THE GARDENS” BULLETIN, SINGAPORE

The Gardens” Bulletin, Singapore is a peer-reviewed Journal publishing original papers and

reviews on a wide range of subjects: plant taxonomy (including revisions), phytogeography,

floristies, morphology, anatomy, as well as horticulture and related fields, such as ecology and

conservation, with emphasis on the plant life of the Southeast Asian-Pacific region.

Dr. K.M. Wong Dr. Jana Leong-Skornickovă

(Editor-in-Chief) (Managing Editor)

S. Lee Y.W. Low Christina Soh

(Graphics Editor) (Copy Editor) (Business Manager)

Editorial Advisory Board

Professor Sir Peter Crane

Yale University

(OLS

Dr. Rogier P.]. de Kok

Royal Botanic Gardens, Kew

U.K.

Dr. W.J]. Kress

National Museum of Natural FHistory

Smithsonian Institution

RSSA

Dr. David J]. Middleton

Royal Botanic Garden Edinburgh

U.K.

Dr Kiat W. Tan

Gardens By The Bay

Dr. Nigel P. Taylor

Singapore Botanic Gardens

National Parks Board, Singapore

Dr. I.M. Turner

Singapore Botanic Gardens

National Parks Board, Singapore

Dr. J.F. Veldkamp

Nationaal Herbarium Nederland

The Netherlands

Dr. Jun Wen

National Museum of Natural History

Smithsonian Institution

U.S.A.

Professor Nianhe Xia

South China Institute of Botany»

National Parks Board, Singapore PR. China

Published twice yearly by the National Parks Board, Singapore, the annual subscription for the journal

1s Singapore $100.00 including postage. Overseas subsceribers should make payment in the form of

bank draft or international money order in Singapore currency, payable to National Parks Board, Please

forward payment to ““Accounts Receivable Section. National Parks Board, Headquarters,

Singapore Botanic Gardens, 1 Cluny Road, Singapore 2595609”.

Instructions for contributing authors

(more details in http://www.sbg.org.sg/research/instructions-for-authors.pdf)

Manuscripts should be sent by e-mail to <gardbullsing(0gmail.com> or posted to

The Editor, Gardens” Bulletin Singapore, Singapore Botanic Gardens, | Cluny Road,

Singapore 259569.

The language used is English. Prior to submission, it may be advisable to have manuscripts checked by

someone fluent or proficient in that language. Contributions must not have been published or be under

consideration elsewhere. There are no page charges. Submitted material cannot be returned.

Authors currently opt for 50 paper offprints and/or a pdf reproduction of their contribution, gratis.

Cover letter, submission and copyright. In your cover letter or message, state clearly you are submitting

your manuscript (state title) for publication in the Gardens” Bulletin, Singapore. By submitting the

manuscript(s), authors agree that upon acceptance, copyright of the entire work becomes the property

ot the Singapore Botanic Gardens National Parks Board, Singapore. Authors must ensure all required

permission has been obtained in writing to publish any material they present; proof may be required.

Manuscripts are best submitted in electronic form (Microsoft Word 97-2003 preferred). Use Times New

Roman, 10-point font, 1.5-line spacing. Do not send original artwork unless requested by the Editor.

Number all pages serially including the title and abstract on the first.

(continued on inside back cover)

—

3 [ AA

The Gardens” Bulletin

Singapore

VOL. 65(1) 2013 ISSN 0374-7859

CONTENTS

P.C. Boyce and S.Y. Wong

Studies on Schismatoglottideae (Araceae) of Borneo XXII:

INI caiematie Aridarum monlanum tefound ......... memo ee eee eee eneaeaasee l

P.C. Boyce and S.Y. Wong

Studies on Schismatoglottideae (Araceae) of Borneo XXIII:

Piptospatha colata and P deceptrix, taxonomic novelties from Borneo ............... Ji

R. Gogoi and S. Borah

Musa markkui (Musaceae), a new species from Arunachal Pradesh, India ........... 19

R. Gogoi and S$. Borah

Two new species and a new record for Co/ocasia (Araceae: Colocasieae)

ii tuuiachal Pradesh. Norţheast India ........<< ceea ee eee ceara aaa atatea atata aa araaia sia aaa aaa 27

R. Kishor and J. Leong-Skornitkovă

Zingiber kangleipakense (Zingiberaceae):

ENE eee li na VARIpIIr., INCI, «otet ie oare o atare atacate are aa aia ela ta arata le Ale ia 39

J.D. Mood, L.M. Prince, J.F. Veldkamp and S. Dey

The history and identity of Boesenbergia longiflora (Zingiberaceae)

iile scripildas:0l-fhye related new taxa << see goe oo aie slot area 3 ia aa ial die 47

M.F. Newman

Valid publication of Boesenbergia aurantiaca (Zingiberaceae) ..................... 97

H.-J. Tillich and J. Leong-Skornitkovă

Aspidistra jiewhoei (Asparagaceae), a new species from north Vietnam ............ 101

Y.H. Tong, W.B. Xu, Y.F. Deng, K.M. Wong and N.H. Xia

Rubovietnamia sericantha (Rubiaceae: Gardenieae),

a new combination.ând notes on the penus in China 107

I.M. Turner

Additions to The Plant Taxa of H.N. Ridley, 4.

The Primitive Angiosperms (Austrobaileyales, Canellales,

Chloranthales, Laurales, Magnoliales, Nymphaeales and Piperales) ................ 115

J.F. Veldkamp

Nomenclatural notes on Eugenia reinwardtiana (Myrtaceae)

and more'or less associate d name se E 14157,

Date of publication: 30 June 2013

Copyright O

National Parks Board

Singapore Botanic Gardens

1 Cluny Road

Singapore 259569

Printed by Oxford Graphic Printers Pte Ltd

Gardens” Bulletin Singapore 65(1): 1-5. 2013 ]

Studies on Schismatoglottideae (Araceae) of Borneo XXII:

The enigmatic Aridarum montanum refound

P.C. Boyce! and S.Y. Wong?

'Pusat Pengajian Sains Kajihayat (School of Biological Sciences),

Universiti Sains Malaysia 11800 USM, Pulau Pinang, Malaysia

phymatarum(a googlemail.com

"Department of Plant Science & Environmental Ecology,

Faculty of Resource Science & Technology,

Universiti Malaysia Sarawak,

94300 Kota Samarahan, Sarawak, Malaysia

sywong(Afrst.unimas.my

ABSTRACT. Aridarum montanum Ridl., a species known from a single herbarium specimen

allegedly collected on Gunung (Mt) Santubong, Sarawak, Malaysian Borneo in 1909, has

been refound on exposed shales in Sri Aman Division, and Sarikei Division, Sarawak, and

subsequently flowered in cultivation. Morphological differences of the new collection

compared with the original description and figure are catalogued and commented upon. An

amended and expanded species description is provided, and the plant is illustrated in habitat,

and from flowering cultivated material. Speculations on the probable location origin of Brooks”

type material are proffered.

Keywords. Aroid, Mount Santubong, rare species, Sarawak, shales

Introduction

Aridarum montanum Ridl., the type species of the genus, has not been recollected

since Cecil Joslin Brooks gathered a single specimen, purportedly on Gunung (Mt)

Santubong, and now deposited in the Natural History Museum, London (BM). Boyce

& Wong (2011) outlined the few facts known pertaining to A. montanum, emphasizing

that numerous surveys of the supposed type locality, a large sandstone mountain

situated on a peninsula jutting into the South China Sea approximately 35 km north of

Kuching, the state capital of Sarawak, had failed to locate the plant, although another

quite different Aridarum (A. nicolsonii Bogner) is abundant there. Recollection of A.

montanum from a two quite separate very wet shale-dominated sites, one in Sri Aman

Division and the other in Sarikei Division, coupled with the persistent failure to locate

plants of this species at the supposed type locality on much drier sandstone ecology,

raises the probability that Brooks” label data are in error.

Brooks was in Sarawak during 1900-1910, employed as a metallurgical chemist

by the gold-exploitation arm of the Borneo Co. Ltd. During this period he collected

a wide range of wildlife, including plants, although mainly ferns. Data for Brooks”

fieldwork are often incomplete, and there are doubts over the numbering of at least part

2 Gard. Bull. Singapore 65(1) 2013

of his collections. Brooks” Borneo fieldwork was concentrated almost exclusively in

west Sarawak. He made collections on Gunung (G.) Santubong (c. 144 N 110*20'E),

G. Pueh (c. 1*”48'N 109*41'E), G. Kapor (c. 1*23'N 110*7'E), G. Singai (c. 1*30'18.28"N

110*10'21.36"E), the Banjaran Bungo (c. 1*16'N 110*9E), Bau (c. 1%25'N 110%9'E),

Bidi (c. 123'N 110*8'E), and Tringgus (c. 1*14N 110*5'E). With the exception of

Banjaran Bungo, none of the above areas has exposed shales. Gunung Santubong,

G. Singai, and Tringgus are predominantly sandstone; G. Kapor and Bidi are forested

karst limestone, while G. Pueh is granite. Our new collections coupled with high levels

of “geological endemism” present among aroids strongly favours A. montanum being

a shale-obligate.

Brooks” only documented excursion away from this general area was in 1908

when he ventured to the source of the true right tributary of the Sungai Sarawak,

afterwards continuing to the headwaters of the Sungai Sambas where it rises in the

Bengkayum (Bengkayang) Mountains (G. Niyut and G. Bentuang) NE of Pontianak,

in modern Kalimantan Barat, Indonesian Borneo. Brooks returned to Sarawak from

this expedition by way of Siluas and G. Penrissen (Brooks 1911). These areas do have

exposed shales, and furthermore there are floristic links with Banjaran Bungo and

via the Klingkang range to the border areas of Lubok Antu, close to one of the new

collections of A. montanum. The Sarawak Banjaran Bungo is botanically reasonably

well sampled and to date A. montanum has never been located there. On balance it

seems most likely that Brooks” collection was made during the trip to the headwaters

of the Sungai Sambas.

Aridarum montanum Ridl., ]. Bot. 51: 201(—202), pl. 527 (1913); Bogner & Hay,

Telopea 9(1): 186 (2000); Boyce & Wong, Malayan Nat. J. 63(4): 613-618, Figs. 2 &

3 (2011). TYPE: CU. Brooks 1035, Malaysian Borneo, Sarawak, Kuching Division,

Santubong (but see above), Oct 1909 (holo BM!). (Fig. 1)

Trailing-pendent or tufted obligate rheophyte to c. 25 cm. Stem initially condensed,

later elongating and often branching from the base, trailing portions to c. 35 cm (or

more?), very slender, 3-4 mm diam., all except the oldest portions clothed with tightly

fitting red-brown netted fibres derived from the prophylls and cataphylls, and slender

adhering sinuous green roots. Leaves numerous, carried in dense tufts at the tips of the

stems, often two or three leaf tufts basal to these stems; peziole 0.2—3 cm long, c. | mm

diam., sheathing at the very base, the wings extended into a narrowly triangular ligular

portion 2.5-3 cm long, drying red-brown; blade linear-lanceolate, stiffly coriaceous,

deep green, 2-10 cm long * 3.5-4.5 mm wide, base very narrowly cuneate, apex

very narrowly acute and apiculate for 0.5-1 mm; midrib abaxially very prominent,

adaxially more or less flush with the lamina; primary lateral veins not differentiated;

secondary venation more or less obscure, running into a relatively thick marginal

vein; tertiary venation very obscure. Inflorescence solitary; peduncle much exceeding

the petioles, 9-10 cm long, c. 0.8 mm diam, green. Sparhe narrowly ovate, apically

acute, unconstricted, 1.5-2 cm long, initially green, late in development (1-2 days

prior to opening) turning entirely white; spathe limb gaping at pistillate anthesis, the

199)

Aridarum montanum in Sarawak interpreted

Fig. 1. Aridarum montanum Ridl. A. Plants in habitat on shale waterfall. Note the long, almost

naked stems. B. Flowering shoot. Note the very narrow leaf blades, the conspicuous ligules,

and the netted fibre covering the naked stem C. Inflorescence at pistillate anthesis, with the

spathe gaping. D. Spadix, with the spathe artificially removed. Note the convex connective and

very long setiform terminus to the thecae. E. Alcohol-preserved spadix. All from PC.Boyce er

al. AR-3728. (Photos: A, Mike Lo; B-E, Peter C. Boyce)

4 Gard. Bull. Singapore 65(1) 2013

upper 2/3 caducous at staminate anthesis, at which time the lower persistent 1/3 flares

into an obconic cup. Spadix 1.4—1.5 cm long, c. 3 mm diam., subeylindric, distally

tapering to an acute apex; pistillate flower zone 2-3 mm long, about three irregular

whorls of subglobose-oblong pistils c. 0.5 mm diam.; stigma sessile, button-like,

narrower than the pistils, c. 0.4 mm diam., papillate, centrally impressed; staminate

flower zone contiguous with pistillate zone, c. 1.2 cm long, c. 2.5 mm diam., fertile

to the acute apex; stamens crowded, arranged in pairs, more or less ellipsoid and the

pairs rhombohexagonal from above, longitudinally aligned (with respect to spadix

axis), c. 1.2—1.5 mm * 0.3—0.4 mm, convex in nature, drying with a deep longitudinal

excavation; thecae on the distal and proximal (with respect to spadix axis) sides of the

anther, base triangular, the remainder a long straight very slender horn c. 7 mm long,

these folded in horizontally across the top of and meeting in the middle of the anther,

elevating somewhat at staminate anthesis. Fruiting spathe broadly obconic, white.

Fruit unknown.

Other specimens examined: MALAYSIAN BORNEO. Sarawak. Sri Aman, Lubok Antu,

Batang Lemanak, 01*09'N 111*39E, PC.Boyce er al. AR-3728 (SAR); Sarikei, Ulu Sarikei, Air

Terjun Ruan, 01*55'02.0"N 111%29'10.7"E, PC.Boyce & S.Y Wong AR-4100 (SAR).

Distribution. Known with certainty only the two localities reported here.

Ecology. Shale cascades and small waterfalls under very wet lowland forest; 25—60

m asl.

Notes. Recollection of A. montanum has revealed critical inaccuracies in the original

description and figure (Ridley 1913), and also interpretative misconceptions in the

description provided by Bogner & Hay (2000).

Inaccuracies in Ridley's description and figure are the excavation of the stamen

connective, and the supposed presence of triangular-based, setiform sterile flowers

at the “base” of each stamen. The connective excavation 1s an artefact resulting from

shrinkage during drying for preservation. In nature the stamen connective is markedly

convex, forming a pronounced dome between the thecae horns (Fig. 1D). It remains so

in alcohol, although the stamen pairs, which are appressed when fresh, shrink laterally

when spirit-preserved, revealing deep sutures between each pair of stamens (Fig. 1E).

Ridley's sterile flowers attached to each stamen are, in fact, the thecae, one on each

end of the stamen, and comprising a triangular somewhat gibbous basal portion (the

actual theca) and a long, setiform terminus though which the pollen is released.

Bogner & Hay's description contains the following statement: “interpistillar

staminodes few at the base of the female zone, shortly stipitate, spindle-shaped,

narrower and shorter than the pistils (interpistillar staminodes fide Ridley (loc. cit.

[i.e., Ridley 1913]); absent from the Holotype in our observation)». Ridley (1913)

makes no mention of “interpistillar staminodes”. He does make comparison of the

“sterile flowers” he believed present at the base of each stamen (discussed above) with

Aridarum montanum in Sarawak interpreted >

the club-shaped sterile stamens (Ridley says “flowers”) associated with the pistils in

most Homalomena. To Ridley this was pertinent because he supposed his Aridarum to

be related to Homalomena sect. Chamaecladon. However, nowhere does Ridley use

the term “interpistillar staminodes” or mention such structures to be basal to the female

zone. What Ridley does say, in the protologue (here translated from the original Latin),

is: “sterile flowers basal to [1.e.. at the base of the stamens]...”

Apart for correcting morphological descriptive inaccuracies, access to

comprehensive material, coupled with field observations, has established that uniquely

for the genus the stems of 4. montanum are much elongated and somewhat branched,

forming pendent masses hanging in the water flow (Fig. 1A). It may be assumed that

Brooks” original collection comprised a single tuft of leaves taken from the base of one

of these stem complexes. Why Brooks failed to collect more representative material is

unclear. Other minor differences between the new collection and the type are that our

plants have very short petioles, less than 3 mm long. The type plant has petioles up to 3

cm long, although most are much less than this, and some very short, but none as short

as here recorded.

Circumscription of Aridarum

The morphologies noted above raise issues with the circumscription of Aridarum

sensu Bogner & Hay (2000), not least the absence of an excavated stamen connective

that is one of the defining morphologies for the genus Aridarum. However, pending

publication of an on-going molecular study, including placement of the type species,

Aridarum sensu Bogner & Hay (2000) is here retained, but with caution.

ACKNOWLEDGMENTS. Research and fieldwork in Borneo was, most recently, under

Sarawak Forestry Department Research Permit No. NCCD.907, 4.4(Jld.7) and Park Permit

No: 104/2012. The continuing collaboration and support of the Forest Department Sarawak.

and Sarawak Forestry Corporation, are gratefully acknowledged.

References

Bogner, J]. & Hay, A. (2000) Schismatoglottideae in Malesia II - Aridarum, Bucephalandra,

Phymatarum and Piptospatha. Telopea 91): 183—194.

Brooks, C.J. (1911) A trip to a source of the Sarawak River and Bengkarum Mountains. J.

Straits Branch Roy. Asiat. Soc. 60: 41-51.

Ridley, H.N. (1913) Some Bornean Aroideae. J. Bot. 51: 201-202.

Wong, S.Y. & Boyce, PC. (2011) Lost Aroids - On the taxonomic importance of relocating

poorly collected species. Malayan Nat. J. 63(4): 613-623.

Digitized by ihe Internet Archive

in 2014

https://archive.org/details/gazetamatematica4651 unse

Gardens” Bulletin Singapore 65(1): 7-17. 2013 7

Studies on Schismatoglottideae (Araceae)

of Borneo XXIII:

Piptospatha colata and P. deceptrix,

taxonomic novelties from Borneo

P.C. Boyce! and S.Y. Wong?

'Pusat Pengajian Sains Kajihayat (School of Biological Sciences)

Universiti Sains Malaysia 11800 USM, Pulau Pinang. Malaysia

phymatarum(a gmail.com

"Department of Plant Science & Environmental Ecology,

Faculty of Resource Science & Technology,

Universiti Malaysia Sarawak,

94300 Kota Samarahan, Sarawak, Malaysia

sywong(4 frst.unimas.my

ABSTRACT. Piptospatha colata P.C.Boyce & S.Y.Wong and P deceprrix P.C.Boyce &

S.Y.Wong are newly described, respectively from Kalimantan Barat and Kalimantan Utara,

Indonesian Borneo. Recognition of these novelties takes to 13 the number of described,

accepted species of Piptospatha. An updated key to the genus is provided and both species are

illustrated, along with those species that are most similar.

Keywords. Aroid, Indonesian Borneo, Kalimantan Barat, Kalimantan Utara, Piprosparha

Introduction

Since the last full revision of Piprosparha (Bogner & Hay 2000) a combination of

molecular and morphological research has resulted in generic changes, and recognition

of a number of new taxa (Okada & Tsukaya 2010; Wong & Boyce 2010, 2012, in

press; Wong et al. 2009, 2011).

Major herbaria with significant tropical Asian collections (e.g., BO, L, SAR,

SING) abound in specimens of unnamed rheophytic aroids. These, however, frequently

defy attempts at identification owing to their incomplete nature, and frequently

inadequate preparation prior to preservation. Failing attempts to recollect at original

localities or, in the case of older material the distinct possibility that such localities

no longer support an indigenous ecology, such material will quite likely forever

remain undetermined. Given this situation, it is ironic that fieldwork and subsequent

cultivation of plants from Borneo continues to reveal numerous taxonomically novel

rheophytic aroid species, which should come as no great surprise given that, has been

noted on numerous occasions, many aroids are highly localised.

Where possible, attempts are made to match cultivated novelties with pre-

existing herbarium specimens. However, often this not practicable owing to the

Gard. Bull. Singapore 65(1) 2013

problems highlghted above. Two such “unmatcehable” novelties belonging to the genus

Piptospatha N.E.Br. are here described.

Da).

Ba)

4a.

Sa)

Key to Piprospatha

Sterile, staminodial interstice between pistillate and staminate flower zones well-

defined... n cs eset aceata a a ai Saal a RI ERE RPR ORI OR RE DORI IRI 2

Sterile interstice absent, or at most defined by one or two staminodes ...... 5

Stem long, repent. (N Kalimantan ICnga)e P. repens

Stem short, erect 13, cai ie a oaze era SRR o Boa NONE IRI e ea ea 3

Pistillate flowers green; spathe terminus slightly beaked but not pileate, glossy

deep pink :... sine inec a aa obuze a ati a aa a a aaa e Ra NI ROI aa RR 4

Pistillate flowers pinkish grey; spathe limb strongly pileate, deep magenta-

purple. (Shales; N Kalimantan iara) 3 P. pileata

Staminodes rounded, convex, white. Leaf blades with primary lateral veins

hardly visible abaxially. (NE Sarawak at Miri, Limbang; Brunei; W Sabah)

sasa în aza atat Bf at aa alea d attata a 20700005) Rae DIORRRDNIII a a i RI P. burbidgei

Staminodes prismatic, truncate, yellow. Leaf with primary lateral veins

impressed. Granite. Indonesian Borneo (Kalimantan Barat: Nanga Taman)

DDR PERIE po e cub ae andone aie ao era dcaaa P colata

Connective extended into a pronounced elongate central beak. (? NE

SarawWak). na esa sta oaza aaa ai are a RR RR E E RE E RI P. insignis

Connective not raised centrally above the thecae, or at most shortly elevated

and Obtuse ni ae a e er aaa o a IRI OD RE 6

Staminate.flowers pubescent E 7

Staminate. flowers plabrous.. eee 10

Spathe white at anthesis; stamen in closely-appressed, regularly-arranged

pairs; leaf blades abaxially with conspicuously tessellate 2-order veins.

(Malay Peninsula and southern peninsular Thailand) ............ P. perakensis

Spathe pink; stamens irregularly arranged; leaf blades abaxially with 2-order

veins not conspicuously tessellate, or only very faintly so. (Borneo ......... 9

New Piprospatha species from Borneo 9

9a. Diminutive plants up to 14 cm tall with decumbent-creeping stems; leaf

blade elliptic, 4-6 cm long, tertiary venation abaxially forming a very faint

tessellate reticulum; spadix 8-12 mm long; pistillate flower zone with 3-5

oblique whorls of staminodes at the base; fruiting spathe up 1 cm long and

wide. (Plants of travertine; Kalimantan Timur: Sangkulirang) .... P manduensis

b. Robust plants to 25 cm tall or more, with short, erect stems; leaf blade very

narrowly oblong-elliptic, 12—20cm long, all veins parallel pinnate; spadix c. 2

cm long; pistillate flower zone fertile to the base; fruiting spathe 2.5 cm long

and wide. (Plants of exposed shales; Sarawak: Kapit) ......... P. marginata

10a. Pistillate flowers bright green; spadix bullet-shaped, staminate portion bright

yellow; thecae broadly excavated, the excavations of adjacent anthers forming a

butterfly-shaped depression; interior of spathe tip rostrum with 5-7 conspicuous

keels; persistent fruiting spathe wide-flared. (Alkaline geologies (limestone,

basalt); SW Sarawak, N Kalimantan Barat) ..................... P viridistigma

b. Pistillate flowers pink or dirty whitish; spadix cylindrical; staminate portion not

bright yellow; thecae longitudinally sulcate with the pores ventral and dorsal

to the sulcae; interior of the spathe tip rostrum with 2—3 conspicuous keels or

keels absent; persistent fruiting spathe narrowly obconic. (Plants not of alkaline

PELES O oroare ruta ale ela A au 0 aa pacate Se oara Il

Ila. Stigmas mid-deep pink; stamen connective with smooth raised rim. (Granites;

iri SATPEREL2 e cea esta 0 ED RI ERIE BRD ERROR RPR P. elongata

b. Stigmas dirty whitish; stamen connective margins not smooth, rim-like.

ISUS LONESIOTASIA ES) e e a aaa o o eee aa aa oală turta Ure aratat 12

I2a. Stamen connective with a triangular wing on each side; staminodes at base of

pistillate zone white, rounded. (Sandstones; NW Sarawak) ....... P. impolita

b. Stamen connective with frilled margins; staminodes at base of pistillate zone

cream, truncate with a central depression. (Hard shales; Kalimantan Utara)

a cr ucue cz cita MESERIE EDO RD 7 III RIO RI N RR 0 EERO P. deceptrix

Piptospatha colata P.C.Boyce & S.Y.Wong, sp. nov.

Piptospatha colata shares green pistils (or stigmas) with P. viridistiama P.C.Boyce,

S.Y.Wong & Bogner and P burbidgei (N.E.Br.) M.Hotta. From P. viridistigma it may

be separated by the presence of a zone of staminodes at the interstice of the pistillate

and staminate flower zones, and by the staminate flowers much more densely arranged,

with cream (not deep yellow) stamens, and truncate (not excavated) connectives.

Piptospatha burbidgei and P. colata are distinguished from one another by truncate

yellow, not convex white, staminodes at the interstice and at the base of the pistillate

flower zone. Leaf morphology also serves to separate P. colata and P burbidgei; the

leaf blades of P burbidgei are narrowly oblong and obtuse, with the adaxial surface

smooth with the primary lateral veins almost invisible. Piprosparha colata vegetatively

10 Gard. Bull. Singapore 65(1) 2013

closely approaches P. pileata S.Y.Wong & P.C.Boyce and P deceptrrix S.Y.Wong

& P.C.Boyce. From both, P colara 1s distinguished by spadix morphology. Spathe

overall morphology of P colata rather resembles that of P pileata and P. elongata

(Engl.) N.E.Br., although again their individual spadix morphologies distinguished

them with ease.

TYPE: K.Nakamoto AR-3780, Indonesian Borneo, Kalimantan Barat, Sekadau,

Nangataman, west of Nangataman, Gunung Canayang east slope, 4 Feb 2012 (holo

SAR! iso BO!). (Fig. 1A, 2A, 3A)

Clumping rheophytic herb to 35 cm tall. Roozs strong, c. 2 mm in diameter. Stem

short, condensed, to 20 mm in diameter, all except the oldest portions obscured by leaf

bases. Leaves many together, spreading or arching, forming a dense rosette; petiole

bases clasping stem; petiole 5-8 cm long, up to 2.5 mm in diameter, D-shaped in

cross-section, minutely scabrous, dull reddish green; petiolar sheath with free ligular

portion, c. 4 cm long, marcescent and ultimately deciduous, pale reddish-pink when

fresh, drying dark reddish brown; leaf blades narrowly elliptic, 5—20 cm long x 24.5

cm wide, base cuneate, somewhat obtuse, apex acute with stout tubule, c. 5 mm long,

in life semi-glossy medium green adaxially, paler abaxially with the mid-rib and

primary lateral veins pale reddish, drying dark reddish brown with abaxial venation

slightly darker; mid-rib bluntly raised adaxially, rounded-raised and minutely scabrous

adaxially; primary lateral veins c. 6 per side, parallel pinnate, impressed adaxially,

very slightly raised abaxially; interprimary lateral veins weaker than primary laterals

although still conspicuous, interprimary veins joining a weakly defined submarginal

collecting vein; primary lateral and interprimary veins very slightly raised abaxially

and adaxially; interprimary veins irregularIy visible as semi-translucent broken lines

running parallel to the primary laterals. Inflorescence solitary, erect; peduncle 11-15

cm long (at anthesis), c. 3.5 mm in diameter, minutely but distinctly scabrous, reddish

brown. Spathe initially erect, later held at c. 90* to peduncle, later still (post anthesis)

again erect, not constricted, deep pink in late bud, spathe limb opening mainly in

shades of glossy deep pink, with the median keel and terminal rostrum deep purple-

pink, the rostrum ultimately deep reddish brown, proximal part of spathe dull olive-

greenish brown with pale speckles; spathe limb, c. 6 cm long, the base c. | cm wide,

mid-way inflated to c. 2.5 cm, then ventrally constricted and terminating in a rostrum c.

6 mm long, internally without rostral keels, or with one only and these weakly defined.

Spadix 2.3—2.8 cm long * 6.5—-7.5 mm in diameter, base slightly obliquely inserted

onto spathe/pedunele; pistillate flower zone with 1-4 rows of rhomboidal truncate pale

yellow staminodes inserted basally, pistillate flower zone jade-green, weakly barrel-

shaped, 5.5—8.5 mm long * 6-7.5 mm in diameter, pistils eylindrical, truncate, very

congested, c. 0.6 mm diameter; stizma weakly umbonate, papillate, as wide as ovary;

pistillate and staminate zones separated by a zone c. 2 mm long comprised of c. 2

whorls of staminodes, these rhomboidal-polygonal, truncate, pale yellow; staminate

flower zone cream, equalling the pistillate zone in width, 1.5-21 cm long * 6.5-7.5

mm in diameter, weakly fusiform to slightly tapering, apex blunt; staminate flowers

congested, comprised of paired stamens, irregularly oblong and very weakly butterfly

New Piptospatha species from Borneo IL]

Fig. 1. A. Piptospatha colata P.C.Boyce & S.Y.Wong. B. Piptosparha viridistima P.C.Boyce,

S.Y.Wong & Bogner. C. Piprospatha burbidgei (N.E.Br.) M.Hotta. D. Piptospatha deceptrix

PC.Boyce & S.Y.Wong. E. Piprospatha pileata S.Y.Wong & P.C.Boyce. F. Piprospatha

elongata (Engl.) N.E.Br. A-F. Spadices at pistillate anthesis, in each instance the spathe

artificially removed. A. from AR-3665; B. from AR-250; C. trom AR-1973; D. from AR-3980;

E. from AR-3923; F. from AR-3601. (Photos: Peter C. Boyce)

Z Gard. Bull. Singapore 65(1) 2013

Fig. 2. A. Piprospatha colata P.C.Boyce & S.Y.Wong. B. Piprosparha viridistizma P.C.Boyce,

S.Y.Wong & Bogner. C. Piprospatha burbidgei (N.E.Br.) M.Hotta. D. Piprospatha deceptrix

PC.Boyce & S.Y.Wong. E. Piptospatha pileata S.Y.Wong & P.C.Boyce. F. Piptosparha

elongata (Engl.) N.E.Br. A. from AR-3665; B. from AR-2432; C. from AR-1973; D. from AR-

3980; E. from AR-3923; F. from AR-3601. (Photos: Peter C. Boyce)

shaped, c. 0.5 mm wide * c. | mm long, connective truncate, glabrous; thecae lateral,

c. 0.3 mm, elhpsoid with a wide rim, sunken into a shallow pit. Infructescence not

observed.

Other specimens seen: INDONESIAN BORNEO. Kalimantan Barat. Sekadau, Sekadau

Hilir, Kayu Lapis, south of Kayu Lapis „ 0”2.38'S 111*0'33.99"E, 20 Sep 2011, Nakamoto AR-

3665 (SAR); Sekadau, south east of Nanga Taman, Kampung Seri Punti, Gunung Raya, south

slope, 3 Feb 2012, Nakamoto AR-3776 (SAR).

Distribution. Indonesian Borneo, Kalimantan Barat, known from two localities at

Nanga Taman, and a third near Kayu Lipis, c. 37 km (in a straight line) to the NE.

Ecology. Obligate rheophyte on waterfalls and river boulders on granite under moist

lowland forest; 100-400 m. asl.

Notes. Piptospatha colata is defined by the combination of green pistils, pale yellow,

prismatic staminodes, a deep pink spathe with a prominent rostrum, semi-glossy

medium green leaves with primary lateral veins impressed adaxially.

New Piptospatha species from Borneo |

(99)

Fig. 3. A. Piptospatha colata P.C.Boyce & S.Y.Wong. B. Piptospatha viridistigma P.C.Boyce,

S.Y.Wong & Bogner. C. Piptospatha burbidgei (N.E.Br.) M.Hotta. D. Piptospatha deceptrix

P.C.Boyce & S.Y.Wong. E. Piptospatha pileata S.Y.Wong & P.C.Boyce. F. Piptospatha

elongata (Engl.) N.E.Br. A-F. Plants in habitat. A. from AR-3776; B. from AR-3669; C.

from AR-1973; D. from AR-3980; E. from AR-3923; F. from AR-2052. (Photos: A & D-E, K.

Nakamoto; B-C & F, Peter C. Boyce)

14 Gard. Bull. Singapore 65(1) 2013

Piptospatha colata is the third species described to have green pistils and

stigmas. The others are vegetatively somewhat similar to P. viridistima P.C.Boyce,

S.Y.Wong & Bogner, (alkaline geologies, NW Borneo), and the vegetatively very

dissimilar P burbidgei (N.E.Br.) M.Hotta, (shales, N Borneo) (Fig. 1A-C). Piptosparha

colata is distinguished from P. viridistigma by the presence of a zone of staminodes

at the interstice of the pistillate and staminate flower zones, by the staminate flowers

much more densely arranged, with cream (not deep yellow) stamens, and truncate (not

excavated) connectives (Fig. IA & B), and the spadix barely one third as long at the

spathe. Leaves of P colara difter by the combination of the relatively shorter petiole

and relatively longer, narrower erect, not arching blades. Piptosparha burbidgei and

P colata are difterentiated by staminode morphology and colour, with the staminodes

truncate, prismatic, yellow, and not convex, rounded, white (Fig. IA & C). Leaf

morphology also readily distinguishes P col/ata from P. burbidgei; leaf blades of P

burbidgei are narrowly oblong, obtuse, and adaxially smooth, with the primary lateral

veins almost invisible, and of a characteristically rather peculiar olive-green (Fig. 3A

& C).

Piptospatha colata vegetatively rather resembles P deceptrrix S.Y.Wong &

P.C.Boyce and P pileata S.Y.Wong & P.C.Boyce (both from shales, Kalimantan Utara).

The leaf blades of P colara are adaxially semi-glossy medium green with impressed

primary lateral veins and noticeably different to matte leaf blades with only slightly

impressed veins of P deceprrix (Fig. 3A & D), and the deep green, glossy blades

with barely impressed venation of P pileata (Fig. 3A & E). In addition, P colata is

distinguished from both by spadix morphology (Fig. IA. D& E).

Spathe morphology of P colara is similar that of both P pileata and P elongata

(Engl.) N.E.Br. (granites, NW Borneo—Fig. 2A, E & F), although the terminal portion

of the spathe of P colata is much less pronounced-rostrate.

Etymology. From Latin colatus [fem. colata], cleansed, purified, in whimsical allusion

to this new species being for some time muddled by the authors with P. viridistigma,

a situation rectified here.

Piptospatha deceptrix P.C.Boyce & S.Y.Wong, sp. nov.

Flowering Piprospatha deceptrix is reminiscent of P burbidgei, with the blunt, rose-pink

spathe with short terminal rostrum almost indistinguishable. However, P deceprrix is

readily distinguished from P. burbidgei by the much longer zone of truncate, centrally

impressed (not weakly convex) pale yellow (not white) staminodes below the pistillate

flower zone; by the absence (or at most very depauperate) interstice staminodial

zone; and by the very pale pinkish grey (not green) pistils and stigmas. The narrowly

elliptic, acute leaf blades with the primary lateral veins adaxially impressed are quite

difterent to those of P burbidgei, in which the leaf blades are narrowly oblong, obtuse,

and adaxially smooth with the primary lateral veins almost invisible. Piptospatha

deceptrix most closely approaches P. pileata in overall apperance, although the latter

1s readily difterentiated by the spadix with much longer zone of yellow interstitial

New Piprospatha species from Borneo 15

staminodes, by almost lacking a zone of staminodes below the pistillate flowers, and

by the deep magenta-purple (not pale rose-pink) strongly pileate spathe limb. Leaves

of P deceptrix and P pileata are somewhat similar, but distinguished by the leaf blades

being glossy (P pileata) rather than matte (P deceprrix), and (in P. deceptrrix) the

petioles lacking the crispulate hyaline wings along the dorsal edges. From both P

burbidgei and P. pileata, P deceptrix 1s distinct by the stouter, blunt-tipped spadix.

TYPE: Nakamoto AR-3980, Indonesian Borneo, Kalimantan Utara, Malinau Selatan,

Mentarong village, near the confluence of Sungai Mentarang and Sg. Malinau, 18 June

2012 (holo SAR! iso BO!). (Fig. 1D, 2D, 3D)

Clumping rheophytic herb to 35 cm tall. Roots strong, c. 3 mm in diameter. Srem short,

condensed, to 25 mm in diameter, obscured by leafbases. Leaves many together, arching,

forming a loose rosette; petiole bases clasping stem; petiole 5-8 cm long, up to 2 mm

in diameter, D-shaped in cross-section, basal portion of petiole minutely scabrous, dull

medium green; petiolar sheath with free ligular portion, 2-4 cm long, marcescent and

ultimately deciduous; persistent part of ligular sheath with hyaline margin, somewhat

dark reddish brown; leaf blades narrowly ellhptic to narrowly oblanceolate, 7-22 cm

long * 24.5 cm wide, base cuneate, somewhat obtuse, apex acute with stout tubule,

c. 5 mm long, in life matte medium green adaxially, paler abaxially, drying dull pale

brown with abaxial venation darker; mid-rib bluntly raised adaxially, rounded-raised

and minutely scabrous adaxially; primary lateral veins c. 8 per side, parallel pinnate,

very slightly impressed adaxially, slightly raised abaxially; interprimary lateral veins

weaker than primary laterals although still conspicuous, interprimary veins Joining

a weaklydefined submarginal collecting vein; primary lateral and interprimary veins

very slightly raised abaxially and adaxially; interprimary veins irregularIy visible as

semi-translucent broken lines running parallel to the primary laterals. Inflorescence

solitary, erect; peduncle 9-17 cm long (at anthesis), c. 3 mm in diameter, minutely

by distinctly scabrous, reddish brown. Sparhe initially erect, later held at c. 45” to

peduncle, later still (post anthesis) once again erect, not constricted, rose-pink in late

bud, opening with spathe lmb bright rose-pink shading to medium pink and then

pale olive-brown (base) proximally; spathe limb infiated at anthesis, shedding during

staminate anthesis, c. 3.5 cm long, the base c. 1.5 cm wide, mid-way inflated to c.

2.5 cm, terminal rostrum c. 3 mm long, with 3—5 very weak internal rostral keels.

Spadix 1.8—2.2 cm long * 6-7 mm in diameter, base obliquely inserted onto spathe

and peduncle; pistillate flower zone with 2-4 rows of cream rhomboidal, apically

impressed staminodes inserted basally, pistillate flower zone pale grey, cylindric, c.

3.5 mm long * c. $ mm in diameter, pistils cylindrical, truncate, very congested, c. 0.6

mm diameter; stigma pale grey, with a slight central depression, strongly papillate, as

wide as ovary; pistillate and staminate zone mostly contiguous, occasionally with a

few scattered cream staminodes between, these rhomboidal-polygonal, with a central

impression; staminate zone pale cream, slightly exceeding the pistillate zone in width,

c. 1.3 cm long * 6-7 mm in diameter, stoutly fusiform, apex blunt; staminate flowers

congested, comprised of obscurely paired stamens, irregularly oblong, c. 0.5 mm wide

x c. | mm long, connective with a weak longitudinal sulcus and slightly frilled margins,

16 Gard. Bull. Singapore 65(1) 2013

these extending around the thecae, glabrous; thecae lateral, c. 0.3 mm, elhpsoid with a

wide rim, the opposite stamens linked by a the connective transverse sulcus. Fruiting

spathe deeply cyathiform, dull olive-green, c. 1 cm long * 1.2 cm wide, the base

obliquely inserted on peduncle. Fruits and seeds not observed.

Distribution. Indonesian Borneo, Kalimantan Utara, known only from the type locality

Ecology. Obligate rheophyte on waterfalls and river boulders on very hard shales

under moist lowland forest; c. 200 m. asl.

Notes. Piptospatha deceptrix 1s defined by the combination of lacking a zone of

staminodes above the pistillate flowers, a blunt, rose-pink spathe, and matte medium

green leaf blades with (abaxially) slightly impressed primary lateral veins.

Inflorescences of P deceprrix are very reminiscent of those of P burbideei,

with the blunt, rose-pink spathe with short terminal rostrum (Fig. 2C & D). However,

P. deceptrix is readily distinguished from P. burbidgei by the much longer zone of

truncate, centrally impressed (not weakly convex) pale yellow (not white) staminodes

below the pistillate flower zone, the absence (or at most very depauperate) interstice

staminodial zone, and the very pale pinkish grey (not green) pistils and stigmas (Fig. IC

& D). The narrowly elliptic, acute leaf blades with the primary lateral veins adaxially

impressed are quite different to those P burbidgei, where the leaf blades are narrowly

oblong, obtuse, and adaxially smooth with the primary lateral veins almost invisible

(Fig. 3C&D).

In overall appearance P. deceprrix most closely approaches P pi/eata, although

the latter is readily differentiated by the spadix with much longer zone of yellow

interstitial staminodes, by almost lacking a zone of staminodes below the pistillate

flowers, and by the deep magenta-purple (not rose-pink) strongly pileate spathe limb

(Fig. ID & E; Fig. 2D & E). Leaves of P deceprrix and P pileata are somewhat

similar, but distinguished by the leaf blades that are glossy (P pileara) instead of matte

(P. deceptrix), and (in P. deceprrix) the petioles lacking the crispulate hyaline wings

along the dorsal edges.

From both P burbidgei and P pileata, P. deceptrix is distinct by the stouter,

blunt-tipped spadix (Fig. IC-E).

Etymology. Latin deceptus |fem. deceptrrix], to deceive, in allusion to this novelty

resembling one species vegetatively, and another in floral morphology.

ACKNOWLEDGEMENTS. The study visits to the herbaria mentioned in this paper were

funded under the first author's ITTO Fellowship Ref. 026/09A. This is part of an on-going

research which is funded by the Ministry of Higher Education, Malaysia by fundamental

research grant scheme vote: FRGS/01(12)/709/2009(25). We also wish to extend our thanks to

the Directors or Curators of BO, L, SAR, and SING for allowing access to material, and to their

staft for facilitating our observations.

New Piptospatha species from Borneo 17

References

Bogner, J. & Hay, A. (2000) Schismatoglottideae in Malesia II - Aridarum, Bucephalandra,

Phymatarum and Piptospatha. Telopea 91): 183-194.

Okada, H. & Tsukaya, H. (2010) A new species of Piprosparha (Araceae: Schismatoglottideae)

from West Kalimantan, Indonesian Borneo. Acra Phytotax. Geobot. 61: 87-92.

Wong, S.Y., Bogner, ]. & Boyce, PC. (2011) Studies on Schismatoglottideae (Araceae) of

Borneo XIV: Piptospatha marginata resurrected and observations on Piptospatha,

notably for the Rejang drainages. Webbia 66: 29-32.

Wong, S.Y., Boyce, P.C. & Bogner, ]. (2009) Studies on Schismatoglottideae (Araceae) of

Borneo VIII: A review of Piptosparha elongata in Sarawak. Gard. Bull. Singapore

61(1): 217-233.

Wong, S.Y. & Boyce, PC. (2010) Studies on Schismatoglottideae (Araceae) of Borneo XI:

Ooia, a new genus, and a new generic delimitation for Piprospatha. Bot. Stud. (Taipei)

51: 543-552.

Wong, S.Y. & Boyce, P.C. (2012) Araceae of Indomalaya II: Piprosparha N.E.Br. Malayan

Nat. J. 64(1): 9-32.

Wong, S.Y. & Boyce, P.C. (in press) Schismatoglottideae of Borneo XIX - Piprospatha pileata,

a remarkable new species from Kalimantan Timur, Indonesian Borneo. Wi//denowia.

Gardens” Bulletin Singapore 65(1): 19-26. 2013 19

Musa markkui (Musaceae),

a new species from Arunachal Pradesh, India

R. Gogoi! and S. Borah?

Botanical Survey of India, Arunachal Pradesh Regional Centre,

Senki View, Itanagar, 791111, Arunachal Pradesh, India

' rajibbsi(ayahoo.co.in (corresponding author)

“souravjyotiborah(4 gmail.com

ABSTRACT. Musa markkui R.Gogoi & S.Borah, a new species of Musa of the section

Rhodochlamys, is described and illustrated from Lohit valley, Arunachal Pradesh, India based

on observed morphological characters in the field. A key to M. markkui and related taxa is

provided.

Keywords. Arunachal Pradesh, banana, India, Musa, Musaceae, new species

Introduction

North East India is considered a part of Southeast Asia and within the centre of diversity

of Musa (Musaceae), a region not studied in detail and where new species and varieties

continue to be reported (Hăkkinen 2007, 2009). The genus Musa consists of about 73

species (Hăkkinen & De Langhe 2001; Hăkkinen & Sharrock 2002; Hăkkinen 2003a,

b, 2004a, b, 2005a, b, 2006a-c, 2007, 2009; Hăkkinen & Meekiong 2004, 2005;

Hăkkinen et al. 2005; Hăkkinen & Wang 2007; Hăkkinen & Wallace 2007; Hăkkinen

et al. 2007; Hăkkinen & Văre 2008a-c; Hăkkinen et al. 2008; Swangpol & Somana

2011) and over 500 cultivars (Simmonds 1956, 1966; Champion 1967; Valmayor et al.

2001, 2002; Hăkkinen 2009).

The present communication records the discovery of a new species of Musa

from the Lohit valley of Arunachal Pradesh, India, here named M. markkui, which

belongs to the section Rhodochlamys. The section Rhodochlamys is one of the four

sections (the others being Australimusa, Callimusa and Musa) into which the genus

Musa is divided, which is confined mainly to NE India, Bangladesh, Myanmar and

NW Thailand (Hăkkinen 2002, 2009). Species in Rhodochlamys are characterised by

erect or drooping inflorescence with fruits pointing towards the bunch apex. Most of

the species typically have relatively few fruits and are best known for their brightly

coloured bracts (Cheesman 1947, 1949; Simmonds 1962; Shepherd, 1999; Hăkkinen

& Sharrock 2002; Hăkkinen 2005b, 2007; Hăkkinen et al. 2007).

Extensive field observations were made by the senior author during four

expeditions in July 2011 and September 2012 in the border areas of Lohit and Anjaw

districts of Arunachal Pradesh, under the Annual Action Plan Project “Flora of

20 Gard. Bull. Singapore 65(1) 2013

Anjaw district” ot the Botanical Survey of India. The new species is described in

the field following the traditional banana taxonomy approach as used by Simmonds

(Simmonds 1962, 1966). Relevant portions of the specimens are deposited as holotype

at the Central National Herbarium (CAL) of the Botanical Survey of India, Howrah,

and isotype at the ASSAM herbarium.

Musa markkui R.Gogoi & S.Borah, sp. nov.

Musa markkui is closely related to M. ornata Roxb, developing slender plants, erect

inflorescences, green peduncles, and pink female and male buds, but differs in developing

more pseudostems per plant, a much taller height, larger leaves, inflorescences that are

at first erect and later becoming horizontal, longer peduncles with whitish pubescence,

revolute bracts, more hands with more fruit in the fruit bunch, and bigger fruits.

TYPE: Gogoi & Borah 21654, India, Arunachal Pradesh, Lohit District, 7 km before

Salangam towards Tidding, 27%56'25.33"N 96*22'38.76"E, 1302 m, 13 September

2012 (holo 3 sheets, CAL; iso ASSAM). (Fig.l & 2).

Plant slender, suckers 12-22, produced freely and close to parent plant, vertical;

mature pseudostem 300-325 cm tall, 9-12 cm in diameter at the base, generaily light

green with blood red blotches, shining, sap milky. Peziole 483-193 cm long, 3—3.5 cm

in diameter, petiole bases winged and not clasping the pseudostem, margin reddish;

blade 193-240 cm long, 45-65 cm wide, margin with brownish or pinkish lining, apex

truncate, upper surface deep green, lower surface light green, mid-rib on lower surface

pink, on upper surface green, leaf base asymmetric, both sides rounded. I/nflorescence

erect, or sometimes erect at first and then horizontal, pedunele to 40 cm long and 5.5

cm in diameter, clothed with white pubescence, sterile pink bracts two, persistent at the

opening of the first female flowers. Female bud lanceolate, to 40 cm long and 8-9 cm

wide; bracts pink, convolute, not waxy, white pubescent, 3-4 bracts parting at a time,

revolute and deciduous. Basal flowers female, hermaphrodite, 4-7 per bract in a single

row, flower 10.5 cm long (whole); ovary 5 cm long, 1.5 cm in diameter, slightly curved,

triangular to quadrangular in cross section; style to 4.3 cm long, stigma capitate, 0.7

cm across; compound tepal 5.5 cm long, 2 cm wide, orange coloured, with 2 thickened

keels, ribbed at the dorsal angles, with a S-toothed orange apex, lobes subequal, rolled

outwards; free tepal 5 cm long, 2 cm wide, translucent yellow, ovate, with a simple

told under the apex, acumen orange; stamens 5, filaments yellowish white, to 2.8 cm

long, anther lobes to 3.2 cm long, rusty brown, anther and style at the same level. Male

bud pink, lanceolate, to 21 cm long and Il cm wide; bracts outside pink, internally

light pink to whitish, one or two bracts parting at a time, revolute and deciduous,

male bud inconspicous or without remains at infructescence maturity, only the rachis

remaining, 13-16 cm long. Male flowers on average 6 per bract in a row, compound

tepal 3.5—5.5 cm long, 0.8—1 cm wide, golden yellow, with a S-toothed apex; free tepal

3—3.5 cm long, to 1.2 cm wide, translucent white, ovate, with a short orange acumen;

style light yellow with creamy or light yellow stigma; stamens 5, filaments white,

anther lobes creamy or light brown, anther and style at the same level; ovary straight,

Musa markkui, new species from India 21

Fig. 1. Musa markkui R. Gogoi & S. Borah. A. Plant in wild. B. Pseudostem base. C. Emerging

inflorescence. D. Inflorescence with immature fruits and male bud. E. Infructescence. (Photos:

R. Gogoi & S. Borah)

22 Gard. Bull. Singapore 65(1) 2013

white, without pigmentation. Fruit brunch compact, with 4-7 fingers in a row, 7-10

hands, pedicel to 4 cm long; individual fruit up to 12 cm long (without pedicel), 2.5—3

cm in diameter, 3-4-angled, angles raised, fruit apex blunt-tipped at apex, without

floral remains, fruit peel colour light greenish yellow when ripe, immature fruit pulp

white, becoming creamy and soft at maturity. Seeds black, compressed, quadrangular,

surface tuberculate, c. 4 mm long and Smm wide at apex.

Distribution and habitat. Musa markkui is quite common în the hilly slopes of Tidding,

Salangam, all the way from Hyuliang to Mataliang, at the higher elevations of 900-—

1400 m in the Lohit and Anjaw district of Arunachal Pradesh. It occurs sympatrically

with M. nagensium var. hongii and M. cheesmanii Simmonds.

Notes. Chromosome numbers of Rhodochlamys species are 2n=22 (Cheesman &

Larter 1935; Simmonds 1962; Shepherd 1999; Hăkkinen & Sharrock 2002; Campion

1967; Hăkkinen 2009; Li et al. 2010).

Etymology. The new species M. markkui is named in honour of Finnish botanist

Markku Hăkkinen for his outstanding contribution to a better understanding of Musa

taxonomy.

There was some confusion in a horticultural context (Singh et al. 2001; Uma et al.

2005; Uma 2006: 9, Fig.7) with the name M. rosacea (non Jacquin, and used without

any authority) from Arunachal Pradesh; indeed, that seems to refer to a distinct species,

and shows similarity to M. markkui, but it is not published and type specimens were

not deposited towards making a valid publication. On the other hand, the confusion

between M. ornata Roxb. and M. rosacea Jacquin is also considered to be resolved

as Jacquin's Musa is synonymous with Musa balbisiana Colla and distinct from the

former (Văre & Hâkkinen 2009).

NE India is very relevant to Musa taxonomy as it is the type locality of several

species, viz., M. velutina H.Wendl. & Drude, M. laterita Cheesman, M. sanguinea

Hook.f., M mannii H.Wendl. ex Baker, M. aurantiaca Mann ex Baker, M. cheesmanii

Simmonds, M. nagensium Prain, etc. The present discovery ofa beautiful Rhodochlamys

species with horticultural potential raises the possibility of further undescribed species

in the wild. The new species M. markkui would be a desirable plant for introduction

into horticultural cireles worldwide.

Key to some closely related Rhodochlamys species

la. Basal flowers female, 45 flowers per bract; male bracts orange externally,

oranpe-yellow inside. e Musa aurantiaca

b. Basal flowers hermaphrodite, 3—7 flowers per bract; male bracts blood red,

pink-or rose on'both'sides; „e oa aero ala a a RE RER DE a Re ERP )

Musa markkui, new species from India 42,

Fig. 2. Musa markkui R.Gogoi & S.Borah. A. Emerging female bud. B. Male bud with immature

fruits. C. Bract with basal flowers of female bud. D. Basal hermaphrodite flower. E. Free tepal

of basal flower (dorsal view). F. Free tepal of basal flower (ventral view). G. Ovary with style

and stigma. H. Male flower. I. Compound tepal (ventral view) with style of male flower. J.

Compound tepal (dorsal view). K. Stamens of male flower. L. Longitudinal section of fruit. M.

Seeds. (Photos: R. Gogoi & S. Borah)

24 Gard. Bull. Singapore 65(1) 2013

2a. Pseudostems 2-3 in the same plant; inflorescence erect or initially erect and

then horizontal; free tepals a quarter the length of the compound tepal; bracts

brick red 10 TOSe: aces e e aa ae tuia pt cr a ata a N ARIEI DR RI DD RIND 3

b. Pseudostems 12-22 in the same plant, free tepals as long as compound tepals,

bracis, blood reg 07 pink none e eee ovaz e ae E a 2000 a 0 RER A

3a. Pseudostem emerging 2 meters from the parent plant; inflorescence erect;

male flowers 6-10 per bract in two rows, orange in colour, bracts brick red

SER RR POD a cer ee Dildo dare a soedo Musa laterita

b. Pseudostem emerging quite close to the parent plant; inflorescence horizontal;

male flowers 2-3 per bract in one row, light yellow; bracts rose in colour

înce pretur ta Tara roi arate aa aratate age IEEE ao Ie 5 RR RIDER Musamannii

4a. Plantupto 150 cm tall; inflorescence horizontal, peduncle red, bracts blood red

externally and internally; fruit bunch lax 2 e Musa sanguinea

b. Plant up to 250-325 cm tall; inflorescence erect, peduncle light green, bracts

pink; fruit bunch compact «n e pe oa acea a oa e ei Re RR 5)

Sa. Plant up to 240 cm high; pseudostem up to 15 in the same plant, with black

blotches; leaves up to 200 cm long, 35 cm wide; peduncle glabrous; bracts not

revolute; fruit bunch up to $ hands with 3-6 fingers; individual fruits up to 8

em long and 2'emi diaree e 2 Musa ornata

b. Plants up to 325 cm high; pseudostems up to 22 in the same plant, with red

blotches; leaves up to 240 cm long and up to 65 cm wide; pedunele pubescent;

bracts revolute; fruit bunch up to 10 hands with 4-7 fingers; individual fruit up

to 12 em long'and 3 ecua diane ler e e Musa markkui

ACKNOWLEDGEMENTS. The authors are grateful to Dr. P. Singh, Director, Botanical

Survey of India, Kolkata and Dr. A. A. Mao, Scientist E and HOO, Arunachal Pradesh Regional

Centre, Botanical Survey of India, Itanagar for much support and logistics. We are also thankful

to Dr. K.N. Gandhi, Senior Nomenclatural Registrar, HUH, Harvard, U.S.A., for his helpful

suggestions during preparation of the manuscript.

References

Champion, J]. (1967) Les Bananiers et Leur Culture, pp. xii + 214. Paris: IFAC, Editions

SETCO.

Cheesman, E.E. (1947). Classification of the bananas II: The genus Musa L. Xew Bull. 2:

106-117.

Cheesman, E.E. (1949) Classification of the bananas ill: Critical notes on species. Kew Bull.

3: 265-272.

Cheesman, E.E. & Larter, L.N.H. (1935) Genetical and ceytological studies of Musa III:

Chromosome numbers in the Musaceae. J. Gener. 30(16): 31-52.

Musa markkui, new species from India 25

Hăkkinen, M. (2002) Wild bananas: The genus Musa L. of the section Rhodochlamys in India.

Newslert. Bot. Surv. India 3(1): 1-3.

Hăkkinen, M. (2003a) Taxonomic history and identity of Musa rubra Wall. ex Kurz. Philipp.

Agric. Scientist 86(1): 92-98.

Hăkkinen, M. (2003b) Musa campestris Beccari varieties in Northern Borneo. Philipp. Agric.

Scientist 86(4): 424-435.

Hăkkinen, M. (2004a) Musa voonii, a new Musa species from Northern Borneo and discussion

of the section Cal/limusa in Borneo. Acta Phyrotax. Geobotr. 55(2): 79-88.

Hăkkinen, M. (2004b) Musa campestris Becc. (Musaceae) varieties in northern Borneo. Folia

Malaysiana 5(2): 81-100.

Hăkkinen, M. (2005a) Musa azizii, a new Musa species (Musaceae) from Northern Borneo.

Acta Phytotax. Geobot. 56(1): 27-31.

Hăkkinen, M. (2005b) Ornamental bananas: Notes on the section Rhodochlamys (Musaceae).

Folia Malaysiana 6(1 & 2): 49-72.

Hăkkinen, M. (2006a) Musa barioensis, a new Musa species (Musaceae) from Northern

Borneo. Acta Phytotax. Geobot. 57(1): 55-60.

Hăkkinen, M. (2006b) Musa lawitiensis Nasution & Supard. (Musaceae) and its intraspecific

taxa in Borneo. Adansonia ser 3, 28(1): 55-65.

Hăkkinen, M. (2006c) A taxonomic revision of Musa rosea (Musaceae) in Southeast Asia.

Novon 16(4): 492-496.

Hăkkinen, M. (2007) Ornamental bananas: Focus on Rhodochlamys. Chron. Hort. 47(2): 7-12.

Hăkkinen, M. (2009) Lectotypification of two Musa sections (Musaceae). Nord. J. Bor. 27:

207-209.

Hăkkinen, M. & De Langhe, E. (2001) Musa acuminatra in Northern Borneo. Montpellier,

France: INIBAP.

Hăkkinen, M. & Sharrock, S. (2002) Diversity in the genus Musa—Focus on Rhodochlamys.

INIBAP Annual Report 2001, pp 16-23. Montpellier, France:INIBAP.

Hăkkinen, M. & Meekiong, K. (2004) (Publ. 2005) A new species of Musa from Borneo. Syst.

Biodivers. 2(2): 169-173.

Hăkkinen, M. & Meekiong, K. (2005) Musa borneensis Becc. (Musaceae) and its intraspecific

taxa in Borneo. Acra Phytotax. Geobor. 56(3): 213-230.

Hăkkinen, M.. Suleiman, M. & Gisil, ]. (2005) Musa beccarii Simmonds (Musaceae) varieties

in Sabah, Northern Borneo. Acra Phyrotax. Geobotr. 56(2): 137-142.

Hăkkinen, M. & Wang, H. (2007) New species and variety of Musa (Musaceae) from Yunnan,

China. Novon 17: 440-446.

Hăkkinen, M. & Wallace, R. (2007) Musa siamensis, a new Musa species (Musaceae) from

Southeast Asia. Folia Malaysiana 8(2): 61-70.

Hăkkinen, M., Suchânkovă, P., Dolezelovă, M., Hribovă, E. & Dolezel, ]. (2007) Karyological

observations in the new variety of Musa beccarii (Musaceae). Acta Phytotax. Geobor.

58(2/3): 61-67.

Hăkkinen, M. & Văre, H. (2008a) A taxonomic revision of Musa aurantiaca (Musaceae) in

Southeast Asia. J. Syst. Evol. 46: 89-92.

Hăkkinen, M. & Văre, H. (2008b) Taxonomic history and identity of Musa dasyearpa, M.

velutina and M. assamica (Musaceae) in Southeast Asia. J. Syst. Evol. 46: 230-235.

Hăkkinen, M. & Văre, H. (2008c) Typification and check-list of Musa L. names (Musaceae)

with nomenclatural notes. Adansonia ser 3, 30(1): 63—112.

Hăkkinen, M., Wang, H. & Ge, X.-]. (2008) Musa itinerans (Musaceae) and its intraspecific

taxa in China. Novon 18: 50-60.

26 Gard. Bull. Singapore 65(1) 2013

Li, L.-F., Hăkkinen, M., Yuan, Y.-M., Hao, G. & Ge, X.-J. (2010) Molecular phylogeny

and systematies of the banana family (Musaceae) inferred from multiple nuclear

and chloroplast DNA fragments, with special reference to the genus Musa. Molec.

Phylogenet. Evol. 57: 1-10.

Liu, A.-Z., Li, D.-Z. & Li, X.-W. (2002) Taxonomic notes on wild bananas (Musa) from China.

Bot. Bull. Acad. Sin. 43: 77-81.

Shepherd, K. (1999) Cytogenetics of the genus Musa. Montpellier, France:INIBAP.

Singh, H.P., Uma, S. & Sathiamoorthy, S. (2001) A Zentative Key for Identification and

Classification of Indian Bananas. Tiruchirapalli, India: National Research Centre for

Banana (ICAR).

Simmonds, N.W. (1956) Botanical results of the banana collecting expedition 1954-5. Kew

Bull. 11(3): 463-489.

Simmonds, N.W. (1962) The Evolution of Bananas. London: Longman.

Simmonds, N.W. (1966) Bananas. 2nd ed. London: Longman.

Swangpol, S. & Somana, J]. (2011) Musa serpentina (Musaceae): A new banana species from

Western border of Thailand. 7hai Forest Bull., Bor. 39: 31-36.

Uma, S. (2006) Farmers Knowledge of wild Musa of India. Rome: FAO.

Uma, S$., Sathiamoorthy, S. & Durai, P. (2005) Banana: Indian Genetic Resources and

Catalogue. Tiruchirapalli, India: National Research Centre for Banana (ICAR).

Valmayor, R.V. (2001) Classification and characterization of Musa exotica, M. alinsanaya and

M. acuminata ssp. errans. Philipp. Agric. Scientist 84(3): 325-331.

Valmayor, R.V. (2002) Classification and characterization of Musella splendida sp. nov.

Philipp. Agric. Scientist 85(2): 204-209.

Văre, H. & Hăkkinen, M. (2009) Proposal to conserve the name Musa balbisiana Colla against

M. rosacea Jacq. (Musaceae). Taxon 58(3): 1010.

Gardens” Bulletin Singapore 65(1): 27-37. 2013 27

Two new species and a new record

for Colocasia (Araceae: Colocasieae)

from Arunachal Pradesh. Northeast India

R. Gogoi! and S. Borah”

Botanical Survey of India, Arunachal Pradesh Regional Centre,

Senki View, ltanagar, 791111, Arunachal Pradesh, India

'rajibdzuko(a gmail.com (corresponding author)

“souravjyotiborah(a gmail.com

ABSTRACT. Two new species of Colocasia (Araceae: Colocasieae), C. boyceana R.Gogoi &

S.Borah and C. dibangensis R.Gogoi & S.Borah are described and illustrated from Arunachal

Pradesh, NE India. Colocasia lihengiae C.L.Long & K.M.Liu is reported as a new record for

the Flora of India. All three species are illustrated from living plants. A key to the Col/ocasia of

India is provided.

Keywords. Aroid, Arunachal Pradesh, Col/ocasia boyceana, Colocasia dibangensis, India

Introduction

The genus Col/ocasia Schott, includes about 20 species mainly confined to tropical

and subtropical Asia (Li & Boyce 2010). One cultivated species C. esculenta (L.)

Schott (taro) had tremendous economic significance since time immemorial, but

taxonomically the genus is still poorly known. As a part of tropical and subtropical

Asia, India is home to multiple wild species of Col/ocasia, but the full number of such

species is not known, due to inadequate survey and study.

While working for the “Flora of Anjaw District” under the annual action plan

of the Botanical Survey of India, the authors discovered and collected three Co/ocasia

species in Lohit Valley and Lower Dibang Valley district of Arunachal Pradesh. After

critical study, including of the relevant literature (Schott 1854; Hooker 1893, 1900;

Karthikeyan et al. 1989; Mayo et al. 1997; Li & Wei 1993; Li & Long 1998, 1999,

2000; Cao & Long 2003; Long & Liu 2001; Yin et al. 2004; Cai et al. 2006; Li & Boyce

2010), two of the species were found to be new. These are described and named here

as Colocasia boyceana R.Gogoi & S.Borah and Colocasia dibangensis R.Gogoi &

S.Borah. The third species has been determined as C. lihengiae C.L.Long & K.M.Liu

and is presented here as a new addition for the Flora of India.

Colocasia boyceana R.Gogoi & S.Borah, sp. nov.

Colocasia boyceana is readily distinguished from C. fontanesii Schott (a dark purple

species commonly grown as ornamental) by the dense hairy male flower zone, although

28 Gard. Bull. Singapore 65(1) 2013

both lack an appendix. Overall, C. boyceana difters from C. fontanesii by the dwarf

habit and in forming massive colonies; the velvety leaf blades with venation impressed

adaxially; the (frequent) presence of a conspicuous purple spot at the junction of the

petiole and adaxial side of the blade; the purple blade margins; and a purple line from

the blade sinus to the dorsal junction of the petiole. Co/ocasia boyceana approaches

C. lihengiae C.L.Long & K.M.Liu but differs by the dense hairy male flower zone and

formation of massive colonies, by the pink cataphylls to the stolons, green petiole, up

to 9 pairs of leaf lateral veins, blade with purple lining along the leaf margin, purple

lining of pink cataphylls in stolons, and the presence of a conspicuous purple spot at

the junction of the petiole and adaxial side of blade.

TYPE: India, Arunachal Pradesh, Lohit district, just crossing Udayak Pass towards

Salangam, 1600 m, 27*55'59.33”N 96%21'18.48”E, 5 September 2012, Gogoi & Borah

21807 (holo CAL; iso ASSAM). (Fig. LA-C, 2)

Herb, medium sized, stoloniferous. Corm subeylindric, not massive, erect or slightly

horizontal, 11-17 cm long, 4-6 cm across, fusiform, much rooting, roots thick,

white; szolons horizontal, non branching, light pink, with pink cataphylls, internodes

cylindric. Leaves 3-6, petiole glabrous, green, 47-82 long, 0.8-lcm wide, dull green

towards base, sheath to less than '£ length, bract to 32 cm long; blade ovate-cordate to

sagittate-cordate, peltate, 27-40 cm long, 14-21 cm wide, velvety, glossy, dark green

adaxially, pale green abaxially, with a purple spot at the ventral junction of petiole,

apex acuminate or caudate; lateral veins 5-9 pairs, raised abaxially and impressed

adaxially, margins with purple colouration, purple lining from sinus to junction of the

petiole dorsally. Inflorescence 1, peduncle green, cylindric, shorter than petiole, 34-

43.5 long, 0.6-0.8 cm across, spathe constricted between tube and limb; tube green,

oblong, 3.2-5.5 long, 1.8-2cm wide, subeylindric; limb erect, yellow on both surfaces,

lanceolate, 13-16.5 cm long, apex acuminate. Spadix shorter than spathe, to 7 cm long;

female zone whitish green, cylindric, c. 2 x 0.8 cm, with inter-pistillar staminodes;

ovary ovate or obovoid, c. 2 mm long, 1.5 mm wide, green, stigma inconspicuously

3-lobed, sessile, disciform, translucent white, staminodes yellow, ovate, erect, c. 2 mm

long and 1.5 mm wide; sterile zone yellowish white, 2.5 x 0.5 cm, eylindric; male zone

c. 2.5 x 0.8 cm, synandria c. 6-androus, polygonal, creamy, with white hairs; appendix

absent. Infructescence green, elliptic, 5.5-6 cm long, 2.3—2.6 cm across; berries green

when young, many seeded, obovate, 6 x 5 mm, seeds many.

Distribution and habitat. Colocasia boyceana grows in massive colonies in moist

shady places along streams. It is so far endemic to the Lohit and Lower Dibang valley

district of Arunachal Pradesh, at 1200-1600 m, recorded only by the type. The habitat

1s shared with Sfeudnera colocasiifolia C.Koch. another colocasioid.

Phenology. Flowering and fruiting July-September.

Etwymology. The specific epithet is given in honour of Peter C. Boyce for his outstanding

contributions to the Araceae of South East Asia.

pi d > =

Colocasia from Northeast India 29

Fig. 1. A—C. Morphological features of Col/ocasia boyceana R.Gogoi & S.Borah. A. Habit

of the plant. B. Abaxial side of the leaf purple lining in the sinus. C. Corm of the plant. D-G.

Morphological features of Colocasia dibangensis R.Gogoi & S.Borah. D. Habit of the plant.

E. Abaxial side of the leaf showing pink veins. F & G. Corm of the plant. (Photos: R. Gogoi

& S. Borah)

(99)

(ao)

Gard. Bull. Singapore 65(1) 2013

|

Fig. 2. Habit and reproductive parts of Colocasia boyceana R.Gogoi & S.Borah. A. Habit

of the plant. B. Inflorescence showing spathe and spadix. C. A complete spadix. D. Portion

of the male zone showing synandria with white hairs. E. Portion of the female zone. F& G.

Intructescence with green berries. (Photos: R. Gogoi & S. Borah)

Colocasia from Northeast India 31

IUCN conservation status. Presently there is no perceived threat to this species.

Notes. Colocasia boyceana is distinct among species of Colocasia as it bears a hairy

male zone, which is the first record of such a character within the genus. This new

species is close to C. fontanesii and C. lihengiae but difters significantly as discussed

above. Co/ocasia fontanesii is treated here as legitimate in place of C. antiquorum (Li &

Boyce, 2010) as the issue is one of typification. When Schott described C. anriguorum

he intended the name to apply to a stoloniferous plant with glossy leaf blades, and a

spathe limb opening almost fully and then reflexing. Unfortunately, in selecting a type

he chose a sterile and incomplete Linnaeus collection that is without doubt referable to

C. esculenta (hydrophobic leaf blade epidermis). Thus C. antiguorum is a synonym of

C. esculenta. Given this, the next available name for the glossy-leaf plant is Schott's

C. fontanesii.

Colocasia dibangensis R.Gogoi & S.Borah, sp. nov.

Colocasia dibangensis ditters from C. yunnanensis C.L.Long & X.Z.Cai (another

Himalayan species found at similar elevations) by its reduced female zone, the lack

of a constriction at the interstice, and characters of the male zone, synandria (and

connective), and the synandrodes of the interstice. It is also distinctive by its purple or

pink young leaves, pink veins on the abaxial blade surface, and reddish-pinkish spathe.

Overall, C. dibangensis difters from C. yunnanensis by the absence of colour patches

between the veins of the adaxial blade surface, the presence of purplish or pinkish

colouration of the young leaf blades and petioles, pinkish veins on the abaxial surface

of the blade, and the markedly more shallow sinus.

TYPE: India, Arunachal Pradesh, Lower Dibang valley distict, 5 km ahead of 65 point

from Mayodia towards Hunli, 28*17'40.84”N, 95*55'11”E, 2129 m, 19 Sep 2012

Gogoi & Borah 21877 (holo CAL, iso ASSAM, ARUN). (Fig. 1ID-G, 3)

Herb, medium sized, tubercled. Corm erect, subglobose, 9-11 cm long, 6-8 cm across;

densely rooted, roots thick, white with reddish coloration. Leaves 2-4, young leaves

pinkish or reddish, old ones green adaxially; petiole pale green with pinkish or reddish

colouration, cylindric, 65-80 cm long, 4-5 cm diam., sheathing is up to ' length

of petiole; leaf blade cordate-peltate, orbicular-cordate, 42-75 cm long, 40-75 cm

wide, membranous, apex slightly apiculate, lateral veins 7-8 pairs, raised abaxially,

pink. Inflorescence 1-3 together; peduncle light pinkish, cylindric, to 17 cm, slender.

Spathe constricted between tube and limb; tube reddish pink, to 5 cm long, 2.5 cm

wide, oblong; limb reddish black externally, light yellow internally, subeylindric, to 13

cm long, to 2.5 cm wide, oblanceolate, margins entire, erect or slightly curved apically,

apex acuminate, never relaxed on anthesis. Spadix sessile, to 17 cm long, shorter than

spathe; female zone reduced, green and yellow, cylindric, to 2.3-2.5 x 1.4 cm, green

fertile flowers mixed with light yellow staminodes, synandrodes broadly oblong to

depressed ovate or depressed obpyramidal, apex subtruncate; ovary green, subglobose

or ovoid, 1.5-2 mm diam., l-loculed, parietal, placentae 3, ovules many; stigma sessile

95)

9)

Gard. Bull. Singapore 65(1) 2013

Fig. 3. Reproductive parts of Colocasia dibangensis R.Gogoi & S.Borah. A & B. Reddish-

purple coloured spathe and spadix of the plant. C. Reduced female zone. D. Portion of sterile

zone. E. Portion of male zone showing synandria. F. Appendix of the spadix. G. Infructescence

with green berries. (Photos: R. Gogoi & S. Borah)

Colocasia from Northeast India 33

or subsessile, translucent white, globose, 0.5 mm wide; sterile zone starts continually

from female zone up to male zone, no constriction or slightly constricted between the

zones, 22.5 cm long, to 1.3 cm wide, cylindric, synandrodes yellowish white, 2-3 mm

long, 2-5 mm wide; male zone pinkish, synandria yellow with pink tinge, polygonal,

6-10-androus; appendix pink, conic, 2.5 x 0.5 cm, apex acute. Infructescence green,

c. 7 cm long, 5 cm across, berry green when young, obovoid, 4-6 mm, seeds many.

Distribution and habitat. Colocasia dibangensis grows in large colonies or isolated

small populations in cool open places on hill slopes or along roadsides. It is so far

endemic to the lower Dibang valley district of Arunachal Pradesh; elevation 1800-—

2200 m, recorded only by the type.

Phenology. Flowering and fruiting July-September.

Etymology. The species is named after its type locality.

IUCN conservation status. Not evaluated, but while collecting we found no obvious

threat to this species.

Notes. Colocasia dibangensis is a species growing at high elevation and with pink or

purple coloured veins abaxially. The pink-coloured spathe and pink male and highly

reduced female zone (1/12th of the spadix) distinguish it from all other species of the

genus. This species is with the group bearing a conspicuous appendix in the spadix,

but its comparatively reduced conic appendix separates it from other species like C.

esculenta, C. fallax and C. affinis which are commonly found in NE India.

Colocasia lihengiae C.L.Long & K.M.Liu in Bot. Bull. Acad. Sin. 42: 313-317. (Fig. 4)

Herb, medium sized, stoloniferous. Corm subglobose, not massive, erect, 3 cm in

diam. Leaves 3-5, petiole glabrous, 60-100 cm long, green with purple reticulation,

blade peltate, saggitate-cordate, abaxially light green, adaxially dark green, leathery,

shining, 25-35 cm long, 14-21 cm wide, lateral veins 4-5 pairs, green. Inflorescences

up to 5, peduncle green with purple reticulation, cylindric, shorter than petiole, 40-45

cm long, 0.7—0.8 cm across, spathe constricted between tube and limb; tube green,

elliptic, subeylindric, 5.5-6.5 cm long, 1.6-2 cm wide; limb erect, golden yellow both

dorsally and ventrally, ovate, 14-16 cm long, apex acuminate. Spadix sessile, shorter

than spathe, to 8.5 cm long; female zone green, cylindric, 2.5-2.8 cm x 1-1.3 cm, 1/3

of the spadix, with inter-pistillar staminodes, yellow; ovary oblong, 2—2.5 x 2 mm,

green, 1-loculed, placentae 2, stigma sessile, 3-lobed, disciform, white, staminodes

yellow; sterile zone yellow, 2.5-3 cm x 0.8-1 cm, cylindric; male zone yellow, 3.8-4

cm x 0.7-0.8 cm, synandria 3-10-androus, polygonal, creamy, without hairs; appendix

absent. Infructescence green, eliptic, 5-7 cm long, 2-2.5 cm across; berries green

when young, ovate, c. 3-4 mm diam., seeds many.

34 Gard. Bull. Singapore 65(1) 2013

Fig. 4. Habit and reproductive parts of Colocasia lihengiae C.L.Long & K.M.Liu. A. Habit of

the plant. B. Corm. C. Inflorescence. D. View of a complete spadix. E. Portion of the female

zone showing ovaries and interpistillar staminodes. F. Portion of the male zone showing

synandria and possible pollinator. G. Infructescence with green berries. (Photos: R. Gogoi &

S. Borah)

Colocasia from Northeast India 35

Distribution. India (Assam: Dihing Patkai Reserve; Arunachal Pradesh: road to

Parasuram Kunda from Chowkham in Lohit district); China (Yunnan, Mengla,

Mengxing River watershed).

Habitat. Colocasia lihengiae grows in little colonies in moist forest floors of tropical

evergreen forests at about 200-400 m. A quite good population was encountered in

Dihing Patkai Reserve torest of Assam and on the way to Parasuram Kunda from

Chowkham in Lohit district of Arunachal Pradesh. The apical shoots and petioles are

sold in market as vegetable.

Phenology. Flowering and fruiting July-September.

Specimen examined. INDIA. Arunachal Pradesh. Between Wakro and Parasuram Kund, 250

m, 5 Sept. 2012, Gogoi & Borah 21814 (ARUN).

Notes. Colocasia lihengiae was described from Yunnan province of China (Long &

Liu 2001). In the F/ora of China account (Li & Boyce 2010), it was treated as a

synonym of C. antiquorum. As mentioned above C. antiquorum is a synonym of C.

esculenta and C. lihengiae is a distinct species from C. esculenta by the absence of an

appendix, and here it is treated as a valid species.

A key to the species of Colocasia is presented for NE India that includes and

distinguishes C. boyceana, C. dibangensis and C. lihengiae, as follows.

Key to Colocasia species in NE India

(i ppeilelix present and morethan 2 cm long e oare caeieaiie e oieige oaie saeeiaie ese 2

b. Appendix absentor highly reduced, less than 1 cm long... 5

2a. Young leaves pinkish, blade 42-75 x 40-7Scm; spathe pink, tube reddish

purple; spadix deep pink, appendix triangular conic ................. C. dibangensis

b. Young leaves whitish green or pale green, blade less than 10-45 x 10-3Scm;

spathe yellow or greenish white, or slightly purplish apically ( C. fa/lax), tube

green; spadix yellow or pale yellowish green, appendix narrowly conic to

e cai ai e sat 3019 ALO al OPRIRE RRC DR RE RI 0 0 RI PR RR PRIN RD 3

3a. Plant tuberous or rhizomatous, up to 100 cm tall; spathe dull yellow, spreading

and open flat, not revolute; infructescence erect ....................... C. esculenta

b. Plant stoloniferous, less than 75 cm tall; spathe bright yellow, not spreading,

IESE SL iile scene pendenE m se aaa i arat o maina E uta alma aaa a aa ata a 4

4a. Leaves with dark patches between primary lateral veins; female and male zones

e UNDA CO RIS RA N E e DO e pe A e Aaaa a ca e to Bla ua ante dlsiat C. affinis

b. Leavesusually concolourous green; female and male zone separated by a zone of

Ss praizi aia 7 0[0 ES a e eg date, setea BM iata dl era Boa. IND, arii e SR C. fallax

36 Gard. Bull. Singapore 65(1) 2013

Sa. Plantrobust, up to 225 cm tall; petiole and peduncle deep purple red; spathe c.

25 x llem; appendix reduced, less than lcm long ....................... C. fontanesii

b. Plantsmall, less than 130cm tall; petiole green or light purple reticulate; spathe

less fhan 17 7em; appendix absenti. nn 6

Ga. Leaf margin with purple lining; purple spot at ventral junction of petiole;

venation impressed; synandria with white hairs ..............cneeeee C. boyceana

b. Nopurple lining and spot on leaf; venation raised; synandria without hairs ...... (|

Ta. Basal lobes of leaf obtuse; petiole green; spathe tube c. 2.5 cm; synandria

stellately-erenate; sterile zone e 352 One e C. manii

b. Basallobesofleafusually acute; petiole hght purple reticulate; spathe tube c. 5.5

cm; synandria polygonal; sterile zone c. 3 cm long ...................... C. lihengiae

Coneclusion

The present report establishes the existence of wild species of Co/ocasia that are shared

between the western and eastern regions of Himalaya, in India and China. At the same

time, it expands our understanding ofa possibly unique assemblage of diverse Col/ocasia

species growing wild in NE India, composed of C. esculenra, C. boyceana, C. affinis, C.

dibangensis, C. fallax, C. fontanesii, C. manii and C. lihengiae. In S China, the overall

assemblage of Colocasia species also appears to be unique with C. affinis, C. bicolor,

C. esculenta, C. fallax, C. fontanesii, C. gaoligongensis, C. gigantea, C. gongii, C.

heterochroma, C. menglaensis, C. tibetensis and C. yunnanensis. The existence of

diverse assemblages of Colocasia species in different regions of Himalaya indicates

that the genus has a long and complex history in the Himalayan region. The recent

discoveries of two new Colocasia species raises a posibility of the further existence of

undescribed species in the wild, and at the same time the existence of more Chinese

species in the region of Indian Himalaya.

ACKNOWLEDGEMENTS. The authors are grateful to Dr. P. Singh, Director, Botanical

Survey of India and Dr. A.A. Mao, Scientist-E & HOO, BSI, APRC for support and logistics.

The first author is highly thankful to Peter C. Boyce, Sarawak, Malaysia for confirming the

novelty of the species here described as C. boyceana, and to Peter Matthews, Museum of

Ethnology, Japan for confirming the new status of the taxon here called C. dibangensis and

for determining C. lihengiae. Thanks are also to Dr. K.N. Gandhi, HUH, Harvard, U.S.A. for

helpful suggestions during preparation of the manuscript.

References

Cai, X.-Z., Long, C.-L. & Liu, K.-M. (2006) Colocasia yunnanensis (Araceae), a new species

from Yunnan, China. Ann. Bot. Fenn. 43: 139-142.

Colocasia from Northeast India 37

Cao, L.-M. & Long, C.-L. (2003) Colocasia bicolor (Araceae), a new species from Yunnan,

China. Ann. Bot. Fenn. 40: 283-286.

Hooker, J.D. (1893) Araceae. In: Flora of British India 6: 490-558. London: L. Reeve & Co.

Hooker, J.D. (1900) Col/ocasia antiquorum var. fontanesii. Curtis s Bot. Mag. 126 (ser.3.v.56):

(i, 7/]/32

Karthikeyan, S$.. Jain, S.K., Nayar, M.P. & Sanjappa, M. (1989) Monocotyledonae. In: F/orae

Indicae Enumeratio. P. 10. Calcutta: Botanical Survey of India.

Li, H. & Boyce, P.C. (2010) Colocasia. In: Flora of China 23. Pp. 73-75. Beijing: Science

Press: St. Louis: Missouri Botanical Garden Press.

Li, H. & Long, C.L. (1998) A preliminary revision of Araceae in China. Acra Bot. Yunnan.

Supp. 10: 12-23.

Li, H. & Long, C.L. (1999) A new species of Co/ocasia (Araceae) from Mts. Gaoligong, China.

Feddes Repert. 110: 423-424.

Li, H. & Long, C.L. (2000) Colocasia gongii (Araceae), a new species from Yunnan, China.

Feddes Repert. 111: 559-560.

Li, H. & Wei, Z.X. (1993) Colocasia heterochroma, a new species of Colocasia from Araceae.

Acta Bot. Yunnan. 15: 16-17.

Long, C.L. & Liu, K.M. (2001) Colocasia lihengiae (Araceae; Colocasieae), a new species

from Yunnan, China. Bor. Bull. Acad. Sin. 42: 313-317.

Mayo, $.J., Bogner, J]. & Boyce, P.C. (1997) The Genera of Araceae. U.K.: Royal Botanic

Gardens, Kew.

Schott, V. (1854) Pflanzenskizzen. In: Oesterreichischesbotanisches Wochenblatt 4(51): 409-—

410.

Yin. J.-T., Li, H. & Xu, Z.-F. (2004) Colocasia menglaensis (Araceae), a new species from

southern Yunnan, China. Ann. Bot. Fenn. 41: 223-226.

Ti în

A

Gardens” Bulletin Singapore 65(1): 39-46. 2013 39

Zingiber kangleipakense (Zingiberaceae):

A new species from Manipur, India

Rajkumar Kishor! and Jana Leong-Skornitkovâ?

'Medicinal Plants and Horticultural Resources Division,

Institute of Bioresources and Sustainable Development,

Takyelpat Institutional Area, Imphal-795001. Manipur, India

“The Herbarium, Singapore Botanic Gardens.

1 Cluny Road, 259569 Singapore

jana_skornickova(4seznam.cz

ABSTRACT. Zingiber kangleipakense Kishor & Skornick. (Zingiberaceae) from Manipur,

India is newly described and illustrated. A comparison with the most closely related species, Z.

longiligulatum and Z. roseum is provided.

Keywords. Gingers, NE India. taxonomy, Zingiber longiligulatum, Zingiber roseum,

Zingibereae

Introduction

The genus Zingiber Mill. (Zingiberaceae, Zingibereae) is distributed in tropical

to warm-temperate Asia with the highest diversity in the monsoonal parts of Asia.

particulariy in Thailand with 56 species (Triboun 2006) and China with 43 species (Wu

& Larsen 2000). The exact number of species in the genus is not known. More than

250 names in Zingiber have been published, but this probably corresponds to about

100 to 150 species (Theilade 1999; Wu & Larsen 2000). Key characteristic features of

the genus Zingiber include i) lateral staminodes fused to the labellum, ii) labellum not

connate to the filament, iii) elongated, horn-like anther crest, wrapped around the style

and 1v) presence of a pulvinus at the base of the petiole, which distinguishes Zingiber

from other ginger genera in the field even when sterile.

Roxburgh reported 11 species of Zingiber in India (1810, 1820). Later, Baker

(1892) described 24 species from British India. Of these, only 16 fall within Indias

current boundaries. In the checklist of Indian monocots, Karthikeyan et al. (1989)

listed 18 species, eight of which were reported by Sabu (2003, 2006) from South India.

There is no recent work on the genus Zingiber from N or NE India.

Inspite of some 60 new Zingiber taxa described in past twenty years from China

(e.g. Tong 1987; Tong & Xia 1987, Tong & Liu 1991, Fang & Qin 1996). Vietnam

(Theilade & Mood 2000), Thailand (e.g. Theilade 1999; Mood & Theilade 2002),

Peninsular Malaysia (Theilade 1998; Lim 2001a.b, 2002, 2003), Borneo (Theilade

& Mood 1997, 1999) and Philippines (Mood & Theilade 2001), no new Zingiber has

been reported from India or Bangladesh recently.

40 Gard. Bull. Singapore 65(1) 2013

While exploring in NE India, the first author found a Zingiber species growing

quite abundantly in moist and shady areas of the Imphal valley in July 2000. It could not

be matched to any Indian, Chinese, Thai or Indochinese species, nor to the protologues

of the vast majority of other Zingiber species. Type specimens of the most closely

related species have been examined at BK, BKF, CAL, HTBC, KUN, MH & P. The

new Zingiber is thus described below.

The measurements and descriptions provided are based on living material. The

plant parts were photographed using a digital camera, while dissected materials were

directly scanned using a flatbed scanner (Model: 2300c, Hewlett Packard), micro

details were photographed using a stereo-zoom microscope (Model: SZ-II, Olympus,

USA).

Zingiber kangleipakense Kishor & Skorni&k., sp. nov.

Zingiberi roseo similis, robustiore (ad 1.7 m longo contra 0.9 m), bracteis viridibus

(contra rubellis), corollae lobis luteis (contra clare rubris), antherae crista lutea

(contra aurantiaca) differt.

TYPUS: Kishor 9, India, Manipur, Imphal, Sagolband, c. 24*48'N 93*55'E, 780 m asl,

20 July 2000 (holo CAL; iso SING; iso Herbarium of Institute of Bioresources and

Sustainable Development, Imphal). (Fig. 1 & 2)

Terrestrial rhizomatous herb, rhizome branched, mature branches up to 2.0 cm in

diam., externally lhght brown, internally white when young, white to pale cream when

old, with mild turmeric aroma. Leafy shoot 150-170 cm tall, erect, fleshy. Leaf sheaths

green or with reddish tinge, glabrous or finely pubescent, with thin membranous

margins; ligule 2—3.2 x 1.3-1.5 cm, slightly, unequally bilobed at apex when young,

more or less entire later, glabrous, hyaline and fragile. Leaves 8-15 per pseudostem,

sessile or shortly petiolate; petiole 0-5 mm long; lamina 35-42 x 7-8 cm, oblong-

lanceolate, adaxially dark green, smooth, pubescent along side of midrib, abaxially

oft-green, pubescent, base cuneate, apex acuminate. Inflorescence generally arising

from the rhizome on a separate short peduncle 0.5-1 cm, sometimes breaking through

the leaf-sheaths up to 25 cm above the ground. Spike 5-8 x 3-4 cm, narrowly ovoid,

bearing 15-20 flowers. Braczs 2.8-6.5 x 1.8—3.5 cm, outer 3-4 bracts oblong, apex

rounded, green or tinged with purplish red, inner ones oblong-lanceolate, pale green,

apex reflexed, cuspidate, shortly hairy, margins hyaline. Bracteole 3.8-4.3 x 0.8

cm, lanceolate, shortly pubescent on the outside, margins thin, membranous, cream

coloured. Calyx c. 2.5 x 0.5 cm, tubular, white, membranous, tri-dentate with 1 cm

longitudinal unilateral incision, pubescent. Floral tube slender c. 5 cm long, pale

yellow to white towards the base, dorsal corolla lobe 2.5—3.0 x 0.4—0.6 cm, translucent

cream at the base, deep yellow with reddish tinge at apex, strongly recurved; lateral

corolla lobes c. 2.5 x 0.5 cm, coloured as the dorsal lobe, recurved, adhering basally

to the ventral surface of the labellum at 1.2 cm from the apex. Label/lum c. 3 x 1.5

cm, light yellow with wavy and crisped margins, side lobes absent or reduced to a 1

mm long, triangular vestige. Anther sessile, thecae 1.8 cm long; connective and crest

Fig. 1. Zingiber kang

IKEHS

A.

Rhizon

IC WIiu

h roots. B. Pseudostems. C. Ligules. D. Apex

and base of the leaf. E. Inflorescence. F. Bracts. G. Bracteole. H. Single flower (side view,

calyx removed). |.

h uri th = + (£

Ai nther with crest (f

Labellum

Toni VIew)

4 j

(Haitened)

L,.

O

Vary

seeds. 0. Seeds embedded in aril. Scale bars: A. C. E—K,

of the floral tube. N. Mature fruit with

l,

M-N (1 cm); B (50

cm). D (5 cm

in XS i! = = zi 1 attane Q

Dorsal and lateral corolla lobes (flattened). K.

J - 7 L ra Îs rs n d |

>pigvnous elands. M. Ovary with calyx and base

shor 9. (Photos: Rajkumar Kishor)

42 Gard. Bull. Singapore 65(1) 2013

yellow. Pollen 277 x 158 um, ovoid. Style 7.5 cm long, filiform, stigma projecting

from the anther crest, ostiole hairy. Epigynous glands two, 4 mm long, free from

each other, cream. Ovary c. 4 x 3-4 mm, trilocular with many ovules, placentation

axile, densely pubescent outside. Fruir a capsule, 4 x 2.5 cm, ovoid-elliptic, trigonous,

green with red tinge outside, bright red inside; seeds up to 6 mm long, black, obovoid,

completely covered in white aril.

Distribution, habitat and ecology. The species is known to occur in at least three

districts of Manipur, namely Imphal West, Imphal East and Sanapati. It grows at 750-—

1400 m above sea level in Imphal Valley usually in the undergrowth of groves and

bamboo brakes, prefering moist and shady areas. It may be found cultivated around

homesteads too. The prevailing climate in the valley is monsoon sub-tropical with an

annual rainfall of 1375 mm and a temperature range of 12—27*C.

Phenology. Flowering June-July, fruiting August-September.

Etwwmology. The specific epithet is assigned in honour of Kangleipak, an old name of

Manipur, which is the natural habitat of Z. kangleipakense. This area provides and

important contribution of plant and animal species to the Indo-Burmese biodiversity

hotspot.

Vernacular names and uses. In Manipur, it is locally known as “Namra”. Young

rhizome along with the pseudostem are sold on local vegetable markets in Imphal and

neighbouring villages and are used as a minor vegetable by cooking with fermented

fish, potato and other items in a preparation commonly known as “iromba”.

Notes. Zingiber kangleipakense is similar to Indian Z. roseum (Roxb.) Roscoe from India

(Roxburgh 1798, 1820). Both species have thick, fleshy, white to pale cream rhizomes,

shortly petiolate leaves of similar size and shape, inflorescences arising from the rhizome

on a short peduncle embedded in the ground and single-lobed yellow labellum. The

lamina of more robust Z. kangleipakense, is, however, pubescent abaxially on the sides

of the midrib, has green and broader bracts, yellow corolla lobes and a yellow anther

crest. Z. kangleipakense is similar also to Chinese Z. longiligulatum S.Q.Tong, but the

latter reaches only up to 1 m, has larger leaves, narrower bracts, patent dorsal corolla

lobe and orange anther crest. More detailed comparison of characters among Z. roseum,

Z. longiligulatum and Z. kangleipakense is presented in Table 1.

Triboun (2006) pointed out the difficulties in placing Z. junceum and Z. barbatum

at infrageneric level as these species produce inflorescence both basally and terminally

fitting into section Zingiber and Dymezewiczia respectively. For similar reasons, it is

difficult to place Z. kangleipakense unequivocally in a section. Although the shape of

the labellum and the inflorescence borne directly from the rhizome resemble numerous

species of section Cryptanthium), the inflorescence of Z. kangleipakense sometimes

protrudes through the pseudostem, a characteristic known from section P/ewranrhesis.

This species was previously misidentified as Amomum aromaticum by Singh et

al. (2003).

New Zingiber from Manipur, India 43

Fig. 2. Zingiber kangleipakense. A. Leafy shoot. B. Infructescence with mature, opened fruit.

C. Infructescence with closed, not fully matured fruit. D-E. Inflorescence breaking through the

leaf-sheaths of pseudostem. F. Infiorescence emerging from the rhizome at the ground level.

Based on Kishor 9. (Photos: Rajkumar Kishor)

44 Gard. Bull. Singapore 65(1) 2013

Table 1. Comparison of characters of Zingiber kangleipakense with Z. roseum and Z.

longiligulatum, the latter two as observed from original descriptions, original illustrations and

types.

Character Z. kangleipakense Z. longiligulatum Z. roseum

Rhizome white to pale cream not described white internally

internally

Leafy shoot 150-170 cm 80-—100 cm 60-90 cm

Ligule 2-—3.2 cm long, entire or 4-5 cm long, entire, not mentioned

bilobed, glabrous pubescent

Lamina 35-42 x 7-8 cm, midrib 43-49 x 10-11 cm, 30 x 8-10 cm,

sides pubescent abaxially pubescent abaxially both sides glabrous

Peduncle up to | cm when arising 2-6 cm not specified; short,

from the rhizome, rarely up to c. 5 cm based

protruding through the on drawing

pseudostem up to 25 cm

above ground.

Bracts 2.8_6.5X 1.8-3.5cem, 44.5 x 0.8-0.9 cm, reddish

outer 2-3 green with green, pubescent, apex

purplish red tinge, inner acuminate

green, apex cuspidate, cusp

hairy

Floral tube white to pale yellow, yellowish at apex, white to pale yellow

glabrous densely pubescent

Corolla yellow with reddish tinge yellowish, dorsal bright red, dorsal

lobes terminally, dorsal corolla corolla lobe patent corolla lobe strongly

lobe strongly reflexed reflexed

Labellum entire, single-lobed or with entire, single-lobed, entire, single-lobed,

rudimentary side lobes, yellowish, side lobes light yellow

unspotted, light yellow absent

Anther crest light yellow orange orange

ACKNOWLEDGEMENTS. The first author thanks the Director, IBSD, Imphal for extending

the laboratory facilities for the study. We thank the curators of BK, BKF, CAL, HTBC, KUN,

MH, P herbaria for letting us examine specimens in their care. The Zingiberaceae Resource

Centre at the Royal Botanic Garden Edinburgh (http://elmer.rbge.org.uk/zre/) and the Asian

Zingiberaceae Resource Centre at Singapore Botanic Gardens are acknowledged for providing

New Zingiber from Manipur, India 45

protologues, related references and images of numerous type specimens. We are grateful to Dr.

J.F. Veldkamp (L) for translating the diagnosis into Latin.

References

Baker, J.G. (1892) Zingiber. In: Hooker, J.D. (ed) Flora of British India 6: 243-249. London:

L. Reeve and Co.

Fang, D. & Qin, D. (1996) Five new species of monocotyledonae from Guangxi. Guihaia 16:

3-8.

Karthikeyan, S., Jain, S.K., Nayar, M.P. & Sanjappa, M. (1989) Zingiberaceae. In: Florae

Indicae Enumeratio - Monocotyledonae. Pp. 289-299. Calcutta: Botanical Survey of

India.

Lim, C.K. (2001a) The *Firebird”: A resplendent new Zingiber from Peninsular Thailand and

Malaysia. Folia Malaysiana 2: 35-42.

Lim, C.K. (2001b) The scented Zingiber wrayi Prain ex Ridley: A new variety. Folia Malaysiana

2: 43-53.

Lim, C.K. (2002) A new endemic species of Zingiber Boehm. from Johor, Malaysia. Folia

Malaysiana 3: 25-30.

Lim, C.K. (2003) Zingiber aurantiacum (Holtt.) Theilade, Z. petiolatum (Holtt.) Theilade and

two related new taxa from Peninsular Malaysia and Thailand. Folia Malaysiana 4: 65-—

76.

Mood, ]. & Theilade, 1. (2001) Two new species of Zingiber (Zingiberaceae) from the

Philippines. Nord. J. Bor. 21: 129-133.

Mood, ]. & Theilade, 1. (2002) New gingers from Southeast Asia. Vew Plantsman |: 14-22.

Roxburgh, W. (1798) Plants of the Coast of Coromandel. Vol. 2. London: W. Bulmer & Co.

Roxburgh, W. (1810) Description of several of the monandrous plants of India. Asiar. Res. Il:

318-362.

Roxburgh, W. (1820) Flora Indica. Serampore: Mission Press.

Sabu, M. (2003) Revision of the genus Zingiber in South India. Folia Malaysiana 4: 25-52.

Sabu, M. (2006) Zingiberaceae and Costaceae of South India. Kerala: Printarts Oftset.

Singh, H.B., Singh, R.S. & Sandhu, J.S. (2003) Herbal Medicine of Manipur: A Colour

Encyclopaedia. New Delhi, India: Daya Publishing House.

Theilade, 1. (1999) A synopsis of the genus Zingiber (Zingiberaceae) in Thailand. Nord. J. Bor.

19: 389-410.

Theilade, 1. (1998) Revision of the genus Zingiber in Peninsular Malaysia. Gard. Bull.

Singapore 48: 207-236.

Theilade, 1. & Mood, J]. (1997). Five new species of Zingiber (Zingiberaceae) from Borneo.

Nord. J. Bot. 17: 337-347.

Theilade, |. & Mood, J]. (1999) Five new species of Zingiber (Zingiberaceae) from Borneo.

Nord. J. Bot. 19: 513-524.

Theilade, 1. & Mood, J]. (2000) Validation of Zingiber collinsii (Zingiberaceae) from Vietnam.

Nord. J. Bot. 20: 32.

Tong, S.Q. (1987) New plants of Zingiber from Yunnan. Acta Phytotax. Sin. 25: 140-149.

Tong, S.Q. & Liu, X.Z. (1991) A new species of Zingiber from Yunnan. Acta Bor. Yunnan.

13:27-29.

Tong, S.Q. & Xia, Y.M. (1987) New taxa of Zingiberaceae from southern Yunnan. Acta

Phytotax. Sin. 25: 460-471.

46 Gard. Bull. Singapore 65(1) 2013

Triboun, P. (2006) Biogeography and Biodiversity of the Genus Zingiber in Thailand. PhD

thesis submitted to the Graduate school, Khon Kaen University, Thailand.

Wu, T.L. & Larsen, K. (2000) Zingiberaceae. In: Wu, Z.Y., P.H. Raven (eds) Flora of China 24:

333-346. Beijing: Science Press.

Gardens” Bulletin Singapore 65(1): 47-95. 2013 47

The history and identity of Boesenbergia longiflora

(Zingiberaceae) and descriptions of five related new taxa

John D. Mood!, Linda M. Prince?, J.F. Veldkamp*

and Santanu Dey*

"Lyon Arboretum, University of Hawaii, 3860 Manoa Road,

Honolulu, HI 96822, USA

zingiber(4/warmlava.com

“The Field Museum, Department of Botany,

1400 S Lake Shore Dr., Chicago, IL 60605, USA

National Herbarium of The Netherlands, Naturalis Biodiversity Center,

P.O. Box 9514. 2300 RA Leiden, The Netherlands

“Department of Botany, Nagaland University, Lumami 798627,

Zunheboto, Nagaland, India

ABSTRACT. The history of Boesenbergia longiflora (Wall.) Kuntze (Zingiberaceae) is

reviewed, iis identity is discussed and a lectotype designated. Five new, related taxa are

described and illustrated: B. collinsii Mood & L.M.Prince, B. hamiltonii Mood, S.Dey &

L.M.Prince. B. kerrii Mood, L.M.Prince & Triboun, B. kingii Mood & L.M.Prince, and B.

maxwellii Mood, L.M.Prince & Triboun. A phylogenetic analysis of plastid rnă intron

(including mark) and nuclear ITS DNA sequence data indicate these Boesenbergia species

form a clade within Boesenbergia. Results of the molecular data analyses in concert with

several diagnostic characters, support the recognition of the new taxa. Historical illustrations,

colour plates, a field key to the species, a comparative table, a listing of the botanical history of

B. longiflora, and a geographical distributional map are provided.

Keywords. Burma, Curcumorpha, Gastrochilus, India, Thailand

Introduction

Boesenbergia longiflora (Wall.) Kuntze was described in 1829 as Gastrochilus

longiflora by Nathaniel Wallich based on his collection from Rangoon, Burma [Wa/lich

65894 (K-W)]. Boesenbergia was proposed in 1891 when Otto Kuntze observed that

Gastrochilus Wall. is a homonym of Gastrochilus D.Don (1825; Orchidaceae). In

1974 it was regarded as belonging to the monotypic genus Curcumorpha A.S.Rao &

D.M.Verma. This change was countered by Larsen (1997) but is still in use by some

(Kress et al. 2002, Gao et al. 2004).

During a botanical survey in the Lampang Province, Thailand in 1998, numerous

plants which at first were identified as B. /ongiflora were observed growing on the

margins of secondary forest. These were easily recognised by their robust stature and

large, white flowers. Later, another Boesenbergia, reminiscent of B. longiflora, but with

yellow flowers, was encountered on a limestone outcrop [Mood & Pedersen 1455 (C)].

48 Gard. Bull. Singapore 65(1) 2013

Its specific identity remained unclear. Several years later, yet another Boesenbergia

with yellow flowers was collected by Mark Collins (1963-2011) from a limestone

area in Loei Province, Thailand. Living plants of this field collection (7-3068) were

later determined to be similar to the earlier Lampang collection. Identification of the

two collections began with a review of Wallich's description of G. /ongiflora which

was described as having small, yellow flowers with red markings on the labellum

(Fig. 1). This information was very surprising, as it was inconsistent with the current

perception of B. longiflora being a ginger with large, white flowers with pink markings

on the labellum (Wu & Larsen 2000; Kress et al. 2002; Gao et al. 2004, 2005; Larsen

& Larsen 2006). This significant discrepancy precipitated a complete review of the

history of B. /longiflora (Appendix A).

The historical findings indicated that the true B. /ongi/lora (Wall.) Kuntze was

very similar to the two aforementioned Thailand collections. The current perception of

a white-flowered ginger appears to have been fostered by a watercolour published by

Hooker in 1843 (Fig. 2). Based on a reference by Baker (1890), the plant Hooker used

for this illustration was sent to Kew from the Calcutta Botanical Gardens (Wallich

1840), which was identified with the unpublished name, G. jenkinsii. Although Baker

(1890) mentioned this error, he described white flowers, as did Schumann (1904).

Holttum (1950) also noted the discrepancy between the Hooker illustration and

Wallich's, but did not pursue the matter. Rao and Verma (1974) described their C.

longiflora as white-flowered, but in this case, it was based on 20 specimens from

Assam and Meghalaya, India, the area where Wallich found G. jenkinsii (Voigt 1845).

Although the historical information improved the taxonomic understanding of

B. longiflora, several taxa remained unconfirmed or unidentified: Wallich's G. jenhinsii

from Assam (Fig. 2); the large white-flowered Boesenbergia common to N. Thailand;

the specimens cited by Rao and Verma; and finally, the two yellow-flowered Thailand

collections. In order to properly identify these and other specimens, the present

research was initiated in 2008 using an integrated taxonomic/phylogenetic approach.

Materials and methods

Taxonomy. Historical references, both text and illustrations (Appendix A) were used to

provide an understanding of past taxonomic perceptions. Also, over 200 digital images

of B. aff. longiflora obtained from various sources were reviewed and categorised by

flower morphology and geographic location, providing early clues on diversity and

phytogeography. Herbarium specimens (75) labelled as B. /ongi/lora or C. longiflora

were examined and photographed at ASSAM, BK, BKF and CAL in 2009. Another

75 specimens were viewed via digital images from AAU, C, E, K, L, P, SING and

US. This exercise provided an important finding—the B. /ongiflora complex was

extremely difficult to sort out and distinguish one taxon from the other in the herbarium.

Vegetative characters often used to determine the identity of dried specimens in

other Zingiberaceae were not particularly useful here. Additionally, flowers did not

preserve well, changed colour upon pressing and became indistinguishable by shape.

Boesenbergia longiflora and related taxa 49

poa

Mia? coluonleie, PL:

eee droga, had,

A Lp

Ani /7 Ad. / Ma Li

Fig. 1. Gastrochilus longiflora (B. longiflora). Watercolour on paper by Vishnupersaud (1829)

from the Wallich Collection, Kew. Reproduced with permission of The Board of Trustees of

the Royal Botanic Gardens, Kew.

50 Gard. Bull. Singapore 65(1) 2013

To determine which taxon a B. aff longiflora specimen belonged, the location, habitat,

plant height, flower colour and underground morphology were important. Here, the

“Additional specimens examined” under each described species are determined based

on a combination of these parameters. The name B. /ongiflora (see “Taxonomy”

below) is lectotypified.

During 2008-2012, c. 25 live rhizome divisions of B. aff. longiflora were

obtained from a variety of sources: botanical gardens, research institutions and various

personal collections. Each accession was grown by the first author in Hawaii, USA

under controlled, shade-house conditions. Details on the morphology and phenology

were recorded over several growing seasons. DNA samples with a corresponding

herbarium specimen were taken from each accession.

In 2009-2012 field observations were made in Thailand with botanists from

BK, the Thailand Institute of Scientific and Technological Research and Kasesart

University. Similarly in India, observations were conducted with personnel from the

Botanical Survey India (Shillong), the Assam Forestry Department and the Nagaland

University. Digital images of all Boesenbergia observed in the field and in cultivation

were recorded for later reference.

Early in the research, all Boesenbergia species known to have radical

inflorescences were evaluated for possible inclusion in the B. /ongi/lora complex. Based

on molecular data (Mood et al., unpublished) B. basispicata K.Larsen ex Sirirugsa,

B. tenuispicata K.Larsen and B. trangensis K.Larsen belong to other Boesenbergia

clades. DNA samples were not available for B. angustifolia (Haller f.) Schltr., B.

phyllostachya (Gagnep.) K.Larsen and B. siphonantha (King ex Baker) M.Sabu,

Prasanthk. & Skorni€k. Consequently, their phylogenetic position is undetermined at

this time.

The final taxonomy presented here represents an incorporation of data from the

phylogenetic analyses, field observations and detailed study of the cultivated plants.

The descriptions are ordered with the yellow-flowered species first, followed by the

white-flowered species. The distribution map (Fig. 20) was constructed by mapping

types and selected specimens of each species (these are marked by an asterisk following

the herbarium abbreviations in the list of additional specimens examined).

Molecular phylogeny. Phylogenetic analyses were conducted to complement and

assist in taxonomic decisions required to elucidate relationships among species of

the B. longiflora clade as defined here. Taxon selection was based on an unpublished

broader analysis of plastid înăK data for Boesenbergia relative to other genera of

Zingiberaceae (authors in prep.). The bulk of the data for non-Boesenbergia samples

are from the earlier family-wide analyses of Kress et al. (2002) with a few additional

sequences from recently described genera such as from Kress et al. (2010) and Leong-

Skornickovă et al. (2011). The data for the specimens cited in these references can

be tound at http://www.ncbi.nlm.nih.gov/genbank/ (GenBank 2011). A representative

shortest maximum parsimony (MP) phylogram is shown in Fig. 3. Only names of

relevant Boesenbergia samples are indicated on the phylogram.

Boesenbergia longiflora and related taxa 5)

ş e î m 7 1044

Pi d d dy is aaeomol Essec Apr L15'£

Pitch dA” Pub du $ Curtis ua A

Fig. 2. Hand-coloured lithograph published in Curtis's Botanical Magazine 69, t. 4010, 1843

as Gastrochilus longiflora. Reproduced with permission of The Board of Trustees of ihe Royal

Botanic Gardens, Kew. (Identified by Baker (1890) as G. jenkinsii. Described here as B.

hamiltonii.)

52 Gard. Bull. Singapore 65(1) 2013

DNA was extracted from silica-dried leaf material or leaf tissue from herbarium

specimens using standard methods as described in Kress et al. (2002). Thirty-seven

samples of Boesenbergia were used in the DNA sequencing analyses. Two samples

of B. pulcherrima (Wall.) Kuntze, the generic type, were designated as outgroup taxa.

Two other samples, B. plicata var. lurida (Radl.) Holttum and B. plicata var. plicata

(Ridl.) Holttum were also included. The remaining samples were all members of the

B. longiflora clade. All samples were designated by a collection or accession number

and vouchered (Appendix B).

Both nuclear and plastid data were collected. The nuclear ribosomal ITS (nrlTS)

region was amplified using the 18S-F and 26S-R primers (Prince 2010) and Phusion

high fidelity polymerase (New England BioLabs, Ipswich, Massachusetts, USA)

with 5X GC Buffer per the manufacturer's instructions at an annealing temperature

of 62*C. The same primers were used for subsequent sequencing. The plastid pnK

region was amplified and sequenced using conditions described in Kress et al. (2002)

or Prince & Kress (2006). Two newly designed primers were synthesized to assist with

sequencing of some difficult samples (SFb: CTCTATGGATTTTICAAGGAT and SRb:

AGACCAAAATGAAAATAATA). All samples were direct sequenced on a 3130x1

Genetic Analyser at Rancho Santa Ana Botanic Garden (Claremont, California, USA).

Noisy sequences (electrophoregrams showing more than a few polymorphic

sites) in the nrITS data were cloned using TOPO TA cloning kits (Invitrogen, now Life

Technologies, Grand Island, New York, USA) with four to eight clones sequenced per

sample. A small number of the 7rnK sequences were also noisy (due to polymerase

“stutter” caused by a mononucleotide T repeat around 450bp). Those samples were

re-amplified using Phusion polymerase, which has been shown to outperform other

polymerases for this particular problem (Fazekas et al. 2010) and re-sequenced.

Individual sequences of each specimen were edited and a consensus sequence

was generated in Sequencher v4.9 (Gene Codes Corporation, Ann Arbor, Michigan,

USA). The consensus sequence was trimmed (18S and 26S data pruned from the

ITS1+5.8S+1TS2 region, removal of amplification primer sequences from the 7rnă

region) exported and aligned manually in Se-Al v2.0a11 (1996; available from A.

Rambaut, Oxford, England, UK at http;//tree.bio.ed.ac.uk/software/seal). Alignment

was relatively straightforward due to the high degree of sequence similarity and length

for the taxa involved. Ambiguous regions were generally restricted to the monomeric

“T” repeat in the 5” irnĂ—matk intergenic spacer (IGS). All newly generated data have

been deposited in GenBank and are available under accession numbers JX992748-—

JX992840 (Appendix B).

Data were analyzed under parsimony and likelihood criteria by genomic data

partition, first independently, and later in combination. The decision to combine data

partitions is often based upon the results of an incongruence-length difference, or ILD

test (Farris et al. 1995). We did not perform this test as it has been suggested to be

too conservative (Cunningham 1997, Struck 2007). We expected the test to fail due

to the presence of two very different ITS copies detected for at least one sample in

the ITS data partition. The decision to combine data partitions was instead based on a

combination of tree topology congruence and branch support values. In most instances

Boesenbergia longiflora and related taxa 53

Boesenbergia clade

Boesenbergia longiflora

clade

|

Boesenbergia plicata

Craniffia. Kedhalia. Newmania

Cornukaempferia

Font Kaempferia

Cati Zingiber

——— hlamys

Pit meu

Curcuma,

Hitchenia,

Smithatris,

Stahlianthus

EI jLarsenianthus

'ommereschea

Globba. Mantisia, and

Caulokaempferia

Hemiorchis

| Renealmia

ii Aframomum

Amomum, Elettariopsis

and Paramomum

Gagnepainiă

=Uipinia pro parte

Alpinia pro parte

Etlingera,

Hornstedtia,

Plagiostachys,

Vanoverberghia

| Pleuranthodium, Reidelia, Burbidgea

iligugmom

iamanthus

amijia

— 5 changes

Fig. 3. One of many shortest maximum parsimony phylograms (simplified) for Boesenbergia

and other representatives of Zingiberaceae based on plastid 1rnK data analysis, rooted using

Siphonochilus ].M.Woods & Franks as suggested by Kress et al. (2002). The position of the

genus Boesenbergia, the B. longiflora clade and the taxa sampled for this study are indicated.

* indicate branches with MP Bootstrap values >50%.

S4 Gard. Bull. Singapore 65(1) 2013

tree topologies were consistent between data partitions. In cases where tree topology

diftered, branch support for the conflicting topology was reviewed. If branch support

was weak (<65% BS, <0.95 PP) the data for those taxa were analysed in combination.

As stated above, the ITS data for one taxon included two very different copies. In

another instance, there was strong positional conflict among the nuclear and plastid

phylogenies for one sample. Disparate copies were included in all individual data

set analyses, but only one copy was included in combined data analyses. The ITS

copy retained for combined analyses was selected to best match to the chloroplast

phylogeny.

Maximum parsimony and maximum likelihood (ML) analyses were conducted

in PAUP* (version 4.0b10, Swoftord 2002). Heuristic search methods were conducted

in each case with 1000 random addition replicates for MP and 10 random addition

replicates for ML, each with tree bisection and regrafting (TBR) branch swapping.

Maximum Parsimony analyses were conducted under Fitch parsimony criteria (Fitch

1971). Maximum likelihood analyses were conducted using model parameters selected

by jModelTest (version 0.1.1 available at http://darwin.uvigo.es; Posada 2008, Guindon

& Gascuel 2003) under both the Akaike Information Criterion (AIC; Akaike 1974) and

the Bayesian Information Criterion (BIC; Schwarz 1978). All Maximum Likelihood

trees were saved. Both AIC criterion and BIC criterion models were analysed for all

data partitions, but only the trees from the AIC analyses will be discussed as both

methods produced nearly identical trees.

Branch support was estimated using parsimony bootstrap (BS) in PAUP* and

posterior probabilities (PP) in MrBayes v3.2.1 (Ronguist & Huelsenbeck 2003).

MrBayes analyses were conducted through the CIPRES portal (Cyberinfrastructure

for Phylogenetic Research; Miller et al. 2010) and used partitioned data whenever

appropriate (partitions = 5'irnK IGS + 3'irnk IGS, mark, ITS) and were run in triplicate

to ensure convergence. Bootstrap values were based on 1,000 pseudoreplicates, each

with 100 random addition replicates, TBR branch swapping, saving a maximum of

10 trees per random addition replicate and hold=4 trees. The number of generations

necessary to estimate posterior probabilities varied depending upon the dataset and the

time required to reach stasis (average standard deviation of the splits frequency =0.01).

Results and discussion

A number of exploratory analyses were conducted to evaluate the consistency of the

phylogenetic hypotheses generated by the different data partitions. As stated above,

some of the data generated from the nuclear ribosomal partition were noisy, indicating

the presence of divergent ITS copies within a sample. Although it is not common,

multiple copies of ITS have been detected in a number of genera and species of

Zingiberaceae including Al/pinia (Liu et al. 2009), and Cornukaempferia (L. Prince

pers. obs.), and multiple ITS copies per individual is prevalent in Curcuma (Zâveskă

et al. 2012) and Kaempferia (L. Prince, pers. obs.). The presence of multiple, strikingly

ditterent copies can be explained by a number of different evolutionary histories, a

Boesenbergia longiflora and related taxa SE)

few of which are presented here. The ITS region is present in hundreds (or thousands)

of copies, often on multiple, different chromosomes. Processes affecting the utility

of ITS for phylogenetic reconstruction were reviewed by Alvarez & Wendel (2003)

including a discussion of the processes described below.

One explanation for the detection of multiple different copies in one organism

is that the multiple copies were present in the ancestor and those copies are being

maintained through time. Another explanation is recent genetic drift of some copies

due to relaxed evolutionary constraints. Given the importance of this region for the

functionality of the organism, it would not be likely unless there has been duplication

(perhaps due to polyploidisation). Chromosome counts have not been made for the

sample of B. longiflora (Kress 03-7305, US) included here, so perhaps this is a plausible

explanation. Yet another possibility is recent gene flow between closely related taxa.

If hybridisation happened in the recent past, there is a possibility that the two different

copies have not yet had the time to undergo concerted evolution. If this process is

incomplete, each parental copy will be recovered and, in a phylogenetic analysis, the

different copies would each cluster with one of the (putative) parents. Alternatively,

chimeric ITS sequences might be detected.

No matter the source of multiple, different copies ofITS present within any given

organism, there is ample indication that most organisms undergo concerted evolution

of the ITS region, a process by which the different copies are homogenised across the

genome resulting in a single (or at least dominant) copy per organism. The length of

time for complete homogenisation of the ITS of any given organism is unknown and

likely highly variable. Although there has been a great deal of speculation regarding

concerted evolution and homogenisation in purported hybrid taxa of flowering plants,

our best understanding of the actual time required is gleaned from experiments with

artificial hybrids (e.g., Armeria: Fuertes Aguilar et al. 1999, Feliner et al. 2001;

Hieracium: Mrăz et al. 2011) and in recently derived polyploidy taxa (e.g., Spartina:

Ainouche et al. 2004; Helictotrrichon: Winterfeld et al. 2009; Oryza: Ying et al. 2010).

Nuclear ribosomal ITS data

The aligned data matrix included 86 potentially parsimony-informative characters (43

for ingroup only). As indicated above, several samples required cloning to obtain clean

ITS sequences. Two other samples, indicated by an asterisk in Fig. 4, should be cloned

to clarify a few polymorphisms. Maximum parsimony analysis produced over 100,000

shortest trees and could not be run to completion. One of the 37 shortest ML trees is

shown in Fig. 4.

The ML phylogram presented in Fig. 4 identifies a moderately supported clade

that includes all samples of B. kerrii and B. collinsii plus one ot the B. longiflora

clones (88% BS; 1.00 PP). Both B. kerrii and B. co/linsii are resolved as monophyletic

with moderate to strong support. The other ingroup clade is moderately to strongly

supported (75% BS; 0.98 PP), and includes all samples of B. kingii, B. hamiltonii,

B. maxwellii and two clones of B. longiflora. Resolution within the clade is poor and

internal branches are generally poorly supported although most of the B. kingii samples

and clones cluster together with 70% BS and 1.00 PP.

56 Gard. Bull. Singapore 65(1) 2013

B. kingii MIIP47 Cl

B. kingii MI1P47 C2

B. kingii M11P47 C3

B. kingii MI1P47 C4

B. kingii M11P47 C5

B. kingii M3019 C10

B. kingii M3074 C2

B. kingit M3074 C3

B. kingii M3074 C8

B. kingii M3019 C3

B. kingit M2002 C2

B. kingii M3020 CI2

„ kingii M3074 C4

B. kingii M3074 C7

B. kingii MI1P78

B. kingii M3015 C3

B. kingii M3019 C6

B. kingii MO8P161

B. kingii M3015 C4

B. kingit M3015 C13

70/1.00 B. kingii M3020 C8

B. kingii M3015 Cl

B. kingii M3015 CI

B. kingii M3019 Cl

B. kingii M3019 C8

B. longiflora M11P48 C1

B. longi ora M11P48 C6

B. kingii Il (ez)

B. kingii k97-5821*

B. rd M11P47 C6

B. hamiltonii M301

B. hamiltonii M3026

B. hamiltonii M3212

B. maxwellii M11C132

S mon ep NI i M002 C3

„kingii M2

7510.98 B. kingiM3015 (Ge)

B. maxwellii M2032

B. maxwellii M2040

B. maxwellii MP 1450

B. maxwellii M11P26

100/1.00 B. maxwellii M11P124

B. maxwellii M2017

B. collinsii M2010

Bi. Colt MRI 483

. collinsii

100/1.00 d A coli MOL

„collinsii

88/1.00 B. kerrii M2058

74/.| 75/0.92]| ! B. kerrii M3009

B. kerrii M2044

0 B. kerrii SEI ia: pe

. longiflora

100/1.00 B. plicata subsp. ic alea, 3177

B. plicata Sute, urida M3120

100/1.00 B. pulcherrima K98-6220

B. pulcherrima M08P276

0.005 substitutions/site

Fig. 4. One of 37 best, Maximum Likelihood phylograms (-ln=2218.749) for Boesenbergia

longiflora and closely related taxa based on analysis of nuclear ribosomal ITS data for all

samples and clones. Support values (Bootstrap/Posterior Probability) for critical branches are

shown above branches. Bold typeface highlights strongiy supported positions of the different

Boesenbergia longiflora copies generated by cloning. Asterisks indicate samples that should

also be cloned to clarify a few polymorphisms. Underlined samples are placed in conflicting

positions on the chloroplast phylogeny. Note: lower branches were pruned to fit page and are

not to scale.

Boesenbergia longiflora and related taxa 57

B. collinsii M2010

B. collinsii M2011

65/0.94 B. collinsii MP1455

B. collinsii MO6P14

61/0.90 B. collinsii M3035

63/0.94 ui B. kerrii M2044

B. kerrii M2049

B. kerrii M2058

B. kerrii M3009

B. maxwellii M2017

B. maxwellii M2032

B. maxwellii M2040

99/1-00_| p maewellii M11P26

B. maxwellii M11P124

B. maxwellii M11C132

B. maxwellii MI1C133

B. longiflora M11P48

98/1.00 B. kingii K97-5821

B. kingii MO8P161

B. kingii M11P47

B. kingii M2002

B. kingii M3015

B. kingii M3019

63/0.83 B. kingii M3020

B. kingii M3074

B. kingii M3272

88/1.00 B. kingii MILP78

B kingii MLLP77

B. hamiltonii M3026

B. hamiltonii M3017

65/0.85

95/1.00

100/1.00

99/1.00 B. plicata lurida M3120

B. plicata plicata M3177

B. pulcherrima M08P276

B. pulcherrima K98-6220

—— 0.0005 substitutions/site

Fig. 5. Single best Maximum Likelihood phylogram (-ln=3953.067) for B. longiflora and

closely related taxa based on analysis of chloroplast 7rnK intron data. Support values (Bootstrap/

Posterior Probability) for critical branches are shown above branches. Numbers in bold typeface

indicate strong support. Underlined samples are placed in confiicting positions on the nuclear

ribosomal phylogeny. Note: lower branches were pruned to fit page and are not to scale.

58 Gard. Bull. Singapore 65(1) 2013

The identification of at least two disparate ITS copies for B. longiflora requires

further discussion. Only one sample of B. /ongi/lora was available for inclusion in

this study. This sample, M//P468 was from cultivated plants grown by the first author,

but originally collected in Burma (Kress 03-7305, US). Multiple clones representing

one B. /ongiflora ITS type were distributed among members of the B. kingii clade

(ITS copy “A”) while the other B. /ongi/lora copy fell sister to the B. kerrii clade

(ITS copy “B”) as is shown in Fig. 4. Although a number of tests have been proposed

to distinguish between the processes of hybridisation and incomplete lineage sorting

(Joly et al. 2009) all have limitations. We were restricted here by the single sample for

B. longiflora, but hopefully, more samples will be available for future analyses.

The majority of the polymorphic samples were identified as B. kingii based

on morphology. Six of the twelve samples required cloning to generate clean ITS

sequences. These samples fall into two categories. The first group included samples

with multiple ITS sequence types, but those sequences were all quite similar with only

a few different bases or slight length variations. Analyses of the ITS data partition

placed all of these sequences in the B. kingii sensu lato clade as described above

(B. hamiltonii + B. kingii + B. maxwellii), and with moderate to high support (75%

BS, 0.98 PP) but with poor resolution within the clade (Fig. 4). Further, most of the

B. kingii samples clustered with moderate support (70% BS, 1.00 PP). Among the

ingroup members, B. kingii is the most broadly distributed species and is the most

genetically diverse taxon.

Chloroplast trnK intron (including the protein coding matK gene)

A total of 36 potentially parsimony-informative characters (15 for ingroup only) were

used to generate almost 100,000 maximum parsimony trees. However, maximum

likelihood analyses resulted in a single best tree (Fig. 5). The lkelihood tree had a

topology identical to several of the MP trees. As with the results of the ITS analyses,

both MP and ML analyses identified two clades within the ingroup, one including

samples of B. collinsii + B. kerrii + B. longiflora + B. maxwellii (65% BS; 0.85 PP)

and a clade comprising B. hamiltonii and B. kingii (63% BS; 0.83 PP). Three taxa were

resolved and supported as monophyletic: B. col/linsii (65% BS, 0.94 PP) B. kerrii (63%

BS, 0.94 PP) and B. maxwellii (99% BS, 1.00 PP). The relationship of B. maxwellii

to B. hamiltonii and B. kingii diftered here relative to the ITS results, but only with

weak (65% BS; 0.85 PP) support. Sequences for two samples were not available for

this data set, B. hamiltonii M3212 and B. maxwellii MP1450. The two samples with

names underlined in Fig. 4, B. kingii M/1P77 and MI1P78, were identical and clearly

supported as members of the B. kingii group in the phylogeny produced by analyses of

the nuclear ITS dataset. Results of the chloroplast data analyses (Fig. 5) clearly (88%

BS, 1.00 PP) placed these two samples in a clade with B. hamiltonii.

Combined analyses

The combined data set required a number of samples to be excluded. Because the ITS

data required cloning for some samples, results of the ITS MP analyses were used to

select the clone with the shortest branch for each sample (as suggested by Beilstein et

Boesenbergia longiflora and related taxa 59

al. 2008) for subsegquent use in the combined analyses. This was done only when all

clones for a particular sample either formed a monophyletic lineage or clustered within

a moderately or well-supported lineage (BS>75%). In the instance of B. kingii samples

MIIP77 and MI1P78, there was positional conflict between the nuclear and plastid

datasets. Those samples were excluded from the combined analysis. As mentioned,

there was only a single sample of B. longiflora available for this study. The nuclear

data set included two distinctly different copies, A and B. Rather than totally exclude

this critical taxon, we selected the nuclear copy B that best matched the chloroplast

phylogeny, while recognising we do not know which better represents the evolutionary

history of the species.

Maximum parsimony analysis produced 468 shortest trees. Maximum likelihood

analyses produced three equally likely trees, one of which is shown in Fig. 6. Both

MP and ML analyses identified two clades within the in-group most similar to those

of the ITS data analyses, a B. kingii clade including samples of B. hamiltonii + B.

kingii + B. maxwellii and a B. longiflora sensu lato clade including samples of B.

collinsii + B. kerrii + B. longiflora. The B. kingii sensu lato clade received 62% BS and

0.78 PP. Unlike the ITS data analyses results, the combined data analyses produced

highly resolved topologies within this clade. Significantly, B. maxwellii is resolved as

monophyletic (83% BS; 1.00 PP). Boesenbergia hamiltonii and B. kingii samples are

grouped together with 51% BS and 0.95 PP. Boesenbergia hamiltonii was also resolved

as monophyletic, but with weak support (<50% BS, 0.86 PP). The B. longiflora sensu

lato clade was strongly supported (95% BS; 1.00 PP) with significant internal structure

and support. Boesenbergia collinsii was supported as monophyletic (100% BS; 1.00

PP) as was B. kerrii (93% BS, 1.00 PP). The single sample of B. longiflora was sister

to B. kerrii (64% BS, 0.64 PP). but this placement should be viewed with caution.

Multiple accessions for each taxon (except B. longiflora) were included to assess

genetic variation within and among the newly identified taxa. The amount of sequence

variation within each taxonomic clade was generally less than the amount of variation

between clades as is shown by the phylograms in Figs. 4-6. Despite the higher level of

sequence diversity within B. kingii, it is supported as monophyletic. The results of both

maximum parsimony and maximum lkelihood analyses of DNA data presented above

consistently identified five mostly strongly supported clades within the B. /ongiflora

complex: B. collinsii, B. hamiltonii, B. kerrii, B. kingii and B. maxwellii. The data also

support two sister relationships, one between B. collinsii and B. kerrii, and one between

B. hamiltonii and B. kingii. The position of B. longiflora and B. maxwellii are less clear.

The relationship of B. longiflora to these taxa is uncertain due to polymorphism în the

nuclear (ITS) data set, but it is clearly closely related to them. Boesenbergia maxwellii

jumps between the two clades depending upon data set examined. Finally, additional

data are needed to test between various hypotheses (incomplete concerted evolution

due to genetic drift post polyploidisation, hybridisation, or incomplete lineage sorting)

to explain the high level of genetic variation detected in the nrlTS of B. kingii. Overall,

although there are a number of questions remaining, the molecular data allowed for the

delineation of six taxa.

60 Gard. Bull. Singapore 65(1) 2013

B. kingii M2002

B. kingii M3074

B. kingii MO8P161

B. kingii MIIP47

B. kingii M3015

B. kingii M3272

89/1.00 B. kingii M3019

B. kingii M3020

51/0.95 B. kingii K97-5821

B. hamiltonii M3017

B. hamiltonii M3026

B. hamiltonii M3212

62078] 79% B. maxwellii M2032

B. maxwellii M2040

B. maxwellii MP1450

B. maxwellii M11P26

83/1.00 B. maxwellii M11P124

B. maxwellii MIIC132

B. maxwellii MLIC133

B. maxwellii M2017

B. collinsii M2010

B. collinsii MP1455

B. collinsii M2011

B. collinsii MO6P14

B. collinsii M3035

95/1.00 B. kerrii M2058

93/1.00 B. kerrii M3009

B. kerrii M2044

B. kerrii M2049

64/0.64 B. longiflora MI1P48

100/1.00 B. plicata lurida M3120

B. plicata plicata M3177

100/1.00

100/1.00

100/1.00 B. pulcherrima K98-6220

B. pulcherrima MO8P276

— 0.0005 substitutions/site

Fig. 6. Single best Maximum Likelihood phylogram (-ln=5747.386) for B. longi/lora and closely

related taxa based on analysis of combined chloroplast /rnă intron and nuclear ribosomal ITS

data. Support values (Bootstrap/Posterior Probability) for critical branches are show above

branches. Numbers in bold typeface indicate strong support.

Boesenbergia longifiora and related taxa 61

Taxonomy

A field key to the Boesenbergia longiflora clade of species as elucidated above is

provided here (see also Table 1.)

Key to six species in the Boesenbergia longiflora alliance

la. Flowers light yellow to bright, darker yellow ...............mcmc ceas 2

EEE lowers pure White 10 creamy White .......mmc-ae came poe o deea oa one aa saadlaula a daealaia -

2a. Plants c. 50-80 cm., leaves broad, some horizontal, thecae red (Thailand)

ac oua a 3 cr a 0 ea E IRRD IRI III RR II ORI B. collinsii

3a. Flowers small, c. 2.5-3.0 cm, very saccate, staminodes light yellow, throat

red maculate, labellum medium yellow, apex entire, thecae white (Burma)

= aeaa a da aie ot Da 08 co A RET RPR IRI RR B. longiflora

b. Flowers larger, c. 3.5-4.0 cm, saccate, staminodes very light yellow to white,

throat red-orange, maculate, labellum streaked with red, apex truncate, thecae

2 re Îi 7 7 0 Co NE ete CI El Ta ) INDORE RE BIR E RR B. kerrii

4a. Rhizomes many, running, cylindrical, c. 5-15 mm diameter, flowers white to

creamy white, throat red, sometimes with pink apex (NE India, Burma, SW

Dar re uri 20 at 8 0 O RR NE PRR RR IRI RR IRON RR B. kingii

b. Rhizomes few, small, with vertical tuberous roots c. 16 cm long .................. 5

Sa. Labellum apex light pink, throat red (NE India)... B. hamiltonii

b. Labellum light and dark pink, throat orange, very frilled, crisped, large flower

Era i inaland Lao: PR)... cec ce ame da starea B. maxwellii

Enumeration of species

Boesenbergia longiflora ( Wall.) Kuntze, Revis. Gen. Pl. 2: 685 (1891). — Gastrochilus

longiflorus Wall., Pl. Asiat. Rar. |: 22, t. 25 (1829) (“longiflora”). — Curcumorpha

longiflora (Wall.) A.S.Rao & D.M.Verma, Bull. Bot. Surv. India 13: 339 (1974), pro

comb. LECTOTYPE (designated here): Wal/lich 65894 (K, IDC microfiche 7394,

digital image seen) Burma, Rangoon. (Fig. 1, 7, 17 & 19A).

Deciduous herb up to | m tall; rhizome small, irregularly shaped, c. | cm diam.,

externally brown, internally light yellow to white; multiple, small bulb-lke rhizomes

62 Gard. Bull. Singapore 65(1) 2013

ri 4 TI —

maria .

Cl 4% PF D

Fig. 7. Boesenbergia longiflora (Wall.) Kuntze. A. First-day flower. B. Second-day flower. C.

Plants. D. New rhizomes and tuberous roots. A-D, M//P48. (Photos: ]. Mood)

Boesenbergia longiflora and related taxa 63

surrounding the main rhizome, c. | cm long, pink or white; tuberous roots two or

more, c. 8 x 0.5 cm, tapering to a tuber, c. 2 x | cm, externally white or pink, internally

white, root hairs few, c. 20 mm long, thin, white. Pseudostem up to c. 30 cm long,

composed of leaf sheaths, base c. 2-2.5 cm diam., 1-2 short leafless sheaths at the

base, leaf sheaths c. 10-16 cm, longitudinally ridged, green, glabrous, margin hyaline.

Leaves 5-8 per pseudostem; petiole 9-18 cm, deeply channelled, green, glabrous;

ligule slightly bilobed, lobes an extension of the hyaline margin, 2 mm long, slightly

acute, protruding outward, green, glabrous; lamina ellptical or broadly ovate, c. 41-

61 x 20-21 cm, plicate, ventrally dark green, glabrous, dorsally lighter green, glabrous

with a few hairs on the midrib, base rounded to cordate, sometimes asymmetric, apex

acute to long acuminate. Inflorescence radical, c. 3-4 per pseudostem, up to c.12 cm

long (including peduncle) produced from the side of the rhizome, pedunele c. 1-3 cm

long, white, glabrous, basal sheaths 1-2, pink and white, glabrous; spike horn-shaped,

5-10 x 1-2 cm. Braets cymbitorm, 3-4, c. 5-6 x 1.5 cm, distichously arranged, red

and green, glabrous, each bract enclosing one flower, some basal bracts sterile, apex

sometimes curved; bracteole cylindrical, c. 5 x 0.5 cm, white, translucent, glabrous,

open to the base, apex acute. Flowers 2-3 per inflorescence, up to c. 11 cm long. Calyx

tubular, 20 x 5 mm, white, translucent, glabrous, apex bi-dentate. Floral tube 10 cm

long, c. 3 mm wide at the base, white, glabrous externally and internally, corolla lobes

(dorsal and ventral) linear to lanceolate, c. 2 x 0.5 cm, yellowish-white, glabrous,

margins involute; androecial tube cup-shaped, c. 4-5 mm long, c. 7 mm diam. at the

top, yel!lowish-white, glabrous externally and internally. Label/lum saccate, semi-

orbicular, 2.2-2.5 cm long, 2.0-2.2 cm wide (when flattened at broadest point) light

yellow, throat centre dark red, maculate with yellow showing through as dots, red

pattern broadening to the lip apex, glabrous, margin wavy or wrinkled, revolute on

the sides, apex elongate, emarginate; lateral staminodes obovate, 1.3 x 1.0 cm, light

yellow, glabrous, apex rounded. Stamen 8 mm long, filament | mm long, 2 mm wide

at base, light yellow, few short glandular hairs, anther 7 mm long, 2 mm wide (first

day) then 5 mm wide (thecae diverging on the second day) apex rounded with no

anther crest, thecae c. 7 x | mm, white, dehiscing along the entire length. Ovary c. 7

x 3 mm, trilocular, axile placentation, white, glabrous; szyle filiform, white, glabrous,

stima rounded, white, ostiole transverse, without cilia, exuding a sticky liquid on

the second day; epigynous glands linear, two, 4 mm long, light yellow. Fruiz not

seen. | Measurements based on living, cultivated material of M//P46, originating from

Kress 03-7305 (US)].

Distribution. So far known only from two locations in Burma (Fig. 20).

Ecology. Collected in the understorey of a primary teak forest [Aress 03-7305 (US)].

More observations are needed in Burma to fully document the ecology.

Phenology. Flowering from May to September with a two-day flowering cyele for

each flower.

64 Gard. Bull. Singapore 65(1) 2013

Etwmology. Latin, longus = long and flos = flower. Named by Wallich for the long

flower.

Notes. The cultivated material (M//P45) was grown from dormant rhizome divisions

of Kress GH2003-051 cultivated at the Smithsonian Institution, and originally

collected on 18 June 2003, in Rakhine state, Burma as Kress 03-7305 (US). This

accession compared very well with Wallich's description and watercolour (Fig. 1). The

only exception was the lack of pigmentation on the lower lamina surface, a character

found to be highly variable throughout this clade. Of note are the very small, bulb-

like rhizomes which develop en masse, underground, at the base of the pseudostem.

Each of these small entities are loosely attached to the main rhizome and if separated

can produce a new plant. Wa/lich 6989B (CAL, K, microfiche 7394) annotated and

listed as G. /ongiflora (Wallich 1832) has a terminal inflorescence and as such, appears

to be a different taxon, perhaps related to B. siphonantha (King ex Baker) M.Sabu,

Prasanthk. & Skorni€k.

Boesenbergia kerrii Mood, L.M.Prince & Triboun, sp. nov.

Boesenbergiae longiflorae (Wall.) Kuntze affinis, inflorescentiis 4 vel plus floribus,

floribus maioribus 3.5-4.0 cm longis c. 2.8 mm latis, labello elongatiore truncato

apice indentato differt.

TY PUS: Mood & Triboun 12P170, Cultivated in Hawaii, USA, | Nov 2012 (holo BK;

iso AAU). Originally from Thailand, Tak Province, Khao Pa Wo District, near Mae

Sot, c. 600 m asl, 16”48.783'N 98*39.70'E, 8 September 2010, Mood & Triboun 2044,

cultivated as M2047. (Fig. 8, 9, 17 & 19B)

Deciduous herb up to 1.2 m tall; rhizome small, globular, c. | cm diam., externally red,

pink or light tan, internally light yellow to white; multiple, small bulb-like rhizomes

surrounding the main rhizome, c. | cm long, pink turning red with age; tuberous roots

few to numerous, c. 12 x 0.5-0.8 cm, tapering to a point, externally and internally

white, root hairs few, c. 10 mm long, thin, white. Pseudostem up to 30 cm, composed of

leaf sheaths, base oval, c. 2-2.5 cm diam., 1-2 leafless sheaths at the base, leaf sheaths

longitudinally ridged, green, glabrous, margin hyaline. Leaves 5-8 per pseudostem;

petiole 9-18 cm, deeply channelled, green, glabrous; lgule slightly bilobed, lobes

an extension of the hyaline margin, 2 mm long, green, glabrous; lamina elliptical or

broadly ovate, c. 41-61 x 20-21 cm, plicate, ventrally dark green, glabrous, dorsally

lghter green, glabrous with a few hairs on the midrib, base rounded to cordate,

sometimes asymmetric, apex acute to long acuminate. Inflorescence radical, c. 3-6

or more per pseudostem, up to c. 15 cm long (including peduncle) produced from the

side of the rhizome; peduncle c. 1-4 cm long, white, glabrous, basal sheaths 1-2 , pink

and white, pubescent; spike horn-shaped, 5-12 x 1-2 cm. Bracts cymbiform, 4-6, c.

4-5 x 1.5-2 cm, distichously arranged, green and red, glabrous, each bract enclosing

one flower, some basal bracts sterile, apex sometimes curved; bracteole cylindrical,

c. 5 x 0.5 cm, white, translucent, glabrous, open to the base, apex acute. Flowers 3-6

Boesenbergia longiflora and related taxa 65

Fig. 8. Boesenbergia kerrii Mood, L.M.Prince & Triboun. Ink line drawing with watercolour of

the type plant by Linda Ann Vorobik (2012).

06 Gard. Bull. Singapore 65(1) 2013

Fig. 9. Boesenbergia kerrii Mood, L.M.Prince & Triboun. A. First-day flower of M2044. B.

Second-day flower of M 2044. C. Plants of M2049. D. Rhizomes and tuberous roots of M2058.

E. Typical habitat on limestone with bamboo. (Photos: ]. Mood)

Boesenbergia longiflora and related taxa 67

per inflorescence, up to c. 15 cm long. Calyx tubular, 2.0 x 0.5 cm, white, translucent,

glabrous, apex bi-dentate. Floral tube 12-14 cm long, c. 3 mm wide at the base, white,

glabrous; corolla lobes (dorsal and ventral) linear to lanceolate, c. 2 x 0.5 cm, white

to light yellow, glabrous, margins involute; androecial tube cup-shaped, c. 4-5 mm

long, c. 10 mm diam. at the top, yellow, glabrous externally and internally. Label/um

saccate, semi-orbicular, 3.8-4 cm long, 2.2 cm wide (when flattened at the broadest

point) light yellow, throat centre orange-red, maculate with yellow showing through

as dots, red pattern broadening toward the lip apex, ending c. 10 mm short of the

apex, then dark red streaks to the apex, glabrous, margin entire, revolute on the sides,

apex shortly to deeply bilobed, 2-8 mm, slightly wavy; lateral staminodes obovate,

1.3 x 1 cm, light yellow, glabrous, apex rounded, revolute, margin wavy. Sfamen ||

mm long, filament 2 mm long, 2 mm wide at the base, light yellow, with a few short

glandular hairs, anther 9 mm long, 3 mm wide (first day) then 6 mm wide (thecae

diverging on the second day) apex rounded with no anther crest, thecae c. 9 x | mm,

light yellow, dehiscing along the entire length. Ovary c. 8 x 4 mm, trilocular, axile

placentation, white, glabrous; szyle filiform, yellowish-white, glabrous, sfizma round

to oval, white, ostiole oval, without cilia, exuding a sticky liquid on the second day;

epigynous glands linear, two, 5 mm long, light yellow. Fruiz not seen. (Measurements

based on living, cultivated material of M2044).

Distribution. This species is prevalent in western Thailand from the southern area of

Tak Province to the southern area of Kanchanaburi Province. It should be expected in

E. Burma.

Ecology. This species has been found only in close proximity to limestone rock outerops.

In almost all situations observed, the primary canopy component was bamboo with

mixed deciduous, hardwood species. The plants grow in the cracks between limestone

rocks where there is accumulation of organic matter or in deeper soils surrounding

the limestone karsts. In the dry season these areas are often burnt, leaving a biochar

residue. Shade is variable from light to medium. Plants commonly occur as single

individuals, but over time, can create small populations of scattered plants. The result

is a group of separate stems growing close together or scattered about.

Phenology. Flowering from June to October with a two-day flowering cyele for each

flower.

Erwmology. Named in honour of Arthur F.G. Kerr (1877-1942) one of the “founding

fathers” of botany in Thailand. His two specimens from the Thailand/Burma border

(1922) appear to be the first collections of this new taxon.

Additional specimens examined: THAILAND. Tak Province. Umphang, Kao Hua limestone

hills, 13 Jun 1922, Kerr 6133 (P, C; *); South of Mae Sot along Maenam Moei, 17 Jun 1922,

Kerr 6144 (K. L, P; *); Khao Pha Wo, 23 Jul 1973, Murata, Fukuoka & Phengkhlai T-16947

(BKF); Khao Pha Wo, 23 Jul 1973, Murata, Fukuoka & Phengkhlai T-16949 (BKF, KYO,

08 Gard. Bull. Singapore 65(1) 2013

L); Mae Sot Dist., 20 Aug 1994, Maxwell 94-911 (BKF). Kanchanaburi Province. Tha Sao

Dist., 14 Sep 2010, Mood & Chalermglin 2049 (BISH; *);, Huai Kayeng Dist., 15 Sep 2010,

Mood & Chalermeglin 2058 (BISH; *), Sai Yok, 16 Sep 2010, Mood & Triboun 3009 (BISH;

*); Sai Yok, 100 m, Aug 1928, Marcan s.n.(C, K); Ka Tha Lai, Fan Faung River Valley, 25

km east of Wangka, 1 Jun 1946, Kostermans 787 (AAU, BO, C, L, P; *); Sai Sok Falls, 30

Jun 1963, Larsen 10349 (AAU; *); Dong Yai Ban Ka Kwang, 14 Aug 1971, Phengkhlai 2959

(AAU, BKF); Thong Pa Phum, 5 Jul 1973, Maxwell 73-109 (AAU; *), Sai Yok, Marcan s.n.

(C, K); Thong Pha Phum, Zriboun 27 (BK; *); Huay Ban Kao to Kritee, 4 Jul 1973, Geesink &

Phengkhlai 6088 (BKF, L).

Notes. Boesenbergia kerrii 1s similar to B. longiflora, but the former has a more

exserted, longer floral tube, broader, longer lip with a truncate apex, different labellum

colour pattern and rectangular throat opening. When habitats are compared, B. kerrii

is found only on or around limestone, while the type of B. longiflora and the specimen,

Kress 03-7305 (US) appear to have been collected on sandstone or shale derived soils

(USACE 1990). The small, bulb-like rhizomes described under B. /ongi/lora are also

found in B. kerrii.

Boesenbergia collinsii Mood & L.M.Prince, sp. nov.

Boesenbergiae longiflorae affinis, rhizomatium parvorum aliquot absentia radicibus

longis crassis tuberosis abuntis, pseudocaule breviore 50-80 cm longo, floribus

maioribus 4-4.2 cm longis 3 cm latis differt.

TYPUS: Mood 12P171, Cultivated in Hawaii, USA, | Nov 2012 (holo BK; iso AAU).

Originally from Thailand, Loei Province, eastern border with Nong Bua Lamphu

Province, along road to Udon Thani, no exact location, c. 300 m asl, August 2003,

Collins T-306$, cultivated as MO6P14. (Fig. 10, 11, 17 & 19C)

Deciduous herb up to 80 cm tall; rhizome small, elongate c. 5 x 0.5 cm, externally

brownish, internally yellow; tuberous roots prolific, c. 15-20, c. 10 x 1 cm, swelling

to 1.5 cm in the lower third or tapering, externally pink, internally three concentric

pink rings, root hairs many, c. 8 mm long, thin, white. Pseudostem up to c. 20 cm

long, composed of leaf sheaths, base oval, c. 2-2.5 cm diam., 1-2 leafless sheaths at

the base, leaf sheaths longitudinally ridged, green or green and red, glabrous, margin

hyaline. Leaves 5-6 per pseudostem; petiole 12-16 cm, deeply channelled, light green

or reddish, glabrous; ligule slightly bilobed, lobes an extension of the hyaline margin,

c. 3 mm long, white, glabrous; lamina elliptical or broadly ovate, c. 28-44 x 12-19

cm, ventrally dark green, glabrous, dorsally lighter green, glabrous with a few hairs

on the midrib, base rounded to cordate, sometimes asymmetric, apex acute to long

acuminate. Inflorescence radical, c. 3-6 or more per pseudostem, up to c. 9 cm long

(including peduncle) produced from the rhizome below the stem; peduncle c. | cm

long, white, glabrous, basal sheaths 1-2, white, glabrous; spike horn-shaped, 5-8.5 x

3 cm. Bracts cymbiform, c. 4, c. 5-8 x 1.5-2 cm, distichously arranged, green or dark

red, each bract enclosing one flower, apex sometimes curved; bracteole cylindrical,

c. 5 x 0.5 cm, white, translucent, glabrous, open to the base, apex acute. Flowers c. 4

per inflorescence, up to c. 15 cm long. Calyx tubular, 2 x 0.5 cm, white, translucent,

Boesenbergia longiflora and related taxa 69

Fig. 10. Boesenbergia collinsii Mood & L.M.Prince. Ink line drawing with watercolour of the

type plant by Linda Ann Vorobik (2012).

70 Gard. Bull. Singapore 65(1) 2013

Fig. 11. Boesenbergia collinsii Mood & L.M.Prince. A. First-day flower of MO6P/4. B. & C.

Flower and plants of M3035. D. Rhizome and tuberous roots of M06P/4. (Photos: J]. Mood)

Boesenbergia longiflora and related taxa 71

glabrous, apex bi-dentate. Floral tube 14 cm long, 3 mm wide at the base, white,

glabrous externally and internally, dorsal corolla lobe lanceolate, 3-3.2 x 1 cm, creamy

white, glabrous, margins involute, ventral lobes linear, 4 x 0.6 cm, creamy white,

glabrous, margins involute; androecial tube cup-shaped, c. 8 mm long, c. 5 mm diam.

at the top, yellow, glabrous externally and internally. Labe/lum saccate, semi-orbicular,

4-4.2 cm long, 3 cm wide (when flattened at broadest point) light yellow, throat centre

bright orange-red, maculate with yellow showing through as dots, interrupted with a

yellow, irregular band, then a dark red band across the lip, turning to pink towards the

apex, externally with a few glandular hairs, internally glabrous, margin entire, revolute

on the sides, apex slightly truncate, wavy; lateral staminodes obovate, 1.6 * 1 cm,

light yellow, dorsal surface with few glandular hairs, ventral surface glabrous, apex

rounded, revolute, margin wavy. Stamen || mm long, filament 1.5-2 mm long, 2-3

mm wide at the base, light yellow, few glandular hairs, anther c. 9 mm long, 3 mm

wide (first day) then c. 6 mm wide (thecae diverging on the second day) apex slightly

bilobed with no anther crest, thecae 9 x 1 mm, red, dehiscing along the entire length.

Ovary c. 8 x 5 mm, trilocular, axile placentation, white, glabrous; szyle filiform, white,

glabrous, sfizma rounded to oval, white, ostiole oval, without cilia, exuding a sticky

liquid on the second day; epizynous glands narrowly ovate, two, 5 mm long, light

yellow. Fruiz a capsule, elliptical, c. 2 cm long, | cm wide, trilocular, white, glabrous,

dehiscence loculicidal, valves rolling outward into coils; seed round, c. 15, c. 3 mm

diam., light brown, slightly pubescent, aril white, translucent. (Measurements based

on living, cultivated material of M06P1/4).

Distribution. This species is more northerly in distribution than B. kerrii, extending

from Northern Lampang Province into Southern Lamphun Province. Moving eastward,

the species is not documented again until the mountains of northern Phitsanulok

Province, then northward into Loei and Nong Bua Lamphu Provinces. Currently, there

are no known specimens from the Lao P.D.R.

Ecology. This species has been found only on or around the base and slopes of limestone

outcrops in secondary forest with bamboo. Specimens from eastern Thailand also

occur on the lower slopes of larger mountains with limestone geology. The plants

prefer wet, but well-drained micro-habitats, even growing in the cracks and crevices

of rock similar to B. kerrii. A single plant was found growing in a tree crotch, possibly

indicating some consumption of the capsules and seed by rodents or birds. Plants can

occur singly or as small populations of scattered individuals.

Phenology. Flowering from June to mid-October with a two-day flowering cyele for

each flower.

Etymology. Named for Mark Collins (1963-2011) an American horticulturist who was

an avid plant collector and enthusiast. For over twenty years he promoted Zingiberales

worldwide and provided hundreds of plants to botanical gardens for conservation. This

72 Gard. Bull. Singapore 65(1) 2013

new species was one of the numerous collections Collins brought to the attention of

the first author over many years of cooperation.

Additional specimens examined: THAILAND. Lamphun Province. Li District, 4 Sep 2010,

Mood & Triboun 2010 (BISH; *); Li District, 5 Sep 2010, Mood & Triboun 2011 (BISH; *).

Lampang Province. Wang Tong District, 12 Aug 1998, Mood & Pedersen 1455 (C; *);, Wang

Nua, 28 Jun 1996, Maxwell 96-927 (BKEF, CMU, L). Phitsanulok Province. Tung Salaeng

Luang, Jul 1966, Larsen 832 (AAU, BKF; *). Phetchabun Province. Pa Prack, Nam Naw, 19

Jun 1964, Chantanamuck 789 (BKF). Loei Province. Phu Luang, 18 Sep 1963, Phusomsaeng

& Bunchuai 47 (BKF);, Loei, Triboun 1424 (BKF; *). Nong Bua Lam Phu Province.

Suwannakuha District, Ban Chokchai, 16 Aug 2011, Mood & MeMakin 3035 (BISH; *).

Chaiyaphum Province. Thung Lui Lai, 27 Jul 1999, Newman 934 (BKF, E; *). Khon Kaen

Province. Pha Nok, Khao, 9 Sep 1963, Smitinand 1123 (AAU; *).

Notes. Boesenbergia collinsii is similar to B. kerrii, but the former has a smaller stature

with broader lamina that tend to become horizontal when mature. The flower of B.

collinsii 15 also larger and longer with more varied coloration and pattern. The plant

normally lacks the many bulb-lke rhizomes at the base of the pseudostem found in B.

kerrii and B. longiflora.

Boesenbergia maxwellii Mood, L.M.Prince & Triboun, sp. nov.

Boesenbergiae longiflorae (Wall.) Kuntze affinis, floribus maioribus 4.5 cm longis

2.7-3.0 cm latis, labello elongato minus saccato albo demum lutescenti maculis rubris

roseis vel violaceis differi.

TY PUS: Mood & Triboun 12P172, Cultivated in Hawaii, USA, 1 Nov 2012 (holo BK;

1so AAU). Originally from Thailand, Tak Province, Mae Lamung, secondary forest,

granitic soil, c. 750 m asl, 15*48.085'N 98*53.754'E, 9 July 2010, Mood & Triboun

2032, cultivated as M2032. (Fig. 12, 13, 18 & 19D)

Deciduous herb up to 1.5 m tall; rhizome small, globular to elongated, c. 1-2 cm

diam., externally yellow, internally light violet, numerous cylindrical, tuberous roots

extending from the rhizome base, c. 10-20x 0.5-0.8 cm, tapering, then enlarging into

a tuber, c. 2 * 3 cm, externally white, internally pink, translucent, root hairs c. 18 mm

long, thin, white. Pseudostem up to c. 30 cm, composed of leaf sheaths, base oval, c. 2-3

cm diam. several leafless sheaths at the base, sheaths longitudinally ridged, externally

green, glabrous, internally yellow (core) margin hyaline. Leaves 4-6 per pseudostem;

petiole c. 5-30 cm, channelled, light green, glabrous; ligule slightly bilobed, c. 2 mm

long, lobes an extension of the hyaline margin, acute, green, glabrous; lamina elliptic,

c. 33-50 x 15-25 cm, ventrally dark green, glabrous, dorsally lighter green, glabrous

with a few hairs on the midrib, base rounded to cordate, apex acute. Inflorescence

radical, c. 3—10 per pseudostem, up to 15 cm long (including peduncle) produced from

the rhizome below the stem, pedunele 3-5 x 0.5-8 cm, white, glabrous, basal sheaths

1-2, white or pink, glabrous; spike horn-shaped, c. 8-10 x 2 cm. Braczs cymbiform,

5-7, c. 5-8.5 x 2-3 cm, distichously arranged, white and pink or red, translucent,

Boesenbergia longiflora and related taxa 73

Fig. 12. Boesenbergia maxwellii Mood, L.M.Prince & Triboun. Ink line drawing with

watercolour of the type plant by Linda Ann Vorobik (2012).

74 Gard. Bull. Singapore 65(1) 2013

Fig. 13. Boesenbergia maxwellii Mood, L.M.Prince & Triboun. A. First-day flower of M2032.

B. Flowers of M2032. C. Flowers of MIIP124. D. Flower of M//P26 from the Lao P.D.R. E.

Flowers, Chin State, Burma. F. Rhizome and tuberous roots of M/2040. (Photos: A-D & F.J.

Mood; E, H. Funakoshi)

Boesenbergia longiflora and related taxa 75

glabrous, each bract enclosing one flower, apex attenuate; bracteole cymbiform, c. 4

x 0.5 cm, white, translucent, glabrous, open to the base, apex 2-dentate. Flowers 5-7

per inflorescence, up to c. 16 cm long. Calyx tubular, 3 * 0.5 cm, white, translucent,

glabrous, apex tri-dentate. Floral tube c. 12-14 cm long, 3 mm wide at the base, white

with a pink tinge, glabrous externally and internally, dorsal corolla lobe oblong, 3.6 *

1.3 cm, white, glabrous. apex cucullate, margins involute, ventral lobes linear, c. 4.3

x 1 cm, white, glabrous, apex sometimes cucullate, margins involute; androecial tube

cup-shaped, c. 10-16 mm long, c. 12 mm diam. at the top, white, glabrous externally

and internally. Labellum slightly saccate. elongate, 4.5-5.0 cm long, 2.7—3.0 cm wide

(when fiattened at the broadest point) white, throat centre orange-red, maculate with

white showing through as dots, lip with an irregular, dark pink band, followed with a

lighter pink and white band to the apex, abaxial surface with few glandular hairs, lip

surface crinkled, margins crisped, apex entire, irregular; lateral staminodes obovate,

c. 2.3 x | cm, white, abaxial surface with few glandular hairs, margins irregular, apex

revolute. Sfamen 12 mm long, filament c. 3 mm long, c. 2 mm wide at base, white,

few glandular hairs, anther 10 mm long. 3 mm wide (first day) then c. 6 mm wide

(thecae diverging on the second day) apex slightly bilobed, with no anther crest, thecae

10 x 1 mm, white, dehiscing along the entire length. Ovary c. 7 * 3 mm, trilocular,

axile placentation, white, glabrous; szyle filiform. white, glabrous, sfizma round, white,

ostiole round, without cilia, exuding a sticky liquid on the second day; epigynous

glands linear, two, 6 mm long, tan. Fruit a capsule, cylindrical, slightly ridged, c. 2 x 1

cm, trilocular, white, glabrous, calyx and floral tube remain partially intact, dehiscence

loculicidal; seed globular, c. 3 mm diam., yellowish-brown, slightly pubescent, anil

white, translucent. (Measurements based on living, cultivated material of M2032).

Distribution. This species is very common in northern Thailand. Collections from Chin

State, Burma and the Lao P.D.R. are known. It might also occur in Yunnan, China.

Ecology. This species occurs in a variety of forest types to include evergreen, dry

deciduous and mixed evergreen/deciduous. Most collections are at middle to higher

elevations in mountainous terrain. Soil types vary from granitic to calcareous with

high organic matter content.

Phenology. Flowers from June to November with a two-day flowering cycle for each

flower.

Etymology. Named in honour of James F. Maxwell, Curator of the Chiang Mai

University Herbarium, Thailand (CMU). For many years he has diligently collected,

documented, identified and preserved the flora of Thailand, Burma, Cambodia and the

Lao P.D.R. to include hundreds of Zingiberaceae. Several of his collections represent

this new taxon.

Additional specimens examined: BURMA. Chin State. Kanpetlet, Laung Pan, Aug 2011,

Funakoshi s.n. (MBK: *); Kanpetlet, near Laung Pan. Aug 2011. Funakoshi s.n. (MBK).

76 Gard. Bull. Singapore 65(1) 2013

LAO P.D.R. Champasak Province. Near Pakxong, secondary forest, 2006, 1286 m., collected

by T. Wood, Mood 11P26 (BISH; *). THAILAND. Mae Hong Son Province. 6 Sep 2010,

Mood & Triboun 2017 (BISH; *), Mae Hong Son, Khun Yuam, 5 Sep 1974, Larsen 34174

(AAU). Chiang Mai Province. Dong Duat waterfalls, 4 Sep 1999, Mood 11P124 (BISH; *);

Chiang Mai, Fang, 7 Jun 1973, Geesink 5750 (BKF);, Chiang Mai, Doi Sutep, 18 Jun 1988,

Maxwell 588-875 (BKF; *); Chiang Mai, Sop Aep, 1 Oct 1971, Murata 7-15458 (BKF); Chiang

Mai, Mae Sanam, 27 Jun 1978, Phengkhlai 4140 (BKF);, Chiang Mai, Doi Inthanon 14 Jul

1990, Phengkhlai 7516 (BKEF); Chiang Mai, Doi Inthanon NP, 20 Jul 1988, Phengkhlai 6619

(BKF; *); Chiang Mai, Doi Chiang Dao, 25 Sep 1971, Murata T-14944 (AAU, BKF; *);

Chiang Mai, Doi Inthanon, 20 Jul 1988, Zamura 7-60130 (BKF);, Chiang Mai, Doi Sutep, 9

Aug 1988, Tamura T-60782 (BKF); Chiang Mai, Doi Chiang Dao, 9 Jun 1955, Fehrain 12477

(BKF); Chiang Mai, Doi Sutep, 11 Jul 1987, Maxwell 687-659 (BKF, CMU, L; *); Chiang Mai,

Chiang Dao, Doi Chiang Dao, 10 Jun 1989, Maxwell 859-731 (E); Chiang Mai, Fang, 26 May

1991, Maxwell 91-509 (E); Chiang Mai, Bo Luang, 4 Jul 1968, Larsen 2097 (AAU, BKF, L);

Chiang Mai, Doi Inthanon, 15 Sep 1995, Larsen 46499 (AAU); Chiang Mai, Doi Chiang Dao,

11 Sep 1967, Tagawa T-9865 (AAU); Chiang Mai, Baan Tham, Doi Chiang Dao, Warrhana

737 (AAU). Lampang Province. Lampang, Doi Kuhn Dahn, 27 Jun 1993, Maxwell 93-695

(BKF, CMU, L; *); Lampang, Jae Sawn NP, 24 Aug 1995, Maxwell 95-575 (BKF, CMU, L).

Tak Province. 9 Aug 2010, Mood & Triboun 2040 (BISH; *). Chiang Rai Province. Chiang

Rai, Doi Yup, 13 Jun 1926, Garrett 294 (BKF); Tha Sai, 12 Aug 1998, Mood & Pedersen 1450

(62):

Notes. This species is closely related to B. kingii as discussed in the phylogenetic

analyses. Since B. maxwellii has a rhizome architecture different from B. kingii, there

is little chance of misidentification where their ranges might overlap, i.e., Burma,

Thailand and possibly China. The most westerly (known) record of B. maxwellii is

in Chin State, Burma, separating it geographically from B. hamiltonii. Boesenbergia

maxwellii difters from the latter in having larger flowers, different flower shape,

greater labellum texture, orange throat, a light and dark pink labellum and plant size

îg.c. 1.5.

Boesenbergia kingii Mood & L.M.Prince, sp. nov.

Boesenbergiae longiflorae (Wall.) Kuntze afinis, caulibus multiplicis, floribus

maioribus 5-6 cm longis 2.5-2.7 cm latis, labello minus saccato elongato cremee albo

fauce rubra differt.

TYPUS: Mood & Vatrcharakorn 12P173, Cultivated in Hawaii, USA, | Nov 2012

(holo BK; iso AAU). Originally from Thailand, Kanchanaburi Province, Huai Kayeng,

secondary forest margin, c. 200 m asl, 14*38.49'N 98*31.40'E, 21 August 2011, Mood

& Vatcharakorn 3074, cultivated as M3074. (Fig. 14, 15, 18 & 19E)

Deciduous herb up to c. | m tall; rhizomes numerous, horizontal runners of variable

length, multiple nodes, c. 0.5-1.5 cm diam., pink or red when young, orange or red

when mature, internally yellow to orange; tuberous roots few, elongate c. 6 x 0.3 cm,

orange or white externally and internally, root hairs few, short, thin, white. Pseudostems

many, up to 30 cm, composed of leaf sheaths, base oval, c. 2.5 cm diam., 1-2 short,

Boesenbergia longiflora and related taxa 7

—

——

<,

i

ad

Fig. 14. Boesenbergia kingii Mood & L.M.Prince. Watercolour on paper by Edward King of

G. King 1020 (1874). Originally annotated as Gastrochilus longiflora. Reproduced by kind

permission of the Director, Botanical Survey of India.

78 Gard. Bull. Singapore 65(1) 2013

Fig. 15. Boesenbergia kingii Mood & L.M.Prince. A. Flower of M3074. B. Flower of MO8P161.

C. Plant habit of M3074. D. Inflorescence, flower and leaf of M3074. E. Rhizomes of M3074.

F. Spreading habit (Assam, India). (Photos: J. Mood)

Boesenbergia longiflora and related taxa 79

leafless sheaths at the base, leaf sheaths longitudinally ridged, cross-hatched, reddish

or green, glabrous, margin hyaline. Leaves 3-7 per pseudostem; petiole 11-15 cm,

deeply channelled, green or red, glabrous; ligule slightly bilobed, an extension of the

hyaline margin, 4 mm long, white, translucent, glabrous; lamina elliptical 40-45 x

15-16 cm, ventrally dark green, glabrous, dorsally lghter green, glabrous with a few

hairs on the midrib, base rounded to cordate, apex acute to attenuate. Inflorescence

radical, c. 3-10 per pseudostem, up 18 cm long (including peduncle) produced from

the top of the horizontal rhizome near the pseudostem, peduncle 1-3 x 0.5-1 cm,

white or pink, glabrous, basal sheaths 1-2, 4-6 x 1.5-2 cm, white; spike cylindrical,

slightly asymmetric, 11-14 x 1-1.5 cm. Braczs linear to cymbiform, 4-5, c. 6-11 x

1.5-2 cm, distichously arranged, white, green or red, glabrous, surface veined, each

bract enclosing one flower, apex acute; bracteole lanceolate, c. 5-6 x 0.5 cm, white,

translucent, glabrous, open to the base, apex 2-dentate. Flowers 4-5 per inflorescence,

up to c. 20 cm long. Calyx tubular, 2-2.3 x 0.5 cm, white, translucent, glabrous, apex

tri-dentate. Floral tube c. 10-15 cm long, c. 0.3—0.4 cm wide at the base, white, tinged

or striped pink, glabrous externally and internally, corolla lobes (dorsal and ventral)

oblong, c. 3.8-4 * 1.4 cm, creamy-white, glabrous, margins involute; androecial

tube cup-shaped, c. 10-12 mm long, c. 13 mm diam. at the top, white, glabrous

externally and internally. Labellum slhghtly saccate, elongate, 5-6 cm long, c. 4

cm wide (when flattened at the broadest point) white to creamy-white, throat centre

bright red, maculate with white showing through as dots, lip creamy-white, abaxial

surface with a few glandular hairs, margin undulate, wrinkled, apex entire; Jateral

staminodes obovate, 2.5 x 1.5 cm, creamy-white, abaxial surface with few glandular

hairs, apex rounded, revolute. Sramen 12 mm long, filament 3-4 mm long. 2-3 mm

wide at the base, white, glabrous, anther 8-9 mm long, 3 mm wide (first day) then c.

5 mm wide (thecae diverging on the second day) apex slightly bilobed with no anther

crest, thecae 9 x 1 mm, white, dehiscing along the entire length. Ovary c. 7 * 3 mm,

trilocular, axile placentation, white, glabrous; style filitorm, white, glabrous, stigma

elongate, white, ostiole vertically rectangular, without cilia, exuding a sticky liquid on

the second day; epigynous glands narrowly ovate, two, 8 mm long, white. Fruit not

seen. (Measurements based on living, cultivated material of M3074).

Distribution. A widespread species, found in Bangladesh, Burma, NE India, SW China

and Thailand.

Ecology. The type locality is in a disturbed area on the margin of a secondary, riverine

forest in very light shade at c. 200 m asl. The soil is a brown, gravelly alluvium. Recent

observations of this species in Eastern Assam and Eastern Thailand were in disturbed,

lowland forest with light shade. From limited observations, it seems to prefer flat

terrain with loose soils having high moisture holding capacity.

Phenology. Flowers from May to September with a two-day flowering cycle for each

flower.

80 Gard. Bull. Singapore 65(1) 2013

Etymology. Named in honour of Sir George King (1840-1909) a Scottish medical

doctor and botanist who worked in India starting in 1865 after graduation from

medical school. For a short time he was Superintendent of the Garden at Saharanpur

and Conservator of Forests in that area. From 1870-1897, he was the Superintendent

of Calcutta Botanic Gardens. During the same period he became the first Director,

Botanical Survey of India (Burkill 1965). His contributions to botany and science

are numerous and far-reaching. The specimen King 1020 (CAL) is the first known

collection of this new species.

Additional specimens examined. BANGLADESH. Chittagong Division. Kaptai Lake, 5 Sep

1999, Newman 980 (E; *); Chimbuk Hill, Bandarban Hill Tracts, 8 Sep 2000, Newman 990 (E;

*). BURMA. Sagaing Division. Katha Dist., Pile R.F., 20 Aug 1915, Rogers 997 (CAL; *);

Alaungdaw Kathapa National Park, 17 Jul 1997, Kress 97-5821 (US; *). Mandalay Division.

Maymyo Hills, Jun 1888, Khan 50 (CAL; *); Mt. Popa Park,17 May 1996, Kress 96-5646 (US;

*). Shan State. 45 miles east of Pyin-Oo-Lwin, 26 Jun 2003, Kress 03-7366 (US; *). CHINA.

Yunnan Province. Xishuangbanna Prefecture (cultivated at Xishuangbanna B.G.) 1 Jul 2009,

Mood 2002 (BISH; *); Culyun Village, 49 km SW of Simao, 12 Jul 2009, Kress 09-8664 (US;

*). INDIA. Sikkim. Teesta Valley, 22 Jul 1874, King 1020 (CAL; *);, Assam. Nambar Forest,

8 May, 1895, Reporter 11375 (ASSAM; *). THAILAND. Phetchabun Province. Nam Nao

vicinity, 14 May 2012, Mood & Varcharakorn 3272 (BISH; *).

Notes. The type selected here with a creamy white flower, dark red throat and white

apex is the most common form observed across the range and as depicted in King's

illustration (Fig. 14). Another form has also been observed with dark pink to light

violet colouring on the apex similar to the colours of B. hamiltonii. Based on limited

observations, this latter form seems to be less robust with shorter pseudostems and

smaller diameter rhizomes. The multi-stemmed habit of B. kingii (în both forms) is

the result of the rhizome morphology—running in habit with multiple growth nodes

similar to a stolon (Fig. 15F). These runners grow outward from the initial plant in

various directions, often producing a new pseudostem at a major node. The result

can be a large, clonal population such as at the type locality, where it encompasses

over 30 m? with hundreds of interconnected stems (Fig. 15C). In ex situ experiments

a planted piece of broken rhizome produced a new mass of running rhizomes with

several pseudostems after one year of growth. In this vein, a specimen from Burma,

C.G. Rogers 991 (CAL) is annotated, “Prevents the natural regeneration of Teak.” This

statement can now be understood with more clarity—B. kingii has the potential for

rapidly spreading once established in a suitable area.

Boesenbergia hamiltonii Mood, S.Dey & L.M.Prince, sp. nov.

Boesenbergiae longiflorae (Wall.) Kuntze affinis, floribus maioribus 3.5-4.5 cm

longis 2.3-2.8 cm latis, labello elongato minus saccato albissimo signis rubris roseis

violaceisque differt.

TYPUS: Dey NUS3, India, Meghalaya, Riboha District, Nongpoh, tropical, semi-

evergreen forest, steep hillside along highway, c. 350 m asl, 25*57.5'N 91*51.183'E,

July 2009 (holo CAL; iso ASSAM). (Fig. 2, 16, 18 & 19F)

Boesenbergia longiflora and related taxa Sl

Gastrochilus jenkinsii Wall. ex Voigt, Hort. Suburb. Calcutt.: 572 (1845), nom.

inval., sine descr. — Voucher: Jenkins s.n. (CAL) India, Assam, Gowahatti. Bangleum

sulphureum Ham., nom. nud. = Alpinia hamiltoniana Wall., Numer. List: 4% 6579.

1832, nom. nud. — Voucher: Hamilton Ao 1808 = Wallich 6579A, India, Gualpura, 30

May 1808 (K-W).

Gastrochilus longiflorus auct. non Wall.: Hooker in Curtis's Bot. Mag. 69: t. 4010

(1843) (hand-coloured plate by W. Fitch; “Long-flowered Gastrochilus”); in Hook.f.,

FI. Brit. India 6: 217 (1890) (= G. jenkinsii). — Voucher: Hooker in Curtis's Bot. Mag.

69: t. 4010 (1843).

Curcumorpha longiflora auct. non A.S.Rao & D.M.Verma: A.S.Rao & D.M.Verma,

Bull. Bot. Surv. India 13: 339 (1974) (“1971”) pro specim.

Deciduous herb up to | m tall; rhizome to c. 2.3 cm diam. externally yellow-brown,

internally yellow; many cylindrical, tuberous roots extending from the rhizome base,

c. 12 x 0.5 cm, externally pink, internally white, sometimes with a swollen apex. c.

1 cm diam., 2 cm long; fibrous roots c. 45-50 x 0.1 cm, yellow-white, with many

secondary root hairs. Pseudostem up to c. 30 cm long, composed of leaf sheaths, base

round to oval, c. 2.5 cm. diam., several leafless sheaths at the base, green, glabrous,

leaf sheaths 12-24 cm, longitudinally ridged, lower portion reddish, upper green,

glabrous. Leaves 3-6 per pseudostem; petiole 8-26 cm, deeply channelled, lhght

green, glabrous; ligule, slightly bilobed, lobes an extension of the hyaline margin,

2 mm long, green or white, glabrous; lamina elliptical, 34-44 x 15-19 cm, plicate,

ventrally dark green, glabrous, dorsally lighter green, glabrous with a few hairs on

the midrib, base rounded to cordate, apex acute. Inflorescence radical, c. 3-10 per

pseudostem, up to c. 19 cm long (including peduncle) produced from the rhizome

below the pseudostem, pedunele 5-9 x 0.8 cm, white, glabrous, basal sheaths 1-2, 3.5—

4.5 x 1-1.5 cm, white, glabrous; spike horn-shaped, 8-11 x 2 cm. Braczs cymbiform,

4-6, to c. 9 cm, distichously arranged, green and white, sometimes red, each bract

enclosing one flower, apex sometimes curved; bracteole cymbitorm c. 5-6 * 0.4

cm, white, translucent, glabrous, open to the base, apex 2-dentate. Flowers 4-6 per

inflorescence, up to c. 15 cm long. Calyx tubular, 2-2.4 x 0.5 cm, white, translucent,

glabrous, apex tri-dentate. Floral tube c. 9-12 cm long, 3-4 mm wide at the base,

white tinged with pink, glabrous externally and internally, corolla lobes (dorsal and

ventral) oblong, c. 4 x 1.2 cm, white, glabrous, margins involute; androecial tube cup-

shaped, c. 8-10 mm long, c. 12 mm diam. at the top, white, glabrous externally and

internally. Labellum slightly saccate, elongate, 5-5.5 cm long, 3.5-4 cm wide (when

flattened at the widest point) lip margins slightly crisped, crinkled, apex emarginate,

white, throat centre red, maculate with white showing thru as dots, colour broadening

toward the margins, ending c. 12 mm from apex, lip entirely pink to the apex, abaxial

surface with few glandular hairs; lateral staminodes obovate, 1.8 * 1.5 cm, white,

abaxial surface with few glandular hairs, apex rounded to slightly acute, margins

revolute in part. Stamen 12-14 mm long, filament 3 mm long, 3 mm wide at the base,

white, glabrous, anther 10-12 mm long, 3 mm wide (first day) then c. 8 mm wide

82 Gard. Bull. Singapore 65(1) 2013

Fig. 16. Boesenbergia hamiltonii Mood, S.Dey & L.M.Prince. A. First-day flower. B. First-day

flower. C. Mature plant. D. Rhizome and tuberous roots. All photos of Dey NU53. (Photos: J.

Mood)

Boesenbergia longiflora and related taxa 83

(thecae diverging on the second day) apex truncate to slightly bilobed with no anther

crest, thecae 10-12 x 1 mm, white, dehiscing along the entire length. Ovary c. 5 *

4 mm, trilocular, axile placentation, white, glabrous; szyle filiform, white, glabrous,

stioma €longate, ostiole vertically rectangular, without cilia, exuding a sticky liquid on

the second day; epigynous glands narrowly ovate, two, 5 mm long, tan-white. Fruit a

capsule, cylindrical, asymmetrical, 2 cm long, | cm wide, calyx and floral tube remain

partially intact, white, glabrous, surface smooth; seed globular, slightly flattened, apex

rounded, tan-yellow, aril sparse, white, translucent. (Measurements based on living,

wild material at the type location in India of Dey NU53).

Distribution. This taxon has been recorded primarily in Meghalaya and hill areas of

Assam. Its full range has not been determined.

Ecology. This species is normally found in sloped habitats where there is some shade,

good soil moisture and excellent drainage. Most plants are seen along roadside banks

on forest margins or more rarely in open forests. Observed elevations range up to 500

m asl, although Rao & Verma (1974) reported elevations up to 1850 m asl. The type

specimen was found growing under light shade in deep, black, well drained soil on the

margin of a disturbed secondary forest at 350 m asl. Associated plants were Shorea

robusta C.F.Gaertn., Tectona grandis L.f., Musa species, bamboo and understory

herbs.

Phenology. Flowers from May to September with a two-day flowering cycle for each

flower.

Etymology. Named for Francis Buchanan Hamilton (1762-1829) a Scottish surgeon

and botanist in the employ of the East India Company from 1794-1815. His botanical

research, collections, geographic documentation and statistical surveys provided a solid

foundation for future explorers and botanists in Northeast India, Burma and Nepal. He

served as Superintendent, Calcutta Botanical Gardens between 1814-1815. His two

specimens of Bangleum sulphureum from 1808 appear to be the first collections of this

new taxon.

Additional specimens examined: BANGLADESH: Sylhet Division. Laour, Jun 1830,

Gomez in Wallich 65798 (K-W; *). INDIA. Assam. Camrupa, 21 Jul 1808, Hamilton 12 (E;

*); Goalpara, Hamilton s.n. (Wallich 65794, K-W, CAL); no location, no date Jenkins s.n.

(ASSAM); Kamrup Dist., 13 Jun 1964, Rao 38791 (ASSAM; *); Darrang, Batasipur, 12 May

1947, Srinivasan 22411 (ASSAM);Tangla, 24 May 1958, Nath 13387 (ASSAM); Sibsagar,

Panbari, 15 Jun 1963, Deb 34846 (ASSAM). Meghalaya. Nongpoh, 31 Jun 1964, Joseph

37477 (ASSAM; *); Nowgong Dist., 18 Aug 1964, Ba/akrishnan 39222 (ASSAM); Nowgong

Dist., 31 Aug 1938, De 20327 (ASSAM); Nowgong Dist., 25 Aug 1964, Balakrishnan 39415

(ASSAM); Khasia Hills, J.D. Hooker s.n. (ASSAM. C:; *); Garo Hills, 6 Sep 1962, Deb 29216

(ASSAM); Khasia & Juanita Hills, 4 Jul 1938, De 20326 (ASSAM); Khasia & Juanita Hills, 8

Jun 1939, Deka 19668 (ASSAM); Khasia & Juanita Hills, 4 Jul 1940, Deka 202364 (ASSAM);

Khasia & Juanita Hills, 23 Jun 1941, De 27089 (ASSAM; *).

84 Gard. Bull. Singapore 65(1) 2013

Notes. This species is distinguished from B. kingii by the small, short rhizome with

long, vertical tuberous roots which usually produces only a single, robust pseudostem

(Fig. 16D). Indicative of this below-ground morphology, B. hamiltonii is easily

recognized in the field by the widely scattered, individual plants, occurring in a low-

density population of seeded individuals (Fig. 16C). In contrast, B. kingii occurs in

multi-stemmed, high-density populations of clonal and seeded individuals (Fig. 1SC, F).

Fig. I7A & B. Flowers. Left: Boesenbergia collinsii (M3035), Centre: B. kerrii (M2044);

Right: B. longi/lora (M11P48). (Photos: J]. Mood)

i

Boesenbergia longiflora and related taxa 85

The flower colour of B. hamiltonii is pure white with a red, maculate throat and a

pale pink lip apex. Colour variations between populations are primarily in degree of

pigmentation. When the labellum is dissected and flattened, it is very similar in shape

to B. kingii, but in living plants the full open, frontal shape is oval in the former and

truncate or rounded in the latter. As a historical note, after Hamilton collected his two

(Banglium) specimens in 1808, he used “su/phureum” (light yellow) as the specific

Fig. 18A & B. Flowers. Left: Boesenbergia maxwellii (MI1P124); Centre: B. kingii (M11P77)

Right: B. hamiltonii (M3209). (Photos: ]. Mood)

50 Gard. Bull. Singapore 65(1) 2013

epithet. Initially, this was a confusing issue, since no yellow flowered Boesenbergia

had been described from NE India. Later, this anomaly was understood after examining

the newly pressed flowers ofall of the specimens used in this study. No matter what the

original living flower colour, all turned a light yellow after drying. It appears Hamilton

based his species descriptor on the dried flower colour rather than on fresh flowers.

This yellow coloration can still be seen on Hamilton 12 (E).

Fig. 19. Stamens & labellum. A. Boesenbergia longiflora (MI1P48). B. B. kerrii (M2044).

C. B. collinsii (M3035). D. B. maxwellii (MI1P124). E. B. kingii (MI1P77). FE. B. hamiltonii

(M3209). (Photos: ]. Mood)

Boesenbergia longiflora and related taxa 87

Conclusions and further research

Our study fully supports Larsen's (1997) conclusion that Curcumorpha should

be reduced to Boesenbergia. This is based on the phylogenetic analyses showing the

B. longiflora clade nested within the larger Boesenbergia clade (Fig. 3). In further

support, three of the four characters Rao & Verma (1974) used to justify Curcumorpha

have been found to occur in other Boesenbergia species. Their fourth character, spiral

bract arrangement, was misinterpreted and bracts are in fact distichously inserted

in taxa throughout the B. /ongiflora clade. Some of their cited specimens are now

determined as B. hamiltonii.

Fig. 20. Geographical distribution of the Boesenbergia longiflora clade showing type localities.

B. collinsii (yellow), B. hamiltonii (light blue), B. kerrii (red), B. kingii (white), B. longiflora

(dark blue) and B. maxwellii (green). Each specimen mapped is noted by an asterisk following

the herbarium abbreviation under the “Additional specimens examined”. (Mapped in GOOGLE

earth, US Dept of State Geographer, 2013 Cnes/Spot image, 2013 Mapabc.com and 2013

Google).

Gard. Bull. Singapore 65(1) 2013

88

S)001 JBoUIeIp S1001

SnoI9qn) [eOII9A UI S'1—S:0 SnoI9qn) |eOIISA S7001 Sn012qn)

“3uo] :]]evus *SBUIOZIUI S1001 SNEIANI [POIIOA OU Aueuu [POIUIOA MO 89001 SN0I9qN7 [EONIOA BINPANUAIe

BUIOZIVI Suruun. Aueuu 3uo] ]]evus auoziyI “Ţ[eLUS BUWOZII S[|eUUS SUIOZIYI MOŢ ÎŢ|euus 9UIozIyI punorăepu

au 7-01 VIU 6-8 tuuu 0] VIU 6 VIU 6 VIU / Yăuo 19Wuv

unu 0-8 wi CI-OI wu 91-01 Wu 8 ULUI S— UIUI S—f Wysuo 2qny [elo30puy

UI9 CI-6 WI SI-O W9 plc UI | WI pl-cl Lo oX0)! Yyăua] 2qn] [e-0l4

US) Sp AG UO (ic Ul 0i gi 0 Si WOExTy-p WOTIxV-8£ WOCC-OTxST ICC (M x 1) tunyloqeT

Ae3uo[a “ayeooes Ae3uo[e Ae3uo[2 “oyeooes

Apus “oyeoodes APUSI[S Apus 2jeooes AJeo9es IOV “AJPODES AIOA adeys vunjogqe]

xode 0]

SUONLUIQUIOO ud pue uroed poxeos

Surd twuopiun XUId XIep 10 ANM V9ŢOIA 10 Xurd “pai “POI XIEP UUM par XIep “eoay) xade 07

ULM JPOIU) Pal ULM “YeOI) pal ULM JPOIU) 9UPI0 JeOIU) pal par-o3uelo — 3uruapeo1q POI) pol 1N0[09 uloned vunjoqe]

MOIJoA

"31 Surose

“ANIM AUIa19 MOJJRA Auueao MOJJRĂ

ANUM 10 arm ond arm oand 10 XIep U51] MOŢ2A 1931] tunIpouu 1N0[09 19MOŢAI

(11) 6-s -€ LS LA se €-T 99205810! 19d SI9M0ȚA

MU0]IUDU nu 'g 1]J2AXbU "9 11SU1]J02 'g 11442) 'g9 D40p/18U0] 'g J9PeIey)

“(un[oqe[ pue yusure[

“SopoOuruIeIs JO AXU93IBAIP JO JUl0d) xode 2qQny [EIOB01pue 0) S9q0[ 20109 30 aseq = W3uo] 2qny Ţeroaoapue 5990] 2]10109 Jo aseq 07 AreAo go xade =

U3u2| 99n [EIOA "[ELIOeUUI BULAI UIOI; PBALISP 91 SusuoInstoul [|V '9pep2 D10Jfi3u0] 'd IV WI04y Sa00ds p15/0q42520g XIS JO uosIeduIo) "1 AAAeL

Boesenbergia longiflora and related taxa 89

Taxa in the B. /ongiflora clade can generally be distinguished from other

Boesenbergia by a combination of characters: robust plants with few leaves, radical

inflorescences with distichous bracts and large, two-day flowers. Their annual life

cyele begins as seed, rhizome-like bulbs (B. kerrii, B. longiflora) pieces of running

rhizome (B. kingii) or mature rhizomes from the previous year. Growth begins in April

or later, coinciding with the monsoon rains and continues through October when the

weather becomes cooler and dry. All species are dormant for about five months. Plants

of B. maxwellii grown in a difterent climate (Hawaii) with rainfall throughout the

dormancy period still tollow their monsoonal cycle even after 20 years of cultivation

(Mood, pers. obs.).

Running rhizomes are found on all current B. kingii collections, including

the putative hybrids. This character, at least in part, might account for its very wide

distribution, whereas the other five species which propagate primarily through seed

dispersal have a much smaller range.

Specimens or pictures identified as B. longiflora in publications prior to this

study should be re-determined. For instance, the plants studied by Gao et al. (2004)

are not B. longiflora, but appear to represent B. kingii. Similarly, in Larsen & Larsen

(2006), the Boesenbergia pictured on page 32 is B. maxwellii, while the yellow-

flowered taxon on page 48 appears to be B. co/linsii.

Long-term observation of cultivated gingers combined with field visits to

document ecology, geology, distribution, pollination biology and other elements has

shown to be an excellent strategy for the study of Boesenbergia. The daily observation

of multiple collections of various taxa from initial growth to dormancy provided

insight well beyond that of field observations alone.

The current study represents a small segment of an on-going research project

whose goal is to improve the overall knowledge of Boesenbergia by re-examining

nomenclature, improving descriptions, analysing genetic relationships and providing

phytochemical profiles. Additionally, further investigation of the B. longiflora clade

continues to include karyotyping, phenology, biogeography and conservation status.

ACKNOWLEDGEMENTS. We would like to thank W. John Kress, Mike Bordelon, Lopez,

Ingrid Pol-Yin Lin (US), Mark Newman (E) for assisting with specimens, plant photography

and collection data. Latin text was translated by Philip H. Oswald (Cambridge, U.K.). We

thank Henry Noltie and Helen Yeats (E), Malcolm Beasley (BM), Penny Brook (British

Library, UK), Gina Douglas (LINN), Louise B. Johansen (Denmark), Gitte Petersen (C),

Finn Borchsenius and Olof Ryding (AAU), Nicholas Hind, Marcelo Sellaro, Lynn Parker,

Tim Utteridge, Martin Xanthos, Katherine Challis (K) and Axel Poulsen (Oslo BG, Norway)

for helpful discussion and assistance in preparatory research. Special thanks to Jana Leong-

Skornitkovâ (SING), Peter Boyce (USM, Malaysia), Pieter Pelser (UC, NZ) David Gang

(WSU, USA), Ida Theilade (UC, Denmark) and Bob Faden (US) for manuscript assistance.

Special acknowledgement to colleagues in Thailand: Poonsak Vatcharakorn, Pramote Triboun

(BK) Yingyong Paisooksantivatana (KU), Piya Charlermglin (TISTR) and the staff at BK

and BKF. In India, special thanks to Shri Jairam Ramesh, Minister of Rural Development;

Jatrinda Sarma, Assam Forestry Dept.; Paramjit Singh, Director of Botanical Survey of India,

90 Gard. Bull. Singapore 65(1) 2013

P. Lakshminarasimhan, B.K. Singh, R. Kumar; and Moaakum (Kohima Science College). The

second author also thanks Rancho Santa Ana Botanic Garden for generously providing several

years of financial support and The Field Museum of Natural History for current and on-going

access to collections and facilities. Permissions for reprinting Figs. | and 2 were kindly granted

by the Board of Trustees of the Royal Botanic Gardens Kew; for Fig. 14, by the Director,

Botanical Survey of India, Kolkata, India. The original watercolours of B. co/linsii, B. kerrii

and B. maxwellii were accomplished in a historical style by Linda Ann Vorobik (UCB, USA).

Colour plates were created by Tiffany D. Shafto (Hawaii, USA).

References

Ainouche, M.L., Baumel, A., Salmon, A. & Yannic, G. (2004) Hybridisation, polyploidy and

speciation in Spartina (Poaceae). New Phytol. 161: 165-172.

Akaike, H. (1974) A new look at the statistical model identification. IEEE 7. Automat. Cont

19: 716-723.

Alvarez, |. & Wendel, J.F. (2003) ITS sequences and plant phylogenetic inference. Molec.

Phylogenet. Evol. 29: 417-434.

Baker, J.G. (1890) Scitamineae. In: J.D. Hooker (ed.), Zhe Flora of British India. Vol. 6. Pp.

217-218. London: Reeve & Co.

Beilstein, M.A., Al-Shehbaz, I.A., Mathews, S. & Kellogg, E.A. (2008) Brassicaceae phylogeny

inferred from phytochrome A and ndh/' sequence data: tribes and trichomes revisited.

Amer J. Bot. 95: 1307-1327.

Burkill, I.H. (1965) Chaptrers on the History of Botany in India. Pp. 168-173. Calcutta: Bombay

Natural History Society & Botanical Survey India.

Cunningham, C.W. (1997) Can three incongruence tests predict when data should be combined?

Molec. Biol. Evol. 14: 733-740.

Don, D. (1825) Prodromus Florae Nepalensis. P. 32. London: Gale.

Fan, L.N. (2004) Phylogenetic Relationship Based on Flavonoids and ITS Regions Studies

on Selected Boesenbergia Species in Sabah. Unpublished thesis, University Malaysia

Sabah, Kota Kinabalu, Sabah.

Farris, J.S., Kallersjo, M., Kluge, A.G. & Bult, C. (1995) Testing significance of incongruence.

Cladistics 10: 315-319.

Fazekas, A.]., Steeves, R. & Newmaster, S.G. (2010) Improving sequencing quality from PCR

products containing long mononucleotide repeats. Bio Techniques 48: 277-285.

Feliner, G.N., Aguilar, J.F. & Rosell6, J.A. (2001) Can extensive reticulation and concerted

evolution result in a cladistically structured data set? C/adistics 17: 301-312.

Fitch, W.M. (1971) Toward defining the course of evolution: Minimum change for a specific

tree topology. Ss. Zool. 20: 406-416.

Fuertes Aguilar, ]., Rossell6, J.A. & Feliner, G.N. (1999) Nuclear ribosomal DNA (nrDNA)

concerted evolution in natural and artificial hybrids of Armeria (Plumbaginaceae)

Molec. Ecol. 8: 1341-1346.

Gao, ].Y., Zhang, L., Deng, X.B., Ren, P.Y., Kong, J].]. & Li, Q.J]. (2004) The floral biology of

Curcumorpha longiflora (Zingiberaceae): A ginger with two-day flowers. Amer J. Bor.

91: 289-293.

Gao, J.Y., Xia, Y.M., Huang, ].Y. & Li, Q.J. (2005) An Introduction to Chinese Ginger Plants.

Beijing: Science Press.

Boesenbergia longiflora and related taxa 9]

GenBank NIH genetic sequence database (2011) Nucleic Acids Research, 2011 Jan; 39 (Database

issue): D32-7. http://www.ncbi.nlm.nih.gov/genbank/ (accessed 26 Nov. 2012).

Guindon, S. & Gascuel, O. (2003) A simple, fast, and accurate algorithm to estimate large

phylogenies by maximum likelihood. Sysz. Bio. 52: 696-704.

Holttum, R.E. (1950) The Zingiberaceae of the Malay Peninsula. Gard. Bull. Singapore 13(1):

106-117.

Hooker, W.J. (1842) Gasrrochilus pulcherrima. Handsome-flowered Gastrochilus. Curtis 5

Bor. Mag. 68: Tab. 3930.

Hooker, W.J. (1843) Gastrochilus longiflora. Long-flowered Gastrochilus. Curtis s Bot. Mag.

69: Tab. 4010.

Joly, S., MeLenachan, P.A. & Lockhart, P.J. (2009) A statistical approach for distinguishing

hybridisation and incomplete lineage sorting. Amer. Naturalist 174: E54-E70.

Kress, W.J., Prince, L.M. & Williams, K.J. (2002) The phylogeny and a new classification of the

gingers (Zingiberaceae): Evidence from molecular data. Amer: J. Bor. 89: 1682-1696.

Kress, W.J., Mood, J.D., Mamiyil, S., Prince, L.M., Dey, S. & Sanoj, E. (2010) Larsenianthus,

a new Asian genus of gingers (Zingiberaceae) with four species. Phyrokeys 1: 15-32.

Kuntze, O. (1891) Revisio Generum Plantarum 2: 685. Leipzig: Felix.

Larsen, K. (1997) Further studies in the genus Boesenbergia (Zingiberaceae). Nord. J. Bor. 17:

361-366.

Larsen, K. & Larsen, S. (2006) Gingers of Thailand. Chiang Mai: Queen Sirikit Botanic

Garden.

Leong-Skornickovă, ].. Ly, N.-S., Poulsen, A.D., Tosh, J. & Forrest, A. (2011) Newmania: A

new ginger genus from central Vietnam. Taxon 60: 1386-1396.

Liu, S.C., Lu, C.T. & Wang, J.C. (2009) Reticulate hybridisation of Al/pinia (Zingiberaceae) in

Taiwan. J. Pl. Res. 122: 305-316.

Miller, M.A., Pfeiffer, W. & Schwartz, T. (2010) Creating the CIPRES Science Gateway

for inference of large phylogenetic trees. In: Proceedings of the Gateway Computing

Environments Workshop (GCE). New Orleans, Louisiana: IEEE.

Mrăz, P., Chrtek, J. & Fehrer, ]. (2011) Interspecific hybridisation in the genus Hieracium s.

str.: Evidence for bidirectional gene flow and spontaneous allopolyploidisation. P/. Sysr.

Evol. 293: 237-245.

Ngamriabsakul, C. & Techaprasan, J. (2006) The phylogeny of Thai Boesenbergia

(Zingiberaceae) based on perA-psbJ spacer (chloroplast DNA). J. Biochem. Mol. Biol.

39: 361-370.

Posada, D. (2008) jModelTest: Phylogenetic model averaging. Molec. Biol. Evol. 25: 1253-—

1256.

Prince, L.M. (2010) Phylogenetic relationships and species delimitation in Canna (Cannaceae)

In: Seberg, O.. Petersen, G., Barfod, A.S. & Davis, ].I. (eds) Diversity, Phylogeny, and

Evolution in the Monocotryledons. Pp. 307-331. Aarhus: Aarhus University Press.

Prince, L.M. & Kress, W.J. (2006) Phylogenetic relationships and classification in Marantaceae:

Insights from DNA sequence data. Zaxon 55: 281-296.

Rambaut, A. (1996) Se-Al (v2.0all) Seguence Alignment Editor. http://tree.bio.ed.ac.uk/

software/seal/ (accessed 26 Nov. 2012).

Rao, A.S. & Verma, D.M. (1974) Curcumorpha—a new genus of Zingiberaceae. Bull. Bor.

Surv. India 13: 339-341.

Ridley, H.N. (1924) The Flora of the Malay Peninsula 4: 246-252. London: Reeve & Co.

Ronquist, F. & Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian phylogenetic inference under

mixed models. Bioinformatics 19: 1572-1574.

92 Gard. Bull. Singapore 65(1) 2013

Sakai, S. & Nagamasu, H. (2006) Notes on inflorescence structure of Boesenbergia

(Zingiberaceae). Acta Phytotax. Geobor. 57: 107-111.

Schlechter, R. (1913) Die Gattungen Gastrochilus Don. und Gastrochilus Wall. Feddes Reper.

Spec. Nov. Regni Veg. 12: 315-317.

Schumann, K. (1904) Zingiberaceae. In: Engler, A. & Prantl, K. (ed) Das P/lanzenreich IV, 46,

Heft 20: 91-95. Leipzig: Engelmann.

Schwarz, G.E. (1978) Estimating the dimension of a model. Ann. Star. 6(2): 461-464.

Smith, R.M. (1981) Zingiberaceae Synoptic Key, Royal Botanic Garden Edinburgh. (RBGE

distribution, unpublished).

Struck, T.H. (2007) Data congruence, paedomorphosis and salamanders. Front. Zool. 4:

22.Swoftord, D.L. (2002) PAUP*: Phylogenetic Analysis Using Parsimony (*and other

methods), vers. 4.0b10., Sunderland, Massachusetts, USA: Sinauer Associates, Inc.

Techaprasan, J]., Ngamriabsakul, C., Klinbunga, S., Chusacultanachai, S., & Jenjittikul, T.

(2006) Genetic variation and species identification of Thai Boesenbergia (Zingiberaceae)

analyzed by chloroplast DNA polymorphism. J. Biochem. Mol. Biol. 39: 361-370.

Valeton, T. (1918) New notes on the Zingiberaceae of Java and Malaya. Bu//. Jard. Bor.

Buitenzorg, Ser. 2, 27: 81-105.

Vanijajiva, O., Suvachittanont, W. & Sirirugsa, P. (2003) Isozyme analysis of relationships

among Boesenbergia (Zingiberaceae) and related genera in Southern Thailand. Biochem.

Syst. Ecol. 31: 499-511.

Vamijajiva, O., Suvachittanont, W. & Sirirugsa, P. (2005) Isozyme analysis of relationships

among Boesenbergia (Zingiberaceae) and related genera by RAPD. Biochem. Syst.

Ecol. 33: 158-170.

Voigt, J]. (1845) Hortus Suburbanus Calcuttensis. Pp. 571-572. Calcutta: Bishop's College

Press.

Wallich, N. (1829) P/antae Asiaticae Rariores 1: 22-23. London: Treuttel & Wiirz.

Wallich, N. (1832) A Numerical List of Dried Specimens (“Catalogue "). London: Wallich.

Wallich, N. (1840) Inventory of 51 spp. of Live Planrs Sent to kew Gardens. Kew: Wallich

collection (unpublished).

Winterfeld, G., Schneider, ]. & Râser, M. (2009) Allopolypioid origin of Mediterranean

species in Helictotrichon (Poaceae) and its consequences for karyotype repatterning and

homogenization of rDNA repeat units. Syst. Biodivers. 7: 277-295.

Wu, T.L. & Larsen, K. (2000) Zingiberaceae. In: Raven, P. & Wu, T.L. (eds) Flora of China 24:

367-368. St. Louis: Missouri Botanical Garden Press; Beijing: Science Press.

Ying, B., Wendel, J.F. & Song, G. (2010) Multiple patterns of rDNA evolution following

polyploidy in Oryza. Molec. Phylogen. Evol. 55: 136-142.

Zâveskâ, E., Fer, T., Sida, O., Leong-Skornitkovă, ]., Sabu, M. & Marhold, K. (2011) Genetic

diversity patterns in Curcuma reflect differences in genome size. Bot. J.Linn. Soc., 165:

388-401.

Appendix A. Botanical history of Boesenbergia longiflora.

1808: Hamilton collected two ginger specimens in Assam, India which he labelled Bang/eum

sulphureum |Hamilton 12 (E) and Hamilton s.n. (Wallich 6579A, K-W, IDC microfiche

7394)].

Boesenbergia longiflora and related taxa 93

1825:

1829:

1832:

1840:

1842:

1843:

1845:

1874:

1890:

1891:

1904:

1913:

1918:

1924:

1950:

D. Don published Gastrochilus D.Don (Orchidaceae).

Wallich published Gastrochilus Wall. (Zingiberaceae) with two species, G. pulcherrima

Wall. (Wallich 6588, IDC microfiche 7394) and G. /ongiflora (Wallich 6589A, IDC

microfiche 7394). The detailed descriptions were accompanied by watercolour

illustrations.

Wallich re-determined Bangleum sulphureum (Hamilton s.n... K-W, IDC microfiche

7394) to Alpinia hamiltoniana Wall. nom. nud. and identified Wallich 240 (K-W, IDC

microfiche 7394) from Bengal as the same species, grouping them under Wallich 6579,

A and B, consecutively.

Wallich dispatched 51 species of living plants from the Calcutta Botanical Gardens

to the Kew Gardens. On the inventory (Wa/lich 1840) the last two items listed are G.

pulcherrima and G. jenkinsii Wall. nom. nud.

Hooker published, “Gasrrochilus pulcherrima. Handsome-flowered Gastrochilus” in

Curtis's Botanical Magazine (t. 3930).

Hooker published “Gastrochilus longiflora. Long-flowered Gasrrochilus” in Curtis's

Botanical Magazine (t. 4010). The description was accompanied by a hand-coloured

plate prepared by William Hood Fitch (Fig. 2). Hooker mentioned that both G.

pulcherrima and this species came to Kew Gardens as living plants from Wallich at the

Calcutta Botanical Gardens.

Voigt, documenting the plants at the Calcutta Botanical Gardens described the G.

longiflora flower as “largish, pale-yellowish, with a rose-coloured lip” and mentioned

that G. jenkinsii is from “Assam and the hills about Gowhatti. Flowered in July 1838.”

Note: This places G. jenkinsii in cultivation at the Calcutta Botanical Gardens Just prior

to Wallich's 1840 dispatch of plants to Kew Gardens.

King collected King 1020 (CAL) in “Sikkim Himalaya.” Accompanying the specimen

are two watercolour illustrations by Edward King, annotated as G. /ongiflora.

Baker listed and briefiy described six Gasrrochilus species and three “Imperfectly

known and undescribed species.” He revised part of Wallich's original description of

G. longiflora stating “staminodes white rather longer than the white corolla-segments

lip tinged with red.” He also mentioned, “The Bot. Mag. plant is G. jenhinsii, Wall.

mss. and has larger flowers than that figured by Wallich, of a purer white, the lip tipped

with bright red.” He broadly expanded the distributional range after annotating other

specimens as G. longiflora.

Kuntze observed that Gastrochilus D. Don had priority over Gasrrochilus Wall. and

proposed Boesenbergia Kuntze for the later homonym.

Schumann listed six known and three imperfectly known Gastrochilus species,

describing G. longiflora as white flowered. Note: Schumann's Fig. 13 is wrongly

labelled “Gastrochilus longiflorum”. It is an exact copy of G. pulcherrima, t. 3930

(Hooker 1842).

Schlechter accepted Boesenbergia Kuntze, listing 23 taxa.

Valeton reviewed 17 Indonesian Gastrochilus species, commenting on the close affinity

of G. angustifolia Hallier f. (Sumatra) to G. longiflora.

Ridley listed 24 Gasrrochilus species for the Malay Peninsula, noting G. longiflora only

as a cultivated plant in Penang Gardens.

Holttum provided an account of Boesenbergia tor the Malay Peninsula, selecting B.

pulcherrima as the type. He commented that the illustration, t. 4010 in Curtis's Botanical

Magazine (Hooker 1843) “does not agree very well with Wallich's” and questioned

94 Gard. Bull. Singapore 65(1) 2013

whether B. /ongiflora actually belongs to Boesenbergia or “may have to be transferred to

another genus.”

1974: Rao & Verma published Curcumorpha A.S.Rao & D.M.Verma with a single species, C.

longiflora (Wall.) A.S.Rao & D.M.Verma and cited 20 white-flowered specimens that

reportedly diftered from Boesenbergia by having stems spurious [a false stem] spikes

radical, bracts spiral and a staminodial cup.

1981: Smith supported Rao & Verma's taxonomic distinction of B. longi/lora as Curcumorpha

based on the four characters.

1997: Larsen questioned the necessity of Curcumorpha, suggesting that the characters

mentioned by Rao & Verma were not sufficiently different from other Boesenbergia

species and recommended that C. /ongiflora be maintained in Boesenbergia.

2002: Kress et al. commented on the phylogeny of Boesenbergia suggesting that Boesenbergia

might be polyphyletic with B. pu/cherrima alled to Curcumorpha.

2004: Gao et al. studied the floral biology of C. /ongiflora finding a two-day flowering cyele

for the species.

2006: Sakai & Nagamasu found that a living specimen identified as B. longi/lora (Tanaka er

al. 023015, TI) had an inflorescence with a distichous bract arrangement.

2003-2006: Other references to B. /ongiflora or C. longiflora include: Vanijajiva et al. 2003,

2005; Fan 2004; Techaprasan et al. 2006; and Ngamriabsakul & Techaprasan 2006.

Appendix B. GenBank accession numbers (ITS/trnk) for Boesenbergia spp. (Zingiberaceae)

used in this study. Sample number (voucher number, herbarium) GenBank numbers. Note:

c=clone.

Boesenbergia collinsii Mood & L.M.Prince: MO6PI4 (Mood 12P/7/, holotype, BK)

JX992751/]X992812; MP1455 (Mood & Pedersen 1455, C) JX992752/]X992813; M2010

(Mood & Triboun 2010, BISH) ]JX992749/]X992810; M2011 (Mood & Triboun 2011, BISH)

JX992750/]X992811; M3035 (Mood & MeMakin 3035, BISH) JX992753/J]X9928 14.

Boesenbergia hamiltonii Mood, S.Dey & L.M.Prince: M3017 (Dey NUS53, holotype, CAL)

JX992754/]X992815; M3026 (Mood 12P177, BISH) JX992755/1X992816; M3212 (Mood

12P1785, BISH) ]X992794/no data.

Boesenbergia kerrii Mood, L.M.Prince & Triboun: M2044 (Mood & 7riboun 12P170,

holotype, BK) JX992756/JX992817; M2049 (Mood & Chalermglin 2049, BISH) ]JX992757/

JX992818; M2058 (Mood 2055, BISH) ]JX992758/]X992819; M3009 (Mood & Triboun 3009,

BISH) JX992759/]X992820.

Boesenbergia kingii Mood & L.M.Prince: M3074 (Mood & Vatcharakom 12P173, holotype,

BK) c2-JX992789, c3-JX992790, c4-J]X992791, cJ]X992792, c8- JX992793/ JX992829;

MOSP161 (live material of Aress 03-7366, US) JX992760/J]X992821; MI11P47 (live material

of Kress 96-5646, US) cl- JX992761, Ce- JX992762, c3- JX992763, c4- JX992764, c5-

JX992765, c6-JX992766/ ]X992822; M2002 (Mood 2002, BISH) c1-JX992769, c2-J]X992770,

c3-JX992771/J]X992825; M3015 (Mood 12P174, BISH) c1-J]X992772, c2-JX992773, c3-

JX992774, c4-JX992775, c-JX992776, c12-J]X992777, c13-JX992778/JX992826; M3019

(Mood 12P175, B1ISH)c1-J]X992779,c3-JX992780,c6-JX992781,c8-J]X992782,c9-]X992783,

c10-JX992784/]X992827; M3020 (Mood 12P176, BISH) c7-JX992785, c8-J]X992786, c9-

JX992787, c12-JX992788/JX992828; M3272 (Mood & Vatcharakom 3272, BISH) JX992795/

JX992830; MI11P77 (live material of Newman 980, E) JX992767/1X992823; MI1P78 (live

Boesenbergia longiflora and related taxa 95

material of Newman 990, E) ]JX992768/]X992824; K97-5821 (Kress 97-5821,US) AF478742/

AF478842.

Boesenbergia longiflora (Wall.) Kuntze: M11P48 (live material of KXress 03-7305, US). cl-

JX992796, c5-J]X992797, c6-]X992798/ JX9928311.

Boesenbergia maxwellii Mood, L.M.Prince & Triboun: M2032 (Mood & Triboun 12P172,

holotype, BK) JX992800, JX992833; MP1450 (Mood & Pedersen 1450, C) JX992802

JX992802; M2017 (Mood & Triboun 2017, BISH) JX992799/]X992832; M2040 (Mood

& Triboun 2040, BISH) JX992801/]X992834; MI11P26 (Mood 11P26, BISH) JX992803

JX992835; M11P124 (Mood 11P124, BISH) JX992804/JX992836; MI1C132 (Funakoshi s.n.,

MBK) JX992805/JX992837; MI1C133 (Funakoshi s.n., MBK) JX992806/]X992838.

Boesenbergia plicata var. lurida (Ridl.) Holttum: M3120 (Mood & Varcharakom 3120,

BISH) JX992808/JX992839.

Boesenbergia plicata var. plicata (Ridl.) Holttum: M3177 (Mood & Vatcharakorn 3177,

BISH) ]JX992807/]X992840.

Boesenbergia pulcherrima (Wall.) Kuntze: MO05P276 (Mood 08P276, BISH) J]X992748/

JX992809; K98-6220 (Kress 98-6220, US) AF478725/AF478825.

[imi ei ie A .

Po zi aa! D ne d

lasa ti piete Lai

Ai! Ama 0lits Si Mimi pin lui că i

"coama

inere otet AUR „Vi m: A

orga a a MIRA tă SAUNA

ai TA eat CI 4 Met at

As, > ovale Aettăă i

vla ko Ec i e

PP

yet

DS Yi! 9 .

14 DEN Să A soi ——. >

E ET i sii per al Ea FE au

pat e oua bestia le Aucaie ADS

AN Na) ai Li Pe parent dd [3 VA Dă 9

nt MIN TUIA pace

ps mie e Wa mt ÎN

E e

EX [] A 4

Aztec UTP Oi

..: ş aj, îi atit

sii Wass |

1410 AAA A

Nr JXOL fl

$ 4

ED se pia +

40% PAID E L

| Li păi

sed aid eee

Ă pu pi D A ia i E:

ta, Lai Pip h

EM LEE + d P'-9P pi

DD ELF. 84),

E i -,

1-2 pata ASPIRA 4%

3 4/7 "ra 1 1%

Gardens” Bulletin Singapore 65(1): 97-100. 2013 97

Valid publication of Boesenbergia aurantiaca

(Zingiberaceae)

Mark F. Newman

Royal Botanic Garden Edinburgh,

20A Inverleith Row,

Edinburgh EH3 SLR, Scotland

m.newman(4rbge.ac.uk

ABSTRACT. The reason why Boesenbergia aurantiaca was invalidly published is given and

the name is validated here.

Keywords. Borneo, Danum Valley, gingers, Sabah, type specimen

Introduction

In 1985, during construction of the Danum Valley Field Centre in Sabah, G.C.G. Argent

and J.A. Ratter of the Royal Botanic Garden Edinburgh visited the area and made

collections of herbarium specimens and living material for cultivation in Edinburgh.

Among the living collections were two Zingiberaceae which were registered in the

RBGE Garden Accessions book for 1985 on 15* May, when they were given accession

numbers 19850843 and 19850847. The Garden Accessions book records that this was

plant material collected by Argent and Ratter during March 1985. Accession number

19850843 is still growing in Edinburgh while 19850847 is assumed to have died.

Among the dried herbarium specimens, which were collected under the Sandakan

herbarium collection number series, was Argent, Ratter, Leopold, Dongop & Kumin

SAN 108235, collected on 25 February 1985.

Boesenbergia aurantiaca R.M.Sm. was one of a number of new species

published by R.M. Smith in her review of the Zingiberaceae of Borneo (Smith 1987).

It appeared in the Notes from the Royal Botanic Garden Edinburgh 44(2): 226 (1987),

and was diagnosed and described in Latin. The type collection is cited as follows,

“Type: Sabah, Danum Valley, 100-250 m, mixed dipterocarp forest, in deep shade, iv

1985, Argent & Ratter San 108235, cult. RBG Edinb., viui 1985 (holo. E).”

In the herbarium at E, there are two herbarium sheets and a spirit collection

which are relevant to the protologue of Boesenbergia aurantiaca. Argent et al. SAN

108235 consists ofa leafy shoot with an inflorescence and, in a capsule attached to the

sheet, a fragment of leaf. The label shows differences in the collectors” names, the date

of collection, and the altitude from those cited in the protologue. This sheet bears the

barcode number e00389050. There is a duplicate of this collection at SAN.

The other sheet consists of a leafy shoot with an inflorescence and a flower, and

bears the barcode number e00149734. The collector is not recorded but is likely to have

98 Gard. Bull. Singapore 65(1) 2013

been R.M. Smith. There is no collection number but there is a reference to the living

accession from which it was made, 19850847. In the capsule attached to the sheet are a

smaller capsule marked, “Boesenbergia (Danum Valley plant)”, which contains dried,

dissected parts of a flower, and a sheet of card with two flower dissections glued to

it. The dissection at the left is marked, “wild coll.” while that on the right is marked,

“cult. plant”; the bottom of the card is marked, “Argent & Ratter SAN 108235”. This

sheet is a mixed collection consisting of parts from the living collection at RBGE and

a part from the wild collection Argent er al. SAN 108233.

The label on this sheet records the following:

Observations in cultivation

Orange flowers. Cultivated plant has corolla tube c.4 cm long; wild collection

shows tubes of up to 7 cm. Leaves dark green with a yellowish “cloud”.

Details of original collection

Sabah, Danum Valley, 100-250 m, mixed dipterocarp forest in deep shade, April

1985, Argent & Ratter San 105235 (material in spirit coll.)

RBGE No. 850847.

RBGE number 850847 is the accession number, now always given in full as 19850847.

The database ofthe living collection at E records this accession as having been collected

by G.Argent & J.Ratter s.n., 15 March 1985 but, as stated in the introduction above,

the Garden Accessions book gave the date simply as March 1985. When the Garden

Accessions books were digitised, the database may have created the date 1Sth March

1985 automatically (R. Cubey pers. comm.). Argent's field book indicates that he and

Ratter were already in the Danum Valley on 25 February and stayed there until 14

March 1985 (G.C.G. Argent pers. comm.) so Smith's record of the original collecting

date as April 1985 on the holotype is a mistake. Living accession 19850847 was alive

in 1992 but could not be located in November 1998 and has not been seen since; it is

assumed dead.

The spirit material is stored in a 500 ml jar with barcode number e0038900$5. It

is important to know whether this material was collected in the Danum Valley, along

with the wild collected herbarium material, or from one of the living accessions at the

Royal Botanic Garden Edinburgh. The fact that the spirit bottle contains an original

collecting tag from the Sandakan herbarium indicates clearly that the spirit material

was collected in the wild (G.C.G. Argent pers. comm.) The herbarium sheet and the

spirit material are not labelled as being parts of one specimen, however, so they must

be treated as duplicates (McNeill et al. 2006, Art. 8.3).

Smith (1987) regarded the cultivated specimen collected in August 1985 as

the holotype, indicated by the word “holotype” in red crayon in Smith's hand on the

sheet. As this sheet is a mixed collection, with parts from two gatherings, however, the

name Boesenbergia aurantiaca was not validly published. The evidence available now

indicates that Smith based her description mainly on the plant cultivated at Edinburgh,

with supplementary notes from the spirit collection, Argenr & Ratter SAN 108235

(E). There is no evidence one way or the other that she studied the herbarium sheet of

Argent & Ratter SAN 108235 (E). Thus, the name can be validly published here, as

follows:

Boesenbergia aurantiaca, valid publication 99

Boesenbergia aurantiaca R.M.Sm., sp. nov. floribus aurantiacis et habitu caespitoso

B. ornatae similis sed foliis fusco-viridibus et pallide luteo-viridibus et ligula multo

breviore distincta. R.M. Smith (in Notes Roy. Bot. Gard. Edinburgh 44: 226-227, t.

4. 1987).

TYPUS: Anon. (R.M. Smith?) s.n., barcode no. e00149734, excluding dissected flower

of Argent, Ratter, Leopold, Dongop & Kumin SAN 105235 in capsule, RBGE living

collection, Aug 1985, taken from a living plant originally collected in Malaysia, Sabah,

Lahad Datu District, Ulu Sg. Segama, Danum Valley Research Centre and grown at

RBGE under accession number 19850847 (holo E).

Erect herb. Leafy shoots cespitose, leaves 4-5. Leaves with petioles 2-8 cm long;

lamina 5—12 x 3-5 cm, elliptic, apex shortly acuminate, glabrous, tawny green,

brightly greenish yellowish variegated along the midrib; ligule 3-5 mm long, bilobed;

sheaths glabrous. Inflorescence terminal on the leafy shoot, more or less sessile, many-

flowered; bracts distichous, to 5 x 0.5 cm, cymbiform, glabrous, single-flowered;

bracteoles smaller than the bracts; flowers orange; calyx 5-6 mm long, 2-—3-lobed;

corolla tube to 7 cm long (shorter in cultivated plants), lobes 1.5-1.8 cm long, the

dorsal one broader; labellum c. 2 * 2 cm, saccate, more or less entire; lateral staminodes

1.3—1.5 x 0.4—0.6 cm, spathulate. Stamen to 1.5 cm long; filament c. | cm long; anther

thecae c. 0.5 cm, parallel, dehiscing by slits, connective prolonged into a | mm long

crest; style glabrous; stigma glabrous. Epigynous glands 2-3 mm long, linear. Ovary

2-3 mm, trilocular with axile placentation. Capsule unknown.

Other specimens seen: MALAY SIA. Sabah. Lahad Datu District, Ulu Sg. Segama, Danum

Valley Research Centre, 25 Feb 1985, Argent, Ratter, Leopold, Dongop & Kumin SAN 108235

(E, including spirit collection, SAN); ibid., East trail E1, damp dipterocarp forest, 13 Oct 1985,

Still SAN 112115 (E).

Ecology. Deep shade in lowland mixed dipterocarp forest, at 100-400 m alt.

Notes: Two herbarium specimens have been made from the surviving RBGE living

accession, number 19850843, namely Neamriabsakul 29 (E) and Newman &

Skornickovă 1471 (E). Images of all Zingiberaceae specimens housed at E may be

seen at the herbarium database of the RBGE, http://elmer.rbge.org.uk/bgbase/vherb/

bgbasevherb.php. Smith”s Latin description of this species has not been translated into

English. Since Latin is less widely read than formerly, a translation into English is

given (above).

ACKNOWLEDGEMENTS. 1 am grateful to D.J. Middleton (E) for useful advice on what

constitutes a valid description and for permission to reprint the Latin diagnosis of Boesenbergia

aurantiaca from the Notes RBG Edinburgh 44: 226 (1987), and to ]. Pereira (SAN) for locating

Argent et al. SAN 108235 at SAN and for sending me a photograph of it. The improvements

suggested by the reviewers, J. McNeill (E) and J. Leong-Skornitkovă (SING), are also

gratefully acknowledged.

100 Gard. Bull. Singapore 65(1) 2013

References

MceNeill, J., Barrie, F.R., Burdet, H.M., Demoulin, V., Hawksworth, D.L., Marhold, K.,

Nicolson, D.H., Prado, J., Silva, P.C., Skog, J.E., Wiersema, J.H. & Turland, N.J. (eds)

(2006) International Code of Botanical Nomenclature (Vienna Code) adopted by the

Seventeenth International Botanical Congress, Vienna, Austria, July 2005. Ruggell:

A.R.G. Gantner Verlag KG [Regnum Veg. vol. 146].

Smith, R.M. (1987) A review of Bornean Zingiberaceae: III (Hedychieae). Votes Roy. Bor.

Gard. Edinburgh 44: 203-232.

Gardens” Bulletin Singapore 65(1): 101-105. 2013 101

Aspidistra jiewhoei (Asparagaceae),

a new species from north Vietnam

Hans-Juergen Tillich! and Jana Leong-Skornikovă&

'Ludwig-Maximilians-University, Systematic Botany,

Menzinger Str. 67, D-80638 Munich, Germany

hjtillich(4 gmx.de

“The Herbarium, Singapore Botanic Gardens,

1 Cluny Road, 259569 Singapore

jana_skomickova(a seznam.cz

ABSTRACT. An unusual new species of Aspidistra Ker Gawl. (Asparagaceae: Nolinoideae)

from north Vietnam, A. jiewhoei Tillich & Skorni€k. is described and illustrated here.

Keywords. Asparagaceae, Aspidistra, Nolinoideae, Vietnam

Introduction

The genus Aspidistra Ker Gawl. (Asparagaceae: Nolinoideae) is distributed from

Assam (India) in the west to southern Japan in the east, and from Central China

southwards to the Malay Peninsula, but the centre of diversity is SE China (Guangxi

Province) and adjacent northern Vietnam (Tillich 2005). During the past three decades

the number of known species has increased considerably from 11 in 1980 to more than

100 (Tillich & Averyanov 2012), with many novelties reported in last decade from

Vietnam (Bogner & Arnautov 2004; Brăuchler & Ngoc 2005; Tillich 2005, 2006;

Tillich et al. 2007; Tillich & Averyanov 2008, 2012; Averyanov & Tillich 2012, in

press). The total number of known species in Vietnam is currently 37, but as most of

the Aspidistra species seem to be stenoendemic, it is expected that with continuing

floristic explorations its numbers will grow progressively.

The first author has been extensively involved with taxonomy of the genus

Aspidistra, and provided a comprehensive key to the genus covering 93 species (Tillich

2008). So when an unidentified Aspidistra species flowered in the living collections

of Singapore Botanic Gardens it was brought to his attention by the second author. It

was clear that this unusual species endowed by several unique morphological features

represents a new species and is here described below.

In line with the collecting practices as outlined by Tillich (2005), the spirit

conserved flower is part of the type specimen as well as colour photo documentation

of important characters including the flower dissection.

102 Gard, Bull. Singapore 65(1) 2013

Aspidistra jiewhoei Tillich & Skorni&k., sp. nov.

Similar to A. /ateralis Tilhch, but differs by its stamens overtopping the stigma

surface, the pistil closely attached to the perigone wall, and the growth form with

upright shoots, bearing the flowers on short peduncles in lateral position and clearly

above ground level.

TYPE: Jana Leong-Skornickovă JLS-1871, Cultivated in the Singapore Botanic

Gardens (SBG Acc. No. 20122069), 5 Dec 2012 (holo SING, including flowers in the

liquid collection; iso M, HN, both including flowers in the liquid collection). Originally

from Northern Vietnam, TuyEn Quang Province, Nă Hang District (collector unknown),

donated to Singapore Botanic Gardens by the Singapore Gardening Society. (Fig. 1 & 2.)

Rhizomatous herb up to 35 cm tall. Rhizome with very short internodes, diameter

10-13 mm. Leaves crowded, cataphylls deep purple when young, up to 12.5 cm long.

Petiole 10-20 cm long, stout, stiff, ventrally with a furrow, deeper at apical part,

shallower towards the base, basal 5-12 mm swollen. Blade broadly ovate, slightly

unequal, 20-30 x 8.5-13 cm, apex acuminate, base rounded, matt dark green above

(nearly dark bluish green), light grey-green beneath with strongly protruding midvein

and well-visible dark green secondary veins, margin very minutely serrate, making the

margin somewhat sharp to touch, revolute. Peduncle up to 4.5 cm long, semi-erect at

first, later more or less horizontal or descending when the flower opens, its tip bent

downward, dark purple externally, with 3 hood-lke, dark purple scales, 2 subtending

the flower and 1 along the scape. Perigone nodding, widely bowl-shaped, 14-15 mm

in diameter, with nearly flat, fleshy base, reddish purple to deep purple internally

and externally, except sometimes outer basal part lighter (cream-yellowish). Lobes 6

(sometimes 8), ovate-triangular, erect to slightly patent, upper surface smooth, in two

whorls of 3 (sometimes 4), outer lobes c. 6-7 x 8-9 mm, inner lobes c. 5-6 x 6-7 mm.

Stamens 6 (8 in flowers with 8 lobes), inserted at apical part of the tube, overtopping

stima surface, anthers sessile, somewhat sunken in a circular bulge, anther thecae c.

1.3 mm long, bean shaped, separated by light green connective tissue, pollen bright

yellow. Pistil depressed obconical, c. 3 mm high, outer (lower) surface closely attached

to perigone wall. Stigma circular, 5-6 mm in diameter, cream-coloured in the slightly

convex centre, margin and lower part tinged with purple red to deep purple, the margin

with small lobes. Fruir unknown.

Ermology. We name this species in honour of Mr. Tan Jiew Hoe, president of Singapore

Gardening Society, for his continuous support of botanical and horticultural research

in Singapore as well as in other parts of Asia, particularly in Laos and Vietnam. It was

him who first brought this unusual plant to our attention and donated several individuals

to the research collections of Singapore Botanic Gardens, where it flowered.

Notes. This species can be readily recognised by stamens overtopping the stigma

surface and the obconical pistil, which, by its outer (lower) surface, is closely attached

to the perigone wall, lacking any space in between (Fig. 2 A, D, F). The latter feature

is so far unique in the genus. The flowers are superficially similar to A. /ateralis Tilheh

104 Gard. Bull. Singapore 65(1) 2013

Fig. 2. Floral characters of Aspidistra jiewhoei. A. Dissection of the flower & detail of the

basal part of the flower (scale in mm). B. Trimeric flower (front view; cultivated in deep shade

condition). C. Trimeric flower (side view; cultivated in deep shade condition). D. Tetrameric

flower with 8 lobes and 8 anthers (front view; cultivated in deep shade condition). E. Trimeric

flower (side view; cultivated in semi-shade condition). F. Trimeric flower (front view: cultivated

in semi-shade condition). (Photos: J. Leong-Skornikovâ)

New Aspidistra from Vietnam 105

from Thua Thi&n-Hu& Province, but in that species the stamens are below stigma

level, and it differs clearly by its remarkable growth form with upright shoots, bearing

the flowers on short peduncles in lateral position clearly above ground level.

It has been observed that trimeric (6 lobes, 6 stamens) as well as tetrameric

flowers (8 lobes, 8 stamens) are produced on a single plant. This phenomenon has been

reported in Aspidistra before, e.g. A. lateralis Tilhch, 4. guangxiensis S.Tang & Y.Liu,

and A. leshanensis K.Y.Lang & Z.Y.Zhou. It is also noticeable that plants cultivated in

deep shade produced slightly smaller flowers on longer peduncles, which were darker

in colour (Fig. 2 B-D), compared to the plants cultivated under semi-shade conditions,

which produced larger, overall slightly more robust flowers, with lighter coloration

(Fig. 2A&E-F).

ACKNOWLEDGEMENTS. The research of the second author is funded by the National Parks

Board, Singapore and the Czech Science Foundation, GACR (grant nos. $21/09/0202 and

P506/10/0623).

References

Averyanov, L.V. & Tillich, H.-J. (2012) New taxa of Aspidistra (Asparagaceae) from Central

Vietnam. Țurczaninowia 15: 5-10.

Averyanov, L.V. & Tillich, H.-J. (in press) Aspidistra truongii — a new species of Asparagaceae

(Convallariaceae s.str.) from Southern Vietnam. 7aiwania 59.

Bogner, ]. & Arnautov, N.N. (2004) Aspidistra locii (Convallariaceae), an unusual, new species

from Vietnam. Wil/denowia 34: 203-208.

Brăuchler, C. & Ngoc, L.H. (2005) Aspidistra renatae (Ruscaceae) — A new species from

Central Vietnam. Blumea 50: 527-529.

Tillich, H.-J. (2005) A key for Aspidistra (Ruscaceae), including 15 new species from Vietnam.

Feddes Repert. 116 (5-6): 313-338.

Tillich, H.-J. (2006) Four new species of Aspidistra (Ruscaceae) from China, Vietnam, and

Japan. Feddes Repert. 117: 139-145.

Tillich. H.-J. (2008) An updated and improved determination key for Aspidistra Ker-Gawl.

(Ruscaceae, Monocotyledons). Feddes Repert. 119: 449-462.

Tillich. H.-J. & Averyanov, L.V. (2008) Two new species and one new subspecies of Aspidistra

Ker-Gawl. (Ruscaceae) from Vietnam. Feddes Repert. 119: 37-41.

Tillich. H.-J. & Averyanov, L.V. (2012) Four new species of Aspidistra Ker-Gawl.

(Asparagaceae) from China and Vietnam with a comment on A. /ongifolia Hook.f. and

A. hainanensis W.Y.Chun & F.C.How. Gard. Bull. Singapore 64(1): 201—209.

Tillich, H.-J., Averyanov, L.V. & Dzu, N.V. (2007) Six new species of Aspidistra (Ruscaceae)

from northern Vietnam. Blumea 52: 335-344.

4 a 3

| Pt 107

706 a

UN d d da]

a. a Pi

LU MAR a, ij

Di ij

2 vă

bsa

Gardens” Bulletin Singapore 65(1): 107-114. 2013 107

Rubovietnamia sericantha (Rubiaceae: Gardenieae),

a new combination

and notes on the genus in China

Y.H. Tong'?, W.B. Xu:, Y.F. Deng!, K.M. Wong+ and N.H. Xia'

'Key Laboratory of Plant Resources Conservation & Sustainable Utilization,

South China Botanical Garden, Chinese Academy of Sciences,

Guangzhou, 510650, People's Republic of China

yh-tong(ascbg.ac.cn, yfdeng(a/scbg.ac.cn (corresponding author), nhxia(ascbg.ac.en

"University of Chinese Academy of Sciences,

Beijing 100049, People's Republic of China

*Guangxi Institute of Botany, Guangxi Zhuang Autonomous Region

& Chinese Academy of Sciences, Guilin, 541006 Guangxi,

People's Republic of China

gxibwbxu(4 gmail.com

“Singapore Botanic Gardens, 1 Cluny Road, Singapore 259569

wkm2000(2 gmail.com

ABSTRACT. Porterandia sericantha, originally published as Randia sericantha, is re-

combined as Rubovietnamia sericantha. Because of its earlier published specific epithet, it is

the correct name for the generic type, Ruboviernamia aristata. Rubovietnamia consists of two

species distributed in SW China and N Vietnam.

Keywords. China, new combination, nomenclature, Porterandia, taxonomy, Vietnam

Introduction

Porterandia Ridl. (1940: 593), a small genus of the Gardenieae in Rubiaceae, consists

of about twenty species distributed in Peninsular Thailand, west Malaysia and

Sulawesi with the centre of diversity in Borneo (Puff et al. 2005, Zahid & Wong 2010).

It is characterised by distinctly sheathing stipules, a densely bristly corolla tube outer

surface, absence of (or at most minute) hairs on the inner surface of the corolla-tube,

and included anthers and style (Zahid & Wong 2010).

Porterandia sericantha (W.C.Chen) W.C.Chen (1999: 384) is the only species

ascribed to the genus in China. It was originally described as Randia sericantha W.C.Chen

(1987: 298) based on collections from the Guangxi and Yunnan provinces, SW China (Fig.

1). Zahid & Wong (2010) pointed out that it is quite different from typical Porterandia in

having the stipules just slightly fused at the base and not forming a distinct tubular sheath,

a sparsely hairy corolla tube outer surface, long flexuous hairs on the inner surface of

the corolla tube, and exerted anthers and style. They (Zahid & Wong 2010) excluded this

species from Porterandia, but did not place it into any genus. In fact, these characters of the

species conform well to Ruboviemnamia Tirveng. (Tirvengadum 1998: 166).

108 Gard. Bull. Singapore 65(1) 2013

Rubovietnamia

The genus Rubovienamia was established with the sole species R. aristata Tirveng.

(Tirvengadum 1998: 167) based on collections from northern Vietnam. Later, A.

aristata was also reported from Yunnan and Guangxi, China (Zhang et al. 2007).

The genus differs from Vidalasia Tirveng. in having typically 2—8-flowered cymes

(sometimes reduced to single flower), subentire stipuliform bracts and bracteoles, and

2-4 ovules and seeds (Tirvengadum 1998, Zhang et al. 2007, Chen & Taylor 2011).

Vidalasia has many-flowered compound cymes, erose-setose stipules and bracts, and

numerous ovules and seeds. Mou & Zhang (2010) suggested a sister relationship

between Ruboviernamia and Duperrea Pierre ex Pitard (1924: 334) based on combined

sequences of two chloroplast markers, but they were unable to test the relationship

between Ruboviernamia and Vidalasia, implied by Tirvengadum (1998) as close.

In China, the distribution recorded for Porterandia sericantha overlaps with

Rubovietnamia aristata, sharing a similar habitat. Also, these two species are very

difficult to distinguish by the illustrations provided by Chen (1987, 1999) and

Tirvengadum (1998), respectively. Chen (1987, 1999) included a line illustration for

the species, which incorrectly depicts an unequally bi-lobed stigma. After examining

the type material, it was found that the stigma is club-like, grooved, with 2 equal lobes

initially cohered together (Fig. 1). Zhang et al. (2007) had studied and noted specimen

material identified by Tirvengadum when they reported R. aristata in China. We have

checked an image of the type of A. aristata, and have examined all specimens cited by

Zhang et al. These and Porterandia sericantha in Chinese herbaria represent the same

species. At the specific rank, the epithet “sericantha” has priority over “aristata”, so

that the new combination, Ruboviernamia sericantha, is necessary (see below).

Mou & Zhang (2010) described a second species, Ruboviernamia nonggangensis

F.J.Mou & D.X.Zhang (2010: 123), from Guangxi, China. It difters from R. aristata

Tirveng. in having much broader foliaceous calyx lobes, and the leaves, young branches

and flowers (including pedicels, ovary, styles and calyx) densely covered with hairs.

Rubovietnamia sericantha (W.C.Chen) Y.F.Deng, Y.H.Tong, W.B.Xu & N.H.Xia,

comb. nov. Basionym: Randia sericantha W.C.Chen, Guihaia 7: 298 (1987). —

Porterandia sericantha (W.C.Chen) W.C.Chen, FI. Reipubl. Popularis Sin. 71(1): 384

(1999); FI. Yunnan. 15:192 (2003); Chen & Taylor, FI. China 19: 292 (2011). TYPE:

China, Yunnan, Xichou Xian, Xinjie, 1200 m, 10 June 1964, Wang 903 (holo KUN;

1so KUN). (Fig. 2)

Rubovietnamia aristata Tirveng., Biogeographica 74: 167 (1988); Zhang et al., Acta

Phytotax. Sin. 45: 91 (2007); Chen & Taylor, FI. China 19: 320 (2011); synon. nov.

TYPE: Vietnam, Hoa Binh, Paco, Mai Cheu, 19 November 1997, Bastien & Doa 22bis

(holo P; iso HN).

Shrubs or small trees, 1-6 m tall. Bark covered with variously shaped lenticels.

Young branches compressed to terete, glabrous or moderately to densely ferruginous

Rubovietnamia in China

109

cp E PLZ PFA PI

RAE 3

Mg:

tf:

E f:

De ==

II LLEză

i imite i =

RX E IES 015308 EA ați

H+

Fig. 1. Holotype of Ruboviernamia sericantha. Courtesy of the herbarium of the Kunming

Institute of Botany, Chinese Academy of Sciences (KUN).

110

Gard. Bull. Singapore 65(1) 2013

-g te

=> Zi

[) „E

3 să

:j8

-

SA (SI 4

sd

=

miza

7719 A le tera

Apare Piti

ui

Sp UI

Fig. 2. Ruboviernamia sericantha. A. Flowering branch. B. Portion of stem showing stipules.

C. Flower with calyx and corolla. D. Calyx slit and spread out. E. Corolla slit and spread out.

F. Stamen. G. Ovary and style. H. Fruiting branch. A-G from Wang 903 (KUN), H from Ching

6401 (BSC). (Drawn by Wang Ling.)

Rubovietnamia in China Il]

hirtellous. Stipules ovate to triangular, 5-7 mm, chartaceous, moderately to densely

strigillose to hirtellous or glabrous, terminating with two minute interpetiolar limbs.

Leaves opposite; petiole 3—15 mm, moderately to densely pilosulous or hirtellous to

glabrescent; leaf blade elliptic, oblanceolate, oblong or obovate, 4-18 x 1.5-5 cm,

drying papery, adaxially sparsely strigillose to subglabrous, abaxially sparsely to

densely pilosulous or hirtellous, base cuneate to obtuse, margin entire, apex acute

to usually short-acuminate, often appearing aristate; lateral veins 7-14 pairs, with

pilosulous domatia in abaxial axils, abaxially inconspicuous, adaxially prominent.

Inflorescences cymose, 2-—5.5 x 3-5 cm, (1l—)3-5-flowered, basically terminal but

occupying a pseudo-axillary position because of sympodial growth; pedunele (0—)1-5

mm, densely pilosulous to hirtellous; bracts triangular, lanceolate or stipuliform, 2.5—

3 mm long, apex acute to acuminate. Flowers with pedicels 0.5—1.7 cm; bracteoles

minute, 1-2 mm long, hirtellous; calyx tube campanulate, 0.7—1 cm long, densely

pilosulous and/or strigose, lobes 5, valvate in buds, ovate-oblong, 5-7 mm long, apex

acute, with the central nerve dorsally ending into an arista, margin ciliate; corolla

white, outside densely yellow sericeous, tube cylindrical, 2—2.2 cm long, inside

glabrous except with a villous ring at middle, lobes 5, ovate to ellptic, 1—1.2 x 0.5-0.6

cm; stamens 5, inserted near the throat, exerted, filaments absent or inconspicuous,

anthers linear, adnate, dorsifixed, 3—5 mm long, apex acute; ovary hirtellous, 1-locular,

ovules 4; style subeylindrical, c. 2.5 cm long, hirsute; stigma bifid, 2-3 mm long,

striate. Fruit a berry, subglobose, 1-—1.7 cm in diam., pilosulous to strigillose; seeds

about 4, ovoid or subglobose, 4-7 mm across.

Distribution. The species is distributed in N Vietnam and SW China (Guangxi and

Yunnan) (Fig. 3).

Ecology. Rubovietnamia sericantha grows in forests or thickets at streamside in

valleys, and also on slopes of limestone hills at elevations of 200-—1500 m. It was

observed flowering from May to June and fruiting from July to October.

Additional specimens examined: CHINA. Guangxi. Baise Shi, Youjiang Qu, Daleng Xiang,

Longhe Cun, 8 Jun 1977, Huang 3-22060 (GXMI), 10 Jun 1984, Chen 37019 (GXMI); Daxin

Xian, Taocheng Zhen, Baoyuan, 13 May 1981, Chen & Ling 34194 (GXMI); Debao Xian,

Longguang Xiang, 700 m, 14 Jan 1956, Expedition to Baise 1904 (|BK, IBSC, KUN), Du'an

Xiang, Fushan Cun, 14 Jul 1977, Expedition to Debao 3-0466065 (GXMI, IBSC), Yandong

Xiang, Qinjia Cun, 24 May 1977, Expedition to Debao 3-47363 (GXMI, IBSC), Chengguan

Zhen, Hanlong Cun, 31 May 1977, Expedition to Debao 3-47384 (GXMI); Hechi Shi, 12 Jul

1928, Ching 6401 (IBSC), Jingchengjiang Qu, Baitu Xiang, Deming Cun, Jiliao, 2 Aug 1977,

Lan 4-4-156 (GXMI); Huanjiang Xian, Mulun Xiang, Leyi to Donglai, 21 Oct 1991, Botanical

Expedition to Yunnan, Guizhou & Guangxi 70060 (IBK, KUN), Donglai, 520 m, 18 Apr 2012,

Au, Peng & Hu ML1053 (BK), Baidan Tun, Tantou, 270 m, 25 Apr 2012, Jiang, Yang & Mo

11591 (IBK), Daan Xiang, Dingxin Cun, Xiagang, 16 Aug 1977, Expedition to Huanjiang

4-3-322 (GXMI), Dongxing Zhen, Duya Cun, Caiken, 14 Aug 1977, Expedition to Huanjiang

4-3-755 (GXMI); Jingxi Xian, Renzhuang Xiang, Bangliang Cun, 750 m, 10 Sep 2006, Liu &

Xu 8 (IBK), near Laolangdong, 590 m, 8 Sep 2010, Huang & Pan LYJĂ0021 (IBK), Yuexu

Zhen, Daxing Cun, 850 m, Xu & Liang B0069 (IBK), Hurun Xiang, Dongpai Cun, 690 m, 20

112 Gard. Bull. Singapore 65(1) 2013

0 80 160 320

CV!

Fig. 3. Distribution of Ruboviemamia sericantha (€).

Sep 2010, Huang & Wu LYJX0574 (IBK), Sanhe Xiang, Gelu Cun, 840 m, 15 Sep 2010, Huang

& Wu LYJX0361 (BK), Nanpo Xiang, Diding Cun, Baling Tun, 890 m, 25 Sep 2010, Huang &

Wu LYJĂ0696 (IBK), Dizhai, 850 m, 21 Dec 1958, Chang 15116 (BK, IBSC), Wuping Xiang,

Yixing Cun, 20 Dec 1958, Chang 14620 (IBK, IBSC), Biaolin Xiang, Tongde, Laohuaidashan,

24 Aug 1935, Ko 55605 (IBK, IBSC), Tanggang to Dean, 3 Nov 1956, Li P00815 (IBK, IBSC),

Tanggang to Anzhen, roadside, on slope, 3 Nov 1956, Li 3472 (BSC), Dizhou Xiang, Fuliu

Cun, 26 Jul 1977, Lin 21602 (GXMI);, Long'an Xian, Pingshan Xiang, 18 May 2005, Shui,

Chen & Zhang B2005-311 (KUN, PE), 18 May 2005, Shui, Chen & Zhang B2005-325 (KUN,

PE); Longzhou Xian, Jinlong Zhen, Banbi, 9 Jun 1965, Fang & Liang 21602 (GXMI), 350

m, 14 Apr 2010, Xu & Pan 10067 (IBK), 6 Jun 1977, Expedition to Longzhou 2-007 (GXMI),

Longdao, 320 m, 23 Jul 2009, Huang, Ye & Li H09620 (BK), Shashu, 4 May 1956, Li 282

(IBK, IBSC), Nonggang, 230 m, 16 Jul 2009, Huang, Wu & Chen H09099 (IBK), 240 m,

Expedition to Guangxi 2016 (IBK), 300 m, 7 Oct 2010, Xu & Wu LZI13 (IBK), 600 m, 10 Jul

2010, Xu & Wu 10544 (BK), Qinglongshan, 160 m, 11 Aug 2008, Expedition to Guangxi 2570

(IBK), Sanlian Xiang, 290-370 m, Expedition to Guangxi 3755 (UBK), 370 m, 16 May 2009,

Huang 1109473 UBK), Xiadong Xiang, Nahua Cun, Longqin, 350 m, 15 Oct 2008, Expedition

to Guangxi 3955 (IBK), Xiangshui Xiang, Siqing Dadui, Longshui, 16 Jun 1979, Expedition

of Longzhou Institute of Medicine 0358 (GXMI), Zhupu Xiang, 200 m, 13 Oct 2008, Liang

et al. 8268 (IBK), 21 Sep 1935, Guangxi Museum 60 (BSC), Shuikou Xiang, Shishan, 16

Sep 1958, Chang 12089 (IBSC), Paizong Xiang, Bagouniu, 380-650 m, 24 Aug 1957, Chen

13952 (BK, IBSC); Luocheng Xian, Qiaoshan Xiang, Qiaoben Cun, Lading, 26 May 1977,

Expedition to Luocheng 4-1-1233 (GXMI), Huaiqun Zhen, Zhenxin Cun, Changdong, 29 May

1977, Expedition to Luocheng 4-1-1563 (GXMI), Tianhe Zhen, Beijiang Cun, 21 Jun 1977,

Rubovietnamia in China 113

Expedition to Luocheng 4-1-1777 (GXMI); Nandan Xian, Baxu Xiang, Li'ao Cun, Jiuxu, 28

Sep 1977, Expedition to Nandan 4-5-828 (GXMI); Napo Xian, Baidu Xiang, Nongbu Cun,

1200 m, 20 May 198, S China Expedition 845 (IBSC), 18 Oct 1977, Fang 3-1529 (GXMI),

Nonghua Cun, Nonghua, 950 m, 20 Jun 1982, Fang, Lai & Wang 25150 (GXMI), Nonglong

Cun, 4 Jul 2012, Jong & Bai 12070419 (IBSC), Delong Xiang, 21 May 1959, Liang 3094

(GXMI), Pingmeng Zhen, 16 Oct 1997, Sino-Japanese Botanical Expedition to Yunnan &

Guangxi of China 1114 UBK, KUN), Lengzhong Xiang, Longxu, 900 m, 3 Dec 1956, Li 3472

(IBK, IBSC), Baihe Xiang, Shanglong Cun, 27 Oct 1977, Fang 3-1573 (GXMI); Ningming

Xian, Longrui, 250 m, 29 Apr 1980, Expedition to Nonggang 11897 (IBK), 300 m, 25 May

2008, Expedition to Guangxi Î181 (IBK), 110-280 m, 13 Oct 2008, Expedition ro Guanexi

3861 (BK); Yizhou Shi, Lali Xiang, Baowei Cun, Machao, Chen & Sha 55953 (GXMI),

15 May 1991, Rao 55846 (GXMI), Desheng Zhen, Xinhui Cun, 29 Sep 1977, Expedition to

Yishan 4-2-1-266 (GXMI). Qianhe Cun, 2 Oct 1977, Expedition to Yishan 4-2-1-506 (GXMI).

Yunnan. Hekou Xian, Nanxi Zhen, Luyingqging, 700-950 m, 21 Oct 2001, Shui er al. 15160

(KUN), Yaoshan Xiang, Dudian Cun, Baiquanchong, 760 m, 27 Oct 1954, Feng 5185 (KUN);

Maguan Xian, Gulinging Xiang, Laofangzi, 103*57'53”E 22*46"49”N, 1400 m, 16 Oct 2002,

Shui, Chen & Sheng 31547 (KUN, PE); Malipo Xian, Babu Xiang, Yunling Cun, Huangjinyin,

28 Nov 1964, unknown coll. 9944 (KUN), 1100 m, 20 Jan 1940, Wang 86267 (IBSC, KUN),

28 Nov 1964, Wu 9944 (KUN), 1030 m, 28 Nov 1964, Lin 658 (KUN), in 1947, Feng 13166

(KUN), 1100-1400 m, 15 Nov 1947, Feng 13259 (IBSC, KUN), 20 Aug 2012, Tong & Bai

12082012 (IBSC), Ganhe Xiang, 1100 m, 11 Nov 1951, Mao 645 (HITBC, KUN), Tiechang

Xiang, Guangao, 1000 m, 14 Feb 1940, Wang 86806 (IBSC, KUN), Xiantian, 24 Nov 1963,

Liu et al. 101861 (KUN), 1000 m, 3 Jan 1940, Wang 86133 (BK, IBSC, KUN), Dongding

Cun, 1000-1100 m, 18 Nov 1947, Feng 13364 (IBSC, KUN), 1000 m, 4 Jan 1940, Wang

86193 (BSC, KUN), Xiajinchang, near Jiangjia Tun, 1210 m, 3 Oct 2003, Shui, Chen & Sheng

21642 (BSC, KUN, PE), 1210 m, 3 Oct 2003, Shui, Chen & Sheng 32727 (KUN, PE), Majie

Xiang, 1300-1500 m, 14 Oct 1947, Feng 12484 (IBSC, KUN); Xichou Xian, Dongma Xiang,

Guoditang, Dadi, 1350 m, 11 Jun 1991, Shui 891-140 (KUN), Cha-ban, 1000 m, 27 Dec 1939,

Wang 86093 (IBSC, KUN).

VIETNAM. Cao Bang. Trung Khanh District, Ngoc Khe Municipality, Pac Nga village,

22%54'59”N 106*31'44"E, 700-750 m, 10 Jun 2004, Avervanov, Loc, The & Vinh 5529 (MO,

P). Ha Giang. Quan Ba District, Pass between Ha Giang and Quan Ba, 4-5 km outside Quan

Ba, 23*06'03”N 105*01"20”E, 11 Jul 2002, van der Werff, Dao, Gray & Doan 17282 (MO, P),

17286 (MO, P).

ACKNOWLEDGEMENTS. We thank the curators of the herbaria GXMI, HITBC, IBK, IBSC,

KUN, MO, P and PE for their help with specimens for our studies. We are grateful to Dr.

Tirvengadum (P) for providing his publication on Ruboviermnamia tor reterence, Ms. Wang

Ling who prepared the line drawing, and Dr. Yu Shengxiang (PE) for his help in preparing the

distribution map.

References

Chen, T. & Taylor, C.M. (2011) Porterandia and Ruboviemamia. In: Wu, Z.Y., Raven, P.H. &

Hong, D.Y. (eds) Flora of China 19. Pp. 291-292, 319-320. Beijing: Science Press; St.

Louis: Missouri Botanical Garden Press.

114 Gard. Bull. Singapore 65(1) 2013

Chen, W.C. (1987) Materials for Rubiaceae. Guihaia 7(4): 297-300.

Chen, W.C. (1999) Porterandia. In: Lo, H.S. (ed) Flora Reipublicae Popularis Sinicae 71(1).

Pp. 384-386. Beijing: Science Press., (in Chinese).

Ridley, H.N. (1940) Notes on some Malayan Rubiaceae. Bu//. Misc. Inform. Kew 1939: 593-—

613.

Mou, F.J]. & Zhang, D.X. (2010) Ruboviernamia nonggangensis (Rubiaceae), a new species

from China. Bor. Stud. 51: 119-126.

Persson, C. (1996) Phylogeny of the Gardenieae (Rubiaceae). Bor. J. Linn. Soc. 121: 91-109.

Pitard-Briau, C.].M. (1924) Rubiacees. In: Lecomte, P.H. (ed) F/ore Generale de 1 'Indo-Chine

3. Pp. 20442. Masson, Paris.

Puff, C., Chayamarit, K. & Chamchumroon, V. (2005) Rubiaceae of Thailand —A Pictorial

Guide to Indigenous and Cultivated Genera. Bangkok: The Forest Herbarium, National

Park, Wildlife & Plant Conservation Department.

Robbrecht, E. & Puff, C. (1986) A survey of the Gardenieae and related tribes (Rubiaceae). Bor.

Jahrb. Syst. 108: 63-—137.

Tirvengadum, D.D. (1998) Novelties in Rubiaceae from the limestone flora of Southeast Asia.

Biogeographica 744): 163-175.

Zahid, M.S. & Wong, K.M. (2010) The circumscription, taxonomy and biogeography of

Porterandia (Rubiaceae-Gardenieae). Edinburgh J. Bot. 67: 265-342.

Zhang, M.D., Chen, W.H. & Shui, Y.M. (2007). Miscellaneous notes on the tribe Gardenieae

(Rubiaceae) from China and Vietnam. Acra Phytotax. Sin. 45: 90-93.

Gardens” Bulletin Singapore 65(1): 115-116. 2013 115

Additions to The Plant Taxa of H.N. Ridley, 4.

The Primitive Angiosperms (Austrobaileyales, Canellales,

Chloranthales, Laurales, Magnoliales, Nymphaeales and

Piperales)

I.M. Turner

Research Associate, Royal Botanic Gardens Kew

Research Associate, Singapore Botanic Gardens

Correspondence address:

Fairfield, Pett Level Road, Winchelsea Beach, East Sussex TN36 4ND. U.K.

Turner 187(4btinternet.com

ABSTRACT. Three taxa omitted from an earlier compilation are listed here. They represent

names authored by Henry Ridley for varieties in the Annonaceae. One name is lectotypified.

Keywords. Annonaceae, lectotype, Ridley

Introduction

In an oversight, three names (all at varietal rank in the Annonaceae) were omitted

from a recent compilation of Henry Ridley's primitive angiosperm taxa (Turner 2012).

These three taxa are listed here in the same style as the original paper.

MAGNOLIALES

Annonaceae

]: Oxymitra fornicata Hook.f. & Thomson var. glabra Ridl., FI. Malay

Penins. 1 (1922) 80. SYNTYPES: Thailand, Pulau Adang, Ridley

15904 (lectotype, designated here, K,; isolectotype SING). Peninsular

Malaysia, Penang, Anon. [Philhipps] s.n. (K).

= FRIESODIELSIA DISCOLOR (Craib) D.Das, Bull. Bot. Surv. India 5 (1963)

93. Oxymitra discolor Craib, Bull. Misc. Inform. Kew 1925 (1925)

11. Sinclair, Gard. Bull. Singapore 14 (1955) 457.

l. Alphonsea maingayi Hook.f. & Thomson var. elliptica (Hook.f.

& Thomson) Ridl., FI. Malay Penins. 1 (1922) 98. Basionym:

ALPHONSEA ELLIPTICA HOook.f. & Thomson, FI. Brit. India 1 (1872)

90.

116 Gard. Bull. Singapore 65(1) 2013

Il. Cyathostemma viridiflorum Griff. var. scortechinii (King) Ridl., FI.

Malay Penins. 1 (1922) 27. Basionym: Cyarhostemma scortechinii

King, ]. Asiat. Soc. Bengal, Pt. 2, Nat. Hist. 61 (1892) 9.

= UVARIA GRIFFITHII L.L.Zhou et al., Syst. Biodivers. 7 (2009) 255.

References

Turner, I.M. (2012) The plant taxa of H.N. Ridley, 4: The primitive angiosperms

(Austrobaileyales, Canellales, Chloranthales, Laurales, Magnoliales, Nymphaeales and

Piperales). Gard. Bull. Singapore 64: 221-256.

Gardens” Bulletin Singapore 65(1): 117-134 2013 117

Nomenclatural notes on Eugenia reinwardtiana

(Myrtaceae) and more or less associated names

J.F. Veldkamp

National Herbarium of The Netherlands. Naturalis Biodiversity Center.

PO. Box 9514, 2300 RA Leiden. The Netherlands

jan-frits veldkamp E naturalis. nl

ABSTRACT. The nomenclatures of Calhyptranthes ramifiora Blanco. Caryophpilus cotinifolius

Miller, Eugenia bukobensis Engler. E. codyensis Munro ex Wight. E. cotinifolia Jacq.. E. elliptica

Lam . E. hypoieuca Thwaites ex Kosterm „E. philhreoides Trimen. E. reimwardiiana DC.. E.

TO ii DC... E. salomonica CT. White, Jossinia Comm. ex DC.. Myrtus carvophyilata L..

M_ cotini folio Plumier. M pimenia L.. and Pimenta acris (Sw.) Kostel. (Myrtaceae). and more

or less associated names are outlined. Some typifications are made.

Keywords. Eugenia, Myrtaceae. Myrtus. nomenclature. Pimenta. Syzwygium

Introduction

The generic delimitation of Eugenia L. against Syzygium J.Gaertn. (Myrtaceae) is

notoriously complicated but gradually, from various disciplines, a clearer concept is

evolving. For anatomy see, e.g.. Ingle & Dadswell (1953) and Schmid (1972a, b. c),

and palynology (Pike 1956). Wilson et al. (2005). based on an analysis with matK.

found that they are in quite different clades: Eugenia was included in the Myrteae

(usually în the subiribe Eugeniinae O. Berg) and Syzygium in the new Syzygieae.

It must be noted, though, that of Eugenia only E. uniflora L. was included and for

Syzygium but 3 species. Similar results based on ITS and psb4-trnH were reported by

Lucas et al. (2005), where the genera again were in difierent clades. However. only

four Eugenia and two Syzygium species were included. Wilson restricted Syzygium

(over 500 spp.) to the Old World, and Eugenia (c. 550 spp.) to the New World. Pacific.

the Philippines, and Africa (2011: 245, 252). In the Philippines (Wilson 2009) there

would be 10 native species and an introduced one. He accepted two species for New

Guinea (Snow & Wilson 2010). The specialists apparently disagree, for according to

a recent revision by Ashton (A; in litt.) there would be only two Malesian species of

“true” Eugenia: E. craveniana N.Snow & Peter G.Wilson and E. reimwardtiana DC.

In the Pacific the related Eugenia salomonica C.T.White ranges from Mussau Is]. (St.

Matthias Group) and Bougainville to the Solomons. All other putative Eugenia would

belong to Syzygium.

An extract from the generic key by Wilson (2011: 227-228) compared to the

generic descriptions gives the following key, which clearly 1s polythetic:

118 Gard. Bull. Singapore 65(1) 2013

Young shoots and flowers often pubescent. Inflorescences usually axillary, uniflorous, rarely

dichasial or raceme-like and many-flowered . Cotyledons fused. — Eugenia

Young shoots and flowers usually glabrous. Inflorescences usually terminal (sometimes

rami- or cauliflorous), usually paniculate. Cotyledons free. — Syzygium

The nomenclatures of these and associated names are sometimes quite complicated

and their study led to various side paths. These admittedly rambling notes may be of

some interest and aid to myrtophiles.

Eugenia reinwardtiana (Blume) DC.

Eugenia reinwardtiana (Blume) DC., Prodr. 3: 267 (1828); Hyland, Austral. ]. Bot.,

Suppl. 9: 28, t. 10 (1983). — Myrtus reinwardtiana Blume, Bijdr. 17: 1082 (1826-—

1827) (*1826”). — Jossinia reinwardtiana (Blume) Blume, Mus. Bot. 1: 120 (1850)

(1849); Merr., Arnold Arbor. 31: 329 (1950). — Jambosa maritima Miq., FI. Ned.

Indiă 1: 435 (1855), nom. superfi. LECTOTYPE (designated here): Reinwardt s.n.

- (L: sh. 898.203—352), Indonesia, Moluccas, Pulo Pombo.

Eugenia rariflora Benth. in Hook., London J. Bot. 2: 221 (1843); F. Br., Bull. Bernice

P. Bishop Mus. 130: 201 (1935). LECTOTYPE (designated by A.C. Smith 1985:

376): Barclay s.n., Fiji (K).

Eugenia carissoides F. Muell., Fragm. 3: 130 (1863). ). LECTOTYPE (designated by

Hyland 1983: Austral. J. Bot., Suppl. 9: 28): Firzalan s.n., Australia, Queensland,

Port Denison (MEL 60227; iso MEL 60276).

Eugenia hypospodia F. Muell., Fragm. 5: 15 (1865). LECTOTYPE (designated by

Hyland 1983: 28): Dallachy s.n., Australia, Queensland, Rockingham Bay (MEL

60222).

Jossinia tahitensis Nadeaud, Enum. Pl. Tahiti: 79 (1873). SYNTYPES: Not indicated

(P, PC, and perhaps elsewhere, e.g., BISH /455/02: 22 Oct 1857, Tahiti, Tiari,

“vallee de Haaripo et ailleurs”).

Eugenia rariflora Benth. var. parvifolia Hillebr., FI. Hawai Isl.: 129 (1888) — Eugenia

waianensis O.Deg., FI. Hawaii. Fam. 273, illus. (15 Jul 1932), non Eugenia

parviflora DC. (1828). TYPE: Lydeate s.n., Hawaii, Oahu, northern slopes of Kaala

(holo B, lost).

Eugenia kangeanensis Valeton in Boerl., Icon. Bogor. 4: 107, t. 333 (“'hkangeensis ”)

(1912); Merr. & L.M. Perry, Mem. Acad. Arts & Sci. 18: 140. = Mem. Gray

Herb. Harvard Univ. 4: 140 (1939). LECTOTYPE (designated here): Jaheri 578,

Indonesia, Moluccas, Kai Isl. (BO; film 62, neg. 1 in L).

Eugenia costenoblei Merr., Philipp. ]. Sci. 9: 123 (1914) — Jossinia costenoblei (Merr.)

Diels, Bot. Jahrb. Syst. 56: 531 (1921). TYPE: Costenoble 1172, Guam, Hilaan

(holo US: sh. 653736, 653737).

Eugenia macrohila C.T. White & W.D.Francis, Proc. Roy. Soc. Queensland 35: 69

(1923). TYPE: WD. Francis, s.n., Australia, Queensland, Marmor (holo BRI

212342; iso BRI 212343, 212344, MEL 60202).

îi

Eugenia nomenclatural notes 119

Jossinia desmantha Diels, ]. Arnold. Arbor. 10: 82 (1929). TYPE: Brass 887, Papua

New Guinea, Central Prov., Port Moresby (holo A).

Eugenia koolauensis O.Deg. var. glabra O.Deg., FI. Hawaii. Fam. 273 (10 Aug 1932).

TYPE : Degener & Bush 4194, Hawai'i, Oahu, 0.5 mile SE of Pohakea Pass (holo

BISH).

Distribution. Malesia: Java (Kangean Isl.)., Lesser Sunda Isl. (Flores). Borneo (Sabah,

Sarawak), Celebes? (fide cultivated tree in BO: A/ston 17205, Rastini 61, both în L),

Moluccas (Ceram, Halmahera, Kai Isl., Pulau Pombo, Saparua), New Guinea (Aru

Isl.; Central Prov., S and E of Port Moresby; curious that it is not more widespread);

Pacific: Austral Isl., Fiji, Gambier Isl., Guam, Hawaii, Henderson Isl., Mariannes,

Marquesas Isl., Niue, Palau, Peleliu, Pitcairn, Rapa, Rarotonga, Samoa, Society Isl.,

Tahiti, Tonga, Truk, Vanuatu, Yap; Australia: coastal zone of Queensland and Torres

Strait 1sl., N West Australia.

Habitat. On or near beaches, monsoon forests, deciduous vine thickets in Australia,

0—500 m alt.; dry forest slopes, occasionally in mesic forest, 180-730 m alt. in Hawaii;

on limestone in Guam.

Vernacular names. Beach cherry (Austr.), Cedar Bay Cherry (Austr.), Mountain topper

(Austr.).

Uses. The sweet fruit according to some has a better taste than cherries, “good bush

tucker”. Used in horticulture for decoration, a minor source of fruit, and for hedges.

Notes. Quite extensive discussions of this species are provided by Merrill (1950) and

Hyland (1983). Merrill discussed the delimitation of the genus Jossinia Comm. ex DC.

with an emphasis on J. reimwardtiana (Blume) Blume.

According to Hyland, the anatomy and vascularisation of the calyx tube

(hypanthium) of Eugenia reinwardtiana conforms with that of Eugenia s.s. as

elucidated by Schmid (1972a, b, c). A molecular analysis of mainly S African taxa by

Van der Merwe et al. (2005) placed it in a clade with species with eastern, 1.€., Asian,

affinities. It was not in the clade with species formerly attributed to /ossinia Comm.

Ex C:

Eugenia koolauensis var. glabra ditters by being glabrous with the flowers

sometimes in two approximates pairs. The type was collected from a dying tree.

An anonymous reviewer of the present paper, perhaps echoing a remark by Diels

(1921: 531) suggested inclusion of Eugenia palumbis Merr. Hosokawa (1940: 542)

and Stone (1970: 446, 448, t. 75, 76) regarded it as distinct. Thus:

Eugenia palumbis Merr., Philipp. ]. Sci. 9: 122 (1914). — Jossinia palumbis (Merr.)

Diels, Bot. Jahrb. Syst. 56: 531 (1921). TYPE: Costenoble 1173, Guam, Tambun

(holo US 653738).

120 Gard. Bull. Singapore 65(1) 2013

According to another, referring to Hyland (1983), E. bryanii might be a synonym of

this, but Hosokawa (1940: 542) without comment, and Stone (1970: 447), tentatively

kept it as distinct:

Eugenia bryanii Kaneh., Botanical Magazine (Tokyo) 51: 913, f. 68 (1937). — Jossinia

bryanii (Kaneh.) Hosok., ]. Jap. Bot. 16: 542. 1940. TYPE: Bryan 1229, Guam,

Achugas Point (holo FU).

Eugenia reinwardtiana (Blume) DC. torma /utea St. John

Eugenia reinwardtiana (Blume) DC. forma /utea St. John, Phytologia 37: 441 (1977).

TYPE: St. John 14901, Polynesia, Gambier Islands, Mangareva, S side of Mt

Makoto (holo BISH; iso L).

St. John (1977) and Smith (1985) reported the fruits as being yellow to bright

orange to brownish, against red in the typical form. The latter did not mention the

palatability and said that there was no reliable local Fijian name. If the fruits are as

pleasant as reported elsewhere, this is remarkable and Fijian material should be studied

again to see whether it really belongs here. “It certainly does not look much like the

common form of E. reinwardtiana that occurs in Australia.” (Snow in litt.).

Myrtus cotini folio Plumier

Plumier collected in the Caribbean between 1689 and 1697. Polhill & Stearn (1976)

made the following observations. Plumier made over 1200 drawings (now in the

Bibliotheque Centrale, P), 508 of which were copied for Boerhaave in Leiden, the

“Codex boerhaavianus” (now in the Library of the University of Groningen, The

Netherlands). After Boerhaave's death these were acquired by Johan Burman in

Amsterdam, who noted that Linnaeus together with Adriaan van Royen had assisted

Boerhaave in his study of the “Plumerian Codex” in the winter of 1737-1738 when

Linnaeus stayed at Van Royen's place. Linnaeus made notes on it in an interleaved

copy of the Genera plantarum (now in LINN).

Plumier used the polynomial Myrrus cotini folio in 1703, while the plate and

descriptions were published by Burman in 1759. These references were not mentioned

by Linnaeus (Richter 1840), possibly because he had no idea of the identity. Only as

late as 1771 did he accept the Eugenia cotinifolia ot Jacquin (1768), see below.

Burman's combination was invalidly published as it was a phrase name;

therefore Steudel (1841) erred when he attributed “corinifolia” to him. The earliest

publication where a binomial was used was that by Aublet (1775), where in the index

to Latin names he cited Myrrus citrifolia for Myrtus 4 on p. 513, which is Plumier's

Myrtus cotini folio. The present identity is therefore with Myrcia citrifolia (Aubl.)

Urban.

Because all authors have relied on Plumier's plate and their combinations thus

are linked together by that, it seems the most logical choice to select it as the lectotype.

In some cases specimens are mentioned and the citation of Plumier is given in an

af sua

De a

seat

Eugenia nomenclatural notes 121

attempt to match the specimen-in-hand with existing literature. Obviously, especially

18th century authors had only a faint idea of the stupendous richness's of tropical

floras, and their specimens may well be something quite different from what Plumier

depicted. To designate these possibly misidentified specimens (if they still exist,

and, if they have been re-identified, can be found) as epitypes would make several

combinations heterotypic and legitimate, and may have unforeseen destabilisation of

well-accepted names.

Vahl (Jul-Dec 1791) coined Myrrus coriacea, citing Swartz (1788), who is often

referred to as the validating author. However, the latter had Plumier's taxon as an

unnamed variety of his Myrtus acris Sw. (see for more under Pimenta acris, below)

and when he did use M coriacea in 1798, he attributed it to Vahl. In the same period

Gmelin (late Sep-Nov 1791) was the first to make the combination Myrrus cotinifolia.

As both names by lectotypification are later homotypic synonyms of Myrtus citrifolia

Aubl., it is rather unimportant to argue which had the priority over what. In the list

below I have arranged them alphabetically.

Poiret (1798) described a fragmentary specimen obtained by Lamarck from the

garden of “citoyen” Cels and thought he could identify that with the plants described

and depicted as Myrtus cotini folio Plumier (1703) or Myrtus foliis alternis ovatis

Plumier (1759), and Caryophyllus aromaticus indiae occidentalis, foliis & fructu

rotundis Plukenet (1696), and doubtfully with Myrzus carvophyllata Jacqg. and Myrtus

acris Sw. However, as the Plumier plate is the lectotype of Myrrus cotinifolia Gmel.,

Poiret's use of the identical combination makes it an isonym.

Steudel (1841) mentioned what he thought were three different uses of Myrzus

cotinifolia: by Burman, Poiret, and Sprengel (1825). Steudel accepted that by Burman,

which is an invalid name. Actually, unknown to him, Gmelin (1791) was the first to

validly make this combination. The ones by Gmelin and Poiret are wholly or partly

based on Plumier's plate, so the combinations by Poiret and Steudel are isonyms of

that by Gmelin with no nomenclatural status. Sprengel by citing Eugenia Linnaeus

(i.€., 1771: 243) referred indirectly to Eugenia cotinifolia Jacq. (1768). It is therefore

a later homonym of Gmelin's name.

The correct combination seems to be as follows.

Myria citrifolia (Aubl.) Urb. in Fedde's Repert. 16: 150 (1919). — [Myrrus cotini

folio Plum., Nov. Pl. Amer., Cat. PL.: 19 (1703), nom. nud.; Pl. Amer.: 203, t. 208,

f. 2 (1759), nom. inval. (edited by J. Burman)]. — Myrzus citrifolia Aubl., Hist.

Pl. Guiane 1: 513 (1775); Table des noms Latins: 20 (1775). — (Myrtus acris Sw.

var. b Sw., Prodr: 79 (1788), sine comb.). — Myrrus coriacea Vahl, Symb. Bot.

2: 59 (Jul-Dec 1791); Sw.., FI. Ind. Occid. 2: 912 (1798), nom. superfi. — Myrtus

cotinifolia Gmel., Syst. Nat., ed. 13, 2: 792 (late Sep-Nov 1791), nom. superfi.;

Poir. in Lam., Encycel. 4: 410 (1798); Burm. ex Steud., Nomencl. Bot. ed. 2, 2:

177 (1841), isonyms. — Myrcia coriacea (Vahl) DC., Prodr. 3: 243 (1828), nom.

superfi. — Pimenta citrifolia (Aubl.) Kostel., Allg. Med.-Pharm. FI. 4: 1525 (1835).

— Aulomyrcia coriacea (Vahl) O. Berg, Linnaea 27: 70 (1855), nom. superfi. —

Myrcia coriacea (Vahl) DC. var. swariziana Griseb., FI. Brit. W. 1.: 234 (1860).

122 Gard. Bull. Singapore 65(1) 2013

— Aulomyrcia citrifolia (Aubl.) Amshoft, Bull. Torrey Bot. Club 75: 531 (1948).

LECTOTYPE (designated here): P/lumier s plate 205, fig. 2, India occidentalis, ?

Jamaica.

Eugenia paniculata Jacq., Coll. 2: 108, t. 5, f. 1 (Apr 1789) (1788); DC., Prodr.

3: 280 (1828), sub E. fragrans Willd. cum ? — Aulomyrcia jacquiniana O. Berg,

Linnaea 27: 69 (1855), non Aulomyreia paniculata O. Berg (1855: 49). — Myrcia

coriacea (Sw.) DC. var. jacquiniana (O. Berg) Griseb., FI. Brit. W. L.: 234 (1860).

— Myrcia paniculata (Jacq.) Krug & Urb. in Urb., Bot. Jahrb. Syst. 19: 577 (1895)

(“panniculata”). TYPE: Aquart in Herb. Jacquin, s.n., Martinique (holo W).

Caryophyllus cotinifolius Miller

Miller (16 Apr 1768) was the first to validate Caryvophyllus cotinifolius, which in

previous editions of the Dictionary he had called Caryophyllus foliis ovatis obtusis

oppositis, floribus sparsis alatibus and noted that this would be the same as “Myrrus

cotini folio. Plum. Cat. 19” of 1703.

| His material had been collected between 1734-1740 by the surgeon Robert

Millar in Cartagena of New Spain (now Colombia). There is no evidence that either

Millar or Miller sent a duplicate to Linnaeus or anybody else. The name is not

mentioned by Sweet (1826) which suggests that the species was not in cultivation in

England anymore.

From Miller's description and remarks it is obvious that that he was descnibing

living plants which he probably had grown in his garden in Chelsea, and tried to

identify these with existing lterature, e.g., Plumier's plate.

Remarkably, Scott (1980: 475) while stating that he had seen the holotype of

Eugenia cotinifolia Jacqg. in BM, noted that “it was collected or communicated by D.

Miller in 1763”. This is against the fact that Jacquin did not mention any collector,

but said that he had seen the specimen in Gronovius's herbarium with unknown

provenance! | think that there has been a mix-up with Philip Miller's Caryophyllus

cotinifolius. Note that “D.” is not an initial, but stands for “Dominus”. Mr. Govaerts et

al. (2008: 62) have equated this with Eugenia cotinifolia Jacq., see below.

Carvophyllus cotinifolius Miller, The Gardeners Dictionary, ed. 8: Carvophyllus 4 (16

Apr 1768). TYPE: Millar s.n. A” 1736, possibly cultivated in Chelsea from seed

from Colombia, Cartagena (holo BM).

Eugenia cotinifolia Jacqg.

Independently, Jacquin (1768, precise date unknown, presumably later than Miller)

described and depicted (fruits only) an Eugenia cotinifolia based on a specimen

he had seen (or received?) from Gronovius without an indication of its origin. He

compared it with E. carthagenensis Jacq. and E. uniflora, which he noted to have

seen in Martinique, where the natives called it “Cerisier de Cayenne”, or Cayenne

a

Ss, n dm

Eugenia nomenclatural notes 123

cherry. This was evidently misread by Linnaeus (1771) who gave as the provenance

of Jacquin's species “Cayenne” (French Guyana), the start of a lengthy confusion and

misapplication of its name. Sprengel (1825) for some reason added the Mascarenes to

its distribution.

Johan Frederik (Jan Fredrik) Gronovius (1686-1762) was the patron, host, and

friend of Linnaeus during his stay in Leiden, Rapenburg 52, with the Hortus botanicus

on the other side of the canal and his printers on the corner at no. 56, now the well-

know pub Barrera. Linnaeus surely saw his herbarium, obtained material from it, and

also (falsely) attributed the name Linnaea to him. There is an unwritten (?) convention

that you cannot name taxa after yourself (or your ancestors).

In Linnaeus's herbarium is a specimen (637.177; as usual without provenance)

misidentified (Merrill 1950: 332) as Myrtus pimenta L. with a pencilled note by J.E.

Smith referring to the Jacquin specimen in the Banks herbarium, BM. However,

Savage (1945) reported the presence of a list of specimens sent by Jacquin to Linnaeus

in the Linnaean Correspondence and this one was not in it. In short, its provenance is

unknown, and that it may have come from Gronovius, Jacquin, or even Miller is pure

speculation. 1 therefore think that McVaugh (1968) erred when he suspected that all

three references were based on the same source. However, he had found no match for

it among the taxa that he knew from the West Indies or northern South America.

Jacquin's herbarium was bought by Banks and is presently in BM. However,

his West Indian collections are rare and fragmentary (Dandy 1979). MeVaugh (1968)

couldn't find anything, but Scott (1980: 475) did. He noted that it was not identifiable

anymore, as flowers (Jacquin didn't have any) and fruits have been lost. In any case,

it was not like any species from the Mascarenes, Africa, Madagascar, Malesia, or

Australia that he had seen.

De Candolle (1828) made the combination /ossinia cotinifolia and (mis)applied

it to material that had come from the mountains of Bourbon (now Reunion) in the

Mascareignes. He cited Sprengel with a question mark, adding “excel. patr.”, which 1

read as “excluding provenance (patria)”, apparently referring to Cayenne. Because

of the influence of the Prodromus this was perpetuated by later authors for various

species there (e.g. Baker 1877, with 5 varieties!) and its distribution was gradually

extended to Sri Lanka, S India, and Polynesia. This is the interpretation of the epithet

that Hyland was referring to.

Actually, Blume (1850: 123) had already seen the error, but as he retained J.

cotinifolia DC. for the Mascareignes, excluding the references to Jacquin and Sprengel,

he actually created a new species with a later homonym, /Jossinia cotinifolia DC. ex

Blume, non Jacq., typified by Commerson 516 (holo L; iso K, P). This is a synonym of

E. orbiculata Lam. (Scott 1980: 480).

Urban (1920) restricted Miller's name to Plumier's Caribbean element, which

he identified with Myrcia citrifolia (Aubl.) Urban. This splitting-up is obviously

erroneous, as Miller described material from Colombia, and only attempted to match

it with existing, literature. Moreover, in lectotypification material has priority over

illustrations.

124 Gard. Bull. Singapore 65(1) 2013

It therefore cannot be ruled out that Miller's and Jacquin's species, only known

from a few 18th century collections, is now extinct. For some reason, Govaerts et al.

(2008: 139) give Venezuela as the distribution.

Eugenia cotinifolia Jacq., Obs. Bot. 3: 3, t. 53 (1768); L., Mant. Alt.: 243 (1771)

(“Cayenne”). —Myrtus cotinifolia (Jacq.) Spreng., Syst. Veg. 2: 481 (1825)

(“Cayenn. Mascaren.”), non Poir. (1798). — Jossinia cotinifolia (Jacq.) DC., Syst.

Veg. 3: 238 (1828). TYPE: Herb. Jacquin s.n. ex herb. Gronovius, provenance

unknown (holo BM; ? LINN).

Jossinia Comm. ex DC.

The ING at the moment of writing (in a version of 9 Feb 1996) stated that a type had

not been designated. However, Scott (1980) chose /Jossinia finifolia (Lam.) DC. before

Ashton (1981: 408) selected /ossinia cotinifolia (Jacq.) DC.

Jossinia Comm. ex DC., Prodr. 3: 237 (337) (1828). LECTOTYPE: Jossinia tinifolia

(Lam.) DC.

Other names

The following names are not in an alphabetical order as one is linked to the other.

Eugenia elliptica Lam.

This was described from Mauritius and reduced to one of the 5 varieties of Eugenia

cotinifolia by Baker (1877). Ashton (1981) regarded it as a synonym of the “typical

subspecies”, and added two more for Sri Lanka: Eugenia cotinifolia Jacqg. subsp.

codyensis (Munro ex Wight) P.S.Ashton from Sri Lanka and the Western Ghats, India,

and subsp. phillyreoides (Trimen) P.S.Ashton, a Sri Lanka endemice only known from

the type. Kostermans (1981: 164) disagreed with this and for what had been called

Eugenia cotinifolia and Eugenia elliptica in Sri Lanka he proposed the new species

Eugenia hypoleuca.

Blume (1850) made the new name Jossinia lamarckii tor Eugenia elliptica

Lam. and Myrtus elliptica Spreng., because he considered E. e/liptica Lam. and M.

elliptica Spreng as different from J. e/liptica DC, but the latter was based on that of

Lamarck and /ossinia lamarckii Blame is therefore a superfluous name. Scott (1990:

12) has all “e//ipticae” under E. eliptica, and (p. 16) Jossinia lamarekii erroneous!y

under £. lucida Lam., as if it was an independent species with Commerson 512 (L,

“holo”) as the type.

Eugenia elliptica Lam., Encycl. Meth. 3: 206 (1789). — Myrtus elliptica (Lam.) Spreng.,

Syst. Veg. 2: 483 (1825). — Jossinia elliptica (Lam.) DC., Prodr. 3: 237 (1828).

Eugenia nomenclatural notes 125

— Jossinia lamarckii Blume, Mus. Bot. 1: 121 (1850) (“1849”), nom. superfl. —

Eugenia cotinifolia Jacq. var. elliptica (Lam.) Lam. ex Baker, FI. Mauritius: 114

(1877). TYPE: Commerson s.n., Mauritius (holo P-LA; iso P, P-JU 73923).

Govaerts et al. (2008: 142) added to this:

Jossinia cordifolia Bojer, Hort. Maurit: 141 (1837), nom. nud. — Fugenia cotinifolia

Jacq. var. cordifolia Bojer ex Baker, FI. Maurit. Seych.: 114 (1877). TYPE: Bojer

s.n., Mauritius (K).

Eugenia hypoleuca Thwaites ex Kosterm.

This name needed to be included here, as Kostermans (1981: 164) compared it to

Eugenia codyensis Munro ex Wight and E phillyreoides Trimen.

Eugenia hypoleuca Thwaites ex Beddome, For. Man.: 112 (1872), nom. nud.; Kosterm.,

Quart. J]. Taiwan Mus. 34 (3-4): 164 (1981). TYPE: Kostermans 28088 (holo L,

iso PDA).

Eugenia codyensis Munro ex Wight

Eugenia codyensis Munro ex Wight, III. Ind. Bot. 2: 13 (1841) — Eugenia cotinifolia

Jacq. subsp. codyensis (Munro ex Wight) P.S.Ashton in Dassan., Rev. Handb. FI.

Ceylon 2: 412 (1981). — Syzygium codvense (Munro ex Wight) Chandrab., Biol.

Mem. 2: 57 (1977). TYPE: Wight s.n., India, Karnataka, Coorg (Kodagu) near

Mercara (Madikeri) (12 25” N, 75" 45'E)(holoK).

Notes. Named after the village Kody or Cody near Vittal close to Sampage Ghat. This

locality is also mentioned for Ophiorrhiza codyensis Gamble (1919).

Kostermans (1981: 165) said that from the description this is a species distinct

from E. hypoleuca, but Govaerts et al. (2008: 185) equated the two.

Eugenia phillyreoides Trimen

Eugenia phillvreoides Trimen, J]. Bot. 23: 207 (Jul 1885); Syst. Cat. Ceylon: 33

(Jun / Jul 1885) (nom. nud., “phil/lvraeoides”); Handb. FI. Ceylon 2: 183 (1894);

Kosterm., Quart. J]. Taiwan Mus. 34(3-4): 164 (Dec 1981). — Syzygium phillyreoides

(Trimen) Santapau, Kew Bull. (3): 276 (1948). — Eugenia cotinifolia Jacqg. subsp.

phillvreoides (Trimen) P.S.Ashton in Dassan., Rev. Handb. FI. Ceylon 2: 413

(1981) (“phyllyraeoides”). TYPE: Anon. s.n., May 1584, Sri Lanka, summit of

Kalupahane Kande (holo K; iso L, PDA).

Eugenia mooniana Wight, Il. Ind. Bot. 2: 13 (1841); Icon. PI. Ind. Orient. 2: 4,t.

551 (1840-1843), non Gardn. (1841). SYNTYPES: Moon s.n., Sri Lanka (? BM),

Wight s.n., India, Courtallum (?kK.).

126 Gard. Bull. Singapore 63(1) 2013

Notes. Kostermans (1981: 165) said that this is a species entirely different from £.

hypoleuca, and more similar to E. mandugodaense Kosterm. and E. willdenowii DC.

There have been some alternative orthographies of the epithet. The original one

15 “phillvreoides”, but “phillyraeoides” and “phyllyraeoides” in later publications.

As it is derived from Phillyrea L. (Oleaceae) the correct orthography seems to be

“phillyreoides” [Rec. 60G.1(1) and (2)].

Eugenia bukobensis Engler

The combination Eugenia bukobensis Engler (1899) is for a species widespread

in Kenya, Tanzania, and Uganda. Engler had previously (1895) misidentified it

with Eugenia cotinifolia Jacqg. var. elliptica (Lam.) Lam. ex Baker. That it was a

misidentification 1s not immediately clear, but can be deduced from the facts that

Engler called it a “n. sp.” (new species) and cited Baker's combination name as “ex

Engl.”, which we now would write as “sensu Engl.”, or “auct. non Baker: Engl.”.

| However, Fosberg (1978) and Verdcourt (1999, 2001) regarded the citation

as a reason to declare the name superfluous and it was proposed for conservation

(Verdcourt et al. 2002). This proposal was rejected as unnecessary for the reasons

given above (Brummitt 2004).

Eugenia bukobensis Engler, Notizbl. Bot. Gard. Berlin 2: 289 (1899). — Syntypes:

Stuhlmann 3261, 3749, 3756, 3794, 3881, “Centralafrikanisches Seengebiet”, now

Tanzania, Bukoba (B, lost). NEOTYPE (designated by Verdcourt et al. 2002):

Gillman 260 (K.).

Eugenia cotinifolia Jacg. var. elliptica auct. non (Lam.) Baker: Engl., Pflanzenw. Ost-

Afrikas C: 287 (1895).

Myrtus pimenta L.

This is a totally different subject, brought about by Mrzus cyrrifolia Poir. (1798), non

M. citrifolia Aubl. (1775) and the confusion created by the application of Myraus cotini

folia Plum. by Landrum (1986: 106-107).

Linnaeus (1737: 501) mentioned Myrrus calvcibus absque appendiculis based

on Myrtus arborea aromatică, foliis laurinis Sloan., flor. 161 [i.e. Cat. PL. Jamaica,

1696]. hist. 2.p.76,t. 191. f£..1 [i.e., Voy. Jamaica, 1725], and Caryophyllus aromaticus

americanus, lauri acuminatis foliis, fructu orbiculari. Pluk. alm. 88, t. 155. f.4 [1692],

both from Jamaica. He noted that the generic position needed further scrutiny by

those who could study living plants. In his Flora zeylanica (1748) for some reason he

mentioned this species again (as Myrtus foliis alternis, but did not actually say that it

occurred in Ceylon = Sri Lanka), while in the Materia medica (17409 sub no. 225) he

cited the FI. Zeyl. with a question mark. The remark “Zeylon?, Cuba, Guiana” cited

by Landrum (1986: 106) is made under the next species, Myrrus foliis obverse ovatis

FI. Zeyl. 183?, which is Pimenta racemosa. This made later authors believe that he

described the species from Sri Lanka (e.g. Landrum 1986: 106). The confusion was

Eugenia nomenclatural notes 127

increased when in 1753 for Myrtus pimenta he stated “Habitat in India” and gave

references to both the Flora zeylanica and the Jamaica ones. This is another example

that he was not always too clear in his distinction between the East and West Indies.

Thus Poiret (1798) was misled to think that there were American and Ceylonese species

involved and he apparently thought that the East Indian one was the major part and so

proposed Myrtus cytrifolia tor the American one. This is an orthographic variant of M.

citrifolia Aubl. (1775) and also is a superfluous name for Myrtus pimenta.

It 1s interesting to note that Heyne (1950: 1181, sub Pimenta officinalis Lindl.)

remarked that cultivation outside Jamaica has always been unsuccessful, and the plants

only exceptionally flowered. It was introduced in Sri Lanka in 1824.

According to Landrum (1986, with an extensive synonymy) the correct name is

Pimenta dioica (L.) Merr., and he appointed as the lectotype Sloane, History of Jamaica

2: t. 191, £. 1. 1725. There is no mention of the possible presence of a specimen in the

Sloane Herbarium (BM) that may have served as the basis of the plate (“typotype”)

and would be a good candidate for an epitype.

Myrtus caryophyllata L.

The German physician, Paul Hermann, prepared a number of herbania in book form

during his stay in Ceylon (Sri Lanka) between 1672 and 1677. One of these, now in

the Institute de France, Paris, was used by Burman (1737). Lourteig (1966) gave an

enumeration of the contents of its single volume. The largest and most important copy,

consisting of 5 volumes, is that now in BM which was seen by Linnaceus (1748). A

third copy in two volumes is in L which, contrary to Van Ooststroom (1937), was not

seen by Linnaeus. It therefore contains no direct Linnaean elements although many

specimens may be syntypes under Art. 9 Note 2(c). A fourth 1-volume copy 1s in the

Forschungsbibliothek, Gotha, Germany, extensively discussed by Rauschert (1970).

Linnaeus (1748) described Myrrus foliis obverse ovatis with a fairly detailed

description and the following references:

Cerasus humilis umbellata, flosculis incarnatis, fructu Montinghos dicto. Burm. zeyl.

SIA

Caryophyllus aromaticus indiae occidentalis, foliis & fructu rotundis, dipyrene, seminus

fere orbiculatis planis. Pluk. alm. 88, t. 15.f.3 (an?)

Danighas Herm. zeyl. 3.

Dam, Herm. zeyl. 14, 53.

Rightly, he was not sure about the Plukenet reference, as this refers to a West

(!) Indian collection, which, as we now know, possibly represents Pimenta racemosa

(MIll.) ].W.Moore (Landrum 1986: 106), but Linnaeus's ideas about India were rather

hazy (as noted above, his “India” can refer to both the West and East Indies!) and so

he confused himself and later authors.

For his descriptions he used the BM Hermann herbarium in which there are

six fragments. All have been regarded as original elements by Jarvis (2007) and the

lectotypification is attributed to Kostermans (1981: 133). However, the latter merely

stated “Herb. Hermann (BM)”. BM 0006211251 on vol. 1, fol. 7 is designated here as

128 Gard. Bull. Singapore 65(1) 2013

the lectotype. BM 000621253 would be an isolectotype. The other parts in the other

volumes were most likely collected at a later moment, and so are syntypes. The L

Hermann collection (Van Ooststroom, 1937: fol. 22), although not seen by Linnaeus, |

would call a syntype [Art. 9, Note 2(c)]. Lourteig (1966) did not mention any specimen

in the Paris copy, and Rauschert (1970) none in that at Gotha.

In 1749, Linnaeus apparently had changed his mind and accepted the reference

to Plukenet and the origin as Cuba and Guiana (!), while the reference to the Flora

zeylanica and Zeylona were given a question mark. In 1753 he reversed again, now

giving the references to the Flora zeylanica and Plukenet equal status, but with

“Zeylona” as the only provenance. His reference to the Materia medica should read

“226”, not 225”, which latter number is correctly cited under the next species, Myrrus

pimenta.

Obviously, the Plukenet citation should be discarded as being an attempt to

identify material-in-hand with existing literature. This was also realised by Swartz

(1788, 1798), see below under Pimenta acris (Sw.) Kostel.

Although Trimen identified the Hermann specimens, he (1894: 174) probably

because of the Kew Rule (first epithet used under a particular generic name) called

the Sri Lanka species Eugenia corymbosa Lam. (1789) with Myrrus carvophyllata L.

(1753) and Syzygium carvophyllaeum Gaertn. (1788) in synonymy.

Eugenia corymbosa Lam. (1789: 199) is based on Vara Rheede, Hort Malab.

5: 53, t. 27 (1685) and a Sonnerat collection from India. The latter would seem the

obvious type. Ashton (1981: 451) cited it as Syzygium corvmbosum (Lam.) DC, which

is an error for “(Blume) DC.”, based on Ca/yprranthus corymbosus Blume (1824:

291) from Java. De Candolle (1828: 261) transferred the latter to Syzygium corvmbosa

(Blume) DC. while he retained (1828: 284) Eugenia corymbosa Lam. in Eugenia.

The occurrence of this species in Borneo as is mentioned in the older literature

is erroneous, and probably refers to Syzygium lineatum (DC.) Merr. & L.M.Perry

(1939: 172).

The correct name is Syzygium carvophyllatum (L.) Alston in Trimen, Hand-

Book FI. Ceylon 6, Suppl.: 116 (1931).

Myrtus caryophyllus Spreng.

Myrtus carvophyllus Spreng.. Syst. Veg. 2: 485 (“483”) (1825) is a superfluous name for

Carvophyllus aromaticus L. from the Moluccas. He also cited Eugenia carvophyllata

Thunb., Willdenow.

Syzygium caryophyllaeum Gaertn.

Syzygium caryophyllaeum Gaertn. is the conserved type ot Syzygium Gaertn.

designated by MceVaugh (1956). It was described on material then in L from Ceylon

(De Candolle 1828: 260, said “herb. Van-Royen”). This appears to have been lost. —

Eugenia carvophyllaeum (Gaertn.) Wight, IIl. Ind. Bot. 2: 15 (1841); Icon. Pl. Ind.

Eugenia nomenclatural notes 129

Orient. 2: 3, t. “540 / 1017” (1840-1843). EPITYPE (designated here): Kostermans

24707 (L! iso K! PDA, US).

Pimenta acris (Sw.) Kostel.

Pimenta acris (Sw.) Kostel. was indirectly based on Myrtus acris Sw. (1788: 79; 1798:

909), which is generally considered as a superfluous name for Myrtus carvophyllata L.

This is incorrect, for Swartz referred to Caryophyllus aromaticus indiae occidentalis,

foliis et fructu rotundis, dipyrene, seminibus fere orbiculatis planis Pluk. (Alm. 188,

t. 155, f. 3. 1692) and Myrtus caryophyllata sensu Jacqg. (1767) from the Caribbean,

which he regarded as different from Linnaeus's East Indian M. carvophyllata L. as

he explained more fully in 1798 (p. 910). In this he was followed by Kosteletzky

(1835). This idea, however, was caused by the false impression that Linnaeus (1753)

made when he gave the provenance of his Myrtus carvophyllata as “Zeylona”, while

including also a South American reference. The Plukenet reference may represent

Pimenta racemosa (Mill.) J.W. Moore (Landrum 1986: 106).

The name therefore originally was legitimate, but in 1798 Swartz also

cited Caryophyllus racemosus “Mill. Dict.”, which refers to the Gard. Dict. Ed.

8, Caryophyllus no. 5. 1768, which epithet under the present rules he should have

adopted, and it becomes a synonym. According to Landrum (1986: 108) this is now

Pimenta racemosa (Mill.) ].W. Moore var. racemosa.

Pimenta acris (Sw.) Kostel. var. citrifolia Kostel. was mentioned by Ashton

(1981: 403) as introduced in Sri Lanka. | have not found this combination made

anywhere, and it is not in Govaerts et al. (2008: 342).

Eugenia roxburghii DC.

Eugenia roxburghii DC., Prodr. 3: 271, £ 74 (1828). — Eugenia zeylanica auct. non

Willd.: Roxb., Hort. Beng.: 92 (1814) (“zeylonica”), nom. nud.; FI. Ind. 2: 490

(1832); Ashton in Dassan., Rev. Handb. FI. Ceylon 2: 416 (1981) (“ceylanica”).

— Eugenia bracteata (Willd.) Raeusch. ex DC. var. roxburghii (DC.) Duthie in

Hook.f., FI. Brit. India 2: 502 (1879). TYPE: Roxburgh in Herb. Lambert in Herb.

DC. (holo G; microfiche IDC), see also Wa/lich 3621-A (K:; IDC microfiche 7394)

and Roxburgh s.n., Icon Ined. 2502 (CAL, K), Bangladesh, Sylhet.

Myrtus bracteata Willd., Sp. PL., ed. 4, 2, 2: 969 (1799). — Eugenia ? bracteata

(Willd.) Roxb., Hort. Beng.: 37 (1814), nom. inval.; Raeusch. ex DC., Prodr.

3: 264. 1828; Roxb., FI. Ind., ed. 2, 2: 490 (1832), isonym, non Rich. (1792). —

Syzygium bracteatum (Willd.) Racusch (“Roxb.”) ex Korth., Ned. Kruidk. Arch.

1: 205 (1846); Raizada, Indian For. 74: 336 (1948) (n.v.), isonym. TYPE: Klein 4”

1796 in Herb. Willdenow 9553 (holo B; microfiche IDC 7440), “India orientali”,

probably Tamil Nadu, Tranquebar (= Tharangambadi).

Myrtus ruscifolia Willd., Sp. PI., ed. 4, 2, 2: 970 (1799), non Eugenia ruscifolia Poir.

(1813). — Syzygium ruscifolium ( Willd.) Santapau & Wagh, Bull. Bot. Surv. India S:

130 Gard. Bull. Singapore 65(1) 2013

109 (1964), nom. superfl. [Duthie in Hook.f., 1879: 502, already had synonymised

M. ruscifolia with M. bracteata, therefore, under Art. 11.5 Santapau & Wagh

should have adopted S. bracteatum (Willd.) Raeusch ex Korth.]. LECTOTYPE

(designated here): Roxbureh in Herb. Willd. 9557, India orientali, probably Tamil

Nadu, Trangquebar (= Tharangambadi) (B; IDC microfiche 7440: third sheet on

right in microfiche; the other two are from Rottler through Klein, collected Sep 11,

Oct 3, 1799, so too late to have been with Willdenow in Dec 1799).

Myrtus latifolia B. Heyne ex Roth, Nov. Pl. Sp.: 232 (1821); Panigrahi, ]. Econ.

Taxon. Bot. 5: 993 (1984), non Eugenia latifolia Aubl. (1775). — Myrtus heynei

Spreng., Syst. Veg. 2: 482 (1825), nom. superfi. — Fugenia heynei Rathakr. & N.C.

Nair, J. Econ. Taxon. Bot. 5: 232 (1984), nom. superfi. | Eugenia bracteata (Willd.)

Roxb. cited]. — Eugenia rothii Panigrahi, ]. Econ. Taxon. Bot. 5: 994 (1984), nom.

superfl. (Eugenia bracteata cited). TYPE: Heyne in Herb. Roth, India, probably

Tamil Nadu, Tranquebar (= Tharangambadi) (holo B, probably lost).

Eugenia fasciculata Wall. ex Blume, Mus. Bot. 1: 87 (1850) (1849). — Eugenia

bracteata (Willd.) Raeusch. ex DC. (“Roxb.”) var. fasciculata (Wall. ex Blume)

Duthie in Hook.f., FI. Brit. India 2: 502 (1879). — Eugenia rothii Panigrahi var.

fasciculata (Willd. ex Blume) H.B. Naithani, FI. PI. India, Nepal & Bhutan: 165

- (1990). LECTOTYPE (designated here): Wa/lich 3622, India, Mont. Pundora (?),

1824 (L: sh. no. 898.203 55; iso L, sh. no. 898.203-—54; K: IDC microfiche 7396).

Myrtus quadripartita Royen ex Blume, Mus. Bot. 1: 87 (1850) (*1849”; nom. nud., in

synon. sub E. bracteata) — Vouchers: Kotella (Herb. A. van Royen s.n., Sri Lanka,

L sh. no. 898.203— 50, — 52,—53).

Eugenia macrosepala Duthie in Hook.f., FI. Brit. India 2: 501 (1879). TYPE: Srocks

s.n., India, N. Canara (holo K).

Distribution. Bangladesh (Sylhet), India (Meghalaya, S$ India, Madras, Namailay

Mts), Sri Lanka, Myanmar (Irrawaddy, Tenasserim), Thailand (Northern: Phitsanulok,

Uttaradit; Northeast: Sakon Nakhon; East: Chaiyaphum; Southeast: Chanthaburi), S

Vietnam (Nhatrang; Thuduc; Poulo Condor, now Conson).

Notes. Govaerts et al. (2008: 163) regarded this as a “true” Eugenia.

The specimens cited under Syzygium bracteatum (Willd.) Raeusch (“Roxb.) ex

Korth., Ned. Kruidk. Arc. 1: 205. 1846, belong to Syzygium zeylanicum (L.) DC. (Mr.

Wuu Kuang Soh, or. comm.).

Calyptranthes ramiflora Blanco

Govaerts et al. (2008: 416) included as a synonym Syzygium latifolium Blanco (1845)

and regarded it as a nom. illeg. (non DC.). Actually it is a misidentification by Blanco

of what he had described earlier (1837) as Ca/yprranthes ramiflora.

Calyptranthes ramiflora Blanco, FI. Filip.: 420 (1837). — Syzygium latifolium auct.

non DC.: Blanco, FI. Filip., ed. 2: 294 (1845). NEOTYPE (designated here):

Eugenia nomenclatural notes 131

Merrill Sp. Blancoan. 669 (Ramos), Philippines, Luzon, Bulacan Prov.. Sapang

Santel, December 18. 1914 [holo US. 00904347, Barcode No.: 00689164; iso

A, B, BM, BO, CAL, F, GH, K, L, MO, NSW, NY, P,U (in L), UC, W]. See

http://botany.si.edu/colls/blanco/blancoimages/Blanco_640/00689164.jpg

= Eugenia similis Merr. = Syzygium simile (Merr.) Merr. (Robinson 1909: 386, 403;

followed by Merrill 1918).

Eugenia salomonica C.I.W hite

Eugenia salomonica C.T. White, ]. Arnold Arbor. 32: 141 (1951). TYPE: Kajewski

1574, Solomon Isl., Bougainville, Kieta, March 1930 (holo A).

Distribution. Papua New Guinea (St. Matthias Group: Mussau Isl.; Bougainville),

Vanuatu (former Solomon Isl.: Santa Cruz Isl.: T&motu Noi (Nendâ); Santa Isabel).

ACKNOWLEDGEMENTS. Mr. L.A. Craven (CANB), Dr. N. Snow (BISH), Dr. P.G. Wilson

(NSW), Mr. P. Widodo (Institut Pertanian Bogor), and two unknown reviewers are much

thanked for various comments. Craven provided localities of Eugenia reimwardtiana in PNG.

Dr. H.-]. Esser kindly checked the holdings in M for some specimens.

References

Ashton, P.S. (1981) Myrtaceae. In: Dassanayake, M.D. A Revised Handbook to the Flora of

Ceylon 2: 408, 412, 450-451. New Delhi: Amerind Publishing Co.; Rotterdam: A.A.

Balkema.

Aublet, J.B.C.F. (1775) Histoire des plantes de la Guiane francoise |: 513; Table des noms

Latins: 20. London: Aublet; Paris: Didot f.

Baker, J.G. (1877) Flora of Mauritius and the Seychelles: 114. London: Reeve & Co.

Blume, C.L. (1824) Ueber die vegetation des Berges Gedee auf der Insel Java. Flora 7: 291.

Blume, C.L. (1850) (1849). Ord. Myrtaceae. Subord. Myrteae. Museum Botanicum Lugduno-

Batavum |: 119-124.

Brummitt, R.K. (2004) Report of the Committee for Spermatophyta: 54. axon 52: 822.

Burman, ]. (1737) Thesaurus Zeylanicus: 57. Amsterdam: Jansson-Waesberg & Schouten.

Dandy, J.E. (1979) In: Stafleu, F.A. & Cowan, R.S. Taxonomic Literature ed. 2, 2. Regnum

Veg. 98: 407.

De Candolle, A.P. (1828) Myrtaceae. In: Prodromus Systematis Naturalis Regni Vegetabilis 3:

238. Paris: Treutel & Wiirz.

Diels, L. (1921) Die myrtaceae Mikronesiens. Bor. Jahrb. Syst. 56: 531.

Engler, A. (1895) Die Pflanzemwelt Ost-Afrikas und der Nachbargebiete C: 287. Berlin: Reimer.

Engler, A. (1899) Diagnosen neuer Afrikanischer Pflanzenarten. 3. Myrtaceae. Notizbl. Kânigl.

Bot. Gart. Berlin 2: 289.

Fosberg, F.R. (1978) Miscellaneous notes on the flora of Aldabra and neighbouring islands.

VII. Eugenia elliptica var. levinervis (Myrtaceae). Kew Bull. 33: 133—134.

132 Gard. Bull. Singapore 65(1) 2013

Gaertner, ]. (1788) De fructibus et Seminibus Plantarum: 166, t. 33, f. 1. Stuttgard: Gaertner.

Gamble, ].S. (1919) Decades kewenses. Bu//. Misc. Inform. Kew 1919: 406.

Gmelin, J.F. (1791) Systema Naturae ed. 13, 2: 792. Leipzig: Beer.

Govaerts, R. et 12 al. (2008) Wor/d Checklist of Myrtaceae: xv, 455. U.K.: Royal Botanic

Gardens, kew. (See also http://apps.kew.org/wesp/myrtaceae)

Heyne, K. (1950) De Nurige Planten van Indonesie |: 1181. Bandung: Van Hoeve,

“S-Gravenhage.

Hosokawa, T. (1940) Materials of the botanical research towards the flora of Micronesia (XIX).

J. Jap. Bot. 16: 54.

Hyland, B.P.M. (1983) A revision of Syzygium and allied genera (Myrtaceae) in Australia.

Austral. J. Bot., Suppl. Ser. 9: 31.

Ingle, H.D. & Dadswell, H.E. (1953) The anatomy ofthe timbers of the south-west Pacific area.

Austral. J. Bot. L: 353-401.

Jacquin, N.J. (1767) Observationes Botanicarum 2: |. Vienna: Kraus.

Jacquin, N.J. (1768) Observationes Botanicarum 3: 3, t. 53. Vienna: Kraus.

Jarvis, C. (2007) Order Out of Chaos: 687. London: Linnean Society.

Kosteletzky, V.F. (1835) A/lgemeine Medizinisch-Pharmazeutische Flora 4: 1526. Prague:

Borrosch & Andre.

Kostermans, A.J.G.H. (1981) Eugenia, Syzygium and Cleistocalyx (Myrtaceae) in Ceylon: A

monographical revision. Quart. J. Taiwan Mus. 34(3-4): 132-133, 164-165.

Lamarck, J.B.P.A. de Monet de (1789) Encyclopedie Methodique 3: 199, 206. Paris:

Panckoecke; Liege: Plomteux.

Landrum, L.R. (1986) Campomanesia, Pimenta, Blepharocalyx, Legrandia, Acea, Myrrhinum,

and Luma (Myrtaceae). FI. Neotrop. 45: 83-84, 105-107.

Linnaeus, C. (1737) Hortus Cliffortianus: 501. Amsterdam: Clifford.

Linnaeus, C. (1748) Flora Zeylanica: 83. Amsterdam: Wetstenium.

Linnaeus, C. (1749) Materia Medica: 78. Stockholm: Salvius.

Linnaeus, C. (1753) Species Plantarum: 472. Stockholm: Salvius.

Linnaeus, C. (1771) Mantissa Altera: 243. Stockholm: Salvius.

Lourteig, A. (1966) L'herbier de Paul Hermann, base du Thesaurus zeylanicus de Johan

Burman. Zaxon 15: 23-33.

Lucas, E.J., Belsham, S.R., Nic Lughadha, E.M., Orlovich, D.A., Sakuragui, C.M., Chase,

M.W. & Wilson, P.G. (2005) Phylogenetic patterns in the fleshy-fruited Myrtaceae —

preliminary molecular evidence. P/. Syst. Evol. 251: 35-51.

MeVaugh, R. (1956) Nomenclatural notes on Myrtaceae and related families. Zaxon 5: 164

165.

MeVaugh, R. (1968) Myrtaceae, in B. Maguire et al., The Botany of the Guyana Highland-Part

VIII. Mem. New York Bot. Gard. 18(2): 217-218.

Merrill, E.D. (1918) Species Blancoanae. Publ. Bur. Sci. Gov. Lab. 12: 289.

Merrill, E.D. (1950) The synonymy of. Jossinia reinwardtiana (Blume) Blume. J. Arnold Arbor:

31: 329-333.

Merrill, E.D. & Perry, L.M. (1939) The myrtaceous genus Syzygium Gaertner in Borneo. Mem.

Amer. Acad. Arts 18. = Mem. Gray Herb. 4: 140, 172.

Miller, P. (1768) The Gardeners Dictionary ed. 8: 4, 5 (Carvophyllus). London: Miller.

Pike, K.M. (1956) Pollen morphology of Myrtaceae from the south-west Pacific area. Ausiral.

J. Bot. 4: 13-53.

Plukenet, L. (1696) 4/magestum Botanicum: 88. London: Plukenet.

Plumier, C. (1703) Nova Plantarum Americanum Genera: 19. Paris: Bondot.

Eugenia nomenclatural notes 133

Plumier, C. (1759) Plantarum Americanum: 203, t. 208, f. 2. Leiden: Burman;Amsterdam.

Poiret, ].L.M. (1798) In: Lamarck, J.B.A.P. de Monet de, Encyclopedie Merhodique, Botanique

4: 410. Paris: Agasse.

Polhill, R.M. & Stearn, W.T. (1976) Linnaeus's notes on Plumier drawings with special

reference to Mimosa latisiliqua. Taxon 25: 323-325.

Rauschert, S. (1970) Das Herbarium von Paul Hermann (1646-1695) in der Forschungbibliothek

Gotha. FHercynia N.E 7: 301-328.

Rheede tot Draakestein, H.A. van (1685) Hortus Indicus Malabaricus 5: 53, t. 27. Amsterdam:

Van Someren & Van Dyk.

Richter, H.E. (1840) Codex Botanicus Linnaeanus. Pp. 1102 + 202. Leipzig: Wigand.

Robinson, C.B. (1909) A preliminary revision of Philippine Myrtaceae. Philipp. J. Sci. 4: 386,

403.

Savage, S. (1945) A Catalogue of the Linnaean Herbarium: Pull-out Leaf at the Back. London:

Taylor & Francis.

Schmid, R. (1972a) A resolution of the Fugenia-Syzygium controversy (Myrtaceae). Amer. J.

Bot. 59: 423-436.

Schmid, R. (1972b) Floral anatomy of Myrtaceae. 1. Syzygium. Bot. Jahrb. Syst. 92: 435-489.

Schmid, R. (1972c) Floral anatomy of Myrtaceae. II. Eugenia. J. Arnold Arbor. 53: 336-363.

Scott, A.J. (1980) Notes on Myrtaceae in the Mascarenes with some recombinations for taxa

from Aldabra, Malaya, New Caledonia. Kew Bull. 34: 473-475, 477, 480, 496.

Scott, A.J. (1990) Myrtaceae. In: Flore des Mascareignes 92: 12, t. 2, f. 5, 6. Mauritius: Sugar

Industry Research Institute; Paris: ORSTOM; U.K.: Royal Botanic Gardens, Kew.

Smith, A.C. (1985) Myrtaceae. In: Flora Vitiensis Nova 3: 374, 376. Lawai, Hawaii: Pacific

Tropical Botanical Garden..

Snow, N. & Wilson, P.G. (2010) New species of Eugenia and Gossia (Myrtaceae: Myrteae)

from Papua New Guinea. 7elopea 12: 454-457, t. 1, 2. (See Telopea 13: 359 (2011) for

emendation of type.)

Sprengel, K. (1825) Systema Vegetabilium ed. 16(2): 481. Gottingen: Dieterich.

St. John, H. (1977) Notes on Eugenia (Myrtaceae) and Haloragis (Haloragaceae) from

southeastern Polynesia. Pacific Plant Studies 34. Phyrologia 37: 441.

Steudel, E.T. (1841) Nomenclator Botanicus ed. 2(2): 177. Stuttgart, Tubingen: Cotta.

Stone, B.C. (1970) The flora of Guam. Micronesica 6: 446-449, t. 75, 76. Swartz, O. (1788)

Nova Genera & Species seu Prodromus: 79. Upsala, Abo: Holmiae.

Swartz, O. (1798) Flora Indiae Occidentalis: 912-913. Erlangen: Palm.

Sweet, R. (1826) Hortus Brittanicus: 155-158. London: Ridgway.

Trimen, H. (1894) A Hand-Book to the Flora of Ceylon 2: 174, 183. London: Dulau & Co.

Urban, 1. (1920) Plumier's Leben und Schriften. Reperr. Spec. Nov. Regni Veg. Beihefte 5: 86.

Vahl, M. (1791) Symbolae Botanicae 2: 59. Copenhagen: Vahl.

Van der Merwe, M.M., van Wyk, A.E. & Botha, A.M. (2005) Molecular phylogenetic analysis

of Eugenia L. (Myrtaceae), with emphasis on southern African taxa. P/. Syst. Evol. 251:

21-34.

Van Ooststroom, $.]. (1937) Hermann's Collection of Ceylon plants in the Rijksherbarium

(National Herbarium), at Leyden. B/umea, Suppl. 1: 198-209.

Verdcourt, B. (1999) The genus Eugenia L. (Myrtaceae) in East Africa. Kew Bull. 54: 47-48.

Verdcourt, B. (2001) Myrtaceae. In: Flora of Tropical East Africa: 59-60. Rotterdam,

Brookfield: A. A. Balkema.

Verdcourt, B., Eilu, G. & Katende, A. (2002) Proposal to conserve the name Fugenia bukobensis

Engl. (Myrtaceae) with a conserved type. Zaxon 51: 389.

134 Gard. Bull. Singapore 65(1) 2013

Wilson, P.G. (2009) Conspectus of the genus Eugenia (Myrtaceae) in the Philippines. Gard.

Bull., Singapore 60: 399-410.

Wilson, P.G. (2011) Myrtaceae. In: K. Kubitzki 7he Families and Genera of Vascular Plants

10. Flowering plants- Eudicots- Sapindales, Cucurbitales, Myrtaceae: 227-228, 245,

252-253. Heidelberg: Springer- Verlag.

Wilson, P.G., O'Brien, M.M., Heslewood, M.M. & Quinn, C.J. (2005) Relationships within

Myrtaceae sensu lato based on a matk phylogeny. P/. Sysr. Evol. 251: 3-19.

Instructions for contributing authors (continued)

Title and authorship. The title should concisely describe the contents. If a scientific name is used, its

authority 1s normally excluded, but the family name would be provided. Authors” names, affiliations

and postal/ e-mail addresses are stated below the utle. If more than one author, indicate “corresponding

author”. Avoid footnotes. A short running title (up to six words) should also be provided.

Abstract. The abstract is at most 100-300 words. It should concisely indicate the article”s contents without

summarising it; mentioning novelties and name changes. Keywords: Suggest at most eight keywords, in

alphabetical order.

Scientific names and author abbreviations. Genus and species names of organisms must be italicised and

followed by the authority (with family name in parentheses) when first mentioned in the text or diagnoses.

Standards for author abbreviations include:

Brummitt, R.K. & Powell, C.E. (1992) Aurhors of Plant Names. Kew: Royal Botanic Gardens, Kew.

Kirk, P.M. & Ansell, A.E. (1992) Aurhors of Fungal Names [Index to Fungi Supplement]. Wallingford:

CAB International.

Herbarium abbreviations (http://sciweb.nybg.org/science?/Index Herbariorum.asp) follow

Holmegren, P.K., Holmegren, N.H. & Barnett, L.C. (eds) (1990) Index Herbariorum. Part 1: The Herbaria

of the World [Regnum Veg. vol. 120]. New York: New York Botanical Garden.

Journal and book title abbreviations. For journals:

Bridson, G.D.R., Townsend, S.T., Polen, E.A. & Smith, E.R. (eds) (2004) BPH-2: periodicals with

botanical content: comprising a second edition of Botanico-Periodicum-Hunlianum. Pittsburg: Hunt

Institute for Botanical Documentation.

For books:

Stafleu, F.A. & Cowan, R. S. (eds) (1976-88) Taxonomic Literature. 2nd edition. 7 vols [Regnum Veg.

vols 94, 98, 105, 110, 112, 115, 116].

Stafleu, F.A. & Mennega, E.A. (eds) (1992—) Taxonomic Literature. Supplements [Regnum Veg. vols

12553130; 1832));

(A useful source of verify ing names of publications is

<http://asaweb.huh.harvard.edu:3080/databases/publication_ index.html>. If in doubt, list full titles.

Other abbreviations and units of measurement. |t using standard abbreviations and acronyms, give the

full term on first mention. Dates are cited as: 1 Jan 2000. SI (metric) units of measurement are used and

spelled out except when preceded by a numeral; they are abbreviated in standard form: g, ml, km, etc.

Tables. Tables are numbered in arabic numerals in the order they are first mentioned in the text and carry

an indicative legend at the head. Tables are given at the end of the manuscript.

Iilustrations. All drawings, maps, graphs and photographic images (individually or collected in a plate)

are to be numbered in arabic numerals in the order they are first mentioned in the text, as Fig. 1, Fig. 2,

etc. (plate components would be referred to in the text as Fig. IA, IB, Fig. IA-D, etc.). If relevant, scale

bars should be used to indicate magnification.

When grouping photographs, the maximum page area 19.5 x 13 cm must be heeded. High resolution digital

images may be submitted as separare files (line drawings in black and white at 600 dpi, photographs at

300 dpi) sent electronically or in a CD. Do not embed images into the main text file.

References in the text. Citation in the text should take the form: King & Gamble (1886) or (King &

Gamble 1886), or King et al. (1886) if more than three authors to a work. Use 2000a, 2000b, etc. if several

papers by the same author(s) in one year are cited.

References listed at the end. There, works mentioned in the text are listed alphabetically as follows:

Dallwitz, M.J., Paine, T.A. & Zurcher, E.J. (1999) User *s Guide to the DELTA Editor. http://

biodiversity.uno.edu/delta/ (accessed on 2 Aug. 2010).

Persson, C. (2000) Phylogeny of Gardenieae (Rubiaceae) based on chloroplast DNA sequences from the

rps 16 intron and irnL(UAA)-F(GAA) intergenic spacer. Nordic J Bor. 20: 257-269.

Ridley. H.N. (1930) The Dispersal of Plants Throughout the World. Ashtord, U.K.: L. Reeve.

Smith, A.C. & Darwin, S.P. (1988) Rubiaceae. In: Smith, A.C. (ed) Flora Viliensis Nova, A New Flora of

Fiji 4: 143-193.

References to web-based resources should include either a doi (digital object identifier) specification

or full URL mentioning also the date it was accessed. Use of DNA sequences from GenBank should be

acknowledged and the studies for which the sequences were generated should be cited.

Style of nomenclatural summaries. The tollowing style is required:

Gardenia anisophylla Jack ex Roxb., FI. Ind. ed. Carey & Wall. 2: 561 (1824).

Medinilla alternifolia Blume, Mus. Bot. 1: 19 (1849).

If authors include full bibliographic data for these works in the list of references at the end of the paper,

they should also be mentioned in the text briefly, e.g., “Nomenelatural references researched include

Blume (1849) and Roxburgh (1824).”

Homotypie synonyms should be provided in a block, stating the type at the end.

Front cover picture: Aspidistra jiewhoei Tillich & Skorni€k. (Photo by J. Leong-Skornickovâ)

NATIONAL

PARKS

G,

€ Botan

Singapore Botanic Gardens, 1 Cluny Road, Singapore 259569 Tel: 64719921 Telefax: 64674832