FORSCHUNGS

Bonn zoological Bulletin 70 (1): 1-14

2021 - Ghiraldi L. et al.

https://do1.org/10.20363/BZB-2021.70.1.001

Research article

urn:|sid:zoobank.org:pub:67213318-C4D5-4D11-AOF4-AEF7B416CA39

Revised catalogue of monotremes and marsupials

in the historic mammal collection housed at

Museo Regionale di Scienze Naturali of Torino, Italy

Luca Ghiraldi'*, Ana Paula Carmignotto’, Vera Tosetto*®, Sandy Ingleby‘ & Mark D.B. Eldridge*

' Museo Regionale di Scienze Naturali di Torino, Via Giolitti 36, I-10123 Torino, Italy

?Laboratorio de Diversidade Animal, Departemento de Biologia Universidade Federal de SGo Carlos (UF SCar), Campus Soro-

caba, Sorocaba, Brazil

3 Universita degli Studi di Torino, Dipartimento di Scienze della Vita e Biologia dei Sistemi, Via Accademia Albertina 13, I-10123

Torino, Italy

*° Australian Museum Research Institute, Australian Museum, I William Street, Sydney, NSW 2010, Australia

“Corresponding author: Email: luca.ghiraldi@regione.piemonte.it

'urn:Isid:zoobank.org:author:3556E7BD-C957-4E5E-8CFA-9DA069E34487

2urn:Isid:zoobank.org:author: BE376A 1 8-C4E4-4CE8-9F47-1796A 8E36A4C

3urn:lsid:zoobank.org:author:285 17B1B-EBB2-4470-8A52-EF3B43A43C91

*urn:Isid:zoobank.org:author: FED6DBA2-B36A-4855-B16B-7276EA33FAE6

>urn:Isid:zoobank.org:author:C42A D8C3-67FB-436E-B191-5BB236287ADF

Abstract. The historic collection of the Museo di Zoologia and of the Museo di Anatomia Comparata of Torino University

(Italy), now hosted at Museo Regionale di Scienze Naturali of Torino, contains almost 3000 mammal specimens, in addi-

tion to 200 almost complete skeletons and an undefined number of skeletal units. The present work, which is part of a larg-

er project whose aim is to make a complete revision of the specimens still present in the historic collection, was focused

on the 135 specimens of monotremes and marsupials, mainly represented by mounted skins, flat skins, and osteological

material composed of 12 skeletons and 32 skulls. The study allowed in addition to the implementation of a new revised

catalogue, the update of the taxonomic nomenclature and a new determination of 32 specimens and 18 skeletal units.

Overall, the monotremes and marsupials in the collection represent 58 species, with some of high scientific value; this is

the case of some extinct species such as: Thylacine (Thylacinus cynocephalus Harris, 1808), Eastern Hare-Wallaby (La-

gorchestes leporides (Gould, 1841)) and the Crescent Nailtail Wallaby (Onycogalea Iunata (Gould, 1841)). Unfortunately,

it was not possible to reach the species level with certainty for 28 specimens due to their bad state of preservation, the loss

of the original labels, the lack of detailed collecting data or because of the juvenile or immature stage of development.

ISSN 2190-7307

http://www.zoologicalbulletin.de

Key words. Ameridelphia, Australidelphia, Monotremata, Natural History Collections, Biodiversity.

INTRODUCTION

Natural history museums and their biological collections

play a fundamental role in disseminating knowledge and

understanding of the earth’s biodiversity (Grande 2017;

Kemp 2017). The wealth of specimens preserved in these

collections have always had an important educational

role, providing data concerning the biology, ecology and

conservation of species, but also serve as major sources

of biological data for scientists. As such they represent

records of inestimable value, providing multidimension-

al documentation in geographic and biodiversity space,

and position in time (Winker 2004). They are invaluable

resources to scientific studies, permitting comparative

analyses in terms of phenotypic change, abundance and/

or distribution. It is therefore of the utmost importance to

publish inventories with all related information in order

Received: 18.05.2020

Accepted: 16.11.2020

to make the scientific community aware of the existence

of such biological heritage.

The present study, which is part of a larger project,

whose final purpose 1s to make a revised catalogue of all

the specimens preserved in the MRSN (Museo Regio-

nale di Scienze Naturali) of Torino (NW Italy), includ-

ing those coming from the historic mammal collections

of the MZUT (Museo di Zoologia dell’ Universita di To-

rino) and the MACUT (Museo di Anatomia Comparata

dell’ Universita di Torino). This was necessary for three

important reasons:

1) Reduced interest in the museum specimens has

meant zoological studies involving taxonomic analysis of

the voucher materials preserved in the collections are no

longer undertaken.

2) Unlike other groups, the MZUT and MACUT mam-

mal collections lacked specialized curatorial staff and

Corresponding editor: E. Barmann

Published: 28.01.2021

2 Luca Ghiraldi et al.

consequently part of the collection has not yet been stud-

ied and the taxonomic status of such material is, as al-

ready pointed out by Tadini (1937), in many cases still

indeterminated.

3) The numerous relocations to which the collection

has been subjected over time, and the problems connect-

ed with its preservation, have contributed to the loss and

the deterioration of many specimens (Tortonese 1957)

and to the loss of original data from several specimens,

which currently have incomplete or no associated infor-

mation regarding their provenance.

The present work, which aims to overcome these is-

sues is the third contribution after those published by

Passeirin d’Entreves & Gavetti (2014) on the cetaceans

and by Calvini et al. (2016) on the primates.

The monotremes and marsupials in the mammal his-

toric collection

The MZUT mammal collection includes about 3,000

specimens, most of which are mounts; several hundred

are preserved as flat skins, whereas most of the small

mammals, in particular bats and small rodents, are kept in

ethanol. In addition, in the MACUT osteological collec-

tion there are approximately 200 almost complete skele-

tons, to which an undefined number of skulls and individ-

ual skeletal units from a large number of heterogeneous

species can be added. Among them, the specimens of

monotremes and marsupials represent only a minor part,

but they are also the ones that have been never investi-

gated with the exception of a single report in the work of

Thomas (1898). These specimens arrived in the muse-

um mainly between 1819 and 1899 and are the results of

the contributions of several scientific expeditions. This

includes the material collected and purchased in Brazil

by Antonio Caffer, assistant at the zoology section of the

Royal zoological museum of Torino, engaged as member

of the scientific staff during the voyage of the “Fregata

Regina” (1839-1840); by Enrico Giglioli from the mu-

seums of Melbourne and Sydney (Australia) during the

three year (1865-1868) voyage around the Globe of the

Italian warship “Pirocorvetta Magenta” (Hyller Giglioli

1876); by Enrico Festa during his four year expedition

(1895-1898) in Panama and Ecuador; and by Alfredo

Borelli who travelled in Argentina, Paraguay, Brazil and

Bolivia between 1893-1896.

The number of specimens was also enhanced with the

contribution of the Royal Zoological Gardens of Torino

and Stupinigi (Corti 1955; Maschetti et al. 1988), and

due to acquisitions from other collectors not directly re-

lated to the Torino Museum, as well as from different Eu-

ropean animal dealers. In many cases during the prepara-

tion of the skins, the skeletons, or part of them, were also

preserved in order to increase the osteological collection

which was mostly used for scientific purposes.

Bonn zoological Bulletin 70 (1): 1-14

MATERIAL AND METHODS

The first phase of the work was to find as much infor-

mation as possible associated with each specimen. Three

major archival sources were used: two old manuscript

catalogues of the mammals (MZUT) and osteological

(MACUT) collections and a degree thesis realized by Ta-

dini in 1937, which reports all the specimens preserved

at that time.

The second step was to carry out a complete revision

and taxonomic update for all the specimens of mono-

tremes and marsupials still present in the collections.

As there continues to be some disagreement about the

classification of marsupials, it was decided for the Aus-

tralasian species to follow the nomenclature of the Hand-

book of the Mammals of the World (Wilson & Mitter-

meier 2015); whereas for the South American opossum

species we followed the nomenclature, taxonomy and

geographic distribution used in the general works of

Gardner (2008), Voss & Jansa (2009), and Astuia (2015),

as well as more recent work for specific genera such as

Giarla et al. (2010) for Thylamys Gray, 1843; Rossi et al.

(2010) and Voss et al. (2014) for Marmosa Gray, 1821;

Voss et al. (2018) for Philander Brisson, 1762; and Voss

et al. (2019) for Metachirus Burmeister, 1854. The popu-

lar names and threat categories follow IUCN (2020).-For

species recently described or revalidated, no IUCN cate-

gory was provided, since these taxa were not yet evaluat-

ed under IUCN criteria.

Along with this second step, skins and skulls were

photographed in high resolution in order to be examined,

whereas for the Ameridelphia osteological materials the

skulls measurement (Fig. 1, Table 1) have also been tak-

en to aid in the taxonomic identification following the

methodology of Cerqueira & Lemos (2000). In addition,

the skulls were also classified in age classes based on

the criteria of tooth eruption of Rossi et al. (2010), being

treated as juveniles (age classes 1 to 4) when the per-

manent dentition are not fully erupted, as subadults (age

class 5) when the third non-deciduous premolars are not

fully erupted, and as adults (age class 6) when all perma-

nent tooth are fully erupted and in place.

The third step was the creation of a catalogue, which

largely follows the structure proposed by Calvini et al.

(2016) where all the specimens have a unique identifica-

tion code that replaces all the previous ones (which are

reported, if present, in parentheses). It begins with the ac-

ronym MZUT followed by the letter T (theriology) and a

progressive number. If for a given specimen the skeleton,

or part of it, can be recognized, it will have the same code

as the specimen. Separated by semicolons are the method

of preservation: mount, unmount (previously mounted),

skin, ethanol; sex and age (if available); origin, date of

the arrival in museum, the name of the person who be-

stowed the specimens in museum and lastly (if neces-

sary) some additional notes reported in the manuscript

©ZFMK

Revised catalogue of monotremes and marsupials housed at MRSN, Italy

Fig. 1. Seven cranio-dental measurements taken on Didelphimorphia marsupial skulls based on the work of Cerqueira & Lemos

(2000).

Table 1. Cranio-dental measurements (mm) of sub-adult (sub) and adult (ad) specimens of Didelphimorphia marsupials housed in

the historic mammal collection of the Torino University.

Species MZUT Age Sex GLS ZB PL MAX C CAN MAD

Caluromys derbianus T417 ad female 594 33.2 32.8 213 86 114 447

Caluromys derbianus T422 ad female 574 32.7 33.7 214 7.1 11.9 43.0

Caluromys derbianus T424 ad female 56.2 32.5 33.0 214 60 11.7 41.7

Chironectes minimus T428 = ad _ LO7 OZ 2a O21 416 169 21.8 865

Didelphis albiventris T433 sub - 178 396, 50,0 SAF se 129 8623

Didelphis aurita T435 ad - 90.0 45.3 56.4 37.8 11.8 161 69.4

Didelphis marsupialis T439 ad female 942 51.8 67.1 445 10.7 183 866

Didelphis marsupialis T440 = ad — 1205 -60°5 “67.9 A3.6 T%9 22.0° ~929

Didelphis pernigra T442 sub - 84.5 40.3 53.3 340 88 140 68.0

Lutreolina crassicaudata 1446 ad - 76.0 42.7 41.4 294 88 145 60.0

Philander melanurus T449 ad male 86.7 34.6 40.1 28 tid) WB 534)

Didelphis sp. T459 ad - 107.5 50.7 642 41.8 179 220 84.0

Didelphis sp. T460 = ad - 101.1 50.0 62.1 400 99 180 79.9

Didelphis sp. T461 ad male 1044 —- 63.0 404 15.0 15.0 840

Didelphis sp. T462 = ad - 96.8 479 599 414 11.7 160 783

Didelphis sp. T463 sub - 9233 4G. 53:2" 36:2 TO “1Si/e FAO

Didelphis sp. T464 ad male 1025 553 622 £41.11 128 179 844

Bonn zoological Bulletin 70 (1): 1-14

©ZFMK

4 Luca Ghiraldi et al.

catalogues or other explicative notes. If the specimens

have no reference the acronym w.d. (without data) was

used. On the same row where there is the name of the

species, the IUCN category has been reported.

Institutional abbreviations

International Union for Conservation of

Nature

MZUT = Museo di Zoologia dell’ Universita di

Torino, Italy

Museo di Anatomia Comparata

dell’ Universita di Torino, Italy

IUCN

MACUT

Abbreviations of threat categories (IUCN 2020)

LC = least concern

NT = near threatened

VU = vulnerable

EN = endangered

CR = critically endangered

EX = extinct

Abbreviations for morphological terms used in the

text and the figures

CAN = distance between canines

C = canine heigth

GLS = greatest length of the skull

MAD = mandibular length

MAX = maximun Length of tooth row

PL = palatal length

ZB = zygomatic breadth

RESULTS AND DISCUSSION

Overall, the historic catalogue of mammals reported

120 marsupial and eight monotreme specimens, whereas

Tadini (1937) recorded 126 marsupials, without includ-

ing 14 specimens collected by Enrico Festa, and eight

monotreme specimens. In contrast, our inventory re-

corded a total of 135 specimens. These comprise eight

monotremes and 127 specimens of marsupials, of which

37 (15 mounted, 21 flat skins, one in ethanol) are from

South America, one from North America (mounted),

one from Timor (mounted) and two from Celebes (now

known as Sulawesi) (mounted), while the remaining 87

(78 mounted, four skins, five in ethanol) are from Austra-

lia and nearby islands.

As regards the osteological materials the old catalogue

reported 15 complete skeletons (one without skull) and

36 skulls. Our inventory documents 12 (two monotems;

two Ameridelphia) complete or partial skeletons and 32

(28 Ameridelphia) skulls, almost all undetermined.

Bonn zoological Bulletin 70 (1): 1-14

This work has resulted in an update of the taxonomic

nomenclature and a new determination of 32 specimens

and 18 skeletal units. Overall, the monotremes and mar-

supials in the collection represent 58 taxa, with some of

them of high scientific value because they are now ex-

tinct, such as: Thylacine Thylacinus cynocephalus Har-

ris, 1808 (Fig. 3), Crescent Nailtail Wallaby Onychoga-

lea lunata (Gould, 1841) (Fig. 6), Eastern Hare-wallaby

Lagorchestes leporides Gould, 1841 (Fig. 5) or very rare

such as the Western Long-Beaked Echidna Zaglossus

bruijnii (Peters & Doria, 1876) (Fig. 2) and the Woylie

Bettongia penicillata Gray, 1837 (Fig. 4).

Unfortunately, it was not possible to identify 28 speci-

mens to species level with certainty because of the fading

of their original colours or their bad state of conservation.

Moreover, some specimens are young or not completely

mature, and a definite determination could not be made

without observing the complete dentition and well-devel-

oped cranial structures or the use of biomolecular tech-

niques. Furthermore, some skulls also lack the prove-

nance, which is very important for some morphologically

similar species under genera such as Didelphis.

COMMENTED CATALOGUE

Order MONOTREMATA Bonaparte, 1837

Family TACHYGLOSSIDAE Gill, 1872

Genus Zaglossus Gill, 1877

WESTERN LONG-BEAKED ECHIDNA Zaglossus

bruijnii (Peters & Doria, 1876) (CR)

MZUT T405 (1010); mount; unsexed ad.; Torres Strait,

Australia; 1866; Voyage of the Pirocorvetta “Magen-

ta”, donation by Mr. Teijsman.

Remarks: The specimen was obtained during the cir-

cumnavigation voyage by the Italian Warship Magenta.

On 2 May 1866, Enrico H. Giglioli and Filippo Defilippi

visited the Botanical Garden of Bogor (Java, Indonesia),

where its Director Johannes Elias Teijsmann (1808-

1882) gave them some specimens of “rare animals” (Gi-

glioli 1876).

Genus Tachyglossus Illiger, 1811

SHORT-BEAKED ECHIDNA Tachyglossus aculeatus

(Shaw, 1792) (LC)

MZUT T406 (897); mount; unsexed ad.; Tasmania, Aus-

tralia; 1/1861; exchange with Ercole Turati from Mi-

lano;

MZUT T407 (540); mount; unsexed; Tasmania, Austra-

lia;

MZUT T408 (MACUT 326); skeleton; w.d.

Remarks. Count Ercole Turati (1829-1881) was a

banker and a passionate naturalist based in Milano (lIt-

aly). He purchased and exchanged many natural history

©ZFMK

Revised catalogue of monotremes and marsupials housed at MRSN, Italy 5

Fig. 2. MZUT T405 specimen of Western Long-Beaked Echidna Zaglossus bruijnii.

specimens and built up a very large private collection, in

particular of birds (more than 20,000 specimens) which,

after his death, were donated to the Natural History Mu-

seum of Milano. Unfortunately, after the bombing in

1943, the collection was almost completely destroyed.

Family ORNITHORHYNCHIDAE Gray, 1825

Genus Ornithorhynchus Blumenbach, 1800

PLATYPUS Ornithorhynchus anatinus (Shaw, 1799)

(NT)

MZUT T409 (541); mount; male ad.; river near Port

Jackson, New South Wales, Australia; 1819; donation

by Mr. Mackay;

MZUT T410 (1335); mount; unsexed ad.; no locality;

1/1892; donation by Mr. Giglio Giuseppe;

MZUT T411 (1562); mount; male ad.; no locality; 1899;

donation by Carlo Bajnotti;

MZUT T412 (1858); mount; unsexed; no locality; 1905;

donation by Mr. Chiotti;

MZUT T413 (2756); mount; unsexed ad.; Melbourne,

Victoria, Australia; 1927; donation by Count Teofilo

Rossi of Montelera;

MZUT T414 (MACUT 325); skeleton; w.d.

Remarks: James Townsend Mackay was the curator of

the botanical garden of the Trinity College (Dublin, Ire-

land) and associate of Linnean Society of London.

The MZUT catalogue reports for the specimen MZUT

T409 the following note “the specimen through its spur

Bonn zoological Bulletin 70 (1): 1-14

caused the loss of a soldier’s arm who wanted to take

him alive”.

Carlo Bajnotti (1868-1942) was a passionate traveller

and naturalist who worked as taxidermist for the Royal

Zoological Museum of Torino (Simondetti 1943).

Mr. Chiotti was ship’s purser of the warship “Liguria”,

captained by His Majesty Luigi Amedeo di Savoia, Duke

of the Abruzzi during his journey around the globe in the

years 1902-1904.

Teofilo Rossi di Montalera (1865-1927) was an entre-

preneur, a politician of the Kingdom of Italy and office of

Mayor of the City of Torino up to 1917.

Order DIDELPHIMORPHIA Gill, 1872

Family DIDELPHIDAE Gray, 1821

Genus Caluromys J.A. Allen, 1900

CENTRAL AMERICAN WOOLLY OPOSSUM Cal-

uromys derbianus (Waterhouse, 1841) (LC)

MZUT T415; skin; unsexed ad.; Vinces, Ecuador,

[X/1897; Festa expedition; (voucher number 89);

MZUT T415 (MACUT 4683); partial skull;

MZUT T416; skin; female ad.; Vinces, Ecuador, [X/1897;

Festa expedition (voucher number 123);

MZUT T416 (MACUT 4736); partial skull;

MZUT 1417; skin; female ad.; Vinces, Ecuador, [X/1897;

Festa expedition (voucher number 125);

MZUT T417 (MACUT 4680); skull:

©ZFMK

6 Luca Ghiraldi et al.

MZUT 1418; skin; unsexed juv.; Vinces, Ecuador,

[X/1897 Festa expedition (voucher number 1251);

MZUT 1T419; skin; unsexed juv.; Vinces, Ecuador,

IX/1897,; Festa expedition (voucher number 1283);

MZUT 1T420; skin; unsexed juv.; Vinces, Ecuador,

IX/1897 Festa expedition (voucher number 1284);

MZUT 1T421; skin; unsexed juv.; Vinces, Ecuador,

[X/1897 Festa expedition (voucher number 1292);

MZUT T4272; skin; female ad.; Vinces, Ecuador, LX/1897;

Festa expedition (voucher number 90):

MZUT T422 (MACUT 4677); skull;

MZUT T423; skin; female ad.; Vinces, Ecuador, LX/1897

Festa expedition (voucher number 121);

MZUT T423 (MACUT 4675); skull;

MZUT 424; skin; female ad.; Vinces, Ecuador, LX/1897;

Festa expedition (voucher number 122);

MZUT T424 (MACUT 4681); skull.

Remarks: All the skins and skulls were undetermined,

and only the skulls were reported in the MACUT cata-

logue.

Genus Marmosa Gray, 1821

ISTHMIAN MOUSE OPOSSUM Marmosa isthmica

Goldman, 1912 (Not Evaluated)

MZUT 7T425, skin; unsexed ad.; Vinces, Ecuador,

IX/1897; Festa expedition (voucher number 114).

Remarks: The specimen was undetermined and not re-

ported in the MZUT catalogue.

LINNAEUS’S MOUSE OPOSSUM Marmosa murina

(Linnaeus, 1758) (LC)

MZUT T426 (693); mount; male ad.; Suriname; 1845;

purchased by G.A. Frank.

Remarks: Gustav Adolph Frank was a natural history

dealer based in Amsterdam.

Genus Metachirus Burmeister, 1854

BROWN FOUR-EYED OPOSSUM WMetachirus myo-

suros (Temminck, 1824) (Not Evaluated)

MZUT T427 (347); mount; unsexed ad.; Rio de Janeiro

(Brazil); 1839; Antonio Caffer expedition.

Genus Chironectes I\liger, 1811

WATER OPOSSUM Chironectes minimus (Zimmer-

mann, 1780) (LC)

MZUT T428 (MACUT 7718); skull; unsexed ad.; Brazil:

24/TX/1914; donation by Alfonso Bovero.

Remarks. Professor Alfonso Bovero (1872-1937) was

an Italian medical doctor. In 1912 he moved to Brazil

where he got the chair of anatomy and histology at the

Faculty of Medicine and Surgery of Sao Paulo Universi-

ty. He was also the founder of the Anatomy museum of

the Sao Paulo University.

Bonn zoological Bulletin 70 (1): 1-14

Genus Didelphis Linnaeus, 1758

WHITE-EARED OPOSSUM) Didelphis albiventris

Lund, 1840 (LC)

MZUT T429 (1386); mount; unsexed ad.; Luque, Para-

guay, VIII/1893; Borelli expedition;

MZUT T429 (MACUT 3731); partial skull;

MZUT T430 (1387); mount; unsexed ad.; Luque, Para-

guay, 1893; Borelli expedition;

MZUT T430 (MACUT 3508); partial skull;

MZUT T431 (1899); ethanol; unsexed juv.; Corrientes,

Argentina; 1893; Borelli expedition;

MZUT 7T432 (2769); mount; unsexed juv.; Argentina,

1928; donation by Principe di Piemonte;

MZUT T433 (MACUT 10035); skull; unsexed subad.;

Brazil; 05/V/1921; donation by Alfonso Bovero.

Remarks: The specimens MZUT T431 and MZUT

T433 were undetermined, MZUT T433 1s not reported in

the MACUT catalogue.

BRAZILIAN COMMON OPOSSUM Didelphis aurita

Wied-Neuwied, 1826 (LC)

MZUT 1T434 (338); mount; unsexed ad.; near Rio de Ja-

neiro (Brazil); 1839; Antonio Caffer expedition;

MZUT T434 (MACUT 338); skeleton;

MZUT T435 (MACUT 7736); skull; unsexed ad.; Bra-

sil; 15/V/1919; donation by Alfonso Bovero.

Remarks: In the MZUT catalogue the specimen MZUT

T434 was reported as Didelphis albiventris, but since it

presents dark face and ears, 1t was redetermined as D. au-

rita. The MZUT T435 was undetermined. See also the

skull measurements in Table 1.

BLACK-EARED OPOSSUM Didelphis marsupialis

Linnaeus, 1758 (LC)

MZUT 1T436 (694); mount; unsexed juv.; Suriname;

1845; purchased by G.A. Frank:

MZUT 1437; skin; unsexed ad.; Vinces, Ecuador;

TX/1897; Festa expedition (voucher number 93);

MZUT T1438; skin; female ad.; Vinces, Ecuador;

IX/1897; Festa expedition (voucher number 109);

MZUT T438(MACUT 4666); skull;

MZUT T439 (1425); mount; unsexed ad.; Punta de Sa-

bana, Darien, Panama; 1895; Festa expedition;

MZUT T439 (MACUT 3777); skull;

MZUT T440 (MACUT 3628); skull; female ad.; Darien

(Ecuador); 1896 Festa expedition;

MZUT T441 (MACUT 7733); skull; unsexed ad.; Brazil:

no date; donation by Alfonso Bovero.

Remarks: The specimen MZUT T436 was identified

as Marmosa murina, but tt was redetermined as Didel-

phis marsupialis due to its dorsal dark pelage, with long

white guard hairs, extending well beyond the base of the

tail, which is large and bicolored in the distal portion.

The dark face and black ears also points to this species.

The specimens MZUT T437 and 438 was undetermined

©ZFMK

Revised catalogue of monotremes and marsupials housed at MRSN, Italy 7

and not reported in the MZUT catalogue. The specimen

MZUT T439 was undetermined.

The specimen MZUT T440 was identified as Chi-

ronectes minimus, but the morphological qualitative and

quantitative characters of the skull lead to redetermina-

tion as D. marsupialis (see Cerqueira & Lemos 2000;

Voss & Jansa 2009). See also the skull measurements in

Table 1. The skull MZUT T440 was undetermined.

ANDEAN WHITE-EARED OPOSSUM Didelphis

pernigra J.A. Allen, 1900 (LC)

MZUT 1442; skin; unsexed ad.; Ibarra, Ecuador,

XII/1896; Festa expedition (voucher number 67);

MZUT T442 (MACUT 4678); partial skull;

MZUT T443; skin; unsexed subad.; Quito, Ecuador,

XII/1896; Festa expedition (voucher number 69);

MZUT T443 (MACUT 4667); skull.

Remarks: All the skins were undetermined and not re-

ported in the MZUT catalogue. The skulls MZUT T442

and 443 were undetermined.

VIRGINIA OPOSSUM Didelphis virginiana Kerr,

1792 (LC)

MZUT T444 (331); mount; unsexed ad.; North America;

1823; donation by Gaspeare Deabbate:

MZUT T445 (MACUT 321); skeleton; w.d.;

MZUT T446 (MACUT 337); skull; juv.; w.d.

Remarks: Gaspeare Deabbate was the General Consul

of the Sardinian Kingdom in Philadelphia (Pennsylvania,

USA).

Genus Lutreolina Thomas, 1910

LITTLE WATER OPOSSUM Lutreolina crassicauda-

ta (Desmarest, 1804) (LC)

MZUT T447 (MACUT 4539): skull; unsexed ad.; w.d.;

MZUT T448 (MACUT 3472); skull; unsexed ad.; no lo-

cality; 1896; collected by Crivelli.

Remarks: MZUT T447 was undetermined; MZUT

T448 was labelled as Didelphis sp., but the morpholog-

ical qualitative and quantitative characters of the skull

lead to redetermination as Lutreolina crassicaudata (see

Voss & Jansa 2009). See also the skull measurements in

Table 1.

We didn’t find any information about Mr. Crivelli.

Genus Philander Brisson, 1762

BLACK FOUR-EYED OPOSSUM = Philander

melanurus (Thomas, 1899) (Not Evaluated)

MZUT 1T449; skin; unsexed ad.; Vinces, Ecuador;

IX/1897; Festa expedition (voucher number 110);

MZUT T450; skin; male ad.; Vinces, Ecuador; [X/1897;

Festa expedition (voucher number 116);

MZUT T450 (MACUT 4676); skull.

Remarks: The specimens MZUT T449 and 450 were

undetermined and are not reported in the MZUT cata-

logue. The skull MZUT T450 was undetermined.

Bonn zoological Bulletin 70 (1): 1-14

GRAY FOUR-EYED OPOSSUM Philander opossum

(Linnaeus, 1758) (LC)

MZUT T451 (341); mount; female ad.; Cayenne (French

Guyana); 10/.V/1899; donation by Mr. Bacle;

MZUT T452 (342); mount; male ad.; Cayenne (French

Guyana); 10/[V/1899; donation by Mr. Bacle;

Remarks: We didn’t find any information about Mr.

Bacle.

SOUTHEASTERN FOUR-EYED OPOSSUM Phi-

lander quica (Temminck, 1824) (LC)

MZUT T453 (335); mount; unsexed ad.; Rio de Janeiro,

Brazil; 1839; Caffer expedition;

MZUT T454 (336); mount; unsexed ad.; Rio de Janeiro,

Brazil; 1839; Caffer expedition.

Genus Thylamys Gray, 1843

ELEGANT FAT-TAILED MOUSE OPOSSUM Thyi-

amys elegans (Waterhouse, 1839) (LC)

MZUT 1T455 (735); skin; unsexed ad.; Valparaiso, Chile:

1845; purchased by G.A. Frank:

MZUT T456 (840); skin; unsexed ad.; Chile; 1849; Pi-

collet d’ Hermillon;

MZUT 1T457 (2935); skin; male ad.; Quilpué, Chile; no

date; donation by Enrico Festa (the specimen was orig-

inally part of Francisco Videla collection).

Remarks: Auguste Picollet d’Hermillon was the Gen-

eral Consul of Kingdom of Sardinia in Valparaiso, Chile.

UNDETERMINED SPECIMENS

Didelphis sp.

MZUT T458 (2643); partial skin; unsexed; Villa Corti-

na?: I/1891;

MZUT T459 (MACUT 7734); skull; unsexed ad.; Brazil;

no date; donation by Alfonso Bovero;

MZUT T460 (MACUT 7735); skull; unsexed ad.; Brazil;

no date; donation by Alfonso Bovero;

MZUT T461 (MACUT 10036); skull; male ad.; Brazil;

25/X/1921; donation by Alfonso Bovero;

MZUT T462 (MACUT 10037); skull; unsexed ad.; Bra-

zil; 1921; donation by Alfonso Bovero;

MZUT T463 (MACUT 10038); skull; unsexed subad.;

Brazil; 1V/1918; donation by Alfonso Bovero;

MZUT T464 (MACUT 10039); skull; male ad.; Brazil:

28/TX/1921; collected by Dr. Y. Karimi;

MZUT T465 (MACUT 10040); skull; unsexed juv.; Bra-

zil; 04/X1/1924.

Remarks: The specimen MZUT T 458 is from the ge-

nus Didelphis, and since it presents dark face and black

ears, it could be identified as D. aurita, if it proves to

come from Atlantic Forest of Brazil or D. marsupialis if

it came from Amazonian Forests.

The specimens from MZUT T459 to MZUT T465

present skulls from the genus Didelphis and by their

measurements (see Table 1) they are probably specimens

©ZFMK

8 Luca Ghiraldi et al.

from black-eared opossums, D. aurita or D. marsupialis

(see Cerqueira & Lemos 2000).

Didelphis cf. imperfecta

MZUT T466 (332); mount; female ad.; Cayenne (French

Guyana); 1810; purchased in Paris by Franco Andrea

Bonelli;

MZUT T467 (333); mount; unsexed juv.; Cayenne

(French Guyana); 1822; from Mr. Banon.

Remarks: The specimens MZUT T466 and 467, previ-

ously cited as D. marsupialis, could not be identified at

species level due to the faded coloration of the skins. But

since they present whiter faces, they could be, instead,

representatives of D. imperfecta.

Order DASYUROMORPHIA Gill, 1872

Family DASYURIDAE Goldfuss, 1820

Genus Antechinus Macleay, 1841

YELLOW-FOOTED ANTECHINUS Antechinus fia-

vipes (Waterhouse, 1838) (LC)

MZUT T468 (548); unmount; unsexed ad.; New South

Wales, Australia; 1856; purchased by G.A. Frank.

DUSKY ANTECHINUS Antechinus swainsonii (Water-

house, 1840) (LC)

MZUT T469 (715); mount; unsexed ad.; Van Diemen

Land (Tasmania), Australia; V/1845; purchased by

G.A. Frank.

Genus Dasyurus E. Geoffroy, 1796

WESTERN QUOLL Dasyurus geoffroii Gould, 1841

(NT)

MZUT 1T470 (889); mount; female ad.; Australia; 1860;

purchased by Verreaux;

MZUT 1T471 (837); mount; unsexed ad.; Australia; 1848;

purchased in Milano (Italy).

Remarks. Mr. Verreaux was a professional collector of

and trade in natural history based in Paris.

SPOTTED-TAILED QUOLL Dasyurus maculatus

(Kerr, 1792) (NT)

MZUT T472 (550); mount; w.d.

Remarks: The specimen lacks the tail.

EASTERN QUOLL Dasyurus viverrinus (Shaw, 1800)

(EN)

MZUT T473; mount; unsexed ad.; Tasmania, Australia;

II/1867;

MZUT 1T474 (354); mount; unsexed ad.; Australia; 1839;

purchased in Rio de Janeiro by Antonio Caffer;

MZUT T475 (899); mount; unsexed ad.; Australia; 1860;

purchased by Verreaux.

Bonn zoological Bulletin 70 (1): 1-14

Genus Phascogale Temminck, 1824

BRUSH-TAILED PHASCOGALE Phascogale_ ta-

poatafa (Meyer, 1793) (NT)

MZUT T476 (695); mount; unsexed ad.; Australia; 1829.

Genus Sminthopsis Thomas, 1887

FAT-TAILED DUNNART Sminthopsis crassicaudata

(Gould, 1844) (LO)

MZUT 1T477 (2042); ethanol; unsexed, ad., Southern

Australia; no date; donation by Oldfield Thomas.

Remarks: Michael Rogers Oldfield Thomas was a Brit-

ish zoologist who worked on the mammal collections at

the Natural History Museum of London.

Family MYRMECOBHDAE Waterhouse, 1841

Genus Myrmecobius Waterhouse, 1836

NUMBAT Myrmecobius fasciatus Waterhouse, 1836

(EN)

MZUT T478 (687); mount; female ad.; York district,

Western Australia; VH/1844; donation by Mr. Preiss

MZUT T479 (699); mount; male ad.; Australia; 1/1845;

purchased by G.A. Frank.

Remarks. The MZUT catalogue reports that the speci-

men MZUT T478 was killed on 10/04/1840.

Johann August Ludwig Preiss (1811-1883) was a German

naturalist mainly interested in plant collection, but he

made extensive collections of natural history specimens

of all kinds. In the course of his activities he visited

from 1838 to 1841 most of the known parts of south-

western Australia and several islands off the coast. Most

of his zoological collection was sold to various European

museums, or dealers of natural history specimens.

Family THYLACINIDAE Bonaparte, 1838

Genus Thylacinus Temminck, 1824

TASMANIAN TIGER Thylacinus cynocephalus Har-

ris, 1808 (EX)

MZUT T480 (352); mount; male ad.; Tasmania, Austra-

lia; 1831; purchased by Mr. Leadbeater;

MZUT T480 (MACUT 331); partial skeleton.

Remarks: The skull 1s inside the taxidermy mount.

Benjamin Leadbeater was a renowned merchant of

natural history materials in London.

Order PERAMELEMORPHIA Ameghino, 1889

Family PERAMELIDAE Gray, 1825

Genus Isoodon (Desmarest, 1817)

SOUTHERN BROWN BANDICOOT J/soodon obesu-

lus (Shaw, 1797) (LC)

MZUT T481 (691); mount; female ad.; Australia;

VII/1844; donation by Mr. Preiss.

Remarks: The specimen was killed on 4/VI/1839.

©ZFMK

Revised catalogue of monotremes and marsupials housed at MRSN, Italy 9

Genus Perameles E. Geoffroy, 1804

LONG-NOSED BANDICOOT Perameles nasuta

Geoffroy, 1804 (LC)

MZUT T482 (829); mount; female ad.; Australia; 1848:

purchased in Milano by Mr. Bonomi.

Family THYLACOMYIDAE Bensley, 1903

Genus Macrotis Reid, 1837

GREATER BILBY Macrotis lagotis Reid, 1837 (VU)

MZUT T483 (848); mount; unsexed ad.; Australia; 1850:

purchased in Milano by Mr. Bonomi.

Order DIPROTODONTIA Owen, 1866

Family PHASCOLARCTIDAE Owen, 1839

Genus Phascolarctos Blainville, 1816

KOALA Phascolarctos cinereus Goldfuss, 1817 (VU)

MZUT T484 (360); mount; unsexed juv.; Australia:

1839-1840; purchased in Rio de Janeiro by Antonio

Caffer;

MZUT T485 (898); mount; unsexed ad.; Australia; ex-

change with Count Ercole Turati from Milan (Italy);

MZUT T486 (964); mount; w.d.;

MZUT 1T487; skin; unsexed ad.; Gosford, New South

Wales, Australia; 1893; donation by G. Podenzana.

Remarks. Giovanni Podenzana (1864-1943) was an

Italian naturalist, explorer and ethnographer. During

the last decade of XIX. century he travelled in Austra-

lia, Tasmania where he gathered numerous ethnographic

artifacts for the Museo Civico of La Spezia (Italy), but

also zoological and botanical specimens who enriched

the collections of several Italian museums.

Family VOMBATIDAE Burnett, 1829

Genus Vombatus E. Geoffroy, 1803

WOMBAT Vombatus ursinus ursinus (Shaw, 1800)

(LC)

MZUT T488 (714); mount; unsexed ad.; islands of the

Bass Strait, Australia, VIII/ 1845, purchased by G.A.

Frank.

Family PHALANGERIDAE Thomas, 1888

Genus Phalanger Storr, 1780

NORTHERN COMMON CUSCUS Phalanger orien-

talis (Pallas, 1766) (LC)

MZUT T489 (800); mount; unsexed ad.; Indonesia,

Timor Island, 1845; purchased by G.A. Frank;

MZUT T490 (799); mount; unsexed ad.; Indonesia,

Timor Island, 1845; purchased by G.A. Frank.

Remarks: The specimen MZUT T4839 is albino variety.

Genus Trichosurus (Lesson, 1828)

COMMON BRUSHTAIL POSSUM Trichosurus vul-

pecula (Kerr, 1792) (LC)

MZUT T491 (2268); mount; unsexed ad.; Australia; do-

nation by Mr. Gallardo;

MZUT T491 (MACUT 7051); skeleton;

MZUT T492 (704); mount; unsexed ad.; 1845; Australia:

purchased by G.A. Frank:

MZUT T493 (679); mount; unsexed ad.; eastern coast of

Australia, I/1844; donation by Dr. Ricord;

MZUT T494 (807); mount; unsexed ad.; Australia; 1845;

purchased by G.A. Frank:

Fig. 3. MZUT T480 specimen of Tasmanian Tiger Thylacinus cynocephalus.

Bonn zoological Bulletin 70 (1): 1-14

©ZFMK

10 Luca Ghiraldi et al.

MZUT T495; skin; unsexed ad.; Gosford, New South

Wales, Australia; 1893; donation by G. Podenzana;

MZUT T496 (MACUT 7868); skeleton; w.d.

Remarks: The specimens MZUT T491 and MZUT

T496 were undetermined.

The specimen MZUT T494 is albino variety.

Alexandre Ricord (1798-1876) was an assistant sur-

geon who devoted his life to natural history. He travelled

in tropical America between 1826 and 1834, collecting

many zoological specimens.

We didn’t find any information about Mr. Gallardo.

Family PPEUDOCHEIRIDAE Winge, 1893

Genus Pseudocheirus Ogilby, 1837

COMMON RINGTAIL POSSUM Pseudocheirus per-

egrinus (Boddaert, 1785) (LC)

MZUT T497; mount; unsexed ad.; w.d.;

MZUT T498 (801); mount; unsexed juv.; Australia:

1845; purchased by G.A. Frank;

MZUT T499 (355); mount; unsexed ad.; Australia; 1839;

purchased in Rio de Janeiro by Antonio Caffer.

Remarks: The specimen MZUT T497 was undeter-

mined.

Genus Petauroides Thomas, 1888

GREATER GLIDER Petauroides volans (Kerr, 1792)

(VU)

MZUT T500 (358); mount; female ad.; Australia;

MZUT T501 (705); mount; unsexed ad.; Australia; 1843;

donation by Dr. Ricord;

MZUT T502 (876); mount; unsexed ad.; Australia; no

date; from Royal Armory of His Majesty.

Family PETAURIDAE Bonaparte, 1838

Genus Petaurus Shaw, 1791

YELLOW-BELLIED GLIDER Petaurus australis

Shaw, 1791 (NT)

MZUT T503 (884); mount; female ad.; Australia; 1860;

purchased by Verraux:

MZUT 1T504; skin; unsexed ad.; Gosford, New South

Wales, Australia; 1893; by G. Podenzana.

Fig. 4. MZUT T512 specimen of Wolye Bettongia penicillata.

Bonn zoological Bulletin 70 (1): 1-14

©ZFMK

Revised catalogue of monotremes and marsupials housed at MRSN, Italy 1]

SUGAR GLIDER Petaurus breviceps Waterhouse,

1839 (LC)

MZUT T505 (1051); mount; unsexed ad.; Melbourne,

Victoria, Australia; donation by Mr. Cossu.

Remarks: Carlo Cossu was the vice-consul of the King-

dom of Italy in Melbourne between the years 1864 and

1870.

Family TARSIPEDIDAE Gervais & Verreaux, 1842

Genus Tarsipes Gervais & Verreaux, 1842

HONEY POSSUM Tarsipes rostratus Gervais & Ver-

reaux, 1842 (LC)

MZUT T506 (688); mount; female ad.; King George III

Bay, Western Australia, Australia; VII/1844; donation

by Mr. Preiss;

MZUT T507 (256); mount; unsexed ad.; Australia;

TX/1846; purchased from G.A. Frank.

Remarks. The MZUT catalogue reports that specimen

MZUT T506 was killed XI/1840.

Family ACROBATIDAE Aplin, 1987

Genus Acrobates Desmarest, 1818

FEATHERTAIL GLIDER Acrobates pygmaeus Shaw,

1793 (LC)

MZUT T508 (3138); ethanol; unsexed ad.; Australia; do-

nation by Enrico Festa;

MZUT T509 (2043); ethanol; unsexed ad.; New South

Wales, Australia; donation by Oldfield Thomas.

Family POTOROIDAE Gray, 1821

Genus Bettongia Gray, 1837

BURROWING BETTONG Bettongia lesueur (Quoy &

Gaimard, 1824) (NT)

MZUT 1T510 (702); mount; male ad.; Australia; 1/1845;

purchased by G.A. Frank

MZUT T511 (1131); mount; unsexed ad.; Australia;

1867; Pirocorvetta “Magenta” expedition.

WOYLIE Bettongia penicillata Gray, 1837 (CR)

MZUT T512 (790); mount; female ad.; Western Austra-

lia, Australia; 1845; purchased by G.A. Frank.

Genus Potorous Desmarest, 1804

LONG-NOSED POTOROO Potorous

(Kerr, 1792) (LC)

MZUT T513 (888); mount; male ad.; Tasmania, Austra-

lia; 1860; purchased by Verreaux.

tridactylus

Family MACROPODIDAE Gray, 1821

Genus Lagorchestes Gould, 1841

EASTERN HARE-WALLABY §Lagorchestes lep-

orides, Gould, 1841 (EX)

Bonn zoological Bulletin 70 (1): 1-14

Fig. 5. MZUT 1T514 specimen of Eastern-Hare Wallaby

Lagorchestes leporides.

MZUT T514; mount; unsexed ad.; Australia;

MZUT T515; mount; unsexed ad.; Australia;

MZUT T516; mount; unsexed ad.; Australia.

Remarks: The specimens MZUT T514-515 were unde-

termined. The specimen MZUT T516 was identified as

Bettongia rufescens.

Genus Lagostrophus Thomas, 1887

BANDED HARE-WALLABY Lagostrophus fasciatus

(Peron & Leseur, 1807) (VU)

MZUT T517 (797); mount; female ad.; Western Austra-

lia, Australia; 1845; purchased by G.A. Frank.

Genus Onychogalea Gray, 1841

BRIDLED NAILTAIL WALLABY Onychogalea frae-

nata (Gould, 1841) (VU)

MZUT T518; mount; male ad.; Australia;

MZUT T519; mount; unsexed ad.; w.d.

CRESCENT NAILTAIL WALLABY Onychogalea lu-

nata (Gould, 1841) (EX)

MZUT T520 (796); mount; unsexed ad.; Western Austra-

lia, Australia; 1845; purchased by G.A. Frank.

©ZFMK

12 Luca Ghiraldi et al.

Fig. 6. MZUT T520 specimen of Crescent Nail Wallaby Onychogalea lunata.

Genus Thylogale Gray, 1837

TASMANIAN PADEMELON Thylogale_billardierii

(Desmarest, 1822) (LC)

MZUT T521; mount; unsexed ad.; Tasmania, Australia.

RED-NECKED PADEMELON Thylogale thetis (Les-

son, 1828) (LC)

MZUT T522 (792); mount; female ad.; New South

Wales, Australia; 1845; purchased by G.A. Frank;

MZUT 1523; skin; unsexed; Gosford, New South Wales,

Australia; 1893; donation by G. Podenzana.

Genus Petrogale Gray, 1837

BRUSH-TAILED ROCK-WALLABY Petrogale peni-

cillata (Gray, 1827) (VU)

MZUT 1524 (1373); mount; unsexed ad.; Australia;

1893; purchased by Mr. Schiavetti.

Remarks: The specimen MZUT T524 was undeter-

mined.

Genus Setonix Lesson, 1842

QUOKKA Setonix brachyurus (Quoy e Gaimard, 1830)

(VU)

MZUT T525; mount; unsexed ad.; Australia.

Bonn zoological Bulletin 70 (1): 1-14

Remarks: The specimen MZUT T525 was undeter-

mined.

Genus Wallabia Trouessart, 1905

SWAMP WALLABY Wallabia bicolor Lesson, 1828

(LC)

MZUT 1T526 (798); mount; male ad.; Western Australia,

Australia; 1845; purchased by G.A. Frank.

Remarks: The locality of provenance is out of the range

of the species (Wilson & Mittermeier 2015).

Genus Macropus Shaw, 1790

EASTERN GRAY KANGAROO Macropus giganteus

Shaw, 1790 (LC)

MZUT 1527; mount; female ad.; Australia;

MZUT T528 (1084); mount; female ad.; Australia; no

date; dead in captivity at the Royal Zoological garden

of Torino;

MZUT T529; mount; male ad.; Australia; no date;

MZUT T530; mount; female juv.; w.d.;

MZUT T531 (MACUT 332); skeleton; w.d.

©ZFMK

Revised catalogue of monotremes and marsupials housed at MRSN, Italy 13

WESTERN GRAY KANGAROO Macropus fuligino-

sus Desmarest, 1817(LC)

MZUT T532; mount; female ad.; Australia; no date;

MZUT T533 (361); mount; female ad.; Australia; no

date; dead in captivity at the Royal menagerie of Stu-

pinigi in II/1859;

MZUT 1534 (2234); mount; male ad.; Australia; no date:

MZUT T534 (MACUT 7056); skull.

Genus Osphanter Gould, 1842

RED KANGAROO Osphranter rufus Desmarest, 1822

(LC)

MZUT T535 (1434); mount; female ad.; Australia; no

date;

MZUT T536; mount; female ad.; w.d.;

MZUT T537; mount; female ad.; w.d.

Remarks: All specimens were undetermined.

Genus Notamacropus Dawson & Flannery, 1985

RED-NECKED WALLABY Notamacropus rufogri-

seus Desmarest, 1817 (LC)

MZUT 1T538 (2724); mount; male ad.; Australia; no date:

donation by Enrico Festa. Dead in captivity;

MZUT T538 (MACUT 7295); skeleton;

MZUT T539 (789); mount; female ad.; King Island, Aus-

tralia; 1845; purchased by G.A. Frank;

MZUT T540 (804); mount; female ad.; Australia:

V/1845; purchased by G.A. Frank;

MZUT T541; mount; male ad.; w.d;

MZUT T542; mount; male ad.; w.d.;

MZUT T542 (MACUT 3461); skull; w.d.;

MZUT T543 (MACUT 336); skeleton; w.d.

Remarks: The specimen MZUT T542 was undeter-

mined.

TAMMAR WALLABY Notamacropus eugenii Des-

marest, 1817 (LC)

MZUT T544 (794); mount; male ad.; Western Australia,

Australia; 1845; purchased by G.A. Frank;

MZUT 1T545 (701); mount; female ad.; Australia; 1845;

purchased by G.A. Frank.

Remarks: The specimen MZUT T544 was labelled as

Halmaturus hautmanni.

PARMA WALLABY Notamacropus parma Water-

house, 1846 (NT)

MZUT T546 (806); mount; unsexed ad.; Western Austra-

lia, Australia; V/1845, purchased by G.A. Frank.

Remarks: The locality of provenance is out of range of

the species (Wilson & Mittermeier 2015).

UNDETERMINED SPECIMENS

Ailurops cf. furvus

MZUT T547 (703); mount; unsexed; Celebes Island, In-

donesia; I/1845; purchased by G.A. Frank.

Bonn zoological Bulletin 70 (1): 1-14

Remarks: The specimen could be identified as A. fur-

vus, due to the size and coat colaration, but because of the

size We can rule out an immature specimen of A. ursinus.

Isoodon cf. auratus.

MZUT T548; ethanol; w.d.

Remarks: The coloration seems to be that of /. auratus.

However, the small size of the specimen could suggest an

immature or an individual from a population of 1. obesu-

Jus characterized by a small size.

Perameles sp.

MZUT T549; ethanol; w.d.

Remarks: The specimen could be a juvenile and there-

fore the identification is difficult. The coat coloration

rules out P. gunni.

Petaurus cf. australis

MZUT T550 (359); mount; unsexed; Australia; 1819;

purchased in London during the Bullock’s Auction in

1819.

Remarks. The patagium is poorly developed, the coat

coloration and the lack of the dorsal stripe seem to indi-

cate P. australis.

Bettongia sp.

MZUT T551 (787); mount; male ad.; Australia; 1846;

purchased by G.A. Frank

Thylogale cf. thetis

MZUT T552 (795); mount; male ad.; New South Wales,

Australia; 1845; purchased by G.A. Frank.

Remarks: The correct identification is uncertain due to

the faded coat, but red on neck and back suggest T° thetis.

Petrogale sp.

MZUT T553 (1367); mount; unsexed ad.; purchased by

Mr. Schiavetti; 1893;

MZUT T554 (MACUT 3453); skull; no locality; 1896;

purchased by Mr. Crivelll.

Remarks. We didn’t find any information about Mr.

Schiavetti and Mr. Crivelli.

Macropus sp.

MZUT T555; mount; male ad.; w.d.;

MZUT T556; mount; female ad.; w.d.;

MZUT T557: mount; male juv.; w.d.;

MZUT T558: mount; male juv.; w.d.;

MZUT T559: mount; female; w.d.;

MZUT T560: mount; female; w.d.;

MZUT T561 (MACUT 329); skeleton (no skull); w.d.;

MZUT T562 (MACUT 322); skull; juv.; w.d.;

MZUT 1563; skeleton; juv.; w.d.

©ZFMK

14 Luca Ghiraldi et al.

Acknowledgements. We wish to thank Kenny Travoullion,

Western Australian Mueum for assistance with the bandicoot

identifications, the reviewers for their suggestions in improving

the manuscript, and Franco Andreone of the Museo Regionale

di Scienze Naturali of Torino for the comments on an earlier

version of the manuscript. We are also grateful to Pier Chiado

Fiorio and Marina Spini of the library of the Museo regionale

di Scienze Naturali di Torino for their support in retrieving sci-

entific literature.

REFERENCES

Astua D (2015) Morphometrics of the largest New World mar-

supials, opossums of the genus Didelphis (Didelphimorphia,

Didelphidae). Oecologia Australis 19 (1): 117-142

Calvini M, Siori MS, Gippoliti S, Pavia M (2016) Catalogue of

the primatological collection of the Torino University. Natu-

ral History Sciences 3 (2): 3-26

Cerqueira R, Lemos B (2000) Morphometric differentiation be-

tween Neotropical black-eared opossums, Didelphis marsu-

pialis and D. aurita (Didelphimorphia: Didelphidae). Mam-

malia 64 (3): 319-327

Corti A (1955) Torino ha avuto il primo giardino zoologico ittal-

iano. Natura 46 (2): 53-67

Gardner AL (2008) Genus Caluromys Allen, 1900. Pp. 1-11 in

AL Gardner (ed.) Mammals of South America, vol. 1: mar-

supials, xenarthrans, shrews, and bats. University of Chicago

Press, Chicago

Giarla TC, Voss RS, SA Jansa (2010) Species limits and phylo-

genetic relationships in the didelphid marsupial genus Thy/-

amys based on mitochondrial dna sequences and morphol-

ogy. Bulletin of the American Museum of Natural History

346: 1-67

Grande L (2017) Curators: Behind the Scenes of Natural His-

tory Museums. University of Chicago Press, First Edition,

Chicago

Hyller Giglioli E (1876) Viaggio intorno al globo della R. Piro-

corvetta Italiana Magenta. Relazione descrittiva e scientifica.

Maisner e Compagnia Editiori, Milano

IUCN 2020. The IUCN Red List of Threatened Species. Ver-

sion 2020-1. Online at: https://www.iucnredlist.org [last ac-

cessed 24 Nov. 2020]

Bonn zoological Bulletin 70 (1): 1-14

Kemp C (2017) The Lost Species: Great Expeditions in the

Collections of Natural History Museums. University of Chi-

cago Press, First Edition, Chicago

Maschetti G, Muti M, Passerin D’Entreves (1988) Serragli e

Menagerie in Piemonte nell’Ottocento sotto la Real Casa

Savoia. Allemandi & C. Editiori, Torino

Thomas O (1898) On the small mammals collected by Dr.

Borelli in Bolivia and Northern Argentina. Bollettino dei

Musei di Zoologia e Anatomia Comparata della R. Universita

di Torino 315 (XIII): 1-4

Passerin d’Entreves P, Gavetti E (2014) La collezione di cetacei

dei Musei di Zoologia e di Anatomia comparata dell’ Univer-

sita di Torino. Museologia Scientifica Memorie 12: 13-21

Rossi RV, Voss RS & Lunde DP (2010) A revision of the didel-

phid marsupial genus Marmosa. Part 1. The species in Tate’s

‘mexicana’ and ‘mitis’ sections and other closely related

forms. Bulletin of the American Museum of Natural History

334: 1-83

Simondetti M (1943) Necrologico — Carlo Bajonotti. Rivista

italiana di Ornitologia I-13 (2): 65-66

Tadini G (1937). Imammiferi del Museo di Torino. Tesi di Lau-

rea inedita della Facolta di Scienze della Regia Universita di

Torino (unpublished)

Tortonese E (1957) Venticinque anni di vita del Museo Zoolog-

ico di Torino (1930-1955). Natura 48 (1): 1-27

Voss RS, Jansa SA (2009). Phylogenetic relationships and clas-

sification of didelphid marsupials, an extant radiation of New

World metatherian mammals. Bulletin of the American Mu-

seum of Natural History 322: 1-177

Voss RS, Gutiérrez EE, Solari S, Rossi RV, Jansa SA (2014)

Phylogenetic relationships of mouse opossums (Didelphidae,

Marmosa) with a revised subgeneric classification and notes

on sympatric diversity. American Museum Novitates 3817:

1-27

Voss RS, Diaz-Nieto JF, Jansa SA (2018) A revision of Phi-

lander (Marsupialia: Didelphidae), Part 1: P. quica, P. canus,

and a new species from Amazonia. American Museum No-

vitates 3891: 1-70

Wilson DE, Mittermeier RA (2015) Monotremes and marsu-

pials. Handbook of the mammals of the World Vol. 5. Lynx

Edicions, Barcelona

Winker K (2004) Natural History Museums in a Postbiodiversi-

ty Era. BioScience 54 (5): 455-459

©ZFMK

Bonn zoological Bulletin 70 (1): 15-49

2021 - Junkiert L. et al.

https://do1.org/10.20363/BZB-2021.70.1.015

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:|sid:zoobank.org:pub:F935 124B-7308-4734-94A3-22CEA 19942E2

Four new species of the Madagascan genus Exphora Signoret, 1860

(Auchenorrhyncha: Fulgoromorpha: Tropiduchidae: Elicini)

with comments on some hitherto undescribed ultrastructural characters

Lukasz Junkiert', Marcin Walczak’? & Agnieszka Bugaj-Nawrocka*>*

'2.3 Faculty of Natural Sciences, Institute of Biology, Biotechnology and Environmental Protection, University of Silesia in Ka-

towice, Bankowa 9, PL-40-007 Katowice, Poland

“Corresponding author: Email: agnieszka.bugaj-nawrocka@us.edu.pl

'urn:lsid:zoobank.org:author: AF78807C-2115-4A33-AD65-9190DA612FB9

2 urn:lsid:zoobank.org:author:046FOD52-7FBA-4D7D-9F79-AEBF7F2C98B8

2 urn:Isid:zoobank.org:author: BSA9DF15-3677-4F5C-A DOA-46B25CA350F6

Abstract. Four new species of the Madagascan genus Exphora Signoret, 1860 (Hemiptera: Fulgoromorpha: Tropiduchi-

dae) are described: EF. bourgoini sp. nov., E. kalalaoensis sp. nov., E. angustivenosa sp. nov. and E. robusta sp. nov. Also,

a new, green colour form of E. /innavuorii Junkiert, Walczak & Bourgoin, 2017 is presented. The male and female geni-

talia of the new species are illustrated. SEM photos of the head, antennae and their sensilla, legs, as well as the fore and

hind wings are given. A number of structures, which were previously unknown or undescribed, are discussed, including

the compound eye with trichoid sensilla, the sensory plate organ on the antennal pedicel surface, the fore and hind wings

hamuli, the area of microtrichia at the costa posterior of the fore wing, the tegula, the postcubitus bulla, the third coxa

with coxal protrusion and the spines of tibia. A distribution map of the newly described species and an illustrated key to

all Exphora species are provided.

Key words. Planthoppers, insect genitalia, SEM, sensilla, wing morphology.

INTRODUCTION

Madagascar is the fourth largest island in the world, re-

maining in relative isolation for about 88 million years,

and over 90% of Malagasy wildlife is endemic (Venc-

es et al. 2009). The state of knowledge of Madagascar’s

fauna improves each year and affects various groups of

animals (e.g., Thalmann & Geissmann 2005; Couri et al.

2006; Olivieri et al. 2007; Glaw et al. 2012). This also

applies to the quantity of newly described Hemiptera

species, especially Heteroptera (e.g., Kment 2013; Banar

et al. 2016; Chiond et al. 2016) and Fulgoromorpha (e.g.,

Stroinski et al. 2011; Constant 2014; Gnezdilov 2015;

Gnezdilov & Bourgoin 2015; Junkiert & Walczak 2015;

Junkiert et al. 2016; Swierczewski et al. 2016). The num-

ber of scientific expeditions has increased significantly,

which allows to describe more and more new species of

plants and animals. However, the rapidly progressing

degradation of the island’s natural habitats is reducing its

biodiversity. Unfortunately, there is a concern that many

of the species described as new taxa for science may no

longer exist at all, because their habitats have been de-

stroyed (Goodman & Benstead 2003).

Within the family Tropiduchidae Stal, 1866, Elicini

Melichar, 1915 (37 genera, 139 species) is one of the

Received: 25.02.2020

Accepted: 02.12.2020

three tribes belonging to the subfamily Elicinae Meli-

char, 1915, next to Bucini Gnezdilov, Bartlett & Bour-

goin, 2016 (two genera, four species) and Parathisciini

Gnezdilov, 2013 (four genera, seven species) (Gnezdilov

2013; Gnezdilov et al. 2016; Bourgoin 2020). Previously,

representatives of this tribe were placed within the Issi-

dae Spinola, 1839 or Lophophidae Stal, 1866. In 1978,

Fennah designated subtribes Elicina and Gaetuliina with-

in Bladinini (Nogodinidae Melichar, 1898). Based on the

morphology of genitalia, as well as the data provided by

Urban & Cryan (2006), Gnezdilov (2007) transferred

Gaetuliina Fennah, 1978, and it gained tribe status (Gae-

tuliini) within the Tropiduchidae. In 2013, Gnezdilov

merged Elicina Melichar, 1915 with the Gaetuliini Fen-

nah, 1978 and established the Elicini tribe.

Among the characteristics distinguishing the repre-

sentatives of the tribe Elicini are hemispheric gono-

placs without teeth or with denticles, lateral spikes on

the metatibia, as well as symmetrical spinulation on the

second metatarsomere (Gnezdilov 2013; Gnezdilov et al.

2016). Elicini are found in the Americas, southern Afri-

ca, Madagascar, Asia, Australia and Oceania (Bourgoin

2020). Fossil records are known also from the areas of

Europe (Szwedo & Stroinski 1999; Szwedo et al. 2019).

Corresponding editor: R. Peters

Published: 28.01.2021

16 Lukasz Junkiert et al.

Currently, the Malagasy fauna of Tropiduchidae 1s rep-

resented by 35 species (including four described in the

present study). Until the mid-1960s, only 19 species of

this family were known from Madagascar (of which ten

from the subfamily Elicinae), including seven species of

the genus Exphora Signoret, 1860: E. guerinii Signoret,

1860, E. fumivenosa (Jacobi, 1917), E. longipennata

Lallemand, 1950, E. succinae Lallemand, 1950, E. ifa-

nadiensis Synave, 1966, E. perinetensis Synave, 1966,

and EF. similis Synave, 1966. Over the past few years, one

species of the genus Chrysopuchus Gnezdilov, 2013, one

of Bambomada Gnezdilov, 2015 and six of Bolitropis

Gnezdilov, 2013 (Gnezdilov 2013, 2015) have been de-

scribed, followed by eight new species of the genus Ex-

phora: E. ambatolaonaensis, E. constanti, E. stroinskii

(Junkiert & Walczak 2015), E. linnavuorii (Junkiert et al.

2017), as well as E. bourgoini sp. nov., E. kalalaoen-

sis Sp. nov., E. angustivenosa sp. nov., and FE. robusta

sp. nov. (this study). Among the genera of the tribe Eli-

cini, Exphora is now a rather speciose genus counting

15 species, including the four described here, ranking

in third place in terms of species numbers within Elicini

(after Neaethus Stal, 1861 and Dictyssa Melichar, 1906).

Examination of unidentified tropiduchid specimens in

the collections of the Royal Belgian Institute of Natural

Sciences in Brussel (Belgium) and the Royal Museum

for Central Africa in Tervuren (Belgium) allowed the de-

scription of new species, as well as of the green colour

form of E. linnavuorii Junkiert, Walczak & Bourgoin,

2017. In addition, the use of scanning electron micros-

copy (SEM) allowed to study a number of structures, not

yet known and described for this genus.

MATERIALS AND METHODS

Examination of the specimens

External structures were examined using a stereoscopic

microscope Olympus SZX9. The genitalia were dissected

after boiling the abdomen three times (about three min-

utes each time) in a 10% solution of potassium hydroxide

(KOH). Then the pygofer and styles were separated from

the abdomen and the aedeagus s.l. was extracted using

thin forceps and a needle blade. After that, the aedeagus

s.1. was placed in glycerine. The genitalia were exam-

ined using a light microscope Nikon Eclipse. Drawings

were made using a camera lucida. Photographs were tak-

en with a Canon Eos camera with extension rings. Wing

venation nomenclature follows Bourgoin et al. (2015).

Quoting the labels of specimens: (/) is used to divide data

on different rows on the label, (;) is used to divide data

on different labels, ({ ]) is used for authors’ comments.

Bonn zoological Bulletin 70 (1): 15-49

Institutional abbreviations

RBINS = Royal Belgian Institute of Natural Sciences,

Brussels, Belgium

RMCA = Musée Royal de I’ Afrique Centrale,

Tervuren, Belgium

Occurrence data and map preparation

All localities were georeferenced using Google Earth

Pro 7.3.2.5776 (Google Inc. 2019, Mountain View, CA,

USA) (coordinates for localities were collected in dec-

imal degrees, datum: WGS84). The map was prepared

in Quantum GIS 3.8 (QGIS Development Team 2019;

http://www.qgis.org) using WGS84 datum and EPSG:

3395 (World Mercator).

RESULTS

A key (Appendix I) to all known species of Exphora is

presented. The authors of this article would like to em-

phasize that they claim that the species EF. /ongipennata

Lallemand, 1950 and E. fumivenosa (Jacobi, 1917) do

not belong to the genus Exphora, but are included in this

key as the genus has not been revised yet.

Taxonomy

Class Insecta Linneaus, 1758

Order Hemiptera Linneaus, 1758

Family Tropiduchidae Stal, 1866

Subfamiliy Elicinae Melichar, 1915

Tribe Elicini Melichar, 1915

Genus Exphora Signoret, 1860

Exphora bourgoini Junkiert & Walczak sp. nov.

(Figs 1A, 2A, 3A, 5-6)

urn: |sid:zoobank.org:act: EF43 ES EF-4DB9-4184-A87C-1354EA32A410

Material examined

Holotype

1 3 / Exphora bourgoini sp. nov. / Junkiert & Wal-

czak det. 2018 [red label]; Sahafanjana / Manambato /

(Anove) [white label]; INSTITUT / SCIENTIFIQUE /

MADAGASCAR [light green label]; Coll. R.L.Sc.N.B.

[blue label] (RBINS).

Paratypes

1 9 / Exphora bourgoini sp. nov. / Junkiert & Wal-

czak det. 2018 [red label]; Sahafanjana / Manambato /

(Anove) [white label]; INSTITUT / SCIENTIFIQUE /

MADAGASCAR [light green label]; Coll. R.L.Sc.N.B.

[blue label] (RBINS).

1 2 / Exphora bourgoini sp. nov. / Junkiert & Walczak

det. 2018 [red label]; H. Synave det. 1956 / EXPHORA

GUERINII [sic!] Signoret (hand written); Sahafanjana /

©ZFMK

New species of Exphora (Hemiptera: Tropiduchidae) 17

oe -

i —— =~ .

a eae

= eT ee

= a a 4 ©. -

- i

Sigh]

e S| |

; . iat

if, 4

{

—-

Ze ma a

Ze 7 oan cas

eT eS eS

Fig. 1. Dorsal habitus of the newly described species. A. Exphora bourgoini sp. nov. B. E. kalalaoensis sp. nov. C. E. angustivenosa

sp. nov. D. E. robusta sp. nov

Bonn zoological Bulletin 70 (1): 15-49 ©ZFMK

18 Lukasz Junkiert et al.

1mm

= ee ,

Sn geae OR

a Lt

Dhak one paige at

‘iit aan’

CORRE Fe He ms hae i

gE aincegine

: a : ’

Bt 4

espe ae. ae

Fig. 2. Metope of the newly described species. A. Exphora bourgoini sp. nov. B. E. kalalaoensis sp. nov. C. E. angustivenosa

sp. nov. D. E. robusta sp. nov.

©ZFMK

Bonn zoological Bulletin 70 (1): 15-49

New species of Exphora (Hemiptera: Tropiduchidae) 19

Z bees

——

Fig. 3. Fore wing and hind wing of the newly described species. A. Exphora bourgoini sp. nov. B. E. kalalaoensis sp. nov. C. E. an-

gustivenosa sp. nov. D. E. robusta sp. nov.

Manambato / (Anove) [white label]; INSTITUT / SCI-

ENTIFIQUE / MADAGASCAR [light green label];

Coll. R.I.Sc.N.B. [blue label] (RBINS).

Description

Body length 10.8 mm.

Head. Metope twice as long as wide, lateral margins

slightly arched and extended laterally at 3/4 in its lower

part, then narrowing to metopoclypeal suture. Dorsal

margin of metope weakly arched but distinctly concave.

Median keel distinct, running through metope and

metopoclypeal suture (Fig. 2A). Metopoclypeal suture

elongate (about 1/4 shorter than metope), triangular.

Lateral keels present and distinct. In lateral view, metope

Bonn zoological Bulletin 70 (1): 15—49

is distinctly convex, whereas metopoclypeal suture

almost straight but median keel in lateral view gently

arches over surface of metopoclypeal suture, and it also

protrudes above surface of metope, but in lateral view it

is covered by also protruding lateral keels. Eyes round.

Coryphe almost 1.5 times as wide as long (measured in

the middle of the length), with anterior margin convex

and distinctly angular and posterior margin distinctly

arcuately concave.

Pronotum and mesonotum. Pronotum bluntly rounded

anteriorly, distinctly concave posteriorly. Mesonotum

weakly convex, with three parallel keels: median

keel is in its anterior part joined to two slanting carina

converging to each other almost at right angle and thus

©ZFMK

20 Lukasz Junkiert et al.

double row

of bristles

Fig. 4. Various views of the protibia of Exphora bourgoini sp. nov. A—C. With double row of bristles highlighted. D. Profemur in

dorsal view with small spines at inner margin.

forming an arrow-shaped structure. Both edges of arrow

are joined to two lateral keels.

Fore wings. Clavus elongate, reaching almost 2/3 of

the wing length, of hyperpterism type. Costal area well

developed with 11 or 12 cells between CA and Pc+CP;

ScP+R._ short, separating; RA two-branched; RP with

at least 7 terminals; MP separating before nodal line;

MP1+2 separating before nodal line, after the third

terminal, clearly forked at the same level as stigma;

MP3+4 separating, before nodal line; MP4 single,

MP3 short, separating before nodal line, after the first

terminal. CuA forking before nodal line and before MP;

3—4 transverse veins connecting CuP and PCu+A1 (more

often one, sometimes two connecting CuP and PCu before

joining with Al and two or three veins connecting CuP

and PCu+A1). Al running parallel to posterior margin

of clavus. Cubital cell twice as long, or even more, than

postcostal cell, radial cell and median cell. Radial cell

sometimes separated by a transverse vein. Cl based

well before C2—C5; C2 and C4 in contact sharing MP

margin. Cl, C2, C3 and C4 of similar length, C5 about

2 times longer. Eighteen or nineteen apical cells. Stigma

longitudinal and dark-brown, well visible, including 4

short veins running to edge of wing (Fig. 3A).

Bonn zoological Bulletin 70 (1): 15-49

Hind wings. Well developed, 4/5 of the fore wings’

length. Hyaline with brown veins. Almost twice long as

wide in midline (ratio length to width: 2.2—2.4). Eleven

apical cells (Fig. 3A).

Legs. Prothoracic and mesothoracic legs: Femur about

2/3 of tibia length, irregular in cross-section, margins of

femur covered with small bristles, inner margin bears

small spines. Tibiae long and thin, trapezoidal in cross-

section, margins covered with small bristles, lateral

margins with double row of bristles (e.g., Fig. 4).

Metathoracic legs. Metafemur margins covered with

small bristles. Metatibia twice as long as metafemur,

triangular in cross-section with concave ventral side.

Margins of metatibia covered with small, barely

visible bristles. Lateral margin with four lateral spines,

three of which are distinct and one is weakly visible.

Metatibiotarsal formula 8/8/2.

Colouration. General colouration yellowish-brown,

more contrastingly coloured than most species of this

genus. Metope with keels distinctly red, between lateral

and median keels red-brown stripes passing along the

metope. Eyes slightly darker than background; ocelli with

dark rim. Posterior margin of pronotum and mesonotum

contoured by a distinct dark line, similar to all darkly

©ZFMK

New species of Exphora (Hemiptera: Tropiduchidae) 21

0.5mm

Fig. 5. Male genitalia of Exphora bourgoini sp. nov. A. Aedeagus, lateral view. B. Anal tube, dorsal view. C. Gonostyl, lateral view.

Bonn zoological Bulletin 70 (1): 15—49 ©ZFMK

22 Lukasz Junkiert et al.

0.5mm

0.2 mm

Fig. 6. Female genitalia of Exphora bourgoini sp. nov. A. Distal part of abdomen in lateral view. B. Anal tube, dorsal view. C.

Gonapophyses VIII. D. Gonapophyses IX. Gp = gonoplac.

marked convex keels on the mesonotum. Lateral margins

of tergites of abdomen brown. Wings hyaline with brown

veins. Femur and tibia colouration uniform-yellowish-

brown, spines of metatibia brown, darker than tibia, the

sharp end of the spike is black. Prothoracic legs darker

than meso- and metathoracic legs.

Bonn zoological Bulletin 70 (1): 15-49

Genitalia. Male. Pygofer with hind margin convex.

Aedeagus s.l. narrow, falcate in lateral view. Ventral

phallobase overreaching half-length of aedeagus. Each

dorso-lateral phallobase lobe with one long apical

finger-shaped process bearing very small denticles.

Subapical process smaller and slightly curved. Ventral

©ZFMK

New species of Exphora (Hemiptera: Tropiduchidae) 23

Fig. 7. Distribution of the newly described species and colour

form on Madagascar. Yellow. Exphora angustivenosa sp. nov.

Green. FE. bourgoini sp. nov. Red. E. kalalaoensis sp. nov. Pur-

ple. £. robusta sp. nov. Blue. E. /innavuorii green colour form.

process (aedeagus s.s.) with inner part duck-head shaped,

outer part elongated in distal part with finger-shaped

apical process and smaller triangular subapical process

(Fig. SA). Anal tube rather robust, weakly narrowed

basally and enlarged apically in dorsal view with two

horn-like angles. Anal column elongate, about 0.5 times

anal tube length (Fig. 5B). Gonostyle triangle-shaped

with smooth roundish edges, lateral margin of gonostyle

slightly concave; capitulum wide and folded, bearing

subapical spiralling tooth on inner side (Fig. 5C).

Female. Endogonocoxal process well sclerotized with

slightly rounded apex and delicate subapical indentation

on the inner side. Gonoplac (third valvula) semi-circular

Bonn zoological Bulletin 70 (1): 15—49

in lateral view with dorsal margin slightly convoluted

innerly (Fig. 6A). Median part of sternite VII sinuous

at ventral side with distinct acute incision in the middle.

Genitalia with anal tube relatively short, broadly rounded

in dorsal view (Fig. 6B). Gonapophyses VIII (first

valvula) almost triangular, strongly sclerotized and

bearing three teeth on dorsal margin, and one relatively

large tooth with smaller subapical tooth (Fig. 6C).

Gonapophyses VIII not visible externally, covered by

gonoplacs. Gonapophyses IX (second valvular) well

developed, sclerotized with apical ends not confluent,

bearing very small quite abundant spikes, acute at apex

(Fig. 6D).

Measurements (in mm, females in parentheses). Body

length: — (10.80); head width (with eyes): 1.84 (1.80-

1.97); metope length: 1.87 (2.02—2.08); metope width:

1.14 (1.22—1.25); metope length/metope width ratio: 1.64

(1.66—1.67); coryphe length: 0.38 (0.44—-0.45); coryphe

width: 0.77 (0.87-0.89); coryphe length/coryphe width

ratio: 0.49 (0.50-0.51); fore wing length: 8.63 (8.64—

8.73); fore wing width: 4.23 (4.44); mesonotum length:

2.02 (1.94—2.13); mesonotum width: 1.95 (2.11—2.29).

Diagnosis. Exphora bourgoini sp. nov. can be

distinguished from other species by the pattern of dark-

brown longitudinal stigma including four short veins

running to edge of wing, metope with wide brown

stripes, horned anal tube, shape of style, aedeagus and

its processes.

Etymology. The name of this new species is dedicated to

professor Thierry Bourgoin, an excellent Fulgoromorphan

specialist from the Institute of the Systematic Evolution

and Biodiversity, National Museum of Natural History,

Paris, France.

Distribution. Madagascar, Sahafanjana [16°32’28.9” S,

49°47°02.4” E] (Fig. 7).

Exphora kalalaoensis Junkiert & Walczak sp. nov.

(Figs 1B, 2B, 3B, 8-9)

urn: |sid:zoobank. org: act: EZCE 1LAF'5-08 FC-4E67-B41F-D297F91973F5

Material examined

Holotype

1 ¢/ Exphora kalalaoensis sp. nov. / Junkiert & Walczak

det. 2018 [red label]; Ile Sainte Marie / forét de Kalalao

/ III-60 Andria R. [white label]; INSTITUT / SCIEN-

TIFIQUE / MADAGASCAR [light green label]; Coll.

R.LSc.N.B. [blue label] (RBINS).

Paratypes

2 63,1 9 / Exphora kalalaoensis sp. nov. / Junkiert &

Walczak det. 2018 [red label]; Ile Sainte Marie / forét

de Kalalao / III-60 Andria R. [white label]; INSTITUT /

©ZFMK

24 Lukasz Junkiert et al.

0.5mm

Fig. 8. Male genitalia of Exphora kalalaoensis sp. nov. A. Aedeagus, lateral view. B. Anal tube, dorsal view. C. gonostyl, lateral

view.

Bonn zoological Bulletin 70 (1): 15-49 ©ZFMK

New species of Exphora (Hemiptera: Tropiduchidae) 25

SCIENTIFIQUE / MADAGASCAR [light green label];

Coll. R.I.Sc.N.B. [blue label] (RBINS).

Description

Body length 10.7—11.1 mm.

Head. Metope almost twice as long as wide, lateral

margins slightly arched and extended laterally at level of

3/4 in its lower part, then narrowing to metopoclypeal

suture. Dorsal margin of metope weakly arcuately

but distinctly concave. Median keel distinct, running

through metope and metopoclypeal suture (Fig. 2B).

Metopoclypeal suture elongate (about 1/4 shorter than

metope) and triangular. Lateral keels present and distinct.

In lateral view, metope distinctly convex, whereas

metopoclypeal suture almost straight, the median keel in

lateral view gently arches over surface of metopoclypeal

suture, and it also protrudes above surface of metope, but

in lateral view it is almost all covered by also protruding

lateral keels. Eyes not quite round (hind edge of the eye

almost straight). Coryphe almost 1.5 times as wide as

long, with anterior margin convex and strongly angular

and posterior margin distinctly arcuately concave.

Pronotum and mesonotum. Pronotum bluntly rounded

anteriorly, distinctly concave posteriorly. Mesonotum

weakly convex, with three parallel keels: median keel is

in its anterior part joined to two slanting lines converging

to each other almost at right angle and thus forming an

arrow-shaped structure. Both edges of arrow are joined

to two lateral keels.

Fore wings. Clavus elongate, reaching almost 2/3 the

length of the whole wing, of hyperpterism type. Costal

area well developed with 12—15 cells between CA and

Pct+CP; ScP+R short; RA two-branched; RP with 6-9

(mostly 7—8) terminals; MP separating before nodal

line; MP1+2 separating before nodal line, 3-4 terminals

(mostly 3), after the last terminal, clearly forked at the

same level as stigma; MP3+4 separating before nodal

line; with 1 terminal; MP4 single, MP3 short, with 1

terminal, separating before nodal line. CuA forking

before nodal line and before MP; two or three transverse

veins connecting CuP and PCu+A1 (one vein connecting

CuP and PCu before joining with Al and one or two

connecting CuP and PCu+A1). Al running parallel to

posterior margin of clavus. Cubital cell at least twice as

long as postcostal cell, radial cell and median cell. Radial

cell separated by a transverse vein. C1 usually separated

by a transverse vein. Cl based well before C2—C5; C2

and C4 in contact sharing MP margin. Cl longer than

C2, C3 and C4, C5 about 2 times longer than C2, C3 and

C4. Seventeen to twenty-one apical cells. Stigma well

visible, including cell created by disjunction of ScP+RA

(with dark brown spot within cell) and 4—5 short veins

running to edge of wing (slightly paler cells) (Fig. 3B).

Bonn zoological Bulletin 70 (1): 15—49

Hind wings. Well developed, 4/5 of the fore wings’

length. Hyaline with brown veins. Almost twice long as

wide in midline (ratio length to width: 2.2—2.4). Twelve

apical cells (Fig. 3B).

Legs. Prothoracic and mesothoracic legs: Femur about

2/3 of tibia length, irregular in cross-section, margins

of femur covered with small bristles, inner margin bear

small spines. Tibiae long and thin, trapezoidal in cross-

section, margins covered with small bristles, lateral

margins with double row of bristles.

Metathoracic legs. Metafemur margins covered with

small bristles. Metatibia twice as long as metafemur,

triangular in cross-section with concave ventral side.

Margins of metatibia covered with small, barely visible

bristles. Lateral margin with four lateral spines, three of

which are distinct and one weakly visible. Metatibiotarsal

formula 8/8/2.

Colouration. General colouration yellowish-brown.

Metope with keels distinctly red, between lateral and

median keels red-brown stripes passing (but thinner than

in the previous species) along the metope. Eyes distinctly

darker than background. Ocelli with delicate rim, blurred

at the back. Posterior margin of pronotum and mesonotum

contoured by a distinct dark line, similar to all darkly

marked convex keels on mesonotum. Lateral margins of

tergites of abdomen brown. Wings hyaline with brown

veins. All legs in the same colour as the rest of the body.

Femur and tibia colouration uniform yellowish-brown,

spines brown, darker than tibia, the sharp end of the spike

black.

Genitalia. Male. Pygofer with hind margin convex.

Aedeagus s.1. U-shaped, robust (thick) in lateral view.

Ventral phallobase reaching half-length of aedeagus.

Each dorso-lateral phallobase lobe with one long apical

finger-shaped process bearing abundant small denticles.

Subapical process smaller and sharp ended. Aedeagus

s.S. with inner part club-shaped, outer part lobate, narrow

on the whole length, slightly sharpened with delicate

indentation on its apical part (Fig. 8A). Anal tube rather

robust, enlarged apically in dorsal view with slightly

convex lateral margin in the middle; anal column short,

about 0.43 times anal tube length (Fig. 8B). Gonostyle

triangle-shaped (but slightly elongated) with smooth

roundish edges, lateral margin of gonostyle slightly

concave; capitulum wide and folded, bearing subapical

spiralling tooth on inner side (Fig. 8C).

Female. Genitalia with anal tube relatively short, broadly

rounded in dorsal view. Gonapophyses VIII (first

valvula) rather triangular, elongated, strongly sclerotized

and bearing two teeth on dorsal margin and one relatively

large tooth, bearing smaller subapical tooth (Fig. 9A).

©ZFMK

26 Lukasz Junkiert et al.

0.5mm

Fig. 9. Female genitalia of Exphora kalalaoensis sp. nov. A. Gonapophyses VIII. B. Gonapophyses IX. C. Anal tube, dorsal view.

Bonn zoological Bulletin 70 (1): 15-49 ©ZFMK

New species of Exphora (Hemiptera: Tropiduchidae) 27

Gonapophyses VIII not visible externally, covered

by gonoplacs. Gonapophyses IX (second valvular)

confluent with endogonocoxal processes forming

triangular structure (Fig. 9B). Gonoplac (third valvula)

semi-circular in lateral view (Fig. 9C). Median part of

sternite VII with shallow roundish incision in the middle.

Measurements (in mm, females in parentheses). Body

length: 10.13 (10.69-11.0); head width (with eyes):

1.81 (1.89-1.93); metope length: 1.93 (1.90-2.01);

metope width: 1.10 (1.20—1.21); metope length/metope

width ratio: 1.75 (1.58-1.66); coryphe length: 0.49

(0.44—0.48); coryphe width: 0.83 (0.89); coryphe length/

coryphe width ratio: 0.49 (0.44—0.48); fore wing length:

8.34 (9.17-9.25); fore wing width: 3.77 (4.51-4.66);

mesonotum length: 1.81 (1.88—1.97); mesonotum width:

2.01 (2.08-2.27).

Diagnosis. Exphora kalalaoensis sp. nov. can be

distinguished from other species by a stigma which

includes cell created by disjunction of ScP+RA (with

dark brown spot within cell) and 4—5 short veins running

to edge of wing, metope with wide brown stripes, anal

tube with obtuse lateral margins, shape of style, aedeagus

and its processes.

Etymology. The name of species is connected with place

where specimens were collected, Kalalao Forest, Sainte

Marie Island, Madagascar.

Distribution. Madagascar, Nosy Boraha (fr. [le Sainte-

Marie), Kalalao Forest [16°55’32.1” S, 49°53’10.0” E]

(Fig. 7).

Exphora angustivenosa Junkiert & Walczak sp. nov.

(Figs 1C, 2C, 3C, 10-11)

urn: lsid:zoobank. org: act: FSB7097C-68BC-46A3-B8FA-511795E141EF

Material examined

Holotype

1 4 / Exphora angustivenosa sp. nov. / Junkiert & Wal-

czak det. 2018 [red label]; Madagascar / Nosy Komba

[blue label]; Coll. R.I.Sc.N.B. [blue label] (RBINS).

Paratypes

1 4 / Exphora angustivenosa sp. nov. / Junkiert & Wal-

czak det. 2018 [red label]; Coll. R.I.Sc.N.B. / Madagascar

/ Nossi-Be / Ex Coll. Le Moult [green label] (RBINS);

1 9 / Exphora angustivenosa sp. nov. / Junkiert & Wal-

czak det. 2018 [red label]; Coll. R.I.Sc.N.B. / Madagas-

car / Nosy Komba [blue label] (RBINS).

1 9 / Exphora angustivenosa sp. nov. / Junkiert & Wal-

czak det. 2018 [red label]; Coll. R.I.Sc.N.B. [blue label];

INSTITUT / SCIENTIFIQUE / MADAGASCAR [white

label]; Madagascar Sambirano / Nosy-Be / forét de

Lokobe / I-60 / Andria Robinson [white label] (RBINS).

Bonn zoological Bulletin 70 (1): 15—49

Description

Body length 12.35—12.60 mm.

Head. Metope twice as long as wide, lateral margins

slightly arched and extended laterally at level of 3/4 in

its lower part, then narrowing to metopoclypeal suture.

Dorsal margin of metope weakly arcuately but distinctly

concave. Median keel distinct, running through metope

and metopoclypeal suture (Fig. 2C). Metopoclypeal

suture elongate (about 1/4 shorter than metope),

triangular. Lateral keels present and distinct. In lateral

view metope is distinctly convex, whereas metopoclypeal

suture almost straight. Median keel in lateral view gently

arches above the surface of the metopoclypeal suture and

it also protrudes clearly above surface of metope, so that

in lateral view it is still visible, and rather not covered by

slightly protruding lateral keels. The eyes not quite round

(hind edge of the eye almost straight). Coryphe almost

1.5 times as wide as long, with anterior margin strongly

convex and strongly angular, and posterior margin

distinctly and very arcuately concave.

Pronotum and mesonotum. Pronotum bluntly rounded

anteriorly, distinctly concave posteriorly. Mesonotum

weakly convex, with three parallel keels: median keel is

in its anterior part joined to two slanting lines converging

to each other almost at right angle and thus forming an

arrow-shaped structure. Both edges of arrow are joined

to two lateral keels.

Fore wings. Clavus elongate, as long as 2/3 of whole

wing length, of hyperpterism type. Costal area well

developed with 10 or 11 cells between CA and Pc+CP;

ScP+R_ short, separating; RA two-branched; RP with

5-7 terminals; MP separating before nodal line; MP1+2

separating before nodal line, after the third or fourth

terminal, clearly forked at the same level as stigma;

MP3+4 separating, before nodal line; MP4 single, MP3

short, separating before nodal line, after the first terminal.

CuA forking before nodal line and before MP. Two or

three transverse veins connecting CuP and PCu+A1 (one

vein connecting CuP and PCu before joining with Al and

one or two connecting CuP and PCu+A1). Al running

parallel to posterior margin of clavus. Cubital cell at least

twice as long as postcostal cell, radial cell and median

cell. Cl based well before, C2, C3 and C4; C5 starts

at a similar level as Cl; C2 and C4 in contact sharing

MP margin. Cl, C2, C3 and C4 of similar length, C5

about 2 times longer. Eighteen to nineteen apical cells.

Stigma longitudinal and brown, well visible, includes 3-4

(mostly 3) short veins running to edge of wing (Fig. 3C).

Hind wings: Well developed, 4/5 of the fore wings’

length. Hyaline with brown veins. Almost twice long as

wide in midline (ratio length to width: 2.2—2.4). Eleven

apical cells (Fig. 3C).

©ZFMK

28 Lukasz Junkiert et al.

Fig. 10. Male genitalia of Exphora angustivenosa sp. nov. A. Aedeagus, lateral view. B. Anal tube, dorsal view. C. Gonosty], lateral

view.

Bonn zoological Bulletin 70 (1): 15-49 ©ZFMK

New species of Exphora (Hemiptera: Tropiduchidae) 29

0.5mm 0.2mm

0.2 mm

Fig. 11. Female genitalia of Exphora angustivenosa sp. nov. A. Distal part of abdomen in lateral view. B. Anal tube, dorsal view.

C. Gonapophyses VIII. D. Gonapophyses [X. Gp = gonoplac.

Bonn zoological Bulletin 70 (1): 15—49 ©ZFMK

30 Lukasz Junkiert et al.

Legs. Prothoracic and mesothoracic legs: Femur about

2/3 of tibia length, irregular in cross-section, margins

of femur covered with small bristles, inner margin bear

small spines. Tibiae long and thin, trapezoidal in cross-

section, margins covered with small bristles, lateral

margins with double row of bristles.

Metathoracic legs: Metafemur margins covered with

small bristles. Metatibia twice as long as metafemur,

triangular in cross-section with concave ventral side.

Margins of metatibia covered with small, barely

visible bristles. Lateral margin with four lateral spines,

three of which are distinct and one is weakly visible.

Metatibiotarsal formula 8/8/2.

Colouration. The species is paler than the previous

one. General colouration ochre-lightbrown, metope

with keels distinctly red, between lateral and median

keels red-brown thin stripes passing (much thinner than

the previous two species) passing along the metope.

Eyes darker than background, almost black, ocelli with

delicate rim, blurred at the back. Posterior margin of

pronotum and mesonotum gently contoured by a very

thin dark line, all convex keels on the mesonotum also

darker than the background. Mesonotum at the proximal

part with two small spots, with two larger irregular spots

on each side, and at the distal part with two small but

distinct spots. Lateral margins of tergites of abdomen

light brown. Wings hyaline with red-brown veins. Legs

ochre-lightbrown, metatibial spines of the same colour

except for the tip that is black.

Genitalia. Male. Pygofer with hind margin convex.

Aedeagus s.l. arched, robust in lateral view. Ventral

phallobase not reaching half-length of aedeagus.

Each dorso-lateral phallobase lobe with long fusiform

process reaching the apex of aedeagus, apical process

semi-circularly covered by abundant denticles, the

lateral margin serrate, subapical process absent. Inner

phallobase lobes spatulate, slightly curved, narrow on

the base and wider on apices. Aedeagus s.s. long and

fusiform (Fig. 10A). Anal tube rather robust, enlarged

apically in dorsal view with concave lateral margin and

roundish lateral margins. Anal column length about

0.54 times anal tube length (Fig. 10B). Gonostyle oval,

elongated. Capitulum wide and folded, bearing subapical

tooth on inner side (Fig. 10C).

Female. Endogonocoxal process, well developed,

apical ends roundish, with well visible incision, inner

margin strongly sclerotized. Gonoplac (third valvula)

semi-circular in lateral view (Fig. 11A). Median part

of sternite VII with distinct roundish incision in the

middle. Genitalia with anal tube relatively short, broadly

rounded in dorsal view (Fig. 11B). Gonapophyses VIII

(first valvula) almost trapezoidal, elongated, strongly

Bonn zoological Bulletin 70 (1): 15-49

sclerotized and bearing three teeth on dorsal margin and

one large, long tooth, bearing smaller subapical tooth

(Fig. 11C). Gonapophyses VIII not visible externally,

covered by gonoplacs. Gonapophyses IX (second

valvular) sclerotized, confluent with endogonocoxal

processes (Fig. 11D).

Measurements (in mm, females in parentheses). Body

length: 12.35 (12.60); head width (with eyes): 2.00

(1.93-—2.00); metope length: 2.18 (1.84-2.14); metope

width: 1.28 (1.27—1.30); metope length/metope width

ratio: 1.70 (1.41—1.68); coryphe length: 0.68 (0.60—

0.67); coryphe width: 0.98 (0.83-0.90); coryphe length/

coryphe width ratio: 0.69 (0.72—0.74); fore wing length:

10.46 (10.17—10.99); fore wing width: 5.13 (4.78—5.32);

mesonotum length: 2.40 (2.32—2.36); mesonotum width:

2.25 (2.12—2.15).

Diagnosis. Exphora angustivenosa sp. nov. can

be distinguished by its size (it is bigger than other

representatives of this genus), small brown longitudinal

stigma which includes 34 (mostly 3) short veins running

to edge of wing, metope with thin brown stripes, anal tube

with roundish lateral margins, shape of style, aedeagus

and its processes.

Etymology. The name of species refers to the thin veins

on the fore wings.

Distribution. Madagascar, Nosy Ambariovato, Nosy

Komba [13°28'18.7” S, 48°20°54.2” E]; Nosy Be,

Lokobe Forest [13°23’36.8” S, 48°18°42.4” E] (Fig. 7).

Exphora robusta Junkiert & Walczak sp. nov.

(Figs 1D, 2D, 3D, 12-13)

urn: |sid:zoobank.org:act: 702486 F8-43C2-4845-9AE3-9189D299CEE9

Material examined

Holotype

1 3 / Exphora robusta sp. nov. / Junkiert & Walczak det.

2018 [red label]; Coll. Mus. Tervuren / Madagascar: Ta-

mata / ve: Foul pointe XI- / 1995 A. Pauly [white label |

(RMCA).

Paratypes

1 3,2 99 / Exphora robusta sp. nov. / Junkiert & Wal-

czak det. 2018 [red label]; Coll. Mus. Tervuren / Mad-

agascar: Tamata / ve: Foul pointe XI- / 1995 A. Pauly

[white label] (RMCA).

Description

Body length 9.5—10.25 mm.

Head. Metope twice as long as wide, lateral margins

Slightly arched and extended laterally at level 3/4

in its lower part, then narrowing to metopoclypeal

suture. Dorsal margin of metope very weakly arcuately

©ZFMK

New species of Exphora (Hemiptera: Tropiduchidae) 31

0.5mm

Fig. 12. Male genitalia of Exphora robusta sp. nov. A. Aedeagus, lateral view. B. Anal tube, dorsal view. C. Gonostyl, lateral view.

Bonn zoological Bulletin 70 (1): 15—49 ©ZFMK

32 Lukasz Junkiert et al.

0.5mm

0.2mm

Fig. 13. Female genitalia of Exphora robusta sp. nov. A. Distal part of abdomen in lateral view. B. Anal tube, dorsal view. C. Go-

napophyses VIII. D. Gonapophyses [X. Gp = gonoplac.

Bonn zoological Bulletin 70 (1): 15-49 ©ZFMK

New species of Exphora (Hemiptera: Tropiduchidae) 33

concave (almost straight). Median keel distinct, running

through metope and metopoclypeal suture (Fig. 2D).

Metopoclypeal suture elongate, equal to 3/4 of the metope

length, triangular. Lateral keels present and distinct. In

lateral view, the metope is distinctly convex, whereas

the metopoclypeal suture is almost straight. Median keel

gently arches over surface of metopoclypeal suture and

protrudes slightly above surface of the metope, bottom

part is hidden by gently protruding lateral keels. The

eyes rather round (hind edge of the eye almost straight).

Coryphe almost 1.5 times as wide as long, with anterior

margin convex and distinctly angular and posterior

margin distinctly arcuately concave.

Pronotum and mesonotum. Pronotum bluntly rounded

anteriorly, distinctly concave posteriorly. Mesonotum

weakly convex, with three parallel keels: median keel is

in its anterior part joined to two slanting lines converging

to each other almost at right angle and thus forming an

arrow-shaped structure. Both edges of arrow are joined

to two lateral keels.

Fore wings. Clavus elongate, reaching almost 2/3 the

length of the whole wing, of hyperpterism type. Costal

area well developed with 13-14 cells between CA and

Pc+CP; ScP+R short, separating; RA two-branched; RP

with at least 8 terminals; MP separating before nodal

line; MP1+2 separating before nodal line, 3—5 terminals

(mostly 3), after the last terminal, clearly forked at the

same level as stigma; MP3+4 separating, before nodal

line; with 2—3 terminals (sometimes 1); MP4 single, MP3

short, with 1—2 terminals, separating before nodal line,

after the last terminal. CuA forking before nodal line

and before MP; two or three transverse veins connecting

CuP and PCu+A1 (one vein connecting CuP and PCu

before joining with Al and one or two connecting CuP

and PCut+A1). Al running parallel to posterior margin

of clavus. Cubital cell twice as long, or even more, than

postcostal cell, radial cell and median cell. Radial cell

separated by a transvers vein. C1 based well before C2-

C5; C2 and C4 in contact sharing MP margin. Cl longer

than C2, C3 and C4, C5 about 2 times longer than C2, C3

and C4. Nineteen to twenty one apical cells. Stigma well

visible, includes cell created by disjunction of ScP+RA

(with dark brown spot within cell) and 4 short veins

running to edge of wing (slightly paler cells) (Fig. 3D).

Hind wings. Well developed, 4/5 of the fore wings’

length. Hyaline with brown veins. Almost twice long as

wide in midline (ratio length to width: 2.2—2.4). Thirteen

apical cells (Fig. 3D).

Legs. Prothoracic and mesothoracic legs: Femur about

2/3 of tibia length, irregular in cross-section, margins

of femur covered with small bristles, inner margin bear

small spines. Tibiae long and thin, trapezoidal in cross-

Bonn zoological Bulletin 70 (1): 15—49

section, margins covered with small bristles, lateral

margins with double row of bristles.

Metathoracic legs. Metafemur margins covered with

small bristles. Metatibia twice as long as metafemur,

triangular in cross-section with concave ventral side.

Margins of metatibia covered with small, barely

visible bristles. Lateral margin with four lateral spines,

three of which are distinct and one is weakly visible.

Metatibiotarsal formula 8/8/2.

Colouration. General colouration brown, metope with

keels distinctly red, between lateral and median keels

red-brown thin stripes passing along the metope. Eyes

darker than background, almost black, ocelli darker

than background, without rim. The hind edge of the

pronotum and mesonotum is contoured by a distinct

dark line, similar like all dark marked convex keels on

the mesonotum. Lateral margins of tergites of abdomen

brown. Wings hyaline with brown veins. Legs brown like

the rest of the body. Metatibial spines dark brown with

black tip.

Genitalia. Male. Pygofer with hind margin convex.

Aedeagus s.l. falcate in lateral view. Ventral phallobase

overreaching half-length of aedeagus. Each dorso-lateral

phallobase lobe with one long apical finger-shaped

process bearing very small denticles. Subapical process

smaller and slightly curved. Inner part of ventral process

(aedeagus s.s.) short and robust, duck-head shaped,

outer part finger-shaped with apical process and smaller

triangular subapical well visible process (Fig. 12A). Anal

tube rather robust, weakly narrowed basally and enlarged

apically in dorsal view with two horn-like edges. Anal

column elongated, about 0.5 times anal tube length

(Fig. 12B). The dorsal and lateral margins of gonostyle

form a right angle, ventral margin oval; capitulum

folded, bearing subapical spiralling tooth on inner side

(Fig.12C).

Female. Endogonocoxal process, well sclerotized with

slightly rounded apex. Gonoplac (third valvula) semi-

circular in lateral view (Fig. 13A). Median part of

sternite VII with distinct, wide triangular incision in the

middle. Genitalia with anal tube relatively short, broadly

rounded in dorsal view (Fig. 13B). Gonapophyses VIII

(first valvula) rather short, almost trapezoidal, strongly

sclerotized and bearing three short teeth on dorsal

margin and one relatively large tooth, bearing smaller

subapical tooth (Fig. 13C). Gonapophyses VII not

visible externally, covered by gonoplacs. Gonapophyses

IX (second valvular) sclerotized, confluent with

endogonocoxal processes, forming _ bell-mouthed

immersion (Fig. 13D).

©ZFMK

34 Lukasz Junkiert et al.

Fig. 14. Exphora linnavuorii. A. Lateral habitus. B. Green form of E. /innavuorii.

Measurements (in mm, females in parentheses). Body

length: 9.48 (10.04—10.24); head width (with eyes): 1.73

(1.66-1.77); metope length: 1.90 (1.86—-1.90); metope

width: 0.98 (1.09-1.24); metope length/metope width

ratio: 1.94 (1.50—1.74); coryphe length: 0.43 (0.44—

0.49); coryphe width: 0.85 (0.82—0.92):; coryphe length/

coryphe width ratio: 0.50 (0.53—0.54); fore wing length:

8.52 (8.41-8.63); fore wing width: 4.26 (3.92-4.41),;

mesonotum length: 1.81 (1.96—2.02); mesonotum width:

2.17 (2.10-2.12).

Diagnosis. Exphora robusta sp. nov. can be distinguished

by its size (it is smaller and more robust than other species

of this genus), brown rounded stigma which includes

four short veins running to edge of wing (colouration is

slightly paler on those cells), metope with wide brown

stripes, horned anal tube, shape of style, aedeagus and

its processes.

Etymology. The name is given according to the robust

appearance of the body of this species.

Distribution. Madagascar, Toamasina, Tamatava

[18°0805.0” S, 49°22°00.9” E] (Fig. 7).

Bonn zoological Bulletin 70 (1): 15-49

Exphora linnavuorii — description of the new colour

form (Fig. 14)

Material examined

1 3 / Exphora linnavuorii / Junkiert & Walczak det. 2018

[red label]; Coll. R.I.Sc.N.B. / Madagascar (2090m) /

Plateau Soaindrana [blue label] (RBINS).

Description

Description consistent with the holotype of Exphora

linnavuorii Junkiert, Walczak & Bourgoin 2017. Unlike

the type specimen whose body is ochre-light brown

(metope with keels distinctly red), this form has a light

green body throughout (metope with keels distinctly

reddish). Wings hyaline, with green veins (veins of

the type specimen are light brown). Legs of the type

specimen are ochre-light brown (anterior and median

legs with darker colour shade), while this form has light

green legs with spikes on metatibiae in the same colour

as the leg and the sharp end of the spike 1s black.

Measurements (in mm, only male). Body length: 9.63;

head width (with eyes): 1.61; metope length: 1.72:

metope width: 0.97; metope length/metope width ratio:

1.77; coryphe length: 0.47; coryphe width: 0.69; coryphe

length/coryphe width ratio: 0.68; fore wing length:

©ZFMK

New species of Exphora (Hemiptera: Tropiduchidae) 3D

Fig. 15. Scanning electron micrographs of Exphora angustivenosa sp. nov., male. A. Entire view of the compound eye. B. Trichoid

sensilla (TS) between different ommatidia. C. Antenna, lateral view. D. Sensory plate organ on antennal pedicel surface. Chl =

sensillum chaeticum type I; fl = flagellum; pe = pedicel; PO = plate organ; sc = scape; SD = sclerotized denticles. Scale bars: A =

300 um; B = 20 um; C = 100 um; D = 30 um.

8.02; fore wing width: 3.43; mesonotum length: 1.90;

mesonotum width: 2.10.

Distribution. | Madagascar, Plateau Soaindrana

panes 13.2 eS.47 70271867 "E| (Rig. 2)

Ultrastructural characters

The terminology used for specific parts of the body and

sensilla is taken from Bourgoin and Deiss (1994), Brozek

and Bourgoin (2013) and Schubnel et al. (2019). The use

of a scanning microscope allowed to visualize some in-

Bonn zoological Bulletin 70 (1): 15—49

teresting structures that have not been presented for mem-

bers of the genus Exphora so far. The images show what

the compound eye looks like (Fig. 15A) and how trichoid

sensilla are arranged on it (Fig. 15B). They are not evenly

distributed and do not adhere to each ommatidium. The

antennal pedicel is short and knobbed, with over a dozen

sensory plate organs (Fig. 15C). Moreover, the antennae

are covered with numerous sensilla chaetica type I, as

well as shorter hairs with rounded ends (Fig. 15D). In

figure 15C, the flagellum is broken at the base. Figure

16 shows the whole head in lateral view, with marked

©ZFMK

36 Lukasz Junkiert et al.

Fig. 16. SEM image of Exphora angustivenosa sp. nov., male.

Head, lateral view. An = antenna; Cl = clypeus; Lb = labium;

Lm = labrum; Sf= stylet fascicle; I-V = segments of labium.

structures, in particular the subsequent segments of the

labrum.

Each metatarsomere is covered with numerous, long

trichobothria (Fig. 17). Distal margins of each metatar-

somere bear spikes with longitudinal reticulation. Metat-

ibiae are provided with distinct spines (4 or 5, depending

on the species) and sensilla chaetica type II (Fig. 18).

Figure 19 presents the ventral surface of the fore wing

with description of particular veins and cells, correspond-

ing to the descriptions given above. The SEM images

Bonn zoological Bulletin 70 (1): 15-49

Fig. 17. SEM image of Exphora angustivenosa sp. nov., male.

Tarsus of hind leg, lateral view. Abbreviations after Liang 2017:

ar = arolium; cl = claw; dst = dorsal seta on tarsus; Isc = lateral

seta on claw; Ist = lateral seta on tarsus; mt I, II and III = meta-

tarsomeres I, II, and III, respectively. Scale bar: 100 um.

show that in this group of tropiduchids, the pterostigma

is not a structural character, but corresponds to an area

of pigmentation of certain cells and veins. On the ven-

tral side of the fore wing, a micro-sculpture on the veins

is noticeable, which may have a strengthening function

(Fig. 20A,B). On the dorsal side of the fore wing, sensilla

chaetica type II occur only on the margin of the wing,

while on the ventral side they occur all over the margin

and on the veins of the membrane (Fig. 20C,D). At the

ventral side of the first anal vein (fore wing) campaniform

sensilla (mechanoreceptors) and sensilla chaetica type I

©ZFMK

New species of Exphora (Hemiptera: Tropiduchidae) 37

are present (Fig. 2OE-F). The area of microtrichia was

found at the costa posterior vein of the fore wing (ven-

tral side) (Fig. 21A—D). Examination of the area where

the wing is attached to the body (Fig. 22A) showed that

the thorax has a special depression where the postcubitus

bulla (Fig. 22B) is hidden when the wings are folded on

the body. In addition, the area of microtrichia at the me-

sopleuron has also been observed, and — while the wings

are placed on the body — this area is 1n contact with the

area of microtrichia at the costa posterior vein of the fore

wing (Fig. 22C—D). Figure 23 presents how tegula and

basal part of the wing look like, when the fore wing is

placed on the body.

" a

- a e-

? rae » ae

etn tere ree?

x pact a ae

Pg as

tt:

The hind wing is covered dorsally with sensilla chaeti-

ca type IJ on each vein (the jugal area was rolled up under

the wing so it cannot be seen in the picture) (Fig. 24). The

SEM pictures of both wings show the hamuli in Exphora

that allow the wings of insects to remain connected in

flight (Fig. 25). For members of the genus Exphora, the

hamuli take the form of a fold at the edge of both wings.

A higher magnification shows that the hamuli on the hind

wing is covered with spines (Fig. 26A—B). A cuticular

micro-sculpture of the fused veins (ScP+R+M) on the

proximal part of the hind wing (Fig. 26C—D) was also

observed.

rear.

Sep, Sie

pe a, *

Fig. 18. SEM image of Exphora angustivenosa sp. nov., male. Spine of tibia (hind leg), ventral view. Ch2 = sensillum chaeticum

type II.

Bonn zoological Bulletin 70 (1): 15—49

©ZFMK

38 Lukasz Junkiert et al.

Ge ci.

—_— ‘i

= f has ia,

at ee 5

i : 3 i ae

* f

™ P

— he / :

a wa me i x

. ‘, i

. a /

. - + d

= “s : : ™, ee

; .

presto —< fe é .

i ee é

: é Wm Cc

a C2

—_ f oe = Me rice =

= : .

“

aa eae

ao RP A

C2 i radial cell

a ———

= —

medial cell —

-~ cubital cell

Fig. 19. SEM image of Exphora angustivenosa sp. nov., male. Fore wing, ventral view. Al = first anal vein; A2 = second anal vein;

bc = basal cubital; CA = costa anterior; CP = costa posterior; CuA = cubitus anterior; CuP = cubitus posterior, MP = media poste-

rior; RP(+MA) = radius posteriori (+media anterior); SCP+R(MA) = subcosta posterior + radius (with media anterior); ScP+RA =

subcosta posterior + radius anterior.

Each metacoxa presents a protrusion shaped as a spine

(Fig. 27A—-B). At higher magnification, a dense pad of

microtrichia can be observed (Fig. 27C—D).

REFERENCES

Bahar P, Davranoglou LR, Chtond D (2016) A New species of

Henicocephaloides from Eastern Madagascar (Hemiptera:

Heteroptera: Reduviidae). Entomologica Americana 122

(1-2): 238-244

Bourgoin T (2020) FLOW (Fulgoromorpha Lists on The Web):

a world knowledge base dedicated to Fulgoromorpha. Ver-

sion 8, updated [01.07.2020]. Online at http://www. hemip-

tera-databases.org/flow/ [last accessed 27 Dec. 2020]

Bourgoin T, Deiss V (1994) Sensory plate organs of the antenna

in the Meenoplidae—Kinnaridae group (Hemiptera: Fulgoro-

morpha). International Journal of Insect Morphology and

Embryology 23: 159-168

Bourgoin T, Wang RR, Asche M, Hoch H, Soulier-Perkins A,

Stroinski A, Yap S, Szwedo J (2015) From micropterism to

hyperpterism: recognition strategy and standardized homol-

ogy-driven terminology of the fore wing venation patterns in

planthoppers (Hemiptera: Fulgoromorpha). Zoomorphology

134 (1): 63-77

Brozek J, Bourgoin T (2013) Morphology and distribution of

the external labial sensilla in Fulgoromorpha (Insecta: He-

miptera). Zoomorphology 132: 33-65

Chtond D, Rédei D, Banary P (2016) A new species of the Mada-

gascan genus Physoderoides (Hemiptera: Heteroptera: Redu-

viidae: Physoderinae). Entomologica Americana 122 (1-2):

245-250

Bonn zoological Bulletin 70 (1): 15—49

Constant J (2014) Revision of the Malagasy lanternfly genus

Belbina Stal, 1863, with two new species (Hemiptera: Ful-

goromorpha: Fulgoridae). European Journal of Taxonomy

102: 1-37

Couri MS, Pont AC, Penny ND (2006) Muscidae (Diptera) from

Madagascar: identification keys, descriptions of new species,

and new records. Proceedings of the California Academy of

Sciences 57 (4): 799-923

Davranoglou RL, Mortimer B, Taylor GK, Malenovsky I (2019)

On the morphology and possible function of two putative vi-

broacoustic mechanisms in derbid planthoppers (Hemiptera:

Fulgoromorpha: Derbidae). Arthropod Structure and Devel-

opment 52: 100880

Fennah RG (1978) The higher classification of the Nogodin-

idae (Homoptera, Fulgoroidea) with the description a new

genus and species. Entomologist’s Monthly Magazine 113:

113-119

Glaw F, Kohler J, Townsend TM, Vences M (2012) Rivaling the

World’s Smallest Reptiles: Discovery of Miniaturized and

Microendemic New Species of Leaf Chameleons (Brooke-

sia) from Northern Madagascar. PLoS One 7(2): e31314. ht-

tps://doi.org/10.1371/journal.pone.0031314

Gnezdilov VM (2007) On the systematic position of the Bla-

dinini Kirkaldy, Tonginae Kirkaldy, and Trienopinae Fen-

nah (Homoptera, Fulgoroidea). Zoosystematica Rossica 15:

293-297

Gnezdilov VM (2013) Contribution to the taxonomy of the

family Tropiduchidae Stal (Hemiptera, Fulgoroidea) with de-

scription of two new tribes from Afrotropical Region. Deut-

sche Entomologische Zeitschrift 60 (2): 179-191

Gnezdilov VM (2015) Madagascan Caliscelidae (Hemiptera,

Fulgoroidea): Current Knowledge and Description of a New

Genus and Species. African Invertebrates 56 (3): 739-746

©ZFMK

New species of Exphora (Hemiptera: Tropiduchidae) 39

Fig. 20. SEM image of Exphora angustivenosa sp. nov., male. A-B. Micro-sculpture on the veins of the fore wing. C—D. Sensilla

chaeticum type II occurring on the ventral side of the fore wing, mainly at distal part of the wing as well as costa anterior and costa

posterior veins. E. Campaniform sensillum. F. Sensillum chaeticum type I, both at ventral side of the first anal vein (fore wing).

Chl = sensillum chaeticum type I; Ch2 = sensillum chaeticum type II (after Wang et al. 2018); CS = campaniform sensillum.

Bonn zoological Bulletin 70 (1): 15—49 ©ZFMK

40 Lukasz Junkiert et al.

Fig. 21. SEM image of Exphora angustivenosa sp. nov., male. A-D. Different views of the area of microtrichia at costa posterior

(CP) of fore wing (ventral view).

Gnezdilov VM, Bartlett CR, Bourgoin T (2016) A new tribe of

Tropiduchidae (Hemiptera: Fulgoroidea) with revision of the

genus Buca and description of asymmetric hind leg spinula-

tion. Florida Entomologist 99 (3): 406-416

Gnezdilov VM, Bourgoin T (2015) New Genera and New

Species of the Tribe Elicini (Hemiptera: Fulgoroidea: Tropi-

duchidae) with Key to Tropiduchid Genera Known from

Madagascar. Annales Zoologici 65 (4): 599-618

Goodman SM, Benstead JP (2003) The Natural History of

Madagascar. University of Chicago Press, Chicago / London

Jacobi A (1917) Die Zikadenfauna Madagascars und der Co-

moren. In: Jacobi A (ed) Voeltzkow‘s Reise in Ostafrika

Vol 3. Schweizerbart’sche Verlagsbuchhandlung, Stuttgart:

519-552

Bonn zoological Bulletin 70 (1): 15—49

Junkiert L, Walczak M (2015) Three new species of the genus

Exphora Signoret, 1860 (Hemiptera, Fulgoromorpha, Tropi-

duchidae) from Madagascar. Zootaxa 3926 (1): 129-136

Junkiert L, Walczak M, Bourgoin T (2017) A new species of

the genus Exphora Signoret, 1860 from Madagascar (He-

miptera: Auchenorrhyncha: Fulgoromorpha: Tropiduchidae).

Entomologica Americana 122 (3): 495-501

Kment P (2013) Carduelicoris stehliki, anew genus and species

of Pentatomidae (Hemiptera: Heteroptera) from Madagascar.

Acta Musei Moraviae, Scientiae biologicae 98 (2): 415-432

Lallemand V (1950) Contribution a I’étude des Homopteres de

Madagascar. Mémoires de |’Institut des Sciences de Mada-

gascar (Series A) 4 (1): 83-96

©ZFMK

New species of Exphora (Hemiptera: Tropiduchidae) 4]

i fag tis tdetcere

focerseeselae

-e

Sot

Fig. 22. Stereoscopic microscope and SEM images of Exphora bourgoini sp. nov. and E. angustivenosa sp. nov. A. Stereoscopic

microscope image of the area where the wing is attached to the body (£. bourgoini sp. nov., male). Circumflex (“) indicates post-

cubitus bulla, i.e., the processus, which is located at the ventral side of fore wing, between cubitus anterior and cubitus posterior.

* indicates the area of microtrichia at mesopleuron. B. SEM image of processus at the ventral side of fore wing (E. angustivenosa

sp. nov., male). C. SEM image of the area of microtrichia at mesopleuron. D. Area of microtrichia at higher magnification. am =

area of microtrichia at costa posterior; bc = basal cubital; PCuB = postcubitus bulla.

Melichar L (1898) Monographie der Ricaniiden (Homoptera).

Annalen des k.k Naturhistorischen Hofmuseums 13: 197—

359.

Melichar L (1906) Monographie der Issiden. (Homoptera). Ab-

handlungen der K. K. Zoologisch-botanischen Gesellschaft

in Wien 3: 1-327

Melichar L (1915) Monographie der Lophopinen. Annales His-

torico-Naturales Musei Nationalis Hungarici 13: 337-385

Olivieri G, Zimmermann E, Randrianambinina B, Rasolohar-

yaona S, Rakotondravony D, Guschanski K, Radespiel U

Bonn zoological Bulletin 70 (1): 15-49

(2007) The ever-increasing diversity in mouse lemurs: Three

new species in north and northwestern Madagascar. Molecu-

lar Phylogenetics and Evolution 43 (1): 309-327

Schubnel T, Desutter-Grandcolas L, Legendre F, Prokop J, Ma-

zurier A, Garrouste R, Grandcolas P, Nel A (2019) To be or

not to be: postcubital vein in insects revealed by microto-

mography. Systematic Entomology 45 (2): 327-336

Signoret V (1860) Faune des hémipteres de Madagascar. lére

partie. Homopteres. Annales de la Société Entomologique de

France 3 (8): 177-206

©ZFMK

A? Lukasz Junkiert et al.

Fig. 23. Stereoscopic microscope image of tegula and basal part

of wing of Exphora bourgoini sp. nov., male. bc = basal cubital;

CA = costa anterior.

Pc+C+ScA

““ScP¢R+MA.

StroinskiA, Gnezdilov VM, Bourgoin T (2011) Sub-brachypter-

ous Ricaniidae (Hemiptera: Fulgoromorpha) of Madagascar

with morphological notes for these taxa. Zootaxa 3145: 1—70

Swierczewski D, Bourgoin T, Stroinski A (2016) Revision of

the Madagascan genus Paraflata (Hemiptera: Fulgoromor-

pha: Flatidae), with notes on planthopper hosts parasitized by

epipyropidae moths. Annales Zoologici 66 (1): 57-82

Synave H (1966) Homopteres de Madagascar. Verhandlungen

der Naturforschenden Gesellschaft in Basel 77: 55—75

Szwedo A, Drohojowska J, Popov Y, Simon E, Wegierek P

(2019) Aphids, true hoppers, jumping plant-lice, scale in-

sects, true bugs and whiteflies (Insecta: Hemiptera) from the

Insect Limestone (latest Eocene) of the Isle of Wight, UK.

Earth and Environmental Science Transactions of the Royal

Society of Edinburgh 1—66

Szwedo J, Stroinski A (1999) Redescription of Tritophania pa-

truelis Jacobi, 1938 from Eocene Baltic amber (Hemiptera:

Nogodinidae). Annales Zoologici Warszawa 49 (3): 203—207

Thalmann U, Geissmann T (2005) New species of woolly le-

mur Avahi (Primates: Lemuriformes) in Bemaraha (Central

: ~

500 pm

Fig. 24. SEM image of Exphora angustivenosa sp. nov., male. Hind wing, dorsal view. Abbreviation after Davranoglou et al. 2019:

AA = anal anterior; AP = anal posterior; cv = cross-vein; CuA = cubitus anterior; CuP — cubitus posterior, MP = media posterior;

Pc+C+ScA = postcubitus + costat+ subcostal anterior; SCP+R+MA = subcosta posterior + radius + media anterior.

Spinola M (1839) Essai sur les Fulgorelles, sous-tribu de la tri-

bu des Cicadaires, ordre des Rhyngotes. Annales de la So-

ciété Entomologique de France 8: 133-337

Stal C (1861) Nova methodus familias quasdam Hemipterorum

disponendi genera Issidarum synoptice disposita. Ofversigt

af Kongliga Svenska Vetenskaps-Akademiens Foérhandlingar

18: 195-212

Stal C (1866) Hemiptera Homoptera Latr. Hemiptera Africana

Vol 4. Officina Norstedtiana, Stockholm, Sweden

Bonn zoological Bulletin 70 (1): 15-49

Western Madagascar). American Journal of Primatology 67

(3): 371-376

Urban JM, Cryan JR (2006) Evolution of the planthoppers (In-

secta: Hemiptera: Fulgoroidea). Molecular phylogenetics

and evolution 42: 556-572

Vences M, Wollenberg KC, Vieites DR, Lees DC (2009) Mada-

gascar as a model region of species diversification. Trends in

Ecology and Evolution 24 (8): 456-465

©ZFMK

New species of Exphora (Hemiptera: Tropiduchidae) 43

Fig. 25. SEM image of Exphora angustivenosa sp. nov., male. A. Fore wing (ventral view). B. Hind wing (dorsal view) hamuli (*),

located along both wing margins.

Fig. 26. SEM images of Exphora angustivenosa sp. nov., male. A. Hind wing (dorsal view) hamuli. B. Higher magnification view

of hamuli with spines (sp). C. General view of the fused veins (ScP+R+M) on the proximal part of hind wing. D. Cuticular mi-

cro-sculpture of the fused veins on the proximal part of hind wing. ScP+R+M = subcosta posterior + radius + media; sp = spines.

Bonn zoological Bulletin 70 (1): 15—49 ©ZFMK

44 Lukasz Junkiert et al.

coxal

protrusion

c a=

4 8 Ps 4

SRS Yeo

> 6a} & ae gg

Fig. 27. Stereoscopic microscope and SEM images of Exphora bourgoini sp. nov. and E. angustivenosa sp. nov.

A. Stereoscopic microscope image of the third coxa with coxal protrusion (E£. bourgoini sp. nov., male). B. SEM

image of the third coxa with coxal protrusion (E. angustivenosa sp. nov., male). C—D. The coxal protrusion at higher

magnification, covered with densely packed microtrichia.

Bonn zoological Bulletin 70 (1): 15—49 ©ZFMK

New species of Exphora (Hemiptera: Tropiduchidae) 45

APPENDIX I.

Key to the species of Exphora

— Exphora longipennata Exphora fumivenosa Exphora perinetensis

Metope distinctly enlarged over clypeus

at almost right angle, with two rows of

ar]

—

Pterostigma small, includes 1-3 cells, | Pterostigma large, well visible, includes} Fore wing with dark brown transvers

without distinct dark spot at cell Cla |more than 3 cells, with distinct dark spot} veins; pterostigma small, barely visible,

(cell Cla is missing) at cell Cla; fore wing with dark brown | includes 1-3 cells, without distinct dark

transvers veins spot at cell Cla

Costal cells number — 7-8 Costal cells number — 8-9 Costal cells number — 9-10

Apical cells number — 16-17 Apical cells number — 15+1 Apical cells number —17+1

Bonn zoological Bulletin 70 (1): 15-49 ©ZFMK

46 Lukasz Junkiert et al.

| Exphora similis | Exphora succinae___|—__Exphora linnavuorii__|

Pterostigma small, barely visible, Pterostigma small, barely visible,

spot at cell Cla spot at cell Cla

Costal cells number — 10-11 Costal cells number — 8-10

Apical cells number — 17-19 Apical cells number — 14-17

ae)

uP)

_—

[oF

1o)

aedeagus

Apical part of aedeagus with long Apical part of aedeagus with long

needle-like processes directed needle-like processes directed

dorsall

Bonn zoological Bulletin 70 (1): 15-49

Pterostigma small, barely visible,

spot at cell Cla

Costal cells number — 7-8

includes 1-3 cells, without distinct dark | includes 1-3 cells, without distinct dark | includes 1-3 cells, without distinct dark

Apical cells number —15-17

Lateral lobes without additional

processes

©ZFMK

New species of Exphora (Hemiptera: Tropiduchidae) 47

Exphora angustivenosa

pterostigma

Pterostigma small, barely visible,

includes 1-3 cells, without distinct dark

spot at cell Cla

Costal cells number — 10-12

Apical cells number — 18+1

aedeagus

Aedeagus s.1. well developed, lateral

lobes with small spikes (1), inner lobes

spatulate (2

Bonn zoological Bulletin 70 (1): 15—49

Exphora ifanadiensis

r |

Z lal

Pterostigma large, well visible, includes

more than 3 cells, with distinct dark spot

at cell Cla

Costal cells number — 9-13

Apical cells number — 18-19

Aedeagus s.l. well developed, lateral

lobes with small spikes (1), inner lobes

Exphora constanti

J ; ia

Pterostigma large, well visible, includes

more than 3 cells, with distinct dark spot

at cell Cla

Costal cells number — 11-13

Apical cells number — 20-22

Apical part of lateral lobes with finger-

like shaped processes (1), inner lobes

with two bulges (2

©ZFMK

48 Lukasz Junkiert et al.

|| Exphora ambatolaonaensis Exphora stroinskii Exphora bourgoini

- ee Ai 4

Pterostigma large, well visible, includes

more than 3 cells, with distinct dark spot

at cell Cla

Costal cells number — 10-11 Costal cells number — 10-12 Costal cells number — 11+1

Apical cells number — 18-19 Apical cells number — 18-20 Apical cells number — 18+1

oO.

Aedeagus s.l. narrow, apical part of | Apical part of lateral lobes with finger- | Apical part of lateral lobes with finger-

lateral lobes with spiky ending (1) like shaped processes (1), inner lobes | like shaped processes (1), inner lobes

like shaped (2

Bonn zoological Bulletin 70 (1): 15-49 ©ZFMK

New species of Exphora (Hemiptera: Tropiduchidae) 49

| Exphora guerini Exphora robusta Exphora kalaloensis

3 a a

( ln > ome

ARH tie ee

Tippee ene

Pterostigma large, well visible, includes | Pterostigma large, well visible, includes | Pterostigma large, well visible, includes

more than 3 cells, with distinct dark spot

at cell Cla

Costal cells number — 10-12 Costal cells number — 12-13 Costal cells number — 12-14

Apical cells number — 19+1 Apical cells number — 19-21 Apical cells number — 20+1

ne]

iB)

or8)

oe)

oP)

Apical part of lateral and inner lobes

with small spikes (1), inner lobes spikes and finger-like shaped processes | of lateral lobes with finger-like shaped

extended in apical part (2); apical (1), inner lobes with distinct spiky processes (1); aedeagus s.s. robust and

process of aedeag as subapical knobed (2

Bonn zoological Bulletin 70 (1): 15—49 ©ZFMK

BHL

Blank Page Digitally Inserted

Bonn zoological Bulletin 70 (1): 51-65

2021 - Saigusa T. & Sinclair B.J.

https://do1.org/10.20363/BZB-2021.70.1.051

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:Isid:zoobank.org:pub:37C79C19-FAF6-4900-BB9B-7D43EC1 AE371

Revision of the 7richoclinocera yixianensis species-group from eastern Asia

(Diptera: Empididae: Clinocerinae)

Toyohei Saigusa! & Bradley J. Sinclair?”

'7. 1-402 Baikoen 2-chome, Chuo-ku, Fukuoka-shi 810-0035, Japan

?Canadian National Collection of Insects & Canadian Food Inspection Agency, OPL-Entomology, K.W. Neatby Bldg., C.E.F.,

960 Carling Ave., Ottawa, ON, Canada KIA 0C6

“Corresponding author: Email: bradley.sinclair@canada.ca

'urn:lsid:zoobank.org:author:390F7B 16-1 B9D-419F-BOCD-F3279B89DF 1D

>urn:Isid:zoobank.org:author:45 16327F-B73E-456C-927F-18EFBOB9E08B

Abstract. The 7richoclinocera yixianensis species-group from eastern Asia is revised and includes five species: 7. emotoi

sp. nov., 7! maculata sp. nov., T. nakanishii sp. nov., T: pakistanensis sp. nov. and 7: yixianensis Li & Yang, 2009. A key

to all five species is provided and their distributions mapped.

Key words. Aquatic dance flies, Empididae, Diptera, Bhutan, China, Nepal, Pakistan.

INTRODUCTION

Adults of the genus Trichoclinocera Collin, 1941 (Dip-

tera: Empididae: Clinocerinae) are normally encountered

on emergent rocks in large streams and rivers (Saigusa &

Sinclair 2016), usually where the riparian vegetation is

open overhead (Sinclair 1994). Larvae inhabit the riffle

zones, moving among the rocks and moss and the imma-

ture stages have been described (Sinclair 1994; Lanning

et al. 2020). Prior to this study, there were 40 described

species found in the Nearctic, Palearctic and Oriental

Regions (Yang et al. 2007; Li & Yang 2009; Sinclair &

Shamshev 2014; Saigusa & Sinclair 2016; Sinclair et al.

2020).

This is third in a series of papers revising the eastern

Asian species of Trichoclinocera. The first contribution

revised the species of the 7? dasyscutellum species-group

and included eight species (Sinclair & Saigusa 2005). The

second study revised the Japanese fauna and included

nine species (Saigusa & Sinclair 2016). In this study, the

species of the Trichoclinocera yixianensis species-group

are revised, presently occurring in Bhutan, China, Nepal

and Pakistan.

MATERIAL AND METHODS

This study is based on material deposited in the following

institutions: Biosystematics Laboratory, Kyushu Univer-

sity, Fukuoka, Japan (KUMEF); and Canadian National

Insect Collection, Ottawa, Canada (CNC). Label data for

primary types are cited from the top downward, with the

Received: 20.01.2021

Accepted: 11.02.2021

data from each label in quotation marks. Labels are cited

in full, with original spelling, punctuation, and date, and

label lines are delimited by a slash (/). The repository of

each type 1s given in parentheses. Secondary type data are

abridged and listed alphabetically.

Methods used in specimen preparation follow Sinclair

(1994, 1995) and Saigusa & Sinclair (2016).

Abbreviations used in the description

acr = acrostichal setulae

dc = dorsocentral setae

dm = discal medial cell

npl = notopleural setae

pal = postalar seta

ph = posthumeral seta

pprn = postpronotal setae

presut spal= presutural supar-alar setae

psut spal = postsutural supra-alar setae

R = radial vein

sctl = scutellar setae

T = tergite

Terms used for adult structures follow those of Cum-

ming & Wood (2017).

Some photographs were taken with a Leica camera

model DFC5400 using Leica Application Suite X. Addi-

tional images were taken using an Olympus SZ60 micro-

scope and camera on Xperia 1011 or Olympus BX-50

and Nikon Coolpix 995 camera. Maps were constructed

by using the location data on the specimen labels. If co-

ordinates were not present on specimen labels, the col-

lection locality data were used to estimate approximate

Corresponding editor: X. Mengual

Published: 18.02.2021

52 Toyohei Saigusa & Bradley J. Sinclair

coordinates, through the use of Google Earth® and Goo-

gle Maps®. SimpleMappr (Shorthouse 2010) was used

to plot the distribution of each species.

TAXONOMY

Trichoclinocera Collin, 1941

Trichoclinocera Collin, 1941: 237. Type species, 7’ stack-

elbergi Collin, 1941 (original designation).

Seguyella Vaillant, 1960: 179 nec Kelsey (1969: 294).

Type species, S. rostrata Vaillant, 1960 (original designa-

tion). Sinclair, 1994: 1012 (synonymy).

Acanthoclinocera Saigusa, 1965: 53. Type species,

A. dasyscutellum Saigusa, 1965 (original designation).

Sinclair, 1994: 1012 (synonymy).

Recognition. Trichoclinocera is distinguished from

other clinocerine genera by the following combination of

characters: R, setose, R, and R, normally nearly parallel,

sal

188 wm

apex of cell dm not strongly produced, M, and M, arising

separately from cell dm, fore femur with rows of ventral

setae; female abdomen truncate, with tergite 9+10 setose

(acanthophorite-like); and apex of phallus membranous,

lacking filament.

Distribution. The genus occurs in the Palearctic, Ne-

arctic and Oriental Regions.

Trichoclinocera yixianensis species-group

Recognition. These are very unusual species of 7ri-

choclinocera, characterized by long spine-like setae at

the base of the fore femora (Figs 3-4), often one-third

to one-half length of the segment; face greatly narrowed,

eyes somewhat narrowed, with facets enlarged antero-

ventrally (Fig. 2), and bacilliform sclerite extending api-

cally beyond base of clasping cercus.

Remarks. Specimens of this group were collected in

seepages and small streams with overhead canopy, in

contrast to broad streams and rivers which are the usual

habitat for Trichoclinocera (see Discussion).

Figs 1—4. Scanning Electron photographs of Trichoclinocera yixianensis Li & Yang. 1. Female head, lateral view. 2. Female head,

anterior view. 3. Male fore femur, anterior view. 4. Female fore femur, anterior view.

Bonn zoological Bulletin 70 (1): 51-65

©ZFMK

Revision of the Trichoclinocera yixianensis species-group from eastern Asia 53

nen NTU eo (

~~.

7 } 8

Figs 5—8. Habitus and forelegs of Trichoclinocera yixianensis species-group. 5. 7’ emotoi sp. nov., male habitus. 6. 7) emotoi

sp. nov., female forelegs. 7. 7’ maculata sp. nov., male habitus. 8. 7’ maculata sp. nov., male forelegs. Scale bars: Figs 6, 8 = 0.5 mm;

Figs 5, 7 = 1.0 mm.

Bonn zoological Bulletin 70 (1): 51-65 ©ZFMK

54 Toyohei Saigusa & Bradley J. Sinclair

Trichoclinocera emotoi sp. nov.

(Figs 5-6, 13, 17-18, 35, 41)

urn: lsid:zoobank.org:act:C258A922-SA4E-458D-923E-096FBIE304FD

Type material. HOLOTYPE <3, labelled: “(E. NE-

PAL)/ Thurukpa (2600m)/ 27°36' N, 87°36' E - - -/ (E.

NEPAL)/ Topke Gola (3700m)/ 27°38' N, 87°35' E”;

“June 12, 1972/ J. Emoto leg./ Kyushu Univ. Col.”;

“THOLOTYPE]/ Trichoclinocera/ emotoi/ Saigusa &

Sinclair [red label]” (KUMF). PARATYPES: NEPAL:

same data as holotype (2 6a’, 2 92, CNC; 3 da, 1 @,

KUME); Penmaten, 2600 m, 27°36' N, 87°36' E / Topke

Gola, 3700 m, 27°38' N, 87°35' E, 30.vi.1973/ H. Ma-

kihara (1 6, KUMF); NE of Thudam, 4000 m, 27°47' N

87°36! E, 25.vi.1972, H. Shima (1 3, CNC).

Recognition. This species is distinguished by the pair

of long spur-like setae mounted on a short tubercle at

the base of the fore femur, greyish legs, clear wings and

clasping cercus with broad U-shaped notch near base.

Description. Wing length 3.64.0 mm. Male. Grey-

blue pruinescence and dark legs (Fig. 5). Head narrowed

ventrally, compound eyes oval; facets enlarged antero-

ventrally. Face greatly narrowed medially, ca. width of

antennal socket, with bright whitish pruinescence; low-

er margin of face straight, lacking cleft and carina; gena

one-seventh as wide as eye height. Frons slightly darker

than face in dorsal view; vertex and ocellar triangle dark

brown, lower postocciput brown, gena lightly pruine-

scent. Ocellar seta longest among cranial setae; occiput

with 3-4 pairs of long setae posterior to ocellar triangle;

postocular with row of short setae along eye margin, up-

per 5—6 setae dark, stouter than lower setae; postgena

with numerous long, white silky setae. Arista-like sty-

lus long and slender, not tapered apically. Palpus short,

pointed apically, ca. one-fourth eye height.

Pleura grey with pale blue pruinescence; scutum grey-

ish brown with somewhat bluish lateral margins, medial-

ly paler brown in posterior view; posterolateral margin of

postpronotal lobe shiny brown; faint black vitta along in-

ner edge of dc; prescutellar depression somewhat bluish

posteromedially in posterior view. Thoracic setae long,

ca. subequal to width of eye; acrostichal setulae lacking:

5-6 dc; O-1 very short, pale pprn, at most one-fourth

length of dc, with 0-2 pale setulae; 1 presut spal; 2 npl;

2 psut spal; 1 pal; 2 pairs sctl and several pale marginal

setulae; several pale setulae on notopleural depression.

Laterotergite with patch of pale setae; prothoracic epi-

sternum with several setulae and 2 long, spine-like setae,

longer than width of fore coxa, shorter seta often pale;

anepisternum with a few pale setulae along posterior

margin; katepisternum with a few minute pale setulae;

hind margin of metepisternum with white setulae.

Wing (Fig. 35) narrow, lightly infuscate, without mark-

ings; pterostigma very narrow, faint, elliptical. One basal

costal seta, two-thirds length of posterior dc. Sparse row

of setulae from base of R to mid-length of R,; auxiliary

Bonn zoological Bulletin 70 (1): 51-65

crossvein lacking; cell dm produced apically; R, and R,

divergent apically; base of R, often with short spur vein.

Halter dark.

Legs dark, coxae with blue pruinescence, concolour-

ous with pleura. Coxae with long, pale marginal setae;

fore coxa with long pale anterolateral setae. Fore femur

(Fig. 6) distinctly swollen on basal half, with pair of setae

mounted on short single tubercle: anterior seta spur-like,

ca. one-half length of femur, posterior seta pale, thinner

and one-half length of anterior seta; anteroventral row of

ca. 20 spine-like setae extending length of femur, length

ca. one-fourth width of femur, decreasing in length api-

cally; 3-4 preapical anterior setae, longer than antero-

ventral setae; row of slender, pale posteroventral setae

extending length of femur, some subequal in length to

width of femur; 2—3 posteroventral, spine-like setae near

mid-length of femur, ca. subequal in length to width of

femur; dense, very short, white pile beneath. Fore tibia

slightly sinuous to arched in shape with row of stout setae

beneath, biserial apically; setae increasing in length api-

cally to width of tibia; row of posterodorsal setae promi-

nent on apical half. Mid femur with slender anteroventral

and posteroventral preapical setae; without anterodorsal

and posterodorsal setae. Hind femur with anteroventral

setae; without anterodorsal and posterodorsal setae. Hind

tibia without posterodorsal spur-like seta near base; 1

erect, spine-like posterodorsal preapical seta. Tarsi long-

er than corresponding tibiae. Empodium pulvilliform,

subequal in length to claw, less than half length of tar-

somere.

Abdomen concolourous with thoracic pleura in lateral

view, with mostly pale setae, darker along posterior mar-

gin. Terminalia (Figs 13, 15-16): hypandrium narrow,

cylindrical, tapered apically, 1.5x length of epandrium;

anterior margin pointed. Phallus extending beyond clasp-

ing cercus; strongly bent sub-basally; shaft narrow with

broad, expanded base; apex with cup-like opening, with

small, round, bulbous membranous swelling, slightly

wider than diameter of apex of phallus; membrane lack-

ing microtrichia; ejaculatory apodeme arched strongly

within base of phallus. Epandrium subtriangular, with

large membranous area at basal margin with hypandrium.

Surstylus slender, two-thirds length of clasping cercus,

lacking apical setae and microtrichia. Clasping cercus

finger-like, tapered on apical half; basal half with broad

U-shaped notch on dorsal margin; long, fine setae on

ventral margin; inner dorsal margin with peg-like setae

along entire length, except in notch.

Female. Similar to male including chaetotaxy of legs.

Terminalia (undissected): Tergite 9+10 with 4 straight

spine-like setae on apical margin.

Distribution. This species is confined to eastern Nepal

known from 2600-4000 m (Fig. 41), often collected to-

gether with 7? maculata sp. nov.

©ZFMK

Revision of the 7richoclinocera yixianensis species-group from eastern Asia 5D

fi €,

, s

awe

a a

ae ee |

eT a a

nition ‘. J

ATL HE OVI LE. ©

” ~

Figs 9-12. Habitus and forelegs of Trichoclinocera yixianensis species-group. 9. 7. nakanishii sp. nov., male habitus, holotype

(terminalia dissected). 10. 7. nakanishii sp. nov., male forelegs, holotype. 11. 7. pakistanensis sp. nov., male habitus, holotype (ter-

minalia dissected). 12. 7’ pakistanensis sp. nov., male forelegs, holotype. Scale bars: Figs 10, 12 = 0.5 mm; Figs 9, 11 = 1.0 mm.

Bonn zoological Bulletin 70 (1): 51-65 ©ZFMK

56 Toyohei Saigusa & Bradley J. Sinclair

Etymology. The specific epithet is named after Jun

Emoto, the collector of the holotype of this species and

many other valuable specimens.

Trichoclinocera maculata sp. nov.

(Figs 7-8, 14, 19-20, 36, 41)

urn: lsid:zoobank.org:act: 1B720600-8E64-456F-8 BC0-867360561A 19

Type material. HOLOTYPE <j, labelled: “(E. NE-

PAL) Thurukpa (2600m)/ 27°36' N, 87°36' E - - -/ Topke

Gola (3700m)/ 27°38' N, 87°35' E”; “June 12, 1972/ H.

Shima leg./ Kyushu Univ. Col.”; “[HOLOTYPE]/ 7ri-

choclinoceral maculata/ Saigusa & Sinclair [red label]”

(KUMP). PARATYPES: NEPAL: same data as holotype

(1 4, KUMF); same data as holotype except, J. Emoto

(1 3, KUMF); same data as holotype except, 9.vii.1972,

J. Emoto (1 4, CNC); Thudam, 3500-3800 m, 27°45' N

87°31' E-27°46' N 87°33’ E, 18.vi.1972, H. Shima (1 3,

CNC).

Recognition. This species is distinguished by 2-3

long, spine-like setae at the base of the fore femur, grey-

ish legs, spotted wings and auxiliary crossvein between

veins R,,, and R,.

Description. Wing length 3.5—-3.8 mm. Male. Grey-

blue pruinescence and dark legs (Fig. 7). Head narrowed

ventrally, compound eyes oval; facets enlarged antero-

ventrally. Face narrowed medially, narrower than width

of antennal sockets, with bright whitish pruinescence;

lower margin of face with short, narrow cleft, lacking ca-

rina; gena one-eighth as wide as eye height. Frons darker

than face in dorsal view; vertex and ocellar triangle dark

brown, lower postocciput brown, gena lightly pruines-

cent. Ocellar seta longest among cranial setae; occiput

with 3 pairs of long, stout setae posterior to ocellar trian-

gle; postocular with row of short setae along margin of

eye, upper 4—5 setae dark, stouter than lower setae; post-

gena with numerous long, white silky setae. Arista-like

stylus long and stout, slightly tapered apically. Palpus

tapered apically, ca. one-fourth eye height.

Pleura grey with blue pruinescence; scutum grey-

ish-brown with paler lateral margins, medially paler

brown in posterior view, bluish on postalar callus extend-

ing medially; dark vitta along inner edge of dc incon-

spicuous. Thoracic setae long, some subequal to width

of eye; acrostichal setulae lacking; 5 dc, prescutellar pair

longest; 1 short pprn, one-fourth length of dc; 1 presut

spal; 2 npl; 1—2 psut spal; 1 pal; 2 pairs sctl, without set-

ulae; several pale setulae near notopleural depression.

Laterotergite with patch of pale setae; prothoracic epi-

sternum with | dark, spine-like seta and | narrower, pale

seta, longer than width of fore coxa; anepisternum with

setulae along posterior margin; katepisternum and hind

margin of metepisternum without setulae.

Wing (Fig. 36) narrow, infuscate, with bands of cloud-

ing at basal third of wing, across apex of cell dm to R

445?

and base of R, and along auxiliary crossvein. Pterostig-

Bonn zoological Bulletin 70 (1): 51-65

ma very narrow, faint, elliptical; 1 basal costal seta, two-

thirds length of posterior dc. Row of long setulae from

base of R to mid-length of R,; auxiliary crossvein be-

tween R,,, and R,; cell dm truncate apically; R, and R,

nearly parallel-sided, somewhat divergent apically. Hal-

ter dark.

Legs dark, coxae with blue pruinescence, concolourous

with pleura. Coxae with long, dark marginal setae; fore

coxae with row of erect setae along anterolateral margin,

subequal to width of coxa. Fore femur (Fig. 8) distinctly

swollen on basal half, with 2—3 black, spine-like basal

setae, posterolateral seta less than one-fourth length of

femur; anteroventral row of ca. 20 stout, spine-like setae

extending length of femur, length ca. one-fourth width of

femur; 2—3 preapical anterior setae, longer than antero-

ventral setae; row of slender, pale posteroventral setae

extending length of femur, ca. one-half width of femur; 1

spine-like posteroventral seta near mid-length of femur,

subequal in length to basal width of femur; dense, very

short, white pile beneath. Fore tibia straight with row of

stout setae beneath, subequal to width of tibia and an-

teroventral setae of femur. Mid femur with slender an-

teroventral and posteroventral preapical setae; without

anterodorsal and posterodorsal setae. Hind femur with-

out distinct anteroventral setae; with a few anterodorsal

and posterodorsal setae. Hind tibia without posterodorsal

spur-like seta near base; several erect dorsal setae on api-

cal fourth. Tarsi longer than corresponding tibiae. Em-

podium pulvilliform, subequal in length to claw, ca. half

length of tarsomere.

Abdomen concolourous with thoracic pleura in lat-

eral view, with mostly pale setae. Terminalia (Figs 14,

19-20): hypandrium narrow, cylindrical, 1.3x length of

epandrium; anterior margin pointed. Phallus extending

beyond clasping cercus, gently arched; shaft narrow,

without basal expansion; apex with cup-like opening,

with small, tubular membrane; membrane lacking micro-

trichia; ejaculatory apodeme arched strongly anteriorly.

Epandrium with large membranous area at basal margin

with hypandrium. Surstylus slender, two-thirds length of

clasping cercus, lacking apical setae and microtrichia.

Clasping cercus finger-like, tapered throughout length to

rounded apex; base expanded posteriorly; fine setae on

ventral margin; inner dorsal margin with sharp, peg-like

setae along entire length.

Female. Unknown.

Distribution. This species is confined to eastern Ne-

pal known from 2600-3800 m near the Tibet border

(Fig. 41), often collected together with 7’ emotoi sp. nov.

Etymology. The specific epithet 1s from the Latin mac-

ulatus (spot, stain, speckle), in reference to the spotted

wings.

©ZFMK

Revision of the Trichoclinocera yixianensis species-group from eastern Asia 57

cl cerc

Figs 13-16. Male terminalia of Trichoclinocera yixianensis species-group, lateral view. 13. 7. emotoi sp. nov. 14. T. maculata

sp. nov. 15. 7. nakanishii sp. nov. 16. T: pakistanensis sp. nov. Scale bars = 0.1 mm. Abbreviations: cl cerc = clasping cercus; epand

= epandrium; hypd = hypandrium; ph = phallus; sur = surstylus.

Bonn zoological Bulletin 70 (1): 51-65 ©ZFMK

58 Toyohei Saigusa & Bradley J. Sinclair

Figs 17-22. Male terminalia of Trichoclinocera yixianensis species-group, lateral view. 17-18. 7. emotoi sp. nov. 17. Terminalia.

18. Clasping cercus. 19-20. 7. maculata sp. nov. 19. Terminalia. 20. Clasping cercus. 21—22. 7? nakanishii sp. nov. 21. Terminalia.

22. Clasping cercus. Scale bars = 0.1 mm.

Trichoclinocera nakanishii sp. nov.

(Figs 9-10, 15, 21-22, 37, 41)

urn: |sid:zoobank.org:act:6191F 70F-BA02-49F 9-BC5D-2F43ECSBB3CE

Type material. HOLOTYPE <, labelled: “(NE-

PAL)/ Chhouban, Kharka, 3400m/ 83°25' E. 28°43' N./

Sept. 28. 1971/ A. Nakanishi”; “[HOLOTYPE]/ Tricho-

clinoceral nakanishii/ Saigusa & Sinclair [red label] [dis-

sected]” (KUMP).

Recognition. This species is distinguished by three

long spine-like setae at the base of the fore femur, greyish

legs, clear wings, and shape of the clasping cercus.

Description. Wing length 3 mm. Male. Grey-blue pru-

inescence and dark brownish legs (Fig. 9). Head pointed

ventrally, compound eyes oval; facets enlarged antero-

ventrally. Face greatly narrowed medially, ca. width of

antennal socket, with bright whitish pruinescence for full

length; lower margin of face with short, narrow cleft,

lacking carina; gena one-seventh as wide as eye height.

Bonn zoological Bulletin 70 (1): 51-65

Frons greyish brown; vertex and ocellar triangle dark

brown, lower postocciput brown, gena lightly pruines-

cent. Ocellar setae longest among cranial setae; occiput

with 3 pairs of setae posterior to ocellar triangle; post-

ocular with row of short setae along margin of eye, upper

3—4 setae dark, stouter than lower setae. Arista-like stylus

short and stout, not tapered apically. Palpus pointed api-

cally, ca. one-fourth height of eye.

Pleura grey with pale blue pruinescence; scutum

brown, paler medially and on postpronotal lobe, some-

what bluish lateral margins; apex of postpronotal lobe

shiny brown, dark vitta along edge of dc inconspicuous;

prescutellar depression brown in posterior view. Thorac-

ic setae long, ca. subequal to width of eye; acrostichal

setulae lacking; 5 pairs dc; 1 very short pprn, one-fourth

length of dc; 1 presut spal; 2 npl; 1 psut spal; 1 pal; 2

pairs sctl and pairs of pale marginal setulae; several pale

setulae on postpronotal lobe and notopleural depression.

Laterotergite with patch of pale setae; prothoracic epi-

©ZFMK

Revision of the 7richoclinocera yixianensis species-group from eastern Asia 59

Figs 23—26. Habitus, forelegs and head of Trichoclinocera yixianensis Li & Yang. 23. Male habitus, lateral view (Shaanxi). 24.

Male forelegs, lateral view (Shaanxi). 25. Male habitus, lateral view (Shaanxi). 26. Female head, anterior view (Shaanxi). Scale

bars: Fig. 26 = 0.5 mm; Figs 23—25 = 1.0 mm.

Bonn zoological Bulletin 70 (1): 51-65 ©ZFMK

60 Toyohei Saigusa & Bradley J. Sinclair

Figs 27-32. Terminalia of Trichoclinocera yixianensis species-group, lateral view. 27—28. 7: pakistanensis sp. nov. 27. Male termi-

nalia, stained with Delafield hematoxyline. 28. Clasping cercus, inner view. 29-30. 7! vixianensis Li & Yang. 29. Male terminalia.

30. Clasping cercus. 31-32. 7! yixianensis Li & Yang. 31. Female terminalia. 32. Close-up of female proctiger. Scale bars: Figs 28,

30 = 0.5 mm; Figs 27, 29, 31-32 = 1.0 mm.

sternum with 1 long, spine-like seta and several pale se-

tae, longer than width of fore coxa; anepisternum with

a few pale setulae on ventral part; katepisternum with a

few minute pale setulae; hind margin of metepisternum

with | white setula.

Wing (Fig. 37) narrow, lightly infuscate, without mark-

ings; pterostigma very inconspicuous, possibly lacking.

One basal costal seta, one-half length of posterior dc.

Sparse row of setulae from base of R to mid-length of R,;

auxiliary crossvein lacking; cell dm produced apically:

R, and R, divergent. Halter knob dark, base of shaft paler.

Legs dark, brownish; coxae with blue pruinescence,

concolourous with pleura. Coxae with long, pale margin-

al setae; fore coxa with erect, pale, anterolateral setae,

longer than width of coxa. Fore femur (Fig. 10) evenly

tapered apically, except extreme base distinctly swollen;

base with 3 black, spine-like setae, anterior posterolat-

eral seta ca. one-half length of femur, remaining setae

one-third length of anterior seta; anteroventral row of

ca. 20 stout, spine-like setae extending length of femur,

Bonn zoological Bulletin 70 (1): 51-65

length less than one-fourth width of femur, decreasing

in length apically; lacking conspicuous preapical anterior

setae; row of slender, pale posteroventral setae extending

length of femur, some subequal in length to width of fe-

mur; | spine-like posteroventral seta near mid-length of

femur, subequal in length to basal width of femur; dense,

very short, white pile beneath. Fore tibia slightly arched

with row of stout setae beneath, length of some subequal

to width of tibia, shorter proximally. Mid femur with

slender anteroventral and posteroventral preapical setae;

lacking anterodorsal and posterodorsal setae. Hind femur

lacking distinct anteroventral setae; lacking anterodorsal

and posterodorsal setae. Hind tibia lacking posterodorsal

spur-like seta near base; several erect dorsal and antero-

ventral setae on apical fourth. Tarsi nearly subequal in

length to corresponding tibiae. Empodium pulvilliform,

subequal in length to claw, less than half length of tar-

somere.

Abdomen concolourous with thoracic pleura in lateral

view. Terminalia (Figs 15, 21—22): hypandrium broad ba-

©ZFMK

Revision of the 7richoclinocera yixianensis species-group from eastern Asia 61

Figs 33—34. Terminalia of Trichoclinocera yixianensis Li & Yang, lateral view. 33. Male. 34. Female. Scale bars = 0.1 mm. Abbre-

viation: T = tergite.

sally, tapered apically, nearly 1.5x length of epandrium;

anterior margin with small projection. Phallus extending

beyond clasping cercus; strongly bent subbasally; shaft

narrow with broad, expanded base; apex with cup-like

opening, with small, round, bulbous swelling of mem-

brane, slightly wider than diameter of apex of phallus;

membrane lacking microtrichia; ejaculatory apodeme

arched strongly within base of phallus. Epandrium with

large membranous area at basal margin with hypandrium.

Surstylus slender, two-thirds length of clasping cercus,

lacking apical setae and microtrichia. Clasping cercus

subtriangular, tapered apically; long, fine setae on ven-

tral margin; inner dorsal margin with peg-like setae along

entire length.

Female. Unknown.

Distribution. Known only from the holotype, collect-

ed in central Nepal, west of Pokhara (Fig. 41).

Etymology. The specific epithet is named after Akinor1

Nakanishi, the collector of the holotype of this species.

Trichoclinocera pakistanensis sp. nov.

(Figs 11-12, 16, 27—28, 38, 41)

urn: lsid:zoobank. org: act: SAF5E4C7-9802-4F 63-9297-E3780DCD499C

Type material. HOLOTYPE <, labelled: “(PAKI-

STAN) Naran/ Kagan V./ 1800m/ 22.vi1.1987/ K. Kan-

miya’; “[HOLOTYPE]/ Trichoclinocera/ pakistanensis /

Saigusa & Sinclair [red label]” (KUMF). PARATYPES:

Bonn zoological Bulletin 70 (1): 51-65

PAKISTAN: same data as holotype [34°54' N 73°39! E]

(1 9, CNC; 1 2, KUMF).

Recognition. This species is distinguished by the pair

of long spine-like setae at the base of the fore femur, very

short anteroventral setae at mid-length of fore femur hid-

den within pile, giving appearance of a broad gap, pale

yellowish-brown legs and clear wings.

Description. Wing length 3.9-4.3 mm. Male. Pale

grey-blue pruinescence and pale yellowish-brown legs

(Fig. 11). Head pointed ventrally, compound eyes oval;

facets enlarged anteroventrally. Face greatly narrowed

medially, less than width of antennal socket, with bright

whitish pruinescence for full length; lower margin of face

with short, narrow cleft, lacking carina; gena one-seventh

as wide as eye height. Frons greyish brown: vertex and

ocellar triangle dark brown, lower postocciput brown,

gena lightly pruinescent. Ocellar setae longest among

cranial setae; occiput with 3-4 pairs of setae posterior to

ocellar triangle; postocular with row of short setae along

margin of eye, upper 3—4 setae dark, stouter than lower

setae. Arista lost in type series. Palpus pointed apically,

ca. one-fourth height of eye.

Pleura grey with pale grey-blue pruinescence; scutum

brown with pale, somewhat bluish lateral margins and

median paler stripe extending full length of scutum; post-

pronotal lobe and postalar callus paler brown; faint dark

vitta along inner edge of dc in dorsal view. Thoracic setae

long, some subequal to width of eye; acrostichal setulae

©ZFMK

62 Toyohei Saigusa & Bradley J. Sinclair

lacking; 5 pairs dc; 1 very short, pale pprn, one-fourth

length of dc; 1 presut spal; 2 npl; 2 psut spal; 1 pal; 2 pairs

sctl, lacking setulae; several pale setulae on postpronotal

lobe and notopleural depression. Laterotergite with patch

of pale setae; prothoracic episternum without spine-like

setae; anepisternum with posterior setulae; katepister-

num without setulae; hind margin of metepisternum with

white setulae.

Wing (Fig. 38) narrow, lightly infuscate, without mark-

ings; pterostigma very narrow, faint, elliptical. One basal

costal seta, one-half length of posterior dc. Sparse row

of setulae from base of R to mid-length of R,; auxiliary

crossvein lacking; cell dm produced apically; R, and R,

divergent. Halter pale brown.

Legs yellowish-brown, darker towards tarsi, coxae

with faint blue pruinescence. Coxae with long, pale mar-

ginal setae; fore coxa with long, pale anterolateral setae,

shorter than width of coxa. Fore femur (Fig. 12) distinct-

ly swollen, tapered apically evenly throughout; base with

2 black, spine-like setae, posterolateral seta ca. one-third

length of femur, anterolateral seta thinner and one-half

length of posterolateral seta; anteroventral row of stout,

spine-like setae extending length of femur, setae very

short medially hidden within pile, setae of apical and bas-

al fourth pronounced ca. one-fourth width of femur; 5—6

slender, preapical anterior setae, longer than anteroven-

tral setae; row of slender, pale posteroventral setae ex-

tending length of femur, length less than width of femur;

without spine-like, posteroventral setae near mid-length;

Bonn zoological Bulletin 70 (1): 51-65

| at

Figs 35—40. Wings of Trichoclinocera yixianensis species-group. 35. T. emotoi sp. nov. 36. 7: maculata sp. nov. 37. T. nakanishii

sp. nov., holotype. 38. 7. pakistanensis sp. nov. 39. T! yixianensis Li & Yang (Bhutan). 40. 7. yixianensis Li & Yang (Shaanxi). Scale

bars = 1.0 mm. Abbreviations: R,,, = second branch of radius; R, = upper branch of third branch of radius.

dense, very long, white pile beneath. Fore tibia straight to

distinctly curved, with row of stout setae beneath, near-

ly subequal in length to width of tibia; apical third with

long spine-like seta, 2x width of tibia. Mid femur with

slender anteroventral and posteroventral preapical setae;

lacking anterodorsal and posterodorsal setae. Hind femur

without distinct anteroventral setae; lacking anterodorsal

and posterodorsal setae. Hind tibia without posterodorsal

spur-like seta near base; 2—3 erect, dorsal spine-like setae

and | similar ventral seta on apical fourth. Tarsi one-third

to one-half longer than corresponding tibiae. Empodium

pulvilliform, subequal in length to claw, less than half

length of tarsomere.

Abdomen concolourous with thoracic pleura in lateral

view. Terminalia (Figs 16, 27—28): hypandrium slender,

tapered apically, subequal in length to epandrium; ante-

rior margin rounded. Phallus extended slightly beyond

clasping cercus; straight beyond base; shaft narrow with

expanded base; apex with small, round, membranous

swelling; membrane lacking microtrichia; ejaculatory

apodeme arched within base of phallus. Epandrium sub-

triangular, with large membranous area at basal margin

with hypandrium. Surstylus slender, slightly shorter than

length of clasping cercus, lacking apical setae or long mi-

crotrichia. Clasping cercus broad, subtriangular, tapered

apically; long, fine setae on ventral margin; inner dorsal

margin lacking peg-like setae.

©ZFMK

Revision of the 7richoclinocera yixianensis species-group from eastern Asia 63

Fig. 41. Known distribution of the Trichoclinocera yixianensis species-group.

Female. Similar to male including chaetotaxy of legs;

posterolateral basal seta of fore femur more than one-

third length of femur.

Distribution. Known only from the type locality in the

western Himalayas (Fig. 41).

Etymology. The specific epithet is in reference to the

country of the type locality.

Trichoclinocera yixianensis Li & Yang, 2009

(Figs 1-4, 23-26, 29-30, 33-34, 39-41)

Trichoclinocera yixianensis Li & Yang, 2009: 134. Type

locality: China: Henan, Yixian, Huaguoshan Mountain

[34°18' N 111°50' E].

Material examined. BHUTAN: E of Jilay La

[27°22' N 89°22' E], 3000 m, 19.vili.1993, T. Saigusa

(1 3, KUMF). CHINA: Shaanxi: Zuoshui-x, Brook nr

tunnel, Hetaoping [33°47' N 108°54' E], 1650-1750 m,

20.vi.1997, T. Saigusa (4 43, 1 9, CNC; 21 3g, 24 29,

KUMEF); Zuoshui-x, Brook nr tunnel, Hetaoping 1650-—

1750 m, 20.vi.1997, T. Saigusa (1 9, KUMF); Fuping-x,

Bridge 3 km NW of Donghetai [33°41' N 107°57' E],

1500 m, 28.vi.1997, T. Saigusa (12 do, 5 299, KUMF);

Fuping-x, Dadianzi, 1850-1960 m, 5 km N of Donghe-

tai, 8.vii.1997, T. Saigusa (2 ¢¢, 3 99, KUMF); Fup-

ing-x, Daping-Huanmuqiao, 1550-1600 m, WNW of

Donghetai, 28.vi.1997, T. Saigusa (1 9, CNC); Fuping-x,

Bonn zoological Bulletin 70 (1): 51-65

Daping-Huanmugqiao, 1500-1600 m, WNW of Donghe-

tai, 28.vi.1997, T. Saigusa (3 6, 1 2, KUMF); Fup-

ing-x, Huanmuqiao, 1600-1700 m, WNW of Donghetai,

28.vi.1997, T. Saigusa (2 do, 1 9, CNC; 1 &, 3 29,

KUMEF); Fuping-x, Wangkoushang, 1450 m, 2 km NE

Donghetai, 25.vi.1997, T. Saigusa (2 99°, KUMEF):; Zu-

oshui-x, W of Hetaoping, 1500-1550 m, 10.vil.1997, T.

Saigusa (6 Jo, 3 29, KUMF); Zuoshui-x, Yingpan-lin-

chang [33°50' N 108°50' E], 1850 m, 10.vit.1997, T.

Saigusa (4 ¢¢, 5 99, KUMF); Fuping-x, Liangfengya,

2000-2100 m, 12 km WNW Longcaoping [33°41' N

107°56' E], 24.vi.1997, T. Saigusa (7 3, 1 9, KUMF).

Sichuan: Jingding, 2900-3030 m, Emeishan [29°30' N

103°40' E], 8.viii.1998, T. Saigusa (2 bo, 1 9, CNC:

5 33,10 92, KUMF). Yunnan: Zhongdian, Tuomunan

[27°20' N 99°59' E], 3030-3500 m, 42 km N Qiaotou,

11.vi.1996, T. Saigusa (1 4, KUMF).

Recognition. This species is distinguished by the three

long spine-like setae at the base of the fore femur and

apical half with 4—5 spine-like posteroventral setae, gen-

erally pale yellowish-brown legs, elongate hypandrium

and clear wings.

Redescription. Wing length 3.9-4.4 mm. Male.

Pale grey-blue pruinescence and yellowish-brown legs

(Figs 23, 25). Head pointed ventrally, compound eyes

oval; facets enlarged anteriorly (e.g., Fig. 26). Face great-

ly narrowed medially, less than width of antennal socket,

with bright whitish pruinescence for full length; lower

©ZFMK

64 Toyohei Saigusa & Bradley J. Sinclair

margin of face with short, narrow cleft, lacking carina;

gena one-seventh as wide as height of eye. Frons slightly

darker than face; vertex and ocellar triangle dark brown,

lower postocciput brown, gena lightly pruinescent. Ocel-

lar setae longest among cranial setae; occiput with 3-4

pairs of setae posterior to ocellar triangle; postocular with

row of short setae along margin of eye, upper 3—4 setae

dark, stouter than lower setae. Arista-like stylus long and

slender, somewhat tapered apically. Palpus pointed api-

cally, ca. one-fourth height of eye.

Pleura brownish with pale grey-blue pruinescence;

scutum brown with pale, somewhat bluish lateral mar-

gins; posterolateral margin of postpronotal lobe shiny

brown; black vitta along inner edge of dc inconspicu-

ous. Thoracic setae long, some subequal to width of eye:

acrostichal setulae lacking; 5 pairs dc; 1 pprn reduced

to black or pale setula, very short, inconspicuous; | pre-

sut spal; 2 npl, lower slender; 1—2 psut spal, anterior

more slender and shorter than posterior; 1 pal; 2 pairs

sctl, lacking setulae; several pale setulae on postpronotal

lobe and notopleural depression. Laterotergite with patch

of pale setae; prothoracic episternum with pair of pale

spine-like setae; anepisternum with short pale posterior

setulae; katepisternum and hind margin of metepister-

num with pale setulae.

Wing (Figs 39, 40) narrow, lightly infuscate, lacking

markings; pterostigma very narrow, faint, elliptical. One

basal costal seta, one-half length of posterior dc. Row

of setulae extending from base of R to just beyond Rs

branching; auxiliary crossvein lacking; cell dm _ pro-

duced apically; R, and R, divergent throughout; base

of R, with small spur. Halter dark, except extreme base

orange-brown.

Legs yellowish-brown, tarsi darker towards tips, coxae

with faint blue pruinescence, especially darker on fore

coxa. Coxae with long, pale marginal setae; fore coxa

with long pale anterolateral setae. Fore femur (Figs 3, 24)

distinctly swollen, tapered apically evenly throughout:

base with 3 black, spine-like setae, posterolateral seta ca.

one-half length of femur, anterolateral and posterior se-

tae thinner and one-half length of posterolateral seta; an-

teroventral row of short, stout spine-like setae extending

length of femur, becoming stouter apically, setae longer

than pile; 5—6 slender, preapical anterior setae, longer

than anteroventral setae; row of slender, pale postero-

ventral setae extending length of femur, length less than

width of femur; apical half with 4—5 spine-like, postero-

ventral setae, basal seta ca. two-thirds width of femur, re-

maining setae decreasing in length apically; dense, long,

white pile beneath. Fore tibia slightly curved with row

of stout setae beneath, length ca. one-half width of tibia;

setae of equal length, except apical seta. Mid femur with

1 (sometimes 2) pairs of spur-like anteroventral and pos-

teroventral preapical setae; lacking anterodorsal and pos-

terodorsal setae. Hind femur with | preapical anteroven-

tral seta; lacking anterodorsal and posterodorsal setae.

Bonn zoological Bulletin 70 (1): 51-65

Hind tibia without spur-like posterodorsal seta near base;

sometimes spur-like, dorsal seta on apical fourth; erect

dorsal and ventral spine-like setae on apical third. Tarsi

ca. one-third longer than corresponding tibia. Empodium

pulvilliform, shorter than length of claw, less than half

length of tarsomere.

Abdomen concolourous with thoracic pleura in lateral

view, with mostly dark setae in dorsal view. Terminalia

(Figs 29-30, 33): hypandrium slender, slightly tapered

apically, nearly 1.3x length of epandrium; anterior mar-

gin somewhat pointed. Phallus extending slightly be-

yond clasping cercus; gradually arched to strongly bent

subbasally; shaft narrow with expanded base; apex with

cup-like opening, with small, round, bulbous swell-

ing of membrane, slightly wider than diameter of apex

of phallus; membrane lacking microtrichia; ejaculatory

apodeme arched within base of phallus. Epandrium sub-

triangular, with large membranous area at basal margin

with hypandrium. Surstylus slender, two-thirds length of

clasping cercus, lacking apical setae or long microtrich-

ia. Clasping cercus narrow, digitiform, tapered apically;

long, fine setae on ventral margin; inner dorsal margin

lacking peg-like setae.

Female. Similar to male including chaetotaxy of legs

(Fig. 4). Sclerites of segment 8 not overlapped laterally

(Figs 31, 34); T8 with posterior row of long and short

setae, T9+10 with stout, curved setae along inner mar-

gin, with apical setae more stout than remaining setae

(Fig. 32); anteroventral corner of T9+10 narrowed and

prolonged obliquely.

Distribution. This is the most widespread species of

this group, found in Bhutan and China (Henan, Shaanx1,

Sichuan, Yunnan) (Fig. 41).

Key to species of the 7. yixianensis species-group

1 Wings spotted and auxiliary crossvein between R,

and R,,, present (Figs 7, 36) ...... maculata sp. nov.

— Wings not spotted and without auxiliary crossvein

between R, and R,,, (Figs 35, 37-40) oo... 2

2. Whe os danke Pie Soo, -O-. bs oS eo Re ee moot 4

Legs yellowish-brown (Figs 11-12, 23-25) .......... 3

3 Fore femur with posteroventral spine-like seta near

mid-length (Figs 3, 24); mid femur with one pair

of stout preapical anteroventral and posteroventral

setae; anteroventral setae at mid-length of fore

femur extending beyond pile (Fig. 24); clasping

cercus narrow, digitiform, with slender inner setae

CET NS OI" Naas Scsrecul estat sions! T. yixianensis Li & Yang

— Fore femur without posteroventral spine-like seta

near mid-length (Fig. 12); mid femur without pair

of stout preapical anteroventral and posteroventral

setae; anteroventral setae at mid-length of fore

femur hidden within pile (Fig. 12); clasping cercus

subtriangular, with stout inner setae (Fig. 28) ..........

Poem Ae ata ells Asay et AIC os nr T. pakistanensis sp. nov.

©ZFMK

Revision of the Trichoclinocera yixianensis species-group from eastern Asia 65

4 Fore femur with pair of stout setae mounted on

short tubercles (Fig. 6); clasping cercus finger-like,

tapered on apically half, with broad U-shaped notch

AtDaSey Gigs Wise un ee anata T. emotoi sp. nov.

— Fore femur with pair of stout setae not mounted

on short tubercles (Fig. 10); clasping cercus

subtriangular, tapered apically, without U-shaped

notch at base (Figs 15, 22) .... 2 nakanishii sp. nov.

DISCUSSION

There are now 44 described species of Trichoclinocera

worldwide, of which 28 species are known from the

eastern Palearctic and Oriental Regions. Currently most

species are recorded from the Himalayas with eight spe-

cies and Japan with nine species. An additional 26 unde-

scribed species from species-groups not yet treated have

been identified by the authors.

Adults of Trichoclinocera normally occur on large,

emergent rocks or boulders in fast flowing streams and

rivers together with other clinocerine genera. But excep-

tions have been noted and summarized as follows: adults

of two Japanese species (1. miranda Saigusa & Sinclair,

2016 and 7: shinogii Saigusa & Sinclair, 2016) were ob-

served on moist sand close to water of slowly moving

rivers, or on pebbles in shallow streamlets partially sep-

arated from the main river, a rather unusual habitat for

this genus. The first author notes that 7. dasyscutellum

(Saigusa, 1965) has almost always been collected along

narrow, shallow streamlets in forests, whereas adults

of 7: vixianensis were surprisingly collected on vertical

rock seepages and steeply inclined or cliff-like surfaces

of small streams.

Sinclair (1994) initially recognized six species-groups

of Trichoclinocera in a revision of the Nearctic spe-

cles (comata, dasyscutellum, dolicheretma, lapponica,

longipes, stackelbergi groups). Some of the definitions

of these groups were re-evaluated by Saigusa & Sin-

clair (2016), with the 7’ /ongipes species-group trans-

ferred into an expanded concept of the 7’ stackelbergi

species-group. Most described and undescribed Palearc-

tic and Oriental species are assigned to the 7’ apponica

Species-group. In the present study, the 7’ yixianensis

Species-group 1s newly described for a morphologically

unusual group of Palearctic/ Oriental species. A small

group of species related to 77 maewa Smith, 1965 appear

to form an additional species-group, defined on the basis

of a cluster of spicule-like projections near the apex of

the phallus. Future studies will focus on this latter group,

as well as new species in the 7! Japponica and T: stackel-

bergi species-groups.

Acknowledgements. The following collectors kindly provided

specimens to the first author: J. Emoto, K. Kanmiya, the late A.

Nakanishi and H. Shima. Scanning electron photographs were

Bonn zoological Bulletin 70 (1): 51-65

produced by T. Tachi and A. Tachi (Kyushu University). Two

anonymous reviewers kindly commented on the manuscript.

REFERENCES

Collin JE (1941) Some Pipunculidae and Empididae from the

Ussuri region on the far eastern border of the U.S.S.R. (Dip-

tera). Proceedings of the Entomological Society of London

(B) 10: 218-248. https://doi.org/10.1111/).1365-3113.1941.

tb00684.x

Cumming JM, Wood DM (2017) [Chapter] 3. Adult morpholo-

gy and terminology. Pp. 89-133 in Kirk-Spriggs AH, Sinclair

BJ (eds) Manual of Afrotropical Diptera. Volume 1. Introduc-

tory chapters and keys to Diptera families. Suricata 4, South

African National Biodiversity Institute, Pretoria

Kelsey LP (1969) A revision of the Scenopinidae (Diptera) of

the World. United States National Museum Bulletin 277:

1-336

Lanning SW, Sinclair BJ, Mabee WR, Combes, MD (2020) 7ri-

choclinocera (Diptera: Empididae): a new aquatic dance fly

record for Missouri. Transactions of the Missouri Academy

of Science 47: 18—20. https://doi.org/10.30956/MAS-28R1

Li Z, Yang D (2009) A new species of Trichoclinocera Collin

(Diptera: Empididae) from China. Aquatic Insects 31: 133-

137. https://doi.org/10.1080/01650420802623778

Saigusa T (1965) Two new species of Clinocerinae from Japan

(Diptera, Empididae). Kontya 33: 53-57

Saigusa T, Sinclair BJ (2016) Revision of the Japanese species

of Trichoclinocera Collin (Diptera: Empididae: Clinoceri-

nae). Zootaxa 4103: 201-229. https://doi.org/10.11646/zoo-

taxa.4103.3.1

Shorthouse DP (2010) SimpleMappr, an online tool to produce

publication-quality point maps. Online at http://www.simple-

mappr.net [last accessed on 8 Feb. 2021]

Sinclair BJ (1994) Revision of the Nearctic species of 7ri-

choclinocera Collin (Diptera: Empididae; Clinocerinae).

The Canadian Entomologist 126: 1007-1059. https://doi.

org/10.4039/Ent126 1007-4

Sinclair BJ (1995) Generic revision of the Clinocerinae (Empi-

didae), and description and phylogenetic relationships of the

Trichopezinae, new status (Diptera: Empidoidea). The Ca-

nadian Entomologist 127: 665-752. https://doi.org/10.4039/

Ent127665-5

Sinclair BJ, Saigusa T (2005) Revision of the Trichoclinocera

dasyscutellum group from East Asia (Diptera: Empididae:

Clinocerinae). Bonner zoologische Beitrage 53 (2004) (1-2):

193-209.

Sinclair BJ, Shamshev IV (2014) Review of Clinocerinae (Dip-

tera: Empididae) from the Caucasus, with description of

three new species. Proceedings of the Zoological Institute

RAS 318: 40-47

Sinclair BJ, Shamshev IV, Gattolliat J-L (2020) Revision of

the aquatic dance flies (Diptera: Empididae: Clinocerinae)

described by F. Vaillant in two 1960 publications. Bonn zoo-

logical Bulletin 69 (2): 263-274. https://doi.org/10.20363/

BZB-2020.69.2.263

Vaillant F (1960) Quelques Empididae Atalantinae d’ Asie russe

[Dipt.]. Bulletin de la Société entomologique de France 65:

170-186

Yang D, Zhang K, Yao G, Zhang J (2007) World Catalog of

Empididae (Insecta: Diptera). China Agricultural University

Press, Beijing.

©ZFMK

BHL

Blank Page Digitally Inserted

Bonn zoological Bulletin 70 (1): 63-65

2021 - Jablonski D. & Masroor R.

https://do1.org/10.20363/BZB-2021.70.1.063

ISSN 2190-7307

http://www.zoologicalbulletin.de

Scientific Note

urn:|sid:zoobank.org: pub:C63D45 10-C397-46D3-A3C9-FF57B6C9E0C9

First record of Eremias kakari Masroor et al., 2020

(Squamata: Lacertidae) for Afghanistan

Daniel Jablonski'* & Rafaqat Masroor’

' Department of Zoology, Comenius University in Bratislava, Ilkovicova 6, Mlynska dolina, Bratislava, Slovakia

?Zoological Sciences Division, Pakistan Museum of Natural History, Garden Avenue, Shakarparian, Islamabad,

Pakistan

“Corresponding author: Email: daniel. jablonski@Quniba.sk

'urn:|sid:zoobank. org:author:B624407A-7A F2-487 1-9B03-C0A694959B8A

2urn:lsid:zoobank.org:author:76A 7CDF5-578E-4580-9 1 EA-O2DD6804DA59

Abstract. The presented paper reports on the first record of Eremias kakari Masroor, Khisroon, Khan, Jablonski, 2020

for Afghanistan based on morphological data obtained from one specimen stored for 49 years in the Zoological Research

Museum Alexander Koenig, Bonn, Germany. Up to now, the species was known only from the type locality in Pakistani

Balochistan.

Key words. Central Asia, endemism, faunistics, morphology, range extension, Reptilia.

The recently described new species of the genus Eremias

Fitzinger, 1834 (Squamata: Lacertidae), E. kakari Mas-

roor, Khisroon, Khan, Jablonski, 2020, was considered

as an endemic lizard, collected in the vicinity of Tanishpa

village (31.1869° N, 68.4126° E), Torghar, Toba Kakar

Range in the Sulaiman Mountains, at an elevation around

2,500 m a.s.l. (Masroor et al. 2020), a remote area of

Pakistani Balochistan. This species is a member of the

subgenus Rhabderemias Lantz, 1928 and is a morpholog-

ically and genetically well-defined species. Based on a

multilocus dataset of mitochondrial and nuclear markers,

E. kakari forms the sister taxon to a clade comprising the

closely related species E. scripta Strauch, 1867 and E.

cholistanica Baig & Masroor, 2006 (Khan et al. 2021).

The species is characterized by having a single row of

subdigital lamellae and a complete row of lateral scales

with an overall three scales around the penultimate pha-

lanx of the 4" toe. Eremias kakari is similar to E.. fasciata

but can be distinguished from it by having 22—26 sub-

digital lamellae under 4" toe, 48—55 dorsal scales across

midbody, ventrals in 11-14 oblique longitudinal series

across the belly, 17—21 femoral pores, and 17—21 scales

in the 9"—10" caudal annulus. This species is known only

from 13 specimens deposited in the Pakistan Museum of

Natural History (PMNH), Islamabad, Pakistan. Because

the type locality of FE. kakari is close to the border with

Afghanistan (ca 60 km), and the same mountain range

(Shinkay Ghar, Sulatman Mountains) traverses through

both countries, its presence in Afghanistan was expected

(Masroor et al. 2020). Most of the territory of Afghani-

Received: 09.01.2021

Accepted: 18.02.2021

stan is, however, inaccessible due to the long-time pres-

ence of political instability and therefore field research is

almost impossible to carry out. The current herpetologi-

cal research in Afghanistan is thus based mostly on the

historical museum collections (see Wagner et al. 2016;

Jablonski et al. 2019a) which is also the case of this con-

tribution. In this scientific note, we provide the first re-

cord of E. kakari for the territory of Afghanistan based on

a specimen stored for 49 years in the museum collection

of the Zoological Research Museum Alexander Koenig,

Bonn, Germany (ZFMK).

This single specimen of FE. kakari (ZFMK-H 8553; cur-

rently stored as E. fasciata) was collected in Urgun, Pak-

tika Province (32.858° N, 69.146° E, ~2300 m a.s.l.)

during July 1972 by Clas Naumann, the former director

of the ZFMK who carried out zoological research in Af-

ghanistan. The examined specimen is an adult male with

the following morphological characters that fully corre-

spond with the diagnostic characters of E. kakari pre-

sented by Masroor et al. (2020; measurements in mm):

snout-vent length (SVL = 58.32), tail length (TL = 91.0),

head length (HL = 12.93), head width (HW = 6.74), head

height (HH = 6.60), trunk length (TrL = 18.41), hindlimb

length (HLL = 32.27), femur length (FL= 8.7), crus length

(CL = 8.24), forelimb length (FLL = 20.7), length of hu-

merus and radius (HRL = 12.35), length of femoral pore

row (LFPR = 7.29), width of space between femoral pore

rows (LFPS = 1.8), length of frontal scale (FrL = 3.2),

maximum width of frontal scale (FrW = 2.4), length of

pileus (Lpil = 12.24), head length from snout tip to the

Corresponding editor: W. Bohme

Published: 26.02.2021

64 Daniel Jablonski & Rafaqat Masroor

1cm

Fig. 1. The specimen of Eremias kakari (ZFMK-H 8553) from Urgun, Paktika Province, Afghanistan. A. Dorsal view on the body.

B. Ventral view. C—F. Details on parts of the head. C. Dorsal parts. D. Ventral parts. E—F. Lateral parts.

anterior edge of collar (NL = 16.5), length of supranasal

suture (SNL = 0.5), length of frontonasal (FNL = 1.5),

length of prefrontal (PFL = 1.56), width of prefrontal

(PFW = 1.45), number of supralabials (SL = 10), num-

ber of infralabials (IL = 7), number of dorsal scales on

midbody (DS = 49), maximum number of scales across

mid-belly in a single row in the widest part (VL = 12),

number of ventral scales in a single row (VT = 32), gu-

lars, from chin shields to the collar (G = 26), number of

collar scales (C = 8), scales around ninth and tenth cau-

dal whorl posterior to the vent (NCWS = 18), number of

supralabials anterior to subocular (SLAS = 6), number

of femoral pores (FP = 17), number of scales separating

femoral pore rows (FPS = 4), subdigital lamellae under

Ath toe (SDLT 4" = 23), number of scales around 4th toe

at penultimate phalanx (SA 4" = 3), subdigital lamellae

under 4th finger (SDLF 4" = 16), contact of fifth maxil-

lary/chin shield with infralabial (FMIL = yes), subocular

in contact with a mouth (SOM = yes), contact of frontal

and supraoculars (FSO = no), contact of infranasal with

rostral (INTR = yes).

After the description of EF. kakari, we found the

above-mentioned museum specimen ZFMK-H 8553,

morphologically determined as E. fasciata. The collect-

Bonn zoological Bulletin 70 (1): 63-65

ing locality of the specimen is, however, far away from

the known records of E. fasciata (~400 km airline) in the

Afghan part of the Sistan Basin (see Wagner et al. 2016

and Fig. 2 of this study). We have considered it as a re-

markable range extension of £. fasciata for the country

suggesting that the collected specimen ZFMK-H 8553

could be a different species. Due to the relatively close

distance to the type locality of EF. kakari (~200 km air-

line) and its presence in the same mountain range, we

correctly expected that it could be conspecific to E. kaka-

ri. Moreover, ZFMK-H 8553 was collected in an area

that does not represent the typical habitats known for

E. fasciata. Eremias fasciata is characteristic for rather

lower-lying desert areas, where it inhabits gravely hama-

da, salt-encrusted silt, drifting loess, silty alluvium, and

sandy plains with bushes (Anderson 1999, Khan 2006),

while F. kakari 1s, based on current information, mostly

a mountain species inhabiting rocky habitats (Masroor

et al. 2020). Such habitat characteristic for FE. fasciata

corresponds with the environment in the Sistan Basin,

and for E. kakari in Urgun, respectively.

Interestingly, specimens of E. fasciata from southern

Afghanistan differ also morphologically (e.g., number

of dark stripes on the body) from the original species

©ZFMK

First record of Eremias kakari Masroor et al., 2020 for Afghanistan 65

_ _ Sistan Basin

¥ ~ Papet

“\

wap uate! /

te. AEN

- =China

{SOR

Nr Besce,

Lo eee

—___—_—

By eine.

ie Ete

Fig. 2. The distribution records of Eremias kakari (ZFMK-H 8553) and E. fasciata from Afghanistan with the designation and the

airline distance of the type locality of E. kakari from Tanishpa in Pakistan and from the nearest records of E. fasciata from the

Sistan Basin in Afghanistan (Wagner et al. 2016): 1 =6 km NW Delaran, Farah Province (CAS 120400-04); 2 = 64 km W Kanda-

har, Kandahar Province (CAS 120398-99); 3 = Pirzada, Kandahar Province (ZMUC R-4594); 4 = 5 mi downstream from Girishk,

Dasht-i-Margo Area, Chah-i-Angir, Helmand Province (CAS 84684-88); 5 = 56 km S and 10 km E of Darweshan, Helmand Prov-

ince (CAS 120397). CAS = California Academy of Sciences, USA; ZMUC = Zoological Museum, University of Copenhagen,

Denmark.

description from the Iranian type locality in Saidabad,

southwest of Kerman (Anderson 1999). Therefore, the

situation needs further integrative research to find out

whether the morphological variability in EF. fasciata is

only environmentally inducted or whether divergent evo-

lution takes place. Nevertheless, &. kakari is the 106"

species of reptile fauna recorded from Afghanistan, 17"

species in the family Lacertidae and 13" species of the

genus Eremias (see Jablonski et al. 2019b).

Acknowledgements. We are thankful to Morris Flecks

(ZFMK) who provided us information and photographs of the

Specimen and two reviewers for their comments that improved

the first version of the manuscript. This study was supported by

the Slovak Research and Development Agency under contract

no. APVV-19-0076.

Bonn zoological Bulletin 70 (1): 63-65

REFERENCES

Anderson SC (1999) The Lizards of Iran. Contributions to Her-

petology, Vol. 15. Society for the Study of Amphibians and

Reptiles, New York

Jablonski D, UroSevic A, Andjelkovi¢ M, DZzuki¢ G (2019a) An

unknown collection of lizards from Afghanistan. ZooKeys

843: 129-147

Jablonski D, Regan JM, Holzheuser C, Farooqi J, Basit A, Mas-

roor R (2019b) Additional data to the herpetofauna of Af-

ghanistan. Herpetozoa 32: 177-193

Khan MA, Jablonski D, Nadeem MS, Masroor R, Kehlmaier C,

Spitzweg C, Fritz U (2021) Molecular phylogeny of Eremias

spp. from Pakistan contributes to a better understanding of

the diversity of racerunners. Journal of Zoological Systemat-

ics and Evolutionary Research 59: 466-483

Khan MS (2006) Amphibians and Reptiles of Pakistan. Krieger

Publishing Company, Malabar, Florida

Masroor R, Khisroon M, Khan MA, Jablonski D (2020) A new

species of Eremias (Squamata: Lacertidae) from the arid

mountains of Pakistan. Zootaxa 4786: 101-121

Wagner P, Bauer AM, Leviton AE, Wilms TM, Bohme W

(2016) A Checklist of the amphibians and reptiles of Af-

ghanistan — Exploring herpetodiversity using biodiversity ar-

chives. Proceedings of the Californian Academy of Sciences

63: 457-565

©ZFMK

BHL

Blank Page Digitally Inserted

Bonn zoological Bulletin 70 (1): 67-84

2021 - Bartak M. et al.

https://do1.org/10.20363/BZB-2021.70.1.067

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:|sid:zoobank.org:pub:B885A4CC-7 1 ED-45F5-8BB3-08A D5 DOFO0C6

SEM morphology and courtship rituals of a new species of Rhamphomyia

(Diptera: Empididae: Empidinae)

from the Kashmir Himalayas (India)

Miroslav Bartak', Shahid Ali Akbar” *, Mariusz Kantursk?, Aijaz Ahmad Wachkoo‘* & Amir Maqbool*

'Czech University of Life Sciences, Faculty of Agrobiology, Food and Natural Resources, Department of Zoology and Fisheries,

Kamycka 129, 165 00 Praha 6 — CZ-Suchdol, Czech Republic

? Division of Plant Protection; Department of Entomology, Central Institute of Temperate Horticulture, Srinagar,

Jammu and Kashmir — IN-191132, India

>Zoology Research Team, Institute of Biology, Biotechnology and Environmental Protection, Faculty of Natural Sciences,

University of Silesia in Katowice, Bankowa 9, PL-40-007 Katowice, Poland

*Department of Zoology, Government Degree College, Shopian, Jammu and Kashmir — IN-192303, India

° Department of Zoology, Government College for Women, M.A. Road, Srinagar, Jammu and Kashmir — IN-190001, India

“Corresponding author: Email: kingakbarali@gmail.com

'urn:Isid:zoobank. org:author:053CF9E7-44BB-43D5-BB79-2F5DD9962899

2urn:Isid:zoobank.org:author: 5AOAC4C2-B427-43A D-840E-7BB4F2565A 8B

3urn:lsid:zoobank.org:author:78C290A3-D07B-4A F9-9358-ED8C05A702BF

“urn:|sid:zoobank. org:author:6F 19EB1 F-5DDC-4722-BBD3-F75C29F901 D9

-urn:lsid:zoobank.org:author:3B24A69F-B725-4A7F-A917-1B760AB6AE88

Abstract. Rhamphomyia bhagati Bartak, Akbar, Kanturski, Wachkoo & Maqbool sp. nov. (Diptera: Empididae) is descri-

bed and illustrated based on male and female specimens. The discovery marks the first record of the genus Rhamphomyia

from the Kashmir Valley. Scanning Electron Microscopy (SEM) analysis was carried out to elucidate the general morpho-

logy and sensilla of the male and female specimens. The species is most prevalent during April and early May. The male

provides female with a nutritious prey, as a courtship gift through a series of rituals discussed herewith.

Keywords. Empididae, Rhamphomyia, courtship, Kashmir valley, India, new species.

INTRODUCTION

Empidinae (Diptera: Empididae) is a subfamily of dipter-

an flies with over 3,000 described species and many still

undescribed (Thompson 2005; Yang et al. 2007; Pape

et al. 2011). These flies occur worldwide with majorities

found in the Holarctic region, exhibit enormous structur-

al diversity and inhabit a broad range of biotopes (Sin-

clair & Cumming 2006; Moulton & Wiegmann 2007).

These are commonly known as balloon or dance flies,

which characterizes their elaborate mating displays, ae-

rial swarming, nuptial gift transfers, and other courtship

rituals (Cumming 1994).

The subfamily is divided into two tribes (1.e., Empidini

and Hilarini) centered on three megadiverse genera: Emp-

is Linnaeus, 1758, Rhamphomyia Meigen, 1822 (tribe

Empidini), and Hilara Meigen, 1822 (tribe Hilarini),

and around 27 other smaller genera (Watts et al. 2016).

Large gaps in the taxonomic knowledge of the subfamily

remain for most regions of the world, especially in the

Received: 07.10.2020

Accepted: 02.03.2021

Southern Hemisphere (Sinclair & Cumming 2006). Lim-

ited literature is also available on the Indian fauna. Apart

from some old works by Walker (1849), Bigot (1889),

Bezzi (1904), Brunetti (1913, 1917, 1920) and Collin

(1960), no recent pertinent literature is available. Of 57

species of Indian Empididae, the subfamily Empidinae

in India currently comprises about 20 species belonging

to four genera (Brunetti 1920; Collin 1960; Alfred et al.

1998; Mitra et al. 2015); however, like other Indian flies

these have not been the subject of a dedicated study and

the true number of species is still unknown (Shah et al.

2014; Wachkoo et al. 2017).

The megadiverse genus Rhamphomyia is the most spe-

ciose of dance flies, currently represented by almost 610

known species globally (Bartak & Kubik 2012; Saigusa

2012; Bartak et al. 2014; Rhodén & Wahlberg 2020), and

with many unpublished records, likely to increase to about

1,500 species (Sinclair et al. 2019). These flies thrive in

mountainous regions with an enormous radiation in the

Holarctic region and are well represented in the arctic en-

Corresponding editor: X. Mengual

Published: 08.04.2021

68 Miroslav Bartak et al.

vironment as well (Sinclair et al. 2019; Shamshev et al. tic species groups of Rhamphomyia have been revised

2020). These flies are also an ideal taxon for site quality (Bartak 1982, 2003; Bartak 2007, 2014; Bartak & Dan-

assessment studies (Grootaert 2004). Several Palaearc- telson 2007; Bartak & Kubik 2008a, b, c, 2009, 2010,

32°0'0"N 34°0'0"N 36°

70°0'0"E 80°0'0"E

= J

a / ik a.

= Wentrallinstitute 1@ + & ; a

—Temperate Horticulture ' ee

= Xe A -

Fig. 1. Study area. a—d. Aerial view of Central Institute of Temperate Horticulture. e-f. Full blossom of fruit trees.

Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK

A new Rhamphomyia from the Kashmir Himalayas 69

2012, 2015). The genus Rhamphomyia, however, still

awaits global taxonomic revision with the dubious status

of some of the proposed subgenera (Bartak 1982; Chvala

1994). Little attention has been paid to Southeast Asian

species and our knowledge of the Indian Himalayan Re-

gion fauna is also very poor. Only three species, R. gri-

seonigra Brunetti, 1913, R. himalayana Brunetti, 1913

and R. unifasciata Brunetti, 1913 have been previously

reported from Indian Himalayas (Brunetti 1913, 1920)

and it is highly likely that many more Rhamphomyia

Species await discovery (Bartak & Kubik 2012). Herein

a new species belonging to Rhamphomyia (Pararham-

Phomyia) is described from the Kashmir valley. This

also marks the first record of the genus from the region.

The species placement within the subgenus (Pararham-

Pphomyia) 1s followed after Collin (1961) and Bartak &

Sinclair (2003). This subgenus is characterized by the

prosternum and mostly propleura without setae, biseri-

al acrostichals, incomplete anal vein, long setose label-

la and usually a distinct basal costal seta. The species is

described and differential diagnoses with closely related

species are provided. Notes on courtship rituals of the

new species are also provided, along with SEM analysis

to elucidate morphological details. Male and female flies

are frequent flower visitors, observed feeding on nectar

all day long from flowers belonging to genera Pyrus,

Prunus, and Cydonia.

MATERIAL AND METHODS

Material and taxonomy

Specimens were collected by hand picking method from

orchards of the Central Institute of Temperate Horticul-

ture (CITH) located in Kashmir Valley. CITH is situated

at 33.59° N, 74.50° E with an altitude of 1,640 m a.s.l.

(Fig. 1), in the Palaearctic portion of India on the north-

ern fringe of the Western Himalayas (Akbar et al. 2018,

2020; Wachkoo & Akbar 2019). Behavioral patterns

were observed similarly as in previous works (Kessel

1955; LeBas et al. 2004; Daugeron & Grootaert 2005;

Wilkinson & Johns 2005). The field photographs were

obtained using a Canon 80D DSLR fitted with 100 mm

macro lens. Five mating couples were observed, thrice

a month for three successive months (April—June) from

2015 to 2018 for their courtship rituals. The pairs, formed

in air and descend from the swarm, were observed af-

ter they commence copulation. The timing of copulation

was counted once the pair settled on nearby vegetation

till copulation was terminated and the pair separated.

Upon separation, these were caught and their body mea-

surements taken. Statistical analysis was carried out with

Statistical Analysis Software (SAS).

Taxonomic analyses were conducted using an Olym-

pus SZX16 stereo zoom microscope. For digital imag-

Bonn zoological Bulletin 70 (1): 67-84

es, ProgResO CapturePro ver. 2.8.0. evolution digital

camera was used on the same microscope with Combine

ZP-Montage software. Later, images were cleaned with

Adobe Photoshop CS6. Genitalia together with 2-3 pre-

genital segments were removed and macerated in potas-

sium hydroxide solution (10%) in small vials, for 1—2

hours, treated with 8% acetic acid and dissected in glyc-

erine. The morphological terms used here follow Sinclair

and Cumming (2006). All body measurements (including

body and setae length) were taken from dry specimens

(therefore the actual length may differ) by means of an

ocular micrometer on the above Olympus microscope.

Description pattern and measurements adopted here

follow Bartak & Kubik (2015). Length of antennal seg-

ments = length of scape:pedicel:postpedicel:stylus (in

0.01 mm). Male body length was measured from anten-

nal base to the tip of last abdominal segment (without

the genitalia) and female body length from the base of

antennae to the tip of the cerci. Wing measurements:

M,/d = length of vein M,:greatest length of discal medial

cell (discal cell); CuA, ratio = length of apical: preapical

sections of vein CuA,; lw/ww = greatest length of the

wing (from basicosta to apex):greatest width of the wing.

Length of frons is measured from front margin of anterior

ocellus to antennal base. Holotype and paratypes are de-

posited in the Central Institute of Temperate Horticulture,

Srinagar, India (CITH). Two paratypes are deposited in

CULSP (Czech University of Life Sciences Prague), two

in University of Silesia, Katowice (DZUS) and two will

be deposited in Natural History Museum, London, UK

(BMNH).

Scanning electron microscopy

Specimens for SEM analyses were preserved in 70% eth-

anol for several days. From ethanol, the specimens were

transferred into 6% phosphotungstic acid (PTA) solution

in 70% ethanol for 24 hours. Dehydration was provid-

ed by ethanol series of 80, 90, 96% and two changes in

absolute ethanol for 10 minutes each. Some of the de-

hydrated specimens were treated with chloroform for 24

h. Dehydrated and cleaned specimens were dried using

the Leica EM CPD 300 automated critical point dryer

(Leica Microsystems, Vienna, Austria). Dry samples

were mounted on aluminum stubs with double-sided ad-

hesive carbon tape and sputter-coated with 30 nm layer

of chromium in a Quorum 150 T ES Plus sputter coater

(Quorum Technologies Ltd, Laughton, East Sussex, UK).

The specimens were imaged by the Hitachi SU8010 field

emission scanning electron microscope FESEM (Hitachi

High-Technologies Corporation, Tokyo, Japan) at 5 and

7 kV accelerating voltage with a secondary electron de-

tector (ESD) in the SEM laboratory of the Institute of

Biology, Biotechnology and Environmental Protection,

University of Silesia in Katowice (Katowice, Poland).

©ZFMK

70 Miroslav Bartak et al.

RESULTS

Rhamphompyia (Pararhamphompyia) bhagati sp. nov.

(Figs 2-9)

urn: |sid:zoobank.org:act:9943F FCF-5CB1-4699-B778-390236261B77

Diagnosis. Light grey microtrichose species of Rhamph-

omyia (Pararhamphomyia) with brown legs, both black

and pale setae on the body, palpus black, acrostichals

narrowly biserial, dorsocentrals irregularly biserial and

slightly longer than acrostichals, both mostly whitish

yellow, often with some dark setae intermixed, axillary

angle 90°, anal vein incomplete, basal costal seta long,

cercus elongate, subcercal process long and thin, epan-

drium extremely elongate with broadly rounded tip, phal-

lus long, filamentous with short basal swelling followed

by S-shaped arc.

Fig. 2. Rhamphomyia bhagati sp. nov. a—c. Male. d—f. Female. a, d. Head, frontal view. b, e. Habitus, lateral view.

c, f. Habitus, dorsal view.

Bonn zoological Bulletin 70 (1): 67-84

©ZFMK

A new Rhamphomyia from the Kashmir Himalayas Fal

0.5mm

ej apod

J apoc’ cere subcercal proc

b 8S WZ x |

ave w= epand

ph or sti Ws a a ~

Be, ¢ i. bie

. beh

cerci

Fig. 3. Rhamphomyia bhagati sp. nov. a. Wing venation with labeled discal cell (dm), cubitus (CuA1) and medial

veins (M2), (note: costal seta broken). b-d. Male genitalia, cercus (cerc), ejaculatory apodeme (ej apod), epandrium

(epand), hypandrium (hypd), phallus (ph), subcercal process (subcercal proc), sternite 8 (8S), tergite 8 (8T). e. Female

genitalia cerci.

Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK

a. Miroslav Bartak et al.

Material examined

Holotype. @, INDIA: Kashmir: Srinagar: Central In-

stitute of Temperate Horticulture, 34.0094°N 74.7984°E,

1640m.a.s.1., 11 April 2015 (CITH).

Paratypes. Same collection data as for holotype, ex-

cept: 11 April 2015 (4 6g, 2 99, CITH; 1 3, 1 9, CUL-

SP), 16 May 2015 (2 64, 1 9, CITH; 1 4, 1 2, DZUS),

28 May 2016 (1 3, 1 9, CITH), 09 June 2017 (4 3g, 1

©, CITH; 1 4, 1 9, BMNH), 11 June 2018 (5 3d’, 5 29,

CITH), 07 May 2019 (15 33, 11 29, CITH), 09 May

2019 (21 33, 14 92, CITH), Shahid Ali Akbar leg.

Distribution. India: Western Himalaya, Kashmir.

Dates of occurrence. April to June.

Description

Male (Figs 2a—c; 3a—d; 4—8; 9a—1)

Head. Light grey, microtrichose; eyes holoptic,

meet along median dorsal line, facets in dorsal half of eye

considerably enlarged (Fig. 2a); frons confined as small

triangle above antennae, without setulae. Frons blackish

brown, 0.15—0.18 mm long. Ocellar triangle prominent,

microtrichose; ocellar setae black, fine, approximately

0.26—0.27 mm long. Occiput sparsely covered with setae

subequally long as ocellars on dorsal part, colour vari-

able, mostly black to brown, often intermixed with white

setae; lower part of occiput mostly with pale and some-

what shorter setae; postocular row incomplete, irregular

or absent on lower half. Face approx. 0.12—0.14 mm wide,

0.15—0.16 mm long, without setae; microtrichose except

1.00 mm

Fig. 4. Scanning electron microscopy (SEM) showing general morphology of the male of Rhamphomyia bhagati

sp. nov. a. Lateral view. b. Head and thorax lateral view. c. Wing. d. Genitalia.

Bonn zoological Bulletin 70 (1): 67-84

©ZFMK

A new Rhamphomyia from the Kashmir Himalayas 73

¥ F: (a " , 4 % te |

1) hi Gate ek & ja fs Re I F ‘ " r «) @ d « 1

5) 250.0um Fe —* Bie ee . Ou : K .

Bit

| <

Vif

50/0um *10-0um

Lue , ~—_- c ~ g ‘ : -

y / , : . \ _ tae :

/ = Dn aa ns -

~~ + S . ¥ ees P

Froritayirl ih = . : 4 ge Se, age

. : a

roost

200um

Fig. 5. SEM of Rhamphomyia bhagati sp. nov. head, antennae and mouth parts. a. Holoptic eyes (e) with enlarged

facets along dorsal half and ocelli (0). b. Fine structure of the ocelli. ec. Fine structure of the ommatidia. d. Scape

(sc), and pedicel (pd) with sclerotic microtrichia. e. Structure of type III trichoid sensilla (dotted arrows) and type IV

trichoid sensilla (solid arrows). f. Fine structure of the type IV trichoid sensilla sockets. g. Postpedicel with the area

of basiconicsensilla (arrow heads) on the ventral side. h. Postpedicel microtrichia and basiconicsensilla (ba). i. Fine

structure of the basiconicsensilla covered by wax layer. j. Stylus. k. Labrum. I. Fine structure of the labrum apical end.

m. Labium. n—o. Fine structure of the ventral side of the labellum with visible pseudotracheae (pt).

Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK

74 Miroslav Bartak et al.

extreme lower margin. Clypeus microtrichose, gena

narrow and microtrichose. Palpus black and short, with

several long setae (up to 0.20 mm). Labrum black,

shiny, distinctly longer than head height; labellum with

rather long setae. Antenna black, both basal segments

short setose (Fig. 2a); length of antennal segments

(scape: pedicel: postpedicel:stylus) = 0.06—0.09 mm:0.06—

0.8 mm:0.27—0.31 mm:0.09-0.11 mm.

Thorax. Black, light grey microtrichose with two nar-

row brownish stripes between dorsocentrals and acros-

tichals (Fig. 2b—c). Most thoracic setae pale, posterior

dorsocentrals, postalars and scutellars black; acrostichals

and dorsocentrals mostly whitish yellow, often with

some dark setae intermixed. Chaetotaxy: antepronotum

with a few short setae in middle; proepisternum with sev-

eral fine setulae; prosternum and propleura bare; acrosti-

iene d

’ 5.00um

Fig. 6. SEM of Rhamphomyia bhagati sp. nov. thorax and wings. a. Long and rigid setae (trichoid and chaetic sensilla)

on thorax. b. Structure of trichoid sensilla. ec. Fine structure of socket and basal part of chaetic sensillum. d. General

view of thoracic microtrichia. e—f. Fine structure of thoracic cuticle and microtrichia with waxy secretion. g. Wing ar-

ticulation and base. h. Pillow-like structures on the articulation part of the wing. i. Chaetic sensilla on the wing edges.

j. Wing membrane with linearly arranged microtrichia. kl. Fine structure of the wing microtrichia.

Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK

A new Rhamphomyia from the Kashmir Himalayas 1D

chals narrowly biserial (almost uniserial anteriorly) and

few in number (5-7 in one row), about 0.10-0.12 mm

long; dorsocentrals irregularly biserial, slightly longer

than acrostichals, ending in 2—3 long black prescutellar

pairs; one presutural intra-alar (intrahumeral), one pre-

sutural supra-alar (posthumeral) and additional 5—8 setae

between dorsocentrals and presutural supra-alar seta; one

long postpronotal seta and several much shorter setulae;

2-3 notopleural setae and 1-3 rather long but fine setae

on anterior part of notopleuron; two pairs of black scute-

llars.

Legs. Brown, light grey microtrichose, with both whit-

ish and brown setae (Fig. 2b). Fore femur with rows of

setae ventrally slightly shorter than femur depth, dorsal

setae much shorter. Fore tibia with very short setulae ven-

trally, with irregularly arranged setae dorsally subequally

long as tibia depth. Mid femur with irregularly arranged

setae anteroventrally, slightly shorter than femur depth,

Jo ot ou Uo oo wom gy

200um

more ventral and thicker proximally and finer and more

anteroventral distally; posteroventral setae much longer,

on apical third longer than femur depth. Mid tibia with

rather dense fine setae anteriorly and anteroventrally;

posteroventral setae slightly thicker, more regularly ar-

ranged, all at most as long as tibia depth; dorsally with

short setae; in some specimens with poorly distinct 1—2

anterodorsal setae. Hind femur distinctly thickened and

flattened, with irregularly arranged rather dense and thick

pale antero- and posteroventral setae on distal two-thirds,

slightly shorter than femur depth; dorsal setae rather

long, especially on proximal part of femur, otherwise

shorter and finer setose. Hind tibia distinctly curved,

shortened and thickened (almost as in R. gibba (Fallén,

1816)), short setose ventrally, with 4—5 rather long pos-

terodorsal setae (up to 0.20—0.23 mm long). Tarsi of all

legs narrow and long, short setose, with apical circlets of

100um

Prrritirarerit

90.0um

Fig. 7. SEM of Rhamphomyia bhagati sp. nov. halter. a. General view of the dorsal side of the halter with robust

scabelum (Sc), pedicellus (Pe) and oval capitellum (Ca). b. Sensilla on the dorsal scabellum (D.Scab.) and dorsal

pedicellus (D.Ped.). ¢. Capitellum with single trichoid sensilla (arrows). d. Fine structure of the basal plate sensilla. e.

Fine structure of the flanking sensilla. f. Fine structure of the trichoid sensilla. g. General view of the ventral side of

halter. h. Flanking sensilla on the ventral pedicellum (V.Ped.). i. Single trichoid sensilla on the capitellum.

Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK

76 Miroslav Bartak et al.

Porrrtlerecl ff : = s tc ‘ po Pease

f 5.0Qum

100um

ioe Oo Uo tan o U

400um

——

- a

Too on 0 fo oo oo rae,

, < ge Wy ip : 5

100um 1 Oks .Orgat x1:80k-LIMCULe, Pott: — Oums. 40.0um

Imo 0 t 0 0 0 Teo

50.0um

1 1 ot oom oO

10.0um 2.00um

Fig. 8. SEM of Rhamphomyia bhagati sp. nov. legs. a. Coxa (cx) with long trichoid sensilla, trochanter (tr) femur (f)

with much shorter ones b. Single campaniform sensillum (arrow) on the proximal part of femur. ¢c. Fine structure of

the campaniform sensillum. d. Fine trichoid sensilla on the dorsal side (solid arrow) and thick and rigid chaetic sen-

silla (dotted arrow) on the ventral side of femur. e. Fine structure of the socket and basal part of trichoid sensillum on

dorsal femur. f. Fine structure of chaetic sensilla on ventral femur. g. Part of tibia with trichoid and chaetic sensilla.

h. Fine structure of dorsal tibiae with trichoid and chaetic sensilla. i. Fine structure of two kinds of chaetic sensilla

with thick and very fine apices on ventral tibia. j. Chaetic sensilla on the distal part of tibia (ti) and first tarsomere (t1).

k. Trichoid and chaetic sensilla on the third tarsomere. I. Trichoid sensilla on the fifth tarsomere (t5), curved claws

(clv) and pulvilli (pulv). m. Fine structure of claw. n. Fine structure of the tentent setae (ts). 0. Fine structure of the

tenent setae terminal plates.

Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK

A new Rhamphomyia from the Kashmir Himalayas

ut pil f eran

100um \

200u

Pourtrutlareel ib i ooo oo | } Pasorrbooaal

10!

s00um 400um Oum

SS —vthe

iF ae PSa ae

: SS ees bar

ote ai eT 1)

50.0um

Fig. 9. SEM of Rhamphomyia bhagati sp. nov. male and female genitalia. a. General view of male genitalia with

labelled phallus (ph) and cerci (cerc). b. Long and rigid chaetic sensilla on the genitalia. ce. Basal part of the phallus.

d-f. Fine structure of different parts of the phallus. g. Trichoid sensilla on the cerci (cerc). h. Trichoid and chaetic sen-

silla on the epandrium. i. Surface of the epandrium and fine structure of trichoid sensilla sockets j. Female abdomen.

k. Chaetotaxy of the terminal segments of female abdomen tergites 6—10 (tg6—tg10) and cerci (cerc). I. Fine structure

of seventh segment of abdomen. m. Genital pore. n—o. Chaetic sensilla on the last abdominal segment and cerci.

Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK

78 Miroslav Bartak et al.

setae and long claws. Posteroapical comb of hind tibia

with | long seta.

Wing. Clear, veins brownish-black to yellowish brown,

pterostigma brown, anal vein incomplete (apparent as de-

pigmented vein in basal two-thirds); anal lobe well de-

veloped with axillary angle right angled (Fig. 3a); basal

costal seta rather long, black. Halter yellow with brown

stem, calypter yellow with whitish fringes (Fig. 2b-—c).

Abdomen. Black, very light grey microtrichose, cov-

ered with whitish yellow setae; epandrium with black

setae and setulae (Fig. 2b—c). Lateral marginal setae on

tergites 2-4 subequally long as their segments, dorsal

setae and setae on segments 5—7 much shorter, sternites

with long, yellowish white setae, sternite 1 without se-

tae, sternite 8 with very long and dense setae (dorsally up

to 0.35 mm long). Segments 6—7 as simple unmodified

structures. Segment 8 with tergite and sternite separat-

ed; tergite 8 simple, somewhat C shaped viewed later-

ally, sternite 8 simple, enlarged, subrectangular in later-

al view. Terminalia as in Fig. 3b—d. Hypandrium short,

lustrous, without setae; epandrium extremely elongated

(apical part about 1.7 mm long), apex broadly rounded;

cercus elongate, lower cercus or subcercal process long

and thin, as an extension of the cercus; phallus filamen-

tous, with short basal swelling followed by S-shaped arc

and then broadly arching around epandrium exceeding

lamellae (total length of very thin hair-like phallus up to

5 mm).

Length. Body about 4.0-4.6 mm long, wing 3.6—

4.0 mm.

Female (Figs 2d-f, 3e, 9j-0)

Similar to male, but body setae much shorter and dark-

er; legs simple and short setose. Eyes dichoptic with all

facets almost equal in size (Fig. 2d). Frons approximately

0.15—0.18 mm, broad with 3—5 black or pale, rather long

setae on sides. Labrum black, labella with rather long se-

tae. Thoracic chaetotaxy: acrostichals and dorsocentrals

mostly black, dorsocentrals distinctly longer (Fig. 2e—f).

Both fore and mid femora short setose, longest (distal)

posteroventrals shorter than femur depth. Both fore and

mid tibiae very short setose, without prominent setae.

Hind femur with only a few anteroventral setae on dis-

tal half, slightly shorter than femur depth, otherwise very

short setose (including very short posteroventrals). Hind

tibia with several antero- and posterodorsal setae as long

as tibia diameter. Terminalia as in Fig. 3e. Length: body

3-3.5 mm; wing 3.4—3.6 mm.

Etymology. The species is named in the honour of Pro-

fessor Ramesh Chander Bhagat.

Remarks. The species described above 1s allied to

Pararhamphomyia with extremely elongated epandri-

um and very long and extremely thin, hair-like phallus,

present (but not in such an extreme form) as in R. (P.)

tenuiterfilata Becker, 1900 or R. (P.) longestylata Frey,

Bonn zoological Bulletin 70 (1): 67-84

1916. However, the former species has the mesoscutum

disc shiny and the latter has all body setae black. The

new species shares some affinities with R. himalayana,

but differs in having the abdomen with long pale setae;

labrum distinctly longer than head height; wing clear

with pterostigma brown; thorax with a few long and pale

setae, whilst R. himalayana has the abdomen with only

short blackish setose; labrum as long as head height; wing

pale brownish without distinct pterostigma and thorax se-

tae short and blackish. The male terminalia of the new

species share some similarities with R. macrura Loew,

1871. However, the two species can be differentiated by

combination of the following characters: R. macrura 1s

entirely black setose species with dark halter and peculiar

comb of ventral setae on mid basitarsus. Moreover, male

terminalia also differs slightly: basal part is bent ante-

riorly and epandrial lamellae are much narrower, whilst

the new species has yellow halter, mid basitarsus without

peculiar setae, basal part of terminalia not bent anteriorly

and the epandrial lamellae are broader.

Notes on SEM morphology of Rhamphomyia bhagati

Sp. nov.

The male is generally similar to the female, except for

the normal sexual dimorphism. The general morphology

of the male specimen with the ratios of body appendages

can be observed on Fig. 4.

Head, antennae and mouthparts

The ommatidia of the compound eye are tightly and reg-

ular deployed 20—25 um, with dimorphism of the omma-

tidia in the upper and the lower half (Fig. 5a—c). The ocel-

li are rounded, slightly convex, 31—47 um, with slightly

developed sclerotic rim on the edges (Fig. 5b). All an-

tennomeres are deeply covered by numerous short and

fine sclerotic microtrichia without sockets and different

number of sensilla with visible sockets (Fig. 5d). Lateral

sides of the scape and pedicel bear quite long, thick, rigid

and deeply ribbed type III trichoid sensilla with pointed

apices (Fig. 5e), whereas the pedicel bears additionally

much shorter type IV trichoid sensilla with very fine and

pointed apices (Fig. 5f). Type III trichoid sensilla on the

scape are 22—25 um long whereas those on the pedicel are

30-60 um long. Type IV trichoid sensilla on the scape are

only 5—6 um long. The postpedicel is the larger segment

with expanded and convex ventral basal part (Fig. 5g).

The whole surface of this segment is densely covered by

numerous short and fine microtrichia and its ventral side

bears numerous basiconicsensilla (most probably type I)

(Fig. 5g—h). The sensilla are rather regular, lengthwise

located. They are 5—9 um long, mostly covered by wax

layer but on the raw sensilla porous surface can be seen

(Fig. 51). The stylus is densely covered by numerous mi-

crotrichia, its very apical part (mechanoreceptor) is raw

and seems to be porous (Fig. 5j). Labrum is covered by a

©ZFMK

A new Rhamphomyia from the Kashmir Himalayas 79

wax layer with pointed epipharyngeal blades (Fig. 5k—l).

The labium is densely covered by numerous microtrich-

ia, with thick long setae (chaetic sensilla), especially on

the dorsal side of labellum (Fig. 5m—n) and well-visible

pseudotracheae (Fig. 50).

Thorax, wings and legs

The thorax is densely covered by numerous, thin, short

and pointed microtrichia. They are slightly curved, have

rounded apices and a lot of wax secretion can be not-

ed between them. The dorsal side of thorax is covered

by thin, fine and pointed trichoid sensilla and very long,

thick, rigid and pointed chaetic sensilla. Both kinds of

sensilla are furthermore ribbed and the chaetic sensilla

arise from large, protuberant sockets (Fig. 6a—f). The

wing has a distinct wax layer, covered by numerous mi-

crotrichia (wing membrane) and chaetic sensilla, espe-

cially on wing edges and wing articulation (Fig. 6g, i-l).

The surface of the basal part of the wing and wing artic-

ulation is densely covered by small pillow-shaped struc-

tures with short and conical projections (Fig. 6h). The

chaetic sensilla are thick and ribbed as on other parts of

the thorax (Fig. 61). The microtrichia are deployed regu-

larly, are fine, almost pointed and also slightly ribbed es-

pecially near the basal half (Fig. 6j-1). The halter 1s cov-

ered by numerous microtrichia with well-visible sensilla

plates on the scabellum and pedicellus and a large oval

capitellum (Fig. 7a—c). Dorsal scabellus is characterized

by well-visible and densely arranged spherical and pro-

tuberant basal plate sensilla (Fig. 7d), which also have a

linear orientation similar to flanking sensilla on the dor-

sal pedicel stem (Fig. 7e). The capitellum, besides short,

fine and pointed microtrichia, bears rather single trichoid

and campaniform sensilla (Fig. 7f). The ventral side of

the halter is rather similar but only on the ventral pedicel,

Table 1. Descriptive analysis of observed courtship characters.

linearly arranged flanking sensilla are visible and trichoid

sensilla on the capitellum (Fig. 7g—-1).

The legs are densely covered by numerous short, fine

and pointed microtrichia and mechanoreceptors. Many

long, fine and pointed trichoid sensilla are found on cox-

ae (Fig. 8a). On the basal inner side of femora a single

campaniform sensillum can be found. The campaniform

sensilla is about 5.5—6.5 um in diameter with quite pro-

tuberant inner part and without visible pore (Fig. 8b—c).

The femora bear besides microtrichia, fine and pointed

trichoid sensilla on the dorsal side and rigid and point-

ed chaetic sensilla (Fig. 8d). Both kinds of sensilla are

ribbed (but the trichoid sensilla are deeper ribbed) and

are characterized by well-developed and protuberant

sockets (Fig. 8e—f). Chaetic and trichoid sensilla are nu-

merous on the tibiae where they are located rather reg-

ularly (Fig. 8g), having the same morphology (Fig. 8h)

with the exception that some chaetic sensilla on the ven-

tral side have elongated and very fine apices (Fig. 81).

Distal parts of tibiae and tarsomeres are characterized

by larger numbers of chaetic sensilla, while distal part of

the last tarsomere bears more trichoid sensilla (Fig. 8j-1).

Claws with proximal halves covered by pointed microtri-

chia. The distal halves are curved and ribbed (Fig. 8m).

Ventral side of the pulvilli are characterized by numerous

and regularly arranged tenent setae with flat capitate ter-

minal plates (Fig. 8n—o).

Male and female terminalia

The terminal part of the male abdomen is densely cov-

ered by very long, rigid and pointed chaetic sensilla

(Fig. 9a—b). The basal part of the phallus is very smooth,

enlarged, with an evident indentation on the ventral side

(Fig. 9c—d). The rest of the phallus is also smooth but

often covered by waxy secretions, especially on the apex

which is double pointed (Fig. 9e—f). The cercus and ep-

Character | ANOVA test results

Source of Variation

between groups SS df MS F P-value F crit

within groups

LH between groups 318.94 ) 159.47 2.47 0.08 3.06

within groups 8521.46 132 64.55

ML between groups 0.42 2 0.21 1.62 0.20 3.06

within groups 17.46 132 0.13

FL between groups 0.95 2 0.47 1.61 0.20 3.06

within groups 38.92 132 0.29

DC between groups 1000.84 2 500.42 0.98 0.37 3.07

within groups 60760.34 120 506.33

Abbreviations: LH = Lek height; ML = Male length; FL = Female length; DC = Duration of copulation

Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK

80 Miroslav Bartak et al.

Fig. 10. Courtship rituals of Rhamphomyia bhagati sp. nov. a. Male occupy terminal tips prior to aerial flights for

raids. b. Aerial nematoceran swarms. ec. Aerial hunting male swarms. d—f. Aerial raids on male nematocerans. g. Male

with captured prey.

Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK

A new Rhamphomyia from the Kashmir Himalayas 81

Fig. 11. Courtship rituals of Rhamphomyia bhagati sp. nov. a. Tangled male and female land on the leaf. b-c. Male

and female in copulation. f, i. Female terminates copulation, and female with leftover prey. e, h. Male terminates cop-

ulation and predated by spider. d, g. Male and female resumes flower visiting.

Bonn zoological Bulletin 70 (1): 67-84 ©ZFMK

82 Miroslav Bartak et al.

Table 2. Correlation among factors affecting duration of cop-

ulation.

Correlation table (n = 572)

DC LH

FL -0.04 -0.06

ML 0.08 -0.07

LH -0.04 1

andrium are characterized by numerous microtrichia,

trichoid and long chaetic sensilla (Fig. 9g—1). The female

terminal segments (besides the very last ones and cer-

cl), especially the tergites appear with less microtrichia

as they are partially retracted into the proximal segment

(Fig. 9j-l), while the ventral sides and cerci are charac-

terized by more chaetic sensilla (Fig. 9m—o).

Courtship rituals

The male and female flies are frequent flower visitors,

without showing any strong territoriality. These are ob-

served visiting flowers from April to June with increase

in incidence towards the middle half of June. Most of the

major temperate fruit crops from the region are visited

by these insects. However, it seems that the white floral

varieties of almond, apple, cherry, pear, plum, and quince

plants are preferred over pink floral varieties of apricot,

peach and nectarine. Apart from being flower visitors,

these flies are seen forming courtship lek swarms during

different phases of the day. On cloudy, cooler days with

suitable conditions, lek swarms are more frequently seen

compared with hot days. Most of the lek sites orient in

Open areas in an otherwise complete canopy (Fig. 10a).

The aerial swarms were usually formed at 74.83 +

8.12 cm from the ground with lower and higher heights

of 60 and 95 cm respectively. These flies usually do not

form swarms above 100 cm, although may attain individ-

ual flight heights of about 300-500 cm. Before the for-

mation of mating swarms, males raid small nematocerans

(Fig. 10b—f) and carry this prey as nuptial gifts to the lek

swarms, where other males also display their captured

raid to the nearby hovering females. All males capture

small male chironomid midges of a particular species,

and no polymorphism in gift giving was observed. The

males after capture of midges may settle on nearby veg-

etation and reorient the prey, before entering the swarm

(Fig. 10g) or they may directly enter the lek after cap-

turing the prey. The prey presentation to the female by

male occurs in the air. The male displays captured prey

by holding it in between the hind legs and hovering near

females in air. Females approach the males in the mid-air

for accepting the prey and to mate. Coupling takes place

abruptly and as the female accepts the gift; a male gets

a better hold of the female in the air with his mid legs.

Bonn zoological Bulletin 70 (1): 67-84

Soon the tangled couple with prey settles along the un-

derside of a leaf with the help of the forelegs of the male

(Fig. 1la). The couple rearranges with the female getting

a proper hold of the prey and starting to consume it, while

the male gets hold of the leaf with its forelegs and ori-

ents for the genital union (Fig. 11b—c). It was observed

that the extremely elongate phallus helps detain an ini-

tially wilting female until the ejaculate is transferred.

The mean duration of copulation (seconds) was 137.27 +

23.57, ranging from 87—190. Upon completion the male

terminate copulation by releasing its hold of the vegeta-

tion. This makes the pair separate either on downward

descent or on impact with the ground. The mated pair is

frequently also disturbed by other insects. In these cases

mainly the female terminates the copulation, by beating

her wings and it may stay with the prey for some time

(Fig. 11f-1). If mating was interrupted in an earlier stage,

the male keeps hold of the prey and re-enters the lek

(Fig. lle); sometimes interruption to mating is caused

by predation of either male or female by spiders, rob-

ber flies and other predator insects (Fig.11h). Excluding

these episodic behavioral events, both male and female

suck nectar to fulfill most of their dietary requirements

(Fig. 11d, g).

The correlation coefficient exhibited a non-significant

negative relationship of female body length with both du-

ration of copulation and lek height from the ground (Ta-

bles 1—2). Females with higher body sizes usually take at

a lower lek height and have lower duration of copulation,

as against females of lower body size who exhibit a high-

er duration of copulation and show a higher lek height

from the ground. Males with larger body size exhibited a

higher duration of copulation (r = 0.08, p > 0.05), how-

ever, with lek height, a non-significant negative relation-

ship was recorded (r = -0.07, p > 0.05). A non-significant

negative relationship also existed between duration of

copulation and lek height (r = -0.04, p > 0.05), suggest-

ing that at lower heights the duration of copulation was

higher and vice-versa. This may be explained by envi-

ronmental factors like wind and gravity, which makes the

attachment to the leaves continuously challenging for the

compromised couples. However, the statistical signifi-

cance of the various observations exhibited that except

for the lek height, none of the other variables were statis-

tically significant at 95% probability and require further

understanding.

Conclusion

Several hypotheses have tried to correlate diversification

rate and traits presumed to intensify sexual selection. The

typical empidine suite of mating behaviors is of particu-

lar interest for understanding such proposed hypotheses

and processes of speciation. During the present study,

observations were made on some of the courtship ritu-

als performed by the new species. Whether some of the

©ZFMK

A new Rhamphomyia from the Kashmir Himalayas 83

exhibited dimorphic sexual structures have any impact

to facilitate speciation and scale relationships among

conspecific members, needs to be explored further. By

using SEM, a more precise picture of the body surface of

these insects was revealed, which in future can facilitate

and clarify function of various parts of the body and even

assist in character identification and misidentification as-

pects in their systematics.

Acknowledgements. The Corresponding author would like

to thank Department of Science and Technology (DST), Govt.

of India, New Delhi for research encouragement and finan-

cial assistance rendered via; N-PDF Fellowship program: File

No: PDF/2015/000866 while the third author gratefully ac-

knowledges the Scholarship for Outstanding Young Scientists

from the Ministry of Science and Higher Education of Poland

(1165/E-340/STYP/12/17). All the authors would also like to

thank Prof. Darryl Gwynne (University of Toronto, Mississau-

ga, Canada), Dr Luc Bussiére (Biological and Environmental

Sciences, University of Stirling, United Kingdom), Mr Suhaib

Firdous Yatoo (Centre for Biological Diversity, CBD) and Dr

M. Javaid Dad (DST- Young Scientist, ICAR- CITH) for their

valuable suggestions. Sincere thanks are due to the director of

CITH for facilitates made available. Thanks are extended to

anonymous reviewers for improving the manuscript with in-

valuable comments and suggestions.

REFERENCES

Alfred JRB, Das AK, Sanyal AK (1998) Faunal Diversity in In-

dia. Published by ENVIS Centre, Zoological Survey of India,

Calcutta i-viit: 1-495

Akbar SA, Dar MA, Mahendiran G, Wachkoo AA (2018) The

first record of pear psylla Cacopsylla bidens (Hemiptera:

Psyllidae) from India along with notes on seasonal occur-

rence and some elements of its biology. Oriental Insects 52

(1): 101-11. https://doi.org/10.1080/00305316.2017.1378598

Akbar SA, Nabi SU, Mansoor S, Khan KA (2020) Morpho-mo-

lecular identification and a new host report of Bactrocera

dorsalis (Hendel) from the Kashmir valley (India). Inter-

national Journal of Tropical Insect Science 40: 315-325.

https://doi.org/10.1007/s42690-019-00083-w

Bartak M (1982) The Czechoslovak species of Rhamphomyia

(Diptera, Empididae), with description of a new species from

Central Europe. Acta Universitatis Carolinae — Biologica

1980: 381-461

Bartak M (2003) Revision of Palaearctic species of Rhampho-

myia (Megacyttarus) argentea group (Diptera: Empididae).

Acta Universitatis Carolinae Biologica 47: 197—245

Bartak M (2007) Five new European species of the Rhamph-

omyia (s.str.) albosegmentata group (Diptera: Empididae).

Revue Suisse de Zoologie 114(2): 417-435

Bartak M, Danielson R (2007) Revision of Rhamphomyia spe-

cies (Diptera, Empididae) described by J. W. Zetterstedt.

Acta Zoologica Universitatis Comenianae 47 (2): 105-114

Bartak M, Kubik S (2008a) New peculiar Eastern Palaearc-

tic Rhamphomyia (Diptera: Empididae). Entomological

News 119 (4): 338-344. https://doi.org/10.3157/0013-

872X-119.4.338

Bartak M, Kubik S (2008b) A new species of Rhamphomyia

(Pararhamphomyia) (Diptera: Empididae) from Thailand.

Bonn zoological Bulletin 70 (1): 67-84

Oriental Insects 42: 285-289. https://doi.org/10.1080/00305

316.2008.10417552

Bartak M, Kubik S (2008c) Four new West Palaearctic species

of the Rhamphomyia (s.str.) (Diptera: Empididae). Revue Su-

isse de Zoolgie 115 (1): 25-36

Bartak M, Kubik S (2009) Two new East Palaearctic

Rhamphomyia (Pararhamphomyia) (Diptera: Empidi-

dae). Entomological News 120 (1): 76-86. https://doi.

org/10.3157/021.120.0114

Bartak M, Kubik S (2010) Three new European species of the

Rhamphomyia (s.str.) melania group (Diptera: Empididae).

Revue Suisse de Zoologie 117 (1): 89-100

Bartak M, Kubik S (2012) A review of the Palaearctic species

of Rhamphomyia subgenus Holoclera (Diptera: Empididae)

with description of 5 new species. Revue Suisse de Zoologie

119 (3): 385-407

Bartak M, Kubik S (2015) Palaearctic species of Rhamphomyia

(Pararhamphomyia) anfractuosa group (Diptera, Empidi-

dae). ZooKeys 514: 111-127. https://doi.org/10.3897/zook-

eys.514.9379

Bartak M, Kubik 8, Civelek H, Dursun O (2014) New species

of Rhamphomyia (Diptera: Empididae) from Turkey with a

key to species of the Middle East and adjacent territories.

Zootaxa 3815 (1): 68-78. https://doi.org/10.11646/zoot-

axa.3815.1.4

Bartak M, Sinclair BJ (2003) Case 3269. Rhamphomyia (Rham-

Dhomyia) Meigen, 1822 and Rhamphomyia (Pararhampho-

myia) Frey, 1922 (Insecta: Diptera): proposed conservation

of usage of the subgeneric names by designation of Empis-

sulcata Meigen, 1804 as the type species of Rhamphomyia.

Bulletin of Zoological Nomenclature 60 (3): 203-205

Bezzi M (1904) Empididae Indo-australianiraccolti dal Signor

L. Biro. Annales Historico-Naturales Musei Nationalis Hun-

garici 2: 320-361

Bigot JMF (1889) Dipteres nouveaux ou peu connus, 34° par-

tie. XLII Empidi. Annales de la Société entomologique de

France (6) 9: 111-134

Brunetti E (1913) New Indian Empidae. Records of Indian Mu-

seum 9: 11-45

Brunetti E (1917) Diptera of the Simla district. Records of Indi-

an Museum 13: 59-101

Brunetti E (1920) Diptera Brachycera. The Fauna of British In-

dia, including Ceylon and Burma. Vol. 1. Taylor and Francis,

London

Chvala M (1994) The Empidoidea (Diptera) of Fennoscandia

and Denmark. Vol. III. Genus Empis. Fauna EntomologicaS-

candinavica 29. E.J. Brill, Leiden, New York, Koln

Collin JE (1960) Some Empididae from Palestine. Annals and

Magazine of Natural History Ser.13 (2): 385-420

Collin JE (1961) British Flies, Empididae. University Press,

Cambridge

Cumming JM (1994) Sexual selection and the evolution of

dance fly mating systems (Diptera: Empididae; Empidinae).

The Canadian Entomologist 102: 769-920

Daugeron C, Grootaert P (2005) Atypical mating behaviour in

the empidine dance fly Rhamphomyia (Lundstroemiella) ma-

gellensis (Diptera: Empididae: Empidinae). Belgian Journal

of Zoology 135 (1): 97-99

Grootaert P (2004) Family Empididae (Diptera, Brachycera).

Pp. 805-809 in: Yule CM & Sen YH (eds.) Freshwater In-

vertebrates of the Malaysian Region. Academy of Sciences,

Malaysia

Kessel EL (1955) The mating activities of balloon flies. Sys-

tematic Biology 4 (3): 97-104

©ZFMK

84 Miroslav Bartak et al.

LeBas NR, Hockham LR, Ritchie MG (2004) Sexual selection

in the gift-giving dance fly, Rhamphomyia sulcata, favors

small males carrying small gifts. Evolution 58(8): 1763—

1772. https://doi.org/10.1554/03-659

Mitra B, Roy S, Biswas O, Chakraborti U (2015) True flies

(Insecta: Diptera): Diversity and Endemism in Himachal

Pradesh, India. International Journal of Advanced Research

in Biology and BioTechnology 1 (1): 46-59

Moulton JK, Wiegmann BM (2007) The phylogenetic relation-

ships of flies in the superfamily Empidoidea (Insecta: Dip-

tera). Molecular Phylogenetics and Evolution 43: 701-713.

https://doi.org/10.1016/j.ympev.2007.02.029

Pape T, Blagoderov V, Mostovski MB (2011) Order Diptera

Linnaeus, 1758. Pp. 222-229 in: Zhang Z-Q (ed.) Animal

biodiversity: An outline of higher-level classification and

survey of taxonomic richness. Zootaxa, Magnolia Press,

Auckland, New Zealand. http://www.mapress.com/zootax-

a/2011/f/zt03148p229

Rhodén C, Wahlberg E. 2020. The phylogeny of Empis and

Rhamphomyia (Diptera, Empididae) investigated using

UCEs including an over 150 years old museum specimen.

Evolutionary Systematics 4: 21-33. https://doi.org/10.3897/

evolsyst.4.49537

Saigusa T (2012) A new Asio-Nearctic subgenus of Rham-

Phomyia (Diptera: Empididae: Empidinae). The Canadian

Entomologist 144 (2): 291-322. https://doi.org/10.4039/

tce.2012.28

Shah GM, Jan U, Wachkoo AA (2014) A checklist of hoverflies

(Diptera: Syrphidae) in the Western Himalaya, India. Acta

Zoologica Academiae Scientiarum Hungaricae 60: 283-305

Shamshev IV, Sinclair BJ, Khruleva OA (2020) The empidoid

flies (Diptera: Empidoidea, exclusive of Dolichopodidae) of

the Russian Arctic islands and Svalbard Archipelago. Zoo-

taxa 4848: 1-75. https://doi.org/10.11646/zootaxa.4848.1.1

Bonn zoological Bulletin 70 (1): 67-84

Sinclair BJ, Cumming JM (2006) The morphology, higher-lev-

el phylogeny and classification of the Empidoidea (Diptera).

Zootaxa 1180: 1-172

Sinclair BJ, Vajda EA, Saigusa T, Shamshev IV, Wheeler TA

(2019) Rhamphomyia Meigen of the Canadian Arctic Ar-

chipelago, Greenland and Iceland (Diptera: Empididae).

Zootaxa 4670 (1): 001-094. https://doi.org/10.11646/zoot-

axa.4670.1.1

Thompson FC (ed.) (2005) Biosystematic Database of World

Diptera. Online at http://www.diptera.org/Diptera/biosys.

htm [last accessed on 1 Nov. 2018]

Wachkoo AA, Akbar SA (2019) Protichneumon pisorius (Hy-

menoptera, Ichneumonidae) — the first record from India. Na-

tional Academy Science Letters 42 (5): 391-393. https://dol1.

org/10.1007/s40009-018-0775-2

Wachkoo AA, Shah GM, Jan U, Akbar SA (2017) A checklist of

soldierflies (Diptera, Stratiomyidae) in India. Journal of Asia-

Pacifc Biodiversity 10 (1): 44-54. https://do1.org/10.1016/j.

japb.2016.04.004

Walker F (1849) List of specimens of dipterous insects in the

collection of the British Museum. Part III, London: 485-687

Watts M, Winkler IS, Daugeron C, de Carvalho CJB, Turner SP,

Wiegmann BM (2016) Where do the Neotropical Empidini

lineages (Diptera: Empididae: Empidinae) fit in a worldwide

context? Molecular Phylogenetics and Evolution 95: 67—78.

https://doi.org/10.1016/j.ympev.2015.10.019

Wilkinson GS, Johns PM (2005) Sexual selection and the evo-

lution of mating systems in flies. Pp. 312-339 in: Yeates

DK & Weigmann BM (eds) The Biology of the Diptera. Co-

lumbia University Press, New York.

Yang D, Zhang K, Yao G, Zhang J (2007) World catalog of

Empididae (Insecta: Diptera). China Agricultural University

Press, Beijing

©ZFMK

Bonn zoological Bulletin 70 (1): 85-95

2021 - Stuke J-H.

https://do1.org/10.20363/BZB-2021.70.1.085

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:lsid:zoobank.org:pub:7C2593 FA-2C3F-4134-8 1 0F-011EC81B42C0

New European species of Athyroglossa Loew, 1860

(Diptera: Ephydridae)

from Finland and the Republic of Georgia

Jens-Hermann Stuke

Roter Weg 22, D-26789 Leer, Germany

Email: jstuke@zfn.uni-bremen.de

urn:Isid:zoobank.org:author:27ED8CBD-9201-4983-8FE3-698FB499A0E0

Abstract. Athyroglossa (Athyroglossa) fennica spec. nov. (Finland) and Athyroglossa (Athyroglossa) kuraensis spec. nov.

(Georgia) are described. A key to European species of Athyroglossa is presented. The male terminalia and sternites 3—5 of

all European species are illustrated.

Key words. Ephydridae, Athyroglossa, Europe, Finland, Georgia, new species, key.

INTRODUCTION

Ephydridae, also known as shore flies, is a large family of

Diptera Acalyptratae with almost exactly 2000 described

species worldwide (based on author’s database). To date,

about 350 species are recorded from Europe. The mor-

phological diversity of Ephydridae is high and, as a proof

of that, 134 genera are currently distinguished. Certainly,

the number of known species will significantly increase

in the future if more taxonomic research and field work

are carried out on this family. Ephydridae are minute to

medium sized flies (0.6—11 mm) and their beauty only

reveals itself under high magnification. In addition to

the morphological diversity, there is also a wide range

of larval natural history with some larvae living in ex-

treme habitats like hot springs, geysers or pools of crude

oil (Mathis 2010). Most shore fly larvae and adults are

typically microphagous on microscopic algae, yeasts and

other unicellular forms, but there are predaceous larvae

and adults, with some species preying on egg masses of

amphibians and spiders (Wirth et al. 1987).

The genus Athyroglossa Loew, 1860 belongs to the

Gymnomyzinae (Gymnomyzini) and is divided into

two subgenera, namely Athyrogiossa s. str. and Par-

athyroglossa Hendel, 1931. There are 36 species known

worldwide with records from the Nearctic (eight species),

the Neotropics (11 species), the Palaearctic (12 species),

the Oriental (one species) and the Australasian (five spe-

cies) Regions. In Europe only four species have been

recorded so far, and these were reviewed by Mathis &

Zatwarnicki (1990). The most recent comprehensive

diagnosis of the genus is given by Mathis et al. (2017).

All we know about the natural history of Athyroglossa

Received: 29.01.2021

Accepted: 05.03.2021

was published by Grimaldi & Jaenike (1983) and Kri-

vosheina & Ozerov (1990).

New material of Ephydridae has been collected all over

Europe since 2003 by the author, with the aim to pre-

pare identification keys to European species. One of the

first genera to be worked out was Athyroglossa and sur-

prisingly two undescribed species were discovered. Here

these two new species of Athyroglossa are described and

illustrated, and an identification key for the European

species of the genus is provided.

MATERIAL AND METHODS

Terminology follows Cumming & Wood (2017) and ge-

nus specific interpretations from Mathis et al. (2017).

Numbers of setae refer to one side of the body only. The

identification of previously described species was done

using Mathis & Zatwarnicki (1990). Nomenclature was

checked with the original descriptions. To investigate

the male terminalia the abdomen was dissected, macer-

ated for about three hours in an aqueous solution of so-

dium hydroxide NaOH,,,.. neutralized with acetic acid

CH,-COOH and stored together with the specimen in in

microvial filled with glycerine C,H(OH),. Indices are

defined in the text below. Labels of holotypes are list-

ed and numbered in the order found, commencing with

the uppermost. They are indicated with double quotation

marks. Line-breaks on labels are indicated by slashes. If

not noted otherwise, all specimens are collected by the

author, air dried, pinned on minuten and deposited in the

author's private collection (PJHS, Leer, Germany).

Corresponding editor: X. Mengual

Published: 08.04.2021

86 Jens-Hermann Stuke

Fig. 1. Habitus of Athyroglossa fennica spec. nov., holotype, 3.

RESULTS

Athyroglossa (Athyroglossa) fennica spec. nov.

(Figs 1, 3,9; 15, 21)

urn. lsid:zoobank.org:act:374E3C1C-15A0-4EBC-A79F-BOB14159325B

Type material

Holotype. FINLAND: <6; (1) ,,Fl Central Finland /

Kolima 3.7 km ese / Pihtipudas / [63,342°N 25,621°E] /

18.vu1.2020, leg. Stuke / 2667 [cross written]”. — (2) “Ho-

lotypus / Athyroglossa fennica 3 / spec. nov. 3 / Stuke

det. 2020”. [The specimen is pinned using a minuten and

is in excellent condition (Fig. 1). The holotype will be pre-

served in the collection of the Museum fiir Naturkunde —

Leibniz Institute for Evolution and Biodiversity Science,

Berlin, Germany (ZMB). ].

Paratypes. FINLAND: 1 <6, 18.vii.2020, Central

Finland, Kolima 3.7 km ESE Pihtipudas [63.342°N

25.621°E], leg. Stuke. — 1 @, 18.vii.2020, Central

Finland, Kolima 8.1 km ESE Pihtipudas [63,310°N

25:670°R)| les-Stuke:

Bonn zoological Bulletin 70 (1): 85—95

Description (holotype, ©)

Body length about 2.2 mm. Wing length = 1.9 mm. Head

height = 0.6 mm.

Head black. Gena-eye-ratio (in lateral view genal

height measured at the maximum eye height:eye

height) = 0.8. Antenna black. First flagellomere strongly

light brown dusted. Arista black, with 4—5 dorsal rays,

basal rays slightly shorter than height of basal aristomere.

Eye brown, all ommatidia about same size, no omma-

trichia recorded. Eye height-length-ratio (in lateral view

maximum eye height:maximum eye length) = 1.2. Ocelli

forming an isosceles triangle. Frons with distinct brown

dusting surrounding ocellar tubercle and reaching for-

ward to ptilinal fissure and posterolaterally to the dorsal

eye margin. Frontal triangle indistinct, reaching forward

to the ptilinal fissure. Frontal triangle polished, inter-

frontal vitta otherwise polished to very fine longitudinal

wrinkled. Facial grooves with indistinct facial carina.

Ventral face bulging and stretching ventrally beneath

the clypeus. Facial grooves and parafacia silver dusted.

Clypeus large, slightly wider than high, shiny, slightly

microsculptured. Gena large, polished in upper *%4 and

microsculptured in ventral ’4. Anteroventral margin and

©ZFMK

New European species of Athyroglossa Loew, 1860 from Finland and the Republic of Georgia 87

posteroventral margin of gena forming an angle of about

65°. Postcranium brown dusted to subshining. Palpus

brown, without setae. Proboscis reaching to mouth edge.

1 ocellar seta; 1 postocellar seta about as long as verti-

cal setae; 1 outer and 1 inner vertical seta; no postorbital

setae; 1 distinct reclinate and | distinct proclinate fron-

to-orbital-seta; 1 large dorsal, 1 smaller but still distinct

seta below and 3 minute facial setae; 1 distinct proclinate

genal seta.

Thorax black. Scutum finely microsculptured, scutel-

lum more roughly microsculptured. Scutum and scutel-

lum covered with short, brown, scattered setulae that are

not arranged in lines. Scutum medially distinctly dusted,

laterally shining. Scutellum subshining to shining. Ane-

pisternum with several setulae. Anepimeron, posterior

margin of anepisternum, meron, katatergite, subscute-

llum and dorsal *% of mediotergite dusted. Other pleu-

rae shining. no acrostichal seta; 0+1 dorsocentral seta;

O prescutellar seta; 1 intra-alar seta; O supra-alar seta:

1 small postpronotal seta; 2 notopleural seta, posterior

inserted above level of anterior; 0 postalar seta; 1 sub-

apical+3 indistinct lateral scutellar seta, only subapical

seta situated on a small tubercle; 1 small katepisternal

seta; | small anepisternal seta. Wing membrane slight-

ly brownish infuscated. Veins brown. Wing complete-

ly covered with microtrichia. Alula about four times as

wide as long. Dark brown setulae at hind margin of al-

ula about twice as long as alula. Costal index I (straight

line distance between the apices of R, and R,,, [section

2 of costa]:straight line distance between the apices of

R,,, and R,,, [section 3 of costa]) = 2.7. Costal index II

(straight line distance between the apices of R,,. and R,,,,

[section 3 of costa]:straight line distance between the api

ces of Media and R,,,. [section 4 of costa]) = 2.1. R,,.

vein-ratio (straight line distance along vein R,,, between

crossvein r-m and branch of R,,, and R,,, [Section | of

R,,,,|:distance apicad of r-m [section 2 of R,,.]) =0.1. M

vein-ratio (straight line distance along vein M between

crossveins dm-cu and r-m [section 1 of M]:distance

apicad of dm-cu [section 2 of M]) = 0.6. M vein-ratio

(straight line distance along vein M between crossveins

dm-cu and r-m:distance apicad of dm-cu) = 0.6. Base and

stem of halter brown, knob of halter black. Legs black

with tarsi lighter dark brown to yellow. Fore tarsi dark

brown, middle and hind tarsi brown. Legs mostly sub-

shining, all tibiae shining on dorsal surfaces. Legs cov-

ered with small setulae. Fore femur with conspicuous,

slightly longer, regular setulae arranged on posteroven-

tral surface, long setae anteroventrally towards the apex

of the middle femur and some regularly arranged pos-

teroventral setulae at the apex of the hind femur. Mid-

dle tibia distally with 2 ventral setae. Metatarsus II-tibia

II-ratio (length metatarsus 2:length tibia 2) = 0.5. Fore

femur distally with 2 inconspicuous posteroventral short

spines.

Bonn zoological Bulletin 70 (1): 85—95

Abdomen black. Tergites laterally reflexed under. Terg-

ites smooth. Tergite 1 completely dusted. Tergites 2+3

broadly dusted in the middle with a small shining hind

margin, dusted at the anterior margin and dusted at the

extreme lateral margin. Tergite 4 broadly dusted in an-

terior 2/3 of the middle and at the anterior margin. Terg-

ite 5 completely dusted dorsally. Tergites covered with

scattered black setulae. Tergite III-IV-ratio (length tergite

3 medially:length tergite 4 medially) = 0.9. Tergite I'V-

V-ratio (length tergite 4 medially:length tergite 5 medi-

ally) = 2.3.

Description of male postabdomen and sternites based

on | dissected paratype: Sternites 3—5 as shown in Fig. 3:

Sternites 3-4 moderately large, elongated. Sternite 5 di-

vided in two triangular sclerites. A small additional scler-

ite between sternites 4 and 5. Sternites 3—5 covered with

scattered setulae. Epandrium as Figs 9 and 15: hind mar-

gin about as long as cercus, without ventral protuberance

and therefore hind margin in lateral view almost straight.

Epandrium with minute setulae and hind margin behind

cerci with 4 strong setae. Cercus elongated, covered with

microtrichia and setae. Surstylus as Figs 9 and 15: elon-

gated, base broadened, dorsally concave, ventrally slight-

ly concave, posterodorsally separated from epandrium,

anteriorly upcurved and pointed anteromedially. No set-

ulae present on surstylus. Hypandrium as Fig. 21: with a

large anteriorly directed appendix that is almost as long

as wide and anteriorly hollowed out. Additionally, with

a narrow ventrally directed appendix. Postgonite elon-

gated, anteriorly rounded, dorsally almost straight, and

ventrally without indentation. Pregonite distinct, slight-

ly shorter than high, dorsally semicircular and ventrally

straight.

Variability. The dusting of the frons can cover almost

all of the frons. Wing may be almost hyaline. Apical tar-

someres may be black.

Female. Female unknown.

Diagnosis. This species is easily recognised by the com-

bination of black fore tarsi and long postocellar seta. The

only other Palearctic Athyroglossa with black fore tarsi is

A. flaviventris (Meigen, 1830), and it has a reduced pos-

tocellar seta. Additional characters to separate both spe-

cies are given in the key below. With the table of the West

Palearctic species presented by Mathis & Zatwarnicki

(1990) A. fennica spec. nov. will key out at couplet 4 with

the separation of A. flaviventris and A. glabra (Meigen,

1830) where a decision to one of the keys alternatives

is not possible anymore. In the key to Nearctic species

(Wirth 1970), A. fennica spec. nov. will be identified as

A. glabra.

©ZFMK

88 Jens-Hermann Stuke

Fig. 2. Habitus of Athyroglossa kuraensis spec. nov., holotype, @.

Etymology. The Latin female adjective “fennica” de-

scribes the known distribution of this new species that is

known thus far from central Finland.

Distribution. Although the author visited 128 locations

all over Finland to collect Ephydridae and several looked

very similar to the locations of A. fennica, this new spe-

cies was only recorded at two adjacent sites in central

Finland.

Ecology. All specimens were collected along man-made

shores with sparse vegetation of a lake. One locality is a

larger harbour, the other one a small area that is used for

fishing and bathing. Such localities are the only locations

where collecting Ephydridae was successful at large

Finnish lakes. At one of the locations A. glabra occurred

together with A. fennica spec. nov.

Bonn zoological Bulletin 70 (1): 85-95

Athyroglossa (Athyroglossa) kuraensis spec. nov.

(Figs 2, 6, 12, 18, 24)

urn: lsid:zoobank.org: act: 30B 1D772-4884-464 B-B308-86441830440B

Type material

Holotype. GEORGIA: 3; (1) “Georgia, Debeda River /

n Kirach-Mughanlo / (41,340°N 45,051°E) / 30.06.2019,

Stuke leg. / 2459 [cross written]”. — (2) “Holotypus

/ Athyroglossa kuraensis & / spec. nov. 3 / Stuke det.

2020”. [The specimen is pinned using a minuten and is

in excellent condition (Fig. 2). The holotype will be pre-

served in the collection of the Museum fiir Naturkunde —

Leibniz Institute for Evolution and Biodiversity Science,

Berlin, Germany (ZMB). |

Paratypes. GEORGIA: 4 33, 1 9: 30.vi.2019, Debe-

da River E of Kirach-Mughanlo [41,334°N 45,068°E];:

4 33,2 29; 30.vi.2019, Debeda River N of Khan-

ji-Gazlo [41,357°N 45,005°E], leg. Stuke. — 7 42,

322; 30.v1.2019, Debeda River n Kirach-Mughanlo

[41,340°N 45,051°E], leg. Stuke. — 1 9; 30.vi.2019,

Kura River 1.6 km E of Ilmazo [41,428°N 45,043°E],

©ZFMK

New European species of Athyroglossa Loew, 1860 from Finland and the Republic of Georgia 89

Figs 3-8. 3; sternites 3-5 (ventral view) of European Athyroglossa. 3. Athyroglossa fennica spec. nov. 4. A. flaviventris (Meigen,

1830). 5. A. glabra (Meigen, 1830). 6. A. kuraensis spec. nov. 7. A. nudiuscula Loew, 1873. 8. A. ordinata Becker, 1896. Abbrevi-

ations: S3 = sternite 3; S = sternite 5.

Bonn zoological Bulletin 70 (1): 85—95 ©ZFMK

90 Jens-Hermann Stuke

Figs 9-14. Epandrium, surstylus and cercus (dorsal view) of European Athyroglossa. 9. A. fennica spec. nov. 10. A. flaviventris

(Meigen, 1830). 11. A. glabra (Meigen, 1830). 12. A. kuraensis spec. nov. 13. A. nudiuscula Loew, 1873. 14. A. ordinata Becker,

1896. Abbreviations: ce: cercus, ep: epandrium, su: surstylus.

leg. Stuke. — 1 9; 30.vi.2019, Kura River 2.0 km ESE

Ilmazo [41,420°N 45,044°E], leg. Stuke.

Description (holotype, ©)

Body length about 2.3 mm. Wing length = 1.8 mm. Head

height = 0.7 mm.

Head black. Gena-eye-ratio (in lateral view genal

height measured at the maximum eye height:eye

height) = 0.7. Scape black, pedicel and first flagellomere

orange brown. First flagellomere strongly white dusted.

Arista black, with 9 dorsal rays, basal rays slightly longer

than width of basal aristomere. Eye brown, all ommatidia

about same size, with minute ommatrichia. Eye height-

length-ratio (in lateral view maximum eye height:max-

imum eye length) = 1.5. Ocelli forming an isosceles tri-

angle. Frons shining. Frontal triangle indistinct, reaching

Bonn zoological Bulletin 70 (1): 85—95

forward to the ptilinal fissure. Frontal triangle polished,

interfrontal vitta otherwise fine longitudinal wrinkled.

Facial grooves with indistinct facial carina. Ventral face

bulging and stretching ventrally beneath the clypeus.

Facial grooves and parafacia strongly silver dusted.

Clypeus large, slightly wider than high, shiny, slightly

microsculptured. Gena large, polished in upper 7% and

microsculptured in ventral “4. Anteroventral margin and

posteroventral margin of gena forming an angle of about

65°. Postcranium subshining. Palpus brown, without se-

tae. Proboscis reaching to mouth edge. Chaetotaxy head:

1 ocellar seta; 1 postocellar seta about as long as vertical

setae; 1 outer and | inner vertical seta; several minute

postorbital setae; 1 distinct reclinate fronto-orbital-seta

and 2 minute proclinate front-orbital setae; 1 large dorsal

©ZFMK

New European species of Athyroglossa Loew, 1860 from Finland and the Republic of Georgia 9]

Figs 15-20. Epandrium, surstylus, hypandrium and cercus (lateral view) of European Athyroglossa. 15. A. fennica spec. nov.

16. A. flaviventris (Meigen, 1830). 17. A. glabra (Meigen, 1830). 18. A. kuraensis spec. nov. 19. A. nudiuscula Loew, 1873.

20. A. ordinata Becker, 1896. Abbreviations: ce = cercus; ep = epandrium; hyp = hypandrium; hypb = hypandrial bar; phyp =

projection of hypandrium; su = surstylus.

and about 8 minute (difficult to see) facial setae; 1 dis-

tinct proclinate genal seta.

Thorax black. Scutum finely microsculptured, scutel-

lum more roughly microsculptured. Scutum and scute-

llum covered with short, brown, scattered setulae that

are not arranged in lines. Scutum medially subshining

to slightly dusted, laterally shining. Scutellum subshin-

ing. Anepisternum with several setulae. Posterior half of

anepimeron, meron, katatergite, subscutellum and dorsal

half of mediotergite dusted. Other pleurae shining. Chae-

totaxy thorax: no acrostichal seta; 0+1 dorsocentral seta;

O prescutellar seta; 1 intra-alar seta; O supra-alar seta:

1 small postpronotal seta; 2 notopleural seta, posterior

inserted above level of anterior; 0 postalar seta; 1 sub-

apical+1 lateral scutellar seta, both situated on small tu-

Bonn zoological Bulletin 70 (1): 85—95

bercles; 1 small katepisternal seta; 1 small anepisternal

seta. Wing membrane hyaline, indistinctly darker around

dm-cu. Veins white but dm-cu, middle part of R,,,, mid-

dle part of R,,, and apex of CuA, dark brown. Wing com-

pletely covered with microtrichia. Alula about twice as

wide as long. Dark brown setulae at hind margin of alula

about as long as alula.

Costal index I (straight line distance between the api-

ces of R, and R,,, [section 2 of costa]:straight line dis-

tance between the apices of R,,, and R,,. [section 3 of

costa]) = 3.0. Costal index II (straight line distance dis-

tance between the apices of R,,, and R,,, [section 3 of

costa]:straight line distance between the apices of Me-

dia and R,,. [section 4 of costa]) = 2.1. R,,, vein-ratio

(straight line distance along vein R,,. between crossvein

©ZFMK

92 Jens-Hermann Stuke

22 (ees

Figs 21-26. 3; Hypandrium (ventral view) of European Athyroglossa. 21. A. fennica spec. nov. 22. A. flaviventris (Meigen, 1830).

23. A. glabra (Meigen, 1830). 24. A. kuraensis spec. nov. 25. A. nudiuscula Loew, 1873. 26. A. ordinata Becker, 1896. Abbrevia-

tions: hypb = hypandrial bars; phyp = projection of hypandrium.

r-m and branch of R,,. and R,, [Section 1 of R

4+5 243 “il :dis-

tance apicad of r-m [section 2 of R,,.])=0.2. M vein-ratio

(straight line distance along vein M between crossveins

dm-cu and r-m [section 1 of M]:distance apicad of dm-

cu [section 2 of M]) = 0.5. Base and stem of halter light

brown, knob of halter white. Legs black with apex of fore

and hind tibiae yellow and middle tibia yellow. All 3 basal

tarsomeres light yellow. Legs partly silver to grey dusted

with middle tibia completely dusted. Legs covered with

small setulae. Obvious are slightly longer posteroventral

setulae on the fore femur. Middle tibia distally with 2

ventral setae. Metatarsus []-tibia II-ratio (length meta-

Bonn zoological Bulletin 70 (1): 85—95

tarsus 2:length tibia 2) = 0.5. Fore femur distally with 5

inconspicuous posteroventral short spines.

Abdomen black. Tergites laterally reflexed under. Terg-

ites smooth. Tergite 1 completely dusted. Tergites 2+3

broadly dusted in the middle. Tergite 4 broadly dusted

in anterior 2/3 of the middle, tergite 5 only with a small

central macula. Tergites covered with single brown setu-

lae. Tergite HI-I'V-ratio (length tergite 3 medially:length

tergite 4 medially) = 0.8. Tergite IV-V-ratio (length terg-

ite 4 medially:length tergite 5 medially) = 2.2.

Description of male postabdomen and sternites based

on 3 dissected paratypes: Sternites 3—5 as shown in

©ZFMK

New European species of Athyroglossa Loew, 1860 from Finland and the Republic of Georgia 93

Fig. 27. Records of Athyroglossa kuraensis spec. nov.

Fig. 6: Sternite 4 large, almost square, sternite 3 small-

er. Sternite 5 divided into 2 large triangular sclerites. No

additional sclerite between sternites 4 and 5. Sternites

slightly dusted and with scattered setulae. Sternite 5 with

obvious long setae on the hind margin. Epandrium as

Figs 12, 18: hind margin with 10 strong setae and without

ventral protuberance and therefore hind margin in later-

al view almost straight. Cercus elongated, covered with

microtrichia and setae. Surstylus as Figs 12, 18: elongat-

ed, dorsally convex, ventrally concave, posterodorsally

fused with epandrium. Surstylus with few minute setulae.

Hypandrium as Fig. 24: with a large anteriorly directed

appendix that is almost as long as wide. Postgonite elon-

Bonn zoological Bulletin 70 (1): 85-95

gated, pointed, dorsally almost straight, and ventrally

with a subapical indentation. Pregonite distinct, with an

almost circular base and a pointed anterior tip.

Variability. The colouration of mid tibia varies between

yellow and light brown. The amount of dusting on scu-

tum may be less in older specimens.

Female. Females do not differ from males other than in

characters of the postabdomen.

Diagnosis. Athyroglossa kuraensis spec. nov. has a re-

duced postocellar seta, white halteres, dark brown to

©ZFMK

94 Jens-Hermann Stuke

black fore and hind tibiae and white basal fore tarsomeres

and therewith can be only confused with 4. nudiuscula.

A. nudiuscula Loew, 1873 is compared with A. kuraen-

sis spec. nov. in the key below. The most obvious diag-

nostic character of A. kuraensis spec. nov. is the slightly

dusted scutum and scutellum. With the table of the West

Palaearctic species of Mathis & Zatwarnicki (1990)

A. kuraensis spec. nov. will be identified as non-Euro-

pean A. argyrata. Both species share important charac-

ters, such as dusting of the scutum and scutellum, white

veins at the wing base and antenna that are partly orange.

However, 4. argyrata has a distinctly microsculptured

face below the antennal grooves (polished in A. kuraen-

sis), light yellow orange hind tibia (brown to black in

A. kuraensis), dorsally shining middle tibia (completely

dusted in A. kuraensis spec. nov.) and obviously dusted

parafacial and facial ridge (only parafacial partly dusted

in A. kuraensis spec. nov.).

Etymology. This species is named after the Kura river.

The type material originates from the Kura and its tribu-

tary, the Debeda river.

Distribution. Although Ephydridae have been collect-

ed all over eastern Georgia and suitable habitats with

other Athyroglossa species have been visited regularly,

A. kuraensis spec. nov. has only been recorded thus far

from a very small area at the border with Azerbaijan

(Fig. 27).

Ecology. All specimens of A. kuraensis spec. nov. were

collected by sweeping at shores of the Debeda or Kura

rivers or a nearby gravel pit with little or no vegeta-

tion. Sympatric species of Athyroglossa recorded at the

locations are A. nudiuscula and A. ordinata. However,

A. kuraensis spec. nov. was the most numerous species

among the collected specimens of Athyroglossa.

Key to European species of Athyroglossa Loew, 1860

1. Halter whitish; postocellar seta less than half the

length of vertical setae; arista with more than seven

branches, the longest of these longer than width of

basal flagellomere; < sternite 4 distinctly wider than

sternite 3, no additional sclerite between sternite 4 and

sternite 5 (Figs 6, 7); ¢ terminalia with epandrium

almost orbicular, posteriorly without protuberance,

and not reaching to tip of cercus (Figs 12-13, 18—

19); hypandrium narrow, hypandrial bars anteriorly

separated by an area of less strong sclerotisation,

and with a distinct anteriorly directed protuberance

ORT Pct PEE ae ee i i Se al ee 2

— Halter dark brown to black; postocellar seta longer

than half the length of vertical setae (exception

flaviventris), arista with less than seven branches

that are often shorter than the width of the first

Bonn zoological Bulletin 70 (1): 85-95

flagellomere; ¢ sternite 4 at most slightly wider than

sternite 3; a small additional sclerite between sternite

4 and sternite 5 (Figs 3-5, 8); 4 terminalia with

epandrium elongated or orbicular, sometimes with a

posterior protuberance; reaching or not reaching to

tip of cercus; hypandrial bars anteriorly fused, and

without distinct anteriorly directed protuberance

(Figs 9-11, 14-17, 20-23, 26) ooo. 3

Scutum shiny; scutellum almost flat, microsculptured,

shiny; tergites 3-4 at most dusted at hind margin;

middle tibia mainly black, dorsally shiny; veins

brown; <@ sternites 3-5 as Fig. 7: sternite 5 divided

into two triangular sclerites with short setae only; ¢

terminalia as Figs 13, 19, 25: anteriorly directed

protuberance of hypandrium wider than long ..........

O28 Fee We oe One nudiuscula Loew, 1873

Scutum with broad medial stripe of slight dusting;

scutellum smooth, convex and slightly dusted all

over; tergite 3 dusted medially over its whole length,

tergite 4 dusted medially for more than half of its

length; middle tibia mainly orange-yellow to light

brown, completely silver dusted; veins in basal half

of wing white; 3 sternites 3-5 as Fig. 6: sternite

5 divided into two ovate sclerites with long apical

setae; 3 terminalia as Figs 12, 18 & 24: anteriorly

directed protuberance of hypandrium about as wide

AS OTOP Mares ew Mn Bee wee kuraensis spec. nov.

Setulae on scutum in lines; fore femora without

posteroventral stout black setulae; scutellum convex,

polished; 3 sternites 3-5 as Fig. 8: sternites 3-4

elongated; sternite 5 divided into two small elliptic

sclerites, distance between these sclerites about

as long as maximum width of one sclerite; ¢

terminalia as Figs 14, 20, 26: epandrium elongated,

posteriorly with protuberance; almost reaching to tip

of cercus; hypandrium with posterodorsally directed

protuberance (Figs 14, 20) ... ordinata Becker, 1896

Setulae on scutum not arranged in lines; fore femora

with posteroventral stout black setulae; scutellum

flat, distinctly microsculptured; 3 at least sternite 4

broader, sternite 5 divided into two larger sclerites,

distance between these sclerites less than maximum

width of one sclerite (Figs 3—5); epandrium less

elongated, posteriorly without protuberance,

not reaching to tip of cercus (Figs 9-11, 15-

17); hypandrium without posteriorly directed

protuberance CF tes 21-23)... i evccccse thous deivssFamvetects 4

Postocellar seta minute, about as long as diameter

of ocellus; pedicel and base of basal flagellomere

orange; fore tarsi dark brown to black; frons shining;

parafacia silver dusted right next to antennal

groove; tergite 4 shiny, only narrowly dusted at fore

margin; 3 sternites 3-5 as Fig. 4: sternite 4 large,

broader than sternite 3; 3 terminalia as Figs 10, 16,

22: hypandrium a large sclerotised plate without

©ZFMK

New European species of Athyroglossa Loew, 1860 from Finland and the Republic of Georgia 95

distinct hypandrial bars; surstylus distally pointed

and curved upwards ......flaviventris (Meigen, 1830)

— Postocellar seta as long as vertical setae; at least

pedicel black; fore tarsi dark brown to black or

yellow; frons shining or partly dusted: parafacia at

eye margin completely shining or silver dusted up to

ventral eye margin; tergite 4 can be more dusted; 3

sternite 4 about as broad as sternite 3; hypandrium

smaller and with distinct hypandrial bars (Figs 21,

23); surstylus distally not curved upwards (Figs 9,

LPR sl NS ets crated. sthaatraaseata diate Mad ae cteanscalaacene, 2a 5

5 Basal two tarsomeres of all legs yellow white:

parafacia completely shining; frons completely

shining, might be subshining in some specimens;

scutum shining; tergite 4 shining, only narrowly

dusted at fore margin; 3 sternites 3-5 as Fig. 5:

sternites 3-4 large, about as broad as wide and

broader than sternite 5; 4 terminalia as Figs 11, 17,

23: epandrium in front of cerci narrow; surstylus

straight, apically rounded; hypandrium narrow and

with small lateral evaginations ..............000.cceeee

1 Saeeeerr 1). Ste eee, 2S glabra (Meigen, 1830)

— All fore tarsomeres black or dark brown, all other

tarsi at least partly black; parafacia dusted along

anteroventral eye margin: frons partly dusted; scutum

at least dusted in the centre; tergite 4 dusted for more

than half of its length in the middle; 3 sternites 3—5

as Fig. 3: sternites 3-4 narrow, distinctly narrower

than long and narrower than sternite 5; 4 terminalia

as Figs 9, 15, 21: epandrium in front of cerci

broad; surstylus slightly s-shaped, apically straight;

hypandrium broad and apically obviously indented

fennica spec. nov.

Acknowledgments. Eliana Buenaventura, Sven Marotzke and

Jenny Pohl, all from the Diptera collection of the Berlin Muse-

Bonn zoological Bulletin 70 (1): 85—95

um, helped to organise a loan of Athyroglossa specimens. Jenny

Pohl in particular invested much time searching for a historical

specimen of A. flaviventris. The Alexander Koenig Research

Museum supported the collecting trip to Georgia. Tony Irwin

(Norwich) and Wayne N. Mathis (Washington) read an earlier

draft of this manuscript, corrected the English and gave valu-

able hints.

REFERENCES

Cumming JM, Wood DM (2017) Adult morphology and termi-

nology. Pp. 89-133 in: Kirk-Spriggs AH, Sinclair BJ (eds)

Manual of Afrotropical Diptera. Volume 1. Introductory

chapters and keys to Diptera families. Suricata 4. Pretoria

Grimaldi DA, Jaenike J (1983) The Diptera breeding on skunk

cabbage, Symplocarpus foetidus (Araceae). Journal of the

New York Entomological Society 91: 83-89

Krivosheina M, Ozerov AL (1989) [Ecology and Morphology

of the Larvae of Athyroglossa glabra Meigen (Diptera, Eph-

ydridae) — Living in Corpses of Vertebrate Animals], in Rus-

sian. Biologi¢eskie Nauki 5: 47-50

Mathis WN (2010) Ephydridae (shore flies). Pp. 1211-1233 in:

Brown BV, Borkent A, Cumming JM, Wood DM, Woodley

NE, Zumbado MA (eds) Manual of Central American Dip-

tera. Volume 2. NRC Research Press, Ottawa

Wirth WW, Mathis WN, Vockeroth JR (1987): Ephydridae. Pp.

1027-1048 in: McAlpine, JF, Peterson, BV, Shewell, GE,

Teskey, HJ, Vockeroth, JR, Wood, DM (eds.): Manual of Ne-

arctic Diptera. Volume 2. Monograph of the Research Branch

Agriculture Canada 11, Ottawa

Mathis WN, Zatwarnicki T (1990) A Revision of the Western

Palearctic Species of Athyroglossa (Diptera: Ephydridae).

Transactions of the American Entomological Society 116:

103-133

Mathis WN, Zatwarnicki T, Stuke J-H, Deeming JC (2017) Or-

der Diptera, family Ephydridae. A conspectus on shore-flies

from the United Arab Emirates. Arthropod Fauna of the UAE

6: 636-761

Wirth WW (1970) A new Athyroglossa with a key to North

American species (Diptera: Ephydridae). Journal of the Kan-

sas Entomological Society 43: 315-319

©ZFMK

BHL

Blank Page Digitally Inserted

Bonn zoological Bulletin 70 (1): 97-113

2021 - Gebicki C. et al.

https://do1.org/10.20363/BZB-2021.70.1.097

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:|sid:zoobank.org:pub:7EE18761-DDC9-46CB-B41A-30295DF72E24

Ugyopini of New Caledonia

(Hemiptera: Fulgoromorpha: Delphacidae: Asiracinae)

with a description of Notuchus linnavuorii sp. nov.

Cezary Gebicki', Marcin Walczak”", Piotr Krupa’ & Malgorzata Kalandyk-Kolodziejczyk*

"3 Jan Dilugosz University in Czestochowa, Faculty of Science & Technology, Armii Krajowej 13/15,

PL-42-200 Czestochowa, Poland

2 4University of Silesia, Faculty of Natural Sciences, Institute of Biology, Biotechnology and Environmental Protection,

Bankowa 9, PL-40-007 Katowice, Poland

“Corresponding author: Email: marcin.walczak@us.edu.pl

'urn:lsid:zoobank.org:author:}6FC4935A-D82E-45BE-BD77-8E9EFEB9BFDD

?urn:lsid:zoobank.org:author:046FOD52-7FBA-4D7D-9F79-AEBF7F2C98B8

3urn:Isid:zoobank.org:author: BA76E970-D883-457E-B171-DBE1C8012232

*urn:Isid:zoobank.org:author:600C5C5B-38C0-4F26-99C4-40A4DC8BBO016

Abstract. The paper presents information about species of Ugyopini, Fennah, 1979 from New Caledonia. One new spe-

cies from New Caledonia is described, Notuchus linnavuorii sp. nov., with notes on the morphological details of selected

external structures. An identification key to all of the species of Notuchus Fennah, 1969 and a checklist of the species

of this genus are also provided. The male terminalia of three species of the genus Ugyops Guérin-Méneville, 1834 (U.

inermis Distant, 1920, U. nemestrinus Fennah, 1969 and U. taranis Fennah, 1964) are described and illustrated for the

first time.

Key words. Delphacidae, Ugyopini, Notuchus, Ugyops, new species, key to species, checklist, New Caledonia.

INTRODUCTION

The genus Notuchus Fennah, 1969 (type species Notu-

chus risioides Fennah, 1969) together with the genera

Canyra Stal, 1862 (type species — in original combina-

tion: Delphax placida Stal, 1854), Melanugyops Fen-

nah, 1956 (type species Melanugyops erebea Fennah,

1956), Perimececera Muir, 1913 (type species Per-

imececera giffardi Muir, 1913), Ugyopana Fennah, 1950

(type species Ugyopana cassia Fennah, 1950), Ugyops

Gueérin-Méneville, 1834 (type species Ugyops percher-

onii Guérin-Meéneville, 1834), and Serafinanat Gebicki

& Szwedo, 2000 (type species Serafinana perperunaet

Gebicki & Szwedo, 2000) comprise the tribe Ugyopi-

ni within the Asiracinae subfamily (Gebicki & Szwedo

2000; Urban et al. 2010; Bourgoin 2020). The genus Notu-

chus comprises nine endemic species, which are found

in Australia (Queensland) — N. kurandae Donaldson,

1979 (syn. N. palmerstonensis Donaldson), N. oresbios

Donaldson, 1988 and N. rotundifacies Donaldson, 1979

(Donaldson 1979, 1983, 1988); on Lord Howe Island —

N. howensis Donaldson, 1987 and N. monticola Fennah,

1973 (Donaldson 1987; Fennah 1973); in New Caledo-

nia — N. risioides Fennah, 1969, and three cavernicolous

species known only from New Caledonia: N. kaori Hoch

Received: 21.01.2020

Accepted: 18.02.2021

& Asche, 2006, N. /arvalis Fennah, 1980 and N. ninguae

Hoch & Asche, 2006 (Fennah 1980; Hoch et al. 2006).

The representatives of this genus differ significantly from

other Delphacidae in their general exterior and head mor-

phology, which partly results from their hidden, epigeic

life in the rainforest floor (Hoch et al. 2006).

N. linnavuorti Gebicki & Walczak sp. nov. represents

the species group monticola as its only representative in

New Caledonia. In its external structure, the species is

most closely related to Australian N. oresbios Donaldson,

1988. The other species from New Caledonia are char-

acterised by a distinctively different structure (especially

the head). N. risioides Fennah, 1969, which represents

the species group risioides, is distinguished by a short-

ened preocular part of the head, and N. kaori Hoch &

Asche, 2006 and N. ninguae Hoch & Asche, 2006, rep-

resentatives of species group /arvalis, are characterised

by advanced troglomorphism. The majority of known

species of the genus Notuchus is characterised by a dor-

soventrally flattened body (especially by a flattened head)

with three clearly visible keels on its lateral margins and

shortened, sclerotised, short and thick forewings (hind-

wings are rudimentary), which are morphological adap-

tations for living in leaf litter and in detritus (upper layer

of detritus) (Hoch et al. 2006).

Corresponding editor: R. Peters

Published: 08.04.2021

98 Cezary Gebicki et al.

The largest genus within the tribe Ugyopini is Ugyops

Guérin-Meéneville, which contains 101 species of which

many are endemic (Asche 1985). It is probably a taxon

of a Gondwanan origin comprising the species that cur-

rently inhabit two isolated areas: the Neotropical region

(from the Antilles to central Brazil) and the Indo-Aus-

tralian region (extending in the North to Central China

and Japan, in the West to the Seychelles, in the East to

some of the islands of Oceania including New Caledo-

nia). There are two recognised subgenera within the ge-

nus Ugyops: U. (Ugyops) Guérin-Meéneville, 1834 and

U. (Paracona) Fennah, 1965 of which the nominative

subgenus contains most of the species, whereas the other

comprises two species that are known only from New

Zealand (Muir 1923; Fennah 1965).

Morphological descriptions of many species of the genus

Ugyops Guérin-Meéneville are not very precise, especially

descriptions of male genitalia are missing (Fennah 1969,

1973; Donaldson 1983). Therefore, it seems justified to

supplement morphological descriptions using scanning

electron microscopy (SEM) and complete information

about male genitalia and male terminalia, which are now

widely considered in recent descriptions of species of

Ugyopini (Hoch et al. 2006).

MATERIAL AND METHODS

The studied material belongs to the collection of the Up-

per Silesian Museum in Bytom (USMB, Poland). It was

collected in December 2006 and March-April 2008. To

collect the specimens, a standard entomological sweep-

net, (O = 0.35 m), a light trap (bulb “MIX”-type 250 W,

E40) and pitfall traps were used.

The specimens were mainly identified based on the

structure of the genital apparatus. The structures were ex-

tracted from the body and mounted using a 10% solution

of KOH according to the procedure developed by Knight

(1965). The material was identified on the basis of the

following keys: Distant (1920), Fennah (1964, 1969),

Donaldson (1979, 1988) and Hoch et al. (2006).

The specimen from the genus Notuchus was quite dirty

(this species lives on the surface of the ground and in its

top layers). Using an ultrasonic cleaner did not give posi-

tive results. For this reason, we used the cleaning method

of Schneeberg et al. (2017). For the SEM, the specimen

was treated with 5% KOH for 14 h at room temperature

(22°C). After the treatment, the KOH was removed with

distilled water. Next, the specimen was dehydrated in an

ascending ethanol/water series (70, 80, 96 and 100% eth-

anol and 100% acetone; in 70-96% ethanol for 15 min in

each concentration, in 100% ethanol and 100% acetone

for one hour each with four reagent changes) and then

dried. The specimens of Ugyops were also cleaned in an

ultrasonic washer, which gave much better results than

Bonn zoological Bulletin 70 (1): 97-113

for the specimen of Notuchus. A method of Kantursk1

et al. (2015) was adapted and used to dehydrate and dry

the specimens. The material was dehydrated in a graded

ethanol/water series of 75%, 80%, 90%, 95% and 100%

for 10 min in each concentration with three 100% etha-

nol changes. The dehydrated samples were then dried in

hexamethyldisilazane (HMDS).

Color photographs of the specimens were obtained us-

ing a Leica M205C stereo microscope, a Leica DFC495

camera and the Leica application suite ver. 4.9.0. The

photographs of the genital structures were obtained us-

ing a Nikon Eclipse E-600 biological microscope with

a Nikon DS-Fi2 digital camera and NIS Elements ver.

4.10.

The SEM examinations were conducted in the Labora-

tory of Scanning Microscopy of the Jan Diugosz Univer-

sity, Czestochowa, Poland using a Tescan VEGA 3 SBU

scanning electron microscope equipped with an X-ray

EDS spectrometer (OXFORD X-ACT PENTAFET Pre-

cision) in the low-vacuum mode and at the Institute of

Biology, Biotechnology and Environmental Protection

of the Faculty of Sciences of the University of Silesia

in Katowice, Poland using a Phenom XL field emission

scanning electron microscope in the low-vacuum mode.

The samples for SEM analyses were mounted on alumin-

ium stubs using double-sided adhesive carbon tape. In

contrast to the methods that are usually used in morpho-

logical studies, the specimens were not sputter-coated

with a film of electrically conductive material. However,

the specimens were covered with anti-static spray. Us-

ing such methods and equipment enable relatively good

quality photos to be obtained without destroying the

specimens, which should be returned to the museum in a

good condition (Gorczyca et al. 2019).

Using scanning microscopy made it possible to obtain

high-quality images, including the overall morphology

of the specimens, the legs in detail and the distribution

and types of the sensilla on the antennae. The classifica-

tion and description of the sensilla are based on Altner

& Prillinger (1980), Stacconi & Romani (2011) and Zhu

et al. (2019). The morphological terminology of the head

is adopted from Holzinger et al. (2003).

Despite the fact that the described specimen of Notu-

chus linnavuorii sp. nov. was a single female, it was dis-

tinguished by a set of morphological features (especially

concerning the head and mesonotum). The morphologi-

cal features of this species make it possible to distinguish

it from other similar species of the genus Notuchus Fen-

nah, 1956, especially from Notuchus oresbios Donald-

son, 1988, which is a morphologically similar species.

All of the known species of the genus Notuchus live

hidden in the forest litter and under mosses (except for a

few cavernicolous species), which is the reason that often

only a few specimens are collected. A large number of

specimens is rarely obtained without using specific col-

lection methods.

©ZFMK

Ugyopini of New Caledonia with a description of Notuchus linnavuorii sp. nov. 99

Abbreviations

Quoting the labels of specimens: (//) is used to divide the

data on the different rows on a label, (;) is used to divide

the data from different labels and ([]) is used for the au-

thors’ comments.

RESULTS

Notuchus linnavuorii Gebicki & Walczak sp. nov.

(Figs 1-4)

urn: |sid:zoobank. org: act:6 D3BBF9F-A2F9-4011-81C8-B1EBA72162A6

Delphacidae Leach, 1815

Ugyopini Fennah, 1979

Notuchus Fennah 1969

Notuchus linnavuorii Gebicki & Walczak sp. nov.

Etymology. The name of this new species is dedicated

to Professor Linnavuori, a Fulgoromorphan and Heter-

opteran specialist.

Material examined

Holotype. 1 8 // Notuchus linnavuorii sp. nov. // Gebic-

ki & Walczak det. 2015 [red label]; New Caledonia (N)

// 21°00.318’ S, 165°14.605’ E // Tchamba (Wao Uni),

20.03.2008 // from refuge to 500 m // leg. R. Dobosz;

5915/26293 // coll. Upper Silesian Museum // (USMB)

Bytom, Poland.

Description

Body. Oval (Fig. 1A, D), dorso-ventrally flattened

(Fig. 1C).

Head. Broad, delta-shaped, vertex acutely rounded.

Coronal keel relatively high, reaching % of the vertex

where it bifurcates. Vertex flat with a distinct concavi-

ty in the apical area (Fig. 2A). Frons with two pairs of

flattened lateral keels that surround its weakly concave

surface. The area between the keels is regularly arcuate

and slightly concave, its maximal width at the level of

antennae is almost three times narrower than the widest

part of middle frons. Frons arcuately tapering towards the

vertex, at its base almost straight with broad ventral mar-

gin. Additional pair of short keels stretching from dorsal

margin of the eye to the apex of the head, which together

with anterolateral keels form characteristic longitudinal

concavity above the eye. Postclypeus broad with arcuate

margins and with light-colored median keel. Anteclypeus

triangular, distinctly shorter than postclypeus with a dis-

tinct median keel. Mouthpart long, reaching the base of

hind legs (Fig. 2B). Rostrum very long, its tip exceeds

the line between hind coxae considerably (Figs 1B, 2D).

Compound eye slightly oval, its posterior margin with

antenna hollow. Eye length (in lateral view) approxi-

mately equal to the length of the part of head anterior

Bonn zoological Bulletin 70 (1): 97-113

to eyes. Ocelli absent. Scapus of antennae with slight-

ly convex lateral margin, pedicellus apically expanding

with numerous placoidal sensilla, which concentrate to

form basal and apical groups (Fig. 3A—B). Apical part

of pedicellus is covered with numerous minute spines,

which are distinctly separated from wide scale-like struc-

tures that cover its basal part (Fig. 3D). A few rather long

spines and more numerous short fine ciliate structures are

evenly distributed among sensilla placoidea (Fig. 3C—D).

Pronotum. Clearly differentiated medial part with

three distinct keels and two lateral parts in the form of flat

plates. Lateral keels arcuate and indistinctly connected to

the posterior margin of pronotum. The structure of lateral

plates forms a cleavage in which basal margins of wings

are located (Fig. 2A).

Mesonotum. In the middle line about 1.5 times larger

than pronotum with three distinct high keels. Its anterior

margin joins pronotum at 4 of the length of its lateral

plates. Median keel bears the mark of the scutellum con-

nection (Fig. 2A).

Tegmina. Coriaceous, strongly shortened and distally

truncated. In medial and clavial parts, strongly convex;

in costal part, flattened and slightly upturned. Both teg-

mina and wings adhere to each other along the medial

margin, narrowly bordered and apically arcuately round-

ed. In basal part, two protrusions formed at the veins R

and M+Cu. Longitudinal veins indistinct with undulating

course and with numerous transverse veins, supposedly

vena spuria. Tegulae absent (Figs 1D, 2A).

Legs. Prothoracic and mesothoracic legs without

spines along tibia but with a row of high chaetae. Their

tarsal segments I and II are small, the third is the longest

and is apically enlarged (Fig. 2C—D). Metathoracic legs

with three strong spines on the ventral margin of tibia,

the convex dorsal margin fits into the shallow elongated

indentation of the femur.

Pattern arrangement of metatibial spines. 2+3, with

the first one being the longest. Post-tibial calcar in cross

section almost round and apically acuminate. The apex

of the basal and medial segment of the tarsus with spines

arranged in a way typical of the Ugyopini and Eodelpha-

cini tribes (Figs 1B, 2E).

Abdomen. With three distinct longitudinal tergal keels

with spikes (Fig. 1D). Ventral plates of pygofer convex,

truncated at the apex. Ovipositor longer than pygofer,

does not extend over the anal tube (Fig. 4A). Broad plates

of the anal tube are joined together on the ventral side

(Fig. 4B).

Ovipositor. Second pair of gonopophyses slightly

arched downwards near apex (Fig. 4C), their dorsal edges

covered with numerous homogenous denticles (Fig. 4D).

Third pair of gonopophyses with strong sclerotised thick-

ening at the basal part and over its entire length (Fig. 4E).

Measurements. Total body length 4.68 mm; maxi-

mal body width 2.56 mm; head length (in its coronal

part) 0.52 mm; head width (at its base) 0.69 mm; head

©ZFMK

100 Cezary Gebicki et al.

1mm

Fig. 1. Notuchus linnavuorii sp. nov., °. A. Dorsal view. B. Ventral view. C. Lateral view. D. Dorsal view, SEM.

Bonn zoological Bulletin 70 (1): 97-113 ©ZFMK

Ugyopini of New Caledonia with a description of Notuchus linnavuorii sp. nov. 101

width (including eyes) 1.35 mm; eye length (in dorsal

view) 0.48 mm; pronotum length (along the median keel)

0.41 mm; pronotum length in its lateral part 0.56 mm;

total pronotum length 2.21 mm; width of the median part

of pronotum (between lateral keels) 0.63 mm; mesono-

tum length 0.78 mm; mesonotum width (at its anterior

margin) 1.41 mm; tegmina length 1.47 mm; length of

the ventral edge of tegmina 0.73 mm; tegmina width

1.34 mm; length of the visible part of abdomen 2.02 mm;

maximal abdomen width 2.49 mm.

Fig. 2. Notuchus linnavuorii sp. nov., 2°. A. Head and thorax with brachypteric wings, dorsal view. B. Front of head. C. First pair

of legs (1). D. Second pair of legs (II) and fragment of labium (La). E. Third pair of legs (III) with calcar (Ca) and teeth (To) in the

distal part of the tibia.

Bonn zoological Bulletin 70 (1): 97-113

©ZFMK

102 Cezary Gebicki et al.

Coloration. General body coloration almost uniformly

greyish-brown. The base of abdomen, thorax and frons

black. Along the anterolateral and interolateral keels of

frons, alternate yellow and black spots present (6 each).

Similar spots (three each) are present on the ventral side

of lateral keels of pronotum. Vertex yellow. Lateral plates

of pronotum with long black blurred spots. Tegmen

brownish, its costal parts distinctly lighter. Longitudinal

veins slightly darker than the rest of the wing. Legs dark.

mae

ae \

|) 4," e?e

oo Se 2

OP Sees &

Apical parts of pro and mesotibia yellowish, metatibia

uniformly dark (Fig. 1A—C).

Distribution. Endemic for New Caledonia.

Remarks. Notuchus linnavuorii sp. nov. is differenti-

ated from the other species in the same genus by a set

of features: a well-developed compound eye, vertex in

the lateral view extending anterior to eyes for about the

Fig. 3. Notuchus linnavuorii sp. nov., ° (SEM). A. Antenna: scapus (Sc) and pedicellus (Pe). B. Pedicellus with sensors structure:

sensilla trichoidea (ST), sensilla placoidea (SP). C. Fragment of pedicellus: ciliate structure (CiS), conoidal structure (CS), sensilla

placoidea (SP), sensilla trichoidea (ST). D. Fragment of pedicellus: ciliate structure (CiS), conoidal structure (CS), squamates

structure (SS).

Bonn zoological Bulletin 70 (1): 97-113

©ZFMK

Ugyopini of New Caledonia with a description of Notuchus linnavuorii sp. nov. 103

length of an eye, marginal carinae distinctly visible inthe feature and the vertex ratio differentiate N. /innavuorii

dorsal view, vertex with a ratio of total length in midline — sp. nov. from its closest Australian species N. oresbios

to length anterior to eyes >1.8; vertex acutely rounded, Donaldson, 1988.

mesonotum with median carina weakly curved. The last

Fig. 4. Notuchus linnavuorii sp. nov., 29. A. Abdomen from below. B. Abdomen from above. C. Left median gonapophysis. D.

Distal part of left median gonapophysis. E. Ovipositor external valvae. A-B.: SEM.

Bonn zoological Bulletin 70 (1): 97-113 ©ZFMK

104 Cezary Gebicki et al.

Key to the males and females of the species

of the genus Notuchus Fennah, 1969

The key is based on partial keys (Donaldson 1979, 1988;

Hoch et al. 2006) and has been supplemented and mod-

ified.

1. Eyes reduced; length of vertex less than half width

at base; surface dorsal and ventral part of the head

of imaginal stage without distinct carinae. Tegmina

vestigial. Endemics of New Caledonia: species

TOU LOLVAUIS 6 csc ccotic ccs ough ence dite act idies spengate gtd mantis th 2

— Eyes normal; vertex more than half width at base;

head with distinct carinae. Tegmina short but

converge:on the dorsallsurface oi... cede teeeaisheess 4

2. Tegmina foliated, veins visible .......000000000

SRE Shs Meg eR ct AACR la N. larvalis Fennah, 1980

Tegmina narrowly lanceolate, veins reduced ......... 3

3. Anterior margin and lateral portion of pronotum pale

yellow; rostrum very long reaching anterior margin

of genital segment in male and reaching posteriorly

to mid-length of ovipositor in female; ventrocaudal

margin of male genital segment bilobate; sclerite of

flagellum membrane taeniform ...........000...c0eee

NEL tn ee. N. kaori Hoch & Asche, 2006

— Thorax uniformly white; rostrum shorter not

reaching anterior margin of genital segment in male

and reaching proximal third of ovipositor in female;

ventrocaudal margin of male genital segment

medially shallowly incised; sclerite of flagellum

PEMA DRAM CMM LORIN a t0 0 8 Mae Rtek Foreman Ae

flaps cetorde <leeaa dt. Be N. ninguae Hoch & Asche, 2006

4. Vertex with ratio of total length in midline to length

anterior to eyes < 1.8: species group monticola ....5

— Vertex with ratio of total length in midline to length

anterior to eyes > 2: species group risioides .......... 8

5. Marginal carinae not visible in dorsal view; vertex

very long, length anterior to eyes significantly more

than width at base (Lord Howe Isl.) ...........0000000.

Seer he das Me N. monticola Fennah, 1973

— Marginal carinae distinctly visible in dorsal view;

vertex shorter, length anterior to eyes at most equal

LOMA, AtsBASG Inc 5287008 Wr 8 NO oe oe oe ee eee 6

6. Vertex rounded, in lateral view extending anterior to

eyes for about length of an eye (Lord Howe Isl.) ....

pier Fs ca FR tans Seal abe N. howensis Donaldson, 1987

WerlexrdCulely NOUNS Gs at Sarna tccetcysatiep saat: t

7. Vertex in lateral view extending anterior to eyes for

more than length of an eye; mesonotum with median

carina strongly convex in lateral view (Donaldson

1988: Fig. 2) (Australia, Queensland) ........0......0..

Cee ee N. oresbios Donaldson, 1988

— Vertex in lateral view extending anterior to eyes at

most for length of an eye; mesonotum with median

carina only slightly convex in lateral view (New

Caledonia) .0H. nS aa, N. linnavuorii sp. nov.

Bonn zoological Bulletin 70 (1): 97-113

8. Frons with lateral margin angulate below level of

eyes (New Caledonia) .....N. risioides Fennah, 1969

— Frons with lateral margins evenly curved below level

of eyes (Australia, Queensland) ........00.0..c0 9

9. Frons generally convex, lateral areas not depressed

below level of median area; length of median area in

midline usually > 1.6 times greatest width ...............

is WR Oren ey N. rotundifacies Donaldson, 1979

— Frons concave, lateral areas distinctly depressed

below level of median area; length of median area in

midline usually > 1.6 times greatest width ..............

ees x15 1 a ee N. kurandae Donaldson, 1979

Checklist of species of the genus Notuchus Fennah,

1969

Species group Jarvalis

I. Notuchus kaori Hoch & Asche, 2006

2. Notuchus larvalis Fennah, 1980

3. Notuchus ninguae Hoch & Asche, 2006

Species group monticola

4. Notuchus howensis Donaldson, 1987

5. Notuchus linnavuorii sp. nov.

6. Notuchus monticola Fennah, 1973

7. Notuchus oresbios Donaldson, 1988

Species group risioides

&. Notuchus kurandae Donaldson, 1979

9. Notuchus risioides Fennah, 1969

10. Notuchus rotundifacies Donaldson, 1979

Information about the selected species of the genus

Ugyops Guérin-Méneville, 1834 from New Caledonia

Ugyops inermis Distant, 1920

(Figs SA—B, 6A, 7A—B, 8A—B, 9A-B, 12A-—B)

Ugyops inermis 1s an endemic species from New Cale-

donia (Distant 1920). Individuals of this species are

about 5—7 mm long. The biology of the species remains

unknown. Perhaps it 1s a nocturnal species. During the

study in New Caledonia, both males and females came to

the light sources (Fig. SA—B). Our text and illustrations

complete Distant’s description (1920), which included a

short and very inaccurate diagnosis of this taxon, without

drawings.

Material examined

1 9 (Fig. 5A) // Ugyops inermis Distant // C. Gebicki det.

2015; New Caledonia (S) // 21°37.632’ S, 165°45.830’ E

// Farino env., rainforest, at light // Les Grandes Fougeres

// 11.03.2008, 467 m // netting, beating // leg. R. Dobosz

& T. Blaik; 5915/17537 // coll. Upper Silesian Museum

// (USMB) Bytom, Poland. — 1 3 (Fig. 5B) // Ugyops in-

ermis Distant // C. Gebicki det. 2015; New Caledonia (S)

©ZFMK

Ugyopini of New Caledonia with a description of Notuchus linnavuorii sp. nov. 105

Fig. 5. A. Ugyops inermis Distant, 1920, 2. B. U. inermis Distant, 1920, 3. C. Ugyops nemestrinus, 3. D. Ugyops taranis Fennah,

1964, 2.

Bonn zoological Bulletin 70 (1): 97-113 ©ZFMK

106 Cezary Gebicki et al.

Fig. 6. Heads in frontal view. A. Ugyops inermis Distant, 1920, ¢. B. Ugyops nemestrinus Fennah, 1969, 3. C. Ugyops taranis

Fennah, 1964, 3.

// 22°10.648’ S, 166°30.430’ E // Mt Koghi rainforest //

12.04.2008, 480 m //at light // leg. R. Dobosz & T. Blaik;

5915/18481 // coll. Upper Silesian Museum // (USMB)

Bytom, Poland.

Description of the external features of U. inermis

Vertex separated from large occiput by horizontal groove

(Fig. 7A). Frons with two very indistinct keels situated

close to each other at apical and basal parts (Figs 6A,

7B). Scapus evenly covered with short setae, pedicellus

with numerous sensilla placoidea, among which there are

fine setae embedded in cavities and arched towards the

apex (Fig. 8A). Less numerous and irregularly distribut-

ed spines are embedded in cavities surrounded by cuticu-

lar fringe. Round or oval platelles are composed of sever-

al dozen hooked setae pointed towards antennal tip. Each

platella is surrounded by cuticular crown divided into

teeth, which are bent inwards (Fig. 8B). Rostrum reaches

beyond the line between hind coxae; its second segment

is about three times longer than its apical segment.

Coloration of dorsal surface. Tip of the head in dorsal

view with two distinct (especially in females) black spots

separated by pale keel. Pronotum with four dark spots

(less visible in males). Scutum with broad central stripe,

uniformly pigmented with yellow ridges in male. Hind

coxae uniformly yellowish, post-tibial calcar and tarsi

pale (in male calcar black and apical part of tibiae and

tarsi greenish). Along claval anal vein A2, two dark spots

(well visible in male), bases of veins R and especially M

Bonn zoological Bulletin 70 (1): 97-113

and Cu with white sections (less visible in male), longi-

tudinal veins uniformly yellow at apical part (greenish in

male) (Fig. SA—B).

Coloration of frons. Central and lateral carinae of frons

uniformly yellowish. Surfaces between keels with five

longitudinal dark patches (median patch is the longest

one) in the lower part and a few irregular spots in the

lateral and apical part. Carinae of clypeus yellowish, the

area between keels darker in the upper part of clypeus.

The scapus uniformly pale, second segment with

two dark stripes (similar to other species of this genus)

(Fig. 6A).

Morphology of male genitalia of U. inermis

Posterior margin of pygofer almost straight, with nar-

row and extremely shallow incisions for genital styles

(one-sixth the length of pygofer — Fig. 12A—B). Anal

tube relatively short, slightly wider than half its length

(lateral view — Fig. 12A). Genital style distinctly broad-

er apically, with a short, rounded apex, which is bent to

the outer side. Inner margin of genital style with short

and strong teeth apically (Fig. 9B). Apexes of connective

short, rounded and directed upwards (in form of a shal-

low “Y” — Fig. 9B). Connective shaft almost as thick as

apical processes. Theca of aedeagus well developed with

two distinct lobe-like processes at the apex. The shaft of

aedeagus almost evenly thick along its length, in circu-

lar form (regular) with a characteristic straight process,

which is broadened and rounded apically. Apex of aedea-

©ZFMK

Ugyopini of New Caledonia with a description of Notuchus linnavuorii sp. nov. 107

Fig. 7. Representatives of the genus Ugyops Guérin-Meéneville,

1834. A, C, E. Heads, prothorax and scutellum, dorsal view;

SEM. B, D, F. Heads in front view; SEM. A-B. Ugyops iner-

mis Distant, 1920, 3. C-D. Ugyops nemestrinus Fennah, 1969,

3S. E-F. Ugyops taranis Fennah, 1964, &.

Bonn zoological Bulletin 70 (1): 97-113

gus membranous, granular in structure without spines or

processes, endowed with a subapical gonopore (Fig. 9A)

Ugyops nemestrinus Fennah, 1969

(Figs 5C, 6B, 7C—D, 8C—E, 10A—B, 12C—D)

Ugyops nemestrinus is an endemic species known from

New Caledonia (Fennah 1969). In terms of body size,

specimens of this species are quite large relative to other

species of this genus. Its body length is about 7-9 mm.

The morphological features of the male were very poorly

illustrated (Fennah 1969). Our work presents an exhaus-

tive supplement to the aforementioned deficiencies. The

biology of this species 1s poorly known.

Material examined

1 3 (Fig. 5C) // Ugyops nemestrinus Fennah // C.

Gebicki det. 2015; New Caledonia (N) // 21°08.941’ S,

165°19.407’ E // Aoupinié (refuge) // 30.03.2008, 400 m

// netting, beating // leg. R. Dobosz; 5915/26751 // coll.

Upper Silesian Museum // (USMB) Bytom, Poland.

Description of external features of U. nemestrinus

Occiput clearly smaller than vertex (Fig. 7C). Frons with

two distinct keels, keels slightly convex and diverge to-

wards apex of the head. Fronto-clypeal suture distinct

and slightly arcuated. Labrum slender, sharply pointed

(Figs 6B, 7D). Second antennal segment covered with

sensilla placoidea over its entire length (except for its

basal part) (Fig. 8C). Sensilla placoidea surrounded by

cuticular ridge with large spines placed vertically. Setae

and rather large spines irregularly distributed among sen-

silla placoidea, tiny tubercles absent (Fig. 8E). Rostrum

reaches beyond the line between hind coxae (Fig. 8D).

Coloration of dorsal surface. Apical part of vertex

with two rather small dark spots merging with each oth-

er. Pronotum and scutum with broad vertical median and

reddish strip. Four irregular reddish spots at the back

edge of pronotum. All pairs of legs more or less uniform-

ly brightly colored. All longitudinal veins of forewings

uniformly yellow, wing cells transparent and colorless

(Fig. 5C).

Coloration of frons. Four carinae dark, areas among

keels uniformly bright colored without patches. Carinae

of clypeus dark yellow, cells between them uniformly

yellow (Fig. 6B).

Morphology of male genitalia of U. nemestrinus

Posterior margin of pygofer slightly undulating with nar-

row and very shallow incisions for genital styles (one-

tenth length of pygofer — Fig. 12C—D); stem of stylus

slightly broader than that in U. inermis. Anal tube rel-

atively narrow, almost three times as long as wide (lat-

eral view — Fig. 12D). Genital styles slightly broadened

and rounded apically. Apexes of genital styles narrowed,

distinctly longer than those in U. inermis and bent to-

©ZFMK

Cezary Gebicki et al.

Fig. 8. Antennae of representatives of the genus Ugyops Guérin-Méneville, 1834 from New Caledonia. A-B. Ugyops inermis

Distant, 1920, 3. C-E. Ugyops nemestrinus Fennah, 1969, 3. F-G. Ugyops taranis Fennah, 1964, 4. D. Distal part of labium (U.

nemestrinus). Abbreviations: SC = scapus; Pe = pedicellus; CiS = ciliate structure; CS = conoidal structure; SP = sensilla placoidea;

ST = sensilla trichoidea; La = labium.

Bonn zoological Bulletin 70 (1): 97-113 ©ZFMK

Ugyopini of New Caledonia with a description of Notuchus linnavuorii sp. nov. 109

0.5mm

Fig. 9. Ugyops inermis Distant, 1920, male genitalia. A. Aedeagus lateral view. B. Gonostyles with connective, ventral view.

wards the outer side. Inner margin of genital style cov-

ered with indistinct teeth in apical part (Fig. 10B). Apex-

es of connective short and rounded (stouter than those

in U. inermis and not “Y”-shaped). Stem of connective

slightly thinner than its apex. Theca of aedeagus with-

out distinct, regular lobe-like processes apically. Aedea-

gus relatively short, bent elliptically, almost evenly thick

along its length with a characteristic thin spine; the spine

not broadened at the apex, slightly bent towards the base

of aedeagus. Apex of aedeagus membranous, granular in

structure without spines or processes, endowed with a

subapical gonopore (Fig. 10A).

Bonn zoological Bulletin 70 (1): 97-113

Ugyops taranis Fennah, 1964

(Figs 5D, 6C, 7E-F, 8F—G, 11A—B, 12E-—F)

Ugyops taranis is a small representative of its genus that

reaches about 4—5 mm in length. It is endemic to New

Caledonia (Fennah 1964). The species was described

based on two females. The male morphological features

are given here for the first time, despite the fact that Fen-

nah had access to a male from the Gressitt’s collections

at a later date (Fennah 1969). The biology of the species

remains unknown.

Material examined

1 & (Fig. 5D) // Ugyops taranis Fennah // C. Gebicki det.

2015; New Caledonia (S) // 22°10.7’ S, 166°30.4’ E // Mt

©ZFMK

110

Cezary Gebicki et al.

Fig. 10. Ugyops nemestrinus Fennah, 1969, male genitalia

Koghi 450-500 // 16.12.2006 rainforest, netting // leg.

R. Dobosz; 5915/6668 // coll. Upper Silesian Museum //

(USMB) Bytom, Poland.

Description of external features of U. taranis

Apical part of vertex distinctly convex (Fig. 7E). Dis-

crete keel slightly convex, broadened in the apical part.

Fronto-clypeal suture straight, barely visible. Labrum

Bonn zoological Bulletin 70 (1): 97-113

4 ae

| ar tte aly cera

. * < ¢ ‘Rg Yi ‘a

; ee ioe

ae See bee

ay 8,

a} 4 : he 4 )

, oe

oe te

spartan te 2

Ser Wy ““

i he 8 ae

ee.

Saat

ele Sat he are

. A. Aedeagus lateral view. B. Gonostyles with connective, ventral view

relatively short (Figs 6C, 7F). First antennal segment

relatively long, covered with long dense hair. Second

antennal segment almost entirely covered with regular-

ly distributed sensilla placoidea (Fig. 8F). Rather large

spines and setae irregularly distributed among sensilla

placoidea, numerous minute immovable tubercles visible

among sensilla placoidea (Fig. 8G).

©ZFMK

Ugyopini of New Caledonia with a description of Notuchus linnavuorii sp. nov. 111

Fig. 11. Ugyops taranis Fennah, 1964, male genitalia. A. Aedeagus lateral view. B. Gonostyles with connective, ventral view.

Coloration of dorsal surface. Apical part of vertex

with two indistinct dark spots, carinae reddish. Prono-

tum with two small spot in the lateral parts. Tegulae dark.

Forewing longitudinal veins mostly green with short and

irregularly distributed dark sections. Inner edge of clavus

black for two thirds of its length and in the apical part

(Fig. 5D).

Coloration of frons. Carinae of facies dark, areas be-

tween them with dark red longitudinal stripes, their me-

dian part pale. Carinae of clypeus reddish and areas pale

(Fig. 6C).

Morphology of male genitalia of U. taranis

Posterior margin of pygofer straight with very deep in-

cisions for genital styles (almost one-third the length of

pygofer — Figs 12E, F). This is distinctly different from

those in U. inermis and U. nemestrinus. Anal tube rel-

Bonn zoological Bulletin 70 (1): 97-113

atively broad, only twice as long as wide (lateral view

— Fig. 12E). Genital styles relatively short, indistinctly

broadened apically, broadly rounded and directed to-

wards the inner side. Inner margin of genital style cov-

ered with distinct, short teeth in apical part (Fig. 11B).

These features are also different from those in the other

two species. Apexes of connective long, slender, directed

towards sides in a distinct way (forming clear “T”). Stem

of connective as thick as its apical processes.

Theca of aedeagus without distinct and regular lobe-

like processes apically of aedeagus relatively short, less

evenly bent, broadened apically with a characteristic thin

spine; the spine tapering, bent towards the apex of aedea-

gus. Apex of aedeagus membranous, granular in struc-

ture with a single lateral spine with a subapical gonopore

(Fig. 11A).

©ZFMK

112 Cezary Gebicki et al.

Fig. 12. External male genitalia. A, D-E. Lateral views. B—C, F. Ventral views. A—B. Ugyops inermis Distant, 1920. C-D. Ugyops

nemestrinus Fennah, 1969. E—F. Ugyops taranis Fennah, 1964.

Bonn zoological Bulletin 70 (1): 97-113 ©ZFMK

Ugyopini of New Caledonia with a description of Notuchus linnavuorii sp. nov. 113

Checklist of the species of the genus Ugyops Guérin-

Meéneville, 1834 of New Caledonia (after Distant 1920,

Fennah 1964, 1969, Bourgoin 2020)

Ugyops (Ugyops) alecto Fennah, 1969

Ugyops (Ugyops) atreces Fennah, 1964

Ugyops (Ugyops) houadouensis Distant, 1920

Ugyops (Ugyops) inermis Distant, 1920

Ugyops (Ugyops) lato Fennah, 1969

Ugyops (Ugyops) manturnus Fennah, 1969

Ugyops (Ugyops) menelaus Fennah, 1964

Ugyops (Ugyops) nemestrinus Fennah, 1969

Ugyops (Ugyops) taranis Fennah, 1964

Acknowledgments. We would like to thank Dr Roland Dobosz

for providing the material from the entomological collection of

the Upper Silesian Museum in Bytom. The authors would also

like to express their gratitude to Professor Manfred Asche, an

outstanding expert of the Delphacidae family, for his valuable

comments regarding this work in its earlier version.

Our grateful thanks are also extended to Dr Wojciech Szc-

zepanski (Upper Silesian Museum in Bytom, Department of

Natural History) for his contributions to our work.

We would also like to thank MSc Marzena Zmarzly (Univer-

sity of Silesia, Faculty of Natural Sciences, Institute of Biology,

Biotechnology and Environmental Protection) and MSc Dasha

Michenko (National Academy of Sciences of Belarus) for tak-

ing the images of the specimens. Special thanks to Dr Wojciech

Prochwicz (Jan Dlugosz University in Czestochowa, Faculty of

Science & Technology) for his help in taking the SEM images.

We also thank Dr Artur Taszakowski, Dr Mariusz Kanturski,

Dr Lukasz Junkiert and Krzysztof Kudta (University of Silesia,

Faculty of Natural Sciences, Institute of Biology, Biotechnolo-

gy and Environmental Protection) and MSc Janusz Trzepizur

(the Elementary School of the Orzet Bialy in Kuleje) for their

technical support.

REFERENCES

Altner H, Prillinger L (1980) Ultrastructure of Invertebrate

Chemo- Thermo-, and Hygroreceptors and its Functional

Significance. International Review of Cytology 67: 69-139

Asche M (1985) Zur Phylogenie der Delphacidae Leach, 1815

(Homoptera Cicadina Fulgoromorpha). Teil I et Il. Marburg-

er Entomologische Publikationen 2 (1): 1-910

Bourgoin T (2020) FLOW (Fulgoromorpha Lists on The Web);

a world knowledge base dedicated to Fulgoromorpha. Ver-

sion 8 updated 2020.12.26. Online at https://hemiptera-data-

bases.org/flow/ [last accessed 16 Mar. 2021]

Distant WL (1920) Rhynchota from New Caledonia Part II.

Homoptera. Annals and Magazine of Natural History 9 (6):

456-470

Donaldson JF (1979) Revision of the genus Notuchus Fennah

(Homoptera: Fulgoroidea: Delphacidae). Journal of the Aus-

tralian Entomological Society 18: 181-185

Donaldson JF (1983) Revision of the Australian Asiracinae

(Homoptera: Fulgoroidea: Delphacidae). Journal of the Aus-

tralian Entomological Society 22: 277-285

Donaldson JF (1987) Notuchus howensis sp. n. (Homoptera:

Fulgoroidea: Delphacidae) from Lord Howe Island. Journal

of the Australian Entomological Society 26: 81-83

Bonn zoological Bulletin 70 (1): 97-113

Donaldson JF (1988) Further studies on Asiracinae (Homop-

tera: Delphacidae) in Australia and New Caledonia. Journal

of the Australian Entomological Society 27: 133-141

Fennah RG (1964) New species of Ugyops (Fulgoroidea: Del-

phacidae). Bulletin of the British Museum (Natural History),

Entomology 15 (5): 117-143

Fennah RG (1965) Delphacidae from Australia and New Zea-

land (Homoptera: Fulgoroidea). Bulletin of the British Muse-

um (Natural History), Entomology 17: 1-59

Fennah RG (1969) Fulgoroidea (Homoptera) from New Cale-

donia and the Loyalty Islands. Pacific Insects Monographs

21: 1-116

Fennah RG (1973) A new species of Notuchus (Homoptera,

Fulgoroidea, Delphacidae) from Lord Howe Island. Records

of the Australian Museum 28: 265—267

Fennah RG (1980) A cavernicolous new species of Notuchus

from New Caledonia (Homoptera: Fulgoroidea: Delphaci-

dae). Revue Suisse Zoologie 87: 757-759

Gebicki C, Szwedo J (2000) A fossil Ugyopine planthopper

from Baltic Amber (Hemiptera: Fulgoroidea: Delphacidae).

Polskie Pismo Entomologiczne 69: 389-395

Gorezyca J, Wolski A, Taszakowski A (2019) Redescription

and new records of the monotypic genus 7rynocoris Herring,

1976 (Heteroptera: Miridae: Cylapinae: Fulviini). Zootaxa

4623 (1): 51-60

Hoch H, Asche M, Burwell Ch, Monteith GM, Wessel A (2006)

Morphological alteration in response to endogeic habitat and

ant association in two new planthopper species from New

Caledonia (Hemiptera: Auchenorrhyncha: Fulgoromorpha:

Delphacidae). Journal of Natural History 40 (32-34): 1867—

1886

Holzinger WE, Kammerlander I, Nickel H (2003) The Auche-

norrhyncha of Central Europe. Vol. 1: Fulgoromorpha, Cica-

domorpha, excl. Cicadellidae, Brill, Leiden / Boston

Kanturski M, Karez J, Wieczorek K (2015) Morphology of the

European species of the genus Eu/achnus (Hemiptera: Aph-

ididae: Lachninae) - A SEM comparative and integrative

study. Micron 76: 23-36

Knight WJ (1965) Techniques for use in the identification of

leafhoppers (Homoptera, Cicadellidae). Entomologist’s Ga-

zette 16: 129-136

Muir FAG (1923) Two species of Delphacidae (Homoptera)

from Kermadec Archipelago. Transactions and Proceedings

of the New Zealand Institute 54: 257

Schneeberg K, Bauernfeind R, Pohl H (2017) Comparison of

cleaning methods for delicate insect specimens for scanning

electron microscopy. Microscopy Research & Technique 80

(11): 1199-1204

Stacconi MVR, Romani R (2011) Antennal Sensory Structures

in Scaphoideus titanus Ball (Hemiptera: Cicadellidae). Mi-

croscopy Research and Technique 75 (4): 458-466

Urban JM, Bartlett CR, Cryan JR (2010) Evolution of Delpha-

cidae (Hemiptera: Fulgoroidea): combined-evidence phylo-

genetics reveals importance of grass host shifts. Systematic

Entomology 35 (4): 678-691

Zhu Q, Wu N, Brozek J, Dai W (2019) Antennal Morphology

and Sexual Dimorphism of Antennal Sensilla in Callitettix

versicolor (Fabricius) (Hemiptera: Cercopidae). Insects 10

(2): 1-16

©ZFMK

BHL

Blank Page Digitally Inserted

Bonn zoological Bulletin 70 (1): 115-139

2021 - Przybycien M. et al.

https://do1.org/10.20363/BZB-2021.70.1.115

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:|sid:zoobank.org: pub: E9E9665D-B904-427E-AE1 7-2E254E2CEAA6

The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group

(Coleoptera: Curculionidae):

an integrative approach using molecular, morphological, ecological,

and biogeographical data

Maja Przybycien', Dorota Lachowska-Cierlik’, Beniamin Waclawik’, Peter Sprick’ & Stanislaw Knutelski* *

"2.35 Department of Entomology, Institute of Zoology and Biomedical Research, Jagiellonian University, Krakow, Poland

*Curculio Institute e.V. (CURCI), WeckenstraBe 15, D-30451 Hannover, Germany

* Corresponding author: s.knutelski@uj.edu.pl

'urn:lsid:zoobank.org:author: EOEDF340-653 1-4F3C-996F-1C7420398937

urn: lsid:zoobank.org:author:A5944069-0F77-4B9F-BE12-7B302385C7E2

3urn:Isid:zoobank.org:author: 14829388-EC88-4A57-8350-9CD87DDFFDCS5

*urn:lsid:zoobank.org:author: CC8F6E14-0623-4BBF-99F4-5F8DA6E35A72

>urn:Isid:zoobank.org:author:C74D006B-64E3-4CD4-B5D0-BEEB853094A9

Abstract. The species of the Otiorhynchus clavipes (Bonsdorff, 1785) group (Coleoptera: Curculionidae) treated here, are

characterized by their unusually high phenotypical variation, which often caused taxonomic problems and controversies.

Molecular markers COI and EF 1-a, karyological analysis, as well as morphological, biogeographical and ecological data

are used to study weevils collected in the Alps, Carpathians, Sudetes and different areas of Germany. In the investigated

populations of the flightless species O. fagi Gyllenhal, 1834 and O. clavipes, we detected an interspecific genetic distance

of 11.3-15.8% (COI) and 3.1—3.7% (EF1-a) depending on geographical distance. The phylogenetic trees indicate that

both species are monophyletic and that they were correctly delimited from each other. Both species have also separate

geographical ranges in Central Europe. Male specimens differ in the morphology of the aedeagus and the last abdominal

sternite. Our study supports the legitimacy of species delimitation of O. fagi and O. clavipes as separate species, which

can be treated as stable taxonomic hypotheses. The determination of the species status required the re-examination of spe-

cies ranges and allowed together with data on biology and altitudinal preferences a better biogeographical and ecological

characterization of the species.

Keywords. Weevils, Otiorhynchus, integrative taxonomy, species delimitation, molecular markers (COI, EF1-a), biodi-

versity, distribution.

INTRODUCTION

Inconsistent definitions and taxonomic treatment of cryp-

tic species prevent informed estimates of their contribu-

tion to biodiversity and impede our understanding of their

evolutionary, biogeographical and ecological significance

(Struck et al. 2018). The cryptic concept refers to two or

more species that have been classified as a single nominal

species including subspecies and varieties due to the fact

that they are apparently morphologically very similar,

show subtle regional or ecological adaptations and/or are

completely indistinguishable (Zuniga-Reinoso & Benitez

2015). Careful taxon-specific approaches and knowledge

are consequently required to discriminate between spe-

cies. One of the most common suppositions 1s that most

cryptic species result from speciation phenomena that are

so recent that morphological traits or any other tradition-

al diagnostic characters have not yet evolved (Winker

Received: 27.09.2020

Accepted: 09.03.2021

2005). In this sense, the hyperdiverse genus Otiorhyn-

chus Germar, 1822, which current systematics is based

mainly on the morphological structure of adults, includes

many cryptic species which have yet to be discovered.

The genus Otiorhynchus (Curculionidae: Entiminae:

Otiorhynchin1) is the most species-rich of all weevil gen-

era in Europe and the West Palaearctic Region, compris-

ing around 1500 valid species and 105 subgenera within

the main distribution area in the Palaearctic region (Hoff-

mann 1950; Smreczynski 1966; Dieckmann 1980; Knu-

telski 2005; Germann 2010; Sttiben et al. 2015; Mazur

2016). In Europe, the tribe Otiorhynchini includes eight

genera, and the subgenus Otiorhynchus Germar, 1822

sensu stricto is represented by 64 species (Alonso-Zaraz-

aga et al. 2017). The highest numbers of species of the

genus Otiorhynchus occur in the European mountains

(Dieckmann 1980), and many local forms inhabit the

high montane and alpine regions and especially areas

Corresponding editor: D. Ahrens

Published: 08.04.2021

116 Maja Przybycien et al.

with non-glaciated refugia and nunataks. Otiorhynchus

species occurring north of the Alps, the Sudetes and

Carpathians (including the Tatra Mts.) represent only a

very small part of the species of this speciose genus (e.g.,

Hoffmann 1950; Smreczynski 1966; Magnano 1998:

Knutelski 2005; Germann 2010; Sttiben et al. 2015;

Mazur 2016). Otiorhynchus species, which are without

exception incapable of flight, are known as general fee-

ders with a large number of host plant genera comprising

deciduous and coniferous trees, woody plants, perennial

dicots and perennial grasses (Smreczynski 1966; Koch

1992; Knutelski 2005; Sprick & Sttiben 2012). Adults are

leaf feeders and cause characteristic bite marks on host

plant leaves, and the larvae are subterraneous, ectopha-

gous root feeders (Willis 1964; Dieckmann 1980; Gosik

et al. 2016).

One of the most problematic taxa arousing much con-

troversy among many current taxonomists are the species

related to Otiorhynchus fagi, previously called Otiorhyn-

chus tenebricosus (Herbst, 1784) group (Casalini & Col-

onnelli 2019), which probably includes two or more cryp-

tic species with a distribution restricted to certain are-

as inside the range. This phenotypically extremely vari-

able taxon was interpreted differently in the past, which

led to the description of many subspecies, varieties and

forms, and the creation of a huge number of species syno-

nym names.

In the opinion of Hoffmann (1950), Otiorhynchus lug-

dunensis Boheman, 1843 together with O. hungaricus

Germar, 1824, O. fuscipes (Olivier, 1807) and O. clavipes

(Bonsdorff, 1785) form a complex of closely related but

separate species in Western Europe. Other authors con-

sidered them forms of one variable species. For example,

Lona (1936) distinguished within O. clavipes three taxa

as varieties, and Hoffmann (1950) regarded these as sub-

species and subdivided additionally each subspecies into

varieties. In turn, Frieser (1981) included in the O. clavi-

pes group: O. lugdunensis, O. fuscipes, O. clavipes sensu

stricto, and O. hungaricus. Morris (1997) treated O. /ug-

dunensis and O. fuscipes in Great Britain as synonyms

of O. clavipes, but he explained that the true status is

unresolved and needs further study especially on bio-

logy. Smreczynski (1966) distinguished O. fuscipes and

O. lugdunensis from Poland and other countries of East-

ern Europe using morphological features and he listed

them as separate species. Likewise, Dieckmann (1980)

treated both taxa as separate and valid species in east-

ern Germany. In his opinion, some specimens from the

mountain and the low mountain ranges, determined as

O. clavipes, belong either to O. fuscipes or to O. lugdu-

nensis, and O. hungaricus was regarded as a southeastern

European species with an isolated occurrence in southern

France. The status of O. hungaricus Germar, 1824 as sepa-

rate species from other taxa of this group raised the least

controversy and is widely accepted (e.g., Endrédi 1961;

Mazur 2002; Alonso-Zarazaga et al. 2017; Yunakov et al.

Bonn zoological Bulletin 70 (1): 115-139

2018). Currently, Casalini & Colonnelli (2019) syno-

nymized the French subspecies Otiorhynchus hungaricus

hospitellensis Hustache, 1923 with the nominotypical

taxon. Magnano (2001) synonymized O. clavipes (Bons-

dorff, 1785), O. fuscipes (Olivier, 1807), and O. /ugdu-

nensis Boheman, 1843 together with more than 30 taxa

to a very diverse species cluster (Delbol 2010, 2013;

Alonso-Zarazaga 2014) under the name of O. tenebrico-

sus (Herbst, 1784). Several other authors (e.g., Germann

2010; Lobl & Smetana 2011) adopted this proposal at

first. Wanat & Mokrzycki (2005) also accepted the syno-

nymization of O. /ugdunensis but with some objections,

arguing ecological distinctness from the nominotypical

O. tenebricosus. However, some researchers using dif-

ferent methods studied and indicated the dissimilarity

between O. tenebricosus and O. lugdunensis. Germann

(2013) reinstalled O. /ugdunensis as a valid species from

synonymy with O. tenebricosus based on differences

in the morphological structure of the aedeagus of both

taxa. Gosik & Sprick (2013) studied the morphological

structure of pupae and found some diagnostic features

specific to each of both taxa. Further evidence for the

status of O. /ugdunensis as separate species came from

the p-distance (COI) of 11.4-11.6% from O. tenebricosus

(Schitte et al. 2013; Stiiben et al. 2015). Probably based

on these results, the name O. /ugdunensis was used again

as a separate taxon in the catalogues of Lobl & Smetana

(2013) and Alonso-Zarazaga et al. (2017). However, in

those two catalogues the synonymy of O. clavipes and

O. fuscipes with the species O. tenebricosus remained

unchanged. The study of the larval morphology of the

O. tenebricosus group (Gosik et al. 2016) confirmed the

validity of O. /ugdunensis as reported by Schiitte et al.

(2013); Germann (2013); and Stuben et al. (2015) against

synonymisation suggested by Magnano (2001) and Fau-

na Europaea (Alonso-Zarazaga 2014). Wanat & Mokrzy-

cki (2018) also withdrew O. /ugdunensis from synonymy

with O. tenebricosus, although the relation to the very

similar O. clavipes remained unresolved. Casalini & Col-

onnelli (2019) designated a neotype for Curculio clavipes

Bonsdorff, 1785, rediscovered several overlooked syno-

nymies and discovered new synonyms of this species.

Recently, O. tenebricosus was synonymized with O. fagi

by Casalini & Colonnelli (2019).

Therefore, it was necessary to verify all available data

and explore this species group more in detail except the

well-defined O. hungaricus. The ecological differenc-

es between the forms, particularly in Central Europe

and the United Kingdom, were also taken into account,

which may provide additional evidence to shed light on

this problem. Thus, the aims of this paper are: 1) to com-

pare morphology, karyology and the results of molecular

analyses of adult weevils of the taxa Otiorhynchus clavi-

pes (Bonsdorff, 1785), O. fuscipes (Olivier, 1807), and

O. lugdunensis Boheman, 1843, collected in the Alps,

Carpathians, Sudetes and different areas of Germany; 2)

©ZFMK

The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 117

to find diagnostic characters useful to distinguish these

taxa, 3) to report new bionomic data, and 4) to present an

updated distribution of these taxa.

MATERIAL AND METHODS

A total of 66 adult specimens were collected for this

study from 16 localities in the Alps (Slovenia), Carpath-

ians (Poland and Slovakia), Sudetes (Poland) and differ-

ent regions in Germany, using sweep nets, beating trays

or direct collecting from plants and under stones, over

a period of ten years (2009-2018). A full list of locali-

ties and their coordinates, biotopes, and collecting plants

with these sites is given in Table 1. Additional specimens

from various regions of Germany, England and France

were used for morphological descriptions and photos of

habitus and abdominal sternites (Figs 7-8). All individu-

als were a priori identified to species level using the keys

of Smreczynski (1966) or Dieckmann (1980). Nomencla-

ture of scientific names follows Alonso-Zarazaga et al.

(2017); Wanat & Mokrzycki (2018); and the PolBIN

(2019).

The gonads of 12 alive individuals (males) of each ta-

xon were dissected for chromosome analysis, the oth-

er 45 individuals were preserved in 99.8% ethanol and

stored at -20°C for molecular and morphometric studies.

Information on morphology, ecology and biogeogra-

phy of the studied taxa is based on the authors’ own data

and Hoffmann (1950, 1963); Smreczynski (1966); En-

drodi (1961); Knutelski (2005); Sprick & Sttiben (2012);

Germann (2013); Mazur (2016); and Gosik et al. (2016).

Molecular analysis

DNA was isolated from complete insects. In order to

avoid the damage of body parts which were later used

in morphometry the specimen were poked with a needle

on the abdomen to facilitate the flow of genetic materi-

al. NucleoSpin tissue kit (Macherey-Nagel) with suitable

procedure was used for the isolation process. Two DNA

fragments, mitochondrial cytochrome oxidase 1 (COI)

and nuclear elongation factor a (EF1-a), were amplified

with PCR technique in a reaction mix consisting of: 3 ul

of DNA, 2 ul of buffer x10 with MgCl, 0.6 pl of dNTPs,

0.6 ul of primer F, 0.6 pl of primer R, 0.2 ul of Taq poly-

merase, 13 wl of water. Amplification was conducted

with the use of the following primers: EF-F sequence

(5° AGAACGTGAACGTGGTATCA 3’), EF-R_ se-

quence (5° CTTGGAGTCACCAGCTACATAACC 3’),

LCO1490-JJ sequence (5° CHACWAAYCATAAAGA-

TATYGG 3’) HCO2198-JJ sequence (5° AWACTTCVG-

GRTGVCCAAARAATCA 37’) (Astrin & Sttiben 2008;

Hernandez-Vera et al. 2013).

The amplification was performed in a Mastercycler

EpigradientS (Eppendorf) with the following profile:

Bonn zoological Bulletin 70 (1): 115-139

95°C for 4 min, 95°C for 30 s, 50°C for COI and 55°C for

EF1, for 1 min, 72°C for 2 min followed by 35 cycles at

95°C for 30 s, 50°C for 1 min, 72°C for 2 minutes and a

final extension step at 72°C for 10 min and | min at 10°C.

The effectiveness of the amplification was checked by

conducting electrophoresis in 1% agarose gel tinted with

Midori Green Advance DNA Stain (NIPPON Genetics)

(100 mg/ml). Purified PCR products were sequenced

with Big Dye Terminator v3.1. Cycle Sequencing Kit

(Applied Biosystems) according to the manufacturer’s

instructions with the same primers that were used in the

PCR reaction. Sequencing reaction was conducted by

Genomed S.A., Warsaw.

Alignment and phylogenetic analysis

Sequences were read and edited using BioEdit v.7.2.6

(Hall 1999) and then aligned using ClustalX (Thomp-

son et al. 1997). The most suitable model of nucleotide

substitution was determined by using MrModeltest 2.3

(Nylander 2004) in conjunction with PAUP*4.0b (Swof-

ford 2002). The GIR+G model was chosen for COI

(proportion of invariable sites I = 0, gamma distribution

shape parameter G = 0.2521), the GTR model for EF-la

(proportion of invariable sites I = 0, equal rates for all

sites).

We used two methods to determine phylogeny: Bayes-

ian inference (BI) and maximum likelihood (ML). BI was

ran using MrBayes 3.1 (Ronquist & Huelsenbeck 2003;

Nylander et al. 2004) with one cold and three heated

Markov chains for 3,000,000 generations and trees were

sampled every 100" generation. Each simulation was run

twice. Stationarity was considered to be reached when

the average standard deviation of split frequencies was

<0.01; the convergence of each run was visually inspect-

ed using Tracer v. 1.5.0 (Rambaut et al. 2009), and appro-

priate number of sampled trees were discarded as ‘burn-

in’, and a majority-rule consensus tree was obtained.

Maximum likelihood was run using RAxML v. 8.0.0

(Stamatakis 2014) with a bootstrap resampling of 100

replicates via the rapid bootstrap procedure of Stamatakis

et al. (2008) to assign support to branches in the ML tree.

Genetic distances were computed in PAUP*4.0b (Swof-

ford 2002) by using uncorrected “p” model. Each tree

has one outgroup — Liparus glabirostris Kuster, 1849

(for EF1 marker) or Liophloeus tessulatus (O.F. Muller,

1776) (for COI marker), both species are from the same

family (Curculionidae). All trees were visualized with

TreeView 1.6.6 (Page 1996).

Chromosomes

The gonads of 12 individuals (males) of each species

were dissected and used as material for slides. The go-

nads were fixed in Carnoy (3:1 96% ethanol: glacial

acetic acid). The squashes were performed on dry ice in

©ZFMK

Maja Przybycien et al.

118

Table 1. Sampling areas, locations, date, biotopes and plants of collected weevils used in molecular analysis: Germany, Poland, Slovakia and Slovenia. Abbreviations: m a.s.l. = meter

above sea level, N = individual numbers, Leg. = name of collector, APC = a priori categorisations, C = Otiorhynchus clavipes, L = O. lugdunensis, T = O. tenebricosus.

x A ae Geograph. _ Altitude :

Sampling area Sampling site coordinates -UEGnered:) Date Biotope Plants N Leg. APC Remarks

Germany

hea eHaG rather abundant, very

Hannover-Linden, er 5, 2011-04-06, TEE j local in a small area

Lower Saxony N52°22'40 E. fortunei, ;

(LSH) park south of £09°42'30" 53 2017-03-23, park ee ee adeee 4 Sprick L (<100 square meters);

Leine river 2017-04-12 on cae beating in the late

Fraxinus spec.

evening and early night

Lower Saxony Bad Zwischenahn- N53°12'18,5" 2012-07-09,

(LSB) Tee iacaas £08°04'22.5" 12 3013-07.02 ee nursery Thuja occidentalis 2 Sprick L _ rare, collected at night

Lower Saxony Ith Mountains N52°04'35"

(LSL) aiauenticiny 509°32'56" 350-400 2012-03-26 5 Sprick T abundant

National Park N51°46'16" coniferous Bisoaluhios abundant, beaten from

Harz: Harz Mts., ee 740 2012-07-02 forest, oa ie ae 1] Sprick T plants and collected

Lower Saxony E10°32'03 Vaccinium myrtillus

at Oderteich lake, mountain under stones

spruce forest forest

Schleswig-Holstein Pinneberg: N53°38'25! Thuja plicata rare, beating in the

(SHP) Rellingen, E09°50'22" Wt SD DOnOF See NUE one 5 eprick L afternoon

hedgerow

Schleswig-Holstein Bullenkuhlen, Nee ae 8 et Agoe nursery HE MEGSDCE. of. 10 Sprick Tie Rare pains:

E09°45'04 2013-06-04 plicata females

(SHB) hedgerow

Paderborn hillside forest Fraxinus excelsior, noe Dale eee

Nore Ne: Wewer Ne 140-150 2012-07-15 oncalcareous Euonymus euro teh 4 Sprick C Cay aro tne ow ek

Westphalia (NRW) ; E08°42'43" ‘ eee P parts of bushes and

Ziegenberg, forest ground Cornus sanguinea

young trees

edge

Bagcr Ware bes Silent 1 Sprick L

(BWH)

©ZFMK

Bonn zoological Bulletin 70 (1): 115-139

119

The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group

AWUNUIUOD SoTUaSOL

UI Jopiog ueINsnyIeoU OC, SCsjaynuy wml apes ysooj aonids = 1-90-€ 107 STII ears bak SR ae e (AMV) sdiv

ssed uiejunow Je Suneaq 1q Id wOVLT9VN SIA DI

BIUIAOTS

sures rysjoqnu Salqv baal soloj sonids -90- u€0,CCo6 LA Niee malone ge suviyyedie

yeoq ok Iyspoynuy 1q Iq — \SO1OF OI-90-€ 10C OS6 |PZ9So8bN “SA SBIR, MOT yyedse’)

BDIBAOTS

Byloysed ( ean

iT INZeI| ysaloj sonIds ~—- $- 80-6007 Orl uvOF.6 10914 “SIA. SMOOIS WSS Pas

uS LOToOSN

}Oq SUBJUOUT JOMO] L8,1L0S14 ay gee ae (AMS) sozepng

out UT soon woxy Suryeog L Tysjanuy saiqgp David ysoaloyaonids ¢(-L0-€ 107 0S6 er aoen ““S]IJA SZSOUOYILY]

BIND BYONS = SIA

suyeoq LS FySyoynuy saiqp partg ysoloyaonsds —_ €9-90-T 107 SL9 ie ies Splysog IoIMAZ (ZO) suemmedre)

sures rysjoynu Salqv Daal soroy sonids -90- u0$.:8000CH map cae sueiyjyedie

yeoq iL yspoynuy 1q Iq — SOlOF 0C-90-C10C Ovcl PCC Lob PN “SYA 9009) (INDO) sueryjedies

opeys & JO a8po oy} snyyAdi wniUlza0 ee w€ LES61A W991 PEN

ye queyd woy Sieg «LS PISTON eet tion] ape[s 97-90-1107 00ST “6SPL.GPN _“SuTtjunoyy eney (ALLO) sueryyedsed

puelod

: (['s°e WI) =sazBUTpP.1009

SYIVUIIY JdV rice | sJUvld 3doj}01g 218q apminty ‘udexZ005) dS Sulduvs Bole SUTTdUIeS

‘ponuyuoD *] a1qeL.

©ZFMK

Bonn zoological Bulletin 70 (1): 115-139

120

Table 2. Measured body parts of the studied taxa for morpho-

metric analysis.

Measurements

width

width of rostrum

Body parts

es eye diameter

distance between eyes

distance: eye-basis of

antennae

width

length

width

length

width of left and right part

width

length

elytra

pronotum

metasternum

sternum

length of dorsal view

width of dorsal view

aedeagus length of lateral view

width of lateral view

angle of apex

width

receptaculum seminis Beieit

eig

70% acetic acid. The finished preparations were dried

with warm air and stained in 4% Giemsa phosphate

buffer (pH 6.8) for 10 min. Well-spread spermatogonial

metaphases were selected for the determination of chro-

mosome numbers. Observations of chromosomes and

photomicrographs were made using a Nikon Eclipse 501

microscope.

Morphological measurements

Weevils were dissected, mounted on separate mounting

cardboards and labelled. Males and females from the

same locality were identified as the same taxon. Mea-

surements of twenty morphometric characters were ana-

lyzed in this study (Table 2). Additionally, sex dimor-

phistic features were also measured (five for males and

two for females). A Nikon SMZ1500 stereomicroscope,

with NIS Elements software, was used for all morpho-

metric measurements. All body parts were photographed

and measured. Every measurement was taken five times

and averaged.

Statistical analyses of all morphometric data were con-

ducted using R software version 3.4.1 (r-project.org) and

slightly modified versions of the R-scripts provided by

Bonn zoological Bulletin 70 (1): 115-139

Maja Przybycien et al.

Baur & Leuenberger (2011). Scatterplots were genera-

ted with the package ‘ggplot2’ (Wickham 2009). Missing

measurements were replaced by mean average of respec-

tive body parts. All data were standardized by transfor-

ming into a logarithmic scale.

Additionally, bl: body length (from front margin of

the eyes to apex of elytra/body), bw: body width (largest

width of body), hw: head width, were measured of four

taxa specimens whose habitus 1s shown in Fig. 7, as well

as the width and length of the five abdominal sternites

(AS) of the five taxa presented in Fig. 8.

Majority of the specimens used in this study are depo-

sited in the Department of Entomology at Institute of Zo-

ology and Biomedical Research, Jagiellonian University

of Krakow (Poland), and those presented in Figs 7-8 are

in the collection of P. Sprick.

RESULTS

DNA analysis

In the case of COI marker analysis, the biggest gene-

tic distance (15.8%) was detected between Otiorhynchus

jagi from the Alps: Karawank Mountains (Slovenia) and

Otiorhynchus clavipes from Schleswig-Holstein: Bullen-

kuhlen (Germany). Compared with other populations of

O. clavipes in Germany the genetic distance is similar

(15.6%). In turn, genetic distance between six popula-

tions of O. clavipes in Germany and five populations of

O. fagi in the Carpathians (Poland), and two populations

in the Sudetes (Poland) is almost similar (11.3—11.6%).

Only in one population of O. fagi from the Gorce Mts.

(Carpathians) there is a bigger genetic distance (12.5%)

to O. clavipes (Table 3).

The results of EF1-a marker analysis of five O. clavipes

populations from Germany and six O. fagi populations

from Poland (four from the Carpathians and two from

the Sudetes) show the biggest genetic distance (4.7%)

between O. fagi from the Carpathians: Zywiec Beskids

(Poland) and O. clavipes from Schleswig-Holstein: Bul-

lenkuhlen (Germany). The genetic distance between the

O. lugdunensis population from Bullenkuhlen and O. fagi

populations from the Carpathians and the Sudetes is a

bit lower (in each case 4.2%). However, the genetic dis-

tance of EFl-a between the other five O. clavipes popu-

lations from Germany and five O. fagi populations from

the Polish Carpathians and the Sudetes is clearly smaller

(mean value 3.1%) (Table 4).

Using two phylogenetic methods and two different

markers (mitochondrial and nuclear), trees of similar to-

pology were obtained (Figs 1—2). On each tree O. fagi and

O. clavipes form separate clades, which implies that they

are correctly divided. Otiorhynchus clavipes is monophy-

letic in both trees. These results also indicate the relative-

ly high genetic variation of O. fagi, especially for COI

©ZFMK

The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 121

— Liophloeus tessulatus

O. ovatus

O. clavipes LSH

O. clavipes LSB

O. clavipes SHB

O. clavipes SHP

O. clavipes LSH

O. clavipes BWH

O. clavipes NRW

O. clavipes LSL

1.00

O. clavipes LSL

O. fagi CZB

O. fagi CGM

0.92

O. fagi CGM

O. fagi CZB

O. fagi CTM

1.00 O. fagi CTM

O. fagi SSM

0.88

O. fagi SKM

O. fagi AKM

1.00

O. fagi AKM

O. coecus KU910731.1

O. asfaltinus

O. sulcatus KR479989.1

O. carinatopunctatus KU918176.1

O. rugosostriatus KR481561.1

0.05

Fig. 1. Bayesian approach consensus tree for COI data. Numbers at nodes indicate Bayesian posterior probability: LSB = Lower

Saxony: Bad Zwischenahn, LSH = Lower Saxony: Hannover; SHB = Schleswig-Holstein: Bullenkuhlen; SHP = Schleswig-Hol-

stein: Pinneberg; NRW = North Rhine Westphalia; BWH = Baden-Wuerttemberg: Heilbronn (GERMANY); CZB = Carpathians:

Zywiec Beskid Mts.; CGM = Carpathians: Gorce Mts.; CTM = Carpathians: Tatra Mts.; SSM = Sudetes: Stolowe Mts.; SKM =

Sudetes: Karkonosze Mts. (POLAND); AKM = Alps: Karawank Mts. (SLOVENIA). Sequences from O. ovatus, O. coecus, O. sul-

catus, O. carinatopunctatus, O. rugosostriatus downloaded from GenBank.

data (Fig. 1). These COI data also show that Alpine popu-

lations are notably different from the Carpathians and

Sudetes populations, and in the Carpathians genetic dif-

ferences between populations within individual moun-

tain ranges are present (Table 3, Figs 1—2). In the case of

O. clavipes genetic differences between populations were

relatively smaller than in the previous species (Fig. 1).

The EF1-a data confirm genetic differences of O. fagi in

the Carpathians and indicate a small variability of some

German O. clavipes populations (Figs 3-4), however, we

had unfortunately no data for the populations from the

Karawank Mts. (Slovenian Alps).

Chromosomes

Otiorhynchus fagi and O. clavipes share the same diploid

complement of 22 chromosomes and a sex determination

mechanism of the parachute type (Xy_.). The meioformu-

la n = 10+Xy. was identical at all metaphase I plates of

spermatid division (Figs 5-6).

Bonn zoological Bulletin 70 (1): 115-139

Morphometric differences

Before the analysis, data on body size were normalized

and then analyzed with principal component analysis

(PCA). This analysis was performed to evaluate body

size correlations between two species among males and

females. We focused on PCs with eigenvalues >1 (Quinn

and Keough, 2002), following our PCA of the body size

data, we considered three principal components, PC1,

PC2 and PC3. To test differences between both species

we used general linear model (GLM). Amid males and

females we observed no significant differences for all

PC’s (Tables 6, 7). The Principal component analysis

(PCA) showed no statistically significant differences be-

tween Otiorhynchus fagi (T) and O. clavipes (L), both for

females (Fig. 7) and males (Fig. 8).

©ZFMK

122

100

O. asfaltinus

Liophloeus tessulatus

100)

Maja Przybycien et al.

soo © fag/ AKM

O. fagi AKM

O. coecus_KU910731.1

O. clavipes LSL

O. clavipes BWH

O. clavipes NRW

O. clavipes LSB

O. clavipes LSH

O. clavipes SHB

O. clavipes SHP

O. clavipes LSH

O. fagi SSM

O. fagi SKM

O. fagi CTM

O. fagi CZB

O. fagi CGM

O. fagi CZB

O. fagi CTM

O. rugosostriatus KR481561.1

O. carinatopunctatus KU918176.1

O. sulcatus KR479989.1

O. ovatus HM412003.1 0.07

Fig. 2. Maximum-likelihood tree for COI data. Numbers at nodes indicate bootstrap values: LSB = Lower Saxony: Bad Zwischen-

ahn, LSH = Lower Saxony: Hannover; SHB = Schleswig-Holstein: Bullenkuhlen; SHP = Schleswig-Holstein: Pinneberg; NRW =

North Rhine Westphalia; BWH = Baden-Wuerttemberg: Heilbronn (GERMANY); CZB = Carpathians: Zywiec Beskid Mts.; CGM

= Carpathians: Gorce Mts.; CTM = Carpathians: Tatra Mts.; SSM = Sudetes: Stolowe Mts.; SKM = Sudetes: Karkonosze Mts. (PO-

LAND); AKM = Alps: Karawank Mts. (SLOVENIA). Sequences from O. ovatus, O. coecus, O. sulcatus, O. carinatopunctatus,

O. rugosostriatus downloaded from GenBank.

Additional information on species

The main morphological features to distinguish O. fagi

and O. clavipes are the sculpture and pubescence of the

upper surface of the body as well as of the underside, the

length of the antennal scrobe and of the funicle, the colo-

ration of the legs, the different body shape and especially

the number of grooves of the last abdominal sternite (AS)

in the male sex (Figs 9-10). The females of both taxa are

marginally different (see Table 5).

Both taxa occur in Central Europe and form two ex-

tremes among other representatives of the genus Ofio-

rhynchus regarding these characteristics and molecular

differences demonstrated earlier (Tables 1—2), and they

behave in this area 1n terms of their ecology and biogeog-

raphy as two separate species (Table 5).

Based mainly on own observations of the authors, the

description of the species has been supplemented with

information from the publications mainly of Hoffmann

Bonn zoological Bulletin 70 (1): 115-139

(1950); Smreczynski (1966); Dieckmann (1980); Ger-

mann (2013); and other authors mentioned in the text.

Otiorhynchus fagi Gyllenhal, 1834

(Figs 9-10, Table 5)

Synonyms were presented according to the order of data

descriptions of species names, after Alonso-Zarazaga

et al. (2017) and Casalini & Colonnelli (2019):

= Curculio clavipes Bonsdorff, 1785: 40

= Curculio rufipes Sturm, 1792: pl. 17

= Curculio tenebricosus Herbst, 1795: 333 not Curculio

tenebricosus Herbst, 1784

= Curculio haematopus Schrank, 1798: 490 not Curculio

haematopus Gmelin, 1790, replacement name for Cur-

culio tenebricosus Herbst, 1795

= Otiorhynchus erythropus Boheman, 1842: 267

= Curculio fuscipes Olivier, 1807: 372 not Curculio fusci-

pes Geoffroy in Fourcroy, 1785

©ZFMK

123

The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group

S9061T'0 098810 86c6l 0

vre000 99ST 0

= c6cS 10

nal el

86c61 0

9E9ST 0

c6cS 10

000000

86c61 0

9E9ST0

c6cS 10

00000°0

86c61 0

9E9ST 0

c6cS 10

000000

‘Or

l6r6l 0

808S1°0

p9rsl0

cLI00 0

CLIO0 0

cLIO0 0

108810

8r6rl0

SO9rl0

Orell 0

Orel 0

OcCcOI 0

v9OrSl 0

OcIST 0

v89I1 0

vs89I1 0

v89I10

ps9I1 0

SOvc0 0

LIC6l 0

v9VSl 0

OcIST 0

v89I10

vs89I10

v89I1 0

SOvc0 0

vre00 0

SLO081°0

c6cS 10

8r6rl 0

evscl 0

[c6c0 0

€60£0 0

vrsLl 0

8r6rl 0

SO9VI0

cISITO

cISItO

cISITO

VETCO 0

SOvc0 0

SLE100

Tv0810

8r6rl 0

SO9rI0

cISII 0

cISIIO

cISIT 0

cISII 0

C900 0

LLSCO 0

SLEI00

vre00 0

€

[SO810

OcISTO

LLLVI0

cISIl 0

cISIT 0

cISI1 0

cISIT 0

068100

VETCO 0

VETTO 0

9rS100

¢1S00°0

vre00 0

TSO81 0

OcIST 0

LLLVI0

cISI1 0

cISIT 0

cISI1 0

068100

VETCO 0

9VS100

¢1S000

vre00 0

00000°0

dNOYOLNO

snjpnssa] "T 9]

180{ OSI

1820 “v1

dHS

sadiav]2 ‘OC “€]

MUN

sadiavj2 ‘OC “TI

dqsT

sadiav]2 ‘OC TI

HST

sadiavj2 ‘OC ‘Ol

aHs

sadiav]2 ‘O 6

WLO

180{ 0 '8

WMS

180 'O 'L

WSS

sof 09

WDO

182 O'S

dZo

180{ Of

WDO

182{O'€

dZo

180{ OT

WLO

182 OC "|

OU/BXBL,

‘(VINAAOTS) ‘SIA yuemerey ‘sdtv = WMV (GNV10d) ‘SW ezsouoysey ‘sajapns = WMS “SIA PMO]OIS ‘sajapns = WSS “SIP 90H

‘sueryyedieg = WDD “SIA prysod 99IMA7Z ‘suvryjyedieg = {7D “SIA BURL, :sueiediey = WLO (ANVINAD) sioqouul g :uld}S[OH-SIMSO[YIS = HS “Uloqsoped ‘elyeydysa SUTUYY

YON = MUN ‘uyeusyosIm7 peg :AUOXBS IOMO'T = GST “JoAOUURH] :AUOXBS JOMOT = HST ‘UdTYNYyUST[NG :UId]STOH-SIMSaTYIS = AHS ‘JOYIVU [OD JOJ SOURISIP OOUDH *¢ IqQUL,

©ZFMK

Bonn zoological Bulletin 70 (1): 115-139

Maja Przybycien et al.

124

Table 4. Genetic distances for EFla marker: LSB = Lower Saxony: Bad Zwischenahn; LSH = Lower Saxony: Hannover; NRW = North Rhine Westphalia: Paderborn; SHP =

Schleswig-Holstein: Pinneberg; SHB = Schleswig-Holstein: Bullenkuhlen (GERMANY); CTM = Carpathians: Tatra Mts.; SSM = Sudetes: Stolowe Mts.; SKM = Sudetes: Karkono-

sze Mts.; CGM = Carpathians: Gorce Mts.; CZB = Carpathians: Zywiec Beskid Mts. (POLAND).

Taxa/no

1. O. fagi

CTM

2: fagi

SSM

3. O. fagi

CTM

4. O. fagi

SKM

5. O. fagi

CGM

6. O. fagi

CZB

7. O. clavipes

LSB

8. O. clavipes

LSH

9. O. clavipes

NRW

10. O. clavipes

SHP

11. O. clavipes

SHB

12. L. glabrirostris

OUTGROUP

0.00000

0.00524

0.03147

0.04196

0.23741

0.00000

0.00524

0.03147

0.04196

0.23741

0.00000

0.00524

0.03147

0.04196

0.23741

0.00000

0.00524

0.03147

0.04196

0.23741

0.00524

0.03149

0.04198

0.23681

0.03671

0.04720

0.23961

0.00000

0.01049

0.24619

0.00000

0.01049

0.24619

0.00000

0.01049

0.24619

10.

0.01049

0.24619

11.

0.25030

12.

©ZFMK

Bonn zoological Bulletin 70 (1): 115-139

The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 125

O. sulcatus KU041904.1

O. auropunctatus HQ883728.1

Liparus glabrirostris

O. clavipes LSB

O. clavipes SHP

O. clavipes LSH

O. clavipes SHP

O. clavipes NRW

O. clavipes BWH

O. clavipes LSH

O. clavipes LSL

O. asplenii

O. fagi SSM

O. fagi SKM

O. fagi CGM

O. fagi CTM

O. fagi CZB

O. coecus KJ801844.1

0.02

Fig. 3. Bayesian approach consensus tree for EF1-a data. Numbers at nodes indicate Bayesian posterior probability: LSB = Lower

Saxony: Bad Zwischenahn, LSH = Lower Saxony: Hannover; SHP = Schleswig-Holstein: Pinneberg; NRW = North Rhine West-

phalia; BWH = Baden-Wuerttemberg: Heilbronn (GERMANY); CZB = Carpathians: Zywiec Beskid Mts.; CGM = Carpathians:

Gorce Mts.; CTM = Carpathians: Tatra Mts.; SSM = Sudetes: Stolowe Mts.; SKM = Sudetes: Karkonosze Mts. (POLAND). Se-

quences from O. sulcatus, O. auropunctatus, O. coecus downloaded from GenBank.

= Curculio maritimus Donovan, 1811: 63

= Otiorhynchus substriatus Silbermann, 1833: no. 7

= Otiorhynchus substriatus Gyl\lenhal, 1834b: 563

= Otiorhynchus sanguinipes Boheman, 1842: 296

= Otiorhynchus waltoni Smith, 1869: 136

= Otiorrhynchus sanguinipes var. subglaber Reitter,

1913: 50

= Otiorhynchus fuscipes forma heynei Voss, 1919: 405

= Otiorhynchus evertsi Uyttenboogaart, 1931: 292

= Otiorrhynchus sanguinipes var. stierlini Uytten-

boogaart, 1931: 295 not Otiorhynchus stierlini Gem-

minger, 1871

= Otiorrhynchus stierlinianus Uyttenboogaart, 1933:

229 not Otiorrhynchus populeti Boheman, 1842 var.

stierlinianus Reitter, 1914b: 159, replacement name

for Otiorrhynchus sanguinipes var. stierlini Uytten-

boogaart, 1931

= Otiorhynchus olivieri Abbazzi & Osella, 1992: 294,

replacement name for Curculio fuscipes Olivier, 1807

not Curculio fuscipes Geoffroy in Fourcroy, 1785

Bonn zoological Bulletin 70 (1): 115-139

Adult morphology. Otiorhynchus fagi is quite vari-

able, depending on the origin, such as in the coloration

of the legs (knees and base of femorae more or less dark-

ened but not as clear as in O. coecus), in the fine pubes-

cence of the top of the body and especially in the sculp-

tures and spaces of the elytral striae. Generally, O. fagi is

morphologically similar to O. clavipes, but it is weaker

and narrower in habit than the usually large, strong form

of O. clavipes. The body length is 8-13 mm. The anten-

nae are black. The upper side of the pronotum Is uneven-

ly scored in the front part, in the back part it is equipped

with small granules, just like on the sides. The sides of

the pronotum are rarely pubescent and hardly stand out

from the upper part. On the elytra there are very small

and very sparse patches of scales. Along the elytral striae

small punctures are clearly visible. The tarsi are black.

Body hairs are rare and very delicate, so that the beetle

appears bare; exceptionally hair clusters at the punctures

of grooves merging into very small spots on the sides of

elytra are hardly noticeable.

©ZFMK

126 Maja Przybycien et al.

Table 5. Additional distinctness in morphology, ecology and biogeography between Otiorhynchus fagi Gyllenhal, 1834 and O.

clavipes (Bonsdorff, 1785; compilation of the authors’ own data and information from Hoffmann (1950, 1963), Smreczynski

(1966), Endr6odi (1961), Knutelski (2005), Sprick & Stiiben (2012), Germann (2013), Mazur (2016) and Gosik et al. (2016); for

illustrations see Figs 7-8.

Feature/Species O. fagi Gyllenhal, 1834 O. clavipes (Bonsdorff, 1785)

Morphology

weaker and narrower than O. clavipes, no stronger and broader than O. fagi; head black with a

body shape bright spots on elytra, antennae black, small cherry stripe behind the eyes, white hair spots on elytra,

points clearly visible on the elytral striae femorae cherry

size 9-13 mm 9.5-15 mm

sten very small and very sparse, scaly patches usually loosely covered by groups of small silver-grey

y present spots

only very fine grooves in front of the

apex, less expanded and less deep, in

great number (more than 40), no crest of

yellowish hairs or bristles at the apex

about 8—15 strong ribs in the middle, accompanied by a

different number of small ribs/grooves at the sides and a

crest of yellow hairs/bristles at the top border

abdominal sternite

apex rounded, the inner bag with several apex usually angular, the inner bag almost completely

aedeagus

complex tortuous sclerites reduced

head dark brown; all thoracic and abdominal head yellow or dark yellow; all thoracic and abdominal

lnevarcolonaton segments from dark yellow to brownish segments yellow or yellowish to brownish

Ecology

in western Europe in lowlands and areas of low and

medium height (low mountain ranges), introduced in

location mainly in mountainous and piedmonts areas Sentral idl aAsteenIbuoMeamninIsrinaacbatk estateean

sandy regions

mainly in forest areas, deciduous and in great parts of Western Europe in the forest zone of the

A mixed, from the lower to the high mountain —_ low hill country; in introduced areas (e.g. the northern

habitat an, ee . RE ty

regions; abundant in different habitats inthe plains) mainly in allotments, nurseries, parks, thickets,

Sudetes and Carpathians Mts. cemeteries, hedges, and gardens

adults feed leaves of various plants, such adults feed leaves and buds mainly of common lilac and

food as European spruce, also of herbaceous privet, also recorded from other Oleaceae plants and

perennials, producing characteristic feeding adjacently growing bushes, producing characteristic

notches feeding notches similarly to O. fagi

May—October, and most often in June and

appearance of adults July; nocturnal, in the mountains also during Og poner anes Zo undan tinea pil ay, manly

the day nocturnal

Biogeography

most mountainous regions of Central mainly in western and central Europe, introduced in

geographic and Eastern Europe, in the hill country eastern Europe and very rare and local in this area;

distribution of Germany, in the Alps, Sudetes and increasing its range with the planting of common lilac

Carpathians (Syringa), white-cedar (Thuja) and privet (Ligustrum)

altitudinal 400-2500 m a.s.l., mostly abundant and up to 200 m a.s.l. (in France also found in some higher

distribution frequent in 800-2100 m a.s.l. mountain areas)

piogeorrapincal European, mountain European, mountain and lowland

element

Bonn zoological Bulletin 70 (1): 115-139 ©ZFMK

The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 127

O. fagi CGM

O. fagi SSM

O. fagi SKM

O. fagi CTM

O. fagi CZB

O. clavipes LSB

O. clavipes SHB

O. clavipes BWH

O. clavipes SHP

O. clavipes NRW

95 O. clavipes LSH

O. clavipes LSH

O. clavipes LSL

O. coecus KJ801844.1

O. sulcatus KU041904.1

O. auropunctatus HQ883728.1

Liparus glabrirostris

0.02

Fig. 4. Maximum-likelihood tree for EF1-a data. Numbers at nodes indicate bootstrap values: LSB = Lower Saxony: Bad Zwischen-

ahn, LSH = Lower Saxony: Hannover; SHB = Schleswig-Holstein: Bullenkuhlen; SHP = Schleswig-Holstein: Pinneberg; NRW =

North Rhine Westphalia; BWH = Baden-Wuerttemberg: Heilbronn (GERMANY); CZB = Carpathians: Zywiec Beskid Mts.; CGM

= Carpathians: Gorce Mts.; CTM = Carpathians: Tatra Mts.; SSM = Sudetes: Stolowe Mts.; SKM = Sudetes: Karkonosze Mts.

(POLAND). Sequences from O. sulcatus, O. auropunctatus, O. coecus downloaded from GenBank.

Male. The elytra are elongate. The last abdominal ster-

nite (AS) is flat and characterized by a great number (>

40) of very fine grooves in front of the apex, less expan-

ded and less deep, bearing no crest of yellowish hairs or

bristles at the posterior edge of the apex (Fig. 8). The

AS of O. fagi is the smallest (1.75 x 1.175 mm = 1.49: 1)

among the compared AS of all measured taxa (Fig. 8).

In appearance it is very similar to AS of O. coecus Ger-

mar, 1823, used here as the ,,outgroup”. The aedeagus of

O. fagi is almost parallel laterally in the apical region,

and the apex is rounded, the inner sac 1s armed with sev-

eral complex tortuous sclerites (Germann 2011, 2013;

Schitte et al. 2013).

Female. The last abdominal sternite has very fine fur-

rows in the central part, and it bears fine hairs at the sides

and at the apex as on the other sternites.

Larva. The head is dark brown; all thoracic and ab-

dominal segments from dark are yellow to brownish; cu-

ticle is almost smooth. For more details on the morpholo-

gy of the larva see the publication of Gosik et al. (2016).

Bonn zoological Bulletin 70 (1): 115-139

Ecology. This species inhabits mainly montane and

submontane areas, from the deciduous and mixed for-

ests of the middle and higher low mountain regions to

the coniferous forest of higher elevations. In the Tatra

Mts. O. fagi mainly inhabits spruce forests, fir-spruce

forests, mountain pine, subalpine and alpine meadows,

rowan-spruce and willow-rowan brushwood, but it is

also found in beeches, alders, in brush and herbs at road-

sides, at streams and at windbreak, on clearings as well as

in couloirs and on turfs on the rocks. Otiorhynchus fagi

does not show clear habitat preferences and can be classi-

fied as eurytopic weevil species of the hill and mountain

regions (Hoffmann 1950; Smreczynski 1966; Dieckmann

1980; Morris 1997; Knutelski 2005; Sprick & Sttiben

2012; Stiiben et al. 2015; Gosik et al. 2016; Mazur 2016).

Food plants. Polyphagous, adults feed on leaves of

various plants, both woody and herbaceous, making

characteristic feeding notches on Picea abies (L.) H.

Karst., Abies alba Mill., Pinus mugo Turra, Alnus inca-

na (L.) Moench, Corylus avellana L., Salix spp., Sorbus

©ZFMK

128

Maja Przybycien et al.

10um

—_—————I

Fig. 5. Chromosomes of Otiorhynchus fagi, arrow indicates Xyp (the sex chromosomes of parachute type).

aucuparia L., Rubus idaeus L., Petasites albus Gaertn.,

Adenostyles alliariae A. Kern., Rumex acetosa L., Trifo-

lium pratense L., Vaccinium myrtillus L., various species

of Alchemilla, Cirsium and Geranium: in the Carpath-

ians and Harz Mts. collected mainly from Picea abies

(Hoffmann 1950; Dieckmann 1980; Palm 1996; Knutel-

ski 2005; Sttben et al. 2015; Kizub and Slutsky 2019;

P. Sprick, pers. data). In the Czech Republic the species

was collected also from Rosa sp., and from Solanum tu-

berosum L. at agricultural potato crops areas near a forest

(Hrabovsky 2014).

Appearance of adults. From beginning of May to

October, and most often in June and July; on and under

Bonn zoological Bulletin 70 (1): 115-139

different plants, under stones and in the leaf litter (Dieck-

mann 1980; Knutelski 2005; Gosik et al. 2016).

Geographical distribution. This species occurs in

several central and east European mountainous regions,

from Eastern France to Romania.

In Western Europe additionally present in the Massif

Central, and possibly, but very isolated and to confirm in

the French Pyrenees (two sites) and in adjacent regions

of Northern Spain (two to three sites). In the Apennines

of northern and central Italy and on Monte Amiata (see

Casalini & Colonnelli 2019), a volcano of Pleistocene

origin in Tuscany, it was also recorded from the north-

ern Mediterranean region. In Germany occurring in all

regions of the Alps and Central Uplands with northern

©ZFMK

The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group

rs “

sok

129

10um

Fig. 6. Chromosomes of Otiorhynchus clavipes, arrow indicates Xyp (the sex chromosomes of parachute type).

limit in the Ith and Harz Mountains and absent or nearly

absent from the northern sandy plains (Kohler & Klaus-

nitzer 1998; Bleich et al. 2020).

On the Balkan Peninsula only present in the northern

or northwestern part (Croatia).

In the Sudetes and the Carpathian areas of Poland the

Species is common, and in particular it is widespread and

often very frequent in the Tatra Mts., as well as in the

Slovakian, Ukrainian and Romanian Carpathians (Knu-

telski 2005; Kizub & Slutsky 2019; own data of P. Sprick

and S. Knutelski). It is widespread and quite frequent in

Switzerland: Jura Mts., midlands, north side of the Alps,

Western and Eastern Central Alps (Germann 2010; in

conjunction with Germann 2013; and C. Germann, pers.

comm. 2020).

It is widespread also in the southeastern part of France:

Alpes de Savoie, Alpes du Dauphiné, Hautes Alpes,

Rhone-Alpes (Isere, Ain), Massif Central/Auvergne

(Cantal, le Lioran, le Sancy, Puy-de-Déme), Vaucluse

(Mt. Ventoux), and Vosges (Hoffmann 1950; Schott

2017).

In Hungary is known only from several localities

(northern part, in the environs of the Bukk highland, close

to the frontier with Slovakia) (Slicker 2019), present also

in Banat (Western Romania) and in Croatia, where it is

Bonn zoological Bulletin 70 (1): 115-139

rare (Endr6odi 1961). Also known from many places in

hillside areas of the same regions.

In Poland the largest enclave outside mountain regions

is located in the Krak6w-Wielun Upland; it includes the

Pradnik valley in the Ojcow National Park.

It was recorded once or sporadically in a few localities

in the highlands and lowlands, too (Hoffmann 1950; En-

drédi 1961; Smreczynski 1966; Dieckmann 1980; Knu-

telski 2005; Germann 2013; Sprick & Stiiben 2012; Stu-

ben et al. 2015; Mazur 2016; Yunakov et al. 2018; Kizub

and Slutsky 2019).

According to Alonso-Zarazaga et al. (2017) and new

information by Casalini and Colonnelli (2019), our own

data, information from some colleagues and further re-

search, the revised distribution is as follows: Austria,

Belgium, Croatia, Czech Republic, France, Germa-

ny, Hungary (northern part), Italy (northern to central

part) (Abbazzi & Maggini 2009; R. Casalini, Roma,

pers. comm. 2020), Liechtenstein, Luxembourg, Poland

(southern part), Romania, Slovakia, Slovenia, ?Spain,

Switzerland, and Ukraine (western part). Information

on introduction of O. tenebricosus to North America by

Alonso-Zarazaga et al. (2017) probably refers to O. clavi-

pes (see next break).

©ZFMK

130 Maja Przybycien et al.

Shape PC2 (20.1%)

OO. fagi

Q O. clavipes

Shape PC1 (35.6%)

Fig. 7. Shape principal component analysis (PCA) for exploring females’ variation within Otiorhynchus fagi (G) and Otiorhynchus

clavipes (Q) using all variables, the variance explained by each shape principal (PC) is given in parentheses. Statistical analysis

showed no significant differences.

There are no reliable data for Great Britain, Ireland, the

Netherlands, and North America. The data for Denmark

have been revised by Casalini and Colonnelli (2019) and

belong to O. clavipes. Records from Belgium are proba-

bly confined to the eastern parts, where altitudes of over

650 ma.s.l. are achieved (M. Delbol, Liege, pers. comm.

2020). Records from Luxembourg seem possible as

heights above 500 m are achieved, too, but should be con-

firmed. All records from four Dutch provinces belonged

to O. clavipes (Heijerman 2020). In Slovenia O. fagi is

present but apparently not common (M. Kahlen, pers.

comm. 2020). Records from Spain (Alonso-Zarazaga

2018) are all from the Basque region bordering to the

west of the Pyrenees: two old and one recent record from

2019, identified by Bahillo de la Puebla as O. tenebrico-

sus (MA Alonso-Zarazaga, pers. comm. 2020), may be

correct, but the finding region is situated rather far and

isolated from the next occurrences in France. Thus it re-

mains doubtful if O. clavipes can be really excluded and

if this occurrence is secondary (introduced) or represents

an original site. Information on the introduction to North

Bonn zoological Bulletin 70 (1): 115-139

America, reported in the catalogue of Alonso-Zarazaga

et al. (2017), is probably not correct. The basis of this re-

cord is unknown. Our research revealed only data about

an introduction of O. clavipes to North America, accord-

ing to Poole & Gentili (1996).

Biogeographical element. Western European: eastern

part, Central and Eastern European, in mountainous re-

gions, abundant along the chains of the Alps, including

Maritime Alps, the Carpathians, Sudetes; further west

until Massif Central; further north in the mid-mountain

areas of Germany and Belgium, and further south along

the Italian mountain chain of the Apennines; disjunct

occurrences apart from this core area were reported for

several regions. Introductions of this species are rare —

opposite to O. clavipes. In the light of the Dutch O. tene-

bricosus records, just recently determined by Heijerman

(2020) as O. clavipes, the distribution of both species in

Belgium, which was communicated preliminairily by M.

Delbol (pers. comm.), should be confirmed and shown

more in detail.

©ZFMK

The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 131

Altitudinal distribution. It occurs between 400 m and

2500 m above sea level (a.s.l.), and it is most abundant

and frequent between 800 m and 2100 ma.s.l.

Otiorhynchus (Otiorhynchus) clavipes_ (Bonsdorff,

1785)

(Figs 9-10, Table 5)

Synonyms were presented according to the order of data

descriptions of species names, after Alonso-Zarazaga

et al. (2017) and Casalini & Colonnelli (2019):

= Curculio clavipes Bonsdorff, 1785: 40

= Curculio rufipes Sturm, 1792: plate 17 not Curculio

rufipes Linnaeus, 1758

= Curculio maritimus Donovan, 1811: 63 not Curculio

maritimus Marsham, 1802

= Othiorhynchus substriatus Silbermann, 1833: no. 7

= Otiorhynchus substriatus Gyllenhal, 1834: 563, not

Othiorhynchus substriatus Silbermann, 1833

= Otiorhynchus lugdunensis Boheman, 1842: 268

= Otiorrhynchus elongatus Stierlin, 1861: 65 not Otio-

rhynchus elongatus Hochhuth, 1847

= Otiorhynchus francolinus L.W. Schaufuss, 1867: 22,

replacement name for Otiorrhynchus elongatus Stier-

lin, 1861: 65 not Otiorhynchus elongatus Hochhuth,

1847

= Otiorhynchus longulus Marseul, 1872: 250, replace-

ment name for Otiorrhynchus elongatus Stierlin, 1861

not Otiorhynchus elongatus Hochhuth, 1847

= Otiorhynchus longulus Marseul, 1873: 143

= Otiorrhynchus dilatipes Guillebeau, 1885: 2

= Otiorhynchus guillebeaui Desbrochers des Loges,

1894: 89

= Otiorrhynchus clavipes ssp. evertsi Uytenboogaart,

1931-292

Adult morphology. Otiorhynchus clavipes 1s general-

ly morphologically very similar to O. fagi, but especial-

ly specimens up to now identified as O. /ugdunensis are

stronger and broader in habit. The body is 8-15 mm long,

black and covered with hairs clear. The head is black, of-

ten cherry colored behind the eyes, with small but clear-

ly visible, light colored scales between the eyes and on

the entire upper surface of the rostrum. The granules on

pronotum and elytra are fine. The elytra are about twice

as long as wide, usually loosely covered with groups of

small, silver-gray spots clearly visible in the usually faint

grooves, sometimes bare even on the disc. The femur is

widened in the middle part, cherry, without spurs. The

tibia is black.

Male. The elytra are elongate. The last abdominal ster-

nite (AS) is with about 6—15 strong ribs in the middle,

on the sides with different numbers of very fine smaller

ribs and grooves, and in front of the end with a well-de-

veloped cavity; at the hind-margin there is a dense fringe

Bonn zoological Bulletin 70 (1): 115-139

of erect yellow hairs. The aedeagus 1s almost parallel

in the apical area, and the apex is angular, the inner sac

is almost completely reduced. The tip of the spiculum

ventrale is more or less deep concave (Germann 2013;

Schiitte et al. 2013).

Female. The elytra are oval. The last abdominal ster-

nite usually bears punctures and hairs.

Larva. The head is dark yellow; all thoracic and ab-

dominal segments are from yellowish to brownish; cuti-

cle is almost smooth (Gosik et al. 2016).

Ecology. This species occurs in the forest zone of col-

line regions and in medium to high areas, but mainly in

the low mountain ranges of Western and western Central

Europe. In the northern central and eastern part of the

continent (e.g., Northern Germany, Poland), it was intro-

duced and inhabits mainly urban estates (cities, very rare-

ly outside), such as gardens, parks, cemeteries, nurseries

and similar areas. This species prefers several Oleaceae,

and it has been found mainly on common lilac (Syringa),

but also on privet (Ligustrum), young ashes (Fraxinus),

Euonymus, Thuja and a few other bushes, which are also

involved in passive transport processes and the introduc-

tion to other regions by trade. Adults are polyphagous

and nocturnal. Weevils start to eat the leaf margin of

shrubs at dusk and continue by night. Larvae are also po-

lyphagous and develop mainly between the roots of these

plants. They were bred with Euonymus fortunei (Turcz.)

Hand.-Mazz., Ligustrum vulgare L. and Syringa vulgaris

L. (Gosik et al. 2016).

The last (sixth) larval instar forms a pupal chamber

with compressed walls made from soil under the ground

(Gosik et al. 2016). Metamorphosis of the larvae oc-

curs from end of February, and in the Paris region adu-

Its emerged from the pupa in March (Hoffmann 1950).

According to Ibbotson & Edwards (1954), the life cycle

of O. clavipes is completed within 12 or 18 months de-

pending on the oviposition period. Adult weevils appear

in two periods. One part pupates in autumn, overwinters

in the pupal chamber and emerges in large numbers from

April to May, the other part pupates from mid-May to

July, and adults emerge from mid-June to end of August.

For pupation larvae move deeper in the soil and pupate

between 15 and 20 cm below soil level. According to

Gosik et al. (2016) early emerging weevils lay eggs in

Spring and early summer, larvae develop during spring

and summer, pupate and hatch in autumn, overwinter in

the pupal cell and emerge again early in the season. And

weevils laying eggs later in the season larvae overwinter

and complete their development in the following season.

Food plants. Larvae and adults are polyphagous. Ma-

inly feed on common lilac, Syringa vulgaris, and also

Ligustrum sp., Aucuba sp., Lonicera sp., etc., especially

in Isere (France) they were observed on vine (Hoffmann

1950). Beetles were collected from various shrubs, such

as Euonymus fortunei (Turcz.) Hand.-Mazz., E. japoni-

cus Thunb., Fraxinus excelsior L., F- ornus L., Viburnum

©ZFMK

132 Maja Przybycien et al.

0.2

Shape PC2 (16.8%)

De)

- 0.4

-0.6

-1.0 - 0.5

QO O. fagi

O O. clavipes

0.0 0.5 1.0

Shape PC2 (44.3%)

Fig. 8. Shape principal component analysis (PCA) for exploring males’ variation within Otiorhynchus fagi (G) and Otiorhynchus

clavipes (Q) using all variables, the variance explained by each shape principal (PC) is given in parentheses. Statistical analysis

showed no significant differences.

tinus L., V. opulus L., Acer sp., Rhus coriaria L., Weige-

la sp., Vitis sp., Lonicera sp. and Thuja plicata Donn ex

D. Don (Hoffmann 1950, 1963; Gosik et al. 2016; Stu-

ben et al. 2015). In the past O. clavipes was reported

by Hoffmann (1950, 1963) to be harmful to Syringa sp.

and Ligustrum sp. in nurseries, and present on Aucuba

sp., Viburnum tinus, V. opulus, Acer sp., Rhus coriaria,

Weigela sp. and Vitis sp. Ibbotson & Edwards (1954) in

turn mention this species as noxious to English strawber-

ry cultures in a rather small area around Cheddar, only. In

Northern Germany it was regarded as species with no or

nearly no economic importance in all parks and tree nurs-

eries where it was found during 2008 to 2011 (Sprick &

Stiiben 2012).

Appearance of the adults. In the nightfall adults be-

gin to devour the edges of buds and leaf plates and gnaw

already in April and May on the leaf and flower buds of

common lilac. In the course of the year large notches

are eaten in the leaf margin of different bushes, causing

characteristic incisions. The weevils already copulate in

mid-April and start laying their eggs in the ground more

or less during the entire season (Gosik et al.2016). They

were found on the plants from April to mid-August (Hof-

Bonn zoological Bulletin 70 (1): 115-139

fmann 1950), with maximum abundance in May and

June.

Geographical distribution. The locus typicus of

“O. lugdunensis” is Lyon (Hoffmann 1950). This species,

now O. clavipes, shows a western to western central Eu-

ropean distribution. Moreover it was introduced to areas

around the North Sea and the Baltic Sea, to eastern Eu-

rope, and even to North America.

In France, it is widespread throughout the entire coun-

try, mainly in the plains and low-altitude hills but also in

the higher mountain ranges (e.g.: Cevennes, Ardeche, la

Garde, la Lozere, montagnes de Provence, Basses-Alpes,

Alpes Maritimes, and also in many other regions (Hoff-

mann 1950; GBIF https://www.gbif.org); there are also

observations from the area around Paris, where it can

sometimes be harmful to nurseries (Hoffmann 1950; Za-

gatti et al. 2001), which may also depend on introduction.

In Germany it was introduced to many localities in

the lowlands, especially into the northern sandy plains,

e.g., Lower Saxony, Schleswig-Holstein, Brandenburg,

Sachsen (Dieckmann 1980; Sprick & Sttiben 2012;

Schittte et al. 2013; Sttiben et al. 2015).

©ZFMK

The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 133

Otiorhynchus fagi Otiorhynchus clavipes

Otiorhynchus clavipes (U.K.) Otiorhynchus coecus

Fig. 9. Habitus of males. O. fagi (Germany, National Park Harz, Sachsen-Anhalt: Brocken, experimental garden, 7.8.2019, 1100 m

a.s.l., leg. & det. P. Sprick; bl = 9.9 mm, bw = 3.95 mm, hw = 1.675 mm), O. clavipes (Germany, Hannover-Linden, park south of

Leine river, 25.5.2009, leg. & det. P. Sprick; bl = 11.2 mm, bw = 5.05 mm, hw = 1.9 mm), O. clavipes (U.K., England, Cornwall:

Rescassa, 21.5.1989, leg. & det. M.G. Morris; bl = 9.55 mm, bw =4.1 mm, hw= 1.7 mm), and O. coecus (Germany, National Park

Harz, Sachsen-Anhalt: Brocken, experimental garden, 28.5.2019, 1100 maz.s.l., leg. & det. P. Sprick; bl = 8.2 mm, bw = 3.6 mm,

hw = 1.5 mm) as an outgroup; bl: body length, bw: body width, hw: head width. All photos by F. Bahr. Scale bar = 5 mm.

Bonn zoological Bulletin 70 (1): 115-139 ©ZFMK

134 Maja Przybycien et al.

Otiorhynchus coecus Otiorhynchus fagi

Otiorhynchus clavipes (U.K.) Otiorhynchus clavipes (France)

Otiorhynchus clavipes

Fig. 10. Abdominal sternites (AS) of males. O. coecus (Germany, National Park Harz, Sachsen-Anhalt: Brocken, experimental

garden, 28.5.2019, 1100 maz.s.1.; AS: 1.65 x 0.9 mm (= 1.83:1), as an outgroup; O. fagi (Germany, National Park Harz, Sachsen-An-

halt: Brocken, experimental garden, 7.8.2019, 1100 ma.s.l., both leg. & det. P. Sprick; AS: 1.65 x0.9 mm (= 1.83:1); O. clavipes

(U.K., England, Cornwall: Rescassa, 21.5.1989, leg. & det. M.G. Morris, the brownish colour indicates a specimen with not ful-

ly-sclerotized exoskeleton; AS: 1.9 x 1.15 mm (= 1.65:1); O. clavipes (France, Savoie: Valloire, 19.8.1987, leg. H. Gunther, det. P.

Sprick; bl = 9.8 mm, bw = 4.45 mm, hw = 1.75 mm; AS: 1.91.1 mm © 1.73:1); O. clavipes (Germany, Hannover-Linden, Park

south of Leine river, 25.5.2009, leg. & det. P. Sprick; AS (2.3 x 1.3 mm = 1,77:1); bl: body length, bw: body width, hw: head width.

All photos by F. Bahr.

Bonn zoological Bulletin 70 (1): 115-139 ©ZFMK

The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 135

In Poland, O. clavipes is known only from a few urban

areas, like Wroclaw and Olsztyn (Biatooki 2005; Mazur

2016; Wanat & Mokrzycki 2018). Its occurrence in large

towns or in areas with tree nurseries is very typical for

introduced flightless weevil species.

Heijerman (2020) confirmed presence O. clavipes in

the Netherlands where it was recorded in several prov-

inces. He supposed that it is not introduced there.

The known current distribution of O. clavipes, mainly

based on Alonso-Zarazaga et al. (2017), is revised here as

follows: originally occurring in Belgium, France, Great

Britain, Germany (western parts: Baden-Wuerttemberg,

Hesse, North Rhine Westphalia; Kohler & Klausnitzer

1998), Ireland, Luxembourg, the Netherlands (southern

colline part), and introduced to: Denmark, Estonia, Ger-

many (northern parts), Latvia, the Netherlands (plain re-

gions), Poland, where it is sometimes very rare and local

(Mazur 2016), Sweden and Switzerland (Germann et al.

2017). The few records from Switzerland are based on

introduction (C. Germann, pers. comm. 2020).

Similar as in O. fagi, the few extreme southwestern

records of O. clavipes are from the Pyrenees and adyja-

cent areas, two on the French and two on the Spanish

side, usually old records, remain doubtful. And if correct,

there is no information, whether these records from Spain

and the French Pyrenees are based on original occurrence

or on introduction.

Biogeographical element. Western European inclu-

ding the western parts of Central Europe; lower foothill

(colline zone) to mountainous regions, introduced in the

lowlands (usually < 100 m a.s.l.) in northern Central,

southern North and Eastern Europe, rarely elsewhere,

often on sandy ground; introduced to North America

(Poole & Gentili 1996) (Table 5).

Otiorhynchus hungaricus Germar, 1824

Synonyms after Casalini & Colonnelli (2019):

= Otiorhynchus hungaricus Germar, 1823: 351:

= Otiorrhynchus hungaricus var. hospitellensis Hus-

tache, 1923: 54

The third species of the O. clavipes group is O. hungari-

cus, which was not main study object of this paper, but it

is included in the revision of the distribution, here.

According to Alonso-Zarazaga et al. (2017) the range

of O. hungaricus was reported as follows: Bosnia-Herce-

govina, Bulgaria, Croatia, Russia: Central European Ter-

ritory, Germany, Hungary, Moldova, Romania, Serbia,

Slovakia, and Ukraine. As there are no data for Germany,

this often repeated record has to be deleted from the list

until an introduction may have been proven.

The following records from isolated sites, which are

given by different authors via https://www.gbif.org, have

to be assessed in future, as to whether they are native or

Bonn zoological Bulletin 70 (1): 115-139

based on introduction: Estonia (Tallinn-Lasnamae, lime-

stone grassland, several specimens) by Roosileht (2015),

Poland (Gory Stolowe, Sudetes Mts., > 800 m as.l.)

by Wanat (2017), and Czech Republic (Tfinec, around

300 m, surrounding area up to over 900 m a.s.1.) by Lan-

geveld et al. (2020). The Estonian records are so far north

of the core area (> 1000 km) that an introduction seems

probable, even if the species inhabits limestone grass-

land in this northern exclave. The record from Poland is

from a rather high area, untypical for this species. The

presence in France is limited to the extreme Southeast

(region of Digne and Alpes-Maritimes; Hoffmann 1950),

but there 1s no information about habitats, indicating that

its status remains unresolved, probably this 1s a historical

introduction of an Eastern European species. In western

Ukraine O. hungaricus inhabits mainly the low moun-

tain Carpathians foothill zone, but the upper altitudinal

limit is unknown. The Russian territory is situated also

rather far from the core area of this species, and introduc-

tion cannot be excluded. The presence in Moldova con-

firms the preference of lower foothill sites, as the high-

est mountain of this country achieves only 428 m a.s.l.

Apparently very little is known about host plants (po-

lyphagous, preference for Rosaceae, according to Mazur

2002) and altitudinal limit. The determination of the right

biogeographical character and especially in the northern

sites the status as native or introduced species have to

be regarded as provisional. Benedikt et al. (2010) listed

this species only from one site in Slovakia (Matranské

Pannonikum region) and characterized it as forest spe-

cies of steppe regions. Thus, we regard it preliminarily as

Southeastern European forest steppe species that prefers

lower altitudes.

In summary it can be stated that there are well-deve-

loped characters of aedeagus and on abdominal sternites

of males (Fig. 8) and very subtle differences, sometimes

easy to overlook, between certain parts of the body of

O. fagi and O. clavipes, such as the presence or absence of

elytral spots (Table 5, Figs 7-8), and that there are signifi-

cant genetic differences between O. fagi and O. clavipes

(Tables 3-4, Figs 1-2) and separate geographical ranges

in Central Europe between all three studied species.

DISCUSSION

The results of our study supports the legitimacy of the

two separate species, O. fagi and O. clavipes, which had

been also suggested by previous studies (Germann 2011,

2013; Gosik & Sprick 2013; Schutte et al. 2013; Stiben

et al. 2015; Gosik et al. 2016; Casalini & Colonnelli

2019; Smreczynski 1966; Dieckmann 1980), in opposite

to synonymizing both taxa proposed by Magnano (2001)

and Fauna Europaea (Alonso-Zarazaga 2014). The data

indicate that O. fagi is a mountain species (Massif Cen-

tral, Alps, Carpathians, Sudetes) and several other more

©ZFMK

136

or less adjacent mountainous areas of Europe with an en-

larged distribution rather far to the North and to the South

in the central part of its range. Otiorhynchus fagi inhabits

preferably coniferous, and also deciduous forests and re-

lated clearings with shrubs, young trees and tall herbs.

On the other hand, O. clavipes is a Western to western

Central European species inhabiting mainly areas with

deciduous trees.

Weevils used in molecular analysis were collected in

various regions of Germany, Poland, Slovakia and Slo-

venia and marked a priori as Otiorhynchus clavipes (C),

O. lugdunensis (L) and O. tenebricosus (T) according

to the usual nomenclature in the beginning of 2019 and

to available identification keys (Table 1), previously to

publication of Casalini and Colonnelli (2019). Our re-

sults (Figs 1-4, 9-10) confirm the synonymization of

O. clavipes and O. lugdunensis and are consistent with

the recently published taxonomic review of these authors

(Casalini & Colonnelli 2019).

Considering the limitations inherent to an exception-

ally morphological study of species delimitation, we

selected an integrative approach combining genetic,

molecular and morphological methods. The desirabi-

lity of an integrative taxonomy has been acknowledged

for more than a decade (Dayrat 2005; Valdecasas et al.

2008; Ober & Connolly 2015), even if it became appar-

ent that observations of the chromosomes did not help in

the separation of taxa, probably because it is a symple-

siomorphic trait (Holecova et al. 2002; Lachowska et al.

2006). Measurements of several body parts did also not

help very much in our study (Figs 7—8), although these

methods were widely used in the past and very useful

in discovering morphological diversity (e.g., Marvaldi

et al. 2002; Przybycien & Wactawik 2015). Differences

in some morphological features between both taxa were

observed but they were not statistically significant. Rea-

sons for the differences of most morphological features

between O. fagi and O. clavipes being so small could

be the phylogenetically low age and their close relation.

Both species produced a rather high number of varie-

ties indicating rather high speed of differentiation may-

be due to Pleistocene or pre-Pleistocene spatial isolation

in mountain areas and indicating a low rate of intermix-

ing despite their size, which should allow a rather better

spreading as in small flightless species. On the other hand

this is in accordance with more recent spreading process-

es by the human-induced passive transport of O. clavipes

as lowland and foothill species and the low introduction

rate of O. fagi as mountain species. Moreover, both may

be subject of ongoing speciation. It seems that genetic

differences will accumulate in prospective generations,

which may lead to even greater isolation between both

taxa and greater morphological differences.

For many weevil species there are significant simi-

larities in morphology, and they can be distinguished

mainly based on their genetic traits, like the genus Aus-

Bonn zoological Bulletin 70 (1): 115-139

Maja Przybycien et al.

tromonticola and new species from New Zealand (Brown

2017) or the genus Sitophilus with the two closely rela-

ted species S. oryzae and S. zeamais (Correa et al. 2013),

or some soil-inhabiting Cryptorhynchinae of the genus

Acallorneuma and the tribe Torneumatini (Sttiben et al.

2016). The method of DNA analysis used in our study

also proved to be the most effective. The results of our

molecular analysis with markers COI and EF-1« indicate

that all German populations studied belong to O. clavi-

pes, and populations from the Alps, the Carpathians and

the Sudetes represent O. fagi. The populations of O. fagi

from the Karawank Mts. (Slovenian Alps) are very dif-

ferent from O. fagi populations of other mountainous re-

gions of Europe, at least based on the available COI data.

We consider this a consequence of long time isolation.

These divergences, especially in COI are rather uncom-

mon in flightless species. Up to now COI or EF-1a could

not be studied in specimens from France and England.

Also habitus and abdominal sternite (AS) of O. clavipes

from Germany, the United Kingdom and France show

rather great morphological variation but differ even

more clearly from the respective morphological parts of

O. fagi.

Our results support the hypothesis that Otiorhynchus

fagi and O. clavipes are two different species and that

O. clavipes is mainly a Western European species. Its

current presence in some cities in the eastern parts of

Europe is an effect of introduction with common lilac,

privet or other shrubs or young trees. Earlier suggestions

of Dieckmann (1980) that diversification of the studied

species began already in the Pliocene and was continued

in the Pleistocene seem worth of further study. This kind

of diversification is still going on, and we regard them as

young, currently evolving species. Studies on evolution

and phylogeography of these taxa in their entire range

could more clearly explain process and time of this phe-

nomenon.

Acknowledgements. We are grateful to our colleagues Miguel

Alonso-Zarazaga (Spain), Marc Delbol (Belgium), Roberto

Casalini (Italy), Christoph Germann (Switzerland), Theodoor

Heijerman (The Netherlands), Manfred Kahlen (Austria) and

Marek Wanat (Poland) for useful information on the presence

of these species in their countries, and Friedhelm Bahr (Germa-

ny) for the excellent photos, as well as to Mitosz Mazur (Po-

land) for offering weevils from the Sudetes. Finally, we would

like to express our warmest thanks to the unknown reviewer for

her or his profound comments.

Financial support. This work was supported by the Jagiello-

nian University (K/ZDS/006320, N18/DBS/000016).

REFERENCES

Abbazzi P, Maggini L (2009) Elenco sistematico-faunistico dei

Curculionoidea Italiani, Scolytidae e Platypodidae esclusi

(Insecta, Coleoptera). Aldrovandia 5: 29-216

©ZFMK

The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 137

Alonso-Zarazaga MA (2014) Fauna Europaea. Version 2.6.2.

Online at http:/(www.faunaeur.org [last accessed 20 Jan.

2020]

Alonso-Zarazaga MA, Barrios H, Borovec R, Bouchard P, Cal-

dara R, Colonnelli E, Gultekin L, Hlava¢ P, Korotyaeev BA,

Lyal CHC, Machado A, Meregalli M, Pierotti H, Ren L, San-

chez-Ruiz M, Sforzi A, Silfverberg H, Skuhrovec J, Tryzna

M, Velazquez de Castro AJ, Yunakov NN (2017) Cooperative

Catalogue of Palaearctic Coleoptera Curculionoidea. Socie-

dad Entomologica Aragonesa, Monografias electronicas SEA

8. Online at www.sea-entomologia.org [last accessed 13 Mar.

2020]

Alonso-Zarazaga MA (2018) Elenco sistematico de los Cur-

culionoidea (Coleoptera) de la peninsula Ibérica e islas

Baleares. Boletin de la Sociedad Entomologica Aragonesa

(S.E.A.) 63: 3-44

Astrin JJ, Sttiben PE (2008) Phylogeny in cryptic weevils: mol-

ecules, morphology and new genera of western Palaearctic

Cryptorhynchinae (Coleoptera: Curculionidae). Invertebrate

Systematics 22 (5): 503-522

Biatooki P (2005) On the distribution of some interesting wee-

vil species (Coleoptera: Apionidae, Curculionidae) in Po-

land. Weevil News Vol. 29. CURCULIO-Institute, M6nchen-

gladbach. Online at http://www.curci.de/Inhalt.html [last

accessed 17 Mar. 2021]

Baur H, Leuenberger C (2011) Analysis of ratios in multivariate

morphometry. Systematic Biology 60 (6): 813-825

Benedikt S, Borovec R, Fremuth J, Kratky J, Schon K,

Skuhrovec J, Tryzna M (2010) Annotated checklist of wee-

vils (Coleoptera: Curculionoidea excepting Scolytinae and

Platypodinae) of the Czech Republic and Slovakia. Klapa-

lekiana 46: 1-1363

Bleich O, Girlich S & Kohler F (2020) Verzeichnis und Ver-

breitungsatlas der Kafer Deutschlands. Internet-Katalog En-

tomofauna Germanica. Online at http://www.coleokat.de/de/

thl/ [last accessed 13 Mar. 2020]

Brown SDJ (2017) Austromonticola, a new genus of broad-

nosed weevil (Coleoptera, Curculionidae, Entiminae) from

montane areas of New Zealand. ZooKeys 707: 73-130

Casalini R, Colonnelli E (2019) Notes on some species of Otio-

rhynchus Germar, 1822 sensu stricto, with new synonymies

and a neotype designation (Coleoptera: Curculionidae). Gre-

dleriana 19: 193-200

Correa AS, Orlando de Oliveira L, Braga LS, Guedes RNC

(2013) Distribution of the related weevil species Sitophi-

lus oryzae and S. zeamais in Brazil. Insect Science 20 (6):

763-770

Dayrat B (2005) Towards integrative taxonomy. Biological

Journal of the Linnean Society 85: 407-415

Delbol M (2010) Les Otiorhynchini de Belgique (Curculioni-

dae: Entiminae). Entomologie faunistique — Faunistic Ento-

mology 62 (4): 139-152

Delbol M (2013) Catalogue des Curculionoidea de Belgique

(Coleoptera: Polyphaga). Belgian Journal of Entomology 13:

1-95

Dieckmann L (1980) Beitrage zur Insektenfauna der DDR: Co-

leoptera — Curculionidae (Brachycerinae, Otiorhynchinae,

Brachyderinae). Beitrage zur Entomologie 30: 145-310

Endrodi S (1961) Bestimmungstabelle der Otiorhynchus-Arten

des Karpaten-Beckens. Krajske Nakladatelstvi, Ostrava

Frieser R (1981) Anthribidae, Otiorhynchinae. Pp. 22-34,

184—240 in: Freude H, Harde KW, Lohse GA (eds) Die Kafer

Mitteleuropas. Band 10. Krefeld

Global Biodiversity Information Facility (GBIF). Online at

https://www.gbif.org [last accessed 13Mar. 2020]

Bonn zoological Bulletin 70 (1): 115-139

Germann C (2010) Die Russelkafer (Coleoptera, Curculionoi-

dea) der Schweiz — Checkliste mit Verbreitungsangaben nach

biogeografischen Regionen. Mitteilungen der Schweizeri-

schen Entomologischen Gesellschaft 83: 41-118

Germann C (2011) Supplement zur Checkliste der Rtisselkafer

der Schweiz (Coleoptera, Curculionoidea). Bulletin de la So-

ciété Entomologique Suisse 84: 155-169

Germann C (2013) First additions to the Checklist of the Swiss

weevil fauna (Coleoptera, Curculionoidea). Bulletin de la

Société Entomologique Suisse 86: 151-164

Germann C, Wyler S, Bernasconi MV (2017) DNA barcoding

of selected alpine beetles with focus on Curculionoidea (Co-

leoptera). Revue suisse de Zoologie 124 (1): 15-38

Gosik R, Sprick P (2013) Morphology and identification of the

pupae of several species of soil-dwelling broad-nosed wee-

vils from Central Europe (Coleoptera, Curculionidae, En-

timinae). Zootaxa 3731 (4): 445-472

Gosik R, Sprick P, Skuhrovec J, Derus M, Hommes M (2016)

Morphology and identification of the mature larvae of seve-

ral species of the genus Otiorhynchus (Coleoptera, Curculi-

onidae, Entiminae) from central Europe with an update of the

life history traits. Zootaxa 4108 (1): 1-67

Hall TA (1999) BioEdit: a user-friendly biological sequence

alignment editor and analysis program for windows 95/98/

NT. Nucl Acids Symp Ser 41: 95—98

Heijerman T (2020) Otiorhynchus clavipes in Nederland (Co-

leoptera: Curculionidae). Entomologische berichten 80 (6):

229-230

Hernandez- Vera G, Caldara R, Tosevski I, Emerson BC (2013)

Molecular phylogenetic analysis of archival tissue reveals

the origin of a disjunct souther African-Palaearctic weevil

radiation. Journal of Biogeography 40: 1348-1359

Hrabovsky K (2014) Nosatcoviti lesnich ekosystémt Beskyd.

Bakalarska prace. Mendelova Univerzita v Brne. Brno

Hoffmann A (1950) Coléopteres Curculionides (Premiere Par-

tie). Faune de France 52

Hoffmann A (1963) Sous-famille des Brachycerinae. Pp. 948—

952 in: Balachowsky AS (ed.): Entomologie appliquée a

Vagriculture, Tome 1. Coléopteres 2. Phytophagoidea (suite

et fin) (Chrysomelidae — Curculionidae — Attelabidae — Sco-

lytidae et Platypodidae). Masson et Cie, Paris

Holecova M, Rozek M, Lachowska D (2002) Heterochromatic

banding patterns on chromosomes of twelve weevil species

(Insecta, Coleoptera, Curculionoidea: Apionidae, Curculio-

nidae). Folia biologica 50 (3-4): 129-134

Ibbotson A, Edwards CAT (1954) The biology and control of

Otiorrhynchus clavipes Bonsd. (Rhyn. Coleopt.), a pest of

strawberries. The Annals of applied Biology 41 (3): 520-535

Kizub IV, Slutsky AI (2019) Contribution to the knowledge of

the genus Otiorhynchus Germar, 1822 (Coleoptera: Curcu-

lionidae) fauna of Ukraine. Part 2. Munis Entomology and

Zoology Journal, Ankaral4 (2): 530-546

Knutelski S (2005) Roznorodnos¢, ekologia 1 chorologia ryj-

kowcow Rezerwatu Biosfery “Tatry” (Coleoptera: Curculio-

noidea). Monografie Faunistyczne 23: 1-340

Koch K (1992) Die Kafer Mitteleuropas. Vol. 3 (Okologie).

Goecke & Evers, Krefeld

Kohler F, Klausnitzer B (1998) Verzeichnis der Kafer Deutsch-

lands. Entomofauna Germanica. Entomologische Nachricht-

en und Berichte (Dresden) 4: 1-185

Lachowska D, Rozek M, Holecova M (2006) Karyotypic cha-

racterization of three weevil species (Coleoptera: Curculioni-

dae, Brachyderini). Folia Biologica 54 (1-2): 13-17

Langeveld B, Creuwels J, Slicker F, Van der Es H (2020) Natu-

ral History Museum Rotterdam — Specimens. Version 1.6.

©ZFMK

138 Maja Przybycien et al.

Natural History Museum Rotterdam. Occurrence Dataset.

https://doi.org/10.15468/kwqaay. Online at https://www.gbif.

org/occurrence/2570204550 [last accessed 13 Mar. 2020]

Lona C (1936) Curculionidae: Otiorrhynchinae I. Pp. 1-226

in: Schenkling S (ed.) Coleopterorum Catalogus auspiciis et

auxilio W. Junk. Pars 148. Junk, Berlin

Lobl I, Smetana A (eds) (2011) 7. Curculionoidea I. Apollo

Books, Stenstrup

Lobl I, Smetana A (eds) (2013) Catalogue of Palaearctic Cole-

optera. Vol. 8. Curculionoidea II. Brill, Leiden / Boston

Magnano L (1998) Notes on the Otiorhynchus Germar, 1824

complex (Coleoptera: Curculionidae). Pp. 51—80 in: Colon-

nelli E., Louw S. & Osella G (eds) Taxonomy, Ecology and

Distribution of Curculionoidea. XX" International Congress

of Entomology (1996, Firenze, Italy). Museo Regionale di

Scienze Naturali, Torino

Magnano L (2001) Designation of lectotypes for species of Cir-

rorhynchus Apfelbeck, 1898, Dodecastichus Stierlin, 1861,

Limatogaster Apfelbeck, 1898, Otiorhychus Germar, 1822

and 7ylotus Schoenherr, 1823, in the Germar and Herbst col-

lections (Coleoptera Curculionidae). Memorie della Societa

Entomologica Italiana 80: 139-158

Marvaldi AE, Sequeira AS, O’Brien CW, Farrell BD (2002)

Molecular and Morphological Phylogenetics of Weevils (Co-

leoptera, Curculionoidea): Do Niche Shifts Accompany Di-

versification? Systematic Biology 51 (5): 761-785

Mazur M (2002) The distribution and ecology of weevils (Cole-

optera, Nemonychidae, Attelabidae, Apionidae, Curculioni-

dae) in western Ukraine. Acta zoologica Cracoviensia 45 (3):

213-244

Mazur M (2016) Otiorhynchini (Coleoptera: Curculionidae)

Polski. Zroznicowanie i klasyfikacja zasiegow. Prace Mono-

graficzne 767. Wydawnictwo naukowe Uniwersytetu Peda-

gogicznego im. Komisji Edukacji Narodowej, Krakow

Morris MG (1997) Broad-nosed weevils. Coleoptera: Curculi-

onidae (Entiminae). Handbooks for the Identification of Bri-

tish Insects 5 (17a). Royal Entomological Society, London

Natural History EM, Abarenkov, K. Estonian Museum of Natu-

ral History. PlutoF. Online at https://www.gbif.org/occur-

rence/2462724453 [last accessed 13 Mar. 2020]

Nylander JAA (2004) MrModeltest 2.0. Program distributed by

the author. Evolutionary Biology Centre, Uppsala University,

Uppsala

Nylander JAA, Ronquist F, Huelsenbeck JP, Nieves-Aldrey JL

(2004) Bayesian phylogenetic analysis of combined data.

Systematic Biology 53 (1): 47-67

Ober KA, Connolly CT (2015) Geometric morphometric and

phylogenetic analyses of Arizona Sky Island populations of

Scaphinotus petersi Roeschke (Coleoptera: Carabidae). Zoo-

logical Journal of the Linnean Society 175: 107-118

Page RDM (1996) TREEVIEW: An application to display phy-

logenetic trees on personal computers. Computer Applica-

tions in the Biosciences 12: 357-358

Palm E (1996) Nordeuropas Snudebiller. 1. De kortsnudede

arter (Coleoptera: Curculionidae) — med szerligt henblik pa

den danske fauna. Danmarks Dyreliv, Bind 7, Apollo Books,

Stenstrup

PoIBIN (2019) Polish Biodiversity Information Network. On-

line at http://coleoptera.ksib.pl/?l=en [last accessed 13 Mar.

2020]

Poole RW & Gentili P (comps.) 1996-1997. Nomina Insecta

Nearctica: A Check List of the Insects of North America. En-

tomological Information Services, Rockville, Maryland: vol.

1. Online at http://nearctica.com/nomina/pdfs/pdf_files.htm

[last accessed 17 Mar. 2021]

Bonn zoological Bulletin 70 (1): 115-139

Przybycien M, Waclawik B (2015) Morphometric measure-

ments of Bryodaemon (Coleoptera: Curculionidae): contri-

bution to phylogeny. Baltic Journal of Coleopterology 15 (2):

129-136

Quinn GP, Keough MJ (2002) Experimental Design and Data

Analisys for Biologists. Cambridge, UK: Cambridge Univer-

sity Press

Rambaut A, Suchard MA, Drummond AJ (2009) Tracer ver.

1.5. Online at tree.bio.ed.ac.uk/software/tracer/ [last ac-

cessed 17 Mar. 2021]

Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phy-

logenetic inference under mixed models. Bioinformatics 19

(12): 1572-1574

Roosileht U (2015) Estonian Additions to Silfverberg’s ,,Enu-

meratio renovata Coleopterorum Fennoscandiae, Daniae et

Baltiae“ Coleoptera Catalog. Sahlbergia 21 (2): 6-39

Schott C (2017) Liste commentée des espéeces alsaciennes

de Cimberidae, Rhynchitidae, Attelabidae, Curculionidae.

(Uniquement les especes confirmées depuis 1950 pour la

région ou de zones limitrophes des départements voisins).

Online at http://claude.schott.free.fr/Curculionidae/Liste_

comm_curcul.html [last accessed 13 Mar. 2020]

Schititte A, Sttiben PE, Sprick P (2013) The Molecular Weevil

Identification Project (Coleoptera: Curculionoidea), Part I. A

contribution to integrative taxonomy and phylogenetic sys-

tematics. Snudebiller 14 (211): 1-77

Slieker F (2019) Natural History Museum Rotterdam (NL)

— Insecta collection. Version 19.34. Natural History Mu-

seum Rotterdam. Online at https://www.gbif.org/occur-

rence/1269535242 [last accessed 20 Jan. 2020]

Smreczynski S (1966) Ryjkowce — Curculionidae. Podrodzi-

ny Otiorhynchinae, Brachyderinae. Klucze do Oznaczania

Owadow Polski, czes¢ XIX, 98b. Panstwowe Wydawnictwo

Naukowe, Warszawa

Sprick P, Sttiben PE (2012) Russelkafer in anthropogenen Le-

bensraéumen. Snudebiller extra (CD Rom), Curculio-Institute,

Monchengladbach. Julius-Kiihn-Institut, Institut fiir Pflan-

zenschutz in Gartenbau und Forst, Braunschweig, Germany

Stamatakis A (2014) RAxML version 8: a tool for phylogenetic

analysis and post-analysis of large phylogenies. Bioinforma-

tics 30 (9): 1312-1313

Stamatakis A, Hoover P, Rougemont J (2008) A rapid bootstrap

algorithm for the RAxML web servers. Systematic Biology

57 (5): 758-771

Struck TH, Feder JL, Bendiksby M, Birkeland S, Cerca J, Gu-

sarov VI, Kistenich S, Larsson KH, Liow LH, Nowak MD,

Stedje B, Bachmann L, Dimitrov D (2018) Finding Evolu-

tionary Processes Hidden in Cryptic Species. Trends in Eco-

logy & Evolution 33 (3): 153-163

Stiiben PE, Schtitte A, Bayer C, Astrin JJ (2015) The Molecular

Weevil Identification Project (Coleoptera: Curculionoidea),

Part II. Towards an Integrative Taxonomy. Snudebiller 16

(237): 1-294, Curculio-Institute, Monchengladbach

Stiben PE, Schtitte A, Lopez H, Astrin JJ (2016) Molec-

ular and morphological systematics of soil-inhabiting

Cryptorhynchinae of the genus Acallorneuma and _ the

tribe Torneumatini (Coleoptera: Curculionidae), with

description of two new species. Beitrage zur Entomo-

logie 66 (2): 169-199

Swofford DL (2002) PAUP*. Phylogenetic Analysis Using

Parsimony (*and Other Methods). Version 4. Sinauer Asso-

ciates, Sunderland, Mass

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins

DG (1997) The CLUSTAL_X windows interface: flexible

©ZFMK

The species status of the Otiorhynchus clavipes (Bonsdorff, 1785) species group 139

strategies for multiple sequence alignment aided by quality

analysis tools. Nucleic Acids Research 25 (24): 4876-4882

Valdecasas AG, Williams D, Wheeler QD (2008) Integrative

taxonomy then and now: a response to Dayrat (2005). Bio-

logical Journal Linnean Society 93: 211-216

Wanat M, Mokrzycki T (2005) A new checklist of the weevils of

Poland (Coleoptera: Curculionoidea). Genus 16 (1): 69-117

Wanat M (2017) Collection of Coleoptera. Wroclaw University,

Museum of Natural History. Online at https://www.gbif.org/

occurrence/1706930172 [last accessed 13 Mar. 2020]

Wanat M, Mokrzycki T (2018) The checklist of the weevils

(Coleoptera: Curculionoidea) of Poland revisited Annales

Zoologici (Warszawa) 68(1): 1-48

Wickham H (2009) ggplot2: Elegant Graphics for Data Analy-

sis. Springer-Verlag, New York

Willis RJ (1964) The bionomics and larval morphology of the

Otiorrhynchid pests of soft fruit crops. PhD thesis, Queen’s

University of Belfast, Belfast

Bonn zoological Bulletin 70 (1): 115-139

Winker K (2005) Sibling species were first recognized by Wil-

liam Derham (1718). The Auk 122 (2): 706-707

Yunakov N, Nazarenko V, Filimonov R, Volovnik S (2018)

A survey of the weevils of Ukraine (Coleoptera: Curculio-

noidea). Zootaxa 4404 (1): 1-494

Zagatti P, Horellou A, Mari A, Arnaboldi F, Reisdorf P (2001)

Atlas des Coléopteres du Massif de Rambouillet et du Parc

Naturel Régional de la Haute Vallée de Chevreuse, Tome

1: 1990-2000. Observatoire National des Invertébrés. Of-

fice Pour l’Information Eco-entomologique. Muinistére de

1’ Aménagement du Territoire et de 1’ Environnement, Paris

Zuniga-Reinoso A, Benitez HA (2015) The overrated use of

the morphological cryptic species concept: An example with

Nyctelia dark beetles (Coleoptera: Tenebrionidae) using geo-

metric morphometrics. Zoologischer Anzeiger 255: 47—53

©ZFMK

BHL

Blank Page Digitally Inserted

Bonn zoological Bulletin 70 (1): 141-171

2021 - Wagner P. et al.

https://do1.org/10.20363/BZB-2021.70.1.141

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:|sid:zoobank.org: pub:4E7 B4E14-7682-465D-A2D9-A26EA04A B3FD

Integrative approach to resolve the

Calotes mystaceus Duméril & Bibron, 1837 species complex

(Squamata: Agamidae)

Philipp Wagner" *, Flora Ihlow’, Timo Hartmann’, Morris Flecks‘, Andreas Schmitz* & Wolfgang Boéhme®

'Allwetterzoo Miinster, Sentruper Strabe 315, D-48161 Minster, Germany

' Department of Biology and Center for Biodiversity and Ecosystem Stewardship, Villanova University, 800 Lancaster Avenue,

Villanova, Pennsylvania 19085, USA

? Museum of Zoology Senckenberg, Dresden, K6énigsbriicker LandstraBe 159, D-01109 Dresden, Germany

46 Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, D-53113 Bonn, Germany

° Natural History Museum of Geneva, UREC-Herpetology & Ichthyology, Route de Malagnou 1, CH-1208 Genéve, Switzerland

“Corresponding author: Email: wagner@allwetterzoo.de

'urn:|lsid:zoobank.org:author:0575CE45-AB5C-4493-A 8A D-DD399E 18284A

2urn:Isid:zoobank.org:author: 1ODB565B-DA19-484E-AE50-ED29945658E8

3urn:Isid:zoobank.org:author:A911B13A-B364-424E-8579-AE23820F1DC1

4urn:|sid:zoobank.org:author:974BF839-926B-4039-96 1 7-135F5CEC2596

>urn:lsid:zoobank.org:author:5B1146D2-B9A6-48E6-9E4E-EB1C8EDIAE7A

6urn:Isid:zoobank.org:author: FFAC2972-9F52-404B-BA9C-489C7793FF8D

Abstract. The genus Ca/otes Cuvier, 1816 “1817” currently contains 25 species, which are widely distributed in Asia

and have been introduced in Africa and America. The genus includes several species complexes, for example, Calotes

versicolor and Calotes mystaceus. The latter was partly resolved by describing Calotes bachae as a distinct species, but it

became obvious that C. mystaceus still consists of several lineages. This study was done to resolve those lineages and we

herein restrict Calotes mystaceus to southern coastal Myanmar, while describing three new species occurring in Cambo-

dia, China, Laos, Myanmar, Thailand, and India. The new species are distinguishable from each other by male coloration

with C. goetzi sp. n. having prominent dark brown dorsolateral blotches, C. geiss/eri sp. n. having orange to light brown

blotches and a whitish stripe from snout-tip to hind limb insertion and C. vindumbarbatus sp. n. having a whitish stripe

from tip of snout continuing to beyond limb insertion. Mean uncorrected p-distances for COI between C. mystaceus and

other taxa are: C. goetzi sp. n. (=0.0603); C. vindumbarbatus sp. n. (=0.0656) and C. bachae (=0.1415). Mean uncorrec-

ted p-distances for 12S between C. mystaceus and other taxa are: C. goetzi sp. n. (=0.0291), C. vindumbarbatus sp. n.

(=0.0375), C. bachae (=0.0548) and C. geissleri sp. n. (=0.0457).

Key words. Calotes bachae, Calotes goetzi sp. n., Calotes geissleri sp. n., Calotes vindumbarbatus sp. n., Indochina.

INTRODUCTION

To date, 25 species of the genus Calotes Cuvier, 1816

“1817” (=journal issued in 1816, but published in 1817)

(Squamata: Agamidae: Draconinae) are recognized (Uetz

et al. 2020). They are mainly distributed across continen-

tal Asia, but also occur on, for example, Sri Lanka, Suma-

tra, and the Moluccas. With the exception of C. versicol-

or (Daudin, 1802) and C. mystaceus Dumeril & Bibron,

1837, species of this genus occupy small geographic rang-

es in India, Sri Lanka, and Myanmar (Hallermann 2000),

while Calotes versicolor in particular has been introduced

on several Asian islands (e.g., Sulawesi and Borneo). In-

dochina, the focal area of this study, harbors eight Ca/otes

species: C. bachae Hartmann, Geissler, Poyarkov, Ihlow,

Galoyan, Rodder & Bohme, 2013; C. chincollium Vin-

dum, 2003; C. emma Gray, 1845; C. htunwini Zug &

Received: 20.01.2021

Accepted: 15.04.2021

Vindum in Zug et al., 2006; C. irawadi Zug, Brown,

Schulte & Vindum, 2006; C. jerdoni Ginther, 1870;

and the widespread species C. mystaceus and C. ver-

sicolor. Calotes rouxii Duméril & Bibron, 1837 and

C. ophiomachus Dumeéril & Bibron, 1837, previously

mentioned in early faunal publications (Morice 1875;

Tirant 1885; Bourret 1927) to occur in Southeast Asia,

are based on misidentifications or synonyms. The latter

is today recognized as synonym of C. calotes, whereas

C. rouxii was transferred to the recently described ge-

nus Monilesaurus (Pal et al. 2018), which is restricted

to the Indian subcontinent.

Despite the widespread distribution of the genus, no

complete review has been done, but several publications

demonstrate that some taxa represent species complex-

es (e.g., Zug et al. 2006; Hartmann et al. 2013). One of

these is the spectacularly colored Blue Forest Lizard

Corresponding editor: A. Bauer

Published: 07.05.2021

142 Philipp Wagner et al.

Calotes mystaceus Duméril & Bibron, 1837. Originally

described from “Pays de Birmans” (=~Myanmar), the

putative range of C. mystaceus extends from China

(e.g., Bain & Hurley 2011) through Southeast Asia (e.g.,

Cambodia: Hartmann et al. 2013, Laos & Myanmar: Das

2015; Thailand: Chan-Ard et al. 2015; to India e.g., Das

2015; see also Figure 1). Previous records from Vietnam

(e.g., Pham et al. 2018) refer to the recently described

C. bachae. A record from Sri Lanka by Flower (1899)

was not confirmed by Somaweera & Somaweera (2009)

and reports from peninsular Malaysia (Das 2015) and the

Andaman and Nicobar Islands (Chan-Ard et al. 2015)

lack references to specific records and are likely also

based on misidentifications. According to Enge & Krys-

ko (2004), C. mystaceus is introduced in Florida, USA.

Previous studies (e.g., Hartmann et al. 2013; Saijun-

tha et al. 2017) revealed high levels of morphological

and genetic differentiations within C. mystaceus. Fur-

thermore, geographic variation of the color pattern

of different populations was recognized from both

sides of the Mekong (e.g., Smith 1921; Bourret 2009),

which was later resolved by the description of Ca/otes

bachae (Hartmann et al. 2013). Therefore, the aim of

this study is a range wide analysis of the morphological

variance and genetic relationships of C. mystaceus Ss.

str. and C. bachae, to implement respective taxonomic

results and discuss potential geographic barriers.

MATERIAL AND METHODS

Institutional abbreviations

The specimens used in this study (see Appendix I) have

been obtained from the following collections:

BMNH = (now NHM) Natural History Museum,

London, UK

California Academy of Sciences,

San Francisco, CA, USA

MNHN = Muséum national d’ Histoire naturelle,

Paris, France

NME = Naturkundemuseum Erfurt,

Erfurt, Germany

ZFMK = Zoologisches Forschungsmuseum

Alexander Koenig, Bonn, Germany

ZMB- = Museum fir Naturkunde, Berlin, Germany

ZMMU = Zoological Museum, Moscow State

University, Moscow, Russia

CAS =

Genetic analysis

Fragments of the two mitochondrial genes 12S rRNA

and COI were sequenced to assess genetic differentia-

tion and to determine phylogenetic relationships between

different populations of Calotes mystaceus. Samples of

thigh muscle tissue were extracted from 54 ethanol-pre-

served museum collection specimens. DNA was extract-

Bonn zoological Bulletin 70 (1): 141-171

ed using the peqGold tissue DNA mini kit (peqLab).

The primers 12sL1091 (light chain; 5'-AAACTGG-

GATTAGATACCCCACTAT—33’) and 12sH1478 (heavy

chain; 5'-AAACTGGGATTAGATACCCCACTAT—3’)

of Kocher et al. (1989) as well as COIVF 1d (light chain;

5'-TTCTCAACCAACCACAARGAYATY GG—33’') and

COIVRId (heavy chain; 5'- TAGACTTCTGGGTGG-

CCRAARAAYCA—3’) of Nazarov et al. (2012) were

used for amplification of 388 bp of 12S rRNA and 600

bp of COI, respectively. PCR cycling conditions follow

Schmitz et al. (2005) and Nazarov et al. (2012). PCR

products were purified using the QIAquick PCR purifi-

cation kit (Qiagen) and sequenced by an external vendor

(Macrogen). Sequences were checked using the orig-

inal electropherograms in PhyDE (http://www.phyde.

de). The dataset was supplemented with sequences from

previous studies (Hartmann et al. 2013; Saijuntha et al.

2017), resulting in a total of 63 sequences (see Table | for

sampled taxa and GenBank accession numbers). We in-

cluded only three sequences from Saijuntha et al. (2017),

carefully chosen to best represent each of the three lin-

eages of C. mystaceus detected by their study, since in-

cluding all sequences showed no alteration in topology,

but resulted in drawbacks concerning the overall support

statistics of trees during preliminary analyses. Sequences

were aligned with MAFFT (Katoh et al. 2009), refined

using the MUSCLE algorithm (Edgar 2004), and manu-

ally corrected where necessary. To account for the phy-

logenetic information of indels, gaps were coded using

the ‘simple method’ of Simmons & Ochoterena (2000) as

implemented in FastGap 1.2 (Borchsenius 2009). Both

gene fragments were analyzed separately as well as us-

ing a concatenated data set for phylogenetic reconstruc-

tion by Bayesian inference (BI). Model parameters were

estimated separately for each gene and codon position

by partitioning the data set. Models of nucleotide sub-

stitution (GTR+G+I for 12S rRNA; K80+I for the 1°,

HKY for the 2", and GTR+G for the 3“ codon position

of COI) were chosen by the Akaike information criterion

(AIC) using Modeltest (Posada & Crandall 1998) as im-

plemented in the package ‘phangorn’ (Schliep 2011) for

Cran R (R Core Team 2020). Bayesian trees were calcu-

lated with MrBayes 3.2.6 (Ronquist et al. 2012) with four

independent runs (10 million generations each, sampled

every 1000, random starting tree). Runs were stopped

when the average standard deviation of split frequencies

had reached 0.01. Convergence of the Markov chains

was checked with Tracer v1.7.1 (Rambaut et al. 2018)

and the initial 25% of generations were discarded prior

to building a consensus tree.

Morphological comparison

A total of 109 specimens belonging to the Calotes mys-

taceus complex (including Calotes bachae) were ex-

amined (see Appendix I). Measurements were taken to

the nearest 0.1 mm using digital calipers. Twenty-three

©ZFMK

New Calotes Species from Mainland SE Asia 143

mensural and eleven meristic characters were obtained

according to Hartmann et al. (2013; Table 2). Specimens

were grouped according to the genetically resolved oper-

ational taxonomic units (OTUs). Juveniles were defined

as specimens with a snout-vent length (SVL) less than

50% of the SVL of the largest specimen of the same OTU

and excluded from the statistical analyses. Analyses of

(co-)variance (AN(C)OVA) were performed to identify

morphological characters that show significant differenc-

es between the OTUs. OTU and sex were considered as

factors for the two-way ANOVA and SVL was added as

covariate for the two-way ANCOVA. Due to sexual di-

morphism, males and females were analyzed separately.

All metric data were log-transformed to assure normal

distribution. Regression residuals were calculated on the

morphometric variables using SVL as a covariable to ac-

count for allometry, 1.e., to avoid size dependent intercor-

relation effects, prior to conducting a principal compo-

nent analysis (PCA) to assess the overall morphological

variation between the putative taxa without making a pri-

orl assumptions about groupings. PCAs were computed

using the ‘ade4’ package (Dray & Dufour 2007) for Cran

R retaining only principal components (PCs) with an ei-

genvalue > 1. Outliers in the PCs were identified using

Mahalanobis distances and removed from the analyses.

As previous authors demonstrated that coloration is an

important character to distinguish distinct evolutionary

lineages in agamid lizards (see, e.g., Stuart-Fox & Ord

2004; Chen et al. 2012; Quah et al. 2012; Wagner 2014)

we also compared coloration patterns of the genetically

distinct lineages.

RESULTS

The phylogenetic analysis of the concatenated 12s rRNA

and COI gene fragments (Fig. 2) reveals differentia-

tion within the Calotes mystaceus complex, including

C. bachae. Based on the type locality (“Pays de Bir-

mans”), Calotes mystaceus s. str. is referable to Clade

D, the sister to Clade A. This latter includes two lineages

(Al and A2) from Central Indochina. Clades A and D to-

gether form the sister to Clade C which includes speci-

mens from northern Myanmar. Basal to these clades is

one lineage including the sister Clades B and E. The lat-

ter includes the holotype of Calotes bachae, while Clade

B includes specimens from western Myanmar. Accord-

ing to our analysis the valid species Calotes mystaceus s.

str. (Clade D) and Calotes bachae (Clade E) are clearly

not sister lineages as C. bachae, along with specimens of

Clade B, constitutes a distinct lineage to the clade that

contains C. mystaceus s. str. Calotes bachae (Clade E)

shows geographic variation between specimens from

Cambodia and Vietnam and one distinct specimen from

Vietnam without precise locality. Clade A shows a differ-

entiation (Clade Al and A2) roughly along the border be-

Bonn zoological Bulletin 70 (1): 141-171

tween Thailand and Myanmar. None of the other clades

show geographic separation.

Mean uncorrected p-distances between species for COI

and 12s rRNA are shown in table 3.

A PCA (Figs 3-4, Table 4, Appendix H—IIT) computed

for all morphological characters of males grouped ac-

cording to genetic OTUs revealed that morphospaces of

the distinct genetic lineages overlap. However, Clade C

is only partly overlapping with Clades B and E, whereas

Clades B, D and E are largely overlapping with Clade

A. The currently valid taxa Calotes bachae (Clade E)

and C. mystaceus (Clade D) also overlap in their mor-

phospaces. In females, most of the morphospaces are

overlapping as well, except for one specimen of Clades

B and C, respectively, and the two specimens represent-

ing Clade D (Figs 3+4, Table 4, Appendix IT). Females of

Clade E are almost completely embedded in the morpho-

space of Clade A. None of the examined morphological

characters was significantly different between OTUs in

the ANOVA and only two characters (“Head width” and

“Interorbital width”) showed differences in the ANCO-

VA (Table 5, Appendix I). According to these results,

the valid species C. mystaceus and C. bachae as well as

the unnamed lineages within the complex are supported

by our genetic data. However, despite the non-discrimi-

natory results of the AN(C)OVA, the clades are clearly

identifiable and have diagnosable characters. Differences

in coloration support the genetic data and distinguish the

lineages from one another. Neither the valid species nor

the cryptic lineages as groups are monophyletic. There-

fore, this complex of lineages, including the above-men-

tioned taxa is herein revised and the genetically support-

ed clades are described as new species according to their

diagnostic morphological characters.

Taxonomic Revision of the Calotes mystaceus species

complex

Calotes bachae Hartmann, Geissler,

Thlow, Galoyan, R6dder & BOhme 2013: 252

(Fig. 2, Clade E)

Hartmann, T., Geissler, P., Poyarkov, N. A. J., [hlow, F., Galoy-

an, E. A., Rédder, D. & W. Bohme (2013). A new species of

the genus Calotes Cuvier, 1817 (Squamata: Agamidae) from

southern Vietnam. Zootaxa 3599 (3): 246—260.

Holotype. ZFMK 88935 (adult male, Fig. 5A-B,

Clade E) from “Vietnam, Dong Nai Province, Cat

Tien National Park (11.6344444° N 107.456667° E),

104 m elevation,” collected by Peter Geibler on May

10" 2009.

Original Diagnosis. A medium-sized Calotes with

a maximum SVL of 97 mm. It can be distinguished

from all taxa of the C. mystaceus complex by the

combination of the following characters: 1) head and

body robust; 2) body scales homogeneous, relative-

ly small, feebly keeled and arranged in regular rows;

Poyarkov,

©ZFMK

Philipp Wagner et al.

144

weg 90% MeL ueg :Arenjoues aJI[pPyIAA Sune}

Apnys SIU. | [O9LI8SMW | S6ILI8SMIW | = -"osuTy :diysuMmo] IAD 90]]] PMN “OLNSIG URAD UA] ‘UOIsTAIC Avjepuey| pOrlEt SVD

Apnys sIUL | ZT6SLISMIN | P8ILI8MIN peol uosue, -Avjepuey] UO Avyepury] JO § UN 96 ‘UOISIAIG Aejepueyy | sewed] 6b8r07 SVD

Apnys sty 97TLISMN SUOH UoOY Suen] OOUTAOIg SURITUSIA, 080L7 NNAZ

Apnys sty 87TLISMINN AB] Ye SuLNI] :OOUIAOI, I[NqeAUles sor] Ev76b MNAZ

Apnys SIUL | P6OSLISMIN | 98TLI8MIN nyni'] Jo JoALUMOp Isnf oATY Usemes =) SueINN :suelfNnN ‘ueuUNA 68PL07 SVD

Apnys SIUL | 96SLI8MIN | O6ILI8MIN peor suosnj-nyniy uo aspliq nyNIT Jo N wy ¢] ‘suelfnN :ueuuny EvI87Z SVO

Apnjs sIuUL | L6OSLI8SMI | I6ILI8MN peol sul[suoT-nyniT Uo osplig NyNIT Jo § wy g] :suelfny :ueuUNA prI87Z SVD

Apnys sIUL | PIOLI8SMIW | 80TLI8MIN sueXsu0T ‘ueysoeg ‘ueuun, SSPTrT SVO

Apnys sIuL | STOLI8SMI | 607LI8MIN sueXsu0T ‘ueysoeg ‘ueuun, LSvTvT SVD

Apnys sIUL | OTOLI8MIW | OLZLI8SMIN Jjouin) suryenyleg Jo § peol nyni]-sul[suo7T ‘sulpsuoT] :ueysoeg ‘ueuuNA euly E9PTVT SVO

E107

ye jo uueUnIeH | €909100M uvodg yeqy yied JeuOTeN UN y WoUYd :soUIAOIg deoy Wag IVE88 NINAZ

E107

‘Te 19 UUeUIeE | «6Q909T0ON Arenyoues asp daywo1g uspny :sOurAOIg IwOYIA Yeoig | eIpoquieg €1706 NNAZ ‘u ‘ds 17j208 ‘Dd

Apnys sty 68ILISMN dred ovg oyeqeyy ed [euoeN edeyyey Mepsuneyy ‘uoIsIAIg suleses ad.Aj0[0y 6ESSIZ SVO

Apnys stu], L8ILISMW dures urged 307] :yeg [euoTeN edeyjey Mepsunryy -UOISIAIG SUIeseS odAyered OLZOIZ SVO

Apnjs stu], ZIZLISMWN OSETIA ynepy :diysumO] MESURD ‘JOLNSIG] MESURD -UOISIAIG, APMSP/Y adAjered OSOEPT SVO

Apnys stu], IIZLISMW OSETIA yNepy :diysumO], MESURD ‘JOLNSIGG MESURD -UOISIAIG, APMSP/L adAjered 8ZOEPT SVO

Apnys sty EITLISMN Osel[IA SuezyeN :diysumo], suezuo], JOLNsIG Wee :a1e1g UIYD TEEEHT SVO

Apnjs sty], SETLISMW OBUIIIA [VISSUITS “JOLNSIG Wee :aye1S UIYD | IJeWUPAPY | odAjered 166L6 MINAZ ‘u ‘ds tajssias ‘Dd

Apnys SUL | [909I00M | TETLI8MIN weg [RUOIEN UOT] JD :OoUIAOI_ 1eN Sug od.Aj0[0y S€688 NNAZ

E107

ye jo uueUnIeH | T909I0ON wed [PUOIEN UOT] JD :OUIAOI_ IBN SUG odAyered €T T7107 V UGA

Apnys sIUL | STOLISMIN | TETLISMIN yueyy Suns], :soulAOIg Sueg OVD 87076 NNAZ

E107

ye Jo uueUNIeH | SySSTrWH BoH sony ‘yleg [euoeN dep] VID ng :s0ulAo1g sony, Yul 1OE€00d VN NWINZ

Apnys sty JETLISMIN [Aqyeso] ostooid ou] | = weujolA 1€796 MINAZ

Apnys SUL | 8ZOLI8SMIN | SETLISMIN sunfueg :doulAold Lryeuryey L6Ev6 ANAZ

Apnys sIuL | LZOLI8SMI | PETLISMIN sunfueg :doulAold Lryeueyey 96€76 NNAZ

Apnys sIUL | 9TOLI8SMIN | E€TLISMIN sunfueg :soulAold Wihyeueyey | eipoquied S6€r6 MNAZ apyong Sajojv)

JUIIIJIY

10)

VNU S7T

UOISSIDIV YuURguas)

Aqe0]

“SIOqUINU UOISsad0R YURqUSDH dAI}Dadsal puv sasdyeue dOUdNsOTAYd dy} UI popnyoul susUTDads *] IQR

Aauunodg

addy, | Gy] adures/zaqono0,

sarpeds

©ZFMK

Bonn zoological Bulletin 70 (1): 141-171

145

New Calotes Species from Mainland SE Asia

Apnys sty]

Apnys sty.

Apnys sty]

L1O@

‘ye 19 eYyJUNIIVS

Apnys sty]

Apnys sty.)

Apnys sty]

L1O@

‘ye 19 eYyJUNIIeS

LI0C

‘ye 39 vyjUNIIeS

Apnys sty.)

Apnys sty.

Apnys sty]

Apnys sty.)

Apnys sty.

Apnys sty]

Apnys sty.)

Apnys sty.

IUIIIJIY,

[ILTOZI8MN

609L 18MIN

OL9LI8MIN

CCOLISMIN

OCOLI8SMIN

99088EXA

ECOLISMIN

IC9LI8MN

LIOLI8MWN

VCILI8MWN

[9088EXo

V8088EXa

619LI8MN

8I9ZI8MN

86SL18MN

66SLI8MN

SO9LI8MN

CIOLI8MN

909LI8MIN

LOOLI8SMIN

OO9LI8SMIA

10D

SOCTLI8MN

COCTLISMIN

VOCLISMINN

CCCLIBMINN

ICCTLISMIN

6ICLISMINN

6CCLISMINN

OCCLISMINN

SICTLI8MN

LECLIBMN

O€cLISMN

LICLISMINN

9ITLISMINN

COILISMINN

cOlILI8MN

661 ZLI8MN

LOCLISMIN

OOCLISMINN

LOTLI8MIN

SCCLIBMIN

VCCLIBMINN

v6ILISMN

VNU S7T

eposeg OAYIeAY 0} UOWUTY [Ie oy} Suoye :diysuMmoOy oy YIeAY :91e1S UO

OBU]IIA

SuneyoyoAesNy :diysumoy, Mepndesn :J1NsIq uloyeg :UOIsTAIG: ApeMIvAdKYV

dures jso10J UIASUNOX puUe d8eIIIA UIqey}

-Ub}H UdOMJOq :diysuMO], MepndesyN “OLNsIq Ulayjeg :UOIsIAIG ApeMmIeAdAYV

JOATY ION Wog Wey :unqiyg :Tueyyeyoyey Uo”

UOYYeN woyes

sueny] suojyy suey, wnyiedg

DOUTAOIg URN

eUISeYyo}ey UOYYeN

eUISeYyd}ey UOYyeN

sueyiq ‘unqdo'y

asplq JOATY eM Y ‘Linqeueyouey

suong ueg ‘lng uoYyD

sue, ‘Tey, suey)

Ie] suelyD

Ie] SueryD

weq ejury 0} dues urg ny eypy :AATenjoues

OJIPILM, OARD Uljepeg pue Sunvjueg :diysumol ues uesueM X :aye1S ULYS

OSLI[IA OSRTIIA JNO], SulepY :AeNjouKS PULTIOM Ye] IU] :aye1S UBYS

Alo\seuo|/

quod sUTPy Jeou :ArenjouRS SJITP]IAA Iesieg :diysumoy, Yylayroey, :ayeyg ueys

dSRI[IA YHouL, Sureyy :ATenyoues puvpjony Oye] su] :o7e1S ueYS

dBE]IIA OG UIA 0} SuNvYydiedy :drysumoy, Suoyedy :aye1S UeYS

ase][IA odoyueg pue eA UTP] UdOMJOq :diysuMO], SUOWeAY ‘981g UPYS

uopnyy ouUTAIETMe] :9781S UOJ]

uopnyy oUTATETMe] :9781S OP]

OSR[IA PMH IT Weg ulejUNOp]

edog :diysumoy, sunepedynedy :101INsIq ( SuNeAN :UOTSTAIG Avyepueyy

Aqe0']

JewuuedAjy

pueyrey,y,

Aauunodg

L8c0v~ SVO

9LTOET SVO

86€6€C SVO

19S0v ANAZ

€1/98L0 a HNN

CI/TSL0 ¥ AWN

DP1Ld

O19SS AWAZ

€1/S8Z0 a HNN

60/18S0 Y ANN

v9l6v AWAZ

L988 AWAZ

TQNO

INO

(60/r8S0 U ANN

®60/78S0 U AWN

vo90ET SVO

vS90ET SVO

697SET SVO

LLSIv~ SVO

LISS€T SVO

88SEC SVO

660SV AWAZ

860S7 AWAZ

T€clec SWO

ody, | GY adures/z9qon0,

snaopjsdul “Dd

sapeds

(panunuos) “T a1qeI

©ZFMK

Bonn zoological Bulletin 70 (1): 141-171

Philipp Wagner et al.

146

; : gO 2

S S B.S. 6

~ SS it hale

a 3 & B

3 Ss Ss

S S

i S

INR SZ eG: ONG © Gyo |e Oe OG: |r

gae2ezl|r> &- Je >| > & Sle

Snr *ngZgz zw Alin n nm! &

A pal Rk AP NIN NY w| &

BW WwW BO Ww!}o re Bb] @

Bio of © VN Ni HRA Ww OO]

SB AalY Y sp wl nA BW NI ®

Sia ie eee ok S OIE

a a s[rx a S & I] S AE

Sa 8

zg 2

—_

3s to DOD Sr 9 <j

> Ss S$ 6 »®

Ss s s o 8 ZS

gee ae <2 is

gsJd6fto# 68

Oo Og OaQoO QO Oo

: eat < eo)

B 56 ‘S S

= & = =

ie) os

Zs =| =

11h rin n

eogle ean xls # 3/5

5S F&F © /0@ 0 GQ Oo o/l/B B S/6

PSE. & FEF Fe ge Fle

es Y Set [dee e-em | PO eee er lt

= nn Nn

Be RO ee cela

aes S$ © & SIE & x

ey aoe = te

556 22 Zlf & 8

rE Soe ae See

a -&4 alo

Ar Re Re =

es Fea a2jg FS

B §& B 5 Ble =

gs Ss 2 & ele & 2

Sao ne Re Peles

Big 20) GD Q)a py B

Sass Rilo ss 5

oO. Uw go na =

eS Gamarces. OS eek

a fr 2& FF ®2 s &

2 Sip 6 oS

5 v2 oa ga y BS

So eee oe ice @ ga

> 2 FF Bf ~

Z2Ss65 6&6 6 A Oe

o U©F:lUmlhUe CU @

> fo « -« - <q

n?Zg ee = See.

2s £ SB S 5 cq

o BF wf °° >

= Sie gle ee @ &

z= 5

gq « Bots

o 5

25 os Ss

5 sR

< 2 'S

é ae

ia is)

per)

is)

> =, (Soe eS She ke —

ee Z=steesz 8/2 = ?

~— | 00 C0 C0] C8 Cc oO CO} 00 CO OO] Um

OO et Ee SE EE a ee ee

gvlixa xa ATA A AN 3/3 3 3/8

Bin vw nie vy vb = =f Se -— vy

Sr [Rs Shes Coot (Son MM Foes | eae Met came en

a] «(E222 SEES

re 0 0 Cc Co co | 0 co ofA

oO SS = — Safe Fe KF1S

ee a yn xn Nn s~}/rn xn nr! =

iS DRA A Aa Alanna a

oS SoS ON 8S S/o © =

NO wo OO fs Wlwoi Wm wv

<>l3 5 53)/53 33s Hl3a45s45lp

eS |S Meee eg ee a (ed S| 8

NO|2A A ALA BDA a a | An nA a] ep

per ie elle. | ae Te Pea a ye Ie

See 2. aire E So = |\re- 12> 8

pend poh my oue, odie shar at ah Cele ES a Gs: |l

Bisa Sa SSeS: a ees a re

bab)

Bonn zoological Bulletin 70 (1): 141-171

(panunuos) *T a1qer

3) 44-50 midbody scale rows; 4) upper dorsolateral

scales pointing backwards and upwards; 5) two short

and well separated spines, surrounded by three to four

scales on either side of the upper head above the tym-

panum; 6) nuchal and dorsal crest continuous, com-

posed of erected compressed scales, directed poste-

riorly; 7) vertebral spines and scales in males 35—42

and in females 43—46; 8) oblique fold of skin in front

of fore limb insertion distinct, covered with small

granular dark scales; 9) extremities and tail relatively

long and slender (see comparison with C. mystaceus

for details); 10) bluish to turquoise head and anteri-

or body part, this coloration not well exceeding front

limb insertion; 11) yellowish light stripe at upper lip

reaching from below anterior corner of eye to posteri-

or end of head; 12) no dorsolateral brownish blotches,

sometimes faint medial brownish blotches across the

vertebral crest.

Male coloration. The brilliant coloration of adult

males is characterized by a brightly colored bluish to tur-

quoise head, with bluish coloration continuing posterior-

ly to fore limb insertion. There is a relatively faded light

(bright yellowish, when under acute distress, a character

typical for C. bachae only) stripe at the upper lip crossing

the tympanum from beneath the eye to end of head. Gular

pouch colored in darker blue, interscale skin black. A tri-

angular to crescent-shaped patch of small black scales is

present in front of shoulder. Very faint brownish blotch-

es extending mid-dorsally over the vertebral crest, from

above fore limb insertion on to tail; posterior to fore limb

insertion brownish orange in color on trunk and tail; hind

limb in a slightly darker brown; venter cream.

Distribution. Calotes bachae is known from southern

Vietnam, with two specimens reported from the Viet-

nam-China border in northern Vietnam, and from eastern

Cambodia (Fig. 1).

Ecology. Calotes bachae is a diurnal, semi-arboreal

lizard, often observed climbing on tree trunks at a height

of 5-10 meters above the ground. The species mainly

inhabits dipterocarp lowland forests and cultural land-

scapes up to 700 m a.s.l. The species seems to be quite

heliophilic, preferring more open habitats without closed

canopies (Hartmann et al. 2013), but was also observed

in dense tropical monsoon forests with closed canopy, in

open gallery forest, and anthropogenic habitats like road-

sides within the forest or open park landscapes within

the headquarters of the park. In these anthropogenic hab-

itats C. bachae occurs in syntopy with Calotes versicol-

or (Hartmann et al. 2013). According to Hartmann et al.

(2013) C. bachae feeds on numerous arthropods includ-

ing Formicidae, Coleoptera, Orthoptera, and Myriapo-

da. Males acquire their breeding coloration at the end

of February, while gravid females have been found

mid-April and egg-laying of a clutch of five eggs was

observed in April and May. Juveniles hatched after 56

days while incubated at 22 to 25° C in captivity.

©ZFMK

New Calotes Species from Mainland SE Asia 147

Fig. 1. Geographic distribution of examined specimens of the Calotes mystaceus complex. Colors correspond to the identified

OTUs. Diamonds mark the type localities of the species described herein. Records with a bold margin were also included in the

phylogenetic analyses. Imprecise (1.e., country-level) records are marked with a question mark. Detailed localities are: Calotes

bachae: Vietnam: Dong Nai Prov.: Cat Tien National Park (1); Dong Nai Nature Reserve (2); Bu Gia Map National Park (3); Kon

Tum (4); Trung Khanh (5); Cambodia: Banlung (7); Calotes goetzi sp. n.. Cambodia: Phnom Kulen National Park (8); Kulen Prom-

tep Wildlife Sanctuary (9); Laos: Muang Phon Hong (10); Luang Prabang (11); Muang Pak Lay (12); Thailand: Sakon Nakhon

Prov. (13); Lam Dom Noi River (14); Khon Buri (15); Nakhon Ratchasima (16); Dilang (17); Ban Nam Len (18); Lom Sak (19);

Ban Bueng (20); Khlong Luang (21); Cha-am (22); Ban Phai (23); Kwai River bridge (24); Ban Dong Noi (25); Phitsanulok Prov.

(26); Nan Prov. (27); Chiang Mai Prov. (28); Fang (33); Myanmar: Kawkareik (30); Mudon (31); Karen Hills (32); Parsa Wildlife

Sanctuary (29); Kyaitong Township (34, 35); Inle Lake Wetland Sanctuary (36, 37); Taunggyi (38); Pindaya (39); Panlaung and

Padalin Cave Wildlife Sanctuary (40); Mandalay- Yangon road (41); Minsontaung Wildlife Sanctuary (42); Popa Mountain Park

(43); Mandalay (44); Shwebo (45); Bhamo (46); Indawgyi Lake (47); “Pegu” (54, see discussion in text); China: Baihualing (48);

Longyang (49, 50); Liuku-Longling road (51); Liuku (52); Liuku-Fugong road (53); Calotes mystaceus: Myanmar: “Pegu” (54;

see discussion in text); Kyaiktryo Pagoda (56, 57); Taungoo (58); Letpein village (59); Hlawga National Park (60); Ngapudaw

township (61); Ngayokekaung village (62); Calotes vindumbarbatus sp. n.: Myanmar: Gat Shang Yang village (63); Hepu village

(64); Linpha village (65); Swekawngaw (66); Calotes geissleri sp. n.: Myanmar: Alaungdaw Kathapa National Park (67, 68); Mauk

village (69, 70); Natzang village (71); Simggial village (72); India: Nagaland: Kohima (73).

Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK

148 Philipp Wagner et al.

NME RO590/09 Calotes emma

NME RO577/09 Calotes emma

ZFMK 44016 Calotes emma

| CAS 210270 (68)

L CAS 243028 (69)

@ CAS 243050 (70)

CAS 215539 (67) Clade B

CAS 243332 (71)

° ZFMK 97991 (72)

ZFMK 96231 (6)

ZFMK 94396 (7)

ZFMK 94395 (7)

ZFMK 94397 (7)

IEBR A.2012.23 (1) Clade E

ZFMK 88935 (1)

« ZFMK 92028 (5)

ZMMU NAPO0301 (3)

CAS 232247 (66)

CAS 239206 (65)

CAS 232387 (63) Clade C

CAS 232388 (63)

ZFMK 97990 (63) &

CAS 239276 (62)

CAS 239398 (61)

CAS 213300 (60) |

— CAS 206548 (59) Clade D

P_« CAS 240287 (57)

~ CAS 240296 (56)

CMf1 (33)

j CAS 207489 (52)

| CAS 228144 (51)

b CAS 242455 (50)

| CAS 242457 9)

CAS 242463 (48

| - CAS 230654 (37) :

CAS 241577 (36) Clade A1

« CAS 235517 (35)

F CAS 235883 (34)

CAS 204849 (41)

CAS 230624 (40)

CAS 231231 (43)

CAS 231404 (42)

CAS 235469 (29)

ZFMK 45498 (31)

ZFMK 45499 (31)

ZFMK 47080 (10)

ZFMK 49164 (17)

ZFMK 55610 (27)

ZFMK 84867 (24)

CNb1 (20)

PTk1 (21)

NME R0581/09 (16) Clade A2

NME RO785/13 (16)

NME R0584/09a (28)

NME R0584/09j (28)

NME RO751/12 (13)

NME RO786/13 (13)

ZFMK 40561 (14)

_ ZFMK 49243 (12)

0.01 ZFMK 88341 (8)

ZFMK 90413 (9)

Fig. 2. The Bayesian consensus tree based on 988 bp of mitochondrial DNA (12S rRNA and COI) shows six distinct lineages within

Calotes mystaceus. Node support in terms of Bayesian posterior probabilities is indicated by circles at nodes (nodes with a BPP >

0.90 are white, BPP > 0.95 are grey, BPP > 0.99 are black, values < 0.90 are not marked). Outgroup (Calotes versicolor) not shown

for clarity. Numbers in parentheses behind taxa refer to localities mapped in Fig. 1.

©ZFMK

Bonn zoological Bulletin 70 (1): 141-171

New Calotes Species from Mainland SE Asia 149

Table 2. Description of the morphological characters and respective abbreviations used in this study.

Character Abbreviation | Description

Mensural characters

4" finger 4"FingL Distance from juncture of 3™ and 4" digits to distalmost extent (outer/distalmost surface of claw) of

4" finger.

4" toe 4"ToeL Distance from juncture of 3" and 4" digits to distal end of 4" digit on hindfoot.

Crus length CrusL Length of tibia from knee to heel.

Eye-ear length EyeEar Distance from anterior edge of tympanum to posterior of orbit (not pupil opening).

Forefoot length ForefL Distance from proximal end of forefoot to tip of fourth digit.

Head height HeadH Dorsoventral distance from top of head to underside of jaw at transverse plane intersecting angle of

jaws.

Head length HeadL Distance from anterior edge of tympanum to tip of snout.

Head width Head W Distance from left to right outer edge of temporal or jaw muscles at their widest point without com-

pression of soft tissue.

Hindfoot length HindfL Distance from proximal end (heel) of hindfoot to distalmost surface of fourth toe.

Interorbital width Interorb Transverse distance between anterodorsal corners of left and right orbits.

Jaw width JawW Distance from left to right outer edge of jaw angles; this measurement excludes jaw musculature

broadening of head.

Lower arm length LoArmL Distance from elbow to distal end of wrist, or just before underside of forefoot.

Naris-eye length NarEye Distance from anterior edge of orbit to posterior edge of naris.

Snout-eye length SnEye Distance from anterior edge of orbit to tip of snout (rostral scale).

Snout-forelimb length | SnForeL Distance from anterior of forelimb, or shoulder, to tip of snout.

Snout width SnW Internasal or internarial distance; transverse distance between left and right nares.

Snout-vent length SVL

Tail height TailH Distance from dorsal to ventral surface of tail base measured just posterior to vent.

Tail length TailL Distance from vent to distal end of tail; noting completeness or regeneration of tail.

Tail width TailW Distance from left to right side of tail base just posterior to vent.

Trunk length TrunkL Body length or axilla-groin length of others; distance between posterior edge of forelimb insertion

(axilla) to anterior edge of hindlimb insertion (inguen).

Upper arm length UpArmL Distance from anterior insertion of forelimb, or shoulder, to elbow.

Upper leg length UpLegL Distance from anterior edge of hindlimb insertion to knee.

Meristic characters

Forefoot lamellae 4FingLm Number of 4" digit lamellae; from 1‘ lamella at digits’ cleft that is wider than deep and touches

dorsal digital scale (on at least one side) to most distal lamella; fragmented proximal scales are

excluded.

Hindfoot lamellae 4ToeLm Analogous to 4FingLm at 4" toe.

Canthus rostralis CanthR Number of elongate scales along ‘dorsolateral snout ridge’ from above posterodorsal corner of nasal

scale to and including posteriormost supraciliary scale.

Dorsal eyelid scales Eyelid Number of scales found along dorsal edge of eyelid.

Dorsal head scales HeadSLn Number of scales longitudinally on midline between interparietal and rostral scale.

Head scales HeadSTr Number of scales in transverse line between posteriormost left and right supraciliary scales, just

anterior of interparietal.

Infralabials Inflab Posterior end defined by posteriormost enlarged scales that touches with Suplab at rear corner of

mouth.

Midbody scale rows | MidbS Number of scale rows around trunk at midbody.

Snout scales SnS Number of scales on line transversally between left and right nasal scales (single scale surrounding

naris).

Supralabials Suplab Posterior end defined by posteriormost enlarged scales that touches Inflab at rear corner of mouth.

Vertebral scales or VertS Number of middorsal scales (spines or not), beginning with first enlarged spine-like scale on nape to

spines

above vent.

Bonn zoological Bulletin 70 (1): 141-171

©ZFMK

150 Philipp Wagner et al.

Table 3. Mean uncorrected p-distances between species for COI (above diagonal) and 12S rRNA (below diagonal). [NA = not

available, C. geiss/eri sp. n. missing in COI data set]

bachae mystaceus | vindumbarbatus sp. n.

bachae NA 0.1465 0.1415 0.1391

geissleri sp. n. 0.0610 NA NA NA

goetzi sp. Nn. 0.0603 0.0486 0.0603 0.0647

mystaceus 0.0548 0.0457 0.0291 0.0656

vindumbarbatus sp. n. | 0.0615 0.0476 0.0326 0.0375

Calotes geissleri sp. n.

(Fig. 2, Clade B)

urn. lsid:zoobank.org:act: EC4DA90A-417D-48 E6-8EA2-FA073D168425

Holotype. CAS 215539 (adult male, Fig. 6A-B,

Clade B) from Myanmar, Sagaing Division, Mon Ywa

District, AK Park, Thabake Sae Camp [22.316806° N,

94.475556° E], collected by H. Win, T. Thin, S.L. Oo

and H. Tun on June 9" 2000.

Paratypes. CAS 210270 from Myanmar, Alaungdaw

Kathapa National Park, Thabakesay (Log Cabin Camp)

[22.318194° N, 94.475722° E]; ZFMK 97991 (formerly

CAS 243200) from Myanmar, Chin State, Phalum Dis-

trict, Simggial village [23.762583° N, 93.546167° E,

1362 m.]; CAS 243028, CAS 243050 both from Myan-

mar, Magway Division, Gangaw District, Gangaw

Township, Mauk village [22.335861° N, 94.144583° E,

205 m.].

Diagnosis. A large sized Calotes species with a known

maximum SVL of 122 mm in males and 114 mm in fe-

males. Tail relatively short, up to 270 mm in males and

223 mm in females. The new species can be distinguished

from other species of the complex by the combination

of the following characters: 1) head and body very ro-

bust; 2) nuchal and dorsal crests continuous, composed

of erect compressed scales, directed posteriorly, larger on

the nuchal crest than on the dorsal crest, becoming small-

er towards the tail; 3) 50-62 scale rows around midbody;

4) 35-45 vertebral spines and scales in males, 49-50

in females; 5) body scales small, homogeneous, feebly

keeled and arranged in regular rows; 6) a short row of

separated spines on both sides of the head, directing from

the tympanum to the first scale of the nuchal crest; 7)

extremities relatively short and robust; 8) oblique skin

fold in front of the fore limbs, 9) head and body bluish,

with a white band from the tip of the mouth along the

upper lip, the tympanum and prominently continuing be-

tween the dorsolateral brownish orange body blotches on

the body reaching the hind limbs, band as broad as the

height of the tympanum on the head and above the front

legs, becoming gradually narrower until the insertion of

the hindlimbs; 10) three or more large distinct brownish

orange blotches on both sides of the body between the

limbs.

Bonn zoological Bulletin 70 (1): 141-171

Description of the holotype. Moderately large male

of 110 mm SVL. Tail relatively short (201 mm), extremi-

ties robust. Head large, distinct from the neck and lateral

sides flat. Posterior parts of jaw angle swollen. Snout-tip

blunt. Nostril in a single scale, separated from the labial

scale by a single scale. Rostral and mental scales small.

Canthus rostralis sharp and straight from the nostril to

the posterior part of the eye, including six scales between

the nostril and the eye and 12 supraciliary scales. Eleven

supralabial scales on both sides of the head, separated

from the orbit by five rows of small scales. Nine infral-

abial scales. Seven scales between the orbit and the tym-

panum, tympanum distinct, with a row of spiny scales

from above the tympanum to the first scale of the nu-

chal crest. Scales on chin and throat keeled. Nuchal crest

with 14 scales, dorsal crest with 21 scales. Spines of the

nuchal crest larger than those of the dorsal crest, rela-

tively uniform in height at the nuchal crest but gradually

decreasing from posterior of the neck to the hind limbs.

Dorsal and lateral body scales keeled, pointing upwards

and backwards. Caudal scales keeled, directed back-

wards. Fore and hind limbs relatively robust, forth finger

and fourth toe longest.

Male coloration. Males in breeding color with blue

head and body (Fig. 6C). A white band 1s present from

the tip of the snout along the upper lips and the tympa-

num, predominantly continuing between the dorsolateral

blotches on the lateral sides of the body to the hind limbs.

The band is as broad as the height of the tympanum on

the head and above the fore legs, becoming gradually

narrower towards the insertion of the hind limbs. Three

or more large distinct brownish-orange blotches on the

lateral sides of the body between the limbs. Non-display

coloration unknown.

Variation. Body measurements and meristic charac-

ters for adult individuals are given in Table 4. Specimens

ranged in size from the smallest female with a SVL of

92 mm (CAS 210270) and the largest female with a SVL

of 114 mm (CAS 243200) to the largest male with a SVL

of 120 mm (CAS 243028). In general, adult males are

larger than females, and have greater SVLs, tail lengths

and head lengths and widths and fewer vertebral scales,

including crest scales. While proportionally the heads of

adult males and females are equal, males have propor-

©ZFMK

New Calotes Species from Mainland SE Asia 151

O Calotes bachae

@ C. bachae holotype

O C. geissleri sp. n.

® C. geissleri sp. n. holotype

O C. goetzi sp. n. (western clade)

® C. goetzi sp. n. holotype

O C. mystaceus

@ C. mystaceus holotype

® C. vindumbarbatus sp. n. holotype

Fig. 3. Principal component analyses results for the morphologically examined specimens. Details of Eigenvalues and explained

variance are given in Table 3.

tionally wider heads than females, probably because of

the swollen jaw angle. Dorsal coloration differs between

sexes and both sexes are able to change coloration. Col-

oration characters (lateral stripe, blotches) are lighter or

sometimes absent in females. Blue coloration on head

and body. The stripe is distinctly present between the

mental and the shoulder, becoming more indistinct be-

tween the blotches on the lateral sides of the body, and

extending to above the hindlimbs. Irregular whitish dots

Bonn zoological Bulletin 70 (1): 141-171

of several scales are present on the lateral sides of the

body in females.

Etymology. The specific epithet is a patronym formed

in the genitive singular honoring Dr. Peter GeiBbler, Mu-

seum Natur und Mensch, Freiburg, Germany, in recog-

nition of his work on the Southeast Asian herpetofauna

in general, and his collection of Calotes bachae speci-

mens in 2009 in particular, which initiated research on

the Calotes mystaceus complex.

©ZFMK

152 Philipp Wagner et al.

( @ holotype)

( ®@ holotype)

( @ holotype)

PC1

Fig. 4. Principal component analysis results for the morphologically examined specimens, colored according to to the genetic

clades. Details of Eigenvalues and explained variance are given in Table 3.

Table 4. Eigenvalues and percent of explained variance per principal component of mensural and meristic data of males and fe-

males as shown in Figs 3-4.

Females PCI PC2 PC3 PC4 PCS PC6 PC7 PC8

Eigenvalue 8.97458 3.36167 2.39687 2.23517 1.94366 1.50995 1.49041 1.16296

Explained variance 0.29915 0.11206 0.07990 0.07451 0.06479 0.05033 0.04968 0.03877

Males PCI PC2 PC3 PC4 PCS PC6 PC7 PC8

Eigenvalue 8.36195 3.14874 2.78013 2.03641 1.53439 1.34330 1.23076 1.06270

Explained variance 0.27873 0.10496 0.09267 0.06788 0.05115 0.04478 0.04103 0.03542

Distribution. The new species is documented only

from Myanmar and India (e.g., BMNH 1956.1.11.98,

specimens mentioned by Lalremsanga et al. [2010]).

Ecology. Calotes geissleri sp. n. is diurnal and semi-ar-

boreal. Preferred habitats are unknown. Lalremsanga

et al. (2010) collected one individual on a branch of Pi-

nus kesiya, about 3m above the ground, in a secondary

forest. The specimen was kept and remained greyish

brown in coloration in captivity, but changed the color of

the head and anterior portion of the trunk to bright blue

minutes after exposure to the sun. Like other Calotes spe-

cies, C. geissleri sp. n. feeds on arthropods like Coleop-

tera, Formicidae and others. In India (see Lalremsanga

et al. 2010) the species occurs in sympatry with Calotes

Jerdoni and C. versicolor.

Calotes goetzi sp. n.

(Fig. 2, Clade A)

urn: sid:zoobank.org:act:7827D48E-E 121-4904-96 36-3A46AE42B369

Holotype. ZFMK 92606 (adult male, Fig. 7A-C, Clade

A) from Cambodia, Siem Reap Province, near Kbal Spean

within the Phnom Kulen National Park [13.699167° N,

103.998611° E].

Paratypes. ZFMK 88341 (adult male), ZFMK 92607

(adult female) from the same locality as the holotype.

Diagnosis. A large species of Ca/otes, with a maximum

SVL of 143 mm in males and 122 mm in females. It can

Bonn zoological Bulletin 70 (1): 141-171

be distinguished from other species of the group by the

combination of the following characters: 1) head, body

and limbs robust, tail long but not as long as in C. mys-

taceus;, 2) body scales mid-sized, homogeneous, keeled,

arranged in regular rows; 3) upper dorsolateral scales

pointing up- and backwards; 4) body scales arranged in

45—60 rows around midbody; 5) two short and separated

spines, surrounded by a ring of scales between the tym-

panum and the vertebral crest on both sides of the head;

6) vertebral crest continuous from above the tympanum

to the hind limbs, composed of erected scales, directed

posteriorly, highest slightly in front of the insertion of the

front limbs, becoming gradually shorter towards the hind

limbs; 7) vertebral scales, including vertebral spines, 37—

52 in males and 43-60 in females; 8) oblique skin fold in

front of the fore limbs; 9) head, body, and limbs bluish in

males; 19) males with a white stripe from between nostril

and orbit along the upper lip and the tympanum to the

front limb insertion; 11) three to five distinct dark brown

dorsolateral blotches.

Description of the holotype. Large male (SVL

118 mm). Body robust, tail relatively short, 236 mm

long. Fore- and hind limbs relatively slender, fourth fin-

ger and toe longest. Head distinct from the neck, poste-

rior jaw angles heavily swollen. Tip of the snout blunt,

rostral small. Nostril large, in a single scale, separated

from the rostral by one elongated scale and from the first

two supralabial scales by two rectangular scales. Canthus

©ZFMK

New Calotes Species from Mainland SE Asia 153

lateral view. C. Living holotype from Cat Tien National Park, Vietnam.

Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK

Philipp Wagner et al.

AYER Sas.

——. -

ee a

pag

Ss ot

Fig. 6. Calotes geissleri sp. n. A. Holotype (CAS 215539, adult male), general view from above. B. Holotype, lateral view. C. Liv-

ing adult male (CAS 220586), from Nat Ma Taung National Park, Htin Chaun Village, Chin State, Myanmar.

Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK

New Calotes Species from Mainland SE Asia

EE ) — > a!

_— oe = f' — we _ aoe | Y ,

a ’ cal eye 5

ees 7. Calotes ery sp. n. A. Holotype (ZFMK 92606, adult male), general view from el B. Gene lateral view. me Living

holotype from Kbal Spean, Cambodia.

Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK

156 Philipp Wagner et al.

Fig. 8. Calotes mystaceus Dumeéril & Bibron, 1837. A. Holotype (MNHN 2557, juvenile male), general view from above. B. Holo-

type, detailed lateral view. C. Adult male from Yangon, eastern Irrawaddy delta, coastal Myanmar, which is within the type locality

“pays de Birmans [=Myanmar].”

Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK

New Calotes Species from Mainland SE Asia 157

rostralis distinct, formed by nine scales from the nos-

tril to above the orbit and continuous with supraciliary

scales. Lateral sides of the head flat. Supralabial scales

9/9, infralabial scales 10/10. Supralabial scales separated

from the orbit by four rows of small scales. Eight scales

between the orbit and the tympanum, two of them slight-

ly ridged. Tympanum distinct, two spines, surrounded by

a ring of scales, between the tympanum and the vertebral

crest. Mental scale small, bordered by two postmental

scales which are separated from each other. First pair

of the postmental scales in contact with the infralabial

scale. Scales on the dorsal part of the chin smooth to fee-

bly keeled, becoming strongly keeled towards the throat.

Vertebral crest continuous from above the tympanum to

the tail, spines highest above the insertion of the front

limbs and gradually decreasing towards the tail. Dorsal

and lateral scales strongly keeled, pointing up- and back-

wards. Ventral scales parallelly keeled. Caudal scales

smooth to feebly keeled, directed backwards. Subcaudal

scales parallel and strongly keeled.

Male coloration. Head, body and limbs bluish. A white

stripe, as high as the tympanum, is present from between

nostril and orbit along the upper lip and the tympanum to

the insertion of the front limb. The stripe is followed by

three to five large reddish-brown to dark-brown blotches,

with the first above the insertion of the fore limbs and

the latest at around midbody or above the insertion of

the hindlimbs, sometimes continuing on the tail. Throat

coloration darker than the chin and the head coloration.

From Thailand, males are known to have bright blue

hindlimbs and crest scales. Intermediate males with a

blue head and a white stripe, but body coloration brown-

ish-black with indistinct light brown blotches. Non-bril-

liant coloration in males from Thailand reddish-brown,

with a white non-continuous stripe from the orbit to

above the hindlimbs. Blotches brownish, darker than the

body coloration.

Variation. Body measurements and meristic characters

for adult individuals are given in Tables 4. Specimens

ranged in size between the smallest adult with a SVL of

84 mm (MNHN 1884.548) and the largest female with

a SVL of 126 mm (ZFMK 44893) to the largest male

measuring 145 mm (MNHN 1884.546). In general, adult

males are larger than females, because of longer SVLs,

tail lengths, head lengths, and widths and slightly fewer

vertebral scales including the crest scales. Heads of adult

males and females are proportionally equal in length,

but male heads are wider than those of females, proba-

bly because of the swollen jaw angle. Dorsal coloration

differs between sexes and both sexes are able to change

the coloration. Coloration characters being lighter in fe-

males; head and body blue. Lateral stripe from between

the nostril and orbit along the upper lips and the tympa-

num to the first blotch. Sometimes the first two brown-

ish blotches are framed by scales in the same coloration

as the lateral stripe. Three to five blotches present, from

Bonn zoological Bulletin 70 (1): 141-171

above the insertion of the fore limbs to about mid-body

or even hindlimb insertion. Non-display coloration of fe-

males with lateral parts of the body gray and dorsal parts

brown, with three to four darker crossbands between the

lateral stripes on both sides of the body. Lateral stripe

white, from the mental scale along the upper lips and the

tympanum to the hindlimbs. Head light blue.

Etymology. The specific epithet is a patronym formed

in the genitive singular honoring Dr. Stephan Goetz, Mu-

nich, Germany, in recognition of his longtime support of

Species conservation efforts in Cambodia.

Distribution. Ca/otes goetzi sp. n. is distributed in a

large area of Indochina and inhabits most of the previous

range of C. mystaceus. The new species is documented

by museum specimens and photo vouchers from Cam-

bodia, China (Yunnan province), Laos, Myanmar, and

Thailand.

Ecology. Calotes goetzi sp. n. is diurnal and semi-ar-

boreal to arboreal and can easily climb on tree trunks at

a height of 5-10 meters or above. The species is known

from dipterocarp lowland forests, cultural landscape and

secondary forest. At its type locality the species was ob-

served in more open habitats with a closed canopy, but

also within dense monsoon tropical forests and solitary

trees in rather open areas. Here it occurs sympatrical-

ly with Calotes versicolor. Hawkeswood & Sommung

(2018) report it from farmland with e.g., rice, coconut,

banana, and durian plantations. Chan-Ard et al. (2015)

report the species from a wide range of forest types in

Thailand, including tree-lined agricultural lands and

grasslands. Similar to other Calotes species, C. goetzi

sp. n. feeds on a variety of arthropods. Chan-Ard et al.

(2015) report from Thailand, that mature individuals are

territorial, chasing away possible intruders. Eggs are bur-

ied in soft soil and later guarded by the males. Amber

et al. (2017) recognized a possible ontogenetic shift in

defense strategies of C. goetzi sp. n. (C. mystaceus at the

time of their publication), with older individuals utilizing

color change, while juveniles do not.

Calotes mystaceus Dumeéeril & Bibron, 1837: 408

(Fig. 2, Clade D)

Dumeril, A. M. C. & G. Bibron (1837). Erpétologie Générale

ou Histoire Naturelle Complete des Reptiles. Vol. 4. Libr. En-

cyclopédique Roret, Paris, 570 pp.

Holotype. MNHN 2557 (juvenile male, Fig. 8A-B),

from “Indes orientales (...) pays de Birmans [=Myan-

mar].”

Original Diagnosis. “Deux petites épines places I’ une

apres l’autres de chaque céte de la nuque. Un pli oblique

en longueur devant |’épaule. Ecailles des cétes du tronc

grandes; celles du ventre moitié plus petites. Dessus de la

base de la queue subanguleux, garni d’écailles seulement

un peu plus grandes que celles qui les avoisinent. Fauve

en dessus; sous l’oeil une bande jaune qui se prolonge

jusque sur |’épaule.”

©ZFMK

158 Philipp Wagner et al.

Table 5. Morphological variation in the examined specimens of the Ca/otes mystaceus complex. Values are given are as mean +

standard deviation and minimum — maximum. Characters marked with an asterisk were significantly different between species in

the AN(C)OVA.

C. bachae C. geissleri sp. n. C. goetzi sp. n. C. mystaceus C. vindumbarbatus sp. n.

females males females males females males females males females males

(n=6) (n= 10) (n= 2) (n=4) (n = 33) (n= 38) (n= 2) (n=7) (n= 2) (n= 3)

SVL 80.5+6.35 88.6+ 14.06 103415.56 114547.72 101.334 114.16+ 87+416.97 8229+ 17.58 60+ 18.38 67+ 14

71-86 56-102 92-114 106-122 10.32 16.34 75-99 58-101 47-73 51-77

83-126 84-145

EyeEar 4.82+0.58 5.924+1.21 6844£1.36 8.1141.25 601+0.76 7.88+41.645.61+40.86 5.094+1.18 3.51+1.56 435+0.79

3.91-5.61 3.56-7.15 5.88-7.8 6.95-9.45 4.66-7.73 5.33-11.46 5-621 3.49-6.56 2414.61 3.444 89

HeadH 14.884 1.85 16.24+2.95 17.43+43.3 20.75+3.88 17.8142.13 2185+ 15.14+ 14644357 10.05+ 11.02 + 2.07

12.19-17.35 11.7-19.55 15.1-19.76 17.45-26.35 13.74-22.38 4.18 3.73 9.87-20.03 2.97 8.64-12.33

13.55— 12.5-17.78 7.95-12.15

31.79

HeadL 19.82 + 1.94 21.9743.5324.714465 2842.71 23.7542.15 2718+ 21.124 2044413 154449 16.28+43.47

16.92-21.5 14.71-25.72 21.42-28 24.89-31.07 20.14-2839 5.44 3.85 14.59-24.73 11.83-18.18 12.28-18.43

7.8-36 18.4-23.85

HeadW* = 15.01 + 1.04 16.89 + 3.22 19.664 2.62 24.87+43.86 17.9742.1623.844+5.2 15.82+ 15.7943.65 12.66+ 13.12+2.59

14.12-16.93 11.21-20.54 17.81-21.52 20.81-30 14.92-22.73 12.75- 1.95 11.19-21.36 3.85 10.19-15.12

37.13 14.44-17.2 9.94-15.39

Interorb* 8.96+0.73 9.92+1.67 14.1641.92 12.341.99 11.12+0.99 1248+ 10.39 + 89416 7.1642.22 7.74+1.43

7.85-9.73 6.7-11.69 12.8-15.52 9.92-1469 9.2-12.7 1.85 Lee? 6.62-10.87 5.59-8.73 6.08—8.57

8.75-16.65 9.13-11.64

JawW 13.92+ 0.93 15.07+2.5 17.77+1.79 20.98 + 1.53 16.54+1.44 20.01 + 1491+ 140942.73 11.844 11.89 42.47

12.82-15.56 10.74-18.36 16.5-19.03 19.32-22.44 14.2-19.65 4.06 1.53 10.44-17.6 3.34 9.13-13.9

12.03— = 13.83-16 9.47-14.2

37.39

NarEye 5.354085 615+1.04 7.3141.55 7.89+0.69 6.86+0.73 7.764 1.316.6242.05 5.994143 423+41.03 469+40.86

3.75-6.19 4.34-7.62 6.22-8.41 7.38-8.9 5.25-8.44 5.31-10.71 5.17-8.07 3.61-7.41 3.54.96 3.72-5.33

SnEye 9.19+41.26 10.08 + 1.8512.01+2.23 12.44+0.78 11.3941.13 12.974 1014+ 954422 6974182 769+1.5

7.58-10.56 6.32-11.96 10.43-13.59 11.71-13.5 8.74-14.22 2.19 2.67 6.44-11.72 5.69-8.26 5.96-8.63

8.64-17.54 8.26-12.03

SnW 5.04+0.62 5.53+0.75 6.334049 6924+0.45 656+41.52 7.7842.885.42+40.59 5374066 4454069 4644081

4.06-5.83 3.94656 5.98-668 6.49-7.48 5.11-14.39 5.1-18.43 5-5.84 448-63 3.96-4.93 3.7-5.15

4FingL 10.04 + 1.05 10.67 + 1.4712.35+0.64 13.69+0.46 12.1441.12 13.154 10.27+ 102+1.74 7.454134 8.09+1.41

8.56-10.93 7.44-12.04 11.89-12.8 13.41-14.37 9.99-14.14 1.64 1.89 7.63-12.08 6.5-8.4 6.46-8.91

9.82-16.03 8.93-11.6

4ToeL 13.38 + 0.93 15.03 + 1.95 16.22 40.76 17.68+0.71 15.12+1.57 1743+ 149142.5 140742.92 1046+ 11.8441.4

11.83-14.59 11.04-16.92 15.68-16.76 16.88-18.59 12.75—20.31 2.19 13.14-— 10.31-18.19 2.64 10.25-12.86

13.71- 16.68 8.6-12.33

21.89

CrusL 17.22 + 1.66 18.46 + 2.9220.91 + 3.43 23.41+0.94 205742.25 23.31 + 17.35+ 17.0843.81 12.59+ 13.89 + 2.96

14.58-18.55 12.65—21.57 18.49-23.34 22.39-24.22 17.11-27.25 2.91 3.44 11.83-21.83 4.19 10.48-15.81

17.55- 14.92— 9.62-15.55

28.98 19.78

ForefL 13.35+0.79 14.62+2.22 159+1.09 18.25+04 15.9541.68 17.71 + 13.364 13.8842.75 10.39+ 11.39 + 1.73

12.11-14.17 10.29-17.73 15.13-16.67 17.67-18.56 13.98-22.19 2.03 1.34 9.97-17.8 2.64 9.39-12.43

13.16-21.4 12.41-14.3 8.53-12.26

HindfL 23.75 + 1.94 25.69 + 3.1828.39+2.74 30.88 +0.81 27.3142.22 3082+ 2534+ 24224489 1789444 19.95+43.35

20.34-25.3 19.75-28.7 26.46-30.33 29.94-31.58 23.74-33.62 3.25 3.85 17.24-29.07 14.78-21 16.09-22.12

23.36— 22.62-

37.41 28.07

LoArmL = 14.45+1.51 15.4942.9317.39+2.81 20.0941.31 175+2.22 19.78+33 1542+ 13.9843.27 1014368 11.1242.17

11.95-15.75 9.6-18.64 15.4-19.38 18.48-21.57 13.64-24.14 13.64— 3.44 8.99-17.38 7.5-12.7 8.62-12.51

27.73 12.99-

17.85

SnForeL 27.83 43.43 30.34 11.23 3242.83 42456 35214454 40.174 31.5+6.36 29.29+804 214566 2261+4.1

23-32 2-39 30-34 37-50 29-45 7.61 27-36 20-41 17-25 1825.83

27-59

TailH 6.72£0.97 9.744207 104267 1456+1.31 9.794144 1441+ 9274352 9044295 4884192 691+42.69

5.12-8.06 6.02-12.29 8.11-11.89 13.44-16.43 7.46-12.69 3.26 6.78-11.76 5.18-13.07 3.52-6.23 3.81-8.61

6.6-21

Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK

New Calotes Species from Mainland SE Asia

Table 5. (continued).

159

C. bachae C. geissleri sp. n. C. goetzi sp. n. C. mystaceus C. vindumbarbatus sp. n.

females males females males females males females males females males

(n= 6) (n= 10) (n=2) (n= 4) (n = 33) (n = 38) (n= 2) (n=7) (n=2) (n=3)

TailL 178.33 + 1744+ 20642404 22267+ 193.77 + 219.96 + 1I58+NA 169.33+ 113+438.18 115+24.04

21.86 63.54 189-223 41.04 23.48 29.55 158-158 37.56 86-140 98-132

157-203 13.6-215 197-270 127-237 161-272 119-210

TailW 7.154143 9.044 1.85 11.2541.53 12434067 1049+ 12424218 8141.51 8044231 63843.84 662+1.75

5.27-915 5.3-12.38 10.17-12.33 11.75-13.35 1.14 5.56-16.39 7.03-9.17 4.98-11.03 3.67-9.1 4.61-7.82

8.31-12.9

TrunkL 3842.83 37.65+13.2 5447.07 5542.45 4852+ 52394628 4044.24 38574658 2947.07 30.67+45.13

34-41 2.5-47 49-59 52-57 5.75 39-65 37-43 29-47 24-34 25-35

38-62

UpArmL 13.15+ 1.37 14.76+2.2616.0540.11 18.3841.41 1561+ 17.56+1.97 1414052 14344309 1025+ 9.95+ 1.33

11.67-14.78 9.69-16.94 15.98-16.13 16.64—20.09 1.73 13.46-21.64 13.73-14.47 9.91-17.87 Bal] 8.44-10.96

12.59-20.53 8.72-11.79

UpLegL 17.924 1.85 19.23 +3.1321.12+2.67 23.5141.39 2012+ 23.1943.01 18.71+4.84 17.5143.9 13.143.14 13.82+41.7

14.85-20.14 12.86—21.83 19.23—23.01 22.31-25.17 1.81 18.47-29.1 15.29-22.14 11.96—-22.18 10.88-15.32 11.85—-14.85

17-25.2

CanthR 8.83+0.75 8.7+1.34 6+0 Face 8.55+0.79 889+0.8 PE283:) 6572207 S820771 5+0

8-10 6-11 6-6 6-10 7-10 8-11 5-9 5-10 5-6 5-5

Eyelid 13:17 40:75. 126+£0:°7 TWSh071 132115 1333 “It +0:92- 1152071, 12.292.0.95 12:35 +0-71 1733 Shs

12-14 12-14 11-12 12-14 1.05 11-15 11-12 11-14 12-13 10-12

11-16

HeadSLn 1542.19 15.8+41.55 1642.83 1554129 1618+ 16.29+42.22 16+0 16.714+2.43 15.54+2.12 1567+1.15

12-18 14-19 14-18 14-17 1.33 11-21 16-16 13-20 14-17 15-17

14-19

HeadSTr 15.6741.63 156+41.58 16+1.41 15541 17.3+1.79 16.86+1.46 145+0.71 16.29+41.11 1641.41 1633+40.58

14-18 13-18 15-17 14-16 13-21 13-20 14-15 15-18 15-17 16-17

Inflab 10.33+0.52 10.2+0.79 10.5+0.71 10+1.41 1064+ 1061411 95+0.71 10.14+0.38 10.5+0.71 10+0

10-11 9-11 10-11 9-12 0.93 8-13 9-10 10-11 10-11 10-10

9-13

SnS 8.3341.03 76+1.35 65+0.71 7+0 8.36+1.29 7894125 7540.71 6574098 65+£0.71 6.67+40.58

7-10 6-10 6-7 7-1 6-10 6-10 7-8 5-8 6-7 6-7

Suplab 1054055 10+0.82 105+0.71 1140.82 10.7+0.81 10424106 95+0.71 10+1.15 105+0.71 10+1

10-11 9-11 10-11 10-12 9-12 8-13 9-10 8-11 10-11 9-11

4FingLm 19.334 1.63 20.7140.95 1941.41 22.3342.08 2033+ 20424+1.29 224+NA 216+1.95 205+0.71 21.33+0.58

18-22 20-22 18-20 20-24 1.22 19-24 22-22 20-25 20-21 21-22

18-23

4ToeLm 23.83+1.17 24+1 25+0 263343.79 23.974 24.19+1.78 28+NA 26+1.22 25+0 26.67 + 0.58

22-25 23-25 25-25 22-29 1.98 22-30 28-28 25-28 25-25 26-27

21-28

VertS 4454122 37.4+43.63 495+0.71 4154451 4888+ 45164364 4347.07 41.864+3.67 4642.83 4433+43.79

43-46 32-42 49-50 35-45 4.01 37-52 38-48 38-49 44-48 40-47

43-60

MidbS 48.17+2.04 47642.76 524283 5545.29 51.82+ 51.68+43.32 4954495 47574454 5440 50.67 + 1.15

46-51 44-53 50-54 50-62 2.81 45-60 46-53 44-56 54-54 50-52

46-59

Revised Diagnosis. A small sized Ca/otes with a max-

imum known SVL of 101 mm in males and 99 mm in fe-

males. Distinguished from all other species of the group

by the combination of the following characters: 1) Head

and body slender, with long tail and extremities; 2) body

scales relatively large in respect to the body size, homo-

geneous, strongly keeled and arranged in regular rows;

3) upper dorsolateral scales pointing back- and upwards;

4) 44-56 scale rows around midbody; 5) no spines above

the tympanum; 6) Vertebral crest, composed of erected

Bonn zoological Bulletin 70 (1): 141-171

spiny scales, directed posteriorly, continuous from above

the tympanum to about the insertion of the hindlimbs,

but spines becoming abruptly shorter above the insertion

of the front limbs; 7) Vertebral scales, including crest

spines 38-49 in males and 38-48 in females; 8) oblique

skin fold in front of the fore limbs; 10) Head, chest, front

limbs, and anterior dorsal crest turquoise; 11) whitish lat-

eral stripe from the snout along the upper lip and the tym-

panum to behind the insertion of the fore limbs, behind

tympanum becoming brownish beige and fusing with

©ZFMK

Philipp Wagner et al.

ra . : os” Rad

25 e248

SIG IO OD. aia

. a

—_ SS 3

er Ars

Fig. 9. Calotes vindumbarbatus sp. n. A. Holotype (CAS 232388, adult male) from Myanmar, Kachin State, Gat Shang Yang

Village, general view from above. B. Holotype, lateral view. C. Living adult male (CAS 232819) from Myanmar, Kachin State,

Mohnyin Township, Hepu village [25.094528° N, 96.401833° E, alt. 243 m.].

Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK

New Calotes Species from Mainland SE Asia 161

beige dorsolateral blotches above front limb insertion;

12) four faint beige dorsolateral blotches.

Male coloration. According to the original descrip-

tion ventral and dorsal parts of the body, tail and limbs

brownish. Upper parts of the head olive, chest and throat

brownish to yellow. Orange-yellowish stripe from the

upper lip crossing the tympanum to the shoulders. More

recently collected males (Figure 8C) show the head and

the anterior of body to the shoulders blue, with a yellow-

ish stripe from the mental towards the upper lips and the

tympanum to above and in front of the insertion of the

front limbs, followed by indistinct orange blotches.

Variation. Body measurements and meristic charac-

ters for adult individuals are given in Table 4. Specimens

ranged in size between the smallest juvenile male with a

SVL of 58 mm (CAS 239398) to the largest male with a

SVL of 101 mm (BMNH 1891.11.26.18) and the largest

female measuring 99 mm (BMNH 1868.4.3.62). In gen-

eral, adult males and females have the same body pro-

portions. Dorsal coloration differs between sexes with

coloration characters generally being lighter in females.

Both sexes are able to change their color. Turquoise col-

oration is restricted to the throat, other parts of the head

and body brownish. White lateral stripe present, extend-

ing from the mental along the upper lips, becoming beige

posterior to tympanum, ending in the first lateral blotch

of the same coloration, followed by three blotches of the

same color but lighter.

Distribution. With the description of the new species

of the group, the distribution of Calotes mystaceus is re-

stricted to the Irrawaddy delta region of coastal southern

Myanmar. However, further research is needed to fully

clarify the species distributional boundaries.

Ecology. Calotes mystaceus is diurnal and arboreal.

The species inhabits forests and more open landscapes

with a closed canopy. Mating was observed in September

2014 ina public garden within Yangon (pers. comm. An-

dreas Hellmann). As in other species of the genus the diet

mainly consists of arthropods.

Calotes vindumbarbatus sp. n.

(Fig. 2, Clade C)

urn: lsid:zoobank. org: act: 202D3652-BF 04-464E-87A2-E1A4611C0CAI1

Holotype. CAS 232388 (adult male, Fig. 9A-B, Clade

C) from Myanmar, Kachin State, Myitkyina Township,

Gat Shang Yang village [25.373421° N, 97.37475° E],

collected by T.Z. Min on April 8" 2003.

Paratypes. CAS 232247 from Myanmar, Sagaing

Division, Homalin Township, North of Swekawngaw

[25.371694° N, 95.369028° E, 205 m.]; CAS 232387

from Myanmar, Kachin State: Myitkyina, Gat Shang

Yang village; CAS 239206 from Myanmar, Sagaing Di-

vision, Hkanti District, Hkanti Township, Linpha village

[25.803389° N, 95.528778° E, 155 m.]; CAS 232819

from Myanmar, Kachin State, Mohnyin Township, Hepu

Bonn zoological Bulletin 70 (1): 141-171

village [25.094528° N, 96.401833° E, 254 m.]; ZFMK

97990 (formerly CAS 232389) from Myanmar, Kachin

State: Myitkyina, Gat Shang Yang village.

Diagnosis. A small Calotes species of the complex,

males with a known maximum SVL of 77 mm, females

with a SVL of 73 mm. Tail length short, up to 140 mm. It

can be distinguished from the other species of the com-

plex by the combination of the following characters: 1)

head slender, not as distinct from the body as in other spe-

cies of the complex; 2) body scales small and homoge-

neous, smooth, and arranged in regular rows around the

body. 3) Upper dorsolateral scales pointing backwards;

4) body scales arranged in 50—54 rows around midbody;:

5) 40-47 vertebral spines and scales in males, 44-48 in

females; two short and well separated spines above the

tympanum; 6) low nuchal and dorsal crest continuous

to the midpoint between the limbs, composed of erect

compressed scales, which are larger on the nuchal and

smaller on the dorsal crest, gradually decreasing towards

the end of the crest; 7) oblique skinfold in front of the

fore limb; 8) extremities and tail long, but shorter than in

C. mystaceus; 9) bluish head and chest; 10) whitish stripe

from about the nostril, along the upper lip to about the

insertion of the fore limb, posteriorly the whitish stripe

is laterally intersected by a dark reticulate pattern across

vertebrae; 11) brownish blotches missing.

Description of the holotype. Small male (SVL

77 mm). Extremities relatively slender with the fourth

finger and toe longest, tail incomplete. Head slightly dis-

tinct from the neck, area posterior of jaw angle slightly

swollen. Tip of the snout blunt, rostral small, nostril in a

single scale, separated from the rostral and the first supra-

labial scale by two scales in a row. Canthus rostralis of

five scales, distinct and straight, canthus scales continu-

ous with supraciliary scales. Lateral sides of the head flat

with 9/9 supralabial scales separated from the orbit by

three rows of small scales. Five feebly ridged scales from

the orbit to above the tympanum. Tympanum distinct,

one spiny scale posteriorly above the tympanum. Mental

scale small, bordered by two postmental scales which are

separated from each other, only the first pair is in contact

with the infralabial scales; 10/10 infralabial scales. Later-

al scales on the chin and throat smooth, becoming keeled

towards the ventral part. A continuous vertebral crest of

elevated spiny scales from above the tympanum to about

mid-body, spine height gradually decreasing posterior of

the neck, in total 40 vertebral scales from the nape to

above the cloaca. Dorsal and lateral scales keeled, point-

ing back- and upwards, in 50 rows around midbody. Cau-

dal scales parallel keeled, directed backwards. Ventral

scales parallel keeled.

Male coloration. Brilliant coloration unknown

(Fig. 9C). Head most probably blue, with a whitish

stripe, less broad than in the other species of the C. mys-

taceus complex, from behind the nasal scale along the

upper lips and the tympanum to the shoulders. Followed

©ZFMK

162 Philipp Wagner et al.

Fig. 10. Overview of the distinct taxa of the Calotes mystaceus complex. A. Calotes mystaceus, male from Mingalardon Town-

ship, Hlawga Wildlife Park, Yangon Divison, Myanmar (CAS 213300). B. Calotes mystaceus, female from Yangon, Myanmar.

C. Calotes bachae, holotype from Cat Tien National Park, Vietnam (ZFMK 92028). D. Calotes bachae, female paratype from Cat

Tien National Park, Vietnam (ZFMK 88936, now IEBR A.2012.23). E. Calotes geissleri sp. n., male from Chin, Myanmar (CAS

220586). F. Calotes geissleri sp. n., female from Magwe, Myanmar (CAS 221593). G. Calotes goetzi sp. n., male from the type

locality Kbal Spean, Cambodia (ZFMK 92606). H. Calotes goetzi sp. n., female from the type locality Kbal Spean, Cambodia

(ZFMK 92607). I. Calotes vindumbarbatus sp. n., male from Kachin, Myanmar (CAS 232819). J. Calotes vindumbarbatus sp. n.,

male from Kachin, Myanmar (CAS 232819).

Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK

New Calotes Species from Mainland SE Asia 163

by one distinct and one or more indistinct lateral blotches

of the same color.

Variation. Body measurements and meristic charac-

ters for adult individuals are given in Table 4. Specimens

ranged in size from the smallest female with a SVL of

47 mm (CAS 232247) and the largest female with a SVL

of 73 mm (CAS 232387) to the largest male with a SVL

of 77 mm (CAS 232388). Adult males are slightly larger

than females, because of longer SVLs and tail lengths,

and have fewer vertebral scales including the crest scales.

However, proportionally males and females are equal.

Dorsal coloration of females unknown, but most prob-

ably similar to other taxa of the species group with fe-

males having lighter coloration characters (lateral stripe,

blotches) than males. Most probably, both sexes are able

to change their coloration.

Etymology. The specific epithet is a patronym honor-

ing Jens Vindum, retired staff of the California Academy

of Sciences, in respect of his outstanding contributions

to the herpetology of Myanmar and SE Asia. The patro-

nym of his family name was used, in recognition of his

impressive beard which has a direct link to “mystaceus”

[Greek for bearded], together with the Latin word “bar-

batus” for bearded.

Distribution. This new species is so far only known

from northern Myanmar.

Ecology. Calotes vindumbarbatus sp. n. is diurnal and

arboreal to semi-arboreal. It inhabits forests and more

open habitats with a dense canopy, but detailed habitat

preference is unknown. As in other Ca/otes species the

diet most likely consists predominantly of arthropods,

but details are not known.

Identification key

Key to the species using the characters of male color-

ation:

Key to the species using the characters of male coloration

1. Brownish dorsolateral blotches ..............0000.ccc. 2

2. Prominent dark brown dorsolateral blotches.............

tephra lis et, cers eR a Calotes goetzi sp. n.

— Brownish orange/tan/light brown dorsolateral

DIGIGHCS Be) cc teecn tls eee mee ke eer ere 5}

3. Whitish stripe from snout-tip to hindlimb insertion

continuous between orange to light brown blotches,

body robust with relatively short limbs...............0.....

ape AE AR ia Atenas ARIE Sty, cecil Calotes geissleri sp. n.

— Whitish stripe from snout-tip to front limb insertion,

posterior to tympanum becoming brownish beige

and fusing with faint brownish dorsolateral blotches,

body slender with relatively long limbs....................

Se TNA | J ters Sine E BS, Bonu he xt AO Calotes mystaceus

4. Yellowish stripe from below eye to posterior end of

|WePa\8 chad ss epee btn Hinsneconclls Rahat 5. Calotes bachae

Bonn zoological Bulletin 70 (1): 141-171

— Whitish stripe from tip of snout continuing to beyond

limb insertion ........... Calotes vindumbarbatus sp. n.

Genetically the clades (Fig. 2) refer to the follow-

ing taxa: Clade Al+A2=Calotes goetzi sp. n.; Clade

B=C. geissleri sp. n.; Clade C=C. vindumbarbatus

sp. n.; Clade D=C. mystaceus; Clade E=C. bachae.

The morphological variation within the type specimens

is given in Appendix IV. In general, PCAs demonstrated

that the species are not distinguishable by their morpho-

spaces. However, they are identifiable by their coloration

(Fig. 10) and by the combination of single characters

(Appendix. V, Table 5). In Calotes vindumbarbatus sp. n.

both males and females are distinctly shorter than the

other species of the complex but have comparably high

numbers of vertebral scales and scales around midbody.

The largest species with the highest scale counts are

C. geissleri sp. n. and C. goetzi sp. n., whereas C. bachae

usually has low scale counts.

DISCUSSION

Dumeril & Bibron (1837) gave as type locality for Calotes

mystaceus “Indes orientales (...) pays de Birmans,*

which corresponds to Myanmar today. The type speci-

men, a juvenile male (MNHN 2557), morphologically

resembles material from the Irrawaddy delta in southern

Myanmar. Specimens from this region also form a dis-

tinct genetic lineage (Clade D) referable to Calotes mys-

taceus. Since no specimens from other regions could be

assigned to C. mystaceus, the species’ distribution might

be restricted to the Irrawaddy delta in southern Myanmar.

More research in this area is required to corroborate this

assumption. In addition to C. mystaceus and C. bachae,

we revealed the C. mystaceus complex to harbor three

genetically distinct lineages which are further support-

ed by both morphological characters and coloration of

adult males. Several authors have demonstrated, that col-

oration is an important character to distinguish distinct

evolutionary lineages in agamid lizards, especially in

taxa with sexually dimorphic coloration but without body

ornamentations like horns (see, e.g., Stuart-Fox & Ord

2004; Chen et al. 2012; Quah et al. 2012; Wagner 2014).

Within the C. mystaceus complex, two lineages (Calotes

bachae, C. vindumbarbatus sp. n.) are clearly distinct in

coloration from all other lineages. The genetic distinct-

ness of Calotes bachae was also supported by Saijun-

tha et al. (2017). The remaining three lineages (Calotes

mystaceus, C. geissleri sp. n., C. goetzi sp. n.) are more

similar to each other in coloration, but distinct to each

other according to the phylogenetic results. However,

all unnamed lineages are distinct enough in coloration

from the recognized species C. bachae and C. mystaceus

to identify them as new species. The former is a distinct

genetic lineage within the C. mystaceus complex, which

©ZFMK

164 Philipp Wagner et al.

would render C. mystaceus polyphyletic if these new spe-

cles were not recognized.

Mean uncorrected p-distances for COI are overall rel-

atively similar between C. mystaceus and its close re-

lated species (C. mystaceus to C. goetzi sp. n.: 0.0603;

C. mystaceus to C. vindumbarbatus sp. n.: 0.0656) and

similar between C. goetzi sp. n. to C. vindumbarbatus

sp. n. (0.0647), but are higher between C. mystaceus to

C. bachae (0.1415). This is similar to the mean uncor-

rected p-distances for 12S, where C. mystaceus 1s closely

related to C. goetzi sp. n. (0.0291) and to C. vindumbar-

batus (0.0375), but less related to C. bachae (0.0548) and

C. geissleri sp. n. (0.0457). The p-distances are similar

between other closely related taxa within the C. mysta-

ceus Clade: C. goetzi sp. n. vs. C. vindumbarbatus sp n.

(0.0326) while C. bachae vs. C. geissleri sp. n. (0.0610)

has similar p-distances than C. bachae vs. C. goetzi sp. n.

(0.0603) and C. bachae vs. C. vindumbarbatus sp n.

(0.0615). These distances are similar to those shown by

Wagener et al. (2009) for recognized taxa at the species

level within the genus Agama. Therefore, these lineag-

es have been described as new species rather than syn-

onymizing the recently described Calotes bachae with

C. mystaceus and producing a taxonomy which underes-

timates diversity.

This taxonomic act restricts C. mystaceus to Myanmar,

while the most widespread taxon of the group, C. goetzi

sp. n., 1s distributed nearly across entire central Indochi-

na, excluding Vietnam. While our study also revealed

two lineages (Al & A2) within C. goetzi sp. n. (Fig.2),

their geographic distribution does not match the phylo-

geographic pattern previously proposed by Saijuntha

et al. (2017). Using the mitochondrial COI gene, Saijun-

tha et al. (2017) studied 238 C. goetzi sp. n. (C. mys-

taceus at that time) from 43 localities across Thailand

and Cambodia and found two major lineages. The first

of their lineages corresponds to northeast Thailand and

adjacent Cambodia and the second to central and north-

ern Thailand respectively. The authors suggested these

lineages to be separated by mountain ranges. Our study

incorporated three sequences from Saijuntha et al. (2017;

table 2), two from the first lineage (CNb1 [20], PTK1

[21]) corresponding to our lineage A2, and one (CMfl

[33]) that matched neither lineage of Saijuntha et al.

(2017) but corresponds to our lineage Al. Therefore, the

structuring observed by Saijuntha et al. (2017) reveals a

fine scale structure within our lineage A2 while the sole

sample representing our lineage Al only found in Myan-

mar and extreme northwestern Thailand, was suggested

to represent a distinct taxon.

The present study supports the Lower Mekong as a dis-

tributional boundary separating C. bachae from the other

taxa as suggested by Hartmann et al. (2013) and Geissler

et al. (2015). However, our study demonstrates the dis-

tributional range of C. bachae to be much larger than

assumed, as specimens from northern Vietnam can also

Bonn zoological Bulletin 70 (1): 141-171

be assigned to this species which was previously only

known from southern Vietnam and adjacent Cambodia.

Myanmar appears to represent a hotspot of species di-

versity, as all species, except for C. bachae, occur in this

country. However, further studies are necessary to clarify

distributional boundaries, potential contact zones, and

speciation processes that led to the diversity of Calotes

species in Myanmar.

The discovery of so far unrecognized species within the

C. mystaceus complex in Indochina is not surprising con-

sidering the geological history of the region and the large

river systems functioning as potential barriers to disper-

sal. As a result, several new species have been described

from the area in recent years (see, e.g., Zug et al. 2006;

Bohlen et al. 2016; Zemlemerova et al. 2016). Bain &

Hurley (2011) found the Red River in northern Indochina

to act as or coincide with an apparent dispersal barrier,

but they have not found any evidence that the Mekong

River limits dispersal of the regional herpetofauna. In

contrast, Geissler et al. (2015) have demonstrated that, at

least for amphibians, the Lower Mekong serves as or at

least coincides with a biogeographical barrier. Moreover,

the distribution pattern of C. bachae versus the other taxa

of the C. mystaceus complex shows that the Lower Me-

kong represents a barrier for these lizard species.

On the western side of the distributional range of the

C. mystaceus complex, the Irrawaddy (=Ayeyarwady

River) could have acted earlier as a geographic barrier

separating C. goetzi sp. n. and C. vindumbarbatus sp. n.

from C. geissleri sp. n. leading to speciation. Howev-

er, for specimens of C. goetzi sp. n. (Fig. 1, locality 47)

and C. vindumbarbatus sp. n. (Fig. 1, locality 64) both

collected from the vicinity of “Lake Indawgyi” we are

missing more detailed information but suggest that these

taxa are already co-occurring in this area, probably due

to anthropogenic diversion. According to the known

distributional range, dispersal of C. goetzi sp. n. could

have been restricted by the two large river systems of

the Mekong and Irrawaddy resulting in speciation with-

in this geographically isolated area. This is supported by

the extreme southern parts of the Salween River marking

the genetic split within C. goetzi sp. n. as an intraspecific

geographic barrier. However, Calotes mystaceus is rec-

ognized from “Pegu” (Fig. 1, locality 54), referring to

the town “Bago” or the “Bago-Division”, but not to the

borders of the former Pegu Empire, because the latter had

ceased to exist long before the specimen was collected.

This division encompasses large parts of the supposed

distribution area of C. mystaceus but in its northern and

eastern boundaries as indicated by sample site 54 (see

Fig. 1) might overlap with the distribution range of C.

goetzi sp. n. and therefore it is possible that both species

occur sympatrically in this area.

Acknowledgments. We are grateful to the following curators

and collection managers: Patrick Campbell (NHM), Lauren

©ZFMK

New Calotes Species from Mainland SE Asia 165

Scheinberg and Jens Vindum (CAS); Ivan Ineich (MNHN),

Ulrich Scheidt (NME), Frank Tillack and Mark-Oliver Rodel

(ZMB). All of them gave not only access to their collections

and material, but also provided help and amicable hospitality.

We are grateful to the Ministry of Environment of the Kingdom

of Cambodia, the staff of the Angkor Centre for Conservation

of Biodiversity (ACCB) for their help during field studies in

Cambodia and to the Allwetterzoo Munster (Germany) for the

financial support of the ACCB and the field studies. Natalia

Ananjeva and Thomas Ziegler helped us with valuable com-

ments on the manuscript and we are thankful to Aaron Bauer

who handled it as editor.

REFERENCES

Amber ED, Waengsothorn S, Strine CT (2017) Calotes mys-

taceus (Moustached Crested Lizard). Defensive behaviors.

Herpetological Review 48: 640

Bain RH, Hurley MM (2011) A biogeographic synthesis of the

amphibians and reptiles of Indochina. Bulletin of the Ameri-

can Museum of Natural History 360: 1-138.

https://doi.org/10.1206/360.1

Bohlen J, Petrtyl M, Chaloupkova P, Borin C (2016) Schistu-

ra kampucheensis, a new species of loach from Cambodia

(Teleostei: Nemacheilidae). Ichthyological Exploration of

Freshwaters 26 (4): 353-362

Borchsenius F (2009) FastGap 1.2. Department of Biosciences,

Aarhus University, Denmark. Online at http://www.aubot.dk/

FastGap_home.htm [last accessed 19 Apr. 2021]

Bourret R (1927) La Faune de I’Indochine, Vértébres. Société

de Géographie de Hanoi, Hanoi

Bourret R (2009) Les Lézards de Il’ Indochine. Edition Chimai-

ra, Frankfurt am Main

Chan-Ard T, Parr JWR, Nabhitabhata J (2015) A Field Guide to

the Reptiles of Thailand. Oxford University Press, New York

Chen IP, Stuart-Fox D, Hugall AF, Symonds MRE (2012) Sex-

ual selection and the evolution of complex color patterns in

dragon lizards. Evolution 66: 3605-3614.

https://doi.org/10.1111/).1558-5646.2012.01698.x

Das I (2015) A Field Guide to the Reptiles of South-east Asia,

Myanmar, Thailand, Laos, Cambodia, Vietnam, Peninsular

Malaysia, Singapore, Sumatra, Borneo, Java, Bali. Blooms-

bury, London, UK

Dray S, Dufour A (2007) The ade4 Package: Implementing the

duality diagram for ecologists. Journal of Statistical Software

22 (4): 1-20. https://doi.org/10.18637/jss.v022.104

Edgar RC (2004) MUSCLE: multiple sequence alignment with

high accuracy and high throughput. Nucleic Acids Research

32 (5): 1792-1797. https://do1.org/10.1093/nar/gkh340

Enge KM, Krysko KL (2004) A new exotic species in Flori-

da, the bloodsucker lizard, Calotes versicolor (Daudin 1802)

(Sauria: Agamidae). Florida Scientist 67: 226—230

Evan SH, Quah CTC, Mohd AM, Shahrul AMS (2012) Col-

or changes during courtship and mating of the green crested

lizard Bronchocela cristatella (Kuhl, 1820) (Squamata: Ag-

amidae) with a discussion of its behavioral and evolutionary

significance. Russian Journal of Herpetology 19: 303-306

Flower SS (1899) Notes on a second collection of reptiles made

in the Malay Peninsula and Siam, from November 1896 to

September 1898, with a list of the species recorded from

those countries. Proceedings of the Royal Zoological Society

of London 1899: 600-697

Geissler P, Hartmann T, Ihlow F, Rodder D, Poyarkov NA. Jr,

Nguyen TQ, Ziegler T, Bohme W (2015) The Lower Me-

Bonn zoological Bulletin 70 (1): 141-171

kong: an insurmountable barrier to amphibians in southern

Indochina? Biological Journal of the Linnean Society 144:

905-914. https://do1.org/10.1111/biy.12444

Grismer LL (2011) Lizards of Peninsular Malaysia, Singapore

and their Adjacent Archipelagos. Edition Chimaira, Frank-

furt am Main, Germany

Hallermann J (2000) A new species of Calotes from the Moluc-

cas (Indonesia), with notes on the biogeography of the genus

(Sauria: Agamidae). Bonner zoologische Beitrage 49 (1-4):

155-163

Hammer O, Harper DAT, Ryan PD (2001) PAST: Paleontolog-

ical statistics software package for education and data analy-

sis. Palaeontologia Electronica 4 (1): 1-9

Harikrishnan S, Vasudevan K, Choudhury BC (2010) A review

of herpetofaunal descriptions and studies from Andaman and

Nicobar Islands, with an updated checklist. Pp 387-398 in:

Ramakrishna, Raghunathan C., Sivaperuman C. (eds) Recent

trends in biodiversity of Andaman and Nicobar Islands. Zoo-

logical Survey of India, Kolkata

Hartmann T, Ihlow F, Edwards S, Sovath S, Handschuh M,

Bohme W (2013) A preliminary annotated checklist of the

Amphibians and Reptiles of the Kulen Promtep Wildlife Sanc-

tuary in Northern Cambodia. Asian Herpetological Research

4: 36-55. https://doi.org/10.3724/SP.J.1245.2013.00036

Hawkeswood TJ, Sommung A (2018) First record of the Blue

Forest Lizard, Calotes mystaceus Duméril & Bibron, 1837

(Reptilia: Agamidae) from Ubon Ratchathani Province,

Thailand, with a review of literature on the biology and dis-

tribution of the species in Thailand. Calodema 607: 1-8

Katoh K, Asimenos G, Toh H (2009) Multiple alignment of

DNA sequences with MAFFT. Methods in Molecular Biolo-

gy 537: 39-64. https://doi.org/10.1007/978-1-59745-251-9 3

Kocher TD, Thomas WK, Meyer A, Edwards SV, Paabo S,

Villablanca FX, Wilson AC (1989) Dynamics of mitchondri-

al DNA evolution in animals: Amplification and sequencing

with conserved primers. Proceedings of the National Acade-

my of Sciences, USA 86: 6196-6200.

https://doi.org/10.1073/pnas.86.16.6196

Lalremsanga HT, Khawlhring L, Lalrotluanga (2010) Three

additional lizard (Squamata: Sauria) records for Mizoram,

India. Journal of Threatened Taxa 2 (2): 718-720.

https://doi.org/10.11609/JoTT.02246.718-20

Manthey U (2008) Agamid Lizards of Southern Asia, Dracon-

inae 1, (Terralog 7a). Edition Chimaira, Frankfurt am Main

Morice A (1875) Coup d’oeil sur la faune de la Cochinchine

Frangaise. Association Lyonnaise des Amis des Sciences Na-

turelles 1875: 25-121

Nazarov R, Poyarkov NA, Orlov NL, Phung TM, Nguyen TT,

Hoang DM, Ziegler T (2012) Two new cryptic species of the

Cyrtodactylus irregularis complex (Squamata: Gekkonidae)

from southern Vietnam. Zootaxa 3302: 1-24.

https://doi.org/10.11646/zootaxa.3302.1.1

Pal S, Vijayakumar SP, Shanker K, Jayarajan A, Deepak V

(2018) A systematic revision of Calotes Cuvier, 1817 (Squa-

mata: Agamidae) from the Western Ghats adds two genera

and reveals two new species. Zootaxa 4482 (3): 401-450.

https://doi.org/10.11646/zootaxa.4482.3.1

Pham AV, Hoang VT, Nguyen TV, Ziegler T, Nguyen TQ (2018)

New records and an updated list of lizards from Son La Prov-

ince, Vietnam. Herpetology Notes 11: 209-216

Posada D, Crandall KA (1998) Modeltest: testing the model of

DNA substitution. Bioinformatics 14: 817-818.

https://doi.org/10.1093/bioinformatics/14.9.817

R Core Team (2020) R: A language and environment for sta-

tistical computing. R Foundation for Statistical Computing,

©ZFMK

166

Vienna, Austria. Online at https://www.R-project.org/ [last

accessed 19 Apr. 2021]

Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA

(2018) Posterior summarization in Bayesian phylogenetics

using Tracer 1.7. Systematic Biology 67: 901-904.

https://doi.org/10.1093/sysbio/syy032

Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling

A, Hohna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP

(2012) MrBayes 3.2: efficient Bayesian phylogenetic infer-

ence and model choice across a large model space. Systemat-

ic Biology 61: 539-542. https://doi.org/10.1093/sysbio/sys029

Sayuntha W, Khumkratok S, Wongpakam K, Thanonkeo S,

Senakhun C, Appamaraka S, Yodsiri S, Thongnetr W, Pilap

W, Kongbuntad W, Tawong W, Agatsuma T, Petney TN, Tan-

trawatpan C (2017) Genetic diversity and population struc-

ture of blue-crested lizard, Calotes mystaceus Duméril &

Bibron, 1837 (Squamata: Agamidae) in Thailand. Journal

of Genetics 96 (2): 377-382.

https://doi.org/10.1007/s12041-017-0767-x

Schliep KP (2011) phangorn: phylogenetic analysis in R. Bio-

informatics 27 (4): 592-593. https://do1.org/b2rv94

Schmitz A, Ineich I, Chirio L (2005) Molecular review of the

genus Panaspis sensu lato in Cameroon, with special refer-

ence to the status of the proposed subgenera. Zootaxa 863:

1-28. https://doi.org/10.11646/zootaxa.863.1.1

Simmons MP, Ochoterena H (2000) Gaps as characters in se-

quence-based phylogenetic analyses. Systematic Biology 49:

369-381. https://doi.org/10.1093/sysbio0/49.2.369

Smith, MA (1921) New or little-known reptiles and batra-

chians from southern Annam (Indo-China). Proceedings of

the Zoological Society of London 29: 423-440.

https://doi.org/10.1111/).1096-3642.1921.tb03271.x

APPENDIX I. List of specimens examined for morphological

analyses. See text for acronyms of museum collections (BMNH

numbers refer to the Natural History Museum, London, UK,

now NHM).

Calotes bachae (n = 17): BMNH 1927.5.20.30, BMNH

1927.5.20.31, BMNH 1927.5.20.32, MNHN 1927.44,

MNHN 1927.46, ZFMK 88935, ZFMK 88936 (now

TEBR A.2012.23), ZFMK 88937, ZFMK 92028, ZFMK

92029, ZFMK 94395, ZFMK 94396, ZFMK 94397,

ZMMU NAP 01509, ZMMU NAP 01512, ZMMU

NAP 02910, ZMMU NAP 02911. Calotes geissleri

sp. n. (7 = 6): BMNH 1856.1.11.98, CAS 210270, CAS

215539, CAS 243028, CAS 243050, CAS 243200 (now

ZFMK 97991). Calotes goetzi sp. n. (n = 71): BMNH

1868.4.3.61, BMNH 1868.4.3.63, BMNH 1891.11.26.29,

BMNH 1914.4.25.1, BMNH_ 1929.12.1.11, BMNH

1933.3.10.1, BMNH 1933.3.10.2, MNHN 1884.546,

MNHN 1884.547, MNHN 1884.548, MNHN 1893.335,

MNHN 1893.336, NME RO0581/09, NME R0584/09,

NME_ R0585/09, NME R0686/11, NME R0751/12,

NME RO0783/13, NME RO784/13, NME RO785/13, NME

Bonn zoological Bulletin 70 (1): 141-171

Philipp Wagner et al.

Somaweera R., Somaweera N. (2009) Lizards of Sri Lanka: A

Colour Guide with Field Keys. Edition Chimaira, Frankfurt

am Main

Stuart-Fox DM, Ord TJ (2004) Sexual selection, natural selec-

tion and the evolution of dimorphic coloration and ornamen-

tation in agamid lizards. Proceedings of the Royal Society of

London B 271: 2249-2255. https://doi.org/dfwvnd

Tirant P (1885) Notes sur les Reptiles et les Batraciens de la Co-

chinchine et du Cambodge. Excursions et Reconnaissance,

Saigon

Uetz P, Freed P, HoSek J (2020) The Reptile Database. Online at

http://www. reptile-database.org [last accessed 29 Nov. 2020]

Wagner P, Bare} MF, Schmitz A (2009) Studies on African Ag-

ama VII. A new species of the Agama agama-group (Linnae-

us, 1758) (Sauria: Agamidae) from Cameroon & Gabon, with

comments on Agama mehelyi Tornier, 1902. Bonner zoolo-

gische Beitrage 56 (4): 285-297

Wagner P (2014) A new cryptic species of the Agama lionotus

complex from south of the Ngong Hills in Kenya. Salaman-

dra 50 (4): 187-200

Zemlemerova ED, Bannikova AA, Lebedev VS, Rozhnov VV,

Abramov AV (2016) Secrets of the underground Vietnam: An

underestimated species diversity of Asian moles (Lipotyphla:

Talpidae: Euroscaptor). Proceedings of the Zoological Insti-

tute RAS 320 (2): 193-220. https://doi.org/f9nr

Zug GR, Brown HHK, Schulte II JA, Vindum JV (2006) Sys-

tematics of the garden lizards, Calotes versicolor group

(Reptilia, Squamata, Agamidae), in Myanmar: Central dry

zone populations. Proceedings of the California Academy of

Sciences 57 (2): 35-68

RO786/13, NME RO0787/13, NME R0790/14,

16640, ZFMK 16641, ZFMK 40561, ZFMK

ZFMK 43930, ZFMK 43931, ZFMK 43932,

44893, ZFMK 44894, ZFMK 45490, ZFMK

ZFMK 45492, ZFMK 45493, ZFMK 45494,

45495, ZFMK 45496, ZFMK 45497, ZFMK

ZFMK 45499, ZFMK 45500, ZFMK 45501,

45502, ZFMK 45553, ZFMK 45554, ZFMK

ZFMK 47081, ZFMK 49164, ZFMK 49202,

49219, ZFMK 49220, ZFMK 49221, ZFMK

ZFMK 49243, ZFMK 49244, ZFMK 49245,

49246, ZFMK 55610, ZFMK 55611, ZFMK 55612,

ZFMK 84867, ZFMK 88341, ZFMK 92606, ZFMK

92607, ZMB 11603A, ZMB 30186, ZMB 30188A, ZMB

30197, ZMB 6034. Calotes mystaceus (n = 9): BMNH

1868.4.3.60, BMNH 1868.4.3.62, BMNH 1891.11.26.18,

CAS 206548, CAS 213300, CAS 239398, CAS 240287,

CAS 240296, MNHN 2557. Calotes vindumbarbatus

sp. n. (1 = 6): CAS 232247, CAS 232387, CAS 232388,

CAS 232389 (now ZFMK 97990), CAS 232819, CAS

239206.

ZFMK

43906,

ZFMK

45491,

ZFMK

45498,

ZFMK

47080,

ZFMK

49242,

ZFMK

©ZFMK

New Calotes Species from Mainland SE Asia 167

APPENDIX IT. Results of the analyses of (co-)variance.

ANOVA (Species*Sex) ANCOVA (Species*Sex+SVL)

Df Sum Sq Mean Sq __ F value Pr(F) Df Sum Sq Mean Sq F value Pr(>F)

EyeEKar 4 9.8948 2.4737 1.5780 0.1863 4 1.8177 0.4544 1.8669 0.1225

HeadH 4 52.8725 13.2181 1.2188 0.3079 4 13.4904 3.3726 0.9480 0.4398

HeadL 4 30.9982 7.7496 0.4756 0.7536 4 0.7392 0.1848 0.0398 0.9969

HeadW 4 110.3601 27.5900 1.8957 0.1173 4 40.9293 10.2323 2.6634 0.0371

Interorb 4 22.8385 5.7096 2.4167 0.0538 4 13.5416 3.3854 5.1825 0.0008

Jaww 4 47.4540 11.8635 1.4079 0.2371 4 13.8597 3.4649 1.1385 0.3431

NarEye 4 3.5544 0.8886 0.7383 0.5681 4 0.4279 0.1070 0.3667 0.8318

SnEye 4 9.0886 2.2721 0.7153 0.5835 4 1.2831 0.3208 0.6036 0.6610

Snw 4 4.5220 1.1305 0.2793 0.8907 4 4.0574 1.0144 0.2483 0.9101

4FingL 4 2.3127 0.5782 0.2894 0.8842 4 0.5621 0.1405 0.3025 0.8757

4ToeL 4 15.4688 3.8672 1.0240 0.3989 4 2.8556 0.7139 0.4292 0.7872

CrusL 4 19.1150 4.7787 0.6483 0.6294 4 1.5220 0.3805 0.3354 0.8535

ForefL 4 3.7860 0.9465 0.2603 0.9027 4 1.4872 0.3718 0.3248 0.8607

HindfL 4 36.3682 9.0920 1.0157 0.4032 4 3.7463 0.9366 0.4704 0.7574

LoArmL 4 24.4185 6.1046 0.7766 0.5431 4 1.6210 0.4052 0.2291 0.9214

SnForeL 4 138.3759 34.5940 0.7310 0.5730 4 42.8073 10.7018 0.7989 0.5288

TailH 4 43.2840 10.8210 1.7550 0.1442 4 9.9255 2.4814 1.7805 0.1390

TailL 4 2929.8532 732.4633 0.6505 0.6283 4 1616.6444 404.1611 0.7285 0.5753

TailW 4 8.8285 2.2071 0.6745 0.6113 4 2.6875 0.6719 0.5411 0.7059

TrunkL 4 91.0978 22.7744 0.4831 0.7481 4 30.3159 7.5790 0.5770 0.6800

UpArmL 4 9.7110 2.4277 0.6430 0.6331 4 3.7578 0.9394 1.0160 0.4031

UpLegL 4 35.9759 8.9940 1.2683 0.2878 4 6.3605 1.5901 0.8706 0.4846

CanthR 4 2.8504 0.7126 0.6347 0.6390 4 1.9353 0.4838 0.4558 0.7679

Eyelid 4 6.9810 1.7452 1.9294 0.1116 4 43572 1.8393 2.0673 0.0911

HeadSLn 4 2.5589 0.6397 0.1826 0.9470 4 2.7415 0.6854 0.1938 0.9411

HeadSTr 4 7.6648 1.9162 0.7963 0.5305 4 6.6723 1.6681 0.6886 0.6017

Inflab 4 1.2920 0.3230 0.3560 0.8393 4 1.2709 0.3177 0.3466 0.8458

SnS 4 2.3226 0.5806 0.3999 0.8083 4 PAPI 0.5568 0.3804 0.8221

Suplab 4 1.9375 0.4844 0.5645 0.6890 4 1.7392 0.4348 0.5079 0.7300

4FingLm 4 15.6652 3.9163 2.2782 0.0677 4 15.5661 3.8915 2.2371 0.0721

4ToeLm 4 8.0602 2.0151 0.6241 0.6466 4 8.5495 2.1374 0.6771 0.6098

VertS 4 77.0790 19.2698 1.3790 0.2470 4 74.8883 18.7221 1.3456 0.2588

MidbS 4 30.3863 7.5966 0.7433 0.5648 4 34.1770 8.5443 0.8404 0.5029

Bonn zoological Bulletin 70 (1): 141-171 ©ZFMK

Philipp Wagner et al.

168

APPENDIX III. PCA loadings showing the correlations of the variables with each principal component.

EyeEar

HeadH

HeadL

Head W

Interorb

JawW

NarEye

SnEye

SnW

X4FingL

X4ToeL

CrusL

ForefL

HindfL

LoArmL

SnForeL

TailH

TailW

TrunkL

UpArmL

UpLegL

CanthR

Eyelid

HeadSLn

HeadSTr

Inflab

SnS

Suplab

VertS

MidbS

PCl

-0.75525

-0.67424

-0.86595

-0.60811

-0.59644

-0.70201

-0.55888

-0.70519

-0.35463

-0.38443

-0.69787

-0.85104

-0.66583

-0.85521

-0.82898

-0.17538

-0.64347

-0.60269

-0.30761

-0.43331

-0.70564

-0.23477

0.11221

0.10498

0.16085

-0.02711

0.07648

-0.33310

0.06534

-0.10086

PC2

0.16989

0.02346

0.05108

0.34174

0.11476

0.21499

0.10090

-0.06856

-0.21067

-0.31922

0.04033

-0.18965

-0.27931

-0.08047

-0.18214

-0.26259

0.18157

-0.16016

0.07998

-0.06371

0.15285

-0.39123

-0.43959

-0.55602

-0.79420

-0.70759

-0.48978

-0.42133

-0.62521

-0.28365

PC3

-0.22269

0.15873

-0.05904

-0.08501

-0.47778

-0.24915

-0.02613

-0.22104

-0.47750

0.19819

0.36659

0.16945

0.27745

0.29367

0.21096

0.10331

-0.09635

-0.55652

-0.55369

-0.07085

0.46822

0.51004

0.16014

-0.26430

-0.10576

-0.11644

-0.08728

0.00313

-0.06376

-0.28425

Females

PC4 PCS5

-0.01294 0.24323

-0.04942 -0.27829

-0.24969 0.21947

0.32551 0.48056

-0.01772 0.09550

0.23554 0.45903

-0.28023 -0.42155

-0.43262 -0.12481

-0.22143 -0.06374

-0.05155 -0.19096

0.28480 -0.24105

0.07265 -0.12514

0.37895 -0.22584

-0.00698 -0.26403

0.09452 -0.10009

-0.19321 0.63065

-0.16504 -0.03693

-0.17410 -0.04155

-0.06031 -0.19381

0.40439 0.15450

-0.12682 0.21040

-0.40430 0.38986

-0.15034 0.29433

0.18548 0.09349

0.03352 -0.03726

-0.01106 0.22691

-0.65324 -0.16930

0.24329 0.05218

0.38778 -0.06164

0.56212 -0.16698

PC6

0.00700

-0.22727

0.03273

-0.10907

0.27685

0.00286

0.25182

0.00138

0.13042

0.36051

0.21365

-0.10511

-0.19237

0.09581

-0.07696

0.35282

-0.10019

-0.17064

-0.36406

0.02603

0.16618

-0.18081

-0.58140

0.43481

0.14819

-0.00926

-0.09119

-0.32409

0.10847

-0.13425

PC7

-0.04300

0.08993

-0.01811

-0.07130

0.11750

-0.01674

-0.33016

-0.09491

-0.23115

0.01694

0.15823

0.11699

-0.02880

0.11081

0.16949

-0.17874

-0.21686

0.03768

0.40744

0.48463

-0.03706

-0.03345

0.20952

0.39520

0.18963

-0.06686

0.07348

-0.45256

-0.28200

-0.44121

PC8

0.11053

0.19408

0.09272

0.14145

-0.09362

-0.02673

0.26470

0.09595

-0.09282

-0.55210

0.07841

-0.03772

-0.06696

-0.02399

-0.02846

-0.32135

0.09744

-0.02758

-0.34864

-0.01337

0.02772

0.13267

0.01400

0.26326

0.16826

0.32044

-0.01296

-0.37246

-0.12152

0.24713

PC1

-0.49448

-0.54832

-0.77265

-0.48326

-0.53248

-0.54572

-0.63474

-0.70986

-0.25000

-0.52555

-0.50561

-0.80714

-0.72394

-0.74190

-0.82194

-0.32402

-0.71715

-0.69643

-0.35213

-0.59939

-0.64429

-0.14721

0.03388

0.34793

0.20249

0.13877

0.06954

0.38437

0.34780

0.14780

PC2

-0.02133

-0.40647

-0.07336

-0.13349

-0.15727

-0.29901

0.17902

0.02333

-0.25742

0.10494

0.24765

-0.18595

0.07031

-0.06006

-0.08915

0.51756

-0.20001

-0.28763

0.11127

-0.01912

0.00180

-0.37221

-0.40134

-0.22163

-0.54805

-0.57709

-0.67905

-0.44679

-0.57617

-0.49523

PC3

-0.44625

-0.24104

-0.15015

-0.62878

-0.34010

-0.45650

-0.17293

-0.03465

-0.19629

0.57245

0.49917

0.30386

0.27142

0.51220

0.15888

-0.08928

-0.15575

-0.09897

0.09077

0.31731

0.17486

0.18127

0.14306

0.53327

0.26218

0.12324

0.19148

0.02271

0.04991

-0.19489

Males

PC4 PC5

0.06837 0.03929

0.19018 0.23031

0.20683 0.16099

-0.01647 -0.22370

0.21315 0.30224

-0.07679 -0.14994

0.13905 0.08910

0.14698 0.33054

-0.12475 -0.33731

-0.09094 -0.13827

0.15975 -0.39533

-0.18112 -0.11203

0.03083 -0.17620

-0.10618 -0.19790

-0.11019 0.03200

-0.25167 0.23200

-0.18595 -0.07670

-0.28503 = -0.11902

-0.72006 0.21148

-0.03996 0.15214

0.04809 0.27442

0.70641 -0.14171

0.45892 -0.24158

0.00820 0.21020

-0.08652 0.39470

0.01809 0.09956

0.05743 0.30968

-0.36597 =: 0.12892

-0.33670 -0.23357

-0.28996 -0.35693

PC6

0.06267

0.17456

-0.15454

0.10301

-0.01767

0.01496

-0.22567

-0.28926

0.39429

-0.22248

0.23919

-0.15885

0.34152

-0.03208

-0.24464

0.49388

-0.00060

0.09819

0.17127

-0.08263

0.09823

0.22109

-0.00807

0.18253

-0.07070

0.31839

0.09565

0.19758

-0.30235

-0.21622

PC7

0.31731

-0.28018

0.19897

0.05942

-0.30404

-0.12911

-0.08849

-0.21731

-0.23871

-0.01199

-0.18324

0.04568

0.00254

-0.08698

-0.02479

0.04105

0.05789

0.15706

-0.08173

0.27742

0.30656

-0.00282

0.43340

-0.16753

-0.10593

-0.18659

0.05075

0.48938

-0.17845

-0.01141

PC8

0.13505

-0.06276

0.15761

0.01572

-0.06344

0.16814

0.35082

-0.13810

0.04083

0.16279

-0.03572

-0.07284

0.07634

-0.04896

-0.04130

0.08881

-0.17193

-0.31878

-0.20439

0.08373

0.31426

-0.10976

-0.19650

0.38285

-0.11181

0.23510

-0.09419

0.03290

-0.05054

0.48185

©ZFMK

Bonn zoological Bulletin 70 (1): 141-171

New Calotes Species from Mainland SE Asia

169

APPENDIX IV. Morphological variation in the type specimens of the Calotes mystaceus complex. Values given as mean +

standard deviation and minimum — maximum.

C. geissleri sp. n.

C. goetzi sp. n.

C. mystaceus

C. vindumbarbatus sp. n.

SVL

EyeEar

HeadH

HeadL

Head W

Interorb

JawW

NarEye

SnEye

SnW

4FingL

4ToeL

CrusL

ForefL

HindfL

LoArmL

SnForeL

TailH

TailL

TailW

TrunkL

UpArmL

UpLegL

CanthR

Eyelid

HeadSLn

HeadSTr

Inflab

C. bachae

holotype paratypes

(n=5)

90 85+8.22

74-97

5.30 5.19+41.2

3.91-7.15

14.88 14.444 2.24

12.19-18.22

21.80 20.84 + 3.26

16.92—25.72

17.04 15,57 £257

13.71—20.02

10.09 9.31 +4 1.45

7.85—11.69

15.00 14.40 + 2.06

12.62-17.94

6.16 5.544 1.21

3.75-6.97

10.44 9.54 + 1.46

7.58-11.54

5.45 5.37+0.92

4.06-6.56

11.79 10.28 + 0.84

8.88-10.94

15.08 13.47 + 1.09

11.83-14.59

1921 17.38 + 2.07

14.58-19.83

13.74 13.59 + 1.35

12.11-15.59

26.14 24.344 2.45

20.34—26.97

15.59 14.954+2.51

11.95-18.64

30 30.40 + 4.67

25.00-37.00

8.71 7.49 42.02

5.12-10.35

199 188.25 + 21.53

157-203

8.44 7.41 + 1.68

5.27-9.57

42 37.60 + 2.97

34-41

14.73 13.66 + 1.62

11.77-15.78

20.24 18.51 +2.78

14.85-21.83

9 8.8 + 0.84

8-10

14 13.2+0.45

13-14

17 IS a5145

14-18

16 16.4+ 1.34

15-18

11 10.2+ 0.45

10-11

holotype

110

6.95

17.45

24.89

20.81

9.92

19.32

7.38

11.71

6.49

13.56

18.59

22.83

17.67

31.58

19.73

Bonn zoological Bulletin 70 (1): 141-171

paratypes

(n= 4)

108 + 12.11

92-120

7.57 + 1.49

5.88-9.45

18.51 42.29

15.10-19.85

26.36 + 3.44

21.42-29.22

22.00 + 3.15

17.81—25.11

13.22 + 1.60

11.8-15.52

19.50 + 2.46

16.50—22.44

7.47+0.92

6.22-8 41

12.14+1.31

10.43—13.59

6.59 + 0.46

5.98-7.09

13.12+ 1.04

11.89-14.37

16.70 + 0.75

15.68-17.47

22:11. +253

18.49-24.22

17.144 1.57

15.13-18.44

29,70 22,22

26.46—31.53

18.46 + 2.22

15.40—20.60

35.50 + 4.65

30.00-41.00

12.09 + 2.87

8.11-14.42

203 + 17.78

189-223

11.78 + 1.08

10.17-12.35

54.25 + 4.57

49-59

17.64 + 1.97

15.98—20.09

22.43 + 2.46

19:23-25417

6+0

6-6

12.25 + 1.26

11-14

16+ 1.83

14-18

1640.82

15-17

10.5 + 1.29

9-12

holotype

118

8.20

26.81

29.60

25.35

12.73

20.02

LIS

13.76

£23

13.30

16.62

24.48

17.43

30.61

20.82

paratypes

(n= 2)

97.5+9.19

91-104

5.55 + 0.80

4.99-6.12

17.55 + 1.07

16.80-18.31

24.27 + 1.32

23.33—25.20

18.34 + 3.38

15.95—20.73

10.98 + 1.00

10.27—11.69

17.34 + 1.63

16.19-18.50

6.51 + 0.39

6.23-6.78

11.40+ 0.51

11.04—-11.76

6.17 + 0.49

5.82-6.52

12.12 +0.30

11.90-12.33

14.58 + 0.40

14.30-14.86

20.88 + 1.33

19.94—21.82

15.00 + 0.28

14.80-15.19

27.39 + 0.33

27.16—27.62

17.75 + 0.88

17.12—18.37

32.00 + 1.41

31-33

9.48 + 1.67

8.30—10.66

214+0

214-214

9.82 + 0.03

9.80-9.84

47.00 + 1.41

46-48

15.77 + 1.48

14.72-16.81

19.91+0.11

19.84-19.99

8.5+0.71

8-9

rae Ot

12-13

16+0

16-16

17.5+0.71

17-18

10.5+0.71

10-11

holotype

4.68

13.56

19.72

14.83

8.20

13.73

5.88

9.90

4.98

10.40

14.07

16.42

13.59

24.22

13.41

9.33

164

8.25

16.33

16.52

holotype

4.89

12.33

18.43

14.05

8.56

12.63

5.33

8.63

aA bs

paratypes

(n=4)

61 + 13.95

47-73

3.79 1.09

2.41-4.71

10.21 42.23

7.95-12.15

15.11 +3.53

11.83-18.18

12.66 + 3.00

9.94-15.39

7.24 + 1.64

5.59-8.73

11.68 + 2.75

9.13-14.20

430+0.81

3.50—5.03

710+ 1.48

5.69-8.48

4.41 +0.68

3.70—5.06

7.57+41.27

6.46-8.91

11.01 + 1.96

8.60—12.86

12.75 +3.14

9.62-15.55

10.63 + 1.96

8.53-12.35

18.5+43.61

14.78—22.12

10.33 + 2.66

7.50-12.70

21.464 4.6

17.00—25.83

5.47 42.25

3.52-8.31

114 + 26.08

86-140

6.3+2.58

3.67-9.1

28.75 + 4.99

24-34

9.85 + 1.57

8.44-11.79

13.22+2.19

10.88—15.32

5.25+0.5

5-6

11.75 + 1.26

10-13

15.75+1.5

14-17

16.25 + 0.96

15-17

10.25+0.5

10-11

©ZFMK

170

APPENDIX IV. (continued).

SnS

Suplab

4FingLm

4ToeLm

VertS

MidbS

C. bachae

holotype paratypes

(n=5)

9 8.6+0.89

8-10

10 10.2+0.45

10-11

21 20+ 1.41

18—22

23 23.84 1.3

22-25

42 42+4.18

35—46

48 45.8+ 1.48

44-48

Philipp Wagner et al.

C. geissleri sp. n.

holotype

Bonn zoological Bulletin 70 (1): 141-171

paratypes

(n=4)

6.75 +0.5

6-7

1140.82

10-12

20.25 + 2.06

18—23

25.2542.87

22-29

46.5 +3.7

42-50

55.545

50-62

C. goetzi sp. n.

holotype

paratypes

(n=2)

75+0.71

7-8

10+0

10-10

20+ 1.41

19-21

220-b OF]

22-23

47.5+4.95

44-5]

52+ 4.24

49-55

C. mystaceus

holotype

C. vindumbarbatus sp. n.

holotype

paratypes

(n=4)

6.5+0.58

6-7

10.5+0.58

10-11

21+0.82

20-22

26+ 1.15

25-27

46.25+ 1.71

44-48

52.5+1.91

50-54

©ZFMK

New Calotes Species from Mainland SE Asia

171

APPENDIX V. Boxplots of selected characters of examined specimens of the different described species. A. Males. B. Females.

120

100

SVL

HeadW

20 25 30 35

120

100

SVL

18 20 22

HeadW

‘ Males

TailL.

C. bachae

C. geissleri sp.n.

T T

C. goetzi sp.n. Ic. vindumbarbatus sp.n.

C. mystaceus

VertS.

C. geissleri sp.n.

: Females

C. mystaceus

TailL.

C. bachae

C. geissleri sp.n.

T T

C. goetzisp.n. |C. vindumbarbatus sp.n.

C. mystaceus

C. bachae

C. geissleri sp.n.

T T

C. mystaceus

Bonn zoological Bulletin 70 (1): 141-171

200

150

100

tees |b

HeadL

—_

C. bachae

C. geissleri sp.n.

T T

C. goetzisp.n. |. vindumbarbatus sp.n.

C. mystaceus

C. bachae

C. geissleri sp.n.

T T

C. goetzi sp.n. C. vindumbarbatus sp.n.

C. mystaceus

C. geissleri sp.n.

C. mystaceus

——

C. bachae

C. geissleri sp.n.

T T

C. mystaceus

200

2 o | as

—— — 8 8

to)

T T T T T T

C. geissleri sp.n.

C. mystaceus

MidbS

wotaae

C. geissleri sp.n.

C. mystaceus

C. bachae

(os goetzi sp.n. |C vindumbarbatus sp.n.

C. geissleri sp.n.

C. mystaceus

C. bachae

C. geissleri sp.n.

C. goetzi sp.n. | C. vindumbarbatus sp.n.

C. mystaceus

©ZFMK

BHL

Blank Page Digitally Inserted

Bonn zoological Bulletin 70 (1): 173-199

2021 - Handfield L. & Handfield D.

https://do1.org/10.20363/BZB-2021.70.1.173

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:|sid:zoobank.org:pub: D0O3E2C9D-73A8-4A A0-89F8-EE2C3E241451

A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863

(Lepidoptera: Crambidae: Spilomelinae: Herpetogrammatini),

with descriptions of three new species

Louis Handfield’* & Daniel Handfield?

'845 de Fontainebleau, Mont-Saint-Hilaire, Québec, Canada, J3H 4J2

?94 Chemin Bonnaly, Orford, Québec, Canada, J1X 6S3

“Corresponding author: Email: lscal@netrover.com

'urn:|lsid:zoobank.org:author:7D9385 1 B-DASE-4E50-B5 12-51 A98AD2549C

2 urn:|sid:zoobank.org:author: 7 D060A75-CD6A-4FB7-9DE2-5DS57FCFF5D1C

Abstract. The genus Herpetogramma Lederer in Canada is revised to include ten species of which three are new: H. aqui-

lonalis sp. n., H. fraxinalis sp. n., and H. nymphalis sp. n. Keys to the Canadian species of Herpetogramma are includ-

ed as well as descriptions, distribution, biology and illustrations of adults and genitalia. Herpetogramma abdominalis

(Zell.,1872) syn. n. and H. fissalis (Grt., 1881) syn. n. are synonymized with H. thestealis (Walker, 1859) here.

Key words. Herpetogramma, abdominalis, aeglealis, aquilonalis, bipunctalis, fluctuosalis, fraxinalis, nvmphalis, pertex-

talis, phaeopteralis, sphingealis, theseusalis, thestealis, Canada, distribution, biology, hostplants.

INTRODUCTION

In February 1967, when my mother (LH) gave me $20

to buy a used copy of Holland’s Moth Book (1903), I

acquired a very precious tool (at the time, the only rare

and costly book available for amateurs) to identify the

moths of my then small collection begun at my parents’

home in Mont-Saint-Hilaire (Québec). But my identifica-

tion problems were not all solved as, amongst others, one

of my specimens of a small moth looking like the moth

illustrated on plate 47: 54 of Holland’s book as Pyrausta

pertextalis (Lederer, 1863) was similar, but not the same

as my specimen. I continued to search for a better answer,

but without finding any. The problem remained unsolved

and was forgotten until 2004, when a lot of Herpetogram-

ma Lederer, 1863 of a very dark form (now known as

H. sphingealis Handfield & Handfield, 2011) were col-

lected at Rougemont, Québec. This reminded me of my

original problem and led me to return to that old Her-

petogramma specimen. As this specimen could still not

be identified, we decided to collect more specimens of

this genus and attempt to provide some resolution to this

problem.

After many years of collecting hundreds of Herpeto-

gramma specimens, studying and searching for more in-

formation, we found out that this difficult group could

only be resolved with the help of the DNA barcoding and

genitalia dissection, the latter being carried by Dr J. Don-

ald Lafontaine. We hope that this revision of the species

Received: 28.01.2021

Accepted: 05.05.2021

known to occur in Canada will help future studies of this

complex genus.

Herpetogramma sphingealis having been described in

2011, we then decided to tackle the rest of the Canadian

species of Herpetogramma. It was not an easy task, but as

we collected hundreds of specimens in Québec between

2004 and 2019, and we were able to study photographs of

all types specimens associated with the existing names,

SO We can now come to a conclusion.

The first lepidopterist who tried to resolve that group

was Forbes (1923) in his treatment of the Lepidoptera

of New York and neighboring States, part 1 (under the

broader genus Pyrausta). In his North American list of

species Munroe (1983) attempted to resolve the taxono-

my of Herpetogramma of the region in providing many

new combinations. Solis (2010) published an illustrated

list of the North American species of Herpetogramma,

but it did not give the information needed to resolve is-

sues with the identification of some of the species occur-

ring in Canada or the United States. After our description

of Herpetogramma sphingealis in 2011, we continued to

collect and study the species occurring in Canada. This

was aided by sending many of our Canadian Herpeto-

gramma to the Canadian Centre for DNA Barcoding Data

(“BOLD”) for DNA barcoding and this gave us a clearer

view of this difficult genus. With the additional charac-

ters of the male vesica and other genitalia characters, we

are now able to present our conclusions pertaining to the

identifications of the species of Herpetogramma known

Corresponding editor: M. Espeland

Published: 13.05.2021

174 Louis Handfield & Daniel Handfield

to occur in Canada and add three new species of Herpe-

togramma to the list of North American species.

In the present paper, the word “Newfoundland” does

not include “Labrador” and vice-versa.

MATERIAL AND METHODS

Repository abbreviations

Specimens were examined from the following collec-

tions:

AC = Personal collection of Alain Charpentier,

Saint-Hyacinthe, Québec, Canada

American Museum of Natural History,

New York, USA

Natural History Museum (formerly British

Museum of Natural History) [BMNH]),

London, UK

Canadian National Collection of Insects,

Arachnids, and Nematodes, Ottawa,

Ontario, Canada, including the collections

of Léo-Paul Landry, Michel Pratte, and

parts of the collections of Alain

Charpentier and Bernard Landry

Cornell University Insect Collection,

Cornell University, Ithaca, New York,

USA

Personal collection of Daniel Abraham

and Nathalie Michel, Saint-Pierre,

Iles-Saint-Pierre-et-Miquelon, France

Personal collection of Daniel Handfield,

Orford, Québec, Canada

Personal collection of Eric Rassart,

Brossard, Québec, Canada

Lyman Entomological Museum, McGill

University, Sainte-Anne-de-Bellevue,

Québec, Canada

Personal collection of Louis Handfield,

Mont-Saint-Hilaire, Québec, Canada

Personal collection of Norman Handfield,

Mont-Saint-Hilaire, Québec, Canada

Naturhistorisches Museum Vienna

(Natural History Museum), Vienna,

Austria

Personal collection of Normand Juneau,

Saint-Maurice, Québec, Canada

E.H. Strickland Entomological Museum,

University of Alberta, Edmonton, Alberta,

Canada

Collection Ouellet-Robert, Université de

Montréal, now Centre de la Biodiversité,

Montréal, Québec, Canada

National Museum of Natural History

(formerly United States National

Museum), Washington, USA

AMNH

NHMUK =

CNC =

CUIC =

DANM

DH =

ER =

LEM =

LH =

NH =

NHM =

NJ =

SEM =

UM =

USNM =

Bonn zoological Bulletin 70 (1): 173-199

Dissecting methods and genital terminology.

Dissections of genitalia and terms for genital structures

and wing patterns and markings follow Lafontaine

(2004) and the terminology used in the Moths of America

North of Mexico (MONA) series, few exceptions follow

Kristensen, Niels P. (2003).

Diagnosis of genus in North America

Herpetogramma Lederer, 1863

Type species: Herpetogramma servalis Lederer, 1863, by

monotypy.

Even if the genus Herpetogramma is worldwide in dis-

tribution (Solis 2010), we have restricted our research

to North America — mostly to Canada — as there are so

many discoveries remaining to be made and also so many

habits of these fantastic species remain unknown. Even

for American species, very few details are known as to

the biology of Herpetogramma (Solis 2010). The latter

is the only author who has tried to shed light on that mat-

ter. Larvae of our species, so far as known (Solis 2010),

are mostly general feeder, especially on herbaceous low

plants, no one in Canada are of economic importance

(Solis 2010).

The last treatment of North American species of Her-

petogramma (Scholtens & Solis 2015) lists ten species

for the North American fauna including the species we

added in 2011 (Handfield & Handfield 2011). With the

present revision, the total number of known North Amer-

ican species is now thirteen of which ten occur in Canada.

Adult. Medium-sized moths with a wingspan of

25-37 mm. The three basic forms in North America

(H. phaeopteralis, H. bipunctalis, and H. theseusa-

lis) have a pale gray-brown or creamy-brown forewing

ground colour with a relatively simple forewing pattern

consisting of darker, slightly wavy, antemedial, postme-

dial, and subterminal lines, and solidly dark reniform and

orbicular spots. The other species have a more complex

pattern with the veins usually lined in dark shading, the

basal and antemedial lines zigzagged, the postmedial and

subterminal lines scalloped between the veins, and the

terminal line even along the outer edge of the forewing;

the orbicular and reniform spots are dark and either solid,

or with a pale center. The hind wing has a similar pattern

to that of the forewing, although usually paler, and the

orbicular and reniform spots are replaced by an elongated

discal spot.

Male genitalia. Valva elongated, elliptical; lightly

sclerotized, except for narrow sclerotized rod-like brace

on dorsal margin, angled at one-third from base, and short

rod along basal '4 of ventral margin, densely covered

with hairlike setae. Uncus about 4 x length of valve, ta-

pered gradually to a densely setose apex. Vinculum with

pair of short eversible coremata each covered with mass

©ZFMK

A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 175

of fine hair-like setae that are longer than valves. Phallus

relatively lightly sclerotized, especially dorsally, usually

7-10 x medial width; eversible vesica 0.65—0.95 x length

of phallus; vesica with one or two basal diverticula, and a

large spiny diverticulum at % or *%4 from base.

Female genitalia. Anal papillae elongated, narrow,

densely setose; posterior apophyses as long as height of

anal papillae; ductus bursae narrow 4—’2 x length of cor-

pus bursae; corpus bursae narrow posteriorly, broad and

oval anteriorly, anterior part 1-7 x as long as narrower

posterior part of corpus bursae. Large posterior part of

corpus bursae covered with minute sclerotized spicules

that are concentrated to form a double-pouched signum

toward posterior end.

DNA Barcoding tree

With the help of BOLD (Barcode of Life Database),

many specimens of all Herpetogramma morpho-species

could be DNA barcoded, and it appears that the genus

Herpetogramma is more complex and diversified than

was previously suspected (see Appendix 1).

Key to Canadian species of Herpetogramma (external

markings of adults)

1. Abdomen with two dark dots dorsally on second

segment, small dark discoidal spot on hindwing;

wingspan 23—24 mm ............00 cee H. bipunctalis

— Abdomen without these two dark dots or the small

GARACISCOIDAL SDO ls. :.careoms aad ae ni dl delat eas 2,

2. Forewings narrow; wingspan about 20 mm .............

pp Ia cts re ene LE: Cn eee at H. phaeopteralis

— Forewings broader; wingspan 25—37 mm............... 3

3. Reniform spot black, kidney shaped..........0...0000.... 4

— Reniform spot square, often with paler center ........ 6

4. Hindwing with an even, thin, gray-brown terminal line

near margin; wingspan 25—27 mm..... H. theseusalis

— Hindwing subterminal line somewhat checkered,

usually projecting into hindwing fringe as dark dots

5. Hindwing with dark gray-brown bands contrasting

with paler ground colour; wingspan 27—33 mm ......

a orl Ce 2 Bec a I) ae PN, Ph Joe. 3 H. aeglealis

— Hindwing dark gray brown; wingspan 31-37 mm....

H. sphingealis

6. Terminal and subterminal lines on hindwing absent;

wingspan 29-32 mm. ............00.... H. fraxinalis sp. n.

— Terminal and subterminal lines on hindwing gray

brown; subterminal line scalloped between veins... 7

7. Terminal line on hindwing barely marked, usually

represented by minute dots on wing veins; wingspan

ge a M00) 00 Lng My oe 20. eae ts H aquilonalis sp. n.

— Terminal line on hindwing continuous, gray brown

Bonn zoological Bulletin 70 (1): 173-199

8. Forewing with reniform and orbicular spots pale

gray brown, concolourous with other markings on

forewing; wingspan 23—24 mm .......... H. pertextalis

— Forewing with reniform and orbicular spots

contrastingly dark, beeing darker than other forewing

Td Ge AGG pe see, ah A aad cee ns LR Re BS AEE, ,

9. Inner margin of subterminal line on hindwing deeply

scalloped between veins; wingspan 29-33 mm .......

AY. Pepe i leetmereen ypc epee Mive bere seth H. thestealis

— Inner margin of subterminal line on hindwing slightly

scalloped between veins; wingspan 26—27 mm .......

Wi § CR ERROR at ME ES cies A H. nymphalis sp. n.

Key to Canadian species of Herpetogramma (male

genitalia)

1. Vesica with single basal diverticulum...............00.... 2

— Vesica with basal and medial or _ subapical

CIV CILICHI AA Axia as A errhi ic eee eA Ree ree | 4

2. Vesica enlarged toward apex.......... H. phaeopteralis

— Vesica cylindrical, of even girth for whole length .. 3

3. Vesica projecting posteriorly from apex of phallus...

silts nea EEN ee at UTR eat cea dee ate H. theseusalis

— Vesica curved at end of phallus to project ventrally .

Baccus SRRare : eenneaices amines 2 se. aa H. bipunctalis

4. Vesica with spiny diverticulum at % distance to

apex of vesica; with two diverticula at base, an

elongated one on right side and a small bubble-like

diverticulum one dorsally ........0.000ccccccecceeteeeeee 5

— Vesica with spiny diverticulum at % distance to apex

of vesica; with one diverticulum at base on right side

with a narrow finger-like secondary one projecting

PROUT 105s. . hk ac oe anh IM one eae Ure eet ee aos 8

5. Vesica straight at position of spiny diverticulum. ......

Lame inctua Dh Be Pie sae va See iar Se oe na okt ba th H. pertextalis

— Vesica angled at position of spiny diverticulum ..... 6

6. Two separate diverticula at base of vesica on right...

Pi, Oe = AeA Man sorrel ha hee te Pay, ED H.. aquilonaris sp. n.

— Single elongated diverticulum at base of vesica on

(5620 Paes Ste eT NN , Wienaee BO, We ed 7

7. Basal diverticulum on right side of vesica elongated

LO PLOJECE POSTSMIOT] Voki. itses Myr scgvsaniceens H. thestealis

— Basal diverticulum on right side of vesica anvil

shaped, projecting anteriorly and posteriorly............

a Poe Neh ae eee ol hae ee H. fraxinalis sp. n.

8. Phallus 8.0-8.8 x as long as its medial width of

[O)OC=t NDEs Mastic ae bone Ud coapbiacin akan haa hii ,)

— Phallus 10.0—10.6 x as long as its medial width of

12) OY 1 LPNS Mie Revs cee esl Sere te EP SPR NE H. sphingealis

9. Distance between end of phallus and base of dorsal

diverticulum 0.5 length of phallus .......0.000.

Med Ricans Rie Ieee Wie cnt chao sR H. nymphalis sp. n.

— Distance between end of phallus and base of dorsal

diverticulum 0.25—0.3 length of phallus .................

se Ee ater Pe eneenlt pet. fs an bots Perm H. aeglealis

©ZFMK

176 Louis Handfield & Daniel Handfield

Note for new names

All names herein for new species are names in apposi-

tion.

Species account

Herpetogramma phaeopteralis (Guenée, 1854) (801196,

MONA 5274)

Pl. 1, Figs 1 (4), 2 (Q) (adults); Pl. 4, Figs 35-36

(¢ gen.); Pl. 7, Fig. 55 (Q gen.).

Synonyms. As listed by Solis 2010; Scholtens & So-

lis 2015: Botys vecordalis Gn., 1854; Botys ostreonalis

WIk., 1859; Botys vestalis W\lk., 1859; Botys additalis

WIk., 1862; Botys plebejalis Lederer, 1863; Botys cella-

talis W\k., 1866; Botys communalis Snellen, 1875; Botys

intricatalis Moschler, 1890; Acharana descripta Warren,

1892. For Botys neloalis W\k. and Botys triarialis Wk.,

“these names and the type specimens associated with

them need to be re-evaluated with respect to the North

American fauna” (Alma Solis, in /itt., 30.1v.2018).

Type material. | 3. Cayenne, French Guyana, lecto-

type in NHML [NHMUK] (Solis 2010).

Diagnosis. This is a generally uniformly medi-

um-brown species having a wingspan of generally

20 mm, without any special markings except for the usu-

al black transverse lines, with a long, black, nearly half-

moon-shaped reniform spot and a small, black, rounded

orbicular spot; there is no pale patch between the orbic-

ular and reniform spots. The forewing narrower than in

other soecies; the hindwing is similar in colour or slightly

paler than the forewing; there is no sexual dimorphism.

Solis (2010: figs 10-11) illustrates a male and a female.

Male genitalia. Figs 35-36. Valvae and genital capsule

generally as described for genus, except sclerotized rod

extending along basal third of ventral margin of valva

more heavily sclerotized than in other species. Vesica ex-

tending posteriorly from phallus, 0.8 x length of phallus,

vesica larger posteriorly, with single dorsal subbasal

diverticulum. Female genitalia. Fig. 55. Large anterior

part of corpus bursae elongated with length about 1.7 x

width, 2 x length of narrower posterior part, and 1.5 x

length of ductus bursae.

Distribution. In the North, it is a rare migrant. Only

five specimens are known from Canada: Ontario: “Cave

west side of lake Mindemoya, Manitoulin Island, 21—

22.x.1979, 4 34, John K. Morton;” and “Lambton Co.,

Port Franks, 18.x.2014, one 9, Kenneth H. Stead” [iden-

tification confirmed by BOLD] [in CNC]. Common from

southern United States southward through the Caribbe-

an region and Central and South America (BOLD, Solis

2010). In BOLD, there are barcode records from Florida,

Oklahoma, South Carolina (Myrtle Beach), Texas, Bo-

livia, Costa Rica, Honduras, Jamaica, Mexico, Peru, and

Brazil. Solis (2010) lists Brazil, Colombia, French Guy-

ana (Cayenne), Haiti, Jamaica, Puerto Rico, and Vene-

zuela. In the United States, it flies in May and June, and

from mid-August to December (Solis 2010). It 1s com-

monly known as the “tropical sod webworm.”

Biology. The larva feeds on St. Augustine grass [Sten-

otaphrum secundatum] (Poaceae) and centipede grass

[Eremochloa ophiuroides| [Poaceae] (Allyson 1984);

also on bermudagrass [Cynodon ssp.|, seashore paspal-

um [Paspalum vaginitium], carpetgrass [Axonopus ssp. |,

zoysiagrass [Zoysia japonica], bahiagrass [Paspalum no-

tatum| and creeping bentgrass [Agrotis stolonifera] (all

Poaceae) (Tofangsazi et al. 2012 rev. 2015). In the Unit-

ed States, the larvae are pests on new lawns, turfgrass,

golf courses, and athletic fields (Tofangsazi et al. 2012

rev. 2015). As the moth is only a rare migrant in Canada,

there is no special habitat in Canada, but the moth prefers

open grassy habitats. It is a nocturnal species, flying from

dusk and comes to light.

Note. According to Shaffer & Munroe (2003), H. phaeo-

pteralis (Gn., 1854) is a New World species that is not

present in the Old World (Europe, Africa, Asia, Ocea-

nia). The data for H. phaeopteralis in the literature for

the Old World list Africa, islands in the Indian Ocean (for

La Réunion, see Guillermet 2009), Asia, Korea (see Bae

et al. 2008). However, all needs to be re-evaluated and

verified (Alma Solis, in litt., 30.iv.2018) because these

records likely refer to H. licarsisalis (Wlk., 1859) (TL

Sarawak, Borneo) which is the Old World species (spec-

imens in CNC of H. Jicarsisalis are from Belgian Congo

[Democratic Republic of Congo], Hawaii [USA]), India

[Republic of India], Japan, Malacca, Samoa Island, Sik-

Figs 1-12 (opposite page). 1. Herpetogramma phaeopteralis 3, CNCLEP00212001: Canada, ON, Manitoulin, The Cave W side,

Lake Mindemoya, 21.x.1979, J. K. Morton. 2. Herpetogramma phaeopteralis 2°, CNCLEP00212002: Canada, ON, Lambton, Port

Franks, 18.x.2014, K.H. Stead. 3. Herpetogramma bipunctalis 6, CNCLEP00212003: Canada, QC, St-Hyacinthe, 4865 rue Mari-

court, 45.609426° N, 72.978514° W, 01.x.2016 at light, Alain Charpentier. 4. Herpetogramma bipunctalis 2°, CNCLEP00212004:

United States, SC, Myrtle Beach, 10.x.1965, A. C. Sheppard. 5. Herpetogramma theseusalis 3, CNCLEP00212005: Canada. QC,

south end of Pike Lake, Manitoulin Is., 7.viii.2008, J. K. Morton. 6. Herpetogramma theseusalis 9°, CNCLEP00212006: Canada,

ON, Rockville Junction Bog, Bidwell Rd, Manitoulin Is., 29.vi.1991, J.K. Morton. 7. Herpetogramma aquilonalis sp. n. Holotype,

3, CNCLEP00212007: Canada, QC, Mont Rougemont, Rougemont, 45°27.89’ N, 73°04.52’ W, 14.vii.2008, D. Handfield. 8. Her-

petogramma aquilonalis sp. n. 3, CNCLEP00212008: Canada, QC, Lanoraie, Tourbiére de Lanoraie, 45°59.50’ N, 73°16.60’ W,

5.vii.2016, D. Handfield. 9. Herpetogramma aquilonalis sp. n. 2°, CNCLEP00212009: Canada, QC, Lanoraie, Tourbiére de Lan-

oraie, 45°59.50’ N, 73°16.60’ W, 5.vii.2016, D. Handfield. 10. Herpetogramma aquilonalis sp. n. 2°, CNCLEP00212010: Canada,

QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°04.29’ W, 14.vii.2008, Louis Handfield and Daniel Handfield. 11. Herpeto-

gramma aquilonalis sp. n. 3: United States, NY, Ithaca, Snyder Heights, 15.vii.1977, 1,100 ft, J.G. Franclemont (CUIC). 12. Her-

petogramma aquilonalis sp. n. 9: United States, NY, Ithaca, Snyder Heights, 22.vii.1977, 1,100 ft, J.G. Franclemont (CUIC).

177

A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863

©ZFMK

Bonn zoological Bulletin 70 (1): 173-199

178 Louis Handfield & Daniel Handfield

kim [Republic of India], Taiwan and Tonkin [Vietnam].

A barcode analysis (BOLD) (23.111.2021) shows a large

divergence between Australian specimens of H. Jicarsi-

salis and South American specimens of H. phaeopteralis.

Herpetogramma bipunctalis (Fabricius, 1794) (801193,

MONA 5272)

Pl. 1, Figs 3-4 (adults); Pl. 4, Figs 37-38 (3 gen.).

Synonyms (as listed by Solis 2010, Scholtens & So-

lis 2015). Botys detritalis Gn., 1854; Botys lycialis Wk.,

1859; Botys philealis Wlk., 1859; Botys terricolalis

Moschler, 1881; Botys repetitalis Grote, 1882; and Botys

simplex Warren, 1892.

Type material. | < from the “West Indies” [Carribean

region] (Surinam in original description) in ZMUC (Zo-

ological Museum, Copenhagen, Denmark) (Solis 2010).

Diagnosis. This well-known species is a pest of culti-

vated beets in the South where it is known as the “south-

ern beet webworm.” Specimens generally have a wing-

span of 23—24 mm; there is no sexual dimorphism and

the species is highly variable in colour pattern being light

brown, cream, or even whitish, but 1s characterized by

the solid, black, reniform and orbicular spots, without a

white or cream-coloured bar between them as in some

other Herpetogramma species. It 1s most easily identi-

fied by the two dark spots on the dorsum of the second

abdominal segment; also there is a small dark discoidal

spot on hindwing. The name bipunctalis refers to the

two black dots on the forewing that plays the role of the

orbicular and reniform. Solis (2010: figs 4—5) illustrates

a male and a female of H. bipunctalis. Male genitalia.

Figs 37-38. Valves and genital capsule as described for

genus. Vesica projecting ventrally from apex of phal-

lus; vesica 0.8 x length of phallus, with single ventral

subbasal diverticulum. Female genitalia. Recently de-

scribed in fig. 150 in Landry (2016).

Distribution. In the North of North America, this is a

rare migrant. Only a few records are known from Qué-

bec: Sainte-Christine, (21.1x.2003, coll. DH [identifica-

tion confirmed by BOLD]); Montréal (22.1x.1957, A.C.

Sheppard); Pincourt (Ile Perrot) (24.ix.1970, V. R. Vick-

ery) (LEM); St-Hyacinthe (4865 Maricourt, 1.x.2016,

Alain Charpentier) (CNC). Records from Ontario include

a migratory flight recorded in 2016 (Long Point and Port

Franks; Kenneth Stead, pers. comm.) and at Ottawa (No-

lie Schneider, pers. comm.). No records are known from

elsewhere in Canada. It is a species generally present in

the mid-eastern and southeastern United States. Records

in BOLD are from Florida, Oklahoma, Tennessee and

Texas (United States of America) and Mexico. The spe-

cies 1s common in agricultural areas where the hostplants

are cultivated. Adults occur from August to December. It

is nocturnal, coming to light and easily flushed during the

day from low vegetation.

Biology. The larva feeds on cultivated beets (Che-

nopodiaceae), cauliflower and cabbage (Brassicaceae),

cabbage (Brassicaceae) and weeds, also feeds especial-

ly on species of Amaranthus (Amaranthaceae), eggplant

(Solanum melongena [Solanaceae]) and beet (Beta vul-

garis [Amaranthaceae]) (Allyson 1984). Specimens in

the USNM were reared from Amaranthus sp., Ambrosia

sp. (Asteraceae) and soybean (Glycine max [Fabaceae])

(J. D. Lafontaine, personal communication, October

2018). The species seems to have found a new hostplant

and feed on the invasive A/ternanthera philoxeroides

(Amaranthacea) in Florida and neighboring States (Hep-

pner 2003); it attacks the parts of the plant that are above

the water level (Lara- Villalon et al. 2014). As the moth is

migratory in Canada, there is no special habitat in Cana-

da, but it 1s generally found in open areas.

Herpetogramma theseusalis (Walker, 1859) (8011200,

MONA 5279)

Pl. 1, Figs 5-6 (adults); Pl. 4, Figs 39-40 (¢ gen.); PI. 7,

Fig. 56 (9 gen.).

Synonymy. feudalis Grote, 1875 (Botis) (Solis, 2010)

(Scholtens & Solis 2015).

Type material. Botis theseusalis Walker, 2 holo-

type from “United States” in NHMUK; Botis feudalis

Grote, 3 lectotype from New York or Massachusetts in

NHMUK by Solis 2010.

Figs 13-24 (opposite page). 13. Herpetogramma fraxinalis sp. n. Holotype 4, CNCLEP00212011: Canada, QC, Mont Rougemont,

Rougemont, 45°28.026’ N, 73°04.29’ W, 5.viii.2009, D. Handfield. 14. Herpetogramma fraxinalis sp. n. 2°, CNCLEP00212012:

Canada, QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°04.29’ W, 29.vii.2008, Louis Handfield and Daniel Handfield.

15. Herpetogramma fraxinalis sp. n. 4, CNCLEP00212013: Canada, QC, Brome-Missisquoi, St-Armand, Domaine Baie-Mis-

sisquol, 18.vili.2000, B. Landry. 16. Herpetogramma fraxinalis sp. n. 9, CNCLEP00212014: Canada, QC, Mont Rougemont,

Rougemont, 45°28.026’ N, 73°04.29’ W, 29.vii.2008, Louis Handfield and Daniel Handfield. 17. Herpetogramma thestealis &,

CNCLEP00121457: Canada, QC, Gatineau Park, Luskville Falls, creek below picnic ground, 45.5333° N, 75.9955° W, 25.vii.2014,

J.F. Landry and B. Landry. 18. Herpetogramma thestealis 2°, CNCLEP00212016: Canada, QC, St-Valérien-de-Milton, Tourbiere

de St-Valérien, 45°32.55’ N, 72°40.24’ W, 2.viii.2005, Daniel Handfield. 19. Herpetogramma thestealis 3, Canada, QC, Mont

Rougemont, Rougemont, 45°28.026’ N, 73°04.29? W, 25.vii.2008, Louis and Daniel Handfield. 20. Herpetogramma thestealis

9, Canada, QC, Otterburn Park, Les Bosquets Hudon, 5.viii.2008, Louis and Daniel Handfield. 21. Herpetogramma pertextalis

3, CNCLEP00212017: Canada, ON, Simcoe, 27.vi.1935, T.N. Freeman. 22. Herpetogramma pertextalis 3, CNCLEP00212018:

Canada, QC, Lac Trousers, 495 rte Mississiquoi, 45°24.86’ N, 72°35.25’ W, 1.viit.2011, Daniel Handfield. 23. Herpetogramma

pertextalis 2°, USNMNH 208285: United States, NY, Six Mile Creek, 31.v.1957, J.G. Franclemont. 24. Herpetogramma pertextalis

2, CNCLEP00121794: Canada, ON, Lambton Co., Port Franks, 28.1x.2014, K.H. Stead.

179

A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863

©ZFMK

Bonn zoological Bulletin 70 (1): 173-199

180 Louis Handfield & Daniel Handfield

Diagnosis. This well-known species has all four wings

concolourous with buff brown (rarely light brown),

except for slightly darker margins; wingspan usually

25 mm; the antemedial line is black and nearly straight,

with no light-coloured patch between the reniform and

orbicular spots; the reniform spot is a black bar, some-

times outwardly convex; the orbicular spot is a rounded

black dot; the apex of the forewing is more squared, not

acutely angled as in other species; the postmedial line

is black, sinuous, and strongly bent below the cell, as

in most Herpetogramma species; the abdomen, thorax,

and head, are of the same colour as the wings; the palpi

are short (Forbes 1923). There is no sexual dimorphism.

Solis (2010: fig. 12) illustrates a male. Male genitalia.

Figs 39-40. Valves and genital capsule as described for

genus. Vesica extending straight posteriorly from phal-

lus, 0.7 x length of phallus, with single dorsal subbasal

diverticulum. Female genitalia. Fig. 56. Large anterior

part of corpus bursae with length about 2 < width, about

4 x length of narrower posterior part, and 2 x length of

ductus bursae.

Distribution. In Canada Herpetogramma theseusa-

lis is only known by a few specimens from Southern

Québec (incl. Saint-Hilaire mountain [in Mont-Saint-

Hilaire]), Eastern Ontario, New Brunswick (Cormier-

ville, Cocagne Co., 29.vi1.2015 [Bug Guide, 20.1x.2020])

and Nova Scotia (near Sherbrooke, 11.vii.2017) [Butter-

flies and Moths of North America, accessed 20.1x.2020].

In the United States, it is known from Maine, Massachu-

setts, New York, and Pennsylvania; farther south it is

recorded from Maryland, Delaware, and Virginia south-

ward to Florida, and along the Gulf of Mexico to Texas.

Specimens barcoded and available on BOLD form two

different Barcode Index Numbers (BINs), suggesting the

existence of two species there, one in the North being the

typical one, and another one in Southern United States,

Only four specimens have been submitted to BOLD and

these are from Québec, Ontario, South Carolina, and

Florida. The types of feudalis are from New York and

Massachusetts (Solis 2010) and consequently feudalis is

considered a synonym of the typical northern H. theseu-

Salis (Solis 2010).

Biology. The larva rolls the tips of various ferns (Forbes

1923) “rolling up fronds into round balls” (Winn 1912, p.

79), and especially Thelypteris palustris (Thelypterida-

ceae) [Specimens in the USNM] (Solis 2010) and LEM

(Hertel lake [on mountain of Saint-Hilaire, Mont-Saint-

Hilaire, Québec [handwritten note on A.C. Sheppard’s

working copy of Winn List]). Thelypteris palustris is a

common fern in eastern North America occurring from

Québec to Florida. The larva also feeds on Osmunda

cinnamonea (Osmundaceae) (East Concord, New York

[CUIC]) and on Onoclea sensibilis (Dryopteridaceae)

in Maine (Adams & Morse 2014), both common ferns

in Eastern Canada. In Maryland, the larva feeds also on

Woodwardia areolata (Blechnaceae) (Maryland Biodi-

versity Project, accessed 20.1x.2020), a fern known only

from southern Nova Scotia in Canada, and then from

Massachusetts to Florida, and along the Gulf of Mexico

to Louisiana and eastern Texas (Lady Bird Johnson Wild-

flower Center, Texas, accessed 20.1x.2020). The moth is

associated with mesic habitats, bogs (like the Lanoraie

bog in Québec), open boggy habitats, and lake and river

shorelines. It is nocturnal and comes to light.

Herpetogramma aquilonalis sp. n.

urn: |sid:zoobank.org:act:89F 000D3-83 DE-4CEC-A9F8-55A4E33D8CEA

Pl. 1, Figs 7-12 (adults); Pl. 4, Figs 41-42 (3 gen.); Pl. 7,

Fig. 57 (2 gen.).

Type material. Holotype <6. Canada: Québec:

Rougemont, montagne [mountain] [45°28’026” N,

73°04’029” W], 14.vu1.2008, Daniel Handfield collection

[MDH006455]. Deposited in CNC.

Paratypes. (54 34, 38 29): Canada: Québec: [Daniel

Handfield Collection]: Canton de Magog, lac Lovering,

25.vii.2002 (1 4); Chambord, usine Louisiana Pacifique,

16.vii.2001 (1 4); Franklin, Réserve écologique du Pin-

Rigide, 5.vii.2013 (1 3), 17.vii.2013 (1 4); Lac Trou-

sers, 495 Route Missisquoi, 2.viii.2011 (3 33); Lano-

16.vii.2007 (1 @), 24.vi.2016 (2 03), 5.vii.2016 (13 33)

, 23.vii.2016 (4 OQ), 5.vii.2016 (11 99), 23.vii.2016

(7 9°); Lac Granet, chalet de la SEPAC, 5.viii.2014

(1 3); Grand-Remous, club du lac Brilé, 5.viii.2010

(3 &4); La Présentation, 5e rang, 17.vii.2002 (1 3);

27.vii.2012 (1 3), 1.viii.2012 (1 3); Moisie, bord du

fleuve, 30.vi.2016 (1 4); Parc des Laurentides, lac Sept-

Iles, 11.vii.2011 (1 4); Pare national de la Pointe-Tail-

Figs 25-34 (opposite page). 25. Herpetogramma nymphalis sp. n. 3, Holotype CNCLEP0089832: Canada, QC, Gatineau, Parc de

la Gatineau, Mont King, 24.v.1989, B. Landry. 26. Herpetogramma nymphalis sp. n. 2°, CNCLEP0089833: Canada, QC, Gatineau,

Parc de la Gatineau, Mont King, 24.v.1989, B. Landry. 27. Herpetogramma nymphalis sp. n. 3, CNCLEP0040835: Canada, MB,

Manitoba Tall Grass Prairie Preserve, Nature Conservancy Block, 49.0895° W, 96.7339° W, 294 m, 19.vii.2007, J.F. Landry and

V. Nazari. 28. Herpetogramma nymphalis sp. n. 2°, CNCLEP0040836: Canada, MB, Manitoba Tall Grass Prairie Preserve, Nature

Conservancy Block, 49.0895° W, 96.7339° W, 294 m, 19.vii.2007, J.F. Landry and V. Nazari. 29. Herpetogramma aeglealis, 3,

Canada, QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°04.29’ W, 25.vi1.2008, D. Handfield. 30. Herpetogramma aeglea-

lis, 2, Canada, QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°04.29’ W, 25.vii.2008, D. Handfield. 31. Herpetogramma

aeglealis, 3, Canada, QC, Mont-Saint-Hilaire, 845 de Fontainebleau, 26.ix.2006, Louis Handfield. 32. Herpetogramma aeglealis,

9, Canada, QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°04.29’ W, 29.vi1.2008, D. Handfield. 33. Herpetogramma sphin-

gealis, 6, Canada, QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°04.29’ W, 29.vii.2008, D. Handfield. 34. Herpetogramma

sphingealis, 2°, Canada, QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°04.29’ W, 29.vii.2008, D. Handfield.

A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 181

182 Louis Handfield & Daniel Handfield

lon, secteur de la dune, 25.vii.2011 (1 4); Parc nation-

al des Monts-Valin, chalet Courtepointe, 17.vii.2009

(1 &), 7.viii.2009 (1 @), 7.ix.2009 (1 3), 7.viii.2009

(1 @); Pare national des Monts-Valin, pic Bellevue,

8.vii.2010 (1 3), 27.vii.2013 (1 @); Pied des Monts

Groulx, refuge du Prospecteur, 28.vii.2014 (1 <4); S[ain]

te-Christine, boisé Julien Picard, 23.vii.2010 (2 3);

S[ain]t-Mathieu-de-Beloeil, 355 des Grands Coteaux,

8.vii.2005 (1 3), 355 des Grands Coteaux, 29.vii.2005

(1 4); Villeroy, Grande Tourbiére, 21.vii.2011 (2 33),

ZEC des Passes, Lac aux Bleuets Secs, 27.vii.2013 (1 3)

(all DH); [Louis Handfield Collection] : Mont-S[ain]

t-Hilaire, 845 de Fontainebleau, 10.vii.2010 (1 3); S[ain]

t-Charles-sur-Richelieu (Ile de Jeannotte) (de jour, bat-

tant les grandes herbes au centre de l’ile, milieu humide),

20.vii.1969 (1 4). [Daniel Handfield Collection]: 9:

Bishopton, chalet Mésange des Sommets, 12.vi1i.2004

(1 2); Canton de Magog, lac Lovering, 23.v1i.2004 (1 9);

Franklin, Réserve écologique du Pin-Rigide, 5.vii.2013

(1 &); Henryville, Réserve écologique Marcel-Raymond,

18.vii.2014 (2 2); Lac Trousers, 495 Route Missisquoi,

1.viit.2011 (2 9°); La Présentation, Se rang, 1.x.2002

Lac Sept-Iles, 11.vii.2011 (1 2); Rougemont, montagne,

14.vi1.2008 (1 9), 29.vii.2008 (1 9); S[ain]te-Christine,

boisé Julien Picard, 15.1x.2006 (1 2); S[ain]te-Christine,

boisé Julien Picard, 3.vii.2011 (1 &), 22.vii.2011 (1 Q),

27.vil.2008 (2 29); ZEC des Passes, tourbiere du lac

Madame, 10.vi11.2013 (1 @).

Etymology. The species name is derived from Latin

aquilo for “northern wind,” referring to the transconti-

nental northern distribution of the species.

Diagnosis. Herpetogramma aquilonalis sp. n. has long

been confused in collections as there is a marked dimor-

phism in this species. That dimorphism led to a puzzle

in identification, white females often masquerading as

“abdominalis” and males as “pertextalis” and sometimes

as “thestealis.” Solis (2010: fig. 14) illustrates a male of

H. aquilonalis sp. n. from the McClean Bogs Reserve,

in New York, as H. abdominalis. Overall, the female is a

whitish moth, different from the females of its southern

counterpart, the true H. pertextalis. So, from H. pertexta-

lis, H. aquilonalis sp. n. can also be easily separated by

its larger size, by the coloring of the wings and even by

the wingshape of the forewings.

Description. Male. Figs 7-8, 11. Wingspan: 25-—

27 mm [rarely 28 mm], more heavily marked and longer

winged than female; palpi and head white, collar white

with a tuft of gray hair dorsally near thorax; thorax and

abdomen light gray, each segment of abdomen marked

by a thin white line at apex; forewing: fringe light gray

marked by a darker line at each vein; terminal line pale

gray, bordered interiorly by darker gray subterminal line,

scalloped between veins; terminal space slightly wider

toward apex; postmedial line wavy, thin, gray, extending

from costa to dorsal margin of wing; medial line thin,

gray, under reniform spot, upon reaching dorsal mar-

gin; turning inwardly toward base of wing; antemedial

line extending from costa, a bit wavy, convex, touching

dorsal margin of wing near medial line; sometimes post-

medial and medial lines connected as in H. theseusalis?;

basal dash absent; costa dark gray from wing base usu-

ally to postmedial line; area between reniform and or-

bicular spots an elongated white patch, or concolourous

with ground colour; reniform spot a dark gray rectangle,

solid or with pale center; orbicular spot dark gray, round,

barely evident in some specimens, sometimes paler

in middle; veins, especially in males, marked by gray.

Hindwing upperside: ground colour white, fringes as in

forewing, terminal area cream, as wide as on forewing:

postmedial line wavy, scalloped between veins; veins not

marked with gray as on forewing; discal spot a gray bar.

Hindwing underside: ground colour white; lines as on

forewing upperside; area between terminal and subter-

minal lines darker than on upperside of wing; reniform

and orbicular spots as on upperside of wing, but darker,

also for large dark line on costa and discal spot. Female.

Figs 9-10, 12. Wingspan: 23—26 mm [rarely 27 mm];

smaller, paler, with forewing apex more squared than in

male; head, palpi, and thorax white, abdomen pale gray,

abdominal segments marked by a thin white line as in

male; forewing mainly white, fringe white, with a very

thin gray mark at each vein, subterminal area between ter-

minal and subterminal lines pale gray; subterminal area

nearly as wide from base to apex, unlike in H. thestealis,

rest of wing white, postmedial and antemedial lines thin,

gray, following same course as in the male; orbicular

spot barely visible, a pale gray dot, reniform spot small,

more rounded than in male, gray with a pale-yellow cen-

ter. Hindwing: white; discal spot an elongated dark gray

spot; subterminal line medium gray to barely evident, es-

pecially light gray, scalloped between veins, fading out

posteriorly. Underside of forewing and hindwing white

except for terminal area of forewing, which has a light

gray dot on each wing vein, darker toward wing apex:

forewing costa marked by a gray line; reniform spot well

Figs 35—42 (opposite page). 35. Herpetogramma phaeopteralis valves PYR 1317: Bermuda, 8.x1i.1951, W. and E. Mason.

36. Herpetogramma phaeopteralis phallus PYR 1317: Bermuda, 8.xi1.1951, W. and E. Mason. 37. Herpetogramma bipunctalis

valves PYR 1311: United States, FL, Homestead, 7.x.1958, D.O. Wolfenbarger. 38. Herpetogramma bipunctalis phallus PYR

1311: United States, FL, Homestead, 7.x.1958, D.O. Wolfenbarger. 39. Herpetogramma theseusalis valves PYR 1313: Canada,

QC, Co. Laviolette, Lac-a-la-Tortue, 22.vii.1947, E. Munroe. 40. Herpetogramma theseusalis phallus PYR 1313: Canada, QC, Co.

Laviolette, Lac-a-la-Tortue, 22.v1i.1947, E. Munroe. 41. Herpetogramma aquilonalis sp. n. valves PYR 1293: United States, OR,

Marion Co., Croisan Gulch, S Salem, 25.vi.1978, R.L. Westcott. 42. Herpetogramma aquilonalis sp. n. phallus PYR 1293: United

States, OR, Marion Co., Croisan Gulch, S Salem, 25.vi.1978, R.L. Westcott.

Bonn zoological Bulletin 70 (1): 173-199

©ZFMK

A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 183

184 Louis Handfield & Daniel Handfield

marked; orbicular spot barely evident in most specimens.

Male genitalia. Figs 41-42. Valves and genital capsule

as described for genus. Vesica with doubled diverticulum

near base on right side and small dorsal diverticulum at

base; spined diverticulum at %4 toward apex of vesica.

Female genitalia. Fig. 57. Large anterior part of corpus

bursae about 2.4 x as long as wide, about 0.6 x total cor-

pus length, 2.7 x length of ductus bursae.

It is to be noted that we have seen in the CUIC a large

collection of specimens of H. aquilonalis sp. n. males

and females from New York State nearly all whitish in

both sexes (Figs 11-12), but still easily recognized by

their size, exactly as for other specimens more alike our

northern population; male brownish specimens are also

present in the New York State population. One of these

New York specimens was dissected and the genitalia

has proven without doubt its identity, especially since a

BOLD analysis has been rejected due to the age of these

specimens.

Distribution. Herpetogramma aquilonalis sp. n. is

transcontinental in Canada, from Newfoundland, Nova

Scotia, New Brunswick, Québec (nearly extending to

Labrador, as specimens have been caught in the Groulx

Mountain Range near the Labrador border [coll. DH]),

also present on the North shore of the St. Lawrence riv-

er up to Moisie River [coll. DH] and also in the Gaspé

Peninsula [Bonaventure along Bonaventure River] [coll.

LH] and Maria [coll. AC]; Magdalen Islands [Havre-aux-

Maisons] [coll. LH]); the French Territory of the Islands

of Saint-Pierre-et-Miquelon (Daniel Abraham and Na-

thalie Michel [DANM]); Newfoundland (BOLD); New

Brunswick (BOLD, CNC); Nova Scotia (BOLD, CNC);

Ontario (BOLD, CNC); scattered localities westward to

Alberta (SEM [Danny Shpeley in litt. & phot.] and in

southern British Columbia (BOLD, CNC). Specimens

from Saskatchewan (BOLD) and Manitoba (BOLD,

CNC) were all previously and wrongly identified as

H. pertextalis or H. abdominalis. The species is also

known from boreal habitats in the United States, from

New York (Adirondacks) to Georgia, mainly in the Appa-

lachian Mountains (BOLD). In the West it occurs in mon-

tane areas from Washington to California [specimens in

USNM; J. D. Lafontaine pers. comm.]. There are even

some specimens from British Columbia [Port Alberni]

called “thestealis” that have been submitted to BOLD;

they group with H. aquilonalis sp. n., not H. thestealis,

these specimens are of a peculiar form of H. aquilonalis

Sp. n.

Biology. Powell & Opler (2009: 180), under the name

H. pertextalis, list the larvae as leaf rollers on Asarum

(Aristolochiaceae), Urtica (Urticaceae), Rubus (Rosace-

ae) and Viola (Violaceae) in the Western United States;

the larva makes a shelter by folding, rolling and tying one

or several leaves of its host plant. It is certainly the same

pattern in Canada and the Eastern United States. In East-

ern United States Matteucia struthiopteris (Onocleace-

Bonn zoological Bulletin 70 (1): 173-199

ae), Plantago lanceolata (Plantaginaceae), and Ribes

(Grossulariaceae) are host plants (David L. Wagner, pers.

comm.); reared records in the USNM are from Euony-

mus sp. (Celastraceae) and Lonicera sp. (honeysuckle)

(Caprifoliaceae) (J. D. Lafontaine, pers. comm.); also on

Solidago flexicaulis and Solidago bicolor (Asteraceae)

(Tomkins Co., New York [CUIC]). Allyson (1984) re-

ports records from Ottawa, Ontario (as H. pertextalis):

10 specimens on Aster macrophyllus (Asteraceae) (17.

vii.1952), 10 specimens on Rubus sp. (Rosaceae) (21.

vui.1953), and 10 specimens on U/rtica sp. (Urticaceae)

(30.v1i.1955) (only as larvae having not been reared to

adults). Specimens in the CNC reared by Dr Bernard

Landry on Pedicularis canadensis (Scrophulariaceae)

(Landry 1993) are H. aquilonalis sp. n. and H. nympha-

lis sp. n. (described below). In the CNC, there are many

specimens reared on Manitoba maple (Acer negundo

[Sapindaceae]) (Ottawa, Ont.), basswood (Tilia amer-

icana [Tiliaceae]) (no locality), Salix sp. (Salicaceae)

(Forest Insect Survey, British Columbia), violet (Viola

sp. [Violaceae]) (prob. Ottawa, Ont.), Lonicera villosa

(Caprifoliaceae) (Almonte, Ontario), basswood (Tilia

sp. [Tiltaceae]) (Almonte, Ont.), false nettle (Boehmeria

cylindrica [Urticaceae]) (Almonte, Ont.), Helianthus sp.

(Asteraceae) (Annapolis, Nova Scotia), Agastache foe-

niculum (Lamiaceae) (Aweme, Manitoba), Steironema

ciliatum (Primulaceae) (Aweme, Manitoba) and Broad-

leaf maple (Acer macrophyllum |Sapindaceae (Mission

City, British Columbia). Two specimens (as abdomina-

lis 2) reared on Hamamelis sp. (Hamamelidaceae) in

the Potomac State Forest, in Maryland (see Larry Line,

Maryland Moths, visited 20.ix.2020); Hamamelis virgin-

iana 1s the only Hamamelis present in Eastern Canada

and eastern United-States (Lady Bird Johnson Wild-

flower Center, Texas, visited 20.1x.2020; Marie-Victorin

1995). It is not surprising that such a widespread species

of Herpetogramma would have a range of larval host

plants over their geographic range, as found in many ex-

amples in the host plant list for species of Lepidoptera in

Tietz 1972 (J. D. Lafontaine. pers. com, 20.111.2021). The

species 1s polyphagous on low plants and rarely found

on woody plants. It prefers open habitats, and open for-

ests, humid maple groves, even bogs and boggy habitats.

H. aquilonalis sp. n. is abundant on the slopes of the

mountain of Rougemont, Québec, in maple groves with

red oak (Quercus rubra) growing on an intrusive igneous

rock (essexite) (O’Neill 1914).

Flight period. In Québec, the moth is in flight from

mid-June to mid-August (with scattered records into

mid-September). The peak flight is from the middle of

July to the beginning of August in most of Canada. It

is the only Herpetogramma species in Canada to have

a second generation in particularly long hot summers as

was the case in 2019 in South-Eastern Québec, but we

have not been able to collect enough specimens to ascer-

tain if it was a full or only a partial second generation. It

©ZFMK

A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 185

is anocturnal species, coming freely to light. According

to Joachim Lafrance (personal notes taken from 1965 to

1969 in Ste-Clotilde, Québec) (under the name H. per-

textalis), the moth flies until up to three o’clock in the

morning.

Herpetogramma fraxinalis sp. n.

urn: lsid:zoobank. org: act: 6EA259F9-5C98-4155-8232-CDFF6C5CC10C

Pl. 2, Figs 13-16 (adults); Pl. 5, Figs 43-44 (4 gen.);

Pl. 7, Fig. 58 (Q gen.).

Type material. Holotype <. Canada: Québec:

Rougemont, montagne [mountain] [45°28’026” N,

73°04’029” W.], 27.vi1.2008, Daniel and Louis Hand-

field. CNC.

Paratypes (16 33, 9 99). Canada: Ontario: Lake

Erie, Wallacetown, reared on Fraxinus americana, For-

est Insect Survey, 17.vii.1958 1 4 (CNC), 15.vii.1958,

3 dS (CNC), reared on Tilia sp., Forest Insect Sur-

vey, 15.vii.1958, 1 4 (CNC); Manitoulin Island, Mud

Creek, Lake Kagawong, 13.vui.1996, John K. Morton,

1 ¢ (CNC) ; Canada: Québec: Milton East [= Sainte-

Cécile-de-Milton], reared on Tilia glabra |= Tilia amer-

icana], Forest Insect Survey, 25.vi.1970, 1 3 (CNC);

S[ain]te-Foy, reared on Fraxinus americana, Forest

Insect Survey, 6.vii.1961, 1 4 (CNC); 10.vii.1961,

1 3 (CNC); Rougemont, montagne, Daniel and Lou-

is Handfield, 25.vii.2008, 1 2 (CNC), 29.vii.2008, 1 3

(LH), 28.vii.2009, 1 4 (LH) ; 8.vii.2010, 2 6S (LH);

12.vii.2010, 1 4 (LH); 16.vii.2010, 1 4 (LH); 12. vii.2008,

1 2 (LH); 24.vi1.2008, 1 2 (LH); 29.vii.2008, 1 2 (LH);

10.vii.2009, 1 9 (LH); 5.vit.2010, 1 9 (LH); 15.vii.2010,

1 9 (LH); 19.vii.2010, 1 2 (LH); Rougemont, montagne,

26.vil.2010, Daniel and Louis Handfield, 1 9 (LH);

Mont-Saint-Hilaire, 845 de Fontainebleau, 5.viii.2017,

Louis Handfield, 1 4 (LH).

Etymology. The species name is derived from one

of the hostplants of the species, Fraxinus americana L.

(Oleaceae).

Diagnosis. Herpetogramma fraxinalis sp. n. has been

in the past confused with H. abdominalis because of its

mainly white wing colour. There is little significant di-

morphism in this species, males and females being nearly

alike, except that the forewings of males are slightly lon-

ger and apically more pointed than those of females and

the latter’s wings have less dark shading than males. It is

a large species (wingspan: 29-32 mm, average 30 mm).

It is easily distinguished from H. aquilonalis sp. n. fe-

males by its wingspan (30 mm for H. fraxinalis sp. n.

and 24—26 mm for H. aquilonalis sp. n. females [rarely

up to 28 mm]), by its large, yellow reniform spot, rare-

ly yellow/brownish, and by its yellowish-gray lines on

the forewings more visible in fresh specimens. Finally, a

larger moth than H. aquilonalis sp. n., and easily recog-

nized by its larger size.

Bonn zoological Bulletin 70 (1): 173-199

Description. Adult. Male. Figs 13, 15. Head and palpi

white; collar light yellow; tegulae light yellow; thorax

white; abdomen pale yellow, each segment marked by

a white band; forewing upperside mostly pale yellowish

white with darker markings faint in most specimens; apex

not sharply pointed; costa with a yellow band along from

wing base to postmedial line; a thin yellow line from base

of wing extending along medial vein almost to postmedi-

al line and lower part of reniform spot; basal area yellow

from base to basal line; basal dash absent; antemedial and

medial lines pale gray, barely evident in most specimens;

postmedial line pale gray, scalloped between veins, when

these are more evident, pale grey, starting at 3/5 of dor-

sum, curved outwards between CuA1 and CuA2, costal

*%5 scalloped, meeting costa at */5; subterminal line barely

evident as faint shade in some specimens; inner part of

costa marked by yellow area, especially where the post-

medial line and antemedial lines touch costa; reniform

spot large, rectangular, with basal and distal edges grey,

orbicular spot yellow rounded, gray, centre yellow; hind-

wing similar to forewing, all lines dentate, thin and gray,

discal spot rectangular, gray, with yellow center; ground

colour pale yellow except yellow band along antemedial

and postmedial lines. Underside of wings typically near-

ly entirely white, except costal border which shows a thin

light-brown or yellow line, especially in males; some-

times reniform and orbicular spots and postmedial line

on forewing, and discal spot on hindwing, show through

to upper side as very light marks; fringes white, some-

times with a pale brown line on veins. Female. Figs 14,

16. Like male except forewings slightly more squared at

apex and mainly white with maculation barely evident

or absent.

Male genitalia. Figs 43-44. Valves and genital cap-

sule as described for genus. Vesica extending posterior-

ly from phallus and about length of phallus; vesica with

anvil-shaped subbasal diverticulum on left projecting

anteriorly and posteriorly, single dorsal subbasal diver-

ticulum; spined diverticulum *%4 toward apex of vesica.

Female genitalia. Fig. 58. Anterior part of corpus bursae

with length 2.5 x width, 2 x length of narrower posterior

part, and 2.5 x length of ductus bursae.

Distribution. Herpetogramma fraxinalis sp. n. is only

known from a small northern area, corresponding exactly

to the northern distribution of Fraxinus americana and

Tilia americana in eastern Canada, the two known host-

plants of the larvae. It is known from eastern Ontario,

southern Québec up to Québec City and the southern part

of the Parc Les Grands Jardins (Carle Bélanger, pers.

comm.), and New Brunswick. It presumably occurs in

northeastern United States.

Biology. Specimens (in CNC) were reared by the

Forest Insect Survey on Fraxinus americana (Oleace-

ae) (Wallacetown, Ont. and Ste-Foy, Québec) and Tilia

americana (Tiliaceae) (Wallacetown, Ontario, and Mil-

ton East, Québec). The species could be in a dangerous

©ZFMK

186 Louis Handfield & Daniel Handfield

decline due to the situation of Fraxinus being killed by

the Emerald Ash Borer (Agrilus platipennis Fairmaire,

1888; Coleoptera, Buprestidae), imported accidentally

from Asia through the United States. It is a forest-dwell-

ing moth, where its hostplants are growing in abundance.

Flight period. The moth is in flight from early July

to early August, with a peak from mid to late July. It is

nocturnal and comes to light.

Note: The yellow on the wings tends to fade or even

disappear in older specimens and on those that have

flown a lot, as evident from their thinner fringes. Some

old specimens are nearly pure white. The best way to ac-

curately identify this species 1s by genitalia dissection or

DNA analysis, or by its large wingspan.

Herpetogramma thestealis (Walker, 1859) (801199,

MONA 5277)

Pl. 2, Figs 17-20 (adults); Pl. 5, Figs 45-46 (@ gen.);

Pl. 8, Fig. 59 (2 gen.).

Synonyms: abdominalis (Zeller, 1872) (Botis) (syn.

n.), magistralis (Grote 1873) (Botis), fissalis (Grote,

1881) (Botis) (syn. n.), gulosalis (Hulst, 1886) (Botis).

Alma Solis (2010), Scholtens & Solis (2015). Misspelled

as thestialis in Forbes (1923) and in Covell (1984).

Type material. One ¢ in BMNH, locality given as “?”

[not known] (Solis, 2010).

Diagnosis. Herpetogramma thestealis has been con-

fused in collections under the name abdominalis due

mostly to the misidentification of the type specimen of

Botis abdominalis Zeller and that of its synonym Botis

fissalis Grote, as well as its occurrence in two forms: a

dark form found in mesic areas such as bogs and marsh-

es, and a paler form found in drier, more xeric areas, a

situation also found in Spilosoma dubia Walker, 1855

(Noctuoidea, Erebidae) (see Handfield 2011: pl. 27) for

example. There is a slight dimorphism in H. thestealis,

males and females being nearly alike, except for fore-

wing shape and colour of wing, females being paler than

males; H. thestealis is a relatively large species (wing-

span 30-35 mm for males; 29-31 mm for females). This

variation has been confirmed by DNA analysis of spec-

imens submitted to BOLD and by genitalia dissections.

Solis (2010, fig. 15) illustrated a male of H. thestealis, as

representing the typical form of the species. The large,

round, dark to very dark, subterminal area, wider at the

costa, and pointed on the veins (in the fringe), is typical

of H. thestealis on the forewings as 1s all the darker fea-

tures on the forewings of the moth. These are the best

distinguishing characters for the species.

Redescription. Adult. Male. Typical (dark form)

(Figs 17, 19): Head, palpi, and thorax brown, the same

brown as on wings; abdomen same brown colour with

white line marking each segment. Forewing: medial line

absent, or represented by a few dark spots between post-

medial and antemedial lines; antemedial line extending

as a Slightly sinuate line from costal basal '/5 to orbicular

spot obliquely outward to posterior margin of wing below

position of orbicular spot; basal line usually evident only

as a dusting of dark scale; reniform spot dark, rectangu-

lar in shape, usually dark brown, but sometimes with a

light center; orbicular spot V-shaped or rounded, rarely

with a light center; area between reniform and orbicular

spots cream, as for ground colour of wing; fringe cream,

marked by brown on each vein, tornus white, not forming

a larger white patch as in other species of Herpetogram-

ma; terminal line dark brown; terminal area dark gray

brown, with deeply scalloped subterminal line on inner

margin; postmedial line curving slightly inward distal to

reniform spot, then curving outward at opposite lower

margin of reniform spot, then turning abruptly inward

to a position below reniform spot, and then downward

below reniform spot to hind margin of wing. Hindwing:

fringe white, marked with brown at veins; terminal area

pale yellowish brown bordered inwardly by dark grayish

brown subterminal line scalloped between veins; post-

medial line irregular, bending outward around position

of dark gray to black discal spot. Light form (Figs 18,

20). As for dark form, except lines, markings, and wings

paler especially in subterminal area, which is yellow

brown and contrasts with dark gray-brown terminal line

and deeply-scallopped subterminal line. Maculation as in

dark specimens, but lighter brown, often with a reddish

iridescence on brown markings. Underside. White, all

lines, and orbicular, reniform, and discal spots brown;

dark terminal area well marked and dark, but lines not

as well marked on hindwings. Female. As for male, also

presenting two forms, but never as dark as for male;

forewings not apex less acute, more squared; usually

smaller than male. Concolourous with male, but not as

dark. Light form more yellow than brown. Male genita-

lia. Figs 45-46. Valves and genital capsule as described

for genus. Vesica extending posteriorly from phallus

and about 1.4 x length of phallus; vesica with elongated

curved diverticulum on left projecting posteriorly, dorsal

subbasal diverticulum two lobed; spined diverticulum *%

toward apex of vesica. Female genitalia. Fig. 59. Ante-

Figs 43—48 (opposite page). 43. Herpetogramma fraxinalis sp. n. valves PYR 1301: Canada, ON, Wallacetown, Lake Erie,

15.vui.1958, F.L.S. 44. Herpetogramma fraxinalis sp. n. phallus PYR 1301: Canada, ON, Wallacetown, Lake Erie, 15.vii.1958,

FILS. 45. Herpetogramma thestealis valves PYR 556: Canada, QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°4.029’ W,

25.vi1.2008, Louis Handfield and Daniel Handfield. 46. Herpetogramma thestealis phallus PYR 556: Canada, QC, Mont

Rougemont, Rougemont, 45°28.026’ N, 73°4.029’ W, 25.vii.2008, Louis Handfield and Daniel Handfield. 47. Herpetogramma

pertextalis valves PYR 1315, United States, NY, Monroe Co., 7.viii.1949, C.P. Kimball. 48. Herpetogramma pertextalis phallus

PYR 1315, United States, NY, Monroe Co., 7.viil.1949, C.P. Kimball.

Bonn zoological Bulletin 70 (1): 173-199

©ZFMK

A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 187

188

rior part of corpus bursae with length 2.5 x width, 1.5 x

length of narrower posterior part, and 3 x length of duc-

tus bursae.

Note: We have submitted many specimens of both the

dark typical form and the light form to BOLD, males and

females, using a very dark male (see Fig. 17) to repre-

sent a “typical” H. thestealis. All sequences were found

to represent a single species, H. thestealis. We have also

compared males and females of the light form in BOLD

and with the images of the type specimens of abdomina-

lis and fissalis, considering also that the type specimens

are old and faded. The forewings of the two types have

the same large, dark subterminal area; the dark subter-

minal area is rounded toward the costa and pointed on

the veins, so the area near the postmedial and subtermi-

nal lines is much narrower near the wing apex, leaving a

small pale cell between the two lines. This is typical of

H. thestealis, whereas in H. aquilonalis sp. n., the other

species that has light forms, this area is pale yellowish

brown and not as large, nor as rounded, as in H. thestea-

lis, and the subterminal line in H. aquilonalis sp. n. is

usually straight near the apex, leaving a larger and lon-

ger pale cell between the two lines. In BOLD, samples

of the light and dark forms cluster together leaving no

doubt that the forms represent a single species. The large,

round, dark to very dark, subterminal area, wider at the

costa, and pointed on the veins typical of H. thestealis are

faded on the types of abdominalis and fissalis but these

distinguishing characters, even though faded, are present

so we conclude that these two names represent synonyms

of H. thestealis.

This is the only Canadian species of Herpetogramma

to have a white leucistic form, mostly in females, rarely

in males. BOLD data confirms that these leucistic spec-

imens are H. thestealis. These specimens have a large

round, black reniform spot on the forewing and on the

hindwing; this is the easiest way to identify them. We

have only seen one semi-melanic specimen.

Distribution. Herpetogramma thestealis occurs

from Eastern Canada (Nova Scotia westward through

southern Québec (as far north as Québec City [CNC]),

and southern Ontario to southern Manitoba. It oc-

curs in eastern and central United States as far south

as Florida. American records in BOLD are from North

Carolina and Tennessee. The species is listed from

as far west as British Columbia (Pohl et al. 2015),

and shown on Moths Photographers Group website

(https://mothphotographersgroup.msstate.edu; accessed

20.1x.2020) by dots and photographs from British Co-

lumbia and as far south as California; however, these

specimens are referrable to H. aquilonalis sp. n.; the

same is true for a specimen from Port Alberni, British

Columbia, shown in Bug Guide (accessed 20.1x.2020)

(https://bugguide.net/) that is also a worn H. aquilona-

lis sp. n.. Some specimens from British Columbia [Port

Alberni] of “thestealis” have been submitted to BOLD

Bonn zoological Bulletin 70 (1): 173-199

Louis Handfield & Daniel Handfield

and they sort out with H. aquilonalis sp. n., not H. thes-

tealis, these specimens are of a peculiar form of H. aq-

uilonalis sp. n.. In BOLD, there are more than 90 speci-

mens analysed from British Columbia and more than ten

from Washington State; none is H. thestealis, all being

H. aquilonalis sp. n.. Also, specimens from Alberta in the

E. H. Strickland Entomological Museum at the Universi-

ty of Alberta, Edmonton, which were identified as H. ab-

dominalis are referred to H. aquilonalis sp. n. and not

to H. thestealis (SEM [Danny Shpeley in litt. & photo.])

and those from Saskatchewan under H. thestealis are re-

ferred to H. aquilonalis sp. n. (BOLD), so no H. aqui-

lonalis sp. n. in Alberta and Saskatchewan. We conclude

that H. thestealis should be removed from lists of species

from areas west of Manitoba.

Biology. Herpetogramma thestealis appears to be

associated with woody plants such as Tilia [Tiliaceae|

and Corylus [Betulaceae] (Forbes 1923), Halesia caro-

lina [Styraceae] and Aralia racemosa |Araliaceae] (D.

Wagner, pers. comm. 2011) (see Handfield & Handfield

2011); in the USNM, only Celastrus scandens |Celastra-

ceae] is reported as a hostplant for H. thestealis. Other

hostplants listed by Solis (2010), needs verification. The

moth seems to prefer wet habitats, like bogs and wet for-

ests, being scarce in less mesic habitats.

Flight period. In eastern Canada, the moth is in flight

from early June to late August, with a peak from mid-Ju-

ly to early August. It is nocturnal and comes to light.

Herpetogramma pertextalis (Lederer, 1863) (801187,

MONA 5275)

Pl. 2, Figs 21-24 (adults); Pl. 5, Figs 47-48 (¢ gen.).

Synonyms: thesealis Zell., 1872 (Botis), gentilis Grote,

1883 (Botis) (Solis 2010) (Scholtens & Solis 2015).

Type material. One male lectotype designated by So-

lis (2010) from “Nordamerica” in the NHM, in Vienna,

Austria; it has a wingspan of 21.5 mm.

Remarks. This is the “true” pertextalis, which is

smaller and differently marked than its northern counter-

part (H. aquilonalis sp. n.). All pyraloid species named

by Lederer are from the southern United States (Texas

and Florida). Some of his southern species occur in the

North, but Lederer’s species that occur in the North, also

occur in the South. This suggests that the type locality

is somewhere in the southern United States, and more

particularly in Texas or northern Florida, and not from

northern United States or Canada. During the years 1850

—1900, the city of Jacksonville was the commercial center

of Florida, and an important city for business with Europe

(Gannon 2013). It is probable that Lederer received his

specimens from Texas, Florida, or elsewhere in southern

United States via Jacksonville. Consequently, the name

pertextalis would not apply to its northern counterpart.

Solis (2010) mentions having seen specimens of per-

textalis in the USNM from Texas and Illinois, under the

©ZFMK

A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 189

name thesealis Zell., 1872, a synonym, with specimens

from Texas and Massachusetts (2 ¢¢ and 1 Q) (Solis

2010). We also have documented it in northern Florida

(Appalachicola National Forest, Liberty Co., Florida,

29.v.1993, Florida State Collection of Arthropods, Flori-

da Museum of Natural History / McGuire Center, James

Hayden, pers. comm.). So, we believe that the type local-

ity of pertextalis Led. is Texas or Florida. As most of the

specimens of Lederer were from Texas, the type locality

is most probably Texas, the specimens being sent to Ger-

many through the port of Jacksonville, Florida.

Diagnosis. Herpetogramma pertextalis has been long

confused with the species we describe above as H. aqui-

lonalis sp. n.. It is a well-marked species, smaller than

H. aquilonalis sp. n., with a wingspan of 21.5—23.0 mm

(males) and 23—24 mm (females) compared to 25—27 mm

(males) and 23—26 mm (females) for H. aquilonalis sp. n..

Solis (2010: fig. 13) illustrated a female of H. pertextalis.

Redescription. Adults. There is a dimorphism in the

species, but not as pronounced as in H. aquilonalis sp. n.,

the female being larger and more boldly marked than

the male. The wingspan of the male is 21.5—23.0 mm,

of the female 23—24 mm. Male (Figs 21—22): head, pal-

pi, thorax, and abdomen concolourous with the wings.

Abdomen with each segment marked by a small white

line (yellowish in dark specimens). Forewings cream

with gray band on costa from wing base to postmedial

line, apex acute, not pointed; fringes white, terminal line

dark brown, at base of pale-brown fringe; subterminal

area, between dentate subterminal line and sinuate post-

medial line cream coloured. Postmedial line dark gray,

sharply defined, incurved from costa to M2 vein, then

bent outwardly to form three points on veins, then turn-

ing inwardly up a position below the reniform spot, then

extending straight to posterior margin of wing. Ante-

medial line dark gray, slightly sinuate, extending from

forewing costa proximal to orbicular spot, projecting

downward and outward to a position on hind margin of

wing below position of orbicular spot. No basal dash but

with an oblique gray basal line near base. Orbicular spot

a grayish dot; reniform spot a rectangular patch, gray

with innerside pale. Area between orbicular and reni-

form spots cream coloured. Veins lightly marked by gray

streaks. Hindwing concolourous with forewing; postme-

dial line wavy with an outward bend at middle of wing,

pointed on veins, as on forewing. Discal spot a gray bar

on creamy-white background. Underside pale gray, all

lines visible, orbicular and reniform spots pale, but visi-

ble, and pale creamy-white area between them. Female

(Figs 23—24). More boldly marked than male; ground co-

lour typically more yellowish white than creamy white,

lines more crisply marked (including costa); postmedial

and antemedial lines converge at hind margin of wing to

form a V or U in many specimens; orbicular spot a round

circle with gray margins and yellow center; reniform spot

rectangular, with gray margins and yellow center. Dis-

Bonn zoological Bulletin 70 (1): 173-199

cal spot of hindwing more boldly marked than in male.

Ground colour of both wings creamy white except for

area between wing margin and submarginal line, which

is pale yellow. Underside as in male but more bodly

marked. Male genitalia. Figs 47-48. Valves and genital

capsule as described for genus. Vesica short, extending

posteriorly from phallus and about 0.66 x length of phal-

lus; vesica with smaller rounded diverticulum on left, as

well as an elongated, curved, multilobed diverticulum

projecting posteriorly; dorsal diverticulum '4 from base

and dorsolateral; spined diverticulum *%4 toward apex of

vesica. Female genitalia. No illustration available.

Distribution. Herpetogramma pertextalis is only

known from extreme Southern Québec (1 <4 from

Philipsburg, 16.vii.1974 [CNC], | ¢ from Trousers Lake,

1.viii.2011 [DH]), 1 4 from Franklin [Réserve écologique

du Pin-Rigide], 8.x.2017 [DH]), and from southern On-

tario (2 3 and 1 @ from Port Franks, Lambton Co.,

18.ix.2014 (4), 4.ix.2015 (4), 1.ix.2016 (Q), K. H. Stead

[CNC], Simcoe, 22. vii.1939, one 4 [CNC], Thousand Is-

lands National Park [shoreline transitional area, marsh],

4 1x.2014 (BOLD), Wellington Co., Puslinch Township,

concession 11 / Hume road, 7.x.2005, Paul D. N. He-

bert (BOLD), Windsor, Ojibway Prairie Provincial Park,

3.1x.2014 (BOLD), and then from New York and Mas-

sachusetts to northern Florida along the Atlantic Coast,

including rivers and lake shores in southeastern United

States and westward to Illinois, Oklahoma, and Texas

(Solis 2010). With more than 90 specimens analysed in

BOLD, the presence of H. pertextalis in British Colum-

bia (Pohl et al. 2015) is clearly an error and the specimens

are H. aquilonalis sp. n. Herpetogramma pertextalis is a

specialist of mesic habitats especially along the Atlantic

coast; it is absent from the Appalachian Mountain range.

In Ontario, it is likely found in Carolinian forests, but it is

not known if the specimens from Ontario were residents

or migrants. Powell et al. (2009) list H. pertextalis as be-

ing present in western North America, but these speci-

mens are more likely referable to H. aquilonalis. sp. n.

Biology. In Maryland, Larry Line (see Maryland

Moths, visited 20.ix.2020) reared a dozen larvae of Her-

petogramma pertextalis found at the beginning of June

“tying conspicuous tubular shelters on terminal shoots

of Clethra alnifolia L. (Clethraceae) in the Patuxent

Wildlife Research Center and in the Millington WMA

[Wildlife Management Area].” Clethra alnifolia is found

along the Atlantic Coastal Plain from Nova Scotia and

Maine southward to northern Florida, and westward

along the Gulf Coast to Louisiana, but does not occur

in the Appalachian Mountains. It is very sporadic in oc-

currence to the west of the Appalachians (northern New

York, western Pennsylvania, Tennessee, etc.). This also

represents the range of H. pertextalis with western re-

cords from Kentucky, Illinois and Oklahoma. The moth

has other hostplants and it could use Clethra acuminata

(Clethraceae) as this plant is found in mountainous ar-

©ZFMK

190 Louis Handfield & Daniel Handfield

eas of Tennessee (incl. Sevier, where the moth has been

found [Mitchell & Hespenheide 1967]), Kentucky, and

West Virginia. Larvae have been found or reared on other

plants like Rubus sp. (Rosaceae) (in West Virginia), and

Plantago lanceolata (Plantaginaceae) (in Connecticut)

(David L. Wagner, pers. comm.). One specimen in the

Murtfeld collection in the CUIC has been reared on Er-

igeron canadensis (Asteraceae) in New York in 1899, but

this is a questionable old record. Other hostplants listed

by Solis (2010: 460) based on specimens in the USNM

are not included here because the material has not been

positively identified. In Québec, the known specimens

have been caught on lake shorelines (Trousers lake and

Philipsburg) and a humid habitat (Franklin, Réserve

écologique du Pin-Rigide); these specimens are in good

condition, but not freshly emerged, and are singletons, so

they could have flown from C/lethra populations in near-

by New York State (Essex Co., Warren Co. along Lake

Champlain [New York Flora Atlas, visited 20.1x.2020])

(http://newyork.plantatlas.usf.edu/) as they do not seem

to represent a resident population. Concerning the speci-

mens from Port Franks, Lambton Co., Ontario, the male

has not been freshly collected, only the female is in good

condition; the dates are late in the season and are from

the Lake Huron shoreline (near Pinery Provincial Park).

The specimen from Simcoe, Ontario, is in good condi-

tion. The Ontario specimens likely represent strays, con-

sidering that the host plant (Clethra sp.) is not present in

Canada. It seems to be a moth of shorelines (rivers, lakes,

etc.) and especially along the Atlantic Coastal Plain in

eastern United States.

Flight period. In Canada, the moth has been found

from the 16" of July to 8" of October. It 1s probably a

wandering species, at least in its northern distribution

(Ontario and Québec), as there are only a few scattered

records. The moth is nocturnal and comes to light.

Note. The specimens identified as H. pertextalis by

Landry (1993) are in fact H. nymphalis sp. n. and H. aq-

uilonalis sp. n.

Herpetogramma nymphalis sp. n.

urn: lsid:zoobank.org:act:41E47FA9-D48 1-44 0E-BA65-193886B7AA82

Pl. 3, Figs 25-28 (adults); Pl. 6, Figs 49-50 (@ gen.);

Pl. 8, Fig. 60 (2 gen.).

Type material. Holotype <. Canada: Québec: Gatin-

eau Park, King Mountain [45°29’33” N, 75°52’42” W.],

14.vi.1989 (emerging date, reared on Pedicula-

ris canadensis), Bernard Landry. CNC. Bold CNC-

LEP00089832.

Paratypes. Canada: Québec: Gatineau Park, King

Mountain, reared on Pedicularis canadensis), Ber-

nard Landry, 16.vii.1989 [emerging date], 1 9 (CNC),

19.vi.1989 [emerging date], 1 4 (CNC); Canada: Mani-

toba: Manitoba Tall Grass Prairie Reserve, Nature Con-

servancy block W[est] of Gardenton, 19.vii.2016, Jean-

Francois Landry and Vazrick Nazari, 3 64 (CNC).

Etymology. The species name is Latin derived from

the word Nympha (plural Nymphae), the small deities

of forests, mountains and rivers, in reference to the little

luminous Nymphs haunting the oak and juniper woods

at night on the top of King mountain, in Gatineau Park,

Québec, according to an old legend to that effect (Lau-

rent Le Sage, pers. comm.).

Diagnosis. Herpetogramma nymphalis sp. n. was con-

fused in collections under the name H. thestealis due to

its similarity with that species, even if it is much smaller

(wingspan: 26 mm for H. nymphalis sp. n. and more than

30 mm [very rarely 29 mm for females] for H. thestea-

lis). It looks like a small orange-brown H. thestealis.

Description. Adult. Head, palpi, thorax, tegulae, and

abdomen concolourous with rusty-brown ground colour

of forewing. Each segment of abdomen marked by a thin

white line. Wingspan 26 mm. Forewing: apex acute, not

round. Fringe: wide, pale brown, marked with darker

brown on veins. Terminal line dark brown. Subterminal

area between terminal and submarginal lines wide, rusty

brown; subterminal line pointed on veins, deeply dentate,

wide at anal angle, then a little narrower through middle,

then wide toward top of wing, leaving a small whitish cell

between it and postmedial line; small cell also typical of

H. thestealis,; area between three outward pointed cells

of the postmedial and subterminal lines narrow. Postme-

dial line a dark brown line from costa to M2 vein, then

bent outwardly toward subterminal line, nearly touching

it, pointed (dentate) on three cells, then bent inwardly to

position below reniform spot, then turning downward to

posterior margin of wing. Antemedial line also a dark

brown line, sinuous, extending from costa to posterior

margin of forewing, but well separated from postmedial

line. Reniform spot rectangular, dark brown or represent-

ed by two parallel dark lines, with light brown inside,

orbicular spot dark, rounded. Area between orbicular

and reniform spots creamy white, distinct. Area between

Figs 49-54 (opposite page). 49. Herpetogramma nymphalis sp. n. valves PYR 1308: Canada, MB, Manitoba Tall Grass Prairie

Preserve Nature Conservancy Block, 294 m, 19.vii.2007, J.F. Landry and V. Nazari. 50. Herpetogramma nymphalis sp. n. phallus

PYR 1308: Canada, MB, Manitoba Tall Grass Prairie Preserve Nature Conservancy Block, 294 m, 19.vii.2007, J.F. Landry and V.

Nazari. 51. Herpetogramma aeglealis valves PYR 555: Canada, QC, Mont Rougemont, Rougemont, 45°28.026’N, 73°4.029’ W,

25.vi1.2008, Louis and Daniel Handfield. 52. Herpetogramma aeglealis phallus PYR 555: Canada, QC, Mont Rougemont,

Rougemont, 45°28.026’ N, 73°4.029’ W, 25.vii.2008, Louis and Daniel Handfield. 53. Herpetogramma sphingealis valves PYR

551: Canada, QC, Mont Rougemont, Rougemont, 45°28.026’N, 73°4.029’ W, 25.vii1.2008, Louis and Daniel Handfield. 54. Her-

petogramma sphingealis phallus PYR 553: Canada, QC, Mont Rougemont, Rougemont, 45°28.026’ N, 73°4.029’ W, 25.vii.2008,

Louis and Daniel Handfield.

Bonn zoological Bulletin 70 (1): 173-199

©ZFMK

A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 191

192 Louis Handfield & Daniel Handfield

subterminal and postmedial lines lightly coloured as is

cell between reniform spot and postmedial line. Ground

colour light rusty brown (dirty white with rusty brown

scales in some specimens [Manitoba]). Costa dark from

base of wing to postmedial line; in paler specimens, cos-

tal area pale between subterminal and postmedial lines,

but still dark brown between postmedial line and wing

base. Hindwing light, ground colour pale yellowish ex-

cept for subterminal area that is dark, but not as dark as on

forewing. Discal spot a dark bar. Postmedial line brown,

sinuous as on forewing. Underside pale, but with all lines

and spots visible including dark band between terminal

and subterminal lines. Without sexual dimorphism.

Specimens that have flown a lot have the same lines,

but the colours are less pronounced with the ground

colour of the wings much paler; however, on the fore-

wing costa, the width of the terminal area is wide, almost

reaching the postmedial line, leaving the subterminal area

very narrow on the costa. Male genitalia. Figs 49-50.

Valves and genital capsule as described for genus. Vesica

extending posteriorly from phallus and similar in length

to phallus; distance between end of phallus and base of

dorsal diverticulum 0.25—0.3x length of phallus; vesica

with gourd-shaped diverticulum on right, apical narrow

part curved posteriorly; spined diverticulum 2 way to-

ward apex of vesica. Female genitalia. Fig. 60. Large

anterior part of corpus bursae with length 2.8 =< width,

2.8 x length of narrower posterior part, and 2.8 x length

of ductus bursae.

Distribution. Herpetogramma nymphalis sp. n. is

known from specimens from Québec (Gatineau Park

[King mountain], and Montréal [on Mount Royal]), On-

tario (Lambton Co., Port Franks) and Manitoba (Garden-

ton) (all in BOLD and CNC).

Biology. The specimens from Gatineau Park were

reared on Pedicularis canadensis (Orobanchaceae),

an unusual hostplants for Herpetogramma (see Landry

1993; identified as H. pertextalis), this hostplant has

also been found in the area where the specimens were

found in Manitoba (see Rousseau 1974 for Québec, and

Scoggan 1957 for Manitoba). We also know that Pedic-

ularis canadensis was present on Mount Royal in Mon-

tréal at least until 1987 (see Marineau, 2008: 112); it is

also present on Saint-Hilaire mountain (see the web site

“Végétaux vasculaires du mont Saint-Hilaire,” visited

20.1x.2020: _ https://gault.mcgill.ca/workspace/uploads/fich-

iers/vascularplant.pdf ) but so far the moth has not been

found on Saint-Hilaire mountain or on Rougemont

mountain. According to Rousseau (1974), Pedicularis

canadensis is rare and localized in southern Québec and

is mostly present in rocky and mountainous woodlands,

including maple groves. Is Pedicularis canadensis the

only hostplant of that species? Probably, but this remains

unproven; more data are needed. It is a moth of xeric

woods, especially in mountainous and rocky places in

Québec.

Bonn zoological Bulletin 70 (1): 173-199

Flight period. The moth should be searched for in July

in suitable areas from New Brunswick (see Hinds 2000),

southern Québec (see Rousseau, 1974), Ontario (see On-

tario Wildflowers, site visited 20.1x.2020) and southeast-

ern Manitoba (see Scoggan 1957), in the native range of

Pedicularis canadensis in Canada. The scarcity of spec-

imens prevents us from giving precise information about

the habits of the moth, but it is probably nocturnal and

comes to light like other Herpetogramma.

Note: All specimens reared by Dr Bernard Landry

(Landry 1993) on Pedicularis canadensis are in the CNC,

have been submitted to BOLD, reviewed and re-identi-

fied as being H. nymphalis sp. n. for the most part, with

a few being H. aquilonalis sp. n. (see above, and Solis

2010 under H. abdominalis).

Herpetogramma aeglealis (Walker, 1859) (801191,

MONA 5280)

Pl. 3, Figs 29-32 (adults); Pl. 6, Figs 51-52 (4 gen.);

Pl. 8, Fig. 61 (& gen.).

Synonym: quinquelinealis (Grt., 1875) (Botis) (see

Solis 2010) (Scholtens & Solis 2015).

Type material. One ¢ from the “United States” in the

BMNH (Solis 2010).

Diagnosis This is probably the best known of all East-

ern North American Herpetogramma. It is common and

easily identified even though it is a variable species with

a typical form, which is pale gray with a yellowish hue

on the forewing. Other forms have a light-gray forewing

ground colour. There is also a dark form (more common

in females, rare in males) that could be confused with

H. sphingealis. Wingspan 29-33 mm (male), 27-31 mm

(female), showing a sexual dimorphism, females having

a more squared and shorter forewing than males, but with

the same colouration and lines in both sexes. Solis (2010:

figs 1, 3) illustrated a typical H. aeglealis (fig. 1) and a

darker form (fig. 3).

Redescription. Adult. It has a wing pattern typical of

Herpetogramma. Generally, head, palpi, thorax, and ab-

domen are concolourous with the wings. The forewing is

elongate with a slightly acute apex in the male, but more

squared in the female, therefore with a shorter wing-

spread; the forewing fringe is pale brown or checkered

in the pale form, and dark gray brown in the dark form,

except the lower part of the fringe is white in both forms

(occasionally the white area is absent); the terminal line

is dark gray brown, slightly darker to much darker than

the fringe and subterminal area; the postmedial line ex-

tends obliquely from the costa to the second medial vein

at the level of the lower edge of reniform spot where it

curves in an outward arc, then curves in an inward arc to

the lower edge of the wing; the reniform spot is a dark

patch more or less rectangular, or curved and crescentic;

the orbicular spot is dark and rounded or square, with a

white area in the cell between the two spots; the ante-

©ZFMK

A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 193

Figs 55-58. 55. Herpetogramma phaeopteralis female PYR 1310: Bermuda, 8.xi1.1951, W. and E. Mason. 56. Herpetogramma

theseusalis female PYR 1314: United States, FL, Stemper, no date, G. Krautwurm. 57. Herpetogramma aquilonalis sp. n. female

PYR 1294: Canada, CAN, QC, Mont Rougemont, Chemin vers la croix, Rougemont, 27.vii.2008, Louis Handfield. 58. Herpeto-

gramma fraxinalis sp. n. female PYR 1305: Canada, QC, Mont Rougemont, Chemin vers la croix, Rougemont, 27.vi1.2008, Louis

Handfield.

194 Louis Handfield & Daniel Handfield

medial and postmedial lines are dark gray brown, con-

trasting in pale forms, less so in dark forms, frequently

with some pale shading on one or both sides of the lower

part of the line. There is no basal dash. The hindwing is

usually paler than the forewing with the antemedial and

postmedial lines dark gray brown, the discal spot is elon-

gated, and the veins usually are dark and contrast with

the paler ground colour; in some forms the subterminal

area 1s contrastingly darker than the general ground co-

lour; the terminal line is dark gray brown and contrasting.

Male genitalia. Figs 51-52. Valves and genital capsule

as described for genus. Phallus 8.0—8.8 mm long; vesica

extending posteriorly from phallus and similar in length

to phallus; vesica with gourd-shaped diverticulum on

right smaller than that of H. nymphalis sp. n.; narrow

apical part of diverticulum curved posteriorly; spined

diverticulum 2 way toward apex of vesica. Female gen-

italia. Fig. 61. Anterior part of corpus bursae with length

2 x width, 3 x length of narrower posterior part, and 3 x

length of ductus bursae.

Distribution. Herpetogramma aeglealis is known in

Canada from New Brunswick westward through south-

ern Québec to southern Ontario. In the United States, it

occurs from Maine westward to Wisconsin and Illinois

and southward to Florida and Texas.

Biology. Herpetogramma aeglealis is a leaf tyer mak-

ing a shelter by folding and tying one or several leaves of

its host plant and is probably a general feeder, but most

records are from “ferns” [Polypodiales] (D. Wagner, pers.

comm. ), like Woodwardia |Polypodiaceae] (in Sweet Air,

Baltimore Co., Maryland, Larry Line, pers. comm.), and

Osmunda claytoniana [Osmundaceae] (in Maryland, see

https://marylandbiodiversity.com/, visited 20.1x.2020). It

has also been reared on a variety of herbaceous plants

including Asarum canadense [Aristolochiaceae] (West

Virginia, Bug Guide.net, visited 20.1x.2020), pokeweed

[Phytolaccaceae] (Forbes 1923); specimens of H. aegle-

alis reared have been found in the USNM on Solidago

sp. [Asteraceae] and one specimen reared on Mayapple

(Podophyllum peltatum) [Berberidaceae] (W.W. Judd,

London, Ontario, 24.VI.1953) (see Judd 1954). Also on

Solidago flexicaulis and S. bicolor (Asteraceae) (Tom-

kins Co., New York [CUIC]). In southeastern Canada,

where H. aeglealis is common, Asarum canadense, Os-

munda claytoniana, and Woodwardia virginica usually

are present. For Québec (see Rousseau 1972), Asarum

canadense is most common of these three host plants, es-

pecially in maple groves (Rousseau, 1974). It is a moth of

mesic woods, open boggy habitats, humid maple groves,

and maple groves on mountain slopes.

Flight period. It is nocturnal and comes freely to light.

According to Joachim Lafrance (personal notes taken

from 1965 to 1969 in Sainte-Clotilde, Québec) the moth

flies from the beginning of the night up to three o’clock

in the morning.

Bonn zoological Bulletin 70 (1): 173-199

Note. It is a variable species, some specimens first ap-

pearing in June are pale, with forewings looking paler

and having orangish to pinkish hue; some of these speci-

mens have been submitted to BOLD and, without doubt,

they are all H. aeglealis. The dark form (male: Fig. 31,

female: Fig. 32) is easy to distinguish from H. sphingea-

lis by the smaller wingspan, and the postmedial line has

pale outside the line in H. aeglealis. That dark form is

rare in males, commoner in females.

Remarks: Specimens reared by Dr Bernard Landry

on Pedicularis canadensis were in fact Herpetogram-

ma nymphalis sp. n. and H. aquilonalis sp. n., and not

H. pertextalis as identified by Landry (1993).

Herpetogramma sphingealis Louis Handfield & Daniel

Handfield, 2011 (801192, MONA 5279,1)

Pl. 3, Figs 33-34 (adults); Pl. 6, Figs 53-54 (¢ gen.);

Pl. 8, Fig. 62 (2 gen.).

Synonym: H. aeg/ealis auct. (in part).

Type material. | ¢ from the mountain of Rougemont

[45°28°026” N, 73°04’029” W.], Rougemont, Québec,

Canada (in CNC) (Handfield & Handfield 2011).

Diagnosis. Adult male (Fig. 33). Wingspan 34—

37 mm. Upperside of head, palpi (except tufts at base),

prothoracic collar, and upperside of thorax and abdomen,

concolourous, chocolate brown, fading to a slightly paler

brown with age; antenna filiform, finely ciliate on under-

side, each segment concolourous dorsally with upper sur-

face of head; upperside of abdomen concolourous with

wings, except for posterior brownish-yellow tuft cover-

ing valvae; maxillary palpi, legs, and underside of head,

thorax, abdomen white, being a beautiful flashing white

in living specimens; dark brown band (nearly width of

eye on side of head) and including the top of the maxil-

lary palpi and chaetosema, gives head appearance of hav-

ing a longitudinal mask; eye black with greenish bands.

Forewing chocolate brown, concolourous with upper-

side of head, thorax, abdomen, fading slightly to a pal-

er brown with age; apex acutely angled; postmedial line

slightly zigzagging from costa to halfway down wing,

then turning abruptly inward at nearly right angle to posi-

tion below reniform spot before turning downwards and

zigzagging to posterior margin of wing; no other lines

visible (except sometimes a vague trace of an outward

curved antemedial line); other marks on forewing are

a white patch on fringe at anal angle, two black dots at

position of orbicular and the reniform spots, a cream-co-

loured rectangular patch between two black dots, and a

dark terminal line at base of fringe; fringe concolourous

with wing except for white anal patch and slightly dark-

er shading on veins. Hindwing concolourous with fore-

wing, including fringe; fringe with dirty white shading at

anal angle; transverse lines not visible or barely evident;

discal spot black, rounded (more elongated in H. aeglea-

lis); a creamy-white patch towards upper margin of wing

©ZFMK

A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 195

Figs 59-62. 59. Herpetogramma thestealis female PYR 762: Canada, BC, Vancouver, Stanley Park, 49.063° N, 123.1528° W,

24.vi1.2007, A. Li. 60. Herpetogramma nymphalis sp. n. female PYR 1302: Canada, QC, Gatineau, Gatineau Park, Mont King,

24.v.1989, B. Landry. 61. Herpetogramma aeglealis female PYR 546: Canada, QC, Mont-St-Hilaire, 45°31.758’ N, 73°10.723’ W,

5.vii.2008, Louis Handfield. 62. Herpetogramma sphingealis female PYR 550: Canada, QC, Otterburn Park, Les Bosquets Hudon,

5.vil1.2006, Louis Handfield.

196

base (usually hidden by overlapping posterior margin of

forewing). Fringes of all wings even, not crenate. Under-

side of all wings, including fringes, a dark grey, fading

to a paler whitish grey towards wing base with white at

base near pure white thorax, especially along inner mar-

gin of hindwing; small creamy patch between orbicular

and reniform dots on forewing. Discal spot on hindwing

often barely evident. Legs mainly pure white, sometimes

with brownish scales on upperside of anterior and poste-

rior legs. Adult female (Fig. 34). Wingspan 31-34 mm

(H. aeglealis 27-31 mm). Essentially same as for male

except forewing larger, less elongated (more squared at

apex); colour of wings a pale chocolate brown, transverse

lines more contrasting. Hindwing as for male, but colour

fading near base, sometimes showing a vague trace of

a postmedial line (Handfield & Handfield 2011). Solis

(2010, fig. 2) illustrated a male of H. sphingealis under

the name H. aeglealis (H. sphingealis was not yet de-

scribed at that time). Male genitalia. Figs 53-54. Valves

and genital capsule as described for genus. Phallus

10.0-10.6 mm long, % x longer than vesica; vesica with

gourd-shaped diverticulum on right with narrow apical

part of diverticulum wider than for H. aeglealis; spined

diverticulum 2 way toward apex of vesica. Female gen-

italia. Fig. 62. Anterior part of corpus bursae with length

2 x width, 3 x length of narrower posterior part, and 3 x

length of ductus bursae.

Distribution. The distribution of Herpetogramma

sphingealis apparently covers the distribution of its

only host plant in North America, although there has

not been enough sampling in the Maritime Provinces

to confirm this. The moth is known from southern Qué-

bec and southern Ontario (Wilson Tract, Norfolk Co.,

25.vii.2008) in Canada [see www.ontariomoths.com/

herpetogramma-sphingealis/]; it has not yet been col-

lected in eastern Ontario. Christmas fern is common in

some areas of Eastern Ontario (e.g., Larose Forest near

Ottawa), but up to 2020 no H. sphingealis has been seen

or collected there (Diane Lepage, comm. pers.). In the

United States, it is known from all Eastern United States

from Maine [River Point Bird Observatory], New Hamp-

shire, Vermont, New York to Northern Florida (Torreya

State Park, Liberty Co., Florida [James Hayden, in Iitt.]),

and eastern parts of Central United States from Michi-

gan, Minnesota to Louisiana. It is a moth occurring in the

darkest areas of rich xeric forests, with maples and oaks,

especially rocky, hilly, maple groves where Christmas

fern occurs commonly (Handfield & Handfield 2011).

Biology. As far as known the host plant is exclusively

Polystichum acrostichoides (Dryopteridaceae) (Ruehl-

mann et al. 1988 [under H. aeglealis|, Handfield & Hand-

field 2011); the larva makes a shelter like a round hut by

folding and tying several leaves generally at the tip of the

fern. It is the only member of Canadian Herpetogramma

proven to be specialized on its hostplant.

Bonn zoological Bulletin 70 (1): 173-199

Louis Handfield & Daniel Handfield

Flight Period. The moth is nocturnal, flying as soon

as the dusk is dying, and comes to light. On the slopes of

Mount Rougemont (Québec), the moth is commoner be-

fore the full moon of July, rarer during the full moon, and

common again after the full moon. Could it be due to its

dark colouring, it is much more visible for owls and bats

and other birds, so the moth is not flying much during the

full moon or is it only due to interference between the

moon and the artificial light? Based on our experience,

the moth is not flying much during that period even if

moonrise is later in the night; anyway it does not fly after

midnight. It is one of the most striking and beautiful Her-

petogramma to see flying and coming to lights.

Note on Herpetogramma fluctuosalis (Lederer, 1863)

Herpetogramma fluctuosalis (Lederer, 1863) (801195,

MONA 5244) was cited from Québec by Louis Hand-

field (1997), on the basis of one specimen from Sainte-

Anne-de-Bellevue (Québec) in the collection of the Ly-

man Entomological Museum (LEM) identified under

that name. This data led Gregory H. Pohl et al. (2018)

to erroneously include that species from Québec in their

checklist of the Lepidoptera of Canada and Alaska. The

specimen in question is in fact a Parapoynx allionealis

(WIk., 1859) (Pyralidae: Acentropinae) (800739, MONA

4764) misidentified. Consequently, H. fluctuosalis has to

be removed from the lists of Lepidoptera of Québec and

of Canada.

Herpetogramma fluctuosalis is present from Mary-

land to Florida and Texas (Solis 2010), including Geor-

gia, Missouri, Oklahoma, South Carolina and Tennessee

(BugGuide, www.bugguide.net, visited 30.1x.2020). It

feeds on Jpomoea batatas (Convolvulaceae) (Solis 2010).

Conclusion

Our paper presents the first systematic revision of the

highly variable Herpetogramma species from Canada,

with description of three new species. Vesica characters

of the male genitalia were significant in distinguishing

species morphologically. We did not include distribution

maps in this paper, as the paucity of data for nearly all

Canadian Provinces and Territories precludes the utility

of such maps. Indeed, with the extensive data available

from Ontario and Québec, maps would be misleading

and would suggest that Ontario and Québec are the world

capital of the genus Herpetogramma! Undoubtedly,

many questions remain unresolved, especially concern-

ing hostplants, but the fact is that the taxonomy of this

genus has always been a real puzzle. Now we hope that

other researchers will follow up with a revision of Herpe-

togramma species of the United States. With the present

work, the total number of Herpetogramma species for

North America is thirteen, but we expect that additional

species remain to be found. Vesica characters of the male

©ZFMK

A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 197

genitalia were significant in distinguishing species mor-

phologically.

Acknowledgements. First, thanks are due to Dr J. Donald La-

fontaine for his constant support and encouragements since the

beginning of this project and his help in finding types in the

British Museum, and data in the USNM, preparation of spec-

imens for BOLD, and preparation of genitalic dissections; to

Jocelyn Gill for her preparation of the figures of specimens and

genitalic armatures; to Dr Jean-Francois Landry for his pre-

cious contribution to the preparation of the barcode tree, his

helpful comments, and for sampling of the specimens for DNA

barcoding and search of data at the USNM; to Dr Paul D.N.

Hebert and the Canadian Centre for DNA Barcoding (“BOLD”)

for his constant support and the barcoding of specimens of Her-

petogramma, and permission to use the sequence analysis; to

Dr David L. Wagner for providing his data on host plants and

specimens; to Dr Alma Solis (USNM) for providing the pho-

tograph and data of the Lederer type in the Vienna Museum

and for providing specimens for study; to Dr James Hayden

(FSCA) for providing data and photographs of specimens in the

Florida State Collection of Arthropods, Gainesville, Florida; to

Dr Kevin Tuck (NHMUK) for finding the type of H. abdomi-

nalis Zell. in the British Museum of Natural History, and his

permission to use photographs and data; to Suzanne Rab Green

(AMNH) for her support and help in finding Herpetogramma

data in the AMNH, New York; to Sarah Lee (UWOC) for her

help in finding Herpetogramma specimens from Dr W.W. Judd

in the collection of the Department of Biology, University of

Western Ontario, London, Ontario; to Dr Jason J. Dombroskie

(CUIC), for his help and assistance when the authors visited the

Cornell University Insect Collection Cornell University, Ithaca,

New York, and further helpful comments; to Suzanne Fauteux

for her constant support, the reading of the manuscript and her

helpful comments; to Norman Handfield (Mont-Saint-Hilaire)

for his support and providing Herpetogramma data from his

collection; to Alain Charpentier (Saint-Hyacinthe and Maria),

to Léo-Paul Landry (Saint-Mathieu-du-Parc), to Normand

Juneau (Saint-Maurice), to Claudette Cormier (Canton-Trem-

blay), to Eric Rassart (Brossard), to Kenneth (Ken) Stead

(Port Franks, Ontario), to Tommy Thouin (Joliette), to Carle

Bélanger (Havre-Saint-Pierre), to Daniel Abraham and Nath-

alie Michel (St-Pierre, Iles-St-Pierre-et-Miquelon, France),

all for providing data and specimens; to Lucie d’Amours and

Sandrine Papageorges (Havre-aux-Maisons, Iles-de-la-Made-

leine, Québec) for collecting Herpetogramma on the Magdalen

Islands; to Louise Cloutier (UdeM) for permitting access to the

Ouellet-Robert Collection (Université de Montréal); to Dr Ter-

ry Wheeler (7) and Dr Stéphanie Boucher (LEM) for permit-

ting access to the Lyman Entomological Museum (McGill Uni-

versity, Sainte-Anne-de-Bellevue); and also to Dr Stéphanie

Boucher who searched for and found the specimen identified as

H. fluctuosalis and for taking photographs and notes; to Diane

Lepage (St. Albert, Ontario) for permitting to use her photo-

graphs of living specimens and for her search for H. sphingealis

in Forét Larose and around in the Ottawa area; to Danny Shpe-

ley (UASM), assistant curator (E. H. Strickland Entomological

Museum, University of Alberta, Edmonton), for taking pho-

tographs of the Herpetogramma specimens in the Strickland

Entomological Museum, University of Alberta, Edmonton; to

Laurent Le Sage (7) (Aylmer) for transmitting the story about

the little nymphs haunting at night the top of King Mountain, in

Bonn zoological Bulletin 70 (1): 173-199

Gatineau Park; and to Théo Léger and one anonymous reviewer

for their helpful comments to improve the manuscript.

REFERENCES

Adams SA, Morse DH (2014) Condition-dependent mate

choice of a parasitoid wasp in the field. Animal Behaviour

88: 225-232

Allyson S (1984) Description of last-instar larvae of 22 spe-

cies of North American Spilomelini (Lepidoptera: Pyralidae:

Pyraustinae) with a key to species. The Canadian Entomolo-

gist 116 (10): 1301-1334

Bae Y-S, Byun B-K, Paek M-K (2008) Pyralid Moths of Ko-

rea (Lepidoptera: Pyraloidea). Korea National Arboretum,

Seoul, Korea

Covell CV jr (1984) A Field Guide to the Moths of Eastern

North America. Houghton Mifflin Company, Boston

Forbes WTM (1923) The Lepidoptera of New York and Neigh-

boring States. Cornell University Agricultural Experiment

Station, Mem 68, Ithaca, New York

Gannon M (2013) History of Florida. University Press of Flor-

ida, Gainesville, Florida

Grote AR (1873) XI. Kleiner Beitrag zur Kenntniss einiger

Nordamerikanischer Lepidoptera. Bulletin of the Buffalo So-

ciety of Natural Sciences 1: 168-174

Grote AR (1882) North American moths, with a preliminary

catalogue of the species of Hadena and Polia. Bulletin of

the Geological and Geographic Survey of the Territories 6

(QE 25 7=277

Guillermet Ch (2009) Les Hétéroceéres ou papillons de nuit de

Vile de La Réunion vol 3 Famille des Pyralidae et Crambi-

dae. La Réunion

Handfield L, Handfield D (2011) A new species of Herpeto-

gramma (Lepidoptera, Crambidae, Spilomelinae) from east-

ern North America. ZooKeys 149: 5-15

Handfield L (1997) Liste des Lépidopteres du Québec et du La-

brador. Fabreries Suppl 7: 1-155

Heppner JB (2003) Lepidoptera of Florida. Part 1. Introduc-

tion and Catalog. Arthropods of Florida and Neighboring

Land Areas vol. 17. Florida Department of Agriculture and

Consumer Services, Division of Plant Industry, Gainesville,

Florida

Hinds HH (2000) Flora of New Brunswick. University of New

Brunswick, Fredericton, New Brunswick

Holland WJ (1903) The Moth Book. Doubleday, Page & Com-

pany, New York

Judd WW (1954) Four species of leaf-tying moths and their

dipterous parasites reared from mayapple, Podophyllum pel-

tatum L. Transactions of the American Microscopical Soci-

ety 73 (4): 401-404

Kimball CP (1965) The Lepidoptera of Florida an annotated

checklist. Arthropods of Florida and Neighboring Land Ar-

eas, vol. 1. Florida Department of Agriculture, Division of

Plant Industry, Gainesville, Florida

Kristensen NP (2003) Skeleton and muscles: adults. Pp. 39-131

in: Kristensen, Niels P. (ed.) Lepidoptera, moths and butter-

flies. Vol. 2: Morphology, physiology, and development. M.

Fischer, Handbook of Zoology IV (36). Walter de Gruyter,

Berlin and New York

Lafontaine JD (2004). Noctuoidea, Noctuidae (part) Noctuinae,

Agrotini in: Hodges RW. (ed.) The Moths of North America,

fasc. 27.1

©ZFMK

198 Louis Handfield & Daniel Handfield

Landry B (1993) La Pédiculaire du Canada (Pedicularis

canadensis L., Scrophulariacées) comme plante-hdte de Lé-

pidopteres dans |’Outaouais. Fabreries 18 (1): 1-10

Landry B (2016) Taxonomic revision of the Spilomelinae (Lep-

idoptera, Pyralidae s. 1.) of the Galapagos Islands, Ecuador.

Revue Suisse de Zoologie 123 (2): 315-399

Lara-Villalon M, Mora-Olivo A, Sanchez-Ramos JG,

Martinez-Avalos JG (2014) Registro de Herpetogramma

bipunctalis (Lepidoptera: Pyralidae: Crambidae) sobre la

invasora Alternanthera philoxeroides (Amaranthaceae) en

Tamaulipas, México. Revista Mexicana de Biodiversidad 85

(2): 621-623

Marie-Victorin Frere (1995) Flore Laurentienne, 3° éd. Les

Presses de |’ Université de Montréal, Montréal, Canada

Marineau K, Dion M-E (2008) Inventaire de la végétation ter-

restre du Mont Royal. Ville de Montréal, Montréal, Canada

Munroe EG (1983) Pyralidae (except Crambinae). In: Hodges

RW et al.(eds). Check List of the Lepidoptera of America

north of Mexico including Greenland. E.W. Classey Limited

and The Wedge Entomological Research Foundation. Lon-

don, England Munroe EG (1995a) Crambidae (Crambinae,

Schoenobiinae, Cybalomiinae, Linostinae, Glaphyriinae,

Dichogaminae, Scopariinae, Musotiminae, Midilinae, Nym-

phulinae, Odontiinae, Evergestinae, Pyraustinae). Pp. 60-

79 in: Heppner JB (ed.) Atlas of Neotropical Lepidoptera.

Checklist: Part 2. Hyblaeoidea — Pyraloidea — Tortricoidea 3.

Association for Tropical Lepidoptera & Scientific Publishers,

Gainesville, Florida

Munroe EG (1995b) Galleriinae. In: Heppner JB (ed.) Atlas

of Neotropical Lepidoptera Checklist: Part 2. Hyblaeoidea

— Pyraloidea — Tortricoidea 3. Association for Tropical Lepi-

doptera & Scientific Publishers, Gainesville, Florida

O’Neill JJ (1914) St. Hilaire (Beloeil) and Rougemont Moun-

tains, Quebec. Mem 43, Geological Survey, Department of

Mines. Ottawa, Canada

Pohl GR, Cannings RA, Landry J-F, Holden DG, Scudder GGE

(2015) Checklist of the Lepidoptera of British Columbia,

Canada. Entomological Society of British Columbia, Occa-

sional Paper No. 3

Pohl GR, Landry J-F, Schmidt BC, Lafontaine JD, Troubridge

JT, Macaulay AD, van Nieukerken EJ, DeWaard J, Dom-

broskie JJ, Klymko J, Nazari V, Stead K (2018) Annotated

Checklist of the Moths and Butterflies (Lepidoptera) of Can-

ada and Alaska. Pensoft, Series Faunistica 118, Sofia, Bul-

garia

Bonn zoological Bulletin 70 (1): 173-199

Powell JA, Opler PA (2009) Moths of Western North America.

University of California Press, Berkeley and Los Angeles,

California

Rousseau C (1968) Histoire, habitat et distribution de 220

plantes introduites au Québec. Le Naturaliste Canadien 95:

49-169

Rousseau C (1974) Géographie floristique du Québec — Labra-

dor. Les Presses de |’ Université Laval, Québec

Ruehlmann TE, Matthews RW, Matthews JR (1988) Roles for

structural and temporal shelter-changing by fern-feeding lep-

idopteran larvae. Oecologia (Berlin) 75: 228—232

Schaffer JC, Munroe E (2003) (2007) Crambidae of Aldabra

Atoll (Lepidoptera: Pyraloidea). Tropical Lepidoptera Re-

search 14 (1-2): 1-114

Scholtens BG, Solis MA (2015) Annotated checklist of the

Pyraloidea (Lepidoptera) of America North of Mexico. Zoo-

Keys 535: 1-136. https://doi.org/10.3897/zookeys.535.6086

Scoggan HJ (1957) Flora of Manitoba. National Museum of

Canada, Bull. 141. Ottawa, Canada

Solis MA (2010) North American Herpetogramma Lederer,

1863 (Lepidoptera: Crambidae: Spilomelinae): Type speci-

mens and identity of species in the United States and Cana-

da. Proceedings of the Entomological Society of Washington

112 (3): 451-463

Tietz HM (1972) An Index to the Described Life Histories, Ear-

ly Stages and Hosts of the Macrolepidoptera of the Continen-

tal United States and Canada, vol.1, The Allyn Museum of

Entomology, Sarasota, Florida

Tofangsazi N, Arthurs SP, Cherry R (2012 rev. 2015) Tropi-

cal Sod Webworm Herpetogramma phaeopteralis Guenée

(Insecta: Lepidoptera: Crambidae). Publ. EENY-541-Ento-

mology and Nematology Department, UF/IFAS Extension,

University of Florida, Gainesville, Florida

Walker F (1858-1866) List of the specimens of lepidopterous

insects in the collection of the British Museum, Parts 16-19,

27, 31, 33-35. Edward Newman, London, 1—253; 254-508;

509-798: 799-1036; 1-286; 1-706; 707-1120; 1121-1533;

1536-2040

Wilbur RL, Hespenheide HA (1967) The Genus Clethra (Cle-

thraceae) in the United States. The Journal of the Elisha

Mitchell Scientific Society 83 (2): 82-88

Winn AF (1912) A preliminary list of the insects of the Province

of Quebec, Part 1 — Lepidoptera. Supplement to Report of

the Quebec Society for the Protection of Plants, Montréal,

Québec

©ZFMK

A revision of the Canadian species of the Genus Herpetogramma Lederer, 1863 199

APPENDIX I

Barcode Tree (according to BOLD as of 30.1x.2020).

BIOUG20646-B08|Ontario Phaeopteralis BOLD:ABY 7602

CNCLEP00119992|Ontario

CNCLEP00119991|Ontario bipunctalis BOLD:AAC4123

DH005997|Quebec

MDH006457|Quebec

MDH005843|Quebec

MDH006113|Quebec

MDH006046|Quebec

MDH008775|Quebec

MDH013988|Quebec

MDH006048|Quebec

MDH006045|Quebec

MDH006027|Quebec

MDH004726|Quebec

CNCLEP00089828|Quebec

MDH002657|Quebec

MDH006479|Quebec

ICNCLEP00041082|Manitoba

MDH002335|Quebec

CNCLEP00027593|Quebec

— CNCLEP00040473|Manitoba

CNCLEP00089827|Quebec

CNCLEP00089826|Quebec

MDH013867|Quebec

UBC-2006-0451|British Columbia

UBC-2006-0452)British Columbia

UBC-2006-0453)British Columbia

UBC-2006-0948|British Columbia

CNCLEP0002757 1|Quebec

MDH002175|Quebec

MDH010174|Quebec

CNCLEP 00116358|Quebec

CNCLEP00138847|Quebec

DH006034|Quebec

CNCLEP 00119650|Quebec

CNCLEP 00119649)|Ontario

CNCLEP 00119648/Ontario fraxinalis BOLD:AAA2323

CNCLEP 00116357|Quebec

CNCLEP00138877|Quebec

CNCLEP00138845|Quebec

CNCLEP00138842|Quebec

CNCLEP00138841|Quebec

MDH006036|Quebec

CNCLEP00138844|Quebec

| [yj CNCLEP00089829|Quebec

DH005739|Quebec

LH2015-06|Quebec

LH2015-04|Quebec

LH2015-02|Quebec

LH2015-01|Quebec

CNCLEP00121457|Quebec

——.MDH001737|Quebec

MDH003649|Quebec

aquilonalis BOLD:AAA2323

thestealis BOLD:AAA2323

BIOUG26008-D05|Ontario

CNCLEP00119993|Ontario

4 CNCLEP00121794|Ontario

MDH009784|Quebec

CNCLEP00040836|Manitoba

CNCLEP00040834|Manitaba

ICNCLEP00040835|Manitoba

CNCLEP00089831|Quebec

jCNCLEP00089832|Quebec

‘CNCLEP00089833|Quebec

pertextalis BOLD:AAA2323

nymphalis BOLD:ABY4315

DH005925|Quebec

MDH006030|Quebec

DH005925.2|Quebec

CNCLEP00224870|Ontario

MDH006040|Quebec

MDH006041|Quebec

CNCLEP00075074|Ontario

yCNCLEP00075073)|Ontario

'MDH006044|Quebec

MDH006033|Quebec

MDH006034|Quebec

MDH006459|Quebec

MDH004788|Quebec theseusalis BOLD:AAH4936

sphingealis BOLD:AAA2324

aeglealis BOLD:AAA2324

0.5%

BHL

Blank Page Digitally Inserted

Bonn zoological Bulletin 70 (1): 201-219

2021 Le. Dil -etale

https://do1.org/10.20363/BZB-2021.70.1.201

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:|sid:zoobank.org:pub: 1 DF3ECBF-A4B1-4C05-BC76-1E3C772B4637

New records and an updated checklist of amphibians and snakes

from Tuyen Quang Province, Vietnam

Dzung Trung Le’, Anh Mai Luong’, Cuong The Pham’, Tien Quang Phan‘, Son Lan Hung Nguyen’,

Thomas Ziegler® & Truong Quang Nguyen”

' Ministry of Education and Training, 35 Dai Co Viet Road, Hanoi, Vietnam

2° Hanoi National University of Education, 136 Xuan Thuy Road, Hanoi, Vietnam

237 Institute of Ecology and Biological Resources, Graduate University of Science and Technology, Vietnam Academy of Science

and Technology, 18 Hoang Quoc Viet Road, Hanoi, Vietnam

°AG Zoologischer Garten K6In, Riehler Strasse 173, D-50735 Kéln, Germany

° Institut fiir Zoologie, Universitat K6éln, Ziilpicher Strasse 47b, D-50674 KéIn, Germany

“Corresponding author: Email: nqt2@yahoo.com

'urn:|sid:zoobank.org:author:2C2D01BA-E10E-48C5-AE7B-FB8170B2C7D1

> urn:Isid:zoobank.org: author: 8F25F198-AOF3-4F30-BE42-9A F3A44E890A

3urn:|sid:zoobank.org:author:24C 187A9-8D67-4DOE-A 171-1885A25B62D7

*urn:lsid:zoobank.org:author:555 DF82E-F461-4EBC-82FA-FFDABE3BFFF2

>urn:|sid:zoobank.org:author:7 163A A50-6253-46B7-9536-DE7F8D81A14C

°urn:|sid:zoobank.org:author:5716DB92-5FF8-4776-ACC5-BF6FA8C2E1 BB

7urn:lsid:zoobank. org:author:822872A6-1C40-461F-AAOB-6A20EEQN6ADBA

Abstract. We provide a checklist of 57 species of amphibians and 42 species of snakes from Tuyen Quang Province,

northern Vietnam. Ten species of amphibians and five species of snakes were recorded for the first time from Tuyen Quang

Province. Based on the new herpetological collection from this province we provide the descriptions of newly recorded

species. The herpetofauna of Tuyen Quang Province contains a high level of conservation concern with four species

endemic to Vietnam, eight species listed in the IUCN Red List, 16 species listed in the Red Data Book of Vietnam, three

species listed in the Vietnam Governmental Decree No 06/2019/ND-CP, and three species listed in the CITES appendices.

Key words. Amphibians, morphology, new records, snakes, taxonomy, Tuyen Quang Province.

INTRODUCTION

Limestone karst forests in Southeast Asia harbor an ex-

tremely rich biodiversity, which includes various site-en-

demic taxa (Clements et al. 2006), and species commu-

nities on different karst formations in the same overall

region can differ from each other considerably (Clements

et al. 2006; Sterling et al. 2006; Webb et al. 2010). Re-

cent new discoveries of snakes from northern Vietnam

showed the high potential of species diversity from lime-

stone karst forests, for instance Achalinus timi Ziegler,

Nguyen, Pham, Nguyen, Pham, van Schingen, Nguyen &

Le, 2019 from Son La Province, Parafimbrios vietna-

mensis Ziegler, Ngo, Pham, Nguyen, Le & Nguyen, 2018

from Lai Chau Province, and Achalinus juliani Ziegler,

Nguyen, Pham, Nguyen, Pham, van Schingen, Nguyen &

Le, 2019, Lycodon pictus Janssen, Pham, Ngo, Le, Nguy-

en & Ziegler, 2019 and Sinomicrurus peinani Liu, Yan,

Hou, Wang, Nguyen, Murphy, Che & Guo, 2020 from

Received: 14.12.2020

Accepted: 05.05.2021

Cao Bang Province (Ziegler et al. 2007, 2018a, 2018b,

2019a, 2019b; Nguyen et al. 2018; Janssen et al. 2019;

Liu et al. 2020).

Tuyen Quang Province is located in northeastern

Vietnam with a complex terrain of limestone karst and

lowland areas with elevations of 200-600 m above sea

level (Sterling et al. 2006). In terms of the herpetofau-

nal diversity, Tuyen Quang Province is one of the most

poorly studied provinces in northern Vietnam. Le et al.

(2007) documented a list of 43 species of reptiles and

amphibians from three districts of Chiem Hoa, Na Hang

and Son Duong. Nguyen et al. (2009) recorded 41 species

of reptiles and amphibians from Tuyen Quang Province.

Phan et al. (2018) recently provided a list of 40 species of

snakes from this province.

As a result of our recent field surveys in Tuyen Quang

Province between 2017 and 2018, we herein provide a

checklist of 57 species of amphibians and 42 species of

snakes, including 15 new records from this province.

Corresponding editor: W. Bohme

Published: 26.05.2021

202 Dzung Trung Le et al.

MATERIAL AND METHODS

Sampling. Field surveys were conducted by Cuong The

Pham, Truong Quang Nguyen, Anh Mai Luong, Tien

Quang Phan, Dzung Trung Le, and Hoa Thi Ninh (here-

after Pham et al.) from 22 August to 2 September 2017

and from 13 to 24 June 2018 in Lam Binh and Na Hang

districts of Tuyen Quang Province (Fig. 1). The coor-

dinates (WGS 84) were determined by using the GPS

Garmin ver. 60CX.

Specimens were collected between 19:00 and 24:00

hours. After photographing in life, specimens were eu-

thanized in a closed vessel with a piece of cotton wool

containing ethyl acetate (Simmons 2002), fixed in 80%

ethanol for five hours, and then later transferred to 70%

ethanol for permanent storage. Tissue samples (muscles

from thigh) were preserved separately in 70% ethanol

prior to fixation. Specimens referred to in this paper are

deposited in the collections of the Institute of Ecology

and Biological Resources (IEBR) and the Vietnam Na-

tional Museum of Nature (VNMN), Hanoi, Vietnam.

Morphological examination. Measurements were taken

in preserved specimens with a digital caliper to the near-

est 0.1 mm.

For amphibian specimens, the following Abbrevia-

tions used in the text

SVL = Snout-vent length

HL = = Head length (from the back of mandible to

tip of snout)

HW = Maximum head width (across angles of jaws)

SL = Snout length or rostral length (from anterior

corner of orbit to the tip of snout)

NS = Distance from nostril to the tip of snout

EN — = Distance from anterior corner of orbit to nostril

IND = Internarial distance

IOD- = Interorbital distance

ED = Eye diameter

UEW = Maximum width of upper eyelid

DAE = Distance between anterior corners of orbits

MN~ = Posterior margin of mandible to nostril

MFE = Posterior margin of mandible to anterior

corner of orbit

MBE = Posterior margin of mandible to posterior

corner of orbit

DPE = Distance between posterior corners of orbits

TD = = Tympanum diameter

TYE = Distance from anterior margin of tympanum

to posterior corner of orbit

FLL = forearm length, from elbow to base of outer

palmar tubercle

HAL = hand length, from base of outer palmar

tubercle to tip of third finger

FL1 = Finger length I-IV

Bonn zoological Bulletin 70 (1): 201-219

Fig. 1. Map of sampling locations (black circle) in Tuyen

Quang Province, northern Vietnam.

OPT = Outer palmar tubercle length

IPT = Inner palmar tubercle length

NPL = Nuptial pad length

FeL = Femur length (from vent to knee)

TbL = Tibia length (from knee to tarsus)

TbW = Maximum tibia width

FoL = Foot length (from tarsus to the tip of 4" toe)

TL1—5 = Toe length I-V

IMT = Inner metatarsal tubercle length

For webbing formula we followed Glaw & Vences

(2007). Sex was determined by the presence of nuptial

pads and based on gonadal inspection.

For snake specimens, measurements were taken after

preservation with a measuring tape. The number of ven-

tral scales was counted according to Dowling (1951). The

dorsal scale rows were given at one head length behind

head, at midbody, and at one head length before vent,

respectively. Scalation was studied by using a stereo mi-

croscope (Leica M80). Bilateral scale counts were given

as left/right. Identification of sex was made by inspection

of presence of hemipenes.

Specimen identification. For taxonomic identifica-

tion, we referred to Bourret (1936, 1942), Smith (1943),

Liu (1950), Taylor (1962), Manthey & Grossmann

(1997), Dubois & Ohler (1998), Lathrop et al. (1998),

©ZFMK

New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam 203

Ziegler & Kohler (2001), Ziegler (2002), Leviton et al.

(2003), Bain et al. (2004), Ohler (2003), Ohler & Delo-

rme (2006), Nguyen (2007), Fei et al. (2008), Stuart &

Heatwole (2008), Fei et al. (2009), Vogel et al. (2009),

Inger & Stuart (2010), Nguyen et al. (2011), Chen et al.

(2013), Hecht et al. (2013), Luu et al. (2013), Nemes

et al. (2013), Ostroshabov et al. (2013), Le et al. (2014a,

b), Neang et al. (2014), Nguyen et al. (2016a, b), Pham

et al. (2016, 2017), Nguyen et al. (2018), Janssen et al.

(2019), and Yu et al. (2019). Species names follow Nguy-

en et al. (2009), Frost (2020), and Uetz et al. (2020).

RESULTS

Taxonomic accounts

Family Megophryidae

Leptobrachella sungi (Lathrop, Murphy, Orlov & Ho,

1998)

Sung’s Toad / Coc may sung (Fig. 2a)

Specimens examined (n = 4). One adult male IEBR

4583 (Field number TQ.2017.50) collected by Pham

et al. on 27 August 2017, near Trung Phin Village

(22°29.584' N/105°23.586' E, at an elevation of

844 m asl.), one adult male IEBR 4584 (Field number

TQ.2017.80) collected by Pham et al. on 29 August 2017,

near Trung Phin Village (22°30.634' N/105°24.304' E,

at an elevation of 926 m asl.), Sinh Long Commune,

Na Hang District, two adult males IEBR 4585, 4586

(Field numbers TQ.2017.123, 126) collected by Pham

et al. on 1* September 2017, near Na Phuong Vil-

lage (22°31.574' N/105°16.966' E, at an elevation of

147 m asl.), Thuong Lam Commune, Lam Binh District.

Description. Morphological characters of the speci-

mens from Tuyen Quang Province agreed well with the

descriptions of Lathrop et al. (1998) and Luong et al.

(2019): SVL 47.6-59.0 mm; head longer than wide

(HL 22.4—-26.0 mm, HW 19.0-22.6 mm); snout dis-

tinctly pointed in dorsal view, longer than eye diameter

(SL 8.3-9.6 mm, ED 7.5—8.0 mm); nostril oval, lateral-

ly positioned, closer to the tip of snout than to eye (NS

3.0-4.0 mm, EN 4.8—5.5 mm); canthus rostralis distinct,

loreal region concave; eye large, approximately twice

diameter of tympanum (TD 2.7—3.8 mm), tympanum

round, indistinct; supratympanic fold distinct, extending

from posterior corner of the eye to a point behind artic-

ulation of jaw; vomerine teeth absent; tongue notched

posteriorly.

Forelimbs: FLL 11.6—15.4 mm, relative finger lengths

I=II<IV<III, tips of fingers not enlarged into discs; web-

bing absent; subarticular tubercles indistinct; palmar tu-

bercles round, inner one very large.

Bonn zoological Bulletin 70 (1): 201-219

Hindlimbs: Thigh short (FL 23.0—27.3 mm); tibia four

times longer than wide (TbL 22.9-27.9 mm, TbW 5.2—

7.5 mm); relative toe lengths I<II<V<HI<IV; webbing

rudimentary between toes I-IV and absent between IV

and V; subarticular tubercles indistinct; inner metatarsal

tubercle oval; outer metatarsal tubercle absent.

Skin: Dorsal surface of head and body, upper part of

flanks with dispersed tubercles; upper eyelid granular;

dorsolateral fold absent; ventral surface smooth.

Coloration in life. Dorsal surface of head and body

brown-copper with a dark bar marking between eyes;

canthus and supratympanic fold brown; upper lip with

dark bars; flanks light brown with dark point, transverse

bars on limbs dark brown; ventral surface opaque white.

Ecological notes. Specimens were found between

19:00 and 21:00 hours on stream shore. The surrounding

habitat was secondary forest of medium and small hard-

woods and shrub.

Distribution. This species is currently known only

from northern Vietnam: Dien Bien, Lao Cai, Yen Bai, and

Vinh Phuc provinces (Nguyen et al. 2009; Luong et al.

2019). Elsewhere, the species is known from southern

China (Frost 2020).

Leptobrachium chapaense (Bourret, 1937)

Chapa Spadefoot Toad / Coc may sa pa (Fig. 2b)

Specimens examined (n = 2). One adult female

IEBR 4587 (Field number TQ.2017.90) collected by

Pham et al. on 30 August 2017, near Na Phuong Vil-

lage (22°28.347' N, 105°21.454' E, at an elevation of

117 m asl.), Thuong Lam Commune, Lam Binh Dis-

trict and one adult female IEBR 4588 (Field number

TQ.2018.89) collected by Pham et al. on 17 June 2018,

near Nam Duong Village (22°36.721' N, 105°20.094' E,

at an elevation of 779 m asl.), Sinh Long Commune, Na

Hang District.

Description. Morphological characters of the spec-

imens from Tuyen Quang Province agreed with the

descriptions of Dubois & Ohler (1998); Lathrop et al.

(1998); and Luong et al. (2019): SVL 40.5—57.2 mm;

head longer than wide (HL 19. 8—26.3 mm, HW 18.2—

27.4 mm); snout round, longer than eye diameter (SL

7.2-10.2 mm, ED 6.4—7.5 mm); nostrils oval, laterally

positioned, closer to the tip of snout than to eye (NS

4.6—-5.7 mm, EN 4.0—5.0 mm); canthus rostralis distinct,

loreal region flattened; eye large, approximately twice

diameter of tympanum (TD 2.6—-3.9 mm); tympanum

round, distinct; supratympanic fold distinct, vomerine

teeth absent; tongue notched posteriorly.

Forelimbs: FLL 11.8-16.9 mm, hand length (HAL

24.2—32.4 mm); relative finger lengths I<II<IV<III, tips

of fingers round; webbing absent; subarticular tubercles

distinct; two palmar tubercles round, inner palmar tuber-

cles larger than outer palmar tubercles.

©ZFMK

204 Dzung Trung Le et al.

Fig. 2. Dorsolateral view of six newly recorded amphibian species from Tuyen Quang Province. a. Leptobrachella sungi (IEBR

4583). b. Leptobrachium chapaense (IEBR 4587). ¢. Leptobrachium guangxiense (IEBR 4589). d. Megophrys microstoma (IEBR

4590) e. Limnonectes limborgi (IEBR 4593) f. Quasipaa boulengeri (IEBR 4597).

Hindlimbs: Thigh short (FL 17.8—24.8 mm); tibia five

times longer than wide (TbL 15.5—22.24 mm, TbW 3.1—

5.7 mm); relative toe lengths I<II<IH<V<IV; webbing

formula [1—211’4—-21111—31V3-—1V; subarticular tubercles

distinct; inner metatarsal tubercle oval.

Skin: Dorsal surface of head and body, upper part of

flanks smooth; ventral surface smooth.

Bonn zoological Bulletin 70 (1): 201-219

Coloration in life. Dorsal pattern brown with small,

diffuse orange blotches on the sacral region, flanks, and

limbs; ventral surface of limbs black with white reticu-

lations, thigh and knee with dark bars; groin and flanks

black with white pustules.

Ecological notes. Specimens were found between 20:00

and 21:00 hours on the ground. The surrounding habitat

©ZFMK

New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam

was mixed secondary forest composed of small to medi-

um hardwoods and shrubs.

Distribution. In Vietnam, L. chapaensis was known

from Lao Cai and Ha Giang provinces in the North south-

wards to Thua Thien Hue Province (Nguyen et al. 2009;

Luong et al. 2019). Elsewhere, this species 1s known

from China, Laos, Myanmar, and Thailand (Frost 2020).

Leptobrachium guangxiense Fei, Mo, Ye & Yang, 2009

Guangxi Pseudomoustache Toad / Coc may quang tay

(Fig. 2c)

Specimen examined (n= 1). One adult male IEBR 4589

(Field number TQ.2018.151) collected by Pham et al. on

26 June 2018, near Na Phuong Village (22°29.653' N,

105°23.574' E, at an elevation of 857 m asl.), Thuong

Lam Commune, Lam Binh District.

Description. Morphological characters of the spec-

imen from Tuyen Quang Province agreed with the de-

scription of Chen et al. (2013): SVL 60.3 mm. Head wid-

er than long (HL 25.3 mm, HW 25.7 mm); snout round,

longer than eye diameter (SL 10.3 mm, ED 8.7 mm); nos-

trils oval, laterally positioned, closer to the tip of snout

than to eye (NS 5.7 mm, EN 5.5 mm); canthus rostralis

distinct, loreal region concave; eye large, approximately

twice diameter of tympanum (TD 3.8 mm), tympanum

indistinct; supratympanic fold distinct, vomerine teeth

absent; tongue notched.

Forelimbs: FLL 16.1 mm, hand length (HAL 30.8 mm);

relative finger lengths II<I<IV<III, tips of fingers round;

webbing absent; subarticular tubercles distinct; two pal-

mar tubercles round, inner one larger than outer one.

Hindlimbs: Thigh short (FbL 24.9 mm); tibia four

times longer than wide (TbL 22.1 mm, TW 6.2 mm); rel-

ative toe lengths I<H<V<HI<IV; toes with rudiment of

webbing; subarticular tubercles distinct; inner metatarsal

tubercle oval.

Skin: Dorsal surface of head and body, upper part of

flanks smooth; ventral surface smooth.

Coloration in life. Dorsal pattern dark grey with small,

diffused white blotches on the sacral region, flanks, and

limbs; upper surface of limbs with transverse bars; ven-

tral surface dark with white spots.

Ecological notes. Specimen was found at 19:30 hours

on the ground near a small stream. The surrounding hab-

itat was mixed secondary forest composed of small hard-

woods and shrubs.

Distribution. In Vietnam, L. guangxiense was known

from Tam Dao National Park, Vinh Phuc Province. Else-

where, this species is known from China (Frost 2020).

Megophrys microstoma Boulenger, 1903

Asian Mountain Toad / Coc nui mieng nho (Fig. 2d)

Specimens examined (n= 3). One adult male IEBR 4590

(Field number TQ.2017.8) collected by Pham et al. on

Bonn zoological Bulletin 70 (1): 201-219

205

25 August 2017, near Giang Chi Village (22°34.370' N,

105°20.138' E, at an elevation of 802 m asl.), Sinh Long

Commune, Na Hang District and two adult males IEBR

4591, 4592 (Field numbers TQ.2017.111, 112) collect-

ed by Pham et al. on 31 August 2017, near Na Phuong

Village (22°29.221' N, 105°20.830' E, at an elevation of

312 masl.), Thuong Lam Commune, Lam Binh District.

Description. Morphological characters of the speci-

mens from Tuyen Quang Province agreed with the de-

scriptions of Ohler (2003) and Luong et al. (2019): SVL

33.5—-38.4 mm; head wider than long (HL 9.8-11.7 mm,

HW 9.9-11.1 mm); snout truncate, protruding, shorter

than horizontal diameter of eye (SL 2.1-3.2 mm, ED

3.6-3.9 mm); loreal region vertical, concave; nostril

closer to the tip of snout than to eye (NS 1.0—1.2 mm,

EN 1.4—2.1 mm); conical dermal appendix on upper eye-

lid present; eye larger than tympanum (TD 3.0—3.3 mm);

tympanum distinct.

Forelimbs: FLL 6.2—7.3 mm; hand length (HAL 18.2—

20.4 mm), relative finger lengths I<I=IV<III, tips of

fingers round, not enlarged into discs; webbing absent;

subarticular tubercles absent; palmar tubercles indistinct.

Hindlimbs: Thigh short (FeL 17.9-18.3 mm); tibia four

times longer than wide (TbL 17.7—19.0 mm, TbW 3.2—

3.5 mm); relative toe lengths I<IT<V<IHK<IV; tibio-tarsal

articulation reaching eye; webbing rudimentary; subar-

ticular tubercles indistinct; metatarsal tubercle indistinct.

Skin: Dorsal surface shagreened, with symmetric glan-

dular ridges; flank shagreened, covered with granules;

ventral surface smooth.

Coloration in life. Dorsum reddish brown, upper sur-

face of limbs with transverse bars; a light bar present be-

low the eye; flanks with some small black spots; ventral

surface cream with dark marbling.

Ecological notes. Specimens were found between

20:00 and 22:00 hours on tree branches or stones near

rocky streams. The surrounding habitat was secondary

forest of small hardwoods and shrubs.

Distribution. In Vietnam, this species was known

from Lao Cai and Ha Giang provinces in the North south-

wards to Dak Lak and Lam Dong provinces (Nguyen

et al. 2009). Elsewhere, the species is known from China,

Laos, Thailand, and Cambodia (Frost 2020).

Family Dicroglossidae

Limnonectes limborgi (Sclater, 1892)

Limborg’s Frog / Ech lim-boc (Fig. 2e)

Specimens examined (n = 4). Two adult males IEBR

4593, 4594 (Field numbers TQ.2018.137, 138) by

Pham et al. on 20 June 2018, near Na Phuong Vil-

lage (22°30.169' N, 105°23.864' E, at an elevation of

973 m asl.), Thuong Lam Commune, Lam Binh Dis-

trict and two adult females IEBR 4595, 4596 (Field

numbers TQ.2017.2, 47) collected by Pham et al. on 25

©ZFMK

206

August 2017, near Giang Chi Village (22°34.370' N,

105°20.138' E, at an elevation of 802 m asl.), Sinh Long

Commune, Na Hang District.

Description. Morphological characters of the speci-

mens from Tuyen Quang Province agreed with the de-

scriptions of Bourret (1942) and Inger & Stuart (2010):

SVL 24.7—27.1 mm in males and 29.3—30.75 mm in fe-

males; head as long as wide (HL 11.4—11.9 mm in males

and 10.7-12.0 mm in females, HW 10.2—12.1 mm in

males and 10.8—11.7 mm in females); snout short, round,

longer than horizontal diameter of eye (SL 3.9-4.5 mm

in males and 4.3-4.6 mm in females, ED 2.5—2.8 mm

in males and 3.7-4.3 mm in females); nostril equidis-

tant from the orbit and the snout tip; closer to the tip of

snout than to eye (NS 1.6—1.8 mm in males and 1.7 mm

in females, EN 2.2—2.5 mm in males and 2.2—2.5 mm in

females); canthus rostralis obtuse, loreal region slight-

ly concave; tympanum distinct, round, approximate-

ly two third of eye diameter (TD 1.7 mm in males and

1.7—2.4 mm in females); vomerine teeth present, in two

oblique ridges, equal in distance from each other as to

choanae; tongue notched posteriorly.

Forelimbs rather short (FLL 5.4-6.1 mm in males

and 7.2-9.1 mm in females), hand length (HAL 11.0-

12.1 mm in males and 12.8—14.0 mm in females) rela-

tive finger lengths IT<I<IV<III; the tips dilated into small

disks; fingers without dermal fringe, free of webbing:

subarticular tubercle distinct, oval, formula 1,1,2,1; sub-

articular tubercles moderate; a large, very prominent,

compressed, blunt-edged inner metatarsal tubercle.

Hindlimbs slender, thigh shorter than tibia (FeL 12.8—

14.1 mm in males and 15.6—16.2 mm in females); tib-

ia five times longer than wide (TbL 13.4—15.2 mm in

males and 15.7—-17.1 mm in females, TbW 2.9-4.1 mm

in males and 4.0—-4.1 mm in females); relative toe lengths

I<II<V<II<IV; tips of toes swollen; webbing formula

114-2111 2-32-31 V3-2V; inner metatarsal tubercle

distinct, oval; subarticular tubercles indistinct.

Skin: Dorsal surface of head and body smooth with

faint traces of a glandular lateral fold; a strong fold ex-

tending from the eye to the shoulder; ventral surface

smooth.

Coloration in life. Dorsal surface brown; with small

dark-grey spots; a dark cross-bar between the eyes and

a A-Shaped mark between the shoulders; thighs and tibia

with dark-brown cross bars; ventral surface cream; throat

cream with dark pattern.

Ecological notes. Specimens were found on the ground

between 19:30 and 22:30 hours on a forest path. The sur-

rounding habitat was mixed secondary forest of small to

medium hardwoods and shrubs.

Distribution. In Vietnam, this species was known

from Lao Cai and Son La provinces in the North south-

wards to Dong Nai and Kien Giang provinces (Nguyen

et al. 2009). Elsewhere, the species is known from Laos,

Bonn zoological Bulletin 70 (1): 201-219

Dzung Trung Le et al.

Cambodia, Malaysia, Myanmar, and Thailand (Inger &

Stuart 2010).

Quasipaa boulengeri (Gunther, 1889)

Boulenger’s Spiny Frog / Ech gai san bau-len-go (Fig. 2f)

Specimens examined (n = 5). One adult male IEBR

4597 (Field number TQ.2017.14) by Pham et al. on 25

August 2017, near Giang Chi Village (22°30.075' N,

105°23.555' E, at an elevation of 889 m asl.), Sinh Long

Commune, Na Hang District, one adult male IEBR

4598 (Field number TQ.2017.45) by Pham et al. on 27

August 2017, near Giang Chi Village (22°30.075' N,

105°23.555' E, at an elevation of 889 m asl.), Sinh Long

Commune, Na Hang District, and three adult females

IEBR 4599, 4600, 4601 (Field numbers TQ.2017.28, 32,

33) by Pham et al. on 26 August 2017, near Giang Chi

Village (22°34.128' N, 105°20.225' E, at an elevation of

799 m asl.), Sinh Long Commune, Na Hang District.

Description. Morphological characters of the spec-

imens from Tuyen Quang Province agreed with the

descriptions of Liu (1950) and Fei et al. (2009): SVL

115.8—118.5 mm in males, 90.9-101.7 mm in females;

head wider than long (HL 42.9-47.1 mm, HW 50.4—

54.8 mm in males, 34.5-38.0 mm, 40.4-43.6 mm in

females); snout obtusely pointed in dorsal view, longer

than horizontal diameter of eye (SL 17.3—18.1 mm, ED

12.13—12.46 mm in males, 13.4—15.4 mm, 10.5—11.8 mm

in females); nostril lateral, round, closer to the tip of

snout than to eye (NS 9.6—10.0 mm, EN 7.7—8.5 mm in

males, 6.8—9.6 mm, 6.9—7.0 mm in females); canthus ros-

tralis short but distinct, loreal region oblique, shallow-

ly concave; tympanum indistinct, approximately half of

eye diameter (TD 4.8—7.0 mm in males, 5.4—5.6 mm in

females); vomerine teeth in two oblique ridges; tongue

notched posteriorly.

Forelimbs short (FLL 23.6—28.1 mm in males, 19.6—

22.3 mm in females), relative finger lengths H<I<IV<III;

tips of all four fingers swollen; fingers without dermal

fringe, free of webbing; subarticular tubercle distinct,

round, formula 1,1,2,2; palmar tubercles one, oval; males

with nuptial pad on finger I and II.

Hindlimbs long, thigh shorter than tibia (FeL 63.4—

64.9 mm in males, 45.8-52.4 mm in females); tibia

three times longer than wide (TbL 60.8-62.8mm, TbW

20.8—24.5 mm in males, 49.5—53.4 mm, 16.5—20.1 mm

in femals); relative toe lengths I<II<III<V<IV in males

and relative toe lengths I<IT<V<II<IV in females; tips

of toes swollen; full webbing; inner metatarsal tubercle

distinct, outer metatarsal tubercle distinct, round; subar-

ticular tubercles oval, formula 1,1,2,3,2.

Skin: Skin of the upper parts covered with large elon-

gated warts and small oval tubercles; upper surface of

limbs with transverse dark bars; flanks with small round

tubercles; males vetral with nuptial pad on chest and bel-

ly.

©ZFMK

New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam 207

Coloration in life. Dorsal surface of head and body

dark-grey; dorsum with black large elongated warts;

flanks with small tubercles, more dense near dorsolateral

folds; dorsal surface of forelimbs, thighs and tibia with

dark cross bars; ventral surface cream, males with nuptial

pad on chest.

Ecological notes. Specimens were found between

19:00 and 22:00 hours on stones or on the ground in

rocky streams. The surrounding habitat was mixed sec-

ondary forest of small to medium hardwoods and shrubs.

Distribution. In Vietnam, this species was known

from Cao Bang, Son La and Nghe An provinces (Nguyen

et al. 2009). Elsewhere, the species is known from China

(Frost 2020).

Remarks. This species is similar to Quasipaa spinosa

and Nanorana yunnanensis (Liu 1950). The specimens

of Quasipaa boulengeri from Tuyen Quang differ from

those of Q. spinosa in having large elongated warts ver-

sus small warts (see Tran et al. 2010) and also differ from

those of N. yunnanensis in having ventral side with one

patch of nuptial pad on chest and belly of the males (ver-

sus with two patches of nuptial pad on both sides of the

chest, see Fei et al. 2009).

Family Rhacophoridae

Raorchestes parvulus (Boulenger, 1893)

Karin Bubble-nest Frog / Nhai cay ti hon (Fig. 3a)

Specimens examined (n = 5). Three adult males IEBR

4602, 4603, 4604 (Field numbers TQ.2018.98, 101,

102) and two adult females IEBR 4605, 4606 (Field

numbers TQ.2018.103, 129) collected by Pham et al. on

18 June 2018, near Trung Phin Village (22°31.577' N,

105°22.504' E, at an elevation of 1047 m asl.), Sinh Long

Commune, Na Hang District.

Description. Morphological characters of the spec-

imens from Tuyen Quang Province agreed well with

the description of Taylor (1962): SVL 18.6—20.3 mm in

males and 20.5—23.1 mm in females; head shorter than

wide (HL 7.3—8 mm in males and 7.8—8.9 mm in females,

HW 6.6—7.8 mm in males and 6.2—8.6 mm in females):

snout round, shorter than eye diameter (SL 2.8-3.7 mm

in males and 3.0—3.5 mm in females, ED 1.9-3.7 mm in

males and 2.3—3.7 mm and in females); nostrils oval, lat-

erally positioned, closer to the tip of snout than to eye

(NS 1.1-1.6 mm in males and 1.2—1.7 mm in females,

EN 1.3—2.0 mm in males and 2.1—2.2 mm in females):

canthus rostralis indistinct, loreal region concave; eye

large, approximately twice diameter of tympanum (TD

1.44.3 mm in males and 0.7—1.48 mm in females), tym-

panum indistinct; supratympanic fold distinct, vomerine

teeth absent; tongue notched posteriorly.

Forelimbs: Forearm short (FLL 4.6—5.5 mm in males

and 5.0-5.9 mm in females), hand length (HAL 9.8—

10.2 mm in males and 9.3—10.1 in females); relative

Bonn zoological Bulletin 70 (1): 201-219

finger lengths I<I<IV<III, tips of fingers enlarged into

discs; webbing absent; subarticular tubercles distinct,

formula 1,1,2,2; inner palmar tubercles small.

Hindlimbs: Thigh short (FeL 9.4-10.4 mm in males

and 9.6—11.5 mm in females); tibia five times longer than

wide (TbL 9.0-10.1 mm in males and 9.5—11.0 mm in

females, TbW 1.9-2.5 mm in males and 2.0—2.1 mm in

females); relative toe lengths I<H<HI<V<IV; toes with

rudiment of webbing; subarticular tubercles distinct; for-

mula 1,1,2,3,2; inner metatarsal tubercle oval.

Skin: Dorsal surface smooth or with small, scattered,

conical warts; ventral surface granular.

Coloration in life. Dorsal greyish, uniform or with

a dark bar or triangular blotch between the eyes, and a

curved dark band along each side of the back; ventral

surface darkly pigmented.

Ecological notes. Specimens were found on the leaves

along the trail, between 19:30 and 21:30 hours. The sur-

rounding habitat consisted of mixed secondary forest

composed of small hardwoods and shrubs.

Distribution. In Vietnam, R. parvulus was known from

Lao Cai and Lai Chau provinces in the North southwards

to Quang Tri Province (Nguyen et al. 2009; Nguyen et al.

2015). Elsewhere, this species is known from Myanmar,

Laos, Thailand, Cambodia and Malaysia (Frost 2020).

Rhacophorus kio Ohler & Delorme, 2006

Black-webbed Treefrog / Ech cay ki-o (Fig. 3b)

Specimen examined (n = 1). One adult male IEBR

4607 (TQ.2018.55) collected by Pham et al. on 15

June 2018, near Nam Duong Village (22°35.644' N,

105°22.056' E, at an elevation of 750 m asl.), Sinh Long

Commune, Na Hang District.

Description. Morphological characters of the speci-

men from Tuyen Quang Province agreed well with the

description of Ohler & Delorme (2006): SVL 72.8 mm;

head longer than wide (HL 25.0 mm, HW 24.1 mm);

snout round, longer than eye diameter (SL 11.6 mm, ED

7.2 mm); nostrils round, without flap of skin, closer to

the tip of snout than to eye (NS 5.0 mm, EN 6.7 mm);

canthus rostralis distinct, loreal region concave; eye

large, approximately twice diameter of tympanum (TD

4.1 mm), tympanum round, distinct; supratympanic fold

distinct, vomerine teeth distinct; tongue notched.

Forelimbs: Forearm slender (FLL 12.1 mm),

hand length (HAL 33.9 mm); relative finger lengths

I<II<IV<III, tips of fingers enlarged into discs; webbing

formula I1’2—-1M0—ONIO—O1V; subarticular tubercles dis-

tinct, formula 1,1,2,1; inner palmar tubercle indistinct.

Hindlimbs: Thigh short (FeL 32.8 mm); tibia five times

longer than wide (TbL 35.6 mm, TbW 7.4 mm); relative

toe lengths I<H<HI<V<IV; toes fully webbed; subarticu-

lar tubercles distinct, formula 1,1,2,3,2; inner metatarsal

tubercle oval.

©ZFMK

208

Dzung Trung Le et al.

Fig. 3. Dorsolateral view of four newly recorded amphibian species from Tuyen Quang Province. a. Raorchestes parvulus (IEBR

4602). b. Rhacophorus kio (IEBR 4607). ¢. Rhacophorus orlovi (IEBR 4608). d. Zhangixalus pachyprotus (VNMN.06923).

Skin: Dorsal surface of head and body, upper part of

flanks smooth; dorsal parts of limbs finely shagreened;

ventral surface smooth.

Coloration in life. Dorsal parts of head and body in-

cluding upper part of flanks green with white spots, lower

part of flanks dark brown with yellow spots correspond-

ing to glandular verrucae; a distinct ink black spot in

armpit; chest, belly and lower part of thigh lemon yellow,

webbing orange yellow with an ink black spot at base

between toes.

Ecological notes. The specimen was found on the

bough along the trail, at 19:00 hours. The surrounding

habitat consisted of mixed secondary forest composed of

small hardwoods and shrubs.

Distribution. In Vietnam, R. kio was known from Lao

Cai and Cao Bang provinces in the North southwards to

Kon Tum and Gia Lai provinces in the Centre (Nguyen

et al. 2009; Nguyen et al. 2015). Elsewhere, this species

is known from India, China, Laos, Thailand, and Cambo-

dia (Nguyen et al. 2009; Frost 2020).

Bonn zoological Bulletin 70 (1): 201-219

Rhacophorus orlovi Ziegler & Kohler, 2001

Orlov’s Treefrog / Ech cay ooc-lop (Fig. 3c)

Specimens examined (n = 5). One adult male IEBR

4608 (Field number TQ.2018.20) and two adult females

IEBR 4609, 4610 (Field numbers TQ.2018.3, 5) collect-

ed by Pham et al. on 13 June 2018, near Nam Duong

Village (22°34.626' N, 105°21.616' E, at an elevation

of 565 m asl.), Sinh Long Commune, Na Hang District,

one adult male IEBR 4611 (Field number TQ.2018.106)

collected by Pham et al. on 18 June 2018, near Trung

Phin Village (22°31.428' N, 105°22.751' E, at an ele-

vation of 994 m asl.), Sinh Long Commune, Na Hang

District, and one adult female IEBR 4612 (Field number

TQ.2018.56) collected by Pham et al. on 15 June 2018,

near Nam Duong Village (22°35.839' N, 105°20.621' E,

at an elevation of 643 m asl.), Sinh Long Commune, Na

Hang District.

Description. Morphological characters of the spec-

imens from Tuyen Quang Province agreed well with

the descriptions of Ziegler & Kohler (2001) and Ostro-

shabov et al. (2013): SVL 39.6-43.8 mm in males and

43.8—52.4 mm in females; head shorter than wide (HL

©ZFMK

New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam 209

14.8-16.8 mm in males and 16.3—19.3 mm in females,

HW 15.4—16.3 mm in males and 16.1—19.1 mm in fe-

males); snout slightly pointed, longer than eye diameter

(SL 7.1-7.7 mm in males and 6.8—7.7 mm in femlaes,

ED 4.5—5.1 mm in males and 5.0—-5.8 mm in females);

nostrils oval, closer to the tip of snout than to eye (NS

4.6 mm, EN 4.0 mm); canthus rostralis well developed,

slightly round constricted; loreal region concave; eye

large, approximately twice diameter of tympanum (TD

2.4—3.2 mm in males and 3.0-3.7 mm in females), tym-

panum round, distinct; supratympanic fold distinct, vom-

erine teeth distinct; tongue notched posteriorly.

Forelimbs: Forearm slender (FLL 7.4—7.9 mm in males

and 7.7-9.4 mm in famales), hand length (HAL 20.8—

20.9 mm in males and 20.9-27.2 mm in females); rela-

tive finger lengths I<H<IV<lIII, tips of fingers enlarged

into discs; webbing formula [12/3—12/311—2N11-1IV;

subarticular tubercles distinct, formula 1,1,2,2; inner pal-

mar tubercles round.

Hindlimbs: Thigh slender (FeL 21.3-21.9 mm in

males and FeL 23.0-27.4 mm in females); tibia four

times longer than wide in males (TbL 22.2—22.4 mm,

TbW 5.3—5.4 mm) tibia five times longer than wide in

females (TbL 24.2—29.4 mm, TbW 4.7—5.8 mm); relative

toe lengths I<I<HI<V<IV; webbing formula [3/4—11I’Z2—

1WIY%-1IV1—'AV; subarticular tubercles distinct; formula

1,1,2,3,2; inner metatarsal tubercle oval. Skin: Dorsal

surface of head and body, upper part of flanks smooth;

limbs without distinct dermal flads and folds except for a

weakly developed fold along outer edge of 4" finger and

5" toe; weak tubercles and protuberances on outer edge

of tarsus; ventral surface smooth.

Coloration in life. Dorsal surface reddish brown, with

some darker markings, flanks light brown with dark

brown reticulation and yellow spots; venter whitish to

light brownish with some indistinct small dark spots.

Ecological notes. Specimens were found on the bough

around small puddles, between 19:30 and 23:00 hours.

The surrounding habitat consisted secondary forest com-

posed of small hardwoods.

Distribution. In Vietnam, R. orlovi was known from

Dien Bien and Son La provinces in the North southwards

to Gia Lai Province in the Centre (Nguyen et al. 2009,

2015). Elsewhere, this species is known from Laos (Frost

2020).

Zhangixalus pachyproctus Yu, Hui, Hou, Wu, Rao &

Yang, 2019

Protruded-vent Treefrog / Ech cay hau mon loi (Fig. 3d)

Specimen examined (n = 1). One adult female

VNMN.06923 collected by Pham et al. on 21 June 2018,

near Na Phuong Village (22°29.432' N, 105°23.437' E,

at an elevation of 812 m asl.), Thuong Lam Commune,

Lam Binh District.

Bonn zoological Bulletin 70 (1): 201-219

Description. Morphological characters of the speci-

men from Tuyen Quang Province agreed well with the

description of Yu et al. (2019): SVL 93.9 mm; head lon-

ger than wide (HL 34.1 mm, HW 33.6 mm); snout round,

longer than eye diameter (SL 13.8 mm, ED 6.5 mm);

nostrils oval, closer to the tip of snout than to eye (NS

6.9 mm, EN 7.5 mm); canthus rostralis distinct, loreal

region concave; eye large, approximately diameter of

tympanum (TD 5.1 mm), tympanum indistinct; supra-

tympanic fold distinct, vomerine teeth distinct; tongue

notched posteriorly.

Forelimbs: Forearm slender (FLL 16.3 mm),

hand length (HAL 52.3 mm); relative finger lengths

I<II<IV<III, tips of fingers enlarged into discs; webbing

formula I1—2/3111—'AIII1-O1V; subarticular tubercles dis-

tinct; formula 1,1,2,1; inner palmar tubercles larger.

Hindlimbs: Thigh slender (FeL 50.2 mm); tibia five

times longer than wide (TbL 48.2 mm, TbW 8.7 mm); rel-

ative toe lengths I<II<HI<V<IV; full webbed; subarticu-

lar tubercles distinct; formula 1,2,2,3,2; inner metatarsal

tubercle oval. Skin: Dorsal surface of head and body, up-

per part of flanks smooth; ventral surface smooth.

Coloration in life. Dorsal surface of head and body

uniformly green, a narrow white stripe present along the

flanks; ventral surface cream.

Ecological notes. The specimen was found at 19:30

hours on the bough along a stream. The surrounding hab-

itat consisted of mixed secondary forest composed of

small hardwoods and shrubs.

Distribution. In Vietnam, Z. pachyproctus was known

from Dien Bien, Son La, Cao Bang, Bac Giang, Thanh

Hoa, Nghe An and Quang Binh provinces (as Rhacopho-

rus maximus, see discussion below) (Nguyen et al. 2009,

2015; Pham AV et al. 2017; Pham CT et al. 2017). Else-

where, this species is known from northeastern India,

Nepal, China, Laos, and Thailand (Nguyen et al. 2009;

Luu et al. 2014; Frost 2020).

Family Colubridae

Lycodon futsingensis (Pope, 1928)

Futsing Wolf Snake / Ran khuyet fut-sing (Fig. 4a)

Specimens examined (n= 2). IEBR 4754 and IEBR 4755

(adult females) collected by Pham et al. on 14 June 2018,

near Nam Duong Village (22°36.283' N, 105°20.367' E,

at an elevation of 850 m asl.), Sinh Long Commune, Na

Hang District.

Description. Morphological characters of the speci-

mens agreed with the descriptions of Hecht et al. (2013),

Le et al. (2014), and Nguyen et al. (2018): Body robust,

subcylindrical; head longer than wide, distinct from

neck; snout obtuse; nostril lateral; eye large, pupil verti-

cal; head scalation complete: internasals 2, prefrontals 2,

parietals 2, supraocular 1, and frontal 1; supralabials 8/8,

35" in contact with eye; infralabials 9/9, 1s\W-4" border-

©ZFMK

210

Dzung Trung Le et al.

Fig. 4. a. Lycodon futsingensis, adult female (IEBR 4755). b. Lycodon pictus, adult female (IEBR 4756). ¢. Lycodon subcinctus,

adult female (IEBR 4757). d. Protobothrops mucrosquamatus, adult male JEBR 4758) from Tuyen Quang Province, Vietnam.

ing chin shields; dorsal scale rows 17—17—15, smooth;

scales of the outer dorsal scale row slightly enlarged;

ventrals 180-211; subcaudals 81-90, paired; cloacal un-

divided.

Coloration in life. Dorsal surface of body and tail

grayish brown to dark brown with 24—26 light brownish

streaks, 12-14 crossbands on dorsal surface of tail; body

bands in Y-shaped at the mid-body; dorsal head grey with

cream bands from eye to neck; belly white; the underside

of the tail dark brown.

Ecology notes. The specimens were collected between

20:00 and 23:00 hours, in rocky streams. The surround-

ing habitat was mixed secondary forest consisting of

small hardwoods and shrubs. Air temperature was 23-

29°C and relative humidity was 70-75%.

Distribution. In Vietnam, Lycodon futsingensis was

known from Dien Bien Province in the north southwards

to Quang Binh and Quang Tri provinces in central Viet-

nam. Elsewhere, this species 1s known from China and

Laos (Nguyen et al. 2009; Uetz et al. 2020).

Remarks. The specimens in Tuyen Quang differ from

those in the description of Le et al. (2014) in having few-

er crossbands on tail (12-14 vs. 17).

Bonn zoological Bulletin 70 (1): 201-219

Lycodon pictus Janssen, Pham, Ngo, Le, Nguyen &

Ziegler, 2019

Pictus Wolf Snake / Ran khuyet pic-tus (Fig. 4b)

Specimen examined (n = 1). IEBR 4756 (adult fe-

male) collected by Pham et al. on 1 September 2017, near

Na Phuong Village (22°29.750' N, 105°18.650' E, at an

elevation of 252 m asl.), Thuong Lam Commune, Lam

Binh District.

Description. Morphological characters of the speci-

men agreed with the description of Janssen et al. (2019):

Body robust, subcylindrical; head longer than wide, dis-

tinct from neck; snout obtuse; nostril lateral; eye large,

pupil vertical; head scalation complete: internasals 2,

prefrontals 2, parietals 2, supraoculars 2, frontal 1; su-

pralabials 8/8, 3-5" in contact with eye; infralabials

10/10, 1s-5 bordering chin shields; dorsal scale rows

17-17-15, smooth; scales of the outer dorsal scale row

slightly enlarged; ventrals 213; subcaudals 90, paired;

cloacal single.

Coloration in life. The body and tail surfaces alter-

nating light brown and cream bands with 25 light bands

on the body; 13 light bands on the tail; ventral surface

mostly cream with dark bands 1n part extending towards

the venter.

Ecology notes. The specimen was found at 22:00 hours

while foraging near a small stream. The surrounding hab-

itat was mixed primary forest consisting of large hard-

©ZFMK

New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam 21

woods and shrubs. Air temperature was 26°C and relative

humidity was 80%.

Distribution. Lycodon pictus was originally discov-

ered from Cao Bang Province in northern Vietnam (Jans-

sen et al. 2019). The species was recently recorded from

Guangxi Zhuang Autonomous Region, China, approxi-

mately 60 km apart from the type locality (Janssen et al.

2020).

Remarks. The specimen from Tuyen Quang differed

from those in the description of Janssen et al. (2019) by

having a greater ratio of tail length/total length (TAL/TL

0.224 vs. 0.211—0.215) and fewer light bands on the body

(25 vs. 28 or 29).

Lycodon subcinctus Boie, 1827

Malayan Banded Wolf Snake / Ran khuyet dai (Fig. 4c)

Specimen examined (n = 1). IEBR 4757 (adult female)

collected by Pham et al. on 26 August 2017 near Nam

Duong Village (22°35.100' N, 105°22.083' E, at an el-

evation of 350 m asl.), Sinh Long Commune, Na Hang

District.

Description. Morphological characters of the speci-

men agreed with the descriptions of Smith (1943) and

Nguyen (2007): Body robust, subcylindrical; head longer

than wide, distinct from neck; snout obtuse; nostril lat-

eral; eye large, pupil vertical.; head scalation complete:

internasals 2, prefrontals 2, parietals 2, supraocular 1,

frontal 1; supralabials 8/8, 3-5" in contact with eye;

infralabials 9/9; dorsal scale rows 17—17—15, keeded;

scales of the outer dorsal scale row slightly enlarged;

ventrals 197; subcaudals 78, paired; cloacal divided.

Coloration in life. Black upper body and tail surface

with white markings on the body extending to the outer-

most scales; creamy yellow abdomen with dark obscure

spots.

Ecology notes. The specimen was found at 21:00 hours

while hiding in a small hole along the bank of a stream.

The surrounding habitat was mixed secondary forest con-

sisting of small hardwoods and shrubs. Air temperature

was 30°C and relative humidity was 82%.

Distribution. In Vietnam, this species was known

from Lai Chau and Bac Kan provinces in the north south-

wards to Lam Dong and Binh Phuoc provinces in central

Vietnam (Nguyen et al. 2009). Elsewhere, this species

is known from China, Thailand, Laos Cambodia, Malay-

sia, Brunei, Indonesia and the Philippines (Nguyen et al.

2009; Uetz et al. 2020).

Family Viperidae

Protobothrops mucrosquamatus (Cantor, 1839)

Brown Spotted Pit Viper / Ran luc cuom (Fig. 4d)

Specimen examined (n = 1). IEBR 4758 (adult male)

collected by Pham et al. on 14 June 2018 near Nam

Bonn zoological Bulletin 70 (1): 201-219

Duong Village (22°36.283' N, 105°20.367' E, at an el-

evation of 850 m asl.), Sinh Long Commune, Na Hang

District.

Description. Morphological characters of the spec-

imen agreed with the descriptions of Bourret (1936),

Smith (1943), Leviton et al. (2003), Nguyen (2007), Stu-

art & Heatwole (2008), Nguyen et al. (2011), Luu et al.

(2013), and Nemes et al. (2013): Head longer than wide,

triangle shaped, distinct from neck; snout obtuse; nos-

tril dorsolateral; eye large; upper head scales, irregular,

scarcely increasing in size anteriorly, no loreal; preocular

1; postocular 1; no temporal; supralabials 10/10; infral-

abials 14/14, 1°~3™ bordering chin shields; dorsal scale

rows 31-25-19, feebly keeled; ventrals 241; cloacal sin-

gle; subcaudals 56+, paired.

Coloration in life. Dorsal head brown, paler below;

dorsum greyish brown, with a series of large brown, dark

edged spots; a dark brown line from eye to the angle of

the mouth, edged in black; ventral surface brownish with

white blotches; dorsal tail light brown, with a series of

conspicuous black spots.

Ecology notes. The specimen was found at 20:30

hours while crawling near the waterfall. The surrounding

habitat was mixed secondary forest consisting of small

hardwood and shrub. Air temperature was 28°C and rela-

tive humidity was 90%.

Distribution. In Vietnam, this species was known

from Ha Giang and Cao Bang provinces in the north

southwards to Kon Tum and Gia Lai provinces in central

Vietnam (Nguyen et al. 2009). Elsewhere, this species

is known from Russia, China, Myanmar, Taiwan, Myan-

mar, Thailand, Laos, and Malaysia (Uetz et al. 2020).

Trimeresurus stejnegeri Schmidt, 1925

Bamboo Pit Viper / Ran luc xanh (Fig. 5)

Specimen examined (n = 1). IEBR 4759 (adult male)

collected by Pham et al. on 18 June 2018 near Trung Phin

Village (22°31.433' N, 105°22.750!' E, at an elevation of

555 m asl.), Sinh Long Commune, Na Hang District.

Description. Morphological characters of the speci-

men agreed with the descriptions of David et al. (2001,

2002), Bain & Nguyen (2004), and Hecht et al. (2013):

Head longer than wide, triangle shape, distinct from neck;

snout obtuse; nostril dorsolateral; eye large; upper head

scales, irregular, scarcely increasing in size anteriorly, no

loreal; preocular 1; postocular 1; no temporal; supralabi-

als 9/10; infralabials 13/14, 1‘W-3™ bordering chin shields;

dorsal scale rows 23—21—15, feebly keeled; ventrals 160;

cloacal single; subcaudals 55+, paired.

Coloration in life. Dorsum green above, venter lighter

than dorsum; a distinct whitish-yellow stripe down the

side of the body; no postocular stripe; tip of tail pale red-

dish.

Ecology notes. The specimen was found at 22:00

hours, while resting on a tree branch near a small pool

©ZFMK

212 Dzung Trung Le et al.

Fig. 5. Trimeresurus stejnegeri, adult male (IEBR 4759) from Tuyen Quang Province, Vietnam.

in a forest. The surrounding habitat was mixed second-

ary forest consisting of small hardwoods and shrubs. Air

temperature was 30°C and relative humidity was 82%.

Distribution. In Vietnam, this species was known

from Lao Cai Province in the north southwards to Quang

Binh Province and Da Nang City in the south (Nguy-

en et al. 2009). Elsewhere, this species is known from

China, Taiwan, and Myanmar (Nguyen et al. 2009; Uetz

et al. 2020).

DISCUSSION

Our new records bring the total number of amphibian

species to 57 and that of snakes to 42 in Tuyen Quang

Province (Table 1). Some taxonomic changes of amphib-

ians were made by recent studies, for example, Nguy-

en et al. (2009) documented the distribution of Lepto-

brachella pelodytoides (Boulenger, 1893) from Lao Cai

Province in the North southwards to Gia Lai Province,

however, Ohler et al. (2011) indicated that L. pelodyto-

ides has a restricted distribution in Myanmar and records

of L. pelodytoides in Vietnam should be assigned to the

L. ventripunctata (Fei, Ye & Li, 1990) group. Matsui

et al. (2010) and McLeod (2010) stated that the previous

record of Limnonectes kuhlii (Tschudi, 1838) in Vietnam

(Nguyen et al. 2009) should be re-identified as L. banan-

ensis Ye, Fei, Xie & Jiang, 2007. Kuraishi et al. (2012)

Bonn zoological Bulletin 70 (1): 201-219

re-identified the records of Polypedates leucomystax

(Gravenhorst, 1829) from Vietnam (Nguyen et al. 2009)

as P. mutus (Smith, 1940) and P. megacephalus Hallow-

ell, 1861. Jiang et al. (2019) resurrected the genus Lepto-

mantis and described a new genus Zhangixalus. Based on

morphological and molecular evidences Yu et al. (2019)

suggested that previous records of R. maximus in Viet-

nam, Laos and Thailand (Nguyen et al. 2009) should be

provisionally assigned to Zhangixalus pachyproctus Yu,

Hui, Hou, Wu, Rao & Yang, 2019. In this study, we fur-

ther extend the distribution of a recently described snake

(Lycodon pictus) in northern Vietnam, including color

pattern variation. The new record of the species in Tuyen

Quang Province is approximately 70 km distant from the

type locality in Cao Bang Province.

Tuyen Quang Province also harbors a high number

of species of conservation concern. Four species are

currently only known from Vietnam, eight species are

listed in the IUCN Red List (2020), three species listed

in the Vietnam Governmental Decree No 06/2019/ND-

CP, three species listed in the CITES appendices (2020),

and 16 species listed in the Red Data Book of Vietnam

(2007).

©ZFMK

New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam 213

Table 1. List of amphibian and snake species recorded from Tuyen Quang Province, Vietnam. Asterisks (*) denote new provin-

cial records. References include: 1 = Le et al. (2007); 2 = Nguyen et al. (2009); 3 = Phan et al. (2018); 4 = Pham et al. (2019a);

5 = Pham et al. (2019b); 6 = this study. IUCN = IUCN Red List of Threatened species, Decree 061 = Decree No 06/2019/ND-CP of

the Government of Vietnam on management of threatened and rare wild plants and animals, CITES = CITES appendices.

No Species name Common name Reference Red Data IUCN Decree CITES

Book (2020) 06(2019) (2020)

(2007)

ANURA FROGS

Bufonidae Toads

1... Duttaphrynus melanostictus (Schnei- Asian Common Toad 1, 2,6

der, 1799)

2. Ingerophrynus galeatus Gunther, Cambodia Toad 1 VU

1864

Hylidae Treefrogs

3. Ayla simplex Boettger, 1901 Annam Treefrog 1

Megophryidae Spadefoot frogs

4. Leptobrachella nahangensis (Lath- Nahang Asian Toad 1/-2.6

rop, Murphy, Orlov & Ho, 1998)

5. __L. sungi (Lathrop, Murphy, Orlov & Sung’s Toad 6

Ho, 1998)

6. _L. ventripunctatus (Fei, Ye & Li, Yunnan Asian Toad 1, 2,6

1990)

7. Leptobrachium chapaense (Bourret, | Chapa Spadefoot Toad 6

1937)

8. L. guangxiense Fei, Mo, Ye & Yang, | Guangxi Pseudomous- 6

2009° tache Toad

9. | Megophrys maosonensis Bourret, Mauson Mountain 1,6

1937 Toad

10. M. microstoma Boulenger, 1903° Asian Mountain Toad 1,6

11. M. pachyprotus Kou, 1985 Huang’s Spadefoot 1

Toad

Microhylidae Narrow-mouthed

frogs

12. Kalophrynus interlineatus (Blyth, Bubble-nest Frog l

1855)

13. Kaloula pulchra Gray, 1831 Malaysian Narrow- 1

mouth Toad

14. Microhyla butleri Boulenger, 1900 Butler’s Pigmy Frog 1.2

15. M. fissipes Boulenger, 1884 Ornate Pigmy Frog i ees

16. M. heymonsi Vogt, 1911 Taiwan Rice Frog 1, 2,6

17. M. pulchra (Hallowell, 1861) Guangdong Rice Frog 12.26

18. Micryletta inornata (Boulenger, 1890) Deli Paddy Frog l

Dicroglossidae True frogs

19. Fejervarya limnocharis (Gravenhorst, Rice-paddy Frog 1, 2.6

1829)

20. Hoplobatrachus rugulosus (Wieg- Common Lowland 1, 2,6

mann, 1834) Frog

21. Limnonectes bannaensis Ye, Fei & Banna Large-headed 12,6

Jiang, 2007 Frog

Bonn zoological Bulletin 70 (1): 201-219

©ZFMK

214 Dzung Trung Le et al.

Table 1. Continued.

No Species name Common name Reference Red Data TIUCN Decree CITES

Book (2020) 06(2019) (2020)

(2007)

ANURA FROGS

22. L. limborgi (Sclater, 1892) Taylor’s Frog 6

23. L. nguyenorum McLeod, Kurlbaum Neguyen’s Wart Frog S)

& Hoang, 2015

24. Quasipaa boulengeri (Ginther, 1889) Boulenge’s Spiny 6 EN

Frog

25. @Q. delacouri (Angel, 1928) Tonkin Asian Frog 1 EN

26. Q. spinosa (Davis, 1875) Chinese Spiny Frog l VU

27. @Q. verrucospinosa (Bourret, 1937) Verrucose Spiny Frog 12

28. Occidozyga lima (Gravenhorst, 1829) Green Puddle Frog 1.256

29. O. martensii (Peter, 1867) Marten’s Frog 1

Ranidae Ranids

30. Amolops ricketti (Roulenger, 1899) Chinese Sucker Frog I

31. Hylarana macrodactyla (Gunther, Guangdong Frog 1

1859 ”1858”)

32. H. taipehensis Van Denburgh, 1909 Taipei Frog l

33. Odorrana andersonii (Boulenger, Anderson’s Frog 1,2 VU

1882)

34. O. bacboensis (Bain, Lathrop, Mur- Tonkin Frog 1,2

phy, Orlov & Ho, 2003)

35. O. chloronota (Ginther, 1875) Green Cascade Frog 1,2, 6

36. O. geminata Bain, Stuart, Nguyen, Geminated Cascade 4 VU

Che & Rao, 2009 Frog

37. O. lipuensis Mo, Chen, Wu, Zhang & —Lipu Cascade Frog 4

Zhou, 2015

38. O. nasica (Boulenger, 1903) Long-snout Torrent 6

Frog

39. O. tiannanensis (Yang & Li, 1980) Tiannan Odorous Frog 1,2

40. Rana johnsi Smith, 1921 John’s Frog 1,2,6

41. Sylvirana guentheri (Boulenger, Gunther’s Amoy Frog 1, 2,6

1882)

42. §. maosonensis (Bourret, 1937 Mauson Frog 128

43. S. nigrovittata (Blyth, 1855) Black-striped Frog l

Rhacophoridae Treefrogs

44. Chiromantis doriae (Boulenger, 1893) Doria’s Asian Treefrog Led

45. Kurixalus bisacculus (Taylor, 1962) Taylor’s Tree Frog 1,2

46. Polypedates megacephalus Hallowell, Hong Kong Whipping 1,6

1861 Frog

47. P. mutus (Smith, 1940) Burmese Whipping 1, 2,6

Frog

48. Raorchestes gryllus (Smith, 1924) Langbian Bubble-nest 122 VU

Frog

New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam

Table 1. Continued.

49.

50.

51.

52.

53.

54.

56.

its

58.

De.

60.

61.

62.

63.

64.

65.

66.

67.

68.

Species name

ANURA

R. parvulus (Boulenger, 1893)

Rhacophorus kio Ohler & Delorme,

2006°

R. orlovi Ziegler & Kohler, 2001°

Theloderma albopunctatum (Liu &

Hu, 1962)

T. corticale (Boulenger, 1903)

Zhangixalus dennysii (Blanford,

1881)

Z. pachyproctus Yu, Hui, Hou, Wu,

Rao & Yang, 2019"

CAUDATA

Salamandridae

Paramesotrion deloustali (Bourret,

1934)

GYMNOPHIONA

Ichthyophiidae

Ichthyophis bannanicus Yang, 1984

SERPENTES

Typhlopidae

Indotyphlops braminus (Daudin,

1803)

Xenopeltidae

Xenopeltis unicolor Reinwardt, 1827

Boidae

Python molurus (Linnaeus, 1758)

Colubridae

Ahaetulla prasina (Bote, 1827)

Amphiesma stolatum (Linnaeus,

1758)

Boiga guangxiensis Wen, 1998

B. kraepelini Stejneger, 1902

B. multomaculata (Boie, 1827)

Calamaria septentrionalis Boulenger,

1890

Coelognathus radiatus (Boie, 1827)

Dendrelaphis pictus (Gmelin, 1789)

Bonn zoological Bulletin 70 (1): 201-219

Common name

FROGS

Karin Bubble-nest

Frog

Black-webbed

Treefrog

Orlov’s Treefrog

Dotted Bubble-nest

Frog

Tonkin Bug-eyed Frog

Denny’s Whipping

Frog

Protruded-vent

Treefrog

SALAMANDERS

Salamanders

Vietnamese Salaman-

der

CAECILIANS

Asian Tailed Caeci-

lians

Banna Caecilian

SNAKES

Blind snakes

Common blind snake

Sunbeam snakes

Sunbeam snake

Pythons

Indian rock python

Colubrines

Oriental whip snake

Buff striped keelback

Guangxi cat snake

Kraepelin’s cat snake

Many-spotted cat

snake

Hongkong dwarf

snake

Copperhead racer

Common bronzeback

215

CITES

Reference Red Data IUCN Decree

Book (2020) 06(2019) (2020)

(2007)

6 EN

1,6

1,2 EN

| ee VU

1 CR VU IIB

1 VU

©ZFMK

216

Table 1. Continued.

Dzung Trung Le et al.

No _ Species name Common name Reference Red Data IUCN Decree CITES

Book (2020) 06(2019) (2020)

(2007)

SERPENTES SNAKES

69. Elaphe moellendorffi (Boettger, 1886) Moellendorf’s rat 1 VU VU

snake

70. Euprepiophis mandarinus (Cantor, Mandarin rat snake [2 VU

1842)

71. Lycodon futsingensis (Pope, 1928)* Futsing wolf snake 6

72. L. meridionalis (Bourret, 1935) Southern big-tooth l

snake

73. LL. pictus Janssen, Pham, Ngo, Le, Pictus wolf snake 6

Nguyen & Ziegler, 2019*

74. L. subcinctus (Boie,1827)* Malayan banded wolf 6

snake

75. L. rufozonatus Cantor, 1842 Red-banded snake [2

76. O. cinereus (Gunther, 1864) Gunther’s kukri snake 1

77. O. eberhardti Pellegrin, 1910 Eberhardt’s kukri 1

snake

78. O. taeniatus (Gunther, 1861) Striped kukri snake 1

79. Ptyas korros (Schlegel, 1837) Indo-chinese rat snake P2 EN

80. P mucosa (Linnaeus, 1758) Oriental rat snake l EN

81. P multicinctus (Roux, 1907) Many-banded green 3

snake

Homalopsidae Muds snakes

82. Hypsiscopus plumbea (Boie, 1827) Boie’s mud snake 1

83. Myrrophis chinensis (Gray, 1842) Chinese mud snake 1

Lamprophiidae Mock vipers

84. Psammodynastes pulverulentus Common mock viper 3

(Boie, 1827)

Natricidae Keelback snakes

85. Fowlea flavipunctatus (Hallowell, Yellow-spotted keel- 1

1860) back

86. Hebius boulengeri (Gressit, 1937) Tai-yong keelback 3

87. H. deschauenseei (Taylor, 1934) Deschauensee’s keel- 2

back

88. Opisthotropis jacobi Angel & Bour- Chapa mountain keel- 2

ret, 1933 back

89. Rhabdophis subminiatus (Schlegel, Red-necked keelback 1

1837)

90. Sinonatrix percarinata (Boulenger, Eastern water snake 1

1899)

Pareatidae Slug snakes

91. Pareas hamptoni (Boulenger, 1905) Hampton’s slug snake 3

92. P margaritophorus (Jan, 1866) Mountain slug snake 3

Bonn zoological Bulletin 70 (1): 201-219

©ZFMK

New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam 217

Table 1. Continued.

No Species name Common name Reference Red Data IUCN Decree CITES

Book (2020) 06(2019) (2020)

(2007)

SERPENTES SNAKES

Pseudoxenodontidae Bamboo snake

93. Pseudoxenodon bambusicola Vogt, Bamboo snake 1

1922

Elapidae Kraits

94. Bungarus fasciatus (Schneider, 1801) Banded krait 1 EN

95. B. multicinctus Blyth, 1861 Many-banded krait 1

96. Naja atra Cantor, 1842 Chinese cobra 2 EN VU IIB II

97. Ophiophagus hannah (Cantor, 1836) King cobra l CR VU IB II

Viperidae Vipers

98. Protobothrops mucrosquamatus Brown spotted pit 6

(Cantor, 1839)* viper

99. Trimeresurus stejnegeri Schmidt, Bamboo pit viper 6

19257

Acknowledgements. We are grateful to the directorate of the

Forest Protection Department of Tuyen Quang Province for

support of our field work. We thank Potess F, Nguyen NQ, and

Uong HS (PRCF) for support of our field work in Lam Binh/

Na Hang, Nguyen T and Nguyen T (Sinh Long Commune) for

their assistance in the field. For the fruitful cooperation within

joint research projects we cordially thank Nguyen SV (IEBR,

Hanoi), as well as Pagel T and Landsberg C (Cologne Zoo).

This research was supported by the Vietnam Academy of Sci-

ence and Technology (Project Code: DLSD00.01/20-23). Field

surveys in Lam Binh/Na Hang were partially supported by the

People Resources and Conservation Foundation (PRCF) and

Cologne Zoo.

REFERENCES

Bain RH, Nguyen TQ (2004) Herpetofaunal diversity of Ha

Giang Province in northeastern Vietnam, with description of

two new species. American Museum Novitates 3453: 1-42

Bourret R (1936) Les serpents de | Indochine. I. Etudes sur la

faune. Henry Basuyau et Cie, Toulouse

Bourret R (1942) Les batraciens de I’Indochine. Institut

Océanographique de I’Indochine: 1-547

Chen W, Zhang W, Zhou S, Li N, Huang Y, Mo Y (2013) Ins-

inght into validity of Leptobrachium guangxiense (Anura:

Megophryidae): evidence from mitochondrial DNA sequenc-

es and morphological charaters. Zootaxa 3641: 31-40

CITES (2020) CITES appendices. Online at http://www.cites.

org [last accessed Mar. 2020]

Clements R, Sodhi NS, Schilthuizen M, Peter KLN (2006)

Limestone karsts of Southeast Asia: Imperiled arks of biodi-

versity. BioScience 56 (9): 733-742

David P, Ashok C, Bharat BB (2001) On the occurrence of

Trimeresurus medoensis Djao in: Djao & Jaing, 1977 (Ser-

pentes, Viperidae, Crotalinae) in India, with a redescription

Bonn zoological Bulletin 70 (1): 201-219

of the species and notes on its biology. Hamadryad 26 (2):

210-226

David P, Vogel G, Pauwels OSG, Vidal N (2002) Description

of a new species of the genus 7rimeresurus from Thailand,

related to Trimeresurus stejnegeri Schmidt, 1925 (Serpentes,

Crotalidae). Natural History Journal of Chulalongkorn Uni-

versity 2 (1): 5-19

Dowling GH (1951) A proposed standard system of counting

ventrals in snakes. British Journal of Herpetology 1 (5):

97-99

Dubois A, Ohler A (1998) A new species of Leptobrachium

(Vibrissaphora) from northern Vietnam, with a review of the

taxonomy of the genus Leptobrachium (Pelobatidae, Mego-

phyinae). Dumerilia 4: 1-32

Fei L, Hu S, Ye C, Huang Y (2009) Fauna Sinica. Amphibia.

Volume 3. Anura. Science Press, Beijing: 1-887

Fei L, Ye C, Jiang J, Xie F (2008) Two new species of the Ra-

nidae from China, with phylogenetic relationships of Hylar-

ana (Sylvirana) nigrovittata group (Amphibia, Anura). Acta

Zootaxonomica Sinica 33: 199-206 (in Chinese with English

abstract)

Frost DR (2020) Amphibian Species of the World: an online

reference. Version 6.0. Online at http://research.amnh.org/

herpetology/amphibia/index.html [last accessed Jan. 2020].

American Museum of Natural History, New York, USA

Glaw F, Vences M (2007) A field guide to the amphibians and

reptiles of Madagascar. Third Edition, Frosch Verlag, Co-

logne

Hecht V, Pham CT, Nguyen TT, Nguyen TQ, Bonkowski M,

Ziegler T (2013) First report on the herpetofauna of Tay Yen

Tu Nature Reserve, northeastern Vietnam. Biodiversity Jour-

nal 4 (4): 507-552

Inger R, Stuart B (2010) Sysmatics of Limnonectes (Taylorana)

Dubois. Currens herpetology 29 (2): 51-58

IUCN (2020) The IUCN Red List of Threatened Species. Ver-

sion 2020.1. Online at http://www.iucnredlist.org [last ac-

cessed 6 Nov. 2020]

©ZFMK

218 Dzung Trung Le et al.

Janssen HY, Ren J-L, Li J-T, Wang Z, Nguyen TT, Nguyen

TQ, Bui QTT, Ngo HT, Le MD & Ziegler T (2020) Range

extension and extended diagnosis of Lycodon pictus: First

country record from China. Revue suisse de Zoologie 127

(2): 413-422

Janssen HY, Pham CT, No HT, Le MD, Nguyen TQ, Ziegler

T (2019) A new species of Lycodon Boie, 1826 (Serpentes,

Colubridae) from northern Vietnam. ZooKeys 875: 1—29

Jiang D, Jiang K, Ren J, Wu J, Li J (2019) Resurretion of the

genus Leptomantis, with Description of a New Genus to the

Family Rhacophoridae (Amphibia: Anura). Asian Herpeto-

logical Research 10 (1): 1-12

Kuraishi N, Matsui M, Hamidy A, Belabus D, Ahmad N, Banha

S, Sudin A, Yong H, Jiang J, Ota H, Thong H, Nishikawa

K (2012) Phylogennetic and taxonomic relationships of the

Polypedates leucomystax complex (Amphibia). Zoological

Sripta 42: 54—70

Lathrop A, Murphy RW, Orlov LN, Ho CT (1998) Two new

species of Leptolalax (Anura: Megophryidae) from northern

Vietnam. Amphibia-Reptilia 19: 253-267

Le DT, Nguyen SLH, Pham CT, Nguyen TQ (2014) New re-

cords of snakes (Squamata: Serpentes) from Dien Bien Prov-

ince. Journal of Biology 36 (4): 460-470

Le DT, Pham AV, Nguyen SLH, Ziegler T, Nguyen TQ (2014)

Babina lini (Chou, 1999) and Hylarana menglaensis Fei,

Ye et Xie, 2008, two additional anuran species for the her-

petofauna of Vietnam. Russian Journal of Herpetology 21:

315-321

Le NN, Nguyen HD, Can TTT, Hoang NV (2007) A survey

on amphibians and reptiles in Son Duong, Chiem Hoa and

Na Hang districts, Tuyen Quang Province. Hanoi National

university of Education Journal of Science 1: 100-106 (in

Vietnamese)

Leviton AE, Wogan GOU, Koo MS, Zug GR, Lucas RS, Vin-

dum JV (2003) The dangerously venomous snakes of Myan-

mar. Illustrated checklist with keys. Proceedings of the Cali-

fornia Academy of Sciences, ser. 4 (54): 407-460

Liu CC (1950) Amphibians of western China. Fieldiana. Zool-

ogy Memoires 2: 1-397

Liu Q, Yan JW, Hou SB, Wang P, Nguyen SN, Murphy RW,

Che J, Guo P (2020) A new species of the genus Sinomicru-

rus (Serpentes: Elapidae) from China and Vietnam. Zoologi-

cal Research 41 (2): 194-198

Luong AM, Nguyen HQ, Le DT, Nguyen SHL, Nguyen TQ

(2019) New records of amphibians (Anura: Megophryidae,

Ranidae) from Dien Bien Province, Vietnam. Herpetology

Notes 12: 375-387

Luu VQ, Calame T, Nguyen TQ, Ohler A, Bonkowski M,

Ziegler T (2014) First records of Gracixalus supercornutus

(Orlov, Ho & Nguyen, 2004) and Rhacophorus maximus

Gunther, 1858 from Laos. Herpetology Notes 7: 419-423

Luu VQ, Nguyen TQ, Pham CT, Dang NK, Vu TN, Miskovic

S, Bonkowski M, Ziegler T (2013) No end in sight? Further

new records of amphibians and reptiles from Phong Nha-Ke

Bang National Park, Quang Binh Province, Vietnam. Biodi-

versity Journal 4: 285-300

Manthey U, Grossmann W (1997) Amphibien und Reptilien

Stdostasiens. Natur und Tier-Verlag, Munster

Matsui M, Kuraushi N, Jiang JP, Ota H, Hamidy A, Orlov N.,

Nishikawa K (2010) Systematics reassessment of fanged

frogs from China and adjacent regions (Anura: Dicroglossi-

dae). Zootaxa 2345: 33-42

McLeod DS (2010) Of least concern? Systematics of a cryp-

tic species complex: Limnonectes kuhlii (Amphibia: Anura:

Bonn zoological Bulletin 70 (1): 201-219

Dicroglossidae). Molecuar Phylogenetics and Evolution 56:

991-1000

Neang T, Hartmann T, Seiha H, Nicholas JS, Neil MF (2014)

A new species of wolf snake (Colubridae: Lycodon Fitzinger,

1826) from Phnom Samkos Wildlife Sanctuary, Cardamom

Mountains, southwest Cambodia. Zootaxa 3814 (1): 68-80

Nemes L, Babb R, Devender WV, Nguyen KV, Le QK, Vu TN,

Rauhaus A, Nguyen TQ, Ziegler T (2013) First contribution

to the reptile fauna of Quang Ngai Province, central Vietnam.

Biodiversity Journal 4 (2): 301-326

Nguyen SV (2007) Fauna of Vietnam: Serpentes. Science and

Technics Publishing House, Hanoi

Nguyen LT, Hoang HV, Nguyen TT, McCormack TEM, Nguy-

en SN (2016) A collection of amphibians and reptilies from

Bac Huong Hoa Nature reserve, Quang Tri Province, Viet-

nam. Proceedings of the 3 National Scientific Conference

on Amphibians and Reptiles in Vietnam: 92-110

Nguyen TQ, Nguyen TV, Pham CT, Ong AV, Ziegler T (2018)

New records of snakes (Squamata: Serpentes) from Hoa

Binh Province, northwestern Vietnam. Bonn zoological Bul-

letin 67 (1): 15-24

Nguyen TQ, Pham CT, Le DT, Nguyen BV, Nguyen SLH

(2015) Diversity of tree frogs (Amphibia: Anura: Rhacopho-

ridae) from Dien Bien provice. Procceding of the 6" National

Scientific conference on Ecology and Biological Resources:

954-959

Nguyen TQ, Stenke R, Nguyen HX, Ziegler T (2011) The ter-

restrial reptile fauna of the biosphere Reserve Cat Ba Archi-

pelago, Hai Phong, Vietnam. Bonner zoologische Monogra-

phien 57: 99-115

Nguyen VS, Ho TC, Nguyen TQ (2009) Herpetofauna of Viet-

nam Edition Chimaira, Frankfurt am Main

Nguyen TV, Pham CT, Nguyen TQ (2016) New records and an

updated list of snakes (Squamata: Serpentes) from Xuan Lien

Nature Reserve, Thanh Hoa Province, Vietnam. Journal of

Biology 38 (3): 324-332

Ohler A (2003) Revision of the genus Ophryophryne Bouleng-

er, 1903 (Megophryidae) with description of two new spe-

cies. Alytes 21 (1-2): 23-44

Ohler A, Delorme M (2006) Well known does not mean well

studie: morphological and molecular support for existence

of sibling species in the Javanese gliding frog Rhacophorus

reinwardtii (Amphibia, Anura). Comptes Rendus Biologies

329: 86-97

Ohler A, Wollenberg KC, Grosjean S, Hendrix R, Vences M,

Ziegler T, Dubois A (2011) Sorting out Lalos: description of

new species and additional taxonomic data on Megophryid

frogs from northern Indochina (genus Leptolalax, Mego-

phryidae, Anura). Zootaxa 3147: 1-83

Ostroshabov A, Orlov N, Nguyen TT (2013) Taxonomy of frogs

of genus Rhacophorus of “hoanglienensis—orlovi” complex.

Russian Jounral of Herpetology 20 (4): 301-324

Pham AV, Nguyen TQ, Ziegler T, Nguyen TT (2017) New re-

cords of tree frogs (Anura: Rhacophoridae: Rhacophorus)

from Son La Province, Vietnam. Herpetology Notes 10: 376—

386

Pham AV, Pham CT, Hoang NV, Ziegler T, Nguyen TQ (2017)

New records of amphibians and reptiles from Ha Giang Prov-

ince, Vietnam. Herpetology Notes 10: 183-191

Pham AV, Tu HV, Nguyen TQ, Pham CT, Song NB, Bui QT,

Hoang TLQ (2016) Species diversity of the family Dicro-

glossidae (Amphibia: Anura) from Son La Province. Pro-

ceedings of the 3% National Scientific Conference on Am-

phibians and Reptiles in Vietnam: 133—139 (in Vietnamese)

©ZFMK

New records and an updated checklist of amphibians and snakes from Tuyen Quang Province, Vietnam 219

Pham CT, An HT, Herbst S, Bonkowski M, Ziegler T, Nguyen

TQ (2017) First report on the amphibian fauna of Ha Lang

karst forest, Cao Bang Province, Vietnam. Bonn zoological

Bulletin 66: 37-53

Pham CT, Nguyen TQ, Luong AM, Phan TQ, Le DT (2019a)

New records of cascade frogs (Amphibia: Anura: Ranidae:

Odorrana) from Tuyen Quang Province. Procceding of the

4" National Scientific conference on Amphibians and Rep-

tiles in Vietnam: 173-177

Pham CT, Phan TQ, Do DT, Nguyen TQ (2019b) New pro-

vincial records of the genus Limnonectes (Amphibia: An-

ura: Dicroglossidae) from Vietnam. Journal of Biology

41 (2se1&2se2): 169-176

Phan TQ, Hoang NV, Pham AV, Pham CT, Nguyen TQ, Le DT

(2018) New records of reptiles from Tuyen Quang Province,

Vietnam. Proceeding of the 3% National Scienctific Con-

ference on Biological Research and Teaching in Vietnam:

371-381

Simmons JE (2002) Herpetological collecting and collections

management. Revised edition. Society for the Study of Am-

phibians and Reptiles. Herpetological Circular 31: 1-153

Smith MA (1943) The fauna of British India, Ceylon and Bur-

ma, including the whole of the Indo-Chinese Subregion.

Reptilia and Amphibia. Vol. HI. Serpentes. Taylor and Fran-

cis, London

Sterling EJ, Hurley MM, Le MD (2006) Vietnam: A Natural

History. Yale University Press, New Haven and London

Stuart LB, Heatwole H (2008) Country records of snakes from

Laos. Hamadryad 33 (1): 97-106

Taylor EH (1962) The Amphibian fauna of Thailand. Universi-

ty of Kanas Science Bulletin 63: 65-599

The Goverment of Vietnam (2019) Decree No 06/2019/ND-CP

of the Government of Vietnam on management of threatened

and rare wild plants and animals, dated on 22 January 2019.

Hanoi

Tran DTA, Le QK, Le KV, Vu TN, Nguyen TQ, Bo6hme W,

Ziegler T (2010) First and preliminary frog records (Amphib-

ia: Anura) from Quang Ngai Province, Vietnam. Herpetology

Notes 3: 111-119

Tran K, Ho CT, Nguyen SV, Pham T (2007) Reptiles and Am-

phibians. In: Dang TN, Tran K, Dang HH, Nguyen C, Nguy-

en TN, Nguyen YH, Dang DT, (Eds.). Vietnam Red Data

Book, Part 1. Animals. Science and Technology Publishing

House, Hanoi

Bonn zoological Bulletin 70 (1): 201-219

Webb CO, Slik JWE, Triono T (2010) Biodiversity inventory and

informatics in Southeast Asia. Biodiversity Conservation 19:

955-972

Uetz P, Freed T, HoSek J (2020) The Reptile Database. Online

at http://reptile-database.reptarium.cz/search.php [last ac-

cessed Mar. 2020]

Vogel G, David P, Pauwels OSG, Sumontha M, Norval G, Hen-

drix R, Vu TN, Ziegler T (2009) A revision of Lycodon ruh-

strati (Fischer 1886) auctorum (Squamata: Colubridae), with

the description of a new species from Thailand and a new

subspecies from the Asian mainland. Tropical Zoology 22:

131-182

Yu G, Hui H, Hou M, Wu Z, Rao D, Yang J (2019) A new spe-

cies of Zhangixalus (Anura: Rhacophoridae), previously

confused with Zhangixalus smaragdinus (Blyth, 1852). Zoo-

taxa 4711 (2): 275-292

Ziegler T, David P, Ziegler TN, Pham CT, Nguyen TQ, Le MD

(2018a) Morphological and molecular review of Jacob’s

Mountain Stream Keelback Opisthotropis jacobi Angel &

Bourret, 1933 (Squamata: Natricidae) with description of a

sibling species from northern Vietnam. Zootaxa 4374 (4):

476-496

Ziegler T, Hendrix R, Vu TN, Vogt M, Forster B, Dang KN

(2007) The diversity of a snake community in a karst forest

ecosystem in the central Truong Son, Vietnam, with an iden-

tification key. Zootaxa 1493: 1—40

Ziegler T, Kohler J (2001) Rhacophorus orlovi sp. N., ein neuer

Ruderfrosch aus Vietnam (Amphibia: Anura: Rhacophori-

dae). Sauria 23: 37-46

Ziegler T, Ngo HN, Pham AV, Nguyen TT, Le MD, Nguyen

TQ (2018b) A new species of Parafimbrios from northern

Vietnam (Squamata: Xenodermatidae). Zootaxa 4527 (2):

269-276

Ziegler T, Nguyen TQ, Pham CT, Nguyen TT, Pham AV, van

Schingen M, Nguyen TT, Le MD (2019a) Three new species

of the snake genus Achalinus from Vietnam (Squamata: Xe-

nodermatidae). Zootaxa 4590: 249-269

Ziegler T, Pham CT, Nguyen TV, Nguyen TQ, Wang J, Wang

Y-Y, Stuart BL, Le MD (2019b) A new species of Opistho-

tropis from northern Vietnam previously misidentified as

the Yellow-spotted Mountain Stream Keelback O. maculosa

Stuart & Chuaynkern, 2007 (Squamata: Natricidae). Zootaxa

4613: 579-586

©ZFMK

BHL

Blank Page Digitally Inserted

Bonn zoological Bulletin 70 (1): 221-225

2021 - Mengual X. & Ssymank A.

https://do1.org/10.20363/BZB-2021.70.1.221

ISSN 2190-7307

http://www.zoologicalbulletin.de

Research article

urn:|sid:zoobank.org:pub:508524B5-F680-4244-9749-E584F32CC1D1

Psilota exilistyla Smit & Vujié, 2008 (Diptera: Syrphidae),

a new Species for the German fauna

Ximo Mengual'* & Axel Ssymank’

'Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, D-53113 Bonn, Germany

?Falkenweg 6, D-53343 Wachtberg, Germany

* Corresponding author: Email: x.mengual@leibniz-zfmk.de

'urn:Isid:zoobank.org:author:A5093 1 OD-B567-4830-B8A4-BCB139BB8768

2urn:|sid:zoobank.org:author:58B9D453-586C-4B08-BA D6-BCC606E3D654

Abstract. A new flower fly species for Germany is reported. Psilota exilistyla Smit & Vujic, 2008 (Diptera: Syrphidae)

is recorded from the Black Forest (Schwarzwald, Baden-Wiurttemberg, south-west Germany). Published records of P.

exilistyla are given in a distribution map.

Key words. New record, hover fly, hoverfly, flower fly, Germany, Schwebfliegen.

INTRODUCTION

The genus Psi/ota Meigen, 1822 (Diptera, Syrphidae,

Eristalinae) is a relatively small group of rarely collected

flower flies, with the exception of a few relatively com-

mon Australian species (Smit & Vuji¢ 2008; Young et al.

2020). The genus is widely distributed, present in the Ne-

arctic (three species), Palaearctic (nine species), Austra-

lian (34 species) and Indomalayan (five species) regions

(Thompson 2013; Young et al. 2020; Radenkovic et al.

2020). In Europe, a total of six species are known: Psi-

lota aegeae Vujic, Stahls & Smit, 2020, Psilota anthra-

cina Meigen, 1822, Psilota atra (Fallén, 1817), Psilota

exilistyla Smit & Vujic, 2008, Psilota innupta Rondani,

1857, and Psilota nana Smit & Vuji¢c, 2008. Adults of Eu-

ropean species of Psi/ota are found in forested areas, in

habitats with mature Quercus, Carpinus, Ulmus, and/or

with coniferous trees (Picea and Pinus) depending on the

particular species (Speight 2020a). Psilota can be diag-

nosed by their densely pilose eye, the presence of a tuft of

pile on the meron anteroventral to the posterior spiracle,

and a pilose, concave to straight face with a projecting

epistoma. All European species are morphologically very

similar: medium-sized, compact-build, and with a gener-

al dark coloration. Their overall morphological similarity

and the incomplete information on the types contribute to

the confusion about the identity of the different taxa and

their names (Smit & Vujic 2008; Speight 2020a; but see

Radenkovié et al. 2020). Known larvae are short-tailed

maggots found in decaying liquid media ranging from

sap flows to waste dumps in termite nests (Kassebeer

et al. 1998; Thompson 2013).

Received: 04.03.2021

Accepted: 18.05.2021

The German syrphid fauna is well known (Schumann

et al. 1999; Schumann 2002, 2005, 2010, Ssymank et al.

2011) and so far, three Psi/ota species have been recorded

from Germany, 1.e., P. anthracina, P. atra, and P. innupta

(Flugel 2001; Smit & Vuji¢ 2008). Here a fourth species

is reported for the first time from Germany, P. exilistyla.

MATERIAL AND METHODS

Locality

During a field expedition in early July, 2014 two Psilota

specimens were collected using a hand net in Baden-Wurt-

temberg, southwest Germany. The male specimen here

reported (Fig. 1) was collected along the path to the Zas-

tler Hutte. Located in the Black Forest (Schwarzwald),

the Feldberg (1,493 m asl) is the highest mountain in Ger-

many outside the Alps, and northwest of Feldberg sum-

mit is the Zastler Hutte, a low-mountain managed hut.

The Feldberg just surpasses the altitude of natural tree

growth and has extended high-mountain grasslands of

the Leontodonto-Nardetum community. The slopes have

seminatural forests of Picea abies (L.) H.Karst. and Abies

alba Mill. The collection site along the path had abundant

subalpine flowering tall herb vegetation adjacent to the

coniferous forest. The specimen was collected into 96%

ethanol and later dried in a Critical-Point Dryer.

The female specimen was collected approximate-

ly 8 km south of this point, along the path to the Berg-

gasthof Prager Boden, in the Gletscherkessel Prag Na-

ture Reserve, and kept in 96% ethanol. The path crosses

high-mountain Nardion-grasslands, and extensive pas-

Corresponding editor: R. Peters

Published: 22.05.2021

Ximo Mengual & Axel Ssymank

Fig. 1. Male specimen of Psilota exilistyla (ZFMK-DIP-00075145). A. Habitus, dorsal view. B. Habitus, lateral view. C. Head,

frontal view. D. Male genitalia: hypandrium, epandrium, cerci and surstyli in lateral view. Scale=1 mm.

tures of the Festuco-Genistetum sagittalis community,

with montane tall herb stands with Chaerophyllum hirsu-

tum L. and adjacent semi-natural Picea abies and mixed

Abies alba forests of the Abieti-Fagetum community.

The Prager Boden and Gletscherkessel Prag is an old

glacial valley where six different glaciers met during the

Wurm-glaciation period. It is well known due to the cold

stenotherm fauna including relicts and endemic beetles in

the huge siliceous screes and block fields (LUBW 1986;

Regierungsprasidium Freiburg 2011).

Taxonomy and photography

Identification was conducted using the species key of

Smit & Vuyic (2008) and Radenkovicé et al. (2020) af-

Bonn zoological Bulletin 70 (1): 221-225

ter using Speight (2020b) to identify the genus. The

male specimen is deposited at the Zoologisches For-

schungsmuseum Alexander Koenig, Bonn, Germany

(ZFMK) and the female specimen is housed at the pri-

vate collection of Axel Ssymank, Wachtberg, Germany

(PCAS).

Focus stacked images were created using the soft-

ware Zerene Stacker® ver. 1.04 (Richland, Washington,

USA), based on photographs of pinned specimens taken

with a Canon EOS 7D® mounted on a P—51 Cam-Lift

(Dun Inc., VA, USA) and with the help of Adobe Light-

room® ver. 5.6. Figure 2 was created with the help of

SimpleMappr (Shorthouse 2010).

©ZFMK

Psilota exilistyla new for Germany 223

Fig. 2. Known records of P. exilistyla. Green= published records; red=new records from Germany.

DNA barcoding

The 5'-end of the mitochondrial cytochrome c oxidase

subunit I (COI) gene, the so called DNA barcode (He-

bert et al. 2003a, 2003b), was obtained from the female

specimen using a metaleg for the DNA extraction. We

used the extraction protocol by Mengual et al. (2018) and

the specimen was labelled as DNA voucher for the pur-

pose of morphological studies. DNA primers and PCR

amplification protocols follow Rozo-Lopez & Mengual

(2015).

The sequences were edited for base-calling errors and

assembled using Geneious R7 (ver. 7.1.9, Biomatters

Ltd). From Smit et al. (2015) we included all the COI

sequences they used in their analysis. The alignment of

the COI sequences was done using Geneious Alignment

and a Neighbour-Joining (NJ) tree was inferred using the

Jukes-Cantor model as implemented in Geneious R7.

Bootstrap support values were estimated from 1,000 rep-

licates as spawned in Geneious R7.

RESULTS

Material examine

GERMANY — 1 8; ZFMK-DIP-00067465, ZFMK

DNA voucher D502; PCAS; Baden-Wirttemberg,

Schwarzwald, Prag/ Geschwend, Prager Boden, Wegab-

stieg von der [Htitte zum Parkplatz]; alt. 930-1050 m;

47°48°28.5” N, 07°59°38.5” E; 10.vi.2014; A. Ssymank

leg. — 1 4; ZFMK-DIP-00075145, ZFMK; Schwar-

zwald, Zastler Tal, Feldberg, Weg zur Zastler Hutte:

alt. 960-1060 m.; 47°53’24.8” N, 08°00°55.5” E to

Bonn zoological Bulletin 70 (1): 221-225

47°53°15.9” N, 08°00’29” E; 09.v1.2014; X. Mengual

and MLS. Peiro leg.

The two specimens collected in the Schwarzwald be-

long to Psilota exilistyla and represent the first records

of this species from Germany. The identification was

confirmed with morphological and molecular characters.

This species belongs to the P. atra species group as de-

fined by Smit & Vuji¢ (2008) with face shiny, at most

only slightly pruinose beneath antennae, and thorax and

abdomen bluish-black coloured, entirely shiny (Fig. 1).

Among the taxa of the P. atra species group, males of P.

exilistyla can be distinguished by having the face about

2.5 x longer than frons (Fig. 1C) and characters of the

male genitalia: epandrium not elongated, broader than

long in lateral view; and surstylus very long and slen-

der, inner surstyle lobe about twice as long as the max-

imum length of the epandrium, and outer surstyle lobe

extremely narrow, often not curved but folded backwards

(Fig. 1D). The females of P. exi/istyla can be identified

by the short black pile at the posterior margin of tergite

4, metafemur not swollen, and postpedicel (basoflagel-

lomere) about 1.5 times as long as broad.

The COI sequence obtained for the female specimen

(GenBank accession number MW703674) is a bit short-

er (651 bp) than the COI sequences used by Smit et al.

(2015), which are 658 bp long. Nevertheless, our speci-

men is placed in the NJ tree (Fig. 3) within the exilisty-

la cluster, together with specimens from Greece and the

Netherlands.

©ZFMK

224 Ximo Mengual & Axel Ssymank

e4007596253|RMNH.INS.556461|Myolepta_vara

100

0.01

e4007598853|RMNH.INS.557239|Psilota_kroshka

e4000483018|/RMNH.INS.553966|Psilota_anthracina

€4003830138|RMNH.INS.551599|Psilota_anthracina

100 | e4003830291|RMNH.INS.551276|Psilota_anthracina

e4003832977|RMNH.INS.553174|Psilota_anthracina

e4003832975|RMNH.INS.553172|Psilota_spec.

ZFMK-DIP-00067465|Psilota_exilistyla_DE

e4003830290|RMNH.INS.551275|Psilota_exilistyla_NL

100

e4003832955|RMNH.INS.553152|Psilota_exilistyla_GR

e4003832956|RMNH.INS.553153|Psilota_exilistyla_GR

e4003830249|RMNH.INS.551234|Psilota_atra

100

e4003832927|RMNH.INS.553124|Psilota_atra

e4003832928|RMNH.INS.553125|Psilota_atra

e4003832943|RMNH.INS.553140|Psilota_atra

e4003832959|/RMNH.INS.553156|Psilota_atra

e4003832960|/RMNH.INS.553157|Psilota_atra

Fig. 3. Neighbour-Joining tree using Jukes-Cantor model of several Psilota species based on COI sequences, with Myolepta vara

(Panzer, 1797) constrained as outgroup. For metadata of the voucher specimens see Smit et al. (2015), except for the female spec-

imen ZFMK-DIP-00067465. GR=Greece; NL=the Netherlands, DE=Germany. Bootstrap support values are given at the nodes.

DISCUSSION

Psilota exilistyla was originally described based on male

and female specimens from Greece and France (Smit &

Vuyic 2008). Since then, new records across Europe have

been published from Belgium, Netherlands and Poland

(Van de Meutter & Reemer 2012; Smit et al. 2015; Van

der Ent 2017; Z6ralski 2018; Bot & Van de Meutter 2019),

but these records were overlooked by Vuji¢ et al. (2020).

Moreover, field observations are graphically documented

in online databases, such as Waarneming (https://waar-

neming.nl/), and incorporated in the Global Biodiversity

Information Facility (www.gbif.org). All these records

plus online published records (Gilg & Mazuez 2019;

Waarnemingen 2020) were summarized in Fig. 2.

The Syrphidae Red List for Germany (Ssymank &

Doczkal 2008; Ssymank et al. 2011) lists P innupta

as extremely rare in this country. Ssymank & Doczkal

(1998) listed P. anthracina as endangered based on lim-

ited data, but later Ssymank et al. (2011) listed P. an-

thracina and P. atra as data deficient. Van de Meutter &

Reemer (2012) stated that due to their scarcity and the

Bonn zoological Bulletin 70 (1): 221-225

fact that are infrequently encountered and sampled, the

distribution and taxonomy of Psi/ota species may still

change when more records become available. After the

revision by Smit & Vuji¢ (2008) and good discriminating

characters for females found by Bot & Van der Meutter

(2019) the European Psi/ota species are better defined.

As an example, published records from Belgium were

restudied by Opdekamp & Van de Meutter (2019) and

now P. exilistyla is the most common Psi/ota species in

Belgium. More revisionary work is needed since the pub-

lications of the last decade to assess precisely the con-

servation status, distribution and taxonomy of Psi/ota in

Europe. More records of P. exilistyla are expected from

Central Europe in the near future.

Acknowledgments. We thank Marissa S. Peiré for collecting

the male specimen of P. exilistyla. We also thank Frank van de

Meutter for sharing their locality data of P. exilistyla in Belgium

and for confirming the identification of the female specimen.

Claudia Etzbauer is acknowledged for obtaining the molecular

sequence for the female specimen and Sander Bot for sharing

data on Psilota. We are very thankful to John Smit for sharing

with us the COI sequences he used in Smit et al. (2015). We

©ZFMK

Psilota exilistyla new for Germany 225

thank Andrew D. Young and John Smit for their helpful com-

ments.

The Regierungsprasidium Freiburg kindly issued the neces-

sary permits for insect research in the two Nature Reserves (AZ

55-8841.06.0, issued on 11.04.2014).

This is a contribution to the German Barcode of Life (Geiger

et al. 2016; http://www.bolgermany.de).

REFERENCES

Bot S, van de Meutter F (2019) Veldgids Zweefvliegen. KNNV

Uitgevertj, Zeist.

Fluigel HJ (2001) Schwebfliegenfunde aus Berlin und Branden-

burg (Diptera: Syrphidae). Markische Entomologische Nach-

richten 3 (2): 33-54

Regierungsprasidium Freiburg (2011) Die Naturschutzgebiete

im Regierungsbezirk Freiburg. 3 ed. Thorbecke: Ostfildern.

Geiger MF, Astrin JJ, Borsch T, Burkhardt U, Grobe P, Hand R,

Hausmann A, Hohberg K, Krogmann L, Lutz M, Monje C,

Misof B, Moriniére J, Muller K, Pietsch S, Quandt D, Rulik

B, Scholler M, Traunspurger W, Haszprunar G, Wagele W

(2016) How to tackle the molecular species inventory for an

industrialized nation — lessons from the first phase of the

German Barcode of Life initiative GBOL (2012-2015) 1.

Genome 59 (9): 661-670. https://do1.org/10.1139/gen-2015-

0185

Gilg ON, Mazuez CN (2019) Inventaire National du Patri-

moine Naturel. RNF - Données de l’association de la RN du

lac de Remoray. Version 1.1. UMS PatriNat (OFB-CNRS-

MNHN), Paris. Online at https://www.gbif.org/occur-

rence/2472536276 [last accessed 21 Aug. 2020]. https://doi.

org/10.15468/3hjtgz

Hebert PDN, Cywinska A, Ball SL, deWaard JR (2003a) Bio-

logical identifications through DNA barcodes. Proceedings

of the Royal Society of London B 270: 313-321. https://doi.

org/10.1098/rspb.2002.2218

Hebert PDN, Ratnasingham S, DeWaard JR (2003b) Barcod-

ing animal life: cytochrome C oxidase subunit 1 divergences

among closely related species. Proceedings of the Royal So-

ciety of London B 270: S96-S99. https://doi.org/10.1098/

rsbl.2003.0025

Kassebeer C, Maibach A, Rotheray GE (1998) The third (final)

stage larva of Psilota anthracina Meigen and Psilota deces-

sa (Hutton) (Dipt., Syrphidae). The Entomologist*‘s Monthly

Magazine 134: 39-43

LUBW (Landesanstalt fiir Umwelt Banden-Wirttemberg)

(1986) Schutzgebietsverzeichnis — Steckbriefe ,,3.2.01 Glet-

scherkessel Prag“ (Schutzgebietsgutachten). Online at http://

wwwz2.lubw.baden-wuerttemberg.de/public/abt2/dokablage/

oac_12/wuerdigung/3/3201.htm [last accessed 04 Mar. 2021]

Opdekamp W, Van de Meutter F (2019) First observations of

Psilota atra (Fallén, 1817) in Belgium (Diptera: Syrphidae).

Bulletin de la Société royale belge d’Entomologie 155: 101—

104

Radenkovi¢ S, Likov L, Stahls G, Rojo S, Pérez-Bafion C,

Smit J, Petanidou T, Van Steenis W, Vuji¢ A (2020) Three

new hoverfly species from Greece (Diptera: Syrphidae)

Zootaxa 4830 (1): 103-124. https://doi.org/10.11646/zoot-

axa.4830.1.4

Rozo-Lopez P, Mengual X (2015) Mosquito species (Diptera,

Culicidae) in three ecosystems from the Colombian Andes:

identification through DNA barcoding and adult morphol-

ogy. ZooKeys 513: 39-64. https://doi.org/10.3897/zook-

eys.513.9561

Bonn zoological Bulletin 70 (1): 221-225

Schumann H (2002) Erster Nachtrag zur ,,Checkliste der Dip-

teren Deutschlands“. Studia dipterologica 9: 437-445

Schumann H (2005) Zweiter Nachtrag zur ,,Checkliste der Dip-

teren Deutschlands“. Studia dipterologica 11 [2004]: 17—27

Schumann H (2010) Dritter Nachtrag zur Checkliste der Dip-

teren Deutschlands. Studia dipterologica 16 [2009]: 619-630

Schumann H, Bahrmann R, Stark A (eds) (1999) Checkliste der

Dipteren Deutschlands. Studia dipterologica, Supplement 2:

1-354

Shorthouse DP (2010) SimpleMappr, an online tool to produce

publication-quality point maps. Online at http://www.simple-

mappr.net [last accessed 21 Aug. 2020]

Smit J, de Bree E, van Steenis J, van der Ent L-J (2015) De

Spichtige Spitsbek Psilota exilistyla, een derde soort Psilota

in Nederland (Diptera : Syrphidae). Nederlandse faunistische

Mededelingen 45: 25-31

Smit J, Vujic A (2008) The Palaearctic species of the genus Psi-

lota Meigen (Diptera, Syrphidae) with the description of two

new species. Studia dipterologica 14 [2007]: 345-364

Speight MCD (2020a) Species accounts of European Syrphidae

2020, vol. 104. 314 pp. in: Speight MCD, Castella E, Sarthou

J-P, Vanappelghem C (eds) Syrph the Net, the database of

European Syrphidae (Diptera). Syrph the Net publications,

Dublin

Speight MCD (2020b) StN key for the identification of the

genera of European Syrphidae (Diptera) 2020, vol. 105. 46

pp. in: Speight MCD, Castella E, Sarthou J-P, Vanappelghem

C (eds) Syrph the Net, the database of European Syrphidae

(Diptera). Syrph the Net publications, Dublin

Ssymank A, Doczkal D (1998) Rote Liste der Schwebfliegen

(Diptera, Syrphidae). Pp. 65—72 in: Binot M, Bless R, Boe

P, Gruttke H, Pretscher P (eds) Rote Liste gefahrdeter Tiere

Deutschlands. Schriftenreihe ftir Landschaftspflege und Na-

turschutz 55. Landwirtschaftsverlag, Munster

Ssymank A, Doczkal D, Rennwald K, Dziock F (2011) Rote

Liste und Gesamtartenliste der Schwebfliegen (Diptera: Syr-

phidae) Deutschlands. Pp. 13-83 in: Binot-Hafke M, Balzer

S, Becker N, Gruttke H, Haupt H, Hofbauer N, Ludwig G,

Matzke-Hajek G, Strauch M (eds) Rote Liste gefahrdeter

Tiere, Pflanzen und Pilze Deutschlands. Band 3: Wirbellose

Tiere (Teil 1). Naturschutz und Biologische Vielfalt 70 (3).

Landwirtschaftsverlag, Munster

Thompson FC (2013) A new Psilota flower fly (Diptera: Syr-

phidae) from Vietnam. The Entomologist’s Monthly Maga-

zine 149: 181-185

Van de Meutter F, Reemer M (2012) The genus Psilota (Dip-

tera: Syrphidae) in Belgium: a tale of three new species to

our fauna in a handful of years. Bulletin van de Koninklike

Belgische Vereniging voor Entomologie 148: 23—26

Van der Ent L-J (2017) Determinatiesleutel tot de soorten van

het genus Psilota in de Benelux op basis van veldkenmerken

(Syrphidae). Vliegenmepper 26 (1): 3—5

Vujic¢ A, Speight MCD, Williams MC, Rojo S, Stahls G, Ra-

denkovic S, Likov L, Milici¢ M, Pérez-Bafion C, Falk S,

Petanidou T (2020) Atlas of the Hoverflies of Greece (Dip-

tera: Syrphidae). Koninklijke Brill NV, Leiden.

Waarnemingen (2020) Online at https://waarnemingen.be/spe-

cies/187051/observations/? [last accessed 21 Aug. 2020]

Young AD, Skevington JH, Van Steenis W (2020) Revision of

the Psilota Meigen, 1822 flower flies (Diptera: Syrphidae) of

Australia. Zootaxa 4737 (1): 1-126 https://doi.org/10.11646/

zootaxa.4737.1.1

Zoralski R (2018) Review of the genus Psilota (Diptera, Syr-

phidae) in Poland. Dipteron 34: 4-14. Online at https://zeno-

do.org/record/1450939 [last accessed 18 May 2021]