a eee ke oR ts Dak ak de ee ee a Oe re Wa wie We Wied A, he Meet

Lee LLLE Sent ie ror ne aren he Motive De the EL TEE Masten an ON,

oi RM NTL Me Ade OE NaN EAS RY AE UNGER AR YEA TR Mb dete UR SII SH OMAN AUNEG BCI

AW PPR Ba Nhe MMOH TS OTL Ee Paty REN 2ST OLE NS Ba re had dO CERNE GH Se TL NVPEN 5 fe ca do ASAE Ae OO MINE OTE

Ay Noite My MOB ete Ho Hd MA Te See Be HOR IO AQ Me et IE BEC IEE Nera My atVit es APL OUP LTME MENTO Dea tg eck ee jae Nd baer ins

Ne He BRM MAT AL MSMy CODE NA TRMI CO Oy Moe Ay SS Oe Be PEA EE CNTR ES ET RET PG MM te INO Late

PNR. BW Mo tetas Betis DOM ity a BME MEANT, OAM TY ROR NEL fag ALES MN NLN TENS TUPI ee AURA EE ACAUE NSN Thar

RFR Be MAM Mea MK MS POMS FAM AT AMA AG AANA Pa he MR RGM LU Fae

SOROS PPM ree £

PMT T I es Or ey Meer®

SRO bl ponte

WUEMRENN WR Ct SL ae Ope gy eye

te AOE iM UM 1h

EV MDI Gy Lag 4M

DRS ie Re Ia fee JT

De NE BO EON He EEO. eae

annie re a Oe he A WE WAN ME Ol MEM dE ee a

Sh Sana hey ogy nA A ee MMM el UTE MMe NAM WANED, cov MANSY Bh,

Dan ears Pe ae Ct aoe WN Wm CNN AN DIL AN GARDE HEY BOD Khe DONG pO BSH

EO EIT yy ’ Pe ern ee oe Do 9 DENATURED 2M MEM AAS

ee ee Le ee eer) Um ee ee URL eee, me re 1 LOAM REHM OM ON Ie te gw

fee te wg ae ok DON NO AINA MTN VM oth UTM hilo fed? ert eee Te Val Ma eae a Bay MLD MAA IMS yh ie

Case ec es re ey LF WN Bon

a Arn

Sele

Wile WEG! Mee bah. tia Val GR yo gah 0 Wh NAA has

Woh MN Yan VV ast Webi yaa st WA Bad GVM BV Ge AS Oe Meta MIN oan,

Ves Doe Raves Ce rd cea Bo whi Hie ES oe Pd St Pe ae ee SOP ott ol

VAWONGS tbSae Abr eee Ree eanne Bie a Pree) 1h a ed A 2a es eC 2 ee a TO et M14 tN Mt

NAGEL Med OBER MAS Fe eet le ate VEE ON INT DRO Meter ONL Le Me re gt ROAP UE IN Seer Bh ey Vit “bavee Saeas RNAV MM FO OTE AL EEA toh MO Vso ON IND Bh ads ng MI ADEA sb OU ML ENON, Be Vite!

A Be IRS EMR OM Me WOE MR A UR DN A ae litte Hast a Ce A cn ee SCOPE MAEVE sae ln phat neat ee Peat ay DULY SUL a ea ivh Ce eye PP eae cere ee 2) | MAAR LA ee a a a BAN MM MH te Mes ah Mae ML VE My i gh sw

ee eee NEN a REN stadia R tts AVR Ay MAI Mall Me Me NGA Me Tete ber nied chee Heaney? NUDES NERA U EG Me eto ita Sot emer ene at APO hy ul Day rane tye uss Mn es bi Si

NP) Aah eto Hat Mi RI TCU er tL OL, tae FOUR OSH AME MNES Ve AUR TG SPEER BTR EY Ot tity OCHRE TOP EM TIRE 5 EAE

9 0 Ma Rel PMSA TEN REN MA Pate e mien ia he MOU MH SWS HS MEN ay ALE RN Bak WM. Oy Ou Ste me Hai ety AN a CO ee RS Oe eh

We VEMe FEM Ms Be Meda My MAN My MLE AMT Raven Ne Fytla Me Pa elas g My Mee Ay NEE E hee HG

ty

es ee Sl Me Se

Re BAS BON He Res:

Vetta ger

be agtely

PUM SIREN Se AGRE MU MAE IUM Mads

thee

+ Cn eee eer en

Wea BN ME ae oS AMM Oly

Bom

SRE OIE,

OT AEN MN Ee A US oe Yang

NM ENON TNO RIN IRE SHEN WTR SA TY MAYAN CL Mb ile gM oA th 4m GA J 1 MW ROH SE IRD, eeu] e a Met em

my Pe LEELA Ee cae es i a nr a rd ANY vor MDE Mes AIS,

erie peas n Maw AW Ee big ELGG MANET Mah OAS VA aVet ed eh ee

NO RAT RAIA He Ne Dan ho HASSLES Gea tad fe WET etn Eevee hE IE Pee eh ANSI ALI WoO STN FE EV 1 Bg EhEN Me AA ha Veneer S178 Ob ry A, Parr) hoe

SN Ra Re de Meme VOM eat MEN ALOT S MOM He oS ROM RM Stade Pa Pe aah PM eG RENE Ady AE SOSH EG et weve gees MONO PPh ety Dan OO ata (a eT OO ed er) Pree Cd rd ee ee | io

aE BARE RL AL SANG Pod ay d Magy CATON U AEN RR, ALT ME ROL ST Maint te aE One ad Pan ae eC TT MAIS WANDS SS PRY SCR PGR TT BY AP UR ans Viton hehe rap b's Sah PLU CMEC N ETA Ae deat ate boat @ ddd)

ATR IMI, 8 oa A eR a Hy a Reeds Ps Mat SOE He ee, Ree MO Or) ea a ee ota tet gt ay eure ee Dea So er es ed TD WY AP bry th Et

Hoh Fe RA MRS CA TI RL MM AB DU RSS, RT ee eo 3 Wea 5

BSH EK Wo Bee Mowe ite Pe hedeedams FaVante Ry Ms Mee MAN Ds fad Panky Re ded e Ee. Mate

SREB A OMA ene OG Bath b en ee en ae eee

Due atata ty

wher,

NAMA NN Ba Pate MAN, WY Hoe BS WN rey Sadig MW TARE ER AN MG an

Pee en ea be rs eae

aaa NaI ely eee?

oe Be Door i

A ae

NNT Mite git pa gle fete

fe tyra gne

pw teu de

eA AN

HSGERE OVEN, oe a8 eo) i

Tas a fa VAT RORACT mse \ Sesh ee ferrite hah gears ga dey! “,

er ce Meese’ A BET Ae MN MeN aye Pye VA Me RED EW Ad ghey

Oni. er ners anh Oe ne OE N tesig PINT CR Ge Eh Pet HN ay Me TT AE ye R TY dnt pee

i ON wh MMT, PLN HN Ve RaW Ramee a I ace eT at EEN No a8 :

I Weel datas aN ae Bee Hee ay ;

UW Shah

Le ays

ah Hee HINES eg

Hiden f

Vebees Mee age tw yt ny

NAO IRA i tah

weegs

SAI Fr DS ta dee

ERA bet VE Ly

RIDING FOAL ALE a

TAM Daina gees,

Ha Mostyn tt

HMI, rece ome

SMe?

Pett BI Sw

Pm AY Na

NTO

arn

stated

be Benen ©

EME De aN

ake ta Hes ody tga es &

SRN IN EOIN

ee Meee wants

oe ae re

ANUP. Meee ta aN"

TG A Ot

NM OM

Mids vss

pn Se

CEM SET ieee

Mew Rataey Mod “a?

wet hewa ate Ra tall yet

sehen he y

aM Be ae

Vee ate Dee

ENT

L5E49

HARVARD UNIVERSITY

ave tians

Ernst Mayr Library

of the Museum of

Comparative Zoology

MCZ

LIBRARY

JUL 24 2012

HARVARD |

UNIVERSITY

MCZ_

LIBRARY

r EB 5 t Que

HAN RSITY

JOURNAL

of the

ENTOMOLOGICAL»y

Volume

One Hundred and Thirty-Eight

2007 :

Published November 2007

JOURNAL

of the

ENTOMOLOGICAL SOCIETY

ONTARIO. | -

Volume One Hundred and Thirty-Eight 7

=") 2007 : ur F

Published November 2007

THE ENTOMOLOGICAL SOCIETY OF ONTARIO

OFFICERS AND GOVERNORS

2006-2007

President: Webmaster:

B. HELSON D. B. LYONS

Natural Resources Canada, Canadian Forest Service

1219 Queen St E., Sault Ste. Marie, ON P6A 2E5

bhelson@nrcan.gce.ca

President-Elect:

R. HALLETT

Dept. of Environmental Biology,

University of Guelph, Guelph, ON NIG 2W1

rhallett@uoguelph.ca

Past President:

J. HUBER

Natural Resources Canada, Canadian Forest Service

c/o Eastern Cereal and Oilseed Research Centre

960 Carling Ave., Ottawa, ON K1A 0C6

huberjh@agr.ge.ca

Secretary:

D. HUNT

Agriculture and Agri-Food Canada G.P.C.R.C.

2585 County Road 20, Harrow, ON NOR 1G0

huntd@agr.gc.ca

Treasurer:

K. BARBER

Natural Resources Canada, Canadian Forest Service

1219 Queen St E., Sault Ste. Marie, ON P6A 2E5

kbarber@nrcan.gc.ca

Librarian:

J. BRETT

Library, University of Guelph

Guelph, ON NIG 2W1

Directors:

D. CURRIE (2007-2009)

Royal Ontario Museum, Toronto, Ontario

H. FRASER (2005-2007)

Ontario Ministry of Agriculture and Food

Vineland Resource Centre, P.O. Box 8000

4890 Victoria Avenue North

Vineland, ON LOR 2E0

M. PICKLES (2005-2007)

3252 Garner Road, Niagara Falls, ON L2E 6S4

J. SKEVINGTON (2007-2009)

Agriculture and Agri-Food Canada

960 Carling Ave., Ottawa, ON K1A 0C6

L. TIMMS (2006-2008)

Faculty of Forestry, University of Toronto

Toronto, ON MS5S 3B3

S. VANLAERHOVEN (2006-2008)

Dept. of Biology, University of Windsor

Windsor, ON NOB 3P4.

ISSN 1713-7845

of

Natural Resources Canada, Canadian Forest Service

1219 Queen St E., Sault Ste. Marie, ON P6A 2E5

Student Representative:

A. THIELMAN

Brock University, St. Catharines, ON L2S 3A1

Newsletter Editor:

J. ALLEN

Ontario Ministry of Agriculture, Food and Rural Affairs

1 Stone Road West, Guelph, ON NIG 4Y2

EDITORIAL COMMITTEE

Scientific Editor:

M. H. RICHARDS*

Dept. of Biological Sciences, Brock University

St. Catharines, ON L2S 3A1

miriam.richards@brocku.ca

Technical Editor: A. Rutgers-Kelly

Layout Artist: A. Rutgers-Kelly

Associate Editors:

A. BENNETT

Agriculture and Agri-Food Canada

960 Carling Ave., Ottawa ON K1A 06C

N. CARTER

Ontario Ministry of Agron and Food

Vineland, ON LOR 2E0

R. HARMSEN

Biology Department, Queen’s University

Kingston, ON N7L 3N6

Y. MAUFFETTE

Faculté des sciences, Département des sciences biologiques _

Université 4 Québec Montréal, Montréal, QC H3C 3P8

J. SKEVINGTON

Agriculture and Agri-Food Canada

Eastern Cereal and Oilseed Research Centre

960 Carling Ave., Ottawa, ON K1A 0C6

~

*Please submit manuscripts electronically to the Editor

(miriam.richards@brocku.ca). |

JESO Volume 138, 2007

JOURNAL

of the |

ENTOMOLOGICAL SOCIETY OF ONTARIO

VOLUME 138 2007

You will notice that there are two Editors’ Forwards in this volume of the Journal

of the Entomological Society of Ontario. On page 2 is the forward from Special Editor

Steve Marshall that was originally printed in Volume 137, which I have been thinking of as

‘Pengelly I’, with the first five papers in this volume comprising ‘Pengelly II’. About two

years ago, we began planning a special volume in memory of David Pengelly, an entomologist

at the University of Guelph who inspired many Ontario and Canadian entomologists. It is

a mark of the esteem in which his students and colleagues held him, that the memorial

volume had to be split into two. I would like to express my warmest thanks and appreciate

to Steve Marshall who acted as the Special Editor of the Pengelly volumes.

With the publication of Volume 138, I am delighted to note that JESO has resumed

a timely publication schedule. Not only is the 2007 volume actually being published in

2007, but preparations are already underway for Volume 139, to be published in 2008.

Another important change is electronic distribution of published manuscripts, with the

added attraction that the electronic versions may include colour plates and maps, which are

generally impossibly expensive to print. Electronic distribution will enable our authors’

work to reach the wider audience that it deserves, not least of all because it will become

accessible to web search engines. These are important developments in bringing JESO

to a wider audience, and everyone who has helped to get us to this point, should award

herself or himself a pat or two on the back. I especially thank the JESO Editorial Board,

the ESO Board, our patient Technical Editor, and the many reviewers whose hard work and

enthusiasm for the Journal, have been the real impetus for these changes.

After that moment of self-congratulation, let me assure you that we are not resting

on our laurels, but intend to continue building on the momentum we have established. First,

we are committed to maintaining annual publication in the autumn of each year (dare we

dream of bi-annual publication?), so please submit your work to JESO — we are already

considering manuscripts for Volume 139 (2008), and the more, the merrier. Remember,

all entomological research is welcome, whether its subjects are in Ontario or elsewhere.

Second, we are planning to begin converting back volumes of JESO into electronic format

for distribution from the website — eventually we would like to post all volumes of JESO

and its predecessor, the Proceedings of the ESO, right back to volume 1. Third, the success

of these Pengelly volumes has inspired suggestions for future special volumes devoted to

particular entomological themes. All these plans will help to ensure a bright and buggy

future for the Journal.

Happy reading!

Miriam H. Richards

Editor

JESO Volume 138, 2007

JOURNAL

of the

ENTOMOLOGICAL SOCIETY OF ONTARIO

VOLUME 138 2007

It has been a pleasure for me to serve as Special Editor for the D. H. Pengelly tribute

volumes, and to work with regular Editor Miriam Richards to line up a diverse assemblage

of papers touching on the range of entomological disciplines influenced by Dave Pengelly

(1922-2004). Dave was widely known, and is fondly remembered, as a fantastic teacher of

entomology and as a huge contributor to the development of the University of Guelph Insect

Collection; but he is also sorely missed as a seemingly infinite reservoir of entomological —

trivia, anecdotes, insightful stories, jokes, support, and wise advice. Almost all of the

authors in these volumes were strongly influenced by Professor Pengelly, most shared his

enthusiasm and passion for collecting and identifying insects, and many worked with Dave

to build up the University of Guelph Insect Collection. Although now widely appreciated as

a treasure trove of information about faunal change and insect distribution while also serving

as the foundation for a growing body of taxonomic research, the University of Guelph

Insect Collection during Pengelly’s tenure was a beleaguered resource used mostly as a

source of specimens for a myriad of entomology courses including the hands-on third year

entomology labs that Dave taught every weekday. It is a testimonial to his foresight that he

not only kept the collection from deterioration or destruction due to invasions of dermestid

beetles and indiscriminate colleagues, he consistently built up the collection and increased

its curatorial level annually. He did not do this alone, of course. Professor Pengelly had a

contagious vision of what was needed to improve our understanding of Ontario’s insects,

and his enthusiasm for the study of insect biology and diversity was such that he was always

associated with dedicated students. Thousands of specimen labels in the insect collection

bear the names of most of the authors of papers in these volumes, standing as permanent

testimonials to a shared vision that started with students working with their mentor at

University of Guelph, and which continues through the widely dispersed teaching, research,

and publications by Dave’s students and colleagues today. I think he would have liked these

sets of papers, and he would have been pleased to see them published in the journal that

he supported so selflessly ... almost every copy of this journal sent out during the 16 year

period “D.H.” was Secretary-Treasurer of the ESO was sent out by Dave personally. We all

wish he were still here to send this one out!

Steve Marshall

Special Editor

Review of Eustochus JESO Volume 138, 2007

REVIEW OF EUSTOCH US, A RARELY COLLECTED GENUS OF

MYMARIDAE (HYMENOPTERA)

J.T. HUBER’? and E. BAQUERO?

Canadian Forestry Service, Natural Resources Canada

Abstract J. ent. Soc. Ont. 138: 3-31

The four nominal species of Eustochus are reviewed. Four new species, E.

confusus from Spain, E. pengellyi and E. yoshimotoi from North America,

and E. nipponicus from Japan are described and a key to the eight species is

given.

Résumé

Nous revisons les quatre espéces nominales d’Eustochus. Nous décrivons

quatre nouvelles espeéces, E. confusus d Espagne; E. pengellyi et E. yoshimotoi

d’Ameérique du Nord, et E. nipponicus du Japon, et pourvoyons une clé

d identification aux huit espéces.

Published November 2007

Introduction

The Holarctic genus Eustochus was established by Haliday (1833) for a species

described by Curtis (1832) ina key as a species of Mymar—M. atripennis (which he attributed

to Walker). Curtis’s laconic description, abstracted here from his key, reads: ‘abdomen

petiolated, wings ciliated and perfect, ovipositor exserted, longer than the abdomen’. The

collection information given next to the name atripennis states simply ‘June, amongst grass

in a wood’. Graham (1982) suggested that perhaps only one specimen had been collected by

Walker, probably at or near Southgate, Middlesex (England). Haliday (1833) redescribed

E. atripennis (Curtis) in more detail, and included it as the only species within his new

genus Eustochus. He mentioned that the species occurred ‘in autumn, among trees, but very

rare’. Since then, the genus has been mentioned infrequently in the literature and only three

more species have been described, based on very few specimens each. Here, we review the

described species and describe four new ones from Spain, Canada, USA, and Japan.

' Author to whom all correspondence should be addressed.

* Correspondence address: Systematic Entomology, K.W. Neatby Building, 960 Carling

Avenue, Ottawa, Ontario, Canada K1A 0C6, email: huberjh@agr.gc.ca

> Departamento de Zoologia y Ecologia, Faculdad de Ciencias, Universidad de Navarra,

31080, Pamplona, Spain

Huber and Baquero JESO Volume 138, 2007

Materials and Methods

This study is based on recent examination of about 115 specimens from the

institutions listed below.

Eustochus species all appear to be very similar to one another so long descriptions

for each species, as for E. besucheti Bakkendorf, would be repetitious; therefore, diagnoses

only are given. The new species are described and illustrated based on females because males

are known for only two species and are exceedingly rare (7 specimens known). Specimens

from Japan were dissected and gold coated for the scanning electron micrographs (Figs. 1

—]5).

Morphological terms used follow Gibson (1997). Measurements, from slide-

mounted specimens unless otherwise indicated, are given in micrometers (uum), and are as

described in Huber (1987). The range is followed by the number of specimens measured, in

parentheses. Primary type data is recorded as found on each label, with slashes indicating

the beginning of each new line. Data from other specimens is given in a standardized format

to simplify retrieval or comparison. Abbreviations used are: Fl —Fl,=funicle segment one to

six, FWL or FWW=forewing length or forewing width, Fl, L (W)=flagellar segment length

(width).

Acronyms of repositories: CNC—Canadian National Collection of Insects, Ottawa,

Canada, J. Huber; FAFU-—Biological Control Research Institute, Fujian Agricultural and

Forestry University, Fuzhou, China, N.-Q. Lin; MRSN—Museo Regionale di Scienze

Naturali (Spinola Collection), Turin, Italy, G. Pagliano; MZNA—Museo de Zoologia,

Universidad de Navarra, Pamplona, Spain, E. Baquero; MHNG—Museum d’ Histoire

Naturelle, Geneva, Switzerland, C. Besuchet; UCRC—University of California, Riverside,

CA, USA, S. Triapitsyn; USNM-—National Museum of Natural History, Washington, DC,

USA, M. Gates.

Eustochus Haliday

Eustochus Haliday, 1833: 269 (key), 349 (description); Westwood, 1839: 78 (diagnosis);

Walker, 1846: 50 (diagnosis); Foerster, 1847: 225 (diagnosis); Foerster, 1856:

117 (key); Blanchard, 1840: 293 (diagnosis); Dalla Torre, 1898: 428 (catalogue);

Ashmead, 1904: 363 (key); Schmiedeknecht, 1909: 494 (key), 495 (diagnosis);

Gahan and Fagan, 1923: 64 (type species designation); Schmiedeknecht, 1930:

450 (key); Kryger, 1950: 61 (description); Annecke and Doutt, 1961: 24 (generic

comment); Debauche, 1948: 200 (description); Schauff, 1984: 50 (diagnosis,

phylogeny); Yoshimoto, 1990: 57 (diagnosis); Xu and Lin, 2003: 65 (diagnosis).

Type species: Mymar atripennis Curtis, by monotypy.

Diagnosis. Body 670-1330 um in length (critical point or air dried specimens); brown to

dark brown, with appendages somewhat lighter in colour. Head (except face) and mesosoma,

scape, dorsal surface of gastral petiole, coxae and femora with distinct reticulate sculpture

(Figs. 1-5, 7-10, 13, 15, 35, 36, 38-43); gaster, underside of petiole, and remainder of legs

4

Review of Eustochus JESO Volume 138, 2007

FIGURES 1-6. Head, Eustochus sp. probably atripennis (Japan, Mt. Tsukuba). 1—dorsal;

2-lateral 3—anterior; 4—ventral; 5—posterior; 6—mouthparts.

Huber and Baquero JESO Volume 138, 2007

100 um

100 um

100 um

20m

20 um

FIGURES 7-15. Mesosoma and metasoma, Eustochus sp. probably atripennis (Japan, Mt.

Tsukuba). 7—mesosoma, dorsal; 8-mesosoma lateral; 9-mesosoma ventral; 10—metasoma,

dorsal; 1 1—metasoma, lateral; 12—metasoma, ventral; |3—petiole dorsal; 14—petiole, ventral;

15—petiole, lateral.

Review of Eustochus JESO Volume 138, 2007

pe

OO cre rr ie th

FIGURES 16-20. Eustochus spp., female antenna, lateral. 16—atripennis (Germany,

Bornheim); 17—besucheti (Switzerland, Laquintal); 18—nearcticus (Canada, MacKenzies

Mt.); 19-triclavatus (paratype); 20—pengellyi (holotype).

Huber and Baquero JESO Volume 138, 2007

FIGURES 21-25. Eustochus spp., female antenna (except 25), lateral. 21—yoshimotoi

(holotype); 22—?nearcticus (USA, Andrews Bald); 23—confusus (holotype); 24—nipponensis

(holotype); 25—atripennis, male (Switzerland, Chancy).

Review of Eustochus JESO Volume 138, 2007

en VOR D0, 200

~

—

FIGURES 26-27. Eustochus spp., wings. 26—atripennis (Germany, Bornheim); 27—

besucheti (Switzerland, Laquintal).

Huber and Baquero JESO Volume 138, 2007

28

4 ai A

Ye

FIGURES 28-29. Eustochus spp., wings. 28—nearcticus (NS, MacKenzies Mt.); 29—

triclavatus (paratype).

Review of Eustochus JESO Volume 138, 2007

i I a 10, 20

FIGURES 30-31. Eustochus spp., wings. 30—pengellyi (holotype); 31—voshimotoi

(holotype).

11

JESO Volume 138, 2007

Huber and Baquero

SN

aaa

y WY Y Yi

SSN

SSS

—

>

dl

an?

4

/

=

ee

>

Ss

a=

--

—

oe

——

9

-

nd ~~ ;

ss

<<

~ <2?

- -_ ~~

~~

>>

———

= ~

2

—

a+

Ys,

ar

ts

- vo

«>

— er

— =

MO

_

32

Yi

Ks

ath

sf.

Y ”

: :

ph} : My

4,' i} oh

/ '"

j Alf seth A wan ‘ ? rf ve “ Rn .

Lyi ter wiiees? gts TANNIN RONAN

: AMYT AA" ur’ ‘ HN ee we

Ay ' +? 3h a ryt \' ~e

IIA AVAL ON WAN YN

AA Ae ARS

i , if , ey ” ty : Ya »

4 La rh HALyS

7 s) * 4 . x \) |

VS 4 ay, ,

Seiler

oD

9

33-

ustochus spp., Wings, 32—?nearcticus (USA, Andrews Bald)

a)

al

4

l

38 32-33.

FIGURI

confusus (holotype),

Review of Eustochus JESO Volume 138. 2007

i a OREO EU

—.

_——

FIGURES 34-36. Eustochus spp., wings and bodies. 34—nipponicus, wings (holotype):

35—atripennis, body lateral (Germany, Bornheim); 36—besucheti, mesosoma dorsal

(Switzerland, Laquintal).

13

Huber and Baquero JESO Volume 138, 2007

0.1mm

FIGURES 37-40. Eustochus spp., bodies. 37—besucheti, metasoma lateral (Switzerland,

Laquintal), 38—nearcticus, lateral (NS, MacKenzies Mt.); 39-triclavatus, mesosoma +

metasoma, lateral (paratype); 40—pengellyi, mesosoma + metasoma, dorsal (holotype).

14

Review of Eustochus JESO Volume 138, 2007

I i 0,

FIGURES 41-43. Eustochus spp., bodies. 41—yoshimotoi, lateral (holotype); 42-

?nearcticus, mesosoma + metasoma, lateral (USA, Andrews Bald); 43—confusus, lateral

(holotype).

15

Huber and Baquero JESO Volume 138, 2007

FIGURES 44-46. Eustochus spp. 44—nipponensis, body lateral (holotype); 45—atripennis,

male head, anterior (Switzerland, Chancy); 46—atripennis, male genitalia, ventrolateral.

16

Review of Eustochus JESO Volume 138, 2007

0.4mm

FIGURES 47-50. Eustochus confusus (paratype). 47-antenna; 48—clava: 49—wings

(forewing damaged); 50—forewing venation.

Huber and Baquero JESO Volume 138, 2007

smooth (Figs. 10-12, 14). Legs with 4 tarsal segments, the basal one not much longer than

each of the others.

Female. Eyes of normal size but ocelli small, the posterior ocelli not much larger than the

mesh diameter of surrounding scupture (Figs. 1-3). Mandibles either relatively short and

not quite meeting medially or occasionally slightly overlapping medially, with two (Fig.

6) or, usually, three teeth. Antennal funicle 6-segmented and clava 2-segmented (Figs.

16-18, 20-24) or, rarely, 3-segmented (Fig. 19); flagellum with longitudinal sensilla on fl,

(1 sensillum), fl, (2 sensilla), fl, (2 sensilla) and clava (1 sensillum on basal segment, 5 on

apical segment) [distribution of longitudinal sensilla on clava of E. triclavatus not clear

due to collapse and poor orientation]. Forewing oval, with a more or less distinct, comma-

shaped, dark mark extending from basal half of marginal vein to posterior margin just beyond

retinaculum (Figs. 26-34); venation 0.35-0.4 times length of forewing; marginal + stigmal

vein longer than submarginal vein; hypochaeta directly in front of proximal macrochaeta or

slightly basal to it and two, widely separated, distal macrochaetae present, the second distal

macrochaeta near apex of venation near base of short stigmal vein. Petiole long and narrow

(Figs. 13-15, 38, 40, 42, 44). Gaster smooth, deep, and somewhat compressed, with gt, the

largest tergum (Figs. 10, 11, 13, 38-44); spiracle present on gt,; dorsal one or two cercal

setae extremely long and curved (Figs. 11, 13), distinctly longer than ventral two setae.

Ovipositor either very long and conspicuously exerted beyond gastral apex, or short and not

extending beyond gastral apex.

Male. Forewing minute and hindwing absent, with very small eyes and ocelli absent, and

large, tridentate mandibles that meet medially (Fig. 45); body with reticulate sculpture less

pronounced than in female. Antenna with 9 flagellar segments, the apical two widely joined

to form a loose clava (Fig. 25).

Discussion. Eustochus is most closely related to Caraphractus Walker, another strictly

Holarctic genus (Schauff 1984). Members of both genera have strongly sclerotized bodies

with distinct reticulation on the head, mesosoma, petiole, coxae, and scape, and they have

similar mesosomal, metasomal, and wing structure. Sclerotization, surface sculpture, and

wings may be convergent due to the habitats in which the species of both genera are found.

A well sclerotized body and strengthened wings are needed for protection while moving

around in forest litter (Ewstochus) or water (Caraphractus). The heavy surface sculpture

may trap air around the body. A host shift from terrestrial to semiaquatic to aquatic host

may have occurred in some ancestral Eustochus species, leading to species that are now

classified as Caraphractus, which parasitize only Dytiscidae, as far as is known. Though

hosts for Eustochus are unknown, a few specimens of Eustochus have been collected near

water (see E. atripennis, below) and the change from hosts in forest litter or soil to hosts

near and eventually in water may easily have occurred.

Biology. Hosts are unknown. Most specimens of Eustochus examined were collected from

deciduous forests. A few were collected near water, and one specimen of £. nearcticus

Yoshimoto from Alberta was collected from gravel in water. A few specimens appear to

have been collected in more open habitats (heron rookery, edge of cornfield), though it

18

Review of Eustochus JESO Volume 138, 2007

is not possible to know exactly what microhabitat they were in. Females and the males

of E. atripennis and E. besucheti were collected near the base of an old trunk (Viggiani

1970), from soil under oak (specimen record, below), and from moss (Bakkendorf 1965),

respectively. A few were also collected in pitfall or Malaise traps. Label data on many

females from Switzerland indicated they were collected from dead leaves and the Belgian

specimen (from Forét de Soignes, Rouge Cloitre) described by Debauche (1948) was

collected by sifting dead leaves. Most likely, species of Eustochus parasitize hosts that lay

their eggs in soil, surface litter, or mosses. The number of specimens collected near water

suggests an aquatic host. A given species of Eustochus likely has more than one generation

per year, judging from the range of dates when specimens were collected, e.g., March to

September for E. atripennis.

Key to Eustochus species

Females

l Ovipositor exerted distinctly beyond apex of gaster, considerably longer than

emenmens. SAT SOAN) LOC. eb! adouedatl ..lmortemaesls) Fano: 2

— Ovipositor not exerted beyond apex of gaster, shorter than metatibia (Figs. 38, 42,

| ER kee SEUPEN Ng avd SE ee ee ee BE CE ges gee LY eee Mee eer eee | 4 nn 6

2(1) Fl, 3.5 times as long as wide, only slightly shorter than fl, (Figs. 16, 19) ............. 3

— Fl, at most 2.2 times as long as wide, distinctly shorter than fl, (Figs. 17, 20, 21)

3(2) Clava 2-segmented; fi, 2.1 times as long as wide (Fig. 16); forewing with longer

venation (distance between second and third macrochaeta at least 1.8 times distance

between first and second macrochaeta) .................00000eeeeeeeees E. atripennis (Curtis)

_ Clava 3-segmented; fi, 2.7 times as long as wide (Fig. 19); forewing with shorter

venation (distance between second and third macrochaeta about 1.4 times distance

between first and second macrochaeta) ................::0000ceee E. triclavatus Xu and Lin

4(2) Fl fi, each longer than wide (Figs. 20, 21); Nearctic ............cccceseseseseeeeseeeeseeees 5

— Fl.-fl, each as wide as long, quadrate (Fig. 17); European ............c:ccceeseeeseseeeeees

empresa tie Nd Oat Cool ted sates La Acadaieds E. besucheti Bakkendorf

5(4) Forewing (Fig. 31) with distinct triangular asetose area behind venation (between

level of hypochaeta and first distal macrochaeta) and in front of one and a partial

second row of microtrichia that extend basally to level of submarginal vein;

mandible with 3 teeth [Western North America] ..................... E. yoshimotoi sp. n.

= Forewing (Fig. 30) with narrow, linear asetose area behind venation (between level

of hypochaeta and first distal macrochaeta) and in front of two rows of microtrichia

that extend basally to level of submarginal vein; mandible with 2 teeth [Eastern

mmmmincds OS bile to) uo hid oul Lleida dina. E. pengellyi sp. n.

6(1) FWL/FWW less than 4.0; Nearctic ..................ccssssseeseeeees E. nearcticus Yoshimoto

se nF OW aVoereater than:4.0; Palacarctic wi..2 :.6...aties. a 7

7(6) Mesosoma deep, about 1.5 times as long as high and dorsum distinctly curved

in lateral view (Fig. 43); forewing (Fig. 33) with about 8 microtrichia on blade

behind apex of submarginal vein + base of marginal vein, arranged in 1-2 indistinct

19

Huber and Baquero JESO Volume 138, 2007

rows; asetose area behind these (and in front of retinaculum) relatively wide [area

concealed: behind -wirigsin Fig; 33} elia...cciw. soos. Ba E. confusus sp. n.

- Mesosoma shallow (Fig. 44), about 1.8 times as long as high and dorsum much

flatter in lateral view; forewing (Fig. 34) with about 15 microtrichia on blade

behind apex of submarginal vein + base of marginal vein, arranged in 2-3 indistinct

rows; asetose area behind these (and in front of retinaculum) relatively narrow

wa ddd. Sots oi GMebereh eased, 2c ae es nies ates baat E. nipponicus sp. n.

Eustochus atripennis (Curtis)

(Figs. 1-15 [but see comments below], 16, 25, 26, 35, 45, 46)

Mymar atripennis Curtis, 1832: folio 411 (description in key); Haliday, 1833: 350 (list).

Eustochus atripennis Haliday, 1833: 349 (description, transfer to Eustochus); Walker, 1846:

54 (list); Foerster, 1847: 226 (description), 233 (German record from Aachen);

Blanchard, 1840: 293 (diagnosis); Dalla Torre, 1898: 428 (list); Ashmead,

1904: 363 (mention in key); Schmiedeknecht, 1909: 495 (list); Kryger, 1950:

63 (description); Debauche, 1948: 201 (description); Bakkendorf, 1965: 122

(key); Viggiani, 1970: 135 (male description); Trjapitzin, 1978: 967 (duplicate

of Bakkendorf key); Graham, 1982: 221 (type material); Schauff, 1984: 51 (type

material lost); Viggiani, 1989: 146 (male genitalia); Ulrich, 1999: 388 (collection

record).

Diagnosis. Female. Body length 978 (820-1330, air and critical point dried specimens).

Head width 201-251 (n=6). Mandibles each with 3 teeth (2 teeth in specimens from Japan

that may be E. atripennis, see additional material, below), the middle tooth slightly the

largest, the dorsal tooth blunt. Mesosoma length/height 1.29-1.44 (n=2). Ovipositor length

746-1007 (n=9), 1.55-1.78 times length of hind tibia; distinctly exserted beyond apex of

metasoma, the exserted part slightly less than hind tibial length.

Antenna (Fig.16). Segment L (W) (n=10): scape 136-169 (32-41), pedicel 66-81

(30-36), fl, 65-95 (15-20), fl, 64-83 (17-20), fl, 56-77 (17-20), fi, 49-60 (22-32), fl, 42-51

(29-40), fl 38-45 (34-45), entire clava 130- 157 (55-79). Ratios of L/W: scape 3. 74- 4.79,

pedicel 1.84-2.48, fl, 3.82-5.48, fl, 3.53-4.45, fl, 3.29-4.1, fl, 1.69-2.26, fi, 1.16-1.54, fi,

0.86-1.04, entire bias 1.84-2.46.

Wings (n=10). FWL 948-1282, FWW 323-454, FWL/FWW ratio 2.88-3.06.

Distance between first and second distal macrochaetae 1.85-2.15 (n=6) times distance

between proximal and first distal macrochaeta. HWL 841-1044, HWW 33-43.

Male. Body length 1075 (critical point dried specimen). Head brown, distinctly darker

than yellowish brown body. Head (Fig. 45) large, with height 208, length on midline 149,

width 307, and 1.55 width of mesosoma. Face in lateral view forming a distinct rounded

protrusion just below eye level, with toruli facing obliquely upward and lower face and

mouthparts strongly sunken in, in lateral view not visible due to protruding gena; face in

anterior view with a curved row of 6 setae above mouth margin. Vertex small, without

ocelli (cf. Viggiani 1970), and widely separated from back of head by occiput. Eye small.

20

Review of Eustochus JESO Volume 138, 2007

Malar space as long as eye and malar sulcus absent. Gena 3 times width of eye. Mouth

about two-thirds width of head, with mandibles huge and capable of overlapping, each

with three teeth, the dorsal one blunt and set back, not in line with the two ventral teeth.

Labrum with one median seta. Mesosoma narrow and reduced. Pronotum visible in dorsal

view, divided medially. Propleura visible in dorsal view as protruding ‘shoulders’ lateral to

pronotum. Mesoscutum small, triangular, margined laterally by posterior of each pronotal

lobe. Notauli absent. Scutellum apparently not divided into anterior and posterior portions

and without placoid sensilla. Dorsellum narrow. Propodeum with small spiracle separated

about 3 times its diameter from dorsellum; propodeal seta midway between anterior and

posterior margins of propodeum, slightly more medial in position than spiracle. Pronotal

lobe length (maximum) 46, mesoscutum length45, scutellum length 47, dorsellum length 14,

propodeum length 122. Metasoma with petiole length 122. Gastral tergum1 overhanging

entire petiole, approximate relative lengths of gt,-gt, (along dorsal margin, critical point

dried specimens) 11, 15, 12, 9, 9, 9, 4. Spiracle apparently present. Cerci with two dorsal

setae longer than ventral two and curved. Gaster length (critical point dried specimen) 614.

Genitalia as in Fig. 46.

Forewing present (cf. Viggiani 1970) but minute and almost haltere-like. Hindwing

absent.

Antenna (Fig. 25) with 9 flagellomeres, the apical two widely joined, clava-like.

Relative proportions of segments L (W) [number of longitudinal sensilla, when present; if

different between left and right antenna, both numbers are given]: scape 130 (35), pedicel

72 (38), fi, 42 (22), fl, 41 (22), fi, 39 (27/24) [1/0], fl, 41 (26/34) [1/2], fl, 36 (36) [2], fi,

36 (37) [2/3], fi, 43 (38) [2], fl, 42 (39) [3], fl, 44 (35) [3]. The widths of fl, and fi, differ

between the left and right antennae due to the different numbers of longitudinal sensilla.

Discussion. This species is distinguished from the other species with long ovipositors by

proportions of the funicle segments, microtrichial pattern behind the forewing venation,

and relatively longer marginal vein. No other described species has such a long venation

(distance between first and second distal macrochaeta at least 1.8 times distance between

proximal and first distal macrochaeta).

The type material of E. atripennis is lost (Graham 1982). Haliday sent specimens

to Spinola in Turin (MRSN) and Graham examined the one specimen of E. atripennis there.

He suggested that it could be designated as neotype, if no undoubted Walker specimen were

found. This specimen was examined by JH. It is still in good condition, exactly as Graham

(1982) described it (complete, except right pair of wings missing) but is not designated as

a neotype here because E. atripennis is not a problematic taxon and an objective definition

of it is not necessary (ICNZ, 1999, Article 75). The specimen (MRSN) is labelled: 1.

“Museo Zoologia/Torino - Italia”. 2. “Eustochus/ atripennis Haliday/ Lectotype °/ M de

V. Graham, 1972”. This lectotype designation is incorrect, because the specimen was not

from the original material seen by Curtis. If desired, the specimen certainly serves as an

example of what Haliday meant when redescribing the species but there are many, more

recently collected, specimens in several museums that can serve as well.

Material examined. Forty-seven females and | male on cards or points, 10 female and one

male on slides (58 additional Swiss and one French specimen were examined many years

21

Huber and Baquero JESO Volume 138, 2007

prior to the present study; they are listed here). CZECH REPUBLIC, Bohemia: Praha-

Stomovka, 18-19August 1999, L. Masner, riparian, yellow pan trap (2, CNC); Revnice

environs, 20-21 August 1999, L. Masner, creek (2, CNC). ENGLAND, Avon: Bristol,

Hallen Wood, 22 July 1925 (2, USNM); Berkeshire, Wytham, em., 8 September 1949,

from soil under oak, G. C. Varley (22, BMNH); Cornwall, Scilly Is., Tresco, 21 September

1975, J. S. Noyes (2, BMNH); Devon, Birchette Wood, 13-21 August 1980 (2, BMNH);

Dorset, Bournemouth, 13 July, 17 August, and September 1981, 28 June 1983, S.C. S.

Brown (42, BMNH); Greater London, Richmond, 25 September 1907, C. Waterhouse

(2, BMNH); Hampshire, New Forest, 24 June 1954, J. Murgetroyd (9, BMNH); Romsey,

Awbridge, August, September 1981, June 1982. C. Vardy (92, BMNH). FRANCE, Haute-

Savoie: Vongy, 11 June 1964, C. Besuchet, dead leaves (9, MHNG). GERMANY, North

Rhine-Westphalia: Bornheim-Brenig, no date, M. Boness, on red currant (2, CNC).

HUNGARY, Somogy: Mernye, 17 August-4 September 1985, N. D. Springate (32, CNC).

SPAIN, Navarra: Artikutza, 29 May 1995, 600 m, 18 May 1997, 25 August—22 September,

6-20 October, and 20 October—17 November 1996, 590-610 m, L. Martinez de Murguia,

Malaise trap (62, CNC, MZNA); Iratibizkar, 26 July 2000, E. Baquero, pitfall trap (29,

CNC, MZNA). SLOVENIA: Bled, 5-12 August 1978, L. Huggert, luxuriant spruce forest,

pan trap (2, CNC); Rateée, 31 July—7 August 1978, L. Huggert, edge of marshy area, pan

trap, (2, CNC). SWITZERLAND, Geneva: Chancy, 8 May 1964, C. Besuchet, dead

leaves (54, 232, CNC, MHNG); L’Allondon, 2 and 7 May 1959, C. Besuchet, sifting

mosses (15°, MHNG); Ticino: Rancate, 8 August 1963, C. Besuchet, dead leaves (289,

CNC, MHNG); Valais, Euseigne, 1000 m, 10 July 1970, C. Besuchet, det. Viggiani, 1976

(52, MHNG); Vouvry, 27 March 1967, at base of old stump, det Viggiani, 1970 (¢, 29,

MHNG); Vaud, Cossonay, 4 August 1953, C. Besuchet, in old stump (2, MHNG).

Additional material (possibly E. atripennis). JAPAN, Honshu: Ibaraki, Mt. Tsukuba,

800 m, 18 September—2 October, 2-20 October 1989, M. J. Sharkey, pan trap (72, CNC).

SOUTH KOREA, Kangwon-Chucheon: Nam-myeon, Hudong-li,°31 July—16 August

2003, Malaise trap in semi-shade, forest edge (2, CNC). The South Korean specimen is as

large as the European (especially British) specimens, but fl, is longer so it is only tentatively

identified as E. atripennis. The Japanese specimens are smaller than E. atripennis from

Europe and because we are not sure if they are conspecific with it, we list them separately

here. The scanning electron micrographs were taken from the Mt. Tsukuba specimens and

may be E. atripennis. They have a long marginal vein but bidentate, instead of tridentate,

mandibles.

Eustochus besucheti Bakkendorf (Figs. 17, 27, 36, 37)

Eustochus besucheti Bakkendorf, 1965: 117 (description); Xu and Lin, 2003: 65 (list).

Diagnosis. Female. Body length 712-772 (n=3, critical point dried specimens). Head

width 192 (n=1). Mandibles each with 3 teeth. Mesosoma length/height about 1.35.

Ovipositor length 585, distinctly exserted beyond apex of metasoma and 1.85 times length

of hind tibia.

22

Review of Eustochus JESO Volume 138, 2007

Antenna (Fig. 17). Segment L (W) (n=1): scape 135 (32), pedicel 64 (31), fl, 45

(18), fl, 45 (18), fl, 53 (20), fl, 33 (30), fi, 33 (36), fl, 33 (39), entire clava 123 (58). Ratios

of L/W: scape 4.21, pedicel 2.05, fi, 2.48, fl, 2.56, fi, 2.68, fl, 1.1, fi, 0.92, fl, 0.84, entire

clava 2.15.

Wings (Fig. 27). FWL 810, FWW 229, FWL/FWW ratio 3.54. Distance between

first and second distal macrochaetae 1.33 times distance between proximal and first distal

macrochaeta. HWL 689, HWW 34.

Male. Eustochus besucheti is the only other species besides E. atripennis whose male is

known, based on a single specimen from Laquintal, the type locality. Apart from apparently

narrower fi, and fi, in E. besucheti, the males of the two species appear to be identical.

Discussion. This species is distinguished from FE. atripennis, the only other European

species with a long ovipositor, by its smaller size, shorter funicle segments, especially fi,

(Fig. 17), shorter forewing venation, and less sclerotized posterior margin of the forewing

just beyond the retinaculum.

Material examined. Three females on cards or point, one on slide. The holotype 2 and

allotype ¢ (MHNG) were not examined. CZECH REPUBLIC, Bohemia: Studnice near

Jablonec nad Nison, 860 m, 14 July 1964, V. Martinek (Q, CNC). SWITZERLAND,

Turgau: Unterwasser, 1440 m, 4 August 1984, L. Masner, screen sweeping (2, CNC);

Valais, Laquintal, 1400-1500 m, 1 July 1962, C. Besuchet, mosses (29, CNC). The

Laquintal specimens examined were preserved in alcohol from the type locality, but not

designated as paratypes by Bakkendorf (1965). They were critical point dried and point

mounted by the senior author and distributed between MHNG and CNC, by permission of

C. Besuchet.

Eustochus confusus Huber and Baquero, sp. nov. (Figs. 23, 33, 43, 47-50)

Diagnosis. Female. Body length 1100 (n=1, paratype on slide). Head width 230 (n=1).

Mandibles tridentate, each with a small dorsal tooth and 2 larger teeth, the middle one

thicker and longer than the ventral one. Mesosoma length/height about 1.5 (Fig. 43).

Ovipositor length 338-356 (n=2), not exserted beyond apex of metasoma and less than

(0.80-0.82 times) length of hind tibia.

Antenna (Figs. 23, 47, 48). Segment L (W) (n=2): scape 161-174 (38-40), pedicel

76-78 (32-33), fl, 64-66 (20), fl, 58-66 (21-24), fl, 51-52 (20-21), fl, 40-44 (28-31), fl, 38-41

(29-35), fl, 37-39 (29-41), entire clava 125-132 (46-48). Ratios of L/W: scape 4.21-4.39,

pedicel 2.35-2.36, fi, 3.24-3.29, fl, 2.38-3.10, fl, 2.54-2.60, fl, 1.29-1.57, fi, 1.08-1.38, fi,

0.94-1.33, entire clava 2.58-2.87.

Wings (Figs. 33, 49). FWL 1083-1151, FWW 262, FWL/FWW ratio (n=1) 4.39.

Distance between first and second distal macrochaetae 1.03-1.04 times distance between

proximal and first distal macrochaeta (Fig. 50). HWL 857-916, HWW 33-41.

23

Huber and Baquero JESO Volume 138, 2007

Discussion. This species is distinguished from the only other species with a non-exserted

ovipositor in the Palaearctic region, E. nipponicus, by the deeper mesosoma that is dorsally

more rounded in lateral view (Fig. 43) compared to a shallower mesosoma that is dorsally

flatter in lateral view (Fig. 44) and the wider asetose area between the retinaculum and rows

of microtrichia behind the venation (Fig. 33). In Europe, E. confiusus is the only species

with an ovipositor shorter than the hind tibial length. The other two, E. atripennis and E.

besucheti have long, exserted ovipositors that are longer than the hind tibia. It differs from

E. nearcticus by its narrower forewing (length/width ratio about 4.4).

Material examined. Two females on slides. HOLOTYPE ¥Y (MZNA) on slide labelled:

1. “MZNAXAO98a /Irati (Navarra, Spain), /18.1X.1982/ UTM:30TXN5460,/390 m,

UNZYEC leg./ MUSEO DE ZOOLOGIA/UNIV. DE NAVARRA”. 2. “Eustochus confusus

Huber and Baquero. Holotype Y”. The holotype is complete and was originally uncleared

and mounted laterally in Hoyer’s medium under a single cover slip (Fig. 23, 33, 43). After

being photographed it was cleared and remounted in Canada balsam. PARATYPE. Same

data as holotype (9, MZNA).

Species name. The species name, confusus, is Latin for confusing. It refers to the initial

confusion we had as to whether E. confusus was the same as E. nearcticus or not. If it had

been, it would be the first Eutochus species occurring in both Europe and North America.

While this is possible, because soil brought to North America as ballast in ships may have

contained parasitized hosts, it is unlikely, given the occurrence of both species in localities

that are not particularly near ports and that consist of native vegetation rather than human

altered habitats.

Eustochus nearcticus Yoshimoto (Figs. 18, 28, 38, possibly also 22, 32, 42)

Eustochus nearcticus Yoshimoto, 1990: 96 (description).

Diagnosis. Female. Body length 690-717 (n=2, critical point dried specimens). Head

width 194 (n=1). Mandibles each with 3 teeth, the dorsal one smaller than the ventral two.

Mesosoma length/height 1.55 (n=1) (Fig. 38). Ovipositor length 256-268 (n=2), 0.69-0.76

times length of hind tibia; not exserted beyond apex of metasoma.

Antenna (Fig. 18). Segment L (W) (n=2): scape 125-141 (30-32), pedicel 66-69

(29-30), fl, 55-66 (15), fl, 52 (19-20), fl, 44-46(17-18), fl, 41-47 (22-24), fl, 38-40 (29),

fl, 36-37 (32-35), entire clava 124-129 (39-50). Ratios of L/W: scape 4.17-4.44, pedicel

2.30-2.33, fl, 3.66-4.42, fl, 2.62-2.76, fl, 2.47-2.68, fl, 1.73-2.09, fl, 1.32-1.41, fl, 1.05-1.12,

entire clava 2.48-3.32.

Wings (Fig. 28). FWL 978-1048, FWW 278-283, FWL/FWW ratio 3.46-3.85.

Distance between first and second distal macrochaetae 1|.03-1.09 times distance between

proximal and first distal macrochaeta. HWL 778-863, HWW 30-31.

Discussion. Eustochus nearcticus is the only described species with a short ovipositor (Fig.

38) in the Nearctic region. It is distinguished from the two Palaearctic species with short

24

Review of Eustochus JESO Volume 138, 2007

ovipositors by proportions of the forewing and mesosoma. Eustochus nearcticus differs

from E£. nipponicus by its deeper mesosoma (length/height ratio about 1.5 compared to

about 1.8), with a more rounded dorsum in lateral view. It differs from E. confusus by its

wider forewing (length/width ratio at most 4.08).

Several specimens from western North America (AB, BC, MT) and southeastern

USA (NC) may belong to FE. nearcticus. We exclude them because we are not sure that

they really are conspecific. They are listed separately below. Minor differences in their

antennal proportions (funicle segments relatively short, somewhat as in E. confusus,

in those specimens slide mounted and measured) size of bare area in front of fore-wing

retinaculum, and height of mesosoma (e.g., Figs. 22, 32, and 42, all from a specimen from

NC), may reflect intraspecific variation within.£. nearcticus but may also indicate that they

are a separate species. A conservative approach is taken here and they are excluded from

E. nearcticus until more material, especially from intervening areas, becomes available

for detailed study. The antenna (Fig. 22) of the NC specimen resembles that figured by

Yoshimoto (1990, fig 36) in that fl, is relatively short, compared to Fig. 18. Both of the

latter figures are specimens from the type localities.

The specimens from British Columbia appear to have a flatter mesosoma, more

resembling FE. nipponicus, than the point-mounted paratypes of FE. nearcticus. It is difficult

to be sure how these specimens are distinguished from E. nipponicus. However, the western

Nearctic specimens all appear to have fl, slightly longer than fl,, whereas E. nipponicus has

fi, shorter than fl,. If they are indeed the same species as E. nipponicus then wider species

limits would then have to be accepted. Similarly, FE. nearcticus specimens from eastern

Canada may be the same as E. confusus, but, if so, wider species limits would again have to

be accepted. Finally, the western specimens may represent a different species from either

E. nipponicus, E. confusus, or E. nearcticus, and possibly could be defined geographically

as well as morphologically. But since several specimens, possibly of E. nearcticus, are from

Ontario it is difficult to define the two populations geographically. It is also possible that

E. nipponicus and E. confusus are the extremes of only one species occurring across the

Palaerctic region, but so far no Eustochus resembling these two species has been collected

between Spain and Japan.

We prefer to treat the specimens with short-ovipositors as three species, with E£.

nearcticus occurring in northeastern North America but not in the Palaearctic region, and EF.

nipponicus distinct from E. confusus in the Palaeactic region. Much more material of these

species is required, especially from intervening areas, to verify their status relative to one

another and determine how many species really are involved.

The craterlike pits on the propodeum, visible on the scanning electron micrograph

in figure 148 of Yoshimoto (1990), are an artifact, presumably due to remnants of a liquid

deposit on the specimen. Cleared, slide mounts prepared of two specimens from the type

locality do not show these pits; the sculpture is uniformly reticulate.

Material examined. Three females on points, two on slides. The holotype (CNC) is

complete and in good condition on a point. Three paratypes from Nova Scotia, as listed

in the original description, were also seen. The fourth paratype, from British Columbia,

is a different species, assigned here to E. yoshimotoi, sp. n. (see below). The paratype

from MacKenzies Mt. was slide mounted for detailed study. An additional specimen from

25

Huber and Baquero

JESO Volume 138, 2007

MacKenzies ML, listed below, was also slide mounted; it was not included in the type series

by Yoshimoto (1990), for unknown reasons,

CANADA, Nova Scotia: Cape Breton Highlands Nat. Park, MacKenzies Mt., 9

August 1983, J. E. H. & R. J. Martin (9, CNC),

Additional material, Thirteen other specimens that may be /, nearcticus were examined,

3 of them (MT and NC) are on slides. CANADA, Alberta: Waterton Lakes National Park,

2 August 1985, Cameron Creek on Akamina Parkway near mouth of Rowe Creek, gravel in

riffle, 1. M. Smith (9, CNC). British Columbia: Kootenay National Park, Daer Pitts, 16-

30 July 2000, G. Gareau, MT, aspen (25°, CNC). Ontario: Brucedale Conservation Area

near Port Elgin, 19 April-16 June 1988, C. Dondale and J. Redner, pit fall trap at edge of

swamp (Y, CNC). UNIFPED STATES: Montana, Flathead Co., Glacier National Park, N.

Fork Flathead area, S. Big Prairie, 3560°, T35N R21 W, sect. 16, 10-17 August 1993, M. A,

Ivie, old growth light burn (24°, CNC). North Carolina: Jackson Co., Whiteside Mt., near

Highlands, 1600 m, April-20 July 1987, CNC Hym. Team, oak forest (29, CNC); Swain

Co., Andrews Bald, pitfall 51, N 35° 20°32” W 83° 39°29’, 10-24 May, 6-22 June, and 10-

25 September 2001, Parker, Stocks, Petersen (S°, CNC).

Eustochus nipponicus Huber and Baquero, sp. nov. (Figs. 24, 34, 44)

Diagnosis. Female. Body length 947-1100 (n=3, critical point dried specimens), Head

width 188-198. Mandibles each apparently tridentate, with 2 large ventral teeth and a small,

dorsal tooth. Mesosoma length/height 1.82 (Fig. 44). Ovipositor length 281 (holotype), not

exserted beyond apex of metasoma and less than (0.91 times) length of hind tibia.

Antenna (Fig. 24). Segment L (W) (holotype): scape 138 (35), pedicel 69 (32),

fl, 51 (19), fl, 51 (20), fi, 41 (20) fl, 44 (24), fl, 39 (29), fl, 37 (32), entire clava 110 (54).

Ratios of L/W: scape 3.89, pedicel 2.19, fl, 2.71, fl, 2.62, fl, 2.01, fl, 1.10, fl, 1.36, fl, 1.15,

entire clava 2.03.

Wings (Fig. 34). FWL 974, FWW 232, FWL/FWW ratio 4.09. Distance between

first and second distal macrochaetae 1.04 times distance between proximal and first distal

macrochaeta. HWL 823, HWW 34.

Discussion. This species is distinguished from /. confusus, the only other Palaearcic species

with a short ovipositor, by the shallower mesosoma with a flatter dorsum in lateral view,

and the narrower asetose area between the retinaculum and rows of microtrichia behind the

venation (Fig. 34).

Material examined, Four females, one ona slide. HOLOTYPE Y (CNC) on slide labelled:

|. “Japan: Honshu/, Iwate, lwaizumi/ Hitsutori, 770m/11-17.vili.1991/ A. Smetana [J47]”.

2. “Eustochus/ nipponicus/ Huber &/ Baquero/ Holotype Y”. The holotype is cleared and

mounted laterally (Fig. 44) under a 6 mm cover slip, with the wings and one antenna under

two additional cover slips. PARATYPES. Same locality data as holotype (29, CNC);

Iwate, Kawai, Yoshibezawa, N 39° 37’ E 141° 31°, 500 m, 25 August 1996, L. Masner,

screen sweeping (Y, CNC).

Review of Eustochus JESO Volume 138, 2007

Species name. The species is named from the Japanese name for the country of origin,

Nippon.

Eustochus pengellyi Huber and Baquero, sp. nov. (Figs. 20, 30, 40)

Diagnosis. Female. Body length 666-896 [up to 973 when gaster somewhat inflated] (n=8,

critical point dried specimens). Head width 184 (holotype). Mandibles each with 2 teeth.

Mesosoma length/height 1.33-1.44 (n=3, critical point dried specimens). Ovipositor length

439, 1.40 times length of hind tibia and distinctly exserted beyond apex of metasoma.

Antenna. Segment L (W) (holotype): scape 121 (30), pedicel 62 (27), fl, 50 (14),

fl, 46 (17), fl, 39 (20), fl, 38 (23), fl, 36 (27), fl, 35 (29), entire clava 105 (54). Ratios of

L/W: scape 4.08, pedicel 2.29, fl, 3.63, fl, 2.62, fl, 1.97, fl, 1.66, fl, 1.33, fl, 1.22, entire clava

1.93.

Wings. FWL 799, FWW 228, FWL/FWW ratio 3.51. Distance between first and

second distal macrochaetae 1.15 (1.30 on other wing) times distance between proximal and

first distal macrochaeta. HWL 668, HWW 26.

Discussion. This species is distinguished from FE. yoshimotoi, the only other Nearctic

species with a long, exserted ovipositor, by a narrower asetose area above the retinaculum

that is separated from the venation by only one complete line of microtrichia (wider asetose

area and at least a partial second line of microtrichia in E. pengellyi). It differs from E.

atripennis by its shorter venation, from E. besucheti by antennal proportions, and from E.

triclavatus by the number of claval segments. The specimens from Japan that we treat as

possibly E. atripennis on the basis of a long venation, also have bidentate mandibles.

Material examined. Thirteen females, two on slides. HOLOTYPE 9 (CNC) on slide

labelled: 1. “CANADA: ON/, Flint Hill near/ Kemptville/, 19-20.vii.1983/, L. Dumouchel”.

2. “Eustochus/ pengellyi/ Huber and Baquero °/ Holotype”. The holotype is cleared

and mounted dorsally in Canada balsam under one 6 mm cover slip and the wings, and

head, antennae and prothorax are under two other coverslips. PARATYPES. CANADA,

Ontario: Frontenac Co., 5 km W. Chaffey’s Locks, Skycroft Campground, 9-14 July

1987, B. Hubley, MT (22, CNC); Thetford, 10-13 October 1982, A. Tomlin, FIT (2, CNC);

Haliburton Forest and Wildlife Reserve, N 45° 15’ W 78° 35’, 12 July 2001, C. Vance,

maple forest, MT (2, CNC); 7 km SE Westport, 134 m, N 44° 37°727’ W 76° 217545’,

1-31 August 2005, S. Peck, maple sugar bush, FIT (9, CNC). Quebéc, Lac Jean-Venne, N

45° 41’ W 76° 03’, 15-20 June, Osmunda marsh, YPT and 14-21 August 1995, L. Masner &

J. Denis, Osmunda marsh creek, YPT (22°, CNC). UNITED STATES, Indiana: Laporte

Co., Indiana Dunes National Lakeshore, Heron Rookery, 29 July 1997, R. Grundel, MT

(22, CNC, USNM). Maryland: Prince George's Co., Beltsville-Agricultural Research

Centre, 1-9 July1980, K. Thorpe, Malaise trap on corn field edge (2, USNM). Tennessee:

Blount Co., Cades Cove, N 35° 2535’ W 83° 17”50’, 29 July1997, R. Grundel, MT (2°,

CNC).

S|

Huber and Baquero JESO Volume 138, 2007

Species name. The species is named in honour of Dr. David Pengelly, whose enthusiasm for

teaching entomology encouraged several students to pursue insect taxonomy as a career.

Eustochus triclavatus Xu and Lin (Figs. 19, 29, 39)

Eustochus triclavatus Xu and Lin, 2003: 66 (description).

Diagnosis. Female. Body length about 720 (n=1, ?paratype on slide). Head width

193. Mandibles each with 3? teeth (not clearly visible). Mesosoma length/height 1.35.

Ovipositor length 415, distinctly exserted beyond apex of metasoma and 1.16 times length

of hind tibia.

Antenna (Fig. 19). Segment L (W) (?paratype): scape—[not measurable] (ca. 23),

pedicel 63 (24), fl, 47 (15), fl, 52 (15), fl, 47 (14), fi, 52 (20), fl, 45 (23), fi, 41 (23), entire

clava 137 (40). tion of L/W: pedicel 2. 58, fi, 3. 14, fi, 3.46, fl, 3.25, fi, 2:57, fi, 1.96, fi,

1.77, entire clava ca. 3.42.

Wings (Fig. 29). FWL 857, FWW 264, FWL/FWW ratio 3.25. Distance between

first and second distal macrochaetae 1.41 times distance between proximal and first distal

macrochaeta. HWL 731, HWW 31.

Discussion. This species is distinguished from all others described so far by the three-

segmented clava (two segmented in other species). It belongs to the group of species with

distinctly exserted ovipositors.

Material examined. One female on slide. CHINA, Shanxi: Fengxian, 2°, 4 September

1999, N.Q. Lin, CNC. The locality (Baoji) given in the original description differs from

the specimen label, quoted here; it is not certain whether this specimen is a paratype. The

holotype 2 (FAFU) was not examined.

The paratype is uncleared, poorly oriented, and the clava of each antenna is slightly

collapsed. It appears to have the division between claval segments 2 and 3 less distinct and

perhaps incomplete, at least on one antenna.

Eustochus yoshimotoi Huber and Baquero, sp. nov. (Figs. 21, 31, 41)

Diagnosis. Eustochus yoshimotoi is one of two Nearctic species with a distinctly exserted

Ovipositor. It is distinguished from the other, E. pengellyi, by the wider, more distinct

asetose area behind the marginal vein (narrower in pengell/yi) and the tridentate mandible

(bidentate in E. pengellyi).

Description. Female. Body length 845 (n=3, critical point dried specimens). Head width

211 (n=2). Mandibles each with 3 teeth. Mesosoma length/height 1.29-1.48. Ovipositor

(Fig. 41) distinctly exserted beyond apex of metasoma, 485-525 (n=3) long and 1.24-1.32

times length of hind tibia.

Antenna (Fig. 21). Segment L (W) (n=2): scape 135-144 (32-33), pedicel 66-71

(32-33), fl, 55-60 (17), fl, 48-56 (17), fl, 44-54 (19-20), fi, 39-44 (27-29), fi, 39-41 (34),

28

Review of Eustochus JESO Volume 138, 2007

fi, 39-40 (38), entire clava 121-138 (57-59). Ratios of L/W: scape 4.06-4.28, pedicel 2.07-

2.10, fi, 3.27-3.51, fi, 2.80-3.19, fl, 2.25-2.87, fl, 1.43-1.55, fi, 1.14-1.20, fi, 1.05-1.06, entire

clava 2.03-2.59. .

Wings (Fig. 31). FWL 950-994, FWW 281-298, FWL/FWW ratio 3.33-3.44.

Distance between first and second distal macrochaetae 0.90-1.02 times distance between

proximal and first distal macrochaeta. HWL 739-809, HWW 38-41.

Material examined. Seven females, four of them on slides. HOLOTYPE & (CNC) on

slide labelled: 1. “USA, WA,/ Pierce Co./ Ashford/ 1-14.viti.1985/ L. Masner, Malaise trap”.

2.“Eustochus/ yoshimotoi °/ Huber and/ Baquero/ Holotype”. The holotype is cleared and

mounted laterally under one 6 mm cover slip.in Canada balsam and the wings are under

another coverslip. PARATYPES. Same data as holotype (42, CNC, USNM); CANADA,

British Columbia, Vancouver Is., Mesache Lake, July 1984, MT, Sharkey—Johnson (°,

CNC). UNITED STATES, California, El Dorado Co., Blodgett Forest, 27 August 1975,

F. Andrews, M. Wasbauer, Pinus ponderosa log (2, UCRC). The paratype from British

Columbia was designated originally as a paratype of E. nearcticus by Yoshimoto (1990) and

bears the paratype label “Eustochus nearcticus”, as well as ours “Eustochus yoshimotoi’.

Species name. The species is named in honour of Carl Yoshimoto, the senior author's

predecessor with the Canadian Forest Service, who was a taxonomist at the CNC and

described the first North American species of Eustochus.

Acknowledgements

We thank K. Bolte for preparing the digital images and compiling the plates and

the curators of the institutions listed above for loaning or donating material to us for study.

B. Landry kindly checked the number of specimens of E. atripennis and E. besucheti in

MHNG and provided their collection information. Through the kindness of G. Pagliano

(MRSN), the senior author was able to borrow the Haliday specimen of E£. atripennis in the

Spinola collection, and an additional specimen of one species was found and brought to my

attention by S. Triapitsyn (UCRC). The manuscript was critically reviewed by G. Gibson

and A. Bennett (CNC).

References

Annecke, D. P. and R. L. Doutt. 1961. The genera of the Mymaridae. Hymenoptera:

Chalcidoidea. Entomology Memoirs. Department of Agricultural Technical

Services, Republic of South Africa 5: 1—71.

Ashmead, W. H. 1904. Classification of the chalcid flies of the superfamily Chalcidoidea,

with descriptions of new species in the Carnegie Museum, collected in South

America by Herbert H. H. Smith. Memoirs of the Carnegie Museum 1(4): 225—

555.

29

Huber and Baquero JESO Volume 138, 2007

Bakkendorf, O. 1965. Description of a new subterranean species including a male and

female of Eustochus Hal. Mitteilungen der Schweizerischen Entomologischen

Gesellschaft 37: 117—122.

Blanchard, E. 1840. Histoire naturelle des insectes Orthopteres, Névroptéres, Hémiptéres,

Hyménopteres, Lépidopteres et Dipteres. Paris: Duménil. 672 pp.

Curtis, J. 1832. British Entomology 9: folio 411. Plates 386—433 (with text).

Dalla Torre, C. G. de. 1898. Subfam. Mymarinae. pp. 422-431. Catalogus hymenopterorum

hucusque descriptorum systematicus et synonymicus. Vol.5: Chalcididae et

Proctotrupidae. Lipsiae [Leipzig]: Guilelmi Engelmann. 598 pp.

Debauche, H. R. 1948. Etude sur les Mymarommidae et les Mymaridae de la Belgique

(Hymenoptera Chalcidoidea). Mémoires du Musée Royal d’Histoire Naturelle de

Belgique 108: 1—248 + 24 plates.

Foerster, A. 1847. Ueber die Familie der Mymariden. Linnaea Entomologica 2: 195-233.

Foerster, A. 1856. Hymenopterologische Studien. II]. Heft. Chalcidiae und Proctotrupii.

Aachen: Ernst ter Meer. 152 pp.

Gahan, A. B. and Fagan, M. M.1923. The type species of the genera of Chalcidoidea or

chalcid-flies. Bulletin of the United States National Museum 124: 1-173.

Gibson, G. A. P. 1997. Morphology and terminology. pp. 16-44 /n Gibson, G. A. P., J.

T. Huber, and J. B. Woolley (eds.), Annotated keys to the genera of Nearctic

Chalcidoidea. Ottawa: NRC Research Press. 794 pp.

Graham, M. W. R. de V. 1982. The Haliday collection of Mymaridae (Insecta, Hymenoptera,

Chalcidoidea) with taxonomic notes on some material in other collections.

Proceedings of the Royal Irish Academy, B 82: 189-243.

Haliday, A. H. 1833. An essay on the classification of the parasitic Hymenoptera of Britain,

which correspond with the Ichneumones minuti of Linnaeus. Entomological

Magazine |: 259-276, 333-350.

Huber, J. T. 1987. Review of Schizophragma Ogloblin and the non-Australian species of

Stethynium Enock (Hymenoptera: Mymaridae). The Canadian Entomologist 119:

823-855.

ICZN. 1999. International Code of Zoological Nomenclature, Fourth Edition. London:

International Trust for Zoological Nomenclature c/o The Natural History Museum.

306 pp.

Kryger, J. P. 1950. The European Mymaridae comprising the genera known up to c. 1930.

Entomologiske Meddelelser 26: 1—97.

Schauff, M. E. 1984. The Holarctic genera of Mymaridae (Hymenoptera: Chalcidoidea).

Memoirs of the Entomological Society of Washington 12. 67 pp.

Schmiedeknecht, O. 1909. Hymenoptera fam. Chalcididae. Genera Insectorum 97: 1—550

+ 8 pls.

Schmiedeknecht, O. 1930. Die Hymenopteren Nord- und Mitteleuropas. Jena: Gustav

Fischer. 1062 pp.

Trjapitzin, V. A. 1978. Hymenoptera II. Chalcidoidea 18. Mymaridae. Opred Nasek. Evrop.

Chasti SSSR. 516-538. [In Russian.] [English translation: Family Mymaridae

(Mymarids). pp. 942—982 Jn Keys to the Insects of the European Part of the USSR.

III. Part 2., Medvedev, G. S. (ed.), 1987. Oxonian Press, New Dehli. 1341 pp.]

30

ee

Review of Eustochus. JESO Volume 138, 2007

Ulrich, W. 1999. Phenology and life cycles of the parasitic Hymenoptera of a dry meadow

on limestone. Polskie Pismo Entomologiczne 68: 383-405.

Viggiani, G. 1970. Description of the male of Eustochus atripennis Hal., 1833, and new

terricolous spcies of Cleruchus Enock, with remarks on Anagrella Bkdf. (Hym.,

Mymaridae). Mitteilungen der Schweizerischen Entomologischen Gesellschaft

43: 135-142.

Viggiani, G. 1989 (1988). A preliminary classification of the Mymaridae (Hymenoptera:

Chalcidoidea) based on the external male genitalic characters. Bollettino del

Laboratorio di Entomologia Agraria “Filippo Silvestri” 45: 141-148.

Walker, F. 1846. Descriptions of the Mymaridae. Annals and Magazine of Natural History

18: 49-54.

Westwood, J. O. 1839. Synopsis of the genera of British insects: 78—79. [Issued with An

Introduction to the Modern Classification of Insects. London: Longman, Orme,

Brown, Green, and Longmans. |

Xu, M. and Lin, N.-Q. 2003. A new species of the genus Eustochus Haliday (Hymenoptera:

Chalcidoidea: Mymaridae) in China. Entomologia Sinica 10: 65-68.

Yoshimoto, C. M. 1990. A review of the genera of New World Mymaridae (Hymenoptera:

Chalcidoidea). Flora & Fauna Handbook no. 7. (Gainesville: Sandhill Crane

Press). 166 pp.

¢ ‘yeti, Vs 1a “Fiat Pines eg wo

-eeunyQusetcatt ) wnbi mareh/ elt hoor

fob dot ating amstagiedy silesinieg aaah’ Eis

Nee Bete tbh rp ‘pao vie agayh Tuba, Wig

veubhecht hecieie “© 329 Gas — bos sdesta- websted A

Jonnecqaneenp ). Meanie ei Mans Ra

aA die feougel) OP et” sgasens: owbidl: io aveneg ott ip: peatidale ie

want? ,.ans Af aaa irene i. dr tena a

jae, crolér hibeteathe hypo eal AAMT

uveiquet gare iby rian bug pen ieDokaas A vine, ot Ta zoroqa

' Nei A IM parte atone

vtutyor gery) ly othr i Gate te wait Jo #oamgonhhile

conwe,) Mdbnwe Bauaereseonas pnb tue

rol 3 By Wen lasted, psoas

bie a in NC Retina etl teas pep

| WW oY; OORT Toe Mealideventin Vand Moyrioridae |

4h George “netéy od: Seip nnareriak’ tn) enther 6

| { , he icpik, HS 2e TAS AaB, ’

. . sercsapet) he parmatite By yghopte

neruiti a Lien cut 2

Pei

f i i“ _

7 ninter aiik he son Awira rc

' vester wT TAC } J} ai 0 ino

vo ¥f

TU a jth vat adi

. ’

fo Die boinc) Mae

, is , vd ron micty; Chalota

Oo ik Se FW cocheatgy gn 12. OF pp, :

fare, Clvelodudes. {feng ra lnsectonedt 1 Med

oe a o> Ope!

‘ . = ie

ymenontoren” Word: tain Majtelenoi pall

eg lt cba nidot or

iM fie mumnar) 1:

New genus and species of Perilampidae JESO Volume 138, 2007

A NEW GENUS AND SPECIES OF PERILAMPIDAE

(HYMENOPTERA: CHALCIDOIDEA) WITH UNCERTAIN

PLACEMENT IN THE FAMILY

J. M. HERATY! AND D. C. DARLING?

Department of Entomology, University of California, Riverside, CA 92521, USA

email: john. heraty@ucr.edu

Abstract J. ent. Soc. Ont. 138: 33-47

A new genus and species of perilampid wasp is described from Yemen and

Israel. The features of the adult do not allow for accurate placement within

any of the existing subfamilies of Perilampidae. The adults are similar to

Chrysolampinae; however, the mandibles have a 3/2 formula and although

the ventral surface of the male scape has distinct pores, these are not isolated

within pits or depressions, which is characteristic of Chrysolampinae and

Perilampinae. The labrum is similar to most Perilampinae, but the prepectus

is associated with the mesepimeron and not the pronotum. The ovipositor is

strongly expanded at the apex and scimitar-shaped, whereas the ovipositor

in all other Perilampidae is needle-like. The morphological features that

relate to the potential phylogenetic placement of this genus in the perilampid/

eucharitid complex are discussed.

Published November 2007

Introduction

The composition and higher level relationships of Perilampidae are uncertain.

There has been debate over the inclusion of Akapalinae, Chrysolampinae, Echthrodapinae,

and Philomidinae together with the more easily characterized Perilampinae within a single

family (Ferriére and Kerrich 1958; Riek 1966; Graham 1969; Bouéek 1972, 1983, 1988;

Burks 1979; Bouéek and Rasplus 1991; Darling 1986, 1995; Noyes 1990; Gibson et al.

1999). Echthrodapinae are now placed in Torymidae (Grissell 1995). Together or in part,

these problematic subfamilies have also been proposed as a sister group or paraphyletic grade

to Eucharitidae (Darling 1988, 1992; Gibson et al. 1999). Support for a close relationship

between these groups is based almost entirely on morphology and behavior of the first-instar

larva or planidium (Heraty and Darling 1984; Darling 1988, 1992; Heraty et al. 2004). The

planidia of the eucharitid subfamilies, Gollumiellinae, Oraseminae, and Eucharitinae, are

all very similar and several features support the monophyly of the Eucharitidae (Heraty and

' Author to whom all correspondence should be addressed.

? Department of Natural History, Royal Ontario Museum, 100 Queen’s Park, Toronto,

Ontario, M5S 2C6, Canada and Department of Ecology and Evolutionary Biology,

University of Toronto, Toronto, Ontario, Canada M5S 1A1; chrisd@rom.on.ca

33

Heraty and Darling JESO Volume 138, 2007

Darling 1984; Heraty et al, 2004), The life history and immature stages of Akapalinae, which

has been placed in either Perilampidae or Eucharitidae, are unknown. In an analysis of 20

morphological features of immature stages, Chrysolampinae were sister to Philomidinae

+ (Perilampinae + Eucharitidae), with the latter three groups united by features of the

planidium that include presence of a straplike tergite, absence of larval antennae, and an

eversible postlabium (Darling 1992), Similar results were obtained from a combined larval

and adult morphology dataset (Gibson et al. 1999), Initial results from molecular analyses

with 28S-D2 ribosomal transcript supported monophyly of Eucharitidae (two genera), but

not Perilampidae + Chrysolampinae, although with only four taxa sampled, the results are

not reliable (Campbell et al. 2000).

Adults of Chrysolampinae and Perilampinae share two apomorphic features: one

or more pores concentrated within distinct pits or depressions on the ventroapical surface

of the male scape, and the gaster high and triangular in profile with the 2™ and 3" gastral

tergites subequal in size and fused medially (Darling 1986, 1997; Gibson et al. 1999).

Philomidinae have been tentatively placed within Perilampidae (Noyes 1990, 2002), but

other than possessing a similar compressed antennal flagellum and a similar gaster shape,

there are no compelling adult characters to support this grouping. Similarly, the only adult

feature of consequence grouping Perilampidae and Eucharitidae is the flap-like labrum with

marginal setae (Darling 1988a); the labrum of Philomidinae is very different and more

similar to Chaleididae (Darling 1988a; Gibson et al, 1999),

Chrysolampinae are easily recognized but difficult to define with synapomorphies.

Apart from what defines Perilampidae as a whole, Chrysolampinae have only a single

prominent synapomorphy — the mandibles each with two sharp apically positioned teeth

(Bouéek 1972, 1988; Darling 1986). Darling (1986, 1988) proposed that the flap-like

structure of the labrum with marginal setae (and no digits) could be another synapomorphy,

although some species that are referable to Chrysolampus have since been discovered to

have a digitate labral margin, as is typical of Eucharitidae and some Perilampinae (Darling,

unpublished),

Perilampinae are easily recognized and have anumber of diagnostic and apomorphic

features (Bouéek 1978, 1988). Synapomorphies of Perilampinae include fusion or at least

a very close association between the prepectus and pronotum, and pronotum with a dorsal

collar (Bouéek 1978). The labrum of Perilampinae is flap-like, digitate, and medially

incised (Darling 1988). Most species also have a pair of aboral digits or sessile setae, and

a pair of translucent areas that are interpreted as vestigial sockets (Darling 1988). The

groundplan structure in Perilampidae is considered to be a fan-like labrum with marginal

digits as in Eucharitidae, although aboral digits are possibly a groundplan feature (Darling

1988). Perilampinae all have 3/2 dentate mandibles, but this is likely plesiomorphic for

Chalcidoidea (Bouéek 1978).

Philomidinae do not help to resolve the relationships of Chrysolampinae and

Perilampinae. The subfamily is highly autapomorphic in morphology. Adults share with

Perilampidae a compressed, densely setose antennal flagellum, and the basal tergite (Gt, )

with distinct dorsal and lateral panels, but the labrum is sclerotized, flap-like, and broadly

attached ventrally to the epipharynx with scattered surface setae (as in Chalcididae), the

prepectus is swollen and shoulder-like, and the pronotum is reduced and obscured in dorsal

view (Darling 1988; Heraty and Darling, unpublished), Like Chrysolampinae, the mandibles

34

New genus and species of Perilampidae JESO Volume 138, 2007

are bidentate with sharp apical teeth. If Philomidinae are part of this same lineage, as

suggested by the morphology of the first-instar larva, then the sails am mandibles are

potentially plesiomorphic for Chrysolampinae.

Recently, a species representing a new genus of chalcidoid wasp was collected

in Israel and Yemen. It has features shared with both Chrysolampinae and Perilampinae

that suggests that it may be either a plesiomorphic perilampid or a potential sister group

to one or both of these subfamilies. Our purpose here is not to provide a final and formal

placement of this genus, but to establish its name and provide a detailed discussion of

important features as a prologue to more in-depth morphological and molecular studies that

are in progress on the higher relationships of the perilampid-eucharitid complex.

Methods and Materials

Terms follow Darling (1988; for mouthparts), Heraty (2002), Gibson (1997), and

Heraty and Quicke (2003; for ovipositor). Our terms differ in one major aspect involving

the apex of the antennal flagellum. In many Chalcidoidea with an apparent 13-segmented

antenna, the apical segment of the clava often has a small button-like apical sensillar area

beyond flagellomere 11 (f1,,; antennomere 13) that is differentiated to the same degree

as between fi'° and fl'', but with no multiporous plate sensilla (Fig. 2, f1,,). The archaic

family Rotoitidae has a 14-segmented antenna (Boucek and Noyes 1988), and we consider

this button-like structure in these and other Chalcidoidea as homologous to the 14"

flagellomere of Rotoitidae. Therefore, a 14-segmented antenna is a more general condition

across Chalcidoidea. Colour versions of the figure plates are accessible from JMH or http://

hymenoptera.ucr.edu.

Jambiya vanharteni n. gen. and n. sp. (Figs. 1-23)

Etymology. Jambiya is treated as an arbitrary combination of letters; the gender is

considered to be female. The name is based on the name of the small curved Yemeni dagger

of the same name which is similar in form to the female ovipositor. The species is named

after Tony van Harten, the collector of the specimens from Yemen.

Current placment. J/ncertae sedis within Perilampidae (see discussion below).

Diagnosis. In Jambiya, the mandibles are 3/2 toothed (Fig. 6), the epipharynx has a single

pair of epipharyngeal setae (Fig. 4), the labrum is flap-like and digitate with paired aboral

digits and translucent areas (Fig. 5), the petiole is membranous ventrally (Fig. 15), the ventral

surface of the male scape has scattered minute pores without prominent pits or depressions

(Figs. 7, 8), the mucro is long and acuminate (Fig. 20), and the ovipositor is apically expanded

and dentate (Fig. 20). This genus is similar to Chrysomalla (Chrysolampinae), which also

has the distinct carina demarking a pronotal collar and a ventrally membranous petiole, but

differs in several key features considered as diagnostic of the subfamily. Jambiva differs

from all known genera of Perilampinae by having the labrum not medially incised, ventral

35

Heraty and Darling JESO Volume 138, 2007

surface of the male scape without any distinct pits (although minute pores are present),

pronotum and prepectus + mesepisternum loosely articulated, ovipositor with the ventral

valves expanded and flattened, and in several aspects of the forewing venation (parastigmal

break, linear stigmal sensilla, short postmarginal vein), Without any congeneric species for

comparison, all of the generic diagnostic features are also relevant for species recognition.

Female. Length |.1-1.3 mm. Body color black with iridescent bluish reflections; tarsi pale

brown; ovipositor valves light brown. Wings hyaline, forewing venation brown.

/ F

a “4

60 sm

FIGURES 1-8, Jambiya vanharteni. \-female head in frontal view; 2—female antenna;

3—male antenna, 4—epipharynx; 5—labrum; 6—mandibles; 7—male scape, ventral view; 8—

closeup of inset box from Fig. 7, Abbreviations; anl-anellus; f1,,flagellomere 12; pdl—

pedicel,

36

New genus and species of Perilampidae JESO Volume 138, 2007

FIGURES 9-15. Jambiya vanharteni. 9-female habitus; 10—female head and mesosoma,

dorsal view; 11—13, male mesosoma: 11-—subdorsal view, 12-—sublateral view, 13-

posterodorsal view; 14—petiole in dorsal view, closeup of Fig. 13; 15, petiole and first

sternite in subventral view. Abbreviations: axg—axillular groove; clc—collar; crs—crenulate

sulcus; fmd—femoral depression; fre—frenum; Gs,—gastral sternite 1; Gt,—gastral tergite 1;

occ—occiput; pre—prepectus; vmpt—ventral margin of petiole.

37

Heraty and Darling JESO Volume 138, 2007

FIGURES 16-22. Jambiya vanharteni. 16—forewing; 17—hind wing; 18—stigmal vein; 19-

forewing vein; 20—apex of gaster, lateral view; 21—male genitalia, ventral view; 22—ovariole.

Abbreviations: aed—aedeagus; dgs—digitus; dv—dorsal valve; muc—mucro; par—paramere;

phb—phallobase; pmv—postmarginal vein; stg—stigmal vein; unc—uncus; vv—ventral valve;

2vf-second valvifer; 3v—third valvula.

Head. Rounded in frontal view (Fig. 1); eyes bare; median ocellus anterior to lateral

ocelli. Frons and lower face smooth and shining with scattered semi-erect setae; ocellar-

ocular depression absent; scrobal depression finely reticulate, shallow with rounded lateral

margins, and extending 2/3 distance to median ocellus; vertex lateral to ocelli transversely

strigate; occiput circularly colliculate (Fig. 6), dorsal occipital margin with a sharp carina

(Fig. 10, occ), carina extending to oral fossa although partially obscured ventrally by fine

postgenal striae. Clypeus smooth with few scattered short setae, margins demarked dorsally

and laterally by weakly impressed smooth sulci that are rounded at dorsolateral margins of

clypeus (clypeus nearly semicircular), clypeal margin slightly rounded with a transverse

shelf (Fig. 1); supraclypeal area indistinct. Malar sulcus demarked by a weak carina (Fig.

38

New genus and species of Perilampidae JESO Volume 138, 2007

transverse ridge

Dees Foe

Pi een oye" i iy

rw.

ee ee Tiwi oS

FIGURE 23. Jambiya vanharteni, ovipositor: A—dorsolateral view of apex; B—ventrolateral

view. Abbreviations: dv—dorsal valve; go-gonangulum; Gt —gastral tergites 7; lw—line of

weakness between third valvula and second valvifer; trs—triangular sclerite; v—valvula; vf—

valvifer; vv—ventral valve.

6); hypostomal lobes broadly separated. Mandibles opposing, 3/2 dentate with teeth long

and subequal (Fig. 6), basal articulation with gena membranous medially. Oral fossa broad.

Epipharynx with single pair of stout epipharyngeal setae (Fig. 4). Labrum with 9 marginal

acuminate digits, 2 aboral digits and 2 medial aboral translucent areas/vestigial sockets

(Fig. 5); palpi 4/3 segmented. Antenna 14-segmented; scape narrow and elongate with

no indication of ventral pits or pores in slide mounted antenna; anellus transverse (Fig. 2,

anl); length of flagellum less than height of eye; funicle 7-segmented, all segments broader

than long and slightly increasing in width apically; clava with four distinct, partially fused

segments, apical segment (f1,,) small and button-like; multiporous plate sensilla large and

numerous on all flagellomeres except flagellomeres 1—2 and flagellomere 12 (Figs. 2, 3);

numerous socketed setae on pedicel and flagellum.

Mesosoma. Pronotum with distinct transverse collar demarked by a transverse carina (Figs.

9-12, clc); collar swollen and projecting laterally anterior to spiracle (Fig. 13), anterior

face imbricate and mostly bare, mostly smooth posterior to carina and with scattered semi-

erect setae; pronotum overlapping mesoscutum (Fig. 11). Mesoscutum mostly smooth with

scattered setae; notauli deeply impressed and converging but not meeting at midline (Figs.

39

Heraty and Darling JESO Volume 138, 2007

10, 11). Scutoscutellar sulci diagonal, meeting anteriorly at transscutal articulation; lateral

axillar lobe rounded and smooth (Figs. 10, 11); scutellar disc smooth medially and weakly

imbricate laterally, with scattered setae; axillular groove (axg) present but broad and only

slightly raised above surface (Fig. 11). Frenal line present and complete dorsally; frenum

(fre) broadly rounded, smooth medially and weakly striate laterally, extended only slightly

over metanotum (Figs. 11-13). Metanotum with broad rounded flange laterally, overlapping

propodeum but not overlapping propodeal spiracle (Fig. 13). Propodeum reticulate

medially with a smooth nucha; spiracle separated from anterior margin by its diameter,

margin of spiracle thick and raised (Figs. 11, 13); callus weakly sculptured with several

long setae (Figs. 11, 12); metepimeral groove present and foveate. Femoral depression

(fmd) broadly and shallowly impressed and weakly reticulate (Fig. 12); transepimeral

sulcus present; transepisternal sulcus present and associated with a weak carina (Fig. 12);

posterior margin of upper mesepimeron even and without any indication of the metathoracic

spiracle. Prepectus (pre) associated with mesepimeron, not fused with pronotum, and in a

different plane from pronotum (Fig. 12); dorsal half of prepectus ovoid with a broad foveate

medial depression (Fig. 12), overlapping base of tegula (Fig. 12), ventral half strongly

narrowed and associated with anterior inflected margin of mesepisternum; mesothoracic

spiracle exposed and prominent (Fig. 12). Propleura broadly separated ventrally, meeting

only near anterior margin (Fig. 12). Coxae smooth to weakly imbricate with scattered long

setae; midcoxa less than half size of hind coxa, hind coax semiglobose and with several

prominent long hairs dorsally; femora expanded medially; tibiae densely setose; fore tibia

obliquely truncate apically and with one large, curved, and bifid spur; mid tibia with a

single long spur almost as long as basitarsus; hind tibia with two spurs, longest half as long

as basitarsus; all tarsi 5-segmented; claws simple. Forewing venation distinct (Figs. 16,

18, 19); submarginal vein with 7 long setae dorsally; parastigma with hyaline break and

2 campaniform sensilla along posterior margin (Fig. 19); stigmal vein broadened apically

and with distinct uncus and 4 campaniform sensilla, stigmal vein roughly perpendicular

to forewing margin; postmarginal vein extending beyond stigmal vein, but equal in length

to vertical height of stigmal vein (Fig. 18); basal area bare except for track of setae along

cubital vein, speculum irregular (mostly setose), costal cell with dense short setae; disc with

dense fine setae and distinct marginal fringe, setal tracts on wing disc absent (Fig. 16). Hind

wing venation complete, no trace of basal vein (submarginal vein parallel and continuous);

3 hamuli; fringe present.

Metasoma. Petiole short and transverse, visible only as narrow smooth band dorsally (Fig.

14), ventrolateral margins of petiolar tergite (vmpt) not fused and petiole membranous

ventrally (Fig. 15); membrane attaching to anterior margin of gastral sternite; not overlapping.

Gastral terga smooth to very lightly coriaceous; basal tergites (Gt,.,) tightly appressed,

following tergites distinctly overlapping and articulating; Gt, depressed medially, anteriorly

with medial crenulate depression, laterally with irregular patch of setae (Fig. 13); following

tergites with single row of prominent setae (Fig. 9). Cerci circular with 5 setae. Sclerotized

epiproct absent. Basal sternite (Gs,) with transverse crenulate sulcus (crs) and raised flat

anterior region (Fig. 15); hypopygium with long, bare mucro (Fig. 20, muc). Ovipositor

sheaths long and parallel (Fig. 20, 2vf and 3v), second valvifer fused dorsally with a strong

internal ridge across dorsal apical margin (Fig. 23), third valvula (3v) separated from

40

Rn

New genus and species of Perilampidae JESO Volume 138, 2007

second valvifer by oblique suture (Fig. 23, posterior ventral margin of 2vf indicated by

arrow), and apically with tuft of setae; ventral valve abruptly expanded apically, laterally

flattened and scimitar shaped with 2 apical prongs (Fig. 20, vv); dorsal valve apically with 2

pronounced basally-directed, keel-like spines (Fig. 20, dv, one spine showing) and a minute

spine subapical to these.

Male. Length, 1.02 mm. Dark brown to black. Antennal scape smooth ventrally (Fig. 7),

minute pores present on ventral surface of scape, but visible only at high magnification, and

scape lacking pits or depressions surrounding pores (Fig. 8). Gt, subtriangular and setose.

Genitalia elongate (Fig. 21); aedeagus articulating and with prominent apodemes; parameres

long and thin with a single apical seta; digitus broad, rounded, and with 2 marginal spines.

Ovarian egg. (Fig. 22). Length 0.15-0.16 mm. Cylindrical without apical stalk or surface

sculpture.

Holotype. Female: YEMEN, 12 km NW Manakhah, 05 May—17 June 2002, A. van Harten;

deposited in CNCI. Paratypes. YEMEN: same locality and collector data, but 3 July—21

August 2001 (2), 6 July—21 August 2002 (2, 24; 2 with slide mount of antenna and one

set of wings, base of metasoma on card, ovipositor in vial on pin; 6 with head on card and

slide mount of wings, antenna and genitalia; body used for SEM); ISRAEL: Arava Valley,

0.2 km N Hazeva Field, N 30°46’56” E 35°14’39”, 26-27 April 1996, 450 ft, school in small

wadi, M. E. Irwin (@). All specimens deposited in CNCI.

Discussion

We are confident that Jambiya belongs to the family Perilampidae. The problem

remains as to which subfamily it should be associated with, or if it deserves a new subfamily

status. Several features are of interest in the placement of Jambiya and also affect our

current treatment of the existing subfamilies of Perilampidae.

Male scape. In all Perilampinae and Chrysolampinae, the ventral subapical region of the

male scape has distinct pits that are usually visible using simple light microscopy (Darling

1986, 1983, 1988b). Each of these pits is associated with | or more pores that are likely

associated with pheromone glands (Darling 1986); pores do not appear in the surrounding

interstices. The male scape of Philomidinae is reticulate without any visible pores, even

in slide mounts (Heraty and Darling, unpublished). Males of some Eucharitidae (some

Gollumiella, Psilocharis, and Neolosbanus) have scattered ventral pores visible only in

slide preparations or under high magnification using SEM (Heraty 1994, 2004), however

these are never associated with pits. Males of Jambiya have minute pores scattered over the

ventroapical surface that are visible only with SEM, and no pits (Figs. 7, 8); pores are absent

in the female scape. The presence of these scattered pores is likely a plesiomorphic condition

among the pteromaloid Chalcidoidea, and possibly all Chalcidoidea (Heraty, unpublished).

The association of pores with distinct pits is the derived feature of Chrysolampinae and

Perilampinae which is not present in Jambiya.

4]

Heraty and Darling ~ JESO Volume 138, 2007

Antennal flagellum. The antennal flagellum is similar in Chrysolampinae and Perilampinae

(cf. Figs 2, 3). The groundplan segmentation of the flagellum includes a distinct transverse

anellus (f1,), followed by seven articulated funicular segments (f1, ,) that are usually broader

than long and slightly increasing in width apically, and finally a four segmented clava (f1, ,,)

with the flagellomeres fused but clearly demarked. The apical flagellomere (fl,,) is small

and button-like. Multiporous plate sensilla (MPS) and numerous stout socketed sensilla

are present on at least flagellomeres 4-11 and the MPS are always absent on the anellus

and flagellomere 12. Although there are exceptions within Chrysolampinae (Brachyelatus,

Austrotoxeuma), the flagellum is compressed and much shorter than the head height, and

often barely extending to the clypeal margin. Philomidinae differ only in that some males

have ventrally ramose antennae, whereas they are always simple in other Perilampidae.

In Eucharitidae, the antennal flagellum is much more elongate, and f1,, is never present

in the same form (may be a complete additional segment in some more derived taxa, cf.

Heraty 2002). Except for the absence of MPS on the second flagellomere, the antenna of

Jambiya is similar to that of most Perilampidae; however many of these features are found

in other Chalcidoidea and it is difficult to ascertain which attributes are synapomorphic for

Perilampidae.

Epipharynx. Chrysolampinae and Philomidinae have two patches of epipharyngeal seta,

whereas Perilampinae, all Eucharitidae, and Jambiya have a single pair of stout setae. The

polarity of this character is uncertain (Darling 1988).

Labrum. The labrum of Jambiya is similar in some regards to both Chrysolampinae and

Perilampinae, but not Philomidinae. A weakly sclerotized, flap-like labrum with evenly

placed digits along the apical margin is known for only some Chrysolampus (Darling,

unpublished). In most Chrysolampinae, digits are absent and the setae are arranged evenly

along the apical margin (Darling 1988a). Within Perilampidae, aboral digits and paired

transluscent areas are known only within Perilampinae (Darling 1988a). Furthermore,

the labrum of Perilampinae is excised medially and arranged into two distinct lobes, with

the translucent areas located along the inner margin of the lobes (Darling 1988a). Darling

(1988a) proposed that aboral digits in Perilampinae were likely derived. Their presence in

Jambiya, in combination with other characters, would suggest that aboral digits might be

plesiomorphic for Perilampinae. The labral digits of Jambiya are finely tapered apically;

they may be either tapered or spatulate in Chrysolampinae and Perilampidae; tapered digits

are considered to be plesiomorphic (Darling 1988).

Pronotal-prepectal association. Jambiya and Chrysolampinae have the prepectus closely

associated with the mesepimeron and broadly separated from the pronotum by a wedge-

shaped gap along most of its anterior length (Fig. 12). The size of the gap is related to the

orientation of the pronotum, and can be more correctly correlated with a close association

of the prepectus with the mesepipleuron and not the pronotum. This form of the prepectus

is typical for Pteromalinae, Torymidae, and other chalcidoids, and is presumed to be

plesiomorphic. Philomidinae have a prepectus unique in Chalcidoidea. The articulation

between the pronotum and prepectus is rigid and closely appressed, but the prepectus

remains separate and uniquely overlaps the posteroventral margin of the pronotum. In

42

New genus and species of Perilampidae JESO Volume 138, 2007

Perilampinae, Akapalinae, and Eucharitidae, the prepectus is more closely associated with

the pronotum, and is fused to the pronotum in all Perilampinae (except Steffanolampus) and

within Eucharitidae (Gollumiellinae and all Eucharitini) (Heraty 2002). Close association

with eventual fusion of the pronotum and prepectus is considered the derived state (Heraty

2002).

Forewing venation. The wing venation of Jambiya is almost identical to that found in

Chrysolampus or Chrysomalla (Chrysolampinae), including the presence of a hyaline break

in the parastigma, shape of the stigmal vein and stigma, and length of the postmarginal vein

(Figs. 16-19). The only difference is the linear arrangement of the campaniform sensilla

along the uncus, which are clustered in Chrysolampinae (cf. Darling 1986). Perilampinae

have no hyaline break, a distinctly different stigma, and a much longer postmarginal vein.

The venation of Philomidinae is similar to Chrysolampinae, but without a hyaline break and

they have numerous campaniform sensilla in the stigma that are arranged in a dense cluster

(Heraty, unpublished).

Petiole. The petiole of Jambiya is short and smooth, with the ventral margins of the petiolar

sclerite broadly separated by a membranous area, and the apex of the petiolar scperite abuts

with the anterior margin of the first gastral sternite (neither overlapping or inserted). A

ventrally membranous petiole is found in Chrysomalla (Chrysolampinae) and females of

Indosema and Timoderus (Eucharitidae: Oraseminae). A ventrally membranous petiole is

known in some Pteromalidae (cf. Heydon 1989) and whether it is a derived or plesiomorphic

state is uncertain. In taxa with a fused petiole (i.e. Orasema in Oraseminae), the sternal

antecostal muscles attach between the crenulate sulcus of the first gastral sternite and the

ventral midline of the petiole (Heraty, unpublished). However, in Jambiya, these same

antecostal muscles divide anteriorly and attach to the ventrolateral margins of the sclerotized

portion of the petiole, suggesting that the remnant of the ventral (first) sternite of the petiole

has been split. If so, this could be an apomorphic state within Chalcidoidea, although it is

potentially plesiomorphic for Perilampidae or Perilampidae + Eucharitidae.

Gastral tergites. Perilampinae and Chrysolampinae have the gaster usually high and

triangular in profile, with the first and second tergites usually similar in size, fused dorsally,

and Gt, has a large lateral panel (Darling 1986, 1997). In these two subfamilies, the margins

of the basal two terga are abutting and non-overlapping dorsally. Philomidinae have the

basal tergite longer than the second and also overlapping the second tergite; the basal tergite

(Gt,) has a lateral panel, but this may be associated more with the odd shape of the gaster,

which is strongly compressed dorsoventrally. The basal gastral tergites of Jambiya are

subequal in length and with Gt, abutting Gt, (Fig. 9). These terga are not fused, and there

is no distinct lateral panel on Gt,. Although the basal tergite is broadly depressed medially,

the gaster is rounded and not triangular (Fig. 9). Other than having closely associated and

abutting basal tergites, the gaster of Jambiya is not similar to other Perilampidae.

Ovipositor. The ovipositor of Jambiya is unique within Chalcidoidea. The ovipositor valves

in Chrysolampinae and Perilampinae are simple and needle-like. An expanded ovipositor

with prominent ridges or spines is associated with oviposition into cavities formed in leaf

43

Heraty and Darling | JESO Volume 138, 2007

tissue occurs in the three subfamilies of Eucharitidae (Gollumiellinae, Oraseminae, and

some Eucharitinae) and Akapalinae, although oviposition habits are unknown in this latter

subfamily (Heraty 1994, 2002; Heraty et al. 2004). It is difficult to postulate a use for

the peculiar ovipositor in Jambiya, however its form may suggest a habit of oviposition

into leaf surfaces as is known for some Eucharitidae (Gollumiellinae, Oraseminae, and

some Eucharitinae; Heraty 2002; Heraty and Quicke 1998). This raises the possibility that

expanded ovipositor and leaf ovipositions are plesiomorphic for the perilampid/eucharitid

complex.

Egg. Jambiya has a fusiform smooth egg (as inferred from ovarian eggs). Perilampinae

have a fusiform egg with a sculptured surface (Heraty and Darling 1984; Darling and

Roberts 1999) whereas Chrysolampinae have a fusiform, although slightly dumbbell-shaped

egg, with a smooth surface (Darling and Miller 1991). The eggs of some Eucharitidae are

fusiform and smooth, but most species have a stalked egg, both in the ovariole and after the

egg is deposited (Heraty 1994, 2002). A fusiform egg is likely plesiomorphic.

None of the morphological features discussed above accurately places Jambiya

within any of the perilampid subfamilies, and at best, the features of Jambiya confuse

the putative synapomorphies of Chrysolampinae and Perilampinae. Although closest to

Chrysolampinae, and especially the genus Chrysomalla, Jambiya lacks any of the defining

characteristics of the subfamily. The antennae are similar in general form (antennal formula,

compact flagellum, and dense setation) to all three subfamilies of Perilampidae, but the lack

of pits on the male scape would seem to exclude this genus from either Chrysolampinae

or Perilampinae. The single pair of epipharyngeal setae is shared with Perilampinae and

Eucharitidae, but not Chrysolampinae or Philomidinae. The 3/2 mandibular formula

excludes Jambiya from Chrysolampinae and Philomidinae. The labrum has a composite of

features shared with Chrysolampinae and Perilampinae, but not Philomidinae. The pronotal-

prepectal complex is likely plesiomorphic and uninformative. The wing venation is almost

identical with some Chrysolampinae, but with a different arrangement of campaniform

sensilla. Polarity is difficult to assess for the forewing vein features, but Jambiya is very

different from either Philomidinae or Perilampinae. The petiole is membranous ventrally

and similar to some Chrysolampinae and Eucharitidae, but the polarity of this feature is

uncertain. The gastral tergites are closely associated and abutting, but otherwise it is not

similar to other Perilampidae. The ovipositor is unique within Chalcidoidea, but has some

similarities with Eucharitidae and Akapalinae that may be suggestive of oviposition into

leaf tissue. Lastly, the egg is fusiform which is characteristic of Perilampinae and some

Eucharitidae, but this is likely a plesiomorphic feature. In summary, Jambiya might well

deserve subfamily status within Perilampidae. A combined morphological and molecular

analysis is currently in progress which should resolve not only the placement of this

enigmatic wasp, but also the phylogeny of the perilampid/eucharitid complex.

New genus and species of Perilampidae JESO Volume 138, 2007

Acknowledgements

This paper is dedicated to Dr. ‘DP’ David Pengelley. He was an extraordinary

mentor that inspired undergraduate students to achieve goals that were far and above what

they would have ever expected of themselves. JMH in particular owes his entire career to

the passion for insects that was instilled by studying under DP as both an undergraduate

and as one of his last graduate students. We would like to thank Gary Gibson (CNCI) and

Roger Burks (UCR) for bringing these specimens to our attention. Johan Liljeblad provided

comments on an earlier draft of this manuscript. We acknowledge the support of NSF

grants DEB-0108245 and EF-0341149 to JMH and an NSERC Discovery Grant to DCD.

References

Boucek, Z. 1972. Mediterranean Perilampidae: Euperilampus and genera allied to

Chrysomalla (Hym., Chalcidoidea). Mitteilungen der Miinchener Entomologischen

Gesellschaft 61: 90-107.

Bouéek, Z. 1978. A generic key to Perilampinae (Hymenoptera, Chalcidoidea) with a revision

of Krombeinius n.gen. and Euperilampus Walker. Entomologica Scandinavica 9:

299-307.

Bouéek, Z. 1983. Perilampidae (Hymenoptera) of Mongolia, from Dr. Z. Kaszab’s

expeditions. Acta Zoologica Academiae Scientiarum Hungaricae 29: 107-121.

Boucek, Z. 1988. Australasian Chalcidoidea (Hymenoptera). Wallingford: CAB

International.

Boucek, Z. and J. S. Noyes. 1987. Rotoitidae, a curious new family of Chalcidoidea

(Hymenoptera) from New Zealand. Systematic Entomology 12: 407-412.

Bouéek, Z. and J.-Y. Rasplus. 1991. Illustrated key to West-Palaearctic genera of

Pteromalidae (Hymenoptera: Chalcidoidea). Institut National de la Recherche

Agronomique, Paris.

Burks, B. D. 1979. Chalcidoidea (part) and Cynipoidea. pp. 768-1107, Jn Catalog of

Hymenoptera in America north of Mexico. Krombein K. V., P. H. Hurd, D. R.

Smith, and B. D. Burks (eds.), Smithsonian Institution Press, Washington, DC.

Campbell, B., J. M. Heraty, J.-Y. Rasplus, K. Chan, J. Steffen-Campbell, and C. Babcock.

2000. Molecular systematics of the Chalcidoidea using 28S-D2 rDNA. pp. 57—71,

In The Hymenoptera: Evolution, Biodiversity and Biological Control. Austin, A.,

and M. Dowton (eds.), CSIRO Publishing, Melbourne.

Darling, D. C. 1983. Systematic studies of the Perilampidae (Hymenoptera: Chalcidoidea).

Unpublished Ph.D. thesis, Cornell University.

Darling, D.C. 1986. Revision of the New World Chrysolampinae (Hymenoptera:

Chalcidoidea). Canadian Entomologist 118: 913-940.

Darling, D. C. 1988a. Comparative morphology of the labrum in Hymenoptera: the digitate

labrum of the Perilampidae and Eucharitidae (Chalcidoidea). Canadian Journal of

Zoology 66: 2811-2835.

Darling, D. C. 1988b. A review of the genus Krombeinius (Hymenoptera: Perilampidae)

with a reexamination of generic limits and phylogenetic relationships and the

45

Heraty and Darling : JESO Volume 138, 2007

descriptions of two new species. Journal of the New York Entomological Society

96: 63-81.

Darling, D. C. 1992. The life history and larval morphology of Aperilampus (Hymenoptera:

Chalcidoidea: Philomidinae), with.a discussion of the phylogenetic affinities of the

Philomidinae. Systematic Entomology 17: 331-339.

Darling, D. C. 1995. New species of Krombeinius (Hymenoptera: Chalcidoidea:

Perliampidae) from Indonesia, and the first description of first-instar larva for the

genus. Zoologische Mededelingen, Leiden 69: 209-229.

Darling, D. C. 1997. Perilampidae. pp 534-540, Jn Annotated keys to the genera of Nearctic

Chalcidoidea (Hymenoptera).Gibson, G. A. P., J. T. Huber, and J. B. Woolley

(eds.), Ottawa, NRC Press.

Darling, D. C. and T. D. Miller 1991. Life history and larval morphology of Chrysolampus

(Hymenoptera: Chalcidoidea: Chrysolampinae) in western North America.

Canadian Journal of Zoology 69: 2168-2177.

Darling, D. C. and H. Roberts. 1999, Life history and larval morphology of Monacon

(Hymenoptera: Perilampidae), parasitoids of ambrosia beetles (Coleoptera:

Platypodidae). Canadian Journal of Zoology 77: 1768—1782.

Ferriére, C. and G. J. Kerrich. 1958. Hymenoptera 2. Chalcidoidea. Section (a) Agaontidae,

Leucospidae, Chalcididae, [Eucharitidae, Perilampidae, Cleonymidae and

Thysanidae. Handbooks for the Identification of British Insects 8: 140.

Gibson, G. A. P. 1997. Morphology and Terminology. pp. 16—44, /n Annotated Keys to the

Genera of Nearctic Chalcidoidea (Hymenoptera). Gibson, G. A. P., J. T. Huber,

and J. B. Woolley (eds.), Ottawa, NRC Press.

Gibson, G. A. P., J. M. Heraty, and J. B. Woolley. 1999. Phylogenetics and classification

of Chalcidoidea and Mymarommatoidea — A review of current concepts

(Hymenoptera, Apocrita). Zoologica Scripta 28: 87—124.

Graham, M. W. R. de V. 1969. The Pteromalidae of north-western Europe (Hymenoptera:

Chalcidoidea). Bulletin of the British Museum (Natural History), Entomology

Supplement 14: 1—908.

Grissell, E. E. 1995. Toryminae (Hymenoptera: Chalcidoidea: Torymidae): A redefinition,

generic classification and annotated World catalog of species. Memoirs of

Entomology International 2: 470 pp.

Heraty, J. M. and D. C. Darling. 1984. Comparative morphology of the planidial larvae

of Eucharitidae and Perilampidae (Hymenoptera: Chalcidoidea). Systematic

Entomology 9: 309-328.

Heraty, J. M. 1994. Classification and evolution of the Oraseminae in the Old World,

with revisions of two closely related genera of Eucharitinae (Hymenoptera:

Eucharitidae). Life Sciences Contributions, Royal Ontario Museum 157: 174 pp.

Heraty, J. M. 2002. A revision of the genera of Eucharitidae (Hymenoptera: Chalcidoidea)

of the World. Memoirs of the American Entomological Institute 68: 359 pp.

Heraty, J., D. Hawks, J. S. Kostecki, and A. Carmichael. 2004. Phylogeny and behaviour

of the Gollumiellinae, a new subfamily of the ant-parasitic Eucharitidae

(Hymenoptera: Chalcidoidea). Systematic Entomology 29: 544-559.

Heraty, J. M. and D. J. Quicke. 2003. Phylogenetic implications of ovipositor structure in

Eucharitidae and Perilampidae (Hymenoptera: Chalcidoidea). Journal of Natural

History 37: 1751-1764.

46

— sy

New genus and species of Perilampidae JESO Volume 138, 2007

Heydon, S. L. 1989. Review of Nearctic Rhicnocoelia and Callimerismus with a discussion

of their phylogenetic relationships (Hymenoptera: RieeRD naa) Journal of the

New York Entomological Society 97: 347-357.

Noyes, J. 1990. A word on chalcidoid classification. Chalcid Forum 13: 6—7.

Noyes, J. 2002. Interactive catalogue of World Chalcidoidea (2"' edition). CD-ROM.

Taxapad and The Natural History Museum.

Riek, E. F. 1966. Australian Hymenoptera Chalcidoidea, family Pteromalidae, subfamily

Perilampinae. Australian Journal of Zoology 14: 1207—1236.

47

“yt : itt

Pati fag be Cs > Tate istong Oe

Seti See ina oe

eae ’ Ms ou OTe |

eee es tare ew apentenetio

fo él muittdo ponge cnaieee Act? reel

es NS Te ‘got SA! |

oop 5 Sd Sat ply oe ee 7 a OF R

i on) Li nn C4 1 bers bor i -

toe 2 he «14

af, Li intopy adda pppoe

dent aiear Bivenoltiagineg) an: tater oath,

i) GRO OB-LIFL Taree ld Caras

Vale itary ‘ead terials

ribectep “ae | Persie ‘of bmberoai

dian Ae dtoolowy ik 7681

horrid, 164 — cea Ca r

¥ ewceegicling, C tsinhinbadl metharninieng, - Bett)

a ; sbocntacwiegs “10? Uw iceetteura deel Hish ir ;

= focohmlnyey aod Seominaigy op (Gusd. Ie ke

q y ““ikeretes ¢ Dut div:: tee Chloe nesters) Leite, Ges

- ie Ri Press.) ran mu

Suites, Tv Pav logenct nes mn

jal ™ y oa 7" ar! ot TT see

| ; ine as é i. : ’ ae “« _ _

. acy Europe (Ayinent

‘ Museu (Netord! Hatt) “Bt

| ?

,

“ crery .: mie olamds

\ cid wea). SY

‘ e* ‘TR : ian Mi fine

aged * ince ok bnchatnine (Ayr

Dini aval samy e Musouniy a od hs H

frei ble tentnige pi lid

y Aegan Bric omchigical liye

ae. * (were pe the 4. ite AF met |

fal W gabthmnils the .

jai nylonhkinics » Systimane 8 i

b dL iniees 3000 de apa

fee. cin Prilas mnpdae ¢

ois he Le Wt) eae

£ *

Gut bacteria from Neodiprion abietis JESO Volume 138, 2007

PRELIMINARY EXAMINATION OF GUT BACTERIA FROM

NEODIPRION ABIETIS (HYMENOPTERA: DIPRIONIDAE)

LARVAE |

B. WHITTOME', R. I. GRAHAM?, AND D. B. LEVIN?

Department of Biosystems Engineering, University of Manitoba,

E2-376 EITC, Winnipeg, Manitoba, Canada R3T 5V6

email: levindb@cc.umanitoba.ca

Abstract - J. ent. Soc. Ont. 138: 49-63

The gut microbiotas of insects are important for many processes, including

digestion, nitrogen fixation, and nutrient recycling. Bacterial 16S ribosomal

DNA (rDNA) extracted from excised Neodiprion abietis larval guts was

amplified using PCR. Two combinations of primers produced six fragments

that were separated using Denaturing Gradient Gel Electrophoresis (DGGE).

The DNA fragments were sequenced directly. BLAST-n analysis and

comparison-rank searches, using the Ribosomal Database Project II, revealed

four predicted bacterial species, one that had similarity to Alphaproteobacteria

and three that aligned with Gammaproteobacteria. Phylogenetic analysis by

maximum parsimony and neighbour joining confirmed these findings and

suggest that Rahnella, Yersinia, Enterobacter, and a Caulobacter-like species

inhabit the N. abietis larval gut.

Published November 2007

Introduction

The balsam fir sawfly, Neodiprion abietis (Hymenoptera: Symphyta: Diprionidae),

is an indigenous phytophagous insect in North America. The larvae feed predominantly

on balsam fir (Abies balsamea Mill), but will also consume white spruce (Picea glauca

Moench) and black spruce (Picea mariana Mill.) (Wallace and Cunningham 1995).

Outbreak populations typically occur every 5-15 years, lasting 4-5 years in duration (Piene

et al. 2001; Moreau et al. 2005). Larvae emerge in early summer after overwintering as

eggs sheltered in the needles of the host plant. Male larvae pupate after their fifth instar,

whereas female larvae may go through an additional instar before pupation. Adults emerge

in late summer and, after mating, females lay eggs in current year foliage, using a saw-

‘Department of Biology, University of Victoria, Victoria, British Columbia, Canada

V8W 2Y2

? Population Ecology Group, Faculty of Forestry and Environmental Management,

University of New Brunswick, Fredericton, New Brunswick, Canada E3B 6C2

> Author to whom all correspondence should be addressed.

49

Whittome et al. JESO Volume 138, 2007

like ovipositor. The majority of current knowledge regarding diprionid sawflies is based

on ecological (Wallace and Cunningham 1995; Li et al. 2005; Moreau et al. 2005) and

anatomical studies (Bordas 1895; Maxwell 1955). Current knowledge of the structure and

organization of the sawfly digestive tract is limited, and almost nothing is known about the

microbiota of sawfly guts.

The insect gut is a complex and highly structured organ. Gut morphology and

function are dependent on several factors: the insect taxon, its stage of development, feeding

behaviour of each developmental stage, food source, environment that the insect inhabits,

and the inhabiting microorganisms (Wigglesworth 1972; Chapman 1985; Nation 2002;

Dillon and Dillon 2003). The first comparative review of hymenopteran guts was made,

by Bordas (1895), describing the macro-morphology of guts from selected insects of every

family in the order Hymenoptera. Sixty years later, Maxwell (1955) compared the internal

anatomy of larvae from 132 species, in eleven families of North American and European

sawflies, within the suborder Symphyta. Neither of these reviews on sawfly gut morphology

mentioned gut microbes.

The natural microbiota of the gut represent microbial-host interactions that range

from pathogenic to obligate mutualism. Studies that define the composition of microbial

communities in the digestive system have primarily been performed using termites,

tsetse flies, aphids, and cockroaches (Dillon and Dillon 2003). Recent interest in insect

endosymbionts, such as bacteria in the genera Wolbachia, Buchnera, or Wigglesworthia

bacteria, has increased our knowledge about relationships of microbes with their insect

hosts. Termite microbiota are best characterized, primarily because the functional roles of

gut microbes in other insects have not been investigated (Brune 1998; Bignell 2000; Breznak

2000). In termites, microbes are mainly located within specialized regions and structures

of the gut. The majority of the termite microbiota are found in pouches of the hindgut,

where bacterial densities can reach 10'' cells per ml of gastric fluid (Breznak and Pankratz

1977). In the midgut, microbial communities are typically sparse and tend to localize

between the microvilli of the epithelial cells (Breznak and Pankratz 1977). Microorganisms

may colonize the gut wall, attach to surfaces such as spines, or course freely in the lumen

(Bignell 2000). Depending on the termite species and its food source, the functional role of

the microbes may range from fermentation and hydrogen production to nitrogen recycling

and carbon elimination (Breznak and Pankratz 1977; Brune 1998; Bauer et al. 2000; Bignell

2000; Brauman et al. 2001).

Recent studies of gut microbiota in the ant genera Camponotus, Solenopsis, and

Tetraponera (Hymenoptera: Formicidae), have shown that bacteria localize to bacteriocytes

within the midgut and the pouch of the hindgut (Shannon et al. 2001; Sauer et al. 2002;

van Borm et al. 2002a; Li et al. 2005). These symbiotic microbiota are members of Alpha,

Beta, and Gamma divisions of Proteobacteria, as well as Flavobacteria (van Borm et al.

2002a), and including a novel candidate genus, Blochmannia (Sauer et al. 2000; Sauer et al.

2002). Classification of these microbes was accomplished by culture-independent methods

as these bacteria often cannot be cultured outside of their hosts (Schroder et al. 1996). In

addition, media for culturing has typically been developed for medical studies and the growth

conditions for fastidious microorganisms are often lacking, leading to misrepresentative

sampling of the gut microbiota (Dillon and Dillon 2003). To surmount these difficulties,

sequence analysis of 16S ribosomal DNA (rDNA) has become widely accepted as a tool

50

Gut bacteria from Neodiprion abietis JESO Volume 138, 2007

for investigating unculturable microbes in these often complex communities (Hongoh et al.

2003a, b).

This manuscript represents the first preliminarily analysis of the gut microbiota

of a diprionid species. PCR was used to amplify bacterial 16S ribosomal DNA (rDNA),

extracted from excised larval guts, and along with Denaturing Gradient Gel Electrophoresis

(DGGE) revealed 4 distinct DNA products. BLAST-n analysis and comparison rank

searches of the Ribosomal Database Project II (RDP II) database showed similarity to

Alphaproteobacteria and Gammaproteobacteria. Maximum parsimony and neighbour

joining analyses confirmed these observations.

Materials and Methods

Larval collection

Balsam fir branches, containing Neodiprion abietis larvae, were collected from

forest stands near Old Man’s Pond (near Corner Brook), Newfoundland, Canada (N 49°

05°59’ W 57° 56°05’). Larvae were maintained on balsam fir in paper bags at 4°C. Head

capsule widths of healthy larvae were measured using a dissecting microscope with a

calibrated objective. Larvae with head-capsule widths between 0.68-1.4 mm, corresponding

to 2™ to 4" instar larvae, were harvested for histological preparation and extraction of total

DNA from the excised gut.

PCR amplification, DGGE, and sequencing of bacterial /6S gene

Larvae harvested for molecular characterization of sawfly-gut bacteria were surface

sterilized with a 60 second wash in 5% bleach, followed by a 60 second rinse in DEPC-treated

water (0.1% diethyl pyrocarbonate). Larvae were submerged in sterile phosphate buffered

saline (PBS, pH 7.4), and anterior and posterior segments were excised just posterior of the

head capsule and immediately anterior to the eighth proleg, respectively. The cuticle was

secured and the gut was pulled from the body cavity. The excised gut was transferred to

fresh PBS and the peritrophic membrane, containing the food bolus, was pulled from the gut

lumen using forceps. The gut tissue was immediately placed into RNAlater (Ambion Inc.,

Austin, Texas) and stored at -20°C.

DNA was purified using TRIzol (Invitrogen Co., Burlington, Ontario), following the

manufacturer’s protocol. Two primer sets were used to ensure amplification of the targeted

bacterial 16S rDNA. Primers p984f-GC (5’-CGCCCGGGGCGCGCCCCGGGCGGGGCGG

GGGCACGGGGGGAACGCGCCGAACCTTAC-3’) and pl40Ir (5’-GCGTGTGT

ACAAGACCC-3’) were used to amplify the V6 to V8 regions of 16S ribosomal DNA

(Nobel et al. 1996; Frederick and Caesar 2000). Primers p515f-GC (5’-CGCCC

GGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGCCAGCAGCCGCGGTAA

-3’) and p806r (5’°-GGACTACCAGGGTATCTAAT-3’) were used to amplify the variable

V4 region of 16S rDNA (Relman 1993). PCR mixtures of 50 ul volume contained reaction

buffer (10 mM Tris-HCI pH 8.3 at 25°C, 50 mM KCl, 1.5 mM MgCl, 0.001% gelatin), 10

uM each of dATP, dTTP, dCTP, and dGTP, 0.1 uM of each primer, | unit Zag polymerase

(Qiagen, Mississauga, Ontario) and approximately 10 ng insect genomic DNA template.

PCR was conducted using a Mastercycler EP thermal cycler (Eppendorf, Mississauga,

51

Whittome et al. JESO Volume 138, 2007

Ontario), with the following settings: (1) 94°C for 5 min, | cycle; (11) 94°C for 30 sec, 52°C

for 30 sec, 72°C for 45 sec, 40 cycles; (iii) 72°C for 5 min, 1 cycle. On completion of

thermal cycling, 10% of the reaction was loaded on a 1% agarose gel and electrophoresed

in 1X TBE buffer (90 mM Tris Borate, pH 8.3, 2 mM EDTA) for 2 hrs at 60 V. The gel was

stained with ethidium bromide and visualised using UV illumination.

Subsequently, the PCR products (50% of the reaction) were separated by DGGE

using the DCode system (BioRad) according to the: manufacturer’s instructions. Gels

consisted of 1 mm thick 6% polyacrylamide with a denaturing gradient of 30-70 % (100%

denaturant corresponds to 7 M urea and 40 % vol/vol deionized formamide) and 1X TAE

buffer (90 mM Tris Acetate, pH 8.3, 2 mM EDTA) for 16 hours. Electrophoresis was

performed at 60°C and 80 V in 1X TAE running buffer for 16 hours. Gels were stained with

SYBR Gold nucleic acid stain (Invitrogen) for 30 minutes and images captured upon UV

illumination. DNA bands were excised with a sterile razor blade and placed in 100 ul of

sterile distilled H,O. The samples were placed at 94°C for 5 minutes to elute the DNA from

the polyacrylamide and were stored at 4°C overnight. Five uL of the supernatant were used

as template to reamplify the individual DNA bands. The PCR conditions were the same as

above, but with only 30 cycles of amplification. The PCR products were gel purified using

the QIAquick Gel Extraction Kit (Qiagen), and samples stored at -20°C until ready for

sequencing. Sequencing was performed by Ontario Genomics Innovation Centre, using an

ABI 3730 DNA Analyzer (BigDye version 3.1).

Sequence data was analysed using BLAST-n (http://www.ncbi.nlm.nih.gov/

BLAST) and the Similarity Rank program of the RDP II (http://rdp.cme.msu.edu/seqmatch/

seqmatch intro.jsp) (Maidak et al. 1999), to determine similarity with known bacterial

species (in the database). Closely related species, as well as gut microbiota listed in recent

publications (Boursaux-Eude and Gross 2000; Sauer et al. 2000; Shannon et al. 2001; van

Borm et al. 2002b; Hongoh et al. 2005), were used to construct phylogenetic trees using

neighbour joining and maximum parsimony algorithms, with 1000 bootstrap replicates.

Phylogenetic and molecular evolutionary analyses were conducted using MEGA version

3.1 (Kumar et al. 2004).

Results

DGGE separated four 16S rDNA fragments when using the p984f-p1401r primer

set (Table 1, #1 to 4), and two fragments after amplification from the p515f-p806r primer

set (Table 1, #5 and 6). BLAST-n analysis and similarity rank comparisons to the RDP II

sequence database predicted four bacteria matches: Rahnella sp. (sequence #1, GenBank

Accession No. EF140875), Yersinia sp. (sequences #2-4, GenBank Accession No. EF 140876-

EF 140878 ), an Enterobacteriaceae (sequence #5, GenBank Accession No. EF140880), and

an Alphaproteobacteria (sequence #6, GenBank Accession No. EF140879).

Phylogenetic analysis confirmed the predicted identities of the first four bacteria and

showed their close relationship to other known insect-gut microbes in the Enterobacteriaceae

family of Gammaproteobacteria. Maximum parsimony and neighbor joining analyses

suggest that sequence #1 was most closely related to Rahnella aquatilis. Both analyses

weakly supported the clustering of sequences #2-4 with Yersinia, with the degree of their

52

JESO Volume 138, 2007

Gut bacteria from Neodiprion abietis

dsfonut yoyeubos/ysyeubos/nponsurawo'dps//:dyy :dy1sqom [| ddu z

LSV1d/A03 yr wy Tqou MMM //:dyYy:ayISgomM LSV TE IGON |

~ (%NOT) 8910090008

‘(%OO1) €STE60000S

(%001) 660L67000S

“(% 001) L6ZS 100008

(%001) E8P6ES000S

‘(%O01) T8PEESOOOS

(%€'S6) E8P6ESOOOS

“(%ES6) T8P6ESOOOS

(%9'b6) E8P6ES000S

‘(%9'v6) T8P6ESOOOS

(%5'°96) I8S€S9000S

_ (%S'96) TLL8EPOOOS

(AyUSPI %) day

(%001) 9P6€91OG

(%001) PL86SrlV

(%16) 8pSOrrOd

( %L6) C9TE6N

(%L6) TTLOSSAV

(%66) OO9LZ9LV

‘(%66) 66SL7Z9LV

(%66) OOILZ9LV

‘(%66) 66SL7T9LV

(%66) OOILZ9LV

‘(%66) 66SL79LV

( %L6) 8rSOrPrOd

‘(%66) 8SL06N

(AjIWUSPI %)

JOquInN) UOISSODNV

Yyoye | seq

~ uintiajoeqoajoideydyy

poinyjnouy)

‘ds ovaoviiajoeqo1ajuq

‘ds DIuIssaX

‘ds pIulsuag

‘ds pIulsUax

‘ds pjjauyoy

AyUap] Poyo!peld

rs (1908d/9D-3S1¢d) 94

OI (1998d/0D-351Sd) S#

80€ (1100p 19/9D-J7864) p#

ri¢ (110 19/9D-Jr86d) c#

IZE (110p19/9D-Jr86d) TH

- Sele (10r1d/O03P86d) 14

(dq) ozis (jas 1ourtid)

uooldury juswseLy FOO

‘(a990d Aq uonesedas pur Yd Aq

uoneoytdure Jaye) synsprui-jeasey siaigo uolsdipoaN JO KAOIQOAIU DY} WO Po}oV.X9 WNC WO. pourej;qo soousnbes WNq [ewosoqi

S9| JO suonsod soy (sosequyep |] dde My) pue yuRquoy wou) sonjea uostedusoo [| dy Pur synsor U-LSV Td IAON SOUSIH “1 ATAVL

53

Whittome et al. | JESO Volume 138, 2007

Uncultured N. abietis bacteria # 2

Uncultured N. abietis bacteria# 3 | —-————

Uncultured N. abietis bacteria # 4 |

Yersinia aleksiciae

Wigglesworthia ssp. of Glossina brevipalpis

Yersinia pestis

Brenneria quercina

79 Symbiont of Formica fusca

Serratia maracens

52 Rhanella spp.

54 Yersinia rhodei

Plesiomanas shigelloides

64 Candidatus Blochmannia silvicola

Candidatus Blochmannia rufipes

Candidatus Blochmannia socius

Candidatus Blochmannia herculeanus

Buchnera aphidicola

Uncultured sheep mite bacteria

Unclassified Pseudomonadaceae of Tetraponera binghami

51 Candidatus Clostridium massiliensis

Candidatus Clostridium timonensis

Clostridium thermocellum

Chloroflexus aggregans

Bacillus megaterium

61 87 Bartonella henselae

69 Wolbachia melophagi

Unclassified Rhizobiaceae of Tetraponera binghami

Wolbachia maritima

Unclassified Methylobacteriaceae of Acromyrmex octospinosus

sd 79 Caulobacter leidyia

99 Unidentified eubacterium AM084885

Unidentified eubacterium of Myrmeleon mobilis DQ163946

Unidentified eubacterium AJ459874

Burkholderia spp. of Tetraponera binghami

Wolbachia inokumae

Wolbachieae incompatibility symbiont of Nasonia vitripennis

96

77

53

FIGURE 1. Phylogenetic analyses of bacterial 16S ribosomal DNA gene sequences

amplified from insect guts. Maximum parsimony (A and C) and neighbour joining trees (B

and D) were inferred using the Mega 3.1 program with 1000 bootstrap repetitions. Support

values >50% are listed at nodes. Sequences of 16S ribosomal DNA from the microbiota

of N. abietis larval guts are indicated with arrows. Bacteria identified by sequences #1-—

4 (from primer set p984f-GC/p140Ir) are represented in Trees A and B, while bacteria

identified by sequences #5 and #6 (primer set p515f-GC /p806r) are represented in Trees C

and D. Boxes indicate groups referred to in Table 1.

54

Gut bacteria from Neodiprion abietis JESO Volume 138, 2007

Uncultured WN. abietis bacteria # 2

B 83 Yersinia aleksiciae

52

Yersinia pestis

62 Brenneria quercina

85 Symbiont of Formica fusca

Serratia maracens

64 Rhanella spp.

87 Uncultured N. abietis bacteria # 1

Rhanella aquatilis

69 rersinia rhodei

Plesiomanas shigelloides

87 Candidatus Blochmannia silvicola

Candidatus Blochmannia rufipes

Candidatus Blochmannia socius

Candidatus Blochmannia herculeanus

Buchnera aphidicola

Burkholderia spp. of Tetraponera binghami

99 Uncultured sheep mite bacteria

Unclassified Pseudomonadaceae of Tetraponera binghami

Flavobacterium of Tetraponera binghami

99 — Wolbachia inokumae

Wolbachieae incompatibility symbiont of Nasonia vitripennis

97—=_ Bartonella henselae

91 Wolbachia melophagi

Unclassified Rhizobiaceae of Tetraponera binghami

Wolbachia maritima

Unclassified Methylobacteriaceae of Acromyrmex octospinosus

91 Caulobacter leidyia

99 Unidentified eubacterium AJ459874

Unidentified eubacterium of Myrmeleon mobilis DQ163946

Unidentified eubacterium AM084885

Bacillus megaterium

Chloroflexus aggregans

80 Candidatus Clostridium massiliensis

56—_§$.. Candidatus Clostridium timonensis

Clostridium thermocellum

FIGURE 1. Continued

5D

Whittome et al. JESO Volume 138, 2007

¢ Yersinia pestis 2

Unidentified eubacterium A Y537571

Plesiomanas shigelloides

Uncultured NV. abietis bacteria # 5

Yersinia aleksiciae

Yersinia rhodei

Rhanella aquatilis

Brenneria quercina

Rhanella spp. DQ217650

Serratia maracens

andidatus blochmannia socius

Candidatus Blochmannia herculeanus

Candidatus Blochmannia rufipes

Candidatus Blochmannia silvicola

Wigglesworthia ssp. of Glossina brevipalpis

Buchnera aphidicola

Burkholderia spp. of Tetraponera binghami

92 Uncultured sheep mite bacteria

Unclassified Pseudomonadaceae of Tetraponera binghami

97 Candidatus Clostridium massiliensis

Candidatus Clostridium timonensis

96 Wolbachia inokumae

Wolbachieae incompatibility symbiont of Nasonia vitripennis

Wolbachia maritima

Clostridium thermocellum

Chloroflexus aggregans

Lactococcus lactis

Bacillus subtilis

52 Bacillus megaterium

53 Lactobacillus maltaromicus

Carnobacterium piscicola

67

Caulobacter leidyia

Bartonella henselae

67 Wolbachia melophagi

Unclassified Rhizobiaceae of Tetraponera binghami

Unclassified Methylobacteriaceae of Acromyrmex octospinosus

Unclassified Alphaproteobacteria DQ516567

80

Unidentified eubacterium of Myrmeleon mobilis DQ163946

Unidentified eubacterium AM084885

Unidentified eubacterium AJ459874

Unidentified eubacterium AJ874181

Unclassified Caulobacteria AY807064

Uncultured N. abietis bacteria # 6

FIGURE 1. Continued

56

Gut bacteria from Neodiprion abietis

60

98

99

73

88

58

55

95

58

FIGURE 1. Continued

JESO Volume 138, 2007

Unidentified eubacterium AJ459874

Unidentified eubacterium AM084885

Unidentified eubacterium of Myrmeleon mobilis DQ163946

Uncultured N. abietis bacteria # 6

Unclassified Caulobacteria AY807064

Unidentified eubacterium AJ874181

—

Unclassified Alphaproteobacteria DQ516567

Bartonella henselae

Wolbachia melophagi

Unclassified Rhizobiaceae of Tetraponera binghami

Unclassified Methylobacteriaceae of Acromyrmex octospinosus

Flavobacterium of Tetraponera binghami

Candidatus Clostridium massiliensis

Candidatus Clostridium timonensis

Clostridium thermocellum

Lactococcus lactis

Bacillus subtilis

Bacillus megaterium

Lactobacillus maltaromicus

Carnobacterium piscicola

Wolbachia maritima

Wolbachia inokumae

Wolbachieae incompatibility symbiont of Nasonia vitripennis

Candidatus Blochmannia rufipes

Buchnera aphidicola

Candidatus Blochmannia silvicola

Wigglesworthia ssp. of Glossina brevipalpis

Burkholderia spp. of Tetraponera binghami

Uncultured sheep mite bacteria

Unclassified Pseudomonadaceae of Tetraponera binghami

Candidatus Blochmannia socius

Candidatus Blochmannia herculeanus

erratia maracens

Yersinia aleksiciae

Yersinia rhodei

Uncultured N. abietis bacteria #5

Brenneria quercina

Plesiomanas shigelloides

Yersinia pestis

Unidentified eubacterium AY537571

Rhanella aquatilis

Rhanella spp. DQ217650

oroflexus aggregans

57

Whittome et al. JESO Volume 138, 2007

relatedness to Yersinia aleksiciae varying (Table | and Figure 1). The three 16S rDNA

sequences showed 98.7% identity to each other and were approximately 320 bp in length.

The identity of the bacterium from which sequence #5 was derived was not

determined beyond Enterobacteriaceae because results from maximum parsimony and

neighbor joining analyses were inconsistent. The difficulty in confirming the identity of

this bacterium may be a result of the small amplicon size (180 bp). However, sequence

#6 (184 bp), which was amplified with the same primer set, clearly clustered with the

Alphaproteobacteriaceae. Maximum parsimony analysis suggested that bacteria, from

which sequence #6 was derived, belonged to the genus Caulobacter.

Discussion

The microbiota identified by 16S rDNA sequences from N. abietis gut tissues

include those that have been found ubiquitously in the environment and likely originated

from the host’s diet (Selenska-Pobell et al. 1995; Dillon and Charnley 2002; Sprague and

Neubauer 2005). Similarly, other free-living microbial species have been isolated from

other sawfly gut tissues, including Pristiphora geniculata, Acantholyda erythrocephala,

and Pikonema alaskensis (R. Graham, unpublished data). Fragments #1-5 (based on 16S

rDNA sequences) represent bacteria that belong to the Gammaproteobacteria, specifically

those in the Enterobacteriaceae family of Gram-negative, anaerobic microbes.

Neither Rahnella aquatilis nor Yersinia aleksiciae have been published as insect

gut microbes, although R. aquatilis has been isolated from both chicken ticks (Montasser

2005) and the intestinal contents of snails (Brenner et al. 1998). An uncultured Rahnella sp.

was reported in GenBank (Accession # U84730) from an isolate of the microbial gut flora

from the coleopteran genera Phaleria and Latreille (Tenebrionidae). Rahnella spp. have

been isolated from foliage (Hashidoko et al. 2002; Izumi et al. 2006) and ferment several

polysaccharides (Brenner et al. 1998). Additionally, Rahnella spp. have been recognized

as strong nitrogen fixers (Brenner et al. 1998; Izumi et al. 2006). This characteristic would

be important for nitrogen recycling in nutrient-poor diets and possibly promote its retention

as a symbiont within the gut, perhaps originally acquired through the sawfly’s diet.

Species of Yersinia have been isolated from other insect guts (Ulrich et al. 1981);

therefore it is not surprising that we found related bacteria in the gut of N. abietis. No

beneficial characteristics have been attributed to Yersinia. Their ubiquitous presence in

soils and detritus suggest that this bacterium is more likely to be a transient microbe ingested

with food matter, rather than part of the permanent flora of the sawfly gut.

16S-sequence analysis of fragment #5 and subsequent phylogenetic comparisons

to other Gammaproteobacteria was inconsistent and poorly resolved. Maximum parsimony

indicated that the closest relative to the N. abietis bacteria was Plesiomanas shigelloides,

while neighbour joining analysis suggested that Y. rhodei was more closely related.

BLAST-n searches of the 16S ribosomal sequence commonly aligned Serratia spp. with

high degrees of identity (97%). Yersinia, Rahnella, and Serratia spp. have been shown to

cluster closely together in a Group B of the enterobacterial genera, with the main signature

nucleotides located between positions 590-649 (Sproer et al. 1999). The p515f-p806r primer

set amplifies the variable V4 region of 16S rDNA between base pairs 627 and 807. This

58

Gut bacteria from Neodiprion abietis JESO Volume 138, 2007

region only overlaps the signature nucleotides by 22 bp, making a positive identification

difficult. Therefore bacterial sequence #5 can only be classified as an Enterobacteriaceae

until further data is collected. .

Finally, 16S-sequence analyses indicated that bacterium #6 was a member

of the Alphaproteobacteria, showing high similarity with uncultured bacteria of insect

larvae and soil (GenBank AJ459874, DQ163946, and AM084885; Table 1; Figure 1 C,

D). An uncultured Caulobacter (GenBank AY 807064) aligned within the unidentified

Alphaproteobacteria, supported by a 98% bootstrap value, suggesting that the N. abietis

bacterium #6 may be Caulobacter-like. Although Caulobacteria have typically been

isolated from aquatic environments, a few isolates have been reported from the intestinal

contents of a millipede (Abraham et al. 1999) and the mite Jetranychus urticae (Hoy and

Jeyaprakash 2005). If N. abietis bacterium #6 is a Caulobacter, this microbe may play a

key role in nutrient acquisition since Caulobacteria have been shown to uptake phosphorus

from nutrient-poor environments (Gonin et al. 2000). Chemical analyses of current year

foliar nutrients have reported phosphorous levels at 900-4000 ppm along the eastern US

coastline and in the Laurentide-Onatcheway region of Québec, Canada (Bauce et al. 1994;

Richardson 2004). Although foliar chemical data for balsam fir growing in Newfoundland

could not be found, it is known that phosphorous levels decline rapidly in trees growing in

harsh conditions (Richardson 2004). Due to the often severe climate of Newfoundland, one

would predict phosphorous levels at the lower end of the range reported.

The diversity of the gut microbiota of N. abietis, using a PCR prospecting

approach, is relatively low compared to the variety of microbes observed in termite and

cockroach guts (Cruden and Markovetz 1984; Hongoh et al. 2003a). Approximately 270

phylotypes have been detected in the gut of Reticulitermes speratus and the bacteria were

classified into 9 of the 20 phyla of eubacteria (Hongoh et al. 2003a). In contrast, only

6 phylotypes were detected in N. abietis and were classified within a single eubacterial

phylum (Proteobacteria).

Although low levels of bacterial diversity within insect guts are not uncommon,

the microbiota are generally composed of multiple phyla. The gut of the gypsy moth,

Lymantria dispar (Order Lepidoptera) has a microbial diversity that ranges from 7 to 15

phylotypes, depending on its diet source (Broderick et al. 2004). A total of 13 genera

were identified from larvae feeding on all diet sources and were classified within the

Actinobacteria, the Bacteroidetes/Chlorobi group, Firmicutes, and Proteobacteria. Similar

results were obtained from cultured isolates and 16S sequence analysis of microbes detected

within the midgut of Culex quinquefasciatus (Order Diptera), where bacteria from 13

genera were identified (Pidiyar et al. 2004). The majority of mosquito bacteria belonged to

the Gammaproteobacteria class (60% of cultured and 46% of culture-independent), while

Actinobacteria and Firmicutes constituted the remainder of the bacterial types.

While diet influences the acquisition of bacterial flora observed in insect guts,

morphology is often a significant factor affecting the diversity of the gut microbiota. Many

termites and cockroaches have evolved complex and convoluted guts (Wigglesworth 1972;

Brune and Friedrich 2000) that allow the retention of bacteria in specialized fermentation

structures. Insects possessing simple and straight alimentary canals, such as the Diprionidae,

Lepidoptera, and many Diptera, generally have a lower diversity of gut microbes (Dillon

and Dillon 2003). Due to the selective diet of N. abietis and the simple morphology of its

gut, the low level of bacterial diversity is not unexpected.

a9

Whittome et al. JESO Volume 138, 2007

Nonetheless, 16S rDNA sequencing and phylogenetic analyses identified six

phylotypes in the larval gut of the balsam fir sawfly; four of the bacteria were clustered with

Rahnella sp. and Yersinia sp., while the other two bacteria were determined to belong to

the Enterobacteriaceae and Caulobacteriaceae. Whether or not they are present as obligate

endobionts, they may variously play significant roles as associated microflora in sawfly

larvae.

Acknowledgements

This work was supported by grants from the BioControl Network of Canada and

the National Sciences and Engineering Research Council of Canada (NSERC). The authors

would like to thank Chris Lucarotti for his valuable comments and editing.

References

Abraham, W. R., C. Strompl, H. Meyer, S. Lindholst, E. R. Moore, R. Christ, M. Vancanneyt,

B. J. Tindall, A. Bennasar, J. Smit, and M. Tesar. 1999. Phylogeny and polyphasic

taxonomy of Caulobacter species. Proposal of Maricaulis gen. nov. with Maricaulis

maris (Poindexter) comb. nov. as the type species, and emended description of

the genera Brevundimonas and Caulobacter. International Journal of Systematic

Bacteriology 49 Pt 3: 1053-1073.

Bauce, E., M. Crepin, and N. Carisey. 1994. Spruce budworm growth, development and

food utilization on young and old balsam fir trees. Oecologia 97: 499-507.

Bauer, S., A. Tholen, J. Overmann, and A. Brune. 2000. Characterization of abundance and

diversity of lactic acid bacteria in the hindgut of wood- and soil-feeding termites

by molecular and culture-dependent techniques. Archives of Microbiology 173:

126-137.

Bignell, D. E. 2000. Introduction to symbiosis. pp. 209-231. /n Termites: Evolution,

Sociality, Symbioses, Ecology. T. Abe, D. E. Bignell, and M. Higashi (eds.),

Dordrecht, Netherlands.

Bordas, M. L. 1895. Appareil glandulaire des Hyménopteres. Annales des Sciences

Naturelles Zoologie et Biologie Animale 19: 1-362.

Boursaux-Eude, C. and R. Gross. 2000. New insights into symbiotic associations between

ants and bacteria. Research in Microbiology 151: 513-519.

Brauman, A., J. Dore, P. Eggleton, D. Bignell, J. A. Breznak, and M. D. Kane. 2001.

Molecular phylogenetic profiling of prokaryotic communities in guts of termites

with different feeding habits. FEMS Microbiology Ecology 35: 27-36.

Brenner, D. J., H. E. Muller, A. G. Steigerwalt, A. M. Whitney, C. M. O’Hara, and P.

Kampfer. 1998. Two new Rahnella genomospecies that cannot be phenotypically

differentiated from Rahnella aquatilis. International Journal of Systematic

Bacteriology 48 Pt 1: 141-149.

Breznak, J. A. 2000. Ecology of prokaryotic microbes in the gut of wood- and litter-feeding

termites. pp. 209-231. Jn Termites: Evolution, Sociality, Symbioses, Ecology. T.

Abe, D. E. Bignell, and M. Higashi (eds.), Dordrecht, Netherlands.

60

Gut bacteria from Neodiprion abietis JESO Volume 138, 2007

Breznak, J. A. and H. S. Pankratz. 1977. Jn situ morphology of the gut microbiota of wood-

eating termites Reticulitermes flavipes (Kollar) and Coptotermes formosanus

(Shiraki). Applied and Environmental Microbiology 33: 406-426.

Broderick, N. A., K. F. Raffa, R. M. Goodman, and J. Handelsman. 2004. Census of the

bacterial community of the gypsy moth larval midgut by using culturing and

culture-independent methods. Applied and Environmental Microbiology 70: 293—

300.

Brune, A. 1998. Termite guts: the world’s smallest bioreactors. Trends in Biotechnology

16: 16-21.

Brune, A. and M. Friedrich. 2000. Microecology of the termite gut: structure and function

on a microscale. Current Opinion in Microbiology 3: 263-269.

Chapman, R. F. 1985. Structure of the digestive system. pp. 165—211. Jn Comprehensive

insect physiology, biochemistry and pharmacology. 4, Regulation - Digestion,

Nutrition, Excretion. G. A. Kerkut and L. I. Gilbert (eds.), Oxford.

Cruden, D. L. and A. J. Markovetz. 1984. Microbial aspects of the cockroach hindgut.

Archives of Microbiology 138: 131-139. —

Dillon, R. and K. Charnley. 2002. Mutualism between the desert locust Schistocerca

gregaria and its gut microbiota. Research in Microbiology 153: 503-509.

Dillon, R. J. and V. M. Dillon. 2003. The gut bacteria of insects: nonpathogenic interactions.

Annual Review of Entomology 49: 71—92.

Frederick, B. A. and A. J. Caesar. 2000. Analysis of Bacterial Communities Associated with

Insect Biological Control Agents using Molecular Techniques. Proceedings of the

10" International Symposium on Biological Control of Weeds 261-267.

Gonin, M., E. M. Quardokus, D. O’Donnol, J. Maddock, and Y. V. Brun. 2000. Regulation of

stalk elongation by phosphate in Caulobacter crescentus. Journal of Bacteriology

182: 337-347.

Hashidoko, Y., E. Itoh, K. Yokota, T. Yoshida, and S. Tahara. 2002. Characterization of

five phyllosphere bacteria isolated from Rosa rugosa leaves, and their phenotypic

and metabolic properties. Bioscience Biotechnology and Biochemistry 66: 2474—

2478.

Hongoh, Y., P. Deevong, T. Inoue, S. Moriya, S. Trakulnaleamsai, M. Ohkuma, C.

Vongkaluang, N. Noparatnaraporn, and T. Kudo. 2005. Intra- and interspecific

comparisons of bacterial diversity and community structure support coevolution

of gut microbiota and termite host. Applied and Environmental Microbiology 71:

6590-6599.

Hongoh, Y., M. Ohkuma, and T. Kudo. 2003a. Molecular analysis of bacterial microbiota in

the gut of the termite Reticulitermes speratus (Isoptera; Rhinotermitidae). FEMS

Microbiology Ecology 44: 231-242.

Hongoh, Y., H. Yuzawa, M. Ohkuma, and T. Kudo. 2003b. Evaluation of primers and PCR

conditions for the analysis of 16S rRNA genes from a natural environment. FEMS

Microbiology Letters 221: 299-304.

Hoy, M.A. and A. Jeyaprakash. 2005. Microbial diversity in the predatory mite Metaseiulus

occidentalis (Acari: Phytoseiidae) and its prey, Tetranychus urticae (Acari:

Tetranychidae). Biological Control 32: 427-441.

61

Whittome et al. JESO Volume 138, 2007

Izumi, H., I. C. Anderson, I. J. Alexander, K. Killham, and E. R. Moore. 2006. Endobacteria

in some ectomycorrhiza of Scots pine (Pinus sylvestris). FEMS Microbiology

Ecology 56: 34-43.

Kumar, S., K. Tamura, and M. Nei. 2004. MEGA3: Integrated software for Molecular

Evolutionary Genetics Analysis and sequence alignment. Briefings in

Bioinformatics 5: 150-163.

Li, H., F. Medina, S. B. Vinson, and C. J. Coates. 2005. Isolation, characterization, and

molecular identification of bacteria from the red imported fire ant (Solenopsis

invicta) midgut. Journal of Invertebrate Pathology 89: 203-209.

Maidak, B. L., J. R. Cole, and C. T. J. Parker. 1999. A new version of the RDP (Ribosomal

Database Project). Nucleic Acids Research 27: 171-173.

Maxwell, D. E. 1955. The comparative internal larval anatomy of sawflies (Hymenoptera:

Symphyta). Canadian Entomologist 87: 1—132.

Montasser, A. A. 2005. Gram-negative bacteria from the camel tick Hyalomma dromedarii

(Ixodidae) and the chicken tick Argas persicus (Argasidae) and their antibiotic

sensitivities. Journal of the Egyptian Society of Parasitology 35: 95—106.

Moreau, G., C. J. Lucarotti, E. G. Kettela, G. S. Thurston, S. Holmes, C. Weaver, D. B.

Levin, and B. Morin. 2005. Aerial application of nucleopolyhedrovirus induces

decline in increasing and peaking populations of Neodiprion abietis. Biological

Control 33: 65-73.

Nation, J. L. 2002. Digestion. pp. 27—64. /n Insect physiology and biochemistry. J. L. Nation

(ed.), Boca Raton, Florida.

Nobel, U., B. Englen, A. Felske, J. Snaidr, A. Wieshber, R. I. Amann, W. Ludwig, and

H. Backhaus. 1996. Sequence heterogeneities of genes encoding 16S rRNAs in

Paenibacillus polymyxa detected by temperature gradient gel electrophoresis.

Journal of Bacteriology 178: 5636—5643.

Pidiyar, V. J., K. Jangid, M. S. Patole, and Y. S. Shouche. 2004. Studies on cultured and

uncultured microbiota of wild Culex quinquefasciatus mosquito midgut based on

16s ribosomal RNA gene analysis. American Journal of Tropical Medicine and

Hygiene 70: 597-603.

Piene, H., D. Ostaff, and E. Eveleigh. 2001. Growth loss and recovery following defoliation

by the balsam fir sawfly in young, spaced balsam fir stands. Canadian Entomologist

133: 675-686.

Relman, D. 1993. The identification of uncultured microbial pathogens. Journal of Infectious

Diseases 168: 1-8.

Richardson, A. D. 2004. Foliar chemistry of balsam fir and red spruce in relation to elevation

and the canopy light gradient in the mountains of the northeastern United States.

Plant and Soil 260: 291-299.

Sauer, C., D. Dudaczek, B. Holldobler, and R. Gross. 2002. Tissue localization of the

endosymbiotic bacterium “Candidatus Blochmannia floridanus” in adults and

larvae of the carpenter ant Camponotus floridanus. Applied and Environmental

Microbiology 68: 4187-4193.

Sauer, C., E. Stackebrandt, J. Gadau, B. Holldobler, and R. Gross. 2000. Systematic

relationships and cospeciation of bacterial endosymbionts and their carpenter

62

Gut bacteria from Neodiprion abietis JESO Volume 138, 2007

ant host species: proposal of a new taxon “Candidatus Blochmannia (gen nov)”.

International Journal of Systematic and Evolutionary Microbiology 50: 1877—

1886.

Schroder, D., H. Deppisch, M. Obermayer, G. Krohne, E. Stackebrandt, B. Holldobler, W.

Goebel, and R. Gross. 1996. Intracellular endosymbiotic bacteria of Camponotus

species (carpenter ants): systematics, evolution and ultrastructural characterization.

Molecular Microbiology 21: 479-489.

Selenska-Pobell, S., E. Evguenieva-Hackenberg, and O. Schwickerath. 1995. Random

and repetitive primer amplified polymorphic DNA analysis of five soil and two

clinical isolates of Rahnella aquatilis. Systematic and Applied Microbiology 18:

425-438.

Shannon, A. L., G. Attwood, D. H. Hopcroft, and J. T. Christeller. 2001. Characterization

of lactic acid bacteria in the larval midgut of the keratinophagous lepidopteran,

Hopmannophila pseudospretella. Letters in Applied Microbiology 32: 36-41.

Sprague, L. D. and H. Neubauer. 2005. Yersinia aleksiciae sp. nov. International Journal of

Systematic and Evolutionary Microbiology 55: 831—835.

Sproer, C., U. Mendrock, J. Swiderski, E. Lang, and E. Stackebrandt. 1999. The

phylogenetic position of Serratia, Buttiauxella and some other genera of the

family Enterobacteriaceae. International Journal of Systematic Bacteriology 49 Pt

4: 1433-1438.

Ulrich, R. G., D. A. Buthala, and M. J. Klug. 1981. Microbiota associated with the

gastrointestinal tract of the Common House Cricket, Acheta domestica. Applied

and Environmental Microbiology 41: 246-254.

van Borm, S., J. Billen, and J. J. Boomsma. 2002a. The diversity of microorganisms

associated with Acromyrmex leafcutter ants. BMC Evolutionary Biology 2: 9.

van Borm, S., A. Buschinger, J. J. Boomsma, and J. Billen. 2002b. Tetraponera ants have

gut symbionts related to nitrogen-fixing root-nodule bacteria. Proceedings of the

Royal Society of London - B: Biological Sciences 269: 2023-2027.

Wallace, D. R. and J. C. Cunningham. 1995. Diprionid sawflies. pp. 193-232. Jn Forest

Insect Pests in Canada. J. A. Armstrong, W. G. H. Ives, and E. J. Mullins (eds.),

Ottawa, Ontario.

Wigglesworth, V. B. 1972. Digestion and nutrition. pp. 476-536. /n The Principles of Insect

Physiology. V. B. Wigglesworth (ed.), London.

63

. breif 120 ARE al

: coehaaeesiar anita Die itl

M dick 52 Vonage nae

Mcaigh Saws ail ah MH) lof ny roan apaden

ow) brn thee owl tocabeelae 1 AE) gaden a, beaten

th seu orcoallés barley sh hee piano < ibaa ns Pt ee

Y Me

' t Hosearet ig a de Le $

woites coral > @00rapl ter cmt aat, A atte Rove! A hhybe i

noo icoheash esvqulnpauned oft de dbase the ek; ah oe spel risa

Lb at 5? ywolqadenald baited cetyl ‘oltre waht elAR

Mae ae ee Acts

Lin ATK Je Ranges

odl.2PO1 Jhavwiadagté, 2: bows La PRR RH

mo) imeem * elim (ace, Oe - when setagbiomeat

rit} vaclomeoell qinminde a pecan chip ee

wh daw bondeown wonoradld fBR2b ante. ‘ pAtladll 7

baiignA eakecgpcke Madge. pede Senol! nomen} sd) to rom verse pak

nhah a | dander leesanain ™ f a

rrvoaeer, | liasowsl: adh ASA pra ianodh a tag be atietinky aS AM

ai oludou) OMG. atanriey ryhee| paar mbit Lie, Bote D

were COC eliett 4 bee gaeate HE. lL 3a ional A ea

beeee7yd .abiaione beter roy i bare ae Py Airis minions oe

' at | radia ‘au Bt ME? 3) ry caphent » ike crete thas Hale

OF Oak OT ee hele wit} oly jeais irda dug JT Adem A Lea

| 4) orsnythertt or fi) 4 i lant an

: SHA a Deo

nine bos qeuhog OLS VEL Nee a

; : inoweslon 4 47 yale tt

5 n 7 Tal c7 q

'

= >» <«

‘ Leras ~ im relst

roe © ae . a i Lh! 38°

a AD at Ay, tine | east

‘andiddhrt- Piasecgnie Aarakonn

me C cnr extie pores Apyried

Revision of North American Sobarocephala JESO Volume 138, 2007

REVISION OF THE NORTH AMERICAN SOBAROCEPHALA

(DIPTERA: CLUSIIDAE, SOBAROCEPHALINAE)

OWEN LONSDALE'AND STEPHEN A. MARSHALL?

Entomology Department, Smithsonian Institution, National Museum of Natural History,

Rm. CE-607, 10" & Constitution Ave. NW, Washington, D.C., 20560-0168

email: Neoxabea@hotmail.com

Abstract J. ent. Soc. Ont. 138: 65-106

The 17 species of Sobarocephala Czerny, 1903 occurring in the Neartic

north of Mexico are reviewed and keyed. Sobarocephala wirthi spec. nov.

and S. pengellyi spec. nov. are described from the eastern United States.

Descriptions, illustrations, and distribution maps are provided for all Nearctic

species.

_ Published November 2007

Introduction

Sobarocephala Czerny, 1903, as redefined by Lonsdale and Marshall (2006), is

a large, predominantly neotropical genus with 17 Nearctic species and at least a dozen

described and undescribed species from the Afrotropical, Australian, and Oriental Regions.

The Nearctic species do not form a monophyletic group, but instead belong to a number of

independent lineages, several of which are tropical in origin. The North American fauna,

including two new eastern species allied to S. /atifrons (Loew), is here revised.

North American Sobarocephala species are small (2.4-5.6 mm), thin, pale yellow

flies, often with distinctive brown patterning. Two male genitalic characters define the

genus (a basal shield on the distiphallus and a “thumb” on the lateral lobe of the distiphallus

(Lonsdale and Marshall 2006)), but Sobarocephala is most easily separated from other

Nearctic Clusiidae by the absence of interfrontal bristles (found in Clusiodes Coquillett,

1904 and Clusia Haliday, 1838), the possession of inclinate anterior fronto-orbital bristles

(reclinate in Clusiodes and Craspedochaeta Czerny, 1903), and the presence of a well-

developed dorsal preapical bristle on the mid tibia (absent in Clusia and Heteromeringia

Czerny, 1903). A key to the North American genera of Clusiidae was provided in Sods

(1987); we follow Woodley (1984) in treating the single Nearctic Chaetoclusia (C. affinis

Johnson) identified in that key as Sobarocephala.

Although the Nearctic Sobarocephala were recently treated by Sabrosky and

Steyskal (1974), considerable new material has become available since then, allowing us

' Author to whom all correspondence should be addressed.

Insect Systematics Lab, Department of Environmental Biology, University of Guelph,

Guelph, Ontario, Canada NIG 2W1

65

Lonsdale and Marshall JESO Volume 138, 2007

to reconsider the Nearctic fauna on the basis of over 1200 specimens. We here add two

species to the genus, provide an updated key, list new distributional data, and draw attention

to previously unrecognized sister-group relationships.

Materials and Methods

Material from the following institutions was examined for this revision: California

Academy of Sciences, San Francisco (CASC); Carnegie Museum of Natural History,

Pittsburgh (CMNH); Canadian National Collection, Ottawa (CNCI); University of Guelph

Insect Collection, Guelph (DEBU); Entomological Museum of Utah State, Logan (EMUS);

Instituto Nacional de Biodiversidad, Santo Domingo de Heredia (INBC); Museum of

Comparative Zoology, Cambridge (MCZC); North Carolina State University, Raleigh

(NCSU); Texas A&M University, College Station (TAMU); Tel Aviv University, Tel Aviv

(TAUI); United States National Museum, Washington, D.C. (USNM).

Specimen preparation and terminology follows that in Lonsdale and Marshall

(2006). The M.,,, ratio is defined as the length of the ultimate section of vein M divided

by the length of the penultimate section. Size ranges include both sexes. Label data for

non-type material is not listed for the relatively abundant S. flaviseta (Johnson), S. latifacies

Sabrosky & Steyskal, and S. /atifrons (Loew). Maps only include Nearctic records.

Generic Diagnosis

Pedicel with pronounced outer and inner angulate extensions. Cell bm open or

closed. Interfrontal bristle absent. Anterior fronto-orbital bristle inclinate. Vein R, bare

dorsally. Thorax usually with two postsutural dorsocentral bristles (rarely one or three in

some tropical species). Presutural intra-alar bristle absent or weak in Nearctic species. Mid

tibia with preapical dorsal bristle. Male 6" spiracle moved into membranous region anterior

to annulus. Ventrolateral lobe of hypandrium setose and relatively large. Distiphallus

almost always with basal shield (present in all Nearctic species); lateral lobe of distiphallus

often with “thumb” (Fig. 20).

Key to the species of Sobarocephala north of Mexico

l. Arista densely plumose (Figs. 1, 2,6, 7). Bristles usually yellow. Gena eee shiny.

First flagellomere with dorsal stripe or spot around base of arista .............. AY 3

— Arista sparsely plumose or pubescent (Figs. 3—5). Bristles light lotto to erry

Gena pilose to silvery tomentose. First flagellomere entirely yellow dorsally (S.

texensis and some S. setipes with light infuscation around base of arista and S. flava

females with anterior margin lightly pigmented) ..................eeeeeeeseeeeeeseeeeseeeeeseeees >

Z: Ocellar bristles minute to absent. Scutum with two pairs of spots; scutellum brown,

at least in part. Sides of frons converging posteriorly. Female tergite 8 yellow.

Surstylus with tubercle—like bristles apical. Southern United States ................8. 3

66

Revision of North American Sobarocephala JESO Volume 138, 2007

- Ocellar bristles well-developed. Scutum and scutellum yellow. Sides of frons

parallel. Female with basal half of tergite 8 brown. Surstylus with tubercle-like

bristles along length of distal and posterior margins. Eastern United States ........... 4

3 Scutellum, laterotergites, and epandrium entirely brown (Fig. 1). Gena shiny. Cerci

flush with distal margin of epandrium (Fig. 28). Surstylus subrectangular with long

palisade-like bristles along inner-distal margin (Figs. 27, 28). Distiphallus large and

spoon-shaped; lateral lobe without thumb (Fig. 29). Southeastern United States,

Central America, Bahamas, Colombia ...........................9. quadrimaculata So6s

~ Scutellum brown laterally (Fig. 2), laterotergites brown lateral to scutellum, and

epandrium yellow. Gena silvery tomentose. Cerci projecting (Fig. 25). Surstylus

triangular with apical tubercle-like bristles (Figs. 24, 25). Distiphallus relatively

small and thin; lateral lobe with thumb (Fig. 26). Florida ...........0.ccecccecesssceeesseeeeeees

mre tae OR UW, SLU IRGR LQ Raii tcc ea. UE S. cruciger Sabrosky & Steyskal

4. Bristles and epandrium yellow (Fig. 6). Wing clear. Hind tibia and tarsi yellow.

Frons yellow. Occiput occasionally pilose. Eastern United States 42.29... id:

RR SO ah NL a le S. affinis (Johnson)

- Bristles ind sereondnitdin brown (Fig. 7). Wing very lightly clouded on distal 1/3

along R,,,. Hind tibia and tarsi sometimes brownish. Frons sometimes with anterior

margin white. Occiput usually pilose. Eastern and southeastern United States

SEENON A RIAN Re OMNI: Sos cniva daaansadsase aces S. muesebecki Sabrosky & Steyskal

3; Sides of frons converging posteriorly. Notopleuron and/or scutellum sometimes with

een aET RS esate Milan lisa Gaile tel) Je. hosluck! AL RAL tic 6

- Sides of frons parallel. Neither notopleuron nor scutellum with white spots ..........8

6. Scutellum white. Scutum with brown supra-alar spot and basal quadrate stripe;

notopleuron, postpronotum, and posterolateral scutal spots white (Fig. 5). Arista

pubescent. Florida, Dominican Republic ............8. atrifacies Sabrosky & Steyskal

— Scutellum yellow. Scutum predominantly yellow, sometimes with brown markings;

white markings, if present, restricted to notopleuron and postpronotum (Fig. 3).

Arista short-plumose .. Uae MMe oon

h Bristles brown. Cell - edosedl) iNest saliote sia potipleunon anid postpronotum

white, at least in part (Fig. 3). Fore tarsi yellow. Female abdomen yellow with thin

central stripe on tergite 3 and with wide light brown stripe (narrowing anteriorly)

on tergites 4 and 5. Tubercle-like bristles on surstylus confined to apex (Fig. 19).

Widespread mv NortlvAmeriva ! oti i0.0. ek ed ee S. flaviseta (Johnson)

— Bristles black. Cell bm open. Notum yellow, sometimes with lateral margin brown

(Fig. 4). Fore tarsi light brown, at least apically. Female abdominal tergites 2-5 with

small brown anteromedial spot; tergites 6 and 7 dark brown. Tubercle-like bristles

on surstylus extending onto agg margin (Fig. 22). Northeastern North America

and Utah .. 6. vissesessssseeeeeesedd» latifacies Sabrosky & Steyskal

8. Scutellum betes hie (Hig. 14). Frons sometimes with orange tint (darkest

posteriorly). Scutum with one pair of wide postsutural stripes (connected posteriorly).

Basicon North Atmerica y).) 00100. 8200. Wa. S. dreisbachi Sabrosky & Steyskal

Scutellum yellow, at least in part. Frons yellow. Pattern on scutum variable ......... 9

9. Scutellum usually with central brown stripe (sometimes only brown medially or

apically), but if yellow with distal infuscation on ventromedial surface, then surstylus

67

Lonsdale and Marshall JESO Volume 138, 2007

14.

hook-shaped (some S. /atifrons; te 48) or subtriangular (some S. wirthi; Fig. 45)

Scutellum entirely yellow or brown lateiuliys never yellow with ventromedial

infuscation. Surstylus — rounded or bifid, but never hook-like or triangular

d 14

Stina on » scmplinp peer at i anlipeiat (Bigs fbi 17). Austad Saidtiis ahecth

Female tergite 2 with wide central stripe. Male abdomen with wide central stripe on

tergites 2-5. Male sternite 5 with posteromedial comb of bristles. Surstylus small,

lobate, and without tubercle-like bristles (Fig. 60) ............ccccceceecceeeeeesseceeeeeeessseeees 1]

Stripe on scutellum evenly brown or darkest at apex (Fig. 10). Acrostichal bristle

present. Female tergite 2 brown along posterior margin or with thin central stripe.

Male abdomen entirely yellow or with variable light brown pattern. Male sternite 5

without comb. Surstylus at least 2/3 length of ap with tubercle-like bristles

along distal 2/3 of posterior margin (Fig. 43) .. ihe sake 2

Scutum yellow with one pair of brown spots on latonanan ie Gemunieon® one pair

of postsutural stripes (Fig. 15). First flagellomere yellow. Bristles light brown.

Fore tibia yellow. Occiput pilose. Small bristle in front of anterior dorsocentral.

Female tergite 6 with wide central stripe. Laterotergites sometimes brown laterally.

Distiphallus short, and lateral lobe small and ovate (Fig. 61). Eastern North America

amin Ab Mttawaleciss caval Aik 6..420ir es ARKS S. setipes Melander & Argo (in part)

Scutum yellow, sometimes with light brown prescutellar spot extending onto

scutellum (Fig. 17). First flagellomere with light infuscation around base of arista.

Bristles brown. Fore tibia light brown. Occiput shiny. No small bristle in front of

anterior dorsocentral. Female tergite 6 yellow. Laterotergites yellow. Distiphallus

longer than half length of phallapodeme, and lateral lobe well-developed (Fig. 58).

Tekasiiaale wea wie... obdneedh eau S. texensis Sabrosky & Steyskal

Bristles light brown. Scutum with light brown lateral markings (Fig. 12). Male face

light brown medially and female face sometimes orange medially. Epandrium dark

brown. Surstylus small, rounded, and 2/3 length of epandrium (Fig. 42). Female

tergite 6 brown, and tergites 2-4 yellow except for thin central brown stripe. Alabama,

Georpiew aivieiaio discs. ds cvallev. Wicket og nde S. pengellyi spec. nov.

Bristles dark brown to black. Scutum with variable lateral markings. Face yellow in

both sexes. Epandrium predominantly or entirely yellow. Surstylus almost as long

as epandrium. Female tergite 6 brown laterally and (sometimes) basally, and tergites

2-4 dark laterally (sometimes also dark medially). Eastern United States ............. 13

Surstylus hook-shaped (Fig. 48). Female abdomen sometimes with central brown

stripe in addition to lateral markings (Fig. 10). Epandrium sometimes with small

basalspot sss Anh. el 4a ee ee has. S. latifrons (Loew)

Surstylus broad and rounded apically (Fig. 45). Female abdomen yellow medially

(Fig. 11): . Epandrium entirely yellow .:¢1.22i2240 aetowleuleling S. wirthi spec. nov.

Female abdomen mostly or entirely yellow on tergites 1-5 and dark brown on tergite

6. Male abdomen entirely yellow and gena thin (height less than half that of first

flagellomere). Surstylus large, lobate, and widest distally. Male cerci rounded and

slightly projecting wwiJak. os eeqewe een. beeen dliw.. see. Jogleeiee

68

Revision of North American Sobarocephala JESO Volume 138, 2007

16.

Female abdomen with wide central stripe on tergites (2) 3-6 (interrupted on tergite

5 in some S. lachnosternum and on tergite 6 in S. interrupta). Male abdomen with

wide central stripe, but if entirely yellow, gena as high as first flagellomere. Surstylus

less than half length of epandrium, small, and rounded or bifid. Male cerci flush with

distal margin of epandrium or sunken .. te satcoheg ..16

First flagellomere yellow in both sexes, \ eit anterior margin n lightly oa SS in

females (Fig. 8). Wing lightly (sometimes indistinctly) clouded along R,,, and costa

(darkest distally). Female Se aes Eastern United States, Texas, Utah

i ...9. flava Melander & Argo

First Racclidmere fark ae to i blacks on jereal half (Fig. 9). Wing clear. Female

laterotergites brown, at least in part. Northeastern North America, Kansas ...............

EN eS Se ee: ane. eon S. atricornis Sabrosky & Steyskal

Postsutural stripe serrate on anterior margin. Scutellum brown laterally (rarely

yellow) (Fig. 13). Female tergite 6 yellow, sometimes with anteromedial spot.

No small bristle in front of anterior dorsocentral. Anterior lateral scutellar bristle

minute or absent. Surstylus bifid (Fig. 51). Male cerci flush with distal margin

of epandrium (Fig. 52). Posterior margin of male sternite 5 without posteromedial

comb. Southeastern United States, Illinois ......... S. interrupta Sabrosky & Steyskal

Postsutural stripe entire and rounded on anterior margin, if present. Scutellum

usually yellow, but if lateral corner brown (some S. setipes), small bristle present in

front of anterior dorsocentral. Female tergite 6 brown, at least medially. Anterior

lateral scutellar bristle not much smaller than posterior bristle, if at all. Surstylus

rounded. Male cerci sunken below distal margin of epandrium. Male sternite 5 with

SE IE IS. SEE ee Se eS ers 17

Notopleuron brown posteriorly (females sometimes with most of notopleuron and

postpronotum brown) and scutum with one pair of wide brown postsutural stripes

(Fig. 15). Acrostichal bristle absent. Length 2.4-2.9 mm. Female abdomen with

wide brown stripe on tergites 2-6. Eastern North America .............csceeesseeeeseeeeeeeeeeees

en en eo S. setipes Melander & Argo (in part)

Scutum yellow with dark brown quadrate spot on notopleuron (sometimes faded

in males and teneral specimens) (Fig. 16). Acrostichal bristle present. Length 3.9-

4.9 mm. Female abdominal pattern as follows: tergite 2 sometimes brown along

posterior margin, tergites 3 and 4 with wide central stripe, tergite 5 with narrow

central stripe, and tergite 6 dark brown. Eastern and central North America .............

ee ta sa radacarescesaonseccesccansncs S. lachnosternum Melander & Argo

69

Lonsdale and Marshall JESO Volume 138, 2007

FIGURES 1-9. 1—Sobarocephala quadrimaculata Soos; male (left) and female abdomen

(right). 2—S. cruciger Sabrosky & Steyskal; male (left) and female abdomen (right). 3—S.

flaviseta (Johnson); female. 4—S. latifacies Sabrosky & Steyskal; male (left) and female

abdomen (right). 5—S. atrifacies Sabrosky & Steyskal; female. 6—S. affinis (Johnson); male

(left) and female abdomen (right). 7—S. muesebecki Sabrosky & Steyskal; male (left) and

female abdomen (right). 8—S. flava Melander & Argo; male (left) and female (right; arista

not illustrated). 9-—S. atricornis Sabrosky & Steyskal; male (left) and female (right; head

not illustrated).

70

Revision of North American Sobarocephala JESO Volume 138, 2007

FIGURES 10-17. 10—Sobarocephala latifrons (Loew); male (left) and female (right; head

not illustrated). 11—S. wirthi spec. nov.; male (left) and female abdomen (right). 12—S.

pengellyi spec. nov.; male (left) and female abdomen (right). 13—S. interrupta Sabrosky &

Steyskal; male (left) and female abdomen (right). 14—S. dreisbachi Sabrosky & Steyskal;

male (left) and female abdomen (right). 15—S. setipes Melander & Argo; male (left) and

female (right; head not illustrated). 16—S. Jachnosternum Melander & Argo; male (left) and

female abdomen (right). 17—S. texensis Sabrosky & Steyskal; male.

Al

Lonsdale and Marshall JESO Volume 138, 2007

Species Descriptions

Sobarocephala affinis (Johnson, 1913) (Figs. 6, 39-41; Map 1)

Chaetoclusia affinis Johnson, 1913: 101. Melander & Argo, 1924: 9.

Sobarocephala testacea Soos, 1964: 449. Sabrosky & Steyskal, 1974: 378.

Sobarocephala affinis, Woodley, 1984: 120.

Redescription (Fig. 6)

Male. Body length 2.8-4.4 mm. Bristles yellow. Two dorsocentral bristles with

one minute bristle in front of anterior dorsocentral. Acrostichal bristle absent. Two pairs

of well-developed lateral scutellar bristles. Arista densely plumose. Sides of frons parallel.

Body yellow except as follows: fore tibia usually light brown to brown; fore tarsi dark

brown; coxae, base of femora, posterior half of katepisternum, parafacial and gena white;

first flagellomere with dark spot around base of arista; occiput occasionally pilose. Male

from Alabama with one pair of small spots behind suture, and lateral margin of postpronotum

(and part of notopleuron) brown. M__,, ratio 3.9-4.6. Wing clear. Cell bm open. Face flat.

Female. Externally similar to male except as follows: abdomen with median stripe

on tergites (2) 3-4; tergites 5-7 and anterior half of tergite 8 brown.

Male terminalia. (Figs. 39-41) Similar to S. muesebecki, except pregonite ovate

and hypandrium with four minute distal bristles.

Distribution: United States: AL, FL,GA, MA, NC, NJ, NY, VA (Map 1).

Holotype. UNITED STATES, VA: Cape Henry, 26 June 1939, A. L. Melander, 3,

USNM.

Additional material examined. UNITED STATES, AL: Kushla, 22 July 1914, A. H.

Sturtevant, 4, USNM; Baldwin Co., Bon Secour Nat. Wildlife Refuge, 5-7 May 1994, S.

A. Marshall, 4, DEBU; Bon Secour (site 4), Malaise, 19 October 2004, 30.30N, 88.74W,

E. Benton, 2, DEBU. FL: Alachua Co., Gainesville, Austin Cary Forest, insect flight

trap, CO, baited, G. B. Fairchild, 6 August 1976, 23, 22, USNM; 9 August 1976, 3, 9,

USNM;; 13 August 1976, 29, USNM; 20 August 1976, 4, 29, USNM; 17 September 1976,

©, USNM; 30 July 1976, ¢, USNM; 26 July 1976, 2, USNM; 16 August 1976, 9, USNM;

Gainesville, Pine Hill Estates, H. V. Weems Jr., Malaise trap, 26 September 1973, 2, USNM;

3 October 1973, 2, USNM; Gainesville, Pierce’s homestead, 8 April 1976, W. H. Pierce,

flight intercept trap, 2, USNM; Mobile Co., Camp Scoutshire (site 24), Malaise trap, 14

December 2004, 31.05N, 88.18W, E. Benton, 9, DEBU. GA: Liberty Co., St. Catherine’s

Isl., 18-21 September 1972, F. C. & B. J. Thompson, 3, AMNH; 24-28 April 1972, Thomas

& Picchi, 9, AMNH. MA: Concord, 19 July 1961, W. W. Wirth, marsh, 3, USNM. NC:

Wake Co., 7 air mi. SW of Raleigh off rd., Malaise trap, C. S. Parron, 21 September 1985,

3, NCSU; 14 August 1985, 3, NCSU; 2 July 1985, 9, NCSU; 30 August 1985, 9, NCSU.

NY: Kalfleisch, 15 August 1962, R. S. Huntington, 2, USNM.

72

Revision of North American Sobarocephala JESO Volume 138, 2007

MAP 1. Distribution of Sobarocephala affinis (Johnson) (circle) and S. muesebecki Sabrosky

& Steyskal (dot).

Comments. While the sister-species Sobarocephala muesebecki and S. affinis are both

largely restricted to the eastern and southeastern coastal United States, the range of S.

muesebecki extends further west into Texas and Pennsylvania. Males of S. muesebecki and

S. affinis are easy to separate using the colour of the epandrium, but females are much more

difficult to distinguish: the bristles of S. muesebecki are darker and the anterior margin of

the frons is light yellow to white, but these characters are often difficult to see in poorly

preserved specimens.

Sobarocephala atricornis Sabrosky & Steyskal, 1974 (Figs. 9, 30-32; Map 2)

Sobarocephala atricornis Sabrosky & Steyskal, 1974: 382.

Redescription (Fig. 9).

Male. Body length 3.0-3.3 mm. Bristles dark brown. Two dorsocentral bristles.

Acrostichal bristle present. Two pairs of well-developed lateral scutellar bristles. Arista

sparsely plumose. Sides of frons parallel.. Notum yellow, usually with light to dark spot on

and (usually) behind notopleuron (pigment sometimes indistinct). Pleuron and legs light

yellow to white. Head largely yellow, with ocellar tubercle brown and ventral half of first

73

Lonsdale and Marshall JESO Volume 138, 2007

flagellomere black; parafacial and gena white and silvery tomentose. Abdomen yellow.

M,,, ratio 4.4. Wing clear or with cloud around apex of R,,, (sometimes filling first radial

cell). Cell bm open. Face flat.

Female. As described for male except as follows: bristles black; scutum yellow

with lateral margin dark brown (sometimes faded) (one female from Ontario (DEBU) with

scutum yellow excluding brownish lateral margin on notopleuron); scutellum sometimes

with thin brown border along lateral margin; laterotergites brown, sometimes yellow below

scutellum; face white; fore tarsi sometimes light brown; tergites 2-4 sometimes with small

spot on posterior margin; tergite 6 and basal margin of tergite 7 brown; lateral stripe present

along length of abdomen (not visible dorsally).

Male terminalia. (Figs. 30-32) Sternite 5 evenly setose. Sclerites of annulus

well-developed. Width of epandrium 4/5 height and length 3/5 height. Surstylus 2/3 height

of epandrium, slightly wider on distal half; tubercle-like bristles along length of posterior

margin, but more concentrated apically. Cerci projecting and rounded; bristles short

with several slightly longer central bristles. Ventral lobe of hypandrium long with three

minute distal bristles; arm short and truncate. Phallapodeme well-developed. Pregonite

ovate, membranous, and possibly fused to hypandrium. Postgonite and basiphallus small.

Epiphallus long, projecting, and perpendicular to basiphallus. Distiphallus half length of

phallapodeme, and lateral lobe thin, hooked, spinulose distally, and without thumb.

243

Distribution. Canada: ON, PQ. United States: KS, MA, MI, NY (Map 2).

Holotype. CANADA, ON: Maynooth, 8 July 1965, J. F. McAlpine, 3, CNCI.

Allotype. UNITED STATES, MI: Claire Co., 23-28 July 1959, R. R. Dreisbach, 9,

USNM.

Paratypes examined. CANADA, ON: Ottawa, J. R. Vockeroth, 12 July 1959, 29, CNCI;

9 July 1962, 2, CNCI. PQ: Abbotsford, 23 June 1937, G. Shewell, 2, CNCI. UNITED

STATES, MI: Monroe Co., J. Truchan, ex. Malaise trap, 1 August 1965, ¢, USNM; 1 July

1965, 2, USNM.

Additional material examined. CANADA, ON: Innisville, 12 July 1963, W. R. M. Mason,

2, CNCI; White R., July 1980, S. A. Marshall, 2, DEBU; Five Points, 25-30 July 1983,

Malaise trap, J. Thompson, 9, DEBU; Wellington Co., University of Guelph Arboretum,

ex. dung, O. Lonsdale, 9 August 2004, 2, DEBU [in alcohol]; 19 July 2005, 6, DEBU [in

alcohol]; University of Guelph Arboretum, B. Brown, unbaited pitfalls, 22 May—8 July

1983, 29, DEBU; mushroom baited pitfalls, 19 July 1983, 22, DEBU; Guelph, 11 July

1981, J. Ernst, 2, DEBU; Fergus, Malaise trap, S. A. Marshall, 16 July 1990, 22, DEBU;

9 July 1990, 2, DEBU; 10 July 1990, 2, DEBU; Rondeau, 25 July 1981, S. A. Marshall,

dung trap, 2, DEBU; Lambton Co., Port Franks, Watson Property, pans, J. Skevington,

15-18 July 1996, 52, DEBU; 31 July—6 August 1996, 2, DEBU; 27 June—2 July 1996, °,

DEBU; 18-22 July 1996, 2, DEBU; Sault Ste. Marie, Ft. Creek Cons. Area, 8 July 1998,

K. N. Barber, sweeps, Jmpatiens, sedge, fern, 46°32.5’N, 84°20.8’W, 3, DEBU; Sault Ste.

Marie, Birchwood Park, 27 July 1986, K. N. Barber, mixed forest, 2, DEBU; Essex Co.,

74

Revision of North American Sobarocephala JESO Volume 138, 2007

Point Pelee N. P., Visitor Centre, Malaise trap and pans, 6-11 August 2000, O. Lonsdale,

2°, DEBU; Ottawa, J. R. Vockeroth, damp, second-growth Acer-Betula wood, 16 July 1989,

3, CNCI; 4 July 1991, 9, CNCI; 7 mi E Griffith, 11 July 1990, B. E. Cooper, 4, CNCI:;

McDonald Island, St. Lawrence Isl. N. P., A. Carter, 15 July 1976, 2, CNCI; Ottawa, 13

August 1974, J. R. Vockeroth, 2, CNCI. UNITED STATES, KS: Riley Co., Manhattan,

8 July 1966, Malaise trap, G. F. Hevel, 2, USNM. NY: Corlear Bay, L. Champlain, June

1939, R. C. Shannon, 3, USNM; Ulster Co., Cherrytown, 4 mi NNW Kerhonkson, 15-30

July 1971, P. & B. Wygodzinsky, 9, AMNH.

Comments. Sobarocephala atricornis can be readily diagnosed by a ventrally black first

flagellomere (hence its name). If the antennae are missing, females can be identified by their

characteristic notal and abdominal patterns. Male S. atricornis are more difficult to identify

because, like many other North American Sobarocephala, they are weakly pigmented and

have dark bristles, however they can be distinguished by their clear wings and brown supra-

alar spots.

MAP 2. Distribution of Sobarocephala atricornis Sabrosky & Steyskal.

75

Lonsdale and Marshall JESO Volume 138, 2007

Sobarocephala atrifacies Sabrosky & Steyskal, 1974 (Fig. 5; Map 3)

Sobarocephala atrifacies Sabrosky & Steyskal, 1974: 379.

Redescription (Fig. 5) |

Female. Body length 3.8-4.4 mm. Bristles light brown. Two dorsocentral bristles.

Acrostichal bristle present. Two pairs of well-developed lateral scutellar bristles. Arista

pubescent. Sides of frons converging posteriorly. Thorax mostly yellow; notopleuron,

postpronotum, scutellum, laterotergites beside scutellum and posterior notal spots white;

one pair of dark brown supra-alar spots and one large posteromedial spot; if face yellow,

anterior margin of scutum brown, including inner half of postpronotum. Coxae white. Legs

mostly yellow, with tarsi dirty white to light brown, and fore tarsomeres 2-5 and distal 1/3 of

tarsomere | brown. Head predominantly yellow, with parafacial and gena white, face black

(yellow in some Dominican Republic specimens), and ocellar tubercle brown. Abdomen

yellow with tergites 3-6 dark brown (tergites 5 and 3 yellow on anterior corner). Cerci

brown. M_,, ratio 3.7, Wing clear. Cell bm closed. Face flat.

Male. Unknown.

Distribution. Florida (Map 3), Dominican Republic.

MAP 3. North American distribution of Sobarocephala atrifacies Sabrosky & Steyskal

(diamond) and S. guadrimaculata Sos (circle).

76

Revision of North American Sobarocephala JESO Volume 138, 2007

Holotype. UNITED STATES, FL: Pinellas Co., High Point, 17 November 1971, K.

Hickman, 2, USNM.

Paratypes. UNITED STATES, FL: Dade Co., Miami, 3 November 1971, G. R. Searis,

McPhail trap in Loquat tree, 62, USNM.

Other material examined. DOMINICAN REPUBLIC. Pedernales, 26 km N Cabo

Rojo, 18°06’N, 71°38’W, 730 m, 13-25 July 1990, L. Masner, J. Rawlins & C. Young,

wet deciduous forest, intercept trap, 22, CMNH; RD-095 Rodeo, ~0.5 km E Presa de

Blanco, Bonao, Monsenor Nouel Prov., 20 March 2003, D. Perez, R. Bastardo, B. Hierro,

2, USNM.

Comments. The paratypes from Florida were collected on grapefruit and guava trees

(Sabrosky and Steyskal 1974).

Sobarocephala cruciger Sabrosky & Steyskel, 1974 (Figs. 2, 24-26; Map 4)

Sobarocephala cruciger Sabrosky & Steyskal, 1974: 376.

Redescription (Fig. 2)

Male. Body length 3.5-5.4 mm. Bristles yellow. Two dorsocentral bristles.

Acrostichal bristle absent. Two pairs of well-developed lateral scutellar bristles. Ocellar

bristle absent. Arista densely plumose. Sides of frons converging posteriorly. Scutum

mostly yellow; lateral margin with one pair of brown spots behind transverse suture and

one pair of spots abutting scutellum; postpronotum light yellow. Scutellum brown laterally.

Anatergite brown below scutellum. Pleuron and legs yellow with fore tarsi brown. Coxae

white. Head mostly yellow, with gena and parafacial white, and first flagellomere brown on

dorsal half; gena silvery tomentose. Tergites 1-5 with central brown stripe; posterior half

of tergite 4 brown; tergite 6 with small central spot; surstylus white; remainder of abdomen

yellow. M,,, ratio 4.0-4.8. Wing clouded on distal 1/3. Cell bm open. Face convex on

dorsal half below antennal bases.

Female. Externally as described for male except anatergite and tergite 6 with

brown medial stripe, tergite 7 light brown, and cerci brown.

Male terminalia. (Figs. 24-26) Sternite 5 evenly setose. Annulus reduced to

thin band ventrally. Width of epandrium 2/3 height and length half height. Surstylus short,

acutely triangular, and curved inwards; tubercle-like bristles terminal only. Cerci projecting

and bifid. Hypandrial arm longer and thicker than ventral lobe, projecting at 90° basally

(arcuate medially); ventral lobe with one minute and two long distal bristles. Pregonite

long and thin with one distal bristle. Postgonite and basiphallus small. Epiphallus thin and

weakly sclerotized. Distiphallus short and bent medially; lateral lobe truncate and minutely

toothed distally with thumb half length of lobe.

Distribution. Florida (Map 4).

qT

Lonsdale and Marshall JESO Volume 138, 2007

Holotype. UNITED STATES, FL: Manatee Co., Cedar Hammock, 16 September 1966,

D. C. Chancey, Steiner trap, ¢, USNM.

Allotype. UNITED STATES, FL: Dade Co., Miami Springs, 3 January 1972, G. R.

Searls, 9, USNM. | :

Paratypes examined. UNITED STATES, FL: Sarasota, McPhail trap, C. K. Hickman,

13 March 1972, 34, USNM; Bradenton, Steiner trap, D. C. Chancey, 10 September 1965,

2, USNM; 29 July 1966, 2, USNM; Volusia Co., S. Dayton, McPhail trap, J. N. Pott, 18

October 1966, 3, 22, USNM; 5 October 1965, 2, USNM; 10 March 1972, 2, USNM; 14

May 1965, 3, USNM; grapefruit tree, 29 October 1971, 9, USNM; 12 October 1972, 9,

USNM; 10 March 1972, 29, USNM; Allendale, McPhail trap, 3 November 1966, 2°, USNM;

Volusia Co., Harbour Oakes, McPhail trap, J. N. Pott, 28 October 1966, 29, USNM; 3

November 1966, 2, USNM; Dade Co., Miami Springs, G. R. Searls, 3 January 1972, 39,

MAP 4. Map of Florida showing distribution of Sobarocephala cruciger Sabrosky &

Steyskal.

78

Revision of North American Sobarocephala JESO Volume 138, 2007

USNM; 22 October 1971, 9, USNM; C. F. Dawling Jr., McPhail trap, 20 February 1968, 2,

USNM; Pinellas Co., High Point, McPhail trap, grapefruit tree, K. Hickman, 17 November

1971, 2, USNM; Sarasota Co., Osprey, McPhail trap, S. V. Hiatt, 24 October 1966, °,

USNM; Hillsborough Co., Tampa, McPhail trap, T. J. Flavoroso, 1 August 1968, 9°,

USNM; 9 October 1967, 2, USNM; 20 October 1969, 29, USNM; Manatee Co., Palmetto,

McPhail trap, 23 September 1966, C. J. Bickner, 9, USNM; J. R. McFarlin, McPhail trap, 8

August 1971, 22, USNM; McFarlin & Bickner, 9 March 1972, 29, USNM.

Additional material examined. UNITED STATES, FL: Gainesville, Doyle Conner

Bldg., Malaise trap, 23 September 1973, H. V. Weems Jr., 9, USNM; Alachua Co., Pierce’s

Homestead, Malaise trap, W. H. Pierce, 13 October 1973, 2, USNM.

Sobarocephala dreisbachi Sabrosky & Steyskal, 1974 (Figs. 14, 54-56, Map 5)

Sobarocephala dreisbachi Sabrosky & Steyskal, 1974: 382.

Redescription (Fig. 14)

Male. Body length 3.3 mm. Bristles brown to dark brown. Two dorsocentral

bristles with one minute bristle in front of anterior dorsocentral. Acrostichal bristle absent.

Two pairs of well-developed lateral scutellar bristles. Arista sparsely plumose. Sides of

frons parallel. Scutum yellow, with notopleuron brown to light brown and postsutural

stripes brown (broadly connected at base). Scutellum and laterotergites beside scutellum

brown (sometimes also with large spot below scutellum). Pleuron and legs light yellowish-

white with fore tarsi brown and anepisternum sometimes yellow. Head yellow with orange

tint (sometimes darker laterally), with ocellar tubercle brown and gena light yellow and

pilose. Abdomen yellow. M.,,, ratio 4.8. Wing lightly clouded around distal half of R,,..

Cell bm open. Face flat.

Female. Similar to male except tergites 3-6 and posterior margin of tergite 2

brown; posterior corners of tergite 5 yellow. Females from Québec with notopleuron yellow

or light brown and fore tibia brown (tip lighter).

Male terminalia. (Figs. 54—56) Fifth sternite with posteromedial comb. Sclerites

of annulus well-developed. Epandrium slightly wider than high; length approximately 3/5

width. Surstylus as high as epandrium, with outline subtriangular and broadly rounded;

tubercle-like bristles absent. Cerci sunken below distal margin of epandrium, and all

bristles short. Hypandrial arm atrophied; ventral lobe with one minute distal and two long

medial bristles. Phallapodeme carinate and atrophied distally. Postgonite small. Pregonite

membranous with one distal setula. Basiphallus well-developed. Epiphallus long, thin, and

strongly projecting from basiphallus. Distiphallus 2/5 length of phallapodeme; thumb of

lateral lobe short and truncate.

Distribution. Canada: ON, PQ. United States: MI, NC, TN, TX (Map 5).

Holotype. UNITED STATES, MI: Ogemaw Co., 1-2 August 1959, R. R. Dreisbach, °,

USNM.

79

Lonsdale and Marshall JESO Volume 138, 2007

Paratypes. CANADA, ON: Ottawa, 26 July 1959, J. R. Vockeroth, ¢, CNCI. UNITED

STATES, NC: Macon Co., Wayah Gap, 3500 ft, 10 August 1957, J. G. Chillcott, 4,

CNCI.

Additional material examined. CANADA, ON: Algoma Dist., Hilton Twp., Hilton Beach,

Malaise trap at edge of field and hardwood forest, 20 August 1992, J. E. Swann, 2, DEBU;

Bruce Co., Inverhuron P. P., back dunes, 44°17°50”N, 81°35’27”W, 20 July—20 August

2003, Malaise, S. A. Marshall, 9, DEBU. PQ: Duncan Lk., nr. Rupert, J. F. McAlpine,

6 August 1970, 9, CNCI; 21 July 1971, 2, CNCI; 16 July 1971, 29, CNCI; 27 July 1971,

2, CNCI. UNITED STATES, TN: Union Co., 9 mi SE La Folette, 9 June 1973, A. O.

Lavallee, 9, EMUS. TX: Jasper Co., Bouton Lake Rec. Area, Angelina Nat’! Forest 11

miles SE of Zavaila, off Texas Hwy 63, 15 May 1993, I. Yarom, 4, TAUI.

Comments. The genitalia of Sobarocephala dreisbachi are similar to those of S. setipes

and S. lachnosternum, in that there is a comb of bristles on the fifth sternite and the cerci are

sunken, but the surstylus is much longer.

MAP 5. Distribution of Sobarocephala dreisbachi Sabrosky & Steyskal.

80

Revision of North American Sobarocephala JESO Volume 138, 2007

Sobarocephala flava Melander & Argo, 1924 (Figs. 8, 33-35, Map 6)

Sobarocephala flava Melander & Argo, 1924: 40. Sabrosky & Steyskal, 1974: 383.

Sobarocephala populi Steyskal, 1951: 129.

Redescription (Fig. 8)

Male. Body length 2.8-5.3 mm. Bristles dark brown to black. Two dorsocentral

bristles plus one minute bristle in front of anterior dorsocentral. Acrostichal bristle present.

Lateral scutellar bristles weak to well-developed. Arista sparsely plumose. Sides of

frons parallel. Notum yellow with notopleuron light brown to brown and lateral margin

of scutum behind notopleuron sometimes brown. Pleuron, coxae, tibiae, and basal 1/3

of femora white, with fore tarsi light brown or yellow and anepisternum sometimes light

yellow. Head yellow with ocellar tubercle brown and sclerites below antenna white; gena

pilose. Abdomen yellow. M,,, ratio 4.0. Wing dusky along R,,, and costa (more so on

distal 4); occasionally clear. Cell bm open. Face flat.

Female. Similar to male except as follows: notopleuron rarely yellow (yellow in

holotype); face, parafacial, and gena sometimes light yellow to white; first flagellomere with

light infuscation along anterior margin; tergites 6-7 brown (tergite 7 usually only pigmented

anterolaterally); specimens from Mississippi with tergites 2-5 (sometimes also tergites 7

and 8) brown laterally; female from Texas mostly yellow, with notopleuron light brown, and

tergites 6 and 7 dark brown anteriorly and laterally. Female from Rondeau Provincial Park

(Ontario) with entire lateral margin of scutum and scutellum dark brown.

Male terminalia. (Figs. 33—35) Externally similar to S. atricornis (Figs. 30, 31)

except apex of surstylus slightly broader. Internally similar to S. atricornis (Fig. 32) except

as follows: pregonite clavate with five bristles along length; only two hypandrial bristles

usually present; lateral lobe strongly bent medially with thumb short, pointed, and projecting

at 90°.

Distribution. Canada: ON. United States: FL, GA, IL, IN, LA, MD, MI, MO, MS, NC,

NY, PA, TX, UT, VA (Map 6).

Holotype. UNITED STATES, VA: Fairfax Co., Dead Run, ISS 15 April [year unknown],

2, USNM.

Paratypes examined. UNITED STATES, LA: Opelousas, April 1917, 2, USNM. MI:

Plummer Isl., 29 June 1913, 9, USNM. VA: Dead Run, R. C. Shannon, 15 July 1915, 39,

USNM; ex. Maple log, 13 March 1915, ISS 19 April 1915, 2, USNM; 11 July 1915, 9,

USNM; Falls Church, N. Banks, June 1920, 2, USNM; 4 July 1913, F. Knab, 29, USNM.

Additional material examined. CANADA, ON: 7 mi E Griffith, 1 July 1990, B. E.

Cooper, 22, CNCI; Hamilton, 13-19 July 1980, Malaise trap, M. Sandborne, 22, DEBU;

Burlington, Royal Bot. Gardens, 16 July 1997, K. N. Barber, sweeps, trail-side Poa, Agrostis,

Phleum, Festuca, Juncus, 43°17.5’N, 79°52.4’W, 2°, DEBU; Burlington, Bronte Crk. Prov.

Pk., 17-20 August 1983, Brown & Marshall, Malaise trap, 9, DEBU; Dundas, May 1980, E.

A. Menard, reared, larva in dead Elm, 2, DEBU; Algonquin Prov. Pk., Swan Lk. Res. Sta.,

81

Lonsdale and Marshall JESO Volume 138, 2007

reared from rothole in dead Maple tree, emerged 30 May 1995, D. C. Caloren, 9, DEBU;

Five Points, 29-30 July 1983, J. G. Thompson, 2, DEBU; Fergus (yard), 9 August 1985, S.

A. Marshall, floodplain, Malaise trap, 2, DEBU; Fergus, Malaise trap, S. A. Marshall 8-14

June 1982, 2°, DEBU; 16 July 1990, 29, DEBU; Port Credit, 15 July 1918, M. C. Van Duzee,

2, CASC; Bells Corners, E. C. Becker, 31. May 1954, reared from under Beech, 2, USNM;

21 June 1954, reared ex. puparia on rotten log, ¢, USNM; Bells Corners, reared ex. puparia

on rotten log, 21 June 1954, E. C. Becker, 54, 62, CNCI; Ottawa, J. R. Vockeroth, damp

second-growth Acer-Betula wood, 4 July 1991, 32, CNCI; 2 July 1992, 22, CNCI; 11 July

1989, 2°, CNCI; 13 August 1991, 22, CNCI; 6 July 1991, 29, CNCI; 28 July 1991, 29, CNCI;

9 August 1992, 9, CNCI; McDonald Isl., St. Lawrence Isl. N. P., A. Carter, Malaise trap,

19 July 1976, 2, CNCI; 20 July 1976, 2, CNCI; 5 August 1976, 29, CNCI; Metcalfe, B.

E. Cooper, 24 July 1984, 22, CNCI; 22 July 1984, 2, CNCI; 4 August 1984, 2°, CNCI; 1

August 1984, 9, CNCI; Essex Co., Point Pelee, 18 July 1978, J. M. Cumming, 2, DEBU;

Windsor, Ojibway Prairie, S. Paiero unburnt forest, yellow pans, 3-6 July 2001, 2, DEBU;

31 July—3 August 2001, 29, DEBU; burnt savannah, yellow pans, 25-29 June 2001, 9,

DEBU; Kent Co., Rondeau P. P., Spicebush Trail, 42°18°09"N, 81°51°06”W, Carolinian

forest, Malaise, 16-29 July 2003, S. A. Marshall, 22, DEBU. UNITED STATES, FL:

Gainesville, Pine Hill Estates, 4 October 1973, H. V. Weems Jr., Malaise trap, 9, USNM.

GA: Forsyth, 2 June 1970, 22, CNCI. IL: Champaign Co., Brownfield Woods, 2 mi

NE Urbana, 29 June 1976, C. T. Maier, 2, EMUS; Mason Co., Sandridge St. Forest, 4 mi

NW Forrest City, 23 June 1976, C. T. Maier, 9, EMUS; Tazewell Co., 3 mi N Macking

along Panther Cr., Webb & Marlin, 10 June 1969, 4¢, EMUS; Carlinville, 9 May 1952, M.

R. Wheeler, 4, AMNH. IN: La Fayette, 8 July 1916, ¢, USNM; July 1912, ¢, USNM; J.

M. Aldrich, 3 July 1915, 9, USNM; August 1914, ¢, USNM; July 1921, ¢, USNM. MD:

Plummers Isl., 11 July 1915, R. C. Shannon, 2, USNM; Colesville, W. W. Wirth, 11 July

1974, 42, USNM; 4 July 1976, 2, USNM; 18 June 1977, 22, USNM; 14 June 1977, 9,

USNM; 28 July 1976, 2, USNM; Montg’y Co., Colesville, W. W. Wirth, Malaise trap, 30

June 1977, ¢, USNM; 26 June 1977, 4,22, USNM; Montg’y Co., Dickerson, G. A. Foster,

14 July 1974, 24, USNM; Montg’y Co., Rockville, W. W. Wirth, Malaise trap, 4 September

1977, 2, USNM; 3 August 1979, ¢, USNM; 26 July 1979, 9, USNM; Montg’y Co., Chevy

Chase “woodend”, 3 August 1974, G. F. Hevel, 2, USNM; Prince Georges Co., Patuxent

Wildlife Res. Centre, W. W. Wirth, 8 July 1978, 2, USNM; J. F. Reinert 31 July 1977, ,

USNM;; Glen Echo, J. R. Malloch, 23 July 1921, 9, USNM; Laurel, 11 June 1965, marsh

edge, 32, CNCI; Prince George Co., Beltsville, 15 July 1979, A. Freidberg, 9, TAUI. MI:

Grosse Ile, 30 June 1949, G. Steyskal, 9, USNM; Berrien Co., St. Joseph, D. D. Wilder, 14

July 1971, 2, USNM; Monroe Co., 20 July 1965, J. Truchan, ex. Malaise trap, ¢, USNM;

Wayne Co., Grosse Isle, G. C. Steyskal, 1 July 1949, 9, USNM; 14 June 1949, 2, USNM;

4 June 1962, 29, USNM; 4 August 1956, 22, USNM; 3 August 1951, 22, USNM; 7 August

1951, 29, USNM; 8 August 1956, 2, USNM; 22 June 1949, 29, USNM; 24 July 1951, 69,

USNM. MO: Columbia, Malaise trap, 24 June 1967, 4pm—7am, F. D. Parker, 2, USNM.

MS: Forrest Co., 6 mi W Wiggins, Sweet Bay Bog, dung trap, 5-8 May 1994, sphagnum,

S. A. Marshall, 32, DEBU. NC: Columbus Co., Lk. Waccamaw, 6 July 1985, W. Stein

& A. Gerberich, blacklight in Oak & Pine scrub sand barriers nr lake, 9, USNM; Bladen

Co., Singletary Lk. St. Pk., 34°35’0N, 78°27°30W, Malaise, 19-22 May 2003, Marshall

& Paiero, 2, DEBU: Wake Co., 7 air mi SW of Raleigh off rd., 1 September 1985, C. S.

82

Revision of North American Sobarocephala JESO Volume 138, 2007

MAP 6. Distribution of Sobarocephala flava Melander & Argo.

Parron, Malaise trap, 29, NCSU; Raleigh, late July, F. Sherman, 2, NCSU. NY: Brainard,

Rensselaer Co., 11-22 July 1966, P. & B. Wygosinsky, 9, AMNH. PA: State College,

Centre Co., 4 July 1972, D. J. Shetlar, 9, CASC. TX: Kerrville, 23 April 1959, Becker

& Howden, 2, CNCI. UT: Garden City, 15 July 1951, F. C. Harmaton, 9, USNM. VA:

Alexandria, 24 June 1951, W. W. Wirth, 3, USNM; St. Falls, 9 July 1926, A. L. Melander,

2, USNM; Falls Church, Holmes Run, 6 August 1960, light trap, 4, USNM; Dead Run, 28

July 1915, 2, USNM; 29 June 1915, 9, USNM; R. C. Shannon, 15 July 1915, 29, USNM;

28 July 1915, 2, USNM; Scott Run, July 1954, M. R. Wheeler 3, 2, USNM:; Marina

National Airport, 28 August 1994, A. Freidberg, 2, TAUI.

Comments. Sobarocephala flava is a commonly collected species throughout much of

eastern North America; specimens have also been collected in central Texas and Utah.

Sobarocephala flaviseta (Johnson, 1913) (Figs. 3, 18—20; Map 7)

Heteromeringia flaviseta Johnson, 1913: 99.

Heteromeringia convergens Malloch, 1922: 50.

Sobarocephala flaviseta, Sabrosky & Steyskal 1974: 380.

Redescription (Fig. 3)

Male. Body length 3.0-5.0 mm. Bristles brown. Two dorsocentral bristles plus

one minute bristle in front of anterior dorsocentral. Acrostichal bristle present. Two pairs of

83

Lonsdale and Marshall JESO Volume 138, 2007

well-developed lateral scutellar bristles. Arista sparsely plumose. Sides of frons converging

posteriorly. Scutum yellow with postpronotum and notopleuron white (at least centrally).

Pleuron light yellow. Legs light yellow with coxae and base of femora white. Head yellow

to white, with ocellar tubercle brown, and with parafacial, gena, sides of face, and scape

white. Abdomen yellow. M__,, ratio 3.1-3.3. Wing clear (sometimes clouded distally in

first radial cell). Cell bm closed. Face, parafacial, and anterior margin of frons uniformly

bulging.

Female. As described for male except as follows: tergite 3 with faded central

stripe; tergites 4 and 5 light brown with anterior-lateral corners widely yellow; abdominal

pattern sometimes reduced to central stripe on tergite 5. Cercus light brown.

Male terminalia (Figs. 18—20). Sternite 5 evenly setose. Sclerites of annulus well-

developed. Epandrium as wide as high and length 3/4 height. Surstylus short, acute, and

curved inwards; tubercle-like bristles distal only. Cerci projecting and slightly emarginate

with one pair of slightly longer central bristles. Hypandrial arm stout and projecting at 90°;

ventral lobe thin, slightly longer than arm, and with one minute and two long distal bristles.

Phallapodeme well-developed and slightly sinuate. Pregonite narrow basally, wide distally

and with five apical bristles. Postgonite absent. Distiphallus % length of phallapodeme and

curved at base; lateral lobe wide, truncate, minutely serrate, and with long thumb.

MAP 7. Distribution of Sobarocephala flaviseta (Johnson).

84

Revision of North American Sobarocephala JESO Volume 138, 2007

Distribution. NB, ON, PQ and eastern U.S. to BC, AB, ID, CO, and TX (Map 7).

Holotype. UNITED STATES, NJ: New Brunswick, 28 May, J. B. Smith, 2, MCZC.

Paratypes examined. UNITED STATES, IN: Lafayette, July 1927, 9, USNM. VA:

Chainbridge, 20 August 22, J. R. Malloch, 9, USNM. NJ: same collection as holotype, °,

MCZC.

Additional material examined. 192, 1982 [AMNH, CNCI, DEBU, TAMU, TAUI,

USNM].

Comments. Sobarocephala latifrons and S. flaviseta are two of the most commonly

encountered Sobarocephaila in northeastern North America, although neither is as frequently

collected as species of Clusia or Clusiodes. Sobarocephala flaviseta is common in eastern

North America, and it has been occasionally collected in Texas and the northwest (Sabrosky

and Steyskal 1974). ;

The apparent female-biased sex ratio of over 10:1 is unusual, although females of

other species are generally more often collected than males. We suspect that this apparent

female-biased sex ratio is a collecting artifact, and is more likely to reflect the clumping of

males at mating sites than a population-level ratio. Too few reared specimens are available

to assess actual sex ratios of any clusiid species.

Sobarocephala interrupta Sabrosky & Steyskal, 1974 (Figs. 13, 51-53; Map 8)

Sobarocephala interrupta Sabrosky & Steyskal, 1974: 384.

Redescription (Fig. 13)

Male. Body length 4.5 mm. Bristles light brown. Two dorsocentral bristles.

Acrostichal bristle present. Arista sparsely plumose. Anterior lateral scutellar bristle minute

or absent. Sides of frons parallel. Notum yellow, with notopleuron brown, scutum with

one pair of basal spots (often serrate), and lateral margin of scutellum brown. Pleuron and

legs light yellow with fore tarsi brown; Mississippi specimens with pleuron and basal half

of femora white. Head yellow, with gena and parafacial dirty white to white, ventral margin

of face sometimes orange, and ocellar tubercle brown; gena pilose. Abdomen yellow with

tergites 2-5 brown (excluding anterior corners). M,_, ratio 3.6-5.5. Wing clear. Cell bm

open.

Female. Similar to male except tergites 3 and 4 brown and tergite 6 with posterior

margin light brown centrally. Scutellum entirely yellow in South Carolina paratype.

Male terminalia. (Figs. 51-53) Sternite 5 evenly setose. Sclerites of annulus

well-developed. Epandrium as high as wide and length half height. Surstylus bifid with

anterior lobe well bristled and posterior lobe sparsely setose with small conical tubercle-

like bristles; lobes subequal in length. Cerci concave medially, flush with distal margin

of epandrium, and with all bristles short. Hypandrial arm very short; ventral lobe with

one minute distal and two long medial bristles. Phallapodeme thinned medially, wide and

85

Lonsdale and Marshall JESO Volume 138, 2007

truncate distally, and not extending past dorsal margin of hypandrium. Pregonite large and

circular with four medial bristles. Postgonite thin and flat with four bristles. Basiphallus

well-developed. Epiphallus small and well-sclerotized. Distiphallus nearly half length of

phallapodeme; lateral lobe small and finger-like with thumb absent.

Distribution. United States: FL, GA, IL, LA, MS, SC, TX (Map 8).

Holotype. UNITED STATES, FL: Orange Co., Rock Springs, 21 April 1970, W. W.

Wirth, 7, USNM.

Allotype. UNITED STATES, FL: Alachua Co., Chantilly Acres, 25 April 1970, W. W.

Wirth, Malaise trap, 9, USNM.

Paratypes examined. UNITED STATES, LA: Kilbourne, 3 May 1959, W. W. Wirth, °,

USNM. SC: Greenwood, Long Cane Lake, 21 July 1957, W. R. Richards, 9, CNCI.

Additional material examined. UNITED STATES, FL: Gainesville, Doyle Conner

Bldg., H. V. Weems Jr., Malaise trap, 16 October 1973, 2, USNM; 8-9 September 1973,

2, USNM; Highlands Hammock St. Pk., H. V. Weems Jr., 15 July 1956, 9, USNM. GA:

MAP 8. Distribution of Sobarocephala interrupta Sabrosky & Steyskal (dot) and S. texensis

Sabrosky & Steyskal (circle).

86

Revision of North American Sobarocephala JESO Volume 138, 2007

Liberty Co., St. Catherine’s Isl., 18-21 September 1972, F.C. & B. J. Thompson, 3, AMNH.

IL: Champaign Co., Brownfield Woods, 2 mi NE Urbana, 29 June 1976, C. T. Maier, 9,

EMUS. MS: Forrest Co., 6 mi W Wiggins, Sweet Bay Bog, 5-8 May 1994, sphagnum,

dung trap, S. A. Marshall, ¢ 32, DEBU. SC: Georgetown Co., Hobcaw Barony, Belle

Baruch Marine Field Lab, on slime mold, May 2004, S. A. Marshall, 9, DEBU [in alcohol].

TX: Montg. Co., Jones St. Forest, 8 mi S Conroe, 28 June—13 July 1987, Wharton, Steck,

Carroll, ¢, TAMU; 1-7 June 1987, Wang, Wharton, Praetorius, Malaise trap, 2, TAMU.

Comments. The medially yellow scutellum, characteristic notal stripes, and bifid surstylus

most readily diagnose Sobarocephala interrupta.

Sobarocephala lachnosternum Melander & Argo, 1924 (Figs. 16, 62-64; Map 9)

Sobarocephala lachnosternum Melander & Argo, 1924: 42. Sabrosky & Steyskal, 1974:

382. .

Redescription (Fig. 16)

Male. Body length 3.9-4.9 mm. Bristles dark brown. Two dorsocentral bristles

plus one minute bristle in front of anterior dorsocentral. Acrostichal bristle present. Two

pairs of well-developed lateral scutellar bristles. Arista sparsely plumose. Sides of frons

parallel. Scutum yellow with notopleuron dark brown (notopleuron sometimes faded,

often in newly emerged adults). Scutellum and laterotergites yellow, although anatergite

sometimes with one pair of light brown stripes lateral to scutellum. Pleuron light yellow

to white excluding yellow anepisternum and katepisternum. Coxae white. Legs yellow

with fore tarsi brown. Head yellow with parafacial and occiput white, gena white and

silvery tomentose, ocellar tubercle brown, and anterior margin of frons with dirty yellow

tint continuing onto dorsal margin of face. Abdomen light yellow, occasionally with light

brown to brown bands on posterior margin of tergites 3-5 (faded medially). M,,, ratio 3.1-

3.5. Wing clear. Cell bm open. Face flat.

Female. Similar to male except as follows: posterior margin of tergite 2 sometimes

brown; tergites 3 and 4 brown with anterior corners yellow; tergite 5 brown centrally and

on posterior margin (sometimes reduced to light posterior spot); tergite 6 dark brown;

remainder of abdomen yellow; pedicel brown in one female (Maryland).

Male terminalia. (Figs. 62—64) Sternite five with comb of bristles on posteromedial

margin. Sclerites of annulus well-developed. Epandrium large and barrel-shaped (as wide

and high as pre-genitalic abdominal segments). Surstylus small and broadly rounded;

tubercle-like bristles absent. Cerci small, rounded, slightly projecting, and with all bristles

short. Ventral lobe of hypandrium elongate and poorly-defined with three minute bristles.

Phallapodeme elongate and well-developed. Basiphallus well-developed. Epiphallus small.

Postgonite large and ovate with several minute setulae. Pregonite absent. Distiphallus very

short and curved; lateral lobe ovate.

Distribution. Canada: ON, PQ, SK. United States: IL, IN, KS, MD, MI, NC, TX, UT, VA

(Map 9).

87

Lonsdale and Marshall JESO Volume 138, 2007

Holotype. UNITED STATES, VA: Rosslyn, R. C. Shannon, found larva 25 November

1912, 3, USNM.

Paratypes. UNITED STATES, VA: Rosslyn, R. C. Shannon, found larva 25 November

1912, ISS 10 January 1913, 4, USNM; bred specimen coll. 25 November 1912, ISS 26

January 1913, °, USNM; bred specimen coll. 25 November 1912, ISS 24 January 1913,

, USNM; ex. rotten log, 2 May 1913, ISS 20 May 1913, 9, USNM; ex. rotten log, 2 May

1913, ISS 17 May 1913, 4, USNM.

Additional material examined. CANADA, ON: Fergus, 10 July 1990, Malaise trap, S. A.

Marshall, ‘°°, DEBU; Guelph, 21 July 1978, W. Ralley, °, DEBU; Dundas, 29 June 1981,

J. Kircher, °, DEBU; Algonquin Prov. Pk., Swan Lk. Survey, 45°29°15”"N, 78°43°20°W,

Malaise trap, hemlock/hardwood, 16-28 July 1993, Larson, Marshall & Barr, ‘°, DEBU;

Shakwa Lk., Oulette Twp., 21 July 1996, A. Applejohn, °°, DEBU; Hamilton, 19-28 August

1980, M. Sandborne, Malaise trap, ‘°°, DEBU; Elgin Co., Springwater Cons. Area, 24 June

1996, D. C. Caloren, °, DEBU; Bruce Co., Dunk’s Bay, Malaise trap, S. A. Marshall,

17 July-18 August 1996, 9°, DEBU; Icewater Crk., 12.7 km NNE Searchmont, mil0.5

Whitmore Dam Rd., 24 June 1986, K. N. Barber, mixed forest, ¢, DEBU; [Nippising]

Hwy#1l7, 7 km W Mattawa, 12 June—2 July 2004, opaque mini sticky traps, mixed forest,

46°17.3°N, 78°49.0°W, K. N. Barber, YY, DEBU; Windsor, Malaise trap, S. A. Marshall,

7-16 August 1982, Y°, DEBU; Sault Ste. Marie, Bristol Pl. Pk., 2 July 2001, K. N. Barber,

sweeps, mostly sedges, 46°30.8’°N, 84°16.6°W, 2°, DEBU; 40 km SSW White River, K.

N. Barber, boreal mixedwood, Malaise trap, 48°14.08’N, 85°22.02’W, 7-22 July 2003, °,

DEBU; multi-colour sticky trap, 48°14.05’N, 85°21.97’W, 10-23 July 2003, 4,39, DEBU;

16-26 June 2003, 4, DEBU; 48°14.14°N, 85°22.02’W, 26 June—10 July 2003, 7, 6%,

DEBU; Ottawa, 24 July 1972, J. R. Vockeroth, damp secondary growth Acer-Betula wood,

©, CNCI; Innisville, 12 July 1963, W. R. M. Mason, Y°, CNCI; 7 mi E Griffith, 5 July 1990,

B. E. Cooper , 2, CNCI. PQ: Gatineau, King Mtn., S. A. Marshall; 23 August 1977, ¢,

DEBU; Kirk’s Ferry, 23 August 1924, G. S. Walley, 4, CNCI; Duncan Lk. Nr. Rupert, J. F.

McAlpine, 20 July 1969, 2, CNCI; 28 July 1971, 2, CNCI; 24 July 1971, 9, CNCI. SK:

Beaver Crk. Cons. Area, ~13 km S Saskatoon, 12 July 1999, K. N. Barber, sweeps, mostly

grasses under Betula/Populus, 51°58.6°N, 106°43’W, 3°, DEBU. UNITED STATES, IL:

Tazewell Co., 3 mi N Mackinaw along Panther Crk., Webb & Marlin, 10 June 1969, 2,

EMUS. IN: Posey Co., Harmonie St. Pk., 24-26 June 1998, Wharton et al., ‘°°, DEBU.

KS: Pottawatomie Co., 12 mi W Wamego, 24 July 1966, G. F. Hevel, 9, USNM. MD:

Montg’y Co., Colesville, W. W. Wirth, Malaise trap, 26 June 1977, , USNM; 15 August

1975, 2, USNM; Colesville, W. W. Wirth, 6 August 1976, 2, USNM; 28 July 1976, 2°,

USNM; Malaise trap, 13 August 1977, °, USNM; Montg’y Co., Bethesda, G. C. Steyskal,

9 August 1972, 29, USNM; Laurel, 11 June 1965, marsh edge, ¢, CNCI. ME: Dryden,

7 July 1959, G. H. Heinrich, 9, CNCI. MI: Wayne Co., Grosse Isle, G. C. Steyskal, 8

August 1956, 2, USNM; 15 June 1949, °, USNM; 4 August 1956, 2, USNM; 23 June

1956, 4, USNM; 19 June 1955, 4, USNM; Monroe Co., 26 July 1956, J. Truchan, ex.

Malaise trap, 3, USNM. NC: Wake Co., 7 air mi SW of Raleigh off rd., 25 July 1985, C.

S. Parron, Malaise trap, 9, NCSU. TX: Salmon, Anderson Co., 6-19 October 1974, H.R.

Burke, 2, TAMU. UT: Utah Co., Provo, Malaise trap, 6-9 July 1985, 4, 9, EMUS; 16-23

88

Revision of North American Sobarocephala JESO Volume 138, 2007

et ogi te asm ee

'

i

' !

i

!

i

awe

oo

MAP 9. Distribution of Sobarocephala lachnosternum Melander & Argo.

July 1985, 22, EMUS; 20-27 July 1985, 9, EMUS; 7-14 August 1985, 32, EMUS; 14-21

August 1985, 9, EMUS; 6-16 July 1985, 32, EMUS; 18-26 June 1985, 4, 149, EMUS; 25

June—6 July 1985, 112, EMUS. VA: Warsaw, 26 July 1952, W. W. Wirth, 2, USNM.

Comments. While male Sobarocephala lachnosternum superficially resemble other pale

North American Sobarocephala, they can be readily identified by a large barrel-shaped

epandrium and small surstyli. Females can be identified by their characteristic abdominal

pattern.

See comments for Sobarocephala setipes.

Sobarocephala latifacies Sabrosky & Steyskal, 1974 (Figs. 4, 21—23; Map 10)

Sobarocephala latifacies Sabrosky & Steyskal, 1974: 380.

Redescription (Fig. 4)

Male. Body length 3.0-5.6 mm. Bristles black. Two dorsocentral bristles plus one

minute bristle in front of anterior dorsocentral. Acrostichal bristle present. Two pairs of

well-developed lateral scutellar bristles. Arista short-plumose. Sides of frons converging

posteriorly. Notum predominantly yellow with notopleuron brown to dark brown; scutum

sometimes brown on lateral margin and laterotergites yellow or brown. Pleuron light yellow.

Coxae white. Legs yellow with fore tarsi light brown (at least apically). Head yellow with

gena and parafacial white, face light yellow and ocellar tubercle brown. Abdomen yellow.

89

Lonsdale and Marshall JESO Volume 138, 2007

M, ,, ratio approximately 3.0. Wing clouded in cell R,, around distal 1/5 of R,,., and around

R,,,. Cell bm open. Face, parafacial, and anterior margin of frons uniformly bulging.

Female. Scutum as described for male. Abdomen yellow with tergites 6 and 7

brown and tergites 2-5 with small spot on anteromedial margin (tergites 2-5 sometimes with

light brown medial stripe and light brown border, or only with posterior margins brown).

Male terminalia. (Figs. 21—23) Sternite 5 evenly setose. Sclerites of annulus

well-developed. Epandrium as wide as long and almost as high as wide. Surstylus short,

rounded, thick, and slightly pointed apically; tubercle-like bristles along entire length

of apical and posterior margins, somewhat encroaching upon posterior surface. Cerci

projecting, somewhat emarginate and with one pair of longer central bristles. Hypandrial

arm curved, widest distally, as long as ventral lobe and projecting at 60-70° basally; lobe with

one minute and two long distal bristles. Phallapodeme long and relatively thin. Pregonite

long, tapered at both ends and with five medial bristles. Postgonite minute. Basiphallus

large with epiphallus at tip. Distiphallus approximately 2/3 length of phallapodeme and

bent at midpoint; lateral lobe well-developed, curved, and toothed distally; thumb well-

developed.

Distribution. Canada: NB, ON, PQ. United States: MA, MI, NC, NH, NY, SC, UT

(northeastern North America and Utah) (Map 10).

Holotype. UNITED STATES, MI: Grosse Ile, Wayne Co., 29 August 1948, G. Steyskal,

3, USNM.

Paratypes examined. CANADA, ON: Bells Corners, ex. Rotten log, 21 June 1954, E. C.

Becker, 2, 2, USNM; Bells Corners, 12 June 1954, E. C. Becker, reared ex. puparia on

rotten log, 2¢, 22, CNCI; Burke Falls, 13 July 1926, F. P. Ide, 29, CNCI; nr. Picton, 9 July

1970, J. F. McAlpine, 2, CNCI. PQ: Hull, 10 August 1965, ex. Malaise trap, 2, CNCI;

Laniel, 28 July 1933, 2, CNCI; Duncan Lk. Nr. Rupert, 1 August 1969, J. F. McAlpine, 9,

CNCI. UNITED STATES. White Mts., Morrison, ¢, USNM.

Additional material examined. CANADA, ON: Tenby Bay, Malaise at lake edge, 19 July

1992, 9, DEBU; Hamilton, 10-13 July 1980, Malaise trap, M. Sandborne, 3’, 32, DEBU;

Dundas, E. A. Menard, 27 June 1980, 3, 22, DEBU; 13 June 1980, 4, 9, DEBU; 17 June

1980, d, 2, DEBU; 1 July 1980, 24, DEBU; 23 June 1980, 9, DEBU; 8 July 1980, 3,

DEBU; 15 July 1980, 4, DEBU; reared in dead Elm, May 1980, ¢, DEBU; Dornoch, fen, 20

July 1996, S. A. Marshall, 4, DEBU; Port Franks, Watson property nr. lake, pans, 8-12 July

1996, J. Skevington, 9, DEBU; Sault Ste. Marie, Bristol Pl. Pk., sweeps, mostly /mpatiens,

Clematis, Rubus, grasses, 46°30.8’N, 84°16.6’W, 11 June 1999, K. N. Barber, 2, DEBU;

Fergus, Malaise trap, S. A. Marshall, 5 July 1990, 2, DEBU; 4 August 1990, 2, DEBU;

9 July 1990, 2, DEBU; (yard) flood plain, Malaise trap, 27 June 1985, S. A. Marshall, °,

DEBU; Guelph, K. N. Barber, 11 July 1979, 29, DEBU; 9 July 1979, 2, DEBU; pan traps,

5-18 July 1980, 22, DEBU; Brown & Marshall, University of Guelph Arboretum, Malaise

head, 28 June4 July 1983, 9, DEBU; Arkell, E. A. Innes, 7 May 1979, 2, DEBU; 7 May

1979, (emerged 22 May 1979), 2, DEBU; 8 May 1979 (emerged 22-30 May 1979), 416,

222, DEBU. UNITED STATES, MD: Colesville, W. W. Wirth, 4 July 1976, 2, USNM; 11

90

Revision of North American Sobarocephala JESO Volume 138, 2007

{

: Jos?

: : ;

’ Sas os :

4 \ a y

‘ XS

7A Os

WV

¢,

at

Aine

fi 3S Id

MAP 10. Distribution of Sobarocephala latifacies Sabrosky & Steyskal.

July 1974, 3, USNM; 18 June 1977, 3, USNM; Montgomery Co., Carderock Pk., 13 June

1970, L. V. Knutson, 2, USNM; Prince Georges Co., Patuxent Wildlife Res. Centre, W. W.

Wirth, 14 July 1978, 9, USNM. MI: Wayne Co., Grosse Ile, 30 June 1949, G. Steyskal,

22, USNM. NC: Cumberland Co., Ft. Bragg, 28 May-3 June 1967, J. D. Birchim, 9,

CASC; Wake Co., 7 air mi SW of Raleigh off rd., 30 August 1985, C. S. Parron, Malaise

trap, ¢, NCSU. NY: Rensselaer Co., 11-22 July 1966, P. &.B. Wygodzinsky, 2, AMNH.

SC: Georgetown Co., Hobcaw Barony, Belle Baruch Marine Field Lab, on slime mold,

May 2004, S. A. Marshall, 29, DEBU [in alcohol]. UT: Summit Co., Coalville, 1710 m, 30

July 1973, P. H. Arnaud Jr., 2, CASC.

Comments. The abdominal pattern of the female is characteristic, but the male abdomen is

entirely yellow, similar to that of several other North American species. Males can be best

diagnosed by a frons that narrows posteriorly, an absence of white shoulder patches, and an

open cell bm.

Sobarocephala latifrons (Loew, 1860) (Figs. 10, 48-50; Map 11)

Heteroneura latifrons Loew, 1860: 82.

Heteromeringia latifrons, Johnson, 1913: 99. Malloch, 1918: 8.

Sobarocephala latifrons, Melander & Argo, 1924: 42. Sabrosky & Steyskal, 1974: 381.

91

Lonsdale and Marshall JESO Volume 138, 2007

Redescription (Fig. 10)

Male. Body length 3.3-4.5 mm. Bristles black. Two dorsocentral bristles plus

one minute bristle in front of anterior dorsocentral. Acrostichal bristle present. Small,

weak presutural intra-alar bristle sometimes present. Lateral scutellar bristles weak. Arista

sparsely plumose. Sides of frons parallel. Scutum predominantly yellow with notopleuron

brown and lateral margin behind suture light brown. Scutellum yellow with median brown

stripe (darkest apically and sometimes faded basally). Laterotergites sometimes light brown

lateral to scutellum. Pleuron and legs white with fore tarsi light brown. Head predominantly

yellow, with face light yellow, ocellar spot large and triangular, and mouthparts, parafacial

and gena white; gena pilose. Abdomen light yellow, often light brown on tergite 5 and

laterally on tergites 2-4, and sometimes with small spot at base of epandrium. M.,, ratio

3.8-4.4. Wing clear. Cell bm open. Face flat.

Female. Similar to male except as follows: lateral brown margin on scutum

wider; fore tarsi brown; scutellar stripe and lateral stripes on laterotergites strong and

always present; laterotergites with thin stripe below scutellum; tergites 2-4 brown laterally,

medially, on posterior margin and laterally on anterior margin; tergite 5 sometimes with

wide median stripe (tapering anteriorly); tergite 6 and anterior margin of tergite 7 brown;

wing dusky along anterior margin.

Male terminalia. (Figs. 48-50) Sternite 5 evenly setose. Sclerites of annulus

well-developed. Epandrium as wide as high and length 4/5 height. Surstylus 4/5 height

of epandrium and with rounded emargination from midpoint of posterior margin to apex

MAP 11. Distribution of Sobarocephala latifrons (Loew) (dot), S. wirthi spec. nov. (circle)

and S. pengellyi spec. nov.

92

Revision of North American Sobarocephala JESO Volume 138, 2007

(appearing “hook-like”’); tubercle-like bristles along posterior and apical margins. Cerci

small and rounded with one slightly longer central bristle. Hypandrial lobe with three

short distal bristles. Phallapodeme and postgonite well-developed. Pregonite elongate and

ovate with four basal bristles, and with thin elongate projection on inner-medial surface.

Basiphallus and epiphallus small. Distiphallus 2/3 length of phallapodeme; thumb and

lateral lobe well-developed with lobe half length of distiphallus.

Distribution. Canada: ON, PQ. United States: DC, GA, IL, MA, MD, MI, NC, NJ, NY,

PA, TX, VA, WV (Map 11).

Holotype. UNITED STATES, DC: “Osten Sacken”, 2, location unknown.

Paratype. UNITED STATES, VA: Fairfax Co., Dead Run, 22 June 1915, R. C. Shannon,

3, USNM.

Additional material examined. 1034, 1532 AMNH, [CASC, CNCI, DEBU, EMUS,

TAMU, TAUI, USNM].

Comments. Sobarocephala latifrons is a commonly collected species in northeastern North

America south of Ottawa and east of the Mississippi. Specimens have also been found in

North Carolina, Georgia, and Texas. The only similar species with an overlapping range is

the closely related S. wirthi, which is more southeastern in distribution. Males of these two

species are distinct (see couplet 13), but females are more difficult to separate.

Sobarocephala muesebecki Sabrosky & Steyskal, 1974 (Figs. 7, 36-38; Map 1)

Sobarocephala muesebecki Sabrosky & Steyskal, 1974: 378.

Redescription (Fig. 7)

Male. Body length 2.6-4.1 mm. Bristles brown. Two dorsocentral bristles plus

one minute bristle in front of anterior dorsocentral. Acrostichal bristle absent. Two pairs

of well-developed lateral scutellar bristles. Arista densely plumose. Sides of frons parallel.

Body yellow with fore tibia and tarsi light brown, ocellar spot and infuscation at base of

arista brown, epandrium dark brown, and coxae, gena, parafacial, and anterior (or lateral)

margin of frons usually white; sometimes lateral half of postpronotum brown (Alabama),

or postpronotum and notopleuron brownish (some North Carolina specimens). Occiput

usually pilose. M,_,, ratio 4.0-4.5. Wing lightly clouded along R,,, on distal 1/3. Cell bm

open. Face flat.

Female. Externally similar to male except as follows: fore tibia light brown; hind

tibia and tarsi sometimes browned (Alabama, Florida, North Carolina); tergites 3, 4, and

posterior margin of tergite 2 with central stripe; tergites 5-7 brown; tergite 8 brown or with

anterior half light brown.

Male terminalia. (Figs. 36-38) Similar to S. atricornis (Figs. 33-35), except

surstylus broader at base, tubercle-like bristles densely arranged along surstylus, pregonite

93

Lonsdale and Marshall JESO Volume 138, 2007

widest basally, and lateral lobe strongly bent medially with small swelling at base of thumb;

thumb short, pointed, and projecting at 90°.

Distribution. United States: AL, FL, NC, NJ, PA, TX (Map 1).

Holotype. UNITED STATES, FL: Levy Co., 7 mi NE of Cedar Key, 1 June 1970, D. L.

Bailey, 3, USNM.

Allotype. UNITED STATES, FL: same collection as holotype, 2, USNM.

Paratypes examined. UNITED STATES, FL: Levy Co., 7 mi NE of Cedar Key, | June

1970, D. L. Bailey, 3, USNM; ex. Malaise, 18 May 1970, 2, USNM.

Additional material examined. UNITED STATES, AL: Baldwin Co., Bon Secour

Nat. Wildlife Refuge, 5-7 May 1994, S. A. Marshall, 22, DEBU. FL: Santa Rosa Co.,

Blackwater R. St. Forest, 23 June 1973, W. W. Wirth, 2, USNM; Levy Co., 7 mi NE

Cedar Key, | June 1970, D. L. Bailey, 4, 2, USNM; Cedar Key, ex Malaise trap, 18 May

1970, D. L. Bailey, 9, USNM; Highlands Co., Archbold Biol. Stn., 11 October 1964, P. H.

Arnaud Jr., 42, CASC; 23 April 1967, B. V. Peterson, 2, CNCI. NC: Columbus Co., Lk.

Waccamaw, 6 July 1985, W. Steiner & A. Gerberich, 9, USNM; Cumberland Co., Fort

Bragg, J. D. Birchim, 23-25 August 1967, 2°, CASC; 16 August 1967, 2, CASC; Bladen

Co., Singletary Lk. St. Pk., 34°35’0N, 78°27°30W, Malaise, 19-22 May 2003, Marshall &

Paiero, 62, DEBU. NJ: Oswego Lk., Burlington Co., 30 August 1974, Menke & Miller,

4°, USNM. PA: State College, Centre Co., 4 July 1972, D. J. Shetlar, 9, CASC. TX:

Salmon, Anderson Co., 22 June 1974, H. R. Burke, Malaise trap, 4, TAMU; 1-8 July 1974,

3,22, TAMU; | June 1974, 4,52, TAMU; Anderson Co., 10 mi SW Elkhart, H. R. Burke,

modified Malaise, 5-6 June 1976, 29, TAMU; Brazos Co., College Stn., Wharton, Malaise

trap, 20 September-4 October 1974, 4, TAMU; 22 July—2 August 1974, 49, TAMU; 14-

21 July 1974, 54, 22, TAMU: Montg. Co., Jones St. Forest, 8 mi S Conroe, 28 June—13

July 1987, Wharton, Steck & Carroll, 22, TAMU; 21-27 June 1987, Wharton, Steck &

Carroll, 2, TAMU; 1-7 June 1987, Wang, Wharton & Praetorius, Malaise trap, 2, TAMU;

28 April—13 July 1987, Steck, Wharton & Carroll, 329, TAMU.

Comments. See comments for Sobarocephala affinis.

Sobarocephala pengellyi spec. nov. (Figs. 12, 42-44; Map 11)

Description (Fig. 12)

Male. Body length 2.9-3.8 mm. Bristles brown. Two dorsocentral bristles plus

one minute bristle in front of anterior dorsocentral. Acrostichal bristle present. Two pairs

of well-developed lateral scutellar bristles. Arista sparsely plumose. Sides of frons parallel.

Scutum yellow with lateral margin brownish behind light brown notopleuron; scutellum

with thin light brown central stripe extending onto base of scutum. Pleuron light yellow with

anepisternum and anterior face of katepisternum yellow. Coxae white. Legs light yellow

94

Revision of North American Sobarocephala JESO Volume 138, 2007

with fore tarsi light brown. Head yellow with face light brown centrally, gena and parafacial

white and pilose, occiput white and ocellar tubercle brown. Abdomen predominantly yellow

with wide light brown central stripe on tergites 2-4 (tapering anteriorly on each tergite) and

epandrium brown (lighter on distal half). M,,, ratio 3.0. Wing clear or with light apical

cloud around R,,,. Cell bm open. Face flat.

Female. As described for male except as follows: scutum with one pair of light

brown lateral spots at base; scutellar stripe most pronounced apically (sometimes continuing

onto base of scutum); laterotergite sometimes with light brown stripe lateral to scutellum

and one stripe below; fore tarsi brown; face yellow (sometimes with orange tint); central

stripe on tergites 2-4 brown, thin, and of equal width along length; tergites 5-7 brown and

sternites 6 and 7 brown.

Male terminalia. (Figs. 42-44) Sternite 5 evenly setose. Sclerites of annulus

well-developed. Length, height, and width of epandrium subequal; tapered to base.

Surstylus 7/10 height of epandrium and broadly rounded; tubercle-like bristles along apical

and posterior margins. Cerci small, rounded, and slightly projecting. Hypandrium with arm

and ventral lobe subequal in length, and ventral lobe with two short medial bristles and one

minute distal bristle. Phallapodeme and basiphallus well-developed. Epiphallus minute.

Pregonite large and ovate with five central bristles. Postgonite absent. Distiphallus 7/10

length of phallapodeme; lateral lobe strongly bent, spinulose distally, with broad flat medial

lobe, and with thumb absent.

Distribution. United States: AL, GA (Map 11).

Holotype. UNITED STATES, GA: Forsyth, 2 June 1970, 3, CNCI.

Paratypes. UNITED STATES, AL: Baldwin Co., Raft River Tributary, 16 October 2001,

30.52.261N, 87.56.934W, J. W. McCreadie, 22, DEBU. GA: same collection as holotype,

102, CNCI.

Comments. Sobarocephala pengellyi can be distinguished from congeners by a black

epandrium, one pair of lateral subbasal spots on the female scutum, a light facial spot, a

relatively short surstylus, and a characteristic lateral lobe on the distiphallus.

Etymology. The specific name is a patronym dedicated to the late D. H. Pengelly, a great

entomologist whose spirit lives on in the community of entomologists associated with “his”

insect collection, the University of Guelph Insect Collection.

Sobarocephala quadrimaculata Sos, 1963 (Figs. 1, 27-29; Map 3)

Sobarocephala nitida Sos, 1963: 393.

Sobarocephala quadrimaculata Sos, 1963: 394. Sabrosky & Steyskal, 1974: 374.

Redescription (Fig. 1)

Male. Body length 2.9-4.4 mm. Bristles yellow with lateral scutellar bristles dark

95

Lonsdale and Marshall JESO Volume 138, 2007

brown. Two dorsocentral bristles. Acrostichal bristle absent. Two pairs of well-developed

lateral scutellar bristles. Ocellar bristle absent. Arista densely plumose. Sides of frons

converging posteriorly. Scutum yellow with one pair of short transverse presutural spots

behind postpronotum and one pair of large, quadrate, postsutural spots on lateral margin;

small triangular spot sometimes in front of scutellum. Scutellum and laterotergites dark

brown. Pleuron yellow. Coxae white. Legs yellow with fore tibia and tarsi brown; fore

tibia and basal 2/3 of fore tarsomere 1 yellow in lighter specimens; hind tibia sometimes

light brown. Head yellow with parafacial and (sometimes) gena white, first flagellomere

with brown dorsal stripe, and ocellar tubercle brown. Abdomen yellow with epandrium

and tergites 2 (medially), 3, 4, 5 (medially) and 6 brown. M ,, ratio 4.0-4.2. Wing lightly

clouded in cell R, and around bm-cu, and with dark infuscation distally on R,,, (appearing

“smudged” to R,,.). Cell bm closed. Face convex on dorsal half below antennal bases.

Female. Externally as described for male except tergite 1 with large oval spot and

abdomen past tergite 6 yellow. Female from Alabama with scutellum yellow medially.

Male terminalia. (Figs. 27—29) Sternite 5 evenly setose. Annulus with sternites

6 and 7 reduced to thin but well-sclerotized band ventrally. Epandrium as wide as high

and almost as long as high. Surstylus rectangular; tubercle-like bristles long, curved, and

terminal. Cerci flat with one longer central bristle. Hypandrial arm relatively long and

sharply angled with base projecting at 90° basally; ventral lobe wide, slightly shorter than

arm, and with one minute and two long distal bristles. Phallapodeme well-developed with

head reduced. Pregonite long, thin, and setulose medially and apically. Postgonite small,

rounded, and setulose. Basiphallus small. Epiphallus long and thin. Distiphallus *% length

of phallapodeme and wide distally (appearing “spoon-shaped”’); lateral lobe large, broad,

and serrate distally, with thumb absent.

Distribution. Bahamas, Colombia, Costa Rica, Mexico, Nicaragua, Panama, United States

(AL, FL, GA, TX) (Map 3, in part).

Holotype. UNITED STATES, FL: 2°, USNM.

Additional material examined. COSTA RICA. Guanacaste: 14 km S Canas, F. D.

Parker, 19-28 February 1990, 2, EMUS; 5-10 August 1990, 4, EMUS; 20-30 October

1989, 3, EMUS; 28 July 1991, 4, EMUS; 1-7 April 1991, 3, 52, EMUS; 8-15 February

1991, 24, 32, EMUS; 20-24 March 1989, 2, EMUS; 16-22 February 1990, ¢, 32, EMUS;

1-5 August 1992, 9, EMUS; 19-28 February 1990, ¢, 22, EMUS; 1-15 July 1991, d,

EMUS; 16-26 January 1990, ¢, EMUS; 24-31 May 1990, 2¢, EMUS; 23-28 February

1990, 73, EMUS; 5-11 January 1991, ¢, EMUS; 1-10 July 1991, 2, EMUS; 2-4 June

1991, 29, EMUS; 9-14 February 1989, 2, EMUS; 3 km SE R. Naranjo, F. D. Parker, 15-25

January 1993, 9, EMUS; 21 July 1993, 2, EMUS; 11-20 December 1992, 2, EMUS; S

Canas, F. D. Parker, 7-10 March 1989, 9, EMUS; 28 July 1991, 2, EMUS; 21-25 January

1989, 22, EMUS; 9-14 February 1989, 3, EMUS; Santa Cruz, P. N. Marino Las Baulas, 0

m, 14 December 2000, Malaise, Y. Cardenas, 2, INBC. Heredia: LaSelva Res. Sta., 11-17

June 1986, W. Hanson & G. Bohart, ¢, EMUS. Limon: Cuatro Esquinas, P. N. Tortuguero,

0 m, September 1989, J. Solano, 2, INBC. Puntarenas: Pen. De Osa, Puerto Jimenez,

10 m, P. Hanson, January 1991, 2, DEBU; May 1991, ¢, DEBU; November 1991, 9,

96

Revision of North American Sobarocephala JESO Volume 138, 2007

DEBU; May 1992, 4, DEBU; 5 km N Puerto Jimenez, 10 m, May 1991, P. Hanson, 4, 29,

DEBU; Malaise trap, June-July 1990, 9, USNM. COLOMBIA. Tol. Armero, Malaise

trap, 30 January—5 February 1977, E. L. Peyton, 2, USNM. HONDURAS. Roatin Isl.,

27 February 1979, G. E. Bohart, 9, EMUS, Roatin Isl (west), 1 January 1980, 29, EMUS.

MEXICO. Jalisco: Puerto Vallarta, 1 January 1971, sea level, P. H. & N. Arnaud, 9,

EMUS; Puerto Vallarta, G. E. Bohart, 10 December 1988, 29, EMUS; 8 December 1984, 3,

EMUS; Quint. Roo, sweeping, F. Carillo, 10-14 October 1986, 24, EMUS. NICARAGUA.

Puerto Rabezas, July 1971, J. Maldonado, 2, USNM. UNITED STATES, AL: Mobile

Co., Chunchula (site 20), Malaise, 25 October 2004, 30.90N, 88.20W, E. Benton, 2°,

DEBU. FL: Royal Palm Pk., 29 January 1933, A. L. Melander, 9, USNM; Gainesville, 8-

22 December 1986, hardwood forest, Malaise trap, W. Mason, 3, 9, CNCI. GA: Georgia:

Liberty Co., St. Catherine’s Island, 18-21 September 1972, F. C. & B. J. Thompson, &,

AMNH. TX: Austin, 28 October 1951, M. R. Wheeler, 2, AMNH.

Comments. Sobarocephala quadrimaculata is a relatively common species from Florida

and Mexico to Colombia. .

Sobarocephala setipes Melander & Argo, 1924 (Figs. 15, 59-61; Map 12)

Sobarocephala setipes Melander & Argo, 1924: 47. Sabrosky & Steyskal, 1974: 384.

Redescription (Fig. 15)

Male. Body length 2.4-2.9 mm. Bristles light brown. Two dorsocentral bristles

plus one minute bristle in front of anterior dorsocentral. Acrostichal bristle absent. Two pairs

of well-developed lateral scutellar bristles. Arista sparsely plumose. Sides of frons parallel.

Scutum yellow with posterior corner of notopleuron and (often) one pair of wide basal

stripes brown. Scutellum yellow (sometimes with brownish central tint). Laterotergites

brown lateral to scutellum; yellow in specimens from Florida and holotype with posterior

notal stripes also absent. Pleuron yellow, with meron and posterior half of katepisternum

white. Legs yellow, with coxae and basal half of femora white and fore tarsi light brown

to brown. Head predominantly yellow, with gena, parafacial, and occiput white and pilose,

ocellar tubercle brown, and light infuscation sometimes around base of arista. Abdomen

yellow with wide stripe on tergites 2-5 (also tergite 6 in one FL male). M__,, ratio 3.2-3.7.

Wing clear. Cell bm open. Face flat.

Female. Similar to male except as follows: anterior half of notopleuron and

postpronotum sometimes brown; notopleuron with central light brown spot; tergite 6 with

wide central stripe. One female from Florida (CNCI) with distal 2/3 of fore tibia brown,

and several females from Québec with fore tibia light brown. Ontario specimens sometimes

with corners of scutellum brown.

Male terminalia. (Figs. 59-61) Sternite five with comb of bristles on posteromedial

margin. Annulus reduced to thin band ventrally. Epandrium as high as wide and length 3/5

height. Surstylus short and rounded; tubercle-like bristles absent. Cerci small, rounded,

slightly sunken below distal margin of epandrium, and bristles short and subequal in length.

Hypandrial arm short, thin and projecting distally; three minute distal bristles on ventral

il

Lonsdale and Marshall JESO Volume 138, 2007

lobe. Phallapodeme thin and shorter than length of hypandrium. Pregonite clavate with

one distal bristle. Postgonite minute. Basiphallus 1/3 length of phallapodeme. Epiphallus

absent. Distiphallus “4 length of phallapodeme; lateral lobe small and ovate with thumb

absent.

Distribution. Canada: ON. United States: FL, IL, IN, LA, MD, MI, MS (Map 12).

Holotype. UNITED STATES, MD: Marlboro, 19 June 1916, R. C. Shannon, ¢, USNM.

Additional material examined. CANADA, ON: Wellington Co., University of Guelph

Arboretum, ex. dung, 8 August 2004, J. Klymko, ¢, DEBU [in alcohol]; 9 August 2004, O.

Lonsdale, 22, DEBU [in alcohol]; 12 August 2004, O. Lonsdale, 34, 2, DEBU [in alcohol];

19 July 2005, O. Lonsdale, 4, DEBU [in alcohol]; Essex Co., Point Pelee N. P., forested area

by west beach, Malaise trap and pans, 10-21 July 1999, O. Lonsdale, ¢, DEBU; Carleton

Place, 27 July 1959, J. G. Chillcott, 9, CNCI; Ottawa, J. R. Vockeroth, 13 August 1974,

&, CNCI; 28 July 1964, 29, CNCI; damp second-growth Acer-Betula wood, 11 July 1991,

2, CNCI; 16 July 1991, 29, CNCI; 3 August 1992, 29, CNCI; Perth Rd., Rideau Tr., 14 July

1981, H. J. Teskey, 9, CNCI; North Gower, 10 August 1984, D. Bell, 2, CNCI. UNITED

STATES, FL: Gulf Hammock, 23 April 1952, G. Peck, 2, CNCI; Sarasota Co., Myakka

R. St. Pk., 21 May 1973, W. W. Wirth, Malaise trap, 2, USNM; Alachua Co., Pierce’s

homestead, W. H. Pierce, 13 October 1973, Malaise trap, 9, USNM; Alachua Co., Chantilly

Acres, 25 April 1970, W. W. Wirth, Malaise trap, 9, USNM; Gainesville, Doyle Corner

MAP 12. Distribution of Sobarocephala setipes Melander & Argo.

98

Revision of North American Sobarocephala JESO Volume 138, 2007

Bldg., 23 September 1973, H. V. Weems Jr., Malaise trap, 29, USNM. IL: Champaign

Co., Brownfield Woods, 2 mi NE Urbana, 26 June 1976, C. T. Maier, 29, EMUS; Equality,

11 September 1952, M. R. Wheeler, 22, AMNH. IN: La Fayette, 2 July [year not given] ,

2, USNM; La Fayette, J. M. Aldrich, 5 August [year not given], 2, USNM; 31 July [year

not given], 2, USNM; 23 July [year not given], 9, USNM; | August [year not given],

2, USNM. LA: Chicot S. Pk. nr. Ville Platte, September 1954, M. Wheeler, 2, USNM.

MD: Montg’y Co., Dickerson, 14 July 1974, G. A. Foster, 4, 2, USNM: Glen Echo, J. R.

Malloch, 16 July 1922, d, 2, USNM; 9 July 1922, 2, USNM; 2 July 1922, 23, USNM.

MI: Wayne Co., Grosse Isle, 21 July 1957, G. C. Steyskal, 9, USNM; St. Joseph, Berrien

Co., 17 April 1972, D. D. Wilder, ¢, CASC. MS: Forrest Co., 6 mi W Wiggins, Sweet Bay

Bog, dung trap, 5-8 May 1994, sphagnum, S. A. Marshall, 2, DEBU.

Comments. Sobarocephala setipes is largely sympatric with the similar S. Jachnosternum,

but S. lachnosternum occurs west into Saskatchewan, Lake Superior, Texas, and Utah (Map

9), and is not known from the southeastern United States.

Sobarocephala setipes is sometimes attracted to dung, and we have observed

copulating pairs on dung baits in mid August in the University of Guelph Arboretum.

Sobarocephala texensis Sabrosky & Steyskal, 1974 (Figs. 17, 57, 58; Map 8)

Sobarocephala texensis Sabrosky & Steyskal, 1974: 381.

Redescription (Fig. 17)

Male. Body length 2.6 mm. Bristles brown. Two dorsocentral bristles.

Acrostichal bristle absent. Two pairs of well-developed lateral scutellar bristles. Arista

sparsely plumose. Sides of frons parallel. Thorax yellow with narrow light brown spot

from base of scutum to center of scutellum. Legs yellow with fore tibia and tarsi brown.

Head predominantly yellow, with occiput white, gena and parafacial white and silvery

tomentose, first flagellomere with infuscation at base of arista and ocellar tubercle brown.

Abdomen yellow with wide central stripe on tergites 2-5. M_,, ratio 2.8-3.7. Wing lightly

clouded along anterodistal margin. Cell bm open. Face flat.

Female. Externally as described for male.

Male terminalia. (Figs. 57,58) Sternite five with comb of bristles on posteromedial

margin. Sclerites of annulus well-developed. Epandrium as wide as high and length 2/3

height. Surstylus rounded and 2/5 height of epandrium; tubercle-like bristles absent. Cerci

small, rounded, slightly sunken below distal margin of epandrium, and with all bristles short.

Hypandrium with one minute distal and one short and one long medial bristle on ventral

lobe; arm atrophied, distal, and projecting at acute angle to long axis of phallapodeme.

Phallapodeme relatively thin. Pregonite rectangular with one distal bristle. Basiphallus

well-developed. Epiphallus and postgonite small. Distiphallus 2/3 length of phallapodeme

with lateral lobe well-developed.

Distribution. United States: TX (Map 8).

99

Lonsdale and Marshall | JESO Volume 138, 2007

Holotype. UNITED STATES, TX: Rio Frio, Leakey, Real Co., 23 May 1972, W. W.

Wirth, ¢, USNM [not examined].

Allotype. UNITED STATES, TX: same collection as holotype, 9, USNM.

Paratypes examined. UNITED STATES, TX: same collection as holotype, 24, 9°,

USNM. ;

Comments. Sobarocephala texensis differs from the similarly coloured S. setipes (Fig. 15)

in having a yellow thorax with a light median stripe on the scutellum that extends onto the

base of the scutum.

Sobarocephala wirthi spec. nov. (Figs. 11, 45-47; Map 11)

Description (Fig. 11)

Male. Body length 3.3-5.0 mm. Bristles dark brown. Two dorsocentral bristles

plus one minute bristle in front of anterior dorsocentral. Acrostichal bristle present. Lateral

scutellar bristles weak. Arista sparsely plumose. Sides of frons parallel. Notum yellow

with notopleuron and (sometimes) postpronotum brown; supra-alar spot sometimes present

(Georgia) and confluent with notopleural spot. Pleuron, coxae, and femora white, with

yellow spot on anepisternum. Legs yellow (entirely yellow in Georgia specimens) with fore

tarsi brown and fore tibia usually light brown to brown. Scutellum with brown apical spot

(highly reduced in some North Carolina specimens) that is sometimes wide and attaining

anterior margin of scutellum. Laterotergites variably coloured. Head yellow with face

light yellow, ocellar tubercle brown, and parafacial, gena, and occiput white; gena pilose.

Abdomen yellow, sometimes with lateral margins of tergites (2)3-5 lightly infuscated

(Georgia). M,,, ratio 3.3. Wing clear, but if scutellar stripe entire, wing dusky in cell R,

and around distal 1/3 of R,,,. Cell bm open. Face flat.

Female. Externally similar to male except as follows: central stripe on scutellum

weak if entire; abdomen partly yellow, with tergite 6 brown, tergite 7 brown basally and

laterally, and posterolateral margins of tergites 2-5 with light brown spots.

Male terminalia. (Figs. 45-47) Sternite 5 evenly setose. Sclerites of annulus

well-developed. Epandrium as wide as high and with length 4/5 height. Surstylus as high

as epandrium and subtriangular; tubercle-like bristles along posterior and apical margins.

Cerci small and rounded with one pair of longer central bristles. Hypandrium with one

minute distal and two long medial bristles on ventral lobe, sometimes with two minute

distal bristles and three long medial bristles. Phallapodeme well-developed with head

thin and recurved. Pregonite thin and elongate with four distal bristles. Basiphallus and

postgonite small. Epiphallus as large as basiphallus in outline. Distiphallus half length of

phallapodeme; lateral lobe well-developed with thumb short, thin, and strongly projecting.

Distribution. United States: DE, FL,GA, MD, NC, NJ (Map 11).

Holotype. UNITED STATES, MD: Montg’y Co., Colesville, W. W. Wirth, 11 July 1974,

3, USNM.

100

Revision of North American Sobarocephala JESO Volume 138, 2007

Paratypes. UNITED STATES, DE: Rehoboth, W.W. Wirth, Malaise trap, 18 July 1972,

3, 2, USNM. FL: Jackson Co., Florida Caverns State Pk., 26 May 1973, W. W. Wirth,

Malaise, 3, USNM; Liberty Co., Torreya State Pk., 13 June 1974, H.'V. Weems Jr. & C.

R. Artaud, Malaise trap, 2, USNM; 5 July 1965, H. V. Weems Jr., Malaise trap, 2, USNM;

Alachua Co., Gainesville, Austin Cary Forest, G. B. Fairchild, 30 August 1976, 2, USNM;

30 July 1976, 2, USNM; 11 June 1976, insect flight trap, 6, 9, USNM. GA: Athens, 8-

11 July 1969, R. & J. Matthews, Malaise, 2, EMUS; Forsyth, 2 June 1970, 234, CNCI.

MD: Montg’y Co., Colesville, W. W. Wirth, 11 July 1974, ¢, 22, USNM; 4 July 1976, 2,

USNM; Malaise trap, 26 June 1977, 29, USNM; 30 June 1977, 3, USNM; Glen Echo, 25

June 1922, J. R. Malloch, 2, USNM. NC: Wake Co., 7 air mi SW of Raleigh off rd., C.

S. Parron, Malaise trap, 17 July 1985, 0, NCSU; 10 July 1985, 24, NCSU; 29 June 1985,

2, NCSU; 31 July 1985, 2, NCSU; 25 June 1985, 9, NCSU; Mecklenberg Co., 22 June

1996, T. Daggy, 2, NCSU. NJ: Oswego Lk., Burlington Co., 30 August 1974, Menke &

Miller, 9, USNM.

Comments. See comments for Sobarocephala latifrons.

Etymology. The specific name honours the late W. W. Wirth, who collected most of the

type material.

Acknowledgements

We would like to thank a number of people for their aid in the preparation of this

paper, including the curators who loaned us most of the material used in this study: T. Nguyen

and D. Grimaldi (AMNH), K. Ribardo and N. Penny (CASC), C. Young (CMNH), D. M.

Wood, J. R. Vockeroth, J. O’Hara, S. Brooks, J. Skevington, L. Bartels and J. Cumming

(CNCI), W. Hanson (EMUS), M. Zumbado and M. Solis (INBC), P. Perkins (MCZC), R.

Blinn (NCSU), E. Riley (TAMU), A. Freidberg (TAUI), and D. Furth, A. Norrbom and F. C.

Thompson (USNM). W. Reeves (Center for Disease Control and Prevention, Atlanta, GA)

graciously donated material from the southern United States. Comments provided by two

reviewers were greatly appreciated. This study was supported by NSERC discovery grants

awarded to Stephen Marshall, and NSERC and OGS grants awarded to Owen Lonsdale.

References

Johnson, C. W. 1913. A study of the Clusiodidae, (Heteroneuridae) of the Eastern United

States. Psyche 20(3): 97-101.

Loew, H. 1860. Diptera Americana ab Osten-Sackenio collecta. Decas prima. Wiener

Entomologische Monatschrift 4: 79-84.

Lonsdale, O. and S. A. Marshall. 2006. Redefinition of the Clusiinae and Clusiodinae,

description of the new subfamily Sobarocephalinae, revision of the genus

Chaetoclusia and a description of Procerosoma gen. n. (Diptera: Clusiidae).

European Journal of Entomology 103: 163-182.

101

Lonsdale and Marshall JESO Volume 138, 2007

Malloch, J. R. 1918. A revision of the dipterous family Clusiodidae (Heteroneuridae).

Proceedings of the Entomological Society of Washington 20(1): 2-8.

Malloch, J. R. 1922. Notes on Clusiodidae (Diptera). Occasional Papers of the Boston

Society of Natural History 5: 47-50.

Melander, A. L. and N. G. Argo. 1924. Revision of the two-winged flies of the family

Clusiidae. Proceedings of the United States Natural History Museum 64: 1—54.

Sabrosky, C. W. and G. C. Steyskal. 1974. The genus Sobarocephala (Diptera: Clustidae)

in America North of Mexico. Annals of the Entomological Society of America

67(3): 371-385.

Sods, A. 1963. Identification key to the species of the “p/umata-group” of the genus

Sobarocephala Czerny (Diptera: Clusiidae). Acta Zoologica Hungarica 9(3-4):

391-396.

Sods, A. 1964. New Sobarocephala—Species from the “plumata-group” (Diptera:

Clusiidae). Annales Historico-Naturales Musei Nationales Hungarici 56: 449-

455.

Sods, A. 1987. Clusiidae. pp. 853-857 Jn Manual of Nearctic Diptera, Vol. 2. (eds), J. F.

McAlpine et al. Monograph 28, Research branch, Agriculture Canada, Ottawa.

1332 pp.

Steyskal, G. C. 1951. The dipterous fauna of tree trunks. Papers of the Academy of Science,

Arts and Letters, Michigan 1949: 121—134.

Woodley, N. E. 1984. The identity of Chaetoclusia affinis Johnson and its placement in

Sobarocephala Czerny (Diptera: Clusiidae), Psyche 91(1—2): 119-121.

102

Revision of North American Sobarocephala JESO Volume 138, 2007

Annulus

Distiphallus

Lateral lobe of

distiphallus

Basal shield of

distiphalus

Epiphallus

FIGURES 18-20. Sobarocephala flaviseta (Johnson), male terminalia. 18—external, left

lateral. 19-external, posterior. 20—hypandrial complex, left lateral. FIGURES 21-23. S.

latifacies Sabrosky & Steyskal, male terminalia. 21—external, left lateral. 22—external,

posterior. 23—hypandrial complex, left lateral. FIGURES 24-26. S. cruciger Sabrosky &

Steyskal, male terminalia. 24—external, left lateral. 25—external, posterior. 26—hypandrial

complex, left lateral. FIGURES 27-29. S. quadrimaculata Soos, male terminalia. 27—

external, left lateral. 28—external, posterior. 29—hypandrial complex, left lateral.

103

Lonsdale and Marshall JESO Volume 138, 2007

an

x

a

FIGURES 30-32. Sobarocephala atricornis Sabrosky & Steyskal, male terminalia. 30—

external, left lateral. 31—external, posterior. 32—hypandrial complex, left lateral. FIGURES

33-35. S. flava Melander & Argo, male terminalia. 33—external, left lateral. 34—external,

posterior. 35— hypandrial complex, left lateral. FIGURES 36-38. S. muesebecki Sabrosky

& Steyskal, male terminalia. 36—external, left lateral. 37— external, posterior. 38—hypandrial

complex, left lateral. FIGURES 39-41. S. affinis (Johnson), male terminalia. 39—external,

left lateral. 40—external, posterior. 41—hypandrial complex, left lateral.

104

Revision of North American Sobarocephala JESO Volume 138, 2007

y Ne 0

=

FIGURES 42-44. Sobarocephala pengellyi spec. nov., male terminalia. 42—external, left

lateral. 43—external, posterior. 44—hypandrial complex, left lateral. FIGURES 45-47. S.

wirthi spec. nov., male terminalia. 45—external, left lateral. 46—external, posterior. 47—

hypandrial complex, left lateral. FIGURES 48-50. S. latifrons (Loew), male terminalia.

48—external, left lateral. 49-external, posterior. 50—hypandrial complex, left lateral.

FIGURES 51-53. Sobarocephala interrupta Sabrosky & Steyskal, male terminalia. 51—

external, left lateral. 52—external, posterior. 53—hypandrial complex, left lateral.

105

Lonsdale and Marshall JESO Volume 138, 2007

FIGURES 54—56. Sobarocephala dreisbachi Sabrosky & Steyskal, male terminalia. 54—

external, left lateral. 55—external, posterior. 56—hypandrial complex, left lateral. FIGURES

57-58. S. texensis Sabrosky & Steyskal, male terminalia. 57—external, left lateral. 58-—

hypandrial complex, left lateral. FIGURES 59-61. S. setipes Melander & Argo, male

terminalia. 59—external, left lateral. 60—external, posterior. 61—hypandrial complex, left

lateral. FIGURES 62-64. S. lachnosternum Melander & Argo, male terminalia. 62—

external, left lateral. 63—external, posterior. 64—-hypandrial complex, left lateral.

106

Decline in long-horned wood boring beetle species? JESO Volume 138, 2007

A DECLINE IN THE NUMBER OF LONG-HORNED WOOD

BORING BEETLE (COLEOPTERA: CERAMBYCIDAE) SPECIES

IN ONTARIO DURING THE 20° CENTURY?

D. B. MCCORQUODALE', J. M. BROWN, AND S. A. MARSHALL?

Department of Biology, Cape Breton University, Sydney, Nova Scotia, Canada B1P 6L2

email: david_mccorquodale@cbu.ca

Abstract J. ent. Soc. Ont. 138: 107—135

Documenting loss of biodiversity in insects is hindered by the lack of species

level inventories for many taxa. In Canada we have a better understanding

of Coleoptera distributions than for most other taxa. Here we ask if we

know how many species of Cerambycidae occur in Ontario, and whether

there has been a change in the number of species over the past 100 years.

More than 18,000 specimens collected since 1862 were examined. A species

accumulation curve demonstrates that the inventory is reasonably complete.

Rarefaction estimates of species richness by decade show that fewer species

were collected after 1950 than before. Most of the 20 species collected only

prior to 1950 were associated with hardwood trees in the Carolinian zone of

extreme southern Ontario. Loss of forested habitat and replacement of old

growth forests with younger forests may have played a role in the decline.

Nine species were first collected after 1950, resulting in a net loss of 11

species. Selected records from after 2000 suggest that the introduction of

species, range expansions into Ontario, and discovery or rediscovery of rare

species is continuing.

Published November 2007

Introduction

Entomologists have difficulty documenting biodiversity losses because species-

level inventories do not exist for most taxa for most locations. In Canada, only about 60-

65% of all arthropod species that exist in the country have been documented (Danks 1979).

For many insect groups we lack keys, comprehensive revisions, or the expert taxonomists

able to identify species, undertake the revisions, and write the keys necessary for species

identification; in short there is a ‘taxonomic impediment’ (Taylor 1983).

The insect fauna of Ontario is incompletely known, although two approaches,

broad scale inventories and curation of existing collections, have expanded our knowledge

in the past 20 years. These approaches have produced species-level inventories for a few

' Author to whom all correspondence should be addressed.

? Department of Environmental Biology, University of Guelph, Guelph, Ontario, Canada

N1G 2W1

107

McCorquodale et al. , JESO Volume 138, 2007

locations (e.g. Skevington et al. 2001; Paiero et al. in press) and many newly recorded

species in relatively well known taxa, such as aculeate Hymenoptera (Buck 2004; Buck et

al. 2006), Hemiptera (Paiero et al. 2004), Orthoptera (Marshall et al. 2006), and Mecoptera

(Cheung et al. 2006). For Cerambycidae, McCorquodale (2002) documented 14 new

records for Ontario, including seven new records for Canada, and clarified the status of 11

other species for which there was equivocal evidence of occurrence in Ontario.

The Cerambycidae are plant-feeding beetles with about 1,100 species in North

America (Linsley 1961; Linsley and Chemsak 1997; Allison et al. 2004). A series of

taxonomic monographs by Linsley (1962a; 1962b; 1963; 1964), Linsley and Chemsak

(1972; 1976; 1985; 1995), and Chemsak (1996), as well as a recent field guide, make

taxonomic information accessible (Yanega 1996). Although most species of Cerambycidae

in North America are well known taxonomically, new taxonomic notes on the genus Oberea

(Yanega 1996) and current work on Jetropium by Serge Laplante, Canadian National Insect

Collection, indicate that systematics work is still required.

Most cerambycids depend on tree or shrub hosts for development. Therefore host

availability and changes in host distribution and abundance should influence the distribution

and abundance of these beetles. In Ontario, land use and forest cover have changed

dramatically over the past 300 years, particularly south of the Canadian Shield (Keddy

1997; Larson et al. 1999; Armson 2001; Suffling et al. 2003). Forests were converted to

agricultural fields and timber was extracted from large areas during the 1800s; forest area

was at a minimum in the 1920s, with about 10% of the original forest cover remaining south

of the Canadian Shield (Larson et al. 1999). Besides the loss of forested area, there has been

a change in the character of forests. Larson et al. (1999) explain that forests in southern

Ontario are younger, more fragmented, and more homogeneous now compared to 300 years

ago. North of the French and Mattawa Rivers, the area of forest cover has changed less

dramatically, but composition of the forest has changed through forest harvesting (Jackson

et al. 2000).

Land use change is expected to change the insect fauna. About 60% of nationally

listed species of vertebrates and vascular plants occur in Ontario, with most of these

occurring only in Ontario and only in the Carolinian or Deciduous Forest zone (Canadian

Wildlife Service 2006). Habitat loss through clearing for agriculture and urbanization are

prime factors.

Here we ask whether there is a good inventory of the Cerambycidae in Ontario.

Given that recent work on a variety of groups has increased the number of species known

for Ontario, it is important to assess the completeness of our inventory. Next, because of

land use changes and decrease in older forests, we ask whether there are fewer species

represented in collections from 1950 to 1999 compared to before 1950. At a finer level, the

same question is asked for eight shorter time periods, roughly decades, four before 1950 and

four from 1950-1999. Host preferences and geographic range of the species in collections

only from before 1950 and only from 1950-1999, are compared to test whether potential

losses are mostly from the extreme south of the province. Finally, significant records from

after 2000 are considered.

This analysis is possible because of the efforts of many generalist insect collectors,

epitomized and encouraged by D. H. Pengelly. Beetles were not his focus, yet while pursuing

bees, many beetles ended up on pins. For each of more than 30 consecutive years starting

108

Decline in long-horned wood boring beetle species? JESO Volume 138, 2007

in the mid-1950s, there are cerambycids collected by Pengelly in the University of Guelph

collection. These are of inestimable value in documenting faunal change. Perhaps more

important are the hundreds of specimens collected by dozens of young students motivated

by Pengelly to learn about where insects live and what they do. From the 1960s to the

1980s students in his insect collection course collected beetles across southern Ontario.

These students, including several contributors to this volume, are prominent on labels of

cerambycids. The specimens deposited in the University of Guelph collection, are more

important than numbers alone indicate, because at the same time relatively few cerambycids

were being deposited in the other major collections in Ontario. D. H. Pengelly’s genuine

curiosity about insects and his ability to ignite curiosity in others made this contribution

possible.

Methods

We identified all pinned adult specimens of Cerambycidae collected in Ontario

(N=18,469) in five major insect collections: Canadian National Insect Collection, Ottawa,

ON [CNC, n=6,050 specimens]; Royal Ontario Museum, Toronto, ON [ROME, n=4,517];

University of Guelph, Guelph, ON [DEBU, n=4,511]; Great Lakes Forestry Centre,

Sault Ste. Marie [GLFR, n=2,142]; Canadian Museum of Nature, Aylmer, PQ [CMNC,

n=705]; and in collections with smaller holdings: Lyman Entomological Museum, McGill

University, Montreal, PQ [LEMQ, n=397]; Canadian Forestry Service-Fredericton, NB

[FRLC, n=80]; Algonquin Provincial Park Visitors Centre, ON [APVC, n=67]; and the

Nova Scotia Museum of Natural History, Halifax, NS [NSMC, n=1].

The primary source for identifications and taxonomy was Yanega (1996),

supplemented with Linsley (1962a; 1962b; 1963; 1964), Linsley and Chemsak (1972; 1976;

1985; 1995), Chemsak (1996), and a few recent revisions to nomenclature (e.g. Napp 1994).

McNamara (1991) provided a checklist of species in Ontario. Non-native species collected

in Ontario but presumed not to be established, such as Physocnemum andreae (Laplante

1989; McCorquodale 2002), Phymatodes lividus, and Prionus californicus (Fletcher 1907),

are not included.

Label data were recorded for all specimens collected up to and including 1999. All

specimens from the same location in one year were considered one record. Specimens from

a more specific locality and a less specific locality in the same year were counted as one

record (i.e. Ottawa in 1905 and Eastern Ontario in 1905 counted as one record). Selected

specimens collected since 2000 and deposited in the University of Guelph collection are

included separately and are not considered in the main analysis.

Old specimens with no year indicated on the label made up a substantial proportion

of all specimens (McCorquodale 2002) and were combined in the category ‘Limited Data’

and then with all specimens from the 1860s to 1919 in the category ‘Before 1920’. The

importance and the limitations of these data were explained in McCorquodale (2002).

These specimens represent the fauna of Ontario prior to 1920, despite having incomplete

label information.

From the specimen label data, we tallied the number of records before 1950, from

1950-1999, and in eight ‘decade’ categories (before 1920, 1920s, 1930s, 1940s, 1950s,

109

McCorquodale et al. JESO Volume 138, 2007

1960s, 1970s, 1980s+1990s), four before 1950 and four from 1950-1999. These latter

categories are referred to as ‘decades’. Some analyses compare pre-1950 and 1950-1999

records, two categories with an approximately equal number of records (Fig. 1; 3,902 and

4,160). Others compare the eight ‘decades’, again each having a similar number of records

(range 855 to 1,284). The biased sample of specimens from after 2000 is only considered

separately.

Individual-based rarefaction, using records as defined above, was used to calculate

expected species richness for each of the time categories (before 1950 and 1950-1999 and

decade) to test whether species richness changed. Rarefaction iteratively sub-samples a data

set to produce a taxon-sampling curve that represents the expected number of species for

a given sample size (Krebs 1999; Buddle et al. 2005; Gotelli and Entsminger 2005). This

allows comparisons between data sets with different sample sizes by comparing expected

species richness for a common number of individuals (i.e. the sample size is set slightly

smaller than the smallest sample). Expected species richness was compared at 3,800

records for before 1950 compared to 1950 to 1999 and at 800 records for the eight ‘decades’.

Estimates of the expected species richness, variance and 95% confidence intervals were

based on 1,000 iterations using EcoSim 7.72 (Gottelli and Entsminger 2005).

Results

Completeness of inventory. Two hundred species, approximately 95% of the 211 species

of Cerambycidae now known from Ontario, had been collected before 1950 (Table 1). The

many old specimens collected prior to 1920, some with incomplete label data, included 179

species; the next highest ‘decade’ total is 157 species from the 1930s (Fig. 1). The 1930s

also had the fewest records. The asymptotic nature of the species accumulation curve (Fig.

2) suggests the inventory of Cerambycidae of Ontario is relatively complete. Between 1950

and 1999 one species was added to the fauna about every 5 years.

We here add the following species not recorded in Ontario by McNamara (1991) or

McCorquodale (2002).

Cerambycinae, Clytini, Xylotrechus mormonus (LeConte): Ontario, Deux-Rivieres, 26 July

1956, F[orest] I[nsect] S[urvey], CNC.

Lamiinae, Ataxiini, Ataxia brunnea Champlain and Knull. Ontario, Chatham Lab, Summer

1937, CNC; Ontario, Harrow, | July 1961, R. S. Dickout, DEBU.

Comparison of species richness before 1950 and 1950 to 1999. Fewer species of

Cerambycidae were collected between 1950 and 1999 than prior to 1950. Raw species

richness prior to 1950 was 200, compared to 191 for 1950-1999. However, it is more

appropriate to compare species richness with rarefaction estimates that control for unequal

sample size. The rarefied expected species richness prior to 1950, 199.5 (198-200, 95%

CI), was higher than for the period 1950-1999, 188.3 (186-190, 95% CI). Comparison of

rarefaction estimates for the eight ‘decades’ (Fig. 3) demonstrates the decline in species

richness for collections from 1950 to 1999 compared to prior to 1950. All four pre-1950

‘decades’ had higher species richness than all four 1950 to 1999 ‘decades’.

110

JESO Volume 138, 2007

Decline in long-horned wood boring beetle species?

C7 I I I hee Pee ok v (Aqiry]) snjoipiuip sapoyoudyg

| a ae 9 ¢ l Me we If | (Aes) snuaowp sapojoudyg

L I I € 6 (UPLUMON) Snasap sapojoudyg

ve, | G I bv «OO! I I 17 (Aqiry[) snajoud wnjjatsay

6C . c c € oe epee (6 v (snoeuUuly) wnaovjoia wnIpyjoD

9€ Meee eo Big) GS XS Rates Kasey winpisiyf wnipyyj0Z

I I UBUIMON| WNjoUUajUD WNIpIjOD

unpre

AA GS Ss c I C I I € (AInIq) 0j9U19 DJJUID DUDYNUY

turf idsoimmjog

6 € I € Z (AI0D pue ay10de7) syjjooissaiduoo snjAjoo4.oyy

SON Se | aia | a: ae | a 9 en A I 9 (JIAO) snsoonssaa snsoydopscy

lundA[seuy

avurAquiviay

a ay A I C (G I. € I I (Aes) vsnfuod psnfuos niunyp

Urry

E € c I I Aaseg wnuvizanmyss wnidojay

I I I € c Aoseg wnjnasnd wnidosjay

CC ue ¢ C C Sg 6 I I € Aqiry wndsajdowpuuis wnidoja

NE ae a 2 < ele 3 | : ei (snoeuUry) wnjolys wnuasp

I I (jJepuey) snjajosqo snoysna snjodoysp

eZ ¢ 6 6 SY £6 () Ap. @ v a (UeSp[eH) $77/0I1aA0f snjodoyap

IUIIOS

IVUINIISY

1 Se ee ae ae Ge

bs 6 © 2 2 &€@ S&S 8S &s S 2 BE

n n n n n n n n n 77) 77) oO

Qu.

‘PEUTQUIOS OS]B S19M SHH] PUL SOG] PUL NZHI SWOJog Ul PAUIWIOD d19M SCG] PUL ‘SOO6T ‘SOOST ‘eIEP powu] ,sopeoop,

JO sashjeue JO “OLRJUO Ul po}d9]]09 seplokquuesaD Jo suounoads Ggp‘g] UO peseq speoap Aq spsode1 Jo Joquinu sy], “| ATAVL

111

Om NON

tm

“E i SF. OO

JESO Volume 138, 2007

Dns eee ao Tt

MAN mH NY

va)

onmonn~mnme FNITFTAN SO

CON = WN

— eer rr —

nae m- ON

Noe -— AN hw

mnrN eH =

—_—

oO

_

oe)

_

(snioliqe,,) snuojoa snyradojAXy

(Aes) snsouup snyrasjojAy

JOYSL] Sta snyIadJO]AY

(snioliqe) supuiujnf sayjsasoAvy

(sniolige) smjouosonul snjdjI0aN

(A10D pure ay10deq) snuozoana snjdj20aN

(Aes) vaudpo snjajo0an

(snioliqe) snypulunon snjajo0aN

(1918104) aviuigos auapjAonsaypy

(ueyen) anduva aualjdonsayy

(Aes) snsoizads sniqooa]5

(I9IAI[Q) VjOIlANA SNJA]D

Alo‘) pure oylode’] s1joouisanu snjay

(A10x) pure oyodeTq) smpiaspfogyp snidajoiayD

(sIue}]) szjigou saplojjoD

UNF)

(Aased) snso1sij1] snjounuag

(snioliqe J) snausi) snjounuag

(uJO}]) syjooluinsups sndojodoy

(Aqary) 8140]]09 DAIIOUOA

(Aes) wnauipiaasg unumaur0saAyd

(snioLiqey) smiipa sapojoudyd

(snovuurq) snaonjsa} sapojpudyd

MUODeT SjoaynapU sapowwudAyd

ponuljuos TUlIpr[e)

[BIOL

S066]

S086]

SOL61

S096]

sOS6|

S061

SOe6]

SOZ6I |

S016]

S006]

S008 1

eyed |

pomury

McCorquodale et al.

‘ponunuoy) “| WIaVvVL

112

JESO Volume 138, 2007

Decline in long-horned wood boring beetle species?

IL

N

N ™~ OM

Nae ee OMTan oa

—~Y

Oo

N

+

N

est EN, MANO

—

b ee |

ABg snypjnopug snyr10j0y

PUTqOIOLOY

ueWopleH smojnovuaponb sayjyovsajayy

FUTMOTpIqy

uBWap[eH snpojynopug snjouojA]

(uelap[eH) suarsaqgnd sauvydosadsayy

(Aes) vyouwmasiaponh ving zy

Turueydosodsay

(JSIAI[Q) SmjDjou snuaydsouas

({[jepuey) sojooiun vssvidsg

(ueWopley) wnsiadsp uoipiydvjasiwg

(uBWop[eH) sijnfn1 sapojoydougq

(peoysiel)) snspydysos sapojpydpugq

(Aintiq) sniupuojp sapojoydouq

(Aes) wnjouosonu uoipiydy 7

(sntoliqe) snsozjia snydvjaup

(UBLUIMON) smjiuind snydpjaup

(UBLIMON) SjazjD1vd snydvjaup

luliprydeyq

(Aes) snyojnpun snysasjojAy

(IBULIDD) SNyDYISDS snydasO/AY

(uBWapleH) smjojnovuaponb snysaaqojAy

(9]U0D9T) snuomsoM snydadjo]Ay

MUODIT Ssuassaauod snydadjojAy

ponunuos tundya

[BIOL

$0661

S0861

SOL61

$0961

SOS61

SOr6I

S061

S0Z6I

SOI61

S0061

S008 I

poqury

‘penunuo) “l AaTaVvL

113

JESO Volume 138, 2007

McCorquodale et al.

Rute eee te TE

ZZ ae Z € € ee I z (uewoplep}) snaiajauuds sasanjdaT

L I I L. Ce I (uewoplep) suansfuoo sasanjdaT

ZI | ¢€ I = 6 I Z (jeyUd[AD) snsuaasuvay snjdjsojdaT

pS Se a SR SO: <a S| p uewopley Mpjnavul sdppjduadaH]

paee=te;- £F fT th ‘ti Ol. € - (Avs) vsuadsp sAqnjdaadayy

9 Se UOTIIG pure UOTII Mos saj9aq

ee. SF FF Lo bed € | (Avg) pypyinsxas sisdoj(sp

2 | Be C L S Gc $f" .4 S (Avg) pjnovu sisdojAispy

v C I I (uewiopyeH) s7.10]/09 sisdojaisy

be. f be oy L ae ee ee S I t g Aqury snypisnd snujsoyjuvay

9 I Z I Z (A9IAI]Q) snjajosqgo snulaoyjuvdp

IUIUIOOYJUBIY

. IVUIIWIe'T

val Z | € 4 ra Z (snioliqeq) sypsauny snuarlandind

wm Sy] I eso te. Pog s | (Avg) sippanins ajdipg

lULIopAYyors |,

GS a) eS se i a a” a Se a (snioliqef) sadiaid saosapng

rurydsowiojytL

Iv Poet ae Se a ee ee € (J9IAI]O) SIJOIUINsUDS SAxOULI]]O)

1u119}d0u9}§

¢ Z I (Avs) auofifnans unoipoug

UISTPOWS

woe | © iC 9 € L i F¥ I C uByeH wnjnfns WnldqC

[ I (I9IAT[Q) WNyDjnodU WiNLAGOE

(uILIqO

i= = @ Ss ££ SS Be SS @ ee

2.2 os € 6 Ss eS & £ & Ge

”n n n n n n n n n 77) 77) oO

[on

‘ponunuoy) “| ATaVv

114

JESO Volume 138, 2007

Decline in long-horned wood boring beetle species?

(Aes) wnaSiu puiayospo4oq-

SC I I v ei C I t

¢ I I I (ADIAI|Q) wnasauld DUaYyIsvI40G

I I (Aes) wnjousayp Duayasv210gq

lUIBWOYoseoIOd

I I (ueWap[eH) snapusdd snus)

lULUTIAS)

Z I I [[nUy pue urejdweyD vauunag vixnjy

FUTIXe} V7

SOL @ 1 -€ 4h #6 €l Ol 6 . 74 (Avg) smgojousadns snsazouasg

b I I I It It Z (ueUlap[ey]) snsojuamo) sniuosodng

an | t I g £ ¢ 9 |L Z (9]U0D27J) snjowavgns sniuosodny

IC oe ¢ 6 C S © Bg I I 91U0D9] 4adnnd sniuosodnq

1ulAsepody

BC I 9 3 € 6 t C (9}U0D97J) YjIqnu vIsojdC

I I (Aes) snqqisiaponh snydiowosap

ce t 9g € rg I t &£ v [ € (jeyuaT[AD) snysapow snydiowosay

TULIspoyUeOV

poi Of OL FF 9 c € V |) a 4 9 Zz ¢ (129H9q) smw1ospf siydpssosy

6 I Ls tt 7% I Cc (Q}U0D97) snjoadsap siydpsso1Q

oe Tt € TI I a 2. ££ = 1 I (91U0De7) snyousis sajdajsuQ

ate) oF ot EL § 6g c (Yout.q) sa1anb sajdapsuyQ

S I I I I I (Aes) snjaan{ sajdajsujQ

St I Ol I a. eZ I Z Z (UBLDP[eH) SMsaivA snipiusa|s

1s Co Oo et Om HM hue € (Avg) pydjo snudorT

‘ponurjuod TUTUTDOYyVUROY

Poe = be © 6S SS S SS YE

P22 Pie. 2 € 6 Se s = 8S €e

n n n n n n n n n n n oO

QO.

‘penuyuoy) “| ATaVL

115

N

JESO Volume 138, 2007

NNN

=

—

Oo — = | CO

— COM O — OO CO =

-_

WON —

—

—

—_

be |

(Aes) $1//091)0]NIO Da2gG—Q

UBWdp|eH 2D]]290 vas2qC

(snioliqe 4) ojpydaso0syjaAua vadaqC

[[NUy 1su0jap va4saq¢—C

Aaseg sualoyap va4aqcQ

AOYIYSIS|IAR]g 1Masvo vasaq—

uo} IIe} pure Susy] siuiffp vasaqcQ

TUID90}]AYd

(Aes) DyDjNsU1I Sasap1gUucy

lUHSpiouO

(sniolige.) 40jD]/1)1) Snuupy20Uu0py

(Aes) snjojjainas snupyrouopy

(Ainiq) snjpjou snumyrou0py

MUODIT HOjDjNU SnuDYyIOU0py

AQAVS| AOJDAOWADUL SNULDYIOUO[Y

(IIAI[Q) SISUaUIJOADI SNUIDYIOUOPP

(a\U0DeT) SMJDINIO SA0BOAII

ueWdap|eH Vsojnqau vjojsaqay]

(199H9q) SNU14B1] SA0H

(ueWdpleH) smjuajnsaajnd saoyH

(uewopleH) 4ayajnd saoH

UODIT Sijigap saoH

TUTTE ’y

(snio1iqeq) pypasiumay sisdoddiyy

1uisdoddipyy

[ROL

$0661

S086

SOL6I

S096 1

sOS6l

S0r6|

S061

S076

S016]

S0061

S008

B1eq

pour]

McCorquodale et al.

‘ponunuoy) “T dTaVvL

116

A a |

— TMH

—

JESO Volume 138, 2007

SENNA NA

~AAAM =

— cO C~ — Cc

ALG ra Gy = A

NANMNANHN MM NM | CO CO

fae)

—_—

Cy Ch GY 6h) GH IN Oh IG ca f- CN

m~ Fees MAB NM

NO — —e

koe SP-en

om Ct

\O

N

\o

WY

N

— |S

=a FN SM

_

—

=<

Keg sijpoayaound ppsadps

3U0DI7T Yisaou vaujndod ppsadvs

Keg onbijgo ppaadvs

Aeg vayjnu ppsadvs

snioliqe s1jp4ajp] bpsadvs

Aeg pjpusoul bpsadvs

[anor pue ya4 subj Dpsadvs

puelg 1pf ppsadps

snioliqe | vaploasip vpsadvs

UCVWIMON YIDjJa19 Dpsadvs

snioliqe | opipuvs vpsadvs

Keg pjpspajva ppsadvs

Tulpiodes

MUON] suwoppioiuad snsayIOUuOsog

MUNDI] snjnaspd snsayIouosog

UBWOp|eH SMX SNABYIOUOSO

(Aes) snaaadspp snaaadspp snadoq

TULIaYIOUOSOg

(sniapaMms) DyDJIUNA1A] DAAAGE

MUNDI] MwnvyIS vas2g—

Aaseg vsouindd vasaqcQ

Aaseg psuojapid vasaqQ

ueWopleH 770)]101ds4ad vasaqcQ

Kasey vpyjod pasaqcQ

‘ponuljuos 1u19901)AYg

[P10]

$0661

S061

S0L6I

$0961

S0S6I

S0r61

SOC6I

S0Z6I

SOI6I

S0061

S008I

Beg

paywury

Decline in long-horned wood boring beetle species?

“penuyuoy) 1 ATaVL

117

JESO Volume 138, 2007

McCorquodale et al.

I I (Aes) pjoyjiaig ppimosdyoodg

DS aa a I es Se ae I rd (Aeg) va1agna panjdajAyooig

nino tt & EE Ge t eS € Kase) iuipjdumys panjdajAyovag

os Gp ge ff S&S ee eC EE @ (Avg) stupjpos panun]jag

€ I 7 MUODE] Sypiaia xojcydoyup

eet 6h UE ULE S. 2 oP 4 (uewopyeH) snaundo xpjdydoyjuy

SE a nn a a Z (uewop|eH) smonuayw xpjdydoyjuy

ine. 8] (i 6l «6FllCUGlCU CU EUEUCUCUDCOD (Avg) vuagnd paapojdouy

€| 4 € I 4 | (Q1U0eT) DauINsuDsS DIYsUDASDUy

i eee Se Gali SR Se: ss 4 9 (Avg) pjoaul] vanjdajpuy

6 € v Z (uewoplepy) vjnfns saplosdoapuay

i a, a | a) aS a a | Se Soe | 9 (Aqiry]) snajoud sdoapuay

CP aoe, 6 ey Sr Bt Beek: 8 (Sumeyorey) s1suajosd sdoapuiay

| ruiinyday

et, alee aoe | ae eS ee De ee (19)S10,J) sipyjpod sn4aooulsaq]

TULIDDOWIS9C

avulinjda']

Pevgerige cg) Pf, 1 €l BE AL & 1b. 8. bt (19810) snuyoysydo.sjay sadov.a]

¢€ ¢ I I uewopley spojnapuanbuinb sadovajay

4 I | | | LoyuoyyS snanuvjau sadov.jay

€ | | | 3U0ge7] snjpsouaf sadov.ja]

1uidoenye],

£6 Pon Cf 6 +S 8 Ste Tr As Keg pjiisaa ppsadvg

Ay See yaa ae ee Ay 2 a JOIAL[Q DIDIUaplA) Dpsadbg

‘ponuijuos tulpssdes

a. =f ££ & & & Be & & SB He

aa. 2 © £282 2 82 e & ¢ * =

n n n n n n n n n n n oO

jon

‘ponunuoy) “| Wav

118

Va)

~Y

CON ONM

NANAWANOMNM

N

=z

JESO Volume 138, 2007

NO TN MN Sm eS

ON OAINNN

Ww re

MONN AN

NAN N

tom +t

—=aANnTMMNN OA

“+t

—

+

— = AG OC) OO GS = oO AN

N

laa)

=

_ ps Eos Coy ba

CO Mm SH ND SS

eS EY WO St eS ica (>

= OD os i

os he OC Fe A

Noto T+

MANDA HOM

rTFree NAN

ON TAT =—

—

\o

N

boo |

foe)

(UBLUMON) S2UuUadiBnd DIGOUI]DYIDS

(snoeuul’y) 4ojisinbul wnispyYy

(Aes) pyjas3iu vAnjdajo3Ag

(UBUOp|eH) VIDJUaNAI DIDBUu_ASOpNas

(puel[g) s7puimopqgn puljosnpsopnasg

(Aes) syjooyna puoplg

Aqiry, pau] vidyovod

(UPLUMON) BIDI1dDI DUsAJSO]IDOAN

(UeUIMON) S240f1g sisdosnjdaT

(Aqity[) buoJ0sMyd DISOgOANJdaT

[[Jepuey vyowpyqns vanjdaT

J[epuey vlagajd vanjdaT

sniolige, DjpulsivUua DANJdIT

(a3U0ge7) DyD4ponh vyopne

(1odnod) supspayuou viyjopne

(93U0ga]) Sjbpad viuopidoipy

(AqIty) DIDJUasADGNS DAajdOUMUDAH

(UPLIMON) SazoWany DAaJdOWWUDAD

(UBUIMON) ONBIXA DAajdouUDADH

(Aes) siuuadiuvds sajoanvy

(Jepuey) o7oOdUOWM SnulpOAT

(Aes) vajnsava sdojaAouq

(UvIOp| eH) VUDILMAWUD DIIVSLADYD)

(SILIB}H) DIDAOJOIAp DAIAPOAJUAD

‘ponunuos rund]

[BIOL

50661

S0861

SOL6I

s096I

SOS6I

SOr6I

SOC6I

SOZ6I

SOI6I

S0061

s008I

powury

Decline in long-horned wood boring beetle species?

‘ponuyuoy) “| dTaVvL

119

S 4, ae eS Saar 3 SS & AR Mae S| ee. | I ee S L (snioliqe) vauunsg DApUvaN

S 1uLIpueled

a IVULIpUBle

‘© 9 I oe ff Z (Aes) vjyjau syopdoan

E tulyepAdON

iC 7 ee? @ ré € € (Q{U0De7T) SyVIgy DANjdajojsay

= 6 C I I I v (Aes) DpypjouonjI0 DAnjdajojsax

eit 8 Sr 82 «OF 6G] hUPeCUSTUCUBlUSlhUCUCU 9 (ADIAI[Q) snuynjada sn4sav0dAa]

= owe ¢| Sf £ O81 £& 8 ££ 2 ¢ 3U0ge7] snsupds snuav0dA]

I | (ueWopleH) smjojouojz0 snaavo0dA]

9 Lt -¢ c (Aes) siaqnsny snsav0da]

Cl ee I € € l | Aaseg ppnpaijnop snsa20da]

ee 2 ae ee”) Ge ee a 4 (Avg) puixo4d Sp4yjADUOS14]

i SNS a ie; a A oe, Ae: Se | ¢ | (Ase) DUDJOSAUUIUL S1AYJADUOSIA]

mor. $c 6): fc 8] 81.01 OC Fe € FE Ss (UBLUMON) SI/IqDINU DpISAYIDAT

See Vee oe é 3 € I I | (udpMO}]) SUOAfiAadg DAIdsD DPISAYIDA]

Renta I I ¢ 9 C 74 ¢ (419}S810,J) suajiu Duolydods

CC | a a ae | Z (sniolige) siusorlajn] DIpBUv.AS

I | (SnJapaMs) 40/091g DI/DBUDAIS

Cc I | (J91AI[Q) BIDUIWINID DI]DBUB4S

mor wi ph’ BE cf ff dl 8c Gé £ ft 8 i (IBWHAD) DIVIAaiqqn vj dajpsub.AIG

IIS Sa SS 9) SR 9) ee 5 A ee | | Se Se 6 (JOIAI[Q) sisuapouns banidajojoug

97 I I 8 i 9g I rd 9 ([jepuey) 4asijJ1A snso20uayy

= 61 I I C € Te : a 2 | (QUODIT) MUNDYIS snsAODOUAIS

io) ‘ponunuog tuiinydsy

i?)

3 [fof > 2 bse es es 6 6 & #e

s a.

2 ‘ponunuoy “| ATAVL

120

JESO Volume 138, 2007

Decline in long-horned wood boring beetle species?

908 Of€F OSL SL

I

va)

foe)

—

I

™

OT OLOL F68

Cl

No)

198

\ oe

SS8 706

bon!

el

—_

C87

617

8r7

ses

bo

IVLOL

(WoYyiouURY) susofidn syApuodsoany

lurpl[Apuodg

avulplApuods

ueuyed sijnood snuolg

(AiniIq) syjooyw) snuog

(19]S1OJ) Wnauunsg DUWOSOYJAC

Pod

(snoeuuly) wnisosdap nuosospA,

IUISI[IOSOIO/

dVUIUOLIg

[BOL

80661

SO86I

SOL6I

80961

SOS6l

SOr6!

SOC6I

SOCc6I

SOT6I

80061

80081

Req

pow]

‘penuyuoy) “| ATEaVL

121

JESO Volume 138, 2007

so1sed

McCorquodale et al.

§ jo Jsqunny

‘sasA[eue SWIOS

JOJ 6861-0861 SB SN661 PUL SOZ6H] Wo ssoY} puke *YZH] WOJoY SP SHTHT PUL SODGI “SOOST FU} Wosy ssOYI YIM PoUTquUIoS o1e ,eIeq

poHWIT, SY] “OURIUG WO seploAquivia,D Jo susutdads GOp‘g | SY} 1OJ (ARdK/UONLIO]J/]) Sp10dd1 JO UOTNQLYsIp jerodway, “| FUNOW

soroedS —@— §p100° eee Bec]

S0661 SO861 SOL61 S0961 SOS6I SOP6I SOE6I SOZ6I SOI6I SOO6I SOO8T POUT

0) m= | | mM ma | 0

007

OV

09 |

08 7

OOl

t t

oor £

=|

S

“

009 &

rs

:

al + 008 3

4)

Or

0001

091

081 0071

122

JESO Volume 138, 2007

Decline in long-horned wood boring beetle species?

‘0Z6I 01 JOLId poq}d9][09 st yeU} ‘sjaqey] oy}

UO BJLP POUT] YIM SproAquuesso [[e sjUssoidos ATOSIyWwO JSIY OY “OVplOAQuivsdD OLIeJUGC JO} dAINO uonepnumnsoe saisadg *7 FUNOI

IVI

\ 4 a < \ ‘, \ \ <7

gs & os & & e gs oe ge

0 2

=}

o

a)

og ™

°

—,

N

a=)

3

OO! t

CQ

©

a

OSI

o

a

S

ooz

o

OSTZ

123

JESO Volume 138, 2007

McCorquodale et al.

‘(SQOZ JOBuIWIS]U_ puUP I][9}0H) WIGOd Suisn suoTesd}I YY‘ PUL Sp1O991 YOR JO o[duIes-qns kB UO poseq oIv SdIVUITIST “6661—-0S6I1

Joe WOT, S9pedop, INOJ dy} JO S[BAIOUL DOUSIPYUOS % CFG SY} YIM JOOSIOJUI JOU OP YSH] WOJoq WO ,sapeoap, INO} dy} JO sTeAIOVUI

DOUIPYUOS CG OY} JY} SMOYS Ul] [VOIVIOA OY *,SOpedap, IYSIO JO} SplOAQuIeIIS OLIRJUGD JOJ ssouYyo soiseds poyorey “¢€ FTUNOIA

(ID %$6) ssauyrry sapadg payaivy

SLI Sol SSI Sbl SEI STI

66-0861

6L-0L61

69-0961 5

=

or]

6S-0S61

i)

i=}

6r-0r6l

=.

6E-0661 &

67-0261

0761 -O8d

124

Decline in long-horned wood boring beetle species? JESO Volume 138, 2007

Species only in collections from prior to 1950 or 1950 to 1999. Twenty species were

collected prior to 1950, but not between 1950 and 1999 (Table 2). Nine species not collected

before 1950 are first represented in collections by specimens collected between 1950 and

1999 (Table 3).

Most species collected only before 1950 or only between 1950 and 1999 were from

southern Ontario, that is south of the Canadian Shield (Tables 2, 3). Locality information

on labels from 100 years ago is often imprecise. However, most of these species were

collected in extreme southern Ontario, along the Lake Ontario shore, Lake Erie shore, or in

southwestern Ontario. Of the 28 species in these two categories, only two were collected in

central and northern Ontario, with one, Microclytus compressicollis, also collected further

south.

Many of the species only collected prior to 1950 use hardwoods as larval hosts

(Table 2). The relatively few, 3 of the 20, that use conifers are associated with pines.

The nine species collected only between 1950 and 1999 included three that use conifers as

hosts.

Four significant records since 2000. Since 2000, three species have been detected in

Ontario for the first time:

Disteniinae, Disteniini, Distenia undata (Fabricius). Ontario, Essex, 10 km E of Essex,

1 August 2000, R. Marchese, Det. BD Gill 2003, CNC. Ontario, Pelee Island,

Porchuk property malaise trap 17-22 July and 28 August—10 September 2001, S.

A. Marshall and B. Porchuk, DEBU.

Lamiinae, Lamiini, Anoplophora glabripennis (Moltschulsky). First identified in Canada

on the basis of specimens brought to University of Guelph from packing crates

shipped to an industry in Waterloo, Ontario in June of 1998, but not detected

outdoors in Canada until 2003 (in northwest Toronto and Vaughan). The Canadian

Food Inspection Agency (2005) reports on ongoing attempts to eradicate and maps

occurrences up until September 2005.

Lamiinae, Tetraopini, Jetrops praeusta (Linnaeus). ONT: Halton (Reg.), Milton, Woodland

Trails Cape, 6" Line Nassagewaya, meadow, yellow pans, 5-6 June 2001, S. Paiero,

DEBU 00172650 and 00172655. ONT. Wellington Co., Guelph, meadow, 6 June

2002, O. Lonsdale, DEBU00185522.

One species that was not collected between 1950 and 1999 was found after 2000.

Cerambycinae, Anaglyptini, Microclytus compressicollis (Laporte and Gory). ON Cornwall,

14 May 2003, Old-growth forest F[light] I[ntercept] T[rap]-20, 45° 02.160’ N, 74° 47.470”

W, OG2-COR, R. Zeran, LEMQ.

Discussion

Do we know the Ontario cerambycid fauna? The Cerambycidae in Ontario are well known,

in contrast to many insect taxa. Three pieces of evidence support this assertion. About 95%

of the species were collected prior to 1950, the species accumulation curve approaches an

125

JESO Volume 138, 2007

McCorquodale et al.

angad ALaq[nyj OLIeJUO I Z (Aes) Wnjousaj]D DUAYISVIAOT

nddd spoompiey 1oyiO

“TWO ONO = ‘‘Pnqpey ‘AroyorH ‘aydey ABMOSPIY I 6 (uewiopeH) snapusdd snui4cy

spoompiey IoyIO

JNO ‘AIOYOIH “Yoiig ‘oldeyy OLILIJUD UII}seq I I (Aes) sngqisiaponb snydsowosapy

yeO “Ausqiny|

angaada ‘Auaqyoe pH ‘AIOYSI ABMOSPIY I ¢ (JOIAI[Q) WnNyD]nNoDUL WUN1AG—E

‘OD prempy

ANgdd ‘ONO Aulaqyoey ‘AIOYxSTH sould ‘AeMospry Y Z (191AI]Q) SMyDjou snuaydsoualy

ABMOSPTY

nad “AWOU “Splaeq “Ig “UepIOL

‘OWT ‘ONO Allaqyoe ‘AQSUILID ‘MOLIe] 9 II (snioliqeq) smjouosonul snjAjo0aN

spooMpiey JoyIO “NUleM

AGA ‘ONO § ‘USV ‘Auiaqyoey ‘AIOYOIHH «= UOPUOT “souLTBYyye IS Z ra (Aes) vaudpo snjA4jo0an

atsictal sonidg ‘ould ABMOSply I I URUIMON wnjouuajuD UNIp1]]0D

uOJIWeH “Udy

ndad “AWOow ‘BMENQO “YSNOIOGII}94g (A10H pure oy0de7)

WAT) ‘ONO 3 ‘Avg Jopuny | 6 0Z S1JODISSAAAUOD SNJAJIOAII

(jjepuey)

ONO ould puog purin I S snjajosgo snaysna snyodoysp

suotdz[[0D s}SOH suOI}vIO'T Sp1od0y «= - SudWTDadS so1sodsg

(966|) BSouey pur (1661) YeswayD pue As]sur] WY are s}soy pue ejep [aqe] WO, 1B SUOTBIOT “OHEIUQ UT

666] PUL 0S] UPEA\I9q OU ING ISG] 0} JOLId payoa]]Oo aeploAquei9y JO sarsads ()Z 94} JO Spode pue suoumtoads Jo JaqUINN ‘7 ATaVL

126

JESO Volume 138, 2007

Decline in long-horned wood boring beetle species?

nad spoompreH Uopuo’y I 6 (Ainiq) s17jooyny snuoisd

ONO SOSSBID aes eT I I (uUBWop[eH) smppjouojI0 snsaz0dA]

agdad uopuoT ‘Ysno10g19}0g

“AWOU ‘ONO ould — ‘Kemospry ‘adopy u0g 9 AG (Aes) siuqn3sny] snsadodd]

ONO yeo ‘ade JOOUIIS I | (SN.IopaMs) 10]/001g DIIDBUDAS

YIVQoUIN “WeoquIoH dyeT

angdd ‘ONO doy ‘poomuol] Jappy poomusasyH ‘uojZuruesT Z € (JDIAI[Q) DJDUIWUNID DIpsUDAS

angad {SPpoompley OJUOIOT, I I (Aes) Djpy1A1g Dpiwosdyoosg

OND é Aemqulo I I (Avg) syjjoounjnz0 va1aqQ

Spoompley

nad JayIO “ALaqyoeH

YWATD ‘ONO ‘AIOYOIH] ‘POOMUOL] uopuo’7T ‘ydjany Z 6 (Aes) DyDjnsu19 sasap1zuc—

tay

angad ‘yeo “ynuyen ‘A1OyoTH ABMOSPIy ¢ p (199H9q) SnUuls1] S20H

PMEVO

ngad ‘uopuo7T “sinoqod

‘AINOW ‘ONO wy “YeO “AloyoIH ‘uoysurUea'T ‘Aemospry 6 €€ (uewopleH) 4ayajnd saonH

SsuoldI[[0D SJSOH suones0'] Sp10ddy«- SUDTATIDOdS sa1ads

‘penunuo) “¢c WIEVE

7

JESO Volume 138, 2007

(wi1oysouuRe yy’)

WATO ouig ‘sonids JUNOWIYSIVIS I ¢ siusofidn sijApuodsoan

FWOUUATD —s- ooo “your ‘ojdeyy = Avg Aqua, “soulja 2ong € b QUOD] sipiia xojdydoyjuy

Aingpng *]]9qind

‘Avg UOI[IWWIA “Lay

‘LIB “91S WNeVS “ayeT

nad uodsIMIS youl “YI2uID

WAT) ‘ONO ,aonids JQIVMII] “JUNOWYIIVIS 6 €] (uewiopleH) vjnfna sapiosdoapuapy

aAgad ‘ONO adinds JOSPUIA “OpIsoRig ré | (yueIyos) Djpydas0syjAsa DAAGOC

| Wy] ‘POOMsseg

AWOU ‘yeQ “jnUsoYyD ‘AJOYOIH yieg nespuoy Z (ueUIMON) spiuind snydvjaup

JNO MOTTA SOIDIATY XNIG I I (a\U0DeT) SNUOULIOU SNYIAAJOIAX

punos A1OD) pue oyi0de]

Angad ‘ONWO ould udMQ ‘Avg 90uR}SUOD) Z Z SIJJOPIUIBADUL SNA]

‘OD prempy 90ulld (A10y pure oy0de'7)

nddad ‘ONO adein ‘29]9q ‘Id ‘UOIIWIeH ¢ v snoiaspfoqp snydajojayD

ONWO I poylVv I [ gU0DI7T s7joaynapu sapojoulAYyd

suoljd2][09 s}SOH suones0'] ~ gpaov0y = suauseds oo o—— sa1sadg

‘(966|) BSouRA pue (/66]) YeswWoYyD pue Adjsur] WO s1B s}soy pur BBP [Ege] WO d18 SUOT]VIO'T

‘OLIRIUD Ul HHH] PUL KSH] USdMI0q ATUO P9}d9]]09 seploAquiviad jo sa1sads 6 dy} JO Sp1Oda1 pue suowloeds Jo JoquINN “¢ ATAVL

McCorquodale et al.

128

Decline in long-horned wood boring beetle species? JESO Volume 138, 2007

asymptote, and with a similar collecting effort to before 1950, only 9 additional species

were found in the 50 years after 1950. This has been achieved largely through efforts of

general collectors. Four significant contributions by cerambycid specialists are by Brimley

(1941) from Prince Edward County and environs, Gardiner (e.g. 1957; 1975) in the Sault

Ste. Marie area, Hicks from Windsor and Ottawa (e.g. 1947; 1962; 1971), and E. J. Zavitz

from Ridgeway in the Niagara Peninsula in the early 1900s.

Four significant records of Cerambycidae collected since 2000 demonstrate that

the Ontario fauna is not static. Ranges change through both contraction and expansion, and

for many species our understanding of their distributions within Ontario is rudimentary.

The arrival of Anoplophora glabripennis in northwestern Toronto was expected (Allen and

Humble 2002). Its potential to wreak havoc on suburban trees and potentially on native

hardwoods in the Carolinian forest has prompted eradication efforts (Ontario Ministry of

Natural Resources 2006). Another non-indigenous species, Jetrops praeusta, continues to

expand its range in eastern North America. Distenia undata ranges from Ohio south to the

southern Appalachians, and since 2000, it has been found twice in extreme southwestern

Ontario, at Harrow and Pelee Island. In fact it is surprising that more species have not

expanded their ranges north to include extreme southern Ontario. Species with a wide

geographic range, hence more subpopulations, may have a better chance of surviving

significant population declines. Prior to 1950 M. compressicollis was collected from

Thunder Bay to Hamilton and Ottawa, a widespread distribution in Ontario. A specimen

collected in 2003 as part of intensive sampling of saproxylic beetles in hardwood forests of

eastern Ontario (Zeran et al. 2006) demonstrates it persists in Ontario. As with many other

species the specimen raises more questions than it answers. Is it still widespread? What is

the host plant? What are its habitat requirements? Is it endangered in Ontario?

Has the number of species in Ontario declined? Both raw species richness and rarefied

estimates show about a 10% decline in the number of species collected since 1950. A

contributing factor is the 20 species not collected between 1950 and 1999. In addition, 23

species were minimally represented between 1950 and 1999, 20 with only one record and

another three collected in only one decade. Only 9 species were first recorded between

1950 and 1999, a net loss of 11 species. The date 1950 is not of special significance, but

merely a convenient split to produce two samples with similar collecting effort. Using 1940

or 1960 as the break results in similar patterns. The general trend for lower species richness

per decade (Fig. 3) supports this assertion.

The decline in number of species of cerambycids in Ontario may have been driven

by environmental change; for cerambycids the most likely changes are in the abundance and

distribution of host plants and their habitats. Alternatively, the apparent decline may be a

function of collecting biases.

Forest regions: The cerambycids collected only prior to 1950 were concentrated in the

southern part of the province, primarily the Carolinian Forest Region. Most of Ontario is

boreal forest (dominated by coniferous trees) and Great Lakes-St Lawrence mixed forest

(Rowe 1972; Hosie 1990; Armson 2001). Only one species from the boreal forest in northern

Ontario, Microclytus compressicollis, was not collected 1950-1999; it was also collected

further south. In contrast, many species from the Carolinian or deciduous forest region

129

McCorquodale et al. JESO Volume 138, 2007

of extreme southern Ontario were not collected from 1950 to 1999. This forest region

occupies a limited area along the north shore of Lake Ontario, west to Pinery Provincial

Park on Lake Huron and all areas to the south, including the Niagara Peninsula and the

north shore of Lake Erie (Rowe 1972; Larson et al. 1999). Despite the limited geographic

area, at least 16 of the 20 species collected only prior to 1950 are known only from this

area. In contrast only two of the nine species collected only between 1950 and 1999 were

restricted to the Carolinian forest region.

Clearing land for farms, towns and cities, and for timber extraction removed

most of southern Ontario’s original forest cover before 1900 (Armson 2001). Reduction

of forest area is most pronounced in the Carolinian because of intensive agriculture and

the concentrations of urban centres (Austen et al. 1994; Larson et al. 1999; Armson 2001).

Significant forest loss from the small overall area of Carolinian forest in Ontario has

contributed to the reduction in its unique cerambycid fauna and consequently to the Ontario

fauna as a whole.

Host plants: The distribution of each cerambycid species depends on the range of appropriate

host plants. Southern hardwoods, such as hickory and hackberry, are the host plants of half

of the 20 species collected only before 1950. Given the decline of Carolinian forests, it

is not surprising many of these apparently declining species use southern hardwoods as

hosts. Of the 9 species collected only between 1950 and 1999, only Anelaphus pumilus uses

southern hardwoods (hickories) as hosts.

The lack of collections after 1950 of three species that feed on pine was not expected,

because White Pine, Pinus strobus L., is still a reasonably common and widespread tree,

even if there are fewer really old trees now. In addition, Red Pine, P. resinosa Soland and

Jack Pine, P. banksiana Lamb, are now more common in southern Ontario in plantations,

especially on abandoned farms on poor sandy soils.

Are the species not collected between 1950 and 1999 extirpated? Our understanding

of current distributions of cerambycids is based on specimens in insect collections, as

are the compilations of Linsley and Chemsak (e.g. 1985; 1995), McNamara (1991) and

McCorquodale (2002). Unlike the recent atlas of bird distributions in Ontario (Cadman et

al. 1987), we have no broad, recent, focused, geographical surveys of cerambycids. Though

we do have a reasonable inventory, and an apparent decline in the number of species, we do

not have sufficient information to assert that the lack of specimens of a particular species in

post-1950 collections represents a significant population decline or an extirpation.

At first glance the decline in the number of species does not appear to be the

result of a lack of collecting because there are more specimens and records from 1950—

1999 than prior to 1950. It seems unlikely that the ability of collectors has declined since

1950, and certainly our understanding of natural history and host plant use has increased.

General collecting has revealed new records for Ontario, for example Anelaphus pumilus,

Clytoleptus albofasicatus, Anthophylax viridis, and Clytus marginicollis. All were part of

general insect collecting rather than focused collecting for cerambycids.

However, since 1950 there has been limited collecting in southern Ontario by

cerambycid specialists and this may have reduced the number of species collected. The hard

to collect specimens may have been missed because specialized knowledge and collecting

130

Decline in long-horned wood boring beetle species? JESO Volume 138, 2007

techniques were lacking. In southern Québec, where similar changes in forest cover have

occurred, there has been not been a similar decline in species richness in collections of

cerambycids. The main reason is a cadre of keen amateur coleopterists with specialized

knowledge of cerambycid natural history (e.g. Laplante 1989).

The hypothesis that the number of cerambycid species in Ontario has declined since

1950 is eminently testable. Focused collecting of cerambycids in the Carolinian forests of

extreme southern Ontario, specifically the Niagara Peninsula, Long Point, Rondeau, Point

Pelee, and Pinery, could provide the data. If many of the species in Table 2 were to be

collected, the logical conclusion would be that the decline is more apparent than real, wheras

if these species were not found, the contention that the decline is real would be supported.

Data on phenology, distribution, and abundance would be useful. The COSEWIC

species at risk ranking (Committee on the Status of Endangered Wildlife in Canada 2004) for

the 20 species only collected prior to 1950 and the 9 collected only between 1950 and 1999,

would likely be ‘Data Deficient’. The lack of information about population size, population

trends, geographic range in Ontario, and the paucity of records would all contribute to this

designation. .

Challenges: Understanding wood boring beetles has not been a priority for the public,

government agencies, or research institutions in Ontario or Canada. Phenology and

host preferences of only a few species of cerambycids have been studied in Ontario (e.g.

Hicks 1947; 1962; 1971; Gardiner 1954; 1955; 1957; 1975). Therefore specific habitat

requirements and phenology in Ontario are largely unknown. With such a low priority,

the opportunity to develop expertise has been limited. This lack of interest is not limited

to the Cerambycidae, as shown by this quote from a recent book on forest insect pests in

Canada: ‘There is no current research being conducted in Forestry Canada on any of the

wood-boring insects described in this chapter’ (Safranyik and Moeck 1995). Since then,

spurred by the detection of Brown Spruce Long-horned Beetle, Tetropium fuscum, in Nova

Scotia and Asian Long-horned Beetle, Anoplophora glabripennis, in Illinois, New York,

and recently Ontario, there has been a redirection of efforts by Canadian researchers (e.g.

Allison et al. 2001; Peddle et al. 2002). If we are going to understand what changes are

occurring in the Ontario cerambycid fauna, understand the reasons behind the changes and

be prepared to detect novel introductions, it is necessary to consider native and introduced

species, and have the expertise to identify both (Huber and Dang 2003).

Acknowledgments

We thank the curators and entomologists at Canadian National Collection (Yves

Bousquet, Serge Laplante, Jeff Cumming, John Huber, Henri Goulet), Royal Ontario

Museum (Chris Darling, Doug Currie, Brad Hubley), University of Guelph (Steven Paiero,

Matthias Buck, Andrew Applejohn, David Caloren, Jeff Skevington), Canadian Museum of

Nature (Bob Anderson, Henry and Anne Howden), Great Lakes Forestry Centre (Kathryn

Nystrom, Kevin Barber), Lyman Entomological Museum (Terry Wheeler, Stephanie

Boucher), Atlantic Forestry Centre (Georgette Smith, Ken Harrison), Algonquin Park

Visitor Centre (Dan Strickland, Ron Tozer), and Nova Scotia Museum of Natural History

131

McCorquodale et al. JESO Volume 138, 2007

(Andrew Hebda, Christopher Majka) and for access to collections and discussions about

cerambycid collections. Serge Laplante graciously shared his expertise on cerambycid

taxonomy, identification, and biology. Don Sutherland, Richard Knapton, and Bill Crins

provided information on the natural history of southern Ontario. Chris Thomson and

Sheena Townsend read through preliminary drafts and provided helpful comments. Bruce

McCorquodale helped out with the old literature and locating old communities in southern

Ontario. Financial support was provided by NSERC and CBU research grants to DBMcC.

References

Allen, E. A. and L. M. Humble. 2002. Nonindigenous species introductions: A threat to

Canada’s forests and forest economy. Canadian Journal of Plant Pathology 24:

103-110.

Allison, J. D., J. H. Borden, R. L. McIntosh, P. deGroot, and R. Gries. 2001. Kairomonal

response by four Monochamus species (Coleoptera: Cerambycidae) to bark beetle

pheromones. Journal of Chemical Ecology 27: 633-646.

Allison, J. D., J. H. Borden, and S. J. Seybold. 2004. A review of the chemical ecology of

the Cerambycidae (Coleoptera). Chemoecology 14: 123-150.

Armson, K. A. 2001. Ontario forests, a historical perspective. Fitzhenry and Whiteside,

Toronto, ON. 233 pp.

Austen, M. J. W., M. D. Cadman, and R. D. James. 1994. Ontario birds at risk, status

and conservation needs. Federation of Ontario Naturalists and Long Point Bird

Observatory, Don Mills, ON. 165 pp.

Brimley, J. F. 1941. A list of the long-horned beetles (Cerambycidae) of Prince Edward

County, Ontario. University of Toronto Studies, Biological Series. 48: 120—123.

Buck, M. 2004. An annotated checklist of the spheciform wasps of Ontario (Hymenoptera:

Ampulicidae, Sphecidae and Crabronidae). Journal of the Entomological Society

of Ontario 134 [2003]: 19-84.

Buck, M., S. M. Paiero, S. A. Marshall. 2006. New records of native and introduced aculeate

Hymenoptera from Ontario, with keys to eastern Canadian species of Cerceris

(Crabronidae) and eastern Nearctic species of Chelostoma (Megachilidae). Journal

of the Entomological Society of Ontario [2005] 136: 37-52.

Buddle, C. M., J. Beguin, E. Bolduc, A. Mercado, T. E. Sackett, R. D. Selby, H. Varady-

Szabo, and R. M. Zeran. 2005. The importance and use of taxon sampling curves

for comparative biodiversity research with forest arthropod assemblages. The

Canadian Entomologist, 137: 120-127.

Cadman, M. D., P. F. J. Eagles, and F. M. Helleiner. 1987. Atlas of breeding birds of Ontario.

Federation of Ontario Naturalists and Long Point Bird Observatory, Don Mills,

ON. 671 pp.

Canadian Wildlife Service. 2006. Species at risk in Ontario. http://www.on.ec.gc.ca/wildlife/

sar/sar-e.html. Viewed 23 June 2006.

Chemsak, J. A. 1996. Illustrated revision of the Cerambycidae of North America. Volume 1.

Parandrinae, Spondylidinae, Aseminae, Prioninae. Wolfsgarden Books, Burbank,

CA. 1x + 149 pp. + 10 pls.

132

Decline in long-horned wood boring beetle species? JESO Volume 138, 2007

Cheung, D. K. B., S. A. Marshall, and D. W. Webb. Mecoptera of Ontario. 2006. Canadian

Journal ofArthepod Identification. |. http://www.biology.ualberta.ca/bsc/ejournal/

cemw01/cmw_01.html. Viewed 18 March 2007.

Committee on the Status of Endangered Wildlife in Canada. COSEWIC assessment process

overview. http://www.cosewic.gc.ca/ Viewed 18 March 2007.

Danks, H. V. 1979. Canada and its insect fauna: An overview. Memoirs of the Entomological

Society of Canada 108: 567-573.

Fletcher, J. 1907. Entomological Record, 1906. Thirty seventh Annual Report of the

Entomological Society of Ontario, 1907: 86—103.

Gardiner, L. M. 1954. Larval description of Acmaeops proteus (Kby.) (Coleopt., Ceramb.).

The Canadian Entomologist 86: 190-192.

Gardiner, L. M. 1955. Larval description of Acanthosinus pusillus Kby. (Coleoptera,

Cerambycidae). The Canadian Entomologist 87: 219-220.

Gardiner, L. M. 1957. Deterioration of fire-killed pine in Ontario and the causal wood-

boring beetles. The Canadian Entomologist 89: 241-263.

Gardiner, L. M. 1975. Insect attack and value loss in wind-damaged spruce and Jack Pine

stands in northern Ontario. Canadian Journal of Forest Research 5: 387-398.

Gotelli, N. J. and G. L. Entsminger. 2005. EcoSim: Null models software for ecology.

Version 7.72. Acquired Intelligence Inc. & Kesey-Bear. Jericho, Vermont 05465.

Available from http://garyentsminger.com/ecosim.htm (08 August 2005).

Hicks, S. D. 1947. Additional notes on Coleoptera taken in Essex County and southern

Ontario. The Canadian Entomologist 79: 117-119.

Hicks, S. D. 1962. The genus Oberea Mulsant (Coleoptera: Cerambycidae) with notes on the

taxonomy, variation, and host affinities of many of the species. The Coleopterists

Bulletin 16: 5—16.

Hicks, S. D. 1971. Comments on certain Coleoptera from extreme southern Ontario and the

Ottawa district. The Coleopterists Bulletin 25: 103—106.

Hosie, R. C. 1990. Native Trees of Canada, 8" edition. Fitzhenry and Whiteside, Toronto,

ON. 380 pp.

Huber, J. T. and P. T. Dang. 2003. Biosystematics in forestry: invasive pests and native

biodiversity. Page 55 Jn Secretariat on the Convention on Biological Diversity

(eds), Facilitating conservation and sustainable use of biological diversity. CBD

Technical Series No. 9. Montreal, QC. 70 pp.

Jackson, S. M., F. Pinto, J. R. Malcolm, and E. R. Wilson. 2000. A comparison of pre-

European settlement (1857) and current (1981—1995) forest composition in central

Ontario. Canadian Journal of Forest Research 30: 605-612.

Keddy, C. 1997. Forest history in eastern Ontario. Eastern Ontario Model Forest, Kemptville,

ON. 42 pp.

Krebs, C. J. 1999. Ecological Methodology. 2" edition. Addison Wesley Longman, Don

Mills, Ontario.

Laplante, S. 1989. Contribution a |’inventaire des Cerambycidae [Coleoptera] de la province

de Québec. Fabreries 14: 56-83.

Larson, B. M., J. L. Riley, E. A. Snell, and H. G. Godschalk. 1999. Woodland heritage

of Southern Ontario: a study of ecological change, distribution and significance.

Federation of Ontario Naturalists, Don Mills, Ontario. 262 pp.

133

McCorquodale et al. JESO Volume 138, 2007

Linsley, E. G. 1961. The Cerambycidae of North America. Part I. Introduction. University

of California Publications in Entomology 18: [111] + 1-135.

Linsley, E. G. 1962a. The Cerambycidae of North America. Part II. Taxonomy and

classification of the Parandrinae, Prioninae, Spondylinae and Aseminae. University

of California Publications in Entomology 19: v + 1-102 + 1 pl.

Linsley, E. G. 1962b. The Cerambycidae of North America. Part III. Taxonomy and

classification of the subfamily Cerambycinae, tribes Opsimini through Megaderini.

University of California Publications in Entomology 20: xi + 1-188.

Linsley, E. G. 1963. The Cerambycidae of North America. Part IV. Taxonomy and

classification of the subfamily Cerambycinae, tribes Elaphidionini through

Rhinotragini. University of California Publications in Entomology 21: ix + 1-

165.

Linsley, E.G. 1964. The Cerambycidae of North America. Part V. Taxonomy and classification

of the subfamily Cerambycinae, tribes Callichromatini through Ancylocerini.

University of California Publications in Entomology 22: viii + 1-197.

Linsley, E. G and J. A. Chemsak. 1972. The Cerambycidae of North America. Part VI. No 1.

Taxonomy and classification of the subfamily Lepturinae. University of California

Publications in Entomology 69: viii + 1-138 + 2 pls.

Linsley, E. G and J. A. Chemsak. 1976. The Cerambycidae of North America. Part VI. No 2.

Taxonomy and classification of the subfamily Lepturinae. University of California

Publications in Entomology 80: 1x + 1—186.

Linsley, E. G, and J. A. Chemsak. 1985. The Cerambycidae of North America, Part VII.

No 1: Taxonomy and classification of the subfamily Lamiinae, tribes Parmenini

through Acanthoderini. University of California Publications in Entomology 102

[1984]: xi+ 1-258.

Linsley, E. G and J. A. Chemsak. 1995. The Cerambycidae of North America, Part VII. No

2. Taxonomy and classification of the subfamily Lamiinae, tribes Acanthocinini

through Hemilophini. University of California Publications ‘in Entomology 114:

xi + 1-292.

Linsley, E. G and J. A. Chemsak. 1997. The Cerambycidae of North America, Part VIII:

Bibliography, index and host plant index. University of California Publications in

Entomology 117: ix + 1-534.

Marshall, S. A., S. M. Paiero, and O. Lonsdale. 2006. New records of Orthoptera from

Canada and Ontario. Journal of the Entomological Society of Ontario 135 [2004]:

101-107.

McCorquodale, D. B. 2002. New records and notes on previously reported species

of Cerambycidae (Coleoptera) for Ontario and Canada. Proceedings of the

Entomological Society of Ontario 132 [2001]: 3-13.

McNamara, J. 1991. Family Cerambycidae. pp. 277-300 Jn Checklist of beetles of Canada

and Alaska. (ed.), Bousquet, Y. Agriculture Canada, Publication No. 1861/E,

Ottawa, Ontario.

Napp, D. S. 1994. Phylogenetic relationships among the subfamilies of Cerambycidae

(Coleoptera: Chrysomeloidea). Revista Brasileira de Entomologia 38: 265-419.

Ontario Ministry of Natural Resources. 2006. Forest Health Alert 1: Asian long-horned

beetle, Anoplophora _ glabripennis. _ http://ontariosforests.mnr.gov.on.ca/

foresthealthoverview.cfm. Viewed 24 June 2006.

134

Decline in long-horned wood boring beetle species? JESO Volume 138, 2007

Paiero, S. M.,S. A. Marshall, and K. G. A. Hamilton. 2004. New records of Hemiptera from

Canada and Ontario. Journal of the Entomological Society of Ontario 134 [2003]:

115-129.

Paiero, S. M., S. A. Marshall, P. D. Pratt, and M. Buck. In press. The insects of a southern

Ontario tallgrass prairie. Jn Arthropods of Canadian grasslands: Ecology and

interactions in grassland habitats. Biological Survey of Canada (Terrestrial

Arthropods). Wheeler, T. A., H. V. Danks, and & R. E. Roughley (eds).

Peddle, S., P. deGroot, and S. Smith. 2002. Oviposition behaviour and response of

Monochamus scutellatus (Coleoptera: Cerambycidae) to conspecific eggs and

larvae. Agricultural and Forest Entomology 4: 217-222.

Rowe, J. S. 1972. Forest regions of Canada. Canadian Forestry Service Publication 1300,

Ottawa, ON.

Safranyik, L and H. A. Moeck. 1995. Wood Borers. Jn Forest insect pests in Canada.

Armstrong, J.A., and W. G. H. Ives (eds.) Canadian Forest Service, Ottawa. pp

171-177.

Skevington, J., D. Caloren, K. Stead, and K. Zufelt. 2001. Insects of North Lambton.

Lambton Wildlife Incorporated, Sarnia, Ontario. 181 pp.

Suffling, R., M. Evans, and A. Perera. 2003. Presettlement forest in southern Ontario:

Ecosystems measured through a cultural prism. Forestry Chronicle 79: 485-501.

Taylor, R. W. 1983. Descriptive taxonomy: past, present and future. pp 93—134, Jn Australian

Systematic Entomology: a Bicentenary Perspective. Highley, E. and R. W. Taylor

(eds.), CSIRO, Melbourne.

Yanega, D. 1996. Field guide to northeastern longhorned beetles (Coleoptera: Cerambycidae).

Illinois Natural History Survey Manual 6, Champaign, Illinois.

Zeran, R. M., R. S. Anderson, and T.A. Wheeler. 2006. Sap beetles (Coleoptera: Nitidulidae)

in managed and old-growth forests in southeastern Ontario, Canada. The Canadian

Entomologist 138: 123-137.

135

PALA iy Te 2g 2G a lextat whi arnt Mob etRalea

o = _—

~ Wales oe

; enn PA peti baestene: Tui cow ae |

ie: ei et eh Cee mre -

_P Yee

ig ae ai

La

“Kabob aelelgttcoR aeaTh atl nro Sooke

Yo stnogeetchasg cmeerienseo tiny

bon. may eigoquge cr; foabisnestens Di seted manly hay

, Foun ol SB TA cucpisoeienaetaae

DUET nokta pert: gneage leanne piV0 Anoka B

=. Gavi ue4 i

qt AW ETD Sobreh enol aueaing: b Gai ah nh

cms, Pablcommein Eetoraed

nétdes 4+ dee we euch. Loot Hors’. reer se

-~ apt oly eieetaOh slettoke

hve modiuoe iti woh deecoelyy seer gb OE naw

ns ee Qi eae? pian th vow eve ura

cade Awlobblnd 2am uk hos yoy

obit We toes aprceliaareg net wanngald s regoomnonnit

>» 19R" The vrnpenmed ht

(sabroyelranry J Te a dds ial bored gil rt eaamabrnent 02 ayes bls Y nf

aioli nguciset) demi’ woah besntads aieniibte

(satrtulisVcoeewla Vpeatiosd qa2 a00C z0leed WAT bie. noebak Bush vir

eaibane) ofl cabane) Sirint) ershesdaio alana Sartre ie

nicely Shae haeige a

nevCr\yi«’ ff Lh wo +) Scares ie Can

7

UVOWIAD « OT eres, Fi

“©

1! host ahi LA laity Of an fornte Mubligaliie

ay

ee A

fal, 4 A ati gn in cel Orthar wt it

yooreenti | Saiciety a Crwartey $94

*

a.

Ty 'atuliics 4 rT] } ViOWaIyY rope i ee }

for: (arttnrns and Canada. Pipe

af (apiarn ba Tae ion Se r -

‘4 reste ula ix i“), 37 yen) ft ‘hes we ye,

‘ ‘Tieueit, Y. Augrecadece Kcneat

shack ve we Se

Phyfee iho senbane ary

4 ann amok heals Res fie rt,

nike epee mM Mental Rear

Kin, aghokdte om

rite were: ewokb bias

Bees of the genus Hylaeus of Ontario JESO Volume 138, 2007

BEES OF THE GENUS HYLAEUS OF ONTARIO

(HYMENOPTERA: APOIDEA: COLLETIDAE)

TATIANA G. ROMANKOVA

Entomology, Department of Natural History, Royal Ontario Museum, 100 Queen’s Park,

Toronto, Ontario, Canada MSS 2C6

email: tatianar@rom.on.ca

Abstract J. ent. Soc. Ont. 138: 137—154

Eight species of Hylaeus Fabricius are reported from Ontario: H. affinis

(Smith), H. annulatus (Linnaeus), H. basalis (Smith), H. bisinuatus Forster,

H. mesillae (Cockerell), H. modestus Say, H. verticalis (Cresson), and

for the first time recorded for Canada, H. nelumbonis (Robertson). Five

additional species, H. fedorica (Cockerell), H. hyalinatus Smith, H. saniculae

(Robertson), H. sparsus (Cresson), and H. rudbeckiae (Cockerell & Casad)

have also been reported in the researched area, but were not found in the

collections examined. The Hylaeus flight period in Ontario starts in May

and continues until the last warm days in autumn. Identification keys for

male and female Hylaeus reported for Ontario are provided, in addition to

information on phenology and locality records.

Published November 2007

Introduction

There has been no comprehensive study of Hylaeus Fabricius (Colletidae) in

Ontario, but separate records of species found in the province are scattered in the literature

(Fye 1965; MacKay and Knerer 1979; Mitchell 1960; Usui 1994). As a result of studying

this group of bees at the largest collections of eastern Canada, knowledge about the

distributional ranges of discussed species has been considerably expanded. The material

examined yielded eight Hy/aeus species from Ontario. At least five more species are likely

present in the province. Three of these have been recorded in the literature from Ontario: H.

saniculae (Robertson) (Mitchell 1960; Snelling 1970; Hurd 1979), H. rudbeckiae (Cockerell

& Casad) (Mitchell 1960), H. hyalinatus Smith (Buck et al. 2005). In addition, H. fedorica

(Cockerell) has been recorded from “Canada” (Metz 1911, as H. grossicornis). Finally, H.

sparsus (Cresson) has been recorded “from southeastern Canada” (Snelling 1968). The first

annotated list of Ontario Hylaeus is presented herein, with distribution maps compiled from

studied specimens, and identification keys to the species for both males and females.

iS7

Romankova JESO Volume 138, 2007

Materials and Methods

All specimens examined are deposited in the entomological collections of the Royal

Ontario Museum (ROME), University of Guelph (DEBU), Canadian National Collection

of Insects (CNCI), University of Manitoba (EDUM), University of California (UCRC), and

North Carolina State University (NCSU). Wooden trap nests were also used by the author to

obtain additional material (Krombein 1967). Species morphological characteristics, flight

periods, and distribution data are based on specimens from these collections. Since I have

not examined any specimens of the additional species recorded for Ontario, the characters

given for them in the keys are taken from published descriptions or rely on examined

specimens from other regions (Ascher 2001; Metz 1911; Mitchell 1960; Osychnyuk 1978).

The distributional data are presented in the form of an annotated list and are illustrated

with maps. The locality records in the annotated lists are arranged from north to south

according to Ontario’s primary administrative divisions, but the terms “county”, “district”,

etc., are omitted. Distribution records from outside Ontario are given according to studied

collections and literature records (Ascher 2001; Buck et al. 2005; Dathe 1994; Hurd 1979;

Metz 1911; Mitchell 1960; Snelling 1966 a,b, 1968, 1970). The morphological terms used

in this paper were defined and illustrated by Michener (1944, 2000). The abbreviations are

as follows: F—flagellar segment, T—metasomal tergum, S—metasomal sternum. An asterisk

designates a species record new for Ontario (and Canada). More than 2500 specimens were

identified using Metz (1911) and Mitchell (1960). All existing determinations in the studied

collections were checked.

Genus Hylaeus Fabricius

Ontario bees of the genus Hy/aeus are distinguished from other members of the

provincial bee fauna by the following combination of characters: small to medium size (4-

9 mm); integument black, shiny, without noticeable pubescence; head, pronotum, tegulae,

and legs usually with yellow markings, which are more extensive in males; scopa absent.

Like other Holarctic Colletidae, Hy/aeus are defined by their short, truncate,

bilobbed glossa, and subantennal suture meeting the antennal socket at its inner side.

The flight period extends from May until the last warm autumn days.

Many Hylaeus species nest in hollow dead stems, others use different pre-existing

cavities (in wood, ground, etc.). Nest cells are made of cellophane-like secretion. Although

females have no scopa, pollen and nectar are carried in the crop. Provisions in cells are

liquid, and the egg floats on the surface of the provisions. Polylectic.

Key to Hylaeus species of Ontario

The brief species descriptions that follow the dashes in the couplets refer only to

the most distinctive characteristics for the particular species. Some frequently encountered

synonyms are given in brackets following the species name in the key. Distributional and

flight period data are included in the male key. Only males generally can be identified with

138

Bees of the genus Hy/aeus of Ontario JESO Volume 138, 2007

confidence; the identification of females is often tentative except for a few species (Metz

1911; Mitchell 1960).

Males. Clypeus always yellow. Antennae with 13 segments. Scape modified or not.

ks Mesepisternum with lamelliform carina between anterior and lateral faces. —S8

spatulate, protrudes conspicuously from genital opening in combination with long

slender gonostyli that extend far beyond apices of penis valves. T1 with white hair

fringes laterally on posterior margin. Malar area as long as basal mandibular width.

Body length 5-6 mm. Ontario: June-August. —Palearctic. New York .................05-

nea re nen es, Pook intaninheon hh Gees le H. hyalinatus Smith

Mesepisternum without lamelliform carina . ane tanh... aod

XM Front coxae angulate or toothed Laitceally: eich nal area nko etna than eye

width. Scape maculated. Paraocular yellow markings abruptly truncate at level

of antennae. Body ae 6 mm. —Quebec, New York, ps to Georgia,

Texas.. eas manancoley miionculnit 2ekal lean Asparsas\(Cresson)

Front coxae ee aS ON Cae EG ox tees EE 2 “a RR LIN ease 3

5 S3 with central eatiling: T1 with white hair fines laterally on posterior margin

NN so os cre old feaa ds. ianeda at hnncytvinde. RARER. Ih aorta, Bef use 4

— 53 eres swellings. T1 with or without hair fringes on posterior margin .......... 5

4. Scape transverse, wider than long, outer half yellow. S2 with swellings. —Labrum

and mandibles black. Supraclypeal area longer than half clypeal length. Antennal

sockets surrounded with elevation. Genal area as wide as eye at its widest part.

Pronotum and tegulae without yellow markings. T1 tessellate, with uniformly

close, shallow, minute punctures. Body length 8-9 mm. Ontario: June-August. —

Transcontinental (alpine in southern part of distribution) ...........H. basalis (Smith)

— Scape longer than wide, curved, yellow antero-laterally. S2 without swellings. —

Labrum and mandibles on inner margins yellow. Supraclypeal area not longer than

half clypeal length. Paraocular yellow marking with inner angle extending beyond

upper margin of antennal socket. Genal area narrower than eye width. Pronotal

collar, pronotal lobes, and tegulae with yellow marks. T1 tessellate, with uniformly

dense, shallow, minute punctures. Body length 4.5-6 mm. Ontario: June—September.

—From British Columbia to Eastern Canada, south to Utah, Louisiana, Mississippi,

eeeees reinw i iil 2. assleccice. H. affinis (Smith) (Prosopis ziziae Robertson)

ne Scape heart-shaped, with outer half yellow. —Paraocular yellow patches apically

truncate, reaching upper edge of antennal sockets at middle. Labrum and mandibles

without yellow markings. Supraclypeal area longer than half clypeal length. Genal

area wider than half width of eye. F1 short, transverse; F2 longer than F1, transverse.

Pronotal lobes with yellow markings, pronotal collar and tegulae without yellow

markings. Mesepisternum with deep, dense punctures less than diameter apart.

T1 without lateral hair fringes, tessellate, with evenly dispersed, minute, shallow

punctures. Body length 5-6 mm. Ontario: May—August. —Holarctic, south to

menial ceticlwaninlie i Hane ss. H.annulatus (Linnaeus) (H. ellipticus Kirby)

* Seanerparuleladedior completely black wait cg Aes Fle. A I a ce eeeeeeees 6

139

Romankova JESO Volume 138, 2007

10.

T1 with lateral white hair fringes on posterior margin. Scape without yellow marking

o Saavia San eitcsisolippile' Duane Soneuee pinch ct caxe lec epite rc e sical 7

Tl idiouk s Biacie on posterior margin. Scape with or without yellow marking

piwdien ed GL. AA a en aes. Saou ee 8

Pa giiblilie seilton markings extending along inner eye margins. Supraclypeal area

shorter than half clypeal length. Frons without impunctate spaces above antennal

sockets. —Scape curved. Mandibles and labrum black to completely yellow. Genal

area wider than half width of eye. Pronotal lobes and usually pronotal collar marked

with yellow. Scutum and mesepisternum with punctures well separated, mostly

diameter or more apart. T1 with dense fine punctures. Body length 4-6 mm. Ontario:

May-—September. —Alaska, transcontinental to California .......... H. modestus Say

Paraocular yellow markings narrow apically, expand from eye margin to upper margin

of antennal sockets. Supraclypeal area longer than half clypeal length. Frons above

antennal sockets with large, shiny, impunctate spaces. —Scape about twice as thick

as flagellum. Mandibles yellow, labrum black. Genal area equal to or narrower than

width of eye. Pronotal lobes and tegulae with yellow markings. Mesepisternum with

punctures more than diameter apart. T1 shiny, with sparse or dense, deep punctures.

Body length 6-7 mm. Ontario: May—September. —Transcontinental ..................

vase uptodate hock aA Se, ee H. verticalis (Cresson)

Seinienlinwel area shorter than half clypeal length. F1 as long as wide. —Scape and

pronotal collar without yellow markings. F1 shorter than F2. Malar area flat, 3 times

as wide as long. Genal area wider than half width of eye (4/5). Paraocular yellow

markings narrowly round apically, terminated above antennal sockets. Pronotal lobes

and tegulae with yellow markings. Scutum subrugose, with deep punctures less than

diameter apart. Scutellum shiny, with well separated punctures. Mesepisternum

hairy, with deep, large, confluent pits. Front tibiae outer and anterior faces, mid

tibiae basal third, hind tibiae basal half, all spurs and tarsi yellow. T1 ferruginous,

disk shiny, with punctures very sparse and obscure. S3 with slight central elevation.

Body length 7 mm. —Ontario, Illinois, Ohio, south to Louisiana, Alabama, Florida ..

Rea ...*H. nelumbonis Gieiblerisias)

Sephieheiedd area vile fie half elias length. F I transverses 1100 (Lee 9

Genal area not longer than half eye width. Mesepisternum with large, deep punctures

irregularly spaced. T1 disk and sterna with deep, distinct and abundant punctures. —

Paraocular yellow marking with upper extension slightly removed from eye margin.

Mandibles and labrum black, or labrum with yellow spot. F1 short, transverse; F2

longer, slightly transverse; F3 elongate. Pronotal lobes, tegulae and often pronotal

collar marked with yellow. Body length 4-6 mm. Ontario: June-August. —Holarctic,

south to California, Georgia .....H. bisinuatus Forster (Prosopis stevensi Crawford)

Genal area wider than half eye width. Mesepisternum with small punctures diameter

or less apart. T1 disk and sterna with sparse, shallow, minute punctures .............10

Mesepisternum shiny, tessellate, with deep punctures a diameter or less apart.

Paraocular areas elevated apically at antennal sockets. Face with depressions above

paraocular areas. —Scape and pronotum without yellow markings. Fl and F2 much

shorter than wide, F3 slightly transverse. Propodeum with long basal area wrinkled.

Body length 3.5-4 mm. —Ontario, Nova Scotia, to Minnesota, Tennessee, Georgia ..

snp on gelesen ls te eda ae cote H. saniculae (Robertson)

140

Bees of the genus Hylaeus of Ontario JESO Volume 138, 2007

ll.

B2:

Mesepisternum shagreened, with shallow punctures. Paraocular area not elevated.

Face without depressions above paraocular areas . on raz. ! ...10

Paraocular yellow marking narrowly tipped, euling it pide ‘ab rift sista —

Propodeal triangle mostly smooth, shagreened, with short, fine wrinkles basally. —

Scape with yellow strip anteriorly. Pronotal lobes without yellow markings. Body

length 4-5 mm. —Michigan, Minnesota, to Texas, North Carolina .....................

egpndnalane H. fedorica (Cockerell) (Prosopis grossicornis Swenk & Cockerell)

paaicular yellow marking narrowed at antennal socket, then clavate, bent towards

upper margin of antennal socket. Propodeal triangle mostly wrinkled .................. 12

Paraocular yellow marking with constriction wider than distance to inner orbit.

Pronotal lobes with yellow markings. —Scape with or without yellow marking. F1

and F2 transverse, F1 little shorter than F2, F3 elongate. Pronotal collar black. Body

length 4-5 mm. Ontario: May—October. —Transcontinental, to northern Mexico

....H. mesillae (Cockerell) (Prosopis cressoni Cockerell; P. telepora Lovell)

Paraocular yellow marking strongly constricted, separated from inner orbits by

much more than its minimum width at constriction. Pronotal lobes black. —Scape

without yellow marking. F1 half as long as F2, or shorter. T1 with distinct, regularly

spaced punctures; central impunctate space distinctive. Body length 4.5 mm. —

Transcontinental ...........cccccccceceeeeeseeeeeeeeeeeeeeeeedH, rudbeckiae (Cockerell & Casad)

Females. Clypeus black, rarely yellow apically. Antennae with 12 segments. Scape not

lb» & a

oS)

modified. Separation of H. modestus and H. affinis, as well as H. mesillae and H.

rudbeckiae is doubtful.

Mesepisternum with lamelliform carina between anterior and lateral faces. —Malar

area not shorter than half basal mandibular width. Mesepisternum with punctures

diameter or more apart. T1 with white hair fringes laterally on posterior margin.

Peeper vernyehti 95-6. Srinath). 028). AGN)... BR IAL, Oe H. hyalinatus Smith

Mesepisternum without lamelliform carina between anterior and lateral faces ........ 2

T1 without hair fringes laterally on posterior Margin ................. ccc ceseeeeeesteeeeeteee 3

T1 with white hair fringes laterally on posterior margin . eK Rc

Supraclypeal area narrowed between antennal sockets, eed spiGhllys and joining

frons at 45° angle. —Clypeus often with apical yellow patch. Genal area wider than

half eye width. Fl and F3 subequal, about as long as wide; F2 shorter, transverse.

Mesepisternum with small, deep punctures, diameter or less apart. T1 disk shiny, with

scattered fine punctures. Body length 5-7 mm. ................... H. annulatus (Linnaeus)

Supraclypeal area not narrowed between antennal sockets, not swollen apically ....4

Pronotal collar with yellow markings. Genal area equal to or narrower than half

width of eye. —F1 elongate, F2 short, transverse, F3 slightly transverse. Pronotal

lobes and tegulae marked with yellow. Mesepisternum with large, deep, irregularly

spaced punctures. T1 disc impunctate medially, anteriorly, and laterally with minute

Pumeranes) Bory Vert 4-6 ois i ci iseesesecneseeseceeseuceiens H. bisinuatus Forster

Pronotal collar usually without yellow markings. Genal area wider than half width

of eye. T1 disk shiny, with sparse, tiny punctures medially, dense laterally ............ 5

141

Romankova JESO Volume 138, 2007

T1 ferruginous. Malar area flat, three times as wide as long. Mesepisternum with large,

well separated to confluent pits. —Genal area as wide as eye width. F2 transverse, F 1

and F3 subequal, as long as wide, little longer than F2. Scutal punctures less than a

diameter apart. Scutellum shiny, with punctures about a diameter apart. Hind tibiae

yellow aoe fore and mid tibiae sometimes with yellow basal spots. Body length

6-7 mm. oad mnithhn ...H. nelumbonis (Robertson)

Tl — ahaha area wikiticgh aiid tiene teases with shallow punctures less

than-diameterapatt .v3 to.. oink waite nena ee ee Ga 6

Pronotal lobes ethane enarens mostly wrinkled. F2 and F3 transverse, shorter

than Fi. Body length 4-Simm tiixtinca dd. Dain ee eee

ise: peewee H. mesillae (Cockerell), H. rudbeckiae (Cockerell & Casad)

Pronotal lobes without yellow markings ........... +S amatge

Propodeal triangle mostly smooth, slendcbetasd Snlth short fine eirisikine basally. —F1

as long as F3, slightly transverse; F2 much shorter, transverse. Body length 4.5 mm

2 dae ../H. fedorica (Cockerell)

Prohedbiah eiidsigtes with imide Metaba area seviiidiitll vill te as ea as F3, or longer; F2

and F3 transverse. Body length 4.5 mm .................. eee H. saniculae (Robertson)

Genal area equal to or wider than width of eye. Pronotal collar usually without

yellow markings. T1 disk centrally punctured or not ................c.cccecceeeeeenseees 9

Genal area narrower than width of eye. Pronotal collar with yellow markings. T1

disk impunctatée centrallyouisiu4,..u eas. well eee ee eee ee 11

Genal area as wide as eye width. —F1 longer than F3, F2 short, transverse.

Integument with yellow markings. Pronotal lobes and tegulae with yellow markings.

Mesepisternum with small, deep punctures, more than diameter apart. T1 shiny, with

punctures scattered on disc ae dense on sides, or punctures almost invisible.

Body length 6-7 mm . 3 Lecce sseseeesessstttsseeeeessssseeed. verticalis (Cresson)

Genal area wider than iit as eye. mite: aie ...10

Integument with yellow markings. Fr ront coxae ~todihieda or -aipelieals on tinflen lies

Mesepisternum shiny, with small punctures a few diameters apart. —F1 as long as

F3, Fl as long as wide, F3 slightly transverse; F2 short, transverse. T1 shiny, with

sparse, obscure, exceedingly minute punctures. pee a 627 mandi vy. J fas. cont

../H. sparsus (Cresson)

ekasuaindios eaugieiihy bilick:! Bi ront coxae not spinose. «Miseuiitdraains with deep

punctures less than or equal to diameter apart. —F1 as long as F3, F2 transverse. T1

shiny, with punctures very fine and shallow. Body length 7-9 mm .....................

RRR. BAA... en es ae H. basalis (Smith)

nudity isteaintth with punctures more than diameter apart. Body length 5-6 mm......

xe. Didi te. Leathe EA ee H. affinis (Smith)

Wesapiotencnnd with punctures equal to or less than diameter apart. Body length 6-7

MIM 6) 39s si 12. Wee Qeee hh: elie cop ee er ale) H. modestus Say

142

Bees of the genus Hy/aeus of Ontario JESO Volume 138, 2007

Annotated list of Ontario Hylaeus

The species are listed in alphabetical order. The abbreviations of the names of the

collectors are as follows: AR—W. Attwater; AT—C. Atwood; BG-N. Bigelow; BK—M. Buck;

BL-S. Beiley; BR—-K. Barber; CL—S. Clark; ED—C. Edwards; GL—T. Galloway; KL-L.

Kelton; KN—G. Knerer; MK—P. MacKay; MN—J. Martin; PA—S. Paiero; PG—D. Pengelly;

RM-T. Romankova; SL-F. Sladen; US—M. Usui.

1. H. affinis (Smith)

Kenora: Oneside Lake, 25 July 1960, 4, CL; Jordan, 13 June—28 July 1914, 34, Ross

(CNCI). Rainy River: Pinewood, 22-28 June.1960, 34, KL; Fort Frances, 15 June 1960,

3, KL(CNCI). Thunder Bay: Fort William, 2 June 1915, 9, SL, det. H. Viereck (CNCI).

Algoma: Black Lake, 29August 1970, ¢, J. MacAlpine (CNCI). Parry Sound: North Bay,

9 June 1963, 3, W. Gague (CNCI). Renfrew: Calabogie, 14 June 1978, 4, M. Gunderman

(ROME); Rackett, 6 August 1953, 9, PG (CNCI). Carleton: Merivale, 7 August 1958,

3, M. Prime (DEBU); Ottawa, 8 June 1970, 2, N. Mills; 22 August 1958, 3, KL; 12-

20 June 1913, gd, 2, SL, det. Swenk (CNCI). Russell: Limoges, 19 July 1978, 9, E.

Fuller, R. Jaagumagi (ROME). Leeds: Chaffeys Locks, 10 July 1963, 9, J. Riotte, I. Smith

(ROME); St. Lawrence Isl., 31 July—14 August 1975, 34 (CNCI). Frontenac: Perth Road,

18 August 1957, ¢, J. Vockeroth (CNCI). Hastings: Marmora, 24 June—23 July 1952,

44, Ross (CNCI); Belleville, 26 June 1949, 4, MN; 15 August 1948, 4, MN; Trenton, 27

August 1905, ¢, Evans (CNCI). Haliburton: Algonquin Park, 14 August 1903, 22, EMW

(ROME). Muskoka: Severn Bridge, 9 July 1965, 2, R. Scott (ROME). Peterborough:

Peterborough, 26 June 1975, 2, F. Quan (ROME); Serpent Mounds P. P., 8 August 1983,

2, 6, GL (EDUM). Durham: Kendal, 19 June 1960, 9, KN, Rubus (ROME). Simcoe:

Simcoe, 19 June 1989, 3, Walley (CNCI). York: Toronto, 4 June 1959, 9, 4, Allium;

14 June 1914, 2; 7 July 1949, 2; 9, W. Brodie (ROME); 30 July 1953, 3, M. Hearst

(DEBU); 7-14 June 1896, 3; 42, 30 July 1893, 3; 21 June 1892, 9; 19 July 1891, g; 14

August 1890, 24; 19 August-2 September 1888, 24 (CNCI); Vivian, 22 June 1961, 29,

KN, Brassica (ROME). Bruce: Sauble Beach, 31 July 1977, 2, W. Maddison; Tobermory,

3-5 August 1977, 23, 52, W. Maddison; 10 July 1960, 9, KN (ROME); Hepworth, 27

June 1979, 24, B. Wit; Dyers Bay, 22 August 1952, 9, PG (DEBU). Dufferin: Primrose,

19, 27 July 1977, 6, AR (DEBU). Peel: Terra Cotta, 25 July 1999, 73,59, RM ; HWY

25 and Burhumthorp Rd., 2001, 34, 49, from nests, TR; Forks of the Credit, 16 June—29

August 1969, 264, 1139, MK; 4 June—12 August 1968, 42¢, 1259, MK; 22-28 June1965,

53, 112, KN (ROME). Wellington: Guelph, 3 July 1973, 3, PG; 13 June 1979, 3, D.

Levis; 26 June 1978, ¢, 2, M. Lichtenberg; 16-23 June 1978, 24, BR; 23 August 1977,

3, BR; 30 May 1962, 3, KN; 7 August 1952, 9, PG; Arkell, 6 June 1978, 23, S. Ball; 8

June 1978, ¢, N. Pierce; 26 May 1977, 24, BR; 11 June 1958, 4, PG; 25 July 1952, 2,

PG (DEBU). Halton: Hilton Falls, 16 July 1999, 2, RM; Speyside, 12 August 1999, 3,

2, RM (ROME); Burlington, 6 June 1984, 3, B. Sinclair; Oakville, 5 July 1978, <, P.

Jursevskis (DEBU). Huron: Goderich, 20 July 1977, 392, W. Maddison (ROME); Kinburn,

26 July 1957, 3, MN (CNCI). Wentworth: Dundas, 25 June 1980, 4, S. Beierl; 19 June

1978, 3, S. Ball; Hamilton, 25 June 1979, 2, K. Runciman; 27 June 1980, 3, S. Beierl

(DEBU). Lincoln: Grimsby, 19 June 1979, 3, M. Bailey; Vineland, 26 June 1956, ¢, C.

143

Romankova JESO Volume 138, 2007

Small (DEBU); Grassie, 31 May 1962, 3, KL(CNCI). Welland: Effingham, | September

1954, ¢ (CNCI). Brant: Ohsweken, 19. June 1979, 3, D. Morris; Brantford, Railway

Prairie, 24 August 2001, 9, PA (DEBU). Haldimand: Long Point, 3 June 1983, 2, T.

Thompson (ROME, DEBU); 18 June 1962, 4, G. Thorpe; Dunnville, 5 August 1954, 2,

C. Miller; Cayuga, 12 July 1925, 3 (CNCI). Middlesex: Komoka, Feed Mill Prairie, 11

July—11 September 2001, 54, 2, PA(DEBU). Elgin: New Glasgow, 27 June 1961, 3¢,

KL(CNCI). Norfolk: Turkey Point, 4 July 1962, 3, G. Thorpe; Normandale, 4 September

1954, 4, R. Lambert (CNCI); Delhi-Simcoe Railway, 7-21 September 2001, 4, PA, prairie

(DEBU). Kent: Rondeau Park, 16-21 June 1977, 3 22, (ROME). Essex: Point Pelee,

25 July 1979, 2; 23 June 1920, 29, BG (ROME); 25 July 1979, 2, AR; 8 September 1954,

3, KL (CNCI); Kingsville, 23 May 1962, ¢, KL (CNCI); 8 July 1977, ¢, BR; Windsor,

Ojibway Prairie, 5 June—21 September 2001, 24, 22, PA (DEBU); Leamington, 4-7 August

1985, 124, GL, 14 July—18 August 1987, 23, GL, (EDUM). Figure 1.

Localities other than Ontario: British Columbia, Manitoba, Saskatchewan, Québec,

Colorado, Wisconsin, Michigan, New York (CNCI, ROME).

45°

e H. affinis

FIGURE 1. Ontario collection localities of Hylaeus affinis.

2. H. annulatus (Linnaeus)

Kenora: Kenora, 13 June 1960, 4, KL; Oneside Lake, 24 June—27 July 1960, 73, CL;

Black Sturgeon Lake, 1963, 303¢ & 2 (CNCI); Vermilion Bay, Cedar Lake, 10 August

1959, 2, E. Cameron (DEBU). Rainy River: Gold Rock, 22 July 1905, 2, H. Newcomb,

144

Bees of the genus Hylaeus of Ontario JESO Volume 138, 2007

det. Stephen (EDUM); Pinewood, 22 June 1960, 43, KL; Finland, 21 July 1960, 3, KL

(CNCI). Thunder Bay: Macdiarmid, 22 June 1921, 2, BG (ROME); Manitouwadge, 12

June 1977, 3, M. Eimann (DEBU). Cochrane: Iroquois Falls, 10 August 1961, 22, KN,

Solidago (ROME); 22 June 1987, 3, J. Vockeroth (CNCI); Porquis, 10 August 1961, 9,

KN; Abitibi, Low Bush, 30 June—19 July 1925, 24,32, BG (ROME). Algoma: Wawa, 7

August 1992, 2, D. Bennett; 13 June 1977, 2, BR; 2 August 1976, 9, P. Heel; Erickson,

7 August 1979, 22, PG; Otasawian Lake, 17 August 1963, 32, KN (DEBU). Sudbury:

Sudbury, 1892, 32 (CNCI); Chapleau, 10 June 1992, 4, US; 5 June 1991, 24, US; 1 July

1990, 2°, US (DEBU). Timiskaming: Haileybury, 7 May 1916, 29, SL(CNCI). Nipissing:

Belwood, 23 June—13 July 1965, 32, ED (DEBU); Temagami, 22 July 1932, 9°, A. Brown

(ROME). Parry Sound: Sand Lake, 30 June 1926, @, F. Ide; Burk’s Falls, 15 July 1926,

3, F. Ide (CNCI); Killbear Park, 20 August 1978, 29, AR (DEBU). Renfrew: Petawawa,

7 June 1961, 4, J. Vockeroth (CNCI). Lanark: Bells Corners, 29 June 1945, 4, O. Peck

(CNCI). Carleton: Ottawa, 17 July 1963, 2, KN (ROME); 2 May-—29 July 1913, 82,

SL (CNCI); 5-16 June 1913, 44, 9, SL (DEBU); 12-20 June 1913, 29, SL (EDUM).

Glengarry: Algonquin Park, 14 August 1903, 2, EMW (ROME). Leeds: St. Lawrence

Isl., 18 July 1975, 4, C. Curran (CNCI). Hastings: Marmora, 11 July 1957, 9; 9 June 1957,

3S, K. Southern (DEBU); 12-24 July 1952, 2, J. Vockeroth; Trenton, 30 June 1905, 9;

22 June 1902, 4, Evans (CNCI). Muskoka: Port Sydney, 24 June—11 July 1919, 29, BG

(ROME). Simcoe: Orillia, 18 June 1924, 4 (CNCI). Bruce: Sauble Falls, 24 July 1977,

3, W. Maddison (ROME); Crane River, 16 July 1977, 2, D. Murrell; Tobermory, 30 May

1998, 4, D. Vaccari; Sauble Beach, 8 July 1981, 2, G. Aiudi; Dyers Bay, 24 July 1954, 9,

PG; 7 July—15 August 1953, 102, PG (DEBU). York: Toronto, 17 July—1 August 1891, 59

(CNCI); 23 June 1990, 2; 7 June 1914, 9, E. Walker; 19-28 July 1891, 29; 3 July 1890,

2 (DEBU); 7 July 1949, 4, (ROME). Dufferin: Primrose, 27 July 1977, 3, AR (DEBU).

Peel: Forks of the Credit, 4 July—18 August 1968, 289, MK; 2 July 1969, 3, MK; 9; Terra

Cotta, 2001, 34, 159, RM, from nests in wood (ROME). Wellington: Arkell, 7 June 1960,

3S, PG; 25 July 1965, 3, PG; Guelph, 3 June 1974, 4, I. Kigatiira; 20 August 1979, 3, J.

Ernst; 11 August 1977, 29, D. Murrell; 17 August 1976, 2, D. Levin; 2 August 1977, 9,

D. Levin; 14 June 1965, 22, 24, ED (DEBU). Halton: Hilton Falls, 16 July 1999, 2,

32, RM; Speyside, 12 August 1999, 3, 9, RM (ROME); Halton, 5 August 1981, @, G.

Aiudi (DEBU); Milton, 9 June 1978, 2’, J. Heraty; Campbellville, 10 June 1977, 22, AR

(DEBU). Huron: Brussels, 22 July 1963, 2, J. VanLoon (DEBU); Kinburn, 26 July 1953,

3, MN (CNCI). Waterloo: Oliver’s Marsh [Oliver Bog], 9 (DEBU). Wentworth: Borer’s

Falls, 1 June 1978, 4, N. Kevin (DEBU); Freelton, 27 July 1984, 3, M. Kasserra (DEBU).

Lincoln: Grimsby, 17 June 1894, 9 (CNCI). Haldimand: Cayuga, 6 August 1952, 2, PG

(DEBU). Essex: Kingsville, 9 July 1977, 9, AT (DEBU); 23 May 1962, 3, KL (CNCI).

Locality unknown: SSH, 19 August 1981, 2, G. Aiudi (DEBU); Ontario, 2 June 1906, °

(DEBU); 7 June 1961, ¢, J. Chillcott (CNCI). Figure 2.

Localities other than Ontario: Alaska, Yukon, North West Territories, British Columbia,

Alberta, Saskatchewan, Manitoba, Québec, New Brunswick, Nova Scotia, Utah (CNCI,

DEBU, ROME).

145

Romankova JESO Volume 138, 2007

50° P< 3

H. annulatus Ln |

90° as°

FIGURE 2. Ontario collection localities of Hylaeus annulatus.

3. H. basalis (Smith)

Kenora: Oneside Lake, 19 July 1960, 2, CL (CNCI); Martin, 20 July 1984, 4, 29,

ROM field party (ROME); 20 June 1984, 4, 29, R. Jaagumagi (DEBU). Thunder Bay:

Nipigon, 25 June 1895, @, J. Fletcher; Black Sturgeon Lake, 30 June 1962, 4¢, 29,

(CNCI). Cochrane: Abitibi Lake, Low Bush, 20 June—17 July 1925, 74, 72, BG (ROME);

Mattagami River, Smoky Falls, 22 June 1936, ¢, G. Walley (CNCI). Algoma: Sault Ste.

Marie, 7 July 1963, 2, D. Stotz (DEBU). Sudbury: Sudbury, 1892, 4; 10 August 1887,

S (CNCI); Chapleau, Racine Lake, 11 June 1992, 492, US; 4 June 1991, 2, US; 5 June-3

August 1990, 34, 112, US, on Early Goldenrod (DEBU). Timiskaming: Haileybury, 7

July 1916, 29, SL(CNCI). Carleton: Ottawa, 5 June—1 July 1913, 3,42, SL.; 1 July 1885,

2; 2 (DEBU); 14 June 1917, 2, SL; 13 June—22 July 1913, 44,42, SL(CNCI). Hastings:

25 July 1902, 2, Evans (CNCI). Haliburton: Dorset, 20 August 1961, 32, KN (ROME).

Muskoka: Macdiarmid, 12-19 June 1921, 6¢, 82, BG (ROME). York: Toronto, 20 July

1893, 2; 19-26 July 1891, 42; 4 June 1883, ¢ (CNCI). Bruce: Dyers Bay, 25 July 1954,

24,32, PG (DEBU). Figure 3.

Localities other than Ontario: Yukon, North West Territories, British Columbia, Alberta,

Saskatchewan, Manitoba, Québec, New Brunswick, Nova Scotia, Wisconsin (CNCI,

DEBU).

4. H. bisinuatus Forster

Algoma: Sault Ste. Marie, 13 July 1963, 2, D. Stoltz (DEBU). Grenville: Prescott, 29 May

1977, 2°, BR (DEBU). Haliburton: Dorset, 16 August 1961, 22, KN, Solidago (DEBU).

146

Bees of the genus Hy/aeus of Ontario JESO Volume 138, 2007

a ON VY OME 150, 2UU7

50°

45°

77 4 oe

H. basalis 7

ey

90° e

> \

FIGURE 3. Ontario collection localities of Hylaeus basalis.

50° wae

A H. verticalis

mw H. bisinuatus

eH. nelumbonis

wid gs°

FIGURE 4. Ontario collection localities of Hylaeus: H. bisinuatus, H. nelumbonis, and H.

verticalis.

147

Romankova JESO Volume 138, 2007

Victoria: Norland, 18 July 1961, 2, PG (DEBU). Durham: Kendal, 12 July 1961, ¢,

KN (ROME). Simcoe: Midland, 9 June 1974, 3, J. Huber (DEBU). Bruce: Dyers Bay,

19 July—17 August 1953, 22, PG; 10-28 July 1952, 22, PG (DEBU). York: Toronto, 11

July 1999, ¢, RM (DEBU). Peel: HWY 25 and Burnhamthorpe Road, 2001, 34, 42, RM,

from nests in wood (ROME). Wellington: Arkell, 24 June 1952, 2°, PG; Guelph, 14 June

1954, 9, R. Crawford; 7 August 1994, ¢, A. Rios; 12 July 1978, ¢, D. Morris; 9 June

1976, 2, C. Miller; 29 June 1965, 3, ED; 9 July 1961, ¢, S. Canetti (DEBU). Haldimand:

Cayuga, 25 August 1952, ¢, PG (CNCI). Lambton: Sarnia, Clear Water Nature Trail, 12

September 2001, 9, PA(DEBU). Kent: Fargo, 3 July 1959, 2, ¢, PG (DEBU). Essex:

Leamington, 18-19 August 1983, 4¢, 22, GL; 7 August 1985, ¢, 2, GL; 17 August 1987,

2,GL(EDUM). Figure 4.

Localities other than Ontario: British Columbia, Alberta, Manitoba, California (CNCI,

DEBU, ROME).

5. H. fedorica (Cockrell)

UNITED STATES, North Carolina: Raleigh, 24 April 1954, 2¢, T. B. Mitchell, on

Pyracantha (NCSU); 25 June 1950, 2, on Daucus carrota (NCSU). Texas: Dallas, 17 March

1907, ¢, R. A. Cushman Coll. [Prosopis grossicornis Swenk & Cockerell] (UCRC).

6. H. hyalinatus Smith

Halton: Oakville, 16 Mile Creek nr Hwy 407, 21 August 2004, ¢, 2, 25 June 2005, 4, M.

Buck (DEBU). Essex: W of Harrow, 28 June 1993, ¢, J. Doherty.

7. H. mesillae (Cockerell)

Kenora: Oneside Lake, 25 June—26 August 1960, 34, CL (CNCI). Rainy River: Rainy

River, 5 June—3 August 1960, 74, CL; Finland, 11-21 June 1960, 2¢,CL(CNCI). Thunder

Bay: Schreiber, 16 August 1962, 29, KN, Solidago (DEBU). Sudbury: Chapleau, Racine

Lake, 6 July 1990, ¢, US, raspberry (DEBU). Renfrew: Petawawa; 7 June 1961, 2, J.

Vockeroth (CNCI). Carleton: Ottawa, 31 May 1914, 2, SL; 5 May 1913, 9, SL; 24 June

1913, 29, SL(DEBU); 4 June—8 October 1913, 54, 62, SL; 15 August 1912, 9; 2 September

1888, 2; 4 June—7 July 1970, 22, N. Mills; 26 July 1955, 4, P. Taschereau; Constance Bay,

30 June 1959, 24, CL; Mer Bleue, 23 June 1952, 34, Chevell (CNCI). Leeds: Morton,

2 August 1961, 2°, KN, Apocynum (DEBU); St. Lawrence N. P., 20 August 1975, 30,

Sigler (CNCI). Hastings: Marmora, 26 May 1952, ¢, R. Lambert (CNCI). Haliburton:

Dorset, 16 August 1961, ¢, KN (ROME). Muskoka: Barrie, 16 July 1961, 29, KN, Rhus

(ROME). Peterborough: 5 July 1977, 2, 2, GL; Serpent Mounds P. P., 8 August 1983, 2,

GL(EDUM). Victoria: Coboconk, 14 August 1961, 2, KN, Rhus; Norland, 18 July 1961,

©, KN, Solidago (DEBU). Northumberland: Brighton, 13 July 1956, ¢ (CNCI). Simcoe:

Barrie, 16 July 1961, 2, KN (ROME). York: Toronto, 31 May 1914, 4; 30 June 1913, 9,

SL; 17 June 1896, 4; 16-30 July 1893, 29; 19 June—2 September 1891, 44, 49; 13 July

1890, 2; 9 September 1888, 4 (CNCI); 1 July 1999, 3, RM (ROME); 2 August 1991, 3; 20

June 1892, 24: 14 June 1891, 4; Keswick, 18 June 1976, ¢ (DEBU). Bruce: Dyers Bay,

14 August 1952, 24, 2, PG; 7 July 1953, 22, PG (DEBU); Kincardine, 28 May 1962, 3¢,

KL (CNCI). Peel: Forks of the Credit, 14 June—3 September 1968, 1969, 18¢, 442, MK,

Melilotus, Rhus, Prunus (ROME). Wellington: Guelph, 4 August 1979, 3, D. Murrell; 20

148

Bees of the genus Hylaeus of Ontario JESO Volume 138, 2007

July 1974, 2, J. Huber; 12 July 1965, 2, ED; 9 July 1961, 3, S. Caultti; 26 June 1956, 32,

PG; Arkell, 28 July 1952, 4, PG; 23 June 1959, 9, PG (DEBU). Halton: Georgetown, 30

August 1893, ¢ (CNCI). Huron: Kinburn, 26 July 1957, ¢, MN (CNCI). Wentworth:

Spencer Creek, 7 September 2003, 2, RM (ROME). Lincoln: Vineland, 7 June 1928, 22

(CNCI); Jordan, 24 August 1961, <4, G. Brumpton (DEBU). Waterloo: Oliver’s Marsh

[Oliver Bog], 21 August 1987, 22, D. Blades (DEBU). Welland: Wainfleet Bog, 14

September 1987, 2, Stirleeng (DEBU). Brant: Ohsweken, 19 June 1979, 3, D. Morris

(DEBU). Haldimand-Norfolk: Cayuga, 26 June 1911, ¢, PG; Delhi-Simcoe Railway, 27

July 2001, 2, PA (DEBU). Kent: Rondeau P. P., 16 June 1977, 9, field party (ROME).

Essex: Kingsville, 17 July 1955, 24, KL; Point Pelee, 4 June 1951, 3; 21 June 1927, 2, F.

Ide (CNCI); Harrow, 6 September 1959, 2, PG;.22 August 1972, 2, J. Huber; River Canard,

10 July 1977, 2, AR; Ojibway, 17 June 1980, ¢, D. Krailo (DEBU); Leamington, 18 August

1983, 2, GL; 4-7 August 1985, 59, 13 ¢, GL; 18 August 1987, 5¢, GL(EDUM). Locality

unknown: Crinif Bog, 8 May 1987, 2<, D. Blades; Figure 5.

Localities other than Ontario: North West Territories, British Columbia, Alberta,

Saskatchewan, Manitoba, Québec, Wisconsin (CNCI, DEBU).

50° ——

4

la

H. mesillae }

90°

ie

oP 80°

FIGURE 5. Ontario collection localities of Hylaeus mesillae.

5°

8. H. modestus Say

Kenora: Oneside Lake, 9 July 1960, ¢ (CNCI); Martin, 20 August 1888, 2; 20 June 1984,

2 (ROME). Rainy River: Minahico, 27 July 1962, 6, KL (CNCI). Thunder Bay: Healy

149

Romankova JESO Volume 138, 2007

Falls, 7 July 1987, 22, GL (EDUM). Algoma: Wawa, 7 August 1992, 9, D. Bennett;

Algoma, 7 August 1977, 2, Crins (DEBU). Nipissing: Opeongo Lake, 25 July 1981, 9,

Brown; Keswil, 5 June 1975, 3, T. Sawingal (DEBU). Parry Sound: Killbear Park, 30

June 1979, 3, AR; 17-20 August 1978, 29, AR; Powassan, 12 July 1978, 29, S. Ball;

11 July 1978, 3, J. Cappleman (DEBU); Port Elwin, 8 June 1955, ¢ (CNCI). Renfrew:

Hills, 14 July 1978, 9, M. Lichtenberg (DEBU). Carleton: Merivale, 30 July 1958, 9, M.

Prime; Ottawa, 8 September 1913, 2, SL; 12 June 1914, 9, SL (DEBU); 22 July 1913,

SL (EDUM); 22 July 1955 , 4, P. Taschereau; 164, 299; Constance Bay (CNCI); 4 mi E

Carp, 10 July 1950, 32, W. P. Stephen, Lonicera (EDUM). Glengarry: Alexandria, 13

July 1978, 3, E. Fuller (ROME). Grenville: Prescott, 29 May—30 July 1977, 24, 2, BR

(DEBU). Leeds: Morton, 2 August 1961, ¢, KN, Apocynum (ROME). Hastings: Madoc,

23 July 1947, 3; Marmora, 5 June 1952, 4, CL; Trenton, 17 August 2000, 2¢; Belleville,

15 June 1962, 4, KL; Bancroft, 18 June 1962, 4, KL (CNCI). Haliburton: Haliburton,

11 September 1957, 2, P. Muller; Dorset, 20 July—16 August 1961, 32, KN, Solidago,

Trifolium, Melilotus; (DEBU). Muskoka: Port Sydney, 13 July—1 August 1919, 29, BG

(ROME). Peterborough: Lakefield, August 1983, 9, GL(EDUM). Victoria: Norland, 18

July 1961, 22, KN (ROME). Northumberland: Crowe Bridge, 18 July 1979, 2, AR; 17

July 1979, 2, BL; 18 July 1977, 2, BL; Healey Falls, 18 July 1979, 2, B. Wit (DEBU).

Simcoe: Orillia, 25 July 1924, 4, H. Viereck, (CNCI); Midland, 26 June 1970, °, J. Huber

(DEBU). York: Oakwood, 18 July 1961, 29, KN, Melilotus; Toronto, 1 July—18 August

1999, 23, 39, RM, Vicia; 27 June 1965, 22, KN (ROME); 164, 2592 (CNCI); Leaside, 4

August 1961, 22, G. Brumpton (DEBU); 9, KN, Trifolium; Hope, 15 June 1929, 3, M.

Dennis (ROME). Bruce: Tobermory, 6 August 1977, 29, D. Maddison; Bruce Peninsula,

10 July 1960, 22, KN, Rhus (ROME); 8 June 2000, 2, C. Onodera; Sauble Beach, 9 July

1981, 82, G. Aiudi, Kircher (DEBU); Hepworth. Grey: Owen Sound, 4 July 1979, 3, B.

Wit; 21 August 1976, 2, P. Heels (DEBU). Peel: Forks of the Credit, 2 July—21 August

1969, 3, 2332, MK; 14 June—23 July 1968, 354, 42, MK, Melilotus; 28 June 1965, 34,

112, KN (ROME); 26 June 1973, 4, PG (DEBU); Terra Cotta, 25 July 1999, 6¢, 72, RM

(ROME). Wellington: Ariss, 27 May 1962, 4, KL; Niagara Falls, 8 June 1962, 4, KL

(CNCI); Belwood, 5-30 July 1972, 3, 2, PG; 5-16 July 1973, 3,59, PG; 19 June 1982, 20,

PG; Arkell, 14 June 1973, 3, PG; 26 May 1977, 3, BR (DEBU); Guelph, 31 May 1962, 4,

2°, Cornus, Helianthus (ROME); 18 August 1964, 2, B. Wyatt; 16 June—September 1994,

32, Brewen; 8 June 1991, 2, M. Castillo; 22 July 1979, 29, J. Corrigan; 30 August 1978,

©, Kreuzer; 5 July 1977, 292, AR; 23 July—23 August 1977, 23, BR; 12 July 1974, 2, J.

Huber; 27 June 1974, ¢, Kigatiira; 22 July 1974, 392, Eden; 19 August 1973, 3, Smith; 4

July 1956, 2°, PG; Rockwood, 12 June 1981, 3, Kircher (DEBU). Halton: Speyside, 12

September 1999, 4°, 492, PM; Hilton Falls, 16 July 1999, 22, RM (ROME); Oakville, 31

July 1976, 2, AR; Milton, 9 June—6 July 1978, 32, Heraty; 27 June 1979, 3, J. Huber;

Halton, 6 July 1978, 4, 2, J. Cappleman; Campbellville, 10 June 1977, 6, BR (DEBU).

Huron: Maitland, 20 July 1977, 52 (ROME). Perth: Listowel, 27 May 1965, ¢, KL

(CNCI). Waterloo: Hespeler, 18 June 1962, 6, KL (CNCI). Wentworth: Ancaster, 24

June 1955, 4, O. Peck (CNCI); Stoney Creek, 12 July 1980, 2, R. Thomson; Dundas,

11 June 1980, 54, C. Bolter; Spencer Gorge, 18 August 1993, 2; Hamilton, 3 July 1979,

3S, S. Beierl; 27 June 1980, 4, S. Beierl (DEBU). Lincoln: Jordan, 3; Vineland, 7 June

1979, 3, BL; 14 June 1977, 22, BR; Grimsby, 19 June 1979, 9, BL; 21 June 1978, 3,

150

Bees of the genus Hy/aeus of Ontario JESO Volume 138, 2007

M. Lichtenberg; 19 June 1978, 2, BL; 14 June 1977, 2, AT (DEBU). Welland: Thorold,

1 July 1984, 32, Gilberg (DEBU). Brant: Brantford, 24 August 2001, ¢ PA (DEBU).

Haldimand: Dunnville, 3 August 1962, 4, KL; Peacock Point, 3 September 1954, <4, C.

Miller; Dunn Twp, 9 August 1990, 2 (CNCI). Middlesex: Komoka, Feed Mill Prairie, 27

July—13 August 2001, ¢, PA(DEBU). Elgin: St. Thomas, 19 July 1955, 4 (CNCI); Orwell,

14 June 1978, 4, M. Lichtenberg (DEBU). Norfolk: St. Williams, 27 May—3 June 2000,

73, BK; 7 September 2001, 2, BK; Delhi-Simcoe Railway, 27 July 2001, ¢, PA (DEBU).

Kent: Rondeau Park, 21 June 1977, 2¢, 22, D. Maddison (ROME); 10 July 1960, 2,

CL; Chatham, 23 August 1913, ¢, SL; Bothwell, 4 July 1962, ¢, CL (CNCI). Essex:

Point Pelee, 31 July 1960, 2¢, 2, KN; 30 June 1920, 6, BG (ROME); 1 June 1982, 3, C.

Hare; 13 June 1979, 4, D. Morris; Windsor, Ojibway Prairie, 5 June—3 July 2001, 32, PA

(DEBU); Kingsville, 23 May 1962, ¢, KL (CNCI); 8 July 1977, 9, Innes; 8 June—8 July

1977, 23, 42, BR; 8 July 1977, 52, AR (DEBU); Leamington, 19 August 1983, 114, 112,

GL; 4-7 August 1985, 104, 102, GL; Weatley, 15 August 1982, 3, 2, GL; 19 August 1987,

22,GL(EDUM). Ontario: Port Perry, 1 August 1934, 9°, F. Urguhart (ROME). Locality

unknown: Lake Superior, 29 June 1961, 2, KN, Rubus (ROME). Figure 6.

Localities other than Ontario: Alaska, North West Territories, British Colombia,

Saskatchewan, Manitoba, Québec, New Brunswick, Nova Scotia (CNCI, DEBU, ROME).

50° —-

5°

a

4

H. modestus

90"

ih 80°

\

FIGURE 6. Ontario collection localities of Hylaeus modestus.

9. *H. nelumbonis Robertson

Norfolk: Long Point, 199?, 72, ¢ (Dr. L. Packer’s Collection). Figure 4.

Localities other than Ontario: UNITED STATES, Ohio: Put-in-Bay, S. Bass Isl., 11 July

151

Romankova JESO Volume 138, 2007

1920, 2, ¢, C. H. Kennedy Coll. (UCRC); North Carolina: Wenona, 27 May 1925, 9, T.

B. Mitchell (NCSU). Louisiana: opp Orange, Sabine R. Ferry, 20 June 1917, ¢ (NCSU);

New Orleans, 13 March 1955, 2, ¢, R. R. Dreisbach [Homotype: Prosopis nelumbonis

Robertson].

10. H. rudbeckiae (Cockerell & Casad)

UNITED STATES, California: Riverside, 2 September 1935, 2, Timberlake Coll.

(UCRC)

11. H. saniculae (Robertson)

UNITED STATES, Tennessee: Gatlinburg, Sm. Mt. N. P., 25 June 1947, 4, T. B. Mitchell

[Homotype: Prosopis saniculae Robertson] (NCSU). Michigan: Mecosta Co., 25 July 1951,

2, R. R. Dreisbach (NCSU); Alcona Co., 27 July 1946, 2, R. R. Dreisbach (NCSU).

12. H. sparsus (Cresson)

UNITED STATES, North Carolina: Mt. Pisgah, 23 June 1934, 22, T. B. Mitchell

(Homotype: Prosopis thaspii Robertson; Homotype: Prosopis sparsa Cresson] (NCSU).

13. H. verticalis (Cresson)

Kenora: Black Sturgeon Lake, 4-8 July 1962, ¢ and 81°; Oneside Lake, 2 June 1960, 2,

CL(CNCI). Sudbury: Chapleau, Racine Lake, @, US (DEBU). Carleton: Ottawa, 3 June

1986, 2, H. Goulet; 11-20 June 1913, 94, SL (CNCI); 18-20 June 1913, ¢, 2, SL; 7 June

1914, 9, SL(EDUM). Hastings: Trenton, 31 May 1896, @, Evans (DEBU). Haliburton:

Minden, 11 September 1957, 2, McMullen; Algonquin Park, 22 August 1993, 2, C. Jons

(DEBU). Northumberland: Hastings, 1895, ¢, Evans; Alderville, First Nations Prairie,

1 September 2001, 2, PA(DEBU). Prince Edward: Picton, Smith Bay [Smith’s Bay], |

July 1970, 2, J. MacAlpine (CNCI). Bruce: Dyers Bay, 19 July—19 August 1953, 52, PG

(DEBU); Bruce Peninsula, 10 July 1960, 2 (ROME). Peel: Caledon East, 28 June 1980, 2,

C. Beierl (DEBU). Wellington: Bellwood, 13 July 1965, 2, ED: Arkell, 2 June 1952, 2,

PG; Guelph, 10 August 1951, 2, PG (DEBU). Halton: Halton Lake, 2001, RM (ROME),

from nests in wood, 3¢. Lincoln: Jordan, 21 June 1919, 3, C. Cunra (CNCI). Essex:

Leamington, 4 August 1985, 2, GL (EDUM); Windsor, Ojibway Prairie, 31 July—3 August

2001, ¢, PA(DEBU). Locality unknown: Ontario, 26 June 1886, ¢ (DEBU). Figure 6.

Localities other than Ontario: British Columbia, Alberta, Saskatchewan, Manitoba,

Québec, New Foundland (CNCI).

Acknowledgments

I am thankful to D. Currie, C. Darling, and B. Hubley (Royal Ontario Museum),

S. Marshall and M. Buck (University of Guelph), J. Huber (Canadian National Collection),

and L. Packer (York University), who made the collections under their care available to me

and who were very supportive during my work on this paper. My thanks are also extended

to R. Roughley (University of Manitoba), D. Yanega (University of California, Riverside),

and R. Blinn (North Carolina State University) for providing specimens from collections

152

Bees of the genus Hy/aeus of Ontario JESO Volume 138, 2007

at their respective institutions. Special gratitude goes to J. Huber, H. Frania, M. Buck,

and anonymous peer reviewers for their thorough reading of the manuscript and valuable

comments, and to L. Packer and J. Grixti (York University) who kindly agreed to test the

keys and also provided important comments. I am very thankful to M. Buck for allowing

me use his yet unpublished locality information on H. hyalinatus. I am thankful to the

members of the Board of Directors for providing me with assistance for this publication.

My deep appreciatation goes to my husband, Alexander, for his enthusiasm in exploring

Ontario bees.

References

Ascher, J. S. 2001. Hylaeus hyalinatus Smith, a European bee new to North America,

with notes on other adventive bees (Hymenoptera: Apoidea). Proceedings of the

Entomological Society of Washington 103(1): 184—190.

Buck, M., S. Paiero, and S. Marshall. 2005. New records of native and introduced Aculeate

Hymenoptera from Ontario, with keys to Eastern Canadian species of Cerceris

(Crabronidae) and eastern Nearctic species of Chelostoma (Megachilidae). Journal

of the Entomological Society of Ontario 136: 37-52.

Dathe, H. H. 1994. Studien zur Systematik und Taxonomie der Gattung Hylaeus F. (Apidae,

Colletidae). 1. Hylaeus annulatus (L.) eine holarktische, Hylaeus aborigensis sp.

n. eine neue sibirische Art. Beitrage zur Entomologie 44: 441-445.

Fye, R. E. 1965. Biology of Apoidea taken in trap nests in Northwestern Ontario

(Hymenoptera). Canadian Entomologist (97): 863-877.

Hurd, P. D. 1979. Superfamily Apoidea, pp. 1741—2209 Jn Catalog of Hymenoptera in

America North of Mexico. Vol. 2. K. V. Krombein, P. D. Hurd, Jr., D. R. Smith,

and B. D. Burks (eds.), Washington: Smithsonian Institution Press.

Krombein, K. V. 1967. Trap-nesting wasps and bees: Life histories, nests and associates.

Washington: Smithsonian Press. 570 pp.

MacKay, P. A., Knerer, G. 1979. Seasonal occurrence and abundance in a community of

wild bees from an old field habitat in Southern Ontario. Canadian Entomologist

111(3): 367-376.

Metz, C. W. 1911. A revision of the genus Prosopis in North America. Transactions of the

American Entomological Society 37: 85—156.

Michener, C. D. 1944. Comparative external morphology, phylogeny, and a classification

of the bees (Hymenoptera). Bulletin of the American Museum of Natural History

82: 151-326.

Michener, C. D. 2000. The Bees of the World. Baltimore & London: Johns Hopkins

University Press. 913 pp.

Mitchell, T. B. 1960. Bees of the eastern United States, 1. North Carolina Agricultural

Experiment Station Technical Bulletin No.141: 1-538.

Osychnyuk, A. Z., D. V. Panfilov, and A. A. Ponomareva. 1978. Apoidea, pp. 279-519 Jn

Species of Insects of the European Region of the USSR. Vol. 3, Hymenoptera. V. I.

Tobias (ed.), Leningrad: Zoological Institute, Academy of Sciences of the USSR.

[In Russian].

153

Romankova JESO Volume 138, 2007

Romankova, T. 2003. Bees of the genus Colletes of Ontario (Hymenoptera, Apoidea,

Colletidae). Journal of the Entomological Society of Ontario 134: 91-106.

Snelling, R. R. 1966a. Studies on North American bees of the genus Hy/aeus, |. Distribution

of the western species of the subgenus Prosopis with description of new forms.

Contribution in Science, Los Angeles County Museum of Natural History No. 98:

1-18.

Snelling, R. R. 1966b. Studies on North American bees of the genus Hylaeus, 2. Description

of anew subgenus and species. Proceeding of the Biological Society of Washington

79: 139-144.

Snelling, R. R.1968. Studies on North American bees of the genus Hy/aeus, 4. The subgenera

Cephalylaeus, Metziella and Hylaeana (Hymenoptera: Colletidae). Contribution

in Science, Los Angeles County Museum of Natural History 144: 1-6.

Snelling R. R. 1970. Studies on North American bees of the genus Hy/aeus, 5. The subgenera

Hylaeus s. str. and Paraprosopis. Contribution in Science, Los Angeles County

Museum of Natural History 180: 1—59.

Usui, M. 1994. The pollination and fruit production of plants in the boreal forest of Northern

Ontario with special reference to blueberries and native bees. M. Sc. Thesis,

University of Guelph, Guelph, ON. 278 pp.

154

EEE a

hn

Snc cd

Sal

Jom Mw

7. ~. Av"). skies Of-° . vi eth’ Lanesboro ae

t: 2. pee: pha ene =~

af a rare subz ves wit) | pei Prensa a ey jen Betty 0

7. Pat +e at :

: @, } Oa). S0odies Of ~emthy American hook MOR age ed at

riudviange, Mectlle 1a Artaine, Otyienontent Cola:

% as : 3 ‘ . on eres ae x as ‘ a

base a isd fe ae CA Si a Nhe ee

ms

ay

ie ae

oe

"i ye

im Seirzent, Loo Adgeles Cratly Rignaeagieesa egy 71-7 = —

Nylons > ef. Mi Pane. Consign bi Lag comieg Las A

Stina uf Natoral History 1 Ale be S?, 7 i. fy, 20 hee

1 the pullnation sad tad ginoducticnt if, prhaiats

Once with specail refatoce ty, tiluclgeriie:

Untversiny of Gueiph, Ouetph ON; 238 pp. ae

*

’

Ce -?

*

2006 ANNUAL MEETING

The 143" Annual Meeting of the Entomological Society of Ontario took place from October 27" to the 29",

2006 with the theme “The Many Facets of Entomology”. As is becoming usual, there was an impressive number

of students at the conference, as well as professional entomologists from around the province. Plenary talks at

the meeting were delivered by Sander Koenraadt (Cornell University), Roger Quinn (Case Western Reserve

University), and Elizabeth Tibbetts (University of Michigan). Additional highlights included several awards

and expressions of appreciation. Dr. Glenn Wiggins became a new Fellow of the ESO. Richly deserved service

awards were presented to several individuals whose work has contributed to ‘the many facets of entomology”

in Ontario: Yves Prévost (former Editor of JESO), David Pree (formerly a JESO Associate Editor), and

Dana Gagnier (former Editor of the ESO newsletter). Last but not least, President’s Prize Awards awards for

outstanding student presentations were made to Amy Sharp (Brock University) and Hien Ngo (York University).

The conference was supported by generous contributions from the University of Guelph, Wings of Paradise

Butterfly Conservatory, Firefly Books, BASF, Bayer CropScience, Engage Agro, Syngenta Seeds, NK Seeds

(Syngenta), Pioneer DuPont, MGS Horticultural Inc., and Laresco. Further details of the 2006 Annual Meeting

can be found in the Autumn 2006 issue of the ESO Newsletter, available on the ESO website.

ENTOMOLOGICAL SOCIETY OF ONTARIO

The Society founded in 1863, is the second oldest Entomological Society in North America and among the

nine oldest, existing entomological societies in the world. It serves as an association of persons interested in

entomology and is dedicated to the furtherance of the science by holding meetings and publication of the Journal

of the Entomological Society of Ontario. The Journal publishes fully refereed scientific papers, and has a

world-wide circulation. The Society headquarters are at the University of Guelph. The Society’s library is

housed in the McLaughlin Library of the University and is available to all members.

An annual fee of $30 provides membership in the Society, and the right to publish in the Journal and receive

the Newsletter and the Journal. Students, amateurs and retired entomologists can join free of charge but do not

receive the Journal.

A World Wide Web home page for the Society is available at the following URL:

http://www.entsocont.com

FELLOWS OF THE ENTOMOLOCIAL SOCIETY OF ONTARIO

W. W. Bill Judd 2002

C. Ron Harris 2003

Edward C. Becker 2003

Glenn Wiggins 2006

APPLICATION FOR MEMBERSHIP

Name:

Address:

Postal Code:

Please send cheque or money order to:

D. Hunt, Secretary, Entomological Society of Ontario

c/o Agriculture and Agri-Food Canada G.P.C.R.C.

2585 County Road 20, Harrow, ON, NOR 1G0

NOTICE TO CONTRIBUTORS

Please refer to the Society web site (http://www.entsocont.com/pub.htm) for current instructions to authors,

which were last printed in Volume 131 (2000), pages 145-147 and can be updated at any time. Copies of those

ve \ instructions are available from the Editor.

..

CONTENTS + ey ae

I. FROM THE EDITOR. Sis ae vieweonsentsatectatiaiatstipiimete neni

If. FROM THE SPECIAL EDITOR... anette a

Ii. SUBMITTED MANUSCRIPTS

J.T. HUBER and E. BAQUERO. — — Review of Bist a rarely oe nus of

Mymaridae (Hymenoptera).| .................:--idsrntsesbedckactssusetaren tee oie

Pe el

I a

J. M. HERATY and D. C. DARLING. — A new genus and species of Perilampi¢ dae

(Hymenoptera: Chalcidoidea) with uncertain placement in the family. ............

B. WHITTOME, R. I. GRAHAM, and D. B. LEVIN. — Preliminary examination of

gut bacteria from Neodiprion abietis (Hymenoptera: Diprionidae) larvae. .......4 9-63

O. LONSDALE and S. A. MARSHALL. — Revision of the North Ame

Sobarocephala (Diptera: Clusiidae, Sobarocephalinae). ................. eile 65-106

D. B. MCCORQUODALE, J. M. BROWN, and S. A. MARSHALL. — A decli ne in

the number of long-horned wood boring beetle er Cerambycidae) species

in Ontario during the 20th century? ........4:::<c..«e-cstesveestssssuusenes eee .... 107-135

vi

T. G. ROMANKOVA — Bees of the genus Hylaeus of Ontario (Hymenoptera:

Apoidea: Colletidae). ...............-s:sss.cscesestesésbssdessentetessrshedseoneataaena 137-154

g

IV. ENTOMOLOGICAL SOCIETY OF ONTARIO inside back cover

V. APPLICATION FOR MEMBERSHIP ~ inside back cover

s

VI. NOTICE TO CONTRIBUTORS inside back cover

ai

‘TOA

= (& pide baad « Meee

hile Pie, Co a8 =) Sawn f oy S=ie-

4, «kt -€e ote Gabe

Prcesiqelgl Park, Leeterte eee

‘a Be

“i

.

~ ar w pt apy Boe i dd

& my a, B,

eS Le see byteen

~ a-¢ 2

a OAc ee

.

.

*

é So ae “

io | @

re ee

4 ~

¢ ¢ »

uy 2% WPLY

|

HO AO

3 2044 118 666 171

a ee ee

ae ed

Lee a er ce Pr

tree

re)

Char erin

any meee

Pent whimy

Nie gien RANS Kia aads vasa e

amisypd papers a

oC Lnys Orne

FH MRR: A, en, 8 sn Geothoae,

AN SEMIND ID EE ENA SOL einai ay Siva, Bin Coe iy

Wms ar dient apa imapetepuenza ve

eV MALE teeynsy be

SV VEN vente ee

wots

ee ees

AON ahaa Naat

1A we aig Oe

TNO deed apne

Om ea mea are

7844 Sane

er nang

VPS e mye cate

Corer

ee)

Pysce syns ae

PORUATS Oe ae

eo Caen

Pore rye

,

Fe emee an we

wae

en ees

ny

cere

APSE K A Ae

Sy Re ete hh eke

CNM

AR ene habe

Sun yene

VE We

avin

Sonne eat

Seat Penytes

SURO Pm te SO Peete

a Cras Senet ny

wy

" Tanne aye

BON BOR eR RG ey A

10 Aenean my Oy =

Am 6p tyme,

Bt dhe be ay

On WO era

ayaa,

VP ree menpe

ae

Meter ©

my ND ay

rape

Poe)

WA ee ener a Larrige,

ae ags Ne nis, AYA TN Ane,

Sa toy ty Puen evra

a WOME Wop Manes) \pssaney aaa v pry PMU ee wees

Up Wrists b AD osan by Mckee : PAESERDAYANE Magy ae

SY Urnsivvamycaraess w

yous IW UAE UND Uaur grup atQd Spay ane et tarey APACS

evens PHPPASUS INS eres HWE NUEON od oe Sorcery

PAU MOUP SIH LE- AN CEL ED tte etme tine

Pere ;

se tyeyts tas AUTO ARLE G4 OD EP ELuEee UNe eT

rere voyeasar ia

ae CLR set ea

Hoe ntyasegang. >

ty Em

PMOL UN Wer ee eipe tne

Me ER REM INGAT SCA HF

Sgt

Ree APE A,

Weis

PCa Ee ee

NEN Petey

2 RRA RAR, STE Re moka ney may

youn vpne Cr ee

my Weare MWe yee Ny VER PL Meee map tae

Pe RULE nies {BoM NOES ONES antag

SPAM Weng 8G whan wanes 2A MORE TEAL ray Seg

' MMER Re a LY OP Le

PAA NAL ES I LP sea ie REAR Le One uey PP gae te PE AY Mee Pan ie OM AD SANE ct) MA iH NG ex BUD ADA Penn

een “eycrit jane Ta ee ea TARP MON PL CO LEAST ELAN eae Weaeuey HD OWN Ne eat tes rsd ae PAPAL WOM ENS ty pi tie dak Se at

Ua RAKED \ npc Henao ie a OR te et Wie cre one oa date PMR NBN So Wy 8 Be MAU tone Sy oe

eat acc a ee ROE Ts Ui oe oh Cal a Be VANES VERN UN I Ys ee Gane EN op ’ Le ges AR AES Sot dea speed A

ree g i! © vik whe ape ete tk ELIA UT Os ayes i Amy ae mlts ge : a Sb 1H Kye Mt By eth on

Aas Wwe ey man red MP ew yy wove ree Seb bey He Mant A EM

‘ Re beh Syrah i toaee whe Wy Stier SRE pA Py Lehner ete rd ee ae PY SST

» ; dw VEO tage AAEM UAWE OT bea [6 te be Ee Rea Wha eM ee bait +e Maen, th s Soy Ev A MME MC tee dep nyt a

SWE WS pte vege aur ee Cl eee Whe avn oye w , hk Wh : ‘

aot Satan ci aytat yr tena pein’ Be rita Na antane s mARiae cs bah eta bee mh Sreere wa ie usin fet aa rey

ba RT ergy SIRES Ur UE ee a ye usual ve ba ye ne es Mae y WYTN ORDA L RP LE as Ut ho tae A A MANE AIT Gs A AN Ay Uh GUY Yee AY AY Sacer ae ta ay tls te ry AY

ati, ae Hi ne bs " Na WRIA er ae Lye ge MPa aes augy EW NA) Aare Peay eg

, Pye ot ytenns ge aay Fue Aap eet VP Whig, bel MVE Py Ver hgeney, W phew igs wren SUe NEAR MS NT ag ay eg

ue wee Ye aa TVR ASE ane yay Une Wy be ge yt vibe Oe Lars vee EN ON he fe

ter seyren Actes eae e DESPA UE MEME NF Rw POP han peat PR Ae GU CPS tae

at rWideinwea tate: 4 S7 EMT vay aU URAL Wiel weary vey PW Ee CE ae yy he ens Wer halg, We tov nee

TNT GS ry BAPE MSG ME Wate Bae ange An beds qe ye WEEDS VEG RUE ELLE ne dy gee WG eee WAP Mee

wey SP VE EPA BS NP AN We YE LE a Watt WA WEDS ye ge eg coer m oy eny

HU TYE VE ye WME WE eae yey VOSA at veya :

Pyeng e ye PAY OW ROUT WF WN yt \

WP PE er Ws ye WUT WY We yE ie ye i"

ee ee PY

Pe RS MEU we AS Wi a a

SESTUE VES ORNS VR Qe 8 ge gee WPS LL Ep ae ae

8 Yr phy

Cea eee ee SE MEMS FYE Ls ye ye Be yn

eS RPE UME be vr ue Mtge RE ye WUUs Heung a

RAT MPEP UT UN Qe ire

‘y

SEAL IEE PE Bip Oy tye

Nd

PME ELE

HLT yt teat oe

Vy

WE oe AWAD Mt ve

Tey

4

ae

4 t

VEER) RU UY ROL Ry

oP RY DAN AY

ye NS

‘W

AWE ae ot PAE YY Ae ov EM PEA Sy tay

Kk ee eer i Rte EE eT) MGR irs mR Rd

err a SELES We ye SEM FE od Ay OL ts Me ONPG Mca ey ty AEE yey

CM Tap asa RR PaO TR RELY ECE pi! Se eRe ibd t Lid

Wet ws Cee Sar Dot ? act eo TS ay sang eC Nr eis eu she

aie 4 , are Me ves AD Wm bON Sg AY ORCL MY A MRC rey Xe

Wr Verte vw LEvAVEN (tye mir te eww ‘ : Wine tt dp anag ey ite yan ae cos a Me Hy hw

Nr hot meh LA he ld Ils a spd SOV E aie ye PEs pens engi Fie 3 raat Wye heir ity eu Warts e NEW Whales SILK” ae

WY WEE per he wey ere vnyeey SLUT MEME EAE SP NAS Usain erie Uae eat is whee y Perel Ferd IP phy ys brew UH UAT NS ta A eM RY Ape wil tas RU ENLAM Mul ah

Yrcyt gs cian aww eye amie yee ey wea ryt ys cM LF yrued ge poe eat ines ma ab rari ae : bes eA ‘ wey

eI 4 Beye oS 3E SE toe eure be amr WM tes Whe ye AVERY yee ae me he gs yes MEME WO Uae ie i eer it

see Fike rece rer urneeea ge See Vee AERO Me a a Oe HH OME 0.85 ah 4 cant Nongee uray nyt ay YN Pep Foy RU Rt RO

VER Ura Rla ge ge NIME Nay Letru Lae aoa ae eae uretrah Wyeast A ae Fa MEAL AN UtLaD Rdte cirkn) Yo TAN MW thar real ay i

le Whee ape ao veut . Lis 7M EUS? ay is Dy At ¥ f i 7 al fthae ale 3 : OU NE METH ME San oy ty

MAM oe be et Bhatt MON Y TW WERE Yc NSP UE WE et we ye VEC gD y Ae WL s t “4 i ay * ‘ fetta bt 1a vn) it 7 an

SO rut ate ney OA YOR yt we we VN YE WE (NP Yt ye wy "y weyers : rule a) wre M Pa nate ae wy $ ste eetiinek

EWM yrye WHERE BP aC We Nee yt ye ye, We et et ge eat ye UT at ae Pyke " : fabless Wily

Pao WE WER ae yee PM yt tery FW Le OW Wha VEN ys WO ae We ge ;

BP eRe ye ys ws wet ve eve fete 6 ye re TM RRVEME AU LT UOT UP UE tat Wtiseantdt ged wee ea one ret

RAMA Od eos ant ee Te tees ATE MT ATURE Leuk tig wens BOP ye atta ge ie WAS aways

Be mete ew MME D LE NOL Urey tun idl ASS TT) WPvel ene WSN DP yr aes ee

Were Ww Baye Megs Be AVE “" Towle weed ten.

AY WwW itwee Me ty