s 2i2 7-

NATURAL HISTORY

ivlUSRUM LIBRARY

Journal of the *

Entomological Society

of British Columbia

Volume 110 Issued December 2013 ISSN #0071-0733

2015

ESBC

Entomological

©2013 Society of British

Columbia

Natural History Museum Library

00 183628

COVER: Agapostemon sp. (Hymenoptera: Halictidae)

A female Agapostemon (probably texanus) gathers nectar from a diffuse knapweed flowerhead.

Halictine bees run that gamut from true eusociality to solitary nesters and are as such an

excellent system for studying the evolution of hymenopteran social behaviour. Agapostemon

species can be communal nesters, but A. texanus as a species seems to be pretty steadfastly

solitary in its habits. Like other ground nesting bees, it has an annual life cycle where

overwintering females emerge in the warm part of the spring, build vertical burrows in soil and

provision individual eggs with a pollen ball to support larval development all the way through

to pupation. Males become abundant in late summer and fall and mated females will overwinter

in diapause to start the cycle over the following year. Unlike the bee, which is native, diffuse

knapweed is an invasive pest in western rangelands.

Photograph details:

Photograph by Robert Lalonde (UBC Okanagan). Made with a Canon EOS digital rebel T2i

equipped with a Canon 100mm f2.8 macro lens in natural light; ISO 800; f8 at 1/250 sec; on 8

July 2013 at 1557h on the UBC Okanagan campus in Kelowna, British Columbia.

The Journal of the Entomological Society of British Columbia is published

annually in December by the Society

Copyright© 2013 by the Entomological Society of British Columbia

Designed and typeset by Tanya Stemberger

Printed by FotoPrint Ltd., Victoria, B.C.

Printed on Recycled Paper.

J. Entomol. Soc. Br]t. Columbia 110, December 2013

Journal of the

Entomological Society of British Columbia

natural HISTORY

IVIUSEUM LIBRARY

1 8 APR 2015

Volume 110 Issued December 2013 ISSN #0071-0733

Directors of the Entomological Society of British Columbia, 2013-2014,

2

G.R. Pohl and R.A. Cannings. The new checklist of British Columbia Lepidoptera and how it

came to be 3

A. Pantoja, D.S. Sikes, A.M. Hagerty, Susan Y. Emmert, and Silvia Rondon. Ground beetle

(Coleoptera: Carabidae) assemblages in the Conservation Reserve Program crop rotation

systems in interior Alaska 6

S. Mathur, D.A. Raworth, K.S. Pike, and S.M. Fitzpatrick. Diagnostic molecular markers to

detect and identify primary parasitoids (Hymenoptera: Braconidae) of Ericaphis Jimbriata on

highbush blueberry 19

A.J. Stock, T.L. Pratt, and J.H. Borden. Seasonal flight pattern of the Western Balsam Bark

Beetle, Dryocoetes confusus Swaine (Coleoptera: Curculionidae), in central British

Columbia 27

SCIENTIFIC NOTES

Chris J.K. MacQuarrie, Daryl J. Williams, and David W. Langor. Update on the establishment

of birch leaffniner parasitoids in western Canada 35

M. Jackson, C. Pyles, S. Breton, T. J. S. McMahon and P. Belton. British Columbia’s 50th

mosquito species, Aedes schizopinax 38

ANNUAL GENERAL MEETING ABSTRACTS

Entomological Society of British Columbia Annual General Meeting Symposium Abstracts: The

Rise and Fall of the Honeybee 40

Entomological Society of British Columbia Annual General Meeting Presentation

Abstracts 44

NOTICE TO CONTRIBUTORS

Inside Back Cover

J. Entomol. Soc. Brit. Columbia 1 10, December 2013

DIRECTORS OF THE ENTOMOLOGICAL SOCIETY

OF BRITISH COLUMBIA FOR 2012-2013

President:

Mike Smirle (president@entsocbc.ca)

Agriculture and Agri-Food Canada, Summerland

President-Elect:

Steve Perlman

University of Victoria

Past-President:

Ward Strong

B.C. Ministry of Forests, Lands and Natural Resource Operations

Treasurer:

Maxence Salomon (membership@entsocbc.ca)

Secretary:

Tracy Hueppelsheuser (secretary@entsocbc.ca)

B.C. Ministry of Agriculture, Abbotsford

Directors:

Renee Prasad (first term), Marla Schwarzfeld (first term). Bob Lalonde (second term), Jenny

Cory (second term), Karen Needham (second term)

Graduate Student Representative:

Ikkei Shikano

Regional Director of National Society:

Bill Riel

Natural Resources Canada, Canadian Forest Service

Editor, Boreus:

Gabriella Zilahi-Balogh (boreus@entsocbc.ca)

Canadian Food Inspection Agency

Web Editor:

Alex Chubaty (webmaster@entsocbc.ca)

Natural Resources Canada, Canadian Forest Service

Honorary A uditor:

Rob McGregor

Douglas College

Society homepage: http://entsocbc.ca Journal homepage: http://journal.entsocbc.ca

Editorial Committee of the Journal of the Entomological Society of British Columbia:

Editor-in-Chief:

Dezene Huber (joumal@entsocbc.ca)

University of Northern British Columbia

Editorial Board:

Lorraine Maclauchlan, Robert Cannings,

Steve Perlman, Lee Humble, Rob

McGregor, Robert Lalonde

Copy Editor: Monique Keiran

Technical Editor: Tanya Stemberger

J. Entomol. Soc. Brit. Columbia 110, December 20 13

3

FORUM

The new Checklist of British Columbia Lepidoptera and how it

came to be

GREGORY R. POHC and ROBERTA. CANNINGS ^

The Entomological Society of British

Columbia (ESBC) is publishing a new

checklist of the Lepidoptera of British

Columbia as the third volume in the ESBC's

Occasional Papers series (Pohl et al., in press).

Occasional Paper No. 1, published in 1951,

was "An annotated check list of the

macrolepidoptera of British Columbia" by J.

R. J. Llewellyn Jones. Llewellyn Jones was an

active ESBC member who willed some of his

estate to the Society so that insect lists and

other projects might be published for the good

of British Columbia (B.C.) entomology. It is

an appropriate and historic gesture for the

ESBC to publish the next major list of British

Columbia moth and butterfly species more

than 60 years later. The 1951 list proved to be

a significant entomological milestone and we

are convinced that ours will be an influential

one, too. The list’s authors are Greg Pohl

(Natural Resources Canada, Northern Forestry

Centre, Edmonton, AB), Rob Cannings (Royal

British Columbia Museum [RBCM], Victoria,

B.C.), Jean-Fran9ois Landry (Agriculture and

Agri-Food Canada, Canadian National

Collection of Insects, Arachnids and

Nematodes [CNC], Ottawa, ON), David

Holden (Canadian Food Inspection Agency,

Burnaby, B.C.), and Geoff Scudder

(University of British Columbia [UBC],

Vancouver, B.C.).

The list documents 2,757 Lepidoptera

species reported for B.C. The data are based

on literature records and examination of the

major public insect collections in the province

and the CNC. The classification and

nomenclature follow the most recent

phylogenetic hypotheses for the order, and

captures nomenclatural changes to the end of

September 2013. We include records from

relevant literature published since 1950 and

from selected older works, such as previous

B.C. checklists and significant taxonomic

revisions. The list supplies taxonomic,

distributional and biological notes for selected

species; we list an additional 30 species that

probably occur in B.C. and consider 126

species to be introduced from outside North

America. Also included is a list of 294 species

erroneously reported from B.C. in previous

works: this important section of the

manuscript clears up previous

misidentifications and errors, many of which

have persisted in the literature for decades.

Introductory sections give an overview of the

order, review the ecozones of the province,

and discuss the history of lepidopterology in

B.C. and our current state of knowledge. We

review each of the 68 families occurring in

B.C., providing information on distinguishing

features, biology and diversity. An index to the

higher taxonomic names, genera, species and

common names is included.

Species lists such as this answer the

fundamental question: "What lives here?" As a

foundation for other biological research, such

lists are the first step on a continuum of

exploration into what these species do and

how they interact with other species. The new

B.C. Lepidoptera checklist will be a

significant and useful resource for anyone

studying the Lepidoptera of the province,

including resource and conservation

managers, biodiversity researchers,

taxonomists, naturalists and amateur

collectors. Although other lists have been

published on portions of the butterfly and

moth fauna, none is as comprehensive as this

one, which represents a major step forward in

our understanding of the Lepidoptera fauna of

the province.

The list had its beginnings as something

else entirely. In the late 1990s, Geoff Scudder

and Rob and Syd Cannings embarked on a

'Natural Resources Canada, Northern Forestry Centre, 5320-122 Street, Edmonton, AB T6H 3S5.

^Curator Emeritus of Entomology, Royal British Columbia Museum, 675 Belleville Street, Victoria, B.C. V8W

9W2.

4

project to produce online overviews and user-

friendly, illustrated identification keys to

about 505 insect families and 29 insect orders

in B.C. Launi Lucas, Geoff’s assistant at

UBC, coordinated much of the project, drew

illustrations, and prepared the material for the

Internet. For several years, the “Insect

Families of British Columbia” project was

funded by Forest Renewal B.C. and its

subsequent incarnations (Forest Innovation

Investment and the Forest Science Program).

Initially, the project results were posted on a

website hosted by the Zoology Department at

UBC, but by 2007 this had migrated to E-

Fauna BC to form core entomological content

there.

Geoff and Rob created the initial draft of

the Lepidoptera list so that they could write a

brief summary of the diversity of each BC

moth and butterfly family for the "Insect

Families of B.C." Don Lafontaine of the CNC

provided the original species list in 2005. By

2007, the Lepidoptera account was complete

and posted on the Internet (Cannings and

Scudder 2007a, 2007b).

In 2009, Greg Pohl brought his expertise

and experience on Lepidoptera to the list.

Beginning with a submission of additional

micromoth names, Greg's involvement grew

and he eventually became the list’s

coordinator. He delved deeply into literature

and collection records to produce a more

comprehensive treatment, with greater

taxonomic detail and updated nomenclature.

His contribution was critical, as he had

already been amassing species names,

collection details, literature, and other

important data on B.C. moths, especially

micromoths, as part of ongoing research on

the western Canadian fauna. To add more

expertise in micromoths and to link the list

more firmly to the national data, Jean-Franqois

Landry joined the team in 2012. A year later,

David Holden also became an author, bringing

considerable B.C. experience and knowledge

to the project. The additional authority these

participants offered was immense: about 450

species were added to the 2007 list, and the

knowledge of many of their colleagues was

incorporated into the data.

The challenge of compiling the

information was straightforward but daunting:

to extract records of Lepidoptera that may

occur in B.C. from all relevant taxonomic

J. Entomol. Soc. Brit. Columbia 110, December 2013

publications, and from specimens in public

collections with significant B.C. holdings.

Butterfly information was largely based upon

the definitive works by Layberry et al. (1998),

Guppy and Shepard (2001) and Pyle (2002).

For macromoths, we drew upon Troubridge

and Lafontaine's Moths of Canada website

(CBIF 2003) and various fascicles in the

Moths of North America series, but have also

examined virtually all North American

taxonomic works published since 1950 and

many from before. For micromoths, we

checked almost every North American

taxonomic publication since 1900, and a few

earlier ones. All these literature records were

then augmented with previous provincial lists,

regional lists and specimen data from the

RBCM, the Beaty Biodiversity collection at

UBC, the Canadian Forest Service-Pacific

Forestry Centre collection, the CNC in

Ottawa, and several other regional collections

across Canada. Some curators were able to

provide species lists for us; we visited other

collections to extract the records ourselves.

Most of this was done over several years by

Greg, with assistance from summer student

Christi Jaeger. As well, Remi Hebert,

Scientific Project Coordinator for the General

Status of Species in Canada (Environment

Canada), stepped in with critical funds for

contracts to extract records from some large

historical monographs and from specimens in

the UBC collection and the CNC. All these

activities brought together the vast majority of

the required data. To produce the current list,

we compiled all the records organised by a

nomenclatural database built by Greg from the

taxonomic papers examined. We then ground-

truthed the list by flagging questionable

records and by checking the identities of

selected specimens. The resulting list was

examined by a number of experts and then

vetted again by anonymous reviewers for the

Journal of the ESBC.

Greg and Rob wrote an introduction

putting the contents of the list in biological,

geographical, historical and taxonomic

contexts. An overview of the Lepidoptera was

excerpted from the order account that Rob had

prepared for the material now online on E-

Fauna BC. Rob also wrote a summary of the

ecozones of B.C. as an overview of the

province’s environment. Greg summarized the

history and current state of Lepidoptera

J. Entomol. Soc. Br]t. Columbia 110, December 20 13

research in B.C. and described the format and

content of the checklist. He also prepared the

index, the reference section, and the list of

excluded taxa.

As authors of the list, we are primarily

compilers and editors of scattered information;

we owe a huge debt to the curators of our

public collections and the taxonomists who

described and revised all the species listed. We

also acknowledge historical workers such as

George W. Taylor, E. M. Anderson, Ernest H.

Blackmore and James R. J. Llewellyn Jones,

as well as more recent researchers and

collectors such as Libby Avis, Cris Guppy,

Dean Nicholson, Jon Shepard and Jeremy

5

deWaard. This list would not exist without

their efforts.

Our intent is to make a PDF of the

complete list available on the ESBC and

RBCM websites and on E-Fauna BC. We

have a large spreadsheet of literature records

and collection holdings that formed the basis

of the species list, and we also hope to make

that available online. We encourage users of

the list to verify uncertain entries and to look

for gaps and omissions that will motivate them

to survey poorly known habitats and discover

new records. Dave Holden^ will compile

additions and corrections to the list and will

disseminate future updated versions.

REFERENCES

Troubridge, J. T., and J. D. Lafontaine. 2003. The moths of Canada. Canadian Biodiversity Information Facility.

http://www.cbifgc.ca/spp_pages/misc_moths/phps/mothindex_e.php [accessed 21 November 2013],

Cannings, R. A., and G. G. E. Scudder. 2007a. Butterflies, moths and skippers of British Columbia. In: B.

Klinkenberg (ed.), E-Fauna BC: Electronic Atlas of the Fauna of British Columbia. Lab for Advanced Spatial

Analysis, Department of Geography, University of British Columbia, Vancouver, B.C. Available from: http://

www.geog.ubc.ca/biodiversity/efauna/lepidoptera.html [Accessed 15 November 2013].

Cannings, R. A., and G. G, E. Scudder. 2007b. Checklist: Order Lepidoptera in British Columbia. In: B.

Klinkenberg (ed.), E-Fauna BC: Electronic Atlas of the Fauna of British Columbia. Lab for Advanced Spatial

Analysis, Department of Geography, University of British Columbia, Vancouver, B.C. Available from: http://

www.geog.ubc.ca/biodiversity/efauna/documents/Lepidoptera2008Cannings.pdf [Accessed 15 November

2013].

Dominick, R, B., C. R. Edwards, D. C. Ferguson, J. G. Franclemont, R. W. Hodges, and E. G. Munroe (series

editors) 1971 to present. The moths of America North of Mexico. E. W. Classey and R. B. D. Publications,

London, UK.

Guppy, C, S., and J. H. Shepard. 2001. Butterflies of British Columbia. Royal British Columbia Museum,

Victoria, B.C., and University of British Columbia Press, Vancouver, B.C. 414 pp.

Layberry, R. A., P, W. Hall, and J.D. Lafontaine. 1998. The Butterflies of Canada. NRC Research Press, Canada

Institute for Scientific and Technical Information, in association with University of Toronto Press, Toronto, ON.

280 pp.

Llewellyn Jones, J. R. J. 1951. An annotated checklist of the macrolepidoptera of British Columbia.

Entomological Society of British Columbia, Occasional Paper 1. 148 pp.

Pohl, G. R., R. A. Cannings, J.-F. Landry, D, G. Holden, and G. G. E. Scudder. In press. Checklist of the

Lepidoptera of British Columbia, Canada. Entomological Society of British Columbia, Occasional Paper 3.

Pyle, R. M. 2002. The butterflies of Cascadia. Seattle Audubon Society, Seattle, WA. 420 pp.

32116 Audrey Drive, Port Coquitlam, B.C. V3C1H1. email: BCLeps@shaw.ca.

6

J. Entomol. Soc. Brit. Columbia 110, December 2013

Ground beetle (Coleoptera: Carabidae) assemblages in the

Conservation Reserve Program crop rotation systems in interior

Alaska

ALBERTO PANTOJA* 2, DEREK S. SIKES 3, AARON M. HAGERTY*,

SUSAN Y. EMMERT*, AND SILVIA RONDON^

ABSTRACT

To improve knowledge of ground beetle communities and the influence of habitat succession

on these communities in Alaska, adult ground beetle (Coleoptera: Carabidae) activity and

diversity were documented on Conservation Research Program (CRP) agricultural lands in

Delta Junction, Alaska (64° N, 145° W). Twenty species, comprising a total sample of 6,116

specimens, were collected during 2006 and 2007 from plots that were in the CRP for 9 years

(young-field plots) and 19 years (old-field plots). Two species, Cymindis cribricollis Dejean

and Amara obesa Say, are reported for the first time for Alaska. Species richness of carabids

for our study plots was estimated, using the Chao 1 and Chao 2 estimators (Chao 1987), to be

22 and 28 species, respectively. Ninety-four percent of the specimens belonged to five species:

Pterostichus adstrictus Eschscholtz (42.9%), Agonum cupreum Dejean (17.9%), Calathus

ingratus Dejean (15%), Amara obesa (11.1%), and Dicheirotrichus cognatus (Gyllenhaal)

(7.1%). Only Ag. cupreum showed significant effects based on plot age, with 7.5 times more

specimens caught on younger plots. The majority of carabid activity occurred late in the

season, from mid-September to early October. A comparison of our findings with historical

data (1943-1956) from the collection of the Matanuska Experiment Station, in Palmer,

Alaska, indicates that only three of the 44 carabid species from the historic Palmer collection

are among the CRP fauna sampled.

Key Words: Alaska, beneficial, Carabidae, CRP, diversity

INTRODUCTION

Little is known about the beneficial insect

fauna associated with Alaska’s agricultural or

natural systems (Hagerty et al. 2009). Given

anticipated expansion of agriculture in Alaska

and current trends in climate change, which is

most pronounced in northern latitudes

(Serreze et al. 2000; Chapin et al. 2006; Chen

et al. 2011), it is important to establish

baseline knowledge of the state’s insect fauna

from which subsequent comparisons can be

made. Ground beetles (Coleoptera: Carabidae)

have been used as ecological indicators for

many years (Pearce and Venier 2006;

Menalled et al. 2007; Work et al. 2008) and

are also known predators of agricultural pests

and seeds of weed plants (Lovei and

Sunderland 1996; Kromp 1999; Harrison and

Regnier 2003; O’Neal et al. 2005; Harrison

and Gallandt 2012). Alaskan farmers have

enrolled more than 10,000 hectares under the

National Resources Conservation Service

(NRCS 2003), Conservation Reserve Program

(CRP), most of which is located near the city

of Delta Junction to control erosion by wind

(Schoephorster 1973; Lewis et al. 1979).

Conservation Reserve Program land in other

states has been positively correlated with

wildlife diversity, including butterflies

'United States Department of Agriculture, Agricultural Research Service, Subarctic Agricultural Research Unit,

Fairbanks, AK 99775 USA

-Current address of corresponding author, United Nations, Food and Agriculture Organization, Regional Office for

Latin America and the Caribbean, Av. Dag Hammarskjdld 3241, Vitacura, Santiago, Chile. Email:

Alberto.Pantoja@fao.org

^Curator of Insects, University of Alaska Museum, 907 Yukon Drive, Fairbanks, AK 99775-6960 USA

''Extension Entomologist Specialist, Oregon State University, Hermiston Agricultural Research and Extension

Center, 2121 South First Street, Hermiston, OR 97838 USA

J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3

7

(Davros et al. 2006), birds (Johnson and

Schwartz 1993; Millenbah et al 1996; Best et

al 1997; Delisle and Savidge 1997),

mammals (Chapman and Ribic 2002), and

herptiles (Semlitsch and Bodie 2003).

The Conservation Reserve Program

promotes the conservation of habitats

beneficial to wildlife (NRCS 2003). However,

participation in the CRP programs requires

that CRP fields be mown every two to three

years to slow succession to shrubs and trees

(Seefeldt et al 2010). Agricultural practices

are known to affect the presence, activity, and

abundance of ground beetles in agricultural

settings (O’Rourke et al 2008; Ward et al

2011). However, despite the long history of

CRP in Alaska (Seefeldt et al 2010), little is

known about the effects of CRP-management

practices on ground beetles in the state.

Additionally, due to the state’s large size,

remoteness, vast regions of roadless lands, and

historic dearth of in-state entomological

professionals, the insect fauna of Alaska is one

of the most poorly documented in the US

(Sailer 1954).

Few detailed descriptions of entire, extant

carabid assemblages in Alaska exist. These

include Lindroth's (1963) description of the

carabids of the Aleutian Islands and studies on

the carabid fauna of Kodiak Island (Ball 1969;

Lindroth 1969b; Lindroth and Ball 1969).

Most of the detailed assemblage descriptions

are checklists, often lacking within-state

locality or ecological data. The earliest

Alaskan records are known from Russian

coleopterist Mannerheim (1843, 1846, 1852,

1853). When Hamilton (1894) summarized

the beetle fauna of Alaska, he reported 43

carabid species now considered valid.

Schwarz (1900) of the Harriman Expedition

reported 28 now-valid species. As part of an

environmental impact statement prior to the

planned, but later aborted, detonation of a

multi-megatonne nuclear device, Watson et al

(1966) documented 19 species of carabids

from the Cape Thompson region of Alaska.

The most thorough treatments of the family

for Alaska, including Canada, is the classic

six-volume work by Lindroth (1969a).

Bousquet (1991) listed 231 Alaskan species,

and Bousquet and Larochelle (1993), listed

234 species. An excellent summary of the

carabidae of the Yukon, which lists 209

species and includes syntheses of

biogeographic and habitat data, was prepared

by Ball and Currie (1997). However, these

more recent synthetic works, from Lindroth

(1969a) to Ball and Currie (1997), summarize

data across vast regions rather than describe

restricted assemblages as we do here.

This research was initiated to study the

species composition, seasonal activity, and

effects of plot age on dominant carabid

species in CRP lands in Delta Junction,

Alaska, and to aid state-wide efforts to

document Alaska’s entomofauna.

MATERIALS AND METHODS

Study Site. Land registered under the

CRP near Delta Junction, Alaska, (64° N, 145°

W) was surveyed for ground beetles. Eight

plots were selected based on their time under

the CRP program (Table 1). Plots were

assigned to two age groups, with four plots per

group according to the plot history under CRP

management that Seefeldt et al (2010)

describe. Plots with nine years under the CRP

program were grouped as young plots, while

plots with 19 years under CRP management

were considered old plots. Older plots have

more disturbance events over time (mowing

and weed control): this was expected to reduce

the relative abundance of carabids.

The Seefeldt et al (2010) report was also

used to assign a litter cover to each plot (Table

1) and compare those parameters to relative

ground beetle species’ frequencies. Plots are

located in the Interior Bottomlands Ecoregion

of the Alaska boreal forest (Gallant et al

1995), adjacent to the outwash plain of the

Tanana River. The area ranges in elevation

from 330 to 385 m; soils are silt loam (NRCS

2013). Surrounding forest vegetation is a mix

of white and black spruce [Picea glauca

(Moench) Voss and P. mariana (Mill.) Britton,

Sterns & Poggenburg], balsam poplar

{Populus balsamifera L.), quaking aspen

{Populus tremuloides Michx.), and paper birch

(Betula papyrifera Marsh.), with associated

understorey species (Hulten 1968). Average

winter temperature are between -2 and -A °C,

with frost-free periods typically lasting 80 to

120 days. The average July temperature is

about 16 °C. Annual precipitation varies from

8

J. Entomol. Soc. Brit. Columbia 110, December 20 13

Table 1

Eight study plots near Delta Junction, Alaska, USA, on Conservation Research Program land.

® Geo-coordinates have a precision of +/- 150 m (WGS84 datum); elevation of all plots: 330-350

m.

Years under CRP: old = 19 years; young = 9 years.

Litter depts. As per Seefeldt et al. (2010).

250 to 300 mm. The study area was cleared

from 1979 to 1982 as part of Delta

Agricultural Projects (Lewis et al. 1979).

Fields are farmed on a three-year rotation,

with two years of spring barley or oats

followed with one year of tilled fallow

(Seefeldt et al. 2010).

Trap Methods. Insects were collected

using pitfall traps, which are a standard

method used to measure ground beetle activity

density in both agricultural and natural

systems (Southwood 1978; O’Rourke et al.

2008; Ward et al. 2011). Although often

interpreted as measures of relative abundance,

pitfall trap catches more accurately measure

activity density and have been criticized for

their demonstrable limitations and biases (e.g..

Topping and Sunderland 1992; Melbourne

1999). Pitfall traps consisted of two plastic

480 ml containers (10.5 cm diameter X 7.5 cm

deep), one inside the other. Holes were dug

with a standard hand-held post-hole digger,

and containers were placed in each hole so

that the rim of the inner container was flush

with the ground. The outer container had holes

in the bottom to allow drainage. The inner

container was filled approximately one-

quarter full with a solution of 25 % propylene

glycol. Each trap was covered with a white

23-cm-diametre plastic plate. Plates were held

in place by three landscaping staples pushed

through the top. The traps were placed in the

field in a diamond pattern (approx. 1 m

between each trap), using five traps within

each of the eight plots, for a total of 40 traps.

Traps were deployed as early as holes could

be dug to set traps.

Insect counts from the five traps per site

and sampling date were combined and

considered as a sample for statistical analysis.

Based on relative plant density, traps were

placed in plot areas that seemed representative

of the overall plot. Traps were emptied and

reset on a weekly basis in 2006 and 2007.

Sampling dates were 6 June to 20 October

2006 and 8 May to 28 September 2007. At

times, voles were caught in traps.

Sample Processing. Samples were

transported to the US Department of

Agriculture (USDA), Agricultural Research

Service (ARS) laboratory on the University of

Alaska-Fairbanks campus and processed.

Ground beetles were pinned and identified

primarily by the third author, using methods

described by Lindroth (1969a), Bousquet and

Larochelle (1993), and Ball and Bousquet

(2001). Most identifications were confirmed

by George E. Ball (University of Alberta,

J . Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3

9

Canada), Robert Davidson (Carnegie Museum

of Natural History, Pittsburg, Pennsylvania),

and Christopher J. Marshall (Oregon State

Arthropod Collection, Corvallis, Oregon).

Voucher specimens were deposited in the

insect collection of the University of Alaska

Museum (UAM), Fairbanks, Alaska. Records

of these specimens are available online via the

UAM database (Arctos 2013a). Species names

follow the classification of Bousquet and

Larochelle (1993), and Ball and Bousquet

(2001).

Species Richness. Estimates v8.2

(Colwell 2009) was used to calculate

estimated species richness using nine

estimators. Species-richness estimators allow

one to extrapolate beyond one’s data to infer

the total number of species in these plots if

sampling were continued using the same

methods, thus providing an estimate of

completeness. The results over the combined

two-year sample for two of the most

frequently used estimators, Chao 1 and Chao

2, were calculated (Chao 1987). Chao 1 is an

abundance-based estimator, in that it uses the

number of species represented by one or two

individuals, whereas Chao 2 is an incidence-

based estimator, in that it relies on the number

of species found in only one or two sample

units, regardless of the number of individuals

(Chazdon et al. 1998).

Data Analysis. The number of insects per

trap per 14-day period was calculated by

combining weekly captures and used to

present seasonal variation. Insect counts from

the five traps per site were pooled for

statistical analysis. Insect counts for species

for which at least 50 specimens were collected

during the two-year sampling period

(O’Rourke et al. 2008) were analyzed using

PROC GLIMIX (SAS 2008), and means were

compared with the LSMEANS statement with

the ILINK option. The Poisson distribution

was used to model the counts, the Generalized

Chi-square/DF was used to test fitness, and

the Type III Tests of Fixed Effects were used

to test significance for time under CRP.

Historic Data. The University of Alaska

Museum Insect Collection (UAM) was

examined to provide additional information on

ground beetle species in Alaska. This

collection, formerly housed at the Matanuska

Experiment Station of the University of

Alaska Agricultural and Forestry Experiment

Station in Palmer, Alaska, is the only large

agricultural insect collection maintained in the

state (Washburn 1972). Some of the carabid

records of the collection were published

previously (Lindroth 1969a) and all of the

species have been reported from the state by

other workers. However, because this

collection was assembled as part of early

agricultural research in Alaska, we report the

Alaskan records here for comparative

purposes. Specimen data for these records are

available via UAM’s online database (Arctos

2013b). The majority of specimens housed in

the UAM Insect Collection were previously

identified by J. M. Valentine and C. H.

Lindroth in the 1940s and 1960s, respectively.

RESULTS

Species Richness. A total of 6,116

specimens representing 20 species from 14

genera were collected (Table 2). The full set of

estimators (±1 SD) yielded estimates that

ranged from 19.7 to 28 species (Fig. 1): 22.8

(ACE); 23.8 ± 0.01 (ICE); 22.3 ± 3.4 (Chao

1); 28 ± 11.7 (Chao 2 ); 23.9 ± 1.9 (Jack 1);

26.8 (Jack 2); 21.7 (Bootstrap mean); 19.7

(MMRuns Mean); 20 (Cole Rarefaction;

Colwell, 2009).

Activity Density. The total number of

specimens from CRP plots was almost equal

between years, with 3,099 and 3,017

specimens for 2006 and 2007, respectively

(Table 2). However, A. cupreum specimens

were 3.2 times more abundant in 2007

(n=828) than in 2006 (n=256), and A. obesa

activity was 15.3 times higher in 2006

(n=644) than in 2007 (n=42). Ninety-four

percent of the specimens belong to five

species: P. adstrictus (42.9%), A. cupreum

(17.9%), C. ingratus (15%), A. obesa (11.1%),

and D. cognatus (7.1%). Two species, A.

obesa and C. cribricoUis, represent new

records for Alaska.

A single species, P. adstrictus, was the

predominant species in both years,

representing 39.3% and 46.4% of total

specimens collected during 2006 and 2007,

respectively (Table 2). This species was

captured equally in all plots, regardless of

time under CRP management or litter depth

10

J. Entomol. Soc. Brit. Columbia 110, December 2013

(Table 1). P. adstrictus was also the most

abundant species in the historic data (Arctos,

2013b), with 58 specimens (Table 3).

Ground beetle activity density differed by

the amount of time the plot had been under the

CRP program, but was not affected by the

depth of the litter cover on plots. However, the

response varied by species (Table 1 and 4). All

species with at least 50 specimens in each year

in the total dataset were found in both old and

young plots, but not in equal proportions. A

significantly lower number (7.5 times less) of

A. cupreum was recorded for plots with a long

history (19 years) under the CRP

Table 2

Activity densities of 20 ground beetle species, for which at least 50 specimens were collected

during the two-year sampling period from CRP land, sorted from most to least abundant. Percent

within yearly totals and sums across both years are presented. Delta Junction, Alaska, USA, 2006-

2007.

n = 3099 and 3017 individuals for 2006 and 2007, respectively.

® New record for Alaska

Amara sp(p.) confirmed as not Amara obesa

J. Entomol. Soc. Brit. Columbia 1 10, December 2013

11

Figure 1. Carabid species richness estimates calculated using the Chao 1 and 2 estimators (Chao

1987) for combined 2006 and 2007 samples, from Delta Junction, AK, CRP land. At Sample 40,

the means of each estimator were 22, 25, and 28, respectively. The observed species richness was

20 species obtained by Sample 27. Estimates were made using Estimates v8.2 (Colwell 2009).

management, compared to plots with a mean

of nine years under CRP (Table 4). However,

frequencies of A. obesa, C. ingratus, D.

cognatus, and P. adstrictus were not

significantly affected by time under CRP

management.

The maximum activity density observed

was 32.9 P. adstrictus per 14-day sampling

period for October 15, 2007. Pterostichus

adstrictus was collected after first snowfall

and can be active until early October. In 2006,

snow/rain was registered as early as

September 25, snow was registered by

September 30, and insects were collected up

to October 30 (Fig. 2).

Activity was observed from May to

October (Fig 2). Traps were deployed as early

as holes could be dug to set traps. During both

years, ground beetles were active during the

first week after traps were deployed, before

the soils thawed. Depending on the year and

species, ground beetle activity, as measured by

the mean number of adults per 14-day period,

started increasing rapidly in late September

(2006) or late August (2007).

Historic Data. The UAM holdings from

the Experiment Station, in Palmer, Alaska,

which were assembled as an agricultural

research collection, includes 44 confidently

identified carabid species (Table 3). Three

species occur in both the historic data and the

CRP findings {P. adstrictus, C. ingratus, and

D. cognatus). Phenology data from the

historic sampling shows three peaks of

activity, with both early (April 3) and late

(November 17) records (Fig. 3).

DISCUSSION

Species Richness. The majority of

estimators predict species richness close to our

observation of 20, although some estimators,

like the Chao2, indicate the fauna could be

much richer than we sampled. The species-

accumulation curve (Fig. 1) does not reach an

asymptote, suggesting additional species in

the community remain unsampled. The large

12

J. Entomol. Soc. Brit. Columbia 1 10, December 2013

Table 3

Forty-four carabid species, based on 254 Alaskan specimens with confident determinations collected

primarily by R. H. Washburn, G. W. Gasser, and J. C. Chamberlin between 1943 and 1956, held in the

UAM Insect Collection, and formerly housed at the Matanuska Experiment Station of the University of

Alaska Agricultural and Forestry Experiment Station, in Palmer, Alaska, USA. Specimen

determinations were made primarily by C. H. Lindroth and J. M. Valentine. Specimen data available

online via the UAM database (Arctos 2013b). Species sorted by number of specimens.

® Also collected from CPR field studies

J. Entomol. Soc. Brit. Columbia 1 10, December 20 13

13

Table 4

Mean number of ground beetles (±SE) with at least 50 specimens per year, in plots with different time

under CRP management (years under CRP: old = 19 years; young = 9 years). Delta Junction, Alaska,

USA, 2006-2007.

number of species with small counts (Table 2)

also indicates sampling of this fauna is

incomplete. Because these plots are not

isolated habitats, a low number of “tourist”

species, which pass through but do not breed

or spend much time in the sampled habitats,

are expected. However, the intent of this study

was to document the dominant carabid

species, which these estimators indicate we

have done.

New State Records. Both of the two

species, A. obesa and C. cribricollis, that are

new records for Alaska are reported from all

three major northwestern Canadian

jurisdictions (YK, NT, BC) by Bousquet

(1991), so their presence in interior Alaska is

not surprising. Bousquet and Larochelle

(1993) list C. cribricollis, but not A. obesa, as

previously reported from Alaska, but based on

doubtful record(s) that need verification.

Amara obesa is reported to prefer dry,

usually sandy, soil with sparse vegetation

(Larochelle and Lariviere 2003). This species

was the fourth most abundant, with 686

specimens eolleeted. Ninety-four percent of

these specimens were collected in 2006.

Cymindis cribricollis is a similarly

xerophilous species eolleeted mainly from dry,

sandy moraines with sparse or absent plant

cover (Lindroth 1969a; Ball and Currie 1997;

Larochelle and Lariviere 2003). In our study,

36 C. cribricollis specimens were collected,

75% of which were from two sandy plots

where little vegetation other than moss was

present; the other 25% of the specimens

collected were from a plot with sandy soils

and sparse bushes, mostly covered by grass.

Our results agree with previously published

accounts of this species’ habitat associations.

It is unknown how widespread this species is

distributed in the state. Given that the

agriculture-associated collecting done in

interior Alaska by the USDA station in Palmer

during the mid- 1900s sampled less than 20%

of the state’s carabid fauna (Table 3), these

two speeies’ status as new records for Alaska

is probably an artifact of past under-sampling

rather than natural range expansions or human

introductions. Nevertheless, it is perplexing

that A. obesa was so common in our 2006

samples in a region of the state easily aceessed

by collectors, and yet had remained previously

undetected.

Trophic Classifications. The top five most

active species (Table 4) are all exclusively

predators, with the exception of D. cognatus,

which is also known to feed on seeds (Calluna

in Europe), and is thus also granivorous

(Larochelle and Lariviere 2003). These

species are recorded as known predators of

flies (Ag. cupreum), lepidopteran larvae (Ag.

cupreum, C. ingrains, and P. adstrictus),

lepidopteran eggs {D. cognatus and P.

adstrictus), sawfly pupae, dipteran eggs, and

elaterids {P. adstidctus), and grasshopper eggs

and nymphs {Am. obesa) (Larochelle and

Lariviere 2003).

Activity Density. The high capture rate of

one species, P. adstrictus, is not uncommon.

O’Rourke et al. (2008) and Hajeck et al.

(2007) reported dominant carabid species in

studies from Iowa and New York, respectively.

Pterostichus adstrictus is a habitat generalist,

and is found from lowlands to alpine zones.

14

J. Entomol. Soc. Brit. Columbia 110, December 2013

-^Pterostrichus adstrictus

•^Agonum cupreum

-h-Amara obesa

Figure 2. Mean number of P. adstrictus, Ag. cupreum. Am. obesa, C. ingratus, and D. cognatus

per 14-day period, CRP land, Delta Junction, Alaska, USA, 2006 (A) and 2007 (B).

interior forests, grasslands, and coastal zones

(Larochelle and Lariviere 2003).

Conservation Reserve Program plots were

mowed in 2006 (Seefeldt et al. 2010), which

might have affected insect relative densities

such as the observation that more than three

times more A. cupreum specimens were

collected in 2007 than in 2006. O’Rourke et

al. (2008) and Hajek et al. (2007) reported

strong yearly variation in ground beetle

populations from disturbed areas in Iowa and

New York, respectively. French et al. (1998)

reported large differences in ground beetle

abundances between years, most likely due to

differences in rainfall. However, this year- to-

year variation is not unusual in Alaska:

leafhoppers (Pantoja et al. 2009), moths

(Landolt et al. 2007), click beetles (Pantoja et

al. 2010a, b), and aphids (Pantoja et al. 2010c)

displayed significant year-to-year variation in

different areas of Alaska, including Delta

Junction. The differences in ground beetles’

adult-activity densities could not be explained

with current knowledge of the biology of this

group in the state, but might be associated

with relative plant types in the plots. Some

carabids are known to consume weed seed

(Toft and Bilde 2002; Ward et al. 2011), and

population size and presence is affected by

agronomic practices and the seed bank in

natural and managed ecosystems (Menalled et

al. 2007). Seefeldt et al. (2010) reported an

increase in plant diversity and increased

density of shrubs with increased time in the

CRP in Alaska. Ground beetle activity might

be affected by reduced grass seed as the shrub

densities increase in the plots. However, plant

diversity increased at a rate of about two

species per 1 000 m2 per year (Seefeldt et al.

2010), and effects of plant successions on seed

bank will not immediately be seen in insect

densities. Research is needed to study the

possible effects of mowing, plant density, and

seed bank on carabid relative densities in

subarctic Alaska. Additional research is also

needed to understand the components of

ground beetles’ diets in Alaska CRP lands and

to elucidate the possible influence of CRP

management practices on their abundance.

Effects on ground beetle abundance by plot

variables such as time in the CRP program

(Table 4) varied by species. Gobbi and

Fontaneto (2008) suggest that the effects of

human intervention on ground beetle species’

richness are species dependent. O’Rourke et

al. (2008) elaborated on the possibility of

manipulating habitat for carabid diversity and

preservation.

J. Entomol. Soc. Brit. Columbia 110, December 2013

15

a,

<

o

2

o

t7>

3

<

O

5

s

Z

o

Figure 3. Phenology of Palmer, Alaska, carabidae. Total counts of all carabid species from

historic sample (Table 3), with date data (n = 231 specimens) aggregated into 14-day periods from

the earliest date across all years.

Late-seasonal adult activity, as we have

found for the most abundant species of the

CRT sites (Fig. 2) and the historic data (Fig.

3), has been associated with carabid species

that overwinter as adults (Hajek ei al. 2007;

Ward et al. 2011). In Iowa, carabids were

captured until late September, but peak

activity was recorded from early June to late

July (O’Rourke et al. 2008). Our data suggest

that mowing CRP plots should occur early in

the season, when carabids are less active (Fig.

2).

Historic Data. Only three of the 44

carabid species from the historic Palmer

collection are among the sampled CRP fauna.

This may seem surprising; however, the entire

state’s fauna includes more than 240 carabid

species, making the lack of shared species

among these small samples less remarkable.

Not surprisingly, these three species are

among the eight most abundant species of the

historic dataset. At least Am. laevipennis and

Sc. marginatus, which were also among the

top eight most abundant in the historic data.

are understandably absent from the CRP data,

because these species are known only from

south of the Alaska Range. The CRP study site

is north of the Alaska Range. Scaphinotus

marginatus is abundantly collected along the

Alaskan coast from the southeast of the state

through the Aleutian chain.

To our knowledge, this is the first report on

species composition and population dynamics

of ground beetles in interior Alaska, and

specifically from CRP lands. Information on

ground beetles’ geographic distribution,

population dynamics, dispersal, and biology is

needed to understand their roles as predators

and seed consumers in natural systems. This

study provides some of the information

necessary to guide future research in subjects

such as species composition, seasonality, a

framework for sampling, and time to mow

fields. Additional research is needed to study

the ecology of the dominant species and their

relationships with soil type and CRP

management practices, including the pest

species on which they are assumed to prey.

ACKNOWLEDGEMENTS

We thank Alaska growers H. Olson and the Kaspari, University of Alaska Extension

Schultz Brothers for use of their farms. P. Agent, provided invaluable assistance in

16

J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3

gaining access to producers’ fields. Technical

assistance in the field laboratory was provided

by B. Sweet, B. Torgerson, C. Flint, C. Curlee,

N. Jenkins, B. Fleshman, D. Fleming, and R.

Ranft. S. Seefeldt and E. Carr, USDA, ARS

Alaska, provided information on CRP land.

Critical comments on an earlier draft of this

manuscript were provided by USDA, ARS

entomologists J. Munyaneza, D. Fielding, and

D. Horton. The authors are indebted to B.

Mackey (ARS) and V. Boero (FAO) for

statistical guidance and analysis.

REFERENCES

Arctos, 2013a. http://arctos. database. museum/saved/CRP-Carabidae (accessed Feb 6, 2013).

Arctos, 2013b. http://arctos.database.museum/saved/Palmer-Carabidae (accessed Feb 6, 2013).

Ball, G. E. 1969. The species of the subgenus Cryobius of the Kodiak Island Archipelago {Pterostichus, Carabidae,

Coleoptera). Pages 156-194 in T. N. V. Karlstrom and G. E. Ball (Eds.), The Kodiak Island Refugium: its

geology, flora, fauna, and history. Ryerson Press, Toronto.

Ball, G. E., and D. C. Currie. 1997. Ground beetles (Coleoptera: Trachypachidae and Carabidae) of the Yukon:

Geographical distribution, ecological aspects, and the origin of the extant fauna. Pages 445^89 in H. V. Danks

and J. A. Downes (eds.). Insects of the Yukon. Biological Survey of Canada (Terrestrial Arthropods), Ottawa.

1034 pp.

Ball, G. E., and Y. Bousquet. 2001. Carabidae Latreill, 1810. Pages 32-132 in Arnett, R. H. , Thomas, M. C.

(eds.), American Beetles, volume 1: Archostemata, Myxophaga, Adephaga, Polyphaga: Staphyliniformia. CRC

Press, Boca Raton, London, New York, Washington, D.C.

Best, L. B., H. Campa 111, K. E, Kemp, R. J. Robel, M. R. Ryan, J. A. Savidge, H. P. Weeks, and S. R.

Winterstein. 1997. Bird abundance and nesting CRP fields and cropland in the Midwest: a regional approach.

Wildlife Society Bulletin 25:864-877.

Bousquet, Y. 1991. Checklist of beetles of Canada and Alaska. Research Branch, Agriculture Canada. Publication

1861/E. Ottawa. 430 pp.

Bousquet, Y., and A, Larochelle. 1993. Catalogue of the Geadaphaga (Coleoptera: Trachypachidae, Rhysodidae,

Carabidae including Cicindelini) of America north of Mexico. Mem. Entomol. Soc. Can. 167:1-397.

Chapman, E. W., and C. A. Ribic. 2002. The impact of buffer strips and stream-side grazing on small mammals in

southwestern Wisconsin. Agriculture, Ecosystems and Environment 88:49-59.

Chapin, F. S. Ill, M. W. Oswood, K. Van Cleve, L. A. Viereck, and D. L. Verbyla (eds). 2006. Alaska’s

Changing Boreal Forest. Oxford University Press, New York, xiv + 354 pp.

Chao, A. 1987. Estimating the population size for capture-recapture data with unequal catchability. Biometrics

43:783-791.

Chazdon, R. L., R. K. Colwell, J. S. Denslow, and M. R. Guariguata. 1998. Statistical methods for estimating

species richness of woody regeneration in primary and secondary rain forests of northeastern Costa Rica. Pages

285-309 in Dallmeier, F. & Comiskey, J. A. (eds.). Forest Biodiversity Research, Monitoring and Modeling.

Conceptual Background and Old World Case Studies. UNESCO Paris and The Parthenon Publishing Group,

Carnforth, UK.

Chen, I. C., J. K. Hill, R. Ohlemuller, D. B. Roy, and C. D. Thomas. (2011) Rapid range shifts of species

associated with high levels of climate warming. Science 333:1024-1026.

Colwell, R. K. 2009. Estimates: Statistical estimation of species richness and shared species from samples. Version

8.2. User's Guide and application published at: http://purl.oclc.org/estimates.

Davros, N. M., D. M. Debinski, K. F. Reeder, and W. L. Hohman. 2006. Butterflies and continuous conservation

reserve program filter strips: Landscape considerations. Wildlife Society Bulletin 34:936-943.

Delisle, J. M., and J. A. Savidge. 1997. Avian use and vegetation characteristics of Conservation Reserve Program

fields. Journal of Wildlife Management 61:318-325.

French, B. W., N C. Elliott, and R. C. Berberet. 1998. Reverting conservation reserve program lands to wheat

and livestock production: effects on ground beetle (Coleoptera: Carabidae) assemblages. Environmental

Entomology 27:1323-1335.

Gallant, A. L., R. F. Binnian, J. N. Omernik, and M. B. Shasby. 1995. Ecoregions of Alaska: U. S. Geological

Survey Professional Paper 1567. United States Government Printing Office, Washington, DC, USA.

Gobbi, M., and D. Fontaneto. 2008. Biodiversity of ground beetles (Coleoptera: Carabidae) in different habitats

of the Italian Po lowland. Agriculture, Ecosystems and Environment 127:273-276.

Hagerty, A. M., A. Pantoja, and S. Y. Emmert. 2009. Lady beetles (Coleoptera: Coccinellidae: Coccinellini)

associated with Alaskan agricultural crops. Journal of the Entomological Society of British Columbia 106:39-

45.

J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3

17

Hajek, A. E., J. J. Hannam, C. Nielsen, A. J. Bell, and J. K. Liebherr. 2007. Distribution and Abundance of

Carabidae (Coleoptera) Associated with Soybean Aphid (Hemiptera: Aphididae) Populations in Central New

York. Ann. Entomol. Soc. Am. 100:876-886.

Hamilton, J. 1894. Catalogue of the Coleoptera of Alaska. With the synonymy and distribution. Transactions of the

American Entomological Society, vol. XXI. pp. 1-38.

Harrison, S. K., and E. E. Regnier. 2003. Postdispersal predation of giant ragweed {Ambrosia trifida) seed in no-

tillage corn. Weed Sci. 51:955-964.

Harrison, S., and E. R. Gallandt. 2012. Behavioural studies of Harpalus rufipes De Geer: an important weed seed

predator in northeastern US agroecosystems. International Journal of Ecology 2012:1-6. doi:

10.1155/2012/846546

Hulten, E. 1968. Flora of Alaska and Neighboring Territories. Stanford University Press, Stanford, California,

USA.

Johnson, D. H., and M. D. Schwartz. 1993. The Conservation Reserve Program and grassland birds.

Conservation Biology 7:934-937.

Kromp, B. 1999. Carabid beetles in sustainable agriculture: a review on pest control efficacy, cultivation impacts

and enhancement. Agriculture, Ecosystems and Environment 74:187-228.

Landolt, P, J., A. Pantoja, A, Hagerty, L. Crabo, and D. Green. 2007. Moths trapped in Alaska with feeding

attractant lures and the seasonality of potential agricultural pests. Canadian Entomol. 139: 278-291.

Larochelle, A., and M. C. Lariviere. 2003. A natural history of the ground-beetles (Coleoptera: Carabidae) of

America north of Mexico. Pensoft, Sofia-Moscow, pp. 1-583.

Lewis, C. E., G. D. Franklin, and D. M. Quarberg. 1979. Delta-Clearwater lands opened for agriculture use —

2000 acre clearing — trial project. Agroborealis 1 1 :32-34.

Lindroth, C. H. 1963. The Aleutian Islands as a route for dispersal across the North Pacific. Zoological Institute,

University, Lund, Sweden, pp. 121-131.

Lindroth, C. H, 1969a. The ground-beetles (Carabidae, Excl. Cicindelinae) of Canada and Alaska. Opuscula

Entomologica Supplementum, Series 1963-1969. Entomologiska Sallskapet, Lund, Sweden.

Lindroth, C. H. 1969b. An analysis of the carabid beetle fauna of the refugium. Pages 195-210 in: T. N. V.

Karlstrom and G. E. Ball (Eds.), The Kodiak Island refugium: Its geology, flora, fauna, and history. Ryerson

Press; Toronto. 262 p.

Lindroth, C. H., and G. E. Ball. 1969. An annotated list of invertebrates of the Kodiak Island Refugium. Pages

122-153 in T. N. V. Karlstrom and G. E. Ball (Eds.), The Kodiak Island Refugium: Its geology, flora, fauna,

and history. Ryerson Press; Toronto. 262 p.

Lovei, G. L., and K. D. Sunderland. 1996. Ecology and behavior of ground beetles (Coleoptera: Carabidae).

Annual Review of Entomology 41 :23 1-256.

Mannerheim, C. G. 1843. Beitrag zur Kaefer-Fauna der Aleutischen Inseln, der Insel Sitkha und Neu-Californiens.

Bulletin de la Societe Imperiale Des Naturalistes Moscou 16:175-314.

Mannerheim, C. G. 1846. Nachtragzur Kaefer-Fauna der Aleutischen Inseln, und der Insel Sitkha. Bulletin de la

Societe Imperiale Des Naturalistes Moscou 19:501-16.

Mannerheim, C. G. 1852. Zweiter Nachtrag zur Kaefer-Fauna der Nord-Amerikanischen Laender des Russischen

Reiches. Bulletin de la Societe Imperiale Des Naturalistes Moscou 25:283-387.

Mannerheim, C. G. 1853. Drifter Nachtrag zur Kaefer-Fauna der Nord-Amerikanischen Laender des Russischen

Reiches. Bulletin de la Societe Imperiale Des Naturalistes Moscou 26:95-273.

Menalled, F. D., R. G. Smith, J. T. Dauer, and T. B. Fox, 2007. Impact of agricultural management on carabid

communities and weed seed predation. Agriculture, Ecosystems and Environment 1 1 8:49—54.

Melbourne, B. A. 1999. Bias in the effect of habitat structure on pitfall traps: An experimental evaluation.

Australian Journal of Ecology 24:228-239.

Millenbah, K. F., S. R. Winterstein, H. Campa, L. T. Furrow, and R. B. Minnis. 1996. Effects of Conservation

Reserve Program field age on avian relative abundance, diversity, and productivity. Wilson Bulletin 108:760-

770.

NRCS (Natural Resource Conservation Service). 2003. National handbook of conservation practices:

conservation practice standard, filter strip. Natural Resource Conservation Service Code 393, Washington,

D.C., USA.

NRCS (Natural Resource Conservation Service). 2013. Alaska Soil Survey Information. Available at http://

www.ak.nrcs.usda.gov/soils/index.html (accessed March 2013)

O’Neal, M. E., J. R. Prasifka, N. P. Schmidt, J. W. Singer, R. L. Hellmich, and K. A. Kohler. 2005. Assessing

Carabid Contribution to Ecosystem Services: Does It Matter If There Are More Beetles? American

Entomologist 51(4):231-233.

O’Rourke, E. M., M. Liebman, and M. E. Rice. 2008. Ground beetle (Coleoptera: Carabidae) in conventional

and diversified crop rotation systems. Environ. Entomol. 37:121—130.

18

J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3

Pantoja, A., A. Hagerty, S. Y. Emmert, and J. Munyaneza. 2009. Leafhoppers (Homoptera: Cicadellidae)

associated with potatoes in Alaska: species composition, seasonal abundance, and potential phytoplasma

vectors. American Journal of Potato Research 86:68-75.

Pantoja, A., A. Haggerty, and S. Y. Emmert. 2010a. A seasonal survey of click beetles in a potato production area

near Palmer, Alaska. American Journal of Potato Research 87:188-194.

Pantoja, A., A. M. Hagerty, and S. E. Emmert. 2010b. A seasonal survey of click beetles in two potato

production areas in interior Alaska. American Journal of Potato Research 87:531-536.

Pantoja, A., A. M. Hagerty, S. Y. Emmert, J-C. Kuhl, K. Pike, J. M. Alvarez, and A. Jensen. 2010c. Aphids

(Hemiptera: Aphididae) associated with rhubarb in the Matanuska Valley, Alaska: Species composition,

seasonal abundance, and potential virus vectors. Journal of Entomology Society of British Columbia 107:75-

81.

Pearce, J. L., and L. A. Venier. 2006. The use of ground beetles (Coleoptera: Carabidae) and spiders (Araneae) as

bioindicators of sustainable forest management: A review. Ecological Indicators 6:780-793.

Sailer, R. I. 1954. Invertebrate research in Alaska. Arctic 7:266-274.

SAS. 2008. Statistical Analysis System Ver. 9. 2. SAS Institute, Cary North Carolina, USA

Schoephorster, D. B. 1973. Soil survey of Salcha-Big Delta area, Alaska. USDA Soil Conservation Service, U. S.

Government Printing Office, Washington, D. C.

Schwarz, E. A. 1900. Papers from the Harriman Alaska expedition. XVIII. Entomological Results (12):

Coleoptera. Proceedings of the Washington Academy of Sciences 2:523-537.

Seefeldt, S., J. Conn, M. Zhang, and P. Kaspari. 2010. Vegetation changes in Conservation Reserve Program

Lands in Interior Alaska. Agriculture Ecosystems and Environment 135:119-126.

Serreze, M. C., J. E. Walsh, F. S. Chapin III, T. Osterkamp, M. Dyurgerov, V. Romanovsky, W. C. Oechel, J.

Morison, T. Zhang, and R. G. Barry. 2000. Observational evidence of recent change in the northern high-

latitude environment. Climatic Change 46:159-207.

Semlitsch, R. D., and J. R. Bodie. 2003. Biological criteria for buffer zones around wetlands and riparian habitats

for amphibians and reptiles. Conservation Biology 17:1219-1228.

Southwood, T. R. E. 1978. Ecological methods with particular reference to the study of insect populations.

Chapman and Hall, New York.

Toft, S., and T. Bilde. 2002. Carabid diets and food value. Pages 81-110 in J. M. Holland (Ed.), the agroecology of

Carabid beetles. Intercept, Androver, UK.

Topping, C. J., and K. D. Sunderland. 1992. Limitations to the use of pitfall traps in ecological studies

exemplified by a study of spiders in a field of winter wheat. Journal of Applied Ecology 29:485^91 .

Washburn, R. H. 1972. The research insect collection. Agroborealis 4:6-7.

Ward, M. J. Ward, M. R. Ryan, W. S. Curran, M. E. Barbercheck, and D. A. Mortensen, 2011. Cover Crops

and Disturbance Influence Activity-Density of Weed Seed Predators Amara aenea and Harpalus pensylvanicus

(Coleoptera: Carabidae). Weed Science 59:76-81.

Watson, D. G., J. J. Davis, and W. C. Hanson. 1966. Terrestrial Invertebrates. Pages 565-584 in N. J.

Wilimovsky and J. N. Wolfe (Eds.), Environment of the Cape Thompson Region, Alaska. United States Atomic

Energy Commission, Division of Technical Information.

Work, T., T. Kolvula, M. Klimaszewski, J. Langor, D. W. Spence, J. R. Sweeney, and J. D. Hebert. 2008.

Evaluation of carabid beetles as indicators of forest change in Canada. Canadian Entomologist 140(4):393— 414.

J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3

19

Diagnostic molecular markers to detect and identify primary

parasitoids (Hymenoptera: Braconidae) of Ericaphis fimbriata on

highbush blueberry

S. MATHURS D.A. RAWORTH^ ^ K.S. PIKE^ 3, AND S.M. FITZPATRICK*

ABSTRACT

The objective of this research was to develop diagnostic molecular markers for detecting and

identifying the most common primary parasitoids of Ericaphis fimbriata (Richards)

(Hemiptera: Aphididae), which is an important vector of Blueberry scorch virus (BlScV) on

highbush blueberry Vaccinium corymbosum L. (Ericales: Ericaceae) in southwestern British

Columbia. Mitochondrial cytochrome c oxidase subunit I gene (COl) sequences and specific

reverse primers for the parasitoids Aphidius ericaphidis Pike and Stary, Ephedrus incompletus

Provencher, and Praon unicum Smith (Hymenoptera: Braconidae) were developed. The

combination of three primers in a multiplex polymerase chain reaction (PCR) assay detected

and differentiated DNA from adults of all three parasitoid species. When individual field-

collected aphids were challenged with the multiplex PCR assay, immatures of the two

numerically dominant parasitoid species, A. ericaphidis and P. unicum, were readily detected,

as was multiparasitism by these two species. The uncommon parasitoid species, E.

incompletus, was detected less frequently by multiplex PCR assay than by rearing from the

aphid hosts.

The diagnostic molecular markers are useful tools for estimating of rates of parasitism and for

identifying immatures of parasitoid species within aphid hosts, particularly if used in

combination with rearing and dissection assays of field-collected aphids.

Key Words: aphids; parasitoids; mtDNA; COI; multiplex PCR; multiparasitism

INTRODUCTION

Hymenopteran parasitoids attack the

dominant colonizing aphid, Ericaphis

fimbriata (Richards) (Hemiptera: Aphididae),

on highbush blueberry, Vaccinium

corymbosum L. (Ericales: Ericaceae) in the

Pacific Northwest (Raworth et al. 2008). The

two primary parasitoid species most

frequently reared from E. fimbriata on

highbush blueberry in British Columbia (B.C.)

are Praon unicum Smith and a recently

described species previously known as

Aphidius n. sp. (Raworth et al. 2008), now

identified as Aphidius ericaphidis Pike and

Stary (Pike et al. 2011). Other primary

parasitoids in the genera Aphidius, Praon, and

Ephedrus were less frequently reared from E.

fimbriata in B.C. (Raworth et al. 2008); those

in the latter genus have since been identified

as E. incompletus Provencher (Mathur and

Pike, unpublished data). All these parasitoids

are in the family Braconidae.

Ericaphis fimbriata transmits Blueberry

scorch virus (BlScV), which causes

substantial crop loss (Bristow et al. 2000). The

primary parasitoids by themselves do not

significantly reduce E. fimbriata populations

on highbush blueberry, but they are part of a

broader community of predators and

pathogens (Mathur et al. unpublished data),

which, if conserved, might slow the

transmission of BlScV by reducing

populations of its main vector. Future studies

of the role and impact of primary parasitoids

within the community of natural enemies

would be facilitated by diagnostic molecular

markers that detect parasitoid DNA within

'Agriculture and Agri-Food Canada, Pacific Agri-Food Research Centre, PO Box 1000, Agassiz, B.C., Canada

VOM lAO

^Irrigated Agriculture Research and Extension Center, Washington State University, 24106 N. Bunn Road, Prosser,

WA, USA 99350

^Retired

20

J. Entomol. Soc. Brit. Columbia 110, December 2013

aphids collected from the field. As noted by

Gariepy et al. (2007), molecular methods

supplement but do not replace traditional

rearing and dissection techniques for detecting

parasitoids in hosts.

Here we report the development of

diagnostic molecular markers that can be used

to detect and identify the most common

primary parasitoids of E. fimbriata on

highbush blueberry. Sequence diversity in the

mitochondrial cytochrome c oxidase subunit I

gene (COI; Hebert et al. 2003) was used to

develop specific primers for A. ericaphidis, E.

incompletus, and P. unicum. Primers for each

species were combined in a specific multiplex

PCR assay capable of detecting

simultaneously the three species of

parasitoids. The accuracy of the multiplex

assay was validated by sampling a local

population of E. fimbriata on highbush

blueberry and comparing the percentage of

collected aphids from which primary

parasitoids emerged with the percentage of

parasitized aphids detected by PCR.

MATERIALS AND METHODS

Development of specific primers for

singleplex and multiplex PCR assays

Adult A. ericaphidis, E. incompletus, and

P. unicum that were preserved in 95% ethanol

were obtained during field surveys in the

Pacific Northwest during 2005 and 2006

(Raworth et al. 2008). Genomic DNA was

isolated from individual parasitoids with a

DNeasy tissue kit® (QIAGEN Inc.,

Mississauga, ON) using the manufacturer’s

protocol. Individuals were air-dried to remove

ethanol and then homogenized using a

disposable microtube pestle (Mandel

Scientific Company Inc., Guelph, ON) in the

extraction buffer provided with the kit. DNA

was eluted in 50 pi of buffer and stored at -80

°C for further use.

The COI region of mitochondrial DNA

from individuals was amplified by PCR using

the universal insect primer set, LCO 1490

(5’GGTCAACAAATCATAAAGATATTGG)

and HCO 2198

(5’TAAACTTCAGGGTGACCAAAAAATC

A) (Folmer et al. 1994). The PCR mixture (50

pi) contained lx PCR buffer solution

(GeneSys Ltd., Medicorp Inc., Montreal, QC),

0.2 mM of dNTPs, 0.2 pM of each universal

primer, 1.25 U of Taq DNA polymerase

(GeneSys Ltd., Medicorp Inc., Montreal, QC)

and 30-50 ng of DNA template. DNA

amplification was performed using a thermal

cycler (iCycler, Bio-Rad Laboratories,

Mississauga, ON). The temperature regime for

all PCR reactions was 94°C for 2 min,

followed by 35 cycles of 94°C for 30 s, 50°C

for 45 s, 72°C for 60 s, and a final extension

step of 72°C for 7 min. PCR products were

visualized on 1.5% agarose gels stained with

GelRed (Biotium Inc., Hayward, CA, USA)

and purified with the QIAquick® PCR

purification kit (Qiagen Inc., Mississauga,

ON). Sequencing of the COI regions was done

by the Nucleic Acid and Protein Synthesis

Unit (NAPS) at the University of British

Columbia (Vancouver, B.C.) using an Applied

Biosystem sequencer and the universal

primers described above. Polymerase chain

reaction products from 13-37 individuals of

each parasitoid species were sequenced to

check for sequence variability. All sequences

were confirmed by sequencing in both

directions.

Specific reverse primers were designed for

A. ericaphidis, E. incompletus and P. unicum

from the regions of the COI gene that were

conserved within species but variable among

species (Table 1). These primer sequences

were evaluated for suitable base composition.

Table 1

Primers used in singleplex and multiplex PCR assays

J. Entomol. Soc. Brit. Columbia 110, December 2013

annealing temperature, and self-compatibility

using the on-line software, Primer3 (Rozen

and Skaletsky 2000). Primers were

synthesized by Integrated DNA Technologies

(Coralville, lA, USA). These primers were

evaluated for PCR specificity using DNA

from 13-37 individuals from A. ericaphidis,

E. incompletus and P. unicum. Polymerase

chain reaction conditions and visualization of

PCR product were as described previously.

To develop the multiplex PCR assay, the

reverse primers for the parasitoids (Table 1)

were mixed with universal forward primer

LCO in a single reaction tube, and then

parasitoid DNA from eight individuals of each

of the three species was challenged with the

combined primers. Polymerase chain reaction

conditions and visualization of the PCR

product were as described previously, except

that the annealing temperature used in the

multiplex assay was 54°C. Extracts of DNA

from healthy, unparasitized E. fimbriata were

included in the assay to check for cross-

reactivity.

Validation of the multiplex PCR assay

In 2011, E. fimbriata (green and red

morphs, alatae and aperterae, immatures

except first instars) were collected weekly

during May through early September from a

0.15-ha research trial of 6-year-old highbush

blueberry ‘Duke’ plants at the Pacific Agri-

Food Research Centre in Agassiz, B.C. (study

site reported by Ehret et al. 2012). Mature and

immature aphids were collected by detaching

the leaves on which they were feeding. All

aphids were later transferred with a fine

paintbrush to the blueberry terminals in

buckets described below. The aphid

population varied according to trends

RESULTS AND

Development of specific primers for

singleplex and multiplex PCR assays

The extracted mitochondrial DNA from all

parasitoid specimens amplified successfully

with the universal primers and produced

distinct bands on agarose gel. The COI

sequences (649 bp) showed high A— T content

with an average of 74% of either A or T. The

consensus COI sequences for A. ericaphidis,

E. incompletus, and P. unicum (and for A. ervi

Haliday, A. matricariae Haliday, P. gallicum

21

described by Raworth (2004), therefore the

number of aphids collected each week ranged

from 65 to 500. About half of the weekly total

number of collected aphids were reared to

allow parasitoids to develop and emerge

(except for the first week, when all collected

aphids were reared). The numbers of aphids in

rearing were 62, 173, 50, 146, 174, 160, 174,

155, 250, 220, 225, 225, 232, 215, 225, 259,

157, 95 and 51, respectively, for each of the

19 weeks. In the rearing assay, aphids were

placed on blueberry terminals cut from plants

in the field then washed to ensure they were

insect-free. The blueberry terminals stood in a

small volume of water in 1.9-litre buckets

with mesh lids under natural light at 21 ± 2°C

for 30 d. Each week, aphids to be reared were

placed in one bucket. The age structure of the

sample of aphids was not estimated.

Parasitoids that emerged from the group of

reared aphids were identified to species (as per

Pike et al. 2011) and preserved in 70%

ethanol. Voucher specimens are stored by K.

Pike. Aphids not used in the rearing assay

were preserved in 95% ethanol. A subset of

these preserved aphids was used for DNA

analysis. The multiplex PCR assay was

validated by comparing the percentage of

aphids that hosted primary parasitoids in the

rearing assay with the percentage of preserved

aphids that revealed parasitoid DNA.

Statistical support for this comparison was

generated by calculating the chi-square

statistic (Yates’ corrected where appropriate;

SYSTAT 2007) on the numbers of primary

parasitoids that emerged from groups of

reared aphids versus the numbers of preserved

aphids in which parasitoid DNA was detected

by PCR.

DISCUSSION

Stary, P. humulaphidis Ashmead, and P.

occidentale Baker from an unpublished study

by Mathur et al.) were deposited in the

National Center for Biotechnology

Information GenBank under accession

numbers EU574902-EU574906, GU237I29-

GU237131 and KC2 11 020-2 1 1032.

All sequences in the sample population of

33 A. ericaphidis were identical; therefore,

there was only one haplotype (KC21 1024) and

no intraspecific divergence. Within the sample

22

J. Entomol. Soc. Brit. Columbia 110, December 2013

Figure 1. Specificity of multiplex PCR assay. Specific reverse primers for A. ericaphidis, E.

incompletus and P. unicum were combined and tested with DNA from: P. unicum. Lanes 1-3; £.

incompletus. Lanes 4-6; A. ericaphidis. Lanes 7-9. Lane 10 is a water control and Lanes M are

100-bp markers.

population of 13 £. incompletus, the average

intraspecific divergence was 1.31% (range

0.3-2. 4%), and seven haplotypes were

identified: haplotype 1 (KC211027) was

represented by six sequences, haplotype 2

(GU237131) was represented by two

sequences, and haplotypes 3 (KC2 11028), 4

(KC211029), 5 (KC211030), 6 (KC 211031),

and 7 (KC211032) were represented by one

sequence each. Within the sample population

of 31 P. unicum, the average intraspecific

divergence was 0.42% (range 0.2-0.6%), and

five haplotypes were identified: haplotype 1

(KC21 1020) was represented by 3 1 sequences,

and haplotypes 2 (KC211021), 3 (KC211022),

4 (KC211023), and 5 (EU574904) were

represented by 1, 1, 2, and 2 sequences,

respectively.

The specific reverse primers designed for

A. ericaphidis, E. incompletus and P. unicum

(Table 1), when used individually with

forward universal primer LCO, selectively

amplified the DNA of the species for which

they were designed. In the multiplex PCR

assay, the combination of universal forward

primer and all three specific reverse primers

differentiated adults of A. ericaphidis, E.

incompletus and P. unicum, and amplified the

appropriate specific fragments: 130 bp for A.

ericaphidis, 261 bp for E. incompletus and

404 bp for/! unicum (Fig. 1).

Validation of the multiplex PCR assay

Only three species of braconid primary

parasitoids emerged from E. fimbriata

collected from the Agassiz site (Fig. 2).

Although other species of Aphidius and Praon

have previously been reared from field-

collected aphids in southwestern B.C.

(Raworth et al. 2008), no additional species of

these two genera were recovered in our study.

As such, the primers we have developed can

be used to identify the species of primary

parasitoids from this site. Praon unicum

emerged from the earliest collections of E.

fimbriata in May, and was present in hosts

throughout the collection period. Aphidius

ericaphidis first emerged from hosts collected

in late June, and was present throughout the

rest of the collection period. A very small

number of E. incompletus emerged from hosts

collected in July, August and early September.

A total of 10 hymenopteran parasitoid

individuals (not shown in Fig. 2) that could

not be identified by morphological

characteristics emerged from aphids collected

in May, June and early July. Secondary

(hyper-) parasitoids {Alloxysta sp., as noted by

Raworth et al. 2008) first emerged in late

June, and were present every week (1-20 per

week) until early September.

Peak numbers of one or both of the two

dominant species, A. ericaphidis and P.

unicum, emerged from hosts collected on 28

June, 20 July, 10 and 23 August, and 1 and 9

September (Fig. 2). To validate the multiplex

PCR assay, DNA from 24^0 preserved E.

fimbriata collected on each of 28 June, 20

July, 10 August and 1 September was

challenged with the combined specific reverse

primers (e.g.. Fig. 3). On all four dates,

multiplex PCR detection of percentage

parasitism by either A. ericaphidis or P.

J. Entomol. Soc. Brjt. Columbia 110, December 2013

23

Figure 2. Percentage of field-collected E. fimbriata from which parasitoids emerged. Numbers of

field-collected E. fimbriata reared from highbush blueberry were 62, 173, 50, 146, 174, 160, 174,

155, 250, 220, 225, 225, 232, 215, 225, 259, 157, 95 and 51, respectively, for each of the 19

weeks in 20 1 1 .

unicum was statistically similar to detection of

parasitism by rearing field-collected E.

fimbriata (P>0.05 in 8 individual

comparisons; Table 2). The numbers of E.

incompletus were too small for valid chi-

square analysis (Fig. 2, Table 2). The

multiplex PCR assay detected E. incompletus

DNA on two of the four dates, whereas E.

incompletus individuals were reared from

aphids collected on each of the four dates. It is

possible that primers in the multiplex assay

did not detect some of the earliest, tiniest life

stages (e.g., eggs) of E. incompletus or of the

other two parasitoids. To establish detection

limits of the primers, a third method of

detection — dissection — should be compared

with the multiplex PCR assay and the rearing

methods (as per methods described by

Gariepy et al. 2007 and Weathersbee et al.

2004). Additionally, sensitivity analysis of the

multiplex PCR assay might help to explain

some of the differences between the two

detection techniques in our study.

The multiplex PCR assay detected DNA

from both A. ericaphidis and P. unicum in a

small percentage of E. fimbriata collected on

20 July, 10 August and 1 September (Table 2;

Fig. 3, Lane 6), indicating multiparasitism by

these two species. Stage-specific information

about this competitive interaction between

primary parasitoids could be obtained by

dissecting the immature stages out of aphid

hosts and challenging their DNA with the

multiplex assay. More dynamic information

about the outcomes of multiparasitism in

field-collected E. fimbriata could be gathered

by comparing a single-aphid rearing assay

with dissection followed by the multiplex

PCR assay. Rearing assays of multiparasitism

by A. smithi and P. pequodorum on pea aphid,

Acyrthosiphon pisum, showed that the

survivor of competition between a first-instar

P pequodorum and any stage of A. smithi was

P. pequodorum', but if P. pequodorum was

killed in the egg stage, A. smithi survived

(Chow and Mackauer 1984, 1985).

The trend toward increased multiparasitism

between 20 July and 10 August suggests that

fewer hosts were available because the E.

fimbriata population was in decline due to

seasonal changes in host-plant quality

(Raworth 2004; Raworth and Schade 2006)

and might indicate that parasitoid populations

were increasing at that time.

Conclusions

The molecular diagnostics developed in

this study can be used, in conjunction with

rearing and dissection techniques, to conduct

24

J. Entomol. Soc. Brit. Columbia 110, December 20 13

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 M

Figure 3. Use of the multiplex PCR assay to detect parasitoid DNA in E. fimbriata collected on

20 July 2011 from highbush blueberry. Of 24 E. fimbriata analysed, 17 are represented in this

figure. Results from one aphid are shown in each of Lanes 1-17. Lanes 1, 2, 5, 10, 11, 15, 16 and

17 show no parasitism (Lane 17 shows as a negative control: one E. fimbriata that was known to

be unparasitized). Lanes 3, 7 and 13 show parasitism by A. ericaphidis (130 bp); Lane 9 shows

parasitism by E. incompletus (261 bp); Lanes 4, 8, 12 and 14 show parasitism by P. unicum (404

bp); and Lane 6 shows multiparasitism by A. ericaphidis and P. unicum. Lane 18 is a water control

and Lanes M are markers. At the bottom of most lanes is a faint band (80 bp) from leftover PCR

ingredients.

detailed studies of the population dynamics of

the primary parasitoids of E. fimbriata in

southwestern B.C., with or without the

augmentative releases of P. unicum proposed

by Raworth et al. (2008; and see Vafaie et al.

2013). In particular, it will be possible to track

the immature stages of A. ericaphidis, E.

incompletus and P. unicum in a single reaction

using the multiplex PCR assay.

The diagnostic accuracy of the multiplex

PCR could likely be improved by: sensitivity

analysis of the PCR; analyses to determine if

DNA from one species inhibits the PCR

reaction to DNA of other species; and analysis

of DNA from parasitoids congeneric to A.

ericaphidis, E. incompletus and P. unicum.

Once these improvements have been made,

the multiplex PCR would be useful on a larger

geographical scale. Aphidius ericaphidis has

been discovered in large numbers east and

west of the Cascades, USA, as well as in

southwestern B.C. (Raworth et al. 2008; Pike

et al. 2011). Praon unicum has been reported

from more than 30 different aphid hosts (see

Smith 1944; Carroll and Hoyt 1986; Johnson

1987; Pike et al. 1997, 2000; Acheampong et

al. 2012) besides E. fimbriata. The primers

developed for P. unicum will, therefore,

facilitate population studies in other systems.

Table 2

Number (%) of E. fimbriata from which a parasitoid emerged during rearing (R) compared to number

(%) of E. fimbriata in which parasitoid DNA was detected by multiplex PCR assay (M).

Species of parasitoid detected

Date (2011) of

a Multiparasitism by A. ericaphidis and P. unicum.

b Ericaphis fimbriata was reared in groups, therefore the number of parasitoids emerging from one

aphid could not be determined.

J. Entomol. Soc. Brit. Columbia 110, December 2013

25

ACKNOWLEDGEMENTS

This research was funded primarily by and the Washington State Blueberry

Agriculture and Agri-Food Canada, in Commission,

cooperation with Washington State University

REFERENCES

Acheampong, S., D. R. Gillespie, and D. J. M. Quiring. 2012. Survey of parasitoids (Hymenoptera) of the green

peach aphids, Myzus persicae and foxglove aphid, Aulacorthum solani (Hemiptera: Aphididae) in British

Columbia. Journal of the Entomological Society of British Columbia 109: 12-23.

Bristow, P. R., R. R. Martin, and G. E, Windom. 2000. Transmission, field spread, cultivar response, and impact

on yield in high bush blueberry infected with Blueberry scorch virus. Phytopathology 90: 474-^79.

Carroll, D, P,, and S. C. Hoyt. 1986. Hosts and habitats of parasitoids (Hymenoptera: Aphidiidae) implicated in

biological control of apple aphid (Homoptera: Aphididae). Environmental Entomology 15: 1171-1178.

Chow, F. J., and M. Mackauer. 1984. Inter- and intraspecific larval competition in Aphidius smithi and Praon

pequodorum (Hymenoptera: Aphidiidae). The Canadian Entomologist 116: 1097-1107.

Chow, F. J., and M. Mackauer. 1985. Multiple parasitism of the pea aphid: stage of development of parasite

determines survival of Aphidius smithi and Praon pequodorum (Hymenoptera: Aphidiidae). The Canadian

Entomologist 117: 133-134.

Ehret, D. L., B. Frey, T. Forge, T. Helmer, and D. R. Bryla. 2012. Effects of drip irrigation configuration and rate

on yield and fruit quality of young highbush blueberry plants. Hortscience 47: 414-421.

Folmer, O., M. Black, W. Hoeh, R. Lutz, and R. Vrijenhoek. 1994. DNA primers for amplification of

mitochondrial cytochrome c oxidase subunit 1 from diverse metazoan invertebrates. Molecular Marine Biology

and Biotechnology 3: 294-299.

Gariepy, T. D., U. Kuhlmann, C. Gillott, and M. Erlandson. 2007. Parasitoids, predators and PCR: the use of

diagnostic molecular markers in biological control of arthropods. Journal of Applied Entomology 131:

225-240.

Hebert, P. D. N., S. Ratnasingham, and J. R. deWaard, 2003. Barcoding animal life: cytochome oxydase subunit

1 divergences among closely related species. Proceedings of the Royal Society of London, Series B 270

(supplement 1): 96-99.

Johnson, J. W. 1987. A revision of the species of Praon Haliday in North America north of Mexico (Hymenoptera:

Aphidiidae). The Canadian Entomologist 119: 999-1025.

Pike, K. S., P. Stary, T. Miller, D. Allison, L. Boydston, G. Graf, and R. Gillespie. 1997. Small-grain aphid

parasitoids (Hymenoptera: Aphelinidae and Aphidiidae) of Washington: distribution, relative abundance,

seasonal occurrence, and key to known North American species. Environmental Entomology 26: 1299-1311 .

Pike, K. S., P. Stary, T. Miller, G. Graf, D. Allison, L. Boydston, and R. Miller. 2000. Aphid parasitoids

(Hymenoptera, Braconidae, Aphidiinae) of Northwest USA. Proceedings of the Entomological Society of

Washington 102: 688-740.

Pike, K. S., P. Stary, G. Graf, D. A. Raworth, S. Mathur, L. K. Tanigoshi, and T. Murray. 2011. A new

Aphidius Nees (Hymenoptera, Braconidae, Aphidiinae) of Ericaphis fmbriata (Richards) (Hemiptera,

Aphidiidae) and key to parasitoids of blueberry aphid in the Pacific Northwest. Zootaxa 2802: 58-62.

Raworth, D. A. 2004. Ecology and management of Ericaphis fimbriata (Hemiptera: Aphidiidae) in relation to the

potential for spread of Blueberry scorch virus. The Canadian Entomologist 136: 711—718.

Raworth, D. A., and D. Schade. 2006. Life history parameters and population dynamics of Ericaphis fimbriata

(Hemiptera: Aphididae) on blueberry, Vaccinium coiymbosum. The Canadian Entomologist 138: 205-217.

Raworth, D. A., K. S. Pike, L. K. Tanigoshi, S. Mathur, and G, Graf. 2008. Primary and secondary parasitoids

(Hymenoptera) of aphids (Hemiptera: Aphididae) on blueberry and other Vaccinium in the Pacific Northwest.

Environmental Entomology 37: 472-477.

Rozen, S., and H. J. Skaletsky. 2000. Primer3 on the WWW for general users and for biologist programmers, pp.

365-386. In S. Krawetz and S. Misener, Bioinformatics Methods and Protocols: Methods in Molecular

Biology. Humana Press. New Jersey.

Smith, C. F. 1944. The Aphidiinae of North America (Hymenoptera: Braconidae). Ohio State University

Contributions in Zoology and Entomology 6: 1-154.

SYSTAT Software Inc. 2007. SYSTAT® 13. 1735 Technology Dr., Ste. 430, San Jose, CA 951 10 USA.

Vafaie, E. K., S. M. Fitzpatrick, and J. S. Cory. 2013. Does rearing an aphid parasitoid on one host affect its

ability to parasitize another species? Agricultural and Forest Entomology 15: 366-374.

26

J. Entomol. Soc. Brit. Columbia 110, December 20 13

Weathersbee A. A., K. A, Shufran, T. D. Panchal, P. M. Dang, and G.A. Evans. 2004. Detection and

differentiation of parasitoids (Hymenoptera: Aphidiidae and Aphelinidae) of the brown citrus aphid

(Homoptera; Aphididae): species-specific polymerase chain reaction amplification of 18S rDNA. Annals of the

Entomological Society of America 97: 286-292.

J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3

27

Seasonal Flight Pattern of the Western Balsam Bark Beetle,

Dryocoetes confusus Swaine (Coleoptera: Curculionidae), in

Central British Columbia

A.J. STOCKI, T.L. PRATT2, AND J.H. BORDEN^

ABSTRACT

Seasonal flight pattern of the western balsam bark beetle, Dryocoetes confusus Swaine, in

stands of subalpine fir, Abies lasiocarpa (Hook) Nutt., in north-central British Columbia was

monitored for three years using multiple-funnel traps baited with (±)-exo-brevicomin. Two

major flight periods occurred per year, the first commencing in mid- to late June, and the

second occurring in mid- to late August. The first flight was predominantly males, while the

second flight was composed primarily of females, probably re-emerged parent adults. Little

flight occurred until within-stand temperatures exceeded 15°C. Traps placed 6 m above the

ground caught four times as many beetles as traps placed 2 m above the ground. Our results

indicate that semiochemical-based manipulation of the western balsam bark beetle should be

implemented by early May.

Key Words: Coleoptera: Curculionidae, Scolytinae

INTRODUCTION

The western balsam bark beetle,

Dryocoetes confusus Swaine, occurs

throughout the range of its host, subalpine fir,

Abies lasiocarpa (Hook) Nutt., from British

Columbia to New Mexico (Bright 1963). The

beetle is the most destructive insect pest of

mature and overmature subalpine fir in British

Columbia (Garbutt 1992).

Mathers (1931) described a two-year life

cycle for D. confusus in central B.C. First

emergence of new adults occurs in late June,

and continues throughout July. These adults

attack fresh host material, with the attacking

males excavating nuptial chambers. Male D.

confusus are polygamous, and mate with up to

four females (Bright 1976). Females excavate

brood tunnels and lay eggs until "well into

August" (Mathers 1931). After egg laying is

completed, the parent adults extend brood

tunnels by feeding, creating tunnels in which

they overwinter. The following spring,

females lay a second brood in a continuation

of these same tunnels. Parent adults then re-

emerge in mid-July to attack fresh material.

and lay a third brood. Eggs of the first brood

hatch in late August, overwinter as small

larvae, develop to teneral adults, and

overwinter again. Progeny of the second

brood, beginning early the second summer,

develop in a similar way. The third brood,

beginning late in the second summer, begins

to hatch by the third week in August (Mathers

1931). Thus, Mathers (1931) identified two

clearly defined flight periods, of which the

second had re-emerging adults.

Baited multiple-funnel traps have been

used to monitor D. confusus flight periods for

three years in Utah, USA (Hansen 1996), and

for three years in northern Idaho and western

Montana, USA (Gibson et al. 1997). Both

studies identified two flight peaks, with the

main part of the first peak occurring from

mid-June to early July, and the second

variably in August to September. In Utah, the

relative size of the two flight peaks varied

across elevations, with a trend towards larger

first peaks at higher elevations, and larger

second peaks at lower elevations. Both studies

'Corresponding author. Regional Entomologist, B.C. Ministry of Forests, Lands, and Natural Resource Operations,

401-333 Victoria St. Nelson, BC Canada VIL 4K3

2B.C. Ministry of Forests, Lands, and Natural Resource Operations, #510, 175-2nd Ave, Kamloops, B.C. Canada

V2C 5W1

^Contech Inc., 7572 Progress Way, Delta, B.C. Canada V4G 1E9

28

J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3

noted a larger pereentage of male beetles in

the early-season flight, and a trend towards

more females in the later season flight.

Hansen (1996) noted that very little flight

oecurred when ambient temperatures were less

than 15°C, although low temperatures were

not a factor separating the two seasonal flight

peaks.

Our objectives were to describe the

seasonal flight patterns of D. confusus and to

assess the vertical distribution of within-stand

flight in central British Columbia.

MATERIALS AND METHODS

Eight-unit multiple-fiinnel traps (Lindgren

1983) were set in the Bulkley Valley, central

British Columbia, in the Engelmann Spruce-

Subalpine Fir or Sub-Boreal Spruce

biogeoclimatic zones (Banner et al. 1993),

annually in 1985, 1986, and 1987. Trapping

periods and locations for monitoring seasonal

flight were 19 June-22 August 1985 (10 traps)

at McKendrick Pass, 13 June-27 August 1986

(6 traps), at Gramophone Creek, and 28 May-

27 August 1987 (10 traps) at Kwun Creek.

Traps were suspended on ropes between two

trees in stands with active beetle infestations,

and were placed at least 50 m apart. The top of

each trap was hung approximately 2 m above

ground in 1985 and 1986. Based on results

from 1986 of vertical distribution of within-

stand flights, the top of each trap was raised to

3 m in 1987. Attractive baits used in each trap

were the aggregation pheromone (±)-exo-

brevicomin (Albany International, Columbus,

Ohio) 99.7% purity (Borden et al. 1987), in

two glass capillary tubes, collectively

releasing 0.4 mg/24 h in 1985 and 1986.

Based on results from experiments in 1986

(Stock et al. 1995), the release rate of trap

baits was increased to four capillary tubes,

collectively releasing 0.8 mg/24 h ({±)-exo-

brevicomin, 98.0% purity, Contech Inc., Delta,

B.C.) in 1987. Captured D. confusus were

counted and sexed daily in 1985, and on

Mondays, Wednesdays, and Fridays in 1986

and 1987. Within-stand temperature and

relative humidity patterns were monitored

with a hygrothermc graph (C.F. Casella and

Co., London, UK, Model 3083/TT) placed in a

Stevens box located under the canopy on the

ground near the funnel traps.

In a separate experiment in 1986, 10 exo-

brevicomin-baited 8-unit multiple-funnel

traps spaced 50 m apart were set out at

Gramophone Creek. Five traps were selected

randomly to be suspended approximately 2 m

above ground, and five to be suspended

approximately 6 m above ground. The

experiment was established on 19 June, and

ended on 1 1 July.

Data from the trap height experiment were

compared using a t-test (Number Cruncher

Statistical System 1988).

RESULTS

Seasonal flight patterns (Fig. 1) indicated

that D. confusus has at least two flight periods

each summer. The first (main) flight period

occurred in mid- to late June, and the second

in mid-August. Flight had probably started

prior to trap placement in 1985 and 1986, as

evidenced by catches in the first collection

period. Peaks in flight activity generally

occurred when maximum daily ambient

temperature was 15°C or warmer (Fig. 1).

Relatively little flight occurred in the interval

between flight peaks, despite apparently

adequate maximum temperatures. The trends

for cumulative captures were roughly similar

each year, showing a slow rise followed by a

sharp increase, with the pattern then repeating

itself (Fig. 2). By assuming a separation of the

two flights on 1 August, the second flight

represented 19% of total flight in 1985, 17%

of total flight in 1986, and 26% of total flight

in 1987. Small numbers of beetles flew in

September in all years after the traps had been

taken down (pers. observations).

Cumulatively, for the three years of study,

less than 5% of total trap catch occurred when

daily maximum temperatures within stands

were less than 15°C.

The overall proportion of captured males

was 0.46 in 1985, 0.67 in 1986, and 0.44 in

1987 (Fig. 3). However, males predominated

early in the season, and the sex ratio became

progressively female-biased over time. The

J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3

29

■ 15

30

u

o

0^

25 2

cd

u

D

a-

20 I

15 -o

e

3

E

10

cd

30

25

20

Figure 1. Seasonal flight patterns and maximum daily temperatures for Dryocoetes confusus

caught in exo-brevicom in-baited multiple funnel traps at Gramophone Creek, B.C., 1985-1986,

and Kwun Creek, B.C., 1987.

30

J. Entomol. Soc. Brit. Columbia 110, December 20 13

28 May-3 1 August

Figure 2. Cumulative trap catch as percent of annual total trap catch for Dryocoetes confusus

caught in exo-brevicomin-baited multiple funnel traps at Gramophone Creek, B.C., 1985-1986,

and Kwun Creek, B.C., 1987.

less well-defined trend in 1986 could be due

to the generally cooler weather early in the

summer, which may have affected the

emergence of one of the sexes. Also, there

were relatively few beetles caught in 1986

(Fig. 1), which may have increased variation,

resulting in weaker trends (see also Fig. 2).

Approximately four times more beetles

were captured in traps at the 6 m height than

at 2 m (Table 1).

DISCUSSION

The evidence that the main flight period of

the western balsam bark beetle occurs

primarily in mid- to late June corresponds well

with Mathers' (1931) data on life history.

Some caution may be needed when

interpreting results of pheromone-baited

funnel traps for monitoring scolytid flight

periods (Bentz 2006). Pheromone-baited traps

within stands may catch disproportionately

more beetles during periods of reduced beetle

flight, and disproportionately fewer beetles

during peak beetle flight, producing an

“elongated” flight period that may not

coincide well with actual beetle emergence

from trees (Bentz 2006). However, for

semiochemical-based management, it is

necessary to know when beetle flight actually

commences in stands, and we are confident

our results indicate that D. confusus flight can

begin in early June or late May (Fig. 1), when

ambient temperatures are higher than 15°C.

This temperature threshold is consistent with

Hansen (1996) and Negr6n and Popp (2009).

Hansen (1996) noted that snow was mostly

gone before flight commenced. The

occurrence of the second peak in mid-August

in central BC, however, was one month later

than the mid-July re-emergence described by

Mathers (1931). This may have been due to

weather. Temperature-driven variation in

development is common in other scolytid

species: it can shorten their life cycles when

warm weather pennits, or lengthen them to

endure periods of cold (Amman 1973; Schmid

and Frye 1977; Langor 1987; Wermelinger

and Seifert 1999). Flight peaks of the western

balsam bark beetle appear to be variable

across the landscape and highly weather

dependent (Hansen 1996; Gibson et al. 1997;

Negron and Popp 2009). This information

should prompt further investigations to

discover if D. confusus can indeed develop on

J. Entomol. Soc. Brit. Columbia 110, December 2013

31

28 May-3 1 August

Figure 3. Seasonal variation in the male component of flying Dryocoetes confusus populations,

Gramophone Creek, B.C., 1985-1986, and Kwun Creek, B.C., 1987.

a one-year cycle, as suggested by Bright

(1963), and which does occur in Dryocoetes

autographus (Johansson et al. 1994) and the

spruce beetle, Dendroctonus rufipennis

(Schmid and Frye 1977). Such a life cycle

may become more prevalent under conditions

of global warming. Further work is also

necessary to assess efficacy of baited funnel

traps for monitoring beetle flight, as per Bentz

(2006). It is essential to understand variability

in life-cycle duration and flight periods in

order to implement pest management tactics,

e.g., semiochemical-based population

manipulation, effectively.

The period between flight peaks

corresponds to when females in galleries are

laying a second brood (Mathers 1931) and/or

feeding to regenerate their flight muscles

(Chapman 1957; Borden and Slater 1969;

Bhakthan et al. 1970; Bhakthan et al. 1971).

Exact information on when first-, second-, or

third- brood beetles are represented in flying

populations at higher latitudes awaits further

study.

The overall proportions of captured males

conformed well to the 0.43 proportion of

males in emerging beetle broods (Stock 1981).

There was no evidence for an early emergence

of the responding sex (females; Fig. 3),

considered to be an outbreeding mechanism in

other scolytids (Cameron and Borden 1967;

Billings and Gara 1975; Borden 1982). Rather,

there is evidence for early emergence of the

pioneering sex (males; Fig. 3), which is

consistent with Hansen (1996) and Negron

and Popp (2009). Early emergence of the

pioneering sex has been shown for summer

brood Ips typographus L. (Botterweg 1983)

and I. perturbatus (Graves 2008). It is possible

that in uneven-aged multi-storied old-growth

subalpine forests, the patchy and temporary

nature of the host resource (newly susceptible

or freshly downed trees; Bleiker et al. 2003,

2005) may force beetle populations to search

over large areas. Early emerging males could

establish new attraction centres, resulting in

multiple matings with local females and

enhanced population genetic heterogeneity

(Flamm et al. 1987). If the responding sex

were to emerge first in such a harsh

environment, the uncertainty of initial attack

success, establishment of secondary attraction,

and ultimately mass-aggregation (Borden et

al. 1986) could be increased, resulting in high

mortality of the responding sex during

dispersal. Subsequent re-emergence of

females late in the summer may further

enhance genetic heterogeneity (Cameron and

Borden 1967).

We hypothesize that a significant

proportion of the second flight is comprised of

re-emerging adults. Flamm et al. (1987) found

that 75% and 64% of attacking Ips avulsus

Eichoff and I. calligraphus Germar,

respectively, re-emerged from original host

trees, and that males represented only 27.8%

of reemerging /. avulsus, compared to 46.7%

of re-emerging I. calligraphus. Anderbrandt et

32

J. Entomol. Soc. Brjt. Columbia 110, December 2013

Table 1

Catch of D. confusus in a five-replicate experiment with 8-unit (±)-exo-brevicomin-baited funnel traps

set at 2 and 6 m above ground, 19 June-1 1 July 1986, Gramophone Creek, B.C.

a Means within columns followed by the same number are not significantly different, t-test, p < 0.0250.

al. (1985) found that about 84% of /.

typographus reemerged, of which about 36%

were males. It is possible that those females fit

enough to re-emerge gain an adaptive

advantage by exploiting unused bark in

previously attacked, but not fully utilized trees

(Flamm et al. 1987). A portion of the second

flight peak may also be generated by broods

originating in downed materials (Negron and

Popp 2009), if development were delayed

because of snow cover.

Our results indicate that pest management

tactics such as semiochemical-based

management (Stock et al. 1990, 1993, and

1995; Maclauchlan et al. 2003; Jeans-

Williams and Borden 2006) need to be

implemented by early May. Finer-scale

silvicultural approaches such as group

selection or small patch harvesting (Veblen et

al. 1991; Stock et al. 1993; Maclauchlan et al.

2003) would need to account for the period

when re-emerged, and presumably gravid,

females are active; e.g., delay implementation

until September.

The tendency of D. confusus to fly well

above ground within stands has been shown

for other scolytid species. Beetles with such

flight patterns presumably avoid the

impediments of understorey vegetation and

dense tree crowns, and are positioned to

intercept pheromone plumes (Ashraf and

Berryman 1969; Schmitz et al. 1980; Amman

and Cole 1983; Bartos and Amman 1989).

Understorey vegetation can be 3 or 4 m high

in subalpine forests. Waters and Stock (1995)

counted attack densities at 1.3, 4 and 8 m

height, and found that beetle attacks per

square metre were greatest at 4 m above

ground, although the difference between

heights was not significant. Flight height may

not be correlated to attack success, although

Maclauchlan et al. (2003) hypothesize that

cool nighttime temperatures near the ground

or wetness and non-vectored fungal

development under the bark may limit gallery

success in the lower two metres of the bole.

It would be useful to know, for

semiochemical-based manipulation of D.

confusus populations, what relationship this

flight pattern might have to the initial attack

height and vertical distribution of attack

density by D. confusus on standing trees.

ACKNOWLEDGEMENTS

We thank management and staff of D. Groot

Logging Ltd., Houston Forest Products Ltd.,

Pacific Inland Resources Ltd., Northwood Pulp

and Timber Ltd., West Fraser Mills Ltd., Phero

Tech Inc., and Regional and District Offices of

the B.C. Forest Service in Smithers and Houston,

B.C., C. Klassen for field assistance, the Science

Council of B.C. Grant No. 1 (RC 12-16) and

GREAT Award to the senior author, and the

Natural Sciences and Engineering Research

Council, Canada Operating Grant No. A3881

and Strategic Grant No. G1611 for their support

of this research. We also thank L. Safranyik, R.

C. Brooke, and two anonymous reviewers for

thoughtful suggestions that improved the

manuscript.

REFERENCES

Amman, G. D. 1973. Population changes of the mountain pine beetle in relation to elevation. Environmental

Entomology 2:541-547.

Amman, G. D., and W, E. Cole. 1983. Mountain pine beetle dynamics in lodgepole pine forests Part II: Population

J. Entomol. Soc. Brit. Columbia 110, December 201 3

33

dynamics. USDA Forest Service Inteimountain Forest and Range Experiment Station, Ogden, Utah. General

Technical Report INT-145. 59 p.

Anderbrandt, O., F. Schlyter, and G. Birgersson. 1985. Intraspecific competition affecting parents and offspring

in the bark beetle Ips typographus. Oikos 45:89-98.

Ashraf, M., and A. A. Berryman. 1969. Biology of Scolytus ventralis (Coleoptera: Scolytidae) attacking Abies

grandis in northern Idaho. Melanderia 2:1-23.

Banner, A., W. MacKenzie, S. Haeussler, S. Thomson, J. Pojar, and R. Trowbridge. 1993. A field guide to site

identification and interpretation for the Prince Rupert Forest Region. B.C. Ministry of Forests, Research

Branch, Victoria, B.C., Land Management Handbook No. 26. 152 pages.

Bartos, D. L., and G. D. Amman. 1989. Microclimate: an alternative to tree vigor as a basis for mountain pine

beetle infestations. USDA Forest Service Res. Pap. Int-400. Ogden, Utah. 10 p.

Bentz, B. J. 2006. Mountain pine beetle population sampling: inferences from Lindgren pheromone traps and tree

emergence cages. Canadian Journal of Forest Research 36:351-360.

Bhakthan, N. M. G., J. H. Borden, and K. K. Nair. 1970. Fine structure of degenerating and regenerating flight

muscles in a bark beetle, Ips confusus. I. Degeneration. Journal of Cell Sciences 6:807-819.

Bhakthan, N. M. G., K. K. Nair, and J. H. Borden. 1971. Fine structure of degenerating and regenerating flight

muscles in a bark beetle, Ips confusus. II. Regeneration. Canadian Journal of Zoology 49:85-89.

Billings, R. F., and R. I. Gara. 1975. Rhythmic emergence of Dendroctonus ponderosae (Coleoptera: Scolytidae)

from two host species. Annals of the Entomological Society of America 68:1033-1036.

Bleiker, K. P., B. S. Lindgren, and L. E. Maclauchlan. 2003. Characteristics of subalpine fir susceptible to attack

by western balsam bark beetle (Coleoptera: Scolytidae). Canadian Journal of Forest Research 33(8): 1538-

1543.

Bleiker, K. P., B. S. Lindgren, and L. E. Maclauchlan. 2005. Resistance of fast- and slow-growing subalpine fir

to pheromone- induced attack by western balsam bark beetle (Coleoptera: Scolytinae). Agricultural and Forest

Entomology 7(3):237-244.

Borden, J. H. 1982. Aggregation pheromones, pp. 74-139. In J. B. Mitton and K. B. Sturgeon (Eds.). Bark beetles

in North American conifers: A system for the study of evolutionary biology. University of Texas Press, Austin,

TX. 527 p.

Borden, J. H., and C. E. Slater. 1969. Flight muscle volume change in Ips confusus (Coleoptera: Scolytidae).

Canadian Journal of Zoology 47:29-32.

Borden, J. H., D. W. A. Hunt, D. R. Miller, K. N. Slessor. 1986. Orientation in forest Coleoptera: an uncertain

outcome of responses by individual beetles to variable stimuli, pp. 97-109. In T. L. Payne, M. C. Birch, and C.

E. J. Kennedy (eds.). Mechanisms in insect olfaction. Clarendon Press, Oxford. .

Borden, J. H., A. M. Pierce, H. D. Pierce, Jr., L. J. Chong, A. J. Stock, and A. C. Oehlschlager. 1987.

Semiochemicals produced by the western balsam bark beetle, Dryocoetes confusus Swaine (Coleoptera:

Scolytidae). Journal of Chemical Ecology 13:823-836.

Botterweg, P. F. 1983. The effect of attack density on size, fat content, and emergence of the spruce bark beetle Ips

typographus L. Z. ang. Entomology 96:47-55.

Bright, D. R., Jr. 1963. Bark beetles of the genus Dtyocoetes (Coleoptera: Scolytidae) in North America. Annals of

the Entomological Society of America 56:103-115.

Bright, D.R., Jr. 1976. The insects and arachnids of Canada and Alaska. 2. Coleoptera: Scolytidae. Canadian

Department of Agriculture Publication No. 1576. 241 p.

Cameron, E. A., and J. H. Borden. 1967. Emergence patterns of Ips confusus (Coleoptera: Scolytidae) from

ponderosa pine. The Canadian Entomologist 99:236-244.

Chapman, J. A. 1957. Flight muscle change during adult life in the Scolytidae. Canadian Department of Forestry,

Division of Forest Biology. Bi-monthly Progress Report 13:3^.

Flamm, R. O., S. P. Cook, T. L. Wagner, P. E. Pulley, and R. N. Coulson. 1987. Reemergence and emergence of

Ips avulsus and Ips calligraphus (Coleoptera: Scolytidae). Environmental Entomologist 16:869-876.

Garbutt, R. 1992. Western balsam bark beetle. Forest Pest Leaflet 64. Canadian Forest Service, Pacific Forestry

Centre, Victoria, BC. 4 p.

Gibson, K., S. Kegley, and B. Oakes. 1997. Western balsam bark beetle activity and flight periodicity in the

Northern Region. USDA Forest Service Cooperative Forestry and Forest Health Protection, Missoula, MT.

Report 97-3. 5 p.

Graves, A. D. 2008. The chemical ecology of the northern spruce engraver, Ips perturbatus (Eichoff) (Coleoptera:

Scolytidae), and associated insects in spruce forests of Alaska. Doctoral Dissertation, University of Minnesota,

St. Paul, MN. 296 pages. (Cited in Negron and Popp 2009).

Hansen, E. M. 1996. Western balsam bark beetle, Dtyocoetes confusus Swaine, flight periodicity in northern Utah.

Great Basin Naturalist 56:348-359.

Jeans- Williams, N. L., and J. H. Borden. 2006. Evaluation of Two Pheromone Baits for Containment and

34

J. Entomol. Soc. Brit. Columbia 110, December 2013

Concentration of Attack by the Western Balsam Bark Beetle, Dryocoetes confusus (Coleoptera: Curculionidae).

Western Journal of Applied Forestry 21 ;27-32.

Johansson, L., J. Andersen, and A. C. Nilssen. 1994. Flexible generation time in Dryocoetes autographus (Ratz.)

(Col., Scolytidae): a key to its success as colonist in subarctic regions? Journal of Applied Entomology 1 17:21-

30.

Langor, D. W. 1987. Emergence, host attack, and overwintering behaviour of the eastern larch beetle,

Dendroctonus simplex Leconte (Coleoptera: Scolytidae), in Newfoundland. The Canadian Entomologist 119:

975-983.

Lindgren, B. S. 1983. A multiple-funnel trap for scolytid bark beetles. The Canadian Entomologist 1 15:299-302.

Maclauchlan, L. E., L. Harder, J. H. Borden, and J. E. Brooks. 2003. Impact of the western balsam bark beetle,

Dryocoetes confusus Swaine (Coleoptera: Scolytidae), at the Sicamous Research site, and the potential for

semiochemical based management in alternative silviculture systems. Journal of the Entomological Society of

British Columbia 100:27-41.

Mathers, W. G. 1931. The biology of Canadian bark beetles. The seasonal history of Dryocoetes confusus Sw. The

Canadian Entomologist 68:247-248.

Negr6n, J. F., and J. B. Popp. 2009. The flight periodicity, attack patterns, and life history of Dryocoetes confusus

Swaine (Coleoptera: Curculionidae: Scolytinae), the western balsam bark beetle, in north central Colorado.

Western North American Naturalist 69(4):447^58.

Number Cruncher Statistical System. 1988. Kaysville, Utah, USA.

Schmid, J. M., and R. H. Frye. 1977. Spruce beetle in the Rockies. USDA Forest Service General Technical

Report RM-49. Fort Collins, Colorado.

Schmitz, R. F., M. D. McGregor, and G. D, Amman. 1980. Mountain pine beetle response to lodgepole stands of

different characteristics, pp. 234-243. In A. A. Berryman and L. Safranyik (Eds.) Proceedings of the second

lUFRO conference on dispersal of forest insects: Evaluation, theory, and management implications. Sandpoint,

Idaho. 27-31 August 1979. Cooperative Extension Service, Washington State University, Pullman, WA.

Stock, A. J., J. H. Borden, T. L. Pratt, H. D. Pierce, Jr., and B. D. Johnston. 1995. Enantiomeric composition

and release rates of exo-brevicomin influence aggregation of the western balsam bark beetle, Dryocoetes

confusus Swaine (Coleoptera: Scolytidae). The Canadian Entomologist 127:449-456.

Stock, A. J., J. H. Borden, and T. L. Pratt. 1993. Containment and concentration of western balsam bark beetle,

Dryocoetes confusus Swaine (Coleoptera: Scolytidae), populations by application of exo-brevicomin. Canadian

Journal Forest Research 24:483-492.

Stock, A.J., J.H. Borden, T.L. Pratt, H.D. Pierce, Jr., and B.D. Johnston. 1990. enJo-Brevicomin: an

antiaggregation pheromone for the western balsam bark beetle, Dryocoetes confusus Swaine (Coleoptera:

Scolytidae). The Canadian Entomologist 122:935-940.

Stock, A. J. 1981. The western balsam bark beetle, Dryocoetes confusus Swaine: secondary attraction and

biological notes. M.Sc. Thesis, Simon Fraser University, B.C.

Veblen, T. T., K. S. Hadley, and M. S. Reid. 1991. Disturbance and stand development of a Colorado subalpine

forest. Journal of Biogeography 18:707-716

Waters, H. J., and A. J. Stock. 1995. Application of MSMAto control western balsam bark beetle in subalpine fir

— B.C. Ministry of Environment special use permit 103-414-92* Research File 48090-2 June 12 1992. Final

report to B.C. Ministry of Environment, Pesticide Control Branch, January 1995. 13 p.

Wermelinger, B., and M, Seifert. 1999. Temperature-dependent reproduction of the spruce bark beetle Ips

typographus, and analysis of the potential population growth. Ecological Entomology 24:103-1 10.

J. Entomol. Soc. Brit. Columbia 110, December 20 13

35

SCIENTIFIC NOTE

Update on the establishment of birch leafminer parasitoids in

western Canada

Chris J.K. MacQuarrie\ Daryl J. Williams^, and David W. Langor^

Five species of birch (Betula) leaf-mining

sawfly have been introduced to Canada. The

two most damaging species, Profenusa

thomsoni (Konow) and Fenusa pumila Leach

(previously known as F pusilla), have wide

distributions in western Canada (Digweed et

al. 2009) and can be significant pests of birch

in the region. The larvae of both species feed

inside the leaf and cause brown blotch-shaped

mines that are characteristic for each species.

When outbreaks of these species occur, the

large numbers of larvae create multiple mines

within individual leaves. This damage causes

trees to take on a burnt appearance, which is

often considered undesirable in urban settings

where birch is a popular ornamental tree. Over

the last 20 years, we have studied the

distribution and impact of these birch leaf-

mining sawflies and their biological control

using parasitoids in the Ichneumonid genus

Lathrolestes Foerster (Digweed et al. 2009,

MacQuarrie et al. 2013).

In Canada, outbreaks of F pumila and P.

thomsoni have been controlled by the

introduction and redistribution of two species

of Lathrolestes that attack the larvae as they

feed within the leaf (Quednau 1 984, Langor et

al. 2002, Digweed et al. 2003, MacQuarrie et

al., 2013). Outbreaks of both sawfly species

have been noted in western Canada, but since

the 1 990s P. thomsoni has been responsible for

most of the observed damage. The sawfly is

controlled by Lathrolestes thomsoni

Reshchikov (previously known as L.

luteolator), an endoparasitoid that was first

observed attacking P. thomsoni during the late

1990s in Edmonton, Alberta (Digweed et al.

2003). In the early 2000s, other populations of

the parasitoid were found attacking the sawfly

in Hay River and Fort Smith, Northwest

Territories, as well as in Edson, Alberta

(MacQuarrie 2008). These parasitoid

populations were later exploited for a

biological control project against an outbreak

of P. thomsoni in Alaska. This project

successfully established L. thomsoni in at least

one site in the state (MacQuarrie 2008, Soper

2012), and demonstrated that relocating free-

living adult L. thomsoni is a feasible way to

establish the parasitoid within an outbreak

population of P. thomsoni.

In the early 2000s, outbreaks of P.

thomsoni were reported in the Northwest

Territories and northern British Columbia. To

help suppress these populations, we collected

adult L. thomsoni from Edson, Edmonton, Hay

River and Fort Smith, and released them in

Prince George, British Columbia, and

Yellowknife, Northwest Territories

(MacQuarrie 2008). We surveyed these

populations in 2012 to determine: 1) if L.

thomsoni had established; and, 2) how

abundant it was. A survey in 2003 found that

P. thomsoni was also present throughout much

of the southern Yukon but not at outbreak

levels (Digweed and Langor 2004). Therefore,

we also surveyed in the Yukon to determine if

P. thomsoni had changed in abundance and if

L. thomsoni was present.

In the summer of 2012, we surveyed for L.

thomsoni in Prince George, Yellowknife and

Whitehorse, Yukon, using traps (7.5 cm x 12.5

cm yellow sticky cards; Contech Inc.,

Victoria, BC) set out at two or three sites in

each city. In both Prince George and

Yellowknife, one site was situated near the

original release site and another site was

established elsewhere. The two Prince George

sites were located in a wooded area and in the

yard of a private home, and were

approximately 1.1 km apart. The two

Yellowknife sites were both located in the

'Natural Resources Canada, Canadian Forest Service, Great Lakes Forestry Centre, 1219 Queen Street East. Sault

Ste Marie, Ontario, Canada. P6A 2E5

^Natural Resources Canada, Canadian Forest Service, Northern Forestry Centre, 5320 122 street NW, Edmonton,

Alberta, Canada. T6H 3S5

J. Entomol. Soc. Brit. Columbia 1 1 0, December 2013

yards of private homes and were

approximately 2.5 km apart. In Whitehorse,

the sites were located in wooded areas near a

major road (two sites) and along a walking

trail (one site). These sites were approximately

0. 5-3.0 km apart.

At each site, three birch trees were selected

by local volunteers, and a trap was hung at

head height (approx. 2 m) in each tree. Traps

were placed in early or mid-June, depending

on the advancement of the season, and

replaced weekly until early or mid-July,

depending on the duration of P. thomsoni adult

flight (Table 1). This study was intended for

detection and not for population assessment.

Volunteers were therefore allowed to carry out

surveys according to their own local

conditions rather than according to a

prescribed method. This meant the number of

traps hung in each city and at each site varied

depending on how frequently the traps were

changed. We report the total number of traps

hung at each site over the trapping period

(Table 1). The volunteers returned the traps at

the end of the season, at which time we

examined the traps’ contents. Identification of

all material on the traps was done by one of

the authors (D. J. Williams).

We found L. thomsoni to be established in

Prince George, and established and abundant

in Yellowknife (Table 1). Populations of the

sawfly at both release sites appear to be large

relative to the size of the parasitoid

populations. Parasitism rates (percent of the

total catch that was adult parasitoids) ranged

from 11-17% in Yellowknife and 6-8% in

Prince George. In contrast, the R thomsoni

population in Whitehorse appeared to be

small, and a parasitoid population was not

detected (Table 1 ).

Our survey indicates L. thomsoni has

established in Prince George and Yellowknife.

Suppression of either population was not

tested, but anecdotal evidence suggests that

damage by P. thomsoni has been less evident

in recent years (MacQuarrie et al. 2013).

However, even when populations are large,

the appearance of damage caused by P.

thomsoni can vary from year to year

(MacQuarrie 2008), and a decrease in visible

damage may not indicate a sawfly population

Table 1

Summary of trap catches for adult Profenusa thomsoni (Konow) and adult Lathrolestes thomsoni

Reshchikov for three cities in 2012.

J. Entomol. Soc. Brit. Columbia 110, December 2013

experiencing suppression by the parasitoid.

Repeated observations of both populations,

including an assessment of parasitism rates,

would be necessary to confirm if L. thomsoni

is controlling P. thomsoni.

The population of P. thomsoni in

Whitehorse is small, and L. thomsoni does not

appear to be present. We suggest that

Whitehorse be monitored at regular intervals

to assess the status of the P. thomsoni

population. Should an outbreak occur, the

established L. thomsoni populations in

Yellowknife and Prince George could serve as

sources of parasitoids for release in

Whitehorse.

Determining the true impact of L. thomsoni

on the dynamics of the Prince George and

Yellowknife P. thomsoni populations requires

collecting and rearing large numbers of

leafminers to obtain an estimate of the percent

37

parasitism. Such estimates have been done for

other P. thomsoni populations, but the work

requires significant time, effort, and financial

resources to make an accurate assessment

(MacQuarrie 2008). These resources are hard

to obtain for species, like P. thomsoni, that are

considered minor, aesthetic pests. In contrast,

sampling adult parasitoids, while a less precise

estimate than rearing, is a simple and

inexpensive way to determine the presence

and relative abundance of a parasitoid.

We are optimistic that control of the sawfly

will be achieved at Prince George and

Yellowknife, based on the observation that L.

thomsoni has persisted at both sites for at least

five years without any assistance or

augmentation. This suggests that the L.

thomsoni populations at these sites are

resilient and should be able to maintain their

presence into the future.

ACKNOWLEDGEMENTS

We thank S. Lindgren, University of

Northern British Columbia, Prince George; S.

Carriere and D. Taylor, Government of the

Northwest Territories, Yellowknife; and B.

Godin, Environment Canada, Whitehorse, for

their assistance in placing and monitoring

sticky traps; and R. Johns and three

anonymous reviewers for their comments on

an earlier version of this manuscript.

REFERENCES

Digweed, S. C., and D. W. Langor. 2004. Distributions of leafrnining sawflies (Hymenoptera: Tenthredinidae) on

birch and alder in northwestern Canada. Can. Entomol. 136: 727-731.

Digweed, S. C., C. J. K. MacQuarrie, D. W. Langor, D. J, M. Williams, J. R. Spence, K. L. Nystrom, and L.

Morneau. 2009. Current status of exotic birch-leafmining sawflies (Hymenoptera: Tenthredinidae) in Canada,

with keys to species. Can. Entomol. 141: 201-235.

Digweed, S. C., R. L. McQueen, J. R. Spence, and D. W. Langor. 2003, Biological control of the ambermarked

birch leafminer, Profenusa thomsoni (Hymenoptera: Tenthredinidae), in Alberta. Information Report NOR-

X-389, NRCan CFS, Northern Forestry Centre, Edmonton, AB.

Langor, D. W., S. C. Digweed, and J. R. Spence. 2002. Fenusa pusilla (Lepeltier), birch leafminer, and Profenusa

thomsoni (Konow) ambermarked birch leafminer (Hymenoptera: Tenthredinidae), pp. 123-127. In Mason,

RG., Huber, J.T. (eds.). Biological Control Programs in Canada, 1981-2000. CABI Publishing, Wellingford,

UK.

MacQuarrie, C. J. K, 2008. Distribution, Biological Control and Population dynamics of Profenusa thomsoni

(Konow) in Alaska. Ph.D. thesis. University of Alberta, Edmonton, AB.

MacQuarrie, C. J. K., D. W. Langor, S. C. Digweed, and J. R. Spence. 2013. Fenusa pumila Leach, birch leaf

miner, Profenusa thomsoni (Konow), Ambermarked birch leaf miner (Hymenoptera: Tenthredinidae), pp. 175-

181. In Mason, P.G., Gillespie, D. (eds.). Biological Control Programmes in Canada 2001-2012. CABI

Publishing, Wellingford, UK.

Quednau, F. W. 1984. Fenusa pusilla (Lepeletier), birch leaf-miner (Hymenoptera: Tenthredinidae), pp. 291-294.

In Kelleher, J.S., Hulme, M.A. (eds.), Biological Control Programmes Against Insects and Weeds in Canada

1969-1980. Commonwealth Agricultural Bureaux, Famham Royal, Slough, UK.

Soper, A, 2012, Biological control of the ambermarked birch leafminer {Profenusa thomsoni) in Alaska. Ph.D.

thesis University of Massachusetts, Amherst, MA.

38

J. Entomol. Soc. Brit. Columbia 1 10, December 2013

SCIENTIFIC NOTE

British Columbia’s 50th mosquito species, Aedes schizopinax

M. Jackson^ C. Pyles^ S. Breton^ T. J. S. McMahon^ and P. Belton^

Larvae of Aedes {Ochlerotatus)

schizopinax Dyar, 1929 (Diptera; Culicidae)

were collected in a survey by Culex

Environmental for the District of Sparwood by

Sylvia Breton on 12 May 2013. The site (Fig.

1 ) was a roadside pool near Sparwood, British

Columbia (B.C.), approximately 20 km west

of the Alberta border. Vegetation around the

pool was mostly pine grass {Calamagrostis

rubescens Buckley) with wild rose {Rosa

acicularis Lindl.) in front of willow {Salix

sp.), cottonwood {Populus sp.) and lodgepole

pine (Pinus contorta Douglas). Representative

specimens will be deposited in the Beaty

Biodiversity Museum, University of British

Columbia. In the 30 years since the

publication of the Provincial Museum

handbook on the mosquitoes of British

Columbia (Belton 1983), four additional

species have been collected in the province.

They all have been examined by Dr. Peter

Belton. The identities of two of these species,

Culex boharti Brookman and Reeves and

Culex restuans Theobald, are being confirmed.

Culiseta particeps (Adams) was reported by

Jackson et al. (2013), while the fourth species,

Aedes schizopinax, is documented here.

Aedes schizopinax was described by Dyar,

(1929) from larvae collected at Story Creek

railway crossing in central Montana. The

specific name (Greek: divided disc) derives

ffom the sclerotised tergite, the saddle or disc

on the terminal abdominal segment X of the

larva. In contrast to the larvae of the sympatric

and related Aedes hexodontus Dyar, Ae.

nevadensis Chapman & Barr, and Ae. punctor

(Kirby), the saddle does not completely

surround the segment, leaving a noticeable

gap ventrally. The species has since been

collected from other subalpine regions of

Montana and from similar habitats in Idaho,

Oregon, California, Wyoming, Utah, Nevada

and New Mexico (Darsie and Ward 2005). In

Canada, the only other collections are of

larvae from Morleyville Settlement and

Calgary, Alberta, 36 years ago (Enfield 1977).

We retain the generic names used in Wood et

al. (1979), noting that some authors have

replaced Aedes with the subgeneric name

Ochlerotatus for all the Aedes species named

here.

The five larvae (preserved in 80% ethanol)

that we examined match the description in

Wood et al. (1979). No adults were reared.

The symmetrically arranged head setae 7 and

5C had two and three branches, respectively,

and all branches of the prothoracic setae 2 and

3P were as sturdy as setae IP. The

mesothoracic setae IM had three strong

branches, and these, with the more obvious

evenly spaced teeth on the pecten and twenty-

five or more pointed comb scales, clearly

identify the species as Ae. schizopinax.

The four anal papillae of the larva are

drawn in Plate 45 of Wood et al. (1979), with

the dorsal pair slightly longer than the ventral

ones. In the fourth and final instar larva that

we measured, the anal segment AX was

0.61mm long and the dorsal two papillae were

slightly longer than the ventral pair (0.38:

0.33mm) and about the same length as the

saddle. Carpenter and LaCasse (1955) in Fig.

188 and Darsie and Ward (2005) in Fig. 772

show the dorsal and ventral papillae to be the

same length. The reason for the difference in

lengths is not known, but it occurs in species

in several genera, always with the dorsal

longer than the ventral pair. The unequal

length of the dorsal and ventral papillae is

used by Wood et al. (Fig. 199) to separate

Aedes increpitus Dyar from Ae. stimulans

(Walker). However, the size of the papillae is

known to vary inversely with the salinity of

the environment (Phillips and Meredith 1969),

so the consistency of the difference in length

of the papillae deserves further study. The seta

on the side of the saddle differed from that

illustrated in Plate 45 of Wood et al. (1979)

'Culex Environmental Ltd., 4^075 Kingsway, Burnaby, B.C. V5H IY9

^Biological Sciences, Simon Fraser University, Burnaby, B.C. V5A 1S6.

J. Entomol. Soc. Brjt. Columbia 110, December 2013

39

Figure 1. Grassy pool near Sparwood (49° 44' 10.28"N, 114° 53' 5.45"W; elevation: 1124m), the

first known site for Aec/es schizopinax in British Columbia.

being bifid rather than unbranched, but this

matches the description of the Californian

specimen in Fig. 772 of Darsie and Ward

(2005).

Sparwood is in the Montane Spruce

biogeoclimatic zone (B.C. Ministry of Forests

2013). It is approximately 160 km southwest

of Morleyville settlement, Alberta, and 400km

northwest of Story Creek, Montana, but all

three localities are at elevations over 1000m.

We expect that Ae. schizopinax will be found

in similar habitats in other parts of

southeastern B.C.

There are at least 82 species of mosquitoes

in Canada (Thielman and Hunter 2007).

Because of the biogeographical history of

B.C. and its rich diversity of habitats, more

than half of these species occur in the

province. We are confident that several more

species will be identified, and in the

meantime, we hope to collect and rear adult

Ae. schizopinax in Sparwood; Adults are

seldom observed, and little is known of their

biology.

REFERENCES

B.C. Ministry of Forests and Range. 2013. Biogeoclimatic Ecosystem Classification Program. Research Branch,

Victoria, BC. http://www.for.gov.bc.ca/hre/becweb/.

Belton, P. 1983. The Mosquitoes of British Columbia. Provincial Museum Handbook #41 Queen’s Printer for

British Columbia, Victoria, BC.

Carpenter, S. J., and W. J. LaCasse 1955. Mosquitoes of North America (north of Mexico). University of

California Press, Berkeley, CA.

Darsie, R. F., and R. A.Ward 2005. Identification and Geographical Distribution of the Mosquitoes of North

America, North of Mexico. University Press of Florida, Gainesville, FL.

Dyar, H. G. 1929. A new species of mosquito from Montana with annotated list of mosquiitoes known from the

state. Proceedings of the United States National Museum 75 (2794): 1-8.

Enfield, M. A. 1977. Additions and corrections to the records of Aedes mosquitoes in Alberta. Mosquito News

37:82-85.

Jackson M., T. Howay, and P. Belton. 2013. The first record of Culiseta particeps (Diptera: Culicidae) in Canada.

The Canadian Entomologist 145:115-116.

Phillips, J. E.. and J. Meredith 1969. Active sodium and chloride transport by anal papillae of a salt water

mosquito larva {Aedes campesths) Nature 222:168-169.

Thielman, A. C., and F. F. Hunter. 2007. Photographic Key to the Adult Female Mosquitoes (Diptera: Culicidae)

of Canada. Canadian Journal of Arthropod Identification. No. 4, 14 December 2007, available online at http://

www.biology.ualberta.ca/bsc/ejournal/th_04/th_04.html, doi: 10.3752/cjai.2007.04

Wood D. M., P. T. Dang, and R. A. Ellis. 1979. The Insects and Arachnids of Canada 6. The Mosquitoes of

Canada (Diptera: Culicidae). Agriculture Canada, Ottawa, ON.

40

J. Entomol. Soc. Brit. Columbia 110, December 201 3

Symposium Abstracts: The Rise and Fall of the Honeybee

Entomological Society of British Columbia

Annual General Meeting,

PacificForestry Centre, Victoria, B.C., Nov. 1-2, 2013

Note: There was a total of eight papers presented in this symposium. We were able to obtain

abstracts from six of the authors.

SuperBoost

H. Borden, Contech Enterprises Inc., Delta,

B. C. WWW. contech-inc. com

SuperBoost is a commercial product based

on the 10-component fatty-acid ester

honeybee brood pheromone. One hundred

eighty milligrams of the non-volatile synthetic

pheromone are deployed in a small plastic

pouch held at the level of the brood comb in a

rigid plastic holder. The pheromone exudes

through a permeable plastic membrane at the

rate of 0. 5-2.0 mg/d. When SuperBoost was

placed in colonies, the ratio of pollen to non-

pollen foragers changed significantly in favour

of the former for five weeks, and foragers

returned to the hive with significantly heavier

pollen loads than did bees returning to

untreated control colonies. Compared to

untreated control colonies, colonies treated for

two consecutive five-week periods during

spring build-up consumed more pollen-

substitute diet, had more brood comb and

more bees, and produced more splits.

In three studies in which colonies were

treated with SuperBoost near the beginning of

nectar flow, treated colonies produced 24-

87% more honey than untreated control

colonies. The effect is hypothesized to be

caused by higher numbers of bees in treated

colonies. In a fourth study, in which colonies

were treated at the beginning of July, there

was no significant increase in honey

production. When colonies were treated

during fall feeding, the results were similar to

those obtained during spring build-

up. Package bee colonies treated six times in

the year starting on 30 April, when colonies

were established, had 2.7-times greater

survival than untreated colonies.

Although SuperBoost is sold elsewhere in

the world, it is not available in Canada, where

it has been declared an unregistered veterinary

drug.

Re-opening Pandora's hive: The risks of

importing honeybee packages from the U.S.

to Canada

C. Culley, Capital Region Beekeepers ‘

Association, Victoria, B.C.

In 1987, in response to the outbreak in the

U.S. of two parasitic mites (honeybee tracheal

mite, Acarapis woodi, and varroa mite, Varroa

destructor). Agriculture and Agri-Food

Canada closed the border to the importation of

honeybees {Apis mellifera) from the

continental U.S. Importations of honeybee

queens were allowed from Hawaii in 1993.

Following the Canadian Food Inspection

Agency’s (CFIA) 2003 risk assessment, the

Agency maintained the import ban on

honeybee packages, but in 2004 allowed the

importation of honeybee queens from the U.S.

In 2013, because requests for import

permits continue to be received, the Animal

Health Risk Assessment (AHRA) unit of the

CFIA conducted a risk assessment to provide

scientific information and advice in support of

the Canadian National Animal Health Program

for the development of import policy. The

CFIA’s Animal Import/Export Division asked

the AHRA to update and assess the likelihood

of biological hazards spreading or becoming

established in Canada, and their likely

consequences as a result of the importation of

honeybee packages from the U.S.

The Capital Region Beekeepers'

Association (CRBA) sent a letter to the

Minister of Agriculture and Agri-Food

requesting that the border remain closed to

honeybee packages due to many disease risks.

Of the risks identified by the CRBA, only four

were recognized by the CFIA: Africanized

honeybee (AHB), antibiotic-resistant

American foulbrood (AFB, resistant to

oxytetracycline [rAFB]), small hive beetle

(SHB), and amitraz-resistant Varroa mite

(acaricide-resistant [rVAR]). The CFIA

considered the following disease agents "not

J. Entomol. Soc. Brit. Columbia 110, December 2013

hazards": Tropilaelaps (not currently found in

U.S., but could appear at any time and be

spread with industrial movements of bees),

Apocephalus borealis (insufficient researeh),

and a wide variety of viruses, also thoroughly

distributed by industrial movements. Several

disease agents could also infect our native

pollinators.

The CRBA does not aeeept the levels of

risk established in the report, due to many

uncertainties that were faetored in. Lack of

research is not a good reason for lower risk.

This risk-assessment document was a

literature review, which is useful; however, it

makes it only more elear that more research

needs to be done before risks can be properly

assessed.

Trends in managed pollinators and

resurgence of urban beekeeping

H. Clay, Urban Bee Network, B. C.

Honey has been a sought-after natural

sweetener for eenturies. Sinee the advent of

the modem movable-frame hive, large-scale

beekeeping for honey production has become

an important sector of rural Canadian

agriculture. Throughout the past eentury,

whenever war or recession has posed a threat

to food supply, urban beekeeping has

increased. The highest number of beekeepers

ever recorded in Canadian history was during

the sugar rationing period of the Second

World War.

Fluctuations have occurred according to

whether beekeeping was profitable (good

honey priees, opportunities for pollination

service rental) or not profitable (low honey

prices, honeybee colony losses, high cost of

replacement bees). Honeybees are also

important pollinators of agricultural crops, and

colony numbers increased after research

showed the importance of bees for improving

erop production. Colony increase occurred in

two eycles: from 1960 to 1985, pollination

service expansion was for tree fruit and berry

crops, and since 1991 the demand for

pollination services has been driven by the

canola seed industry. Other managed

pollinators such as alfalfa leafcutter bees,

bumble bees and mason bees offer some

potential for greenhouse-crop pollination and

as complementary pollinators, but their

availability and short flight range have been

limiting factors for large-scale crops.

41

Canada's beekeeping industry was

significantly affected by the arrival of a new

parasite, Varroa mite, in 1989. Beekeeper

numbers dropped steadily for two decades

from their peak in 1985. Reeently, there has

been a measurable upward trend of urban

beekeepers and colony numbers following the

Global Financial Crisis (2008-2010) and its

accompanying recession. This period also

corresponded with a surge in media interest

and public awareness of honeybee colony

losses. Many consumers are concerned about

the plight of pollinators and want to obtain

food loeally, so demand for urban bees is high.

With recent changes in city bylaws, it is clear

that the trend to urban agriculture and urban

beekeeping is here to stay.

Native pollinators and the diversity of bees

C. S. Sheffield, Royal Saskatchewan Museum,

Regina, SK

The last decade has revealed that we are so

reliant on one species, the European honeybee

{Apis mellifera L.), for crop production via

pollination that we now face a possible food-

security issue with its continuing decline. Our

best hopes may not lie in putting all our

research efforts and resources into helping this

eharismatic species, but in also including other

native bee species into the crop-pollination

equation.

Canada has over 800 species of bees, and

many show much potential as managed and

encouraged pollinators. Wild bees can be

encouraged to live in many terrestrial habitats,

including agricultural ones, by conserving and

providing ample pollen and nectar resources

and nesting sites and habitats. Cavity-nesting

bees, primarily the family Megachilidae, show

great potential as alternative managed

pollinators, because many speeies aeeept

artificial nesting sites (i.e., nesting blocks) and

show strong preferences for some crop plants.

As well, combinations of crop and non-crop

plants that flower in sequence can be used to

promote bee-population growth in crop

systems. By considering what bees need, and

then providing it, we ean supplement

pollination ser\'ices. In addition, most of the

things that we do to help native bees will also

benefit honeybees, which allows us to meet

concerns for all pollinators.

42

Colony collapse disorder, farm chemicals,

and pollinator declines

P. van Westendorp, British Columbia Ministry

of Agriculture, Abbotsford, B.C.

Since 2000, pollinator declines have been

reported in many parts of the world. This

decline has not been limited to honeybees

{Apis mellifera), but also to other

Hymenoptera pollinators. French beekeepers

first reported high losses of apparently healthy

colonies near com and potato plantings.

Neither of these crops is of interest to bees as

forage sources. Similar losses were reported

by beekeepers in other European countries,

which led to the suspicion of a link between

colony losses and the insecticides used on

these crops.

In the late 1980s, the neonicotinoid

insecticides were introduced in Europe; since

then, formulations have been registered in

more than 120 countries. The neonicotinoids

mimic the natural plant derivative of nicotine,

which is characterized by its rapid knock-

down effect, short efficacy period, and rapid

breakdown. On the other hand, neonicotinoids

have proven highly effective at disrupting an

insects central nervous system, as well as for

their systemic action and high persistence in

the soil. Furthermore, neonicotinoids display

low to moderate toxicity to mammals,

affecting only their peripheral nervous

systems.

In the fall of 2006, U.S. beekeepers

reported catastrophic losses of apparently

healthy colonies without the identification of

the causal agent(s). The phenomenon was

dubbed “colony collapse disorder” (CCD).

The extent of the losses was so significant that

it seriously jeopardized the production of a

range of pollinator-dependent crops, most

notably almonds. Despite intense research

efforts, no definitive causal agent of CCD has

been identified. It is generally accepted that

CCD is caused by various biotic and abiotic

factors. In particular, mite parasitism of the

obligate, host-specific Varroa destructor has

had a highly destmctive impact on honeybees.

The situation has been exacerbated by bee

vimses vectored by the Varroa mite. Other

factors include management, bee genetics,

dietary deficiencies, and exposure to fann

chemicals. However, until now, there has been

no scientific evidence of a direct link between

CCD and neonicotinoid insecticides.

J. Entomol. Soc. Brit. Columbia 110, December 2013

Since the initial introduction of

neonicotinoids, a wide range of systemic

formulations have been developed for use in

numerous crops. Acute toxicity to insects has

never been in dispute, but due to their

persistence in the environment, it is believed

that neonicotinoids may cause pollinator

declines due to their chronic exposure at sub-

lethal levels, resulting in irreparable nerve

damage. An increasing body of evidence

shows that chronic exposure at sub-lethal

levels results in memory loss, changes in

foraging and reproductive behavior, and a

suppression of the insect’s immune response

system.

While unequivocal scientific evidence of

the impact of neonicotinoids on pollinators

has not yet been produced, the environmental

consequences of the constant application of

farm chemicals are highlighted by the way

these products are marketed and promoted.

From the 1960s onwards, integrated pest

management (IPM) programs were developed

for most crops and considered the use of any

chemical or drug only when monitoring data

support the need for the chemical or drug.

However, today, many farm chemicals are

applied prophylactically, regardless of need.

Neonicotinoid insecticides are applied to

100% of com seed and 50% of soy seeds.

Until recently, farmers had to pay a higher

price for untreated com seed. The departure

from IPM principles is of great concern,

because they are replaced by a management

system that incorporates the indiscriminate

and chronic use of chemicals into the

environment, without clear evidence on the

long-term impact these chemicals have on

non-target organisms.

Decision-making by the Canadian Food

Inspection Agency

H. Higo, Canadian Food Inspection Agency,

Surrey, B.C.

The 2013 risk analysis on the importation

of bulk honeybees from the continental U.S.

was released by the Canadian Food Inspection

Agency (CFIA) on 25 October 2013. The

CFIA uses a standard protocol for evaluating

potential risks of imports from other countries.

This presentation outlines the general risk

assessment protocol and details how this

protocol was applied in the recent honeybee

risk assessment.

J. Entomol. Soc. Brit. Columbia 110, December 20 13

The CFIA considered four disease and pest

issues to be hazards: the Africanized

honeybee, antibiotic-resistant American

foulbrood, small hive beetle, and acaricide-

resistant Varroa mites. These hazards were all

estimated to be moderate or low-to-moderate

risks. Because the risks had not changed

significantly since the last risk assessment in

2003, no change in the importation status of

bulk honeybees from the continental U.S. was

recommended.

Bee integrated pest management

H. Higo, Canadian Food Inspection Agency,

Surrey, B.C.

Honeybee colony losses have increased

significantly in recent years, from an average

loss of 10-15% prior to 2006 to 30% or more

since then. The causes of these elevated

colony losses appear to be multi-factorial,

including diseases and pests (such as the

Varroa mite, Nosema disease, and viruses

transmitted by Varroa mites), reduced pollen

and nectar availability with habitat loss and

mono-cropping agriculture systems, and

exposure to pesticides or other environmental

factors in the field and in the hive. Integrated

pest management (IPM) of Varroa mites and

other diseases in the hive without relying

heavily on harsh chemicals may help to reduce

the honeybee decline.

This presentation outlines a novel project

using proteomics — a potential new weapon in

the IPM toolbox — to select for specific

honeybee behaviours that combat Varroa

mites and other diseases. Several honeybee

antennal proteins were shown in a previous

43

project to be closely associated with worker

hygienic behaviour, in which workers

selectively remove diseased or infested pupae

from the colony before the disease or mite has

a chance to reproduce. Beginning in 2011, we

sampled and tested commercial colonies

across western Canada for hygienic behaviour.

Cooperating beekeepers allowed us to remove

selected queens, and going forward we used a

two-pronged selection protocol to breed three

generations of bees, either using proteomics or

traditional, laborious field tests for disease-

resistance.

Early results appear promising, but final

results from the 2013 mite and bacterial

challenges of the F3 generation are still being

evaluated. As well, economic evaluations are

underway in Manitoba and Alberta, as are

practical evaluations of F3 queens by

commercial cooperators across western

Canada. Results will be released in the

summer of 2014, and proteomic testing could

soon be a new IPM tool available to

beekeepers.

This project involved researchers from the

University of British Columbia (Leonard

Foster, Marta Guama, Amanda van Haga,

Miriam Bixby), University of Manitoba (Rob

Currie), Agriculture and Agri-Food Canada

(Stephen Pemal, Abdullah Ibrahim, Shelley

Hoover, Adony Melathopoulos) and bee

breeders Liz Huxter and Heather Higo.

Funding was provided by Genome Canada,

Genome BC, Genome Alberta, Agriculture

and Agri-Food Canada, University of British

Columbia, University of Manitoba, and the

B.C. Honey Producers Association.

44

J. Entomol. Soc. Br]t. Columbia 110, December 2013

Presentation Abstracts

Entomological Society of British Columbia

Annual General Meeting,

PacificForestry Centre, Victoria, B.C., Nov. 1-2, 2013

Phylogenetics and natural history of the

subfamily Tryphoninae (Hymenoptera:

Ichneumonidae)

A. Bennett, Canadian National Collection of

Insects, Agriculture & Agri-Food Canada,

Ottawa, Ontario

The Tryphoninae are a group of

ectoparasitoid wasps that parasitize sawfly and

Lepidoptera larvae. There are 1252 species in

59 genera worldwide. A morphological

phylogenetic analysis was performed to

examine their relationships. This analysis

permits discussion of the evolution of adaptive

characters and host associations.

Bee talk: Do honeybees use the Earth

magnetic field as a reference to align their

waggle dance?

V. Lambinet, M. Hayden, M. Bieri and G.

Gries, Departments of Biological Sciences and

Physics, Simon Fraser University, Burnaby,

B. C

Waggle-dancing honeybees recruit hive

mates to a food source. Directional

information is encoded in the angle between

the waggle run line of the dancer and a

reference line, predicted to be gravity or the

geomagnetic field (GMF). Canceling the GMF

around hives revealed no effect on the dancer's

recruiting success.

De novo transcriptome of Megastigmus

spermotrophus: Hunting for mechanisms of

host manipulation

A. Paulson, S. Perlman, P. von Aderkas,

Department of Biology, University of Victoria,

Victoria, B.C.

Megastigmus spermotrophus

(Hymenoptera; Torymidae) is a seed parasite

of Douglas-fir, Pseudotsuga menziesii. Three

highly expressed venom transcripts from

females were identified in the transcriptome.

One of these venoms,

aspartylglucosaminidase, has been identified

as a major venom constituent of two parasitoid

wasps.

Cyberbugs: Military and non-military

research and applications

A. Behennah, 1829 Laval Avenue, Victoria,

B. C.

Within the past 20 years, a series of

experiments have attempted to hybridize

insects with technology for military or

security purposes. Hymenoptera were applied

to the detection of explosives and land-mines,

and electronics implanted into muscle and

nerve tissues remade cockroaches, moths, and

beetles into remote-controlled bio-robots.

Drosophila suzukii in the D. suzukii world:

Humidity decreases density-dependent

competition

C. Hodson, S. Dhanani, A. Hoi, A. Chubaty

and F. Simon, Department of Biological

Sciences, Simon Fraser University, Burnaby,

B.C.

Humidity has been suggested to be

important for Drosophila suzukii

development; However, how it mediates

competition has not been described

previously. An examination of density-

dependent competition under variation in

humidity of D. suzukii suggests that high

humidity reduces the consequences of

competition at high densities.

Transgenerational Effects on Disease

Resistance in an Insect Herbivore

G. Olson and J. Cory, Department of

Biological Sciences, Simon Fraser University,

Burnaby, B.C.

The western tent caterpillar undergoes

dramatic population cycles that coincide with

viral epizootics. Our research investigates how

changes in dietary factors related to density

altered disease resistance over two

generations. Contrary to expectations, our

findings indicate that dietary stressors may

enhance disease resistance, leading to more

disease-resistant populations.

J. Entomol. Soc. Brit. Columbia 1 1 0, December 20 1 3

Web-reduction behaviour in black widows:

A story of attraction, courtship,

manipulation, and rivalry

C. Scott, D. Kirk, S. McCann and G. Gries,

Department of Biological Sciences, Simon

Fraser University, Burnaby, B.C.

Western black widow females attract males

with a silk-borne sex pheromone. During

courtship, males often engage in ‘web-

reduction’ — dismantling and bundling up

parts of the female’s web. We present data

from a field experiment demonstrating that

web-reduction functions to decrease web

attractiveness, thereby limiting the arrival of

male competitors.

How to kill a parasite: Transcriptional

responses in a Drosophila defensive

symbiosis

P. Hamilton, J. Leong, B. Koop and S.

Perlman, Department of Biology, University of

Victoria, Victoria, B.C.

Symbioses of insects can be critical to host

defense. Drosophila neotestacea is defended

against a nematode parasite by the bacterium

Spiroplasma, but the mechanism of this

defense is unknown. Transcriptome

sequencing in this system shows that the

production of toxins by Spiroplasma is the

most likely cause of defense.

Population dynamics of a tritrophic food

chain in a warming world: A modeling

approach

M. Orobko, F. Simon and B. Roitberg,

Department of Biological Sciences, Simon

Fraser University, Burnaby, B.C.

We simulated varying levels of heat waves,

along with predicted mean temperature

increases, in a model of a tritrophic food chain

with organisms whose performances were

temperature-dependent. We found that heat

waves could lead to an increased risk of

extinetion in these communities.

Exploring the temporal and dose-

dependent immune response to baculovirus

in an insect

J. Scholefield, I. Shikano, V. Fung, and J.

Cory, Department of Biological Sciences,

Simon Fraser University, Burnaby, B. C.

We exposed the cabbage looper,

Trichoplusia ni, to different doses of a

baculovirus, and measured the haemocyte

45

response at different time periods following

exposure. Changes in haemocyte type and

density could affect within-host competition

with other pathogens. The changes have

important evolutionary consequenees for the

evolution of virulenee and insect population

management.

How do entomopathogenic fungi and

parasitoids interact over a long term to

control aphids in greenhouses?

Y. Norouzi, J. Cory and D. Gillespie,

Department of Biological Sciences, Simon

Fraser University, Burnaby, B.C., and

Agriculture & Agri-Food Canada, Agassiz,

B. C.

Beauveria bassiana (strain GHA) in the

commercialized form, BotaniGard, had a

positive interaction with a parasitoid Aphidius

matricariae. In the six- week period, the use of

both biocontrol agents together resulted in

fewer aphids and more parasitoid mummies

on the plants than any of those biocontrol

agents alone.

A social raptor exploits the absconding

response of Neotropical social wasps in

order to prey on their nests

S. McCann, O. Moeri, T. Jones, C. Seott, G.

Khaskin, R. Gries, S. O’Donnell and G. Gries,

Department of Biological Sciences, Simon

Fraser University, Burnaby, B.C. and

Department of Biodiversity, Earth and

Environmental Science, Drexel University,

Philadelphia, PA, USA.

Red-throated Caraearas are faleonid

raptors that speeialize in the brood of social

wasps. We tested the hypothesis that they use

repellents to fend off wasps by chemically

analyzing the birds’ feather and feet and

video-recording nest attacks. We conelude that

caraearas use behavioural manipulation to

subdue their prey.

Anopheles gambiae alters blood-feeding

behavior in response to a host protected

with the new repellent 3c(3,6)

C. Hudson and B. Roitberg, Department of

Biological Sciences, Simon Fraser University,

Burnaby, B.C.

Anopheles gambiae is a vector of

Plasmodium spp., which cause malaria. We

evaluated bloodhost-seeking behaviour of A.

gambiae when the host is protected by the

46

chemical 3c(3,6). We compared our results

with DEET and found that 3c(3,6) may be an

effective new chemical to repel A. gambiae.

We can't be friends: Interspecific

aggressive competitive behaviour of

Drosophila suzukii and Drosophila

melanogaster females when forced to share

a common resource

T. Dancau, T.L.M. Stemberger, B. Roitberg,

Department of Biological Sciences, Simon

Fraser University, Burnaby, B.C.

Drosophila suzukii differs from all other

Drosophila by ovipositing in fresh rather than

rotting fruits (Hauser 2011). When forced to

utilize the same resources as D. melanogaster,

D. suzukii performs poorly (Stemberger, pers

comm). This study explores one aspect of

competitive behaviours between these two

species.

Insect community dynamics in a high-

Arctic ecosystem

S. Robinson and G. Henry, University of

British Columbia, Vancouver, B.C.

Climate change is expected to alter the

dynamics of high-Arctic ecosystems. Plant

communities have been studied in many high-

Arctic ecosystems, but there are relatively few

studies of insect communities, and even fewer

on how these communities change throughout

the short snow-free season. Having this

information is important in the context of

pollination services to flowering plants.

During the summer of 2012, we eonducted

bowl trapping and hand-netting every two

days, in order to survey the overall insect

community as well as important floral visitors,

at Alexandra Fiord, Ellesmere Island,

Nunavut. The dominant floral visitors were

primarily dipterans: Syrphidae of the genus

Eupeodes, Muscidae of the genera Phaonia

and Drymeia. Arctic bumblebees (Bombus

polaris) were also found, but at nowhere near

the frequency of the dipterans. Both families

of dipterans were also found to visit during

distinctly different times of the snow-free

season. We present some of our preliminary

findings on how this community changes

throughout the season, and what changes in

visitation may mean for a warming arctic.

J. Entomol. Soc. Brit. Columbia 110, December 2013

Pheromone-mediated defensive behaviour

of Dolichvespula maculata.

S. Ibarra, S. McCann, R. Gries, H. Zhai, and

G. Gries, Department of Biological Sciences,

Simon Fraser University, Burnaby, B. C.

We tested pheromone-mediated defensive

behavior by Dolichovespula maculata hornets

in response to venom-gland extracts from

conspecifics. In venom-gland extracts of D.

maculata, we identified seven components

that, when tested as a synthetic blend, induced

defensive behavior similar to venom-gland

extracts.

Patch-size and temperature-interaction

effects on the predation of pea aphids

{Acrythosiphon pisum) by the Asian

Ladybird beetle, Harmonia axyridis

D. Quach, J. McKenzie and D. Gillespie,

Department of Biological Sciences, Simon

Fraser University, Burnaby, B.C. and

Agriculture & Agri-Food Canada, Agassiz,

B.C.

In order to study the combined effects of

rearing temperature, foraging patch size, and

foraging temperature on the predation rate of

pea aphids by the Asian Ladybird beetle, a

2x2x2 factorial design experiment was done

using rearing temperature, foraging

temperature, and arena size as variables.

Exposure temperature had the strongest effect

on predation rate, whereas a strong interaction

between exposure temperature and arena size

was observed.

Effects of poplar phenolics on the fitness

and behaviour of Chaitophorus aphids

A. Wong, P. Constabel and S. Perlman,

Department of Biology, University of Victoria,

Victoria, B.C.

Effects of phenolic secondary metabolites

on phloem feeders was investigated using

transgenic poplar with high tannins and low

phenolic glycosides in bioassays with

specialist Chaitophorus aphids. Aphids had

higher fecundity on transgenic plants, but

preferred wild-type tissue. Phenolic glycosides

were identified in aphid extracts providing

support for their presence in phloem and

ingestion during aphid feeding.

*■

I

-V>|

NOTICE TO CONTRIBUTORS

The Journal of the Entomological Society of British Columbia is published once a year in December and

articles are also published online as they are accepted. The JESBC provides immediate open access to its

content on the principle that making research freely available to the public supports a greater global

exchange of knowledge. Manuscripts dealing with all facets of the study of arthropods will be considered for

publication. Submissions may be from regions beyond British Columbia and the surrounding jurisdictions

provided that content is applicable or of interest to a regional audience. Review and forum articles are

encouraged. Authors need not be members of the Society. Manuscripts are peer-reviewed, a process that

takes about six weeks. This journal utilizes the LOCKSS system to create a distributed archiving system

among participating libraries and permits those libraries to create permanent archives of the journal for

purposes of preservation and restoration.

Submissions. The JESBC accepts only electronic submissions via the journal homepage: http://

journal.entsocbc.ca/. Style and format guidelines, open access fees, and other information for authors can be

found at the journal homepage.

Scientific notes. Scientific notes are an acceptable format for short reports. They must be two journal pages

maximum, about four manuscript pages. Scientific Notes do not use traditional section headings, and the

term "Scientific Note" precedes the title. A short abstract may be included if desired. Notes are peer-

reviewed in the same manner as regular submissions.

Review and forum articles - Please submit ideas for review or forum articles for consideration to the editor

at joumal@entsocbc.ca. Reviews should provide comprehensive, referenced coverage of current and

emerging scientific thought on entomological subjects. Forum articles of about 1000 words in length should

provide opinions, backed by fact, on topics of interest to entomologists and to the general public. Both

review and forum submissions are only published in the journal following full and rigorous peer review.

Electronic reprints. As an open access journal, article reprints from all issues of the journal can be

downloaded as PDFs from the journal homepage.

Back issues. Electronic back issues are available online free-of-charge. Print back issues of many volumes of

the journal are available at $15 each.

Membership in the Society is open to anyone with an interest in entomology. Dues are $20 per year for

domestic memberships, $10 for students, and $25 for international memberships. Members receive electronic

copies of Boreus (the newsletter of the Society), and when published, occasional papers. There is a further

$10 (domestic) or $15 (international) fee for members interested in receiving a print copy of the journal.

Membership and membership renewals can be purchased at: http://blogs.sfu.ca/groups/esbc/membership/.

Journal of the

Entomological Society of British Columbia

Volume 1 1 0 Issued December 2013 ISSN #007 1 -0733

Directors of the Entomological Society of British Columbia, 2013-2014 2

G.R. Pohl and R.A. Cannings. The new checklist of British Columbia Lepidoptera and

how it came to be 3

A. Pantoja, D.S. Sikes, A.M. Hagerty, Susan Y. Emmert, and Silvia Rondon. Ground

beetle (Coleoptera: Carabidae) assemblages in the Conservation Reserve Program crop

rotation systems in interior Alaska 6

S. Mathur, D.A. Raworth, K.S. Pike, and S.M. Fitzpatrick. Diagnostic molecular markers

to detect and identify primary parasitoids (Hymenoptera: Braconidae) of Ericaphis

fimbriata on highbush blueberry 19

A.J. Stock, T.L. Pratt, and J.H. Borden. Seasonal flight pattern of the Western Balsam Bark

Beetle, Dryocoetes confusus Swaine (Coleoptera: Curculionidae), in central British

Columbia 27

SCIENTIFIC NOTES

Chris J.K. MacQuarrie, Daryl J. Williams, and David W. Langor. Update on the

establishment of birch leafminer parasitoids in western Canada 35

M. Jackson, C. Pyles, S. Breton, T. J. S. McMahon and P. Belton. British Columbia’s 50th

mosquito species, Aedes schizopinax 38

ANNUAL GENERAL MEETfNG ABSTRACTS

Entomological Society of British Columbia Annual General Meeting Symposium Abstracts:

The Rise and Fall of the Honeybee 40

Entomological Society of British Columbia Annual General Meeting Presentation

Abstracts 44

NOTICE TO CONTRIBUTORS Inside Back Cover