Paiolive, Montchamp,

29.vi-21.vil.2011, M. Speight & E. Castella, det. P.

Withers [1', PCPW]; Ardéche, forét de Paiolive, Gran-

zon, 6.v—29.vi.2011, M. Speight & E. Castella, det. P.

Withers [1', PCPW]; same data as previous, 29.vi-21.

vii.2011, M. Speight & E. Castella, det. P. Withers [13',

PCPW]. GREECE: Peloponnisos, Taiyetos mountains,

950-1800 m, 15-19.v.1990, ZMCE [1¢', ZMUC].

©ZFMK

New data on Mediterranean Pipunculidae 45

Dasydorylas gradus Kehlmaier, 2005

TURKEY*: 30.v.2008, Antalia,

Vikhrev, det. D.J. Gibbs [16', PCDG].

Gundogmus, N.

Remarks. A distinctive species, formerly known only

from Israel (Kehlmaier 2005b).

Dasydorylas holosericeus (Becker, 1987)

FRANCE: Ardeéche, forét de Paiolive, Combe de Bouse,

8—28.1v.2010, M. Speight & E. Castella, det. P. Withers

[14, PCPW]; same data as previous, 8.ix—4.x.2010, M.

Speight & E. Castella, det. P. Withers [1', PCPW]; Ar-

deche, forét de Paiolive, Langarneyre, 26.vi-10.vii.2010,

M. Speight & E. Castella, det. P. Withers [1¢, PCPW];

same data as previous, 28.vii—3.vill.2010, M. Speight &

E. Castella, det. P. Withers [1¢, PCPW]; Ardéche, forét

de Paiolive, Granzon, 29.vi-21.vii.2011, M. Speight & E.

Castella, det. P. Withers [1¢, PCPW]. GREECE*: Ken-

driki Makedonia, Kerkini, Procom site, 41°22'38.1"N

23°21'58.8"E, 60 m, 27.vi-3.vil.2007, G. Ramel, det.

D.J. Gibbs [14¢, PCDG]. SPAIN*: Gerona, Caralps,

1200-1300 m, 13—17.vi.1982, S. Andersen, L. Lyneborg,

V. Michelsen [1', ZMUC].

Remarks. First reliable citing from Spain. A previous

Spanish record, as FE. demeyeri Kozanek, 1993 (see

Kehlmaier 2005a for synonymy), needs confirmation due

to a possible confusion with Dasydorylas roseri (Becker,

1897). The type material of E. demeyeri proved to be a

mixture of D. holosericeus and D. roseri, but the identity

of the single Spanish paratype could not be revalidated

so far.

Dasydorylas horridus (Becker, 1897)

FRANCE: Ardeéche, forét de Paiolive, Granzon, 28.1v—

25.v.2010, M. Speight & E. Castella, det. P. Withers [1¢,

PCPW]; Ardeéche, forét de Paiolive, Chibasse, 28.1v—

25.v.2010, M. Speight & E. Castella, det. P. Withers [1¢,

PCPW].

Dasydorylas setosus (Becker, 1908)

SPAIN: Canary Islands, Tenerife, Monte Aguirre, v.1927,

A. Cabrera [1¢, MNCN]; Canary Islands, Tenerife,

Médano, 18.iv.1930, A. Cabrera [14, MNCN]; Canary

Islands, Tenerife, Monte Aguirre, xi1.1934, A. Cabrera

[12, MNCN].

Eudorylas angustimembranus (Kozanek, 1991)

FRANCE*: Ardeche, forét de Paiolive, Bildon, 28.vii—

31.vill.2010, M. Speight & E. Castella, det. P. Withers

Bonn zoological Bulletin 68 (1): 31-60

[14, PCPW]; same data as previous, 30.ix.2010, M.

Speight & E. Castella, det. P. Withers [1¢', PCPW].

Eudorylas bermeri Kehlmaier, 2005

SPAIN: Granada, Barranco de Miranda, 8 km SW Or-

giva, 300 m, 20.iv.1966, L. Lyneborg & M. Lange-

mark [14, ZMUC]; Mallorca, S’Albufera, Es Comt,

39°46'34"N 3°08'27"E, 2 m, 25.iv.2006, det. D.J. Gibbs

[14¢, PCDG]; Almeria, Adra, 36°47'10"N, 3°5'44.5'"'W,

433 m, 9.v.2012, R. Andrade [1¢ 19, PCCK]; Ibiza,

Torre de Ses Portes, P.N. Ses Salines, 30.v.2006, M.J.

Ebejer, det. D.J. Gibbs [12, PCDG].

Remarks. First citing for mainland Spain; previously re-

corded from Mallorca (Balearic Islands) by Riddiford &

Férriz (2007).

Eudorylas blascoi De Meyer, 1997

FRANCE: Pyrénées-Orientales, forét de la Massane,

Col del Pal, 29.vii.2009, J. Garrigue, det. P. Withers

[14, PCPW]; Var, Vidauban, 7.v.2014, T. Ramage, det.

P. Withers [1¢, PCPW]. GREECE*: Chios, Thimiana,

38°17'87"N 26°07'89"E, 6-16.v.2003, C.J. Palmer, det.

D.J. Gibbs [19, PCCP]; Kendriki, Makedonia, Thes-

saloniki, Limni Volvi, 10.v.1998, M.J. Ebejer, det. D.J.

Gibbs [14, PCME]; Kendriki Makedonia, Kerkini, Mid-

way site, 41°18'49.8"N 23°16'35.6"E, 750 m, 30.vi-6.

vii.2008, G. Ramel, det. D.J. Gibbs [14, PCDG]; Ken-

driki Makedonia, Kerkini, Farfara site, 41°19'30"N

23°15'00"E, 750 m, 28.vii—3.vili.2008, G. Ramel, det.

D.J. Gibbs [192, PCDG]; Kendriki Makedonia, Kerki-

ni, Procom, Promohonas, 41°22'38.1''N 23°21'58.8"E,

60 m, 11—-17.vu1.2007, G. Ramel, det. D.J. Gibbs [19,

PCDG]. SPAIN: Asturias, Corros (de Parcal), 10.v.1990,

C. Rey [1d, MNCN]; Madrid, El Pardo, 7.viii.1904, J.

Arias Encobert [26'3', MNCN]. TURKEY*: Nevsehir,

Avanos, Urgiip area, 1000 m, 4-6.v.1993, V. Michelsen

[14, ZMUC].

Eudorylas fluviatilis (Becker, 1900)

GREECE*: Kendriki Makedonia, Kerkini, Ecotourism

site, 41°08'15.6"N 23°13'01"E, 65 m, 29. vili—4.1x.2006,

G. Ramel, det. D.J. Gibbs [14, PCDG]. SPAIN: Tener-

ife, Guimar, 3.iv.1973, PJ. Chandler & C.H. Jackson,

det. DJ. Gibbs [12, PCDG]; Canary Islands, Tener-

ife, Fanabe, 22.vii.1970, J.J. & A. Menier [23'¢ 229,

MNHN]; TURKEY*: Antalya, Side, 28.1x.2007, dunes,

N. Vikhrev, det. D.J. Gibbs [19, PCDG].

Eudorylas fuscipes (Zetterstedt, 1844)

FRANCE: Ardeéche, forét de Paiolive, Granzon, 25.v—

27.vi.2010, M. Speight & E. Castella, det. P. Withers

©ZFMK

46 Christian Kehlmaier et al.

[1¢, PCPW]; Ardéche, forét de Paiolive, Montchamp,

28.1v—22.v.2010, M. Speight & E. Castella, det. P. With-

ers [1, PCPW]; Ardéche, forét de Paiolive, Langarney-

re, 28.1v—25.v.2010, M. Speight & E. Castella, det. P.

Withers [16', PCPW]; Ardéche, forét de Paiolive, Her-

mitage, 23.v—26.v1.2010, M. Speight & E. Castella, det.

P. Withers [1<, PCPW]; same data as previous, 26.vi-28.

vii.2010, M. Speight & E. Castella, det. P. Withers [1¢,

PCPW]; Ardeéche, forét de Paiolive, Chibasse, 28.iv—

25.v.2010, M. Speight & E. Castella, det. P. Withers [1¢,

PCPW]. SPAIN: Cantabria, San Pedro de Bedoya, 17—

30.viii.1990, C. Rey [204 299, MNCN].

Eudorylas fusculus (Zetterstedt, 1844)

FRANCE: Alpes-Maritimes, Sophia Antipolis, 1.1x.2010,

leg., det. P. Withers [1¢, PCPW]; Ardéche, forét de

Paiolive, Bildon, 25.vi1.2010, M. Speight & E. Castella,

det. P. Withers [14, PCPW]; Var, Vidauban, 20.iv.2015,

T. Ramage, det. P. Withers [14', PCPW]; same data as

previous, 28.v.2015, T. Ramage, det. P. Withers [2¢¢4,

PCPW]; same data as previous, 8.vi.2015, T. Ramage,

det. P. Withers [26'3', PCPW]. SPAIN: Lleida, La Nogu-

era, 41°57'34.3"N, 0°51'44.2"E, 612 m, 3.viii.2014, R.

Andrade [19° PCCK].

Eudorylas ibericus Kehlmaier, 2005

FRANCE*: Ardeche, forét de Paiolive, Combe de

Bouse, 31.vili—8.1x.2010, M. Speight & E. Castella, det.

P. Withers [1', PCPW]; Ardéche, forét de Paiolive, Lan-

garneyre, 24.vi-10.vii.2010, M. Speight & E. Castella,

det. P. Withers [14, PCPW]; Ardéche, Réserve Naturelle

Nationale des Gorges de |l’Ardeche, 24.vu.2015, J.

Claude, det. P. Withers [1<4, PCPW]. MOROCCO. Itzér

area, 2100 m, 16.iv.1989, ZMCE [1¢', ZMUC]. SPAIN:

Salamanca, Villar de Ciervo, Las Coronas, 17—21.v.2005,

H.-P. Tschorsnig [19, PCCK]. TUNISIA*: Ain Draham

area, 5—18.v.1988, ZMCE [2'3', ZMUC].

Remarks. Ebejer & Kettani (2019) recently recorded fe-

males of this species from Morocco.

Eudorylas jenkinsoni Coe, 1966

FRANCE: Ardéche, forét de Paiolive, Chibasse, 25.v—

24.vi.2010, M. Speight & E. Castella, det. P. Withers [1¢,

PCPW]; Ardeche, forét de Paiolive, Bildon, 20.vii-30.

vilil.2010, M. Speight & E. Castella, det. P. Withers [1°,

PCPW]; Ardeéche, forét de Paiolive, Granzon, 25.v—27.

vi.2010, M. Speight & E. Castella, det. P. Withers [1¢,

PCPW]; same data as previous, 30.1x.2010, M. Spei-

ght & E. Castella, det. P. Withers [14, PCPW].

Bonn zoological Bulletin 68 (1): 31-60

Eudorylas johnenae Dempewolf, 1996

SPAIN*: Lleida, Sorpe, 1200-1300 m, 19—22.vi.1982, S.

Andersen, L. Lyneborg, V. Michelsen [1¢, ZMUC].

Eudorylas longifrons Coe, 1966

FRANCE: Ardeéche, forét de Paiolive, Granzon,

25.v11.2010, M. Speight & E. Castella, det. P. Withers

[14, PCPW].

Eudorylas mediterraneus De Meyer & Ackland, 1997

FRANCE: Bouches-du-Rhéne, Martigue La Revaille,

8.v.2017, P. Withers, det. P. Withers [1¢, PCPW].

GREECE: Sterea Elada, Drossohori, Parnassos Mts.,

15.v.1998, M.J. Ebejer, det. D.J. Gibbs [14', PCME].

PORTUGAL: Algarve, Albufeira, 26.1v.1989, A.E.

Stubbs, det. D.J. Gibbs [1<, PCDG]. SPAIN: Salaman-

ca, Villar de Ciervo, Las Coronas, 17—21.v.2005, H.-P.

Tschorsnig [19, PCCK]; Ibiza, Es Cavallet, P.N. Ses

Salines, 1.vi.2006, M.J. Ebejer, det. D.J. Gibbs [19,

PCME]; Mallorca, Sa Roca, S’Albufera, 8.x.2007, NJ.

Riddiford, det. D.J. Gibbs [1¢, PCDG]; same data as

previous, 27—28.x.2007 [24'3, PCDG]; same data as

previous, 6.x.2007 [12, PCDG]; same data as previous,

21—23.x.2007 [12, PCDG]; Mallorca, Mondrago, S’Am-

arador, 9.x.2007, J. Salva, det. D.J. Gibbs [12, PCDG];

Mallorca, Puig Sant Marti, 22.x.2007, M.A. Rens, det.

D.J. Gibbs [19, PCDG].

Eudorylas monegrensis De Meyer, 1997

SPAIN: Andalucia, Corona, 36°55'24"N 3°18'27"W,

1250 m, 12.vi.2008, & det. D.J. Gibbs [14', PCDG].

Eudorylas nemoralis Kozanek, 1993

SPAIN: Salamanca, Villar de Ciervo, Las Coronas, 17—

21.v.2005, H.-P. Tschorsnig [2¢'4, PCCK].

Eudorylas obliquus Coe, 1966

CYPRUS: Diarizos Valley, Nikoklela, 70 m, 23.1v.2002,

M.J. Ebejer, det. D.J. Gibbs [3'¢', PCME]; Pano Lefka-

ra, 595 m, 26.iv.2002, M.J. Ebejer, det. D.J. Gibbs [1¢,

PCME]; Malia, 570 m, 27.1v.2002, M.J. Ebejer, det. D.J.

Gibbs [1¢, PCME]. FRANCE: Alpes Maritimes, Biot,

20.xi-12.xii.2010, A. Piton, det. P. Withers [1¢, PCPW];

Var, Vidauban, 28.v.2015, T. Ramage, det. P. Withers

[1¢, PCPW]. GREECE: Peloponnisos, Taiyetos moun-

tains, 950-1800 m, 15-19.v.1990, ZMCE [2¢¢ 19,

ZMUC]; Peloponnisos, Monemvasia, 3.v.1984, G. Chris-

tensen [1', ZMUC]; same data as previous, 23.v.1984

[14, ZMUC]; same data as previous, 7.vi.1984 [1¢,

ZMUC]; Kendriki Makedonia, Kerkini, Ecotourism site,

©ZFMK

New data on Mediterranean Pipunculidae 47

41°08'15.6"N 23°13'01.2"E, 45 m, 23-29.v.2006, G.

Ramel, det. D.J. Gibbs [12, BMNH]; Kendriki Make-

donia, Kerkini, Procom site, Promohonas, 41°22'38.1'"N

23°21'58.8"E, 60 m, 4-10.vii.2007, G. Ramel, det. D.J.

Gibbs [12, BMNH]; Kendriki Makedonia, Kerkini,

Pumping St. site, 41°12'48.7"N 23°06'11.9"E, 40 m,

9-15.v.2007, G. Ramel, det. D.J. Gibbs [14', BMNH]. IT-

ALY: Sicily, Catania, Randazzo, Lago di Gurida, 870 m,

11.vi.1999, M.J. Ebejer, det. D.J. Gibbs [14, PCME].

SPAIN: Gerona, Caralps, 1200-1300 m, 13—17.v1.1982,

S. Andersen, L. Lyneborg, V. Michelsen [1¢, ZMUC];

Valencia, near Alcoy, 1000 m, 21.vi.2003, A.E. Stubbs,

det. D.J. Gibbs [2¢¢, PCDG]; Mallorca, S’Albufera,

Es Comu, 39°46'34"N 3°08'27"E, 2 m, 20.iv.2006, det.

D.J. Gibbs [2¢'4, PCDG]; Mallorca, Puig de Sant Marti,

39°49'29"N 3°05'S51"E, 23.iv.2006, det. D.J. Gibbs

[233 229, PCDG]; Mallorca, S’Albufera, Es Coma,

39°46'34"N 3°08'27"E, 2 m, 25.iv.2006, det. D.J. Gibbs

[13 12, PCDG]; Mallorca, Son Ton Woods, Sa Pobla,

21.iv.2001, M.J. Ebejer, det. D.J. Gibbs [24'4', PCME].

Eudorylas obscurus Coe, 1966

FRANCE: Ardeéche, forét de Paiolive, Montchamp,

8—28.1v.2010, M. Speight & E. Castella, det. P. Withers

[14, PCPW]; Ardéche, forét de Paiolive, Granzon, 8-28.

iv.2010, M. Speight & E. Castella, det. P. Withers [1%,

PCPW]; Ardeche, forét de Paiolive, Hermitage, 28.1v—

23.v.2010, M. Speight & E. Castella, det. P. Withers [1¢,

PCPW]; Ardeéche, forét de Paiolive, Langarneyre, 26.vi—

10.vit.2010, M. Speight & E. Castella, det. P. Withers

[14, PCPW]; Ardéche, Réserve Naturelle Nationale des

Gorges de I’Ardeéche, 18.111—1.iv.2015, J. Claude, det. P.

Withers [1<', PCJC]; same data as previous, 8—23.vi.2015,

det. P. Withers [1<, PCJC]; Pyrénées-Orientales, forét

de la Massane, réserve intégrale, 3.vi.2009, J. Garrigue,

det. P. Withers [3'3', PCPW]. GREECE: Peloponnisos,

Taiyetos mountains, 950-1800 m, 15—19.v.1990, ZMCE

[14, ZMUC]. SPAIN: Salamanca, Villar de Ciervo, Las

Coronas, 17—21.V.2005, H.-P. Tschorsnig [2¢'4¢, PCCK];

Gerona, Caralps, 1200-1300 m, 13—17.vi.1982, S. An-

dersen, L. Lyneborg, V. Michelsen [30'¢', ZMUC]; Llei-

da, Sorpe, 1200-1300 m, 19—22.v1.1982, S. Andersen,

L. Lyneborg, V. Michelsen [1¢, ZMUC]. TURKEY*:

Nevsehir, Avanos, Urgtip area, 1000 m, 4-6.v.1993, V.

Michelsen [14, ZMUC].

Eudorylas pannonicus (Becker, 1897)

FRANCE: Ardeéche, forét de Paiolive, Combe de Bouse,

25.v—26.v1.2010, M. Speight & E. Castella, det. P. With-

ers [1¢, PCPW]; Ardéche, forét de Paiolive, Langar-

neyre, 28.vii—31.vili.2010, M. Speight & E. Castella,

det. P. Withers [1<, PCPW]; Ardéche, forét de Paiolive,

Chibasse, 25.v—27.v1.2010, M. Speight & E. Castella,

det. P. Withers [1<, PCPW]; Ardéche, forét de Paiolive,

Bonn zoological Bulletin 68 (1): 31-60

Granzon, 29.vi-21.vu.2011, M. Speight & E. Castella,

det. P. Withers [1<, PCPW]; Ardéche, forét de Paiolive,

Hermitage, 28.vit-31.vii.2010, M. Speight & E. Cas-

tella, det. P. Withers [1<, PCPW]; Ardéche, forét de

Paiolive, Bildon, 25.vii.2010, M. Speight & E. Castella,

det. P. Withers [1¢, PCPW]. GREECE: Peloponisos,

5 km S of Monemvasia, 15.v.1984, G. Christensen [19,

ZMUC]; Lakonia, 5 km S of Monemvasia, 15.v.1985, G.

Christensen [1 9°, ZMUC]; Kendriki Makedonia, Kerkini,

Midway site, 41°18'49.8'N 23°16'35.6"E, 750 m, 16-22.

vii.2008, G. Ramel, det. D.J. Gibbs [14 Form A 19,

PCDG]; Kendriki Makedonia, Kerkini, Krousia mts. site,

41°11'32.4"N 23°03'59.6"E, 190 m, 13—-19.v1.2007, G.

Ramel, det. D.J. Gibbs [16' Form D, PCDG].

Remarks. Eudorylas pannonicus in its current species

concept might represent a species complex (Kehlmaier

2005a). At Kerkini, Form A, representing the lectotype

of E. pannonicus, was collected at “Midway”, whereas

Form D, formerly only known from Bulgaria, was col-

lected at “Krousia”.

Eudorylas subfascipes Collin, 1956

GREECE*: Makedhonia/Thessalia, Olympos, 700-

2100 m, 21-26.v.1990, ZMCE [13', ZMUC].

Eudorylas subterminalis Collin, 1956

SPAIN: Sobira, Pallars, Soriguera, 42°22'15.0"N

1°14'12.1"E, 4.vi1.2014, R. Andrade [19°, PCCK].

Eudorylas terminalis (Thomson, 1870)

FRANCE: Ardeche, forét de Paiolive, Langarneyre,

28.iv—25.v.2010, M. Speight & E. Castella, det. P. With-

ers [1¢', PCPW]. SPAIN: Gerona, Caralps, 1200-1300 m,

13—17.v1.1982, S. Andersen, L. Lyneborg, V. Michelsen

[14, ZMUC].

Remarks. First French record with locality data. Previ-

ously, only a country record of unknown provenance was

published (De Meyer 1992; Withers 2006).

Eudorylas triangularis Kehlmaier, 2005

TURKEY*: Antalya, Koprilii Kanyon National Park,

28—29.iv.1993, V. Michelsen [19, ZMUC].

Eudorylas trigonus (Becker, 1921)

GREECE: Kendriki Makedonia, Kerkini, Midway

site, 41°18'49.8"N 23°16'35.6"E, 750 m, 12—18.v.2008,

G. Ramel, det. D.J. Gibbs [29 9, PCDG]; same data as

previous, 26.v—1.vi.2008 [29 9°, PCDG].

©ZFMK

48 Christian Kehlmaier et al.

Eudorylas unicolor (Zetterstedt, 1844)

GREECE: Ipiros, Smolikas Mountains, 700-1500 m,

21-22.v.1994, V. Michelsen [1<, ZMUC]; Kendriki

Makedonia, Kerkini, Krousia mts. site, 41°11'32.4"N

23°03'59.6"E, 190 m, 27.vi-7.vil.2007, G. Ramel, det. &

coll. D.J. Gibbs [1.', PCDG].

Eudorylas venturai Kehlmaier, 2005

SPAIN: Almeria, Alhama, 5 km W, 200-500 m,

17.iii. 1966, L. Lyneborg [1¢4, ZMUC]; Valencia, Campos

de Cerezos, 8.iii.2008, S. Montagud et al. [1¢, MVHN

(Cod. 140308JL12)]; Granada, Barranco de Miranda,

8 km SW Orgiva, 300 m, 16.1v.1966, L. Lyneborg & M.

Langemark [14, ZMUC]; Andalucia, Cortijo del Alca-

zar, 36°55'1I5"N 4°05'18"E, 990-1200 m, 9.vi.2006,

D.J. Gibbs, det. DJ. Gibbs [14', PCDG]; Mallorca,

Puig de Sant Marti, 39°49'29"N 3°05'51"E, 19.v.2007,

D.J.Gibbs, det. D.J.Gibbs [14, PCDG].

Remarks. Coe (1969) published the two males from

Almeria and Granada as Eudorylas montium (Becker,

1897). To our knowledge (Kehlmaier 2003, 2005a), no

reliable records of E. montium from Spain exist and the

species should be deleted from the national checklist.

Eudorylas wahisi De Meyer, 1997

SPAIN: Mallorca, S’Albufera, Es Comu, 39°46'34"N

3°08'27"E, 2 m, 25.iv.2006, D.J. Gibbs, det. D.J. Gibbs

[12, PCDG].

Eudorylas zermattensis (Becker, 1897)

FRANCE: Ardeéche, forét de Paiolive, Montchamp,

25.vi-12.vii.2009, M. Speight & E. Castella, det. P.

Withers [1¢, PCPW]; Pyrénées-Orientales, forét de

la Massane, Col del Pal, 20.vi.2009, J. Garrigue,

det. P. Withers [14', PCPW]. GREECE*: 5 km south

of Monemvassia, 29.1v.1982, S. Andersen, L. Lyne-

borg & V. Michelsen [19, ZMUC]; Monemvassia,

29.iv.1984, G. Christensen [19, ZMUC]; same data as

previous, 9.1x.1984 [19, ZMUC]; same data as previous,

13.ix.1984 [1¢, ZMUC]; Kendriki Makedonia, Kerki-

ni, 41°09'06.5"N 23°11'55.0"E, 23-29.v.2005, G. Ra-

mel, det. D.J. Gibbs [19, PCDG]; Kendriki Makedonia,

Kerkini, Ecotourism site, 41°08'15.6"N 23°13'01.2"E,

65 m, 20-26.vi.2006, G. Ramel, det. D.J. Gibbs [14 19,

BMNH]; Kendriki Makedonia, Kerkini, Pumping St.

site, Kerkini, 41°12'48.7'"N 23°06'11.9"E, 40 m, 13-19.

vi.2007, G. Ramel, det. D.J. Gibbs [14, BMNH]; Kend-

riki Makedonia, Kerkini, Pumping St. site, 41°12'48.7""N

23°06'11.9"E, 40 m, 20—26.v1.2007, G. Ramel, det. D.J.

Gibbs [12, BMNH]. SPAIN: Granada, Rio Guadalfeo,

Orgiva, 300 m, 2.iv.1966, L. Lyneborg & M. Langemark

Bonn zoological Bulletin 68 (1): 31-60

[14, ZMUC]; Gerona, Caralps, 1200-1300 m, 13-17.

vi.1982, S. Andersen, L. Lyneborg, V. Michelsen [1°,

ZMUC].

Eudorylas zonatus (Zetterstedt, 1849)

FRANCE: Ardéche, forét de Paiolive, Chibasse, 25.v—

27.v1.2010, M. Speight & E. Castella, det. P. Withers

[14, PCPW]; Ardéche, forét de Paiolive, Granzon, 25.v—

27.v1.2010, M. Speight & E. Castella, det. P. Withers

[14, PCPW]; Var, Vidauban, 28.v.2015, T. Ramage, det.

P. Withers [1<, PCPW]; same data as previous, 8.vi.2015

[44'4, PCPW].

TOMOSVARYELLINI

Dorylomorpha (Dorylomorpha) confusa (Verrall, 1901)

SPAIN: Cantabria, Fuente Dé, 17.vi.1980, P.J. Chandler,

det. PJ. Chandler [1<, PCPC].

Dorylomorpha (Dorylomorpha) extricata (Collin, 1937)

FRANCE: Ardeéche, forét de Paiolive, Granzon, 28.1v—

25.v.2010, M. Speight & E. Castella, det. P. Withers [1¢,

PCPW]; Corsica, Forét d’Agnone, Vizzavona, 910 m,

1—2.vi.2000, A.C. Pont, det. D.J. Gibbs [19, BMNH].

Dorylomorpha (Dorylomorpha) imparata (Collin, 1937)

FRANCE: Corsica, Forét d’Agnone, Vizzavona, 910 m,

1—2.vi.2000, A.C. Pont, det. D.J. Gibbs [1¢, BMNH];

same data as previous, 28—29.v.2000 [12, BMNH];

same data as previous, 30-31.v.2000 [12, BMNH].

GREECE*: Kendriki Makedonia, Kerkini, Beles,

41°17'19"N 23°12'18"E, 25.1v—1.v.2005, G. Ramel, det.

D.J. Gibbs [1¢, PCDG]; Kendriki Makedonia, Ker-

kini, Kerkini marsh site, 41°13'32.8"N 23°05'04.2"E,

45 m, 21-27.iii.2007, G. Ramel, det. D.J. Gibbs [1-¢,

BMNH]; Kendriki Makedonia, Kerkini, Kerkini marsh

site, 41°13'32.8"N 23°05'04.2"E, 45 m, 11—-17.1v.2007,

G. Ramel, D.J. Gibbs [12, BMNH]; same data as previ-

ous, 4-10.iv.2007 [1<, BMNH]; same data as previous,

18-24. iv.2007 [24'3', BMNH].

Dorylomorpha (Dorylomorpha) rufipes (Meigen, 1824)

SPAIN*: Santander, near Cosgaya by Rio Neva,

18.vi.1980, P.J. Chandler, det. P.J. Chandler [1<, PCPC].

Dorylomorpha (Dorylomyia) incognita (Verrall, 1901)

SPAIN: Jaén, Sierra de Cazorla, Roblehondo, 1300 m,

28.v—15.vi.1993, J.L. Nieves [1¢, MNCN]; Madrid, Si-

erra de Guadarrama, Cercedilla, Estacion Biologica El

©ZFMK

New data on Mediterranean Pipunculidae 49

Ventorrillo, 40°45'16.5"N 4°01'15.5"W, 1450 m, 16-22.

vi.1989, J.L. Nieves & C. Rey [12, MNCN]; same data

as previous, 6—14.vii.1989 [12, MNCN]; same data as

previous, 1421 .vii.1989 [14 19, MNCN].

Dorylomorpha (Dorylomyza) lautereri Albrecht, 1990

GREECE*: Kendriki Makedonia, Kerkini, Pumping

Station site, 41°12'49"N 23°6'12"E, 40 m, 16—22.v.2007,

Malaise, G. Ramel, det. D.J. Gibbs [19, PCDG].

Tomosvaryella cilifemorata (Becker, 1907)

CYPRUS*: Kalavasos Dam, 34°48'01'""N 33°16'02"E,

165 m, 24.iv.2002, M.J. Ebejer, det. D.J. Gibbs [16,

PCME]. FRANCE: Ardeche, Réserve Naturelle Natio-

nale des Gorges del’ Ardéche, 7.vu1.2015, J. Claude, det. P.

Withers [14, PCJC]. GREECE*: Kendriki Makedonia,

Kerkini, Krousia Mts. site, 41°11'32.4"N 23°03'59.5"E,

190 m, 4-10.vii.2007, G. Ramel, det. D.J. Gibbs [1-4,

PCDG]; same data as previous, 27.vi-3.vii.2007 [13,

PCDG]; Kendriki Makedonia, Kerkini, Midway site,

‘-

Fig. 6. A. Surstyli of a Spanish 7° cilifemorata formerly published as 7: nigronitida. B. Surstyli of the lectotype of Zomosvaryella

disjuncta (Becker, 1900). C. Lectotype of Zomosvaryella vicina (Becker, 1900). D. Surstyli of the holotype of Zomosvaryella

lyneborgi (Coe, 1969), a junior synonym of Jomosvaryella cilitarsis (Strobl, 1910). E. Right lateral view of ovipositor of Zomosva-

ryella vicina (Becker, 1900). F. Dorsal view of ovipositor of Zomosvaryella vicina (Becker, 1900).

Bonn zoological Bulletin 68 (1): 31-60

©ZFMK

50 Christian Kehlmaier et al.

41°18'49.8"N 23°16'35.6"E, 750 m, 30.vi-6.vii.2008,

G. Ramel, det. D.J. Gibbs [12, PCDG]. ITALY: Sici-

ly, Catania, Randazzo Rummolo (Flascio river), 850 m,

7.vi.1999, M.J. Ebejer, det. M.J. Ebejer [1¢, PCME].

SPAIN: Granada, Barranco de Miranda, 8 km SW Orgi-

va, 300 m, 20.iv.1966, L. Lyneborg [1<, ZMUC]; Grana-

da, Mecina Bombaron, 800 m, 8.v.1966, L. Lyneborg &

M. Langemark [1¢, ZMUC].

Remarks. The Spanish material was, together with a

third male from Spain (Almeria, Alhama 5 km W, 200-—

500 m, 28.11.1966, L. Lyneborg), originally published as

Tomosvaryella nigronitida Collin, 1958 by Coe (1969).

The third specimen could not be located at ZMUC. The

other two specimens were dissected and the syntergoster-

nite 8 of one of the males is illustrated in Fig. 6A. Geni-

talia and outer morphology correspond to 7° cilifemorata

as outlined in Foldvari & De Meyer (2000). The latter au-

thors also comment on a possibile synonymy of the two

species. As 7! nigronitida is based on the female holotype

from Croatia and has been only recorded once thereaf-

ter by De Meyer (1995) (a single female from Israel),

collecting at the type locality is necessary before a final

decision can be made. The male sex of 7. nigronitida 1s

thus unknown and the species needs to be deleted from

the Spanish checklist. Strobl (1909) described this spe-

cies from Spain under Pipunculus argyrosticus Strobl,

1909, which was synonymised with T. cilifemorata later

by Aczél (1944).

Tomosvaryella cilitarsis (Strobl, 1910)

Tomosvaryella lyneborgi (Coe, 1969) syn. nov.

SPAIN: Almeria, Tabernas, 8 km N, 14.111.1966, L. Ly-

neborg [1¢' (holotype of T. jyneborgi), ZMUC]; Grana-

da, Sierra de Contraviesa, 5 km SE Orgiva, 500 m,

18.iv.1966, L. Lyneborg [12 (paratype of 7 lyneborgi),

ZMUC]; Mallorca, S’Albufera, Es Comu, 39°46'34"N

3°08'27"E, 2 m, 25.1v.2006, D.J. Gibbs, det. D.J. Gibbs

[1¢, PCDG].

Remarks. The type series of 7’ /yneborgi consists of a

male holotype and a female paratype. Coe (1969) figures

the undissected male terminalia and the female oviposi-

tor. The male syntergosternite 8 was detached from the

abdomen to obtain a better view of the surstyli (Fig. 6D)

and other genitalic features, and it was found to be a ju-

nior synonym of 7° cilitarsis (for the latter see Kehlmaier

2008b).

Tomosvaryella coquilletti (Kertész, 1907)

GREECE?*: Kendriki Makedonia, Kerkin1, 41°09'06.5'""N

23°11'55.0"E, 13-—19.v1.2005, G. Ramel, det. D.J. Gibbs

[14, PCDG]; SPAIN*: Burgos, NW of Ora, 19.vi.1980,

P.J. Chandler, det. D.J. Gibbs [1', PCPC].

Bonn zoological Bulletin 68 (1): 31-60

Tomosvaryella dentiterebra (Collin, 1949)

EGYPT: Edku Salt Lakes (© Lake Idku), 2.vu.1944,

R. Coe [4 (lectotype), BMNH]. same data as lectotype

[12 (paralectotype), BMNH]; Lake Karoun (= Qarun),

1x.1945, R. Coe [1° (paralectotype), BMNH].

Remarks. The species was originally described from

Egypt and it has been recently recorded and redescribed

from Iran (Majnon Jahromi et al. 2017b).

Tomosvaryella disjuncta (Becker, 1900)

FRANCE: Alpes-Maritimes, Biot, 3—10.x.2010, A. Pi-

ton, det. P. Withers [1<, PCPW]; same data as previous,

11—20.x.2010, A. Piton, det. P. Withers [1¢, PCPW].

Remarks. This is the second record of 7. disjuncta from

Europe and France. The species was originally described

from Egypt and only recently recorded from Val les

Bains (Ardeche) by Withers (2006). Kuznetzov (1993)

redescribed the species and designated a lectotype which

has been studied and illustrated (Figs 6B, 7A).

Tomosvaryella freidbergi De Meyer, 1995

GREECE®*: Kendriki Makedonia, Kerkini, Pumping St.

site, 41°12'48.7"N 23°06'11.9"E, 40 m, 13.—-19.vi.2007,

G. Ramel, det. D.J. Gibbs [24¢4¢, BMNH];; Kendriki

Makedonia, Kerkini, Pumping St. site, 41°12'48.7"N

23°06'11.9"E, 40 m, 20—26.v1.2007, G. Ramel, det. D.J.

Gibbs [24'3', BMNH]; Kendriki Makedonia, Kerkini,

Procom site, Promohonas, 41°22'38.1"N 23°21'58.8"E,

60 m, 4-10.vii.2007, G. Ramel, det. D.J. Gibbs [1¢'19,

BMNH]; Kendriki Makedonia, Kerkini, Krousia Mts.

base camp, 41°18'35''N 23°03'36"E, 1300 m, 25-31.

vii.2007, G. Ramel, det. D.J. Gibbs [3¢¢, BMNH].

SPAIN: Canary Islands, Tenerife, near Santiago,

2.1v.1973, P.J. Chandler & C.H. Jackson, det. D.J. Gibbs

[14, PCDG]; Canary Islands, Tenerife, Purto de Erjos,

2.1V.1973, P.J. Chandler & C.H. Jackson, det. M. Fold-

vari [14, PCDG]; Canary Islands, Tenerife, El] Medano,

3.1v.1973, P.J. Chandler & C.H. Jackson, det. D.J. Gibbs

[12, PCDG]; Canary Islands, La Palma, near Las Indias,

26.v.1976, PJ. Chandler, det. M. Foldvari [16', PCDG];

Canary Islands, La Palma, La Cumbrecita, 29.v.1976, P.J.

Chandler, det. D.J. Gibbs [14, PCDG]; Asturias, Corros

(de Parcal), 31.v.1990, C. Rey [14, MNCN]; Cantabria,

San Pedro de Bedoya, 17—30.vili.1990, C. Rey [19,

MNCN]. TURKEY*: Denizli, Aci Gol, 4.vi.1997, M.J.

Ebejer, det. D.J. Gibbs [1', PCME].

Tomosvaryella frontata (Becker, 1897)

MALTA: Mellieha Bay, Ghadira, 19-31.viti.1992, B.

Petersen [4¢¢ 72 2, ZMUC]. SPAIN*: Mallorca, S’Al-

©ZFMK

New data on Mediterranean Pipunculidae 51

Fig. 7. Dorsal view of surstyli, epandrium and syntergosternite 8 of lectotypes of A. Zomosvaryella disjuncta (Becker, 1900), and

B. Tomosvaryella vicina (Becker, 1900).

bufera, Sa Roca, 39°47'47"N 3°06'19"E, 2 m, 19.1v.2006,

D.J. Gibbs, det. D.J. Gibbs [1 9, PCDG]; Mallorca, Cami

des Polls, S’Albufera, 21.v.2006, M.J. Ebejer, det. D.J.

Gibbs [12, PCME]; Mallorca, S’Albufera, Sa Roca,

39°47'47"N 3°06'19"E, 2 m, 18.v.2007, D.J. Gibbs, det.

D.J. Gibbs [3¢'¢ 399, PCDG].

Tomosvaryella geniculata (Meigen, 1824)

CYPRUS*: Lefkas Dam, 34°53'50"N 33°18'19"E,

290 m, 26.iv.2002, M.J. Ebejer, det. D.J. Gibbs [19,

PCME]. FRANCE: Ardéche, forét de Paiolive, Gran-

zon, 25.vi1.2010, M. Speight & E. Castella, det. P. With-

ers [1¢, PCPW]; Ardéche, forét de Paiolive, Chibasse,

25.v—27.v1.2010, M. Speight & E. Castella, det. P. With-

ers [14', PCPW]; Ardéche, forét de Paiolive, Combe des

Bouses, 31.viii—8.1x.2010, M. Speight & E. Castella,

det. P. Withers [1', PCPW]; Var, Vidauban, 13.vi.2014,

T. Ramage, det. P. Withers [1<', PCPW]; same data as

previous, 22.vi.2014, T. Ramage, det. P. Withers [2¢.¢,

PCPW]; same data as previous, 8.v1.2015, T. Ramage,

det. P. Withers [44'3', PCPW]; Corsica, Forét d’Ag-

Bonn zoological Bulletin 68 (1): 31-60

none to Cascade des Anglais, Vizzavona, 900-1100 m,

28.v.2000, A.C. Pont, det. D.J. Gibbs [14, BMNH]; Cor-

sica, Forét d’Agnone, Vizzavona, 910 m, 1—2.v1.2000,

A.C. Pont, det. D.J. Gibbs [12, BMNH]; Ardéche, Gil-

hac, 44°50'18.3"N 4°46'2.3"E, 339 m, 22.viil.2008, C.J.

Palmer, det. D.J. Gibbs [1¢, PCCP]. GREECE*: Ken-

driki Makedonia, Kerkini, 41°09'06.5'""N 23°11'55.0"E,

23—29.v.2005, G. Ramel, det. D.J. Gibbs [19, PCDG];

Kendriki Makedonia, Kerkini, Plateau, Kerkini Mts,

41°18'53"N 23°01'46"E, 1000 m, 8—13.viil.2007, G. Ra-

mel, det. D.J. Gibbs [1', BMNH]; Kendriki Makedonia,

Kerkini, Plateau, Kerkini Mts, 41°18'59"N 23°01'55"E,

1000 m, 8—-13.viil.2007, G. Ramel, det. D.J. Gibbs

[1¢, BMNH]. SPAIN: Mallorca, S’Albufera, Sa Roca,

18.iv.2001, M.J. Ebejer, det. M.J. Ebejer [12, PCME].

Tomosvaryella helwanensis (Collin, 1949)

EGYPT: Helwan, xi.1944, R.L. Coe, B.M. 1946-39 [3

(lectotype), BMNH]; same data as lectotype [1¢ 399

(paralectotypes), BMNH].

©ZFMK

52 Christian Kehlmaier et al.

Fig. 8. Tomosvaryella helwanensis (Collin, 1949). A. Right lateral view of male surstylus. B. Strictly dorsal view of syntergoster-

nite 8. C. Left lateral view of male surstylus. D. Right lateral view of phallus and phallic guide. E. Left lateral view of ovipositor.

F. Dorsal view of ovipositor.

Remarks. The species was originally described from

Egypt based on eleven males and nine females and it has

not been recorded thereafter. Here, Collin’s extensive and

detailed description 1s completed by the illustration of the

male and female terminalia (Figs 8A—F) and by the later-

al habitus view of the female (Fig. 9) in order to enable a

secure identification.

Tomosvaryella hildeae De Meyer, 1997

GREECE*: Chios, Armolia, 38°16'86"N 26°02'91"E,

20.v.2003, C.J. Palmer, det. D.J. Gibbs [14 19, PCCP;

Bonn zoological Bulletin 68 (1): 31-60

1¢, PCDG]. SPAIN: Andalucia, above Alcaucin,

36°54'44"N_ 4°06'17"E, 800-1050 m, 7.v1.2006, D.J.

Gibbs, det. D.J. Gibbs [14, PCDG].

Tomosvaryella hispanica De Meyer, 1997

SPAIN: Asturias, Corros (de Parcal), 10.v.1990, C. Rey

[14, MNCN]; Salamanca, Villar de Ciervo, Las Coronas,

17-21.v.2005, H.-P. Tschorsnig [16', PCCK].

©ZFMK

New data on Mediterranean Pipunculidae 53

Fig. 9. Right lateral view of female of Zomosvaryella helwanensis (Collin, 1949).

Tomosvaryella inermis De Meyer, 1995

GREECE*: Kendriki Makedonia, Kerkini, Ecotourism

site, 41°08'15.6"N 23°13'01"E, 65 m, 20.v—3.vi.2006, G.

Ramel, det. D.J. Gibbs [14 12, PCDG].

Tomosvaryella israelensis De Meyer, 1995

GREECE*: Kendriki Makedonia, Kerkini, Ecotourism

site, 41°908'15.6"N 23°13'01"E, 65 m, 12-18.1x.2006,

G. Ramel, det. D.J. Gibbs [1<, PCDG]; same data as

previous, 29.viii-4.ix.2006 [2¢¢, PCDG]; Kendriki

Makedonia, Kerkini, Pumping Station site, 41°12'49"N

23°06'12"E, 40 m, 18—24.v1.2007, G. Ramel, det. D.J.

Gibbs [146:19, PCDG].

Tomosvaryella kuthyi Aczél, 1944

CYPRUS*: Akrounta, 34°48'48""N 33°05'30"E, 600 m,

24.iv.2002, M.J. Ebejer, det. D.J. Gibbs [14, PCME].

FRANCE: Alpes-Maritimes, Biot, 20—26.1x.2010, A. Pi-

ton, det. P. Withers [1<, PCPW]; same data as previous

Bonn zoological Bulletin 68 (1): 31-60

but 11—20.x.2010, A. Piton, det. P. Withers [16', PCPW];

Ardeche, forét de Paiolive, Granzon, 25.vii.2010, M.

Speight & E. Castella, det. P. Withers [16', PCPW]; Ar-

déche, forét de Paiolive, Combe des Bouses, 28.vii.2010,

M. Speight & E. Castella, det. P. Withers [1¢, PCPW];

Ardeche, forét de Paiolive, 31.viti—8.1x.2010, M. Spei-

ght & E. Castella, det. P. Withers [14, PCPW]; Ardéche,

forét de Paiolive, 8.ix—4.x.2010, M. Speight & E. Cas-

tella, det. P. Withers [1<, PCPW]; Ardéche, forét de

Paiolive, Bildon, 28.vii—31.vi1.2010, M. Speight & E.

Castella, det. P. Withers [1<, PCPW]; Ardéche, forét

de Paiolive, Langarneye, 26.vi-10.vu1.2010, M. Spei-

ght & E. Castella, det. P. Withers [14, PCPW]; Ardéche,

forét de Paiolive, 28.vii-3.vil.2010, M. Speight & E.

Castella, det. P. Withers [1<, PCPW]; Ardéche, forét

de Paiolive, Hermitage, 23.v—26.vi.2010, M. Speight,

det. P. Withers [1<, PCPW]; Ardéche, forét de Paiolive,

Chibasse, 25.v—27.v1.2010, M. Speight & E. Castella,

det. P. Withers [14', PCPW]; Pyrénées-Orientales, forét

de la Massane, Col Fondo, 14.1x.2014, J. Garrigue, det.

P. Withers [1', PCPW]; Pyrénées-Orientales, forét de

la Massane, réserve intégrale, 7.vi1.2009, J. Garrigue,

©ZFMK

54 Christian Kehlmaier et al.

det. P. Withers [1<, PCPW]; Var, Vidauban, 19.v.2014,

T. Ramage, det. P. Withers [2¢'¢', PCPW]; same data

as previous, 13.vi.2014 [1¢, PCPW]; same data as

previous, 28.v.2015 [14, PCPW]; same data as previ-

ous, 8.vi.2015 [54'3, PCPW]. GREECE*: Kendriki

Makedonia, Kerkini, Krousia Mts. site, 41°11'32.4"N

23°03'59.5"E, 190 m, 30.v—5.vi.2007, G. Ramel, det.

D.J. Gibbs [24'3', BMNH]. SPAIN: Almeria, Adra,

36°47'24.8"N 3°06'06.6"W, 502 m, 9.v.2012, R. Andrade

[23:3 12, PCCK]; Catalunya, Barcelona, Pruit, 15 km S

Olot, 30 km W Girona, 42°02'39"N 2°27'31"E, 900 m,

4 vii.1997, C. Lange & J. Ziegler [12, PCCK]; Mallorca,

Puig de Sant Marti, 39°49'29"N 3°05'51"E, 23.iv.2006,

D.J. Gibbs, det. D.J. Gibbs [1° 19, PCDG]; Mallorca,

Son Bosc, S’Albufera, 24.v.2006, M.J. Ebeyjer, det. D.J.

Gibbs [14 19, PCME].

Tomosvaryella parakuthyi De Meyer, 1995

CYPRUS*: Frenaros, 35°03'04.50"N 33°52'57.66"E,

1.ix-30.x.2018, S. Schiffel [14, PCCK].

Tomosvaryella pilosiventris (Becker, 1900)

Tomosvaryella glabrum (Adams, 1905) syn. nov.

SPAIN: Canary Islands, Tenerife, Fanabe, 22.vu.1970,

J.J. & A. Menier [14 12, MNHN]. TURKEY*: Antalya,

Side, green grass plot, 28.i1x.2007, N. Vikhrev, det. D.J.

Gibbs [14', PCDG].

Remarks. The original type series consisted of an un-

specified number of males and females collected at Cairo,

Assiut and Fayum between November and March (Beck-

er, 1900). At MNHU four specimens were identified that

belong to the type series: 24'3' 12, Fayum, 44775, III;

192, Cairo, 44244, XI. The whereabouts of the syntypes

from Assiut 1s unknown. Both present males have been

dissected in the past. One male (with missing head) was

labelled as lectotype by Sergey Kuznetzov. However, this

lectotype designation was apparently never published.

The “head-less” male is hereby designated as lectotype

in order to fix the name involved and ensure a universal

and consistent interpretation of the taxon in the future.

The status of this species involves several nomencla-

tural acts. Aczél (1944) originally placed 7: pilosiventris

in synonymy under 7! subvirescens (Loew, 1872), but

Kuznetzov (1994) restored 7: pilosiventris as a good spe-

cies. Hardy (1949) placed 7 glabrum (Adams, 1905) in

synonymy under 7! subvirescens, but later De Meyer et

al. (2001) reinstated 7’ glabrum as a valid taxon and syn-

onymised 7: tecta De Meyer, 1993 under T: glabrum. The

present study revealed that 7’ pi/osiventris is conspecif-

ic with specimens identified as 7. glabrum syn. nov. by

Kehlmaier & Majnon Jahromi (2015), who also studied

material originally identified as 7. glabrum by De Mey-

Bonn zoological Bulletin 68 (1): 31-60

er et al. (2001). Male genitalia are figured in De Meyer

(1993).

Tomosvaryella resurgens De Meyer, 1997

SPAIN: Mallorca, Santa Ponca, 23.x.1992, C.J. Palmer,

det. D.J. Gibbs [16', PCCP]; Mallorca, S’ Alqueria, An-

dratx S’ Alqueria, Andrnix, 2.vii1.2007, J. Monterde, det.

D.J. Gibbs [1¢19, PCDG]; Mallorca, Puig San Marti,

15.ix.2008, N. Riddiford, det. P. Withers [1¢, PCPW];

Mallorca, Mandrago, 13—14.1x.2007, N. Riddiford, det.

P. Withers [1¢, PCPW]; Santa Eugencia, light trap,

10.viii.2005, N. Riddiford, det. P. Withers [1¢', PCPW].

Tomosvaryella sepulta De Meyer, 1997

SPAIN: Mallorca, S’Albufera, Es Comu, 39°46'34N

3°08'27"E, 2 m, 20.1v.2006, DJ. Gibbs, det. D.J.

Gibbs [3¢¢, PCDG]; Mallorca, Puig de Sant Marti,

39°49'29"N 3°05'S1"E, 23.1v.2006, DJ. Gibbs, det.

D.J. Gibbs [12, PCDG]; Andalucia, W of Capilerilla,

36°56'21"N 3°20'26"W, 1480 m, 7.vi.2008, D.J. Gibbs,

det. D.J. Gibbs [16 292, PCDG].

Tomosvaryella trichotibialis De Meyer, 1995

SPAIN: Mallorca, S’Albufera, Es Comu, 39°46'34"N

3°08'27"E, 2 m, 18.v.2007, D.J. Gibbs, det. D.J. Gibbs

[13, PCDG]; same data as previous, 20.v.2009 [19,

PCDG]; Andalucia, Sendero vela blanca, 36°44'05"N

2°10'14"W, 240 m, 29.iv.2008, D.J. Gibbs, det. D.J.

Gibbs [1¢, PCDG].

Tomosvaryella vicina (Becker, 1900)

EGYPT: Luxor, 44629, ii, T. Becker [ (lectotype),

MNHU]; same data as lectotype [34'3' (paralectotypes),

MNHU]; Assiut, 44396, xii, T. Becker [14 19 (paralec-

totypes), MNHU]; Assiut, 44459, xii, T. Becker [1¢' 19°

and 1 badly damaged specimen (only part of thorax and

five legs left), MNHU].

Remarks. De Meyer (1993: fig. 36) redescribed and

illustrated the species, listing only the male “holotype”

with the label data “4629 II”. This is obviously a misin-

terpretation and a typo, respectively. In De Meyer (1996),

one syntype from Assiut (44459) and three syntypes

from Luxor (44629) are mentioned. The original type

series consisted of an unspecified number of males and

females collected at Assiut and Luxor between Dezem-

ber and February (Becker, 1900). At MNHU, nine spec-

imens were identified that belong to the type series. All

specimens are pinned on minutens. The four males from

Luxor are placed on two insect needles. One male from

Luxor has been dissected in the past and was labelled as

lectotype by Sergey Kuznetzov. This lectotype designa-

©ZFMK

New data on Mediterranean Pipunculidae 55

tion was apparently never published. The dissected male

from Luxor is hereby designated as lectotype in order to

fix the name involved and ensure a universal and consis-

tent interpretation of the taxon in the future. The male

syntergosternite 8 (Figs 6C, 7B) and the female oviposi-

tor are illustrated (Figs 6E & F).

DISCUSSION

Ninty-eight named species of Pipunculidae from eleven

countries (Cyprus, Egypt, France, Greece, Italy, Malta,

Morocco, Portugal, Spain, Tunisia, and Turkey) are in-

cluded in this work. Among them there are three new spe-

cies described in full. In addition, 56 first national records

were compiled, demonstrating that the knowledge on the

distribution of big-headed flies in the Mediterranean Ba-

sin is still very fragmentary for most countries. But even

in comparatively well-studied countries like Spain, 13

species could be added to the national list. In detail, the

number of named species in the present paper, first na-

tional records, and newly described species are: Cyprus

(6 named species / 4 first records / 0 new species), Egypt

(1/0/0), France (42/6/1), Greece (31/23/0), Italy (3/0/0),

Malta (2/0/0), Morocco (1/0/0), Portugal (2/0/0), Spain

(56/13/3), Tunisia (5/5/0), and Turkey (10/8/0). Appen-

dix II provides national checklists for selected countries,

whose pipunculid fauna has not been summarised in the

past years (Cyprus, Egypt, Greece, Malta, Morocco, Tu-

nisia, and Turkey). The national checklist for Portugal

currently comprises 45 species (Kehlmaier & Andrade

2016). The national checklist for Italy stands at 105 spe-

cies (Kehlmaier 2008a, 2010a). The national checklist for

continental France (Withers 2006) must be complement-

ed by the addition of C. brachium sp. n., C. grandimem-

branus, E. angustimembranus, E. ibericus, J. pilosa, and

P. elegans, counting a total of 115 species. And the na-

tional checklist for Spain (KehImaier 2003, 2005a; Kehl-

maier & Assmann 2008; Kehlmaier & Alonso-Zarazaga

2018) now counts 101 species, with Ch. zyginae, C. bra-

chium sp. n., C. penultimus, C. vittipes, D. holosericeus,

D. rufipes, E. johnenae, P. oldenbergi, P. zugmayeriae,

7. coquilletti, T: frontata, T. osito sp. n., and T. pugiuncu-

Jus sp. n. added in this study.

Due to the lack of taxonomic workers, expertise and

funds on Pipunculidae, a targeted and systematic collect-

ing of the family in the Mediterranean has hardly ever

been conducted in the past. Although pipunculids lead

a rather concealed life, even a couple of collecting days

can contribute valuable faunistic insights to regional fau-

nas as shown by Kehlmaier (2010a), who hand-netted 83

specimens belonging to 18 species in nine collecting days

on the Italian island of Sardinia. The majority of records

presented here must either be regarded as by-catches of

fellow entomologists, or originated from small biodiver-

sity projects, highlighting the importance of such initia-

Bonn zoological Bulletin 68 (1): 31-60

tives often organised by enthusiasts and amateur ento-

mologists and therefore lacking any substantial financial

support. Their commitment as well as scientific expertise

cannot be overrated in this respect. Two examples that

we would like to point out are The Albufera Internation-

al Biodiversity Project on Mallorca (TAIB) (Mallorca,

Balear Islands, Spain; https://www.taib.info/en/) and the

Wetland Kerkini Biodiversity Study (Central Macedonia,

Greece; http://www.ramel.org/lake-kerkini/). TAIB has

been running since 1989 and focuses on the biodiversity

of the S’Albufera Natural Park. Since 1989 regular trap-

ping projects are undertaken during spring and autumn

field excursions, training programms, and cooperations

with taxonomists, including four Diptera specialists re-

sulting in a total of 20 Pipunculidae species including

the two newly described Tomosvaryella (Table 1). The

Wetland Kerkini Biodiversity Study took off as a one-

man-project in 2001, surveying the biotic diversity for

Lake Kerkini and its associated Nature Reserves. The

Pipunculidae material studied in the present work was

collected during 2005—2007 and so far 22 species of Pi-

punculidae have been identified most of them new to the

Greek fauna (Table 2).

Acknowledgments. Material was put at our disposal by Car-

olina Martin (MNCN), Lisa and Klaus Standfuss (Dortmund),

Sergio Montagud Alario (MVHN), Rui Andrade (Porto),

Peter J. Chandler (Melksham), Jocelyn Claude (Laberge-

ment-Sainte-Marie), Martin J. Ebejer (Cowbridge), Milan

Kozanek (Bratislava), Chris J. Palmer (Hampshire), Thomas

Pape (ZMUC), Adrian C. Pont (Goring-on-Thames), Sebas-

tian Schiffel (Dresden), Martin C.D. Speight (Dublin), Alan

Stubbs (Peterborough), Hans-Peter Tschorsnig (Stuttgart), Ni-

kita Vikhrev (Moscow), Joachim Ziegler (formerly MNHU),

the Albufera International Biodiversity Project (TAIB, courtesy

of Nick J. Riddiford, https://www.taib.info/en/) and the Wet-

land Kerkini Biodiversity Study (courtesy of Gordon J. Ramel,

http://www.ramel.org/lake-kerkini/). The first author received

financial support by the European Commission HUMAN PO-

TENTIAL PROGRAMME, under BIODIBERIA at MNCN in

Madrid. Collection work at ZMUC in Copenhagen was made

possible through financial support received from the SYNTH-

ESYS Project (http://www.synthesys.info/) financed by Eu-

ropean Community Research Infrastructure Action under the

FP7 ‘Capacities’ programme. Nigel Wyatt (BMNH) organised

the loan of type material. Also, we would like to thank the two

anonymous reviewers for their helpful comments and sugges-

tions. The DNA barcoding data was generated in the molecular

laboratory of the Museum of Zoology, Senckenberg Dresden

(SGN-SNSD-Mol-Lab).

REFERENCES

Ackland DM (1993) Notes on British Cephalops Fallén, 1810

with description of a new species, and Microcephalops De

Meyer, 1989, a genus new to Britain (Dipt., Pipunculidae).

Entomologist's Monthly Magazine 129: 95-105

Aczél M (1944) Die Gattung Zomosvaryella Acz. (Dipt.). (Do-

rylaiden-Studien VIII). Annales Historico-Naturales Musei

Nationalis Hungarici, Pars Zoologica 37: 75-130

©ZFMK

56 Christian Kehlmaier et al.

Albrecht A (1990) Revision, phylogeny and classification of the

genus Dorylomorpha (Diptera, Pipunculidae). Acta Zoologi-

ca Fennica 188: 1-240

Becker T (1900) Dipterologische Studien V. Pipunculidae.

Erste Fortsetzung. Berliner Entomologische Zeitschrift 45:

215-252

Coe RL (1969) Some Pipunculidae (Diptera) from Southern

Spain, with description of a new species. Entomologiske

Meddelelser 37: 3-8

Cuttelod A, Garcia N, Abdul Malak D, Temple H & Katariya

V (2008) The Mediterranean: a biodiversity hotspot under

threat. 13 pp. in: Vie J-C, Hilton-Taylor C & Stuart SN (eds),

The 2008 Review of The IUCN Red List of Threatened Spe-

cies. IUCN Gland, Switzerland. https://www.researchgate.

net/publication/285086595 (accessed: 06.11.2019).

De Meyer M (1989) The West-Palaearctic species of the pi-

punculid genera Cephalops and Beckerias (Diptera): classi-

fication phylogeny and geographical distribution. Journal of

Natural History 23: 725-765

De Meyer M (1992) Preliminary database on the distribution of

Pipunculidae in Europe. Faunal inventories of sites for car-

tography and nature conservation — Proceedings of the 8th

International Colloquium of the European Invertebrate Sur-

vey, Brussels: 91-100

De Meyer M. (1993) A revision of the Afrotropical species of

Tomosvaryella Aczél, 1939 (Diptera: Pipunculidae). Annals

of the Natal Museum 34: 43-101

De Meyer M (1995) The pipunculid flies of Israel and the Sinai

(Insecta, Diptera, Pipunculidae). Spixiana 18: 283-319

De Meyer M (1997) Contribution to the Pipunculidae fauna of

Spain (Diptera). Beitrage zur Entomologie 47: 421-450

De Meyer M, Foldvari M & Baez M (2001) The Pipunculidae

(Diptera) fauna of the Canary Islands and Madeira. Bulletin

et Annales de la Société Royale belge d‘Entomologie 136

[2000]: 144-152

Ebejer M (2012) The familes Lonchopteridae, Opetiidae and

Pipunculidae of Malta (Diptera, Aschiza). Bulletin of the En-

tomological Society of Malta 5: 77-79

Ebejer M & Kettani K (2019) The Pipunculidae, a neglected

family of Diptera in Morocco. Dipterists Digest 26: 13-18

Foldvari M & De Meyer M (2000) Revision of Central and

West European 7omosvaryella Aczél species (Diptera, Pi-

punculidae). Acta Zoologica Academiae Scientiarum Hun-

garicae 45 [1999]: 299-334

Grootaert P & De Meyer M (1986) On the taxonomy and ecol-

ogy of Nephrocerus Zetterstedt (Diptera, Pipunculidae) with

a redescription of N. /apponicus and a key to the European

species. Bulletin van het Koninklijk Belgisch Instituut voor

Natuurwetenschappen, Entomologie 56: 85-91

Hardy DE (1949) The African Dorilaidae (Pipunculidae-Dip-

tera). Memoires de I’Institut Royal des Sciences Naturelles

de Belgique 36: 1-80

International C (2011) Biological diversity in the Mediterranean

Basin. URL: _http:/Awww.eoearth.org/view/article/150647

(accessed: 31. January 2019)

Jervis MA (1992) A taxonomic revision of the pipunculid fly

genus Chalarus Walker, with particular reference to the Eu-

ropean fauna. Zoological Journal of the Linnean Society 105:

243-352

Kehlmaier C (2001) Records of Stratiomyidae, Pipunculi-

dae and Conopidae (Diptera) from northern Spain. Munibe

(Ciencias naturales) 51: 79-84

Kehlmaier C (2003) Pipunculidae (Diptera) from a forest eco-

system in northern Spain, with the description of a new spe-

cies. Entomologische Zeitschrift 113: 87-94

Bonn zoological Bulletin 68 (1): 31-60

Kehlmaier C (2005a) Taxonomic revision of European Eudo-

rylini. Verhandlungen des Naturwissenschaftlichen Vereins

in Hamburg (NF) 41: 45-353

Kehlmaier C (2005b) Taxonomic studies on Palaearctic and

Oriental Eudorylini (Diptera: Pipunculidae), with the de-

scription of three new species. Zootaxa 1030: 1-48

Kehlmaier C (2006) The West-Palaearctic species of Jassido-

Dphaga Aczél and Verrallia Mik described up to 1966 (Dip-

tera: Pipunculidae). Stuttgarter Beitrage zur Naturkunde,

Serie A (Biologie) 697: 34 pp

Kehlmaier C (2008a): 4.3.19 Pipunculidae. 207—220 pp. in:

Ziegler J (ed), Diptera Stelviana. A dipterological perspective

ona changing alpine landscape. Volume 1. Studia dipterolog-

ica Supplement 16. Ampyx- Verlag, Halle (Saale)

Kehlmaier C (2008b) Finnish Pipunculidae (Diptera) Studies

Part I: Taxonomic Notes on Cephalops Fallén, 1810, Pipun-

culus Latreille, 1802 and Zomosvaryella Aczél, 1939. Zoot-

axa 1672: 1-42

Kehlmaier C. (2010a) Syrphoidea (Diptera: Pipunculidae and

Syrphidae) previously unrecorded from Sardinia (Italy), with

the description of a new species of the genus Pipunculus La-

treille. Studia dipterologica 16 [2009]: 155-167

Kehlmaier C (2010b) A nomenclatural note on European Cha-

larus (Diptera: Pipunculidae): a new synonymy of C. elegan-

tulus Jervis, 1992. Zootaxa 2656: 67

Kehlmaier C & Assmann T (2008) The European species of

Chalarus Walker, 1834 revisited (Diptera: Pipunculidae).

Zootaxa 1936: 1-39

Kehlmaier C & Alonso-Zarazaga MA (2018) Pipunculidae

(Diptera) from the Caldera de Taburiente National Park,

La Palma (Canary Islands, Spain) — investigating the mor-

phological and molecular variability in a new species of

big-headed flies. Graellsia 74(1): e069

Kehlmaier C & Andrade R (2016) New records of big-headed

flies (Diptera: Pipunculidae) from Portugal. Studia diptero-

logica 22 [2015] 137-151

Kehlmaier C & Majnon Jahromi B (2015) On the presence

of Pipunculidae (Diptera) in Iran. Studia dipterologica 21

[2014]: 29-36

Kehlmaier C, Dierick M & Skevington JH (2014) Micro-CT

studies of amber inclusions reveal internal genitalic features

of big-headed flies, enabling a systematic placement of Me-

tanephrocerus Aczél, 1948 (Insecta: Diptera: Pipunculidae).

Arthropod Systematics and Phylogeny 72: 23-36

Kehlmaier C, Michalko R & Korenko S (2012) Ogcodes fu-

matus (Diptera: Acroceridae) reared from Philodromus

cespitum (Araneae: Philodromidae), and first evidence of

Wolbachia alphaproteobacteria in Acroceridae. Annales Zoo-

logici (Warszawa) 62: 281-286

Kozanek M & Belcari A (1995) Contribution to the knowledge

of the pipunculid fauna of Italy (Diptera Pipunculidae). Bol-

letino della Societa Entomologica Italiana 127: 159-178

Kuznetzov SY (1993) A new Jomosvaryella Aczél from Egypt,

with redescription of 7! disjuncta (Becker) (Diptera, Pipun-

culidae). Diplerologicol Research 4(3) 151-162

Kuznetzov SY (1994) Short notes on synonymy and nomen-

clature of Pipunculidae (Diptera). Dipterologicol Research

5(2): 105

Majnon Jahromi B, Gheibi M, Fallahzadeh M, Kehlmaier C &

Hesami S (2017a) Pipunculidae from southern Iran (Diptera:

Brachycera) including two new species of the genus 7o-

mosvaryella Aczél. Zootaxa 4273: 488-500

Majnon Jahromi B, Gheibi M, Fallahzadeh M, Kehlmaier C &

Hesami S (2017b) A checklist of the genus Zomosvaryella

Aczél (Diptera: Pipunculidae) from the Middle East with

©ZFMK

New data on Mediterranean Pipunculidae 57

the description of a new species. Zoology in the Middle East

63(4): 336-347. DOI: 10.1080/09397140.2017.1349240.

Raffael JA & De Meyer M (1992) Generic classification of the

family Pipunculidae (Diptera): a cladistic analysis. Journal of

Natural History 26: 637-658

Rafael JA & Skevington JH (2010) Pipunculidae (big-headed

flies). 793-803 pp. in: Brown BV, Borkent A, Cumming JM,

Wood DM, Woodley NE & Zumbado MA (eds), Manual of

Central American Diptera. Volume 2. NRC Research Press,

Ottawa

Riddiford N (ed) (2006) TAIB Project S’Albufera: A Mediter-

ranean model for the study of biodiversity and environmental

change. The Albufera International Biodiversity Group An-

nual Report 2005. 126 pp.

URL: _ https://www.taib.info/download/fieldwork-reports/TAIB-

Report-2005.pdf?x22428 (accessed: 07. August 2017)

Riddiford N & Férriz M (eds) (2007) TAIB Project S’ Albufera:

A Mediterranean model for the study of biodiversity and en-

vironmental change. The Albufera International Biodiversi-

ty Project Annual Report 2006. 106 pp. URL: https://www.

taib.info/download/fieldwork-reports/TAIB-Report-2006.

pdf?x22428 (accessed: 07. August 2017)

Appendix I. Characterisation of selected collecting localities.

¢ El Boalo: Malaise trap placed in a degraded Quercus pyre-

naeica Willd. forest.

¢ El Pardo: The study site is dominated by a mature Quercus

ilex L. forest with isolated Ou. suber L., Qu. coccifera L. and

Fraxinus L. The climate is of continental Mediterranean char-

acter. Malaise trap.

¢ Estacién Biolégica El Ventorrillo: Spain, Madrid, Sierra

de Guadarrama, Cercedilla, Estaci6n Biologica El Ventorrillo,

40°45'16.5"N 4°01'15.5''W. Malaise trap placed on a south-

west facing slope between a mixed deciduous forest dominated

by Acer pseudoplatanus L. and Ulmus glabra Huds. and a ma-

ture growth of Pinus sylvestris L. The transition zone between

the two being characterized by small clearings, dominated by a

variety of bushes like Cytisus L., Crataegus L., Rubus L., Rosa

L., Cistus L., Santolina L., Juniperus L., Prunus L. etc. The

climate is subhumid Mediterranean with cold winters.

¢ Forét de la Massane: France, Pyrénées-Orientales, forét de

la Massane, 42°28'31''N 3°01'09"E. One of the last remaining

ancient forests in the Mediterranean basin. It comprises 336

hectares of mixed old forest, much of it dead wood, with princi-

pally beech (Fagus sylvatica L.), mixed with holm-oak (Quer-

cus ilex L.), downy oak (Quercus pubescens Willd.) and sessile

oak (Quercus petraea (Matt.) Liebl.).

¢ Forét de Paiolive: France, Ardéche, forét de Paiolive,

44°23'40"'N 4°10'41"E. This area covers 15 square kilometres

and is dominated by river gorges cut by the River Chassezac.

Bonn zoological Bulletin 68 (1): 31-60

Skevington JH (2002) Revision of Australian Eudorylas Aczél

(Diptera: Pipunculidae). Studia dipterologica 9: 621-672

Skevington JH & De Meyer M (2004) Pipunculidae Research

by Elmo Hardy: Another Founding Event on the Hawaiian

Islands. Bishop Museum Bulletin in Entomology 12: 13-25

Skevington JH & Yeates DK (2001) Phylogenetic classification

of Eudorylini (Diptera: Pipunculidae). Systematic Entomol-

ogy 26: 421-452

Skevington JH, Kehlmaier C & Stahls G (2007): DNA barcod-

ing: mixed results for bigheaded flies (Diptera: Pipunculli-

dae). Zootaxa 1423: 1-26

Strobl G (1909) Spanische Dipteren. III. Beitrag. Verhandlun-

gen der Zoologisch-Botanischen Gesellschaft in Wien 59:

121-301

Withers P (2006) A preliminary account of the fauna of Pipun-

culidae (Diptera) of continental France. Dipterists Digest,

2nd Series, 13: 145-155

There are extensive dry grasslands and garrigue-type terrain,

with riverine forests of mainly downy oak (Quercus pubescens

Willd.) and holm-oak (Quercus ilex L.).

¢ Kerkini: Greece, Kendriki Makedonia, Lake Kerkini,

41°10'46"'N 23°9'20"E. This locality refers to the Wetland Ker-

kini Biodiversity Study (courtesy of Gordon J. Ramel, http://

www.ramel.org/lake-kerkini/) which covers many habitats

from the actual lake shore right into the nearby mountains. For

detailed information visit the project’s homepage.

¢ S’Albufera: Spain, Balear Island, Mallorca, 39°47'50"N

3°6'22.5"E. An extensive wetland area in north Mallorca close

to Port d’ Alcudia. Surveys were carried out on behalf of TAIB

(The Albufera International Biodiversity Project, courtesy of

Nick J. Riddiford, https://www.taib.info/en/) in April and May

2006 and May 2007 by D.J. Gibbs. Sampling was confined to

sweep-netting but included visits to many habitats both within

and adjacent to S’Albufera Natural Park. Particularly the dunes

of Es Comu and the dry, Pine covered low hills of Puig san

Marta were productive collecting localities.

¢ Vidauban: France, Var, Vidauban, Vidauban golf club,

43°23'36" 6°27'51'"E. This area is situated in the Plaine des

Maures, an area dominated by parasol pine (Pinus pinea L.)

and cork-oak (Quercus suber L.). There are also numerous tem-

porary or permanent ponds in the area.

©ZFMK

58 Christian Kehlmaier et al.

Appendix II. A systematic checklist of named Pipunculidae of selected Mediterranean countries.

[*Probably misidentified (see Kehlmaier 2005a: 312; Kehlmaier 2005b: 12)].

Fi [reece tia [torneo [tania [ Tukey [ Gyprs

Nunbecotreoiedeeies Ts | oat tk | kf 6

. = — SS eee [ili

ae |. | | ad | as

[ChatarinaeAcré 1939 |

[ChalarusWalker,1834 |

fie

C. brevicaudis Jervis, 1992

C. clarus Jervis, 1992

C. indistinctus Jervis, 1992

C. spurius (Fallén, 1816)

Verrallia Mik, 1899

V. aucta (Fallén, 1817)

Nephrocerinae Aczél, 1939

Cephalops Fallén, 1810

C. (Cephalops) conjunctivus Coe, 1958

C. (Parabeckerias) obtusinervis (Zetterstedt, 1844)

C. (Semicephalops) perspicuus (de Meijere, 1907)

C. (Semicephalops) straminipes (Becker, 1900)

C. (Semicephalops) ultimus (Becker, 1900)

Claraeola Aczél, 1940

C. clavata (Becker, 1897)

C. cypriota Kehlmaier, 2005

C. conjuncta (Collin, 1949)

Clistoabdominalis Skevington, 2001

C. dilatatus (De Meyer, 1997)

C. nitidifrons (Becker, 1900)

C. ruralis (Meigen, 1824)

C. sinaiensis (De Meyer, 1995)

C. trochanteratus (Becker, 1900)

C. tumidus (De Meyer, 1997)

Dasydorylas Skevington, 2001

—

[ne

oe |

oa |

—

/ |

a |

ill

[C.brevicandis Jervis, 1992 |

[Cclarus Servis 1992

[C.indistinctus Jervis, 1992 |

[C.spurius (Fallen, 1816)

[Vervallia Mik 1899

Vaueta (Fallen 1817)

[NephrocerinaeAczé 1939 |

[Nephrocerus Zetterstedt, 1838 |

[N.seutellatus (Macquart, 1834) |

[Pipunculinae Walker, 1834 |

Cephalopsini

[Cephalops Fallen 1810

[C.(Cephalops) conjunetivus Coe 1958 |

[C. (Parabeckerias) obtusinervis (Zetterstedt, 1844) [|

[C. (Semicephalops) perspicuus (de Meijere, 1907) |

[C. (Semicephalops) straminipes (Becker, 1900) |

[C.(Semicephalops) ultinus (Becker, 1900) |

fudotini

[Claraeola cas 1940

[C.clavata (Becker, 1897)

[Ceypriota Kehmaier, 2005 |

[Cconjuneta (Colin, 1949) |X

[Clistoabdominalis Skevington, 2001 |

[C.dilatatus (De Meyer, 1997) |

[C.nitidfrons (Becker, 1900) |X

[Cruralis (Meigen, 1824) |X

[C.sinaiensis(De Meyer, 1995) |X

[C.trochameratus (Becker, 1900) |X

LC. tumidus(De Meyer. 1997) |

[Pasydorylas Skevington, 2001 |

[D. gradusKehimaier,2005 |

[D. holosericeus (Becker, 1897) |

[D. setosus (Becker, 1908) |

[EudorylasAcas1940

[eanctusKehinaien 2005 ————~d Si XT dT

[ie blscorDemeyen i977 ———S—S—~d Si x | dT Cd

Bonn zoological Bulletin 68 (1): 31-60 ©ZFMK

New data on Mediterranean Pipunculidae 59

eg ed or

EcmatiKorneis iTS Xx TTT

.ctorans (beckon 99) —————S—~i SSCs x | Pr

fet (Becker 190) ————~d CX ~| x | pd

ae A a

Ee semesnciniesa6s LP

infers Colin, 1956 <i SiS

medteranen De Meyer Ackand, 997 |__| _x_[| x

i. obinme coe. i566 SS SSSCdESSCdS XT

[&obscrusCoe,1966 —————S—S—~d Si

.panmonicas Backer 187) ————SS~s SX

sae Ganssens 1955) |__| x |

. stfascpes Coli, i986 |__| x |

.rapezods Becker 900) «dCi

.triangris Keniaie, 2005 |__| |

é.tigoms Benker 190) «dCi

uncer Catertea, 884) +d + x |

. cermatensis (Beker, 1997) ————~dYt iS

Piomenustaneiie 2 ———SSSSC*di

PcarevoiaiKunen.i5 ||

P.umbarine Kohima 2010 +i

[Doniomerpha ALI

[B. Denyomerpha)imparaacouin,i9a | «|X|

[B (Dostomyza) aera esst 1950 |__| _x_[|

Tomowanetanasie9 |

racer Kuen. i958 |X S|

Fr ciiemoraa ecker1901) ————~d_x | x |

Fr coguite Keres, 907) —————~+dt «ix

bmn Dene 95

djs Bote, 90)

Tr dts DeMeyer 995 SS~S

fidbergi De Meyer 995 ————SS—~dCS~dSC

froma Becken 1997) —————S—S~d <P

Fr genicuta(eigen, 82) <i SiS

nanensis Colin, 949) ————S—~dC SP

Tr tldeos DeMeyer 9977 ———S~wSSiC

[ir inermis De Meyer 1995 «di xX

inpinaa Dewieyen 1995 ————SS—C~iCi SP

Bonn zoological Bulletin 68 (1): 31-60 ©ZFMK

mM |r | | | x | OS | OS

60 Christian Kehlmaier et al.

[ee

[KisrcenisdeMeeni9s EE x TT

7. parakuthyi De Meyer, 1995

T: vicina (Becker, 1900) x

Bonn zoological Bulletin 68 (1): 31-60 ©ZFMK

FORSCHUNGS

AM 6ENIG Bonn zoological Bulletin 68 (1): 61-91

2019 -Trape JF et al.

https://do1.org/10.20363/BZB-2019.68.1.061

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:|sid:zoobank.org:pub:0F40DD 1 A-D80F-49BA-B6DF-FF8F27E487E7

On the Psammophis sibilans group

(Serpentes, Lamprophiidae, Psammophiinae)

north of 12°S, with the description of a new species from West Africa

Jean-Francois Trape', Pierre-André Crochet’, Donald G. Broadley*?, Patricia Sourouille’,

Youssouph Mané*, Marius Burger®, Wolfgang Boéhme’, Mostafa Saleh’, Anna Karan’,

Benedetto Lanzat!’ & Oleg Mediannikov"!

“> Institut de Recherche pour le Développement (IRD), Laboratoire de Paludologie et de Zoologie Médicale, UMR MIVEGEC,

B.P. 1386, Dakar, Sénégal

2.4 Centre d’Ecologie Fonctionnelle et Evolutive (CEFE), UMR 5175, CNRS — Université de Montpellier — Université Paul-Valéry

Montpellier — EPHE, 1919 Route de Mende, F-34293 Montpellier cedex 5, France

3 Natural History Museum of Zimbabwe, P.O. Box 240, Bulawayo, Zimbabwe

° African Amphibian Conservation Research Group, Unit for Environmental Sciences and Management, North-West University,

Potchefstroom 2520, South Africa — Flora, Fauna & Man, Ecological Services Ltd, Tortola, British Virgin Islands

’Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, D-53113 Bonn, Germany

° Departement of Zoology, Faculty of Science, Al Azhar University, Cairo, Egypt

*1 Aix Marseille Université, IRD, AP-HM, MEPHI, Marseille, France

!0 Museo di Storia Naturale, Universita di Firenze, Sezione di Zoologia ‘‘La Specola”’, Via Romana 17, I-50125 Firenze, Italy

“Corresponding author: Email: jean-francois.trape@ird.fr

'urn:lsid:zoobank. org:author:F8BE8015-09CF-420B-98D3-D255D 142AA2D

urn:|sid:zoobank.org:author: BBBDEE7B-A5F5-4161-A85B-8955EA 86432A

>urn:lsid:zoobank. org:author: 1615CF64-94B 1-4FOB-849E-18514AB10010

“urn:|sid:zoobank.org:author:4B2249CA-1D60-4A CB-8839-D6128B523A0F

>urn:|sid:zoobank.org:author: 1 1 SEFE60-2220-436F-AB43-CAF6D5011410

°urn:lsid:zoobank.org:author: DE28 1330-973D-4FFO-B506-809247E76E4D

7urn:|sid:zoobank.org:author: FFAC2972-9F52-404B-BA9C-489C7793FF8D

Surn:lsid:zoobank.org:author: | CE839A7-CE97-498D-8780-36C64029C899

*urn:|sid:zoobank.org:author:8AA64018-8520-4694-BD77-FDDA 760DBD3C

'urn:Isid:zoobank.org:author:}6E670725-CBA3-4E05-A4F2-26602ED614F9

''urn:lsid:zoobank. org:author:EF2B 1604-1 BDB-4739-AA65-7458BD8DB3F8

Abstract. Based on molecular, morphological and field data, the status and zoogeography of the taxa of the Psammophis

sibilans group north of 12°S are reviewed. Molecular data including sequences from 20 of the 22 described species known

to occur north of 12°S suggest that P. sibi/ans distribution is restricted to northeastern Africa, from Egypt to Ethiopia. Po-

pulations from West Africa are described as a new species, P. afroccidentalis sp. nov., and those from Chad, Cameroon and

Central African Republic are assigned to P. rukwae which is also distributed from Tanzania to Ethiopia. Molecular data

indicate the occurrence within this complex of three additional cryptic species in the Horn of Africa. Populations previous-

ly assigned to P. phillipsi in Central Africa north, south and east of the Congo forest block are assigned to P. mossambicus

and the status of P. occidentalis is discussed. P. phillipsi is restricted to West Africa, with P. irregularis as junior synonym.

Key words. Reptilia, Ophidia; Psammophiinae, Psammophis sibilans, Psammophis afroccidentalis sp. nov., taxonomy,

biogeography, Africa.

INTRODUCTION

According to Hughes (1999) Psammophis sibilans (Lin-

naeus, 1758) is the species “mostly widely and commonly

reported from Africa and the most confused taxonomical-

ly of any African snake”. According to Broadley (1963)

Received: 26.10.2018

Accepted: 24.05.2019

“the Psammophis sibilans group has been a herpetolo-

gist’s nightmare for two centuries”. The nomen sibilans

was based on several specimens, one of them is still ex-

tant and preserved at Uppsala University museum (Lin-

naeus coll. n° 42). It has been figured by Anderson (1898:

fig. 12) and Brandstatter (1996: fig. 25), and its identi-

Corresponding editor: P. Wagner

Published: 13.06.2019

62 Jean-Frang¢ois Trape et al.

ty well established (Loveridge 1940). The type locality

“Asia” (in error) was corrected to Africa (Anderson 1898,

Flower 1933) then restricted to Egypt (Loveridge 1953).

Loveridge (1940) revised the genus and grouped the fol-

lowing six taxa as subspecies of P. sibilans: P. schokari

(Forskal, 1775), P. phillipsi (Hallowell, 1844), P. notos-

tictus Peters, 1867, P. trinasalis Werner, 1902, P. leighto-

ni Boulenger, 1902, and P. sudanensis Werner, 1919. He

also synonymized P. irregularis Fisher, 1856, P. brevi-

rostris Peters, 1881, P. mossambicus Peters, 1882 and P.

leopardinus Bocage, 1887 with P. sibilans, and P. regula-

ris Sternfeld, 1908 and P. occidentalis Werner, 1919 with

P. phillipsi. Marx (1958) described Psammophis aegyp-

tius and erected P. schokari as a full species. Broadley

(1966) described P. sibilans rukwae from southwestern

Tanzania. This taxon was distinguished from all other

related southeastern forms of Psammophis by having

the first five lower labials in contact with anterior sub-

linguals, an arrangement typical of Egyptian populations

of P. sibilans. He also argued that P. sibilans rukwae was

widely distributed north of the Equator from Tanzania to

Senegal. Broadley (1977) recognized P. phillipsi as a full

species ranging from Senegal to South Africa, P. /eop-

ardinus as a subspecies of P. sibilans, and P. notostictus,

P. leightoni and latter (Broadley 2002) P. trinasalis and

brevirostris as full species distributed in southern A frica.

Spawls (1983) described P. /eucogaster on the basis of a

single specimen from Wa, Ghana. A revision of the genus

Psammophis by Brandstatter (1995, 1996) was discussed

by Hughes (1999) who provided an updated table of the

nomenclatural changes in Psammophis over the past 100

years. Branch (1998) restricted P. phillipsi to West Af-

rica and applied the name P. mossambicus for southern

African populations. Hughes (1999), then Trape & Mané

(2006), thought that P. /eucogaster was conspecific with

P. sudanensis, which they recognized as a full species,

whereas Broadley (1977) previously synonymized P. su-

danensis with P. sibilans, and Bohme (1986) treated it

as conspecific with P rukwae. Hughes & Wade (2002)

described P. zambiensis from Zambia and southern Dem-

ocratic Republic of the Congo, a species previously con-

founded with P. /eopardinus from Angola that they erect-

ed as a full species. Broadley (2002) erected P. orientalis

Broadley, 1977, from eastern and southern Africa as a

full species. This taxon was initially described as a sub-

species of P. subtaeniatus Peters, 1882, a species widely

distributed south of 12°S (Broadley 2002). Hughes &

Wade (2004) revived P. occidentalis from the synonymy

of P. phillipsi and proposed to use this name for the pop-

ulations of central Africa north of the Congo forest block

previously assigned to P. phillipsi. Several Psammophis

species were included in the phylogeny of the Lamprophi-

idae by Vidal et al. (2008). Kelly et al. (2008) published

a phylogenetic study of Psammophis and allied genera

including 39 species, but few specimens from West or

Central Africa were included in these studies. Additional

Bonn zoological Bulletin 68 (1): 61-91

species of the genus Psammophis currently recognized

in Africa north of 12°S include P. elegans (Shaw, 1802),

P. praeornatus (Schlegel, 1837), P. lineatus (Duméril,

Bibron & Dumeéril, 1854), P punctulatus Dumeril, Bi-

bron & Dumeril, 1854, P. angolensis (Bocage, 1872),

P. biseriatus Peters, 1881, P. pulcher Boulenger, 1895,

P. jallae Perraca, 1896, and P. tanganicus Loveridge,

1940 (Wallach et al. 2014, Uetz & HoSek 2018). Here we

present molecular and morphological data on the taxa of

the P. sibilans group and review their status and zooge-

ography north of 12°S.

MATERIALS AND METHODS

Extensive field studies of snakes were conducted in West

and Central Africa between 1980 and 2017 by one of the

authors (JFT) who collected more than 4,000 specimens

belonging to the genus Psammophis. The database of

another author (DGB) included most of the P. sibilans

group material available in American, European and

southern African museums, totalling more than 3,000

specimens. Tissues from selected specimens of most taxa

and colour variants of the P. sibilans group collected by

JFT, MB and WB between 2006 and 2017, or originat-

ing from the BEV tissue collection in Montpellier, were

used for the molecular study (see Table 1). We also ob-

tained tissues from specimens of P. sibilans from Egypt

(collected by MS), and of P. mossambicus from Gabon

(provided by L. Chirio). We included in our phylogenetic

tree data from GenBank, in particular those from Kelly

et al. (2008) and Vidal et a/. (2008) who sequenced most

Psammophis taxa known from southern and eastern Af-

rica. Sequences of Malpolon monspessulanus and Psam-

mophylax rhombeatus downloaded from GenBank were

used as outgroups.

Molecular studies were conducted independently in

Montpellier (PS and PAC) and Marseille (OM and AK)

with 3 mitochondrial DNA genes: ND4 (Montpellier),

16S (Marseille), and CytB (both Montpellier and Mar-

seille, most samples duplicated). DNA from small pieces

of snake tissue samples preserved in 80-96% ethanol was

extracted using either the DNeasy Blood & Tissue Kit or

the BioRobot MDx Workstation (Quiagen, Courtaboeuf,

France), with customized extraction protocols following

the manufacturer’s instructions and doing negative con-

trol with water. Whole DNA eluted in 200 ul AE Buffer

was stored at 4°C until used in Polymerase chain reactions

(PCR) amplifications. We amplified mitochondrial 16S

rDNA with the universal vertebrate primers 16SA-2290,

CGCCTGTTTACCAAAAACAT and 16SB-2860, CCG-

GTCTGAACTCAGATCACGT (Gatesy eft al. 1997),

NADH dehydrogenase subunit 4 with primers ND4,

CACCTA TGACTACCAAAAGCTCATGTAGAAGC

and Leu CATTACTTTTACTTGGATTTGCACCA

(Arévalo et al. 1994) and Cytochrome b with primers

©ZFMK

Psammophis sibilans group 63

L14724, CGAAGCTTGATATGAAAAACCATCGTTG

(Irwin et a/. 1991) and H15547b AATAGGAAG TAT-

CATTCTGGTTTAATG (Campbell 1997). Primers were

manufactured by Eurogentec (Seraing, Belgium).

In Montpellier PCR amplification was carried out in

20 uL using REDExtract-N-Amp PCR Reaction Mix,

primers at 0.5 uM and 8 ul of DNA. Thermocycling con-

ditions were an initial denaturation step of 2 minutes at

94°C, followed by 35 to 40 cycles of 94°C, 40 s; 53°C,

40 s; 72°C, 1 min and a final elongation step of 10 min

at 72°C. Negative extraction and PCR controls with wa-

ter were amplified to check absence of contamination by

PCR products from previous amplifications in our ampl-

icons. Approximatively 150 ng of unpurified PCR prod-

ucts were sent to Eurofins Genomics (Ebersberg, Germa-

ny) for purification and sequencing with PCR primers

and internal forward primer of Cytochrome b gene SNK-

P2b TGARGACAAATATCATTC (Kelly et al., 2003).

In Marseille PCR was performed using a HotStar Taq

DNA Polymerase Kit (Qiagen) with 1.0 uwL MgCl2, 0.2

uL HotStart Tag, 2.5 wl 10x PCR buffer, 2.5 uL dNTP

(2 mM stock), 0.5 uL of a 10 uM solution of each primer,

12.8 wL sterile water and 5 uwL of DNA. Cycling condi-

tions were as follows: 94°C 2 minutes followed by 40

cycles of 94°C, 30 s; 53°C, 30 s; 72°C, 1 min.; the final

elongation was at 72°C, 3 min. We did not use positive

controls. Sterile water was used as negative control. PCR

products were visualized by electrophoresis on a 1.5%

agarose gel, stained with ethidium bromide and exam-

ined using an ultraviolet transilluminator. The PCR prod-

ucts were purified using a QIAquick Spin Purification Kit

(Quiagen) according to the manufacturer’s instructions.

Sequencing of amplicons was performed using the Big-

Dye Terminator Cycle Sequencing Kit (Perkin Elmer Ap-

plied Biosystems) with ABI automated sequencer (Ap-

plied Biosystems 3130 Genetic Analyzer).

We used Codon Code Aligner 4.2.5 (LI-COR, Inc) and

MEGA 6.06 (Tamura et al. 2013) to check, assemble and

align sequences. The phylogenetic tree was inferred us-

ing Maximum-likelihood with MEGA 6.06 using the fol-

lowing options: 1000 bootstrap replications, use all sites,

and default settings for the other options. The best substi-

tution model (HK Y+G+I) was determined with MEGA

using the BIC critertum for the whole alignment.

Morphological analysis included classical meristic

data (numbers of dorsals, ventrals, subcaudals, oculars,

temporals, supralabials and infralabials) and several col-

oration characters, with special attention to some char-

acters that previous studies have shown to be of interest

in the genus Psammophis (Hughes 1999, Broadley 2002,

Hughes & Wade 2002): (1) the infralabials contact with

anterior sublinguals, (2) the aspect of the cloacal scale

(entire or divided), (3) the dorsal head pattern, (4) the oc-

curence and aspect of a vertebral chain (colour pattern of

alternate pale and dark areas on the central row of dorsal

Bonn zoological Bulletin 68 (1): 61-91

scales), and (5) the occurrence of pale longitudinal bands

over body.

RESULTS AND DISCUSSION

Molecular analysis

We aligned 513-514 bp of 16S, 797 bp of cytochrome 5,

and 852-855 bp of ND4. Of the 2160 mitochondrial nu-

cleotides, 776 are variable and 654 informative under the

parsimony criterion. All sequences have been deposited

with GenBank and accession numbers are given in Ta-

ble 1 (Appendix I).

The phylogenetic tree (Fig. 1) includes sequences from

our specimens and additional sequences from GenBank

specimens. Only two taxa (P. pulcher and P. zambiensis)

of the 22 Psammophis taxa currently known north of

12°S are missing in this tree which reveals eleven major

lineages of Psammophis species, including nine lineages

for the species (and unnamed cryptic species) distributed

north of 12°S:

¢ Lineage | includes two clades, the first one (clade 1a)

comprising the GenBank sequences of P. rukwae from

Tanzania and Kenya, one of our sequences from Ethi-

opia, and sequences from Chad, with in particular all

those from Baibokoum at the tri-junction border of Chad,

Cameroon and Central African Republic, some of them

belonging to specimens with uniform dorsum (Fig. 2)

and others with marked vertebral and dorsolateral stripes

(Fig. 3). All these specimens are characterized by five in-

fralabials in contact with the anterior sublinguals and a

divided cloacal. The second clade 1b comprises all our

sequences from West Africa, but also a sequence from

Mao in Chad. As in clade la, some of them belong to

specimens with uniform dorsum (Fig. 4) and others with

marked vertebral and dorsolateral stripes (Fig. 5). As in

clade 1a, all these specimens have also five infralabials

in contact with the anterior sublinguals and a divided clo-

acal. Within clade la, there is very little divergence be-

tween P. rukwae from Tanzania and our specimens from

Chad and Ethiopia, and less divergence between our

specimens than between P. rukwae from Tanzania and

P. rukwae from Kenya. Within clade 1b, two groups with

close sequences are observed, one including specimens

from Senegal, Mauritania, Guinea, Ivory Coast (data not

shown, ND4 only), Mali (data not shown, ND4 only)

and one of two specimens from Niger, the second group

including specimens from Burkina Faso and Benin, the

second specimen from Niger (data not shown, ND4 only)

and a specimen from Mao in Chad. To our knowledge,

there is no available name in the literature for these West

African specimens of clade 1b that were previously con-

founded with P. sibilans or attributed either to PR. rukwae,

P. cf. rukwae or P. cf. phillipsi in the recent literature.

©ZFMK

64 Jean-Frang¢ois Trape et al.

P. rukwae Chad IRD 2121.N

971 p. rukwae Chad IRD 2020.N

P. rukwae Chad IRD 2150.N

77\ P. rukwae Chad IRD 1949.N

198 P. rukwae Chad IRD 1888.N

P. rukwae Kenya DQ486279 DQ486443 1a

95} P. rukwae Ethiopia MBUR 08343

P. rukwae Chad IRD 2001.N

100)..4 P. rukwae Chad IRD 2759.N

P. rukwae Chad IRD 2002.N

99) P. rukwae Tanzania DQ486214 DQ486375

100! P. rukwae Tanzania DQ486215 DQ486376

P. rukwae Kenya DQ486282 DQ486446

70; P. afroccidentalis Niger FJ404325 FJ404316 FJ404219

P, afroccidentalis Mauritania IRD TR.4501

P. afroccidentalis Guinea IRD 5001.G

ito P. afroccidentalis Guinea IRD TR.4177

P. afroccidentalis Senegal IRD TR.4167 1 b

99) P. afroccidentalis Burkina Faso IRD TR.4173

P. afroccidentalis Chad IRD 2808.N

98} | P. afroccidentalis Benin ZFMK 77012

46| P. afroccidentalis Benin ZFMK 77036

82 P. afroccidentalis Benin ZFMK 77019

1007 P. orientalis Mozambique DQ486295 DQ486459

100} P. orientalis Tanzania DQ486219 DQ486380 2 a

99) P. orientalis Mozambique DQ486235 DQ486396

48) P. orientalis Tanzania DQ486232 DQ486393

z P. cf. sudanensis Kenya DQ486266 DQ486429 2 b

100 P. cf. sudanensis Tanzania DQ486221 DQ486382

| P. subtaeniatus Zimbabwe DQ486253 DQ486415 2 Cc

| P. sudanensis Chad IRD 2289.N

1" 100] P. sudanensis Chad IRD 2280.N 2 d

98) P. sudanensis Chad IRD 2283.N

P. sudanensis Chad IRD 2231.N :

| | al P. sp. cf. sibilans Ethiopia DQ486256 DQ486419 2 e

P. sibilans Ethiopia MBUR 08588

P. sibilans Egypt BEV T.4799

100] |p. sibilans Egypt AUZC R.143973 2f

100! P. sibilans Egypt AUZC R.143972

P. leopardinus Namibia DQ486298 DQ486462 3 a

100/- P. sp. cf. occidentalis Burundi DQ486264 DQ486427

98) P. sp. cf. occidentalis Zambia DQ486210 DQ486371

P. brevirostris South Africa DQ486241 DQ486402 3 b

100L P. brevirostris Zimbabwe DQ486234 DQ486395

P. sp. Ethiopia MBUR 08346 3c

40| P. phillips? Guinea IRD 5005.G

P. phillipsi Guinea IRD 5004.G

51} P. phillipsi Guinea IRD 5002.G

99 P. phillipsi Guinea IRD 5003.G

P. phillipsi Guinea IRD TR.4609 3 d

gq| | P. phillips? Guinea IRD TR.4610

99 P. phillipsi Togo IRD 10.T

P. phillipsi Togo IRD 358.T

|, P. phillipsi Togo IRD 44.T

75| P. phillipsi Togo IRD 367.T

P. mossambicus Chad IRD 2226.N

63] P. mossambicus Chad IRD 2136.N

P. mossambicus Chad IRD 2066.N

99 P. mossambicus Chad IRD 2053.N

P. mossambicus Chad IRD 2224.N

100] | P. mossambicus Chad IRD 2238.N

P. mossambicus Chad IRD 2186.N

P. mossambicus Cameroon IRD TR.4579

oor P. mossambicus South Africa DQ486239 DQ486400

96 P. mossambicus Mozambique FJ404322 FJ404314 FJ404217

94;— P. mossambicus Mozambique DQ486293 DQ486457

P. mossambicus Tanzania DQ486198 DQ486359 3 e

P,. mossanibicus Kenya DQ486283 DQ486447

P. mossambicus Rwanda DQ486222 DQ486383

93. Pp, mossambicus Zambia ZFMK 88703

7799) P. mossambicus Zambia ZFMK 88503

3h) -P. mossambicus Zambia ZFMK 88502

t P. mossambicus Botswana DQ486249 DQ486411

53] P,. mossambicus Republic Congo MBUR 08242

|| P. mossambicus Gabon IRD TR.4367.LC

SSI! P. mossambicus Gabon IRD TR.4366.LC

10] P. mossambicus Republic Congo MBUR 03143

P, mossambicus Gabon DQ486290 DQ486454

34 57! P. mossambicus Gabon FJ404323 AY612061 AY611879

P. lineatus Chad IRD 2120.N

100L P. Jineatus Benin FJ404354 FJ404313 FJ404216

P. biseriatus Tanzania DQ486228 DQ486389

99 P. sp. Somalia FJ404326 FJ404317 FJ404220

96 P, tanganicus Tanzania DQ486217 DQ486378

gi— P. elegans Ivory Coast IRD 222.Cl

P. elegans Mauritania IRD TR.4504

62 100|__p. elegans univittatus Chad IRD 2761.N

(| P. punctulatus trivirgatus Tanzania DQ486269 DQ486432

P. praeornatus Senegal IRD 9193.S

aon Oo ao Ff

l| 400 P, schokari Tunisia FJ404324 AY612034

29 P. schokari Morocco DQ486204 DQ486365

700 P. aegyptius Egypt BEV.11350 MG003038 MG002972

57 Tool; P. aegyptius Egypt BEV.T4801 MG003042 MG002976

991 P. aegyptius Egypt BEV.10372 MG003041 MG002975

100) P. angolensis Botswana CMRK263 DQ486248 DQ486410

P. angolensis Botswana CMRK447 DQ486275 DQ486439 9

99 100 P. angolensis Zambia CMRK283 DQ486254 DQ486416

100'_ P. angolensis Tanzania CMRK392 DQ486270 DQ486433

P. crucifer South Africa DQ486310 D|486334 10

P. jallae Botswana DG486247 DO4B6409

gl trigrammus Namibia DQ486305 Da486469 1 1

: Malpolon monspessulanus FJ404320 AY 188029 AY188068

99 Psammophylax rhombeatus Fu404327 FJ404312 Fl404215

0.05

Fig. 1. Phylogenetic tree (16S, Cyt. B, ND4) of the African spe-

cies of Psammophis inferred with maximum likelihood from a

concatenated dataset. Numbers on branches are bootstrap sup-

port values. Black lines separate the major lineages, and red

lines clades within lineages 1—3 which include most species of

the Psammophis sibilans group.

Bonn zoological Bulletin 68 (1): 61-91

They are described below as a new species, Psammophis

afroccidentalis sp. nov.

¢ Lineage 2 includes six clades. Clade 2f comprises

the three specimens of P. sibilans from Egypt and one

specimen from Ethiopia, clade 2e a GenBank sequence

from Ethiopia attributed to P. cf. sibilans, clade 2d our

specimens of P. sudanensis from Chad, clade 2c Gen-

Bank sequences of Kenyan and Tanzanian specimens at-

tributed to P. sudanensis, clade 2b P. subtaeniatus from

Zimbabwe, and clade 2a P. orientalis from Tanzania and

Mozambique. No sequence of P. sibilans from Egypt was

available before the present study, and our results clearly

show that most previous records of P. sibilans in the lit-

erature were erroneous, but also that P. sibilans distribu-

tion reach Ethiopia, likely with a continuous distribution

through Sudan as previously proposed by Brandstatter

(1995, 1996). Unfortunately, no specimen from Sudan

was available for the molecular study.

¢ Lineage 3 corresponds to the P. phillipsi complex

and includes five clades. All species belonging to these

clades have four infralabials in contact with the anteri-

or sublinguals. Clade 3a corresponds to P. /eopardinus

from Namibia, clade 3b comprises P. brevirostris from

southern Africa and GenBank sequences from Burundi

and Zambia of Kelly et al. (2008) labelled P. phillipsi

occidentalis (see below), and clade 3c corresponds to a

probably undescribed species from Ethiopia collected by

one of us (MB). The two other clades include specimens

of wet savannas and forest-savanna mosaics distributed

either in West Africa (clade 3d), or north, east and south

of the Congo forest block (clade 3e).

All specimens from West Africa (clade 3d) are al-

most identical genetically, but they include both typical

P. phillipsi specimens (from Guinea and Togo, with en-

tire cloacal scale) and two specimens from southern Togo

characterized by black dorsal blotches and, for one spec-

imen, by a divided cloacal scale, 1.e., matching the char-

acteristics of the holotype of P. irregularis that originated

from the same area (Fig. 6). This supports the view that

P. irregularis is a junior synonym of P. phillipsi, a species

restricted to West Africa.

Around the Congo forest block (clade 3e), specimens

from Chad and Cameroon selected for the molecular

analysis also presented a variety of colour patterns, in-

cluding unpatterned specimens, specimens with dor-

sal black blotches, specimens with orange supralabials

(Fig. 7) that are common in Adamaoua mountains in

Cameroon (Psammophis sp. 1 of Chirio & LeBreton

2007), and specimens with or without black spots on

the supralabials, the throat and the ventrals. Despite

these marked differences in colour patterns, sequences

were all almost identical, and there was little difference

between these specimens and those of P. mossambicus

from south and east of the Congo forest block. All have

four infralabials in contact with the anterior sublinguals

and a divided cloacal. Hughes & Wade (2004) resurrect-

©ZFMK

Psammophis sibilans group 65

ed P. occidentalis Werner, 1919, for the populations of

the P. phillipsi complex distributed north of the Congo

forest block from Cameroon to Uganda. The lectotype

of P. occidentalis (type locality: “Congo” without preci-

sion) has a vertebral chain, a dorsolateral light coloured

stripe on body scales 4/5 and grey obfuscation of the

ventral scales in the midline (Hughes & Wade 2004).

This pattern was not observed in the specimens from

Chad or Cameroon that we sequenced, but according to

Hughes & Wade (2004) it is not rare north of the Con-

go forest block where various patterns are observed as

previously highlighted by Roux-Estéve (1965). Howev-

er, the pattern with a vertebral chain and a dorso-lateral

stripe is also common south of the Congo forest block, in

particular in coastal savannas of Gabon, Republic of the

Congo and Democratic Republic of the Congo (“P. sib-

ilans” of Trape & Roux-Estéve 1995, see Fig. 8). Our

three specimens from coastal Gabon and Republic of the

Congo with this pattern are very close molecularly to

P. mossambicus specimens from Zambia, Rwanda, Tan-

zania, Kenya, Mozambique, Botswana and South Africa.

Thus we follow Branch (1998) and Broadley (2002) in

attributing all specimens of clade 3e to P mossambicus,

both north, east and south of the Congo forest block, and

we treat P. occidentalis as synonym of P. mossambicus.

East and south of the Congo forest block, clade 3b in-

cludes P. brevirostris from Zimbabwe and South Africa,

and two specimens from Burundi and Zambia studied

by Kelly et a/. (2008) that were attributed with doubt

by these authors to P. phillipsi occidentalis. According

to Hughes & Wade (2004), who revived this taxon, P.

occidentalis was attributable only to populations north of

the Congo forest block from Cameroon to Uganda. How-

ever, aS mentioned above, the specimens from this area

that we sequenced match much better P. mossambicus.

Kelly et al. (2008) sequences in clade 3b may correspond

to P. zambiensis — a species known from Zambia — or to

an undescribed cryptic species.

¢ Lineages 4-11 include species previously sequenced

and discussed by Kelly et al. (2008) and some additional

taxa. In the P. sibilans group, both P. schokari and P. ae-

gyptius (lineage 8) belong to a lineage distant from those

of P. sibilans, P. rukwae and P. afroccidentalis sp. nov.

Lineage 5 comprises three species, all distributed in East

Africa: P. biseriatus, P. tanganicus and a cryptic species

from Somalia sequenced by Kelly et al. (2008). In the

other lineages, no species belong to the P. sibilans group.

There is little divergence between P. elegans univittatus

Perret, 1961 from Cameroon and Chad and the nominate

subspecies from West Africa (lineage 6). The colour pat-

terns of these two taxa are distinct, with univittatus pos-

sessing a single vertebral brown line and lacking those

present on the flanks in e/egans. The univittatus pattern

is rare in West Africa (Hughes unpublished, Trape &

Mané 2015) but was observed in all specimens collected

in Chad except two specimens from Mao (Trape unpub-

Bonn zoological Bulletin 68 (1): 61-91

lished). Lineages 4, 7, 9 and 10 comprise each a single

species, P. lineatus, P. praeornatus, P. angolensis and

P. crucifer, respectively, with the later species restricted

south of 12°S. Finally, lineage 11 comprises two species,

P. jallae and P. trigrammus, which are also restricted

south of 12°S (Broadley 2002).

SYSTEMATIC ACCOUNT

PSAMMOPHIS SIBILANS (Linnaeus, 1758)

Egyptian Hissing Sand Snake,

Schmuck-Sandrennnatter

Psammophis _rayé,

Coluber sibilans Linnaeus, 1758, Syst. Nat., ed. 10, 1:

222. Type locality: “Asia” & 1766, Syst. Nat., ed. 12,

12383;

“Le Chapelet” Lacépede, 1789, Hist. Nat. Serpens 2:

246, pl. xii, fig. 1.

Coluber Gemmatus Shaw, 1802, Gen. Zool., 3: 539. No

locality.

Coluber moniliger Daudin, 1803, Hist. Nat. Rept. 7: 69.

No locality.

Natrix sibilans Merrem, 1820: Vers. Syst. Amphib.: 114.

Coluber auritus Geoffroy Saint Hilaire, 1827, Descr.

Egypte, 1, Hist. Nat. Rept.: 147, 151, pl. viti, fig. 4.

Type locality: Egypt.

Psammophis sibilans Boie, 1827, in Oken, Isis, 20, col.

547; Gunther, 1858: 136 (part); Jan & Sordelli, 1870:

Livr. 34, Pl. 11, fig. 3 (Cairo); Boulenger, 1896: 161

(part); Anderson, 1898: 303, fig. 12, Pl. xlim; Bouleng-

er, 1915c: 653 (part); Flower, 1933: 824; Corkill, 1935:

20 (part); Parker, 1949: 70 (part); Largen & Rasmus-

sen, 1993: 366 (part); Brandstatter, 1995: 173 (part), PI.

14; Schleich et al., 1996: 517; Largen, 1997: 91 (part);

Baha el Din, 2006: 266; Largen & Spawls, 2010: 564

(part); Geniez, 2015: 248.

Coluber lacrymans Reuss, 1834, Mus. Senckenberg 1:

139. Type locality: Tor District, Arabia (= Tor, Sinai

Peninsula, Egypt).

Psammophis moniliger Peters, 1862: 274 (Egypt).

Psammophis sibilans sibilans Loveridge, 1940: 30 (part);

Marx, 1956: 8; 1968: 198; Lanza, 1972: 178; 1983:

227 (part); 1990: 440 (part); Saleh, 1997: 156, PI. 92.

Description. (325 specimens from Egypt and two spec-

imens from Ethiopia examined) Nostril pierced between

2 nasals; preocular 1 (very rarely 2), in short contact with

or separated from frontal; postoculars 2 (very rarely 3);

temporals basically 2+2+3, but with frequent fusions; su-

pralabials 8 (but often 9 in Upper Egypt), the 4" & 5" (or

the 5" & 6") entering orbit; infralabials usually 10 or 11

(rarely 9 or 12), the first 5 in contact with anterior sublin-

guals; dorsal scales in 17-17-13 rows; ventrals 154-178:

cloacal divided; subcaudals 98-119 (lowest count 91 fide

©ZFMK

66 Jean-Frang¢ois Trape et al.

Anderson 1898, but tip of the tail probably mutilated).

Brandstatter (1995, fig. 68-70) has published SEM mi-

crographs of a dorsal scale of an Egyptian specimen.

Dorsum brown, top of head often with a pale median

stripe on the snout which either terminates at the fron-

tal or continue up to two-thirds its length (Fig. 9), back

of head often with pale transverse markings; labials im-

maculate yellow or with a few dark spots; dorsum plain

(Fig. 10) or with a vertebral line with each scale yellow

with black laterally or paler at base and pale dorsolateral

stripes on scale rows 4 and 5 (Fig. 11); lower half of outer

scale row and ventrals yellow; sometimes a pair of faint

or broken black ventral hairlines.

Size. Largest specimen: 1,445 mm (Flower 1933).

Remarks. Here we follow the usage established by

Loveridge (1953) in treating “Egypt” as the type locality

of P. sibilans. However, to fulfil the requirements of the

code of Zoological Nomenclature, a proper restriction

of type locality would require designation of a lectotype

and, if the origin of the lectotype cannot be traced and/or

its identity cannot be ascertained, application to the com-

mission to set aside the type and designate a neotype in

accordance with Article 75.5 of the Code. Further studies

are needed to establish the distribution of P. sibilans in

north-eastern Africa. Sequences from Ethiopia and So-

malia published by Kelly et a/. (2008) and one additional

sequence from our specimens suggest that at least three

cryptic species of the Psammophis sibilans group occur

in the Horn of Africa.

Habitat. Cultivated and other vegetated areas along

the Nile in Egypt and Sudan, woodland savanna in Ethi-

opia.

Distribution. Egypt, Sudan and Ethiopia. Possibly

extending in neighbouring areas of Eritrea and South

Sudan. Figure 12 shows the geographic distribution of

the P. sibilans specimens that we sequenced, and of other

sequenced specimens of closely related species.

PSAMMOPHIS RUKWAE Broadley, 1966

Rukwa Whip Snake, Psammophis du Rukwa, Ruk-

wa-Sandrennnatter

Psammophis sibilans sibilans (not Linnaeus) Loveridge,

1940: 30 (part); 1956: 48 (part); Perret, 1961: 136;

Roussel & Villiers, 1965: 1528; Graber, 1966: 141.

Psammophis sibilans (not Linnaeus) Boulenger, 1896:

161 (part); Sternfeld, 1908b: 218, 233; 1909a: 21;

1917: 478; Bohme, 1975: 40; Hughes, 1983: 353

(part); Chippaux, 2006: 175 (part); Chirio & Ineich,

2006: 52; Chirio & LeBreton, 2007: 534.

Psammophis subtaeniatus (not Peters) Loveridge, 1933:

254 (part).

Psammophis subtaeniatus sudanensis (not Werner) Ve-

sey-FitzGerald, 1958: 62, Pl. 17; Robertson ef al.,

1962: 428.

Bonn zoological Bulletin 68 (1): 61-91

Psammophis sibilans rukwae Broadley, 1966: 3. Type

locality: Kafukola, Rukwa valley, Tanzania. Holotype:

NMZB 4212.

Psammophis rukwae Cadle, 1994: 119; Brandstatter,

1995: 151; Spawls et al., 2002: 406.

Psammophis rukwae rukwae Broadley & Howell, 1991:

28.

Description. (127 specimens examined) Nostril pierced

between 2 nasals; preocular 1 (very rarely 2), in short

contact with or separated from frontal; postoculars 2:

temporals basically 2+2+3, but with frequent fusions;

supralabials 8 (very rarely 9), the 4" & 5" (very rarely

5 & 6") entering orbit; infralabials usually 11 (rarely 10

or 12), the first 5 (very rarely 4) in contact with anteri-

or sublinguals; dorsal scales in 17-17-13 rows; ventrals

160-184 (Rukwa type series 165-177; populations East

of 25°E 160-184; Chad 169-177; up to 192 for Soma-

lia, but probably a cryptic species); cloacal divided; sub-

caudals 71-102 (Rukwa type series 83-96; populations

East of 25°E 71-100, Chad 84—102 (n=30). Brandstatter

(1995, figs 63, 64) has published SEM micrographs of a

dorsal scale of the holotype NMZB 4212.

Top of head with a pale median stripe which forks and

then borders the frontal, but the head may become uni-

form yellow-brown in large adults; labials immaculate

or with large brown spots; dorsum dark or light brown,

rarely uniform, most specimens with at least a vertebral

chain, each scale in vertebral row paler at base. Some

specimens have ill-defined pale dorsolateral stripes on

scale rows 4 and 5, which fade out in some adults, but

many other specimens, including large adults, have both

well contrasted vertebral chain, with black pigment on

each side of the scales of the vertebral row, and well

contrasted pale dorsolateral stripes on scale rows 4 and

5 with black pigment on each side. Lower half of outer

scale row and ends of ventrals yellowish, separated or not

by a pair of brown or blackish ventral lines from a yellow

mid-ventral band.

Size. Largest specimen (TM 25301 — Kafukola, Ruk-

wa, Tanzania) 1,090 + 388 = 1,478 mm.

Remarks. According to Broadley (1966) P. rukwae was

a subspecies of P. sibilans distinguished by consistent

ventral pattern of a pair of black lateral hairlines similar

to that found in P. subtaeniatus. However our series of

specimens from Chad show that many specimens lack

black lateral hairlines.

Habitat. Flood plains and grasslands seem to be the

preferred habitats in eastern Africa. In Chad this species

is common in all types of savannas.

Distribution. East Africa from the Rukwa valley in

Tanzania, north through Kenya, Uganda, Ethiopia, South

Sudan and Sudan, then the western populations extend

from the Central African Republic and Chad west to

northern Cameroon.

©ZFMK

Psammophis sibilans group 67

Fig. 3. Psammophis rukwae. Lineated phase. Sequenced specimen IRD 2150.N. Baibokoum (Chad)

Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK

68 Jean-Frang¢ois Trape et al.

PSAMMOPHIS AFROCCIDENTALIS

Béhme & Mediannikoy, sp. nov.

urn: lsid:zoobank.org:act:E27CDF96-C9ED-48 20-B64F-93A4FD16CCE8

Trape,

West-African Whip Snake, Psammophis ouest-africain,

Westafrikanische Sandrennnatter

Psammophis sibilans (not Linnaeus) Boettger, 1881:

395; Boulenger, 1896: 161 (part); Boulenger, 1906:

214; Sternfeld, 1908a: 412; Chabanaud, 1918: 165;

Angel, 1933a: 69; 1933b: 162, fig. 61; Andersson,

1937: 8; Cansdale, 1949: 106; Hughes & Barry, 1969:

1023; Roman, 1980: 61; Chippaux, 2006: 175 (part);

Trape & Mané, 2000: 26; 2002: 149; 2004: 21; 2015:

45; Villiers & Condamin, 2005: 144; Auliya er al.,

2012: 280; Hughes, 1983: 353 (part); 2012: 123; 125

(ZFMK 29365 from Tamanrasset); Chirio, 2012: 83;

Trape & Baldé, 2014: 317.

Psammophis trinasalis (not Werner) Chabanaud, 1918:

166 (Senegal).

Psammophis sibilans sibilans (not Linnaeus) Loveridge,

1940: 30 (part); Leston 1950: 84; Villiers, 1950: 93;

1951: 827; 1952: 892; 1953: 1119; 1954: 1242; 1956a:

880; 1956b: 158; 1963: 1372; 1975: 138; Condamin,

1958: 255; Doucet, 1963: 306.

Psammophis phillipsii (not Hallowell) Bohme, 1978:

398, Fig. 16, 17 (right); 2000: 71.

Psammophis rukwae (not Broadley) Bohme, 1978: 401;

1987: 259; Brandstatter, 1995: 151 (part); Chirio,

2009: 30.

Psammophis cf. rukwae (not Broadley) Joger, 1981: 332;

1982: 332; Gruschwitz et al., 1991: 30.

Psammophis cf. phillipsii (not Hallowell) Schatti, 1986:

771; Bohme et al., 1996: 21; Rodel et al., 1995: 7;

1999: 170; Ullenbruch ef a/., 2010: 43.

Psammophis sudanensis (not Werner) Ullenbruch et al.,

2010: 44; Chirio, 2012: 83.

Psammophis aff. sibilans (not Linnaeus) Trape & Mané,

2017: 120.

Holotype. MNHN 2018.0013 (formerly IRD 7631.S, a

male from Dakar Hann, Senegal (14°43’N, 17°26’ W)

collected by J.-F. Trape on December 10th, 2005 (Figs.

13 & 14).

Diagnosis. Distinguishable from other species of the

P. sibilans group by the combination of the following

characters: 17 scale rows around midbody, 156—185 ven-

trals, 96-120 subcaudals (rarely less than 100), cloacal

divided, 5 infralabials in contact with anterior sublin-

guals (very rarely 4). Dorsum pale brown, dark brown

or greenish-brown, rarely uniform, usually a vertebral

chain with the scale of vertebral row paler at base, but

this chain often restricted to part of the dorsum, ill-de-

fined and occasionally totally absent; pale dorsolateral

stripes on the 4" row of dorsals, but often ill-defined or

absent; top of head with a pale median stripe on the snout

Bonn zoological Bulletin 68 (1): 61-91

which forks when reaching the frontal and then borders

the frontal, but often ill defined or absent in adults. Ge-

netically diagnosable through possession of unique mi-

tochondrial haplotypes. Psammophis afroccidentalis

sp. nov. can be distinguished from P. rukwae by a higher

number of subcaudals (P. rukwae 70-100, exceptionnaly

up to 105), from P. sibilans by major differences in mi-

tochondrial haplotypes, a pale median stripe that borders

the frontal (not bordering the frontal in P. sibilans) and

a more uniform dorsal colouration in most specimens,

from P. schokari and P. aegyptius by a lower number of

subralabials (8 versus 9) and a different head pattern, and

from P. sudanensis, P. phillipsi, P. occidentalis, P. mos-

sambicus, P. leopardinus, P. zambiensis and P. subtae-

niatus by a higher number of infralabials in contact with

the anterior sublinguals (5 versus 4) and by different head

and dorsal patterns.

Description of holotype. A male specimen, snout-

vent length 745 mm, tail length 345 mm, total length

1090 mm, ratio total length: tail length 3.16. Supralabi-

als 8/8 supralabials, 4° & 5 entering orbit (Fig. 15);

11/11 infralabials, first 5 contact anterior sublinguals; 1/1

preocular contacting frontal; 2/2 postoculars; 2/2 anterior

temporals (the lower one on right side divided); 2+3/2+3

posterior temporals. Scale rows 17 around hood, 17

around midbody, 13 one head length ahead of the vent,

all smooth and oblique. Dorsal scales smooth, oblique.

Vertebral row not enlarged. Ventrals 168 (Dowling: 167),

subcaudals 104, all divided, cloacal divided.

Top of head with a pale median stripe on the snout

which forks and then borders the frontal; labials pale

brown and yellowish. Dorsum uniform brown except pale

dorsolateral stripes on scale rows 4 and adjacent parts of

rows 3 and 5. No vertebral chain. Belly yellowish, limit

with dorsal colouration on the first row of dorsals; traces

of broken brown hairlines on part of the ventrals.

Etymology. The name is derived from the contraction

of Africa and occidentalis, the region of Africa where this

species 1s distributed.

Variation. (924 specimens examined) Nostril pierced

between 2 nasals; preocular 1, in contact with or sepa-

rated from frontal; postoculars 2; temporals basically

2+2+3 with occasional fusions or divisions, supralabials

8, the 4" & 5" entering orbit; infralabials usually 11 (rare-

ly 9 or 10), the first 5 (very rarely 4, 2% of specimens

only) in contact with anterior sublinguals; dorsal scales

in 17-17-13 rows; ventrals 156-165.9-180 in males; 160-

173.2-185 in females, cloacal divided; subcaudals 98-

108.0-121 in males, 96-106.2-120 in females.

Colouration variable (Figs 4, 5, 16, 17). Top of head

pale brown with a pale median stripe on the snout which

forks and then borders the frontal, but the head often

becomes uniform brown in adults; labials immaculate

or with brown spots; dorsum from light brown to dark

brown; a vertebral chain rarely absent but often ill-de-

fined, with most scale in vertebral row paler at base and

©ZFMK

Psammophis sibilans group 69

a" a\ v5

wa Sa A,

Fig. 5. Psammophis afroccidentalis sp. nov. Lineated phase. Dakar (Senegal).

Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK

70 Jean-Frang¢ois Trape et al.

rarely black edged; pale dorsolateral stripes on scale row

A either well contrasted, ill-defined or absent; belly light

yellowish, often immaculate but occasionally with hair-

lines.

Size. Largest intact specimen (IRD 3538.S — Matam,

Senegal) 1,145 + 460 = 1,505 mm, but largest SVL =

1,260 mm in two specimens with truncated tails (IRD

3345.8 — Jalalawy, Senegal, and IRD 3345.S — Matam,

Senegal).

Remarks. There are limited molecular differences be-

tween a mainly western group of specimens (Senegal,

Mauritania, Mali, Guinea, Ivory Coast and one of the two

specimens from Niger) and those from Burkina Faso, Be-

nin, Niger, and Mao in Chad. They are not correlated to

differences in colour patterns nor in meristic data.

Habitat. Sahel and Sudan savanna in West Africa.

Penetrates in Guinea savanna and relict populations in

sahelo-saharan wetlands.

Distribution. Mauritania (northernmost record: Tidra

island 19°44’N, 16°24’W), Senegal, Gambia, Guinea

Bissau, Guinea, Mali (northenmost record: Tinjemban

16°44°N, 02°50’W and along the Niger River), Ivory

Coast, Burkina Faso, Ghana, Togo, Benin, Niger (north-

ernmost record: Azzel 17°03’N, 08°03’E), Nigeria and

Chad (Mao). Possibly a relict population in southern Al-

geria (ZFMK 29365 from 200 km north of Tamanrasset,

a damaged specimen previously assigned to P. rukwae by

Bohme 1986 and to P. sibilans by Hughes 2012).

PSAMMOPHIS SUBTAENIATUS Peters, 1882

Western Stripe-bellied Sand Snake, Psammophis a ventre

ligné, Gelbbauch-Sandrennnatter

Psammophis sibilans var. subtaeniata Peters, 1882: 121

(part). Type locality: Tete, Mozambique. Lectotype:

ZMB 9992A designated by Broadley, 1977: 13.

Psammophis bocagii Boulenger, 1895: 538. Type local-

ity: “Angola”, subsequently given as Benguela (Bou-

lenger 1896). Lectotype: BMNH 67.7.23.22.

Psammophis subtaeniatus Broadley, 2002: 93.

One specimen examined by DGB from north of Latitude

12° S, MBL 1772 from Rio Bengo near Luanda in Ango-

la (8°43’S, 13°24’E), one of the syntypes of P. bocagii

destroyed by fire in the Museu Bocage. Full data for this

taxon have been published in Broadley (2002).

PSAMMOPHIS ORIENTALIS Broadley, 1977

Eastern Stripe-bellied Sand Snake, Psammophis oriental,

Ostliche Sandrennnatter

Psammophis subtaeniatus orientalis Broadley, 1977, Ar-

noldia Rhod. 8, No, 12: 17. Type locality: Morogoro,

Bonn zoological Bulletin 68 (1): 61-91

Tanzania. Holotype: MCZ 146965; Broadley & How-

ell, 1991: 27; Brandstatter, 1995: 194 (part).

Psammophis orientalis Broadley, 2002: 94; Spawls et al.,

2002: 405.

Description. (147 specimens examined) Nostril pierced

between 2 nasals; preocular 1 (very rarely 2), in short

contact with or separated from frontal; postoculars 2:

temporals basically 2+2+3, but with frequent fusions;

supralabials 8 (very rarely 7 or 9), the 4" & 5" (rarely

3 & 4th qth 5 & 6" or 5" & 6th) entering orbit; infral-

abials usually 10 (rarely 9 or 11), the first 4 (very rarely

3 or 5) in contact with anterior sublinguals; dorsal scales

in 17-17-13 rows; ventrals 148-170; cloacal divided:

subcaudals 95-117. Brandstatter (1995, figs 74-75) has

published SEM micrographs of a dorsal scale of NMZB

23336 from Mutare, Zimbabwe.

Dorsum dark brown, top of head uniform; each scale

in vertebral row paler at base, an ill-defined pale dorso-

lateral stripe on scale row 4 and 5; a dark stripe across

rostral, anterior nasal and upper portions of supralabi-

als 1-4; labials white speckled with black; lower half of

outer scale row and ends of ventrals white, separated by

a pair of well defined black ventral lines from a yellow

mid-ventral band.

Size. Largest male (NMZB 11267 — Mafia Island, Tan-

zania) 790 + 395 = 1,185 mm: largest female (USNM

72471 — Dodoma, Tanzania) 730 = 350 = 1,080 mm.

Remarks. This form was originally assigned to P. sub-

taeniatus sudanensis (Loveridge, 1940; Broadley, 1966),

but was later described from Morogoro, Tanzania, where

it is sympatric with P. sudanensis.

Habitat. Dry savannas on the east coast from Kenya

south to about Latitude 23°S in Mozambique, sometimes

sympatric with P. subtaeniatus in southeastern Zimba-

bwe.

Distribution. East Africa from coastal Kenya, south

through Tanzania, Malawi, eastern Zimbabwe and Mo-

zambique to the Bazaruto archipelago and adjacent main-

land.

PSAMMOPHIS SUDANENSIS Werner, 1919

Northern Stripe-bellied Sand Snake, Psammophis sou-

danien, Sudanesische Sandrennnatter

Psammophis subtaeniatus (not Peters) Boulenger, 1896:

161 (part); Tornier, 1896: 82 (part, Arusha); Corkill,

1935: 22: Loveridge, 1936a: 38, 193; Uthmoller, 1937:

119; Pitman 1938: 155, Pl. K, fig. 2; Bohme, 1975: 39

(Makolo); Hedges 1983: 30, fig. 39; Chippaux, 1999:

166; 2006: 179.

Psammophis sibilans (not Linnaeus) Hedges 1983: 30,

fig. 29.

©ZFMK

Psammophis sibilans group 71

Psammophis subtaeniatus var. sudanensis Werner, 1919:

504. Type locality: Kadugli, Sudan. Lectotype NMW

19086.

Psammophis sibilans sibilans (not Linnaeus) Bogert,

1940: 79 (part); 1942: 3 (Voi); Villiers 1951: 827 (part),

Fig. 3; Broadley & Howell, 1991: 28.

Psammophis subtaeniatus sudanensis Loveridge, 1940:

50 (part); 1956: 49 (part); 1957: 280 (part); Mertens,

1955: 59; Broadley, 1966: 5 (part); Spawls, 1978: 8

(part).

Psammophis cf. rukwae (not Broadley) Bohme, 1978:

A402, fig. 17 (left); Joger, 1982: 332, fig. 8.

Psammophis leucogaster Spawls, 1983: 11. Type locali-

ty: Wa, Ghana. Holotype BMNH 1980.261.

Psammophis rukwae (not Broadley) Bohme, 1986: 172

(part); Bohme & Schneider, 1987: 259.

Psammophis subtaeniatus subsp. Bohme, 1987: 85 (Dar-

fur).

Psammophis_ subtaeniatus orientalis (not Broadley)

Brandstatter, 1995: 194 (part).

Psammophis sudanensis Hughes 1999: 67; Spawls, et

al., 2002: 407; Trape & Mané, 2002 : 149, 2015 : 45;

Trape, 2005: 142; Villiers & Condamin, 2005: 144;

Trape & Baldé, 2014: 323.

Psammophis sudanensis leucogaster Trape & Mané,

2006: 156.

Description. (114 specimens examined) Nostril pierced

between 2 nasals; preocular 1, in short contact with or

separated from frontal; postoculars 2 (very rarely 1 or 3);

temporals basically 2+2+3, but with frequent fusions; su-

pralabials 8 (very rarely 7 or 9), the 4" & 5" (rarely 3% &

Am or 4%, 5" & 6") entering orbit; infralabials usually 10

(rarely 9 or 11), the first 4 (very rarely 3 or 5) in contact

with anterior sublinguals; dorsal scales in 17-17-13 rows;

ventrals 150—180; cloacal divided (entire in type of /eu-

cogaster); subcaudals 93-122. Dorsum dark brown, top

of head with a black-bordered pale median stripe extend-

ing far back on the frontal before forking (Fig. 18), trans-

verse pale markings on back of head; labials immaculate

white or speckled with black; vertebral stripe ill-defined

in the east, strongly marked in the west, broadening on

the nape; pale dorsolateral stripes on scale rows 4 and 5;

lower half of outer scale row and ends of ventrals whit-

ish, often separated by a pair of well defined black ven-

tral lines (occasionally ill-defined or absent in West and

Central Africa) from a yellow mid-ventral band.

Size. Largest male (MCZ 53449 — Torit, South Sudan)

820 + 390 = 1210 mm; largest female (FMNH 58389 —

Torit, South Sudan) 920 + 405 = 1325 mm.

Remarks. The type of P. /eucogaster from Ghana ap-

pears to be a highly aberrant specimen of P. sudanensis.

Populations from Chad are probably similar genetically

to those in Kordofan, the type locality, which is close

geographically and ecologically. The sequences of P. su-

danensis from Tanzania and Kenya of Kelly et al. (2008)

Bonn zoological Bulletin 68 (1): 61-91

belong to a distinct clade, suggesting that they may be-

long to a cryptic species. However, the pattern of a Ken-

yan specimen illustrated by Spawls et a/. (2002) is simi-

lar to those of our specimens from West Africa and Chad

(Fig 19). Some rare specimens from Chad are uniformly

beige dorsally (e.g. IRD 2871.N and 2884.N).

Habitat. In eastern Africa, coastal thicket, moist

and dry savanna and high grassland, from sea level to

2,700 m (Spawls et al. 2002). In Chad it was the most

common colubrid snake that JFT collected in almost all

moist and dry savanna areas of the country (17% of 1,010

colubrids collected between 7°N and 14°N). In West Af-

rica, it is a very rare species: only three specimens out

of 9,000 snakes in Senegal, all in the Sahel north of

14°N (Trape & Mané unpublished), one specimen out

of 1,714 in Niger (Trape & Mané 2015), none out of

4,906 in Guinea (Trape & Baldé 2014), and none out of

5,224 in Mali (Trape & Mané 2017). A single specimen

of P. sudanensis was present in Roman’s collection of

5,000 snakes from Burkina Faso (Trape 2005). Psammo-

phis sudanensis reports from Sangaredi area (Guinea) by

Chirio (2012) and from southern Benin by Ullenbruch et

al. (2010, see Figs 16 & 17 p. 44) are in fact attributable

to specimens belonging to the lineated phase of P. afroc-

cidentalis sp. nov.

Distribution. East Africa from southern Sudan, south

through eastern Uganda and Kenya to northern Tanzania,

west through the Central African Republic, Cameroon,

Nigeria, Niger, Burkina Faso, Ghana, Senegal. Sympatric

with P. orientalis at Morogoro in Tanzania, with P. ruk-

wae in Chad and Cameroon, and with P. afroccidentalis

sp. nov. in West Africa.

PSAMMOPHIS PHILLIPS (Hallowell, 1844)

Phillips’ Whip Snake, Psammophis de Phillips, Phil-

lips-Sandrennnatter

Coluber Phillipsii Hallowell, 1844, Proc. Acad. Nat. Sci.

Phil.: 169. Type locality: Liberia. Lectotype: ANSP

5112, designated by Broadley 1977: 24.

Psammophis Phillipsii Hallowell, 1854: 100 & 1887: 69.

Psammophis irregularis Fischer, 1856: 92. Type locality:

Peki, Ghana; Giinther, 1858: 137. Holotype apparent-

ly lost according to Hughes & Wade 2004. Dumeéril,

1860: 208, Pl. xvui, fig. 9; Jan & Sordelli, 1870: livr.

34, Pl. iv, fig. 1-2; Matschie, 1893: 212.

Psammophis sibilans (not Linnaeus) Werner, 1902: 338

(Togo); Klaptocz, 1913: 286; Aylmer, 1922: 21; Barbo-

ur & Loveridge, 1930a: 773 (Liberia); Monard, 1940:

Lee

Psammophis notosticta (not Peters) Matschie, 1893: 212

(Togo).

Psammophis regularis Sternfeld, 1908a: 412, 428 (Togo);

1909b: 20 (Togo); Chabanaud, 1916: 377; 1917: 12

(Benin).

©ZFMK

Fe. Jean-Frang¢ois Trape et al.

Psammophis_ sibilans phillipsi Loveridge, 1938: 59;

1940: 41 (part); 1946: 246; Leston, 1950: 84; Vil-

liers, 1950: 98; 1954: 1242; Angel et al., 1954: 396;

Condamin, 1958: 255; 1959: 1359; Taylor & Weyer,

1958: 1217; Doucet, 1963: 307; Menzies, 1966: 175;

Roux-Esteve, 1969: 121; Balletto et a/., 1973: 101;

Villiers, 1975: 140.

Psammophis sibilans sibilans (not Linnaeus) Loveridge,

1940: 30 (part); Villiers, 1956: 158; 1966: 1765; Dou-

cet, 1963: 306 (part).

Psammophis sibilans var. phillipsi Cansdale, 1949: 106

(Ghana).

Psammophis phillipsi Leston & Hughes, 1968: 754;

Hughes & Barry, 1969: 1023; Bohme, 1978: 398

(part); Joger, 1981: 331, fig. 16; Hughes, 1983: 346,

353 (part); Roman, 1984: 23; Butler & Reid, 1990: 32

(part); Gruschwitz et al., 1991: 30 (Gambia); Cadle,

1994: 119; Brandstatter, 1995: 75 (part); Bohme, 2000:

71; Ineich, 2003: 619; Luiselli et al., 2004: 415 (part);

Villiers & Condamin, 2005: 144; Trape & Mané, 2006:

150; Chippaux, 2006: 178 (part); Ullenbruch ef al.,

2010: 43; Hughes, 2012: 123; Trape & Baldé, 2014:

316 ; Trape & Mané, 2017: 120.

Psammophis cf. phillipsii Rodel et al., 1995: 7; 1999:

170.

Description. (180 specimens examined) Nostril pierced

between 2 (rarely 3) nasals; preocular 1, usually widely

separated from frontal; postoculars 2; temporals usual-

ly2+2 or 2+3; supralabials 8 (very rarely 7), the 4° & 5"

entering orbit; infralabials usually 10 (rarely 9 or 11), the

first 4 (very rarely 5) in contact with anterior sublinguals;

dorsal scales in 17-17-13 rows; ventrals 161—183; cloacal

usually entire (9% divided); subcaudals 89-115. Brand-

statter (1995: Fig. 56—57) illustrated photomicrographs

of a mid-dorsal scale of SMF 20067 from Ghana.

Dorsum olive brown, uniform in most specimens

(Fig. 20), rarely with black-edged mid-dorsal scales

forming black lines (Fig. 21), or with irregularly scat-

tered black scales on the body anteriorly (Fig. 6). Top of

head usually uniform, but reticulations may be present,

including a double pale line on the frontal (Fig. 6). Each

labial and sublingual is usually adorned with a dark spot.

Venter yellow or white, uniform or with lateral rows of

black spots or short streaks or irregular black speckling.

Size. Largest specimen (MCZ 53726 — Achimota, Gha-

na) 1,280 + 533 = 1,813 mm,

Remarks. Brandstatter (1995) and Hughes (1999) first

restricted the name P. phillipsi to the uniform olive form

with an entire cloacal shield in West Africa, where it oc-

cupies forest clearings and moist savanna. Our molecular

data also support this view for the occasional West Af-

%, :

oo a o y

“

. -

> b

7 *

- ”~

» 4 Agito =

1 ae

Fig. 6. Psammophis phillipsi “irregularis”. Sequenced specimen IRD 44.T. Vicinity of Kpalimé (Togo).

Bonn zoological Bulletin 68 (1): 61-91

©ZFMK

Psammophis sibilans group 73

rican specimens with a divided cloacal shield and black

dorsal blotches (P. irregularis Fisher).

Habitat. Moist savannas and deforested rainforest ar-

eas of West Africa from coastal Gambia to Nigeria.

Distribution. Gambia, Senegal, Guinea Bissau, Guin-

ea, Sierra Leone, Liberia, southern Mali, Ivory Coast,

Ghana, Togo, Benin, Nigeria.

PSAMMOPHIS MOSSAMBICUS (Peters, 1882)

Olive Whip Snake, Psammophis olivatre, Olivenfarbige

Sandrennnatter

Psammophis sibilans (not Linnaeus) Mocquard, 1887:

78 (Brazzaville); Bocage, 1895: 114 (part, var. C);

Tornier, 1896: 82; Boulenger, 1905: 113; 1906: 214

(part, Fernand Vaz); Sternfeld, 1911: 250; Boulenger,

1915a: 213; 1915b: 631; Loveridge, 1916: 85; 1918:

328; Sternfeld, 1917: 478; Schmidt, 1923: 111; Love-

ridge, 1923: 886; Loveridge, 1928: 39; 1933: 255;

Witte, 1933a: 123; 1933b: 93; Corkill, 1935: 20 (part);

Loveridge, 1936a: 38; 1936b: 262; Uthmoller, 1937:

119; Mertens, 1955: 59; Laurent, 1960: 55; Trape &

Roux-Esteéve, 1995: 41.

Psammophis sibilans var. mossambica Peters, 1882, Rei-

se nach Mossambique...3: 122. Type locality: Mozam-

bique Island. Lectotype: ZMB 2468A.

Psammophis sibilans var. tettensis Peters, 1882, Reise

nach Mossambique...3: 122. Type locality: Tete, Mo-

zambique.

Psammophis sibilans var. intermedius Fischer, 1884: 14

(Arusha, Tanzania).

Psammophis irregularis (not Fischer) Sauvage, 1884:

201.

Psammophis sibilans var. occidentalis Werner, 1919:

504. Type locality: Congo. Holotype NMW 19245:2.

Psammophis notostictus (not Peters) Witte, 1933a: 123;

1933b: 93.

Psammophis brevirostris (not Peters) Witte, 1933a: 123;

1933b: 93.

Psammophis_ sibilans phillipsii Loveridge, 1940: 41

(part); Witte 1962: 117 (part); Perret 1961: 136; Bohme

1975: 40; Stucki-Stirn, 1979: 434.

Psammophis subtaeniatus (not Peters) Witte, 1941: 212

(part, Bitshumbi, P.N. Virunga); Joger, 1990: 97, Fig. 6

(Bangui, CAR).

Psammophis sibilans sibilans (not Linnaeus) Bogert,

1940: 79 (part); Loveridge, 1940: 30 (part); 1942a:

110; 1942b: 8; 1956: 48 (part); Witte, 1941: 213; 1955:

220219622 1173197582; Laurent, 1950: 8; 1954-59:

1956: 249, Pl. xxiv, fig. 1; 1964: 113; Monard, 1951:

164; Villiers, 1966: 1765; Vesey-FitzGerald, 1958:

60; Robertson ef al., 1962: 428; Bourgeois, 1964: 81;

Roux-Esteve, 1965: 72; Thys van den Audenaerde,

1965: 381 (Kinshasa); Broadley, 1971: 88 (Zambia);

Bonn zoological Bulletin 68 (1): 61-91

Pitman, 1974: 156; Stucki-Stirn, 1979: 430; Pakenham,

1983: 26; Spawls, 1978: 8; Rasmussen, 1991: 177.

Psammophis subtaeniatus sudanensis (not Werner) Lau-

rent, 1956: 248, PI. xxiv, fig. 2 (part, Bitshumb1); Per-

ret, 1961: 136; Witte, 1962: 117; 1975: 88.

Psammophis_ phillipsi Joger, 1982: 331, 1990: 97;

Hughes, 1983: 346, 353 (part); Butler & Reid, 1990:

32 (part); Broadley, 1991: 530; Broadley & Howell,

1991: 28; Rasmussen, 1991: 177; Brandstatter, 1995:

75 (part), 1996: 55 (part); Trape & Roux-Esteve, 1995:

41; Chippaux, 1999: 164 (part); Luiselli et al/., 2004:

A15 (part); Chirio & Ineich, 2006: 52: Jackson et al.,

2007:77.

Psammophis mossambicus Branch, 1998: 92; Haagner et

al., 2000: 15; Hughes & Wade, 2002: 77; Spawls et

al., 2002: 405; Broadley et al., 2003: 167, Pl. 110-1;

Marais, 2004: 153; Bates et al., 2014: 377.

Psammophis phillipsi occidentalis Hughes & Wade,

2004: 129, Fig. 1.

Psammophis occidentalis Chirio & LeBreton, 2007: 532;

Wallach et al., 2014: 589.

Psammophis sp. Chirio & LeBreton, 2007: 538.

Psammophis cf. phillipsi Pauwels & Vande weghe, 2008:

220:

Description. (431 specimens examined) Nostril pierced

between 2 (rarely 3) nasals; preocular 1, usually wide-

ly separated from frontal; postoculars 2 (rarely 1 or 3);

temporals usually2+2/3 but fusions or partial fusions fre-

quent; supralabials 8 (very rarely 6, 7 or 9), the fouth and

fifth & (rarely third & fourth or fifth and sixth) entering

orbit; infralabials usually 10 (rarely 9 or 11), the first 4

(rarely 5, e.g. sequenced specimen IRD 2226.N) in con-

tact with anterior sublinguals; dorsal scales in 17-17-13

rows; ventrals 154-188; cloacal divided (rarely entire);

subcaudals 84—122.

Dorsum brown or greenish brown often uniform

(Fig. 22), sometimes yellowish posteriorly, sometimes

with scattered black scales (rarely more black scales

than olive ones). Other specimens have black-edged

dorsal scales, a vertebral chain and a yellow or whitish

dorsolateral stripe on scale rows 4 and 5 (Fig. 23), this

pattern almost constant in specimens from coastal areas

of Gabon, Republic of the Congo and Democratic Re-

public of the Congo. Top of head uniform or reticulated,

which fades out in adults. Supralabials uniform or speck-

led with black. Venter yellow or whitish, uniform or with

lateral rows of black spots or short streaks or irregular

black speckling, sometimes delimiting a mid-ventral

band of grey ofuscation. A specimen from coastal Ga-

bon with a contrasted head and body pattern is illustrated

in Pauwels & Vande weghe (2008, Figs 333-334), and a

specimen from Kenya with uniform dorsum is illustrated

in Spawls et al. (2002: 405). Roux-Esteve (1965) pro-

vided a detailed description of the two types of patterns

of the populations of southern Central African Republic.

©ZFMK

74 Jean-Frang¢ois Trape et al.

Fe, eS

Fig. 8. Psammophis mossambicus. Typical specimen from Pointe Noire area (Republic of Congo) with a head reticulated pattern,

a vertebral chain and a pale dorso-lateral stripe (MNHN 1988.2316).

Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK

Psammophis sibilans group 75

De Witte (1966) provided scale counts of specimens of

Garamba National Park in northern Democratic Republic

of the Congo.

Size. Largest specimens for the species, including south

of 12°S: NMK 3233/1 — Kassa B, Sennar, Sudan, 1,320 +

460 = 1,780 mm; IRD 2226.N — Baibokoum, Chad, 1,227

+ 508 = 1,735 mm; IRD 2136.N — Baibokoum, Chad,

1,235 + 515 = 1,750 mm; NMZB 16031 — Ndau School,

Western Province, Zambia, 1,260 + 500 = 1,760 mm.

Remarks. (Broadley, 1977, 1983) first applied the

name P. phillipsi to populations in eastern Africa, but

Brandstatter (1995) and Hughes (1999) restricted the

name to the uniform olive form with an entire cloacal

shield in West Africa, and our molecular data support this

view. Branch (1998) first used the name P. mossambicus

Peters for the southern African populations after Broad-

ley selected a lectotype in Berlin. Hughes & Wade (2004)

used the name P. occidentalis for populations from Cam-

eroon to Uganda with a divided cloacal, but our data

show little molecular divergence between southern A fri-

can populations and those from north of the Congo forest

block, despite a great variety of colour patterns in both

regions. Another available name for this species was

P. irregularis Fischer, 1856, based on a specimen from

Peki in former German Togo with a divided cloacal and

extensive black dorsal patches on the anterior third of

the body, decreasing posteriorly, but our molecular study

show that such specimens from Togo are molecularly

identical to typical P phillipsi from West Africa. Data

for specimens south of 12°S were published by Broadley

(2002). Further molecular studies are needed to investi-

gate if additional species of this complex occur around

the Congo forest block (e.g. sequencing specimens with

a grey mid-ventral band from Central African Republic

and other areas), and to clarify the situation in Nigeria

where both P. phillipsi and P. mossambicus occur, possi-

bly in sympatry.

Habitat. Moist savannas and grasslands, especially ri-

parian habitats, swamps, reed beds and cultivated areas

from sea level to 1,500 metres.

Distribution. Southeastern Nigeria, Cameroon, south-

ern Chad, Central African Republic, Sudan, South Su-

dan, Gabon, Republic of Congo, Democratic Republic

of Congo, Rwanda, Burundi, Uganda, Kenya, Tanzania,

Angola, Zambia, Mozambique, Malawi, northeastern

Namibia, northern Botswana, Zimbabwe and the North-

ern, Mpumalanga and KwaZulu-Natal provinces of

South Africa.

PSAMMOPHTS LEOPARDINUS Bocage, 1887

Leopard Whip Snake, Psammophis Iéopard, Leop-

arden-Sandrennnatter

Bonn zoological Bulletin 68 (1): 61-91

Psammophis sibilans var. leopardinus Bocage, 1887:

206. Type locality: Catumbela, Angola. Lectotype

MBL 1798, destroyed by fire in the Museu Bocage.

Psammophis sibilans var. C (part) & D Bocage, 1895:

117; Ferreira 1905: 116.

Psammophis sibilans leopardinus Broadley, 1977: 18, PI.

ii; 1983: 143

Psammophis brevirostris leopardinus Brandstatter, 1995:

oo:

Psammophis leopardinus Broadley, 2002: 95.

Description. Two specimens examined by DGB from

the Angolan coast north of Latitude 12° S: USNM 20132

from Luanda and TM 45751 from Quicama National

Park. Nostril pierced between 2 or 3 nasals; preocular 1,

widely separated from frontal; postoculars 2; temporals

usually 2 + 3; supralabials 8, 4 & 5" entering orbit; in-

fralabials 10, the first 4 in contact with anterior sublin-

guals; dorsal scales in 17-17-13 rows; ventrals 163-167;

cloacal divided; subcaudals 104—106.

Both specimens have P. /eopardinus head markings,

but the dorsum is uniform except for a yellow dotted ver-

tebral line in USNM 20132 and pale dorsolateral stripes

on scale row 4 in TM 45751.

Ferreira (1905) recorded three specimens from north-

ern Angola (Cazengo; Chingo) and Cabinda, which were

presumably destroyed by fire in the Museu Bocage.

Further data on this taxon were published by Broadley

(2002) and Hughes & Wade (2002).

PSAMMOPHIS ZAMBIENSTS Hughes & Wade, 2002

Zambian Whip Snake, Psammophis zambien, Sambische

Sandrennnatter

Psammophis sibilans (not Linnaeus) Pitman, 1934: 297

(part, “‘Chimikombe’ specimens only).

Dromophis lineatus (not Dumeril & Bibron) Laurent,

1956: 247 (Kundelungu, DRC).

Psammophis ? sibilans Broadley & Pitman, 1960: 445.

Psammophis_ brevirostris leopardinus (not Bocage)

Broadley, 1971: 88; Brandstatter, 1955: 53, Pl. 39 &

1966: 48 (Zambia only); Haagner et al., 2000: 16.

Psammophis zambiensis Hughes & Wade, 2002: 75.

Type locality: “Abercorn”, probably = Mweru-Wanti-

pa, Zambia. Holotype: BM 1959.1.1.81; Broadley er

al., 2003: 170.

Description. (23 specimens examined) Nostril pierced

between 2 nasals; preocular 1, separated from frontal:

postoculars 2; temporals usually 2+2/3; supralabials 8

(rarely 7 or 9), the 4" & 5" (rarely 3% & 4") entering

orbit; infralabials 9 or 10, the first 4 in contact with ante-

rior sublinguals; dorsal scales in 17-17-13 rows; ventrals

147-161; cloacal divided (entire in NMZB 16601); sub-

caudals 72-83. Brandstatter (1995, fig. 39) has published

©ZFMK

76 Jean-Frang¢ois Trape et al.

Fig. 9. Psammophis sibilans. Dorsal view of the head of BM 1897.10.28.603 from Abasstyeh near Cairo, Egypt (A), MNHN

2001.0601 from Ain Ghossair near Ismailia, Egypt (B), and AUZC.R02262 from Qalubiya near Cairo, Egypt (C). Note the black

edged yellow median line starting from the snout which is not forking then bordering the frontal as observed in Psammophis afroc-

cidentalis sp. nov. and P. rukwae.

eS Pg le

-) oe a w

J ad

: .

Fig. 10. Psammophis sibilans. Plain phase. Specimen from Fatyum (Egypt).

Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK

Psammophis sibilans group 77

Fig. 11. Psammophis sibilans. Lineated phase. Specimen from Ain Ghossair near Ismailia, Egypt (MNHN 2001.0601).

a SEM micrograph of a dorsal scale of NMZB 10636

from Ikelenge, Zambia.

Dorsum greenish-brown, top of head with complex

pale markings; labials yellowish speckled with black; a

pale double chain marking covers the dorsal nine scale

rows anteriorly, dorsal scales heavily edged in black

(more extensive in juveniles and subadults), a pale dor-

solateral stripe on scale row 4 and 5 continues caudad;

lower half of outer scale row and ventrals greenish, free

edges of ventral irregularly bordered with black (more

extensive in subadults). Two specimens from Sake-

ji School (Haagner et a/. 2000), and all those from the

Muchinga escarpment and Malawi, lack the distinctive

dorsal and ventral markings, but are still distinguishable

from sympatric / parapatric P- mossambicus by their low

ventral and subcaudal counts.

Size. Largest male (PEM 6237 — Sakeyi School, Zam-

bia) 770 + 275 = 1,045 mm; largest female (PEM 6224 —

Sakeyi School, Zambia) 740 + 180+ mm (tail truncated).

Remarks. This taxon was originally assigned to

P. leopardinus, which it resembles in dorsal colour pat-

tern, but it differs in tts much lower mandibular tooth

counts and also lower ventral and subcaudal counts. In

addition there seems to be no connection across eastern

Angola and the two forms occupy very different habitats.

The sequences of “P. occidentalis” from Zambia and Bu-

rundi in Kelly et al. (2008) and Fig. 1 may correspond to

this species. See Hughes & Wade (2002) for further data.

Bonn zoological Bulletin 68 (1): 61-91

Habitat. Apparently inhabiting swampy areas in moist

miombo woodland in Zambia and Katanga or montane

grassland in Malawi.

Distribution. Northern Zambia and adjacent Katanga

Province of the DRC, extending into montane areas of

northern and central Malawi.

TENTATIVE KEY TO THE SPECIES OF

PSAMMOPHITS NORTH OF LATITUDE 12°S

(excluding the cryptic species only known by their se-

quences)

la. Dorsal scales in 17 or 19 rows at midbody.............. 2

1b. Dorsal scales in less than 17 rows at midbody ...... 14

2a. Supralabials usually 8 (occasionally 9 for P. sibilans),

with fourth and fifth, or four, fifth and sixth entering

the orbit (occasionally fifth and sixth for P. sibilans).

Dorsaliscalesanwyitowsy: 0) eae o)

2b. Supralabials usually 9, with fifth and sixth, or four,

fifth and sixth entering the orbit. Dorsal scales in 17

TOW va CALC ys 1 teeta. ita Aen eae eee sane eeaht 10

3a. Temporals 1+2, rarely two anterior temporals.

Ventrals 138-167, subcaudals 73-107. Dorsum

brown or olive, uniform or with a fine yellow

vertebral line and a yellow dorsolateral stripe. Belly

yellowish, often with short transverse black marks at

(ne Outened Ges: san... a wen Psammophis lineatus

©ZFMK

78 Jean-Frang¢ois Trape et al.

rf a

a ee

J p-g

rae s\

| q

Al.

Rp A

eh re

A P. afroccidentalis sp. nov.

PP. phillipsi

VP. mossambicus

RP. rukwae

S P. sibilans

S P. sudanensis

C] Type locality

Fig. 12. Geographic distribution of the sequenced specimens of

P. sibilans and other species frequently confounded with P. sib-

ilans. P. phillipsi, P. mossambicus, P. rukwae, P. sudanensis,

and P. afroccidentalis sp. nov. One symbol may correspond to

several specimens from neighbouring localities. Location of

type locality is approximate for P. sibilans (“Egypt”), P. phil-

lipsi (“Liberia”) and P. mossambicus (“insel Mossambique’”).

3b. Temporals basically 2+2, fusions and/or divisions

TRC QUCMION Secs hae ia hsemunnd Mera Rane earn 4

4a. Usually the first five infralabials in contact with the

AUG LIOL SU MS WANS sek tnt het ange ee aR OLEATE AS 5

4b. Usually the first four infralabials in contact with the

AMSHIOF SUBLNGUAIS:.. | ovis Hy rccetonndbdig Us yeh eee rtantern de 6

5a. Subcaudals 71-102, ventrals 160-184. Dorsum

brown, often with a black and white vertebral chain,

the black pigment either covering the edges or the

hindermost part of the scale. A pale dorsolateral

stripe absent or present. Top of head often with a

pale median stripe on the snout which forks when

reaching the frontal and then borders the frontal.

Sahel and Sudan savanna from Cameroon to Ethiopia

and Panzania 12 2) Be ree Psammophis rukwae

5b. Subcaudals 98-119, ventrals 154-178. Dorsum

uniform or strongly stripped with a black and white

vertebral chain, the black pigment covering the

edges of the scale, and a pale dorsolateral stripe. Top

of head often with a pale median stripe on the snout

which is interrupted before the frontal or forks only

after the middle of the frontal. Northeastern Africa

from Egypt and Sudan to Ethiopia............0000...00....

she helen btn Ah aii ahs Dede e hk Psammophis sibilans

Bonn zoological Bulletin 68 (1): 61-91

Fig. 13. Psammophis afroccidentalis sp. nov. General view of

the holotype MNHN 2018.0013 (formerly IRD 7631.S) from

Dakar, Senegal.

5c. Subcaudals 96-120, ventrals 156-185. Dorsum

brown with a black and white vertebral chain, the

black pigment covering the hindermost part of the

scale. A pale dorsolateral stripe absent or present.

Top of head often with a pale median stripe on the

snout which forks when reaching the frontal and

then borders the frontal. Sahel, Sudan and Guinean

Savalitias.OL West -AlmiCde(.....00 4 wil. voltae tents

6a. Cloaqual scale usually entire. Dorsum and top of

head usually uniform. If present, reticulations on the

top of the head may form a complex network, but

never with a pale median stripe on the snout which

forks and then borders the frontal. Moist savannas of

VCS EAM 1G 2 iets: st eee 2 28t ee osarat Psammophis phillipsi

GbaGloaqualscale Givi” Se stcen snk -pscct iy pan! dose le 7

7a. Ventrum yellowich usually with a pair of well-defined

|) TG) eo) Ee TetshPeen epee ie ot bestvolies Gel Pt Saale F, el aoe Oa 8

7b. Ventrum uniform or with ill-defined black lines or

CASHES: . 2 rerres| S ARs, ed teeta excl Aes trates bce retae 9

8a. Top of head with a yellow median stripe on the snout

and the frontal. A yellow vertebral line bordered by

two pairs of brown and one pair of yellow dorsolateral

stripes. Ventrals 148-180, subcaudals 90-129. Dry

savannas of West, Central and East Affrica................

Fee See NS Pe Ld Psammophis sudanensis

8b. No median stripe on the top of the head. Dorsum

brown uniform. Ventrals 148-170, subcaudals 95—

Li? Goastal areas Or, Rast AMiCar 5.2. cect eens

©ZFMK

Psammophis sibilans group 79

Fig. 14. Psammophis afroccidentalis sp. nov. Ventral view of the holotype MNHN 2018.0013 from Dakar, Senegal.

Fig. 15. Psammophis afroccidentalis sp. nov. Lateral (A), dor-

sal (B) and ventral (C) view of the head of the holotype MNHN

2018.0013 from Dakar, Senegal.

Bonn zoological Bulletin 68 (1): 61-91

9b.

Oe.

9a. Subcaudals 84-122, ventrals 154-188. Dorsum olive

to yellow-brown, uniform or with black-edged scales

forming narrow black longitudinal lines, or with

scattered black scales (rarely largely black), or witha

black and white vertebral line and a pale dorsolateral

stripe. Top of head uniform or with complex pale

markings. Ventrum yellow or whitish, uniform or

with rows of black lateral spots or irregular black

spekling, some specimens with a mid-ventral band

of grey obfuscation. Moist savannas and forest

clearings from southeastern Nigeria to eastern and

southern Africa............... Psammophis mossambicus

Subcaudals 75-90, ventrals 148-165. Dorsum

greenish-brown with scales often heavily edged in

black and the nine median rows with black and white

markings. Top of head reticulated. Free edges of

ventrals irregularly edged in black. Zambia, Malawi

and southern Democratic Republic of Congo...........

Psammophis zambiensis

Subcaudals 79-106, ventrals 151-167. Colour

pattern variable, a pale dorsal chain pattern usually

changes posteriorly to paired dorsolateral stripes.

Pale transverse and reticulated markings often

present on back of head. Chin and throat speckled

and sometimes bands of grey flecking on ventrum.

Angola and northern Namibia..........00....0ccccee

DBA snes pie (rms enn des: Psammophis leopardinus

©ZFMK

80 Jean-Frang¢ois Trape et al.

Fig. 16. Psammophis afroccidentalis sp. nov. General view of a specimen with a typical dorsal head pattern, ill-defined vertebral

chain and lacking pale dorsal stripes. Dielmo, Senegal.

10a. Subcaudals more than 140 ....00000... eee 11

10b. Subcaudales less than 135 ......000...ccceceeeeeee 12

Ila. Ventrals 170-198, subcaudals 143-178. Flanks and

belly heavily speckled with black. Semi-desert and

arid savannas from southeastern Egypt to Somalia

and northern Tanzania....... Psammophis punctulatus

11b. Ventrals 186-211, subcaudals 142-172. Flanks

not speckled with black, belly with a large median

grey band. Sahel and sudano-guinean savannas from

Senegal to Chad and Central African Republic.........

Ted ampere ite een re Psammophis elegans

12a. Usually three supralabials entering the orbit.

Ventrals 155-181, subcaudals 106-132. Angola and

southern Affica..........00.... Psammophis subtaeniatus

12b. Usually two supralabials entering the orbit. North

ATH Casands Salen’ Je le. ee dae eo fee on ad, A 13

BOGY Ie Joan el rene eon Cm Psammophis schokari

13b. Ventrals 183-203. Dorsal scales in 17 or 19 rows at

TG" DOG Vesa. ry, cr aaa wee Psammophis aegyptius

Bonn zoological Bulletin 68 (1): 61-91

14a. Dorsal scales in 11 rows at mid-body ...........0...0.0....

eer ae te ee eee rer Psammophis angolensis

14b. Dorsal scales in 13 rows at mid-body......................

seo a cane ie, Re oe Psammophis pulcher

14c. Dorsal scales in 15 rows at mid-body .................. 15

15a. Two upper labials, usually fourth and fifth, entering

orbit. Ventrals 161-191, subcaudals 107-133. Top

of head with transverse black bars. West and Central

PMI Cates Arne a AER ow Psammophis praeornatus

15b. Two upper labials, usually fifth and sixth, entering

orbit. Ventrals 138-156, subcaudals 102-134. Top of

head more or less uniform. East Affica........0....00.

olay fey Ae eh A ar ee os oli Psammophis biseriatus

15c. Three upper labials, usually the fourth, fifth and

sixth, entering orbit. Ventrals 142-169, subcaudals

81—123. Top of head with dark bordered tan blotches

and a light longitudinal stripe along the junctions of

infranasals and prefrontals. East Affica ..........000..00..

feces eae Psammophis tanganicus

©ZFMK

Psammophis sibilans group 81

. ne ay is om

-_ oS

’ . =

Fig. 17. Psammophis afroccidentalis sp. nov. Juvenile specimen with a vertebral chain and pale dorso-lateral stripes. Dakar, Sen-

egal.

Fig. 18. Psammophis sudanensis. Jos (Nigeria). Specimen with a typical head and dorsal pattern.

Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK

Jean-Francois Trape et al.

Fig. 19. Psammophis sudanensis. Bitea (Chad). Specimen with a typical head and dorsal pattern.

Fig. 20. Psammophis phillipsi. Mt Nimba (Guinea).

Bonn zoological Bulletin 68 (1): 61-91

Psammophis sibilans group 83

Fig. 21. Psammophis phillipsi. Sequenced specimen IRD 5002.G. Kindia (Guinea).

Fig. 22. Psammophis mossambicus. Sequenced specimen IRD 2238.N. Baibokoum (Chad).

Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK

84 Jean-Frang¢ois Trape et al.

Fig. 23. Psammophis mossambicus. Sequenced specimen LC.4366. Gamba (Gabon).

Acknowledgments. Part of this work was based on an unpub-

lished 2005 preliminary manuscript by D. G. Broadley, C. Kel-

ly, B. Lanza and J.-F. Trape which included only morphological

data, most of them from the databases of DGB and JFT, and

further data communicated to DGB by B. Hughes and B. Lan-

za. This manuscript has never been published due to numer-

ous remaining issues that were only resolved recently, at least

in part, when molecular data become available for specimens

from Egypt, and central, eastern and western Africa. Christo-

pher Kelly published separately his molecular study of eastern

and southern African specimens (Kelly et a/. 2008). Donald

G. Broadley and B. Lanza unfortunately deceased before the

achievement of this work, and we aknowledge here their enor-

mous contribution both to this study and African herpetology.

We thank L. Chirio for providing samples of P. mossambicus

from Gabon, A.-G. Zassi-Boulou for helping collecting sam-

ples of P. mossambicus in the Republic of Congo, P. Geniez

for useful discussions on the Psammophis species of northern

Africa, and P. Wagner and B. Hughes for helpful remarks on a

preliminary manuscript.

REFERENCES

Anderson J (1898) Zoology of Egypt. 1. Reptilia and Batrachia.

London, Bernard Quaritch

Andersson LG (1937) Reptiles and Batrachians collected in the

Gambia by Gustav Svensson and Birger Rudebeck (Swedish

Expedition 1931). Arkiv for Zoologi, A29, 16: 1-28

Angel F (1933a) Sur quelques reptiles et batraciens du nord

du Soudan frangais. Bulletin du Muséum national d’ Histoire

naturelle, Paris, série 2, 5: 68-69

Angel F (1933b) Les serpents de |l’Afrique Occidentale

Francaise. Paris, Larose

Bonn zoological Bulletin 68 (1): 61-91

Angel F, Guibe J, Lamotte M, Roy R. (1954) La réserve na-

turelle intégrale du Mont Nimba. Serpents. Mémoires de

l'Institut frangais d’ Afrique noire 2: 381-402

Arévalo E, Davis SK, Sites Jr JW (1994) Mitochondrial DNA

sequence divergence and phylogenetic relationships among

eight chromosome races of the Sceloporus grammicus com-

plex (Phrynosomatidae) in Central Mexico. Systematic Biol-

ogy 43: 387-418

Auliya M, Wagner P, BOhme W (2012) The herpetofauna of

the Biyagos Archipelago, Guinea-Bissau (West Africa) and

a first country-wide checklist. Bonn Zoological Bulletin 61:

255-281

Aylmer C (1922) The snakes of Sierra Leone. Sierra Leone

Studies 5: 7-37

Baha El Din SM (2006) A guide to the reptiles and amphibians

of Egypt. American University in Cairo Press, Cairo & New

York

Balletto E, Bardelli G, Spano S (1973) Contributo all’ erpetolo-

gia della Costa d’Avorio. Bolletino dei Musei e degli Istituti

Biologici dell’ Universita di Genova 41: 85-104

Barbour T, Loveridge A (1930a) Reptiles and amphibians from

Liberia. In: Strong, R. Report of the Harvard-African Expe-

dition upon the African Republic of Liberia and the Belgian

Congo. 2: 769-786

Barbour T, Loveridge A (1930b) Reptiles and amphibians from

the central African lake region. In: Strong, R. Report of the

Harvard-African Expedition upon the African Republic of

Liberia and the Belgian Congo. 2: 786-796

Bates MF, Branch WR, Bauer AM, Burger M, Marais J, Alex-

ander GJ, De Villiers MS (eds.) (2014) Atlas and red list of

the reptiles of South Africa, Lesotho and Swaziland. Suricata

1. South African National Biodiversity Institute, Pretoria

©ZFMK

Psammophis sibilans group 85

Bocage JV Barboza du (1887) Mélanges erpétologiques. IV

Reptiles du dernier voyage de M.M. Capello et Ivens a tra-

vers l'Afrique. Jornal de Sciencias, Mathematicas, Physicas

e Naturaes, Lisboa 11(44): 201-208

Bocage JV Barboza du (1895) Herpétologie d’Angola et du

Congo. Imprimerie Nationale, Lisbonne

Boettger O (1881) Aufzahlung der von Frhrn. H. und Frfr. A.

von Maltzan im Winter 1880/81 am Cap Verde in Senegam-

bien gesammelten Kriechthiere. Abhandlungen der Sencken-

bergischen Naturforschenden Gesellschaft 12: 393-418

Bogert CM (1940) Herpetological results of the Vernay Angola

Expedition, with notes on African reptiles in other collec-

tions. I. Snakes, including an arrangement of African Colu-

bridae. Bulletin of the American Museum of natural History

77. 1-107

Bogert CM (1942) Snakes secured by the Snyder East Afri-

can expedition in Kenya Colony and Tanganyika Territory.

American Museum Novitates 1178: 1-5

Bohme W (1975) Zur Herpetofaunistik Kameruns, mit Be-

schreibung eines neuen Scinciden. Bonner Zoologische Bei-

trage 26: 2-48

Bohme W (1978) Zur Herpetofaunistik des Senegal. Bonner

Zoologische Beitrage 29: 360-417

Bohme W (1986) Preliminary note on the taxonomic status of

Psammophis leucogaster Spawls, 1983 (Colubridae: Psam-

mophin1). Litteratura Serpentium 6 (5): 171-180

Bohme W (1987) Zur Kenntnis von Psammophis subtaeniatus

Peters, 1882 an seinem nordostlichen Arealrand (Serpentes:

Colubridae: Psammophini). Salamandra 23: 84-89

Bohme W, Meinig H, Rédel MO (1996) New records of am-

phibians and reptiles from Burkina Faso and Mali. British

Herpological Society Bulletin 56: 7-26

Bohme W (2000) Diversity of a snake community in a Guin-

eran rain forest (Reptilia, Serpentes). Bonner Zoolologische

Monographien 46: 69-78

Bohme W, Schneider B (1987) Zur Herpetofaunistik Kamer-

uns (III) mit Beschreibung einer neuen Cardioglossa (Anura:

Arthroleptidae). Bonner Zoologische Beitrage 38: 241-263

Boulenger GA (1896) Catalogue of the snakes in the British

Museum (Natural History). Volume III. British Museum

(Natural History), London

Boulenger GA (1905) A list of the batrachians and reptiles col-

lected by Dr W.J. Ansorge in Angola, with descriptions of

new species. Annals and Magazine of Natural History (7) 16:

105-115

Boulenger GA (1906) Report on the reptiles collected by the

late L. Fea in West Africa. Annali dell Museo Civico di Storia

Naturale di Genova (Series 3) 2: 196-216

Boulenger GA (1915a) A list of the snakes of the Belgian and

Portuguese Congo, Northern Rhodesia and Angola. Proceed-

ings of the Zoological Society of London 85: 193—223

Boulenger GA (1915b) A list of the snakes of East Africa, north

of the Zambezi and south of the Soudan and Somaliland, and

of Nyasaland. Proceedings of the Zoological Society of Lon-

don 85: 611-640

Bourgeois M (1964) Les reptiles de la Kasapa (Elizabethville).

Publications de |’Université Officielle du Congo a Lubum-

bashi 7: 65-89

Branch WR (1998) Field guide to snakes and other reptiles of

southern Africa. Struik, Cape Town

Brandstatter F (1995) Eine Revision der Gattung Psammophis

mit Berticksichitung der Schwesterngattung innerhalb der

tribus Psammophiinae (Colubridae: Lycodontinae). Teil 1:

Die Gattungen und Arten der Tribus Psammophiinae. Teil

2: Rasterelektronenmikroskopische Untersuchungen zur

Bonn zoological Bulletin 68 (1): 61-91

Schuppenultrastruktur bei den Arten der Tribus Psammophi-

ini mit besonderer Berticksichtigung der Arten der Gattung

Psammophis. Unpub. D.Sc. thesis, Universitat des Saarlan-

des, Saarbrticken

Brandstatter, F. 1996. Die Sandrennattern. Westarp. — Wiss.,

Magdeburg; Spektrum Akad. Verlag, Heidelberg

Broadley DG (1963) Psammophis sibilans (Linnaeus, 1758)—a

taxonomic dustbin. Journal of the Herpetological Association

of Rhodesia 20: 5—7

Broadley DG (1966) A review of the African stripe-bellied

sand-snakes of the genus Psammophis. Armmoldia Rhodhesia

2 (36): 1-9

Broadley DG (1971) The reptiles and amphibians of Zambia.

Puku 6: 1-143

Broadley DG (1977) A review of the genus Psammophis in

southern Africa (Serpentes: Colubridae). Arnoldia Rhodhe-

sia 8 (12): 1-29

Broadley DG (1983) FitzSimons’ snakes of southern Africa.

Revised edition. Delta Books, Johannesburg

Broadley DG (1991) The herpetofauna of northern Mwinilunga

District, northwestern Zambia. Arnoldia Zimbabwe 9 (37):

519-537

Broadley DG (2002) A review of the species of Psammophis

Boie found south of Latitude 12° S (Serpentes: Psammophi-

inae). African Journal of Herpetology 51: 83-119

Broadley DG, Howell KM (1991) A checklist of the reptiles of

Tanzania, with synoptic keys. Syntarsus 1: 1-70

Broadley DG, Pitman CRS (1959) On a collection of snakes

taken in Northern Rhodesia by Monsieur H.J. Bredo. Occa-

sional papers of the National Museums of Southern Rhodesia

24B: 437-451

Broadley DG, Doria CT, Wigge J (2003) Snakes of Zambia.

An atlas and field Guide. Edition Chimaira, Frankfurt a. M.

Butler JA, Reid JC (1990) Records of snakes from Nigeria. Ni-

gerian Field 55: 19-40

Cadle JE (1994) The colubrid radiation in Africa (Serpentes:

Colubridae): phylogenetic relationships and evolutionary

patterns based on immunological data. Zoological Journal of

the Linnean Society 110: 103-140

Campbell BN (1997) Hic sunt seroentes; molecular phyloge-

netics and the Boidae (Serpentes: Booidea). Ph.D. disserta-

tion, Queen’s Univ., Ont., Canada, published privately

Cansdale GS (1949) Further notes on Gold Coast snakes. Nige-

rian Field 14: 106-113

Chabanaud P (1916) Enumeration des ophidiens non encore

étudiés de Il’ Afrique occidentale, appartenant aux collections

du Muséum, avec la description des espeéces et des variétés

nouvelles. Bulletin du Muséum national d’ Histoire naturelle

22: 362-383

Chabanaud P (1918) Etude d’une collection de reptiles de P Af-

rique Occidentale Franc¢aise, récemment donnée au Muséum

(histoire naturelle de Paris par le Dr G. Bouet, avec la de-

scription de deux especes nouvelles. Bulletin du Muséum

national d’ Histoire naturelle 24: 160-166

Chippaux JP (1999, 2006) Les serpents d’ Afrique occidentale

et centrale. IRD éditions, Paris

Chirio L (2009) Inventaire des reptiles de la Réserve de Bio-

sphere Transfrontali¢re du W (Niger/Bénin/Burkina Faso :

Afrique de |’Ouest). Bulletin de la Société Herpétologique

de France 132: 13-41

Chirio L (2012) Inventaire des reptiles de la région de Sangaré-

di (Guinée maritime). Bulletin de la Société Herpétologique

de France 144: 67-100

©ZFMK

86 Jean-Frang¢ois Trape et al.

Chirio L, Ineich I (2006) Biogeography of the reptiles of the

Central African Republic. African Journal of Herpetology

55: 23-59

Chirio L, Lebreton M (2007) Atlas des reptiles du Cameroun.

MNHN & IRD éditions, Paris

Condamin M (1958) La collection des serpents de l’IFAN

(aquisitions 1956). Bulletin de I’Institut Francais d’ Afrique

Noire, Série A 20: 243-262

Condamin M (1959) Serpents récoltés a Sérédou (Guinée) par

R. Pujol. Bulletin de I’Institut Frangais d’Afrique Noire,

Série A 21: 1351-1366

Corkill NL (1935) Notes on Sudan snakes. A guide to the spe-

cies represented in the collection in the Natural History Mu-

seum Khartoum. Sudan Government Museum (Natural His-

tory), Khartoum 3: 1-41

Doucet J (1963) Les serpents de la République de Cote d’Ivo-

ire. Acta Tropica 20: 201-340

Dowling HG (1951) A proposed standard system of counting

ventral scales in snakes. British Journal of Herpetology 1 (5):

97-99

Ferreira J Bethencourt (1905) Reptis e amphibios de Angola da

Regido ao norte do Quanza (Collecg¢aéo Newton — 1903). Jor-

nal de Sciencias, Mathematicas, Physicas e Naturaes, Lisboa

(2) 7: 111-117

Flower SS (1933) Notes on the recent reptiles and amphibians

of Egypt, with a list of the species recorded from that king-

dom. Proceedings of the Zoological Society of London 103:

735-831

Gatesy JL, Amato G, Vrba E, Schaller G, Desall R (1997) A

cladistic analysis of mitochondrial ribomosal DNA from the

Bovidae. Molecular Phylogenetics and Evolution 7: 303-319

Graber M (1966) Note d’herpétologie tchadienne: étude

préliminaire de quelques serpents récoltés dans la région de

Fort Lamy de 1954 4 1965. Revue d’Elevage et de Médecine

Vétérinaire des Pays Tropicaux19: 137-148

Geniez P (2015) Serpents d’Europe, d’Afrique du Nord et du

Moyen-Orient. Paris, Delachaux et Niestlé

Gruschwitz M, Lenz S, B6hme W (1991). Zur Kenntnis der

Herpetofauna von Gambia (Westafrika). Teil 1. Herpetofau-

na 13 (74): 13-34

Haagner GV, Branch WR, Haagner AJF (2000) Notes on a

collection of reptiles from Zambia and adjacent areas of the

Democratic Republic of the Congo. Annals of Eastern Cape

Museums 1: 1—25

Hedges NG (1983) Reptiles and amphibians of East Africa.

Kenya Literature Bureau, Nairobi

Hellmich W (1957) Die Reptilienausbeute der Hamburgischen

Angola-Expedition. Mitteilungen aus dem Hamburgisches

Zoologisches Museum und Institut 55: 39-80

Hughes B (1983) African snake faunas. Bonner Zoologische

Beitrage 34: 311-356

Hughes B (1999) Critical review of a revision of Psammophis

(Linnaeus, 1758) (Serpentes: Reptilia), by Frank Brandstat-

ter. African Journal of Herpetology 48: 63-70

Hughes B (2012) Snakes of Bénin, West Africa. Bulletin de la

Société Herpétologique de France 144: 101-159

Hughes B, Barry DH (1969) The snakes of Ghana, a checklist

and key. Bulletin de I’Institut Fondamental d’ Afrique Noire

31: 1004-1041

Hughes B, Wade E (2002) On the African leopard whip snake,

Psammophis leopardinus Bocage, 1887 (Serpentes, Colub-

ridae), with the description of a new species from Zambia.

Bulletin of the Natural History Museum (Zoology Series) 68

(2): 75-81

Bonn zoological Bulletin 68 (1): 61-91

Hughes B, Wade E (2004) Is Psammophis sibilans occidenta-

lis Werner 1919 (Squamata: Serpentes; Colubridae) a junior

synonym of P. phillipsii (Hallowell 1844) ? Herpetozoa 16

(3/4): 127-132

Ineich I (2003) Contribution a la connaissance de la biodiversi-

té des régions afro-montagnardes: les Reptiles du mont Nim-

ba. Mémoires du Muséum national d’ Histoire naturelle 190:

597-637

Irwin DM, Kocher TD, Wilson AC (1991) Evolution of the Cy-

tochrome b Gene of Mammals. Journal of Molecular Evolu-

tion 32: 128-144

Jackson K, Zassi-Boulou A-G, Mavoungou LB, Pangou S

(2007) Amphibians and reptiles of the Lac Télé community

reserve, Likouala Region, Republic of Congo (Brazzaville).

Herpetological Conservation and Biology 2: 75—86

Joger U (1981) Zur Herpetofaunistik Westafrikas. Bonner Zo-

ologische Beitrage 32: 297-340

Joger U (1982) Zur Herpetofaunistik Kameruns (II). Bonner

Zoologische Beitrage 33: 313-342

Joger U (1990) The herpetofauna of the Central African Re-

public, with description of a new species of Rhinotyphlops

(Serpentes: Typhlopidae). In: Peters G. & R. Hutterer (eds.)

Vertebrates in the tropics: pp. 85-102

Kelly CMR, Barker NP, Villet MH, Broadley DG, Branch WR

(2008) The snake family Psammophiidae (Reptilia: Ser-

pentes): Phylogenetics and species delimitation in the Afri-

can sand snakes (Psammophis Boie, 1825) and allied genera.

Molecular Phylogenetics and Evolution 47: 1045-1060

Klaptocz A (1913) Reptilien, Amphibien und Fische aus

Franzésich-Guinea. Zoologische Jahrbticher (Systematik)

34: 279-290

Lanza B (1972) The reptiles of the Awash National Park (Shoa,

Ethiopia). Monitore Zoologico Italiano N.S. Suppl. 4 (7):

159-184

Lanza B (1983) A list of the Somali amphibians and reptiles.

Monitore Zoologico Italiano N.S. Suppl. 18 (8): 193-247

Lanza B (1990) Amphibians and reptiles of the Somali Demo-

cratic Republic: check list and biogeography. Biogeographia

14: 407-465

Largen MJ (1997) An annotated checklist of the amphibians

and reptiles of Eritrea, with keys for their identification.

Tropical Zoology 10: 63-115

Largen MJ, Rasmussen JB (1993) Catalogue of the snakes of

Ethiopia (Reptilia Serpentes), including identification keys.

Tropical Zoology 6: 313-434

Largen MJ, Spawls S (2010) The amphibians and reptiles of

Ethiopia and Eritrea. Chimaira, Frankfurt am Main

Laurent RF (1950). Reptiles et Batraciens de la région de Dun-

do (Angola du Nord-Est). Publicagées Culturais da Compan-

hia de Diamantes de Angola, Dundo 10: 7-17

Laurent RF (1954) Reptiles et Batraciens de la région de Dundo

(Angola) (Deuxieme note). Publicagdées Culturais da Com-

panhia de Diamantes de Angola, Dundo 23: 35-84

Laurent RF (1956) Contribution a |’ Herpetologie de la région

des Grands Lacs de |’Afrique centrale. Annales du Musée

Royal du Congo Belge, Sér. 8vo (Sci. Zool.) 48: 1-390

Laurent RF (1960) Notes complémentaires sur les Chéloniens

et les Ophidiens du Congo oriental. Annales du Musée Royal

du Congo Belge, Sér. 8vo (Sci. Zool.) 84: 1-86

Laurent RF (1964) Reptiles et Amphibiens de Il’Angola

(Troisieme contribution). Publicagées Culturais da Compan-

hia de Diamantes de Angola, Dundo 67: 11-165

Leston D (1950) Identification of snakes of the Gold Coast.

Crown Agents, London

©ZFMK

Psammophis sibilans group 87

Leston D, Hughes B (1968) The snakes of Tafo, a forest Co-

coa-farm locality in Ghana. Bulletin de I’ Institut Fondamen-

tal d’ Afrique Noire 30: 737-770

Loveridge A (1916) Report on the collection of Ophidia in the

Society’s Museum. Journal of the East African and Uganda

natural History Society 5: 76-87

Loveridge A (1918) Notes on snakes in East Africa. Journal

of the East African and Uganda natural History Society 13:

315-338

Loveridge A (1923) Notes on East African snakes, collected

1918-1923. Proceedings of the Zoological Society of Lon-

don 93: 871-897

Loveridge A (1928) Field notes on vertebrates collected by

the Smithsonian-Chrysler East African Expedition of 1926.

Proceedings of the United States National Museum 73 (17):

1-69

Loveridge A (1933) Reports on the scientific results of an expe-

dition to the southwestern highlands of Tanganyika Territory.

VII. Herpetology. Bulletin of the Museum of Comparative

Zoology 74: 197-416

Loveridge A (1936a) African reptiles and amphibians in Field

Museum of Natural History. Zoological Series, Field Muse-

um of Natural History 22: 1-111

Loveridge A (1936b) Scientific results of an expedition to rain

forest regions in eastern Africa. V. Reptiles. Bulletin of the

Museum of Comparative Zoology 79: 209-337

Loveridge A (1938) On a collection of reptiles and amphibians

from Liberia. Proceedings of the New England Zoological

Club 17: 49-74

Loveridge A (1940) Revision of the African snakes of the gen-

era Dromophis and Psammophis. Bulletin of the Museum of

Comparative Zoology 87: 1-69

Loveridge A (1942a) Scientific results of a fourth expedition to

forested areas in east and central Africa. IV. Reptiles. Bul-

letin of the Museum of Comparative Zoology 91: 237-373

Loveridge A (1942b) Comments on the reptiles and amphibians

of Lindi. Tanganyika Notes and Records 14: 1-14

Loveridge A (1953) Zoological results of a fifth expedition to

East Africa. III. Reptiles from Nyasaland and Tete. Bulletin

of the Museum of Comparative Zoology 110: 141-322

Loveridge A (1956) On snakes collected in the Anglo-Egyp-

tian Sudan by J.S. Owen, Esq. Sudan Notes and Records 36:

37-56

Loveridge A (1957) Check List of the reptiles and amphibians

of East Africa (Uganda; Kenya; Tanganyika; Zanzibar). Bul-

letin of the Museum of Comparative Zoology 117: 151-362

Luiselli L, Akani GC, Angelici FM, Eniang EA, Ude L, Poli-

tano E (2004) Local distribution, habitat use, and diet of two

supposed species of the Psammophis phillipsi complex (Ser-

pentes: Colubridae), sympatric in southern Nigeria. Amphib-

ia-Reptilia 25: 415—423

Marais J (2004) A complete guide to the snakes of southern

Africa. Struick Publishers, Cape Town

Marx H (1956) Keys to the lizards and snakes of Egypt. NAM-

RU-3 Research Report NM 005 050.39.45. Cairo

Marx H (1958) Egyptian snakes of the genus Psammophis.

Fieldiana Zoologica 39: 191—200

Matschie P (1893) Die Reptilien und Amphibien des Togoge-

bietes. Mitteilungen von Forschungsreisenden und Gelehrten

aus den Deutschen Schutzgebieten 6: 207—215

Menzies JI (1966) The snakes of Sierra Leone. Copeia 21:

169-179

Mertens R (1955) Amphibien und Reptilien aus Ostafrika.

Jahreshefte des Vereins fiir vaterlandische Naturkunde in

Wirttemberg 110: 47-61

Bonn zoological Bulletin 68 (1): 61-91

Monard A (1940) Résultats de la Mission scientifique du Dr

Monard en Guinée Portugaise 1937-1938. Arquivos do Mu-

seu Bocage 11: 147—180

Monard A (1951) Reptiles et Batraciens. In: Résultats de la

mission zoologique suisse au Cameroun. Mémoires de |’In-

stitut fran¢ais d’Afrique noire, série Sciences naturelles 1:

123-185

Mocquard MF (1887) Sur les ophidiens rapportés du Congo par

la mission de Brazza. Bulletin de la Société Philomathique de

Paris, série 7, 11: 62-92

Pakenham RHW (1983) The reptiles and amphibians of Zanzi-

bar and Pemba Islands (with a note on the freshwater fishes).

Journal of the East African Natural History Society and Na-

tional Museum 177: 1-40

Papenfuss TJ (1969) Preliminary analysis of the reptiles of arid

central West Africa. Wasman Journal of Biology 27: 249-325

Parker HW (1949) The snakes of Somaliland and the Sokotra

Islands. Zoologische Verhandelingen 6: 1-115

Pasteur G, Bons J (1960) Catalogue des reptiles actuels du

Maroc. Révision de formes d’Afrique, d’Europe et d’ Asie.

Travaux de |’ Institut scientifique chérifien, série Zoologie 21:

1-132

Pauwels OSG, Vande Weghe JP (2008) Les reptiles du Gabon.

Smithsonian Institution, Washington

Perret JL (1961) Etudes herpétologiques africaines III. Bul-

letin de la Société neuchateloise de Sciences naturelles 84:

133-138

Perret JL, Mertens R (1957) Révision du matériel her-

pétologique du Cameroun, étudié par A. Monard. Revue su-

isse de Zoologie 64: 73-78

Pitman CRS (1934) A check list of Reptilia and Amphibia oc-

curring and believed to occur in Northern Rhodesia. In: a re-

port on a faunal survey of Northern Rhodesia. Government

Printer, Livingstone, pp 292-312

Pitman CRS (1938, 1974) A guide to the snakes of Uganda.

Wheldon & Wesley, Codicote

Rasmussen JB (1991) Snakes (Reptilia: Serpentes) from the

Kouilou River basin, including a tentative key of the snakes

of the République du Congo. Tauraco Research Report 4:

175-188

Robertson IAD, Chapman BM, Chapman RF (1962) Notes on

some reptiles collected in the Rukwa Valley, S.W. Tangan-

yika. The Annals and Magazine of natural History (13) 5:

421-432

Rodel MO, Grabow K, Bockheler C, Mahsberg D (1995)

Die Schlangen des Comoé-Nationalparks, Elfenbeinktste

(Reptilia: Squamata: Serpentes). Stuttgarter Beitrage zur

Naturkunde Ser A 528: 1-18

Rodel MO, Kouadio K, Mahsberg D (1999) Die Schlangenfau-

na des Comoé-Nationalparks, Elfenbeinkiste: Erganzungen

und Ausblik. Salamandra 35: 165—180

Roman B (1980) Serpents de Haute-Volta. C.N.R.S.T., Ouaga-

dougou

Roman B (1984) Serpents des pays de |’Entente. C.N.R.S.T.,

Ouagadougou

Roussel MR, Villiers A (1965) Serpents du Mayo-Kebbi

(Tchad). Bulletin de l’Institut Fondamental d’ Afrique Noire,

sér. A, 27: 1522-1533

Roux-Esteve R (1965) Les serpents de la région de la

Maboké-Boukoko. Cahiers de la Maboké (Zoologie) 3: 51—

Roux-Esteve R (1969) Les serpents de la région de Lamto

(Céte dIvoire). Annales de |’Université d’Abidjan, série E

2: 81-137

©ZFMK

88 Jean-Frang¢ois Trape et al.

Saleh MA (1997) Amphibians and reptiles of Egypt. Publica-

tion of National Biodiversity Unit, No. 6, Cairo

Sauvage HE (1884) Notice sur une collection de reptiles et de

poisons recueillie a Majumba, Congo. Bulletin de la Société

Zoologique de France 9: 199-204

Schatti B (1986) Herpetologische Ausbeute einer Sammelreise

nach Mali (Amphibia, Reptilia). Revue suisse de Zoologie

93: 765-778

Schmidt KP (1923) Contributions to the herpetology of the

American Museum Congo Expedition, 1909-1915. Part II. —

Snakes. Bulletin of the American Museum of Natural History

49: 1-146

Schleich HH, Kastle W, Kabish K (1996) Amphibians and rep-

tiles of North Africa. Koeltz Publisher, Koenigstein

Spawls S (1978) A checklist of the snakes of Kenya. Journal of

the East African Natural History Society and National Muse-

um 31 (167): 1-18

Spawls S (1983) A new Psammophis from northern Ghana.

British Journal of Herpetology 6: 311-312

Spawls S, Howell K, Drewes R, Ashe J (2002) A field guide to

the reptiles of East Africa. Academic Press, San Diego

Sternfeld R (1907) Die Schlangenfauna von Kamerun. Mittei-

lungen aus dem Zoologischen Museum in Berlin 3: 397-432

Sternfeld R (1908a) Die Schlangenfauna Togos. Mitteilungen

aus dem Zoologischen Museum in Berlin 4: 207—236

Sternfeld R (1908b) Zur Schlangenfauna Ostafrikas. Mitteilun-

gen aus dem Zoologischen Museum in Berlin 4: 237—247

Sternfeld R (1909a) Die Fauna der deutschen Kolonien. He-

rausgegeben mit Untersttitzung des Reichs-Kolonialamtes

vom Zoologischen Museum in Berlin. Reihe I, Kamerun.

Heft.1. Die Schlangen Kameruns. R. Friedlander & Sohn,

Berlin

Sternfeld R (1909b) Die Fauna der deutschen Kolonien. He-

rausgegeben mit Unterstiitzung des Reichs-Koloniatlamtes

vom Zoologischen Museum in Berlin. Reihe II. Togo. Heft 1.

Die Schlangen Togos. R. Friedlander & Sohn, Berlin

Sternfeld R (1910) Die Fauna der deutschen Kolonien. Heraus-

gegeben mit Unterstiitzung des Reichs-Kolonialamtes vom

Zoologischen Museum in Berlin. Reihe II. Deutsch-Os-

tafrika. Heft 2. Die Schlangen Deutsch-Ostafrikas. R.

Friedlander & Sohn, Berlin

Sternfeld R (1911) Zur Reptilienfauna Deutsch-Ostafrikas.

Sitzungsberichte der Gesellschaft Naturforschender Freunde

zu Berlin 4: 245-251

Sternfeld R (1913) Reptilia. In: Wissenschaftliche Ergebnisse

der deutschen Zentral-Afrika-Expedition 1907-1908. Band

IV, Zoologie II. pp. 197-280. Leipzig, Klinkhardt & Bier-

mann

Sternfeld R (1917) Reptilia und Amphibia. In: Hamburgische

wissenschaftliche Siftung. Ergebnisse der zweiten deutschen

Zentral-Afrika-Expedition, 1910-1911. Band I, Zoologie II.

pp. 407-509. Leipzig, Klinkhardt & Biermann

Stucki-Stirn MC (1979) Snake report 721: A comparative study

of the herpetological fauna of the former West Cameroon/

Africa. Herpeto-Verlag, Teuffenthal

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013)

MEGAG6: Molecular Evolutionary Genetics Analysis version

6.0. Molecular Biology and Evolution 30: 2725-2729

Taylor EH, Weyer D (1958) Report on a collection of amphibi-

ans and reptiles from Harbel, Republic of Liberia. University

of Kansas Science Bulletin 38: 1191-1230

Thys Van Den Audenaerde DFE (1965) Les serpents des en-

virons de Léopoldville. Revue de Zoologie et de Botanique

Africaine 72: 366-388

Bonn zoological Bulletin 68 (1): 61-91

Tornier G (1896) Die Kriechthiere Deutsch-Ost-Afrikas. Beit-

rage zur Systematik und Descendenzlehre, 1-164

Trape JF (2005) Note sur quelques serpents méconnus du

Burkina Faso de la collection de Benigno Roman. Bulletin

de la Société Herpétologique de France 116: 39-49

Trape JF, Baldé C (2014) A checklist of the snake fauna of

Guinea, with taxonomic changes in the genera Philotham-

nus and Dipsadoboa (Colubridae) and a comparison with the

snake fauna of some other West African countries. Zootoxa

3900: 301-338

Trape JF, Mané Y (2000). Les serpents des environs de Diel-

mo (Sine-Saloum, Sénégal). Bulletin de la Société Her-

pétologique de France 95: 19-35

Trape JF, Mané Y (2002). Les serpents du Sénégal: liste com-

mentée des espeéces. Bulletin de la Société de Pathologie Ex-

otique 95: 148—150

Trape JF, Mané Y (2004) Les serpents des environs de Banda-

fassi (Sénégal oriental). Bulletin de la Société Herpétologique

de France 109: 5-34

Trape JF, Mané Y (2006) Guide des serpents d’Afrique occi-

dentale. Savane et désert. IRD éditions, Paris

Trape JF, Mané Y (2015) The snakes of Niger. Amphibian and

Reptile Conservation, 9(2) (special section): 39-55 (e110)

Trape JF, Mané Y (2017) The snakes of Mali. Bonn Zoological

Bulletin 66: 107-133

Trape JF, Roux-Estéve R (1995) Les serpents du Congo: liste

commentee et clé de détermination. Journal of African Zool-

ogy 109: 31-50

Uetz P, HoSek J (2018) The Reptile Database (eds.). Online

at: http://www.reptile-database.org, last accessed on Octo-

ber10th 2018

Ullenbruch K, Grell O, Bohme W (2010) Reptiles from south-

ern Bénin, West Africa, with the description of a new Hemi-

dactylus (Gekkonidae), and a country-wide checklist. Bonn

Zoological Bulletin 57: 31-54

Uthmoller W (1937) Beitrag zur Kenntnis der Schlangenfauna

des Kilimandscharo (Tanganyika-Territory, ehemaliges Du-

utsch-Ostafrica). Temminckia 2: 97-134

Vesey-Fitzgerald LDEF (1958) The snakes of Northern Rhode-

sia and the Tanganyika borderlands. Proceedings and Trans-

actions of the Rhodesia scientific Association 46: 17—102

Vesey-Fitzgerald LDEF (1975) A guide to the snakes of the

Tanzania and Kenya borderlands Journal of the East African

Natural History Society and National Museum 149: 1—26

Vidal N, Branch WR, Pauwels OSG, Hedges SB, Broadley DG,

Wink M, Cruaud C, Joger U, Nagy ZT (2008) Dissecting the

major African snake radiation: a molecular phylogeny of the

Lamprophiidae Fitzinger (Serpentes, Caenophidia). Zootaxa

1945: 51-66

Villiers A (1950) La collection de serpents de ?I.F.A.N. Institut

Frangais d’ Afrique Noire, Catalogues VI, Dakar

Villiers A (1951) La collection de serpents de ’ IFAN (acquisi-

tions 1950). Bulletin de I’Institut Frangais d’Afrique Noire

13: 813-836

Villiers A (1952) La collection de serpents de IFAN (acquisi-

tions 1951). Bulletin de I’Institut Frangais d’Afrique Noire

14: 881-898

Villiers A (1953) La collection de serpents de IFAN (acquisi-

tions 1952). Bulletin de I’Institut Francais d’Afrique Noire

15: 1103-1127

Villiers A (1954) La collection de serpents de IFAN (acquisi-

tions 1953). Bulletin de I’Institut Frangais d’Afrique Noire

16 (sér. A): 1234-1247

©ZFMK

Psammophis sibilans group 89

Villiers A (1956a) La collection de serpents de PIFAN (acqui-

sitions 1954-1955). Bulletin de |’Institut Fran¢ais d’ Afrique

Noire 18 (sér. A): 877-883

Villiers A (1956b) Le Parc National du Niokolo-Koba. Vol. 1.

Reptiles. Mémoires de |’Institut Frangais d’ Afrique Noire

48: 143-162

Villiers A (1963) Serpents africains des collections de Muséum

de Paris. Bulletin de I’Institut Frangais d’ Afrique Noire 25

(sér. A): 1367-1373

Villiers A (1965) Serpents récoltés au Mali et en Haute-Volta

par le Dr. Lamontellerie. Bulletin de I’ Institut Francais d’ Af-

rique Noire 27 (sér. A): 1192-1195

Villiers A (1966) Contribution a la faune du Congo (Brazza-

ville). Mission A. Villiers et A. Descarpentries. XLII. Rep-

tiles Ophidiens. Bulletin de I’ Institut Fondamental d’ Afrique

Noire 28 sér. A): 1720-1760

Villiers, A (1975) Les serpents de l’ ouest Africain. Inititiation et

Etudes A fricaines II (3éme édit.), Dakar

Villiers A, Condamin M (2005) Les serpents de |’Ouest Afric-

ain. IFAN, Inititiation et Etudes Africaines II (4 éme édit.),

Dakar

Wallach V, Williams KL, Boundy J (2014) Snakes of the world:

a catalogue of living and extinct species. CRC Press, Boca

Raton, London, New York

Werner F (1902) Uber Westafrikanische Reptilien. Verhandlun-

gen der Zoologisch-Botanischen Gesellschaft in Wien 52:

332-348

Werner F (1915) Reptilia und Amphibia. In W. Michaelsen,

Beitrage zur Kenntnis der Land- und Sisswasserfauna

Deutsch-Stidwestafrikas. 3: 323-376

APPENDIX I

Werner F. (1919) Wissenschaftliche Ergebnisse der mit Unter-

stiitzung der Kaiserlichen Akademie der Wissenschaften in

Wien aus der Erbschaft treitl von F. Werner unternommenen.

Zoologischen Expedition nach dem Anglo-Aegyptischen Su-

dan (Kordofan) 1914. IV. Bearbeitung der Fische, Amphibien

und Reptilien. Denkschriften der Kaiserlichen Akademie der

Wissenschaften in Wien, Mathematische-Naturwissenschaft-

liche Klasse 96: 437-509

Witte GF de (1933a) Batraciens et Reptiles recueillis par M.L.

Burgeon au Ruwenzori, ua Kivu et au Tangnyka. Revue de

Zoologie et de Botanique Africaine 24: 111-123

Witte GF de (1933b) Reptiles récoltés au Congo Belge par le Dr

H. Schouteden et par M. G.-F. de Witte. Annales du Musée

du Congo Belge (Zoologie) 3: 53—100

Witte GF de (1941) Batraciens et reptiles. Exploration du Parc

national Albert. Mission G.-F. de Witte (1933-1935) 33:

1-261

Witte GF de (1953) Reptiles. Exploration du Parc national de

l’Upemba. Mission G.-F. de Witte 6: 1-322

Witte GF de (1955) La population de reptiles de la région de

Mutsora (Kivu Nord). Académie royale des Sciences colo-

niales (N.S.) 1: 203-225

Witte GF de (1962) Genera des serpents du Congo et du Ru-

anda-Urundi. Annales du Musée royal de I’ Afrique Centrale

(Sci. Zool.) 104: 1-203

Witte GF de (1966) Reptiles. Exploration du Parc national de la

Garamba. Mission H. de Saeger 48: 1-108

Witte GF de (1975) Serpents: Boidae, Colubridae, Elapidae

et Viperidae. Exploration du Parc national des Virunga 24:

62-121

Table 1. Localities and GenBank numbers of sequenced specimens.

Species & collection N° | Country & locality Cyt B 16S

P. rukwae Chad O7°44°N / MH997939 | MK032650 | MK005696

IRD 2121.N Baibokoum 1S5°41’E

P. rukwae Chad O7°44°N / MH997941 | MK032652 | MK005698

IRD 2150.N Baibokoum 1S5°41’E

P. rukwae Chad O7°44°N / MH997931 | MK032646 | MK005692

IRD 2020.N Baibokoum 15°41’E

P. rukwae Chad 12°07’N / MH997936 | MK032643 | MK005689

IRD 1888.N Mahargal Balen P/4) 0)

P. rukwae Chad 10°41°N / MH997937 | MK032644

IRD 1949.N Bon Amdaoud 19°28’E

P. rukwae Ethiopia 10°36’N / MH997968 | MK032678 | MK005726

MBUR 08343 near Kutaworke 34°24’ E

P. rukwae Chad 12°04N / MH997929 MK005690

IRD 2001.N N’Djaména | he yat OF oa

P. rukwae Chad 12°04N / MH997930 | MK032645 | MK005691

IRD 2002.N N’Djaména 15°07°E

P. rukwae Chad 10°33°N / MH997951 | MK032658 | MK005706

IRD 2759.N Kiékeé 19°48°E

P. afroccidentalis sp. nov. | Benin 07°13’N / MH997972 | MK032682

ZFMK 77019 Za-Kpota O2S1 20

P. afroccidentalis sp. nov. | Benin 07°20’N / MH997971 | MK032681

ZFMK 77012 Dyidja 01°56’E

Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK

90 Jean-Frang¢ois Trape et al.

Species & collection N° | Country & locality Cyt B | ND4 | 168 |

P. afroccidentalis sp. nov. | Benin O7°11VN/ MH997973 | MK032683

ZFMK 77036 Bohicon 02°04’E

P. afroccidentalis sp. nov. | Niger 14°02’N / MK032663

IRD 370.N Toundi Farkia O1°32°E

P. afroccidentalis sp. nov. | Burkina Faso 1 1°32°Ni7 MH997961 | MK032677 | MK005718

IRD TR.4173 Pa 03°18’W

P. afroccidentalis sp. nov. | Senegal 13°12’N/ MH997960 MK005717

IRD TR.4167 Dar Salam 13°06’W

P. afroccidentalis sp. nov. | Ivory Coast 09°31°N / MK032660

IRD 328.CI Niagnon 06°26’ W

P. afroccidentalis sp.nov | Mali 11°09°N / MK032642

IRD 115.M Doussoudiana 07°48’ W

P. afroccidentalis sp. nov. | Guinea 10°16’N / MH997962 | MK032671 | MK005719

IRD TR.4177 near Tiva 14°11 W

P. afroccidentalis sp. nov. | Guinea 11°10°N/ MH997954 | MK032665 | MKO005711

IRD 5001.G near Sangaredi 13°50’W

P. afroccidentalis sp. nov. | Mauritania 17°517N/ MH997965 | MK032674 | MK005721

IRD TR.4501 near Matmata 12°09" W

P. afroccidentalis sp. nov. | Chad 14°08’N / MK005683 MK005708

IRD 2808.N Mao 15°18°E

P. sibilans Egypt 25°01’N / MH997935 | MK032641

BEV T4799 near Edfu 32° 5808,

P. sibilans Egypt 29°25’ N# MH997928 | MK032639 | MK005687

AUZC R.143972 Faiyum 30°S4V’E

P. sibilans Egypt 29°25’N / MH997934 | MK032640 | MKO005688

AUZC R.143973 Faiyum 30°S4V’E

P. sibilans Ethiopia 10°35’N / MH997970 | MK032680 | MK005727

MBUR 08588 near Kutaworke 34°21VE

P. sudanensis Chad O7°44’N / MH997948 MK005703

IRD 2280.N Baibokoum 15°41VE

P. sudanensis Chad 07°44’N / MH997949_ | MK032657 | MK005704

IRD 2283.N Baibokoum 15°41VE

P. sudanensis Chad O7°44’N / MH997946 | MK032655

IRD 2231.N Baibokoum 15°41’E

P. sudanensis Chad O7°44’N / MH997950 MK005705

IRD 2289.N Baibokoum 15°41’E

Psammophis sp. Ethiopia 10°40°N / MH997969 | MK032679

MBUR 08346 NE of Kutaworke 34°2S°E

P. phillipsi Guinea 10°03’N / MH997955 | MK032666 | MK005712

IRD 5002.G Kindia 12°51°W

P. phillipsi Guinea 10°03’N / MH997956 | MK032667

IRD 5003.G Kindia 12°51°W

P. phillipsi Guinea O9°14"N / MH997957 | MK032668 | MK005713

IRD 5004.G Kissidougou 10°03’ W

P. phillipsi Guinea 09° 14"N / MH997958 | MK032669 | MKO005714

IRD 5005.G Kissidougou 10°03’ W

P. phillipsi Guinea 07°43°N / MK005681 MK005715

IRD TR.4609 Ziéla 08°21°>W

Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK

Species & collection N°

Psammophis sibilans group

Country & locality Cyt B

ND4 16S

P. phillipsi Guinea O8°O1’N / MK005682 MK005716

IRD TR.4610 Paia 09°02’ W

P. phillipsi Togo 08°05S’N / MK005680 | MK032661 | MK005709

IRD 358.T Dyjiguengué 00°38’°E

P. phillipsi Togo 08°05S’N / MH997952 | MK032662 | MKO005710

IRD 367.T Dyjiguengué 00°38’°E

P. phillipsi Togo O7°19°N / MK005686

IRD 10.T Sodo 00°48°E

P. phillipsi Togo 06°54’N / MH997953 | MK032664

IRD 44.T Kpalimé 00°37°E

P. mossambicus Chad 07°44’N / MH997940 | MK032651 | MK005697

IRD 2136.N Baibokoum 15°41’E

P. mossambicus Chad 07°44’N / MH997942 MK005699

IRD 2186.N Baibokoum 15°41’E

P. mossambicus Chad 07°44’N / MH997945 | MK032654 | MKO005701

IRD 2226.N Baibokoum 15°41’E

P. mossambicus Chad 07°44’N / MH997932 | MK032647 | MK005693

IRD 2053.N Baibokoum 15°41’E

P. mossambicus Chad 07°44’N / MK032648 | MK032648 | MK005694

IRD 2066.N Baibokoum 15°41’E

P. mossambicus Chad 07°44’N / MH997944 | MK032653 | MKO005700

IRD 2224.N Baibokoum SAK

P. mossambicus Chad 07°44’N / MH997947 | MK032656 | MK005702

IRD 2238.N Baibokoum £54 he

P. mossambicus Cameroon 05°43’N / MH997967 | MK032676 | MK005723

IRD TR.4579 Foumban 10°5S’E

P. mossambicus Zambia I29D SF MH997976 | MK032686

ZFMK 88703 Luambe Nat. Park 32 aS E

P. mossambicus Zambia Leta sy MH997974 | MK0326684

ZFMK 88502 Ikelenge Nchila 24°16°E

P. mossambicus Zambia 1114S MH997975 | MK032685

ZFMK 88503 Ikelenge Nchila 24°16°E

P. mossambicus Gabon 02°43’S / MH997963 | MK032672 | MK005720

IRD TR.4366.LC Gamba 10°01’E

P. mossambicus Gabon 02°43’S / MH997964 | MK032673

IRD TR.4367.LC Gamba 10°01’E

P. mossambicus Republic of Congo | 04°32’S / MK005684 MK005725

MBUR 08242 Hinda 12°04"E

P. mossambicus Republic of Congo | 04°29’S / MK005684 MK005724

MBUR 03143 Lake Fony 11°46°E

P. lineatus Chad 07°44’N / MH997938 | MK032649 | MK005695

IRD 2120.N Baibokoum 15°41°E

P. elegans Mauritania 16°33’N / MH997966 | MK032675 | MK005722

IRD TR.4504 35 km E Rosso 15°317W

P. elegans Ivory Coast 07°00’N / MH997943 MK005728

IRD 222.CI Drekro 05°177W

P. elegans univittatus Chad 10°41°N / MK005679 | MK032659 | MKO005707

IRD 2761.N Bon Amdaoud 19°28°E

P. praeornatus Senegal 13°04’N / MH997959 | MK032670

IRD 9193.8 Fafakourou 14°33’W

Bonn zoological Bulletin 68 (1): 61-91 ©ZFMK

BHL

Blank Page Digitally Inserted

Bonn zoological Bulletin 68 (1): 93-96

2019 - Landgref Filho P. et al.

https://do1.org/10.20363/BZB-2019.68.1.093

ISSN 2190-7307

http://www.zoologicalbulletin.de

Scientific note

urn:|sid:zoobank.org: pub: CBA 156F4-E9AA-401C-B036-77C362CE1 E89

Diet composition of Ameerega picta (Tschudi, 1838) from

the Serra da Bodoquena region in central Brazil, with a summary of dietary

studies on species of the genus Ameerega (Anura: Dendrobatidae)

Paulo Landgref Filho’, Fabricio H. Oda", Fabio T. Mise’,

Domingos de J. Rodrigues‘ & Masao Uetanabaro*

' Universidade Federal de Mato Grosso do Sul, Campus Aquidauana, 79200-000, Aquidauana, Mato Grosso do Sul, Brazil

? Departamento de Quimica Biologica, Programa de Pés-graduagdo em Bioprospec¢do Molecular, Universidade Regional do

Cariri, 63105-00, Crato, Ceard, Brazil

3Departamento de Biologia, Universidade Estadual do Centro-Oeste, 85040-080, Guarapuava, Parana, Brazil

*Instituto de Ciéncias Naturais, Humanas e Sociais, Universidade Federal de Mato Grosso — Campus Universitario de Sinop,

78557-267, Sinop, Mato Grosso, Brazil

*Instituto Nacional de Ciéncia e Tecnologia de Estudos Integrados da Biodiversidade Amazénica — Niucleo Regional de Sinop,

Sinop, Mato Grosso, Brazil

>Rua Clovis n. 24, 79022-071, Campo Grande, Mato Grosso do Sul, Brazil

* Corresponding author: Email: fabricio_oda@hotmail.com

'urn:Isid:zoobank.org:author:5821C96D-4D9E-4E1 D-BE9B-C231B77D1AF3

2urn:Isid:zoobank.org:author:3497 12B5-E1B2-4059-A826-58F081DD3A4D

3urn:Isid:zoobank.org:author:E996A F2A-6CB7-4B73-8DEF-AB7CS5EEE1 AAO

4urn:Isid:zoobank.org:author: ACFBA432-3220-49 10-A FF5-8FF85053A872

Surn:Isid:zoobank.org:author:626F6A E3-7D90-4500-BFDC-4E6F4E01B378

Abstract. We provide data on the diet composition of Ameerega picta from the region of Serra da Bodoquena in the state

of Mato Grosso do Sul, central Brazil. We also provide a summary of dietary studies on species of the genus Ameerega.

Key words. Cerrado, dendrobatid frog, feeding habits, trophic ecology.

The Neotropical genus Ameerega Bauer, 1986 (Anu-

ra: Dendrobatidae), currently includes 31 species of

frogs distributed in Bolivia, Brazil, Colombia, Ecuador,

French Guiana, Guyana, Peru, Surinam, and Venezue-

la (Frost 2019). The spot-legged poison frog Ameerega

picta (Tschudi, 1838) is a small (SVL in males: 24 mm;

females: 26 mm), terrestrial, diurnal frog distributed in

Bolivia (Departamentos Santa Cruz, Cochabamba, Beni,

and La Paz), Brazil (states of Mato Grosso and Mato

Grosso do Sul), Peru (Departamentos Ucayali and Madre

de Dios), Colombia (Departamentos de Amazonas, Meta,

and Putumayo), and Venezuela (state of Bolivar) at al-

titudes of 200 to 2500 m asl (Duellman 2005; Acosta

Galvis 2017; Frost 2019). Ameerega picta is character-

ized as myrmecophagous (Mebs et al. 2010), but studies

on diet composition in different populations are scarce.

Toft (1980) investigated the diet of A. picta (as Dendro-

bates pictus) and 12 syntopic species in Amazonian Peru.

Ramon et al. (2010) determined the diet composition of

A. picta in an area of the Cerrado (Brazilian savanna) in

the municipality of Nova Xavantina in Mato Grosso state

Received: 12.12.2018

Accepted: 03.06.2019

in central Brazil. Considering the previous information

on the diet composition of A. picta throughout its geo-

graphic distribution, new studies could contribute to the

understanding of its trophic ecology. Here, we provide

data on the diet composition of A. picta from the region

of Serra da Bodoquena in the state of Mato Grosso do

Sul, central Brazil. We also provide a summary of dietary

studies on species of the genus Ameerega.

This study was conducted on the Rancho Branco

farm (20°41’S, 56°47’W) located in the municipality of

Bodoquena, state of Mato Grosso do Sul, central Brazil

(Fig. 1). We conducted six field trips (each lasting four

days) between May and October 2001. Specimens of

A. picta were sampled during the day on the leaf litter

near the margins of the Salobrinha stream using visual

and auditory search methods (Scott & Woodward 1994),

We determined the sex of the specimens collected and

measured snout-vent length (SVL) to the nearest 0.01 mm

using calipers. The specimens collected were euthanized

with 5% lidocaine, fixed in 10% formalin and preserved

in 70% ethanol. Voucher specimens were deposited at

Corresponding editor: W. Bohme

Published: 13.06.2019

94 Paulo Landgref Filho et al.

18°S

21°S

@ Rancho Branco farm

L_] Bodoquena municipality

— Rivers

Ecoregions

MS Pantanal

MS Cerrado

fH Atlantic Forest

Paraguay

Fig. 1. Map of the study site in the region of Serra da Bodoquena, municipality of Bodoquena, state of Mato Grosso do Sul, central

Brazil. Brazilian state abbreviations: GO, Goias; MG, Minas Gerais; MS, Mato Grosso do Sul; MT, Mato Grosso; PR, Parana; SP,

Sao Paulo.

Fig. 2. Specimen of Ameerega picta from region of Serra da

Bodoquena, municipality of Bodoquena, state of Mato Grosso

do Sul, central Brazil.

the zoological collection of the Universidade Federal de

Mato Grosso do Sul (ZUFMS — AMP, Brazil).

In the laboratory, a longitudinal incision was made in

each individual to remove the stomach and determine

Bonn zoological Bulletin 68 (1): 93-96

Table 1. Relative number (N%) of prey categories consumed

by Ameerega picta (N = 50) in the region of Serra da Bodoque-

na in the municipality of Bodoquena, state of Mato Grosso do

Sul, central Brazil (percentages shown in parentheses).

Prey categories N(%)

Insecta

Formicidae A0 (22.6)

Coleoptera (both larvae and adults) 39:(22:0)

Diptera 29 (16.4)

Homoptera 17 (9.6)

Arachnida

Araneae 22 (12.4)

Arthropod remains 30 (16.9)

Total 177 (100)

the contents under a stereomicroscope. Food items were

identified to the lowest taxonomic category possible. We

used the Student’s f-test (t) to determine differences in

numeric percentage (N%) per prey category between

males and females. As no significant differences between

sexes were found (t = 0.72, p > 0.05), we calculated the

numeric percentage per prey category for the pooled

stomachs.

©ZFMK

Diet composition of Ameerega picta from the Serra da Bodoquena region

Table 2. List of dietary studies on species of Ameerega in South America

Species

A. bilinguis

A. braccata

A. flavopicta

A. hahneli

A. parvula

A. petersi

A. picta

A. trivittata

Locality*

Parque Nacional Yasuni, Francisco de Orellana province (ECU)

Estacion Bioldgica Jatun Sacha, Napo province (ECU)

Reference

Darst et al. (2005)

Chapada dos Guimaraes, MT (BRA)

Cuiaba, MT (BRA)

Forti et al. (2011)

Minacu, GO (BRA)

Alto Paraiso, GO (BRA)

Pirenopolis, GO (BRA)

Caldas Novas, GO (BRA)

Ecological Station of Piratininga, MG (BRA)

Biavati et al. (2004)

Lima & Eterovick (2013)

Parque Nacional Yasuni, Francisco de Orellana province (ECU)

Estacion Bioldgica Jatun Sacha, Napo province (ECU)

Darst et al. (2005)

Biological Station Panguana, Huanuco province (PER) Toft (1980)

Remanso farm, Nova Xavantina, MT (BRA) Ramon et al. (2010)

Rancho Branco farm, Bodoquena, MS (BRA) This study

Biological Station Panguana, Huanuco province (PER) Toft (1980)

Juruti, PA (BRA)

Luiz et al. (2015)

“BRA, Brazil: PA, Para; MT, Mato Grosso; MS, Mato Grosso do Sul; GO, Goias; MG, Minas Gerais; ECU, Ecuador; PER, Peru.

We examined 61 specimens of Ameerega picta (Fig. 2),

50 of which (82%) had stomach contents. We identified

177 prey items in five prey categories belonging to the

classes Insecta and Arachnida. The most numerous prey

items in the diet composition of A. picta were Formicidae

(23%), Coleoptera (22%) and Diptera (16%) (Tab. 1). A

small variety of prey and high abundance of Formicidae

have been found in the diet of other populations of A. pic-

ta (Toft 1980; Ramon et al. 2010) and congeneric species,

such as A. bilinguis, A. braccata, A. flavopicta, A. hahne-

li, A. parvula, A. petersi and A. trivitatta (Toft 1980;

Biavati et al. 2004; Darst et al. 2005; Forti et al. 2011;

Luiz et al. 2015). The sequester of chemical defenses

from dietary sources 1s an important adaptation to the an-

ti-predator defense of dendrobatid frogs, as their diurnal

habits result in greater exposure to predators (e.g., Luiz

et al. 2015). The diet composition pattern of these species

of Ameerega is related to their dietary specialization on

ants, which are the source of the toxic alkaloids secreted

through the skin (Saporito et al. 2004; Darst et al. 2005;

Mebs et al. 2010). Some dendrobatid species that feeds

on ants and/or mites in higher proportions have been con-

sidered “ant-mite specialists” (Simon & Toft 1991; Toft

1995; Caldwell 1996). However, mites have been sug-

gested to be more important than ants as dietary sourc-

es of alkaloids in poison frogs (Saporito et al. 2007). In

the present study, we found high abundance of Formici-

Bonn zoological Bulletin 68 (1): 93-96

dae, Coleoptera and Diptera and absence of mites in the

diet composition of A. picta from region of the Serra da

Bodoquena, which seems to reflect the availability vari-

ation of these prey items in the habitats from which the

frogs were sampled.

Although Ameerega picta exhibits sexual dimorphism

in body size (Uetanabaro et al. 2008), we did not find

any significant difference between sexes regarding nu-

meric percentages per prey category. Differences in diet

composition between males and females are reported for

A. braccata and A. trivitatta (Forti et al. 2011; Luiz et al.

2015), which may be related to behavioral differences

that enable the partitioning of feeding resources between

SEXES:

We found only seven studies on the diet composition of

eight species of Ameerega (Tab. 2). The eight species of

Ameerega in the dietary studies analyzed correspond to

26% of the species in this genus, demonstrating that the

diet of most species of the genus is unknown. Therefore,

further studies should focus on species of Ameerega and

another dendrobatid species with undetermined diet in

order to improve the understanding of the trophic ecolo-

gy of the poison frogs.

Acknowledgments. The authors would like to thank the

Fundacéo Grupo Boticario de Protegéo a Natureza (process

#046820002) and project Padrées de biodiversidade da fauna

©ZFMK

96 Paulo Landgref Filho et al.

e flora do Pantanal (process #521746/97-3) for having provid-

ed both financial and logistical support during the fieldwork.

The Conselho Nacional de Desenvolvimento Cientifico e Tec-

nologico for having granted master’s scholarships to Domingos

J. Rodrigues (2000-2001) and Valdir who granted us access to

Assentamento Canaa and provided logistical support. We would

also like to thank Fabricio R.D. Fonseca, Rafael S. Arruda, Re-

nata S. Ledo and Tatiana S.F. de Souza for their assistance in

the field. Fabricio H. Oda receives a postdoctoral fellowship

from the Coordena¢gao de Aperfeigoamento de Pessoal de Nivel

Superior/Funda¢éo Cearense de Apoio ao Desenvolvimento

Cientifico e Tecnologico (grant n. 88887.162751/2018-00).

REFERENCES

Acosta Galvis AR (2017) Lista de los Anfibios de Colombia.

Online at http://www.batrachia.com/ (last access 20 April

2018)

Biavati GM, Wiederhecker HC, Colli GR (2004) Diet of Epipe-

dobates flavopictus (Anura: Dendrobatidae) in a Neotropical

Savanna. Journal of Herpetology 38: 510-518

Caldwell JP (1996) The evolution of myrmecophagy and its

correlates in poison frogs (Family Dendrobatidae). Journal

of Zoology 240: 75-101

Darst CR, Menéndez-Guerrero PA, Coloma LA, Cannatella DC

(2005) Evolution of dietary specialization and chemical de-

fense in poison frogs (Dendrobatidae): a comparative analy-

sis. American Naturalist 165: 56-69

Duellman WE (2005) Cusco Amazonico: The lives of amphib-

ians and reptiles in an Amazonian Rainforest. Comstock

Books in Herpetology, Cornell

Forti LR, Tissiani ASO, Mott T, Strissmann C (2011) Diet of

Ameerega braccata (Steindachner, 1864) (Anura: Dentro-

batidae) from Chapada dos Guimaraes and Cuiaba, Mato

Grosso State, Brazil. Brazilian Journal of Biology 71: 189-

1960

Frost DR (2019) Amphibian Species of the World: an Online

Reference, Version 6.0. http://research.amnh.org/herpetolo-

gy/amphibia/index.html/ (last access 26 March 2019)

Lima NGS, Eterovick PC (2013) Natural history of Ameerega

flavopicta (Dendrobatidae) on an island formed by Trés Ma-

rias hydroelectric reservoir in southeastern Brazil. Journal of

Herpetology 47: 480-488

Bonn zoological Bulletin 68 (1): 93-96

Luiz LF, Contrera FAL, Neckel-Oliveira S (2015) Diet and tad-

pole transportation in the poison dart frog Ameerega trivittata

(Anura, Dendrobatidae). Herpetological Journal 25: 187—190

Mebs D, Jansen M, Kohler G, Pogoda W, Kauert G (2010)

Myrmecophagy and alkaloid sequestration in amphibians: a

study on Ameerega picta (Dendrobatidae) and Elachistocleis

sp. (Microhylidae) frogs. Salamandra 46: 11-15

Ramon D, Fenker J, Calvao L, Pereira O, Marestoni T (2010)

Dieta e micro-habitat de duas espécies de anuros Rhinella

ocellata (Bufonidae) e Ameerega picta (Dendrobatidae),

Nova Xavantina-MT, Brasil. In: Programa de Pos-gradu-

acéo em Ecologia e Conservacao, Universidade do Estado de

Mato Grosso, Brazil. https://docplayer.com.br/8530067-Di-

eta-e-micro-habitat-de-duas-especies-de-anuros-rhinel-

la-ocellata-bufonidae-e-ameerega-picta-dendrobatidae-no-

va-xavantina-mt-brasil.html (last access 11 June 2019)

Saporito RA, Martin Garraffo H, Donnelly MA, Edwards AL,

Longino JT, Daly JW (2004) Formicine ants: an arthropod

source for the pumiliotoxin alkaloids of dendrobatid poison

frogs. Proceedings of the National Academy of Sciences of

the United States of America 101: 8045-8050

Saporito RA, Donnelly MA, Norton RA, Garraffo HM, Spande

TF, Daly JW (2007) Oribatid mites as a major dietary source

for alkaloids in poison frogs. Proceedings of the National

Academy of Sciences of the United States of America 104:

8885-8890

Simon MP, Toft CA (1991) Diet specialization in small verte-

brates: mite-eating in frogs. Oikos 61: 263-278

Scott Jr NJ, Woodward BD (1994) Standard techniques for in-

ventory and monitoring: Surveys at breeding sites. Pp. 118—

125 in: Heyer WR, Donelly MA, McDiarmid RW, Hayek

LC, Foster MS (eds) Measuring and monitoring biological

diversity: Standard methods for Amphibians. Smithsonian

Institution Press, Washington

Toft CA (1980) Feeding ecology of thirteen syntopic species

of anurans in a seasonal tropical environment. Oecologia 45:

131-141

Toft CA (1995) Evolution of diet specialization in poison-dart

frogs (Dendrobatidae). Herpetologica 51: 202—216

Uetanabaro M, Prado CPA, Rodrigues DJ, Gordo M, Campos Z

(2008) Guia de Campo dos Anuros do Pantanal Sul e Planal-

tos de Entorno. Editora UFMS/UFMT, Campo Grande

©ZFMK

Bonn zoological Bulletin 68 (1): 97-124

2019 - Bouarakia O. et al.

https://do1.org/10.20363/BZB-2019.68.1.097

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:|sid:zoobank.org:pub:B119E34D-9E27-47EF-99A0-051 ABA0E8268

Biogeographic history of Gerbillus campestris (Rodentia, Muridae) in Morocco

as revealed by morphometric and genetic data

Oussama Bouarakia'*, Christiane Denys’, Violaine Nicolas’, Touria Benazzout & Abdelaziz Benhoussa*

'° Laboratory ‘Biodiversity, Ecology and Genome’, Research Center ‘Plant and Microbial Biotechnology, Biodiversity and

Environment’, Faculty of Sciences, Mohammed V University in Rabat, 4 Avenue Ibn Battouta B.P. 1014 RP, Rabat, Morocco

?.3 Institut Systématique Evolution Biodiversité (ISYEB), Sorbonne Universités, MNHN, CNRS, EPHE, 57 Rue Cuvier, CP 51,

F-75005 Paris, France

* Faculty of Sciences, Mohammed V University in Rabat, 4 Avenue Ibn Battouta B.P. 1014 RP, Rabat, Morocco

* Corresponding author: Email: oussama.bouarakia@hotmail.com

'urn:lsid:zoobank.org:author:7F7449 1 B-8506-4D56-8D03-4629 1 SCEO9F5

2urn:|sid:zoobank.org:author:FCD37439-1E9D-4FD2-A 845-E311603D45EF

3urn:Isid:zoobank.org:author:FA 1B1FA8-CB99-4CE8-B87A-F9B329ES5DFO07

*urn:Isid:zoobank.org: author: F33BA 104-53D9-4250-B807-744A6BCCBDDA

>urn:lsid:zoobank.org:author: A9B4B5A6-68D0-4BB3-9B99-683A 92EC6FD6

Abstract. Gerbillus campestris is a widely distributed small rodent that lives in various habitats in North Africa and can be

a potential agricultural pest. We conducted a biogeographic study of this species with an integrative approach using mor-

phometric data from body and craniomandibular distances and molecular genetic data from the cytochrome b gene of the

mitochondrial DNA. We collected 96 individuals in six localities from central, northern and eastern Morocco. Data from

18 morphological characters were used in multivariate statistical analyses and molecular data were analysed using maxi-

mum likelihood and median-joining networks. Our analyses confirmed the high morphological variability in this species

and allowed to discriminate four groups containing the studied populations. We found that a few craniomandibular measu-

rements had the highest contribution in the differences between populations, and that this variability reflected a spatial and

environmental differentiation. In the genetic analyses, we placed our six populations and six individuals from four other

countries in nine previously identified phylogenetic lineages in this species, and we also added a tenth lineage. Limited

gene flow, isolation by distance and biogeographic barriers were further explored to explain this genetic structuration. We

also jointly examined morphometric and genetic variability and found that the morphological groups were congruent with

the genetic lineages and the geographic distribution. A better knowledge of the phenotypic plasticity and genetic diversity

of this gerbil can be used to comprehend the micro-evolutionary processes in other small mammals in North Africa.

Key words. North Africa, cytochrome b gene, craniometry, populations, Gerbillinae, agriculture.

INTRODUCTION

The Gerbillinae subfamily and the genus Gerbillus are

the most diverse group of rodents in North Africa. Like

other small rodents, the species of this genus represent

suitable models for the construction of biogeographic his-

tory thanks to their brief generation time and prolific re-

production rates; their rather limited dispersion capacities

and strong affiliation to arid and/or open habitats (Avise

2000; Nicolas et al. 2009). A few recent molecular studies

have attempted to review the systematics of the various

species of Gerbillus inhabiting North Africa and Moroc-

co, or to better understand their biogeography (Abiadh

et al. 2010; Ndiaye et al. 2012, 2013a, 2016; Nicolas

et al. 2014; Bouarakia et al. 2018). Among this genus, the

most widespread species in Morocco 1s the North African

Gerbil, Gerbillus campestris Loche, 1867, which is also

considered as an agricultural pest (Giban & Haltebourg

Received: 14.01.2019

Accepted: 04.02.2019

1965; Ouzaouit 1980; Zyadi & Benazzou 1992). It is a

long tailed, middle sized gerbil, with naked hind feet, that

lives throughout the Mediterranean part of North Africa

from Egypt, west of the Nile River and Delta, to Morocco

in the West. It is also present but less widely distributed in

the Sahara Desert and Sahel region, in Sudan, Niger and

Mali (Happold 2013; Granjon et al. 2016; Denys et al.

2017). The species dwells in different habitats, from sub-

humid to arid and desertic regions, except high moun-

tains, forests and sandy desert areas. It occupies steppes,

arable lands, rocky habitats and oases; and digs its bur-

row in sandy or clay soils (Petter & Saint Girons 1965;

Happold 1967; Aulagnier & Thevenot 1986; Kowalski &

Rzebik-Kowalska 1991; Dobigny et al. 2002; Musser &

Carleton 2005; Aulagnier et al. 2017).

Previous studies have investigated the intraspecific

variability of Gerbillus campestris. Petter & Saint-Gi-

rons (1965) suggested the subdivision of the species in

Corresponding editor: R. Hutterer

Published: 13.06.2019

98 Oussama Bouarakia et al.

Morocco into to two subspecies based on coloration cri-

teria. In Tunisia, due to geographic variation in size, the

existence of two subspecies was suggested (Ranck 1968:

Jordan et al. 1974). By combining the variation of skull

size and characters, external size and pelage colour, two

to five subspecies were identified in Egypt, Libya and Su-

dan (Setzer 1958; Ranck 1968; Osborn & Helmy 1980).

Benazzou & Zyadi (1990) and Baala (1995) displayed

the presence of a geographic biometric variation between

five populations in Morocco, while Baala (1995) showed

the absence of biochemical polymorphism between these

five populations. On a chromosomal level, the most com-

mon diploid number of chromosomes for G. campestris

is 2n = 56. This karyotype is present in Algeria, Tunisia,

Egypt, Mali and Niger (Matthey 1952; Wassif et al. 1969;

Jordan et al. 1974; Dobigny et al. 2001, 2002). However,

chromosomal polymorphism was documented in Moroc-

co with 2n = 56 in Taroudant locality and 2n = 57, 58 in

Goulimine locality (Lay et al. 1975). More recently, Nico-

las et al. (2014) presented a complex phylogeographic

pattern in Morocco and North Africa using cytochrome

b sequences. The wide distribution of G. campestris, the

multiplicity of habitats tt occupies, the rich geographic

diversity of the region and the extreme environmental

changes that occurred in North Africa during the Pleisto-

cene, parallel this important intraspecific diversity.

To complete the phylogeographic structuration uncov-

ered by Nicolas et al. (2014), we increased sample size

wa:

Mauritania

Senegal @

Oe,

in three localities and added three new ones in Morocco,

to perform a study of genetic variability based on the cy-

tochrome b gene of the mitochondrial DNA. The addi-

tional sampling from north-western Morocco helped us

to explore the existence of barriers to gene flow in this

part of Morocco, namely the Sebou River. In addition,

the new sampling from north-eastern Morocco on both

the eastern and western sides of the Moulouya River was

useful to investigate the role of the Moulouya River and/

or its arid valley as a major geographic barrier and to ver-

ify the suggested east-west genetic differentiation around

this river (Nicolas et al. 2014; Lalis et al. 2016; Beddek

et al. 2018). We also included samples from GenBank

from four new localities (Mali, Tunisia, Libya and Egypt)

to better identify past gene flow in other parts of the dis-

tribution range of the species.

Furthermore, we used body and craniomandibular dis-

tance-based measurements of genetically typed individu-

als from six localities from central, northern and eastern

Morocco in a comparative study of morphometric vari-

ability, to explore the influence of spatial, geographic and

environmental factors on phenotypic diversity. Finally,

we jointly examined the morphological and genetic inter-

population variability to verify their congruence in defin-

ing the biogeographic history of the species in Morocco.

Chad

Fig. 1. Map displaying the geographic range (grey area, as mentioned by Granjon et al. 2016) of Gerbillus campestris and the dis-

tribution of the ten mitochondrial lineages. Dotted lines surround the geographic groupings of five lineages (1, 2, 3, 4 and 6). Based

on Nicolas et al. (2014), only the localities of Mali and Niger were included in the geographic grouping of lineage 2. Localities from

the present work (CHR, ANT, KTR, MZ, GCF, FRT) and from bibliography (numbered from | to 28) are indicated (see Appendix

I). Localities 14, 16, 20, 23 and 24 shelter haplotypes from both lineages 1 and 3. Moulouya, Sebou, Niger and Nile Rivers are also

shown in the map.

Bonn zoological Bulletin 68 (1): 97-124

©ZFMK

Biogeographic history of Gerbillus campestris 99

MATERIAL AND METHODS

Sampling. We collected 96 specimens of Gerbillus

campestris between 2011 and 2015 in six localities in

Morocco from various regions: 10 specimens in the

Tingitane peninsula in Chrouda locality (named hereafter

CHR); 13 in central Morocco in Aounate locality (ANT);

24 in Kenitra (KTR) and 25 in Merja Zerga (MZ) in the

Gharb region north of the Sebou River; five in Guercif

(GCF) on the west side of the Moulouya River and 19 in

Fritissa (FRT) on the east side of the river in the Oriental

region (Fig. 1, see Appendix I). We captured the animals

alive using Sherman traps then we euthanized them by

cervical dislocation. This protocol was approved by the

Cuvier (Museum National d’Histoire Naturelle, Paris)

ethics committee. We extracted a piece of the liver for

the genetic study and preserved the carcasses in formal-

dehyde. Later, we extracted and prepared the skulls for

the morphometric study. Then, we deposited voucher

specimens in the collections of the Laboratory ‘Biodi-

versity, Ecology and Genome’ of the Faculty of Sciences

of Rabat, except those from the Chrouda locality, that

are preserved in the collections of the Museum National

d’ Histoire Naturelle of Paris (see Appendix I).

Morphometric study. We used the standard body mea-

surements, head-body length (HB), tail length (T), hind

feet length (HF), ear length (E), weight (WT) and the

ratio of tail length to head-body length (%T). Using a

Mitutoyo caliper accurate to 0.01 mm, we took 10 skull

measurements (mm) on dorsal, ventral and lateral view

of the skull. We also took three mandibular measure-

ments (mm). Abbreviations of these craniomandibular

values are as follows: greatest length of skull (GLS),

width of the zygomatic arch (WZYG), breadth of brain-

case (BB), length of nasals (LN), least interorbital con-

Table 1. Geographic data for the six localities studied in Morocco.

striction (IO), occipital height from the tympanic bulla

to the parietal-interparietal suture (HOCC), length of

anterior palatine foramina (LAF), length of upper molar

series (M1M3), width of the palate between the first two

molars M1 at the anterocone (WP), diagonal length of

tympanic bulla (LTB), length of the mandible from the

tip of the lower incisor to the angular process (LMDB),

height of the mandible taken above the mandibular con-

dyle (HMDB), length of lower molar series (LM1MS3).

The body and skull variability in each population was

first calculated using descriptive statistics (minimum,

maximum, mean, standard deviation). Multivariate

analyses were conducted on log transformed body and

craniomandibular measurements to make them more ho-

mogenous. To represent the body and skull variability we

performed a principal component analysis (PCA). The

results of the PCA were analysed to identify the factors

influencing the structure of the data point clouds as visu-

alized in the bi-plot graphs of the analyses.

A multivariate analysis of variance (MANOVA) was

made to test the sexual dimorphism for the body and

skull variables. We made another MANOVA to test the

effect of the “locality” variable on the measurements.

The standard significance threshold for the MANOVA

was set at 5%. To visualize the morphological variability

without the influence of sex, we performed a PCA sepa-

rately within each sex. We also conducted a discriminant

function analysis (DFA) within each sex to quantify the

rate of discrimination based on the “locality” variable. In

this DFA, we did not include the two individuals of CHR

locality. An additional DFA was conducted on the data of

the combined sexes to quantify the rate of discrimination

based on the “locality” variable, and to identify the mea-

surements that best categorise morphological variabili-

ty. Finally, we tested the influence of altitude, latitude,

longitude and annual precipitations using MANOVA

Locality Altitude (m) Latitude Longitude Precipitations (mm)

Chrouda

(CHR) 209 35.360 -5.170 795

Aounate

(ANT) 185 32.746 -8.244 317

Kenitra

(KTR) 43 34.445 -6.520 579

Merja Zerga

(MZ) 25 34.817 -6.310 622

Guercif

(GCF) 410 34.206 -3.424 222

BritissA 510 34.161 3.231 218

(FRT) ae

Bonn zoological Bulletin 68 (1): 97-124

©ZFMK

100 Oussama Bouarakia et al.

(Tab. 1). All statistical analyses were performed using the

software XLSTAT version 2016 (Addinsoft 2012).

To minimize age-related bias, two individuals were

excluded from the statistical analyses because they were

identified as juveniles. This age estimation was done us-

ing the dental wear scheme of the upper molar series es-

tablished by Zyadi (1989) and the age classes based on

weight made by Zyadi & Benazzou (1992). Also, in all

the multivariate analyses, we did not include 11 tndivid-

uals due to missing data in the measurements.

Molecular study. We extracted and purified the DNA

of the 96 individuals using the QIAGEN Kit (DNeasy

Blood & Tissue Kit) following the manufacturer recom-

Table 2. Body measurements of Gerbillus campestris in six populations in Morocco. Abbreviations: head-body length (HB); tail

length (T); hind feet length (HF); ear length (E); weight (WT); ratio of tail length to head-body length (%T); sample size (N); min-

imum (Min); maximum (Max); standard deviation (S.d.).

Chrouda Aounate’ Kenitra Merja Zerga Guercif — Fritissa All popula-

(CHR) (ANT) (KTR) (MZ) (GCF) (FRT) Hows

N 2 12 24 24 5 19 86

ye OMin 95 83 83 78 81 89 78

Max 105 103 103 98 116 108 116

(mm) Mean — 100.00 92.33 94.42 90.87 102.40 98.37 94.60

S.d 7.07 7.02 5.72 4.75 14.54 6.49 ROT

N 2 12 22 24 5 18 83

7 Min 109 99 94 93 106 11 93

Max 119 117 112 117 149 134 149

(mm) Mean 114.00 110.64 106.27 107.54 126.80 121.33 112.29

S.d 7.07 5.16 5.07 5.59 18.40 7.07 10.09

N 2 12 24 24 5 19 86

We Min 26 23 23 23 24 25 23

Max 28 26 25 26 29 28 29

(mm) Mean 27.00 24.67 24.52 24.44 25.60 26.55 25.09

S.d. 1.41 0.78 0.60 0.71 2.07 0.88 1.33

N 2 12 24 24 5 19 86

: Min 12 13 14 13 1 15 if

Max 15 16 16 16 16 18 18

(mm) Mean 13.50 14.92 15.10 14.56 14.00 16.18 15.06

S.d D9 1.16 0.77 0.68 1.87 0.80 1.14

N 2 12 24 24 5 19 86

wr Min 34 16.8 17.8 16 18 22.5 16

Max 40 32 35 25 37.5 36.5 40

(8) Mean 37.00 377 24.85 20.57 29.00 28.13 24.75

S.d 4.24 5,37 4.52 2.55 8.31 4.66 5.60

N 2 12 22 25 5 18 83

Min 104 11 97 99 117 104 97

%T Max 125 131.5 131 144 131 138 144

Mean 114.54 Wise 113,09 118.72 123.96 123.72 119.08

S.d. 15.17 6.98 9.17 8.77 5.96 10.03 9.97

Bonn zoological Bulletin 68 (1): 97-124 ©ZFMK

Biogeographic history of Gerbillus campestris 101

mendations. Then we amplified the cytochrome b gene

(1040 bp) via polymerase chain reaction (PCR) using

the primers L7 (ACC AAT GAC ATG AAA AAT CAT

CGT T) and H15915 (TCT CCA TTT CTG GTT TAC

AAG AC) (Ducroz et al. 2001). The PCR included an

initial denaturation step of 3 min at 94°C, followed by

38 cycles of 30 sec at 94°C, 40 sec at 52°C, and 90 sec at

72°C, with a final extension step of 5 min at 72°C. Dou-

ble-stranded PCR products were purified and sequenced

by Eurofins. We checked the chromatograms then we

corrected and aligned the sequences both manually and

using ClustalW in the software BioEdit (Hall 1999). To

attain the genetic identification, we entered the sequenc-

es into the Basic Local Alignment Search Tool (BLAST,

https://blast.ncbi.nim.nih.gov/Blast.cgi). All the se-

quences were submitted to GenBank (see Appendix I).

To choose the model of nucleotide substitution for our

phylogenetic analysis, we used the software jModeltest

2.1.10 (Darriba et al. 2012). The General time reversible

(GTR)+I+G model (Gu et al. 1995) was determined as

the best-fit model of nucleotide substitution, according

to the Akaike information criterion (Akaike 1973). We

constructed a phylogenetic tree using the Maximum

Likelihood method (ML) in the software MEGA 7.0.26

(Tamura et al. 2013). The robustness of the obtained to-

pologies was estimated in all the treatments using a boot-

strap analysis (1000 replicates). We included in the mo-

lecular analysis all the cytb sequences of G. campestris

present in the GenBank database (108 sequences). We

removed the beginning and the end of all the sequences

used in the analysis because these parts of the sequences

were missing in many specimens from GenBank, and we

maintained a fragment of 1033 pb. We rooted the phy-

logenetic tree with one representative from each of the

three subgenera of Gerbillus: G. simoni for the subge-

nus Dipodillus, G. hesperinus for the subgenus Gerbil-

lus and G. henleyi for the subgenus Hendecapleura (see

Appendix I). We also used the Median Joining algorithm

through the software NETWORK version 4.500 (Bandelt

et al. 1999) to estimate evolutionary relationships among

the haplotypes. Finally, the Pairwise Kimura two-param-

eter (K2P) genetic distances (Kimura 1980) between the

lineages were computed using MEGA 7.0.26 (Tamura

et al. 2013).

RESULTS

Morphometric study. In the descriptive statistics of the

body and craniomandibular measurements, we observe

the existence of a variability between the six populations

(Tabs 2-3). In general terms concerning body and cranio-

mandibular size, the highest mean values belong to the

populations of CHR, GCF and FRT; while the lowest

mean values belong to the populations of ANT, KTR and

MZ.

Bonn zoological Bulletin 68 (1): 97-124

Variables (axes F1 and F2: 74,59 %)

F2 (10,08 %)

7 \

als

=\'5)

-0,75

F1 (64,52 %)

Fig. 2. Correlation circle obtained by the principal component

analysis (PCA) of the body and craniomandibular variables in

the factor space of (F1 and F2).

Observations (axes F1 and F2: 74,59 %)

2 Mz «TR,

ama MZ ® op on

* + +

an® en Gen ¢ .

an! 2 Nz gW2 ¢ 2¢ KTR Wir | Chi

3 , 2 eee. Je ae Far *¢ & ¢

Z uz

So -—Y dy 3 # __eM te ¥, = » oe: ;

a KTR mz ig +, rity ‘mn * e

f 1 wz ® +. we em | “ Piss og, FRT RT

on ant + + we +

2 uz @ li Pi +

ant + Sar +

3 ant ® ANT +

4 co @ aE

F1 (64,52 %)

Fig. 3. Projection of individuals on the first two axes (F1 and

F2) of the principal component analysis (PCA). Different co-

lours represent different localities (Chrouda: black; Aounate:

green; Kenitra: blue; Merja Zerga: red; Guercif: orange; Fri-

tissa: purple).

For the PCA, we visualize in the correlation circle,

the first two axes F1 and F2 that represent respectively

64.52% and 10.08% of the total variance (Fig. 2). The

projection of the 18 body and craniomandibular variables

on the F1xF2 plane shows that the F1 axis is positively

©ZFMK

102 Oussama Bouarakia et al.

Table 3. Craniomandibular measurements of Gerbillus campestris in six populations in Morocco. Abbreviations: greatest length of

skull (GLS), width of the zygomatic arch (WZYG), breadth of braincase (BB), length of nasals (LN), least interorbital constriction

(IO), occipital height from the tympanic bulla to the parietal-interparietal suture (HOCC), length of anterior palatine foramina

(LAF), length of upper molar series (M1M3), width of the palate between the first two molars M1 at the anterocone (WP), diagonal

length of tympanic bulla (LTB), length of the mandible from the tip of the lower incisor to the angular process (LMDB), height of

the mandible taken above the mandibular condyle (HMDB), length of lower molar series (LM1M3); sample size (N); minimum

(Min); maximum (Max). standard deviation (S.d.).

Chrouda Aounate Kenitra Merja Zerga Guercif Fritissa All popula-

(CHR) (ANT) (KTR) (MZ) (GCF) (FRT) tions

N 2 m2 24 24 5 19 86

Min 28.77 25.42 25.66 25.36 26.98 28.09 25.36

GLS Max 32.66 29:77 28.63 28.98 31.07 31.74 32.66

Mean DO: ial 27.90 27.43 Zee 29.68 30-12 28.23

S.d. 2S 1.36 0.83 0.80 Pero 1.02 1.62

N Z 12 24 24 5 19 86

Min 12.5 10.77 10.81 10.01 10.97 12 10.01

WZYG Max 13.8 12.64 12.4 1225 13.26 37 13.8

Mean 13.15 11.81 11.62 29 1232 12.83 11.90

S.d. 0.92 0.61 0.47 0.49 0.97 0.53 0.81

N 2 12 24 24 5 19 86

Min 13.82 12.83 12:57 1259 13.34 13.69 1257

BB Max 14.53 14.18 13.55 13.65 15.59 15.27 15°39

Mean 14.17 13.52 13.13 [elk 14.57 14.24 13,55

S.d. 0.50 0.42 0.26 0:33 0.85 0.41 0.64

N 2 12 24 24 5 19 86

Min 11.26 10.09 10.09 9.84 10.43 11.08 9.84

LN Max | Bee | 12.12 | ae bE73 12.87 13.08 [354

Mean 12.38 27 ha3 11.00 11.89 12,32 11.45

S.d. 159 0.67 0.49 0.48 1.10 0.49 0.79

N 2 12 24 24 5 19 86

Min 5.24 4.52 4.62 4.55 4.88 5.01 4.52

IO Max 5.8 5.43 5:2 5.46 5.63 5.94 5.94

Mean 5:52 5.00 491 4.99 5.29 5.43 5.10

S.d. 0.40 0.27 0.14 0.20 0.27 0.25 0.30

N Z 12 24 24 5 19 86

Min Pi2 10.42 9.94 10.05 10.71 11.11 9.94

HOCC Max 11.44 11.06 10.87 10.89 11.91 11.94 11.94

Mean [132 10.82 10.44 10.44 11.24 11.43 10.78

S.d. 0.17 0.21 0.26 0.26 0.47 (23 0.49

N 2 12 24 24 5 19 86

Min B22 4.44 42 4.42 4.38 49 42

LAF Max 5.64 5:29 5.69 5.65 5:52 6.08 6.08

Mean 5.42 4.97 23 S33 5.16 5.46 Rees

S.d. 0.31 0.29 0.35 0.31 0.48 0.32 0.36

Bonn zoological Bulletin 68 (1): 97-124 ©ZFMK

Biogeographic history of Gerbillus campestris

Table 3. (continued)

Chrouda Aounate Kenitra

(CHR) (ANT) (KTR)

N 2 12 24

Min 4.21 3:71 3.38

M1M3 Max 4.22 4.2 3.89

Mean 4.21 3.89 3.64

S.d. 0.01 0.14 0.12

N 2 12 24

Min 3.02 2.66 2.88

WP Max Bie 3.2 3.54

Mean Boy. 2.99 3.19

S.d. 0.36 0.17 0.16

N 2 12 24

Min 8.11 8.14 8.14

LTB Max Isl 8.95 8.91

Mean 8.60 8.71 8.44

S.d. 0.70 0.25 0.18

N 2 12 24

Min 16.37 14.42 14.77

LMDB Max 18.56 17.18 6.3

Mean 17.46 16.05 15.81

S.d. L55 0.89 0.50

N Z 12 24

Min 6.67 6.31 6.23

HMDB Max 7.81 7.49 7.44

Mean 7.24 6.92 6.85

S.d. 0.81 0.37 0.28

N 2 12 24

Min SAS B99 3.27

LM1M3 Max 4.05 4.03 3.66

Mean 3.90 3.81 B55

S.d. 0.21 0.13 0.10

correlated with all the variables, which indicates a size

axis. On the other hand, several variables are positive-

ly correlated with the F2 axis, while several others are

negatively correlated with this axis. The most strongly

positively correlated variable with the F2 axis is the vari-

able WP, with a correlation value of 0.69. The scatter plot

of the PCA (Fig. 3) does not allow to visualize different

distinct groups, but all the specimens from FRT and CHR

and virtually all those from GCF are located on the pos-

itive side of the Fl axis. Contrarily, the specimens from

Bonn zoological Bulletin 68 (1): 97-124

103

Merja Zerga Guercif Fritissa All popula-

(MZ) (GCF) (FRT) tions

24 5 19 86

3.41 Boo 3.76 3.38

3.86 4.27 4 36 4 36

3.65 4.13 4.07 3.81

0.11 0.11 0.15 0.24

24 5 19 86

ZAS 2.85 2:95 2.66

3.54 3.41 3.58 3.58

3.19 3.18 3.23 SF

0.17 22 0.18 0.19

24 5 19 86

7.89 8.55 8.85 7.89

8.87 9.87 75 9.87

8.44 925 9.36 8.73

0.24 0.49 G27 0.46

24 5 19 86

14.71 13.32 16.26 14.42

16.8 18.35 hSe35 18.56

15.71 Aral Z 78 16.22

0.52 1.38 0.63 0.92

24 5 19 86

6.42 6.58 7.04 6:23

7.61 7.74 8.26 8.26

6.94 7.28 ee | HOT

0.30 0.50 0.36 0.42

24 5 19 86

3.3 3.8 3.74 Si2t

3.64 4.15 4.13 4.15

3.50 3 OF 32, 3.68

0.11 O12 0.10 O22.

MZ and KTR are located mainly on the negative side of

F1. Specimens from ANT show high size variation.

Among the 83 individuals (55% males, 45% females),

the average size of females seems somewhat larger than

the one of males, and the Wilks’ test in the MANOVA

showed the existence of sexual dimorphism (Wilks’ ) =

0.598, F statistics = 2.386, DF, = 18, DF, = 64, p< 0.05),

which means that sex has a slightly significant influence

on the dispersal of the observations on the PCA. For the

PCA of the male individuals, we visualize the scatter plot

of the two first axes F1 and F2 that represent respective-

©ZFMK

104 Oussama Bouarakia et al.

Variables (axes F1 and F2: 81,36 %)

F2 (10,68 %)

F1 (70,68 %)

Fig. 4. Correlation circle obtained by the discriminant function

analysis (DFA) of the body and craniomandibular variables in

the factor space of (F1 and F2).

ly 66.45% and 10.17% of the total variance (see Appen-

dix IT). For the PCA of the female individuals, we visu-

alize the scatter plot of the two first axes Fl and F2 that

represent respectively 62.55% and 13.46% of the total

variance (see Appendix II). In both the PCA of males

and females, the Fl axis is positively correlated with

all the variables indicating a size axis; with the cranio-

mandibular measurements HOCC, LTB, WZYG, BB,

LN, HMDB, LMDB and GLS being the most strongly

correlated variables with F1 (values ranging from 0.83

to 0.98). In both scatter plots (males and females), indi-

viduals from MZ and KTR are the smallest, while those

from FRT are the largest. Male individuals from GCF are

almost as large as the individuals from FRT, while the

female individuals from GCF have a high size variation.

Male individuals from ANT show a medium size and the

females show high size variation. The male individual

from CHR 1s one of the largest individuals and the female

from CHR has a medium size. In the DFA, we were able

to quantify the discrimination between five populations

within each sex: in the males, 100% of the individuals of

ANT were correctly classified, 86.67% for KTR, 81.25%

for MZ, 100% for GCF and 100% for FRT; while in the

females, 100% of the individuals were correctly classi-

fied in each one of the five populations.

The Wilks’ test in the MANOVA revealed the presence

of a highly significant morphological difference between

the various localities (Wilks’ 2 = 0.01, F statistics =

5.146, DF, = 90, DF, = 296, p < 0.0001). According to

Bonn zoological Bulletin 68 (1): 97-124

this result, we performed a discriminant function analysis

(DFA) to quantify the morphological variability based on

a locality effect. In the correlation circle (Fig. 4), the first

two axes Fl and F2 of the DFA represent respectively

70.68% and 10.68% of the total variance. The projec-

tion of the 18 body and craniomandibular variables on

the F1xF2 plane shows that the F1 axis 1s positively cor-

related with all the variables except WP (-0.02). In the

F1 axis, the most discriminating variables are LM1M3

(0.91), HOCC (0.88), M1M3 (0.87), LTB (0.82), BB

(0.80) and GLS (0.75).

Observations (axes F1 and F2: 81,36 %)

F2 (10,68 %)

F1 (70,68 %)

Fig. 5. Projection of individuals on the first two axes (F1 and

F2) of the discriminant function analysis (DFA). Different sym-

bols represent different localities. Also shown are confidence

circles for each locality using covariance hypothesis.

On the scatter plot of the two first axes of the DFA

(Fig. 5), although some overlap can be observed, we can

distinguish four major groups:

— Group I composed of the individuals of Merja Zerga

(MZ) and Kenitra (KTR);

— Group II composed of the individuals of Aounate

(ANT);

— Group III composed of the individuals of Guercif

(GCF) and Fritissa (FRT);

— Group IV composed of the individuals of Chrouda

(CHR).

This structuration is integrated by the F1 axis that iso-

lates Group I on the negative side of the axis and Groups

III and IV on the positive side, while Group IJ is located

in an intermediate position along this axis. The F2 axis

allows a complete separation between Group IV and

Group III. The DFA has also allowed to quantify the dis-

crimination between the six populations: 100% of the

©ZFMK

Biogeographic history of Gerbillus campestris 105

Lineage 6 (Morocco)

Lineage 4 (Tunisia,

Algeria, Morocco)

Lineage 8 (Morocco)

Lineage 7 (Morocco)

Lineage 10 (Mali)

Lineage 1 (Morocco)

Lineage 3 (Morocco)

Lineage 2 (Egypt, Libya,

Niger, Mali)

Fig. 6. Phylogenetic tree of Gerbillus campestris for the cytochrome b gene resulting from the Maximum-Likelihood analysis

(GTR +1I+G substitution model). Numbers at nodes represent ML bootstrap support. To improve clarity, values of the most apical

nodes are not shown. The scale bar represents the branch length measured in the number of substitutions per site. The ten mitochon-

drial lineages are presented on the right border along with their geographic origin.

Bonn zoological Bulletin 68 (1): 97-124 ©ZFMK

106 Oussama Bouarakia et al.

individuals of ANT were correctly classified, 86.4% for

KTR, 87.5% for MZ, 80% for GCF, 100% for FRT and

100% for CHR.

Based on the results of the MANOVA, all the geo-

graphic parameters (altitude, latitude, longitude, annual

precipitations; Tab. 1) have a highly significant effect:

Wilks’ A = 0.01, F statistics = 5.146, DF, = 90, DF, =

296, p < 0.0001). A supplementary observation concern-

ing the body variation between our suggested morpho-

metric groups is the difference of dorsal coat colour,

being dark brown for Group I, II and IV; and yellowish

brown for Group HI.

Molecular study. Based on the results of the phyloge-

netic tree (Fig. 6) and the haplotypes network (Fig. 7),

the individuals from the six localities belong to four of

the nine phylogenetic lineages previously identified by

Nicolas et al. (2014):

— All the ten individuals from Chrouda (CHR) are found

in lineage 7, which was previously composed of four

specimens from this same locality.

— All the 13 individuals from Aounate (ANT) are found

in lineage 1, which is widely distributed in Morocco

and contains specimens from many localities south of

the Bou Regreg River.

— All the 24 individuals from Kenitra (KTR) and the 25

individuals from Merja Zerga (MZ) are found in lin-

eage 6, that was previously composed of only nine

specimens from Merja Zerga.

— All the five individuals from Guercif (GCF), west of

Moulouya River, and the 19 individuals from Fritissa

(FRT), east of Moulouya River, are found in lineage 4

that previously contained only specimens from the east

of this river (Morocco, Algeria and Tunisia).

Moreover, we have added three individuals from Egypt

(Khalifa et al. 2018) and one from Libya (Chevret et al.

2014) to lineage 2, that was previously composed only

of specimens from Niger and Mali (Tessalit and Adrar

des Iforas localities). We also added one individual from

Tunisia (Alhajeri et al. 2015) to lineage 4. Furthermore,

we have attributed one individual from Mali (Sinkerma

locality) (Schwan et al. 2012) to a new suggested lineage

10. The K2P genetic distance between lineage 10 and the

other lineages goes from 1.4% with lineage 8, to 2.6%

with lineage 2.

DISCUSSION

Morphological adaptation. The results of the morpho-

metric study revealed a significant morphological vari-

ability among Gerbillus campestris in Morocco. The

significant difference in the MANOVA testing the effect

of “locality” variable; and the relatively high rate of dis-

Bonn zoological Bulletin 68 (1): 97-124

crimination of the DFA indicates a spatial structuration

between populations. This structuration was represented

by Group I (Merja Zerga and Kenitra populations), Group

II (Aounate population), Group III (Guercif and Fritissa

populations) and Group IV (Chrouda population). The

parameters that contribute the most to this clustering are

the lower and upper molar series length, the skull height,

the tympanic bulla length and the braincase breadth. The

variation of these parameters shows a gradual increase in

size, from Group I being the smallest, to Group IV and

Group III being the largest; while Group IT has a medium

size. In Morocco, a few previous studies were made on

the geographic variation in biometrics for G. campestris

(Benazzou & Zyadi 1990; Baala 1995). Apart from the

Kenitra locality, they showed for different localities than

Ours an interpopulational variation in size, with Kenitra

being the smallest. Another type of body variation re-

ported in Morocco was related to the dorsal coat colour,

being fawn grey in the northern regions and gradually

brightening towards the south, until becoming light fawn

in desertic habitats (Petter 1961).

In our study, the morphological variability was slightly

influenced by sex, as we showed in the MANOVA the

existence of a weak sexual dimorphism when males and

females were analysed together. The PCA of the variabil-

ity within each sex shows almost similar results between

males and females; and roughly a similar distribution of

individuals in the F1xF2 plane. Also, there is a strong rate

of discrimination between the populations within each

sex. All these reasons support a weak influence of sex

on the clustering of our populations in distinct groups. In

the precedent study of G. campestris in Morocco, Baala

(1995) found no significant sexual dimorphism in five

populations. In Tunisia, Jordan et al. (1974) found sex-

ual difference in only one character. Additionally, sexual

dimorphism has seldom been confirmed in Muridae ro-

dents using classical morphometric analysis (Csanady &

Mo8ansky 2018). Thus, larger samples from each pop-

ulation are needed to verify if the minor sexual dimor-

phism that we uncovered is not due to sampling bias.

The morphometric structuration that we showcased in

G. campestris 1s explained by the wide distribution of

this species in Morocco and the vast environmental di-

versity of this country. The significant differences found

in the MANOVA for the geographical factors (altitude,

latitude, longitude, precipitations) give more explanation

to support this spatial and environmental differentiation.

A similar result was found for Rattus rattus in Tunisia,

where latitude, longitude, altitude and precipitation vari-

ables exhibited a significant control on size parameters

(Ben Faleh et al. 201 2a).

Our different populations are located in diverse bio-

climates: subhumid for Group I (Kenitra and Merja

Zerga) and Group IV (Chrouda), semi-arid for Group II

(Aounate) and arid for Group III (Guercif and Fritissa)

(Mokhtari et al. 2013). The influence of varying biocli-

©ZFMK

Biogeographic history of Gerbillus campestris 107

Fig. 7. Minimum spanning network of Gerbillus campestris for the cytochrome b gene haplotypes. Circle sizes are proportional

to the number of similar haplotypes observed in the data set. Branch lengths are proportional to the number of mutations between

haplotypes. The dashed ellipses (added for clarity) represent the ten mitochondrial lineages.

Bonn zoological Bulletin 68 (1): 97-124 ©ZFMK

108 Oussama Bouarakia et al.

mates and rainfall patterns on the populations acts indi-

rectly through the availability and type of food resources

(Yom-Tov & Geffen 2011; Breno et al. 2011). Previous

studies showed an influence of climate on the skull of

rodents, through variations in the type and availability of

food (Renaud et al. 2005; Samuels 2009). The quality and

quantity of food were shown to influence growth rates

and skull morphology in the multimammate rat, Mas-

tomys natalensis (Lalis et al. 2009; Breno et al. 2011). In

the muskrat, Ondatra zibethicus, the high availability of

food to each individual accelerated its growth, but if food

was less abundant, there was an extension of the growth

phase and an increase in growth variability (Pankakos-

ki et al. 1987). Pocket gophers inhabiting alfalfa crops

had larger body and skull size compared to those living

in natural dry environments (Patton & Brylski 1987). In

another example, a high difference in protein content in

the diet of captive rats, Rattus norvegicus, caused a clear

modification in adult skull shape but much less modifi-

cation in the adult body and skull size (Miller & German

1999; Reichling & German 2000). However, squirrel

monkeys, Saimiri sciureus that were fed a diet varying in

protein content had different skull sizes but similar shape

(Ramirez Rozzi et al. 2005). Surprisingly in our study,

the individuals of Kenitra and Merja Zerga are the small-

est even if they occupy the fertile agricultural fields of

the Gharb region, characterized by high food availability

and the abundance of peanut crops known to be rich in

protein; as opposed to the individuals of Guercif and Fri-

tissa, that are the largest even if they occupy habitats with

low food availability in the Oriental region.

Food hardness, too, has an influence on skull devel-

opment. This is an important factor of differentiation

between our suggested morphometric groups, especially

that the most discriminating variables in the DFA are the

lower and upper molar series length. It was established in

various species of rodents that skull morphology can be

associated with the structure of food. In the prairie deer

mouse, Peromyscus maniculatus, a softer diet caused a

reduction in size of the masseteric tubercles and a nar-

rowing of the zygomatic plate (Myers 1996). In laborato-

ry rats, individuals feeding on a soft diet suffered a 12%

loss of the mass of the skull and mandible, 4% decrease in

the length of the angular process and 1% to 2% decrease

in the dimensions of the cranial and facial skeleton, com-

pared to the individuals feeding on a normal diet (Moore

1965). Other studies performed on rats demonstrated that

maxillary breadth was markedly increased in the hard-di-

et reared individuals (Beecher & Corruccini 1981); that a

modification in food consistency altered the masticatory

muscle function and thus had an impact on craniofacial

morphology (Kiliaridis 2006); and that a harder diet in-

creased the growth of craniomandibular structures, espe-

cially those connected to the masticatory function (Abed

et al. 2007). Feeding on a harder diet also relatively aug-

mented the skull width of other mammals (Corruccini &

Bonn zoological Bulletin 68 (1): 97-124

Beecher 1984; Ciochon et al. 1997). In our studied pop-

ulations, the smallest individuals, representing Group I

populations (Kenitra and Merja Zerga) feed on various

crops but primarily on peanut crops, in the form of seeds

at the seedling stage, or the plant at the vegetative stage,

or the pods at maturity (Zyadi & Benazzou 1992). On the

opposite, the biggest individuals, representing Group III

(Guercif and Fritissa), feed mainly on wheat and other

cereals, in the form of plants and their hard grains. Our

explanations connecting the morphological differences

to the quantity and quality of food resources are hypo-

thetical but reasonable, even if we do not possess quanti-

fiable data on the food resources available to the studied

populations or the stomach content of the individuals.

Differentiation between our morphometric groups was

also partly due to the increase in size of the occipital part

of the skull, represented by an increase in the size of the

tympanic bulla, and therefore an increase in skull height

and braincase breadth. This hypertrophy is observed in

our populations with the increase of aridity, from Group I

with the smallest bullae, found in a subhumid bioclimate,

to Group III with the largest, found in an arid bioclimate.

The size increase of the bullae also seems to go along

with the decline of the population’s density, from Group

I of the Gharb region where G. campestris is prolific

and can pullulate (Zyadi & Benazzou 1992), to Group

II of the Oriental region where this species is much less

abundant. Bioclimate variability, through the change of

aridity levels, causes variations in vegetation cover and

the abundance of food resources. At first, fewer food re-

sources are available in the more arid habitats, and con-

sequently there is a lowering of the rodent population

density. Secondly, more arid habitats are characterized

by a lower vegetation cover and thus more open habitats.

Hypertrophy of the tympanic bullae, and consequently

enhanced auditory sensitivity, is considered as an adap-

tation to these conditions of arid habitats. Gerbillinae ro-

dents were distinguished to be one of the rodent families

most predisposed to the hypertrophy of their bullae (Pet-

ter 1961). A better hearing acuity facilitates the encounter

of the sexes and reproduction in low population densities

(Petter 1961) and can help in evading predators in these

more open habitats (Lay 1972; Webster & Webster 1975;

Alhajeri et al. 2015). Similar to our results, Colangelo

et al. (2010) found in Gerbilliscus that modifications in

the molar row and the tympanic bulla were related to cli-

mate.

Other possible factors influencing morphological vari-

ability are predation pressure and intra- and interspecific

competition (Yom-Tov & Geffen 2011). The different

degrees of predation pressure by various predators (birds

of prey, reptiles, small carnivores, rats, dogs) as well as

competition over resources with the other rodents that we

have captured in the studied localities (Mus musculus,

Mus spretus, Rattus rattus, Rattus norvegicus, Meriones

shawit), need to be tested by joint ecological studies.

©ZFMK

Biogeographic history of Gerbillus campestris 109

Phylogeographic distribution. Previously, Nicolas et al.

(2014) revealed a complex phylogeographic structuration

of Gerbillus campestris in the form of nine mitochondrial

lineages in Morocco, North Africa (Algeria and Tunisia)

and the western Sahel region (Mali and Niger). Accord-

ing to these authors, different factors contributed to this

structuration: isolation by distance; the climatic fluctua-

tions of the Pleistocene marked by warming and cooling

conditions, and the period of aridification at the end of

the Pleistocene; and the role of the Moulouya River and

Bou Regreg River as biogeographical barriers to genetic

flow. The new sampled specimens and populations in our

study give additional details concerning the distribution

of the various lineages (Fig. 1).

The supplementary individuals from Chrouda locali-

ty reinforce the presence of lineage 7 in this locality as

an allopatric lineage, in spite of the small geographic

distance between this locality and the Esperada locality

where exists the allopatric lineage 8, that forms a recent

monophyletic group with lineage 7 beyond the Rif moun-

tains in the extreme north of Morocco.

The added individuals from Aounate locality show that

lineage 1 is still the only lineage present in this locality,

even though this lineage is sympatric with lineage 3 in

almost all the localities surrounding Aounate locality, in

the north, east and south; between the Bou Regreg River

and Souss River.

In the allopatric lineage 6, the Merja Zerga locality and

the new locality of Kenitra are both located between the

northern side of the Sebou River, the largest river in Mo-

rocco, and the southern side of the Loukkos River. How-

ever, on the southern side of the Sebou River, in the Sidi

Boughaba locality just nearly 30 km from the Kenitra lo-

cality, we find the allopatric lineage 5. This suggests that

the Sebou River is a significant barrier to gene flow for

this species. Studies on different plant species have found

that the Sebou River was a major geographical limit to

gene flow (Hypochaeris salzmanniana DC. by Ortiz

et al. 2007; Chamaerops humilis L. by Garcia-Castafio

et al. 2014; Onopordum dissectum Murb. by Balao et al.

2017). The north-west of Morocco is surrounded by the

Rif and Middle Atlas Mountains and comprises several

long rivers (Bou Regreg, Sebou and Loukkos Rivers)

originating in these mountains and extending to the At-

lantic coast at different latitudes, creating large estuaries

and floodplains (Chichagov 2008), that probably acted as

barriers separating the populations of G. campestris and

promoting genetic isolation.

Lineage 4 was thought to be restricted to the eastern

bank of the Moulouya River in Morocco and extend-

ing to the north of Algeria and to the north of Tunisia

(Nicolas et al. 2014). However, thanks to our sampling

in the new localities of Guercif and Fritissa, we showed

that lineage 4 originating on the eastern bank of the

Moulouya has later spread towards the western bank of

the river. For another North African Gerbillinae rodent,

Bonn zoological Bulletin 68 (1): 97-124

Meriones shawii, Lalis et al. (2016), using both mtDNA

and nDNA, suggested to split it into two species with

an east-west structuration roughly around the Moulouya,

though samples were missing from the western side of

the Moulouya and from Northern Morocco. On the con-

trary, in the Greater Egyptian Jerboa, Jaculus orientalis,

one of the three identified cytb lineages is found both in

northern Morocco west of the Moulouya and in north-

ern Algeria (Ben Faleh et al. 2012b). Based on Beddek

et al. (2018), the structuration of mitochondrial diversity

of reptiles and amphibians species around the Moulouya,

between northern Morocco and north-western Algeria,

can be assembled into three groups: 1) the same lineage

exists in north-western Algeria and northern Morocco,

on both sides of the Moulouya (Zimon tangitanus, Tro-

gonophis wiegmanni, Podarcis vaucheri, Acanthodacty-

lus erythrurus), 11) north-western Algeria is inhabited by

the same lineage that is found in northern Morocco but

only on the eastern side the Moulouya (Natrix maura);

1i1) a continuity between Moroccan populations from the

two sides of the Moulouya, but with a separation from

the populations of north-western Algerian (Pelophylax

saharicus, Natrix maura). For these reptiles and amphib-

ians, the origin of the east-west phylogeographic break

around the Moulouya was attributed to the former marine

Rifian corridor that joined the Atlantic Ocean with the

Mediterranean Sea, east of the Rif mountains, between

8.0 Mya and 5.6 Mya (Barhoun & Bachiri 2008; Beddek

et al. 2018). Although part of this marine corridor was

located on the present Moulouya valley, this paleogeo-

graphic barrier cannot be applied, at least not directly, to

the case of G. campestris since the history of this species

has occurred starting from the middle Pleistocene (0.4-

0.5 Mya) (Tong 1989). Our results may lessen the role of

the Moulouya River and the valley encompassing it, in

preventing the spread of G. campestris towards western

Morocco at some point in the past, but the real geograph-

ic differentiation in this region 1s complex and should be

further explored. An alternative possible explanation for

the occurrence of lineage 4 on the western bank of the

Moulouya River is a human-mediated transport of indi-

viduals, which can represent a counterbalancing factor to

the genetic differentiation caused by geographic barriers.

Surprisingly, and although they originate from very

distant localities, the specimens from Libya and Egypt

belong to the Saharan lineage 2 along with the individ-

uals of Niger and Mali (Tessalit and Adrar des Iforas

localities), which makes lineage 2 the most widespread

lineage, being present in Mali and Niger in the south and

west; and Libya and Egypt in the north and east. Ger-

billus campestris has a large distribution and occupies

a wide variety of habitats, except in the Sahara Desert

where it has a sporadic distribution and is restricted to

rocky massifs. The Sahara Desert acts as a barrier to

genetic flow between north and south of the desert, for

species that are not adapted to extremely arid and san-

©ZFMK

110 Oussama Bouarakia et al.

dy habitats, like G. campestris. However, the presence

of lineage 2 from Mali and Niger in the south, to Egypt

and Libya in the north of the Desert can represent a relic

of a larger distribution during more favourable periods

of the Pleistocene. Paleoenvironmental data and climatic

reconstructions show that North Africa regularly shifted

from wetter to drier climatic conditions throughout the

Quaternary (deMenocal 2004; Schuster et al. 2006; Ta-

bel et al. 2016), leading to periodic contraction/expan-

sion of the Sahara Desert. Similarly, Nicolas et al. (2018)

showed through ecological niche modelling and genetic

data that presently unsuitable arid areas of the Saharan

Desert were suitable for the amphibian Bufotes bouleng-

eri throughout most of the Quaternary.

Another unexpected result concerns the specimen from

south central Mali (Sinkerma locality) representing the

added lineage 10. Even if it is geographically close to the

specimens from north-east Mali (Tessalit and Adrar des

Iforas localities), the Sinkerma individual is genetically

very distant from lineage 2 (2.6%) and seems to be ge-

netically closer to lineages from the north of Morocco. In

this case, the high genetic differentiation between the ad-

jacent populations eliminates the role of isolation-by-dis-

tance as a cause of genetic variability. The Sinkerma

locality is found south of the Niger River, the third lon-

gest river in Africa, compared to the two other localities

that are situated north of the river. Therefore, the Niger

River may have played a role as a barrier to gene flow

between lineages, similarly to what was suggested for

other rodents (Nicolas et al. 2008, 2009; Brouat et al.

2009; Dobigny et al. 2010; Hima et al. 2011; Colangelo

et al. 2013). Also, phylogeographic studies for different

rodents showed the existence of distinct phylogroups in

this region of West Sahel (Mastomys erythroleucus by

Brouat et al. 2009; Acomys chudeaui by Nicolas et al.

2009; Gerbillus henleyi by Bouarakia et al. 2018). To

explain the phylogeographic discontinuity for G. camp-

estris in Mali, more samples from this region are needed

to evaluate the combined actions of barriers and allopat-

ric differentiation or the effects of lineage sorting from

a highly polymorphic ancestral gene pool (Avise 2000).

Relationship between morphometric and molecular

variability. A crucial goal of this work is the confronta-

tion of the results of the morphometric study to those of

the molecular study. Previously, Baala (1995) showed in

five populations in Morocco, that the biometric variabil-

ity was not accompanied by allozymic variability based

on biochemical differentiation of proteins. However, in

our study, the morphometric results are congruent with

the genetic results and the geographic distribution. The

geographic structuring of the six populations of G. camp-

estris in Morocco has produced sufficient phenotypic dif-

ferentiation and high levels of sequence divergence that

allows their discrimination into four groups:

Bonn zoological Bulletin 68 (1): 97-124

— Group I of the morphometric study, composed of the

populations of Merja Zerga and Kenitra, corresponds

to the genetic lineage 6 and Is present in north-west-

ern Morocco.

— Group II, representing the population of Aounate,

corresponds to the genetic lineage | and is present in

central Morocco;

— Group III, composed of the populations of Guercif

and Fritissa, corresponds to genetic lineage 4 and is

present in north-eastern Morocco;

— Group IV representing the population of Chrouda,

corresponds to the genetic lineage 7 and is present in

the extreme north of Morocco.

A notable point is the clarification of the phylogeograph-

ic status of the populations of Guercif and Fritissa in

relation to the populations present either on the eastern

bank or the western bank of Moulouya River. This river

was considered to be a major barrier reducing dispersal

rates and thus hindering gene flow between the eastern

populations (Tunisia, Algeria and east of Morocco) and

the western ones (west of Morocco). Yet, both the mor-

phological and genetic analyses showed that the popula-

tions of Guercif (west of Moulouya) and Fritissa (east of

Moulouya) belong to the same group.

Although we did not determine the specific relationship

between morphological and genetic variation, we were

able nonetheless to demonstrate for G. campestris its high

plasticity, its capacity of adaptation and the micro-evolu-

tionary processes at work. In summary, G. campestris 1s a

widely distributed species that can be divided in Moroc-

co into different assemblages of populations that experi-

enced variable degrees of geographic isolation and adapt-

ed to different local environmental conditions, resulting

in a strong morphological differentiation and genetic

structuration. But systematically speaking, the question

to be asked is whether we should see this variability as

a progressive gradient or must divide the species into

different diverging subspecies. Several subspecies were

previously described based on geographic variations of

pelage coloration, external size and/or skull characters

(Setzer 1958; Petter & Saint-Girons 1965; Ranck 1968;

Jordan et al. 1974; Osborn & Helmy 1980). Based only

on their geographic distribution, we may attribute some

populations used in the current study to these different

subspecies. For example, the individuals from Tunisia

and Algeria belonging to lineage 4 may be attributed

to the subspecies G. campestris campestris Levaillant,

1857. However, in other cases, specimens from the same

lineage fall within different subspecies: the individuals

from Egypt fit with G. campestris haymani Setzer, 1958;

while the one from Libya fits with G. campestris dod-

soni Thomas, 1902. Furthermore, Petter & Saint-Girons

(1965) suggested that only two subspecies are found in

Morocco and they were identified based merely on color-

ation criteria (G. c. campestris and G. c. dodsoni), which

©ZFMK

Biogeographic history of Gerbillus campestris 111

does not correspond to the complex phylogeographic

structuration revealed in this country. Gerbillus hilda

Thomas, 1918, first described as a new species in Mo-

rocco on the northern Atlantic coast (122 km south-west

of Tangiers), approached the dimensions of G. campes-

tris externally and cranially but was characterized by a

small band of hairs on the hind feet soles (Thomas 1918).

Specimens captured 17 km south-west of Rabat and de-

scribed as G. hilda by Schlitter & Setzer (1972) appear to

be closer in body and skull dimensions to the G. camp-

estris individuals of Group I. G. hilda was later regarded

as a subspecies of G. campestris (Petter 1975 and Corbet

1978, as cited in Lay 1983), while Lay (1983) viewed

it as a subspecies of G. nanus. If we want to reconsider

the taxonomy of Gerbillus campestris on an intraspecific

level, genetic variability and morphological character-

istics must be further identified across the range of the

species.

CONCLUSIONS

Supplementary sampling from the whole distribution

area of Gerbillus campestris should be carried out, and

different markers must be used in the genetic study to

better explore the genetic diversity of this species in the

Sahara Desert (Mali, Niger) and in Algeria. In addition,

the study of morphological variability should be refined

in order to include specimens from all the geographic

range of the species and all the genetic lineages. Clas-

sical morphometry is not sufficient and craniomandibu-

lar variation should be further studied using geometric

morphometric methods. Further research should focus on

how morphological and genetic variations could be relat-

ed to the adaptation capacity of this rodent to anthropized

habitats, increasing its pullulation capacity and the dam-

age it can cause to agricultural crops.

Acknowledgements. The present study was supported by the

Laboratory ‘Biodiversity, Ecology and Genome’ of the Faculty

of Sciences of Rabat, by the UMR7205 ISYEB of the ‘Muse-

um National d’ Histoire Naturelle’ of Paris and by the CNRS-

CNRST corporation project (2014-2015): ‘Caractérisation de la

diversité génétique des rongeurs Gerbillidae du Maroc, de leur

distribution et de leurs ectoparasites: Implications pour la santé

et la conservation’. Molecular analyses were supported by the

‘Service de Systématique Moléculaire’ of the ‘Museum Nation-

al d’ Histoire Naturelle’ of Paris (UMS 2700, Paris, France) and

the ‘Centre National pour la Recherche Scientifique et Tech-

nique’ of Morocco. We also thank S. Liefrid, A. Rihane, L. Ti-

farouine and Z. Sahi for helping in the collection of specimens.

REFERENCES

Abed GS, Buschang PH, Taylor R, Hinton RJ (2007) Matura-

tional and functional related differences in rat craniofacial

growth. Archive of Oral Biology 52: 1018-1025

Bonn zoological Bulletin 68 (1): 97-124

Abiadh A, Chetoui M, Lamine-Cheniti T, Capanna E, Colange-

lo P (2010) Molecular phylogenetics of the genus Gerbillus

(Rodentia, Gerbillinae): Implications for systematics, taxon-

omy and chromosomal evolution. Molecular Phylogenetics

and Evolution 56: 513-518

Addinsoft S.A.R.L. (2012) XLSTAT 2016: Leading data anal-

ysis and statistical solution for Microsoft Excel. Addinsoft

SRL

Akaike H (1973) Information theory and an extension of the

maximum likelihood principle. In: Petrov BN, Csaki F (eds)

Proceedings of the Second International Symposium on In-

formation Theory, Akadémiai Kiado, Budapest, pp. 267-281

Alhajeri BH, Hunt OJ, Steppan SJ (2015) Molecular systemat-

ics of gerbils and deomyines (Rodentia: Gerbillinae, Deomy-

inae) and a test of desert adaptation in the tympanic bulla.

Journal of Zoological Systematics and Evolutionary Re-

search 53: 312-330

Alvarez Y, Mateo JA, Andreu AC, Diaz-Paniagua C, Diez A,

Bautista JM (2000) Mitochondrial DNA haplotyping of 7es-

tudo graeca on both continental sides of the Straits of Gibral-

tar. Journal of Heredity 91: 39-41

Arano G, Llorente GA, Montori A, Busckley D, Herrero P

(1998) Diversification in north-west African water frogs: mo-

lecular and morphological evidence. Herpetological Journal

8: 57-64

Aulagnier S, Thévenot M (1986) Catalogue des mammiferes

sauvages du Maroc. Travaux de |’Institut scientifique, Série

Zoologie 41: 1-164

Aulagnier S, Cuzin F, Thévenot M (2017) Mammifeéres sau-

vages du Maroc : Peuplement, répartition, écologie. Société

Frangaise pour |’ Etude et la Protection des Mammiferes

Avise JC (2000) Phylogeography: the history and formation of

species. Harvard University Press, Cambridge, Massachu-

setts

Baala L (1995) Etude de la variabilité morphologique et

génétique chez Gerbillus campestris Levaillant, 1857 (Ron-

geurs, Gerbillidés) au Maroc. Mémoire D.E.S., Univ. Mo-

hammed V, Rabat, Morocco

Balao F, Navarro-Sampedro L, Berjano R, Garcia-Castafio

JL, Casimiro-Soriguer R, Talavera M, Talavera S, Terrab A

(2017) Riverine speciation and long dispersal colonization in

the Ibero-African Onopordum dissectum complex (Asterace-

ae). Botanical Journal of the Linnean Society 183: 600-615

Bandelt HJ, Forster P, Rohl A (1999) Median-joining networks

for inferring intraspecific phylogenies. Molecular Biology

and Evolution 16: 37—48

Barhoun N, Bachiri TN (2008) Evénements biostratigraphiques

et environnementaux enregistrés dans le corridor sud rifain

(Maroc septentrional) au Miocene supérieur avant la crise de

salinité messinienne. Geodiversitas 30(1): 21-40

Beddek M, Zenboudji-Beddek S, Geniez P, Fathalla R, Sou-

rouille P, Arnal V, Dellaoui B, Koudache F, Telailia S, Peyre

O, Crochet PA (2018) Comparative phylogeography of am-

phibians and reptiles in Algeria suggests common causes for

the east-west phylogeographic breaks in the Maghreb. PLOS

ONE 13(8): e0201218

Beecher RM, Corruccini RS (1981) Effects of dietary consis-

tency on craniofacial and occlusal development in the rat.

Angle Orthodontist 51: 61-69

Benazzou T, Zyadi F (1990) Présence d’une variabilité

biométrique chez Gerbillus campestris au Maroc (rongeurs,

gerbillides). Mammalia 54: 271-279

Ben Faleh A, Annabi A, Said K (2012a) Morphometric varia-

tion in black rat Rattus rattus (Rodentia: Muridae) from Tu-

nisia. Acta Zoologica Bulgarica 64: 381-387

©ZFMK

112 Oussama Bouarakia et al.

Ben Faleh AR, Granjon L, Tatard C, Othmen AB, Said K, Cos-

son JF (2012b) Phylogeography of the Greater Egyptian Jer-

boa (Jaculus orientalis) (Rodentia: Dipodidae) in Mediterra-

nean North Africa. Journal of Zoology 286: 208-220

Bouarakia O, Denys C, Nicolas V, Tifarouine L, Benazzou T,

Benhoussa A (2018) Notes on the distribution and phyloge-

ography of two rare small Gerbillinae (Rodentia, Muridae) in

Morocco: Gerbillus simoni and Gerbillus henleyi. Comptes

Rendus Biologies 341(7-8): 398-409

Breno M, Leirs H, Van Dongen S (2011) Traditional and geo-

metric morphometrics for studying skull morphology during

growth in Mastomys natalensis (Rodentia: Muridae). Journal

of Mammalogy 92(6): 1395-1406

Brouat C, Tatard C, Ba K, Cosson JF, Dobigny G, Fichet-Calvet

E, Granjon L, Lecompte E, Loiseau A, Mouline K, Piry S,

Duplantier JM (2009) Phylogeography of the Guinea mul-

timammate mouse (Mastomys erythroleucus). a case study

for Sahelian species in West Africa. Journal of Biogeography

36(12): 2237-2250

Chevret P, Dobigny G (2005) Systematics and evolution of the

subfamily Gerbillinae (Mammalia, Rodentia, Muridae). Mo-

lecular Phylogenetics and Evolution 35(3): 674-688

Chevret P, Ndiaye A, Dobigny G, Granjon L (2014) New mo-

lecular evidence for Gerbillus: phylogenetics relationships

among Gerbillus (Rodentia: Gerbillinae) inferred by mito-

chondrial and nuclear genes. Unpublished.

Chichagov VP (2008) The plains at the periphery of the Atlas

Mountains: the genesis, relief, current desertification. Geog-

raphy and Natural Resources 29: 292—296

Ciochon RL, Nisbett RA, Corruccini RS (1997) Dietary con-

sistency and craniofacial development related to masticatory

function in minipigs. Journal of Craniofacial Genetics and

Developmental Biology 17: 96-102

Colangelo P, Castiglia R, Franchini P, Solano E (2010) Pattern

of shape variation in the eastern African gerbils of the genus

Gerbilliscus (Rodentia, muridae): Environmental correla-

tions and implication for taxonomy and systematics. Mam-

malian Biology 75: 302-310

Colangelo P, Verheyen E, Leirs H, Tatard C, Denys C, Dobigny

G, Duplantier JM, Brouat C Granjon L, Lecompte E (2013) A

mitochondrial phylogeographic scenario for the most wide-

spread African rodent, Mastomys natalensis. Biological Jour-

nal of the Linnean Society 108: 901-916

Corruccini RS, Beecher R (1984) Occlusofacial morphologi-

cal integration lowered in baboons raised on soft diet. Jour-

nal of Craniofacial Genetics and Developmental Biology 4:

135-142

Csanady A, Mogansky L (2018) Skull morphometry and

sexual size dimorphism in Mus musculus from Slovakia.

North-Western Journal of Zoology 14(1): 102—106

Darriba D, Taboada GL, Doallo R, Posada D (2012) Jmodelt-

est2: More models, new heuristics and parallel computing.

Nature Methods 9(8): 772

Denys C, Taylor P, Aplin K (2017) Subfamily Deomyinae, Ger-

billinae, Leimacomyinae, Lophiomyinae species accounts.

In: Wilson DE, Lacher Jr TE, Mittermeier RA (eds) Hand-

book of the Mammals of the World, Vol. 7, Rodents H, Lynx

Edicions, Barcelona, 2017, pp. 598-650

Dobigny G, Moulin S, Cornette R, Gautun JC (2001). Rodents

from Adrar des Iforas, Mali. Chromosomal data. Mammalia,

65: 215-220

Dobigny G, Nomao A, Gautun JC (2002) A cytotaxonomic

survey of rodents from Niger: implications for systematics,

biodiversity and biogeography. Mammalia 66(4): 495-523

Bonn zoological Bulletin 68 (1): 97-124

Dobigny G, Catalan J, Gauthier P, O’Brien PCM, Brouat C, Ba

K, Tatard C, Ferguson-Smith M, Duplantier JM, Granjon L,

Britton-Davidian J (2010) Geographic patterns of inversion

polymorphisms in a wild African rodent, Mastomys erythro-

leucus. Heredity 104: 378-386

Ducroz JF, Volobouev V, Granjon L (2001) An assessment of

the systematics of Arvicanthine rodents using mitochondrial

DNA sequences: Evolutionary and biogeographical implica-

tions. Journal of Mammalian Evolution 8: 173-206

Escoriza D, Comas MM, Donaire D, Carranza S (2006) Redis-

covery of Salamandra algira Bedriaga, 1883 from the Beni

Snassen massif (Morocco) and phylogenetic relationships of

North African Salamandra. Amphibia-Reptilia 27: 448-455

Garcia-Castafio JL, Terrab A, Ortiz MA, Stuessy TF, Talavera

S (2014) Patterns of phylogeography and vicariance of Cha-

maerops humilis L. (Palmae). Turkish Journal of Botany 38:

1132-1146

Giban J, Haltebourg M (1965) Le probleme de la Mérione de

shaw au Maroc. Comptes Rendus du Congres sur la Protec-

tion des Cultures tropicales, Marseille, 587-588

Granjon L (2016) Gerbillus campestris. The IUCN Red List of

Threatened Species 2016: e.T45088A22465830. http://dx.do1.

org/10.2305/IUCN.UK.2016-3.RLTS.T45088A22465830.en

Gu X, Fu YX, Li WH (1995) Maximum likelihood estimation

of the heterogeneity of substitution rate among nucleotide

sites. Molecular Biology and Evolution 12: 546—557

Hall TA (1999) BioEdit: a user-friendly biological sequence

alignment editor and analysis program for Windows 95/98/

NT. Nucleic Acid Symposium Series 41: 95—98

Happold DCD (1967) Gerbillus (Dipodillus) campestris (Ger-

billinae, Rodentia) from the Sudan. Journal of Natural His-

tory 1:3, 315-317

Happold DCD (2013) Mammals of Africa, Vol. III, Blooms-

bury Publ., London

Hima K, Thiam M, Catalan J, Gauthier P, Duplantier JM, Piry

S, Sembene M, Britton-Davidian J, Granjon L, Dobigny G

(2011) Extensive Robertsonian polymorphism in the African

rodent Gerbillus nigeriae: geographic aspects and meiotic

data. Journal of Zoology 284: 276-285

Jordan RG, Davis BL, Baccar H (1974) Karyotypic and mor-

phometric studies of Tunisian Gerbillus. Mammalia 38:

667-680

Khalifa MA, Younes MI, Ghazy A (2018) Cytochrome b shows

signs of adaptive protein evolution in Gerbillus species from

Egypt. The Journal of Basic and Applied Zoology 79:1

Kiliaridis S (2006) The importance of masticatory muscle func-

tion in dentofacial growth. Seminars in Orthodontics 12:

110-119

Kimura M (1980) A simple method for estimating evolution-

ary rate of base substitutions through comparative studies of

nucleotide sequences. Journal of Molecular Evolution 16:

111-120

Kowalski K, Rzebik-Kowalska B (1991) Mammals of Algeria.

Polish Academy of Sciences, Institute of Systematics of Evo-

lution of Animals, Wrodow, Poland

Lalis A, Baylac M, Cosson JF, Makundi RH, Machang’u RS,

Denys C (2009) Cranial morphometric and fine scale genetic

variability of two adjacent Mastomys natalensis (Rodentia:

Muridae) populations. Acta Theriologica 542: 171-181

Lalis A, Leblois R, Stoetzel E, Benazzou T, Souttou K, Denys

C, Nicolas V (2016) Phylogeography and demographic histo-

ry of Shaw’s Jird (Meriones shawii complex) in North Africa.

Biological Journal of the Linnean Society 118(2): 262-279

©ZFMK

Biogeographic history of Gerbillus campestris 113

Lay DM (1972) The anatomy, physiology, functional signifi-

cance and evolution of specialized hearing organs of gerbill-

ine rodents. Journal of Morphology 138: 41-120

Lay DM, Agerson K, Nadler CF (1975) Chromosomes of some

species of Gerbillus (Mammalia, Rodentia). Zeitschrift fir

Saugetierkunde 40: 141-150

Lay DM (1983) Taxonomy of the genus Gerbillus (Roden-

tia: Gerbillinae) with comments on the applications of ge-

neric and subgeneric names and an annoted list of species.

Zeitschrift fir Satigetierkunde 48: 329-354

Matthey R (1952) Chromosomes de Muridae (II). Experientia

8: 389-390

deMenocal P (2004) African climate change and faunal evo-

lution during the Pliocene-Pleistocene. Earth and Planetary

Science Letters 220: 3-24

Miller JP, German RZ (1999) Protein malnutrition affects the

growth trajectories of the craniofacial skeleton in rats. Jour-

nal of Nutrition 129: 2061—2069

Mokhtari N, Mrabet R, Lebailly P, Bock L (2013) Spatialisa-

tion des bioclimats, de l’aridité et des étages de végétation

du Maroc. Revue Marocaine des Sciences Agronomiques et

Vétérinaires, volume 2, pp. 50-66

Moore WJ (1965) Masticatory function and skull growth. Jour-

nal of Zoology 146: 123-131

Musser GC, Carleton MD (2005) Superfamily Muroidea. In:

Wilson DE, Reeder DAM (eds), Third edition, Mammal spe-

cies of the world: A taxonomic and geographic reference,

Vol. 2, John Hopkins University Press, Baltimore, MD, USA,

pp. 894-1531

Myers P, Lundrigan BL, Gillespie BW, Zelditch ML (1996)

Phenotypic plasticity in skull and dental morphology in the

prairie deer mouse (Peromyscus maniculatus bairdii). Jour-

nal of Morphology 229: 229-237

Ndiaye A, Ba K, Aniskin V, Benazzou T, Chevret P, Konecny

A, Sembéne M, Tatard C, Kergoat GJ, Granjon L (2012) Evo-

lutionary systematics and biogeography of endemic gerbils

(Rodentia, Muridae) from Morocco: an integrative approach.

Zoologica Scripta 41: 11-28

Ndiaye A, Shanas U, Chevret P, Granjon L (2013a) Molecular

variation and chromosomal stability within Gerbillus nanus

(Rodentia, Gerbillinae): taxonomic and biogeographic impli-

cations. Mammalia 77(1): 105-111

Ndiaye A, Chevret P, Dobigny G, Granjon L (2013b) Molec-

ular phylogeny of Gerbillus (Rodentia: Gerbillinae) using

mitochondrial and nuclear genes: taxonomic implications.

11th International Mammalogical Congress (IMC), Belfast,

Ireland

Ndiaye A, Chevret P, Dobigny G, Granjon L (2016) Evolution-

ary systematics and biogeography of the arid habitat-adapt-

ed rodent genus Gerbillus (Rodentia, Muridae): a mostly

Plio-Pleistocene African history. Journal of Zoological Sys-

tematics and Evolutionary Research 54: 299-317

Nicolas V, Bryja J, Akpatou B, Konecny A, Lecompte E, Colyn

M, Lalis A, Couloux A, Denys C, Granjon L (2008) Compar-

ative phylogeography of two sibling species of forest-dwell-

ing rodent (Praomys rostratus and P. tullbergi) in West Afri-

ca: different reactions to past forest fragmentation. Molecular

Ecology 17: 5118-5134

Nicolas V, Granjon L, Duplantier JM, Cruaud C, Dobigny G

(2009) Phylogeography of spiny mice (genus Acomys, Ro-

dentia: Muridae), from the southwestern margin of the Sa-

hara, with taxonomic implications. Biological Journal of the

Linnean Society 98: 29-46

Nicolas V, Ndiaye A, Benazzou T, Souttou K, Delapre A, Cou-

loux A, Denys C (2014) Phylogeography of the North Af-

Bonn zoological Bulletin 68 (1): 97-124

rican Dipodil (Rodentia: Muridae) based on Cytochrome-b

sequences. Journal of Mammalogy 95(2): 241-253

Nicolas V, Mataame A, Crochet P, Geniez P, Ohler A (2015)

Phylogeographic patterns in North African water frog Pe-

lophylax saharicus (Anura: Ranidae). Journal of Zoological

Systematics and Evolutionary Research 53: 239-248

Nicolas V, Mataame A, Crochet PA, Geniez P, Fahd S, Ohler A

(2018) Phylogeography and ecological niche modeling un-

ravel the evolutionary history of the African green toad, Bu-

fotes boulengeri boulengeri (Amphibia: Bufonidae), through

the Quaternary. Journal of Zoological Systematics and Evo-

lutionary Research 56:102-116

Ortiz MA, Tremetsberger K, Talavera S, Stuessy TE, Garcia-

Castafio JL (2007) Population structure of Hypochaeris

salzmanniana DC. (Asteraceae), an endemic species to the

Atlantic coast on both sides of the Strait of Gibraltar, in re-

lation to Quaternary sea level changes. Molecular Ecology

16: 541-552

Osborn DJ, Helmy I (1980) The contemporary land mammals

of Egypt (including Sinai). Fieldiana Zoology new series 5:

1-428

Ouzaouit A (1980) La situation des rongeurs au Maroc. In:

Journées nationales sur les Rongeurs nuisibles, Rabat 1-3

December 1980. Ministere de I’ Agriculture et de la Réforme

agraire, Rabat, Morocco, 5p

Pankakoski E, Vaisanen RA, Nurmi K (1987) Variability of

muskrat skulls: measurement error, environmental modifica-

tion and size allometry. Systematic Zoology 36: 35-51

Patton JJ, Brylski PV (1987) Pocket gophers in alfalfa fields:

causes and consequences of habitat-related body size varia-

tion. The American Naturalist 130: 493-506

Petter F (1961) Répartition géographique et écologique des

rongeurs désertiques (du Sahara occidental a |’ Iran oriental).

Mammalia 25(special number): 1-219

Petter F, Saint-Girons MC (1965) Les rongeurs du Maroc.

Travaux de I’ Institut Scientifique Chérifien, Rabat, Série Zo-

ologie 31: 44-47

Ramirez Rozzi FV, Gonzalez-José R, Pucciarelli HM (2005)

Cranial growth in normal and low-protein-fed Saimiri: an en-

vironmental heterochrony. Journal of Human Evolution 49:

515-535

Ranck G (1968) The rodents of Libya: Taxonomy, ecology and

zoogeographical relationships. Bulletin of U.S. National Mu-

seum of Natural History 275, 264 pp

Reichling TD, German RZ (2000) Bones, muscles and viscer-

al organs of protein-malnourished rats (Rattus norvegicus)

grow more slowly but for longer durations to reach normal

final size. Journal of Nutrition 130: 2326-2332

Renaud S, Michaux J, Schmidt DN, Aguilar JP, Mein P, Auffray

JC (2005) Morphological evolution, ecological diversifica-

tion and climate change in rodents. Proceedings of the Royal

Society B: Biological Sciences 272: 609-617

Samuels JX (2009) Cranial morphology and dietary habits of

rodents. Zoological Journal of the Linnean Society 156(4):

864-888

Schlitter DA, Setzer HW (1972) A new species of short-tailed

gerbil (Dipodillus) from Morocco (Mammalia: Cricetidae:

Gerbillinae). Proceedings of The Biological Society of

Washington 84: 385-391

Schuster M, Duringer P, Ghienne JF, Vignaud P, Mackaye HT,

Likius A, Brunet M (2006) The age of the Sahara Desert.

Science 311: 821

Schwan TG, Anderson JM, Lopez JE, Fischer RJ, Raffel SJ,

McCoy BN, Safronetz D, Sogoba N, Maiga O, Traore SF

(2012) Endemic Foci of the Tick-Borne Relapsing Fever

©ZFMK

114 Oussama Bouarakia et al.

Spirochete Borrelia crocidurae in Mali, West Africa, and

the Potential for Human Infection. PLoS Neglected Tropical

Diseases 6(11): e1924

Setzer HW (1958) The gerbils of Egypt. Journal of the Egyptian

Public Health Association 33(6): 205—227

Tabel J, Khater C, Rhoujjati A, Dezileau L, Bouimetarhan I,

Carre M, Vidal L, Benkaddour A, Nourelbait M, Cheddadi R

(2016) Environmental changes over the past 25 000 years in

the southern Middle Atlas, Morocco. Journal of Quaternary

Science 31: 93-102

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013)

MEGAG6: Molecular Evolutionary Genetics Analysis version

6.0. Molecular Biology and Evolution 30: 2725-2729

Thomas O (1918) New Forms of Dendromus, Dipodillus, and

Gerbillus. Annals and Magazine of Natural History 9, vol.

2(7): 59-64

Tong H (1989) Origine et évolution des Gerbillidae (Mamma-

lia, Rodentia) en Afrique du Nord. Mémoires de la Société

Géologique de France 155: 1-120

Bonn zoological Bulletin 68 (1): 97-124

Wassif K, Lutfy RG, Wassif S (1969) Morphological, cytologi-

cal, and taxonomic studies of the rodent genera Gerbillus and

Dipodillus from Egypt. Proceedings of the Egyptian Acade-

my of Sciences XXII: 77-96

Webster DB, Webster M (1975) Auditory systems of Heteromy-

idae: functional morphology and evolution of the middle ear.

Journal of Morphology 146: 343-376

Yom-Tov Y, Geffen E (2011) Recent spatial and temporal

changes in body size of terrestrial vertebrates: probable caus-

es and pitfalls. Biological Reviews 86: 531-541

Zyadi F (1989) Etude de la dynamique d’une population de

Gerbillus campestris (Rodentia, Gerbillidae) de la plaine du

Rharb. These 3eme Cycle, Univ. Mohammed V, Faculté des

Sciences de Rabat, 130p

Zyadi F, Benazzou T (1992) Dynamique de population de

Gerbillus campestris (Rodentia, Gerbillidae) dans la plaine

du Gharb, Maroc, Revue d’Ecologie la Terre et la Vie, 473:

245-258

©ZFMK

115

Biogeographic history of Gerbillus campestris

JOM STULL

SOM STULL

SION STULL

JOM STULL

SOM STULL

SIOM STULL

SION STULL

SION SIYL

SOM STULL

SION STULL

JOM STULL

SOM STULL

SIOM STULL

SION STULL

JOM STULL

SOM STULL

SIOM SIYL

SOM STULL

SIOM STULL

SION STULL

SOM STULL

IIUIAIFIY

caLAvlaVAN-Ysa

CULAVIAVAN- ASA

TY LA-vIaVAN- asa

CLLNV-VIAVAN- SA

CILNV-VIAVA-aSA

ILLNV-rldavVA- asa

OILLNV-VIaVA-aSa

6LNV-VldVAN-adSA

8.INV-TIAVA-aSA

LINV-VIYVAN- SA

9LINV-VLYVA-aSA

SINV-VIAVAN-YSA

VINV-VIYVAN- SA

CLINV-VlYVAC-aSaA

CLNV-VIdVAN- SA

LINV-7VlavVA- asa

C810

O81)

891)

OS1O

SvlO

CVO

6Cc1O

9ITO

SITIO

Ell

oN JOqon0,

C9LCSPAN

CIOTCSVAIN

I9TCSPAIN

ESICSVAWN

CSICSVAIN

IST cSv AN

OST CST AN

6vV I cCSV AN

O9TCSTAIN

8VIcSVAIN

LvVIcSVAWN

OVI CST AN

6ST CSV AN

SvICSTAIN

bpricsSvAN

eVICSVAWN

CVICSVAIN

IVI csv aN

OVI CST AN

6E1CSVAIN

8E1CSTAIN

LEICSVAN

9ETCSVAIN

SEICSVAN

VEICSVAN

CElLCSVAWN

oN YUBA UIE)

UIA

LNV

INV

LNV

INV

LNV

INV

LNV

UHO

9pod ApIPBIOT

eIuoy

eluoy

elluoy

oyeunoV

epnoly)

epnolyy)

epnoly)

epnolyy)

epnolyg

epnolyy)

Ay]eIO'T

009010)

0D9010/

099010)

0D9010/\

0D9010/

009010)

099010/\

009010)

0D9010/\

009010)

0D9010/\

0D0010/

0D9010/

0D9010/\

099010)

009010)

0d9010/

0D9010/

0D9010/\

AQUNO)

cuLy

(eal BI

Talo

€ILLNV

CILLNV

ILLNV

OLLNV

6.LNV

8.LINV

LINV

9INV

SLINV

VINV

€LNV

CLNV

LINV

OLYHO

6aHO

8auHO

LYHO

JUNHO

SuHO

VaHO

€adHO

CuHO

TYHO

apod *v0dS

SLAJSAAUDI “DH

SLJSAAGUDI “DH

SLAJSAGUDI “DH

SLJSAAUDI “DH

SLAJSAAUDI “DH

SLJSAAUDI “DH

SLIJSAAUDI “DH

SLJSAAUDI “DH

SLJSAAGUDI “DH

SLISAAUDI “DH

SLAJSAAUDI “DH

SLJSAACUDI “DH

SLJSAAUDI “DH

SLJSAACUDI “DH

SLAJSAAUDI “DH

SLISAGUDI “DH

SLAJSAAUDI “DH

SLISACUDI “DH

SLAJSAAUDI “DH

SLAJSAAGUDI “DH

SLAJSAAUDI “DH

soieds

‘QOUdIOFOI puB JOQUINU JOYONOA “Ioquinu yURqUdy “UISIIO d1ydeIs0NS Id} YIM ‘Apnys d1}9Ud8 SY} UI posn sudUTdads Jo JSI'T

T XIGNAddV

©ZFMK

Bonn zoological Bulletin 68 (1): 97-124

Oussama Bouarakia et al.

116

JOM STULL

JOM SIU

SOM STULL

SIOM STULL

SOM STULL

JOM SIYL

SION STULL

SOM STULL

JOM STULL

SION STULL

SOM STULL

JOM STULL

SION STULL

JOM STULL

SION STULL

JOM STULL

SION STULL

SOM STULL

SIOM STULL

SION STULL

YOM STY,L

IIUIAIFIY

LZW-VIAVA- ASA

9ZW-VIAVA- ASA

SZW-VIAVW- ASA

VZW-VIAVA- ASA

EZW-VIAVN- USA

CZW-VIAVA- ASA

[IZW-VIUVAW- ASA

VOALA-S LAVIN ASA

ECULA-S LUVNW- ASA

CCULA-S TAVIN- USA

[cal a-S PAVIA aSA

OCALA-S LAVIN ASA

6laLA-STAVIAN-aSA

8la.LaA-sS TAVIA-aSA

LIAL A-vldVA- asa

STA LAVAS

Cla La-rldaVvVA- asa

VIALA vlad VA-aSaA

ClaLa-vlavW-asa

ClUaLA Vlad VA-aSaA

[Tabor laVvW-adsa

OlLAELA-VlaVIA-aSA

6aLA-VIaVN-aSA

8ULAVIAVAN- ASA

LYLA-VIAVW- ASA

9A LA-VIAVAN- ASA

SULA-VIaVAN- ASA

VALA-VIAVW- ASA

oN Foqono,

l6lcsv an

O6IcST AN

681 CSV AN

881 CSV AN

L81cSVAWN

981 CST AN

S8ICSTAIN

P8I CSV AN

E8lLCSVAWN

C8ICSTAIN

[8IcSv AN

O8TcSVAIN

6LI CSV AN

8LICSV AWN

LLICSVAWN

9LICSV AN

SLICSVAN

DLICSVAWN

ELICSVAWN

CLICSVAIN

ILICSVAIN

OLICSV AN

691 CST AN

891 CSTAIN

LOICSVAIN

99T CST AN

S9ICSTAIN

DIT CSVAIN

oN WUBI!)

UIA

9pod ApITBIOT

esI97 BLD

eSI97 BID

eID yy

eIUDy

eID y

eID yy

eID

eID yy

eIUDy

eID yy

eID y

eID

eID y

eID

eID yy

eIUDy

eID yy

eIIUDy

eID yy

eID y

Ay]VIOT

Od90IO/

Od9010/

Od90IO/

Od9010/

OdD0IO/

Od90IO/

Od901O/

Od90IO/

Od90I0/

Od901O/

Od9010/

Od901O/

OdD0IO/

Od9010/

Od90IO/

Od901O/

Od90IO/

Od901O/

OdD0IO/

Od901O/

AQUNO)D

LZW

SZW

VZIN

eZW

CZIN

IZIN

pVouLya

ceca Ly

CCULA

IcuLo

OcuLy

6laLa

8laLa

LIALY

9TaLa

SlTaLy

VIaLa

claLy

ClaLa

Pi TST

OLYLY

6a Ly

sadly

Lalo

9a LY

Sale

Vay

9pod “90dS

(ponunuos) "| XIGNAddV

SLAJSAAUDI “DH

SLJSACUDI “DH

SLJSAAUDI “DH

SLAJSAAUDI “DH

SLJSAAUDI “DH

SLAJSAAUDI “DH

SLIJSAAUDI “DH

SLAJSAAUDI “DH

SLJSAAUDI “DH

SLAJSAAUDI “DH

SLISAGUDI “DH

SLJSAAUDI “DH

SLAJSAAUDI “DH

SLJSAGUDI “DH

SLISAAUDI “DH

SLJSAAUDI “LH

SLJSACUDI “DH

SLAJSAAUDI “DH

SLJSAAUDI “DH

SLAJSAGUDI “DH

SLAJSACUDI “DH

SLJSAAUDI “DH

soieds

©ZFMK

Bonn zoological Bulletin 68 (1): 97-124

117

Biogeographic history of Gerbillus campestris

SOM STYL

SOM STULL

JOM STULL

SION SIYL

SOM STULL

JOM SIYL

SION STULL

SOM STULL

SION SIYL

SION SIUL

SOM STULL

SIOM STULL

SION STULL

SOM STULL

SOM SIYL

SION STULL

SOM SIYL

SION STULL

SOM STULL

SION STULL

JOM STULL

JOM SIYL

SOM STULL

JOM STULL

SIOM STULL

YOM STYL

IIUIAIFIY

SLYA-S PUVA ASA

Plats TAVIA-ASA

€Ladd-slTaVW-aSA

CLYA-S TUVIN-ASA

LLasd-S Pav aSA

9ADD-STUVIAC- ASA

SHOD-STUVW- ASA

VADD-S TUVIA- ASA

CHOD-VIAVIA- ASA

[HOD-VIAVAC ASA

SCZIN-S LUVIN ASA

VCZIN-S LUVW- ASA

ECZIN-STAVIAN-USA

CCZIN-S LUVIN ASA

ICZIN-S LUVIN ASA

OCZN-VIAVW- ASA

6LZN-VIAVW- ASA

8IZIN-VIAVAN- ASA

LIZW-VIAVW- ASA

9IZN-VIAVW- ASA

SIZINN-VIAVAN- ASA

VIZN-VIAVW- ASA

CIZIN-VIAVAN- ASA

CIZN-VIAVAN- ASA

LIZIN-VIAVIAN-USA

OLZN-VIAVW- ASA

6ZIW-VIAVA- SA

8ZW-VIAVW- USA

oN Foqono,

[el csvan

OE CSVAIN

6c I CSV AWN

[1 ccspoin

OL ccSV AN

8S 1 CST AN

LSICSVAWN

9ST CSVAIN

SSICSTAIN

DS ICSVAN

60ccS TAIN

80CCSTAIN

LOCCSV AN

90CCST AN

SOcCST IN

VOCCSV AN

COCCSVAWN

COCCSV AN

LOccSV AN

OOCcCSV AN

661 CSV AN

861 cSTAIN

LOICSVAN

961 CST AN

S6ICSVAIN

VOI CcSVAWN

COlCSVAW

COICSV AN

oN WUBE UI)

ZINN

9pod APITBIOT

ess]

BSS]

jrorony

eSIO7 BID

eSI97 BID

esIO7 BID

esI97 BID

eSI97 BID

esI97 BID

eSIO7 BID

esI97 BID

esIa7 BID

esI97 BID

eSI97 BID

esI97 BID

eSI97 BID

Ay]VIOT

Od90IO/

Od901O/

OdD0IO/

OdD01O/

Od901O/\

Od90IO/

OdD0IO/

Od9010/

OdD0IO/

Od90IO/

OdD0IO/

Od90IO/

Od901O/

OdD0IO/

Od90IO/

OdD0IO/

Od90IO/

Od901O/

AQUNO)

¢ Las

pla

€ Lad

Cla

LLa4

9499

SHOD

pIOD

CHOD

THOD

SCZW

VCZW

EcZIN

CCZW

ICZW

OCZN

61 ZN

8IZN

LIZW

OT ZN

SI ZW

VIZW

eI ZIN

CIZIN

IL ZIN

OLZN

6ZIN

8ZIN

9pod ‘v0dS

(ponunuod) "| XIGNAddV

SLJSAAUDI “DH

SLSAAUDI “DH

SLISAAUDI “DH

SLJSAAUDI “DH

SLIJSAAUDI “DH

SLAJSAAUDI “DH

SLAJSAGUDI “DH

SLJSAAUDI “DH

SLAJSAAUDI “DH

SLJSAAUDI “DH

SLASAAUDI “DH

SLJSAAUDI “DH

SLAJSAAUDI “DH

SLASAAUDI “DH

SLAJSAAUDI “DH

SLASAAUDI “DH

SLJSAAUDI “DH

soieds

©ZFMK

Bonn zoological Bulletin 68 (1): 97-124

Oussama Bouarakia et al.

118

(PIOT) Te 19 SRJOOIN

(PIOT) Te 19 SRTOOIN

(PIOT) Te 19 SRJOOIN

(PIOT) Te 19 SRJOSIN

(PIOT) Te 19 SRJOOIN

(PIOT) Te 19 SRTOOIN

(PIOT) Te 19 SeJOOIN

(S107) Te 190 Holey

(9107) ‘Te 10 OAPIPN

(S107) Te 19 eyeYY

(S107) Te 19 eyeUY

(S107) Te 19 eyeYY

yIOM SIU

yIOM SIU,

yIOM SIU [

yIOM SIU,

yIOM SIU

yIOM SIU [

yIOM SIU L

yIOM SIU,

YAOM STYL

IIUIAIFIY

Ic Lads PUVA ASA

OCLAA-S LUVIN USA

61. Led-S TUVAN- USA

81 Lad-s LUVIN ASA

LILad-S TaVW- SA

91LaA-S TAVN- USA

SILad-$ PUVA ASA

€lLdd-s TYVINN- ASA

CILYA-S LUVIN USA

[1 Ladd-$ PAVIA aSA

OLLYA-STUaVN- ASA

6.LYA-S TUVIN-ASA

8.LYA-S LUVIN ASA

9LYA-S TUVIN-ASA

oN Joqono,

[98S E804

SE8SE80

PE8SE8OA

CE8SC80 A

CEBSE8OA

LE8ses04

O€8SE80A

6C8S E807

8C8S E80

91068084

VLOSOON'T

6LVCOLX A

8LVCOLX A

SSI98ZX>

COLLSVAWN

COLLSVAW

T9LLSVAWN

O9LLSVAWN

6SLLSVAWN

8CICSVAIN

LCEICSVAWN

ICI CSV AN

SCICSTAIN

SIccSv AN

VIccSV AN

elccSvAW

CICCSV AN

CEICSV AN

oN YUBA UIS)

UYHO

O¢

9¢

Lat

ARs al

9pod ApIBIO'T

epnoly)

epeiodsy

epnojyuony

Poss Sy UlV [Sqef

PIZNO IPI§

(sIseQ BMIS) BUOLAILZ [J

(sIseQ BAIS) BUOLAIEZ 1g

(SISEO VMIS) BUOTAILZ [gq

ess

Ay]WIO'T

Od90IO/

OdD0IO/

Od90IO/

OdD0IO/

Od90IO/

OdD0IO/

Od90IO/

eISIUN],

vISIUN

AB q

OdD0IO/

Od901O/

Od9010/

Od901O/

Od90IO/

Od901O/

Od9010/

Od901O/

Od90IO/

Od901O/

OdD0IO/

Od901O/

AQUNO)D

9800-L

O99VI-L

CSOVIN-L

LLVVIW-8

OLVVW-8

OCCVIN-D

8ICVIN-Y

SICVIN-Y

COCVIT

00607 ALL

€90L66 I

O8cSOON

6LcSOOW

8LcSOOW

[clad

CARE

61. Lat

81LaaA

Li Ld

91 La

SI Lad

elLdd

CLLaA

[1Lad

Ol La

6.LaH

8.La4

9.LaA

9pod ‘v0dS

(ponunuod) "| XTIGNAddV

SLASAAUIDO °

SLASAadUvd °

SLASAadUDO °

SLASAadUvd °

SLASAadUIDO °

SLASAaAUDO °

SLASAadUvd °

SLSadUvd °

SLASadUvd °

SLASAaAUIDO °

SLASAadUDd °

SLASAadUDO °

SLASAadUIDO °

SLASadUvd °

SLYSaduUvd °

SLASAaAUIDO °

SLASadUvd °

SLSAadUvd °

SLASAadUIDO °

SLASadUvd °

SLSAadUvd °

SLASAaAUIDO °

SLYSAadUDO °

SLASAadUIDO °

SLASAaAUIDO °

SLASAadUDO °

SLSaduUvd °

SLASAadUIDO °

soieds

SS a se ae ees pm aay: P| te ay ss EO RS

©ZFMK

Bonn zoological Bulletin 68 (1): 97-124

119

(P10Z) °

(P1OZ) °

(PL07) °

(P10) °

(P107) °

(PL07) °

(PIO) °

(P10Z) °

(P107) °

(P10) °

(PL07) °

(P10) °

(P1O7) °

(P10Z) °

Caval

(PLO0Z) °

(P10Z) °

(P10) °

(P107) °

(PIO0Z) °

(VIO) °

(PL0Z) °

(P1O0Z) °

(P10) °

(PLO7) °

(P10Z) °

Biogeographic history of Gerbillus campestris

[e 30 SPJOOIN

[e 39 SPJOOIN

[e 10 SPJOOIN

[e 30 SPJOOIN

[e 19 SPJOOIN

[e 10 SPJOOIN

[e 30 SPJOOIN

[e 39 SP[OOIN

[e 30 SPJOOIN

[e 19 SP[OOIN

[e 39 SPJOOIN

[e 10 SPJOOIN

[e 19 SP[OOIN

[e 39 SP[OOIN

[e 30 SP[OOIN

[e 30 SPJOOIN

[e 19 SPJOOIN

[e 10 SPJOOIN

[e 19 SPJOOIN

[e 10 SP[OOIN

[e 30 SPJOOIN

[e 19 SPJOOIN

[e 10 SPJOOIN

[e 39 SPJOOIN

IIUIAIJFIY

oN JOqon0,A

LO8SE8O A

098S E807

6S8S E807

8S8SE80 4

LS8SE804

9S8S E807

816Se804

SS8SE80

PS8SE80A

ES8SC80

CS8SE8OA

[S8Se8)0 4

OS8S E802

68S E807

8P8Se80 7

LV8Ses0r

9V8SE80A

SV8Se80

PV8SE80A

EV8SC80 A

CV8S E807

[v8Se80 4

OV8SE80%

6E8S E807

8E8SC80 A

LE8SE8OA

9E8SE8OA

LI6S E807

oN WUBE UI)

INV

UHO

9pod ApIBIO'T

Yooxer, N Wy OZ

WIDON PpenoO

WIDON peo

WIDUN PenoO

eqeysnog pis

eqeysnog Ipis

ayeunoy

aeunoy

aeuno0y

aAvqnoyyinog

ZV [A INnos

ZV [A INOs

ZV [A INOS

ZV [A INnOs

ZV [A INOs

IRDOW.T IPIS

IRIDOW.T IPIS

eSI97 BID

esI97 BID

eSI97 BID

esI97 BLD

eSI97 BID

esI97 BID

eSI97 BID

epnolyy)

Ay]VIOT

Od901O/

Od90IO/

Od901O/

Od90IO/

OdD0IO/

Od90IO/

OdD0IO/\

OdD0IO/

OdD01O/

Od90IO/

OdD0IO/

Od90IO/

OdD01O/

Od90IO/

Od901O/

OdD01O/

Od901O/

Od90IO/

Od901O/

Od90IO/

Od901O/

OdD0IO/

Od901O/

AQUNO)

Loar}

LAY. CALS

OCVNO I

CHNOA I

CCHS S

OTES-S

TOH.LO-1

OIG.LO-1

608.LO-1

9T6VN-6

S68VIN-€

O68VIN- I

688VIN- I

8L8VINN- I

SS8VIN-E

CS8VWN- I

Svs8VIN- I

VP8VIN-E

S~LVIW-9

vrLVW-9

eVLVW-9

CVLVIW-9

6eLVW-9

SCLVW-9

6IZLVIN-9

9ILVIN-9

SILVIN-9

[900-4

9pod “v0dS

(ponunuod) "| XTIGNAddV

SLJSAAUDI “DH

SLIJSAAUDI “DH

SLJSAAUDI “DH

SLJSAAGUDI “DH

SLAJSAAUDI “DH

SLAJSAACUDI “DH

SLISAAUDI “DH

SLAJSAAUDI “DH

SLJSACUDI “DH

SLAJSAAUDI “DH

SLAJSAGUDI “DH

SLAJSAAUDI “DH

SLJSAAUDI “DH

SLAJSAAUDI “DH

SLJSAAUDI “DH

SLISAAUDI “DH

SLAJSAAUDI “DH

SLJSAGUDI “DH

SLIJSAAUDI “DH

SLAJSAAUDI “DH

SLJSAAUDI “DH

SLAJSAAUDI “DH

SLJSAAUDI “DH

SLAJSAGUDI “DH

soieds

©ZFMK

Bonn zoological Bulletin 68 (1): 97-124

Oussama Bouarakia et al.

120

(P1O7) °

(P107) °

(PLO7) °

(PL0Z) °

(P10) °

(P107) °

(P10Z) °

(P10) °

(P107) °

(P10) °

(P10Z) °

(P10) °

(PLOZ) °

(P10Z) °

(PL07) °

(P107) °

(P10Z) °

(PL0Z) °

(PLO0Z) °

(PLOZ) °

(P10) °

(PL07) °

(P10Z) °

(P1OZ) °

[e 19 SPJOOIN

[e 10 SPJOOIN

[e 30 SPJOOIN

[e 10 SP[OOIN

[e 30 SP[OOIN

[e 10 SPJOOIN

[e 19 SPJOOIN

[e 10 SPJOOIN

[e 30 SPJOOIN

[e 10 SP[OOIN

[e 19 SPJOOIN

[e 10 SP[OOIN

[e 19 SPJOOIN

[e 10 SPJOOIN

[e 30 SPJOOIN

[e 39 SPJOOIN

[e 30 SPJOOIN

[e 10 SPJOOIN

IIUIAIFOY

oN JOqon0,

S68SE80 4

68S E807

C68S C807

CO8S E802

L68S E804

068S E80

688S E80 A

888SE80 4

L88S C80 4

988S E802

S88SE80 4

P88S E807

E88SC80 4

C88S E807

[88S€8)0 4

O88S E80 A

6L8S E80 A

8L8SE80 4

LL8SE80A

9L8S E807

SL8SE80 4

PL8SE80A

EL8SC80 4

CLES E807

[L8S E804

OL8S E802

698S E802

898S C807

oN YUBA UIS)

9pod ApITBIO'T

elmnoessy § WY S

elmnoessy § UY S

elmnoessy § WY S

elmnoessy § Wy ¢

YyooyeeA, N Wy OZ

YyOoyeUeA, N Wy OZ

YOoyeLeA, N Wy OZ

YyooyeLeA, N WY OZ

YOoyeURA, N Wy OZ

YyooyeUeA, N Wy OZ

YyooyeueA, N WY OZ

YOoyeLeA, N Wy OZ

YOoyeLRA, N WY OZ

YOoyeLeA, N Wy OZ

YOoyeUeA, N WY OZ

YyooyeUeA, N Wy OZ

YOoyeLRA, N WY OZ

YyooyeueA, N Wy OZ

YOoyeLRA, N WY OZ

YOoyeLeA, N Wy OZ

YooyeLeA, N Wy OZ

YyooyeLeA, N Wy OZ

YOoyeUeA, N Wy OZ

YOoyeLeA, N WY OZ

YOoyeLRA, N Wy OZ

YOoyeLeA, N Wy OZ

Ay]VIOT

Od90IO/

Od901O/

Od90IO/

OdD0IO/

Od90IO/

OdD0IO/

Od90IO/

Od901O/

OdD0IO/

Od901O/

Od90IO/

OdD0IO/

Od901O/

OdD0IO/

Od901O/

Od9010/

Od901O/

Od90IO/

Od901O/

OdD0IO[

OdD01O/

AQUNO)

eee l=]

8cDT°1

Leal]

8cDT"1

LOD TAL

6 a |

SCOTTI

BOOT]

CCO'T- |

Wee eal

OC Tl

GLO}

81D 1-1

SED Ea

SIDT-1

VIDT-I

1 ES 1A Be

Cloves

HOTT

CLOVE]

Gols

sO 1-1

LD I-[

9D'T 1

SOT 1

Peale]

EVAL

COT 1

9pod “90ds

(ponunuod) "| XTIGNAddV

SLSadUvd °

SLASAadUIDO °

SLASAadUDO °

SLASAadUvd °

SLYSadUvd °

SLYSAadUDO °

SLASAadUIDO °

SLASAadUvd °

SLASAadUDO °

SLASAAUID °

SLASAadUIDO °

SLASAadUDO °

SLASAAUIDO °

SLASAadUvd °

SLASAAUIDO °

SLASAadUvd °

SLASAadUIDO °

SLASAadUID °

SLASAadUIDO °

SLASAadUDO °

SLASAaAUID °

SLYSAadUDvd °

SLASAadUDO °

SLASAAUIDO °

SLYSAadUvd °

SLSaduUvd °

SLASAadUIDO °

soieds

Se a oe ae Ses As ie Oe SS

©ZFMK

Bonn zoological Bulletin 68 (1): 97-124

121

Biogeographic history of Gerbillus campestris

(PIOT) Te 19 SeJOOIN CLOSE8OA I (Se1OJ] Sop IeIpy) IWolpy TRA LAAOQE0-% S1AISadwupd ‘H

(PILOT) ‘Te 39 SPJOSIN 616SE80M 8 W]eSSo Te SCSAL-Z —- Slusadwupd ‘DH

(PILOT) TB 39 SPJOSIN 998S E807 8 W]eSsa Te 9909W-7J Os S1ISadwuipd “DH

(PLOT) Te 39 SPJOSIN S98SE8OM 8 {]eSsoa Te 6S6SIW-T Os S1JSadwupd ‘DH

(PILOT) Te 39 SPJOSIN OLSOSEND 6 JOUIeLUUTe eIsIun |, WHLI-p = SLsadiuva “DH

(PIOT) ‘Te Jo SBJOSIN 69S9SENDO 6 JOUTeUTWUe PY eIsIUN |, WHEI-p = SLusadiuva “DH

(PIOZ) Te 19 SPJOOIN 89S9SENO 6 JOWRUIUWIeH eIsIUn |, WHO7C-b = SLsadiuva “DH

(PLOT) Te 39 SPJOSIN LOSOSENMO 6 JOUIeLUUe eIsIUn WH9-? SLASAAUDI “DH

(PLOT) ‘Te 12 SBJOOIN 99S9SENDO 6 JOUTeUTWUe PY eIsIUN |, WH8I-p = SLsadiuva “DH

(PIOZ) Te 19 SeJOOIN S9SOSEND Ol euipoynog eIsIUn |, Hd9T-p ss SISadwuip9 “H

(PIOTZ) ‘Te 12 SeJOSIN [l6S€804 Il PIZNog IPs eIstuny, IAAP90-p = SLsadupa “5

(PIO) ‘Te 12 SeJOSIN OL6S€804 Il PIznog Ip!s eIstun IAA€90-p = SLSadiupa “+

(PIOT) ‘Te 19 SBOOIN VI8SE8OA Gl jowolq [q golpeH CLIOS[V €9|-1 SLAJSAAUDI “DH

(PILOT) Te 39 SPJOSIN C98SE8O A GL jowolq [q golpeH BLIOS[V 611-7 SLAJSAAUDI “DH

(PIOT) Te 19 SRJOOIN TIBSE8IM a jowald [4 qefpey elas[V L6-b Sisadups “5

(PILOT) ‘Te Jo SBJOOIN 9T6SE80M El Inopinog OdD0OIOW. =ZTAATZOO-] = SSadupa ‘DH

(PIOT) ‘Te 0 SeJOSIN LO6S E80 vi SSNOS pono § UT ¢ ODSOIOJ IQDT-1 = Silsadwupa “

(PIOTZ) ‘Te 12 Se[OSIN 906S £804 vi SSNOS pono § UT ¢ OSS0IO/ O9DT-E = SLsadupa “H

(PIOT) Je 19 SPJOOIN CO06SE80M cl ssnog pono § Wy ¢ ODDO0IOJ SSN 1-1 SLASAAUDI “DH

(PIOT) ‘Te 19 SRJOOIN vO6S E807 SI SSNOS pono § UY ¢€ OIS0IOJ LSOT-1 = Siisadwupa “5

(PIO) ‘Te 32 SeJOSIN €06S E807 91 bIINOBSSH § UY OT OSS0IO/ ESOT-1 = Stapsadiupa “5

(PIO) ‘Te 12 SeJOSIN CO6S E807 91 bIINOBSSH § UY OT OIS0IOJ TSOT-E = SL.sadwupa “H

(PIOTZ) ‘Te 32 SeJOSIN L06S E804 oI blINORSSH § UL OT ODSOIO/ ISOT-1 = Sisadwupa

(PLOT) ‘Te 10 SBJOSIN O06S £807 91 elmnoessy § WY 07 ODD0IO/I SPO T-[ sidjsadiupoa

(PILOT) ‘Te 39 SPJOSIN 668S E804 7A | eimnoessy S$ WY ¢ ODDO01OJ| CPN 1-1 siasadups ‘

(PILOT) Te 39 SPJOSIN 868S E80 ial eimoessy S$ WY ¢ ODDOIO TPOT-1 = SLusadupa “DH

(PILOT) Te 39 SPJOSIN LO8S E807 LI eimoessy S$ WY ¢ ODD01O/ IPOT-1 = Stagsaduin9 “5

(PLOT) Te 39 SPJOSIN 968S E804 LI eimoessy S$ WY ¢ ODDOIOJ OPOT-| siysadups ‘Dp

JIUIAIJOY] oN JOqono,d oN WuBgquesy 9pos AjI[BIOT A}IBIO'T AQUNO) Ipod ‘deds soiseds

(ponunuod) "| XTIGNAddV

©ZFMK

Bonn zoological Bulletin 68 (1): 97-124

Oussama Bouarakia et al.

122

(S10Z) Te 19 eryesenog

(ZI0Z) [B19 OAVIPN

(S107) Te 19 elyeenog

(S007)

AUSIQO 7 JOIAYD

(Z10Z) Je 39 UeMYIS

(ZI0Z) Te 19 OAVIPN

(Z10Z) [2 19 OAVIPN

(GE107) Te 19 SACIPN

(PIOZ) ‘Te 39 JoIADY

(pIOZ) Te 19 SBJOOIN

(pIOZ) Te 10 SeJOOIN

(pIOZ) ‘Te 19 SeJOOIN

O1L6099HW

CO8CSONL

[l6099HN

[ZclSsfv

v68cocxl

LOVI CONE

OOVI CONE

81 c96Vd a

9TL9ECIN

S16Se804

PI6OSE80A

LO8CSONE

€l6Se80

= EB OPM Ee} st mM

(Se1OJ] Sop IeIpy) Iolpq

BULIOYUIS

no[sV

Nd essepy ssnos

(zapesy) WV

sTuepey

welesnohH

(SeJOJ] Sop JeIpy) sJWolpy

ODD0IO/|

ODD0IO/

0D9010J\

0d9010J\

JOSIN

eAqry]

JOSIN

1UOUIS “L)

snulsadsay “5

idajuay “5

O€06661 sLusadiua “5

cel

“600¢d ZT

C8OT SLAJSACUDI “DH

SLOT SLAJSAAUDI “DH

Or06661 sLusadwupa “5

T878PdINN = Siusaduipo ‘5

TAAB8LT-C Stuisaduipa “1

TAAOb0-% = SiuIsaduipa “+

1O8TS9-T —_ SLusadutpo “5

IAAPE0-Z SiuISaduipa “+

SLIJSAAUDI “DH

(ponunuos) ‘| XIGNAddV

©ZFMK

Bonn zoological Bulletin 68 (1): 97-124

Biogeographic history of Gerbillus campestris 123

APPENDIX ILI.

Projection of male individuals on the first two axes (F1 and F2) of the principal component analysis (PCA). Different colours

represent different localities (Chrouda: black; Aounate: green; Kenitra: blue; Merja Zerga: red; Guercif: orange; Fritissa: pur-

ple). The dashed ellipses (added for clarity) represent the six populations.

Observations (axes F1 and F2: 76,63 %)

F1 (66,45 %)

124 Oussama Bouarakia et al.

APPENDIX III.

Projection of female individuals on the first two axes (F1 and F2) of the principal component analysis (PCA). Different colours

represent different localities (Chrouda: black; Aounate: green; Kenitra: blue; Merja Zerga: red; Guercif: orange; Fritissa: purple).

The dashed ellipses (added for clarity) represent the six populations.

Observations (axes F1 and F2: 76,01 %)

"ee, get

*eeenee®

psaseessaPennneernens,, ot

aeuee “ee

ot fe

.*” *48°

ANT @ *

+* Pid .

é :

ite)

—

s *s

ofn

0 1

F1 (62,55 %)

Bonn zoological Bulletin 68 (1): 125-146

2019 - Steenis J van et al.

https://do1.org/10.20363/BZB-2019.68.1.125

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:|sid:zoobank.org:pub:D11F29FC-D803-44BD-850E-6A0895E268C3

Hoverflies (Diptera: Syrphidae) of Cyprus:

results from a collecting trip in October 2017

Jeroen van Steenis'’", Menno P. van Zuijen’, Wouter van Steenis*, Christodoulos Makris*,

André van Eck* & Ximo Mengual®

‘Naturalis Biodiversity Center, Leiden. Hof der Toekomst 48, NL-3823 HX Amersfoort, The Netherlands

?Kolkakkerweg 21-2, NL-6708 RK Wageningen, The Netherlands

>Naturalis Biodiversity Center, Leiden. Vrouwenmantel 18, 3621 TR Breukelen, The Netherlands

*Ethnikis Antistaseos 21, 3022 Lemessos, Cyprus

> Korte Hoefstraat 30, 5046 DB Tilburg, The Netherlands

°Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, D-53113 Bonn, Germany

* Corresponding author: Email: jvansteenis@syrphidaeintrees.com

'urn:lsid:zoobank.org:author:C7FODO01C-B182-4B93-AF73-E4154367B535

?urn:Isid:zoobank.org:author:C82093 D8-EE58-47DD-B13A-4F47BDF73911

3urn:Isid:zoobank.org:author:59753746-8 DB9-4954-A22B-6D5D582132A2

*urn:Isid:zoobank.org:author:B13BD7FB-27F2-4F33-A5C2-D281947E2309

>urn:lsid:zoobank.org:author:3F9CD483-BDC2-43C5-9235-CADF874C427D

°urn:|sid:zoobank.org:author:A5093 1OD-B567-4830-B8A4-BCB139BB8768

Abstract. In October 2017 an international expedition to Cyprus was made in order to collect hoverflies (Diptera: Syr-

phi-dae) and to improve knowledge of the local fauna. In twelve days, numerous localities were visited in a wide range

of habitats, where Syrphidae were collected by hand net. Malaise and pan traps were placed in some sam-pling localities

around the Troodos Mountains. In total, 52 Syrphidae species were collected, 23 of which represent new species records

for the island and another three belong to undescribed taxa. Newly obtained DNA data from the genera Merodon and

Ceriana indicate a large interspecific morphological variation within Merodon sp. nov. | and support the recent split of

C. glaebosa Van Steenis & Ricarte, 2016 from C. vespiformis (Latreille, 1809).

Key words. Hoverfly, Cyprus, faun. nov., DNA, ecology.

INTRODUCTION

Short collecting trips in connection with the Internation-

al Symposium on Syrphidae in Finland (2007) were fol-

lowed by expeditions to Serbia (Van Steenis et al. 2015),

the Russian Far East (Mutin et al. 2016) and Taiwan

in 2016. For 2017, a further expedition was planned to

collect hoverflies (Diptera, Syrphidae); a priori the aim

was to visit SE Europe and collect Mediterranean spe-

cies of the genera Eumerus Meigen, 1822 and Merodon

Meigen, 1803. The recent papers on Eumerus (Grkov-

i¢ et al. 2015), Pseudodoros Becker, 1903 (Van Eck &

Makris 2016), Merodon (Sa8ié et al. 2016) and the tribe

Cerioidini (Van Steenis et al. 2016) plus the contacts al-

ready established by André van Eck were decisive in se-

lecting Cyprus as the collecting destination. The collect-

ing trip to Cyprus had the aim of improving the current

knowledge of the syrphid fauna of the island, especially

to sample the species occurring in autumn. This collect-

ing trip fitted with the current project run by André van

Eck to establish the first hoverfly checklist of Cyprus.

Received: 23.12.2018

Accepted: 04.06.2019

The results of the present report will be included in the

final checklist for Cyprus.

MATERIAL AND METHODS

From October 1 to October 13" 2017 Syrphidae sam-

pling was carried out in the Republic of Cyprus, mainly

in the central and western parts of the island.

Syrphidae were collected by hand net from morning to

late afternoon, with most specimens collected between 10

am and 4 pm. Before 10 am the sun was still too low and

in the mountains it was cold (<20°C), facts that hindered

us from collecting hoverflies, as syrphids needed to warm

up before starting to fly or feed. After 4 pm the tempera-

ture fell slowly, but with the onset of sunset most Syrphi-

dae ceased flying. On more cloudy days, lower altitudes

were visited to make collecting still possible in warm and

sunny weather.

Plant names provided in the present work follow the

nomenclature from The Plant List (2013).

Corresponding editor: R. Peters

Published: 01.07.2019

126 Jeroen van Steenis et al.

Fig. 1. Malaise trap sites. A. Pera Pedi. B. Pine forest above Trooditissa picnic site. C. Paphos forest, Appides stream. D. Troodi-

tissa — Prodromos road E804.

Collecting by Malaise and Pan Traps

In several sampling sites, pan traps and Malaise traps

of different fabrics were used. Malaise traps were ei-

ther home-made or commercial models, both based on

Townes’ model (Townes 1972) (Fig. 1). One commercial

model consisted of two single Malaise traps sewn togeth-

er along the lowest part, making it twice as long and with

two collecting heads (Fig. 1C). All the collecting heads

had a capacity of 0.5 to 0.7 L and were filled with at least

90% pure ethanol. The pan traps were of two types in

the colours white and yellow. The collecting medium

consisted of water with diluted salt as preservative and a

detergent to reduce surface tension. After collecting, all

specimens were rinsed several times in at least 90% pure

ethanol and stored in plastic bags. Finally, the collected

specimens were transferred to plastic vials prior to study.

Bonn zoological Bulletin 68 (1): 125-146

Search for immature stages

We searched for larvae and puparia in aphid colonies,

decaying and rotting plant material, live rootstocks and

other habitats with decaying organic matter such as open

and closed rot holes and sap streams on live trees. Wa-

ter-filled rot holes in trees were searched for larvae but

did not render any specimens.

Several times, bulbs were dug out to check for larvae

or larval feeding signs. In the field, no larvae were found

in the bulbs. In order to check for the presence of larvae,

two plants (its bulbs and most of its tubers) of Aspho-

delus aestivus Brot. and 15 bulbs of Colchicum troodi

Kotschy (Fig. 2E) and Prospero autumnale (L.) Speta

(Fig. 2D) were removed for potential rearing of larvae.

The bulbs of each species were placed together in plas-

tic containers and covered with a soil and sand mixture.

The containers were kept indoors at room temperature

and watered several times a week. Each container was

covered by an entomological net in order to capture any

freshly hatched specimens.

©ZFMK

Hoverflies of Cyprus: results from a collecting trip in October 2017 127

Fig. 2. Flowers. A. Taraxacum cyprium, Trooditissa picnic site. B. Cachrys crassiloba, Pera Pedi. C. Foeniculum vulgare, Gialia

River near Agios Sozomenos. D. Prospero autumnale, Kourio near ancient Kourion stadium. E. Colchicum troodi, Trooditissa

picnic site. KF. Crithmum maritimum, Kavo Gkreko.

Localities visited la. Saittas to Mesa Potamos (34°52’29.25”N

32°54’53.40”E, 706 m. a.s.l.). Small valley in a Pinus

A total of 25 different sampling localities were surveyed brutia Ten. forest with Alnus orientalis Decne., Pla-

during the collecting trip: tanus orientalis L., Quercus alnifolia Poech, Stvrax

128

1b.

Te!

officinalis L. and flowering Hedera pastuchovii sub-

sp. cypria (McAllister) Hand. Visited on 2.X.2017.

Almyrolivado (34°55’33.38"N = 32°53’24.00”E,

1546 m. as.l.). Small stream in Pinus nigra forest

with Dittrichia viscosa subsp. angustifolia (Bég.)

Greuter, Rubus sanctus Schreb. and Epipactis vera-

trifolia Boiss. & Hohen. Visited on 2.X.2017.

Saittas to Fylagra (34°53'01.69"" N 32°55'16.75" E,

757 m. a.s.l.). Stream valley in Pinus brutia forest re-

covering from fire, with Platanus orientalis, Quercus

alnifolia, Arbutus andrachne L., Tamarix smyrnensis

Bunge and flowering Dittrichia viscosa subsp. angus-

tifolia. Visited on 2.X.2017.

2. Trooditissa picnic site (34°54'53.05" N 32°50'32.14"

E, 1340 m. a.s.l.) (Fig. 3A). Rocky stream banks in

Pinus brutia forest with Alnus orientalis, Platanus

orientalis, Quercus alnifolia and flowering Colchi-

cum troodi, Taraxacum cyprium H. Lindb. and Hede-

ra pastuchovii subsp. cypria. Visited on 2.X, 4.X.and

OX IOLY:.

. Pera Pedi, abandoned vineyard (34°51'56.8" N

32°50'55.91" E, 881 m. a.s.1.). Flower-rich abandoned

vineyard next to Pera Pedi - Mandria road with flow-

ering Foeniculum vulgare (Fig. 2C), Dittrichia vis-

cosa subsp. angustifolia, Cachrys crassiloba (Boiss.)

Meikle, Polygonum equisetiforme Sm., Chondrilla

Juncea L. and Hypericum triquetrifolium Turra. Vis-

ited on 2.X, 4.X. and 12.X.2017. Three Malaise traps

were used in this locality (Figs 1A, 3B).

. Hala Sultan Tekke (34°53'10.37" N 33°36'30.74" E,

5 m.a.s.l.) (Fig. 3C). Dry canal at the west side of the

Larnaka Salt Lake with abundant flowering Polygo-

num equisetiforme, Foeniculum vulgare and Aspara-

gus horridus L. Visited on 3.X.2017.

5. Akrotiri marsh (34°37'38.92" N 32°56'27.78" E, 5 m.

a.s.1.). Open area with extensive reed beds dominated

by Phragmites australis (Cav.) Steud. and flower-rich

meadows, partly grazed by cattle, with Foenicu-

lum vulgare, Dittrichia viscosa subsp. angustifolia

and Polygonum equisetiforme. Visited on 3.X. and

10.X.2017.

6. Pine forest above Trooditissa picnic site (34°55'05.8"

N 32°50'55.95" E, 1480 m. a.s.l.). Small open area

next to a flowing stream, with flowering Dittrichia

viscosa subsp. angustifolia, Rubus sanctus and Jun-

cus spp. The dominant species in the surrounding

pine forest were Pinus brutia, Pinus nigra subsp.

pallasiana (D. Don) Holmboe, Juniperus foetidissi-

ma Willd., Cistus creticus L. and Genista fasselata

Decne. Visited on 4.X. and 12.X.2017 (Fig. 1B). Two

Malaise and several pan traps were placed here.

7. Alassa, north side of Kouris Dam, (34°45'34.34" N

32°55'53.92" E, 217 m. a.s.l.). Dry bank of dam with

meadows and deep ravines, some of which still con-

tained water, and flowing river with reed beds, Jun-

cus spp., Piptatherum miliaceum (L.) Coss., Tamarix

Bonn zoological Bulletin 68 (1): 125-146

Jeroen van Steenis et al.

spp., Mentha longifolia subsp. cyprica (Heinr. Braun)

Harley and Dittrichia viscosa subsp. angustifolia.

Visited on 4.X.2017.

8. Gialia River near Agios Sozomenos (35°03'0.41"" N

33°26'27.89" E, 184 m. a.s.l.). Wide flat dry river

bed with Vitex agnus-castus L., Nerium oleander L.,

Tamarix smyrnensis and abundant flowering Foenic-

ulum vulgare and Dittrichia viscosa subsp. angustifo-

lia. Visited on 5.X.2017.

9. Agios Sozomenos (35°04'01.8" N 33°26'13.19" E,

10.

—

13:

14.

202 m. a.s.l.). Rocky slope at field boundary with

Ziziphus lotus (L.) Lam. bushes and phrygana with

Thymbra_ capitata (L.) Cav., Noaea mucronata

(Forssk.) Asch. & Schweinf. and several non-flower-

ing bulbous plants. Visited on 5.X.2017.

Valley along Karvounas-Kakopetria road (B9)

(34°58'28.77" N 32°54'46.96" E, 790 m. a.s.l.)

(Fig. 4A). River valley with riverine broadleaved for-

est and a gravel road bordered by Polygonum equi-

setiforme and several non-flowering bulbous plants.

The dominant species in the broadleaved forest were

Alnus orientalis, Platanus orientalis and flowering

Hedera pastuchovii subsp. cypria. Visited on 5.X.

and 9.X.2017.

.Paphos forest, Appides stream (34°59'28.6" N

32°38'49.2" E, 747 m. a.s.l.) (Fig. 1B). Small stream

with Alnus orientalis, Platanus orientalis and flow-

ering Rubus sanctus, Colchicum troodi and Hedera

pastuchovii subsp. cypria. The dominant species in

the surrounding montane pine forest were Pinus bru-

tia, Quercus alnifolia, Arbutus andrachne and Cistus

spp. Visited on 6.X. and 12.X.2017. Two Malaise and

several pan traps were placed in this locality.

Paphos forest, Livadi Picnic site near Pomos village

(35°06'06.2" N 32°35'37.33" E, 366m. a.s.l)), Large

open area around small streams, with Alnus orien-

talis, Platanus orientalis and flowering Foeniculum

vulgare and Dittrichia viscosa subsp. angustifolia in

montane forest dominated by Pinus brutia, Quercus

alnifolia and Cistus spp. Visited on 6.X.2017.

Asomatos, near Limassol Salt Lake (34°37'37.46" N

32°57'17.67" E, 2 m. a.s.l.). Forest corridor in Fasou-

ri forest along the north margin of the Akrotiri Salt

Lake. Fasouri forest is an old plantation with exotic

trees such as Eucalyptus spp., Casuarina cunning-

hamiana Migq. and Acacia saligna (Labill.) H. Wendl.

The north margin of the Akrotiri Salt Lake is covered

by large reed beds dominated by Phragmites austra-

lis and stands of Zamarix tetragyna Ehrenb. Along

the corridor the dominant species were Carex spp.,

Juncus spp., Dittrichia viscosa subsp. angustifolia

and Lotus spp. Visited on 7.X.2017.

Kourio near ancient Kourion stadium (34°40'15.62"

INe32002 28:35," 0.2 2s as (Pie 3D): Open

landscape covered by stands of Pinus brutia and Cu-

pressus sempervirens L. and maquis with Juniperus

©ZFMK

Hoverflies of Cyprus: results from a collecting trip in October 2017 129

Fig. 3. Adult habitat, collecting sites on Cyprus. A. Trooditissa picnic site. B. Pera Pedi. C. Hala Sultan Tekke. D. Kourio near

ancient Kourion stadium. E. Diarizos River south of Tzelefos Bridge. F. Kavo Gkreko.

Phoenicea L., Ceratonia siliqua L., Olea europaea di, Asparagus acutifolius L. and Drimia maritima

L., Pistacia lentiscus L., Cistus parviflorus Lam. and (L.). Visited on 7.X. and 10.X.2017.

Cistus salviifolius L. The area is very rich in bulbous ‘15. Oreites wind farm (34°43'35.12" N 32°37'21.13" E,

plants too. Flowering during our visit were the spe- 370 m. a.s.l.). Hilly area covered with maquis and Pi-

cies Prospero autumnale (L.) Speta, Colchicum troo- nus brutia stands. The dominant species in the maquis

130

Jeroen van Steenis et al.

Fig. 4. Habitat of Syrphidae on Hedera pastuchovii subsp. cypria. A. Karvounas-Kakopetria road B9. B. Trooditissa-Prodromos

road E804.

16.

Vie

18.

19.

are Ceratonia siliqua, Olea europaea, Quercus coc-

cifera subsp. calliprinos (Webb) Holmboe, Pistacia

lentiscus, Pistacia terebinthus L., Cistus parviflorus,

Cistus salviifolius and flowering Asparagus acutifo-

lius and Drimia maritima. Visited on 7.X.2017.

Mamonia (34°45'41.44" N 32°38'35.51" E, 184 m.

a.s.1.). Uncultivated field next to Mamonia — Archi-

mandrita road with Foeniculum vulgare and Polygo-

num equisetiforme. Visited on 7.X.2017.

Kapileio to Limnatis (34°49'0.07" N 32°57'50.59" E,

372 m. a.s.l.). Dry stream bed with A/nus orientalis,

Arundo donax L. and flowering Foeniculum vulgare,

Dittrichia viscosa subsp. angustifolia and Polygonum

equisetiforme. Visited on 8.X.2017.

Mesa Potamos (34°52'33.09" N 32°54'48.70" E,

720 m. a.s.l.). Stream in Pinus brutia forest with A/-

nus orientalis, Platanus orientalis, Quercus alnifolia

and flowering Hedera pastuchovii subsp. cypria. Vis-

ited on 8.X.2017.

Stream near Trikoukkia monastery on Trooditissa —

Prodromos road E804 (34°55'53.18" N 32°50'22.42"

E, 1352 m. as.l.). Stream in Pinus nigra forest with

Alnus orientalis, Platanus orientalis and flowering

Bonn zoological Bulletin 68 (1): 125-146

20.

2M,

D2,

Hedera pastuchovii subsp. cypria. Visited on 9.X.

and 13.X.2017 (Fig. 1D). One Malaise and several

pan traps were placed near low growing Hedera.

Lefkosia, Athalassa National Forest Park

(B57 07233815 1heNI33"22 5894 Fi. l/ Onin. tars je@ pen

lowland area with forest plantation dominated by Pi-

nus spp. Flowering plants were Foeniculum vulgare

and Dittrichia viscosa subsp. angustifolia. Visited on

10.X.2017.

Diarizos River south of Tzelefos Bridge and north

of Arminou Dam (34°53'11.71" N 32°44'46.54" E,

460 m. a.s.l.). Flower-rich meadows close to the dam

and surrounded by steep slopes with Alnus orientalis,

Platanus orientalis, Tamarix smyrnensis and montane

forest dominated by Pinus brutia, Quercus coccifera

subsp. calliprinos, Styrax officinalis and Pistacia ter-

ebinthus. Flowering plants were Foeniculum vulgare,

Dittrichia viscosa subsp. angustifolia and Polygonum

equisetiforme. Visited on 11.X.2017 (Fig. 3E).

Platys Valley (34°54'50.97" N 32°46'0.59" E, 550 m.

a.s.1.). Narrow valley with steep slopes along Diarizos

River with a narrow gravel road next to the river. The

dominant species in the valley were A/nus orienta-

©ZFMK

Hoverflies of Cyprus: results from a collecting trip in October 2017 131

lis, Platanus orientalis, abundant flowering Hedera

pastuchovii subsp. cypria and sporadically flower-

ing Colchicum troodi. The valley was surrounded by

montane forest dominated by Pinus brutia, Quercus

alnifolia, Acer obtusifolium Sm. and Cistus spp. Vis-

ited on 11.X.2017.

23. Komititzi picnic site near Mylikour village

(34°56'50.57" N 32°46'29.18" E, 655 m. a.s.l.). Open

area in Pinus brutia forest next to a stream with Alnus

orientalis, Platanus orientalis, flowering Colchicum

troodi and abundant flowering Hedera pastuchovii

subsp. cypria. Visited on 11.X.2017.

24. Diarizos River near Prastio village (34°47'51.96" N

32°42'20.46" E, 320 m. a.s.l.). Broadleaved riverine

forest with A/nus orientalis, Platanus orientalis and

meadows with flowering Foeniculum vulgare, Dittri-

chia viscosa subsp. angustifolia, Polygonum equiseti-

forme and Rubus sanctus. Visited on 12.X.2017.

25. Kavo Gkreko (34°57'50.38" N 34°04'50.24" E, 9 m.

a.s.1.). Rocky coast with sparse vegetation dominat-

ed by Crithmum maritimum L. (Fig. 2F). Visited on

13.X.2017.

Adult identification

We used available general literature for the identification

of the collected specimens to genus and species level

(Van Veen 2004; Speight & Sarthou 2017) and the fol-

lowing genus specific literature: Callicera Panzer, 1806

(Speight 1991; Smit 2014); Eumerus (Sack 1932; Stack-

elberg 1961; Vuji¢ & Simié 1998; Grkovié et al. 2015);

Merodon (Hurkmans 1993; Radenkovic¢ et al. 2011;

Popovic et al. 2015; Vujic et al. 2018); Paragus Latreille,

1804 (Sorokina & Cheng 2007); Pipiza Fallén, 1810

(Vujic¢ et al. 2013); Sphaerophoria Lepeletier & Serville,

1828 (Bankowska 1964) and Syritta Lepeletier & Ser-

ville, 1828 (Lyneborg & Barkemeyer 2005).

Images

Habitat photos were made by the first author with a

Nikon Coolpix P510. The images of the pinned adults

were made with a Canon EOS D6 DSLR camera with

a Canon MP-E 65 mm 1-—5x macro lens mounted on a

Cognisys StackShot macro rail. Lighting was provided

by a Yongnuo macro ring lite yn-14ex. Several images of

the specimens were stacked with Zerene Stacker 1.04 and

further edited with GNU Image Manipulation Program

(GIMP 2.8.22).

DNA analysis

Several specimens were selected to sequence the Folmer

region of the mitochondrial cytochrome c oxidase sub-

unit I (COI), the so-called DNA barcode (Hebert et al.

2003).

Bonn zoological Bulletin 68 (1): 125-146

One to three legs of either dry pinned, or ethanol-pre-

served, specimens were used for DNA extraction. Ex-

tractions were carried out using the NucleoSpin Tissue

DNA Extraction kit (Macherey-Nagel, Duren, Germany)

following the manufacturer’s instructions; samples were

resuspended in 100 ul ultra-pure water. Entire specimens

were preserved and labelled as DNA voucher specimens

for the purpose of morphological studies and deposited

at the Zoological Museum Alexander Koenig [ZFMK],

as listed in Appendix I.

The COI sequence fragment was amplified using

the forward primer LCO-1490 (5'-GGTCAACAAAT-

CATAAAGATATTG-3') and the reverse primer 780R

(5'-CCAAAAAATCARAATARRTGYTG-3’). PCR

amplification protocols for mitochondrial COI were the

same as described in Mengual et al. (2008, 2012). Am-

plified DNA was electrophoresed on 1.5% agarose gels

for visual inspection of amplified products. PCR prod-

ucts were enzymatically treated with ExoSap-IT (USB,

Cleveland, OH, USA) and then sequenced (using the

PCR primers) in both directions. The sequences were

edited for base-calling errors and assembled using Ge-

neious R7 (version 7.1.3, Biomatters Ltd.). All new se-

quences were submitted to GenBank (see Appendix I for

accession numbers). The uncorrected pairwise distances

(% similarity) among COI sequences of selected Mero-

don and Ceriana specimens are shown in Appendices I

and II.

RESULTS

DNA sequences

COI sequences were successfully obtained for 11 select-

ed specimens collected on Cyprus in 2017 (Appendix I).

The sequence length varied between 658 and 669 bp. In

order to compare the COI sequences of two different Ce-

riana species, Jeffrey H. Skevington (Canadian National

Collection of Insects, Arachnids and Nematodes, Ottawa,

Canada) kindly shared with us the COI sequences of nine

Ceriana vespiformis (Latreille, 1809), which are deposit-

ed in BOLD (http://www. boldsystems.org/).

Species list

The species list for the collected material is given in al-

phabetical order. The main distribution is mentioned for

each species, and for some species, this is followed by

other information on, for example, threat category and

biology. The information on distribution is mainly from

Dirickx (1994) and Speight (2017); other references are

given for each species separately. Under the section re-

marks, habitat and habit information is given based on

our own observations during the fieldwork in Cyprus. All

collected specimens are given with their locality number.

©ZFMK

M52 Jeroen van Steenis et al.

Callicera macquarti Rondani, 1844

(Fig. SA)

Widespread Mediterranean autumn species (Speight

1991). Recorded from Cyprus (Dirickx 1994).

Remarks. Widespread in the Troodos area (10: 3¢'¢

729; 11: 294 629; 19: 14599). All the females were

collected on Hedera pastuchovii subsp. cypria either

feeding on the flowers or flying close to the leaves and

flowers. Based on our observations, Speight (2017) and

Claussen & Standfuss (2017), Hedera seems to be the

main food source for the adults. Two males were collect-

ed while defending a territory on Pinus nigra (Fig. 5A)

or on leaves of low shrubs near the base of Pinus nigra

in full sun, making short flights and most often returning

to the same spot. Also collected in a Malaise trap and a

white pan trap.

Ceriana glaebosa Van Steenis & Ricarte, 2016

(Fig. 6A)

Endemic species from Cyprus with spring and autumn

populations and a dark and light form (Van Steenis et al.

2016).

Remarks. One light form female was collected on Foe-

niculum vulgare (21). The presumed model (Crabroni-

dae: Cerceris spp. Fig. 6B) was found in several plac-

es (3, 8, 16, 21) where flowering Foeniculum vulgare

was present. DNA barcode comparison shows a 2.79 to

3.04% difference between C. glaebosa and specimens of

C. vespiformis (Appendix IIT) supporting the recent split

of these species (Van Steenis et al. 2016).

Cheilosia thessala Claussen & Stahls, 2007

(Fig. 5B)

First published record of this genus and species for Cy-

prus.

Described from Thessalia, Greece (Claussen & Stahls

2007).

Fig. 5. Adults in their natural habitat. A. Callicera macquarti 3, on Pinus spp. defending a territory, Paphos forest, Appides stream.

B. Cheilosia thessala 3, feeding on Foeniculum vulgare, Diarizos River south of Tzelefos Bridge. C. Milesia crabroniformis °,

egg-laying behaviour near entrance of rot hole in Acer spp., Paphos forest, Appides stream.

Bonn zoological Bulletin 68 (1): 125-146

©ZFMK

Hoverflies of Cyprus: results from a collecting trip in October 2017 133

Fig. 6. Adult Syrphidae and their models, dorsal view. A. Ceriana glaebosa 3. B. Cerceris spp. 2 (model of C. glaebosa). C.

Merodon pruni @. D. Philanthus spp. 2 (model of M. pruni). Scale bar = 1.0 mm.

Remarks. Collected in autumn 2016 in Cyprus for the

first time (pers. comm. Van Eck) based on specimens col-

lected on Hedera in the Troodos mountains. During this

trip, collected in low numbers throughout the Troodos

mountains (2: 23: 19; 3: 19; 10: 6¢¢ 799; 22: 12;

24: 12) mostly on Hedera pastuchovii subsp. cypria, and

Bonn zoological Bulletin 68 (1): 125-146

very abundantly at Tzelefos Bridge (21: 46¢¢ 1499)

visiting flowers of Foeniculum vulgare (Fig. 5B).

Chrysotoxum intermedium Meigen, 1822

Widespread Mediterranean species, recorded previously

from Cyprus (Dirickx 1994).

©ZFMK

134 Jeroen van Steenis et al.

Remarks. The only Chrysotoxum species found in Cy-

prus so far. Collected in a Malaise trap and by hand net

while visiting flowers on Cachrys crassiloba and Foenic-

ulum vulgare (3: 629; 17: 19).

Didea fasciata Macquart, 1834

First published record of this genus and species for Cy-

prus.

Widespread European species. Dirickx (1994) did not

give records from Greece or Turkey.

Remarks. Several males and some females were collect-

ed on Hedera pastuchovii subsp. cypria (2: 173.3 329;

11: 348; 19: 288).

Episyrphus balteatus (De Geer, 1776)

Very common and widespread species. Dirickx (1994)

gave records from Cyprus.

Remarks. Found in most habitats (2: 399; 3: 299; 7:

Le Seer: 2 PO ale] Oe LDC ale DC ie

19: 19; 21: 14 399; 23: 19; 24: 299). Flower visiting

observed on Hedera pastuchovii subsp. cypria, Foenic-

ulum vulgare, Dittrichia viscosa subsp. angustifolia and

Cachrys crassiloba.

Eristalinus aeneus (Scopoli, 1763)

Very common and widespread species, especially in

coastal areas. Dirickx (1994) mentioned records from

Cyprus.

Remarks. Collected in several coastal areas (4: 6¢'¢

999; 7:14; 8: 14:17:14 19; 25: 14 19) at Hala Sul-

tan Tekke in great numbers on Polygonum equisetiforme,

furthermore found on Foeniculum vulgare and Crithmum

maritimum.

Eristalinus megacephalus (Rossi, 1794)

First published record of this species for Cyprus.

Widespread Mediterranean species (see Dirickx 1994),

Remarks. Found at the coastal Akrotiri marsh on Dittri-

chia viscosa subsp. angustifolia and at Tzelefos Bridge

on Foeniculum vulgare (5: 20¢ 19; 21: 12).

Eristalinus taeniops (Wiedemann, 1818)

Widespread Mediterranean species. Georghiou (1977)

recorded it from Cyprus.

Remarks. In Troodos mountains mainly found flower

visiting on Hedera pastuchovii subsp. cypria (7: 14; 10:

4gS 299; 22: 13).

Eristalis similis (Fallén, 1817)

First published record of this species for Cyprus.

Bonn zoological Bulletin 68 (1): 125-146

Widespread Mediterranean species, also migratory far

into Northern Europe (Bartsch et al. 2009).

Remarks. One male specimen was collected visiting

flowers of Hedera pastuchovii subsp. cypria (10).

Eristalis tenax (Linnaeus, 1758)

Very common and widespread species. Dirickx (1994)

mentioned records from Cyprus.

Remarks. Several specimens found feeding on Hedera

pastuchovii subsp. cypria (3: 12; 19: 5299; 21: 19).

Eumerus amoenus Loew, 1848

Widespread Mediterranean species. Claussen & Lucas

(1988) and Vuji¢ & Simi¢ (1998) gave records from Cy-

prus.

Remarks. Widespread and abundantly found species in

Cyprus (2: 1543 59.9; 3: 399: 4: 14; 6: 14; 8: 499;

114g S92 Ss TAs TOE 18826 Ge 21 11 Oe 221305

409; 24: 19). Most often seen flying low over bare

ground or through low vegetation and often close to Col-

chicum flowers. Also found higher in the vegetation and

feeding on Foeniculum vulgare and Hedera pastuchovii

subsp. cypria or basking on leaves of large bushes.

One male hatched from collected tubers of Asphode-

lus aestivus. The hatched male was seen flying close to

the bulbs on 18.11.2018. This is a new host plant for this

hoverfly species and the second time that A. aestivus is

recorded as a host plant for hoverfly immatures (Ricarte

et al. 2008). Other species of Asphodelus L. have been

reported as host plants for other Eumerus species (Ri-

carte et al. 2017). Efflatoun (1922) reared this hoverfly

species from Allium (Alliaceae), potato tubers, water

melon, grapes, rotten paw-paw and damaged rhizomes

of Iris germanica L. (Iridaceae). Furthermore, Assem &

Nasr (1967) reported it as injurious to onion.

Eumerus argyropus Loew, 1848

(Figs 7C, 7D)

First published record of this species for Cyprus.

Mediterranean species (Vujié & Simi¢ 1998; Krpaé et al.

2011; Claussen & Standfuss 2017).

Remarks. Most abundantly found along Appides stream

in Troodos Mountains flying through the vegetation,

sometimes close to Colchicum flowers (2: 23' 19; 3:13;

11:43¢ 1199).

Eumerus basalis Loew, 1848

First published record of this species for Cyprus.

Widespread Mediterranean species (Vuji¢ & Simié 1998).

Remarks. Widespread and common species throughout

Cyprus (3: 3443 899; 8: 19; 10: 234 19; 16: 27¢¢

69 9:17:43 299; 21: 634 19; 22: 13). Found high-

©ZFMK

Hoverflies of Cyprus: results from a collecting trip in October 2017 135

Fig. 7. Adult, A-C, dorsal view; D-F lateral view. A. Pelecocera (Chamaesyrphus) sp. nov. 3. B. Pelecocera (Chamaesyrphus)

pruinosomaculata 2. C. Eumerus argyropus 3. D. Eumerus argyropus 2. E. Eumerus lucidus 2. F. Eumerus rusticus 2. Scale

bar = 1.0 mm.

er in the vegetation than E. amoenus and found flower Eumerus lucidus Loew, 1848

visiting on Polygonum equisetiforme, Foeniculum vul- (Fig. 7E)

gare, Cachrys crassiloba, Colchicum troodi and on Hed-

era pastuchovii subsp. cypria. First published record of this species for Cyprus.

136 Jeroen van Steenis et al.

Described from Rhodos (Greece) and further known

from mainland Greece (Ssymank 2013; Claussen &

Standfuss 2017).

Remarks. Identity confirmed by Ante Vujic. Found at

Trooditissa picnic site and Appides stream on Hedera

pastuchovii subsp. cypria (2: 42°; 11: 299). Habitat

and characters for identification similar to E. argyropus.

Eumerus pusillus Loew, 1848

First published record of this species for Cyprus.

Widespread Mediterranean species (Claussen & Lucas

1988). Ricarte et al. (2008) reared larvae from decayed

bulbs of Drimia maritima.

Remarks. Identity confirmed by Ante Vuji¢. Found in

the same habitat as F. basalis, flower visiting on Foenic-

ulum vulgare, Cachrys crassiloba and Hedera pastucho-

vii subsp. cypria (3: 299; 12: 7¢¢ 19; 16: 733 19;

PF LIGS SOO ANS POI 336649 922-745 19:

2425 S38 Ae).

Eumerus aff. rusticus Sack, 1932

(Fig. 7F)

First published record of this species for Cyprus.

Described on the basis of one male and one female from

“Asia Minor” most likely collected in Turkey (Sack

1932), and also reported from Romania and Turkmeni-

stan (Stackelberg 1961; Bradescu 1991).

Remarks. The identification is based on females only,

and therefore not entirely reliable. Based on Sack (1931)

and Stackelberg (1961) these specimens belong to E. rus-

ticus. The specimens were collected at Hala Sultan Tekke

on Polygonum equisetiforme, at Mylikouri flying near

Colchicum and at Agios Sozomenos on Foeniculum vul-

gare (4: 299; 8: 19; 22: 299).

Eumerus torsicus Grkovi¢ & Vujic, 2015

(Figs 8A, 8B)

Described from some Greece islands and Cyprus (Grkov-

i¢ et al. 2015).

Remarks. Identity confirmed by Ante Vuji¢. Found in

the same habitat as FE. argyropus and flying around Col-

chicum (2: 443 22.9; 11: 229; 24: 12).

Eumerus vestitus Bezzi, 1912

(Fig. 8C)

Eastern Mediterranean species. Dirickx (1994) provid-

ed records from Cyprus (as E. efflatouni Curran, 1938).

Smit et al. (2017) mentioned EF. efflatouni as junior syn-

onym of E. vestitus.

Remarks. Found at Hala Sultan Tekke and Agios So-

zomenos (4: 2¢'4; 8: 299) flower visiting on Foenic-

ulum vulgare.

Bonn zoological Bulletin 68 (1): 125-146

Eupeodes corollae (Fabricius, 1794)

Very common and widespread species. Dirickx (1994)

provided records from Cyprus.

Remarks. Widespread on Cyprus (2: 24'3' 799; 3: 4¢¢

1099; 5: 499; 6: 14 499; 7: 14; 8: 40h 1099; 10:

529; 11:30 499; 12: 299; 14:19; 16:19; 17: 403

TO 19s SO GLBS-Oy 21s ais O0s-22> 10 2Ar toy.

flower visiting on Hedera pastuchovii subsp. cypria,

Foeniculum vulgare, Cachrys crassiloba and Dittrichia

viscosa subsp. angustifolia.

Eupeodes nuba (Wiedemann, 1830)

Mediterranean species. Dirickx (1994) gave records from

Cyprus.

Remarks. One male was found at Tzelefos Bridge (21)

on Foeniculum vulgare.

Ferdinandea aurea Rondani, 1844

(Fig 8D)

First published record of this genus and species for Cy-

prus.

Mediterranean species with a flight period from late sum-

mer into winter, and larvae in Quercus species, possibly

in water-filled holes (Ricarte et al. 2010).

Remarks. In Troodos Mountains collected on Hedera

pastuchovii subsp. cypria and Taraxacum cyprium (2:

BOOS 67290210 3a C NI6dS 200)

Heringia heringi (Zetterstedt, 1843)

First published record of this genus and species for Cy-

prus.

Widespread European species but rare in the Mediterra-

nean region (Claussen & Lucas 1988).

Remarks. One female found flower visiting on Foenicu-

lum vulgare at Tzelefos Bridge (21) and one female col-

lected in a Malaise trap at Pera Pedi (3).

Ischiodon aegyptius (Wiedemann, 1830)

(Fig 8E)

First published record of this genus and species for Cy-

prus.

Mediterranean species (Dirickx 1994) and widespread in

the African continent (Mengual 2018).

Remarks. Found on Foeniculum vulgare (8: 6¢.¢ 52.9).

Melanostoma mellinum (Linnaeus, 1758)

Widespread species. Dirickx (1994) gave records from

Cyprus.

Remarks. Only collected in a Malaise trap at Pera Pedi

(22004:

©ZFMK

Hoverflies of Cyprus: results from a collecting trip in October 2017 137

Fig. 8. Adult; A, D lateral view; B, C, E, F dorsal view. A. Eumerus torsicus 3. B. Eumerus torsicus 9. C. Eumerus vestitus 2. D.

Ferdinandea aurea &. E. Ischiodon aegyptius 2. F. Merodon sp. nov. 2 (natans group) &. Scale bar = 1.0 mm.

Merodon avidus (Rossi, 1790) Merodon neofasciatus Stahls & Vujic, 2018

(Figs 9C, 9D)

Widespread central and eastern Mediterranean species.

Popovic et al. (2015) gave records from Cyprus. First published record of this species for Cyprus.

Remarks. Two male specimens were collected inasmall East Mediterranean species from the M. geniculatus

grassy meadow in ariverine forest (24) andonemaleina group (Vuji¢ et al. 2018).

Malaise trap at Pera Pedi (3).

138 Jeroen van Steenis et al.

Fig. 9. Adult; dorsal view. A. Merodon aff bessarabicus 3. B. Merodon aff bessarabicus 2. C. Merodon neofasciatus ¢. D. Mer-

odon neofasciatus 2. E. Merodon pulveris @. F. Merodon pulveris &. Scale bar = 1.0 mm.

Remarks. Identity confirmed by Ante Vujic. Widespread

but scarce in Cyprus (5: 805 39.9; 11:19: 14: 299; 25:

353 299). Found flower visiting on Dittrichia viscosa

subsp. angustifolia at Akrotiri marsh and Crithmum mar-

itimum at Kavo Gkreko.

Bonn zoological Bulletin 68 (1): 125-146

Merodon pruni (Rossi, 1790)

(Fig 6C)

Widespread Mediterranean species (Claussen & Lucas

1988). Dirickx (1994) gave records from Cyprus.

©ZFMK

Hoverflies of Cyprus: results from a collecting trip in October 2017 139

Remarks. Found flower visiting on Foeniculum vul-

gare, Cachrys crassiloba and Crithmum maritimum (3:

1033 72Q; 8: 19; 16: 14 299; 17: 53 o¢ 8Q9; 21:

255 399; 24: 19; 25: 234 19). Found together with

the presumed wasp model (Crabronidae: Philanthus spp..,

Fig. 6D), with which the resemblance of the white-yel-

low abdominal colour and the irregular flight pattern, is

especially striking in flight.

Merodon pulveris Vuji¢ & Radenkovic¢, 2011

(Figs 9E, 9F)

First published record of this species for Cyprus.

Described from Lesvos, Greece and Turkey (Radenkovic

et al. 2011).

Remarks. Identity confirmed by Ante Vujic. Widespread

in the lower parts of Cyprus (3: 14 329; 11: 19; 14:

2333 1199; 16: 19; 17: 299; 21: 39 @). Found flower

visiting on Foeniculum vulgare and Prospero autumnale.

Also seen flying low over bare ground and around leaves

of Prospero autumnale and other bulbous plants.

Merodon aff bessarabicus

(Figs 9A, 9B)

First published record of this species for Cyprus.

Remarks. Identity confirmed by Ante Vujic. Yellow-co-

loured species found throughout the Troodos mountains

(11: 2334 1199; 12: 14; 14: 14; 15: 1¢ 19) and seen

flying around Colchicum. Morphologically this species

is rather variable concerning pile coloration on the scu-

tum and scutellum and the shape of the plate-like struc-

ture on the metatrochanter. However, the three selected

morphologically distinct specimens share the same COI

haplotype (Appendix IT) and have no differences in the

male genitalia, which indicate a broad intraspecific mor-

phological variation.

Merodon aff natans

(Fig. 8F)

First published record of this species for Cyprus.

Remarks. Identity confirmed by Ante Vuji¢. Collected at

Kourion Stadium (14: 23).

Milesia crabroniformis (Fabricius, 1775)

(Fig. SC)

First published record of this genus and species for Cy-

prus.

Widespread in the Mediterranean region (Dirickx 1994).

Remarks. The female specimen was collected while

seen flying around the ruins of a wooden building with

several old logs (11). One additional female was seen

flying through this same wooden building and later with

egg-laying behaviour at a Platanus orientalis tree with a

Bonn zoological Bulletin 68 (1): 125-146

large hole near its base. This specimen was not collected

but was photographed (Fig. 5C).

Myathropa florea (Linnaeus, 1758)

Very common and widespread species. Dirickx (1994)

gave records from Cyprus.

Remarks. Found on flowers of Hedera pastuchovii sub-

sp. cypria and Foeniculum vulgare (2: 14.19; 10: 19483

1899; 19: 19; 21:23; 22: 248).

Neoascia podagrica (Fabricius, 1775)

Widespread West-Palaearctic species, previously record-

ed from Cyprus (Claussen & Lucas 1988; Dirickx 1994).

Remarks. One male was collected on Hedera pastucho-

vii subsp. cypria close to a river (10), together with many

Riponnensia morini.

Neocnemodon spec.

First published record of this genus for Cyprus.

Remarks. Only one @ collected in a Malaise trap above

the Trooditissa picnic site (6). The females of this genus

are at the moment not identifiable. Recent insights (Vuji¢

et al. 2013) showed that Heringia and Neocnemodon are

separate genera.

Paragus (Paragus) bicolor (Fabricius, 1794)

Widespread species in Europe and northern Africa. Dir-

ickx (1994) gave records from Cyprus.

Remarks. Widespread and common species on Cyprus

(3: 6605 2999; 4: 234; 8: 293; 21: 73h 299).

Flower visiting on Cachrys crassiloba, Foeniculum vul-

gare and Polygonum equisetiforme.

Paragus (Paragus) compeditus Wiedemann, 1830

(Fig. 10A)

First published record of this species for Cyprus.

Southeastern Mediterranean species (Dirickx 1994).

Remarks. Widespread species; however, not found at

higher elevations (4: 54'3' 49.9; 5: 2344 499; 8: 16204

1699; 13: 19; 17: 12; 20: 19; 21: 344). Flower visit-

ing on Cachrys crassiloba, Foeniculum vulgare and Po-

lygonum equisetiforme.

Paragus (Paragus) quadrifasciatus Meigen, 1822

(Fig. 10B)

Widespread Mediterranean species, extending its range

to Northern Europe and reaching the Netherlands (Reem-

er et al. 2009). Dirickx (1994) gave records from Cyprus.

Remarks. Widespread and common species on Cyprus

O13" 65:0 109 Or 107 td: 161g Tes 17: Ad:

©ZFMK

140 Jeroen van Steenis et al.

Fig. 10. Adult; A-D, dorsal view; E, F lateral view. A. Paragus compeditus ¢. B. Paragus quadrifasciatus 3. C. Pipiza noctiluca,

&. D. Pseudodoros nigricollis 3. E. Riponnensia morini &. F. Sphaerophoria bengalensis 3. Scale bar = 1.0 mm.

21: 1604; 22: 14; 24: 14). Flower visiting on Cachrys Paragus (Pandasyopthalmus) haemorrhous (Meigen,

crassiloba, Foeniculum vulgare and Polygonum equiset- 1822)

iforme.

Widespread in Europe, Afrotropical Region and Euro-

pean parts of Russia. Dirickx (1994) gave records from

Cyprus.

Hoverflies of Cyprus: results from a collecting trip in October 2017 141

Remarks. Collected on flowers of Foeniculum vulgare

and Dittrichia viscosa subsp. angustifolia (5: 14; 21:

233).

Paragus (Pandasyopthalmus) tibialis (Fallén, 1817)

Widespread in Europe, North of Africa, Turkey and Isra-

el. Dirickx (1994) gave records from Cyprus.

Remarks. More widespread and more common than the

previous species (4: 40.9; 5: 23'3; 8: 35'S), flower vis-

iting on Dittrichia viscosa subsp. angustifolia, Foenicu-

lum vulgare and Polygonum equisetiforme.

Pelecocera (Chamaesyrphus) pruinosomaculata (Strobl,

1906)

(Fig. 7B)

First published record of this genus and species for Cy-

prus.

Dirickx (1994) recorded it only from the Iberian Peninsu-

la, and showed his doubts about its occurrence in Israel.

Claussen & Standfuss (2017) recorded the species from

mainland Greece. As there might be several undescribed

Pelecocera (Chamaesyrphus) species in the Mediterra-

nean region (Claussen & Lucas 1988; Claussen & Stand-

fuss 2017), the true identity of the Israeli records remain

uncertain.

Remarks. One male was collected on Polygonum eq-

uisetiforme flowers in partly shaded conditions close to

several Hedera pastuchovii subsp. cypria plants stand-

ing on either side of a small stream. On these Hedera

plants one male of Pelecocera (Chamaesyrphus) sp. nov.

was collected, indicating that both species can be found

in flight closely together. One additional male of P. (C_)

pruinosomaculata was collected in a Malaise trap in an

abandoned vineyard (3).

Pelecocera (Chamaesyrphus) sp. nov.

(Fig. 7A)

First published record of this species for Cyprus.

So far known only from the Troodos Mountains in Cy-

prus (pers. obs. A. van Eck).

Remarks. All specimens were collected at or on Hedera

pastuchovii subsp. cypria (10: 19: 19: 2844 1399; 22:

14), where most specimens were seen flying close to the

flowers, and also feeding on them. The species was most

often seen flying in fully sunlit places, occasionally in

partially shaded places at a height of 1 to 4 metres above

ground level. One Malaise trap placed over a low-grow-

ing Hedera pastuchovii subsp. cypria bush (Fig. 1D)

contained 24 specimens and a yellow pan trap close by

the Malaise trap contained a single specimen. This spe-

cies will be described in a forthcoming work (A. van Eck

in prep.). It is considered that this species has a strong

connection to the Hedera flowers and possibly this is the

Bonn zoological Bulletin 68 (1): 125-146

main food source of the adults and possibly also a favour-

able mate-location place.

Pipiza noctiluca (Linnaeus, 1758)

(Fig. 10C)

First published record of this genus and species for Cy-

prus.

Common and widespread species in Europe (Vujic et al.

2013).

Remarks. Specimens were collected visiting flowers of

Hedera pastuchovii subsp. cypria and seen flying low

through vegetation; also collected in a Malaise trap (2:

19; 3 1399 1088992 V1).

Pseudodoros nigricollis Becker, 1903

(Fig. 10D)

Recently recorded from one locality at the west coast of

Cyprus (Van Eck & Makris 2016).

Remarks. Now also recorded in a second locality, in the

south near Akrotiri Salt Lake (13: 14¢'¢' 12). Found rest-

ing or flying slowly through Phragmites australis (Cav.)

Trin. ex Steud. leaves; one male caught by a yellow crab

spider on Dittrichia viscosa subsp. angustifolia.

Riponnensia morini Vujic, 1999

(Fig. 10E)

First published record of this species for Cyprus.

Threatened and with a restricted range on the Balkans,

and possibly extinct at the type locality (Vuji¢ et al. 2001),

but recently recorded from FYR Macedonia (Krpaé et al.

2011) and Greece (Claussen & Standfuss 2017). Up to

now recorded only in spring.

Remarks. All specimens have been collected on Hede-

ra pastuchovii subsp. cypria along a bridge over a small

river (10: 90¢'4¢ 59. 2), most specimens were seen in half

shade. This is the first time the genusname Riponnensia

is published for Cyprus, although one species of this ge-

nus was mentioned from Cyprus by Dirickx (1994) under

the name Orthonevra longicornis , which was transferred

to the genus Riponnensia by Maibach et al. (1994).

Scaeva pyrastri (Linnaeus, 1758)

Very common and widespread species. Dirickx (1994)

provided records from Cyprus.

Remarks. Found on Hedera pastuchovii subsp. cypria

(2: 299; 6:19; 19: 2¢¢ 299).

Sphaerophoria bengalensis Macquart, 1842

(Fig. 1OF)

First published record of this species for Cyprus.

©ZFMK

142 Jeroen van Steenis et al.

Ghorpadé (2009) synonymized S. turkmenica Bankows-

ka, 1964 under S. bengalensis. In the Palaearctic Region,

Speight (2017) reported this species from parts of Euro-

pean and Asiatic Russia, the Caucasus (Armenia, Azer-

baijan), Iran, Arabian Peninsula (Oman), Kazakhstan,

and Turkmenistan. The species was originally found in

the Oriental Region along the Himalayas to West Bengal.

Remarks. Several specimens were collected at Agios

Sozomenos while flower visiting on Foeniculum vulgare.

Also collected at Hala Sultan Tekke and in a Malaise trap

in Pera Pedi (3: 14; 4: 14; 8: 644).

Sphaerophoria rueppelli Wiedemann, 1830

Widespread European species. Dirickx (1994) provided

records from Cyprus.

Remarks. Common on Cyprus (4: 53° 22.9; 5: 10¢¢

399: 7: 2388; 8: 1¢ 899; 9: 14; 17: 19; 21:48 19).

Found flower visiting on Polygonum equisetiforme, Foe-

niculum vulgare and Dittrichia viscosa subsp. angusti-

folia.

Sphaerophoria scripta (Linnaeus, 1758)

Very common and widespread species. Dirickx (1994)

gave records from Cyprus.

Remarks. Found flower visiting on Foeniculum vulgare,

Cachrys crassiloba and Dittrichia viscosa subsp. angus-

tifolia (3: 43.4; 5: 33.4; 8: 19).

Syritta flaviventris Macquart, 1842

Widespread Mediterranean species. Dirickx (1994) gave

records from Cyprus.

Remarks. Flower visiting on Polygonum equisetiforme

and Dittrichia viscosa subsp. angustifolia (4. 16¢¢

499: 5: 303¢ 1099; 13: 294 19).

Syritta pipiens (Linnaeus, 1758)

Very common and widespread species. Dirickx (1994)

gave records from Cyprus.

Remarks. Very common species (1: 11¢¢ 399; 2: 12;

SPU S224 2056 BOOS Saree os O60.

1029; 7:13; 8: 533 329; 10: 50h 299; 12:14 19;

182268 Vw 2 IIE LOEG C4 OO? 20: WS ITI GS

299; 22: 245 299; 24: 19), flower visiting on Po-

lygonum equisetiforme, Foeniculum vulgare, Cachrys

crassiloba, Dittrichia viscosa subsp. angustifolia and

Hedera pastuchovii subsp. cypria.

DISCUSSION

Little information is known about the flower fly fauna of

Cyprus. In his work on the syrphid fauna of the Mediter-

Bonn zoological Bulletin 68 (1): 125-146

ranean countries, Dirickx (1994) provided bibliographic

references for 36 species recorded from Cyprus. But nei-

ther comprehensive species lists nor articles about col-

lecting trips on Cyprus have been published until now.

Based on literature studies, recent field trips and some

collection work, circa 70 species are recorded from Cy-

prus (van Eck unpub.). Our collecting trip resulted with

more than half (52) of the known fauna for this island,

adding nine new genera and 23 new species records to

the island’s list. The genera Eumerus and Merodon are

well represented with eight and six species, respective-

ly. These genera are very species-rich in the Mediterra-

nean region (e.g. Hurkmans 1993; Grkovic et al. 2017).

Although the genus Merodon is relatively well studied

in the Eastern Mediterranean region (Hurkmans 1993;

Radenkovic¢ et al. 2011; Popovic et al. 2015; Vujic et al.

2018), two undescribed species have been found on this

trip, which, however, were already known to occur on

Cyprus (A. Vuji¢ pers. comm.). Within the genus Eumer-

us, some of the listed species differ from mainland spec-

imens in several characters and some collected females

could not be identified. It is likely that some of the Cy-

priot Eumerus taxa will turn out to be different from the

mainland species and name changes are to be expected

(A. Vuji¢ pers. comm. ).

The species’ composition differs between autumn and

spring, and the number of species is most likely lower in

autumn than in spring according to current evidence (van

Eck unpub.). Based on our experience and fieldwork,

more species are likely to occur in Cyprus and several of

those taxa might be endemics, as Ceriana glaebosa (Van

Steenis et al. 2016), due to the geographical landscape

and the relative isolation of the island. The present re-

sults prompt us to continue our fieldwork and collecting

trips to improve the knowledge on biology, ecology and

taxonomy of Syrphidae and to persist with work on local

hoverfly faunas.

Acknowledgments. The Department of Environment (ref. no’s

02.15.001.003 and 04.05.002.005.006) and the Department of

Forests (ref. no. 2.15.05.3) of the Ministry of Agriculture, Ru-

ral Development and Environment of the Republic of Cyprus

(Nicosia, Cyprus) kindly permitted us to collect in Cyprus. Mr

Michael Makris (the Paphos Divisional Forests Officer) kind-

ly informed us about suitable collecting places when we met

each other out in the field. We thank Claudia Etzbauer (ZFMK,

Germany) for her support to obtain molecular data. Ante Vujic¢

(Novi Sad) helped with identification of some species of the

genera Eumerus and Merodon, Jeffrey Skevington (Ottawa)

gave permission to use DNA barcodes of Ceriana vespiformis

produced by his laboratory and Eddie John (Cowbridge, UK)

checked the English text. The Dutch Uyttenboogaart-Eliasen

©ZFMK

Hoverflies of Cyprus: results from a collecting trip in October 2017 143

foundation under number SUB.2017.05.08 provided financial

support for the first author.

REFERENCES

Assem MA, Nasr ESA (1967) A syrphid fly, Eumerus amoenus

Loew injurious to onion in U.A.R. (Diptera: Syrphidae). Ag-

ricultural Research Review (Cairo) 45(2): 27-32

Bankowska R (1964) Studien tiber die palaarktischen Arten der

Gattung Sphaerophoria St.Farg. et Serv. (Diptera, Syrphi-

dae). Annales Zoologici, Warszawa 22: 285-353

Bartsch H, Binkiewicz E, Klintbjer A, Radén A, Nasibov E

(2009) Blomflugor: Eristalinae & Microdontinae. National-

nyckeln till Sveriges flora och flora, DH 53b. Artdatabanken,

SLU, Uppsala. 478 pp

Bradescu V (1991) Les Syrphides de Roumanie (Diptera, Sy-

rphidae). Clés de détermination et répartition. Travaux du

Muséum d‘ Histoire naturelle “Grigore Antipa” 31: 7-83

Claussen C, Lucas JAW (1988) Zur Kenntnis der Schwebflie-

genfauna der Insel Kreta mit der Beschreibung von Eumer-

us minotaurus sp. n. (Diptera, Syrphidae). Entomofauna,

Zeitschrift fir Entomologie 9(5): 133-168

Claussen C, Stahls G (2007) A new species of Cheilosia Mei-

gen from Thessaly/Greece, and its phylogenetic position

(Diptera, Syrphidae). Volucella 8: 45-62

Claussen C, Standfuss K (2017) Schwebfliegen (Diptera, Sy-

rphidae) im Olivengtrtel SO-Thessaliens/GR, neue Funde

und Gesamtverzeichnis. Entomofauna, Zeitschrift fiir Ento-

mologie 38(2): 405—424

Dirickx HG (1994) Atlas des Diptéres syrphides de la région

méditerranéenne. L’ Institut royal des Sciences naturelles de

Belgique, Bruxelles. 317 pp

Efflatoun HC (1922) A monograph of Egyptian Diptera, Pt. 1:

Syrphidae. Mémoires de la Société Entomologique D’ Egypte

2(1): 1-123

Georghiou GP (1977) The Insects and Mites of Cyprus. Benaki

Phytopathological Institute, Athens. 347 pp

Ghorpadé K (2009) Some nomenclatural notes on Indian Sub-

region Syrphini (Diptera—Syrphidae). Colemania 15: 3—13

Grkovic A, Vuji¢ A, Radenkovic S, Chroni A, Petanidou T

(2015) Diversity of the genus Eumerus Meigen (Diptera,

Syrphidae) on the eastern Mediterranean islands with de-

scription of three new species. Annales de la Société ento-

mologique de France 51: 361-373

Grkovic A, Vuji¢ A, Chroni A, van Steenis J, Dan M, Raden-

kovi¢ S (2017) Taxonomy and systematics of three species of

the genus Eumerus Meigen, 1822 (Diptera: Syrphidae) new

to southeastern Europe. Zoologischer Anzeiger 270: 176-192

Hebert PDN, Cywinska A, Ball SL, deWaard JR (2003) Bio-

logical identifications through DNA barcodes. Proceedings

of the Royal Society of London B 270: 313-321

Hurkmans W (1993) A monograph of Merodon (Diptera: Syr-

phidae). Part 1. Tijdschrift voor Entomologie 136: 147—234

Krpaé VT, Vujié A, Simié S, Lazarevska S (2011) New data on

hover-flies (Diptera: Syrphidae) in Macedonia. Entomologia

Croatica 15: 185-208

Lyneborg L, Barkemeyer W (2005) The genus Syritta, A World

Revision of the genus Syritta Le Pelletier & Serville, 1828

(Diptera: Syrphidae). Entomograph 15. Apollo Books, Den-

mark. 224 pp

Maibach A, Goeldlin de Tiefenau P, Speight MCD (1994) Lim-

ites génériques et caractéristiques taxonomiques de plusieurs

genres de la Tribu des Chrysogasterini (Diptera: Syrphidae)

Bonn zoological Bulletin 68 (1): 125-146

2. Statut taxonomique de plusieurs des espeéces étudiées et

analyse du complexe Melanogaster macquarti (Loew).

Annales de la Société entomologique de France (N.S.) 30:

253-271

Mengual X (2018) A new species of /schiodon Sack (Diptera,

Syrphidae) from Madagascar. African Invertebrates 59: 55—

Mengual X, Stahls G, Rojo S (2008) Molecular phylogeny of

Allograpta (Diptera, Syrphidae) reveals diversity of lineages

and non-monophyly of phytophagous taxa. Molecular Phylo-

genetics and Evolution 49: 715-727

Mengual X, Stahls G, Rojo S (2012) Is the mega-diverse genus

Ocyptamus (Diptera, Syrphidae) monophyletic? Evidence

from molecular characters including the secondary structure

of 28S rRNA. Molecular Phylogenetics and Evolution 62:

191-205

Mutin, VA, Steenis J van, Steenis W van, Palmer C, Bot S.,

Skevington J., ..., Mengual X. (2016) Syrphidae fauna (Dip-

tera: Syrphidae) of Tumnin river basin, the eastern macro-

slope of the northern Sikhote-Alin, Russia. Far Eastern En-

tomologist, 306, 1-31

Popovic D, Aéanski J, Djan, M, Obreht D, Vujic A, Radenkovic

S (2015) Sibling species delimitation and nomenclature of

the Merodon avidus complex (Diptera: Syrphidae). European

Journal of Entomology 112: 790-809

Radenkovi¢ S, Vuji¢ A, Stahls G, Pérez-Bafion C, Rojo S,

Petanidou T, Simi¢ S (2011) Three new cryptic species of the

genus Merodon Meigen (Diptera: Syrphidae) from the Island

Lesvos (Greece). Zootaxa 2735: 35-56

Ricarte A, Marcos-Garcia A, Rotheray GE (2008) The early

stages and life histories of three Eumerus and two Merodon

species (Diptera: Syrphidae) from the Mediterranean region.

Entomologica Fennica 19: 129-41

Ricarte A, Nedeljkovic Z, Quinto J, Marcos-Garcia MA (2010)

The genus Ferdinandea Rondani, 1844 (Diptera, Syrphidae)

in the Iberian Peninsula: First records and new breeding sites.

Journal of the Entomological Research Society 12(3): 57-69

Ricarte A, Souba-Dols GJ, Hauser M, Marcos-Garcia MA

(2017) A review of the early stages and host plants of the gen-

era Eumerus and Merodon (Diptera: Syrphidae), with new

data on four species. PLoS ONE 12(12): e0189852. https://

doi.org/10.1371/journal.pone.0189852

Sack P (1932) Die Fliegen der Palaearktischen Region, 31.

_ Syrphidae. Stuttgart (Schweizerbart), 451 pp

Sasic¢ L, Aéanski J, Vujic A, Stahls G, Radenkovic S, Milic, D.,

..., Dan, M. (2016) Molecular and morphological inference

of three cryptic species within the Merodon aureus species

group (Diptera: Syrphidae). PLoS ONE 11(8): e0160001.

https://doi.org/10.1371/journal.pone.0160001

Smit JT (2014) Two new species of the genus Callic era Panzer

(Diptera: Syrphidae) from the Palaearctic Region. Zootaxa

3779(5): 585-590

Smit JT, van Harten A, Ketelaar R (2017) Order Diptera, family

Syrphidae. The hoverflies of the Arabian Peninsula. Arthro-

pod fauna of the UAE 6: 572-612

Sorokina VS, Cheng X-Y (2007) New species and new dis-

tributional records of the genus Paragus Latreille (Diptera,

Syrphidae) from China. Volucella 8: 1-33

Speight MCD (1991) Callicera aenea, C. aurata, C. fagesi

and C. macquarti redefined, with a key to and notes on the

European Callicera species (Diptera: Syrphidae). Dipterists

Digest 10: 1-25. http:/\www.dipteristsforum.org.uk/docu-

ments/DD/df_1_10.pdf

Speight MCD, Sarthou J-P (2017) StN keys for the identification

of the European species of various genera of Syrphidae 2017/

©ZFMK

144 Jeroen van Steenis et al.

Clés StN pour la détermination des espéces Européennes de

plusieurs genres des Syrphidae 2017, vol. 99, Syrph the Net

publications, Dublin, 139 pp

Speight MCD (2017) Species accounts of European Syrphidae,

2017. Syrph the Net, the database of European Syrphidae

(Diptera), vol.97, Syrph the Net publications, Dublin, 294 pp

Ssymank A (2013) Contribution to the fauna of hoverflies (Dip-

tera: Syrphidae) of northeastern Greece, with special focus

on the Rhodope Mountains with the Natura 2000 site Perio-

chi Elatia, Pyramis Koutra. Studia dipterologica 19 (2012):

17-57

Stackelberg AA (1961) Palaearctic species of the genus Eumer-

us Mg. (Diptera, Syrphidae). Horae Societatis Entomologi-

cae Unionis Soveticae 48: 181—229 [in Russian]

The Plant List (2013) The Plant List Version 1.1. Published

on the Internet; http://www.theplantlist.org/ (accessed

14.X1.2018)

Townes H (1972) A light-weight Malaise trap. Entomological

News 83: 239-247

van Eck A, Makris C (2016) First records of Pseudodoros nigri-

collis Becker (Diptera: Syrphidae) from Cyprus. Biodiversity

Data Journal 4: e8139. https://doi.org/10.3897/BDJ.4.e8139

van Steenis J, van Steenis W, Ssymank A, van Zuijen MP, Ned-

eljkovié Z, Vuji¢ A, Radenkovi¢ S (2015) New data on the

Bonn zoological Bulletin 68 (1): 125-146

hoverflies (Diptera: Syrphidae) of Serbia and Montenegro.

Acta entomologica serbica 20: 67—98

van Steenis J, Ricarte A, Vujic A, Birtelle D, Speight MCD

(2016) Revision of the West-Palaearctic species of the tribe

Cerioidini (Diptera, Syrphidae). Zootaxa 4196(2): 151-209

van Veen MP (2004) Hoverflies of Northwest Europe: Identi-

fication keys to the Syrphidae. KNNV Publishing, Utrecht,

254 pp

Vuji¢ A, Simié S (1998) Genus Eumerus Meigen, 1822 (Dip-

tera: Syrphidae) in area of former Yugoslavia. Glasnik

Prirodnjatkog Muzeja u Beogradu B 49-50: 173-190

Vujic A, Simié S, Radenkovic S (2001) Endangered species

of hoverflies (Diptera: Syrphidae) on the Balkan Peninsula.

Acta entomologica serbica 5: 93-105

Vuji¢ A, Stahls G, Aéanski J, Bartsch H, Bygebjerg R, Ste-

fanovic A (2013) Systematics of Pipizini and taxonomy of

European Pipiza Fallén: molecular and morphological evi-

dence (Diptera, Syrphidae). Zoologica Scripta 42: 288-305

Vujic A, Stahls G, Aéanski J, Rojo S, Pérez-Bafion C, Raden-

kovi¢ S (2018) Review of the Merodon albifasciatus Mac-

quart species complex (Diptera: Syrphidae): the nomencla-

tural type located and its provenance discussed. Zootaxa

4374: 25-48

©ZFMK

a 86106 sove6 | sore 1768 1768 1768 [soca] suaaynd wy

197 16 197 16 ; [roca] smmiosnfoou W

197 16 878 66 [LOE] sunjou jye W

197 16 87866 Lege] sunjou jye W

78688 90688 [goed] snaiqnapssag jye W

L99¢d] snoiqnspssaq Je W

[Z9Ed] snaiqvspssaq Je W

Z£9ECU

] u‘ds ;w

“SUDUTTOAS UOPOsAW PdJD9T9S UdDMJOq (ALILIIWIS 0%) SOOULISIP ISIMITed Pd}DOIIONUN [OOD “TT Xipueddy

C€908C000-dId jensusW “xX “897 ‘LIOTX LO W OLE “A WEL ITLEoTE

“MNAZ Nu SEEPoPE WR] PUIM SoILIO “ejnose ‘soyded :‘SAYdAD

7908c000-dId Jensusl “X 897 “LIOTX'LO WIT “A LE 877 oTE

“MNAZ NuZ9'S LOPobe Whipeis UoLINOY juorouY ‘Idoysidg “Jossewty :SAadAD

09087000-dIG Jensusyl “XxX 2397 “L107 X90 W Lr “A 7 6b. 8EoTE

-MNAZ N 9’ 87,6Sob€ “Weeans sapiddy ‘1so10,4 soydeg ‘soydeg ‘SQYdAD

¢L08c000-dId jensusl “X 2897 “LIOTX'LO WIT “A LE 8778S oTE

a eas “MNAZ N.iZ9'S LOPE Wipes UoLINOY juorouY ‘Idoysidy “Jossewry :SAYdAD

9908c000-dId jensucy “xX :°89T “L107 X'€0

“MNAZ WS “A BLLTISoTE N 76 SELEoPE YSIL UNOLTY ‘TOSseul'T ‘SVAdAD

ISO6S6MIN €908c000-dId jensusy “XK “897 “L107 X' FO W OPEL “A PI TEOSoTE

“MNAZ N SO'ES.PSoPE SUS UII PSSIPOOIL, “Sony ‘TOSseUTT ‘SAAD

LS$087000-dIG jensuaW “xX 897 “LIOTX TI “W Lp “A 7 6p, 8E0TE

-MINAZ N 9 87,6SopE ‘Weons sapiddy ‘yso10,J soydeg ‘soyded ‘SAYdAD

616£c000-dId Jensusl “X :°89T “LIOTX TI-80 “osiepe “W 188

“MNAZ “A 16'SS,0SoTE N 89S, 1SoP€ “PILAOUIA PIO “Ipod Jog ‘JOSSeUT'T :SNAdAD

€Z8Z£c000-dId Jensuspl “X 2897 “L107 X60 “X1/2Y VAapaf] UO “WI ZSET “A .,19'61,0SoTE

SPOSSESIN (snydudsapupy))

“INAZ N uSEPS.SSobE “VOSA PeOs SuOye ‘soneyd ‘JOsseul'] :SAAdAD eee

6v6L7000-dIG jensuayl “X -89T “L107 X'LO-ZO ‘asleep “We 18g :

‘ ‘ ; snoeuul pan]yIou vzid1

eQoeo as INAZ FI 16°SS,0S0ZE N 1.895, 1SobE ‘PAeAOUIA PIO ‘Ipad dq ‘JOSSeUI] “SAAD (8521 D p pomnoow d | 6sed

LL8L7000-dIG uolinZ AGW .897 LIOTX TL W O09 “A LPS 9bPhoTE N wIL TL ESob€ P

9P06S6AN -JNAZ ‘TIOAIOSOY NOUILUTY JO YOU ‘Ospliq SOJaTay JO Nos ‘soydedg ‘SQUdAD PLOG, SHEE ay STURT UES Esoqenis MUNA )-| 3560.

oN TORO. UOHVULIOJUI Jaqe Ivak puv 10yjn saidods snua a Said

yueguas oN CI MINAZ 0 JUL [9qu'T p quny I re qe]

‘saouanbas [QD OY} OF S1OquINU UOISsad0R YURqUSyH YUM */ [07 snIdA_D UO paydaT]oo suswIdads JOYONOA WN ‘T xXipueddy

9S06S6XAN SNIIGDADSS AQ Ife uopolayy

SS06S6XIN SUubIDU Je uopolayy

VSO6S6AN SNIIGDADSS AQ Ife uopolayy

[107 ‘SlAoyuapey 7 dfn sidaajnd uopolay’

TSO6S6MWN 8107 “SIINA 2 sTYyRIS snyolospfoau uopolayy

subjou jye uopo1aeyy

OSO06S6XAN SNIIGDADSS AQ Ife uopo1ayy

(snydudsapupy))

Dda9094/ag

(9061 ‘IGoNS) | vipjnovwosoumnsd

6V06S6AWN

Hoverflies of Cyprus: results from a collecting trip in October 2017

‘u ds

SO8| SOOM PO FSS | SOs | SOmal|| hoae| he: || so:

©ZFMK

Bonn zoological Bulletin 68 (1): 125-146

Jeroen van Steenis et al.

146

©ZFMK

[LL8L7000-dIG-AWAZ,

OP06SOXIIN $89°96 96'S6 90€ L6 PIT L6 66L'96 661'96 661'96 61:96 61:96 saa

PePTLOX $89°96 110°66 Zh8 66 67L'66 PEL 66 PEL'66 PEL'66 PEL'66 P£L'66 Ur pace

L7PZLOXIN 96'S6 110°66 £686 6£8'86 858 86 858'86 858'86 8S8'86 858'86 pa syn

STPTLONN 90€'L6 Zh8'66 £6'86 001 001 001 001 001 001 [1l-vecac No]

smusofidsaa ‘Dd

yurguey psogav]s ‘Dd smusofidsaa ‘Dd smusofidsaa ‘Dd smusofidsaa ‘Dd smlsofidsaa “D smsofidsaa ‘Dd smsofidsaa ‘Dd smsofidsaa ‘Dd smsofidsaa ‘Dd smsofidsaa ‘Dd

001

[ST-8IZNVUAS]

smusofidsaa “Dd

[SI-LICAVYAS

smusofidsaa ‘Dd

‘SIOquINU UOIssao0R YUR_UayH YIM ‘susUTIdads DUDLIAD Pa}d9TAS UI9MJOq (ATLILITUUTS 0%) S9URISTIP 9SIMATed Po}d9LIONUN [QD “TIT Xipusddy

Bonn zoological Bulletin 68 (1): 125-146

FORSCHUNGS

Bonn zoological Bulletin 68 (1): 147-162

2019 - Sharma B.K. & Sharma S.

https://do1.org/10.20363/BZB-2019.68.1.147

Research article

urn: |sid:zoobank.org:pub:D9308652-B9BF-4BBB-B573-F1C4B53E1ACS

The biodiverse rotifers (Rotifera: Eurotatoria) of Northeast India:

faunal heterogeneity, biogeography, richness in diverse ecosystems

and interesting species assemblages

Bhushan Kumar Sharma’’ & Sumita Sharma?

'2 Department of Zoology, North-Eastern Hill University, Shillong — 793 022, Meghalaya, India

* Corresponding author: Email: profbksharma@gmail.com

'urn:lsid:zoobank.org:author:FD069583-6E7 1-46D6-8F45-90A 87F35BEFE

2urn:Isid:zoobank.org:author:668EQFE0-C474-4D0D-9339-F01ADFD239D1

Abstract. The biodiverse Rotifera of northeast India (NEI) revealed 303 species belonging to 53 genera and 24 families;

~96% of these species examined from seven states of NEI affirm the rotifer heterogeneity of our plankton and semi-plank-

ton collections. This study documents the record number of species of global and regional biogeographic interest, high-

lights affinity with Southeast Asian and Australian faunas, and indicates notable heterogeneity in richness and composition

amongst the seven northeastern states. The speciose rotifers of small lentic biotopes of Arunachal Pradesh, Mizoram,

Nagaland, Meghalaya, Manipur and Tripura, the floodplain lakes (bee/s) and small wetlands (dobas and dubies) of the

Brahmaputra and the Barak floodplains of Assam, and the floodplain lakes (pats) of Manipur are noteworthy. Deepor Beel

and Loktak Lake (two Ramsar sites) are the globally rich rotifer ‘hotspots’. Interesting assemblages per sample of 80+

species in certain beels and pats, and up to 50 species in dobas and dubies depict the ‘Rotifera paradox’. The most diverse

and interesting Rotifera of NEI, than any other region of India, is attributed to habitat and ecosystem heterogeneity of wa-

ter bodies spread over varied ecological regimes, the location of the region in the Himalayan and Indo-Burma Biodiversity

hotspots, vital biogeographic corridor of ‘the Assam gateway’, ‘the rotiferologist effect’ and the sampling intensity. Our

ISSN 2190-7307

http://www.zoologicalbulletin.de

study marks a valuable contribution to biodiversity and biogeography of the Indian, Asian and Oriental Rotifera.

Key words. Biodiversity, distribution, important taxa, species assemblages, Rotifera paradox.

INTRODUCTION

Northeast India (NEI), a geographic division of India,

originally consisted of the contiguous seven ‘sister-states

of Assam, Arunachal Pradesh, Meghalaya, Manipur,

Mizoram, Nagaland and Tripura; the logistically distant

state of Sikkim was recently added to this easternmost re-

gion of India. NEI occupies a unique geographic location

in the Indo-Chinese sub-division of the Oriental region,

forms part of both the Himalayan and the Indo-Burma

biodiversity ‘hot-spots’, and includes ‘the Assam-gate-

way’ as a vital biogeographic corridor of India (Mani,

1974). This region is known for diverse freshwater eco-

systems, ranging from small lentic biotopes to the fluvial

floodplains, located under varied geo-morphologic and

ecological regimes which impart special biodiversity

and ecological diversity interest to assessment of aquatic

metazoan diversity of NEI. Referring particularly to this

aspect, Sharma & Sharma (2014a) initially commented

on the importance of NEI vis-a-vis the rich biodiversity of

Rotifera — an important group of freshwater zooplankton.

Nevertheless, this work highlighted distinct gaps relating

to the poorly explored states of Arunachal Pradesh (the

eastern Himalayas), Nagaland, Manipur and Mizoram as

Received: 06.03.2019

Accepted: 18.06.2019

well as stressed on the need for overall augmentation of

faunal analyses from other states of this region.

The present study, a follow up of our earlier work

(Sharma & Sharma 2014a), endeavors to provide a com-

prehensive assessment of Rotifera biodiversity of NEI

based on intensive collections from the former seven

‘sister-states’ of Assam, Arunachal Pradesh, Meghalaya,

Manipur, Mizoram, Nagaland and Tripura. We present

an exhaustive species inventory of the rotifers known to

date from NEI and provide illustrations of selected rare

and interesting species to provide validations otherwise

routinely lacking in the Indian works (Sharma & Sharma

2014a, 2017). Remarks are made on Rotifera heteroge-

neity of NEI with reference to species richness, nature

and composition, elements of global and regional bio-

geographic interest, important taxa, and comparison of

the rotifer faunas of the sampled seven states. We also

comment on ecological diversity and interesting species

assemblages found in our studies on the floodplain lakes

(bee/s) and small wetlands (dobas and dubies) of the

Brahmaputra and the Barak river floodplains of Assam;

the floodplain lakes (pats) of Manipur; and small lentic

ecosystems of Arunachal Pradesh, Mizoram, Nagaland,

Meghalaya, Manipur and Tripura. This intensive study

Corresponding editor: B. Huber

Published: 01.07.2019

148 Bhushan Kumar Sharma & Sumita Sharma

fa Shee let, so

oe }

\ : e pel

aa i

p ,

=a) a 5

ft ;

NORTHEAST INDIA

Arunachet Pradesh

Sikkim 72

engtok ltanagar / SS

re) g f *

: re A

+ Guwahati Assam 4 \

Goat BA

Shillong

Meghalaya

Tripura

Aizwal

Mizoram

Agartala\

Fig. 1A—B. A. Map of India showing (in blue color) northeast India (NEI). B. Map of NEI indicating the states of Arunachal

Pradesh, Assam, Manipur, Meghalaya, Mizoram, Nagaland and Tripura.

marks an important contribution to biodiversity and bio-

geography of Rotifera of India, Asia and the Oriental re-

gion as well as of the tropical and subtropical floodplains

and small lentic ecosystems.

MATERIALS & METHODS

This study is based on analysis of plankton and semi—

plankton samples collected, during several faunal and lim-

nological surveys undertaken between 1998-2017, from

scattered localities of the seven states (between 90—94°E,

22-—28°N) of NEI (Fig. 1A—B). The samples were collect-

ed from the Brahmaputra valley (90°-93°E, 26°—27°N)

and the Barak valley (24°48’—24°80’N, 92°45’-92°75’E)

of Assam; Tripura (92°10’—92°20’E, 22°56’—24°32’N);

Arunachal Pradesh (26°28’—29°30’N, 91°20’—97°30’E),

Mizoram (21°58’—24°35’N, 92°15’—93°29’E), Megha-

laya (90°05’—92°40’E, 25°10’—26°15’N); and Nagaland

(25°4’—27°0’N, 93°3’-93°5’E). The collections were ob-

tained from small ephemeral and perennial lentic ecosys-

tems of Arunachal Pradesh, Mizoram, Meghalaya, Ma-

nipur, Nagaland and Tripura; small floodplain wetlands

(dobas or dubies) as well as floodplain lakes (bee/s) of

the Brahmaputra and Barak river basins, respectively and

beels of Majuli River Island of Assam; the floodplain

lakes (pats) of the Iral, Imphal and Thoubal river basins

of Manipur; selected reservoirs of Meghalaya, Mizoram

and Tripura; and intensive limnological surveys of two

Ramsar sites namely Loktak Lake (Manipur) and Deepor

Bonn zoological Bulletin 68 (1): 147-162

beel (Assam). The voucher collections are deposited in

the holdings of Zoological Survey of India, Kolkata. In

addition, our species inventory includes certain sessile

and bdelloid rotifers not observed in our collections but

otherwise recorded from NEI (Sharma & Sharma 2014a).

All the samples were collected by towing a nylobolt

plankton net (mesh size # 50 um) from varied freshwater

ecosystems in seven states of NEI and were preserved

in 5% formalin. In addition, some collections were not

preserved to examine live rotifers. Individual collec-

tions were screened with a Wild stereoscopic binocular

microscope; the rotifers were isolated and mounted in

polyvinyl alcohol-lactophenol mixture, and were ob-

served with a Leica DM 1000 image analyzer fitted with

a drawing-tube. The micro-photographs were taken with

a Leica DM 1000 image analyzer. Rotifera species were

identified following the works of Koste (1978), Koste

and Shiel (1987, 1989, 1990), Segers (1995), Sharma

(1983, 1987a, 1987b, 1998, 2014), Sharma & Sharma

(1997, 1999, 2000, 2008, 2014b, 2014c, 2015a, 2018a,

2018b) and Jersabek & Leitner (2013). Segers (2002)

was followed for the system of Rotifera classification

and comments on the distribution of various taxa were

made following Segers (2007) and Jersabek & Leitner

(2013). The community similarities were calculated us-

ing Serensen’s index (Sorensen 1948). Hierarchical clus-

ter analysis, based on Sorensen’s similarities, was done

using SPSS (version 11.0) to examine the rotifer commu-

nity groupings.

©ZFMK

The biodiverse rotifers of Northeast India

RESULTS

We record a total of 303 species of Rotifera (Table 1)

belonging to 53 genera and 24 families from Northeast

India (NEI). Of these, 292 species (~96%) are observed

in our plankton and semi-plankton collections from sev-

en ‘sister states’ of NEI. A detailed systematic list of the

documented taxa is presented below:

Systematic list of Rotifera recorded from Northeast

India

Phylum: Rotifera

Class: Eurotatoria

Subclass: Monogononta

Order: Ploima

Family: Brachionidae

1. Anuraeopsis coelata De Beauchamp, 1932

A. fissa Gosse, 1851

A. navicula Rousselet, 1911

Brachionus ahlstromi Lindeman, 1939

B. angularis Gosse, 1851

B. bennini Leissling, 1924

B. bidentatus Anderson, 1889

B. budapestinensis Daday, 1885

9. B. calyciflorus Pallas, 1766

10. B. caudatus Barrois & Daday, 1894

11. B. dichotomus reductus Koste & Shiel, 1980

12. B. dimidiatus Bryce, 1931

13. B. diversicornis (Daday, 1883)

14. B. donneri Brehm, 1951

15. B. durgae Dhanapathi, 1974

16. B. falcatus Zacharias, 1898

B. falcatus reductus Koste & Shiel, 1987

17. B. forficula Wierzejski, 1891

18. B. kostei Shiel, 1993

eee see eS

19. B. leydigii Cohn, 1862

20. B. lyratus Shephard, 1911

21. B. mirabilis Daday, 1897

22. B. murphyi Sudzuki, 1989

23. B. nilsoni Ahlstrom, 1940

24. B. quadridentatus Hermann, 1783

25. B. rubens Ehrenberg, 1838

26. B. srisumonae Segers, Kotethip & Sanoamuang, 2004

27. Keratella cochlearis (Gosse, 1851)

28. K. edmondsoni Ahlstrom, 1943

29. K. javana Hauer, 1937

30. K. lenzi Hauer, 1953

31. K. procurva (Thorpe, 1891)

32. K. quadrata (Miller, 1786)

33. K. serrulata (Ehrenberg, 1838)

34. K. tecta (Gosse, 1851)

35. K. ticinensis (Callerio, 1921)

36. K. tropica (Apstein, 1907)

Bonn zoological Bulletin 68 (1): 147-162

37. Notholca acuminata (Ehrenberg, 1832)

38. N. labis Gosse, 1887

39. N. squamula (Muller, 1786)

40. Plationus patulus (Muller, 1786)

Al. Platyias leloupi (Gillard, 1967)

42. P. quadricornis (Ehrenberg, 1832)

Family: Epiphanidae

43. Epiphanes brachionus (Ehrenberg, 1837)

44. E. senta (Muller, 1773)

Family: Euchlanidae

45. Beauchampiella eudactylota (Gosse, 1886)

46. Dipleuchlanis ornata Segers, 1993

47. D. propatula (Gosse, 1886)

48. Euchlanis dilatata Ehrenberg, 1832

49. E. incisa Carlin, 1939

50. E. meneta Myers, 1930

51. E. oropha Gosse, 1887

52. E. semicarinata Segers, 1993

53. E. triquetra Ehrenberg, 1838

54. Tripleuchlanis plicata (Levander, 1894)

Family: Mytilinidae

55. Lophocharis oxysternon (Gosse, 1851)

56. L. salpina (Ehrenberg, 1834)

57. Mytilina acanthophora Hauer, 1938

58. M. bisulcata (Lucks, 1912)

59. M. brevispina (Ehrenberg, 1830)

60. M. lobata Pourriot, 1996

61. M. michelangellii Reid & Turner, 1988

62. M. ventralis (Ehrenberg, 1830)

Family: Trichotriidae

63. Macrochaetus collinsi (Gosse, 1867)

64. M. danneelae Koste & Shiel, 1983

65. M. longipes Myers, 1934

66. M. sericus (Thorpe, 1893)

67. M. subquadratus (Perty, 1850)

68. Trichotria tetractis (Ehrenberg, 1830)

69. Wolga spinifera (Western, 1894)

Family: Lepadellidae

70. Colurella adriatica Ehrenberg, 1831

71. C. colurus (Ehrenberg, 1830)

72. C. obtusa (Gosse, 1886)

149

73. C. sanoamuangae Chittapun, Pholpunthin &

Segers, 1999

74. C. sulcata (Stenroos, 1898)

75. C. tesselata (Glascott, 1893)

76. C. uncinata (Miller, 1773)

C. uncinata bicuspidata (Ehrenberg, 1832)

77. Lepadella acuminata (Ehrenberg, 1834)

78. L. apsida Harring, 1916

79. L. benjamini Harring, 1916

80. L. bicornis Vasisht & Battish 1971

©ZFMK

150 Bhushan Kumar Sharma & Sumita Sharma

81. L. biloba Hauer, 1938

82. L. costatoides Segers, 1992

83. L. cristata (Rousselet, 1893)

84. L. dactyliseta (Stenroos, 1898)

85. L. desmeti Segers & Chittapun, 2001

86. L. discoidea Segers, 1993

87. L. elongata Koste, 1992

88. L. eurysterna Myers, 1942

89. L. cf favorita Klement, 1962

90. L. latusinus (Hilgendorf, 1889)

91. L. lindaui Koste, 1981

92. L. minoruoides Koste & Robertson, 1983

93. L. minuta (Weber & Montet, 1918)

94. L. nartiangensis Sharma & Sharma, 1987

95. L. neglecta Segers & Dumont, 1995

96. L. ovalis (Miller, 1786)

97. L. patella patella (Muller, 1773)

L. patella elongata Sharma & Sharma, 1987

L. patella oblonga (Ehrenberg, 1834)

98. L. quadricarinata (Stenroos, 1898)

99. L. quinquecostata (Lucks, 1912)

100. L. rhomboides (Gosse, 1886)

101. L. rhomboidula (Bryce, 1890)

102. L. triba Myers, 1934

103. L. triptera Ehrenberg, 1830

L. triptera alata (Myers, 1934)

104. L. vandenbrandei Gillard, 1952

105. L. (Heterolepadella) apsicora Myers, 1934

106. L. (H.) ehrenbergi (Perty, 1850)

107. L. (H.) heterostyla (Murray, 1913)

108. L. (H.) heterodactyla Fadeev, 1925

109. Squatinella bifurca (Bolton, 1884)

110. S. lamellaris (Miller, 1786)

Family: Lecanidae

111. Lecane acanthinula (Hauer, 1938)

112. L. aculeata (Jakubski, 1912)

113. L. aeganea Harring, 1914

114. L. arcula Harring, 1914

115. L. aspasia Myers, 1917

116. L. batillifer (Murray, 1913)

117. L. bifastigata Hauer, 1938

118. L. bifurca (Bryce, 1892)

119. L. blachei Berzins,1973

120. L. braumi Koste, 1988

121. L. bulla (Gosse, 1851)

L. bulla diabolica (Hauer, 1936)

122. L. calcaria Harring & Myers, 1926

123. L. clara (Bryce, 1892)

124. L. closterocerca (Schmarda, 1898)

125. L. crepida Harring, 1914

126. L. curvicornis (Murray, 1913)

127. L. decipiens (Murray, 1913)

128. L. dorysimilis Trinh Dang, Segers & Sanoamuang,

2015

129. L. doryssa Harring, 1914

Bonn zoological Bulletin 68 (1): 147-162

130.

131.

132;

133;

134.

13D:

136,

13%.

138.

139;

140.

141.

142.

143.

144.

145.

146.

147.

148.

149.

150.

151.

LOZ

153;

154.

1:55:

156.

15%.

158.

159;

160.

161.

162.

163.

164.

165.

166.

167.

168.

169.

170.

LEY,

172,

173;

174.

Was

176.

177.

178.

179.

180.

181.

182.

183.

184.

185.

L. elegans Harring, 1914

L. elongata Harring & Myers, 1926

L. flexilis (Gosse, 1886)

L. furcata (Murray, 1913)

L. glypta Harring & Myers, 1926

L. haliclysta Harring & Myers, 1926

L. hamata (Stokes, 1896)

L. hastata (Murray, 1913)

L. hornemanni (Ehrenberg, 1834)

L. inermis (Bryce, 1892)

L. inopinata Harring & Myers, 1926

L. isanensis Sanoamuang & Savatenalinton, 2001

L. jaintiaensis Sharma, 1987

L. lateralis Sharma, 1978

L. latissima Yamamoto, 1951

L. leontina (Turner, 1892)

L. levistyla (Olofsson, 1917)

L. ludwigii (Eckstein, 1883)

L. luna (Miller, 1776)

L. lunaris (Ehrenberg, 1982)

L. marchantaria Koste & Robertson, 1983

L. monostyla (Daday, 1897)

L. nana (Murray, 1913)

L. nitida (Murray, 1913)

L. niwati Segers, Kotethip & Sanoamuang, 2004

L. obtusa (Murray, 1913)

L. ohioensis (Herrick, 1885)

L. papuana (Murray, 1913)

L. paxiana Hauer, 1940

L. pertica Harring & Myers, 1926

L. ploenensis (Voigt, 1902)

L. pusilla Harring, 1914

L. pyriformis (Daday, 1905)

L. quadridentata (Ehrenberg, 1830)

L. rhenana Hauer, 1929

L. rhytida Harring & Myers, 1926

L. rugosa (Harring, 1914)

L. ruttneri Hauer, 1938

L. scutata (Harring & Myers, 1926)

L. shieli Segers & Sanoamuang, 1994

L. signifera (Jennings, 1896)

L. simonneae Segers, 1993

L. sola Hauer, 1936

L. solfatara (Hauer, 1928)

L. stenroosi (Meissner, 1908)

L. stichaea Harring, 1913

L. stichoclysta Segers, 1993

L. styrax (Harring & Myers, 1926

L. superaculeata Sanoamuang & Segers, 1997

L. sympoda Hauer, 1929

L. syngenes (Hauer, 1938)

L. tensuiseta Harring, 1914

L. thienemanni (Hauer, 1938)

L. undulata Hauer, 1938

L. unguitata (Fadeev, 1925)

L. ungulata (Gosse, 1887)

©ZFMK

The biodiverse rotifers of Northeast India

Family: Notommatidae

186. Cephalodella catellina (Miller, 1786)

187. C. forficata (Ehrenberg, 1832)

188. C. forficula (Ehrenberg, 1832)

189. C. gibba (Ehrenberg, 1830)

190. C. intuta Myers, 1924

191. C. mucronata Myers, 1924

192. C. trigona (Rousselet, 1895)

193. C. ventripes (Dixon-Nuttal, 1901)

194. Monommata grandis Tessin, 1890

195. M. longiseta (Miller, 1786)

196. M. maculata (Harring & Myers, 1930)

197. Notommata pachyura (Gosse, 1886)

198. N. spinata Koste & Shiel, 1991

199. Taphrocampa annulosa Gosse, 1851

Family: Scaridiidae

200. Scaridium longicaudum (Miller, 1786)

Family: Gastropodidae

201. Ascomorpha ecaudis Perty, 1850

202. A. ovalis (Bergendal, 1892

203. A. saltans Bartsch, 1870

204. Gastropus minor (Rousselet, 1892)

Family: Trichocercidae

205. Trichocerca abilioi Segers & Sarma, 1993

206. T. bidens (Lucks, 1912)

207. T. bicristata (Gosse, 1887)

208. T: braziliensis Murray, 1913

209. T. capucina (Wierzejski & Zacharias, 1893)

210. T cylindrica (Imhof, 1891)

211. T edmondsoni (Myers, 1936)

212. T elongata (Gosse, 1886)

213. T flagellata Hauer, 1937

214. T hollaerti De Smet, 1990

215. T iernis (Gosse, 1887)

216. T. insignis (Herrick, 1885)

217. T. insulana (Hauer, 1937)

218. T. kostei Segers, 1993

219. T. longiseta (Schrank, 1802)

220. T. maior (Hauer, 1935)

221. 7: mus Hauer, 1938

222. T. porcellus (Gosse, 1851)

223. T. pusilla (Jennings, 1903)

224. T. rattus (Miller, 1776)

225. T. ruttneri Donner,1953

226. T. scipio (Gosse, 1886)

227. T. siamensis Segers & Pholpunthin, 1997

228. T. similis (Wierzejski, 1893)

229. T. stylata (Gosse, 1851)

230. T sulcata (Jennings, 1894)

231. T. taurocephala (Hauer, 1931)

232. T. tenuior (Gosse, 1886)

233. T. tigris (Muller, 1786)

234. T. uncinata (Voigt, 1902)

Bonn zoological Bulletin 68 (1): 147-162

235. T. voluta (Murray, 1913)

236. T: weberi (Jennings, 1903)

Family: Asplanchnidae

237. Asplanchna brightwelli Gosse, 1850

238. A. priodonta Gosse, 1850

Family: Synchaetidae

239. Ploesoma lenticulare Herrick, 1855

240. Polyarthra euryptera Wierzejski, 1891

241. P. vulgaris Carlin, 1943

242. Synchaeta oblonga Ehrenberg, 1832

243. S. pectinata Ehrenberg, 1832

Family: Dicranophoridae

151

244. Dicranophoroides caudatus (Ehrenberg, 1834)

245. Dicranophorus forcipatus (Miller, 1786)

Order: Flosculariaceae

Family: Floscularidae

246. Floscularia ringens (Linnaeus, 1758)

247. Lacinularia flosculosa (Miller, 1773)

248. L. racemovata Thorpe, 1893

249. Limnias ceratophylli Schrank, 1803

250. Ptygura melicerta Ehrenberg, 1832

251. P. tacita Edmondson, 1940

252. Sinantherina procera (Thorpe, 1893) *

253. S. semibullata (Thorpe, 1893)

254. S. socialis (Linnaeus, 1758)

255. S. spinosa (Thorpe, 1893)

256. Stephanoceros fimbriatus (Goldfusz, 1820)

Family: Conochilidae

257. Conochilus unicornis Rousselet, 1892

Family: Hexarthridae

258. Hexarthra intermedia Wiszniewski,1929

259. H. mira (Hudson, 1871)

Family: Testudinellidae

260. Pompholyx sulcata Hudson,1885

261. Testudinella amphora Hauer, 1938

262. T brevicaudata Yamamoto, 1951

263. T: dendradena de Beauchamp, 1955

264. T: emarginula (Stenroos, 1898)

265. T: greeni Koste, 1981

266. T: parva (Ternetz, 1892)

T: parva bidentata (Ternetz, 1892)

T. parva semiparva (Hauer, 1938)

267. T: patina (Hermann, 1783)

268. T. tridentata Smirnov, 1931

269. T: walkeri Koste & Shiel, 1980

270. T. sp. Sharma & Sharma 2018a

271. T. sp.1 Sharma & Sharma 201 8a

©ZFMK

152

Family: Trochosphaeridae

272. Filinia brachiata (Rousselet, 1901)

273. F. camasecla Myers, 1938

274. F longiseta (Ehrenberg, 1834)

275. F opoliensis (Zacharias, 1898)

276. F- pejleri Hutchinson, 1964

277. F- saltator (Gosse, 1886)

278. F. terminalis (Plate, 1886)

279. Horaella brehmi Donner, 1949

280. Trochosphaera aequatorialis Semper, 1872

Order: Collothecaceae

Family: Atrochidae

281. Cupelopagis vorax (Leidy, 1857)

Family: Collothecidae

282. Collotheca hexalobata Banik, 2002*

283. C. ornata (Ehrenberg, 1832)

284. C. mutabilis (Hudson, 1885)

285. C. tenuilobata (Anderson, 1889)

286. C. tetralobata Banik, 2002 *

287. C. trilobata (Collins, 1872) *

Sub-class: Bdelloidea

Order: Philodinida

Family: Adinetidae

Bhushan Kumar Sharma & Sumita Sharma

288. Adineta longicornis Murray, 1906 *

289. A. vaga (Davis, 1873)

Family: Habrotrochidae

290. Habrotrocha angusticollis (Murray, 1905)

291. H. angusticollis attenuata (Murray, 1906) *

292. H. lata (Bryce, 1892)

293. H. leitgebii (Zelinka, 1886)*

294. H. microcephala (Murray, 1906) *

Family: Philodinidae

295. Dissotrocha aculeata (Ehrenberg, 1832)

296. Macrotrachela multispinosa Thompson, 1892

297. Philodina citrina Ehrenberg, 1832

298. Rotaria macroceros (Gosse, 1851)

299. R. mento (Anderson, 1889)

300. R. neptunia (Ehrenberg, 1830)

301. R. neptunoida Harring, 1913*

302. R. rotatoria (Pallas, 1766)

303. R. tardigrada (Ehrenberg, 1830) *

* Not observed in our collections

Brachionus dichotomus reductus (Fig. 2A), B. don-

neri (Fig. 2B), B. falcatus reductus (Fig. 2C), B. kostei

(Fig. 2D), B. lyratus (Fig. 2E), B. murphyi (Fig. 2F),

B. nilsoni (Fig. 2G), B. srisumonae (Fig. 2H), Collothe-

ca hexalobata, C. tetralobata, Colurella sanoamuangae,

C. tesselata (Fig. 21), Dipleuchlanis ornata (Fig. 2J—K),

Euchlanis semicarinata (Fig. 2L—M), Gastropus minor

(Fig. 3A), Keratella edmondsoni (Fig. 3B), K. javana

(Fig. 3C), K. serrulata (Fig. 3D), K. ticinensis, Lecane

batillifer, L. bifastigata, L. calcaria (Fig. 3E), L. clara

(Fig. 3F), L. dorysimilis (Fig. 3G), L. jaintiaensis,

L. isanensis (Fig. 3H), L. latissima (Fig. 31), L. march-

antaria (Fig. 3J), L. niwati (Fig. 3K), L. rhenana, L shieli

(Fig. 3L), L. superaculeata (Fig. 4A), Lepadella desme-

ti (Fig. 4B), L. elongata, L. minoruoides, L. neglecta

(Fig. 4C), L. vandenbrandei, Macrochaetus danneelae

(Fig. 4D), Mytilina lobata (Fig. 4E), M. michelangellii,

Notholca acuminata, N. labis (Fig. 4F), N. squamula,

Squatinella bifurca (Fig. 4G—H), Testudinella amphora,

T! brevicaudata, T: greeni, T: parva bidentata, T. triden-

tata, T. walkeri (Fig. 41), Trichocerca edmondsoni, T. hol-

laerti, T: maior, T: mus (Fig. 4J), T: siamensis(Fig. 4K),

7) taurocephala (Fig. 4L), and T. uncinata, observed in

our collections from the sampled seven states, are rotifers

with global or regional biogeographic interest or their In-

dian distribution yet restricted to NEI. Of these, certain

rare and interesting species are illustrated to warrant for

validations and to serve as source of reference for the

future workers.

Table 1. Rotifera taxa recorded from Northeast India and seven states.

States /NEI| Taxa— Species

Arunachal Pradesh

Assam

Manipur

Meghalaya

Mizoram

Nagaland

Tripura

Northeast India

P72

244

200

161

162

150

176

303

Present study

Bh,

Genera Families Species Genera Families

Earlier Report Species added

(Sharma & Sharma 2014a)

76 29 18 96

26 46 21 28

155 45 23 45

135 36 19 26

76 28 17 86

66 os 14 84

152 36 20 24

238 50 23 65

Bonn zoological Bulletin 68 (1): 147-162

©ZFMK

The biodiverse rotifers of Northeast India 153

I J-K L—-M

Fig. 2A—M. Interesting Rotifera from Northeast India. A. Brachionus dichotomus reductus Koste & Shiel, ventral view. B. Bra-

chionus donneri Brehm, ventral view. C. Brachionus falcatus reductus Koste & Shiel, ventral view. D. Brachionus kostei Shiel,

dorsal view. E. Brachionus lyratus Shephard, ventral view. F. Brachionus murphyi Sudzuki, ventral view. G. Brachionus nilsoni

Ahlstrom, ventral view. H. Brachionus srisumonae Segers, Kotethip & Sanoamuang, dorsal view. I. Colurella tesselata (Glascott),

lateral view. J-K. Dipleuchlanis ornata Segers, ventral view and cross-section (after Sharma, 2005). L-M. Euchlanis semicarinata

Segers, dorsal and lateral views.

154 Bhushan Kumar Sharma & Sumita Sharma

Fig. 3A—L. Interesting Rotifera from Northeast India. A. Gastropus minor (Rousselet), lateral view. B. Keratella edmondsoni Ahl-

strom, dorsal view. C. Keratella javana Hauer, ventral view. D. Keratella serrulata (Ehrenberg), ventral view. E. Lecane calcaria

Harring & Myers, ventral view. F. Lecane clara (Bryce), dorsal view. G. Lecane dorysimilis Trinh Dang, Segers & Sanoamuang,

dorsal view. H. Lecane isanensis Sanoamuang & Savatenalinton, ventral view. I. Lecane latissima Yamamoto, dorsal view. J. Le-

cane niwati Segers, Kotethip & Sanoamuang, ventral view. K. Lecane marchantaria Koste & Robertson, dorsal view. L. Lecane

Shieli Segers & Sanoamuang, dorsal view.

The biodiverse rotifers of Northeast India 155

I J K lif

Fig. 4A-L. Interesting Rotifera from Northeast India. A. Lecane superaculeata Sanoamuang & Segers, ventral view. B. Lepadella

desmeti Segers & Chittapun, ventral view. C. Lepadella neglecta Segers & Dumont, ventral view. D. Macrochaetus danneelae

Koste & Shiel, ventral view. E. Mytilina lobata Pourriot, lateral view. F. Notholca labis Gosse, ventral view. G-H. Squatinella bi-

furca (Bolton), lateral and dorsal views. I. Testudinella walkeri Koste & Shiel, ventral view. J. Trichocerca mus Hauer, lateral view.

K. Trichocerca siamensis Segers & Pholpunthin, lateral view. L. Trichocerca taurocephala (Hauer), lateral view.

156 Bhushan Kumar Sharma & Sumita Sharma

B® Lecanidae OLepadellidae @ Brachionidae @ Trichocercidae O Testudinellidaae O Notommatidae

No. of species

Fig. 5. Species richness of important Rotifera families of seven states of NEI; ASS-Assam; MNP-Manipur; TRP-Tripura; MEG-Me-

ghalaya; MIZ-Mizoram, NGL-Nagaland; ARP-Arunachal Pradesh.

Dendrogram using Average Linkage (Between Groups)

Rescaled Distance Cluster Combine

5 10 15 20

Manipur

Tripura

> Nagaland

Arunachal

Mizoram

Meghalaya

Fig. 6. Hierarchical cluster analysis of Rotifera assemblages of seven states of NEI.

Rotifera of Northeast India contained 287 species of | 150 species were observed from Assam, Manipur, Tri-

Monogononta and 16 of Bdelloidea. The rotifer rich- pura, Arunachal Pradesh, Mizoram, Meghalaya and Na-

ness of seven states varied (Table 1) between 150-244 galand, respectively. Lecanidae, Brachionidae, Lepadel-

(181+39 species) and 244, 200, 176, 172, 162, 161 and __lidae, Trichocercidae, Notommatidae, Testudinellidae,

The biodiverse rotifers of Northeast India 157

Table 2. Rotifer community richness by aquatic ecosystem types of Northeast India.

Study sites Species Genera Families

Ramsar sites

Loktak Lake (93°46’— 93°55’E, 24°25’—24°42’N) 200 48 23

Deepor Beel (91°35’—91°43’E, 26° 05’—26°11’N) 183 36 20

Floodplain lakes (beel/s) of Brahmaputra Basin, Assam 244 46 el

Barpeta (6 beels) (90°52’—91 °42’E, 26°17'—-26°40’N) 176 35 19

Mayjuli River Island (10 bee/s) (93°-95°E, 25°-27°N) 174 34 18

Dibru-Saikhowa Biosphere Reserve (DSBR) (5 ee/s) 162 32 18

(95°22’—95°24’E, 27°34’-27°55’N)

Tinsukia (5 beels) (95°22’—96°35’E, 27°14’—28°40’N) 169 33 19

Dibrugarh (6 beels) (93°22’—95°35’E, 26°19’—27°30’N) 179 3) 19

Floodplain lakes (pats) of Manipur

Manipur valley (15 pats) (93°45’—94°00’E, 24°25’—24°45’N) 200 48 23

Small floodplain wetlands (dobas or dubies) of Assam

A. Brahmaputra valley (90°—93°E, 26°—27°N) 167 34 18

a. Lower Assam 154 34 18

b. Central Assam 150 31 19

c. Upper Assam 135 30 1

B. Barak valley, south Assam (92°45’—92°75’E, 24°48’—24°80’N) 159 35 19

Arunachal Pradesh (91°20’—97°30’E, 26°28’—29°30’N) 165 Sy 19

Nagaland (93°3’-93°5’E, 25°4’-27°0’N) 150 37 19

Mizoram (92°15’—93°29’E, 21°58’—24°35’N) 162 35 19

Meghalaya (90°05’—92°40’E, 25°10’—26°15’N) 161 40 20

Tripura (92°10’—92°20’E, 22°56’—24°32’N) 163 35 19

Manipur (93°50’—94°00’E, 24°10’—24°55’N) 169 44 22

Floscularidae and Euchlanidae were represented by 75,

42, 41, 32, 14, 11 and 10 species, respectively; Trochos-

phaeridae and Philodinidae comprised 9 species each;

and Trichotriidae and Collothecidae included 8 and 7 spe-

cles, respectively. Brachionidae and Flosculariidae each

yielded six genera. The richness variations of speciose

six Eurotatoria families in seven states of NEI are shown

in Fig. 5. The rotifer communities of the sampled sev-

en states had similarities ranging between 72.1—82.3%

(vide Serensen’s index). The hierarchical cluster analy-

sis (Fig. 6) showed highest affinity between the rotifer

assemblages of Assam and Manipur, while Meghalaya

fauna showed the highest divergence.

Our observations on faunal diversity of Rotifera in the

floodplain lakes, small floodplain wetlands and small

Bonn zoological Bulletin 68 (1): 147-162

lentic ecosystems of NEI recorded richness variations as

indicated in Table 2. Two Ramsar sites: Loktak Lake and

Deepor Beel yielded 200 species belonging to 48 genera

and 23 families, and 183 species belonging to 36 gen-

era and 20 families, respectively. The small floodplain

wetlands (dobas or dubies) of the Brahmaputra river ba-

sin had 157 species with marginal variations from low-

er (154 species), central (150 species) and upper Assam

(135 species); and dobas or dubies from Barak valley of

south Assam had 159 species. The sampled small lentic

ecosystems of Arunachal Pradesh, Nagaland, Mizoram,

Meghalaya, Tripura and Manipur had 150-165 species.

Richness ranged from 162 to 179 in various floodplain

lakes (beels) of Assam and Manipur floodplain lakes

(pats) had 200 species.

©ZFMK

158 Bhushan Kumar Sharma & Sumita Sharma

DISCUSSION

The rotifer assemblages of NEI reveal total richness (S)

of 303 species belonging to 53 genera and 24 families;

these represent ~70%, ~81% and 96% of species, genera

and families of the phylum known to date from India,

respectively, and thus highlight highly biodiverse char-

acter vis-a-vis the Indian Rotifera. Further, 292 species

(~96% of S) observed from seven northeastern states af-

firm the high rotifer heterogeneity found in our plankton

and semi-plankton collections. To date, Rotifera of NEI

is the most speciose and diverse than any region of In-

dia (Sharma & Sharma 2017) and Sri Lanka (Fernando

1980) — the only reasonably well sampled country of the

Indian subcontinent. The diverse nature of rotifer fauna is

attributed to overall habitat diversity and ecological het-

erogeneity of aquatic ecosystems located across varied

ecological and geomorphic regimes, the location of NEI

in the Himalayan and Indo-Burma Biodiversity hotspots,

the ‘rotiferologist effect’ vide Fontaneto et al. (2012), and

sampling intensity. The rotifer richness documented from

this interesting biogeographic region of India is similar to

that of Cambodia (304 species: Sor et al. 2015) although

less than the 398 species known from well studied fauna

of Thailand (Sa-Ardrit et al. 2013). On the other hand,

our tally is distinctly higher than other Southeast Asian

faunas including Laos (Segers & Sanoamuang 2007),

Philippines (Tuyor & Segers 1999), Malaysia (Segers

2004; Fontaneto &Ricci 2004), Myanmar (Koste 1990),

and Singapore (Fernando & Zankai 1981) and Vietnam

(Trinh et al. 2019).

This study records high Rotifera richness amongst sev-

en states (150-244, 181+39 species; 49.5—80.5% of S) of

NEI than 66—216 species reported earlier (Sharma & Shar-

ma 2014a). Our observations show a distinct > two-fold

increase in species known each from Arunachal Pradesh

(Sharma & Sharma 2019a), Mizoram (Sharma & Sharma

2015b), and Nagaland (Sharma et al. 2017). In addition,

we report richness updates from Manipur (29%); Assam

(12.9%) and Meghalaya (19.2%) and Tripura (17.8%)

and overall species update of 27.3% from NEI. Assam

> Manipur depict highest number of species of the phy-

lum known from any state of India, while Manipur also

reflects rich higher diversity (genera and families). The

state-wise richness variations from NEI concur with the

report of ‘All Taxa Biological Inventories (ATBI) vide

Dumont & Segers (1996) for the tropical and subtropical

rotifer assemblages. With nearly ’4 species known from

all seven states, the rotifers communities showed 72.1—

82.3% similarities (vide Sorensen’s index). Assam and

Manipur rotifers had the maximum affinity (82.3%) and

it was followed by 81.5% similarity between two hills

states of Arunachal Pradesh and Nagaland, while Megha-

laya had the greatest dissimilarity to other assemblages.

Bonn zoological Bulletin 68 (1): 147-162

Rotifera of NEI is characterized by sizable fraction of

species (~ 24% of S) of global biogeographic interest

which are categorized as follows:

a) Australasian species: Brachionus dichotomus re-

ductus, B. falcatus reductus, B. kostei, B. lyratus,

B. murphyi, Lecane batillifer, L. latissima, L. shieli,

Macrochaetus danneelae, Notommata spinata and

Testudinella walkeri,

b) Oriental endemics: Brachionus donneri, B. srisu-

monae, Colurella sanoamuangae, Keratella edmond-

soni, Lecane acanthinula, L. blachei, L. bulla diabol-

ica, L. isanensis, L. niwati, L. solfatara, L. superacu-

leata and Filinia camasecla;

c) Indo-Chinese species: Lecane dorysimilis;

d) Indian endemics: Collotheca hexalobata C. tetralo-

bata, Lecane jaintiaensis, Lepadella nartiangensis,

and undetermined 7estudinella sp. and T. sp.1 (vide

Sharma & Sharma 2018a).

e) Paleotropical species: Dipleuchlanis ornata, Euchla-

nis semicarinata, Keratella javana, Lecane braumi,

L. lateralis, L. simonneae, L. stichoclysta, L. unguita-

ta, Lepadella bicornis, L. discoidea, L. minoruoides,

L. vandenbrandei, Testudinella brevicaudata, T. gree-

ni, Trichocerca abilioi, T. braziliensis, T. hollaerti and

T. kostei;

f) Palaearctic species: Cephalodella trigona, Lecane bi-

fastigata and Squatinella bifurca,

g) Holarctic species: Lecane elongata, L. levistyla,

Trichocerca taurocephala and T. uncinata;

h) Nearctic and Palearctic species: Trichocerca maior,

i) Neotropical species: Lecane calcaria, L. marchantar-

ia, L rugosa, L. sola, Lepadella neglecta, Mytilina

lobata;

j) Neotropical-Pacific species: Lepadella desmeti and

L. elongata;

k) Cosmo (sub) tropical species: Brachionus durgae:

1) Other interesting species: Lecane calcaria, L. rhena-

na, L. ruttneri, L. patella oblonga, Mytilina mi-

chelangellii, Ptygura tacita, Testudinella amphora,

Trichocerca edmondsoni and T. siamensis.

Our collections highlight the record richness of 91% and

87% of the Australasian and the Oriental elements known

from India, respectively with ~81% and ~67% species

of the two categories exclusively restricted to NEI, re-

spectively. This diagnostic feature, affirming strong af-

finity of Rotifera of NEI with that of Southeast Asia and

Australia, is hypothesized to invasion of these elements

through ‘the Assam gateway’ — a vital biogeographic cor-

ridor of India (Mani 1974) which is known to facilitate

interchanges between the Indian and Asian biota (Ranga

Reddy 2013) and presently even with Australian Rotif-

era. About ~72% species of the listed 12 categories are

reported to date from India exclusively from NEI. Be-

sides, 32 species (10.6%) namely Adineta vaga, A. lon-

©ZFMK

The biodiverse rotifers of Northeast India 159

gicornis, Cephalodella intuta, C. ventripes, Colurella

tesselata, Habrotrocha angusticollis, H. angusticollis

attenuata, H. lata, H. leitgebii, H. microcephala, Kera-

tella javana, Lecane aeganea, L. clara, L. glypta, L. rhyt-

ida, L. stichaea, Lepadella heterodactyla. L. latusinus,

L. patella oblonga, Monommata grandis, M. maculata,

Stephanoceros fimbriatus, Taphrocampa annulosa, Te-

studinella dendradena, T. tridentata, Trichocerca bidens,

T. insignis, T: insulana, T: mus, T. scipio and T: sulcata

are characterized by the Indian distribution restricted to

NEI. Our remarks thus impart both the global and region-

al biogeographic interest to Rotifera fauna of NEI and,

hence, assign it a contrasting identity than the rotifer as-

semblages of the rest of India. The relative paucity of the

Indian endemics in NEI is secondary as (a) a number of

such species namely Brachionus srisumonae, Colurella

sanoamuangae, Lecane dorysimilis, L. isanensis, L. la-

tissima, L. niwati, L. shieli, L. superaculeata, Lepadella

desmeti and Trichocerca siamensis are described as new

species from Thailand and elsewhere from southeast

Asia; (b) about eight potential new species from NEI are

awaiting descriptions pending analysis of more speci-

mens (BKS, unpublished); and (c) collections from high

and middle altitudes of Arunachal Pradesh, and the most

unexplored eastern Himalayan state of Sikkim are likely

to add interesting species.

Lecanidae (75 species) forms a notable fraction of Ro-

tifera of NEI (24.8%) and that of individual states (5149

species), while Brachionidae (42, 28+5 species) > Lep-

adellidae (41, 2645 species) > Trichocercidae (32, 18+4

species) contribute 38.1%. The four families collectively

comprise sizable components of 62.9% and 66.943.4%

of Rotifera species known from NEI and the seven

states, respectively. The order of importance deviates

as Lepadellidae > Brachionidae in our collections from

Manipur, Meghalaya and Nagaland in particular due to

diagnostic paucity of the brachionids. On the contrary,

the Brachionidae-rich Rotifera of Assam and Arunachal

Pradesh (33 species each) are noteworthy. Lecanidae,

Lepadellidae, Trichocercidae and Brachionidae richness

of NEI represents ~81%, ~91%, ~86% and ~84% of the

species of these taxa known from India. The cumulative

importance of these families concurs with the reports

from Thailand (Sa-Ardrit et al. 2013), Africa (Segers

et al. 1993; Green 2003), Argentina (Jose de Paggi 2001),

and Brazil (Serafim Jr. et al. 2003; Bonecker et al. 2005,

2009). Notommatidae, Testudinellidae, Trochosphaeri-

dae, Mytilinidae and Trichotriidae are other Monogonont

families with richness interest. The stated features of

richness impart a broadly littoral-periphytic character to

the rotifer fauna of NEI which, in turn, is largely attribut-

ed to nature of the sampled water bodies, and even pau-

city of planktonic rotifers in small lentic ecosystems pre-

dominant in hill states of Arunachal Pradesh, Mizoram,

Nagaland and Meghalaya, and largely sampled from Tri-

pura and Manipur.

Bonn zoological Bulletin 68 (1): 147-162

The importance of ‘tropic-centered’ Lecane throughout

the seven states (27.7+1.7% of S) confirms the most im-

portant role of this thermopile in Rotifera communities

of NEI as found in southeast Asia (Segers 1996, 2001).

This generalization, inclusive of the eastern Himalayan

state of Arunachal Pradesh (Sharma & Sharma 2019a),

marks a notable contrast to its relative paucity from the

western Himalayas (Sharma & Sharma 2018c). The rich-

ness of ‘tropic-centered’ Brachionus merits caution in

light of the relative paucity of its species in Manipur as

well as in hill states of Meghalaya, Mizoram, Nagaland

and Arunachal Pradesh. This salient feature is attribut-

ed to slightly acidic waters (Sharma & Sharma 2005,

2014a) of hilly areas, lack of permanent limnetic habitats

(Sharma & Sharma 2014c) and is hypothesized to result

from certain factors otherwise limiting the regional dis-

tribution of Brachionus spp. (BKS, unpublished); the last

aspect yet needs to be investigated. The rotifer fauna of

NEI indicates highest richness (10 species) of “temperate

centered’ Keratella, amongst 11 known Indian species

(Sharma & Sharma 2014c), but with the ‘cold-water’

Keratella serrulata and K. ticinensis found exclusive-

ly from Arunachal Pradesh (Sharma & Sharma 2019a).

Further, the three species of “temperate centered’ Nof-

holca are known only from this eastern Himalayan state

(Sharma & Sharma 2019a). Our observations also focus

attention on the paucity of Mytilina and Filinia spp., and

lack of Conochilus from Arunachal Pradesh, Nagaland

and Mizoram; and paucity of Filinia, and scarceness of

Hexarthra and Conochilus species in Manipur. Overall

importance of ‘tropic-centered’ taxa, restricted occur-

rence of ‘cold-water’ species, high richness of cosmopol-

itan species (~65%) and collective richness (~21%) of

cosmotropical and (sub) tropical species impart a broadly

tropical character to Rotifera of NEI.

Segers et al. (1993) hypothesized (sub) tropical flood-

plain lakes as the globally rich rotifer habitats, while

Sharma & Sharma (2008, 2014a, 2018b) extended this

hypothesis to the floodplains of NEI. While augmenting

the studies supporting our hypothesis, we now report 200

and 183 species from Loktak Lake and Deepor beel, re-

spectively; the two Ramsar sites are thus categorized as

Rotifera ‘hot-spots’ of the Indian sub-region as well as

one of the globally most biodiverse rotifer biotopes. Be-

sides, the selected beels of Barpeta district (176 species),

the Dibru-Saikhowa Biosphere Reserve (162 species),

the Majuli River island (174 species), Dibrugarh district

(179 species) and Tinsukia district (169 species) of the

Brahmaputra river basin of Assam, and selected pats of

Manipur (200 species) reveal speciose assemblages. The

richness known from various bee/s and pats of NEI large-

ly compares with 184 species from the well-sampled Up-

per Parana floodplain (Bonecker et al. 1994, 1998, 2005)

of Brazil, while it is more biodiverse than the records

from the Rio Pilcomayo National Park (a Ramsar site),

Argentina (Jose de Paggi 2001); Oguta lake and Iyi-Efi

©ZFMK

160 Bhushan Kumar Sharma & Sumita Sharma

lake from the Niger delta (Segers et al. 1993), Africa:

Lake Guarana, Brazil (Bonecker et al. 1994); Thale-No1

Lake, a Ramsar site of Thailand (Segers and Pholpunthin

1997); Laguana Bufeos of Bolivia (Segers et al. 1998;

Koste 1974), and from Rio Tapajos and Lago Camaleao

(Koste and Robertson 1983) of Brazil, respectively; and

the Kashmir Himalayan floodplains (Sharma & Sharma

2018c).

We focus attention on the high species richness of Roti-

fera of small lentic ecosystems of NEI; the latter deserve

attention as hotspots both in terms of species composition

and biological traits (EPCN 2008), and are considered as

keystone systems for analyses and conservation of bio-

diversity (Oertli et al. 2010; Céréghino et al. 2014; Vad

et al. 2017; Oertli 2018). These water bodies are largely

ignored in India while Sharma & Kensibo (2017) hypoth-

esized these biotopes to be one of the biodiverse Rotifera

habitats of the Indian sub-region. The small lentic habi-

tats predominant in the hill states of Arunachal Pradesh,

Nagaland, Mizoram and Meghalaya had 165, 150, 162

and 161 species, respectively. Besides, small floodplain

wetlands (dobas or dubies) of Assam are the rotifer rich

habitats with record richness of 167 species from the

Brahmaputra valley with marginal variations of 154, 150

and 135 species from dobas or dubies of lower, central

and upper Assam regions, while dobas or dubies of Barak

valley of south Assam have ~93% of the rotifer species

reported from the floodplains of south Assam (Sharma &

Sharma 2019b). The results thus endorse our hypothesis

on overall importance of varied small lentic ecosystems

of NEI vis-a-vis Rotifera biodiversity.

This study highlights the record richness of 84 and 81

species found in May and June, 2017 collections from a

floodplain lake (bee/) of upper Assam; 85 species each

from December 2016 and January 2017 samples from

Deepor beel (Ramsar site) and the record richness of 86

and 89 species from Loktak Lake basin of Manipur in

November and December 2017 samples. The assemblag-

es of 80+ species are described as the ‘Rotifera paradox’,

analogous to the classical ‘paradox of the plankton’ re-

ported by Hutchinson (1961), which reveal the intriguing

possibility of the co-existence of a number of rotifer spe-

cies in the floodplain ecotones and are attributed to high

amount of niche overlap (MacArthur 1965). The said re-

ports merit interest as compared with the highest global

assemblage of 102+ species known from Broa reservoir,

Brazil (Segers & Dumont 1995). Our results are more

biodiverse than earlier highest individual Indian reports

of 76 species from a beel of DSBR (Sharma et al. 2017),

79 species from Deepor beel (Sharma & Sharma 2013)

and 79 species from Loktak Lake (Sharma 2009; Sharma

et al. (2016). Further, our collections from unstructured

small floodplain wetlands (dobas or dubies) of the Maju-

li River Island and upper Assam highlight the * Rotifera

paradox’ with speciose assemblages of up to 50 species

per sample (Sharma & Sharma 2019c).

Bonn zoological Bulletin 68 (1): 147-162

In summary, the most biodiverse Rotifera of NEI, than

known from any region of the Indian subcontinent, is

noteworthy. High richness of species of global and re-

gional biogeographic interest with a large fraction ex-

clusively restricted to NEI, the littoral-periphytic rotifer

assemblages with broadly tropical character except that

of the eastern Himalayan state of Arunachal Pradesh, and

notable rotifer heterogeneity amongst the seven north-

eastern states are notable attributes. The high affinity of

NEI Rotifera with Southeast Asian and Australian faunas

highlights the role of ‘the Assam-gateway’ that facilitates

the invasion of the Australasian, Oriental, the Indo-Chi-

nese and the Southeast Asian species. The species-rich

rotifer assemblages of small lentic environs of Arunachal

Pradesh, Mizoram, Nagaland, Meghalaya, Manipur and

Tripura; beels and dobas and dubies of the Brahmapu-

tra and the Barak river floodplains of Assam, and pats

of Manipur; the examples of ‘the Rotifera paradox’ in

certain beels and pats, and dobas and dubies highlight

the tremendous ecological diversity of this phylum in

NEI. This study is an important contribution to biodi-

versity and biogeography of Rotifera of India, Asia and

the Oriental region. Our results affirm the importance of

intensive sampling and taxonomic expertise in enabling

comprehensive faunal analyses and documentation of

small rotifer species that are usually over-looked in the

Indian works. Analyses of the littoral-periphytic, sessile,

colonial and benthic rotifers from the unexplored eastern

Himalayan state of Sikkim, high and middle altitudes of

Arunachal Pradesh and also other states are desired for

future biodiversity update.

Acknowledgements. The senior author is thankful to the Min-

istry of Environment, Forests and Climate Change (Govt. of

India) for AICOPTAX project, the G.B. Pant Institute of Hi-

malayan Environmental Development, Almora for a research

grant, and to “University with Potential for Excellence Program

(Biosciences)” program of North-Eastern Hill University, Shill-

ong for a research program which facilitated the sampling. The

senior author is thankful to the Head, Department of Zoology,

NEHU, Shillong, for facilities and collectively to Drs L. Pach-

uau, M.K. Hatimuria, G. Thangjam, K.R. Sounti Pou, S.I. Khan

and N. Noroh for their help in the field collections on several

occasions. We thank our peers: Dr Russell J. Shiel, Australia

and an anonymous reviewer for useful comments and sugges-

tions. Our special personal thanks to Dr Russell J. Shiel for his

critical post-peer review scrutiny of our Ms. We wish to thank

Dr Ralph S. Peters and Dr Bernhard Huber (Bonn zoological

Bulletin) for help and suggestions during the peer review. The

authors have no conflict of interests.

REFERENCES

Bonecker CC, Aoyagui ASM, Santos RM (2009) The impact

of impoundment on the rotifer communities in two tropical

floodplain environments: interannual pulse variations. Bra-

zilian Journal of Biology 69: 529-537

©ZFMK

The biodiverse rotifers of Northeast India 161

Bonecker CC, Costa CLD, Velho LFM, Lansac-To6ha FA

(2005) Diversity and abundance of the planktonic rotifers in

different environments of the Upper Parana River floodplain

(Parana State — Mato Grosso do Sul State, Brazil). Hydrobi-

ologia 546: 405-414

Bonecker CC, Lansac-Toha FA, Rossa DC (1998) Planktonic

and non-planktonic rotifers in two environments of the upper

Parana River floodplain, state of Mato Grosso do Sul, Brazil.

Brazilian Archives of Biology & Technology 41: 447-456

Bonecker CC, Lansac-Téha FA, Staub A (1994) Qualitative

study of Rotifers in different environments of the high Para-

na River floodplain (Ms), Brazil. Revista UNIMAR, 16(1):

1-16

Céréghino R, Botx D, Cauchie HM, Martens K, Oertli B (2014)

The ecological role of ponds in a changing world. Hydrobi-

ologia 723(1):1—6

Dumont HJ, Segers H (1996) Estimating lacustrine zooplank-

ton species richness and complementarity. Hydrobiologia

341: 125-132

EPCN (2008) The Pond Manifesto. Available: http://campus.

hesge.ch/epcn/projects.asp.

Fernando CH (1980) The freshwater zooplankton of Sri Lanka,

with a discussion of tropicalfreshwater zooplankton compo-

sition. Internationale Revue der gesamten Hydrobiologie 65:

411-426

Fernando CH, Zankei NP (1981) The Rotifera of Malaysia and

Singapore with remarks on some species. Hydrobiologia 78:

205-219

Fontaneto D, Marcia Barbosa A, Segers H, Pautasso M (2012).

The ‘rotiferologist’ effect and the other global correlates of

species richness in rotifers. Ecography 35: 174—182

Fontaneto D, Ricci C (2004) Rotifera: Bdelloidea. Pp.121—126.

In: Yule CM, Sen YH (eds) Freshwater Invertebrates of the

Malaysian Region. Academy of Sciences Malaysia

Green J (2003) Associations of planktonic and periphytic roti-

fers in a tropical swamp, the Okavango Delta, Southern Afri-

ca. Hydrobiologia 490: 197—209

Hutchinson GE (1961) The paradox of the plankton. American

Naturalist 95: 137-145

Jersabek CD, Leitner MF (2013) The Rotifer World Catalog.

World Wide Web electronic publication. http,//www.rotifera.

hausdernatur.at/accessed {17.07.2018}

José De Paggi S (2001) Diversity of Rotifera (Monogononta) in

wetlands of Rio Pilcomayo national park, Ramsar site (For-

mosa, Argentina). Hydrobiologia 462: 25-34

Koste W (1974) Zur Kenntnis der Rotatorienfauna der ‘schwim-

menden Weise‘ einer Uferlagune in der Varzea Amazoniens,

Brasilien. Amazoniana 5: 25-60

Koste W (1978) Rotatoria. Die Radertiere Mitteleuropas, be-

griindet von Max Voigt. Uberordnung Monogononta. Geb-

rider Borntaeger, Berlin, Stuttgart. I. 673 pp U. II. Tafelbd.

(T. 234)

Koste W (1990) Zur Kenntnis der Radertierfauna des Kin-

da-Stausees in Zentral-Burma (Aschelmintes: Rotatoria). Os-

nabriicker Naturwissenschaftliche Mitteilungen 16: 83-110

Koste W, Robertson B (1983) Taxonomic studies of the Ro-

tifera (Phylum Aschelminthes) from a central Amazonian

varzea lake, Lago Camaleao (Ilha de Marchantaria, Rio Soli-

moes, Amazonas, Brazil). Amazoniana 7(2): 225-254.

Koste W, Shiel RJ (1987) Rotifera from Australian inland

waters. II. Epiphanidae and Brachionidae (Rotifera: Mono-

gononta). Invertebrate Taxonomy 7: 949-1021

Koste W, Shiel RJ (1989) Rotifera from Australian inland wa-

ters. IV. Colurellidae (Rotifera: Monogononta). Transactions

of the Royal Society of South Australia 113: 119-143

Bonn zoological Bulletin 68 (1): 147-162

Koste W, Shiel RJ (1990) Rotifera from Australian inland wa-

ters V. Lecanidae (Rotifera: Monogononta). Transactions of

the Royal Society of South Australia 114(1): 1-36

Mac Arthur, RH (1965) Patterns of species diversity. Biological

Revue 40: 510-533

Mani MS (1974) Biogeographical evolution in India, In: Mani

MS (ed.) Ecology and Biogeography in India. Dr. W. Junk

b.v. Publishers, The Hague. pp. 698—724

Oertli B (2018) Freshwater biodiversity conservation: The role

of artificial ponds in the 21st century. Aquatic Conservation

Marine and Freshwater Ecosystems 28: 264—269

Oertli B, Biggs J, Céréghino R, Declerck S, Hull A, Miracle

MR. (eds) (2010) Pond Conservation in Europe. Dordrecht,

the Netherlands: Springer

Ranga Reddy Y (2013) Neodiaptomus prateek n. sp., a new

freshwater copepod from Assam, India, with critical review

of generic assignment of Neodiaptomus spp. and a note on di-

aptomid species richness (Calanoida: Diaptomidae). Journal

of Crustacean Biology 33(6): 849-865

Sa—Ardrit P, Pholpunthin P, Segers H (2013) A checklist of the

freshwater rotifer fauna of Thailand (Rotifera, Monogononta,

Bdelloidea). Journal of Limnology 72(2): 361-375

Segers H (1995) Rotifera 2: Lecanidae. 6. pp: 1-226. In: Du-

mont HJ, Nogrady T (eds) Guides to identification of the Mi-

croinvertebrates of the Continental waters of the world. SPB

Academic Publishing bv. Amsterdam, the Netherlands.

Segers H (1996) The biogeography of littoral Lecane Rotifera.

Hydrobiologia 323: 169-197

Segers H (2001) Zoogeography of the Southeast Asian Rotifera.

Hydrobiologia 446/447: 233-246

Segers H (2002) The nomenclature of the Rotifera, annotated

checklist of valid family— and genus—group names. Journal

of Natural History 36: 621-640

Segers H (2004) Rotifera: Monogononta. Pp.106—119. In: Yule

CM, Sen YH (eds) Freshwater Invertebrates of the Malaysian

Region. Academy of Sciences Malaysia.

Segers H (2007) Annotated checklist of the rotifers (Phylum Ro-

tifera), with notes on nomenclature, taxonomy and distribu-

tion. Zootaxa 1564: 1-104

Segers H, Dumont HJ (1995) 102+ rotifer species (Rotifera:

Monogononta) in Broa reservoir (SP., Brazil) on 26 August

1994, with the description of three new species. Hydrobiolo-

gia 316: 183-197

Segers H, Ferrufino NL, De Meester L (1998) Diversity and

zoogeography of Rotifera (Monogononta) in a flood plain

lake of the Ichilo River, Bolivia, with notes on little known

species. International Review of Hydrobiology 83: 439-448

Segers H, Nwadiaro CS, Dumont HJ (1993) Rotifera of some

lakes in the floodplain of the river Niger (Imo State, Nigeria).

II. Faunal composition and diversity. Hydrobiologia 250:

63-71

Segers H, Pholpunthin P (1997) New and rare Rotifera from

Rivers for Life Thale Noi Lake, Pattalang Province, Thai-

land, with a note on the taxonomy of Cephalodella (Notom-

matidae). Annals Limnologie 33: 13-21

Segers H, Sanoamuang L (2007) Note on a highly diverse ro-

tifer assemblage (Rotifera: Monogononta) in a Laotian rice

paddy and adjacent pond. Internationale Revue Hydrobiolo-

gie 92(6): 640-646

Serafim M Jr, Bonecker CC, Rossa DC, Lansac-Toéha FA, Cos-

ta CL (2003) Rotifers of the Upper Parana River floodplain:

additions to the checklist. Brazilian Journal of Biology 63(2):

207-212

©ZFMK

162 Bhushan Kumar Sharma & Sumita Sharma

Sharma BK (1983) The Indian species of the genus Brachionus

(Eurotatoria: Monogononta: Brachionidae). Hydrobiologia

104: 31-39

Sharma BK (1987a) Indian Brachionidae (Eurotatoria: Mono-

gononta) and their distribution. Hydrobiologia 144: 269-275

Sharma BK (1987b). On the distribution of lecanid rotifers

(Rotifera: Monogononta: Lecanidae) in North-Eastern India.

Revue Hydrobiologie tropicale 20: 101-105

Sharma BK (1998) Freshwater Rotifers (Rotifera: Eurotatoria).

In: Fauna of West Bengal. State Fauna Series 3(11): 341—

461. Zoological Survey of India, Calcutta.

Sharma BK (2005) Rotifer communities of floodplain lakes of

the Brahmaputra basin of lower Assam (N. E. India): biodi-

versity, distribution and ecology. Hydrobiologia 533: 209-—

22s.

Sharma BK (2009) Diversity of Rotifers (Rotifera: Eurotatoria)

of Loktak lake, North-eastern India. Tropical Ecology 50(2):

277-285.

Sharma BK (2014) Rotifers (Rotifera: Eurotatoria) from wet-

lands of Majuli — the largest river island, the Brahmaputra

river basin of upper Assam, northeast India. Check List

10(2): 292-298

Sharma BK, Haokip TP, Sharma S (2016) Loktak lake, Ma-

nipur, northeast India: a Ramsar with rich rotifer (Rotifera:

Eurotatoria) diversity and its meta-analysis. International

Journal of Aquatic Biology 4(2): 69-79

Sharma BK, Kensibo (2017) Rotifer assemblages (Rotifera:

Eurotatoria) of two wetlands of Nagaland, northeast India:

ecosystem diversity and interesting features. International

Journal of Fisheries and Aquatic Studies 5(2): 609-617

Sharma BK, Kensibo, Sharma S (2017) Biodiversity of rotifers

(Rotifera: Eurotatoria) of Nagaland, northeast India; rich-

ness, composition and ecosystem diversity. International

Journal of Fisheries and Aquatic Studies 5(5): 180-187

Sharma BK, Noroh N, Sharma S (2017) Rotifers (Rotifera:

Eurotatoria) from floodplain lakes of the Dibru Saikhowa

Biosphere Reserve, upper Assam, northeast India: ecosystem

diversity and biogeography. International Journal of Aquatic

Biology 5(2): 79-94.

Sharma BK, Sharma S (1997) Lecanid rotifers (Rotifera: Mo-

nogononta: Lecanidae) from North-Eastern India. Hydrobio-

logia 356: 157-163

Sharma BK, Sharma S (1999) Freshwater Rotifers (Rotifera:

Eurotatoria). In: Fauna of Meghalaya. State Fauna Series

4(9): 11-161. Zoological Survey of India, Calcutta

Sharma BK, Sharma S (2000). Freshwater Rotifers (Rotifera:

Eurotatoria). In: Fauna of Tripura: State Fauna Series 7 (4):

163-224. Zoological Survey of India, Calcutta

Sharma BK, Sharma S (2005) Biodiversity of freshwater roti-

fers (Rotifera: Eurotatoria) from North-Eastern India. Mit-

teilungen aus dem Museum fur Naturkunde Berlin, Zoolo-

gische Reihe 81: 81-88

Sharma BK, Sharma S (2014a) Northeast India — An important

region with a rich biodiversity of Rotifera. In: Sharma BK,

Dumont HJ, Wallace RL (eds) Rotifera XIII: Rotifer Biology

— A structural and functional Approach. International Review

of Hydrobiology 99(1—2): 20-37

Sharma BK, Sharma S (2014b) Indian Lecanidae (Rotifera:

Eurotatoria: Monogononta) and its distribution. In: Sharma

BK, Dumont HJ, Wallace RL (eds) Rotifera XIII: Rotifer Bi-

ology — a Structural and Functional Approach. International

Review of Hydrobiology 99(1—2): 38-47

Sharma BK, Sharma S (2014c) The diversity of Indian Bra-

chionidae (Rotifera: Eurotatoria: Monogononta) and their

distribution. Opuscula Zoologica Budapest 45(2):165—180

Bonn zoological Bulletin 68 (1): 147-162

Sharma BK, Sharma S (2015a) The diversity and distribution

of Lepadellidae (Rotifera: Eurotatoria: Monogononta) of India.

International Review of Hydrobiology 100 (1): 34-42

Sharma BK, Sharma S (2015b) Biodiversity of freshwater ro-

tifers (Rotifera: Eurotatoria) of Mizoram, Northeast India:

composition, new records and interesting features. Interna-

tional Journal of Aquatic Biology 3(5): 301-313

Sharma BK, Sharma S (2017) Rotifera: Eurotatoria (Rotifers).

Chapter 7: 93-113. In: Kailash Chandra, Gopi KC, Rao DV,

Valarmathi K, Alfred JRB (eds) Current status of freshwater

faunal diversity in India. Zoological Survey of India, Kolkata

Sharma BK, Sharma S (201 8a) The Indian species of 7estudinel-

la (Rotifera: Flosculariacea: Testudinellidae) and their distri-

bution. International Journal of Aquatic Biology 6(1): 15-20.

Sharma BK, Sharma S (2018b) Loktak Lake, Manipur revisited:

A Ramsar site as the rotifer (Rotifera: Eurotatoria) biodiver-

sity hot-spot of the Indian sub-region. Bonn zoological Bul-

letin 67(1): 5-13

Sharma BK, Sharma S (2018c) The rotifers (Rotifera: Eurota-

toria) from the Kashmir Himalayan floodplains and Rotifera

biodiversity of Jammu & Kashmir, north India. International

Journal of Aquatic Biology 6(4): 208—220

Sharma BK, Sharma S (2019a) The biodiverse rotifer assem-

blages (Rotifera: Eurotatoria) of Arunachal Pradesh, the east-

ern Himalayas: alpha diversity, distribution and interesting

features. Bonn zoological Bulletin 68(1):1—12

Sharma BK, Sharma S (2019b) The biodiverse rotifers (Rotif-

era: Eurotatoria) of the floodplain wetlands of Barak valley

of Assam state, northeast India. Opuscula Zoologica Buda-

pest 50(1): 3-15.

Sharma BK, Sharma S (2019c) The biodiverse rotifers (Rotif-

era: Eurotatoria) from small wetlands of the Brahmaputra river

floodplains of lower and upper Assam, northeast India. Jour-

nal of Limnology and Freshwater Fisheries Research DOI:

10.17216/LimnoFish-15981

Sharma S, Sharma BK (2008) Zooplankton diversity in floodplain

lakes of Assam. Records of the Zoological Survey of India, Oc-

casional Paper No 290: 1-307

Sharma S, Sharma BK (2013) Faunal diversity of aquatic in-

vertebrates of Deepor Beel (a Ramsar site), Assam, northeast

India. Wetland Ecosystem Series 17: 1-226. Zoological Survey

of India, Kolkata

Sor R, Meas S, Wong KY, Min M, Segers H (2015) Diversity

of Monogononta rotifer species among standing water bodies

in northern Cambodia. Journal of Limnology 74(1): 192—204

Sorensen T (1948) A method of establishing group of equal am-

plitude in plant sociology based on similarity of species con-

tent and its application to analyse the vegetation of Danish

commons. Biologiske Skrifter 5: 1-34

Trinh MD, Vo MV, Traw ANQ, Le HTN, Tran SN (2019) Spe-

cies diversity of rotifers (Rotifera: Eurotatoria) of Phu Ninh

Lake with five new records from Vietnam. International Jour-

nal of Aquatic Biology 7(1): 38-44.

Tuyor JB, Segers H (1999) Contribution to the knowledge of

the Philippine freshwater zooplankton: new records of mono-

gonont Rotifera. International Review of Hydrobiology 84:

175-180.

Vad CF, Péntek A, Cozma NJ, Féldi A, Toth A, Toth B, Béde

NA, Mora A, Ptacnik R, Acs E, Zsuga K, Horvatha Z (2017)

Wartime scars or reservoirs of biodiversity? The value of

bomb crater ponds in aquatic conservation. Biological Con-

servation 209: 253-262

©ZFMK

Bonn zoological Bulletin 68 (1): 163-165

2019 - Sinclair J.B. & Shamshev I.V.

https://do1.org/10.20363/BZB-2019.68.1.163

ISSN 2190-7307

http://www.zoologicalbulletin.de

Scientific note

urn:Isid:zoobank.org:pub: A6BFC9BE-08 19-438 1-9199-2198E05A3145

Atalanta astigmatica Stackelberg, a new synonym of Wiedemannia lota Walker

(Diptera: Empididae: Clinocerinae)

Bradley J. Sinclair’* & Igor V. Shamshev’

‘Canadian National Collection of Insects & Canadian Food Inspection Agency, OPL-Entomology, K.W. Neatby Bldg., C.E.F.,

960 Carling Ave., Ottawa, ON, KIA 0C6, Canada

Zoological Institute, Russian Academy of Sciences, Universitetskaya nab. 1, St. Petersburg, 199034, Russia

* Corresponding author: Email: bradley.sinclair@canada.ca

'urn:Isid:zoobank.org:author:45 16327F-B73E-456C-927F- 1 8EFBOB9E08B

2urn:Isid:zoobank.org:author:569F41CC-EC2B-4CF0-802A-8D7056C72C93

Abstract. An uncatalogued species of Empididae, Atalanta (Philolutra) astigmatica Stackelberg, 1937 was recently dis-

covered. This species is a new synonym of Wiedemannia lota Walker, 1851.

Key words. Turkmenistan, dance flies, Palaearctic.

While sorting through miscellaneous reprints, the publi-

cation of the Russian dipterist A.A. Stackelberg (1937)

was found to include an uncatalogued species of Empid-

idae: Atalanta (Philolutra) astigmatica Stackelberg,

1937. The species was based on four males and one fe-

male collected at Kara-Kala (now Magtymguly), Turk-

menistan. The species is not listed in the Palaearctic and

World catalogues (Chvala & Wagner 1989; Yang et al.

2007), but is recorded in the online database: Systema

Dipterorum (Evenhuis & Pape 2019). It should be noted

that A. (P.) astigmatica is the only species of Empididae

described by A.A. Stackelberg. Atalanta Meigen, 1800 is

treated as a junior synonym of Clinocera Meigen, 1803

(Evenhuis & Pape 2017).

The type series of A. (P.) astigmatica was collected by

the Russian parasitologist Polina A. Petrishtsheva (St. Pe-

tersburg, Institute of Experimental Medicine). She stud-

ied invertebrates (especially culicids and phlebotomids of

Diptera) as vectors of diseases but her collection (pres-

ent in ZIN) also includes many other taxa of Diptera that

were found together with imagoes of Culicidae and Psy-

chodidae in mammal burrows, caves, etc. The type locali-

ty, Magtymguly, is a small town (village in 1931) situated

near the southern slopes of the Kopet Dag Range on the

river Sumbur (south-western Turkmenistan) and it is not

a surprise that a species of aquatic empidids was found.

However, P.A. Petrishtsheva notes on labels (also in the

title of the paper of A.A. Stackelberg) a specific biotope,

“syum” (syumy, plural in Russian), which are artificial

or natural caves near villages which local people used

mainly for food storage. Stackelberg (1937) described

A. (P.) astigmatica in Russian (p. 123) and in German

Received: 14.05.2019

Accepted: 24.06.2019

(p. 133), because a part of the paper was simultaneous-

ly published in two languages and both versions of the

description are identical. In the Russian version he notes

that P.A. Petrishtsheva found several specimens but in the

German version four males and one female are indicated.

Stackelberg (1937) clearly designates a “type”; 1.e., ho-

lotype, and the entire series was listed as housed in the

Zoological Institute, St. Petersburg, Russia (ZIN), where

two male specimens were found; one specimen in the

general Empididae collection and one specimen in a box

with materials of P.A. Petrishtsheva, both are definitely

conspecific and undoubtedly originates from series noted

by Stackelberg in his paper. However, none of these spec-

imens bear an identification or type label of Stackelberg

(Fig. 1).

On the basis of the male terminalia and specifically

the clasping cercus, this species is conspecific with Wie-

demannia lota Walker, 1851 (Figs 1—2). For this reason

we propose that W. astigmatica is a junior synonym of

W. lota (syn. nov.). Wiedemannia lota is widespread in

the Palaearctic Region from Ireland to central Asia (Ta-

jikistan) (Chvala & Wagner 1989; Shamshev 2016).

The French dipterist F. Vaillant borrowed from ZIN a

collection of Clinocerinae collected in Middle Asia. In

the resulting paper (Vaillant 1960) he notes two males

and one female specimen collected by Petrishtsheva from

Kara-Kala, but did not recognize them as type specimens.

Vaillant identified these specimens as W. Jota. One of

these male specimens was returned to the general Empid-

idae collection of ZIN with Vaillant’s determination la-

bel attached. Vaillant retained two males from the series,

which are now housed in Musée cantonal de zoologie,

Corresponding editor: X. Mengual

Published: 01.07.2019

164 Bradley J. Sinclair & Igor V. Shamshev

Figs 1-3. Atalanta astigmatica Stackelberg, 1937 (=Wiedemannia lota Walker, 1851). 1. Paratype male, habitus in

lateral view and labels; 2. Paratype male, habitus, dorsolateral view; 3. Labels of holotype.

Atalanta astigmatica Stackelberg, a new synonym of Wiedemannia lota Walker

Lausanne, Switzerland (MZLS). One of these male spec-

imens included a Stackelberg identification label (Fig. 3),

which clearly identifies it as the holotype of A. astigmati-

ca. Stackelberg (1937) stated that the series was collected

in September (IX), but the holotype is labelled August

(VII), which we consider an oversight by the author.

Apparently, Vaillant overlooked the type status of this

specimen. He (Vaillant 1960) made no mention of Stack-

elberg’s paper with the description of A. astigmatica and

probably was unaware that it was an available name.

Wiedemannia lota Walker, 1851: 107.

Atalanta (Philolutra) astigmatica Stackelberg, 1937:

123. Type locality: “Kara-Kala” (= Magtymeguly, 38°26'N

56°18'E), Turkmenistan. Syn. nov.

Type material examined.

Holotype. Male, labelled (Fig. 1C): “[printed in Cyrillic,

Russian] Kara-kala [now Magtymguly], Syumy/ Turk-

mentya [= Turkmenistan] VHI —/ Petrishtsheva [1]931”;

“Atalanta Typ. °33/ astigmatica sp.n./ Stackelberg det.”;

“Wiedemannia/ (Chamaedipsia)/ lota HALIDAY/ </

F. VAILLANT dét. [yellow label]” (ZIN) [currently

housed in MZLS].

Paratypes. Same data as for holotype, except collected in

IX (2 64, ZIN, 1 63, MZLS).

Bonn zoological Bulletin 68 (1): 163-165

165

Acknowledgements. Jean-Luc Gattolliat (MZLS) kindly as-

sisted us in locating two males from the type series donated

by F. Vaillant to his Museum and provided the photo of the

holotype labels. Alexey Kovalev (ZIN) kindly produced pho-

tos of the habitus of the paratype. The study of Igor Shamshev

was performed within the frames of the Russian State Research

Project No AAAA-A19-119020690101-6 and supported by

the Russian Foundation for Basic Research (grant no. 18-04-

00354A).

REFERENCES

Chvala M, Wagner R (1989) Empididae. Pp. 228-336 in: Sods

A & Papp L (eds) Catalogue of Palaearctic Diptera, Volume 6,

Therevidae — Empididae. Elsevier Science Publishing, Am-

sterdam

Evenhuis NL, Pape T (2017) Battling the un-dead: the status of

the Diptera genus-group names originally proposed in Johann

Wilhelm Meigen’s 1800 pamphlet. Zootaxa 4275: 1-74

Evenhuis NL, Pape T (eds) (2019) Systema Dipterorum, Ver-

sion 2.2. Online at http://sd.zoobank.org/, accessed on

May 14, 2019

Shamshev IV (2016) An annotated checklist of empidoid flies

(Diptera: Empidoidea, except Dolichopodidae) of Russia.

Proceedings of the Russian Entomological Society 87: 3-183

Stackelberg AA (1937) Neue Dipteren-arten aus Hohlen de

Vertebrata Turkmeniens und angegrenzenden Lander Mittel

Asiens. Trudy soveta po izucheniyu estestvennykh proiz-

voditelnykh sil. Seria Turkmenskaya 9: 121—139 [In Russian

with German descriptions]

Vaillant F (1960) Quelques Empididae Atalantinae d’ Asie russe

[Dipt.]. Bulletin de la Société entomologique de France 65:

170-186

Walker F (1851) Insecta Britannica. Diptera. Volume 1. Reeve &

Benham, London

Yang D, Zhang K, Yao G, Zhang J (2007) World Catalog of

Empididae (Insecta: Diptera). China Agricultural University

Press, Beijing

©ZFMK

BHL

Blank Page Digitally Inserted

Bonn zoological Bulletin 68 (1): 167-181

2019 - Mey E.

https://do1.org/10.20363/BZB-2019.68.1.167

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:|sid:zoobank.org:pub:A7B17D73-FA88-41B9-9361-FB3B3AB2ABDD

Parasitic on bird or mammal?

Echinopon monounguiculatum gen. nov., spec. nov.,

representative of a new family (Echinoponidae fam. nov.) in the Amblycera

(Insecta: Psocodea: Phthiraptera)

Eberhard Mey

Zentralmagazin Naturwissenschaftlicher Sammlungen der Martin-Luther-Universitat Halle-Wittenberg,

[Natural Science Collections, Martin Luther University Halle-Wittenberg], Domplatz 4, D-016108 Halle (Saale), Germany

* Corresponding author: Email: mey-rudolstadt@t-online.de

urn:lsid:zoobank.org:author:40DEB37F-48C3-434A-BA40-A7495ED878CC

Abstract. On the study skin of a Bornean Black Magpie Platysmurus aterrimus (Passeriformes, Corvidae) collected in

1888, stored in the collection of the Museum fir Tierkunde [Zoological Museum] Dresden, a female specimen of a pha-

rate amblyceran third instar larva was found. The possibility that the larva originally lived on this bird can be definitively

excluded, therefore it can only be considered as a straggler from an unknown host species. Its morphology showed a com-

bination of unusual characters that differentiates the specimen from all other known Amblycera, but that does place it close

to the Menoponidae sensu Jato. The insect, measuring only 1.32 mm in length, is characterized dorsally by stiff spine-like

setae on thorax and abdomen, and can be placed close to a menoponoid-style habitus by the following autapomorphies that

form the basis for the erection of Echinoponidae fam. nov.: 1. A blunt, curved cutaneous bulge on both sides of the labrum

equipped with three sturdy setae on each side, whose function (apart from possible movement coordination) is unknown.

— 2. A respiration system with tiny stigmata and tracheae, apparently without a post-spiracular setal complex at each end

of the central abdominal tergites. — 3. Coxa I is rounded, not elongated anteroposteriorly as tn all avian Amblycera. — 4. All

three pairs of legs have only a single long apically curved, basally humped claw. A small euplantula sits apically opposite

the second, only slightly smaller, first tarsal segment while the tarsus sole is equipped with two rows of adhesive pads (?)

and two setae pairs. Single-clawed Amblycera are only known from Neotropical mammals. — 5. Dorsally and ventrally,

head, thorax, and abdomen setae depart in many details from previously known chaetotaxies, (e.g.) ventral femur III has

setal combs (ctenidia) with three rows, on each side of abdominal segment II they have two rows, and on segments III to

VII one row on each (ctenidia are absent in all mammal-infesting Amblycera and in avian Amblycera are unknown in

such an excessive development); abdominal macrochaetae present only ventrally with one pair on each side of segment IT

and two pairs on segments VIII and IX. — 6. The female probably lacks the anal corona of setae typical of Menoponidae.

These characters, and the circumstances of the discovery of the specimen (with a record of a goniodoid ischnoceran, also

a straggler, on the same skin), allow us to make the simple decision as to whether the enigmatic Single-clawed Spiny

Amblyceran Echinopon monounguiculatum gen. nov., spec. nov. is an avian or a mammalian amblyceran.

Key words. Amblycera, morphology, taxonomy.

INTRODUCTION

The search for mummified chewing lice on an old mu-

seum study skin of the endemic Bornean Black Magpie

Platysmurus aterrimus (Corvidae) resulted in the sur-

prising discovery of an unknown species and genus of

the suborder Amblycera. Despite the rather awkward

situation of having only a single pharate (molting) third

instar larval female amblyceran to work with, whose ac-

tual host species was definitely not the Bornean Black

Magpie, this remarkable finding is here presented. The

specimen represents a new taxon, which actually requires

the erection of its own family within the Amblycera, a

suborder parasitizing almost all avian families but only a

Received: 03.01.2019

Accepted: 09.07.2019

few mammal groups, in particular Neotropical Rodentia

as well as Australian and Neotropical Marsupialia.

Based on the overview by Price et al. (2003: 3), 1509

valid species of Amblycera are known, of which 1341

infest birds and only 168 infest mammals. Taking a con-

servative approach, they can be placed in 10 families

(see Mey 2003; number of species according to PRICE

et al. 2003 in square brackets): Only on birds — Meno-

ponidae Myjéberg, 1910 s./. [1043], Laemobothriidae

Myjoberg, 1910 [20], Ricinidae Neumann, 1890 [79] and

Trochiloecetidae (Carriker, 1960) Clay, 1962 a [30]. On

mammals — Boopiidae Mjéoberg, 1910 [55], Trimeno-

ponidae Harrison, 1915 [18], Protogyropidae (Ewing,

1924) Eichler, 1963[1], Gyropidae Kellogg, 1896 [44],

Abrocomophagidae Emerson & Price, 1976 [3] and

Corresponding editor: R. Peters

Published: 18.07.2019

168 Eberhard Mey

Gliricolidae (Ewing, 1924) v. Kéler, 1957 [45] (see also

Emerson 1982, Lakshminarayana 1976). If we ignore

the anthropogenically created secondary colonization of

Heterodoxus spiniger (Enderlein, 1909), this straightfor-

ward picture of the hospitalic distribution is “distorted”

only by one other boopiid species (Therodoxus oweni

Clay, 1971), which lives on cassowaries of New Guinea

(Mey & Barker in prep.).

A consistent recognition by louse systematists of the

Psocodea in the phylogenetic system has so far not been

reached because arguments regarding the paraphyly of

the Phthiraptera are apparently insufficiently grounded.

The discussion is still ongoing since Lyal’s (1987) mor-

phological and Murrell & Barker’s (2005) controversial

genetic study; see also Johnston et al. (2004), Yoshiza-

wa & Johnston (2006) and Friedemann et al. (2013).

Following the dissolution of the orders Psocoptera and

Phthiraptera, and their amalgamation in the order Psoco-

dea (formerly the superorder of Psocoptera and Pththi-

raptera), Ruggiero et al. (2015) among others have sug-

gested the following phylogenetic classification:

Order: Psocodea

Suborder: Troctomorpha

Infraorder: Nanopsocetae

Subinfraordinal group: Phthiraptera

Superfamily groups: Amblycera, Anoplura, Ischnocera

and Rhynchophthirina

The study by Johnson et al. (2018) confirms this classi-

fication.

MATERIAL & METHODS

The bird study skin that harbored the Echinopon spe-

cimen was twice thoroughly examined by me. During a

cursory observation the finding was initially misidenti-

fied as the exuviae of a Dermestes beetle, but following

preparation of the specimen it was eventually discovered

to be an unidentified louse species (Fig. 1) The follow-

ing more thorough examination of the Bornean Black

Magpie skin showed with certainty that the Echinopon

individual could not have originally infested that bird

species but must have arrived on the skin through con-

tamination. Neither a second specimen of Echinopon nor

amblyceran nits could be found on the skin. Only the sev-

eral imagines of the ischnoceran Olivinirmus borneensis

Mey, 2017 occurring on the skin can definitely be accept-

ed as having lived on the Bornean Black Magpie, espe-

cially as nits and larvae of the species were also found.

Instead, an additional finding on the skin (Figs 2—3) was

a pharat immature male of a goniodoid specimen (total

length 1.05 mm, head length 0.34, rear head breadth

0.42, abdomen breadth 0.51). Therefore, the possibility

must be conceded that the type host of Echinopon might

Bonn zoological Bulletin 68 (1): 167-181

Pharate

Fig. 1. female third instar larva, holotype

(Slide M. 5408. b) of Echinopon monounguiculatum gen. nov.,

spec. nov. Total length 1.32 mm. Photos: Stephan Lowe.

be a bird, and this would be either a pigeon/dove or a

galliform, since the true goniodids only parasitize the

orders Columbiformes and Galliformes. It can be not-

ed, that this specimen also reveals similarities with these

three ischnocerans, which live only on the Couas (Cuc-

uliformes) of Madagascar: Couala Gustafsson & Bush,

August 2017 (syn. Couanirmus Mey, September 2017),

Tesonirmus Mey, 2017 or Koanirmus Mey, 2017 (Gus-

tafsson & Bush 2017, Mey 2017). Echinopon morphol-

ogy also points in this direction, though it is so unusual

that a mammal as host cannot be excluded at this stage.

It is more than likely that both larvae (Figs 1—2) got

onto the Bornean Black Magpie skin from their origi-

nal host as “stragglers”, either in life in the “game bag”,

or on the taxidermy table, or even as mummies during

some handling of the study skin collection. In this last

case, strictly speaking, the idea that the type host must

occur on Borneo would have to be rejected. Skin C 9223

©ZFMK

Parasitic on bird or mammal? Echinopon monounguiculatum fam., gen. & spec. nov. in the Amblycera, Phthiraptera 169

Fig. 2. Pharate male third instar larva goniodoid ischnocer-

an, undetermined (slide M. 5408. b, total length 1.05 mm),

found together with Echinopon monounguiculatum gen. nov.,

spec. nov. on the study skin of a Bornean black Magpie Platy-

smurus aterrimus.

was purchased in 1888 by A. B. Meyer from the taxi-

dermist and natural history dealer Edward Gerrard Ist

(1810-1910). Gerrard was working for the “new Natural

History Museum in South Kensington”, and was an “as-

sociate member of the Linnean Society of London and a

friend of Charles Darwin” (Morris 2014: 2). How Ger-

rard came into possession of the skin and under which

circumstances can today hardly be reconstructed without

going to a great deal of trouble. The inventory book of

the Dresden collection contains less information on the

matter than the original label on the bird skin itself; nor

does Morris (2014) provide any clues that could help. For

the moment, we have no other choice than to hope that

Echinopon monounguiculatum gen. nov., spec. nov. will

one day be rediscovered.

Bonn zoological Bulletin 68 (1): 167-181

Forty years have passed since the amblyceran chew-

ing-louse family Abrocomophagidae was erected, named

from the new genus and species Abrocomophaga chilen-

sis Emerson & Price, 1976 discovered in 1974 in the

Chilean Andes on Bennett’s Chinchilla Rat Abrocoma

bennettii (Emerson & Price 1976). This is the most recent

case in the 200-year history of phthirapterology in which

a new discovery immediately required that such a high

new taxonomic category be employed to accommodate

an unknown recent chewing louse.

Fig. 3. Male genitalia of the goniodoid in Fig. 2. Scale 0.1 mm.

In the meantime two further South American Abro-

comophaga species have been found: A. emmonsae

Price & Timm, 2000 ex Cuscomys ashaninka Emmons,

1999 [Abrocomidae] and A. hellenthali Price & Timm,

2000 ex Octodon degus (Molina, 1782) [Octodontidae]|

(Price & Timm 2000). However, Price & Timm (2000:

211) have withdrawn Abrocomophagidae, treat it now as

a synonym and place it in the Gyropidae, although they

state: “This genus [Abrocomophagal] is separated from

others in the family Gyropidae (and suborder Amblyc-

era) in having known representatives with all legs having

an unmodified tarsal claw and the abdomen with only

five pairs of spiracles”. Price et al. (2003: 75) should at

least have mentioned the former proposed division of

Gyropidae into subfamilies (Protogyropinae, Gyropinae

and Gliricolinae, see Clay 1970) but they did not.

The pharate third-stage Echinopon larva is mounted in

Canada balsam, and the state of its preservation can be

seen in Fig. 1. The photographs of the prepared specimen

©ZFMK

170 Eberhard Mey

Fig. 4. Front of head of Echinopon monounguiculatum gen. nov., spec. nov. with “labral organ” (LO).

Figs 5—6. Chaetotaxy of margin of front of head from one side above the upper mandibular articulation between nodus and labrum

(semi-schematic), 9 9. 5. Actornithophilus totani (Schrank, 1803) (Menoponidae sensu lato). 6. Echinopon monounguiculatum

gen. nov., spec. nov. (Echinoponidae fam. nov.) with “labral organ” (LO). Scale 0.1 mm.

Parasitic on bird or mammal? Echinopon monounguiculatum fam., gen. & spec. nov. in the Amblycera, Phthiraptera 171

Fig. 7. Labium and postmentum chaetotaxy of Echinopon mon-

ounguiculatum gen. nov., spec. nov. Scale 0.1 mm.

(which also show a male of the pharate goniodoid men-

tioned above) were taken by Stephan Lowe at the Phy-

letisches Museum of the Friedrich-Schiller-Universitat in

Jena. All line drawings are by the author.

The following description of the new taxon is unusual

—a perhaps justified objection — in that it is solely based

on a single pharate third instar female, on which larval as

well as imaginal characters are visible. It should be re-

called that the paurometaboly of the Phthiraptera means

that during post-embryogenesis the morphostructure de-

velops gradually altering imaginipetal characters (e.g.,

chaetotaxy; see for instance Eichler 1959, v. Kéler 1952,

1955, Modrzejewska & Ztotorzycka 1987, Price 1987).

Even the beginnings of genital structures can often be

recognized in pharate third instar. The evaluation of these

characters therefore requires great care in order to avoid

erroneous interpretations.

In the Echinopon monounguiculatum holotype, the

postembryonic molt suture is a Y-shaped “fault line”

running from the head to abdominal segment VI (Fig. 1).

In this feature, Echinopon does not fundamentally dif-

fer from the familiar pattern in the other Amblycera (es-

pecially Menoponidae sensu /ato): molt suture running

from head to the far margin of abdominal segments II,

Fig. 8. Antenna and apparently three-segmented maxillarpalpus (end segment in molt) of Echinopon monounguiculatum gen. nov.,

spec. nov.

Bonn zoological Bulletin 68 (1): 167-181

©ZFMK

172 Eberhard Mey

DHS 27

Fig. 9. Chaetotaxy of head, prothorax, and mesothorax (dorsal) of Echinopon monounguiculatum gen. nov., spec. nov. Front of

head to molt suture. Rear of head in fresh molt, except for a few bristles on the temple not yet sclerotized, therefore uncertain in

outline.

38 =#

ee vee ote oy

Fig. 10. Chaetotaxy of head, prothorax, and mesothorax (dorsal) of Echinopon monounguiculatum gen. nov., spec. nov. Sclerotized

temple half, both pronotum halves and mesonotum of the third instar larva with bristles. Scale 0.1 mm. Bristle enumeration after

Clay (1962, 1969) and Ledger (1970, 1971).

Parasitic on bird or mammal? Echinopon monounguiculatum fam., gen. & spec. nov. in the Amblycera, Phthiraptera 173

Fig. 11. Meso- and metanotum as well as abdominaltergite I

(each of right side) of Echinopon monounguiculatum gen. nov.,

spec. nov. Scale 0.1 mm.

III, or IV (Eichler 1963, v. Kéler 1969, Neuffer 1954).

In the Laemobothriidae, however, there is a difference,

since in Eulaemobothrion atrum (Nitzsch, 1818) the pre-

formed molt suture is in a ventral position, beginning on

both sides of the antennal bases, then joining up before

the gular plate and running medianly to the third pair of

legs (v. Kéler 1969: 63).

A phylogenetic character analysis of Echinopon, to-

gether with a revision of Jadwigiella Mey, Eichler &

Kaddou (Menoponidae sensu lato) (Mey et al. 2004), is

planned.

Abbreviations. A, 8, C: dorsal temple setae (new ?, un-

known in Amblycera ?). — a—e (f): dorsal head sensillae (f

is perhaps new). — appsr: anterior-posterior pronotal setal

row (= marginal prothoracic setae = mps). — Cn: clypeal

nodus. — cps: central pronotal setae complex. — ct 2—7:

ventral ctenidia (“setal comb”) on abdominal segments II

to VII. — DHS 2—32: dorsal head setae 2-32. — dps I—3:

dorsal prothoracic setae. — E: euplantula. — ES: ecdysial

suture. — L: labrum. — LO: “labral organ”. — M: mandi-

ble. — Pm: postmentum. — Pn: postnotum. — ps: pronotal

Bonn zoological Bulletin 68 (1): 167-181

Fig. 12. Double-segmented tarsus and tibia (detail) of first pair

of legs of Echinopon monounguiculatum gen. nov., spec. Nov.

Pretarsus in molt (imaginal claw fully developed, larval “drawn

in” and disintegrating).

sensillum. — f: transverse pronotal carina. — T /—2: tarsus

1 (first segment), 2 (second segment = pretarsus).

RESULTS

Phylogenetic placement. The Echinoponidae fam. nov.

are differentiated from all other known Amblycera by the

following characters. If there is a strong possibility that

certain characters are autapomorphies then this is indicat-

ed. Characters whose interpretation is uncertain are also

thus indicated. The characters or combined characters

1-4, 6, 8-12, 14 and 15 are exclusive to the Echinoponi-

dae.

1. Special organ flanking each side of the labrum. Pear-

shaped cutaneous bulge with bristles between labrum

and front of clypeal nodus, mounted on a broad base

immediately before the upper mandibular articulation

(Figs 4, 6). Whether this is homologous with the bris-

tle-free pulvinus (pallettes, pulvinarium) of Ricinus is

questionable. Autapomorphy.

2. Diverges in at least six positions from the striking

dorsal head bristles (including sensilla) of Menoponi-

dae s./. and Boopiidae (Figs 9-10). The following are

six autapomorphies: (1) On rear head only one macro-

chaeta on temple (DHS 27; also longest head bristle)

with one associated mesochaeta (DHS 26). (2) From

here to interface of pronotum and rear head 8 micro-

chaetae are marginally inserted at roughly similar

©ZFMK

174 Eberhard Mey

Figs 13—14. Echinopon monounguiculatum gen. nov., Spec. nov.

13. First pair of legs (of the right one only coxa and trochan-

ter). Tibia (partly) and femur without bristles. Scale 0.1 mm.

14. Tibia and tarsus enlarged.

intervals. Therefore, compared with Menoponidae

and Boopliidae, between DHS 23 and 26 there are 6

additional bristles (in Fig. 10 not numbered). (3) The

submarginal DHS 21—23 are microchaetae. In Meno-

ponidae and Boopiidae at least one of them is in the

form of a macrochaeta (Fig. 10). (4) Among the preoc-

ular setae DHS 8-11 of Menoponidae and Boopi-

idae one is missing, probably the first one (DHS 8).

In this group of bristles DHS 9 is the second-longest

head macrochaeta. It is followed by a short (DHS 10)

and the third-longest head bristle (DHS 11) (Fig. 9).

(5) Of the setal complex DHS 14—16 with sensilla c

and d there is only one microchaeta (14 or 15) and

also, shifted one bristle-length towards the median, a

bristleless sensillum (probably d) (Fig. 9). (6) Of the

dorsal head sensilla a—-e (sensu Clay 1969, Marshall

2003) only d is definitely without an accompanying

bristle. Also without an adjacent bristle is a new (=

f) sensillum, sitting on the rear head exactly between

DHS 21 and 22 (Fig. 10). (7) In Fig. 10, three temple

setae, marked A, B and C, cannot with certainty be

homological with bristles observed in Menoponidae

or Boopiidae.

3. Prothorax without macrochaeta, which would have

been longer than the prothorax. Pronotum with 11

robust marginal-posterior spines (= appsr incl. mps)

Bonn zoological Bulletin 68 (1): 167-181

Parasitic on bird or mammal? Echinopon monounguiculatum fam., gen. & spec. nov. in the Amblycera, Phthiraptera 175

Fig. 15. Femur III with “double” triple-rowed ctenidia (upper

of imago, lower of third instar larva) of Echinopon monoun-

guiculatum gen. nov., spec. nov.

on one half and 9 on the other. Their regularly spaced

points of insertion line the side and hind margins

of the pronotum. All spines are relatively short, the

longest being the middle ones on the hind margin

(Fig. 10). Autapomorphy.

. Oneach body half, along the transverse pronotal cari-

na, there are three relatively fine bristles (differing in

size only on one side), dps 1—3. In this row, on both

sides, there 1s a pronotal sensillum (ps.). On each side

two robust spiny setae are inserted median-posterior-

ly (Fig. 10). Autapomorphy.

. Narrow free mesonotum with one pair of microchae-

tae on the margin (Figs 10-11). The actual micro-

chaetae placing (in Figs 10-11) on the mesonotum is

unclear.

. Except for the front margin, the metanotum is

equipped with dense series of spine-like setae, (each

half with 36 spines), only one pair of spines extends

median-posteriorly over the hind margin of abdomi-

nal tergite I (Fig. 11). Autapomorphy.

. First coxa rounded (Fig. 13), not anterioposteriorly

extended as in Boopiidae and bird-infesting Ambly-

cera. Plesiomorphy?

. Tarsus two-segmented. First tarsal segment with dou-

ble row of adhesive pads on the soles (each with at

least 8 pads), which are each flanked at the start and

Figs 16-17. Abdomen (ventral) of Echinopon monounguiculatum gen. nov., spec. nov. from segment III (16), from segment III to

end of abdomen (17). Note ctenidiae and macrochaetae growth. Ventral structures hardly pigmented and sclerotized.

Bonn zoological Bulletin 68 (1): 167-181

©ZFMK

176 Eberhard Mey

\ ct 2

ee ee eee ree, ee ”

ct 3

C gs vary ty

—1

ct4

Win,

Fig. 18. Abdomen (ventral) with central chaetotaxy of Echinopon monounguiculatum gen. nov., spec. nov. Lateral bristles very

probably incomplete. Scale 0.1 mm.

Parasitic on bird or mammal? Echinopon monounguiculatum fam., gen. & spec. nov. in the Amblycera, Phthiraptera 177

Fig. 19. Abdomen (dorsal) from segment IV of Echinopon monounguiculatum gen. nov., spec. nov. Lateral sclerites on left side

have been pushed into each other on the slide. Scale 0.1 mm.

end with one pair of bristles. On tarsus I apical-dis-

tally a small euplantula (Figs 13-14). Second tarsal

segment without euplantula. Autapomorphy.

9. Second tarsal segment (pretarsus) of the three more or

less same-sized pairs of legs with a single claw. Claw

large, roughly half as long as second tarsal segment,

apically more or less bent to a hook, basally with a

proximal hump; not spreadable (Figs 12-14). Aut-

apomorphy.

10. Hardly sclerotized tiny abdominal stigmata pleural

(!) between the separated lateral sclerites. Tracheae

on segments III to VHI are so small that they can

Bonn zoological Bulletin 68 (1): 167-181

hardly be detected. The lumen of the tracheal branch-

es 1s hardly larger than that of Gliricola porcelli

(0.005 mm). So stigmata and tracheae of Echinopon

are among the smallest in the Amblycera.

. Postspiracular setal complex of abdominal tergites is

peculiar: postspiracular seta on mediad lateral sclerite

is long spiny seta, which is accompanied by only one

minute seta closely associated with the alveolus of the

postspiracular seta on segments II to VIII (Fig. 19).

12. Dorsal and ventral abdominal bristles in combination

autapomorph, in each of these characters: (1) Dor-

sal and pleural aspects equipped almost exclusively

—

©ZFMK

178 Eberhard Mey

with spines (except for tiny anterior bristles stand-

ing in 1—2 rows on tergites II to VIII). At least one

macrochaeta on each side of terminal end of abdo-

men abdomen (Fig. 19). (2) Ventrally without long

spines, bristles finer and more differentiated than dor-

sally (Figs 18-19). (3) Segments II to VHI ventrola-

terally with combs of spiny setae. Ctenidia on III in

double rows, all others in single rows (Figs 16-18).

(4) Macrochaetae ventrally only on segment II and

terminalia as follows: on II a lateral macrochaeta on

each side, which extends to segment VI; on segment

VIII two pairs of macrochaetae on each side, which in

the prepared specimen (Figs 17—18) show a striking

“relaxed position” below the end of the abdomen (in

front of the vulval opening).

13. Vulva margin with only two median small bristles

(Fig. 18). Genital chamber with striking outline,

above which a group of bristles in four rows is me-

dianly inserted into the still opaque hypogynium

(Fig. 18). Autapomorphies?

14.Hind margin of final abdominal segment almost

straight except for two slight lateral indentations and

completely sclerotized (not soft skinned as is usual),

(Figs 18-19).

15. Setal fringe around anal margin absent (Figs 18-19).

TAXONOMY

Phthiraptera Haeckel, 1896

Suborder Amblycera Kellogg, 1896

Echinoponidae Mey, fam. nov.

Type species: Echinopon monounguiculatum Mey,

gen. nov., here designated

urn. lsid:zoobank.org:act: E49D 1362-3FA2-412F-A162-08365D65CB55

Diagnosis. Very small (total length of 9 pharate larva

1.32 mm; 4 unknown, based on known amblyceran

males probably < 1 mm) amblyceran louse of meno-

ponoid habitus. “Labral organ” laterally on each side

between cranial mandibular articulation and margin of

front of head. Only one macrochaeta (DHS 27) on head,

where, between DHS 26 and border of thorax, there are

eight marginal microchaetae. (Head chaetotaxy does not

conform to known patterns in Menoponidae sensu lato).

Coxa I rounded. Leg pairs homonomous, pretarsus with

only one non-spreadable long robust claw. Thorax and

abdomen dorsally with short robust protective spine-like

setae. Ventral ctenidia on femur III with three rows, on

each side of abdominal segment II two rows, and on seg-

ments HI to VII one row. On abdominal segment VIII

two pairs of macrochaetae flank the hypogynium on each

side. Lateral-sternally on abdominal segment I one mac-

rochaeta on each side. No further macrochaetae on abdo-

men. Respiratory system with tiny spiracle and trachea

Bonn zoological Bulletin 68 (1): 167-181

on abdominal segments III-VHI, but complete without

postspiracular-seta complex.

True type host (bird or mammal) unknown.

Autapomorphies. The extraordinary single-clawed

pretarsus, the dense dorsal spiny growth on thorax and

abdomen, the presence of ventral ctenidia on abdominal

segments II—VII, and the sparse but striking growth of

ventral macrochaetae on abdominal segments II and VHI

are only some of the characters unique among the Am-

blycera and clearly autapomorphic for the family.

Echinopon Mey gen. nov.

Type species: Echinopon monounguiculatum spec. nov.

urn: |sid:zoobank.org:act: FED6BD6C-2097-4DDD-B480-D5858F239A9E

Diagnosis. By the characters of the family.

Apomorphies. As for the family.

DESCRIPTION

Measurements. Total length 1.32 mm, head length (me-

dian) 0.30 mm, front head breadth 0.33 mm, rear head

breadth 0.46 mm. Remaining intact abdomen broadest at

segment IV with 0.51 mm. The four ventral macrochae-

tae on each side of abdominal segment VHI/IX are by far

the longest body hairs (c. 0.6 mm).

Head. Typical menoponoid head form (Figs 1, 9). Tem-

poral region dorsally with honeycomb-like structure

(here only visible on skin of third instar). Front of head

with slightly protruding clypeus, with nodus on each side

(Figs 4, 6).

Before the abutment of the upper mandibular articula-

tion there is a cutaneous, clearly contrasting pear-shaped

opaque structure with 5 bristles (LO in Fig. 6). The fron-

tal “pear-stalk” is formed by a relatively large bristle,

which (in the prepared specimen) lies in the narrow space

between labrum and frontal head margin, where it prob-

ably reaches to the head median on each side (bristle tips

not visible; bristles in Fig. 6 however exposed). An addi-

tional bristle of the same thickness, but probably slight-

ly shorter, emerges below this one and similarly lies in

front of the labrum. The three other bristles on the “labral

organ” are microchaetae directed proximally or caudally

(Fig. 6). The lateral labral bristle group exists in a simi-

lar form also in the Menoponidae sensu Jato (Fig. 5) and

Boopiidae, but it is not structured in the way it is in the

organ unique to Echinopon. It probably has a tactile func-

tion connected to movement or feeding.

The labrum is almost fixed to the front head margin

(Fig. 4). For labium see Fig. 7. Labial palps with 6 or 7

terminal setae and prementum with 3 setae on each side

©ZFMK

Parasitic on bird or mammal? Echinopon monounguiculatum fam., gen. & spec. nov. in the Amblycera, Phthiraptera 179

(Fig. 7). The cibarial sclerite is of the Colpocephalum

type (Haub 1972). Gula (without pigmentation) with two

bristles of different length on each side. Maxillary palps

only apparently with three segments (basal segment on

both sides not definitely identified) (Fig. 8). Apical max-

illary segment with strikingly rod-shaped pair of bristles.

Maxillary palps without postpalpal processes. Antennae

with four segments, on terminal segment (second fla-

gellomere = anellus) two sensilla coeloconicum. Dor-

solateral head margin with notch. Antennal fossae fully

developed (Fig. 9). One short, one middle-sized seta at

the anterior termination of the ventrolateral head margin.

Ommatidia not found, one ocularis (DHS 20) present

as microchaeta (Fig. 9). Dorsal head chaetotaxy as in

Figs 9-10.

Thorax. Transverse pronotal carina with 3 setae on each

side (larger on one side than on the other), one sensil-

lum (ps) each between the two mediad ones (Fig. 10).

Pronotum posterior-medially on each side with one pair

of bristles. Anterior-posterior row of 20 bristles (11/9, of

nearly equal length) on the dorsal prothorax complete

without gap (Fig. 10). The postnotum (Pn) with two mi-

crochaetae, hyaline (Fig. 13). Between coxae I there is a

conspicuous “bracing sclerite’, between coxae I and II

an anteriorly forked pair of sclerites (Fig. 13, interpreta-

tion unclear). The craniad bristle pair very probably be-

longs to the prosternite. A small free-moving mesonotum

with its own fine bristles (whose assignment is doubtful)

(Figs 10-11). Metanotum, except for the craniad third,

densely covered with spine-like setae (36 on each side!)

(Fig. 11).

All pairs of legs incl. tarsi and claws homonomous.

In detail, however, coxa I and femur I are slightly larg-

er than those of the other leg pairs. Bristles and sensilla

of coxa I and trochanter I as in Fig. 13. Coxae I to III

roughly rounded. Distance between coxae I and II slight-

ly greater than between II and HI. Tibiae of all pairs of

legs dorsal-distally with marginal fine spines projecting

at right-angles (on tibiae I c. 17/14, on II c. 11/10, and

on II c. 8/9); larval bristle rows are already disintegrat-

ing (Fig. 15). Only femur III sternally with triple-rowed

ctenidium (Fig. 15). This has the longest spines compared

with the only single- or double-rowed abdominal ctenid-

ia (Fig. 18). The tarsi have two segments (Figs 13-14).

All pairs of legs with a single apically slightly curved

claw of the same size (= single-clawed creeping leg, pes

reptans). The unguitractor divides on the proximally un-

equal paired on tarsus II (Figs 13-14). The structure of

the larval pretarsus was discernably complete so that in1-

tially a double claw was considered, but in the pharate

specimen this can be definitely excluded.

Abdomen. Ventrally and pleurally with finely streaked

shagreened appearance. By contrast, tergites finely and

densely spotted (Figs 16-17). Surface textured only on

Bonn zoological Bulletin 68 (1): 167-181

lateral sclerites and distal ends of tergites with caudal

false hairs protruding from the integument. Abdomen

dorsally mainly only with spines (one pair of macrochae-

tae only at the end of the abdomen), ventrally (except for

ctenidia) with finer bristles and pairs of macrochaetae on

segments II and VIII/IX (Figs 16-18).

On segment I only one very narrow lateral sclerite

(Fig. 11), on segments II to VIII on each side two se-

parate lateral sclerites (tergopleurites) (Fig. 16-17, 19).

It can be expected that the separate abdominal tergopleu-

rites II-VIII will be fused together following imaginal

molt.

Tergopleurites with a posterior row of spines: I, 13; II-

IV, 14 each; V, 13; VI, 14; VII, 12; VIII, 10; TX, 8 (incl.

2 macrochaetae) + 6 spines on rear margin of abdomen.

Anterior half of tergopleurites with fine, double-rowed

Sparse cover of microchaetae (Fig. 19). Sternites not scle-

rotized (Figs 16-18). Bristle pattern (except on ctenidia

and lateral thin spine on each side of segments HJ—VIT/

IX) hardly discernable because of ecdysis. Ctenidia on

sternites III and IV perhaps still in development? Abdo-

men ventrally with macrochaetae on only two places: on

each side sternolaterally on segment II one and on seg-

ment VIII/IX a double pair (Fig.18).

Subgenital region with a unique bristle pattern

(Fig. 18). Bell-shaped genital chamber, on which 16 fine

bristles of the same size are concentrated. Only a single

pair of microchaetae on the vulva margin, immediately

before which are 4 fine much larger bristles.

Abdominal end is broadly truncated, slightly indented

laterally on each side (Figs 17-19). Anal margin com-

pletely lacking (perhaps only applies to larval stage?).

Dorsal side of abdominal terminalia with a submargi-

nal row of 6 spines and on each side one macrochaeta,

ventromedial 8 fine bristles (only the insertion points are

visible since the bristles are broken off).

Between the lateral sclerites (Fig. 19), or laterally from

there, are the stigmata (on segments III to VIII), to which

(only partly visible) inconspicuously small tracheae lead.

Their lumen has a diameter of less than 0.006 mm. For

comparison, the diameter of some longitudinal tracheal

trunks: Gliricola porcelli (Schrank, 1781) 0.005 mm,

Heterodoxus longitarsus (Piaget, 1880) 0.040 mm, Lae-

mobothrion maximum circi (Fourcroy, 1785) 0.069 mm,

and Piagetiella titan (Piaget, 1880) 0.119 mm (v. Keéler

1967). Abdominal post-spiracular setal complex com-

plete left, in contrast to all other Amblycera. These have:

“At least one pair of post-spiracular setae with two min-

ute adjacent setae, rarely absent and replaced by single

circular sensillum” (Clay 1970: 87). Trichobothria on the

abdomen not confirmed.

Derivatio nominis. The genus name is created from the

latinized Greek echinatum (= spiny) and the suffix pon. It

is neuter. The species epithet is constructed from Greek:

mono (= one) and unguiculata (= claw), referring to the

©ZFMK

180 Eberhard Mey

single-claw condition of all three pairs of legs. The name

of the provisionally monotypic family Echinoponidae

fam. nov. 1s derived from the genus name.

Echinopon monounguiculatum Mey spec. nov.

urn: lsid:zoobank.org:act: F916D592-C184-4262-AF 56-3C80CC29B676

Figs 1, 4, 6-19

Single-clawed Bornean Spiny Amblyceran; Einkrallige

Borneo-Stachelamblyzere

Material. A female pharate third instar larva (slide Mey

5408. b) collected from a dry study skin (C 9223) of Pla-

tysmurus aterrimus in the Museum fir Tierkunde, Senck-

enberg Naturhistorische Sammlungen Dresden. Skin la-

bel reads: “1888 Trusan, Borneo, coll. Gerrard“. True

host unknown.

Holotype. (M. 5408. b) in the Zentralmagazin Naturwis-

senschaftlicher Sammlungen of the Martin-Luther-Uni-

versitat Halle-Wittenberg, Deutschland [Natural Science

Collections, Martin Luther University Halle-Wittenberg,

Germany].

Diagnosis. By the character of the genus.

Description. The description of the species is contained

in that of the genus.

CONCLUSIONS

None of the presently known bird-infesting Amblycera

possesses on all pairs of legs tarsi ending in a single claw.

As far as known, only some menoponids (Dennyus Neu-

mann, 1906 sensu lato) living on swifts (Apodiformes)

have undergone a remarkable reduction in the plesiomor-

phic double-clawed character of the pretarsus. While in

23 species of the subgenus Col/lodennyus Ledger, 1970

only the tarsi of the first pair of legs have lost their two

claws (Clayton et al. 1996, Ledger 1970), in the subge-

nus Crenodennyus Ewing, 1930 on Dennyus elbli Price &

Clayton (probably only a provisional species in Cteno-

dennyus) all three pairs of legs are clawless (Price &

Clayton 1997). In the remaining 23 known Dennyus

species in the subgenera Ctenodennyus Ewing, 1930

(2 spp.), Dennyus (19 spp.), and Takamatsuia Uchida,

1926 (2 spp.) all pretarsi have remained double-clawed

(Ledger 1971, Price et al. 2003). That this phenomenon

should manifest itself in the menoponids, living on — of

all birds — the supremely aerial swifts, is absolutely re-

markable and deserves greater attention.

Compared with the delicate pair of claws on avian Am-

blycera, the apparently powerful single claw of Echino-

pon is also a distinct morphostructural peculiarity. Look-

ing at the Booptidae, which only occur in the Australian

Bonn zoological Bulletin 68 (1): 167-181

Region (apart from Heterodoxus spiniger), it is perhaps

possible that this adaptive variant arose, probably having

its origin in a change of host (from bird to mammal) in

the very distant past. There is perhaps a similar case in

the Trichophilopteridae (Ischnocera), only found on the

lemurs of Madagascar. While all other mammal-inhabit-

ing Ischnocera (Trichodectoidea, c. 400 species) possess

single-clawed pretarsi, the monotypic Trichophilopteri-

dae have retained two unequal claws. Yet no mammal-in-

festing amblycerans show femoral and/or abdominal

ctenidia. These setal combs are only found in various

Menoponidae sensu Jato genera, especially Colpocepha-

/um complex, but nowhere in such a markedly excessive

development as in Echinopon.

With Echinopon we are actually looking at a taxon

that does not allow us to make the simple decision as to

whether it is an avian or a mammalian amblyceran.

Acknowledgments. For permission to work in the avian study

skin collection of the Museum fiir Tierkunde, Senckenberg

Naturhistorische Sammlungen Dresden, I wish to extend my

warmest thanks to the curator Dr. Martin Packert. Prof. Dr. Rolf

Beutel (Phyletisches Museum Jena) made it possible for the

student Stephan Lowe to take his excellent photomicrographic

images. Brian Hillcoat (Berlin) translated the manuscript into

English. I am most grateful for the support of all those con-

cerned.

REFERENCES

Barker SC, Whiting MF, Johnson KP, Murell A (2003) Phy-

logeny of the lice (Insecta, Phthiraptera) inferred from small

subunit rRNA. Zoologica Scripta 32: 407-414

Clay T (1962a) A key to the species of Actornithophilus Ferris

with notes and descriptions of new species. Bulletin of the

British Museum (Natural History), Entomology 11: 191—253

Clay T (1962b) A new species of Anatoecus Cummings (Mal-

lophaga) from Phoenicopterus ruber Linn. Entomologische

Berichten 22: 220-226

Clay T (1969) A key to the genera of the Menoponidae (Am-

blycera: Mallophaga: Insecta). Bulletin of the British Muse-

um (Natural History), Entomology 24: 3-26 + plates 1-6

Clay T (1970) The Amblycera (Phthiraptera: Insecta). Bulletin

of the British Museum (Natural History), Entomology 25:

75-98 + plates 1-5

Clayton DH, Price RD, Page RDM (1996) Revision of Den-

nyus (Collodennyus) lice (Phthiraptera: Menoponidae) from

swiftlets, with descriptions of new taxa and a comparison

of host-parasite relationships. Systematic Entomology 21:

179-204

Eichler W (1959) Die Larvenstadien der Mallophagen. I. Eu-

laemobothrion cubense (Kellogg & Ferris). Wissenschaftli-

che Zeitschrift der Martin-Luther-Universitat Halle-Witten-

berg, Mathematisch-Naturwissenschaftliche Reihe 8 (4/5):

543-548

Eichler W (1963) Mallophaga. Dr. Bronns Klassen und Ord-

nungen des Tierreichs, Funfter Band. Arthropoda, III. Abtei-

lung: Insecta, 7. Buch b) Phthiraptera, 1. Teil. 291 pp. Aka-

demische Verlagsgesellschaft Geest & Portig K.-G., Leipzig

©ZFMK

Parasitic on bird or mammal? Echinopon monounguiculatum fam., gen. & spec. nov. in the Amblycera, Phthiraptera 181

Emerson KC (1982) Mallophaga. Pp. 409-415 in: Parker, S. P.

(ed) Synopsis and Classification of living Organisms. Mc-

Graw-Hill Book Company, Inc., New York

Emerson KC, Price RD (1976) Abrocomophagidae (Mallopha-

ga: Amblycera), a new family from Chile. The Florida Ento-

mologist 59: 425-428

Friedemann K, Spangenberg S, Yoshizawa K, Beutel RG

(2013) Evolution of attachment structures in the highly di-

verse Acercaria (Hexapoda). Cladistics 30: 170-201

Gustafsson, DR, Bush, SE (2017) Morphological revision of

the hyperdiverse Brueelia-complex (Insecta: Phthiraptera:

Ischnocera: Philopteridae) with new taxa, checklists and ge-

neric key. Zootaxa 4313 (1): 1-443

Haub, F. (1972) Das Cibarialsklerit der Mallophaga-Amblyc-

era und der Mallophaga-Ischnocera (Kellogg) (Insecta).

Zeitschrift fur Morphologie der Tiere 73: 249-261

Johnston KP, Yoshizawa K, Smith VS (2004) Multiple origins

of parasitism in lice. Proceedings of the Royal Society of

London, Series B, 271: 1771-1776

Johnson KP, Dietrich HC, Friedrich F, Beutel RG, Wipfler, B,

Peters RS, Allen JM, Petersen M, Donath A, Walden KKO,

Kozlov AM, Podsiadlowski L, Mayer C, Meusemann K,

Vasilikopoulos A, Waterhouse RM, Cameron SL, Weirauch

C, Swanson DR, Percy DM, Hardy NB, Terry I, Liu S, Zhou

X, Misof B, Robertson HM, Yoshizawa K (2018) Phyloge-

nomics and the evolution of hemipteroid insects. Proceed-

ings of the National Academy of Sciences 115: 12775-12780

Kéler Sv (1952) Uber den feineren Bau der Tarsen bei Pseu-

domenopon rowanae Kéler. Beitrage zur Entomologie 2:

573-582

Kéler Sv (1955) Einige Bemerkungen tber den Bau der Tars-

en von Gyropus und Gliricola. Beitrage zur Entomologie 5:

293-308

Kéler, Sv (1957) Uber die Deszendenz und die Differenzierung

der Mallophagen. Zeitschrift fiir Parasitenkunde 18: 55-160

Kéler, Sv (1969) 17. Ordnung Mallophaga (Federlinge und

Haarlinge). Handbuch der Zoologie I'V., 2. Halfte, 2. Auflage,

2. Teil, 17: 72 pp. Walter de Gruyter & Co. Berlin

Lakshminararayana KV (1976): Nomenclatural changes in

Phthiraptera — some suggestions. Angewandte Parasitologie

17: 160-167

Ledger JA (1970) A preliminary review of Dennyus (Mallopha-

ga: Menoponidae) parasitic on swiftlets. Journal of the Ento-

mological Society of South Africa 33: 239-260

Ledger JA (1971) A review of Dennyus (Phthiraptera: Meno-

ponidae) parasitic on the avian genera Apus and Crypsiurus.

Journal of the Entomological Society of South Africa 34:

37-56

Lyal CHC (1987) Phylogeny and classification of the Psocodea,

with particular reference to the lice (Psocodea: Phthiraptera).

Systematic Entomology 10: 145-165

Marshall IK (2003) A morphological phylogeny for four fami-

lies of amblyceran lice (Phthiraptera: Amblycera: Menoponi-

dae, Boopiidae, Laemobothriidae, Ricinidae). Zoological

Journal of the Linnean Society 138: 39-82

Mayer C (1954) Vergleichende Untersuchungen am Skel-

ett-Muskelsystem des Thorax der Mallophagen unter Bertick-

Bonn zoological Bulletin 68 (1): 167-181

sichtigung des Nervensystems. Zoologische Jahrbticher,

Abteilung ftir Anatomie und Ontogenie der Tiere 74: 77-131

Mey E (2003) Tierlause (Phthiraptera). Pp. 308-330, 880-881

in: Kaestner A, Gruner HE (Hrsg.), Lehrbuch der Speziellen

Zoologie. Band I: Wirbellose Tiere, 5. Teil: Insecta (Hrsg.

HH Datue). 2. Auflage. Spektrum Akademischer Verlag,

Heidelberg/Berlin

Mey E (2017) [2016] Neue Gattungen und Arten aus dem

Brueelia-Komplex (Insecta, Phthiraptera, Ischnocera,

Philopteridae s. 1.). Rudolstadter naturhistorische Schriften

22: 85-215

Mey E, Eichler W, Kaddou IK (2004) Jadwigiella enigmati-

ca nov. gen. et spec. (Insecta, Phthiraptera, Amblycera,

Menoponidae s. |.) von der Guineataube Columba guin-

ea (Aves, Columbiformes). Rudolstadter naturhistorische

Schriften 12: 133-140

Modrzejewska M, Ztotorzycka J (1987) Studies on morphology

of nymphs of selected Amblycera and Ischnocera (Mallopha-

ga). Polskie Pismo Entomologiczne 57: 657-672

Morris PA (2012): Edward Gerrard & Sons A Taxidermy Mem-

oir. Lavenham Press, Lavenham, Suffolk.

Murrell A, Barker SC (2005) Multiple origins of parasitism in

lice: phylogenetic analysis of SSU rDNA indicates that the

Phthiraptera and Psocoptera are not monophyletic. Parasito-

logical Research 97: 274—280

Neuffer G (1954) Die Mallophagenhaut und ihre Differen-

zierungen. Zoologische Jahrbticher, Abteilung fiir Anatomie

und Ontogenie der Tiere 73 (4): 425-616

Price RD (1987): Order Mallophaga. Pp. 215-223 in Stehr,

FW (ed.): Immature Insects. Kendall/Hunt Pub. Company,

Dubuque, Iowa.

Price RD, Clayton DH (1997) Two new species of Denny-

us (Ctenodennyus) lice (Phthiraptera: Menoponidae) from

Swiftlets (Apodiformes: Apodidae). Journal of the Kansas

Entomological Society 70: 4-10

Price RD, Hellenthal RA, Palma RL (2003) World checklist of

chewing lice with host associations and keys to families and

genera. Pp. 1-448 in: Price RD, Hellenthal RA, Palma RL,

Johnson KP, Clayton DH (eds.): The chewing lice: world

checklist and biological overview. Illinois Natural History

Survey Special Publication 24, X + 501 pp.

Price RD, Timm RM (2000) Review of the chewing louse genus

Abrocomophaga (Phthiraptera: Amblycera), with description

of two new species. Proceedings of the Biological Society of

Washington 113 (1): 210-217

Ruggiero MA, Gordon DP, Orrell TM, Bailly N, Bourgoin T,

Brusca RC, Cavalier-Smith T, Guiry MD, Kirk PM (2015)

Correction: A higher level classification of all living organ-

isms. PLoS ONE 10(6): e0130114. https://doi.org/10.1371/

journal.pone.0119248.

Uchida S (1926) Studies on amblycerous Mallophaga of Japan.

Journal of the College of Agriculture Tokyo 9: 1-56

Yoshizawa K, Johnston KP (2006) Morphology of male genita-

lia in lice and their relatives and phylogenetic implications.

Systematic Entomology 31: 350-361