Memoirs of Museum Victoria 71:1-9 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Vertical distribution and migration of planktonic polychaete larvae in Onagawa

Bay, north-eastern Japan

Hirokazu Abe* , Waka Sato-Okoshi, Goh Nishitani and Yoshinari Endo

Laboratory of Biological Oceanography, Graduate School of Agricultural Science, Tohoku University, Tsutsumidori-

Amamiya 1-1, Aoba-ku, Sendai, 981-8555, Japan (abehirol3@gmail.com; wsokoshi@bios.tohoku.ac.jp; ni5@bios.

tohoku.ac.jp; yendo@bios.tohoku.ac.jp)

* To whom correspondence and reprint requests should be addressed. E-mail: abehirol3@gmail.com

Current affiliation: Tohoku National Fisheries Research Institute, Fisheries Research Agency, 3-27-5 Shinhama-cho,

Shiogama, Miyagi 985-0001, Japan

Abstract Abe, H., Sato-Okoshi, W., Nishitani, G. and Endo, Y. 2014. Vertical distribution and migration of planktonic polychaete

larvae in Onagawa Bay, north-eastern Japan. Memoirs of Museum Victoria 71: 1-9.

The planktonic larvae of polychaetes are one of the most numerous and diverse groups in coastal zooplankton;

however, little is known about their larval dynamics and the factors that affect their vertical distribution. We investigated

the vertical distribution and migration of planktonic polychaete larvae in Onagawa Bay, north-eastern Japan, particularly

focusing on the dominant spionid larvae. In total, 14 families of planktonic polychaete larvae and 14 species or genera of

spionid larvae were identified during our study. Their density greatly fluctuated according to season and depth, with the

polychaete larvae generally distributed in the lower layers of the water column. Furthermore, trends in vertical distribution

of spionid larvae varied between species. In winter and spring, larvae of Polydora onagawaensis were the most prevalent,

with a wide range in vertical distribution. In summer and autumn, larvae of Pseudopoly dor a achaeta and Prionospio spp.

were the most prevalent spionid larvae and were primarily distributed in the lower layers of the water column. Trends in

larval vertical distribution varied as a result of differences in adult habitat; these variations would enable the larvae to

efficiently recruit into their appropriate adult habitats. Spionid larvae did not show diel vertical migration. Larvae of two

spionid taxa, Pseudopolydora achaeta and Prionospio spp., exhibited tidal vertical migration, with larvae appearing to

avoid dispersal by moving to slower-flowing deeper water during flood and ebb tides. Although many previous studies

assume that, because of their limited swimming capacity, polychaete larvae are passively dispersed within the water

column, this study indicates that polychaete larvae can control their vertical distribution to some extent, and this small-

scale vertical migration may be important as a retention mechanism for polychaete larvae.

Keywords polychaete larva, Spionidae, Polydora, Pseudopolydora, Prionospio, vertical distribution, vertical migration, larval retention

Introduction

Many marine invertebrates pass through a planktonic larval phase

during their early life history. Historically, larval dispersal has

typically been considered a passive process, and most larvae have

been thought to be unable to control their horizontal dispersal

(Chia et al., 1984; Scheltema, 1986), with a few exceptions such

as some larval crustaceans (Luckenbach and Orth, 1992).

However, the ability of larvae to control their vertical distribution

in the water column has been well known and can have significant

outcomes in terms of larval transport and horizontal distribution,

because the current speed and direction generally vary with depth

(Young, 1995; Hill, 1998; Metaxas, 2001).

Tidal vertical migration patterns have been observed,

particularly in estuarine invertebrate larvae (Carriker, 1951;

Cronin, 1982). Tidal currents move faster at the surface layers

and slower at the bottom layers because of the friction at the

bottom layers. Therefore, larvae can be transported towards

the sea or shore or remain within the estuary by migrating to

the surface or bottom layers, respectively, in synchronisation

with tidal cycles (Forward and Tankersley, 2001; Tankersley et

al., 2002; Gibson, 2003). These larval behaviours related to

relocation are also known as ‘selective tidal stream transport’

(Greer Walker et al., 1978).

H. Abe, W. Sato-Okoshi, G. Nishitani &Y. Endo

Diel vertical migration is also well known for many

planktonic animals, including invertebrate larvae. Three

patterns of diel vertical migration (DVM) have been observed

for planktonic invertebrate larvae: (i) nocturnal (normal) DVM,

with an ascent to a minimum depth at night and a descent to a

maximum depth during the day; (ii) reverse DVM, with the

ascent to a minimum depth during the day and the descent to a

maximum depth at night; (iii) twilight DVM, with an ascent to

the surface at sunset, a descent to deeper water around midnight,

a second ascent to the surface in the early morning hours,

followed by a final descent to deeper water at sunrise (Forward,

1988; Pearre, 2003). Although the latter two patterns are rare for

invertebrate larvae (Young and Chia, 1987; Queiroga and

Blanton, 2005), some larvae, particularly decapods, are sensitive

to the diel light cycle (Forward et al., 1984). These behaviours

occur in a wide range of planktonic animals and are considered

to be predator avoidance behaviour because larvae alter their

DVM patterns in the presence of predators (Bollens and Frost,

1991; Neill, 1992; Cohen and Forward, 2009).

In addition to the light and tidal cycles, gravity, temperature,

oxygen, salinity, hydraulic pressure and chemicals from

phytoplankton and predators are believed to influence larval

vertical distribution and migration (Huntley and Brooks, 1982;

Pires and Woollacott, 1983; Forward, 1988; Lass and Spaak,

2003). Furthermore, larval behavioural responses are also

changeable depending on species, larval condition and feeding

history (Thorson, 1946, 1964; Metaxas and Young, 1998a;

Arellano et al., 2012). Mechanisms determining vertical

distribution and migration of planktonic larvae are complex.

Although the diverse vertical distribution and migration of

many planktonic animals is well known, there is limited

information about these behaviours in polychaete larvae.

Polychaetes are one of the major components of coastal

macrobenthos in terms of species richness, density and total

biomass (Ward and Hutchings, 1996). They play major roles in

the marine food web and in the functioning of benthic

communities by their activity in decomposition of organic

matter and bioturbation (Aller, 1982; Tomiyama et al., 2005).

The planktonic larvae of polychaetes are one of the most

numerous and diverse groups of coastal zooplankton

(Omel’yanenko and Kulikova, 2002). Despite the great

importance of this group in marine ecosystems, the planktonic

larval phase of polychaetes is still poorly understood.

Materials and methods

To reveal seasonal vertical distribution of planktonic polychaete

larvae, sampling was performed from January to December

2012 at St. 1 (38°26'14.42" N 141°27'38.79" E; 21-23 m depth) in

Onagawa Bay (fig. 1). Zooplankton samples were collected once

a month from the surface down to 20 m in depth at 5-m intervals

using an Iwaki MD-70R shipboard magnet pump (Iwaki Co.,

Ltd, Tokyo, Japan). A priming water tank and suction hose were

connected to a magnet pump and were being primed seawater

before pumping. The nozzle of the suction hose was attached to

a 1.5-kg weight with wire and dropped to each depth.

Approximately 100 L of seawater was pumped up onto the boat

and filtered through a hand net with a mesh size of 110 pm, and

the plankton samples were fixed with 5% neutralised

formaldehyde solution. Planktonic polychaete larvae were

identified and counted under a stereomicroscope. Vertical

profiles of temperature and salinity were determined using a

CTD RINKO-Profiler (JFE Advantech Co., Ltd, Kobe, Japan).

Chlorophyll (Chi) a concentration was measured once per

month. Water samples were collected from the surface down

to 20-m depth at 5-m intervals with a 5-L Van Dorn water

sampler. Subsamples of 128 mL were taken at each depth and

pre-filtered through 200-pm mesh onto a GF/F filter (average

pore size 0.7 p m). After filtration, each filter was immediately

covered by a quantitative filter and aluminium foil to protect it

from light. Chi a was extracted from each filter by immersion

in 90% acetone for 24 h in the dark at -20°C , and fluorescence

was determined with a Turner Designs fluorometer by the

method demonstrated by Yentsch and Menzel (1963).

Diel and tidal vertical distribution of planktonic polychaete

larvae were examined by sampling at 0-, 5-, 10-, 15- and 20-m

depths at 3-h intervals over a 21-h period. Zooplankton

samples were collected at 8:00, 11:00, 14:00, 17:00, 20:00 and

23:00 on 20 August 2012 (spring tide) and 2:00 and 5:00 on 21

August 2012 (half tide) and treated in the same manner as has

been described above. Vertical profiles of temperature, salinity

and Chi fluorescence values were determined using a CTD

RINKO-Profiler.

In order to analyse the relationships between larval and

Chi vertical distribution, a weighted mean depth (WMD) for

each vertical profile was calculated using the following

equation (Rollwagen-Bollens et al., 2006):

WMD =

KA-ZJ

1(A) ’

where i is each depth sampled, A is the density of polychaete

larvae (individuals m -3 ) or chlorophyll a concentration (p g

L -1 ), and Z is the sampling depth (m). Pearson’s product-

moment correlation coefficient ( r ) and associated significant

probability ( P ) were calculated to examine the relationship

between larval and Chi vertical distribution.

The significance of differences in larval vertical distribution

of the dominant Pseudopolydora achaeta and Prionospio spp.

in daytime vs. night-time and flood and ebb vs. high and low

tide during the 21-h investigation were tested using the statistical

test for differences in vertical plankton distributions in the

presence of patchiness when replicate samples were available

(Beet et al., 2003). Samples taken at different times were pooled

into two sets of observations, daytime and night-time, and flood/

ebb and high/low tide, and considered as replicates. Plankton

profiles collected at 5:00 on 21 August were treated as night¬

time profiles because it was just after daybreak. The null

hypothesis, that the shapes of the depth profiles of mean

abundance are the same under all conditions (i.e. daytime,

night-time, flood/ebb tide, and high/low tide) was tested using

the following test statistic (Paul and Banerjee, 1998):

B = n 2^

Mu ) 2

where T and D are the number of conditions and depths,

respectively, is the average density of n replicates for condition

Vertical distribution and migration of planktonic polychaete larvae in Onagawa Bay, north-eastern Japan

Figure 1. Location of the sampling station in Onagawa Bay.

i at depth j, and p tj and c are the maximum likelihood (ML)

estimates of the mean (p0 and dispersion coefficient (c0 under

the null hypothesis, respectively. The ML estimates, test statistic

B, and its corresponding P-values under the null hypothesis

were obtained using MATLAB software (MathWorks Japan,

Tokyo, Japan), as described by Beet et al. (2003).

Results

Seasonal vertical distribution of planktonic polychaete larvae

Water temperature ranged from 4.4 to 25.9°C, with lowest

temperatures at the 20-m depth in March and highest at 0-m

depth in September. Thermal stratification in the water column

began in April and lasted until September. The differences in

temperature between the top and bottom waters were 2-5°C in

these months. In other seasons, the water column was vertically

well mixed. Salinity ranged from 28.4 to 34.7 but was generally

stable at approximately 33-34. An episodic decrease in surface

salinity in April was a consequence of heavy rainfall. Except

for the 0-m depth, salinity was almost the same in all layers of

the water column.

Chi a concentration varied from 0.18 to 11.71 pg L _1 , with

marked seasonal and vertical variations (fig. 2). The lowest value

was recorded at 20-m depth in June and the highest at 10-m depth

in April. Typical of the annual pattern in temperate waters, there

was a large spring phytoplankton bloom throughout the water

column in February and another in April (fig. 2). High Chi a

concentrations were also observed in the bottom water in January,

July and August, and at 0 m in September. The Chi a concentration

was very low in March, June, November and December.

The density of planktonic polychaete larvae fluctuated

from 0 to 6240 individuals (ind.) nr 3 and varied greatly

according to season and depth (fig. 2). The lowest density was

recorded at 0-m depth in February and March, and the highest

density was recorded at 5-m depth in May. Larvae belonging

to 14 families were identified. Spionidae was the most

dominant family for most months (68.2%), followed by

Phyllodocidae (11.6%) and Polynoidae (5.7%). In general,

polychaete larvae were very sparse at the surface (0-m depth)

and were distributed in the lower layers of the water column

(fig. 2). This trend in vertical distribution was primarily

observed in dominant spionid larvae, as well as in the larvae

of Phyllodocidae and Terebellidae. In contrast, Serpulidae

larvae tended to be located in the upper layers of the water

column. There was slight correlation between weighted mean

depth of planktonic polychaete larvae and Chi concentration

during the study period from January to December 2012, but

this correlation was not significant (r = 0.44, P = 0.149; n = 12).

The density of planktonic spionid larvae fluctuated from 0

to 5680 ind. m 3 , and also differed greatly depending on season

and depth (fig. 3). The lowest densities were recorded at 0-m

depth in February, March and December, and the highest

density was recorded at 5-m depth in May. Larvae belonging

to 14 species/genera were identified. Pseudopolydora achaeta

was the dominant species (36.7%), followed by Polydora

onagawaensis (30.6%) and Prionospio spp. (10.7%). During

the period from January to June, larvae of the spionid P.

onagawaensis were dominant. They did not show specific

trends with regard to vertical distribution and tended to be

distributed at a wide range of depths. During summer, larvae

of Pseudopolydora achaeta and Prionospio spp. were the

dominant species/genus and tended to be distributed in the

lower layers of the water column.

Diel and tidal vertical distribution of planktonic polychaete

larvae

Water temperature ranged from 18.0 to 23.5°C, with the lowest

temperature near the bottom and the highest at the surface.

There was thermal stratification, and a stable thermocline was

observed between 0- and 5-m depths for the entire period.

Salinity ranged from 32.3 to 33.9 and was stable around 33.0

to 34.0, except in the surface water at 11:00 on 21 August.

Except for the 0-m depth, salinity was almost the same in all

layers of the water column. Chlorophyll fluorescence values

Depth 5 ' 1 ° Depth

H. Abe, W. Sato-Okoshi, G. Nishitani &Y. Endo

Density (ind m J )

1000 2000 iOOG 0 2000 4000 WOO 300C

Apr o»

10 m

15 m

20 m

• Oct.

Iff

)

' *

■ Phyllgdoddae

SB Serpulidae

* Chi p

Chi a concentration (pg L 1 )

Vertical distribution of each family of planktonic polychaete larvae (upper axes) and chlorophyll a concentration (pig L _1 ) (lower axes)

Onagawa Bay from January to December 2012.

Density [ind m ■*)

o too 200 300

2000 4000

May

111

1Sm J\

20m g|

lflCO 2000

2tt> 300 400

0 m

10 m

hfov.

0 m

Deo,

□ Polydoro onugowaensis

O Polydora sp-

5 m

: m:u

CD Pseudopolydarn acboEta

■ Pseudopolydora reticulata

10 m

] B1J

m Pseudopolydora paucibronchiota

^ Prionospio spp.

15 m

Dipofydora spp.

CD Boccardia spp,

20 m

-emM

m Rhyncbospio glutaea

□ Others

Figure 3. Vertical distribution of each species or genus of planktonic spionid larvae at St. 1 in Onagawa Bay from January to December 2012.

Vertical distribution and migration of planktonic polychaete larvae in Onagawa Bay, north-eastern Japan

Density (ind nr 3 )

500 10W isoo :ow

0 1 Z 3 4 S

0 1 I 3 4

Chi fluorescence (ppb)

□ Spionidae

E3 Magelonidae

■ Phyllodaddae

aa Serpulidae

□ Others

-m- Chl-F

Figure 4. Diet changes in vertical distribution of planktonic polychaete (upper axes) and chlorophyll fluorescence (ppb) (lower axes) larvae at St.

1 in Onagawa Bay from 8:00 a.m. on 20 August to 5:00 a.m. on 21 August, 2012.

ranged from 0.6 to 3.7 ppb, with the lowest value at 0-m depth

at 11:00 and the highest at 15-m depth at 17:00 (fig. 4). The

maximum chlorophyll levels were found deeper in the water

column all throughout the day.

The density of planktonic polychaete larvae fluctuated

from 40 to 3520 ind. m 3 and varied greatly according to depth

(fig. 4). The lowest density was recorded at the 0-m depth at

11:00, and the highest density was recorded at the 5-m depth at

11:00. Larvae belonging to 11 families were identified on 20

and 21 August. Spionidae was the dominant family at all times

(78.9%), followed by Phyllodocidae (9.3%) and Serpulidae

(3.6%). The larvae of Spionidae and Magelonidae were almost

absent at the surface (0-m depth) and tended to be distributed

in the lower layers of the water column. In contrast, the larvae

of Serpulidae tended to be distributed in the upper layers of

the water column.

Planktonic spionid larval densities ranged from 30 to 2880

ind. nr 3 (fig. 5). The lowest density was at 0-m depth at 11:00

and the highest density at 5-m depth at 11:00. Larvae belonging

to 11 species/genera were identified. Pseudopolydora achaeta

and Prionospio spp. were the dominant species/genera (49.9%

and 38.3%, respectively). In general, spionid larvae were sparse

at the surface (0 m) and tended to be distributed in the lower

layers of the water column. However, the highest density was

recorded at the 5-m depth at 11:00 because of the extremely

high density of Prionospio spp. (2040 ind. nr 3 ). The larvae of

Pseudopolydora achaeta and Prionospio spp. tended to

distribute slightly shallower during high and low tide and

deeper during flood and ebb tide, especially in daylight hours

(fig. 6). However, there were no statistically significant

differences in the vertical distribution of Pseudopolydora

achaeta and Prionospio spp. during the day vs. night (B = 1.39,

P > 0.05 and B = 8.23, P > 0.05, respectively), or flood/ebb vs.

high/low tide (B = 1.38, P > 0.05 and B = 3.20, P > 0.05).

Discussion

Vertical distribution of planktonic polychaete larvae

Polychaete larvae in Onagawa Bay generally tend to be

distributed at higher densities in the lower layers of the water

column and sparser densities at the surface (figs 2 and 4). In

Onagawa Bay, the close timing between the phytoplankton

blooms and the occurrence of planktonic polychaete larvae

had been observed previously, and most planktonic polychaete

larvae have tended to synchronise with summer phytoplankton

increases and fall blooms (Abe et al., 2011). Because the

phytoplankton increase near the surface during summer and

autumn in Onagawa Bay, it was previously assumed that a

photopositive response brought larvae up towards the

phytoplankton-rich surface waters, as indicated by Thorson

(1946; 1964) during summer and autumn in Onagawa Bay

(Abe et al., 2011). However, the results of this study contradicted

this assumption, because they indicated that polychaete larvae

tended to be distributed in the lower layers rather than the

H. Abe, W. Sato-Okoshi, G. Nishitani &Y. Endo

Density (incf nr 3 )

o 1000 jfloe soon

500 1000 1500 2000

□ Polydora onagowoensis

E3 Pseudopotydora ochaeta

■ Pseudopolydora reticulata

■ Pseudop otydo r a paucibrpnchipta

S Prionospio spp.

SES Dipolydora spp.

K Rhynchospio gfutaea

n Others

Figure 5. Diel changes in vertical distribution of planktonic spionid larvae at St. 1 in Onagawa Bay from 8:00 a.m. on 20 August to 5:00 a.m. on

21 August 2012.

140

120

100

140

'-L

|U_

Figure 6. Box plots of vertical distribution of two spionid larvae: a. Pseudopoly dor a achaeta and b, Prionospio spp. The central line in the box

represents the median, the upper and lower boundaries of the box represent the quartiles, and the vertical bar represents the 95% range of larval

distribution (left axes). The dashed wavy lines and dark shaded areas represent the tidal level (right axes) and night-time, respectively.

surface layers, even in summer and autumn. The previously

documented positive phototactic response of spionid larvae

(Blake and Woodwick, 1975; Levin, 1986) was easily observed

in this study, as the live larvae clearly moved towards the light

source during microscope observation. However, this

photopositive behaviour did not result in vertical migration in

the field, as we found spionid larvae distributed primarily in

the lower layers. The majority of young larvae of the benthic

invertebrates were reported to be positively phototactic under

laboratory illumination (Thorson, 1946) but have been

Vertical distribution and migration of planktonic polychaete larvae in Onagawa Bay, north-eastern Japan

observed to avoid very strong light and often to be absent from

the surface layers of the sea (Russell, 1927; Thorson, 1964).

The results of our study appear to be consistent with these

reports. However, the results of our 21-h survey showed that

the vertical distribution of spionid larvae did not vary between

daytime and night-time (figs 4-6); therefore, strong light

intensity cannot be the explanation for the scarcity of spionid

larvae at the surface. In other studies, polychaete larvae have

been found in higher densities at the bottom of the water

column (Wilson, 1982; Ambrogi et al., 1989; Yokoyama, 1995;

Schliiter and Rachor, 2001). Distribution of polychaete larvae

in the bottom layers of the water column may be a common

phenomenon in many marine waters.

In contrast to most of the polychaete larvae that were

present in the lower layers of the water column, only Serpulidae

larvae, one of the predominant intertidal animals in Onagawa

Bay, tended to be distributed in the upper layers of the water

column (figs 2 and 4). Thorson (1964) generalised that the

larvae of intertidal species are photopositive throughout their

planktonic larval period and larvae of most subtidal species

are initially photopositive but become photonegative before

settlement. Although it is unknown if the difference in larval

vertical distribution between intertidal and subtidal

polychaetes is due to a difference in their phototactic response,

the difference in larval vertical distribution may be reflected

in their adult habitats.

The vertical distribution trend of spionid larvae differed

from species to species in this study. The larvae of

Pseudopolydora achaeta and Prionospio spp. tended to be

distributed in the lower layers of the water column (figs 3 and

5), whereas P. onagawaensis larvae showed no specific trends

in vertical distribution and were distributed at a wide range of

depths (fig. 3). Polydora onagawaensis, a recently described

species from Onagawa Bay (Teramoto et al., 2013), is a shell¬

boring polychaete, and adults inhabit the shells of molluscs

distributed in the intertidal zone as well as those suspended in

deeper water for aquaculture in Onagawa Bay. It is possible

that the larval distribution of P. onagawaensis is determined

by the habitat in which the larvae were produced and hatched,

and their wide range of vertical distribution has a role in larval

recruitment to the vertically wide range of adult populations.

The larvae of Pseudopolydora reticulata and Rhynchospio

glutaea tended to be distributed in the surface and middle

layers of the water column, respectively (figs 3 and 5). Adults

of Pseudopolydora reticulata and R. glutaea are commonly

distributed in the soft bottom sediments of intertidal and

shallow subtidal zones (Radashevsky and Hsieh, 2000; Zhou

et al., 2010). Shallower distribution of these larvae was also

consistent with the area in which they were produced and

probably assists with larval recruitment to adult populations.

Larval vertical distribution may be influenced by the water

layer in which hatching occurred (Pearse, 1994).

Some invertebrate larvae have been observed to alter their

swimming behaviour in response to the presence and quality

of food patches (Raby et al., 1994; Metaxas and Young, 1998b;

Burdett-Coutts and Metaxas, 2004). In this study, although

there was no significant correlation, a similar trend in vertical

distribution between polychaete larvae and Chi a concentration

was observed in several months (fig. 2). It is considered that

various factors influence larval vertical distribution, so it

would be difficult to detect a clear correlation between larval

and Chi vertical distribution. However, the observed trend

may indicate that the vertical distribution of Chi regulates the

vertical distribution of polychaete larvae to some extent in

Onagawa Bay.

Diel and tidal vertical migration of planktonic polychaete larvae

The phenomenon of DVM widely occurs in many marine

zooplankton taxa (Rawlinson et al., 2004), including

polychaete larvae (Garland et al., 2002). However, no

difference was observed in the vertical distribution of

polychaete larvae between the light and dark hours over the

21-h sampling period in Onagawa Bay (figs 4-6). Polychaete

larvae did not show DVM in this study indicates that the light

condition was not very important for larval vertical distribution

of polychaete larvae. This was consistent with the results of

seasonal vertical distribution of spionid larvae in this study.

It is well known that some invertebrate larvae show a tidal

vertical migration pattern (Cronin, 1982). In this study, although

there was no significant relationship between larval vertical

distribution and tidal cycle, the larvae of Pseudopolydora

achaeta and Prionospio spp. tended to be distributed at slightly

shallower depths during high and low tide and at greater depths

during flood and ebb tide, especially in daylight hours (fig. 6). In

general, tidal currents are faster at the surface layers and slower

at the bottom layers. Therefore, these larval tidal migrations

were considered to avoid dispersal by moving to slower-flowing

deeper water during flood and ebb tide. Tidal vertical migration

has also been reported in the larvae of the colony-forming

polychaete Sabellaria alveolate] the larvae of S. alveolata

tended to migrate closer to the surface during flood tide and

nearer to the bottom during ebb tide, promoting a net landward

transport of larvae (Dubois et al., 2007). Although the swimming

capacity of polychaete larvae is often limited, and vertical

migration was small, this vertical migration may be important

as a retention mechanism for polychaete larvae.

Some larvae are reported to vary their DVM behaviour

throughout ontogeny (Neill, 1992). Although ontogenic

migration is not a general feature in polychaete larvae,

ontogenic larval migration has been reported in two polychaete

species, Pectinaria koreni and Owenia fusifor mis (Lagadeuc

et al., 1990; Thiebaut et al., 1992), and these ontogenic

migrations are believed to be important for larval retention in

the estuarine and coastal environments. Larval vertical

migration is well known for decapod larvae, bivalve larvae

and gastropod larvae (Cronin, 1982; Forward et al., 1984;

Forward and Tankersley, 2001; Gibson, 2003; Rawlinson et

al., 2004; Lloyd et al., 2012). Meanwhile, many studies assume

a passive dispersal of polychaete larvae within the water

column (Banse, 1986; Stancyk and Feller, 1986; Levin, 1986;

Kingsford et al., 2002). There is very little information on the

vertical distribution and vertical migration of polychaete

larvae throughout the world, and this study indicates the need

for additional knowledge about the vertical migration of

polychaete larvae.

H. Abe, W. Sato-Okoshi, G. Nishitani &Y. Endo

Acknowledgements

We would like to thank Dr Yasushi Gomi, Wataru Teramoto,

Messrs Noritaka Ayakoji, Jiro Endo, Daiki Fujii, Akio

Kamitani and Hiromasa Ohno for their valuable assistance in

field sampling. We would like to express our gratitude to the

captain Toyokazu Hiratsuka and staff of the Field Science

Center at the Graduate School of Agricultural Science, Tohoku

University, for their kind cooperation in the sample collections

in Onagawa Bay. We also express our gratitude to Dr Andrew

Beet, WHOI, for his provision of MATLAB programs for

statistical analysis. We are grateful to an anonymous reviewer

and to the editor, Dr Robin Wilson (Museum Victoria), for

their constructive comments, which improved the manuscript.

This study was supported by a research grant from the

Research Institute of Marine Invertebrates Foundation.

References

Abe, H., Sato-Okoshi, W., and Endo, Y. 2011. Seasonal changes of

planktonic polychaete larvae and chlorophyll a concentration in

Onagawa Bay, northeastern Japan. Italian Journal of Zoology 78:

255-266.

Aller, R.C. 1982. The effects of macrobenthos on chemical properties

of marine sediment and overlying water. Pp. 53-102 in: McCall,

P.L. andTevesz, M.J.S. (eds). Animal-sediment relations. Plenum

Press: New York.

Ambrogi, R., Ferrari, I., and Geraci, S. 1989. Biotic exchange between

river, lagoon and sea: the case of zooplankton in the Po Delta.

Scientia Marina 53: 601-608.

Arellano, S.M., Reitzel, A.M., and Button, C.A. 2012. Variation in

vertical distribution of sand dollar larvae relative to haloclines,

food, and fish cues. Journal of Experimental Marine Biology and

Ecology 414-415: 28-37.

Banse, K. 1986. Vertical distribution and horizontal transport of

planktonic larvae of echinoderms and benthic polychaetes in an

open coastal sea. Bulletin of Marine Science 39: 162-175.

Beet, A., Solow, A.R., and Bollens, S.M. 2003. Comparing vertical

plankton profiles with replication. Marine Ecology Progress

Series 262: 285-287.

Blake, J.A., and Woodwick, K.H. 1975. Reproduction and larval

development of Pseudopoly dor a paucibranchiata (Okuda) and

Pseudopoly dora kempi (Southern) (Polychaeta: Spionidae).

Biological Bulletin 149: 109-127.

Bollens, S.M., and Frost, B.W. 1991. Diel vertical migration in

zooplankton: rapid individual response to predators. Journal of

Plankton Research 13: 1359-1365.

Burdett-Coutts, V., and Metaxas, A. 2004. The effect of the quality of

food patches on larval vertical distribution of the sea urchins

Lytechinus variegatus (Lamarck) and Strongylocentrotus

droebachiensis (Mueller). Journal of Experimental Marine

Biology and Ecology 308: 221-236.

Carriker, M. 1951. Ecological observations on the distribution of oyster

larvae in New Jersey estuaries. Ecological Monographs 21: 19-38.

Chia, F.S., Buckland-Nicks, J., and Young, C.M. 1984. Locomotion of

marine invertebrate larvae: a review. Canadian Journal of

Zoology 62: 1205-1222.

Cohen, J.H., and Forward R.B. Jr. 2009. Zooplankton diel vertical

migration—a review of proximate control. Oceanography and

Marine Biology: an Annual Review 47: 77-110.

Cronin, T.W. 1982. Estuarine retention of larvae of the crab

Rhizhropanopeus harrisii. Estuarine , Coastal and Shelf Science

15: 207-220.

Dubois, S., Comtet, T., Retiere, C., and Thiebaut, E. 2007. Distribution

and retention of Sabellaria alveolata larvae (Polychaete:

Sabellariidae) in the Bay of Mont-Saint-Michel, France. Marine

Ecology Progress Series 346: 243-254.

Forward, R.B. Jr. 1988. Diel vertical migration: zooplankton

photobiology and behaviour. Oceanography and Marine Biology:

an Annual Review 26: 361-393.

Forward, R.B. Jr, Cronin, T.W., and Stearns, D.E. 1984. Control of diel

vertical migration: photoresponses of a larval crustacean.

Limnology and Oceanography 29: 146-154.

Forward, R.B. Jr, and Tankersley, R.A. 2001. Selective tidal-stream

transport of marine animals. Oceanography and Marine Biology:

an Annual Review 39: 305-353.

Garland, E.D., Zimmer, C.A., and Lentz, S.J. 2002. Larval

distributions in inner-shelf waters: the roles of wind-driven cross¬

shelf currents and diel vertical migrations. Limnology and

Oceanography 47: 803-817.

Gibson, R.N. 2003. Go with the flow: tidal migration in marine

animals. Hydrobiologia 503: 153-161.

Greer Walker, M., Harden Jones, F.R., and Arnold, G.P 1978. The

movements of plaice ( Pleuronectes platessa L.) tracked in the

open sea. Journal du Conseil International pour VExploration de

la Mer 38: 58-86.

Hill, A.E. 1998. Diel vertical migration in stratified tidal flows:

implications for plankton dispersal. Journal of Marine Research

56: 1069-1096.

Huntley, M., and Brooks, E.R. 1982. Effects of age and food

availability on diel vertical migration of Calanus pacificus.

Marine Biology 71: 23-31.

Kingsford, M.J., Leis, J.M., Shanks, A., Lindeman, K.C., Morgan,

S.G., and Pineda, J. 2002. Sensory environments, larval abilities

and local self-recruitment. Bulletin of Marine Science 70: 309-

340.

Lagadeuc, Y., Conti, P., Retiere, C., Cabioch, L., and Dauvin, J.C.

1990. Processus hydrodynamiques et recrutement de Pectinaria

koreni, Annelide Polychete a cycle bentho-pelagique, en Baie de

Seine orientale. Oceanis 16: 245-256.

Lass, S., and Spaak, P. 2003. Chemically induced anti-predator

defences in plankton: a review. Hydrobiologia 491: 221-239.

Levin, L.A. 1986. The influence of tides on larval availability in

shallow waters overlying a mudflat. Bulletin of Marine Science

39: 224-233.

Lloyd, M.J., Metaxas, A., and deYoung, B. 2012. Physical and

biological factors affect the vertical distribution of larvae of

benthic gastropods in a shallow embayment. Marine Ecology

Progress Series 464: 135-151.

Luckenbach, M.W., and Orth, R.J. 1992. Swimming velocities and

behavior of blue crab ( Callinectes sapidus Rathbun) megalopae in

still and flowing water. Estuaries 15: 186-192.

Metaxas, A. 2001. Behaviour in flow: perspectives on the distribution

and dispersion of meroplanktonic larvae in the water column.

Canadian Journal of Fisheries and Aquatic Sciences 58: 86-98.

Metaxas, A., and Young, C.M. 1998a. Behaviour of echinoid larvae

around sharp haloclines: effects of the salinity gradient and

dietary conditioning. Marine Biology 131: 443-459.

Metaxas, A., and Young, C.M. 1998b. Responses of echinoid larvae to

food patches of different algal densities. Marine Biology 130:

433-445.

Neill, W.E. 1992. Population variation in the ontogeny of predator-

induced vertical migration of copepods. Nature 356: 54-57.

Omel’yanenko, V.A., and Kulikova, V.A. 2002. Composition, seasonal

dynamics, and long-term fluctuations in the density of pelagic

polychaetes in Amurskii Bay, Sea of Japan. Russian Journal of

Marine Biology 28: 308-316.

Vertical distribution and migration of planktonic polychaete larvae in Onagawa Bay, north-eastern Japan

Paul, S.R., and Banerjee, T. 1998. Analysis of two-way layout of count

data involving multiple counts in each cell. Journal of American

Statistical Association 93: 1419-1429.

Pearre, S. Jr. 2003. Eat and run? The hunger/satiation hypothesis in

vertical migration: history, evidence and consequences. Biological

Reviews 78: 1-79.

Pearse, J.S. 1994. Cold-water echinoderms break ‘Thorson’s Rule’.

Pp. 26-43 in: Young, C.M. and Eckelbarger, K.J. (eds).

Reproduction, larval biology and recruitment of deep-sea

benthos. Columbia University Press: New York.

Pires, A., and Woollacott, R.M. 1983. A direct and active influence of

gravity on the behavior of a marine invertebrate larva. Science

220: 731-733.

Queiroga, H., and Blanton, J. 2005. Interactions between behaviour and

physical forcing in the control of horizontal transport of decapod

crustacean larvae. Advances in Marine Biology 47: 107-214.

Raby, D., Lagadeuc, Y., Dodson, J.J., and Mingelbier, M. 1994.

Relationship between feeding and vertical distribution of bivalve

larvae in stratified and mixed waters. Marine Ecology Progress

Series 103: 275-284.

Radashevsky, V.I., and Hsieh, H.-L. 2000. Pseudopolydora

(Polychaeta: Spionidae) species from Taiwan. Zoological Studies

39: 218-235.

Rawlinson, K.A., Davenport, J., and Barnes, D.K.A. 2004. Vertical

migration strategies with respect to advection and stratification in

a semi-enclosed lough: a comparison of mero- and

holozooplankton. Marine Biology 144: 935-946.

Rollwagen-Bollens, G.C., Bollens, S.M., and Penry, D.L. 2006.

Vertical distribution of micro- and nanoplankton in the San

Francisco Estuary in relation to hydrography and predators.

Aquatic Microbial Ecology 44: 143-163.

Russell, F.S. 1927. The vertical distribution of plankton in the sea.

Biological Reviews 2: 213-262.

Scheltema, R.S. 1986. On dispersal and planktonic larvae of benthic

invertebrates: an eclectic overview and summary of problems.

Bulletin of Marine Science 39: 290-322.

Schliiter, M., and Rachor, E. 2001. Meroplankton distribution in the

central Barents Sea in relation to local oceanographic patterns.

Polar Biology 24: 582-592.

Stancyk, S.E., and Feller, R.J. 1986. Transport of non-decapod

invertebrate larvae in estuaries: an overview. Bulletin of Marine

Science 39: 257-268.

Tankersley, R.A., Welch, J.M., and Forward, R.B. Jr. 2002. Settlement

times of blue crab ( Callinectes sapidus) megalopae during flood-

tide transport. Marine Biology 141: 863-875.

Teramoto, W., Sato-Okoshi, W., Abe, H., Nishitani, G., and Endo, Y.

2013. Morphology, 18S rRNA gene sequence, and life history of a

new Polydora species (Polychaeta: Spionidae) from northeastern

Japan. Aquatic Biology 18: 31-45.

Thiebaut, E., Dauvin, J.-C., and Lagadeuc, Y. 1992. Transport of

Owenia fusiformis larvae (Annelida: Polychaeta) in the Bay of

Seine. I. Vertical distribution in relation to water column

stratification and ontogenic vertical migration. Marine Ecology

Progress Series 80: 29-39.

Thorson, G. 1946. Reproduction and larval development of Danish

marine bottom invertebrates. Meddelelser fra Kommissionen for

Danmarks Fisker-og Havundersogelser, Serie Plankton 4: 1-523.

Thorson, G. 1964. Light as an ecological factor in the dispersal and

settlement of larvae of marine bottom invertebrates. Ophelia 1:

167-208.

Tomiyama, T., Katayama, S., Omori, M., and Honda, H. 2005.

Importance of feeding on regenerable parts of prey for juvenile

stone flounder Platichthys bicoloratus in estuarine habitats.

Journal of Sea Research 53: 297-308.

Ward, T., and Hutchings, P.A. 1996. Effects of trace metals on infaunal

species composition in polluted intertidal and subtidal marine

sediments near a lead smelter, Spencer Gulf, South Australia.

Marine Ecology Progress Series 135: 123-135.

Wilson, S.R. 1982. Horizontal and vertical density distribution of

polychaete and cirripede larvae over an inshore rock platform off

Northumberland. Journal of the Marine Biological Association

of the United Kingdom 62: 907-917.

Yentsch, C.S., and Menzel, D.W. 1963. A method for determination of

phytoplankton chlorophyll and phaeophytin by fluorescence.

Deep-Sea Research and Oceanographic Abstracts 10: 221-231.

Yokoyama, H. 1995. Occurrence of Paraprionospio sp. (Form A)

larvae (Polychaeta: Spionidae) in hypoxic water of an enclosed

bay. Estuarine, Coastal and Shelf Science 40: 9-19.

Young, C.M. 1995. Behavior and locomotion during the dispersal

phase of larval life. Pp. 249-277 in: McEdward, L.R. (ed.).

Ecology of marine invertebrate larvae. CRC Press: Florida.

Young, C.M., and Chia, F.S. 1987. Abundance and distribution of

pelagic larvae as influenced by predation, behavior, and

hydrographic factors. Pp. 385-463 in: Giese, A.C., Pearse, J.S.

and Pearse, V.B. (eds). Reproduction of marine invertebrates, Vol.

9. Academic Press: New York and London.

Zhou, J., Wei-wei, J., and Xin-zhen, J. 2010. Records of Polydora

complex spionids (Polychaeta: Spionidae) from China’s coastal

waters, with emphasis on parasitic species and the description of

a new species. Marine Fisheries 32: 1-15.

Memoirs of Museum Victoria 71:11-19(2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Ampharete undecima, a new deep-sea ampharetid (Annelida, Polychaeta) from the

Norwegian Sea

TOM AlVESTAD 1 (http://zoobank.org/urn:lsid:zoobank.org:author:8A7B0958-8630-42E5-B957-B9DCD308D031),

JON ANDERS KoNGSRUD 2 (http://zoobank.org/urn:lsid:zoobank.org:author:4AF3F49E-9406-4387-B282-73FA5982029E) AND

KATRINE KoNGSHAVN 2 (http://zoobank.org/urn:lsid:zoobank.org:author:2DF65B94-8531-4377-908F-5A81407F7DF7)

1 Uni Research, Thorm0hlensgate 55, N-5020 Bergen, Norway (tom.alvestad@uni.no)

2 Natural History Collections, University Museum of Bergen, Allegaten 41,5007 Bergen, Norway (Jon.kongsrud@um.uib.no;

Katrine.kongshavn@um.uib.no)

* To whom correspondence and reprint requests should be addressed. E-mail: Jon.kongsrud@um.uib.no

http://zoobank.Org/urn:lsid:zoobank.org:pub:B0E558D8-7096-434A-BB6C-67E23BB44F0C

Abstract Alvestad, T., Kongsrud, J.A. and Kongshavn, K. 2014. Ampharete undecima, a new deep-sea ampharetid (Annelida,

Polychaeta) from the Norwegian Sea. Memoirs of Museum Victoria 71: 11-19.

Ampharete undecima, a new deep-sea polychaete belonging to the family Ampharetidae, is described from slope

depths in the Norwegian Sea. The new species is of small size, up to 5 mm long and 0.5 mm wide, and thus it may have

been overlooked in previous studies. It is shown to be a common and widespread species in the Nordic Seas in depths

ranging from 600-1650 m. The new species is referred to the genus Ampharete based on characteristics of the prostomium,

the presence of buccal tentacles with secondary pinnulae, four pairs of branchiae arising from fused segment II + III, 12

thoracic uncinigerous segments, and a single pair of nephridial papillae on segment IV. The new species differs from all

known species of Ampharete in having 11 rather than 12-28 abdominal uncinigerous segments.

Keywords MAREANO, Nordic Seas, Arctic, Norway, Ampharetidae, PolyNor, new species

Introduction

The genus Ampharete Malmgren, 1866, as defined by Jirkov

(2011), is a species-rich genus of sediment-dwelling polychaetes,

comprising about 40 nominal species worldwide (Parapar et

al., 2012). The Northern Atlantic and Arctic species of

Ampharete have been well studied by several authors, including

Holthe (1986), Jirkov (1997, 2001) and Parapar et al. (2012).

However, information about the occurrence and distribution of

Ampharete in the deeper parts of the Nordic Seas is still

inadequate, and taxonomic challenges were indicated by Jirkov

(2001). The water masses below ~650 m depth in the Nordic

Seas are of Arctic origin, with temperatures below 0°C, and

differ significantly from the relatively warm surface waters,

which are of Atlantic origin (Blindheim and 0sterhus, 2005).

A major shift in species diversity and composition in the Nordic

seas related to the different water masses has been indicated for

several invertebrate taxa, including polychaetes (Svavarsson et

al., 1993; Hqisaeter, 2010; Kongsrud et al., 2011; Bakken et

al., 2014).

The present study is based on material from a large number

of samples from deep-water habitats in the Nordic Seas

collected during several cruises with RV H. Mosby in the

1980s (organised by the University of Bergen) and from the

ongoing large-scale mapping program MAREANO (Marine

AREA1 database for Norwegian waters, 2013). During general

identification work of polychaetes from widespread deep-sea

samples from the Nordic Seas, numerous specimens

representing an undescribed species of Ampharete were

encountered. The new species is of diminutive size (less than

5 mm in length) and may thus have been overlooked in previous

studies. In the present study, we formally describe this new

species of Ampharete utilising scanning electron microscopy

to study and illustrate morphological characteristics. Further,

based on presence or absence of the new species in a large

number of deep-sea samples from the Nordic Seas, we describe

the occurrence and distribution of the new species in the area.

Materials and methods

A large portion of the material used in the present study

originates from several cruises with RV H. Mosby in the

period 1981-1987 to different areas of the Nordic Seas (see

Kongsrud et al. (2011) for details), collected using an RP-

sledge (Brattegard and Fossa, 1991). The MAREANO samples

were collected in 2008 and 2009 from off the north-west coast

of Norway using an RP-sledge and a van Veen grab (0.2 m 2 )

(MAREANO 2013). The remaining few samples were

T. Alvestad, J.A. Kongsrud & K. Kongshavn

collected in 1990 during the RV Meteor cruise west of Bear

Island at about 75°N using an RP-sledge, and from

environmental monitoring off the west coast of Norway

collected using a box corer. All sampling localities are shown

in fig. 1. Geographical positions are given in decimal degrees.

All samples included in the present study have been

washed through sieves with a mesh size of 0.5 mm. The

materials have been prefixed in 10% formaldehyde and

subsequently transferred to 75% alcohol. All examined

specimens are deposited in the Natural History Collections,

University Museum of Bergen, Norway (ZMBN).

The specimens were identified using dissecting and

compound microscopes. Staining with methyl blue has been

used to aid in identification. Line drawings of the holotype

were prepared using a dissecting microscope with a camera

lucida. SEM images were made using a ZEISS Supra 55VP

microscope at the Laboratory for Electron Microscopy,

University of Bergen.

Systematics

Family Ampharetidae Malmgren, 1866

Genus Ampharete Malmgren, 1866

Ampharete undecima sp. nov.

Zoobank LSID. http://z 00 bank. 0 rg/urn:lsid:z 00 bank. 0 rg:act:

405975B9-C3FF-4CEE-92FF-44C0A3671AAD

Figures 2-6

Type locality. Norwegian Sea, 72.367°N 14.895°E, 770 m depth.

Type material. RV G.O. Sars MAREANO stn R379-47, RP, 9 Apr

2009, holotype (ZMBN 94022), 2 paratypes mounted for SEM

(ZMBN 94023), 19 paratypes (ZMBN 94024), 19 paratypes (ZMBN

94025) and 1 paratype (ZMBN 94026).

Additional material. RV H. Mosbv : Stn 81.03.21.1, 63.166°N

4.816°E, 830 m, 21 Mar 1981 (1 spec.); stn 81.06.04.4, 66.983°N

4.270°E, 1380 m, 4 Jun 1981 (1); stn 81.06.06.7, 65.716°N 5.238°E,

794 m, 6 Jun 1981 (34); stn 81.06.06.8, 65.666°N 4.815°E, 996 m, 6

Jun 1981 (9); stn 81.08.16.3, 62.800°N 1.043°E, 1009 m, 16 Aug 1981

(3); stn 82.01.21.2, 62.491°N 1.721°E, 604 m, 21 Jan 1982 (6); stn

82.01.21.4, 62.560°N 0.981°E, 804 m, 21 Jan 1982 (5); stn 82.01.21.6,

62.803°N 1.088°E, 984 m, 21 Jan 1982 (5); stn 82.08.15.1, 63.048°N

0.808°E, 1286 m, 15 Aug 1982 (2); stn 82.08.23.1, 63.213°N 3.121°E,

1003 m, 23 Aug 1982 (3); stn 82.11.26.1, 63.178°N 2.765°E, 1030 m,

26 Nov 1982 (1); stn 82.11.27.1, 62.985°N 3.218°E, 804 m, 27 Nov

1982 (73); stn 83.06.02.1, 62.198°N 0.003°W, 708 m, 2 Jun 1983 (15);

stn 83.06.03.2, 60.201°N 6.625°W, 1220 m, 3 Jun 1983 (55); stn

83.06.08.1, 65.168°N 9.493°W, 784 m, 8 Jun 1983 (4); stn 83.06.08.2,

65.460°N 7.588°W, 1626 m, 8 Jun 1983 (3); stn 83.06.17.2, 62.338°N

1.411°W, 543 m, 17 Jun 1983 (1); stn 83.06.17.3, 62.593°N 1.233°W,

781 m, 17 Jun 1983 (18); stn 84.05.23.1, 62.585°N 1.793°W, 656 m, 23

May1984 (328); stn 84.05.23.3, 62.508°N 1.851°W, 576 m, 23 May

1984 (5); stn 84.05.23.7, 62.411°N 1.540°W, 575 m, 23 May 1984 (2);

stn 84.11.20.2, 63.133°N 1.895°W, 1087 m, 20 Nov 1984 (29); stn

84.11.21.1, 62.791°N 1.836°W, 811 m, 21 Nov 1984 (2); stn 85.01.08.1,

62.525°N 1.443°W, 701 m, 08 Jan 1985 (135); stn 85.01.08.2,62.706°N

1.186°W, 897 m, 08 Jan 1985 (44); stn 85.01.12.2, 63.166°N 0.643°W,

1489 m, 12 Jan 1985 (1); stn 85.01.12.3, 63.048°N 0.796°W, 1293 m,

12 Jan 1985 (1); stn 86.06.13.1, 63.218°N 7.031°W, 1261 m, 13 Jun

1986 (1); stn 86.07.25.1, 69.023°N 8.410°W, 879 m, 25 Jul 1986 (10);

stn 86.07.27.2, 70.810°N 9.728°W, 886 m, 27 Jul 1986 (6); stn

86.08.15.5, 62.610°N 1.573°W, 654 m, 15 Aug 1986 (26); stn

86.08.15.7,62.843°N 1.431°W, 951 m, 15 Aug 1986 (15); stn 86.08.17.5,

62.996°N 1.140°W, 1143 m, 17 Aug 1986 (4); stn 86.08.17.6, 62.691°N

1.756°W, 750 m, 17.08.1986 (115). RV Meteor . Stn M410/90,74.843°N

15.377°W, 894 m, 16 Jul 1990 (79); stn M507/90,74.883°N 15.275°W,

991 m, 28 Jul 1990 (87). RV G.O. Sars MAREANO : Stn R209-17,

GR, 69.800°N 16.420°W, 1590 m, 5 Jun 2008 (1); stn R209-18, GR,

69.800°N 16.420°W, 1590 m, 5 Jun 2008 (1); stn R229-27, GR,

69.142°N 13.682°W, 1115 m, 11 Jun 2008 (1); stn R232-34, GR,

69.407°N 14.696°W, 1408 m, 14 Jun 2008 (1); stn R297-346, GR,

68.653°N 11.908°W, 807 m, 14 Oct 2008 (3); stn R297-347, GR,

68.653°N 11.908°W, 807 m, 14 Oct 2008 (1); stn R351-355, GR,

68.840°N 13.087°W, 765 m, 29 Oct 2008 (2); stn R351-356, GR,

68.840°N 13.087°W, 765 m, 29 Oct 2008 (2); stn R379-363, GR,

72.367°N 14.895°W, 760 m, 9 Apr 2009 (5); stn R379-47, RP,

72.367°N 14.895°W, 770 m, 9 Apr 2009 (10); stn R391-370, GR,

72.278°N 15.666°W, 729 m, 12 Apr 2009 (5); stn R391-51, RP,

72.281°N 15.666°W, 728 m, 12 Apr 2009 (34); stn R397-54, RP,

72.247°N 15.945°W, 635 m, 14 Apr 2009 (3); stn R404-381, GR,

72.078°N 15.806°W, 621 m, 15 Apr 2009 (1); stn R405-59, RP,

72.140°N 15.346°W, 899 m, 20 Apr 2009 (20); stn R406-61, RP,

72.189°N 14.829°W, 1030 m, 21 Apr 2009 (20); stn R444-148, RP,

71.741°N 15.236°W, 993 m, 20 Sep 2009 (7); stn R776-51, BC,

68.189°N 10.362°W, 873 m, 3 May 2012 (1). Environmental

monitoring: Stn V-12, 67.002°N 5.334°W, 1330 m, 1 Jun 1998 (2).

Diagnosis. A small species of up to 5 mm in length and 0.5

mm in width. Branchiae arranged close together; three pairs

in anterior transverse row and last pair in a posterior position.

Paleae long, thin and slender with curved tips, 9-12 on each

side. Abdomen with 11 chaetigerous segments. Pygidium

with two short conical lateral cirri and a number of small

rounded papillae.

Description. Holotype, complete, 4 mm long and 0.4 mm wide

in thorax (fig. 2A-B). Other complete specimens are up to

5 mm in length and 0.5 mm in width. Colour in alcohol

pale yellow.

Prostomium trilobed, without glandular ridges or eyes;

prostomial median lobe delimited by deep lateral grooves,

widest at the base, gradually narrowing to form acute,

rounded frontal part (fig. 3A-B). Paired nuchal organs as

circular, ciliated spots located in lateral grooves at base of

median prostomial lobe (fig. 3B). Buccal tentacles with

secondary filaments, pinnae; tips of pinnae covered by tufts

of cilia (fig. 4B-C). Four pairs of long branchiae on fused

segment II+III; three pairs of branchiae arranged in anterior,

transverse row without median gap, fourth pair slightly

posterior to anterior row, between 2nd outermost and

innermost branchiae of anterior row (fig. 2C). Bases of

branchiae in anterior row completely fused, forming a

characteristic and well-marked edge above head in frontal

view (fig. 3A-B). Branchiae of segment II in 2nd outermost

position of anterior row, branchiae of segment III in

outermost position of anterior row, branchiae of segment IV

in innermost position of anterior row, branchiae of segment

V in posterior position (figs 2C, 4A). One pair of nephridial

papillae, located dorsally between the two posterior

branchiae on segment IV (figs 2C, 4A). Fused segment II and

Ampharete undecima, a new deep-sea ampharetid (Annelida, Polychaeta) from the Norwegian Sea

Iceland

Norway

North

Sea

Norwegian

Sea v

15°E

-70° N

60°N-

Figure 1. Map of the Nordic Seas showing type locality and records of Ampharete undecima sp. nov. Background map based on GEBCO08 and

the Ocean Basemap (March 2013) by ESRI.

T. Alvestad, J.A. Kongsrud & K. Kongshavn

Figure 2. Ampharete undecima sp. nov. (A) Habitus of holotype (ZMBN 94022), dorsolateral view, posterior part of body twisted and the last 3

abdominal chaetigers are not distinguishable in drawing; (B) posterior end of holotype, ventral view; (C) schematic drawing of head and anterior

end of body, indicating placement and origin of branchiae, and position of paired nephridial papillae on segment IV. Abbreviations: al-11,

abdominal chaetigers; ac, anal cirri; pal, paleae; tl-14, thoracic chaetigers. Scale bars: 250 pm.

Ill with 9-12 long, thin and slender paleae on each side, with

curved tips (figs 3B, D, 5A). Thorax and abdomen of similar

length; thorax slightly wider than abdomen, slightly tapering

posteriorly (figs 2A, 3C). Abdomen of similar width

throughout, or slightly tapering posteriorly. A total of 14

thoracic segments with notopodia and capillary chaetae. Last

12 chaetigers of thorax with neuropodia and uncini (figs 2A,

3A, C). Notopodia simple, finger-shaped; first 2 reduced,

remaining 12 up to 3 times longer than wide. Notochaetae as

spinulose capillaries (fig. 5F-G), arranged in double rows;

capillaries from anterior row generally thinner and shorter

than from posterior row. Thoracic neuropodia rounded to

oval (fig. 3C). Thoracic uncini with two vertical rows of 4-6

teeth above rostrum (fig. 5B-C). Continuous ventral shields

present to thoracic unciniger 8. A total of 11 abdominal

uncinigers (fig. 2A-B, 3C). Anterior 2 abdominal segments

with neuropodia as thoracic type (fig. 3C); remaining

abdominal uncinigers with enlarged neuropodia without

cirri (figs 3A, C, 5D). Abdominal uncini with 4 vertical rows

of 4-6 teeth above rostrum (fig. 5D-E). Pygidium with

Ampharete undecima, a new deep-sea ampharetid (Annelida, Polychaeta) from the Norwegian Sea

Figure 3. Ampharete undecima sp. nov. (A) Habitus, frontal and ventral view, posterior end of body missing; (B) head, frontal view, enlarged

from A; (C) habitus, lateral view; (D) head, lateral view, enlarged from C. A-B, paratype (ZMBN 94023, spm #1); C-D, paratype (ZMBN 94023,

spm #2). Abbreviations: al-11, abdominal chaetigers; br, branchiae; no, nuchal organs; pal, paleae; tl—14, thoracic chaetigers. Scale bars: A, C,

200 pm; B, D, 20 pm.

terminal ciliated anal opening, surrounded by 2 short lateral

cirri and small rounded papillae (figs 2B, 4D). Head and

ventral shields dyed by methyl blue; anterior tip

of prostomium with particularly strong colour (fig. 6A-C).

Tube unknown.

Distribution. Common and widespread in the Nordic Seas in

depths ranging from 600-1650 m (fig. 1).

Etymology. The species is named after the Latin word for

eleven, referring to the eleven abdominal segments.

Remarks. Ampharete undecima sp. nov. is referred to the genus

Ampharete based on the presence of a trilobed prostomium

without glandular ridges, and with the median lobe delimited

by deep grooves, buccal tentacles with pinnulae, the presence

of four pairs of branchiae arising from the fused segment

II+III, 12 thoracic uncinigers, and a single pair of nephridial

papillae located dorsally on segment IV (Parapar et al., 2012;

Imajima et ah, 2012).

Ampharete undecima sp. nov. differs from all known

species of Ampharete in having 11 rather than 12-28

abdominal uncinigerous segments. In the Norwegian Sea, A.

undecima sp. nov. commonly occurs together with two other

species of the genus, A. cf. lindstroemi (Malmgren, 1867) and

A. finmarcicha (M. Sars, 1865) (Alvestad and Kongsrud, pers.

obs.). A. undecima sp. nov. may easily be distinguished from

both by a number of characters in addition to the number of

abdominal uncinigers, including body size, the narrow and

tapering middle lobe of the prostomium, number and shape of

paleae, and arrangement of the branchiae (Holthe, 1986;

Parapar et ah, 2012; pers. obs.).

T. Alvestad, J.A. Kongsrud & K. Kongshavn

Figure 4. Ampharete undecima sp. nov. (A) Head and anterior part of body, dorsal view; (B) head, ventral view; (C) detail of buccal tentacle,

enlarged from B; (D) posterior part of body and pygidium, lateral view. A, specimen from RV H. Mosby stn 84.05.23.1; B-C, specimen from RV

H. Mosby stn 83.06.03.2; D, paratype (ZMBN 94023, spm #2). Abbreviations: alO-11, abdominal chaetigers 10-11; ac, anal cirri; ap, anal

papillae; brl-4, branchiae; bt, buccal tentacles; np, nephridial papillae; pal, paleae; tl—3, thoracic chaetigers 1-3. Scale bars: 10 pm.

Ampharete undecima, a new deep-sea ampharetid (Annelida, Polychaeta) from the Norwegian Sea

Figure 5. Ampharete undecima sp. nov. (A) Details of paleae; (B) thoracic uncini from chaetiger 5; (C) details of thoracic uncini, enlarged from

B; (D) abdominal uncini from chaetiger 22; (E) details of abdominal uncini; (F) notopodium with capillary chaetae; (G) scale covering of

capillary chaetae, enlarged from F. Scale bars: 10 pm.

T. Alvestad, J.A. Kongsrud & K. Kongshavn

Figure 6. Ampharete undecima sp. nov. Paratypes (ZMBN 94024). Methyl blue staining pattern. (A, C) lateral, (B) ventral. Characteristic deep

stain on the anterior tip of the prostomium indicated by arrows in figure.

Acknowledgements

We are grateful to the MAREANO project and to T. Brattegard

for making material available for the present study through the

University Museum of Bergen. We thank N. Budaeva for

preparing the line drawings of the holotype, and the staff at the

Laboratory for Electron Microscopy, UoB for assistance during

work in the SEM lab. TA was supported by the Norwegian

Deepwater Programme (NDP), administered by the Norwegian

Academy of Science and Letters (DNVA). This work is part of

the ongoing work on Polychaete diversity in the Nordic Seas

(PolyNor) supported by the Norwegian Species Initiative.

Ampharete undecima, a new deep-sea ampharetid (Annelida, Polychaeta) from the Norwegian Sea

References

Bakken, T., Oug, E., and Kongsrud, J.A. 2014. Occurrence and

distribution of Pseudoscalibregma and Scalibregma (Annelida,

Scalibregmatidae) in the deep Nordic Seas, with the description of

Scalibregma hanseni n. sp. Zootaxa 3753(2): 101-117.

Blindheim J., and 0sterhus, S. 2005. The Nordic Seas, main oceanographic

features. Pp. 11-37 in: Drange, H., Dokken, T., Furevik, T., Gerdes,

R. and Berger W. (eds), The Nordic Seas: an integrated perspective.

American Geophysical Union: Washington DC.

Brattegard, T., and Fossa, J.H. 1991. Replicability of an epibenthic

sampler. Journal of the Marine Biological Association of the

United Kingdom 71: 153-166.

Hpisaeter, T. 2010. The shell-bearing, benthic gastropods on the

southern part of the continental slope off Norway. Journal of

Molluscan Studies 76: 234-244.

Holthe, T. 1986. Polychaeta Terebellomorpha. Marine Invertebrates of

Scandinavia 7: 1-194.

Imajima, M., Reuscher, M.G., and Fiege, D. 2012. Ampharetidae

(Annelida: Polychaeta) from Japan. Part I: The genus Ampharete

Malmgren, 1866, along with a discussion of several taxonomic

characters of the family and the introduction of a new identification

tool. Zootaxa 3490: 75-88.

Jirkov, I.A. 1997. Ampharete petersenae sp. n. (Ampharetidae,

Polychaeta) from the Northern Atlantic. Zoologicheskii Zhurnal

76(12): 1418-1420 (in Russian, with English summary).

Jirkov, I.A. 2001. Polychaeta of the Arctic Ocean. Yanus-K Press:

Moscow (in Russian).

Jirkov, I.A. 2011. Discussion of taxonomic characters and classification

of Ampharetidae (Polychaeta). Italian Journal of Zoology 78(S1):

78-94.

Kongsrud, J.A., Bakken, T., and Oug, E. 2011. Deep-water species of

the genus Ophelina (Annelida, Opheliidae) in the Nordic Seas,

with the description of Ophelina brattegardi sp. nov. Italian

Journal of Zoology 78: 95-111.

Malmgren, A.J. 1866. Nordiska Hafs-Annulater. Ofversigt af

Koniglich Vetenskapsakademiens forhandlingar, Stockholm, 22:

355-410.

MAREANO (Marine AREA1 database for Norwegian waters). URL:

http://mareano.no/en. [1 August 2013].

Parapar, J., Helgason, G.V., Jirkov, I., and Moreira, J. 2012. Polychaetes

of the genus Ampharete (Polychaeta: Ampharetidae) collected in

Icelandic waters by the Bioice project. Helgoland Marine

Research 66(3): 331-344.

Sars, M. 1865a. Fortsatte Bidrag til Kundskaben om Norges Annelider.

Forhandlinger i Videnskabs-Selskabet i Christiania 1864: 5-20.

Svavarsson, J., Strpmberg, J.-O., and Brattegard, T. 1993. The deep-

sea Asellota (Isopoda, Crustacea) fauna of the northern seas:

species composition, distributional patterns and origin. Journal of

Biogeography 20: 537-555.

Memoirs of Museum Victoria 71:21-25 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Do symbiotic polychaetes migrate from host to host?

TEMIR A. BrITAYEV 1 (http://zoobank.org/urn:lsid:zoobank.org:author:725C032C-5184-4ACl-A393-6CC9895824FE) AND

ELENA S. MeKHOVA 2 * (http://zoobank.org/urn:lsid:zoobank.org:author:B38AB627-C3AA-4DEl-BC18-14CA67191558)

1 Laboratory of Ecology and Morphology of Marine Invertebrates, A.N. Severtsov Institute of Ecology and Evolution.

119071 Leninsky prospekt 33, Moscow, Russia, (britayev@yandex.ru)

2 Laboratory of Ecology and Morphology of Marine Invertebrates, A.N. Severtsov Institute of Ecology and Evolution.

119071 Leninsky prospekt 33, Moscow, Russia, (elena.mehova@gmail.com)

* To whom correspondence and reprint requests should be addressed. Email: elena.mekhova@gmail.com

http://zoobank.Org/urn:lsid:zoobank.org:pub:lBA63B23-07A4-44FA-B222-F93B412D79F7

Abstract Britayev, T.A. and Mekhova, E.S. 2014. Do symbiotic polychaetes migrate from host to host? Memoirs of Museum Victoria

71: 21-25.

It is generally considered that symbiotic animals colonise their hosts during their early stages of development. The

main goal of the present study was to assess whether post-settled stages (juvenile and adult) of the symbiotic polychaete

Paradyte crinoidicola are able to colonise their host comatulid crinoids. We also considered possible motives for symbiont

migrations based on the intraspecific traumatism, size and sex structure data, and distribution pattern of P. crinoidicola. To

this end, field sampling and experiments with depopulated hosts of the comatulid crinoid Himerometra robustipinna were

carried out. The infestation prevalence was 62%, each infested host harbored from 1 to 7 polychaetes, and multiple

infestations with 2 or 3 polychaetes per host were common. Mean intensity was 2.1 specimens per host. The dispersion

coefficient was 1.7, greater than 1, indicating the tendency to contagious distribution pattern. Male/female ratio in P.

crinoidicola was very close to the expected 1:1 ratio. About 33 % of P. crinoidicola had a traumatised posterior ends, and

31% damaged and regenerated parapodia, elytra and cirri, likely attributable to intra-specific fighting. In the field experiments

depopulated crinoids were rapidly colonised by symbionts. The infestation characteristics of recolonised hosts didn’t differ

significantly to that of the control. Mean length of polychaetes and the ratio of small polychaetes to large polychaetes were

similar in the experimental series and in the control, indicating a colonisation of crinoids not only by settling larvae, but

predominately by migrating post-settled juveniles and adults. The male/female ratio deviated significantly in favor of males

in the experimental series, suggesting that males more than females actively migrate among hosts. Intraspecific competition

and searching for mating partners are proposed as causes for host swapping in P. crinoidicola.

Keywords Polychaeta, Paradyte crinoidicola, symbiont, traumas, sex ratio, migration, host switching, recolonisation, Comatulida,

crinoids, Vietnam.

Introduction

Obligatory symbiotic animals are well adapted morphologically

and behaviorally to live in close association with their hosts,

while it seems likely that they are vulnerable to predators

during movements between the hosts (Castro, 1978). Thus, it

was considered that interactions among particular symbiotic

associations are established only during close contacts

between hosts, as in the case of the crab ( Liopetrolisthes

mitra) inhabited sea urchins (Thiel et al., 2003), or the

polychaetes ( Histriobdella homari ) associated with lobsters

(Simon, 1968). Nevertheless, host-to-host migrations suggest

the existence of a free-living stage in the life-cycles of

symbionts, which was already demonstrated in several species

of crabs and ophiuroids (e.g. Castro, 1978; Fourgon et al.,

2007; Bruyn et al., 2009). Host switching was also found in the

crinoid-associated shrimp Synalpheus stimpsoni

(VandenSpiegel et al., 1998) and in a few species of symbiotic

polychaetes (Lande and Reish, 1968; Dimock, 1974; Britayev,

1991). It was supposed that host-to-host migrations should be

a rather common phenomenon in symbionts with territorial

behavior (Martin and Britayev, 1998). Motives for host

swapping include searching for better shelter and food supply,

mating partners, and intraspecific and interspecific competition

(Castro, 1978; Thiel et al., 2003). However, it is not clear

whether all these motives are relevant for each particular

species, or if motives differ in different species.

To verify the existence of host-to-host migrations in

symbiotic polychaetes we selected the scaleworm Paradyte

crinoidicola (Potts, 1910) as it is one of the most common

symbiotic polychaetes in tropical shallow waters with evidence

of territoriality (Britayev et al., 1999). This species is widely

T.A. Britayev & E. Mekhova

distributed in the Indo-West Pacific and inhabits more than 30

species of shallow-water unstalked crinoids or comatulids

with relatively high (14 to 48%) infestation prevalence

(Zmarzly, 1984; Britayev and Antokhina, 2012).

The main goal of the present study was to assess

experimentally whether post-settled juvenile and adult P.

crinoidicola migrate from host to host. We also considered

intraspecific traumatism, size and sex structure, distribution

pattern of polychaetes, and based on data obtained, possible

motives for the migrations of symbionts.

Material and methods

Sampling of crinoids and their symbionts, and field experiments

were carried out in the outer part of Nhatrang Bay (South

China Sea, South Vietnam), near eastern coast of Tre Island.

Host crinoid Himerometra robustipinna (Carpenter, 1881)

employed in our studies is common in the Bay of Nhatrang,

where it forms dense aggregations up to 10-15 individuals per

m 2 . Individuals are usually bright-red colored, which easily

distinguishes them from other crinoids in situ (fig. la). P.

crinoidicola is very abundant in the area (fig. lb) and inhabits

all the comatulids found in the Bay.

Specimens of H. robustipinna were hand-collected by

SCUBA diving at 6-10 m depth. Individuals were gently pulled

away from the substrate, and immediately placed in separate zip-

lock plastic bags to avoid loss of symbionts. On the boat, crinoids

were carefully checked and all visible polychaete symbionts

were removed and fixed in 70% alcohol. Later in the laboratory,

polychaetes were measured, sexed, and traumas recorded.

Although individuals easily fragmented, body measurements are

possible due to high correlation between length and width (y =

12,88x + 0,328, where y = length, x = width, R 2 = 0,983). Thus,

only body width between bases of parapodia of the widest

segments was measured. Sex was determined by the presence of

oocytes in females, spermatids or spermatozoa in males. For that

purpose, 1-2 midbody segments were placed on a slide in a drop

of glycerol, covered by a coverslip, and analysed with a light

microscope. Traumas to body and parapodia were recorded

according to Britayev and Zamishliak (1996). Two main types of

traumas were distinguished: small traumas (i.e. damaged elytra,

cirri or parapodia, either lacking or being smaller than those of

nearby segments as a consequence of regeneration processes,

probably attributable to intra-specific aggressive behavior) (fig.

2b, d) and large traumas (primarily posterior end of body lost and

regenerated, probably as a result of predators, e.g. fish and

crustacean attacks) (fig. 2 c). Specimens lacking elytra, cirri, and

posterior body end without traces of regeneration were not

considered as traumatised.

To characterise the infestation of H. robustipinna by P.

crinoidicola we determined the proportion of crinoids infested

(prevalence) and the mean number of symbiont individuals per

host infested (mean intensity). To determine the significance

of differences in the male/female ratio and prevalence we

used cp- test - angular Fisher transformation. To determine

the significance of differences in the mean intensity and mean

length we used t-test. To assess the distribution of polychaetes

among hosts we employed the ratio of variance (a 2 ) to mean

value (p), a 2 /p (coefficient of dispersion). If a population has a

random distribution, this ratio is close to 1.0. If the population

distribution is more uniform than random o 2 /p < 1.0, and if the

population is distributed contagiously, o 2 /p >1.0 (Zar, 1984).

For field experiments the area characterised by the

presence of large boulders and rocky outcrops, which are

suitable substrates for crinoids were selected. These boulders

were separated from each other by coarse sand with dead

shells and pebbles, which in general is an inappropriate

substrate for crinoids.

The study design included three experimental series and a

control. In the first two series depopulated and tagged specimens

of H. robustipinna were placed on boulders with dense

aggregation of crinoids to test whether post-settled symbionts

are able to migrate among host individuals within the locality.

In the third series a group of depopulated hosts was placed on

the isolated boulder without further crinoids to test the influence

of spatial isolation on host colonisation by symbionts.

A total of 42 crinoid individuals collected together with their

symbionts served as control. In each of the three series of

experiments 14 depopulated hosts were used. After a one-week

exposure, all experimental hosts were collected and analysed.

Crinoids were carefully checked for symbionts and symbionts

themselves were processed as described above. It was assumed

that all P. crinoidicola exceeding 5 mm in length or with

developed sexual reproductive structures infesting depopulated

crinoids were the result of migration events. This takes into

account the size of late nectochaetae (Bhaud and Cazaux, 1987)

and a few observations on the growth of post-settled scaleworms

(Pernet, 2000). More details on the experimental design and area

studied are described in a general paper dedicated to

recolonisation of H. robustipinna by associated symbiotic

community (Dgebuadze et ah, 2012).

Results.

Infestation characteristics and traumatism in the control.

From the 42 crinoid specimens employed in the experiments

we found 26 infested with P. crinoidicola , i.e. prevalence of

62%. Altogether 54 polychaetes were found, most (88.9%)

with gametocytes in the body cavity. The mean length of the

polychaetes was 9.3 mm. The ratio of small (L 4-7 mm) to

large polychaetes (L 8-15 mm) was 0.3:1. Each infested host

harboured from 1 to 7 polychaetes, and multiple infestations

with 2 or 3 polychaetes per host were very common (Table 1).

The mean intensity was 2.1 specimens per host. The dispersion

coefficient was 1.7 (Table 1). Male/female ratio in P.

crinoidicola was very close to the expected 1:1 (chi-square

0.083, P> 0.1).

Among P. crinoidicola infesting H. robustpinna, 33%

showed “large” traumas. The proportion of animals with

damaged and regenerated parapodia, elytra and cirri (small

traumas) was similar with 30% (Table 1).

Recolonisation experiments

After 7 days of exposure all tagged crinoids except one from

series 3 were recorded. The data revealed that depopulated

crinoids were rapidly colonised by symbionts. The prevalence

Do symbiotic polychaetes migrate from host to host?

Figure 1. a. Host crinoid Himerometra robustipinna (Carpenter, 1881) in situ. b. Polychaete Paradyte crinoidicola (Potts, 1910) on the arm of the host.

Figure 2. Traumas of Paradyte crinoidicola. a. Traumatized and regenerated elytra (white arrows), b. Dorsal surface of P. crinoidicola covered by

unaffected elytra, c. Damaged and partially regenerated parapodium (white arrow), d. Traumatized and regenerated posterior end of body. White

arrow indicates border between old and new chaetigers.

T.A. Britayev & E. Mekhova

Table 1. Infestation characteristics, size, male/female ratio, traumas of Paradyte crinoidicola, and number of hosts (in parenthesis) in the control

and in the experimental series.

Indices

Control (42)

Series 1 (14)

Series 2 (14)

Series 3 (13)

Symbionts number

Prevalence (infested hosts)

62% (26)

57% (8)

50% (7)

64% (8)

Mean intensity (±SD)

2.1 (±1.4)

1.6 (±1.1)

1.4 (±0.5)

2.7 (±1.7)

Mean length, mm (±SD)

9.3 (±2.9)

10.2 (±3)

8.9 (±2.1)

8.7 (±3.3)

Small/large worm ratio

0.3

0.2

0.3

Dispersion coefficient

1.7

1.1

0.3

4.3

Male/female ratio

1.1

1.4

3.5

5.7

Small traumas (%)

Large traumas (%)

of infestation was high and close to that in the control, while

mean intensity of recolonised hosts deviated in both sides to

that of the control (Table 1). The dispersion coefficient varied

significantly from 0.3 in series 2 to 4.3 in series 3. This

variability correlates rather with the low number of polychaetes

in series 1 and 2 than with biological interactions.

Mean length of polychaetes and the ratio of small to large

polychaetes were similar in the experimental series and in the

control (Table 1). Male/female ratio deviated in favour of

males in the experimental series (joint samples, chi-square

10.8, P < 0.01). This deviation was insignificant in series 1 and

2 (chi-square 0.3 and 2.8 respectively, P > 0.1), but increased

substantially in the spatially isolated locations in series 3

(Table 1, chi-square 9.8, P < 0.01). The proportion of

traumatised polychaetes varied for specimens with small

traumas from 0 to 42%, and for specimens with large traumas

from 29 to 60 (Table 1).

Discussion

Paradyte crinoidicola are very fragile animals, which easily

fragment when disturbed and lose elytra and cirri, both

original and regenerated. Thus, the actual number of animals

with both types of traumas should be higher than observed,

and for this particular species of scaleworm traumas of

parapodia are the most relevant mark of intraspecific

interactions. The high frequency of traumas similar to that in

other symbiotic scaleworms with intraspecific competition for

the host territory, viz. Arctonoe vittata, Gastrolepidia

clavigera, Branchipolynoe seepensis (Britayev, 1991; Britayev

and Zamyshliak, 1996; Britayev et al., 2007), suggests

territoriality also in P. crinoidicola. On the other hand, our

observations on host infestation and tendency to contagious

distribution of polychaetes among hosts (the dispersion

coefficient higher than 1 in the control and series 3, Table 1),

disagree with the expected regular distribution in species with

territorial behavior ( e.g . Odum, 1971) and data on solitary

distribution of P. crinoidicola among comatulid hosts in the

Red Sea (Fishelson, 1985). We suggest, that this particular

situation, viz. co-occurrence of contagious distribution and

territoriality, is related to several circumstances: (1) tolerance

of adult and juvenile residents to recruits, already known in

some other symbionts with territorial behavior, e.g. the crab

Allopetrolisthes spinifrons (Baeza et al., 2002), (2) relatively

large size of the host comatulid H. robustipinna and (3) its

morphological complexity, providing isolated microhabitats

for polychaetes. The discrepancy to Fishelson’s observations is

probably related to predation pressure regulating the

abundance of polychaetes, which is low due to overfishing in

the Bay of Nhatrang and relatively high in the Red Sea area

studied by Fishelson (senior author’s personal observation).

Our data revealed that depopulated crinoids were rapidly

colonised by symbionts. The infestation characteristics of

recolonised hosts didn’t differ significantly to that of the

control. To determine whether polychaetes infest host by

migration of already settled juveniles and adults from

neighbouring comatulids, or by settlement of larvae from the

plankton, the mean length of polychaetes and proportion of

adults in the control and in the experimental series were

compared. Similar means of both indices support the

hypothesis on migration of polychaetes between hosts.

Presently, host-swapping behavior has been documented in

only 3 polychaete species, the hesionid Ophiodromus

puggetensis (Lande and Reish, 1968), and the scaleworms

Arctonoepulchra and A. vittata (Dimock, 1974; Britayev, 1991).

With P. crinoidicola our experiments revealed one further

species with such a behavioral adaptation, suggesting it is a

more common phenomenon among symbiotic polychaetes than

has been considered so far, and proved indirectly a link between

territoriality and host-to-host migrations (Britayev, 1991).

The experimental series 1 and 2 indicated movement of

symbionts in dense host aggregations or over short distances.

It has been suggested such migrations are more common

between hosts with contagious distribution patterns than

between spatially dispersed hosts (Thiel et al., 2003). The

infestation characteristics of crinoids in the spatially isolated

site (series 3) were not lower than that of crinoids from

aggregations of series 1 and 2, suggesting also extensive long¬

distance host-to-host migrations. This unexpected result

Do symbiotic polychaetes migrate from host to host?

indicates the ability of symbionts to rapidly cross inappropriate

biotopes and requires special consideration.

As has been demonstrated earlier (Britayev, 1991),

intraspecific aggressive interactions accompanied by traumas

of body appendages lead to relocation of symbiotic polychaetes

from one host to another. The high frequency of traumas in the

control and series 1 and 3 indirectly indicates intraspecific

interactions in P. crinoidicola populations, so we can suggest

that one reason of their host-to-host migration is intraspecific

competition. Another possible reason likely is the search for

mating partners. The deviation in the sex ratio in favor of males

in experimental series indicates a higher migratory activity of

males in comparison to females. This latter phenomenon

attributed to searching for a mate is well known in symbiotic

crabs ( e.g. Wirtz and Diesel, 1983; Yanagisawa and Hamaishi,

1986; Baeza, 1999; Thiel et al., 2003), but only recently

documented in symbiotic polychaetes (Britayev et al., 2007).

Acknowledgements

The authors want to express their thanks to the administration

and the staff of the Coastal Branch of Russian-Vietnam

Tropical Center for the help in organising and conducting field

studies, to Dr. Polina Dgebuadze and our colleagues from the

Laboratory of Morphology and Ecology of Marine

Invertebrates of A.N. Severtsov Institute of Ecology and

Evolution, RAS for technical and field assistance. The study

was supported by the Russian Foundation for Basic Research,

under grants 12-05-00239, 12-04-31017. We are also thankful

for two anonymous reviewers whose comments greatly

benefited the manuscript.

References

Baeza, J.A. 1999. Indicadores de monogamia en el cangrejo comensal

Pinnixa transversalis (Milne, Edwards, & Lucas) (Decapoda:

Brachyura: Pinnotheridae): distribucion poblacional, asociacion

macho - hembra y dimorfismo sexual. Revista de Biologia Marina

y Oceanografi'a 34: 303 - 313.

Baeza, J.A., Stotz, W., Thiel, M. 2002. Agonistic behaviour and

development of territoriality during ontogeny of the sea anemone

dwelling crab Allopetrolisthes spinifrons (H. Milne, Edwards,

1837) (Decapoda: Anomura: Porcellanidae). Marine and

Freshwater Behaviour and Physiology 35: 189-202.

Bhaud, M., and Cazaux C. 1987. Description and identification of

polychaete larvae; their implications in current biological

problems. Oceanis 13(6): 596-753.

Britayev, T.A. 1991. Life cycle of the symbiotic scaleworm Arctonoe

vittata (Polychaeta: Polynoidae). Ophelia 5: 305-312.

Britayev, T.A., Doignon, G., Eeckhaut, I. 1999. Symbiotic polychaetes

from Papua New Guinea associated with echinoderms, with

descriptions of three new species. Cahiers de Biologie Marine 40:

359-374.

Britayev, T.A., and Antokhina, T.I. 2012. Symbiotic polychaetes from

Nhatrang Bay, Vietnam. Pp 11-54 in: Britayev, T.A., and Pavlov,

D.S. (eds). Benthic fauna of the Bay of Nhatrang, Southern

Vietnam. Vol. 2. KMK Scientific Press: Moscow.

Britayev, T.A., Martin, E., Krylova, R., von Cosel, T., Aksiuk, T. 2007.

Life-history traits of the symbiotic scale-worm Branchipolynoe

seepensis and its relationships with host mussels of the genus

Bathymodiolus from hydrothermal vents. Marine Ecology 28: 36-48.

Britayev, T.A., and Zamyshliak, E. 1996. Association of the

commensal scaleworm Gastrolepidia clavigera (Polychaeta:

Polynoidae) with holothurians near the coast of South Vietnam.

Ophelia 45: 175-190.

Bruyn, C., Rigaud, T., David, B., De Ridder, C. 2009. Symbiosis

between the pea crab Dissodactylus primitivus and its echinoid

host Meoma ventricosa: potential consequences for the crab

mating system. Marine Ecology Progress Series 375: 173-183.

Carpenter, P.H. 1881. The Comatulae of the Leyden Museum. Notes

Leyden Museum 3: 173-217.

Castro, P. 1978. Movements between corals colonies in Trapezia

ferruginea (Crustacea: Brachyura), an obligate symbiont of

scleractinian corals. Marine Biology 46: 237-245.

Dgebuadze, P., Mehova, E., Britayev, T.A. 2012. Recolonization of the

Himerometra robustipinna (Himerometridae, Crinoidea) by

macrosymbionts: an in situ experiment. Symbiosis 58(1-3): 253-258.

Dimock, R. 1974. Intraspecific aggression and the distribution of a

symbiotic polychaete on its host. Pp. 29-44 in: Vernberg, W.B.

(ed). Symbiosis in the sea. University of South Carolina Press:

Columbia.

Fishelson, L. 1985. Ecology of Red Sea crinoids and their epi- and

endozoic fauna. Marine Biology 28(2): 183-192.

Fourgon, D., Jangoux, M., Eeckhaut, I. 2007. Biology of a ‘babysitting’

symbiosis in brittle stars: analysis of the interactions between

Ophiomastix venosa and Ophiocoma scolopendrina. Invertebrate

Biology 126: 385-395.

Lande, R., Reish, D. 1968. Seasonal occurrence of the commensal

polychaetous annelid Ophryodromus pugettensis on the starfish

Patiria miniata. Bulletin of the Southern California Academy of

Sciences 67: 104-111.

Martin, D., and Britayev, T. 1998. Symbiotic polychaetes: review of

known species. Oceanography and Marine Biology 36: 217-340.

Odum E.P. 1983. Basic Ecology. Harcourt Brace College Publishers:

New-York. 613p.

Pernet, B. 2000. Reproduction and development of three symbiotic

scaleworms (Polychaeta: Polynoidae). Invertebrate Biology 119(1):

45-57.

Potts, F.A. 1910. Polychaeta of the Indian Ocean. Pt. 2. The

Palmyridae, Aphroditidae, Polynoidae, Acoetidae and

Sigalionidae. Transactions of the Linnean Society of London, Ser.

2, 16: 325-353.

Simon, J. 1968. Incidence and behavior of Histriobdella homari

(Annelida: Polychaeta), a commensal of the American lobster.

Bioscience 18: 35-36.

Thiel, M., Zander, A., Baeza, J.A. 2003. Movements of the symbiotic

crab Liopetrolisthes mitra between its host sea urchin Tetrapygus

niger. The Bulletin of Marine Science 72: 89-101.

VandenSpiegel. D., Eeckhaut, I., Jangoux, M. 1998. Host selection by

Synalpheus stimpsoni (De Man), an ectosymbiotic shrimp of

comatulid crinoids, inferred by a field survey and laboratory

experiments. Journal of Experimental Marine Biology and

Ecology 225: 185-196.

Wirtz, P., and Diesel, R. 1983. The social structure of Inachus

phalangium, a spider crab associated with the sea anemone

Anemonia sulcata. Zeitschriftfur Tierpsychologie 62: 209-234.

Yanagisawa, Y., and Hamaishi, A. 1986. Mate acquisition by a solitary

crab Zebrida adamsii, a symbiont of the sea urchin. Journal of

Ethology 4: 153-162.

Zar J.H. 1984. Biostatistical analysis, pp. 718. Englewood Cliffs, N.J.

(ed), Prentice-Hall.

Zmarzly, D. 1984. Distribution and ecology of shallow-water crinoids

at Enewetak Atoll, Marshall Islands, with an annotated checklist

of their symbionts. Pacific Science 38: 105-122.

Memoirs of Museum Victoria 71:27-43 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

New symbiotic associations involving polynoids (Polychaeta, Polynoidae) from

Atlantic waters, with redescriptions of Parahololepidella greeffi (Augener, 1918)

and Gorgoniapolynoe caeciliae (Fauvel, 1913)

TEMIR A. BrITAYEV 1 (http://zoobank.org/urn:lsid:zoobank.org:author:725C032C-5184-4ACl-A393-6CC9895824FE),

JOAO GlL 2 (http://zoobank.Org/urn:lsid:zoobank.org:author:FEB78694-898B-441C-B4CE-48E407CEFCC5),

ALVARO AlTUNA 3 (http://zoobank.org/urn:lsid:zoobank.org:author:0F6368E6-8E9F-4D66-A854-E40B6F019E88),

MARTA CalVO 4 (http://zoobank.org/urn:lsid:zoobank.org:author:35987386-5634-45B5-9A4F-95DCB6FCACF0) AND

DANIEL Martin 2 * (http://zoobank.org/urn:lsid:zoobank.org:author:BlD58BF8-6FB4-41EE-9B0C-3E52632A42C4)

1 A.N. Severtzov Institute of Ecology and Evolution (RAS), Moscow (Russia).

2 Centre d’Estudis Avangats de Blanes (CEAB - CSIC), 17300 Blanes (Girona), Catalunya (Spain).

3 INSUB, Museo de Okendo, Zemoria, 12. Apdo. 3223, 20013 Donostia-San Sebastian, Euskadi (Spain)

4 Museo Nacional de Ciencias Naturales (MNCN - CSIC), 28006 Madrid (Spain).

* Corresponding author: D. Martin. Centre d'Estudis Avan gats de Blanes (CEAB - CSIC), Carrer d’acces a la Cala Sant

Francesc 14,17300 Blanes (Girona), Catalunya (Spain). E-mail: dani@ceab.csic.es

http://zoobank.Org/urn:lsid:zoobank.org:pub:0FDF65D7-2BB9-4409-AEF2-B36E4AE16500

Abstract Britayev, T.A., Gil, J., Altuna, A., Calvo, M. and Martin, D. 2014. New symbiotic associations involving polynoids

(Polychaeta, Polynoidae) from Atlantic waters, with redescriptions of Parahololepidella greeffi (Augener, 1918) and

Gorgoniapolynoe caeciliae (Fauvel, 1913). Memoirs of Museum Victoria 71: 27-43.

Different circumstances such as sampling methodology, sample sorting or taxa distribution among different experts

often lead symbiotic associations to remain hidden and the mode of life of the involved partners are either not defined or

directly reported as free living. This was apparently the case of Parahololepidella, a genus proposed by Pettibone (1969)

to include Hololepidella greeffi Augener, 1918, reported as free-living from shallow waters off Sao Tome and Cabo Verde

Islands (W Africa). In this paper, we report for the first time the symbiotic status of P. greeffi (Augener, 1918), which lives

in association with the antipatharian Tanacetipathes cf. spinescens (Gray, 1857), based on new materials collected in Sao

Tome Island. In addition to the originally described features, the species is characterized by a variable presence of cephalic

peaks and by an irregular distribution of elytra from segment 32-33, which may be asymmetrical (within the same

individual) and differ between individuals. A list of all known polychaete species associated with antipatharian corals is

also provided. We also report new findings of Gorgoniapolynoe caeciliae (Fauvel, 1913) from deep waters of the Atlantic

coasts of the Iberian Peninsula, living in association with the octocorals Candidella imbricata (Johnson, 1862) (first report

for the Spanish waters) and Corallium niobe Bayer, 1964. The diagnosis of Gorgoniapolynoe is emended and we suggest

that G. corralophila (Day, 1960) should be referred to a different genus and that G. pelagica Pettibone, 1991a should be

considered as nomen dubium. The Iberian G. caeciliae fits well with the re-description by Pettibone (1991a), except for the

presence of clavate papillae on dorsal cirri, which were neither mentioned nor figured in previous descriptions.

Keywords New symbiotic associations; Polynoidae; Myriopathidae; Primnoidae; Coralliidae; Sao Tome Island; Cabo Verde Island;

Iberian Peninsula.

Introduction

Among the polychaete families, the Polynoidae includes the

highest number of symbiotic species. There were about 163

species involved in more than 420 relationships reported by

Martin & Britayev (1998), but the number has increased

continuously since then and currently exceeds 200 species

involved in about 550 relationships (D. Martin, unpublished data).

Different circumstances (such as sampling methodology,

sample sorting, or taxa distribution among the different experts)

often lead symbiotic associations to remain hidden. Consequently,

the mode of life of the involved partners is either not defined or

directly reported as free living. Some new reports may correspond

to these “hidden” associations, which turned to be recognized as

symbiotic when new or more precise observations were carried

out. This is the case for Parahololepidella, a genus proposed by

Pettibone (1969) to include Hololepidella greeffi Augener, 1918.

All known specimens of this species were reported as free-living

from shallow waters off Sao Tome and Cabo Verde Islands

(Augener, 1918; Pettibone, 1969).

T. Britayev, J. Gil, A. Altuna, M. Calvo & D. Martin

New specimens of this species were found among newly

collected materials from Sao Tome Island, housed and sorted

in the Museo Nacional de Ciencias Naturales (MNCN-CSIC)

of Madrid, and from Cabo Verde Island (collected during an

expedition to the Canarias - Cape Verdian region, CANCAP),

housed and sorted in the Naturalis - Nationaal Natuurhistorisch

Museum, Leiden (NNMN). All newly collected specimens

were living in association with the antipatharian Tanacetipathes

cf. spinescens (Gray, 1857) (Myriopathidae). Consequently, we

first report here the symbiotic status for Parahololepidella

greejfi (Augener, 1918). Moreover, as some morphological

details were not properly described in the original description,

we provide a full re-description of the species, including some

considerations on the status of Hololepidella fagei Rullier,

1964. A list of all known polychaete species associated with

antipatharian corals is also provided.

Furthermore, we also report on new findings of

Gorgoniapolynoe caeciliae (Fauvel, 1913) from deep waters off

the Atlantic coasts of the Iberian Peninsula, living in association

with the octocorals Candidella imbricata (Johnson, 1862) and

Corallium niobe Bayer, 1964. Both the genus and the species

are re-described based on these newly collected materials.

Material and methods

The specimens of P. greejfi and its host antipatharian

Tanacetipathes cf. spinescens were collected in different

locations off Sao Tome and Cabo Verde Islands (see the

corresponding Examined Material section and Table 1 for a

detailed list of samples and locations). Specimens from Sao

Tome Island were directly fixed and preserved in 70% ethanol,

while those from Cabo Verde were fixed in formaldehyde

(10% in seawater) and later rinsed with fresh water and

transferred to 70% ethanol.

The specimens of G. caeciliae were collected during the

2010 and 2011 expeditions of the INDEMARES project by the

Spanish Institute of Oceanography (IEO), at the Galicia Bank

(associated with Candidella imbricata) and at the Aviles

Canyon System (associated with Corallium niobe). Samples

were collected with the help of a hard bottom grab (“Draga de

roca” in Spanish, DR in the respective sample codes). They

were also directly fixed and preserved in 70% ethanol. Voucher

specimens are deposited at the IEO (Gijon Laboratory, Spain)

and the Okendo Museum (Donostia-San Sebastian, Spain).

Light microscope micrographs of relevant morphological

characters were made at the Laboratory of Microscopy and

Digital Photography of the CEAB, with the help of a ProgRes

CIO Plus digital camera (Jenoptics, Jena) attached to a Zeiss

Axioplan compound microscope (body) and a CT5 digital

camera (Jenoptics, Jena) attached to a SMZ1000 Nikon

stereomicroscope (parapodia). Drawings of parapodia were

made using an Olympus U-DA camera lucida attached to an

Olympus BX-41 microscope.

Abbreviations in text: af: anterior fragment; pf: posterior

fragment; L: length; WW: width without parapodia and

without chaetae; WC: width with parapodia and chaetae.

Taxonomic account

Family Polynoidae Kinberg, 1856

Subfamily Polynoinae Kinberg, 1856

Genus Parahololepidella Pettibone, 1969

Type species. Hololepidella greejfi Augener, 1918.

Diagnosis. Body long, slender, flattened, with sides nearly

parallel, tapered posteriorly, with numerous segments (up to 140

or more). Elytra numerous up to 50 and more pairs, on segments

2, 4, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 26, 29, 32, thereafter

irregularly arranged on alternate segments, often asymmetrical,

with different number on right and left sides. Elytra oval smooth,

without tubercles and micropapillae; first pairs medium sized,

usually covering mid-dorsum; following ones very small,

leaving mid-dorsum and parapodia uncovered. Prostomium

bilobed, subtriangular anteriorly, with or without distinct

cephalic peaks, with two palps and three antennae. Ceratophore

of median antenna in anterior notch; lateral antennae inserted

ventrally. First (tentacular) segment with a pair of tentaculophores

inserted laterally to prostomium, with 1-2 aciculae and one

slightly serrated unidentate notochaeta; facial tubercle

prominent; mouth surrounded by two lateral lips, one dorsal

with six-seven lobes, and one large ventral lip with 7-9 lobes.

Second (buccal) segment with first pair of elytra, sub-biramous

parapodia and long, tapering ventral cirri; without nuchal fold.

Parapodia sub-biramous. Notopodia small, digitiform;

notochaetae short, stout (not as stout as neurochaetae), tapering

to blunt tips, unidentate. Neuropodia with longer rounded

prechaetal lobes with subacicular digitiform processes;

postchaetal lobes short, rounded; neurochaetae stout, with faint

spinous regions, and slightly hooked, unidentate all of same

type. Dorsal cirri smooth, with cylindrical, relatively long

cirrophores and very long styles. Dorsal tubercles absent.

Ventral cirri short, tapering. Nephridial papillae short, bulbous.

Parahololepidella greejfi (Augener, 1918)

Zoobank LSID. http://z 00 bank. 0 rg/urn:lsid:z 00 bank. 0 rg:act:

FAED770C-2A9C-4EF6-AEC2-156863AED046

(Figs. 1-7)

Hololepidella greejfi-. Augener (1918), p. 148, pi. 2, figs. 22-24, pi.

3, fig. 52, text-fig. 9; Hartman (1959), p. 81; Rullier (1964), p. 130, fig. 3.

Hololepidella jagei: Rullier (1964), p. 132, fig. 4; Hartman (1965),

p. 9.

Parahololepidella greejfi'. Pettibone (1969), p. 54-55, fig. 4;

Kirkegaard (1983), p 192.

Material examined. Cabo Verde Archipelago. Santiago Island, SW coast

near Ponta da Cidade, 14°54'N 23°38'W. Sta. CANCAP 7.D01, depth to

22 m, one specimen af and pf (NNMN 24481) on Tanacetipathes cf.

spinescens, loose boulders on coarse sand, scuba diving, 20-21.08.1986,

“Tydeman” Cabo Verde Islands Exped., 1986. W of Boa Vista Island, W

of Ilheu de Sal Rei, 16°H'N 23°00'W, Sta. CANCAP 7.081, depth 70 m,

one complete specimen (NNMN 24644) on Tanacetipathes cf.

spinescens, antipatharians and sponges, 1.2 m Agassiz trawl, 28.08.1986,

“Tydeman” Cabo Verde Islands Exped., 1986.

New symbiotic relationships involving Polynoidae

Table 1. List of samples collected during the RSTP Cruise (2006) where Parahololepidella greejfi occurred in association with Tanacetipathes cf.

spinescens. N: Number of worms per sample; WT: Water temperature (°C); Depth (m); fr: fragment.

MNCN

Catalogue

Date

Reference

Island

Station

Coordinates

Depth

14/01/06

16.01/13707

Sao Tome Is.

Lago Azul 2

00°24T9.0” N

06°36'26.6” E

20-25

15/01/06

16.01/13708

Sao Tome Is.

Diogo Vaz 2

00°18'97.r N

06°30'23.3” E

5-15

15/01/06

16.01/13709

Sao Tome Is.

Diogo Vaz 1

00°18'53.2” N

06°29'23.3” E

20-25

18/01/06

16.01/13704

Sao Tome Is. - Rolas Is.

Pedra do Braga

00°00757.94”N

06°30'52.03”E

15-20

18/01/06

16.01/13706

lfr

Sao Tome Is. - Rolas Is.

Pedra do Braga

00°00"57.94”N

06°30'52.03”E

15-20

18/01/06

16.01/13705

Sao Tome Is. - Rolas Is.

Pedra do Braga

00°00'57.94”N

06°30752.03”E

15-20

Figure 1.- Parahololepidella greeffi. MNCN 16.01/13708. (A, B) and MNCN 16.01/14341 (C, D). Adults in dorsal (A, C) and ventral (B, D) view.

T. Britayev, J. Gil, A. Altuna, M. Calvo & D. Martin

Figure 2.- Parahololepidella greejfi. MNCN 16.01/13708. Juvenile. A. Entire view. A1 - A4. Detail of the anterior end (Al), mid-anterior region

(A2), mid-posterior region (A3), and posterior end (A4). Scale bars are cm.

Sao Tome e Principe Archipelago. 1 syntype, Ilha das Rolas,

Zoological Museum of Hamburg (ZMH 5692); 16 worms (plus some

fragments) on Tanacetipathes cf. spinescens, collected during the

Republic of Sao Tome e Principe (RSTP) cruise by CPD Service

Supporting Science Research (Table 1).

Description. Based mainly on a well-preserved specimen,

broken in two fragments, NNMN 24481). Body long, slender,

dorso-ventrally flattened, with sides nearly parallel, tapering

posteriorly, with up to 140 or more segments (figs. 1,2). Without

dorsal ciliary bands.

Prostomium slightly wider than long; cephalic peaks present

or absent; ceratophore of median antenna in anterior notch, style

smooth, tapering, longer than palps; lateral antennae inserted

ventrally to median antenna, styles smooth, tapering; anterior

pair of eyes dorso-lateral on widest part of prostomium,

posterior pair dorsal, near posterior prostomial margin, slightly

smaller than anterior ones; palps tapering. Facial tubercle

prominent; mouth surrounded by two lateral lips, one dorsal

with 6-7 lobes, and one large ventral lip with 7-9 lobes. Pharynx

with four light-brown jaws, all similar in shape and size; nine

pairs of large marginal pharyngeal papillae.

First (tentacular) segment with a pair of tentaculophores

inserted laterally to prostomium, with one, rarely two aciculae

and one slightly serrated unidentate notochaeta, with dorsal

and ventral tentacular cirri, styles smooth, tapering. Second

(buccal) segment with first pair of elytra, sub-biramous

parapodia and long, tapering ventral cirri. Nuchal fold absent.

Following segments with ventral cirri short, not reaching to tip

of neuropodium. Cirrigerous segments without dorsal tubercle.

Dorsal cirri smooth, with cylindrical, relatively long cirrophores

and very long styles.

Elytra numerous up to 50 and more pairs, on segments 2,4,

5,7, 9,11,13, 15,17,19, 21, 23, 26, 29,32, thereafter irregularly

New symbiotic relationships involving Polynoidae

Figure 3.- Parahololepidella greejfi. MNCN 16.01/13708. Elytrae. Numbers represent the segment from which elytra were removed.

arranged on alternate segments, often asymmetrical, with

different number on right and left sides (Table 2). Elytra almost

oval in outline, smooth, soft, tubercles and micropapillae

absent; first 11-12 pairs slightly folded, medium sized, usually

covering mid-dorsum; following ones, very small, leaving mid¬

dorsum and parapodia uncovered (fig. 3).

Parapodia sub-biramous (fig. 4A). Notopodia small,

digitiform (fig. 4B). Neuropodia with longer rounded prechaetal

lobes with subacicular digitiform acicular lobe; postchaetal

lobes shorter, distally rounded; tips of noto- and neuroacicula

penetrating epidermis (figs. 4B-4D, 5A, 5B). Nephridial

papillae short, bulbous, starting on segment 6 (fig. 4E).

Notochaetae slightly thinner than neurochaetae, few in

number (0-5), nearly smooth, unidentate; neurochaetae few in

number, but more numerous (5-10) than notochaetae, with

unidentate tips and faint serration, all of same type (fig. 4F, 4G).

Surface of elytra and body often covered with scattered,

angular, extraneous particles.

Measurements. 75-120 chaetigers, L 26-44 mm, WW 1.2-1.5

mm, WC 2.6-3.3 mm (Table 2).

Colour. Living worms not seen. Alcohol preserved worms with

light brown background, a prominent dark brown longitudinal

mid-dorsal band along all body (figs. 1A, 1C, 2), and dark brown

T. Britayev, J. Gil, A. Altuna, M. Calvo & D. Martin

Table 2. Variation in elytra distribution pattern and size in specimens of Parahololepidella greeffi associated to Tanacetipathes cf. spinescens.

Asymmetrical and variable elytral positions are marked in italics. Width: WW/WC; R: right side; L: left side.

Length

(mm)

Width

(mm)

Chaetiger

numb.

Elytra

numb.

Distribution of elytra

MNCN 16.01/

13708 af

1.45/3.25

110

R 2 4 5 7 9 11 13 15 17 19 21 23 26 29 32 33 34 38 40 42 44 46

48 50 52 54 56 60 62 64 66 68 7 2 74 76 78 80 82 84 86 88 90 92

94 96 98 100 102 104 106 109

L 2 4 5 7 9 11 13 15 17 19 21 23 26 29 32 33 34 39 39 41 43 45

47 49 51 53 55 56 60 62 64 66 68 70 72 74 76 78 80 82 84 86 88

90 92 94 96 98 100 102 104 106 109

MNCN 16.01/

13707

120

51/49

R 2 4 5 7 9 11 13 15 17 19 21 23 26 29 32 33 35 39 42 44 46 48

54 56 58 60 62 64 66 68 70 72 74 76 84 87 90 92 95 97

99 101102 103 105 107108 110 112 116119

L 2 4 5 7 9 11 13 15 17 19 21 23 26 29 32 34 36 38 39 42 44 46

54 56 58 60 62 64 66 68 70 72 74 76 84 87 90 95 98

99 101102 103 105 108 110 112 116119

MNCN 16.01/

13705 af + pf

1.5/3.1

108

50/49

R 2 4 5 7 9 11 13 15 17 19 21 23 26 29 32 33 35 37 39 41 43 45

47 50 52 54 56 58 60 62 64 66 68 70 72 74 76 78 80 81 83 85 87

89 91 93 95 102 104 106

L 2 4 5 7 9 11 13 15 17 19 21 23 26 29 32 33 35 37 39 42 44 45

47 50 52 54 56 58 60 62 64 66 68 70 72 74 76 78 80 81 84 86 88

90 92 94 102 104 106

MNCN 16.01/

13704 af + pf

1.2/2.6

R 2 4 5 7 9 11 13 15 17 19 21 23 26 29 32 34 36 38 40 42 47 48

51 53 55 57 59 61 63 65 67 69 71 73 75 77 79 81 83 86

L 2 4 5 7 9 11 13 15 17 19 21 23 26 29 32 34 3 6 38 40 42 47 48

51 53 55 57 59 61 63 65 67 69 71 73 75 77 79 81 86 88

NNMN 24481

af-i- pf

43/45

R 2 4 5 7 9 11 13 15 17 19 21 23 26 29 32 36 38 40 42 44 46 48

50 52 54 56 59 60 64 66 68 70 72 73 76 78 82 84 86 91 92 96 97

L 2 4 5 7 9 11 13 15 17 19 21 23 26 29 33 34 35 3739 41 43 45

47 49 51 53 55 57 59 60 63 65 67 69 71 72 75 77 81 83 85 89 92

96 97

NNMN 24644

35/34

R 2 4 5 7 9 11 13 15 17 19 21 23 26 29 32 34 36 38 40 42 44 46

48 50 52 54 56 58 60 62 64 66 68 70 72

L 2 4 5 7 9 11 13 15 17 19 21 23 26 29 32 34 36 38 40 42 44 47

49 51 53 55 57 59 61 63 65 67 69 71

pigmentation on cirrophores and, sometimes, on bases of cirri.

Some specimens may also show a longitudinal dark brown band

on ventral side, narrow in anterior segments, occupying nearly

all body width from mid-body to posterior end (fig. IB, ID).

Remarks. Our specimens agree well with Pettibone’s (1969)

description. However, the syntype deposited at the ZMH was in

a very poor state of preservation, being almost dehydrated (fig.

6A), to the extent that the the chaetae were damaged (fig. 6B).

The material from the museum included a few dissected

parapodia in an additional jar, which appeared to be in better

conditions (fig. 6D-F). The only differences with the parapodia

of the newly collected material were that the neurochaetae

seemed to be slightly thicker in the syntype, two of them

appearing slightly bidentate (black arrow, fig. 6E). Taking into

account the conditions of this material, however, we cannot

dismiss the possibility that these two traits could have been

caused by the dehydrating process suffered by the syntype.

Some of the features commonly used to discriminate species

and, even, genera among polynoids are highly variable within the

newly collected material. For instance, specimen MNCN

16.01/137094 lacks cephalic peaks, while they are present in

specimen NNMN 24644. Also, the elytra distribution becomes

asymmetrical (within a given worm) and irregular (between

worms) from chaetiger 32 or 33 to the end of the body (Table 2).

A similar variability was also described for another long bodied

species, Medioantenna variopinta (Di Camillo et al., 2011). The

shape of elytra may also vary. They are relatively large, covering

prostomium and mid-dorsum up to chaetigers 15-23, becoming

then very small and leaving the dorsum uncovered. However,

several specimens also show some small anterior elytra leaving

the dorsum uncovered, we suggest this being caused by the

presence of regenerating (small) elytra and/or parapodia. The

restricted distribution of these damaged elytra and/or parapodia,

lead us to attribute its presence to intra-specific aggressive

New symbiotic relationships involving Polynoidae

Figure 4.- Parahololepidella greejfi. MNCN 16.01/13708. Mid-body segment. A. Whole view of a transversal section, showing elytra and dorsal

cirri on the same segment. B. Notopodium. C. Neuropodial acicular lobe. D. Neuropodial post-acicular lobe. E. Ventral cirri and nephridial

papilla (black arrow). F. Neuropodial chaetae. G. Notopodial chaetae. Scale bars are cm (A) and mm (B-G).

T. Britayev, J. Gil, A. Altuna, M. Calvo & D. Martin

Figure 5.- Parahololepidella greejfi. MNCN 16.01/13708. Right cirrigerous parapodium. A. From chaetiger 44, posterior view, chaetae omitted.

B. From chaetiger 12, posterior view, with chaetae. Gorgoniapolynoe caeciliae. MNCN 16.01/14337. C. Left elytron of first pair; left margin

folded on dorsal side. D. Detail of margin of same elytron. E. Notochaeta. F. Ventral-most neurochaeta. G. Dorsal-most neurochaeta. H. 35 th

parapodium. Scale bars are pm.

behaviour that seems to characterize different species of symbiotic

polychaetes, particularly polynoids (e.g. Britayev et al., 2007).

Elytrae also seem the reason why Rullier (1964) described

a small (i.e. juvenile) specimen of P. greejfi as a new species,

Hololepidella fagei Rullier, 1964. Being small, this specimen

showed all elytra large, covering mid-dorsum, like those from

anterior-most segments in larger worms. This species was

synonymized with P. greejfi by Pettibone (1969) while

describing Parahololepidella as a new genus.

Ecology. Parahololepidella greejfi was found at 0-30 m deep,

living in association with colonies of the antipatharian

Tanacetipathes cf. spinescens, while it was previously recorded as

free living (Augener, 1918; Pettibone, 1969; Rullier, 1964). In fact,

Rullier (1964) reported specimens of H. greejfi occupying white

mucous tubes, incrusted with sand grains and fragments of shells.

According to Pettibone (1969), these tubes were perhaps formed

by some commensal host. However, the supposed presence of

tubes was not observed in our material, as the worms were always

directly attached to the surface of the host antipatharian, without

any trace of tubes. They were crawling on the main stems of the

plumose branches of the coral (fig. 7), having very similar, cryptic

colour (when preserved). All six colonies examined harboured

polychaetes, two of them with several individuals on each colony

(up to 6 in a 15x10 cm branch, MNCN 16.01/13707).

As previously reported for all known symbiotic polychaetes

(Martin & Britayev, 1998), the finding of P. greejfi as symbiont

reinforces the high diversity of the representatives of the

family Polynoidae living in association with antipatharian

hosts: of the 12 known species, eight are polynoids, three are

species of Eunice , and the remaining one is a syllid (Table 3).

Distribution. Tropical and Equatorial East Atlantic, Cabo

Verde and Sao Tome Archipelagos.

Genus Gorgoniapolynoe Pettibone, 1991

Type species. Gorgoniapolynoe bayeri Pettibone, 1991

Diagnosis. Body dorso-ventrally flattened, with up to about 60

segments; elytra leaving mid-dorsum uncovered, except in

anterior-most segments. 15 pairs of elytra on chaetigers 2, 4, 5,

7, 9, 11, 13, 15, 17,19, 21, 23, 26, 29, and 32. First 1-2 pairs of

elytra modified, with translucent, chitinous central area.

Prostomium wider than long, with rounded lobes and three

New symbiotic relationships involving Polynoidae

Figure 6.- Parahololepidella greejfi. Syntype ZMH 5692. A. Anterior end, dorsal view. B. Neurochaetae from anterior region, showing damaged

tips. C. Notochaetae. D. Dissected parapodia from mid-body. E. Neurochaetae of the same (black arrow pointing at the apparently bidentate

chaetae). F. Notochaetae of the same. B, C, E, F: scale bar 125 pm.

antennae; cephalic peaks absent or present; lateral antennae

latero-ventral to median antenna. Two pairs of eyes. Parapodia

with elongate acicular lobes, with noto- and neuroacicula

penetrating epidermis; tip of neuropodia extending to supra-

acicular process. Notochaetae few (0-7), stout, with blunt tip;

neurochaetae few, but more numerous (7-15), of same width as

notochaetae, usually bidentate. Prominent glandular area on

bases of ventral cirri starting from chaetigers 11-18.

Remarks. This diagnosis agrees in general with that of Pettibone

(1991a) and Bamich et al. (2013). The former paper included

nine species in Gorgoniapolynoe, among which seven fit well

with the generic diagnosis thus forming a compact species group.

However, Gorgoniapolynoe corralophila (Day, 1960) and

Gorgoniapolynoe pelagica Pettibone, 1991a differ in several

features. Both species have more numerous noto- and

neurochaetae; G. corralophila has three pairs of modified elytra

and notochaetae with widely spaced rows of spines and long bare

tips. The single known specimen of G. pelagica is small, has

twelve pairs of elytra and notochaetae of two kinds: long, stouter

than neurochaetae, and short, of the same width as neurochaetae.

This suggests that it could be a juvenile of another species.

Accordingly, we propose that G. corralophila should be referred

to a different genus and that G. pelagica could be a juvenile and

thus the species should be considered as nomen dubium.

Gorgoniapolynoe caeciliae (Fauvel, 1913)

Zoobank LSID. http://z 00 bank. 0 rg/urn:lsid:z 00 bank. 0 rg:act:

ACBD73A0-486E-4DE0-A72C-C553F46A7481

(Figs. 5C-H, 8-10)

Polynoe caeciliae: Fauvel (1913), 24, fig. 7A-D; Fauvel (1914), 69,

pi. 4, figs. 1-6, 18-19; Hartmann-Schroder, 1985: 31-33, figs. 1-5 (in

part; not specimens from Indian Ocean, not figs. 6-11).

Gorgoniapolynoe caeciliae: Pettibone (1991a), 704, figs. 12-14.

Material examined. Galicia Bank, NW Iberian Peninsula. Host

Candidella imbricata. MNCN 16.01/14337: 3 specimens from different

colonies, Sta. DR10-14/08/2010, INDEMARES 2010 expedition, 1482

m depth, 42°27.672'N 011°59.233'W. MNCN 16.01/14338: 1 specimen

from one colony, Sta. DR16- 24/08/2010, INDEMARES 2010

T. Britayev, J. Gil, A. Altuna, M. Calvo & D. Martin

Table 3. List of known polychaete species associated with antipatharian hosts. 1) Hartmann-Schroder & Zibrowius (1998); 2) Molodtsova &

Budaeva (2007); 3) Pettibone (1991b); 4) Wagner et al. (2012); 5) Pettibone et al. (1970); 6) Hanley & Burke (1991); 7) Barnich et al. (2013); 8)

this paper; 9) Glasby (1994); 10) Glasby & Krell (2009).

Family

Species

Host

References

Eunicidae

Eunice antipathum (Pourtales, 1867)

Distichopathes filix (Pourtales, 1867)

1,2

Elatopathes abietina (Pourtales, 1874)

1,2

Eunicidae

Eunice kristiani Hartmann-Schroder & Zibrowius,

1998

cf. Antipathes cylindrica Brook, 1889

1,2

Eunicidae

Eunice marianae Hartmann-Schroder & Zibrowius,

1998

cf. Antipathes cylindrica Brook, 1889

1,2

Polynoidae

Antipathypolyeunoa nuttingi Pettibone, 1991b

Tanacetipathes tanacetum (Pourtales, 1880)

3,4

Polynoidae

Bayerpolynoe floridensis Pettibone, 1991b

Stylopathes columnaris (Duchassaing, 1870)

3,4

Polynoidae

Benhamipolynoe antipathicola (Benham, 1927)

Stylopathes tenuispina Silberfeld, 1909

Stylopathes columnaris (Duchassaing, 1870)

4,5

Polynoidae

Brychionoe karenae Hanley & Burke, 1991

Leiopathes sp.

Polynoidae

Eunoe purpurea Treadwell, 1936

Bathypathes cf. alternata Brook, 1889

Polynoidae

Neohololepidella antipathicola Hartmann-Schroder

& Zibrowius, 1998

Elatopathes abietina (Pourtales, 1874)

1,2

Distichopathes filix (Pourtales, 1867)

1,2

Polynoidae

Parahololepidella greejfi (Augener, 1918)

Tanacetipathes cf. spinescens (Gray, 1857)

Polynoidae

Tottonpolynoe symantipatharia Pettibone, 1991b

Par antipathes sp.

Syllidae

Bollandiella antipathicola (Glasby, 1994)

Antipathes sp.

2,9,10

expedition, 1423 m depth, 42°28.838'N 011°55.873'W.

Aviles Canyon System, Bay of Biscay, N Iberian Peninsula. Host

Corallium niobe. MNCN 16.01/14341: 1 specimen, Sta. DR16-

05/08/2010: 1 specimen from one colony fragment and several colony

fragments without polychaetes but showing modifications of the axis

front resulting from the interaction with the polychaetes, INDEMARES

2010 expedition, 928 m depth, 44°01.509’N 005°42.898’W.

Additional material: Voucher specimens deposited in the IEO laboratory,

Gijon (Spain), and INSUB, Museo de Okendo, Donostia-San Sebastian.

Galicia Bank, NW Iberian Peninsula. Host Candidella imbricata. Sta.

DR10-14/08/2010: 32 specimens from seven colonies and fragments,

INDEMARES 2010 expedition, 1482 m depth, 42°27.672’N

011°59.233’W. Sta. DR16-24/08/2010: 18 specimens from one colony and

fragments, INDEMARES 2010 expedition, 1423 m depth, 42°28.838’N

011°55.873'W. Sta. DR04-22/07/2011: 1 specimen from one colony

fragment, INDEMARES 2011 expedition, 1288 m depth, 42°58.419’N

12°02.982’W. Sta. DR12-05/08/2011: ca. 72 specimens from three colony

fragments, INDEMARES 2011 expedition, 1585 m depth, 42°32.157’N

12°03.795'W. Host Corallium sp. Sta. DR08-13/08/2010: one dead colony

with likely worm-induced galleries, without worms, INDEMARES

2010 expedition, 1196 m depth, 42°55.941'N 12°05.149'W.

Diagnosis. Prostomial lobes rounded, without cephalic peaks;

first pair of elytrae modified with crescent shaped area on lateral

side, transparent, chitinous,withscatteredroundedmicrotubercles

and elongate globular micropapillae (figs. 5C, 5D, 8A, 8B);

remaining elytrae translucent almost circular with slightly folded

borders (fig. 8C); dorsal cirri with scarce clavate papillae, mainly

at basis (fig. 8D); parapodia as in generic diagnosis (figs. 5H, 8D),

with big, digitate nephridial papillae (fig. 8E); 0-3 notochaetae,

stout, with blunt tips (figs. 5E, 8F); 8-15 neurochaetae, as stout as

notochaetae, bidentate (figs. 5F, 5G, 8G, 8H).

Measurements. 37-49 chaetigers, L 7.0-17.0 mm, WW 0.9-1.6

mm, WC 1.4-2.3 mm.

Remarks. The Iberian specimens agree well with the re¬

description of the species by Pettibone (1991a), except in the

presence of clavate papillae on dorsal cirri, which were neither

mentioned nor figured in the original description.

Ecology. Gorgoniapolynoe caeciliae lives in association with

different species of octocorals belonging to the Acanthogorgiidae,

Primnoidae and Coralliidae (Barnich et al., 2013; Bayer, 1964;

Eckelbarger et al., 2005; Pettibone, 1991a). The polychaetes were

observed in all sampling stations where the host C. imbricata

(Primnoidae) was obtained, from 1288 m to 1585 m deep, living

inside galleries formed by highly modified sclerites of the

gorgonian (figs. 9A-9D), similar to those described by previous

authors in the same host (see Cairns, 2004, on colonies from W

Atlantic), but also on the acanthogorgiid gorgonian Acanthogorgia

armata Verrill, 1878 and A. aspera Pourtales, 1867, and on the

primnoid gorgonian Callogorgia sp. (see Barnich et al., 2013;

Britayev, 1981, and references herein).

Similar galleries (some with worms inside) were observed

in other species of Candidella, such as C. helmintophora

New symbiotic relationships involving Polynoidae

Figure 7.- Tanacetipathes cf. spinescens. MNCN16.01/13707. A.- Whole view of a host colony harbouring four specimens of Parahololepidella

greejfi. B. Detail of a host curled on the main stem of the host black coral. White arrows point to the position of the symbionts.

T. Britayev, J. Gil, A. Altuna, M. Calvo & D. Martin

100

Figure 8.- Gorgoniapolynoe caeciliae. MNCN 16.01/14337. A. Left elytron from first pair. B. Detail of margin of same. C. Elytron from mid-

anterior region. D. Parapodium from chaetiger 32, dorsal cirri broken (placed in approximate position); black arrow pointing on the small

scattered papillae on cirri; white arrow pointing on the approximate position of nephridial papilla. E. Nephridial papilla. F. Notochaetae. G.

Neurochaetae from dorsal-most bundle. H. Neurochaetae from ventral-most bundle. Scale bars are pm.

New symbiotic relationships involving Polynoidae

Figure 9.- Gorgoniapolynoe caeciliae. MNCN 16.01/14337. A. Two fragments of Candidella imbricata, one of them with the symbiont inside a

gallery formed by expanded esclerites (arrow pointing on worm’s head). B. Detail of the anterior end of the worm (arrow pointing on worm’s head

showing eyes through the first pair of elytra). C. Fragment of Candidella imbricata with the symbiont inside a gallery formed by expanded

esclerites (arrows pointing on worm’s head and pygidium). D. Same worm as in C, extracted from the gallery. MNCN 16.01/14341. E. Fragment

of Corallium niobe, with a worm inside a gallery in the axis of a branch. F. Anterior end of the same worm as in E, extracted from the gallery.

Scale bars are mm.

T. Britayev, J. Gil, A. Altuna, M. Calvo & D. Martin

Figure 10.- Dead colony of Corallium sp. showing traces of galleries (pointed by white arrows and outlined by red tracing) likely originated for

the association with Gorgoniapolynoe caeciliae. Scale bar is cm.

New symbiotic relationships involving Polynoidae

(Nutting, 1908) from Hawaii (Cairns, 2009; Nutting, 1908).

Other Hawaiian gorgonians, belonging to the genus Narella

(Primnoidae), such as N. alata Cairns & Bayer, 2008, N.

macrocalyx Cairns & Bayer, 2008 and N. vermifera Cairns &

Bayer, 2008 (Cairns & Bayer, 2008), showed similar galleries

with worms. However, the polychaetes in these four host

species were not identified. Thus, it is not possible to assess

whether they belong to the same polynoid species or to a

similar one. For instance, Gorgoniapolynoe galapagensis

Pettibone, 1991a was described in association to Narella

ambigua (Studer, 1894) from Galapagos Islands (Eastern

Central Pacific Ocean) and Gorgoniapolynoe bayeri Pettibone,

1991a, associated with Narella clavata (Versluys, 1906),

occurred in Philippine Islands (North Pacific Ocean).

Gorgoniapolynoe caeciliae was also reported in association

with five species of Corallium (Coralliidae), C. bayeri Simpson

& Watling, 2011, C. johnsoni Gray, 1860, C. niobe Bayer,

1964, C. secundum Dana, 1846 and C. tricolor (Johnson, 1898)

(Bayer, 1964; Fauvel, 1913; Hartmann-Schroder, 1985;

Simpson & Watling, 2011; Stock, 1986). It must be pointed out

that Stock (1986) reported C. projundum Dana, 1846 as a host

for the polychaete, but this species does not exist and most

likely was a misspelling for C. secundum. When associated

with Corallium , including our sample of C. niobe (figs. 9E,

9F), the worms induce malformations in the host branches,

which form entirely covered galleries that contain a single

worm inside (see Barnich et al., 2013, and references herein).

Similar galleries were also depicted by Bayer (1956) on C.

secundum and Bayer (1964) on C. niobe, but the worms were

not identified. The dead colony of Corallium found in Galicia

Bank completely lacked the original soft tissues (those

observed in the picture correspond to secondary colonization

of the coral skeleton by a zoantharian), this preventing the

identification to species level. However, the skeleton also

showed traces of several galleries (fig. 10), which agree with

those found on the living colonies of C. niobe harbouring the

polychaete at the Aviles Canyon System.

In all cases, all the galleries were not excavated on the

coral skeleton but appeared to be produced by the coral tissues

and skeleton overgrowing the original soft tube produced by

the worm (which may still be observed laying between the

coral tissues and the worms themselves), in a similar way to

the modifications induced by Eunice norvegica (Linnaeus,

1767) on its host scleractinian coral Lophelia pertusa

(Linnaeus, 1758) (Mueller et al., 2013). This suggests that G.

caeciliae may play an equivalent, functional role to that of E.

norvegica in structuring the assemblages of its coral hosts.

Distribution. Widely distributed in the NW and NE Atlantic,

from 400-1500 m depth according to Barnich et al. (2013).

The present report includes a slightly deeper depth range

(down to 1585 m) and is the first mention of the association

between G. caeciliae and C. imbricata for Spanish waters. The

presence of the polychaete in different locations from N and

NW Iberian waters was previously reported by Fauvel (1913),

Hartmann-Schroder (1985) and Pettibone (1991a) in

association with Corallium species (i.e. C. niobe and

C. johnsoni ).

Acknowledgements

The present study was partly financed by the Russian Foundation

of Basic Researches (grant No 12-05-00239-a) and the European

Community through the INDEMARES-LIFE project (07/

NAT/E/000732) and is a contribution of D. Martin to the

Consolidated Research Group 2014 SGR 120 of the Generalitat

de Catalunya and to the Reseach Project CTM2013-43287-P,

funded by the Spanish State Research Plan. We wish to thank

Dr. T. Molodtsova from the Institute Oceanology RAS for the

identification of the antipatharian host and for providing us with

additional specimens of P. greeffi, and the two anonymous

reviewers for their insightful comments on the manuscript.

References

Augener, H. (1918). Polychaeta. In Beitrage zur Kenntnis der

Meeresfauna Westafrikas (Vol. 2, pp. 67-625). Hamburg:

Herausgegeben von W. Michaelsen.

Barnich, R., Beuck, L., & Freiwald, A. (2013). Scale worms

(Polychaeta: Aphroditiformia) associated with cold-water corals in

the eastern Gulf of Mexico. Journal of the Marine Biological

Association of the United Kingdom, 93(8), 2129-2143.

Bayer, F. M. (1956). Descriptions and redescriptions of the Hawaiian

octocorals collected by the U.S. Fish Commission steamer

“Albatross” (2. Gorgonacea: Scleraxonia). Pacific Science, 10, 67-

95.

Bayer, F. M. (1964). The genus Corallium (Gorgonacea: Scleraxonia)

in the western North Atlantic ocean. Bulletin of Marine Science of

the Gulf and Caribbean, 14, 465-478.

Benham, W. B. (1927). Polychaeta. British Antarctic ‘Terra Nova ’

Expedition Natural History Reports, Zoology, 7(2), 47-182.

Britayev, T. A. (1981). Two new species of commensal polynoids

(Polychaeta: Polynoidae) and bibliography on polychaetes,

symbionts of Coelenterata. [In Russian]. Zoologicheski Zhurnal,

60(6), 817-824.

Britayev, T. A., Martin, D., Krylova, E. M., von Cosel, R., & Aksiuk, E.

S. (2007). Life-history traits of the symbiotic scale-worm

Branchipolynoe seepensis and its relationships with host mussels

of the genus Bathymodiolus from hydrothermal vents Marine

Ecology: An Evolutionary Perspective, 28(1), 36-48.

Brook, G. (1889). Report on the Antipatharia. Report on the Scientific

Results of the Voyage of the H.M.S. Challenger. Zoology, 32,

1 - 222 .

Cairns, S. D. (2004). Studies on western Atlantic Octocorallia

(Coelenterata: Anthozoa)- Part 5: the genera Plumarella Gray,

1870; Acanthoprimnoa, n. gen.; and Candidella Bayer, 1954.

Proceedings of the Biological Society of Washington, 117(4), 447-

487.

Cairns, S. D. (2009). Review of Octocorallia (Cnidaria: Anthozoa)

from Hawaii and adjacent seamounts. Part 2: Genera

Paracalyptrophora Kinoshita, 1908; Candidella Bayer, 1954; and

Calyptrophora Gray, 1866. Pacific Science, 63, 413-448.

Cairns, S. D., & Bayer, F. M. (2008). A Review of the Octocorallia

(Cnidaria: Anthozoa) from Hawaii and Adjacent Seamounts: The

Genus Narella Gray, 18701. Pacific Science, 62(1), 83-115.

Dana, J. W. (1846). Zoophytes. Volumen VII of the United States

Exploring Expedition during the years 1838, 1839, 1840, 1841,

1842, under the command of Charles Wilkes, U.S.N.. Philadelphia:

Lea and Blanchard.

Day, J. H. (1960). The Polychaete fauna of South Africa. Part 5. Errant

species dredged off Cape coasts. Annals of the South African

Museum, 45(3), 261-373.

T. Britayev, J. Gil, A. Altuna, M. Calvo & D. Martin

Di Camillo, C. J., Martin, D., & Britayev, T. A. (2011). Symbiotic

association between Solanderia secunda (Cnidaria, Hydrozoa,

Solanderiidae) and Medioantenna variopinta sp. nov. (Annelida,

Polychaeta, Polynoidae) from North Sulawesi (Indonesia).

Helgoland Marine Research, <55(4), 495-511.

Duchassaing, P. (1870). Revue des Zoophytes et des Spongiaires des

Antilles. Paris: Victor Masson.

Eckelbarger, K. J., Watling, L., & Fournier, H. (2005). Reproductive

biology of the deep-sea polychaete Gorgoniapolynoe caeciliae

(Polynoidae), a commensal species associated with octocorals.

Journal of the Marine Biological Association of the United

Kingdom, 86(6), 1425-1433.

Fauvel, P. (1913). Quatrieme note preliminare sur les polychetes

provenant des campagnes de l’“Hirondelle” et de la “Princesse-

Alice”, ou deposees dans le Musee Oceanografique de Monaco.

Bulletin de VInstitut Oceanographique (Foundation Albert ler,

Prince de Monaco), 270, 1-80.

Fauvel, P. (1914). Annelides polychetes non-pelagiques provenant des

campagnes de l’Hirondelle et de la Princesse-Alice (1885-1910).

Resultats des Campagnes Scientifiques Accomplies par le Prince

Albert I. Monaco, 46, 1-432.

Glasby, C. J. (1994). A new genus and species of polychaete, Bollandia

antipathicola (Nereidoidea, Syllidae), from black coral.

Proceedings of the Biological Society of Washington, 107, 615-621.

Glasby, C. J., & Krell, F.-T. (2009). Bollandiella nom. nov. for the

polychaete genus Bollandia Glasby, 1994 (Annelida: Polychaeta:

Phyllodocida: ?Syllidae). Proceedings of the Biological Society of

Washington, 122(3), 355-356.

Gray, J. E. (1857). Synopsis of the families and genera of axiferous

zoophytes or barked corals. Proceedings of the Zoological Society

of London, 25, 278-294.

Gray, J. E. (1860). Description of a new coral (Corallium johnsoni)

from Madeira. Proceedings of the Zoological Society of London,

28, 393-394, plate XVIII.

Hanley, J. R., & Burke, M. (1991). A new genus and species of

scaleworm (Polychaeta, Polynoidae) from the Cascade Plateau,

Tasman Sea. The Beagle, Records of the Northern territory Museum

of Arts and Sciences, S(l), 97-102.

Hartman, O. (1959). Catalogue of the polychaetous Annelids of the

World, parts 1-2. Allan Hancock Foundation Publications,

Occasional Papers, 23, 1-628.

Hartman, O. (1965). Supplement and index to the catalogue of the

polychaetous annelids of the World, including additions and

emendations since 1959. Allan Hancock Foundation Publications,

Occasional Papers, 23, 1-197.

Hartmann-Schroder, G. (1985). Polynoe caeciliae Fauvel (Polynoidae),

ein mit Korallen assoziierter Polychaet. Mitteilungen aus dem

Hamburgischen zoologischen Museum und Institut, 82, 31-35.

Hartmann-Schroder, G., & Zibrowius, H. (1998). Polychaeta

associated with Antipatharia (Cnidaria: Anthozoa): description of

Polynoidae and Eunicidae. Mitteilungen aus dem Hamburgischen

zoologischen Museum und Institut, 95, 29-44.

Johnson, J. Y. (1862). Descriptions of two new corals from Madeira,

belonging to the genera Primnoa and Mopsea. Proceedings of the

Zoological Society of London, 1862, 245-246.

Johnson, J. Y. (1898). Short diagnoses of two new species of Coralliidae

from Madeira. Annals and Magazine of Natural History, 7(2), 421-

422.

Kinberg, J. G. H. (1856). Nya slagten och arter af Annelider. Ofversigt

af Konglia Vetenskapsak-Aademiens Ffor handling ar, Stockholm

72(9-10), 381-388.

Kirkegaard, J. B. (1983). The Polychaeta of West Africa Part II. Errant

species 1. Aphroditidae to Nereididae. Atlantide Report, 13, 181-

240.

Linnaeus, C. (1758). Systema Naturae Regna Tria Naturae, Secundum

Classes, Ordines, Genera, Species, cum characteribus, dijferentiis,

synonymis, locis. Tomus I. Editio Decima, Reformata. Stockholm:

Laurentii Salvii.

Linnaeus, C. (1767). Systema Naturae per Regna Tria Naturae, Editio

Duodecimo, Reformata, Tomus I, Pars II. Regnum Animate.

Stockholm: Laurentii Salvii.

Martin, D., & Britayev, T. A. (1998). Symbiotic polychaetes: Review of

known species. Oceanography and Marine Biology: An Annual

Review, 36, 217-340.

Molodtsova, T., & Budaeva, N. (2007). Modifications of Corallium

morphology in black corals as an effect of associated fauna. Bulletin

of Marine Science, 81, 469-480.

Mueller, C. E., Lundalv, T., Middelburg, J. J., & van Oevelen, D. (2013).

The symbiosis between Lophelia pertusa and Eunice norvegica

stimulates coral calcification and worm assimilation. [Article]. PLoS

ONE, 8(3).

Nutting, C. C. (1908). Descriptions of the Alcyonaria collected by the

U.S. Bureau of Fisheries steamer Albatross in the vicinity of the

Hawaiian Islands in 1902. Proceedings of the United States National

Museum, 34, 543-601.

Pettibone, M. H. (1969). The genera Polyeunoa McIntosh, Hololepidella

Willey, and three new genera (Polychaeta, Polynoidae). Proceedings

of the Biological Society of Washington, 82(3), 43-62.

Pettibone, M. H. (1970). Polychaeta Errantia of the Siboga Expedition.

Part IV. Some additional polychaetes of the Polynoidae, Hesionidae,

Nereidae, Goniadidae, Eunicidae, and Onuphidae, selected as new

species by the late Dr. Hermann Augener with remarks on other

related species. In Siboga-Expeditie Uitkomsten op Zoologisch,

Bonatisch, Oceanographisch en Geologisch gebied verzameld in

Nederlandsch Oost-Indie 1899-1900 (pp. 199-270). Leiden: E.J.

Brill.

Pettibone, M. H. (1991a). Polynoids commensal with gorgonian and

stylasterid corals, with a new genus, new combinations, and new

species (Polychaeta: Polynoidae: Polynoinae). Proceedings of the

Biological Society of Washington, 104(4), 688-713.

Pettibone, M. H. (1991b). Polynoid polychaetes commensal with

antipatharian corals. Proceedings of the Biological Society of

Washington, 104(4), 714-726.

Pourtales, L. F. d. (1867). Contributions to the fauna of the Gulf Stream

at great depths. Bulletin of the Museum of Comparative Zoology at

Harvard College, 1(6), 103-120.

Pourtales, L. F. d. (1874). Crinoids and corals. Zoological results of the

“Hassler” expedition. Illustrated Catalogue of the Museum of

Comparative Zoology at Harvard College, 8, 25-50.

Pourtales, L. F. d. (1880). Reports on the Results of Dredging, under the

Supervision of Alexander Agassiz, in the Caribbean Sea, 1878-79,

by the United States Coast Survey Steamer “Blake,” Commander

J.R. Bartlett, U.S.N., Commanding, 6: Report on the Corals and

Antipatharia. Bulletin of the Museum of Comparative Zoology at

Harvard College, Vl(4), 95-120.

Rullier, F. (1964). Resultats scientifiques des campagnes de la Calypso -

Campagne de la Calypso aux lies du Cap Vert (1959) (suite): 5.

Annelides polychetes. Annales de VInstitut Oceanographique,

41(6), 113-218.

Silberfeld, E. (1909). Diagnosen neuer japanischer Antipatharien aus der

Sammlung von Herm Prof. Doflein (Miinchen). Zoologischer

Anzeiger, 34, 760-793.

Simpson, A., & Watling, L. (2011). Precious corals (Coralliidae) from

north-western Atlantic Seamounts. Journal of the Marine Biological

Association of the United Kingdom, 91, 369-382.

Stock, J. H. (1986). Cases of hyperassociation in the Copepoda

(Herpyllobiidae and Nereicolidae). Systematic Parasitology, 8, 71-

81.

New symbiotic relationships involving Polynoidae

Studer, T. (1894). Reports on the dredging operations off the West

Coast of Central America to the Galapagos, to the West Coast of

Mexico, and in the Gulf of California, in charge of Alexander

Agassiz, carried on by the U. S. Fish Commission Steamer

“Albatross,” during 1891, Lieut. Commander Z. L. Tanner, U. S.

N., commanding. X. Note preliminaire sur les Alcyonaires.

Bulletin of the Museum of Comparative Zoology of Harvard

College, 25(5), 53-69.

Treadwell, A. L. (1936). Polychaetous annelids from the vicinity of

Nonsuch Island, Bermuda. Zoologica, New York, 27(1), 49-68.

Verrill, A. E. (1878). Notice of recent additions to the marine fauna of

the eastern coast of North America, No. 2. The American Journal

of Science and Arts, 16(95), 371-378.

Versluys, J. (1906). Die Gorgoniden der Siboga Expedition II. Die

Primnoidae. Siboga- Expeditie Monographie, XIII, 1-178.

Wagner, D., Luck, D. G., & Toonen, R. J. (2012). Chapter Two - The

Biology and Ecology of Black Corals (Cnidaria: Anthozoa:

Hexacorallia: Antipatharia). In L. Michael (Ed.), Advances in

Marine Biology (Vol. Volume 63, pp. 67-132): Academic Press.

Memoirs of Museum Victoria 71:45-51 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Morphological anomalies in polychaetes: Perinereis species (Polychaeta: Annelida)

examples from the Brazilian coast

Marina C. L. Coutinho and Cinthya S. G. Santos*

Biology Institute, Marine Biology Department, Federal Fluminense University, Rua Outeiro Sao Joao Batista, s/n, PO Box

100.644, Niteroi, RJ 24020-150, Brazil (marinacoutinho88@gmail.com, cinthyasantos@id.uff.br)

* To whom correspondence and reprint requests should be addressed. E-mail: cinthyasantos@id.uff.br

Abstract Coutinho, M.C.L. and Santos, C.S.G. 2014. Morphological anomalies in polychaetes: Perinereis species (Polychaeta:

Annelida) examples from the Brazilian coast. Memoirs of Museum Victoria 71: 45-51.

The examination of a large number of specimens in the context of taxonomic and ecological studies may lead to the

discovery of morphological anomalies. The aim of this study was to describe the morphological anomalies observed in

some individuals of Perinereis anderssoni and Perinereis ponteni collected in various regions of the Brazilian coast. A

total of 290 specimens were analysed from along the northern and southern Brazilian coast, and 21 of these presented

morphological anomalies, such as variations in the number of tentacular cirri and eyes, completely or basally fused

antennae, chaetigers with three parapodia, and others. Perinereis anderssoni presented the highest number of anomalous

individuals, and the most frequent morphological anomaly was the presence of a single antenna and nine tentacular cirri.

Anomalous individuals of P. ponteni with seven tentacular cirri were also commonly collected. Ilha do Mel (PR) was the

area with the highest percentage of individuals with anomalies (12.96%), followed by Martim de Sa (SP) (10.31%), Sao

Francisco do Conde (BA) (8.33%), Tambaba (PB) (5.55%) and Itaipu (RJ) (1.92%). Most of the sampling locations have a

history of contamination by a diverse array of pollutants. We provide background information for the morphological

changes observed in two species that occur along the Brazilian coast, but additional studies are needed to confirm the real

cause of these anomalies and their effect on the population structure of these ecologically important species.

Keywords morphology, abnormalities, Nereididae, Perinereis, Ceratonereis, Unanereis

Introduction

The genus Perinereis is commonly found in shallow-water

environments is composed of approximately 60 described

species and is considered polyphyletic (Bakken and Wilson,

2005). The species in this genus are characterised by the

presence of a proboscis with conical paragnaths on the

maxillary and oral rings, and conical and additional bar¬

shaped paragnaths on the oral ring, four pairs of tentacular

cirri with distinct cirrophores, one pair of biarticulated palps,

a pair of frontal antennae, two pairs of eyes, notopodia with

homogomph spinigers throughout, neuropodia with

homogomph spinigers, heterogomph spinigers and

heterogomph falcigers, notopodial ligule present and

prechaetal notopodial lobe and postchaetal neuropodial lobe

present or absent (De Leon-Gonzalez and Solfs-Weiss, 1998;

Bakken and Wilson, 2005).

The examination of a large number of specimens in the

context of taxonomic and ecological studies may lead to the

discovery of morphological anomalies (Mohammad, 1981).

These anomalies may occur within and between populations

and can be the result of a range of processes (e.g. genetic,

ecophenotypic or ontogenetic) or due to other factors, such as

injury. Genetic processes are related to the presence of

different genotypes in the same population or different

populations of the same species, and are associated with

phenotypic (i.e. relating to the external shape, physiological

or behavioural character) variations of adaptive value to

individuals. Morphological changes with adaptive value have

been found in several species of polychaetes, particularly in

the Nereididae (Geracitano et al., 2004a). Ecophenotypic

factors refer to morphological changes resulting from

environmental changes, such as contamination or changes in

the concentration of an abiotic factor, and they can also

generate genetic alterations (Backmann et al., 1995;

Geracitano et al., 2002, 2004b; Bocchetti et al., 2004;

Ferreira-Cravo et al., 2009; Mouneyrac et al., 2010; Ahrens

et al., 2013). Ontogenetic factors are associated with the

changes undergone by organisms during their development

(Qian, 1999; Kubal et al., 2012). In the same way, injuries

caused by predators may alter the bodies of individuals and

M.C.L. Coutinho & C.S.G. Santos

result in the reduction or absence of cirri and parapodial

structures.

The aim of this study was to describe the morphological

anomalies observed in individuals of Perinereis anderssoni

Kinberg, 1866 and Perinereisponteni Kinberg, 1866, collected

from different regions along the Brazilian coast. It is beyond

the scope of this study to determine the causes of these

anomalies.

Materials and methods

A total of 119 atokous individuals of P. ponteni (7.00-77.50

mm) and 171 of P. anderssoni (4.50-58.12 mm) from different

states along the northern and southern Brazilian coast were

analysed. Specimens of P. anderssoni were collected from

four populations in the following localities: Ilha do Mel,

Parana (PR) (July to August 2012); Itaipu, Rio de Janeiro (RJ)

(April 2009 to April 2010); Tambaba, Paralba (PB) (February

2009); Martim de Sa, Sao Paulo (SP) (March, April, August

and September 2001). Specimens of P. ponteni were collected

from four populations in the following localities: Ilha do Mel,

Parana (PR) (July 2012); Itaipu, Rio de Janeiro (RJ) (August

2009 to March 2012); Sao Francisco do Conde, Bahia (BA)

(July 2011) and Martim de Sa, Sao Paulo (SP) (March and

September 2001) (fig. 1).

All specimens were collected from rocky shores by

scraping small areas covered by the bivalve Brachidontes sp.

and the green alga Ulva sp. and mixed with coarse sediment

grains. Specimens were anesthetized with menthol, fixed in

10% formalin (except for the populations of Itaipu, which were

fixed in 4% formalin) and preserved in 70% ethanol. The

specimens were examined with a stereomicroscope and

photographed with a Sony CyberShot 13MP digital camera.

Photographs were edited with PhotoScape v.3.6.2.

Results

A total of five specimens of P. ponteni (9.8-20.6 mm long) and

16 specimens of P. anderssoni (6.0-41.9 mm long) from a

number of populations presented morphological anomalies

(figs 2 and 3). Based on descriptions of P. anderssoni and P.

ponteni by Lana (1984), De Leon-Gonzalez (1999) and Santos

and Steiner (2006), the differences were considered anomalies

and not intraspecific or interspecific variations as they did not

045° W 035° W

Figure 1. Location of sampling sites in states of Brazil.

follow a pattern of occurrence (table 1). It is also notable that

the cirri and parapodial anomalies were never symmetrical,

nor did they occur in the same parapodia or body region.

Of the two species, P. anderssoni had the most observed

anomalies, and this may be partly explained by the greater

number of individuals examined. Among the sampling

localities, Ilha do Mel (PR) was the locality with the highest

percentage of anomalous individuals (12.96%), followed by

Martim de Sa (SP) (10.31%), Sao Francisco do Conde (BA)

(8.33%), Tambaba (PB) (5.55%) and Itaipu (RJ) (1.92%) (fig. 4).

Table 1. Morphological characteristics and anomalies described in P. ponteni and P. anderssoni

Morphological characters/

Normal characters

Anomalies

Species

P. ponteni

P. anderssoni

Antennae

A pair of frontal antennae

Single antenna, two antennae

completely fused, two antennae

basally fused

Tentacular cirri (number)

Number of parapodia

Number of eyes

Eight tentacular cirri

Chaetiger with two parapodia

Two pairs of eyes

Seven or nine tentacular cirri

Six, seven or nine tentacular cirri

Chaetiger with three parapodia

Five eyes

Morphological anomalies in polychaetes: Perinereis species (Polychaeta: Annelida) examples from the Brazilian coast

Figure 2. Morphological anomalies in P. anderssoni : A. single antenna; B. basally fused antennae; C. completely fused antennae; D. seven

tentacular cirri; E. two parapodia on the same side of chaetiger; F. five eyes; G. nine tentacular cirri; H. six tentacular cirri.

M.C.L. Coutinho & C.S.G. Santos

Figure 4. Percentage of morphological anomalies found in the species

P. anderssoni and P. ponteni.

Figure 5. Number and type of morphological anomalies found in the

species P. anderssoni and P. ponteni.

The most frequently observed morphological anomaly

shared by both species was the presence of nine tentacular

cirri. For P. anderssoni, the most frequent anomaly was the

presence of a single antenna and nine tentacular cirri, and for

P. ponteni, it was the presence of seven tentacular cirri (fig. 5).

In some specimens, we found alterations in the number of

paragnaths, but this was not considered anomalous.

Discussion

It is beyond the scope of this paper to determine the possible

causes of the morphological anomalies that were observed.

Most studies that report malformations or anomalies in

polychaetes relate them to exposure to pollutants and its effects

at many levels: individual, specific, population and community.

In an earlier study, Reish et al. (1974) observed bifurcation in

Capitella capitata larvae exposed to copper and zinc. Geracitano

et al. (2004b) found morphological and histological anomalies

(e.g. curling, protrusions, cuticle separation from the epidermis)

in Laeonereis acuta that were caused by copper exposure. In

addition, Mendez et al. (2009) described changes in colouration,

swelling and rupture of the epidermis in Eurythoe complanata

individuals exposed to mercury. Oliveira (2009) associated the

anomalies observed in Laeonereis species (such as hypertrophy

of the cirri and dorsal lobes, absence of dorsal ligules, and

bifurcated cirri, lobes and ligules) with environments polluted

by domestic and industrial sewage and harbour activities.

The sampling localities in this study show variation in

their degree of ‘health’. The economy of Ilha do Mel, for

example, is based on tourism, and the region suffers from the

influence of Paranagua Bay, where fishing, urban occupation,

tourism and industry are all common activities, and the bay is

home to the main South American grain shipping port

(Martins et al., 2010; Gonzaga et al., 2013). Prior information

about morphological changes in some marine organisms in the

area is available in Valdez-Domingos et al. (2007), who

recorded histopathological lesions in the gills of Crassostrea

rhizophorae found in Paranagua Bay. There was no direct

relationship established by the authors between the lesions and

Morphological anomalies in polychaetes: Perinereis species (Polychaeta: Annelida) examples from the Brazilian coast

a specific contaminant because the study only evaluated the

impact of a range of human activities. Among the species we

studied, a single antenna was the anomaly most observed in

polychaetes from this locality.

Fishing is the main economic activity in Itaipu followed by

tourism. However, this locality is adjacent to Guanabara Bay,

which is considered one of the most polluted environments of the

Brazilian coast. It hosts large municipalities, several industries,

shipyards, ports, naval bases, refineries and marine oil terminals

(Marques-Junior et al., 2009). There are already local records of

histopathological alterations in a species of commercial fish

(Cardoso et al., 2009) contaminated by mercury. The most

common morphological anomaly found in polychaete specimens

from Itaipu Beach was the presence of a single antenna.

There is one genus in the family, JJnanereis Day, 1962, with

two described species: U. macgregori Day, 1962 and U. zgahli

Ben Amor, 1980, that presents one antenna. The first species

description was based on an incomplete specimen, and the

second description is poor. Apart from the number of antennae,

all of the other Unanereis characteristics are similar to

Ceratonereis species, including long tentacular and notopodial

cirri. The second species description is also based on one

specimen, and apart from noting the presence of one antenna, it

is similar to Composetia Hartmann-Schroder, 1985, which was

previously considered a subgenus of Ceratonereis. The author

mentioned that the species is similar to Ceratonereis costae

Grube, 1840 in all other features. Bakken and Wilson (2005)

and Santos et al. (2005) nested both genera, Unanereis and

Ceratonereis , in a polytomy. They did not make any decisions

about nomenclature, and that is not our intention here, even

though it deserves attention. We suggest, based on what we have

observed for Perinereis species, Pseudonereis and Laeonereis

(Santos and collaborators, pers. obs.), that until more Unanereis

specimens are found, the presence of one antenna could, in fact,

be an anomaly and not a synapomorphy of this taxon.

In Sao Francisco do Conde, oil-related activities are

potential sources of pollution in the region (Veiga, 2003).

Santos (2011) reported cases of cadmium and lead

contamination in fish and shellfish in a number of localities in

Sao Francisco do Conde. Specimens from this locality

presented variations in the number of tentacular cirri as their

most common anomaly.

Tourism is also the main economic activity in Tambaba

and Martim de Sa (Projeto Orla). In Martim de Sa, fishing

activities are also important (http://www.caraguatatuba.

sp.gov.br). Specimens collected in this region presented

variations in the number of tentacular cirri. We believe that

genetic or ecophenotypic factors may be responsible for the

larger numbers of tentacular cirri because this anomaly was

found in both Martim de Sa, where there are no records of

severe contamination, and in Sao Francisco do Conde, an

affected site. Lower numbers of tentacular cirri can be

explained by injury, such as from predation, but the same

cannot be said when a larger number of cirri are observed.

Others anomalies found in this study, such as a variation in

the number of eyes, may be due to genetic factors; this anomaly

was found in Martim de Sa, which has not experienced high

levels of contamination.

Historically, variation in the number of paragnaths is

considered important and of taxonomic value as it is a

diagnostic trait in some species. Small variations in quantity

within or among populations are usually considered normal.

According to Ben-Eliahu (1987), the number of paragnaths in

proboscidial areas can be size-related. Breton et al. (2004)

identified variations in the number of paragnaths in populations

of Nereis virens from different sites and concluded that the

differences were due to intraspecific variation. Garcia-Arberas

and Rallo (2000) associated the change in the number of

paragnaths in Hediste diversicolor with change in

environmental conditions, such as sediment grain size.

Maltagliati et al. (2006) also studied the paragnaths of H.

diversicolor and suggested that paragnaths on different rings

(oral and maxillary) may have different functions. This species

has a variable diet, and one possible cause for variation is

heritability of different patterns of paragnaths. However,

previous morphometric analysis carried out by Coutinho (2013)

(using the same individuals used here) and by Clfmaco (2013),

for Allita succinea, found no relationship between size or age

and the number of paragnaths encountered. Silva (2014), in a

phylogeographic study of P. anderssoni and P. ponteni along

the Brazilian coast, suggested that P. ponteni is the same

species found all along the coast and that P. anderssoni consists

of two, latitudinally separated cryptic species: one species is

found in the north-east, and another is distributed in the south

and south-east of Brazil. Nevertheless, we found no congruence

between the variability in the number of paragnaths and the

distribution suggested by Silva (2014). Once, four paragnaths in

area V were found in individuals from Itaipu (south-east) and

Tambaba (north-east), and individuals from Ilha do Mel (south)

presented either five or two paragnaths in area V. Therefore, the

variation in the number of paragnaths observed in the

specimens studied here is not considered anomalous but normal

morphological variability.

It is reasonable to assume that ecophenotypic factors, such

as pollution, could be generating the observed morphological

changes in these species, because benthic organisms are more

sensitive to environmental changes as a result of their limited

mobility.

We dismissed ontogenetic factors and methods of fixation

as possible causes of the anomalies found in this study. Peixoto

(2013) described the reproductive biology and population

structure of P. anderssoni , and none of these anomalies or

morphological alterations was found in the larvae or small

size-classes; they were found in adult specimens (Peixoto,

pers. com.). For P. ponteni , ontogenetic factors may be

possible, but this is improbable because this species is

morphologically similar to P. anderssoni. Until now, no

alterations of this magnitude have been linked to methods of

fixation, so we also dismiss this factor.

Based on our results and the information discussed above,

we suggest that more studies are needed to confirm the real

causes of the morphological anomalies found in P. anderssoni

and P. ponteni. Additionally, other localities, including

pristine rocky shores, should be investigated along the

Brazilian coast, as both species are widely distributed and

common in shallow-water environments.

M.C.L. Coutinho & C.S.G. Santos

Acknowledgements

We are grateful to CAPES (Coordenagao de Aperfeigoamento

de Pessoal de Nivel Superior) for financial support. We also

thank Andre Santos and Ricardo Krul for their assistance

with the collections and Cristiana Sette and Joao Miguel de

Matos Nogueira for the material from Bahia and Parafba,

respectively. We also thank Wagner Magalhaes for his

assistance with translation.

References

Ahrens, J.B., Borda, E., Barroso, R., Paiva, P.C., Campbell, A.M., Wolf,

A., Nugues, M.M., Rouse, G.W., and Schulze, A. 2013. The curious

case of Hermodice carunculata (Annelida: Amphinomidae):

evidence for genetic homogeneity throughout the Atlantic ocean

and adjacent basins. Molecular Ecology 22: 2280-2291.

Backmann, M., Hardege, J.D., andZeeck, E. 1995. Effects of the volatile

fraction of crude oil on spawning behaviour of nereids (Annelida,

Polychaeta). Marine Environmental Research 40(3): 267-276.

Bakken, T., and Wilson, R.S. 2005. Phylogeny of nereidids (Polychaeta,

Nereididae) with paragnaths. Zoologica Scripta 34: 507-547.

Ben Amor, Z. 1980. Presence en Mediterranee du genre Unanereis

Day, 1962 (Polychaeta, Nereidae) et description de U. zghali n. sp.

Bulletin de I’Office National des Peches 4(1): 13-15.

Ben-Eliahu, M.N. 1987. An approach to nereidid morphometry.

Biological Society of Washington 7: 169-173.

Bocchetti, R., Fattorini, D., Gambi, M.C., and Regoli, F. 2004. Trace

metal concentrations and susceptibility to oxidative stress in the

Polychaete Sabella spallanzanii (Gmelin) (Sabellidae): potential

role of antioxidants in revealing stressful environmental

conditions in the Mediterranean. Archives of Environmental

Contamination and Toxicology 46: 353-361.

Breton, S., Dufresne, F., Desrosiers, G., and Blier, P. 2004.

Morphological variation in Nereis (Neanthes) virens (Polychaeta:

Nereididae) populations. Journal of the Marine Biological

Association of the United Kingdom 84: 983-985.

Cardoso, T.P., Marsico, E.T., Medeiros, R.J., Tortelly, R., and Sobreiro,

L.G. 2009. Mercury level and histopathologic analysis of muscle,

kidney and brain of largehead hairtail ( Trichiurus lepturus )

collected in Itaipu beach, Niteroi, Rio de Janeiro, Brazil. Ciencia

Rural, Santa Maria 39(2): 540-546.

Clfmaco, C.S.S. 2013. Variagao intra e interpopulacional em Alitta

succinea (Leuckart,1847) (Polychaeta; Nereididae): qual a

informagao contida nas paragnatas? Dissertagao de Mestrado em

Biologia Animal, Universidade Federal de Pernambuco. 69 pp.

Coutinho, M.C.L. 2013. Analises morfometrica e morfoldgica de

Perinereis anderssoni Kinberg, 1866 e Perinereis ponteni

Kinberg, 1866 (Polychaeta: Nereididae) na costa brasileira.

Dissertagao de Mestrado em Biologia Marinha, Universidade

Federal Fluminense. 110 pp.

Day, J.H. 1962. Polychaeta from several localities in the western

Indian Ocean. Proceedings of the Zoological Society of London

139(4): 627-656.

De Feon Gonzalez, J.A. 1999. Nereididae (Annelida: Polychaeta) de

Mexico. Facultad de Ciencias Biologicas, Universidad Autonoma

de Nuevo Feon. Informe final SNIB-CONABIO Proyecto No.

H011. Mexico DF.

De Feon-Gonzalez, J.A., and Solfs-Weiss, V. 1998. The genus

Perinereis (Polychaeta: Nereididae) from Mexican littoral waters,

including the description of three new species and the

redescriptions of P. anderssoni and P. elenacasoae. Proceedings

of the Biological Society of Washington 111(3): 674-693.

Ferreira-Cravo, M., Ventura-Fima, J., Sandrini, J.Z., Amado, F.F.,

Geracitano, F.A., Rebelo, M., Bianchini, A., and Monserrat, J.M.

2009. Antioxidant responses in different body regions of the

polychaeta Laeonereis acuta (Nereididae) exposed to copper.

Ecotoxicology and Environmental Safety 72: 388-393.

Garcia-Arberas, L., and Rallo, A. 2000. Variations in paragnath

number of Hediste diversicolor from the Basque coast, in relation

to habitat conditions. Journal of the Marine Biological

Association of the United Kingdom 80: 733-734.

Geracitano, L.A., Bocchetti, R., Monserrat, J.M., Regoli, F., and

Bianchini, A. 2004a. Oxidative stress responses in two populations

of Laeonereis acuta (Polychaeta, Nereididae) after acute and

chronic exposure to copper. Marine Environmental Research 58:

1-17.

Geracitano, F.A., Fuquet, C., Monserrat, J.M., and Bianchini, A.

2004b. Histological and morphological alterations induced by

copper exposure in Laeonereis acuta (Polychaeta, Nereididae).

Marine Environmental Research 58: 263-267.

Geracitano, L.A., Monserrat, J.M., and Bianchini, A. 2002.

Physiological and antioxidant enzyme responses to acute and

chronic exposure of Laeonereis acuta (Polychaeta, Nereididae) to

copper. Journal of Experimental Marine Biology and Ecology

277: 145-156.

Gonzaga, C.A.M., Denkewicz, P., and Prado, K.C.P. 2013. Unidades

de conservagdo, ecoturismo e conflitos socioambientais na Ilha

do Mel, Parana, Brasil. Congresso Internacional de

Administrate. Gestao Estrategica: Criatividade e Interatividade.

Grube, A.E. 1840. Actinien, Echinodermen und Wiirmer des

Adriatischen- und Mittelmeers, nach eigenen Sammlungen

beschrieben. 1-92. J.H. Bon. Konigsberg.

Hartmann-Schroder, G. 1985. Revision der Gattung Ceratonereis

Kinberg (Nereididae, Polychaeta) (Mit besonderer

Beriicksichtigung der Arten mit enigeschnittenem Prostomium).

Mitteilungen aus dem Hamburgischen zoologischen Museum und

Institut, 82: 37-59.

Kinberg, J.G.H. 1866. Annulata nova. Ofversigt af Koniglich

Vetenskapsakademiens forhandlingar, Stockholm, 23(9): 337-357.

Kubal, P., Sukumaran, S., and Vijapure, T. 2012. Record of bi-

operculate fouling serpulid polychaete, Hydroides operculatus

(Treadwell, 1929) from Diu, west coast of India. Indian Journal of

Geo-Marine Sciences 41(4): 381-384.

Fana, P.C. 1984. Anelideospoliquetas errantes do litoral do estado do

Parana. Tese de Doutorado, Universidade de Sao Paulo. 274 pp.

Maltagliati, F., Massaro, L., Cossu, P., and Castelli, A. 2006.

Morphological differentiation in the ragworm, Hediste

diversicolor (Polychaeta, Nereididae), as revealed by variation of

paragnath number and distribution. Italian Journal of Zoology

73(3): 255-262.

Marques-Junior, A.N., Moraes, R.B.C., and Maurat, M.C. 2009.

Poluigao marinha. In: Pereira, R.C. and Soares-Gomes, A. (eds),

Biologia marinha, 2nd edn. Editora Interciencia: Rio de Janeiro.

Martins, C.C., Braun, J.A.F., Seyffert, B.H., Machado, E.C., and

Fillmann, G. 2010. Anthropogenic organic matter inputs indicated

by sedimentary fecal steroids in a large South American tropical

estuary (Paranagua estuarine system, Brazil). Marine Pollution

Bulletin 60: 2137-2143.

Mendez, N., Green-Rufz, C., and Vazquez-Nunez, R. 2009. Mortality

and abnormalities observed after experimental Hg exposure in the

polychaete Eurythoe complanata (Pallas) from Mazatlan,

Mexico. Bulletin of Environmental Contamination and

Toxicology 83: 488-492.

Mohammad, M.B.M. 1981. Malformations in some polychaete

annelids from Kuwait, Arabian Gulf. Hydrobiologia, Dordrecht

78: 129-131.

Morphological anomalies in polychaetes: Perinereis species (Polychaeta: Annelida) examples from the Brazilian coast

Mouneyrac, C., Perrein-Ettajani, H., and Amiard-Triquet, C. 2010.

Influence of anthropogenic stress on fitness and behaviour of a

key-species of estuarine ecosystems, the ragworm Nereis

diversicolor. Environmental Pollution 158: 121-128.

Oliveira, V.M. 2009. Variabilidade morfoldgica de Laeonereis

(Hartman, 1945) (Polychatea: Nereididae) ao longo do Atldntico

Ocidental. Dissertagao de Mestrado em Ciencias Biologicas,

Universidade Federal do Parana. 51 pp.

Peixoto, A.M. 2013. Biologia reprodutiva e dinamica populacional

de Perinereis anderssoni Kinberg, 1866, na regiao entremares da

Praia de Itaipu, Niteroi, RJ. Dissertagao de Mestrado em Biologia

Marinha, Universidade Federal Fluminense. 79 pp.

Projeto Orla. 2008. Plano de gestao integrada da orla mantima do

municipio de Conde - Paraiba. Ministerio do Meio Ambiente.

Available: http://www.mma.gov.br/estruturas/orla/_arquivos/pgi_

orla_condepb_aprovado_ctepb_ll.pdf Accessed: 14 March 2013.

Qian, P.Y. 1999. Larval settlement of polychaetes. Hydrobiologia,

Netherlands 402: 239-235.

Reish, D., Piltz, F., Martin, J., and Word^ J. 1974. Induction of

abnormal polychaete larvae by heavy metals. Marine Pollution

Bulletin 5(8): 125-126.

Santos, L.F.P. 2011. Avaliagao dos teores de cddmio e churnbo em

pescado proveniente de Sao Francisco do Conde, Bahia.

Dissertagao de Mestrado em Alimentos, Nutrigao e Saude,

Universidade Federal da Bahia. 76 pp.

Santos, C.S.G., Pleijel, F., Lana, P., and Rouse, G.W. 2005. Phylogenetic

relationship within Nereididae (Annelida: Phyllodocida).

Invertebrate Systematics 19: 557-576.

Santos, C.S.G., and Steiner, T.M. 2006. Classe Polychaeta - Famflia

Nereididae. Pp. 121-133 in: Amaral, A.C.Z., Rizzo, A.E. and

Arruda, E.P. (eds). Manual de identificagao dos invertebrados

marinhos da regiao Sudeste-Sul do Brasil. Editora da

Universidade de Sao Paulo - EDUSP: Sao Paulo, 1.

Silva, B.F. 2014. Filogeografia comparada de duas especies do

genero Perinereis (Nereididae, Polychaeta) ao longo da costa

brasileira. Dissertagao de Mestrado em Biodiversidade e Biologia

Evolutiva, Universidade Federal do Rio de Janeiro. 91 pp.

Valdez Domingos, F.X., Azevedo, M., Silva, M.D., Randi, M.A.F.,

Freire, C.A., Silva de Assis, H.C., and Oliveira Ribeiro, C.A. 2007.

Multibiomarker assessment of three Brazilian estuaries using

oysters as bioindicators. Environmental Research 105: 350-363.

Veiga, I.G. 2003. Avaliagao da origem dos hidrocarbonetos em

sedimentos superficial de manguezais da regiao Norte da Bala

de Todos os Santos/BA. Dissertagao de Mestrado em Engenharia

de Reservatorio e de Exploragao, Universidade Estadual do Norte

Fluminense. 224 pp.

WebSite: http://www.caraguatatuba.sp.gov.br Accessed: 12 March 2013.

Memoirs of Museum Victoria 71:53-65 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Oogenesis in Phragmatopoma (Polychaeta: Sabellariidae): Evidence for

morphological distinction among geographically remote populations

LARISSE FARONI-PEREZ 1,2 * (http://zoobank.org/urn:lsid:zoobank.org:author:4CA7EB42-2B06-4440-9C96-445627996773) AND

FERNANDO Jose Zara 1,3 (http://zoobank.org/urn:lsid:zoobank.org:author:ElB59617-C2A7-4B98-983C-0CE39AF7E9A3)

1 Programa de Pos-Graduagao em Ciencias Biologicas (Zoologia), Instituto de Biociencias - UNESP, Rio Claro -

SP, 13506-900, Brazil

Current addresses:

2 Programa de Pos Gradua§ao em Ecologia - PPGECO, Departamento de Ecologia e Zoologia, Centro de Ciencias

Biologicas - Universidade Federal de Santa Catarina -Campus Universitario, s/n, sala 208, Bloco C, CCB, Corrego Grande

Florianopolis Santa Catarina, 88010-970, Brazil. *(faroni.perez@gmail.com).

3 Departamento de Biologia Aplicada, Invertebrate Morphology Laboratory (IML), Aquaculture Center (CAUNESP) and

IEAMar - Univ. Estadual Paulista, Jaboticabal - SP, 14884-900, Brazil, (fjzara@fcav.unesp.br).

* To whom correspondence andr eprint requests should be addressed: email: faroni.perez@gmail.com

http://zoobank.Org/urn:lsid:zoobank.org:pub:214387E6-lAEE-47C2-8938-FCEB3BDFA505

Abstract Faroni-Perez, L. and Zara, F. J. 2014. Oogenesis in Phragmatopoma (Polychaeta: Sabellariidae): Evidence for morphological

distinction among geographically remote populations. Memoirs of Museum Victoria 71: 53-65.

The Southwest Atlantic Ocean sand-reef building polychaete, Phragmatopoma lapidosa, was recently synonymised

with Phragmatopoma caudata based on morphological characters. This study uses histochemical and ultrastructural

procedures to describe oogenesis in Phragmatopoma caudata from the Southwest (SW) Atlantic and make a comparison

with previously published data for the Northwest Atlantic (NW) forms. In the South American worms, the exposed ovary

consists of simple groups of oogonia attached to blood vessels, unlike the NW Atlantic worms in which only the

proliferative and previtellogenesis phases of the oocytes are associated with blood vessels. In SW Atlantic worms, the

oocytes float in the coelom during the vitellogenic phase. We discovered several heterogeneous features (e.g., cell

extensions, amoeboid cells, ovary capsule, active uptake of material from blood vessels and egg envelope) that can be used

to distinguish between North and South Hemisphere populations of P. caudata. In light of the observed divergence between

worms from these separated populations, our findings support reproductive plasticity. The present study reveals biodiversity

within sand-reef making sandcastle worms.

Keywords ultrastructure, histochemistry, reproductive biology, ovary,geographic plasticity, histology, benthic invertebrates, worm reefs.

Introduction

The type-locality of Phragmatopoma lapidosa Kinberg, 1866,

is Rio de Janeiro, Brazil. The species was synonymised with P.

caudata Kr0yer in Morch (1863) described from a population

in the North Atlantic Ocean (Kirtley, 1994). The same author

synonymised P. moerchi Kinberg, 1867, P. digitata Rioja, 1962

and P. peruensis Hartman, 1944 with P. virgini Kinberg, 1867

(Kirtley, 1994), demonstrating a different approach to species

discrimination in the genus. Systematic studies among

Phragmatopoma spp. have focused on characters of the

anterior region of the body, especially the modified opercular

paleae (Amaral, 1987, Hartman, 1944, Kinberg, 1867, Kirtley,

1994, Morch, 1863). However, there is no concise comparative

morphological study on these structures documenting clear

variability among and within various Phragmatopoma species.

Probably because of this, the taxonomy of Phragmatopoma

spp. is incomplete and imprecise. Several species of

sabellariids appear to have been described inadequately and

redescription seems to be needed (Kirtley, 1994).

In the past, it was assumed that different strategies of

reproductive biology were reliable for delineating species.

Therefore, oogenesis and ovary structure in several polychaetes

were reviewed, and a summary phylogeny was proposed

(Eckelbarger, 1983, 1984, 2005, 2006). Light microscopy and

ultrastructural studies of ovary morphology and development

were carried out on several species from different polychaete

families representing a wide-spectrum sampling of reproductive

biology. Among the different species of Capitella Blainville,

1828, specific types of yolk precursors and metabolites were

uptake by the oocyte during vitellogenesis suggesting variation

in the egg envelope. Differentiation of the oocyte occurs

L. Faroni-Perez & F.J. Zara

following separation from the follicle cells (Eckelbarger and

Grassle, 1983). Studies of oogenesis (Eckelbarger, 1979) and

larvae (Eckelbarger, 1976, Eckelbarger and Chia, 1978,

McCarthy et al., 2002) in Phragmatopoma lapidosa (syn. P.

caudata) of the Northwest Atlantic Ocean described the regional

pattern of reproduction and development. Eckelbarger (1976)

observed for North American Phragmatopoma the presence of

gametes during all months of the year, although seasonal

variability in egg number can occur (McCarthy et al., 2003).

Studies of comparative gametogenesis can be helpful in

elucidating and testing hypotheses about biogeography and

the evolution of a taxon. Studies of oogenesis may be useful

for generating phylogenetic hypotheses based on characteristics

such as: (1) the presence, number, and location of definable

ovaries; (2) the existence of extraovarian versus intraovarian

oogenesis; (3) the release of previtellogenic oocytes into the

coelom as solitary cells or in clusters; (4) mechanism of

vitellogenesis; (5) the presence or absence of accessory cells;

(6) the morphology of the egg envelope; and (7) the structure

of the yolk pellet (Eckelbarger, 1988, 2006). In the present

case, there are 12 genera and over 130 species of sabellariid

worms (Read and Fauchald, 2012). Species of sabellariids can

be solitary or gregarious and occur from continental shallow

waters to continental shelf and slope depths. Morphological

studies have elucidated the basal and derived genera within

sabellariids (Capa et al., 2012, Dales, 1952). Moreover, Capa et

al., (2012) have not found any phylogenetic relationship

between some of the genera that construct colonies and reefs

(e.g. Phragmatopoma, Sabellaria, Gunnarea).

Oogenesis has been studied in only a few Phragmatopoma

and Sabellaria species and little progress in studies of

sandcastle worm reproductive biology has been achieved in

recent years (Culloty et al., 2010). It would be most helpful if

information about reproductive biology (Eckelbarger, 1988,

2006) was included in the recent phylogenetic of sabellariids

(Capa et al., 2012) and further studies should assess whether

the pattern of oogenesis is consistent with previous phylogenetic

studies published for the family.

The objective of this study is to describe the oogenesis of

Phragmatopoma caudata from the southeast of the Brazilian

coast using the histochemistry and transmission electron

microscopy. For the first time, we provide a cytochemical

description of oogenesis for Brazilian sabellariids. In addition,

we compare consistencies in reproductive characteristics

between South and North American Phragmatopoma spp.

(Eckelbarger, 1979, Eckelbarger and Chia, 1978).

Material and methods

Sampling. Phragmatopoma caudata were collected at the

Itarare beach at Sao Vicente, Sao Paulo State, Brazil

(23°58'49"S; 46°22'02"W), during low tide in September 2009.

Based on previous fieldwork data, it was known the specimens

were carrying gametes in the sampling month, which is the

beginning of the spring season (Faroni-Perez pers. obs.). In the

laboratory, the specimens were removed from the sand tubes,

anaesthetised by thermal shock with cold (4°C) sea-water and

sexed. The length of the opercular crown (ventro-dorsal) was

measured and only mature females were used, since the size

ranged from 1.72 to 2.66 mm (Faroni-Perez, 2014).

Histology. Intact female worms (N=5) were fixed in 4%

paraformaldehyde prepared with water from the sampling site

containing sodium phosphate buffer 0.2 M (pH 7.2) for 24 hours

at 4°C. After fixation, materials were rinsed in the same buffer

(twice for 30 min), dehydrated in an ethanol series (70-95%), and

embedded in methacrylate resin Leica®. Serial sections of 5 to 8

pm were obtained by Leica RM2252 microtome. Haematoxylin

and eosin staining was proceeded according to Junqueira and

Junqueira (1983) avoiding ethanol and xylene bath (Sant Anna et

al., 2010) and used for traditional histological description.

Histological images were acquired by a Leica DM2000

photomicroscope and digitised using the Leica IM50 software.

Cellular measurements. Cell measurements were obtained

using the Leica IM50 software with appropriate system

calibrations. All oocytes were measured using the 20X

objective, and slides were stained by haematoxylin and eosin

(HE). The largest cell diameter was obtained using only

oocytes showing both a clear nucleus and a prominent

nucleolus. Oocyte measurements were performed on five

individuals with different operculum lengths and representing

adult specimens. For each stage of oogenesis, the average

oocyte diameters were obtained from ten cells per individual.

Histochemistry. Xylidine ponceau (Mello and Vidal, 1980) and

mercuric-bromophenol blue staining techniques (Pearse, 1985)

were used to demonstrate the presence of total protein. The

Periodic acid-Schiff (PAS) technique was used to identify

neutral polysaccharides with groups 1-2 glycol (Junqueira and

Junqueira 1983; Pearse, 1985). The Alcian blue technique (pH

1.0 and 2.5) was chosen to demonstrate acidic polysaccharides

(Junqueira and Junqueira, 1983), and Sudan Black B was used

to determine the total lipids according Leica® protocol (Zara

et al., 2012).

Ultrastructure. For transmission electron microscopy (TEM),

individual Phragmatopoma caudata (N=5) were fixed in 3%

glutaraldehyde and 0.1 M (pH 7.3) sodium cacodylate buffer in

filtered seawater (CBSF) for 4 hours and, post-fixed in 1%

osmium tetroxide in the same buffer for 1 hour at 4°C. The “en

bloc staining” was carried out using 1% aqueous uranyl acetate.

The materials were dehydrated in ascending acetone series (50-

100%) and embedded in Epon-Araldite resin. The ultrathin

sections were stained with uranyl acetate and lead citrate and

photographed in the Philips CM100 transmission electron

microscopy at 80Kv electron beam.

Results

Histology and Histochemistry. The transverse dimension

(ventral to dorsal) of the operculum of the analysed specimens

ranged from 1.72 to 2.66 mm. The ovaries were clearly

definable and closely associated to blood vessels of the

intersegmental septa of Phragmatopoma caudata (fig. 1). In the

ovary, the oogonia and oocytes were not surrounded by follicle

cells (fig. 1). The oogonia, previtellogenic and early vitellogenic

oocytes were attached to each other (fig. 1) until they were

Oogenesis in Phragmatopoma (Polychaeta: Sabellariidae)

released into coelom, where only late vitellogenic oocytes

were observed (fig. 2).

The proliferative phase was marked by oogonia during

mitosis, with a basophilic cytoplasm and an average diameter

of 8.8 ± 2.2 pm. Three growth oocyte stages were classified:

including oocytes in previtellogenesis (31.8 + 5.3 pm) and

early vitellogenesis (77.6 + 9.4 pm), which were attached to the

ovary, and late vitellogenesis that occurs in cells free in the

coelom (100.4 ± 13.0 pm) (figs. 1 and 2).

The oogonia were smaller than the oocytes which were

characterised by a large nucleus showing different stages of

meiotic prophase and basophilic cytoplasm. Cell extensions

connecting oogonia and blood vessels were noticeable (fig. 1).

The previtellogenic oocytes showed a large nucleus and one or

more nucleolus. Their cytoplasm was strongly basophilic

without granules. Contrasting to the previtellogenic cell, the

early vitellogenic oocytes were showed only one nucleolus in

their large nucleus and the cytoplasm showed some acidophilic

yolk granules (fig. 1). During late vitellogenesis, the mature or

late vitellogenic oocytes occupied the entire coelomic cavity

without direct contact to blood vessels (fig. 2). These oocytes

were large and filled with yolk basophilic granules with less

affinity to eosin than those in the previous stage (fig. 2). The

basophilic vitelline envelope was clearly observed (fig. 2).

There were no additional or follicular cells associated with

these germ cells.

Histochemical analysis using xylidine ponceau (fig. 3) and

mercuric-bromophenol blue (fig. 4) revealed that the cytoplasm

of oogonia and previtellogenic oocytes were positively stained

for proteins. During early vitellogenesis, the oocyte yolk

granules, as well the egg envelope, were highly reactive

compared to oocytes in late vitellogenesis (figs. 3 and 4). The

oogonia were stained slightly for polysaccharides. However, the

previtellogenic oocytes exhibited a slight cytoplasmic response

to polysaccharides containing 1-2 glycol groups, such as

glycogen (fig. 5). The oocytes in early vitellogenesis showed

both cytoplasm and yolk granules that were slightly reactive to

PAS. The oocytes in late vitellogenesis displayed a negative

reaction to yolk granules and positive marks in the egg

envelopes, indicating the glycoprotein constitution (fig. 5). The

oogonia and oocytes at different stages were negative to Alcian

blue tests (pH 1.0 and 2.5) for acidic polysaccharides (figs. 6 and

7). The oogonia were negative for lipid droplets, as stained by

Sudan black B (fig. 8). In previtellogenic oocytes, some sparse

lipid droplets were stained. The oocytes in early vitellogenesis

showed qualitatively more lipid droplets than those in late

vitellogenesis, which had several sparse lipid droplets. The yolk

granules were negative to Sudan black B (fig. 9).

Ultrastructure

Proliferative phase. The ovary structure showed oogonia and

oocytes. Oogonia connected to blood vessels via cellular

prolongations to the flat endothelium (fig. 10). Between the

germinative cells and the blood vessel occurred by a thin layer

of connective tissue (figs. 10 and 11) showing collagen-like

fibres contrasting with the electron-dense region of the ovary

basal lamina (figs. 11). The oogonia, as well as the oocytes

were connected via desmosomes (fig. 11). Differentiation

between the oogonia and oocytes was indicated by the

presence of mitotic chromosomes on an elliptical oogonia

nucleus (figs. 10, 11, 12, and 14). The oocytes showed a

rounded nucleolus, and the nucleoplasm contained dispersed

chromatin and meiotic synaptonemal complexes (figs. 12-14).

The oogonium cytoplasm was narrow and contained electron-

dense mitochondria and a few vesicles of rough endoplasmic

reticulum (RER) (figs. 10,11,12, and 14). The oocytes depicted

had the same cytoplasmic characteristic, although cytoplasm

was larger than in oogonia and had well-developed vesicular

RER (figs. 10, 11, 14).

Growth phase. After meiosis, the previtellogenic oocytes

increased both in cytoplasmic and nuclear volumes. The

nucleus showed a single, large nucleolus and scattered

heterochromatin blocks (figs. 15 and 16). Previtellogenic

oocytes were elongated with a rounded, coelomic distal end.

The plasma membrane maintained contact with other oocytes

in prophase or previtellogenesis near the coelomic distal end

(fig. 15). The cytoplasm was filled by RER consisting of parallel

lamellae (fig. 16). A few electron-dense mitochondria, with

shapes ranging from spherical to ellipitical, were common in

the perinuclear cytoplasm (figs. 15-17). Accumulations of

electron-dense a-glycogen were scattered in the cytoplasm (fig.

17), in agreement with the PAS-positive stains (fig. 5). The

rounded end of the previtellogenic oocytes delineated a free

margin in contact with the coelomic cavity characterised by the

microvilli and thin egg envelope (figs. 18-21). The cortical

cytoplasm showed many Golgi complexes, and several cortical

granules were nearby (fig. 18). The cortical granules were filled

with fibrous material of different electron densities (figs. 18-21).

Among the small microvilli occurs the matrix of the egg

membrane, which is granular while the basal region was

electron-lucent and forming the wide perivitelline space at this

phase (figs. 19-21). The microvilli apex, above the egg envelope,

showed an expansion bearing extensive filamentous adornment

with an electron-dense central region (figs. 19 and 20). The end

of the previtellogenesis was determined by the beginning of

endocytotic activity marked by pits in the plasma membrane

and presence of coated vesicles in the cortical cytoplasm (figs.

20 and 21) at the same time that the yolk granules arose.

During vitellogenesis or exogenous phase of yolk

production, two distinct ultrastructural oocyte stages were

observed (i.e. oocytes in early and late stage of vitellogenesis).

During early vitellogenesis, the oocytes were attached to the

ovarian blood vessel and the nucleus showed the same

characteristics as the previtellogenic oocytes, with many

scattered heterochromatin blocks (figs. 22 and 23). The large

number of nuclear pores were indicative of the high nuclear

activity during the early vitellogenesis (fig. 23). Clusters of

granular electron-dense material, or nuages, were observed

next to the nuclear envelope and perinuclear cytoplasm (fig.

23). The cytoplasm was filled with lamellar rough ER, several

lipid droplets, and small yolk granules (figs. 22-25). The yolk

granules were rounded, compact and showed areas with varied

electron densities (figs. 24 and 25). Inside the yolk granules,

some electron-lucent spherical areas were visible, (fig. 24).

Particles of a-glycogen were adjacent to the yolk granules (fig.

L. Faroni-Perez & F.J. Zara

Figures 1-9. Histology and Histochemistry in Phragmatopoma caudata of the SW Atlantic. Figures 1 and 2 Oogonia (Oo) and previtellogenic

oocytes (Pv) of early vitellogenesis (Ev) associated with the intersegmental blood vessels (B V) for cytoplasmic prolongations (black star). Oocytes

in advanced and late vitellogenesis are released into the coelomic cavity (white star). Oocytes in vitellogenesis have intensely acidophilic granules,

and the ripe oocytes are less acidophilus (black arrows). Figure 2 depicts oocytes in late vitellogenesis occupying the entire coelom with a

basophils vitelline envelope (white arrow). N = nucleus; H&E staining. Scales = 20 pm. Figures 3 and 4 Techniques used to visualize basic and

total proteins, respectively. The previtellogenic and vitellogenesis (Ev) oocytes (Pv) have intense granules (large black arrow), and the ripe in late

vitellogenesis (Lv) are less reactive (white arrow). The vitelline envelope is reactive to protein (small arrow). Scales = 20 pm. Figure 5 Technique

for visualizing neutral polysaccharides with positive staining in both the previtellogenic oocyte cytoplasm and the vitellogenic oocyte granules.

The reactivity disappears in the vitellogenic granules of ripe oocytes, but surrounding these is a noticeable positive staining (large black arrow).

Star = oogonia with little reactivity to neutral polysaccharides. The egg envelope is reactive to PAS (small arrow). Scale = 20 pm. Figures 6 and

7 Absence of acid polysaccharides (pH 1.0 and 2.5), respectively, in oogonia and oocytes in P. caudata. Scales = 20 pm. Figures 8 and 9 Lipids

stained by Sudan Black B. The oogonia are uniformly positive (small white arrow), while the oocytes during previtellogenesis and vitellogenesis

have droplets in the cytoplasm (large black arrow). The yolk granules are reactive during vitellogenesis, while the staining is less intensive (large

white arrows) in the mature oocytes. The vitelline envelopes have lipids (small black arrow). Scales = 20 pm.

Oogenesis in Phragmatopoma (Polychaeta: Sabellariidae)

Figures 10-14. Ultrastructure in Phragmatopoma caudata of the SW Atlantic. Proliferative Phase. Figures 10 and 11 Oogonia (Oo) and

oocytes (Oc) connected via cellular prolongations (white arrow) to the endothelium of the intersegmental blood vessel (Bv). Note that the contact

of ovary basal lamina is quite electron dense (black arrow). Desmosomes (D) form the oocyte-oocyte junction (Figure 10, 1,150X; Figure 11,

2,050X). M = mitochondria; Ch = chromosome. Figure 12 Oogonia with mitotic chromosomes (Ch) and oocytes in prophase with finely granular

chromatin and chromosomes united by synaptonemal complexes (arrows) (2,400X). Figure 13 Synaptonemal complex (33,600X). N = nucleus.

Figure 14 Narrow cytoplasm in oogonia (Oo) androunded nucleus. Oocyte (Oc) with wide cytoplasm and adhesion via desmosomes (D) (2,050X).

L. Faroni-Perez & F.J. Zara

Figures 15-21. Ultrastructure in Phragmatopoma caudata of the SW Atlantic. Grow Phase. Figures 15 and 16 Previtellogenic oocyte with a

large nucleus (N) and nucleolus (Nu), as well as small rough heterochromatin clumps (small arrow). The cytoplasm is filled with rough, lamellar

endoplasmic reticulum (RER) and noticeable mitochondria (M) in the perinuclear cytoplasm. The elongated portions of these cells create adhesion

with adjacent oocyte (large arrow) (Figure 15, 2,050X. Figure 16, 4,200X). Oc = oocyte. Figure 17 Cytoplasm showing glycogen a (Gly) greater

than the ribosomes (white arrows) attached to the reticulum (black arrow) (13,500X). M = mitochondria. Figures 18 and 19 Cortical cytoplasm

of the rounded surface, showing Golgi complexes (GC) close to the cortical granules (CG), positioned beneath the microvilli (Mv) with the

expansion bearing extensive filamentous adornment above the vitelline envelope (Eg) (Figure 18, 10,500x. Figure 19, 5,400X). Figures 20 and

21 Plasma membrane on a rounded surface showing endocytic depressions (black arrow) and coated vesicles (Cv). The vitelline envelope is

composed by means of medium-apical extracellular matrix (2) in relation to microvilli (Mv). The basal region is electron-lucent and forming the

beginnings of the perivitelline space (1) (Figure 20. 13,500X. Figure 21, 28,000X). GC = Golgi complexes. Eg = vitelline envelope.

Oogenesis in Phragmatopoma (Polychaeta: Sabellariidae)

Figures 22-27. Ultrastructure in Phragmatopoma caudata of the SW Atlantic. Grow Phase. Figure 22 Oocyte during early vitellogenesis (Ev)

with attributes of several yolk granules (Y) and lipid droplets (Li) in the cytoplasm, adjacent to an oocyte in late vitellogenesis (Lv) which vitelline

envelope (Eg) thick (1,450X). N = nucleus, arrow = clumps of heterochromatin. Figure 23 Nucleus showing the heterochromatin clumps (large

white arrow) and many complex pores in the nuclear envelope (small white arrows). The perinuclear cytoplasm aspect of granular material

accumulations, juxtaposed with the nuclear envelope (black arrow) and next to mitochondria (M) (2,050X). Figure 24 Small and rounded yolk

granules (Y) with different electron-densities and lucid spheres are observed inside. Besides Vesicles containing some electron-dense material (white

arrow) also have lucid spheres (black arrow) and resemble nascent yolk granules (8,200X). Figure 25 Yolk granules (Y) of oocytes at the beginning

of vitellogenesis showing varied electron-densities (black arrow) and electron-lucent spheres (large white arrow). Glycogen is also noticed (small

white arrow) (21,500X). Figure 26 Cortical cytoplasm showing Golgi complexes (GC) close to the cortical granules (CG), which are filled with a

fibrous material (black arrow). Note the large amount of glycogen (Gly) in the cytoplasm (1,150X). White arrow = glycogen. Figure 27 Microvilli

(Mv) are larger and the egg envelope (Eg) thicker (2), relative to the previous stage. The perivitelline space (1) appears thinner (1500X).

L. Faroni-Perez & F.J. Zara

Table 1. Ultrastructural oogenesis in Phragmatopoma spp. from Northwest and Southwest Atlantic Ocean.

NW Atlantic*

SW Atlantic**

Anterior face of septal blood vessel ciliated

present

Oogenesis (type)

intraovarian

intraovarian (until early

vitellogenesis) and extraovarian

(during late vitellogenesis)

Follicle cells

present

absent

Peritoneal capsule covering ovary during

vitellogenesis

present

absent

Asynchronous oogenesis

present

Amoeboid cells

present

absent

Mitochondrial cloud locality (in previtellogenic

oocytes)

one part of oolema

perinuclear cytoplasm

Golgi complexes

adjacent to oolema where

microvilli are formed

close to cortical granules

Golgi complexes (arrangement)

semicircle

parallel

Cortical granules

early vitellogenesis

previtellogenesis

Endocytosis

present

Coated vesicles

present

Annulate lamellae (coelomic eggs)

present

Golgi complexes (coelomic eggs)

few

Egg mambrane formation

early vitellogenesis

previtellogenesis

Egg envelope with extracellular matrix (coelomic

eggs)

present

Microvilli with granular tips

present

Intermicrovillar distance change during oogenesis

present

Granules of microvilli changes complexity and

number increased during oogenesis

present

Autosynthetic crystallized yolk granules (coelomic

eggs)

synthesis begin prior to the

heterosynthetic yolk granules

synthesis begin after to the

heterosynthetic yolk granules

Golgi complexes where occur the synthesis of

heterosynthetic yolk granules

absent

present

* Eckelbarger and Chia 1978; Eckelbarger 1979 ** This study. NA: no information available.

25) . The glycogen was abundant throughout the cytoplasm,

and its size was large compared to the ribosomal particles (fig.

26) . The remainder of the cytoplasm had the same

characteristics as the previtellogenic stage. The Golgi

complexes were more common in the cortical cytoplasm near

the cortical granules and a large number of mitochondria were

observed (figs. 22-27). The endocytic activity was observed in

the plasma membrane, and the larger microvilli maintained

the same apical characteristics as observed at the end of

previous stage. The perivitelline space (electron-lucent) was

smaller and the vitelline envelope thicker than observed for

the previtellogenic oocytes (fig. 27).

The oocytes in late vitellogenesis (i.e. ripe) were filled with

yolk granules, lipid droplets and thick vitelline envelope (fig.

28). These oocytes occupied the entire coelomic cavity toward

the body wall (figs. 29). The remarkable cytoplasmic structure

was the annulate lamellae that formed patches through the yolk

and lipid droplets (fig 28 and 30). The annulate lamellae were

characterised by several fenestrated endomembranes with

parallel structures (figs. 31-33). The yolk granules were distinct

to the early of vitellogenesis forming an elliptical and extremely

compact structure. These mature yolk granules showed a

medullar crystalline substructure and a cortex with electron-

lucent spheres (figs. 34-36). These granules were surrounded

Oogenesis in Phragmatopoma (Polychaeta: Sabellariidae)

Figures 28-40. Ultrastructure in Phragmatopoma caudata of the SW Atlantic. Growth Phase. Figure 28 Oocyte during late vitellogenesis

filled with yolk granules (Y) and lipid droplets (Li). Note the cytoplasmic patches where the annulate lamellae (Al) are located and the well-

developed egg envelope (Eg) (810x). Figure 29 Ripe oocytes occupy the entire coelomic cavity toward the body wall (810x). MC = muscle; Ep =

epidermis. Figure 30 General view of the annulate lamellae (Al) between yolk granules and lipid droplets (560X). Figures 31-33 The annulate

lamellae are composed by fenestrated endomembranes (arrows) parallel to each other arranged (Figure 31,2,900X. Figure 32,10,500X. Figure 33,

3,100X). Figure 34 Mature yolk granules with an elliptical shape (Y) showing a medullar crystalline substructure (white arrow) and non-crystalline

cortex with electron-lucent spheres (black arrow) (13500X). Figure 35 Crystallised medullar in a parallel arrangement (white arrow) and a cortical

lucid sphere (black arrow) (43,000X). Figure 36 Yolk granules (Y) and lipid droplets (Li) in the cytoplasm, with the presence of glycogen granules

(arrow) close to the droplets (13,500X). M = mitochondria. Figure 37 Details of yolk granules delimited by the membrane (arrow) next to a lipid

droplet (Li) and glycogen (Gly) (61000X). Figure 38 Cortical cytoplasm filled with yolk granules (Y), lipid droplets (Li) and cortical granules

(CG) below the plasma membrane. Notice the thick egg envelope (Eg) (2,050X). Figure 39 The perivitelline space (1) is narrow and the egg

envelope (Eg) is composed of two layers (2 and 3) with different electron-densities. The winding microvilli (Mv) are completely immersed in the

egg envelope. Only the apical surface of the microvilli is in contact with the coelomic cavity (arrow) (5,400X). CG = cortical granules. Figure 40

Microvilli apex showing the expansion bears extensive filamentous adornment with an electron-dense centre (31,000X).

L. Faroni-Perez & F.J. Zara

by membrane since the previous phase (fig. 37). The

endoplasmic reticulum and a few Golgi complexes were more

common at the cortical cytoplasm. The cytoplasm showed

fewer glycogen granules, particularly around the yolk granules

and lipid droplets (figs. 36 and 37). The oocyte surface had

long, sinuous microvilli sharing similar characteristics to the

other phases. Additionally, endocytic pits were observed. The

microvilli were extensive filamentous adornment structures on

the outer surface of oocytes and in the coelomic cavity. The egg

envelope displayed two different electron-dense layers and a

very thin perivitelline space (figs. 38-40).

We found several differences in oogenesis among the

Northwest and Southwest Atlantic Ocean populations, and the

concise ultrastructural descriptions are summarised in Table 1.

Discussion

The histochemical results presented here are novel for the

Sabellariidae. Oogenesis in Phragmatopoma caudata from Sao

Vicente, SP, Brazil, entails a number of new features: 1) a distinct

ovarian proliferation characterised by small oogonia clusters that

were connected by intercellular extensions to the blood vessel

walls; 2) an absence of accessory, or follicular, cells; and 3) a

complex vitellogenesis cycle. There were also different stages

and mechanisms of yolk formation and yolk precursors from the

circulatory system, endocytic activity in previtellogenic oocytes,

and the crystallisation in vitellogenic oocytes.

Since oogenesis in Phragmatopoma from the southwestern

Atlantic Ocean has never been reported, it has not been

possible until now to consider intraspecific variation in terms

of reproductive characteristics. Oogenesis is different between

the worms in the SW Atlantic (present results) from those in

the NW Atlantic (Eckelbarger, 1979, 1983, 2005, 2006). The

heterogeneity revealed in this study suggests additional

molecular analysis should be carried out to investigate the

current synonymy based on morphological analyses (Dos

Santos etal., 2011, Kirtley, 1994). The differences in oogenesis

identified between these geographically remote populations

may reflect an evolving divergence among the populations.

The nature of oocyte development ( i.e . from

autosynthetically to heterosynthetically) reported in our study

differs from those described in NW Atlantic worms by

Eckelbarger (1979). Oocyte development in P. caudata from

the SW Atlantic occurs after the dissemination of the

previtellogenic oocytes into the coelom in a free-floating

phase. This mechanism of oogenesis is an extraovarian

oogenesis process (Eckelbarger, 1983, 1994, 2006). The

absence of distinct ovaries in the peritoneum also occurs in

some species of nereidids, phyllodocids, and sphaerodorids

(Olive, 1983). In these cases, the germ cells, oogonia or very

early oocytes, are realesed into the coelom. In addition, in

species of pectinariids and sabellids solitary previtellogenic

oocytes are released into the coelom where they undergo

vitellogenesis (Eckelbarger, 2005).

Both autosynthetic and heterosynthetic mechanisms of

yolk production could be observed during vitellogenesis in

specimens from the Southern Hemisphere as had previously

been described for NW Atlantic specimens (Eckelbarger,

1979). Nevertheless, differences in the cytology of vitellogenic

process were observed between worms from the two

populations. In NW Atlantic worms, only a single pellet is

formed by either mechanism producing two morphotypes of

yolk granules (Eckelbarger, 1979). On the other hand,

vitellogenesis appeared to be a combination of both processes

in the SW Atlantic worms and a single morphological type of

yolk granule is formed. In Phragmatopoma lapidosa (syn. P.

caudata ), the type II yolk granules, formed heterosynthetically

from endocytosis of yolk precursors from the blood vessel,

appear much later than type I, which are formed

autosynthetically (Eckelbarger, 1979). Although the two

morphological types of yolk were described for NW Atlantic

worms, the author highlighted that it is possible precursors are

sequestered endocytotically from the circulatory system

assembly into type I yolk bodies. The convoluted contacts

between blood-vessels and developing oocytes (early

developing oocytes) increase the surface area (Olive, 1983)

and may optimize the uptake of nutrients and yolk precursors

from blood vessels. Furthermore, presumably the single type

of yolk observed in worms from the SW Atlantic may be the

result of the earlier appearance of coated pits besides the

oocyte releasing to the coelom before vitellogenesis is

completed. In P. lapidosa (syn. P. caudata) from the NW

Atlantic, as well as in P. caudata from the SW Atlantic, the

ovaries are ephemeral, repeated in a large number of segments,

and have the centres of germ cell proliferation connected to

blood vessels via the intersegmental septa (Eckelbarger, 1979,

2005,2006, Eckelbarger and Chia, 1978). The mitotic divisions

in P. caudata were detected only in the germ cells during the

intraovarian growth phase associated with blood vessels.

Follicle cells. In contrast to Phragmatopoma caudata from the

SW Atlantic population, worms from the NW Atlantic had

follicle cells and oocytes connected to the blood vessels during

the complete oocyte maturation. Consequently, the vitellogenesis

occurred inside the ovaries which, were covered by a peritoneal

capsule (Eckelbarger, 1979, Eckelbarger and Chia, 1978).

Although lacking physiological evidence that material actually

passes from the follicle cells to the developing oocytes, the

follicle cells of Phragmatopoma lapidosa (syn. P. caudata )

appear to serve as intermediaries between the oocytes and the

surrounding coelomic fluid (Eckelbarger, 1979). Oocytes

surrounded by a distinct follicle cells layer as described in P.

lapidosa (syn. P. caudata) species of the NW Atlantic

(Eckelbarger, 1979) are absent in P. caudata from the SW

Atlantic. Thus, the nutrient sources for yolk precursors provided

by follicle cells, and amoeboid cells in the NW Atlantic species

are directed uptake from the blood vessel (early vitellogenesis)

and coelom to proteosythesis for P. caudata from the SW

Atlantic. In polychaetes, little is known about protein synthesis

during oogenesis (Lee, 1988; Song and Lee, 1991). In addition,

gene expression connected with oogenesis remains unstudied

and therefore nothing is known of which genes code for follicle

cells and how differentiation-specific proteins are involved in the

formation of the ovarian follicular cells or the timing of oocytes

to be released to the coelom among close related species. A

prerequisite to further analysis of the role of genes coding for

Oogenesis in Phragmatopoma (Polychaeta: Sabellariidae)

follicle cells is to find a model to assess how small changes in the

genetic structure might affect the adhesion and interrelationships

between different cell types. Since current findings reveal

morphological variation in the patterns of oogenesis in the two

populations described so far, we recommend Phragmatopoma as

a promising model for further molecular analysis.

Endocytosis and Yolk Synthesis. The presence of coated vesicles

in the cortical cytoplasm after the end of previtellogenesis and

during the whole vitellogenesis confirms the heterosynthetic

process of yolk granules formation. In worms from the SW

Atlantic, the large number of coated vesicles observed on the

surface of oocyte indicated a common mechanism of substance

uptake, primarily the extrinsic vitellogenesis proteins. In

addition, the large numbers of coated vesicles indicated the

high endocytic activity and relatively short vitellogenesis

period (Eckelbarger, 1983). Oogenesis occurs quickly in P.

lapidosa (syn. P.caudata ) from the NW Atlantic, and hundreds

of coated vesicles were seen for each oocyte during

vitellogenesis (Eckelbarger, 1979, 1983) similar to the

observations in this study.

Endocytosis is known as a distinct mechanism for

incorporating large molecular weight exogenous yolk proteins

into the oocyte and there may be some association between the

number of endocytotic pits generated along the oocyte

oolemma and the length of the vitellogenic phase (Eckelbarger,

1980, 1983). In Phragmatopoma lapidosa (syn. P. caudata )

from the NW Atlantic, precursor molecules for yolk formation

via an autosynthetic process may enter the oocyte through the

microvillus, that appears just prior to vitellogenesis by means

of combined efforts of Golgi complexes and RER assembled

into yolk bodies (Eckelbarger, 1979). Even so, the autosynthetic

and heterosynthetic processes of yolk synthesis were similar

in Phragmatopoma worms from both the NW and SW Atlantic

Ocean populations. On the other hand, in Phragmatopoma

caudata from the SW Atlantic, the extraovarian oogenesis

occurs during late vitellogenesis without involving follicle

cells as reported for other Sabellariidae. Thus, our results

provide additional evidence that oogenesis in the populations

of the NW and SW Atlantic is clearly dissimilar to previously

described (Eckelbarger, 1979, 1983, 1984, 2005). A

comparative study has revealed differences in oogenesis

among four Capitella species (Eckelbarger and Grassle, 1983).

The variation in abundance and relative size of specific yolk

pellets in the eggs of Capitella spp. was apparently related to

the quantities of lipid and glycogen stored in the follicle cells.

It is plausible that such differences have a significant impact

on embryogenesis and larval development.

Cortical Granules. The population from the SW Atlantic

Ocean displayed Golgi complex activity, synthesis of cortical

granules near the plasma membrane and yolk precursors were

uptake from the circulatory system. The cortical granules

showed different electron densities and fibrous material

similar to that observed in worms from the NW Atlantic

(Eckelbarger, 1979, 2005). In Phragmatopoma lapidosa (syn.

P. caudata ) from the NW Atlantic the cortical granules

appeared early in vitellogenesis, our results showed earlier

appearance, during previtellogenesis.

Annulate lamellae. The annulate lamellae are cytomembranes

containing pores and are frequently attached or connected to

the endoplasmic reticulum. Commonly, ribosomes are attached

to the membranes that extend from the annulate lamellae

(Kessel, 1989). In polychaetes, both ooplasmic and internuclear

annulate lamellae have been described in some species but

their function is unknown (Eckelbarger, 1988). In oocytes of

Phragmatopoma caudata from the NW Atlantic, the annulate

lamellae appear during the mid-stage of vitellogenesis. In late-

stage, the annulate lamellae are still observed in the ooplasm

(Eckelbarger, 1979), similar to this study. Although its function

is unclear, in P. caudata from the SW Atlantic, the annulate

lamellae is closely associated with yolk granules and lipid

droplets, and persists until the oocyte is fully-grown.

Egg envelope. Ultrastructural results reveal that the oocyte

surfaces in Phragmatopoma caudata from the SW Atlantic

population and in P. lapidosa (syn. caudata ) from the NW

Atlantic population (Eckelbarger and Chia, 1978) have a

granular extracellular matrix layer. The egg envelope of both

Phragmatopoma populations exhibited changes during oocytes

maturation. In worms from the NW Atlantic, the microvilli

appear during the early growth phase, and related granules are

continuously produced. The following phase is characterised by

an increase in granule formation by the existing microvilli

which are no longer being formed (Eckelbarger and Chia, 1978).

In Phragmatopoma caudata from the SW Atlantic

population, the glycoproteinaceous egg envelope, composed

only of neutral polysaccharides, is a layer of granules whose

complexity and size increase during vitellogenesis and may

play a role as a selective barrier for nutrient uptake. Oocytes in

contact with coelomic fluid might induce an increase in

surface area through elaboration of the oolemma into

numerous microvilli showing expansion. This may facilitate

the uptake of low molecular weight yolk precursors

(Eckelbarger, 1988). However, the differences observed in the

formation of the egg membrane between the NW and SW

Atlantic Ocean populations may indicate early stages of

genetic divergence, or alternatively, may be an adaptive

response to the mechanisms underlying the local environment.

Although a recent study supported the synonymy of

Phragmatopoma species (Dos Santos et al., 2011), this action

could be premature (Capa et al., 2012). The plasticity found in

oogenesis among the worms from Florida, USA, and Sao

Paulo, Brazil, are considerable (Table 1). In addition we should

not assume that the reproductive traits reported in the literature

for gregarious intertidal populations of sabellariids would

necessarily be accurate for the entire family, including those

solitary deep-sea species. Our work demonstrates asynchronous

oogenesis in Phragmatopoma caudata which was similar to

that found in P. lapidosa from the NW Atlantic (Eckelbarger,

1979). Thus, different stages of oocyte development can be

observed simultaneously within a single organism. This

contrasts with Sabellaria alveolata in which a gametogenesis is

synchronous and all oocyte are in the same stage during the

reproductive cycle (Culloty et al., 2010). However, in S.

alveolata populations from the NE Atlantic, the various

gametogenesis stages also occurred simultaneously among

L. Faroni-Perez & F.J. Zara

individuals in the population (Culloty et al., 2010). The factors

regulating the onset of the reproductive cycle and spawning

events are poorly understood in Sabellariidae worms.

In conclusion, oogenesis observed in Phragmatopoma

caudata of the SW Atlantic is similar to that found in the NW

Atlantic indicating that the taxa are closely related and recently

separated. However, the diverse aspects of oogenesis documented

here give support to the reproductive plasticity among the

geographically remote populations. We suggest that the

taxonomic status be reviewed incorporating additional traits.

Thus, heterogeneity in both oogenesis and oocyte development

patterns among the worm populations from the Northern and

Southern Hemisphere may indicate (1) different species, and (2)

differences in the production of ovarian oocytes due to latitude

(i.e. environmental drivers). Further studies, using broad

latitudinal comparisons of oogenesis and molecular analyses

along with descriptions of the ultrastructure of sperm, are

required to determine the number of possible species. It would

then be possible to determine if the geographically remote worm

populations with their heterogeneous characteristics are the

evolutionary products of distinct past tokogenetic events.

Acknowledgements

The authors give thanks to Sao Paulo Research Foundation

(FAPESP grants# JP #2005/04707-5; Biota 2010/50188-8) and

CAPES (Ciencias do Mar II 1989/2014 #23038.004309/2014-

51) for financial support and to FAPESP (MSc#07/56340-3)

for scholarship grants LFP Authors are indebted to Professor

Dr P.J.W. Olive and Dr C.L. Thurman for valuable suggestions

on the manuscript. We also thank T.T. Watanabe, M. Iamonte

and A. Yabuki from the Electron Microscopy Laboratory in

the Department of Biology (UNESP - Rio.Claro). We also

thank Dr. F.H. Caetano, CEBIMar/USP (#2008/04) and

National Geographic Society (#8447/08) for technical support.

This manuscript is part of L. Faroni-Perez’s Master Thesis in

Zoology for the Graduate Program in Biological Sciences

(Zoology), Institute of Biosciences (UNESP - Rio Claro).

References

Amaral, A.C.Z. 1987. Breve caracteriza§ao de Phragmatopoma lapidosa

Kinberg, 1867 (Polychaeta, Sabellariidae). Revista Brasileira de

Zoologia 3(8): 471-474.

Capa, M., Hutchings, P., and Peart, R. 2012. Systematic revision of

Sabellariidae (Polychaeta) and their relationships with other

polychaetes using morphological and DNA sequence data.

Zoological Journal of the Linnean Society 164(2): 245-284.

Culloty, S.C., Favier, E, Ni Riada, M., Ramsay, N.F., and O'Riordan,

R.M. 2010. Reproduction of the biogenic reef-forming honeycomb

worm Sabellaria alveolata in Ireland. Journal of the Marine

Biological Association of the United Kingdom 90(3): 503-507.

Dales, R.P. 1952. The development and structure of the anterior region of

the body in the Sabellariidae, with special reference to

Phragmatopoma californica. Quarterly Journal of Microscopical

Science 93(4): 435-452.

Dos Santos, A.S., Riul, P, Brasil, A.C.S., and Christoffersen, M.L. 2011.

Encrusting Sabellariidae (Annelida: Polychaeta) in rhodolith beds,

with description of a new species of Sabellaria from the Brazilian

coast. Journal of the Marine Biological Association of the United

Kingdom 91(2): 425-438.

Eckelbarger, K.J. 1976. Larval development and population aspects of

reef-building polychaete Phragmatopoma lapidosa from east coast

of Florida. Bulletin of Marine Science 26(2): 117-132.

Eckelbarger, K.J. 1979. Ultrastructural evidence for both autosynthetic

and heterosynthetic yolk formation in the oocytes of an annelid

{Phragmatopoma lapidosa, Polychaeta). Tissue and Cell 11(3):

425-443.

Eckelbarger, K.J. 1980. An ultrastructural study of oogenesis in

Streblospio benedicti (Spionidae), with remarks on diversity of

vitellogenic mechanisms in Polychaeta. Zoomorphologie 94(3):

241-263.

Eckelbarger, K.J. 1983. Evolutionary radiation in polychaete ovaries and

vitellogenic mechanisms - their possible role in life history patterns.

Canadian Journal of Zoology-Revue Canadienne De Zoologie

61(3): 487-504.

Eckelbarger, K.J. 1984. Comparative aspects of oogenesis in polychaetes.

Fortschritte Der Zoologie 29,123-148.

Eckelbarger, KJ. 1988. Oogenesis and female gametes. Pp. 281-307 in:

Westheide, W. and Hermans, C.O. (eds). The Ultrastructure of

Polychaeta. volume 4 New York: Microfauna Marina.

Eckelbarger, K.J. 1994. Diversity of metazoan ovaries and vitellogenic

mechanisms: implications for life history theory. Proceedings of the

Biological Society of Washington 107(1): 193-218.

Eckelbarger, K.J. 2005. Oogenesis and oocytes. Hydrobiologia 535,

179-198.

Eckelbarger, K.J. 2006. Oogenesis. Pp 23-43 in: Rouse, G. and Pleijel,

F. (eds). Reproductive biology and phylogeny of Annelida. Enfield,

New Hampshire: Science Publishers.

Eckelbarger, KJ. and Chia, F.S. 1978. Morphogenesis of larval cuticle in

polychaete Phragmatopoma lapidosa - correlated scanning and

transmission electron microscopic study from egg envelope formation

to larval metamorphosis. Cell and Tissue Research 186(2): 187-201.

Eckelbarger, K.J. and Grassle J.P 1983. Ultrastructural differences in the

eggs and ovarian follicle cells of Capitella (Polychaeta) sibling

species. Biological Bulletin 165(2): 379-393.

Faroni-Perez, L. 2014. Seasonal variation in recruitment of

Phragmatopoma caudata (Polychaeta, Sabellariidae) in the

southeast coast of Brazil: validation of a methodology for

categorizing age classes. Iheringia, Serie Zoologia 104(1): 05-13.

Hartman, O. 1944. Polychaetous annelids. Part VI. Paraonidae,

Magelonidae, Longosomidae, Ctenodrilidae, and Sabellariidae.

Allan Hancock Pacific Expeditions 10(3): 311 -389.

Junqueira, L.C.U., and Junqueira, L.M.M.S. 1983. Tecnicas Basicas de

Citologia e Histologia. Sao Paulo: Livraria e Editora Santos, 123 pp.

Kessel, R.G. 1989. The annulate lamellae - from obscurity to spotlight.

Electron Microscopy Reviews 2(2): 257-348.

Kinberg, J.G.H. 1867. Annulata nova. OJversigt af Koniglich

Vetenskapsakademiensforhandlingar 23(9): 337-357.

Kirtley, D.W. 1994. A review and taxonomic revision of the Family

Sabellariidae Johnston, 1865 (Annelida: Polychaeta). Vero Beach,

Florida: Sabecon Press. 223 pp.

Lee, Y.R. 1988. Changes in the protein components of vitelline envelope

during oogenesis of a tubiculous polychaete, Schizobranchia

insignis. Cell Differentiation and Development 25(1): 23-36.

McCarthy, D.A., Forward Jr., R.B., and Young, C.M. 2002. Ontogeny of

phototaxis and geotaxis during larval development of the sabellariid

polychaete Phragmatopoma lapidosa. Marine Ecology Progress

Series 241, 215-220.

McCarthy, D.A., Young, C.M., and Emson, R.H. 2003. Influence of

wave-induced disturbance on seasonal spawning patterns in the

sabellariid polychaete Phragmatopoma lapidosa. Marine Ecology

Progress Series 256,123-133.

Mello, M.S.L., and Vidal, B.C. 1980. Praticas de Biologia Celular,

Sao Paulo: Edgard Blucher - FUNCAMP. 71pp.

Oogenesis in Phragmatopoma (Polychaeta: Sabellariidae)

Morch, O.A.L. 1863. Revisio critica Serpulidarum. Et Bidrag til

R0rormenes Naturhistorie 3(1): 347-470.

Olive, RJ.W. 1983. Oogenesis in Annelida: Polychaeta. Pp 357-422 in:

Adiyodi, K.G. and Adiyodi, R.G. (eds). Reproductive Biology of

Invertebrates: Oogenesis, Oviposition, and Oosorption. volume I,

New York: John Wiley & Sons Ltd.

Pearse, A.G.E. 1985. Histochemistry: Theorical and applied. Volume

2. Edinburgh, Churchill Livingstone. 998 pp.

Read, G., and Fauchald, K. 2012. Sabellariidae. In: Read, G.; Fauchald,

K. (2012). World Polychaeta database. Accessed through: World

aphia.php?p=taxdetails&id=979 on 2012-10-09.

SantAnna, B.S., Turra A., and Zara F.J. 2010. Simultaneous activity

of male and female gonads in intersex hermit crabs. Aquatic

Biology 10(3): 201-209.

Song, H.K. and Lee, Y.R. 1991. Patterns of protein synthesis and

accumulation during oogenesis in the polychaete, Pseudopotamilla

occelata Moore. Invertebrate Reproduction and Development

20(3): 249-258.

Zara, F.J., Toyama M.H., Caetano F.H., and Lopes-Greco L.S. 2012.

Spermatogenesis, spermatophore and seminal fluid production in

the adult blue crab Callinectes danae (Portunidae). Jounal of

Crustacean Biology 32(2): 249-262.

Memoirs of Museum Victoria 71:67-78 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Character mapping and cladogram comparison versus the requirement of total

evidence: does it matter for polychaete systematics?

Kirk Fitzhugh*

Natural History Museum of Los Angeles County, 900 Exposition Boulevard, Los Angeles, California 90007, USA

(kfitzhug@nhm.org)

* To whom correspondence and reprint requests should be addressed. E-mail: kfitzhug@nhm.org

Abstract Fitzhugh, K. 2014. Character mapping and cladogram comparison versus the requirement of total evidence: does it matter

for polychaete systematics? Memoirs of Museum Victoria 71: 67-78.

The practice of partitioning data for the inferences of phylogenetic hypotheses has become a routine practice in biological

systematics. Two popular approaches: (i) mapping ‘morphological’ characters onto ‘molecular’ phylogenies, and (ii) comparing

‘morphological’ and ‘molecular’ phylogenies, are examined in light of what is known as the requirement of total evidence.

Inferences of phylogenetic hypotheses, indeed all taxa, occur by a type of non-deductive reasoning known as abduction. The

intent of abduction is to offer at least tentative causal accounts that explain character data. The rational acceptance of abductively

derived hypotheses is subject to conditions of the requirement of total evidence as a matter of the evidential support for those

hypotheses. It is shown that both character mapping and comparisons of cladograms using partitioned datasets are procedures

that severely reduce the credibility of phylogenetic hypotheses. This problem is alleviated by acknowledging the formal stmcture

of the why-questions we ask in relation to character data, for which phylogenetic hypotheses serve as answers.

Keywords abductive inference, biological systematics, cladograms, phylogenetic hypotheses, requirement of total evidence

“The requirement of total evidence is not itself controversial.”

(Kelly, 2008: 64)

Introduction

Biological systematics has entered a state of complacency, where

research agendas tend to follow prescribed methodological rules

that satisfy requirements for using particular software packages

or programs that lead to phylogenetic (or otherwise) hypotheses,

or claim to provide empirical assessments of those hypotheses.

This state of affairs might be expected if we adhere to Kuhn’s

(1970) notion of ‘normal science’ (but see Popper, 1970).

Regardless of the consensus that might obtain in a field of science,

this does not afford the accepted protocols and methods immunity

from critique. There is, for instance, the expectation that scientific

inquiry operates within the constraints set by the basic principles

of rational reasoning (Williamson, 2000; Thagard, 2004), where

the acceptance of propositions is governed by evidential support.

That support comes either in the form of evidence leading to

inferences of hypotheses and theories or the subsequent evidence

supplied during empirical testing. If approaches to inquiry agreed

upon among a group of scientists are identified as leading to less

than rational conclusions due to the exclusion of evidence, either

during the formulation or testing of hypotheses/theories, then the

intended goal(s) of such inquiries and associated methods must

be judged relative to the criteria that determine the credibility of

those hypotheses/theories. Whitehead’s (1925: 18) admonition

remains relevant: “The progress of biology and psychology has

probably been checked by the uncritical assumption of half-

truths. If science is not to degenerate into a medley of ad hoc

hypotheses, it must become philosophical and must enter into a

thorough criticism of its own foundations.”

Among presentations at the 11th International Polychaete

Conference that addressed phylogenetic relationships, the most

common approach was that of ‘character mapping’. Phylogenetic

hypotheses, implied by cladograms, are inferred for sets of

sequence data, and via those diagrams various conclusions are

drawn regarding the evolution of morphological traits (cf.

Halanych et al., 2001; Bleidorn et ah, 2003; Hall et ah, 2004;

Halanych, 2005; Rousset et ah, 2006; Schulze, 2006; Struck et

ah, 2007; Colgan et ah, 2008; Kupriyanova and Rouse, 2008;

Wiklund et ah, 2008; Vrijenhoek et ah, 2009; Zanol et ah, 2010;

Struck et ah, 2011; Magesh et ah, 2012; Goto et ah, 2013).

Interestingly, the inverse—obtaining transformation series via

the mapping of nucleotides on cladograms inferred from

‘morphological’ characters—is never considered. An equally

widespread approach involves comparisons of cladogram

topologies inferred from different datasets for the same group of

organisms (cf. Rousset et ah, 2003, 2004; Eeckhaut and

K. Fitzhugh

Lanterbecq, 2005; Halanych, 2005; McHugh, 2005; Kupriyanova

et al., 2006; Sperling et al., 2009; Zrzavy et al., 2009; Parry et al.,

2014). The popularity of character mapping and cladogram

comparisons is by no means limited to polychaetes, as perusals

of such journals as Molecular Phylogenetics and Evolution,

Nature, and Systematic Biology will attest. Regardless of their

popularity, the problems surrounding these techniques are so

significant as to preclude their use. This paper will identify the

epistemic difficulties in light of the necessary principle of

rationality known as ‘the requirement of total evidence’.

Why systematics?

Determining that protocols such as cladogram comparisons and

character mapping are problematic requires that we first

acknowledge the intent of reasoning in biological systematics.

The overarching goal of scientific inquiry is to acquire causal

understanding of the phenomena we observe/describe, which

also affords opportunities for predictions into the future (Hempel,

1965; Hanson, 1958; Rescher, 1970; Popper, 1983,1992; Salmon,

1984a; Van Fraassen, 1990; Strahler, 1992; Mahner and Bunge,

1997; Hausman, 1998; Thagard, 2004; Nola and Sankey, 2007;

de Regt et al., 2009; Hoyningen-Huene, 2013). As a field of

science, we should expect the objective of systematics to be

consistent with that of other fields. The consequence is that the

aim of systematics is to causally account for the differentially

shared characters we observe among organisms, whether extant

or represented as fossils (Fitzhugh, 2012, 2013, and references

therein). Consider the actions of compiling observation statements

into a data matrix and ‘inferring cladograms.’ The implied intent

would have to be that of explaining, by way of past evolutionary

events, differentially shared characters. The primacy of

explanation in systematics is, however, rarely cogently articulated

and has led to a tendency to only focus on the diagrammatic

qualities of cladograms, ‘phytogenies’ or ‘trees’, with inordinate

attention on ‘groups’ and topologies, rather than recognising that

cladograms are composite hypotheses representing at least three

classes of causal events: (i) character origin/fixation among

individuals of reproductively isolated ancestral populations and

(ii) subsequent population-splitting events (Fitzhugh, 2012: Figs

1, 4; 2013: Fig. 1), as well as (iii) species hypotheses, which are

inferred prior to cladograms-as-hypotheses, denoting more

proximate accounts of character origin/fixation among individuals

of reproductively isolated populations observed in the present.

Causal events (i)-(iii) are implied by the ‘interior branches’,

‘nodes’ and ‘terminal branches’, respectively, that make up

cladograms. Needless to say, cladograms typically convey

nothing in the way of specifics regarding the causal events they

are intended to imply. There are additional classes of hypotheses

utilised in systematics (cf. Hennig, 1966: Fig. 6; Fitzhugh, 2012:

Table 1; 2013: Table 1), but the emphasis in this paper will be on

those that are phylogenetic. Presenting a diagram as a ‘phylogeny ’

minimally assumes that it causally accounts for specifiable

characters that were the basis for the inference, e.g. a data matrix.

To assert that cladograms do not have to meet such an obligation

would reduce them to nothing more than rhetorical devices with

little or no scientific utility.

Phylogenetic reasoning

Acknowledging cladograms, trees, phylogenies, etc., as sets of

explanatory accounts providing at least initial causal

understanding of select characters of organisms necessitates

that we identify the particular type of reasoning employed to

move from observation statements, as data matrices partim, to

cladograms. Inferring tentative causes from observed effects is

known as abductive reasoning, or abduction (Peirce, 1878,1931,

1932, 1933a, 1933b, 1934, 1935, 1958a, 1958b; Hanson, 1958;

Achinstein, 1970; Fann, 1970; Reilly, 1970; Curd, 1980; Nickles,

1980; Thagard, 1988; Josephson and Josephson, 1994; Baker,

1996; Hacking, 2001; Magnani, 2001; Psillos, 2002, 2007, 2011;

Godfrey-Smith, 2003; Norton, 2003; Walton, 2004; Aliseda,

2006; Fitzhugh, 2005a, 2005b, 2006a, 2006b, 2008a; 2008b;

2008c, 2009, 2010a; Schurz, 2008). Abduction has the form:

[1] • auxiliary theory(ies)/hypotheses, b

• theory(ies) relevant to observed effects, t (e.g. ‘common

ancestry’)

• observed effects, e 1 (e.g. shared characters)

• explanatory hypothesis(es), h (e.g. cladograms).

Abduction is non-deductive, as indicated by the double line

separating premises (upper) from conclusion(s) (lower);

deductive arguments are denoted by a single line separating

premises and conclusion. Operationally, while abduction

supplies hypotheses that at least initially account for observed

effects, potential test evidence required to empirically evaluate

the causal claims in hypotheses are predicted deductively:

[2] • auxiliary theory(ies)/hypotheses, b

• theory(ies) relevant to the observed effects, t

• specific causal conditions presented in explanatory

hypothesis via [1]

• proposed conditions needed to perform test

• observed effects, e y , originally prompting h (cf. [1])

• ‘predicted test evidence’, i.e. effects related as closely

as possible to the specific causal conditions of the

hypothesis.

Induction sensu stricto is the subsequent act of testing hypotheses:

[3] • auxiliary theory(ies)/hypotheses, b

• theory(ies) relevant to observed effects, t

• test conditions performed

• confirming/disconfirming evidence, e 2 (observations of

‘predicted test evidence’ in [2], or alternative

observations)

• h is confirmed/disconfirmed.

Note that the premises in [3] comprise the ‘test evidence’. But

of this evidence, it is the observations that ensue from the act

of testing (third and fourth premises), either in the form of

‘predicted test evidence’ inferred in [2] or alternative results,

that stand as ‘test evidence’ that confirms or disconfirms,

respectively, the hypothesis.

While there is the assumption that the premises used in

inferences of any kind are true, only deduction can provide a

Character mapping and cladogram comparison versus the requirement of total evidence: does it matter for polychaete systematics?

conclusion that is guaranteed true if the premises are true. In

other words, the rules for valid deduction limit the conclusion to

being a restatement of what is in the premises (Salmon, 1984b;

Copi and Cohen, 1998). The conclusions derived from abductions

and inductions are probabilistic rather than certain since the

content of conclusions can extend beyond that of the premises.

From a Bayesian perspective, abduction provides the basis

for the prior probability of a hypothesis, P (h I e x , b ), and

induction the posterior probability, P (h I e 2 , b). Note that

‘evidence’ in both [1] and [3] consists of the respective

premises (Longino, 1979; Salmon, 1984b; Achinstein, 2001;

Fitzhugh, 2012). 1 It is worth mentioning that while we speak of

evidence as the premises in any form of inference that leads to

conclusions, ‘evidence’ in the form of character data allowing

for abductive inferences of cladograms is in sharp contrast to

the ‘test evidence’ required to empirically evaluate those

hypotheses (cf. Fitzhugh, 2006a, 2010a, 2012).

Regarding systematics, the inferences of phylogenetic

hypotheses, indeed all taxa, are abductive (Fitzhugh, 2006a,

2012, 2013). Following the form in [1], inferences of

phylogenetic hypotheses should exhibit the following

schematic structure:

[4] • Phylogenetic theory : If character x(0) exists among

individuals of a reproductively isolated, gonochoristic or

cross-fertilising hermaphroditic population, and

character x(l) originates by mechanisms a,b,c ... n,

and becomes fixed within the population by

mechanisms d, e,f ... n (= ancestral species hypothesis),

followed by event(s) g,h,i ... n, wherein the population

is divided into two or more reproductively isolated

populations, then individuals to which descendant

species hypotheses refer would exhibit x(l).

• Observations (effects): Individuals to which specific

hypotheses x-us and y-us refer have ventrolateral

margins with appendages in contrast to smooth as seen

among individuals to which other species hypotheses

( a-us, b-us, etc.) refer.

• Causal conditions (phylogenetic hypothesis X-us):

Ventrolateral margin appendages originated by some

unspecified mechanism(s) within a reproductively

isolated population with smooth ventrolateral margins,

and the appendage condition became fixed in the

population by some unspecified mechanism(s) (=

ancestral species hypothesis), followed by an

unspecified population-splitting event(s) that resulted in

two or more reproductively isolated populations.

Note that while the formal name X-us would be graphically

1 The prior probability, P (h I e { , b), is typically shown as P (h). Since

the evidence in abduction is known, i.e. P(e x ) = 1, then P (h I e v b)

- P (h). As noted by Williamson (2000: 187), “... e itself should

not be built into the background information, for that would give

P(e) the value 1, in which case P (h I e) and P (h) would be equal

and e would not be evidence for anything”. The negative

implications for how systematists routinely refer to character

data as ‘supporting evidence’ for cladogram topologies are

significant (cf. Fitzhugh, 2012).

represented as a cladogram, i.e. ((a-us, b-us (x-us, y-us))), what

is significant is that such a diagram implies the ‘causal

conditions’ of character origin/fixation and population¬

splitting events.

The form of the ‘phylogenetic theory’ in [4] is

determined by a necessary conceptual link that must exist

between ‘observed effects’ in the form of differentially shared

characters and the ‘phylogenetic theory’ (Fitzhugh, 2012); that

link being the why-questions we implicitly or explicitly ask

(Fitzhugh, 2006c, 2012) regarding those effects:

[5] ‘Why do individuals to which specific hypotheses x-us

and y-us refer have ventrolateral margins with appendages

in contrast to smooth, as seen among individuals to which

other species hypotheses (a-us, b-us, etc.) refer?’

As we are confronted with surprising or unexpected

phenomena requiring explanation, in the form of differentially

shared characters among organisms, what follows are the

why-questions that prompt abductive inferences to phylogenetic

hypotheses. The analyses by Fitzhugh (2006c, 2008b, 2012,

2013) have shown that those why-questions are located within

the data matrix, where the designations of outgroups contribute

to what is known as the contrastive nature of why-questions

(Salmon, 1984a, 1989; Sober, 1986, 1994; VanFraassen, 1990;

Lipton, 2004; Fitzhugh, 2006a; 2006b; 2006c). This contrastive

form distinguishes what is in need of explanation (‘Why do

individuals to which specific hypotheses x-us and y-us refer

have ventrolateral margins with appendages ...’), from what

has been previously explained (‘... in contrast to smooth, as

seen among individuals to which other species hypotheses

(a-us, b-us, etc.) refer?’). Why-questions seek common cause

answers by way of the fact that observation statements of

shared similarities carry the presupposition that those

statements are true (Bromberger, 1966; Sober, 1986, 1988;

Marwick, 1999; Sintonen, 2004; Schurz, 2005). Given this

presupposition, explaining those similarities should involve

causes that maintain as much as possible the truth of the

observation statements, and that is achieved by way of a theory

that ensures common causes as much as possible. Hence, the

‘phylogenetic theory’ in [4] is consistent with the

presuppositions of why-questions implied in data matrices,

and thus necessary. The impact of this issue on phylogenetic

inference, especially regarding so-called ‘likelihood’ and

‘Bayesian’ methods, will be mentioned later (cf. ‘Defeasible

arguments against the requirement of total evidence’).

The requirement of total evidence

It was noted in the previous section that abduction, like

induction sensu stricto, is non-deductive, such that regardless

of the truth of the premises, conclusions are only probable, as

opposed to certain qua deduction. The consequence is that

‘initial’ credibility of abductive conclusions, tentative though

they are, must be judged against the content of the premises.

Excluding evidence that has the potential, either positively or

negatively, to alter belief in, or support for a conclusion directly

impinges on acceptance of that conclusion. While there are no

general rules of non-deductive logic dictating the content of

premises, there is the principle known as ‘the requirement of

K. Fitzhugh

total evidence’ that determines the degree to which rational

credibility should be assigned to hypotheses (Carnap, 1950;

Barker, 1957; Hempel, 1962, 1965, 1966, 2001; Salmon, 1967;

1984a, 1984b, 1989, 1998; McLaughlin, 1970; Sober, 1975;

Fetzer, 1993; Fetzer and Almeder, 1993; Fitzhugh, 2006b;

Kelly, 2008; Neta, 2008). Carnap (1950: 211, emphasis

original) provided the first explicit description of the

requirement:

Requirement of total evidence ’: in the application of

inductive logic to a given knowledge situation, the total

evidence available must be taken as basis for determining the

degree of confirmation.”

While the context of Carnap’s characterisation is inductive,

the requirement applies to all non-deductive reasoning. Failure

to consider this more inclusive application has led some

systematists (e.g. Wheeler, 2012: 73) to incorrectly justify the

requirement via the conflation of phylogenetic inference with

testing.

If the goal of scientific inquiry is the continued pursuit of

causal understanding of phenomena we encounter, and

evidence is that which justifies belief in the hypotheses that

afford us that understanding, then deciding what evidence to

consider in the derivations of beliefs will be of paramount

importance. The requirement of total evidence provides the

basis for choosing. Hempel (1962: 138) cogently describes the

situation: “The general consideration underlying the

requirement of total evidence is obviously this: If an

investigator wishes to decide what credence to give to an

empirical hypothesis or to what extent to rely on it in planning

his actions, then rationality demands that he take into account

all the relevant evidence available to him; if he were to consider

only part of that evidence, he might arrive at a much more

favorable, or a much less favorable, appraisal, but it would

surely not be rational for him to base his decision on evidence

he knew to be selectively biased.”

In speaking of systematics, with the popular approaches of

comparing phylogenetic hypotheses inferred from different

datasets, or mapping characters on to a pre-existing set of

hypotheses, i.e. cladograms, Hempel’s (1966: 177, emphasis

original) remarks are particularly illuminating: “When two

sound inductive arguments thus conflict, which conclusion, if

any, is it reasonable to accept, and perhaps act on? If the available

evidence includes the premises of [two different] arguments, it

is irrational to base our expectations concerning the conclusions

exclusively on the premises of one or the other of the arguments;

the credence given to any contemplated hypothesis should

always be determined by the support it receives from the total

evidence available at the time ... What the requirement of total

evidence demands, then, is that the credence given to a

hypothesis h in a given knowledge situation should be

determined by the inductive support, or confirmation, which h

receives from the total evidence e available in that situation.”

In the event one is determining the plausibility of a

hypothesis, whether as the product of abduction or induction,

the requirement of total evidence provides a basis for assuring

that plausibility is considered by way of all relevant evidence

available to an investigator. 2 This is a matter of judging what

premises are being used to support a particular conclusion, cf.

[1] and [3]. Note that Hempel (1966) speaks of rationality

when it comes to deciding theory or hypothesis acceptance.

Scientific inquiry is rational to the extent we accept that

theories and hypotheses are true, and that they lead to true

beliefs, given available evidence. The requirement of total

evidence is one of the basic tools to ensure rationality.

Since our present interest is with abduction specifically, it

would be useful to look at an example of the implications of

the requirement of total evidence on that type of reasoning.

Consider the following abductive argument, where I attempt to

explain why my lawn is wet:

[6] • When it rains, the grass gets wet

• My lawn was wet this morning

• It must have rained last night.

The basis for the abduction would follow from the (contrastive)

why-question (cf. [5]), ‘Why is my lawn wet in contrast to

being dry?’ Questioning the initial plausibility of the

hypothesis would entail determining if there are available

premises that have been excluded or not considered. For

instance, if we consider other premises (in italics), the

plausibility of the conclusion in [6] drops substantially:

[7] • My lawn sprinklers turn on automatically at

4 am every day

• My lawn was wet this morning

• The grass is dry in adjacent yards

• The lawn sprinklers watered the lawn last night.

Notice that the contradictory conclusions in [6] and [7] are

permissible given their respective premises. The requirement

of total evidence imposes no rules on how non-deductive

reasoning itself should take place, but rather provides a

necessary criterion of rationality for accepting the conclusions

from inferences based on available evidence, i.e. the premises.

If we are aware of the additional premises in [7], it would be

2 It is routine in systematics that inclusion of ‘all relevant/available

evidence’ in abduction might not be immediately practical. For

instance, it is often the case that various classes of ‘morphological’

characters are known across a group of organisms, but other classes of

characters , e.g. cilia patterns, internal anatomy, ultrastructure,

nucleotide sequences, etc., are sporadically available. Inclusion of

these latter data can necessitate an abundance of ‘unknown’ (i.e. *?’)

codings, resulting in explanations (transformation series) that are

largely uninformative within the scope of organisms considered. It

might be more effective to delay explaining these latter observations

until more inclusive coverage is attained. This is not to suggest that

some classes of characters should be explained separately from others.

The requirement of total evidence stipulates an ideal for inclusion of

evidence. The goal with regard to abduction is to get as close as

possible to that ideal within the limits of epistemic feasibility.

Alternatively, if one wishes, for instance, to explain sequence data for

a limited group of organisms for which other data are readily available,

e.g. ‘morphological’ characters, the requirement of total evidence

decisively mandates that these latter data be explained within the

same abductive inference as those sequence data.

Character mapping and cladogram comparison versus the requirement of total evidence: does it matter for polychaete systematics?

less rational to accept the conclusion in [6]. We recognise that

considering these latter premises makes the initial conclusion

less credible relative to the causal account that relies on the

more inclusive available evidence that can affect plausibility:

[8] • There are no records of rainfall last night

• My lawn sprinklers turn on automatically at

4 am every day

• My lawn was wet this morning

• The grass is dry in adjacent yards

• The lawn sprinklers watered the lawn last night.

An analogous situation will be examined in the next section

for phylogenetic inferences.

The requirement of total evidence and systematics:

epistemic issues

With the basics of abductive reasoning and the requirement of

total evidence presented in the previous sections, we can

identify implications for two common approaches in

systematics: comparing cladograms inferred from different

datasets, and mapping characters on cladograms inferred from

other data.

Comparing cladograms

The practice of inferring phylogenetic hypotheses from

separate sets of why-questions qua partitioned datasets, with

subsequent comparisons of topologies, also known as

‘taxonomic congruence,’ has a lengthy history (e.g. Mickevich,

1978). The most popular approach at present is to compare

cladogram topologies inferred from ‘morphological’ and

sequence data, respectively, or between ‘morphological’ and

different sets of sequence data.

Using the schematic example in fig. 1A, the most basic

problem with cladogram comparison can be identified.

Separate abductive inferences (cf. [1], [4]) accounting for

observations in datasets a and [3 are implied by the respective

topologies, ( a-us ( b-us ( c-us , d-us ))) and ((i a-us , b-us) ( c-us ,

d-us )). The letters on each cladogram ‘node’ indicate

hypotheses of population-splitting events necessary to explain

the data in conjunction with hypotheses of character origin

and fixation [‘transformation series,’ i.e. n( 0 —> 1)]. Whether or

not the theories used (cf. Phylogenetic theory in [4]) in the

two inferences are the same will not matter at the moment.

Note that the respective conclusions are contradictory in that

they hypothesise the past existence of different sets of causal

conditions. Strictly speaking, however, the causal events of

character origin/fixation are assumed to be independent of one

another. This assumption is required for the fact that we ask

separate why-questions (cf. [5]) regarding different characters,

and operate under the view that those observations need to be

explained by separate or independent causal events of character

origin and fixation among members of reproductively isolated

ancestral populations (Fitzhugh, 2006a, 2006c, 2008c, 2012).

But when we take population-splitting events into account,

problems with cladogram comparison become apparent.

Consider population-splitting event B in fig. 1A. In

conjunction with the hypotheses of character origin/fixation of

characters 2(1), 3(1), and 4(1) among members of an ancestral

population, splitting event B also explains the presence of

those characters among individuals to which specific

hypotheses b-us , c-us and d-us also refer. Next consider

population-splitting events E and F in the other cladogram.

Hypothesis E partially explains character 7(1) among

individuals to which a-us and b-us refer, while hypothesis F

accounts in part for character 8(1) among individuals to which

c-us and d-us refer. What is immediately apparent is that

hypothesis B contradicts hypotheses D, E and F, and vice

versa. The plausibilities of the individual hypotheses are

compromised because they account for respective observations

with conflicting causal events of the same class. Hypothesis B

could not be rationally accepted relative to hypotheses D-F.

Contradictory sets of population-splitting events are decisive

for acknowledging that the composite hypotheses represented

by cladograms impinge on our ability to rationally explain all

available, relevant observations. It is also the case that the

separate hypotheses of character origin/fixation implied by the

two cladograms call into question the credibility of those

classes of hypotheses. For instance, explaining characters 2(1)

through 5(1) influence rational acceptance of hypotheses for

characters 7(1) and 8(1), and vice versa. The solution is to infer

causal accounts for both sets of characters within the same

inference (fig. IB). Indeed, this is a constraint immediately

apparent from the perspective mentioned earlier, that why-

questions (cf. [5]) determine the conceptual link between

observation statements and the theory that must be uniformly

applied to those statements (cf. [4]).

Related to the issue of contradictory population-splitting

events just described (fig. 1A), there is an additional problem

that has received insufficient attention. It is not uncommon,

especially with the separate inferences of phylogenetic

hypotheses for ‘morphological’ and sequence data, that

different theories are employed. As the only solution to

rationally decide between contradictory hypotheses of

population-splitting events is to apply the requirement of total

evidence (fig. IB), this also entails that the same theory(ies) be

used for all available observations being explained. The matter

of what theory(ies) to use in the inferences of phylogenetic

hypotheses lies beyond the scope of this paper. 3 Regardless,

there are substantial epistemic difficulties associated with

most phylogenetics-related theories due to the fact that

relations between observations, why-questions, and abductive

inferences required to answer those questions have been

largely overlooked (Fitzhugh, 2006a, 2006b, 2006c, 2008c,

2012, 2013). In lieu of combining data, the only alternative is

to segregate out those why-questions that would not require

phylogenetic hypotheses as answers, but rather one of the

other classes of hypotheses, e.g. intraspecific or specific. Such

attention to detail is, however, rarely considered.

An obvious consequence of the analysis presented thus far

is that phrases of the form ‘Morphological and molecular

3 Albeit the Phylogenetic Theory in [4] is sufficient for the why-

questions asked in systematics (cf. [5]) (Fitzhugh, 2012). In terms of

presenting causal events accounting for shared characters, cladograms

are remarkably vague in their details.

K. Fitzhugh

Theory + a dataset:

x-us

a-us

b-us

c-us

d-us

Theory + p dataset:

x-us

a-us

b-us

c-us

d-us

Theory

a/p:

-f y

d-us

c-us

x-us

5(0—^1)

6(Q-»T) —y

a-us

2<0“*i) rdf

b-us

3(0—^1 ) jr-J f

4(0 >i) / 7(0-1 r

c-us

a-us

d-us

7(0^1)*

Figure 1. Example of the error of cladogram comparisons. A, phylogenetic hypotheses inferred from separate sets of premises. Letters on

cladogram ‘nodes’ indicate population-splitting events relevant to the various hypotheses of character origin/fixation within ancestral populations.

The requirement of total evidence precludes such a comparison of cladogram topologies because explanations of characters 1(1)—5(1) by

population-splitting events A-C (left cladogram) contradict explanations of 6(1)—8(1) by population-splitting events D-F. See text for further

discussion. B, explaining observations in accordance with the requirement of total evidence, correcting the problem in ‘A’.

phylogenies for group X disagree (or agree)’ are epistemically

meaningless. There can be no disagreement/agreement due to

the fact that the objective of phylogenetic inference is not to

obtain ‘trees’. Cladograms, as branching structures, are only

as scientifically informative as the hypotheses of past causal

events that can be discerned from such diagrams, as answers

to why-questions. To speak of ‘disagreement’ among

‘phylogenies’ or cladograms as branching structures is to

commit the fallacy of reification; treating cladograms as the

tangible objects of interest rather than the actual hypotheses

implied by those diagrams. The only disagreements that can

be referred to among cladograms inferred from different sets

of data are hypotheses of character origin/fixation within

ancestral populations and subsequent population-splitting

events (cf. fig. 1A); both being the result of failing to follow the

requirement of total evidence (pace fig. IB).

Character mapping

The popular alternative to separate inferences of phylogenetic

hypotheses for partitioned data is the use of cladogram

topologies based on one set of data as the ‘framework’ for

determining phylogenetic hypotheses for other data not

involved in the inference of a cladogram (i.e. not present in the

premises; cf. [1], ej. As with cladogram comparisons discussed

earlier, the issue here will be to show that decisions regarding

the plausibility of phylogenetic hypotheses are compromised

because mapping involves inferential processes separate from

inferences of the cladograms-as-phylogenetic hypotheses

upon which characters are mapped.

Fig. 2A presents an abductive inference for a set of

observed effects—dataset a—where the cladogram implies at

a minimum the two classes of causal events of character

origin/fixation and subsequent population splitting. Also

represented are the separately inferred species hypotheses,

a-us through d-us. Using this cladogram topology, additional

observations—dataset P—are then ‘mapped’ on to ‘branches’

of the cladogram (fig. 2B), generally in a presumptive effort to

‘optimise’ placements of characters to minimise ad hoc

hypotheses of homoplasy.

Character mapping fails as a scientifically viable approach

because it is in essence a variant of cladogram comparison. As

discussed in the previous section, the phylogenetic hypotheses

Character mapping and cladogram comparison versus the requirement of total evidence: does it matter for polychaete systematics?

Theory +

Data a: o,, o 2 ,... o„

Data p: o x , o y ,... o„

map characters

Theory +

Data p: o„ o y ,... o„

Theory +

Data a: o,, o 2 , ... o„

Data p: o x , o y ,... o„

Figure 2. Example of the error of character mapping. A, phylogenetic hypotheses are inferred for a set of characters. Numbers on cladogram

‘nodes’ indicate population-splitting events relevant to the various hypotheses of character origin/fixation within ancestral populations (not

shown; cf. fig. 1). B, a different set of characters are ‘mapped’ onto the branches of the cladogram in ‘A’. C, the ‘mapped’ characters in ‘B’

actually refer to phylogenetic hypotheses inferred separately from the hypotheses implied by the cladogram in ‘A’ and ‘B’. D, explaining

observations in accordance with the requirement of total evidence, correcting the problem in ‘B’ and ‘C\ See text for further discussion.

(fig. 2A) inferred using dataset a are only relevant to those

characters, as explanatory accounts. While mapping (fig. 2B)

gives the appearance of conjoining additional observations to

these hypotheses to produce a more inclusive set of explanations,

this is not the case. Regardless of what characters are mapped

on to a previously inferred cladogram, the transformation series

for the mapped characters do in fact represent consequences of

inferential acts, albeit quite vague, that are wholly separate from

the initial inference (fig. 2C). As composite hypotheses,

cladograms h { and h 2 in fig. 2A and 2B/C, respectively, refer to

different sets of explanatory accounts. The fact that the

cladograms have the same topologies has no epistemic standing.

Topologies of branching diagrams are immaterial. What matters

are the causal events conveyed by those diagrams as answers to

why-questions. The population-splitting events in h { (fig. 2A)

only pertain to explanations of a-type characters, while events

in h 2 { fig. 2B/C) only relate to (3-type characters, yet both sets of

hypotheses refer to classes of events that directly impinge on the

credibility of those hypotheses. Per the requirement of total

evidence, the only solution is that both sets of characters must

be explained via the same abductive inference (fig. 2D).

Defeasible arguments against the requirement of total

evidence

Cladogram comparisons and character mapping have become

accepted practices in biological systematics on the basis of

two common arguments endorsing the partitioning of

character data: (i) sets of characters are so different in quality,

or subject to radically dissimilar causal processes, as to

require separate treatment, and (ii) classes of data with

inordinately disparate representation will result in the ‘signal’

or ‘noise’ from the larger class ‘overwhelming’ what can be

offered by the smaller class. Most often the perceived need

for partitioning falls along the arbitrary lines of ‘morphology’

and nucleotide or amino acid sequences. Partitioning has

never been defended on the basis of presenting a valid

alternative to the requirement of total evidence that indicates

the requirement is defective and at the same time establishes

that partitioning promotes a more rational evaluation of

hypothesis credibility in relation to abductive reasoning (cf.

Fitzhugh, 2006b, 2008c). In this section, arguments (1) and

(2) are shown to be invalid.

K. Fitzhugh

‘Characters cannot be combined’

Claiming that a particular class of data, e.g. nucleotide

sequences, is fundamentally different from another class, e.g.

‘morphology,’ such that phylogenetic hypotheses explaining

the former must be inferred separately from phylogenetic

hypotheses explaining the latter suffers from several basic

oversights. Recall that aligning systematics with all fields of

science requires acknowledging that the objective is to acquire

causal understanding of differentially shared characters among

organisms. This goal, via why-questions (cf. [5]) leading to

abductive inferences (cf. [4]), provides the conceptual link

between our observation statements of the properties of

organisms and the explanatory hypotheses referred to as taxa

(Fitzhugh, 2005b, 2008b, 2009, 2010b, 2012, 2013; Nogueira et

al., 2010, 2013). There are two aspects of this conceptual link

that have been almost uniformly overlooked in systematics,

especially with regard to developments of algorithms for

phylogenetic inference: the why-questions related to our

observations (cf. [5]) and the nature of abductive reasoning

required to provide at least initial answers to those questions

(cf. [1], [4]). Indeed, while principles of phylogenetic inference

have developed around notions like parsimony, ‘likelihood,’

and ‘Bayesianism,’ 4 the latter two have no relevance to

abduction, and parsimony is only worthy of consideration in

the context of the why-questions to which abduction is directed

(Sober, 1975; Fitzhugh, 2006a, 2006b, 2012). All in all, what

stands as the basis for phylogenetic inference is correctly

applying abduction to why-questions, not deciding whether to

use [sic] parsimony, ‘likelihood,’ or ‘Bayesianism.’

What precludes data partitioning on the basis that classes of

data are either qualitatively different or the products of

substantively different causal processes is that the why-questions

invariably have the form shown in [5]. The very nature of

observation statements of shared similarities determines that

why-questions seek common cause answers (cf. ‘Reasoning and

the requirement of total evidence’, above)—a perspective that is

at odds with ‘likelihood’ and ‘Bayesian’ methods in systematics

(Fitzhugh, 2006a, 2012). The standard argument for ‘likelihood’

and ‘Bayesian’ phylogenetic inferences is that they take into

consideration rates of sequence evolution (Felsenstein, 2004;

4 These terms are placed in quotes because their application to abductive

reasoning is erroneous (Fitzhugh, 2012). The likelihood principle

refers to the probability of observing test evidence for a particular

hypothesis, P(e I h) (Hacking, 1965; Howson and Urbach, 1993;

Lipton, 2008), while Bayesianism addresses changes in belief in

hypotheses, as posterior probabilities P (h I e), subsequent to the

‘introduction of test evidence’ (Salmon, 1967; Howson and Urbach,

1993; Hacking, 2001). The methods known as ‘maximum likelihood’

and ‘Bayesianism’ in systematics incorrectly conflate the abductive

inferences of hypotheses with the testing of those hypotheses—a long¬

standing view created by equating abductive evidence, i.e. the

premises in [1] and [4], with test evidence (cf. [2], [3]). This mistake

has been extended to include the concept of statistical consistency

(Felsenstein, 1981, 2004), where preferred methods should ‘converge’

on true [.sic] hypotheses with the addition of more and more ‘test’

evidence (not abductive evidence). As noted by Fitzhugh (2012, see

also references therein), consistency is a perspective that is meaningless

in the context of abduction.

Schmidt and von Haeseler, 2009; Ronquist et al., 2009). But

once one invokes rates, this must place a priori constraints on

our observation statements, rather than introducing rates within

the abductive framework for explaining those observations

relative to other observations by way of phylogenetic hypotheses.

This is a direct consequence of basic logic and rationality: the

assumption that premises are true propositions (Williamson,

2000). For observation statements of shared similarities to have

the status of evidence/premises in abduction (e.g. [4]:

Observations (effects)), those statements must be regarded as

true. The conjunction of a theory of substitution rates and shared

similarities is a contradiction. Rates of sequence evolution must

be considered at the point one proceeds from perceptions to

observation statements. For instance, rather than accepting that

individuals to which species hypotheses x-us, y-us and z-us refer

have nucleotide A at position 234, in contrast to T, as observed

among individuals to which species hypotheses a-us, b-us and

c-us refer, a theory of substitution rates must first be used to

determine which nucleotides are in fact A while others are A. In

other words, accepting a theory of substitution rates requires

that one’s perceptions of A first be subjected to an initial

abductive inference distinguishing some A’s as shared

similarities that are distinct from A’s (other shared similarities).

Upon making this distinction, the subsequent why-question

would have the form, “Why do individuals to which species

hypothesis x-us refers have an A at position 234, whereas

individuals to which species hypotheses y-us and z-us refer have

A (in contrast to T, as observed among individuals to which

species hypotheses a-us, b-us and c-us refer)?” The form of the

why-question is a necessary consequence of applying the theory

of substitution rates at the proper epistemic juncture, i.e. prior to

the abductive inference of phylogenetic hypotheses, [4]. 5 The

subsequent abductive inference directed at all relevant shared

similarities would again seek common cause answers in the

form of phylogenetic hypotheses.

With the correct utilisation of why-questions that require

phylogenetic hypotheses as answers, there are no differences

between characters that could warrant the partitioning of data

that leads to cladogram comparison or character mapping.

Similarly, attempts to develop methodological criteria to

determine the extent to which data should be combined, such

as the incongruence length difference test (Farris et al., 1995;

Barker and Lutzoni, 2002), are nullified due to the fact that

they operate under the incorrect assumption that cladograms

can be empirically compared for the purpose of deciding

whether or not the respective explanations of partitioned data

should be discarded in lieu of being explained en masse.

51 doubt any systematist would find this manoeuvre practical, much less

readily operational. But the only alternative is to maintain the integrity

of observation statements of shared similarities in both why-questions

and abductive inferences (cf. [5], [4], respectively). As with any field of

science, calling into question whether or not shared similarities should

be explained by way of some hypothesis of common cause is

something considered during the process of empirical hypothesis

testing, not the inferences of those hypotheses. This is yet one more

reason why ‘likelihood’ and ‘Bayesian’ approaches to abductive

reasoning are misguided.

Character mapping and cladogram comparison versus the requirement of total evidence: does it matter for polychaete systematics?

‘One set of data will overwhelm other data ’

The intuitive appeal of the idea that the large number of

nucleotides or amino acids comprising sequence data can have

negative effects on the ‘signal’ offered by ‘morphological’

characters derives from two misconceptions. First, it is

senseless to regard characters as either ‘signal’ or ‘noise.’ To

invoke this distinction introduces the incorrect presumption

that one has already explained observations prior to the

abductive inferences of phylogenetic hypotheses, or is relying

on specious ‘support’ measures like the bootstrap or Bremer

index (Fitzhugh, 2006a, 2012) subsequent to inferring

explanations. As the intent of phylogenetic inference is to

provide answers to specifiable why-questions regarding our

observation statements, there are no concepts of ‘signal’ and

‘noise’ that are applicable. Second, presuming that explaining

one set of characters negatively impinges on explanations of

other sets of characters requires introducing some sort of

extra-evidential justification for partitioning, of which there is

none. Characters considered in abductive inferences to

phylogenetic hypotheses are equivalent from the perspective

that they require the same explanatory structure. That

equivalence is determined by the fact that the why-questions

being asked (cf. [5]), and which are implied by a data matrix

(Fitzhugh, 2006c), invoke a theory of common ancestry (cf.

[4], Phylogenetic theory) applicable to all the observations.

Rather than introducing ad hoc maneuvers to ensure obtaining

unwarranted, preordained results, answers to why-questions

need to be evaluated through the standard approach of seeking

test evidence that either confirms hypotheses or points to

alternatives.

Conclusions

Rationality is a fundamental feature of scientific inquiry, for it

enables making empirical choices between competing

hypotheses or theories. In the context of abductive reasoning,

being the source of hypotheses throughout biological

systematics, objectively determining initial degrees of belief

between hypotheses is a matter of considering the content of

premises (cf. [1], [4], [6]-[8]). The requirement of total evidence

ensures that the basis for initially accepting one hypothesis over

another, i.e. P (h { I e v e 2 , ... ej > P (h 2 1 ef, is a rational decision.

That initial acceptance is not the same as acceptance subsequent

to subjecting hypotheses to empirical testing (cf. [2], [3]), in

which case the requirement of total evidence would also apply

when taking into account test evidence. Regardless of properly

adhering to the requirement of total evidence, the hypotheses

implied by cladograms are profoundly meager causal constructs,

lacking in the details needed to even consider them worthy of

testing (Fitzhugh, 2012). But, this inherent limitation does not

justify the tradition of uncritical thinking that has developed

within, and has become a mainstay of biological systematics.

The lack of proper consideration of the requirement of

total evidence within systematics has probably been mainly

due to outright disagreement with the principle and/or not

fully understanding it, coupled with the historical failure to

embrace abductive reasoning, and perhaps no awareness

regarding the importance of rationality in science. Overlooking

these factors figures prominently in, for instance, Felsenstein’s

(2004: 536) mistaken view that a ‘total evidence debate’ exists

in systematics. What might be perceived as a debate is actually

the conjunction of multiple misunderstandings of reasoning.

No valid dispute exists on the subject within the scope of logic

(Hempel, 1965; Kelly, 2008; Neta, 2008) that could warrant

the perception that the requirement can be bypassed in

systematics. Unless systematics is successful at devising its

own unique protocols for ensuring rational reasoning—which

has not been the case—there is no denying the import of the

requirement of total evidence. It is an ironic twist that scientists

are quick to criticise such pursuits as creationism/intelligent

design because they fail at leading to scientifically acceptable

conclusions. Given the choice between the well-tested theory

of natural selection and an untested theory of a non-natural

designer, reliance on the latter is acknowledged as offering

less rational understanding than the former. Yet, we see

cladogram comparisons and character mapping deemed

acceptable, even though they too violate the same basic tenet

of rationality. The success of scientific inquiry stands on

consistently recognising the essential necessary elements for

rational reasoning. Systematics cannot afford to depart from

those standards by ignoring the requirement of total evidence.

Acknowledgements

Drs Helio da Silva and Vasily Radashevsky provided valuable

comments.

References

Achinstein, P. 1970. Inference to scientific laws. Pp. 87-111 in:

Stuewer, R.H. (ed.), Vol. V: Historical and philosophical

perspectives of science. Minnesota studies in the philosophy of

science. University of Minnesota Press: Minneapolis.

Achinstein, P. 2001. The book of evidence. Oxford University Press:

New York. 290 pp.

Aliseda, A. 2006. Abductive reasoning: logical investigations into

discovery and explanation. Springer: Dordrecht. 225 pp.

Baker, V.R. 1996. Hypotheses and geomorphological reasoning. Pp.

57-85 in: Rhoads, B.L. and Thorn, C.E. (eds). The scientific

nature of geomorphology. Proceedings of the 27th Binghamton

Symposium in Geomorphology held 27-29 September 1996. John

Wiley & Sons: New York.

Barker, F.K., and Lutzoni, F.M. 2002. The utility of the incongruence

length difference test. Systematic Biology 51: 625-637.

Barker, S.F. 1957. Induction and hypothesis. Cornell University Press:

New York. 203 pp.

Bleidorn, C., Vogt, L., and Bartolomaeus, T. 2003. A contribution to

sedentary polychaete phylogeny using 18S rRNA sequence data.

Journal of Zoological Systematics and Evolutionary Research

41: 186-195.

Bromberger, S. 1966. Why-questions. Pp. 86-111 in: Colodny, R.G.

(ed.), Mind and cosmos: essays in contemporary science and

philosophy. University of Pittsburgh Series in the Philosophy of

Science, 3. University of Pittsburgh Press: Pittsburgh.

Carnap, R. 1950. Logical foundations of probability. University of

Chicago Press: Chicago. 607 pp.

Colgan, D.J., Hutchings, P.A., and Beacham, E. 2008. Multi-gene

analyses of the phylogenetic relationships among the Mollusca,

Annelida, and Arthropoda. Zoological Studies 47: 338-351.

K. Fitzhugh

Copi, I.M., and Cohen, C. 1998. Introduction to logic. Prentice-Hall:

New Jersey. 714 pp.

Curd, M.V. 1980. The logic of discovery: an analysis of three

approaches. Pp. 201-219 in: Nickles, T. (ed.). Scientific discovery,

logic and rationality. D. Reidel Publishing Company: Dordrecht.

de Regt, H.W., Leonelli, S., and Eigner, K. 2009. Focusing on scientific

understanding. Pp. 1-17 in: de Regt, H., Leonelli, S. and Eigner,

K. (eds), Scientific understanding: philosophical perspectives.

University of Pittsburgh Press: Pittsburgh.

Eeckhaut, I., and Lanterbecq, D. 2005. Myzostomida: a review of the

phylogeny and ultrastructure. Hydrobiologia 535-536: 253-275.

Fann, K.T. 1970. Peirce’s theory of abduction. Martinus Nijhoff: The

Hague. 62 pp.

Farris, J.S., Kallersjo, M., Kluge, A.G., and Bult, C. 1995. Testing

significance of incongruence. Cladistics 10: 315-319.

Felsenstein, J. 1981. Evolutionary trees from DNA sequences: a

maximum likelihood approach. Journal of Molecular Evolution

17: 368-376.

Felsenstein, J. 2004. Inferring phytogenies. Sinauer Associates Inc.:

Sunderland. 664 pp.

Fetzer, J.H. 1993. Philosophy of science. Paragon House: New York.

197 pp.

Fetzer, J.H., and Almeder R.F. 1993. Glossary of epistemology/

philosophy of science. Paragon House: New York. 149 pp.

Fitzhugh, K. 2005a. Les bases philosophiques de l’inference

phylogenetique: une vue d’ensemble. Biosystema 24: 83-105.

Fitzhugh, K. 2005b. The inferential basis of species hypotheses: the

solution to defining the term ‘species’. Marine Ecology 26: 155-165.

Fitzhugh, K. 2006a. The abduction of phylogenetic hypotheses.

Zootaxa 1145: 1-110.

Fitzhugh, K. 2006b. The ‘requirement of total evidence’ and its role in

phylogenetic systematics. Biology & Philosophy 21: 309-351.

Fitzhugh, K. 2006c. The philosophical basis of character coding for

the inference of phylogenetic hypotheses. Zoologica Scripta 35:

261-286.

Fitzhugh, K. 2008a. Fact, theory, test and evolution. Zoologica Scripta

37: 109-113.

Fitzhugh, K. 2008b. Abductive inference: implications for ‘Linnean’

and ‘phylogenetic’ approaches for representing biological

systematization. Evolutionary Biology 35: 52-82.

Fitzhugh, K. 2008c. Clarifying the role of character loss in phylogenetic

inference. Zoologica Scripta 37: 561-569.

Fitzhugh, K. 2009. Species as explanatory hypotheses: refinements

and implications. Acta Biotheoretica 57: 201-248.

Fitzhugh, K. 2010a. Evidence for evolution versus evidence for intelligent

design: parallel confusions. Evolutionary Biology 37: 68-92.

Fitzhugh, K. 2010b. Revised systematics of Fabricia oregonica Banse,

1956 (Polychaeta: Sabellidae: Fabriciinae): an example of the need

for a uninomial nomenclatural system. Zootaxa 2647: 35-50.

Fitzhugh, K. 2012. The limits of understanding in biological

systematics. Zootaxa 3435: 40-67.

Fitzhugh, K. 2013. Defining ‘species’, ‘biodiversity’, and ‘conservation’

by their transitive relations. Pp. 93-130 in: Pavlinov, I.Y. (ed.). The

species problem - ongoing problems. InTech: New York.

Godfrey-Smith, P. 2003. Theory and reality: an introduction to the

philosophy of science. University of Chicago Press: Chicago. 272 pp.

Goto, R., Okamoto, T., Ishikawa, H., Hamamura, Y., and Kato, M.

2013. Molecular phylogeny of echiuran worms (Phylum:

Annelida) reveals evolutionary pattern of feeding mode and

sexual dimorphism. PLoS ONE 8: e56809.

Hacking, I. 1965. Logic of statistical inference. Cambridge University

Press: New York. 232 pp.

Hacking, I. 2001. An introduction to probability and inductive logic.

Cambridge University Press: New York. 302 pp.

Halanych, K.M. 2005. Molecular phylogeny of siboglinid annelids (a.k.a.

pogonophorans): a review. Hydrobiologia 535-536: 297-307.

Halanych, K.M., Feldman, R.A., and Vrijenhoek, R.C. 2001. Molecular

evidence that Sclerolinum brattstromi is closely related to

Vestimentiferans, not to frenulate pogonophorans (Siboglinidae,

Annelida). The Biological Bulletin 201: 65-75.

Hall, K.A., Hutchings, P.A., and Colgan, D.J. 2004. Further

phylogenetic studies of the Polychaeta using 18S rDNA sequence

data. Journal of the Marine Biological Association of the United

Kingdom 84: 949-960.

Hanson, N.R. 1958. Patterns of discovery: an inquiry into the

conceptual foundations of science. Cambridge University Press:

New York. 241 pp.

Hausman, D.M. 1998. Causal asymmetries. Cambridge University

Press: New York. 300 pp.

Hempel, C.G. 1962. Deductive-nomological vs. statistical explanation.

Pp. 98-169 in: Feigl, H. and Maxwell, G. (eds), Minnesota studies

in the philosophy of science, Vol. 3. University of Minnesota

Press: Minneapolis.

Hempel, C.G. 1965. Aspects of scientific explanation and other essays

in the philosophy of science. The Free Press: New York. 505 pp.

Hempel, C.G. 1966. Recent problems of induction. Pp. 112-134 in:

Colodny, R.G. (ed.). Mind and cosmos. University of Pittsburgh

Press: Pittsburgh.

Hempel, C.G. 2001. The philosophy of Carl G. Hempel: studies in

science, explanation, and rationality. Fetzer, J.H. (ed.) Oxford

University Press: New York.

Hennig, W. 1966. Phylogenetic systematics. University of Illinois

Press: Urbana. 263 pp.

Hoyningen-Huene, P. 2013. Systematicity: the nature of science.

Oxford University Press: New York. 287 pp.

Howson, C., and Urbach, P. 1993. Scientific reasoning: the Bayesian

approach. Open Court: Chicago. 470 pp.

Josephson, J.R., and Josephson, S.G. (eds) 1994. Abductive inference:

computation, philosophy, technology. Cambridge University

Press: New York. 306 pp.

Kelly, T. 2008. Common sense as evidence: against revisionary ontology

and skepticism. Midwest Studies in Philosophy 32: 53-78.

Kuhn, T.S. 1970. The structure of scientific revolutions. University of

Chicago Press: Chicago. 210 pp.

Kupriyanova, E.K., Macdonald, T.A., and Rouse, G.W. 2006.

Phylogenetic relationships within Serpulidae (Sabellida,

Annelida) inferred from molecular and morphological data.

Zoologica Scripta 35: 421-439.

Kupriyanova, E.K., and Rouse, G.W. 2008. Yet another example of

paraphyly in Annelida: molecular evidence that Sabellidae

contains Serpulidae. Molecular Phylogenetics and Evolution 46:

1174-1181.

Lipton, P. 2004. Inference to the best explanation. Routledge: New

York. 232 pp.

Lipton, P. 2008. Inference to the best explanation. Pp. 193-202 in:

Stathis, P. and Curd, M. (eds). The Routledge companion to

philosophy of science. Routledge: New York.

Longino, H.E. 1979. Evidence and hypothesis: an analysis of evidential

relations. Philosophy of Science 46: 35-56.

Magesh, M., Kvist, S., and Glasby, C.J. 2012. Description and phylogeny

of Namalycastisjay a sp. n. (Polychaeta, Nereididae, Namanereidinae)

from the southwest coast of India. ZooKeys 238: 31-43.

Magnani, L. 2001. Abduction, reason, and science: processes of

discovery and explanation. Kluwer Academic: New York. 205 pp.

Mahner, M., and Bunge, M. 1997. Foundations of biophilosophy.

Springer: New York. 423 pp.

Marwick, P. 1999. Interrogatives and contrasts in explanation theory.

Philosophical Studies 96: 183-204.

Character mapping and cladogram comparison versus the requirement of total evidence: does it matter for polychaete systematics?

McHugh, D. 2005. Molecular systematics of polychaetes (Annelida).

Hydrobiologia 535-536: 309-318.

McLaughlin, A. 1970. Rationality and total evidence. Philosophy of

Science 37:271-278.

Mickevich, M.F. 1978. Taxonomic congruence: Rohlf and Sokal’s

misunderstanding. Systematic Zoology 29: 162-176.

Neta, R. 2008. What evidence do you have? The British Journal for

the Philosophy of Science 59: 89-119.

Nickles, T. 1980. Introductory essay: scientific discovery and the

future of philosophy of science. Pp. 1-59 in: Nickles, T. (ed.).

Scientific discovery, logic and rationality. D. Reidel Publishing

Company: Dordrecht.

Nogueira, J.M.D.M., Fitzhugh, K., and Hutchings, P. 2013. The

continuing challenge of phylogenetic relationships in

Terebelliformia (Annelida: Polychaeta). Invertebrate Systematics

27: 186-238.

Nogueira, J.M.D.M., Fitzhugh, K., and Rossi, M.C.S. 2010. A new

genus and new species of fan worms (Polychaeta: Sabellidae)

from Atlantic and Pacific Oceans—the formal treatment of taxon

names as explanatory hypotheses. Zootaxa 2603: 1-52.

Nola, R., and Sankey, H. 2007. Theories of scientific method: an

introduction. McGill-Queen’s University Press: Ithaca. 381 pp.

Norton, J.D. 2003. A material theory of induction. Philosophy of

Science 70: 647-670.

Parry, L., Tanner, A., and Vinther, J. 2014. The origin of annelids.

Palaeontology DOI: 10.1111/pala.l2129.

Peirce, C.S. 1878. Illustrations of the logic of science. Sixth paper-

deduction, induction, and hypothesis. Popular Science Monthly

13: 470-482.

Peirce, C.S. 1931. Collected papers of Charles Sanders Peirce, Vol. 1.

Principles of philosophy. Hartshorne, C., Weiss, P. and Burks,

A.W. (eds). Harvard University Press: Cambridge. 393 pp.

Peirce, C.S. 1932. Collected papers of Charles Sanders Peirce, Vol. 2.

Elements of logic. Hartshorne, C., Weiss, P. and Burks, A.W. (eds).

Harvard University Press: Cambridge. 535 pp.

Peirce, C.S. 1933a. Collected papers of Charles Sanders Peirce, Vol.

3. Exact logic. Hartshorne, C., Weiss, P. and Burks, A.W. (eds).

Harvard University Press: Cambridge. 433 pp.

Peirce, C.S. 1933b. Collected papers of Charles Sanders Peirce, Vol.

4. The simplest mathematics. Hartshorne, C., Weiss, P. and Burks,

A.W. (eds). Harvard University Press: Cambridge. 601 pp.

Peirce, C.S. 1934. Collected papers of Charles Sanders Peirce, Vol. 5.

Pragmatism and pragmaticism. Hartshorne, C., Weiss, P. and

Burks, A.W. (eds). Harvard University Press: Cambridge. 455 pp.

Peirce, C.S. 1935. Collected papers of Charles Sanders Peirce, Vol. 6.

Scientific metaphysics. Hartshorne, C., Weiss, P. and Burks, A.W.

(eds). Harvard University Press: Cambridge. 462 pp.

Peirce, C.S. 1958a. Collected papers of Charles Sanders Peirce, Vol.

7. Science and philosophy. Hartshorne, C., Weiss, P. and Burks,

A.W. (eds). Harvard University Press: Cambridge. 415 pp.

Peirce, C.S. 1958b. Collected papers of Charles Sanders Peirce, Vol.

8. Reviews, correspondence and bibliography. Burks, A.W. (ed.).

Harvard University Press: Cambridge. 352 pp.

Popper, K.R. 1970. Normal science and its dangers. Pp. 51-58 in:

Lakatos, I. and Musgrave, A. (eds). Criticism and the growth of

knowledge. Cambridge University Press: New York.

Popper, K.R. 1983. Objective knowledge: an evolutionary approach.

Oxford University Press: New York. 395 pp.

Popper, K.R. 1992. Realism and the aim of science. Routledge: New

York. 420 pp.

Psillos, S. 2002. Simply the best: a case for abduction. Pp. 605-625 in:

Kakas, A.C. and Sadri, F. (eds). Computational logic: logic

programming and beyond. Springer: New York.

Psillos, S. 2007. Philosophy of science A-Z. University Press:

Edinburgh. 280 pp.

Psillos, S. 2011. An explorer upon untrodden ground: Peirce on

abduction. Pp. 117-151 in: Gabbay, D., Hartmann, S. and Woods,

J. (eds). The handbook of the history of logic. Vol. 10: inductive

logic. Elsevier B.V.: Oxford.

Reilly, F.E. 1970. Charles Peirce’s theory of scientific method.

Fordham University Press: New York. 200 pp.

Rescher, N. 1970. Scientific explanation. The Free Press: New York.

242 pp.

Ronquist, F., van der Mark, P, and Huelsenbeck, J.P 2009. Bayesian

phylogenetic analysis using MRBAYES. Pp. 210-266 in: Lemey,

P., Salemi, M. and Vandamme, A.-M. (eds). The phylogenetic

handbook: a practical approach to phylogenetic analysis and

hypothesis testing. Cambridge University Press: New York.

Rousset, V., Pleijel, F., Rouse, G.W., Erseus, C., and Siddall, M.E.

2006. A molecular phylogeny of annelids. Cladistics 22: 1-23.

Rousset, V., Rouse, G.W., Feral, J.-P., Desbruyeres, D., and Pleijel, F.

2003. Molecular and morphological evidence of Alvinellidae

relationships (Terebelliformia, Polychaeta, Annelida). Zoologica

Scripta 32: 185-197.

Rousset, V., Rouse, G.W., Siddall, M.E., Tillier, A., and Pleijel, F.

2004. The phylogenetic position of Siboglinidae (Annelida)

inferred from 18S rRNA, 28S rRNA and morphological data.

Cladistics 20: 518-533.

Salmon, W.C. 1967. The foundations of scientific inference. University

of Pittsburgh Press: Pittsburgh. 157 pp.

Salmon, W.C. 1984a. Scientific explanation and the causal structure

of the world. Princeton University Press: Princeton. 305 pp.

Salmon, W.C. 1984b. Logic. Prentice-Hall Inc.: Englewood Cliffs. 180 pp.

Salmon, W.C. 1989. Four decades of scientific explanation. Pp. 3-219

in: Kitcher, P. and Salmon, W.C. (eds). Scientific explanation.

Minnesota studies in the philosophy of science, Vol. XIII.

University of Minnesota Press: Minneapolis.

Salmon, W.C. 1998. Causality and explanation. Oxford University

Press: New York. 434 pp.

Schmidt, H.A., and von Haeseler, A. 2009. Phylogenetic inference

using maximum likelihood methods. Pp. 181-198 in: Lemey, P.,

Salemi, M. and Vandamme, A.-M. (eds). The phylogenetic

handbook: a practical approach to phylogenetic analysis and

hypothesis testing. Cambridge University Press: New York.

Schulze, A. 2006. Phylogeny and genetic diversity of palolo worms

(Palola , Eunicidae) from the tropical North Pacific and the

Caribbean. The Biological Bulletin 210: 25-37.

Schurz, G. 2005. Explanations in science and the logic of why-

questions: discussion of the Halonen-Hintikka-approach and

alternative proposal. Synthese 143: 149-178.

Schurz, G. 2008. Patterns of abduction. Synthese 164: 201-234.

Sintonen, M. 2004. Reasoning to hypotheses: Where do questions

come? Foundation of Science 9: 249-266.

Sober E. 1975. Simplicity. Oxford University Press: New York. 189 pp.

Sober, E. 1986. Explanatory presupposition. Australasian Journal of

Philosophy 64: 143-149.

Sober, E. 1988. Reconstructing the past: parsimony, evolution, and

inference. MIT Press: Cambridge. 265 pp.

Sober, E. 1994. From a biological point of view: essays in evolutionary

biology. Cambridge University Press: New York. 268 pp.

Sperling, E.A., Vinther, J., Moy, V.N., Wheeler, B.M., Semon, M.,

Briggs, D.E., and Peterson, K.J. 2009. MicroRNAs resolve an

apparent conflict between annelid systematics and their fossil

record. Proceedings of the Royal Society of London. Series B,

Biological Sciences 276: 4315-4322.

Strahler, A.N. 1992. Understanding science: an introduction to

concepts and issues. Prometheus Books: Buffalo. 409 pp.

K. Fitzhugh

Struck, T.H., Paul, C., Hill, N., Hartmann, S., Hosel, C., Kube, M„

Lieb, B., Meyer, A., Tiedemann, R., Purschke, G., and Bleidorn,

C. 2011. Phylogenomic analyses unravel annelid evolution. Nature

471: 95-98.

Struck, T.H., Schult, N., Kusen, T., Hickman, E., Bleidorn, C., McHugh,

D. , and Halanych, K.M. 2007. Annelid phylogeny and the status of

Sipuncula and Echiura. BMC Evolutionary Biology 7: 57.

Thagard, P. 1988. Computational philosophy of science. The MIT

Press: Cambridge. 240 pp.

Thagard, P. 2004. Rationality and science. Pp. 363-379 in: Mele, A.

and Rawlings, P. (eds). Handbook of rationality. Oxford University

Press: Oxford.

Van Fraassen, B.C. 1990. The scientific image. Clarendon Press: New

York. 235 pp.

Vrijenhoek, R.C., Johnson, S.B., and Rouse, G.W. 2009. A remarkable

diversity of bone-eating worms (Osedax; Siboglinidae; Annelida).

BMC Biology T. 74-86.

Walton, D. 2004. Abductive reasoning. The University of Alabama

Press: Tuscaloosa. 303 pp.

Wheeler, W.C. 2012. Systematics: a course of lectures. Wiley-

Blackwell: Oxford. 426 pp.

Whitehead, A.N. 1925. Science and the modern world. Lowell

lectures, 1925. The Macmillan Company: New York. 212 pp.

Wiklund, H., Nygren, A., Pleijel, F., and Sundberg, P. 2008. The

phylogenetic relationships between Amphinomidae,

Archinomidae and Euphrosinidae (Amphinomida: Aciculata:

Polychaeta), inferred from molecular data. Journal of the Marine

Biological Association of the United Kingdom 88: 509-513.

Williamson, T. 2000. Knowledge and its limits. Oxford University

Press: New York. 340 pp.

Zanol, J., Halanych, K.M., and Fauchald, K. 2010. Phylogeny of the

bristle worm family Eunicidae (Eunicida, Annelida) and the

phylogenetic utility of noncongruent 16S, COI and 18S in

combined analyses. Molecular Phylogenetics and Evolution 55:

660-676.

Zrzavy, J., Rfha, P., Pialek, L., and Janouskovec, J. 2009. Phylogeny of

Annelida (Lophotrochozoa): total-evidence analysis of

morphology and six genes. BMC Evolutionary Biology 9: 189.

Memoirs of Museum Victoria 71:79-84 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

A new species of Exogone (Syllidae: Exogoninae) from off the state of Sao Paulo

(south-east Brazil)

MARCELO VERONESI FuKUDA 1,2 ’* (http://zoobank.Org/urn:lsid:zoobank.org:author:6BE36A7B-8997-451C-8DE5-35E0ED6F651D) AND

JOAO MlGUEL De Matos NoGUEIRA 1 (http://zoobank.org/urn:lsid:zoobank.org:author:C40C8C12-619D-4EC2-8998-253708120D3F)

1 Laboratories de Poliquetologia (LaPol), Departamento de Zoologia, Instituto de Biociencias, Universidade de Sao Paulo,

Rua do Matao, travessa 14, n. 101, 05508-900, Sao Paulo, SP, Brazil

2 Centro de Biologia Marinha, Universidade de Sao Paulo, Rodovia Manoel Hypolito do Rego, Km 131.5, 11600-000, Sao

Sebastiao, SP, Brazil

* To whom correspondence and reprint requests should be addressed. E-mail: mvfukuda@gmail.com

(http://zoobank.Org/urn:lsid:zoobank.org:pub:CAE05031-C022-4FC3-A61A-4DFE6ED698ED)

Abstract Fukuda, M.V. and Nogueira, J.M.M. 2014. A new species of Exogone (Syllidae: Exogoninae) from off the State of Sao

Paulo (south-east Brazil). Memoirs of Museum Victoria 71: 79-84.

We describe a new species of Exogone Orsted, 1845 (Syllidae: Exogoninae) found in dense populations in some

areas off the State of Sao Paulo (south-east Brazil). Exogone cebimar sp. nov. has an enlarged median antenna, dorsal cirri

present on all chaetigers, a triangular process on each of the shafts of spiniger-like chaetae of segments 1 and 2, and a short

proventricle, extending for two segments only. This new species is one of the subjects of ongoing studies dealing with the

characterisation of brooding methods found in the subfamily Exogoninae.

Keywords Araga Bay, polychaete, intertidal, rocky shore, CEBIMar

Introduction

Despite records existing for around 140 species, the syllid

fauna along the Brazilian coast is still considered largely

unknown, since most of the records come from material

collected from shallow waters off the south-eastern region of

the country, and mostly from soft bottoms. The northern coast

of the State of Sao Paulo, south-eastern (SE) Brazil, is one of

the best-studied regions for the polychaete fauna of the

intertidal zone, but even in this area it is not rare to find new

occurrences and species new to science in taxonomic studies.

During studies focused on the polychaete fauna occurring

off the State of Sao Paulo and, in particular, a recent research

into the diversity and reproductive features of the Syllidae

Grube, 1850, a new species of Exogone Orsted, 1845 was found.

This new species is abundant in the studied area, to

the extent that it has been chosen as one of the target species for

an ongoing research into the reproduction of Syllidae, being

representative of the ventral brooding of eggs and embryos

method found in the subfamily. Characterisation of this

reproductive process will be presented in subsequent papers.

Materials and methods

The material analysed came from three projects focused on

the biota occurring off the State of Sao Paulo. The first,

‘Biodiversity of intertidal polychaetes on rocky shores off the

State of Sao Paulo’ (‘BioPol’) sampled a range of beaches

comprehending most of the shoreline of Sao Paulo. The other

two projects, ‘Taxonomic study of the Syllidae (Annelida,

Polychaeta) in the Araga Bay and analysis of the incubation

modes in the Exogoninae’ and ‘Biodiversity and functioning

of a subtropical coastal ecosystem: a contribution to integrated

management’ (‘BIOTA - Araga’)’, are ongoing studies

conducted on the Araga Bay (Sao Sebastiao, Sao Paulo). This

bay is particularly important because it is very rich in terms of

biodiversity, but it is threatened by expansion plans for the

neighbouring Port of Sao Sebastiao.

In all projects, collections were made on rocky shores

from the intertidal zone at neap tides, mostly by scraping

different biological substrates (sponges, ascidians, algae, etc.)

from the rocks. In the laboratory, polychaetes were sorted

under a stereomicroscope, relaxed in a menthol solution, fixed

in 4% formaldehyde and, a few weeks later, rinsed in fresh

water and preserved in 70% ethanol.

Identifications were based exclusively on morphological

characters. Illustrations were done with the aid of a drawing

tube attached to an Olympus® BX-51 microscope. Length of

specimens was measured from the tip of the palps to the tip of

the pygidium, excluding anal cirri; width was measured at

proventricle level, excluding parapodia. Blade lengths for

M.V. Fukuda & J.M.M. Nogueira

compound chaetae are provided in dorso-ventral sequence.

For scanning electron microscope (SEM) observation,

specimens were dehydrated in a series of ethanol solutions

with progressively increasing concentrations up to 100%,

critical-point dried, covered with a 10-20 nm layer of gold,

and then observed under the SEM at the Laboratorio de

Microscopia Eletronica, Instituto de Biociencias, Universidade

de Sao Paulo.

Abbreviations

Abbreviations for museum names are as follows:

AM — The Australian Museum, Sydney, Australia

MNCN — Museo Nacional de Ciencias Naturales, Madrid,

Spain

MZUSP — Museu de Zoologia da Universidade de Sao Paulo,

Sao Paulo, Brazil

ZUEC — Museu de Zoologia da Universidade Estadual de

Campinas, Campinas, Brazil

ZMH — Zoologisches Museum Hamburg, Hamburg, Germany

Systematics

Family Syllidae Grube, 1850

Subfamily Exogoninae Langerhans, 1879

Genus Exogone Orsted, 1845

Type species. Exogone naidina Orsted, 1845.

Diagnosis. Relatively small, thin and slender bodies. Palps well

developed, completely fused or with terminal notch.

Prostomium ovate, with 2 pairs of eyes in trapezoidal

arrangement and, sometimes, 1 pair of anterior eyespots; 3

smooth antennae, all short and ovate, or at least median antenna

elongate, digitiform. Peristomium with 1 pair of peristomial

cirri. Dorsal cirri present on all chaetigers or absent on

chaetiger 2. Peristomial, dorsal and ventral cirri short,

papilliform to ovate. Compound chaetae with subdistally

inflated and spinulated shafts; in some species, shafts with

conspicuous subdistal triangular enlargement (‘triangular

process’) on spiniger-like chaetae of a few anterior parapodia.

Blades of falcigers usually spinulated, bidentate, distal tooth

smaller than subdistal one; dorsalmost compound chaetae

frequently with long and slender spiniger-like blades, with

short spinulation. In some species, compound chaetae

secondarily simple by fusion of shaft and blade, or by loss of

blade. Dorsal simple chaetae present from anterior body,

usually sigmoid, progressively stouter posteriorwards; dorsal

simple chaetae bayonet-like in some species. Ventral simple

chaetae usually present only on posteriormost chaetigers,

bidentate, distal tooth smaller than subdistal one. Aciculae

distally inflated, apparently hollow, with slightly bent tip.

Pygidium with one pair of anal cirri, usually longer than dorsal

cirri along body (San Martin, 2005).

Exogone cebimar sp. nov.

Zoobank LSID. http://z 00 bank. 0 rg/urn:lsid:z 00 bank. 0 rg:act:

0D7F6ADA-B2A7-469D-8594-E4D6240028C9

Figures 1-2, table 1.

Material examined. Project 'BIOPOL'. Sao Sebastiao - Praia do

Ara§a (23°48’54"S 45°24’24" W): 1 spec., 17 Apr 2003; 15 specs, 15Jul

2003; 18 specs, 25 Sep 2003; Praia Preta (23°49'16"S 45°24'35"W): 1

spec., 18 Apr 2003; 8 specs, 18 Jul 2003. Sao Vicente - Ilha Porchat

(23°58'39"S 46° 22 ’ 08 "W): 1 spec., 15 Jun 2003; Praia das Vacas

(23°58'55"S 46°2248"W): 1 spec., 16 May 2003.

Project “BIOTA-Ara§a\ Sao Sebastiao - Praia do Ara£a

(23°48’54"S 45°24'24"W): 2 specs, 18 May 2011; 16 specs, 25 Sep

2011; 6 specs, 21 Nov 2011; 6 specs, 22 Feb 2012; 72 specs, 7 May

2012; 19 specs, 30 Sep 2012; 75 specs (holotype, MZUSP1966;

paratype 1, MZUSP 1967; paratype 2, ZUEC-Pol 14101; paratypes,

MZUSP 1968), 1 Oct 2012; 2 specs, 2 Oct 2012.

Type material. Data of the holotype and two selected paratypes are

provided in table 1, all specimens collected by Project 'BIOTA-A raga;

1 Oct 2012.

Comparative material examined. Exogone lourei Berkeley and

Berkeley, 1938. Pacific Ocean, Australia - Western Australia, Goss

Passage, Beacon Island (28°25'30"S 113°47'E): 12 specs (AM

W26992), coll. P Flutchings, 22 May 1994, det. G. San Martin, 2001.

Atlantic Ocean, Cuba - Canarreos Archipelago, Isla de la Juventud,

Punta del Frances: 3 specs. (MNCN 16.01/630), leg. & det. G. San

Martin. Cape Verde - Sal Island, Joaquim Petinha: 3 specs. (MNCN

16.01/6909), coll. & det. G. San Martin, 8 Aug 1985.

Exogone multisetosa Friedrich, 1956. Pacific Ocean, Peru - Lima:

3 specs (ZMH P-15371, holotype; P-15372, paratypes), coll. Remane,

22 Jun 1952, det. Friedrich, 1956.

Description. Body usually orange in colour in live specimens,

thin and elongate, holotype largest specimen analysed, 7.78

mm long, 0.23 mm wide, with 46 segments (table 1). Palps

ovate, elongate, almost totally fused, with distal notch (figs 1A;

2A-B, D). Prostomium ovate, shorter than palps, with 2 pairs

of eyes in trapezoidal arrangement; anterior eyespots absent;

median antenna inserted slightly anterior to anterior pair of

eyes, elongate, almost reaching tip of palps, subdistally inflated,

distally tapering; lateral antennae inserted close to median

antenna but slightly anteriorly, ovate, short, almost 1/3 length

of median antenna (figs 1A; 2A-B, D). Peristomium slightly

shorter than subsequent segments; peristomial cirri ovate,

short, smaller than lateral antennae; nuchal organs as 1 pair of

dorsolateral short ciliated slits, close to border between

prostomium and peristomium (fig. 2E). Dorsal cirri present on

all chaetigers, ovate, slightly larger than peristomial cirri but

smaller than lateral antennae on anterior body, with slight

increase in size and more tapered distally, ovate to pyriform,

towards posterior body; ventral cirri similar to dorsal cirri of

corresponding parapodium but smaller, ~l/2-2/3 length of

corresponding parapodial lobe (fig. 2B-D). Parapodial lobes

conical (figs 1A; 2A-D). Shafts of compound chaetae

subdistally spinulated, spines arranged in thin rows on midbody

chaetae (fig. ID). Anterior and midbody parapodia with 1,

sometimes 2 spiniger-like chaetae each, posterior body

parapodia with single spiniger-like chaetae each; spiniger-like

chaetae of chaetigers 1 and 2 with subdistal short triangular

A new species of Exogone (Syllidae: Exogoninae) from off the State of Sao Paulo (south-east Brazil)

Table 1. Morphological variation among selected specimens of the type series of E. cebimar sp. nov. All specimens were collected at Praia do

Araga (23°48'54”S 45°24'24”W) on the rocky shore, intertidal zone, 1 Oct 2012.

Exogone cebimar sp. nov.

Holotype

MZUSP 1966

Paratype 1

MZUSP 1967

Paratype 2

ZUEC-Pol 14101

Number of chaetigers

Total length x width at proventricle (mm)

7.78 x 0.23

6.62 x -0.20

7.00 x -0.17

Length of blades of spiniger-like chaetae (//m)/number of spiniger-like

chaetae per parapodium

Anterior body

50-37/1

42-31/1

42-36/1

Midbody

45-32/1-2

42-35/1

45-35/1-2

Posterior body

-22/1

22-18/1

Length of blades of falcigers (//m)/number of falcigers per parapodium

Anterior body

10-7.5/5-6

10-7.5/5-7

Midbody

-75/3-4

Posterior body

-75/2-3

75-5/2-3

Length of pharynx (chaetigers)

Length of proventricle (chaetigers); number of muscle cell rows

2;-20

2;-21

process on shafts (figs 1B-C; 2F-G); blades spinulated,

inconspicuously bifid, 50-31 pm long on anterior body, 45-32

pm on midbody, 22-18 pm on posterior body (table 1). Anterior

parapodia with 5-7 falcigers each, midbody with 3-4, posterior

parapodia with 2-3 falcigers each; blades of falcigers bidentate

and spinulated (figs 1D-E; 2G); slight dorsoventral gradation

in length, blades 10-7.5 pm long on anterior body, -7.5 pm on

midbody, 7.5-5 pm long on posterior body (table 1). Dorsal

simple chaetae present from anterior body, sigmoid, subdistally

spinulated, with thin tip, progressively stouter posteriorwards

(figs 1F-G; 2H); ventral simple chaetae only present on

posteriormost chaetigers, sigmoid, bidentate, tips resembling

those of falciger blades, about as thick as dorsal simple chaeta

of corresponding parapodium (figs 1H; 21). Anterior parapodia

with up to 3 aciculae each, 2 of which are distally inflated,

apparently hollow, one straight, other distally oblique,

remaining acicula straight, distally tapering (fig. II); number of

aciculae per parapodium decreasing towards posterior body,

posterior parapodia with single acicula each, stouter than on

anterior body parapodia, distally inflated, with slightly oblique

tip (fig. 1J). Pygidium with elongate anal cirri, slightly longer

than median antenna (fig. 2C). Pharynx through 4-5 chaetigers,

anterior margin surrounded by -10 soft papillae (fig. 2D), inner

margin of pharynx chitinised; large conical tooth close to

opening; proventricle through -2 chaetigers, with -20 muscle

cell rows (fig. 1A; table 1).

Remarks. Exogone cebimar sp. nov. differs from all other

species in the genus by the following combination of characters:

median antenna longer than lateral ones, almost reaching tip of

palps, subdistally inflated, distally tapering; dorsal cirri present

on chaetiger 2; shafts of spiniger-like chaetae from chaetigers 1

and 2 subdistally with short triangular process; and proventricle

short, through -2 chaetigers.

Exogone cebimar sp. nov. belongs to a group of species with

a triangular process on the shaft of each spiniger-like chaeta of

some anterior body chaetigers. This group also includes E.

arenosa Perkins, 1981, E. lourei Berkeley and Berkeley, 1938, E.

multisetosa Friedrich, 1956, E. pseudolourei San Martin, 1991,

E. rostrata Naville, 1933, and E. uniformis Hartman, 1961. Of all

these species, however, only E. lourei has that process occurring

on both chaetigers 1 and 2, as in E. cebimar sp. nov., all other

species having it on a single chaetiger, either 1 or 2.

Exogone lourei , however, is a larger species, differing

from E. cebimar sp. nov. in having a longer proventricle,

extending for 4-5 chaetigers, instead of -2 chaetigers, as in E.

cebimar sp. nov. Furthermore, the triangular processes on the

shafts of spiniger-like chaetae of E. cebimar sp. nov. are

different from those of E. lourei and all other species in this

group, as in all other species it is a larger structure, frequently

larger than the width of the distal part of the shaft, and it is

inserted at 90° to the shaft, whereas in E. cebimar sp. nov., the

triangular processes are smaller, roughly pointed triangles

coming out of the shaft.

The chitinised lining of the pharynx in this species

frequently forms small fractures in the opening, probably due to

abrasion while feeding. In some cases, these fractures resemble

small teeth, as found in species that have a trepan, however, in

dissected specimens of Exogone cebimar sp. nov., we did not

see any sign of teeth other than the central pharyngeal tooth.

Etymology. The species is named after the ‘Centro de Biologia

Marinha da Universidade de Sao Paulo’ (‘CEBIMar - USP’),

whose facilities are used by many researchers working on

different marine-related fields. The existence of this institution

on the northern coast of the State of Sao Paulo can be considered

one of the main reasons for it being one of the best-studied

regions of the Brazilian coast.

M.V. Fukuda & J.M.M. Nogueira

Figure 1. Exogone cebimar sp. nov.: A, anterior body, dorsal view; B, spiniger-like chaeta, chaetiger 1; C, spiniger-like chaeta, chaetiger 2; D,

compound chaetae, anterior and midbody; E, compound chaetae, posterior body; F, dorsal simple chaeta, anterior body; G, dorsal simple chaeta,

posterior body; H, ventral simple chaeta; I, aciculae, anterior body; J, acicula, posterior body. Scale bars: A = 100 ja. m, B-H = 10 ji m.

A new species of Exogone (Syllidae: Exogoninae) from off the State of Sao Paulo (south-east Brazil)

Figure 2. Exogone cebimar sp. nov., SEM: A, anterior body, dorsal view; B, anterior body, ventral view; C, posterior body and pygidium, dorsal

view; D, anterior body, frontoventral view; E, peristomium, right-hand side dorsolateral view (arrow pointing to nuchal organ; ‘pc’, peristomial

cirrus); F, spiniger-like chaeta, chaetiger 2; G, detail of shafts, spiniger-like chaeta and falciger, chaetiger 2; H, dorsal simple chaeta, posterior

body; I, ventral simple chaeta. Scale bars: A = 70 jim, B = 48 jim, C = 42 jim, D = 50 ji m, E = 20 jim, F = 3.6 jim, G = 1 ji m, H = 5 ji m, 1=4 jm i.

M.V. Fukuda & J.M.M. Nogueira

Acknowledgements

We are grateful to the Project ‘BIOPOL’ team, and to Professor

Dr Cecilia Amaral (IB/UNICAMP), Professor Dr Gustavo

Muniz Dias (UFABC) and all the personnel involved in

Project ‘BIOTA-Ara 5 a\ We also thank the technicians Enio

Matos and Phillip Lenktaitis (IB/USP) and Lara Guimaraes

(MZUSP) for preparing specimens for the SEM studies and

for operating the SEM equipment. We are grateful to the staff

of the museums that housed animals analysed in this study,

particularly Dr Stephen Keable (AM), Dr Javier Sanchez

Almazan (MNCN), Dr Aline Staskowian Benetti (MZUSP),

Dr Tatiana Steiner (ZUEC) and Professor Dr Angelika Brandt

(ZMH). MVF receives a post-doctoral fellowship from

FAPESP—Funda 5 ao de Amparo a Pesquisa do Estado de Sao

Paulo (proc. 10/19424-7).

References

Berkeley, E., and Berkeley, C. 1938. Notes on polychaeta from the

coast of western Canada. 2. Syllidae. Annals and Magazine of

Natural History, London (Ser. 11) 1: 33-49.

Friedrich, H. 1956. Mitteilungen iiber neue und wenig bekannte

Polychaeten aus Mittel- und Siidamerika. Senckenbergiana

Biologica 37(1-2): 57-68.

Grube, A.E. 1850. Die Familien der Anneliden. Archiv fiir

Naturgescliichte 16: 249-364.

Hartman, O. 1961. Polychaetous annelids from California. Allan

Hancock Pacific Expeditions 25: 1-226.

Langerhans, P. 1879. Die Wiirmfauna von Madeira. Zeitschrift fiir

Wissenschaftliche Zoologie 33: 513-592.

Naville, A. 1933. Quelques formes epitoques d’annelides polychetes

nouvelles ou peu connues pechees a la lumiere dans la baie de Banyuls.

Annales des Sciences Naturelles, Paris (Ser. 10) 16: 171-208.

Orsted, A.S. 1845. Ueber die Entwicklung der Jungen bei einder

Annelide und ueber aeusseren Unterscheide zwischen beiden

Geschlechten. Archiv fiir Naturgeschichte 11(1): 20-23.

Perkins, T. 1981. Syllidae (Polychaeta), principally from Florida, with

descriptions of anew genus and twenty-one new species. Proceedings

of the Biological Society of Washington 93(4): 1080-1172.

San Martin, G. 1991. Grubeosyllis and Exogone (Exogoninae,

Syllidae, Polychaeta) from Cuba, the Gulf of Mexico, Florida and

Puerto Rico, with a revision of Exogone. Bulletin of Marine

Science 49(3): 715-740.

San Martin, G. 2005. Exogoninae (Polychaeta: Syllidae) from

Australia with description of a new genus and twenty-two new

species. Records of the Australian Museum 57: 39-152.

Memoirs of Museum Victoria 71:85-95 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

A review of the occurrence and ecology of dense populations of Ditrupa arietina

(Polychaeta: Serpulidae)

JOHN P. Hartley (http://zoobank.org/urn:lsid:zoobank.org:author:5C51172A-E84D-426C-918B-8DE2EAD48986)

Hartley Anderson Limited, Blackstone, Dudwick, Ellon, Aberdeenshire AB41 8ER, UK (jph@hartleyanderson.com)

Abstract Hartley, J.P. 2014. A review of the occurrence and ecology of dense populations of Ditrupa arietina (Polychaeta:

Serpulidae). Memoirs of Museum Victoria 71: 85-95.

Dense populations of the free-living serpulid Ditrupa arietina were first recorded to the west and north of the Shetland

Isles in the 1920s and have since been reported from the Celtic and North Seas, the Armorican shelf, the Mediterranean and

the Azores. These dense populations (of many thousands per square metre) numerically dominate the benthic fauna, and the

tubes provide sites of attachment for a range of other species. Vacated tubes are also occupied by other animals, and tube

fragments can contribute significantly to biogenic carbonate sediments, both Recent and fossil. Dense Ditrupa populations

have been the subject of detailed autecological research over the last 15 years, but in spite of the apparent ecological importance

of the species, it is not reflected in the European Nature Information System (EUNIS) or other North-east (NE) Atlantic

habitat classifications. This paper provides a synthesis of the environmental conditions where high densities of Ditrupa have

been found, with new data from seabed samples and photos. Ditrupa appears to occupy different habitats in the NE Atlantic

and the Mediterranean, and studies of its morphology and genetics are needed to determine if there is a taxonomic basis to

this ecological separation. Although the evidence is sparse, it is concluded that, in the NE Atlantic, dense populations of

Ditrupa are found in areas where the seabed is periodically disturbed by internal wave action. European and other habitat

classification schemes require revision to reflect the areas of occurrence and benthic effects of internal waves.

Keywords polychaete. North-east Atlantic, Mediterranean, faunal assemblage, habitat classification, EUNIS, disturbance, internal waves

Introduction

The free-living serpulid polychaete Ditrupa arietina (O.F.

Muller, 1776), was described from material probably from

Norway or Denmark (ten Hove and Smith, 1990). Until 1990,

it was generally considered to have a cosmopolitan distribution;

ten Hove and Smith (1990) clarified the taxonomy of the genus

and concluded that the distribution of D. arietina was boreal

to subtropical East Atlantic. The genus is of geological

importance, with extensive fossil deposits (see, for example,

Dominici, 2001 and Martinell et al., 2012) and makes

significant contributions to some Recent biogenic carbonate

sands and gravels (see Wilson 1979, 1982). Ecologically, the

tubes provide sites of attachment for other taxa, including

solitary corals, other serpulids, foraminiferans and bryozoans

(see McIntosh, 1923; Wilson, 1976), while vacated tubes are

occupied by a range of animals (see Myers and McGrath,

1979; Wilson, 1982). Predators of the species are poorly

known, with the exception of flatfish (Rae, 1956) and naticid

gastropods, which leave characteristic drill holes (Grey et ah,

2005). The species can achieve very high densities (—11,000/

m 2 ) (Gremare et ah, 1998) and has been listed as characteristic

of some benthic assemblages (e.g. Stephen, 1923; Glemarec,

1969; Labrune et ah, 2007a) although it is not listed in any

assemblage in EUNIS (European Nature Information System),

a pan-European classification of marine, freshwater and

terrestrial habitats (http://eunis.eea.europa.eu/about.jsp). This

review of the occurrence of dense populations of D. arietina

and whether it is a characterising species of particular habitat

types was prompted by finding the species in great abundance

during a regional survey of the northern North Sea, within a

faunal assemblage that closely matched that described by

Stephen (1923).

Benthic assemblages characterised by high densities of

Ditrupa arietina

Fig. 1 shows the distribution of records of high densities of

Ditrupa from the North-east (NE) Atlantic and Mediterranean

(where positions or maps were given), and for convenience the

records are summarised below by geographic area. Greater

emphasis is placed on the NE Atlantic records (including

previously unpublished data) as a series of recent papers

describe and discuss the occurrence of high densities of

Ditrupa in the Mediterranean.

J.P. Hartley

NE Atlantic records of high densities of Ditrupa arietina

The first quantitative benthic study to report high densities of

Ditrupa was by Stephen (1923, as Ditrupa subulata = arietina ).

He sampled extensively across the central and northern North

Sea and to the west of Scotland using a Petersen grab and an

~1.5mm sieve. Stephen (1923) distinguished a series of faunal

community types, including a Ditrupa community to the north

and west of Shetland with two variations: pure Ditrupa (at up

to 720/m 2 cited in the text and 360/m 2 listed in Table VI)

described as “very barren with few other forms being found

where it occurs”, and Ditrupa with Ophiura affinis, described

as “a mingling of Ditrupa subulata with the Ophiura affinis

community”. McIntosh (1869) had earlier noted Ditrupa (as

Ditrypa ) to be “abundant” off Shetland, from dredgings made

around the islands in 1867 and 1868, but without quantification.

Since he lists some other species as “very abundant” it is here

considered that these densities of Ditrupa were not exceptional.

McIntosh (1923) also recorded the species as abundant, but as

he cited Crawshay (1912), who reported a single specimen from

the western English Channel, again it is concluded that the

densities were not particularly high.

Le Danois (1948) described a “facies a Dentales” from

around the shelf edge of the Celtic Sea and off North Gascony

with the scaphopod Dentalium and solitary coral Caryophyllia

listed as characteristic taxa. In his list of the fauna of the shelf

edge facies, Ditrupa was included (along with several other

serpulid taxa) under ‘epifauna’; Ditrupa was also included in

lists of the principal fauna of the muddy facies of the Atlantic

slope and of the semi-abyssal zone. In Supplement 1 to Le

Danois’s book, Ditrupa was not indicated to be either a facies

characterising or a most important species, suggesting that it

had not been found in great abundance.

Glemarec (1969) summarised the benthic faunal

communities present off the North Gascony coast and mapped

(his Fig. 1) a broad area of the outer Armorican shelf as

comprising Ditrupa sands (“sables a alenes”). These were

described as “sables roux a pointes d’alenes” with a median

diameter of 270-400 pm and a zoogenic calcium carbonate

content of >50%. Glemarec (1969) included (his Fig. 2) a

seabed photo showing numerous Ditrupa tubes but did not give

densities. The community was considered equivalent to the

facies “a Dentales de la bordure continentale” distinguished by

Le Danois (1948). This could be a suggestion that Le Danois’s

“Dentales” also included Ditrupa , although the difference

could also reflect a major increase in Ditrupa densities in the

decades between the surveys. Glemarec (1973), in his

consideration of the European North Atlantic shelf benthic

communities, included similar information on the Ditrupa

arietina/Dentalium entalis community (of open sea etage fine

sands) to that in Glemarec (1969) and Le Danois (1948) but

again without densities; surprisingly, Stephen’s (1923) report of

a Ditrupa community widespread off Shetland was not cited.

A survey of the benthic fauna of the Celtic Sea was

undertaken in 1974 and 1975 with the results given in a limited

circulation report (Hartley and Dicks, 1977) and mollusc

records published by Hartley (1979). Ditrupa was present at

20 of 86 stations sampled, with very high densities found at

three sites off south-west (SW) Ireland sampled in May/June

1975 from the RV Challenger , summarised in table 1. The

trawl at station C27 recovered some 14,800 live Ditrupa, and

previously unpublished quantitative data from two 0.1m 2 grab

samples from station C26 are given in table 2, where Ditrupa

comprised 84% of the fauna retained on a 1mm mesh.

The fauna from the trawl at station C31 suggests some

temporal persistence of the population, with a mix of living

Ditrupa and vacated tubes occupied by other species or living on

them. Of the 624 Ditrupa tubes retained by the trawl, 173 (28%)

contained live D. arietina, 214 (34%) contained the amphipod

Siphonoecetes striatus and 22 (4%) contained the sipunculan

Phascolion strombus. In total, over 50% of empty tubes were

occupied by other taxa, and the tubes frequently had the coral

Caryophyllia smithii (35,6%) or the serpulid Hydroides norvegica

(18,3%) attached. These observations and others (e.g. Gambi and

Jerace, 1997; Morton and Salvador, 2009 ; Ferrero-Vicente et al.,

2014) emphasise the importance of living and empty Ditrupa

tubes as a habitat. The high densities of Ditrupa at some Celtic

Sea stations were also noted by Dicks and Hartley (1982); they

commented that the reasons for the establishment of such high-

density, low-diversity communities in shelf depths were unclear.

Wilson (1982) suggested that Ditrupa arietina was the most

important indicator species characteristic of the rippled sands of

the ocean-facing outer continental shelf in the weak current

areas of the western Celtic Sea and to the west of Brittany and

Scotland. He noted that data on the density and distribution of

Ditrupa were sparse, although to the west of Scotland the

species occurred in discrete patches with densities of up to

1600/m 2 . Wilson et al. (1983) obtained “several thousand live

Ditrupa ” from an anchor box dredge sample taken in September

1979 from a sand patch ~59 km west of the Hebrides. Dyer et al.

(1982) noted and illustrated with a seabed photo taken in 1978,

high densities of Ditrupa to the west of Shetland and indicated

that Ditrupa and the echinoid Cidaris were characteristic of the

area. Cranmer et al. (1984) also reported that Ditrupa was

common and locally abundant in the area.

A stratified random regional survey of the East Shetland

Basin of the North Sea was undertaken in July 2007 with

samples obtained by 0.1m 2 Day grab from 86 stations (Hartley

Anderson Ltd, 2008). Ditrupa was present at 24 stations,

typically at low densities, but at stations 26, 28 and 40 it

numerically dominated the fauna retained on a 1mm mesh (see

tables 3, 4, 5 and 6 and fig. 2).

The two stations (26 and 28) with the highest densities of

Ditrupa are species-rich and have an abundant fauna, with

above survey average S (110 taxa) and N (909 individuals/0.1

m 2 , n = 69). Thus the fauna is not high density, low diversity,

as found in the NW Mediterranean (H’ of ~2.5, Labrune et al.,

2007a) and in the Celtic Sea (table 2). This suggests that in the

northern North Sea at least, dense populations of Ditrupa can

establish (by larval settlement and/or post larval redistribution)

in the presence of an existing and diverse fauna, and in the

presumed absence of significant physical disturbance. In

addition, the station 26 and 28 results indicate that the presence

and feeding activities of Ditrupa do not lead to a significant

loss of diversity in the other fauna. The numerically important

taxa listed in tables 5 and 6 show a good degree of commonality

A review of the occurrence and ecology of dense populations of Ditrupa arietina (Polychaeta: Serpulidae)

Table 1. Details of high Ditrupa density stations in the Celtic Sea (Hartley and Dicks, 1977).

Station number

Sampling gear

Location

Depth (m)

Sediment type (visual

observation)

C26

Agassiz trawl

0.1 m 2 Day grab (x2)

50°5T48”N

08°29T8”W

113

Muddy sand

C27

Agassiz trawl

50°57'54”N

08°42'0”W

110

Mud, sand, gravel,

shells

C31

Agassiz trawl

0.1 m 2 Day grab

50 o 42'12”N

09°17'48”W

126

Sand, shells

Figure 1. Records of high densities of Ditrupa from the North-east Atlantic and Mediterranean Sea. 1, Stephen (1923). 2, Glemarec (1969). 3,

Hartley and Dicks (1977). 4, Dyer et al. (1982). 5, Gambi and Giangrande (1986). 6, Gremare et al. (1998). 7, Cosentino and Giacobbe (2006). 8,

Hartley Anderson Ltd (2008). 9, Labrune et al. (2007a). 10, Gardline (2009). 11, Morton and Salvador (2009). 12, Wilson et al. (1983).

between stations (particularly stations 26 and 28, which

clustered at >70% similarity in classification analysis) (Hartley

Anderson Ltd, 2008). The use of 0.5mm and 1mm sieves

results in some differences in the lists of numerically important

taxa, but regardless of mesh size and the presence of juveniles.

especially in the 0.5mm sieve data, the faunal dominance of

Ditrupa is evident at stations 26, 28 and 40. The occurrence in

abundance of the solitary coral Caryophyllia smithii where

numerous Ditrupa tubes are present agrees with the findings

of Wilson (1976).

J.P. Hartley

Table 2. Total fauna from two 0.1m 2 grab samples from Celtic Sea

survey station C26 (see Hartley and Dicks, 1977; nomenclature has

been updated).

Station C26

Grab 1

Grab 2

Ditrupa arietina

377

741

Myriochele spp. agg.

Echinoidea juv.

Anthozoa juv.

Echinocyamus pusillus

Siphonoecetes striatus

Ophiura ajfinis

Phaxas pellucidus

Ophiuridae juv.

Aspidosiphon muelleri

Abra nitida

Hilbigneris gracilis

Amphictene auricoma

Owenia jusiformis

Amphipoda indet.

Ampelisca indet.

Ampharetidae juv.

Magelona sp.

Paranymphon spinosum

Atelecyclus rotundatus

Corbula gibba

2/0.1 m 2

446

885

Seabed photos taken at a site at 75 m depth in the central

North Sea showed numerous Ditrupa tubes lying on the sediment

surface (Gardline 2009, site JRP). Grab samples at the site

indicated a Ditrupa density of 390/m 2 in moderately sorted fine

sand with a mean grain size of 157 pm and a silt/clay content of

6.7% (ERT, 2009). This is considered to be a small patch of

Ditrupa, as photos and samples from 16 other stations within 8

km showed the species to be absent or rare, which is consistent

with the results of numerous macrofaunal surveys in the region

(Rees et al., 2007, UK Benthos database and unpublished data).

Morton and Salvador (2009) reported Ditrupa at M00-250

m depth off the Azores, and as a significant component of the

fauna at depths of ~200 m; the samples were taken by dredge

and quantitative density information was not included. They

highlighted the different depth zones of Ditrupa occurrence

between the Mediterranean and the Azores and suggested this

may be related to differences in light penetration or food

availability, or other factors such as sediment type or

disturbance. Morton and Salvador (2009) also illustrate (their

Fig. 4A 1 ) and describe the live position of the worm (with the

majority of the tube buried in the sediment) and indicate that,

when placed on sediment, worms attempt to re-burrow. This

contrasts with the range of published seabed photographs

showing tubes lying at the sediment surface and would call into

question the findings of Guizien et al. (2010) of Ditrupa spatial

redistribution caused by swell-induced bed load transport.

Ellis et al. (2002, 2013) in a regional beam trawl study of the

epifauna of the Celtic Sea noted that Ditrupa was very abundant

at a number of sites and that it “was abundant off south-western

Ireland at depths of 102-305 m”. Ellis et al. (2002) listed Ditrupa

in the dominant fauna associated with a Pagurus prideaux-

Poraniapulvillus assemblage of the southern Celtic Sea; a similar

assemblage and its occurrence was described by Ellis et al. (2013),

although Ditrupa was not listed in the dominant fauna.

Selected UK and North Sea areas where Ditrupa arietina

is absent

Based on detailed regional surveys, it is apparent that Ditrupa

is absent from some areas, such as the southern North Sea

(Degraer et al., 2006; Daan and Mulder, 2006; Diesing et al.,

2009; Tappin et al., 2011) and the Irish Sea (Bruce et al., 1963;

Mackie et al., 1995; Robinson et al., 2009; Hartley Anderson

Ltd, 2009). These areas coincide with non-stratified waters or

areas of shallow stratification and suggest that in the North

Atlantic Ditrupa is restricted to Glemarec’s (1973) open sea

etage, where annual thermal variations are small; this is in

apparent contrast to the situation in the NW Mediterranean,

where dense populations of Ditrupa are found in shallow 10-

30 m coastal waters where bottom water temperatures have an

~10°C annual variation (Charles et al., 2003, their Fig. 9).

Regional epifaunal surveys of the North Sea undertaken using

beam trawls (Jennings et al., 1999; Callaway et al., 2002) did

not report Ditrupa, even in areas of known occurrence; this is

believed to reflect the sampling method.

Mediterranean records of high densities of Ditrupa arietina

Ditrupa was historically considered to be an uncommon

species in the Mediterranean, although a dramatic increase in

abundance along the NW Mediterranean coast occurred

around 30 years ago. Gremare et al. (1998) reported high

densities (>1000/m 2 ) of Ditrupa arietina at all sites sampled in

surveys off the Catalan coast carried out in the 1990s, with

maximum densities of 11,086/m 2 , accounting for as much as

79% of total macrofaunal abundance and biomass. Ditrupa

was predominantly found in depths of between 20 and 30 m in

well-sorted fine sands and muddy sands. Gremare et al. (1998)

concluded that Ditrupa abundance had recently increased all

along the Catalan coast (as there were few reports of the species

in the area before 1970) and that the increase was not due to

sediment instability but rather to a reduction in silt/clay in the

sediment due to increased frequency of easterly storms. Sarda

et al. (2000) also reported a significant increase in Ditrupa

numbers in a shallow water area off the mouth of the Tordera

River (Catalan coast) following the removal of sand by suction

dredging for beach replenishment. The dredging defaunated

the sediments and changed their grain size composition; fine

sands redistributed over the winter after cessation of dredging

and in spring were densely colonised by a range of species,

including Ditrupa, which attained densities of ~2800/m 2 .

A review of the occurrence and ecology of dense populations of Ditrupa arietina (Polychaeta: Serpulidae)

Table 3. Details of the highest Ditrupa density stations in the northern North Sea (Hartley Anderson Ltd, 2008).

Station

number

Location

Depth (m)

Sediment type

S a

N a

H’(log 2 )

Ditrupa % of total fauna

61.216492° N

0.795038° E

166

Very poorly sorted fine sand

119

1093

4.9

43 (1 mm)

22 (0.5 + 1 mm)

61.236048° N

0.855043° E

167

Very poorly sorted fine sand

128

1222

4.8

49 (1 mm)

26 (0.5 + 1 mm)

61.024875° N

0.750020° E

156

No data

472

5.1

23 (1 mm)

12 (0.5 + 1 mm)

60.999035° N

0.618103° E

151

Poorly sorted fine sand

615

5.2

2 (1 mm)

3 (0.5 + 1 mm)

a Numbers from 0.1 m 2 sieved on 0.5mm mesh

Table 4. Sediment characteristics for highest Ditrupa density stations in the northern North Sea (Hartley Anderson Ltd, 2008)

Station

Carbonate %

Organic

Mean diameter

(Am)

Coarse %

(>2 mm)

Fine %

(<63 pm)

Silt

Clay

30.99

0.94

141

2.19

15.86

11.79

4.07

30.09

0.73

159

1.64

14.76

11.04

3.72

30.43

0.56

240

0.21

6.98

4.67

2.31

Figure 2. Photo of East Shetland Basin survey station 28 sample with numerous Ditrupa tubes; also visible are the solitary coral Caryophyllia

smithii (red arrow) and the foraminiferan Astrorhiza arenaria (yellow arrow).

J.P. Hartley

Table 5. The ten most abundant taxa (by rank) in metazoan fauna >0.5

mm at the highest Ditrupa density stations in the northern North Sea.

Densities are numbers per 0.1 m 2 (Hartley Anderson Ltd, 2008).

Station 26 £ 1093/0.1 m

Station 40 £472/0.1 m 2

Ditrupa arietina

243

Ditrupa arietina

Minuspio cirrifera

146

Aricidea wassi

Ophiura ajfinis

100

Minuspio cirrifera

Spiophanes kroyeri

Euchone sp. 1

Myriochele spp. agg.

Echinocardium juv.

Owenia Jusiformis

Aricidea wassi

Spiophanes bombyx

Eclysippe cf. vanelli

Echinocyamus pusillus

Axinulus croulinensis

Poecilochaetus serpens

Glycera lapidum

Glycinde nordmanni

Aonides paucibranchiata

Ampharetidae juv.

Echinocardium juv.

Station 28 £1222/0.1 m

Station 42 £615/0.1 m 2

Ditrupa arietina

322

Minuspio cirrifera

174

Myriochele spp. agg.

Ophiura afftnis

Aricidea wassi

Echinocardium juv.

Ophiura ajfinis

Spiophanes kroyeri

Echinocardium juv.

Eclysippe cf. vanelli

Spiophanes kroyeri

Ampharetidae juv.

Owenia jusiformis

Axinulus croulinensis

Euchone sp. 1

Mugga wahrbergi

Ditrupa arietina

Poly noidae juv.

Echinocyamus pusillus

Myriochele spp. agg.

Paraonides sp. 1

Euchone sp. 1

Medernach et al. (2000) investigated the ecology of these

dense populations of Ditrupa and reported the species has a

2-year life span, starts breeding in its first year, has two

spawning periods in a year, a planktonic larval stage lasting

~6 weeks, with high larval mortality on initial benthic

settlement. Charles et al. (2003) extended these studies and

found that settling larvae do not show sediment grain size

selectivity, and concluded that the observed spatial

heterogeneity in the density and structure of adult populations

was mainly due to post-settlement processes. Charles et al.

Table 6. The ten most abundant taxa (by rank) in metazoan fauna >1.0

mm at the highest Ditrupa density stations in the northern North Sea.

Densities are numbers per 0.1 m 2 (Hartley Anderson Ltd, 2008).

Station 26 £562/0.1 m 2

Station 40 £242/0.1 m 2

Ditrupa arietina

243

Ditrupa arietina

Ophiura ajfinis

Spiophanes kroyeri

Echinocardium juv.

Owenia jusiformis

Spiophanes kroyeri

Spiophanes bombyx

Minuspio cirrifera

Echinocardium juv.

Euchone sp. 1

Echinocyamus pusillus

Eclysippe cf. vanelli

Minuspio cirrifera

Caryophyllia smithii

Ampharetidae juv.

Glycera lapidum

Euchone sp. 1

Praxillella ajfmis

Polydora sp.

Polycirrus arcticus

Urothoe elegans

Cirolana borealis

Yoldiella philippiana

Eudorella truncatula

Yoldiella philippiana

Station 28 £659/0.1 m 2

Station 42 £257/0.1 m 2

Ditrupa arietina

322

Echinocardium juv.

Ophiura ajfinis

Owenia jusiformis

Echinocardium juv.

Ophiura ajfinis

Spiophanes kroyeri

Myriochele spp. agg.

Caryophyllia smithii

Spiophanes kroyeri

Minuspio cirrifera

Euchone sp. 1

Eclysippe cf. vanelli

Echinocyamus pusillus

Polycirrus arcticus

Minuspio cirrifera

Yoldiella philippiana

Chone longocirrata

Ampharetidae juv.

Spiophanes bombyx

Euchone sp. 1

Pseudopoly dora

paucibranchiata

Urothoe elegans

(2003) indicate a planktonic larval stage of 3 weeks (abstract)

and ~4-5 weeks (text).

Labrune et al. (2007a), in a regional scale survey of the

Gulf of Lions (NW Mediterranean), found from cluster

analysis that Ditrupa was the numerically dominant polychaete

in cluster I, comprising sands (fine to very fine sands with

~10% silt/clay from their Fig. 4) in 10-20m depth (average

density of 616/m 2 ) and one of the dominants (average density

of 100/m 2 ) in cluster Ila (stations in depths of 30 m in the west

of the survey area, fine sands with ~20% silt/clay). Labrune et

A review of the occurrence and ecology of dense populations of Ditrupa arietina (Polychaeta: Serpulidae)

al. (2007b) revisited the conclusions of Gremare et al. (1998)

on the causes of increased Ditrupa abundance and proposed

that they were in fact due to greater sediment stability linked

to a reduction in the frequency of storms. Guizien et al. (2010)

expanded the studies of these Ditrupa populations with field

and lab flume experiments to investigate the hydrodynamic

mobility of the animals in swell-induced currents. They found

that normal tidal currents were not sufficient to transport

animals with tubes >6 mm, but that moderate swell-induced

currents could result in bed load transport of tubes of up to

25mm length. Field sampling before and after a swell event

indicated hydrodynamic redistribution of animals, with

significant losses or gains in densities of different size classes

at some stations sampled; these changes were not linked to

larval recruitment but to the translocation of adults. Guizien et

al. (2010) considered that Ditrupa was epifaunal, without

organs to allow burrowing or surface movement, was tolerant

of sediment disturbance, and in shallow waters may not strictly

be a sedentary species.

Dense populations of Ditrupa were reported from the

Tyrrhenian Sea by Gambi and Giangrande (1986) and from its

southeastern boundary (the Strait of Messina) by Cosentino

and Giacobbe (2006). Gambi and Giangrande (1986) sampled

around the mouths of the Rivers Tiber and Ombrone and listed

Ditrupa as a characterising species in two station clusters:

cluster C, comprising mixed sediments in water depths of

15-30 m off the Tiber, and cluster A, including fine and very

fine sands in 5-10 m off the Ombrone. The samples were taken

with a Charcot dredge, and their data are therefore considered

semi-quantitative; the abundance data in their Table 1 are

without area units. Cosentino and Giacobbe (2006) report

high densities of Ditrupa (>500/0.25 m 2 ) in muddy sands

(~20% mud) in depths of 35-45 m, where it made up nearly

80% of the polychaete and mollusc fauna. They variously

describe the species as being eurytopic (an indicator of high

sedimentation rates) and mud-tolerant. Cosentino and

Giacobbe (2006) suggest several possible causes for the high

Ditrupa density, including episodic high sediment load inputs

as a result of terrestrial floods, and sediment disturbance/

induced instability from pipeline installation. They note the

transitory nature of the dense Ditrupa population found in

their 1992 survey, with declines in abundance in the 1993 and

1995 surveys and an absence of living Ditrupa or dead tubes

in 1999; this suggests that significant sediment movement(s)

had occurred in the area, since complete empty tubes would be

expected to endure for several years before fragmenting.

Discussion

The enigmatic discrepancies in the patterns of distribution and

abundance of Ditrupa between the NE Atlantic and the

Mediterranean raise a number of questions. In the NE Atlantic,

the species has a wide distribution in waters that strongly

stratify thermally (and is apparently absent from waters that

do not and in more enclosed basins), with high densities

typically found on ocean-facing outer continental shelves and

upper slopes. In the Mediterranean, Ditrupa was considered

uncommon until about 30 years ago but since then it has been

widely recorded as a (or the) faunal dominant in shallow

waters (typically ~10-30 m depth) of the NW Mediterranean

and Tyrrhenian Sea.

This apparent ecological difference may point to the

presence of two or more cryptic species, or the presence of an

unrecognised introduced species in the Mediterranean.

Ditrupa tube shape and free-living habit are distinctive and in

routine surveys tend to be used for identification without

examining the morphology of the worm inside. The

Mediterranean examples examined by ten Hove and Smith

(1990, from 40-50 m depth in the Baie de Cavalaire) consisted

of empty tubes. Ten Hove and Kupriyanova (2009) note that

the colour of the animals may be useful for serpulid species

discrimination in the field but caution that there is inter- and

intraspecific variability and that colour is rapidly lost in fixed

material. Tantalisingly, there appears to be a difference in

living Ditrupa branchial crown colouration from off Madeira

(pallid in Fig. 1A in ten Hove and Kupriyanova, 2009) and

those from the NW Mediterranean illustrated by Guizien et al.

(2010, with red spots in their Fig. la). Investigations of the

comparative morphology and genetics of specimens from the

shallow Mediterranean and deeper NE Atlantic are now

needed to resolve this enigma. The Ditrupa sequences

currently in GenBank are all derived from Mediterranean

material (from Banyuls, Kupriyanova et al., 2006; Kupriyanova

and Rouse, 2008; and from Collioure, Lehrke et al., 2007).

An alternative explanation for the apparent ecological

difference and absence from northern non-stratified waters is

the thermal tolerance of the species, possibly in relation to

winter minimum temperature, which in the southern North

Sea can be ~4°C. Annual temperature variation seems an

unlikely candidate, since Charles et al. (2003) illustrated an

~10°C range for the NW Mediterranean, which is similar to

that recorded for the Celtic Sea.

There is a paucity of published detail on the sediment

types occupied by dense Ditrupa populations, with a reported

range from medium through very fine sands with a variable

proportion of mud (<63 pm), to muds. However, sediment type

may not be a key determining factor, based on the findings of

Charles et al. (2003) that settling larvae do not show sediment

grain size selectivity, and the density and structure of adult

populations was mainly due to post-settlement processes.

Areas where dense populations of Ditrupa have been

reported are subject to periodic sediment disturbance; in the

shallow waters of the Mediterranean such disturbance has

been attributed to storms (Gremare et al., 1998; Guizien et al.,

2010), other physical processes, including strong tides,

floodwaters and seismic activity (Cosentino and Giacobbe,

2006), or human activities such as sand extraction (Sarda et

al., 2000) and pipeline installation (Cosentino and Giacobbe,

2006). In contrast, the areas of the NE Atlantic where abundant

Ditrupa have been found are in water depths where storm-

wave-induced oscillatory currents would not result in sediment

disturbance (Draper, 1967) or be affected by strong tides,

flood waters or seismic activity. Trawling is an additional

source of sediment disturbance that could facilitate the

establishment of high population densities of Ditrupa by

disrupting elements of the existing benthic community.

J.P. Hartley

However, in view of the extensive and long-term trawling that

has occurred in the North Sea and the general absence of

records of abundant Ditrupa in numerous benthic surveys, this

does not appear to a major factor.

A source of sediment disturbance that does not seem to

have been considered in previous discussions of dense Ditrupa

populations is internal waves. These energetic phenomena are

of global occurrence in waters with strong density gradients,

and Jackson (2004) includes examples from all the areas

considered earlier in this paper except the Tyrrhenian Sea.

However, Nash and Mourn (2005) identified river plumes as a

source of internal waves, which indicates they could affect the

areas studied by Gambi and Giangrande (1986). Pomar et al.

(2012, see also Pomar et al., 2013) reviewed the major effects

of internal waves on sediment mobilisation, structures and the

sedimentary record. In the Celtic Sea (and Armorican shelf),

the areas of high Ditrupa abundance appear to correspond

with those influenced by internal waves, which occur during

the summer months (July to September), when a well-

developed thermocline is present (Pingree and Mardell, 1981;

Jackson, 2004). Internal waves near the Celtic Sea shelf break

have been observed to amplify spring barotropic tidal currents

to in excess of 100 cm s 1 and may be important in modifying

sediment transport rates (Heathershaw, 1985). As the Celtic

Sea internal waves are seasonal, the sediment disturbance they

cause may be an important factor in the establishment of dense

populations of Ditrupa. Sediment disturbance may promote

high Ditrupa densities in two ways: disruption of the

established benthic fauna, allowing successful recruitment of

large numbers of Ditrupa larvae; and through post-settlement

redistribution and concentration in areas of deposition. The

variability of internal wave occurrence, intensity and depth of

impingement on the seabed (reflecting the variability of the

seasonal and permanent pycnoclines) can be conjectured to

explain why dense populations of Ditrupa near the shelf break

appear to occur in patches rather than a continuous band.

However, the Celtic Sea areas where Ditrupa occurs in

abundance appear to be consistent with the near shelf break,

where mixing by internal tide breaking results in a

phytoplankton community dominated by picoeukaryotes and

other larger phytoplankton, and which is distinct from that of

adjacent oceanic and shelf areas (Green et al., 2008; Sharpies

et al., 2009). Sharpies et al. (2009) indicate that the internal

tide occurs regularly throughout the stratified season (April to

September) and propose links to it, and its effects, on the

timing of fish spawning, larval feeding, and the export of

particulate organic matter out of the photic zone. Therefore, a

possible alternative explanation for Ditrupa abundance in

parts of the Celtic Sea is the seasonally enhanced food supply

(plankton-derived particulate organic matter), which the life

history of the species allows it to exploit effectively through

post-larval redistribution into areas of particulate organic

matter settlement. Charles et al. (2003) indicate that in the

NW Mediterranean, the great bulk of Ditrupa larval settlement

occurs in April to May (the spawning period in the NE

Atlantic), and the environmental cues triggering it are not

known, but, based on water temperatures, later spawning in

the Celtic Sea can be conjectured.

Other NE Atlantic shelf edge areas and islands where dense

populations of Ditrupa have been reported also develop seasonal

thermoclines, have permanent thermoclines or have pycnoclines

at the interface between different water masses. Therefore,

sediment disturbance through internal wave breaking is

proposed as a likely major contributory factor to the occurrence

of such populations, potentially also linked to seasonal

enhancement of plankton-derived food supply. The maps

illustrating shelf edge surface chlorophyll peaks around the

British Isles in Pingree and Mardell (1981, their plates 1 and 2)

and Sharpies et al. (2009, their Fig. 1) indicate areas of search

for dense Ditrupa populations in future sampling exercises.

There do not appear to be any published time-series of

benthic surveys of NE Atlantic areas where dense Ditrupa

populations have been found. As a consequence, much of this

discussion has relied on extrapolation from shallow-water

Mediterranean evidence, which may not be applicable to

deeper waters of the outer shelf and upper continental slope.

Repeated sampling is required to better document the ecology

of NE Atlantic Ditrupa populations and their role in

characterising the benthic assemblages of the continental

shelf. The different sampling methods used are a confounding

variable in perspectives on benthic assemblages with Ditrupa.

In particular, the sieve mesh used influences perceptions of the

species composition and relative diversity of associated fauna

(compare Stephen’s (1923) results from a ~1.5 mm sieve with

those from 1.0mm and 0.5mm meshes in tables 5 and 6 above).

Similarly, trawl samplers may not retain Ditrupa unless they

clog with sediment or have a fine mesh liner; thus it is uncertain

if Ditrupa was not common in the wide area of the northern

North Sea surveyed by Basford et al. (1989) or just not sampled.

Eleftheriou and Basford (1989) did not include uncommon

taxa in the interpretation of their regional grab survey of the

northern North Sea, and since Ditrupa was not mentioned, it

is assumed that it was not abundant in their samples. Seabed

photography is valuable in documenting Ditrupa presence and

density, ideally augmented with physical sampling to allow

distinction between live animals and empty tubes. It is not

known whether the difference in relative faunal diversity

apparent between samples from the Celtic Sea (table 2) and

northern North Sea (table 3) is real or a reflection of the low

number of samples and differences in sample processing

methods in the field; further sampling is required to enable

valid comparisons to elucidate this.

This review aimed to conclude whether benthic

assemblages dominated by Ditrupa were sufficiently consistent

in their occurrence to warrant inclusion in habitat

classifications, or alternatively, whether they were ephemeral

and thus rightly excluded. For the NE Atlantic, the weight of

evidence (albeit limited) suggests that dense populations of

Ditrupa occur with sufficient regularity in areas with well-

bounded depth and hydrodynamic conditions that the

assemblage should be included in habitat classifications. Such

classification schemes would benefit from revision to take

account of internal waves as a significant source of bed shear

stress, sediment disturbance and trophic modification in the

deep circalittoral and upper slope, areas currently defined as

where the seabed is not affected by waves. Considerable effort

A review of the occurrence and ecology of dense populations of Ditrupa arietina (Polychaeta: Serpulidae)

has recently been expended to improve European habitat

classifications for use in marine spatial planning and

identification of marine protected areas (West et al., 2010;

McBreen et al., 2011; Cameron and Askew, 2011), but none

makes any reference to internal waves. This is remarkable

since they have long been documented, together with their

links to ecologically important habitats such as cold water

corals (Frederiksen et al., 1992) and to sediment disturbance

(Heathershaw, 1985; Hosegood and van Haren, 2004).

In addition, the ecology of Ditrupa presents a number of

interesting questions. Is its free-living habit (in contrast to

most other serpulids) an adaptation that allows colonisation of

sedimentary areas, particularly those subject to periodic

hydrodynamic disturbance, with the robust elephant tusk

shaped tube allowing successful post larval and adult animal

redistribution via bed-load transport, and facilitating both

filter and surface deposit feeding? Is the operculum used by an

animal to allow some repositioning or as an anchor in periods

of high bed shear stress? Does the resulting spatially and

temporally variable patchwork of Ditrupa densities hinder the

establishment of high densities of predators such as naticid

gastropods, or parasites?

Acknowledgements

My sincere thanks to the following: the organisers of the 11 th

International Polychaete Conference for providing the

opportunity and spur to distil these ideas; the editors and

reviewers for helpful comments on the manuscript; Oil & Gas

UK for commissioning the 2007 and 2009 regional surveys of

the East Shetland Basin and eastern Irish Sea; Peter Garwood

for analysing the 2007 survey samples and for reviewing the

draft paper; Derek Moore for facilitating access to literature

and help during the 2007 survey; Ivor Rees for access to Le

Danois’ 1948 book and for commenting on the manuscript;

Susan Hartley for challenging questions, insightful discussions

and reviewing the manuscript; my present and past colleagues

for help in the field, comments and GIS mapping.

References

Basford, D.J., Eleftheriou, A., and Raffaelli, D. 1989. The epifauna of

the northern North Sea (56°-61°N). Journal of the Marine

Biological Association of the United Kingdom 69: 387-407.

Bruce, J.R., Colman, J.S., and Jones, N.S. (eds) 1963. Marine fauna of

the Isle of Man and its surrounding seas, 2nd edn. Liverpool

University Press: Liverpool, UK. 307 pp.

Callaway, R., Alsvag, J., de Boois, I., Cotter, J., Lord, A., Hinz, H.,

Jennings, S., Kroncke, I., Lancaster, J., Piet, G., Prince, P., and

Ehrich, S. 2002. Diversity and community structure of epibenthic

invertebrates and fish in the North Sea. ICES Journal of Marine

Science 59: 1199-1214.

Cameron, A., and Askew, N. (eds) 2011. EUSeaMap - preparatory

action for development and assessment of a European broad-

scale seabed habitat map final report. Available at http://jncc.gov.

uk/euseamap

Charles, F., Jordana, E., Amouroux, J.M., Gremare, A., Desmalades,

M., and Zudaire, L. 2003. Reproduction, recruitment and larval

metamorphosis in the serpulid polychaete Ditrupa arietina (O.L.

Muller). Estuarine, Coastal and Shelf Science 57: 435-443.

Cosentino, A., and Giacobbe, S. 2006. A case study of mollusc and

polychaete soft-bottom assemblages submitted to sedimentary

instability in the Mediterranean Sea. Marine Ecology 27: 170-183.

Cranmer, G.J., Dyer, M.L., and Fry, P.D. 1984. Further results from

headline camera surveys in the North Sea. Journal of the Marine

Biological Association of the United Kingdom 64: 335-342.

Crawshay, L.R. 1912. On the fauna of the outer-western area of the

English Channel. Journal of the Marine Biological Association of

the United Kingdom 9: 292-393.

Daan, R., and Mulder, M. 2006. The macrobenthic fauna in the Dutch

sector of the North Sea in 2005 and a comparison with previous

data. NIOZ-report 2006-3, NIOZ: Texel, The Netherlands. 93 pp.

Degraer, S., Wittoeck, J., Appeltans, W., Cooreman, K., Deprez, T.,

Hillewaert, H., Hostens, K., Mees, J., Vanden Berghe E., and

Vincx, M. 2006. The macrobenthos atlas of the Belgian part of

the North Sea. Belgian Science Policy. D/2005/1191/3. 164 pp.

Dicks, B., and Hartley, J.P 1982. The effects of repeated small oil

spillages and chronic discharges. Philosophical Transactions of

the Royal Society of London B 297: 285-307.

Diesing, M., Ware, S., Foster-Smith, R., Stewart, H., Long, D., Vanstaen,

K., Forster, R., and Morando, A. 2009. Understanding the marine

environment - seabed habitat investigations of the Dogger Bank

offshore draft SAC. JNCC Report No. 429. Joint Nature

Conservation Committee: Peterborough, UK. 89 pp. +5 appendices.

Dominici, S. 2001. Taphonomy and paleoecology of shallow marine

macrofossil assemblages in a collisional setting (late Pliocene-

early Pleistocene, western Emilia, Italy). Palaios 16: 336-353.

Draper, L. 1967. Wave activity at the sea bed around northwestern

Europe. Marine Geology 5: 133-140.

Dyer, M.F., Fry W.G., Fry P.D., and Cranmer, G.J. 1982. A series of

North Sea benthos surveys with trawl and headline camera.

Journal of the Marine Biological Association of the United

Kingdom 62: 297-313.

Eleftheriou, A., and Basford, D.J. 1989. The macrobenthic infauna of

the offshore northern North Sea. Journal of the Marine Biological

Association of the United Kingdom 69: 123-143.

Ellis, J.R., Lancaster, J.E., Cadman, P.S., and Rogers, S.I. 2002. The

marine fauna of the Celtic Sea. Pp. 45-65 in: Nunn, J.D. (ed.).

Marine biodiversity in Ireland and adjacent waters. Ulster

Museum: Belfast.

Ellis, J.R., Martinez, I., Burt, G.J., and Scott, B.E. 2013. Epibenthic

assemblages in the Celtic Sea and associated with the Jones Bank.

Progress in Oceanography 117: 76-88.

ERT. 2009. ConocoPhillips Jasmine Field, pipeline route to Judy and

new JRP site at Judy. UKCS Blocks 30/06a and 30/07a.

Environmental Baseline Survey, March 2009. ERT Report No. 2022.

European Environment Agency. EUNIS (European Nature

Information System), http://eunis.eea.europa.eu/about.jsp

Ferrero-Vicente, L.M., Marco-Mendez, C., Loya-Femandez, A., and

Sanchez-Lizaso, J.L. 2014. Observations on the ecology and

reproductive biology of the sipunculan worm Aspidosiphon muelleri

in temperate waters. Journal of the Marine Biological Association

of the United Kingdom 94: 1629-1638.

Frederiksen, R., Jensen, A., and Westerberg, H. 1992. The distribution

of the Scleractinian coral Lophelia pertusa around the Faroe

Islands and the relation to internal tidal mixing. Sarsia 77: 157-171.

Gambi, M.C., and Giangrande, A. 1986. Distribution of soft-bottom

polychaetes in two coastal areas of the Tyrrhenian Sea (Italy):

structural analysis. Estuarine, Coastal and Shelf Science 23:

847-862.

Gambi, M.C., and Jerace, S. 1997. Epibiosis on the tubes of the

polychaete Ditrupa arietina Serpulidae in some populations of

the soft bottoms off the southern Tyrrhenian Sea. Biologia Marina

Mediterranea 4: 380-383.

J.P. Hartley

Gardline. 2009. Jasmine to Judy export pipeline corridor route and

environmental baseline surveys. UKCS Block 30/06a and 30/07a.

Pipeline Route Survey Report. Gardline Project Ref. 7987. Report

by Gardline Geosurvey Ltd, Great Yarmouth.

Glemarec, M. 1969. Le plateau continental Nord-Gascogne et la

Grande Vasiere etude bionomique. Revue des Travaux Institut des

Peches Maritimes 33: 301-310.

Glemarec, M. 1973. The benthic communities of the European North

Atlantic continental shelf. Oceanography and Marine Biology:

an Annual Review 11: 263-289.

Green, J.A.M., Simpson, J.H., Legg, S., and Palmer, M. 2008. Internal

waves, baroclinic energy fluxes and mixing at the European shelf

edge. Continental Shelf Research 28: 937-950.

Gremare, A., Sarda, R., Medernach, L., Jordana, E., Pinedo, S.,

Amouroux, J.M., Martin, D., Nozais, C., and Charles, F. 1998. On

the dramatic increase of Ditrupa arietina O.F. Muller (Annelida:

Polychaeta) along both the French and the Spanish Catalan coasts.

Estuarine, Coastal and Shelf Science 47: 447-457.

Grey, M., Boulding, E.G., and Brookfield, M.E. 2005. Shape

differences among boreholes drilled by three species of naticid

gastropods. Journal ofMolluscan Studies 71: 253-256.

Guizien, K., Charles, F., Hurther, D., and Michallet, H. 2010. Spatial

redistribution of Ditrupa arietina (soft bottom Mediterranean

epifauna) during a moderate swell event: evidence and implications

for biotic quality indices. Continental Shelf Research 30: 239-251.

Hartley Anderson Ltd. 2008. 2007 East Shetland Basin Regional

Survey. Hartley Anderson Ltd. Report HAL/O&GUK/ 2008.9 to

the Government/Industry Offshore E nvironmental Monitoring

Committee. 25 pp. + appendices.

Hartley Anderson Ltd. 2009. 2008 Irish Sea regional survey data.

Hartley Anderson Ltd. report HAL/O&GUK/ 2009.11 to the

Government/Industry Offshore Environmental Monitoring

Committee. 7 pp. + appendices.

Hartley, J.P. 1979. On the offshore Mollusca of the Celtic Sea. Journal

of Conchology 30: 81-92.

Hartley, J.P., and Dicks, B.M. 1977. Survey of the benthic macrofaunal

communities of the Celtic Sea. Oil Pollution Research Unit (Field

Studies Council), Pembroke. 16 pp. + appendices.

Heathershaw, A.D. 1985. Some observations of internal wave current

fluctuations at the shelf-edge and their implications for sediment

transport. Continental Shelf Research 4: 485-493.

Hosegood, P.J., and van Haren, H. 2004. Near-bed solibores over the

continental slope in the Faeroe-Shetland Channel. Deep-Sea

Research Part II 51: 2943-2971.

Jackson, C. 2004. An atlas of internal solitary-like waves and their

properties , 2nd edn. Prepared under contract with the Office of

Naval Research, Code 322PO. http://www.internalwaveatlas.com/

Atlas2_index.html

Jennings, S., Lancaster, J., Woolmer, A., and Cotter, J. 1999.

Distribution, diversity and abundance of epibenthic fauna in the

North Sea. Journal of the Marine Biological Association of the

United Kingdom 79: 385-399.

Kupriyanova, E.K., McDonald, T.A., and Rouse, G.W. 2006.

Phylogenetic relationships within Serpulidae (Annelida:

Polychaeta) inferred from molecular and morphological data.

Zoologica Scripta 35: 421-439.

Kupriyanova, E.K., and Rouse, G.W. 2008. Yet another example of

paraphyly in Annelida: molecular evidence that Sabellidae

contains Serpulidae. Molecular Phylogenetics and Evolution 46:

1174-1181.

Labrune, C., Gremare, A., Amouroux, J.M., Sarda, R., Joao, G., and

Taboada, S. 2007a. Assessment of soft-bottom polychaete

assemblages in the Gulf of Lions (NW Mediterranean) based on a

mesoscale survey. Estuarine, Coastal and Shelf Science 71:133-147.

Labrune, C., Gremare, A., Guizien, K., and Amouroux, J.M. 2007b.

Long-term comparison of soft bottom macrobenthos in the bay of

Banyuls-sur-Mer (Northwestern Mediterranean Sea): a

reappraisal. Journal of Sea Research 58: 125-143.

Le Danois, E. 1948. Les profondeurs de la mer. Trente ans de

recherches sur lafaune sous-marine au large des cotes de France.

Payot: Paris. 303 pp.

Lehrke, J., ten Hove, H.A., Macdonald, T.A., Bartolomaeus, T., and

Bleidorn, C. 2007. Phylogenetic relationships of Serpulidae

(Annelida: Polychaeta) based on 18S rDNA sequence data, and

implications for opercular evolution. Organisms, Diversity &

Evolution 7: 195-206.

Mackie, A.S.Y., Oliver, P.G., and Rees, E.I.S. 1995. Benthic

biodiversity in the southern Irish Sea. Studies in Marine

Biodiversity and Systematics from the National Museum of

Wales. BIOMOR Reports 1. 263 pp.

Martinell, J., Kowalewski M., and Domenech, R. 2012. Drilling

predation on serpulid polychaetes ( Ditrupa arietina ) from the

Pliocene of the Cope Basin, Murcia region. Southeastern Spain.

PLoS ONE 7(4): e34576.

McBreen, F., Askew, N., Cameron, A., Connor, D., Ellwood, H., and

Carter, A. 2011. UKSeaMap 2010: predictive mapping of seabed

habitats in UK waters. JNCC Report, No. 446. 103 pp.

McIntosh, W.C. 1869. Report on the Annelids dredged off the Shetland

Islands by Mr. Gwyn Jeffreys in 1867-68. Pp. 231-345 in:

Jeffreys, J.G., Norman, A.M., McIntosh, W.C. and Waller, E.

(eds). Last report on dredging among the Shetland Isles. Report

of the British Association for the Advancement of Science for

1868.

McIntosh, W.C. 1923. A monograph of the British marine Annelids,

Volume IV, Part II. Polychaeta - Sabellidae to Serpulidae with

additions to the British marine Polychaeta during the publication

of the monograph. Ray Society. Pp. 251-538, 14 pis.

Medernach, L., Jordana, E., Gremare, A., Nozais, C., Charles, F., and

Amouroux, J.M. 2000. Population dynamics, secondary

production and calcification in a Mediterranean population of

Ditrupa arietina (Annelida: Polychaeta). Marine Ecology

Progress Series 199: 171-184.

Morton, B., and Salvador, A. 2009. The biology of the zoning subtidal

polychaete Ditrupa arietina (Serpulidae) in the Azores, Portugal,

with a description of the life history of its tube. Agoreana

Suplemento 6: 145-156.

Muller, O.F. (1776) Zoologiae Danicae Prodromus, seu animalium

Daniae et Norvegiae indigenarum. Characteres, nomina et

synonyma imprimis popularium. Havniae, 1776, xxxii + 282 pp.

Myers, A.A., and McGrath, D. 1979. The British and Irish species of

Siphonoecetes Kroyer (Amphipoda-Gammaridea). Journal of

Natural History 13: 211-220.

Nash, J.D., and Mourn, J.N. 2005. River plumes as a source of large-

amplitude internal waves in the coastal ocean. Nature 437: 400-

403.

Pingree, R.D., and Mardell, G.T. 1981. Slope turbulence, internal

waves and phytoplankton growth at the Celtic Sea shelf-break.

Philosophical Transactions of the Royal Society of London A

302: 663 -682.

Pomar, L., Morsilli, M., Hallock, P., and Badenas, B. 2012. Internal

waves, an under-explored source of turbulence events in the

sedimentary record . Earth-Science Reviews 111: 56-81.

Pomar, L., Morsilli, M., Hallock, P., Badenas, B., and Bourgault, D.

2013. Reply to Shanmugam, G., comment on “Internal waves, an

under-explored source of turbulence events in the sedimentary

record”. Earth-Science Reviews 116: 206-210.

Rae, B.B. 1956. The food and feeding habits of the lemon sole. Marine

Research 1956(3): 1-32.

A review of the occurrence and ecology of dense populations of Ditrupa arietina (Polychaeta: Serpulidae)

Rees, H.L., Eggleton, J.D., Rachor, E., and Vanden Berghe, E. (eds)

2007. Structure and dynamics of the North Sea benthos. ICES

Cooperative Research Report No. 288. 258 pp.

Robinson, K.A., Darbyshire, T., Van Landeghem, K., Lindenbaum, C.,

McBreen, F., Creaven, S., Ramsay, K., Mackie, A.S.Y., Mitchell,

N.C., Wheeler, A., Wilson, J.G., and O’Beirn, F. 2009. Habitat

mapping for conservation and management of the southern Irish

Sea (HABMAP) I: seabed surveys. Studies in Marine Biodiversity

and Systematics from the National Museum of Wales. BIOMOR

Reports 5(1). 148 pp. + appendices.

Sarda, R., Pinedo, S., Gremare, A., and Taboada, S. 2000. Changes in

the dynamics of shallow sandy-bottom assemblages due to sand

extraction in the Catalan Western Mediterranean Sea. ICES

Journal of Marine Science 57: 1446-1453.

Sharpies, J., Moore, C.M., Hickman, A.E., Holligan, P.M., Tweddle,

J.F., Palmer, M.R., and Simpson, J.H. 2009. Internal tidal mixing

as a control on continental margin ecosystems. Geophysical

Research Letters 36: L23603.

Stephen, A.C. 1923. Preliminary survey of the Scottish waters of the

North Sea by the Petersen Grab. Scientific Investigations of the

Fisheries of Scotland 1922 III: 1-21.

Tappin, D.R., Pearse, B., Fitch, S., Dove, D., Geary, B., Hill, J.,

Chambers, C., Bates, R., Pinnion, C., Green, M., Gallyot, J.,

Georgiou, L., Brutto, D., Marzialetti, S., Hopla, E., Ramsay, E.,

and Fielding, H. 2011. The Humber regional environmental

characterisation. British Geological Survey Open Report

OR/10/54. 317 pp.

ten Hove, H.A., and Kupriyanova, E.K. 2009. Taxonomy of Serpulidae

(Annelida, Polychaeta): the state of affairs. Zootaxa 2036: 1-126.

ten Hove, H.A., and Smith, R.S. 1990. A re-description of Ditrupa

gracillima Grube, 1878 (Polychaeta, Serpulidae) from the Indo-

Pacific, with a discussion of the genus. Records of the Australian

Museum 42: 101-118.

West, N., Swift, R., and Bell, C. 2010. Accessing and developing the

required biophysical datasets and data layers for Marine

Protected Areas network planning and wider marine spatial

planning purposes. Report No 10: Task 2E. Seabed Energy

Layers. Available at http://randd.defra.gov.uk/Document.

aspx?Document=MB0102_9939_TRP.pdf

Wilson, J.B. 1976. Attachment of the coral Caryophyllia smithii S. &

B. to tubes of the polychaete Ditrupa arietina (Muller) and other

substrates. Journal of the Marine Biological Association of the

United Kingdom 56: 291-303.

Wilson, J.B. 1979. Biogenic carbonate sediments on the Scottish

continental shelf and on Rockall Bank. Marine Geology 33: 85-93.

Wilson, J.B. 1982. Shelly faunas associated with temperate offshore

tidal deposits. Pp. 126-171 in: Stride, A.H. (ed.). Offshore tidal

sands - processes and deposits. Chapman and Hall: London.

Wilson, J.B. et al. 1983. RRS Challenger Cruise 12/79:18 August - 7

September 1979. Geological investigations in the northern North

Sea and on the continental shelf west and north of Scotland;

recovery and relaying of current meter moorings south and west

of the Wyville-Thomson Ridge. Institute of Oceanographic

Sciences, Cruise Report No. 153, 22 pp.

Memoirs of Museum Victoria 71:97-107 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Polychaete diversity in the estuarine habitats of Terminos Lagoon, southern Gulf

of Mexico

PABLO Hernandez-Alcantara 1 (http://zoobank.org/urn:lsid:zoobank.org:author:6DA0DE56-E980-4B31-9B16-BEBAA35DE639),

J. DANIEL Cortes-Solano 2 (http://zoobank.org/urn:lsid:zoobank.org:author:C32969C6-5213-4903-9F96-27A37ED24286),

NADIEZHDA M. MeDINA-CanTU 3 (http://zoobank.org/urn:lsid:zoobank.org:author:1082E3F0-8AC4-4091-8948-45C1685C50E8),

A. LAURA AviLES-DlAZ 4 (http://zoobank.org/urn:lsid:zoobank.org:author:E18A5F35-9826-4E83-876D-3258D76FEFDF) AND

VlVIANNE SOLIS-WEISS*’ 5 (http://zoobank.Org/urn:lsid:zoobank.org:author:9D486357-8D55-4B9B-8A04-CE3912359848)

'• 2 - 3 ’ 4 Unidad Academica de Ecologfa y Biodiversidad Acuatica, Instituto de Ciencias del Mar y Limnologfa, Universidad

Nacional Autonoma de Mexico. Circuito Exterior S/N. Cd. Universitaria, D. F. 04510, Mexico (' pabloh@cmarl.unam.mx;

2 danictro@gmail.com; 3 nadi.mari@hotmail.com; 4 que.linda.callorhinus@gmail.com)

5 Unidad Academica Sistemas Arrecifales Puerto Morelos, Instituto de Ciencias del Mar y Limnologfa, Universidad

Nacional Autonoma de Mexico. Puerto Morelos, Q. Roo, 77580, Mexico (solisw@cmarl.unam.mx)

* To whom correspondence and reprint requests should be addressed. Email: solisw@cmarl.unam.mx

http://zoobank.Org/urn:lsid:zoobank.org:pub:599BB612-1816-4584-90EA-37104C4501C9

Abstract Hernandez-Alcantara, P., Cortes-Solano, J.D., Medina-Cantu, N.M., Aviles-Dfaz, A.L. and Solfs-Weiss, V. 2014. Polychaete

diversity in the estuarine habitats of Terminos Lagoon, Southern Gulf of Mexico. Memoirs of Museum Victoria 71: 97-107.

In order to establish the status of the biodiversity of the polychaete fauna inhabiting the soft bottoms in the largest

lagoon-estuarine system from the southern end of the Gulf of Mexico, Terminos Lagoon, we collected and identified 3,398

specimens belonging to 119 species and 33 families of polychaetes. The soft bottom fauna was then compared with records

of polychaetes collected in other habitats in the lagoon such as seagrass beds and mangroves. In all, 190 species from 34

families of polychaetes previously recorded there were taken into account. The families Nereididae (20 spp.), Spionidae

(15 spp.) and Syllidae (14 spp.) were the most diverse. The soft bottom habitat has by far the largest number of species (119)

followed by the seagrass beds and mangroves with 75 and 42 species respectively. Large spatial heterogeneity in polychaete

composition was observed, as only 5% of the species ( Melinna maculata, Capitella sp., Mediomastus californiensis,

Schistomeringos rudolphii, Marphysa sanguinea, Alitta succinea , Diopatra cuprea, Scoloplos treadwelli, Prionospio

heterobranchia and Scolelepis squamata ) were widely distributed in the lagoon. The polychaete fauna living in the

mangroves is quite similar to that from seagrasses and soft bottoms (R (AN0 S im) = 0.247 and 0.3 respectively), but the

polychaetes in the seagrasses and soft bottoms are clearly different from each other (R (AN0SIM) = 0.622). The 119 polychaete

species identified in this study represent a significant increase in the records of biodiversity recorded so far in Terminos

Lagoon, while the total of 190 species recorded for the whole lagoon represents a larger number than any other recorded

for an American tropical estuary.

Keywords Polychaeta, soft bottoms, seagrass beds, mangroves, distribution, Mexico

Introduction

The lagoon-estuarine environments are one of the most

productive aquatic systems on earth and constitute important

refuges, breeding and feeding grounds for marine and

freshwater organisms that commonly live there or visit them,

either occasionally or seasonally. These environments play a

prominent role for man, due to their biological diversity and the

fishing activities that are usually associated. However, the

continuing increase of the human populations around these

grounds has taken its toll and the negative effects are evident

on the flora and fauna of the region (Lotze et al., 2006; Orth et

al., 2006). Particularly, Terminos Lagoon, one of the largest

lagoons of Mexico, has been drastically impacted by human

pressure during the last decades, mainly due to shrimp fisheries,

urbanization of Carmen Island and deforestation of riverine

vegetation for intensive agriculture (Villeger et al., 2010).

Coastal lagoons and estuaries are usually sites with low

diversity but high faunal abundance due to their special

environmental conditions (Constable, 1999). This is associated

with the “minimum species” concept expressed by Remane

(1934) to explain that the large variations of environmental

factors in those brackish waters exclude many species and

thus, the transitional marine-freshwater zones are typically

P. Hernandez-Alcantara, J.D. Cortes-Solano, N.M. Medina-Cantu, A.L. Aviles-DIaz & V. Solls-Weiss

species poor communities. In these water bodies the biota is

characterized by a high level of adaptive evolution to stress

and to those environmental variations that distinguish those

aquatic systems, especially salinity variations. That is why the

implementation of studies dedicated to the knowledge of the

biodiversity of these lagoon-estuarine systems is fundamental

to create monitoring programs that can help mitigate and

control the anthropic effects on that biota.

In Mexico, even if coastal lagoons cover approximately

30-35% of its almost 11,000 km of littorals (Contreras, 1985),

their study has not been a priority for benthic specialists. In

these systems, polychaetes are typically the main component

of the macrofaunal communities (Hutchings, 1998), and they

frequently represent more than half the number of species and

organisms present in any sample (Blake, 1994; Hutchings,

1998; Olsgard et al., 2003). So, it can be assumed that their

abundance and diversity patterns are the most important for

understanding the functioning of these systems and are crucial

to define the structure, production and general dynamics and

health of their benthic communities. The biological processes

observed in this group alone, could in fact reflect those of the

whole benthos in general (Mackie et al., 1997; Glasby and

Read, 1998; Olsgard and Somerfield, 2000).

Even if in the southern Gulf of Mexico those systems are

widely represented (623,600 ha) and the polychaetes are

recognized as one of their most important benthic components

(Hernandez-Alcantara and Solfs-Weiss, 1991, 1995), so far

their presence has only been recorded in eleven, including

Terminos Lagoon, from the 174 lagoon-estuarine systems

recorded in that region. That is why the objective of this study

is to establish the biodiversity recorded in the polychaetes of

the soft bottoms of one of the largest coastal lagoons of the

Gulf of Mexico, Terminos Lagoon, and to compare it to the

variety of species so far recorded there in seagrasses and

mangroves, as a departure point for future monitoring

programs of the regional benthic fauna.

Methods

Study area

Terminos Lagoon is located at the southern end of the Gulf of

Mexico (18° 38'N; 91° 34'W); it is about 70 km long and 30 km

wide, including two small tributary lagoons and swamp areas

(fig. 1). It was declared “Protected Area of Flora and Fauna of

Terminos Lagoon” (APFFLT for its initials in Spanish) in

1994, and a Ramsar site in 2004. Depth in the Lagoon averages

3.5 m. Two inlets connect it to the Gulf of Mexico (fig. 1), and

the winds, coupled with the prevailing currents, force the

seawater inflow through the Puerto Real Inlet (to the east),

while the lagoon waters outflow through the Carmen Inlet (to

the west) (Yanez-Arancibia and Day, 2005). Soft bottoms

devoid of vegetation are the dominant habitat in the lagoon

and cover most of the approximately 2500 km 2 of its total

surface while mangroves, dominated by Rhizophora mangle

(Linnaeus, 1753) are present around most of its edges; dense

and extensive prairies of seagrass beds dominated by Thalassia

testudinum Banks ex Konig, 1805, are also present in the

lagoon, although they are restricted to the south and southeast

of the Carmen Island and the southeastern end of the lagoon

(fig- 1).

Data analysis

The faunal information presented here is primarily based on

the specimens collected in soft bottoms in Terminos Lagoon

as part of the multidisciplinary project “Joint Environmental

Study of Terminos Lagoon (JEST)”, carried out during 2008-

2009 by the “Institut de Recherche pour le developpement »

(IRD) from France, the Universidad Autonoma Metropolitana-

Iztapalapa Mexico and the Universidad Nacional Autonoma

de Mexico. The objective of the general project was to compare

scientific results obtained some 20 years ago, with new data,

and thus establish, the present environmental status and

biogeochemical functioning of the Lagoon. To this aim, the

faunal data in this study were combined with information

about the polychaete species previously reported in seagrasses

(Ibanez-Aguirre and Solfs-Weiss, 1986; Cruz-Abrego et al.,

1994) and mangroves of the Lagoon (Hernandez-Alcantara

and Solfs-Weiss, 1991, 1995).

The biological samples for this study were taken with a

Van Veen (0.06 m 2 ) or Ekman (0.053 m 2 ) grab at 24 stations

distributed evenly over the soft bottoms of the Lagoon. The

faunal information for the seagrass and mangrove areas was

taken from published sources and made with a quadrat (0.06

m 2 ) at 22 stations for the seagrasses and five stations with a

corer (25 cm inner diameter, 20 cm penetration in the sediment)

for the mangroves. All samples collected in each habitat were

washed through a 0.5 mm mesh, to separate the macrofauna

and fixed in 4% formalin to be later preserved in 70% alcohol.

The comparison of the information resulting from this

study with that coming from the literature was complicated by

the different sampling procedures used in each case, so that

for comparison purposes, the distribution of species in the

three studied habitats was analyzed only as presence/absence

information. The faunal list presented here is made using the

current names of species as well as the names under which

they were reported initially (in parentheses), so that they are

readily traceable in the original source. Most species names

were verified with the World Polychaeta database (Read and

Fauchald, 2013), accessed through the World Register of

Marine Species (WoRMS, 2013). Before data processing, the

original list was filtered to remove all doubtful records, i.e.

those attributed to species whose known world distribution

does not correspond to the marine region studied here, or

species whose identification was incorrect.

The differences among the polychaete species in the three

habitats were evaluated with ANOSIM (analysis of similarity).

ANOSIM tests the hypothesis that there are no differences

between habitats in the composition of species, by calculating

the test statistic R which varies from R = 0 (groups

indistinguishable from one another) to R = 1 (no similarity

between groups) (Clarke, 1993). By resampling the data, a

probability level can be associated with R; in this case p< 1%

was used to distinguish the different habitats. The ANOSIM

test was performed using the Plymouth Routines in Multi-

Variate Ecological Research (PRIMER v6) software (Clarke

and Gorley, 2006).

Polychaete diversity in the estuarine habitats of Terminos Lagoon, Southern Gulf of Mexico.

Table 1. Distribution of the polychaete species collected in the three habitats of Terminos Lagoon (SB: soft bottoms; SG: seagrass beds; M:

mangroves).

Family - Species

Habitat

Family - Species

Habitat

Acoetidae

Opheliidae

Polyodontes lupinus (Stimpson, 1856)

Armandia agilis (Andrews, 1891)

Ampharetidae

Armandia cirrhosa Filippi, 1861

Melinnopsis sp. 1

Armandia maculata (Webster, 1884)

Isolda bipinnata Fauchald, 1977

Armandia bioculata Hartman, 1938

Melinna maculata Webster, 1879

Orbiniidae

Melinna palmata Grube, 1870

Leitoscoloplos foliosus (Hartman, 1951) (as

Haloscoloplos foliosus (Hartman, 1951))

Amphinomidae

Leitoscoloplos fragilis (Verrill, 1873) (as

Haloscoloplos fragilis (Verrill, 1873))

Hipponoe sp.

Leodamas rubra (Webster, 1879) (as

Scoloplos (Leodamas) rubra (Webster,

1879))

Linopherus ambigua (Monro, 1933)

Nainereis sp.

Arenicolidae

Naineris setosa (Verril, 1900)

Arenicola cristata Stimpson, 1856

Protoaricia oerstedii (Claparede, 1864)

Capitellidae

Scoloplos robustus Rullier, 1964 (as

Leitoscoloplos robustus (Verrill, 1873))

Capitella sp. (as Capitella capitata

(Fabricius, 1780))

Scoloplos texana (Maciolek and Holland,

1978)

Capitomastus sp.

Scoloplos treadwelli Eising, 1914

Mediomastus californiensis Hartman, 1944

Owenidae

Notomastus hemipodus Hartman, 1945 (as

Notomastus luridus Verrill, 1873

Galathowenia oculata (Zach, 1923)

Notomastus sp.

Owenia fusiformis Delle Chiaje, 1844

Rasghua sp.

Owenia sp.

Cirratulidae

Paraonidae

Aphelochaeta sp.

Aricidea (Acmira) hirsute Arriaga-

Hemandez, Hemandez-Alcantara and

Solfs-Weiss, 2013

Caulleriella alata (Southern, 1914)

Aricidea (Strelzovia) suecica Eliason, 1920

(as Aricidea suecica Eliason, 1920)

Caulleriella bioculata( Keferstein, 1862)

Cirrophorus armatus (Glemarec, 1966)

Timarete filigera (Delle-Chiaje, 1828) (as

Cirriformia filigera (Delle-Chiaje, 1828))

Paraonides lyra (Southern, 1914) =

Paradoneis carmelitensis Arriaga-

Hemandez, Hemandez-Alcantara and

Solfs-Weiss, 2013

Timarete tentaculata (Montangu, 1808) (as

Cirriformia tentaculata (Montagu, 1808))

Pectinariidae

Monticellina dorsobranchialis (Kirkegaard,

Pectinaria meredithi Long, 1973

1959)

100

P.Hernandez-Alcantara, J.D. Cortes-Solano, N.M. Medina-Cantu, A.L. Aviles-Dlaz & V. Solls-Weiss

Family - Species

Habitat

Family - Species

Habitat

Moticellina sp.

Pectinaria sp.

Aphelochaeta marioni (Saint-Joseph, 1894)

(as Tharyx marioni (Saint-Joseph, 1894))

Petta pellucida (Ehlers, 1887) (as Petta

pusilla Malmgren, 1866)

Aphelochaeta parva (Berkeley, 1929) (as

Tharyx parvus (Berkeley, 1929))

Petta tenuis Caullery, 1944

Cossuridae

Petta sp.

Cossura delta Reish, 1958

Phyllodocidae

Dorvilleidae

Hypereteone heteropoda Hartman, 1951 (as

Eteone heteropoda Hartman, 1951)

Dorvillea rubra (Grube, 1856)

Hypereteone foliosa (Quatrefages, 1865) (as

Eteone foliosa Quatrefages, 1866)

Schistomeringos rudolphii{ Delle-Chiaje,

1828)

Hypereteone lactea Claparede, 1868 (as

Eteone lactea Claparede, 1868)

Eunicidae

Hypereteone sp. (as Eteone sp.)

Lysidice ninettaAudoum and Milne-

Edwards, 1833

Phyllodoce arenae Webster, 1879

Lysidice unicornis (Grube, 1840) (as

Nematonereis unicornis (Grube, 1840)

Pilargidae

Marphysa aransensis Treadwell, 1939

Ancistrosyllis commensalis Gardiner, 1976

Morphysa sanguinea (Montagu, 1815)

Hermundura fauveli (Berkeley and Berkeley,

1941) (as Loandalia fauveli (Berkeley and

Berkeley, 1941))

Flabelligeridae

Hermundura vivianneae (Salazar-Vallejo

and Reyes-Berragan, 1990) (as Parandalia

vivianneae Salazar-Vallejo and Reyes-

Berragan, 1990)

Piromis eruca (Claparede, 1869) (as

Pherusa eruca (Claparede, 1869))

Hermundura sp. 1 (as Parandalia sp.)

Piromis roberti (Hartman, 1951)

Sigambra bassi (Hartman, 1945)

Glyceridae

Sigambra grubii (Muller, 1858)

Hemipodia sp. 1

Sigambra wassi Pettibone, 1966

Goniadidae

Polynoidae

Glycinde multidens Muller, 1858 (as

Glycinde solitaria (Webster, 1879))

Antinoe microps Kinberg, 1856

Goniada echinulata Grube, 1870

Antinoe uschakovi (Ibarzabal, 1988)

Goniada maculata Oersted, 1843

Antinoe sp. 1

Goniadides carolinae Day, 1973

Lepidonotus lacteus (Ehlers, 1887)

Ophiogoniada sp. 1

Lepidonotus sublevis Verrill, 1873

Hesionidae

Malmgreniella taylori Pettibone, 1993

Gryptis arenicola glabra (Hartman, 1961)

Malmgreniella variegata (Treadwell, 1917)

Podarkeopsis brevipalpa (Hartmann-

Malmgreniella sp. 1

Schroder, 1959) (as Gyptis brevipalpa

(Hartman-Schroeder, 1959))

Polychaete diversity in the estuarine habitats of Terminos Lagoon, Southern Gulf of Mexico.

101

Family - Species

Habitat

Family - Species

Habitat

Hesiocaeca sp.

Malmgreniella sp. 2

Oxydromus sp.

Sabellidae

Lumbrineridae

Branchioma sp.

Lumbrineris impatiens Claparede, 1868

Megalomma bioculatum (Ehlers, 1887)

Ninoe sp.

Parasabella lacunosa (Perkins, 1984)

Scoletoma Candida (Treadwell, 1921)

Demonax microphthalmus (Verrill, 1873) (as

Sabella microphthalma (Verrill, 1873))

Scoletoma elongata (Treadwell, 1931)

Sabella sp.

Scoletoma ernesti (Perkins, 1979)

Serpulidae

Scoletoma tenuis (Verrill, 1873) (as

Lumbrineris tenius (Verrill, 1873))

Hydriodes parvus (Tradwell, 1902)

Scoletoma treadwelli (Hartman, 1956)

Hydroides dianthus (Verrill, 1873)

Scoletoma verrilli (Perkins, 1979)

Hydroides protulicola Benedict, 1887

Scoletoma sp.

Sigalionidae

Maldanidae

Sthenelais boa (Johnston, 1833)

Sabaco elongatus (Verrill, 1873) (as

Branchioasychis americana (Hartman,

1945))

Sthenelais helenae Kinberg, 1856

Axiothella sp.

Sthenelais sp.

Axiothella mucosa^ Andrews, 1891)

Sthenolepis sp.

Clymenella torquata (Leidy, 1855)

Spionidae

Clymenella sp. 1

Dipolydora socialis (Schmarda, 1861) (as

Polydora socialis (Schmarda, 1861))

Clymenura sp. 1

Dipolydora sp.

Isocirrus sp. 1

Malacoceros vanderhorsti (Augener, 1927)

Maldane sp. 1

Minuspio ca. cirrifera Wiren, 1883

Nereididae

Paraprionospio alata (Moore, 1923) (as

Prionospio (Paraprionospio) pinnata Ehlers,

1901 or Paraprionospio pinnata (Ehlers,

1901))

Allitta succinea (Frey and Leuckart, 1847)

(as Neanthes succinea (Frey and Leuckhart,

1847))

+ Polydora cornuta Bose, 1802 (as Polydora

ligni (Webster, 1879))

Ceratonereis costae (Grube, 1840)

PolydoraplenaBerkeley and Berkeley, 1936

Ceratonereis irritabilis (Webster, 1879)

Prionospio ehlersi Fauvel, 1928

Ceratonereis versipedata (Ehlers, 1887)

Prionospio heterobranquiaMoore , 1907

Ceratonereis sp.

Prionospio pygmaeus Hartman, 1961

Dendronereis sp.

Prionospio sp.

Laeonereis culveri (Webster, 1879)

+ Scolelepis ca. lighti Delgado-Blas, 2006

Laeonereis sp.

Scolelepis squamata (O.F. Muller, 1806)

Leonnates sp. 1

Spiophanes sp.

102

P.Hernandez-Alcantara, J.D. Cortes-Solano, N.M. Medina-Cantu, A.L. Aviles-Diaz & V. Solis-Weiss

Family - Species

Habitat

Family - Species

Habitat

Leptonereis sp.

Streblospio benedicti (Webster, 1879)

Neanthes acuminata Ehlers, 1868

Stemaspidae

Neanthes caudata (Delle-Chiaje, 1827)

Sternaspis sp. 1

Nereis falsa Quatrefages, 1866

Sternaspis sp. 2

Nereis grayi (Pettibone, 1956)

Syllidae

Nereis micromma Harper, 1979

Exogone dispar (Webster, 1879)

Nereis oligohalina (Rioja, 1946)

Exogone lourei Berkeley and Berkeley, 1938

Nereis pelagica Linnaeus, 1758

Haplosyllis spongicola (Grube, 1855) (as

Syllis spongicola (Grube, 1855))

Nereis riisei Grube, 1857

Perkinsyllis spinisetosa (San Martin, 1990)

Nicon sp.

Pionosyllis sp.

Platynereis sp.

Prosphaerosyllis riseri (Perkins, 1980)

Stenoninereis martini Wesenberg-Lund,

1958

Streptosyllis sp. 1

Oenonidae

Syllis garciai (Campoy, 1932)

Arabella iricolor (Montangu, 1804)

Syllis gracilis Grube, 1840

Arabella sp.

Syllis mexicana (Rioja, 1960) (as Elhersia

mexicana (Rioja, I960))

Drilonereis longa Webster, 1879

Sylliis variegataGmbe, 1860

Onuphidae

Syllis sp. (as Syllis (Typosyllis) sp.)

Americonuphis magna( Andrews, 1891)

Syllis hyalina Grube, 1863

Diopatra cuprea (Bose, 1802)

Syllis lagunae Tovar-Hemandez, Hemandez-

Alcantara and Solis-Weiss, 2008

Kinbergonuphis cedroensis (Fauchald, 1968)

Terebellidae

Kinbergonuphis pulchra (Fauchald, 1980)

Loimia viridis Moore, 1903

Kinbergonuphis rubrescens (Augener, 1906)

Polycirrus ca. haematodes (Claparede,

1864)

Kinbergonuphis simoni (Santos, Day and

Rice, 1981)

Scionides sp.

Kinbergonuphis vermillionensis (Fauchald,

1968)

Terebella lapidaria Linnaeus, 1767

Kinbergonuphis sp.

Terebella sp.

Kinbergonuphis sp. 1

Trichobranchidae

Kinbergonuphis sp. 2

Terebellides carmenensis Solis-Weiss,

Fauchald and Blankensteyn, 1991 (as

Terebellides stroemi Sars, 1835)

Kinbergonuphis sp. 3

Terebellides lanai Solis-Weiss, Fauchald and

Blankensteyn, 1991

Onuphis eremita (Audowin and Milne -

Edward, 1833)

Polychaete diversity in the estuarine habitats of Terminos Lagoon, Southern Gulf of Mexico.

103

Figure 1. Location and distribution of habitats in Terminos Lagoon, southern Gulf of Mexico.

Results

For this study, 3,398 specimens (33 families and 119 species)

were collected and identified in the soft bottoms of Terminos

Lagoon. Combining these results with the published

information in its seagrasses and mangroves, we found that, so

far, 190 species from 34 families have been recorded there

(Table 1). The most diverse families were Nereididae (20 spp.),

Spionidae (15 spp.) and Syllidae (14 spp.), although we note

that their presence in the different habitats under study is

highly variable. On the other hand, 68% of the families

collected for this study were represented by only five or fewer

species (fig. 2).

The distribution of the polychaete fauna in the Lagoon

shows that soft bottoms constitute the more diversified habitat

(119 species in 33 families), followed by the seagrasses with 75

species in 26 families, while the mangroves’ environment has

the least diverse fauna, with 42 species in 21 families. Although

some caution is advisable when comparing the number of

species of soft bottoms with literature records, mainly because

the methodology and sampling effort are different, we

observed that the faunal differences between habitats are more

pronounced among families with the highest number of

species: in the soft bottoms, six families are represented by

eight species or more, but in the seagrasses only the nereidids

and spionids (eight species) were similarly represented, and in

the mangroves only these same families (Nereidae and

Spionidae) were found with a maximum of six species (fig. 2).

In the soft bottoms, the highest number of species was

found in the families Onuphidae (10 spp.), Nereididae and

Polynoidae (both with 9 species), and Lumbrineridae, Syllidae

and Spionidae (8 species). Although the nereidids and spionids

were also diversified taxa in the seagrasses (both with 8

species) and mangroves (both with 6 species), the high

diversity of onuphids, lumbrinerids and polynoids seems to be

exclusive of the soft bottoms (fig. 2). Besides the polynoids, the

families Acoetidae, Glyceridae and Sternaspidae have been

only recorded in soft bottoms, while the Amphinomidae is the

only one which has not been collected in that habitat. The

family Syllidae occurs preferably in soft bottoms and seagrass

beds, while the Maldanidae and Cossuridae are mainly found

in soft bottoms and mangroves.

The distribution of the polychaetes in the three habitats

shows that most species are not widely distributed: most of

them, 154 species (81% of the total species), have been

recorded in only one habitat, and only 5% of the polychaetes

(10 species) are able to spread out to the different habitats of

104

P.Hernandez-Alcantara, J.D. Cortes-Solano, N.M. Medina-Cantu, A.L. Aviles-Diaz & V. Solis-Weiss

oMangroves

□Seagrass beds

■ Soft bottoms

3881 06

Family

Figure 2. Number of species by family at each habitat in Terminos Lagoon.

Figure 3. Distribution of the number of species by

habitat in Terminos Lagoon. (SB: soft bottoms; SG:

seagrass beds; M: mangroves).

the lagoon (Table 1). Most of the species (7) distributed in all

habitats have limited motility, and belong mainly either to

Spionidae ( Scoloplos treadwelli (Eising, 1941), Prionospio

heterobranchia Moore, 1907 and Scolelepis squamata (O.F.

Miiller, 1806) or Capitellidae ( Capitella sp. and Mediomastus

californiensis (Hartman, 1944)). On the other hand, 26 species

were found in two of the habitats, but the number of motile

species clearly increased and more than 40% (11 species) can

be classified as motile polychaetes (Table 1, fig. 3): six species

are common to soft bottoms and seagrasses, nine species

occur simultaneously in soft bottoms and mangroves, and 11

species are found in seagrasses and mangroves.

The biotic heterogeneity in the habitats of Terminos

Lagoon, evaluated by the ANOSIM test, shows that the global

value of R = 0.51 is clearly much larger than any of the 999

permuted values (p = 0.1%), rejecting the null hypothesis that

there are no differences in the polychaetes’ composition of the

three environments. However, these faunal differences are not

equal in each combination of groups, since pairwise tests show

that the main separation of habitats, based on their species

composition, is between the soft bottoms and seagrass beds (R

= 0.622, p < 0.1%). On the other hand, the polychaete species in

the soft bottoms and mangroves (R = 0.3, p = 1.1%), and in the

seagrasses and mangrove environments (R = 0.247, p = 5.5%)

are very similar, and their faunal differences are not significant.

Discussion

The benthic macrofauna of tropical estuaries is commonly

dominated by the Polychaetous annelids (Flint and Younk,

1983; Hernandez-Alcantara and Solis-Weiss, 1995; Silva et al.,

2011). This is due, among other things, to their highly diverse

ethological habits which help them adapt to the (also) high

environmental variability (Magalhaes and Barros, 2011). In

this context, polychaetes are known for their tolerance of

drastic environmental changes that make it possible for them

to be well represented in lagoon-estuarine ecosystems (Gambi

et al, 1997; Dittman, 2000; Rosa Filho et al., 2005). The

“species minimum” concept indicates that the variable

environmental features present in brackish systems, tend to

exclude species (Remane, 1934). As a whole, the 190 species

recorded in Terminos Lagoon do not seem to represent

outstanding diversity levels; this is especially true if they are

compared to the 854 species of polychaetes recorded in the

sublittoral soft bottoms of the Gulf of Mexico (Fauchald et al.,

2009) even if, admittedly, the last are living in the more stable

environment of the continental shelf. On the other hand, the

comparison of biodiversity with other estuarine systems in the

southern Gulf of Mexico is difficult, because knowledge of the

polychaetes is very limited : only one species is known to have

been collected in each of three estuaries, and a maximum of

70 species have been recorded in the other seven estuaries in

this region. However, even considering that comparisons with

other such studies in the region are to be taken with caution,

due to the different sampling procedures used (Sicinski and

Janowska, 1993; Gambi et al, 1997), the 190 species of

polychaetes recorded in Terminos Lagoon clearly represent a

much higher biodiversity than that observed in many of the

tropical estuarine systems of the American continent. Such is

the case with the 83 taxa registered in an estuary of the

Amazon (Silva et al., 2011), the 58 species of polychaetes

recorded in an estuarine system in southern Brazil (Magalhaes

and Barros, 2011), the 77 species registered in an impacted

estuary of Rio de Janeiro, also in Brazil (Santi and Tavares,

2009), or the 120 species of polychaetes collected in an estuary

in Costa Rica (Maurer and Vargas, 1984). Notwithstanding the

relatively high diversity observed in Terminos Lagoon, few

families are diverse and widely distributed: of the 34 families

recorded, 23 are represented by fewer than five species.

It is known that, along an estuary, the benthic communities

vary widely in composition and are often associated with

changes in salinity and type of sediment; in addition, the

Polychaete diversity in the estuarine habitats of Terminos Lagoon, Southern Gulf of Mexico.

105

greater complexity of habitats, such as the presence of

vegetation or heterogeneous substrates, could be accompanied

by increased species richness (Castel et al., 1989; Junoy and

Vieitez, 1990). In this sense, we noted that few species (5%)

occur in the whole lagoon and therefore, the faunal composition

is different from one habitat to the next. However, these

differences are only significant between the soft bottoms and

seagrass environments. Most of these widely distributed

species are deposit feeders or detritivores, which have already

been reported as dominant in the soft bottoms of the lagoon

(Hernandez-Alcantara, 1991). For their part, the motile

species, like Marphysa sanguined (Montagu, 1815), Alitta

succinea (Frey and Leuckart, 1847) and Diopatra cuprea

(Bose, 1802) have been usually reported on seagrass beds

(Ibanez-Aguirre, 1986; Cruz-Abrego et ah, 1994).

It is necessary to have a much better knowledge of the life

histories and behavior of the benthic fauna in the estuarine

systems to achieve an adequate analysis of the structure of the

marine communities. However, the complexity of the habitat

structure created by the aquatic vegetation is an important

factor in determining the diversity and composition of the

communities, since they provide feeding resources and refuges

to many invertebrates. This, in turn, generates differences

with the fauna in unstructured habitats, such as soft bottoms

(Minello et ah, 2003).

In the mangrove sediments, the number of species was the

lowest and the polychaete species present were very similar to

those recorded in soft bottoms or seagrasses. In this case, the

sampling effort was lower than in the other habitats, which

could lead to an underestimate of their real biodiversity.

However, few species are limited to the mangroves and, for

many this environment is an extension of their “normal”

habitat (Hutchings and Recher, 1982; Hernandez-Alcantara

and Solfs-Weiss, 1991). Anyhow, it is possible that in this

lagoon, an active faunal exchange takes place between the

mangroves and the other two habitats studied (Hernandez-

Alcantara and Solfs-Weiss, 1991).

Differences in the structure of the habitats analyzed and

the highly variable environmental changes, which characterize

the lagoon-estuarine systems, determine the high number of

species recorded exclusively in one habitat (154 species), but it

may also provide a particular space for opportunistic species,

like, in this instance, the spionid polychaetes. Spionids are one

of the most diverse families in the lagoon and their

characteristic species Scoloplos treadwelli, Prionospio

heterobranchia and Scolelepis squamata, occur in the three

habitats while Paraprionospio alata (Moore, 1923), Streblospio

benedicti (Webster, 1879) and Poly dor a cornuta Bose, 1802,

have been collected in two habitats at the same time. Spionids

are often abundant in fine sediments and they can show

marked population fluctuations. Many are opportunistic,

responding to enrichment and disturbance (Pearson and

Rosenberg, 1978). Another species frequently recorded in the

three habitats of the Terminos Lagoon, Capitella sp.

(Capitellidae), is closely related to Capitella capitata (Fabricius,

1780), which thrives in organic-rich environments and has

been used as a biological indicator of organic pollution (Reish,

1959). The enrichment of the sediments in this lagoon could

well cause the presence of these opportunistic polychaetes.

However, this “species” is actually considered to include a

group of unnamed sibling species with different life

histories and reproductive attributes, but with only slight

morphological differences between them (Grassle and Grassle,

1976). That is why, in this study, the analyzed individuals were

left as Capitella sp., and the previous records of C. capitata in

the lagoon, whose specimens were also revised, were all

renamed Capitella sp., until their taxonomic status can be

elucidated.

The presence of root structures in seagrass beds may

reduce the water flow, increase the content of organic matter in

that sediment and provide refuge from predation for benthic

invertebrates (Orth et al., 1984), encouraging the presence of a

rich benthic fauna. However, in Terminos Lagoon, the number

of species of polychaetes is clearly higher in soft bottoms than

in seagrasses, which is probably the result of this being the

largest habitat of the lagoon, but also of its large variation in

environmental conditions, while the seagrass beds are mainly

distributed in areas with strong marine influence from

southern Del Carmen Island and patches of different size at

the eastern end of the lagoon (both sides of Puerto Real inlet).

The faunal composition is related to habitat type in

estuarine environments, and usually the number of species is

higher in a structured habitat, such as the seagrasses, compared

to soft bottoms devoid of vegetation (Ferraro and Cole, 2004;

Hosack et al., 2006). However, the results obtained in this

study do not support previous observations which suggest that

complex habitat structure increases the presence of species

(Hosack et al., 2006), and the faunal differences could be

associated to other physical-chemical factors. Unfortunately,

the scarce information available on the structural organization

of the benthic communities, not only in Terminos Lagoon, but

in all the tropical estuarine systems of the Gulf of Mexico,

makes it difficult to evaluate and verify these statements.

Besides, from the 1980s, Terminos Lagoon conditions have

been changing constantly, with an increase of marine

influence, more turbidity, a general decrease of depth, and

even a decrease in the seagrass meadows, particularly around

Ciudad del Carmen (the island city), associated with an

increasingly fast urbanization (Villeger et al., 2010). This

could modify the relationships between the species already

settled, new settlements and their distributional patterns.

Anyway, the information about the biodiversity of the

polychaetes from this study is important as a departure point for

understanding the ecological mechanisms prevalent in this

lagoon-estuarine system, since the polychaetes have been widely

used as indicators of the general “health” in benthic communities,

especially those under pollution impacts (Dean, 2008).

Unfortunately, anthropogenic influence is increasing in those

systems all along the southern region of the Gulf of Mexico,

negatively affecting them. In 1971, the largest deposit of

hydrocarbons in Mexico (Cantarell) and one of the largest in the

world was discovered, precisely in front of Terminos Lagoon on

the continental shelf. Following this discovery the area became

one of the most important economic zones of the country, but

this development triggered the transformation of previously rural

areas into urban zones quite rapidly (Soto-Galera et al., 2010).

106

P. Hernandez-Alcantara, J.D. Cortes-Solano, N.M. Medina-Cantu, A.L. Aviles-DIaz & V. Solis-Weiss

This exceptional economic development and its many related

activities (oil extraction and associated industry, fisheries,

tourism, fast urbanization, etc.) has increased the exploitation

and deterioration of the natural resources of the region, and its

traditional activities which often collide with the modern and

excessively fast development (Sanchez-Gil et al., 2004).

Finally, it is necessary to emphasize the fact that benthic

communities are severely threatened by the worsening conditions

of those habitats due to human activities (Snelgrove et al., 1997),

and that only a small fraction of the species which live in the

benthos in general have been described in tropical regions. So,

there is a high probability that many of them will disappear even

before they are known (Snelgrove, 1998, 1999), in particular, in

the southern Gulf of Mexico, where oil extraction and processing

of its derivates take place in the vicinity of these lagoon-estuarine

systems. Even if the characterization of the polychaete fauna

found in Terminos Lagoon is still incomplete, the information

generated by this type of biotic inventory, including spatial and

seasonal variation, is key to understanding the functioning of

these communities and will hopefully further stimulate the study

of these environments in the southern region of the Gulf of

Mexico. In turn, those studies will help to manage and protect

these natural resources, while allowing the rational exploitation

of the oil and fisheries industry.

Acknowledgements

Our very special thanks go to Renaud Fichez and Christian

Grenz, Heads of the project JEST (Joint Environmental Study

of Terminos Lagoon), for inviting us to participate in this

project and for financing our expeditions to Terminos Lagoon.

We would also like to thank Laura G. Calva B., Edna

Salamanca Q. and Gabriela Valdes L. from UAM-Iztapalapa,

for their valuable support during the sampling trips.

References

Blake, J.A. 1994. Introduction to the polychaeta. Pp. 39-113 in: Blake,

J.A. and Hilbig, B. (eds), Taxonomic Atlas of the benthic fauna of the

Santa Maria Basin and western Santa Barbara Channel , Volume 4.

Santa Barbara Museum of Natural History: California.

Castel, J., Labourg, P.J., Escaravage, V., Auby, I., and Garcia, M.E.

1989. Influence of seagrass beds and oyster parks on the abundance

and biomass patterns of meio- and macrobenthos in tidal flats.

Estuarine, Coastal and Shelf Science 28: 71-85.

Clarke, K.R. 1993. Non-parametric multivariate analyses of changes in

community structure. Australian Journal of Ecology 18: 117-143.

Clark, K.R., and Gorley, R.N. 2006. Primer v6: user manual/tutorial.

PRIMER-E: Plymouth. 190 pp.

Constable, A. J. 1999. Ecology of benthic macro-invertebrates in soft-

sediments environments: a review of progress towards quantitative

models, predictions. Australia Journal of Ecology, 24: 452-476.

Contreras, F. 1985. Las lagunas costeras mexicanas. Centro de

Ecodesarrollo, Secretarfa de Pesca: Mexico. 253 pp.

Cruz-Abrego, F.M., Hernandez-Alcantara, P., and Solis-Weiss, V. 1994.

Estudio de lafauna de poliquetos (Annelida) y moluscos (Gastropoda

y Bivalvia) asociada a ambientes de pastos marinos ( Thalassia

testudinum) y manglares ( Rhizophora mangle ) en la Laguna de

Terminos, Campeche, Mexico. Anales del Instituto de Ciencias del

Mar y Limnologia, Universidad Nacional Autonoma de Mexico

21(1-2): 1-13.

Dean, H.K. 2008. The use of polychaetes (Annelida) as indicator species

of marine pollution: a review. Revista de Biologia Tropical 56: 11-38.

Dittman, S. 2000. Zonation of benthic communities in a tropical tidal

flat of north-east Australia. Journal of Sea Research 43: 33-51.

Fauchald, K., Granados-Barba, A., and Solis-Weiss, V. 2009. Chapter

37. Polychaeta (Annelida) of the Gulf of Mexico. Pp. 751-788 in:

Felder, D. and Camp, D. (eds). Gulf of Mexico-origins, waters, and

biota, Volume 1. Biodiversity, Texas A&M University Press: USA.

Ferraro, S.P, and Cole, F.A. 2004. Optimal benthic macrofaunal

sampling protocol for detecting differences among four habitats

in Willapa Bay, Washington, USA. Estuaries 27: 1014-1025.

Flint, R.W.J., and Younk, A. 1983. Estuarine benthos: long-term

community structure variations. Corpus Christi Bay, Texas.

Estuaries 6: 126-141.

Gambi, M.C., Castelli, A., and Guizzardi, M. 1997. Polychaete

populations of the shallow soft bottoms off Terra Nova Bay (Ross

Sea, Antarctica): distribution, diversity and biomass. Polar

Biology 17: 199-210.

Glasby, C.J., and Read, G. 1998. Polychaete worms: a diverse yet

poorly known group. Water & Atmosphere 6: 7-9.

Grassle, J.F., and Grassle, J.P. 1976. Sibling species in the marine

pollution indicator Capitella. Science 192: 567-569.

Hosack, G.R., Dumbauld, B.R., Ruesink, J.L., and Armstrong, D.A.

2006. Habitat associations of estuarine species: comparisons of

intertidal mudflat, seagrass ( Zostera marina ), and oyster {Crassostrea

gigas) habitats. Estuaries and Coasts 29(6B): 1150-1160.

Hernandez-Alcantara, P. and Solis-Weiss, V. 1991. Ecological aspects

of the polychaete populations associated with the red mangrove

Rhizophora mangle at Laguna de Terminos, southern part of the

Gulf of Mexico. Ophelia Supplement 5: 451-462.

Hernandez-Alcantara, P., and Solis-Weiss, V. 1995. Algunas

comunidades macrobenticas asociadas al manglar ( Rhizophora

mangle) en la Laguna de Terminos, Golfo de Mexico. Revista de

Biologia Tropical 43: 117-129.

Hutchings, P.A. 1998. Biodiversity and functioning of polychaetes in

benthic sediments. Biodiversity and Conservation 7: 1133-1145.

Hutchings, P.A., and Recher, H.F. 1982. The fauna of Australian

Mangroves. Proceedings of the Linnean Society of N.S.W 106:

83-121.

Ibanez-Aguirre, A.L., and Solis-Weiss, V. 1986. Anelidos poliquetos

de las praderas de Thalassia testudinum del noroeste de la Laguna

de Terminos, Campeche, Mexico. Revista de Biologia Tropical 34:

35-47.

Junoy, J., and Vieitez, J.M. 1990. Macrozoobenthic community

structure in the Ria de Foz, an intertidal estuary (Galicia,

northwest Spain). Marine Biology 107: 329-339.

Lotze, H.K., Leihan, H.S., Bourque, B.J., Bradbury, R.H., Cooke,

R.G., Kay, M.C., Kidwell, S.M., Kirby, M.X., Peterson, C.H., and

Jackson, J.B.C. 2006. Depletion, degradation, and recovery

potential of estuaries and coastal seas. Science 312: 1806-1809.

Mackie, A.S., Parmiter, C., and Tong, L.K.Y. 1997. Distribution and

diversity of Polychaeta in the southern Irish Sea. Bulletin of Marine

Science 60: 467-481.

Magalhaes, W.F., and Barros, F. 2011. Structural and functional

approaches to describe polychaete assemblages: ecological

implications for estuarine ecosystems. Marine and Freshwater

Research 62: 918-926.

Maurer, D., and Vargas, J.A. 1984. Diversity of soft-bottom benthos in

a tropical estuary: Gulf of Nicoya, Costa Rica. Marine Biology 81:

97-106.

Minello, T.J., Able, K.W., Weinstein, M.P., and Hays, C.G. 2003. Salt

marshes as nurseries for nekton: testing hypotheses on density,

growth and survival through meta-analysis. Marine Ecology

Progress Series 246: 39-59.

Polychaete diversity in the estuarine habitats of Terminos Lagoon, Southern Gulf of Mexico.

107

Olsgard, F., and Somerfield, P.J. 2000. Surrogates in marine benthic

investigations which taxonomic unit to target? Journal of Aquatic

Ecosystem Stress and Recovery 7: 25-42.

Olsgard, F., Brattegard, T., and Holthe, T. 2003. Polychaetes as

surrogates for marine biodiversity: lower taxonomic resolution and

indicator groups. Biodiversity and Conservation 12: 1033-1049.

Orth, R.J., Fleck, K.L. Jr., and Van Montfrans, J. 1984. Faunal

communities in seagrass beds: a review of the influence of plant

structure and prey characteristics on predator-prey relationships.

Estuaries 7: 339-350.

Orth, R.J., Carruthers, T.J.B., Dennison, W.C., Duarte, C.M.,

Fourqurean, J.W., Kenneth, L., Heck, K.L., Hughes, A.R.,

Kendrick, G.A., Kenworthy, W.J., Olyarnik, S., Short, F.T.,

Waycott, M., and Williams, S.L. 2006. A global crisis for seagrass

ecosystems. Bioscience 56: 987-996.

Pearson, T.H., and Rosenberg, R. 1978. Macrobenthic succession in

relation to organic enrichment and pollution in the marine

environment. Oceanography and Marine Biology: an Annual

Review 16: 229-311.

Read, G., and Fauchald, K. (eds). 2013. World Polychaeta database.

Accessed through: World Register of Marine Species at http://

www.marinespecies.org/polychaeta on 2013-09-25

Reish, D.J. 1959. An ecological study of pollution in Los Angeles

Long-Beach harbors, California. Allan Hancock Foundation

Publications. Occasional paper 22: 1-119.

Remane, A. 1934. Die Brackwasserfauna. Verhandlungen der

Deutschen Zoologischen Gesellschaft 36: 34-74.

Rosa Filho, J.S., Busman, D.V., Viana, A.P., Gregorio, A.M.S., and

Oliveira, D.M. 2005. Macrofauna bentonica de zonas entre-mares

nao vegetada do estuario do rio Caete, Braganga, Para. Boletim do

Museu Paraense Emilio Goeldi 2(3): 109-121.

Sanchez-Gil, P., Yanez-Arancibia, A., Ramfrez-Gordillo, J., Day, J.,

and Templet, P. 2004. Some socio-economic indicators in the

Mexican states of the Gulf of Mexico. Ocean & Coastal

Management 47: 581-596.

Santi, L., and Tavares, M. 2009. Polychaete assemblage of an

impacted estuary, Guanabara Bay, Rio de Janeiro, Brazil.

Brazilian Journal of Oceanography 57(4): 287-303.

Sicinski, J., and Janowska, E. 1993 Polychaetes of the shallow

sublittoral of Admiralty Bay, King George Island, South Shetland

Islands. Antarctic Science 5: 161-167.

Silva, R.F., Rosa Filho, J.S., Souza, S.R., and Souza-Filho, P.W. 2011.

Spatial and temporal changes in the structure of soft-bottom

benthic communities in an Amazon estuary (Caete estuary,

Brazil). Journal of Coastal Research SI 64: 440-444.

Snelgrove, P.V.R. 1998. The biodiversity of macrofaunal organism

in the marine sediment. Biodiversity and Conservation 7:

1123-1132.

Snelgrove, P.V.R. 1999. Getting to the bottom of marine biodiversity:

sedimentary habitats. BioScience 49(2): 129-138.

Snelgrove, P.V.R., Blackburn, T.H., Hutchings, P.A., Alongi, D.M.,

Grassle, J.F., Hummel, H., King, G., Koike, I., Lambshead, P.J.D.,

Ramsing, N.B., and Solis-Weiss, V. 1997. The importance of

marine sediment biodiversity in ecosystem processes. Ambio 26:

578-583.

Soto-Galera, E., Piera, J., and Lopez, P. 2010. Spatial and temporal

cover changes in Terminos Lagoon reserve, Mexico. Revista de

Biologia Tropical 58(2): 265-575.

Villeger, S., Ramos-Miranda, J., Flores-Hernandez, D., and Mouillot,

D. 2010. Contrasting changes in taxonomic vs. functional

diversity of tropical fish communities after habitat degradation.

Ecological Applications 20(6): 1512-1522.

WoRMS Editorial Board (2013). World Register of Marine Species.

Available from http://www.marinespecies.org at VLIZ. Accessed

2013-11-19

Yanez-Arancibia, A., and Day, J.W. 2005. Ecosystem functioning: the

basis for sustainable management of Terminos Lagoon, Campeche,

Mexico. Instituto de Ecologfa A.C., Jalapa, Veracruz: Mexico.

76 pp.

Memoirs of Museum Victoria 71:109-121 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Description of a new species of Marphysa Quatrefages, 1865 (Polychaeta:

Eunicidae) from the west coast of Peninsular Malaysia and comparisons with

species from Marphysa Group A from the Indo-West Pacific and Indian Ocean

IzWANDY IDRIS 1,2 * (http://zoobank.org/urn:lsid:zoobank.org:author:8CD057BB-C667-4499-A6E7-CE324B96B467),

PAT HUTCHINGS 3 (http://zoobank.org/urn:lsid:zoobank.org:author:FB643A6D-4A03-427B-BA13-BA92E876FDED) AND

AZIZ ArSHAD 1 (http://zoobank.org/urn:lsid:zoobank.org:author:046547DB-4F65-438B-80E9-42000996AF2D)

1 Faboratory of Aquatic Biology and Ecology, Department of Aquaculture, Faculty of Agriculture, Universiti Putra

Malaysia, 43400, Serdang, Malaysia (azizar.upm@gmail.com)

2 School of Marine Science and Environment, Universiti Malaysia Terengganu, 21030 Kuala Nerus, Terengganu, Malaysia

(izwandy.idris@umt.edu.my)

3 Australian Museum Research Institute, Australian Museum, 6 College Street, Sydney 2010, New South Wales, Australia

(Pat. Hutchings @austmus. gov. au)

* To whom correspondence and reprint requests should be addressed. E-mail: izwandy.idris@umt.edu.my

http://zoobank.Org/urn:lsid:zoobank.org:pub:FC7A68FC-2A8A-45E4-828A-C1299E7CC984

Abstract Idris, I., Hutchings, PA. and Arshad, A. 2014. Description of a new species of Marphysa Quatrefages, 1865 (Polychaeta:

Eunicidae) from the west coast of Peninsular Malaysia and comparisons with species from Marphysa Group A from the

Indo-West Pacific and Indian Ocean. Memoirs of Museum Victoria 71: 109-121.

A new species of Marphysa Quatrefages, 1865 (Polychaeta: Eunicidae) is described from the west coast of

Peninsular Malaysia and compared with species from Marphysa Group A from the Indo-West Pacific and Indian Ocean.

The number of species known within Marphysa Group A has been increased, and the concept that M. mossambica is a

widely distributed species in the Indo-Pacific is refuted. The new species is commercially important and occurs in the

mangrove forest along the west coast of Peninsular Malaysia. Notes on the biology, ecology and commercial aspects of M.

moribidii sp. nov. are presented.

Keywords polychaete, mangrove, intertidal, commercial polychaete, bait worm, Marphysa

Introduction

Studies on polychaete taxonomy in Malaysia are relatively few

compared with those of neighbouring countries (Paxton and

Chou, 2000; Aungtonya et al., 2002; Al-Hakim and Glasby,

2004; Chan, 2009; Rajasekaran and Fernando, 2012).

Publications on polychaetes are scattered, with no specific

taxon targeted; examples of the publications are Ong (1995)

and Nishi (2001). A recent literature review by Idris and

Arshad (2013) indicates that 64 species from 31 families of

polychaete have been identified in Malaysia since 1866.

Nevertheless, with a total 4675 km of Malaysian coastline it is

suggested that the number of polychaete species recorded will

increase with additional studies.

As part of the effort to increase the number of identified

polychaete species in Peninsular Malaysia, a survey was

conducted to identify polychaetes used as baitworms. This

survey identified seven species (from four families) that are

harvested and used regularly by local recreational fishers

(Idris et al., 2012; Idris and Arshad, 2013). One of the species

reported was identified as Marphysa cf. mossambica (Peters,

1854) and it was found along the west coast of Peninsular

Malaysia within the mangrove forest.

The species Marphysa mossambica was initially described

as Eunice mossambica by Peters (1854) with reference to

specimens collected from Mozambique:

“E. mossambica sp., closely related to E. sanguinea

Montagu, but different concerning the position of the antennae

and the position of the eyes. The external antennae do not

protrude beyond the posterior head region and the eyes are

located at the outer part of the basis of the internal antennae.

Distributed in sandy coastal regions, from Mossambique to

Mossimboa, from 11° to 15° south” (sic).

Unfortunately, Peters (1854) description on the species is

too brief and did not mention chaetal types or dentition of the

jaws, which are critical characters for the identification of this

group of worms. Over 100 years later, Fauchald (1987)

examined the lectotype material deposited in the Zoologische

110

I. Idris, P.A. Hutchings & A. Arshad

Museum, Berlin, Germany, (ZMB F2046) and provided a

detailed description of the species.

In 1865, Kinberg identified a specimen from Sydney

Harbour (Port Jackson), Australia, as Nauphanta novaehollandiae

Kinberg, 1865. Many polychaete workers, namely Gravier

(1900), Crossland (1903) and Augener (1922), agreed that N.

novaehollandiae should be synonymised with M. mossambica.

Augener (1922), however, appears to have preferred to use the

name N. novaehollandiae rather than M. mossambica , as the

description made by Kinberg (1865) is more complete. Fauchald

(1987), after examining the lectotype (ZMB F2046) and

paralectotypes (ZMB 47, ZMB 4005), transferred M.

mossambica into the genus Nauphanta as ‘fan-shaped chaetae’

were present and there was a total absence of compound chaetae.

This differs from Fauchald (1970), who proposed that species of

Marphysa could be split into five groups, with one referred to as

Group A, characterised by lacking any composite chaetae; M.

mossambica is included within this group. A recent study by

Glasby and Hutchings (2010) has suggested that the synonymy

of N. novaehollandiae with M. mossambica be reinstated. They

suggested that while Fauchald (1987) regarded the differences

where the branchiae and hooks begin as species specific, in fact

these differences can be due to size-related variation. A more

recent review of the family Eunicidae by Zanol et al. (2014) has

included a new character for M. mossambica—a wide pectinate

chaeta with wide teeth on posterior chaetigers.

Until 2010, Marphysa Group A, comprised only two

species— M. mossambica and M. simplex Treadwell, 1922. The

latter species was then synonymised with M. mossambica

(Glasby and Hutchings, 2010), leaving M. mossambica as the

only species in this group. Nevertheless, a detailed examination

of Marphysa cf. mossambica specimens from Peninsular

Malaysia found consistent morphological differences

compared with the description of M. mossambica that warrant

the description of a new species in Marphysa Group A.

Materials and methods

Figure 1. Locations of Marphysa moribidii sp. nov. in Peninsular

Malaysia: A, Sg. Merbuk estuary, Kedah; B, Kuala Gula, Perak; C,

Kg. Terubong Laut, Perak; D, Kg. Sitiawan, Perak; E, Morib mangrove,

Selangor; F, Kuala Lukut, Negeri Sembilan; G, Bt. 4, Port Dickson,

Negeri Sembilan; H, Tg, Kupang, Johor.

EVO LS15 SEM with a Robinson Backscatter Detector.

Biometric measurements of the width of chaetiger 10 (including

parapodia) and number of chaetigers on which the branchiae

occurred from 35 specimens were made using a stereo

microscope with a calibrated eye graticule. Analysis and graphs

of size-related data were made using Microsoft Excel® 2010.

Ethanol-preserved specimens were deposited at the

Australian Museum, Sydney, (AM) and at the Museum and

Art Gallery of the Northern Territory (NTM), Australia.

Lectotype specimens (ZMB 4005, as stated in the specimen

jar from the Zoologische Museum, Berlin, not ZMB F2046, as

stated in Fauchald (1987)) were re-examined as well as a SEM

stub with parapodia from various regions of the body.

Specimens were collected from various locations on the west

coast of Peninsular Malaysia (fig. 1). Malaysia is located in the

central part of south-east Asia and consists of two land masses

— Peninsular Malaysia and east Malaysia. Peninsular

Malaysia is a land bordered with Thailand in the north, while

Indonesia and Singapore share the maritime limits in the west

and south, respectively. The east Malaysia consist of two states

i.e. Sabah and Sarawak. Both states are located on the northern

part of Borneo island, sharing land border with Indonesia in

the south, while Philippines share the maritime border at the

east of Sabah. A sovereign Brunei is located on the upper part

of the state border between Sabah and Sarawak.

All sampling locations on the west coast of Peninsular

Malaysia are similar in terms of habitat — mangrove forest

and mudflats. Specimens were relaxed in 7% MgCl, then fixed

in 10% formalin and later preserved in 70% ethanol.

Material was examined using stereo (Olympus SZ) and

compound (Nikon Eclipse E400) microscopes. Detail characters

on parapodia 3, 10, 20, 50, 100, 150, 260, 400 and 456 were

observed using the scanning electron microscope (SEM) Zeiss

Abbreviations

AM Australian Museum, Sydney

NTM Museum and Art Gallery of the Northern Territory,

Australia

ZMB Zoologische Museum, Berlin, Germany

Systematics

Order Eunicida Dales, 1962

Family Eunicidae Berthold, 1827

Genus Marphysa Quatrefages, 1865

Marphysa moribidii Idris, Hutchings and Arshad sp. nov.

Zoobank LSID. http://z 00 bank. 0 rg/urn:lsid:z 00 bank. 0 rg:act:

C693255A-0A15-4162-B9D2-B4EFAFD0C341

Figures 2, 3, 4

New Marphysa species from Peninsular Malaysia

111

Figure 2. Marphysa moribidii sp. nov. [A] anterior section, lateral view. Note on the white spots on the epidermis of the specimen; [B], anterior

section, dorsal view, showing the palpophore (I) and ceratophores (II); [C] mandible; [D] maxillae. [A, B, C] from non-type specimens; [D], from

holotype (AM W43731). Mx = Maxillae. Scale bars: [A, B, C, D] = 1 mm.

112

I. Idris, P.A. Hutchings & A. Arshad

Figure 3. Marphysa moribidiii sp. nov., [A] limbate and simple capillary chaetae, chaetiger 3; [B] symmetrical pectinate chaeta on the supra-

position (arrow), chaetiger 50; [C] asymmetrical pectinate chaetae (arrow), chaetiger 10; [D] whole parapodium with branchia, showing relative

length with notopodial cirrus, chaetiger 150; [E] sub-acicular hook (arrow), chaetiger 150. Brc = Branchia; Ntp = Notopodial cirrus; Neu =

Neuropodial cirrus. [A, C, D, E] = Paratype, AM W38692; [B] = Non-type (AM W38687). Scale bars: [A, D, E] = 100 pm\ [B, C] = 20 pm.

New Marphysa species from Peninsular Malaysia

113

Figure 4. Marphysa moribidii sp. nov. [A] details of symmetrical pectinate chaetae, chaetiger 20; [B] wide pectinate chaeta with wide teeth

(W-pct), dorsal view, chaetiger 400; [C] asymmetrical pectinate chaetae, all types, chaetiger 456; [D] (arrow) detail of bidentate sub-acicular

hook, chaetiger 98. Asym-bd = asymmetrical pectinate with broad shaft; Asym-ns = asymmetrical pectinate with narrow shaft; [A] = non-type

(AM W38687); [B, C] = holotype (AM W43731), [D] = non-type specimen. Scale bars: [A] = 3 pm\ [B, C, D] = 20 pm.

114

I. Idris, P.A. Hutchings & A. Arshad

Material examined. Holotype. AM W43731 - male, complete, Pantai

Kelanang, Morib, Selangor, 2.75827°N 101.4379°E, coll. I. Idris 19 Jul

2012.

Paratypes. AM W38690 - 2 specs (1 male and 1 female), AM

W38691 - 1 female, AM W38692 - 1 female, NTM W024777 - 1

spec. Data same as holotype.

Other material examined : AM W38684 - 1 female complete, NTM

W024778 - 1 spec., Sg. Merbuk tributary, 5.6392°N 100.4138°E (range

10 km), coll, local bait digger 9 Feb 2011; AM W38685 - 2 females,

NTM W024776 - 1 spec.. Kg. Terubong Laut, Larut, Perak, 4.5659°N

100.6557°E (range 2 km), coll, local bait digger 8 Feb 2011; AM W38686

- 1 male, Kuala Gula, Perak, 4.9285°N 100.5086°'E (range 5 km), coll,

local bait digger 11 Feb. 2011; AM W38689 - 1 male, Tg. Kupang (2nd

link bridge), Johore, 1.3956°N 103.6221°E, coll. I. Idris 5 Nov 2010; AM

W38693 - 2 males. Kg. Sitiawan, Lumut, Perak, 4.2498°N 100.6893°E,

coll, local bait digger 8 Feb 2011; AM W38694 -1 male, NTM W024775

- 1 spec., Bt. 4, Port Dickson, Negeri Sembilan, 2.5034°N 101.8352°E

(range 2 km), coll, local bait digger 20 Jan 2011; AM W38695 - 1

female, NTM W024774 - 1 spec., Kuala Lukut, Negeri Sembilan,

2.5698°N 101.7945°E, coll, local bait digger 20 Jan 2011.

Comparative material examined. Eunice mossambica ZMB 4005

Lectotype - female, Mozambique, coll, and det. Peters 1854; Marphysa

mossambica AM W35469 - female, Dumangas, Iloilo, Philippines,

10.7968°N 122.6695°E, coll. J. Monteros-Recente 7 May 2010, det.

C.J. Glasby.

Measurement. Holotype. Mature male (with gametes visible

through body wall in parapodia on anterior and mid body

segments), complete specimen total length of 333 mm in

preserved solution (70% ethanol). Body width at chaetiger 10

(with parapodia) 9.76 mm, total number of segments 465.

Paratypes mostly incomplete, body width at chaetiger 10 (with

parapodia) 4.8 - 8.0 mm. Longest preserved specimen is AM

W38684, with total length of 612 mm and 780 segments.

Description. Holotype (paratype values in parentheses). Body

long and slender. Cylindrical at anteriormost part of

metastomium until chaetiger 7 (3 - 7) but gradually becoming

flattened dorsoventrally towards posterior end. Live worm with

blood red branchiae. Anterior metastomium dark red gradually

became lighter, slightly transparent towards posterior allowing

the alimentary canal to be seen. Preserved specimen olive

green with white spots dorsoventrally distributed on anterior;

continue mid-dorsally along metastomium to about one-quarter

of the body length (figs. 2A and B). White spots visible on live

specimen, but faint and not detected on some specimens if the

worm was not completely cleaned of adhering sediment.

Prostomium consists of semi-circular, bilobed upper lips

with distinct middle notch, appearing as if two lobes present

(fig. 2B). Prostomium surface and appendages with almost

smooth surface, without articulations. Prostomium appendages

slightly curved. Median antenna about the same length as

lateral antennae and slightly longer than palps (0.2 - 0.5 times

longer). Antennae (median and lateral) about twice the length

of the prostomium. Ceratophores and palpophores present,

cylindrical, short, with no articulations (fig. 2B). No gap

between palps and lateral antennae, but small gaps exist

between median and lateral antennae. Eyes absent.

Peristomium consists of two rings with length of first ring

about 2.5 times longer than second ring. Dorsal part of first

ring slightly longer than ventral side including peristomium

fold. Lateral and ventral sides of first peristomium ring (lateral

and lower lips) covered with abundant folds (fig. 2A).

Mandibles dark brown but with white calcified layer on cutting

plates (paratype: transparent cutting plates). Cutting plate sub-

oval, flat, no dentition on cutting edge, slightly rough surface

with carrier almost parallel (fig. 2C). Maxillae dark brown but

becoming paler on edge (fig. 2D). Dental formulae: Mxl = 1 +

1, MxII = 4 + 4 (4 + 5 - 6), MxIII = 6 + 0 (8 + 0), MxIV = 4 +

8 (7 + 8) and MxV = 1 + 1 (1 + 1). MxVI is absent.

Parapodia consisting of notopodial and neuropodial cirri,

as well as post-chaetal lobe. Pre-chaetal lobe absent (fig. 3A).

Notopodial cirri gradually change from subulate to conical

towards posterior parapodia. Neuropodia initially with conical

cirri gradually becoming sub-conical towards posterior end.

Base of notopodial cirri sub-ovulate in anterior chaetigers

without inflation but gradually becoming circular in median

and posterior chaetigers. Post-chaetal lobe sub-conical in first

chaetiger, gradually becoming sub-triangular by chaetiger

three, low and broad from chaetiger four to around chaetiger

130, then gradually decreasing in size from chaetiger 131

towards posterior end. Branchiae first emerge from base of

dorsal cirri at chaetiger 35 (33 - 39) and disappear by last 20

chaetigers. Number of branchial filaments gradually increases

from one to maximum 11 (6 - 14), filaments arranged as

pectinate type in mid-body, number of filaments decreases to

one filament on posterior segments (fig. 3D). Length of

branchial stem shorter than neuropodial cirri by chaetiger 35

(33 - 39), the chaetiger on which branchiae first emerge.

Branchial stem length then gradually increases until about 10

- 15 times longer than notopodial cirri by chaetiger 70, where

maximum number of branchial filaments is reached (13 in

type specimens, 14 in non-types).

Chaetae divided into two fascicles: supra-acicular and sub-

acicular chaetae with aciculae located in middle (lateral view)

(fig. 3A). Six types of chaetae present: thick limbate; slender

capillary; symmetrical pectinate; asymmetrical pectinate with

narrow shaft; asymmetrical pectinate chaetae with broad

shaft; and wide pectinate chaetae with wide teeth (figs. 3B, C;

figs. 4A, B, C). Limbate chaetae longer and thicker than

capillaries but both serrated. Limbate and capillary chaetae

present in both fascicles throughout body. Number of limbate

chaetae range from 28 - 41 until about chaetiger 100 and then

reducing to 13 - 19 chaetae in posterior region. Capillary

chaetae present in small numbers (<10) throughout.

Symmetrical pectinate chaetae characterized as having both

outer teeth of the same length with slender shaft (fig. 3B; fig.

4A). Symmetrical pectinate chaetae present from chaetiger

five (chaetiger three in paratype), apparently absent after

chaetiger five until chaetiger 50, then present again from

chaetiger 51 onwards. Asymmetrical pectinate chaetae only

present from chaetiger 100 onwards in type specimens and

characterised as having the outer teeth of different length to

the median teeth with broad or narrow shafts (fig. 3C, figs. 4B,

C). The wide-toothed pectinate chaetae with wide body are

present in holotype from about chaetiger 400 onwards (figs.

4B, C). Numbers of pectinate chaetae per parapodia ranged

from one to six for both holotype and paratypes. Aciculae 3 -

New Marphysa species from Peninsular Malaysia

115

500 600 7.00 8.00 9 00 1000 1100 12-00

Body width (mm) at chaetiger 10 with parapodia

Figure 5. Relationships between body width (at chaetiger 10 with parapodia) and [A], first chaetiger with branchiae; and [B], first chaetiger with

subacicular hook of Marphysa moribidii sp. nov., from Morib mangrove, Malaysia. Regression equations and coefficients are for all data points

(n = 35).

4 per parapodium, dark brown, distally pointed, and arranged

straight and almost parallel between fascicles. No sub-acicular

hooks in holotype; however in paratypes, bidentate hooks

present from median chaetiger (chaetiger 71 in one paratype

only), but occurring irregularly.

Pygidium typical of Marphysa species, two pairs of

unequally sized pygidial cirri inserted ventrally, arranged on

top of each other. Largest: dorsal, two times height of

pygidium, smallest about one-quarter height of pygidium.

Etymology. The name ‘ moribidii ’ refers to the location (Morib

mangrove) where the type specimens were collected. Morib is

also the landing site of the 46 th Indian Beach Group under the

Allied Forces to mark the end of the Japanese occupation of

Malaya in 1945. The local name for Marphysa moribidii is ruat

bakau (mangrove worm).

Intraspecific variation. Information on the morphological

variation present in this species is based upon detailed examination

of 914 specimens collected from the type locality from June 2011

to December 2012. However, of these, only 136 specimens were

complete. The large number of incomplete specimens was due to

the method of collecting by digging with a shovel and the fragility

of the animals. Length of complete specimens in preserved 70%

ethanol ranges from 7 - 477 mm, with the number of chaetigers

varying from 113 - 580. However, there is an incomplete specimen

with 600 chaetigers, indicating that the number of chaetigers can

be higher or similar to the longest deposited specimen (AM

W38684). Body colour varies from dark olive green to light

brown. In some specimens, the white spots are absent.

Peristomium flap on the anterior of first ring can extend until it

covers the ceratophores and palpophores. However, in some

specimens, the flap was not detected or was reduced.

The chaetiger number at which the branchiae commence

varies greatly in non-type specimens. The branchiae begin

from chaetiger 4 - 63 as a single filament (in some specimens

two to three filaments) and can reach a maximum number of

14 filaments in non-type specimens. The distribution of

bidentate, sub-acicular hooks is irregular; they are present

from chaetiger 44 in some specimens (figs. 3E, 4D). Some

specimens also possess two bidentate sub-acicular hooks at

the midsection of the body (chaetigers 60 - 78).

The relationship between body width at chaetiger 10 and the

chaetiger on which the branchiae appear (fig. 5A) shows a

significant positive linear relationship ( R 2 = 0.21; n = 35;p< 0.05).

The positive relationship for these morphological

characters is similar to that found in M. cf. mossambica and

occurring in the synonymised M. novaehollandiae (Glasby and

Hutchings, 2010). However, the correlation value of M.

moribidii and M. cf. mossambica differs significantly between

the two species (c = 3.19, p < 0.05).

Moreover, the relationship between body width and the

chaetiger on which the sub-acicular hook appears (fig. 5B) is

not statistically significant ( R 2 = 0.05; n = 35\p> 0.05). Thus

the appearance of sub-acicular hooks on the parapodia is not

in a predictable pattern for M. moribidii sp.nov.

116

I. Idris, P.A. Hutchings & A. Arshad

Table 1. Morphological comparison between Marphysa moribidii sp. nov., Marphysa mossambica and Marphysa cf. mossambica (sensu

Fauchald, 1987 and sensu Glasby and Hutchings, 2010) from Australia. Variations (ranges) in population in parentheses. "Distinguishing

characteristic.

Characteristics

Marphysa moribidii

sp. nov. (present

study)

Eunice (Marphysa)

mossambica

(Lectotype; Fauchald

1987 and present

study)

Nauphanta

novaehollandiae

(Marphysa cf.

mossambica (sensu

Fauchald 1987))

Marphysa cf.

mossambica (sensu

Glasby and

Hutchings, 2010)

Location

West coast of Peninsular

Malaysia (type locality:

Morib mangrove)

South-west of Indian

Ocean (Mozambique)

South-west Pacific

Ocean (Australia)

Arafura Sea, south-east

Indian Ocean

(Australia)

Preserved body length

(mm) (chaetiger 10 inch

parapodium)

9.8(7.1-47.7)

40 (measured at

chaetiger 20)

(2.2 - 9.0)

Body shape

Rounded initially, but

becoming flatter

starting from chaetiger

7 towards posterior

Rounded until chaetiger

10, then flattened

towards posterior

Not mentioned

Rounded initially,

flattened in middle and

posterior body

Body pigmentation 3

Olive green with white

spots on dorsal and

ventral sides of anterior

section

Not mentioned (no

white spots, light brown

pigmentation; pers. obs.)

Not mentioned

No pigmentation

Prostomium shape

Anteriorly truncate,

bilobed with distinct

mid notch

Frontally truncate,

bilobed with shallow

mid notch

Anteriorly truncate,

bilobed with distinct

mid notch

Bilobed

Prostomium appendages

(surface)

Smooth throughout

Ceratophore

Present

Median antenna (length

relative to palps)

Slightly longer than

palps

Mid antenna reaching to

chaetiger 3

Slightly longer

Twice length of palps

Median antenna (length

relative to prostomium)

About ~1 time (2 times)

length of prostomium

1.5 times longer than

prostomium

Reaching chaetiger 2

About 1.5 times length

of prostomium

Mandibles

Flat, dark-brown carrier

and calcerous layer on

cutting plate

Not mentioned (light

brown, transparent at

the edge; pers. obs.)

Not mentioned

Dark brown; lighter-

coloured cutting plate

Maxillae

Dark brown, but

becoming lighter at the

edge

Not mentioned

Brown, edges and

sutures darker brown

Mxl (number of teeth; left

+ right)

1 + 1

MxII (number of teeth;

left + right)

4 + 4 (5 - 6)

(5-7)+ (5-7)

5 + 6

(5-7)

MxIII (number of teeth;

6 (8) + 0

(4-7)+ 0

? + 0

left + right)

New Marphysa species from Peninsular Malaysia

117

Characteristics

Marphysa moribidii

sp. nov. (present

study)

Eunice (Marphysa)

mossambica

(Lectotype; Fauchald

1987 and present

study)

Nauphanta

novaehollandiae

(Marphysa cf

mossambica ( sensu

Fauchald 1987))

Marphysa cf.

mossambica ( sensu

Glasby and

Hutchings, 2010)

MxIV (number of teeth;

left + right)

4 (7) + 8

(4-5)+ (8-9)

? + 8

MxV (number of teeth;

left + right)

1 + 1

?+ 1

Branchiae - first chaetiger

emerges 3

35 (4 - 63)

(30-49)

(14-46)

Branchiae - last chaetiger

emerges

About 20 chaetigers

before pygidium

About 20 - 25

chaetigers before

pygidium

Not mentioned

About 20 - 25

chaetigers before

pygidium

Branchiae - max.

filaments 3

11 (14)

Post-chaetal lobe - shape

anteriorly

First chaetiger:

sub-conical but

gradually becoming

subtriangular, low and

broad and slightly

bilobed after chaetiger

100

Pre- and post-chaetal

lobes continuous around

dorsal edge of

neuropodium

Low and broad

Pectinate chaetae - first

present 3

Present from chaetiger 5

(3)

Present on mid-body

chaetigers (-100)

Present beginning from

the mid-section towards

posterior

Present on first few

chaetigers

Pectinate chaetae -

symmetry 3

Four types -

1. Symmetrical, narrow

shaft with thin teeth

(~30)

2. Asymmetrical with

thinner teeth (>30) and

broad shaft

3. Asymmetrical with

thinner teeth (<30) with

narrow shaft

4. Wide body with wide

teeth (-8)

Three types of

asymmetrical (no.

teeth):

1. Coarse teeth (-30)

with broad shaft

2. Thinner teeth (-30)

with narrow shaft

3. Wide body with wide

teeth (-8)

Pectinate

(symmetrical?) on

anterior segment and

fan chaetae

(asymmetrical?) on

posterior segments

Asymmetrical pectinate

chaetae throughout

Pectinate chaetae: no. of

teeth (anterior)

Not mentioned

(15-25)

Pectinate chaetae - no. of

teeth (midbody and

posterior chaetigers)

Up to 50 teeth

Fan chaetae - -35 teeth

(30-40)

Pectinate chaetae - no.

per parapodia 3

(1-6)

(1 - 10)

No info on pectinate

chaetae, but fan chaetae

(0-2)

are > 2

118

I. Idris, P.A. Hutchings & A. Arshad

Characteristics

Marphysa moribidii

sp. nov. (present

study)

Eunice (Marphysa)

mossambica

(Lectotype; Fauchald

1987 and present

study)

Nauphanta

novaehollandiae

(Marphysa cf

mossambica (sensu

Fauchald 1987))

Marphysa cf.

mossambica (sensu

Glasby and

Hutchings, 2010)

Pectinate chaetae - outer

teeth

Slightly longer than

inner teeth

Long thickened superior

edge

Pectinate chaetae -

similar length for outer

and inner teeth

Slightly longer than

inner teeth, one longer

than other

Sub-acicular limbate

capillaries

Present

Sub-acicular limbate

capillaries - first present

Chaetiger 1

Sub-acicular hooks

Absent (present)

Present

Sub-acicular hooks - tips

Hooded, bidentate

Bidentate

Sub-acicular hooks - first

chaetiger

(44 - 100); irregular

pattern

(58 - 73); irregular

pattern

44; irregular pattern

58 (23 - 68)

Sub-acicular hooks - max

no.

Not mentioned

Aciculae - max no.

Not mentioned

Aciculae - colour

Dark brown

Dark to light brown

Brown

Pygidium

2 pairs of cirri located

on the ventral side (one

long pair, one short-and-

small pair)

Not mentioned

Biology and ecology. Marphysa moribidii sp. nov. is dioecious

and iteroparous. This can be seen by the presence of oocytes of

varying sizes in every month (Idris et al., in prep.). Sexual

dimorphism is not present in M. moribidii sp. nov. The

population at the type locality (Morib mangrove) (fig. 1) is

unevenly distributed and can be found down to depths of about

450 mm from the surface in the mangrove area with Rhizophora

apiculata , Avicennia alba and Sonneratia caseolaris. The new

species is a sub-surface deposit feeder based on analysis of its

intestinal contents (Idris et al., in prep.).

Distribution. Along the Straits of Malacca, Singapore, in the

mangrove area with Rhizophora spp., Avicennia alba and

Sonneratia caseolaris.

Economic exploitation. M. moribidii sp. nov. is one of the

polychaete species harvested as bait worms in Peninsular

Malaysia (Idris and Arshad, 2013). The species is harvested

and sold in Malaysian states along the Straits of Malacca,

except Perlis. Five to ten individuals of M. moribidii sp. nov.

(mostly incomplete) are sold for MYR10 (~US$3). Although

the M. moribidii sp. nov. fishery is currently unregulated and

undocumented, selling of this species is believed to have been

conducted for many years. Most bait diggers harvest the species

either on a part-time basis (mainly on weekends due to low

demand on weekdays, except for school and public holidays) or

for personal use. Some bait diggers also sell worms to fishing

shops or are contracted by them to collect the worms.

Fortunately, harvesting and selling of M. moribidii sp. nov. is

very localized since the worms do not live outside their natural

habitat for a long period (2-3 days), and coelomic fluid from

broken specimens has been found to accelerate the mortality of

other worms when packed together (pers. obs.).

New Marphysa species from Peninsular Malaysia

119

Marphysa mossambica (Peters, 1854)

Marphysa mossambica Gravier, 1900: 267, pi. 14, figs 89-90,

text figs 137-139.—Crossland, 1903: 139-140, pi. 15, figs

7-10.—Day 1967, 395, fig. 17.5 i-m.

Synonymy.

Eunice mossambica Peters, 1854: 612.

Nauphanta novaehollandiae Kinberg, 1865: 564; 1910: 43,

pi. 16, fig. 23, 23B, C, F ,G.

Marphysa simplex Treadwell, 1922: 151-152, text-fig. 39, pi.

5, figs 8-12.

Nauphanta mossambica Fauchald, 1987: 376-378, fig. 1.

Figure 6.

Material examined. Lectotype. ZMB 4005 - complete, female.

Paralectotypes. (6): ZMB 47 and ZMB F2046, all specimens were

collected at Mc^ambique, coll. Peters 1854.

Remarks. We re-examined the lectotype (ZMB 4005) and the

associated SEM stubs used in Zanol et al. (2014). The anterior

section was photographed while the following parapodia have

been mounted: 2, 32, 96, 160, 224 and 252. The anterior

section of M. mossambica is light brown and the white spots

absent (fig. 6A). The limbate chaetae are observed throughout

the chaetigers (fig. 6B). We observed that M. mossambica has

three types of pectinate (described as ‘fan’ by Fauchald,

1987) chaetae: two asymmetrical and one with few teeth (figs.

6C, D, E), confirming the observations of Zanol et al. (2014).

The first asymmetrical type consists of chaetae with about 30

teeth with broad shaft (figs. 6C, D), while the second

asymmetrical type also has about 30 teeth but with shaft

narrower than the first type (fig. 6E). The other type, with

only eight to nine large saw-like teeth (identified as ‘wide¬

toothed pectinate’ by Zanol et al. 2014) is situated basally to

the asymmetrical pectinate chaetae (figs. 6C, D). This type of

pectinate chaeta only appears in posterior chaetigers (found

in chaetigers 224 and 252) at the base of the chaetal fascicle

and is easily obscured by limbate chaetae and other pectinate

chaetae. We were able to observe this type of chaeta under

SEM (also observed under SEM by Zanol et al. 2014) and

only under light microscope with careful adjustment, which

may explain why Fauchald (1987) failed to describe them

when he re-examined the lectotype. Fauchald (1987, his figs,

lb, c) illustrates two types of pectinate chaetae, varying in the

number of teeth—one with about 20 and one with 40, neither

markedly asymmetrical, although, as seen in figs. 6C - E,

they are clearly asymmetrical. These two types of pectinate

chaetae are present from the early mid-body (>30 segments),

which contradicts an earlier observation by Fauchald (1987),

that they do not occur until after parapodia 100.

Glasby and Hutchings (2010) recorded M. mossambica

from various locations in Australia, but did not examine the

lectotype, relying on Fauchald’s (1987) revised description.

Re-examination of other Australian material from Queensland

identified as this species (AM W33021) under the SEM did not

reveal the pectinate chaetae with only 8-9 teeth, and we now

believe that the Australian material listed by Glasby and

Hutchings (2010) needs to be re-examined as it may represent

another undescribed species in this complex (we are now

referring to it as Marphysa cf. mossambica until further studies

are completed).

Discussion

With the exception of the pectinate chaetae types and

characters on M. mossambica, all three species (M. moribidii,

M. mossambica and M. cf. mossambica) are difficult to

differentiate due to the subtlety of their differences. Details of

M. moribidii and comparisons with the other two sibling

species are shown in table 1.

Our study highlights the need for obtaining complete

specimens to allow examination of parapodia from all sections

of the animal. This is probably why specimens from the

western part of the Indian Ocean are still being identified as

M. mossambica. The specimens nearest to M. mossambica

were identified in Singapore (Chan, 2009), India (Nicobar Is.)

(Rajasekaran and Fernando, 2012) and the Taiwan Straits

(Paxton and Chou, 2000). We suggest that specimens from

these locations as well as other parts of the Western Pacific

should be re-examined. In particular, the posterior chaetigers

need to be studied in order to determine the presence or

absence of wide pectinate chaetae with wide teeth.

Although Marphysa is a species-rich genus (Orensanz,

1990), some species have been described as having a

cosmopolitan distribution. One is M. sanguinea Montagu,

1813, which has been reported from all oceans of both

northern and southern hemispheres, except for the polar

regions (see Day, 1967; Miura, 1977; Gathof, 1984; Paxton

and Chou, 2000; Prevedelli et al., 2007). However, Hutchings

and Karageorgopoulos (2003), as well as Lewis and

Karageorgopoulos (2008), have challenged the cosmopolitan

status of M. sanguinea. Hutchings and Karageorgopoulos

(2003) suggest that the distribution of M. sanguinea is

restricted to northern Europe, and that records from other

parts of the world should be checked. Certainly, the records

of M. sanguinea from South Africa have been found to

represent another species (Lewis and Karageorgopoulos,

2008), and this has been confirmed both morphologically and

molecularly.

Acknowledgements

Help with fieldwork from students and staff of the Marine

Biotechnology Laboratory at the Institute of Bioscience,

Universiti Putra Malaysia was greatly appreciated, as were

useful comments received from the two anonymous reviewers.

Thanks also go to Sue Lindsay from the Australian Museum

for fantastic SEM images and Sandy Ritcher (University of

Leipzig, Germany) for translation of Peters (1854). This

project was partly funded by the Research University Grant

Scheme (RUGS): Grant No. 9300303 awarded to Izwandy

Idris and Aziz Arshad. The Australian Museum generously

awarded a student grant to the first author, enabling attendance

at the 11 th International Polychaete Conference (Sydney) to

present this paper.

120

I. Idris, P.A. Hutchings & A. Arshad

Figure 6. Marphysa mossambica. [A] anterior section, lateral view; [B] limbate chaetae, unique character for Group. A, chaetiger 2; [C] two types

of pectinate chaetae (arrows), I: wide teeth and wide body, and II: asymmetrical pectinate with broad shaft, chaetiger 224; [D] details of pectinate

chaetae, I: wide teeth and wide body, and II: asymmetrical pectinate with broad shaft, showing the cryptic position of wide teeth and wide body

chaeta, chaetiger 224; [E] another type of pectinate chaeta, asymmetrical pectinate with narrow shaft, chaetiger 224. Scale bars: [A] = 5 mm; [B,

C] = 100 pm\ [D, E] = 10 pm. All images are from the lectotype (ZMB 4005).

New Marphysa species from Peninsular Malaysia

121

References

Al-Hakim, I., and Glasby, C.J. 2004. Polychaeta (Annelida) of the

Natuna Islands, South China Sea. Raffles Bulletin of Zoology

Supplement No. 11: 25-45.

Augener, H. 1922. Revision der australischen Polychaeten-Typen von

Kinberg. Arkivfor Zoologi 14: 1-42.

Aungtonya, C., Thaipal, S., and Bussarawit, S. 2002. A list of

polychaetes (Annelida) in the reference collection database of the

Phuket Marine Biological Center, Thailand. Phuket Marine

Biological Center Special Publication 24: 21-32.

Berthold, A. A. 1827. Latreille’s Naturliche Familien des Thierreichs.

Aus dem Franzosischen, mit Anmerkungen und Zusatzen Wiemar:

Verlage Landes-Industrie-Comptoirs. 606 pp.

Chan, W.M.F. 2009. New nereidid records (Annelida: Polychaeta)

from mangroves and sediment flats of Singapore. Raffles Bulletin

of Zoology. Supplement No. 22: 159-172.

Crossland, C. 1903. On the marine fauna of Zanzibar and British East

Africa, from collections made by Cyril Crossland in the years

1901 and 1902. Polychaeta. Part II. Proceedings of the Zoological

Society of London 73: 129-144.

Dales, R. P. 1962. The polychaete stomodeum and the inter¬

relationships of the families of Polychaeta. Proceedings of the

Zoological Society of London, 139(3): 389-428.

Day, J.H. 1967. A monograph on the Polychaeta of Southern Africa.

Part 1: Errantia. Trustees of the British Museum (Natural

History): London. 458 pp.

Fauchald, K. 1970. Polychaetous annelids of the families Eunicidae,

Lumbrineridae, Iphitimidae, Arabellidae, Lysaretidae and

Dorvilleidae from Western Mexico. Allan Hancock Monographs in

Marine Biology, No. 5. Allan Hancock Foundation, University of

Southern California: Los Angeles, California. 335 pp.

Fauchald, K. 1987. Redescription of the genus Nauphanta Kinberg,

1865 (Polychaeta: Eunicidae). Proceedings of the Biological

Society of Washington 100(2): 375-380.

Gathof, J.M. 1984. Family Eunicidae Savigny, 1818. Pp. 1-31 in:

Uebelacker, J.M. and Johnson, P.G. (eds). Taxonomic guide to the

polychaetes of the Northern Gulf of Mexico, Vol. 6. Barry A. Vittor

& Associates: Alabama.

Glasby, C.J., and Hutchings, P.A. 2010. A new species of Marphysa

Quatrefages, 1865 (Polychaeta: Eunicida: Eunicidae) from

northern Australia and a review of similar taxa from the Indo-

West Pacific, including the genus Nauphanta Kinberg, 1865.

Zootaxa 2352: 29-45.

Gravier, C. 1900. Contribution a l’etude des Annelides Polychetes de

la Mer Rouge. In E. C. Masson (Ed.), Nouvelles Archives du

Museum d’Histoire Naturelle. Paris: Libraires de PAcademie de

Medecine. 2: 137-282.

Hutchings, P.A., and Karageorgopoulos, P. 2003. Designation of a

neotype of Marphysa sanguinea (Montagu, 1813) and a description

of a new species of Marphysa from eastern Australia.

Hydrobiologia 496: 87-94.

Idris, I., and Arshad, A. 2013. Checklist of polychaetous annelids in

Malaysia with redescription of two commercially exploited species.

Asian Journal of Animal and Veterinary Advances 8: 409-436.

Idris I., Glasby C.J., and Arshad, A. 2012. Nereididae (Annnelida:

Polychaeta) used as baitworms in Peninsular Malaysia. Pp. 239-

250 in: Mohamed-Zin, W.W.M.K. (ed.), UMT Postgraduate

Conference 2012. Corns Hotel, Kuala Lumpur, 5-7 July 2012.

Kinberg, J.G.H. 1865. Annatula nova. Ofversight af Forhandlingar

Konglia Vetenskaps-Akademiens 22: 167-179, 238-258.

Lewis, C., and Karageorgopoulos, P. 2008. A new species of Marphysa

(Eunicidae) from the Western Cape of South Africa. Journal of

the Marine Biological Association of the United Kingdom 88:

277-287.

Miura, T. 1977. Eunicid polychaetous annelids from Japan. II. La Mer

15: 61-81.

Montagu, G. 1813. Descriptions of several new or rare animals,

principally marine, discovered on the South Coast of Devonshire.

Transactions of the Linnean Society of London, 11(1): 1-26.

Nishi, E. 2001. A new species of scaleworm, Grubeulepis malayensis

(Annelida: Polychaeta: Eulepethidae), from Morib Beach,

Malaysia, living in Chaetopterid tubes. Species Diversity 6: 1-9.

Ong, B. 1995. Polychaetes of Telok Aling, Penang, Malaysia. Raffles

Bulletin of Zoology 43: 257-283.

Orensanz, J.M. 1990. The eunicemorph polychaete annelids from

Antarctic and Subantarctic seas: with addenda to the

Eunicemorpha of Argentina, Chile, New Zealand, Australia, and

the southern Indian Ocean. Pp. 1-183 in: Kornicker, L.S. (ed.).

Biology of the Antarctic Seas XXI, Antarctic Research Series, Vol.

52. American Geophysical Union: Washington DC.

Paxton, H., and Chou, L.M. 2000. Polychaetous annelids from the

South China Sea. Raffles Bulletin of Zoology. Supplement No. 8:

209-232.

Peters W.C.H. 1854. Uher die Gattung Bdella, Savigny, (Limnatis,

Moquin-Tandon) und die in Mossambique beobachteten Anneliden,

wovon hier eine Mittheilung folgt [informal title in meeting report].

Akademie der Wissenschaften zu Berlin, Monatsberichten,

Bericht liber die zur Bekanntmachung geeigneten Verhandlungen

der Koniglichen Preussischen Akademie der Wissenschaften zu

Berlin: Berlin.

Prevedelli, D., Massamba N'Siala, G., Ansaloni, I., and Simonini, R.

2007. Life cycle of Marphysa sanguinea (Polychaeta: Eunicidae)

in the Venice Lagoon (Italy). Marine Ecology 28: 384-393.

Quatrefages, A. de. 1865. Histoire naturelle des Anneles marins et

d’eau douce. Annelides et Gephyriens. Vol. 1. Paris: Librarie

Encyclopedique de Roret. 588 pp

Rajasekaran R., and Fernando O.J. 2012. Polychaetes of Andaman and

Nicobar Islands. Pp. 1-22 in: Venkataraman, K., Raghunathan, C.

and Sivaperuman, C. (eds). Ecology of faunal communities on the

Andaman and Nicobar Island. Springer: Heidelberg.

Treadwell, A. L. (1922). Leodicidae from Fiji and Samoa. Publications

of the Carnegie Institution of Washington 312: 127-170, 8 plates,

68 figs.

Zanol, J., Halanych, K.M., and Fauchald, K. 2014. Reconciling

taxonomy and phylogeny in the bristleworm family Eunicidae

(Polychaete, Annelida). Zoologica Scripta 43(1): 79-100.

Memoirs of Museum Victoria 71:123-159 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Written in stone: history of serpulid polychaetes through time

Alexei P. IPPOLITOV 1 ’*, OlEV VlNN 2 , Elena K. Kupriyanova 3 (http://zoobank.org/urn:lsid:zoobank.org:author:D0BE23CD-F6C3-

4FE8-AB09-EBD4B9A55D0B) AND MANFRED JAGER 4

1 Geological Institute of Russian Academy of Sciences, 7 Pyzhevski Lane, Moscow, Russia; (ippolitov.ap@gmail.com)

2 Department of Geology, University of Tartu, Ravila 14A, 50411, Tartu, Estonia; (olev.vinn@ut.ee)

3 Australian Museum Research Institute, 6 College Street, Sydney, NSW 2010, Australia; (elena.kupriyanova@austmus.gov.au)

4 Lindenstral3e 53,72348 Rosenfeld, Germany; (langstein.jaeger@web.de)

1 to whom correspondence and requests for reprints should be addressed. Email: ippolitov.ap@gmail.com

Abstract

Keywords

Ippolitov, A.P., Vinn, O., Kupriyanova, E.K. and Jager, M. 2014. Written in stone: history of serpulid polychaetes through

time. Memoirs of Museum Victoria 71: 123-159.

Although the fossil record of annelids in general is poor, calcareous tube-building Serpulidae are a notable

exception. The “stumbling block” of understanding the serpulid fossil record is obtaining reliable taxonomic interpretations

of fossil tubes based on morphology. Luckily, serpulid tubes demonstrate high variety of ultrastructures and nonuniform

mineralogical composition, which can be used as new tools for decrypting the fossil record. Ancient Late Ediacaran (580-

541 Ma) and Paleozoic (541-252 Ma) rocks contain diverse tubicolous fossils that have often been erroneously interpreted

as annelids, and serpulids, in particular. Palaeozoic to Middle Jurassic coiled spirorbiform tubes, often referred to as

Spirorbis, had been shown to be microconchids, a group of probable lophophorate affinity. The most ancient records of

unequivocal serpulids date back to the Middle Triassic (-244 Ma) of the Mesozoic, and from the Earliest Jurassic (-200

Ma) fossil serpulids become common. From the latest Jurassic (-146 Ma) serpulids colonised hydrocarbon seep

environments and possibly also penetrated the deep sea. Concerted efforts of paleontologists and zoologists are needed for

further understanding of serpulid evolutionary history. The serpulid fossil record can become a valuable instrument for

calibration of “molecular clocks” in polychaetes, which would allow dating not only divergence events in serpulids, but

also in annelid groups that lack a representative fossil record.

Annelida, Polychaeta, Serpulidae, biomineralisation, fossil record, tube ultrastructure, mineralogy

Introduction

Polychaetes are mostly soft-bodied animals with a very poor

paleontological record. Imprints of soft-bodied animals are rare

and only known from a limited number of localities with

exceptional preservation (so called “Lagerstatten”). The most

important among them are the Cambrian Burgess Shale (505 Ma;

Conway Morris, 1979; Eibye-Jacobsen, 2004), the Devonian

Hunsriick Slate (405 Ma; Briggs and Bartels, 2010), the

Carboniferous Mazon Creek fauna (310 Ma; Fitzhugh et al.,

1997), and the Cretaceous Hakel polychaete fauna (-95 Ma;

Bracchi and Alessandrello, 2005). The oldest known annelid

fossils are polychaetes from the Cambrian (Vinther et ah, 2011)

and the oldest known fossil polychaete is Phragmochaeta

canicularis Conway Morris et Peel, 2008 from the Early

Cambrian Sirius Passet (518 Ma) fauna.

In the paleontological record, polychaete fossils are dominated

by biomineralised tubes and, sometimes, fossilised jaws, known

as scolecodonts (e.g. Hints and Eriksson, 2007). Although many

polychaetes build muddy or mucous (Sabellidae), chitinous (e.g.

Chaetopteridae, Siboglinidae), agglutinated (e.g. Pectinariidae,

Sabellariidae) or calcareous tubes, only tubes made of calcium

carbonate have good chances to be preserved. Of the three

polychaete families known to build calcareous tubes (Serpulidae,

Sabellidae, and Cirratulidae), serpulids are obligatory calcareous

tube builders, whereas in cirratulids and sabellids calcareous

tubes are restricted to a single genus in each family (Perkins,

1991; ten Hove and van den Hurk, 1993; Fischer et ah, 1989;

2000; Vinn et ah, 2008a; Vinn, 2009). Not surprisingly, serpulids

have the best fossil record among all annelids, being represented

mainly by tubes, and, to a lesser degree, by calcified opercula.

Serpulids are common on hard substrata in all marine

habitats at all depths, being an important element of the

encrusting biota in Recent seas. They are important fouling

organisms and can also form reefs. Fossil serpulid tubes were

first described over 300 years ago, in “Oryctografia Norica” by

124

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

the German doctor Johann Jakob Baier (1708) as “Tubus

vermicularis fossilis”. Despite this, geologists and

paleontologists traditionally pay little attention to the group,

partly because of the perceived opinion of its small potential

value in stratigraphy and reconstructing paleoenvironments.

There are several large reviews of serpulid faunas of different

geological periods (e.g. Rovereto, 1899; 1904; Briinnich

Nielsen, 1931; Parsch, 1956; Schmidt, 1955; Lommerzheim,

1979; Jager, 1983; 1993; 2005), but only few papers (e.g. Jager

1983, 1993, 2005) discuss evolution and geological history of

fossil serpulids. The only comprehensive overview of the

entire serpulid fossil record in the Phanerozoic by Gotz (1931),

and a short summary by Regenhardt (1964) are now clearly

outdated, and the most recent review (Vinn and Mutvei, 2009)

focuses mainly on false serpulids from the Paleozoic.

The aims of the present paper are: 1) to outline the serpulid

fossil record, including discussion of some serpulid-like

tubicolous fossils; 2) to discuss the current state of knowledge of

serpulid paleontology and 3) to indicate directions of future

research in the evolutionary history of serpulids.

1. Current state of serpulid systematics and phylogeny

According to the most recent review of serpulid taxonomy (ten

Hove and Kupriyanova, 2009), the family comprises 46 genera

with about 350 extant species. This, however, does not include

about 140 species from the nominal subfamily Spirorbinae,

arranged in 24 genera (Ippolitov and Rhzavsky, 2014). Serpulidae

Rafinesque, 1815 was not subdivided into subfamilies until

Chamberlin (1919) established the subfamily Spirorbinae for

small-sized serpulids having tubes coiled into flat spirals. Later

Rioja (1923) placed hypothetically primitive species with a

pinnulated operculum-bearing radiole or without operculum into

the subfamily Filograninae. Pillai (1970) elevated Spirorbinae to

the family Spirorbidae, which was widely accepted until

phylogenetic data, both based on morphology and molecular

analyses (e.g. Kupriyanova, 2003; Kupriyanova et al., 2006;

Lehrke et al., 2007) indicated that spirorbins are nested inside

Serpulidae. Thus, the family status of Spirorbinae is not justified

because recognition of Spirorbidae would make Serpulidae

sensu stricto a paraphyletic group. All phylogenetic molecular

analyses indicate that neither traditional Serpulinae, nor

Filograninae are monophyletic and that spirorbins are close to

“filogranin” taxa (Kupriyanova et al., 2006; 2009; Lehrke et al.,

2007; Kupriyanova and Nishi, 2010), with the result that the

traditional subfamilies were abandoned. The analyses inferred

two major clades (tentatively termed A and B) within Serpulidae

(fig. 1). Clade A comprises two subclades: clade Al, the “S erpula-

group” (with the genera Serpula, Crucigera, Hydroides ), and

clade All, the “Spirobranchus- group” (with, amongst others, the

genera Spirobranchus, Ficopomatus and Ditrupa). Clade B

included clade BII (the monophyletic subfamily Spirorbinae) as

sister group to clade BI, the “Protula-growp” (with amongst

others the genera Profit, Protula and Vermiliopsis ). Relationships

within clade Al were further briefly studied by Kupriyanova et

al. (2008). No molecular spirorbin phylogeny is currently

available, but Macdonald (2003) proposed a hypothesis based on

morphological data.

2. Decrypting the serpulid fossil record: where we are

2.7. The stumbling block in fossil record interpretation

The main problem of serpulid paleontological record is

obtaining reliable taxonomic interpretations of fossil tubes.

Starting with Rovereto (1899; 1904) for the Cenozoic and

Regenhardt (1961) and all subsequent authors for the Mesozoic,

attempts were made to determine fossil tubes according to the

classification used for Recent species (e.g. Lommerzheim,

1979; 1981; Jager, 1983; 1993; 2005; Radwanska, 1994a; 2004;

Ippolitov, 2007a; 2007b; Jager and Schubert, 2008; Schlogl et

al., 2008; Vinn and Wilson, 2010). However, classification of

extant serpulids is based on body and chaetal characters, while

little attention is paid to the tube morphology. While a tube is

important for protection, it is not integrated with the animal

body, and thus, does not constitute a genuine exoskeleton

(Regenhardt, 1964; Weedon, 1994; Seilacher et al., 2008).

Adaptive evolution of tubes is relatively independent of that of

the soft tissue, resulting in relatively weak correlations between

tube and body characters used by zoologists for classification

of Recent forms. This probably explains why polychaete tubes,

unlike mollusc shells, have not become very important for

taxonomy. Some Recent genera have very distinct tubes (e.g.

Janita, Vitreotubus, Neomicrorbis, Placostegus, Ditrupa)

easily recognizable in fossil state (see section 2.2). In others

(e.g. Bathyvermilia, part of Filogranula, Semivermilia,

Pseudovermilia, Pyrgopolon, Spiraserpula ), tube morphology

is important for species distinction, but reliable generic

attribution based on tubes alone is difficult due to high intra¬

generic variability. Moreover, tubes of some speciose genera

often show little or no interspecific variability ( Spirobranchus,

Serpula, and Hydroides) or have a very simple tube morphology

(e.g. Apomatus/Protula, Hyalopomatus ), making their

recognition in the fossil state problematic. Most species of the

largest genus Hydroides comprising around 100 extant species

have uniform tubes with a flattened upper surface, sometimes

with two or three indistinct keels.

Such genera that are “problematic” from the paleontological

point of view comprise about 55% of the Recent non-spirorbin

serpulids (Table 1). In Spirorbinae the situation is even worse,

as normally no Recent genera, except for a very distinct

questionable spirorbin Neomicrorbis and the peculiar fossil

genus Bipygmaeus, can be confidently determined by tube

morphology alone. Reasonably confident determinations of

fossil spirorbins are based mainly on opercula associated with

tubes (Lommerzheim, 1981; Jager, 1993; 2005). However,

because preservation of opercula is uncommon, determinations

by tubes inevitably remains the main means of study of fossil

spirorbins.

Paleontologists are restricted in their interpretations to

“easily recognisable” genera. Other fossil species are tentatively

classified within known Recent genera, assigned to exclusively

“fossil” genera, or conventionally treated as “ SerpulaT ’

(Lommerzheim, 1979; Jager, 1993; 2005). As a result,

zoologists are skeptical about most generic affinities proposed

by paleontologists based on tubes. This leads to a paradoxical

situation when despite diverse and abundant fossils, zoologists

lack reliable paleontological data for understanding the

Written in stone: history of serpulid polychaetes through time

125

o.i

Clade Al

"Serpu la-group"

- Cmdgera zygophora

r Serpula vemcularis

J - Serpula Columbiana

— Serpula jukesii

~ Crutigera inconstans

— Hydroides brachyacanthus

* i- Ditrupa ariettw

Pseudochitinopoma occidenlalis

Galeoiaria caespitosa

Clade All

Galeoiaria hystrix

Ficopomtus enigmaticus

Ficopomatus mcrodon

Ficopomtus miamiensis

Spirobrancbus triqueter

Snirobranchus taematu s

Spirobranchus lima

Spirobrancbus comiculatus

Laminatubus alvirti

Manfugia cavatica

"Spir obra n ch u s-g roup"

Clade B

Chihnopoma serrula

- Metertrmiha acantbophora

Vermitiopsis labiata

Vetmiliopsis striaticeps

- Vermiliopsis pygidiatis

Pratts hybrotbermica

— FHograna imptexa

Satmacina sp.

- Protolaaospira eximia

■ Pratula tubulaha

Clade Bl

"Protula-group"

Clade Bll Spirorbinae

- Spirorbis indenlatus

schizobnnchia Sabellidae

- GunnareacaDensis Sabellariidae (outgroup)

Figure 1. A hypothesis of phylogenetic relationships within Serpulidae (a Bayesian majority rule consensus phylogram of the combined 18S and

28S rDNA serpulid sequence data; modified from Kupriyanova et al., 2009). Nodes with posterior probabilities of 1.0 are indicated by

evolutionary history of the group, while paleontologists are

restricted in their geological, paleoecological, and

biogeographical interpretations because no direct comparison

of fossils with Recent taxa is possible. Currently described

fossil serpulids are grouped in about 50 genera, 40% of which

are taken from Recent zoology (Table 1), and ~60% are used

exclusively for fossil material (Table 2). Whether these fossil

genera are truly extinct taxa, or should be synonymised with

extant genera (and vice versa), is not always obvious. The

current interrelation of Recent and fossil genera (Table 1)

shows that although many extant serpulid genera are recognised

in fossil state, the attribution of fossil tubes is often problematic.

2.2. Tube morphology: how helpful is it for understanding fossil

record?

Comparative morphology of fossil tubes remains the major

tool of serpulid paleontology. The main characters allowing

recognition of Recent genera in the fossil state (fig. 2) are type

of aggregation, type of coiling/curving, attachment to the

substrate, external sculpture, expansion rate, presence of

internal tube structures (ITS), development of attachment

structures, wall opacity/transparency, appearance, size, and

opercular morphology.

Aggregations. Dense aggregations of serpulid tubes can be

formed either by asexual reproduction or as a result of

gregarious larval settlement. Asexual budding results in

branching “pseudocolonies” sensu Nishi and Nishihira (1994)

of Filograna/Salmacina (fig. 2D) that are easily recognizable

as fossils. Gregarious larval settlement leading to dense

aggregations is typical for Recent Ficopomatus (fig. 2L),

Serpula, and Hydroides. This process is also a key to reef

formation by serpulids. In the case of Filogranella it is not

clear which factors are the main contributors to its reef-forming

(Hoeksema and ten Hove, 2011), although aggregations may

reach huge sizes. For some fossil taxa that sometimes build

aggregations, such as Parsimonia, a close relationship to

Serpula was proposed (Regenhardt, 1961).

Free and attached tubes. Normally tubes are attached to the hard

substrate at least partially, but some serpulids e.g. Ditrupa,

Bathyditrupa, Nogrobs (fig. 2A, B, J, respectively) and,

occasionally, species in other genera (e.g. Serpula crenata

126

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

Table 1. Recent serpulid genera and their fossil record. The list of Recent non-spirorbin genera follows ten Hove and Kupriyanova (2009) data

with modifications, the list of Recent spirorbin genera and species number is after Ippolitov and Rzhavsky (2014: Tab. 1). Dating of the most

ancient finds does not reflect origin time as due to the scarcity of fossil record most taxa are probably older than indicated. The number of fossil

species for each genus is approximate, as most of fossil species described as “ Serpula ” in older publications need to be revised. Absolute ages

here and in the text are provided according to the official site of the International Commission of Stratigraphy www.stratigraphy.org/GSSP/index.

html, accessed 10-12-2013. Designations: *genera with fossil type species; **some extant species recognised also as fossils in sub-Recent

(Pliocene-Holocene) sediments; f taxa originally used in paleontological literature only (extinct genera).

Genus (including most common

synonyms and subgenera)

Number

of extant

species

Number

of fossil

species

Most ancient fossil finds and

their age

Tube characters allowing

recognition in fossil state

SABELLIDAE

Glomerula* Briinnich Nielsen, 1931

-Calcisabella Perkins, 1991,

=f Cycloserpula Parsch, 1956,

=f Omasaria Regenhardt, 1961

Late Carboniferous (323-304 Ma;

present paper) or Late Hettangian

(200 Ma; Jager, 2005)

glomerate coiling; very slow

expansion; absence of basal

cementing flanges

NON-SPIRORBIN SERPULIDAE

Apomatus Philippi, 1844

not recognised

Bathyditrupa Kupriyanova, 1993a

?Late Pliensbachian (-185 Ma;

Behrendsen, 1891);?Late Albian

(-105 Ma; Jager, 2005)

unattached tusk-shaped tubes with

quadrangular cross-section. Maybe

synonym of f Nogrobs

(Tetraditrupa) (see Jager, 2005) or

f Nogrobs (Tetraserpula) (see

Ippolitov, 2007a).

Bathyvermilia Zibrowius, 1973

??Late Sinemurian {“Serpula”

etalensis (Piette, 1856); -194 Ma)

long free anterior part with

characteristic frequent peristomes

Chitinopoma Levinsen, 1884

3-4

not recognised

Chitinopomoides Benham, 1927

not recognised

Crucigera Benedict, 1887

not recognised

Dasynema de Saint-Joseph, 1894

not recognised

Ditrupa Berkeley, 1835

=f Acerrotrupa Yu et Wang, 1981,

=f Sinoditrupa Yu et Wang, 1981

Danian (65 Ma; Jager, 1993)

unattached tusk-shaped tubes with

circular cross-section

Ficopomatus Southern, 1921

not recognised.

Filograna Berkeley, 1835

Late Anisian (244 Ma;

Senowbary-Daryan et al., 2007)

pseudocolonial; small-sized;

individual tubes packed in

branching bundles.

Indistinguishable from Salmacina

Filogranella Ben-Eliahu et Dafni,

1979

1(3?)

not recognised

Filogranula Langerhans, 1884

?=f Flucticularia Regenhardt, 1961

6 **

late Early Toarcian (-180 Ma;

Jager, unpubl.; Ippolitov, 2007a)

sculpture; size; aperture with

spines

Floriprotis Uchida, 1978

not recognised

Galeolaria de Lamarck, 1818

Cenomanian (100 Ma;

Lommerzheim, 1979)

sculpture (massive median

bicarinate keel), cross-section

Hyalopomatus Marenzeller, 1878

11-12

not recognized

Hydroides Gunnerus, 1768

?Middle Paleocene (-60 Ma;

Lommerzheim, 1981); or Middle

Miocene (-15 Ma; Schmidt, 1955)

flattened upper side, usually

bordered by keels, coiling

tendency

Janita de Saint-Joseph, 1894

_**

?Cenomanian (100 Ma;

Lommerzheim, 1979); or

?Badenian (15 Ma; Radwanska,

1994a)

not recognised confidently

Written in stone: history of serpulid polychaetes through time

127

Genus (including most common

synonyms and subgenera)

Number

of extant

species

Number

of fossil

species

Most ancient fossil finds and

their age

Tube characters allowing

recognition in fossil state

Josephella Caullery et Mesnil, 1896

?earliest Cenomanian (100 Ma;

Lommerzheim, 1979)

size, very slow expansion

Laminatubus ten Hove et

Zibro wius, 1986

not recognized

Marijugia Absolon et Hrabe, 1930

Pliocene/earliest Pleistocene

(2.5-3.6 Ma; Bosak et al., 2004)

the only extant species found in

fossil state

Metavermilia Bush, 1905

subgen.: f Vepreculina Regenhardt,

1961

Late Rhaetian (205 Ma; Jager,

2005); or Late Callovian (165 Ma;

Ippolitov, 2007a)

sculpture, size, growth rate

Microprotula Uchida, 1978

not recognized

Neovermilia Day, 1961

=f Proliserpula Regenhardt, 1961

3+**

Late Oxfordian (158 Ma;

Radwanska, 2004)

size, sculpture, attachment

stmctures morphology

No grabs* de Montfort, 1808

=Spirodiscus Fauvel, 1909,

-sDitrupula Briinnich Nielsen, 1931,

7-rGlandifera Regenhardt, 1961,

7-iTubulostium Stoliczka, 1868;

subgen.: ( l^Tetraditrupa

Regenhardt, 1961;

(7)iTetraserpula Parsch, 1956

[Interrelations between all

subgenera remain uncertain]

10+

Late Pliensbachian (~185 Ma; see

Jager, 2005) - non-spiral forms of

subgenus Tetraserpula; Late

Toarcian (~176 Ma; Jager, 2005)

- spiral forms of Nogrobs s. str.

spiral coiling, quadrangular

cross-section

Omphalopomopsis de Saint-Joseph,

1894

not recognised

Paraprotis Uchida, 1978

1(2?)

not recognised

Paumotella Chamberlin, 1919

not recognised

Placostegus Philippi, 1844

=f Eoplacostegus Regenhardt, 1961

Late Oxfordian (158 Ma;

Radwanska, 2004)

cross-section, aperture with spines,

size, growth mode

Pomatostegus Schmarda, 1861

not recognised

Protis Ehlers, 1887

6-7

not recognised

Protula Risso, 1826

-Membranopsis Bush, 1910;

subgen.: f Longitubus Howell, 1943

?24

3+**

Early Albian (~113 Ma; see Jager,

2005)

medium to large-sized tubes, often

growing upwards from the

substrate; no sculpture

Pseudochitinopoma Zibrowius,

1969

Early Oxfordian (163 Ma;

Ippolitov, unpubl.)

size, well-developed transverse

sculpture

Pseudovermilia Bush, 1907

?Cenomanian (100 Ma;

Lommerzheim, 1979); or

?Burdigalian (20 Ma; Jager and

Schneider, 2009)

size, sculpture

Pyrgopolon* de Montfort, 1808

=Sclerostyla Mprch, 1863,

=f Falcula Conrad, 1870,

=f Hexaserpula Parsch, 1956,

= \Hepteris Regenhardt, 1961;

subgen.: f Hamulus Morton, 1834;

iTurbinia Michelin, 1845

(=t Pyrgopolopsis Rovereto, 1904);

t Ornatoporta Gardner, 1916;

fSeptenaria Regenhardt, 1961

15+

Barremian (128 Ma; Jager, 2011)

tube size, expansion rate; growth

mode; sculpture

128

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

Genus (including most common

synonyms and subgenera)

Number

of extant

species

Number

of fossil

species

Most ancient fossil finds and

their age

Tube characters allowing

recognition in fossil state

Rhodopsis Bush, 1905

not recognised

Salmacina Claparede, 1870

indistinguishable from Filograna

Semivermilia ten Hove, 1975

?Badenian (15 Ma; Radwanska,

1994a)

not recognised confidently

Serpula Linnaeus, 1758

(?) subgen.: f Cementula Briinnich

Nielsen, 1931

9**

?Cenomanian (100 Ma; Jager,

2005); Paleogene (~66 Ma) to

Recent

most fossil species are described

under this generic name. True

Serpula (“s. str.”) determined by

two/three keeled tubes.

Morphological specification is too

poor to allow confident

recognition, so precise number of

fossil species is not clear now.

Spiraserpula* Regenhardt, 1961

Late Callovian (164 Ma; Ippolitov,

2007b)

coiling type, ITS

Spirobranchus de Blainville, 1818

-Pomatoceros Philippi, 1844,

=Pomatoleois Pixel!, 1913

26+

2+**

?Cenomanian (100 Ma;

Lommerzheim, 1981, by

opercula); Middle Paleocene (~60

Ma; Lommerzheim, 1981)

large size; subtriangular section,

opercular morphology

Tanturia Ben-Eliahu, 1976

not recognised

Vermiliopsis de Saint-Joseph, 1894

=f Peraserpula Regenhardt, 1961

13-19

Late Callovian (164 Ma; Vinn and

Wilson, 2010)

trumpet-shaped peristomes,

sculpture, fast growth

Vitreotubus Zibrowius, 1979

_**

not recognised

SPIRORBINAE

Amplicaria Knight-Jones, 1984

not recognised

Anomalorbis V ine, 1972

not recognised

Bushiella Knight-Jones, 1973

13(14?)

not recognised

Circeis de Saint-Joseph, 1894

Middle Paleocene (~60 Ma;

Lommerzheim, 1981)

some species described by

opercula with good confidence;

tubes - by coiling direction;

sculpture; with poor confidence

Crozetospira Rzhavsky, 1997

not recognised

Eulaeospira Pillai, 1970

??Cenomanian (100 Ma;

Lommerzheim, 1979)

low confidence

Helicosiphon Gravier, 1907

not recognised

Janua de Saint-Joseph, 1894

3**

??Cenomanian (100 Ma;

Lommerzheim, 1979); Middle

Paleocene (~60 Ma;

Lommerzheim, 1981)

some species described after

opercula; some based on tubes,

with low confidence

Knightjonesia Pillai, 2009

not recognised

Leodora de Saint-Joseph, 1894

not recognised

Metalaeospira Pillai, 1970

??Cenomanian (100 Ma;

Lommerzheim, 1979) or Middle

Paleocene (~60 Ma;

Lommerzheim, 1981)

low confidence for ancient

Paleocene species determined by

opercula

Written in stone: history of serpulid polychaetes through time

129

Genus (including most common

synonyms and subgenera)

Number

of extant

species

Number

of fossil

species

Most ancient fossil finds and Tube characters allowing

their age recognition in fossil state

Neodexiospira Pillai, 1970

10(11?)

?Late Barremian (~126 Ma; Jager, operculum; tube sculpture, coiling

2011), Maastrichtian (72 Ma) direction; relatively good

confidence for most ancient

species

Nidificaria Knight-Jones, 1984

not recognised

Paradexiospira Caullery et Mesnil,

1897

3(4?)

not recognised

Paralaeospira Caullery et Mesnil,

1897

Middle Paleocene (~60 Ma; operculum morphology, coiling

Lommerzheim, 1981) direction, sculpture

Pillaiospira Knight-Jones, 1973

not recognised

Pileolaria Claparede, 1868

21(22?)

?Late Barremian (~126 Ma; Jager, low confidence

2011)

Protolaeospira Pixell, 1912

_**

not recognised

Protoleodora Pillai, 1970

not recognised

Romanchella Caullery et Mesnil,

1897

not recognised

Simplaria Knight-Jones, 1984

not recognised

Spirorbis Daudin, 1800

9**

??Cenomanian (100 Ma; most of fossil material described in

Lommerzheim, 1979) older publications is

conventionally placed under this

name

Vinearia Knight-Jones, 1984

not recognised

GENERA OF UNCERTAIN NATURE (DOUBTFUL SPIRORBINAE)

Neomicrorbis * Rovereto, 1903

=f Granorbis Regenhardt, 1961;

=t Spirorbula Briinnich Nielsen, 1931

?Late Bathonian (~167 Ma; Jager, coiling to both directions,

2005); Late Berriasian (~142 Ma; sculpture, large size

Ippolitov, unpubl.)

(Ehlers, 1908), S. israelitica Amoureux, 1976, and Pyrgopolon

differens (Augener, 1922)), are secondary free-living on soft

substrate as adults, while larvae attach to smallest objects.

Among fossils similar free-lying tubes are known in such genera

as Tetraserpula, Tetraditrupa, Triditrupa, Pentaditrupa, and

Nogrobs, as well as in large number of highly diversified spirally

coiledforms {Rotularia- shaped genera, Conorca, Orthoconorca ).

Tube shape and coiling. General tube shape in most genera is

undetermined, resulting in a variety of straight, irregularly

twisted or coiled tubes within a genus or even species. Some,

however, have a determined tube shape, e.g. tusk-shaped

Ditrupa, Bathyditrupa and all spirally coiled taxa (fig. 2A, B,

J, S-W). Spiraserpula, known both as Recent and fossil, tends

to alternate spirally coiled and irregularly curved tube

segments. Coiling mode (spirals attached to substrate or

growing over each other) and direction (clockwise only,

anticlockwise only, or both) are the most important characters

for both extant and extinct forms. Obligatory trochospiral

coiling, where coiling direction can be both clockwise and

anti-clockwise within a species, is characteristic only of some

fossil genera such as Conorca, Protectoconorca, Orthoconorca,

and Rotularia- shaped genera (Regenhardt, 1961; Jager, 1983;

1993). The proportion of tubes coiled in each direction can be

either constant within a species or vary intraspecifically for

material of slightly different geological ages (Jager, 1983: Tab.

3-5). There is also a tendency to have one coiling direction

strongly dominant (e.g. in some Orthoconorca, Protectoconorca

and Rotularia). Spirorbins (fig. 2S-W) are an example of mostly

attached spiral tubes coiled in a certain direction within most

genera and species. The most remarkable exception is the

problematic Neomicrorbis (fig. 2S), having tubes coiled equally

in both directions in all species. Among indeterminately coiled

tubes, sometimes there are coiling tendencies allowing generic

attribution. For example, Hydroides species often form wide

rounded loops (fig. 2H) and so do fossil Mucroserpula and, less

often, Recent Serpula.

130

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

Written in stone: history of serpulid polychaetes through time

131

Sculpture (=ornament) and cross-section. Along with coiling

mode, external sculpture is the most important character for

tube identification. In cases when tubes lack pronounced

sculpture (. Apomatus, Hyalopomatus, Protula - fig. 2C, E),

identification of fossils becomes problematic. The tube

sculpture typically consists of longitudinal keels (up to 9) or

rows of denticles, and transverse ridges and peristomes of

varying complexity (fig. 2G, H, J-S, U, W). Keels modify the

external cross-section making it (sub)triangular (fig. 20, P) or

multi-angular (fig. 2K, R), and the cross-section is the most

robust character allowing generic recognition in fossil state.

Transverse peristomes indicate growth stops and can be rare

and irregularly spaced (fig. 2L), or almost regularly spaced (e.g.

in Pseudochitinopoma, fig. 2Q). Sculpture can also be

represented by regular pits (e.g. in Pseudomicrorbis,

Metavermilia, fig. 2K) and alveoli (perforations, fig. 20), which

are usually species-specific rather than characteristic of genera.

Sculpture and tube cross section can change in ontogeny

and during the transition to growth away from the substrate. In

the latter case cross-section tends to become circular, while

longitudinal sculpture disappears and peristomes become more

frequent (fig. 2F). Thus, free tube fragments of most genera can

hardly be identified with confidence, however, in some taxa

(e.g. fossil members of Vermiliopsis and “ Filogranula ”)

sculpture is well-developed in free fragments as well, and in

some taxa ( Pyrgopolon (Septenaria )) keels become even more

numerous than in the attached part. Several Recent genera (e.g.

Janita, Pseudochitinopoma , Vitreotubus, fig. 2R, Q, M,

respectively) can be easily recognised by sculpture only; all

others show some interspecific variability, however, the limited

extent of this variability usually justifies generic attributions.

Internal tube structures. The lumen of serpulid tubes is circular

and smooth, but members of genus Spiraserpula have unique

internal tube structures (ITS), such as longitudinal keels and

crests of often fragile appearance inside the lumen (Pillai,

1993; Pillai and ten Hove, 1994; ten Hove and Kupriyanova,

2009). Although Spiraserpula seems to be a genus well-

recognisable by tube coiling mode, differences in ITS

morphology make species recognition a lot easier. Internal tube

structures are also known for calcareous sabellids of the genus

Glomerula, where it was found in some fossil species of

Cretaceous-Paleogene age (see Jager, 1993, 2005; fig. 8A).

Attachment structures. The area of tube attachment is often

widened to form basal flanges running along tube sides (e.g.

Pseudovermilia, Spirobranchus-, fig. 2P). When these flanges

are continuously hollow (fig. 7H) or subdivided by septae inside

(fig. 8P), they are referred to as tubulae (Hedley, 1958: fig. 9;

Jager, 1983: 11, text-fig. 2; Ippolitov, 2007a, b), and probably

help the animal to widen and thus to strengthen the attachment

area, without requiring too much calcareous material. The

frequency of septae inside tubulae has been used as one of

justifications for synonymy of the fossil genus Proliserpula

with Recent Neovermilia (Jager, 1993; 2005).

Tabulae. Some serpulids from clades AI and All may build

inside the tube lumen transverse septae (tabulae) that partition

the oldest tube parts as a response to posterior tube damage

(ten Hove and Kupriyanova, 2009). Although tabulae are

sometimes mentioned by paleontologists (e.g. Muller, 1963;

1970; Nestler, 1963; Ziegler and Michalfk, 1980; Ziegler, 1984),

their morphology, frequency and variability have not been

studied well enough to be useful for classification.

Wall transparency. Tubes of most serpulids can be either opaque

or porcellaneous, (i.e. with an internal opaque and external

hyaline layer), but Placostegus, Vitreotubus (fig. 2N, M,

respectively), and some spirorbins (e.g. Neomicrorbis, fig. 2S)

have completely transparent (hyaline) tubes that can be

recognised in the fossilised state. Transparency is determined

by certain tube ultrastructure (see below).

Figure 2. Morphological diversity of Recent serpulids. A-R: non-spirorbin serpulids: A - Ditrupa arietina (O. F. Muller, 1776), unattached tusk-shaped

tubes with circular cross-section. B - Bathyditrupa hovei Kupriyanova, 1993a, unattached tusk-shaped tube with quadrangular cross-section (after

Kupriyanova et al., 2011: 47, fig. 2E). C -Apomatus globifer Theel, 1878, simple tube without sculpture. D - pseudocolony of Filograna sp. tubes. E

-Hyalopomatus biformis (Hartman, 1960), simple tube without sculpture (after Kupriyanova and Nishi, 2010: 62, fig. 5a). F - orange tube of Serpula

vermicularis Linnaeus, 1758, distal unattached part with peristomes. G - same, attached tube parts with multiple low keels. H - Hydroides albiceps

(Grube, 1870) tube with flattened upper surface bordered by a pair of keels. I - Hydroides norvegicus Gunnerus, 1768, tube without keels, with wavy

growth lines. J - Nogrobs grimaldii (Fauvel, 1909), unattached spirally coiled tube, quadrangular in cross-section (after Kupriyanova and Nishi, 2011:

2, fig. 1C). K - Metavermilia arctica Kupriyanova, 1993b, tube with characteristic combination of transverse and longitudinal sculptural elements

resulting in “honey-comb” structure. L - Ficopomatus enigmaticus (Fauvel, 1923), aggregation of tubes with irregularly spaced peristomes. M -

Vitreotubus digeronimoi Zibrowius, 1979, transparent tube with very characteristic flat wide paired keels. N - Placostegus sp., transparent tube (after

ten Hove and Kupriyanova, 2009: 8, fig. IF). O - Spirobranchus polytrema (Philippi, 1844), tube with single keel and alveoles. P - Spirobranchus

taeniatus (de Lamarck, 1818), simple tube with single smooth keel and peripheral flanges. Q - Pseudochitinopoma beneliahuae Kupriyanova et al.,

2012, completely attached tube with transverse ridges (after Kupriyanova et al., 2012: 63, fig. 3A). R -Janita fimbriata (delle Chiaje, 1822), tube with

very characteristic sculpture. S-W: Spirorbinae: S -Neomicrorbis azoricus Zibrowius, 1972, coiled attached tube with numerous keels of denticles (after

ten Hove and Kupriyanova, 2009: 65, fig. 29C). T -Bushiella ( Bushiella ) evoluta (Bush, 1905), clockwise coiled tube with planospiral initial whorls

and evoluted distal part. U - Bushiella ( Jugaria ) kofiadii Rzhavsky, 1988, clockwise coiled tube with distinct keels. V - Circeis armoricana de Saint-

Joseph, 1894, anticlockwise coiled planospiral tube. W - Paradexiospira vitrea (Fabricius, 1780), anticlockwise coiled vitreous tube. A, C, D, F-I, K,

L, O, P - photo E. Wong, E, M, Q - photo E. Kupriyanova, B, J - photo E. Nishi, T-W - photo A. Rzhavsky, S - photo R. Bastida-Zavala, R - photo A.

Ravara, N - photo G. Rouse. Scale: A - 1 mm, B - 0.5 mm, C - 1 mm, D - 2 mm, E - 0.5 mm, F, G - 5 mm, H, I, J, K - 1 mm, L - 1 mm, M - 2 mm,

N-P- 1 mm, Q - 0.5 mm, R - 1 mm, S - 2 mm, T-W - 1 mm.

132

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

Opercula. Several serpulid genera (, Spirobranchus, Pyrgopolon,

except for fossil subgenus Pyrgopolon ( Septenaria ),

Neomicrorbis and all spirorbins) have fully or partially calcified

opercula that fossilise well and are characteristic enough for

distinguishing genera and species. Linking fossil tubes and

opercula is often problematic as they are usually found

separately (but see Cupedo, 1980a, b; Jager, 2005), resulting

even in generic taxa based on opercula only (e.g. Lommerzheim,

1979; 1981). Opercula of Bathyvermilia, a Recent genus having

thin calcified opercular endplates, are not known in the fossil

record. The literature on fossil opercula can be found in full in

Radwanska (1994b) and Gatto and Radwahska (2000).

Size. At least two Recent serpulid genera, Rhodopsis and

Josephella, are characterised by minute tubes with diameter not

exceeding 0.2 mm, which was used as an argument for

attributing minute fossil tubes to Josephella (Regenhardt, 1961;

Baluk and Radwanski, 1997). In all other genera interspecific

variability of tube size is more or less clearly defined, making

this character useful for understanding the fossil tube affinity.

All the characters mentioned above are used while

determining fossil tubes. Although determination may not be

very precise, a combination of characters usually allows

making a qualified guess regarding at least the group of closely

related Recent genera, “Formenkreis” sensu Lommerzheim

(1979), where a fossil species belongs. Morphology is used not

only for descriptions of fossil species and genera, but also for

inferring phylogenetic relationships among those taxa (e.g.

Jager, 1983; 1993; 2005).

In some striking cases taxa originally described by

paleontologists by tubes were later found or recognised among

Recent serpulids by zoologists. One example of such “living

fossils” is the fossil Neomicrorbis that was discovered as a

bathyal N. azoricus Zibrowius, 1972 and recognised by size,

coiling, and characteristic sculpture (fig. 2S). Other examples

include Spiraserpula recognised by ITS found both in fossil and

extant taxa (Pillai, 1993; Pillai and ten Hove, 1994) and

characteristically coiled calcareous sabellid Glomerula known

to paleontologists from the early 19 th century (Jager, 2005;

Ippolitov, 2007a), but discovered in Recent fauna only recently

(Perkins, 1991). Recent Spirodiscus (fig. 2J) with distinct

spirally coiled quadrangular tubes was synonymised with fossil

genus Nogrobs (Jager, 2005; ten Hove and Kupriyanova, 2009)

having very similar tubes, and Recent Sclerostyla was

considered a synonym of fossil Pyrgopolon (Jager, 1993; 2005)

based on tube shape, size, sculpture, and very characteristic

calcified opercula (Wrigley, 1951; Cupedo, 1980a, b).

2.3. Tube ultrastructures: a new tool in serpulid systematics?

Studies over the last three decades revealed extensive

ultrastructural diversity in serpulid tube walls (e.g. Bohnne

Havas, 1981; Bubel et al., 1983; Bandel, 1986; ten Hove and

Zibrowius, 1986; Zibrowius and ten Hove, 1987; Nishi, 1993;

Sanfilippo, 1998a, b; 2001; Vinn, 2005; 2007; 2008; Vinn et

ah, 2008b, d). Vinn et ah (2008b) recognised four main groups

of tube ultrastructures in serpulids according to orientation of

calcium carbonate crystals: 1) isotropic structures (the

crystallisation axis lacks a uniform orientation, fig. 3A-E); 2)

semi-oriented structures (the crystallisation axis has semi¬

uniform orientation, fig. 3F, G); 3) oriented prismatic structures

(the crystallisation axis has a uniform orientation and is

continuous through successive growth increments, fig. 3H, I,

M-O); and 4) oriented complex structures (the crystallisation

axis of the crystals has a uniform orientation that is not

continuous through successive growth increments, fig. 3J-L).

In total, 13 distinct ultrastructures (Vinn et ah, 2008b, d) are

currently recognised in Recent serpulids (fig. 3, 4).

These 13 types can be arranged into several (up to 4) tube

layers, though the majority of species have single-layered

tubes. Vinn et ah (2008b) examined 44 species belonging to

36 genera and showed that 47% of studied species possess a

unique combination (ultrastructural types and their

arrangement into layers) of tube characters. Most advanced

and highly ordered types of structures are difficult to explain

from the point of the classic for serpulids “granular secreting”

model (Neff, 1971), so a matrix-mediated model of

biomineralisation was proposed (Vinn et ah, 2009).

Ultrastructures of Recent tubes may show inter-specific

variability (Vinn, 2007; Ippolitov and Rzhavsky, 2008) and

can even have a more or less clear adaptive significance

(Sanfilippo, 1996; Vinn and Kupriyanova, 2011), but intra¬

generic variability of ultrastructures is poorly understood. The

idea that generic affiliation of fossils can be evaluated using

tube ultrastructures was first proposed by Sanfilippo (1998b).

The ultrastructural investigation into fossil tubes has recently

commenced (e.g. Sanfilippo, 1998a; 1999; Vinn, 2005; 2007;

2008; Vinn and Furrer, 2008; Vinn et ah, 2012) and has

already helped to prove the serpulid nature of fossils in some

doubtful cases (Vinn et ah, 2008c; Taylor, 2014).

Ultrastructures can potentially be used to distinguish

serpulid taxa and even to verify linking fossils with recent

taxa (Kupriyanova and Ippolitov, 2012) and thus, they may be

crucially important for further interpretation of the fossil

record and understanding serpulid evolution. However, the

ultrastructural method is not widely used to estimate the

systematic position of Recent and fossil tubes for two reasons.

First, ultrastructural variability within Recent genera is

insufficiently studied for any meaningful comparison with

fossils. Second, fossil material is often diagenetically altered

(i.e. original mineralogy, crystal shapes and arrangement may

be changed during the sediment to rock transformation);

although direct comparisons are still possible, they are

restricted to well-preserved fossil material (fig. 5D-I).

Comparison of ultrastructural variation with molecular

phylogenies (e.g. Kupriyanova and Nishi, 2010) reveals a

striking difference in the complexity of tube ultrastructures

between the two major clades. The complex oriented structures

and the oriented prismatic structures restricted to the clade A

(Vinn et ah, 2008b; Vinn and Kupriyanova, 2011: fig. 1) seem

to be derived from isotropic structures that are considered to

be plesiomorphic (Vinn, 2013c). However, oriented prismatic

structures are also known for spirorbins (Ippolitov and

Rzhavsky, 2008) nested inside clade B that predominantly has

isotropic structures, thus suggesting an evolutionarily

independent origin. In both clade A (Vinn and Kupriyanova,

2011) and in spirorbins (Ippolitov and Rzhavsky, 2008)

Written in stone: history of serpulid polychaetes through time

133

Table 2. Main “fossil” serpulid genera still not recognised in Recent fauna. Uncommon genera, taxa of doubtful validity, and taxa erroneously

described as serpulids (e.g. numerous Paleozoic genera listed in Ziegler, 2006) are not included. For designations see Table 1.

Fossil genera and most common

synonyms

Number

of species

Known stratigraphic range

Comments

NON-SPIRORBIN SERPULIDS

t Austrorotularia Macellari, 1984

Kimmeridgian to Maastrichtian

(157-66 Ma)

originally described as a subgenus of

f Rotularia, but likely a separate

lineage

t Cementula Briinnich Nielsen, 1931

10+

?Late Pliensbachian to ?Late

Burdigalian (184-17 Ma)

included species partly may be

related to Serpula/Hydroides, partly

to Spiraserpula with reduced ITS,

and partly to sabellid Glomerula. In

paleontological literature also as

subgenus of Serpula (see Jager and

Schneider, 2009).

f Conorca Regenhardt, 1961

?Cenomanian, Turonian to

Maastrichtian (7100, 92-66 Ma)

f Corynotrypoides Bizzarini et Braga,

1994

Camian (237-227 Ma)

originally described as cyclostome

bryozoan, serpulid affinities

proposed by Taylor (2014)

f Cycloplacostegus Jager, 2005

?Late Turonian, Early Santonian to

Early Maastrichtian (791, 86-71 Ma)

f Dorsoserpula Parsch, 1956

Middle Oxfordian to latest

Maastrichian (160-66 Ma)

f Genicularia Quenstedt, 1856

Early Oxfordian (163 Ma)

f Jereminella Lugeon, 1919

Maastrichtian (72-66 Ma)

doubtful validity, poorly studied

genus

f Laqueoserpula Lommerzheim, 1979

Late Oxfordian to latest

Maastrichtian (159-66 Ma)

doubtful status, may be related to

Filogranula, Metavermilia or other

genera

f Martina Ziegler, 1984

Early Turonian (93 Ma; Ziegler,

1984)

nomen dubium

f Mucroserpula Regenhardt, 1961

?Late Pliensbachian (Jager and

Schubert, 2008); Bajocian to

Maastrichtian (7184,170-66 Ma)

large-sized representatives from the

Pliensbachian may belong to

fPropomatoceros

f Octogonella Ziegler, 2006

Middle Danian (64 Ma)

doubtful validity, may be a synonym

of Pyrgopolon

i Orthoconorca Jager, 1983

Late Albian to Late Danian (-105-

-62 Ma)

f Paliurus Gabb, 1876

Cenomanian to Eocene (100-34 Ma)

doubtful validity, revision needed

f Pannoserpula Jager et al., 2001

Middle Oxfordian to Late

Kimmeridgian (161-152 Ma)

f Parsimonia Regenhardt, 1961

Late Volgian to Middle Santonian,

?Campanian to Maastrichian

(-147-85 Ma, 780-66 Ma)

partly may be a synonym of Serpula

f Pentaditrupa Regenhardt, 1961

Hettangian to Danian (201-62 Ma;

Jager 2005)

may be a synonym or subgenus of

f Genicularia

134

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

Fossil genera and most common

synonyms

Number

of species

Known stratigraphic range

Comments

f Propomatoceros Ware, 1975

24+

Pliensbachian to Turonian (190—89

Ma)

some species included in the genus

may be referred to Serpula and

Spirobranchus. Upper time limit is

uncertain, as Cretaceous species

listed by Ippolitov (2007b) need

revision

t Protectoconorca Jager, 1983

Cenomanian to Maastrichtian

(100-66 Ma)

f Rotularia Defrance, 1827a

=~\Spirulaea Bronn, 1827

20+

Danian to Priabonian (66-34 Ma)

all subgenera, classically treated

under this genus (e.g., Regenhardt,

1961; Jager, 1993) are considered as

separate genera in the present paper

f Rotulispira Chiplonkar et Tapaswi,

1973b

=f Praerotularia Lommerzheim, 1979

20+

Hauterivian to ?Maastrichtian

(133-766 Ma)

f Ruxingella Stiller, 2000

Late Anisian (244 Ma)

questionable validity, as no

comparison with other fossil and

Recent taxa provided

f Sarcinella Regenhardt, 1961

Middle Jurassic to Early Campanian

(-174-80 Ma; Jager, 2005)

i Tectorotidaria Regenhardt, 1961

10+

Hauterivian to Maastichtian (133-66

Ma)

doubtful validity, partly (including

type species) may belong to

f Tubulostium Stoliczka, 1868.

Originally f Tectorotularia was

described as a subgenus of

f Rotularia , but likely a separate

lineage

'\'Triditrupa Regenhardt, 1961

Cenomanian (100-94 Ma)

originally described as a subgenus of

Ditrupa, but likely a separate

lineage. Doubtful status, maybe a

subgenus of Pyrgopolon (Jager,

1993,2005). ‘

f Tubulostium Stoliczka, 1868

?=i Tectorotidaria Regenhardt, 1961

Albian to Turonian (113-90 Ma)

doubtful validity, may be a synonym

of Nogrobs de Montfort, 1808 fv.

str :)

'\Weixiserpula Stiller, 2000

Late Anisian (244 Ma)

questionable validity, as no

comparison with other fossil and

Recent taxa provided

SPIRORBINAE

f Bipygmaeus Regenhardt, 1961

Early Cenomanian to Middle Danian

(100-63 Ma)

f Cubiculovinea Lommerzheim, 1981

Middle Paleocene (62-59 Ma)

genus description based on opercula

only

f Ornatovinea Lommerzheim, 1979

Earliest Cenomanian (-100 Ma)

genus description based on opercula

only

DOUBTFUL SPIRORBINAE

f Pseudomicrorbis Jager, 2011

Late Berriasian to Barremian

(-142-125 Ma)

Written in stone: history of serpulid polychaetes through time

135

1,5 pm

Figure 3. Ultrastructural diversity of Recent serpulid tubes. A-E: isotropic structures: A - Serpula crenata Ehlers, 1908, inner tube layer, cross section

of irregularly oriented prismatic structure (IOP), B - Pseudovermilia madracicola ten Hove, 1989, cross section of sphemlitic irregularly oriented

prismatic structure (SIOP) (after Vinn et al., 2008b: fig. 2A), C -Neovermiliafalcigera (Roule, 1898), cross section of irregularly oriented platy structure

(IOPL), D - Laminatubus alvini ten Hove et Zibrowius, 1986, cross section of homogeneous angular crystal structure (HAC), E - Pomatostegus

stellatus (Abildgaard, 1789), cross section of homogeneous rounded crystal structure (HRC) (after Vinn et al., 2008b: fig. 3E), F, G: semi-oriented

structures: F - Protula diomedeae Benedict, 1887, cross section of semi-ordered irregularly oriented prismatic structure (SOIOP) (after Vinn, 2007: fig.

5.5), G-Pyrgopolon ctenactis Morch, 1863, outer tube layer, cross section of semi-ordered sphemlitic irregularly oriented prismatic stmcture (SOSIOP)

(after Vinn, 2007: fig. 7.4), H, I and M-O: oriented prismatic stmctures: H - Spiraserpula caribensis Pillai et ten Hove, 1994, outer tube layer,

longitudinal section of sphemlitic prismatic stmcture (SPHP) (after Vinn, 2007: fig. 6.5), I - Vitreotubus digeronimoi Zibrowius, 1979, longitudinal

section of simple prismatic stmcture (SP) (after Vinn et al., 2008b: fig. 5B, enlarged), J-L: oriented complex stmctures: J - Hydro ides dianthus Verrill,

1873, third layer from outside, longitudinal section of lamello-fibrillar stmcture (LF) (after Vinn, 2008: fig. 4.5), K - Floriprotis sabiuraensis Uchida,

1978, inner layer, cross section of sphemlitic lamello-fibrillar stmcture (SLF), L - Spirobranchus giganteus (Pallas, 1766), outer layer, longitudinal

section of ordered fibrillar stmcture (OF) (after Vinn et al., 2008b: fig. 6B), M-0 - Ditrupa arietina (O. F. Muller, 1776), regularly ridged prismatic

stmcture (RRP): M - tube external surface, etched with 1 % acetic acid for 30 sec (after Vinn et al., 2008d: fig. 3F), N - external tube layer, longitudinal

section, O - lateral surface of a RRP stmcture prism with ridges (after Vinn et al., 2008d: fig. 4A).

136

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

oriented prismatic structures tend to form dense outer tube

layer near the surface of the wall. Unilayered tubes with

prismatic structure of the only layer are transparent (Ippolitov

and Rzhavsky, 2008; Vinn et al., 2008b) because of parallel

orientation of optical axes in crystals.

2.4. Tube mineral composition: new cues for serpulid evolution

Tubes of serpulids consist of calcite, aragonite, or a mixture of

both modifications of calcium carbonate (Bornhold and

Milliman, 1973; Vinn et al., 2008b) interspersed with an

organic mucopolysaccharide matrix. The first comprehensive

overview of serpulid tube mineralogy by Bornhold and

Milliman (1973) provides data for over 100 specimens

belonging to 24 species of 11 genera. The study found only

limited correlations of tube mineralogical composition with

environmental factors and with classification. However, data

on mineralogical composition have been used to test the

generic affiliation of serpulid tubes (Ferrero et al., 2005) and

to distinguish species within a single genus (e.g. Bornhold and

Milliman, 1973; followed by ten Hove, 1974: 47).

Calcite and aragonite are rarely present in almost equal

quantities within one tube, and calcite-aragonite ratio may

significantly vary not only among species, but also within a

species and even within a single tube during the ontogeny

(Bornhold and Milliman, 1973). Vinn et al. (2008b) found some

correlations between mineralogy and ultrastructural types,

showing that lamello-fibrillar ultrastructure, mainly known for

clade A, is exclusively calcific. Similarly, the simple prismatic

ultrastructural type is clearly correlated with calcite mineralogy.

When mapped to existing phylogeny, aragonitic mineralogy

is predominantly associated with the “filogranin” non-

spirorbin clade BI having simple un-oriented structures, while

calcific mineralogy is more typical for clade A showing

complex ultrastructures (Vinn, 2012). Aragonitic irregularly

oriented prismatic structure (fig. 3A, 4A) appears to be

plesiomorphic for serpulids (Vinn and Kupriyanova, 2011),

while complex oriented calcific structures are far more

advanced. Vinn (2012) hypothesised that calcite is favoured by

the serpulid biomineralisation system for producing complex

structures. In contrast, within molluscs aragonite has a greater

variety of complex structures as compared to that of calcite

(Carter et al., 1990). Recently Smith et al. (2013) also showed

that clade Al (“Serpula- group”) tends to have mixed

mineralogy with dominating calcite, and clade All

(“Spirobranchus- group”) tends to have fully calcific

mineralogy, sometimes with little aragonite. Again no clear

correlations with environmental factors were found.

According to the hypothesis by Vinn and Mutvei (2009),

supported by Smith et al. (2013), ocean chemistry was the

dominant factor controlling the evolution of serpulid tube

mineralogy over geological time periods with differing

conditions favouring the precipitation of a certain mineral

(so-called ’’calcific” and “aragonitic” seas, see Stanley, 2006).

According to this idea, plesiomorphic serpulids of clade BI tend

to have aragonitic mineralogy because they originated and

diverged in aragonitic seas of the Triassic period, while more

advanced calcific serpulids of clade A mainly evolved during the

Jurassic-Cretaceous time, which was the epoch of calcific seas.

2.5. Organic component of tubes: will biochemistry meet

paleontology?

The only approach complementing ultrastructural and

mineralogical studies is histochemical investigation of the

organic tube component as suggested by ten Hove and van den

Hurk (1993) and Gatto and Radwanska (2000). This organic

component is represented by an inner organic membrane

lining the lumen and an organic matrix inside the tube walls.

The inner organic membrane is found in all serpulids (Nishi,

1993; Vinn, 2011) and may play an important role for the

biomineralisation process (Tanur et al., 2010), but this needs

further clarification (Vinn, 2011). The organic matrix of the

tube wall should be preserved in fossil serpulid tubes, as it

does in mollusc shells. The tube matrix seems to be organised

in thin sheets running parallel to accretion surfaces (Vinn et

al., 2008b), but such organisation was observed only in some

taxa within clade A (Vinn, 2013b). Tanur et al. (2010) found

that most of the soluble organic tube matrix of a Recent species

Hydroides dianthus (Verill, 1873) is composed of carboxylated

and sulfated polysaccharides, whereas proteins form a minor

component. No data on other species are available and further

studies are needed to determine usability and potential of this

method for paleontology.

3. An outline of serpulid evolution as revealed by fossils

3.1. False serpulids: tubular fossils below the Precambrian-

Cambrian boundary (~541 Ma)

During so-called “Cambrian explosion”, an episode in the

Earth history that took place about 541 Ma, most major fossil

invertebrate groups suddenly appeared in paleontological

record within a short time interval, often having developed

mineral structures within or around the body.

Many tubular fossils of problematic affinity appeared

already during the preceding Late Ediacaran (~577-541 Ma).

They include chitinous tubes of sabelliditids, often considered

to be the ancestors of Recent Siboglinidae, and calcified

tubular problematics Cloudina, Sinotubulites (Chen et al.,

2008), as well as unusual forms with triradial symmetry, such

as Anabarites (Kouchinsky et al., 2009). Many of these tubular

fossils have been attributed to annelids in general and serpulids

in particular (e.g. Yochelson, 1971; Glaessner, 1976; Chen et

al., 1981; Bandel, 1986), but their true biological affinities are

usually unresolved. The major function of mineralised tubes

was probably protection against predation (Bengston, 2002),

but physiological adaptation to changing ocean chemistry and

the opportunity to grow larger were also proposed (e.g.

Bengston, 2004: 69-70).

Cloudina (fig. 6A), the most famous tube-building

metazoan common in deposits of the terminal Neoproterozoic

Ediacaran Period (549-541 Ma), has often been affiliated with

serpulids (Germs, 1972; Glaessner, 1976; Hua et al., 2005).

Tube morphology and microgranular ultrastructure (fig. 5A)

suggest that Cloudina is not closely related to any Recent

calcareous polychaetes (serpulids, sabellids or cirratulids)

(Vinn and Zaton, 2012a). The type of asexual reproduction and

presence of a closed tube base in Cloudina is more compatible

Written in stone: history of serpulid polychaetes through time

137

0 M

oooooo8g§o8888oo

Kn n ° 89 °^ 000808

)OOqOO 0R80OOOOOOC

OOOOt

_ _ 0000c

_ QQpQqc

OOQOOOOO

[oooooooo

0000000c

DOOOOOOC

0000000

000000c

T 0000006c

T OOOPOO Ot

»ogg|g|lIl

@B§ 8 p®

Figure 4. Schematic presentation of serpulid tube ultrastructures (from Vinn et al., 2008b). A - irregularly oriented prismatic (IOP) stmcture. B -

spherulitic irregularly oriented prismatic (SIOP) structure. C - irregularly oriented platy (IOPL) structure. D - homogeneous angular crystal (HAC)

structure. E - rounded homogeneous crystal (RHC) stmcture. F - semi-ordered irregularly oriented prismatic (SOIOP) stmcture. G - semi-ordered

spherulitic irregularly oriented prismatic (SOSIOP) stmcture. H - spherulitic prismatic (SPHP) structure. I - simple prismatic (SP) stmcture. J - lamello-

fibrillar (LF) stmcture. K - sphemlitic lamello-fibrillar (SLF) stmcture. L - ordered fibrillar (OF) stmcture. Regularly ridged prismatic stmcture (RRP,

see fig. 3 M-O) is similar to SP stmcture. Abbreviations: H: horizontal section; L: longitudinal section; T: transverse section.

138

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

with the hypothesis of an animal of cnidarian grade (Hua et ah,

2005; Vinn and Zaton, 2012a; Zhuravlev et ah, 2012).

3.2. Paleozoic (541-252 Ma) tubular problematic taxa

Paleozoic rocks, especially of Early Cambrian age (-540 Ma),

contain tubular fossils of uncertain affinities, some of which

are carbonate (e.g. Coleolella), and others are phosphatic

(. Hyolithellus, Sphenothallus) or even siliceous ( Platysolenites ).

Among Paleozoic fossils, two common and diverse fossil

groups, Cornulitida and Microconchida, have traditionally

been described as serpulids. Including them in the serpulid

fossil record resulted in a long-held controversy regarding the

geological age of calcareous polychaetes and in wrong

interpretations of evolutionary patterns within the Serpulidae

by both zoologists (e.g. Pillai, 1970; Knight-Jones, 1981) and

paleontologists (Jager, 1993: 101).

Cornulitids (fig. 6B) are mostly small (2-5 mm, although

some species could reach 25 mm in tube diameter) calcareous

tubular fossils ranging from the Middle Ordovician to the

Carboniferous (470-300 Ma) and found in normal marine

settings. They have been affiliated with annelids due to the

tubular shape of their shells. Similar to modern serpulids,

cornulitids were presumably suspension feeders and common

encrusters on Paleozoic hard substrates. Their biological

affinities have long been debated, but they could represent

stem group of phoronids (Taylor et al., 2010). Recent analysis

by Vinn and Zaton (2012b) places them with confidence within

the Lophotrochozoa.

Microconchids (fig. 6C) are a Spirorbis- like extinct group

of lophophorates ranging from the Late Ordovician to the

Middle Jurassic (458-164 Ma) that inhabited all aquatic

environments from hypersaline to freshwater (Zaton et al.,

2012). Due to their small size (usually <1 mm, up to 2 mm in

coil diameter) and obligatory spirally coiled calcareous tubes,

for decades microconchids were treated as spirorbins (e.g.

Goldfuss, 1831; Zittel, 1880; Malaquin, 1904; Howell, 1962;

Figure 5. Ultrastractural diversity of fossil serpulids and some typical “pseudoserpulids”. A-C: ultrastructures of most characteristic pseudoserpulids: A

- Cloudina sinensis Zhang et al. in Ding et al., 1992, showing microgranular structure; Late Ediacaran (549-542 Ma), China (after Feng et al., 2003: fig.

lb). B - microconchoid Palaeoconchus tenuis (Sowerby in Murchison, 1839), Silurian (Wenlockian; 433-427 Ma), England (after Vinn, 2006: fig. 4).

C - microconchoid Punctaconchus ampliporus Vinn et Taylor, 2007, surface showing pores; Middle Jurassic (Bathonian, 168-166 Ma), U.K. (after Vinn

and Taylor, 2007: fig. A 2 ). D-I: ultrastructures of fossil serpulids: D - ‘ Serpula ’ etalensis (Rette, 1856), longitudinal section of irregularly oriented

prismatic structure (IOP); Early Jurassic, Late Pliensbachian (-185 Ma), eastern Germany (after Vinn et al., 2008c: fig. ID). E - Rotularia spirulaea

(Lamarck, 1818), longitudinal section of homogeneous angular crystal structure? (HAC); Eocene (56-34 Ma) of Doss Trento, Northern Italy. F - Protula

sp., cross section of semi-ordered irregularly oriented prismatic structure (SOIOP); Tongrian, Late Eocene (-35 Ma), Latdorf, North Germany (after

Vinn, 2007: fig. 3.1, detail). G - Propomatoceros sp., outer tube layer, spherulitic prismatic structure (SPHP); Middle Volgian (-148 Ma), Samara

region, Russia. H - Placostegus polymorphus Rovereto, 1895, cross section of simple prismatic stmcture (SP); Badenian (-15 Ma). Miocene,

Ehrenhausen, Styria, Austria (after Vinn, 2007: fig. 1.5, detail). I - Spiraserpula sp., oblique section of lamello-fibrillar structure (LF); Badenian (-15

Ma), Miocene, Nussdorf, Vienna, Austria (after Vinn, 2007: fig. 4.5).

Written in stone: history of serpulid polychaetes through time

139

Regenhardt, 1964; Pillai, 1970; Lommerzheim, 1979; 1981;

Jager, 1983; 1993). Burchette and Riding (1977) who analysed

microconchid morphology and tube ultrastructure, were the

first to justify doubts about their annelid affinities and

interpreted them as gastropods. The microconchid

microlamellar tube wall (fig. 5B) with small pores (fig. 5C) is

incompatible with known serpulid ultrastructural diversity,

and currently microconchids are interpreted as extinct

tentaculitoids (Weedon, 1991; Taylor and Vinn, 2006).

None of the reports of Paleozoic serpulids, starting from

Cambrian and Ordovician (e.g. Dalve, 1948; Clausen and

Alvaro, 2002) and continued by Devonian (e.g. Sandberger

and Sandberger, 1856) records, show the presence of

unequivocal serpulid tube characters (such as, for example, a

LEGEND

O key points in polychaete

evolution, inferred

from fossil record

'pseudoserpulid"

stratigraphic distribution

genuine calcareous

tubeworms distribution

I genuine calcareous

i tubeworms,

questionable

distribution

l interva I s with no fi n d s

I connecting problematic

and unequivocal records

distribution, predicted

l from analysis of the

1 phytogeny but not yet

confirmed by fossil record

evolutionary

transitions

MOSTCOMMON

“PSEUDOSERPULIDS”

Figure 6. Outline of geological history of calcareous polychaetes and some convergent tube-dwelling taxa (“pseudoserpulids”) during the Phanerozoic.

A - Cloudina hartmannae Germs, 1972, SEM, Late Ediacaran (549-542 Ma), China (after Hua et al., 2005: fig. 1A). B - Cornulites sp.. Early

Ordovician (485-470 Ma), Estonia (after Vinn, 2013a: fig. 8). C - microconchoid Palaeoconchus tenuis (Sowerby in Murchison, 1839), Silurian

(Wenlockian; 433-427 Ma), England (after Vinn, 2006: fig. 4). Scale: A - 3 mm, B - 0.5 mm, C - 1 mm.

140

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

median keel or tubules). Many of these finds still should be

re-investigated to check their annelid affinity. The most

confusing records of numerous Paleozoic serpulid genera are

provided in the overview by Ziegler (2006), who treated

almost all existing tubular fossils as serpulids. There is no

reason to support such an opinion.

3.3. Possible calcareous tubeworms of the Late Paleozoic

Some Late Carboniferous to Permian records of calcareous

tubes likely belong to the sabellid genus Glomerula judging by

their slowly growing tubes with characteristic glomerate

coiling. The most ancient among them are the Late

Carboniferous (323-304 Ma) “tubeworms” (Hoare et al., 2002,

fig. 1.1-1.7) and probably also species described as “ Serpula ”

spp. by Stuckenberg (1905). Younger finds of the same type are

Late Permian (265-254 Ma) fossils from Australia described as

Serpula testatrix Etheridge, 1892. All these finds are

characterised by the tube diameter of only about 0.25 mm,

while younger Mesozoic Glomerula tubes (fig. 7C-E) can reach

up to 4-5 mm in diameter, and tubes of the only known Recent

species G. piloseta (Perkins, 1991) have diameters about 0.5

mm. Sabellids seem to have a primitive biomineralisation

system compared to that of serpulids (Vinn and Mutvei, 2009),

and thus their earlier representatives may be interpreted as

common ancestors of calcified sabellids and serpulids.

More or less coeval are Late Permian finds of attached

tubes that do not show typical glomerate coiling and, therefore,

may potentially represent true serpulids (e.g. some figured

specimens of u Serpula pusilla Geinitz, 1848”, “ Vermilia ”

obscura King, 1850 and maybe “ Serpulites ” from Australia

(Guppy et al., 1951)). Such fossils were also reported from

Lithuania by Suveizdis (1963). Due to small size of these

fossils, similar to that of above-mentioned sabellids, details of

their morphology are unclear from old descriptions and figures,

so their potentially serpulid nature is yet to be re-investigated.

3.4. Earliest records of genuine serpulids

Serpulids seem to rise soon after the Permian-Triassic boundary,

famous for being the largest extinction event in geological

history. Adequately preserved fossils of first unequivocal

serpulids from the Middle Triassic (Late Anisian, -244 Ma) of

China are represented by strange tiny tubes lacking any

sculpture or having an indistinct single median keel. They were

described within two new genera as Weixiserpula weixi Stiller,

2000 and Ruxingella lianjiangensis Stiller, 2000. Exactly of the

same age (Late Anisian; -244 Ma) are the first unequivocal

finds of small pseudocolonial tubes described as Filograna

minor by Senowbary-Daryan et al. (2007) from Turkey, and a

diversified community described by Assmann (1937) from

Upper Silesia (Western Poland). The latter, besides Filograna

morphotype, includes large-sized tubes, some of which have

longitudinal sculpture and some show a tendency to build

aggregations. Slightly younger (Ladinian; -242-237 Ma) are

records of tubes from South Europe with more or less prominent

single median keels (Fliigel et al., 1984: 186, PI. 26, fig. 9).

During the Late Triassic serpulids became widely distributed

along the northern and southern margins of the Tethys Ocean.

Fossil tubes morphologically similar to Recent morphotypes are

known from Indonesia (Jaworski, 1915) and Europe (Munster,

1841; Ziegler and Michalfk, 1980; Jadoul et al., 2005, fig. 4c).

Some of them are large-sized forms, with tube diameters up to

5-6 mm, but mostly unsculptured. Numerous records of small

tube bundles from the Late Triassic sediments of Southern

Europe and Turkey (Schmidt and von Pia, 1935; Senowbari-

Daryan and Link, 2005) comparable to those of Recent Filograna

(fig. 2D, 7F-G) indicate wide dispersal of this genus during the

Figure 7. Morphological diversity of Jurassic and Cretaceous (mainly Early Cretaceous) tube-dwelling polychaetes. A, B - fossil serpulid communities

encrusting belemnite rostra, PIN 5071/100 and 5071/101, respectively; Middle Oxfordian (161 Ma), Kostroma region, Russia. C-E: calcareous sabellids:

C - Glomerula flaccida (Goldfuss, 1831). PIN 5071/2, Late Callovian (163.5 Ma), Moscow region, Russia (after Ippolitov, 2007a: PI. 7, fig. 2); D -

Glomerula gordialis (von Schlotheim, 1820) with characteristic glomerate coiling, PIN 5071/102, Middle or Late Oxfordian (161-158 Ma), Mordovia

region, Russia; E - Glomerula cf. plexus (J. de C. Sowerby, 1829), pseudocolonial form, PIN 5071/106; Middle Volgian (150 Ma), Samara region,

Russia. F-J: possible members of serpulid clade BI: F-G - Filograna socialis (Goldfuss, 1831), pseudocolonial form, PIN 5071/109; Middle Volgian

(150 Ma), Orenburg region, Russia; H - Metavermilia goldjussi Ippolitov, 2007a, PIN 5071/15, Late Callovian (163.5 Ma), Moscow region, Russia

(after Ippolitov, 2007a: PI. 7, fig.15); I -Metavermilia striatissima (Fiirsich, Palmer et Goodyear, 1994), PIN 5071/134(1,2), Late Oxfordian (159 Ma),

Kostroma region, Russia; J - Vermiliopsis negevensis Vinn et Wilson, 2010, TUG 1372-2, Late Callovian (~ 164 Ma), Israel (after Vinn and Wilson,

2010: fig. 6.2). K-0 - possible members of serpulid clade AIL K - “ Filogranula ” runcinata (J. de C. Sowerby, 1829), PIN 5071/112(1, 2), Middle

Oxfordian (161 Ma), Kostroma region, Russia; L - Propomatoceros lumbricalis (von Schlotheim, 1820), No. 5071/24-28, Late Callovian (163.5 Ma),

Moscow region, Russia (after Ippolitov, 2007b: PI. 12, fig. 3); M - the same, PIN 5071/36, same age and locality (after Ippolitov, 2007b: PI. 12, fig. 7);

N - Mucroserpula tricarinata (J. de C. Sowerby, 1829), PIN 5071/19, Late Callovian (163.5 Ma), Moscow region, Russia (after Ippolitov, 2007b: PI.

12, fig. 2); O -Neovermilia ampullacea (J. de C. Sowerby, 1829), PIN 5204/9, TTuronian (94-89 Ma), Bryansk region, Russia. P-Q: probable members

of serpulid clade AL P - Spiraserpula oligospiralis Ippolitov, 2007b, PIN 5071/50 (holotype). Late Callovian (163.5 Ma), Moscow region, Russia (after

Ippolitov, 2007b: PL 12, fig. 11); Q - ‘’"Serpula” sp. nov., PIN 5071/136 (1, 2, 3), Late Oxfordian (-158 Ma), Kostroma region, Russia. R-Z: clade

uncertain: R - Pseudomicrorbis cf. pseudomicrorbis Jager, 2011, problematic taxon interpreted as close to plesiomorphic spirorbins, PIN 5071/150, Late

Berriassian (-141 Ma), Crimea, Ukraine; S-T: Nogrobs (Tetraserpula ) barremicus (Sasonova, 1958), PIN 5071/151, Late Barremian (-126 Ma),

Saratov region, Russia; U-W: Rotulispira damesii (Noetling, 1885), clockwise coiling. PIN 5204/13, Cenomanian (100-94 Ma), Orel region, Russia: U

- view from upper side, V - view from lower (attachment) side, W - lateral view; X-Z: Teetorotularia cf. polygonalis (J. de C. Sowerby, 1829), PIN

5204/6, Aptian (125-113 Ma), Atyrau region, Kazakhstan: X - view from upper side, Y - view from the attachment side, Z - lateral view. Material is

deposited in the Paleontological Institute of Russian Academy of Sciences (PIN) and the Natural History Museum, Geological Museum, University of

Tartu, Estonia (TUG). Scale: A-C - 10 mm, D-K - 5 mm, L, M - 10 mm, N-Z - 5 mm.

Written in stone: history of serpulid polychaetes through time

141

142

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

Late Triassic epoch. The Late Triassic (Carnian) genus

Corynotrypoides , characterized by tiny quickly branching tubes

forming procumbent pseudocolonies and originally described as

bryozoan (see Taylor, 2014), seems too be reasonably close to

Filograna. At least some of the Triassic serpulids were members

of reef communities, and some of them were even reef-forming

organisms (e.g. Braga and Lopez-Lopez, 1989).

In total, only about 10 species are known from the Late

Triassic (e.g. Ziegler and Michalfk, 1980; Senowbari-Daryan

and Link, 2005; Senowbari-Daryan et al., 2007), but due to

the relatively small size of tubes, Triassic fossil diversity is

poorly studied. Morphological diversity of this period

includes several characteristic types similar to Recent forms,

suggesting that at least some extant genera have their

evolutionary roots in the Triassic. The presence of Filograna-

like fossils indicates that not only clade B was already

separated from clade A by this time, but inside clade BI the

Protis-Filograna clade had already diverged from the

Chitinopoma-Protula-Metavermilia-Vermiliopsis clade by

the end of the Triassic (fig. 9). Probable members of the latter

group are small triangular to pentangular tubes described as

“Serpula spec, indet.” by Jaworski (1915). Interestingly, in the

earliest known Filograna {F. minor Senowbary-Daryan et al.,

2007) from the Middle Triassic, tubes of individual specimens

are not yet densely connected to each other, while in Late

Triassic species the integration of individuals is more

prominent (see Senowbari-Daryan and Link, 2005). This may

mean that early evolution of the Filograna!Salmacina clade

and its divergence from other serpulids occurred shortly

before the Middle Triassic.

Figure 8. Morphological diversity of Mesozoic (Late Cretaceous) and earliest Cenozoic tube-dwelling polychaetes. A, B: calcareous sabellid Glomerula

serpentina (Goldfuss, 1831): A - cross-section, showing trilobate lumen, GPIHH 4402, latest Maastrichtian (-66 Ma), Maastricht region, Netherlands

(after Jager, 2005: PI. 1, fig. 6); B - specimen with characteristic meandrous coiling, GPI HH 2556, Early Maastrichtian (-71 Ma), Lower Saxony,

Germany (after Jager, 1983: PI. 2, fig. 2). C-F: possible members of clade BI: C, D - “ Filogranula ” cincta (Goldfuss, 1831): C - BGR/NLfB kma 324,

Late Maastrichtian (-70 Ma), Lower Saxony, Germany (after Jager, 1983: PI. 8, fig. 10); D - SCMH 782, Coniacian (-88 Ma), Helgoland Island,

Schleswig-Holstein, Germany (after Jager, 1991: PI. 5, fig. la). E -Metavermilia ( Vepreculina ) minor Jager, 1983, holotype, BGR/NLfB kca 46, Early

Campanian (-80 Ma), Lower Saxony, Germany (after Jager, 1983: PI. 9, fig. 8b). F - Vermiliopsis fluctuata (J. de C. Sowerby, 1829), BGR/NLfB kma

321, Early Maastrichtian (-70 Ma), Lower Saxony, Germany (after Jager, 1983: PI. 8, fig. 2a). G-U - possible members of All clade: G, H-Dor so serpula

wegneri (Jager, 1983); G - aperture with ’’Nebenrohre”, additional tube of uncertain nature, GPI GO 843-4, Campanian or Early Maastrichtian (-83-72

Ma), Lower Saxony, Germany (after Jager, 1983: PI. 4, fig. 5); H - holotype, characteristic coiling mode around crinoid stem object, BGR/NLfB ksa 15,

Late Santonian (-84 Ma), Lower Saxony, Germany (after Jager, 1983: PI. 4, fig. la); I -Neovermilia ampullacea (J. de C. Sowerby, 1829), SCMH 885,

Turonian or Coniacian (-94-86 Ma), Helgoland Island, Schleswig-Holstein, Germany (after Jager, 1991: PI. 1, fig. 4c); J - Parsimonia parsimonia

Regenhardt, 1961, spirally coiled modification, GPI GO 843-3, Middle Santonian (-85 Ma), Lower Saxony, Germany (after Jager, 1983: PI. 3, fig. 4a);

K, L -Pyrgopolon ( Septenaria ) macropus (J. de C. Sowerby, 1829), GPI HH 2577, Early Maastrichtian (-71 Ma), Riigen Island, Mecklenburg-Western

Pomerania, Germany (after Jager, 1983: PI. 10, fig. 8b,d); M, N - Pyrgopolon {Hamulus) sexangularis (Munster in Goldfuss, 1831), GPI GO 843-8,

Late Campanian (-74 Ma), Lower Saxony, Germany (after Jager, 1983: PI. 11, fig. lid, a); O, P -Pyrgopolon {Pyrgopolon) mosae mosae de Montfort,

1808; O - GPI HH 4427, latest Maastrichtian (-66 Ma), Maastricht region, Netherlands (after Jager, 2005: PI. 7, fig. 3); P - base of broken tube showing

tubulae, NHMM 2001 101, Late Maastrichtian (-67 Ma), Maastricht region, Netherlands (after Jager, 2005: PI. 7, fig. 1); Q-R- operculum of Pyrgopolon

{Pyrgopolon) mosae ciplyana (de Ryckholt, 1852), from private collection. Late Maastrichtian (-68 Ma), Maastricht region, Netherlands (after Jager,

2005: PI. 7, fig. 7b,a); S -Pyrgopolon {Pyrgopolon) regia regia Regenhardt, 1961, NHMM JJ 882b, Late Maastrichtian (-68 Ma), Belgium (after Jager,

2005: PI. 8, fig. 6b); T -Pyrgopolon {Septenaria)polyforata (Jager, 1983, BGR/NLfB kma335, Early Maastrichtian (-70 Ma), Lower Saxony, Germany

(after Jager, 1983: PI. 10, fig. 11); U -Ditrupa schlotheimi (Rosenkrantz, 1920), NHMM 1992200-2, Early Danian (-66-65 Ma), Belgium (after Jager,

1993: PI. 4, fig. 2). V-W: questionable members of clade All: V - Pentaditrupa subtorquata (Miinster in Goldfuss, 1831), BGR/NLfB kma 309, Early

Maastrichtian (-71 Ma), Lower Saxony, Germany (after Jager, 1983: PI. 7, fig. 2); W -Nogrobs {Tetraditrupa) canteriata (von Hagenow, 1840), GPI

BN 2 GPI Bo M. Jager, Early Maastrichtian (-71 Ma), Riigen Island, Mecklenburg-Western Pomerania, Germany (after Jager, 1983: PI. 7, fig. 10).

X-HI: clade uncertain, taxa with obligatory spiral coiling: X-Y - Conorca trochiformis (von Hagenow, 1840), GPI HH 2588, Early Maastrichtian (-72

Ma), Schleswig-Holstein, Germany (after Jager, 1983: PI. 13, fig. 8a, b); Z - Cycloplacosteguspusillus (J. de C. Sowerby, 1844), GPI HH 2582, latest

Campanian (-73 Ma), Schleswig-Holstein, Germany (after Jager, 1983: PI. 12, fig. 11); AB-BC - Protectoconorca senonensis Jager, 1983, holotype,

GPI HH 2609, Middle Santonian (85 Ma), Lower Saxony, Germany (after Jager, 1983: PI. 16, fig. 2a,b); CD - Rotularia tobar gracilis Jager, 1993,

holotype, NHMM 1992201-1, Early Danian (-66-65 Ma), Belgium (after Jager, 1993: PI. 5, fig. 1); DE - Orthoconorca turricula (d’Eichwald, 1865),

GPI HH 2593, Early Maastrichtian (-72 Ma), Schleswig-Holstein, Germany (after Jager, 1983: PI. 14, fig. 3); EF - Neomicrorbis crenatostriatus

subrugosus (Munster in Goldfuss, 1831), lectotype, GPI BN 5 GPI Bo M. Jager; Late Campanian (-73 Ma), North Rhine-Westphalia, Germany (after

Jager, 1983: PI. 15, fig. 9a); FG-HI: Neomicrorbis crenatostriatus crenatostriatus (Munster in Goldfuss, 1831): FG - BGR/NLfB (G), Nr. kma351. Early

Maastrichtian (-71 Ma), Lower Saxony, Germany (after Jager, 1983: PI. 15, fig. 2a); GH-HI - operculum, GPI HH 2604, Early Campanian (-83 Ma),

Schleswig-Holstein, Germany (after Jager, 1983: PI. 15, fig. 6b,a). IJ-KL: genuine spirorbins: H - Bipygmaeus pygmaeus (von Hagenow, 1840), GPI

HH 4434, latest Maastrichtian (-66 Ma), Maastricht region, Netherlands (after Jager, 2005: PI. 8, fig. 13a); JK-KL - Neodexiospira palaeoforaminosa

Jager, 2005, latest Maastrichtian (-66 Ma), Maastricht region, Netherlands: JK - GPI HH 4437 (after Jager, 2005: PI. 8, fig. 17); KL - GPI HH 4438

(after Jager, 2005: PI. 8, fig. 18b). Material is deposited in the Geologisch-Palaontologisches Institut und Museum der Universitat Hamburg (GPI HH),

Geozentrum Hannover (formerly: Bundesanstalt fur Geowissenschaften und Rohstoffe/Niedersachsisches Landesamt fiir Bodenforschung, Hannover)

(BGR/NLfB), Geowissenschaftliches Zentmm der Universitat Gottingen (formerly: Geologisch-Palaontologisches Universitats-Institut, Gottingen)

(GPI GO); Natuurhistorisch Museum Maastricht (NHMM); Steinmann-Institut fiir Geologie, Mineralogie und Palaontologie der Universitat Bonn

(formerly: Geologisch-Palaontologisches Universitats-Institut), Bonn (GPI BN); Stiihmer collection in the Museum Helgoland (SCMH). Scale: A - 0.5

mm, B-H, K-S, U, V, X-Z, CD-KL- 1 mm, I, J, T, W, AB, BC - 5 mm.

Written in stone: history of serpulid polychaetes through time

143

144

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

Figure 9. Geological history of calcareous tube-building polychaetes in Mesozoic and Cenozoic suggested by fossil record. Only the most common

serpulid genera and those from the phylogenetic tree (fig. 1) are included. For legend see Figure 6. Major events: 1 - most ancient finds of cirratulids

with calcified tubes; 2 - the youngest possible position of “coiling point” in spirorbins; 3 - first finds of calcified opercula in several serpulid lineages;

4 - penetration of serpulids to freshwater cave habitat.

Written in stone: history of serpulid polychaetes through time

145

Whether triangular tubes with single keels on the upper

side (e.g. “ Propomatoceros ” slavicus Ziegler and Michalfk,

1980) and large-sized tubes with round cross-section (“ Serpula ”

constrictor Winkler, 1861 sensu Jaworski, 1915) from Indonesia

are representatives of clade A or clade BI is uncertain.

“ Serpula ” schimischowensis Assmann, 1937, characterised by

large tubes with one or two indistinct keels, is probably the

only Triassic species that can be confidently interpreted as a

member of clade A (either AI or All). However, most Triassic

finds cannot be attributed to any particular clade.

In conclusion, serpulids did not seem to play a significant

role in Middle Triassic ecosystems, and their wide diversification

and world-wide dispersal began during the Late Triassic to the

Early Jurassic (237-174 Ma). Calcareous tubes first appeared in

sabellids and serpulids either in the Late Paleozoic or during the

Triassic as an adaptation to predation pressure and evolved in

rapidly changing post-Permian/Triassic extinction ecosystems.

The main evolutionary trends suggested by Triassic finds are size

diversification that resulted in appearance of large tubes,

including irregularly coiled attached ones, and wide dispersal of

pseudocolonial forms. However, all known Triassic serpulid

localities are restricted to the margins of the warm Tethys Ocean

that extended sub-latitudinally from South Europe to Indonesia.

3.5. Jurassic (201-145 Ma) diversification epoch

Serpulid faunas of the Jurassic are relatively well studied.

Taxonomical reviews describing morphological variety of

fossil tubes are mostly based on European material (Parsch,

1956; Ippolitov, 2007a, b; Jager and Schubert, 2008) with most

species known since the 19 th century (e.g. Goldfuss, 1831).

The Triassic/Jurassic boundary is characterised by the

large extinction event, but its influence on serpulid biota has

not been studied. In the Early Jurassic (201-174 Ma) new

serpulid morphotypes include larger sculptured subtriangular

to sub-pentangular attached tubes with prominent median

keels (genus Propomatoceros ) and free-lying pentagonal tubes

(genus Pentaditrupa; see Jager, 2005; Jager and Schubert,

2008). During the Early Jurassic epoch, serpulids, including

Filograna- like forms (Aberhan, 1992) seem to disperse from

Europe to South America (Behrendsen, 1891; Biese, 1961). The

most ancient finds of free-lying tetragonal serpulids of the

genus Nogrobs are known from South America (Behrendsen,

1891) and dated by Late Pliensbachian (~185 Ma), while finds

of this genus in Europe are somewhat younger (Late Toarcian;

~176 Ma; Jager, 2005). During the Early Jurassic, serpulids

also first dispersed to temperate waters of Northern Hemisphere,

appearing in North Siberia (Ippolitov, unpubl.; Kirina, 1976:

98). In Canada diversified Boreal serpulid communities are

known starting from the Middle Jurassic (Bathonian/Callovian

boundary, ~166 Ma; Parsch, 1961).

During the Middle-Late Jurassic (174-145 Ma) the total

number of known serpulids increased up to about 150 nominal

species (Parsch, 1956; Ippolitov, 2007a, b; 2010), but the exact

number is uncertain because many taxa are in need of revision.

This was the time of remarkable radiation in Mesozoic

(Ippolitov, 2010), which included the appearance of most

important serpulid morphotypes, such as forms with multiple

keels and spiral tubes (Ippolitov, 2010; also fig. 7). The earliest

representatives of many extant genera (e.g. Vermiliopsis,

Nogrobs, Metavermilia, Spiraserpula ) can be recognised with

confidence in the Jurassic (Jager, 1983; 1993; 2005; Ippolitov,

2007a, b; 2010; Vinn and Wilson, 2010).

Comparison of the fossil record of this age with the

molecular phylogeny of Recent taxa (fig. 1) shows that Middle

Jurassic fossil faunas already contain members of all three

major clades, and even smaller clades, including some extant

genera, can be recognised (fig. 9). Clade BI is represented by

numerous small to medium-sized tubes with several keels

classified as Vermiliopsis and Metavermilia. The first members

of these genera are confidently traced from the Middle Jurassic

(Metavermilia goldfussi Ippolitov, 2007a and Vermiliopsis

negevensis Vinn et Wilson, 2010) starting from the Bajocian

(~170 Ma). There are earlier records of Metavermilia- like

tubes from the Late Triassic (Rhaetian; 208.5-201 Ma) and

Pliensbachian (191-183 Ma) (Jager, 2005: 148), but because

these finds remain undescribed, they are considered here as

members of Metavermilia-Vermiliopsis clade (fig. 9) or its

stem group. During the Late Jurassic the morphogroup

Metavermilia-Vermiliopsis (fig. 7H-J) was represented by

numerous species (Goldfuss, 1831; Parsch, 1956), suggesting

that all main divergence events in the Chitinopoma-Protula-

Metavermilia-Vermiliopsis clade happened before the end of

the Jurassic. However, unequivocal members of the Protula-

Chitinopoma clade were still not present in the Jurassic,

probably indicating that divergence within this branch took

place later. Another member of clade BI, Filograna/Salmacina

(fig. 7F, G) was common in the Jurassic continuing from the

Triassic. Non-attached and variously curved tubes were widely

spread in the Early Jurassic (Jager, 1993). Some of them, e.g.

“ Serpula ” etalensis (Piette, 1856), have tubes with round

cross-sections and numerous peristomes, thus resembling free

anterior parts of Recent deep-sea Bathyvermilia (ten Hove,

pers. comm. 2014) belonging to clade BI. The affinity of

“ Serpula ” etalensis with this clade is supported by simple

unilayered wall with irregularly oriented prismatic (IOP)

(Vinn et al., 2008c) structure, which is characteristic for

members of clade BI.

Clade AI is represented in the Jurassic by Spiraserpula.

The most ancient probable member of this genus is

Spiraserpula oligospiralis Ippolitov, 2007b (fig. 7P) from the

Middle-Upper Jurassic boundary (Late Callovian/Early

Oxfordian; 163.5 Ma), which has characteristic tube coiling,

but no ITS typical for younger (Cretaceous to Recent) members

of the genus. There are numerous doubtful records of this

genus and related Cementula from the Early-Middle Jurassic

(see Jager, 1993; Ippolitov, 2007b; Jager and Schubert, 2008)

and even Triassic (Ziegler and Michalik, 1980). Because all

these pre-Callovian tubes do not have typical subtriangular

cross-sections with median keel extending into a spine over

the aperture, these records may belong either to the

representatives of the calcareous sabellid Glomerula (that

tends to have spirally coiled tubes as juveniles) or to a yet

undescribed genus. The presence of well-defined Spiraserpula

in Middle-Late Jurassic indicates that true representatives of

the Serpula-Hydroides clade must have already existed at that

time, but most fossil species can hardly be placed within these

146

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

genera. The probable exception is Late Jurassic (Tithonian,

~150 Ma) Serpula coacervata Blumenbach, 1803, which is

similar in morphology to some Recent Serpula species and

also produced tube aggregations (ten Hove and van den Hurk,

1993). Another possible clade AI member of Late Oxfordian

age (~158 Ma), belonging to still undescribed species, can be

seen in fig. 7Q.

Clade All is represented by the well-recognizable genus

Placostegus traced from the Late Oxfordian (~158 Ma:

Placostegus conchophylus Radwanska, 2004). Like Recent

forms, fossil Placostegus spp. already had transparent tubes

(Ippolitov, unpubl.) Other transparent tubes of the same age

are usually classified as Filogranula (fig. 7K) (see Ippolitov,

2007a) and are known from the latest Early Jurassic and

Middle Jurassic (“ Serpula tricristata” Goldfuss, 1831: Early

Toarian to earliest Aalenian, ~180-174 Ma). Given that tube

transparency is produced by simple prismatic (SP) structure

(Vinn et al., 2008b) and that all non-spirorbin Recent species

having this structure are members of clade All (Vinn and

Kupriyanova, 2011), fossil transparent tubes can be interpreted

as belonging to members of clade All, probably related to the

Placostegus and Vitreotubus. Data on tube ultrastructures of

some fossil species with quadrangular tubes (Vinn and Furrer,

2008; Vinn et al., 2012) show that such tubes also have SP

structure, thus confirming attribution of such tubes to clade

AIL Another possible member of the clade All is Neovermilia

(fig. 70) that, like Placostegus , is known from the Late

Oxfordian (Radwanska, 2004).

The Ditrupa-Pseudochitinopoma group is another

subclade within clade All with possible roots in the Jurassic

period. Small tubes with characteristic more or less regular

transverse ridges and circular cross-section, closely resembling

Recent Pseudochitinopoma beneliahuae Kupriyanova et al.,

2012, are known from the Late Callovian or Early Oxfordian

(~164-163 Ma; Ippolitov, unpubl.) of Crimea. Although

representatives of true Ditrupa appear only after the

Cretaceous-Paleogene boundary (Jager, 1993 and fig. 8U),

from the beginning of the Early Jurassic (Hettangian; ~200

Ma) there are records of Pentaditrupa (Jager and Schubert,

2008), a genus with free-lying pentagonal tubes considered as

a likely direct ancestor of Ditrupa (see Jager, 1993: 92; Jager

and Schubert, 2008: 56).

Numerous fossils having large sub-triangular tubes with

pronounced median keels appear during the Early Jurassic.

They are classified within the exclusively “fossil” genus

Propomatoceros (fig. 7L, M) and related Mucroserpula

(Ippolitov, 2007b; Jager and Schubert, 2008). Tube

ultrastructures of Propomatoceros show a dense outer layer

(sensu Vinn and Kupriyanova, 2011) formed by spherulitic

prismatic structure (SPHP; fig. 5G), typical for clade A.

Despite the striking morphological similarity of these tubes to

Recent Spirobranchus, fossil Propomatoceros seem to lack

opercular calcification, therefore, its attribution to any of

Recent genera is not justified (Ippolitov, 2007b). Jurassic

Propomatoceros appears to be a member of Laminatubus-

Spirobranchus clade (fig. 1) or a stem group including common

ancestors of Laminatubus-Spirobranchus and Galeolaria-

Ficopomatus-Marifugia clades.

In addition to the morphotypes well-represented in Recent

biota, large spirally coiled tubes adapted for settlement on

small objects with subsequent transition to free-lying on soft

substrates originated during the Jurassic (Jager, 1993). Such

tubes became an essential component of serpulid faunas in

late Mesozoic (Cretaceous) seas. It seems that during the

Jurassic such a morphotype has appeared at least twice: in the

Early Jurassic ( Nogrobs s. str. with tetragonal tubes) and in the

Late Jurassic (Kimmeridgian; ~155 Ma) of Austral Realm

(Austrorotularia with three-keeled tubes). The phylogenetic

position of these genera is uncertain. Fossil Nogrobs seems to

be a member of clade All according to its transparent tube

with simple prismatic (SP) structure (Kupriyanova and

Ippolitov, 2012). However, Recent members of the genus,

Nogrobs grimaldii (Fauvel, 1909), have opaque tubes {ibid),

which makes matching of Recent and fossil forms doubtful.

Tubes of Austrorotularia by their size and type of sculpture

are comparable with those of Recent Spirobranchus, thus,

Austrorotularia is likely to belong to clade All as well.

Although Jager (1993: 86-87) suggested an evolutionary

transition from Nogrobs to Austrorotularia and other genera

formerly included in Rotularia as subgenera (see Regenhardt,

1961; Jager, 1993), the tube sculptures in all these taxa are too

different, suggesting that coiling in all these taxa could have

evolved independently within clade A. Comparative

ultrastructural study of all former Rotularia subgenera is still

pending, but at least one genus, Rotularia sensu stricto from

the Paleogene, shows distinct advanced lamello-fibrillar (LF)

structure in the tube wall (Vinn, 2008), which is quite difficult

to connect with simple prismatic structure of Nogrobs.

To conclude, although Jurassic was the epoch of rapid

diversification of serpulids and their world-wide dispersal,

subtropical latitudinal Tethys Ocean remained the main centre

of dispersal thoughout the entire Jurassic.

3.6. Cretaceous (145-66 Ma): further diversification

During the Cretaceous period (145-66 Ma) the number of

nominal species increased to over 200 (e.g. Jager, 1983; 1993;

2005; Ippolitov, 2010). The Cretaceous serpulid fauna is

relatively well-studied (Briinnich Nielsen, 1931; Regenhardt,

1961; Chiplonkar and Tapaswi, 1973a, b; Lommerzheim, 1979;

Jager, 1983; 1993; 2005; Ziegler, 1984; Koci, 2009; 2012 and

many more papers) and was subject to elaborate classification

of fossil tubes under Recent generic names. However, the

serpulid fossil record of the Early Cretaceous epoch (145-100

Ma) is still very fragmentary, with large unstudied gaps, while

the Late Cretaceous epoch (100-66 Ma) is probably the best-

studied time interval in serpulid evolutionary history,

characterised by a very continuous fossil record.

Excluding scarce data scattered over older publications

(e.g. Regenhardt, 1961, who redescribed, amongst others, some

Early Cretaceous serpulids and introduced several new taxa),

there are only three comprehensive investigations analysing

serpulid faunas of the Early Cretaceous. The generic

composition of the serpulid community from the Hauterivian

(~132 Ma) of South America (Garberoglio and Lazo, 2011; Luci

et al., 2013) looks basically similar to that of the Jurassic. The

only innovation is the abundance of coiled Neomicrorbisl

Written in stone: history of serpulid polychaetes through time

147

Pseudomicrorbis that were extremely rare in the Jurassic. The

fauna of Barremian age (~128 Ma) described by Jager (2011)

from South-Eastern France differs from Late Jurassic serpulid

biota and resembles that of the Late Cretaceous. Besides

Neomicrorbis (fig. 8EF-HI) and its possible ancestor

Pseudomicrorbis (fig. 7R), it includes diversified spirorbins as

well as large tubes of Pyrgopolon (fig. 8K-T) and characteristic

small Vepreculina (treated as subgenus of Metavermilia by

Jager, 1993; 2005; 2011; see fig. 8E), both unknown in the

Jurassic. The younger Early Aptian (~125-120 Ma) fauna from

England (Ware, 1975), however, again resembles the Jurassic

one, as no genera such as Neomicrorbis and Pyrgopolon were

present. This is probably because the territory of England was

part of the cold-water Boreal realm, while the major serpulid

diversification took place in the warmer Tethyan Realm. Also,

because this community inhabited sponges as a substrate,

direct comparisons with communities found on other substrates

are not really confident. The early Cretaceous was also the time

of wide divergence of Rotularia- like coiled serpulids,

represented now by Austrorotularia, Tubulostium (both in

Southern Hemisphere only), Rotulispira and Tectorotularia.

The Late Cretaceous was the time when warm epicontinental

seas characterised by high rates of carbonate sedimentation

occupied large areas in Europe. Serpulid evolution of this time

has been described in detail by Jager (2005: 210-212). The main

changes in the serpulid biota include diversification of species

within older genera and shifts of dominant genera. Because of

the carbonaceous mud floor of Late Cretaceous European seas,

this time period was dominated by forms quickly starting to

grow upwards, such as the large Pyrgopolon , and free-lying

forms like Pentaditrupa (fig. 8V) and Nogrobs ( Tetraditrupa )

(fig. 8W) that did not need much space to attach their initial

tubes. Some Pyrgopolon species, such as hexagonal members of

the subgenus Hamulus (fig. 8M-N), adapted to a new lifestyle by

modifying their tube sculpture into a peculiar “snow shoe”

shape sensu Savazzi (1995), which allowed animals to live free

on the surface of a muddy substrate (see discussion of “ Serpula ”

alata in Savazzi (1995; 1999)). The deficit of hard substrates

probably also explains appearance of numerous genera with

spiral tubes that cannot be attributed to any Recent genus (e.g.

Conorca, Orthoconorca, and Protectoconorca, see fig. 8X, Y,

AB, BC, DE) as well as diversification of Placostegus- like taxa

normally growing upwards from the substrate (fig. 8Z). On the

contrary, large spiral Rotularia- shaped forms, the common

element of serpulid biota during the Early Cretaceous and

earliest Late Cretaceous (Cenomanian; 100-94 Ma), almost

disappeared in European communities starting from the base of

Turonian (~94 Ma), probably being displaced by Conorca-Uke

forms (Jager, 1993). However, in epicontinental seas of former

Gondwana continent in the Southern Hemisphere during the

Mesozoic, coiled free-lying forms remained the dominant

morphotype during the entire Late Cretaceous epoch (e.g. see

Tapaswi, 1988 for India and Macellari, 1983 for Antarctica).

Large tubes having pronounced median keels (clade All)

and mostly attached to the substrate {Propomatoceros- like

forms) became less common in the Cretaceous than they were

in the Jurassic. Finds of Spirobranchus-Yike opercula

(Lommerzheim, 1979) starting from the earliest Late

Cretaceous (Cenomanian; 100 Ma) indicate that this clade

probably diverged from the Laminatubus lineage before that

time. However, because Spirobranchus is hardly

distinguishable from Jurassic Propomatoceros by tube

morphology, further studies are needed to date this transition.

Starting from the end of Early Cretaceous (Early Albian;

~110 Ma; Jager, 2005), records of large unsculptured Protula-

like tubes (clade BI) become common. However the origin of

this genus should be hypothesised cautiously because simple

unsculptured tubes of Protula are hardly recognisable among

fossils of Early Cretaceous and Jurassic. Protula- like tubes are

common in the Albian and Cenomanian (100-94 Ma), but almost

completely disappear in shallow-water European seas starting

from Turonian and up to the end of Late Cretaceous (94-66 Ma).

The first representatives of another BI member, characteristic

tiny-sized serpulid genus Josephella, are known from the Late

Cretaceous of Europe (Regenhardt, 1961; Jager, 2005).

During the Cretaceous, opercular calcification appeared in

several independent lineages {Neomicrorbis and other

Spirorbinae (fig. 8GH-HI); Spirobranchus-Galeolaria clade

and Pyrgopolon (fig. 8Q, R)) (Wade, 1922; Avnimelech, 1941;

Lommerzheim, 1979; Cupedo, 1980a, b; Jager, 1983; 2005),

supposedly improving protection against predators.

3.7. The rise of Spirorbinae

The earliest spirorbins, represented by characteristic large¬

sized Neomicrorbis tubes (up to 6-7 mm in diameter) bearing

numerous longitudinal rows of tiny tubercules appear to be of

Early Cretaceous age (?Early Hauterivian, ~132 Ma, Luci et

al., 2013; Late Barremian, ~126 Ma, Jager, 2011; Late

Berriassian, ~141 Ma, Ippolitov, unpubl.). Undescribed finds

mentioned by Jager (2005) from the Middle Jurassic (Late

Bathonian; ~166 Ma) also seem to belong to Neomicrorbis

(Jager, unpubl.). It is unclear whether the Late Jurassic

(?Middle Kimmeridgian, ~154 Ma) “ Spirorbis clathratus ”

Etallon, 1862 sensu von Alth, 1882 belongs to Neomicrorbis or

to the closely related Pseudomicrorbis (fig. 7R). The latter

genus is similar to Neomicrorbis, but its tube sculpture is

represented by rows of very small pits, not tubercules, and the

initial tube is straight. For the latter character Pseudomicrorbis

was originally placed outside Spirorbinae (Jager, 2011),

however, in Recent Spirorbinae the initial tube is also straight

or just slightly curved (Rzhavsky, pers. comm., 2013;

Malaquin, 1904: fig. 1; Okuda, 1946: PI. 26, fig. 16; ten Hove,

1994: 66). Whether Pseudomicrorbis belongs within or outside

Spirorbinae depends on a formal definition of spirorbins, but

Pseudomicrorbis is clearly closely related to Neomicrorbis.

The only known Recent species of this group, Neomicrorbis

azoricus, combines characters typical for spirorbins and non-

spirorbin serpulids, so its attribution to spirorbins is uncertain

(ten Hove and Kupriyanova, 2009: 66; Rzhavsky, pers. comm.).

Abundant undisputable spirorbins similar to extant forms

appear from the middle of the Early Cretaceous (Late

Barremian, ~126 Ma, Jager, 2011). These finds are represented

by anticlockwise coiled sculptured species questionably

referred to Neodexiospira (mentioned as “Janua

(.Dexiospira )?”), and clockwise coiled unsculptured tubes

described as Pileolarial spp.

148

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

From the latest Cretaceous (~66 Ma) spirorbins, again

attributed to Pileolarial and Neodexiospira (fig. 8JK-KL), the

latter with good confidence due to characteristic sculpture and

preserved opercula associated with tubes (Jager, 2005),

together with exclusively fossil genus Bipygmaeus (fig. 8IJ),

became common among encrusters (e.g. Jager, 1983; 1993;

2005). Younger Early Paleogene (62-59 Ma) communities

(Lommerzheim, 1981) already contain diversified spirorbins.

The intensive radiation of Spirorbinae can be attributed to

their small size, short generation time, and compact spiral

tubes allowing them to quickly colonise flexible and ephemeral

substrates, such as macroalgae and seagrass blades, and thus,

to compete for settlement sites in the highly productive and

densely populated upper subtidal zone (Ippolitov, 2010).

Spirorbinae were not the only Mesozoic serpulids adapted to

settlement on algae, also some larger forms twisted over algal

blades. Other Mesozoic serpulids that experimented with

coiling were Rotularia- shaped forms (. Austrorotularia,

Rotulispira, Tectorotularia, Tubulostium) and Nogrobs sensu

stricto with large planospiral tubes adapted to soft sediments,

as well as small Conorca-like, tubes ( Conorca, Orthoconorca,

Protectoconorca ) often coiled in high turret-like spirals. The

latter forms probably disappeared due to being outcompeted

by Spirorbinae.

The origin of Spirorbinae is still a challenge for

paleontologists because fossil data do not agree with molecular

phylogenies. As pseudocolonial serpulids representing the

Filograna/Salmacina clade are common in the Middle and

Late Triassic, the spirorbin lineage that apparently diverged

early within “filogranin” clade BI (fig. 1) should have appeared

even earlier, far from the Late Jurassic to Early Cretaceous age

postulated by paleontological data. But the divergence point

does not necessarily coincide with the “coiling point”, which

possibly occurred later in this lineage (fig. 9).

3.8. Cenozoic (66 Ma) to Recent: the rise of Recent serpulidfauna

The serpulids seem to cross the Cretaceous-Paleogene

boundary (66 Ma) without any drastic losses, even though this

boundary is famous for its extinction event killing numerous

other marine groups and the dinosaurs. A detailed study of the

Maastrichtian-Danian boundary interval (around 66 Ma) by

Jager (1993) has shown no drastic changes in serpulid faunas

around the boundary. However, reshaping of post-crisis marine

ecosystems of the early Cenozoic might have indirectly

triggered further radiation of serpulid biota. At least some

genera seem to completely disappear during the latest

Cretaceous (Table 2; see also Jager, 1993), but whether this is

a true extinction pattern or an artifact of our poor knowledge

of the Early Cenozoic serpulid faunas, remains unclear.

The number of serpulid species increased in the Paleogene

(66-23 Ma), but the fauna of this period is relatively poorly

studied. Paleogene serpulid diversity was studied by Briinnich

Nielsen (1931), who described a fauna of mostly attached

serpulids from the Danian (mostly Middle Danian; ~64-63

Ma) of Denmark. His data show that faunas of Paleogene are

comparable to those of Late Cretaceous age, as many genera

and dominating morphotypes (. Neomicrorbis, Pyrgopolon,

Spirobranchus-like forms, Protula ) remain common.

Starting from Danian there was a remarkable come-back

of coiled forms (represented now by Rotularia sensu stricto ),

which continued throughout the entire Paleocene and Eocene

(66-34 Ma; Jager, 1993; Wrigley, 1951). At least in some fossil

communities of the Middle Paleocene (62-59 Ma), spirorbin

diversity is similar to that of non-spirorbin serpulids, indicating

their intensive diversification (e.g. Lommerzheim, 1981).

The influential, but clearly outdated monograph on

serpulid faunas of the Cenozoic including Eocene (56-34 Ma)

and Oligocene (34-23 Ma) epochs by Rovereto (1904) treats

materials from Western Europe and Italy. In general, serpulid

fauna of this age resembles that described by Briinnich Nielsen

(1931) from the Paleocene. Rovereto (1904: P1.3, fig. 3) figures

at least one remarkable loop-coiled species of Eocene age (56-

34 Ma) that closely resembles Recent Hydroides, the genus not

known from older Mesozoic sediments. Gradual expansion of

free-lying Ditrupa in Europe started from the earliest

Paleogene and peaked in the Eocene (~56-34 Ma). Also,

during the Eocene Pyrgopolon tubes that can be traced back to

the Cretaceous, but are remarkably smaller, became common

and diverse at least in some regions (Wrigley, 1951).

The Eocene/Oligocene boundary, the largest extinction

event in the Cenozoic, was also an important time in serpulid

evolution (Jager, 2005: 211). Some taxathat once flourished in

Mesozoic seas have gradually lost their dominance in the

calcareous tubeworm communities by this time. The most

remarkable example is the calcified sabellid Glomerula, traced

up to the end of Eocene (34 Ma) and nowadays known as a

single species endemic to the Great Barrier Reef. Other

examples include free-lying coiled Rotularia, which

completely disappeared by the end of Eocene (34 Ma; Jager,

1993: 88) and problematic Neomicrorbis, still present in

Recent seas as a single bathyal relict species (Zibrowius, 1972;

ten Hove and Kupriyanova, 2009).

To summarise, during the entire Paleogene period there

were no drastic evolutionary experiments with tube shape and

coiling comparing with the Mesozoic, but there were obvious

shifts in dominance of serpulid communities. However, the

most ancient calcareous tubes of cirratulids are known from

the late Oligocene (~25 Ma) in North America (Fischer et al.,

1989; 2000), suggesting that cirratulids acquired tube

calcification quite late and independently from serpulids and

sabellids (Vinn and Mutvei, 2009).

Serpulid communities of the younger Cenozoic (Neogene

period; 23-2.6 Ma) are very similar to those found in Recent

seas. Several hundreds of fossil serpulid species have been

described from the Neogene (e.g. Rovereto, 1899; 1904;

Schmidt, 1950; 1951; 1955; Radwanska, 1994a). The important

new element compared to Mesozoic faunas is the wide

dispersal of the Hydroides morphotype (slowly growing tubes

with flattened upper side and loop-coiling tendency).

Hydroides probably had appeared during the early Paleogene

(e.g. Lommerzheim, 1981) or Eocene (Rovereto, 1904) and

became common starting from the Neogene (Rovereto, 1899;

1904; Schmidt, 1950; 1951; 1955; Radwanska, 1994a).

During the latest Cenozoic serpulids colonised freshwater

cave habitats. The most ancient fossilised tubes of the only

known Recent freshwater species Marifugia cavatica Absolon

Written in stone: history of serpulid polychaetes through time

149

and Hrabe, 1930 were discovered in a collapsed cave in

Slovenia are dated around the Late Pliocene/earliest

Pleistocene (2.5-3.6 Ma; Bosak et al., 2004). Molecular data of

Kupriyanova et al. (2009) suggest that penetration into non¬

marine waters appeared once in the evolution of Serpulidae.

The transition of Marifugia to a subterranean environment

likely has occurred via ancestral marine shallow-water to

intertidal or estuarine species (like extant Ficopomatus) that

evolved the necessary adaptations to withstand low salinity

and then penetrated freshwater caves via surface lakes

(Kupriyanova et al., 2009). The age of serpulid penetration of

brackish water is uncertain as there is no reliable fossil record

of the brackish-water genus Ficopomatus. Two Cenozoic

species described by Schmidt (1951) as “Mercierella”, a junior

synonym of Ficopomatus, are unlikely to belong to this genus

(ten Hove and Weerdenburg, 1978: 101), and the Late Jurassic

Mercierella{l ) dacica Dragastan, 1966 is not a serpulid, but

most likely a calcareous alga {ibid).

Given that representatives of clade Al {“Serpula- group”)

have the most diverse and complex tube ultrastructures (Vinn

et al., 2008b) and considering its intensive radiation during the

Cenozoic, it is likely that the main ultrastructural diversification

of serpulid tubes, which resulted in appearance of highly

ordered ultrastructures, also took place at that time. This may

partly explain why Mesozoic, especially Jurassic, serpulids do

not show such ultrastructural diversity (e.g. Vinn and Furrer,

2008) as seen in Recent forms. On the contrary, ultrastructural

diversity of Cenozoic material looks to be close to that of

Recent taxa (Vinn, 2007). Species-level radiation within

extant genera of serpulid clade All (“Spirobranchus- group”)

also could have happened largely during the Cenozoic, while

most genera seem to be of Mesozoic origin.

Recent diversity, which counts around 500 species, is not

necessary indicative of intensive diversification in evolution of

Serpulidae during Pleistocene-Holocene (2.6 Ma to Recent).

Because the fossil record is never as well-known as Recent

diversity, comparing Recent richness with generalised

numbers for large time intervals covering millions of years is

speculative. Numerous Recent species identifiable by their

tube morphology and geographic distribution have been

recognised in Pliocene-Holocene sediments (Table 1) (e.g. Di

Geronimo and Sanfilippo, 1992).

3.9. Calcareous sabellids: rise and fall during the Mesozoic-

Cenozoic

Calcified sabellids of the genus Glomerula appeared during

the Late Paleozoic (Late Carboniferous, see above) or Early

Jurassic (Late Hettangian; 200 Ma) and flourished in Mesozoic

shallow seas producing numerous species (Jager, 2005: Table

1), which were amongst the most common encrusters in

Mesozoic shallow-water serpulid communities all over the

world, often constituting up to 50% of total number of tubes.

They were so common that six out of seven known Mesozoic

sabellid species were described already in the early 19 th

century by pioneers of paleontology (von Schlotheim, 1820;

Defrance, 1827b; J. de C. Sowerby, 1829; Goldfuss, 1831).

Besides typical forms, the diversity of fossil Mesozoic

Glomerula includes pseudocolonial species appearing as large

irregular glomerates of interweaving tubes (fig. 7E), and

species with strange internal tube structures making the lumen

cross-section triradial (Jager, 1983; 1993; 2005; see fig. 8A).

Late Cretaceous sabellids demonstrate “balls-of-wool” tube

coiling with no visible attachment areas, probably indicating a

transition to the “rolling stone” lifestyle (Savazzi, 1999).

Gradual decrease in abundance of calcareous sabellids relative

to that of serpulids during the subsequent Cenozoic suggests

that more advanced biomineralisation system acquired by

serpulids allowed greater evolutionary plasticity of coiling and

growth modes, thus giving serpulids competitive advantage

over sabellids. The most crucial competitor for sabellids was

probably Hydroides, which spread widely over shallow-water

environments when calcareous sabellids declined. However,

precise timing of this change is unclear because during the

Oligocene (34-23 Ma) neither Hydroides, nor Glomerula seem

to be common.

3.10. “False serpulids” of the Cenozoic: a fossil record bias

As in the Paleozoic, the outline of Cenozoic serpulid history is

somewhat disturbed by numerous records of false serpulids as

well as some true serpulids described as belonging to different

fossil groups. Two examples are tusk-shaped scaphopods,

which are often confused with serpulid genus Ditrupa, and

vermetid gastropods, which have irregularly coiled shells with

complex sculpture comparable to that of Spirobranchus tubes.

Shells of both these mollusc groups are frequently confused

with serpulid tubes in older zoological publications and even

in current zoological practice (ten Hove, 1994). Therefore,

numerous fossils described as “ Dentalium ” or “ Ditrupa ” in

older publications need to be re-investigated (as e.g. done by

Palmer, 2001). Scaphopods are an ancient group first appearing

in the Paleozoic, while tusk-shaped serpulid worms with

circular cross-section ( Ditrupa ) appear only in the latest

Mesozoic. This means that for most of the Mesozoic the tusk¬

shaped serpulids are easily distinguishable from scaphopods

by multiangular cross-sections of the tube. Confusion of

serpulids with vermetids (e.g. part of species in Zelinskaja,

1962) is typical mainly for the material from Paleogene and

Neogene periods, when irregularly coiled gastropods became

common. There are also few records of problematic fossils

from the Cenozoic, e.g. phosphatic tubes from the Paleogene

of Chile described as serpulid Semiserpula chilensis by Wetzel

(1957). Because phosphate mineralogy is unknown for Recent

serpulids, the affinity of these irregularly loop-coiled tubes

remains unclear.

3.11. Serpulid reefs and sediments

In Recent ecosystems, serpulid tubes contribute to sediment

and reef formation (reviewed by ten Hove and van den Hurk,

1993 and Ferrero et al., 2005). Serpula vermicularis Linnaeus,

1758 and Galeolaria hystrix Morch, 1863 build reefs in

temperate seas with normal salinity (ten Hove and van den

Hurk, 1993), while extensive reefs of F. enigmaticus (Fauvel,

1923) are found in brackish-water subtropical locations around

the world (Dittmann et al., 2009). Tubes of free-lying Recent

Ditrupa form shell banks (density up to 1000 ind. nr 2 ) on

continental shelves in temperate to tropical seas all over the

150

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

world (ten Hove and van den Hurk, 1993), and D. arietina (O.

F. Mtiller, 1776) significantly contributes to calcite sediment

production in temperate seas (Medernach et al., 2000). Both

serpulid reefs and banks produced by free-lying forms are

known in the fossil record.

The “serpulid” reefs from Paleozoic sediments were formed

not by true annelids, but by tentaculitoids, the group closely

related to lophophorates (Vinn and Mutvei, 2009). The earliest

true serpulid build-ups are known from the Late Triassic

(Norian) of Europe (ten Hove and van den Hurk, 1993; Berra and

Jadoul, 1996; Cirilli et al., 1999), around the Triassic-Liassic

boundary in Spain (Braga and Lopez-Lopez, 1989), and Middle

Jurassic of Southeastern Spain (Navarro et al., 2008). They

became common in the Late Jurassic-Early Cretaceous

(Regenhardt, 1964; Palma and Angeleri, 1992; ten Hove and van

den Hurk, 1993; Kiessling et al., 2006). “ Serpula ” coacervata

Blumenbach, 1803 tube fragments form a considerable portion

of the rock mass around the Jurassic/Cretaceous boundary in

north Germany (ten Hove and van den Hurk, 1993), probably

being restricted to brackish water environments, the formation of

such rocks may be explained by wave erosion of some build-ups.

In younger Cenozoic rocks serpulid build-ups are described

from the Early Eocene deposits of India (Ghosh, 1987), Miocene

and Pliocene of Spain (ten Hove and van den Hurk, 1993), and

Miocene (23-5 Ma) of the southern part of Eastern Europe (south

Poland, Ukraine, Moldova). Miocene deposits of Eastern Europe

contain especially numerous spirorbin and serpulid build-ups

(Pisera, 1996; Gorka et al., 2012), and the mass occurrence of

serpulid build-ups is explained by enormously high water

alkalinity in isolated water basins of the Paratethys (Gorka et al.,

2012). The diversity of serpulids constituting these reefs has not

been studied, and at least some of these “serpulids” can be

vermetid gastopods (see section 3.10). Sub-recent records of

serpulid reefs include those from the Mid-Holocene of Argentina

(Ferrero et al., 2005) and the Holocene of California (Howell et

al., 1937).

Fossil banks of free-lying serpulids are known from the

latest Early Jurassic (Late Toarcian; 176 Ma) of England,

Middle Jurassic of Germany and France (Jager, unpubl.);

Middle Jurassic (Bathonian; ~167 Ma and Late Callovian;

~164 Ma) in Crimea (Ippolitov, unpubl.). In all listed cases

banks are formed by mass occurrence of tetragonal spirally

coiled Nogrobs s. str. tubes. Banks formed by tusk-shaped

Ditrupa, similar to those known from Recent seas, become

common from earliest Paleogene (Danian; 66 Ma) onwards in

Europe (Jager, unpubl.), and are also described from the Early

Miocene (~20 Ma) of Taiwan (Cheng, 1974).

Both banks and carbonate build-ups in fossil state result in

carbonate rocks consisting mainly of serpulid tubes with some

matrix, called “serpulit” (alternatively, “serpula limestone” or

“spirorbis limestone”) by geologists.

3.12. Serpulids in deep-sea chemosynthetic communities

Serpulids apparently colonised seeps during the Jurassic: their

first appearance in such environments is recorded from the

latest Volgian (~146 Ma) of Svalbard (Vinn et al., in press).

Fossil (Early Cretaceous) serpulid communities from methane

seeps are characterised by low species diversity and mostly

low abundance (Vinn et al., 2013). Hydrocarbon seep serpulids

belong to several genera only (Vinn et al., 2013 and in press),

and in the majority of fossil seeps only a single species was

found. This pattern resembles that of molluscs from vents and

seeps (Kiel, 2010a, 2010b). Unlike many gastropods and

bivalves at vents and seeps that are restricted to these

environments, serpulids are ‘colonists’ (Olu et al., 1996a): taxa

from the surrounding sea floor that opportunistically invade

seeps and vents because of the high abundance of organic

matter. The fact that both serpulids and molluscs started

colonising the seep environment shortly after their first

appearance in the geological record supports the hypothesis

that the seep faunas share evolutionary traits with the deep-sea

fauna in general (Kiel and Little, 2006).

Similar to serpulids of fossil seeps, most serpulids at

modern vents (ten Hove and Zibrowius, 1986; Kupriyanova et

al., 2010) and seeps (Olu et al., 1996a, 1996b) also show low

diversity. Seep serpulid abundance is high relative to the

surrounding seafloor, but low to moderate compared to that of

molluscs or siboglinid tubeworms that typically dominate

these ecosystems (Vinn et al., 2013).

4. Conclusions and future studies: where to go next

Because studies of fossil serpulid tubes have no well-

established stratigraphical, paleoecological or biogeographical

application in palaeontology, the end result is that relatively

little attention has been traditionally paid to the fossil record

of this group. Concerted efforts of both palaeontologists and

zoologists are required to advance our understanding of

serpulid evolutionary history. Palaeontologists need to provide

fossil material from poorly studied stratigraphical intervals

(especially re-evaluation of problematic Late Paleozoic

tubicolous fossils, the Early Cretaceous gap, and review of the

Cenozoic fauna) and from poorly studied geographical regions

(mainly outside Europe). New robust phylogenies with greater

taxon coverage and integrating new molecular and

morphological data from all serpulid genera are expected

from zoologists. Further ultrastructural, mineralogical and

histochemical studies of both Recent and fossil tubes are

needed for reliable linking of fossils to Recent taxa.

Examination of genetic differences between closely related

taxa allowing the estimation of a divergence time based on a

known rate of accumulation of neutral genetic differences,

known as molecular clock. No attempts have been made to age

the Serpulidae based on genetic data, even though main

diversification events can be roughly dated by the fossil record.

This fossil record can provide an invaluable tool for calibration

of molecular clocks not only in serpulids, but by extrapolation

also in other annelid groups that lack a fossil record.

Acknowledgements

We are grateful to Harry A. ten Hove (Netherlands Centre for

Biodiversity Naturalis, Leiden) who reviewed the manuscript

and provided invaluable remarks and suggestions greatly

improving the paper. The study was partly supported by RFBR

grant no. 14-05-31413 and RAS Presidium Program no. 28 to

API and ABRS grant RF213-19 to EKK. OV is indebted to a

Written in stone: history of serpulid polychaetes through time

151

Sepkoski Grant (Paleontological Society), an Estonian Science

Foundation grant ETF9064, Estonian Research Council grant

IUT20-34 and the target-financed project (from the Estonian

Ministry of Education and Science) SF0180051s08 for

financial support. We thank E. Wong, A. Rzhavsky, E. Nishi,

R. Bastida-Zavala, and G. Rouse for providing the photographs.

Some photographs of fossil serpulids were made by A.V.

Mazin (Laboratory of photography, Paleontological Institute

RAS). Our special thanks are due to A.V. Rhzavsky for his

remarks on an earlier draft of the manuscript.

References

Aberhan, M. 1992. Palokologie und zeitliche Verbreitung benthischer

Faunengemeinschaften im Unterjura von Chile. Beringeria 5:

3-174.

Abildgaard, P.C. 1789. Beschreibung 1. einer grossen Seeblase

(.Holothuria Priapus Linn.) 2. zween Arten des Steinbohrers

(Terebella Linn.) 3. einer grossen Sandrohre (Sabella Linn.).

Schriften der Gesellschaft naturforschender Freunde zu Berlin 9:

133-146.

Absolon, K., and Hrabe, S. 1930. fiber einen neuen Siisswasser-

Polychaeten aus den Hohlengewassern der Herzegowina.

Zoologischer Anzeiger, Leipzig 88(9/10): 249-264.

Alth, A. von 1882. Die Versteinerungen des Nizniower Kalksteines.

Beitrdge zur Paldontologie Osterreich-Ungarns und des Orients

1: 183-332.

Amoureux, L. 1976. Serpula ( Paraserpula ) israelitica, nouvelle

espece de Serpulidae (Annelides Polychetes) et une petite

collection annelidienne de la Mediterranee orientale. Bulletin de

Museum National d’Histoire Naturelle, Paris, (3)

404(Zoologie281): 1047-1059.

Assmann, P. 1937. Revision der Fauna der Wirbellosen der

oberschlesischen Trias. Abhandlungen der Preufiischen

Geologischen Landesanstalt 170: 1-134.

Augener, H. 1922. fiber litorale Polychaeten von Westindien.

Sitzungsberichte der Gesellschaft naturforschender Freunde zu

Berlin 1922: 38-53.

Avnimelech, M. 1941. Upper Cretaceous serpulids and scaphopods

from Palestine. Bulletin of the Geological Department, Hebrew

University 3(2): 1-16.

Baier, J.J. 1708. Oryctografia Norica, sive, Rerum fossilium et ad

minerale regnum pertinentium. Ntirnberg: W. Michael. 102 pp.

Baluk, W., and Radwanski, A. 1997. The micropolychaete Josephella

commensalis sp. n. commensal to the scleractinian coral

Tarbellastraea reussiana (Milne-Edwards & Haime, 1850) from

the Korytnica Clays (Middle Miocene; Floly Cross Mountains,

Central Poland). Acta Geologica Polonica 47(3-4): 211-224.

Bandel, K. 1986. The reconstruction of “Hyolithes kingF as annelid

worm from the Cambrian of Jordan. Mitteilungen aus dem

Geologisch-Paldontologischen Institut der Universitat Hamburg

61: 35-101.

Behrendsen, 0.1891. Zur Geologie des Ostabhanges der argentinischen

Cordillere. Zeitschrift der Deutschen Geologischen Gesellschaft

43: 369-420.

Ben-Eliahu, M.N. 1976. Polychaete cryptofauna from rims of similar

intertidal vermetid reefs on the Mediterranean coast of Israel and

in the Gulf of Elat: Serpulidae (Polychaeta Sedentaria). Israel

Journal of Zoology 25: 103-119.

Ben-Eliahu, M.N., and Dafni, J. 1979. A new reef-building serpulid

genus and species from the Gulf of Elat and the Red Sea, with

notes on other gregarious tubeworms from Israeli waters. Israel

Journal of Zoology 28: 199-208.

Benedict, J.E. 1887. Descriptions of ten species and one new genus of

annelids from the dredging of the U.S. Fish Commissiom Steamer

Albatross. Proceedings of the United States National Museum 9:

547-553.

Bengston, S. 2002. Origins and early evolution of predation. Pp. 289-

317 in Kowalewski M., and Kelley P.H. (Eds.) The Fossil Record

of Predation (The Paleontological Society Papers 8).

Bengston, S. 2004. Early skeletal fossils. Pp. 67-77 in Lipps J.H.,

Waggoner B.M. (Eds.). Neoproterozoic-Cambrian Biological

Revolution. (The Paleontological Society Papers 10).

Benham, W.B. 1927. Polychaeta. British Antarctic (“Terra Nova”)

Expedition, 1910. British Museum (Natural History), Natural

History Report, Zoology 7(2): 47-182.

Berkeley, M.J. 1835. Observations upon the Dentalium subulatum of

Deshayes. Zoological Journal, London 5(20): 424-427.

Berra, F., and Jadoul, F. 1996. Norian serpulid and microbial

bioconstructions: implications for the platform evolution in the

Lombardy Basin (Southern Alps, Italy). Facies 35: 143-162.

Biese, W. 1961. El Jurassico de Cerritos Bay os. Universidad de Chile.

Facultad de ciencias fisicas y matematicas. Instituto de geologia.

Publicacion 19: 1-63.

Bizzarini, F., and Braga, G. 1994. Corynotrypoides ladina gen. et sp.

nov., a questionable cyclostomatous bryozoan from the Upper

Triassic of the Eastern Dolomites (NE Italy). Pp. 29-32 in

Hayward, P.J., Ryland, J.S., and Taylor, P.D. (Eds.) Biology and

Palaeobiology ofBryozoans. Olsen & Olsen: Fredensborg.

Blainville, H. de 1818. Memoire sur la classe des Setipodes, partie des

Vers a sang rouge de M. Cuvier, et des Annelides de M. de

Lamarck. Bulletin de la Societe Philomatique de Paris 3: 78-85.

Blumenbach, J.F. 1803. Specimen Archaeologiae telluris terrarumque

imprimis Hannoverenarum. H. Dieterich: Gottingen. 28 pp.

Bohnne Havas, M. 1981. A Ditrupa cornea (L.) es konvergens

formainak szelekcioja scanning elektronmikroszkoppal [Selection

of Ditrupa cornea (L.) and forms convergent with it by scanning

electron microscope]. Evi Jelentese a Magyar Allami Foldtani

Intezet 1979 [Annual report of the Hungarian Geological Institute

of 1979]: 387-415 [in Hungarian],

Bornhold, B.D., and Milliman, J.D. 1973. Generic and environmental

control of carbonate mineralogy in serpulid (polychaete) tubes.

Journal of Geology 81: 363-373.

Bosak, P, Mihevc, A., and Pruner, P. 2004. Geomorphological

evolution of the Podgorski Karst, SW Slovenia: contribution of

magnetostratigraphic research of the Crnotice II site with

Marifugia sp. Acta Carsologica 33: 175-204.

Bracchi, G., and Alessandrello, A. 2005. Paleodiversity of the free-

living polychaetes (Annelida, Polychaeta) and description of new

taxa from the Upper Cretaceous Lagerstatten of Haqel, Hadjula

and Al-Namoura (Lebanon). Memorie della Societa Italiana de

Scienze Naturali e del Museo Civico di Storia Naturale di Milano

32: 1-64.

Braga, J.C., and Lopez-Lopez, J.R. 1989. Serpulid bioconstructions at

the Triassic-Liassic boundary in southern Spain. Facies 21: 1-10.

Briggs, D.E.G., and Bartels, C. 2010. Annelids from the Lower

Devonian Hunsriick Slate (Lower Emsian, Rhenish Massif,

Germany). Palaeontology 53: 215-232.

Bronn, H.G. 1827. Verzeichnis der vom Heidelberger Mineralien-

Komptoir verkauflichen Konchylien-, Pflanzenthier- und anderen

Versteinerungen. Zeitschrift fur Mineralogie 2: 529-544.

Briinnich Nielsen, K. 1931. Serpulidae from the Senonian and Danian

deposits of Denmark. Meddelelser fra Dansk geologisk Forening

8: 71-113.

152

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

Bubel, A., Stephens, R.M., Fenn, R.H., and Fieth, R 1983. An electron

microscope. X-ray diffraction and amino acid analyses study of

the opercular filament cuticle, calcareous opercular plate and

habitation tube of Pomatoceros lamarckii Quatrefages

(Polychaeta: Serpulidae). Comparative Biochemistry and

Physiology 74B: 837-850.

Burchette, T.P., and Riding R. 1977. Attached vermiform gastropods

in Carboniferous marginal marine stromatolites and biostromes.

Lethaia 10(1): 17-28.

Bush, K.J. 1905. Tubicolous annelids of the tribes Sabellides and

Serpulides from the Pacific Ocean. Harriman Alaska Expedition

12: 169-355.

Bush, K.J. 1907. Descriptions of the two genera of tubicolous annelids,

Paravermilia and Pseudovermilia, with species from Bermuda

referable to them. American Journal of Science, New Haven (4)

23: 131-136.

Bush, K.J. 1910. Description of new serpulids from Bermuda, with

notes on known forms from adjacent regions. Proceedings of the

Academy of Natural Sciences of Philadelphia 62: 490-501.

Carter, J.G., Bandel, K., de Buffrenil, V., Carlson, S.J., Castanet, J.,

Crenshaw, M.A., Dalingwater, J.E., Francillion-Vieillot, H.,

Geradie, J., Meunier, F.J., Mutvei, H., de Riqles, A., Sire, J.Y.,

Smith, A.B., Wendt, J., Williams, A., and Zylberberg, L. 1990.

Glossary of Skeletal Biomineralization. Pp. 609-671 in: Carter

J.G. (Ed.). Skeletal Biomineralization: Patterns, Processes and

Evolutionary Trends. Short Course in Geology 5 (II).

Caullery, M., and Mesnil, F. 1896. Note sur deux Serpuliens nouveaux

('Oriopsis Metchnikowi n. g., n. sp. et Josephella Marenzelleri n.

g., n. sp.). Zoologischer Anzeiger, Leipzig 19(519): 482-486.

Caullery, M., and Mesnil, F. 1897. Etudes sur la morphologie comparee

et la phylogenie des especes chez les Spirorbes. Bulletin

Biologique de la France et de la Belgique 30: 185-233.

Chamberlin, R.V. 1919. The Annelida Polychaeta. “Albatross”

Expedition. Memoirs of the Museum of Comparative Zoology,

Harvard 48: 1-518.

Chen, M.E., Chen, Y., and Qian, Y. 1981. Some tubular fossils from

Sinian-Lower Cambrian boundary sequences, Yangtze Gorge.

Tianjin Institute of Geology and Mineral Resources Bulletin 3:

117-124.

Chen, Z., Bengtson, S., Zhou, C.-M., Hua, H., and Yue, Z. 2008. Tube

structure and original composition of S inotubulites: shelly fossils

from the late Neoproterozoic in southern Shaanxi, China. Lethaia

41: 37-45.

Cheng, Y.-M. 1974. Paleocurrent direction of the Taliao formation

(Lower Miocene) indicated by Ditrupa sp. (Serpulidae) shells.

Acta Geologica Taiwanica 17: 13-22.

Chiaje, S. delle 1822-1828. Memorie sulla storia e notomia degli

Animali senza vertebre del regno di Napoli. Figures (1822), Vol.

3. 232 pp.

Chiplonkar, G.W., and Tapaswi, PM. 1973a. Fossil polychaetes from

the Upper Cretaceous rock formations of South India. I.

Proceedings of the Indian Academy of Science, Section B

Biological Science 77(4): 116-130.

Chiplonkar, G.W., and Tapaswi, PM. 1973b. Fossil polychaetes from

the Upper Cretaceous rock formations of South India. II.

Proceedings of the Indian Academy of Science, Section B

Biological Science 77(5): 202-213.

Cirilli, S., Iannace, A., Jadoul, F., and Zamparelli, V. 1999. Microbial-

serpulid build-ups in the Norian-Rhaetian of the western

Mediterranean area: ecological response of shelf margin

communities to stressed environments. Terra Nova 11: 195-202.

Claparede, E. 1868. Les Annelides Chetopodes du Golfe de Naples.

Memoires de la Societe de Physique et d’Histoire naturelle de

Geneve 19(2): 313-584.

Claparede, E. 1870. Les annelides chetopodes du Golfe de Naples.

Supplement. Memoires de la Societe de physique et d’histoire

naturelle de Geneve 20(2): 365-542.

Clausen, S., and Alvaro, J.J. 2002. Encrusting strategies in a Cambrian

nonreefal epibenthic community. Bulletin de la Societe

Geologique de France 173: 553-559.

Conrad, T.A. 1870. Notes on recent and fossil shells, with descriptions

of new species. American Journal of Conchology 6: 71-78.

Conway Morris, S. 1979. Middle Cambrian polychaetes from the

Burgess Shale of British Columbia. Philosophical Transactions of

the Royal Society of London. Series B, Biological Sciences 285:

227-214.

Conway Morris, S., and Peel, J.S. 2008. The earliest annelids: Lower

Cambrian polychaetes from the Sirius Passet Lagerstatte, Peary

Land, North Greenland. Acta Palaeontologica Polonica 53: 137-

148.

Cupedo, F. 1980a. De opercula van Hamulus sexcarinatus Goldfuss

(Polychaeta Sedentaria, Serpulidae) uit het Boven-Krijt van Zuid-

Limburg. Publicaties van het Natuurhistorisch Genootschap in

Limburg 29 (for 1979): 1-4.

Cupedo, F. 1980b. De opercula van Sclerostyla mellevillei (Nijst & Le

Hon), “ Serpula ” instabilis (Wrigley) en “ Ditrupa ” mosae (Bronn),

en hun betekenis voor de systematiek van deze soorten. Publicaties

van het Natuurhistorisch Genootschap in Limburg 29 (for 1979):

1-19.

Dalve, E. 1948. The fossil fauna of the Ordovician in the Cincinnati

Region. Cincinnati, Ohio, University Museum, Department of

Geology and Geography, University of Cincinnati. 56 pp.

Daudin, F.M. 1800. Recueil de memoires et de notes sor des especes

ineditis ou peu connues de mollusques, de vers et de Zoophytes.

Paris: 50 pp.

Day, J.H. 1961. The Polychaete fauna of South Africa. 6. Sedentary

species dredged off Cape coasts with a few new records from the

shore. Journal of the Linnean Society, London {Zoology) 44: 463-

560.

Defrance, M. 1827a. Rotulaire. Pp. 321-322 in Levrault, F.G. (Ed.).

Dictionnaire des sciences naturelles 46. Strasbourg, Paris.

Defrance, M. 1827b. Serpules. Pp. 549-572 in Levrault, F.G. (Ed.).

Dictionnaire des sciences naturelles 48. Strasbourg, Paris.

Di Geronimo, I., and Sanfilippo, R. 1992. Policheti Serpuloidei

pleistocenici di Catallarga (Grammichele, Catania). Naturalista

Siciliano 16(3-4): 159-173.

Ding, L.-F., Zhang, L., Li, Y., and Dong, J. 1992. The Study of the Late

Sinian-Early Cambrian Biotas from the Northern Margin of

Yangtze Platform [in Chinese]. Beijing: Scientific and Technical

Documents Publishing House. 135 pp.

Dittmann, S., Rolston, A., Benger, S.N., and Kupriyanova, E.K. 2009.

Habitat requirements, distribution and colonization of the

tubeworm Ficopomatus enigmaticus in the Lower Lakes and

Coorong. Final report for the South Australian Murray-Darling

Basin Natural Resources Management Board, 99 pp.

Dragastan, O. 1966. A new serpulid species in the Upper Jurassic of

Rumania. Palaontologische Zeitschrift 40: 147-150.

Ehlers, E. 1887. Report on the Annelids. Reports on the results of

dredging, under the direction of L.F. Pourtales, during the years

1868-1870, and of Alexander Agassiz, in the Gulf of Mexico, and

in the Caribbean Sea, in the U.S. Coast Survey Steamer “Blake”.

Memoirs of the Museum of Comparative Zoology, Harvard 15:

1-335.

Ehlers, E. 1908. Die bodensassigen Anneliden aus den Sammlungen

der deutschen Tiefsee-Expedition. Pp. 1-168 in Chun, C. (Ed.).

Wissenschaftliche Ergebnisse der deutschen Tiefsee-Expedition

auf dem Dampfer ‘Valdivia’ 1898-1899, 16.

Written in stone: history of serpulid polychaetes through time

153

Eibye-Jacobsen, D. 2004. A reevaluation of Wiwaxia and the

polychaetes of the Burgess Shale. Lethaia 37: 317-335.

Eichwald, E. d’ 1865-1868. Lethaea rossica ou paleontologie de la

Russie. 2. Periode moyenne. Schweizerbart: Stuttgart. 1304 pp.,

40 pis.

Etallon, A. 1862. Etudes paleontologiques sur le Haut-Jura.

Monographic du Corallien. Vertebres, Articules, Mollusques.

Memoires de la Societe d’Emulation du Department du Doubs,

3erne ser. 6: 53-260.

Etheridge, R. 1892. A monograph of the Carboniferous and Permo-

Carboniferous invertebrata of New South Wales. Part II -

Echinodermata, Annelida and Crustacea. Memoirs of the

Geological Survey of New South Wales, Palaeontology 5: 65-131.

Fabricius, O. 1780. Fauna Groenlandica, systematice sistens,

Animalia Groenlandiae occidentalis hactenus indagata, quoad

nomen specificum, triviale, vernaculumque synonyma auctorum

plurium, descriptionem, locum, victum, generationem, mores,

usum, capturamque singuli prout detegendi occasio fuit,

maximaque parte secundum proprias observationes. Hafniae

[Copenhagen] et Lipsiae [Leipzig]. 452 pp. [Polychaeta and

Annelida data: pp. 266-315; 374-384]

Fauvel, P. 1909. Deuxieme note preliminaire sur les Polychetes

provenant des campagnes de l’Hirondelle et de la Princesse-Alice,

ou deposees dans la Musee Oceanographique de Monaco. Bulletin

de VInstitute Oceanographique 142: 1-76.

Fauvel, P. 1923. Un nouveau serpulien d’eau saumatre, Mercierella

n. g., enigmatica n. sp. Bulletin de la Societe Zoologique de France

47: 424-430

Feng, W., Chen, Z., and Sun, W. 2003. Diversification of skeletal

microstructures of organisms through the interval from the latest

Precambrian to the Lower Cambrian. Science in China, Beijing,

(,Series D ) 46: 977-985.

Ferrero, L., Obenat, T.S., and Zarate, M.A. 2005. Mid-Holocene

serpulid build-ups in an estuarine environment (Buenos Aires

Province, Argentina). Palaeogeography, Palaeoclimatology,

Palaeoecology 222: 259-271.

Fischer, R., Galli Oliver, C., and Reitner, J. 1989. Skeletal structure,

growth, and paleoecology of the patch reefbuilding polychaete

worm Diplochaetetes mexicanus Wilson, 1986 from the Oligocene

of Baja California (Mexico). Geobios 22: 761-775.

Fischer, R., Pernet, B., and Reitner, J. 2000. Organomineralization of

Cirratulid tubes - Fossil and Recent examples. Facies 42: 35-50.

Fitzhugh, K., Sroka, S„ Kruty, M. D., and Henderson, A. A. 1997.

Polychaete worms. Pp. 64-83 in: Shabica, C. W., and Hay, A. A.

(Eds.), Richardson s guide to the fossil fauna of Mazon creek.

Northeastern Illinois University: Chicago, IL.

Fliigel, E., Fltigel-Kahler, E., Martin, J.M., and Martin-Algarra, A.

1984. Middle Triassic Reefs from Southern Spain. Facies 11:

173-218.

Fiirsich, F.T., Palmer, T.J., and Goodyear, K.L. 1994. Growth and

disintegration of bivalve-dominated patch-reefs in the Portlandian

(Upper Jurassic) of southern England. Palaeontology 37: 131-171.

Gabb, W.M. 1876. Notes on American Cretaceous fossils, with

descriptions of some new species. Proceedings of the Academy of

Natural Sciences of Philadelphia (3) 28: 276-324.

Garberoglio, R.M., and Lazo, D.M. 2011. Post-mortem and symbiotic

sabellid and serpulid-coral associations from the Lower

Cretaceous of Argentina. Revista Brasileira de Paleontologia 14:

215-218.

Gardner, J.A. 1916. Vermes. Pp. 745-749, pi. 47 in: Bassler, R.S.,

Berry, E.W., Clark, W.B., Gardner J.A., Goldman, M.I., Pilsbry,

H.A., Stephenson, L.W. Upper Cretaceous. Maryland Geological

Survey, 6(2). The Johns Hopkin Press: Baltimore.

Gatto R., and Radwanska, U. 2000. Serpulid opercula (Annelida:

Polychaeta) from the Upper Eocene of Possagno, NE Italy:

taxonomy, taphonomy and palaeobiological significance. Acta

Geologica Polonica 50: 343-354.

Geinitz, H.B. 1848. Die Versteinerungen des deutschen

Zechsteingebirges. Arnoldische Buchhandlung: Dresden und

Leipzig. 26 pp.

Germs, G. J.B. 1972. New shelly fossils from Nama Group, South West

Africa. American Journal of Science 272: 752-761.

Ghosh, C.C. 1987. Report on a serpulid framestone from the Khuiala

formation (Lower Eocene) Jaisalmer Basin, Rajastan. Current

Science 56: 414-415.

Glaessner, M.F. 1976. Early Phanerozoic annelid worms and their

geological and biological significance. Journal of the Geological

Society (London ) 132: 259-275.

Gotz, G. 1931. Bau und Biologie fossiler Serpuliden. Neues Jahrbuch

fur Mineralogie, Geologie und Palaontologie, Beilage-Band

66B: 385-438.

Goldfuss, A. 1831. Petrefacta Germaniae. I. Divisio secunda:

Radiariorum Reliquiae - Strahlenthiere der Vorwelt. Arnz & Co:

Diisseldorf: 165-240.

Gorka, M., Studenska, B., Jasionowski, M., Hara, U., Wysocka, A.,

and Poberezhskyy, A. 2012. The Medobory hills (Ukraine):

Middle Miocene reef systems in the Paratethys, their biological

diversity and lithofacies. Biuletyn Pahstwowego Instytutu

Geologicznego 449: 147-174.

Gravier, C. 1907. Sur les Annelides Polychetes recueillies par

l’Expedition Antarctique fran§aise (Terebelliens, Serpuliens).

Bulletin du Museum d’Histoire Naturelle, Paris 13: 46-52.

Grube, A.E. 1870. Beschreibungen neuer oder weniger bekannter von

Hrn. Ehrenberg gesammelter Anneliden des Rothen Meeres.

Monatsberichte der koniglich preussischen Akademie der

Wissenschaften zu Berlin 1869: 484-521.

Gunnerus, J. 1768. Om nogle norske coraller. Skrifter det Kongliger

norske Videnskabsselskabet Trondhjem 4: 38-73.

Guppy, D.J., Lindner, A.W., Rattigan, J.H., and Casey, J.N. 1951. The

Stratigraphy of the Mesozoic and Permian sediments of the Desert

Basin, Western Australia. Bureau of Mineral Resources, Geology

and Geophysics, Canberra? Records 1951/60: 1-12.

Hagenow, F. von 1840. Monographie der Riigen’schen Kreide-

Versteinerungen. 2. Radiarien und Annulaten. Neues Jahrbuch

fur Mineralogie, Geognosie, Geologie und Petrefaktenkunde

1840: 631-672.

Hartman, O. 1960. Systematic account of some marine invertebrate

animals from the deep basins off southern California. Allan

Hancock Pacific Expeditions 22(2): 69-176.

Hedley, R.H. 1958. Tube formation by Pomatoceros triqueter

(Polychaeta). Journal of the Marine Biological Association of the

United Kingdom 37: 315-322.

Hints, O., and Eriksson, M. 2007. Diversification and biogeography of

scolecodont-bearing polychaetes in the Ordovician.

Palaeogeography, Palaeoclimatology, Palaeoecology 245: 95-

114.

Hoare, R.D., Mapes, R.H., and Yancey T.E. 2002. Structure, taxonomy

and epifauna of Pennsylvanian rostroconchs (Mollusca). The

Paleontological Society Memoir 58 ( Supplement to Journal of

Paleontology 76): 1-30.

Hoeksema, B.W., and ten Hove, H.A. 2011. Aggregation of the reef¬

building tube worm Filogranella elatensis at Semporna, eastern

Sabah, Malaysia. Coral Reefs 30: 839.

Hove, H.A. ten 1974. Notes on Hydroides elegans (Haswell, 1883) and

Mercierella enigmatica Fauvel, 1923, alien serpulid polychaetes

introduced into the Netherlands. Bulletin Zoologisch Museum,

Universiteit van Amsterdam 4: 45-51.

154

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

Hove, H.A. ten 1975. Serpulinae (Polychaeta) from the Caribbean, 3.

The genus Pseudovermilia. Studies on the Fauna ofCuragao and

other Caribbean Islands 47: 46-101.

Hove, H.A. ten 1994. The dualistic relation between Molluscs and

Serpulid tube-worms. Pp. 65-70 in: Coomans-Eustatia, M.,

Moolenbeek, R., Los, W., and Prins, P. (Eds.). De horen en zijn

echo. Stichting Libri Antilliani, Zoologisch Museum Amsterdam.

Hove, H.A. ten, and Hurk, P. van den 1993. A review of recent and

fossil serpulid ‘reefs’: actuopalaeontology and the ‘Upper Malm’

serpulid limestones in NW Germany. Geologie en Mijnbouw 72:

23-67.

Hove, H.A. ten, and Kupriyanova, E.K. 2009. Taxonomy of Serpulidae:

the state of affairs. Zootaxa 2036: 1-126.

Hove, H.A. ten, and Weerdenburg, J.C.A. 1978. A generic revision of

the brackish-water serpulid Ficopomatus Southern, 1921

(Polychaeta: Serpulinae), including Mercierella Fauvel 1923,

Sphaeropomatus Treadwell 1934, Mercierellopsis Rioja 1945 and

Neopomatus Pillai 1960. Biological Bulletin 154: 96-120.

Hove, H.A. ten, and Zibrowius, H. 1986. Laminatubus alvini gen. et

sp. n. and Protis hydrothermica sp. n. (Polychaeta, Serpulidae)

from the bathyal hydrothermal vent communities in the eastern

Pacific. Zoologica Scripta 15: 21-31.

Howell, B.F. 1943. Hamulus, ii Falcula , \ and other Cretaceous Tubicola

of New Jersey. Proceedings of the Academy of Natural Sciences

of Philadelphia 95: 139-166.

Howell, B.F. 1962. Worms. Pp. W144-W177 in: Moore R.C., and

Teichert C. (Eds.) Treatise on invertebrate paleontology. Pt. W.

Miscellanea, Conodonts, conoidal shells of uncertain affinities,

worms, trace fossils and problematical The Geological Society of

America and the University of Kansas: Boulder, Colorado, and

Lawrence, Kansas.

Howell, B.F., Mason, A.M., and Mason, J.F. 1937. Reef-forming

serpulid from the Pleistocene of San Pedro, California. Bulletin of

the Wagner Free Institute of Science 12: 1-2.

Hua, H., Chen, Z., Yuan, X., Zhang, L., and Xiao, S. 2005.

Skeletogenesis and asexual reproduction in the earliest

biomineralizing animal Cloudina. Geology 33: 277-280.

Ippolitov, A.P. 2007a. Contribution to the revision of some late

Callovian serpulids (Annelida, Polychaeta) of central Russia: Part

1. Paleontological Journal 41: 260-267.

Ippolitov, A.P. 2007b. Contribution to the revision of some late

Callovian serpulids (Annelida, Polychaeta) of central Russia: Part

2. Paleontological Journal 41: 429-436.

Ippolitov, A.P. 2010. Serpulid (Annelida, Polychaeta) evolution and

ecological diversification patterns during Middle-Late Jurassic.

Earth Science Frontiers 17: 207-208.

Ippolitov, A.P, and Rzhavsky A.V. 2008. On the tube microstructure

of recent spirorbids (Annelida, Polychaeta). Doklady Biological

Sciences 418: 20-22.

Ippolitov, A.P, and Rhzavsky, A.V. 2014. Tube morphology,

ultrastructures and mineralogy in Recent Spirorbinae (Annelida;

Polychaeta; Serpulidae). I. General Introduction. Tribe

Paralaeospirini. Invertebrate Zoology 11: 293-314.

Jadoul, F., Galli, M.T., Calabrese, L., and Gnaccolini, M. 2005.

Stratigraphy of Rhaetian to lower Sinemurian Carbonate platforms

in Western Lombardy (Southern Alps, Italy): Paleogeographic

implications. Rivista Italiana di Paleontologia e Stratigrafia

111(2): 285-303.

Jager, M. 1983. Serpulidae (Polychaeta sedentaria) aus der

norddeutschen hoheren Oberkreide - Systematik, Stratigraphie,

Okologie. Geologisches Jahrbuch, Reihe A 68: 3-219.

Jager, M. 1991. Serpulidae und Spirorbidae (Polychaeta sedentaria)

aus dem Alb und der Oberkreide Helgolands (Norddeutschland).

Geologisches Jahrbuch, Reihe A 120: 139-175.

Jager, M. 1993. Danian Serpulidae and Spirorbidae from NE Belgium

and SE Netherlands: K/T boundary extinction, survival, and

origination patterns. Contributions to Tertiary and Quaternary

Geology 29:13-131.

Jager, M. 2005. Serpulidae und Spirorbidae (Polychaeta Sedentaria)

aus Campan und Maastricht von Norddeutschland, den

Niederlanden, Belgien und angrenzenden Gebieten. Geologisches

Jahrbuch, Reihe A 157 (for 2004): 121-249.

Jager, M. 2011. Sabellidae, Serpulidae and Spirorbinae (Polychaeta

sedentaria) from the Barremian (Lower Cretaceous) of the Serre

de Bleyton (Drome, SE France). Annalen des Naturhistorischen

Museums in Wien, Serie A 113: 675-733.

Jager, M., and Schubert, S. 2008. Das Ober-Pliensbachium (Domerium)

der Herforder Liasmulde; Teil 2, Serpuliden (Kalkrohrenwiirmer).

Geologie und Paldontologie in Westfalen 71: 47-75.

Jager, M., and Schneider, S. 2009. Serpulidae (Annelida, Polychaeta)

from the lower Ottnangian (Late Burdigalian) Upper Marine

Molasse of Dommelstadl and Gurlarn (Passau area. Lower

Bavaria, SE Germany). Neues Jahrbuch fur Geologie und

Paldontologie, Abhandlungen 254: 105-115.

Jager, M., Kapitzke, M., and Rieter, M. 2001. Neufunde von

Pannoserpulapannosa (Quenstedt, 1857) (Polychaeta, Serpulidae)

aus den Korallenkalken (Ober-Kimmeridgium) von Nattheim und

Gerstetten (Schwabische Alb). Stuttgarter Beitrage zur

Naturkunde, Serie B 308: 1-17.

Jaworski, E. 1915. Die Fauna der Obertriadischen Nucula-Mergel von

Misol. Paldontologie von Timor 2: 73-174.

Kiel, S. 2010a. On the potential generality of depth-related ecologic

structure in cold-seep communities: Cenozoic and Mesozoic

examples. Palaeogeography, Palaeoclimatology, Palaeoecology

295:245-257.

Kiel, S. 2010b. The fossil record of vent and seep mollusks. Pp. 255-

278 in: Kiel, S. (Ed.), The Vent and Seep Biota. Topics in

Geobiology. Springer, Heidelberg.

Kiel, S., and Little, C.T.S. 2006. Cold seep mollusks are older than the

general marine mollusk fauna. Science 313: 1429-1431.

Kiessling, W., Scasso, R., Aberhan, M., Ruiz, L., and Weidemeyer, S.

2006. A Maastrichtian microbial reef and associated limestones in

the Roca Formation of Patagonia (Neuquen Province, Argentina).

Fossil Record - Mitteilungen aus dem Museum fiir Naturkunde 9:

183-197.

King, W. 1850. A monograph of the Permian fossils of England.

Palaeontographical Society Monograph 5: 1-258.

Kirina, T.I. 1976. [The left bank of the lower course of Lena River],

In: Stratigrafiya jurskoi sistemy Severn SSSR: 98-107 [in Russian].

Knight-Jones, P. 1973. Spirorbinae (Serpulidae: Polychaeta) from

south-eastern Australia. A new genus, four new subgenera and

seven new species. Bulletin of the British Museum (Natural

History) 24(4): 231-259.

Knight-Jones, P. 1981. Behaviour, setal inversion and phylogeny of

Sabellida (Polychaeta). Zoologica Scripta 10: 183-202.

Knight-Jones, P. 1984. A new species of Protoleodora (Spirorbidae:

Polychaeta) from eastern U.S.S.R., with a brief revision of related

genera. Zoological Journal of the Linnean Society, London 64(2-

3): 109-120.

Kocf, T. 2009. Nove nalezy a predbezna zprava o revizi serpulidmch

cervu (Polychaeta, Canalipalpata) z lokalit Velim a Kank - Na

Vrsfch (prfbojova facie ceske krfdove panve). Vlastivedny

Zpravodaj Polabi 39(2007-2008): 207-238.

Kocf, T. 2012. Sabellidae and Serpulidae (Polychaeta, Canalipalpata)

from the locality Kank - Na Vrsfch in Kutna Hora (Upper

Cenomanian - Lower Turanian, Bohemian Cretaceous Basin - the

Czech Republic). Acta Musei Nationalis Pragae, Series B -

Historia Naturalis 68(1-2): 7-14.

Written in stone: history of serpulid polychaetes through time

155

Kouchinsky, A., Bengston, S., Feng, W., Kutygin, R., and Val’kov,

A.K. 2009. The Lower Cambrian fossil Anabaritids: affinities,

occurrences and systematics. Journal of Systematic Palaeontology

7:241-298.

Kupriyanova, E.K. 1993a. Deep-water Serpulidae (Annelida,

Polychaeta) from Kurile-Kamchatka Trench. 2. Genera

Bathyditrupa, Bathyvermilia, and Protis. Zoologicheskii Zhurnal

72(3): 21-28 [in Russian],

Kupriyanova, E.K. 1993b. A new species, Metavermilia arctica

(Polychaeta, Serpulidae), from the Arctic Ocean. Sarsia 78(2):

155-157.

Kupriyanova, E.K. 2003. Life history evolution in Serpulimorph

polychaetes: a phylogenetic analysis. Hydrobiologia 496: 105-114.

Kupriyanova, E.K., Bastida-Zavala, R., Halt, M.N., Lee, M., and

Rouse, G.W. 2008. Phylogeny of the Serpula-Crucigera-

Hydroides clade (Serpulidae; Annelida) using molecular and

morphological data: implications for operculum evolution.

Invertebrate Systematics 22: 425-437.

Kupriyanova, E.K., and Ippolitov, A.P. 2012. Are Mesozoic shallow-

water serpulids (Annelida, Polychaeta) ancestors of the Recent

deep-sea fauna? Abstracts of the 13 th Deep-Sea Biology

Symposium, Wellington, New Zealand.

Kupriyanova, E.K., McDonald, T.A., and Rouse, G.W. 2006.

Phylogenetic relationships within Serpulidae (Annelida:

Polychaeta) inferred from molecular and morphological data.

Zoologica Scripta 35: 421-439.

Kupriyanova, E.K., Hove, H.A. ten, Sket, B., Trontelj, P., Zaksek, V.,

and Rouse, G.W. 2009. Evolution of a unique freshwater cave¬

dwelling serpulid polychaete Marifugia cavatica Absolon and

Hrabe, 1930. Systematics and Biodiversity 7: 389-401.

Kupriyanova, E.K., and Nishi, E. 2010. Serpulidae (Annelida,

Polychaeta) from Patton-Murray Seamount, Gulf of Alaska,

North Pacific Ocean. Zootaxa 2665: 51-68.

Kupriyanova, E.K., and Nishi, E. 2011. New records of the deep-sea

Nogrobs grimaldii (Serpulidae: Annelida). Marine Biodiversity

Records 4 (e74): 1-4.

Kupriyanova, E.K., Nishi, E., Kawato, M., and Fujiwara, Y. 2010. New

records of Serpulidae (Annelida, Polychaeta) from hydrothermal

vents of North Fiji, Pacific Ocean. Zootaxa 2389: 57-68.

Kupriyanova, E.K, Bailey-Brock, J.H., and Nishi, E. 2011. New

records of Serpulidae (Annelida, Polychaeta) collected by R/V

“ Vityaz ” from bathyal and abyssal depths of the Pacific Ocean.

Zootaxa 2871: 43-60.

Kupriyanova, E.K., ten Hove, H.A., and Nishi, E. 2012. A taxonomic

revision of the genus Pseudo chit inop oma Zibrowius, 1969

(Serpulidae, Annelida) with descriptions of two new species.

Zootaxa 3507: 57-78.

Lamarck, J.B. de 1818. HistoireNaturelle des animaux sans vertebres,

presentant ... Part 5. Deterville and Verdiere: Paris. 612 pp.

[Annelides, pp. 274-374].

Langerhans, P. 1884. Die Wurmfauna von Madeira. 4. Zeitschrift fiir

wissenschaftliche Zoologie 40: 247-285.

Lehrke, J., ten Hove, H.A., Macdonald, T.A., Bartolomaeus, T., and

Bleidorn, C. 2007. Phylogenetic relationships of Serpulidae

(Annelida: Polychaeta) based on 18S rDNA sequence data, and

implications for opercular evolution. Organisms, Diversity and

Evolution 7: 195-206.

Levinsen, G.M.R. 1884. Systematisk-geografisk Oversigt over de

nordiske Annulata, Gephyrea, Chaetognathi og Balanoglossi.

Anden Halvdel (= Pt.2). Videnskabelige Meddelelser fra Dansk

naturhistorisk Forening i Kpbenhavn 1883: 92-350.

Linnaeus, C. 1758. Systema Naturae, 10th edition. Vol. 1. L. Salvius:

Holmiae. 823 pp.

Lommerzheim, A. 1979. Monographische Bearbeitung der Serpulidae

(Polychaeta sedentaria) aus dem Cenoman (Oberkreide) am

Siidwestrand des Miinsterlander Beckens. Decheniana 132:

110-195.

Lommerzheim, A. 1981. Palaozane Serpulidae und Spirorbidae

(Polychaeta) von den Emperor Seamounts, NW-Pazifik. Zitteliana

7: 31-54.

Luci, L., Garberoglio, R.M., and Lazo, R.G. 2013. Serpulids and other

calcareous tube-dwelling encrusting polychaetes from the Early

Cretaceous Agrio Formation (Neuquen Basin, Argentina).

Geobios 46: 213-224.

Lugeon, M. 1919. Sur l’inexistence de la nappe du Augsmatthorn.

Bulletin de la Societe Vaudoise des Sciences Naturelles 51: 55-57.

Macdonald, T.A. 2003. Phylogenetic relations among spirorbid

subgenera and the evolution of opercular brooding. Hydrobiologia

496: 125-143.

Macellari, C.E. 1984. Revision of serpulids of the genus Rotularia

(Annelida) at Seymour Island (Antarctic Peninsula) and their

value in stratigraphy. Journal of Paleontology 58(4): 1098-1116.

Malaquin, A. 1904. Le Spirorbis pusillus du Terrain Houiller de

Bruay. La formation du tube des Spirorbes et leur adaptation en

eau douce a l’epoque houillere. Annales de la Societe Geologique

duNord, Lille 34: 68-74.

Marenzeller, E. von 1878. Die Coelenteraten, Echinodermen und

Wiirmer der K.K. Osterreichisch-Ungarischen Nordpol-

Expedition. Denkschriften der Kaiserlichen Akademie der

Wis sens chaften, Wien (mathematisch-naturwissenschaftliche

Classe) 35: 357-398.

Medernach, L., Jordana, E., Gremare, A., Nozais, C., Charles, F., and

Amouroux, J.M. 2000. Population dynamics, secondary

production and calcification in a Mediterranean population of

Ditrupa arietina (Annelida: Polychaeta). Marine Ecology -

Progress Series 199: 171-184.

Michelin, J.L.H. 1840-1847. Iconographie zoophytologique;

description par localites et terrains des polypiers fossiles de

France et pays environnants. Paris: P. Beertrand. 348 pp.

Morch, O.A.L. 1863. Revisio critica Serpulidarum, et Bidrag til

Rprormenes Naturhistorie. Naturhistorisk Tidsskrift, Kpbenhavn,

Series 3, 1: 347-470.

Montfort, D. de 1808. Conchyliologie systematique, 1. Coquilles

univalves, cloisonees. Paris. 409 pp.

Morton, S.G. 1834. Synopsis of the organic remains of the Cretaceous

Group of the United States. Key & Biddle: Philadelphia. 88 pp.

Muller, A.H. 1963. Kammerung in Serpulidenrohren (Annelida,

Polychaeta) der Oberen Kreide. Geologie, Berlin, 12(10):

1194-1203.

Muller, A.H. 1970. Neue Serpuliden aus dem Mesozoikum und einige

Bemerkungen fiber Sclerostyla (Polychaeta sedentaria).

Monatsberichte der deutschen Akademie der Wissenschaften,

Berlin, 12(1): 53-62.

Muller, O.F. 1776-1777. Zoologiae Danicae Prodromus, seu

animalium Daniae et Norvegiae indigenarum. Characteres,

nomina et synonyma imprimis popularum. Havniae. 174 pp.

[published 1776], plates [published 1777].

Munster, G. zu 1841. Beschreibung und Abbildung der in den

Kalkmergelschichten von St. CassiangefundenenVersteinerungen.

Pp. 25-152 in: Wissmann, H.L. and Munster, G. zu (Eds.),

Beitrage zur Geognosie und Petrefacten-Kunde des siiddstlichen

Tirols vorzilglich der Schichten von St. Cassian. Bayreuth:

Buchner’sche Buchhandlung.

Murchison, R.I. 1839. The Silurian system. Murray: London. 768 pp.

Navarro, V., Reolid, M., Molina, J.M., and Ruiz-Ortiz, P.A. 2008.

Slope breccias colonized by bivalves and serpulids during the

Middle Jurassic (Subbetic, SE Spain). Facies 54: 403-415.

156

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

Neff, J.M. 1971. Ultrastructure of calcium phosphate-containing cells

in the serpulid polychaete worm Pomatoceros caeruleus.

Calcified Tissue Research 7(1): 191-200.

Nestler, H. 1963. Querboden bei Serpuliden (Polychaeta Sedentaria)

aus dem Unter-Maastricht der Insel Riigen. Geologie, Berlin,

12(5): 596-603.

Nishi, E. 1993. On the internal structure of calcified tube walls in

Serpulidae and Spirorbidae (Annelida, Polychaeta). Marine

Fouling 10: 17-20.

Nishi, E., and Nishihira, M. 1994. Colony formation via sexual and

asexual reproduction in Salmacina dysteri (Huxley) (Polychaeta,

Serpulidae). Zoological Science 11: 589-595.

Noetling, F. 1885. Die Fauna der baltischen Cenoman-Geschiebe.

Palaontologische Abhandlungen 2: 199-247.

Okuda, S. 1946. Studies on the development of Annelida Polychaeta I.

Journal of the Faculty of Science, Hokkaido University. Series 6,

Zoology 9(2): 115-219.

Olu, K., Duperret, A., Sibuet, M., Foucher, J.-P., and Fiala-Medoni, A.

1996a. Structure and distribution of cold seep communities along

the Peruvian active margin: relationship to geological and fluid

patterns. Marine Ecology - Progress Series 132: 109-125.

Olu, K., Sibuet, M., Harmegnies, F., Foucher, J.-P., and Fiala-Medoni,

A., 1996b. Spatial distribution of diverse cold seep communities

living on various diapiric structures of the southern Barbados

prism. Progress in Oceanography 38: 347-376.

Pallas, P.S. 1766. Miscellanea Zoologica. Hagae Comitum. 224 pp.

Palma, R.M., and Angeleri, M.P. 1992. Early Cretaceous serpulid

limestones: Chachao Formation, Neuquen Basin, Argentina.

Facies 27: 175-178.

Palmer, C.P. 2001. Dentalium giganteum Phillips: a serpulid worm

tube. Proceedings of the Yorkshire Geological Society 53: 253-255.

Parsch, K.O.A. 1956. Die Serpuliden-Fauna des siidwestdeutschen

Jura. Palaeontographica Abteilung A, Palaozoologie,

Stratigraphie 107: 211-240.

Parsch, K.O.A. 1961. Einige Serpuliden aus dem Jura von Alberta,

Kanada. Stuttgarter Beitrdge zur Naturkunde 63: 1-6.

Perkins, T.H. 1991. Calcisabella piloseta, a new genus and species of

Sabellinae (Polychaeta: Sabellidae). Bulletin of Marine Science

48: 261-267.

Philippi, A. 1844. Einige Bemerkungen fiber die Gattung Serpula,

nebst Aufzahlung der von mir im Mittelmeer mit dem Thier

beobachteten Arten. Archiv fur Naturgeschichte, Berlin 10: 186—

198 [translated in: Annals and Magazine of Natural History

London (1) 14: 153-162].

Piette, E. 1856. Notice sur les gres dAiglemont et de Rimogne.

Bulletin de la Societe geologique de France, ser. 2, 13: 188-207.

Pillai, T.G. 1970. Studies on a collection of spirorbids from Ceylon

together with a critical review and revision of spirorbid

systematics, and an account of their phylogeny and zoogeography.

Ceylon Journal of Science (Biological Science) 8: 100-172.

Pillai, T.G. 1993. A review of some Cretaceous and Tertiary serpulid

polychaetes of the genera Cementula and Spiraserpula Regenhardt

1961, Laqueoserpula Lommerzheim 1979 and Protectoconorca

Jager 1983. Palaontologische Zeitschrift 67: 69-88.

Pillai, T.G. 2009. Knightjonesia, anew genus (Polychaeta: Spirorbidae)

with a winged opercular peduncle, and its taxonomy. Zootaxa

2059: 46-50.

Pillai, T.G., and ten Hove, H.A. 1994. On recent species of Spiraserpula

Regenhardt, 1961, a serpulid polychaete genus hitherto known

only from Cretaceous and Tertiary fossils. Bulletin of the Natural

History Museum, London (Zoology ) 60: 39-104.

Pisera, A. 1996. Miocene reefs of the Paratethys: a review. SEPM

Concepts in Sedimentology and Paleontology 5: 97-104.

Pixell, H.L.M. 1912. Polychaeta from the Pacific coast of North

America. Part I. Serpulidae, with a revised table of classification

of the genus Spirorbis. Proceedings of the Zoological Society of

London 1912: 784-805.

Pixell, H.L.M. 1913. Polychaeta of the families Serpulidae and

Sabellidae, collected by the Scottish National Antarctic Expedition.

Transactions of the Royal Society of Edinburgh 49: 347-358.

Quenstedt, F.A. 1856-1858: Der Jura. Tfibingen: Laupp. 842 pp.

Radwanska, U. 1994a. Tube-dwelling polychaetes from the Korytnica

Basin (Middle Miocene; Holy Cross Mountains, Central Poland).

Acta Geologica Polonica 44: 35-83.

Radwanska, U. 1994b. A new group of microfossils: Middle Miocene

(Badenian) opercular caps ( calottae ) of the tube-dwelling

polychaetes Vermiliopsis Saint-Joseph, 1894. Acta Geologica

Polonica 44: 83-96.

Radwanska, U. 2004. Tube-dwelling polychaetes from the Upper

Oxfordian of Wapienno/Bielawy, Couiavia Region, north-central

Poland. Acta Geologica Polonica 54: 35-52.

Rafinesque, C.S. 1815. Analyse de la nature ou tableau de Tunivers et

des corps organises. J. Barravecchia: Palermo. 224 pp.

Regenhardt, H. 1961. Serpulidae (Polychaeta sedentaria) aus der

Kreide Mitteleuropas, ihre okologische, taxionomische und

stratigraphische Bewertung. Mitteilungen aus dem Geologischen

Staatsinstitut in Hamburg 30: 1-115.

Regenhardt, H. 1964. “Wurm-” und Serpuliden-Rohren in Geschieben

unter besonderer Berficksichtigung von “Riffbildungen”.

Lauenburgische Heimat. Zeitschrift des Heimatbund und

Geschichtsvereins Herzogtum Lauenburg, neue Folge 45: 57-62.

Rioja, E. 1923. Estudio sistematico de las especies Ibericas del

suborden Sabelliformia. Trabajos del Museo Nacional de

Ciencias Naturales Serie Zoologica 48: 1-144.

Risso, A. 1826. Histoire Naturelle des principals productions de

VEurope Meridionale et particulierement de celles des environs

de Nice et des Alpes Maritimes. IV, Mollusques, Annelides. Paris:

439 pp. [Annelides p. 397-432.]

Rosenkrantz, A. 1920. Craniakalk fra Kjpbenhavns Sydhavn.

Danmarks Geologiske Underspgelse, Serie 2, 36: 1-79.

Roule, L. 1898. Notice preliminaire sur les especes dAnnelides

recueillies dans les explorations sours-marines du “Travailleur” et

du “Talisman”. Bulletin du Museum National d’Histoire Naturelle

4: 190-195.

Rovereto, G. 1895. Di alcuni anellidi del terziario in Austria. Atti della

Societa Ligustica di scienze naturali e geografiche 6(2): 152-158.

Rovereto, G. 1899. Serpulidae del Terziario e del Quaternario in Italia.

Palaeontographia Italica. Memorie di Paleontologia 4: 47-92.

Rovereto, G. 1903. Anellidi del Terziario. Rivista Italiana di

Paleontologia 9(4): 103-104.

Rovereto, G. 1904. Studi monografici sugli Anellidi fossili, 1,

Terziario. Palaeontographia Italica. Memorie di Paleontologia

10: 1-73.

Ryckholt, P. de 1852. Melanges paleontologiques. Partie I. Memoires

couronnes et Memoires des Savants etrangers de TAcademie

royale des Sciences, des Lettres et des Beaux-Arts de Belgique

24: 1-176.

Rzhavsky, A.V. 1988. Jugaria kofiadii sp. n. (Polychaeta, Spirorbidae)

from the Arctic Basin. Zoologicheskii Zhurnal 67(6): 933-934 [in

Russian].

Rzhavsky, A.V. 1997. Three new species and new genus of Spirorbidae

(Polychaeta) from the Southern Indian Ocean, with a brief

description of two species incerta sedis from the Southern

Hemisphere. Ophelia 46(3): 233-245.

Saint-Joseph, A. de 1894. Les Annelides polychetes des cotes de

Dinard. Troisieme Partie. Annales des sciences naturelles, Paris,

Series 7,17: 1-395.

Written in stone: history of serpulid polychaetes through time

157

Sandberger, G., and Sandberger, F. 1856. Die Ver Steiner ungen des

rheinischen Schichtensystems im Nassau. Kreidel & Niedner:

Wiesbaden. 564 pp.

Sanfilippo, R. 1996. Micromorphology, microstructure and functional

morphology of the Josephella marenzelleri (Polychaeta

Serpulidae) tube. Bolletino della Societa Paleontologica Italiana,

Special Volume 3: 205-211.

Sanfilippo, R. 1998a. Spirorbid Polychaetes as boreal guests in the

Mediterranean Pleistocene. Rivista Italiana di Paleontologia e

Stratigrafia 104: 279-286.

Sanfilippo, R. 1998b. Tube morphology and structure of the bathyal

Maditerranean serpulid Hyalopomatus variorugosus Ben-Eliahu

et Fiege, 1996 (Annelida, Polychaeta). Rivista Italiana di

Paleontologia e Stratigrafia 104: 131-138.

Sanfilippo, R. 1999. Ditrupa brevis n. sp., a new serpulid from the

Mediterranean Neogene with comments on the ecology of the genus.

Rivista Italiana di Paleontologia e Stratigrafia 105: 455-464.

Sanfilippo, R. 2001. Bathyvermilia islandica (Polychaeta, Serpulidae):

a new deep-water species from south of Iceland. Sarsia 86: 177-

182.

Sasonova, I.G. 1958. Lower Cretaceous deposits of Russian platform.

Pp. 31-183 in: Flyorova O.V. (Ed.). Mesozoic and Tertiary deposits

of central parts of Russian platform. Moscow: Gostoptehizdat [in

Russian].

Savazzi, E. 1995. Morphology and mode of life of the polychaete

Rotularia. Palaontologische Zeitschrift 69: 73-85.

Savazzi, E. 1999. Serpulid polychaetes. Pp. 601-607 in: Savazzi, E.

(Ed.), Functional morphology of the invertebrate skeleton. John

Wiley & Sons: Chichester. 706 pp.

Schlogl, J., Michalfk, J., Zagorsek, K., and Atrops, F. 2008. Early

Tithonian serpulid dominated cavity-dwelling fauna, and the

recruitment pattern of the serpulid larvae. Journal of Paleontology

82: 351-361.

Schlotheim, E.F. von 1820. Die Petrefactenkunde auf ihrem jetzigen

Standpunkte. Becker: Gotha. 437 pp.

Schmarda, L.K. 1861. Neue wirbellose Thiere beobachtet und

gesammelt auf einer Reise um die Erde 1853 bis 1857. Erster

Band (zweite Halfte). Turbellarien, Rotatorien und Anneliden.

Wilhelm Engelmann: Leipzig. 164 pp.

Schmidt, M., and von Pia, J. 1935. Fossilien der spanischen Trias.

Abhandlungen der Heidelberger Akademie der Wissenschaften.

Mathematisch-Naturwissenschaftliche Klasse 22: 1-140.

Schmidt, W. 1950. Neue Serpula- Arten aus dem Material des

Naturhistorischen Museums in Wien. Annalen des

Naturhistorischen Museums in Wien 57: 159-162.

Schmidt, W.J. 1951. Neue Serpulidae aus dem tertiaren Wiener

Becken. Annalen des Naturhistorischen Museums in Wien 58:

77-84.

Schmidt, W.J. 1955. Die Tertiaren Wiirmer Osterreichs.

Osterreichische Akademie der Wissenschaften. Mathematisch-

Naturwissenschaftliche Klasse. Denkschriften 109: 1-121.

Seilacher, A., Olivero, E.B., Butts, S.H., and Jager, M. 2008. Soft-

bottom tube worms: from irregular to programmed shell growth.

Lethaia 41: 349-365.

Senowbari-Daryan, B., and Link, M. 2005. Filograna (colonial

serpulid worm tubes) from Upper Triassic (Norian) reef boulders

of Taurus Mts. (southern Turkey). Facies 51: 454-459.

Senowbari-Daryan, B„ Link, M., and I§intek, I. 2007. Filograna

minor nov. sp. (Worm Tube) from the Middle Triassic (Anisian)

reef boulders of the Karaburun Peninsula, Western Turkey.

Turkish Journal of Earth Sciences 16: 1-9.

Smith, A.M., Riedi, M.A., and Winter, D.J. 2013.Temperate reefs in a

changing ocean: skeletal carbonate mineralogy of serpulids.

Marine Biology 160: 2281-2294.

Southern, R. 1921. Polychaeta of the Chilka Lake and also of fresh and

brackish waters in other parts of India. Memoirs of the Indian

Museum 5: 563-659.

Sowerby, J. de C. 1829. The Mineral Conchology of Great Britain.... VI.

London: Sowerby J. de C. 230 pp.

Sowerby, J. de C. 1840-1846. The Mineral Conchology of Great

Britain...VII. London: Sowerby J. de C. 80+11 pp.

Stanley, S.M. 2006. Influence of seawater chemistry on biomineralization

throughout Phanerozoic time: Paleontological and experimental

evidence. Palaeogeography, Palaeoclimatology, Palaeoecology

232:214-236.

Stiller, F. 2000. Polychaeta (Annelida) from the Upper Anisian (Middle

Triassic) of Qingyan, south-western China. Neues Jahrbuch fur

Geologie und Palaontologie, Abhandlungen 217: 245-266.

Stoliczka, F. 1867-1868. The Gastropoda of the Cretaceous rocks of

Southern India. Memoirs of the Geological Survey of India.

Palaeontologia Indica 5: 497 pp.

Stuckenberg, A. 1905. [Die Fauna der Obercarbonischen Suite des

Wolgadurchbruches bei Samara]. Memoires du Comite Geologique.

Nouvelle Serie 23: 1-144 [in Russian]

Suveizdis, PI. 1963. [Upper Permian deposits of Polish-Lithuanian

syneclise]. Pp. 225-235 in Grigyalis, A.A. and Karatajute-Talimaa

V.N. (Eds.) Voprosy geologii Litvy. Vilnus [in Russian].

Tanur, A.E., Gunari, N., Sullan, R.M.A., Kavanagh, C.J., and Walker,

G.C. 2010. Insights into the composition, morphology, and

formation of the calcareous shell of the serpulid Hydroides

dianthus. Journal of Structural Biology 169: 145-160.

Tapaswi, P.M. 1988. Role of serpulids in the biostratigraphy of the

Upper Cretaceous rocks from Tiruchirapally District, South India.

Recent Researches in Geology 12: 183-187.

Taylor, P.D., 2014. Possible serpulid worm affinities of the supposed

bryozoan Corynotrypoides from the Triassic Cassian Formation of

the Italian Dolomites. Batalleria 20: 11-16.

Taylor, P.D., and Vinn, O. 2006. Convergent morphology in small spiral

worm tubes (‘ Spirorbisf and its palaeoenvironmental implications.

Journal of the Geological Society, London 163: 225-228.

Taylor, P.D., Vinn, O., and Wilson, M.A. 2010. Evolution of

biomineralization in “lophophorates”. Special Papers in

Palaeontology 84: 317-333.

Theel, H.J. 1878. Les Annelides Polychetes des mers de la Nouvelle-

Zemble. Kungliga Svenska Vetenskapsakademiens Handlingar

16(3): 1-75.

Uchida, H. 1978. Serpulid tube worms (Polychaeta, Sedentaria) from

Japan with the systematic review of the group. Bulletin of the

Marine Park Research Stations 2: 1-98.

Verrill, A.E. 1873. Report upon the invertebrate animals of Vineyard

Sound and the adjacent waters, with an account of the physical

characters of the region. United States Commission of Fisheries,

Washington, Report for 1871-1872: 295-778.

Vine, P. J. 1972. Spirorbinae (Polychaeta: Serpulidae) from the Red Sea,

including description of a new species. Zoological Journal of the

Linnean Society, London 51(2): 177-201.

Vinn, O. 2005. The tube ultrastructure of serpulids (Annelida,

Polychaeta) Pentaditrupa subtorquata, Cretaceous, and Nogrobs

cf. vertebralis, Jurassic, from Germany. Proceedings of the

Estonian Academy of Sciences, Geology 54: 260-265.

Vinn, O. 2006. Two new microconchid (Tentaculita Boucek, 1964)

genera from the Early Palaeozoic of Baltoscandia and England.

Neues Jahrbuch fur Geologie und Palaontologie, Monatshefte

2006:89-100.

Vinn, O. 2007. Taxonomic implications and fossilization of tube

ultrastructure of some Cenozoic serpulids (Annelida, Polychaeta)

from Europe. Neues Jahrbuch fur Geologie und Palaontologie,

Abhandlungen 244: 115-128.

158

A.P. Ippolitov, 0. Vinn, E.K. Kupriyanova & M. Jager

Vinn, O. 2008. Tube ultrastructure of the fossil genus Rotularia

Defrance, 1827 (Polychaeta, Serpulidae). Journal of Paleontology

82: 206-212.

Vinn, O. 2009. The ultrastructure of calcareous cirratulid (Polychaeta,

Annelida) tubes. Estonian Journal of Earth Sciences 58: 153-156.

Vinn, O. 2011. The role of an internal organic tube lining in the

biomineralization of serpulid tubes. Carnets de Geologie /

Notebooks on Geology - Letter 2011/01 (CG2011_L01).

Vinn, O. 2012. Calcite in the skeletons of annelids. Pp. 245-261 in

Dobrev, J. and Markovic, P. (Eds.), Calcite: Formation, Properties

and Applications. Nova Science Publishers.

Vinn, O. 2013a. Cornulitid tubeworms from the Ordovician of eastern

Baltic. Carnets de Geologie [Notebooks on Geology ], Brest, Letter

2013/03 (CG2013_L03): 131-138.

Vinn, O. 2013b. Occurrence, formation and function of organic sheets

in the mineral tube structures of Serpulidae (Polychaeta, Annelida).

PLoS ONE 8(10): e75330.

Vinn, O. 2013c. SEM Study of semi-oriented tube microstructures of

Serpulidae (Polychaeta, Annelida): implications for the evolution

of complex oriented microstructures. Microscopy Research and

Technique 76: 453-456.

Vinn, O., and Furrer, H. 2008. Tube structure and ultrastructure of

serpulids from the Jurassic of France and Switzerland, its

evolutionary implications. Neues Jahrbuch fur Geologie und

Palaontologie, Abhandlungen 250: 129-135.

Vinn, O., Hryniewicz, K., Little, C.T.S., and Nakrem, H.A. (in press).

A Boreal serpulid fauna from Volgian-Ryazanian (latest Jurassic-

earliest Cretaceous) shelf sediments and hydrocarbon seeps from

Svalbard. Geodiversitas.

Vinn, O., Hove, H.A. ten, and Mutvei, H. 2008a. On the tube

ultrastructure and origin of calcification in sabellids. Palaeontology

51:295-301.

Vinn, O., Hove, H.A. ten, Mutvei, H., and Kirsimae, K. 2008b.

Ultrastructure and mineral composition of serpulid tubes

(Polychaeta, Annelida). Zoological Journal of the Linnean Society

154: 633-650.

Vinn, O., Jager, M., and Kirsimae, K. 2008c. Microscopic evidence of

serpulid affinities of the problematic fossil tube “ Serpula ” etalensis

from the Lower Jurassic of Germany. Lethaia 41: 417-421.

Vinn, O., Kirsimae, K., and Hove, H.A. ten 2009. Tube ultrastructure

of Pomatoceros americanus - implications for the tube formation

of serpulids. Estonian Journal of Earth Sciences 58: 148-152.

Vinn, O., and Kupriyanova, E.K. 2011. Evolution of a dense outer

protective tube layer in serpulids (Polychaeta, Annelida). Carnets

de Geologie [Notebooks on Geology]. Letter CG2011/05 (CG2011_

L05).

Vinn, O., Kupriyanova, E.K., and Kiel, S. 2012. Systematics of serpulid

tubeworms (Annelida, Polychaeta) from Cretaceous and Cenozoic

hydrocarbon-seep deposits in North America and Europe. Neues

Jahrbuch fur Geologie und Palaontologie, Abhandlungen 266:

315-325.

Vinn, O., Kupriyanova, E.K., and Kiel, S. 2013. Serpulids (Annelida,

Polychaeta) at Cretaceous to modern hydrocarbon seeps: ecologic

and evolutionary patterns. Palaeogeography, Palaeoclimatology,

Palaeoecology 390: 35-41.

Vinn, O., and Mutvei, H. 2009. Calcareous tubeworms of the

Phanerozoic. Estonian Journal of Earth Sciences 58: 286-296.

Vinn, O., Mutvei, H., Hove, H.A. ten, and Kirsimae, K. 2008d. Unique

Mg-calcite skeletal ultrastructure in the tube of the serpulid

polychaete Ditrupa. Neues Jahrbuch fiir Geologie und

Palaontologie, Abhandlungen 248: 79-89.

Vinn, O., and Taylor, P.D. 2007. Microconchid tubeworms from the

Jurassic of England and France. Acta Palaeontologica Polonica

52(2): 391-399.

Vinn, O., and Wilson, M.A. 2010. Sabellid-dominated shallow water

calcareous polychaete tubeworm association from the equatorial

Tethys Ocean (Matmor Formation, Middle Jurassic, Israel). Neues

Jahrbuch fiir Geologie und Palaontologie, Abhandlungen 258:

31-38.

Vinn, O., and Zaton, M. 2012a. Inconsistencies in proposed annelid

affinities of early biomineralized organism Cloudina (Ediacaran):

structural and ontogenetic evidences. Carnets de Geologie

CG2012_A03: 39-47.

Vinn, O., and Zaton, M. 2012b. Phenetic phylogenetics of tentaculitoids

- extinct problematic calcareous tube-forming organisms.

Geologiska Foreningen i Stockholm Forhandlingar 134: 145-156.

Vinther, J., Eibye-Jacobsen, D.E., and Harper, D.A.T. 2011. An Early

Cambrian stem Polychaete with pygidial cirri. Biology Letters 7:

929-932.

Wade, B. 1922. The fossil annelid genus Hamulus Morton, an

operculate Serpula. Proceedings of the United States National

Museum 59(2359): 41-46._

Ware, S. 1975. British Lower Greensand Serpulidae. Palaeontology

18:93-116.

Weedon, M.J. 1991. Microstructure and affinity of the enigmatic

Devonian tubular fossil Trypanopora. Lethaia 24: 227-234.

Weedon, M.J. 1994. Tube microstructure of recent and Jurassic

serpulid polychaetes and the question of the Palaeozoic

‘spirorbids’. Acta Palaeontologica Polonica 39: 1-15.

Wetzel, W. 1957. Semiserpula, eine neue Rohrenwurm-Gattung aus

dem Alt-Tertiar Chiles. Senckenbergiana Lethaea 38: 29-36.

Winkler, G.G. 1861. Der Oberkeuper, nach Studien in den bayrischen

Alpen. Zeitschrift der Deutschen Geologischen Gesellschaft 13:

459-521.

Wrigley, A. 1951. Some Eocene serpulids. Proceedings of the

Geologists’ Association 62: 177-202.

Wrigley, A. 1952. Serpulid opercula from the Kunrade-limestone

(Upper Cretaceous, Maestrichtian). Mitteilungen aus dem

Geologischen Staatsinstitut in Hamburg 21: 162-164.

Yochelson, E.L. 1971. The little-known Pennsylvanian Clavulites

reinterpreted as a “worm”. Journal of Paleontology 45: 126-129.

Yu, Ch.-M., and Wang, H.-J. 1981. Some tube-like fossils from the

Early Tertiary of Northern Jiangsu. Acta Paleontologica Sinica

20(5): 406-417 [in Chinese],

Zaton, M., Vinn, O., and Tomescu, M. 2012. Invasion of freshwater

and variable marginal marine habitats by microconchid

tubeworms - an evolutionary perspective. Geobios 45: 603-610.

Zelinskaja, W.A. 1962. Vermetidae from the Eocene deposits of the

Nicopol district. Paleontologicheskii Sbornik 2(4): 27-31 [in

Russian]

Zhuravlev, A.Yu., Linan, E., Gamez Vintaned, J.A., Debrenne, F., and

Fedorov, A.B. 2012. New finds of skeletal fossils in the terminal

Neoproterozoic of the Siberian Platform and Spain. Acta

Palaeontologica Polonica 57(1): 205-224.

Zibrowius, H. 1969. Review of some little known genera of Serpulidae

(Annelida Polychaeta). Smithsonian Contributions to Zoology 42:

1 - 22 .

Zibrowius, H. 1972. Une espece actuelle du genre Neomicrorbis

Rovereto (Polychaeta Serpulidae) decouverte dans l’etage bathyal

aux A§ores. Bulletin du Museum National d’Histoire naturelle

Paris, 3 e serie, 39 (Zoologie33): 423-430.

Zibrowius, H. 1973. Revision of some Serpulidae (Annelida Polychaeta)

from abyssal depths in the Atlantic and Pacific, collected by the

“Challenger” and Prince of Monaco Expeditions. Bulletin of

British Museum of Natural History (Zoology) 24: 427-439.

Zibrowius, H. 1979. Vitreotubus digeronimoi n. g., n. sp. (Polychaeta

Serpulidae) du Pleistocene inferieur de la Sicile et de l’etage

bathyal des Aijores et de l’Ocean Indien. Tethys 9(2): 183-190.

Written in stone: history of serpulid polychaetes through time

159

Zibrowius, H., and ten Hove, H.A. 1987. Neovermiliafalcigera (Roule,

1898) a deep- and cold-water serpulid polychaete common in the

Mediterranean Plio-Pleistocene. Bulletin of Biological Society of

Washington!-. 259-271.

Ziegler, V. 1984. Family Serpulidae (Polychaeta, Sedentaria) from the

Bohemian Cretaceous Basin. Sbormk Narodmho Muzea v Praze

39B: 213-254.

Ziegler, V. 2006. The fossil serpulids. Univerzita Karlova v Praze,

Pedagogicka fakulta: Praha. 108 pp.

Ziegler, V., and Michalfk, J. 1980. Late Triassic serpulids (Annelida,

Polychaetia, Sedentarida) in the Western Carpathians. Geologicky

Zbormk - Geologica Carpathica 31: 627-640.

Zittel, K. A. von 1880. Handbuch der Palaeontologie. Abt.I. Bd.II.

Protozoa, Coelenterata, Echinodermata und Molluscoidea.

Miinchen, Leipzig: R. Oldenbourg. 765 pp.

Memoirs of Museum Victoria 71:161-168 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Polychaete assemblages associated with the invasive green alga Avrainvillea

amadelpha and surrounding bare sediment patches in Hawaii

WAGNER F. MAGALHAES 1 ’ 2 (http://zoobank.org/urn:lsid:zoobank.org:author:15B35B98-ClA4-4124-A191-8F4A3A5BC8B7) AND

Julie H. Bailey-Brock 1 ’ 2 ’* (http://zoobank.org/urn:lsid:zoobank.org:author:FC91F8C4-D607-4B35-8923-C36889C5577F)

1 Department of Biology, University of Hawaii at Manoa, 2538 McCarthy Mall, Honolulu, Hawaii 96822, USA (wagnerfm@

hawaii.edu; jbrock@hawaii.edu)

2 Water Resources Research Center, University of Hawaii at Manoa, 2540 Dole Street, Honolulu, Hawaii 96822, USA

* To whom correspondence and reprint requests should be addressed. E-mail: jbrock@hawaii.edu

Abstract Magalhaes, W.F. and Bailey-Brock, J.H. 2014. Polychaete assemblages associated with the invasive green alga Avrainvillea

amadelpha and surrounding bare sediment patches in Hawaii. Memoirs of Museum Victoria 71: 161-168.

Avrainvillea amadelpha is one of the most widespread invasive green algae on Hawaii’s reefs, but virtually nothing

is known about its associated fauna. A total of 16 sampling stations were selected: ten stations were distributed in areas

where the invasive alga occurred abundantly (‘A’ stations) and six stations were placed on bare sand patches (‘S’ stations).

Three replicates of ~475 cm 3 each were collected in March 2010 at each station, by hand, using a nalgene corer (11 cm in

diameter by 5 cm deep). Based on the comparison between Avrainvillea amadelpha-dommattd bottoms and the

surrounding bare sediment patches, our study demonstrates that these habitats support a diverse and abundant polychaete

assemblage, with 2621 individuals and 84 species collected. The species Sphaerosyllis densopapillata (34.14%),

Phyllochaetopterus verrilli (8.32%), Protocirrineris mascaratus (5.9%), Exogone longicornis (4.9%) and Syllis cornuta

(4.47%) are the dominant taxa. The non-metric multidimensional scaling clearly separated the ‘A’ stations from the ‘S’

stations. ANOSIM has shown that stations within the a priori- defined group A’ are significantly dissimilar from the

stations in the group ‘S’ (R = 0.527; P = 0.1%). SIMPER analysis has confirmed the slight but greater dissimilarity between

algae and sediment stations (average dissimilarity = 60.12) than within either algae (52.27) or sediment stations (52.04).

The invasive green alga A. amadelpha facilitates the development of above-ground polychaete communities, but the

negative effects of this invader on the infaunal communities should be further investigated.

Keywords invasive species, seaweeds, Avrainvillea amadelpha, Polychaeta, Maunalua Bay

Introduction

Invasive species are considered to be one of the greatest threats

to marine biodiversity (Vitousek et al., 1997) and can act by

altering the physical environments in significant ways for other

species (Cuddington and Hastings, 2004). Macroalgae are

especially worrying invaders because they can develop into

ecosystem engineers, changing food webs and spreading beyond

their initial point of introduction efficiently (Thresher, 2000).

The effects of invasive algae on indigenous communities

are being increasingly well-understood, particularly through

studies concerning Caulerpa species. Caulerpa taxifolia has

spread in temperate regions worldwide and modifies chemical

and physical sediment and water properties (Gribben et al.,

2013). The presence of this species is known to increase the

density of epibiont organisms by facilitating recruitment of

native species (Gribben and Wright, 2006; Bulleri et al., 2010).

However, it may also decrease the density of infaunal

organisms and modify the abiotic environment (Neira et al.,

2005; Gribben et al., 2013). The presence of the invasive

Caulerpa racemosa var. cylindracea in the Mediterranean has

been proven to expand suitable habitat for polychaete worms,

increasing the number of associated species (Argyrou et al.,

1999; Box et al., 2010; Lorenti et al., 2011).

The green siphonous alga Avrainvillea amadelpha

(Montagne) A. Gepp and E. Gepp, 1908 (Order Bryopsidales)

has been reported since the early 1980s from the south-east

shore of Oahu, Hawaii (Brostoff, 1989) and now is considered

one of the most widespread invasive non-indigenous species in

Maunalua Bay (Coles et al., 2002). This species proliferates in

soft bottom habitats, co-occurring in areas that were once

dominated by the endemic Hawaiian sea grass Halophila

hawaiiana (Smith et al., 2002).

Efforts to remove introduced algae from reefs in Kaneohe

Bay and off Waikiki have been ongoing and have achieved

some success (Smith et al., 2004). However, little effort has

162

W.F. Magalhaes & J.H. Bailey-Brock

been made to investigate whether the invertebrate taxa

inhabiting the bottoms dominated by these invasive algae are

composed of native species or introduced species.

Avrainvillea amadelpha mats typically serve as substrates

for many native species of epiphytic algae (Smith et al., 2002),

and this association is known to increase the diversity of

associated faunal assemblages by providing food and shelter

(Johnson and Scheibling, 1987; Duffy, 1990). The physical

complexity of the habitat may also be increased, providing a

refuge from fish predation (Coull and Wells, 1983; Dean and

Connell, 1987) and greater availability of surface area for

recruitment (Connor and McCoy, 1979, McGuinness and

Underwood, 1986). Algal turfs have been shown to reduce

impact from wave exposure (Dommasnes, 1968) and enhance

communities on exposed reefs (Bailey-Brock et al, 1980).

The macrobenthic assemblages associated with invasive

algae in Hawaii are scarcely known, and this study aimed to

provide baseline data on the polychaete worms associated with

A. amadelpha mats and nearby bare sediment patches prior to

removal efforts.

Materials and methods

Study area and sampling design

This study was carried out on nearshore reef flats in Maunalua

Bay on the south shore of Oahu, Hawaii (fig. 1). The area is

predominantly composed of consolidated limestone reef flats

covered by a shallow layer of fine to coarse sand. The reef flats

support abundant growth of the non-indigenous algae Gracilaria

salicornia, Hypnea musciformis and Avrainvillea amadelpha

(Coles etal., 2002).

A total of 16 sampling stations were selected for this study:

ten stations were distributed in areas where Avrainvillea

amadelpha occurs abundantly (A’ stations) and six stations were

placed on bare sand patches (‘S’ stations; fig. 1). Three replicates

of approximately 475 cm 3 each were collected in March 2010 at

each station, by hand, using a nalgene corer (11 cm in diameter

by 5 cm deep). The Avrainvillea amadelpha samples (A’ stations)

were composed of sediment to a depth of 5 cm and the overlying

algae within the corer. The sediment samples (‘S’ stations)

consisted of the top 5 cm of sediment.

All samples were fixed in buffered 4% formalin and Rose

Bengal mixture immediately after sampling for a minimum of

48 h. Organisms were carefully removed from the crevices

and branches of the algae, placed in 70% ethanol, then the

sediments were elutriated over a 0.5-mm sieve and the retained

infauna placed in 70% ethanol. The polychaetes were sorted,

counted and identified to the lowest taxonomic level possible

using compound and dissecting microscopes.

For comparative purposes, 20 samples of Gracilaria

salicornia were collected (ten samples during the summer

months and ten during the winter months of 2009) on the reef in

front of the Natatorium in Waikiki on the south shore of Oahu,

Hawaii. Samples were collected with a nalgene corer (11 cm in

diameter by 5 cm deep). This dataset is part of an unpublished

report by C. Moody, and the samples were donated and the

polychaetes were later identified to species level by the authors.

Data analyses

The replicates within each station were summed, and the

abundance ( N ), species richness (S), and Shannon-Wiener

diversity index (log e; H’), and Pielou’s Evenness (/’) were

calculated for each station. nMDS ordination was constructed

to produce two-dimensional ordination plots to show

relationships between stations in relation to polychaete

abundance and richness.

Figure 1. Map of the study area showing the algae (‘A’ stations; circles) and sediment stations (‘S’ stations; squares).

Polychaetes associated with an invasive alga in Hawaii

163

Table 1. Summary of the results from SIMPER analysis with the species that contributed to up to 60% of the similarity within each group of stations.

Species/contribution to similarity (up to 60%)

‘A’ stations (%)

‘S’ stations (%)

Sphaerosyllis densopapillata (Syllidae)

14.84

16.89

Exogone verugera (Syllidae)

8.34

Branchiosyllis exilis (Syllidae)

7.07

Armandia intermedia (Opheliidae)

6.63

Lysidice nr. unicornis (Eunicidae)

6.19

Scyphoproctus sp. (Capitellidae)

5.71

Perinereis nigropunctata (Nereididae)

5.12

Syllis cornuta (Syllidae)

4.92

8.86

Phyllodoce parva (Phyllodocidae)

4.71

Lumbrineris dentata (Lumbrineridae)

10.12

Exogone longicornis (Syllidae)

9.01

Paraonella sp. (Paraonidae)

8.65

Westheidesyllis heterocirrata (Syllidae)

6.53

A10

2D Stress: 0 14

S4 AS

1.95

2.25

2.12

_S5_

Shannon-Wiener diversity

2.42

1.84

1.87

A10

2.21

: A7 ) 1 59

2.61

f .M '

3.03

2:35

2.59

229

2.83

2D Stress: 014

0.4

1.6

; 2.8

■ 4

0.78

2 49

0.81

S6 ]

0J5

2,31

Number of individuals

A10

. A8

197

323

AT, 290

190'

193

386

ioi

S5i

85 _

Pielou’s Evenness

2D Stress: 0.14

) 40

160

280

J400

2D Stress: 0.14

0.58

: A1

0.59

A10

0.66

A7 0.55

0.80

• 0.1

: 0.4

0.87

0.74

0.86

) 1

0.89

0,79

0.91

088

Figure 2. nMDS ordinations of polychaete assemblages: A, using data of all taxa; B, bubbles indicating abundance in number of individuals; C,

bubbles indicating values of Shannon-Wiener diversity; D, bubbles indicating values of Pielou’s Evenness.

164

W.F. Magalhaes &J.H. Bailey-Brock

An analysis of similarity (ANOSIM) was performed to

test the statistical significance of the a priori- defined groups

(i.e. A’ stations vs. ‘S’ stations). Similarity percentage analysis

(SIMPER) identified those taxa that explained relatively large

proportions of the similarity within a group. All multivariate

analyses were done using the Bray-Curtis similarity coefficient

with non-standardized and fourth root transformed data using

PRIMER 6.0 software.

Results and discussion

A total of 2621 polychaetes representing 84 taxa were

collected. The ‘A’ stations had a total of 64 taxa and 1821

individuals, while the ‘S’ stations had a total of 47 taxa and

800 individuals. The most abundant species were Sphaerosyllis

densopapillata (Syllidae; 34.14%), Phyllochaetopterus verrilli

(Chaetopteridae; 8.31%), Protocirrineris mascaratus

(Cirratulidae; 5.9%), Exogone longicornis (Syllidae; 4.9%) and

Syllis cornuta (Syllidae; 4.47%). Syllid polychaetes comprised

the most abundant and rich polychaete family, with 1517

individuals and 24 species. Syllids are known to be the most

abundant and species-rich polychaete family associated with

Posidonia beds in the Mediterranean (e.g. Gambi et al., 1995).

The non-metric multidimensional scaling clearly separated

the ‘A’ stations from the ‘S’ stations (fig. 2). The Shannon-

Weiner diversity index did not seem to explain many of the

differences between the groups; however, polychaetes from

the ‘A’ stations occurred in greater abundance compared with

the ‘S’ stations, with exception of station S4 (fig. 2).

ANOSIM indicated that stations within the a priori-

defined group ‘A’ were significantly dissimilar from stations in

the group ‘S’ (R = 0.527; P = 0.1%). SIMPER analyses

confirmed the slight but greater dissimilarity between algae

and sediment stations (average dissimilarity = 60.12) than

within either algae (52.27) or sediment stations (52.04). The

syllid Sphaerosyllis densopapillata was the most abundant

species overall and explained 14.82% of the similarity within

the ‘A’ stations and 16.89% within the ‘S’ stations (table 1).

The other top taxa varied greatly between the types of stations

(table 1). Sphaerosyllis densopapillata was removed from the

analysis of similarity to verify the influence of this abundant

species on the dissimilarity between stations. The average

dissimilarity increased between algae and sediment stations

(from 60.12 to 64.5) and within both algae (from 52.27 to 55.6)

and sediment stations (from 52.04 to 56).

Even though there were significant differences between

the stations located on Avrainvillea amadelpha mats and those

sampled on sediments without the algae (ANOSIM), stations

within the algal mats were also dissimilar. This might have

been explained if other variables such as length and density of

algal branches, amount and size of the sediment within the

branches, human disturbance near shore, and nature of the

underlying substrate were measured.

Several polychaete worms, including the tube builder

Mesochaetopterus minutus and the syllid Westheidesyllis

heterocirrata, were predominantly collected from the bare

sediment patches. Mesochaetopterus minutus is a gregarious

worm that forms tufts of sand-covered tubes and is mainly

found on shallow-water reef flats along 0‘ahu’s south shore

(Bailey-Brock, 1979, 1987). This species may be playing an

important role in these assemblages by binding the sediments

loosened by the algal removal efforts in and around their

tubes. Chaetopterids can reach densities of 62,400 per m 2 on

0‘ahu’s south shore, and if they are present in high densities

on the outer reef flats of the area where A. amadelpha has been

removed, they may retain the sediments that would otherwise

be transported closer to the shore (Bailey-Brock, 1979).

Chaetopterid mounds retain a high abundance of polychaetes

but a low diversity, with only 22 species being found by

Bailey-Brock (1979).

The diversity of polychaete species found in Avrainvillea

amadelpha mats is considerably higher than that found in

another invasive alga, Gracilaria salicornia, present in south

Oahu (table 2). Gracilaria salicornia is low growing, less

structured and has small thalli and many branches, as opposed

to A. amadelpha. A total of 15 polychaete species have been

found commonly in both invasive algae, and the syllids were

the dominant family in G. salicornia as well (table 2). The

most abundant polychaetes associated with G. salicornia were

Nereis jacksoni, Syllis cornuta and the ctenodrilid Raphidrilus

hawaiiensis. The ctenodrilid was originally described from

those algal assemblages (Magalhaes et al., 2011) and has been

found in low abundance in association with A. amadelpha at

the study site.

Avrainvillea amadelpha mats are a suitable habitat for

polychaetes at this location, especially for those detritus

feeders favoured by the fine sediment coating accumulated

on the branches and in crevices of the alga. The presence of

the macroalga Caulerpa racemosa has also been shown to

increase the diversity and abundance of polychaetes (Argyrou

et al., 1999; Box et al., 2010). Lorenti et al. (2011) also

observed that polychaetes increased in percentage

contribution to the total macrofaunal diversity after the

introduction of C. racemosa.

The development of above-ground communities are usually

facilitated by the presence of invasive macroalgae because of

the added structure they give to previously unstructured

habitats (Wonham et al., 2005; Gribben et al., 2013). This

unnatural increase in diversity in previously unvegetated

sediments may have detrimental effects, especially below

ground. For instance, the biomass of the invasive Caulerpa

taxifolia has been negatively associated with the abundance of

infaunal organisms (Gribben et al., 2013), and modification of

environmental parameters below ground by invasive species

has also been noted (e.g. Neira et al., 2005).

Current efforts to remove the attached A. amadelpha in the

area of this study may help to recover the previous ecological

state of the local polychaete assemblages, since infaunal

organisms have been known to recover quickly after restoration

of the sedimentological characteristics of the habitat (Dernie

et al., 2003). Further collections after the removal efforts will

be necessary to compare with the results presented herein.

This study was conducted two months before the first effort at

removal of invasive alga from the area and represents

important baseline information for understanding the

resilience of this ecosystem.

Polychaetes associated with an invasive alga in Hawaii

165

Table 2. Taxonomic list of polychaete species organized by family found on bare sediment patches, Avrainvillea amadelpha and from another

invasive alga Gracilaria salicornia.

Avrainvillea

Bare sediments

Gracilaria

amadelpha

salicornia

Amphinomidae

Eurythoe sp.

Linopherus microcephala (Fauvel, 1932)

Ampharetidae

Lysippe sp.

Capitellidae

Capitella jonesi (Hartman, 1959)

Capitellethus cinctus Thomassin, 1970

Heteromastus cf. filiformis (Claparede, 1864)

Notomastus tenuis Moore, 1909

Scyphoproctus pullielloides Hartmann-Schroder, 1965

Scyphoproctus sp.

Chaetopteridae

Mesochaetopterus minutus Potts, 1914

Phyllochaetopterus verrilli Treadwell, 1943

Cirratulidae

Aphelochaeta sp.

Caulleriella bioculata (Keferstein, 1862)

Caulleriella sp.

Cirriformia crassicollis (Kinberg, 1866)

Cirriformia sp.

Monticellina nr. cryptica Blake, 1996

Protocirrineris mascaratus Magalhaes & Bailey-Brock, 2013

Tharyx sp.

Timarete hawaiensis (Hartman, 1956)

Timarete punctata (Grube, 1859)

Cossuridae

Cos sura cf. coasta Kitamori, 1960

Ctenodrilidae

Raphidrilus hawaiiensis Magalhaes, Bailey-Brock & Davenport, 2010

Dorvilleidae

Dorvillea sp.

Protodorvillea biarticulata Day, 1963

Eunicidae

Eunice afra Peters, 1854

Eunice antennata (Savigny in Lamarck, 1818)

Lysidice nr. ninetta Audouin & Milne-Edwards, 1833

Lysidice nr. unicornis (Grube, 1840)

Flabelligeridae

Flabelligeridae gen. sp.

166

W.F. Magalhaes & J.H. Bailey-Brock

Avrainvillea

amadelpha

Bare sediments

Gracilaria

salicornia

Hesionidae

Hesionidae fragment

Lumbrineridae

Lumbrineris dentata Hartmann-Schroder, 1965

Lumbrineris latreilli Audouin & Milne Edwards, 1834

Maldanidae

Axiothella quadrimaculata Augener, 1914

Rhodine sp.

Nereididae

Micronereis sp.

Neanthes arenaceodentata (Moore, 1903)

Nereis jacksoni Kinberg, 1866

Nereis sp.

Perinereis nigropunctata (Horst, 1889)

Platynereis dumerilii (Audouin & Milne Edwards, 1834)

Oenonidae

Arabella sp.

Arabella iricolor (Montagu, 1804)

Opheliidae

Armandia intermedia Fauvel, 1902

Polyophthalmus pictus (Dujardin, 1839)

Orbiniidae

Naineris sp.

Questa caudicirra Hartman, 1966

Questa retrospermatica Giere, Ebbe and Erseus, 2007

Oweniidae

Galathowenia oculata (Zachs, 1923)

Paraonidae

Aricidea sp.

Cirrophorus sp.

Paraonella sp.

Phyllodocidae

Eumida sp.

Phyllodoce parva (Hartmann-Schroder, 1965)

Pilargidae

Synelmis cf. gibbsi Salazar-Vallejo, 2003

Protodrilidae

Protodrilus albicans Jouin, 1970

Sabellidae

Amphiglena mediterranea (Leydig, 1851)

Branchiomma nigromaculatum (Baird, 1865)

Euchone sp.

Polychaetes associated with an invasive alga in Hawaii

167

Avrainvillea

amadelpha

Bare sediments

Gracilaria

salicornia

Sigalionidae

Sigalionidae gen. sp.

Spionidae

Aonides sp.

Laonice nr. cirrata (M. Sars, 1851)

Microspio granulata Blake and Kudenov, 1978

Spio filicornis (Muller, 1776)

Sternaspidae

Sternaspis sp.

Syllidae

Branchiosyllis exilis (Gravier, 1900)

Brania rhopalophora (Ehlers, 1897)

Brania sp.

Exogone longicornis Westheide, 1974

Exogone sp.

Exogone verugera (Claparede, 1868)

Grubeosyllis mediodentata (Westheide, 1974)

Haplosyllis sp.

Myrianida pachycera (Augener, 1913)

Odontosyllis sp.

Opistosyllis sp.

Pionosyllis sp.

Sphaerosyllis centroamericana Hartmann-Schroder, 1974

Sphaerosyllis densopapillata Hartmann-Schroder, 1979

Sphaerosyllis risen Perkins, 1981

Sphaerosyllis sp.

Syllinae juv.

Syllis cornuta Rathke, 1843

Syllis variegata Grube, 1860

Trypanosyllis sp.

Typosyllis aciculata orientalis Imajima & Hartman, 1964

Typosyllis crassicirrata Treadwell, 1925

Typosyllis ornata Hartmann-Schroder, 1965

Typosyllis sp.

Virchowia japonica Imajima & Hartman, 1964

Westheidesyllis heterocirrata (Hartmann-Schroder, 1959)

Terebellidae

Nicolea gracilibranchis (Grube, 1878)

Poly cirrus sp.

Trichobranchidae

Trichobranchus nr. glacialis Malmgren, 1866

168

W.F. Magalhaes & J.H. Bailey-Brock

Acknowledgements

This is contributed paper WRRC-CP-2015-05 of the Water

Resources Research Center and contributed paper 2014-15 of

the Department of Biology, University of Hawaii at Manoa,

Honolulu. B. Dugan and G. Lynch assisted in the sampling,

and the former helped in processing the samples. Cressa

Moody kindly donated her samples for polychaete identification

by the authors. This research was funded by the National

Institutes for Water Resources 104B Project No. 2010HI287B

awarded to J.H. Bailey-Brock. We thank two anonymous

reviewers and the editorial assistance of Dr. Robin Wilson for

improving this manuscript.

References

Argyrou, M., Demetropoulos, A., and Hadjichristophorou, M. 1999.

Expansion of the macroalga Caulerpa racemosa and changes in

soft bottom macrofaunal assemblages in Moni Bay, Cyprus.

Oceanologica Acta 22(5): 517-528.

Bailey-Brock, J.H. 1979. Sediment trapping by chaetopterid

polychaetes on a Hawaiian fringing reef. Journal of Marine

Research 37: 643-656.

Bailey-Brock, J.H. 1987. Phylum Annelida. Pp. 213-454 in: Devaney,

D.M. and Eldredge, L.G. (eds). Reef and shore fauna of Hawaii.

Bishop Museum Press: Hawai‘i.

Bailey-Brock, J.H., White, J.K., and Ward, L.A. 1980. Effects of algal

turf and depressions as refuges on polychaete assemblages of a

windward reef bench at Enewetak Atoll. Micronesica 16(1): 43-58.

Box, A., Martin, D., and Deudero, S. 2010. Changes in seagrass

polychaete assemblages after invasion by Caulerpa racemosa var.

cylindracea (Chlorophyta: Caulerpales): community structure,

trophic guilds and taxonomic distinctness. Scientia Marina 74(2):

317-329.

Brostoff, W.N. 1989. Avrainvillea amadelpha (Codiales, Chlorophyta)

from 0‘ahu, Hawaii. Pacific Science 43: 166-169.

Bulleri, F., Balata, D., Bertocci, I., Tamburello, L., and Benedetti-

Cecchi, L. 2010. The seaweed Caulerpa racemosa on

Mediterranean rocky reefs: from passenger to driver of ecological

change. Ecology 91(8): 2205-2212.

Coles, S.L., DeFelice, R.D., and Eldredge, L.G. 2002. Nonindigenous

marine species at Waikiki and Hawai‘i kai, O'aim, HawaVi. Bishop

Museum Technical Report 25. 245 pp.

Connor, E.F., and McCoy, E.D. 1979. The statistics and biology of the

species-area relationship. The American Naturalist 113: 791-833.

Coull, B.C., and Wells, J.B. 1983. Refuges from fish predation:

experiments with phytal meiofauna from the New Zealand rocky

intertidal. Ecology 64: 1599-1609.

Cuddington, K., and Hastings, A. 2004. Invasive engineers. Ecological

Modelling 178: 335-347.

Dean, R.L., and Connell, J.H. 1987. Marine invertebrates in algal

sucession. II. Tests of hypothesis to explain diversity with

succession. Journal of Experimental Marine Biology and Ecology

109: 217-247.

Dernie, K.M., Kaiser, M.J., and Warwick, R.M. 2003. Recovery rates

of benthic communities following physical disturbance. Journal

of Animal Ecology 72: 1043-1056.

Dommasnes, A. 1968. Variations in the meiofauna of Corallina

officinalis L. with wave exposure. Sarsia 34: 117-124.

Duffy, J.E. 1990. Amphipods on seaweeds: partners or pests?

Oecologia 83: 267-276.

Gambi, M.C., Giangrande, A., Martinelli, M., and Chessa, L.A. 1995.

Polychaetes of a Posidonia oceanica bed off Sardinia (Italy) -

spatio-temporal distribution and feeding guild analysis. Scientia

Marina 59: 129-141.

Gribben, P.E., Byers, J.E., Wright, J.T., and Glasby, T.M. 2013. Positive

versus negative effects of an invasive ecosystem engineer on

different components of amarine ecosystem. Oikos 122: 816-824.

Gribben, P.E., and Wright, J.T. 2006. Invasive seaweed enhances

recruitment of a native bivalve: roles of refuge from predation and

the habitat choice of recruits. Marine Ecology Progress Series 318:

177-185.

Johnson, S.C., and Scheibling, R.E. 1987. Structure and dynamics of

epifaunal assemblages on intertidal macroalgae Ascophyllum

nodosum and Fucus vesiculosus in Nova Scotia, Canada. Marine

Ecology Progress Series 37: 209-227.

Lorenti, M., Gambi, M.C., Guglielmo, R., Patti, F.P., Scipione, M.B.,

Zupo, V., and Buia, M.C. 2011. Soft-bottom macrofaunal

assemblages in the Gulf of Salerno, Tyrrhenian Sea, Italy, an area

affected by the invasion of the seaweed Caulerpa racemosa var.

cylindracea. Marine Ecology 32(3): 320-334.

Magalhaes, W.F., Bailey-Brock, J.H., and Davenport, J.S. 2011. On the

genus Raphidrilus Monticelli, 1910 (Polychaeta: Ctenodrilidae)

with description of two new species. Zootaxa 2804: 1-14.

McGuinness, K.A., and Underwood, A.J. 1986. Habitat structure and

the nature of communities on intertidal boulders. Journal of

Experimental Marine Biology and Ecology 104: 97-123.

Neira, C., Levin, L.A., and Grosholz, E.D. 2005. Benthic macrofaunal

communities of three sites in San Francisco Bay invaded by

hybrid Spartina, with comparison to uninvaded habitats. Marine

Ecology Progress Series 292: 111-126.

Smith, J.E., Hunter, C.L., Conklin, E.F., Most, R., Sauvage, T., Squair,

C., and Smith, C. 2004. Ecology of the invasive red alga Gracilaria

salicornia (Rhodophyta) on 0‘ahu, Hawaii. Pacific Science 58:

325-343.

Smith, J.E., Hunter, C.L., and Smith, C.M. 2002. Distribution and

reproductive characteristics of nonindigenous and invasive marine

algae in the Hawaiian Islands. Pacific Science 56: 299-315.

Thresher, R.E. 2000. Key threats from marine bioinvasions: a review

of current and future issues. Pp. 24-36 in: Pederson, J. (ed.).

Marine bioinvasions. Proceedings of the First National

Conference, January 24-27, 1999. Massachusetts Institute of

Technology, Sea Grant College Program: Boston.

Vitousek, P.M., Mooney, H.A., Lubchenco, J., and Melillo, J.M. 1997.

Human domination of Earth’s ecosystems. Science 277: 494-499.

Wonham, M.J., O’Connor, M., and Harley, C.D.G. 2005. Positive

effects of a dominant invader on introduced and native mudflat

species. Marine Ecology Progress Series 289: 109-116.

Memoirs of Museum Victoria 71:169-176 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Incipient speciation within the Namalycastis abiuma (Annelida: Nereididae)

species group from southern India revealed by combined morphological and

molecular data

Mathan Magesh* 1 , Sebastian Kvist 2 and Christopher J. Glasby 3

1 Department of Aquatic Biology and Fisheries, University of Kerala, Thiruvananthapuram, India, 695581.

2 Museum of Comparative Zoology, Department of Organismic and Evolutionary Biology, Harvard University, 26 Oxford

Street, Cambridge, MA 02138, USA. E-mail: skvist@fas.harvard.edu

3 Museum and Art Gallery of the Northern Territory, GPO Box 4646, Darwin NT 0801, Australia. E-mail:

chris.glasby@nt.gov.au

* Corresponding author: maheshmathan2008@gmail.com

Abstract Magesh, M., Kvist S. and Glasby, C. J. 2014. Incipient speciation within the Namalycastis abiuma (Annelida: Nereididae)

species group from southern India revealed by combined morphological and molecular data. Memoirs of Museum Victoria

71: 169-176.

Namalycastis abiuma (Grube, 1872), originally described from Brazil, comprises a species complex of morphologically

similar forms occurring circumtropically, including India. Apart from the Namalycastis abiuma species group, four other

Namalycastis species are presently known from India: N. indica Southern, 1921, N.fauveli Nageswara Rao, 1981, A. glasbyi

Fernando & Rajasekaran, 2007, and N.jaya Magesh, Kvist & Glasby, 2012. Recent sampling along the southern Indian coast

has uncovered new specimens of the A. abiuma species group. The present study uses combined morphological and molecular

data (DNA barcoding) to explore species boundaries within the complex in southwest India and thereby resolve existing

taxonomic confusion. In order to evaluate morphological variability within the A. abiuma species group, a total of 50

specimens were sampled from different geographical regions in southern India, and assessed using traditional methods. For

18 of the specimens, a 509 bp fragment of COI, the proposed DNA barcoding gene, was sequenced and subjected to tree

reconstruction using both distance methods and maximum parsimony. Based on similarity alone, six different haplotypes

were recognized within the dataset and these were also subsequently recovered as six distinct clades in the parsimony analysis.

There is significant concordance between the morphotypes and the genetic haplotypes, suggesting that significant structural

forces are acting on the specimens at a population level, and that these specimens may even be in an early stage of speciation.

Keywords Nereididae; Namanereidinae; Namalycastis abiuma ; Taxonomy; Phylogeny; Genetic variation; DNA barcoding.

Introduction

The subfamily Namanereidinae (Nereididae) consists of three

genera {Namalycastis Hartman, 1959; Namanereis Chamberlin,

1919; and Lycastoides Johnson, 1903) and is most prominently

known from the tropics and subtropics. Thirty-nine

namanereidin species have been reported throughout the

world and some of these pertain to larger complexes of

problematic species, herein termed “species groups”. The

genus Namalycastis contains 22 species (Glasby 1999a, 1999b;

Magesh et al. 2012; Conde-Vela 2013), four of which have so

far been recorded on the Indian subcontinent. These include

N. indica Southern, 1921, N.fauveli Nageswara Rao, 1981, N.

glasbyi Fernando & Rajasekaran, 2007, and N. jaya Magesh,

Kvist & Glasby, 2012. In addition, there are several records of

the N. abiuma species group in southern India (Glasby 1999a;

Magesh et al. 2012).

The N. abiuma species group concept was introduced by

Glasby (1999a) for a group of individuals that ‘exhibit a greater

amount of morphological variation over their range than is

typical for a namanereidinae species’ (Glasby 1999a: 115). It

was expected that such species groups ‘will probably be found

to contain more than one species with further characterisation

of reproductive mode and genetics’ (R 115); that is, species

groups likely comprise morphologically cryptic species.

Indeed the first cryptic species, N. jaya, was discovered

recently (Magesh et al. 2012). Cryptic species are recognised

170

M.Magesh , S. Kvist & C.J. Glasby

when the species group hypothesis of Glasby (1999) is falsified

by independent data, which in the present study is the DNA

barcode gene. Our concept of species most closely follows the

Synapomorphic Species Concept as defined by Wilkins (2003:

635): ‘A species is a lineage separated from other lineages by

causal differences in synapomorphies’.

Recognition of the Namalycastis abiuma species group

follows Glasby (1999a). It has a noticeably broad diagnosis, but

may be distinguished from many other Namalycastis species by

having brown epidermal pigment on the dorsal side of the body

(including the pygidium), short antennae (not extending beyond

the tip of the palpophore) and coarsely serrated spinigerous

chaetae (but not falcigerous chaetae) in parapodia of the posterior

part of the body. The concept includes several separately

described species including Lycastis meraukensis Horst, 1918

(described from New Guinea), L. nipae Pflugfelder, 1933

(Sumatra), L. vivax Pflugfelder, 1933 (Sumatra), Namalycastis

rigida Pillai 1965 (Philippines) and A. meraukensis var. zeylancia

(Sri Lanka) (Glasby 1999). Although the association of these

species with the N. abiuma species group in Glasby (1999a) was

intended to represent formal synonymy, the fact that the ICZN

rules do not apply to species groups, means that all of these

names, with the exception of the variety N. meraukensis var.

zeylancia (also not covered by ICZN), are currently valid and

potentially available to newly discovered cryptic species.

The most widely reported Namalycastis species in India, N.

indica, is very similar to the N. abiuma species group in external

appearance, and unless chaetal types and distributions are

examined carefully, the two species are very difficult to

separate. Most descriptions of N. indica, in the taxonomic

literature fail to give an adequate account of chaetal types and

distributions and it is therefore quite possible that the two

species have been extensively confused (Glasby 1999).

Doubtful taxonomic references to N. indica include those of

Ghosh (1963), Day (1967), and Sunder Raj & Raj (1987).

Because of this potentially wide confusion of specimens

pertaining to the A. abiuma species group and the morphological

similarity with A. indica , the addition of molecular tools for

separation of species is becoming increasingly pressing. Such

tools, if applied correctly, would enable taxonomists to both

evaluate synonymous taxa and to separate this species complex

into distinct taxa. Thus, studying the genetic variations within

these species groups is important for inferring solid species

diagnoses and in identifying potentially novel species, as well

as addressing the question of how many species ( sensu Wilkins,

2003) are present within these species groups. Here, we shed

some light on part of this issue by examining specimens that

are morphologically compatible with A. abiuma from different

regions across the Indian subcontinent, and use both molecular

and morphological techniques to clarify taxonomic ambiguity.

Materials and methods

Specimen collection

Between January 2008 and December 2009, polychaete worms

were collected from various localities, at varying salinities

and depths, along the southern Indian coast; Kadinamkulam

Lake (depth 2 m), Kayamkulam Kayal (2-3 m), Cochin (Kochi)

estuarine system (3 m), Thoothukudi mangroves (Tamilnadu;

1 m) and the Ariankuppam estuary of Puducherry (0.5 m)

(Fig. 1). The sites were selected based on the habitat suitability

and the presumed presence of Namalycastis spp. For the better

part, specimens were collected from muddy sediments; at

Kadinamkulam Lake, mud was commonly mixed with slightly

rotting organic matter. All specimens have been deposited in

the Zoological Reference Collection of the Zoological Survey

of India, Kozhokode, Kerala, India.

Morphological examinations

Sampling strategies and identifications followed the method of

Glasby (1999a) and Magesh et al. (2012). Descriptions are based

on the same character set used by Glasby (1999a). After securing

tissue for DNA extraction (see below), specimens were relaxed

in isotonic MgCl 2 , quickly submerged in 95% ethanol to evert

the proboscis, fixed in 10% formalin and subsequently

transferred to 70% ethanol. Fixed specimens were then dissected

and the parapodia were mounted in polyvinyl lactophenol on

microscope slides to enable microscopical examinations of the

morphology. Tissues to be used for DNA sequencing were fixed

in 95% ethanol and their further processing is described below.

DNA sequencing and analyses

A total of 18 specimens, identified as the A. abiuma species

group were chosen for the molecular portion of this study and

five specimens, including N.jaya and Platynereis bicanaliculata

(Baird, 1863) were used as outgroup taxa; the trees were rooted

with P. bicanaliculata. A complete list of specimens, sampling

sites, and GenBank accession numbers can be found in Table 1.

Approximately 20-40 chaetigers of the posterior part of the

worms (excluding the pygidium) were used for DNA extraction.

Total genomic DNA was isolated from the specimens following

the extraction protocol of Miller et al. (1988). Partial sequences

of cytochrome c oxidase subunit I (COI) were PCR-amplified

using the primers suggested by Ivanova et al. (2007) (i.e., FRld

[ 5 , xxCXCCACCAACCACAARG AYATYGG-3’] and FRld_

tl [5’- CACCTCAGGGTGTCCGAARAAYCARAA-3’]). The

PCRused 30 cycles of the following protocol: an initial 5 minute

denaturation step at 94°C for all samples, followed by 30

seconds denaturation at 94°C, 30 seconds annealing at 55°C, 2

minutes extension at 72°C and a final 5 minute extension step at

72°C for all samples. PCR products were subsequently checked

on a 2% agarose gel and successful amplifications were gel

eluted using a chromous gel extraction kit (Gel Extraction

SPIN-50, Chromous Biotech, Bangalore, India) following the

instructions given by the manufacturer. The DNA was then

purified using a PureFast Genomic DNA purification kit (Helini

Biomolecules, Chennai, India), cycle sequencing was carried

out using the same primers as above, and ethanol precipitation

prepared the DNA for sequencing. Nucleotide sequencing was

then performed using an ABI 3500 XL Genetic Analyzer

(Applied Biosystems, Foster City, CA). All nucleotide sequences

are deposited at NCBI; accession numbers are presented in

Table 1.

Assembly of forward and reverse strand sequences was

carried out using BioEdit ver. 7.0.5.2 (Hall 1999), and reconciled

sequences were aligned using MAFFT ver. 7 (Katoh & Standley

Incipient speciation in Namalycastis abiuma

171

Andhra Pradesh

Karnataka

Puduchei

Kerala

nwi

Tamil Nadu

★

Mini f y ir*l

(UklHlwnv)

Arabian Sea

Bay of Bengal

Samphng Srte

0 20 40 00 120 160

Kdonvews

Indian Ocean

Figure 1. Map of the collection localities for the specimens of the Namalycastis abiuma species group.

11WU IJWN irt/TH HW*

172

M.Magesh , S. Kvist & C.J. Glasby

2013) applying the L-INS-i strategy and default settings; note

that the final alignment was devoid of gaps such that the

sequences can be treated as pre-aligned. Intraspecific and

interspecific variations were then calculated using MEGA ver.

5.2.2 (Tamura et al. 2011) with the following settings:

uncorrected-p distances, pairwise deletion of gaps and using 1 st ,

2 nd and 3 rd codon positions. A Neighbour-Joining tree was

constructed in PAUP* ver. 2.0bl0 (Swofford 2002) using

uncorrected-p distances. Also, a phylogenetic tree under the

criterion of maximum parsimony was constructed using PAUP,

where a heuristic search was performed employing 1000 initial

addition sequences and TBR branch swapping. Support values

for the nodes were estimated through bootstrap resampling using

100 random addition sequences and the same settings as above.

Results

Morphological analyses

In total, 50 specimens were collected that were identified to

the Namalycastis abiuma species group. These specimens all

fit within the range of the known intraspecific variation of the

species, as follows:

Diagnosis. Brown epidermal pigment dorsally and on pygidium;

prostomium with shallowly cleft anteriorly, antennae extending

short of tip of palpophore; jaws with a single robust terminal

tooth , 4-5 subterminal teeth, 3-5 teeth ensheathed proximally;

notochaetae present or absent; neurochaetae arrangement Type

A sensu Glasby (1999a); subneuroacicular falcigers in

parapodia of chaetiger 10 with blades 4.3-5.7x longer than

width of shaft head and having 4-15 fine to moderate sized

teeth; subneuroacicular falcigers in parapodia of chaetiger 10

with blades 3.7-7.2 x longer than width of shaft head, up to 18

teeth; subneuroacicular spinigers in parapodia of posterior

body with blades coarsely serrated proximally; heterogomph

chaetae with boss not prolonged; pygidium with multi-incised

rim (modified slightly after Glasby 1999a).

Preliminary morphological investigations suggested that

the specimens can be further subdivided into two

morphologically distinct lineages (subgroup 1 and 2). The

morphological and some ecological characteristics of the

subgroups are further discussed below. Within subgroup 1, a

total of four morphotypes could be identified and within

subgroup 2, an additional two morphotypes were found for a

total of six morphotypes among the 50 specimens (Table 1).

Subgroup 1

Thirty-seven out of the 50 specimens were categorized as

subgroup 1 on the basis of morphological characters.

Diagnosis: as for the N. abiuma species group except body

uniform in width anteriorly, tapering gradually posteriorly.

Eyes, 2 pairs, black, arranged obliquely, unequal in size,

posterior pair larger than anterior pair. Posterodorsal tentacular

cirri short and extending posteriorly to end of first chaetiger.

Jaws with, 6 or 7 subterminal teeth and 4 teeth unsheathed

proximally. One or two notochaetae per notopodium. Notopodial

sesquigomph spinigers observed from chaetigers 5-11 until mid

body; spinigers absent in posterior part of body. Supra-

neuroacicular sesquigomph spinigers in chaetiger 10. Supra-

neuroacicular falcigers in chaetiger 10 moderately serrated and

teeth non-uniform in length. Sub-neuroacicular spinigers in

chaetiger 10 with medium or finely serrated blades; blades with

coarse serrations proximally posteriorly from chaetiger 30-120.

Intraspecific variation among morphotypes

Ml. Specimens AQPA1- AQPA 10: Notochaetae present from

chaetiger 8 to mid body, one or two per notopodium, in no

particular order. Jaws with 11 teeth (Fig. 2A).

M2. Specimens AQMM1- AQMM10; AQMM51 - AQMM55:

From fifth chaetiger to mid body, notochaetae single (rarely

two; e.g. AQMM51) or absent in many mid-body parapodia.

Jaws with 9 teeth (Fig. 2C). Number of homogomph spinigers

usually greater than number of heterogomph chaetae; only

subneuroacicular spinigers present in some chaetigers (e.g.

chaetiger 18).

M3.Specimens AQMM82 & AQMM92: Notochaetae single or

absent in posterior podia. Jaws with 10 teeth (Fig. 2B).

M4. Specimens AQMM6 and AQMM61-AQMM65:

Parapodium and dorsal cirrus very wide in middle and posterior

chaetigers (Fig. 2K). Dorsal cirri increase in length posteriorly

(Fig. 2J).

Subgroup 2

Thirteen out of the 50 specimens were categorized as species

group 2 on the basis of morphological characters.

Diagnosis: as for N. abiuma species group except, entire body

with width tapering posteriorly. Antennae extending to tip of

palpophore. Eyes equal or unequal in size (with posterior pair

smaller); sometimes faded or absent.

Posterodorsal tentacular cirri long and extending

posteriorly up to chaetiger 4 or 5. Jaws with 8 teeth (Fig. 2D).

Notochaetae presentfrom chaetiger 10-12. Supra-neuroacicular

falcigers in chaetiger 10 with blades moderately or coarsely

serrated, about 11 teeth. Sub-neuroacicular falcigers in

chaetiger 12 with 14 teeth. Sub-neuroacicular spinigers in

anterior body with blades finely serrated and sub-neuroacicular

spinigers in posterior body with coarsely serrated blades.

Intraspecific variation among morphotypes

M5. Specimens K1-K10; K51-K55: Eyes are faded in a few

specimens (e.g. Kl, K3 and K53), absent in a few specimens

(e.g. K5-10), and merged in a few specimens (Figs. 21, 2E and

2F, respectively).

M6. Specimens K24 and K242: Three eyes present and about

equal in size (Fig. 2G, H). Three acicula (rather than the usual

two) present in chaetiger 10; Figs. 2L and 2M).

DNA barcoding and Neighbour-Joining

A total of 18 specimens were successfully sequenced for a 509

bp region of COI, representing all of the six morphotypes

specified above (M1-M4 in species group 1, and M1-M2 in

species group 2). In addition, COI sequences from Namalycastis

jaya (HQ456363 and JN790065-67) and Platynereis

Incipient speciation in Namalycastis abiuma

173

Figure 2. Selected morphological characters of the various N. abiuma species group morphotypes (M1-M6). A, Ml, jaws with 11 teeth; B, M3,

jaws with 10 teeth; C, M2, jaws with 9 teeth; D, M5 and M6 jaws with 8 teeth; E, M5, specimen with eyes absent; F, specimen with merged eyes;

G-H, M5, specimens with three eyes; I, M5, specimen with faded eyes; J, M4, specimen with the longer tentacular cirri, indicative of species

group 2 (see text); K, M4, specimen with relatively wider parapodium; L-M, M6, specimens showing three acicula; N, multi-incised pygidium.

174

M.Magesh , S. Kvist & C.J. Glasby

bicanaliculata (GU362685) were downloaded from NCBI to

allow for a wider range of interspecific comparisons, as well as

phylogenetic analysis. The final alignment was devoid of

inserted gaps, such that the sequences could be treated as pre¬

aligned. The genetic divergence comparisons between

haplotypes are presented in Table 2. Genetic variation within

the total dataset of W. abiuma’ specimens averaged 0.69% ±

0.21 and ranged between 0 (in several comparisons) and 0.99%

(for specimens AQMM6, AQMM62-63 [haplotype H2] when

compared against K5, K52-53 [haplotype H3]). As a reference,

the average genetic variation between the W. abiuma’

haplotypes and N. jaya, and P. bicanaliculata was 1.42% ±

0.33, and 24.61% ± 0.19, respectively.

As a complement to the genetic distances, the resulting

Neighbour-Joining (NJ) tree is presented in Fig. 3. The tree

includes five main clades, four of which include representatives

of the N. abiuma species group - specimens of N.jaya represent

the remaining clade. These clades correspond to the haplotypes

in the genetic variation analysis. This finding suggests some

level of population structure and possibly incipient speciation

within the specimens of the N. abiuma species complex treated

in the present study. However, at the same time, the clades

recovered in the NJ tree do not entirely reflect the morphotype

separation. Specifically, the clade comprising specimens of

haplotype HI includes specimens displaying three different

morphotypes (M1-M3; Fig. 3). The remaining clades each

include only a single morphotype such that both morphology

and molecules corroborate the separation of members of these

clades.

Phylogeny

Nineteen out of the 509 aligned positions in the final COI

dataset were parsimony informative. The heuristic search

resulted in two equally parsimonious trees and these are

presented in Figs. 4a and b, respectively. The resulting

topologies are largely congruent with that of the NJ tree, as

expected. Bootstrap support (BS) is low across the tree, most

likely owing to the numerous identical haplotypes present in

the dataset, in combination with the low number of parsimony

informative characters. Notably, specimens of the N. abiuma

species group do not form a monophyletic group, since

specimens of N.jaya nest within the clade. In both of the most

parsimonious trees, haplotype H2 (AQMM6, AQMM62 and

AQMM63) is recovered as the sister group to the remaining

taxa with bootstrap support (BS) of 61% (Figs. 4a and b).

However, the trees disagree on the sister group of specimens

pertaining to haplotype HI (AQPA3-5, AQMM5, AQMM7-9,

AQMM52 and AQMM92): in one of the trees, N. jaya is

recovered as the sister group (BS <50%), whereas a clade

containing haplotypes H3 and H4 (K24, K242, K5, K52 and

K53) is recovered as the sister group of haplotype HI in the

remaining tree (BS 56%).

Discussion

In combination with the NJ and parsimony trees, the

intraspecific versus interspecific variation within the dataset

used here conclusively shows that the N. abiuma species group

Figure 3. Neighbour joining tree derived from the COI dataset.

Specimens pertaining to the N. abiuma species group are indicated in

bold font, and morphotype (M1-M6) and haplotype (H1-H4) numbers,

as referred to in text, are denoted by the brackets

harbours more intraspecific diversity than previously noted.

By and large, there is high congruence between the separation

of morphotypes and haplotypes in the dataset. There is some

evidence towards a separation, so far only at a population

level, between haplotype H2 (specimens AQMM6, AQMM62

and AQMM63; also corresponding to morphotype M4) and

the remaining haplotypes. This is supported both by

morphology (specimens within morphotype M4 possess a

wider parapodium and dorsal cirrus in middle and posterior

chaetigers than other specimens), genetic distances (0.88%

average distance when compared to remaining N. abiuma

haplotypes) and phylogenetics (haplotype H2 constitutes a

separate clade, as sister to the remaining specimens).

Comparable patterns of congruence between morphology and

molecules, when focusing on the separation of populations,

were also recovered for haplotypes H3 (corresponding to

morphotype M6) and H4 (corresponding to morphotype M7).

Both of the most parsimonious trees recover specimens of

N. jaya nested within the major clade of the N. abiuma species

group (albeit with negligible support). As a result, the detailed

topology of the trees (Figs. 4a and 4b) further suggests the

separation of haplotype H2 from the remaining taxa. This may

indicate that haplotype H2 may be in a later stage of speciation

than the remaining haplotypes, based on its phylogenetic

Incipient speciation in Namalycastis abiuma

175

(a)

S(honges

AQPA3

AQPAJ

AQPAS

AQMMS

AQMMH

AOMVI7

AQiMMS

AQJHM*

AQHM92

■M3

Nirarulynustis feyu

Kttmalytasili faya

N6tnafyc&iti.iJttya

Nemtdyemtii Ju)u

K33

AQMMifr

AO WWW

AQMM63

Pionmereii tleanafittilosa

Figure 4. A-B shows the two equally parsimonious trees recovered from the phylogenetic analysis based on the COI dataset (length: 153, Cl:

0.896, RI: 0.935). Specimens pertaining to the A. abiuma species group are indicated in bold font, and morphotype (M1-M6) and haplotype (Hl-

H4) numbers, as referred to in text, are denoted. Bootstrap support values above 50% are shown at each node. Branch lengths are drawn

proportional to change.

position in the parsimony trees. However, the average COI

genetic distance between haplotype H2 and the remaining

specimens of the N. abiuma species group is lower than normal

estimations of interspecific divergence (e.g., Hebert et al. 2003a,

2003b; Smith et ah, 2005; Ratnasingham & Hebert, 2007). It

thus seems premature to formally separate haplotype H2 from

the remaining N. abiuma specimens, but our results suggest that

these specimens may be in early stages of speciation.

The material included in the original description of

Namalycastis indica was collected both from Calcutta and

Cochin Backwater (Southern 1921) and specimens from the

different locations differed slightly in their morphology (e.g.

antennae shape, teeth count on jaw and size of tentacular cirri;

Glasby 1999). The present study seems to include both of these

variants as some specimens differed in their possession of

shorter (Kadinamkulam and Cochin) or longer (Kayankulam)

tentacular cirri. However, a number of globally distributed

Namalyastis species have previously been incorrectly described

as distinct separate species, and several of these were later

assigned to the N. abiuma species group (although not formally

synonymised; see Introduction) by Glasby (1999). These

include Lycastis meraukensis (Horst, 1918; Fauvel, 1932),

Lycastis indica (Horst, 1924; Fauvel, 1932; Aziz, 1938; Ghosh,

1963), Namalycastis cf. abiuma (Hutchings & Glasby, 1985),

Lycastis nipae (Pflugfelder, 1933), Lycastis vivax (Pflugfelder,

1933), Lycastis senegalensis (Monro, 1939), Lycastris [sic]

indica (Day, 1951), Namalycastis rigida (Pillai, 1965) and

Namalycastis meraukensis zeylanica (Silva, 1961) (see Glasby

(1999) for a full account of synonyms). Therefore, it would be

premature to conclude that some specimens of the present

study indeed represent both variants found by Southern (1921).

One of the strangest findings of the present study is the

occurrence of three eyes (in one side) and three acicula (10 th

chaetiger) in morphotype M2. This is the first record of a

Namalycastis species possessing such a set of characteristics.

However, a more rigorous and taxon-inclusive morphological

assessment is needed prior to drawing any conclusions. For

example, it is still possible that the polluted environment of the

Kayamkulam collection area is the cause of this oddity. This is

particularly plausible, seeing as the genus already presents

several adaptations of the eyes to low-salinity or semi-terrestrial

habitats (Sadasivan Tampi 1949, Storch & Welsch 1972).

In conclusion, the N. abiuma species group does seem to

possess a higher degree of diversity than currently reflected in

the taxonomy, as was suggested by Glasby (1999). Because of

the somewhat confusing morphology of these species, it is

important that future studies also include molecular

information.

176

M.Magesh , S. Kvist & C.J. Glasby

Acknowledgements

MM thanks the Commonwealth Scientific and Industrial

Research Organization (CSIRO) Australia, and the Australian

Museum, especially Dr. Pat Hutchings, for constant

encouragement and for providing full financial support for

MM’s attendance at the IPC 2013 in Sydney, Australia. The

Wenner-Gren Foundations generously supplied funding for SK.

References

Conde-Vela, V.M. (2013) Namalycastis occulta n. sp. and a new record

of N. borealis (Polychaeta: Nereididae: Namanereidinae) from the

Northwestern Caribbean Sea. Zootaxa 3721, 475-487.

Day, J.H. (1967) A monograph of the Polychaeta of Southern Africa.

Part 1. Errantia. British Museum of Natural History Publication

656, pp. 878.

Fernando, O.J. & Rajasekaran, R. (2007) A new species of

Namanereidinae: Namalycastis glasbyi sp. nov. from Indian

waters. Journal of the Bombay Natural History Society 104, 64-67.

Ghosh, A. (1963) On a collection of Polychaeta from the southeast

coast of India with a new eunicid record. Journal of the Marine

Biological Association, India 5, 239-245.

Glasby, C.J. (1999a) The Namanereidinae (Polychaeta: Nereididae).

Part 1, Taxonomy and Phylogeny. Records of the Australian

Museum, Supplement 25, 1-129.

Glasby, C.J. (1999b) The Namanereidinae (Polychaeta: Nereididae).

Part 2, Cladistic biogeography. Records of the Australian Museum,

Supplement 25, 131-144.

Hall, T.A. (1999) BioEdit: a user-friendly biological sequence

alignment editor and analysis program for Windows 95/98/NT.

Nucleic Acids Symposium, Series 41, 95-98.

Hebert, P. D. N., Cywinska, A., Ball, S. L„ & deWaard, J. R. (2003b).

Biological identifications through DNA barcodes. Proceedings of

the Royal Society of London B: Biological Sciences 270, 313-321.

Hebert, P.D.N., Ratnasingham, S. & deWaard, J.R. (2003a) Barcoding

animal life: cytochrome c oxidase subunit 1 divergences among

closely related species. Proceedings of the Royal Society of London

B: Biological Sciences 270, 96-99.

Hutchings, P.A. & Glasby, C.J. (1985) Additional nereidids (Polychaeta)

from eastern Australia, together with a redescription of Namanereis

quadraticeps (Gay) and the synonymising of Ceratonereis

pseudoerythraeensis Hutchings & Turvey with C. aequisetis

(Augener). Records of the Australian Museum 37, 101-110.

Ivanova, N.V., Zemlak, T.S., Hanner, R.H. & Hebert, P.D.N. (2007)

Universal primer cocktails for fish DNA barcoding. Molecular

Ecology Notes 7, 544-548.

Katoh, K. & Standley, D.M. (2013) MAFFT Multiple sequence

alignment software version 7: improvements in performance and

usability. Molecular Biology and Evolution 30, 772-780.

Magesh, M., Kvist, S. & Glasby, C.J. (2012) Description and phylogeny

of Namalycastis jaya sp. n. (Polychaeta, Nereididae,

Namanereidinae) from the southwest coast of India. ZooKeys 238,

31-43.

Miller, S.A., Dykes, D.D. & Polesky, H.F. (1988) A simple salting out

procedure for extracting DNA from human nucleated cells.

Nucleic Acid Research 16, 1215.

Ratnasingham, S. & Hebert, P.D.N. (27) BOFD: the barcode of life

data system. Molecular Ecology Resources 7,355-364.

Sadasivan Tampi, PR. (1949) On the eyes of polychaetes. Proceedings

of the Indian Academy of Sciences, Series B 29, 129-147.

Smith, M. A., Fisher, B. F., & Hebert, P. D. N. (2005). DNA barcoding

for effective biodiversity assessment of a hyperdiverse arthropod

group: the ants of Madagascar. Philosophical Transactions of the

Royal Society B: Biological Sciences 360, 1825-1834.

Southern, R. (1921) Polychaeta of the Chilka Fake and of fresh and

brackish waters in other parts of India. Memoirs of the Indian

Museum 5, 563-659.

Storch, V. and Welsch, U. (1972) Ultrastucture and histochemistry of

the integument of air-breathing polychaetes from mangrove

swamps of Sumatra. Marine Biology 17, 137-144.

Sunder Raj, S.K. & Raj, P.J.S. (1987) Polychaeta of the Pulicat Fake

(Tamil Nadu). Journal of the Bombay Natural History Society 84,

84-104.

Swofford, D. (2002) PAUP*: phylogenetic analysis using parsimony

(*and other methods). Version 4.0b. Computer software and

manual. Sinauer associates: Sunderland, MA.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. & Kumar,

S. (2011) MEGA5: Molecular Evolutionary Genetics Analysis

using Maximum Fikelihood, Evolutionary Distance, and

Maximum Parsimony Methods. Molecular Biology and Evolution

28, 2731-2739.

Wilkins, J.S. (2003) How to be a chaste species pluralist-realist: the

origins of species modes and the synapomorphic species concept.

Biology and Philosophy 18, 621-638.

Memoirs of Museum Victoria 71:177-201 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Morphology, feeding and behaviour of British Magelona (Annelida: Magelonidae),

with discussions on the form and function of abdominal lateral pouches

KATE Mortimer* (http://zoobank.org/urn:lsid:zoobank.org:author:F524276C-06D3-469A-AB33-0EA577F19F62) AND

ANDREW S.Y. MaCKIE (http://zoobank.org/urn:lsid:zoobank.org:author:3CCFC961-D3C6-48DD-All 1-818870364429)

Department of Natural Sciences, Amgueddfa Cymru - National Museum Wales, Cathays Park, Cardiff CF10 3NP, Wales,

UK (Katie.Mortimer@museumwales.ac.uk, Andy.Mackie@museumwales.ac.uk)

* To whom correspondence and reprint requests should be addressed. E-mail: Katie.Mortimer@museumwales.ac.uk

Abstract Mortimer, K. and Mackie, A.S.Y. 2014. Morphology, feeding and behaviour of British Magelona (Annelida: Magelonidae),

with discussions on the form and function of abdominal lateral pouches. Memoirs of Museum Victoria 71: 177-201.

Observations were made on Magelona johnstoni Fiege, Ficher & Mackie, 2000 and Magelona mirabilis (Johnston,

1865) maintained in a laboratory aquarium. Burrowing, feeding, palp regeneration, lateral pouch function, and behaviour

were studied. The two morphologically similar (and co-occurring) species exhibited different behaviours and feeding

strategies. Individuals of M. johnstoni were seen to undertake lateral sinuous movements of the thorax, both within and

outside the burrow. These movements often occurred simultaneously in several animals, and on occasion, semi- emergent

pairs also made direct thoracic contact. This behaviour generally took place between April and July and was likely

associated with reproduction; published works suggest spawning may take place between May and August. The morphology

and function of abdominal lateral pouches was investigated through SEM images, experimental observation, and

consideration of literature accounts.

Keywords live observation, polychaete, burrowing, feeding, functional biology, lateral pouch, reproduction, palp regeneration,

Magelona johnstoni, Magelona mirabilis

Introduction

The Magelonidae is a small family of polychaete worms, with

around 70 species described worldwide. Most species are

included in the genus Magelona F. Muller, 1858; however, two

further genera have been described, Meredithia Hernandez-

Alcantara & Solfs-Weiss, 2000 and Octomagelona

Aguirrezabalaga, Ceberio & Fiege, 2001.

Magelonids are common in sands and muds, both

intertidally and subtidally; most species occur in shallow

waters (<100 m). They have a characteristic flattened

prostomium, which gives rise to the group’s common name,

the shovelhead worms. Two long papillated palps arise ventral

to the prostomium, one either side of the mouth. Magelonid

bodies are divided into two regions: a thorax of eight or nine

segments, and an abdomen of many segments. Very little

information about the biology, anatomy and behaviour of these

animals exists; most existing knowledge comes from the

works of McIntosh (1877, 1878, 1879, 1911, 1915, 1916) and

Jones (1968). Filippova et al. (2005) investigated the

musculature of Magelona cf. mirabilis by phalloidin labelling

and confocal laser scanning microscopy (cLSM), while Dales

(1962, 1977) and Orrhage (1973) provided details on the

magelonid buccal region and proboscis. Brasil (2003)

examined the phylogeny of the Magelonidae based on external

morphological features. Relatively little is known about the

reproductive biology of the group (Rouse, 2001; Blake, 2006),

and most knowledge of magelonid larval development comes

from Wilson (1982).

Jones (1968) made observations on an unnamed species

of Magelona collected near Woods Hole, stating that it was

“more closely related to, but not identical with, the species

referred to as M. papillicornis F. Muller by McIntosh (1877,

1878, 1879, 1911, and 1915) and other European workers”.

This species was not subsequently formally described. Few

other studies of living magelonids exist. The present study

aims to increase our knowledge of several British magelonid

species: primarily Magelona johnstoni Fiege, Licher &

Mackie, 2000 and Magelona mirabilis (Johnston, 1865).

Most European records of Magelona papillicornis Muller,

1858 (a Brazilian species) have been attributed to these two

species, after the works of Jones (1977) and Fiege et al.

(2000), and therefore the Magelona sp. of Jones (1968) is

likely to share similarities with them and have great relevance

to our study.

178

K. Mortimer &A.S.Y. Mackie

One of the main diagnostic features within the Magelonidae

is the presence or absence of lateral abdominal pouches. Fiege

et al. (2000) described two types of lateral pouch present

within the family:

• 2-shaped pouches occur on the anterior abdomen

and are generally paired on either side of the body.

They are bounded, dorsally and ventrally, by a

cuticular flap, containing a convoluted membrane,

and open anteriorly.

• C-shaped pouches open posteriorly, occurring on

median and posterior abdominal chaetigers. They

are simple, pocket-like, and appear C-shaped when

viewed in cross-section. They may be unpaired,

alternating from one side of the body to the other, on

alternate segments, or paired on consecutive

segments.

Unfortunately, mention of magelonid pouches within

species descriptions has been somewhat vague. Although

Uebelacker and Jones (1984) stated: “In some species, lateral

pouches occur between the parapodia of two consecutive

anterior abdominal parapodia, or anterior to the parapodia of

some or all segments farther back”, it was not until the work of

Fiege et al. (2000) that different pouch morphologies in

magelonids were described more fully. Many species

descriptions prior to this noted only presence or absence,

made no mention whatsoever, or incorrectly reported absence

of pouches. The last two situations have been particularly true

for species where the first pouch appears in the posterior

region of the animal (e.g. Magelona filiformis Wilson, 1959 or

Magelona dakini Jones, 1978—appearing after the 100th

chaetiger, see appendix), or for species described from anterior

fragments only. Reporting of anteriorly opening pouches was

generally more reliable due to their conspicuous nature in

comparison with posteriorly opening pouches. Patterns in

pouch location distribution are reported more widely

nowadays, and, more recently, additional pouch morphologies

have been recognised: e.g. medial slits of posteriorly opening

pouches (Mortimer, 2010: 22).

The function of these lateral pouches is unknown. Fiege et

al. (2000) observed no independent motion of pouches for M.

johnstoni , only contraction and expansion associated with

movement. However, based on a personal communication

from Leslie Harris, they reported irregular pouch contractions

for Magelona sacculata Hartman, 1961, first on the dorsal side

and then on the ventral side. Jones (1968) stated that the

function of pouches in Magelona species would not seem to be

related to reproduction, since they are present in males,

females and juveniles, and neither Jones (1978) nor McIntosh

(1911) found any communication from the interior of the

animal through to the pouches.

To gain a better understanding of the biology of magelonids

and to investigate the possible function of lateral pouches,

detailed observation of live material was made in the

laboratory. Additional study on pouch morphology was made

using Scanning Electron Microscopy (SEM).

Materials and methods

Animal collection

Animals were collected over a 5-month period (November

2012 - April 2013) from three separate beaches (Rhossili

Beach and Oxwich Bay, South Wales; and Berwick-upon-

Tweed, Northumberland, north-east England) at low water (tide

height of 0.9 m or less). Animals were gently removed from the

sediment by hand using wash bottles and pliable forceps, after

digging. Three species were collected: M. johnstoni (fig. 1), M.

mirabilis (fig. 2) and M. filiformis. Animals were placed in

small containers with seawater (a few individuals per container

to prevent entanglement) and kept cool in iceboxes during

transportation. The samples were processed within the

laboratory as soon as possible after collection.

Tank and cooling system

An aquarium tank (45 x 20 x 20 cm), holding ~11 L of artificial

seawater, was chilled by means of a closed water system (fig.

3A). Water was circulated by an AquaManta EFX 200 External

Filter passed through a D-D DC300 aquarium cooler and into a

coiled tube running along the bottom of the tank (kept in place

between two layers of plastic mesh), before returning to the filter

for circulation. A plastic shelf on top of the coiled pipe provided

a flat surface on which smaller observation tanks were placed.

Pipes between the filter, cooler and tank were lagged to prevent

condensation and help maintain the experimental temperature.

The water in the closed system was kept at a constant temperature

(within ±1.5°C), with the aquarium water ~3-5°C higher

(depending on the ambient temperature of the laboratory). The

aquarium temperature was initially set to 6-7°C but was

increased in parallel with sea surface temperatures for

Northumberland as observations progressed (i.e. ranging from

~6°C in winter to ~14°C in summer). A standard aquarium

pump and large air stone was employed to aerate the water and

create a current within the tank.

Capillary tube observations

Two sizes of non-heparinised capillary/melting point tubes (80

mm in length, closed ends removed with a hand-held rotary tool),

with internal diameters of 0.80 mm and 1.1 mm were used. In

general, smaller diameter tubes were used for M. johnstoni and

larger diameter tubes for M. mirabilis. It was important to select

the right diameter tube for each individual; if too large, they were

unable to crawl inside or would not remain inside. If the tubes

were a good fit, then worms would quickly move up the inside,

stopping ~3 cm from the end before looping their palps out (fig.

3B). Bubbles were removed before the addition of animals by

placing a plastic pipette (cut to the right diameter) on the end of

the capillary tube and sucking water through.

In initial experiments, animals were removed from the

sediment and the prostomium placed gently into the end of the

tube using forceps. The worms were then ‘encouraged’ to crawl

in by gently tapping the posterior. However, in later experiments

animals were left in the sediment and the end of a capillary tube

placed near their prostomia. In most cases, they would crawl into

the tubes after a short period of time, decreasing handling and

the likelihood of damage during sediment removal. The capillary

Morphology, feeding and behaviour of Magelona

179

Figure 1. Magelona johnstoni Berwick-upon-Tweed (A, C, D, G: NMW.Z. 2013.037.0018; B: NMW.Z. 2013.037.0001; E, F: NMW.Z.

2013.037.0017; H: NMW.Z. 2013.037.0015): A, whole animal; B, anterior (dorsal view); C, anterior (ventral view); D, anterior (lateral view); E,

palp; F, prostomium (ventral view, showing mouth); G, prostomium (ventral view, ‘proboscis’ everted); H, posterior section of female showing

eggs. All MgCl 2 -relaxed. Photos: A.S.Y. Mackie.

180

K. Mortimer &A.S.Y. Mackie

Figure 2. Magelona mirabilis Berwick-upon-Tweed (NMW.Z. 2013.037.0020): A, whole animal; B, anterior (ventral view); C, palp; D, prostomium

(ventral view, showing mouth); E, posterior. All MgCl 2 -relaxed. Photos: A.S.Y. Mackie.

1 cm

Morphology, feeding and behaviour of Magelona

181

Figure 3. Experimental set-up: A, aquarium tank and cooling system; B, Magelona johnstoni Berwick-upon-Tweed (NMW.Z. 2013.037.0001):

live animal in capillary tube. Photo: A.S.Y. Mackie.

tubes were then placed in small observation tanks within the

main aquarium, some capillary tubes on the bottom of the tank

and others held upright using a small plastic table-shaped holder.

Capillary tubes were removed from the tank at intervals and

viewed under a Leica MZ9.5 zoom microscope.

Additional observations within capillary tubes primed

with a weak carmine or food colouring solution were carried

out under a microscope. Carborundum powder was also tested

(particle size ~36 pm) but proved to be too coarse and dense.

In situ laboratory experiments

Sediment from the sampling site was sieved through a 0.5-

mm sieve to remove macrofauna, while trying to retain the

sediment characteristic of the sample. This was placed into a

182

K. Mortimer &A.S.Y. Mackie

small glass tank (internally 11.3 x 11.3 x 11.5 cm; volume ca.

1470 cm 3 ) and allowed to settle before adding magelonids.

Further sediment was placed on top and allowed to settle in

a fridge before placing into the aquarium. In earlier trials,

worms were placed directly onto the surface of the sediment,

but many were unable to penetrate the surface so this second

technique was adopted. Experiments were carried out in

both still and flowing water to observe any potential

differences in behaviour. The sediment level within the

observation tanks was increased (to 5.5 cm deep, ca. 700 cm 3

volume) during observations between April and June 2013,

both to increase water flow across the sediment and allow a

greater depth for burrowing.

Food was added to the tank at the sediment surface or

around capillary tubes every 4-7 days, using plastic pipettes.

Several food options were utilised: frozen marine

invertebrate aquarium food (Dutch Select foods—food for

invertebrates, marine) and SeAquariums Invertfood liquid

diet (made up of plankton and other essential marine

nutrients). Food was mixed with flocculent material

collected from the surface of the sediment during sampling,

enabling it to sink towards the sediment surface.

Animals were observed for seven months (April-

October) during daylight hours; no observations were made

at night. All experiments were filmed with a miniDV

camcorder, and the resulting footage was observed both at

full speed and in slow motion (10-50% slower). Separate

glass tanks within the main aquarium were utilised, each

containing only one of the species (M. mirabilis or M.

johnstoni ), allowing direct comparison of their behaviour. A

further two smaller tanks were used, one containing animals

that had lost both palps upon collection and one containing

those that had lost only one. Palp regeneration was then

followed over a period of 40 days for M. johnstoni. Animals

were observed using a low-powered zoom microscope

(xl5-30) held horizontally towards the tank. Food colouring

and carmine particles were added to the surface waters of

small isolated tanks holding individual animals, in order to

observe water flow.

Scanning electron microscopy (SEM)

Additional animals collected for SEM were fixed in ca. 6-8%

formaldehyde or glutaraldehyde in seawater. Specimens were

subsequently washed with fresh water, and transferred in an

alcohol series through to 100% ethanol for critical point

drying. They were then Sputter coated before imaging using a

Jeol Neoscope JCM-5000 SEM. Specimens have been

deposited in the National Museum of Wales (NMW), Cardiff.

Current knowledge of pouches in magelonids

All magelonid species descriptions and re-descriptions were

examined for details of pouch presence/absence, pouch type

(anteriorly or posteriorly opening), configuration (paired or

unpaired), pattern (on alternating segments or consecutive

segments) and the segment at which they first occur.

The resulting information was then compiled to identify

groups of species.

Observations and Discussion

Species presence and abundance

Each of the selected sampling sites varied in terms of sediment

characteristics and consequently differed in the species present

and their relative abundances. Magelona johnstoni was most

abundant in the silty fine sands of Berwick-upon-Tweed, while

M. filiformis dominated in the fine sands of Oxwich Bay.

Magelona mirabilis was collected in low numbers at all sites,

but M. johnstoni was absent from collections made at Oxwich

Bay. Magelona were difficult to consistently collect on the

Rhossili Bay shore due to its susceptibility to onshore winds

and waves, though all three species were known to occur there,

and sublittorally (Mackie et al. 2006). Hence, M. johnstoni and

M. mirabilis were conveniently sourced from Berwick-upon-

Tweed, and M. filiformis was collected at Oxwich Bay.

Unfortunately all material of M. filiformis was small and

delicate, and mortality occurred within several days. No

observational data was obtained for this species.

Of the two remaining British species, Magelona alleni

Wilson, 1958 was only recorded once during preliminary

sampling at Mumbles Bay, Swansea (March 2012) and, from

previous collecting (1998-2012), was known to be infrequent

at Berwick-upon-Tweed. Magelona minuta Eliason, 1962 is an

offshore muddy sediment species and was not encountered on

any of the shores.

As previously mentioned, European records of the

Brazilian M. papillicornis actually relate to M. mirabilis or M.

johnstoni, or both. The same situation holds for any pre-2000

account of M. mirabilis (see Fiege et al. 2000). In the following

text, an asterisk identifies these erroneous or suspect citations

as M. papillicornis * or M. mirabilis*.

Burrowing

Burrowing observations for M. johnstoni essentially match

those described by McIntosh (1878; 1911) for M. papillicornis*

and Jones (1968) for Magelona sp. When burrowing, M.

johnstoni moved its prostomium laterally from side to side,

loosening the sediment in front and aiding movement forward.

The everted ‘proboscis’ (see Mortimer et al., 2012 regarding

terminology) was used as an anchor, allowing the body to be

pulled towards the head. The ‘proboscis’ was then retracted,

the prostomium moved forward and the process repeated.

Jones (1968) felt that eversion of the ‘proboscis’ occurred

primarily due to the hydrostatic pressure of the blood, but to a

lesser extent via that of the coelomic fluid. The ‘proboscis’ is

therefore totally essential for burrowing, and if compromised,

would likely be fatal for the worm. This was recognised by

McIntosh (1915), who suggested that the group’s preference

for fine sands may help avoid sharp fragments of coarse gravel

and sand that might damage their proboscides.

Jones (1968) postulated that the hollow cylindroid dorsal

muscular ridges of the magelonid prostomium, which are

provided with longitudinal muscles, were presumably fluid-

filled and likely to provide rigidity during burrowing. During

burrowing, the palps trailed behind the body, but once the worm

was near the sediment surface, the palps looped out from

underneath the body towards the opening. Both M. johnstoni

Morphology, feeding and behaviour of Magelona

183

and M. mirabilis were observed to burrow directly to the surface

of the sediment and then withdraw into the burrow. Alternatively,

they stopped before the surface and moved their palps through

the sediment to the water column. Palp length in living animals

was extremely long (figs 1A-E; 2A), and the worms could stay

well within the burrow with only the last distal sixth of the palps

projecting into the water column (fig. 4A).

In the laboratory, M. johnstoni generally burrowed

horizontally within the sediment. This was consistent with

field observations, collected animals being found with the

same orientation within the sediment at Berwick-upon-Tweed.

To commence feeding, worms then burrowed upwards from

their horizontal position towards the surface, thus, creating an

arched or diagonally shaped burrow opening out into the water

column (fig. 4A). Some variation in burrow shape was

observed, although no U-shaped burrows were seen. McMahon

and Jones (1967) and Jones (1968) suggested that Magelona

sp. constructed vertical burrows. The latter author described

animals burrowing directly downwards once initially placed

into the observation chamber, then after reaching the bottom,

they burrowed up to the surface. Although for our M. johnstoni,

burrow shape was straighter in deeper sediment, strictly

vertical burrows were not usually seen.

Differences in observed behaviours could be due to the

contrasting experimental chambers and the methodology of

both studies. The chamber used by McMahon and Jones (1967)

was constructed from a U-shaped rubber tube clamped between

two pieces of glass plate, which were no more than 0.7-1.0 cm

apart (McMahon pers. comm.), and worms were introduced to

the sediment surface. As stated above, M. johnstoni struggled

to penetrate the sediment when placed directly onto the surface,

therefore additional sediment was allowed to settle upon the

worms after their placement into the cube-shaped tank. This

may have affected the direction of initial travel; however, the

much broader tank would not have constrained the direction of

burrowing. The sediment volume in the observation tank used

here was ~700 cm 3 , allowing ample space for movement in any

direction, unlike the narrow tank of McMahon and Jones

(1967) and Jones (1968). Nevertheless, once settled, M.

johnstoni often burrowed against the glass of the observation

tank, allowing them to be fully observed. Whether this was

fortuitous, the worms were simply burrowing until they reached

the glass, or it was due to an attraction to food accumulated

against the tank sides, was not determined. The undescribed

Magelona from Woods Hole was shown to have U-shaped

burrows (McMahon, pers. comm.), with both ends at the

surface. This warrants further investigation, particularly

between species, and may depend on an ability to burrow

backwards as well as forwards within a burrow.

During feeding and resting within the burrow, the bodies

of both M. mirabilis and M. johnstoni were greatly stretched,

their abdomens somewhat narrower than the thorax. In this

region, only the lamellar tips were in contact with the sides of

the burrow (fig. 6). If disturbed, contraction of their bodies

enabled both species to withdraw quickly into their burrows.

However, neither seemed able to actively burrow backwards.

To change direction, bodies were retracted, bringing the

prostomia under the sediment surface and new burrows were

formed in other directions. Before initiating a new burrow,

individuals blocked the ends of their old burrows by shaking

their prostomia laterally while everting their proboscides.

Burrows were observed to be temporary and worms moved

around, periodically after several hours or days, making new

burrows. Fauchald (1983) observed similar behaviour for M.

sacculata living in sandy substrates off southern and central

California. This species appeared to move through the

sediment on a more or less continual basis. Movement to a new

burrow may be initiated by the need to locate further food

sources. However, M. mirabilis moved around less frequently

than M. johnstoni and was generally much less active.

Permanency of burrows may well be species-specific; species

such as M. alleni and M. cincta Ehlers, 1908 build recognisable

tubes (Mortimer and Mackie, 2009; Mortimer et al., 2012).

Burrows appeared to be maintained by mucus, something

noted previously by Jones (1968) for Magelona sp. and Wilson

(1982) for metamorphosing/metamorphosed M. filiformis, M.

alleni and M. mirabilis *. Wilson further noted that some

larvae used a band of mucus for adhesion in the approximate

region of the ninth adult chaetiger. Interestingly, we have seen

adults of M. alleni, separated from their usual red-purple

papery tube (during the sieving of grab samples) quickly

produce a loose mucus-bound sand tube (pers. obs.). Mucus

secretions for M. johnstoni appeared much greater than those

for M. mirabilis in the laboratory.

The longevity of magelonids kept in glass capillary tubes

was much reduced in comparison with those living unconstricted

in the aquarium sediment. Animals kept in capillary tubes

within the aerated tank lasted about 4 days only. This was in

marked contrast to the success others have had in maintaining

various Spionida for long periods of time (over 4 years) in

capillary tubes within petri dishes (Williams, 2002; Dualan and

Williams, 2011). This dependence on sediment was recorded by

McIntosh (1911), “sand is very necessary for the existence of

this form, for though the animals survive a considerable period

in captivity in vessels filled with pure sea-water, they thrive

much longer amongst fine sand, with a few inches of water over

it”. In our study, one individual kept in a capillary tube held

upright in sediment, survived for over 8 weeks.

Buccal region

The buccal region of M. johnstoni has three lips, one larger

triangular lip above two smaller lateral lips (fig. IF, fig. 5A).

These were seen to expand and separate, revealing a triangular¬

shaped mouth at their centre (fig. 4F). Animals displayed a

‘gulping’ action, apparently sucking in water on opening the

mouth. The surface of the top lip and the area just above in M.

johnstoni is speckled (fig. IF).

Our observations agreed with those of the mouth of M.

papillicornis* as described by McIntosh (1911), “a somewhat

triangular or T-shaped slit surrounded by lips of mucous

membrane, and situated between or very slightly in front of

the bases of the tentacles. The anterior lip is sinuous but

complete, while inferiorly there is a wide fissure (bounded

laterally by prominent margins), which runs a considerable

distance backwards. The lips are very mobile and in life

frequently expand to gulp water.”

184

K. Mortimer &A.S.Y. Mackie

Figure 4. Feeding in Magelona jolinstoni : A, feeding position within the burrow (ventral view), indicating four zones where different methods are

utilised to move food particles along the palp; B, looping of the palp at the surface (zone 1), in order to pass food particles along the palp (lateral

view); C, similar process to that shown in B but utilising coiling of the palp (lateral view, papillae omitted for clarity); D, sequence showing the

process of passing food particles from papillae to papillae along palp in zone 2; E, food particles being passed between papillae of both palps in

zone 3; F, region where food particles are dropped towards mouth (ventral view) in zone 4.

Morphology, feeding and behaviour of Magelona

185

Figure 5. Magelona johnstoni Berwick-upon-Tweed: A, prostomium and first two chaetigers (ventral view), showing mouth surrounded by one

upper (UL) and two lower lips (LL), and the proboscis (Pb, not everted) (NMW.Z. 1999.021.0020a); B, papillae of mid-palp region

(NMW.Z.2013.037.0008c); C, left-hand anteriorly opening pouch located between chaetigers 10 and 11 (lateral view, DF = dorsal flap, VF =

ventral flap, LO = lateral organ, CM = convoluted membrane) (NMW.Z.2013.037.001 lb); D, close-up view of convoluted membrane; E, transverse

section through the body and anteriorly opening pouch situated between chaetigers 10 and 11 (posterior half of pouch and parapodia of chaetiger

11) (NotoL = notopodial lamellae, NeuroL = neuropodial lamellae) (NMW.Z.2013.037.0010c); F, anterior half of same pouch

(NMW.Z.2013.037.0010b). Photos: K. Mortimer.

186

K. Mortimer &A.S.Y. Mackie

Figure 6. In situ picture of the posterior thorax and anterior abdomen of living Magelona johnstoni (chaetigers 7-14, dorsal view).

The buccal region of M. mirabilis (fig. 2D) functioned

differently. When feeding, a more extendable extension

(‘buccal tube’) of the alimentary canal appeared to be present,

and ‘gulping’ was not observed. However, feeding observations

in this species were relatively infrequent and further

investigations are warranted. A ‘buccal tube’ was previously

reported for Magelona cf. agoensis Kitamori, 1967 (Mortimer

et al., 2012: Fig. 4), and the length to which it can be protruded

seems to be species specific.

Palps and feeding

Magelona johnstoni and M. mirabilis both remained well

within their burrows during feeding, projecting only the distal

sixth of their palps into the water column (fig. 4A). This is in

contrast to records by Jones (1968), who stated that once

Magelona sp. worms had reached the surface, they would

withdraw only several millimetres and extend their palps as

much as 15 to 20 mm into the water column. This was

equivalent to one quarter of the worm’s length (McMahon and

Jones, 1967). In general, our animals only extended their palps

up to 4 mm above the sediment surface during feeding. Greater

extensions of the palps above the sediment were observed in M.

johnstoni in still water conditions when the air stone was

turned off, and in these conditions, they would keep the palps

stiff and displayed in a V-shape. McIntosh (1877) stated that

they could extend to two inches (5 cm) in M. papillicornis*,

“with the capability of even greater elongation”. His figure

(McIntosh 1878: pi. XXXVIII, fig. 1) showed three-quarters of

the palp emerging. McIntosh (1911) later noted that Magelona

“projects its extremely elongated tentacles through the aperture

of its tube into the surrounding water, in which they are jerked

to and fro, stand stiffly out, or are gracefully curved and moved

in a serpentine manner here and there over the sand”.

In our studies, the palps of M. johnstoni showed one of

three arrangements when exposed in the water column: stiff

and V-shaped with tips pointing upwards, arched with tips on

the surface on the sediment, or gently waving. When a current

was flowing, M. johnstoni tended to wave its palps gently and

laterally within the water column. The individual palps of

each animal frequently exited the sediment via different holes,

often in different directions. These separate holes were

connected ~5 mm below the sediment surface (fig. 4A). In

capillary tube experiments, palps were extended further

outside to sense the environment (fig. 3B), but were rapidly

withdrawn in response to any vibrational stimuli.

The addition of food particles to the observation tank

caused an instant reaction in M. johnstoni ; palps were waved

more rapidly within the water column and across the surface

of the sediment. Animals hidden within the sediment quickly

responded and many palp tips emerged. Such an immediate

response to food was also noted by Jones (1968). In addition,

the response of M. johnstoni was more marked when food

particles were mixed with flocculent material collected from

the sediment surface at the Northumberland sampling site.

However, no reaction to food was observed in M. mirabilis,

and its palps remained still within the water column, despite

several foods being tested.

We observed some slight differences in feeding between

M. johnstoni (fig. 4A-F) and Magelona sp., as described by

Jones (1986). For M. johnstoni, the distal tips (one-sixth) of the

palps were looped outside the burrow to collect food particles

from both the sediment surface and within the water column.

One palp tip raked the surface, sometimes resuspending food

particles to be picked up by the other palp. Food particles were

moved along the palps quickly, like a ‘Mexican wave’ or

conveyor belt passing particles from one part of a looped palp

to a more proximal adjacent part (fig. 4B). Some animals were

seen to coil their palps into the burrow, bringing food within

(fig. 4C) and accelerating particle transfer. Palp looping was

similar to the food transfer mechanism in the account of Jones

(1968), but coiling was a new observation.

In total, four different areas of food manipulation along

the palp length were recognised for M. johnstoni (fig. 4A):

(1) The emergent distal looping/coiling zone—where

food particles were moved along the palps by large

movements (fig. 4B, C).

Morphology, feeding and behaviour of Magelona

187

(2) The second zone, just below the surface, where each

palp diverged within the sediment—food was

transferred by very small loops of the palps in

conjunction with direct movement by the papillae

(figs IE, 5A). Here, food particles were passed from

papilla to papilla along each palp (fig. 4D).

(3) The third zone, further down the burrow, where the

two palps aligned together in parallel—food particles

were moved cooperatively between the papillae of

both palps (fig. 4E). Particles could be moved using

papillae of just one palp (as in zone 2), but the

cooperative method predominated.

(4) The drop zone, coinciding with the non-papillated

regions of the palps—food particles descended directly

from the rapidly splayed palps to the mouth (fig. 4F).

As they neared the mouth, a ‘gulping’ action aided

consumption of the particles, and as transport of food

particles within this zone was noticeably swift, it was

likely that ‘gulping’ also created a current inward

toward the mouth. No other forms of current generation

(e.g. from pouch/lamellar movements, or lateral body

movements) were observed during feeding.

Once consumed, food particles were readily observed

through the body wall and moved rapidly through the thorax.

However, the thoracic gut transition time increased as more food

was consumed. McMahon and Jones (1967) and Jones (1968)

postulated that there might be a mucus thread aiding the transport

of food particles across the non-papillated region of the palps.

They identified probable mucus-secreting cells at the bases of the

papillae, along the proximal 20% of the palps and on the ventral

surface of the prostomium. Jones (1968) also witnessed a

coordinated movement between food particles moving to the

mouth and along the gut, adding credence to the involvement of

a mucus thread. However, we found no evidence for a mucus

strand for M. johnstoni. Further, movement of particles through

the thorax slowed as feeding progressed, yet movement along the

palps continued as before. Food abundance had a major influence

on feeding. For instance, if a glut of food was present at the

sediment surface, animals continually brought food particles

into the burrow, storing them just above the prostomium. One

individual filled its entire burrow from prostomial tip to sediment

surface with food, which was later fed upon more slowly. Despite

burrows being temporary structures, the burrow structure

around the palps was well maintained during feeding.

On occasion, individuals emerged slightly from the sediment

and moved their palp tips towards the mouth region. This

occurred simultaneously with ‘proboscis’ eversion that created

a channel in which the palp tip was wiped across the mouth. The

function of this behaviour was unclear.

Magelona mirabilis did not feed in the same manner as M.

johnstoni. Its palps remained erect within the water column

and made no response to the addition of food. Only relatively

small movements of the palps were observed, even when water

flow was increased. The species never waved its palps in the

water column, as seen in M. johnstoni, even under comparable

flow rates.

The palps of M. mirabilis (fig. 2A) (particularly the proximal

third) were extremely stiff in comparison with those of M.

johnstoni, even in relaxed animals. The blood vessels within the

palps (compare figs IF, G with 2B, D) were clearly much wider

in M. mirabilis, and this may contribute to their rigidity. The

general ‘feeding’ position within the burrow was similar to that

of M. johnstoni, though M. mirabilis kept its palps closer

together (fig. 7), the papillae (fig. 2C) of each extensively

interlocked.

Then, on day 63, two animals were seen to consume large

amounts of sediment, ignoring the recent addition of food. Their

palps remained stiffly displayed within the water column,

however long thin ‘pellets’ of sediment were brought down to

the non-papillated region of their palps. These pellets were

possibly formed as sediment was squeezed between the

interlocked palps, but this could not be confirmed as the burrows

were only partially visible. On several occasions, individuals

were observed to move their palps backwards and forwards in a

saw-like motion. Pellet movement was rather slow and often

jerky, particularly in the region of the prostomium. This

movement was unlike that observed for M. johnstoni. Again, no

evidence of a mucus string was apparent, although sediment

particles moved as if ‘tugged’ towards the mouth. Consumption

of sediment was slow, with no quick ‘gulping’ action, and

material built up around the mouth region. The ‘mouth’ region

of M. mirabilis seemed to be more extendable than that of M.

johnstoni, protruding more as a tube as it gathered in particles.

Apart from the apparently infrequent sediment ingestion,

another possibility was that M. mirabilis preferentially fed on

minute particles (and/or bacteria) in the water, which were

unable to be seen using the techniques utilised here. This could

explain why the papillae of its palps within the burrow were so

interlocked. There was no evidence that the species employed a

form of mucus-net suspension feeding, as found in certain other

polychaetes (Riisgard and Larsen, 2010), though debris was

seen to become lodged in between and along the length of the

palp tips of M. mirabilis (fig. 7). All experimental individuals of

this species survived over seven months within the tank. Further

investigations with an increased number of animals are needed

before any conclusions about its mode of feeding can be made.

Palps of M. johnstoni appear to be selective in what they

pick up, using the papillae at the palp tips like fingers.

Selectivity of the magelonid diet has been previously suggested

(Hunt, 1925; Linke, 1939), and Fauchald and Jumars (1979)

considered the group selective surface deposit feeders, and that

selectivity may increase within poorly sorted sediments.

However, the possibility of suspension feeding has been

suggested by other authors (see Rouse, 2001). Our observations

have shown M. johnstoni to both capture particles suspended

within the water column as well as from the sediment surface,

an idea previously suggested for M. papillicornis* (Wolff,

1973; Hartmann-Schroder, 1971), thus implying two different

feeding modes.

The constituents of the magelonid diet have been noted by

several authors (McIntosh, 1911; Hunt, 1925; Mare, 1942;

Jones, 1968; Hartmann-Schroder, 1971; Wolff, 1973; Ktihl,

1974) and include detritus, diatoms, organic debris, algal

cysts, spores, foraminiferans, tintinnids, and the larvae of

188

K. Mortimer &A.S.Y. Mackie

Figure 7. Various palp positions observed for Magelona mirabilis from in situ experiments. Third picture depicts debris collecting on and in

between the palps.

crustaceans, molluscs and worms. Bivalve and polychaete

larvae, pelagic eggs and tintinnids have been recorded in the

diets of magelonid larvae (Lebour, 1922; Thorson, 1946;

Smidt, 1951; Kiihl, 1974; Wilson, 1982). Although doubts exist

as to whether natural predation on bivalve larvae is common

(Johnson and Brink, 1998), prevalence may be higher in later-

stage larvae (Wilson, 1982; Johnson and Brink, 1998).

McIntosh (1911) and Mare (1942) additionally reported the

presence of sand, silt and debris, which likely concurs with our

observations for M. mirabilis, and lends support for the

presence of interspecific variation in feeding between

co-existing magelonid species. This, and contributing factors

such as behaviour, size, morphology, habitat, presence/absence

of a tube, and palp morphology (e.g. stiffness/flexibility),

warrants further investigation.

Palp regeneration

Several M. johnstoni lost their palps upon collection, and this

provided an opportunity to monitor their regeneration. All

animals initially stayed well within the sediment and were not

visible for the first few days. By day 3, one individual began

protruding the tip of its prostomium out of the sediment

surface, occasionally everting its ‘proboscis’. This individual

moved fairly swiftly around the tank, repeating this behaviour

in different locations. While at the surface, it created an

inward current toward the mouth by combining ‘gulping’ with

everting and retracting the ‘proboscis’, enabling feeding

despite the loss of palps. Capillary tube experiments confirmed

that conspicuous inward currents could be produced in

this manner.

Palp regeneration progressed at different rates between

animals, and between palps on the same individual (table 1). By

day 29, one pair of palp tips were noticeable protruding out of

the sediment surface (palps now up to nine times prostomial

length), and by day 31, one animal was using its palps to feed.

Although these palps were thinner and shorter than those in

intact animals, they were able to manipulate food particles

effectively and bring food to the mouth, as previously described

for the species (see above). McIntosh (1911) described the

rapidity by which magelonids regenerated their palps, noticing

that within 3 days “the new organs appeared on each side as

short blunt processes into which the blood entered”. This agrees

well with the current observations, which saw short stumps on

every animal within the same period.

During regeneration, individuals were seen to carry out

lateral sinuous movements of the thorax within the burrow.

This was first noticed on day 3 and continued sporadically up

until day 24. The purpose of this behaviour was unclear,

however, magelonid palps are thought to also have a respiratory

function; this will be discussed more fully below.

Observations were also made on individuals that had lost

only one palp. Initially, such animals were observed to stay

close to the sediment surface, with the remaining palp extended

into the water column and waved, as in normal behaviour. Palp

regeneration followed a similar time-scale to that of animals

lacking both palps. By day 8 they were a third of the length of

the prostomium, and by day 18, about twice the length of the

prostomium. By day 36, one regenerating palp was of similar

length to the intact palp (less than one prostomium length’s

difference in size). Single-palp individuals collected food

particles effectively with their remaining palps, using a similar

technique to that seen in zone 2 of intact animals (fig. 4D).

Although transfer of food particles was slower, their feeding

capability did not appear compromised in any other way.

These observations suggest the implication of palp loss in

magelonids is lessened by their ability to continue to feed

either with only one or no palps, and their ability to regenerate

to fully functioning palps within ~30 days.

Sinuous lateral movements

On occasion, M. johnstoni made gentle, sinuous lateral

movements of the thorax within the burrow, often for long

periods. Jones (1968) also observed movements of the anterior

20 to 25 chaetigers of Magelona sp. (~85-100 times per

Morphology, feeding and behaviour of Magelona

189

Table 1. Showing palp regeneration data for three Magelona johnstoni, all of which lacked palps on collection.

Day

Palp length (in prostomium lengths)

Notes

1-2

All animals within the sediment

Stumps

One prostomium protruding just out of the sediment. Very slight lateral

noticeable

movements of body observed.

1/6

All at or near sediment surface.

1/3

2/3

1/6

All animals within the sediment; one just below the surface. Palps regenerating at

different rates.

1/3

Two animals making slight lateral movements within burrow. Animal with

shortest palps protruding prostomium tip just out of sediment.

One animal continuing small lateral movements of the thorax within the burrow.

Another protruding prostomium tip just out of sediment.

3/4

One animal at surface with prostomium tip just emerging from sediment, while

another was undergoing lateral movements of the thorax within burrow.

4,1 Vi

Unequal regeneration of palps occurring on one animal. One animal making

lateral movements within burrow.

No animals at surface or undergoing lateral movements.

One animal making lateral movements.

First observation of palps emerging from the sediment surface. Palps relatively

thin.

Palps appearing equal in length.

Palp tips at surface, first observation of an animal feeding using their palps,

although palps still relatively thin.

~12

Palp tips within water column.

8,2

Palp regeneration uneven within the same animal.

minute), which produced an inward-moving current. Jones

noted that this behaviour was infrequent and postulated that it

was linked to respiration, as occurrence and intensity of this

behaviour increased if the water was allowed to become

deoxygenated. Oxygen levels in our study were always

maintained and we could not confirm this. However, sinuous

movements were seen more frequently in individuals

regenerating palps.

Both Jones (1968) and McIntosh (1911) believed that

magelonid palps had, in part, a respiratory function, on the

basis of their vascular nature and their placement into the water

column. Additionally, when the current within the tank was

halted, individuals extended their palps further into the water,

holding them stiffly upwards. Therefore, a higher occurrence of

these sinuous movements in individuals lacking palps could be

a compensatory response for a loss of respiratory capacity. The

relationship between burrow irrigation and body undulations

has also been reported for other annelids. For example, Wells

(1949) stated that Arenicola marina Linnaeus, 1758 irrigated

their burrows, providing a supply of oxygenated water, using

special waves that travelled along their bodies, usually from

tail to head. Female A. marina could also use an altered form

of this irrigation behaviour during reproductive events

(Hardege and Bentley, 1997), bringing sperm into the burrows.

Lateral movements also occurred outside of the burrow.

These movements were brisk and quite marked, with the sides

of the body almost touching the sediment on both sides, in

contrast to the gentle undulations seen within the burrow.

McIntosh (1911) stated that magelonids protrude their anterior

region from the sand into the water column for aeration and

food, suggesting that the modified chaetae of the 9th chaetiger

aided emergence from the burrow. However, he made no

mention of lateral movements of the body in conjunction with

this behaviour, unlike Jones (1968) who noted this behaviour

in individuals without palps, believing it related to respiration.

This behaviour occurred “even when there appeared to be an

adequate supply of fresh, oxygenated sea water”. This is in

contrast to the current findings, as individuals without palps

generally remained within the sediment, only bringing their

prostomial tips above the sediment surface, and these

movements occurred in individuals with intact palps and in

aerated water, suggesting no link to respiration.

During lateral movements, the lateral abdominal pouches

were generally kept flat against the body wall, and only slight

190

K. Mortimer &A.S.Y. Mackie

movements in response to body movement were observed.

While no sinuous lateral movements of the body were observed

in M. mirabilis, further investigations with an increased

number of individuals are warranted.

Reproductive behaviour?

As stated above, animals periodically extended their thoraxes

out of their burrows/capillary tubes, generally to the thorax/

abdominal junction (but occasionally to approximately

chaetiger 15-20). Individuals would then display lateral

sinuous movements of the thorax outside of the burrow, with

sporadic eversion of the ‘proboscis’. These out-of-burrow

movements often lasted for long periods of time, unless the

animal was disturbed. However, this was an intermittent

behaviour and generally took place during the months of April

to July. No instances of this behaviour occurred after this

period. Lateral movements were witnessed in animals with

both palps intact, and occurred in both still and flowing,

aerated water. Movements were often observed simultaneously

in several animals, and during these periods pairs would often

lean towards each other sometimes with bodies in direct

contact (fig. 8).

During one observation in an isolated tank with slightly

raised water temperature, an individual emerged from its

burrow and commenced sinuous lateral movements of the

thorax, directed towards a second individual believed to be

female. Individual two was just below the surface, but the

palps of each were in direct contact with those of the other.

This occurred for several minutes before individual two

retracted into its burrow, later emerging in another burrow

some 3.5 cm away. Individual one emerged to the approximate

level of chaetiger 15, stretching across the sediment towards

the new position of individual two. Individual two appeared

to respond to these lateral movements, by waving and looping

the palps towards individual one. Individual two remained

within the burrow, just below the sediment surface, but both

individuals commenced entwinement of their palps until the

tips became quite interlocked. After a period of time,

individual two emerged from the burrow, to the approximate

level of chaetiger 5. Cessation of palp entwinement occurred

and individual two disappeared back into its burrow.

Although the exact reason for this is unclear, the individual

may have responded to vibrational stimuli. Individual one

remained on the surface of the sediment for some time,

continuing to stretch towards individual two, making lateral

prostomial movements and eversion of the ‘proboscis’.

Eventually, individual one withdrew into the sand and began

burrowing in another direction. Simultaneously, in this

isolated tank, another pair were observed making lateral

movements of the body, one within the water column and one

within the sediment. The latter individual later emerged

from the burrow and continued moving the thorax outside

the burrow. Four days later, a further two individuals (one

female and one male) carried out lateral movements.

Although, no release of reproductive products was ever

confirmed, the synchronised/reactive behaviour of

individuals outside of the burrow was strongly suggestive of

an involvement in reproduction. The simultaneous spawning

of gametes in broadcast spawners would increase the

probability of egg fertilisation.

Hardege and Bentley (1997) stated that synchronicity of

gamete release within a population was particularly important

for semelparous species, and that environmental factors such

as photoperiod, temperature, lunar periodicity and tidal cycles

may help in the synchronisation of broadcast spawners

(believed to be the case for magelonids, see below). The

observations of synchronised movements as described above

during periods of increased water temperature suggests this is

an important factor triggering this behaviour in magelonids.

In addition, pheromones can play a final part in synchronising

reproduction in both iteroparous and semelparous polychaete

species (Hardege and Bentley, 1997).

One possibility is that lateral movements of the thorax may

be involved in gamete release, either helping bring sperm into

the burrow for egg fertilisation, as seen in female Arenicola

marina (Hardege and Bentley, 1997), or dispersing both eggs

and sperm. Jones (1968) showed that sinuous movements of

the body within the burrow of Magelona sp. produced an

inward current, suggesting that sperm released by the male

could be drawn into the burrow for egg fertilisation. However,

most records suggest that magelonid eggs and sperm are

spawned directly into the water, and sperm structure would

suggest fertilisation outside of the burrow (Blake, 2006;

Rouse, 1999, 2006).

Our video footage of M. johnstoni clearly shows an

exhalent current from the burrow during lateral movements

outside the burrow, and it seems probable that if tubes are

blind-ending, any inward current should circulate around the

burrow and back out. If eggs and sperm are released from the

posterior end into the burrow, then circulatory currents may

help to push them from the burrow into open water.

Reproduction

Eggs were observed in M. johnstoni collected in November

2012 (Rhossili), and March and April 2013 (Berwick-upon-

Tweed), with reproductive animals appearing more fragile

abdominally. Reproductive females were white abdominally, in

stark contrast to the conspicuous green gut (fig. 1H). Eggs were

observed in M. mirabilis from November 2012 (Rhossili) and

April 2013 (Berwick-upon-Tweed), while they were observed

in animals of M. filiformis collected in January, February

(Oxwich Bay) and April 2013 (Berwick-upon-Tweed).

Wilson (1982) collected mature eggs from M. mirabilis*

between May and August, although the best fertilisations

occurred in animals from July and August. This was in

agreement with McIntosh (1877), who stated that M.

papillicornis* was full of ova and sperm at St Andrews in

June, and “the ova and spermatozoa ... attain perfection in

summer and autumn”. McIntosh (1911) stated that ova of a

considerable size were present in large numbers at the end of

June, but those that developed in late autumn did not

successfully produce embryos. Kiihl (1974) suggested that M.

papillicornis* in Elbe, Cuxhaven, Scharnhorn and Gelbsand

reproduced during the summer months. Wilson (1982)

considered the spawning season for M. filiformis in Plymouth

to peak during August, although mature gametes were

Morphology, feeding and behaviour of Magelona

191

Figure 8. Showing two individuals of Magelona jolmstoni simultaneously making lateral sinuous movements of the thorax (outside the burrow)

(dorsal views).

collected between April and October, while M. alleni was

likely to mature in late September or October.

The timing of spawning may be influenced by the

availability of food. Kiihl (1974) suggested that Magelona

larvae were dependent on bivalve larvae of the right size.

Magelona larvae were generally present in the Plymouth

Sound plankton from April to November, but more commonly

from July to October (Wilson, 1982). McIntosh (1915)

encountered Magelona larvae from May-November in St

Andrews, (locality not stated but assumed from McIntosh

1916: pi. XCIV, fig. 17), although numbers were generally

much lower in October and November. Similar timings were

noted by Kiihl (1974) for M. papillicornis* larvae, present

from May to October in polyhaline rivers discharging into the

German North Sea (Elbe, Weser) and the Wadden Sea (Ems).

Magelona juveniles may settle from the plankton by

September, as indicated by samples collected in bottom-nets

(McIntosh, 1915).

Nevertheless, very little is known about magelonid

reproduction (Rouse, 2001). They are believed to be broadcast

spawners, with ect-aquasperm (as defined by Jamieson and

Rouse, 1989) (Blake, 2006; Rouse, 1999; Rouse, 2006). The

mechanism by which Magelona species shed gametes from

their burrows is unknown. Several accounts have suggested

magelonids only reproduce once, with mortality occurring after

spawning. Ripe magelonids can be extremely fragile and, as

also noted by McIntosh (1911), “it is possible that at the

reproductive season degeneration of the organs [palps] may

occur in some instances, or the animals themselves may perish”.

Fauchald (1983) considered M. sacculata to be an annual

species (monotelic/semelparous) with feeding larvae, based

partly on the work by Hannan et al. (1977) in Monterey Bay.

Species activity

Observations show that M. johnstoni is a very active worm in

comparison with the other two species investigated.

Behavioural differences were obvious: M. filiformis was the

most inactive and M. johnstoni the most active. The species

differ markedly in terms of body shape and size: M. filiformis

being very slender and long, comprising of many segments,

while bothM. mirabilis and M. johnstoni are broader animals.

Magelona johnstoni moved around the environment more

192

K. Mortimer &A.S.Y. Mackie

frequently, while M. mirabilis, the larger of the two species,

stayed very still, inhabiting burrows for much longer periods.

Additionally, M. mirabilis appeared much less responsive to

vibrational stimuli than M. johnstoni, which reacted to the

slightest of knocks. Jones (1968) noted that the Magelona sp.

was also extremely sensitive to vibrational stimuli, both within

the sand and in the water column, and stated that its lateral

organs (see figs 5 and 10) shared similarities with those

vibration receptors found in ctenophores and chaetognaths.

Mucus production in M. mirabilis was much lower than in M.

johnstoni during observations. Magelona johnstoni placed in

petri dishes with a small amount of sediment were shown to

cover themselves in a mucus/sediment mixture very quickly,

producing a rudimentary ‘tube’. McIntosh (1915) noted this

behaviour, suggesting that this is “probably to compensate for

the absence of its element”.

Pouches

The most obvious morphological feature separating M.

johnstoni and M. mirabilis is the respective presence or absence

of anteriorly opening abdominal lateral pouches on the anterior

abdomen. The function of these (and other posteriorly directed

pouches) in magelonids has never been resolved, despite much

attention (McIntosh, 1878, 1911; Jones, 1968).

No significant movements of lateral abdominal pouches,

either anteriorly or posteriorly opening forms, were observed

for M. johnstoni during any capillary tube or in situ experiment.

In general, the pouches were kept flat against the body. Any

slight contractions of the anteriorly opening pouches were

attributable to body movements. Lateral movements of the

thorax would cause the lateral edges of the dorsal and ventral

flaps to come together, and when animals lunged forward,

pouches occasionally contracted slightly as the body elongated

and narrowed. Slow-motion video footage also revealed small

pouch contractions as the lumen/ventral vessel of the posterior

region contracted, often propagating a wave down the abdomen.

On occasion, the first pair of anteriorly opening pouches

expanded against the sides of the capillary tubes, but this was

generally restricted to a few individuals in poor condition.

Water flow throughout the capillary tube was produced by

eversion and retraction of the ‘proboscis’, and through lateral

movements of the body. Observations using carmine particles

showed that water movement around the pouches was not

significantly greater than that around parapodia and segments

of other parts of the body. Water flowing along the dorsal and

ventral edges of the body was directed laterally around

parapodia and toward the opening of the pouches (fig. 9). No

additional flow created by pouch function was evident when

water flowed back out.

Possible function of abdominal lateral pouches

Anchor

One hypothesis is that pouch function may be related to

anchorage, particularly during lateral body movements outside

the burrow, from which M. johnstoni emerges to the

approximate level of chaetiger 9 (just above the first pair of

abdominal pouches). Pouches expanded against burrow sides

could help prevent worms being swept away by water

movements. However, healthy M. johnstoni kept their lateral

pouches flat against the body (fig. 6). In addition, burrow

entrances become widened during this behaviour, making

such anchorage unlikely. Posteriorly opening pouches were

also kept flat against the body and were never shown to expand

against the burrow sides.

Propulsion

Another hypothesis is that the contraction of anteriorly

opening pouches could aid movement backwards (perhaps

enhancing rapid retraction when under threat of predation),

with posteriorly opening pouches enabling movement

forwards. No evidence of pouch contraction could be seen in

video of M. johnstoni for either slow or rapid movement,

forwards or backwards. The presence of a medial slit in

posteriorly opening pouches in some species also suggests that

this is an unlikely function.

Reproduction, sperm storage, and brooding

Throughout this study, gametes were present within the body

cavities of Magelona specimens, but no relationships between

gametes and pouches were observed. Jones (1968) doubted

any relationship between pouch function and reproduction

because of their presence in both sexes and in juvenile forms.

Conversely, McIntosh (1877, 1878, 1879) believed that ‘lateral

organs’ (see below) appeared in ripe animals in summer and

autumn. However, it is likely that he was examining two

different species, M. mirabilis and M. johnstoni. As

magelonids are thought to be broadcast spawners with ect-

aquasperm, the likelihood that pouch function is related to

sperm storage is low. Although sperm storage has been

described for some members of the Spionida (see Blake,

2006), such as Streblospio benedicti Webster, 1879,

Pseudopolydora kempi (Southern, 1921), Pseudopolydora

paucibranchiata (Okuda, 1937) and Pygospio californica

Hartman, 1936, sperm receptacles in these species differ

greatly in morphology and show clear connections to the

interiors of the animals concerned. No such connections have

been found in magelonid pouches. Fauchald (1983) stated it

unlikely that M. sacculata (a species with paired anteriorly

opening pouches in the anterior abdomen) brooded its young

due to its large reproductive effort. Nevertheless, pouch

function could be seasonal, and without direct observation of

spawning events, the link between the two cannot be

completely refuted.

Burrow irrigation

Our observations suggest that magelonids use lateral movements

of the thorax within the burrow (rather than contraction and

expansion of pouches) to generate water circulation.

Morphology of pouches

Investigation of pouch morphology along the body of M.

johnstoni supported a graduation between anteriorly and

posteriorly opening pouches, as reported by Mortimer (2010).

Understanding the form of the anteriorly opening pouches has

been extremely difficult due to their apparently complex

Morphology, feeding and behaviour of Magelona

193

Figure 9. Lateral view of Magelona johnstoni between chaetigers 9 (to the left of the picture) and chaetiger 11 (to the right), showing anteriorly

opening abdominal pouches between chaetigers 10 and 11. Arrows indicate water flow around the pouches and lamellae, as observed during

capillary tube experiments.

convolutions. SEM images (fig. 5E-F) of transverse sections

have now shown these to be simpler bags with highly

convoluted surfaces. The convolutions were much greater on

the external surfaces than on the internal ones, and the

membranes themselves were relatively thick. No connections

between pouches and the interior body cavity were apparent.

The inner surfaces of the posteriorly opening pouches seemed

somewhat convoluted as well (fig. 10D-E). The C-shaped flap,

when viewed from a posterior direction, showed the dorsal

and ventral portions to be thicker, with a thinner more textured

section in between, revealing a closer affinity with the

structure of the anteriorly opening forms. At the extreme

posterior end, it was sometimes possible to see a small ‘hole’

(fig. 10A-B) at the intersegmental margin, which from the

study of other partially formed pouches in the region (fig.

10C), we believe represented the initiation of a new pouch.

Pouch distribution

A review of current knowledge of lateral pouches within the

Magelonidae (appendix) revealed several distinct species-groups:

1. Species without pouches (excluded from appendix,

but note pouch absence may be incorrectly reported

in some species).

2. Species possessing both anteriorly and posteriorly

opening pouches, such as M. johnstoni (N.B. species

for which the presence of posteriorly opening

pouches is unknown are highlighted).

3. Species possessing posteriorly opening pouches on

consecutive segments.

4. Species with posteriorly opening pouches on

alternating segments. Pouches are generally unpaired

and alternate from one side of the body to the other.

Some species may have a few consecutive pouches,

amongst the alternating ones.

5. Species with posteriorly opening pouches in the

latter part of the abdomen only.

In groups 3 and 4, pouches are generally present from

chaetigers 20-45. However, in group 5 (perhaps those species

attaining the greatest number of chaetigers), pouches do not

appear until the extreme posterior (i.e. approximately chaetiger

60-80 or later). Groups 3-5 are distinguishable, purely based on

the pattern of pouch location, i.e. unpaired/paired and the

chaetiger on which pouches are first present. However, further

differentiation could be made based on pouch morphology, e.g.

separating those species with medially slit pouches (usually

occurring in those with paired pouches on consecutive segments).

The chaetiger on which anteriorly opening pouches first

occur differs between species, the majority commencing

between chaetigers 11 and 12, but some starting from chaetiger

194

K. Mortimer &A.S.Y. Mackie

Figure 10. Abdominal posteriorly opening pouches from several specimens of Magelona johnstoni : A-B, initiation of new pouches represented

by small ‘holes’ (lateral view) (A: NMW.Z.2013.037.0008e; B: NMW.Z.2013.037.0010d); C, first pouch (~6 chaetigers) from pygidium (lateral

view) (NMW.Z.2013.037.001 Id); D, first pouch from a regenerating tail (ventral/posterior view) (NMW.Z.2013.037.0008c); E, third pouch (~10

chaetigers) from pygidium (posterior view) (NMW.Z.2013.037.001 Id); F, posteriorly opening pouch of an abdominal fragment (lateral posterior

view) (NMW.Z.1998.028). Photos: K. Mortimer.

Morphology, feeding and behaviour of Magelona

195

10 (chaetiger 9 is even reported in a small number of species).

Most anteriorly opening pouches are paired; however, unpaired

pouches are reported in some species, and this warrants

further investigation, as does their number (some species only

have one pair, while in others there are several). At present,

details on the morphology of pouches in described species are

insufficient to be able to further categorise the groups.

‘Lateral organs ’ of McIntosh

Jones (1968) stated that the structures termed ‘lateral pouches’

were equivalent to the ‘lateral organs’ of McIntosh (1879, 1911,

1915). However, according to McIntosh’s accounts (1877,1879),

lateral organs appeared in ripe individuals, suggesting a

connection with reproduction. In his 1877 account under a

section headed ‘Reproductive Organs’, McIntosh states “the

ova and spermatozoa are present in each sex in great abundance

in the posterior region of the body, and attain perfection in

summer and autumn. On the sides of the body, also, peculiar

convoluted organs occur in processes composed of the cuticle,

hypoderm, and basement-tissue”. Similarly in 1879, McIntosh

writes “and in a male loaded with spermatozoa at the same

season, and in which the lateral organs were present, the

diaphanous tapering tips were extended forward nearly to the

cuticle, and curved inward like the horns of the springbok”.

McIntosh (1879) suggested that the appearance of ‘lateral

organs’ caused ‘a curious change’, in which cephalic vessels

became abbreviated and the direction of blood flow at the base

of the prostomium was modified, further stating that there was

a greater diversity in cephalic vessels in animals bearing

‘lateral organs’. McIntosh does not refer to lateral organs in his

1911 account, but does note ‘peculiar structures’ that occur on

either side of the body in males and females with developed

sexual products, on many of the posterior segments. Curiously,

he states that these structures invariably occur on the segment

immediately behind the mouth, stating: “and in this it first

attains perfection”. ‘Lateral organs’ are figured in McIntosh

(1878: pi. XXX, fig. 7) and clearly show anteriorly opening

paired pouches located between the 10th and 11th chaetigers.

Also figured, is a transverse section through the body wall and

‘lateral organ’ (pi. XXXIV, fig. 2) from the anterior abdominal

region, which shows a dorsal and ventral flap with convoluted

membrane. There is some doubt about which species McIntosh

studied: although originally identified as M. papillicornis,

most European records have been referred to either M.

johnstoni or M. mirabilis. Fiege et al. (2000) reviewed

specimens collected by McIntosh at St Andrews, referring

them to M. mirabilis, and McIntosh’s 1916 drawing certainly

shows an anterior abdomen lacking anteriorly opening pouches.

Yet, the pouches drawn by McIntosh (1878) are indicative of M.

johnstoni, although no locality was given for this particular

specimen. McIntosh (1915) stated that “on the sides of the

posterior region, from the twenty-fifth or twenty-sixth segment

backward, are the peculiar glandular organs (pouch-like) which

occupy the lateral region of each segment”. Abdominal pouches

do not occur in M. mirabilis until approximately chaetiger 80

(see Fiege et al. 2000: 226 and Appendix), but posteriorly

opening pouches are present in M. johnstoni from around

chaetiger 20. As these two species were not differentiated until

2000, it is extremely likely that McIntosh was observing the

two morphologically similar and co-existing species M.

johnstoni and M. mirabilis under the name of M. papillicornis.

Hence, the occurrence of ‘lateral organs’ was actually an

unrecognised species-specific character, and not related to

reproduction. Although McIntosh did not always state the

location of specimen collection, references to St Andrews

throughout his accounts exist (1877, 1878, 1911, 1915), and text

clearly states that specimens possessing ‘lateral organs’ were

present alongside specimens without.

Acknowledgements

The authors would like to thank Jason Williams (Hofstra

University), Carol Anne Simon (Stellenbosch University),

Greg Rouse (Scripps Institution of Oceanography) and Adriana

Giangrande (Universita del Salento) for their advice, Daniel

Martin and Joao Gil (Centre d’Estudis Avan§ats de Blanes) for

provision of papers, and Peter Howlett, Anna Holmes, Teresa

Darbyshire and Catalena Angele (National Museum Wales)

for their help with photography, SEM and care of animals

under observation. Particular thanks go to Robert McMahon

(The University of Texas at Arlington) for his personal

communications on his observations of Magelona sp. from

Woods Hole.

References

Aguirrezabalaga, F., Ceberio, A., and Fiege, D. 2001. Octomagelona

bizkaiensis (Polychaete: Magelonidae) a new genus and species

from the Capbreton Canyon (Bay of Biscay, north-east Atlantic).

Journal of the Marine Biological Association of the United

Kingdom 81: 221-224.

Blake, J.A. 2006. Chapter 13. Spionida. Pp. 565-638 in: Rouse, G.W.

and Pleijel, F. (vol. eds). Reproductive biology and phytogeny of

Annelida. Science Publishers Inc.: Enfield New Hampshire.

Bolivar, G.A., and Lana, PC. 1986. Magelonidae (Annelida:

Polychaeta) do litoral sudeste do Brasil. Neritica 1: 131-147.

Brasil, A.C. dos S. 2003. Filogenia de Magelonidae Cunningham &

Ramage, 1888 (Annelida-Polychaeta) com base na morfologia

externa. Tese de Doutorado, Setor de Ciencias Biologicas-

Zoologia, Universidade Federal do Parana. 113 pp.

Buzhinskaja, G.N. 1985. Polychaeta of the shelf off south Sakhalin and

their ecology. Issledovaniya Fauny Morei 30: 72-224 (in Russian).

Clarke, D.T., Paterson, G.L.J., Florence, W.K., and Gibbons, M.J. 2010.

A new species of Magelona (Polychaeta: Magelonidae) from

southern Namibia. African Natural History 6: 77-82.

Dales, R.P. 1962. The polychaete stomodeum and the inter¬

relationships of the families of Polychaeta. Proceedings of the

Zoological Society of London 139(3): 389-428.

Dales, R.P. 1977. The polychaete stomodeum and phylogeny. Pp. 525-546

in: Reish, D.J. and Fauchald, K. (eds). Essays on polychaetous

annelids in memory of Dr. Olga Hartman. Allan Hancock

Foundation, University of Southern California: Los Angeles.

Dualan, I.V., and Williams, J.D. 2011. Palp growth, regeneration, and

longevity of the obligate hermit crab symbiont Dipolydora

commensalis (Annelida: Spionidae). Invertebrate Biology 130(3):

264-276.

Ehlers, E. 1908. Die bodensassigen Anneliden aus dem Sammlungen

der deutschen Tiefsee-Expedition. Wissenschaftliche Ergebnisse

der Deutschen Tiefsee-Expedition auf dem Dampfer “Valdivia”

1898-1899 16: 1-167.

196

K. Mortimer &A.S.Y. Mackie

Eliason, A. 1962. Undersokningar over Oresund. XXXXI Weitere

Untersuchungen liber die Polychaetenfauna des Oresunds. Lunds

Universitets Arsskrift, N.F. Avd. 2 58: 1-98.

Fauchald, K. 1983. Life diagram patterns in benthic polychaetes.

Proceedings of the Biological Society of Washington 96(1):

160-177.

Fauchald, K., and Jumars, P.A. 1979. The diet of worms: a study of

polychaete feeding guilds. Oceanography and Marine Biology

Annual Review 17: 193-284.

Fiege, D., Licher, F., and Mackie, A.S.Y. 2000. A partial review of the

European Magelonidae (Annelida: Polychaeta): Magelona

mirabilis redefined and M. johnstoni sp. nov. distinguished.

Journal of the Marine Biological Association of the United

Kingdom 80: 215-234.

Filippova, A., Purschke, G., Tzetlin, A.B., and Muller, M.C.M. 2005.

Reconstruction of the musculature of Magelona cf. mirabilis

(Magelonidae) and Prionospio cirrifera (Spionidae) (Polychaeta,

Annelida) by phalloidin labeling and cLSM. Zoomorphology 124:

1 - 8 .

Gallardo, V.A. 1968. Polychaeta from the Bay of Nha Trang, South

Viet Nam. Naga Report 4(3): 35-279.

Glemarec, M. 1966. Les Magelonidae des Cotes de Bretagne.

Description de Magelona wilsoni n. sp. Vie et Milieu 17: 1077-

1085.

Gravier, C. 1905. Sur les annelides polychetes de la Mer Rouge

(Cirratuliens, Spionidiens, Ariciens). Bulletin du Museum

d’Histoire Naturelle 11(1): 42-46.

Gravier, C. 1906. Contribution a l’etude des annelides polychaetes de

la Mer Rouge. Nouvelles Archives du Museum d’Histoire

Naturelle, Paris, Ser. 4 8: 123-236, pis 1-9.

Hannan, C.A., Hulberg, L.W., Mawn, K.M., and Nybakken, J.W. 1977.

A study to develop standard procedures for life history analysis of

benthic invertebrates for biological monitoring in marine and

estuarine environments. Moss Landing Marine Laboratories,

California State University Consortium: Moss Landing,

California. 217 pp.

Hardege, J.D., and Bentley, M.G. 1997. Spawning synchrony in

Arenicola marina: evidence for sex pheromonal control.

Proceedings of the Royal Society of London, Series B 264:

1041-1047.

Hartman, O. 1936. New species of Spionidae (Annelida Polychaeta)

from the coast of California. University of California Publications

in Zoology 41(6): 45-52.

Hartman, O. 1944. Polychaetous annelids from California, including

two new genera and nine new species. Allan Hancock Pacific

Expeditions 10: 239-304.

Hartman, O. 1961. Polychaetous annelids from California. Allan

Hancock Pacific Expeditions 25: 1-226.

Hartmann-Schroder, G. 1971. Annelida, Borstenwiirmer, Polychaeta.

Die Tierwelt Deutschlands 58: 1-594.

Hernandez-Alcantara, P, and Solis-Weiss, V. 2000. Magelonidae

from the Mexican Pacific and Northern Gulf of Mexico, with the

description of a new genus ( Meredithia ) and four new species. In:

Reish, D. J. and Lana, P. (eds). Proceedings of the 6th International

Polychaete Conference, Curitiba, Brazil, 1998. Bulletin of Marine

Science 67: 625-644.

Hunt, J.D. 1925. The food of the bottom fauna of the Plymouth fishing

grounds. Journal of the Marine Biological Association of the

United Kingdom 13: 560-599.

Jamieson, B.G.M., and Rouse, G.W. 1989. The spermatozoa of the

Polychaeta (Annelida): an ultrastructural review. Biological

Reviews 64: 93-157.

Johnson, K.B., and Brink, L.A. 1998. Predation on bivalve veligers by

polychaete larvae. Biological Bulletin 194: 297-303.

Johnston, G. 1865. A catalogue of the British non-parasitical worms

in the collection of the British Museum. Trustees of the British

Museum: London. 365 pp.

Jones, M.L. 1963. Four new species of Magelona (Annelida,

Polychaeta) and a redescription of Magelona longicornis Johnson.

American Museum Novitates 2164: 1-31.

Jones, M.L. 1968. On the morphology, feeding, and behavior of

Magelona sp. Biological Bulletin 134: 272-297.

Jones, M.L. 1977. A redescription of Magelona papillicornis F.

Muller. Pp. 247-266 in: Reish, D. J. and Fauchald, K. (eds). Essays

on polychaetous annelids in memory of Dr. Olga Hartman.

Printed for the Allan Hancock Foundation. University of Southern

California: Los Angeles, CA.

Jones, M.L. 1978. Three new species of Magelona (Annelida,

Polychaeta) and a redescription of Magelona pitelkai Hartman.

Proceedings of the Biological Society of Washington 91: 336-363.

Kitamori, R. 1967. Magelonidae (Polychaetous annelids) from Japan,

including the description of a new species. Bulletin of Tokai

Regional Fisheries Research Laboratory 50: 49-54.

Kiihl, H. 1974. Uber Vorkommen und Nahrung der Larven von

Magelona papillicornis O.F. Muller (Polychaeta Sedentaria) im

Miindungsgebiet von Elbe, Weser und Ems. Berichte der Deutsche

Wissenschaftlichen Kommission fur Meeresforschung, Berlin

23(3): 296-301.

Lebour, M.V. 1922. The food of planktonic organisms. Journal of the

Marine Biological Association of the United Kingdom 12:

644-677.

Linke, O. 1939. Die Biota des Jadebusenwattes. Helgolander

Wissenschaftliche Meeresuntersuchungen 1: 201-348.

Linnaeus, C. 1758. Systema naturae per regna tria naturae, secundum

classes, ordines, genera, species, cum characteribus, differentiis,

synonymis, locis. Editio decima, reformata. Laurentius Salvius:

Holmiae. ii, 824 pp.

Mackie, A.S.Y., James, J.W.C., Rees, E.I.S., Darbyshire, T., Philpott,

S.L., Mortimer, K., Jenkins, G.O., and Morando, A. 2006. The

Outer Bristol Channel Marine Habitat Study. Studies in marine

biodiversity and systematics from the National Museum of Wales.

BIOMOR Reports 4: 1-249 and A1-A227, + DVD-ROM (2007).

Mare, M.F. 1942. A study of a marine benthic community with special

reference to the micro-organisms. Journal of the Marine

Biological Association of the United Kingdom 25: 517-554.

McIntosh, W.C. 1877. On the structure of Magelona. Annals and

Magazine of Natural History, Ser. 4 20: 147-152.

McIntosh, W.C. 1878. Beitrage zur Anatomie von Magelona.

Zeitschrift fur Wissenschaftliche Zoologie 31: 401-472.

McIntosh, W.C. 1879. On the circulatory system of Magelona. Journal

of Anatomy and Physiology 13(3): 331-345.

McIntosh, W.C. 1911. On the structure of Magelona. Annals and

Magazine of Natural History Ser. 8, 7: 417-457 (Translation of

McIntosh, 1878).

McIntosh, W.C. 1915. A monograph of the British marine annelids.

Vol. Ill. Part I. Text. Polychaeta. Opheliidae to Ammocharidae.

The Ray Society: London.

McIntosh, W.C. 1916. A monograph of the British marine annelids.

Vol. III. Part II. Plates. Polychaeta . Opheliidae to Ammocharidae.

The Ray Society: London.

McMahon, R.F., and Jones, M.L. 1967. Observations on feeding in

Magelona sp. Biological Bulletin of the Marine Biological

Laboratory, Woods Hole 133: 476.

Mohammad, M.-B.M. 1970. On two new polychaetous annelids from

Kuwait. Zoologischer Anzeiger 185: 303-307.

Mohammad, M.-B.M. 1973. New species and records of polychaete

annelids from Kuwait, Arabian Gulf. Zoological Journal of the

Linnean Society 52: 23-44.

Morphology, feeding and behaviour of Magelona

197

Monro, C.C.A. 1933. The Polychaeta Sedentaria collected by Dr. C.

Crossland at Colon, in the Panama region, and the Galapagos

Islands during the expedition of the S.Y. ‘St. George’. Proceedings

of the Zoological Society of London 1933: 1039-1092.

Mortimer, K. 2010. Magelonidae (Polychaeta) from the Arabian

Peninsula: a review of known species, with notes on Magelona

tinae from Thailand. Zootaxa 2628: 1-26.

Mortimer, K., Cassa, S., Martin, D., and Gil, J. 2012. New records and

new species of Magelonidae (Polychaeta) from the Arabian

Peninsula, with a re-description of Magelona pacifica and a

discussion on the magelonid buccal region. Zootaxa 3331: 1-43.

Mortimer, K., Gil, J., and Fiege, D. 2011. Portuguese Magelona

(Annelida: Magelonidae) with a description of a new species, a

re-description of Magelona wilsoni Glemarec, and a key to adult

Magelonidae from European waters. Italian Journal of Zoology

78 (Suppl. 1): 124-139.

Mortimer, K., and Mackie, A.S.Y. 2003. The Magelonidae (Annelida:

Polychaeta) from the Seychelles, with the description of three new

species. In: Sigvaldadottir, E., Mackie, A.S.Y., Helgason, G.V.,

Reish, D. J., Svavarsson, J., Steingrfmsson, S. A. and Gudmundsson,

G. (eds). Advances in polychaete research. Hydrobiologia 496(1-

3): 163-173.

Mortimer, K., and Mackie, A.S.Y. 2006. The Magelonidae (Annelida:

Polychaeta) from the Seychelles. 2. Description of four additional

species, three new to science. In: Sarda, R., San Martin, G.,

Lopez, E., Martin, D. and George, D. (eds). Scientific Advances in

Polychaete Research. Scientia Marina 70(S3): 125-137.

Mortimer, K., and Mackie, A.S.Y. 2009. Magelonidae (Polychaeta)

from Hong Kong, China; with discussions on related species and

redescriptions of three species. In: Maciolek, N.J. and Blake, J.A.

(eds). Proceedings of the Ninth International Polychaete

Conference. Zoosymposia 2: 179-199.

Muller, F. 1858. Einiges fiber die Anneliden fauna der Insel Santa

Catharina an der brasilianischen Kfiste. Archivfiir Nat urgeschichte

24:211-220.

Nateewathana, A., and Hylleberg, J. 1991. Magelonid polychaetes

from Thailand, the Andaman Sea, with descriptions of eight new

species. In: Petersen, M.E. and Kirkegaard, J.B. (eds), Systematics,

biology and morphology of world Polychaeta. Proceedings of the

2nd International Polychaete Conference, Copenhagen, 1986.

Ophelia Suppl. 5: 169-184.

Okuda, S. 1937. Spioniform polychaetes from Japan. Journal of the

Faculty of Science, Hokkaido University, Ser. 6 Zoology 5(3):

217-254.

Orrhage, L. 1973. Two fundamental requirements for phylogenetic

scientific works as a background for an analysis for Dales (1962)

and Webb (1969) theories. Zeitschrift fur Zoologische Systematik

und Evolutionsforschung 11: 161-173.

Riisgard, H.U., and Larsen, PS. 2010. Particle capture mechanisms in

suspension feeding invertebrates. Marine Ecology Progress

Series 418: 255-293.

Rouse, G.W. 1999. Polychaeta, including Pogonophora and

Myzostomida. Pp. 81-124 in: Jamieson, B.G.M. (ed.).

Reproductive biology of invertebrates, Vol. IXB. Progress in

Male Gamete Ultra structure and Phytogeny. Oxford and IBH

Publishing Co.: New Delhi.

Rouse, G.W. 2001. Magelona Mfiller, 1858. Pp. 261-263 in: Rouse,

G.W. and Pleijel, F. (authors), Polychaetes. Oxford University

Press: Oxford.

Rouse, G.W. 2006. Chapter 3. Annelid sperm and spermiogensis. Pp.

45-76 in: Rouse, G.W. and Pleijel, F. (eds). Reproductive biology

and phytogeny of Annelida. Science Publishers Inc.: Enfield New

Hampshire.

Smidt, E.L.B. 1951. Animal production in the Danish Waddensea.

Meddelelser fra Danmarks Fiskeri- og Havunders0gelser 11(6):

151 pp.

Southern, R. 1921. Polychaeta of the Chilka Lake and also of fresh and

brackish waters in other parts of India. Memoirs of the Indian

Museum 5: 563-659.

Thorson, G. 1946. Reproduction and larval development of Danish

marine bottom invertebrates, with special reference to the

planktonic larvae in the sound (0resund). Meddelelser fra

Danmarks Fiskeri- og Havunders0gelser. Ser.: Plankton 4: 7-523.

Uebelacker, J.M., and Jones, M.L. 1984. Family Magelonidae. 7.1-

7.29 in: Uebelacker, J.M. and Johnson PG. (eds). Taxonomic guide

to the Polychaetes of the Northern Gulf of Mexico. Final report to

the Minerals Management Service, contract 14-12-001-29091.

Barry A. Vittor & Associates: Mobile, Alabama.

Webster, H.E. 1879. The Annelida Chaetopoda of New Jersey. Annual

Reports of the New York State Museum of Natural History 32:

101-128.

Wells, G.P. 1949. Respiratory movements of Arenicola marina (L.):

intermittent irrigation of the tube, and the intermittent aerial

respiration. Journal of the Marine Biological Association of the

United Kingdom 28: 447-464.

Wesenberg-Lund, E. 1949. Polychaetes of the Iranian Gulf. Danish

Scientific Investigations in Iran 4: 247-400.

Williams, J.D. 2002. The ecology and feeding biology of two Polydora

species (Polychaeta: Spionidae) found to ingest the embryos of

host hermit crabs (Anomura: Decapoda) from the Philippines.

Journal of Zoology, London 257: 339-351.

Wilson, D.P 1958. The polychaete Magelona alleni n. sp. and a re¬

assessment of Magelona cincta Ehlers. Journal of the Marine

Biological Association of the United Kingdom 37: 617-626.

Wilson, D.P. 1959. The polychaete Magelona fliformis sp. nov. and

notes on other species of Magelona. Journal of the Marine

Biological Association of the United Kingdom 38: 547-556.

Wilson, D.P. 1982. The larval development of three species of

Magelona (Polychaeta) from localities near Plymouth. Journal of

the Marine Biological Association of the United Kingdom 62:

385-401.

Wolff, W.J. 1973. The estuary as a habitat: an analysis of data on the

soft-bottom macrofauna of the estuarine area of the Rivers Rhine,

Meuse, and Scheldt. Zoologische Verhandelingen. Uitgegeven

Door Het Rijksmuseum van Natuurlijke Histoire te Leiden 126:

1-242.

Zhou, J., and Mortimer, K. 2013. A new species of Magelona

(Polychaeta: Magelonidae) from Chinese coastal waters. Journal

of the Marine Biological Association of the United Kingdom

93(6): 1503-1510.

198

K. Mortimer &A.S.Y. Mackie

Appendix.

All known information from literature records on the presence, morphology and pattern of lateral abdominal pouches within the

Magelonidae. Key to categories: 1) species in which pouches are reported as absent (not included in table); 2) species possessing

both anteriorly and posteriorly opening pouches (presence of posteriorly opening pouches unknown/not confirmed in some

species + ); 3) species with paired posteriorly opening pouches on consecutive segments; 4) species with unpaired posteriorly

opening pouches alternating from one side of the body to the other, on alternate segments (sporadic pouches on consecutive

segments may be present); 5) species with posteriorly opening pouches in the latter part of the abdomen only.

Species

Notes

Chaetiger of

first

Record

Category

appearance

Magelona sp. of

Jones (1968)

Paired anteriorly opening pouches between chaetigers

10 & 11.

Jones (1968)

Unpaired pouches, approximately every 4th chaetiger,

alternating from one side of the body to the other.

20-23

Magelona sp. A

Large, paired pouches.

Uebelacker and Jones

(1984)

Posteriorly opening pouches, unpaired on alternate

chaetigers, on alternating sides of the body.

*Notes only paired and unpaired C configuration

pouches.

*Brasil (2003)

Magelona sp. B

Large, paired pouches.

Uebelacker and Jones

(1984)

Posteriorly opening pouches, unpaired on alternate

chaetigers, on alternating sides of the body.

18-26

*Notes only paired and unpaired C configuration

pouches.

*Brasil (2003)

M. cincta Ehlers,

1908

C configuration, unpaired on alternate chaetigers and

alternate sides of the body, based on a single specimen

from Mozambique. Not observed on holotype

(specimen short anterior fragment).

Mortimer and Mackie

(2009)

M. conversa

Mortimer & Mackie,

2003

2 configuration, paired (11, 14, 17, 20). Unpaired

pouches on alternate chaetigers and alternate sides of

the body.

Mortimer and Mackie

(2003)

^Several unpaired pouches very large, more akin to 2

configuration pouches.

23-26

Mortimer et al. 2012*

M. cornuta

Wesenberg-Lund,

1949

C configuration, paired, on consecutive segments,

medially slit, edges of which are surrounded by thicker

cuticle (based on specimens from Hong Kong, not

observed on short holotype).

~41

Mortimer and Mackie

(2009)

M. crenulata Bolivar

& Lana, 1986

Bolsas genitais pareadas no setfgero lie nao pareadas

nos setfgeros 20 e 28 [paired genital bags on setiger 11

and unpaired on chaetigers 20 to 28].

11; 20-28

Bolivar and Lana

(1986)

^Paired and unpaired 2 configuration.

*Brasil, 2003

M. crenulijrons

Gallardo, 1968

C configuration, unpaired, on alternate chaetigers and

alternate sides of the body. Not originally described,

but present on type material.

25* based on

Hong Kong

specimen

Mortimer and Mackie

(2009)

Morphology, feeding and behaviour of Magelona

199

Species

Notes

Chaetiger of

first

Record

Category

appearance

M. dakini Jones, 1978

Unpaired, alternating from one side of the body to the

other, irregularly located on chaetigers.

101-117

Jones (1978)

^Unpaired C configuration pouches.

*Brasil (2003)

M. debeerei Clarke et

al., 2010

2 configuration, paired between chaetigers 10 & 11 and

14 & 15, unpaired pouches present between 13 & 14 in

some specimens. C configuration not observed

Clarke et al. (2010)

M.filiformis Wilson,

1959

C configuration occurring at the extreme posterior end,

unpaired, on alternate segments and alternating from

one side of the body to the other. Not recorded in

original description and reported as absent in Fiege et

al. (2000) and Brasil (2003).

This study

M. gemmata

Mortimer & Mackie,

2003

C configuration, paired, on consecutive segments

Mortimer and Mackie

(2003)

Magelona sp. G

Posteriorly opening pouches, paired, on consecutive

segments.

27-28

Uebelacker and Jones

(1984)

2/3?

^Paired, 2 configuration pouches present.

*Brasil (2003)

M. hartmanae Jones,

1978

Unpaired, initially on alternate segments and alternate

sides of the body. However, variation in pattern occurs

more posteriorly. Occasional pouches on consecutive

segments.

42-48

Jones (1978)

^Unpaired C configuration pouches present.

*Brasil (2003)

M. heteropoda

Mohammad, 1973

2, paired, ^membrane on both sides of holotype

presumed missing.

Mohammad (1973),

synonymised with M.

obockensis , see

Mortimer (2010)

C configuration, unpaired, more or less alternating

between chaetigers and side of the body. Pouches quite

large, expanded more dorsally and ventrally, often

convoluted.

M. johnstoni Fiege et

al., 2000

2, those between 10 & 11 paired, then several pouches

occur either paired or unpaired. Some variation in

patterns.

(9)10

Fiege et al. (2000)

C configuration, unpaired, *on alternate segments and

alternating sides of the body.

~20

^Present study

Magelona sp. L

Posteriorly opening pouches, paired on consecutive

segments.

28-31

Uebelacker and Jones

(1984)

^Paired C configuration pouches.

*Brasil (2003)

M. lusitanica

Mortimer et al., 2011

Unpaired posteriorly opening pouches, alternating from

one side of the body to the other, either on consecutive

segments or every other. Pattern varies along body.

Mortimer et al. (2011)

M. mahensis

Mortimer & Mackie,

2006

Unpaired C configuration pouches present, on alternate

chaetigers, on alternate sides of the body, “Often more

or less folded, with thicker cuticle on edges of fold and

thinner cuticle inside. Edges of fold can be abutting or

overlapping.”

Mortimer and Mackie

(2006)

200

K. Mortimer &A.S.Y. Mackie

Species

Notes

Chaetiger of

first

Record

Category

appearance

M. mirabilis,

(Johnston, 1865)

C configuration pouches present, paired, occurring on

every 3 or 5 segments for the neotype.

~78

Fiege et al. (2000)

^Paired C configuration pouches present.

*Brasil (2003)

M. montera

Mortimer et al., 2012

Posteriorly opening, paired pouches on consecutive

segments. “Pouches appear as simple folds, split

medially with thicker cuticle surrounding edges”.

Mortimer et al. (2012)

M. obockensis

Gravier, 1905

2, paired between chaetigers 11 & 12. Unpaired,

anteriorly opening pouches present on one specimen,

more closely resembling posteriorly opening pouches.

Mortimer (2010);

Gravier (1906)

C configuration pouches, unpaired, alternating from

one side of the body to the other, usually on alternate

segments, “often quite large, more expanded both

dorsally and ventrally, often convoluted”. Mortimer

(2010) suggested this represented a graduation between

the two pouch morphologies along the body.

17-27 1

^ased on senior

author’s notes on

syntype material

*Only paired C configuration pouches present.

*Brasil (2003)

M. pacifica Monro,

1933

Paired posteriorly opening pouches, on consecutive

segments. Medially split, with thicker cuticle

surrounding edges.

36-40

Mortimer et al. (2012)

M. parochilis Zhou &

Mortimer, 2013

Paired, anteriorly opening pouches between 11 & 12

and 14 & 15 (occasionally between 17 & 18).

Zhou and Mortimer

(2013)

Unpaired posteriorly opening pouches, on alternate

chaetigers, alternating from one side of the body to the

other.

M. pectinata

Nateewathana &

Hylleberg, 1991

Large lateral pouches usually present between

chaetigers 11 & 12 and 13 & 14. Other records of

pouches present between chaetigers 10 & 11 and 12 &

13, 20 & 21, and 23 & 25. Smaller sporadic pouches are

recorded for the posteriori

10/11

Nateewathana and

Hylleberg (1991)

M. pitelkai Hartman,

1944

Posteriorly opening, unpaired, on alternate segments,

alternating from one side of the body to the other.

64-84

Jones (1978)

M. pulchella

Mohammad, 1970

C configuration, initially alternating and unpaired, then

paired on consecutive segments. In the posteriormost

region they are unpaired on consecutive segments,

alternating from one side to the other.

Mortimer (2010)

3/4

M. rioja Jones, 1963

Pouches present in posterior region, occurring in a

sporadic and irregular pattern; they “appear to be

identical with similar structures described by Hartman

(1961) for Magelona sacculata and others”.

Jones (1963)

^Paired and unpaired £ configuration pouches.

*Brasil (2003)

M. sacculata

Hartman, 1961

“Conspicuous pouched membranes, first present behind

the modified ninth segment, occur also between

segments 10 and 11, and at irregular intervals in

abdominal segments”. Note: original figure only shows

pouches between segments 10 and 11 (paired).

9/10?

Hartman, 1961

^Paired and unpaired pouches of both morphologies

present.

*Brasil (2003)

Morphology, feeding and behaviour of Magelona

201

Species

Notes

Chaetiger of

first

appearance

Record

Category

M. sachalinensis

Buzhinskaja, 1985

Large paired pouches between chaetigers 11-12 and

further irregular pouches, which may occur either

singly or paired + .

Buzhinskaja (1985)

M. tinae

Nateewathana &

2, paired.

Nateewathana and

Hylleberg (1991)

Hylleberg, 1991

C configuration, unpaired, roughly on every other

segment, alternating between sides of the body.

Pouches quite large, often convoluted.

Mortimer (2010)

M. wilsoni Glemarec,

1966

Posteriorly opening, unpaired, alternating from one

side of the body to the other. Pattern irregular,

sometimes on consecutive segments, sometimes

alternately (description based on a Gulf of Lions

specimens, not observed in type material).

Mortimer et al. (2011)

Memoirs of Museum Victoria 71:203-216 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

The identity of juvenile Polynoidae (Annelida) in the Southern Ocean revealed

by DNA taxonomy, with notes on the status of Herdmanella gracilis Ehlers

sensu Augener

Lenka Neal 1 , Helena Wiklund 1 , Alexander I. Muir 1 , Katrin Linse 2 and Adrian G. Glover 1 *

1 Department of Life Sciences, The Natural History Museum, Cromwell Road, London SW7 5BD, UK Email: a.glover@nhm.ac.uk

2 British Antarctic Survey, High Cross Madingley Road, CB3 0ET, Cambridge, UK Email: kl@bas.ac.uk

* To whom correspondence and reprint requests should be addressed. E-mail: a.glover@nhm.ac.uk

Abstract Neal, L., Wiklund, H., Muir, A.I., Linse, K. and Glover, A.G. 2014. The identity of juvenile Polynoidae (Annelida) in the

Southern Ocean revealed by DNA taxonomy, with notes on the status of Herdmanella gracilis Ehlers sensu Augener.

Memoirs of Museum Victoria 71: 203-216.

Using molecular data (COl, 16S and H3 genes), we provide evidence for a long-held view that Southern Ocean

scaleworms (Polynoidae) morphologically agreeing with Herdmanella gracilis sensu Augener, 1929 Ehlers sensu Augener

are in fact juveniles of another species. The problematic genus Herdmanella is declared a nomen dubium. Importantly, at

least two species were identified; one adult counterpart is a common circumpolar species, Austrolaenilla antarctica

Bergstrom, 1916, and the other is of an as yet unknown identity. More adult counterparts are likely to be discovered with

greater sequencing effort and larger taxon coverage. We have discovered a great genetic diversity within the A. antarctica

clade in the COl gene, and future studies may elucidate if this represents a cryptic species. Currently, we adopt a conservative

approach and suggest that given low diversity in mtl6S and complete identity in H3 genes, this clade represents a single

species, with only the specimen from South Georgia likely deserving the status of a cryptic species, as shown by haplotype

network analysis. High mtDNA diversity in populations of Antarctic scaleworms may be linked to habitat fragmentation

during recent glacial periods. Our study also highlights the importance of identifying juvenile specimens correctly in order

to understand ecological processes such as the apparent high productivity in the Amundsen Sea region.

Keywords Antarctica, Polychaete, DNA barcoding, marine diversity, population genetics, deep sea, cryptic species

Introduction

Exploration of our still largely unknown oceans continues to

yield new taxonomic discoveries, mostly resulting in

descriptions of new species. However, increased collecting

effort, combined with new molecular tools, also provides an

opportunity to address longstanding problems in taxonomy.

Molecular taxonomy in general, and ‘DNA barcoding’ (Hebert

et al., 2003) in particular, has grown quickly as a discipline in

the past decade. Despite important problems with this

approach (e.g. Meier et al. 2008; Collins and Cruickshank,

2012; Bergsten et al., 2012; Srivathsan and Meier, 2012), DNA

barcoding has become an important tool in a diverse range of

biological disciplines. In taxonomy, it has been primarily

implemented for problems of species identification and species

delimitation (see e.g. Monaghan et al., 2006; Vogler and

Monaghan, 2007; Hamilton et al. 2011). Additionally, DNA

barcoding has proved successful in linking different

developmental stages of the same species in a wide range of

animal taxa, such as shrimps (Shank et al., 1998), beetles

(Ahrens et al., 2007), marine invertebrates (Webb et al., 2006;

Heimeier et al., 2010; Bracken-Grissom et al., 2012) and fish

(Pegg et al., 2006; Valdez-Moreno et al., 2010).

In the marine environment, plankton and nekton

collections commonly include larval and juvenile

developmental stages that differ from their adult counterparts

in their morphology. Early taxonomists, often unaware of the

existence of the larval stages, sometimes misidentified these

morphologies as independent adult lineages (Bracken-Grissom

et al., 2012). Past approaches to these problems included

rearing experiments in aquaria (Richards and Saksena, 1980;

Haynes, 1982) or in situ (Haynes, 1979). However, this

approach is not always practical and requires a collection of

live larvae. Often, if specimens were primarily collected for

other types of studies, such as biodiversity surveys, they may

not have been collected live and a molecular approach

therefore represents an alternative tool for identification of

larval stages.

204

L. Neal, H. Wiklund, A.I. Muir, K. Linse &A.G. Glover

For over 100 years, the polynoid species Herdmanella

gracilis Ehlers, 1908 presented a problem for polychaete

taxonomists. Ehlers (1908) described this species upon

examination of a number of specimens collected from deep

water (1500-2000 m) off the coast of East Africa (in the

Indian Ocean) during the Valdivia expedition 1898-99. It is not

clear if a type specimen of this species was deposited, but no

types are known to exist (Pettibone, 1976). Given the small

size of this species (1.5 mm long, 15 segments, 8 pairs of

elytra), it has long been suggested that it represents a juvenile

form of an otherwise benthic species. Ehlers (1908) expressed

some reservations: “... it is not impossible (even though in my

opinion improbable) that it is a juvenile of a known species

...” but proceeded with formal description anyway. His

decision to assign this species to the genus Herdmanella

Darboux, 1899 was never properly explained. Later, Monro

(1930) suggested H. gracilis could be a juvenile stage of the

polynoid Antinoe pelagica, now known as Austrolaenilla

pelagica Monro (1930) from the Southern Ocean. Hartmann-

Schroder (1974) considered Herdmanella gracilis to be the

juvenile of a species related to the polynoid genus Harmothoe,

a view supported by Pettibone (1976), who considered H.

gracilis to be a doubtful species belonging to the subfamily

Harmothoinae (now Polynoinae, see Muir, 1982). Once

recognised as a valid species, Augener (1929) identified small

polynoids from the Weddell Sea as Herdmanella gracilis, and

in doing so expanded its range to the Southern Ocean,

proposing that it could be a very widespread form that can

presumably live in the tropical deep sea as well as the shallow

high-latitude regions. This resulted in H. gracilis being listed

in Polychaeta Errantia of Antarctica , an atlas compiled by

Hartman (1964).

Further, the new species Herdmanella aequatorialis St0p-

Bowitz, 1991 has been described from off West Africa

(equatorial Atlantic Ocean) at 300 m depth. St0p-Bowitz

(1991) recognised that, given the small size of the single,

damaged specimen, it may be a juvenile, but unable to assign

it to any other known genera, and given its similarity to H.

gracilis, he proceeded with erecting a new species in the genus

Herdmanella. The two species H. gracilis and H. aequatorialis

are currently regarded as the only valid species in Herdmanella,

although this itself is a problematic genus (its status is

addressed in the Discussion section of this paper). The other

species previously referred to this genus, Herdmanella nigra

Hartman, 1967, has been transferred to Bathyeliasona by

Pettibone 1976.

As part of the 2005 BIOPEARL I expedition to the Scotia

Sea (Linse, 2008) and the 2008 BIOPEARL II expedition to

the Amundsen Sea in west Antarctica (fig. 1, table 1), a large

number of polychaete worms were collected (Linse et al.,

2013; Neal et al., in prep.). Polynoidae were particularly

abundant in the Amundsen Sea (n > 5000) and were represented

by 23 species. Currently there are about 66 recognised

polynoid species in the Southern Ocean (WoRMS, 2013), and

hence the Amundsen Sea collection represents a reasonable

coverage of the polynoid diversity of this region. A large

number (>2000) of these individuals were small polynoids

either considered to be indeterminable juveniles or to be

representatives of the small-sized species Herdmanella gracilis

(based on locality we consider these Herdmanella gracilis

Ehlers sensu Augener, 1929, rather than Ehlers, 1908). As

specimens were preserved both for molecular studies in

ethanol and for morphological studies in formaldehyde, there

was an opportunity to use molecular taxonomy methods to

analyse the validity of the species determination of H. gracilis,

to examine the genetic heterogeneity in populations, and to

commence investigation of the ecological significance of this

abundance of juvenile Polynoidae.

Methods

Field methods

The macrobenthic samples were collected by epibenthic

sledge (EBS) during the BIOPEARL I and II expeditions with

RRS James Clark Ross (JR144 and JR179) (fig. 1, table 1). The

EBS (for a detailed description see Brenke (2005)) consists of

an epi- (lower) and a supra- (upper) net, each with an opening

of 100-cm width and 33-cm height, 500-pm mesh size on the

sides and ending in cod ends with a mesh size of 300 pm. The

EBS was hauled over the seabed at 1 knot for 10 min. On deck,

the samples of the first 1000-m and 1500-m and the first two

500-m EBS hauls per station were immediately fixed in 96%

pre-cooled ethanol and kept for 48 h in -20°C for later DNA

extraction, while the samples of the remaining 500-m, 1000-m

and 1500-m EBS hauls per station were fixed in 4%

formaldehyde for morphological analysis.

Morphological investigation

Where possible, live specimens were examined aboard ship,

with sorted samples being preserved individually and images

taken on ship with a Nikon Coolpix camera mounted on a

Leica stereo microscope. In the laboratory, Leica MZ6 and

DM5000 stereo and compound microscopes were used to

further identify polynoid specimens. Images of these

specimens were captured using a Zeiss V.20 and AxioCam

HRc, and a Leica DFC 480 dedicated camera system connected

to the DM5000.

Molecular work

In total, DNA was extracted from 33 ingroup specimens.

Eleven specimens morphologically agreed with Herdmanella

gracilis Ehlers sensu Augener, 1929, 19 with Austrolaenilla

antarctica, three with A. pelagica (table 2). Eight outgroup

sequences were included (table 2.) Five outgroup sequences

were obtained from GenBank and three were generated as a

part of wider polynoid study (Wiklund et al., in prep.). Based

on the availability of sequences, we included other species

currently in the subfamily Polynoinae ( Harmothoe fuligineum

(Baird, 1865), Harmothoe oculinarum (Storm, 1879), Bylgides

groenlandicus (Malmgren, 1867), Antarctinoe ferox (Baird,

1865), Malmgrenia mcintoshi (Tebble & Chambers, 1982)), as

well representatives of three other subfamilies ( Macellicephala

violacea (Levinsen, 1887), Eulagisca gigantea Monro, 1939,

and Lepidasthenia berkeleyae Pettibone, 1948).

DNA was extracted from parapodia with a DNAeasy Tissue

Kit (Qiagen) following the protocol supplied by the manufacturer.

DNA taxonomy and the identity of Herdmanella gracilis (Polynoidae) in the Southern Ocean

205

60 & W-

80°W*

100°W-

South

Georgia

r*'. South Sandwich

\ ' Islands

Shag

Rocks #

Scotia

i Sea

South

Orkney

Islands

Falkland

Islands,

Weddell

Sea

■ Sou ths

'America

Antarctic;

Peninsula

Bellingshausen

Sea

BI03

Bim

Amundsen

Sea

20°W

40 W

-70 D S

80°S

120 fi W

140A/V

160 S W

Figure 1. Map showing sampling localities. Black circles refer to BIOPEARL I samples, grey circles to BIOPEARL II samples, grey square to

ANDEEP III samples and black triangle to ANDEEP-SYSTCO samples.

206

L. Neal, H. Wiklund, A.I. Muir, K. Linse &A.G. Glover

Table 1. Details of sampling stations used in this study. Latitude and longitude are provided for the ship’s location when the sampling device first

landed on the seafloor.

Cruise

Locality

Station

Depth (m)

Latitude

Longitude

ANDEEP III

Weddell Sea (WS)

133

1580

62° 46' 44"

53° 2' 34" W

ANDEEP - SYSTCO

Weddell Sea (WS)

85-15

2752

52° O' 28" S

8° O' 13" W

BIOPEARL I

South Georgia (SG)

SG-EBS-3

500

53° 35' 51"

37° 54' 11" W

BIOPEARL I

Elephant Island (El)

EI-EBS-1

1500

61° 36' 43"

55° 13' 3" W

BIOPEARL I

Powell Basin (PB)

PB-EBS-4

500

60° 49' 18"

46° 29' 6" W

BIOPEARL I

Shag Rocks (SR)

SR-EBS-4

200

53° 37' 41"

40° 54' 28" W

BIOPEARL II

Amundsen Sea BI03

BI03-EBS-1B

500

71° 47' 29"

106° 12' 50" W

BIOPEARL II

Amundsen Sea BI03

BI03-EBS-1C

500

71° 47' 9" S

106° 12'27" W

BIOPEARL II

Amundsen Sea BI04

BI04-AGT-1B

1500

74° 21' 28"

104° 43' 50" W

BIOPEARL II

Amundsen Sea BI04

BI04-EBS-3E

500

74° 23' 46"

104° 45' 28" W

BIOPEARL II

Amundsen Sea BI04

BI04-EBS-1A

1500

74° 21'35"

104° 44' 45" W

BIOPEARL II

Amundsen Sea BI04

BI04-EBS-2B

500

74° 29' 16"

104° 19' 58" W

BIOPEARL II

Amundsen Sea BI04

BI04-EBS-3D

500

74° 23' 27"

104° 46' 2" W

BIOPEARL II

Amundsen Sea BI05

BI05-EBS-2A

1000

73° 52' 49"

106° 18' 59" W

BIOPEARL II

Amundsen Sea BI05

BI05-EBS-3A

500

73° 58' 19"

107° 25' 22" W

BIOPEARL II

Amundsen Sea BI06

BI06-EBS-3D

500

71° 20' 56"

109° 57' 53" W

Three genes were targeted: the ‘barcoding’ mitochondrial (mt)

protein-coding gene COl, the mt non-coding 16S and the

nuclear (n) protein-coding H3 gene. About 650 bp or 350 bp of

COl, 500 bp of 16S and 300 bp of H3 were amplified using

primers listed in table 3. PCR mixtures contained 1 ]A of each

primer (10/rM), 2 jA template DNA and 21 jA Red Taq DNA

Polymerase 1.1X MasterMix (VWR) in a mixture totalling 25

jA. The temperature profile was as follows: 96°C for 240 s,

followed by (94°C for 30 s, 48°C for 30 s then 72°C/60 s)*35

cycles, followed by 72°C for 480 s. PCR purification was

performed using a Millipore Multiscreen 96-well PCR

Purification System, and sequencing was performed on an ABI

3730XL DNA Analyser (Applied Biosystems) at the Natural

History Museum Sequencing Facility, using the primers

mentioned above. Overlapping sequence fragments were

merged into consensus sequences using Geneious (Drummond

et al., 2007). COl and H3 sequences were aligned using

MUSCLE (Edgar, 2004) with default settings, while 16S

sequences were aligned using MAFFT (Katoh et al., 2002) with

default settings, both programs provided as plug-ins in Geneious.

The program jModelTest (Posada, 2008) was used to assess the

best model for each partition (COl, 16S and H3) with BIC,

which suggested GTR+I+G as the best model for all of the

genes. The data was partitioned into the three parts (16S, H3,

COl), the evolutionary model mentioned above was applied to

each partition and corresponding codon position. The

parameters used for the partitions were unlinked. Bayesian

phylogenetic analyses (BAs) were conducted with MrBayes

3.1.2 (Ronquist and Huelsenbeck, 2003). Analyses were run

three times with the COl separate dataset, and with the COl,

H3 and 16S combined dataset, for 10,000,000 generations. Of

these, 2,500 000 generations were discarded as burn-in.

Haplotype networks using statistical parsimony (Templeton,

1992) were constructed with the program TCS (Clement et al.,

2000). In total, 28 COl sequences of Austrolaenilla antarctica

and Herdmanella gracilis were cut to the same length of 320 bp.

As part of data exploration, different statistical limits ranging

from 90% (the lowest limit available in TCS) to 95% were

employed. The distances among COl sequences were calculated

in MEGA version 5.0 (Tamura et al., 2011) and expressed as

K2P distance (uncorrected p-distances were also calculated, but

the results were very similar) for the purpose of comparison

with other studies.

Results

Morphology

During the morphological investigation, a large number of

(>2000) small polynoid specimens (fig. 2a and b) were found

and at first considered to be indeterminable juveniles (fig. 2c).

Upon closer examination, two morphotypes were distinguished:

those with cephalic peaks (fig. 3a) and those without cephalic

peaks (fig. 3b). No other morphological differences were found

between these two morphotypes using light microscopy. The

cephalic peaks were not reported in the descriptions either by

Ehlers (1908) or Augener (1929); therefore, only specimens

without cephalic peaks were assigned to Herdmanella gracilis.

DNA taxonomy and the identity of Herdmanella gracilis (Polynoidae) in the Southern Ocean

207

Table 2. Taxa studied, outgroups, DNA identification, collection sites, haplotype ID, Clade ID and NCBI GenBank accession numbers. Voucher

numbers are available through the GenBank website.

Morphology ID

DNA ID

Locality

Site

Depth (m)

Haplotype #

Clade

COI

16S

Austrolaenilla antarctica

A. antarctica

Amundsen

Sea

BI03-1

500

KJ676619

n/a

“

KJ676624

n/a

“

B104-1

1500

KJ676623

n/a

“

B104-3

500

KJ676612

KJ676606

KJ676637

“

n/a

“

n/a

“

n/a

“

n/a

“

n/a

“

KJ676613

n/a

“

KJ676614

n/a

“

KJ676615

n/a

“

KJ676616

n/a

“

BI05-2

1000

KJ676621

KJ676606

KJ676637

“

BI05-2

1000

KJ676622

n/a

“

Elephant Is.

EI-EBS-1

1500

KJ676620

KJ676606

KJ676637

“

South Georgia

SG-EBS-4

500

KJ676631

n/a

“

Weddell Sea

138

1580

KJ676618

n/a

“

85-15

2752

“

n/a

Herdmanella gracilis

A. antarctica

Amundsen

Sea

B104-3

500

KJ676625

n/a

“

KJ676612

KJ676606

KJ676637

“

n/a

“

KJ676626

n/a

“

KJ676627

n/a

“

KJ676617

n/a

“

KJ676628

n/a

“

KJ676629

n/a

“

KJ676630

KJ676606

KJ676637

“

juvenile indet.

Powell Basin

PB-EBS-3

500

n/a

KJ676636

KJ676610

KJ676641

“

juvenile indet.

Shag Rocks

SR-EBS-4

500

n/a

“

n/a

Austrolaenilla pelagica

A. pelagica

Amundsen

Sea

BI04-3

500

n/a

KJ676632

KJ676607

KJ676638

“

BI05-3

500

n/a

“

n/a

“

n/a

“

n/a

Antarctinoe ferox

outgroup

n/a

outgroup

KJ676611

n/a

Bylgides groenlandicus

outgroup

GenBank

n/a

outgroup

HQ024272

n/a

Eulagisca gigantea

outgroup

Amundsen

Sea

n/a

outgroup

KJ676633

KJ676608

KJ676639

Harmothoe Juligineum

outgroup

Amundsen

Sea

n/a

outgroup

KJ676634

KJ676609

KJ676640

Harmothoe oculinarum

outgroup

GenBank

n/a

outgroup

AY894314

n/a

Lepidasthenia berkeleyae

outgroup

GenBank

n/a

outgroup

HM473443

n/a

Macellicephala violacea

outgroup

GenBank

n/a

outgroup

JX119016

n/a

Malmgrenia mcintoshi

outgroup

GenBank

n/a

outgroup

JN852935

n/a

208

L. Neal, H. Wiklund, A.I. Muir, K. Linse &A.G. Glover

Table 3. List of primers used in this study.

Primer

Sequence 5’-3’

References

16SF

16SbrH

H3F

H3R

LCO

HCO

355R

CGCCTGTTTATCAAAAACAT

CCGGT CT GA ACT CAGAT CACGT

ATGGCTCGTACCAAGCAGACVGC

ATATCCTTRGGCATRATRGTGAC

GGT CA ACA A AT CATA A AGATATTGG

TA A ACTT CAG G GT GACCA A A A A AT CA

GGGTAAACTGTTCATCCTGTTCC

Palumbi (1996)

Colgan et al. (2000)

Folmer et al. (1994)

Nylander et al. (1999)

Table 4. Within- and between-clade distances as measured by K2P, expressed as mean

% (range in brackets).

Within-clade distance Between-clade distance

ABC

Cl C2 C3

A 0

B 0.45 (0.3-0.6)

C 2.9 (0-7.3)

Cl -

C2 2.5(03^1.1)

C3 1 (0-3.5)

15.4(14.3-16) -

18.3(14.8-20.9) 14.4 (12.4—16.3) -

6.7 (5.4—73) -

6.4 (5.4-7.1) 43(2.9-5.1) -

No morphological differences were found among individuals

lacking cephalic peaks assigned to H. gracilis , and these were

therefore assumed to belong to a single species, based on

morphology. A short description of the juveniles initially

thought to be H. gracilis is provided here.

Systematics

Polynoidae Malmgren, 1867

Juvenile, indeterminable

Figures 2, 3.

Material examined. Over 2000 specimens, from BIOPEARL I and II

expeditions to the Amundsen Sea, Antarctic, in March 2006 and

March 2008, cruise numbers JR144 and 179, station numbers listed in

table 1, depth 500 m.

Description. Voucher material. Length excluding palps 1.5

mm, 14-15 segments, 8 pairs of elytra. Colour of preserved

specimen white to creamy yellow, in live specimens anterior

body translucent, the posterior body bright yellow to orange.

Prostomium bilobed, rhomboid to oval, anterior lobes rounded

but without cephalic peaks; 2 pairs of small, black, subdermal

eyes present, anterior pair positioned medially at widest part of

prostomium. 3 antennae; median antenna often missing and

only large antennophore present, inserted distally on

prostomium, two lateral antennae inserted anteroventrally on

prostomium, styles short, slender, papillated. Pair of long

(twice length of prostomium), thick, smooth palps present,

narrowing distally. Proboscis when extended with 2 pairs of

amber-coloured jaws and 9 pairs of small, equal-sized

triangular papillae on the rim. Two pairs of tentacular cirri

present, lateral to prostomium, styles slender, papillated,

tentaculophores of similar size, tentacular segment with

notochaetae, few, stout, serrated. Parapodia biramous,

notopodia smaller than neuropodia with long, slender,

papillated dorsal cirrus; notochaetae present in moderate

numbers, stout, straw-like in colour, serrated, much shorter

than neurochaetae; neuropodia with long, slender ventral cirrus

inserted proximally; neurochaetae numerous, extremely long,

thin, almost capillary-like, all unidentate. Elytra often missing,

when present small, ovoid, translucent with rough surface, with

sparse microtubercules only, some elongated papillae

irregularly present on surface and fringe. Pygidium conical,

anal cirri not observed.

Remarks. The specimens morphologically agree with the

description of Herdmanella gracilis Ehlers, 1908; however, it

was decided not to assign them to this species without a

molecular assessment considering that the specimens are likely

to be juveniles, and the type locality (East Africa) is far distant

from the Amundsen Sea.

DNA taxonomy and the identity of Herdmanella gracilis (Polynoidae) in the Southern Ocean

209

Figure 2. Juvenile Polynoidae: a, image of live specimens agreeing morphologically with Herdmanella gracilis Ehlers, 1908; b, detail of

specimen; c, drawing of H. gracilis from the orginal description published by Ehlers (1908).

Molecular data

The results from the molecular phylogenetic methods based on

the COl gene only (fig. 4) and on the combined analysis of COl,

16S and H3 genes (fig. 5) suggest that Herdmanella gracilis-hke

specimens from the Southern Ocean represent juvenile stages of

at least two species (clade B and C in fig. 4a). The identity of the

juvenile specimens collected in the Powell Basin and at Shag

Rocks (clade B in fig. 4a) remains unresolved; however,

Herdmanella gracilis-Wke specimens from the Amundsen Sea

(clade C) were a close match with adult Austrolaenilla antarctica

Bergstrom, 1916, forming a well-supported monophyletic

group. The A. antarctica clade forms three subclades (Cl, C2

and C3), and COl diversity is high, with an average K2P

distance of 2.9% (range 0-7.3%) (table 4). The changes were

found in the third codon position and did not result in changes

to amino sequences once translated. Additionally, mtl6S and

nH3 sequences were obtained for representatives of clades C2

(n = 2) and C3 (n = 3). In 16S, the genetic distance within clade

C was reduced to <1% for all specimens, and in nuclear H3

genes, their sequences were identical.

The 28 specimens in clade C, morphologically assigned to

Austrolaenilla antarctica and Herdmanella gracilis

represented 20 haplotypes (table 2). Only seven specimens (five

of A. antarctica and two of H. gracilis ) belonged to the same

haplotype (no. 1), and all of these were from the Amundsen Sea

station BI04, 500 m depth (table 2). Two specimens from the

deep Weddell Sea shared one haplotype, no. 13. The rest of the

specimens were all unique haplotypes. A single haplotype

network was not recovered using a 90% connectivity limit (11

steps), the lowest limit available in the TCS program. These

settings in TCS resulted in the South Georgian haplotype not

connecting to the main network formed by all other haplotypes,

no. 1-19 (fig. 6a). The same result was obtained using a 91%

connectivity limit (results not shown). Ultimately, increasing

the parsimony limit to 95% (seven steps) resulted in a

breakdown into five haplotype networks (fig. 6b). Three of

Figure 3. Presence of cephalic peaks in juvenile polynoids: a, type 1

juvenile of Harmothoe fuligineum —cephalic peaks clearly present

(arrowed); b, type 2 juvenile—cephalic peaks absent, consistent with

H. gracilis Ehlers, 1908.

210

L. Neal, H. Wiklund, A.I. Muir, K. Linse &A.G. Glover

Macetlicephala violacea

Eulagisca gigantea

- Harmothoe oculinarum

- --- Bylgides groenlandicus

Matmgrenia mcintoshi

- Antarctinoe ferox

Austrolaenilla pelagica

CLADE A

Herdmanella gracilis

GLADE B

jCLADE Cl :

Austrolaenilla antarctica SG

* r Austrolaenilla antarctica

L Austrolaenilla antarctica 13

— Austrolaenilla antarctica 14

—1 1 — Austrolaenilla antarctica 15

Austrolaenilla antarctica 16

- Austrolaenilla antarctica 17

Austrotaeniila antarctica 18

Austrolaenilla antarctica 19

Herdmanella gracilis 2

Austrolaenilla antarctica 1

- Austrolaenilla antarctica 3

Austrolaenilla antarctica 1

- Austrolaenilla antarctica 1

Austrolaenilla antarctica 4

- Austrolaenilla antarctica 5

- Austrolaenilla antarctica 6

- Austrolaenilla antarctica 1

- Herdmanella gracilis 7

Herdmanella gracilis 8

Herdmanella gracilis 1

- Austrolaenilla antarctica 9

Herdmanella gracilis 10

Herdmanella gracilis 1

Austrolaenilla antarctica 1

- Herdmanella gracilis 11

Herdmanella gracilis 12

* r- Harmothoe fuliginoum

I- Juvenile with cephalic peaks

- Eunoe nodosa

CLADE C

CLADE C3

Harmothoe Impar

Lepidonotus ctava

substitutions per site 0.09

Figure 4. Phylogenetic tree from Bayesian consenus analysis based on COl (mtDNA) only. Stars represent significant node values (>95%) for

Bayesian posterior probabilities. Clade numbers and letters refer to table 2 and the main text.

these - South Georgian (SG), Amundsen Sea Station BI03 (no.

14), and Weddell Sea (no. 13) were represented by single

haplotypes only. Four haplotypes from various sampling

stations and depths in the Amundsen Sea (nos 16-19) formed a

separate network. The largest network was composed of

haplotypes of A. antarctica and H. gracilis from the Amundsen

Sea station BI04,500 m (haplotypes no. 1 -12) with the addition

of a single haplotype from Elephant Island (haplotype no. 15).

Discussion

Taxonomy and genetic diversity: Herdmanella gracilis in the

Southern Ocean

Ever since Augener (1929) first identified small polynoid

specimens from the Southern Ocean as Herdmanella gracilis

Ehlers, 1908, this species was considered to have an Antarctic, as

well as Indian Ocean (type locality) distribution. However, given

DNA taxonomy and the identity of Herdmanella gracilis (Polynoidae) in the Southern Ocean

211

Figure 5. Phylogenetic tree from Bayesian consenus analysis based on

the COl, 16S (mtDNA) and H3 (nDNA) combined dataset of selected

specimens. Stars represent significant node values (>95%) for Bayesian

posterior probabilities.

the small size of the specimens, the longstanding suggestion by

many authors was that they were juveniles, with links suggested

to the genus Austrolaenilla (Antinoe in Monro, 1930) or

Harmothoe Kinberg, 1855 (Augener, 1929; Hartmann-Schroder,

1974; Pettibone, 1976. During the morphological investigation of

a large number of these small polynoids in our study, two

morphotypes were distinguished: those with cephalic peaks (a

feature not reported in Herdmanella gracilis) (fig. 3a) and without

cephalic peaks (fig. 3b) (consistent with H. gracilis ). The small

specimens with cephalic peaks are not the subject of this paper,

but molecular methods employed in a wider phylogenetic study

of Southern Ocean Polynoidae have identified these as juveniles

of Harmothoe Juliginemn (Baird, 1865) (Wiklund et al., in prep.).

However, when identifiers are presented with a large number of

these small worms (thousands in this study), the two morphotypes

can be confused, as the cephalic peaks can be easily overlooked.

The molecular methods based on the COl gene only and on

combined analysis of the COl, 16S and H3 genes suggest that

Herdmanella gracilis- like specimens from the Southern Ocean,

which are morphologically indistinguishable, do in fact

represent juvenile stages of at least two species (clades B and C

in fig. 4). It is very likely that greater sequencing effort would

identify other species within the Herdmanella gracilis-Wke

juveniles. The identity of the adult stage for H. gracilis-Uke

juveniles from the Scotia Sea (clade B in fig. 4) remains

unresolved. Herdmanella gracilis- like specimens from the

Figure 6. Haplotype network of 20 haplotypes based on Austrolaenilla

antarctica and Herdmanella gracilis mtCOl data: a, representing 91%

connection limit; b, representing 95% limit. Small black circles

represent unsampled haplotypes, large circles represent the sampled

haplotypes with their size proportional to the frequency of the

haplotype (n = 1, 2 and 7). Numbers in the shapes correspond to

haplotype identification numbers (see table 2). Different geographical

locations are coded—white circles are Amundsen Sea BI04, 500-m

depth; light grey circles are BI04,1500-m depth; dark grey circles are

BI03; cross-hatched circles are Weddell Sea; horizontal hatched

circles are Elephant Island; and black circles are South Georgia.

Amundsen Sea are a close match with the adult stage of

Austrolaenilla antarctica Bergstrom, 1916, a common species

with wide circumpolar distribution, with Austrolaenilla

antarctica and H. gracilis constituting a well-supported

monophyletic group (clade C in fig. 4). In COl, the genetic

diversity in clade C was rather high (see further discussion

below); the smallest distance between A. antarctica and H.

gracilis-like specimens was 0%, but the average distance was

approximately 4%. However, the gap between ‘good’ species,

e.g. between A. antarctica and A. pelagica was on average 18.3

(range 14.8-20.9) (table 4), which suggests that an average of 4%

distance may constitute potential intraspecific variation. Given

this relatively large ‘barcoding gap’, even for specimens sampled

from the same locality, 16S and H3 sequences were obtained for

212

L. Neal, H. Wiklund, A.I. Muir, K. Linse &A.G. Glover

a small number of representative specimens with high COl

divergences. In 16S, the genetic distance was reduced to <1%,

and in nuclear H3 genes, these sequences were identical.

Additionally, haplotype networks with a 95% connectivity

limit provide a useful tool for species delimitation (e.g. Hart and

Sunday, 2007; Monaghan et al., 2006). For the purposes of

clarifying the identity of the Herdmanella gracilis- like specimens

from the Southern Ocean, the haplotype networks confirmed the

identity of many of these specimens as juveniles of Austrolaenilla

antarctica, even under the strict 95% connectivity limit (fig. 6b,

table 2). However, the status of specimens morphologically

agreeing with A. antarctica (from various locations in the

Southern Ocean) as a single species can be questioned. The

single specimen from South Georgia (corresponding to clade Cl

in fig. 4) could be justified as a different species since the single

haplotype network could not be recovered, even under a 90%

limit (fig. 6a). Specimens from clades C2 and C3 formed a single

haplotype network under 90 and 91% limits (fig. 6a), but failed

under the more conservative 95% limit (fig. 6b). However, the

network of the haplotype numbers 16-19 fails to be connected to

the main network by a single step.

As with the ‘barcoding gap’, the coveted 95% connectivity

limit may not work well for Austrolaenilla antarctica, although

the presence of cryptic species cannot be discounted. A larger

sampling effort, covering other locations and including a

greater number of specimens of A. antarctica, would be needed

to clarify its status as a single or cryptic species. Several

studies using DNA to delimit Southern Ocean taxa based on

mitochondrial sequence data suggested the discovery of new

(often cryptic) species, e.g. the polychaete Glycera kerguelensis

(Schuller, 2010), the pycnogonids Nymphon australe (Mahon

et al., 2008) and Colossendeis megalonyx (Krabbe et al., 2010),

amphipods (Loerz et al., 2009; Baird et al., 2011), nudibranch

Doris kerguelensis (Wilson et al., 2009), crinoid

Promachocrinus kerguelensis (Wilson et al., 2007), ostracods

(Brandao et al., 2010) or octopus (Allcock et al., 2011), while

fewer studies supported a true circumpolar distribution (e.g.

Raupach et al., 2010; Arango et al., 2011). A summary of the

extent of the barcoding studies in the Southern Ocean has

been provided by Grant et al. (2011) and Allcock and Strugnell

(2012). Nygren (2013) provides an in depth review of cryptic

diversity in polychaetes.

The problem of species delimitation and species concepts

has a long history in biology (e.g. de Queiroz, 2007; Wiens,

2007; Wilkins, 2011). In recent years, the molecular approach

has been added to the toolbox for both species identification and

species delimitation. As already mentioned above, a common

approach, which we also adopted here, is to search for

discontinuities in DNA sequence variation either through the

statistical parsimony method (Templeton et al., 1992), which is

used to build haplotype networks, or by the discovery of a

barcoding gap (Hebert et al., 2003). This gap is supposed to

represent the difference between the highest genetic distance

found within species and the lowest genetic distance found

between species. The most common part of DNA used in animal

barcoding studies is the COl gene of mtDNA. However, this

choice of marker, as well as the concept of the barcoding gap

itself, has been subject to fierce criticism ever since it was

proposed by Hebert et al. (2003). In their review of mitochondrial

DNA, Galtier et al. (2009) concluded that, given the

heterogeneous evolutionary rate of mtDNA and processes such

as hybrid introgression or balancing selection, the universal

distance-based ‘gaps’ for delineation of taxa into species do not

exist. This view has been supported by many other workers,

adding problems of small sample sizes or narrow geographical

coverage, which may affect the size of the ‘gap’, resulting in

extensive literature concerning the use of mtDNA barcodes (e.g.

Moritz and Cicero, 2004; Meyer and Paulay, 2005; Meyer et al.,

2008; Bergsten et al., 2012; Collins and Cruickshank, 2012).

The increasingly accepted approach to species delimitation will

rely on examination of mtDNA sequence distance, variation at

multiple (including nuclear) genetic loci in a phylogenetic

context, careful morphological examination, as well as

ecological and biological observations (see references in

Nygren, 2013). However, to obtain all these lines of evidence is

not always possible and certainly takes time.

The most comprehensive work on barcoding of polychaetes

to date was completed by Carr et al. (2011) on Arctic

polychaetes. Their analysis of 1876 specimens, representing

333 provisional species, revealed 40 times more between-

species sequence divergence in COl as opposed to within

species (16.5% versus 0.38%), as estimated by Kimura 2

parameter (K2P) distance measure. In Carr et al. (2011), the

COl barcodes have high discriminatory power for polychaetes

because the average observed within-clade divergence in their

study was 3.8% (highest within-species divergence was 5.7%),

indicating that barcodes naturally form tight clades with low

variation. A smaller regional barcoding study on Chilean

polychaetes conducted by Maturana et al. (2011) corroborated

the results of Carr et al. (2011) by finding that mean pairwise

sequence distance comparisons, based on K2P within-species,

ranged from 0.2 to 0.4%, while interspecific comparisons were

much higher and ranged between 18 and 47%.

Results from our study approach the interspecific

differences observed in other research on polychaetes (e.g.

Schuller, 2010; Maturana et al., 2011; Carr et al., 2011), with

the average K2P distance in COl found to range from 14.4 to

18.3% (table 4). However, variable results were obtained for

within-species diversity in COl. There was no divergence in

Austrolaenilla pelagica clade A (fig. 4) in specimens from

various sampling sites in the Amundsen Sea (greatest distance

ca. 500 km apart). Similarly, the two juveniles of unknown

identity forming clade B (fig. 4a) were separated by less than

1% in COl, despite the fact that these specimens came from

the geographically distant sites of the Powell Basin and Shag

Rocks. Additionally, unpublished work by Ramon (pers.

comm.) on Antarctic marine larvae revealed a close match to

the unknown species in clade B in COl and 16S sequences

with unidentified polynoid larvae from the Ross Sea. The low

level of divergence within these clades (A and B), which also

correspond to morphological species, is in agreement with the

results of other studies mentioned above. Large distribution

areas have often been accepted for marine fauna in the past,

but this assumption has been questioned (e.g. Hellberg, 2009).

Further, the discovery of cryptic species also challenges this

idea (Nygren, 2013). However, wide distributions have been

DNA taxonomy and the identity of Herdmanella gracilis (Polynoidae) in the Southern Ocean

213

shown for polychaetes by Schiiller and Hutchings (2012), who

demonstrated long-distance dispersal in Terebellides gingko

using 16S rDNA sequences.

In contrast, a very high level of diversity was observed in

the Austrolaenilla antarctica clade A, with the greatest distance

being 7.3%. The specimens in the A. antarctica clade were

collected from several locations in the Southern Ocean (table

1), covering a total geographical distance of ca. 6000 km (if

following the shelf of islands in the Scotia Arc). Reflecting

this, the A. antarctica clade itself is formed of three clades (Cl,

C2 and C3). The most divergent specimen from South Georgia

(clade Cl) may possibly represent a cryptic species, a notion

also supported by the haplotype network analysis. Clade C2 is

comprised entirely of adults that agreed morphologically with

A. antarctica, with an average distance of approximately 2.5%

(range 0.03-4.1% (table 4)). These specimens were mostly

collected at locations from across the Amundsen Sea at

varying depths, but the clade also contains one specimen from

Elephant Island, 1500 m (BIOPEARL I collection), and the

most divergent specimen is from the abyssal Weddell Sea

(ANDEEP collection). Clade C3 includes exclusively juveniles

and adults collected from a single sampling station on inner

shelf BI04 at 500 m. Individuals from a single station were

selected to establish the identity of the juveniles previously

identified as Herdmanella gracilis in order to reduce the

diversity introduced by factors such as geographical or

bathymetrical distance. Even though the average distance was

low at 1% within this clade, the highest COl distance was

3.5% (table 4). In this study, only a small number of individuals

were sequenced from >1000 specimens collected at this

particular site, and potential future work specifically aimed at

population genetics may provide further insights.

In a large-scale study of lumbricid earthworms in Britain,

King et al. (2008) found that two morphs of Allolobophora

chlorotica (with over 14% divergence at COl) are interbreeding

and therefore represent a single taxon. This conclusion was

further supported by amplified fragment length polymorphism

(AFLP) markers. In their overall survey of COl sequence

diversity of nine species of British earthworms, represented by

71 individuals, they found that sequence divergences within

species varied from 0.35% to 12.35%, highlighting yet again

the lack of a universal threshold for the barcoding gap, even

within closely related species, which is similar to our results

for two recognised and one suspected species of Austrolaenilla.

Similar results were obtained in a recent study by Achurra and

Erseus (2013) examining population structure of the aquatic

oligochaete Stylodrilus heringianus Claparede, 1862, covering

its range on a European scale (Estonia to Spain) using

sequences of the mt COl and two nuclear genes: internal

transcribed spacer region and histone 3. The authors also

found a large COl diversity, with a maximum distance of

7.7%, as measured by K2R Nevertheless, nuclear genes failed

to confirm any lineage separation, and it was concluded that

the sampled specimens all belong to the same species,

asserting that the mitochondrial single-locus approach can be

problematic for the accurate delimitation of species.

Of several hypotheses proposed to explain high diversity in

mitochondrial sequence data and its discordance with nuclear

genes (see e.g. King et al., 2008), that of incomplete speciation

following isolation in distinct glacial refugia is of particular

relevance to the Southern Ocean fauna. The Earth’s climatic

history is marked by alternating glacial and interglacial

periods. During the ice ages, populations of plants and animals

have shown primarily two survival strategies: migration or

survival in situ, helped by the existence of glacial-free refugia.

Populations in different refugia will diverge from one another

through genetic drift, which may lead to reproductive isolation

of those populations. The recent insights into the history of

glaciation in Antarctica have shown that at glacial maxima,

grounded ice sheets extended over much of the Antarctic

continental shelf (Thatje et al., 2005). As a result, most (if not

all) available habitat for marine benthos was destroyed, making

this group particularly vulnerable to extinction. Earlier workers

such as Dell (1972) proposed that the continental shelf fauna

was completely eradicated by glacial cycles and recolonised

from the deep sea. Others suggested that some fauna survived

on the continental shelf itself in ice-free refugia (Clarke et al.,

2004). These ice-free regions existed on a range of temporal

and spatial scales, and not all areas around the continent have

been glaciated at the same time (Anderson et al., 2002). As

such, isolation of historic populations in Cenozoic glacial

refugia could provide some explanation for the high mtDNA

diversity in our modern Antarctic polychaete populations. The

shelf of the Amundsen Sea, the site of collection of most

specimens used in this study, is particularly complex in its

bathymetry as a result of past as well as present day glacial

activity (Lowe and Anderson, 2002).

Status of the genus Herdmanella

Darboux, 1899, erected the genus Herdmanella for the species

Polynoe (?) ascidioides McIntosh, 1885, which was found at

station 160 of the Challenger Expedition in the Southern Ocean

(42°42’S 134°10’E, south of Australia) in the branchial chamber

of an ascidian on red clay at 4755m depth. This is therefore the

type species of the genus by monotypy. McIntosh, 1885, himself

mentioned some similarity between his species Polynoe (?)

ascidioides and Polynoe (Macellicephala) mirabilis McIntosh,

1885. Uschakov (1971) also compared this species to the genus

Macellicephala. However, Hartmann-Schroder (1974) referred

to it as Macellicephala (Macellicephala) ascidioides (McIntosh,

1885), saying that it is incompletely known, but explicitly

making Herdmanella a junior synonym of Macellicephala

McIntosh, 1885. More recently, Pettibone (1976) referred to

Polynoe (?) ascidioides as a ‘doubtful Polynoidae’. The holotype

is apparently the only specimen of this species that has been

reported. This holotype has been re-examined by Muir (1982),

who found it to be in bad condition and lacking a head, so it

cannot with certainty be referred to any polynoid subfamily. It

is clear, therefore, that Polynoe (?) ascidioides McIntosh, 1885

must be regarded as a nomen dubium (a name of unknown or

doubtful application). If the name of the type species of a genus

(Polynoe (?) ascidioides ) is a nomen dubium, it follows that the

generic name Herdmanella must also be a nomen dubium. It is

not clear why previous authors did not arrive at this conclusion.

Although our study provides clear evidence that specimens

from the Southern Ocean morphologically consistent with

214

L. Neal, H. Wiklund, A.I. Muir, K. Linse &A.G. Glover

Herdmanella gracilis are in fact juveniles of at least two species

in the polynoid genus Austrolaenilla, we cannot come to a

definite conclusion about the identity of H. gracilis from the

type locality in the equatorial Indian Ocean. We have, however,

certainly strengthened the longstanding suggestion that it is a

juvenile, and the results from the Southern Ocean point towards

the genus Austrolaenilla as adult counterparts, but no adults of

Austrolaenilla species are known from the equatorial Indian

Ocean. Similarly Herdmanella aequatorialis from the Gulf of

Guinea, currently regarded as the other valid species in the

genus Herdmanella , is also likely to be a juvenile of an, as yet

unknown, polynoid. Austrolaenilla meteorae (originally placed

in Harmothoe ) was described by Hartmann-Schroder (1982)

from the equatorial Atlantic Ocean off West Africa and may

possibly be the adult of H. aequatorialis. As the genus

Herdmanella is now regarded as a nomen dubium, the two

species H. gracilis and H aequatorialis are now without a

generic placement, and as they probably represent juveniles of

other species they are also best regarded as nomina dubia.

Ecology of polynoid juveniles

Larval ecology is important to understanding patterns and

processes influencing marine populations, communities and

ecosystems. However, one of the limitations to the study of

community ecology is the ability to correctly identify marine

larvae and juveniles. As this study shows, not only is it

problematic to attempt to distinguish juveniles of related

polynoid species on the basis of morphology alone, but

juveniles may well have been considered different species in

the past. This of course will have repercussions for subsequent

analysis of community structure. It is indeed rather arbitrary

how to treat a large collection of juveniles in an ecological

analysis if their identity is spurious. Without being able to

identify these correctly, it may be sensible to exclude

indeterminable juveniles from the analysis. However, the

distribution and abundance patterns of juveniles are of great

interest, given that very little is known about this subject.

The large number of juveniles (>2000) belonging to several

polynoid species collected in the Amundsen Sea is suggestive of

recent spawning. The samples were collected towards the end of

the austral summer in early March of 2008. This points to a

potentially synchronised summer spawning event of at least two

polynoid species— Austrolaenilla antarctica and Harmothoe

juligineum. The largest numbers were found at 500 m depth (the

shallowest horizon sampled during the BIOPEARL II cruise),

and they were exceptionally abundant at two inner-shelf stations

in Pine Island Bay. Although recent studies indicated the

existence of so-called food banks available to benthos

throughout the year (Smith et ah, 2002; Glover et al., 2008), it is

likely that recruitment predominantly occurs during the summer

months and is linked to high food availability. In addition, the

inner-shelf BIOPEARL II stations are characterised by the

presence of polynyas, areas known for high productivity (Arrigo

and Van Dijken, 2003). The high number of polynoid juveniles

in this region is likely linked to this. The analysis of biodiversity

and ecology of polychaetes from Amundsen Sea is currently

underway (Neal et al., in prep.).

Acknowledgements

We would like to thank Pat Hutchings and the organising

committee of the 11th International Polychaete Conference,

Sydney and Dr Robin Wilson the editor of the conference

proceedings. We would like to thank Dr Angelika Brandt

from the Museum of Zoology, Hamburg, Germany, for access

to specimens collected as part of the ANDEEP expeditions.

This is ANDEEP publication #186. Huw Griffiths (BAS)

kindly provided the map of the sampling locations. Katrin

Linse is part of the British Antarctic Survey Polar Science

for the Planet Earth Programme, which is funded by The

Natural Environment Research Council (NERC). This

research was funded by the Systematics and Taxonomy

research scheme (SynTax) (through NERC and the

Biotechnology and Biological Sciences Research Council)

and the European Union Framework 7 People Program

(Marie Curie).

References

Achurra, A., and Erseus, C. 2013. DNA barcoding and species

delimitation: the Stylodrilus heringianus case (Annelida: Clitellata:

Lumbriculidae). Invertebrate Systematics 27(1): 118-128.

Ahrens, D., Monaghan, M.T., and Vogler, A.P. 2007. DNA-based

taxonomy for associating adults and larvae in multi-species

assemblages of chafers (Coleoptera: Scarabaeidae). Molecular

Phylogenetics and Evolution 44(1): 436-449.

Allcock, A.L., Barratt, I., Eleaume, M., Linse, K., Norman, M.D.,

Smith, P.J., Steinke, D., Stevens, D.W., and Strugnell, J.M. 2011.

Cryptic speciation and the circumpolarity debate: a case study on

endemic Southern Ocean octopuses using the COI barcode of life.

Deep-Sea Research Part IP. Topical Studies in Oceanography

58(1): 242-249.

Allcock, A.L., and Strugnell, J.M. 2012. Southern Ocean diversity:

new paradigms from molecular ecology. Trends in Ecology and

Evolution 27(9): 520-528.

Anderson, J.B., Shipp, S.S., Lowe, A.L., Wellner, J.S., and Mosola,

A.B. 2002. The Antarctic Ice Sheet during the Last Glacial

Maximum and its subsequent retreat history: a review. Quaternary

Science Reviews 21(1): 49-70.

Arango, C.P., Soler-Membrives, A., and Miller, K.J. 2011. Genetic

differentiation in the circum-Antarctic sea spider Nymphon

australe (Pycnogonida: Nymphonidae). Deep-Sea Research Part

IP Topical Studies in Oceanography 58(1): 212-219.

Arrigo, K.R., and Van Dijken, G.L. 2003. Phytoplankton dynamics

within 37 Antarctic coastal polynyas. Journal of Geophysical

Research 108(C8): 3271. 18 pp.

Augener, H. 1929. Beitrage zur Planktonbevolkerung der Weddellsee

nach dem Ergebnissen der Deutschen Antarktischen Expedition

1911-1912. V. Die Polychaeten der Weddellsee. Internationale

Revue der Gesamten Hydrobiologie und Hydrographie 22: 273-312.

Baird, W. 1865. Contributions towards a monograph of the species of

Annelides belonging to the Aproditacea, containing a list of the

known species, and a description of some new species contained

in the National

Collection of the British Museum. Journal of the Linnean Society of

London, Zoology 8:172-202.

Baird, H.P, Miller, K.J., and Stark, J.S. 2011. Evidence of hidden

biodiversity, ongoing speciation and diverse patterns of genetic

structure in giant Antarctic amphipods. Molecular Ecology

20(16): 3439-3454.

DNA taxonomy and the identity of Herdmanella gracilis (Polynoidae) in the Southern Ocean

215

Bergsten, J., Bilton, D.T., Fujisawa, T., Elliott, M., Monaghan, M.T.,

Balke, M., Hendrich, L., Geijer, J., Herrmann, J., Foster, G.N.,

Ribera, I., Nilsson, A.N., Barraclough, T.G., and Vogler, A.R

2012. The effect of geographical scale of sampling on DNA

barcoding. Systematic Biology 61(5): 851-869.

Bracken-Grissom, H.D., Felder, D.L., Vollmer, N.L., Martin, J.W., and

Crandall, K. 2012. Phylogenetics links monster larva to deep-sea

shrimp. Ecology and Evolution 2(10): 2367-2373.

Brandao, S.N., Sauer, J., and Schon, I. 2010. Circumantarctic

distribution in Southern Ocean benthos? A genetic test using the

genus Macroscapha (Crustacea, Ostracoda) as a model. Molecular

Phylogenetics and Evolution 55(3): 1055-1069.

Brenke, N. 2005. An epibenthic sledge for operations on marine soft

bottom and bedrock. Journal of the Marine Technology Society

39(2): 10-19.

Carr, C.M., Hardy, S.M., Brown, T.M., Macdonald, T., and Hebert,

P.D.N. 2011. A tri-oceanic perspective: DNA barcoding reveals

geographic structure and cryptic diversity in Canadian

polychaetes. PloS ONE 6(7): e22232.

Clarke, A., Aronson, R.B., Crame, J.A., Gili, J.-M., and Blake, D.B.

2004. Evolution and diversity of the benthic fauna of the Southern

Ocean continental shelf. Antarctic Science 16(4): 559-568.

Clement, M., Posada, D.C.K.A., and Crandall, K.A. 2000. TCS: a

computer program to estimate gene genealogies. Molecular

Ecology 9(10): 1657-1659.

Colgan, D., Ponder, W.F., and Eggler, P.E. 2000. Gastropod

evolutionary rates and phylogenetic relationships assessed using

partial 28S rDNA and histone H3 sequences. Zoologica Scripta,

29(1): 29-63.

Collins, R.A, and Cruickshank, R.H. 2012. The seven deadly sins of

DNA barcoding. Molecular Ecology Resources 13: 969-975.

Darboux, J.G. 1899. Recherches sur les aphroditiens. Travaux de

Vlnstitut de Zoologie de TUniversite de Montpellier et de la Station

Maritime (Zoologique) de Cette 6: 1-276.

Dell, R.K. 1972. Antarctic benthos. Advances in Marine Biology 10:

1-216.

De Queiroz, K. 2007. Species concepts and species delimitation.

Systematic Biology 56(6): 879-886.

Drummond, A.J., Ashton, B., Cheung, M., Heled, J., Kearse, M., Moir,

R., and Stones-Havas S. 2007. Geneious ver. 3. 0. Available at

http: //www. geneious. com

Edgar, R.C. 2004. MUSCLE: multiple sequence alignment with high

accuracy and high throughput. Nucleic Acids Research 32(5):

1792-1797.

Ehlers, E. 1908. Die Bodensassigen Anneliden aus den Sammlungen

der deutschen Tiefsee-Expedition. Wissenschaftliche Ergebnisse

der Deutschen Tiefsee-Expedition aufdem Dampfer Valdivia 1898-

1899 16(1): 1-168.

Folmer, O., Black, M., Hoeh, W., Lutz, R., and Vrijenhoek, R. 1994.

DNA primers for amplification of mitochondrial cytochrome c

oxidase subunit I from diverse metazoan invertebrates. Molecular

Marine Biology and Biotechnology 3: 294-299.

Galtier, N., Nabholz, B., Glemin, S., and Hurst, G.D.D. 2009.

Mitochondrial DNA as a marker of molecular diversity: a

reappraisal. Molecular Ecology 18(22): 4541-4550.

Glover, A.G., Smith, C.R., Mincks, S.L., Sumida, P.Y.G., and Thurber,

A.R. 2008. Macrofaunal abundance and composition on the West

Antarctic Peninsula continental shelf: evidence for a sediment

‘food bank’ and similarities to deep-sea habitats. Deep-Sea

Research II55: 2491-2501.

Grant, R.A., Griffiths, H.J., Steinke, D., Wadley, V., and Linse K.

2011. Antarctic DNA barcoding; a drop in the ocean? Polar

Biology 34(5): 775-780.

Hamilton, C., Formanowicz, D.R., and Bond, J.E. 2011. Species

delimitation and phylogeography of Aphonopelma hentzi

(Araneae, Mygalomorphae, Theraphosidae): cryptic diversity in

North American tarantulas. PloS ONE 6(10): e26207.

Hart, M.W., and Sunday, J. 2007. Things fall apart: biological species

form unconnected parsimony networks. Biology Letters 3(5):

509-512.

Hartman, O. 1964. Polychaeta Errantia of Antarctica. Antarctic

Research Series 3: 1-131.

Hartman, O. 1967. Polychaetous annelids collected by the USNS

Eltanin and Staten Island cruises, chiefly from Antarctic seas.

Allan Hancock Monographs in Marine Biology 2: 1-387.

Hartmann-Schroder, G. 1974. Die Unterfamilie Macellicephalinae

Hartmann-Schroder, 1971. Mittheilungen aus dem Hamburgischen

Zoologischen Museum und Institut 71: 75-85.

Hartmann-Schroder, G. 1982. Die Polychaeten der Fahrt 36 (1975)

von F.S. ‘Meteor’ in das Auftriebsgebiet vor Nordwest-Afrika.

METEOR Forschungsergebnisse D(35): 1-20.

Haynes, E. 1979. Description of larvae of the northern shrimp,

Pandalus borealis , reared in situ in Kachemak Bay, Alaska.

Fisheries Bulletin 77(1): 157-173.

Haynes, E.B. 1982. Description of larvae of the golden king crab,

Lithodes aequispina, reared in the laboratory. Fisheries Bulletin

80(2): 305-313.

Hebert, P.D.N., Ratnasingham, S., and de Waard, J.R. 2003. Barcoding

animal life: cytochrome c oxidase subunit 1 divergences among

closely related species. Proceedings of the Royal Society of London.

Series B, Biological Sciences 270 Supplement 1: S96-S99.

Heimeier, D., Lavery, S., and Sewell, M. 2010. Using DNA barcoding

and phylogenetics to identify Antarctic invertebrate larvae: lessons

from a large scale study. Marine Genomics 3(3-4): 165-177.

Hellberg, M.E. 2009. Gene flow and isolation among populations of

marine animals. Annual Review of Ecology, Evolution, and

Systematics 40: 291-310.

Katoh, K., Misawa, K., Kuma, K., and Miyata, T. 2002. MAFFT: a

novel method for rapid multiple sequence alignment based on fast

Fourier transform. Nucleic Acids Research 30(14): 3059-3066.

King, R.A., Tibbie, A.L., and Symondson, W.O.C. 2008. Opening a can

of worms: unprecedented sympatric cryptic diversity within British

lumbricid earthworms. Molecular Ecology 17(21): 4684-4698.

Krabbe, K., Leese, F., Mayer, C., Tollrian, R., and Held, C. 2010.

Cryptic mitochondrial lineages in the widespread pycnogonid

Colossendeis megalonyx Hoek, 1881 from Antarctic and

Subantarctic waters. Polar Biology 33(3): 281-292.

Linse, K. 2008. The BIOPEARL expedition to the Scotia Sea in 2006.

Antarctic Science 20(3): 211-212.

Linse, K., Griffiths, H.J., Barnes, D.K., Brandt, A., Davey, N., David,

B., DeGrave, S., d’Udekem d’Acoz, C., Eleaume, M., Glover,

A.G., Hemery, L., Mah, C., Martin-Ledo, R., Munilla, T.,

O’Loughlin, M., Pierrat, B., Saucede, T., Sands, C., Strugnell,

J.M., and Enderlein, P. 2013. The macro- and megabenthic fauna

on the continental shelf of the eastern Amundsen Sea, Antarctica.

Continental Shelf Research 68: 80-90.

Loerz, A., Maas, E., Linse, K., and Coleman, C.O. 2009. Do circum-

Antarctic species exist in peracarid Amphipoda? A case study in

the genus Epimeria Costa, 1851 (Crustacea, Peracarida,

Epimeriidae). ZooKeys 18: 91-128.

Lowe, A.L., and Anderson, J.B. 2002. Reconstruction of the West

Antarctic ice sheet in Pine Island Bay during the Last Glacial

Maximum and its subsequent retreat history. Quaternary Science

Reviews 21:1879-1897.

216

L. Neal, H. Wiklund, A.I. Muir, K. Linse &A.G. Glover

Mahon, A.R., Arango, C.P., and Halanych, K.M. 2008. Genetic

diversity of Nymphon (Arthropoda: Pycnogonida: Nymphonidae)

along the Antarctic Peninsula with a focus on Nymphon australe

Hodgson 1902. Marine Biology 155(3): 315-323.

Maturana, C.S., Moreno, R.A., Labra, F.A., Gonzalez, C.A.,

Rozbaczylo, N., Carrasco, F.D., and Poulin, E. 2011. DNA

barcoding of marine polychaetes species of southern Patagonian

fjords. Revista de Biologia Marina y Oceanografia 46(1): 35—42.

McIntosh, W.C. 1885. Report on the Annelida Polychaeta collected by

H.M.S. Challenger during the years 1873-76. Challenger Reports

12: 1-554.

Meier, R., Zhang, G., and Ali, F. 2008. The use of mean instead of

smallest interspecific distances exaggerates the size of the

“barcoding gap” and leads to misidentification. Systematic Biology

57(5): 809-813.

Meyer, C.P., andPaulay, G. 2005. DNA barcoding: error rates based on

comprehensive sampling. PLoS Biology 3(12): e422.

Monaghan, M.T., Balke, M., Pons, J., and Vogler, A.P. 2006. Beyond

barcodes: complex DNA taxonomy of a South Pacific Island

radiation. Proceedings of the Royal Society of London. Series B,

Biological Sciences 273(1588): 887-893.

Monro, C.C.A. 1930. Polychaete worms. Discovery Reports 2: 1-222.

Moritz, C., and Cicero, C. 2004. DNA barcoding: promise and pitfalls.

PLoS Biology 2: 1529-1531.

Muir, A.I. 1982. Generic characters in the Polynoinae (Annelida,

Polychaeta), with notes on the higher classification of scale-worms

(Aphroditacea). Bulletin of the British Museum (Natural History).

Zoology Series 43(3): 153-177.

Nygren, A. 2013. Cryptic polychaete diversity: a review. Zoologica

Scripta 43: 172-183.

Nylander, J.A.A., Erseus, C., and Kallersjo, M. 1999. A test of

monophyly of the gutless Phallodrilinae (Oligochaeta, Tubificidae)

and the use of a 573 bp region of the mitochondrial cytochrome

oxidase I gene in analysis of annelid phylogeny. Zoologica Scripta

28:467^182.

Palumbi, S.R. 1996. Nucleic acid II: the polymerase chain reaction. Pp.

205-247 in: Hillis, D.M., Moritz, G. and Mable, B.K. (eds).

Molecular systematics. Sinauer Associates: Sunderland, Maryland.

Pegg, G.G., Sinclair, B., Briskey, L., and Aspden, WJ. 2006. MtDNA

barcode identification of fish larvae in the southern Great Barrier

Reef, Australia. Scientia Marina 70(S2): 7-12.

Pettibone, M.H. 1976. Revision of the genus Macellicephala McIntosh

and the subfamily Macellicephalinae Hartmann-Schroder

(Polychaeta, Polynoidae). Smithsonian Contributions to Zoology

229: 1-71.

Posada, D. 2008. jModelTest: phylogenetic model averaging.

Molecular Biology and Evolution 25(7): 1253-1256.

Raupach, M.J., Thatje, S., Dambach, J., Rehm, P., Misof, B., and

Leese, F. 2010. Genetic homogeneity and circum-Antarctic

distribution of two benthic shrimp species of the Southern Ocean,

Chorismus antarcticus and Nematocarcinus lanceopes. Marine

Biology 157(8): 1783-1797.

Richards, WJ., and Saksena, V.P 1980. Description of larvae and early

juveniles of laboratory-reared gray snapper, Lutjanus griseus

(Linnaeus) (Pisces, Lutjanaidae). Bulletin of Marine Science 30(2):

515-521.

Ronquist, F. and Huelsenbeck, J.P. 2003. MrBayes 3: Bayesian

phylogenetic inference under mixed models. Bioinformatics 19:

1572-1574.

Schuller, M. 2010. Evidence for a role of bathymetry and emergence in

speciation in the genus Glycera (Glyceridae, Polychaeta) from the

deep Eastern Weddell Sea. Polar Biology 34(4): 549-564.

Schuller, M., and Hutchings, P.A. 2012. New species of Terebellides

(Polychaeta: Trichobranchidae) indicate long-distance dispersal

between western South Atlantic deep-sea basins. Zootaxa 2395:

1-16.

Shank, T.M., Lutz, R.A., and Vrijenhoek, R.C. 1998. Molecular

systematics of shrimp (Decapoda: Bresiliidae) from deep-sea

hydrothermal vents: enigmatic “small orange” shrimp from the

Mid-Atlantic Ridge are juvenile Rimicaris exoculata. Molecular

Marine Biology and Biotechnology 7(2): 88-96.

Smith, C.R., Mincks, S.L., Glover, A.G., DeMaster, D.J., and Sumida,

P.Y.G. 2002. FOODBANCS on the Antarctic Peninsula shelf: the

benthic food bank hypothesis and the seasonal deposition pulse.

American Geophysical Union, Ocean Sciences Meeting, Honolulu,

HI. EOS 83.

Srivathsan, A., and Meier, R. 2012. On the inappropriate use of

Kimura-2-parameter (K2P) divergences in the DNA-barcoding

literature. Cladistics 28(2): 190-194.

St0p-Bowitz, C. 1991. Some new or rare species of pelagic polychaetes

from the Gulf of Guinea. Ophelia Supplement 5: 261-270.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and

Kumar, S. 2011. MEGA5: molecular evolutionary genetics

analysis using maximum likelihood, evolutionary distance, and

maximum parsimony methods. Molecular Biology and Evolution

28(10): 2731-2739.

Templeton, A.R., Crandall, K.A., and Sing, C.F. 1992. A cladistic

analysis of phenotypic associations with haplotypes inferred from

restriction endonuclease mapping and DNA sequence data. III.

Cladogram estimation. Genetics 132(2): 619-633.

Thatje, S., Hillenbrand, C.-D., and Larter, R. 2005. On the origin of

Antarctic marine benthic community structure. Trends in Ecology

and Evolution 20(10): 534—540.

Uschakov, P.V. 1971. On a new abyssal species of Macellicephala

McIntosh (Polychaeta, Errantia) from the Aleutian Trench. Trudy

Instituta Okeanologii Akademiia Nauk SSSR 92: 36-40.

Valdez-Moreno, M., Vasquez-Yeomans, L., Ellas-Gutierrez, M.,

Ivanova, N.V., and Hebert, P.D.N. 2010. Using DNA barcodes to

connect adults and early life stages of marine fishes from the

Yucatan Peninsula, Mexico: potential in fisheries management.

Marine and Freshwater Research 61(6): 655-671.

Vogler, A.P, and Monaghan, M.T. 2007. Recent advances in DNA

taxonomy. Journal of Zoological Systematics and Evolutionary

Research 45(1): 1-10.

Webb, K.E., Barnes, D.K., Clark, M.S., and Bowden, D. 2006. DNA

barcoding: a molecular tool to identify Antarctic marine larvae.

Deep-Sea Research Part II: Topical Studies in Oceanography

53(8-10): 1053-1060.

Wiens, J.J. 2007. Species delimitation: new approaches for discovering

diversity. Systematic Biology 56(6): 875-878.

Wilkins, J.S. 2011. Philosophically speaking, how many species

concepts are there? Zootaxa 2765: 58-60.

Wilson, N.G., Hunter, R.L., Lockhart, S.J., and Halanych, K.M. 2007.

Multiple lineages and absence of panmixia in the “circumpolar”

crinoid Promachocrinus kerguelensis from the Atlantic sector of

Antarctica. Marine Biology 152(4): 895-904.

Wilson, N,G„ Schrodl, M., Halanych, K.M. 2009. Ocean barriers and

glaciation: evidence for explosive radiation of mitochondrial

lineages in the Antarctic sea slug Doris kerguelenensis (Mollusca,

Nudibranchia). Molecular Ecology 18:965-984.

WoRMS Editorial Board. 2013. World Register of Marine Species.

Available from http://www.marinespecies.org at VLIZ.

Memoirs of Museum Victoria 71:217-236 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Original specimens and type localities of early described polychaete species

(Annelida) from Norway, with particular attention to species described by O.F.

Muller and M. Sars

ElVIND OuG 1 * (http://zoobank.org/urn:lsid:zoobank.org:author:EF42540F-7A9E-486F-96B7-FCE9F94DC54A),

TORKILD BAKKEN 2 (http://zoobank.Org/urn:lsid:zoobank.org:author:FA79392C-048E-4421-BFF8-71A7D58A54C7) AND

JON ANDERS KoNGSRUD 3 (http://zoobank.org/urn:lsid:zoobank.org:author:4AF3F49E-9406-4387-B282-73FA5982029E)

1 Norwegian Institute for Water Research, Region South, Jon Filletuns vei 3, NO-4879 Grimstad, Norway (eivind.oug@niva.no)

2 Norwegian University of Science and Technology, University Museum, NO-7491 Trondheim, Norway (torkild.bakken@ntnu.no)

3 University Museum of Bergen, University of Bergen, PO Box 7800, NO-5020 Bergen, Norway (jon.kongsrud@um.uib.no)

* To whom correspondence and reprint requests should be addressed. E-mail: eivind.oug@niva.no

Abstract Oug, E., Bakken, T. and Kongsrud, J.A. 2014. Original specimens and type localities of early described polychaete species

(Annelida) from Norway, with particular attention to species described by O.F. Muller and M. Sars. Memoirs of Museum

Victoria 71: 217-236.

Early descriptions of species from Norwegian waters are reviewed, with a focus on the basic requirements for re¬

assessing their characteristics, in particular, by clarifying the status of the original material and locating sampling sites. A

large number of polychaete species from the North Atlantic were described in the early period of zoological studies in the

18th and 19th centuries. The descriptions were often short or referred solely to general characteristics, which by today’s

standards are considered inadequate for species discrimination. As a result, a number of taxa among the so-called ‘well-

known and widely distributed’ species have later been confused with morphologically similar species. Close to 100

presently valid species were described from Norwegian waters before 1900. The most prolific contributions were made by

O.F. Muller (with about 20 species from 1771-1776) and Michael Sars (with more than 50 species from 1829-1872). Other

authors in the 19th century included Anders 0rsted, Heinrich Rathke and Gerhard Armauer Hansen. Descriptions were

mostly in Latin (O.F. Muller) or in Norwegian or Danish with the diagnosis in Latin (M. Sars and contemporary naturalists).

Original material from O.F. Muller is not known to exist. Original material from M. Sars and contemporary scientists does

still exist, but is often not identified as original (‘syntypes’) and is occasionally spread over several museum collections.

Locating original sampling localities (‘type localities’) has been achieved by combining information from various

literature sources, labels of original material (when extant), and knowledge of historic place names.

Keywords Polychaeta, early-described species, original material, sampling sites, Norway

Introduction

The Nordic countries were central in the early studies of

marine fauna and flora in scientific history. In the second half

of the 18th century, several scientists, e.g. Johan Ernst

Gunnerus, Otto Friderich Muller and Otto Fabricius,

corresponded with Carl Linnaeus and contributed to his

Systema naturae, as well as describing new species in their

own publications (Anker, 1950; Wolff, 1994; Moen, 2006). In

the 19th century, a large number of species were described

from Nordic waters by Michael Sars, Anders 0rsted, Heinrich

Rathke, Gerhard Armauer Hansen, Anders Johan Malmgren,

Henrik Nikolai Kr0yer and Ivar Arwidsson, for example.

Typically, many of the species are among the most common

and abundant in the areas in which they were described.

A number of the early-described species are insufficiently

characterised with regard to present-day requirements in

species taxonomy. In numerous cases, species have been

confused with morphologically similar species and reported

from wide geographic areas. From the late part of the 19th

century, there emerged a tradition of lumping polychaete

species (Barroso et al., 2010). Fauvel (1959) expressed

explicitly a view that polychaete species had a high degree of

morphological variation and consequently had a wide

geographic distribution. It is presently agreed that the reported

wide distribution results from confusing similar species with

separate distributions and also different responses to

environmental conditions. This has been clear for some time

from critical morphological studies (e.g. Williams, 1984;

218

E. Oug, T. Bakken & J.A. Kongsrud

Mackie and Pleijel, 1995; Koh et al., 2003). Furthermore,

recent studies have shown that even in more restricted areas,

several morphologically similar but genetically different

forms have been demonstrated among common species (e.g.

Breton et al., 2003; Nygren et al., 2005; Bleidorn et al., 2006).

In Norway, work has been initiated to trace original material

and type localities for early-described species of polychaetes.

The main intention is to clarify the status of the species and

through this establish a basis for characterisation of species in

accordance with present-day standards of taxonomy. The advent

of molecular genetic methods presents new challenges in

taxonomy, while providing powerful tools to discriminate

between confused species. It has long been understood that the

knowledge of polychaetes in Norwegian waters is incomplete

due to many unresolved systematic problems, particularly

among early-described species. Close to 100 presently valid

species of polychaetes were described from Norwegian waters

during the 18th and 19th centuries. The present paper gives a

general overview of the early studies, places of collection,

nature of original publications and status of original material.

The most influential individuals in the 18th and 19th centuries

were Otto Friderich Muller and Michael Sars, respectively, and

most of the focus is on their contributions. Part of the present

work has been carried out under the framework of the Norwegian

Taxonomy Initiative, which is a broad-scale program aimed at

mapping species diversity in Norway.

Abbreviations

NHMO Natural History Museum, Oslo

NMWC National Museum of Wales, Cardiff

NNHE Norwegian North-Atlantic Expedition

NTNU-VM Norwegian University of Science and

Technology, University Museum, Trondheim

USNM National Museum of Natural History, Washington

ZMBI Zoological Museum, Berlin

ZMBN University Museum of Bergen

The need to reassess the characteristics of early-described

species

The proper characterisation of early-described species is

necessary to resolve complexes of confused species and for

discriminating and diagnosing related new species. Without

this clarification, species descriptions may confuse characters

from similar species. The need for precise species identification

is crucial in monitoring and for environmental assessment

studies, e.g. the European Water Framework Directive, where

the detection of species changes is the very basis for assessing

to what degree human influences or climate changes are

affecting natural ecosystems. Inaccurate species discrimination

reduces the sensitivity of monitoring tools.

There is also a need to clarify which of several species is

the originally named species when species complexes are

resolved. The rapidly expanding use of molecular genetic

methods has demonstrated how cryptic species are common in

the marine environment (Knowlton, 2000). From Nordic

waters, several examples of cryptic species among early-

described phyllodocids have been demonstrated (Nygren et

al., 2009, 2010; Nygren and Pleijel, 2011). For the nereidid

Hediste diversicolor (O.F Miiller, 1776) and the orbiniid

Scoloplos armiger (O.F. Muller, 1776), clear genetic

differences between populations have been documented

(Breton et al., 2003; Bleidorn et al., 2006; Audzijonyte et al.,

2008). Furthermore, in international gene sequencing

databases such as the database holding DNA-barcoding

sequences, BOFD (Barcode of Fife Data System)

(Ratnasingham and Hebert, 2007), there are several examples

of different molecular sequences being uploaded for the same

taxon, reflecting the improper discrimination of related

species. For example, recent searches in the BOFD database

for H. diversicolor and Cirratulus cirratus (O.F. Muller, 1776)

showed three and four putative species, respectively, indicated

by DNA barcoding (access date 3 April 2014). The rapidly

expanding use of modern genetic analytical techniques, hence,

necessitates that correct genetic information can be obtained

for early-described species.

In order to clarify the characters of insufficiently described

species, the established practice in taxonomy is to examine the

original material (type specimens), or in cases where new

material is needed, to collect at the same location where the

original material was collected (type locality). These

specifications imply that the status of the original material

should be known, and the locality for collecting new material

(type locality) should be fixed. The International Code of

Zoological Nomenclature (ICZN) provides rules governing

what constitutes original material and how type localities

should be fixed (ICZN, 1999). New material may be collected

in cases where the original material has been lost, for critical

morphological studies that cannot be performed on original

material, and for molecular genetic analyses. Material from

type localities (topotypic material) may also be of great help if

the original specimens are of poor quality but still in a

condition to confirm conspecific status. Genetic sequences

from the same samples will provide genetic characterisation

of the species in question and provide museum vouchers for

specimens used in genetic analyses (Pleijel et al., 2008).

The collection of new material is particularly important

for genetic characterisation. Attempts to obtain genetic

information from old museum specimens have generally

failed. Museum specimens have traditionally been preserved

in formalin, which degrades and fragments DNA, and may

cause a number of changes to the DNA (Skage and Schander,

2007). Protocols have been tested to accommodate the

challenge to extract DNA suitable for sequencing without

much success (Schander and Halanych, 2003; Skage and

Schander, 2007). The general need for new material in

genetically supported taxonomic work underlines the

importance of critically selecting the place to sample the

material for linking molecular genetics to traditional

taxonomy. The type locality can provide a link between

modern genetically based taxonomy and traditional

morphology-based taxonomy.

Original specimens and type localities of early described polychaete species from Norway

219

Table 1. Summary of valid species named by O.F. Muller. Access number and annotations in ‘prodromus’ (Muller, 1776) is shown: +, species

indicated as found and diagnosed by Muller himself; #, species described by other authors; no particular indication. Species described in

Zoologia Danica are shown by volume number and locality when stated. See Figure 6 for localities.

Valid name

Prodromus:

number/reference

Zoologia

Danica

Locality (-ies)

Descriptions/revisions

Originally in Lumbricus

Nephtys ciliata

2607/-

Vol. Ill

Norway (no precise

locality)

Fauchald (1963), Rainer (1991)

Cirratulus cirratus

2608/#

Scoloplos armiger

2610/+

Vol. I

Kristiansand

Scoletoma fragilis

2611/+

Vol. I

Dr0bak in Oslofjord

Frame (1992)

Originally in Amphitrite

Amphitrite cirrata

2617/#

Muller (1771)

Pista cristata

2620/+

Vol. II

Kristiansand

Pherusa plumosa

2621/#

Vol. Ill

Greenland; Norway (no

precise locality)

Fabricius (1780); emended J.C.

Abilgaard (Haase, 1915)

Pectinaria auricoma

2622/-

Vol. I

Dr0bak and

Kristiansand

Originally in Nereis

Hediste diversicolor

2624/#

Hyalinoecia tubicola

2625/+

Vol. I

Dr0bak in Oslofjord

Syllis armillaris

2626/+

Muller (1771), Licher (1999)

Eunice pennata

2630/+

Vol. I

Dr0bak in Oslofjord

Winsnes (1989), Fauchald (1992)

Nereimyra punctata

2633/+

Vol. II

Dr0bak in Oslofjord

Pleijel et al. (2012)

Glycera alba

2634/+

Vol. II

Norway (no precise

locality)

Procerea prismatica

2637/-

Nygren (2004)

Spio filicornis

2640/#

Fabricius (1780), Meissner et al. (2011)

Originally in Aphrodita

Pholoe longa

2646/#

Fabricius (1780), Pettibone (1992)

Originally in Dentalium (Mollusca)

Ditrupa arietina

2853/+

ten Hove and Smith (1990)

Orig in Tubularia (Cnidaria part)

Fabricia stellaris

3065/+

Muller (1774), Fitzhugh (1990)

Not in ’prodromus’

Myrianida prolifera (as

Nereis prolifera)

Vol. II

Norway (no precise

locality)

Nygren (2004)

Scololepis squamata (as

Lumbricus squamatus)

Vol. IV

Helgoland

Most probably described by J.C.

Abildgaard

220

E. Oug, T. Bakken & J.A. Kongsrud

The earliest described species: O.F. Muller and Zoologia

Danica

Otto Friderich Mtiller (1730-1784) (variant spelling Otto

Friedrich) was one of the most important early naturalists and

one of the pioneers in marine biology (fig. 1). He was Danish

and performed most of his studies in Denmark, but came to

work in Norway during the 1770s through marriage to a

wealthy Norwegian widow. In Norway, he was based in

Dr0bak, a small settlement about 30 km south of Oslo (at the

time called Christiania), but during summer periods he made

travels to the south coast of Norway and Norwegian inland

areas to collect animals and plants. He described species from

a variety of species groups from fresh water as well as marine

habitats. In addition to polychaetes, he described species of

molluscs, crustaceans, echinoderms and several parasite

groups (Anker, 1950; Wolff, 1994).

O.F. Muller’s most important contribution is the large and

ambitious Zoologia Danica (complete name Zoologiae

Danica seu Animalium Daniae et Norvegiae variorum ac

minus notorum, Descriptiones et historia [Descriptions and

natural history of the rare and little known animals of Denmark

and Norway]), which was intended to include all known

animal species in Denmark and Norway. The work was never

completed, but four volumes were released (Miiller, 1777-84;

Muller and Abildgaard, 1789; Muller et al., 1806) before the

work was discontinued (Anker, 1950; Wolff, 1994). Muller

died soon after the release of the second volume, and the third

and fourth volumes were edited and completed by

contemporary naturalists in Copenhagen (P.C. Abildgaard, M.

Vahl, J. Rathke, H.S. Holten). The text was in Latin, but

parallel editions with text in Danish and German were made of

the first volume. All species were illustrated by Muller’s

brother, C.F. Muller, who also edited a new release of the two

first volumes in 1788 (Muller, 1788). Fig. 2 presents an example

of the quality of the text and illustrations in Zoologia Danica.

Prior to the release of Zoologia Danica, a so-called

forerunner Zoologia Danica prodromus was published in 1776

(Muller, 1776). The ‘prodromus’ is essentially an annotated

catalogue of all contemporary known species of animals in

Denmark and Norway and the first inventory based on the

Linnean classification system. In total, more than 3000 species

are included. All species were entered with an access number,

scientific name (binomial), brief diagnosis in Latin, references,

and vernacular names if appropriate (fig. 3). New species

detected by Muller were entered pending a full description in

the main work. For several of these, however, no more

descriptions were given and the brief and usually very general

diagnosis in the ‘prodromus’ is the only extant information.

For several species described by other authors (e.g. Hans

Str0m and Otto Fabricius) and by Muller himself in previous

works (Muller, 1771), the scientific name given in the ‘prodromus’

is the first name published in accordance with the nomenclatural

rules and hence the oldest available name of the species. Later,

this caused much confusion. One example is the spionid Spio

filicornis (listed as Nereis filicornis in ‘prodromus’), which was

described by Otto Fabricius from Greenland (Fabricius, 1780).

Spio filicornis was for a long time considered a European species,

Figure 1. Otto Friderich Muller. From drawing by Cornelius H0yer.

Reproduced from Wolff (1994).

but has recently been re-described, based on newly collected

material from Greenland (Meissner et al., 2011). This is

particularly relevant to determination of type localities for the

species, which in several cases are still not settled.

A list of valid polychaete species named by O.F. Muller is

given in table 1. Muller presented information on sampling

localities, mostly as part of the descriptions in Zoologia

Danica. In some cases details may be found in travel reports

and letters. For some species, the sampling locality is exactly

specified, but for others, only a general area is indicated. For

species cited from other authors, the sampling localities may

be found in their descriptions. Tracing type localities may,

therefore, be uncertain and requires information from different

text sources. For several species, e.g. Cirratulus cirratus

(Muller, 1776) and Hediste diversicolor (Muller, 1776), the

type locality has not been clarified. Muller kept a large

collection of specimens (Anker, 1950), but no polychaete

material is presently known to exist (D. Eibye-Jacobsen, pers.

comm.). A more detailed review of the species named by O.F.

Muller is in progress and will be published elsewhere.

Original specimens and type localities of early described polychaete species from Norway

221

21 HJJtVDO GR0SSA

Ek uno [jinique mjreriem mueidjm cxccmers vidL

!■} moms inri'ftimim eunuduatmcx paro in dfXtra Vtiirris pane pmfriilLt.

In VEN’ERE jsxqlkta iusta cardinal) inu-a bjiiKtiias linJhuii caiuolum auimt-

Jis mcntirui-.

Ftg !■ Hinuiii™ * litJDi

Fig. s, iiiukm a vcnrrt nttinli flUgnitujLne ftflii.

F'ig. j. AllIMill! iiirjiJ.iiLs tkliiiniiuc f.‘dl>nMii if pitifinouiru will iTugnituJinc,

Fig | tmigsritm miiilofum in j'dirin-i jwiibili,

Fig. j. Autid UM^ukudiivs ei!n tat.

Tar. xxil

LVMBRICVS nwaus,

Lvmbkjcvs ruber > vemicis lawralibus Mis, feds fticjcuhtis.

Zooi. 1) pr, j.

Dim. Skcor^Ormcn,

Facies ontniuo Ismthitd ttrrtfrrir, wawitili dilKhftiorcs iiagilcsquc, prorfus vri

in Info tmejiri, vim ioo; bin! tapin' prujiimi Blwquc pcdibos, JhirLmaqnc Idu de-

feSto pirs iioftiuir arnica; altera tnim, qu«c ergo pvUica « abrupt* videbamr, ruilii

didimc minus uinotuit.

Pirilc.t {implices; fafcicuio tniin fstarum rnioruru, fubiacCntetjuc papilla carnca lotcs

brcuiorc, tilfa, cowpominiur.

CaFvt ecmftac Uguta onuitsa, [iibtus soncaua; infra lianc fuLitus os rugululiim,

pal pH] ik liini imruuli, earnci.

Jn argilbfts liiuis DrUSacbifti/ii rati.

Fisj. I. Lumbricniti frajiSim mrnrjii migiuiir.iiise,.

Fig. %. f-s amicA C’jfmijjn.i uiiiai. cjjmic In|>£c'iac. viT ji .

Fi^. 3, pjxioii in&rwttuv wpes* <uro wc « eullo aiditi magnutudinc (iflit.

LVMBRiCVS armiger.

Lcmbricvs ruber, laineflis ventiis Jancevlfici-;, geminatisj ainice

mi!! i S. Z ml D. prodr. its 1 a

Lonji. 20 Jin. lac. I tin.

Corpus teres, rufum, fcgnicntis vltra ccmum compofrum, horum 17 prior*

mmica, fribtus pun8is vcrinque binis nigricsntibus, alrero inaiure rtbtamur; reliqui

tinikb fcu vmrx]iie in oollam albklam eleuira; haec vcmrcm verfus vcrinqu!; promincr

ae verrucula rtfla a-nranaiuri time adiacerftea (implex, breuis, ccnerrinia, icgre lunrl

CDiitpikitJi Segment* bina murids pmxiiiiJ fuijs vamds, rdiqua goftataruin j,raster

vtiru-

The second era: Michael Sars and the beginning of

systematic descriptions of Norwegian marine fauna

After O.F. Muller, there was a period with few investigations

of the Norwegian marine fauna until about 1830, when Michael

Sars started his career. From about 1840, several other

scientists were active, and the latter half of the century was a

very prolific period in the systematic description of the marine

fauna (Sakshaug and Mosby, 1996). Michael Sars (1805-1869)

was born in Bergen on the west coast of Norway, where he also

started his studies of marine animals (fig. 4). He was educated

in theology and practiced as a vicar, first in Kinn near Flor0

(1831-40) and later in Manger near Bergen (1840-54). He was

awarded a professorship at the University of Oslo (then

Christiania) from 1855, where he remained until his death in

1869 (0kland, 1955; Helle, 2006). Starting in 1849, he made

^W.AfT'x Kit

Figure 2. Text page and plate for descriptions of Scoletoma fragilis (=

Lumbricus fragilis ) and Scoloplos armiger (= Lumbricus armiger)

from Zoologia Danica Vol. I (Muller, 1777-84).

several travels to northern Norway to collect specimens. In

Oslo he collected in the Oslofjord with his main focus on the

region near Dr0bak.

Michael Sars had abroad interest in several marine species

groups and early in his career earned an international

reputation for studies of the life histories of cnidarians and

echinoderms. Throughout his career, he described new species

in various groups, among them cnidarians, polychaetes,

molluscs and echinoderms. In the 1860s he also sampled,

together with his son Georg Ossian Sars, numerous species

from the great depths (>800 m) in offshore areas. The deep sea

had previously been considered lifeless, and their findings

raised a broad international interest in deep-sea expeditions.

In Norway the findings contributed to the funding of the

Norwegian North Atlantic Expedition, which was carried out

in 1876-78 (Sakshaug and Mosby, 1996; Helle, 2006).

222

E. Oug, T. Bakken & J.A. Kongsrud

Table 2. Chronological overview of polychaete species described by Michael Sars from Norwegian waters. See fig. 6 for localities. NHMO =

Natural History Museum Oslo; ZMBN =University Museum of Bergen; ZMBI = Zoological Museum Berlin; NMWC = National Museum of

Wales, Cardiff; USNM = National Museum of Natural History, Washington DC.

Original name

Valid name

References, including

later descriptions

Original

localities

Type material and remarks

M. Sars 1829

Flabelligera affinis

Flabelligera affinis M. Sars,

1829

Sars 1829:31-34, pi.

3, figs 16-19

Bergen area

Original material probably lost

Terebella longicornis

Sars 1829: 28-31, pi.

1, figs 7-9

Bergen area

Uncertain status, original

material probably lost

M. Sars 1835

Terebellides stroemii

Terebellides stroemii M.

Sars, 1835

1835: 48-50, pi. 13,

figs 31a-e

Glesvaer near

Bergen

Original material lost. Neotype

NHMO, selected from Manger

near Bergen (Parapar and

Hutchings, in press)

Amphitrite gunneri

Amphicteis gunneri (M.

Sars, 1835)

1835: 50-51, pi. 11,

figs 30a-d; 1865: 2-6,

9-10 (offprint)

Glesvaer near

Bergen; Flor0

Lectotype and paralectotype,

NHMO (Hartley, 1985). Type

locality not specified on label

of lectotype (Glesvaer and

Flor0).

Sabella? octocirrata

Ampharete octocirrata (M.

Sars, 1835)

1835: 51-52, pi. 13,

figs 32a-g

Glesvaer near

Bergen; Flor0

Possible syntypes, NHMO

(Holthe, 1986)

Serpula libera

Ditrupa arietina (O.F.

Muller, 1776)

1835: 52-54, pi. 12,

figs 33a-c; 1851: 84

Bergen area

including

Glesvaer; Flor0

Possible syntypes, NHMO. M.

Sars (1835) indicates

synonymy with D. arietina

Chaetopterus

norvegus [sic!]

Chaetopterus norvegicus M.

Sars, 1835

1835: 54-5S, pi. 11,

figs 29a-h; 1851: 87;

1861b: 86-87; 1861c:

255-256

Bergen area;

Flor0

Syntypes, NHMO

Nereis virens

Alitta virens (M. Sars, 1835)

1835: 58-60, pi. 10,

figs 27a-c

Bergen area

Possible syntypes, NHMO

Phyllodoce foliosa

Notophyllumfolio sum (M.

Sars, 1835)

1835: 60-61, pi. 9, figs

26a-e; 1873a: 22A-226

Manger near

Bergen

Lectotype and 3

paralectotypes, NHMO

(Nygren et al., 2010)

Onuphis conchylega

Nothria conchylega (M.

Sars, 1835)

1835: 61-63, pi. 10,

figs 28a-e; 1851: 89

Bergen area;

Flor0

Lectotype, NHMO, selected

from Flor0 (Fauchald, 1982)

Polynoe gelatinosa

Alentia gelatinosa (M. Sars,

1835)

1835: 63-64, pi. 9, figs

25a—c

Bergen area;

Flor0

Original material probably lost

(Loshamn, 1980)

Nais ? clavicornis

Macrochaeta clavicornis

(M. Sars, 1835)

1835: 6A-65, pi. 9, figs

24a-d

Flor0

Original material probably lost

(Banse, 1969)

M. Sars 1846

Oligobranchus roseus

Scalibregma inflatum

Rathke, 1843

1846: 91-93, pi. 10,

figs 20-27; 1863: 52;

1873a

Flor0

Holotype, NHMO (Mackie,

1991)

M. Sars 1851

Notomastus latericeus

Notomastus latericeus M.

Sars, 1851

1851: 79-80; 1856:

9-12 pi. II, figs 8-17

Flor0;

Komagfjord

Syntypes, NHMO

Original specimens and type localities of early described polychaete species from Norway

223

Original name

Valid name

References, including

later descriptions

Original

localities

Type material and remarks

Clymene miilleri

Proclymene muelleri (M.

Sars, 1851)

1851: 80-81; 1856:

13-15, pi. 1, figs 1-7;

1862a: 91 (21-22 in

offprint)

Bergen area

Syntypes. NHMO

Clymene cirrosa

lEuclymene droebachiensis

(M. Sars in G.O. Sars, 1872)

1851: 81

Troms0

Holotype, NHMO, originally

described based on posterior

fragment. Possible synonym of

Euclymene droebachiensis

(Arwidsson, 1906)

Ammochares assimilis

Owenia assimilis (M. Sars,

1851)

1851: 81-82

Troms0; Bergen

area

Syntypes, NHMO. Species

reinstated by Koh et al. (2003)

Sabella crassicornis

Bispira crassicornis (M.

Sars, 1851)

1851: 82-83; 1862b:

119-121 (28-29 in

offprint)

Troms0

Lectotype, NHMO;

paralectotype, ZMBN

(Knight-Jones and Perkins,

1998)

Sabella papillosa

Euchone papillosa (M. Sars,

1851)

1851: 83; 1862b:

129-130 (38-39 in

offprint)

0ksfjord;

Hav0ysund

Syntypes, NHMO

Sabella neglecta

Potamilla neglecta (M. Sars,

1851)

1851: 83; 1862b:

122-123 (31-32 in

offprint)

Hammerfest;

Troms0

Possible syntypes, NHMO.

Neotype (!) selected, ZMBI

(Knight-Jones, 1983)

Serpula polita

Placostegus tridentatus (J.C.

Fabricius, 1779)

1851: 84

Bergen; 0ksfjord;

Komagfjord

Syntypes, NHMO

Sabellides cristata

Melinna cristata (M. Sars,

1851)

1851: 85-86; 1856:

19-24, pi. II, figs 1-7

Bergen;

Hav0ysund

Original material probably

lost. Neotype, NMWC,

selected from Hjeltefjord near

Bergen (Mackie and Pleijel,

1995)

Nerine cirrata

Laonice cirrata (M. Sars,

1851)

1851: 87-88; 1862a:

64—65 (15-16 in

offprint)

Ure in Lofoten;

Troms0;

Hammerfest

Lectotype, NHMO, selected

from Ure (Sikorski, 2011)

Nerine folio sa

Possibly synonym of

Scolelepis foliosa (Audouin

and Milne Edwards, 1833)

1851: 87-88; 1862a:

61-64 (12-15 in

offprint)

Bergen area

Syntypes, NHMO

Oniscosoma arcticus

Spinther arcticus (M. Sars,

1851)

1851: 90; 1862a:

52-55

Komagfjord

Syntypes, NHMO

Euphrosyne armadillo

Euphrosyne armadillo M.

Sars, 1851

1851: 91; 1862a:

55-56 (6-7, offprint)

Bergen area

Syntypes, NHMO

M. Sars 1856

Spiochaetopterus

typicus

Spiochaetopterus typicus M.

Sars, 1856

1856: 1-8, pi. I, figs

8-21

Manger (Helle)

near Bergen

Syntypes, NHMO

Clymene quadrilobata

Pseudoclymene

quadrilobata (M. Sars,

1856)

1856: 15-16, pi. II,

figs 18-22

Flor0; Manger

near Bergen

Syntypes, NHMO. Replaced

by Clymene gracilis new name

by Sars (1861c, 1862a).

Redescribed as distinct species

by Arwidsson (1906)

Sabellides borealis

Ampharete borealis (M.

Sars, 1856)

1856: 22-24

Reine in Lofoten;

0ksfjord

Possible syntypes, NHMO

(Holthe, 1986)

224

E. Oug, T. Bakken & J.A. Kongsrud

Original name

Valid name

References, including

later descriptions

Original

localities

Type material and remarks

Sabellides sexcirrata

Samytha sexcirrata (M.

Sars, 1856)

1856: 23-24

Manger near

Bergen

Possible syntypes, NHMO

(Holthe, 1986)

M. Sars 1861a

Polynoe nodosa

Eunoe nodosa (M. Sars,

1861)

1861a: 58-59

Hav0ysund

Syntypes, NHMO (Bamich

and Fiege, 2010)

Polynoe asperrima

Acanthicolepis asperrima

(M. Sars, 1861)

1861a: 59

Manger and

Herdla near

Bergen

Syntypes, NHMO C3154

(Bamich et al., 2000)

Polynoe rarispina

Harmothoe rarispina (M.

Sars, 1861)

1861a: 60

Vads0

Syntypes, NHMO (Bamich

and Fiege, 2009)

Polynoe scabriuscula

Gattyana cirrhosa (Pallas,

1766)

1861a: 60-61; 1861c:

252-253; 1869: 254

Kristiansund,

Vads0

Possible syntypes, NHMO. M.

Sars (1869) indicates

synonymy with G. cirrhosa

M. Sars 1861b

Chaetopterus sarsii

Chaetopterus sarsii Boeck

in Sars, 1861

1861b: 85-87; 1861c:

255; 1863: 50-51;

1873a: 261-262

Beian in

Trondheimsfjord

Syntypes, NHMO. Boeck,

1860: 252 nomen nudwn

M. Sars 1861c

Ophiodromus vittatus

Ophiodromus flexuosus

(delle Chiaje, 1828)

1861c: 255; 1862a:

87-88 (18-19 in

offprint); 1873a: 229

Kristiansund,

Molde, Manger,

Asgardstrand in

Oslofjord

Type probably lost on loan

Clymene gracilis

Praxillella gracilis (M. Sars,

1861)

1861c: 256; 1862a:

91-92 (22-23 in

offprint)

Bollaeme in

Oslofjord; Molde;

Kristiansund;

Gr0t0y and

Slattholmen in

Lofoten;

Ramfjord near

Troms0; Vads0

Syntypes, NHMO. Clymene

gracilis introduced as new

name for Clymene

quadrilobata Sars, 1856.

Redescribed as distinct species

by Arwidsson (1906)

Clymene biceps

Chirimia biceps (M. Sars,

1861)

1861c: 256-258;

1862a: 93-95 (24-25

in offprint)

Bollaeme in

Oslofjord;

Kristiansund;

Troms0;

0ksfjord; Vads0

Syntypes, NHMO

M. Sars 1862a

Euphrosyne cirrata

Euphrosyne cirrata (M.

Sars, 1862)

1862a: 56 (7 in

offprint); 1863: 50

Manger near

Bergen

Possible syntypes, NHMO

Eurythoe borealis

Pareurythoe borealis (M.

Sars, 1862)

1862a: 58-59 (9-10 in

offprint)

Manger near

Bergen

Material lost; original

description based on notes

only (Sars 1862a)

Nerine oxycephala

Aonides oxycephala (M.

Sars, 1862)

1862a: 64 (15 in

offprint)

Flor0

Syntypes, NHMO

Castalia aurantiaca

Hesiospina aurantiaca (M.

Sars, 1862)

1862a: 90 (20 in

offprint)

Flor0; Manger

near Bergen

Lectotype, NHMO, selected

from Manger (Pleijel, 2004)

Castalia longicornis

Hesiospina aurantiaca (M.

Sars, 1862)

1862a: 90 (21 in

offprint)

Manger near

Bergen

Original material lost. Neotype

= lectotype of H. aurantiaca

(Pleijel, 2004)

Original specimens and type localities of early described polychaete species from Norway

225

Original name

Valid name

References, including

later descriptions

Original

localities

Type material and remarks

M. Sars 1862b

Dasychone decora

Branchiomma infarctum

(Kr0yer, 1856)

1862b: 124—125

(33-34 in offprint)

Troms0;

Hammerfest;

Vads0

Syntypes, NHMO

Dasychone argus

Branchiomma bombyx

(Daly ell, 1853)

1862b: 125-126

(34—35 in offprint);

1863: 67-68

Glesvaer and

Manger near

Bergen;

Asgardstrand in

Oslofjord

Syntypes, NHMO

Chone Kroyerii

Chone kroyerii M. Sars,

1862

1862b: 126-128

(35-37 in offprint)

Manger near

Bergen; Troms0;

Vads0

Possible syntypes, NHMO.

Type material not indicated

(Tovar-Hemandez, 2007)

Chone rubrocincta

Euchone rubrocincta (M.

Sars, 1862)

1862b: 128-129

(37-38 in offprint);

1863: 66-67

Flor0; Manger

Syntypes, NHMO (Banse,

1972, Tovar-Hemandez, 2007)

M. Sars 1863

Polynoe nivea

Leucia nivea (M. Sars,

1863)

1863: 39^12

Beian in

Trondheimsfjord

Holotype, NHMO (Loshamn,

1980; Chambers, 1989;

Bamich and Fiege, 2010)

Polynoe clavigera

Harmothoe clavigera (M.

Sars, 1863)

1863: 42^16

Kristiansund

Holotype, NHMO (Bamich

and Fiege, 2009)

Polycirrus trilobatus

Amaeana trilobata (M. Sars,

1863)

1863: 53-58

Slattholmen in

Lofoten,

Kristiansund

Syntypes, NHMO

Terebella artifex

M. Sars 1865a

Lanice conchilega (Pallas,

1766)

1863: 58-66

Beian in

Trondheimsfjord

Syntypes, NHMO

Amphicteis

finmarchica

Ampharete finmarchica (M.

Sars, 1865)

1865a: 10-14 (6-10 in

offprint)

Ramfjord near

Troms0

Syntypes, NHMO

Polycirrus arcticus

Polycirrus arcticus M. Sars,

1865

1865a: 14-16 (10-13

in offprint)

Troms0; Vads0

Possible syntypes, NHMO

(Holthe, 1986)

Terebella ebranchiata Leaena ebranchiata (M.

Sars, 1865)

M. Sars 1867 (nomina nuda )

Clymene laeviceps

Lophosyllis maculata

M. Sars 1869 (nomina nuda )

Maldane? pellucida

Eumenia?

erucaeformis

Trophonia pallida Possibly synoym of

Diplocirrus glaucus

(Malmgren, 1867)

1865a: 16-20 (13-16

in offprint)

Varangerfjord

Possible syntypes, NHMO

(Holthe, 1986)

Synonymy indicated by M.

Sars (1869)

Trophonia pilosa

Pygophelia singularis

226

E. Oug, T. Bakken & J.A. Kongsrud

Original name

Valid name

References, including

later descriptions

Original

localities

Type material and remarks

Polynoe abyssicola

Harmothoe abyssicola

Bidenkap, 1894

Skrava in

Lofoten,

Oslofjord

Syntypes, NHMO. Described

by Bidenkap (1894). Revised

Bamich and Fiege (2009) on

specimens from Oslofjord

M. Sars in G.O. Sars 1872a

Paramphinome

pulchella

Paramphinome jeffreysii

(McIntosh, 1868)

1872a: 45^19, pi. 4,

figs 19-35.

Lofoten,

Oslofjord,

Alesund near

Molde

Possible syntypes, NHMO. M.

Sars, 1869: nomen nudum

Umbellisyllis fasciata

Possibly synonym of

Odontosyllis gibba

Claparede, 1863 (Nygren

2004)

1872a: 41^13, pi. 4,

figs 12-18

Flekkefjord near

Kristiansand,

Lofoten,

Hardangerfjord,

Kristiansund

Type material not confirmed.

M. Sars 1869: nomen nudum

M. Sars in G.O. Sars

1872b

Laenilla mollis

Austrolaenilla mollis (M.

Sars in G.O. Sars, 1872)

1872b: 406^107;

1873a: 207-214, pi.

14, figs 1-16

Drpbak in

Oslofjord

Type probably lost. Extended

description (1873a) includes

specimens from Lofoten

Eteone jucata

Possibly synonym of Eteone

flava (Fabricius, 1780)

(Pleijel 1993)

1872b: 407; 1873a:

226-229, pi. 15, figs

1-6

Dr0bak in

Oslofjord

Syntypes, NHMO. M. Sars

1867: nomen nudum

Onuphis quadricuspis

Paradiopatra quadricuspis

(M. Sars in G.O. Sars, 1872)

1872b: 407^108;

1873a: 216-222, pi.

15, figs 7-19

Dr0bak and

Asgardstrand in

Oslofjord; Skrova

in Lofoten

Lectotype, NHMO, selected

from Dr0bak (Fauchald,

1982). M. Sars, 1867: 291;

1869: nomen nudum

Aricia norvegica

Phylo norvegica (M. Sars in

G.O. Sars, 1872)

1872b: 408; 1873a:

236-240, pi. 16, figs

1-8

Bolaeme and

Dr0bak in

Oslofjord;

Lofoten

Syntypes, NHMO. M. Sars

1867: 291 nomen nudum

Trophonia flabellata

Pherusa flabellata (M. Sars

in G.O. Sars, 1872)

1872b: 409; 1873a:

249-252, pi. 17, figs

1-12

Dr0bak in

Oslofjord; Skrova

and Brettesnes in

Lofoten

Syntypes, NHMO. M. Sars

1869: nomen nudum

Chloraema pellucidum Flabelligera ajfinis M. Sars,

1829 (fide St0p-Bowitz

1948)

1872b: 409^110;

1873a: 252-261, pi.

16, figs 9-20

Not specified,

whole coast

Holotype, NHMO (St0p-

Bowitz, 1948). M. Sars 1867:

291: nomen nudum, as

Siphonostomum pellucidum;

1869: nomen nudum, as

Chloraema pellucidum

Prionospio plumosus

Prionospio plumosa (M.

Sars in G.O. Sars, 1872)

1872b: 410; 1873a:

263-268, pi. 17, figs

13-29

Dr0bak in

Oslofjord

Types, USNM (Sigvaldadottir,

1998). M. Sars 1867: 291

nomen nudum, as Ctenospio

plumosus

Spiophanes cirrata

Possibly synonym of

Spiophanes kroyeri Grube,

1860 (Sdderstrom 1920;

Meissner 2005)

1872b: 410^111;

1873a: 268-273, pi.

18, figs 1-16

Dr0bak in

Oslofjord; Skrova

in Lofoten

Type probably lost (Meissner,

2005)

Clymene planiceps

Isocirrus planiceps (M. Sars

in G.O. Sars, 1872)

1872b: 411^112

Dr0bak in

Oslofjord, Ter0y

in Hardanger

Syntypes, NHMO

Original specimens and type localities of early described polychaete species from Norway

227

Original name

Valid name

References, including

later descriptions

Original

localities

Type material and remarks

Clymene

Drobachiensis

Euclymene droebachiensis

(M. Sars in G.O. Sars, 1872)

1872b: 412

Drpbak in

Oslofjord

Syntypes, NHMO

Clymene affinis

Praxillella affinis (M. Sars

in G.O. Sars, 1872)

1872b: 412

Bolaeme in

Oslofjord

Syntypes, NHMO

Lumbriclymene

cylindricauda

Lumbriclymene

cylindricauda M. Sars in

G.O. Sars, 1872

1872b: 413

Drpbak in

Oslofjord

Syntypes, NHMO. M. Sars

1867: 291 nomen nudum , as

Clymene cylindricauda

Streblosoma

cochleatum

Streblosoma bairdi

(Malmgren, 1866)

1872b: 414

Dr0bak in

Oslofjord

Possible syntypes, NHMO

Streblosoma

intestinale

Streblosoma intestinale M.

Sars in G.O. Sars, 1872

1872b: 414

Dr0bak in

Oslofjord; Odvaer

in Lofoten

Possible syntypes, NHMO

Thelepodopsis flava

Thelepus cincinnatus

(Fabricius, 1780)

1872b: 415

Dr0bak in

Oslofjord

Possible syntypes, NHMO

Chone longocirrata

Chone longocirrata M. Sars

in G.O. Sars, 1872

1872b: 415^116

Dr0bak in

Oslofjord

Type probably lost (Tovar-

Hemandez, 2007)

Dasychone

inconspicua

Branchiomma inconspicuum

(M. Sars in G.O. Sars, 1872)

1872b: 416

Dr0bak in

Oslofjord

Syntypes, NHMO. M. Sars

1867: 291 nomen nudum

Protula borealis

uncertain, possibly synonym

of Protula tubularia

(Montagu, 1803)

1872b: 417

Not specified,

whole coast

Syntypes NHMO. M. Sars

1865b: nomen nudum; 1866:

nomen nudum; 1869: nomen

nudum

228

E. Oug, T. Bakken & J.A. Kongsrud

Table 3. Summary of polychaetes described from Norwegian waters in the 19th century by several authors: Heinrich Rathke, Anders 0rsted,

Georg Ossian Sars, Lauritz Esmark, Gerhard Armauer Hansen and Wilhelm Storm. See tables 1 and 2 for species described by O.F. Muller and

Michael Sars. NNHE, Norwegian North-Atlantic Expedition 1876-78; NHMO, Natural History Museum Oslo; NTNU-VM, Norwegian

University of Science and Technology, University Museum Trondheim; ZMBN, University Museum of Bergen. See fig. 6 for localities.

Original name

Localities

Remarks

Rathke 1843

Sigalion idunae

Molde

Synonymised with Sthenelais boa (Johnston, 1833)

Nereis grandifolia

Kristiansund

Synonymised with Nereis pelagica Linnaeus, 1758

Nereis sarsii

Synonymised with Hediste diversicolor (O.F. Muller, 1776)

Syllis cornuta

Kristiansund

Accepted

Syllis tigrina

Molde

Synonymised with Syllis armillaris (O.F. Muller, 1776)

Halimede venusta

Molde

Synonymised with Nereimyra punctata (O.F. Muller, 1776)

Ephesia gracilis

Molde

Synonymised with Sphaerodorumflavum (0rsted, 1843)

Aricia muelleri

Molde

Synonymised with Scoloplos armiger (O.F. Miiller, 1776)

Arenicola boeckii

Trondheimsfjord

Synonymised with Arenicolides ecaudata (Johnston, 1835)

Scalibregma inflatum

Molde

Accepted; neotype from Molde (Mackie, 1991)

Ammotrypane aulogaster

Dr0bak in Oslofjord; Molde

and Namsenfjord

Synonymised with Ophelina acuminata 0rsted, 1843

Ammotrypane limacina

Molde

Accepted as Ophelia limacina

Ammotrypane oestroides

Molde

Synonymised with Travisia forbesii Johnston, 1840

Siphonostoma vaginiferum

Kristiansund

Accepted as Flabelligera vaginifera

Siphonostoma villosum

Molde

Accepted as Brada villosa

Siphonostoma inhabile

Molde

Accepted as Brada inhabilis

Clymeneis stigmosa

0rsted 1845

Kristiansund and Molde

Accepted

Sigalion tetragonum

Dr0bak in Oslofjord

Accepted as Neoleanira tetragona

Syllis longocirrata

Dr0bak in Oslofjord

Accepted as Syllides longocirrata

Notophyllum polynoide

Dr0bak in Oslofjord

Nomen dubium, original material lost (Nygren et al., 2010)

Goniada norvegica

Dr0bak in Oslofjord

Accepted

Spione trioculata

Dr0bak in Oslofjord

G.O. Sars1873b

Nychia globifera

Storegga, off Western Norway

Accepted as Harmothoe globifera. Type lost (Bamich and Fiege,

2010)

Hermadion? hyalinus

Storegga, off Western Norway

Accepted as Adyte hyalina; holotype, NHMO (Bock et al., 2010)

Esmark 1874

Eteonopsis geryonicola

Oslofjord

Accepted as Ophryotrocha geryonicola, syntypes NHMO

Hansen 1879a

Polynoe aspera

NNHE stn 48

Accepted as Harmothoe aspera; type ZMBN

Polynoe (Eunoe) islandica

NNHE stn 48

Synonymised with Eunoe nodosa (M. Sars, 1861); type ZMBN

Nephthys atlantica

NNHE stns 18,31 and 87

Synonymised with Aglaophamus malmgreni (Theel, 1879); type

ZMBN

Original specimens and type localities of early described polychaete species from Norway

229

Original name

Localities

Remarks

Typhlonereis gracilis

NNHE stn 40

Accepted: lectotype, ZMBN 2183 (Bakken, 2003)

Onuphis hyperboraa

NNHE stn 18 and 48

Accepted as Nothria hyperborea; lectotype, ZMBN 2210, NNHE

stn 18 (Fauchald, 1982)

Scalibregma (?) abyssorum

NNHE stn 18

Nomen dubium (Bakken et al., 2014), type ZMBN

Scalibregma parvum

NNHE stns 18 and 31

Accepted as Pseudoscalibregma parvum; lectotype ZMBN, NNHE

stn 31 (Bakken et al., 2014)

Ammotryphane

cylindricaudatus

NNHE stns 31 and 87

Accepted as Ophelina cylindricaudata; lectotype ZMBN, NNHE

stn 87 (Kongsrad et al., 2011)

Spderodorum abyssorum

NNHE stn 33

Accepted as Ephesiella abyssorum: type ZMBN

Trophonia hirsuta

NNHE stns 18 and 31

Accepted as Diplocirrus hirsutus ; type ZMBN

Cirratulus abyssorum

NNHE stn 87

Uncertain status; type ZMBN

Cirratulus abranchiatus

NNHE stn 31

Accepted as Chaetozone abranchiatus

Clymene Koreni

NNHE stn 87

Accepted as Maldane koreni ; type ZMBN

Myriochele Sarsii

NNHE stn 38,40 and 51

Synonymised with Myriochele heeri Malmgren, 1867; type ZMBN

Potamilla Malmgreni

NNHE stn 40 and 51

Accepted as Potamethus malmgreni, type ZMBN

Protula arctica

NNHE stn 51

Accepted as Prods arctica-, type ZMBN

Hansen 1879b

Polynoe arctica

NNHE stn 223, 224, 237

Synonymised with Eunoe oerstedi Malmgren, 1866; type ZMBN

Aricia arctica

NNHE stn 224, Jan Mayen

Accepted as Scoloplos arctica-, type ZMBN

Storm 1879

Lcenilla violacea

R0berg in Trondhjemsfjord

Accepted as Leucia violacea-, syntypes NTNU-VM (Bamich and

Fiege, 2009)

Lcenilla oculinarum

Gal genes in Trondhjemsfjord

Accepted as Harmothoe oculinarum. Type specimens in NHMO

and NTNU-VM (Fiege and Bamich, 2009).

Hansen 1880

Polynoe assimilis

NNHE stn 363

Synonymised with Harmothoe globifera (G.O. Sars, 1873),

(Bamich and Fiege, 2010); type ZMBN

Polynoe spinulosa

NNHE stn 363

Synonymised with Eunoe nodosa (M. Sars, 1861); type ZMBN

Polynoe foraminifera

NNHE stn 338

Synonymised with Eunoe nodosa (M. Sars, 1861); type ZMBN

Polynoe glaberrima

NNHE stn 366

Accepted

Trophonia borealis

NNHE stns 270, 275

Synonymised with Pherusa plumosa (O.F. Mtiller, 1776); type

ZMBN

Trophonia rugosa

Spitzbergen, Magdalenabay

Accepted as Brada rugosa; type ZMBN

Trophonia arctica

Spitzbergen, Magdalenabay

Synonymised with Brada rugosa (Hansen, 1880)

Brada granulosa

NNHE stn 337

Accepted; type ZMBN

Myriochele danielsseni

NNHE stn 192

Accepted; type ZMBN

Storm 1881

Leodice gunneri

Trondhjemsfjord

Synonymised with Eunice norvegica (Linnaeus, 1767)

230

E. Oug, T. Bakken & J.A. Kongsrud

VERMES, HELMINTH: NEREIS. 217

Oie forcipeto,

262 J. NEREIS ttvciilticac orporc vix conlpicuo. Gr. Tguerola&i

3624. N. divtrfieoior fubdeprdTe, pcdibus acumlnatis fetifei‘i$.

tViirm. 104. t» 6 - Sift. S. 1. p. I <>y» 2?

2C25. N. TtiUcola fubdcpreffa, pedilms fubcinotia, globo.

fii. * +

3G26. N. analUarh fubdepvefia palibus comas arm knrlcu*

leHbus. Wiirm. ijo* t. 9, * 4"

3627, N. fintbr'mfl fubdcplefl'a pcdibus ci until kn^geria,

fVm-tH. 144. r. g. * 4 *

Sfog. N. verrucojk convtsi, pedjbus cinatis vemicofis.

D- Stii-Skol-Orm* fViirm. 140* t, 7. Apw.y, 284.

Isi. K. poo. D. Act. Ifavn. 10 . p, 9 . b. t. IV,

Aft, Havn. p. 169. E. e, f. 10. N, pthgka. Linn.

3619. N, pimata convexa, pedibus cirratis pitinigetis, * 4 "

2630. N .pcjinitta convexu, pedibut cirratis pennigeiis, Aft,

nidi-. 4. p. 51. t. 2, f- 7 * 12. At tubulus alie*.

nus eft, N. norvegka Linn.

2631. N, piijilfo depiefia, pedibus cirratis, filament;* anicu*

latts. * +

& Ore probo fadeo.

2G32. N. ftttiiftra tlcpiefTs, lamdlis pedum etiiptkis. * 4*

2(533. P ull ^ ttt& fubdepreflii, pedibus I on gift! me cirratis. *4"

2634. N. (il/m Ilibcnnvejtij, froivtc coiuuta, pedibus mutiefs

bifid is. * 4*

2635. N* wuicalatfl convex* , kmc! Lis pedum fob cor dads,

Wftmt. i$6. 1.10, f

26315, N. viridis depretTai lamellls pedum lanteolatit. Wimn* ^

16a. r- 11* f

• ^

E e 3637,

Figure 3. Example of text page from Zoologia Danica prodromus for

polychaetes with armed mouth (‘ore forcipato’) and with eversible

pharynx (‘ore proboscideo’). From Muller (1776).

Michael Sars described nearly 80 species of polychaetes,

of which 54 are considered valid (table 2). The descriptions

generally had a standardised form, with a diagnosis in Latin

followed by an extended description with morphological

details in Norwegian. In some few cases, descriptions were

given in either German (Sars, 1846) or French (Sars, 1856).

Some of the works were re-edited and translated into German,

French or English and published in international journals (see

Sars, 1829, 1835, 1856, 1869). From about 1860, most new

species were published as contributions from the newly

established scientific society of Christiania (Det norske

Videnskaps-Akademi [The Norwegian Academy of Science

and Letters]). His latest descriptions of new species were

published after his death in three papers edited (without

Figure 4. Michael Sars. Photography by P.M. Thomsen. Reproduced

from 0kland (1955).

changes) or revised by his son Georg Ossian Sars (Sars, 1872a,

1872b, 1873a). Altogether, there are 14 publications with

descriptions of new species of polychaetes (table 2).

The correct reference to the descriptions needs attention.

Several contributions from the scientific society were

published both in an annual periodical and as separate

offprints. The offprints had separate pagination (starting at p.

1) and usually a different title (e.g. Sars, 1862a, 1862b). The

periodical was published the year after the presentations, e.g.

contributions for 1861 were published in 1862. It may also

cause problems that several species were described more than

once. This was the case for some species for which the first

publication was rather short and Michael Sars then presented

a more complete description in a later publication. The use of

illustrations varied. The earliest publications were illustrated

(Sars, 1829, 1835, 1846, 1856), but later publications were

generally not. The last species descriptions (Sars, 1873a)

contained detailed illustrations of some of the species made by

G.O. Sars, who was an extremely skilled illustrator.

Contemporary with Michael Sars, several foreign

naturalists visited Norway for fauna studies. In approximately

1840, new species were described by the Danish naturalist

Anders 0rsted and the German-Polish naturalist Heinrich

Rathke (table 3). 0rsted visited Dr0bak, having been inspired

by the works of O.F. Muller (0rsted, 1845), whereas Rathke

visited several places in the middle part of Norway (Rathke,

1843). No material from 0rsted’s polychaetes from Dr0bak is

known to exist (Wolff and Petersen, 1991). The existence of

the material of Rathke is uncertain. A couple of decades later,

Original specimens and type localities of early described polychaete species from Norway

231

the most important contribution to the knowledge of the

polychaete fauna was recorded by Gerhard Armauer Hansen

in his treatment of the material collected during the Norwegian

North-Atlantic Expedition (NNHE), 1876-78. In total 27

polychaete species were described as new species from the

expedition, of which 16 are considered valid (table 3). All

species descriptions were originally published in Norwegian

(Hansen, 1879a; 1879b; 1880), but the descriptions were later

repeated with parallel text in English in a comprehensive

expedition report (Hansen, 1882).

Museum collections of original material

In general the material collected by the early naturalists were

kept in their own private collections or donated or sold to

museum collections (Anker, 1950; 0kland, 1955). In the

museums, collected specimens were placed in common

collections. Specimens and samples used for species

descriptions were generally not specifically indicated. The

degree to which original specimens have been identified and

catalogued as ‘types’ at some later stage varies among

museums. All too often, however, it seems that original

materials have been forgotten and/or overlooked in the

collections and consequently been reported as missing when

asked for in modern taxonomic studies. For most early-

described species, the identification of original material

(holotype or syntypes) today is, therefore, totally dependent on

information on sample labels (site, date, collector) and

knowledge of the original sampling sites. The present

principles of designating and cataloguing a type series as

specified in the Zoological Code (ICZN) did not come into

force until much later (ICZN, 1999).

In Norway, there are four natural history museums that

maintain scientific marine collections. The first to be

established was the collections of the Royal Norwegian

Society of Sciences and Letters in Trondheim, which was

founded in 1760 (Moen, 2006; Bakken et al., 2011). The other

museums, in Oslo (then Christiania), Bergen and Troms0,

were founded in 1812, 1825 and 1872, respectively. In their

first periods of activity, the museums concentrated on local

fauna and flora, but gradually the museums also built up

collections of specimens from other parts of Norway, and,

starting in the 1870s, from expeditions to the Nordic Seas and

Arctic areas and more distant destinations (see e.g. Sakshaug

and Mosby, 1996). Some specimens have been distributed

among the museums as early curators seemed to share or split

samples between the museums (Bakken, 1999).

In the present study, efforts have been made to identify

original materials from Michael Sars in Norwegian museums

that have not yet been identified as ‘types’. Most of the material

is located in the collections of the Natural History Museum,

University of Oslo (NHMO), but some is also found in the

University Museum, University of Bergen (ZMBN). During

his research, Michael Sars also sent specimens to other

European museums, e.g. in Copenhagen (information from

letters, see 0kland, 1955). Potentially, original material

(syntypes) may, therefore, have been distributed among several

museums. In the present study, original material from 25

species has been identified in the collections of the museum in

Oslo (see table 2). Original labels with Michael Sars’

characteristic hand-writing (fig. 5) and corresponding

information on sampling sites from labels and species

descriptions have been taken as evidence for the status of the

material. These specimens have now been catalogued and

transferred to a separate type collection. Material of somewhat

uncertain status, e.g. lacking original labels, has been

registered as possible types (table 2) and catalogued.

Type localities

The Zoological Code (ICZN) states that all sampling localities

for a collection of syntypes are to be regarded as type localities

(ICZN, 1999). When a lectotype has been designated, or a

neotype in the case of missing original material, the locality of

the designated specimen is the sole type locality, and localities

for other previous syntypes lose their status. These

specifications imply that a uniquely defined type locality (one

locality only) will be the case only for species originally

described from one locality or when a lectotype or neotype

has been designated in later revisions. For modern taxonomy,

and for molecular studies of species complexes in particular,

the precise location of one type locality is crucial. With regard

to the species described by O.F. Muller, some species included

in Zoologia Danica were described from one locality, which

then fixes the type locality (e.g. Dr0bak in the Oslofjord for

Scoletoma fragilis, Eunice pennata and Hyalinoecia tubicola :

table 1). For Miiller’s other species, especially those that

referred to other authors in the ‘prodromus’, the identification

of sampling localities may be more obscure. As Muller in the

‘prodromus’ often referred to several authors and publications,

the first step is to decide which of them constitutes the original

description; then information may be extracted on localities,

which are often rather inaccurately reported. The matter is

also complex for poorly characterised species that essentially

have been diagnosed by later authors, e.g. Glycera alba by

0rsted (1843), based on specimens from sampling localities

outside of the area indicated by Muller.

The naturalists of the 19th century generally reported their

sampling localities, but often rather roughly, with little more

than place name and depth. The studies of 0rsted (1845) and

Rathke (1843) were restricted to one or a few places. Michael

Figure 5. Original label written by Michael Sars for Ampharete

finmarchica. Original text reads: ‘Amphicteis finmarchica Sars.

Ramfjorden Tromso S.’ Natural History Museum, Oslo.

232

E. Oug, T. Bakken & J.A. Kongsrud

Sars, however, often reported several localities for his species,

especially in the late publications, when he had collected material

from all parts of Norway (table 2, fig. 6). In the descriptions, he

did not indicate whether material from one or several localities

had been used. Therefore, it should be a task in connection with

revisions to critically examine all syntypes and select lectotypes

that are in accordance with the species descriptions. Until today

this has only been done for seven of the species of Michael Sars

(table 2). Presently, there is one specified type locality for only

about half of the species that he described as new, either by

original designation (one locality) or by subsequent selection of a

lectotype or neotype by later authors.

Conclusions

The correct taxonomy of the species is the key to biological

knowledge and the very basis for documenting biodiversity.

Taxonomy requires a thorough knowledge of past research, even

if that means beginning with old, poorly preserved and labelled

specimens. It is acknowledged that modern research is hindered

by the inaccessibility of older taxonomic literature, poor

descriptions of early-described species, and the uncertain

existence and location of type material (Glasby and Read, 1998).

The present rapidly increasing use of molecular genetic methods

for species characterisation reinforces the need to clearly assess

the identity of the species. Any information on original material,

their repositories and sampling localities is therefore urgently

■75'N

•W'N

Figure 6. Localities for polychaetes described by Otto Friderich

Muller, Michael Sars, Anders 0rsted, Heinrich Rathke and Gerhard

Armauer Hansen from Norwegian waters. Upper left map inset shows

stations sampled by the Norwegian North-Atlantic Expedition

(NNHE) 1876-1878.

Hammsifest

Hgvpysund

Komsgftjerd ^

Ofcsfiord _

Vaile

Varangertiorid

Mold*

# Mamaenfjord

^ Trortdhtiimt^jord

Bergen^

• A Drotialc

Hording# Oslofjord

O O.F. MUlter

• M. Sars

A A. Orsted

♦ G.A. Hansen

needed. In Norway, correct taxonomy is critical for biodiversity

mapping (e.g. the MAREANO seabed mapping program: Buhl-

Mortensen et al., 2012), environmental surveillance monitoring

at offshore petroleum installations, and studies of the effects of

climate changes. Furthermore, recent studies of selected

polychaete families have revealed considerable species shifts

from offshore shelf to deep-water areas in the Nordic Seas

(Kongsrud et al., 2011; Bakken et al., 2014).

The present study is intended to facilitate access to

descriptions, material and localities of the early-described

species from Norway. Most of the old literature is in Danish or

Norwegian, with place names that often are obsolete or very

local. Native knowledge is therefore essential, as is knowledge

of the history of science, reading descriptions in the original

language, tracing unpublished field notes and letters that may

be kept as part of collections, and access to museum catalogues

to supplement more precise data on sampling localities.

Knowledge of local geography is also of paramount

importance, especially when place names have changed over

time with the development of language and change of local

administrative systems.

Basic taxonomy incorporating revisions of early-described

species is tedious work. It is a real challenge to do revisions

fast enough to keep up with molecular studies. In cases where

molecular data are needed at the first instance, the best practice

will be to collect specimens from original localities or within

the geographical range where the original material may have

been collected, which implies that information on original

sampling and material must be known. The documentation of

material and sampling localities of the early-described species

is thus a basis for the advancement of taxonomy and

biodiversity mapping using new techniques and methods.

Acknowledgements

The present studies commenced as part of the project ‘Polyskag’

funded by the Norwegian Taxonomy Initiative through the

Norwegian Biodiversity Information Centre. We are indebted to

Danny Eibye-Jacobsen and Martin McNaughton at the

Zoological Museum, Copenhagen, for providing access to

original copies of Zoologia Danica and digitalization of text and

plates. Special thanks go to Ann-Helen R0nning at the Natural

History Museum Oslo (NHMO) for help locating original

material in the collections of the NHMO. Karsten Sund and Ase

Wilhelmsen (NHMO) and Katrine Kongshavn (ZMBN) helped

with photos and preparation of figures. Thanks are also due to

Alex Muir at the Natural History Museum, London, and to one

anonymous referee for comments on the manuscript.

References

Anker, J. 1950. Otto Friderich Muller’s Zoologia Danica. Library

Research Monograph 1. Munksgaard: Copenhagen. 108 pp.

Arwidsson, I. 1906. Studien liber die Skandinavischen und arktischen

Maldaniden nebst Zusammenstellung der iibrigen bisher

bekannten arten dieser Familie. Zoologische Jahrbiicher

Supplement 9: 1-308, 12 pis.

Audouin, J.V., and Milne Edwards, H. 1833. Classification des

Annelides, et description de celles qui habitent les cotes de la

France. Annales des Sciences Naturelles 29: 195-269.

Original specimens and type localities of early described polychaete species from Norway

233

Audzijonyte, A., Ovcarenko, I., Bastrop, R., and Vainola, R. 2008.

Two cryptic species of the Hediste diversicolor group (Polychaeta,

Nereididae) in the Baltic Sea, with mitochondrial signatures of

different population histories. Marine Biology 155: 599-612.

Bakken, T. 1999. A catalogue of the type specimens of protozoans,

invertebrates and fish in the Museum of Natural History and

Archaeology, NTNU. Gunneria 74: 1-38.

Bakken, T. 2003. Redescription and resurrection of Typhlonereis

gracilis Hansen, 1879. Sarsia 88: 346-352.

Bakken, T., Fremstad, E., and Aagaard, K. 2011. Bishop Gunnerus as

a naturalist: his impact on biodiversity research today. Det

Kongelige Norske Videnskabers Selskabs Skrifter 2011: 109-128.

Bakken, T., Oug, E., and Kongsrud, J.A. 2014. Occurrence and

distribution of Pseudoscalibregma and Scalibregma (Annelida,

Scalibregmatidae) in the deep Nordic Seas, with the description of

Scalibregma hanseni n. sp. Zootaxa 3753: 101-117.

Banse, K. 1969. Acrocirridae n. fam. (Polychaeta Sedentaria). Journal

of the Fisheries Research Board of Canada 26: 2595-2620.

Banse, K. 1972. Redescription of some species of Chone Kroyer and

Euchone Malmgren, and three new species (Sabellidae,

Polychaeta). Fishery Bulletin 70: 459-495.

Barnich, R., and Fiege, D. 2009. Revision of the genus Harmothoe

Kinberg, 1856 (Polychaeta: Polynoidae) in the Northeast Atlantic.

Zootaxa 2104: 1-76.

Barnich, R., and Fiege, D. 2010. On the distinction of Harmothoe

globifera (G.O. Sars, 1873) and some other easily confused

polynoids in the NE Atlantic, with the description of a new species

of Acanthicolepis Norman in McIntosh, 1900 (Polychaeta,

Polynoidae). Zootaxa 2525: 1-18.

Barnich, R., Gil, J., and Fiege, D. 2000. Revision of the genus

Acanthicolepis Norman in McIntosh, 1900 (Polychaeta,

Polynoidae, Polynoinae). Sarsia 85: 313-319.

Barroso, R., Klautau, M., Sole-Cava, A., and Paiva, P. 2010. Eurythoe

complanata (Polychaeta: Amphinomidae), the ‘cosmopolitan’

fireworm, consists of at least three cryptic species. Marine

Biology 157: 69-80.

Bidenkap, O. 1894. Systematisk oversigt over Norges Annulata

Polychaeta. Forhandlinger i Videnskabs-Selskabet i Christiania

10: 1-142.

Bleidorn, C., Kruse, I., Albrecht, S., and Bartolomaeus, T. 2006.

Mitochondrial sequence data expose the putative cosmopolitan

polychaete Scoloplos armiger (Annelida, Orbiniidae) as a species

complex. BMC Evolutionary Biology 6(47): 1-13.

Bock, G., Fiege, D., and Barnich, R. 2010. Revision of Hermadion

Kinberg, 1856, with a redescription of Hermadion magalhaensi

Kinberg, 1856, Adyte hyalina (G.O. Sars, 1873) n. comb, and

Neopolynoe acanellae (Verrill, 1881) n. comb. (Polychaeta:

Polynoidae). Zootaxa 2554: 45-61.

Boeck, C. 1860. Bemaerkninger over og Afbildning af en ny art af

Annelidslaegten Chaetopterus. Forhandlinger i Videnskabs-

Selskabet i Christiania 1859: 252.

Breton, S., Dufresne, F., Descrosier, G., and Blier, P.U. 2003.

Population structure of two northern hemisphere polychaetes,

Neanthes virens and Hediste diversicolor (Nereididae), with

different life-history traits. Marine Biology 142: 707-715.

Buhl-Mortensen, L., Buhl-Mortensen, P., Dolan, M.F.J., Dannheim,

J., Bellec, V., and Holte, B. 2012. Habitat complexity and bottom

fauna composition at different scales on the continental shelf and

slope of northern Norway. Hydrobiologia 685: 191-219.

Chambers, S.J. 1989. Leucia nivea: apolynoid (Polychaeta) new to the

British Isles. Irish Naturalists’ Journal 23: 145-147.

Claparede, E. 1863. Beobachtungen iiber Anatomie und

Entwicklungsgeschichte wirbelloser Thiere an der Kiiste von

Normandie angestellt. W. Engelmann: Leipzig. 120 pp.

Dalyell, J.G. 1853. The powers of the Creator displayed in the creation;

or observations on the life amidst the various forms of the humbler

tribes of animated nature, with practical comments and

illustrations. John van Voorst: London. 359 pp.

Delle Chiaje, S. 1828. Memorie sulla storia e notomia degli animali

senza vertebre del Regno di Napoli. Stamperia della Societa’

Tipografica, Napoli. 232 pp.

Esmark, L. 1874. Eteonopsis geryonicola. Forhandlinger i

Videnskabs-selskabet i Christiania 1873: 497-498.

Fabricius, J.C. 1779. Reise nach Norwegen mit Bemerkungen aus der

Naturhistorie und Oekonomie. Carl Ernst Bohn: Hamburg. 398 pp.

Fabricius, 0.1780. Fauna Groenlandica: systematice sistens animalia

Groenlandiae occidentalis hactenus indagata, quoad nomen

specificum, triviale, vernaculumque. Ioannis Gottlob Rothe:

Hafniae and Lipsiae (Copenhagen and Leipzig). 452 pp., 1 pi.

Fauchald, K. 1963. Nephtyidae (Polychaeta) from Norwegian waters.

Sarsia 13: 1-32.

Fauchald, K. 1982. Revision of Onuphis, Nothria, and Paradiopatra

(Polychaeta: Onuphidae) based upon type material. Smithsonian

Contributions to Zoology 356: 1-109.

Fauchald, K. 1992. A review of the genus Eunice (Polychaeta:

Eunicidae) based upon type material. Smithsonian Contributions

to Zoology 523: 1-422.

Fauvel, P. 1959. Classes des annelides polychetes. Distribution

geographique. Traite de Zoologie 5: 163-165.

Fiege, D., and Barnich, R. 2009. Polynoidae (Annelida: Polychaeta)

associated with cold-water coral reefs of the northeast Atlantic

and the Mediterranean Sea. Zoosymposia 2: 149-164.

Fitzhugh, K. 1990. A revision of the genus Fabricia Blainville, 1828

(Polychaeta: Sabellidae: Fabriciinae). Sarsia 75: 1-16.

Frame, A. 1992. The lumbrinerids (Annelida: Polychaeta) collected in

two northwestern Atlantic surveys with descriptions of a new

genus and two new species. Proceedings of the Biological Society

of Washington 105: 185-218.

Glasby, C.J., and Read, G.B. 1998. A chronological review of

polychaete taxonomy in New Zealand. Journal of the Royal

Society of New Zealand 28: 347-374.

Grube, A.E. 1860. Beschreibung neuer oder wenig bekannter

Anneliden. Archiv der Naturgeschichte 26: 71-118.

Haase, P. 1915. Boreale und arktische Chloraemiden.

Wissenschaftlichen Meeresundersuchungen Abteilung Kiel, Neue

Folge 17: 169-228.

Hansen, G.A. 1879a. Annelider fra den norske Nordhavsexpedition i

1876. Nyt Magazin for Naturvidenskaberne 24: 1-17.

Hansen, G.A. 1879b. Annelider fra den norske Nordhavsexpedition i

1877. Nyt Magazin for Naturvidenskaberne 24: 267-272.

Hansen, G.A. 1880. Annelider fra den norske Nordhavsexpedition i

1878. Nyt Magazin for Naturvidenskaberne 25: 224-234.

Hansen, G.A. 1882. Annelida. Pp. 1-53 in: The Norwegian North-

Atlantic Expedition 1876-1878. Grpndahl & Spn: Christiania.

Hartley, J.P. 1985. The re-establishment of Amphicteis midas (Gosse,

1855) and redescription of the type material of A. gunneri (M.

Sars, 1835) (Polychaeta: Ampharetidae). Sarsia 70: 309-315.

Helle, K.B. 2006. Michael Sars, the Norwegian pioneer of

international marine biology in the 19th century. Introductory

notes in facsimile reprint of “Fauna Littoralis Norvegiae I”.

Mangschou AS, University of Bergen/UNIFOB: Bergen. 8 pp.

Holthe, T. 1986. Polychaeta terebellomorpha. Marine Invertebrates of

Scandinavia 7: 1-194.

ICZN. 1999. International Code of Zoological Nomenclature. 4th

edn. International Trust for Zoological Nomenclature: London.

306 pp.

Johnston, G. 1833. Illustrations in British zoology. Magazine of

Natural History, London 6(34): 320-324.

234

E. Oug, T. Bakken & J.A. Kongsrud

Johnston, G. 1835. Illustrations in British zoology. Magazine of

Natural History, London 8: 565-569.

Johnston, G. 1840. Miscellanea Zoologica British Annelids. Annals

and Magazine of Natural History, Ser. 1,4: 368-375.

Knight-Jones, P. 1983. Contributions to the taxonomy of Sabellidae

(Polychaeta). Zoological Journal of the Linnean Society 79: 245-

295.

Knight-Jones, P., and Perkins, T.H. 1998. A revision of Sabella,

Bispira and Stylomma (Polychaeta: Sabellidae). Zoological

Journal of the Linnean Society 123: 385-467.

Knowlton, N. 2000. Molecular genetic analyses of species boundaries

in the sea. Hydrobiologia 420: 73-90.

Koh, B.-S., Bhaud, M.R., and Jirkov, I.A. 2003. Two new species of

Owenia (Annelida: Polychaeta) in the northern part of the Atlantic

Ocean and remarks on previously erected species from the same

area. Sarsia 88: 175-188.

Kongsrud, J.A., Bakken, T., and Oug, E. 2011. Deep-water species of

the genus Ophelina (Annelida, Opheliidae) in the Nordic Seas,

with the description of Ophelina brattegardi sp. nov. Italian

Journal of Zoology 78(S1): 95-111.

Krpyer, H. 1856. Meddelelser af en Afhandling om Ormeslaegten

Sabella Linn., isaer med Hensyn til dens nordiske Arter. Oversigt

over det Kongelige Danske videnskabernes selskabsforhandlinger

1856: 1-36.

Licher, F. 1999. Revision der Gattung Typosyllis Langerhans, 1879

(Polychaeta: Syllidae). Morphologie, Taxonomie und Phylogenie.

Abhandlungen der Senckenbergischen Naturforschenden

Gesellschaft 551: 1-336.

Linnaeus, C. 1758. Systema naturae. 10th edn. Laurentii Salvii: Holmiae.

Linnaeus, C. 1767. Systema naturae. 12th edn. Laurentii Salvii: Holmiae.

Loshamn, A.A. 1980. En systematisk og dyregeograf.sk unders0kelse

over skjellrygg-gruppen (familie Aphroditidae sensu Fauvel

1923) [A systematic and biogeographic study of the scale worms

(family Aphroditidae sensu Fauvel 1923)]. Master’s Thesis,

University of Oslo. 369 pp.

Mackie, A.S.Y. 1991. Scalibregma celticum new species (Polychaeta:

Scalibregmatidae) from Europe, with a redescription of

Scalibregma inflatum Rathke, 1843 and comments on the genus

Sclerobregma Hartman, 1965. Bulletin of Marine Science 48:

268-276.

Mackie, A.S.Y., and Pleijel, F. 1995. A review of the Melinna cristata-

species group (Polychaeta: Ampharetidae) in northeastern

Atlantic. Mitteilungen aus dem Hamburgischen Zoologischen

Museum und Institut 92: 103-124.

Malmgren, A.J. 1866. Nordiska hafs-annulater. Ofversikt af Kongliga

Vetenskaps-Akedemiens Forhandlingar 22: 355-410.

Malmgren, A.J. 1867. Annulata Polychaeta Spetsbergiae,

Groenlandiae, Islandiae et Scandinaviae hactenus cognita. Ex

Officina Frenckelliana: Helsingfors. 127 pp., 115 pis.

McIntosh, W.C. 1868. Report on the annelids dredged off the Shetland

Islands by Mr. Gwyn Jeffreys in 1867. Annals and Magazine of

Natural History Ser. 4, 2: 249-252.

Meissner, K. 2005. Revision of the genus Spiophanes (Polychaeta,

Spionidae); with new synonymies, new records and descriptions

of new species. Mitteilungen Museum fur Naturkunde Berlin

Zoologische Reihe 81: 3-66.

Meissner, K., Bick, A., and Bastrop, R. 2011. On the identity of Spio

filicornis (O.F. Miiller, 1776) - with the designation of a neotype,

and the description of two new species from the North East

Atlantic Ocean based on morphological and genetic studies.

Zootaxa 2815: 1-27.

Moen, T.L. 2006. A translation of bishop Gunnerus’ description of the

species Hydroides norvegicus with comments on his Serpula

triqvetra. Scientia Marina 70S3: 115-123.

Montagu, G. 1803. Testacea Britannica or natural history of British

shells, marine, land, and fresh-water, including the most minute:

systematically arranged and embellished with figures. J. White:

London. Vol. 1: xxxvii + 291 pp. and Vol. 2: 293-606 pp.

Muller, C.F. (ed.) 1788. Zoologiae Danica seu Animalium Daniae et

Norvegiae rariorum ac minus notorum. Descriptiones et historia.

Vols I and II (reissue). N. Muller et filii: Havniae (Copenhagen).

Muller, O.F. 1771. Von Wiirmern des siissen und salzigen Wassers.

Heineck und Faber: Havniae (Copenhagen). 200 pp., 16 pis.

Muller, O.F. 1774. Vermivm terrestrium etfluviatilium, seu animalium

infusoriorum, helminthicorum et testaceorum, non marinorum,

succincta historia. Heineck et Faber: Havniae (Copenhagen).

Muller, O.F. 1776. Zoologiae Danicae prodromus: seu Animalium

Daniae et Norvegiae indigenarum; characteres, nomina, et

synonyma imprimis popularium. Hallageriis: Havniae

(Copenhagen). 282 pp.

Muller, O.F. 1777-1784. Zoologiae Danica seu Animalium Daniae et

Norvegiae rariorum ac minus notorum. Descriptiones et historia.

Volumes I and II. Sumtibus Weygandinis: Hauniae et Lipsiae

(Copenhagen and Leipzig). (Vol. I 40 pis. 1777; Vol. I Latin text

1779; Vol. I Danish text 1781; Vol. I German text 1783; Vol. II 40

pis. 1780; Vol. II Latin text 1784.)

Muller, O.F., and Abildgaard, RC. 1789. Zoologiae Danica seu

Animalium Daniae et Norvegiae rariorum ac minus notorum.

Descriptiones et historia.. Volume III. 40 pis (Latin text). N.

Muller et filii: Havniae (Copenhagen).

Muller, O.F., Abildgaard, P.C., Vahl, M„ Holten, J.S., and Rathke, J.

1806. Zoologiae Danica seu Animalium Daniae et Norvegiae

rariorum ac minus notorum. Descriptiones et historia. Volume

IV. 40 pis (Latin text). N. Christensen: Havniae (Copenhagen).

Nygren, A. 2004. Revision of Autolytinae (Syllidae: Polychaeta).

Zootaxa 680: 1-314.

Nygren, A., Eklof, J., and Pleijel, F. 2009. Arctic-boreal sibling

species of Paranaitis (Polychaeta, Phyllodocidae). Marine

Biology Research 5(4): 315-327.

Nygren, A., Eklof, J., and Pleijel, F. 2010. Cryptic species of

Notophyllum (Polychaeta: Phyllodocidae) in Scandinavian waters.

Organisms Diversity & Evolution 10: 193-204.

Nygren, A., and Pleijel, F. 2011. From one to ten in a single stroke -

resolving the European Eumida sanguinea (Phyllodocidae,

Annelida) species complex. Molecular Phylogenetics and

Evolution 58(1): 132-141.

Nygren, A., Pleijel, F., and Sundberg, P. 2005. Genetic relationships

between Nereimyra punctata and N. woodsholea (Hesionidae,

Polychaeta). Journal of Zoological Systematics and Evolutionary

Research 43: 273-276.

0kland, F. 1955. Michael Sars, et minneskrift [Michael Sars, a

memorial volume]. Det norske Videnskaps-Akademi i Oslo. A.W.

Brpggers Boktrykkeri: Oslo. 221 pp.

0rsted, A.S. 1843. Annulatorum danicorum conspectus. Fascicle I.

Maricolae. Naturhistorisk Tidsskrift 4: 1-52, 7 pis.

0rsted, A.S. 1845. Fortegnelse over dyr, samlede i Christianiafjord

ved Dr0bak fra 21-24 juli 1844. Naturhistorisk Tidsskrift 2, 1:

400-427, 1 pi.

Pallas, P.S. 1766. Miscellanea Zoologica, quibus novl imprimis atque

obscurl animalium species describuntur et observationibus

iconibusque illustrantur. Apud Petrum van Cleef: Hagae

Comitum (Hague, the Netherlands). 77 pp., 7 pis.

Parapar, J., and Hutchings, P.A., in press. Redescription of Terebellides

stroemii (Polychaeta, Trichobranchidae) and designation of a

neotype. Journal of the Marine Biological Association of the

United Kingdom.

Pettibone, M. 1992. Contribution to the polychaete family Pholoidae

Kinberg. Smithsonian Contributions to Zoology 532: 1-24.

Original specimens and type localities of early described polychaete species from Norway

235

Pleijel, F. 1993. Polychaeta Phyllodocidae. Marine Invertebrates of

Scandinavia 8: 1-158.

Pleijel, F. 2004. A revision of Hesiospina (Psamathini, Hesionidae,

Polychaeta). Journal of Natural History 38: 2547-2566.

Pleijel, F., Jondelius, U., Norlinder, E., Nygren, A., Oxelman, B.,

Schander, C., Sundberg, P., and Thollesson, M. 2008. Phylogenies

without roots? A plea for the use of vouchers in molecular

phylogenetic studies. Molecular Phylogenetics and Evolution 48:

369-371.

Pleijel, F., Rouse, G.W., and Nygren, A. 2012. A revision of Nereimyra

(Psamathini, Hesionidae, Aciculata, Annelida). Zoological

Journal of the Linnean Society 164: 36-51.

Rainer, S.F. 1991. The genus Nephtys (Polychaeta: Phyllodocida) of

northern Europe: a review of species, including the description of

N. pulchra sp. n. and a key to the Nephtyidae. Helgoldnder

Meeresuntersuchungen 45: 65-96.

Rathke, H. 1843. Beitrage zur fauna Norwegens. Verhandlungen

Kaiserlichen Leopoldinisch-Carolinischen Akademie

Naturforscher, Breslau 20(1): 1-264,12 pis.

Ratnasingham, S., and Hebert, P.D.N. 2007. BOLD: The Barcode of

Life Data System (www.barcodinglife.org). Molecular Ecology

Notes 7:355-364.

Sakshaug, E., and Mosby, H. 1996. A review of Norwegian marine

biology and oceanography until the Second World War.

Norwegian University of Science and Technology, Trondhjem

Biological Station: Trondheim, Norway. 38 pp.

Sars, G.O. 1872a. On some remarkable forms of animal life from the

great deeps off the Norwegian Coast. I. Partly from posthumous

manuscripts of the late Professor Dr. Michael Sars. University-

Program for the 1st half-year 1869. Christiania. 82 pp.

Sars, G.O. (ed.) 1872b. Diagnoser af nye Annelider fra

Christianiafjorden, efter Professor M. Sars’s efterladte

Manuskripter. Forhandlinger i Videnskabs-Selskabet i

Christiania 1871: 406-417.

Sars, G.O. 1873a. Bidrag til Kundskaben om Christianiafjordens

Fauna. III. Vaesentlig udarbeidet efter Prof. Dr. M. Sars’s efterladte

Manuscripter. Nyt Magazin for Naturvidenskaberne 19: 201-281,

pis. 14-18.

Sars, G.O. 1873b. Bidrag til Kundskaben om dyrelivet paa vore

havbanker. Forhandlinger i Videnskabs-Selskabet i Christiania

1872: 73-119.

Sars, M. 1829. Bidrag til S0edyrenes Naturhistorie, Part 1. Bergen. 59

pp. [Shortened German version in Oken’s Isis, col. 221-233,

edited by L. Thienemann (1833).]

Sars, M. 1835. Beskrivelser og Iagttagelser over nogle mcerkelige eller

nye i Havet ved den Bergenske Kyst levende Dyr av Polypernes,

Acalephernes, Radiaternes, Annelidernes og Molluskernes

Classer, med en kort Oversigt over de hidtil af Forfatteren

sammsteds fundne Arter og deres Forekommen. Thorstein

Hallagers Forlag: Bergen. 81 pp. ([Shortened French version in

Annales dAnatomie et Physiologie 2: 81-90, edited by M.P

Gervais (1838).]

Sars, M. 1846. Beschreibung des Oligobranchus roseus, einer neuen

Form der Riickenkiemenwtirmer. Fauna Littoralis Norvegiae 1:

91-94.

Sars, M. 1851. Beretning om en i Sommeren 1849 foretagen zoologisk

Reise i Lofoten og Finmarken. Nyt Magazin for

Naturvidenskaberne 6: 121-211.

Sars, M. 1856. Nye Annelider (Nouvelles annelides). Fauna Littoralis

Norvegiae 2: 1-24. [Also The Annals and Magazine of Natural

History 19: 430-431 (1857).]

Sars, M. 1861a. Uddrag av en Afhandling om de ved Norges Kyster

forekommende Arter af Annelideslaegten Polynoe. Forhandlinger

i Videnskabs-Selskabet i Christiania 1860: 54-62.

Sars, M. 1861b. Om Chaetopterus sarsii og C. norvegicus.

Forhandlinger i Videnskabs-Selskabet i Christiania 1860: 85-88.

[Also as offprint: Uddrag af en med Afbildninger ledsaget

Beskrivelse over Chaetopterus sarsii Boeck, nov. spec., og

Chaetopterus norvegicus Sars, pp. 1-3.]

Sars, M. 1861c. Beretning om en i Sommeren 1859 foretagen zoologisk

Reise ved Kysten af Romsdals Amt. Nyt Magazin for

Naturvidenskaberne 11: 241-263.

Sars, M. 1862a. Uddrag av en Afhandling, ledsaget af detaillerede

Afbildninger, over en Deel norske Annelider. Forhandlinger i

Videnskabs-Selskabet i Christiania 1861: 50-95. [Also as

offprint: Bidrag til Kundskaben om Norges Annelider (Fjerde

Afhandling), pp. 1-25.]

Sars, M. 1862b. Om de ved Norges Kyster forekommende Arter af den

Linneiske Annelideslaegt Sabella. Forhandlinger i Videnskabs-

Selskabet i Christiania 1861: 116-133. [Also as offprint: Bidrag

til Kundskaben om Norges Annelider (Fjerde Afhandling), pp.

25-42.]

Sars, M. 1863. Geologiske og zoologiske Iagttagelser, anstillede paa

en Reise i en Deel af Trondhjems Stift i Sommeren 1862. Nyt

Magazin for Naturvidenskaberne 12: 253-340.

Sars, M. 1865a. Fortsatte Bidrag til Kundskaben om Norges Annelider.

Forhandlinger i Videnskabs-Selskabet i Christiania 1864: 5-20.

Sars, M. 1865b. Bemaerkninger over det dyriske Livs Udbredning i

Havets Dybder. Forhandlinger i Videnskabs-Selskabet i

Christiania 1864: 53-68.

Sars, M. 1866. Om arktiske Dyreformer i Christianiafjorden.

Forhandlinger i Videnskabs-Selskabet Christiania 1865: 198-200.

Sars, M. 1867. Beskrivelse og Afbildninger af fplgende norske

Annelider. Forhandlinger i Videnskabs-Selskabet i Christiania

1866: 291-292.

Sars, M. 1869. Fortsatte Bemaerkninger over det dyriske Livs

Udbredning i Havets Dybder. Forhandlinger i Videnskabs-

Selskabet i Christiania 1868: 246-275. [Also The Annals and

Magazine of Natural History, Ser. 4, 3: 423-441 (1869).]

Schander, C., and Halanych, K.M. 2003. DNA, PCR and formalinized

tissue—a short review and protocols. Organisms Diversity and

Evolution 3: 195-205.

Sigvaldadottir, E. 1998. Cladistic analysis and classification of

Prionospio and related genera (Polychaeta, Spionidae). Zoologica

Scripta 27: 175-187.

Sikorski, A.V. 2011. Review of Laonice (Spionidae, Annelida) with

remarks on several species and a description of a new species

from South Africa. Italian Journal of Zoology 78(S1): 201-214.

Skage, M., and Schander, C. 2007. DNA from formalin-fixed tissue:

extraction or repair? That is the question. Marine Biology

Research 3: 289-295.

Sbderstrom, A. 1920. Studien iiber die Polychatenfamilie Spionidae.

Uppsala University. 286 pp.

Stpp-Bowitz, C. 1948. Les flabelligeriens Norvegiens. Bergens

Museums drbok 1946/1947, Naturvit 2: 1-59.

Storm, V. 1879. Bidrag til Kundskap om Throndhjemsfjordens Fauna.

Det Kongelige Norske Videnskabers Selskabs Skrifter 1878:

9-36.

Storm, V. 1881. Bidrag til Kundskap om Throndhjemsfjordens Fauna.

Det Kongelige Norske Videnskabers Selskabs Skrifter 1880:

1-30.

ten Hove, H.A., and Smith, R.S. 1990. A re-description of Ditrupa

gracillima Grube, 1878 (Polychaeta, Serpulidae) from the Indo-

Pacific, with a discussion of the genus. Records of the Australian

Museum 42: 101-118.

Theel, H. 1879. Les annelides polychetes des mers de la Nouvelle-

Zemble. Kongliga Svenska Vetenskaps-akademiens Handlingar

16: 1-75.

236

E. Oug, T. Bakken & J.A. Kongsrud

Tovar-Hernandez, M.A. 2007. On some species of Chone Kr0yer,

1856 (Polychaeta: Sabellidae) from world-wide localities. Zootaxa

1518: 31-68.

Williams, S.J. 1984. The status of Terebellides stroemi (Polychaeta;

Trichobranchidae) as a cosmopolitan species, based on a

worldwide morphological survey, including description of new

species. Pp. 118-142 in: Hutchings, P.A. (ed.). Proceedings of the

First International Polychaete Conference, Sydney. The Linnean

Society of New South Wales.

Winsnes, I.M. 1989. Eunicid polychaetes (Annelida) from

Scandinavian and adjacent waters. Family Eunicidae. Zoologica

Scripta 18: 483-500.

Wolff, T. 1994. En naturhistorisk pioner. Om O.F. Mullers jagt pa

‘Havets frembringelser’ og hans Zoologia Danica. Naturens

Verden (Denmark) 1994: 442-458.

Wolff, T., and Petersen, M.E. 1991. A brief biography of A.S. 0rsted,

with notes on his travels in the West Indies and Central America

and illustrations of collected polychaetes. Ophelia Supplement 5:

669-685.

Memoirs of Museum Victoria 71:237-246 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

The pros and cons of using micro-computed tomography in gross and micro-

anatomical assessments of polychaetous annelids

Gordon L. J. Paterson 1 *, Dan Sykes 2 , Sarah Faulwetter 3 , Reece Merk 4 , Farah Ahmed 5 , Lawrence E. Hawkins 6 ,

John Dinley 7 , Alexander D. Ball 8 and Christos Arvanitidis 9

1 Department of Life Sciences, Natural History Museum, London SW7 5BD, UK (g.paterson@nhm.ac.uk)

2 Department of Facilities, Natural History Museum, London SW7 5BD, UK (d.sykes@nhm.ac.uk)

3 Hellenic Center for Marine Research, RO.Box 2214,71003 Heraklion Crete, Greece (sarifa@hcmr.gr)

4 School of Ocean and Earth Sciences, National Oceanography Centre, University of Southampton, S014 3ZH, UK

5 Department of Facilities, Natural History Museum, London SW7 5BD, UK (f.ahmed@nhm.ac.uk)

6 School of Ocean and Earth Sciences, National Oceanography Centre, University of Southampton, S014 3ZH, UK

(leh@noc.soton.ac.uk)

7 School of Ocean and Earth Sciences, National Oceanography Centre, University of Southampton, S014 3ZH, UK

(dinleyjohn@me.com)

8 Department of Facilities, Natural History Museum, London SW7 5BD, UK (a.ball@nhm.ac.uk)

9 Hellenic Center for Marine Research, RO.Box 2214,71003 Heraklion Crete, Greece (arvanitidis@hcmr.gr)

* To whom correspondence and reprint requests should be addressed. Email: g.paterson@nhm.ac.uk

Abstract Paterson, G.L.J., Sykes, D., Faulwetter, S., Merks, R., Ahmed, F., Hawkins, L.E., Dinley, J., Ball, A.D. and Arvanitidis, C.

2014. The pros and cons of using micro-computed tomography in gross and micro-anatomical assessments of polychaetous

annelids. Memoirs of Museum Victoria 71: 237-246.

The use of micro-CT scanners in the study of anatomy and functional morphology of marine invertebrates is

becoming more common. The advantages and disadvantages of this methodology for the study of the internal anatomy of

polychaetes are discussed. Soft-bodied invertebrates such as polychaetes pose some specific problems. It can be difficult

to gain sufficient contrast between different types of tissues to be able to image them with X-rays. A range of stains can

help enhance the contrast between tissues. In this study we investigate a number of stains, concentrating on those considered

reversible. The advantages of such stains in the study of museum specimens and the resulting possibilities for large-scale

comparative morphology studies are outlined.

Keywords Polychaeta, internal anatomy, micro-CT, staining methods

Introduction

Phylogenetic studies of polychaetous annelids in recent years

have mainly used molecular approaches (e.g. Struck et ah, 2011;

Wiklund et al., 2008; Zrzavy, et al., 2009). Less numerous but of

equal importance have been those studies that have used recent

methodological advances in morphological techniques, such as

confocal microscopy to study nerves and muscles systems (e.g.

Mao, 2007; Orrahage, 1990; Zanol et al., 2011; see reviews in

Lanzavecchia et al., 1988; Purschke, 1988; 2005; Saulnier-

Michel, 1992; Tzetlin and Purschke, 2005; Tzetlin and Zhadan,

2009). It may be argued that further progress in understanding the

phylogeny of polychaetes and other taxa requires the pace of

morphological work to quicken to match the rapidity of molecular

investigations. Anatomical studies are more intensive in terms of

the time needed, skills required and techniques involved.

Undertaking large-scale anatomical studies can be a daunting

task, not least of which is access to the necessary comparative

238

G.L.J. Paterson, D. Sykes, S. Faulwetter, R. Merks, F. Ahmed, L.E. Hawkins, J. Dinley, A.D. Ball & C. Arvanitidis

material. And yet . .it is the history of morphological change that

we wish to explain...” (Raff et al., 1989, quoted in Nielsen, 2012).

The development and increasing availability of micro-

computed tomography (micro-CT) scanners holds great

promise in supporting structural and functional anatomical

analyses (e.g. Golding et al., 2007; Li et al., 2008). CT scans

have been used in medical fields for many years and their

ability to produce 3-D renderings of many features is well

known and documented (e.g. Udupa and Herman, 2000). Their

use in anatomical studies of non-human subjects is increasing

and there have been several studies focused on polychaetes.

For example, Dinley et al., (2009) showed how the method

could be used in functional anatomical studies, while

Faulwetter et al. (2013) have shown how the rendered micro-

CT images provide detailed taxonomic results.

There is no doubt that this is a maturing technology but

what is perhaps the most exciting aspect of using micro-CT is

that images of internal structures can be obtained without

damage to the specimen. The technology provides the

opportunity to undertake large-scale studies in a relatively

short timescale and using museum collections not normally

amenable to conventional anatomical studies. Nevertheless,

because the technology is still emerging, questions need to be

asked as to the efficacy of the approach, what it can and, as

importantly, what it cannot as yet visualise, and from a curator’s

perspective that the method is safe to use on specimens.

In this paper we will: 1) evaluate micro-CT as a method for

the study of internal anatomy of polychaetes; 2) assess the pros

and cons of the various approaches that are possible using this

methodology; and, 3) by way of example, present some

preliminary results based on a study of the internal anatomy of

the pharyngeal apparatus of ‘errant’ polychaetes (sensu Struck

et al., 2011) re-examining the seminal work of Dales (1962).

This study complements that of Faulwetter et al. (2013),

focussing on the use of micro-CT for internal anatomical

studies.

Material and methods

CT technology

Two different micro-CT scanners have been used to scan the

polychaetes in this study. 1) Nikon metrology HMX ST 225 at

the Imaging and Analysis Centre, Natural History Museum

(NHM). The HMX ST 225 uses either a tungsten, molybdenum,

silver or copper target and has a 4 megapixel (2000x2000

pixel) detector panel. The highest possible resolution is 5pm!

pixel. The scanner can produce X-ray energies of up to 225kV

and 200//A. 3,142 projections are taken over a 360° rotation

and subsequently reconstructed with CT Pro software (Nikon

Metrology, Tring, UK), which uses a modified Feldkamp’s

back-projection algorithm.

2) Sky Scan 1172 microtomograph at the Hellenic Centre for

Marine Research uses a tungsten source and is equipped with an

11 megapixel CCD camera (4000x2672 pixel). The highest

possible resolution is 0.8 //m/pixel. Specimens were scanned at

a voltage of 60 kV with a flux of 167//A without filter and scans

were performed for a full rotation of 360°. Images were acquired

at highest camera resolution. The projection images were

subsequently reconstructed into a sequence of cross sections

with the NRecon software (Bruker/SkyScan, Kontich, Belgium)

which uses a modified Feldkamp’s back-projection algorithm.

These cross-sections were reconstructed from the full set of

projection images (360°), other reconstruction parameters were

chosen individually for each sample.

Three-dimensional models were created, from the

tomographic datasets, and manipulated using the Drishti

software suite (http://eode.google.eom/p/drishti-2) Limaye

and VG-Studio Max 2.1 (Volume Graphics GmbH, Heidelberg,

Germany). Drishti is recommended for the manipulation of

this type of dataset. Drishti operates by loading a stack of

‘back-projected’ images (cross-sections of the sample) from

the scan then converting it into 3-D volumetric data. This

image is composed of voxels (3-D pixels) that are individually

assigned a grayscale value, which represents the x-ray

absorption at that point.

Staining protocols

Stains such as phosphotungstic acid (PTA) and iodine are well

established in micro-CT studies (see Metscher, 2009) and

appear to have similar general properties. As part of a wider

study on the use of micro-CT in the study of polychaete

anatomy we reviewed the potential for existing histological

stains to be developed for use in CT studies. Specifically, we

were looking for stains known to highlight particular tissues

and which also have the potential to increase the absorption of

X-rays by those tissues, making them appear more opaque. The

test determined how easy the protocols for staining were, the

specificity of the stain in CT rendering and whether the process

could be reversible, making them more amenable to use on

museum specimens. In addition to Iodine and PTA, two

traditional histological stains which stain specific tissues, were

tested - silver stain (Golgi, 1873) and iron stain (Wigglesworth,

1952). The former stains nerve tissue while the latter highlights

nucleic acids and proteins. As part of a Master’s study project

undertaken by one of the authors (RM) the efficacy of the

various stains were assessed for a number of different staining

and clearing regimes. Standard histological methods were used

to assess stain penetration and using the results the timings and

concentrations cited below were derived.

a) Silver stain. The Silver stain method is based on the

method of Golgi (1873) but adapted as a bulk stain. Stain

reversal is possible.

1) Specimens were stained in 3% aqueous potassium

dichromate for up to seven days, and the solution replaced daily

and kept in the dark. 2) Excess solution was removed and samples

placed in a solution of 2% silver nitrate and stained for seven

days; the solution was changed frequently until brown precipitate

no longer appeared. The specimen will be red to black in colour.

3) Specimens were removed from the stain, rinsed with, and then

stored in, 70% ethanol, ready to be scanned.

Stain removal. 1) Specimens were dehydrated, firstly in 90%

ethanol for 24 hours then a further 24 hours in 100% ethanol. 2)

Specimens were placed in a 1:1 solution of hexamethyldisilizane

(HMDS) and 100% ethanol for 24 hours, then placed in 100%

solution of HDMS for 24 hours. 3) Once the stain had disappeared

the specimen was rehydrated in stages back to 70% ethanol.

The pros and cons of using micro-computed tomography in gross and micro-anatomical assessments of polychaetous annelids

239

Table 1. Comparison of traditional anatomical approaches, using the SEM and micro-CT.

CT Approach

Classical

Serial section

Straightforward

Process well understood but histology can be complex

Dissection

Virtual-straightforward after training

Needs skill and manual dexterity

3-D Reconstruction

Easy-depending on equipment

Involved

Identification of

anatomical feature/tissue

Difficult at times

Well established

Impact on specimen

Specimen available for further study

Specimen altered and in some cases destroyed

DNA impact

Limited depending on X-ray dosage

Compromised in some procedures

Resolution

Micron/submicron range

Thin sections can give high cell-level resolution but

resolution in Z is generally compromised

HMDS should always be used in a fume cupboard and be

handled with protective gloves and goggles.

b) Iron Stain. Wigglesworth (1952) developed the Iron

stain to highlight and measure the abundance of nucleic acids

and proteins. Exact timing will depend on specimen size. The

method outlined below applies to large specimens (>3 cm in

length), in this case a large nereidid.

1) Specimens were hydrated in stages to distilled water. 2)

Placed in 0.25% solution of ammonium iron (III) sulphate (iron

alum) for five minutes. 3) Rinsed gently with distilled water. 4)

Placed in 10% solution of ammonium sulphide for 150 seconds

(i this was carried out in a fume cupboard ). A black iron

sulphide precipitate formed immediately. 5) Specimen were

then blotted dry and transferred to 2% solution of potassium

ferricyanide. A cloudy precipitate formed. The solution was

changed until this no longer happened. 6) Specimens were left

in final solution for 24 to 48 hours (changing the solution after

24 hours if longer staining was sought until specimens were a

blue colour. 7) Finally the specimens were rinsed with and

stored in 70% ethanol, ready to scan.

Stain removal. 1) Specimen placed in saturated solution of

potassium oxalate for at least 48 hours until all the blue stain

has been removed. The solution should be replaced every 24

hours. Stain removal can take up to one week on large

specimens. 2) Specimen can then be dehydrated in stages back

to 70% ethanol.

c) Iodine stain. Exact timing will depend on the size of

specimen. These instructions are for a large nereidid. 1)

Specimens were dehydrated to 100% ethanol, in two steps

80% then 100%, 24 hours per step. 2) They were then placed

in I2E (stock solution of 1% metallic iodine in 96% alcohol)

for 24 hours, ready for scanning.

Stain removal. 1) Specimens were placed in 90% ethanol

for as long as it took to remove stain. As the stain comes out of

the specimen The solution was replaced, at least every 24

hours as it became cloudy black, until the precipitate no longer

formed2) Specimen was hydrated back to 70% ethanol in

stages.

d) Phosphotungstic acid (PTA). The stock solution

comprised 1% (w/v) phosphotungstic acid in water. The

specimens were stained in a mixture of 30 ml 1% PTA solution

and 70 ml absolute ethanol ( 0.3% solution).

1) Specimens were dehydrate to 70% ethanol (PTA in 70%

ethanol keeps indefinitely). 2) They were stained for at least 2

hours but longer (e.g. overnight) was sometimes necessary

depending on specimen size. 3) Specimens were then washed

in 70% ethanol. Staining is stable for months. 4) Specimens

were scanned in 70% - 100% ethanol.

This is an irreversible stain.

Enhancing contrast by use of (HMDS).

Hexamethyldisilizane (HDMS) removes water from tissues

effectively increasing the clarity of boundaries between air

and tissue which in turn enhances the contrast when scanning

with X-rays. The use of HMDS emulates critical point drying

and has therefore gained favour in scanning biological material

using the SEM (Bray et al., 1993). However, the standard

method (Oshel, 1997) has had to be adapted for polychaete

specimens to be scanned using a micro-CT.

1) Specimens were dehydrated through ethanol series

70%, 80%, 90% to 100% with 24 hours in each. 2) Then

transferred to 1:1 solution of 100% ethanol and HMDS for 24

hours. 3) Transferred to HMDS for at least 24 hours. 4)

Specimen was removed from solution and air dried overnight

in a fume cupboard. Specimen is then ready for scanning.

Rehydrating. 1) The procedure reversed the above starting

with the 100% HMDS with at least 24 hours in each solution

until the desired storage solution was reached.

240

G.L.J. Paterson, D. Sykes, S. Faulwetter, R. Merks, F. Ahmed, L.E. Hawkins, J. Dinley, A.D. Ball & C. Arvanitidis

Results

General approach

Table 1 contrasts conventional anatomical methods employing

such techniques as dissection and traditional histology with

micro-CT. Both approaches have drawbacks. A conventional

approach involves a range of techniques to produce data. Dinley

(2013) demonstrated the range of approaches useful in functional

anatomical studies of polychaetes. Such techniques range from

the low resolution - gross anatomy provided by dissections - to

ultra high-resolution derived from transmission electron

microscopy. Reconstructing the structure of particular features

or visualising the arrangements of internal anatomy is time

consuming and can be compromised by artefacts caused by

sample processing, for examples wrinkles and shrinkage in the

sections can distort anatomical features and the resolution in thin

sections might be very good in X and Y, but the sections are

considerably thicker than this in conventional serial sections, so

the data collected is not isotropic whereas computed voxels from

micro-CT are isotropic. In addition to the range of skills required

in developing this conventional anatomical ‘pipeline’, such

studies also require the use of a number of specimens. Therefore,

large-scale comparative studies are particularly challenging to

undertake. Access to museum specimens, an obvious source of

specimens from a broad range of species, is restricted because of

damage resulting from destructive sampling, dissections and

alteration of specimens in making serial sections.

By contrast, micro-CT scans and supporting software

allow the researcher to perform many tasks virtually, such as

dissection or sectioning in various planes as well as produce

accurate 3-D rendering of anatomical features without any

induced distortion. Using the micro-CT scanner overcomes

many of the issues which restrict the use of specimens from

museum collections and opens the way for relatively rapid yet

detailed anatomical studies.

However, micro-CT also has challenges and problems. In

this next section we will outline some of these issues and

discuss the solutions or alternatives.

Issues and problems

X-ray transparency and anatomical imaging. Problems

associated with trying to image soft-bodied invertebrates,

such as polychaetes, stem from the fact that they absorb almost

no X-rays, resulting in images with very little contrast. Whilst

jaws and other hard structures such as chaetae can be

visualised, other internal features such as nerves, muscles and

blood vessels can be more challenging to discriminate.

With a low contrast image, internal anatomy may be

difficult to describe or illustrate accurately. Unstained material

poses particular problems as the images can be ‘noisy’ and

lengthy manipulation with visualization software is needed to

differentiate real structures from rendering artefacts (fig. 1). So

it may be necessary to assess structures and features observed

in micro-CT images by comparing them to classical anatomical

studies in the initial stages.

There are approaches which can overcome, at least to some

extent, the problem of X-ray transparency. Dependent on the

scanner used, parameters (e.g. scanning time, filters, X-ray

energy, wavelength) can be optimised to reduce noise and

increases the contrast and so improve the final images.

Studies using the NHM micro-CT scanner on unstained

polychaetes suggest that using a molybdenum target with

exposure times of 354 ms and voltages of 110 kV at 200 pA and

exposure times of 354 ms produces good quality images. Good

images were obtained using the Skyscan 1172 with a tungsten

target, 60kV / 167/*m without filter (or with an aluminium filter

if the specimen contains both hard and soft structures). In both

cases the specimens were scanned in a sealed tube in air, and

not immersed in liquid medium (a small reservoir of liquid at

the bottom of the tube kept the specimens hydrated).

Resolution. Classical histological analyses making use of

embedded and serially sectioned materials deliver high spatial

resolution compared to many micro-CT scanners. It is possible to

scan to relatively high resolutions using the micro-CT but this is

dependent on the on the type of CT scanner employed. With the

classical “cone beam” micro-CT scanner the spot size determines

the maximum resolution possible and the geometry of the

scanning system (origin of the X-rays; position of the sample;

position and size of the detector panel; number and size of pixels

in the panel) determine the maximum size of specimen that can

be examined for any given spot size or resolution. An approximate

guide is that the higher the resolution required, the smaller the

area of the sample that can be scanned. Alternative micro-CT

systems make use of X-ray focussing systems, lenses and detector

panels derived from Synchrotron X-ray micro-CT technologies

and these systems can overcome many of the limitations of the

cone-beam scanners, but at increased cost and complexity.

Use of stains in anatomical studies. While stains described

here increase the opacity of tissues, most are non-specific,

unlike conventional histological stains which have a long history

of study and many can be tissue or cell-type specific. Most

stains currently employed in micro-CT analyses are used to

enhance the bulk contrast rather than distinguishing between

specific tissues. Thus it is often the case that distinctly different

tissues appear to have the same or similar contrast in the

resulting images. Also, bulk staining poses problems in that the

stain has to be able to penetrate the specimen and still be of

sufficient molecular weight to absorb effectively X-rays.

Specimens stored in alcohol or dehydrated in various mediums

have poorer permeability than fresh material. There are methods

to ‘relax’ fixed tissue which increases the permeability of the

cuticle but these have yet to be tested on polychaete specimens.

Conventional histochemical stains are used on very thin sections

of tissue so that penetration is not usually an issue.

Staining for specific tissues

Silver stain. Results indicate that the main drawback with

Silver stain is that is does not penetrate effectively far within

the tissues when used as a bulk stain. The stain is difficult to

use and unstable in that it often does not stain but precipitates

out of solution. Generally, whilst in some cases it has been

shown to stain nerves, overall the resulting images are ‘noisy’

showing poor resolution (fig.la). These results contrast with

those of Butzloff (2011) for honey bees, where silver was used

to good effect to stain a number of internal features. It is likely

that the better results obtained are due to the chemistry of

The pros and cons of using micro-computed tomography in gross and micro-anatomical assessments of polychaetous annelids

241

Figure 1. Transverse sections of Hediste diversicolor after treatment with reversible stains or drying agents, a) Silver stain, the gut and main

muscle blocks can be seen but also showing paper material used to stabilise the specimen surrounding the central image (molybdenum target,

131 KV, 354 millisec exposure; b) iron stain, again gut and main muscles can be seen but also ventral blood vessels linking the central ventral

blood vessel to the network surrounding the gut (molybdenum target, 131 KV, 500 millisec exposure); c) Iodine shows similar anatomical

features as Iron stained material (molybdenum target, 130 KV, 320 millisec exposure); d) Hexamethyldisilizane (HDMS) image shows more

clearly the internal anatomy including the ventral blood vessels (molybdenum target, 110 KV, 300 millisec exposure). Scale bar = 1.00 mm.

Specimens were scanned using the Nikon metrology HMX ST 225 at the NHM. Abbreviations: Ac-internal paradpodial acicula; DLM-dorsal

longitudinal muscle; G-gut; Plc-V-Plexus lateral connective blood vessels; VB-ventral blood vessel; VLM-ventral longitudinal muscles

chitin and silver but also due to action taken to improve the

permeability and therefore uptake of silver. Chemically

enhancing permeability through the epidermis is potentially

also a useful area for future investigation for polychaetes.

Iron stain. Results of Iron staining showed more promise

than the Silver stain. Surface features were clear and internal

features generally showed greater contrast (fig.lb). Blood vessels

were clearly identified in nereidids and arenicolids. This method

is also reversible by placing the specimen in a saturated solution

of potassium oxalate until the original blue stain disappears.

Iodine stain. Metscher (2009) described a range of

methods using iodine to stain soft tissue. The ease of use and

levels of contrast obtained have made this a popular method in

micro-CT scanning. With polychaetes results are less

consistent. For example, this stain works well with those

species with well-developed muscle systems such as nereidids

(fig. lc) but is less successful with groups such as arenicolids

where muscle systems are less concentrated. The method is

also easily reversible by placing the specimen in 90% ethanol

until the iodine is removed from the specimen.

PTA stain. Phosphotungstic acid worked very well on all

studied specimens (fig.2). Muscles and the cuticle stained very

well, a known feature of PTA, which binds preferentially to

certain proteins (Quintarelli et al., 1973). However, PTA

penetrates tissues slowly and is bound in high quantities, so

staining can take several weeks for large specimens and the

solution needs to be renewed frequently until the desired

staining effect is achieved.

242

G.L.J. Paterson, D. Sykes, S. Faulwetter, R. Merks, F. Ahmed, L.E. Hawkins, J. Dinley, A.D. Ball & C. Arvanitidis

Figure 2. Pharyngeal anatomy of Glyceridae: Glycera tesselata (PTA-staining) (a-c); Pilargidae: Sigambra parva (d-f) and Polynoidae:

Lepidonotus clava (g-i). Glycera a) surface morphology showing everted pharynx; b) longitudinal section through everted pharynx; c) transverse

section of gut as indicated by line in b); scale bars = 0.5 mm. Sigambra d) surface morphology showing everted morphology; e) longitudinal

section through the pharynx; f) transverse section through distal pharynx as indicated by the line in e); scale bars = 0.5 mm. Lepidonotus g)

surface morphology showing everted pharynx; h) longitudinal section through pharynx; i) transverse section through distal pharynx as indicated

by line in h); scale bar = 1.00 mm. P = pharynx. All three examples show a relatively short axial pharynx approximately as wide as long. The

distal part of the pharynx is characterised by distinct muscle blocks which when contracted form a cruciform cross section. Specimens were

scanned using the SkyScan 1172 microtomograph at HCMR at 60kV /167 pA, without a filter, no camera binning, full rotation of 360°, tungsten

target. Abbreviations used: J-jaws; P-pharynx; PG-poison glands; Pr-prostomium; PS-proboscidian sheath; RM-ring muscle.

Creating greater contrast by drying

Protocols using Hexamethyldisilizane (HMDS) are gaining

increased use in electron microscopy and micro-CT because

of the greater clarity and contrast of the resulting data. HMDS

effectively mimics the critical-point drying process,

dehydrating the tissues and, as importantly, this drying process

appears to be reversible with limited after effects on the

specimen. Fig. Id shows how effective HDMS can be. Fine

scale internal anatomy such as the lateral connective blood

vessels are clearly seen as are the dorsal and ventral blood

vessels themselves. Muscular tissue is well differentiated and

a reasonable degree of resolution is possible. However, internal

tissue damage is possible, particularly tearing and ruptures,

caused by differential drying during the dehydration process

in HDMS. Specimens treated with HMDS become fragile and

can be damaged if not handled carefully.

Further work needs to be undertaken to ensure that tissue

damage either is not a problem or that a suitable protocol can

be established to minimise these effects.

An example of the uses of micro-CT in the study of

polychaete anatomy

Dales’ (1962) seminal paper laid out the fundamental gross

anatomy of the polychaete pharynx and, whilst there have been

a number of revisions of parts of this schema, a comprehensive

review of this work has yet to take place. Using both micro-CT

scanners, we have scanned the pharyngeal anatomy of a

representative species from most families currently considered

The pros and cons of using micro-computed tomography in gross and micro-anatomical assessments of polychaetous annelids

243

to be part of the Aciculata clade {sensu Rouse and Pleijel,

2001). The basic gross morphology was assessed. A list of the

species examined is given in the figure captions. Figs 2-4

indicate that there are significant differences in the overall

proportions of the pharynx and associated structures. Fig. 2

illustrates what might be termed taxa with a short pharynx, i.e

one where the length to breadth ration is 1:1 or 2:1. The relative

proportions of the pharynx varies from being relatively short

and approximately as wide as long in the glycerid, pilargid and

polynoid. Fig. 3 shows taxa where the pharynx is much longer

than broad i.e. >3:1. The hesionid and phyllodocid have long

pharynxes while the nephtyid has an intermediate length. The

pharynx among taxa shown in fig. 4 have different anatomical

arrangements. In the syllid the basic pattern of a thin mucular

tube (sensu Dales 1962) connecting to a thick muscular pharynx

was not observed. The muscles of the buccal tube in the syllid

are not well developed, and this region could be better described

as a proboscidain tube leading to a muscular proventicle (sensu

Tzetlin and Purschke, 2005).

Dales (1962) proposed that the muscular pharynx in errant

taxa was used primarily to crush prey. A second character

found in some families is the development of four sets of

longitudinal muscle blocks in the distal part of the pharynx

(Figs 2, 3) resulting in a cruciform cross-section. Dinley et al.

(2009) showed this arrangement in Nephtyidae (Nephtys

hombergi, fig. 3i), suggesting that it facilitated the crushing of

ingested prey. Other families showing this arrangement are

the Glyceridae (fig. 2c), Pilargidae (fig. 2f), and the scaleworm

families Polynoidae (fig.2i), Sigalionidae (not shown here) and

Aphroditidae (not shown here). It was absent in the Hesionidae

(fig3c), Phyllodocidae (fig.3e), Syllidae and Nereididae

specimens examined (fig. 4).

Figure 3 Pharyngeal anatomy of Hesionidae: Hesiospina similis (a-c, PTA staining); Phyllodocidae: Phyllodoce lineata (d-f. PTA staining) and

Nephtyidae Nephtys hombergi (g. Iron stain, h-i, unstained). Hesiospina a) surface morphology showing everted pharynx; b) section through

everted pharynx; c) TS showing distal pharynx as indicated by line in b. Phyllodoce d) surface morphology showing everted pharynx; e) section

through pharynx; f) TS showing distal pharynx as indicated by line in e. Scale bars = 0.5 mm. Nephtys images from three different individuals g)

surface morphology showing everted pharynx; h) section showing pharynx but not everted; i) TS of distal pharynx indicated by line in h. Scale bar

= 1.00 mm Hesiospina and Phyllodoce have long thin pharynges while Nepthys has a medium lengthed phaynx. Only Nepthys shows the cruciform

muscle arrangement in the distal pharynx, in the others the muscles do not appear to form these discrete blocks. Images 3a-f were produced using

the SkyScan 1172 microtomograph at HCMR at 60kV / 167//A, without a filter, no camera binning, full rotation of 360°, tungsten target. Images

3g-i were produced using the Nikon metrology HMX ST 225 at the NHM (60 KV, 2 sec exposure, molybdenum target.) Abbreviations used:

OPM-outer pharyngeal muscles; P-pharynx; Pr-prostomium; PS-proboscidian sheath; T-teeth; VLM-ventral longitudinal muscle.

244

G.L.J. Paterson, D. Sykes, S. Faulwetter, R. Merks, F. Ahmed, L.E. Hawkins, J. Dinley, A.D. Ball & C. Arvanitidis

Figure 4. Pharyngeal anatomy of Syllidae: Syllis gracilis (a-c, PTA stained) and Hediste diversicolor (d-h, ). Syllis a) section through body

showing the proventricuius; b) surface morphology, lines c where transverse section c image taken, line d where transverse section d image taken;

c) TS showing pharyngeal tube; d) TS showing proventricle. Scale bars = 0.5 mm. Hediste e) surface morphology; f) section through pharynx,

lines g and h where transverse section images taken; g) TS through anterior pharynx at level of jaws; h) TS through distal pharynx. TS through

pharynx indicates that the pharynx is not symmetrical, particularly in the distal part. Scale bars e, f = 5.00 mm, g,h = 1.00 mm. Images la-d

were produced using the SkyScan 1172 microtomograph at HCMR at 60kV / 167/iA, without a filter, no camera binning, full rotation of 360°,

tungsten target. Images i-h were produced using the Nikon metrology HMX ST 225 at the NHM (60 KV, 2 sec exposure, molybdenum target).

Abbreviations used:; DLM-dorsal longitudinal muscles; J-jaws; M-mouth; P-pharynx; Pr-prostomium; PO-proventricle; PS-proboscidian

sheath; VLM-ventral longitudinal muscles.

Finally, while most of the families examined showed a

symmetrical or nearly symmetrical axial pharynx, Nereididae

did not. (fig. 4h). There was a distinct asymmetry with the ventral

muscle blocks more developed than the dorsal (also noted by

Dales, 1962). This arrangement may be related to the orientation

of the large jaws, a feature absent in most other families.

Analyses of the gross anatomy is subject of continuing

study but it appears that the stomodeum and associated

structures can produce more characters for phylogenetic

studies than have been used the past.

Discussion

Micro-CT is an imaging tool par excellence. Table 2

summarises the advantages and disadvantages of using micro-

CT in anatomical studies. The advantages centre around the

ease of studying specimens without damaging them and the

relative ease of interpreting resulting images. A range of

techniques can be deployed to produce virtual dissections of

key features and serial sections in any plane desired. The

resulting files, both original image stacks and rendered images

are standard image files and thus can be distributed without

compatibility problems between researchers. CT rendering

can also be embedded within PDFs (see Faulwetter et al. 2013

for an example), which enables readers to examine and interact

with the images produced. It is also possible that rendered

images of type specimens could be sent as virtual loans instead

of delicate specimens.

Despite the apparent high capital costs (conventional cone-

beam scanners range from US$80K to over US$400K

depending on the features), scanners are actually comparable

in price with highly specified traditional compound

microscopes in the case of the cheaper scanners; while the

more expensive scanners are comparable with scanning

electron microscopes, thus bringing CT scanning within reach

of many institutions. Questions regarding the resolution of the

resultant images depend on the specimens and to some degree

the techniques employed, particularly whether staining is

used. However, technological advances in instrument design

are resulting in greater resolution (Stock, 2012).

The pros and cons of using micro-computed tomography in gross and micro-anatomical assessments of polychaetous annelids

245

Table 2. Comparing the advantages and disadvantages of imaging with a micro-CT.

Pros

MicroCT is relatively quick to scan - 40 minutes to 12 hours (overnight)

Specimens are available for future study

Ease of reconstruction and investigation

Volumes created can be distributed and reanalysed easily

Images are easy to interpret and display - 2-D and 3-D

Using a range of techniques it is possible to use Types and rare specimens

Micro-CT scannere are becoming relatively inexpensive (less than the cost of a SEM)

Free analytical software exists (e.g. Drishti, Image J)

Cons

Lack of stains for specific tissues

Image volumes are large (>3+ GB)

Rendering the images is very time consuming depending on what you want to achieve

Storage and retrieval of large numbers of files

Data pipelines and IT infrastructure can be an issue

Technical support helps enormously in running and developing techniques

Attempts to develop stains to highlight specific tissues have

mixed success and more development is needed - a topic which

is of interest to other disciplines as well (Pauwels et al., 2013).

Drying with HMDS appears to provide a useful procedure to

enhance tissue contrast in soft-bodied invertebrates like

polychaetes. However, there is some development still needed

on the methodology to understand the risk posed by differential

drying which can result in tissue damage.

Perhaps the most important considerations when embarking

on micro-CT studies are the time and infrastructure required.

The amount of time is dependent on two distinct aspects of the

study. The first is the degree of detail and discrimination

required, while the second depends on the IT infrastructure

and support available. The first is driven by the scientific

question and is mediated by factors such as the need for contrast

enhancement, the resolution of the micro-CT scanner, the x-ray

source, etc., as explained above. High resolution studies will

require more effort in adjusting the initial parameters than

those undertaken to look at gross anatomical features and can

only be undertaken on small samples. Micro-CT studies can be

considered as analysis-heavy. It is relatively quick to acquire

the X-ray images needed to create the reconstruction but it then

requires a reasonable investment of time to process the images

into a coherent and recognisable result. While powerful

software is available, some free, it nevertheless takes time to

produce images of specific tissues or structures. Rendering of

surface features and anatomy is easiest to undertake but

generating pictures of internal anatomy can involve considerable

manipulation of the rendered images to isolate and display

specific features. The results are, however, considerably easier

for third parties to interpret in resulting publications and the

data files are available allow others to manipulate, explore and

evaluate the data produced.

Consideration must also be given to data management

when undertaking micro-CT studies. In laboratories with

existing imaging capability such data pipelines will be well

established but for individuals and newly established micro-CT

systems, consideration must be given to the transfer, retrieval,

manipulation and long-term storage of files. An image stack of

X-rays is often gigabytes in size (depending on specimen size

and how much of the specimen is imaged). Manipulating and

analysing such files requires a powerful computer with

considerable RAM (read-only memory) size and dedicated

graphics card. Individual scientists need to consider how they

will store original images and rendered results and will need

access to a secure off-site server for long-term storage.

One aspect of the use of X-rays is their potentially

damaging effect on genetic tissue. Given that X-rays are a core

tool for human medicine, this suggests that use of micro-CT

may have limited impact on genetic material. Trials using bird

specimens did not find any discernible effects (Paredes et al.,

2012) and tests on polychaete material also failed to show any

major impact, at least for the 16S rRNA gene (Faulwetter et al.,

2013) . These results indicate that - at least with commonly

used scanning parameters - there should be no impediment to

using this approach on specimens in museums.

Conclusions

The current state-of-the-art suggests that the micro-CT is a

particularly useful tool for anatomical studies, particularly for

large-scale comparative projects. In conjunction with other

methods, the micro-CT data are also useful in isolating

specific areas or internal structures for further studies.

New instruments, software and processors mean that the

technology is advancing and that increased use will advance

246

G.L.J. Paterson, D. Sykes, S. Faulwetter, R. Merks, F. Ahmed, L.E. Hawkins, J. Dinley, A.D. Ball & C. Arvanitidis

our understanding of the anatomy at increasingly higher

resolutions. Real time functional anatomical analyses will also

be possible. Thus, the potential for polychaete anatomical

studies has never been so great, and three-dimensional imaging

techniques such as micro-CT have the potential to give a strong

boost to the discipline and pave the way for new discoveries.

References

Bray, D. F., Bagu, J. and Koegler, P. 1993. Comparison of

Hexamethyldisilizane (HDMS), Peldri II, and critical-point

drying methods for scanning electron microscopy of biological

specimens. Microscopy Research Techniques 26(6): 489-495.

Butzloff, P. R. 2011. Micro-CT Imaging of denatured chitin by silver

to explore honey bee and insect pathologies. PLoS ONE, 6,

e27448, 1-10.

Dales, R. P. 1962. The polychaete stomodeum and the inter¬

relationships of the families of Polychaeta. Proceedings of the

Zoological Society of London 139: 289-328.

Dinley, J. 2013. The Paradigms of gut architecture and Feeding

Biomechanics in shallow water Polychaetes. PhD thesis

University of Southampton.

Dinley, J., Hawkins, L., Paterson, G., Ball, A., Sinclair, I., Sinnett-

Jones, P., and Lanham, S. 2009. Micro-computed X-ray

tomography: a new non-destructive method of assessing sectional,

fly-through and 3-D imaging of a soft-bodied marine worm.

JournalofMicroscopy, 1-11. doi:10.1111/j. 1365-2818.2009.03335.x

Faulwetter, S., Vasileiadou, A., Kouratoras, M., Dailianis, T. and

Arvanitidis, C. 2013. Micro-computed tomography:

Introducing new dimensions to taxonomy. ZooKeys, 263, 1-45.

doi:10.3897/zookeys.263.4261

Golding, R. E. & Jones, A. S. 2007. Micro-CT as a novel technique for

3-D reconstruction of molluscan anatomy. Molluscan Research,

27, 123-128.

Golgi, C. 1873. Sulla struttura della sostranza grigia della cervello.

Gazzetta Medica Italiana, Lombardia 6:244-246.

Lanzavecchia, G., De Eguileor, M. and Valvassori, R. 1988. Muscles.

Microfauna Marina, 4, 71-88.

Li, H., Tang, Z., Hu, G. & Zhang, H. 2008. Micro-computed

tomography for small animal imaging: technological details.

Progress in Natural Science, 18, 513-521.

Mao, X., Zhu, L.-Y. and Zheng, J.-S. 2007. A study of the histology,

histochemistry and ultrastructural of the digestive tract of the

Marphysa sanguinea. Zhongguo Haiyang Daxue Xuebao, 37,

961-967.

Metscher, B. 2009. Micro-CT for comparative morphology: simple

staining methods allow high contrast 3-D images of diverse non-

mineralised animal tissues. BMC Physiology 9:11

Nielsen, C. 2011. Animal evolution. 3 rd edition. Oxford University

Press, Oxford.

Orrhage, L. 1990. On the microanatomy of the supraoesophageal

ganglion of some amphinomids (Polychaeta Errantia), with

further discussion of the innervation and homologues of the

polychaete palps. Acta Zoologica (Copenhagen), 71, 45-49.

Oshel, P 1997. SPI-Chem™ Hexamethyldisilizane (HDMS).

Microscopy Today 97:4-16.

Paredes UM, Prys-Jones R, Adams M, Groombridge J, Kundu S,

Agapow P-M, Abel RL (2012) Micro-CT X-rays do not fragment

DNA in preserved bird skins. Journal of Zoological Systematics

and Evolutionary Research 50: 247-250. doi: 10.111 l/j.1439-

0469.2012.00657.x

Pauwels, E., van Loo, D., Cornillie, P., Brabant, L., van Hoorebeke,

L., 2013. An exploratory study of contrast agents for soft tissue

visualization by means of high resolution X-ray computed

tomography imaging. Journal of microscopy 250, 21-31.

Purschke, G. 1988. Pharynx. Microfauna Marina, 4, 177-197.

Purschke, G. 2005. Sense organs in polychaetes (Annelida).

Hydrobiologia, 535-536, 53-78.

Quintarelli G, Bellocci M, Geremia R (1973) On phosphotungstic

acid staining. IV. Selectivity of the staining reaction. Journal of

Histochemistry & Cytochemistry 21: 155-160. doi:

10.1177/21.2.155

Raffe, R.A., Field, K.G., Olsen, G.J. et al 1989. Metozoan phylogeny

based on analysis of 18S RNA. In Fernholm, B., Bremer, K. and

Jornvall (eds). The hierarchy of life. Moleculaes and morphology

in phylogenetic analyses. Excerta Medical, Elsivier Amsterdam.

pp247-260.

Roche, R. C., Abel, R. A., Johnson, K. G. & Perry, C. T. 2010.

Quantification of porosity in Acropora pulchra (Brook 1891)

using X-ray micro-computed tomography techniques. Journal of

Experimental Marine Biology and Ecology, 396, 1-9.

Rouse, G. and Pleijel, F. 2001. Polychaetes. Oxford University Press,

396pp

Saulnier-Michel, C. 1992. Polychaeta: digestive system. Microscopic

anatomy of invertebrates. Volume 7: Annelida., 53-69.

Stock, S.R. 2012 Trends in micro-and nanoComputed Tomography

2010-2012. Developments in X-Ray Tomography VIII,: San

Diego, CA, USA, 13-15 Aug. 2012 In: Proceedings of Proceedings

of the SPIE - The International Society for Optical

Engineering Volume: 8506 Pages: 850602 (4 pp.) DOI:

10.1117/12.930157

Struck, T. H., Paul, C., Hill, N., Hartmann, S., Hosel, C., Kube, M.,

Lieb, B., Meyer, A., Tiedemann, R., Purschke, G. and Bleidorn,

C. 2011. Phylogenomic analyses unravel annelid evolution.

Nature 470 (7336), 95-98. doi:10.1038/nature09864

Tzetlin, A. and Purschke, G. 2005. Pharynx and intestine.

Hydrobiologia, 535-536, 199-225.

Tzetlin, A. and Zhadan, A. 2009. Morphological variation of axial

non-muscular proboscis types in the Polychaeta. Zoosymposia,

2, 415-427.

Udupa, J.K. and Herman, G. T. (2000) 3-D Imaging in Medicine, 2nd

Edition, CRC Press, Boca Raton.

Wiklund, H„ Nygren, A., Pleijel, F. and Sundberg, P. 2008. The

phylogenetic relationships between Amphinomidae,

Archinomidae and Euphrosinidae (Amphinomida: Aciculata:

Polychaeta), inferred from molecular data. Journal of the Marine

Biological Association of the United Kingdom, 88, 509-513.

Wigglesworth, V. B. 1952. The role of iron in histological staining.

Quarterly Journal of Microscopical Science 93:105-118.

Zrzavy, J., Rfha. P, Pialek, L., & Janouskovec, J. (2009). Phylogeny

of Annelida (Lophotrochozoa): total-evidence analysis of

morphology and six genes. BMC Evolutionary Biology, 9(1), 189.

doi: 10.1186/1471-2148-9-189

Zanol, J. 2010. Homology of prostomial and pharyngeal structures in

Eunicida (Annelida) based on innervation and morphological

similarities. Journal of Morphology, 271, 1023-1043.

Memoirs of Museum Victoria 71:247-269 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Systematics, evolution and phylogeny of Annelida - a morphological perspective

Gunter Purschke 1 *, Christoph Bleidorn 2 and Torsten Struck 3

Zoology and Developmental Biology, Department of Biology and Chemistry, University of Osnabriick, Barbarastr. 11,

49069 Osnabriick, Germany (purschke@biologie.uni-osnabrueck.de)

2 Molecular Evolution and Animal Systematics, University of Leipzig, Talstr. 33, 04103 Leipzig, Germany (bleidorn@

rz.uni-leipzig.de)

3 Zoological Research Museum Alexander Konig, Adenauerallee 160, 53113 Bonn, Germany (torsten.struck.zfmk@uni-

bonn.de)

* To whom correspondence and reprint requests should be addressed. Email: purschke@biologie.uni-osnabrueck.de

Abstract Purschke, G., Bleidorn, C. and Struck, T. 2014. Systematics, evolution and phylogeny of Annelida - a morphological

perspective . Memoirs of Museum Victoria 71: 247-269.

Annelida, traditionally divided into Polychaeta and Clitellata, is an evolutionary ancient and ecologically important

group today usually considered to be monophyletic. However, there is a long debate regarding the in-group relationships

as well as the direction of evolutionary changes within the group. This debate is correlated to the extraordinary evolutionary

diversity of this group. Although annelids may generally be characterised as organisms with multiple repetitions of

identically organised segments and usually bearing certain other characters such as a collagenous cuticle, chitinous

chaetae or nuchal organs, none of these are present in every subgroup. This is even true for the annelid key character,

segmentation. The first morphology-based cladistic analyses of polychaetes showed Polychaeta and Clitellata as sister

groups. The former were divided into Scolecida and Palpata comprising Aciculata and Canalipalpata. This systematisation

definitely replaced the old concept of dividing polychaetes into Errantia and Sedentaria, whereas the group Archiannelida

had already been abandoned. The main critics came from a contradicting hypothesis relying on scenario based on

plausibility considerations regarding Clitellata as highly derived annelids nesting within polychaetes and rendering the

latter paraphyletic. In this hypothesis the absences of typical polychaete characters were regarded as losses rather than as

primary absences. However, to date attempts to unambiguously identify the sister group of Clitellata on the basis of

morphological characters have failed. Thus, two hypotheses on the last common annelid ancestor have been put forward

either being an oligochaete-like burrowing animal or a parapodia-bearing epibenthic worm. These attempts to understand

the major transitions in annelid evolution are reviewed and discussed in the light of new morphological evidence such as

photoreceptor cell and eye evolution as well as the evolution of the nervous system and musculature. We also discuss the

plausibility of these scenarios with regard to recent advances in molecular phylogenetic analyses.

Keywords polychaetes, oligochaetes, Clitellata, Sedentaria, Errantia, ground pattern, morphology

Introduction

Annelida, traditionally divided into Polychaeta and Clitellata

(Rouse and Fauchald, 1995, 1998; Bartolomaeus et al., 2005),

is an evolutionary ancient and ecologically important group

comprising approximately 16,500 species occurring in marine,

limnetic and terrestrial habitats (Struck, 2011; Struck et al.,

2011). Their biological importance relies not only on the

comparatively high number of species but also on their often

high abundance. Although some species can be found in the

plankton throughout their entire life span, annelids usually

constitute a significant part of the endo- and epibenthos where

they occupy almost every existing ecological niche in the

marine environment. They occur from the deep sea to the

supralittoral zones of sandy beaches. However, the vast

majority of the limnetic and terrestrial species belong to only

one clade, called Clitellata, the members of which show

specific adaptations to terrestrial life (e.g. Purschke, 1999,

2002). Obviously due to subsequent adaptive radiations, this

broad ecological range occupied by annelids resulted in a high

morphological diversity (fig. 1A-L).

248

G. Purschke, C. Bleidorn &T.Struck

Figure 1. Examples of annelid diversity. A-D. Members of the basal radiation; A. Owenia fusiformis, Oweniidae, length about 100 mm. Inset:

part of the tube. B. Chaetopterus variopedatus, Chaetopteridae, length about 250 mm. C. Sipunculus nudus, Sipuncula, length about 350 mm.

D. Eurythoe complanata, Amphinomidae, length about 140 mm. E-F. Former Archiannelida; E: Protodriloides chaetifer, Protodrilida, length

about 13 mm; F. Diurodrilus subterraneus, length about 440 pm. G-H. Errantia; G. Platynereis dumerilii, Nereididae, length about 100 mm. H.

Microphthalmus similis, incertae sedis, length about 18 mm. I-M. Sedentaria. I. Fabricia stellaris, Sabellidae, length about 4 mm. J. Pygospio

elegans, Spionidae, length about 25 mm. K. Ophelia rathkei, Opheliidae, length about 8 mm. L. Lanice conchilega, Terebellidae, juvenile, length

up to 300 mm. M. Enchytraeus sp. Clitellata, length about 15 mm. Originals B, C, D: W. Westheide, Osnabriick.

Evolution and Phylogeny of Annelida

249

This diversity is the main reason why the phylogenetic

relationships among Annelida are still one of the largest

unsolved problems in metazoan phylogeny (Rouse and

Fauchald, 1995, 1997; Eibye-Jacobsen and Nielsen, 1996;

Westheide, 1997; Westheide et al., 1999; Rouse and Pleijel,

2001, 2003; Purschke, 2002; Bartolomaeus et al., 2005;

Struck, 2012). The main problems concern the monophyly of

Annelida, the organisation or character composition of the

annelid stem species, monophyly versus paraphyly of

Polychaeta, the inter-relationships between the various annelid

subtaxa as well as the taxon composition of the group

(Bartolomaeus et al., 2005; Struck et al., 2011; Struck, 2012).

Morphological and molecular evidence increases that taxa

which were formerly recognised as separate “phyla” are now

regarded as part of the annelid radiation, namely Pogonophora

(now Siboglinidae), Echiura, Myzostomida, and Sipuncula

(reviewed by Halanych et al., 2002; Struck, 2012; but see

Eibye-Jacobsen and Vinther, 2012).

The taxon composition of this presumed monophyletic

group Annelida including these former “phyla” is crucial for

reconstructing the characters of the annelid stem species or its

last common ancestor (Purschke, 2002). As a result of the

controversial hypotheses on the taxon composition and

phylogeny of Annelida, two hypotheses regarding the last

common ancestor have been put forward: either an oligochaete-

like burrowing animal, or a parapodia-bearing epibenthic

worm. Consequently polychaetes may be monophyletic or

paraphyletic (see Bartolomaeus et al., 2005; Struck, 2011).

Irrespective of the taxa included, the state of almost every

character considered varies greatly among annelids making

ground pattern reconstruction a difficult task. Although there is

general agreement that Annelida are organisms with a multiple

repetition of identically organised segments (Bartolomaeus et

al., 2005; Struck, 2011; Hannibal and Patel, 2013), there are

certain taxa in which even this so-called key-character is

virtually absent: e.g., Echiura, Sipuncula, Diurodrilus

(Purschke et al., 2000; Wanninger et al., 2005; Worsaae and

Rouse, 2008; Nielsen, 2012; Golombek et al., 2013). The

number of segments varies between species and may comprise

between only 6 or fewer (e. g. Parapodrilus psammophilus

Westheide, 1965) to more than 1,000 segments (e. g. Eunice

apliroditois (Pallas, 1788)) resulting in body lengths varying

from less than 600 pm to about 6 m (see Paxton, 2000).

Presence of segmentally arranged chitinous chaetae is another

key-character of annelids (Hausen, 2005a). However, the

pleisomorphic condition regarding shape and structure of these

chaetae and whether these chaetae were primarily situated in

lobe-like appendages, the parapodia, is also a matter of

discussion (Rouse and Fauchald, 1997; Bartolomaeus et al.,

2005; Struck, 2011). Also, some taxa lack chaetae in all stages

of their life cycle (e.g., Polygordiidae; see Ramey et al., 2012).

The aims of the present paper are (1) to briefly review the

systematics of annelids, (2) to discuss morphological characters

presumably important for the reconstruction of the ground

pattern, (3) to elucidate the question of paraphyly of polychaetes,

and (4) to identify directions of future research in annelid

morphology and phylogeny. Finally, all these are discussed in

the light of current molecular phylogenetic analyses of Annelida.

Annelid Systematics

Since the first phylogenetic analyses of molecular and

morphological datasets, approximately 20 years ago (Rouse

and Fauchald, 1997; McHugh, 1997), systematics of Annelida

has been undergoing major reassessments after a period of

relative stability. Although a detailed historical review of

traditional annelid systematisation can be found in Struck

(2012), some highlights are briefly summarised. Annelida as a

separate group was first recognised by Lamarck (1802) and

included polychaetes, earthworms and echiurans. Audouin &

Milne Edwards (1834) divided Annelida into annelides

errantes, annelides tubicoles (ou sedentaires), annelides

terricoles (= Capitellida + oligochaetes), and annelides

soucieuses (= Hirudinea). Errantia included the more vagile

forms and Sedentaria the more or less sessile, often

microphagous annelid groups. In this concept Annelida

obviously was not divided into Polychaeta and Clitellata (or

Oligochaeta). The division of Annelida into Polychaeta and

Oligochaeta goes back to Grube (1850), retaining the division

of polychaetes into two major groups which he called Rapacia

and Limivora. This classificatory concept of subdividing

polychaetes into Errantia and Sedentaria has been widely

accepted and was in use with some modifications for more

than 100 years (e. g., Hartmann-Schroder, 1971). A third major

annelid group, called Archiannelida, comprising several

groups of seemingly simply organised, small annelids was

introduced later by Hatschek (1878, 1893). This grouping

mirrors the view that “simple equals primitive” (e. g. Jamieson,

1992; but see Hughes et al., 2013).

Archiannelids show an apparently simple organisation and

may retain characters otherwise typical for annelid larvae

such as ciliary bands used for locomotion (Figs IE, F, 6C).

Their segmentation is often hardly recognisable and many

species possess neither chaetae nor parapodia. Most

archiannelid species are members of the meiofauna of marine

sediments (interstitial annelids). Errantia may be

morphologically characterised by well-developed parapodia

often equipped with dorsal and ventral cirri, prostomial

antennae and palps, usually with a high number of homonymous

segments, one or several pairs of tentacular (peristomial) cirri,

a pair of pygidial cirri, and adult individuals usually with one

or two pairs of pigmented, multicellular eyes (fig. 1G, H).

Often three subgroups are distinguished: Amphinomida,

Eunicida, and Phyllodocida. By contrast, Sedentaria are much

more diverse (fig. 1I-L) and may be characterised by more or

less simple or even lacking parapodia, usually without dorsal

and ventral cirri, typically with hooked chaetae (uncini); palps

and pygidial cirri are either absent or present whereas antennae

and peristomial appendages are always lacking. Pigmented

adult eyes are usually of the larval type in this group; i.e.

bicellular only, comprising one photoreceptor and one pigment

cell. These polychaetes often have fewer segments than errant

polychaetes and the body may be divided into different regions

(Hartmann-Schroder, 1971; Fauchald, 1977; Bartolomaeus et

al., 2005; Purschke et al., 2006; Suschenko and Purschke,

2009). With respect to the characters mentioned above

Clitellata show simple chaetae and lack parapodia as well as

250

G. Purschke, C. Bleidorn &T.Struck

any appendage on the prostomium, peristomium and pygidium

(fig. 1M). On the other hand, clitellates show an exclusive

combination of numerous characters such as the clitellum,

hermaphroditism, a specific type of spermatozoon, a dorsal

pharynx, a specific type of photoreceptor cell (= phaosome),

and a posteriorly dislocated brain, supporting their monophyly

(Purschke, 2002; Bartolomaeus et al., 2005).

Dales (1962, 1963) was among the first to question this

traditional concept (Dales, 1963, p. 64): “The polychaetes are,

indeed, most usually divided into two subclasses, the Errantia

and the Sedentaria. This division is not a natural one, however,

and does not reflect the way in which these worms, have

evolved ...” He proposed a classification based on analysing

the distribution of characters such as buccal organs and

nephridia. A similar approach has been adopted by Storch

(1968) using muscular systems as the most important

characters. Although neither classification gained general

acceptance, polychaete subtaxa usually were placed at equal

rank in the following years, retaining Polychaeta and Clitellata

as highest ranked taxa. Fauchald (1977), obviously inspired by

Clark’s (e.g. 1964) ideas of an earthworm-like annelid ancestor,

placed the oligochaete-like forms at the base of the polychaetes.

Although listed without any interrelationships specified,

Fauchald (1977, p. 7) stated: “the sequence of families

indicates an increasing morphological distance from the

ancestral polychaete” implying that the groups listed first were

presumably closer to the annelid stem species than the

following ones. In parallel, Archiannelida was recognised as

an artificial, presumably polyphyletic assemblage of interstitial

annelids primarily adapted to life in the mesopsammon (e. g.,

Hermans, 1969; Fauchald, 1974; Westheide, 1985, 1987).

Westheide (1997) questioned the sister group relationship

of Polychaeta and Clitellata and considered Polychaeta

paraphyletic and Clitellata being sister to an unknown

polychaete taxon. However, in the same year the first

hypothesis based on cladistic analyses was published (fig. 2A;

Rouse and Fauchald, 1997). This phylogenetic hypothesis was

widely accepted in a comparatively short period of time,

introduced to many textbooks and is still in use - of course

with some modifications (see e. g. Rouse and Pleijel, 2001,

2003). These first morphological-based cladistic analyses of

polychaetes showed Polychaeta and Clitellata as sister groups

contradicting the hypothesis of a paraphyletic Polychaeta

(Westheide, 1997). In the hypothesis of Rouse and Fauchald

(1997) Polychaeta were divided into Scolecida and Palpata.

Scolecida comprised the more or less oligochaete-like

appendage-less polychaetes, whereas Palpata contained all

palp-bearing polychaetes. Palpata were subdivided into

Aciculata and Canalipalpata. Irrespective of the fact that

Aciculata and Errantia comprise the same subtaxa, this

systematisation replaced the old concept dividing polychaetes

into Errantia and Sedentaria. Interestingly, as already

suggested by Bartolomaeus (1995, 1998) and by the hypothesis

of Rouse & Fauchald (1997), Pogonophora forms a polychaete

in-group (which was subsequently called Siboglinidae), but

Echiura and Sipuncula were still excluded from Annelida

based mainly on the lack of annelid key characters such as

segmentation and chaetae.

The main criticism on the hypothesis of Rouse & Fauchald

(1997) came from a contradicting hypothesis which regarded

Clitellata as highly derived annelids forming a polychaete

in-group and rendering the latter paraphyletic (Purschke,

1997, 1999, 2000, 2002, 2003; Westheide, 1997; Westheide et

al., 1999; Bartolomaeus et al., 2005). Although to date all

attempts have failed to unambiguously identify the sister

group of Clitellata, in this hypothesis the absence of typical

polychaete characters in Clitellata and Echiura is regarded as

losses rather than as primary absences (Purschke, 1997, 1999;

Purschke et al., 2000).

It is suggested that cladistic analyses using morphological

data may fail to recognise absent characters as losses rather

than as primary absences (Purschke et al., 2000; Bleidorn,

2007; see Fitzhugh, 2008). Thus, the sister-group relationship

Polychaeta-Clitellata as found in Rouse and Fauchald (1997)

may have been biased by the misinterpretation of a number of

convergently lost characters. Likewise the highly derived

nature of several characters of Clitellata related to their

adaptations to terrestrial life was not recognised. In contrast,

according to Rouse & Fauchald (1997) Clitellata should more

or less resemble the annelid stem species. For the same

reasons exclusion of Echiura and Sipuncula from Annelida

might represent an analytical artifact. Careful analyses of the

development of the latter taxa provided evidence for a reduced

rather than absent segmentation (Hessling, 2002; Hessling

and Westheide, 2002; Tzetlin and Purschke, 2006; Kristof et

al., 2008).

This morphology based cladistic hypothesis was never

supported by molecular phylogenetic analyses, but if included

Clitellata usually appeared as a polychaete in-group (e.g.,

McHugh, 1997; Bleidorn et al., 2003; Rousset et al., 2007;

Zrzavy et al., 2009; Struck et al., 2007, 2008, 2011; Weigert et

al., 2014). In addition, monophyly of the basal group Scolecida

was never recovered by molecular analyses. Whereas the first

molecular analyses suffered from low or lack of support for

deep nodes in the annelid tree, current analyses now relying

on phylogenomic datasets based on hundreds of genes show

high support for even deep nodes in the annelid tree (Struck et

al., 2011; Weigert et al., 2014; but see Kvist and Siddall, 2013).

These analyses recover a basal grade comprising several

enigmatic taxa such as Chaetopteridae, Oweniidae,

Magelonidae as well as Sipuncula and Amphinomidae

(Weigert et al., 2014). The vast majority of annelid taxa form

a monophyletic group named Pleistoannelida (Struck, 2011),

with Errantia and Sedentaria being the highest ranked sister

groups, the latter including Clitellata (fig. 2B). However,

it should be noted here that the taxon composition and

definition of both Errantia and Sedentaria is slightly different

from the traditional concepts (Struck et al., 2011; Struck,

2012; Weigert et al., 2014). Interestingly, a comparison of

trees obtained from phylogenomic analyses to those obtained

using morphological data show that the major difference is

the placement of the root of the annelid tree either within

the former Palpata or close to Clitellata, respectively

(Struck, 2012).

Evolution and Phylogeny of Annelida

251

- CLITELLATA

- Echiura

- Sipuncula

Figure 2. Phylogenetic hypotheses of annelid relationships. A. Cladistic analysis based on morphological data (modified from Rouse and Fauchald

1997). B. Phylogenetic tree based on phylogenomic data (modified after Struck et al. 2011; Weigert et al. 2014).

Clitellata

Alvinellidae

Pectinariidae

Arenicolidae

Opheliidae

Echiura

Capitellidae

Spionidae g

Sabellariidae ™

Sabellidae F

Serpulidae 5

Lftf

Sibogiinidae

Flabelligeridae

Acrocirridae

Cirratutldae

Orbiniidae

rtf

tfE

Tomopteridae

Glyceridae

Phyllodocidae

Nereididae

Nephtyidae

Polynoidae

Sigalionidae

Syllidae

Eunicidae £

Lumbrineridae g

Onuphtdae o

Sipuncula

Amphinomidae

Chaetopteridae

Magebnidae

Gweniiidae

Siboglinidae

Sabellariidae

Sabellidae

Serpulidae

Oweniidae

rtf

L-c

Acrocirridae

Flabelligeridae

Cirratulidae ■

Alvinellidae

Ampharetldae

Pectinariidae '

Terebellidae

Tricho bran chid ae

Apistobranchidae

Spionidae

Trochochaetidae §

Longosomatidae §

Poecilochaetidae

Chaetopteridae

Amphinomidae

Euphrosinidae

Dorvilleidae

Lumbrineridae

Eunicidae

Oiuge

Arenicolidae

Maidanidae

Capitellidae

Opheliidae

Scalibregmatidae

Orbiniidae

Paraonidae

Questidae

Cossuridae

Acoetidae

Aphroditidae

Eulepethidae

Polynoidae

Sigalionidae

Pholoidae

Chrysopetaiidae

Glyceridae 5

Goniadidae g

Paralacydoniidae g

Pisionidae Q

Lacydoniidae ?

Phyllodocidae

Nephtyidae

Nereididae

Hesionidae

Pilargidae

Sphaerodoridae

Syllidae

252

G. Purschke, C. Bleidorn &T.Struck

Morphological characters of Annelida

This conflict on the systematisation of Annelida may lead to

differences in the reconstruction of the annelid ground pattern.

Despite existence of certain outstanding studies on annelid

anatomy, earlier polychaete systematics was largely based on

external morphology (reviewed e.g. by Fauchald and Rouse,

1997) and even though some of these studies were extremely

comprehensive, additional morphological characters are

needed to develop well-founded homology hypotheses

(Fauchald and Rouse, 1997; Muller, 2006). Recently, fine

structural investigations (cLSM, TEM, SEM) as well as

developmental ones have provided such data and may provide

better evidence for homology considerations (e.g., Orrhage and

Miiller, 2005; Muller, 2006; Hunnekuhl et al., 2009; Suschenko

and Purschke, 2009; Wilkens and Purschke, 2009a, b;

Filippova et al., 2010; Doring et al., 2013; Lehmacher et al.,

2014; see also Fauchald, 1977; Fauchald and Rouse, 1997).

These studies have mainly focussed on the muscular system,

nervous system and sensory organs. Another source of data is

the determination of the so-called molecular fingerprint (gene

expression patterns) of cell types for homology assessments (e.

g. Arendt, 2008; Arendt et al., 2009; Doring et al., 2013).

Given the two main opposing morphology-based

phylogenetic hypotheses discussed above it is surprising that

the differences in the ground pattern of the annelid stem

species are smaller than might be expected. According to

Fauchald (1974) the ancestral annelid resembled a polychaete

and was characterised by complete septation, distinct

segments, chaetae and low parapodial folds, anterior end

without appendages and a burrowing lifestyle. The stem

species was a marine, gonochoristic, broadcast spawner with a

planktotrophic larva. This hypothesis was only slightly

changed after Rouse and Fauchald’s (1997) cladistic analysis:

according to this hypothesis the last common ancestor of

Annelida was homonomously segmented, the longitudinal

musculature not forming a continuous layer but consisted of

4-5 longitudinal bands, the gut as a straight tube with

dorsolateral folds in the foregut, chaetae all simple capillaries,

the prostomium distinctly set off but with no appendages,

nuchal organs, and internal supporting chaetae and parapodia

absent. The annelid stem species after Weigert et al. (2014)

was homonomously segmented, with longitudinal muscle

bands, the gut forming a straight tube with dorsolateral folds

in the foregut (microphagous deposit feeder), simple chaetae

emerging from parapodia, prostomium and peristomium

present with palps, and bicellular eyes present. Thus the main

differences are the structure of the prostomium, presence or

absence of anterior appendages, the presence of nuchal organs,

the nature of the eyes and structure of parapodia. Therefore,

these structures and others which have largely been neglected,

such as the cuticle and the nervous system, will now be

discussed in more detail. Other character complexes will only

be mentioned briefly as they have been discussed previously or

they will not be discussed as they lack any phylogenetic signal

with respect to this question (e.g., Purschke, 2002;

Bartolomaeus et al., 2005). These include the mesoderm, the

coelom and the nephridia (Rieger and Purschke, 2005;

Bartolomaeus and Quast, 2005), pharynx and intestine

(Tzetlin and Purschke 2005) as well as the biphasic life cycle

(Rieger, 1994; Rieger and Purschke, 2005; Nielsen, 2012).

Segmentation

The annelid body generally consists of a small presegmental

region, the prostomium, a segmented trunk, and a small

postsegmental region, the pygidium (fig. 3A-C; see Fauchald

and Rouse, 1997; Hutchings and Fauchald, 2000; Rouse and

Pleijel, 2001; Purschke, 2002; Bartolomaeus et al., 2005). The

prostomium contains the brain (cerebral ganglia) as well as the

most important sensory structures. The pygidium bears a

terminally or dorsally positioned anus. The mouth is situated

ventrally in the first segment, usually called the peristomium.

New segments are formed in the posterior growth zone in

front of the pygidium. Each segment generally comprises a

pair of ganglia in the ventral nerve cord, a pair of coelomic

cavities, a pair of metanephridia, and paired ventral and dorsal

groups of chaetae (see Purschke, 2002; Bartolomaeus et al,.

2005). The leeches show obvious signs of reduced but still

recognisable segmentation: for instance, the ventral nerve

cord clearly allows the number of segments comprising the

body to be determined (Purschke et al., 1993).

Most annelid groups regarded as lacking segmentation

such as Siboglinidae, Echiura, Sipuncula and Diurodrilus

generally show signs of suppression or reduction of

segmentation (fig. 1C, F). Among these Siboglinidae are the

most obviously segmented, when the often-missing posterior

part of the body was found (Webb, 1964; Southward, 1988;

Southward et al., 2005). Only subtle traces of segmentation

have been found in developmental stages of echiuroids and

sipunculans whereas in adults all signs of segmentation are

absent (Hessling and Westheide, 2002; Hessling, 2003;

Wanninger et al., 2005; Kristof et al., 2008). Species of

Diurodrilus, a group of small interstitial animals, do not exhibit

any signs of segmentation even in the nervous system (Worsaae

and Rouse, 2008): However, molecular phylogenetic data and

other morphological characters clearly support the inclusion of

this taxon within Annelida (see Golombek et al., 2013).

Whereas formerly segmentation in arthropods and

annelids has generally been assumed to be a synapomorphic

character, the early molecular phylogenetic analyses raised

doubts regarding a single evolutionary origin of segmentation

in these taxa (for summary see Dordel et al., 2010). Increasing

molecular developmental data demonstrates evidence for a

convergent origin of segmentation (see Shankland and Seaver,

2000; Seaver, 2003; De Rosa et al., 2005; Seaver et al., 2012).

However, others have proposed that the last common ancestor

of Bilateria was already segmented (de Robertis et al., 2008;

Couso, 2009; Chesebro et al., 2013).

Cuticle

Without exception a collagenous cuticle completely covers the

annelid epidermis (Storch, 1988; Gardiner, 1992; Hausen,

2005b). The cuticle is composed of an amorphous or filamentous

matrix that usually houses layers of parallel collagen fibres

which are oriented perpendicularly between the layers (fig. 4A-

E). Presumably the matrix is composed of different

Evolution and Phylogeny of Annelida

253

Figure 3. General organization of an annelid exemplified with Trypanosyllis coeliaca (Errantia, Syllidae). A. Entire animal. B. Enlargement of

head region; arrowhead: pigmented eyes; arrow: pharynx tooth. C. Posterior end with growth zone (arrow). - ac = anal cirrus, dc = dorsal cirrus,

dtc = dorsal tentacle cirrus, i = intestine, la = lateral antenna, ma = median antenna, pa = palp, pt = pharyngeal tube, pv = proventricle.

Micrographs of living specimen.

254

G. Purschke, C. Bleidorn &T.Struck

mucopolysaccharides and hyaluronic acid (Hausen, 2005b). The

uppermost part is usually devoid of collagen fibres and is called

an epicuticle. The cuticle is traversed by microvilli extending

above the surface and either forms isolated epicuticular

projections or multiple tips. This uppermost part is covered by a

glycocalix. A cuticle exhibiting these characteristics is found in

all major annelid clades including Sipuncula, although

considerable variation occurs (fig. 4A-E). The cuticle may vary

in thickness, number of microvilli, or development of collagen

fibres. Especially in larvae and adults of small or interstitial

species the collagen fibres appear to be less developed, sometimes

more irregularly arranged or even absent. In these cases the

cuticle more or less resembles the egg envelope from which it

originates (Eckelbarger, 1978). However, there are other

examples of polychaetes with less well-developed layers of

collagen fibres among polychaetes such as found in chaetopterids,

oweniids, magelonids, apistobranchids and psammodrilids (fig.

4 D, E; Kristensen and Nprrevang, 1982, Hausen, 2001, 2005b,

2007). Absence of collagen fibres in the cuticle is thus observed

in most groups belonging to the basal radiation according to

Weigert et al. (2014) indicating that the presence of grids of

collagen fibres probably is an autapomorphy of the clade

comprising Amphinomida , Sipuncula and Pleistoannelida.

Thus, the relevance of the cuticle as a phylogenetic important

character and as a possible autapomorphy of the entire group has

so far been underestimated (Purschke, 2002).

Chaetae and Parapodia

Chaetae are generally regarded as the most characteristic and

important taxonomic feature of Annelida. They constitute the

most thoroughly studied annelid structures (for references see

Rouse and Fauchald, 1995, 1997; Westheide, 1997; Rouse and

Pleijel, 2001; Hausen, 2005a). Chaetae have various functions

and may aid in locomotion on the substrate, anchoring the

body inside the tubes, protecting and defending the body,

supporting parapodia, etc. Accordingly they show an

extraordinary structural diversity and often exhibit species-

specific characters (Hausen, 2005a). On the basis of light

microscope investigations several types of chaetae are

distinguished (Rouse, 2000; Rouse and Pleijel, 2001). The

most common type represented by thin tapering cylinders is

the simple or capillary chaetae, which may be smooth or have

various additional substructures and ornamentations (fig. 5A,

F). Capillaries are often regarded as representing the

plesiomorphic type (Rouse and Fauchald, 1997; Rouse and

Pleijel, 2001; Struck et al., 2011).

Irrespective of their external diversity, the formation and

ultrastructure of chaetae appears very uniform: Each chaeta is

made up of many longitudinal tubules consisting of chitin

cross-linked by proteins situated in epidermal follicles.

Chaetae are formed by a single cell called a chaetoblast and its

dynamic microvilli are responsible for the variations in form

and diameter of tubules as well as the external structure of the

Figure 4. Cuticle ultrastructure of annelids. A-B. Eurythoe complanata (Amphinomidae). A. Cross section of cuticle on the trunk. Cuticle made

up of layers of parallel collagen fibres (cf) traversed by microvilli (mv), which branch apically above the epicuticle (ec, arrowhead), epicuticle (ec)

with dense bodies (db). B. Tangential section showing arrangement of collagen fibres and microvilli. C. Polygordius appendiculatus

(Polygordiidae). Microvilli extend far above epicuticle (ec). D. Sphaerodoropsis minuta (Sphaerodoridae). Cuticle with irregularly arranged

hardly visible collagen fibres (cf), covered by dark disk-like structures (arrowhead); cuticle traversed by cilium (ci) of receptor cell. E.

Ophiodromus pallidas (Hesionidae). Cuticle without collagen fibres, microvilli branch above cuticle (arrowhead). - be = basal cuticle, cf =

collagen fibre, ci = cilium, db = dense body, ec = epicuticle, mv = micovillus. TEM micrographs.

Evolution and Phylogeny of Annelida

255

Figure 5. Parapodia and chaetae. A. Eunice pennata (Eunicidae); parapodium comprised of dorsal cirrus (dc), neuropodium (nep), ventral cirrus

(vc) and branchia (br); acicula invisible. SEM micrograph. B. Scoloplos armiger (Orbiniidae). Cross section showing parapodium with supportive

chaetae and chaetal sac; arrowheads point to sectioned chaetae. TEM micrograph. C. Syllidia armata (Hesionidae); notopodium restricted to

dorsal cirrus and acicula (ac). D. Streptosyllis websteri (Syllidae). Aciculae (ac) extending outside parapodial lobe (arraowheads). E. Sphaerodopsis

minuta (Sphaerodoridae). Acicula with chaetoblast (chb); arrowheads point to junctional complexes. F. Fabricia stellaris (Sabellidae). Parapodium

of thorax with capillaries and uncini. G. Lanice conchilega (Terebellidae). Uncini. - ac = acicula, br = branchia, ch = chaeta, cm = circular

muscle, coe = coelom, dc = dorsal cirrus, dim = dorsal longitudinal muscle, ep = epidermis, dbv = dorsal blood vessel, fc = follicle cell, i =

intestine, mv = microvillus, nep = neuropodium, obm = oblique muscle, pm = protractor muscle, rm = retractror muscle, snv = subneural blood

vessel, vbv = ventral blood vessel, vc = ventral cirrus, vim = ventral longitudinal muscle, vnc = ventral nerve cord. C, D, F, G: micrographs from

living specimens, slightly squeezed.

256

G. Purschke, C. Bleidorn &T.Struck

chaetae (fig. 5B, E; Purschke, 2002; Hausen, 2005a). As a rule

these tubules show diminishing diameters from the centre to

the periphery. The chaetoblast forms the base of an epidermal

follicle lined by follicle and typical epidermal supportive cells;

the follicle cells lacking a cuticle (fig. 5E). Follicle cells and

the chaetoblast also function in mechanical coupling of the

chaeta due to prominent myoepithelial junctions, extensive

intermediate filaments and apical hemidesmosomes (fig. 5E;

Specht, 1988; Hausen, 2005a). Depending on the arrangement

and function chaetae may be individually moveable or form

functional groups situated in a common chaetal sac.

Among the various types of chaetae, a few have been used

to define higher-level in-group relationships including aciculae

(fig. 5B-D, E), uncini, hooks (fig. 5F, G) and paleae

(Bartolomaeus et al., 2005; Hausen, 2005a). The former are

supportive chaetae in parapodia, deeply anchored in the

tissues and normally not exposed to the exterior although in

certain taxa they can protrude slightly (fig. 5B-D; Fauchald

and Rouse, 1997; Rouse and Pleijel, 2001; Hausen, 2005a).

Aciculae are not formed in the same chaetal sacs as the other

chaetae in the same fascicle (fig. 5B). These chaetae function

as skeleton for the entire parapodial lobes. Aciculae have been

regarded as being homologous in Amphinomida, Eunicida and

Phyllodocida and represent the most important synapomorphic

character uniting these groups as Aciculata (Rouse and

Fauchald, 1997). However, supporting chaetae are also present

in other polychaete groups such as Chaetopteridae, Orbiniidae,

Apistobranchidae, Psammodrilidae and Myzostomida

(Hausen, 2005a). Nevertheless, there is a still ongoing debate

as to whether these supportive chaetae are homologous or

convergent structures (Fauchald and Rouse, 1997; Rouse and

Pleijel, 2001; Hausen, 2005a; Hoffmann and Hausen, 2007;

Struck, 2011; Struck et al., 2011; Eibye-Jacobsen and Vinther,

2012). As stated by, e.g. Rouse and Pleijel (2001, p.23):

“aciculae are formed exactly in the same manner as the

projecting chaetae”, this question can hardly be solved by

morphological studies alone.

Other types of chaetae, which have received much

attention, are the hooks and uncini. Such chaetae are usually

present in tube-building polychaetes (fig. 5F, G). Due to a high

degree of similarity in structure and in their process of

formation they have been regarded to be homologous across

polychaetes, potentially supporting a clade uniting those taxa

bearing this character (Bartolomaeus et al., 2005; Hausen,

2005a). An opposite view was taken by Rouse and Fauchald

(1997) who, based on their cladistic analyses, regarded uncini

as being evolved independently in several lineages. Recent

phylogenomic studies (Struck et al., 2011; Weigert et al., 2014)

have not helped resolving this question, since taxa such as

Oweniidae and Chaetopteridae, either possessing hooks or

uncini, are part of the basal annelid radiation. Struck et al.

(2011) indicated these chaetae as a possible apomorphy for

Sedentaria and thus they also hypothesised convergent

evolution of this type of chaetae. However, it has not been

ruled out, whether these highly specific chaetae were also

present in the annelid stem species and have been lost

repeatedly. Parsimony-based ancestral character state

reconstructions point to that direction.

Appendages of the prostomium - antennae and palps

Head appendages include antennae, palps, peristomial cirri

and in more cephalised polychaetes also cirri of anterior

segments (Rouse and Pleijel, 2001) (Figs 3A, B, 6A-E, 10G, I).

Among these, only antennae and palps appear phylogenetically

informative for the deep nodes since peristomial cirri are

restricted to a few taxa within Eunicida and Phyllodocida.

Antennae are prostomial sensory appendages usually

present in representatives of Amphinomida, Eunicida and

Phyllodocida (Rouse and Pleijel, 2001; Purschke, 2002). There

may be a pair of lateral antennae and an unpaired median

antenna resulting in between 0 and 3 appendages. Generally

they are more or less digitiform (Figs 6A, B, 7A, B) ranging

from smooth to articulated and are divided into a basal

ceratophore and a ceratostyle. Due to their corresponding

innervation pattern they have been regarded as homologous

throughout annelids (fig. 11F; Orrhage and Muller, 2005).

Antennae are innervated from the dorsal commissure of the

dorsal root of the circumoesophageal connectives. Each lateral

antenna receives one nerve whereas in the median antenna

there are two nerves separated by a muscle band attaching to

its base. Whether this also applies for the unpaired median

appendages (antennae or occipital tentacles) present in certain

Spionidae and Paraonidae is a matter of discussion (see

Orrhage, 1966; Fauchald and Rouse, 1997; Rouse and Pleijel,

2001; Orrhage and Muller, 2005). However, their innervation

pattern is the same as in the median antenna of the errant

forms and their homology would imply that they represent the

plesiomorphic condition and that repeated losses have

occurred in sedentary polychaetes. Again antennae may then

be an autapomorphy of a clade comprising Pleistoannelida,

Amphinomida and Sipuncula.

A pair of palps is present in many but not all annelids

(Rouse and Pleijel, 2001; Purschke, 2002) (Figs 6A-E, 10G, I).

In contrast to antennae, palps exhibit a considerably greater

structural diversity. Often two types of palps are distinguished:

prostomial (also called sensory or solid) and peristomial (also

termed grooved, feeding or hollow) palps (Fauchald and

Rouse, 1997; Rouse and Pleijel, 2001; Struck et al., 2011).

However, irrespective of these classifications, it must be kept

in mind that palps of any kind are sensory but only the

so-called sensory palps are solely sensory (Amieva and Reed,

1987; Purschke, 2002, 2005).

Moreover, the terms solid or hollow palps are somewhat

misleading, since all palps usually comprise mesodermal

tissues at least in the form of musculature and often coelomic

cavities as well (Orrhage, 1964, 1974; Gardiner, 1978; Amieva

and Reed, 1987; Purschke, 1993). This is also the case for the

palpophores of Nereis sp. which possesses sensory palps (fig.

6D, E). Irrespective of the presence of coelomic cavities, these

mesodermal tissues are separated by a distinct extracellular

matrix from the epidermis and nerves (Purschke, 1993).

Coelomic cavities forming hollow palps are for example

present in Protodrilidae and Saccocirridae (fig. 6C; see

Purschke, 1993, Purschke and Jouin-Toulmond, 1994), taxa

which have been assigned by Rouse and Fauchald (1997) to

belong to Canalipalpata and which lack feeding palps.

Evolution and Phylogeny of Annelida

257

Figure 6. Head appendages and innervation. A. Syllis sp. (Syllidae). Anterior end with palps (pa), median (ma) and lateral antennae (la), nuchal

organs (no), tentacular cirri on the right broken off. B. Parapionosyllis labronica (Syllidae). Dorsal view, nervous system labelled with antibody

against acetylated □-tubulin, appendages supplied with prominent nerves, depth coding. C. Saccocirrus sp. (Saccocirridae). Ventral view, note

ventral ciliated band (arrowheads), palps (pa) supplied with numerous ciliated sensory cells. D, E. Nereis sp. (Nereididae). Palp. D. Palp composed

of palpophore (pph) and palpostyle (ps) the latter with numerous sensory cilia. E. Longitudinal section showing musculature and coelomic cavity

inside palpophore (pph) and connection of palp nerve (pn) with the brain (b). - b = brain, dc = dorsal cirrus, din = dorsolateral nerve, dn = dorsal

nerve, ey = eye, la = lateral antenna, ma = median antenna, no = nuchal organ, pa = palp, pn = palp nerve, pph = palpophore, pr = prostomium,

ps = palpostyle, rm = retractor muscle, vc = ventral cirrus. A, C, D: SEM micrographs. Originals S. Raabe & W. Mangerich, Osnabriick; B: cLSM

micrograph, original M. Kuper, Osnabriick; E: Azan staining.

258

G. Purschke, C. Bleidorn &T.Struck

Figure 7. Pigmented eyes. A. Platynereis dumerilii (Nereididae). Two pairs of adult eyes (ey) situated on the prostomium. B. Microphthalmus

similis (Errantia, incertae sedis). Arrowheads point to small prostomial eyes. C. Nicolea zostericola (Terebellidae). Numerous small pigmented

eyes below tentacular crown (arrowheads). D. Nereis sp. (Nereididae). Section showing pigmented eye with lens (le); arrowhead points to zone

with rhabdomeres, arrow: marks layer of cell bodies of photoreceptor cells below pigment cell layer (psc). E. Piscicola geometra (Clitellata).

Pigmented eye with phaosomous photoreceptor cells (prc), arrowhead points to phaosomes. F. Saccocirrus papillocercus (Saccocirridae). Small

pigmented eye, structurally indistinguishable from larval eye; arrow indicates inverse orientation of photoreceptive structures, eye cup

communicates with exterior via small pore (arrowhead). G. Gyptis propinqua (Hesionidae). Multicellular-pigmented eye with lens, arrows

indicate converse orientation of photoreceptive processes. - br = branchia, cu = cuticle, ep = epidermis, ey = eye, la = lateral antenna, le = lens,

pa = palp, prc = photoreceptor cell, psc = pigmented supportive cell, smv = sensory microvilli, tc = tentacular cirri, te = tentacle. A-C: micrographs

from living animals; D, E: histological sections, Azan staining; F, G: TEM micrographs.

Evolution and Phylogeny of Annelida

259

However, this placement has not been supported by recent

molecular phylogenetic investigations and so their systematic

position remains unresolved (e. g. Struck et al., 2008; Zrzavy

et al., 2009; Golombek et al., 2013). Also Protodriloides (Fig

IE), which is regarded as closely related to these taxa,

possesses palps without coelomic cavities but with musculature

and blood vessels (Purschke, 1993). Moreover, in molecular

analyses by Struck et al. (2008) and Zrzavy et al. (2009)

Polygordiidae usually fall in the same clade comprising

Protodrilidae and Saccocirridae although Polygordiidae may

be one of only a few examples for polychaetes with true “solid”

palps since their stiff palps lack both musculature and

coelomic cavities (Wilkens and Purschke, 2009a). The same

applies to the appendages of Sphaerodoridae which are devoid

of musculature and are stiff as well (Filippova et al., 2010).

Previously it has been assumed that palps of all errant taxa

lack musculature, coelomic cavities and blood vessels

(Purschke, 2005). But analyses of Syllidae and Dorvilleidae as

well as of Nerillidae revealed the presence of well-developed

musculature in the palps of errant polychaetes (Filippova et

al., 2006, 2010; Muller and Worsaae, 2006). A highly

developed muscular system is also present in, e.g., the palps of

adults in Magelonidae (see Filippova et al., 2005), which are

placed in the basal part of the annelid tree in a recent

phylogenomic analysis (Weigert et al., 2014).

Irrespective of whether adult palps are prostomial or

peristomial, they are regarded as homologous due to their

corresponding innervation from the dorsal and ventral roots of

the circumoesophageal connectives (Fauchald and Rouse,

1997; Rouse and Pleijel, 2001; Orrhage and Muller, 2005).

There are up to 12 palp nerve roots, which can be homologised

due to their positions and relations to other nervous elements

(Figs 6E, 11F; Orrhage and Muller, 2005). However, no

annelid taxon studied to date exhibits all these roots and so far

a ground pattern has not been reconstructed. Usually there are

two main palp nerve roots (comparatively thick nerves

Figure 8. Macrochaeta clavicornis (Acrocirridae). 2 nd pair of pigmented eye, typical multicellular adult eye with converse oriented photoreceptive

processes (arrows), lens absent. Pigment cup formed by a layer pigmented supportive cells (psc) penetrated by processes of rhabdomeric

photoreceptor cells (prc), pupil formed by unpigmented supportive cells (use). Cu = cuticle, ep = epidermis, prc = photoreceptor cell, psc =

pigmented supportive cell, smv = sensory microvilli, use = unpigmented supportive cells. Original: I. Dykstra, Osnabruck.

260

G. Purschke, C. Bleidorn &T.Struck

comprising numerous neurites) which are situated on both

circumoesophageal roots (fig. 11F). Some roots appear to be

restricted to a smaller group of taxa such as roots Nos. 1, 2 and

3 which have only been found in Sabellariidae, Serpulidae and

Sabellidae. On the other hand, roots No. 6 on the ventral and

root No. 9 on the dorsal root of the circumoesophageal

connective have been reported in most taxa investigated and

may be promising candidates for having been present in the

Figure 9. Nuchal organs. A. Schematic representation of nuchal organ in Nerillidium troglochaetoides (Nerillidae). After TEM observations,

modified from Purschke (1997). B. Eusyllis (?) sp. (Syllidae). Nuchal organs (encircled) visible as ciliary patches in the posterior region of the

prostomium, micrograph from living animal. C. Saccocirrus sp. (Saccocirridae). Nuchal organs form oval patches (encircled). D. Myrianida

prolifera (Syllidae). Nuchal epaulettes form u-shaped ciliary band extending posteriorly on peristomium and 1 st chaetiger. - ey = eye, la = lateral

antenna, ma = median antenna, me = motile cilium, mv = microvillus, oc = olfactory chamber, pa = palp, pr = prostomium, rm = retractor muscle,

sd = sensory dendrite, so = soma of receptor cell, sue = supportive cell. C, D: SEM micrographs, W. Mangerich, S. Raabe, Osnabriick.

Evolution and Phylogeny of Annelida

261

Figure 10. Lateral organs. A-D. Malacoceros fuliginosus, (Spionidae). A. 2 parapodia with lateral organ (boxed) between noto- (no) and

neuropodium (ne). B. Enlargement of left parapodium, lateral organ visible as ciliary brush. C. Enlargement of B, note cilia arranged in distinct

rows. D. Base of 2 collar receptors with single sensory cilium (ci) and circle of microvilli (mv). E-F. Eunice pennata (Eunicidae). Lateral organ

(dorsal cirrus organ). E. 2 parapodia showing position of lateral organ (boxed). F. Enlargement of boxed area from E. G-J. Lateral organ like

ciliary bands of unknown function between noto- and neuropodia in polychaetes. G-H. Eurythoe complanata (Amphinomidae). G. Anterior end,

lateral view; arrows point to ciliary bands between noto- and neuropodia. H. enlargement of parapodium. I-J. Syllis sp. (Syllidae). I. Anterior end

lateral view, parapodia with ciliary bands (arrows). J. Enlargement of parapodia with ciliary bands (arrow). - br = branchia, no = notopodium, ne

= neuropodium, ci = cilium, mv = microvillus, dc = dorsal cirrus, vc = ventral cirrus, la = lateral antenna, pa = palp, ma = median antenna, tc =

tentacular cirrus. SEM Micrographs; originals E, F M: Nesnidal, Osnabriick, G-J S; Raabe, Osnabriick

262

G. Purschke, C. Bleidorn &T.Struck

annelid ground pattern (Wilkens and Purschke, 2009b). Taxa

regarded as belonging to the basal radiation (see Weigert et al.,

2014) do not show a unique pattern but at least nerve root No.

6 is usually present. In developing and regenerating spionids

the palps buds appear at the posterior edge of the prostomium

and their peristomial position is achieved later on (e.g. Blake

and Arnofsky, 1999; Lindsay et al., 2008). This feature may

suggest aprostomial origin in general. Also in Apistobranchidae

the palps are inserted in front of the nuchal organs and should

therefore be prostomial. However, a prostomial origin may not

be supported by observations in cirratulids (Petersen, 1999)

where the palps originate more posteriorly.

Most of the palp-less taxa have been placed in Scolecida

by Rouse and Fauchald (1997). They regard the absence of

palps as the plesiomorphic character state in their “Scolecida-

Palpata” hypothesis whereas in the “Errantia-Sedentaria”

hypothesis absence is interpreted as a loss which must have

happened more than once (Bartolomaeus et al., 2005, Struck,

2011; Struck et al., 2011; Weigert et al., 2014).

The entire prostomium is a highly sensory area innervated

by a complicated network of nerves originating from the brain

independent of the palp nerve roots (see Orrhage and Muller,

2005). Interestingly, such palp nerve roots have also been

reported from taxa which do not possess palps

(Scalibregmatidae, Paronidae and Orbiniidae; see Orrhage

and Muller, 2005; Wilkens and Purschke, 2009b). This has

been taken as an indication of reduction of palps in those taxa,

rather than their primary absence. While representatives of

several scolecidan taxa have not been investigated, preliminary

investigations in Opheliidae (Purschke, unpubl. obs.) indicate

occurrence of palp nerve roots in this family which contradicts

previous studies (Orrhage, 1966). In certain species of

Scalibregmatidae a secondary gain of palps from prostomial

horns has been hypothesised based on a cladistics analysis

(Martinez et al., 2013).

On the other hand, the tentacles present in the

terebellomorph polychaetes Alvinellidae, Ampharetidae,

Pectinariiidae, and Terebellidae have been regarded as

representing multiple grooved palps (Rouse and Pleijel, 2001),

even though from the structure of the anterior nervous system

there is no evidence for the existence of palps and antennae in

the latter three families (Orrhage, 2001). Instead it has been

concluded that the tentacles of these belong to the alimentary

canal and should be termed buccal tentacles (Orrhage, 2001).

Moreover, their central nervous system appears to be highly

derived and structurally simple (Orrhage, 2001; Heuer et al.,

2010). However, this has been questioned by Zhadan and

Tzetlin (2002). Likewise, a proof that the appendages in

Siboglinidae are really palps is still lacking although normally

assumed (see Rouse and Pleijel, 2001).

Eyes

Most annelids possess some kind of photoreceptor cells or

light sensitive organ (Rouse and Pleijel, 2001; Purschke, 2005;

Purschke et al., 2006). Due to their extreme structural diversity

they have been regarded as difficult to evaluate in phylogenetic

analyses (Fauchald and Rouse, 1997). There may be up to

three different types of photoreceptor cells (PRCs):

rhabdomeric PRCs, ciliary PRCs and phaosomous PRCs (Figs

7E-G, 8). The former two types, rPRCs and cPRC, occur with

supportive cells either with shading pigment (PSC) or without

pigment (USC). Only eyes (or ocelli) with PSC allow

discrimination of the direction of light source (for reviews see

Purschke, 2005; Purschke et al., 2006). These eyes may be

divided into different types: larval and adult eyes (characterised

by their molecular fingerprint and usually by their different

structure) as well as cerebral and so-called ectopic eyes

occurring elsewhere on the body (Purschke et al., 2006;

Arendt et al., 2009). Depending on the taxa considered there

may be 0, 1, 2 or 3 pairs of cerebral eyes (fig. 7A-C); and

certain species may possess more eyes and sometimes in odd

numbers (e. g. Terebellidae).

Larval type of eye. The so-called larval type of eye usually

consists of only two cells: a PSC and an rPRC forming an

inverse ocellus with the sensory processes projecting away

from the incoming light (fig. 7F; Purschke, 2005; Purschke et

al., 2006). In certain cases these eyes are still part of the

epidermal epithelium and connected to the outside via a small

pore (e. g. Saccocirrus spp. fig. 7F; see Arendt et al., 2009).

Such ocelli are generally present in trochophores and may be

formed and functional within 24 h after fertilisation

(Dorresteijn, 2005). Such simple eyes are perfectly adapted

sensory structures for positive or negative phototaxis (Jekely

et al., 2008). Such eyes may occur in adults of certain species

as well and, based on structural data, it is impossible to

determine if they represent persisting larval eyes or diminutive

adult eyes. With few exceptions of specialised eye types such

larval type eyes have been regarded as being restricted to

adults of sedentarian taxa (Purschke et al., 2006; Purschke

and Nowak, 2013). The fate of the larval eyes in ontogeny is

not completely known as it is, hard to follow especially in

large species. Moreover, whereas formerly a replacement by

the adult eyes has generally been assumed to occur besides

rare cases of persistence (Purschke et al., 2006; Purschke and

Nowak, 2013), recent investigations indicate probable

persistence even in species for which a replacement by the

adult eyes has been assumed (Backfisch et al., 2013). A unique

example of larval eyes being transformed into adult eyes

occurs in Capitella teleta (Yamaguchi and Seaver, 2013). So in

this species the adult eyes are a mixture of both larval and

adult eye structures and further studies are needed to determine

how often this phenomenon occurs in other species.

Adult type of eye. Typical adult eyes in annelids are

multicellular comprising rPRCs with shading pigment, PSCs

and USCs. These cells form a continuous epithelium in which

rPRCs and PSCs intermingle resulting in a converse (everse)

eye with the sensory processes projecting towards the light

(Figs 7D, F, G, 8; Purschke et al., 2006; Suschenko and

Purschke, 2009). As these eyes develop from epidermal

anlagen, they may still be connected with the exterior by a

more or less prominent duct (Purschke and Nowak, 2013).

Adult eyes of this kind are known to occur in Phyllodocida,

Eunicida and Amphinomida, whereas lenses, which are

typically formed by the PSCs, have only been found among

Phyllodocida (Purschke et al., 2006; Suschenko and Purschke,

2009). Very likely, two pairs of adult eyes belong to the ground

Evolution and Phylogeny of Annelida

263

pattern of Phyllodocida, Eunicida and Amphinomida. Given

the phylogenetic hypothesis of Weigert et al. (2014) this means

this is a plesiomorphic feature that has been lost secondarily in

Sedentaria. On each side the eyes develop from a common

anlage and split into two eyes each after initial formation

(Dorresteijn, 2005; Backfisch et al., 2013). However, in these

taxa several representatives exist which usually possess rather

small eyes of unknown affiliation to either larval or adult eyes.

This is especially the case for the so-called eyespots which are

present in many representatives of Syllidae, but also occurs in

several other members of these groups. So far only a few

species have been investigated. Several examples of

miniaturisation of adult eyes are reported in errant polychaetes

(Purschke and Nowak 2013; Purschke unpubl. obs.).

In sedentarian polychaetes miniaturised adult eyes are

present as well, for example in Fauveliopsis cf. adriatica and

with respect to their proposed phylogenetic position more

importantly in the orbiniid Scoloplos armiger (Wilkens and

Purschke, 2009b; Purschke, 2011). The pigmented eyes of

Sipunculida are also structurally similar to the adult eyes of

polychaetes (Purschke, 2011), which are especially important in

the “new annelid phylogeny” where Sipuncula are part of the

annelid radiation (Dordel at al., 2010; Weigert et al., 2014).

Among Sedentaria, Flabelligeridae and Accrocirridae are

known to possess rather large eyes and should be examined to

determine if they represent typical adult annelid eyes. Whereas

Flabelligeridae have been described to possess an unusual

platyhelminth type of pigmented eye of inverse design (see

Purschke et al., 2006), preliminary observations in Macrochaeta

clavicornis (Sars, 1835) (Accrocirridae), which possess three

pairs of eyes, an anterior minute pair and two larger pairs

situated more posteriorly, showed that the minute eye probably

is a reduced adult eye. The second pair is an adult eye without

doubt (fig. 8) and the most posterior pair is of the platyhelminth

type. This implies that the inverse eye most likely represents a

new acquisition in a taxon at least comprising these two families

within Cirratuliformia. However, these studies have to be

extended to more species of Cirratuliformia to test this

hypothesis. Further investigations must show whether the small

eyes present in other sedentarian annelids also represent

miniaturised adult eyes. For Capitella teleta Blake et al., 2009 it

may be that the eye is unique as it is a mixture of the larval and

adult eye (Yamaguchi and Seaver, 2013). Also the findings in

the leech Helobdella robusta (Shankland et al., 1991), fit into

this general picture (Doring et al., 2013). It could be shown that

the PRCs probably have been derived from those of the adult

annelid eye, whereas the eyes as such evolved de novo in the

stem lineage of leeches (e.g. fig. 7E).

In summary, gene expression studies support that the

larval eye in annelids is homologous to the pigmented eyes of

other bilaterians (e. g. under control of pax6\ Arendt et al.,

2002; Dorresteijn, 2005; Backfisch et al., 2013; Doring et al.,

2013). At some point in the annelid lineage adult eyes must

have evolved, no later than in the last common ancestor of

Amphinomidae, Sipuncula and Pleistoannelida. Whether they

might already belong to an earlier emerging lineage has yet to

be determined and needs to be investigated in Oweniidae,

Magelonidae, Apistobranchidae and Chaetopteridae which are

regarded as belonging to the first, basal radiation in annelids

(Struck, 2011; Weigert et al,. 2014). However, histological

investigations of Chaetopterus variopedatus indicate that

adult eyes are present (Martin and Anctil, 1984). Probably

there are parallel events of miniaturisations and progressive

reductions or losses of adult (and larval) eyes, one of which is

characteristic for the lineage comprising most sedentary

groups including Clitellata (Doring et al., 2013). Besides the

pigmented eyes there are other photoreceptive structures,

which may have a similar phylogenetic importance but further

investigations are necessary (see Hausen, 2007; Wilkens and

Purschke, 2009a).

Nuchal organs

Nuchal organs are situated at the posterior edge of the

prostomium and are visible as densely ciliated structures,

which can be withdrawn in many forms (fig. 9A-D) (Purschke,

1997, 2002, 2005). Especially in many burrowing, tube¬

building sessile or terrestrial forms they may be completely

internalised. Despite their external diversity (fig. 9B-D) they

show an overall structural similarity and are composed of a

few identical cell types throughout (fig. 9A). Thus, their

homology is generally accepted (Rouse and Fauchald, 1997;

Rouse and Pleijel, 2001; Purschke, 2005).

Whereas their absences in polychaetes usually were

regarded as losses, the absence of nuchal organs in Clitellata

was mostly seen as primary resulting in recognition of nuchal

organs as the most important autapomorphy for the taxon

Polychaeta (Rouse and Fauchald, 1997). On the other hand,

there is evidence that there is a high probability that Clitellata

have also lost nuchal organs (e. g. Purschke, 1997, 1999, 2000,

2002). Interestingly, all molecular phylogenetic studies

conducted so far revealed Clitellata in a highly derived position

among the polychaetes supporting the latter view (Weigert et

al., 2014). By contrast, some taxa such as Oweniidae need to

be re-examined to determine if nuchal organs are present as

vestiges, or if they are really absent. Thorough investigations

by Hausen (2001) confirmed the absence of nuchal organs in

two species of Magelona and presence in Apistobranchidae.

At present it remains unresolved whether these structures were

present in the last common ancestor of Annelida or have

evolved later within the annelids.

Lateral organs

Ciliated bands, papillae or pits which occur between noto- and

neuropodia in many sedentary polychaetes represent sensory

organs consisting of two types of uniciliated receptor cells and

supportive cells (Purschke and Hausen, 2007). These organs

are commonly termed lateral organs (fig. 10A-D). Besides

sedentary polychaetes, such organs have been shown to be

present in Eunicida as well, here called dorsal cirrus organ due

to the lack of a typical notopodium in these taxa (fig. 10E, F;

Hayashi and Yamane, 1997; Purschke, 2002). However, in

Eunicida only one receptor cell type is present (Hayashi and

Yamane, 1997; Purschke, unpubl. obs.). Similar ciliary bands

have also been observed in representatives of Amphinomidae

and Syllidae, but histological investigations are still needed

(fig. 10G-J).

264

G. Purschke, C. Bleidorn &T.Struck

For a robust phylogenetic assessment of the evolution of

lateral organs data of some important taxa is missing and

especially their occurrence in representatives of the basal annelid

radiation should be (reinvestigated. According to the literature

lateral organs are present in Magelonidae and Apistobranchidae

but absent in Chaetopteridae and Oweniidae (Fauchald and

Rouse, 1997). However, their fine structure is unknown. Given a

questionable presence in amphinomids the resulting picture

currently is puzzling allowing several equally parsimonious

explanations, either as ground pattern character or as convergently

evolved structures occurring in several lineages.

Central nervous system

The central nervous system in Annelida is generally described

as a rope-ladder nervous system consisting of a prostomial

brain connected with the ventral nerve cord via double

circumoesophageal connectives (Bullock and Horridge, 1965;

Orrhage and Muller, 2005; Muller, 2006; Lehmacher et al.,

2014). The ventral nerve cord was generally seen as rope-

ladder-like chain of paired segmental ganglia connected by

connectives and commissures. However, as already stated by

Bullock and Horridge (1965) a considerable degree of variation

in polychaetes exists making it difficult to deduce phylogenetic

hypotheses (fig. 11A-H).

Muller (2006) considered a nervous system with the

following characters as the ground pattern in annelids: (1)

paired circumoesophageal connectives consisting of dorsal

and ventral roots interconnected via two intracerebral

commissures each; (2) a ventral nerve cord comprising

primarily five connectives; (3) numerous commissures per

segment; (4) numerous segmental nerves per segment and (5)

peripheral nervous system with several longitudinal pairs of

nerves and one median unpaired nerve. The highest numbers

reported so far are 17 longitudinal nerves in Saccocirrus

papillocercus (see Orrhage and Muller, 2005) and up to 18

segmental nerves in Polygordius appendiculatus (see

Lehmacher et al., 2014). Thus the entire nervous system has an

orthogonal appearance and a typical rope-ladder-like nervous

system is a rare exception or does not exist at all (fig. 11A-E).

From this pattern all nervous system structures observed may

have derived. For instance, the most common polychaete

nervous system shows partly fused circumoesophageal

connectives, whereas in clitellates they are completely fused

forming simple connectives throughout (fig. 11C, D).

Interestingly, during ontogenesis and regeneration experiments

this fusion can be observed and each annelid nervous system

starts with double circumoesophageal roots (e.g. Hessling and

Westheide, 1999; Muller, 2004, 2006; Muller and Henning,

2004). The same applies for the structure of the ventral cord.

The question of whether the nervous system has a

basiepithelial or subepidermal position in the ground pattern is

still a matter for discussion. However, as already discussed

(Bullock and Horridge, 1965; Martin and Anctil, 1984;

Purschke, 2002; Orrhage and Muller, 2005) a basiepidermal

position is more common than formerly thought. Interestingly,

species with a subepidermal position of the nervous system in

adults may have a basiepidermal position in juveniles (e.g.,

Scoloplos armiger; Purschke, unpubl. obs.). In this case

ontogeny may reflect the direction of evolution for this

character. In many species the ventral nerve cord usually lies

between the ventral longitudinal muscle bands bulging into

the body cavity but is still part of the epidermis as documented

by a continuous ECM with the epidermis (Figs 5B, 11E). As a

consequence circular muscle fibres are generally interrupted

in this area (Lehmacher et al., 2014). Alternatively, the nerve

cord may be subepithelial for a short distance allowing the

circular fibres to pass below it.

Whether the nerve cord was actually a medullary cord (fig.

11B) and not subdivided into connectives and ganglia (fig.

11C, D) in the ground pattern is another point of discussion.

However, this seems to be a comparatively rare case in

Annelida occurring in highly derived annelids such as

oligochaetous Clitellata and a few polychaetes such as

Polygordius spp. (see Lehmacher et al., 2014). Although

ganglia and connectives are reported to occur in Chaetopterus

variopedatus (see Martin and Anctil, 1984), annelid species

regarded to be part of the basal radiation should be

reinvestigated for this character.

Within the polychaete brain several ganglia (neuropils

encased by associated neuronal somata) may be distinguished

(fig. 11F-G; Orrhage and Muller, 2005). There are more than

25 pairs in errant forms whereas especially in many sedentary

species there are no distinguishable ganglia at all (Heuer et al.,

2010). Thus, with a few exceptions the former authors

discouraged any efforts of homologising ganglia in annelids.

However, recently, the so-called mushroom bodies, which

were first identified by Holmgren (1916) in polychaetes, came

back into the phylogenetic discussion (fig. 11G, H; Heuer et al.,

2010). Heuer et al. (2010) regarded mushroom bodies as an

ancient structure already present in the annelid stem species

and their absence in many annelids as reductions. Since typical

mushroom bodies have only been shown to exist in Nereididae

and Aphroditiformia and to a lesser degree in a few other

errant taxa, as an alternative it has been proposed that

mushroom bodies evolved within Errantia or even in one or

some of their subtaxa as well as independently in arthropods

(Struck, 2012; Struck et al., 2014). This view is held because so

far these structures are unknown in any taxon regarded to be

basal in the annelid radiation irrespective of which of the

conflicting hypotheses is considered (fig. 2A, B).

Musculature

A body wall musculature consisting of an outer layer of

circular and an inner layer of longitudinal fibres was generally

considered to represent the annelid ground pattern (Dales,

1963; Pilato, 1981; Purschke and Muller, 2006). These muscles

may be accompanied by other muscle systems such as oblique,

diagonal, bracing and dorso-ventral fibres as well as muscles

belonging to the parapodia. The existence of these different

muscles indicates that the entire muscular system in annelids

is highly diverse and complex. In the meantime, it is generally

accepted that the longitudinal fibres do not form a complete

cylinder rather they are arranged in discrete bands with four

bands representing the ground pattern (fig. 5B; Rouse and

Fauchald, 1995,1997; Tzetlin and Filippova, 2005, Lehmacher

et al., 2014). Usually the musculature is ventrally interrupted

Figure 11. Nervous system and brain. A. Nervous system of the trunk with longitudinal and segmental circular nerves exemplified by Parapodrilus

psammophilus (Dorvilleidae). Ventral cord consists of unpaired median (mn) and main paired nerves (mvn). B-D. Anti a-tubulin immunoreactivity;

dotted lines indicate segment borders. B. Polygordius appendiculatus (Polygordiidae), ventral nerve cord (green) comprising three closely apposed

neurite bundles, serotonergic perikarya (red) in a repetitive pattern although distinct ganglia are absent (medullary cord). Note high number of

segmental nerves. C-D. Brania clavata (Syllidae); depth coding images. C. Brain (b) and ventral nerve cord in ventral view, ventral cord consists of

several closely apposed nerves forming 3 bundles behind 1 st ganglion (gl), 4 segmental nerves (arrowheads, ppn) in each segment; brain gives rise to

several stomatogastric nerves (sn). D. Ventral cord in the trunk region. F. General diagram of the cephalic nervous system in polychaetes, numerals

refer to palp nerve roots, somata stippled. E-H. Nereis sp. (Nereididae). E Ventral nerve cord in basiepithelial position (arrowheads refer to epidermal

extracellular matrix). F. Parasagittal section with mushroom bodies (mb), note subepithelial position of brain; arrowheads point to cerebral ganglia.

H Enlargement of anterior part of mushroom body with stalks of globuli cells (gc). - br = brain, cc = circumoesophageal connective, dcdr = dorsal

commissure of dree, dcvr = dorsal commissure of vrcc, dlln = dorsolateral longitudinal nerve, dree = dorsal root of cc, ecm = extracellular matrix, ep

= epidermis, gl = 1 st ganglion, gc = globuli cell, in = intestine, lln = lateral longitudinal nerve, mb = mushroom body, mn = median nerve of ventral

cord, mvn = main nerve of ventral cord, nla = nerve of lateral antenna, nma = nerve of median antenna, no = nuchal organ, np = neuropil, obm =

oblique muscle, pn = palp nerve, ppn = parapodial nerve, sn = stomatogastric nerve, so = somata of neurites, sog = suboesophageal ganglion, vbv =

ventral blood vessel, vcdr = ventral commissure of dree, vcvr = ventral commissure of vrcc, vim = ventral longitudinal muscle, vrcc = ventral root of

cc. A, F: modified from Muller and Orrhage (2005). Micrographs; B C: Lehmacher, C, D: M. Kuper, Osnabriick.

266

G. Purschke, C. Bleidorn &T.Struck

and separated by the ventral nerve cord and this may also

apply to the circular fibres. These latter fibres are always less

developed than the longitudinal ones and are likely to be

absent in a number of taxa. Whether these absences are

plesiomorphic or apomorphic is still being discussed and

requires more data from a variety of polychaete taxa (see

Tzetlin and Filippova, 2005; Purschke and Muller, 2006).

Since these fibres are sometimes very delicate, investigations

with modern methods such as cLSM are highly desirable (see

Lehmacher et al., 2014). Recently, the oblique fibres running

from the lateral sides to the ventral midline received closer

attention and apparently their importance has been

underestimated probably because the situation as present in

earthworms had been regarded as representing the annelid

ground pattern (see Purschke and Muller, 2006 for discussion).

Conclusions

In conclusion the question as to which characters belong to the

last common ancestor of annelids has not been resolved although

there has been considerable progress in recent years. Probably,

the last common ancestor of annelids had a biphasic life cycle

with a planktonic acoelomate larva and a benthic coelomate

adult (including blood vascular system and metanephridia), a

collagenous cuticle without being arranged in layers of parallel

fibres, an epidermis with at least a few ciliated cells (responsible

for generating water currents or movements of the animals), a

homonomous segmentation, longitudinal muscle bands, ill-

defined or lacking circular muscle fibres, oblique muscles

running to the ventral midline, a nervous system comprising a

prostomial brain and a ventral nerve cord comprising five

connectives linked to the brain via double circumoesophageal

connectives and additional longitudinal nerves that give the

entire nervous system an orthogonal appearance, a foregut with

dorsolateral ciliated folds (microphagous deposit feeder), a gut

forming a straight tube, simple chaetae and parapodia and a

head consisting of a prostomium and a peristomium with

feeding palps, larval bicellular eyes and adult multicellular eyes.

Such adult eyes are not restricted to the errant forms and

among the putative basal branching groups multicellular adult

eyes are present at least in Chaetopteridae, Sipuncula and

Amphinomida. A duplication event of the adult eyes possibly

occurred in the stem lineage of Amphinomida and

Pleistoannelida. There is a high degree of probability of

parallel events of miniaturisations and progressive reductions

or even losses of adult (and larval) eyes, one of which is

characteristic for the lineage comprising most sedentary

groups including Clitellata. The latter possess unique

photoreceptor cells (phaosomes) derived from typical annelid

rhabdomeric photoreceptor cells and occasionally secondarily

developed pigmented eyes (fig. 7E; Doring et al., 2013).

Whether nuchal organs belong to the annelid ground pattern

(Rouse and Fauchald, 1995,1997) currently remains unresolved

since their absence in Oweniidae, Chaetopteridae, Magelonidae

and Sipuncula has yet to be confirmed. A similar scenario is

conceivable for the lateral organs as well as for other characters

such as the basiepithelial position of the ventral nerve cord and

whether it is divided into ganglia and connectives or represents

a medullary cord. In view of the new molecular phylogeny

(Struck et al., 2011; Weigert et al., 2014) several members of the

basal branching groups should be re-investigated to elucidate

the characters of the annelid stem species.

Acknowledgements

The first author (GP) thanks the organisers and especially Dr.

Pat Hutchings, Sydney, for an invitation to the XI th International

Polychaete Conference, held in Sydney August 4 th -9 th 2013,

and The Ian Potter Foundation for travelling funds. The

research was in part supported by the German Research

Association (DFG) (e.g., Pu 84/3-1, Pu 84/6-2 to GP, BL 787/5-

1 to CB, STR 683/7-1, STR 683/8-1 to THS), and this is

gratefully acknowledged. Thanks are due to our numerous

co-workers and colleagues who during the past years have

contributed to our research in many ways.

References

Amieva, M. R. and Reed, C.G. 1987. Functional morphology of the

larval tentacles of Phragmotopoma californica (Polychaeta:

Sabellariidae): composite larval and adult organs of

multifunctional significance. Marine Biology 95: 243-258.

Arendt, D. 2008. The evolution of cell types in animals: emerging

principles from molecular studies. Nature Reviews Genetics 9:

868-882.

Arendt, D., Tessmar, K., Campos-Baptista, M. I. M., Dorresteijn, A.,

and Wittbrodt, J. 2002. Development of pigment-cup eyes in the

polychaete Platynereis dumerilii and evolutionary conservation

of larval eyes in Bilateria. Development 129: 1143-1154.

Arendt, D., Hausen, H., and Purschke, G. 2009. The “division of

labor“ model of eye evolution. Philosophical Transactions of the

Royal Society B 364: 2809-2817.

Audouin, J. V., and Milne Edwards, H. 1834. Recherches pour servir

a Thistoire naturelle du littoral de la France, ou recueil de

memoires sur I’anatomie, la physiologie, la classification et les

moeurs des animaux de nos cotes; ouvrage accompagne de

planches faites d’apres nature. Crochard, Paris.

Backfisch, B., Rajan, V. B. V., Fischer, R. M., Lohs, C., Arboleda, E.,

Tessmar-Raible, K., and Raible, F. 2013. Stable transgenesis in the

marine annelid Platynereis dumerilii sheds new light on

photoreceptor evolution. Proceedings of the Na tional Academy of

Sciences of the USA 110:193-198.

Bartolomaeus, T., and Quast, B. 2005. Structure and development of

nephridia in Annelida and related taxa. Hydrobiologia 535/536:

139-165.

Bartolomaeus, T., Purschke, G., and Hausen, H. 2005. Polychaete

phylogeny based on morphological data - a comparison of current

attempts. Hydrobiologia 535/536: 341-356.

Blake, J. A., and Arnofsky, P. L. 1999. Reproduction and development

of the spioniform Polychaeta with application to systematics and

phylogeny. Hydrobiologia 402: 57-106.

Bleidorn, C. 2007. The role of character loss in phylogenetic

reconstruction as exemplified for the Annelida. Journal of

Zoological Systematics and Evolutionary Research 45: 299-307.

Bleidorn, C., Vogt, L., and Bartolomaeus, T. 2003. New insights into

polychaete phylogeny (Annelida) inferred from 18S rDNA

sequences. Molecular Phylogenetics and Evolution 29: 279-288.

Bullock, T. H., and Horridge, G. A. 1965. Structure and function in

the nervous system of invertebrates. Freeman & Co., New York.

Clark, R. B. 1964. Dynamics in metazoan evolution. The origin of the

coelom and segments. Clarendon, Oxford.

Evolution and Phylogeny of Annelida

267

Chesebro, J., Pueyo, J., and Couso, J., 2013. Interplay between a Wnt-

dependent organiser and the Notch segmentation clock regulates

posterior development in Periplaneta americana. Biology Open

2: 1-ll.doi: 10.1242/bio.20123699.

Couso, J., 2009. Segmentation, metamerism and the Cambrian explosion.

International Journal of Developmental Biology 53: 1305 - 1316.

Dales, R. R 1962. The polychaete stomodeum and the interrelationships

of the families of Polychaeta. Proceedings of the Zoological

Society of London 139: 389-428.

Dales, R. P. 1963. Annelids. Hutchinson University, London. 200pp.

De Robertis, E.M., 2008. The molecular ancestry of segmentation

mechanisms. Proceedings of the National Academy of Sciences of

the U. S. 105: 16411-16412.

De Rosa, R., Prud’homme, B., and Balavoine, G. 2005. Caudal and

even-skipped in the annelid Platynereis dumerilii and the ancestry

of posterior growth. Evolution and Development 7: 574-587.

Dordel, J., Fisse, F., Purschke, G., and Struck, T. H. 2010. Phylogenetic

position of Sipuncula derived from multi-gene and phylogenomic

data and its implication for the evolution of segmentation. Journal

of Zoological Systematics and Evolutionary Research 48: 197-207.

Doring, C., Gosda, J., Tessmar-Raible, K., Hausen, H., Arendt, D., and

Purschke, G. 2013. Evolution of clitellate phaosomes from

rhabdomeric photoreceptor cells of polychaetes - a study in the

leech Helobdella robusta (Annelida, Sedentaria, Clitellata).

Frontiers in Zoology 10; 52: 1-14.

Dorresteijn, A. 2005. Cell lineage and gene expression in the

development of polychaetes. Hydrobiologia 535/536: 1-22.

Eckelbarger, K. J. 1978. Morphogenesis and settlement in the

Sabellariidae. Pp. 145-164, In: Chia, F.S. and Rice, M. E. (eds.).

Settlement and metamorphosis of marine invertebrate larvae.

Elsevier, New York.

Eibye-Jacobsen, D., and Nielsen, C. 1996. Point of view. The

rearticulation of annelids. Zoologica Scripta 25: 275-282.

Eibye-Jacobsen, D., and Vinther, J. 2012. Reconstructing the ancestral

annelid. Journal of Zoological Systematics and Evolutionary

Research 50: 85-87.

Fauchald, K. 1974. Polychaete phylogeny: a problem in protostome

evolution. Systematic Zoology 23: 493-506.

Fauchald, K. 1977. The polychaete worms. Definitions and keys to the

orders, families and genera. Natural History Museum of Los

Angeles County. Sciences Series, Los Angeles.

Fauchald, K., and Rouse G. 1997. Polychaete systematics: past and

present. Zoologica Scripta 26: 71-138.

Filippova, A., Purschke, G., Tzetlin, A. B., and Muller, M. C. M. 2005.

Reconstruction of the musculature of Magelona cf. mirabilis

(Magelonidae) and Prionospio cirrifera (Spionidae) (Polychaeta,

Annelida) by phalloidin labelling and cLSM. Zoomorphology

124: 1-8.

Filippova, A., Purschke, G., Tzetlin, A. B., and Muller, M. C. M. 2006.

Three-dimensional reconstruction of the F-actin musculature of

Dorvillea kastjani (Dorvilleidae: Polychaeta) by means of

phalloidin-labelling and cLSM. Scientia Marina 70S3: 293-300.

Filippova, A., Purschke, G., Tzetlin, A. B., and Muller, M. C. M. 2010.

Musculature in polychaetes: comparison of Myrianida prolifera

(Syllidae) and Sphaerodoropsis sp. (Sphaerodoridae). Invertebrate

Biology 129: 184-198.

Fitzhugh, K. 2008. Clarifying the role of character loss in phylogenetic

interference. Zoologica Scripta 37: 561-569.

Gardiner, S. L. 1978. Fine structure and function of the ciliated

epidermis on the tentacles of Owenia fusiformis (Polychaeta,

Oweniidae). Zoomorphologie 91: 37-48.

Gardiner, S. L. 1992. Polychaeta: General organization. Pp. 19-52. In:

Harrison, F. W. and Gardiner, S. L. (eds) Microscopic Anatomy of

Invertebrates, Vol. 7 Annelida. Wiley-Liss, New York.

Golombek, A., Tobergte, S., Nesnidal, M. P., Purschke, G., and Struck,

T. H. 2013. Mitochondrial genomes to the rescue - Diurodrilidae

in the myzostomid trap. Molecular Phylogenetics and Evolution

69: 312-326.

Grube, A. E. 1850. Die Familien der Anneliden. Archiv fiir

Naturgeschichte 16: 249-364.

Halanych, K., Dahlgren, T., and McHugh, D. 2002. Unsegmented

annelids? Possible origin of four lophotrochozoan worm taxa.

Integrative and Comparative Biology 42: 678-684.

Hannibal, R. L., and Patel, N. H. 2013. What is a segment? EvoDevo

4:35: 1-10.

Hartmann-Schroder, G. 1971. Annelida, Borstenwiirmer, Polychaeta.

pp. 1-594, In: Dahl, M. and Peus, F. (eds). Die Tierwelt

Deutschlands, Vol. 58. Gustav Fischer, Jena.

Hatschek, B. 1878. Studien liber die Entwicklungsgeschichte der

Anneliden. Ein Beitrag zur Morphologie der Bilateralien. Arbeiten

des Zoologischen Instituts zur Universitat Wien 1: 277-404.

Hatschek, B. 1893. System der Anneliden. Ein vorlaufiger Bericht.

Lotos 13: 123-126.

Hausen, H. 2001. Untersuchungen zur Phylogenie „spiomorpher“

Polychaeten (Annelida). Logos, Berlin, 142 pp.

Hausen, H. 2005a. Chaetae and chaetogenesis in polychaetes

(Annelida). Hydrobiologia 535/536: 37-52.

Hausen, H. 2005b. Comparative structure of the epidermis in

polychaetes (Annelida). Hydrobiologia 535/536: 25-35.

Hausen, H. 2007. Ultrastructure of presumptive light sensitive ciliary

organs in larvae of Poecilochaetidae, Trochochaetidae, Spionidae,

Magelonidae and its phylogenetic significance. Zoomorphology

126:185-201.

Hermans, C. O. 1969. The systematic position of the Archiannelida.

Systematic Zoology 18: 85-102.

Hessling, R., and Westheide, W. 1999. CLSM analysis of development

and structure of the central nervous system of Enchytraeus crypticus

(“Oligochaeta”, Enchtraeidae). Zoomorphology 119: 37-47.

Hessling, R., and Westheide, W. 2002. Are Echiura derived from a

segmented ancestor? Immunohistochemical analysis of the

nervous system in developmental stages of Bone Ilia viridis.

Journal of Morphology 252: 100-113.

Hessling, R. 2003. Novel aspects of the nervous system of Bonellia

viridis (Echiura) revealed by the combination of

immunohistochemistry, confocal laser scanning microscopy and

three-dimensional reconstruction. Hydrobiologia 496: 225-239.

Heuer, C. M., Muller, C. H. G., Todt, C., and Loesel, R. 2010.

Comparative neuroanatomy suggests repeated reduction of

neuroarchitectural complexity in Annelida. Frontiers in Zoology

7:13: 1-21.

Hoffmann, S., and Hausen, H. 2007. Chaetal arrangement in

Orbiniidae (Annelida, Polychaeta) and its significance for

systematics. Zoomorphology 126: 215-227.

Hughes, M., Gerber, S., and Wills, A. 2013. Clades reach their highest

morphological disparity early in their evolution. Proceedings of

the National Academy of Sciences of the USA 110: 13875-13879.

Hunnekuhl, V. S., Bergter, A., Purschke, G., and Paululat, A. 2009.

Development and embryonic pattern of body wall musculature in

the crassiclitellate Eisenia andrei (Annelida, Clitellata). Journal

of Morphology 270: 1122-1136.

Hutchings, P. A., and Fauchald, K. 2000. Definition and general

description. Pp 1-3, In: Beesley, P. L., Ross, G. J. B. and Glasby, C.

J. (eds), Polychaetes and Allies: The Southern Synthesis. Fauna of

Australia. Vol. 4A Polychaeta, Myzostomida, Pogonophora,

Echiura, Sipuncula. CSIRO Publishing, Melbourne.

Jamieson, B. G. M. 1992. Oligochaeta. Pp. 217-322. In: Harrison,

F.W., and Gardiner S. L. (eds). Microscopic anatomy of

Invertebrates. Vol. 7 Annelida. Wiley-Liss, New York.

268

G. Purschke, C. Bleidorn &T.Struck

Jekely, G., Colombelli, J., Hausen, H., Guy, K., Stelzer, E., Nedelec, F.,

and Arendt, D. 2008. Mechanism of phototaxis in marine

zooplankton. Nature 456: 395-399.

Kristensen, R. M., and Nprrevang, A. 1982. Description of

Psammodrilus aedificator sp. n. (Polychaeta), with notes on the

Arctic interstitial fauna of Disko Island, W. Greenland. Zoologica

Scripta 11: 265-279.

Kristof, A., Wollensen, T., and Wanninger, A. 2008. Segmental mode

of neuronal patterning in Sipuncula. Current Biology 18: 129-1132.

Kvist, S„ Siddall, M. E. 2013. Phylogenomics of Annelida revisited: a

cladistic approach using genome-wide expressed sequence tag

data mining and examining the effects of missing data. Cladistics

29: 435.

Lamarck, J.-B., de 1802. Les nouvelles classes des animaux sans

vertebres. Verdierre, Paris.

Lehmacher, C.,Fiege,D., and Purschke, G. 2014. Immunohistochemical

and ultrastructural analysis of the muscular and nervous systems

in the interstitial polychaete Polygordius appendiculatus

(Annelida). Zoomorphology 133: 21-41.

Lindsay, S. M., Jackson, J. L., and Forest, D. L. 2008. Morphology and

regeneration in two spionid polychaete species: implications for

feeding efficiency. Invertebrate Biology 127: 65-79.

Martin, N., and Anctil, M. 1984. The nervous system of the tube-

worm Chaetopterus variopedatus (Polychaeta). Journal of

Morphology 181: 161-173.

Martinez, A., Di Domenico, M., and Worsaae, K. 2013. Gain of palps

within alineage of ancestrally burrowing annelids (Scalibregmatidae).

Acta Zoologica (Stockholm). (in press) DOI: 10.111/azo. 12039.

McHugh, D. 1997. Molecular evidence that echiurans and

pogonophorans are derived annelids. Proceedings of the National

Academy of Sciences of the USA 94: 8006-8009.

Muller, M. C. M. 2004. Nerve development, growth and differentiation

during regeneration in Enchytraeus fragmentosuis and Stylaria

lacustris (Oligochaeta). Development, Growth and Differentiation

46: 471-478.

Muller, M. C. M. 2006. Polychaete nervous systems: Ground pattern

and variations - cLS microscopy and the importance of novel

characteristics in phylogenetic analysis. Integrative and

Comparative Biology 46: 125-133.

Muller, M. C. M., and Henning, L. 2004.Neurorgenesis during

regeneration in Dorvillea bermudensis (Dorvilleidae): formation

of the polychaete ground pattern. Journal of Comparative

Neurology 471: 49-58.

Muller, M. C. M., and Worsaae, K. 2006. CLSM analysis of the

phalloidin-stained muscle system in Nerilla antennata,

Nerillidium sp. and Trochnerilla mobilis (Polychaeta; Nerillidae).

Journal of Morphology 267: 885-896.

Nielsen, C. 2012. Animal evolution. Interrelationships of the living

phyla. 3. Edition. Oxford University, New York. 402pp.

Orrhage, L. 1964. Anatomische und morphologische Studien liber die

polychaetenfamilien Spionidae, Disomidae und Poecilochaetidae.

Zoologiska Bidrag fran Uppsala 36: 335-405.

Orrhage, L. 1966. Uber die Anatomie des zentralen Nervensystems

der sedentaren Polychaeten. Ein Beitrag zur Diskussion fiber die

Architektur des Polychaeten-Gehirns und Uber den Begriff Palpen

bei den Borstenwfirmern. Arkiv for Zoologi 19: 99-133.

Orrhage, L. 1974. Uber die Anatomie, Histologie und Verwandtschaft

der Apistobranchidae (Polychaeta, Sedentaria) nebst

Bemerkungen fiber die systematische Stellung der Archianneliden.

Zeitschrift fiir Morphologie der Tiere 79: 1-45.

Orrhage, L. 2001.On the anatomy of the central nervous system and

the morphological value of the anterior end appendages of

Ampharetidae, Pectinariidae and Terebellidae (Polychaeta). Acta

Zoologica (Stockholm) 82: 57-71.

Orrhage, L., and Mfiller, M. C. M. 2005. Morphology of the nervous

system of Polychaeta (Annelida). Hydrobiologia 535/536: 79-111.

Paxton, H. 2000. “Eunicidans”. Pp 89-91, In: Beesley, P. L., Ross, G.

J. B., and Glasby, C. J. (eds), Polychaetes and Allies: The Southern

Synthesis. Fauna of Australia. Vol. 4A Polychaeta, Myzostomida,

Pogonophora, Echiura, Sipuncula. CSIRO Publishing,

Melbourne.

Petersen, M. E. 1999. Reproduction and development in Cirratulidae

(Annelida: Polychaeta). Hydrobiologia 402: 107-128.

Pilato, U. 1981. The significance of musculature in the origin of the

Annelida. Bollettino di Zoologica 48: 209-228.

Purschke, G. 1993. Structure of the prostomial appendages and the

central nervous system in the Protodrilida (Polychaeta).

Zoomorphology 113: 1-20.

Purschke, G. 1997. Ultrastructure of nuchal organs in polychaetes

(Annelida) - new results and review. Acta Zoologica (Stockholm)

78: 123-143.

Purschke, G. 1999. Terrestrial polychaetes - models for the evolution

of the Clitellata (Annelida)? Hydrobiologia 406: 87-99.

Purschke, G. 2000. Sense organs and the central nervous system in an

enigmatic terrestrial polychaete, Hrabeiella periglandulata

(Annelida). Invertebrate Biology 119: 329-341.

Purschke, G. 2002. On the ground pattern of the Annelida. Organisms,

Diversity and Evolution 2: 181-196.

Purschke, G. 2003. Is Harbeiella periglandulata the sister group of

Clitellata? Evidence from an ultrastructural analysis of the dorsal

pharynx in H. periglandulata and Enchytraeus minutus

(Annelida, Clitellata). Zoomorphology 122: 55-66.

Purschke, G., and Jouin-Toulmond, C. 1994. Ultrastructure and sense

organs and the central nervous system in Parenterodrilus

taenioides and their phylogenetic significance in the taxon

Protodrilida. Memoires du Museum national d’Histoire naturelle

162: 119-128.

Purschke, G., and Hausen, H. 2007. Lateral organs in sedentary

polychaetes (Annelida) - Ultrastructure and phylogenetic

significance of an insufficiently known sense organ. Acta

Zoologica (Stockholm) 88: 23-39.

Purschke, G., and Mfiller, M. C. M. 2006. Evolution of body wall

musculature. Integrative and Comparative Biology 46: 497-507.

Purschke, G., and Nowak, K. 2013. Ultrastructure of pigmented eyes

in Dorvilleidae (Annelida, Errantia, Eunicida) and their

importance for understanding the evolution of eyes in polychaetes.

Acta Zoologica (Stockholm) (in press). DOI: 10.1111/azo.l2052.

Purschke, G., Westheide, W., Rohde, D., and Brinkhurst, R. O. 1993.

Morphological reinvestigation and phylogenetic relationship of

Acanthobdella peledina (Annelida, Clitellata). Zoomorphology

113:91-101.

Purschke, G., Hessling, H., and Westheide, W. 2000. The phylogenetic

position of the Clitellata and the Echiura - on the problematic

assessment of absent characters. Journal of Zoological

Systematics and Evolutionary Research 38: 165-173.

Purschke, G., Arendt, D., Hausen, H., and Mfiller, M. C. M. 2006.

Photoreceptor cells and eyes in Annelida. Arthropod Structure

and Development 35: 211-230.

Ramey, P. A., Fiege, D., and Purschke, G. 2013. Polygordiida:

Polygordiidae Czerniavsky, 1881. Pp. 1-10, In: Westheide, W. and

Purschke, G. (eds) Handbook of Zoology , De Gruyter, Berlin

(published online ahead of print as Zoology Online: http://www.

degruyter.com/view/Zoology/bp_029147-6_7).

Rieger, R. M. 1994. The biphasic life cycle - a central theme of

metazoan evolution. The American Zoologist 34: 484-491.

Rieger, R. M., and Purschke, G. 2005. The coelom and the origin of

the annelid body plan. Hydrobiologia 535/536: 127-137.

Evolution and Phylogeny of Annelida

269

Rouse, G. W. 2000. Morphology and physiology. Pp 9-32, In: Beesley,

P.L., Ross, G. J. B., and Glasby, C. J. (eds) Polychaetes & Allies.

The Southern Synthesis. Fauna of Australia. Vol. 4a Polychaeta,

Myzostomida, Pogonophora, Echiura, Sipuncula. CSIRO

Publishing, Melbourne.

Rouse G. W., and Fauchald, K. 1995. The articulation of annelids.

Zoologica Scripta 24: 269-301.

Rouse G. W., and Fauchald, K. 1997. Cladistics and polychaetes.

Zoologica Scripta 26: 139-204.

Rouse G.W., and Fauchald, K. 1998. Recent reviews on the status,

delineation and classification of the Annelida. The American

Zoologist 38: 953-964.

Rouse, G. W., and Pleijel, F. 2001. Polychaetes. Oxford University

Press, Oxford, New York. 354 pp.

Rouse, G. W., and Pleijel, F. 2003. Problems in polychaete systematics.

Hydrobiologia 496: 175-189.

Rousset, V., Pleijel, F., Rouse, G. W., Erseus, C., and Siddall, M. E.

2007. A molecular phylogeny of annelids. Cladistics 23: 41-63.

Seaver,E. C. 2003. Segmentation: Mono- or polyphyletic? International

Journal of Developmental Biology 47: 583-595.

Seaver, E. C., Yamaguchi, E., Richards, G. S., and Meyer, N. P. 2010.

Expression of the pair-rule gene homologs runt, Pax3/7, even-

skipped-1 and even-shipped-2 during larval and juvenile

development of the polychaete annelid Capitella teleta does not

support a role in segmentation. EvoDevo 3:8: 1-18.

Shankland, M., and Seaver, E. C. 2000. Evolution of the bilaterian

body plan: What have we learned from annelids? Proceedings of

the National Academy of Sciences of the USA 97: 4434-4437.

Southward, E. C. 1988. Development of the gut and segmentation of

newly settled stages of Ridgeia (Vestimentifera): implications for

relationship between Vestimentifera and Pogonophora. Journal of

the Marine Biological Association of the United Kingdom 68: 465-

487.

Southward, E. C., Schulze, A., and Gardiner, S. L. 2005. Pogonophora

(Annelida): Form and function. Hydrobiologia 535/536: 227-251.

Specht, A. 1988. Chaetae. Pp. 45-59. In: Westheide, W., and Hermans,

C. O. (eds) The Ultrastructure of Polychaeta. Mikrofauna

MarinaVol. 4, Fischer, Stuttgart.

Storch, V. 1988. Integument. Pp. 13-36. In: Westheide, W., and

Hermans, C. O. (eds) The Ultrastructure of Polychaeta. Mikrofauna

MarinaVol. 4, Fischer, Stuttgart.

Struck, T. H. 2011. Direction of evolution within Annelida and the

definition of Pleistoannelida. Journal of Zoological Systematics

and Evolutionary Research 49: 340-345.

Struck, T. 2012. Phylogeny of Annelida. In: Westheide W., and

Purschke, G. (eds.) Handbook of Zoology. Annelida. De Gruyter,

Berlin. Published ahead of print in Zoology online, 1-23.

Struck, T. H., Schult, N., Kusen, T., Hickman, E., Bleidorn, C.,

McHugh, D., and Halanych, K. M. 2007. Annelida phylogeny and

the status of Sipuncula and Echiura. BMC Evolutionary Biology 7,

57: 1-11.

Struck, T. H., Nesnidal, M. R, Purschke, G., and Halanych, K. M.

2008. Detecting possible saturated positions in 18S and 28S

sequences and their influence on phylogenetic reconstruction of

Annelida (Lophotrochozoa). Molecular Phylogenetics and

Evolution 48: 628-645.

Struck, T. H„ Paul, C., Hill, N., Hartmann, S., Hoesel, C., Kube, M„

Lieb, B., Meyer, A., Tiedemann, R., Purschke, G., and Bleidorn, C.

2011. Phylogenomic analyses unravel annelid evolution. Nature

471: 95-98.

Struck, T. H., Wey-Fabrizius, A.R., Golombek, A., Hering, L., Weigert,

A., Bleidorn, C., Klebow, S., Iakovenko, N., Hausdorf, B.,

Petersen, M., Kiick, P., Herlyn, H., and Hankeln, T. 2014. Platyzoan

paraphyly based on phylogenomic data supports a non-coelomate

ancestry of Spiralia. Molecular Biology and Evolution (in press),

DOI: 10.1093/molbev/msul43.

Suschenko, D., and Purschke, G. 2009. Ultrastructure of pigmented

adult eyes in errant polychaetes (Annelida): Implications for

annelid evolution. Zoomorphology 128: 75-96.

Tzetlin, A. B., and Filippova, A. 2005. Muscular system in polychaetes

(Annelida). Hydrobiologia 535/536: 113-126.

Tzetlin, A., and Purschke, G. 2005. Pharynx and intestine.

Hydrobiologia 535/536: 199-225.

Tzetlin, A. B., and Purschke, G. 2006. Fine structure of the pharyngeal

apparatus of the pelagosphera larva in Phascolosoma agassizii

(Sipuncula and its phylogenetic significance. Zoomorphology

125:109-117.

Wanninger, A., Koop, D., Bromham, L. Noonan, E., and Degnan, B.

M. 2005. Nervous and muscle system development in Phascolion

strombus (Sipuncula). Development Genes and Evolution 215:

509-518.

Webb, M. 1964. The posterior extremity of Siboglinum fiordicum

(Pogonophora). Sarsia 15: 33-36.

Weigert, A., Helm, C., Meyer, M., Nickel, B., Arendt, D., Hausdorf, B.,

Santose, S. R. Halanych, K. M., Purschke, G., Bleidorn, C., and

Struck, T. H. 2014. Illuminating the base of the annelid tree using

transcriptomics. Molecular Phylogenetics and Evolution (in

press), D01:10.1093/molbev/msu080.

Westheide, W. 1985. The systematic position of the Dinophilidae and

the archiannelid problem. Pp. 310-326. In: Morris, S. C., George,

J. D., Gibson, R., and Platt H. M. (eds) The origins and

relationships of lower invertebrates. The Systematic Association,

Oxford.

Westheide, W. 1987. Progenesis as a principle in meiofauna evolution.

Journal of Natural History 21: 843-854.

Westheide, W. 1997. The direction of evolution within the Polychaeta.

Journal of Natural History 31: 1.15.

Westheide, W., McHugh, D., Purschke, G., and Rouse, G. 1999.

Systematization of the Annelida: different approaches.

Hydrobiologia 402: 291-307.

Wilkens, V., and Purschke, G. 2009a. Central nervous system and

sense organs, with special reference to photoreceptor-like sensory

elements, in Polygordius appendiculatus (Annelida), an

interstitial annelid with uncertain phylogenetic affinities.

Invertebrate Biology 128: 46-64.

Wilkens, V., and Purschke, G. 2009b. Pigmented eyes, photoreceptor¬

like sense organs and central nervous system in the polychaete

Scoloplos armiger (Orbiniidae, Annelida) and their phylogenetic

importance. Journal of Morphology 270: 1296-1310.

Worsaae, K., and Rouse, G. W. 2008. Is Diurodrilus an annelid?

Journal of Morphology 269: 1426-1455.

Yamaguchi, E., and Seaver, E. C. 2013. The importance of larval eyes

in the polychaete Capitella teleta: effects of larval eye deletion on

formation of the adult eye. Invertebrate Biology 132: 352-367.

Zhadan, A., and Tzetlin, A. B. 2002. Comparative morphology of the

feeding apparatus in the Terebellida (Annelida: Polychaeta).

Cahiers de Biologie Marine 43: 149-164.

Zrzavy, J., Riha, P, Pialek, L., and Janouskovec, J. 2009. Phylogeny of

Annelida (Lophotrochozoa): total evidence analysis of

morphology and six genes. BMC Evolutionary Biology 9, 189:

1-14.

Memoirs of Museum Victoria 71:271-278 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Molecular phylogenetics of the Neanthes acuminata (Annelida: Nereididae) species

complex

Donald J. Reish 1 *, Frank E. Anderson 2 , Kevin M. Horn 2 and JOrg Hardege 3

1 Department of Biological Sciences, California State University, Long Beach, California, USA

2 Department of Zoology, Southern Illinois University, Carbondale, Illinois, USA

3 School of Biological, Biomedical and Environmental Sciences, University of Hull, Hull, UK Hardege@hull.ac.uk

To whom correspondence and reprint requests should be addressed. [DJReish@aol.com]

Abstract Reish, D.J., Anderson, F.E., Horn, K.M. and Hardege, J. 2014. Molecular phylogenetics of the Neanthes acuminata

(Annelida: Nereididae) species complex . Memoirs of Museum Victoria 71: 271-278.

The Neanthes acuminata (Nereididae) species complex is a broadly distributed group of marine benthic

polychaetous annelids that is known by many names around the world and comprises at least four species. They are the

only nereidids known that show exclusively male parental care. The female dies after laying her eggs in a common mucoid

tube where they are fertilized, and the male incubates the eggs until the young leave the tube. All of the species in the N.

acuminata complex are identical in their morphological characteristics and they all possess a similar number of segments

and paragnath distribution and similarly shaped parapodia. However, populations from the U.S. East Coast, southern

California, Hawaii and Portugal differ in chromosome number. Eye and egg colour also vary among populations—some

worms in southern California have red eyes and produce bright yellow/orange eggs, while others have black eyes and

produce pale yellow eggs. These variations suggest that N. acuminata may represent multiple evolutionarily significant

units. Clarification of the phylogenetic relationships among lineages in this species complex will provide a framework for

studying character evolution and revising taxonomy within this intriguing group of nereidids. To that end, we sequenced

regions of one nuclear and two mitochondrial genes from worms sampled from multiple sites in North America (southern

California, Mexico and Connecticut), the central Pacific (Hawaii) and Europe (Germany, Portugal and the UK). Maximum

likelihood and Bayesian analyses of these data clarify relationships in this complex and show that worms sampled from

California and Mexico represent two geographically intermingled subclades. These two subclades are congruent with eye

and egg colour data; one subclade consists of red-eyed worms, the other consists of black-eyed worms. Furthermore, we

found evidence that individuals representing these subclades can occasionally be found at the same locality.

Keywords Neanthes caudata, Neanthes arenaceodentata, polychaete, phylogenetic relationships, morphs, COI, 16S, ITS1.

Introduction

The polychaete Neanthes acuminata (Ehlers, 1868) (Annelida:

Nereididae) species complex is cosmopolitan in distribution

and comprises at least four species (Weinberg et al., 1990).

Neanthes acuminata is the only valid scientific name for this

group. It is known by this name from New England to North

Carolina (Day, 1973). The southern California population was

initially referred to the European species N. caudata (delle

Chiaje, 1841) (Reish, 1957), which was later considered a

synonym of N. arenaceodentata Moore, 1903 by Pettibone

(1963). This name was applied to the California population by

Reish and Alosi (1968), but Day (1973) considered both N.

caudata and N. arenaceodentata synonyms of N. acuminata.

Neanthes cricognatha (Ehlers, 1904), also considered part of

the complex, is known from India and Hong Kong (Fauvel,

1950) and Australia and New Zealand. References to the

literature concerning the populations used in this study are

presented in Table 1. For convenience in this paper, N.

acuminata refers to samples from New England; N. caudata to

samples from Portugal, and N. arenaceodentata to samples

from southern California, Mexico and Hawaii. All members

of this species complex, except N. cricognatha, have been

cultured through several generations in the laboratory at

California State University, Long Beach (CSULB) by coauthor

Reish (DJR). All are morphologically identical, with small

conical paragnaths covering both rings of the proboscis and

neuropodial heterogomph compound chaetae with a long

blade terminating with a hook. Reproduction is unique in that

the female reproduces once, but the male, which takes care of

the embryos through the 21 st segmented stage, is capable of

reproducing as many as nine times (Reish et al., 2009). The

272

D.J. Reish, F.E. Anderson, K.M. Horn & J. Hardege

Table 1. Selected references to literature concerning the populations

used in this study

Neanthes arenaceodentata:

Los Angeles Harbour Reish, 1956 [as N. caudata\, Crippen

and Reish, 1967, Reish, 1972

Venice, California: Winchell, et al. 2010.

Alamitos Bay: Reish, 1964 [as N. caudata ], 1972

San Gabriel River, Reish, 1972, Oshida, et al. 1976.

Newport Bay: Reish, 1972

Punta Banda, Mexico: Dfaz-Castaneda and Rodreguez-

Villanueva, 1998

Hawaii: Bailey-Brock, et al., 2002.

Neanthes acuminata

Connecticut: Day, 1973, Weinberg, et. al., 1990

Neanthes caudata

Portugal: Fauvel, 1923, Bellan, 1967

members of the species complex differ from each other on the

basis of chromosome number: Neanthes acuminata (2N = 22),

N. arenaceodentata (2N = 18), Hawaiian N. arenaceodentata

(2N = 28) (Weinberg et al., 1990), N. caudata (2N = 18) (Reish,

unpublished) and behaviour (Sutton et al., 2005). Worms

prefer to mate with worms collected from the same population.

Males and females from southern California and New England,

as expected, were aggressive to each other and failed to mate

(Sutton et al., 2005). The chromosome number is unknown for

N. cricognatha, which is not a part of the present study.

Materials and Methods

Taxon sampling

Neanthes acuminata was collected from the Connecticut

intertidal zone by J. D. Hardege in 2004 and transported to

CSULB where it was cultured for more than 10 generations

before the culture was terminated. Collections from southern

California were collected by DJR with exception of those from

Venice Lagoon which had previously been cultured by

Christopher J. Winchell at the University of California, Los

Angeles. Collections from Estero Punta Banda and Bahia de

San Quintin, Baja California were preserved in 70% ethanol

by Maricarmen Necoechea and shipped to DJR. The Hawaiian

specimens were collected by Bruno Pernet and shipped live to

CSULB. Culturing these worms was unsuccessful and living

specimens were preserved in 70% ethanol prior to death.

Living specimens, except as noted above, were shipped by

overnight express to the University of Hull and Southern

Illinois University. Additional data on location, date of

collection, culture history and locality are given in Table 2.

Specimens from laboratory populations have been deposited

in the Los Angeles County Museum of Natural History under

the following catalog numbers: LACM-AHF 6194 (Reish lab),

6195 (L.A. Harbour), 6196 (Venice Canals), 6197 (Alamitos

Bay), 6198 (San Gabriel River), 6199 (Newport Bay), 6200

(Hawaii) and 6201 (Faro, Portugal).

Culture methods were the same for all populations.

Cultures were established by pairing a female, as determined

by the presence of large eggs in her coelom, with a sexually

unknown worm. A behavioral response was used to determine

a male. Same sexes fight and opposite sexes lie alongside one

another (Reish and Alosi, 1968). Males cannot be determined

by the presence of sperm as in epitokal nereidids. Pairs were

placed in a petri dish containing normal sea water and fed

rehydrated dried Enteromorpha sp. and constructed a common

mucoid tube. The female lays her eggs within the tube where

they are fertilized. The female dies after egg laying or is eaten

by the male. The male incubates the developing embryos by

his body undulations, which refresh the water within the tube.

After three to four weeks, the young worms (V21 segments)

emerge from the parent’s tube and commence feeding (Reish,

1957). There is no pelagic larval stage. Established populations

were maintained in aerated 15-gallon (57 liters) aquaria

containing 10 gallons (38 liters) of seawater. Approximately

100 juvenile worms were used to establish a population in an

aquarium. Worms were fed weekly with commercial rabbit

food that was soaked in seawater prior to use, stirred and the

supernatant fluid added to the aquarium. Aquaria were drained

and cleaned monthly. Worms reproduced within the aquaria

and specimens were removed as needed.

DNA Extraction, PCR, and Sequencing

DNA was extracted from tissue samples using a DNeasy kit

(Qiagen) according to manufacturer’s instructions. Regions of

two mitochondrial markers - cytochrome oxidase subunit I (COI

or coxl ) and the 16 S ribosomal subunit (rrnL) - and one nuclear

marker - internal transcribed spacer 1 (ITS1) - were amplified

via PCR using HotStar Master Mix (Qiagen) (half reactions)

using primer pairs (COI—Folmer et al., 1994; 16S—Geller et al.,

1997; ITS1: ITS III and ITS VIII; Palumbi, 1996). PCR thermal

cycling parameters were as follows: 95°C (15 minutes) for

enzyme activation, followed by 35 cycles of 95°C (45 seconds),

40°C (45 seconds) and 68°C (1 minute) and a final terminal

extension cycle of 68°C for 7 minutes. PCR products were

purified using a MinElute Gel Purification Kit (Qiagen) and both

strands were sequenced on an ABI 3730x1 automated sequencer.

Molecular Data Set Construction

COI, 16S and ITS1 sequences were downloaded from the

GenBank nucleotide database (http://www.ncbi.nlm.nih.gov/

nuccore) for members of three other species; these were used

as outgroups for our analyses. Two of these species were (like

Neanthes ) members of Nereididae— Namalycastis jaya

Magesh, Kvist and Glasby (2012) (GenBank accession

numbers: HQ456363 [COI] and HM138706 [16S]) and

Platynereis dumerilii (Audouin and Milne-Edwards, 1834)

(GenBank accession numbers [complete mitochondrial

genome]: AF178678) A non-nereidid phyllodocid ( Nephtys sp.

‘San Juan Island’ YV-2008, GenBank accession number

[complete mitochondrial genome]: EU293739) was used as a

distant outgroup to root the tree. These taxa were chosen

because both COI and 16S data were available from the same

Molecular phylogenetics of the Neanthes acuminata (Annelida: Nereididae) species complex

273

Table 2. Collection, culture and analysis location data on Neanthes acuminata complex

Collection locality

Collection date

Eye/ova color

# lab generations

Lab

Connecticut 1

2002

Black/pale

~20

Hull

Venice, California

2008

Black/pale

~10

Hull, SIU

Los Angeles Harbour 2

1964

Red/orange

200+

Hull, SIU

Los Angeles Harbour 13

2008

Red/orange

~12

Hull. SIU

Alamitos Bay

2011

Black/pale

Hull, SIU

San Gabriel River

2008

Black/pale

~12

Hull, SIU

Newport Bay

2004

Red/orange

~20

Hull, SIU

Bahia de San Quintin and Estero

2010

Unknown

Not cultured

Hull, SIU

Punta Banda, Baja California

2010

Unknown

Not cultured

Oahu, Hawaii

2011

Black/pale

Not cultured

SIU

Portugal

2009

Black/pale

Hull, SIU

Humber Estuary, UK 4

Hull

Bremerhaven Estuary, Germany 4

Hull

l No longer in culture

Collected from the inner harbour (Reish lab)

Collected from the outer harbour

4 Nereis diversicolor

voucher specimen for all three species (ITS1 data from the

outgroups were not included in our analyses; ITS1 sequences

from species outside the Neanthes acuminata complex could

not be aligned with ingroup ITS1 sequences).

Sequence Alignment and Phylogenetic Analyses

Sequence contigs were assembled and edited using Sequencher

5.1 (GeneCodes, Ann Arbor, Michigan), aligned with

MUSCLE v3.8.31 (Edgar, 2004) and concatenated in Mesquite

(Maddison and Maddison, 2010). ITS1 sequences from the

outgroups ( Namalycastis and Platynereis) were highly

divergent from Neanthes acuminata ITS1 sequences, leading

to spurious preliminary alignments. As a result, we excluded

outgroup ITS1 data from the data matrices prior to alignment.

Preliminary analyses suggested that the individual loci

supported topologically concordant phylogenies, so data from

the three individual loci were concatenated into two data

matrices—a “full” data set (comprising all specimens for

which at least one locus—COI, 16S or ITS1—was sequenced),

and an “all three genes” data set (comprising all specimens for

which COI, 16S and ITS1 sequences were generated). Four

data partitioning schemes were evaluated for these data sets:

1) no partitioning (i.e., one data subset), 2) partitioned by gene

(three data subsets), 3) partitioned by gene, with first and

second codon positions of COI separated from third codon

positions (four data subsets: COI positions 1 and 2, COI

position 3, 16S and ITS1) and 4) partitioned by gene with COI

partitioned by codon (five data subsets; ITS1, 16S, COI 1 st , 2 nd

and 3 rd codon positions). Best-fitting substitution models were

chosen using jModelTest v2.1.1 (Darriba et al., 2012) and the

best-fitting partitioning scheme was chosen using a second-

order correction of the Akaike information criterion (AICc)

and the Bayesian Information Criterion (BIC). Partitioned

maximum likelihood analyses were performed with GARLI

2.0 (Zwickl, 2006). The ML tree search consisted of 10

searches (5 with random starting trees and 5 with stepwise

starting trees, each with 100 search replicates); ML bootstrap

analysis in GARLI 2.0 comprised 100 pseudoreplicates, each

with random starting trees and 10 search replicates. Bayesian

analyses were performed with MrBayes v3.2.1 (Ronquist and

Huelsenbeck, 2003), with four independent runs of four chains

each, temperature set to 0.05 to improve mixing, and the run

automatically terminated when a topological convergence

diagnostic (the average standard deviation of split frequencies)

dropped below 0.01. For Bayesian analyses, data were

unpartitioned or partitioned by gene and codon position, as

described for ML analyses.

Results

DNA was extracted from a total of 115 specimens. Due to

difficulty in PCR amplification of some loci from some specimens

and missing sequences for some loci for some outgroup taxa, the

full data set comprises a substantial amount of missing data

(Table 2). GenBank numbers for the sequences generated in this

study are COI: KJ539071 - KJ539141,16S: KJ538962 - KJ538996,

ITS1: KJ538997 - KJ539070. The full and “all three genes” data

matrices are available on request to FEA.

The best-fitting models for each of the partitions were as

follows—COI 1 st positions: 000010+G, COI 2 nd positions:

274

D.J. Reish, F.E. Anderson, K.M. Horn & J. Hardege

Nephtys sp.

Namalycastis jaya

- Pfatynereis dumeritif

-T Hawaii (2)

100

1.0

Hawaii (2)

Portugal (6)

100

0 92

100

0.99

-fi Humber (3) +

i Bremerhaven (2)

L A. Harbor (5)

Newport (17)

Reish Lab (16)

San Gabriel (1)

Venice Lagoon (1)

0.95

Punta Blanca J2

0.93

"|| Venice Lagoon (13)

Alamitos Bay (2)

0.1

Alamitos Bay (8)

Bahia do San Quentin (2)

Punta Blanca (3)

San Gabriel (18)

Figure 1. Maximum-likelihood tree resulting from partitioned analysis of the full concatenated data set in Garli 2.0. Numbers above branches

represent ML bootstrap support values; numbers below branches represent posterior probabilities from an unpartitioned Bayesian analysis in

MrBayes 3.2.1. Within each dashed box names refer to all populations present within that clade.

Molecular phylogenetics of the Neanthes acuminata (Annelida: Nereididae) species complex

275

0.99

0.1

- Platynereis dumerilii

Portugal FI

99/1.0

100

1.0

LA Harbor FI

LA Harbor F2

LA Harbor F3

LA Harbor F4

Newport FI

Newport F2

Newport F3

Newport F4

Reish Lab FI

Reish Lab F2

Reish Lab F3

Reish Lab F4

95/0.991 Venice La 9 oon FI

I Venice Lagoon F2

90/0.99

1.0

80/0.99

San Gabriel FI

95/1.0

■ San Gabriel F3

Alamitos Bay FI

71/0.99| Alamitos Bay F2

Figure 2. Maximum-likelihood tree resulting from partitioned analysis of the “all three genes” data set in Garli 2.0. Numbers above branches

represent ML bootstrap support values; numbers below branches represent posterior probabilities from an unpartitioned Bayesian analysis in

MrBayes 3.2.1

276

D.J. Reish, F.E. Anderson, K.M. Horn & J. Hardege

Table 3. Number of specimens (OTUs) and amount of missing data for

the “full” and “all three genes” data matrices.

Matrix

Full

All three genes

Number of OTUs

111

# outgroup OTUs

3 a

l b

OTUs missing

COI

16S

ITS

l c

OTUs with only:

COI

16S

ITS

Total missing datad

56%

7.6%

a - Nephtys sp., Namalycastis jay a and Platynereis dumerilii

b - Platynereis dumerilii only

c - Missing from Platynereis dumerilii

d - includes terminal gaps, missing loci and indels in ITS

000001 (full) and 011110+F (all three genes), COI 3 rd positions:

HKY+G, 16S: TPM2uf+G (full) and 011212+G+F (all three

genes), ITS1: K80+I (full) and 011010+G (all three genes)

(substitution codes are from jModeltest; the TPM2uf model is

the “three-parameter” or Kimura (1981) model, and has a

substitution code of 010212). The best-fitting partitioning

scheme for both the full and all-three-genes data set was the

“five data subsets” scheme in which 16S, ITS1 and each COI

codon position had a separate substitution model. Phylogenies

resulting from maximum likelihood and Bayesian analyses of

the “full” and “all three genes” data matrices under this

partitioning scheme are presented in figures 1 and 2.

Partitioned Bayesian analyses of the full data set failed to

converge after >20 million generations; posterior probabilities

shown in figure 1 are from an unpartitioned Bayesian analysis

(GTR+I+G model) of that data set. The overall topologies of

the trees are consistent with one another, with several well-

supported nodes in both trees.

Sequences could not be obtained for all loci from every

worm; in the full data matrix, 56% of the cells were missing

data (including alignment gaps). In some cases, individual

worms were represented by data from only one or two loci,

resulting in nonoverlapping data among specimens. For

example, for the four Hawaii specimens, we obtained only 16S

data for two specimens, only ITS1 data from another specimen

and both COI and ITS1 data (but not 16S) from a fourth

specimen. The closest match to the two Hawaii 16S sequences

was a 16S sequence from a Portugal specimen, resulting in a

closer (but artifactual) relationship between these two Hawaii

specimens and the other two in the data set (Fig. 1). Despite

this, trees resulting from maximum likelihood and Bayesian

analyses of individual-gene data sets (not shown) and the

“full” and “all three genes” concatenated data sets were

congruent, so we will focus on trees resulting from analyses of

the full data matrix. The full matrix trees suggested that

worms sampled from Connecticut, Hawaii and Portugal, as

well as N. diversicolor Miiller sampled from Germany and the

UK, were genetically distinct from one another, and all

analyses recovered a well-supported clade comprising all

worms collected from Mexico and California (Fig. 1). This

clade comprised two well-supported subclades, one consisting

of worms collected from Los Angeles Harbour and Newport

Beach (clade A), and the other consisting of worms sampled

from all other southern California and Mexico (Punta Banda)

population (clade B). Two members of Clade A (San Gabriel

JDH 12 and Venice Lagoon JDH 1) were collected in localities

generally inhabited by Clade B individuals.

Discussion

The finding that worms sampled from Connecticut, Hawaii,

southern California, and Portugal form separate clades on our

trees that correlate with geographic location is not particularly

surprising. Some studies of polychaete species complexes with

broad geographical distributions have yielded genetic evidence

of substantial cryptic variation (e.g. Neanthes diversicolor,

Virgilio et al., 2009), while others have revealed little genetic

differentiation among widely separated regions (e.g., Ahrens

et al., 2013). Unlike many polychaetes (but similar to N.

diversicolor ), species in the Neanthes acuminata complex

have no pelagic larval stage. Species in this complex also use

odour to initiate interpopulation aggression and pre-mating

isolation. These life history features could partially explain

why we seem to see genetic differences over short geographic

distances. Worms sampled from Connecticut (2n=22) and

Hawaii (2n=28) have different diploid chromosome numbers

than do worms from California (2n=18), corroborating the

inference that at least these three clades of worms in our

phylogeny (Fig. 1) represent distinct species.

Two distinct subclades were found in southern California,

one consisting of specimens collected from Los Angeles

Harbour and Newport Beach (clade A), and the other

comprising samples from all other southern California and

Mexico sites (clade B). These clades were congruent with

morphological and karyotypic differences seen among these

populations—worms in clade A have red eyes and bright

yellow/orange eggs, while worms in clade B have black eyes

and pale yellow eggs. Since there are only two known

populations in the N. acuminata complex with this colour

distinction, we propose that the specimens from Los Angeles

Harbour and Newport Bay were the result of a mutation giving

rise to red eyes and bright orange ova. A similar eye colour

mutation arose in a laboratory population of Platynereis

dumerilii that was maintained for a long period of time at the

Universitat Koln (Fischer, 1969). The orange eye color was the

result of a mutation that generated a recessive or allele.

Backcrosses between black-eyed worms and the mutant form

with red eyes produced a 1:1 ratio of black-eyed/orange-eyed

Molecular phylogenetics of the Neanthes acuminata (Annelida: Nereididae) species complex

277

offspring. We speculate that a mutation producing the red eye/

bright orange ova occurred in Newport Bay population which

occurs intertidally in the back bay area. This mutant population

may have been accidentally introduced into Los Angeles

Harbour. It was a common practice for the owners of pleasure

boats docked in Newport Bay to move their boats into the

polluted waters of the inner harbour of the Los Angeles area to

kill the fouling organisms attached to the vessel. Since N.

arenaceodentata is known to live within the fouling organism

community attached to boat floats (Crippen and Reish, 1969),

the mutant could have been associated with such organisms

attached to pleasure boats anchored in Newport Bay and were

transported to Los Angeles Harbour in this way. The initial

collection of N. areaceodentata was made in the west basin

area of Los Angeles Harbour in December 1953 by DJR. This

collection formed the basis of the life history study of the

species (Reish, 1957). The ova were bright orange but the eye

color was not noted. This population was destroyed prior to

DJR moving to CSULB.

Additional evidence for the Newport-Los Angeles Harbour

clade is the behavioural responses observed in the Southern

California populations by Sutton et al. (2005). Black-eyed San

Gabriel River worms showed more aggression toward red-eyed

worms sampled from two sites (Newport and LA Harbour) than

worms from the two red-eyed populations showed toward each

other (though these findings were not statistically significant).

Earlier Weinberg et al. (1992) reported that the inability of

worms from the lab population to mate with worms from San

Gabriel River and Newport Bay was evidence for rapid

reproductive isolation of the lab worms following a founder

event. However, this hypothesis was rejected by Rodriguez-

Trelles et al. (1996) based on allozyme electrophoresis analyses

of the three populations. Worms from the lab population and San

Gabriel River produced offspring (DJR, personal observations).

Worms collected from another locality in LA Harbour in 2008

by DJR were identical in appearance to the lab population,

indicating little or no change from the 1964 collection.

The second clade on the Pacific Coast comprises worms

from Venice, Alamitos Bay, San Gabriel River and Baja

California. There are many estuaries in Southern California and

Baja California and many of them have been altered in California,

but those in Baja California have not been modified to any great

extent. We assume that populations have existed in these areas

for a long period of time. Historically, Alamitos Bay was an

estuary formed by the San Gabriel River, but it became separated

following a flood in 1938. The San Gabriel River became

polluted and was devoid of benthic life by the late 1950s (Reish,

1956). Subsequently, the sources of pollution were eliminated

and the channels were deepened. Shortly thereafter, electricity¬

generating plants were constructed and water was taken from

Alamitos Bay for cooling the plants and discharged into San

Gabriel River. Neanthes arenaceodentata was not found in San

Gabriel River until 1971 (Reish unpublished report); we assume

that they were introduced from Alamitos Bay.

Two members of Clade A (San Gabriel JDH 12 and Venice

Lagoon JDH 1) were collected in localities generally inhabited

by Clade B individuals, suggesting that limited migration

occurred among these sites.

In conclusion, we have demonstrated that members of the

N. acuminata complex sampled from multiple sites in the U.S.,

Mexico and Europe represent genetically distinct groups

(possibly distinct species), and the different morphs of N.

arenaceodentata seen in southern California represent two

genetically distinct groups. We believe that the different

populations seen in southern California may be the result of

limited larval dispersion, the use of signature odour profiles

for interpopulation aggression, pre-mating isolation, and

preference for an estuarine habitat.

Acknowledgements

We would like to thank Megan Ratts (SIUC) and David H.

Lunt (Hull) for assistance with laboratory work. This project

was supported in part by the “WormNet II: Assembling the

Annelid Tree of Life” project (U.S. National Science

Foundation grant DEB-1036516) to FEA.

References

Ahrens, J. B., Borda, E., Barroso, R., Paiva, P. C., Campbell, A. M.,

Wolf, A., Nugues, M. M., Rouse, G. W. and Schulze, A. 2013. The

curious case of Hermodice carunculata (Annelida: Amphinomidae):

evidence for genetic homogeneity throughout the Atlantic Ocean

and adjacent basins. Molecular Ecology 22:2280-2291.

Audouin, J. V. and Milne-Edwards, H., 1834. Recherches pour server

a l’histoire naturelle du littoral de la France, ou recueil de

memoires sur l’anatomie, la physiologie, la classification et les

moeudrs des asnimaux de nos cotes; ouvrage accompagne de

planches faites de apres nature. Paris, vol. 2, 290 p.

Bailey-Brock, J. H., Paava, B., Barrett, B. M., and Dreyer, J., 2002.

Polychaetes associated with a tropical ocean outfall: synthesis of

a biomonitoring program off O’ahu, Hawai’i. Pacific Science 56:

459-479.

Bellan, G. 1967. Pollution et peuplements benthiques sur substrat

meuble dans la region de Marselle. Premiere Parte. Review

Internationale d’Oceangraphie Medical. 6-7: 53-87.

Crippen, R. W. and Reish, D. J. 1969. An ecological study of the

polychaetous annelids associated with fouling material in Los

Angeles Harbor, with special reference to pollution. Bulletin of

the Southern California Academy of Sciences 68:170-187.

Day, J. H. 1973. New Polychaeta from Beaufort, with a key to all

species recorded from North Carolina. NOAA Technical, Report

NMFSl National Oceanic and Atmospheric Administration,

National Marine Fisheries Service, Washington, D. C. circ-375.

Darriba, D., Taboada, G. L., Doallo, R., and Posada, D. 2012.

jModelTest 2: more models, new heuristics and parallel computing.

Nature Methods, 9: 772. doi:10.1038/nmeth.2109.

delle Chiaje, S., Descrizione e notomia degli animali invertebrate

della Sicilia citeriore osservati vivi negli annil822-1830, 5 vols.

Naples, Italy.

Dfaz-Castaneda, V. and Rodrfguez-Villanueva, 1998. Polychaete

fauna from San Quintin Bay, Baja Calfornia, Mexico. Bulletin of

the Southern California Academy of Sciences 97: 9-32.

Edgar, R. C. 2004. MUSCLE: multiple sequence alignment with high

accuracy and high throughput. Nucleic Acids Research 32: 1792-

7. doi:10.1093/nar/gkh340.

Ehlers, E., 1868. Die Borstenwtirmer. Annelida Polychaeta. Leipzig,

Germany. 748 p.

Ehlers, E., 1904. Neuseelandische Anneliden. Abhandlungen der

Koniglichen Gesellschaft der Wissenschaften zu Gottingen.

Mathematisch-Physikalische Klasse. Neue Folge. 3: 1-80.

278

D.J. Reish, F.E. Anderson, K.M. Horn & J. Hardege

Fauvel, P. 1953. The fauna of India. Annelida Polychaeta. The Indian

Press, Ltd. Allhabad. 507 p.

Fischer, A. 1969. Eine Pigmentmangelmutante bei dem Polychaaeten

Platynereis dumerilii. Molecular General Genetics 104:3609-379.

Folmer, O., Black, M., Heoh, W., Lutz, R. & Vrijenhoek, R. 1994. DNA

primers for amplification of mitochondrial cytochrome c oxidase

subunit I from diverse metazoan invertebrates. Molecular Marine

Biology and Biotechnology 3: 294-299.

Geller, J.B., Grosholz, E. & Ruiz, G. 1997. Cryptic invasions of the crab

Carcinus detected by molecular phylogeography. Molecular

Ecology 6: 256-262.

Maddison, W. P. and Maddison, D. R. 2010. Mesquite: a modular system

for evolutionary analysis. Retrieved from http://mesquiteproject.org .

Magesh, M. Kvsi, S. abd Glabsy, C. J., 2012. Description and phylogeny

of Namalycastis jay sp. n. (Polychaeta, Nereididae, Namanereidinae)

from the southwest coast of India. Zookeys 234: 41-43.

Moore, J. P., 1903. Descriptions of two new species of Polychaeta from

Woods Hole, Mass.. Proceedings of the Academy of Natural History

Philadelphia 55: 720-726.

Oshida, P. S., Meams, A. J., Reish, D. J. and Word, C. S., 1976. The

effects of hexavalent and trivalent chromium on Neanthes

arenaceodentata (Polychaeta: Annelida). Southern California

Coastal Water Research Project. TM 225: 1-58.

Palumbi, S.R. 1996. Nucleic acids II: the polymerase chain reaction. Pgs.

205-248 in Molecular Systematics , 2nd edition, D. Hillis, C. Moritz,

and B. Mable, Eds. Sinauer Associates.

Pettibone, M. H. 1963. Marine polychaete worms of the New England

region. 1. Aphroditidae through Trochochaetidae. Smithsonian

Institute Bulletin, part 1, Washington, D.C. 355p.

Reish, D. J. 1956. An ecological study of San Gabriel River, California,

with special reference to pollution. California Fish and Game 42:

51-63.

Reish, D. J. 1957. The life history of the polychaetous annelid Neanthes

caudata (delle Chiaje), including a summary of the development in

the family Nereidae. Pacific Science 11: 216-228.

Reish, D. J., 1964. Studies on the Mytilus edulis community in Alamitos

Bay, California: II. Population variations and discussions of the

associated organisms. The Veliger 6: 202-207.

Reish, D. J. 1968. The polychaetous annelids of the Marshall Islands.

Pacific Science 22: 208-231.

Reish, D. J., 1972. Marine Life of Southern California. Kendall/Hunt

Publishing Co„ Dubuque, Iowa. 164 p.

Reish, D. J. and Alosi, M. C. 1968. Aggressive behavior in the

polychaetous family Nereidae. Bulletin of the Southern California

Academy of Sciences 67: 21-28.

Reish, D. J., De Calibus, K, Dewar, J. and Bube, C. 2009. Reproductive

longevity in two species of polychaetous annelids. Zoosymposia

2: 349-395.

Rodriguez-Telles, F, Weinberg, T. R, and Ayala, R. J. 1996. Presumptive

rapid speciation after a foundering event in a laboratory population

of Nereis allozyme electrophoretic does not support the

hypothesis. Evolution 50: 457-461.

Ronquist, F.,and Huelsenbeck, J. P. 2003. MrBayes 3: Bayesian

phylogenetic inference under mixed models. Bioinformatics 19:

1572-1574.

Sutton, R., Bolton, E., Bartel-Hardege, H. D., Eswards, M, Reish, D. J.

and Hardege, J. D. 2005. Chemical signal mediated premating

reproductive isolation in a marine polychaete Neanthes acuminata

( arenaceodentata ). Journal of Chemical Ecology 31:1865-1876.

Virgilio, M., Fauvelot, C., Costantini, F., Abbiati, M., & Backeljau, T.

2009. Phylogeography of the common ragworm Hediste

diversicolor (Polychaeta: Nereididae) reveals cryptic diversity

and multiple colonization events across its distribution. Molecular

Ecology 18(9), 1980-94. doi:10.1111/j.l365-294X.2009.04170.x

Weinberg, J. R., Starczak, V. R., Mueller, C., Pesch, G. C. and Lindsay,

S. M. 1990. Divergence between populations of a monogamous

polychaete with male parental care: premating isolation and

chromosome variation. Marine Biology 107: 205-213.

Weinberg, J. R., Starczak, V. R., and Jorg, D. 1992. Evidence for rapid

speciation following a founder event in the laboratory. Evolution

46: 1214-1220.

Winchell, C. J., Valencia, J. E. and Jacobs, D. K., 2010. Confocal

analyosis of nervous system architecture in direct-developing

juveniles of Neanthes arenaceodentata (Annelida, Nereididae).

Frontiers in Zoology 7: 17-36.

Zwickl, D.J. 2006. Genetic algorithm approaches for the phylogenetic

analysis of large biological sequence datasets under the maximum

likelihood criterion. The University of Texas, Austin, Texas.

Memoirs of Museum Victoria 71:279-287 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Fishing bait worm supplies in Japan in relation to their physiological traits

Hidetoshi Saito 1 *, Koichiro Kawai 2 , Tetsuya Umino 3 and Hiromichi Imabayashi 4

Graduate School of Biosphere Science, Hiroshima University, Kagamiyama 1-4-4, Higashi-Hiroshima 739-8528, Japan.

1 saito@hiroshima-u.ac.jp

2 kawagogi@hiroshima-u.ac.jp

3 umino@hiroshima-u.ac.jp

4 imabayas@hiroshima-u.ac.jp

*To whom correspondence and reprint requests should be addressed. E-mail: saito@hiroshima-u.ac.jp

Abstract Saito, H., Kawai, K., Umino, T. and Imabayashi, H. 2014. Fishing bait worm supplies in Japan in relation to their

physiological traits. Memoirs of Museum Victoria 71: 279-287.

Market research was conducted from 2009 to 2013 to investigate the supply of live worms for fishing bait in Japan.

We obtained 25 types of live fishing bait worms, including 16 species of polychaete, 1 species of echiuran, and 1 species

of sipunculid. These were divided into three groups according to their country of origin: 1) worms supplied from native

populations, five species (. Perinereis wilsoni, Hediste diadroma, Kinbergonuphis enoshimaensis, Pseudopotamilla

occelata, and Hydroides ezoensis), 2) worms supplied from both native and non-native populations, three species

(.Marphysa cf. iwamushi, Halla okudai, and Urechis unicinctus ), and 3) worms supplied from non-native populations, 10

species (. Perinereis linea, Alitta virens, Nectoneanthes uchiwa, Namalycastis rhodochorde, Glycera nicobarica, Diopatra

sugokai, Marphysa cf. tamurai, Marphysa cf. mossambica, Scoletoma heteropoda, and Sipunculus nudus). Salinities in

which no mortality of nereid worms occurred was 5-35 psu i n Alitta virens, 5-30 psu in Namalycastis rhodochorde, and

10-35 psu in Perinereis linea. Worms living in temperate areas had a wide temperature tolerance of 5-30 °C in Alitta

virens, Perinereis linea, Glycera nicobarica, Marphysa cf. iwamushi, and Scoletoma heteropoda. Tropical species

(Namalycastis rhodochorde and Marphysa cf. mossambica ) could not survive above 20 °C.

Keywords endangered species, fishing bait, import, non-native species, polychaete

Introduction

Human-mediated introduction of aquatic organisms beyond

their native range has long been of great interest to ecologists.

Although the shipping industry has received considerable

attention as a dispersal mechanism for aquatic nuisance species,

many invasions have been linked to other mechanisms of transfer

including the bait industry (Weigle et al., 2005). The release of

unused bait by anglers is an important vector of invasive species

(Haska et al., 2012; Kilian et al., 2012). Previous studies reported

that live fishing bait has been imported from Asian to European

countries and the USA (Olive, 1994; Gambi et al., 1994; Costa et

al., 2006; Cohen, 2012). Since 1969, about 1,000 t a year of live

fishing bait has been imported into Japan from mainly Asian

countries (Hayashi, 2001). According to a review of human-

mediated introduction of aquatic organisms into Japan (Iwasaki,

2006), one Perinereis and one Marphysa species have been

imported as bait. However, a preliminary investigation revealed

that there are unconfirmed bait species other than these two

worms in the Japanese bait market, and therefore detailed

research is needed to clarify how many species are supplied as

live fishing bait.

In this study, market research was conducted from 2009 to

2013 to investigate the supply of live bait worms in Japan. In

addition, to determine which species pose the greatest risk as

invasives, we studied some of the physiological traits (salinity

and temperature tolerances) of the imported bait species.

Materials and methods

Market research

Bait worms were purchased at stores and wholesalers in

Hiroshima, Okayama, Osaka, Toyohashi, and Hamamatsu, or

via online from Osaka, Nagoya, and Sendai from December

2009 to May 2013. At the same time information on the local

fishing name, source country, price, commercial size, and

target fishes was obtained (Fig. 1). Bait worms were fixed in

10% formalin and then stored in 70% ethanol. Specimens

were identified under stereo and compound light microscopes.

All specimens were deposited at the Laboratory of Aquatic

Animal Ecology, the Graduate School of Biosphere Science,

Hiroshima University.

280

H. Saito, K. Kawai, T. Umino & H. Imabayashi

40°N

30°N

Fig. 1. Location of market research in Japan.

Survival experiments

Eight species of imported worms, Perinereis linea, Alitta

virens, Namalycastis rhodochorde, Glycera nicobarica,

Marphysa cf. iwamushi, Marphysa cf. mossambica,

Scoletoma heteropoda, and Halla okudai were obtained from

bait shops. Each species of worm was transferred to an aerated

120-L aquarium containing artificial seawater at 25 ppt and 23

°C for 24 h before experiments to exclude inactive individuals.

Survival experiments were performed in polyethylene

containers (30x12x9 cm) maintained in a biotron (UZ-2242,

NK system). Each experimental worm was placed in a

container provided with a 5-cm layer of artificial seawater

with an air filter. Experiments were replicated five times at

seven different salinities (5, 10,15, 20, 25,30, and 35 ppt) at 23

°C, and seven different temperatures (5, 10, 15, 20, 25, 30, and

35 °C) at 25 ppt. The inhabitable range of salinity and

temperature was evaluated from the 100 % survival of

individuals after 5 days.

Fishing bait worm supplies in Japan in relation to their physiological traits

281

Table 1. Local market names, research dates, market places, source country, commercial size, price, and target fish of the bait worms sold in Japan.

Local

market name

Research

date

Market

place

Source

country

Commercial

size (BL: cm)

Price

(Japanese Yen)

Target

fish*

Ishi-gokai

14 May 2010

Hiroshima

Japan

5-10

800 /100g

Whiting, Goby

Ao-mushi

17 Mar. 2010

Hiroshima

China

10-20

600 /100g

Flounders, Greenling

Super

Ao-mushi

31 Aug. 2011

Osaka via online

China

10-20

750 /100g

Flounders, Greenling

Aka-isome

31 Aug. 2011

Osaka via online

China

10-20

750 /100g

Flounders, Greenling

Mizu-gokai

11 Mar. 2012

Okayama

Japan

10-20

1000/lOOg

Goby, Japanese Seaperch

Ao-kogane

16 Dec. 2009

Hiroshima

Netherlands

15-25

800 /100g

Flounders, Black Seabream

Aka-kogane

17 Nov. 2010

Osaka

China

15-25

1500/100g

Flounders

Super Cordelle

23 Jul. 2012

Sendai via online

Vietnam

30-80

300 /indv.

Red Seabream

Chi-mushi

10 Jan. 2010

Osaka via online

China

15-25

750 /100g

Flounders

Shiro-chirori

21 Mar. 2013

Hamamatsu

China

15-25

1000/100g

Flounders

Fukuro-mushi

11 Aug. 2010

Osaka

China

10-20

1600/100g

Black Seabream

Iso-mushi

26 Mar. 2011

Toyohashi

Japan

10-20

50 /indv.

Black Seabream, Whiting

Iwa-mushi

9 May 2013

Hiroshima

Japan

15-25

2000 /100g

Flounders, Greenling

Hon-mushi

18 Feb. 2013

Hiroshima

China

15-25

2000 /100g

Flounders, Greenling

Honsa-mushi

10 Jan. 2010

Osaka via online

China

20-40

2000 /100g

Flounders, Greenling

Straw-mushi

23 Sep. 2012

Nagoya via online

Indonesia

15-25

100 /indv.

Black Seabream

Chrori

2 Jun. 2010

Hiroshima

China

15-25

1600 /100g

Whiting, Red Seabream

Tai-mushi

21 Dec. 2009

Hiroshima

China

30-60

6500 /100g

Red Seabream

Tai-mushi

8 May 2012

Hiroshima

Japan

30-60

6500 /100g

Red Seabream

Erako

16 Jan. 2011

Sendai via online

Japan

4-8

100/lOOg

Flounders

Pipe-mushi

15 Nov. 2012

Osaka

Japan

1-2

100/lOOg

Black Seabream

Kouji

16 Dec.2009

Hiroshima

Japan

5-10

190 /indv.

Red Seabream, Flounders

Super Kouji

12 Dec.2009

Hiroshima

China

10-15

110 /indv.

Red Seabream, Flounders

Yu-mushi

16 Dec.2009

Hiroshima

China

10-15

110 /indv.

Red Seabream, Flounders

BB Worm

10 Jan. 2010

Osaka via online

China

10-20

80 /indv.

Flounders

* Whiting: Sillago japonica, Goby: Acanthogobius flavimanus. Flounders: Pleuronectes yokohamae and Kareius bicoloratus,

Greenling: Hexagrammos otakii, Japanese Seaperch: Lateolabrax japonicus, Black Seabream: Acanthopagrus schlegelii, Red

Seabream: Pagrus major

Results

Market research

Twenty-five types of worm were sold as live fishing bait (Table 1).

Of these, 17 were imported from China, Vietnam, Indonesia, and

the Netherlands, and the remaining eight were supplied from

Japan. Of the bait worms sold, 16 species were polychaetes, 1

species an echiuran, and 1 species a sipunculid. These were divided

into three groups according to their country of origin. The bait

characteristics of each species are described overleaf. (Table 2)

1) Worms supplied from native populations

Perinereis wilsoni Glasby and Hsieh, 2006

This species is a nereid worm, which was known as Perinereis

nuntia vallata Grube (1857) (e.g., Imajima, 1996), but then

described as a new species by Glasby and Hsieh (2006).

Perinereis wilsoni is distributed on intertidal reef flats or

rocky shores under boulders in Taiwan, China, Japan, and

South Korea (Glasby and Hsieh, 2006). It has been cultured

since the 1980s in Japan (Yoshida, 1984), and the worms have

been mainly supplied under the local market name Tshigokai’,

meaning boulder worm. Wholesalers reported that a small

amount of Tshigokai’ is imported from China; however, we

were unable to obtain Chinese specimens.

282

H. Saito, K. Kawai, T. Umino & H. Imabayashi

Table 2. Scientific names, local market names, distributions and habitats of bait worms sold in Japan.

Scientific name

Local market name

Distribution

Habitat

Perinereis wilsoni

Ishi-gokai

Taiwan, China, Japan, South

Korea

Reef flats of Intertidal zone

Perinereis linea

Ao-mushi, Super Ao-

mushi, Aka-isome

China, Korea

Mudflats of the upper intertidal

zone in estuaries

Hediste diadroma

Mizu-gokai

Japan, China

Mud and Sandflats of intertidal

zone in estuaries

Alitta virens

Ao-kogane

Northern Atlantic and Pacific

oceans, North Sea

Mud and Sandflats of intertidal to

subtidal zone in estuaries and

coasts

Nectoneanthes uchiwa

Aka-kogane

Western Japan Korea, China

Mudflats in intertidal or subtidal

zone in estuaries and coasts

Namalycastis rhodochorde

Super Cordelle

Vietnam, Indonesia, Malaysia

Mudflats of intertidal zone in

estuaries with mangrove

Glycera nicobarica

Chi-mushi, Shiro-chirori

Southern Pacific and Indian

Oceans, Japan, East China

Sea

Sandflats of intertidal to subtidal

zone

Diopatra sugokai

Fukuro-mushi

Malaysia, Thailand, China,

Taiwan, Japan

Sandflats of intertidal to subtidal

zone in estuaries and coasts

Kinbergonuphis enoshimaensis

Iso-mushi

Japan

Sand beach of intertidal zone of

open sea

Marphysa cf. iwamushi

Iwa-mushi, Hon-mushi

China, Korea, Japan

Sandflats and rocky shores of

intertidal to subtidal zone

Marphysa cf. tamurai

Honsa-mushi

East China Sea, Japan

Mud and Sandflats of intertidal

zone

Marphysa cf. mossambica

Straw-mushi

Malaysia, Indonesia

Mudflats of intertidal zone in

estuaries with mangrove

Scoletoma heteropoda

Chrori

Japan, Southern Sakhalin,

Yellow Sea

Mud and Sandflats of intertidal to

subtidal zone

Halla okudai

Tai-mushi

Japan, China, Malaysia,

Southern Australia

Sandflats of intertidal to shallow

subtidal zone

Pseudopotamilla occelata

Erako

Northern Japan, Pacific ocean

Surface of rocks of intertidal to

subtidal zone

Hydroides ezoensis

Pipe-mushi

Japan, Russia

Surface of rocks of intertidal to

subtidal zone

Urechis unicinctus

Kouji, Super Kouji,

Yu-mushi

China, Korea, Japan

Mud and Sandflats of intertidal to

subtidal zone

Sipunculus nudus

BB Worm

Atlantic, Pacific and Indian

Oceans, Mediterranean and

Red Seas

Sand flats intertidal to shallow

subtidal zone

Hediste diadroma Sato and Nakashima, 2003

This species is a nereid worm, which was known as Neanthes

japonica (Izuka, 1908) (e.g., Izuka, 1908; Imajima, 1972,

1996), but then described as a new species by Sato and

Nakashima (2003). This species is found in the intertidal

muddy and sandy sediments of estuaries of Japan and China

(Sato and Nakashima, 2003). It is harvested during late

November to March (until reproductive swarming occurs)

around Kojima (Okamaya) under the local market name

‘Mizu-gokai’, meaning water worm.

Fishing bait worm supplies in Japan in relation to their physiological traits

283

Kinbergonuphis enoshimaensis Imajima, 1986

This species is a onuphid worm that lives in sandy sediments

of the intertidal zone of Central and Western Japan (Enoshima

and Amakusa) (Imajima,1986, 2001). A limited number are

harvested from sandy coasts of the open sea around Tohashi,

Aichi, central Japan under the local market name ‘Iso-mushi’,

meaning beach worm. Wholesalers reported that bait collectors

attract this worm by scattering olfactory stimulants such as

fish and shellfish on sand, and then by digging with a shovel.

Pseudopotamilla occelata Moore, 1905

This species is a sabellid worm found on the surface of rocks

of the intertidal zone of Northern Japan and the Pacific Ocean

(Uchida, 1992). Limited numbers are harvested in Miyagi,

northern Japan under the local market name ‘Erako’, meaning

branchiae worm.

Hydroides ezoensis Okuda, 1934

This species is a serpulid worm that lives on the surface of

rocks, shells, the holdfasts of kelp, and other substrata in Japan

and Russia (Imajima, 1976, 1996). Limited numbers are

harvested at Osaka, western Japan under the local market

name ‘Pipe-mushi’, meaning pipe worm. Wholesalers reported

that this species is used as bait for black seabream,

Acanthopagrus schlegelii to hook several calcareous tubes

which worms are entering. Hydroides ezoensis has been

introduced to British waters, suggesting that this species was

transported by shipping from the north-west Pacific, perhaps

from Japan (Thorp et al., 1987).

2) Worms supplied from native and non-native populations

Marphysa cf. iwamushi Izuka, 1907

The eunicid worm, Marphysa iwamushi was described by

Izuka, 1907, but then synonymized with Marphysa sanguinea

by Imajima and Hartman, 1964 (Miura, 1977; Imajima, 2007).

This worm lives in sandy and rocky sediments from the

intertidal to subtidal (Izuka, 1912; Imajima, 2007). Recently,

Hutchings and Karageorgopoulos (2003) redescribed

Marphysa sanguinea using a specimen collected in England

as the type locality. Subsequent taxonomic revisions of the

Marphysa sanguinea group have been done from different

parts of the world (Lewis and Karageorgopoulos, 2008; Glasby

and Hutchings, 2010). Lewis and Karageorgopoulos (2008)

reported that there is sufficient genetic differentiation between

the geographically separated populations of Australia,

England, Japan, Portugal, and South Africa, suggesting that

Marphysa sanguinea does not occur in Japan. More recently,

Taru (2013) recognized Marphysa iwamushi as a valid species.

This worm similar to Imajima’s (2007) description whose

subacicular chaetae comprise compound spingerous chaetae

only. This worm has been imported from Korea since 1969,

although the main source country has shifted to China (Saito

et al., 2011). A small amount of the worm is harvested in Japan

under the local market names Twa-mushi’ and ‘Hon-mushi’,

meaning rock worm and genuine worm, respectively.

Halla okudai Imajima, 1967

This species is an oenonid worm that lives in sandy sediments

of the intertidal to shallow subtidal in Japan, Malaysia, and

Southern Australia (Okuda, 1933; Imajima, 1967; Idris and

Arshad, 2013). Limited numbers of this species have been

harvested in Hiroshima, western Japan under the local market

name ‘Tai-mushi’, meaning bream worm. Since 2004, this

worm has been imported from Fujan, southern China.

Wholesalers mentioned that Halla okudai is the most effective

worm of all bait worms for red seabream, Pagrus major, but

that supplies are limited. Therefore, the market price is very

high (6500 yen/100 g).

Halla okudai is a carnivorous worm feeding on bivalves,

especially the manila clam, Ruditapes phillipinarum (Saito et

al., 2004). Recently, there are concerns that there has been a

collapse of the Japanese population, because production of the

clam decreased drastically in Japan (The Japanese Association

of Benthology, 2012).

Urechis unicinctus (von Drasche, 1881)

This species is a urechid spoon worm, which is found in

muddy and sandy sediments of the intertidal to shallow depths

of China, Korea, and Japan. It has been harvested from the

Seto Inland Sea, western Japan under the local market names

‘Kouji’, ‘Super Kouji’, and ‘Yu-mushi’, which all mean good

bait (Saito et al., 2011). This worm has been imported from the

Shandong Peninsula, China since 1996. This species is also

consumed by humans in China, Korea, and Japan (Hokkaido)

(Nishikawa, 1992).

3) Worms supplied from non-native populations

Perinereis linea (Treadwell, 1936)

This species is a nereid worm, which has been imported from

Korea since 1969, although the main source country is now

China (Hayashi, 2001). It was formerly recognized as

Perinereis aibuhitensis Grube, 1878 (e.g. Imajima, 1996), but

was synonymized with Perinereis linea by Arias et al. (2013).

This species is found in silty sediments in the upper littoral

zone of estuaries and coastal areas of China and Korea (Choi

and Lee, 1997; Arias etal., 2013). Wholesalers mentioned that

Perinereis linea has been mainly harvested from the Yellow

Sea population (worms have a greenish body color) in summer

and the East China Sea population (worms have a yellowish

body color) in winter. In addition, both populations have been

cultured recently in the South China Sea (Hainan) under the

local market names ‘Super Ao-mushi’ and Aka-isome’,

meaning excellent blue worm and red worm, respectively.

Alitta virens (Sars, 1835)

This species is a nereid worm, which lives in muddy and sandy

sediment of the intertidal to subtidal in estuaries and the coasts

of the North Sea, Northern Atlantic, and Pacific Oceans

(Khlebovich, 1996; Bakken and Wilson, 2005). The aquaculture

of this species in European countries began in 1979 (Olive,

1994). In Japan, this cultured worm has been imported from

The Netherlands since 1994 under the local market name ‘Ao-

kogane’, meaning blue gold. In Japan, a common name ‘Jya-

284

H. Saito, K. Kawai, T. Umino & H. Imabayashi

mushi’, meaning snake worm, was known as Neanthes virens

(e.g., Imajima, 1972, 1996) , but then synonymized with Alitta

brandti Malmgren, 1865 by Khlebovich (1996).

Nectoneanthes uchiwa Sato, 2013

This species is a nereid worm, which was formerly recognized

as Nectoneanthes oxypoda sensu Imajima, 1972 (e.g., Imajima,

1972, 1996), but then described as a new species by Sato

(2013). This species inhabits muddy sediments in the intertidal

or shallow subtidal areas (up to 20 m depth) of estuarine

embayments of Western Japan (Seto Inland Sea, Ariake Sea,

and Shiranui Sea), Korea, and China (Sato, 2013). It was once

harvested in the Seto Inland Sea, western Japan (Okuda, 1933).

This species has been imported from China since the 1980s

(Wu et al., 1985), and we obtained it in Osaka, western Japan

under the local market name Aka-kogane’, meaning red gold.

Namalycastis rhodochorde Glasby, Miura and Nishi, 2007

This species a nereid worm, which lives in mud banks and

mudflats of estuaries with mangroves in South-east Asia

including the Mekong Delta (Vietnam), West Kalimantan

(Indonesia), and Sabah (Malaysia). It has been imported from

Vietnam into Japan since 1993 (Glasby et al., 2007). We

obtained this worm (online order) from Sendai, northern Japan

under the local market name ‘Super Cordelle ’.

Glycera nicobarica Grube, 1868

This species is a glycerid worm that lives in intertidal to

subtidal sandy sediments of Japan, the East China Sea,

Southern Pacific, and Indian Oceans (Imajima, 2007).

Glycerid worms (probably Glycera americana) were once

harvested in the Seto Inland Sea, western Japan (Okuda, 1933).

Glycera nicobarica has been imported from China since 2010

under the local market names ‘Chi-mushi’ and ‘Shro-chirori’,

meaning blood worm and white proboscis worm, respectively.

Diopatra sugokai Izuka, 1907

This species is an onuphid worm, which inhabits intertidal to

subtidal sandy sediments of estuaries and coastal waters of

Malaysia, Thailand, China, Taiwan, and Japan (Choe, 1960;

Paxton, 1998; Imajima, 2001). It was once harvested in

Matsushima Bay, Tokyo Bay, Ise Bay, the Seto Inland Sea, and

the Ariake Sea, Japan (Choe, 1960). Recently, it has been

imported from China under the local market name ‘Fucro-

mushi’, meaning tube worm.

Marphysa cf. tamurai Okuda, 1934

This eunicid worm, sold under the local market name ‘Honsa-

mushi’, meaning genuine sand worm, has been imported from

China since 2008. According to the Key to Indo-west Pacific

Marphysa species (Glasby and Hutchings, 2010), this worm

resembles Marphysa tamurai whose prostomium is sub-

conical and buccal lips are separated by a faint notch.

Marphysa tamurai is found in muddy and sandy sediments of

the intertidal zone of Central and Western Japan (Ise Bay and

Onomichi) (Okuda, 1934, 1938). However, there is a lack of

recent information on the habitat of this species in Japan.

Marphysa cf. mossambica (Peters, 1854)

This eunicid worm, sold under the local market name ‘Straw-

mushi’, meaning worm entering a straw tube, has been

imported from Indonesia since 1995. This worm seems to

belong to the Mossambica-group whose subacicular chaetae

comprise limbate chaetae only (Glasby and Hutchings, 2010).

According to observations by Idris (Idris, pers comm. 2013),

this worm is similar to Marphysa cf. mossambica from

Malaysia, and is most probably a new species (Idris and

Arshad, 2013). This species is found in mangroves and mud

flats along the west coast of the Malaysian peninsula (Idris and

Arshad, 2013).

Scoletoma heteropoda (Marenzeller, 1879)

This species is a lumbrinerid worm, which is found in intertidal

and subtidal muddy and sandy sediments of Japan, Southern

Sakhalin, and the Yellow Sea (Imajima and Higuchi, 1975;

Imajima, 2001). It was once harvested in the Seto Inland Sea and

the Ariake Sea, western Japan (Saito et al., 2011). Recently, it has

been imported from China under the local market name ‘Chirori’.

Sipunculus nudus Linnaeus, 1766

This species is a sipunculid peanut worm, which lives in

intertidal to shallow subtidal sandy sediments of the Atlantic,

Pacific, and Indian Oceans and Mediterranean and Red Seas

(Culter et al., 1984; Nishikawa, 1992). It has been imported

from China since 2010 under the local market name ‘BB

Worm’. This species is edible and consumed in Micronesia,

the Philippines, and China (Nishikawa, 1992; Tsuji, 2007).

Survival experiments

The nereid worms had a wide salinity tolerance range of 5-35 psu

in Alitta virens, 5-30 psu in Namalycastis rhodochorde, and

10-35 psu in Perinereis linea. Marphysa cf. mossambica showed

a wider tolerance (15-35 psu) than Marphysa cf. iwamush (20-35

psu). Halla okudai did not survive below 25 psu (Fig. 2).

The temperature tolerances of worms from temperate

areas had a range of 5-30 °C in Alitta virens, Perinereis linea,

Glycera nicobarica, Marphysa cf. iwamushi, and Scoletoma

heteropoda, and 10-35 °C in Halla okudai. The tropical

species, Namalycastis rhodochorde and Marphysa cf.

mossambica, did not survive below 20 °C (Fig. 3).

Discussion

In Japan, bait worms were once collected mainly from the

intertidal zone of the Seto Inland Sea and Ise Bay (Okuda, 1933,

1938). However, large parts of the sandy and muddy intertidal

flats of the Japanese coast, including areas used by bait

collectors, have disappeared because of anthropogenic coastal

developments (e.g., reclamation, seawall construction) (Sato,

2010). To satisfy the demand of Japanese anglers, two species of

nereid and eunicid worm have been imported from Korea since

1969, although the main source country shifted to China after

the 1990s with an annual supply of approximately 10001 and an

increasing number of bait species (Hayashi, 2001).

In this study, a total of 25 types of live bait worms were

obtained in Japan, and we were able to identify 16 species of

Fishing bait worm supplies in Japan in relation to their physiological traits

285

M arp hysa

Haifa

i\ amaly castis rhadochonfe

moxxamhica

5 10 IS 20 25 30 3S

S 10 IS 20 25 30 35

Salinity (|mu)

Water tempi 1 m lure ( J C)

Fig. 2. Schematic representation of inhabitable salinity range of

imported worms. The inhabitable range of salinity was evaluated from

the 100 % survival of individuals after 5 days.

Fig. 3. Schematic representation of inhabitable temperature range of

imported worms. The inhabitable range of temperature was evaluated

from the 100 % survival of individuals after 5 days.

polychaete, 1 species of echiuran, and 1 species of sipunculid.

These were divided into three groups according to their

country of origin: 1) worms supplied from native populations,

five species ( Perinereis wilsoni, Hediste diadroma,

Kinbergonuphis enoshimaensis, Pseudopotamilla occelata,

and Hydroides ezoensis), 2) worms supplied from both native

and non-native populations, three species ( Marphysa cf.

iwamushi, Halla okudai, and Urechis unicinctus ), and 3)

worms supplied from non-native populations, 10 species

(Perinereis linea, Alitta virens, Nectoneanthes uchiwa,

Namalycastis rhodochorde, Glycera nicobarica, Diopatra

sugokai, Marphysa cf. tamurai, Marphysa cf. mossambica,

Scoletoma heteropoda, and Sipunculus nudus). Other

countries have also been reported to import bait worms. In the

United States, California imports two species from South

Korea ( Perinereis linea ) and Vietnam {Namalycastis

rhodochorde ) (Cohen, 2012). Likewise, Spain and Portugal

import three species, Perinereis linea from China, Sipunculus

nudus from Vietnam, and Glycera dibranchiata from the USA

(Costa et al., 2006). These reports indicate that Japan imports

more bait species than other countries. It seems that the

difference in the number of imported species is caused by the

presence of domestic fishing grounds in Europe and the United

States (Cunha et al., 2005; Sypitkowski et al., 2010).

The bait industry is considered as an important vector of

invasive species (Weigle et al., 2005; Haska et al., 2012; Kilian

et al., 2012). Kilian et al. (2012) reported that 65% of anglers

released their unused bait into the water at the end of a fishing

trip. Indeed, Nishi and Kato (2004) reported that Perinereis

linea was discarded in Tokyo Bay (Yokohama, Japan) by

fishermen. In Japan, among the bait worms, nereid worms are

inexpensive (market price of Perinereis linea is approximately

10% of Halla okudai) and are mass-supplied items.

Consequently, they tend to be discarded into the water. Our

research revealed that Alitta virens, Namalycastis

rhodochorde, and Marphysa cf. mossambica are considered

to be non-native species as their native distributional area is

outside of Japan. In addition, Nectoneanthes uchiwa and Halla

okudai are listed as endangered species in Japan (The Japanese

association of benthology, 2012). Hence, the import of bait

worms may increase the risk of accidental introduction of non¬

native species and change the distribution pattern of rare

species.

In this study, the nereid worms Alitta virens and Perinereis

linea, which inhabit boreal and temperate zones have wide

salinity and temperature tolerances of 5 or 10 to 35 psu, and

5-30 °C, respectively. Alitta virens inhabits the White Sea,

whose temperature and salinity varies during the year from 0

to 1 °C in winter up to 20 °C in summer, and from 22 to 26 psu

during the year to 0-5 psu for several days during the spring

ice melt (Ushakova and Sarantchova, 2004). In the Yellow

Sea, Perinereis linea inhabits silty sediments of the upper

littoral zone of estuaries where sediment temperature is 3.3-

26.6 °C and salinity 28.0-29.6 psu (Choi and Lee, 1997). More

recently, an established population of the exotic worm

Perinereis linea was reported from the Mar Menor lagoon,

Mediterranean Sea where salinities of 42-47 ppt and

temperatures of 10.8-31.5 °C have been recorded (Arias et al.,

2013). These data indicate that both worms can survive a range

of temperatures and salinities.

Our experiments showed that two tropical worms had a

salinity tolerance with a range of 5-30 psu for Namalycastis

rhodochorde, and 15-35 psu for Marphysa cf. mossambica.

Both species could not survive in water temperatures below 20

°C. Glasby et al. (2007) reported that Namalycastis

rhodochorde was distributed throughout South-east Asia,

where it inhabits mud banks and mudflats of estuaries and

rivers from full seawater to almost freshwater. The mangrove

palm, Nypa fruticans, is present as far south as northern

Australia (Northern Territory and North-east Queensland)

and northward to southern Japan (Yaeyama Islands). Therefore,

there is a possibility that Namalycastis rhodochorde also

occurs there, or if not native to these areas, could become

established if introduced. It is possible for anglers in southern

Japan to obtain Namalycastis rhodochorde and Marphysa cf.

mossambica, because they are sold online. Therefore, detailed

monitoring of their establishment should be undertaken.

286

H. Saito, K. Kawai, T. Umino & H. Imabayashi

Acknowledgments

We are grateful to Izwandy Idris (Universiti Malaysia

Terengganu) for his taxonomic information of Marphysa

worms. This work was partly supported by a Grant-in-Aid for

Scientific Research (C) of the Japan Society for the Promotion

of Science.

References

Arias, A., Richter., A, Nuria Anadon, N., and Glasby, C.J. 2013.

Revealing polychaetes invasion patterns: Identification,

reproduction and potential risks of the Korean ragworm,

Perinereis linea (Treadwell), in the Western Mediterranean.

Estuarin e. Coastal and Shelf Science 131: 117-128.

Bakken, T., and Wilson, R.S. 2005. Phylogeny of nereidids (Polychaeta,

Nereididae) with paragnaths. Zoological Scripta 34: 507-547.

Choe, S. 1960. On the life history of the polychaete worm, Diopatra

neapolitana Delle Chiaje. Bulletin of the Japanese Society of

Scientific Fisheries 26:430-437.

Choi. J.W., and Lee, J.H. 1997. Secondary production of a Nereid

species, Perinereis aibuhitensis in the intertidal mudflat of the

west coast of Korea. Bulletin of Marine Science 60: 517-528.

Cohen, A.N. 2012. Aquatic invasive species vector risk assessments:

Live saltwater bait and the introduction of non-native species into

California. Center for Research on Aquatic Bioinvasions:

California. 58 pp.

Costa, P.F.E., Gil, I, Passos, A.M., Pereira, P., Melo, P., Batista, F.,

and Fonseca, L.C.D. 2006. The market features of imported non-

indigenous polychaetes in Portugal and consequent ecological

concerns. Scientia Marina 70S3: 293-300.

Culter, E.B., Culter, N.J. and Nishikawa, T. 1984. The Sipuncula of

Japan: Their systematics and distribution. Publication of the Seto

Marine Biological Laboratory 29: 249-322.

Cunha, T., Hall, A., and Queiroga, H. 2005. Estimation of the Dioptra

neapolitana annual harvest resulting from digging activity in

Canal de Mira, Ria de Aveiro. Fisheries Research 76: 56-66.

Gambi, M.C., Castelli, A., Giangrande, A., Lanera, P., Prevedelli, D.,

and Vandini, R.Z. 1994. Polychaetes of commercial and applied

interest in Italy: an overview. Memoires du Museum national

d’Histoire naturelle 162: 593-603.

Glasby, C.J., and Hsieh, H-L. 2006. New species and new records of

the Perinereis nuntia species group(Nereididae: Polychaeta) from

Taiwan and other Indo-West Pacific shores. Zoological Studies 45:

553-577.

Glasby, C.J., and Hutchings, P.A. 2010. A new species of Marphysa

Quatrefages, 1865 (Polychaeta: Eunicida: Eunicidae) from

northern Australia and a review of similar taxa from the Indowest

Pacific, including the genus Nauphanta Kinberg, 1865. Zootaxa

2352: 29-45.

Glasby, C. J., Miura, T., Nishi, E., and Junardi. 2007. A new species of

Namalycastis (Polychaete: Nereididae: Namanereidinae) from the

shores of South-east Asia. The Beagle, Records of the Museums

and Art Galleries of the Northern Territory 23: 21-27.

Haska, C.L., Yarish, C., Kraemer, G., Blaschik, N., Whitlatch, R.,

Zhang, H., and Lin, S. 2012. Bait worm packaging as a potential

vector of invasive species. Biological invasions 14:481-493.

Hyashi, I. 2001. Recent progress in polychaete ecology 32. Useful and

harmful functions to human activities (2). Aquabiology 23: 617-

621.

Hutchings, P.A., and Karageorgopoulos, P. 2003. Designation of a

neotype of Marphysa sanguinea (Montague, 1813) and a

description of a new species of Marphysa from eastern Australia.

Hydrobiologia 496: 87-94.

Idris, I., and Arshad., A. 2013. Checklist of Polychaetous Annelids in

Malaysia with redescription of two commercially exploited species.

Asian Journal of Animal and Veterinary Advances 8: 409-436.

Imajima, M. 1967. Errant polychaetous annelids from Tsukumo Bay

and vicinity of Noto Peninsula, Japan. Bulletin of the National

Science Museum.Tokyo 10: 403-441.

Imajima, M. 1972. Review of the Annelid worms of the Family Nereidae

of Japan, with Descriptions of Five New Species or Subspecies.

Bulletin of the National Science Museum.Tokyo 15: 37-153.

Imajima, M., and Higuchi, M. 1975. Lumbrineridae of polychaetous

annelids from Japan, with descriptions of six new species. Bulletin

of the National Science Museum.Tokyo, A (Zool.) 1: 5-37.

Imajima, M. 1976. Serpulinae (Annelida, Polychaeta) from Japan. I.

The genus Hydroides. Bulletin of the National Science Museum.

Tokyo,Ser.A(Zool.) 2: 229-248.

Imajima, M. 1986. A new species of Onuphidae (Polychaeta) from

Enoshima, Central Japan. Bulletin of the National Science Museum.

Tokyo,Ser.A 12: 149-153.

Imajima, M. 1996. Annelida, Polychaeta. Biological Research

Corporation: Tokyo. 530pp.

Imajima, M. 2001. Annelida, Polychaeta II. Biological Research

Corporation: Tokyo. 542pp.

Imajima, M. 2007. Annelida, Polychaeta III. Biological Research

Corporation: Tokyo. 560pp.

Iwasaki, K. 2006. Human-mediated introduction of marine organisms

in Japan: a review. Pp. 104-112 in: Koike, F., Clout, M.N.,

Kawamichi, M., De Poorter, M., and Iwasaki, K. (eds). Assessment

and Control of Biological Invasion Risks. Shoukadoh Book Sellers:

Kyoto, and IUCN: Gland.

Izuka, A. 1908. On the Breeding habit and development of Nereis

japonica n.sp. Annotationes Zoologicce Japnonenses 6: 295-3053.

Izuka, A. 1912. The Errantiate Polychaeta of Japan. Journal of the

College of Science, Imperial University of Tokyo 30:1-262.

The Japanese association of benthology. 2012. Threatened Animals of

Japanese Tidal Flats: Red Data Book of Seashore Benthos. Tokai

University Press: Kanagawa. 285pp.

Khlebovich, V.V. 1996. Fauna of Russia and neighbouring countries.

Polychaetous annelids. Volume III. Polychaetes of the family

Nereididae of the Russian seas and the adjacent waters. Nauka

Publishing House: St.Petersburg. 224 pp.

Kilian, J.V., Klauda, R.J., Widman, S., Kashiwagi, M., Bourquin, R.,

Weglein, S., and Schuster, J. 2012. An assessment of a bait

industry and angler behavior as a vector of invasive species.

Biological Invasions 14: 1469-1481.

Lewis, C., and Karageorgopoulos, P. 2008. A new species of Marphysa

(Eunicidae) from the western Cape of South Africa. Journal of

marine Biological Association of the United Kingdom 88: 277-287.

Miura, T. 1977. Eunicid Polychaetous Annelids from Japan. II. La mer

(Bulletin de la Societe franco-japonaise d’oceanographie) 15: 61-81.

Nishi, E., and Kato, T. 2004. Introduced and globally invaded

polychaetous annelids. Japanese Journal of Benthology 59: 83-95.

Nishikawa, T. 1992. The Phylum Echiura. Pp. 306-309 In: Nishimura

S (Ed), Guide to Seashore Animals of Japan with Color Pictures

and Keys, vol. 1. Hoikusha, Osaka,

Okuda, S. 1933. Some polychaete annelids used as bait in the Seto

Inland Sea. Annotationes Zoologicce Japnonenses. 14:243-253.

Okuda, S. 1934. Anew species of errantiate polychaete, Marphysa tamurai

n sp. Proceedings of the Imperial Academy Tokyo 10: 521-523.

Okuda, S. 1938. Polychaetous Annelids from the Ise Sea. Zoological

Magazine 50:122-131.

Olive, P. J.W. 1994. Polychaeta as a world resource: a review of patterns

of exploitation as sea angling baits and the potential for aquaculture

based production. Memoires du Museum national d’Histoire

naturelle 162: 603-610.

Fishing bait worm supplies in Japan in relation to their physiological traits

287

Paxton, H. 1998. The Diopatra chiliensis confusion—redescription of

D. chiliensis (Polychaeta, Onuphidae) and implicated species.

Zoologica Scripta 27: 31-48.

Saito,H., Imabayashi,H., Kawai,K., and Cole,V., 2004. Time and

energetic costs of feeding on different sized prey by predatory

polychaete Halla okudai (Imajima). Journal of Experimental

Marine Biology and Ecology 311:223-232.

Saito, H., Niwa, N., Kawai, K., and Imabayashi, H. 2011. Current state

of aquatic animals sold as sport fishing bait in Western Japan.

Bulletin of the Hiroshima University Museum 3:45-57..

Sato, M., and Nakashima, A. 2003. A review of Asian Hediste species

complex (Nereididae, Polychaeta) with descriptions of two new

species and a redescription of Hediste japonica (Izuka, 1908).

Zoological Journal of the Linnean Society 137: 403-445.

Sato, M. 2010. Anthropogenic decline of peculiar fauna of estuarine

mudflats in Japan. Plankton Benthos research 5 (Suppl): 202-213.

Sato, M. 2013. Resurrection of the genus Nectoneanthes Imajima,

1972 (Nereididae: Polychaeta), with redescription of Nectoneanthes

oxypoda (Marenzeller, 1879) and description of a new species,

comparing them to Neanthes succinea (Leuckart, 1847). Journal

of Natural History 47: 1-50.

Sypitkowski, E., Bohlen, C., and Ambrose Jr, W.G. 2010. Estimating

the frequency and extent of bloodworm digging in Maine from

aerial photography. Fisheries Research 101: 87-93.

Tarn, M. 2013. Annelida, Polychaeta. Pp. 60-70 In: Suzuki, T., Kimura,

S., Kimura, T., Mori, K., and Taru, M. (eds). Benthos of the tidal

flat. Wetland International Japan. Tokyo.

Tsuji, T. 2007. Coastal gleaning and resource utlization of Sipunculus

robustus and Dolabella auricularia in Mactan Island, Philippines.

Tropical Ecology Letters 68:6-12.

Thorp, C.H., Pyne, S., and Weat, S.A. 1987. Hydroides ezoensis Okuda,

a fouling serpulid new to British coastal waters. Journal of Natural

History 21:863-877.

Uchida, H. 1992. Polychaeta. Pp. 310-373 In: Nishimura, S. (ed.).

Guide to Seashore Animals of Japan with Color Pictures and

Keys,vol. I. Hoikusha, Osaka.

Ushakova, O.O., and Sarantchova, O.L. 2004. The influence of salinity

on fertilization and larval development of Nereis virens

(Polychaeta, Nereidae) from the White Sea. Journal of

Experimental Marine Biology and Ecology 301:129-139.

Weigle, S.M., Smith, L.D., Carlton, J.M., and Pederson, J. 2005.

Assessing the risk of introducing exotic species via the live marine

species trade. Conservation Biology 19: 213-223.

Wu, B.L., Sun, R., and Yang, D. 1985. The Nereidae (polychaetous

annelids) of the Chinese coast. Springer-Verlag: Berlin. 234pp.

Yoshida, S. 1984. Studies on the aquaculture of a common polychaete,

Perinereis nuntia (Grube). Bulletin of the Osaka Prefectural

Fisheries Experimental Station 6: 1-63.

Memoirs of Museum Victoria 71:289-301 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Shallow-water polychaete assemblages in the northwestern Mediterranean Sea and

its possible use in the evaluation of good environmental state

RAFAEL SardA 1 *, LeTZY Serrano 1 ’ 2 , Celine LabRUNE 3 , JoAO Gil 1 (http://zoobank.org/urn:lsid:zoobank.org:author:A4107583-

591D-4719-AC59-320AD57D6E9E), DAVID MARCH 1,4 , JEAN MlCHEL AmOUROUX 3 , SERGI TABOADA 5 , PAULO BONIFACIO 6 AND

Antoine Gremare 6

1 Centre d’Estudis Avan§ats de Blanes, Consejo Superior de Investigaciones Cientfficas, Carrer d’acces a la Cala Sant

Francesc 14, Blanes 17300, Spain.

2 Autonomous University of Chiriquf. Department of Zoology. Urb. El Cabrero, David, Chiriquf 0427. Panama.

3 Universite Pierre et Marie Curie-Paris. CNRS UMR7621. Observatoire Oceanologique de Banyuls. Banyuls-sur-Mer

66650, France.

4 Instituto Mediterraneo de Estudios Avanzados, Consejo Superior de Investigaciones Cientfficas, Miquel Marques, 21.

Esporles 07190. Spain.

5 University of Barcelona, Department of Animal Biology, Av. Diagonal 643, Barcelona 08028, Spain.

6 Universite Bordeaux 1. UMR 5805 EPOC - OASU. Station Marine dArcachon. 2 Rue du Professeur Jolyet. Arcachon

33120. France.

* To whom correspondence and reprint requests should be addressed. Email: sarda@ceab.csic.es

Abstract Sarda, R., Serrano, L., Labrune, C., Gil, J., March, D., Amouroux, J.M., Taboada, S., Bonifacio, P. and Gremare, A. 2014.

Shallow-water polychaete assemblages in the northwestern Mediterranean Sea and its possible use in the evaluation of

good environmental state. Memoirs of Museum Victoria 71: 289-301.

Forty-four shore-normal transects along the Northwestern Mediterranean coast between the mouth of the Rhone

River (France) and Valencia City (Spain) were sampled during the REDIT-I (September 1998, [Rl]) and REDIT-II

(December 1999, [R2]) campaigns. Polychaete distribution patterns on shallow littoral fine sands (10 to 50 m water depths)

were analyzed at a regional scale. A total of 359 species of polychaetes were identified which represents 38% of all

polychaete species recorded in the western Mediterranean. Four main soft-bottom communities were identified from the

samples in the area: Littoral Fine Sands, Littoral Sandy Mud, Terrigenous Coastal Mud and Detritic Sand. Predominantly

sandy environments were characterized by Ditrupa arietina and Owenia fusiformis while Lumbrineris latreilli,

Hilbigneris gracilis and Sternaspis scutata were numerically dominant in muddy environments. Biological diversity

assessments at different temporal and spatial scales are required by the European Marine Strategy Framework Directive

(2008/56/EC) in accordance with criteria and methodological standards of Good Environmental Status (GEnS). Selected

indicators for descriptors are explored based on this mesoscale assessment.

Keywords Polychaeta. Northwestern Mediterranean, Marine Strategy Framework Directive, GEnS. Infauna.

Introduction

The assessment of biological diversity at different temporal and

spatial scales is a prerequisite when criteria and methodological

standards on Good Environmental Status of marine waters

(GEnS, following Mee et al., 2008) need to be evaluated

following the Marine Strategy Framework Directive (MSFD)

(2008/56/EC) (European Commission, 2008). For these

assessments, ecosystem integrity as well as particular pressures

requiring management responses, need to be understood across

biogeographic regions (Cochrane et al., 2010). Following the

recommendations of the MSFD, a suitable set of European

ecological assessment areas should be defined to analyse habitat

290

R. Sarda, L. Serrano, C. Labrune, J. Gil, D. March, J.M. Amouroux, S. Taboada, P. Bonifacio &A. Gremare

and community distributions and condition. Initial assessments

have been recently carried out by member states. This knowledge

is basic for cooperation in planning future coastal and marine

conservation and uses, as well as for further implementation of

the MSFD. Although indicators of GEnS are required by the

Directive at national, ecoregional or sub-regional inside

subnational economic exclusive zone scales, its application at

other geographical spatial scales should be also possible and

even advisable in marine management (Sarda et al., in press).

During 1998-99, cooperation between French and Spanish

scientific institutions was initiated to assess the biological

diversity from shallow soft-bottom environments in the Gulf

of Lions and the northern Mediterranean Spanish coast (10 to

50 m water depths). The main aim of the study was to describe

the distributions of benthic species present in the region as

well as the range of its existing benthic communities. This

region comprises around 2000 km of coastal fringe and can be

considered as a suitable area for assessment and implementation

of the MSFD because of its size, social and ecological

importance and existing scientific knowledge.

The Gulf of Lions was the departure point for the pioneer

biological description of soft-bottom communities in the

Mediterranean (Peres and Picard, 1964; Picard, 1965; Guille,

1970, 1971; Masse, 1972; Bellan and Bourcier, 1984). Some

decades later, the distribution, composition and ecological

quality of the benthic macroinfauna in the Gulf of Lions were

reassessed by Gremare et al., (1998a; 1998b), and more recently

by Labrune et al., (2006a, 2006b, 2007, 2008). The unification

of the terminology for the description of the soft-bottom

communities observed in the Gulf of Lions by these authors

was one of the main results of the REDIT-I Program. Three

main communities corresponding with historical community

classification data (Peres and Picard, 1964; Picard, 1965;

Guille, 1970) were detected: Littoral Fine Sands (LFS), Littoral

Sandy Mud (LSM), and Terrigenous Coastal Mud (TCM).

Polychaetes are one of the dominant and characteristic

groups of soft-bottom communities (Knox, 1977; Coll et al.,

2010). It has been shown that, in most cases, polychaetes

constitute a good surrogate for describing the functioning of

the entire benthic community (Giangrande et al., 2005) and

aid assessment of environmental condition. The numerical

dominance, multiple life history traits and relatively large

knowledge base about polychaetes call for inclusion as GEnS

benthic indicators and offer a means to understand the

mechanisms governing community dynamics.

In Europe, the recently introduced Marine Strategy

Framework Directive (MSFD) seeks to implement the ecosystem

approach to marine management to deliver protection of marine

ecosystems while at the same time recognising the needs of

society to benefit from marine resources allowing its sustainable

use. The main objective of MSFD is to achieve GEnS for its

marine waters by 2020 and the resources upon which marine-

related economic and social activities depend through an

integrated ecosystem-based approach. The approach promotes a

holistic view on management by ensuring sustainable use of the

seas; providing safe, clean, healthy and productive marine

waters (Browman et al., 2004; Borja et al., 2011). The MSFD

establishes European Marine Regions on the basis of

geographical and environmental criteria. Each member state, in

cooperation with other member states and non-EU countries

within a marine region, are required to develop strategies for

their marine waters. The marine strategies to be developed by

each member state must contain a detailed assessment of the

state of the environment, a definition of GEnS at regional level

and the establishment of clear environmental targets and

monitoring programs to reach and maintain such GEnS.

In this paper we introduce new data from the North¬

western Mediterranean coast of Spain to the previous analysed

Gulf of Lions region (Labrune et al., 2006a, 2006b, 2007,

2008). Using all this data, the aim of the present study is to

describe the distributional range of soft-bottom communities

and their associated polychaete species while addressing the

suitability of using particular indicators derived from this

analysis for the MSFD, especially for Biodiversity descriptor

of GEnS but also to explore the suitability for further

descriptors of the Directive.

Material and methods

Sampling and laboratory procedures

Benthic samples were obtained at 44 transects perpendicular

to the shore, extending from the mouth of the Rhone River

(France) (43°19'55"N, 4°44'56"E at the 10 m station) south to

Valencia city (Spain) (39°28'23"N, 0°18'30"E at the 10 m

station) (Figure 1). At each transect three macroinfaunal

samples were taken from each of five stations at 10, 20, 30, 40

and 50 m water depths. An additional sample was taken for

sedimentological analyses. Samples were collected during the

REDIT-I and REDIT-II oceanographic campaigns. The

REDIT-I campaign (September 1998) was carried out from the

mouth of the Rhone River to the French-Spanish border on

board the N.O. Georges Petit. The REDIT-II campaign

(December 1999) was carried out from the French-Spanish

border to the vicinity of the city of Valencia on board the N.O.

Tethys. A total of 220 stations were sampled. Sampling failed

at 20 stations (10 m samples at RIO, RIP, R2C, R2D, R2F,

R2I, and R2S; 20 m samples at R2I and R2S; 30 m samples at

R2I; 40 m samples at RIO, RIP, R1Q, R1R and R1S; and 50 m

samples at RIO, RIP, R1Q, R1R and R1S).

Samples were collected using a 0.1 m 2 van Veen grab and

sieved on board using a 1 mm mesh. The mesh residue was

fixed in 5% formaldehyde buffered in seawater. As described in

previous works (Labrune et al., 2006a, 2006b, 2007, 2008),

this mesh was selected to enable a comparison with previous

works carried out in the region. Grabs with penetration lower

than 15 cm were rejected and all samples (with none, few or

significant algal or detrital material) were treated in the same

way. In the laboratory, samples were sorted under a dissecting

microscope and all faunal groups separated. Polychaetes were

later identified to the lowest practical taxonomic level and

counted. Gil (2011) was used as reference work for identification.

Unidentified species were only considered when they were

sufficiently complete, mature and distinct from identified

species. Data analyses were carried out on data pooled over the

three replicated sampling units (Ellingsen, 2001). Individual

polychaete species biomass was determined as wet weight

Polychaete assemblages in the northwestern Mediterranean

291

Figure 1. (Upper left graph) Map of the studied zone. Blue circles represent sampled stations from the Gulf of Lions and red circles from the

Northern Mediterranean Spanish coast. (Lower graph) Schematic diagram showing the distribution of the four studied communities in the

mesoscale studied area

(avoiding presence of water outside the animal when weighting

it) to avoid destruction of the collected material except for two

nominal species Ditrupa arietina (O.F. Muller, 1776) and

Owenia jusiformis Delle Chiaje, 1844. For these two species

we used regressions of width vs. dry weight to convert width

measurements to biomass following Sarda et al. (1999).

D. arietina : DW n = 0.4522 ( d n ) 3 992

O. jusiformis: DW 0/ = 0.8434 (wt Qf ) 2177

where DW Da and DW^ are dry weights of both species in mg

and (d Da ) is diameter aperture of the D. arietina tube, in mm,

and (wt 0/ ) is the maximum width of the tube of O. fusiformis

in mm. For comparative purposes biomass data given in this

paper is expressed in dry weight using the conversion factor of

dry weight = 17.6% of wet weight calculated for polychaete

species (Rumohr et al., 1987).

Bionomic data are given as means for each measured

parameter per station (biological: abundance, biomass,

richness, diversity; sedimentological: D50, silt/clay%) for each

identified assemblage. Basic sediment texture features that

might be correlated with assemblages were derived from

granulometric analysis conducted on fresh sediment using a

Malvern® Mastersizer 2000 laser microgranulometer.

Data analysis and cartographical work

Analysis of species data for the classification of the polychaete

assemblages was performed on reduced sets of species in

order to limit noise introduced by less common species and its

associated distorting effects in the analytical work. Species

present in less than 10% of the obtained samples were

excluded; rare species usually have little meaning for the

description of benthic communities and their omission does

not affect community interpretation.

292

R. Sarda, L. Serrano, C. Labrune, J. Gil, D. March, J.M. Amouroux, S. Taboada, P. Bonifacio &A. Gremare

Table-1. List of the eleven qualitative descriptors of Good Environmental Status (GEnS) according to the Marine Strategy Framework Directive.

In parentheses is indicated the task group study for the introduction of indicators

1 .

Biological diversitv is maintained. The qualitv and occurrence of habitats and the distribution and abundance of

species are in line with prevailing physiographic, geographic and climatic conditions. (Cochrane et al., 2010)

Non-indigenous species introduced bv human activities are at levels that do not adverselv alter the ecosvstems. (Olenin

etal., 2010).

Populations of all commerciallv exploited fish and shellfish are within safe biological limits, exhibiting a population

age and size distribution that is indicative of a healthy stock. (Piet et al., 2010).

All elements of the marine food webs, to the extent that thev are known, occur at normal abundance and diversitv and

levels capable of ensuring the long-term abundance of the species and the retention of their full reproductive capacity.

(Rogers et al., 2010).

Human-induced eutrophication is minimised, especiallv adverse effects thereof, such as losses in biodiversitv.

ecosystem degradation, harmful algae blooms and oxygen deficiency in bottom waters. (Ferreira et al., 2010).

Sea-floor integrity is at a level that ensures that the structure and functions of the ecosvstems are safeguarded and

benthic ecosystems, in particular, are not adversely affected. (Rice et al., 2010).

Permanent alteration of hvdrographical conditions does not adverselv affect marine ecosvstems.

Concentrations of contaminants are at levels not giving rise to pollution effects. (Law et al.. 2010).

Contaminants in fish and other seafood for human consumption do not exceed levels established bv Community

legislation or other relevant standards. (Swartenbroux et al., 2010).

10.

Properties and quantities of marine litter do not cause harm to the coastal and marine environment. (Galgani et al..

2010)

11.

Introduction of energy, including underwater noise, is at levels that do not adverselv affect the marine environment.

(Tasker et al., 2010).

In this paper we are presenting and using the two obtained

sub-regional clusters (France and Spain) following the initial

mandate of the MSFD to work on subnational economic exclusive

zone regional scales. Multivariate analyses were performed in

order to elucidate similarities. Polychaete assemblages were

constructed from cluster analysis corresponding to similarities

of approximately 25% (Bray Curtis similarity index, average

link grouping). Densities were square-root transformed to limit

the influence of the most dominant taxa (Clarke and Warwick,

1994). The taxa most responsible for similarities within each

cluster of stations or for dissimilarities between clusters of

stations were identified using the SIMPER procedure. The

Shannon-Wiener information index (H', log e) was used as a

measure of diversity. All multivariate analyses were carried out

using the Primer® 6 software package (version 6.1.13) (Clarke

and Gorley, 2006). The Benthic Quality Index (BQI) (Rosenberg

et al., 2004) was computed as an estimate of integrity.

Benthic production estimates were based on biomass data.

In order to rank the most important polychaete species

contributing to the productivity of the region, we estimated

secondary production using the allometric equation developed

by Brey (1990):

P = (B/A)°- 73 *A

where A is density, B is biomass, B/A is mean individual biomass

and 0.73 is the average exponent of the regression of annual

production on body size for macrobenthic invertebrates. This

indirect method is based on the use of empirical relationships and

yields the secondary production of all species within a community.

The geographical extent of the five identified communities

was determined. The study area was defined as the union of a

convex hull polygon containing all samples and the relief area

of bathymetric data (Catalano-Balearic Sea - Bathymetric

chart, 2005, www.icm.csic.es/geo/gma/MCB) from 5 to 55 m

contours. The study area was divided into a regular grid of 500

x 500 m. The presence or absence of each community was

identified at each station. Inverse distance weighting (IDW,

Cressie 1993) was used to interpolate the presence or absence

of each community at non-sampled grid cells and estimate

community areal coverage. All data were re-projected to the

projection system ETRS89 LAEA. Data analysis was conducted

using the ‘idw’ function (ie., setting an inverse distance

weighting power = 20) from the ‘gstat’ package (Pebesma,

2004) and the R software (http://www.r-project.org).

Utility of data as indicators for qualitative descriptors of GEnS

The MSFD (EC, 2008) describes GEnS based on eleven

qualitative descriptors and indicators selected from those

published by each descriptor task force (Table 1). Recently,

both France and Spain presented their initial assessment for

the Mediterranean and the Levantine-Balearic regions. Here,

we assess the suitability of the use of the REDIT campaigns

data in relation with the qualitative descriptor of GEnS to

contribute to the improvement of the knowledge of these areas.

Polychaete assemblages in the northwestern Mediterranean

293

Table 2. Mean benthic parameters for the different assemblages identified in the REDIT Campaigns. All values are computed as the mean of each

considered parameter (D50, %silt/clay, abundance, biomass, richness, and diversity) per station for all the stations included in the same group

except for total richness where the accumulated number of species found in all stations of the group is given. D50 computes the mean grain size

for each identified assemblage. (Da)* LFS Spanish assemblage with high numbers of Ditrupa arietina.

Assemblages

LFS

LSM

TCM

France

Spain

Spain (Da)*

France

Spain

France

Spain

Granulometry

D50 (urn)

145.8

126.1

299.8

86.5

99.6

21.2

25.1

355.0

Silt/Clay content(%)

8.7

5.8

11.7

29.5

56.2

77.3

18.9

Biological parameters

Abundance (ind sq m)

1074

646

1006

473

719

179

468

896

Biomass (mg dw sq m)

1031

385

979

112

1030

184

375

372

Total Richness (#)

105

160

154

249

138

123

Average Richness (#)

Diversity (H’)

1.58

1.87

2.58

1.95

2.66

2.31

2.27

2.95

Indicator used in the assessment of some of the Good Environmental Status descriptors using data for the REDIT mesoscale

assessment (sq m equals to ind nr 2 ).

Results

Assemblage classification and key species

About 35,000 polychaete and sipunculan specimens were

identified representing 359 species. More species were found

in the Spanish region (325 species) than the French region (175

species), but the area covered by the Spanish campaign was

also larger. In the case of polychaetes they constitute 38% of

all known Western Mediterranean species (Gil, 2011). In the

French region, three main polychaete assemblages were

identified based on a 25% similarity level (fig. 2, upper graph).

In the Spanish region, based on the same 25% similarity level,

two assemblages were identified, both of them with clear sub¬

clusters (fig. 2, lower graph). The distributions of these

assemblages were related to depth and sedimentological

parameters. Mean sediment grain size decreased with depth

and increasing percentage of silt and clay; only deep stations

off rocky shores in the Costa Brava showed a different pattern,

forming detritic sand bottoms. Other variables such as

abundance, biomass, and diversity are highly correlated to the

presence of two, shallow-dwelling species located in sandy

environments Ditrupa arietina and Owenia fusiformis.

Sedimentary and biological characteristics of the proposed

assemblages are presented in Table 2.

Three main clusters were identified in the French region

(fig. 2, upper graph). Cluster I was comprised of 10 and 20 m

stations associated with Littoral Fine Sands (LFS sensu

Labrune et al., 2007). Cluster II grouped 30 m stations with a

higher content of fines (LSM sensu Labrune et al., 2007) and

could be separated into two sub-clusters based on geographical

considerations (Labrune et al., 2007). Finally, Cluster III

gathered 40 and 50 m stations from muddy sediments (TCM

sensu Labrune et al., 2007).

In the Spanish region two main clusters were delineated;

Cluster I consisted of stations associated with Littoral Fine

Sands (LFS), but could be further divided into two sub-clusters

(la and lb) due to the presence or absence of the polychaete D.

arietina respectively. In the sub-cluster lb, a separate set of

stations of the LSM community can be seen with the common

presence of D. arietina in the samples. Cluster II included the

rest of the stations with two sub-clusters: sub-cluster Ha

incorporated most of the 50 m deep stations on muddy

sediments (TCM), and sub-cluster lib was composed of a

more heterogeneous set of samples, both in depth (with a lower

percentage of fines) and in species composition, and were

more similar to the LFS assemblage. One particular group of

stations within sub-cluster lib (with asterisk in fig. 2, lower

graph) was also differentiated by deeper stations, but with

sedimentological composition of medium sands and a smaller

(18.9%) percentage of fines. These stations could not be

incorporated into any of the previously named assemblages

and were assigned to a Detritic Sand (DS) community.

The most abundant species for each of the assemblages are

shown in Table 3. The density of the first six species accounted

for 66% of the total average density in the Littoral Fine Sands

(LFS) assemblages, 53.9% in the Littoral Sandy Mud (LSM)

assemblages, 54.7% in the Terrigenous Coastal Mud (TCM)

assemblages, and 53.7% in the Detritic Sand environment

(DS) off Costa Brava.

LFS assemblages were characterized by high densities (79%

in the case of the French region) of two species, D. arietina and

O. fusiformis. The presence of D. arietina is the determining

factor that separated different assemblages in this community

(Table 3). Both species were more abundant in the Gulf of Lions

than in the northern Mediterranean Spanish coast resulting in a

more homogeneous composition in this area.

Similarity (%) Similarity (%)

294

R. Sarda, L. Serrano, C. Labrune, J. Gil, D. March, J.M. Amouroux, S. Taboada, P. Bonifacio &A. Gremare

Cluster I Cluster \la Cluster Mb Cluster III

Figure 2. Cluster analysis of polychaete fauna for the Gulf of Lions region (France; upper graph) and the Northern Mediterranean Spanish coast

(Spain; lower graph). Asterisk observed in lower graph indicates stations associated with the Detritic Sand Community (DS)

Polychaete assemblages in the northwestern Mediterranean

295

Table 3. Six most dominant species of each assemblage identified during the present study and its average density (ind m 2 ).

LITTORAL FINE SAND Community (LFS)

FRANCE

SPAIN

LFS with Ditrupa

LFS without Ditrupa

Ditrupa arietina

616

Ditrupa arietina

302

Owenia jusiformis

129

Owenia jusiformis

233

Eunereis longissima

Spiochaetopterus

costarum

Aponuphis bilineata

Chone duneri

Mediomastus fragilis

Notomastus latericeus

Scoletoma impatiens

Galathowenia oculata

Pseudopolydora

paucibranchiata

Lumbrineris latreilli

Protodorvillea

kefersteini

Galathowenia oculata

LITTORAL SANDY MUD Community (LSM)

FRANCE

SPAIN

LSM west Cap Agde

LSM east Cap Agde

LSM

Lumbrineris latreilli

171

Lumbrineris latreilli

Monticellina

heterochaeta

Ditrupa arietina

100

Nephtys hombergii

Hilbigneris gracilis

Goniada emerita

Mediomastus fragilis

Sternaspis scutata

Scoletoma impatiens

Glycera unicornis

Aponuphis bilineata

Hilbigneris gracilis

Notomastus latericeus

Laonice bahusiensis

Scoletoma impatiens

Lumbrineris latreilli

TERRIGENOUS COASTAL MUD Community (TCM) and DETRITIC SAND Community (DS)

FRANCE

SPAIN

TCM

Lumbrineris latreilli

Hilbigneris gracilis

Aspidosiphon muelleri

220

Sternaspis scutata

Monticellina

heterochaeta

Sphaerosyllis taylori

Heteromastus filiformis

Prionospio fallax

Pisione remota

Nephtys incisa

Sternaspis scutata

Kefersteinia cirrata

Abyssoninoe hibernica

Cirrophorus branchiatus

Ditrupa arietina

Glycera unicornis

Galathowenia oculata

Heteromastus filiformis

LSM assemblages were the most diverse group. In the

French region, sub group la was identified north of Cap ‘Agde

(see Labrune et al., 2007 for geographical reference) with lb

south. In both cases Lumbrineris latreilli (Audouin & Milne-

Edwards, 1833) was the most abundant species, but the

absences (north) or presence (south) of D. arietina was the

main reason for this separation (Table-3). In the Spanish

region, D. arietina was rare, but Hilbigneris gracilis (Ehlers,

1868) and Monticellina heterochaeta Laubier, 1961 were

numerically dominant.

TCM assemblages in the French region were clearly

differentiated from the other two communities both in

sedimentological and composition parameters. This community

was typically bounded by the 30 and 40 m isobaths. Lumbrineris

296

R. Sarda, L. Serrano, C. Labrune, J. Gil, D. March, J.M. Amouroux, S. Taboada, P. Bonifacio &A. Gremare

latreilli and Sternaspis scutata (Ranzani, 1817) were the

numerically dominant species. In the Spanish region, these

assemblages seem closer to the LSM ones and were characteristic

of 50 m and deeper stations. Hilbigneris gracilis and M.

heterochaeta were abundant and common species, but other

species such as Prionospio fallax Soderstrom, 1920 and S.

scutata also reached high densities (Table 3). Off the Costa

Brava, the DS assemblage was likely a result of strong currents

affecting this area through mechanisms also responsible for the

different sedimentary characteristics (Duran et al., 2014). These

sediments were characterized by the medium-sized sipunculans

(20 mm long average adult size) Aspidosiphon muelleri Diesing,

1851 which inhabits empty shells of prosobranchs and D.

arietina, as well as other small taxa like Sphaerosyllis taylori

Perkins, 1981 and Pisione remota (Southern, 1914) which, due

to their average size, surely would have been much more

abundant if a smaller mesh size was used.

Potential Good Environmental Status (GEnS)

Five of the eleven descriptors associated with the evaluation of

GEnS can directly use data obtained in the REDIT assessment:

biodiversity, non-indigenous species, food webs,

eutrophication, and seafloor integrity. Our assessment follows

these five descriptors. These data also provide regional-scale

context within which future studies can evaluate these five

descriptors as well as others occurring at different scales (e.g.

ecological mechanisms affecting harvests, trophic targets for

contamination detection).

Biodiversity - This descriptor has the highest number of

potential indicators. The descriptor can be simultaneously

assessed at four levels of biophysical organization: ecosystem,

landscape, habitat/community, and species states. For the latter

two we can directly get indicators for this region from the

present study. At the habitat/community level dominant,

special, and protected habitats can be identified. One of the

dominant habitats in the EUNIS classification (http://eunis.eea.

europa.eu/habitats-code-browser.jsp?expand=A#level_A) is

Shallow Sublittoral Sediments; the four communities identified

in the present work (with their assemblages), LFS, LSM, TCM

and DS, represent shallow sublittoral sediments. The areal and

geographic extents of these communities are shown in Table 4.

At the species level, based on its dominance, five species can be

considered characteristic of these communities: D. arietina

and O. fusiformis in shallow sandy environments, and L.

latreilli, H. gracilis and S. scutata in muddy environments.

Non-indigenous species - Non-indigenous species,

including invasive alien species, have the potential to alter

ecosystems (Zenetos et al., 2010) and consequently affect

GEnS. The number of such species as well as their range,

abundance and impacts on autochthonous communities need

to be assessed in the evaluation of this descriptor. Seven

polychaete species have been identified as non-indigenous

species for the Levantine-Balearic sub-region (Alemany, IEO

personal communication). No data are available for the French

region. None of the species found in the REDIT campaigns are

on this list. The number of new entrants per time unit (i.e.

year) is proposed as a numerical indicator for this descriptor.

In our case, this number would therefore be 0.

Marine food webs - This descriptor addresses functional

aspects of marine food webs, especially the rates of energy

transfer within the system, levels of productivity among key

components and ecosystem structure in terms of size and

abundance of individuals. Although the descriptor is intended

to be used for the entire marine food web and addressed from

analysis of several trophic levels, estimates of productivity and

size at individual levels are needed and may also serve as local

proxies. These two indicators are showed in Table 4 for the key

characteristic species. The main trophic composition of the

three basic communities analyzed can be related to the

dominance of the filter feeder D. arietina in the LFS community,

a much more diverse trophic environment where filter feeders,

carnivores and deposit-feeding species are more or less equally

distributed in the LSM community, and the biomass dominance

of the deposit feeder S. scutata in the TCM community.

Eutrophication - Measures of sensitivity to eutrophication

can be observed in different ecosystem compartments (e.g.

nutrients, chlorophyll, physico-chemical states). Among

benthic habitats the relationship between organic enrichment

and benthic productivity has been well documented and

populations of pioneering species are often used as positive or

negative indicators of excessive organic enrichment. The

abundance and productivity of Capitella capitata (Fabricius,

1780) and closely-related taxa have been used as clear

indicators of organic enrichment and eutrophication in the

marine environment for many years (see Serrano et al., 2011

for an example of this impact in the studied area). Although C.

capitata was found in our samples, its average density did not

suggest any ‘hotspots’ of potential enrichment, though

sampling density did not provide the spatial resolution required

to state that eutrophication on the scale of less than tens of

kilometers did not exist in the study area. A second species,

normally cited as indicator of organic enrichment and known

from the region, Malacoceros fuliginosus (Claparede, 1869),

did not appear in our samples. It is likely that other species

encountered in the present work can be included in the list of

indicators, but given the limits of current knowledge, denser

sampling along known organic gradients within each

biogeographic region is required to identify likely candidates.

Sea floor integrity- The basic indicator of this descriptor

gives information on the total area of seabed significantly

affected by human activities. Changes in functional diversity

and relative abundance of life traits associated with

opportunistic and sensitive species can provide estimates of

integrity by using different metrics compiled over space and

time. The BQI index was used to assess the benthic ecological

status of the environment. Table 4 shows the value of this index

for the assemblages located in the French part of the study.

Discussion

Among the benthic environments analyzed from the mouth of

the Rhone River (France) to Valencia City (Spain), four

different polychaete communities with different species and

sedimentary characteristics were distinguished, namely the

Littoral Fine Sand (LFS), the Littoral Sandy Mud (LSM), the

Terrigenous Coastal Mud (TCM), and the Detritic Sand (DS)

Polychaete assemblages in the northwestern Mediterranean

297

Table 4. Indicators used in the assessment of some of the Good Environmental Status descriptors using data for the REDIT mesoscale assessment.

Descriptor 1

LFS

LSM

TCM

Habitat extension (ha* 103)

200.95

271.30

228.70

14.25

Gulf of Lions (France) Northern Mediterranean Spanish coast (Spain)

Descriptor 1

LFS

LSM

TCM

Descriptor 1

LFS

LSM

TCM

Species State

Ditrupa arietina

Abundance (ind sq m)

616

Abundance (ind sq m)

151

Biomass (mg dw sq m)

962.6

4.6

5.1

Biomass (mg dw sq m)

351.7

44.4

1.4

113.0

Oweniafusiformis

Owenia fusiformis

Abundance (ind sq m)

233

Abundance (ind sq m)

Biomass (mg dw sq m)

106.9

0.1

Biomass (mg dw sq m)

125.5

1.2

0.5

2.2

Lumbrineris latreilli

Abundance (ind sq m)

138

Abundance (ind sq m)

Biomass (mg dw sq m)

18.9

141.0

44.3

Biomass (mg dw sq m)

5.3

15.0

4.2

9.0

Hilbigineris gracilis

Hilbigneris gracilis

Abundance (ind sq m)

Biomass (mg dw sq m)

8.5

Biomass (mg dw sq m)

0.7

26.1

27.3

0.6

Sternaspis scutata

Abundance (ind sq m)

Biomass (mg dw sq m)

23.3

271.9

Biomass (mg dw sq m)

59.8

241.5

Descriptor 2

LFS

LSM

TCM

Descriptor 2

LFS

LSM

TCM

Non-indigenous species (Nie)

Number of Nie (#)

New entrans Nie y-1

Descriptor 4

LFS

LSM

TCM

Descriptor 4

LFS

LSM

TCM

Species State

Ditrupa arietina

Productivity (mg dw sq m)

853.3

9.2

4.7

Productivity (mg dw sq m)

279.9

33.1

1.3

87.1

Average biom. (mg dw sq m)

1.56

0.08

1.28

Average biom. (mg dw sq m)

2.33

2.96

1.4

2.63

Owenia fusiformis

Productivity (mg dw sq m)

131.9

0.2

Productivity (mg dw sq m)

106.8

1.4

0.6

3.1

Average biom. (mg dw sq m)

0,46

0.10

Average biom. (mg dw sq m)

1.82

0.60

0.50

0.28

Lumbrineris latreilli

Productivity (mg dw sq m)

19.4

140.2

43.4

Productivity (mg dw sq m)

6.6

17.0

5.3

9.0

Average biom. (mg dw sq m)

0.90

1.02

1.08

Average biom. (mg dw sq m)

0.44

0.63

0.42

1.00

Hilbigneris gracilis

Productivity (mg dw sq m)

10.4

0.7

Productivity (mg dw sq m)

0.9

34.1

37.3

1.5

Average biom. (mg dw sq m)

0.47

0.10

Average biom. (mg dw sq m)

0.35

0.37

0.31

0.04

Sternaspis scutata

Productivity (mg dw sq m)

12.0

142.7

Productivity (mg dw sq m)

49.6

136.2

Average biom. (mg dw sq m)

11.65

10.88

Average biom. (mg dw sq m)

1.99

8.33

Descriptor 5

LFS

LSM

TCM

Descriptor 5

LFS

LSM

TCM

Species State

Capitella spp.

Abundance (ind sq m)

Descriptor 6

LFS

LSM

TCM

Descriptor 6

LFS

LSM

TCM

BQI index

11.70

17.07

19.84

BQI index

Indicator used in the assessment of some of the Good Environmental Status descriptors using data for the REDIT mesoscale

assessment (sq m equals to ind nr 2 ).

298

R. Sarda, L. Serrano, C. Labrune, J. Gil, D. March, J.M. Amouroux, S. Taboada, P. Bonifacio &A. Gremare

communities, following Labrune et al. (2007) classification.

Shallow sandy environments of the Northwestern

Mediterranean are mostly occupied by the LFS community.

Near rocky shores such as the Cap de Creus (Sarda et al., 2012)

or highly dynamic deltas such as the Tordera River (Sarda et

al., 1999), the LFS community can be replaced by the Littoral

Coarse Sand community (LCS). Between shallow sandy and

deeper muddy environments, we can find the LSM community,

in the past defined as a transition facies (Guille, 1971;

Desbruyeres et al, 1972-73). This community, normally

characterized by sand grains with fine content not higher than

50%, forms a narrow fringe in the Gulf of Lions but is broader

and occupies larger areas in the Northern Mediterranean

Spanish coast. Where benthic environments are clearly muddy

with a high percentage of silt and clay, the species composition

is dominated by TCM community. However, as shown in

locations off the Costa Brava rocky shores, sometimes

oceanographic conditions make sediments change basic

profiles and assemblage differences decoupled from

bathymetric contours.

Sandy environments at these shallower habitats were easily

distinguished by the disproportionate presence of D. arietina

and O. fusiformis. The presence of D. arietina was higher in

the French region (more than half of the density of the

assemblage), and the northern part of the Catalan coast of

Spain (one third). Southwards on the Spanish Mediterranean

coast the presence of D. arietina decreased. Peres and Picard

(1957) pointed out that D. arietina was associated with

unstable soft sediments and Desbruyeres et al., (1972-73)

considered this species within the Nephtys hombergii Savigny

in Lamarck, 1818 community, in which records of D. arietina

were not so frequent and densities small. Gremare et al.,

(1998a, 1998b) and Labrune et al. (2007) detected a drastic

increase of D. arietina populations over recent decades,

attributing these high densities to an unidentified response to

environmental factors. Sarda et al, (2000) also reported sharp

increases of D. arietina and O. fusiformis after dredging

activities on the Catalonian coast. Today, the dominance of the

passive filter-feeder D. arietina in shallow sandy environments

(from 10 to 30 m) in the Gulf of Lions is one of the most

obvious components of these benthic habitats. Whether this

dominance is related to sediment disturbance, to changes in

the sediment release from rivers, to a cascade effect due to

other species reductions, or to other unidentified cause or

causes, it is worth considering its study and should represent

an important aspect of MSFD work. Ditrupa arietina was also

present in important numbers in the LSM community of the

French region.

Owenia fusiformis, L. latreilli and N. hombergii also

deserve comment in these sandy environments. Owenia

fusiformis populations seem to be more consistent and

frequently encountered in this region. Guille (1970) and

Desbruyeres et al., (1972-73) recorded this species widely in

the Northwestern Mediterranean (from well-sorted fine sand

in 5 m deep waters to detritic sediments 163 m deep). Owenia

fusiformis was the second most abundant species on the whole

coast in these sediments. Its range covered the entire study

area. While O. fusiformis was generally restricted to 10 and 20

m stations, L. latreilli was the most abundant species at the

LSM community in the French region coexisting with

populations of another important species H. gracilis, in the

Spanish region. Desbruyeres et al. (1972-73) reported L.

latreilli as the second most abundant species after N.

hombergii, however, the presence of the latter species is

restricted today and its presence seems to be lower than in past

decades. In specific places (e.g. off Barcelona) large alterations

to the pattern described in this work have been described and

may be a response to organic enrichment (Ros and Cardell,

1992; Cardell et al., 1999; Serrano et al., 2011).

Muddy environments were common at the deepest stations.

Nearly all 40 and 50 m stations of the Gulf of Lions and 50 m

stations of the Spanish coast were described as mud and

grouped in the analysis. In this case, L. latreilli in the French

region and H. gracilis in the Spanish region as well as S.

scutata can be identified as the most characteristic species

following previously identified distributions (Desbruyeres et

al., 72-73; Galil and Lewinsohn, 1981; Gambi and Giangrande,

1986; Salen-Picard et al., 2003). The exceptions were habitats

located off the Costa Brava region where, probably due to

stronger currents, mud disappeared and detritic sand

environments prevailed.

The MSFD is to be implemented at sub-national economic

exclusive zone regional scales. In these regions the essential

characteristics and present environmental status of these

waters, together with corresponding pressures and impacts,

need to be assessed and strategies developed to define GEnS at

a regional level. These assessments may also be used at other

geographical scales (e.g. administratively defined regions,

marine protected zones, tourist destination areas, offshore

metropolitan regions). In all these cases, the concept of GEnS

in social and ecological assessments can be also applied. Borja

et al. (2011) performed an assessment of the environmental

status of the Spanish Basque Country following MSFD

requirements, and have proposed a method of recombining the

eleven descriptors within the MSFD to be applied at a different

scale. At whatever assessment scale one works on these issues,

the identification, mapping, and consistent evaluation of

physical and biological characteristics of benthic habitat types

is essential.

The use of the MSFD principles at other scales than the

one mentioned in the Directive could be advisable. In any

case, the description of GEnS and the interpretation of “good”

are key to implementation and relates to human values and

worldviews (Mee et al., 2008). Our REDIT work does not

pretend to be considered as a kind of standard/reference

position for the region in order to set objectives for GEnS, but

a “status quo” of its present situation concerning shallow soft-

bottom benthic habitats. The definition of “good” for the

different descriptors should be determined by those officers

managing the region under which the principles of the MSFD

would be applied. If GEnS need to be achieved at whatever

regional scale an operational definition of GEnS with agreed

targets and approaches for integrating assessment results

should be approved (Borja et al., 2013).

The mesoscale assessment carried out in the REDIT

campaigns contributed to the determination of the distributional

Polychaete assemblages in the northwestern Mediterranean

299

range and extension of the three most widespread communities

in the Mediterranean exclusive economic zones of the Gulf of

Lions and Northern Mediterranean coast of Spain. Abundance

and biomass data for dominant benthic macroinfaunal species

are relevant indicators for application of the MSFD descriptor

1, biodiversity and by evaluating productivity and average size,

biomass, descriptor 4. The absence of non-indigenous

polychaete species within an extensive sampling effort has

important implications for descriptor 2, invasive species.

Although the Mediterranean is, globally speaking, an

oligotrophic sea, metropolitan areas and human activities can

result in localised eutrophication. This was the case off

Barcelona where several studies (Ros and Cardell, 1992;

Cardell et ah, 1999; Serrano et al., 2011) illustrated an instance

of enrichment and eutrophication; however, eutrophication is

not a regional problem based on the assessment carried out.

Finally, applying metrics such as the BQI in the assessment of

seafloor integrity resulted in a “moderate” (LFS, LSM) or

“good” (TCM) state for this benthic environment in the French

case; however, this trend was mostly due to a single species ( D.

arietina ), the community dynamics of which requires

investigation to determine its mechanisms of proliferation.

The distributional range and key characteristics of the

soft-bottom communities in the Gulf of Lions and the Northern

Mediterranean Spanish coast allowed us to consider its

potential use in the assessment of GEnS for the region. Besides

individual data for key characteristic species in the ecosystem,

the use of several benthic metrics could be useful to evaluate

GEnS in the region.

Acknowledgements

This study was carried out within the framework of the

SYSCOLAG Project (Contrat Etat-Region 2000-2006). This

work was partly carried out within the EU Network of Excellence

“Marine Biodiversity and Ecosystem Functioning” (MARBEF)

and the MEVAPLAYA-II Project. We would like to express our

gratitude to Brian Paavo and another reviewer for their dedication

and comments on this paper. Thanks are given also to the

“Conseil Regional Languedoc-Roussillon” and the IFARHU-

SENACYT for supporting grants to some of the authors.

References

Bellan, G. and Bourcier, M. 1984. Bilan ecologique du detournement

permanent d’un petit fleuve cotier dans l’emissaire d’eaux usees

d’une grande ville. Marine Environmental Research 12: 83-111.

Borja, A., Galparsoro, I., Irigoien, X., Iriondo, S., Menchaca, I.,

Muxika, I., Pascual, M., Quincoces, I., Revilla, M., Rodriguez, G.,

Santurtun, M., Solaun, O., Uriarte, A., Valencia, V. and Zorita, I.

2011. Implementation of the European Marine Strategy

Framework Directive: A methodological approach for the

assessment of environmental status, from the Basque Country

(Bay of Biscay). Marine Pollution Bulletin 62: 889-904.

Borja, A., Elliott, M., Andersen, J.H., Cardoso, A.C., Carstensen, J.,

Ferreira, J.C., Heiskanen, A.-S., Marques, J.C., Neto, J.M.,

Teixeira, H., Uusitalo, L., Uyarra, M.C. and Zampoukas, N. 2013.

Good Environmental Status of marine ecosystems: what is it and

how do we know when we have attained it?. Marine Pollution

Builletinl6 : 16-27.

Brey, T. 1990. Estimating productivity of macrobenthic invertebrates

from biomass and mean individual weight. Archive of Fishery and

Marine Research 32: 329-343.

Browman, H.I., Stergiou, K.I., Cury, P.M., Hilborn, R., Jennings, S.,

Lotze, H.K., Mace, P.M., Murawsni, S., Pauly, D., Sissenwine, M.

and Zeller, D. 2004. Perspectives on ecosystem-based management

of marine resources. Marine Ecology Progress Series 274: 269-303.

Cardell, M.J., Sarda, R. and Romero, J. 1999. Spatial changes in

sublittoral soft-bottom polychaete assemblages due to river inputs

and sewage discharges. Acta Oecologica 20: 343-351.

Clarke, K.R. and Warwick, R.M. 1994. Change in marine communities:

an approach to statistical analysis and interpretation. Plymouth:

Plymouth Marine Laboratory, 144pp.

Clarke, K.R. and Gorley, R.N., 2006. User Manual/Tutorial.

PRIMER-E Ltd. Plymouth. 192 pp.

Cochrane, S.K.J., Connor, D.W., Nilsson, P., Mitchell, I.. Reker, J.,

Franco, J., Valavanis, V., Moncheva, S., J.Ekebom, J., Nygaard,

K., Serrao Santos, R., Naberhaus, I., Packeiser, T., van de Bund, W.

and Cardoso, A.C. 2010. Marine Strategy Framework Directive.

Guidance on the interpretation and application of Descriptor 1:

Biological diversity. Report by Task Group 1 on Biological

diversity for the European Commission’s Joint Research Centre,

Ispra, Italy. 114pp.

Coll, M., Piroddi, C., Steenbeek, J., Kaschner, K., Lasram, F.B.R.,

Aguzzi, J., Ballesteros, E., Bianchi, C.N., Corbera, J., Dailianis,

T., Danovaro, R., Estrada, M., Froglia, C., Galil, B.S., Gasol, J.M.,

Gertwagen, R., Gil, J., Guilhaumon, F., Kesner-Reyes, K., Kitsos,

M. -S., Koukouras, A., Lampadariou, N., Laxamana, E., Lopez-Fe

de la Cuadra, C.M., Lotze, H.K., Martin, D., Mouillot, D., Oro, D.,

Raicevich, S., Rius-Barile, J., Saiz-Salinas, J.I., San Vincente, C.,

Somot, S., Templado, J., Turon, X., Vafidis, D., Villanueva, R. and

Voultsiadou, E. 2010. The biodiversity of the Mediterranean Sea:

Estimates, patterns, and threats. PLoS ONE 5: ell842.

Cressie, N.A.C. 1993, Statistics for Spatial Data, Wiley.

Desbruyeres, D., Guille, A. and Ramos, J.M. 1972-73. Bionomie

benthique du plateau continental de la cote catalane espagnole.

Vie Milieu 23: 335-363.

Duran, R., Canals, M., Sanz, J.L., Lastras, G., Amblas, D. and

Micallef, A. 2014. Morphology and sediment dynamics of the

northern Catalan continental shelf, northwestern Mediterranean

Sea. Geomorpohology 204: 1-20.

Ellingsen, K.E. 2001. Biodiversity of a continental shelf soft-sediment

macrobenthos community. Marine Ecology Progress Series 218:

1-15.

European Commission. 2008. Directive 2008/56/EC of the European

Parliament and the Council of 17 June 2008, establishing a

framework for community action in the field of marine

environmental policy (Marine Strategy Framework Directive ).

Official Journal of the European Union L164,19-40.(MSFD). 2008.

Ferreira, J.G., Andersen, J.H.. Borja, A., Bricker, S.B., Camp, J.,

Cardoso da Silva, M., Garces, E., Heiskanen, A.S., Humborg, C.,

Ignatiades, L., Lancelot, C., Menesguen, A., Tett, P, Hoepffner,

N. and Claussen, U. 2010. Marine Strategy Framework Directive

- Task Group 5 Report Eutrophication. EUR 24338 EN - Joint

Research Centre, Luxembourg: Office for Official Publications of

the European Communities, 49 pp.

Galgani, F., Fleet, D., van Franeker, J., Katsanevakis, S., Maes, T.,

Mouat, J., Oosterbaan, L., Poitou, I., Hanke, G., Thompson, R.,

Amato, E., Birkun, A. and Janssen, C. 2010. Marine Strategy

Framework Directive - Task Group 10 Report Marine Litter. EUR

24340 EN - Joint Research Centre, Luxembourg: Office for

Official Publications of the European Communities, 48 pp.

300

R. Sarda, L. Serrano, C. Labrune, J. Gil, D. March, J.M. Amouroux, S. Taboada, P. Bonifacio &A. Gremare

Galil, B., and Lewinsohn, CH. 1981. Macrobenthic Communities of

the Eastern Mediterranean Continental Shelf. Marine Ecology

P.S.Z.N.I. 2: 343-352.

Gambi, M.C. and Giangrande, A. 1986. Distribution of soft-bottom

polychaetes in two coastal areas of the Tyrrhenian Sea (Italy):

Structural analysis. Estuarine, Coastal and Shelf Science 23:

847-862.

Giangrande, A., Liciano, M. and Musco, L. 2005. Polychaetes as

environmental indicators revisited. Marine Pollution Bulletin 50:

1153-1162.

Gil, J. 2011. The European Fauna of Annelida Polychaeta. PhD,

Faculdade de Ciencias. Universidade de Lisboa. 1554 pp.

Gremare, A., Amouroux, J.M., Charles, F., Medernach, L., Jordana,

E., Nozais, C., Vetion, G. and Colomines, J.C. 1998a. Temporal

changes in the biochemical composition of particulate organic

matter sedimentation in the Bay of Banyuls-sur-Mer. Oceanologica

Acta 21: 783-792.

Gremare, A., Amouroux J.M. and Vetion, G 1998b. Long-term

comparison of macrobenthos within the soft bottoms of the Bay of

Banyuls-sur-mer (northwestern Mediterranean Sea). Journal of

Sea Research 40: 281-302.

Guille, A. 1970. Bionomie benthique du plateau continental de la cote

catalane frangaise. II. Les communautes de la macrofaune. Vie

Milieu 21: 149-280.

Guille, A. 1971. Bionomie benthique du plateau continental de la cote

catalane frangaise. VI. Donnees autecologiques (Macrofaune). Vie

et Milieu 22: 469-527.

Knox, G. 1977. The role of polychaetes in benthic soft-bottom

communities. Essays on Polychaetous Annelids in Memory of Dr.

Olga Hartman. Allan Hancock Foundation, Los Angeles: 547-604.

Labrune, C., Gremare, A., Amouroux, J.M., Sarda, R., Gil, J. and

Taboada, S. 2006a. Diversity of polychaete fauna in the Gulf of

Lions (NW Mediterranean). Vie et Milieu 56: 315-326.

Labrune, C., Amouroux, J.M., Sarda, R., Dutriex, E., Thorin, S.,

Rosenberg, R. and Gremare, A. 2006b. Characterization of the

ecological quality of the coastal Gulf of Lions (NW

Mediterranean). A comparative approach based on three biotic

indices. Marine Pollution Bulletin 52: 34-47.

Labrune, C., Gremare, A., Amouroux, J.M., Sarda, R., Gil, J. and

Taboada, S. 2007. Assessment of soft-bottom polychaete

assemblages in the Gulf of Lions (NW Mediterranean) based on a

mesoscale survey. Estuarine, Coastal and Shelf Science 71: 133-147.

Labrune, C., A. Gremare, J.-M. Amouroux, R. Sarda, J. Gil and S.

Taboada (2008). Structure and diversity of shallow soft-bottom

benthic macrofauna in the Gulf of Lions (NW Mediterranean).

Helgoland Marine Research 62(3): 201-214.

Law, R., Hanke, G., Angelidis, M., Batty, J., Bignert, A., Dachs, J.,

Davies, I., Denga, Y. Duffek, A., Herut, B., Hylland, K., Lepom, P.,

Leonards, P, Mehtonen, J., Piha, H., Roose, P., Tronczynski, J.,

Velikova, V. and Vethaak, D. 2010. Marine Strategy Framework

Directive - Task Group 8 Report Contaminants and Pollution Effects.

EUR 24335 EN - Joint Research Centre, Luxembourg: Office for

Official Publications of the European Communities, 16 pp.

Masse, H. 1972. Quantitative investigations of sand-bottom

macrofauna along the Mediterranean north-west coast. Marine

Biology 15: 209-220.

Mee, L., Jefferson, R.L., Laffoley, D.dA. and Elliott, M. 2008. How

good is good?. Human values and Europe’s proposed Marine

Strategy Directive. Marine Pollution Bulletin , 56: 187-204.

Olenin, S., Alemany, F., Cardoso, A.C., Gollasch, S., Goulletquer, P.,

Lehtiniemi, M., McCollin, T., Minchin, D., Miossec, L.,

Occhipinti-Ambrogi, A., Ojaveer, H., Rose Jensen, K.,

Stankiewicz, M., Wallentinus, I. and Aleksandrov, B. 2010.

Marine Strategy Framework Directive - Task Group 2 Report Non-

indigenous Species. EUR 24342 EN - Joint Research Centre,

Luxembourg: Office for Official Publications of the European

Communities, 4 pp.

Pebesma, E. J. 2004. Multivariable geostatistics in S: the gstat package.

Computers and Geosciences, 30: 683-691.

Peres, J.M. and Picard, J. 1957. Note preliminaire sur une communaute

benthique recemment mise en evidence: la biocoenose a Dentalium

rubescens et Lucina (Miltha) borealis. Recueil des Travaux de la

Station Marine d’Endoume 21: 12.

Peres, J.M. and Picard, J. 1964. Nouveau manuel de bionomie

benthique de la mer Mediterranee. Recueil des Travaux de la

Station Marine d’Endoume 31: 5-137.

Picard, J. 1965. Recherches qualitatives sur les biocenoses marines

des substrats meubles dragables de la region marseillaise (France).

Bulletin des Recherches et Travaux de la Station Marine

d’Endoume. 36: 1-160.

Piet, G.J., Albella, A.J., Aro, E., Farrugio, H., Lleonart, J., Lordan, C.,

Mesnil, B., Petrakis, G., Pusch, C., Radu, G and, Ratz, H.J. 2010.

Marine Strategy Framework Directive - Task Group 3 Report

Commercially Exploited Fish and Shellfish. EUR 24316 EN - Joint

Research Centre, Luxembourg: Office for Official Publications of

the European Communities, 82 pp.

Rice, J., Arvanitidis, C., Borja, A., Frid, C., Hiddink, J., Krause, J.,

Lorance, P., Ragnarsson, S.A., Skold, M. and Trabucco, B. 2010.

Marine Strategy Framework Directive - Task Group 6 Report

Seafloor Integrity. EUR 24334 EN - Joint Research Centre,

Luxembourg: Office for Official Publications of the European

Communities, 73 pp.

Rogers, S., Casini, M., Cury, P., Heath, M., Irigoien, X., Kuosa, H.,

Scheidat, M., Skov, H., Stergiou, K.I., Trenkel, V.M., Wikner, J.

and Yunev, O. 2010. Marine Strategy Framework Directive - Task

Group 4 Report Food Webs. EUR 24343 EN - Joint Research

Centre, Luxembourg: Office for Official Publications of the

European Communities, 55 pp.

Ros, J.D. and Cardell, M.J. 1992. Seasonal distribution pattern of

polychaetes from a heavily polluted coastal area (Barcelona, NE

Spain, NW Mediterranean). Pp. 101-110 in: Colombo, G., Ferrari,

I., Ceccherelli, V.U. and Rossi, R. (eds). Marine Eutrophication

and Population Dynamics, Olsen & Olsen PUbl. Fredensborg

(Denmark).

Rosenberg, R., Blomqvist, M., Nilsson, H.C., Cerderwall, H. and

Dimming, A. 2004. Marine quality assessment by use of benthic-

species-abundance distributions: a proposed new protocol within

the European Union water framework Directive. Marine Pollution

Bulletin 49: 728-739.

Rumohr, H., Brey, T. and Ankar, S. 1987. A compilation of biometric

conversion factors for benthic invertebrates of the Baltic Sea. The

Baltic Marine Biologists Publications 9: 1-56.

Salen-Picard, C., Arlhac, D. and Alliot, E. 2003. Responses of a

Mediterranean soft bottom community to short-term (1993-1996)

hydrological changes in the Rhone river. Marine Environmental

Research 55: 409-427.

Sarda, R., Pinedo, S. and Martin, D. 1999. Seasonal dynamics of

macroinfaunal key species inhabiting shallow bottoms in the Bay

of Blanes (NW Mediterranean). Acta Oecologica 20: 315-326.

Sarda, R., Pinedo, S., Gremare, A. and Taboada, S. 2000. Changes in

the dynamics of shallow soft-bottom due to man-made disturbance

processes in the Catalan Western Mediterranean Sea. ICES

Journal of Marine Sciences 57: 1446-1457.

Polychaete assemblages in the northwestern Mediterranean

301

Sarda, R., Rossi, S., Marti X. and Gili, J.M. 2012. Marine Benthic

Cartography of the Cape de Creus (NE Catalan Coast,

Mediterranean Sea). Scientia Marina 76: 159-171.

Sarda R., O’Higgings, T., Cormier, R., Diedrich, A. and Tintore, J. in

press. Proposal of a Marine Ecosystem-Based Management

System: linking the theory of environmental policy and practice

of environmental management. Ecology and Society.

Serrano, L.G., Cardell, M.J., Lozoya, J.P. and Sarda R. 2011. A

polychaete-dominated community in the NW Mediterranean Sea,

20 years after cessation of sewage discharges. Italian Journal of

Zoology 78: 333-346.

Swartenbroux, F., Albajedo, B., Angelidis, M., Aulne, M., Bartkevics,

V., Besada, V., Bignert, A., Bitterhof, A., Hallikainen, A.,

Hoogenboom, R., Jorhem, L., Jud, M., Law, R., Licht Cederberg, D.,

McGovern, E., Miniero, R., Schneider, R., Velikova, V., Verstraete,

F., Vinas, L. and Vlad, S. 2010. Marine Strategy Framework

Directive - Task Group 9 Report Contaminants in Fish and Other

Seafood. EUR 24339 EN - Joint Research Centre, Luxembourg:

Office for Official Publications of the European Communities, 3 pp.

Tasker, M.L., Amundin, M., Andre, M., Hawkins, A., Lang, W.,

Merck, T., Scholik- Schlomer, A., Teilmann, J., Thomsen, F.,

Werner, S. and Zakharia, M. 2010. Marine Strategy Framework

Directive - Task Group 11 Report Underwater noise and Other

Forms of Energy. EUR 24341 EN - Joint Research Centre,

Luxembourg: Office for Official Publications of the European

Communities, 55 pp.

Zenetos, A., Gofas, S., Verlaque, M., (finar, M.E., Garcia Raso, J.E.,

Bianchi, C.N., Morri, C., Azurro, E., Bilecenoglu, M., Froglia, C.,

Soikou, I., Volanti, D., Sfriso, A., San Martin, Giangrande, A.,

Katagan, T., Ballesteros, E., Ramos Espla, A., Mastrototaro, F.,

Ocana, O., Zingone, A., Gambi, M.C. and Streftaris, N. 2010.

Alien species in the Mediterranean Sea by 2010. A contribution to

the application of European Union’s Marine Strategy Directive

(MSFD). Part I. Spatial Distribution. Mediterranean Marine

Science 11: 381-493.

Memoirs of Museum Victoria 71:303-309 (2014) Published 31-12-2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

A new species of Chaetopterus (Annelida, Chaetopteridae) from Hong Kong

YANAN SuN 1,2,t (http://zoobank.Org/urn:lsid:zoobank.org:author:llDBA76B-239F-496A-9F79-0C6CDD98B57F)

AND JlAN-WEN QlU 1 ’*’* (http://zoobank.Org/urn:lsid:zoobank.org:author:C7554413-4141-4E83-B715-7DE16B0034Bl)

1 Department of Biology, Hong Kong Baptist University, 224 Waterloo Road, Kowloon, Hong Kong, PR China (E-mail:

qiujw@hkbu.edu.hk)

2 Department of Biological Sciences, Faculty of Science, Macquarie University, New South Wales 2109, Australia (E-mail:

yanan. sun@austmus. gov. au)

* To whom correspondence and reprint requests should be addressed. E-mail: qiujw@hkbu.edu.hk

http://zoobank.Org/urn:lsid:zoobank.org:pub:E0F5298D-4E60-4A4C-BB6B-14F08E16BE57

Abstract Sun, Y. and Qiu, J.-W. 2014. A new species of Chaetopterus (Annelida, Chaetopteridae) from Hong Kong. Memoirs of

Museum Victoria 71: 303-309.

A new species, Chaetopterus qiani sp. nov., is described based on 18 specimens collected from a fish farm in Hong

Kong. This species is small (body length: 11. 5-35.5 mm), with nine, five and 10-16 chaetigers in regions A, B and C,

respectively. It belongs to a small group of epibenthic Chaetopterus species with long notopodia in region C. This species

can be distinguished from other epibenthic Chaetopterus by a combination of the following features: up to 16 light-

brownish cutting chaetae in A4, wide neuropodia in A9, large wing-shaped notopodia in Bl, 10-16 chaetigers in region C,

long club-shaped notopodia and a short conical dorsal cirrus in the dorsal lingule of neuropodia in region C. A key to

Chaetopterus from the Pacific region is provided.

Keywords taxonomy, polychaete, Chaetopterus, new species, Hong Kong

Introduction

Chaetopterus is a genus of tubiculous polychaetes characterised

by having three distinct body regions. Their body is highly

modified for a unique way of filter-feeding: the first pair of the

middle parapodia are extremely long and aliform (wing¬

shaped) and secrete a mucus bag to trap food particles from

the water current; the last three pairs of the middle parapodia

are fused to form semicircular fans, whose beating, like

moving pistons, creates a current of water through the tube

(Brown, 1975). Chaetopterus species are frequently used as

model organisms in studies of reproduction and early

development (Irvine et al., 1999; Petersen et al., 2000; Yang et

al., 2004), as well as of bioluminescence (Shimomura, 2006).

Despite the common use of Chaetopterus as an experimental

model, there has been confusion over the number of valid

species in the genus. Fauvel (1927, 1953) synonymised several

species of Chaetopterus with C. variopedatus (Renier, 1804), as

he considered the variations in body size, number of anterior

segments, and length of parapodia to be intraspecific,

representing ontogenetic changes or incomplete regeneration

following autotonomy. Hartman (1959) went further and

synonymised all 25 nominal Chaetopterus species with C.

variopedatus, suggesting that there are no reliable morphological

distinctions among them. This cosmopolitan species concept

was supported by the observation of Scheltema (1971) on

planktonic samples, which indicated that Chaetopterus larvae

would be able to widely disperse through the transocean current.

However, the cosmopolitan species concept was challenged by

Petersen (1984a, 1984b, 1997), who stated that ‘C. variopedatus ’

represents a species complex containing at least ten species. The

concept that C. variopedatus is a single cosmopolitan species

was also refuted by a phylogenetic analysis based on molecular

data (Osborn et al., 2007). Indeed, recent studies of Chaetopterus

have recognised many more species, and their distribution

ranges may well be more limited. From Japan, three new species

(C. izuensis, C.japonicus and C.pacificus) have been discovered,

and three species (C. cautus, C. takahashii and C. longipes)

have been redescribed (Nishi, 2001). From the Galapagos

Islands, three new species (C. aduncus, C. charlesdarwinii and

C. galapagensis ) have been published, and two species (C.

longipes and C. macropus ) have been redescribed (Nishi et al.,

2009). In addition to the aforementioned benthic or epibenthic

species, Chaetopterus also has one pelagic species (C.

pugaporcinus ) (Osborn et al., 2007), collected at depths of

between 875 and 3000 m in Monterey Bay, California, although

it was not certain whether these specimens were larvae or

adults. Several morphological traits (e.g. tube shape, infaunal or

epifaunal habitat, shape and colour of A4 modified chaetae, and

shape of cirri in the lateral lobe of region C notopodia) have

304

Y.Sun&J.-W Qiu

Table 1. Major quantitative morphological parameters in Chaetopterus qiani sp. nov.

Catalogue

number

Body

length

(mm)

Length of region

(mm)

Body

. width

(mm)

No. of

chaetigers

in C

Length of

notopodia in

B1 (mm)

No. of

modified

chaetae in A4

Length of

tentacle (mm)

Sex

Remarks

Holotype

MBM179979

24.3

5.4

11.7

7.2

4.7

3.6

Paratype

MBM179980

28.3

6.2

12.1

4.3

5.1

2.4

MBM179981

28.6

6.6

10.4

11.6

4.2

4.5

2.6

MBM179982

21.1

4.5

8.5

8.1

3.5

2.7

1.5

MBM179983

24.4

n.r.

13.1

11.3

2.7

3.5

n.r.

MBM179984

23.7

4.5

11.4

7.8

3.6

3.8

2.5

MBM179985

26.1

6.8

9.3

3.6

4.6

2.3

MBM179986

31.2

6.5

14.3

10.4

3.6

5.2

2.5

AM W46121

26.1

3.4

13.8

8.9

5.9

4.3

2.5

AM W46122

17.8

3.6

8.6

5.6

3.5

3.4

1.9

AM W46123

33.4

7.1

4.3

4.5

5.7

AM W46124

17.5

4.2

7.5

5.8

3.5

4.1

AM W46125

35.6

6.5

6.1

5.6

3.3

AM W46126

27.6

13.2

9.4

3.5

4.1

n.r

AM W46127

11.6

5.4

3.2

2.4

2.5

AM W46128

4.6

14.6

6.8

4.5

4.6

2.2

AM W46129

5.5

6.5

n.r.

4.0

n.r.

n.r. = character not recorded due to loss of the anterior or posterior part. ? = individuals whose sex cannot be determined by light

microscopy, incomplete specimen without region A. b In this specimen, region C has 6 chaetigers only; the posterior part of

region C is missing, incomplete specimen without region C.

been found to be useful for distinguishing Chaetopterus species

(Petersen, 1984a, 1984b, 1997; Nishi et al., 2000, 2009; Nishi,

2001; Osborn et al., 2007).

Along the Chinese coasts, the only recorded species is

C. variopedatus, which is likely to be C. cautus, according to

the description by Yang and Sun (1988). Here we describe

Chaetopterus qiani sp. nov. from Hong Kong and provide a

key to the Chaetopterus species in the Pacific region.

Materials and methods

Samples were hand-collected from a floating raft in a fish farm

at Port Shelter, Hong Kong. They were fixed in 10%

formaldehyde and then transferred to 75% ethanol one week

later. The morphology of specimens was observed under a

stereomicroscope and a compound microscope. Scaled

photographs of the whole body and body structures were taken

using a Digital Sight DS-SM camera mounted on an Olympus

SZX 16 microscope. One paratype was dehydrated with

graded concentrations of ethanol, critical point dried using a

BAL-TEC CPD 030 Critical Point Dryer, and observed under

a LEO 1530 FESEM scanning electron microscope.

Types are deposited in The Marine Biological Science

Museum (MBM) of the Chinese Academy of Sciences,

Qingdao, China, and in the Australian Museum (AM), Sydney,

Australia (table 1). Description was mainly based on the

holotype, with supplementary data from the paratypes showing

the variations in morphological characters; SEM micrographs

were generated to show the details of the chaetae.

Systematics

Genus Chaetopterus Cuvier, 1830

Chaetopterus qiani sp. nov.

Zoobank LSID. http://z 00 bank. 0 rg/urn:lsid:z 00 bank. 0 rg:act:

DB2F51FF-35F1-4676-890C-F4A4B83FCB68

A new species of Chaetopterus (Annelida, Chaetopteridae) from Hong Kong

305

Figures 1A-G, 2A-H

Material examined. 18 specimens. All type specimens were collected

from the fish farm in Port Shelter, Hong Kong (22°20'37.15”N

114°16'58.70”E) on 19 Mar 1998. Holotype: MBM179979, 1 complete

specimen in tube with eggs in the parapodia of region C. Paratypes:

MBM79980-79986, AM W46121-W46129 and AM W46131 (table 1).

Diagnosis. 9 chaetigers in region A; modified chaetae of A4

light brown, 10-12 in number; wide neuropodia in A9; large

wing-shaped notopodia in Bl; long club-shaped notopodia and

short conical dorsal cirrus in the dorsal lobe of neuropodia in

region C; uncini with 7-9 teeth on lateral lobe of Cl, and 10-

13 teeth on ventral lobe of Cl.

Description. Holotype complete with tube (fig. 1A-C), total

length 24.3 mm: 5.4 mm in region A, 11.7 mm in region B, and

7.2 mm in region C. Widest part of region A 4 mm.

Region A with 9 chaetigers. Prostomium small, with anterior

border rounded, entire. Peristomium extended, completely

covering prostomium; wide-horseshoe shaped in anterior view.

Two grooved palps extending beyond peristomium, length 3.6

mm (fig. 1A). A pair of eyes present, located at the base of palps.

Middorsal ciliated groove extending through region A (fig. 1 A).

Ventral surface with a long, slender ventral shield (plastron) (fig.

IB): length 4.2 mm, width 2 mm. First 8 chaetigers uniramous,

with long, triangular notopodia. Notopodia of A6 longest (figs

ID, 2A). Ninth chaetiger biramous, with long notopodium and

stubby neuropodial lobe. Each notopodium with 2-3 rows of

light-yellow lanceolate chaetae; dorsal chaetae longer and more

slender than lateral ones (fig. 2B, D-E). Notopodia of A4 with

10 modified chaetae. Modified chaetae light brown and club-

shaped, with knob-like expanded tip, and arranged in 3 or 4

rows with 2-4 chaetae per row (figs IE, 2B-C). Neuropodia of

A9 with a row of uncini; uncini bluntly D-shaped, with 6-7

teeth in a single row (fig. 2F).

Region B with 5 chaetigers. Digestive gland green in fresh

material; colour lost in ethanol-preserved specimens.

Parapodia biramous. Bl with enormously enlarged, distally

tapering, aliform notopodia extending to A1 (fig. 1A). B2 with

elongate parapodium modified as large cupule. B3-B5 fused

middorsally, forming enlarged fans. All notopodia of region B

without chaetae or uncini. Neuropodia of Bl and B2 with

upper and lower uncini lobe, B3-B5 with lower uncini lobe

only. Uncini in a single row, similar in shape with uncini in

region A; with 5-6 teeth in upper and lower lobe of Bl and B2

(fig. 2G), and 9-10 teeth in B3-B5.

Region C with 14 chaetigers. Parapodia all biramous.

Notopodia long, club-shaped with slightly swollen tip (fig. 1A,

B). Neuropodia bilobed; lateral lobe with papillary cirrus on

lateral side only; ventral neuropodial lobe without cirrus (fig. IF).

Eggs present in neuropodia of holotype (fig. 1G). Uncini of region

C similar to those of region A in shape, with 6-7 teeth in lateral

neuropodial lobe of Cl, and 10-13 teeth in ventral neuropodial

lobe of Cl (fig. 2H). Other uncini of region C with 7-9 teeth.

Variation. Several morphological parameters show variations

among the type specimens (table 1). The body length varies

from 11.6-35.6 mm and the width from 2.4-4.5 mm. The

number of modified chaetae in A4 ranges from 8-16. The first

notopodia in region B extends to chaetiger A1 in 7 specimens,

to A2 in 3 specimens and to A4 in 5 specimens. The number

of chaetigers in region C varies from 10-16. Of the type

specimens, 5 are females with observable eggs under the body

wall, but sex is indeterminable in other type specimens.

Type location and distribution. Currently only known from

Port Shelter, Hong Kong.

Etymology. This species is named in honour of Professor Pei-

Yuan Qian to recognise his support for polychaete research.

Discussion

Petersen (1984a, 1984b, 1997) separated Chaetopterus into

two groups according to habitat and tube characteristics: large

benthic species with a U-shaped tube, and small epibenthic

species with an irregularly shaped tube. According to this

classification, C. qiani sp. nov. belongs to the epibenthic group,

which also includes six other species of Chaetopterus from the

Pacific region: C. aduncus Nishi, Hickman and Bailey-Brock,

2009; C. Charlesdarwinii Nishi, Hickman and Bailey-Brock,

2009; C. gregarius Nishi, Arai and Sasanuma, 2001; C.

izuensis Nishi, 2001; C. japonicus Nishi, 2001; and C. longipes

Crossland, 1904. This group is characterised by small size

(<30 mm in body length) and only a small number of chaetigers

in region C (<20). Nishi et al. (2000) proposed 30 characters

for distinguishing Chaetopterus species. Among them, ten

characteristics were used for distinguishing the Pacific species:

presence/absence of eyes, morphology of prostomium and

peristomium, number of chaetigers in region A, colour and

shape of modified chaetae in A4, presence/absence of

neuropodia on the last chaetiger in region A, relative size of

notopodia in region A, shape and size of notopodia in Bl, size

and number of teeth in uncini in regions B and C, presence/

absence of rudimentary cirri on the lateral lobe of neuropodia

in region C, and tube shape and composition.

Based on these morphological characters, C. qiani sp. nov.

can be distinguished from other species in the epibenthic group

of the Pacific region by a combination of characters. It has nine

chaetigers in region A, whereas C. aduncus has 10-11 chaetigers

in region A. The new species has neuropodia in A9, whereas C.

longipes does not have neuropodia in any of the region A

segments. It has eyes and the tubes are muddy, whereas C.

izuensis does not have eyes and its tubes are sandy. Chaetopterus

qiani sp. nov. can be distinguished from C. charlesdarwinii and

C. gregarious by the colour and arrangement of the modified

chaetae in A4. The A4 modified chaetae of C. qiani sp. nov. are

light brown and arranged in three or four rows with two to four

chaetae per row, whereas the modified chaetae of C.

charlesdarwinii and C. gregarious are dark brown and arranged

in one row only. Chaetopterus qiani sp. nov. is similar to C.

japonicus (recorded from the southern Pacific side of central

Japan) in the presence of eyes and light-brown modified chaetae

in A4. However, the tube of C. qiani sp. nov. is irregularly curved

or J-shaped and muddy, whereas the tube of C. japonicus is

U-shaped and has sand and shell fragments on the surface.

Besides, C. qiani sp. nov. has more chaetigers in region C than C.

japonicus (12 vs. 6).

306

Y.Sun&J.-W Qiu

Figure 1. Chaetopterus qiani sp. nov., A-C, G: holotype MBM179979. D-F: paratype BU01. A, dorsal view of the whole worm; B, ventral view

of the whole worm; C, tube; D, region A, lateral view; E, notopodium of A4 showing modified chaetae; F, ventral view of neuropodia in region

C; G, notopodia of region C, showing eggs. A, B and C# = region A, B and C chaetigers, g = mid-dorsal ciliated groove, nt = notopodia, ne =

neuropodia, p = palp, per = peristomium, pi = ventral shield (plastron), pr = prostomium. Bar scales: A-B, D, F-G: 1 mm, C: 1 cm, E: 200 pm.

A new species of Chaetopterus (Annelida, Chaetopteridae) from Hong Kong

307

Figure 2. Chaetopterus qiani sp. nov., paratype AM W46131. A, Al-6 showing the relative size and arrangement of chaetae, with arrows

indicating the positions of chaetigers A1 and A4; B, A3-4, showing the different shapes of the lateral chaetae; C, modified chaetae of A4; D,

lanceolate chaetae on lateral side of notopodium; E, lanceolate chaetae on dorsal side of notopodium; F, uncini in neuropodium of A9; G, uncini

in neuropodia of Bl; H, uncini in neuropodia of Cl. Bar scales: A: 500 pm, B: 100 pm, C-E: 20 pm, F-H: 10 pm.

308

Y.Sun&J.-W Qiu

Among the characters that have been used to compare species

recorded from the Pacific region (Nishi et al., 2009), some (body

width, ratio of length/width of ventral shield, and number of teeth

of uncini in each region) exhibit overlap in ranges, but others

(shape and composition of tubes, the presence/absence of eye

spots, number of chaetigers in region A and region C, number and

shape of pairs of A4 modified chaetae, and shape of neuropodial

cirri) can be applied to distinguish Chaetopterus species. Based

on these morphological characters, a key to the Chaetopterus spp.

is provided.

Key to Pacific species of Chaetopterus

1 Benthic, with most of the tube buried in bottom.7

- Epibenthic, with the tube attached to a solid surface. 2

2 Region A with 10-11 chaetigers. C. aduncus

- Region A with 9 chaetigers.3

3 Last chaetiger of region A unilobed. C. longipes

- Last chaetiger of region A bilobed. 4

4 Tube fragile, made of sand and shell debris; notopodia of

B1 straight and slender. C. izuensis

- Tube parchment-like, made of mud; notopodia of B1

triangular. 5

5 A4 modified chaetae light brown; notopodia of region C

club-shaped with slightly swollen end. C. qiani sp. nov.

- A4 modified chaetae dark brown; notopodia of region C

lanceolate with tapered end.6

6 Region A with a prominent bulbous swelling on the dorsal

side of notopodia; uncini with 8-9 teeth in Bl, 9-10 teeth

in B3. C. Charlesdarwinii

- Region A without swelling; uncini with 6-7 teeth in Bl,

5-6 teeth in B3. C. gregarius

7 Neuropodial dorsal cirri of region C long.8

- Neuropodial dorsal cirri of region C short or rudimentary

. 9

8 Neuropodial ventral lobe in region C with both dorsal and

ventral cirri. C. cautus

- Neuropodial ventral lobe in region C with dorsal cirrus

only. C. pacificus

9 Region A with 13-15 chaetigers. C. galapagensis

- Region A with less than 12 chaetigers. 10

10 Region C with 5-8 chaetigers. C.japonicus

- Region C with more than 10 chaetigers. 11

11 Region A with a prominent bulbous swelling on the dorsal

side of notopodia. C. macropus

- Dorsal swelling in region A absent. C. variopedatus

Acknowledgements

We thank Dr Mary Peterson for help with the initial

identification, Dr Eijiroh Nishi for providing some important

literature, and Yingxuan Li for technical support. This study

was supported by a grant (HKU5/CRF/12G) from the

University Grants Committee.

References

Brown, S.C. 1975. Biomechanisms of water-pumping by Chaetopterus

variopedatus Renier. Skeletomusculature and kinematics.

Biological Bulletin 148: 136-150.

Crossland, C. 1904. The Polychaeta of the Maidive Archipelago from

the collections made by J. Stanley Gardiner in 1899. Proceedings

of the Zoological Society of London 1: 270-286.

Cuvier, G. 1830. Le regne animal distribue d’apres son organisation,

pour servir de base a Vhistoire naturelle des animaux et

d’introduction a Tanatomie comparee, Volume 3 [includes

Polychaeta], 2nd edition. Deterville et Crochard: Paris. 504 pp.

Fauvel, P. 1927. Polychetes sedentaires. Addenda aux errantes,

Arhiannelides, Myzostomaires. Faune de France 16: 1-494.

Fauvel, P. 1953. The fauna of India including Pakistan, Ceylon,

Burma and Malaya. Annelida Polychaeta. Indian Press:

Allahabad. 507 pp.

Hartman, O. 1959. Catalogue of the polychaetous annelids of the

world. Part II. Occasional Papers of the Allan Hancock

Foundation 23: 1-353.

Irvine, S.Q., Chaga, O., and Martindale, M.Q. 1999. Larval ontogenetic

stages of Chaetopterus : developmental heterochrony in the

evolution of chaetopterid polychaetes. Biological Bulletin 197:

319-331.

Nishi, E. 1996. Dense aggregation of Chaetopterus longipes

Crossland, 1904 (Chaetopteridae, Polychaeta) in coral reefs at

Okinawa, Japan. Natural History Research 4: 41-47.

Nishi, E. 2001. Partial revision of Japanese Chaetopterus

(Chaetopteridae: Polychaeta) including three new species from

the Pacific side of central Japan. Actinia (Yokoyama National

University) 14: 1-32.

Nishi, E., Arai, Y., and Sasanuma, S. 2000. A new species of

Chaetopterus (Polychaeta: Chaetopteridae) from off the Tokyo

Bay, central Japan, with notes on its luminescence. Actinia

(Yokohama National University) 13: 1-12.

Nishi, E., Hickman, C.P. Jr., and Bailey-Brock, J.H. 2009. Chaetopterus

and Mesochaetopterus (Polychaeta: Chaetopteridae) from the

Galapagos Islands, with descriptions of four new species.

Proceedings of the Academy of Natural Sciences of Philadelphia

158:239-259.

Osborn, K.J., Rouse, G.W., Goffredi, S.K., and Robison, B.H. 2007.

Description and relationships of Chaetopterus pugaporcinus , an

unusual pelagic polychaete (Annelida, Chaetopteridae). Biological

Bulletin 212: 40-54.

Petersen, K.J., Irvine, S.Q., Cameron, R.A., and Davidson, E.H. 2000.

Quantitative assessment of Hox complex expression in the indirect

development of the polychaete annelid Chaetopterus sp.

Proceedings of the National Academy of Sciences of the United

States of America 97(9): 4487-4492.

Petersen, M.E. 1984a. Chaetopterus variopedatus (Renier) (Annelida:

Polychaeta: Chaetopteridae): a species complex. What species are

being used at MBL? Biological Bulletin 167: 513. (Abstract)

Petersen, M.E. 1984b. Chaetopterus variopedatus (Annelida:

Polychaeta): another victim of the “characteristic species” disease.

American Zoologist 24: 62A. (Abstract)

A new species of Chaetopterus (Annelida, Chaetopteridae) from Hong Kong

309

Petersen, M.E. 1997. Contribution to a revision of Chaetopterus Cuvier

(Polychaeta: Chaetopteridae): redescription of C. appendiculatus

Grube and C. cautus Marenzeller, with comments on some other

species. Bulletin of Marine Science 60: 619-620. (Abstract)

Renier, S.A. 1804. Prospetto della Classe dei Vermi nominati e ordinate

second oil sistema di Bose. Zoologische Jahrbiicher 64: 41-110.

Scheltema, R.S. 1971. The dispersal of the larvae of shoal-water

benthic invertebrate species over long distances by ocean currents.

Pp. 7-28 in: Fourth European Marine Biology Symposium.

Cambridge Press: London.

Shimomura, O. 2006. Bioluminescence: chemical principles and

methods. World Scientific Publishing Company: Singapore.

Yang, D., Hinton, S.D., and Eckberg, W.R. 2004. Regulation of

cleavage by protein kinase C in Chaetopterus. Molecular

Reproduction and Development 69: 308-315.

Yang, D., and Sun, R. 1988. Polychaetous annelids commonly seen

from the Chinese waters. China Agriculture Press: Beijing. 352

pp. (In Chinese)

Memoirs of Museum Victoria 71:311-325 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Chrysopetalidae (Annelida: Phyllodocida) from the Senghor Seamount, north-east

Atlantic: taxa with deep-sea affinities and morphological adaptations

CHARLOTTE Watson 1 * (http://zoobank.org/urn:lsid:zoobank.org:author:B2A32582-0DCC-43C5-840C-6DBC9B1935D4), ADAM J. ChIVERS 2 ,

Bhavani E. Narayanaswamy 2 , Peter Lamont 2 and Robert Turnewitsch 2

1 MAGNT, Museum and Art Gallery of the Northern Territory, PO Box 4646, Darwin, NT 0810, Australia (charlotte.

watson@nt.gov. au)

2 SAMS, Scottish Association for Marine Science, Oban, Argyll, PA37 1QA, Scotland, UK (adam.chivers@sams.ac.uk);

bhavani.narayanaswamy@sama.ac.uk; peter.lamont@sams.ac.uk; robert.turnewitsch@sams.ac.uk

* To whom correspondence and reprint requests should be addressed. E-mail: charlotte.watson@nt.gov.au

(http://zoobank.Org/urn:lsid:zoobank.org:pub:B2A32582-0DCC-43C5-840C-6DBC9B1935D4)

Abstract Watson, C., Chivers, A.J., Narayanaswamy, B.E., Lamont, P. and Turnewitsch, R. 2014. Chrysopetalidae (Annelida:

Phyllodocida) from the Senghor Seamount, north-east Atlantic: taxa with deep-sea affinities and morphological

adaptations. Memoirs of Museum Victoria 71: 311-325.

Senghor Seamount is located in the north-east (NE) Atlantic Ocean, 550 km west of Senegal, Africa, in the Cape

Verde Archipelago. Macrofaunal sampling was undertaken from the summit (~100 m depth) to the base of the seamount

03300 m depth) during the RV Meteor cruise (November 2009). The Chrysopetalidae fauna represents the first record for

the family from a tall seamount habitat and is composed of East Atlantic continental margin and deep-sea species.

Dysponetus sp. 1 is present at the summit and Dysponetus caecus at base depths. Thrausmatos is recorded for the first time

in the Atlantic Ocean, as Thrausmatos senghorensis sp. nov., and is found at mid-slope depths only. The taxon with the

largest number of individuals, Arichlidon reyssi, is most evident at the summit, with one record mid-slope. All Senghor

species belong to the only three chrysopetalid genera that possess epitokous, swimming neurochaetae. Adults of A. reyssi

from the Senghor Seamount and planktonic metatrochophore larvae from the NE Atlantic coast are compared and

described in detail. The West Atlantic benthic nectochaete larvae of Arichlidon gathofi are also described in the interest

of recognising and separating the two cryptic Atlantic Arichlidon species.

Keywords North-east Atlantic, polychaete, Chrysopetalidae, swimming neurochaeta, depth distribution, chrysopetalid larva

Introduction

Seamounts are undersea mountains with heights above 1000 m

and usually of volcanic origin. They are highly abundant in the

Pacific Ocean but occur also in the Atlantic and Indian Oceans

(Consalvey et al., 2010). Less than 0.3% of seamounts have

been biologically sampled in any detail, and infaunal studies

including quantitative sampling methodologies have been

scarce (Schlacher et al., 2010; Ramirez-Llodra et al., 2010).

Recent mid NE Atlantic seamount studies include descriptions

of the structure and function of seamount ecosystems in the Cape

Verde region (Christiansen et al., 2010) and quantitative research

into polychaete diversity of the Senghor Seamount (Chivers et al.,

2013). Polychaetes are the most common infaunal organisms on

NE Atlantic seamounts, with the majority represented by

Onuphidae, Syllidae, Eunicidae and Amphinomidae collected by

large-aperture-mesh trawl and dredge (Surugiu et al., 2008).

Dominant taxa present among the Senghor Seamount fauna are

Syllidae, Spionidae, Cirratulidae and Chrysopetalidae collected

by quantitative cores (Chivers et al., 2013).

Chrysopetalidae have been recorded from all oceans and are

one of the most common polychaetes living in crevicular habitats

in tropical, shallow coral reefs of the Indo-Pacific and Atlantic

(Watson, 2010). Chrysopetalids are small, often fragmentable

polychaetes with golden or silver notochaetal palaeal or spinous

fans that cover the dorsum. Separate sexes have been described,

and they possess an eversible proboscis with a pair of grooved

stylets and an omnivorous, scavenging lifestyle. Over the past 20

years new chrysopetalid taxa have been collected from

continental shelves and abyssal oceanic depths associated with

wood and whale falls, nodule fields, hydrothermal vents and cold

seeps (e.g. Watson, 2001; Dahlgren, 2004).

312

C. Watson, A.J. Chivers, B.E. Narayanaswamy, P. Lamont & R. Turnewitsch

Specialised swimming neurochaetae have been recorded

in species of three chrysopetalid taxa —Arichlidon,

Dysponetus and Tlirausmatos (Aguirrezabalaga et al., 1999;

Watson Russell, 1998, 2000; Watson, 2001). These three

genera constitute the only taxa collected at Senghor Seamount,

and swimming neurochaetae are described for the first time in

Dysponetus caecus (Langerhans, 1880).

Dysponetus caecus and Arichlidon reyssi (Katzmann et

al., 1974) have been reported over a wide range of depths in the

western Atlantic (Watson Russell, 1998; Boggemann, 2009)

and A. reyssi in this study from Senghor Seamount. Whether

these taxa are able to move between different depths, or

whether each taxon comprises a number of cryptic species

living at different depths, is discussed.

Differences in larval dispersal mode have been considered

one of the main factors related to species genetic connectivity

between seamounts, and between seamounts, their adjacent

islands and continental margins (e.g. Samadi et al., 2006, Cho

and Shank, 2010). Planktonic larvae are typically present in a

number of chrysopetalid taxa (Cazaux, 1968; Watson Russell,

1987) and also comprise a major part of the first polychaete

fauna settling on artificial reefs, in both temperate and tropical

studies (Hutchings and Murray, 1982; Cole et al., 2007).

Planktonic larvae of Arichlidon reyssi from the NE

Atlantic are described in detail, as are larvae of Arichlidon

gathofi Watson Russell, 2000 from the West Atlantic, in order

to morphologically distinguish the larvae of these two cryptic

species. Six- to seven-segmented larvae can be identified to

species by examination of palaeal chaetal types of the posterior

-most setigers. Clarification is provided of the morphological

changes of the first three anterior segments in planktonic

metatrochophore larvae and late nectochaetae larvae during

metamorphosis and benthic settlement.

Materials and methods

Sampling region. The Senghor Seamount is situated in a meso-

to oligotrophic region of the NE Atlantic Ocean and forms an

isolated topographical feature located in the Cape Verde

Archipelago, ~550 km from the West African mainland at

17.17°N 21.92°W (fig. la). The seamount is almost symmetrical

in shape, with a summit plateau in ~100 m water depth and a

northern base located at a depth of ~3300 m (fig. lb).

The Senghor summit and upper slopes are composed of

craggy areas of bare volcanic rock alternating with patches of

coarse sand consisting of coral and bryzoan fragments, sponge

spicules, shell gravel from molluscs and barnacles, and some

detrital matter. Mid-slope sediments are finer sand covered

with shell fragments, and deep-sea stations at the base of the

seamount comprise fine, clay-like deposits. Seafloor video

footage shows very diverse habitats and faunal communities,

especially at the summit, where the seafloor is covered in

sediment showing ripple marks (indicating strong currents).

Rocks protruding through sediment are overgrown with soft

corals, gorgonians and sponges. Deeper stations, at ~800 m

depth, have more sparsely populated soft-bottom habitats, but

also rocky areas with soft corals and diverse fish communities

(Christiansen et al., 2010).

Sampling methods. Chrysopetalid data presented in this study

were derived from Senghor Seamount samples collected from

a northern transect with four stations (fig. IB) and an eastern

transect with four stations, at depths of ~100-3300 m. No

chrysopetalids were found on the southern or western transects

(where only two stations were sampled) or at a reference station

situated 110 km north of Senghor.

The macrofauna was sampled using a German Multicorer

(MUC) with a core diameter of 94 mm, equivalent to 69.4 cm 2

surface area per core. Three deployments were made at each

station, with a minimum of three cores taken from each

deployment (i.e. a total of nine cores per station). The upper 5

cm of sediment was sliced for faunal analysis, and each

sediment sample was placed into a 4% formaldehyde solution

for a minimum of two days to fix the tissues prior to sediment

washing (to reduce damage to the individuals). The samples

were then gently washed on a 250-/<m-mesh sieve with filtered

seawater (20-/mi mesh size) and further rinsed in fresh water

before being transferred to 70% ethanol with 2% glycol added.

The macrofauna was initially sorted into major taxonomic

groups and counted. The polychaete fauna was then pooled, a wet

weight biomass value was obtained, and then sorting (nominally

to putative species level) was carried out. The Scottish Association

for Marine Science (SAMS) and the German Centre for Marine

Biodiversity Research (DZMB) undertook collections at Senghor

Seamount, and the chrysopetalid material is housed at the

National Museums of Scotland, Edinburgh (NMS), Senckenberg

Museum, Frankfurt (SMF) and the Museum and Art Gallery of

the Northern Territory, Darwin (NTM). Arichlidon gathofi

specimens are in the National Museum of Natural History,

Washington DC (USNM).

Chaetal terminology follows that of Watson Russell (1991)

with designations of notochaetal paleae based on position: i.e.

lateral group inserts below the acicula; main group above the

acicula; median group at the mid-dorsal line. Abbreviations

used: prefix / denotes larval; a = adult; p = primary; s =

segment. Chaetae: tc - transitory chaetae; la = lateral paleae;

ma = main paleae; me = median paleae; en = epitokous

neurochaetae; sn = superior group neurochaetae; if - inferior

group neurochaetae. Anterior end: Roman numerals (I—III)

indicate segment number; dc = dorsal cirrus; vc = ventral cirrus;

dtc - dorsal tentacular cirrus; vtc = ventral tentacular cirrus.

Systematics

Family Chrysopetalidae Ehlers, 1864

Thrausmatos Watson, 2001

Thrausmatos dieteri Watson, 2001: 57-66, Figs 1-5 [type species]

Thrausmatos senghorensis sp. nov. Watson, 2014

Zoobank LSID. http://z 00 bank. 0 rg/urn:lsid:z 00 bank. 0 rg:act:

B2A32582-0DCC-43C5-840C-6DBC9B1935D4

Figures 2A-D.

Material examined. Holotype: NE Atlantic, Cape Verde Archipelago,

Senghor Seamount, East transect, 17°09.66'N 21°53.12'W, some dead

coral, 1656.5 m. Core #01, coll. DZMB, Oct 2009, SMF 22963.

Paratypes: same details as holotype. Core 517 #08, coll. SAMS, 1,

NMS.Z.2013.160.01; 1,NTMW25388.

Chrysopetalidae (Annelida: Phyllodocida) from the Senghor Seamount, north-east Atlantic

313

- 22 * 12 '

- 22 * 03 '

21 * 54 *

-21 * 45 '

17 * 15 *

IT’OS*

- 22 ' 12 *

- 22 * 03 '

- 21 * 54 *

- 21 * 45 '

17 * 15 ’

17 * 06 *

Figure 1. A, Map of Senghor Seamount, located in the Cape Verde Archipelago, NE Atlantic. Data extracted from Smith and Sandwell (1997);

dataset created by A. Dale (SAMS). B, Senghor Seamount with the location of transects. Data and map created by Thor Hansteen and Alexander

Schmidt, GEOMAR. (A, B, reproduced from Chivers et al., 2013.)

314

C. Watson, A.J. Chivers, B.E. Narayanaswamy, P. Lamont & R. Turnewitsch

Figure 2. A-D: Thrausmatos senghorensis sp. nov., Senghor Seamount, SMF 22963. A, Anterior end, dorsal view, slide preparation; B, anterior end,

dorsal view; C, mid-body parapodium, slide preparation; D, detail of superior-most neurochaeta (asterisked in fig. 2C). Scalebars: A-C, 100 /iin;

D, 10/<m.

Description. Based on holotype, an anterior end of 15 segments,

length 2.5 mm, width 1.35 mm. Prostomium with subulate

median and two lateral antennae; two palps with ovoid bases,

subulate distal halves with broad, rounded tips; ovoid caruncle;

eye pigment absent. Segment I achaetose with 2 pairs of long

cirri; segment II with 2 pairs of long cirri, notochaetal fascicle;

segment III biramous with dorsal and ventral cirri, noto- and

neurochaetae. Prostomium, caruncle, all ceratophores darker

coloured, appear glandular; body epidermis dense with small,

rounded structures, probably bacteria. Elongate pharynx with

pharyngeal papillae and posterior muscular bulb, extends to

segments 8-9 (figs. 2A, B).

Pale golden palaeal notochaetae insert in fans that cover

the dorsum. Mid-body notochaetal fascicle with 2-3 short,

pointed lateral palae with 5-6 ribs. Main palaea number 10-12

with 16-17 ribs and a couple of lightly raised ribs; medial

main a little shorter with same number of ribs; widely spaced

horizontal striae. Larval-type main palaea distally with broad

‘shoulders’; adult-type main palaea more slender with rounded

‘shoulders’; apices prominent (fig. 2C). Very thin, short dorsal

acicula; slender dorsal cirri shorter or same length as fan.

Neurochaetae number about 30; with long blades and bifid

tips. Specialised superiormost fascicle with 2 short falcigers

with large basal serrations, inserts supra to overlying long,

robust ventral acicula (see asterisk indicating position, fig. 2C;

detail, fig. 2D). Mid-superior, middle and inferior neurochaetal

groups with very finely serrate falcigerous blades with tiny

bifid tips; long, slender ventral cirri (fig. 2C).

Remarks. Elaboration of body shape and posterior end is not

possible as all type material is fragmented. The two paratype

specimens are both composed of anterior ends of seven

segments and display no deviations in chaetal morphology

from the holotype.

Thrausmatos species are deep-sea dwellers found only at

depths >1000 m. Thrausmatos dieteri Watson, 2001 was

originally described from hydrothermal vents and seeps from

Fiji and New Guinea, SW Pacific. Thrausmatos is a new

record for the Atlantic and T. senghorensis sp. nov. is the first

record from a nominal non-chemosynthetic habitat.

Thrausmatos senghorensis individuals are smaller bodied

than those of T. dieteri and differ in: the more rounded shape

of the main palaea and their lack of numerous heavy raised

ribs; lesser number of lateral palaea (3 vs. 5-6); shorter dorsal

cirri; short falcigers rather than long spinigers of the

specialised neurochaetal superior fascicle (fig. 2D); and

Chrysopetalidae (Annelida: Phyllodocida) from the Senghor Seamount, north-east Atlantic

315

absence of pronounced ventral pads. It is very difficult to

discern gametes with the opacity of the thick epidermis, which

is covered in multiple rounded structures resembling bacteria

(fig. 2C). This was also observed in T. dieteri (Watson, 2001).

Thrausmatos senghorensis is found at the Senghor

Seamount in depths of between 1000 and 3000 m, where

ferromanganese crusts are formed at the interface of waters of

the oxygen minimum zone and deeper waters (Wang et al.,

2011). Although there is no indication of vents or seeps in the

area (Chivers, unpublished data), a megacore sample from

mid-slope depths on the East transect revealed numerous

barnacle plates, suggesting a former vent community that had

collapsed (Christiansen et al., 2010). It is possible that the

presence of T. senghorensis at Senghor Seamount indicates

past or as yet undetected hydrothermal activity.

The specialised neurochaetal fascicle appears to be a

permanent structure in both small and large individuals of

Thrausmatos species. These compound chaetae insert in a

superior position overlying the ventral acicula of the

neurochaetal fascicle. They are much shorter than the transient,

long fascicle observed in gametogenic swimming individuals

of Arichlidon and Dysponetus. Larval stages of Thrausmatos

species are not yet documented.

Distribution and habitat. Thrausmatos senghorensis is found

at Senghor Seamount, NE Atlantic, at -1600 m, among bare

volcanic rock and patches of predominantly fine sand and shell

fragments.

Etymology. The species name, senghorensis, is named after

Senghor Seamount.

Dysponetus Levinsen, 1879

Dysponetuspygmaeus Levinsen, 1879: 9, PI. 1, Figs 1-6 [type

species]

Dysponetus caecus (Langerhans, 1880)

Figures 3A, B.

Chrysopetalum caecum Langerhans, 1880: 278-279, NE Atlantic,

Madeira Island.—Laubier, 1964: 125-138, Mediterranean, 32 m.

Dysponetus caecus Dahlgren and Pleijel, 1995: 159-173, NE

Atlantic, Mediterranean, intertidal to 85 m.—Boggemann, 2009: 283-

296, East Atlantic, Angola Basin, to 5494 m.

Material examined. Dysponetus caecus NE Atlantic, Cape Verde

Archipelago, Senghor Seamount, 17°21.82'N 21°57.93'W, North

transect. Core 1511 #11, 3241 m, coll. SAMS, Oct 2009, SMF 22964.

Description. Anterior fragment with 13 segments, 3.4 mm

long, 1.6 mm wide. Streamlined body, with tapered anterior

end. Transparent to silvery notochaetal spines in long fascicles

covering dorsum; neurochaetae extend out beyond notochaetae.

Prostomium rounded to quadrate, with glandular, ovoid,

unpigmented patches on the prostomium, lateral antennae

broken, medial papillae (median antenna?) present; 2

ventrolateral palps with broad bases, subulate tips, moderate

length. Elongate, single lobe present on posterior margin of

mouth; elongate pharynx to segment 7-9 with pair of slender,

red-brown stylets (fig. 3A).

Anterior segment I very contracted, with 2 pairs of cirri,

dorsal tentacular cirri broken, ventral tentacular cirri present.

Segment II biramous with notochaetae and dorsal cirri,

neurochaetae, no ventral cirri; notopodia of segment III with

notochaetae and dorsal cirri, neuropodia with subulate

ventral cirri.

Notochaetal spines long, especially mid-body; with 2 rows

of long spinelets. Notopodia with elongate dorsal ceratophores;

cirrostyles mostly broken. Shorter dorsal cirri on anterior

segments become longer after segment 5. Compound

neurochaetae with slender shafts with bifid tip at joint and long,

slender, finely serrate blades, minute blade tips unidentate to

bifid. Very long-shafted, specialised swimming neurochaetae,

numbering 4-6 insert in superior-most position (fig. 3B).

Remarks. In the absence of extant type material of

Chrysopetalum caecum (Langerhans, 1880) from Madeira

Island, NE Atlantic, Dahlgren and Pleijel (1995) designated a

neotype from southern France, Mediterranean. The authors

redescribed the species and placed it within the genus

Dysponetus. More recently Boggemann (2009) described

Dysponetus caecus from abyssal depths off Angola, West

Africa, South-east (SE) Atlantic.

Dysponetus caecus Senghor Seamount and Madeira Island

specimens of Langerhans (1880: Fig. 9C) have moderate

length palps. Palps are lost in Boggemann’s specimens of

abyssal material from Angola (2009: Figs 20A, B). All

Mediterranean material described by Laubier (1964: Fig. 1A)

and Dahlgren and Pleijel (1995: Fig. 3A) have longer palps.

The arrangement of segments of the anterior end, based

primarily on Mediterranean material, and agreed on by

Laubier (1964) and Dahlgren and Pleijel (1995), are as follows:

segment 1 with 2 pairs of cirri; segment 2 uniramous with

notochaetae and dorsal and ventral cirri; segment 3 biramous

with dorsal and ventral cirri and chaetigerous lobes. Segment

1 of Senghor material agrees with the above but segment 2 is

biramous with chaetigerous lobes and dorsal cirri but no

ventral cirri. There appears no sign that ventral cirri were

broken off from neuropodia 2, although cirri are fragile and

easily lost in dysponetids. More entire material would be

needed for confirmation.

A marked increase in notochaetal length has not been

observed before in Dysponetus (CW, pers. obs.). These longer

notochaetae appear in D. caecus from Senghor Seamount in

segments 9-13, the same segments that possess epitokous

neurochaetae (fig. 3A). Slender, non-epitokous neurochaetal

blades of D. caecus appear spinigerous under the light

microscope. Only on highest magnification do the tips of

neurochaetae appear unidentate or bifid within the same

individual (also observed by Dahlgren and Pleijel (1995)).

Neuropodia are very slender with a compressed, dense

neurochaetal fascicle. Simple neurochaetae, described in D.

caecus (Dahlgren and Pleijel, 1995), were not discerned.

Epitokous swimming neurochaetae, similar to those

described in planktonic adults of Arichlidon species (Watson

Russell, 1998, 2000), have been observed in Dysponetus

gracilis Hartman, 1965 from deep waters of the NE Atlantic

by Aguirrezabalaga et al. (1999) and in gametogenic

316

C. Watson, A.J. Chivers, B.E. Narayanaswamy, P. Lamont & R. Turnewitsch

Figure 3. A-B: Dysponetus caecus, Senghor Seamount, SMF 22964. A, Anterior end, dorsal view, slide preparation; B, neuropodium XII with

superior swimming neurochaetae. Scalebars: A-B, 100/«n.

undescribed species of Dysponetus and Pseudodysponetus

(Boggemann, 2009) from southern Australia (CW, unpubl.

obs.). These extended, very long-shafted and bladed,

compound chaetae insert in a superior position within the

neurochaetal fascicle and are recorded for the first time in the

male D. caecus from Senghor Seamount (fig. 3B).

Very little is known of the larval stages of Dysponetus

species. The only two instances recorded are of benthic larvae

of Dysponetus pygmaeus (Watson Russell, 1987) and planktonic

larvae of Dysponetus cf. pygmaeus (Yokouchi, Fig. in litt .).

Dysponetus caecus can be separated from its congeners

based on a few combinations of characters. However, it is clear

that within D. caecus there are a number of morphological and

ecological disparities between Mediterranean and NE Atlantic

forms, e.g. palp length and anterior segment formulae; and

large depth differences reported between regions e.g. intertidal

Chrysopetalidae (Annelida: Phyllodocida) from the Senghor Seamount, north-east Atlantic

317

in Mediterranean to ~5000 m off Angola. Morphological

revision and genetic analysis of fresh material would help to

resolve whether NE Atlantic and Mediterranean Dysponetus

caecus, as presently understood, is a single species or a

complex of cryptic species.

Habitat and distribution. At Senghor Seamount Dysponetus

caecus occurs among the least-biomass and fine clay-like

sediments recorded at the base in ~3000 m depths (Chivers et

ah, 2013). The nominal distribution of D. caecus is currently

from 52°N to 19°S in the East Atlantic, including the

Mediterranean. Dysponetus caecus has been collected from

hard and soft substrates, from 1 m to depths of over 5000 m

(Dahlgren and Pleijel, 1995; Boggemann, 2009).

Dysponetus sp. 1

Material examined. Senghor Seamount, 17°12.30'N 21°57.70'W,

North transect. Core 1509 #01, shelly sand, 133 m, coll. SAMS, Oct

2009, SMF 22963.

Description. One anterior end of 9 segments, 1.2 mm long, 0.9

mm wide. Very small bodied, body fragmented after pharynx

level. Prostomium quadrate, with two pairs of large, entire

eyes; two small lateral antennae visible on anterior edge of

prostomium, median antenna broken, two ventrolateral palps

with subulate tips, moderate length. Elongate, single lobe

present on posterior margin of mouth; elongate pharynx with

pair of slender, red-brown stylets; everted proboscis with ring

of small papillae.

Anterior segments: very reduced, achaetose segment I with

2 pairs of long dorsal cirri, ventral cirri bases evident; segment

II biramous with notochaetae, long dorsal cirri, neurochaetae,

no ventral cirri; notopodia of segment III with notochaetae,

dorsal cirri, neuropodia with neurochaetae, small, subulate

ventral cirri, not extending past neuropodial tip.

Notochaetal spines moderate length with two rows of

spinelets; compound neurochaetae with slender shafts, slender,

finely serrate blades, minute blade tips unidentate to bifid.

Remarks. Overall anterior end and chaetal characters agree

between the shallow and deep Dysponetus individuals, but the

smaller Dysponetus sp. 1 possesses two pairs of large red eyes,

and all D. caecus material from both shallow and deep waters

have been described in the literature as lacking eyes.

The only dysponetid described with eyes from the NE

Atlantic is Dysponetus joeli Olivier, Lana, Oliveira &

Worsfold, 2012 recorded from the English Channel in a maerl,

shallow-water habitat. Without examining original Dysponetus

joeli material, it is not possible to compare the single Senghor

Seamount specimen based on the poorly preserved material

figured and described in the literature.

Habitat. Dysponetus sp. 1 is found at 133 m at Senghor

Seamount among coarse sediments.

Arichlidon Watson Russell, 1998

Arichlidon hanneloreae Watson Russell, 1998: 160, Figs 1-4

[type species]

Arichlidon reyssi (Katzmann, Laubier & Ramos, 1974)

Figures 4A, B.

Bhawania reyssi Katzmann, Laubier & Ramos, 1974: 313-317,

Fig. 1A-G. Type locality: Adriatic Sea.

Paleanotus heteroseta Rullier, 1964: 142-3. Cape Verde Islands.

Chrysopetalum debile Cazaux, 1968: 536-541. Arcachon, France

(larvae).

Arichlidon reyssi Watson Russell, 1998: 159-176, Figs 4C, 6G,

H. Adriatic, Mediterranean, Cape Verde Islands.

Arichlidon reyssi Watson Russell, 2000: 465-477, Fig. 1A-D.

Eastern Mediterranean

Material examined: NE Atlantic, Cape Verde Archipelago, Senghor

Seamount, East summit, 17°12.30'N 21°53.12'W, shelly sand, 133.6 m.

Core 1510 #08, coll. SAMS, 14, NMS.Z.2013.160.02; 17°10.62'N

21°56.83'W, 103.1 m, coarse sediment. Core 1531 #11, coll. SAMS, 3,

NMS.Z.2013.160.03; 17°12.29'N 21°57.69'W, 132.4 m, Core #01, coll.

DZMB,4, NMS.Z.2013.160.04; 17°10.62’N 21°56.84W, 103.1 m. Core

#01, coll. DZMB, 3, NMS.Z.2013.160.05; 17°10.62'N 21°56.82'W,

102.7 m. Core #01, coll. DZMB, 1, NMS.Z.2013.160.06; East summit,

17°12.30'N 21°57.70'W, 133.6 m, shelly sand. Core 1510 # 12, coll.

SAMS, 2, NMS.Z.2013.160.07; East summit, 17°12.30’N 21°57.70'W,

shelly sand, 133 m, Corel509 #02, coll. SAMS, 2, NMS.Z.2013.160.08;

17°09.66'N 21°53.12’W, dead coral, 1656.5 m. Core 1517 #08, coll.

SAMS, 2, NMS.Z.2013.160.09; East summit, 17°12.30’N 21°57.70'W,

shelly sand, 133.6m, Corel510#10,coll.SAMS,3,NMS.Z.2013.160.01;

17°10.62'N 21°56.82'W, Core #04, 102.7 m, coll. DZMB, 2, SMF

22965; 17°1210.62’N 21°56.84’W, Core #05, 103.1 m, coll. DZMB, 6,

SMF 22966; 17°12.29’N 21°57.69’W, Core #07, 132.4 m, coll. DZMB,

17, SMF 22967; 17°10.62'N 21°56.84'W, Core #08, 103.1 m, coll.

DZMB, 2, SMF 22968; 17°10.62'N 21°56.82’W, Core #10, 102.4 m,

coll. DZMB, 8, SMF 22969; 17°12.29'N 21°57.69'W, Core 864 #02,

132.4 m, coll. DZMB, 10, NTM W 025386; East summit, 17°12.30'N

21°57.70'W, Core 1509 #01, shell sand, 133 m, coll. SAMS, 3, NTM

W25387.

Description. Largest individual measuring 50 segments, length

5.0 mm and width 1.1 mm. Body relatively short, broad, with

silver to pale-golden palaeal fans, often with brownish scale

bands, covering dorsum. Prostomium with two pairs of violet-

black eyes often fused, forming rectangular block visible

beneath palaea of anterior segments (fig. 4A). Segment I with

two pairs of dorsal and ventral tentacular cirri; segment II with

palaeal notochaetae, dorsal cirri, neurochaetae, ventral cirri

absent. Lateral palaea fascicle intergrades smoothly with main

palaea fascicle; distinctive group of asymmetrical ornate

median palaea interlock middorsal line forming smooth convex

ridge. From segment VI median group palaea number 3-5.

Long lateral-most median palae appears first at segment VI and

continues down body as tallest palae in entire fan (fig. 4B).

Dorsal surface of notochaetal palae with tubercules and raised

serrate ribs. Neurochaetae comprising superior group of

spinigers; mid group with strongly dentate falcigers; inferior

group falcigers with short, broad, curved articles with smooth

to minutely serrate margin and blunt tip.

Remarks. One character, not reported on previously, and

observed in 67 individuals of Arichlidon reyssi at Senghor

Seamount and in material of all other re-examined Arichlidon

species, is a distinctive paired structure at a level near the top

of the pharynx. It is composed of two small, brownish,

318

C. Watson, A.J. Chivers, B.E. Narayanaswamy, P. Lamont & R. Turnewitsch

Figure 4. A-B: Arichlidon reyssi, adult, Senghor Seamount, NMS.Z.2013.160.09, slide preparations. A, Anterior end; B, mid-body notopodium

from anterior end. Scalebars: A, 100 /<m; B, 50/*m.

Chrysopetalidae (Annelida: Phyllodocida) from the Senghor Seamount, north-east Atlantic

319

triangular structures sitting opposite each other, either side of

the pair of stylets (fig. 4A). When dissected they spill out

densely packed, tiny, golden-brown globules; function currently

unknown. They are reminiscent of the oil globules common to

many chrysopetalid species that occur as larger, singular

globules inside parapodia (Watson, 2012).

Epitokous swimming neurochaetae, described from both

benthic and planktonic adults in all nominal Arichlidon

species (Watson Russell, 1998, 2000), were not seen in any

Arichlidon reyssi individuals in the present study.

Adult specimens of Arichlidon reyssi from the Cape Verde

Archipelago (Maio, Brava and Boavista Islands) in sponge,

shell and sediment samples, depth 20-425 m, were included in

the description of the new genus Arichlidon and a redescription

of A. reyssi from the Adriatic and Mediterranean Seas and NE

Atlantic (Watson Russell, 1998). Arichlidon reyssi specimens

observed in this present study from Senghor Seamount

morphologically agree with the former Cape Verde material

examined in all characters of body shape, size, colouration,

notochaetal and neurochaetal characters, including numbers

of palaeal ribs and chaetal types.

Previously, Arichlidon reyssi have been collected in

moderately large numbers (e.g. 82 individuals from one

station) and over large depth ranges (10-4000 m) in the

Eastern Mediterranean (Watson Russell, 1998). At Senghor

Seamount, A. reyssi ranges from the summit at 102 m to mid¬

slope depths of over 1000 m. In both cases, no discernible

morphological differences were found between individuals at

different depths.

Arichlidon is one of a number of chrysopetalid taxa that

possess primarily cryptic species with a very conservative

morphology. Watson Russell (2000) described a new species,

Arichlidon gathofi from the western Atlantic, and compared it

with A. reyssi on the basis of one character in particular. In A.

reyssi, the long lateral-most median palae, with a higher

number of ribs, is taller than the main fan (fig. 4 B); in A.

gathofi, the lateral-most median palae, with a slightly lesser

number of ribs, is the same height or shorter than the main fan

(fig. 6E). This singular median-palae is evident in mid-body

segments in juvenile and adult material examined and

dissected from both species (Watson Russell, 2000: 476). In

order to identify chrysopetalid larvae to species, it is essential

to study chaetal patterns throughout the entire body. In the

interests of distinguishing Atlantic Arichlidon larvae to

species, and to elaborate on the sequence of changes in the

morphology of planktonic to benthic individuals, larvae of A.

reyssi and A. gathofi are described below.

Distribution and habitat. Benthic adults of Arichlidon reyssi

are found from the Mediterranean, NE Atlantic coast, and the

islands and seamount of the Cape Verde Archipelago. Among

the Senghor Seamount chrysopetalid fauna, A. reyssi comprises

the largest number of individuals, which predominantly dwell

in coarse sediments at the summit at ~100 m, among the largest

polychaete biomass recorded. There is also one record from

mid-slope at 1651 m.

Arichlidon reyssi metatrochophore planktonic larvae

Figures 5A-F.

Material examined: NE Atlantic, France, Arcachon, from plankton

outside Marine Station, Nov 1987, coll. C. Cazaux, 3 entire specimens

all 6 segments.

Description based on planktonic specimens. 1: Length 480

pm, width 440 pm; 2: length 640 pm, width 440 pm; 3: length

720 pm, width 520 pm; NTM W25385.

Broad, ovoid bodies filled with dense oily droplets;

conspicuous fascicles of long, brown, latero-anteriorly directed

transitory notochaetal spines in first chaetigerous segment (fig.

5A). Smallest larva 1 with notochaetal fans more folded and

bare mid dorsal line; larvae 2 and 3 with notochaetal palaeal

fans spread over dorsum from segments II-VI; compound

falcigerous neurochaetae from segments II-VI. All larvae

possess large rounded epispheres with three pairs of eyes;

largest pair in anterodorsal position with apparent lenses,

smaller pairs more dorsal. Larva 1 prostomium with small,

unpaired, anterolateral cirrus (developing lateral antenna?);

larva 3 with circular hyaline patch mid-episphere and

developing mouth. No median antennae, palps or nuchal

organs visible.

Small ciliate ‘buds’ present each side of body at posterior

latero-dorsal edges of episphere at dividing line between head

and trunk (nascent adult segment 1). Larval segment I with

two pairs of larval tentacular cirri, longer than following cirri;

inserting at the same level as the transitory notochaetae.

Transitory notochaetae insert in large, rounded dorso-lateral

lobe with 2 aciculae; number ~15, with larger spinelets along

entire lateral edge and minor spinelets in another plane along

part of length (figs 5A-D).

Segment II, ventral view: very small neuropodial rami

present and directed towards mid-body ventral line i.e. not

laterally; with fascicles of spinigerous neurochaetae, ventral

cirri absent. Neuropodia III-V1 with subulate ventral cirri

(fig. 5C).

Notopodia of segments II—III with larval primary palaea

types only: with 2-4 lateral palaea, 1-3 short spines, 4 large

symmetrical main palaea and 2 broad asymmetrical palaea in

medial-most position. Notopodium of segment III with 2

lateral palaea with 8-12 ribs, 5-7 main palaea with 17-21 ribs

and 4 symmetrical median palaea. Larval main palaea distally

rounded. Subsequent notopodia with 1 small spine overlying

dorsal aciculum; notopodia of segments II-VI with relatively

short, subulate dorsal cirri (fig. 5B).

Segments IV-VI notopodium with adult chaetal types

replacing larval types. Notopodia of segment IV with 4 lateral

palaea with 6-14 ribs; 4-5 main palaea with 15-19 ribs,

including large, slightly asymmetrical subunit 1 palae with

19-20 ribs and 3 raised serrated ribs; 5-6 median palaea

grading in size and degree of asymmetry with 7-14 ribs,

including tall lateral-most one with 2-3 raised and serrated

ribs as tall as or taller than main palaea group) (fig. 5E).

Notopodia of segment V with 3 lateral, 4 main and 5 median;

notopodia 6 with small notosetal fascicle comprising 1-2

slender lateral, 2 main and 3 short median palae. Adult main

palae distally squarer (fig. 5F).

320

C. Watson, A.J. Chivers, B.E. Narayanaswamy, P. Lamont & R. Turnewitsch

Figure 5. A-F: Arichlidon reyssi 6-segmented larva, Arcachon, NE Atlantic, NTM 25385; A, D-F: slide preparations. A, Entire larva, dorsal

view; B, anterior end, dorsal, left side detail (transitory chaetae drawn in part); C, anterior end, ventral view, left side detail; D, detail of anterior

end of fig. 5A; E, notopodium segment IV; F, neuropodia segments IV and V. Scalebars: A, 50/«n; B-C, 100//m; D-F, 10 ji m.

Chrysopetalidae (Annelida: Phyllodocida) from the Senghor Seamount, north-east Atlantic

321

Segment III neuropodia mainly with falcigerous

neurochaetae with slender, narrow blades; recognisable adult

chaetae and adult types from neuropodia of segments IV-VI.

Neuropodium of segment IV with 1 superior spiniger, 2-4 mid¬

superior falcigers with long blades, 4 mid-inferior falcigers

with shorter blades and 6-8 inferior falcigers with typical adult

smooth, short, curved blades (fig. 5F). Neuropodium of segment

VI with 1-2 superior long, narrow-bladed falcigers and 2-3

lower falcigers with shorter, slender blades. All neuropodia

with 1 short, simple spine overlying ventral acicula. Pygidium

composed of ventral median conical protruberance and dorsal

rounded structure with two lateral anal cirri.

Remarks. Cazaux (1968) provided detailed figures of the early

development of a species he identified as Chrysopetalum

debile, collected at different stages from the plankton at

Arcachon, NE Atlantic. The ‘C. debile’ identification was

based on one of a number of chrysopetalid species present in

the region, and original material was subsequently lost. Study

of recent material of metatrochophore chrysopetalid larvae

from the same locality and described in this paper, confirms

Cazaux’s material as most likely belonging to the species

Arichlidon reyssi.

Behavioural observations in Cazaux’s 1968 paper include

a description of the planktonic larvae not feeding but living on

their reserves and at the slightest touch rolling into a ball,

becoming bristly like a ‘Chaetosphera’ larvae. He observes

there is a planktonic duration of at least three weeks between

metatrophore 1 to nectochaete 1, and their presence in stations

located between the ocean and inner estuary of the Bay of

Arcachon between October and December. Bhaud in litt.

mentions their presence in the Western Mediterranean

between August and October.

Distribution. Planktonic larvae of Arichlidon reyssi have been

reported from the Mediterranean and NE Atlantic coast.

Arichlidon gathofi benthic nectochaete larvae

Figures 6A-F.

Arichlidon gathofi Watson Russell, 2000: 465-477

Figures 1-5.

Material examined: Paratypes. USA, off North Carolina, western

Atlantic, Stn. 2606, 34° 35'N 75° 52'W, 45 m, coll. RV Albatross, 18

Oct 1885, USNM 186017. Note: 148 individuals were collected; among

these were 36 juveniles and 4 late nectochaete larvae, the latter

described herein.

Description based on benthic specimens. 7 segments: length 520

pm, width 500 pm (fig. 6A, B); 7 segments: length 460 pm, width

460 pm\ 8 segments: length 540 pm, width 460 pm\ 10 segments:

length 700 pm, width 500 pm; 11 segments: length 840 pm,

width 52 pm; 14 segments: length 920 pm, width 520 pm.

Larvae of 7 segments with broad, ovoid body shape with

palaeal fans fully extended over dorsum, neurochaetae

extending out beyond palaea; dense oil globules in gut.

Rounded prostomium with faint red eye pigment visible; short,

stout median antenna inserts on anterior edge of prostomium;

lateral antennae, palps and nuchal fold absent. Segments I—III

in adult configuration (figs 6A, B). Segment I more visible in

ventral view, with two pairs of dorsal and ventral tentacular

cirri (fig. 6B).

Notopodium of segment II with 2 narrow palaea, 6-8 ribs.

Notopodium of segments II-IV include primary, expanded

palaea in medial position with 15-16 ribs (fig. 6C). Segments

V-VII with adult type, slimmer, asymmetrical median palaea,

numbering 2-3, shorter than main fan, with 11-14 ribs (fig.

6D). Broad, asymmetrical medial-most, subunit 1, main palae

(A. gathofi species character) present posterior segments VI-

VII. Prominent, curved notochaetal spine originating from

lateral group (continues into adult); subulate dorsal cirri

present on all notopodia (figs 6C, D).

Neurochaetae of segment II all spinigers; neurochaetae of

segments III—VII include 2-3 superior spinigers; adult groupings

of mid-superior and mid-inferior falcigers; typical short, curved

articles of inferior falcigers. Pygidium composed of slender

ventral cone and dorsal structure with two filiform anal cirri.

Post-larvae and juveniles 8-14 segments with body slightly

tapered anteriorly and posteriorly; neurosetae not extending

out beyond palae. Prostomium smaller with two pairs of eyes,

longer, subulate median antenna, two lateral antenna and two

ventral, long, cylindrical palps. Triangular mouth fold

posterior to palps, pair of stylets evident in pharynx; raised

glandular nuchal fold present posterior to prostomium.

Increasing numbers of adult main palaeal notochaetae and

neurochaetae with increasing body segments.

Remarks. Chrysopetalid notochaetal palaea, spines and

neurochaetal shafts are composed of internal longitudinal ribs

and horizontal diaphragms (Westheide and Watson Russell,

1992). The appearance of the first chaetae arises in the

trochophore after initiation of the first larval segment. These

long, brown, spinulose provisional chaetae are internally

striated. The metatrochophore 4-segmented larvae develop

compound falcigerous neurochaetae with striated shafts, and

the generation of the sixth segment initiates primary, laterally

folded, notochaetal palaeal fans and spines, all striated

internally (Cazaux, 1968; Watson Russell, 1987).

This construction of internally striated chaetae creates

maximum strength and lightness for larvae and adults found

mid-water. Adult chrysopetalids may also possess epitokous,

swimming neurochaetae, as first described for Arichlidon

gathofi collected from the plankton (Watson Russell, 2000,

Fig. 5A, and reproduced in this paper as fig. 6F).

Mileikovsky (1962) observed that the long provisional

chaetae found in chrysopetalid, sabellariid and some

‘Chaetosphaera’ spionid trochophore larvae are probable

convergent structures suited to a similar pelagic mode of living,

with larvae able to be transported very long distances. There is

no record of chrysopetalid teleplanic larvae, but chrysopetalid

metatrochophore larvae have been collected from vertical

plankton tows from the surface down to 100 m, in 3000-4000

m depth in the Gulf Stream, NW Atlantic (Mileikovsky, 1962).

Original material was lost but its identity is inferred from his

figures as belonging to either the genus Arichlidon or the deep-

sea-dwelling Strepternos (see Watson Russell, 1997).

322

C. Watson, A.J. Chivers, B.E. Narayanaswamy, P. Lamont & R. Turnewitsch

Figure 6. A-F: Arichlidon gatliofi, 7-segmented larva, Carolina, West Atlantic, USNM 186017. A, Entire larva, dorsal view; B, ventral view of

A; C, notopodium segment IV; D, notopodium segment VI (figs A, C, after Watson Russell, 1987: Figs 28.4, 6: as ‘new genus 1’). E, A. gathofi,

adult, mid-body notopodium, detail median fascicle; F, mid-body neuropodium with epitokous swimming neurochaetae (figs E, F after Watson

Russell, 2000: Figs ID, 5A). Scalebars: A, 200/un; B, 350/^m; C-E, 40 pirn-, F, 100/un.

Chrysopetalidae (Annelida: Phyllodocida) from the Senghor Seamount, north-east Atlantic

323

Distribution and habitat. Arichlidon gathofi is found from

North Carolina, USA to Panama, Central America, western

Atlantic. Benthic habitat varies from silty sands in the Gulf of

Mexico to algal, sea-grass, shell and coral rubble substrates of

the islands of the north and south Caribbean; 1-106 m.

Remarks on the larval morphology and development of

Arichlidon reyssi and A. gathofi. Metamorphosis at the

6-7-segment stage occurs at benthic settlement and includes

loss of larval notopodia 1 (comprising larval pair of cirri and

transitory, provisional chaetae, figs. 5A-D) and development

of adult segment I in a dorsal/ventral plane. The episphere

reduces in size as it differentiates into a more adult prostomium

and its appendages develop. Concurrent with these changes is

development of adult notopodia II and III with forward rotation

and part fusion, particularly evident in dorsal view; larval

primary palaea are lost on notopodia II and replaced by a few,

short adult palaea (fig. 6A). The nuchal fold begins to take

shape as a result of these former changes and forms part of the

retraction mechanism of the anterior end. A discreet caruncle,

as postulated by Cazaux (1968), is found primarily in

Chrysopetalum and is not present in Arichlidon species.

Adult segment I is developed from the ciliate buds seen in

the larvae at the conjunction of the episphere and trunk (fig.

5A-D). From a 7-segmented larvae onwards, this segment I

appears reduced and fused in part to the prostomium. It

supports a pair of dorsal and ventral cirri that are often more

visible in ventral view. These later-formed adult cirri are

shorter than the larval pair and are approximately the same

size as those dorsal cirri seen in segment II (fig. 6A, B). At no

developmental stage are chaetae present on adult segment I in

Arichlidon species, and the term ‘tentacular’ is therefore

retained as a descriptor for the cirri of this segment.

A similar series of morphological changes has been

described for the larval deep-sea chrysopetalid Strepternos

didymopyton Watson Russell, 1991, which has the same

anterior end schema, i.e. segment I with two pairs of tentacular

cirri, segment II with notopodia, chaetae, neuropodia with

chaetae, ventral cirri absent (Watson Russell, 1997). In

Strepternos and Arichlidon, the small neuropodia 1 does not

at any time possess ventral cirri (fig. 5C, 6B). It has been the

contention of some authors, e.g. Perkins, 1987, that there has

been loss of ventral cirri from this segment during ontogeny.

Identification of Atlantic Arichlidon larvae to species. Chaetal

patterns in the midposterior body of chrysopetalid larvae can

be used for identification to genus and species (Watson Russell,

1987). The shape of the main palaea (and particularly the

inferior-most curved, falcigerous neurochaetae from posterior

segments) identify the above larvae as belonging to the genus

Arichlidon (fig. 5F). Adult lateral, main and median palaeal

types are present from segments IV-VI, with the overall

highest numbers of adult chaetal types present in segments

IV-VI in A. reyssi and segments V-VII in A. gathofi. The tall

lateral-most median palae—a distinguishing species character

for A. reyssi— is clearly visible from segment IV (fig. 5E); the

shorter, broader median palae visible from segment V in A.

gathofi (fig. 6D).

Discussion

Dispersal mode and depth ranges of chrysopetalid species at

Senghor Seamount

The polychaete fauna of the Cape Verde Islands represents

West African species, American elements absent from the

continental African plateau, small numbers of endemic

species, and species from the southern limit of the NE Atlantic

and Mediterranean (Ruillier, 1964). Senghor Seamount

chrysopetalid species present in this study comprise a

predominantly eastern Atlantic fauna. Thrausmatos species

are deep-sea dwellers found only at depths greater than 1000

m, and the new species, T. senghorensis, is potentially a NE

Atlantic seamount endemic. Dysponetus caecus and

Arichlidon reyssi are regional benthic species: A. reyssi from

the Mediterranean Sea and the NE Atlantic coast, including

the Cape Verde Archipelago; D. caecus from the Mediterranean

Sea, NE to SE Atlantic coast, including off West Africa.

Dispersal of chrysopetalid larvae and swimming adults to

and from Senghor Seamount must largely be determined by

regional and local hydrodynamic regimes. NE Atlantic water

circulation near the surface does not favour transport of larvae

from the European mainland towards seamounts (Surugiu et

al., 2008). Mediterranean water outflow occupies the NE

Atlantic at depths of around 1000 m; one branch forms an

eastern boundary slope current, the other forms isolated

anticyclonic vortices, with velocities of up to 30 cm s 1 , referred

to as Meddies. Meddies consist of lenses of warm, salty water

with a diameter of around 60 km that move westwards at a

depth interval of 800-1400 m. Those that do not collide with

seamounts may have a lifetime of up to five years (Richardson

et al., 2000). Meddy structures have been inferred at Senghor

from 200 m (Christiansen et al., 2010). Planktonic larvae and

swimming adults of Arichlidon reyssi and Dysponetus caecus

hypothetically could disperse by passive travel in the deeper

currents and Meddies in a ‘stepping stone’ fashion along

continental margins and between islands and seamounts.

Deep-sea communities are known to be strongly influenced

by bathymetric gradients, although the exact controls of depth

zonation remain conjectural (Carney, 2005). Arichlidon reyssi

shares records with Dysponetus caecus for extreme depth

ranges (from shallow to abyssal waters) within the

Mediterranean and NE Atlantic. At Senghor Seamount,

individuals of Arichlidon reyssi, morphologically identical,

are found at ~100 m and also at ~1600 m. This raises the

question—are we dealing with the same species or a number

of cryptic species over these depth ranges?

Bik et al. (2010) found low genetic divergence across

vertical depths (~2800 m) among Antarctic taxa, and identical

gene sequences recorded over a 680-m depth range in another

taxon within the free-living marine nematodes. Genetic

analyses suggest the same species is present between 400- and

1800-m depths in a poeobiid polychaete species off Central

California (K. Osborn, pers. comm.), and results for cryptic

species of phyllodocid polychaetes on the NE Atlantic

continental shelf of between <100 m and >1000 m confirmed

shallow and deep forms represented different species (Nygren

et al., 2010).

324

C. Watson, A.J. Chivers, B.E. Narayanaswamy, P. Lamont & R. Turnewitsch

DNA studies of Arichlidon reyssi and Dysponetus caecus

benthic populations at different depths would help to resolve:

(i) whether the same species has the ability to live and move

between areas of very different depths; (ii) whether this is

evidence of the existence of different species belonging to a

number of clades that may be sympatric at different depths; or

(iii) whether these are distinct species living at different depths

with no apparent morphological distinguishing characters to

separate them.

Acknowledgements

CW is grateful to Claude Cazaux and his gift of specimens

from Arcachon, to Will Watson Russell for help with digital

illustrations, and to the Museum and Art Gallery of the

Northern Territory (MAGNT), Darwin, for ongoing support.

The authors would like to thank the crew of the RV Meteor,

the chief scientist Dr Bernd Christiansen, all the scientific

personnel of research cruise M79-3, and Dr Kai George at

DZMB. The research leading to these results has received

funding from the Natural Environment Research Council

(grant awarded to RT and BEN, NE/G006415/1) and the

European Community’s Seventh Framework Programme

(FP7/2007-2013) under the HERMIONE project (awarded to

BEN, grant 226354). AC was jointly funded through a PhD

studentship from the NREC and from the MASTS pooling

initiative (The Marine Alliance for Science and Technology

for Scotland), funded by the Scottish Funding Council (grant

HR09011). All support is gratefully acknowledged.

References

Aguirrezabalaga, E, San Martin, G., Petersen, M.E., and Ceberio, A.

1999. Presencia de Dysponetus gracilis Hartman, 1965

(Polychaeta, Chrysopetalidae) en las costas europeas, Golfo de

Vizcaya. Boletin de la Real Sociedad Espanola de Historia,

Natural (Seccion Biologica) 95(3-4): 21-25.

Bik, H.M., Thomas, W.K., Lunt, D.H., and Lambshead, J.D. 2010.

Low endemism, continued deep-shallow interchanges, and

evidence for cosmopolitan distributions in free-living nematodes

(order Enoplida). BMC Evolutionary Biology 10 (389): 1-10.

Boggemann, M. 2009. Polychaetes (Annelida) of the abyssal SE

Atlantic. Organisms, Diversity & Evolution 9: 251-428.

Carney, R.S. 2005. Zonation of deep biota on continental margins.

Oceanography and Marine Biology: an Annual Review 43: 211—

278.

Cazaux, C. 1968. Etude morphologique du development larvaire

d’Annelides Polychetes (Bassin d’Arcachon) 1. Aphroditidae,

Chrysopetalidae. Archives de Zoologie Experimental et

Generate 109: 477-543.

Chivers, A.J., Narayanaswamy, B.E., Dale, A., Lamont, P.A., and

Turnewitsch, R. 2013. Changes in polychaete standing stock and

diversity on the northern side of Senghor Seamount (NE Atlantic).

Biogeosciences 10: 3535-3546.

Cho, W., and Shank T.M. 2010. Incongruent patterns of genetic

connectivity among four ophiuroid species with differing coral

host specificity on North Atlantic seamounts. Marine Ecology 31

(1): 121-143.

Christiansen, B., Brand, T., Buntzow, M., Busecke, J., Coelho, R.,

Correia, S., Denda, A., Diniz, T., Jung, S., Kaufmann, M., Kieneke,

A., Kirriakoulakis, K., Koppelmann, R., Kuhnert, J., Kwasnitschka,

T., Lamont, P., Martin, B., Montgomery, J., Peine, F., Piedade, A.,

Reichelt, T., Rieger, V., Schmidt, A., Stahl, H., Tiedke, J., Truscheit,

T., Turnewitsch, R., Unger, K., Vogel, S., and Warneke-Cremer, C.

2010. METEOR-Berichte. Structure and function of seamount

systems in the Cape Verde Region, Northeast Atlantic, Cruise No.

79, Leg 3. Available at: http://www.dfg-ozean.de/fileadmin/DFG/

Berichte METEOR/Fahrtbericht M79-3.pdf

Cole, V.J., Chapman, M.G., and Underwood, A.J. 2007. Landscapes

and life-histories influence colonisation of polychaetes to

intertidal biogenic habitats. Journal of Experimental Marine

Biology and Ecology. 348: 191-199.

Dahlgren, T.G., and Pleijel, F. 1995. On the generic allocation of

Chrysopetalum caecum (Polychaeta, Chrysopetalidae).

Mitteilungen aus dem Hamburgischen Zoologischen Museum

und Institut 92: 159-173.

Ehlers, E. 1864. Die Borstenwiirmer (Annelida Chaetopoda) nach

systematischen und anatomischen Untersuchungen dargestellt.

Whilhelm Engelmann: Leipzig.

Hartman, 0.1965. Deep water polychaetous annelids off New England

to Bermuda and other North Atlantic areas. Allan Hancock

Foundation Publications 28: 56-57.

Hutchings, R, and Murray, A. 1982. Patterns of recruitment of

polychaetes to coral substrates at Lizard Island, Great Barrier

Reef - an experimental approach. Australian Journal of Marine

and Freshwater Research 33: 1029-1037.

Katzmann, L., Laubier, L., and Ramos, J. 1974. Une nouvelle espece

Mediterraneene de Chrysopetalidae (Annelides Polychetes).

Annalen des Naturhistorischen Museums in Wien 78: 311-317.

Langerhans, P. 1880. Die Wurmfauna Madeiras. II. Zeitschrift fur

Wissenschaftliche Zoologie 33: 267-316.

Laubier, L. 1964. Contribution a la faunistique du coralligene. VI.

Presence de Chrysopetalum caecum Langerhans dans l’endofaune

coralligene. Vie et Milieu 15: 125-138.

Mileikovsky, S.A. 1962. On the morphology and systematics of

polychaetes belonging to the family Chrysopetalidae E. Ehlers,

1864 (genera Paleanotus L. Schmarda 1861, Heteropale H.P

Johnson, 1897, and others). Zoologicheskii Zhurnal 41: 648-659

(in Russian, English summary).

Nygren, A., Eklof, J., and Pleijel, F. 2010. Cryptic species of

Notophyllum (Polychaeta: Phyllodocidae) in Scandinavian waters.

Organisms, Diversity & Evolution 10(3): 193-204.

Olivier, F., Lana P., Oliveira, V., and Worsfold, T. 2012. Dysponetus

joeli sp. nov. (Polychaeta: Chrysopetalidae) from the north-east

Atlantic, with a cladistic analysis of the genus and a key to species.

Journal of the Marine Biological Association of the United

Kingdom 92: 989-996.

Perkins, T.H. 1985. Chrysopetalum, Bhawania and two new genera of

Chrysopetalidae (Polychaeta), principally from Florida. Proceedings

of the Biological Society of Washington 98(4): 856-915.

Ramirez-Llodra, E., Brandt, A., Danovaro, R., De Mol, B., Escobar,

E., German, C.R., Levin, L.A., Martinez Arbizu, P., Menot, L.,

Buhl-Mortenson, P., Narayananaswamy, B.E., Smith, C.R.,

Tittensor, D.P., Tyler, P.A., Vanreusel, A., and Vecchione, M.

2010. Deep, diverse and definitely different: unique attributes of

the world’s largest ecosystem. Biogeosciences 7: 2851-2899.

Richardson, P.L., Bower, A.S., and Zenk, W. 2000. A census of Meddies

tracked by floats. Progress in Oceanography 45: 209-250.

Samadi, S., Bottan, L., Macpherson, E., Richer de Forges, B., and

Boisselier, M. 2006. Seamount endemism questioned by

geographic distribution and population genetic structure of

marine invertebrates. Marine Biology 149: 1463-1475.

Chrysopetalidae (Annelida: Phyllodocida) from the Senghor Seamount, north-east Atlantic

325

Schlacher, T.A., Rowden, A.A., Dower, J.F., and Consalvey, M. 2010.

Seamount science scales undersea mountains: new research and

outlook. Marine Ecology 31(1): 1-13.

Surugiu, V., Dauvin, J.C., Gillet, R, and Ruellet, T. 2008. Can seamounts

provide a good habitat for polychaete annelids? Example of the

northeastern Atlantic seamounts. Deep-Sea Research Part 1 -

Oceanographic Research Papers 55(11): 1515-1531.

Wang, X., Peine, F., Schmidt, A., Schroder, H.C., Wiens, M.,

SchloPmacher, U., and Muller, W.E.G. 2011. Concept of biogenic

ferromanganese crust formation: coccoliths as bio-seeds in crusts

from central Atlantic Ocean (Senghor Seamount/Cape Verde).

Natural Product Communications 6: 1-10.

Watson, C. 2001. New genus and species of Chrysopetalidae (Polychaeta)

from hydrothermal vents (south-western Pacific). Beagle, Records of

the Museums and Art Galleries of the Northern Territory 17: 57-66.

Watson, C. 2010. Revision of the pantropical genus Treptopale

(Annelida: Phyllodocida: Chrysopetalidae): redescription of

Treptopale rudolphi Perkins 1985 and description of two new

species including comparison of Treptopale populations in

northern Australia. Beagle, Records of the Museums and Art

Galleries of the Northern Territory 26: 37-55.

Watson Russell, C. 1987. Chrysopetalidae. Pp. 660-670 in: Bhaud, M.

and Cazaux, C. Description and identification of polychaete

larvae; their implications in current biological problems. Oceanis

13: 596-753.

Watson Russell, C. 1991. Strepternos didymopyton Watson Russell in

Bhaud & Cazaux, 1987 (Polychaeta: Chrysopetalidae) from

experimental wooden panels in deep waters of the western North

Atlantic. In: Proceedings of the 2nd International Polychaete

Conference, Copenhagen. Ophelia Supplement 5: 283-294.

Watson Russell, C. 1997. Patterns of growth and development in the

deep-sea worm, Strepternos didymopyton (Polychaeta:

Chrysopetalidae). Fifth International Polychaete Conference,

China. Bulletin of Marine Science 60(2): 405-426.

Watson Russell, C. 1998. Description of Arichlidon new genus and

two new species from Australia; Bhawania reyssi redescribed and

assigned to Arichlidon (Chrysopetalidae: Polychaeta). Beagle,

Records of the Museums and Art Galleries of the Northern

Territory 14: 159-176.

Watson Russell, C. 2000. Description of a new species of Arichlidon

(Chrysopetalidae: Polychaeta) from the West Atlantic and

comparison with the East Atlantic species Arichlidon reyssi.

Sixth International Polychaete Conference, Brazil. Bulletin of

Marine Science 67(1): 465-477.

Westheide, W., and Watson Russell, C. 1992. Ultrastructure of

chrysopetalid paleal chaetae (Annelida, Polychaeata). Acta

Zoologica 73(3): 197-202.

Memoirs of Museum Victoria 71:327-342 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

A graphically illustrated glossary of polychaete terminology: invasive species of

Sabellidae, Serpulidae and Spionidae

EUNICE Wong 1 ’* (http://zoobank.org/urn:lsid:zoobank.org:author:DA932F59-B729-4B4B-9D2D-A880194CD891),

ELENA K. Kupriyanova 1 (http://zoobank.org/urn:lsid:zoobank.org:author:D0BE23CD-F6C3-4FE8-AB09-EBD4B9A55D0B),

PAT HUTCHINGS 1 (http://zoobank.org/urn:lsid:zoobank.org:author:E83A37D3-33D8-4999-ACA6-8DFECAF05Dll),

MARIA CAPA 2 (http://zoobank.org/urn:lsid:zoobank.org:author:A5F87E39-A766-4619-915D-9FC759B56206),

VASILY I. RadASHEVSKY 3,4 (http://zoobank.org/urn:lsid:zoobank.org:author:7637875A-94A6-4448-84AA-D7088014B501) AND

HARRY A. TEN Hove 5 (http://zoobank.org/urn:lsid:zoobank.org:author:3E712C6F-D992-4601-8F7E-F282171D6732)

1 Marine Invertebrates, Australian Museum Research Institute, Australian Museum, 6 College Street, Sydney, New South

Wales 2010, Australia (eunice.wong@austmus.gov.au; elena.kupriyanova@austmus.gov.au; pat.hutchings@austmus.gov.au)

2 University Museum, Norwegian University of Science and Technology, 7491 Trondheim, Norway (maria.capa@ntnu.no)

3 A.V. Zhirmunsky Institute of Marine Biology, Far Eastern Branch of the Russian Academy of Sciences, 17 Palchevsky

Street, Vladivostok 690059, Russia (radashevsky@gmail.com)

4 Far Eastern Federal University, 8 Sukhanov Street, Vladivostok 690950, Russia

5 Naturalis Biodiversity Center, Darwinweg 2, 2333 CR Leiden, The Netherlands (harry.tenhove@naturalis.nl)

* To whom correspondence and reprint requests should be addressed. E-mail: eunice.wong@austmus.gov.au

Abstract Wong, E., Kupriyanova, E.K., Hutchings, R, Capa, M., Radashevsky, V.I. and ten Hove, H.A. 2014. A graphically illustrated

glossary of polychaete terminology: invasive species of Sabellidae, Serpulidae and Spionidae. Memoirs of Museum

Victoriall: 327-342.

A well-illustrated glossary supports the study of polychaete anatomy and systematics, as well as aiding species

identification, a need that emerged within the shipping and aquaculture industries over recent decades. Sabellidae,

Serpulidae and Spionidae are polychaete families that most often include species that are translocated globally through

ship fouling, ballast water or aquaculture trade. Accurate identifications are crucial since these translocations have

significant ecological and commercial implications and also for phylogenetic and other biological studies. Using digital

illustrations of specimens (deposited predominantly at the Australian Museum in Sydney), a glossary has been developed

for these three families with the aim of standardising terminologies. Complete-focus images were generated with Helicon

Focus 5.3 Pro software from multiple image layers. The definitions have been explained specific to families and illustrated

with these images, thus creating the first comprehensive, digitally illustrated glossary of polychaete terminology.

Keywords invasive, biofouling, biosecurity, identification key, digital photographs, Australia

Introduction

The identification of polychaetes, as with all invertebrate

groups, requires an understanding of both the morphological

features and the terminologies used to describe these features.

Therefore, a glossary underpins the study of the systematics of

a particular group. Soon after its publication, the glossary of

the ‘pink’ book (Fauchald, 1977) became a standard reference

for terms used in systematic polychaete literature. However,

terminology used for polychaete features has varied greatly

among authors, resulting in confusion that has never been

resolved, even within individual families (e.g. Nogueira et al.,

2010, for Terebellidae; Capa and Murray, 2009, and Capa et

al., 2011a and 2011b, for Sabellidae; ten Hove and Kupriyanova,

2009, for Serpulidae; Light, 1978, and Radashevsky, 2012, for

Spionidae). Moreover, the terms used for homologous

structures may differ considerably between families, while

identical terms are sometimes used for features with different

origins (e.g. ‘branchia’ in Serpulidae and Spionidae)—hence

the potential for confusion.

In recent decades, the need for polychaete identification has

arisen among the shipping and port management industries as a

result of increasing global trade, as well as within the aquaculture

industry. Environmental consultants, biologists and quarantine

officers are required to examine ship hulls and wharves in ports

and marinas for anthropogenically translocated organisms,

including polychaetes. Invasions of pest species threaten local

marine communities and biodiversity, generating substantial

328

E. Wong, E. Kupriyanova, P. Hutchings, M. Capa, V.l. Radashevsky & H.Aten Hove

losses for the aquaculture, shipping and tourism industries

(Holloway and Keough, 2002; Bax et al., 2003; £inar, 2012).

The polychaete families Serpulidae, Sabellidae and Spionidae

collectively comprise 40% of the translocated polychaetes

worldwide (£inar, 2012), and some of these are listed as pest

species (DAFF, 2012) as they can have considerable impact on

native ecosystems, including the potential to displace local

species (£inar et al., 2005; £inar, 2012). For many species, the

impacts are yet to be studied.

The obvious need for a well-illustrated digital guide for

non-specialists resulted in the Invasive Polychaete Identifier

(Kupriyanova et al., 2013) that was developed at the Australian

Museum with the aim of enabling identification of Australian

native and invasive (or potentially invasive) polychaetes. This

guide includes a glossary that is linked to the terms used in the

text. The approach taken by the guide is comprehensive

visualisation for identifications of sabellid, serpulid and

spionid species. Museum specimens were photographed

through a Leica MZ16 dissection microscope fitted with a

Spot Flex 15.2 camera. Some specimens were stained with

methylene blue or methyl green to increase contrast and thus

visually enhance important diagnostic features. Slides were

made of chaetae of some species. Helicon Focus 5.3 Pro

software was used to create completely focused images by

integrating the layers of partially focused images captured.

There have been previous attempts to standardise

definitions within each of the three families under

consideration. The influential taxonomic revision of Sabellidae

by Fitzhugh (1989) has for years been the source of terminology

for this family, and Capa et al. (2011a) recently reviewed the

terminology of most sabellid morphological features. Ten

Hove and Kupriyanova (2009) reviewed the state of taxonomy

in Serpulidae (not including, however, the subfamily

Spirorbinae) and provided a discussion of morphology and a

glossary for the family. Most recently, Radashevsky (2012)

reviewed the morphology of Spionidae and the terms used in

this family. As a next step towards easier communication of

taxonomic information, here we provide the first fully

illustrated glossary of the polychaete terms that are specific to

these three families (Sabellidae, Serpulidae and Spionidae).

While we have attempted to standardise terms, we are not

implying that structures with the same name are necessarily

homologous structures, and in many cases detailed

developmental studies are required to ascertain this. The

terminologies pertaining to general biology and systematics

are not covered, as it is expected that users can refer to standard

textbooks and literature (e.g. Beesley et al., 2000; Rouse and

Pleijel, 2001) if they are not already equipped with this

knowledge.

GLOSSARY

abdomen (Sabellidae and Serpulidae): body region posterior

to the thorax; recognised by notopodial (dorsal) uncini and

neuropodial (ventral) chaetae (fig. la).

accessory gills (Spionidae): see branchiae.

acicular spine (Spionidae): straight thick chaetae in notopodia

of posterior segments (fig. lb).

acicular uncinus (pi. acicular uncini) (Sabellidae): hook¬

shaped uncinus with a poorly developed breast and a long

handle (fig. lc).

anal depression (Sabellidae): dorsoventrally flattened

expansion of posterior abdominal segments, accompanied in

some species by lateral flanges (fig. Id).

anterior peristomial ring (Sabellidae): anterior part of the

peristomium, attached to the radiolar lobe; ventral anterior

lobe can be triangular or rounded (fig. le).

apron (Serpulidae): membranous flap formed by thoracic

membranes joined ventrally past the last thoracic chaetigers

(fig- If)-

avicular uncinus (pi. avicular uncini) (Sabellidae): Z-shaped

uncinus with well-developed breasts and a handle (fig. lg).

bayonet chaetae (Serpulidae): special collar chaetae with 1 or

2 (sometimes more) large proximal teeth at the base of a distal

limbate zone (fig. lh).

bayonet chaetae (Sabellidae): small, thin and slightly bent,

narrowly hooded (see limbate chaetae) thoracic and

abdominal chaetae (fig. li).

bifurcate: divided into 2 parts or branches.

bilimbate: chaetae with a hood (limbus) visible on both sides

of the shaft; see limbate chaetae and broadly hooded.

branchiae (Spionidae): paired body appendages on segments,

provided with blood loop for respiration (fig. lj). N.B., different

from radiolar crown of Sabellidae and Serpulidae.

breast (Sabellidae and Serpulidae): rounded part of an

uncinus; located below the main fang in Sabellidae or anterior

fang (peg) in Serpulidae (fig. 2a). Uncini with well-developed

breasts are avicular (Sabellidae).

broadly hooded (Sabellidae and Serpulidae): hooded

capillaries with the distal hood (limbus) enlarged on both

sides of the shaft and appearing bilimbate under the compound

microscope (fig. 2b).

capillary chaetae: slender, often long, chaetae, tapering to a

fine point; the term has been used as a collective term for

elongate, needle-like or hair-like chaetae of otherwise variable

shape and ontogeny (fig. 2c).

caruncle (Spionidae): a dorsal extension of the prostomium,

taking the form of an elevation or a distinct crest separating

the nuchal organs one from another (fig. 2d).

chaeta (pi. chaetae) (hence Polychaeta, ‘with many hairs’):

chitinous bristle protruding from an epidermal pocket in the

body wall (fig. 2e).

A graphically illustrated glossary of polychaete terminology: invasive species of Sabellidae, Serpulidae and Spionidae

329

Figure 1. (a) Bispira manicata with abdomen region highlighted red. (b) Posterior notopodia of Boccardiella bihamata stained with methyl

green; arrow points to acicular spine, (c) Acicular thoracic uncini of Euchone limnicola. (d) Ventral anal depression in Euchone variabilis (left,

stained with methylene blue) with lateral flanges, and in Euchone limnicola , without flanges, (e) Collar region/base of radiolar crown in Myxicola

infundibulum stained with methylene blue; anterior peristomial ring highlighted red. (f) Lateral view of Spirobranchus tetraceros (left) and

ventral view of Spirobranchus kraussii (right), both stained with methylene blue; arrows point to apron, (g) Z-shaped avicular thoracic uncini of

Laonome triangularis (above) and Bispira manicata (below, stained with methyl green), (h) Bayonet collar chaetae in Serpula jukesi, stained

with methyl green, (i) Bayonet thoracic chaetae in Jasmineira sp. (j) Arrows point to branchiae in Boccardia chilensis (left and right specimens

stained with methylene blue and methyl green, respectively). All scales in mm.

330

E. Wong, E. Kupriyanova, P. Hutchings, M. Capa, V.l. Radashevsky & H.Aten Hove

Figure 2. (a) Thoracic uncini of Bispira manicata, stained with methyl green; arrow points to breast of uncinus. (b) Broadly hooded thoracic

chaetae of Euchone limnicola and collar chaetae of Laonome calida. (c) Capillary chaetae from collar of Spirobranchus taeniatus (on left,

stained with methyl green) and chaetiger 1 of Boccardia proboscidea (on right), (d) Dorsal view of anterior ends of Polydora haswelli (on left,

stained with methyl green) and Boccardia proboscidea (on right); arrows point to caruncle, (e) Arrows point to thoracic chaetae of (left to right,

respectively) Bispira porifera, Boccardiella bihamata (stained with methyl green) and Spirobranchus cariniferus (stained with methylene blue),

(f) Arrows demonstrate chaetal inversion in Branchiomma bairdi (left) and Spirobranchus cariniferus (right), (g) Lateral views of thoracic

regions of Bispira porifera (left) and Polydora haswelli (right, stained with methyl green); each bracket indicates 1 chaetiger. All scales in mm.

A graphically illustrated glossary of polychaete terminology: invasive species of Sabellidae, Serpulidae and Spionidae

331

chaetal inversion (Sabellidae and Serpulidae): the thorax

bears chaetae dorsally (in notopodia) and uncini ventrally (in

neuropodia); while in the abdomen the position of the chaetae

and uncini is reversed (fig. 2f).

chaetiger: segment bearing chaetae (fig. 2g).

cirrus (pi. cirri): soft tactile appendage, usually on parapodia,

peristomium and pygidium (fig. 3a).

cirriform (Spionidae): bearing cirri (fig. 3a).

collar (Sabellidae and Serpulidae): a more or less encircling

membranous flap projecting from the peristomium and, in

some cases, covering the base of the radiolar crown (fig. 3c).

collar chaetae (Sabellidae and Serpulidae): notochaetae of the

first (collar) chaetiger not accompanied by neuropodial uncini

(fig-3d).

collar segment (Sabellidae and Serpulidae): first chaetiger,

often bearing a membranous collar and notochaetae (see

collar chaetae), but lacking uncini (fig. 3e).

companion chaetae (Sabellidae): chaetae with a basal shaft

and a distal hood, arranged in a single row, parallel to the row

of thoracic uncini (fig. 3b).

companion chaetae (Spionidae): short capillary chaetae,

usually distally bilimbate, accompanying heavy falcate spines

on segment 5 in polydorins (members of the tribe Polydorini)

(fig- 5g).

constriction (Serpulidae): narrowing of the opercular

peduncle at base of opercular funnel or ampulla (fig. 3f).

constriction (Spionidae): narrowing of the upper part of hook

shaft (fig. 3g).

distal wings (Serpulidae): paired lateral outgrowths of the

peduncle located just below the operculum (fig. 3h).

dorsal: pertaining to, or situated at, the back (dorsum) (fig. 4a).

dorsal lips (Sabellidae): paired rounded lappets on dorsal

margin of mouth; used for feeding, tube building, and sorting

the particles collected by the radiolar crown (fig. 4b).

dorsal radiolar appendages (Sabellidae): modified radioles

fused to dorsal lips (fig. 4b).

falcate spines (Spionidae): chaetae resembling mammalian

canine teeth; characteristically present in the posterior row

notochaetae of segment 5 in polydorins (members of the tribe

Polydorini) (fig. 4c).

faecal groove (Sabellidae and Serpulidae): ciliated channel

running along the body and used for directing the faeces from

the anus to the anterior tube opening (fig. 4d).

faecal groove inversion (Sabellidae and Serpulidae): change in

the position of the ciliated groove (used to direct faeces from the

anus to the tube mouth): it runs ventrally in the abdomen, passing

between the last thoracic notopodia and the first abdominal

neuropodia, and becomes dorsal in the thorax (fig. 4e).

flat trumpet-shaped chaetae (Serpulidae): in profile

resembling a hollow trumpet, with distal expanded part edged

with 2 rows of teeth. However, examination with SEM shows

that these chaetae are flat, with a single row of acute marginal

teeth (fig. 4f).

funnel (Serpulidae): inverted, cone-like proximal part of the

operculum in Hydroides , and the entire operculum in Serpula

(fig- 4g).

glandular girdle (Sabellidae): complete or incomplete pale

ridge around the first or second chaetiger (fig. 4h).

handle (Sabellidae): posterior elongated extension of an

uncinus; always embedded in body wall (fig. 4i).

hood (preferred term for Sabellidae): distal extension of

capillary chaetae, appearing as a flat, longitudinal flange under

the compound microscope, but made of tightly packed

microfibrils as seen under SEM (fig. 5a). N.B., the same as

limbus in Serpulidae.

hood (Spionidae): a thin sheath surrounding the distal dentate

end of hooks (fig. 5b). N.B., not the same as hood in Sabellidae.

hooded chaetae (preferred term for Sabellidae): capillary

chaetae with hood. N.B., the same as limbate chaetae in

Serpulidae.

hooded chaetae (Spionidae): hooked chaetae with hood (see

hood for Spionidae). N.B., not the same as hooded chaetae

in Sabellidae.

hooks (Spionidae): distally curved chaetae used to hold

individual inside the burrow or tube (fig. 5c); also see uncinus,

which can be hook-shaped in Sabellidae.

inter-radiolar membrane (Sabellidae and Serpulidae):

membrane connecting basal parts of radioles (fig. 5d).

inter-ramal eyespots (Sabellidae): simple eyes located

between the rami (notopodia and neuropodia) in both thoracic

and abdominal segments (fig. 5e).

keel (Serpulidae): outer longitudinal prominent ridge running

along the calcareous tube length (fig. 5f).

lappet: lobe or flap-like projection,

lateral: located on the side.

332

E. Wong, E. Kupriyanova, P. Hutchings, M. Capa, V.l. Radashevsky & H.Aten Hove

Figure 3. (a) Cirriform pygidium of Pygospio elegans, stained with methyl green; arrow points to a cirrus, (b) Companion chaetae (arrows) as

parallel row anterior to thoracic uncini in Sabella spallanzanii (left) and Bispira manicata (right, stained with methylene blue), (c) Arrows point

to collar flaps in Laonome calida (left) and Spirobranchus cariniferus (right), both stained with methylene blue, (d) Collar/thoracic regions of

Laonome triangularis (left, stained with methylene blue) and Ficopomatus enigmaticus (right); arrows point to collar chaetae. (e) Collar segments

indicated by different arrows in (left to right, respectively) Branchiomma galei, Laonome triangularis (stained with methylene blue) and

Spirobranchus cariniferus (stained with methylene blue), (f) Constrictions, indicated by arrows, occurring below funnels in opercula of Hydroides

malleolaspinus and Hydroides minax. (g) Constriction, indicated by arrow, in upper shaft of neuropodial hooks of Polydora uncinata. (h) Opercula

of Spirobranchus polytrema, S. cariniferus and S. tetraceros (left to right, respectively); arrows indicate distal wings. All scales in mm.

A graphically illustrated glossary of polychaete terminology: invasive species of Sabellidae, Serpulidae and Spionidae

333

Figure 4. (a) Dorsal/ventral sides illustrated on examples of (left to right, respectively) Serpulidae ( Spirobranchus tetraceros), Sabellidae ( Bispira

manicata ) and Spionidae ( Polydora haswelli , stained with methyl green), (b) Arrows indicating paired dorsal radiolar appendages, fused to

dorsal lips, in (left to right, respectively) Sabella spallanzanii, Bispira porifera and Bispira manicata. (c) Falcate spines in notochaetae on

chaetiger 5 of Polydora uncinata. (d) Anterior regions of Branchiomma bairdi (dorsal view) and Laonome calida (ventral view, stained with

methylene blue); arrows indicate faecal grooves, (e) Faecal groove inversion in Branchiomma bairdi : faecal groove runs ventrally in abdomen

and dorsally in thorax, (f) SEM image of flat trumpet-shaped abdominal chaetae in Serpula Columbiana, (g) Arrows indicate opercula funnels

in Hydroides malleolaspinus and Hydroides tuberculatus. (h) Arrow indicates glandular girdle on chaetiger 2 of Euchone variabilis, stained

with methylene blue, (i) Arrows indicate handles of acicular thoracic uncini in Euchone limnicola (left) and avicular thoracic uncini in Bispira

manicata (right, stained with methyl green). All scales in mm.

334

E. Wong, E. Kupriyanova, P. Hutchings, M. Capa, V.l. Radashevsky & H.Aten Hove

Figure 5. (a) Arrows indicate hood on collar chaetae of Laonome triangularis (left 2 images), Laonome calida and thoracic chaetae of Crucigera

websteri (SEM image), (b) Arrow indicates hood in neuropodial hooks of Polydora uncinata. (c) Hooks in posterior neuropodia of Polydora

uncinata. (d) Radioles proximally connected by inter-radiolar membranes (arrows) in Sabella spallanzanii and Spirobranchus cariniferus (stained

with methylene blue), (e) Inter-ramal eyes (arrows) located between notopodia and neuropodia of Branchiomma galei and Branchiomma bairdi.

(f) Calcareous tubes of Spirobranchus cariniferus (left) and Spirobranchus kraussii (right); arrows indicate keels on tube, (g) Falcate spines in

notopodia of chaetiger 5 of Polydora uncinata ; arrow indicates lateral flange, (h) Lobate condition in collars of (left to right, respectively)

Spirobranchus cariniferus (stained with methylene blue), Sabella spallanzanii and pygidium of Polydora ciliata (stained with methyl green).

Lobes highlighted red. All scales in mm.

A graphically illustrated glossary of polychaete terminology: invasive species of Sabellidae, Serpulidae and Spionidae

335

lateral flange (Spionidae): small subdistal structure on heavy

falcate spines in polydorin spionids (fig. 5g).

limbate chaetae (preferred term for Serpulidae): capillary

chaetae with limbus. N.B., the same as hooded chaetae in

Sabellidae.

limbus (preferred term for Serpulidae): distal extension of

capillary chaetae; appearing as a flattened longitudinal flange

under the compound microscope, but made of tightly packed

microfibrils as seen under SEM. N.B., the same as hood in

Sabellidae.

lobate: subdivided into lobes (fig. 5h).

main fang (Sabellidae and Serpulidae): largest fang (or tooth)

of an uncinus, surmounted by row(s) of much smaller teeth

(fig- 6a).

male horns (Spionidae): a pair of dorsal appendages on

segment 2 in Pygospio males (fig. 6b).

median antenna (Spionidae): see occipital antenna.

narrowly hooded (Sabellidae): capillary chaetae with the

distal hood (limbus) only on 1 side of the shaft (fig. 6c); see

limbate chaetae.

neurochaetae: chaetae of neuropodia (fig. 6d).

neuropodium (pi. neuropodia): ventral branch or ramus of a

parapodium (fig. 6d).

notochaetae: chaetae of a notopodium (fig. 6e).

notopodium (pi. notopodia): dorsal branch or ramus of a

parapodium (fig. 6e).

nuchal organs: paired ciliated sensory organs on the

prostomium; in Spionidae extending over dorsal side of certain

anterior segments as ciliary bands, entire or metameric (fig. 6f).

nuchal papilla (Spionidae): see occipital antenna.

occipital antenna (Spionidae): a short median appendage on

the prostomium (fig. 6f).

operculum (pi. opercula) (Serpulidae): tip of modified radiole

used to plug the tube when the worm is retracted (fig. 6g).

opercular endplate (Serpulidae): terminal reinforcement of

operculum, often chitinous or calcareous (fig. 7a).

paleate (Sabellidae): broadly hooded (bilimbate) capillaries

with the shaft not reaching the tip of the chaetae.

palmate: having lobes radiating from a common point (fig. 7b).

palps: a pair of feeding and/or tactile appendages arising from

the head or anterior end of body (fig. 7c).

parapodium (pi. parapodia): fleshy lateral projection from a

body segment; usually bearing chaetae (fig. 7d).

peduncle (Serpulidae): modified radiole bearing the

operculum (fig. 7e).

peduncular wings (Serpulidae): see distal wings.

peristome (Serpulidae): collar-like widening of tube; former

tube mouth (fig. 7f).

peristomium: anterior body region surrounding the mouth

and located posterior to and/or below the prostomium (fig. 7g).

pinnules (Sabellidae and Serpulidae): small ciliated paired

outgrowths located along from the inner edge of the radioles,

giving each radiole a feathery appearance (fig. 7h).

prostomium: anteriormost presegmental region of body;

usually bearing radioles and sensory organs such as palps,

antennae, nuchal organs and eyes.

posterior peristomial ring (Sabellidae and Serpulidae): posterior

part of the peristomium; may bear a membranous collar.

pseudoperculum (pi. pseudopercula) (Serpulidae): modified

radiole, generally without pinnules; can develop into a new

functional operculum when the functional operculum is lost

(fig. 7i).

pygidium: postsegmental terminal body part surrounding the

anus (fig. 7j).

radiolar crown (Sabellidae and Serpulidae): anterior part

extended outside the tube and used for feeding and respiration;

of prostomial origin and made of pinnulated radioles attached

to radiolar lobes around the mouth (fig. 8a).

radiolar eyes (Sabellidae and Serpulidae): ocelli found in the

radiolar crown; can vary in number, arrangement and structure

(fig. 8b).

radiolar flanges (Sabellidae): paired, lateral membranous

extensions along outer margins of radioles (fig. 8c).

radiolar lobes (Sabellidae and Serpulidae): proximal part of

the radiolar crown attached to the anterior end of the body;

generally arranged as 2 semicircles, 1 on each side of the

mouth, but forming spirals in some species (fig. 8d).

radioles (Sabellidae and Serpulidae): filaments making up the

radiolar crown; attached to the radiolar lobes and bearing rows

of paired ciliated pinnules (fig. 8e).

radius (pi. radii) (Serpulidae): radial projection of the funnel

(genera Hydroides and Serpula only) (fig. 8f).

ramus: a branch.

rasp-shaped uncini (Sabellidae and Serpulidae): with 2 or

more rows of teeth (fig. 8g).

recurved spines (Spionidae): heavy chaetae with distal parts

bent backwards, found in notopodia of posterior segments

(fig. 8h).

336

E. Wong, E. Kupriyanova, P. Hutchings, M. Capa, V.l. Radashevsky & H.Aten Hove

Figure 6. (a) Thoracic uncini of Desdemona aniara (above, SEM image) and Laonome triangularis (below); arrows indicate main fangs, (b) A

pair of dorsal horns (indicated by arrow) on chaetiger 2 of a male of Pygospio elegans. (c) Narrowly hooded thoracic chaetae of Sabellastarte

australiensis. (d) Thoracic neuropodia highlighted red on (left to right, respectively) Branchiomma bairdi, Bispira manicata, Boccardiella

bihamata (stained with methyl green) and Boccardia proboscidea (stained with methyl green); arrows indicate neurochaetae. (e) Thoracic

notopodia highlighted red on (left to right, respectively) Branchiomma bairdi , Bispira manicata, Boccardiella bihamata (stained with methyl

green) and Boccardia proboscidea (stained with methyl green); arrows indicate notochaetae. (f) SEM image of dorsal anterior end of Poly dor a

cornuta. Red arrows indicate a pair of nuchal organs; outlined arrow indicates occipital antenna, (g) Arrows indicate opercula of (left to right,

respectively) Hydroides norvegicus (stained with methylene blue), Ficopomatus enigmaticus and Spirobranchus tetraceros. All scales in mm.

A graphically illustrated glossary of polychaete terminology: invasive species of Sabellidae, Serpulidae and Spionidae

337

Figure 7. (a) Operculum of Spirobranchus minutus (above) and Spirobranchus kraussii (below); arrows indicate opercular endplate. (b) Paleate

collar chaetae of Laonome triangularis, (c) Arrows indicate palps of Polydora haswelli (stained with methyl green) and Boccardiaproboscidea (live

specimen), (d) Parapodia highlighted red in (left to right, respectively) Sabellastarte australiensis , Boccardiella bihamata (stained with methyl

green) and Spirobranchus cariniferus (stained with methylene blue), (e) Arrows indicate peduncle of Hydroides norvegicus (stained with methylene

blue) and Spirobranchus cariniferus. (f) Tubes of Ficopomatus enigmaticus and Ficopomatus uschakovi\ arrows indicate peristomes, (g) Collar

region/base of radiolar crown in Myxicola infundibulum stained with methylene blue; peristomium highlighted red. (h) Radioles of Bispira serrata

and Bispira porifera\ arrows indicate individual pinnules, (i) Anterior end of Hydroides norvegicus (stained with methylene blue); arrow indicates

pseudoperculum. (j) Arrows indicate pygidium of Bispira serrata and Boccardia polybranchia (stained with methyl green). All scales in mm.

338

E. Wong, E. Kupriyanova, P. Hutchings, M. Capa, V.l. Radashevsky & H.Aten Hove

Figure 8. (a) Radiolar crowns in (left to right, respectively) Branchiomma bairdi, Spirobranchus kraussii and Euchone variabilis. (b) Radioles

of Bispira serrata and Bispira manicata ; arrows indicate radiolar eyes, (c) Arrow indicates radiolar flange on Bispira serrata. (d) Radiolar crown

of Bispira manicata, consisting of 2 radiolar lobes (arrows), (e) Radiole filaments of Sabellastarte australiensis and Bispira porifera. (f) Single

radius highlighted red in Hydroides brachyacanthus and Serpula jukesii. (g) SEM image of rasp-shaped posterior abdominal uncini in Serpula

columbiana. (h) Recurved spines in posterior notopodia of Boccardiella bihamata (on left, stained with methyl green) and Polydora uncinata

(on right), (i) SEM image of saw-shaped thoracic uncini on Serpula columbiana. All scales in mm.

A graphically illustrated glossary of polychaete terminology: invasive species of Sabellidae, Serpulidae and Spionidae

339

saw-shaped uncini (Serpulidae): with only 1 row of teeth (fig. 8i).

sedentary: attached to a surface and not moving freely.

segment: 1 of the serially repeated units comprising the trunk;

often separated internally by septae or dissepiments (fig. 9a).

shaft: proximal smooth part of chaetae, partly embedded in

the tissue; also see handle.

spine-like chaetae (Sabellidae): narrowly hooded capillaries

(also see limbate chaetae). N.B., not the same as falcate spines

and recurved spines of Spionidae.

spinules (Serpulidae): each of the tubercular or tooth-like

projections of a spine in the verticil of the genus Hydroides

(fig. 9b). By their position relative to the axis, spinules may be

internal, lateral or external. By their position along the spine,

spinules may be proximal, medial or distal.

Spirobranchus -type chaetae (Serpulidae): special collar

chaetae with a ‘fin’ positioned below the distal limbus (hood)

and consisting of numerous tiny hair-like spines (fig. 9c).

stylodes (Sabellidae and Serpulidae): outward projections

from the outer margin of radioles; can be digitiform (cylindrical

or finger-like), strap-like (flattened) or palmate (branched and

flattened); always paired in Sabellidae, unpaired in Serpulidae

(fig. 9d).

thoracic membrane (Serpulidae): thin folds on both sides of

thorax, extending from dorsal part of collar to lateral and/or

ventral side of posterior thorax (fig. 9e).

thorax: anterior region of the body behind the head (fig. 9f).

tonguelet (Serpulidae): special form of lappet, between

dorsolateral and ventral lobes of the collar in some serpulid

genera (fig. 9g).

torus (pi. tori) (Sabellidae and Serpulidae): transverse

elevation of parapodium surrounding the uncini (fig. 10a).

triangular depression (Serpulidae): depressed area between

thoracic uncinigerous tori which gradually approach and

almost touch one another posteriorly and ventrally (fig. 10b).

true trumpet-shaped chaetae (Serpulidae): distally hollow

chaetae, with 2 parallel rows of sharp denticles, extending into

a long lateral spine (fig. 10c).

tube: protective structure completely enclosing the body in

some polychaete families; made of mucus often covered by

sediment particles (Sabellidae, Spionidae) or calcium

carbonate (Serpulidae, exceptionally Sabellidae) (fig. lOd).

uncinigerous (Sabellidae and Serpulidae): bearing uncini.

uncinus (pi. uncini) (Sabellidae and Serpulidae): small

modified hook-shaped or comb-shaped chaeta deeply

embedded into tissue, with only its dentate edge protruding

from the body wall; uncini usually arranged in tori in

transverse elevated rows (fig. lOe).

ventral: lower or underside of the body; side of the polychaete

body bearing the mouth.

ventral lips (Sabellidae): membranous lappets on both

lateroventral sides of mouth (fig. lOf).

ventral radiolar appendages (Sabellidae): modified radioles

generally lacking pinnules; located on the ventral edge of the

radiolar lobes.

ventral sacs (Sabellidae): vesicles filled with sediment used

for tube building; located between the radiolar lobes (fig. lOg).

ventral shields (Sabellidae and Serpulidae): epidermal

glandular areas on ventral side of the thorax; well-defined or

diffused (fig. 11a).

verticil (Serpulidae): distal part (usually a crown of chitinous

spines) of operculum in Hydroides (fig. lib).

verticil spine (Serpulidae): radial elements together forming

the verticil in Hydroides (fig. lib).

Acknowledgements

This project was funded by the Australian Museum Foundation,

the Australian Biological Resources Study (ABRS), the

Fisheries Research and Development Corporation (FRDC), the

Russian Foundation for Basic Research (Project 09-04-01235)

and the Government of the Russian Federation (Project 11.

G34.31.0010). We thank Jen Cork, Sue Lindsay, Anna Murray,

Dr Waka Sato-Okoshi, Dr Carol Simon and Russ Weakley for

contributing to the project in various ways, and Alexander

Semenov for providing pictures of some polychaetes.

Participants of the Invasive Polychaete Workshop (1-2 August

2013 at the Australian Museum) provided tremendously helpful

feedback to a draft version, which we have incorporated into

the final online version of the guide containing this glossary.

References

Bax, N., Williamson, A., Aguero, M., Gonzalez, E., and Geeves, W.

2003. Marine invasive alien species: a threat to global biodiversity.

Marine Policy 27(4): 313-323.

Beesley, P.L., Ross, G.J., and Glasby, C. J. (eds) 2000. Polychaetes &

allies: the southern synthesis. Fauna of Australia volume 4.

CSIRO Publishing: Melbourne. 465 pp.

Capa, M., Hutchings, P., Aguado M.T., and Bott, N. 2011a. Phylogeny

of Sabellidae (Annelida) and relationships with other taxa inferred

from morphology and multiple genes. Cladistics 27: 449-469.

Capa, M., and Murray, A. 2009. Review of the genus Megalomma

(Polychaeta: Sabellidae) in Australia with descriptions of three

new species, new records and notes on certain features with

phylogenetic implications. Records of the Australian Museum

61(2): 201-224.

Capa, M., Nogueira, J.M.M., and Silva Rossi, M.C. 201 lb. Comparative

internal structure of dorsal lips and radiolar appendages in

Sabellidae (Polychaeta) and phylogenetic implications. Journal of

Morphology 272: 302-319.

340

E. Wong, E. Kupriyanova, P. Hutchings, M. Capa, V.l. Radashevsky & H.Aten Hove

Figure 9. (a) Single segments of Branchiomma bairdi (left 2 images) and Polydora haswelli (stained with methyl green) highlighted red. (b)

Arrows indicate spinules on opercula of (left to right, respectively) Hydroides elegans , H. heteroceros and H. tambalagamensis. (c) Spirobranchus-

type collar chaetae from Spirobranchus tetraceros (stained with methyl green), (d) Radioles of Branchiomma galei and Branchiomma bairdi ;

arrows indicate stylodes (palmate in B. galei and simple in B. bairdi). (e) Arrow indicates thoracic membrane of Spirobranchus cariniferus,

stained with methylene blue, (f) Thorax regions (highlighted red) of (left to right, respectively) Bispira manicata, Spirobranchus cariniferus

(stained with methylene blue) and Branchiomma bairdi. (g) Arrow indicates tonguelet of Spirobranchus cariniferus (stained with methylene

blue), partially covered by collar. All scales in mm.

A graphically illustrated glossary of polychaete terminology: invasive species of Sabellidae, Serpulidae and Spionidae

341

Figure 10. (a) Tori of Branchiomma bairdi and Sabella spallanzanii highlighted red. (b) Triangular depression in Spirobranchus tetraceros

(stained with methylene blue) highlighted red. (c) SEM image of true trumpet-shaped chaetae of Spirobranchus giganteus. (d) Tubes of (left to

right, respectively) Spirobranchus taeniatus , Bispira serrata and Pseudopolydora paucibranchiata'. calcareous in Serpulidae (5. taeniatus) and

muddy in Sabellidae (B. serrata ) and Spionidae (P. paucibranchiata ). (e) Uncini of (left to right, respectively) Branchiomma bairdi , Spirobranchus

cariniferus (stained with methylene blue), and close-up in Bispira manicata (stained with methyl green), (f) Arrow indicates ventral lip in live

specimen of Branchiomma arctica (photo: © Alexander Semenov), (g) Collar region of Bispira serrata and Sabella spallanzanii', arrows indicate

ventral sacs. All scales in mm.

342

E. Wong, E. Kupriyanova, P. Hutchings, M. Capa, V.l. Radashevsky & H.Aten Hove

Figure 11. (a) Ventral shields of Bispira porifera (stained with methylene blue) and Branchiomma bairdi highlighted red. (b) Opercula of (left to

right, respectively) Hydroides heteroceros, H. longispinosus and H. sanctaecrucis; red arrows indicate verticil; outlined arrows indicate verticil

spines. All scales in mm.

(Tinar, M.E. 2012. Alien polychaete species worldwide: current status

and their impacts. Journal of the Marine Biological Association

of the United Kingdom 93(5): 1-22.

(finar, M.E., Ergen, Z., Dagli, E., and Petersen, M.E. 2005. Alien

species of spionid polychaetes ( Streblospio gynobranchiata and

Polydora cornuta) in Izmir Bay, eastern Mediterranean. Journal

of the Marine Biological Association of the United Kingdom 85:

821-827.

DAFF (The Australian Government Department of Fisheries and

Forestry). 2012. The National System for the Prevention and

Management of Marine Pest Incursions, http://www.daff.gov.au/

animal-pi ant-health/pests-diseases-weeds/marine-pests/

biofouling/national-system

Fauchald, K. 1977. The polychaete worms. Definitions and keys to the

orders, families and genera. Natural History Museum of Los

Angeles County Science Series 28: 1-188.

Fitzhugh, K. 1989. A systematic revision of the Sabellidae-

Caobangiidae-Sabellongidae complex (Annelida: Polychaeta).

Bulletin of the American Museum of Natural History 192: 1-104.

Holloway, M.G., and Keough, M.J. 2002. An introduced polychaete

affects recruitment and larval abundance of sessile invertebrates.

Ecological Applications 12: 1803-1823.

Hove, H.A. ten, and Kupriyanova, E.K. 2009. Taxonomy of Serpulidae

(Annelida, Polychaeta): the state of affairs. Zootaxa 2036: 1-126.

Kupriyanova, E.K., Wong, E., and Hutchings, P.A. (eds) 2013. Invasive

Polychaete Identifier - an Australian perspective. Version 1.1, 4

Dec 2013. http://polychaetes.australianmuseum.net.au/

Eight, W.J. 1978. Spionidae (Polychaeta, Annelida) (Invertebrates of

the San Francisco Bay estuary system). The Boxwood Press:

Pacific Grove, California. 211 pp.

Nogueira, J.M., Hutchings, P., and Fukada, M.V. 2010. Morphology of

terebelliformpolychaetes (Annelida: Polychaeta: Terebelliformia),

with a focus on Terebellidae. Zootaxa 2460: 1-185.

Radashevsky, V.l. 2012. Spionidae (Annelida) from shallow waters

around the British Islands: an identification guide for the

NMBAQC Scheme with an overview of spionid morphology and

biology. Zootaxa 3152: 1-35.

Rouse, G.W., and Pleijel, F. 2001. Polychaetes. Oxford University

Press: New York. 354 pp.

Memoirs of Museum Victoria 71:343-345 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Bertil Akesson (1928 - 2013)

obituary

Arne Nygren 1 *, Thomas Dahlgren 2 , Fredrik Pleijel 3 ,

Helena Wiklund 4 , Tomas Cedhagen 5 , Christer

Erseus 6 and Malte Andersson 7

1 Maritime Museum & Aquarium, Karl Johansgatan 1-3, 41459

Gothenburg, Sweden (arne.nygren@kultur.goteborg.se);

2 Uni Research Milj0, Thorm0hlensgt. 49 B, 5006 Bergen, Norway

(thomas. d ahl gren@ uni. no);

3 Department of Biological and Environmental Sciences, University of

Gothenburg, The Loven Centre Tjarno, 45296 Stromstad, Sweden

(fredrik.pleijel@bioenv.gu.se);

4 Life Sciences Department, The Natural History Museum, Cromwell

Rd, Kensington, London SW7 5BD, UK (helenaswiklund@gmail.com);

5 Aarhus University, Department of BioScience, Ole Worms Alle 1,

8000 Aarhus C, Denmark (cedhagen@bios.au.dk);

6 Department of Biological and Environmental Sciences, University of

Gothenburg, Box 463, 40530 Gothenburg, Sweden (christer.erseus@

bioenv.gu.se);

7 Department of Biological and Environmental Sciences, University of

Gothenburg, Box 463, 40530 Gothenburg, Sweden (malte.andersson@

bioenv.gu.se)

* To whom correspondence and reprint requests should be addressed.

Email: arne.nygren@kultur.goteborg. se

Bertil Akesson passed away June 25, 2013 at the age of 85,

mourned by his wife Birgitta and son Bengt with family.

Bertil was born in Lund and grew up at Skabersjo Castle,

where his father Alfred Akesson worked as estate trustee. After

graduating in Malmo, Bertil started his academic career at Lund

University in 1948. He took his master’s degree in 1951 and his

doctorate in 1958 in zoology on sipunculids. Bertil married

Birgitta Stendahl in 1960, also a biologist working as a teacher

trainer. Bertil had a position for 12 years as Associate Professor

of Zoology in Lund, but in 1970 he transferred his personal

research fellowship to the University of Gothenburg, where he

got closer to the marine facilities on the Swedish west coast.

As the Department of Zoology in Gothenburg grew, the

broad topic of structural and ecological zoology became

unmanageable to be handled by a single professor. As a

professor in Zoology, Bertil Akesson then in 1986 took over

the responsibility for the ecological activity at the Department.

He was also Head of Department for two periods. He retired in

1993 but continued his research at the institution for many

years, publishing what became his last paper in 2011. BertiTs

Bertil Akesson (photograph from a private source).

long research career reflects the major changes in zoology

during this epoch. Throughout the first part of his career he

developed a great skill in comparative morphology and

published three major studies on sipunculans. During the

1960s, he broadened his research field with embryology,

mainly working with polychaetes, soon to become his central

model and analysed with dedicated enthusiasm.

Bertil’s influential pioneering work showed that a group of

polychaete species ( Ophryotrocha ), with small body size,

short generation time and resistance to a broad range of

environmental conditions, was well suited for laboratory

experiments. In these polychaetes, he saw great potential to

analyse some of that time’s central research problems, such as

speciation, behaviour, mode of reproduction and life cycle

strategies. BertiTs work established the group as a model

organism for both basic evolutionary questions as well as an

ecotoxicology model for the effects of marine pollutants. He

held more than 20 species in culture in his lab, some of them

continuously for 30-40 years, and he played a key role in

distributing these species to laboratories all around the world.

344

A. Nygren, T. Dahlgren, F. Pleijel, H. Wiklund, T. Cedhagen, C. Erseus & M. Andersson

Bertil Akesson was well known in his field of research and

he had broad international collaboration with marine research

stations and universities in Europe as well as in the USA and

Australia. His international contacts were beneficial to

graduate students as well as younger colleagues in that he

enthusiastically encouraged and arranged for their visits to

foreign institutions. In Sweden Bertil contributed to the

expansion of the marine field station at Tjarno at University of

Gothenburg, where he also supervised a number of PhD

students. He was also active at the field station at Kristineberg,

from where it is not far to Hogby, where Bertil and his family

have had their summer residence since 1966.

Bertil Akesson’s work at the department was dominated by

research and, in the years closer to retirement, administration as

Head of the Department. He was also a tutor and university

teacher. In all, Bertil was factual, honest and impartial, efficient,

positive, and supportive. He was gifted with much humour that

helped to solve many knots, often with a merry laugh. We miss

our dear colleague Bertil, his good humour, positive view on

life, and irrepressible enthusiasm for science.

Bibliography

Akesson. B. 1958. A study of the nervous system of the Sipunculoidea.

Undersokningar over Oresund 38: 1-249.

Akesson, B. 1961. A method of continuous observation of the object

during vital staining with methylene blue. Arkiv for Zoologi 13:

321-322.

Akesson, B. 1961. A rapid method of orienting small and brittle objects

for sectioning in definite planes. Arkiv for Zoologi 13: 479-482.

Akesson, B. 1961. On the histological differentiation of the larvae of

Pisione remota (Pisionidae, Polychaeta). Acta Zoologica 42: 177-

225.

Akesson, B. 1961. Some observations on Pelagospliaera larvae.

Galathea Report 5: 7-17.

Akesson, B. 1961. The development of Golfingia elongata Keferstein

(Sipunculoidea) with some remarks on the development of

neurosecretory cells in sipunculoids. Arkiv for Zoologi 13: 511-531.

Akesson, B. 1962. The embryology of Tomopteris helgolandica

(Polychaeta). Acta Zoologica 43: 135-199.

Akesson, B. 1963. The comparative morphology and embryology of the

head in scale worms (Aphroditidae, Polychaeta). Arkiv for Zoologi

16:125-163.

Akesson, B. 1964. On the eyes of Tomopteris helgolandica

(Tomopteridae, Polychaeta). Acta Zoologica 46: 179-189.

Akesson, B. 1967. A preliminary report on the early development of the

polychaete Tomopteris helgolandica. Arkiv for Zoologi 20: 141-146.

Akesson, B. 1967. On the biology and larval morphology of

Ophryotrocha puerilis Claparede & Metschnikov (Polychaeta).

Ophelia 4: 111-119.

Akesson, B. 1967. On the nervous system of the Lopadorhynchus larva

(Polychaeta). Arkiv for Zoologi 20: 55-78.

Akesson, B. 1967. Orientation and embedding of small objects in

Steedman’s polyester wax for sectioning in definite planes. Arkiv

for Zoologi 19:247-249.

Akesson, B. 1967. The embryology of the polychaete Eunice kobiensis.

Acta Zoologica 48: 141-192.

Akesson, B. 1968. The ontogeny of the glycerid prostomium. Acta

Zoologica 49: 203-217.

Akesson, B. 1968. The parasite-host relation between Eucoccidium

ophryotrochae Grell and Ophryotrocha labronica La Greca &

Bacci. Oikos 19: 158-163.

Akesson, B. 1970. Ophryotrocha labronica as test animal for the study

of marine pollution. Helgolander wissenschaftliche

Meeresuntersuchungen 20: 293-303.

Akesson, B. 1970. Sexual conditions in a population of the polychaete

Ophryotrocha labronica La Greca & Bacci from Naples. Ophelia 7:

167-176.

Akesson, B. 1972. Incipient reproductive isolation between geographic

populations of Ophryotrocha labronica (Polychaeta, Dorvilleidae).

Zoologica Scripta 1: 207-210.

Akesson, B. 1972. Sex determination in Ophryotrocha labronica

(Polychaeta, Dorvilleidae). Pp. 163-172 in: Battaglia, B. (ed.). Fifth

European Marine Biology Symposium. Piccin Editore, Padova.

Akesson, B. 1973 Dinophilidemas (Archiannelida) systematiska

stallning. Zoologisk Revy 35: 76-78.

Akesson, B. 1973. Morphology and life history of Ophryotrocha maculata

sp. n. (Polychaeta, Dorvilleidae). Zoologica Scripta 2: 141-144.

Akesson, B. 1973. Reproduction and larval morphology of five

Ophryotrocha species (Polychaeta, Dorvilleidae). Zoologica Scripta

2: 145-155.

Akesson, B. 1974. Fortplantning hos en marin maskgrupp. Svensk

Naturvetenskap, 97-106.

Akesson, B. 1975. Bioassay studies with polychaetes of the genus

Ophryotrocha as test animals. Pp 121-135 in: Koeman, J.H. and

Strik, J.J. (eds.), Sublethal effects of toxic chemicals on aquatic

animals. Elsevier, Amsterdam.

Akesson, B. 1975. Reproduction in the genus Ophryotrocha (Polychaeta,

Dorvilleidae). Pubblicazioni della Stazione Zoologica di Napoli 39

(Supplement): 377-398.

Akesson, B. 1976. Morphology and life cycle of Ophryotrocha diadema,

a new polychaete species from California. Ophelia 15: 23-35.

Akesson, B. 1976. Temperature and life cycle in Ophryotrocha labronica

(Polychaeta, Dorvilleidae). Ophelia 15: 31-4H.

Akesson, B. 1977. Crossbreeding and geographic races: Experiments

with the polychaete genus Ophryotrocha. Mikrofauna des

Meeresbodens 61: 11-18.

Akesson, B. 1977. Parasite-host relationships and phylogenetic

systematics. The taxonomic position of dinophilids. Mikrofauna des

Meeresbodens 61: 19-28.

Akesson, B. 1978. A new Ophryotrocha species of the labronica group

(Polychaeta, Dorvilleidae) revealed in crossbreeding experiments.

Pp. 573-590 in: Battaglia, B. and Beardmore, J. (eds.), NATO

Conference Series (Marine Science). Plenum Publishing, New York.

Akesson, B. 1980. The use of certain polychaetes in bioassay studies.

Rapports et Proces-verbaux des Reunions Conseil International

pour TExploration de la Mer 179: 315-321.

Akesson, B. 1982. A life table study on three genetic strains of

Ophryotrocha diadema (Polychaeta, Dorvilleidae). International

Journal of Invertebrate Reproduction 5: 59-69.

Akesson, B. 1983. Methods for assessing the effects of chemicals on

reproduction in marine worms. Pp. 459^482 in: Vouk, V.B. and

Sheehan, PJ. (eds.). Methods for assessing the effects of chemicals

on reproductive function. Chicester, John Wiley.

Akesson, B. 1984. Speciation in the genus Ophryotrocha (Polychaeta,

Dorvilleidae). Fortschritte der Zoologie 29: 299-316.

Akesson, B. 1994. Evolution of viviparity in the genus Ophryotrocha

(Polychaeta, Dorvilleidae). Memoires du Museum national

d’Histoire naturelle. Serie A, Zoologie 162: 29-35.

Akesson, B. & Costlow, J.D. 1978. Effects of temperature and salinity on

the life cycle of Ophryotrocha diadema (Polychaeta, Dorvilleidae).

Ophelia 17: 215-229.'

Akesson, B., and Costlow, J.D. 1992. Effects of constant and cyclic

temperatures at different salinity levels on survival and reproduction

in Dinophilus gyrociliatus (Polychaeta, Dinophilidae). Bulletin of

Marine Science 48: 485-499.

Bertil Akesson (1928 - 2013) Obituary

345

Akesson, B., and Ehrenstrom, F. 1984. Avoidance reactions in

dorvilleid polychaetes when exposed to chemical contaminated

sediments. Pp. 3-12 in: Persoone, G. Jaspers, E. and Claus, C.

(eds.). Proceedings of the International Symposium on

Ecotoxicological Testing for the Marine Environment, Ghent,

Belgium, September 12-14, 1983, volume 2.

Akesson, B., and Hendelberg, J. 1989. Nutrition and asexual

reproduction in Convolutriloba retrogemma, an acoelous

turbellarian in obligate symbiosis with algal cells. Pp 13-21 in:

Ryland, J.S. and Tyler, P.A. (eds.). Reproduction, genetics and

distribution of marine organisms. 23rd European Marine Biology

Symposium, School of Biological Sciences, University of Wales,

Swansea, 5-9 September 1988. International Symposium Series.

Olsen and Olsen, Fredensborg, Denmark.

Akesson, B., and Paxton, H. 2005. Biogeography and incipient

speciation in Ophryotrocha labronica (Polychaeta, Dorvilleidae).

Marine Biology Research 1: 127-139.

Akesson. B., and Rice, S. 1992. Morphology and life cycle of two

Dorvillea species with obligate asexual reproduction. Zoologica

Scripta 21: 351-362.

Akesson, B., Gschwentner, R., Hendelberg, J., Ladurner, P, Muller, J.,

and Rieger, R. 2001. Fission in Convolutriloba longifissura:

asexual reproduction in acoelous turbellarians revisited. Acta

Zoologica 82: 231-239.

Dahlgren, T.G., Akesson, B., Schander, C., Halanych, K.M., and

Sundberg, P. 2001. Molecular phylogeny of the model annelid

Ophryotrocha. Biological Bulletin 201: 193-203.

Heggpy, K.K, Schander, C., and Akesson, B. 2007. The phylogeny of

the annelid genus Ophryotrocha (Dorvilleidae). Marine Biology

Research 3: 412-420.

Hendelberg, J., and Akesson, B. 1988. Convolutriloba retrogemma

gen. et sp. n., a turbellarian (Acoela, Platyhelminthes) with

reversed polarity of reproductive buds. Fortschritte der Zoologie

36: 321-327.

Hendelberg, J., and Akesson, B. 1991. Studies of the budding process

in Convolutriloba retrogemma (Acoela, Platyhelminthes).

Hydrobiologia 227: 11-17.

Nilsson Skold, H., Obst, M., Skold, M., and Akesson, B. 2009. Stem

cells in asexual reproduction of marine invertebrates. Pp. 105-137

in: Rinkevich, B. and Matranga, V. (eds.). Stem cells in marine

organisms. Springer Science, Business Media.

Ockelmann, K., and Akesson, B. 1990. Ophryotrocha socialis, n.sp., a

link between two groups of simultaneous hermaphrodites within

the genus (Polychaeta, Dorvilleidae). Ophelia 31: 145-162.

Paavo, B., Bailey-Brock J.H., and Akesson B. 2000. Morphology and

life history of Ophryotrocha adherens sp. nov. (Polychaeta,

Dorvilleidae). Sarsia 85: 251-264.

Paxton, H„ and Akesson, B. 2007. Redescription of Ophryotrocha

puerilis and O. labronica (Annelida, Dorvilleidae). Marine Biology

Research 3: 3-19.

Paxton, H., and Akesson, B. 2010. The Ophryotrocha labronica group

(Annelida: Dorvilleidae), with the description of seven new

species. Zootaxa 2713: 1-24.

Paxton, H., and Akesson, B. 2011. The Ophryotrocha diadema group

(Annelida: Dorvilleidae), with the description of two new species.

Zootaxa 3092: 43-59.

Memoirs of Museum Victoria 71:347-351 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

M. Nechama Ben-Eliahu,

4 January 1935 - 23 March 2014.

Obituary and some personal

reminiscences

Ariel D. Chipman 1 and Harry A. ten Hove 2

1 National Natural History Collections, The Hebrew University of

Jerusalem, Edmond J. Safra Campus, Givat Ram 91904, Jerusalem,

Israel ariel.chipman@mail.huji.ac.il

2 Naturalis Biodiversity Center, Darwinweg 2, 2333CR Leiden, the

Netherlands harry.tenhove@naturalis.nl

To whom correspondence and reprint requests should be addressed:

ariel.chipman@mail.huji.ac.il

Nechama Ben-Eliahu was born in New York City in 1935. After

a B.A. and M.A. at Indiana University she initially embarked on

a teaching career. A lecture by David Ben-Gurion (Israel’s

prime minister at the time) that she attended in the early 1960s

turned out to be a life-changing experience and she decided to

emigrate to Israel. She arrived in Israel as a single mother with

a young son on the 22 nd of June 1962. Years later she would still

celebrate that date as the most important day in the year, even

more significant than her birthday. She initially settled in Haifa,

first working as a teacher, but soon taking on a research position

at the Sea Fisheries Research Station in Haifa, working on a

major joint research project of the Smithsonian Institute and

the Hebrew University of Jerusalem sorting invertebrate taxa

from the Red Sea and the Mediterranean.

Ariel: When Nechama would talk about her work on serpulids,

she often told the story of how she came to work on this

obscure taxon. When she first joined the staff of the Sea

Fisheries Research Station, she was told she could choose

between echinoderms and polychaetes. She asked to look at

some samples to decide. An average sample included no more

than five species of echinoderms, which could all be easily

identified to species. Such a sample included over 20 species

of polychaetes, none of which could be identified easily. It was

immediately obvious to her which she should pursue.

Harry: My first - at the time still infrequent - contacts with

Nechama must go back to the early 1970s when Por’s

publication about Lessepsian migration in Systematic Zoology

caught my attention, and Nechama started to publish on that

topic too. I forgot the exact year, but she still lived in Beersheba.

We mainly exchanged reprints, an occasional piece of

information or check on identification of serpulids. My first

M. Nechama Ben-Eliahu at the 10th International Polychaete Conference,

Lecce, Italy, in June 2010 (photograph by Sergio I. Salazar Vallejo).

brush with the “peoples’ person” she was occurred during the

1st International Polychaete Conference in Sydney, 1983. Soon

after that came the first of a couple of visits to the Netherlands,

during which she generally was based at least some part in our

home in Nieuwegein.

Soon after arriving in Israel, Nechama remarried, adopting

her husband’s two sons from a previous marriage as her own.

She moved to the southern city of Beersheba, continuing her

work on polychaetes, now as part of her Ph.D. thesis on the

diversity of polychaete cryptofauna, under the joint supervision

of Profs. Dov Por and Uriel Safriel from the Hebrew University.

Her life was split between Haifa, Beersheba (where she also

worked as a teaching assistant at the University of the Negev)

and Jerusalem. After a few years in Beersheba, she moved to

Jerusalem on her own, single once again, and lived in aflat in

Jerusalem, where she hosted many guests and visitors over

the years.

348

A.D. Chipman & H.A. Ten Hove

Harry: In 1990 Nechama invited me to her apartment for a

six-week period in Israel, three weeks of fieldwork to sample

the ongoing Lessepsian migration, three weeks of labwork.

Jerusalem proved to be a small world. When we had dinner

with friends of hers, I recognized the church on a painting as

the one I was married in; her friend had lived in the town

where I went to grammar school and had been a regular visitor

to my wife’s neighbours. When she introduced me to my

prospective diving buddy, Shmuel Pisanty, I did not

immediately recognize his face, but she was even more

surprised than I when Shmuel and I realised that we had

enjoyed each other’s cooking in 1967, both doing research in

the Zoological Station in Den Helder (nowadays NIOZ), the

Netherlands. Of course Nechama showed me around in the

Biblical Zoo in Jerusalem, of which she was a board member,

where she proudly showed me her visualized idea: animal

footprints in concrete to educate the younger generation.

Nechama and I had long and sometimes heated discussions

over material, interpretations, emerging texts, whatever. The

result of the fieldwork and those discussions was published in

1992. On a later occasion in Nieuwegein, I heard her admit to

my wife that she sometimes contradicted me just for the sake

of the argument. She appreciated very much that I arranged a

meeting with the director of the Royal Amsterdam Zoo, Artis

Natura Magistra, whom I happened to know. That time, by the

way, we again found out that it is a small world: visiting a

mill-museum in Holland we stumbled across one of her

political friends from Jerusalem!

Ariel: Nechama’s life moved in many different circles, and she

knew a huge number of people. There was the circle of

zoologists (Polychaete lovers and others) - both in Israel and

abroad - who all seemed to be her best friends. There was the

circle of the American community in Jerusalem, where she

was very active and apparently known by everyone. There was

the circle of the Biblical Zoo, where she was an active board

member. And, of course there was political activity. Nechama

devoted almost every spare minute to politics. She was a

regular demonstrator for peace, reconciliation and

understanding with our Arab neighbors. She was constantly

handing out flyers, standing at vigils or marching in protest.

She became an active member of the liberal party Ratz, which

later reformed to give rise to Meretz. Here also she was an

active board member, knew all of the members of parliament

and city council personally (and had all of their respect). She

frequently said to me that she made a decision to devote a

certain percentage of her time (I think she said 10%, but it was

closer to 50%) to make this country a better place for her

children and grandchildren. She lost a granddaughter to a

terrorist attack, and this only made her reserve stronger to

continue acting for Peace.

Harry: Amongst others we shared a passion for politics, she to

the far left, we (my wife and I) to the right of the middle (we

have a lot of political parties in the Netherlands, even more

than in Israel). Being an active member of the “Peace Now”

movement, she regularly demonstrated against the settlement

policy and for solidarity between all inhabitants of Israel. She

told us that she often had been abused by pedestrians during

those demonstrations. Nevertheless she persisted in these

efforts even after her 17 year old granddaughter, whom we had

visited together in 1990, was killed in a Hamas suicide attack

in 2003. Another common trait was our love for animals, hers

for cats, mine for dogs. I vividly remember the devastation in

her face when, in our living room, she was informed by phone

that her cat in Jerusalem had disappeared.

Upon completing her Ph.D., Nechama remained at the Hebrew

University of Jerusalem, as the curator of aquatic invertebrates

in the National Natural History Collection. Nechama’s public

and scientific activity earned her many accolades. She was

chosen as an honorary citizen of Jerusalem for her work in the

Zoo and other public activity. She was also made an honorary

member of the Zoological Society of Israel for her work on

Lessepsian migrants.

Ariel: I first met Nechama as a graduate student. I had no

interest in serpulids or any other worms at the time (my work

was on amphibian development). Even though I knew nothing

of her work, she had a very clear presence in the department.

Her general liveliness and optimism were extremely

contagious, and she was well-liked by everyone. She was the

“older sister” of many of the graduate students in the

department, and volunteered to do English editing for

everyone’s papers and presentations.

Harry: But of course we often talked shop, more and more

calcareous tubeworms, though she kept an interest in other

polychaetes as well. In 1986 she came to Amsterdam with an

outline of a manuscript on some extremely small worms she

had from the Red Sea and Cyprus, which she believed to be

new to science and wanted to give the Arabic name Hadiya

(gift). However, I had the feeling having seen a description

(and drawing) of an operculum very similar, if not the same, in

papers by Bush and Straughan, and advised her to have a good

look at those papers. A year later I was sent a manuscript for

review by a well-known journal. It was the same manuscript,

finished but without what I thought were essential

modifications. She dearly wanted to make the statement

included in Hadiya. I phoned the editor and told him that I

hardly could remain anonymous, since I could only give the

same comments as a year before. He asked me to review the

paper anyhow, so I bought a different daisy wheel for the

printer (she would recognize my lettering from my frequent

letters), asked my colleague to write some remarks in the

margin of the manuscript, and sent off an “anonymous”

review. After a couple of months Nechama sent me a letter

asking my advice on two reviews she had received, one by

Helmut Zibrowius and one a very long set of comments by an

anonymous reviewer, almost as long as the original manuscript.

I could only confess that I had been that anonymous reviewer,

and she immediately asked me to come in as second author.

Once interested, she could be very tenacious, and in this case

even went to the USA again to find new material in Bush’s dry

coral collections. Mind you, the tubes are hair thin and the dry

opercula slightly over 0.1 mm wide! The rest you can read in

our 1989 publication.

M. Nechama Ben-Eliahu, 4 January 1935 - 23 March 2014. Obituary and some personal reminiscences

349

Ariel: When I returned from my post-doc to a faculty position

at the Hebrew University, I was made academic curator of the

aquatic invertebrate collection - the same collection that

Nechama was the (now retired) curator of. Not having a

background in natural history collections, I was greatly helped

into the new position by Nechama and her great experience

and passion for natural history. We became very close in the

last few years, talking almost daily, often over lunch. We

talked about a wide range of subjects, as wide as Nechama’s

interests, from science and zoology, through university politics

and, of course, frequently about national politics. I heard many

stories from her about the Golden Years of the Collections; her

field work in the Suez Canal weeks after the end of the 1967

war; the great collecting expedition in the Western

Mediterranean on board the Meteor, wading in boots in the

mud near Haifa Harbor; her trips around the world to the

International Polychaete Conferences (I think she attended

every one of them, except for the last one in Sydney). The last

meeting she went to was the one in Lecce. She brought me the

conference T-shirt as a gift, and I still wear it and think of her.

Harry: I mentioned her capacity for tenaciousness. My

preferred animals are big and showy, or with nice and very

distinctive opercula thought to be clear-cut species, such as the

X-mas tree worms Spirobranchus and Hydroides. She

nevertheless lured me into small to very small worms three

times, with Rhodopsis (above), with the mistakes made in

juvenile Hydroides (published 2005), and the taxonomic mess

of Salmacina. Admittedly, we have not solved the last

problematic taxon, one would need DNA for that, but found at

least some useful characters, which I until then had thought

impossible. Her Magnum Opus (with some help from my side)

of course was Serpulidae (Annelida: Polychaeta) from the

Suez Canal—From a Lessepsian Migration Perspective (a

Monograph ), 2011. Her drive made us even search for

additional data for this reconstruction in time - of serpulid

settlement in the Suez Canal - in dry tubes attached to

molluscs in Naturalis, painstaking work which in Dutch would

be called “monks’ work”! With her impulsive continuous

improvements, even when I was in the middle of editing parts,

she made me mad and almost drove me crazy, but finally a lot

of work came together in this paper.

Ariel: About 4 years ago she went into hospital for what

supposed to be a routine operation, during which it was

discovered she had cancer. A series of medical errors and

complications led to the fact that for the last few years of her life

she was in and out of hospitals. She didn’t lose her optimism or

her energy. She continued to come to work whenever she could

(despite being retired for over 10 years). She would always

apologize if she missed a day’s work because of a doctor’s

appointment or because she wasn’t feeling well. I had to argue

with her to convince her that it perfectly legitimate not to come

to work under these conditions, and we are all happy to see her,

but nobody would be angry with her if she didn’t come in. She

made the last edits to her monograph and went over the final

proofs, while in the hospital, much to the surprise (and respect)

of the hospital staff. As a sign of gratitude, she invited the entire

staff of the ward she was in to a guided visit to the Zoo.

Harry: The last years, especially after she had been diagnosed

with cancer, we spoke (and sometimes saw) each other almost

every two weeks by phone (or on Skype). Even then she remained

a “peoples’ person”, worrying about others. In hospital

November 2011 she called to inform me that her email account

had been hacked and misused (which I had noticed an hour

before) to solicit money from her contacts. She asked me to

warn the annelid community. Unfortunately the begging proved

to be successful with one of her local acquaintances. Nechama

always was very reticent to talk about herself, notwithstanding

the fact that she was perfectly aware that both my wife and I

know cancer first hand, and as a straightforward Dutchman I

can ask very direct questions. She always enquired about our

health, and that of the children/grandchildren, and indeed kept

us informed on the (family) situation in Israel. Summer 2013

she decided not to go to the 11th International Polychaete

Conference in Sydney, she had not missed a single one before,

sent me the presentation of her intended talk, but nevertheless

told me she hoped to go to the next conference in three years

time. Typical for her state of mind. After that her scientific

communications dwindled to nil, although she tried, the effort

proved to be too strenuous. However, even a few weeks before

the end she still showed a student, interested in Spirobranchus

and with whom I was exchanging information, specimens

present in the Hebrew University Collections. When she was not

on Skype any longer, nor answering mails, I knew that her

situation was bad. Some 10 days before she died I last heard her

voice over the phone, weak as the way she felt. Amongst my

colleagues, Nechama ranked as a friend. I will miss her.

Ariel: In 2012 Nechama and I got a joint grant to look at

Mediterranean serpulids, repeating the survey done by her and

Harry 20 years earlier. Work on this project filled the last years

of her life. She was not able to do sampling herself, so we hired

a professional marine biologist to sample for us. I went with her

to meet him on the Kibbutz where he lives on the Mediterranean

coast, and she taught him how and where to sample. She waded

into the water (frail as she was), and pulled specimens out with

her hands. I think this was the last time she was “in the field”.

About a week before her death a sample of serpulids arrived for

her to go over. Sadly, she never had a chance to see them.

Nechama Ben Eliahu passed away late in the evening of the 23 rd

of March 2014. Her funeral was attended by several hundred

people. The eulogies lasted for over 45 minutes (very unusual

for Jewish funerals), with acquaintances from all her different

circles speaking in her memory. They all praised her kindness,

her wonderful cheerfulness and her total dedication to

everything she did. She will be sorely missed by all.

Bibliography - M. Nechama Ben-Eliahu

Ben-Eliahu, M.N., 1972a. Littoral Polychaeta from Cyprus. Tethys 4,

1: 85-94.

Ben-Eliahu, M.N., 1972b. A description of Hydroides steinitzi n.sp.

(Polychaeta: Serpulidae) from the Suez Canal with remarks on the

serpulid fauna of the Canal. Israel Journal of Zoology 21: 77-81.

Ben-Eliahu, M.N., 1972c. Studies on the migration of the Polychaeta

through the Suez Canal, Biological effects of interoceanic canals.

XVII International Zoological Congress, Monaco, (preprint), 14 pp.

350

A.D. Chipman & H.A. Ten Hove

Ben-Eliahu, M.N., 1972d. Polychaeta errantia of the Suez Canal.

Israel Journal of Zoology 21(3-4): 189-237.

Ben-Eliahu, M.N., 1975a. Polychaete cryptofauna from rims of similar

intertidal vermetid reefs on the Mediterranean coast of Israel and in

the Gulf of Elat: Nereidae (Polychaeta Errantia). Israel Journal of

Zoology 24: 177-191.

Ben-Eliahu, M.N., 1975b. Polychaete cryptofauna from rims of similar

intertidal vermetid reefs on the Mediterranean coast of Israel and in

the Gulf of Elat: Sabellidae (Polychaeta Sedentaria). Israel Journal

of Zoology 24: 54-70.

Ben-Eliahu, M.N., & U.N. Safriel, 1975. A comparison of species

diversities of Polychaeta from rims of similar intertidal vermetid

reefs from the eastern Mediterranean and the Gulf of Elat.

Proceedings 6th Scientific Conference of the Israel Ecological

Society, Tel-Aviv June 1975: 26-37.

Ben-Eliahu, M.N., 1976a. Polychaete cryptofauna from rims of similar

intertidal vermetid reefs on the mediterranean coast of Israel and in

the Gulf of Elat: Serpulidae (Polychaeta Sedentaria). Israel Journal

of Zoology 25: 103-119.

Ben-Eliahu, M.N., 1976b. Polychaete cryptofauna from rims of similar

intertidal vermetid reefs on the Mediterranean coast of Israel and in

the Gulf of Elat: Sedentaria. Israel Journal of Zoology 25: 121-155.

Ben-Eliahu, M.N., 1976c. Errant polychaete cryptofauna (excluding

Syllidae and Nereidae) from rims of similar intertidal vermetid reefs

on the Mediterranean coast of Israel and in the Gulf of Elat. Israel

Journal of Zoology 25: 156-177.

Ben-Eliahu, M.N., 1977a. Polychaete cryptofauna from rims of similar

intertidal vermetid reefs on the Mediterranean coast of Israel and in

the Gulf of Elat: Syllinae and Eusyllinae (Polychaeta Errantia:

Syllidae). Israel Journal of Zoology 26: 1-58.

Ben-Eliahu, M.N., 1977b. Polychaete cryptofauna from rims of similar

intertidal vermetid reefs on the Mediterranean coast of Israel and in

the Gulf of Elat: Exogoninae and Autolytinae (Polychaeta Errantia:

Syllidae). Israel Journal of Zoology 26: 59-99.

Ben-Eliahu, M.N., & J. Dafni, 1979. Anew reef-building serpulid genus

and species from the Gulf of Elat and the Red Sea, with notes on

other gregarious tubeworms from Israeli waters. Israel Journal of

Zoology 28: 199-208.

Ben-Eliahu, M.N., 1980. Nereidae (Annelida: Polychaeta) of the eastern

Mediterranean and Sinai Peninsula, with an appendix on a new

serpulid. Israel Journal of Zoology 29: 206-207.

Ben-Eliahu, M.N., & U.N. Safriel, 1982. A comparison between species

diversities of polychaetes from tropical and temperate structurally

similar rocky intertidal habitats. Journal of Biogeography 9: 371-

390.

Ben-Eliahu, M.N., & D. Golani & A. Ben Tuvia, 1983. On predation of

polychaetes (Annelides) by the squirrel-fish Adioryx ruber

(Holocentridae), with a new polychaete record for the Mediterranean

coast of Israel. Tethys 11(1): 15-19.

Ben-Eliahu, M.N., & P.A. Hutchings & CJ. Glasby, 1984. Ceratonereis

lizardensis n. sp. (Polychaeta; Nereididae) and Malacoceros indicus

(Spionidae), from a Mangrove Habitat at Lizard Island, North

Queensland, in PA. Hutchings ed.. Proceedings of the First

International Polychaete Conference, Sydney, Australia, 1983.

Sydney, The Linnean Society of New South Wales, pp. 91-97.

Ben-Eliahu, M.N., 1987. An approach to nereidid morphometry. Bulletin

of the Biological Society of Washington 7: 169-173.

Ben-Eliahu, M.N., & U.N. Safriel & S. Ben-Tuvia, 1988. E nvironmental

stability is low where polychaete species diversity is high: quantifying

tropical vs temperate within-habitat features. Oikos 52: 255-273.

Ben-Eliahu, M.N., 1989a. Lessepsian migration in Nereididae (Annelida:

Polychaeta): some case histories, in E. Spanier, Y. Steinberger and

M. Luria eds.. Environmental Stability. Environmental Quality and

Ecosystem Stability: Jerusalem.

Ben-Eliahu, M.N., 1989b. Serpulid tubeworms of Red Sea origin in

the eastern Mediterranean. Israel Journal of Zoology 35: 84.

Ben-Eliahu, M.N., & H.A. ten Hove, 1989. Redescription of

Rhodopsis pusilla Bush, a little known but widely distributed

species of Serpulidae (Polychaeta). Zoologica Scripta 18, 3:

381-395.

Ben-Eliahu, M.N., 1990. Nereididae of the Suez Canal potential

Lessepsian migrants. Israel Journal of Zoology 36(3-4): 162-163.

Ben-Eliahu, M.N., & D. Golani, 1990. Polychaetes (Annelida) in the

gut contents of goatfishes (Muliidae), with new polychaete

records for the Mediterranean coast of Israel and the Gulf of Elat

(Red Sea). Marine Ecology 11(3): 193-205.

Ben-Eliahu, M.N., 1991a. Red Sea serpulids (Polychaeta) in the

eastern Mediterranean. In: M.E. Petersen & J.B. Kirkegaard

(eds). Proceedings of the 2nd Internatioal Polychaete Conference,

Copenhagen, 1986. Ophelia Supplement 5: 515-528.

Ben-Eliahu, M.N., 1991b. Nereididae of the Suez Canal - potential

Lessepsian migrants? Bulletin of Marine Science 48(2): 318-329.

Ben-Eliahu, M.N., & D. Golani & A. Ben Tuvia, 1991. On predation

by goatfishes (Muliidae) with new polychaete records for the

Mediterranean coast of Israel and the Gulf of Elat. Israel Journal

of Zoology 36: 41-42.

Ben-Eliahu, M.N., & H.A. ten Hove, 1991. Serpulid tubeworms

(Annelida: Polychaeta) - a recent expedition along the

Mediterranean coast of Israel finds new population buildups of

Lessepsian migrant species. Proceedings of the Israel Society of

Zoology 37: 179-180.

Ben-Eliahu, M.N., & H.A. ten Hove, 1992. Serpulids (Annelida:

Polychaeta) along the Mediterranean coast of Israel - New

population buildups of Lessepsian migrants. Israel Journal of

Zoology 38: 35-53.

Ben-Eliahu, M.N., & D. Fiege, 1994. Polychaetes of the family

Acoetidae (=Polyodontidae) from the Levant and the Central

Mediterranean with a description of a new species of Eupanthalis.

Memoires du Museum national d’Histoire naturelle 162: 145-161.

Ilan, M., & M.N. Ben-Eliahu & B.S. Galil, 1994. Three deep water

sponges from the Eastern Mediterranean and their associated

fauna. Ophelia 39, 1: 45-54.

Ben-Eliahu, M.N., 1995. A list of Polychaeta from along the Levant

coast. Haasiana, a newsletter of the Biological Collections of the

Hebrew University 1: 78-89.

Ben-Eliahu, M.N., & D. Fiege, 1995. Polychaeta from the continental

shelf and slope of Israel collected by ‘Meteor’ 5 Expedition

(1987). Senckenbergiana Maritima 25(4/6): 85-105.

Ben-Eliahu, M.N., 1996. Nereid cryptofauna of intertidal vermetid

reefs along the Mediterranean coast of Israel — Twenty years’

overview, in Y. Steinberger ed.. Presentation of our world in the

wake of change. Jerusalem, ISEEQS Pub., pp. 592-595.

Ben-Eliahu, M.N., & D. Fiege, 1996. Serpulid tube-worms (Annelida:

Polychaeta) of the Central and Eastern Mediterranean with

particular attention to the Levant Basin. Senckenbergiana

Maritima 28 (1/3): 1-51.

Ben-Eliahu, M.N., & D. Fiege & H. Zibrowius, 1997. Shelf and deep¬

water Serpulidae of the eastern Mediterranean with particular

emphasis on the Levant Basin. Bulletin of Marine Science

60(2): 608.

Ben-Eliahu, M.N., & G. Payiatas, 1999. Searching for Lessepsian

migrant serpulids (Annelida: Polychaeta) on Cyprus - some results

of a recent expedition. Israel Journal of Zoology 45: 101-119.

Ben-Eliahu, M.N., & H.A. ten Hove, 2001. On some previously

unreported collections of Serpulidae (Polychaeta: Annelida)

from the Suez Canal. Abstract, 2001 Meeting Israel Society of

Zoology.

M. Nechama Ben-Eliahu, 4 January 1935 - 23 March 2014. Obituary and some personal reminiscences

351

Hove, H.A. ten & M.N. Ben-Eliahu, 2003. Taxonomic confusion due

to ontogeny in some Hydroides species (Annelida: Polychaeta:

Serpulidae). Book of abstracts. Zoological Society of Israel, 40th

Meeting, Sde Boqer, 21.12.2003: 91. {Israel Journal of Zoology)

Hove, H.A. ten & M.N. Ben-Eliahu, 2005. On the identity of Hydroides

priscus Pillai 1971 - Taxonomic confusion due to ontogeny in

some serpulid genera (Annelida: Polychaeta: Serpulidae).

Senckenbergiana Biologica 85, 2: 127-145.

Ben-Eliahu, M.N., & H.A. ten Hove, 2006. The serpulid tubeworm

fauna from the Mediterranean, Suez Canal, and Red Sea.

Haasiana, a newsletter of the Biological Collections of the

Hebrew University 3: 60.

Ben-Eliahu, M.N., & H.A. ten Hove & D. Fiege, 2001. Report on

Serpulidae (Annelida: Polychaeta) from the Red Sea. Program &

Abstracts of the 7th International Polychaete Conference, 2-6

July, Reykjavik Iceland, 191 pp.: 86.

Ben-Eliahu, M.N., & H.A. ten Hove & E. Rahamim, 2008. Further

studies on the “cosmopolitan” status of “ Salmacina dysteri ” in the

Indo-Pacific. p. 241 in: Proceedings of the forty-fourth annual

meeting of the Zoological Society of Israel, 9 December 2007.

Israel Journal of Ecology and Evolution 54: 239-255.

Ben-Eliahu, M.N., & H.A. ten Hove, 2011. Serpulidae (Annelida:

Polychaeta) from the Suez Canal—From a Lessepsian Migration

Perspective (a Monograph). Zootaxa 2848: 1-147.

Ben-Eliahu, M.N., & H.A. ten Hove & G. Rilov, 2012. Estimating lag¬

time in population buildups of Lessepsian migrant serpulid

tubeworms along the Levant Mediterranean coast. Abstract, 21st

International Congress of Zoology, Haifa, Israel, 2-7 September

2012.

Ben-Eliahu, M.N., & A. Chipman & H.A. ten Hove & H.K. Mienis &

G. Rilov, 2013. Alien invasive serpulids in the Levant

Mediterranean—an update. Program & Abstracts of the 11th

International Polychaete Conference 4-9 August 2013, Sydney.

Memoirs of Museum Victoria 71:353-359 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Michel Bhaud (1940 - 2012) obituary

Daniel Martin 1 * and Peter J. W. Olive 2

1 Centre d’Estudis Avan§ats de Blanes (CEAB-CSIC), Carrer d’acces a

la Cala Sant Francesc 14, 17300 Blanes (Girona), Catalunya (Spain)

2 Emeritus Professor, School of Marine Science and Technology,

Newcastle University, Newcastle upon Tyne, NE2 4NS, UK

* To whom correspondence should be addressed.

Email: dani@ceab.csic.es

It was with great sadness that we learned of the death of

Professor Michael Bhaud on May 8 2012, when he was only

72 years old.

Michel Bhaud was born the 30th of July 1940 in Vebret, a

small village shadowed by the basaltic plateau of Chastel-

Marlhac, in Cantal (Auvergne, France). He studied in Caen,

obtained a DEA in Biological Oceanography in Paris (1964),

and became Doctor in Natural Sciences in 1971. His Doctoral

Thesis was directed by Professor Pierre Drach, having as a

member of the jury a Professor already well-known as a

polychaetologist: Lucien Laubier.

Michel entered the CNRS in October 1966 as “Stagiaire de

Recherche” and soon moved to “Attache de Recherche” (1968)

and “Charge de Recherche” (1973). He was then Maitre-

Assistant at the University of Paris VI (1973-1976) and finally

became “Maitre de Conference” since 1980. In 1975 he

received the bronze medal of the CNRS.

Michel was also lucky with his military service, which he

was able to undertake within the framework of a technical

cooperation in the ORSTOM Oceanographic Centre at Nosy-

Be (Madagascar), from February 1967 to May 1968. His time

spent at Nosy-Be, as was always the case with the various

challenges and opportunities he faced, resulted in scientific

papers, in this case an important series of papers on larval

biology (e.g. Bhaud, 1969a, Bhaud, 1969b, Bhaud, 1972b).

Being as active in teaching activities as in research, Michel

participated in all levels of student training, including practical

lessons during the annual visits to the OOB by the 3rd cycle

students of the University of Paris, in addition to the

supervision of numerous pre- and post-doctoral students, all of

whom successfully gained their theses and proceeded to post¬

doc projects. Many now occupy senior positions in laboratories

in France and around Europe. All (Daniel Martin included)

were infected by his love of nature, its creatures, and the

science that tries to describe them. His enthusiasm was

contagious and he has been a guide for their studies from the

moment their collaborations began during their ‘stages’ in the

Meeting of the INTAS project on the sibling species problem held in

Ravenna (1999): L Michel Bhaud; 2. Phyllis Knight-Jones; 2.

Vladislav Khlevovitch; 4. Marco Abbiati; 5. Daniel Martin; 6. Temir

Britayev (Absent: Alexander Rzhavsky).

OOB, where all frequently enjoyed the interesting

conversations at the social and scientific parties that Michel

kindly offered at his beautiful house in Mas Parer, a small

village half way from Banyuls-sur-mer to the Col de Banyuls,

half way from the sea to the Pyrenees.

Michel has been an important mentor, a good friend, an

exemplary person, and an excellent scientist influencing for the

better all who worked with him. To typify these experiences,

following Daniel Martin’s first ‘stage’ in Banyuls in 1994, they

established a continuous collaboration that resulted in a long-

lasting friendship, but also in the publication of scientific

papers on several of Michel’s preferred topics, from larval

biology and recruitment to the life cycle of Eupolymnia

354

D. Martin & P.J.W. Olive

nebulosa and the taxonomy and ecology of Chaetopteridae and

Oweniidae (Arnoux et al., 1995, Bhaud et al., 1995a, Bhaud et

al., 2006, Bhaud et al., 2003, Cha et al., 1997, Martin et al.,

1996, Martin et al., 1998, Martin et al., 2008, Martin et al.,

2006, Martin et al., 2000). They also collaborated in several

joint projects. Among them, a French/Spanish INTEREG

project and an INTAS project on the sibling species problem

deserve special mention. The international reputation and

prestige of Michel resulted in ongoing collaboration between

DM and other well-recognised scientists working on marine

ecology and polychaetes; these included Vladislav Khlebovich,

Marco Abbiati, Phyllis Knight-Jones and Temir Britayev (Fig.

1). No doubt many others would be able to recount similar

influences, resulting in new insights and new research directions

typified by Daniel Martin’s current interest in the Haplosyllis

spongicola complex.

Michel’s vast experience and knowledge enabled him to

play an active role in the governance, planning and supervision

of National and International research programmes. His role

in the French National Research Program on the Determinism

of the Recruitment (PNDR) has to be highlighted in particular;

this was led by Michel for several years and gave rise to a

series of internationally important studies on recruitment and

larval biology and ecology that were revolutionary and will

always remain a matter of discussion.

Michel’s work at the Laboratoire Arago of the OOB, began

at the time when Professor Drach was appointed Director

(1965 a 1976). Soon he joined the Plankton Team, where he

was in charge of the study of the polychaete larvae (always

encouraged by Lucien Laubier). According to his own words:

“Malgre les travaux de THORSON, tout reste a faire en

Mediterranee. Alors commence le lent travail d’identification

par elevages apres la peche en mer ou ma presence est

constante.” Since then, he intensively worked on the study of

polychaete larvae, taking many different approaches:

taxonomic identifications, faunistics, dispersal, biogeography,

settlement, feeding modes, swimming behaviour, and so on

(e.g. Arnoux et al., 1995, Bhaud, 1966a, Bhaud, 1966b, Bhaud,

1967a, Bhaud, 1972c, Bhaud, 1974d, Bhaud, 1983d, Bhaud,

1986, Bhaud, 1988c, Bhaud, 1989, Bhaud, 1990a, Bhaud, 1991,

Bhaud, 1993b, Bhaud, 1998c, Bhaud, 2003, Bhaud & Cazaux,

1982, Bhaud & Cazaux, 1987, Bhaud & Cazaux, 1990, Bhaud

et al., 1990, Bhaud et al., 1994a, Bhaud et al., 1995a, Bhaud et

al., 1995b, Bhaud & Duchene, 1989, Bhaud & Duchene, 1996,

Bhaud & Fernandez-Alamo, 2000, Bhaud & Gremare, 1988,

Bhaud et al., 1999, Bhaud & Fernandez-Alamo, 2001, Duchene

et al., 1992, Marcano & Bhaud, 1995, Nozais et al., 1997).

After several years focusing on plankton, Michel started to

enlarge his scientific interests to the benthic domain, studying

the energetic links between ecosystems and the energy flows

at the individual level, which at that time corresponded to a

particular component of the studies conducted by the research

group on “Structure and Functioning of the Benthic

Ecosystem” at the Laboratory Arago. Accordingly, Michel

argued that “Cette modification progressive de l’orientation’

des recherches permet, en depassant les questions liees a une

unite zoologique particuliere, un regroupement des differents

sujets autourd’un theme lie aufonctionnementdes ecosystemes

et a leurs relations.” (e.g. Bhaud, 1988b, Bhaud et al., 1995b,

Cha et al., 1997, Martin et al., 1998, Martin et al., 2000).

The focus on benthos and the combined interest on the

factors affecting larval dispersal and the distribution of the

adult populations also led Michel to pay attention to taxonomic

problems and so he became one of the best representatives of

a remarkable generation of French polychaete taxonomists.

For instance, his work on Chaetopteridae (e.g. Bhaud, 1966a,

Bhaud, 1969d, Bhaud, 1969f, Bhaud, 1972a, Bhaud, 1975e,

Bhaud, 1977b, Bhaud, 1978, Bhaud, 1998b, Bhaud, 2003,

Bhaud, 2005, Bhaud & Fernandez-Alamo, 2000, Bhaud et al.,

2002a, Bhaud et al., 2006, Bhaud et al., 1994c, Bhaud et al.,

2003, Bhaud & Petti, 2001, Bhaud et al., 2002b, Martin et al.,

2008, Nishi & Bhaud, 2000, Nishi et al., 2004b, Nishi et al.,

1999) and Oweniidae (e.g. Koh & Bhaud, 2001, Koh & Bhaud,

2003, Koh et al., 2003, Martin et al., 2006, Pinedo et al., 2000)

are still matter of reference.

In addition to the more than 120 scientific papers he wrote

during his prolific scientific life (see a complete reference list

at the end of this text), Michel was very active in many other

aspects of scientific life. For instance, since the first one in

Sydney, where he presented a paper on the oocytes of

Sabellaria alveolata (Bhaud et al., 1984), his presence and

talks in the different Polychaete Conferences (and also his

participation in social events) will always be within the best

souvenirs of most of us (Figure 2). He also participated in and

presented papers at many of the meetings of the International

Society for Invertebrate Reproduction for instance those held

in UK, France (Lille), Japan, and Dublin and at international

meetings relating to aquaculture and fisheries. In this way he

ensured that polychaete research was well represented at

important scientific meetings with a broader taxonomic remit.

As global concerns about climate change began to emerge, he

soon realised the significance of his work on polychaete

reproduction and larval development in this important context

and took part in international meetings to consider what the

ecological consequences of climate change might be (Bhaud et

al 1994b). It was characteristic of Michel, throughout his

publishing career, that he thought deeply about the wider

significance of his work and many of his papers are fine

examples of scientific philosophy and thought.

It is testimony to the character of Michel that, from the

many international collaborations that characterised his long

and active career, grew many personal friendships as both

authors can testify. As a polychaete biologist, Peter Olive

shared many of the Michel’s interests especially those in

different aspects of reproductive biology. Michel’s publications

on the timing of polychaete larval appearance in different

biogeographical regions (e.g. Bhaud 1972c, 1988, 1991, 1998;

Bhaud and Duchene 1989, 1996; Bhaud et al 1990, 1992, 1995;

Bhaud and Fernandez-Alamo, 2000) strongly influenced much

of the work done at Newcastle University and served as a key

starting point for taught courses on reproduction and

seasonality for honours Zoology and Marine Biology students

at Newcastle University. The mechanisms by which

polychaetes, and other marine organisms, transduce

environmental signals, the so called proximate factors

determining the timing of breeding and the ultimate factors

Michel Bhaud (1940-2012)

355

through which an adaptive advantage is gained, has long

interested marine biologists and the work of Michel is central

to this problem. Michel understood the important distinction

between these two aspects and, with his students and

international collaborators, he contributed extensively to this

important field of study, requiring, as it does skills in both field

ecology and experimental, laboratory based, investigation

(Bhaud 1982a,b,c; Bhaud and Cha, 1992; Bhaud et al 1994b;

Cha et al, 1997; Martin et al. 1998). These studies will continue

to inform current interest in the molecular biology of

environmental signal transduction and biorhythmicity in

marine organisms and continue to have importance in relation

to climate change.

Michel was, throughout his research career, a natural

collaborator, forging links around the world. He became

involved with international training programmes and

contributed much to the development of a new generation of

researchers who would share his enthusiasm and who benefited

from his unmatched experience and knowledge of polychaete

larval biology. As an example, he participated as a lecturer in

the first advanced polychaete training workshop organised by

Maria Gambi at the Stazione Zoologica di Napoli’s ecology

laboratory on the Island of Ischia. Here, experienced teachers

and researchers were joined by the vanguard of younger

scientists working at the cutting edge of the latest taxonomic

procedures to teach an international group of polychaete

researchers at early stages in their careers. Michel’s enthusiastic

teaching in this milieu will have done much to cement the

interest of those who attended many of whom are now among

todays leading polychaete biologists and taxonomists.

Michel’s involvement in research, graduate student

development and training, and international scientific

enterprises stimulated cross national collaboration in many

different ways. He encouraged his overseas collaborators to

become involved in the examination of PhD theses in the

French way, and several of his overseas collaborators were

invited to participate at a ‘soutenance’. This was sometimes a

linguistic challenge for English speaking members (Peter

Olive included), but was always a pleasure and an honour.

Most importantly it led to opportunities to discuss areas of

mutual scientific interest and to forge further research

collaborations. He also encouraged participation of overseas

observers in the governance of those French National research

programmes in which he was involved. Through this an avenue

was opened for rapid the exchange of ideas between national

programmes in different countries not otherwise formally

linked. As an example, links developed between the CNRS

PNDR programme alluded to above, and the UK NERC

programme on Developmental Ecology of Marine Animals

(DEMA) (see Atkinson and Thorndyke eds., 2001) being

supported at the same time.

It was inevitable given the generous nature of Michel, that

these collaborations lead to close personal friendships, and the

authors of this appreciation make no apology for drawing on

their own personal experiences in the knowledge that similar

experiences will have been enjoyed by many others.

Michel Bhaud: A. with Wynn Knight-Jones at the 1 st Polychaete

conference in Sydney. B. at the 3 rd Polychaete Conference in Long

Beach. C. with Tomoyuki Miura, Maria Ana Fernandz-Alamo,

Madamme Dauvin and Jean-Claude Dauvin at the 8 th Polychaete

Conference in Madrid.

Michel and his wife Yvonne, also a CNRS researcher at

the OOB, had a daughter, Katy, and a son, Manu, and four

grandchildren. An international exchange of teenage children

between Michel’s family and Peter Olive (to learn the language)

as planned and instigated by Michel, was followed by family

vacations atBanyuls-sur-merfor some 13 years. The hospitality

extended by Michel and Yvonne, frequently involved an

invitation to stay in their delightful house and always

generously hospitality on the terrace of Mas Parer. Those

memories of good companionship on the terrace overlooking

the valley remain priceless and the friendships that developed

between the young people at Banyuls and the visitors from

England have endured to this day and are an unseen tribute to

the generosity of spirit of Michel, his wife Yvonne and their

children.

After a long and productive scientific life in which Michel

always remained an important scientific guide and mentor as

well as a kind and supportive person and friend, he retired in

2005, when he left the OOB. Sometime later, he courageously

underwent a triple bypass operation, after which Michel lived

at his beloved Massif Central, always devoted to his family

and, particularly, to his grandchildren but also characteristically

involved in local affairs.

Michel Bhaud has been one of the most important

influences in our scientific careers and we feel that his abiding

footprint will long remain with the entire polychaete

community. For those who knew him at a personal level, his

kindness and friendship will equally last forever. In presenting

this appreciation of his scientific career we also hope to

express our sympathy for his family, and for friends who

survive him.

356

D. Martin & P.J.W. Olive

References

Arnoux S., et al. (1995) Recruitment in the light of biological-physical

interactions in coastal waters: Results of PNDR action at the

Arago Laboratory in 1994-1995. Vie et Milieu, 45(2), 85-105.

Bhaud M. Quelques elements du recrutement larvaire neritique revus

pour une application aux grandes profondeurs. banyuls sur mer:

Universite P & M Curie laboratoire Arago.

Bhaud M. (1966a) Etude du developpement et de l’ecologie de quelques

larves de Chaetopteridae (Annelides Polychetes). Vie et Milieu, 17,

531-571.

Bhaud M. (1966b) Les larves planctoniques dAnnelides Polychetes;

leur interet pour une meilleure connaissance faunistique. Vie et

Milieu, 17,435-437.

Bhaud M. (1967a) Contribution a l’ecologie des larves pelagiques

d’annelides polychetes a Banyuls-sur-Mer. Comparaisons avec les

regions septentrionales. Vie et Milieu, 18, 273-315.

Bhaud M. (1967b) Etude du developpement de quelques larves

dAnnelides Polychetes a Banyuls-sur-Mer. Vie et Milieu, 18, Ser.

A, 531-558.

Bhaud M. (1969a) Etude de la migration verticale quotidienne des

larves de Mesochaetopterus Sagittarius a Nosy-Be (Madagascar).

Marine Biology, 4(1), 28-35.

Bhaud M. (1969b) Evolution des populations Meroplanctoniques de

larves de Mesochaetopterus Sagittarius ((Clarapede,1870) a Nosy-

Be (Madagascar). Vie et Milieu, 20(1-B), 159-170.

Bhaud M. (1969c) Liaisons entre la repartition spatiale du plancton, les

methodes de prelevement et l’interpretation des variations

mensuelles. Vie et Milieu, 23(2B), 297-231.

Bhaud M. (1969d) Note sur la systematique de la famille des

Chaetopteridae (annelides polychetes). pp 255-256.

Bhaud M. (1969e) Quelques donnees sur la biologie des invertebres

benthiques en climat tropical. Etude parallele des larves

pelagiques. Cahiers ORSTOM.Serie Oceanographie, 10(2), 161-

168.

Bhaud M. (1969f) Remarques systematiques et biogeographiques sur

le genre Mesochaetopterus Potts, 1914. Vie et Milieu, 20,325-332.

Bhaud M. (1971) La phase larvaire d’Oxydromus propinquus (Marion

et Bobretzky, 1875) Hesionidae. Vie et Milieu, 22,153-162.

Bhaud M. (1972a) Contribution a l’etude systematique des

Chaetopteridae (annelides polychetes). Vie et Milieu, 23, Ser. A(l),

141-156.

Bhaud M. (1972b) Identification des larves dAmphinomidae

(annelides polychetes) recueillies pres de Nosy-Be (Madagascar)

et problemes biologiques connexes. Cahiers ORSTOM.Serie

Oceanographie, 10(2), 203-216.

Bhaud M. (1972c) Quelques donnees sur le determinisme ecologique

de la reproduction des Anelides Polychetes. Marine Biology, Yl,

115-136.

Bhaud M. (1974a) Determination en petite profondeur du niveau de

peche des filets a plancton. Vie et Milieu, 24(1B), 93-108.

Bhaud M. (1974b) Etude de la repartition verticale du zooplancton en

Mediterranee. Campagne Mediplanct 1972 du N.O. “ Le NoroTt”.

II. Analyse des Methodes d’ echantillonnage. Annales de Vlnstitut

Oceanographique de Monaco, 50(1), 41-50.

Bhaud M. (1974c) Etude de la repartition verticale du zooplancton en

Mediterranee. Campagne Mediplanct 1972 du N.O. “Le Noroit”.

I. Buts et generalites. Annales de Vlnstitut Oceanographique de

Monaco, 50(1), 27-39.

Bhaud M. (1974d) La campagne Hydromed II du N.O.Jean-Charcot

premiere description de deux larves de Phyllochaetopteres

(Annelides polychetes). Vie et Milieu, 24(3,ser.A), 453-470.

Bhaud M. (1974e) Repartition des larves d’annelides polychetes en

Adriatique septentrionale. Thalassia Jugoslavia, 10(1-2), 1-21.

Bhaud M. (1975a) La campagne Hydromed II du N.O. Jean Charcot.

Larves dAnnelides Polychetes et problemes oceanographiques

connexes. Vie et Milieu, 25(2B), 261-282.

Bhaud M. (1975b) La campagne Hydromed II du N.O. Jean Charcot.

Larves d’annelides polychetes et problemes oceanographiques

connexes. Vie et Milieu, 25, Ser. B(2), 261-282.

Bhaud M. (1975c) Nouvelles donnees sur les larves de Sabellariidae en

Mediterranee. Annales de Vlnstitut Oceanographique de Monaco,

51(2), 155-172.

Bhaud M. (1975d) Nouvelles observations de Sabellariidae (Annelides

Polychetes) dans la region malgache. Cahiers ORSTOM.Serie

Oceanographie, 13(1), 69-77.

Bhaud M. (1975e) Presence de Mesochaetopterus minutus (Annelide

Polychete), Chaetopteridae) dans la region de Banyuls-sur-Mer.

Vie et Milieu, 25, 341-344.

Bhaud M. (1975f) Rapports entre epoque de reproduction.

Biogeogrphie et repartition verticale. Un exemple particulier:

Spiochaetopterus costarum (Annelide polychete). Vie et Milieu,

25, 123-140.

Bhaud M. (1977a) Interpretation des variations numeriques

saisonnieres chez deux types d’organismes marins. Annales de

Vlnstitut Oceanographique, 53(1), 31-46.

Bhaud M. (1977b) Note sur quelques representants du genre

Phyllochaetopterus (annelides polychetes) et observations au

microscope abalayage des soies specialises. Vie et Milieu, 27(1),

11-33.

Bhaud M. (1978) Morphological variations of the modified setae of

chaetopterids during ontogenesis. Ophelia, 17(2), 199-206.

Bhaud M. (1979) Description et utilisation d’un engin de recolte a

proximite du sediment. Bulletin d’Ecologie, 10(a), 15-27.

Bhaud M. (1980) Mise en evidence des principauxfacteurs ecologiques

de la reproduction des polychaetes: etude de synthese. Oceanis,

6(3), 251-276.

Bhaud M. (1982a) Mise en evidence des principaux facteurs

ecologiques de la reproduction des polychetes: etude de synthese.

Oceanis, 3(2), 251-272.

Bhaud M. (1982b) Relation entre strategies de reproduction et l’aire de

repartition chez les annelides Polychetes. Oceanologica Acta, 5,

465-475.

Bhaud M. (1983a) Comparaison of enlarged setae in larvae and adults of

Phyllochaetopterus verrilii (Polychaeta). Ophelia, 22(2), 257-236.

Bhaud M. (1983b) An improved device for near-bottom water

sampling. Preliminary result. Journal du Conseil Permanent

International pour VExploration de la Mer, 41(1), 46-49.

Bhaud M. (1983c) Les limites de distributions geographiques chez

quelques invertebres marins. Oceanis, 9(4), 317-335.

Bhaud M. (1983d) Premieres observations de la larve planctonique

recoltee en haute mer d’un representant des Paraonidae (Annelide

Polychete). Vie et Milieu, 33(1), 41-48.

Bhaud M. (1984) Les larves meroplanctoniques et leur implication en

biogeographie et paleobiogeographie. Comptes Rendues

hebdomadaires des seances de VAcademie des Sciences, Paris,

299(Ser. Ill num. 9), 361-364.

Bhaud M. (1986) Preliminary data on meroplanktonic larvae of

Polychaeta in the Noumea lagoon, south western new Caledonia.

Journal of Coastal Research, 2(3), 297-309.

Bhaud M. (1988a) Change in setal pattern during early development of

Eupolymnia nebulosa (Polychaeta: Terebellidae) grown in

simulated natural conditions. Journal of the Marine Biological

Association of the United Kingdom, 68, 677-687.

Bhaud M. (1988b) Influence of temperature and food supply on

development of Eupolymnia nebulosa (Montagu, 1818)

(Polychaeta, Terebellidae). Journal of Experimental Marine

Biology and Ecology, 118, 103-113.

Michel Bhaud (1940-2012)

357

Bhaud M. (1988c) La biologie larvaire chez les invert ebres marins:

une question d’actualite (Notes de lecture et commentaires). Vie et

Milieu, 38(1), 19-24.

Bhaud M. (1988d) The two planktonic larval periods of Lanice

conchilega (Pallas, 1766) Annelida Polychaeta. A peculiar

example of the irreversibility of evolution. Ophelia, 29(2), 141-

152.

Bhaud M. (1989) Role de la dissemination larvaire en

paleobiogeographie reevalue a la lumiere des donnees concernant

l’epoque actuelle. Bulletin de la Societe de Geologie France, 3,

551-559.

Bhaud M. (1990a) Acquisition de la vie benthique par Eupolymnia

nebulosa, Polychete Terebellidae: dispositifs experimentaux et

premiers resultats. Vie et Milieu, 40, 17-28.

Bhaud M. (1990b) Conditions d’etablissement des larves de

Eupolymnia nebulosa: acquis experimentaux et observations en

milieu naturel. Oceanis, 16, 181-190.

Bhaud M. (1991) Larval release from the egg mass and settlement of

Eupolymnia nebulosa (Polychaeta, Terebellidae). Bulletin of

Marine Science, 48(2), 420-431.

Bhaud M. (1993a) Atelier PNDR: Acquisition de la vie benthique sous

conditions controlees: l’occasion d’une reflexion. Informes du

Programe National sur le Determinisme du Recrutement, 19-20,

38-43.

Bhaud M. (1993b) Relationship between larval type and geographical

range in marine species: complementary observations on

gastropods. Oceanologica Acta, 16(2), 191-198.

Bhaud M. (1993c) Un modele coneptuel sur les sources de la variation

interannuelle. Informes du Programe National sur le Determinisme

du Recrutement, 19-20, 28-33.

Bhaud M. (1994a) Examples d’esperimentation in situ et au laboratoire

dans les recherches en benthologie.

Bhaud M. (1994b) La vie du programme: deux annees d’activite.

Informes du Programe National sur le Determinisme du

Recrutement, 21, 39-43.

Bhaud M. (1994c) Les contraintes dans la realisation des cycles de

developpement en mer. Bulletin de la Societe Zoologique de

France, 116(3-4), 27-36.

Bhaud M. (1995) L’ecosysteme hydrothermal profond et le recrutement.

Informes du Programe National sur le Determinisme du

Recrutement, 22, 34-38.

Bhaud M. (1998a) Developmental pattern diversity on a latitudinal

transect: interaction of adult habitat and larval dispersal. An

extensive summary. Oceanis, 24(4), 117-136.

Bhaud M. (1998b) The species of the genus Spiochaetopterus

(Polychaeta, Chaetopteridae) in the Atlantic-Mediterranean

biogeographic area. Sarsia, 83, 243-263.

Bhaud M. (1998c) The spreading potential of polychaete larvae does

not predict adult distributions, consequences for conditions of

recruitment. Hydrobiologia, 375/376,35-47.

Bhaud M. (2000a) Some examples of the Contribution of Planktonic

Larval Stages to the Biology and Ecology of Polychaetes. In:

Proceedings of the VI International Polychaete Conference.

Bulletin of Marine Science, 67(1), 345-358.

Bhaud M. (2000b) Two contradictory elements determine invertebrate

recruitment: dispersion of larvae and spatial restrictions on adults.

Oceanologica Acta, 23(4), 409-422.

Bhaud M. (2003) Identification of adults and larvae in Spiochaetopterus

(Polychaeta, Chaetopteridae): consequences for larval transport

and recruitment. Hydrobiologia, 496, 279-287.

Bhaud M. (2005) Evidence of a geographical variation in

Mesochaetopterus (Polychaeta: Chaetopteridae) from the Pacific

Ocean. Journal of the Marine Biological Association of the United

Kingdom, 85(6), 1409-1423.

Bhaud M. and Amouroux J.M. (1973) Sur la presence d'individus

adultes de Spiochaetopterus costarum (annelide polychete) dans la

region de Banyuls-sur-mer. Vie et Milieu, 23, Ser. A(2), 371-373.

Bhaud M., Bougnol C. and Duchene J.C. (1978) Observations sur la

limite de repartition bathimetrique de la polychete sedentaire

Terebellides stroemi dans le Golfe de Lion. Comptes Rendues de

TAcademie des Sciences de Paris, 287, 947-950.

Bhaud M. and Cazaux C. (1982) Les larves des Polychetes des cotes de

France. Oceanis, 8(2), 57-160.

Bhaud M. and Cazaux C. (1987) Description and identification of

polychaete larvae; their implications in current biological

problems. Oceanis, 13(6), 596-753.

Bhaud M. and Cazaux C. (1990) Buoyancy characteristics of Lanice

conchilega (Pallas) larvae (Terebellidae). Implications for settlement.

Journal of Experimental Marine Biology and Ecology, 141,31-45.

Bhaud M., Cazaux C. and Mathivat-LallierM.H. (1990) Metamorphose

retardee chez les larves de Polychetes et modele d’acquisition de

la vie benthique. Oceanis, 16(3), 207-223.

Bhaud M. and Cha J.H. (1992) Sources de fluctuation et stabilite dans

le cycle de vie d ’Eupolymnia nebulosa (Polychete) en Mediterranee.

Annales de I’Institut Oceanographique de Monaco, 68(1-2), 25-35.

Bhaud M., Cha J.H., Dauvin J.C., Laubier L. and Reish D.J. (1994a)

Larvae-substrate relationships of Eupolymnia nebulosa (Montagu,

1818) (Polychaeta, Terebellidae): An experimental analysis. Actes

de la 4eme Conference internationale des Polychetes. Paris, pp

371-382. [Zoologie.

Bhaud M., Cha J.H., Duchene J.C., Martin D. and Nozais C. (1995a)

Larval biology and benthic recruitment: New prospect on the role

of egg-masses and modelling life-cycle regulation. Scientia

Marina, 59(1), 103-117.

Bhaud M., Cha J.H., Duchene J.C. and Nozais C. (1994b) Influence of

temperature on the marine fauna: what can be expected from a

climate change. Journal of Thermal Biology, 20(1-2), 91-104.

Bhaud M., Cha J.H., Duchene J.C. and Nozais C. (1995b) Influence of

temperature on the marine fauna: What can be expected from a

climatic change. Journal of Thermal Biology, 20(1-2), 91-104.

[Duplication]

Bhaud M. and Dauvin J.C. (1990) Programme national sur le

determinisme du recrutement:methode et premiers resultats

concernant les invertebres benthiques. Journal des Recherches

Oceanographiques, 15, 25-28.

Bhaud M. and Duchene J.-C. (1996) Change from planktonic to

benthic development: is life cycle evolution an adaptive answer to

the constraints of dispersal? Oceanologica Acta, 19(3-4), 335-346.

Bhaud M. and Duchene J.C. (1975) Observations sur l’efficacite

comparee de 2 bennes. Vie et Milieu, 27(1A), 35-53.

Bhaud M. and Duchene J.C. (1978-1979) Donnees quantitatives sur les

fonds meubles de 90 m au large de Banyuls-sur-mer. Vie et Milieu,

28-29QA-B), 21-38.

Bhaud M. and Duchene J.C. (1989) Biologie larvaire et strategie de

reproduction des annelides polychetes en province subantarctique.

C.N.F.R.A., Paris, 59, 68-79.

Bhaud M. and Duchene J.C. (1996) Change from planktonic to benthic

development: is life cycle evolutioin an adaptative answer to the

constraints of dispersal? Oceanologica Acta, 19, 335-346.

[Duplication]

Bhaud M. and Fernandez-Alamo M.A. (2000) Planktonic larvae of

Spiochaetopterus (Polychaeta, Chaetopteridae) in the Gulf of

California: new evidence that the geographic distribution of

species with a long planktonic larval life is relatively restricted.

Ophelia, 52(1), 65-76.

Bhaud M. and Gremare A. (1988) Larval development of the Terebellid

Polychaete Eupolymnia nebulosa (Montagu, 1818) in the

Mediterranean Sea. Zoologica Scripta, 17(4), 347-356.

358

D. Martin & P.J.W. Olive

Bhaud M. and Gremare A. (1991) Reproductive cycle of Eupolymnia

nebulosa (Polychaeta: Terebellidae) in the Western Mediterranean

Sea. In: Proceedings of the 2nd International Polychaete

Conference. Ophelia, Supplement 5, 295-304.

Bhaud M., Gremare A., Lang F. and Retiere C. (1987) Comparative

study of reproductive features of Eupolymnia nebulosa (Montagu)

(Polychaeta, Terebellidae) in two parts of its distributional area.

Comptes Rendues hebdomadaires des seances de I’Academie des

Sciences, Paris, 304, 119-122.

Bhaud M., Gruet I., Gruet Y. and Hutchings PA. (1984) Variation

saisonniere du nombre et de la taille des ovocytes chez Sabellaria

alveolata (Linne) (Polychaeta; Sabellariidae) et des parametres

climatiques. Proceedings of the First Intenational Polychaete

Conference. Sydney, Australia: The Linnean Society of New

South Wales, pp 450-460.

Bhaud M., Jacques G. andRazouls C. (1967) Donnees meteorologiques

et hydrologiques sur la region de Banyuls-sur-Mer. Vie et Milieu,

18(1B), 137-151.

Bhaud M., Koh B.S. and Hong J.S. (2002a) Contribution to the present

status of Spiochaetopterus costarum: description of

Spiochaetopterus coreani, a new species of Chaetopteridae

(Polychaeta) from the West Coast of Korea. Proceedings of the

Biological Society of Washington, 115(2), 350-358.

Bhaud M., Koh B.S. and Martin D. (2006) New systematic results

based on chaetal hard structures in Mesochaetopterus (Polychaeta).

In: Recent Advances in Polychaete Research. Sarda,R., San Martin,

G., Lopez, E., Martin, D. & George, J. D. (Eds.). Scientia Marina,

70(Suppl. 3), 35-44.

Bhaud M., Koubbi P., Razouls S., Tachon O. and Acconero A. (1999)

Description of planktonic polychaete larvae from Terre Adelie

and the Ross Sea (Antarctica). Polar Biology, 22, 329-340.

Bhaud M., Lastra M.C. and Petersen M.E. (1994c) Redescription of

Spiochaetopterus solitarius (Rioja, 1917), with notes on tube

structure and comments on the generic status (Polychaeta:

Chaetopteridae). Ophelia, 40, 115-133.

Bhaud M. and Lefevre M. (1986) Les larves chetospheres des

Polychetes Spionidae dans le Pacifique. Remarques sur

Tidentification des stades larvaires. Bulletin du Museum National

d’Histoire Naturelle Paris, 8, 573-589.

Bhaud M., Martin D. and Gil J. (2003) Spiochaetopterus creoceanae, a

new species of Chaetopteridae (Polychaeta) from the Persian Gulf

belonging to the costarum- complex. Scientia Marina, 67(1), 99-

105.

Bhaud M. and Petti M. (2001) Spiochaetopterus nonatoi, anew species

of Chaetopteridae (Polychaeta) from Brazil: biogeographical

consequences. Journal of the Marine Biological Association of the

United Kingdom, 81(2), 225-234.

Bhaud M., Ravara A.A., Marcano G. and Moreira M.H. (2002b)

Mesochaetopterus Sagittarius: an example of a biogeography

discrepancy between larval and adult boundaries: implication for

recruitment studies. Journal of the Marine Biological Association

of the United Kingdom, 82(4), 565-572.

Bhaud M. and von Buren M. (1974) Une nouvelle larve d’annelide

polychete observee dans la region de Banyuls-sur-Mer. Contexte

ecologique d’une telle observation. Vie et Milieu, 24, Ser. A(3),

471-478.

Bhaud M.R. and Fernandez-Alamo M.A. (2001) Firts description of

the larvae of Idanthyrsus (Sabellariidae, Polychaeta) from the

Gulf of California and Bahia de Banderas, Mexico. Bulletin of

Marine Science, 68(2), 221-232.

Cha J.H. and Bhaud M. (2000) A new experimental approach to assess

settlement conditions in tube-building polychaetes; biological

implications. Oceanologica Acta, 23(4), 443-452.

Cha J.H., Bhaud M. and Nattero M.J. (1991) Etude esperimentale du

recrutement benthique en canal hydrodynamique et en milieu

calme. Comptes Rendues deVAcademie des Sciences de Paris, 313,

113-118.

Cha J.H., Martin D. and Bhaud M. (1997) Effects of temperature on

oocyte growth in the Mediterranean terebellid Eupolymnia

nebulosa (Annelida, Polychaeta). Marine Biology, 128, 433-439.

Duchene J.C. and Bhaud M. (1988) Uncinial patterns and age

determination in terebellid polychaetes. Marine Ecology Progress

Series, 49, 267-275.

Duchene J.C., Nozais C., Nival P., Boucher J. and Bhaud M. (1992)

Etude de remission des stades larvaires precoces d ’Eupolymnia

nebulosa (Polychaeta: Terebellidae). Ille Colloque du Programme

National sur le Determinisme du Recrutement. Monaco: Annales

de l’lnstitut Oceanographique, pp 15-24.

Grehan A.J., Keegan B.F., Bhaud M. and Guille A. (1992) Sediment

profile imaging of soft substrates in the western Mediterranean:

the extent and importance of faunal reworking. Comptes Rendues

de I’Academie des Sciences de Paris, 315, 309-315.

Koh B.S. and Bhaud M. (2001) Description of Owenia gomsoni n. sp.

(Oweniidae, Annelida Polychaeta) from the Yellow Sea and

evidence that Owenia fusiformis is not a cosmopolitan species. Vie

et Milieu, 51(1-2), 77-86.

Koh B.S. and Bhaud M. (2003) Identification of new criteria for

differentiating between populations of Owenia fusiformis

(Annelida, Polycheta) from different origins; rehabilitation of old

species and erection of two new species. Vie et Milieu, 53(2-3),

65-96.

Koh B.S., Bhaud M. and Jirkov I.A. (2003) Two new species of Owenia

(Annelida: Polychaeta) in the northern part of the North Atlantic

Ocean and remarks on previously erected species from the same

area. Sarsia, 88,175-188.

Lenaers G. and Bhaud M. (1992) Molecular phylogeny of some

polychaete annelids: an initial approach to the Atlantic-

Mediterranean speciation problem. Journal of Molecular

Evolution, 35(5), 429-435.

Marcano G. and Bhaud M. (1995) New observations on the terebellid

(Polychaeta) aulophore larvae on the French coasts. Ophelia,

43(3), 229-244.

Martin D., Cha J.H. and Bhaud M. (1996) Consequences of oocyte

form modifications in Eupolymnianebulosa (Annelida;Polychaeta).

Invertebrate Reproduction and Development, 29, 27-36.

Martin D., Cha J.H., Nozais C. and Bhaud M. (1998) An experimental

approach to the effects of varying recruitment strategy and food

intake on early reproductive traits in a brooding Mediterranean

polychaete. Marine Ecology Progress Series, 164, 147-156.

Martin D., Gil J., Carreras-Carbonell J. and Bhaud M. (2008)

Description of a new species of Mesochaetopterus (Annelida,

Polychaeta, Chaetopteridae), with re-description of

Mesochaetopterus xerecus and an approach to the phylogeny of the

family. Zoological Journal of the Linnean Society, 152, 201-225.

Martin D., Koh B.S., Bhaud M., Gil J. and Dutrieux E. (2006) The

genus Owenia (Annelida, Polychaeta) in the Persian Gulf, with

description of a new species, Owenia persica. Organisms Diversity

and Evolution, 6, 325-326.

Martin D., Le Nourichel C., Uriz M.J., Bhaud M. and Duchene C.

(2000) Ontogenic shifts in chemical defences in the NW

Mediterranean Eupolymnia nebulosa (Polychaeta, Terebellidae).

In: Proceedings of the VI International Polychaete Conference.

Bulletin of Marine Science, 67(1), 287-298.

Michel Bhaud (1940-2012)

359

Michel C., Bhaud M., Boumati P. and Halpern B.S. (1984) Physiology

of the digestive tract of the sedentary polychaete Terebellides

stroemi. Marine Biology, 83, 17-31.

Nishi E. and Bhaud M. (2000) Two new species of Spiochaetopterus

(Polychaeta: Chaetopteridae) from Okinawa, Japan, woth notes on

Pacific Spiochaetopterus. Pacific Science. University of Hawaii

Press , 54(1), 15-26.

Nishi E., Bhaud M. and Koh B.S. (2004a) Species of Spiochaetopterus

(Annelida: Polychaeta) from Sagami Bay and Tokyo Bay, Central

Japan with a Comparative Yable of Species from Japanese and

Adjacent Waters. Zoological Science, 21, 457-464.

Nishi E., Bhaud M. and Koh B.S. (2004b) Two new species of

Spiochaetopterus (Annelida: Polychaeta) fom Sagami Bay and

Tokyo Bay, Central Japan with a comparative table of species from

Japanese and adjacent waters. Zoological Science, 21,457-464.

Nishi E., Miura T. and Bhaud M. (1999) A new species of

Spiochaetopterus (Chaetopteridae: Polychaeta) from a cold-seep

site off Hatsushima in Sagami Bay, central Japan. Proceedings of

the Biological Society of Washington, 112(1), 210-215.

Nival P., Boucher J. and Bhaud M. (1992) III colloque du programme

national sur le determinisme du recrutement. Annales de VInstitut

Oceanographique de Paris, Nouvelle Serie, 68,7-13.

Nozais C., Duchene J.C. and Bhaud M. (1997) Control of position in

the water column by the larvae Poecilochaetus serpens,

(Polychaeta): the importance of mucus secretion. Journal of

Experimental Marine Biology and Ecology, 210, 91-106.

Pinedo S., Sarda R., Rey C. and Bhaud M. (2000) Effect of sediment

particle size on recruitment of Owenia fusiformis in the Bay of

Blanes (NW Mediterranean Sea): an experimental approach to

explain field distribution. Marine Ecology Progress Series, 203,

205-213.

Memoirs of Museum Victoria 71:361-366 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Professor R.B. (Bob) Clark (1923 -

2013) - polychaete biologist and

environmentalist: a pioneer in

comparative endocrinology of

reproduction, growth and regeneration.

Peter Olive 1 * and Patricia A. Hutchings 2

1 School of Marine Science and Technology, Newcastle University, UK

(Peter.01ive@newcastle.ac.uk)

Australian Museum, 6 College Street, Sydney NSW 2000, Australia

(Pat.Hutchings@austmus.gov.au)

* To whom correspondence should be addressed.

Email: peter.olive@ncl.ac.uk

Professor R.B. (Bob) Clark, an outstanding scholar and leading

polychaete biologist of his generation, died quietly at his home

on 28 th September 2013, shortly before his 90 th birthday. He

was born in London in November 1923, the son of Joseph L.

Clark and Dorothy (nee Halden). In his later career he was

widely acclaimed for his work in Marine Pollution, a field of

study that he did much to establish and one that has ever

increasing global significance f He was appointed a member

of the Royal Commission on Environmental Pollution 2 which,

together with his authorship of the various editions of his text

book on Marine Pollution (Clark, 1986-2001) and other major

publications (e.g. Clark, 1982) rightly establish his pre¬

eminence in this field. He was also invited to give evidence at

the Royal Commission Enquiry on oil drilling on the Great

Barrier Barrier Reef which was chaired by Prof J.E. Smith

FRS, then the Director of the Plymouth Marine Laboratory in

the early 1970s. This enquiry was instrumental in defining the

boundaries of the GBR Marine Park which was declared in

1975 and ensured that no oil drilling could occur within the

park. This Park was later declared a World Heritage Area.

Bob Clark took a first degree in physics and graduated

from Chelsea Polytechnic in 1944. After working for a while

in this role he entered Exeter University to read Zoology in

1947, graduating in 1950. His first appointment as a zoologist

was at the University of Glasgow and, while at the University

1 From mimeos to e-copy - a tribute to Professor RB (Bob) Clark,

founding editor of the Marine Pollution Bulletin. Marine

Pollution Bulletin 46(9): 1051-1054

2 8 th report of Royal Commission on Environmental Pollution : Oil

Pollution in the Sea 1981 HMSO, London

Bob Clark during a visit to China in the 1990s (photograph by Prof.

Wu Boa Ling).

of Glasgow, he was able to study in the USA at Universities of

Washington, Seattle and University of California (Berkeley)

where he was Assistant Professor during a Sabbatical awarded

to polychaete biologist Ralph Smith. He also worked

extensively at the Friday Harbor Marine Laboratory, teaching

there till 1978. He was appointed to the University of Bristol

as Lecturer in 1956, awarded a DSc by the University of

London in 1965 and appointed to the positions of Professor

and Head of the Department of Zoology and Director of the

Dove Marine Laboratory at Newcastle University, UK in 1965.

He was also honoured with election as a Fellow of the Royal

Society of Edinburgh in 1970. Bob married Mary Clark, a

USA citizen and they had a productive professional

collaboration for many years. After his move to Newcastle

upon Tyne, Mary returned to the USA to pursue an independent

academic career and they divorced. Bob remarried and is

survived by Sue, their two children, Juliet and Stephen and

grandson Gus.

362

P. Olive & PA. Hutchings

Bob did much to establish polychaetes as models in

experimental and evolutionary zoology and created vibrant,

polychaete research schools at Bristol and Newcastle

Universities, supervising and mentoring many of the next

generation of polychaete scientists. He was also the supervisor

in Bristol of Barrie Jamieson, who became a leader in the field

of oligochaete biology (see Brinkhurst and Jamieson 1971,

Jamieson 1971 supplementary bibliography). The relationship

between the polychaetes and oligochaetes (clitellate annelids)

was among the issues Bob addressed (Clark, 1969, 1978) that

is finally being clarified with the aid of molecular data. As a

supervisor, Bob generously encouraged his students to publish

independently and did not follow the modern tradition of

publishing jointly. His influence therefore extends well beyond

his own publications. Athough it is not appropriate here to cite

all the publications of his students, a supplementary

bibliography listing some of the work arising from studies

carried out under his supervision is included.

The polychaete studies begun at Glasgow University

resulted in the publication of one of the first keys to Polychaete

families in English (Clark, 1960a) and tellingly, a short paper

on pelagic swarming in Scalibregmatidae (Clark, 1954), a

topic which would re-emerge in various forms during much of

his research career. His ecological studies include a survey of

the distribution of Nephtys species in the British Isles (Clark,

Alder and McIntyre, 1962; Clark and Haderlie, 1960) and in

California (Clark and Haderlie, 1962) and the food of Nephtys

(Clark, 1962). The problem of niche partitioning and

geographical distribution of Nephtys species he addressed, has

been reprised by former students (Olive and Morgan, 1991,

supplementary bibliography) and remains a topic of importance

for the polychaete community.

Bob’s early training, and initial career in mathematics and

physical sciences, underpinned much of his work on

polychaetes, especially his investigations into biomechanics

and movement and his work in this field influenced many

others. He became an expert histologist and combined studies

of polychaete structure, often in collaboration with Mary

Clark, with experimental studies (Clark, 1956, 1958, 1962;

Clark and Clark, 1960a, b). He re-appraised the nature of

undulatory swimming in polychaetes, demonstrating that, in

species with prominent parapodia, the wave form propagates

from tail to head (direct locomotory wave) and the power

stroke of the parapodium, exerted at the crest of the wave,

produces the main propulsive force (Clark, 1964; Clark, 1976,

Clark and Tritton, 1970). He also investigated swimming in

smooth bodied species, such as Opheliidae, in which the

parapodia play no significant role in the generation of

locomotory forces and the locomotory wave is retrograde as in

other smooth bodied worms and fish (Clark and Hermans,

1976). Colin Hermans became a close friend of Bob’s and has

provided the authors with illuminating reminiscences of his

early scientific career and influence in the States. His

investigations into the role of the coelom and septa in the

shape changes, that enable annelids to work in their

environment, was fundamental to his thinking and his studies

extended to investigations of non-coelomate invertebrates

(Clark and Cowey, 1958). The combination of his histological

and experimental investigations, together with his rigorous

scholarship, enabled him to produce a definitive review of the

evolution of swimming forms among annelids in relation to

reproduction (the phenomenon of epitoky) (Clark, 1961) which

remains a classic and is an essential introduction to the subject.

As a student of biomechanics in annelids he became greatly

interested in the deeper evolutionary implications of the

relationship between form, function and phylogeny of

metazoans. His interests culminated in a major synthesis, the

book “The Dynamics of Metazoan Evolution” (Clark, 1964),

which remains a masterpiece of scholarship and is a testament

to the depth of his knowledge and thought.

‘The Dynamics’ subtitled “The origin of the coelom and

segments” addressed metazoan phylogeny, a topic which has

re-emerged in current biology in the wake of the genomic

revolution, and to which the polychaete community is continuing

to make important contributions. In it he, addressed theories

relating to metazoan relationships in the light of “the principles

of comparative morphology”, which he argued, “must be taken

into account when phylogenies are proposed, but which have

hitherto escaped serious discussion in this context”. In particular

he explained, “as a student of the annelids, he was exercised by

two outstanding problems: the nature and origin of the coelom

and of metameric segmentation”. He proceeded to a detailed

analysis of the relationship between structure and movement in

various grades of metazoan organisation, adopting what he

described as, “ ...a purely functional point of view”. He then

proceeded to a discussion of various theories relating to possible

phylogenies of Metazoa in the light of comparative morphology

and biomechanics. He recognised that “it is certain that many of

the derivations of major groups of organisms that are accepted

now will be re-examined, rejected and changed in the future.”

But, he cogently argued, “stem forms, from which several

modern phyla diverge, must be possible animals.. .they must be

conceived as living organisms, obeying the same principles that

we have discovered in existing animals, and any new

structures... must have conferred some selective advantage

upon them”. The argument that any putative ancestral, or

primitive organism, must have obeyed the same physical laws as

living organisms, is as valid now, in the ‘molecular age’, as it

was then. Bob continued to evaluate theories relating to the

relationships between worm like phyla (Clark, 1969,1978). This

was, of course, well before molecular and phylogenetic studies

of polychaetes which are now providing new insights into these

problems and which, a perhaps rather incredulous Bob,

discussed with Peter during their morning chats over a coffee

and a whisky in his later years.

To return to Bob’s development as a polychaete biologist,

during his early years at Glasgow, when he held a post as

Assistant Professor at the University of California (Berkeley),

and worked at the Universities of Washington and Seattle and

Friday Harbor Marine Laboratory he formed many deep

friendships and developed a deep interest in the emerging

fields of neurosecretion and comparative endocrinology of

invertebrates. He subsequently made a major impact on the

comparative endocrinology of growth, regeneration and

reproduction in polychaetes that indirectly led to subsequent

endeavous to breed worms commercially and to the

Professor R.B. Clark (1923 -2013): polychaete biologist and environmentalist

363

establishment of aquaculture businesses in Europe, China and

SE Asia (see Olive, 1999, supplementary bibliography).

Invertebrate comparative endocrinology, was at the time

dominated by studies of insects and Bob, together with

contemporaries, Hauenschild in Germany and Durchon in

France, stimulated an interest in the endocrinology of

polychaetes. His studies of the histology of the Nephtys brain

(Clark, 1955, 1958a,b,c), laid the foundations for experimental

studies of Nepthys endocrinology as subsequently pursued at

Newcastle University by Peter Olive and his students and, for

the masterful ultrastructural studies of his former student

D.W. Golding, which lead for instance to the discovery of

‘neurosecretory endfeet systems’ with ramifications for

neurosecretory studies throughout the metazoa.

While at the University of Bristol (UK) his research largely

focussed on growth, regeneration and the ‘once per lifetime’

switch to reproductive maturation, typically observed in

Nereididae but he also reviewed the subject in great depth

providing the key reviews for anyone seeking an entree into

the subject (see Clark, 1965; Clark and Olive, 1973). His

chosen model organism for his own studies was the estuarine

Nereis diversicolor (now Hediste diversicolor ), a species in

which epitoky has been suppressed, but in which sexual

maturation and the ability to regenerate lost caudal segments

are, nevertheless, negatively linked to the onset of sexual

maturation. This complemented the work of the Durchon

laboratory at Lille, France, on the epitokous species Perinereis,

and that of the Hauenschild laboratory in Germany, using

Platynereis dumerili as the experimental model. The nature of

the regulatory control by the supraoesophageal ganglion

proved difficult to establish (e.g Clark and Bonney, 1960,

Clark and Ruston, 1963) but Bob’s student at Bristol, D.W.

Golding, brilliantly established the permissive nature of this

control and demonstrated the existence of a caudal growth

field, such that the number of segments regenerated is a

function of the number lost and not, as previously thought,

determined by the level of hormonal output (Golding, 1967e-f,

supplementary bibliography). The proof that the ganglion has

a permissive role, essential for segment proliferation, but not

itself determining the rate nor the number of segments

regenerated, is crucial to our understanding of caudal

regeneration in nereidids and given the resurgence of interest

in segment formation in polychaetes (especially in nereidids)

following the discovery of pan-metazoan Hox-gene regulatory

system, this work remains highly relevant and will no doubt

lead to further investigations of the nature of the influence of

the so called juvenile brain hormonal function in nereidid

regeneration. His studies of Hediste diversicolor also included

aspects of behaviour and learning (Clark, 1960 b, c, d), and his

postgraduate student Stuart Evans also took this subject

forwards (Evans, 1969, supplementary bibliography).

Following his appointment at Newcastle University, Bob

re-established a polychaete based research school, both on the

University Campus and at the Dove Marine Laboratory. He

attracted a large number of visiting scientists from USA and

around the world to work at the Dove Marine Laboratory

including Marianne Pettibone, Ralph Smith, Larry Ogglesby,

Colin Hermans, Fu Chiang Chia, Arthur Fontaine, Bao Lin

Wu and Son Lin Zhang, making the Dove Marine Laboratory,

a dynamic research environment for a new generation of

polychaete students. These included the authors of this

appraisal (PJWO and PAH) but also John Daly, Peter Gibson,

Peter Garwood, Ivan Estcourt, Evelyn Jaros and others (see

selected publications of their student work in the supplementary

bibliography). Students at this time were encouraged to explore

the diversity of polychaete life histories, with a particular

focus on comparative aspects of reproduction and the timing

of reproduction. He encouraged an experimental approach and

tellingly distinguished clearly between the so called ‘ultimate’

and ‘proximate factors’ controlling the timing of reproductive

events (Clark, 1979). He gave his students a free head in the

choice of experimental material and this resulted in the study

of a remarkable array of polychaetes, drawn from several

different clades. The species studied at this time included:

Cirratulus cirratus (Cirratulidae, with Peter Olive),

Dodecaceria spp. (Cirratulidae, with Peter Gibson - see

Gibson and Clark, 1976), Melinna cristata (Ampharetidae,

now Melinna elisabethae, with Pat Hutchings), Harmothoe

imbricata (Polynoidae, with John Daly, Peter Garwood),

Fabricia sabella (Sabellidae, Fabriciinae with Dave Lewis,

Evelyn Jaros). This approach continued to be a feature of the

Newcastle polychaete school and over the next few years, the

array of species studied was expanded to include members of

the Nephtyidae, Phyllodocidae, Hesionidae, Spionidae,

Capitellidae and Arenicolidae, leading to an appreciation of

the diverse patterns of control of reproduction in polychaetes

commensurate with their long evolutionary history (Clark,

1979; Clark and Olive, 1973). As a supervisor Bob had a

‘hands off’ approach, so each student had to solve the problems

they encountered in their own way, sometimes made all the

more difficult by the choice of experimental material. He

insisted that his students followed the highest standards of

scholarship, making sure that all citations were based on a

detailed study of the original material, and he expected an

accurate, succinct style of writing like his own. Pat and Peter

both remember that this could be very challenging. We may

not have reached his high standards, but the trying did no

harm. The research output emanating from this school took

polychaete endocrinology and the study of reproduction into

new territory and clearly demonstrated that there is no such

thing as a ‘typical polychaete’. The outcome has had a profound

influence on the current agenda in polychaete science.

Away from the laboratory, Bob was always generous in his

hospitality - Professor D.I.D. Howie, on learning of the passing

of Bob Clark, recalled the excellent hospitality he enjoyed at

the home of Bob and Mary Clark during the first neurosecretion

conference held at Bristol University and commented on how

this experience stimulated his own interests in neurosecretion

and endocrinology of the lugworm Arenicola marina, which,

in this way, also entered into the canon of experimental

endocrinology of polychaetes. Bob’s hospitality was extended

not only to his peers, but also to his research students both at

Bristol and at Newcastle where, during ‘polychaete discussion

groups’ held at Bob’s house in the evenings, with a glass of

wine or beer to aid proceedings, his many research students

learned to engage in the cut and thrust of scientific debate, to

364

P. Olive & PA. Hutchings

state clearly, and defend their emerging ideas - a perfect

grounding for their later careers.

Bob Clark was a stimulating teacher, expecting students to

reach the cutting edge of science and to pursue their own ideas.

He held temporary posts at the University of California

(Berkeley) and was visiting lecturer at five Western Canadian

Universities (Sept. ‘78 - March ’79). Colin Hermans has told us

of how Bob’s period at Berkeley had a long lasting though

largely unseen influence. At Newcastle, as previously at Bristol,

he had a strong influence on degree programme development,

emphasising the role of University teaching not only in

imparting knowledge “but more importantly, to give students

the ability to think independently, to form judgements which

they can justify and support with tested evidence” (preface to

Clark, 1986). Peter and Pat were both student demonstrators to

his practical classes, supporting his course on comparative

morphology. The labs required a not insignificant understanding

of mathematics, and Pat remembers classes, in which nereidids

were encouraged to swim, and the students being asked to get a

handle on how the worms moved forward - although of course

if they try too hard they go backwards - a challenging practical

for students and demonstrators alike. Bob also promoted

teaching in other areas in which he had an active research

interest. He appointed former students S.M. Evans to teach

animal behaviour and D.W. Golding to teach endocrinology and

neurosecretion and each of them proceeded to create their own

research schools in these fields. He appointed Fu Chiang Chia to

teach developmental biology taught later by Peter Olive. These

appointments ensured that the curriculum for Zoologists and

Marine Biologists at Newcastle continued to reflect his influence.

He instigated honours student projects, requiring them to carry

out investigations of a real problem under the guidance of a

member of staff, and to write up their results in the form of a

research paper. Peter, who was at Newcastle University as an

undergraduate when Bob first burst onto the scene, remembers

having to carry out three projects, one comparing the muscular

and segmental anatomy of nereidids and glycerids in relation to

their mode of life and learning from him trichrome staining

techiniques for the histology required.

Bob entered enthusiastically into the scientific life of the

North East England. He was an active member of the Natural

History Society of Northumbria, taking great interest in the

Hancock Natural History Museum, (now Museum of the

North), he served for many years as a committee and council

member, advising, for instance, on the management of the

Fame Islands, as well as being a successful and influential

editor of the The Transactions of the Natural History Society

of Northumbria (1988-1997). He was honoured by election to

a Fellowship of the Royal Society of Edinburgh in 1970. His

lay interests in Newcastle included his active participation in

local education at all levels, he was a governor of Newcastle

Prep School, and a well remembered Church Warden at St

Georges Church, Jesmond. The vicar at the time, Canon

Michael Middleton, recalled at the service of remembrance

held at the Church, that Bob brought the same attributes -

foresight, clear decision making and a dry wit - to his work for

the Parish, just as in his professional life. Peter and Pat have

received many emails from friends and former colleagues who

recall with warmth his wit and humour as well as his foresight,

and excellence as a scientist, scholar and writer.

At Newcastle his interests expanded to include the

important field of Marine Pollution. There were at the time a

number of serious oil spillages affecting UK coastal waters

- most notably the Torrey Canyon in 1968. His response was

incisive and practical; he established with John Croxall, an

oiled sea bird research unit, to develop a methodology for

removing oil from affected sea birds (Clark, 1984; Clark and

Croxall, 1972) and, realising the need for a medium for rapid

communication of results, he began the series of, at first

mimeographed, newsletters, which eventually developed into

the leading journal in the field - Marine Pollution Bulletin

- that he edited for 25 years (see footnote a ). He was appointed

to the Royal Commission on Environmental Pollution,

working on the 8 th RCEP report Oil Pollution in the Sea, the

findings of which he published in a hugely influential paper

in Transactions of the Royal Society (Clark, 1982). He

travelled widely, investigating and advising on the effects of

oil spills around the world (Clark, 1985, 1987, 1991; Dicks et

al., 1982, Larmine et al., 1987, Mann and Clark, 1978; Wu

and Clark, 1983; Sell et al., 1995). His unrivalled knowledge

of marine pollution, clear objective analysis and his

characteristic direct writing is shown in the text book Marine

Pollution (Clark, 1986), which he saw through five editions

(the last in 2001). As a text book it is an exemplar of concise,

lucid writing which remains the ideal introduction to the

subject. Bob continued his work as a marine environment

consultant long into retirement. His development from

polychaete biologist to world expert in marine pollution, with

special expertise in relation to biological impacts of oil

spills, presaged by some 30 years, subsequent developments

at Newcastle University, where marine sciences,

oceanography and marine zoology together with marine

technology, naval architecture and offshore engineering now

form a unique School of Marine Sciences and Technology

(www.NewcastleMarine).

Bob Clark was one of the outstanding scientists of his

generation - a great scholar and writer, fondly remembered not

only for his scientific work, but for his dry wit, good humour

and friendship. In recent years Peter Olive was able to share

time with Bob, who would chat over a coffee and a glass of

wine or whisky about the old days. He retained a keen interest

in the work of his former students, even when increasing

infirmity limited his ability to get out and about. Pat remembers

being a surprise guest at his 75 th Birthday when she again

greatly enjoyed his hospitality. Bob’s role as a mentor and

supporter helped greatly in her move to the Australian

Museum, enabling her to take forward polychaete studies and

to become involved in the management of the environments

Bob had done much to protect. Peter was even able to update

Bob on the hosting of the 11 th International Polychaete

Conference in Sydney (2013). On behalf of the polychaete

community, we extend sympathy to the family and friends

who survive him, and we hope that our thoughts and

remembrance at least recall for others the significance of his

scientific life.

Professor R.B. Clark (1923 -2013): polychaete biologist and environmentalist

365

Publications of RB Clark (polychaete papers and selected

papers on marine pollution and oil spill remediation).

Clark, M.E., and Clark, R.B. 1962. Growth and regeneration in Nephtys.

Zoologische Jarhbuchte (Physiologie) 70: 24-90.

Clark, R.B. 1953. Pelagic swarming in Scalibregmidae (Polychaeta).

Annual Report of the Scottish Marine Biological Association,

(1952), 53: 20-22.

Clark, R.B. 1955. The posterior lobes of the brain of Nephtys and the

muscular glands of the prostomium. Quarterly Journal of

Microscopical Science 4: 545-565.

Clark, R.B. 1956. The blood vascular system of Nephtys (Annelida

Polychaeta). Quarterly Journal of Microscopy 97: 235-249.

Clark, R.B. 1958a. The gross morphology of the anterior nervous system

of Nephtys. Quarterly Journal of Microscopy 99: 205-220.

Clark, R.B. 1958b. The micromorphology of the supra-oesophageal

ganglion of Nephtys. Zoologische Jahbucher (Physiologie) 68:

261-296.

Clark, R.B. 1958c. The ‘posterior lobes’ of Nephtys : observations on

three New England species. Quarterly Journal of Microscopical

Science 99: 205-210.

Clark, R.B. 1960a. The fauna of the Clyde Sea area. Polychaeta Scottish

Marine Biological Association: Millport, 71pp.

Clark, R.B. 1960b. The learning abilities of nereid polychaetes and the

role of the supraoesophageal ganglion. Animal Behaviour

Supplement 1: 89-100.

Clark, R.B. 1960c. Habituation of the polychaete Nereis to sudden

stimuli. I. General properties of the habituation process. Animal

Behaviour 8: 83-91.

Clark, R.B. 1960d. Habituation of the polychaete Nereis to sudden

stimuli. II. Biological significance of habituation. Animal Behaviour

8: 92-103.

Clark, R.B. 1961. The origin and formation of the heteronereis. Biological

Reviews of the Cambridge Philosophical Society 36: 199-236.

Clark, R.B. 1962a. Observations on the food of Nephtys. Limnology and

Oceanography 7: 380-385.

Clark, R.B. 1962b. On the stmcture and functions of polychaete septa.

Proceedings of the Zoological Society, London 138: 543-578.

Clark, R.B. 1964. Dynamics in Metazoan Evolution, Oxford University

Press: Oxford, London, i-viii, 313pp.

Clark, R B. 1965. Endocrinology and Reproductive Biology of

Polychaetes. Oceanography and Marine Biology, Annual Review 3:

211-255.

Clark, R.B. 1969. ‘Systematics and phylogeny’: Annelida, Echiura,

Sipuncula In: eds M Florkin and BT Scheer, Chemical Zoology 4:

1-68. Academic Press: New York.

Clark R.B. 1976. Undulatory swimming in polychaetes In: Davies, P.S.

ed.. Perspectives in Experimental Biology 1. Zoology: 437-446

Pergamon Press: London.

Clark, R.B. 1978. Composition and Relationships. In: Mill, P.J., ed..

Physiology of Annelids Academic Press, London, 1-32.

Clark R.B. 1979. E nvironmental Determination of Reproduction in

Polychaetes. In Stancyck, S.E. ed.. Reproductive Ecology of Marine

Invertebrates , Belle W Baruch Institute for Marine Biology,

University of South Carolina Press: Columbia, South Carolina, pp.

107-122.

Clark, R.B. 1982. The long term effects of oil pollution on marine

populations 1982. Philosophical Transactions of the Royal Society,

London series B297: 183 -433.

Clark, R.B. 1984. Impact of oil pollution on Seabirds. Environmental

Pollution 33 A: 1-22.

Clark, R.B. 1985. Social aspects of waste disposal. In: The Role of

Oceans as a Waste Disposal Option. Springer: Netherlands pp.

691-699.

Clark, R.B. 1986-2001 Marine Pollution (fifth edition) 2001 Oxford

University Press, (first published 1986) pp. 237.

Clark, R.B. 1987. Summary and conclusions: environmental effects of

the North Sea oil and gas developments Philosophical

Transactions of the Royal Society, London 316B: 669-677.

Clark, R.B. 1991. Assessing marine pollution and its remedies. South

African Journal of Marine Sciences 10: 341-351.

Clark, R.B., Alder, J., and Mcyntyre, A.D. 1962. The distribution of

Nephtys on the Scottish coast. Journal of Animal Ecology 31:

359-372.

Clark, R.B., and Clark, M.E. 1960a. The fine structure and

histochemistry of the ligaments of Nephtys. Quarterly Journal of

Microscopical Science 101: 133-148.

Clark, R.B., and Clark, M.E. 1960b. The ligamentary structure and

segmental musculature of Nephtys. Quarterly Journal of

Microscopical Science 101: 149-176.

Clark, R.B., and Cowey, J.B. 1958. Factors controlling the change of

shape of certain nemertean and turbellarian worms. Journal of

Experimental Biology 35: 731-748.

Clark, R.B., and Haderlie, E.C. 1960. The distribution of Nephtys

cirrosa and N. hombergi on the south-western coasts of England

and Wales. Journal of Animal Ecology 29: 117-147.

Clark, R.B., and Haderlie, E.C. 1962. The distribution of Nephtys

californiensis and N. caecoides on the Californian coast. Journal

of Animal Ecology 31: 339-357.

Clark, R.B., and Hermans, C. 1976. Kinetics of swimming in some

smooth bodied polychaetes. Journal of Zoology, London 178: 147-

159.

Clark, R.B., and Olive, P.J.W. 1973. Recent advances in polychaete

endocrinology and reproductive biology. Oceanography and

Marine Biology, Annual Review 11: 176-223.

Clark, R.B., and Tritton, D.J. 1970. Swimming mechanisms in

nereidiform polychaetes. Journal of Zoology, London 161: 257-

251.

Dicks, B., Hartley, J. P., Straughan, D., & Clark, R. B. 1982. The

Effects of repeated small oil spillages and chronic discharges [and

discussion]. Philosophical Transactions of the Royal Society of

London. 297B: 285-307.

Larmine, F.G., Clark, R.B., Rudd, J.K. and Tasker, M.C. 1987. The

history and future of North Sea oil and gas: an environmental

perspective. Philosophical Transactions of the Royal Society,

London 316B: 487-493.

Sell, D., Conway, L., Clark, T., Picken, G. B., Baker, J. M., Dunnet, G.

M., ... & Clark, R. B. (1995, February). Scientific criteria to

optimize oil spill cleanup. In: International Oil Spill Conference

(Vol. 1995, No. 1, pp. 595-610). American Petroleum Institute.

Wu B. L. and Clark, R.B. 1983. Marine pollution research in China.

Marine Pollution Bulletin 14: 210-212.

Supplementary Bibliography

Brinkhurst, R.O., and Jamieson, B.J.M. 1971. Aquatic Oligochaeta of

the World. Oliver and Boyd, Edinburgh, 800 pp.

Daly, J.M. 1972. The maturation and breeding biology of Harmothoe

imbricata (Polychaeta: Polynoidae). Marine Biology 12: 53-66.

Daly, J.M. 1973. Some relationships between the process of pair

formation and gamete maturation in Harmothoe imbricata (L.)

(Annelida, Polychaeta). Marine Behaviour and Physiology 1: 277-

284.

Daly, J.M. 1974. Gametogenesis in Harmothoe imbricata (Polychaeta:

Polynoidae). Marine Biology 25: 35-40.

Estcourt, I.N. 1966. The life history and breeding biology of Nicon

aestuariensis Knox (Annelida, Polychaeta). Transactions of the

Royal Society of New Zealand, Zoology 7: 79-94.

366

P. Olive & PA. Hutchings

Evans, S.M. 1969. Habituation and the withdrawal response in nereid

polychaetes. 1. The habituation process in Nereis diversicolor.

Biological Bulletin of the Marine Biological Laboratory, Woods

Hole, Mass 137: 95-104.

Garwood, P.R. 1980. The role of temperature and daylength in the

control of the reproductive cycle in Harmothoe imbricata (L)

(Polychaeta: Polynoidae). Journal of Experimental Marine

Biology and Ecology 47: 35-53.

Garwood, P.R. 1981. Observations on the cytology of the developing

female germ cell in the polychaete Harmothoe imbricata (L).

International journal of Invertebrate Reproduction 3: 333-345.

Gibson, PH. 1978. Systematics of Dodecaceria (Annelida, Polychaeta)

in relation to the reproduction of its species. Zoological Journal of

the Linnaean Society 63: 275-287.

Gibson, P.H., and Clark, R.B. 1976. Reproduction of Dodecaceria

caulleryi (Polychaeta: Cirratulidae). Journal of the Marine

Biological Association of the UK 56: 649-674.

Golding, D.W. 1967a. Regeneration and growth control in Nereis I.

Growth and regeneration. Journal of Embryology and

Experimental Morphology 18: 67-77.

Golding, D.W. 1967b. Regeneration and growth control in Nereis II.

An axial gradient of growth potentiality. Journal of Embryology

and Experimental Morphology 18: 79-90.

Golding, D.W. 1967c. Neurosecretion and regeneration in Nereis. I.

Regeneration and the role of the supraoesophageal ganglion.

General and Comparative Endocrinology 8: 348-355.

Golding, D.W. 1967d. Neurosecretion and regeneration in Nereis. II.

The prolonged activity of the supraoesophageal ganglion. General

and Comparative Endocrinology 8: 356-367.

Golding, D.W. 1967e. Endocrinology, regeneration and maturation in

Nereis. Biological Bulletin of the Marine Biological Laboratory,

Woods Hole, Mass. 133: 567-577.

Hutchings, P.A. 1973a. Gametogenesis in a Northumberland population

of the polychaete Melina cristata. Marine Biology 18: 199-211.

Hutchings, P.A. 1973b. Age structure and spawning of a

Northumberland population of the polychaete Melina cristata.

Marine Biology 18: 218-227.

Jamieson, B.G.M. 1971. A review of the Megascolecoid earthworm

genera (Oligochaeta) of Australia. Part III. The subfamily

Megascolecinae. Memoirs Queensland Museum 16: 69-102.

Olive, P.J.W. 1970. Reproduction in a Northumberland population of

the polychaete Cirratulus cirratus. Marine Biology 5: 259-273.

Olive, P.J.W. 1971. Ovary structure and oogenesis in Cirratulus

cirratus (Polychaeta Cirratulidae). Marine Biology 8: 243-259.

Olive, P.J.W. 1973. The regulation of ovary function in Cirratulus

cirratus (Polychaeta). General and Comparative Endocrinology

20: 1-15.

Olive, P.J.W., and Morgan, P.J. 1991. The reproductive cycles of four

British intertidal Nephtys species in relation to their geographical

distribution (Polychaeta: Nephtyidae). Proceedings of the 2 nd

International Polychaete Conference, in: ME Petersen and JB

Kirkegaard (eds) Ophelia supplement 5: 351-361.

Memoirs of Museum Victoria 71:367-375 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Elis Wyn Knight-Jones:

pioneering marine biologist and

polychaete taxonomist (1916-2012)

Andrew S.Y. Mackie 1 *, Gaynor Oddy 2 ,

Philip Knight-Jones 3 , John S. Ryland 4 ,

Ernest Naylor 6 and Ioanna S.M. Psalti 6

1 Department of Natural Sciences, Amgueddfa Cymru - National

Museum Wales, Cathays Park, Cardiff CF10 3NP, Wales, U.K. (andrew.

mackie@museumwales.ac.uk)

2 Pulford Road, Sale, Cheshire M33 3LP, England, U.K.

3 Duke Street, Micheldever, Winchester, S021 3DF, England, U.K.

4 Swansea University, Singleton Park, Swansea, SA2 8PP, Wales, UK

5 School of Ocean Sciences, Bangor University, Menai Bridge, Anglesey

LL59 5AB, Wales, UK

6 Dime Limited, Oxford Road, Littlemore, Oxford OX4 4PE, England,

* To whom correspondence and reprint requests should be addressed.

Email: andrew.mackie@museumwales.ac.uk

Figure 1. Wyn Knight-Jones. A, photograph with his mother Maud.

On the reverse side, his father wrote “Taken circa May 1916 at

Hanford, Stoke on Trent & sent to me in France!”; B, in school

photograph, circa 1922; C, with Grandfather, circa 1929.

Wyn Knight-Jones was born in White House, Hanford,

Trentham Rural District (now a southern suburb of Stoke-on-

Trent) in Staffordshire on 7 March 1916. He was the first child

of Maud Knight (nee Cotterill) and William Ellis Jones;

younger brother Owen Arthur was born in 1923. His mother

was one of the first women to obtain a Bachelor of Arts degree

in Classics (First Class) and, as an external student, followed

this with a Master of Arts degree from the University of

London in 1907. His father attended University College of

North Wales (now Bangor University) and began a career in

banking as an accountant in the London City and Midland

Bank in Bala, 50 miles to the southeast.

However, at the time of Wyn’s birth he was serving as a

Lieutenant in the 14 th Battalion Royal Welch Fusiliers in the

snow-covered trenches of northern France. A few months later

he received his first photograph (“Taken around May”) of Wyn

and Maud at Hanford (fig. 1A). Unfortunately, he was wounded

in early June. William wrote a letter (postmarked June 9) to

his father Owen from No. 8 General Hospital, Rouen, telling

him that the operation to remove two pieces of shell from his

(lower back) wound had been successful. After making a good

recovery, he was promoted to Captain and returned to Britain

to train young troops, before returning to serve in the Army of

the Rhine after the Armistice of 11 November 1918. He was

demobbed after Easter 1919 and returned to Bala to forge a

successful career at the Midland Bank.

Wyn had no recollection of seeing his father in uniform.

One of his earliest memories, at the age of 3, was of his genial

paternal grandfather warming his posterior in front of the fire

at the Agent’s house Bryngwyn on the Peniarth Estate,

Llanegryn in Gwynedd. Owen Jones and the family lived

there from his appointment as Estate Agent in 1890 until his

death in 1922. Wyn recalled that his father’s brother, John

Owen Jones (1884-1972), “alternated between school teaching

(chemistry) and professional singing”; in newspaper clippings,

he was referred to as the “popular artiste” Owen Bryngwyn.

School (1922-1933)

Banking took Wyn’s father to the Head Office of the Midland

Bank in London. In 1922, Wyn was part of the Kindergarten at

Oakland House School, Blackheath in the southeast of the city,

but after the summer he was in the ‘Transition Division’ at

Clanricarde House School (fig. IB) in Sutton in the southwest.

His first report was good; “A very keen pupil. Shows decided

aptitude for Drawing and has done well in every way.”

In 1926, aged 10, he started boarding at Fonthill

Preparatory School, East Grinstead, Surrey. The school wrote

to his father in May re-assuring him that Wyn was “settling in

368

A.S.Y. Mackie, G. Oddy, P. Knight-Jones, J.S. Ryland, E. Naylor & I.S.M. Psalti

wonderfully well” and making friends. A letter from Wyn to

his mother was also positive, but he complained “we scarcely

ever go out” and mentioned thinking of murder regarding the

lady who came to wake him in the morning! By December,

Wyn had clearly settled in and was doing very well

academically, though the Headmaster (Rev. Walpole E. Sealy)

wrote that “Wyn’s love of jests — apparently mistimed? —

lost him his Class Prize this term.” The next report in April

1927 noted that Wyn seemed to have taken the previous

comments to heart, “sensible boy.” There were criticisms

again in the August report, but that December he won the

Class Prize. This up and down pattern was frequent throughout

Wyn’s remaining time at Fonthill, although in December 1928

the Headmaster grudgingly acknowledged that appendicitis

could have affected his work that term. Nevertheless, he

managed to pass the Common Entrance Examination for

Epsom College in the summer of 1929. The notification of this

in early July happily coincided with his father’s promotion to

General Manager’s Assistant at the Midland Bank. Wyn also

showed signs of ability in singing, handicrafts, cricket and

hockey during his time at Fonthill. In his last school report

(August 1929), Rev. Sealy noted that Wyn had come 4 th in the

class, “which was none too bad”. However, he followed this

with a warning: “He is of course more capable than he likes us

to imagine, and should do well in life: but he must not postpone

his efforts too long, or he will find himself a bearded old man

boring his grandchildren with the great things that he might

have done, if he had been more ambitious.”

Wyn started attending Epsom College following the

summer break (fig. 1C) and his reports soon followed their

usual pattern. They were at first poor, though his potential was

readily recognised. His marks in Latin were a good barometer

of his progress and response to criticism. In November 1929

he was 19 th in a class of 22, yet only a year later he was 3 rd

equal. The Housemaster wrote “I rejoice to hear of increased

effort at Latin and hope it will spread to other subjects.” By

March 1931 He was 1 st in Latin, but improvement was still

desired in other areas - and in later reports the need to make

more effort was frequently voiced. Wyn responded and his

reports from late 1931, and throughout 1932, were good.

Conversely, in December, his teacher’s comments regarding

Zoology were worrying: “Weak. I can hold out no hope for his

obtaining a scholarship unless he makes a stupendous effort

and vast progress.” Concern at his lack of academic application

continued in 1933. Nonetheless, Wyn continued to fulfil his

potential in other areas. He gained 1 st string athletic colours,

played in the 3 rd XV rugby team and obtained his Bronze

Medallion from the Royal Life Saving Society. In addition, in

November 1932, he received his Certificate A’ for the Infantry

syllabus in the Junior Division of the Officer Training Corps.

In his last Epsom report, in July (aged 17), his Housemaster

wrote “Has taken life too easily lately but has done some

useful work as a prefect.” The Headmaster was more

encouraging and wrote that he was a good and promising boy,

who should do well, and he wished Wyn well for the future.

University (1933-1939)

“If you’re keen on zoology, you’d better go to Bangor” was his

father’s advice (Knight-Jones, 1996). Wyn easily passed a

‘scholarship interview’ with Professor F.W. Rogers Brambell

FRS and became a student at the University College of North

Wales, regardless of there being no actual ‘scholarship’

available. Brambell had been a prime mover in establishing a

Marine Station at Menai Bridge (Psalti, 2001), and the two

quickly developed a lasting friendship. True to form, Wyn

admitted that it took him another 3 years “to become even

moderately studious.” Wyn enjoyed university life to the full

and took part in athletics, rugby, and rock-climbing. He was

awarded full colours for boxing, representing the University of

Wales at the Universities Athletic Union (UAU) finals of 1937.

In March 1935, he received his Certificate ‘B’ qualification in

the Artillery syllabus of the Officers Training Corps (Senior

Division). Wyn also joined a number of university clubs and

societies. He was Secretary of the Chess Club, Student President

of the Biological Society, and took part in several productions of

the English Dramatic Society. Wyn met fellow student Mary

(Luned Mary) Morgan-Jones and they began dating (fig. 2A, B).

The mischievous side of his personality was well expressed

and some of his exploits gained him a notoriety that was long

remembered in the university. One such anecdote implicated

Wyn in the release of Cabbage White butterflies (obtained

from the Zoology Department) into the projector beam at a

local cinema. Two other tales were recounted in the book

published to celebrate 50 years of Marine Science Laboratories

at Bangor University (Psalti, 2001: 24): “Knight-Jones broke

into Powys Hall just before the exams and replaced the blotting

paper with toilet tissue. On another occasion he disturbed a

ladies’ garden party by staging a fight with a friend on the roof

overlooking the College garden, then proceeding to throw him

down from a considerable height. Only later was it revealed

that this was a borrowed tailor’s dummy.”

Despite these escapades (and others), Wyn did start to take

his studies more seriously. He was enthralled by things that

interested him and by the knowledgeable scientists that he met

through Brambell, or through invited lectures to the Biological

Society. For the latter, he remembered being particularly

impressed by Walter Garstang, first director of the Lowestoft

Marine Laboratory and father-in-law of Alister Hardy (Knight-

Jones, 1996). Wyn further developed his interest in marine

biology by volunteering to assist H.A. Cole at the Fisheries

Experiment Station in Conwy during the 1937 and 1938

summer vacations. He also participated in a Marine Vacation

Course at the Marine Biological Association’s laboratory in

Plymouth around Easter-time 1938. Wyn obtained a First Class

Honours BSc in Zoology that very same year.

In 1938-39, Wyn had carried out some research into the

nervous system of Saccoglossus (Enteropneusta) under the

direction of Professor Brambell. Following on from this, and

on Brambell’s advice, he made contact with Professor J.Z.

Young FRS at Oxford with a view to developing this work for

a DPhil. His preferred location appeared to have been

Magdalen College, however, Young advised that obtaining a

scholarship to Jesus College was a better option at that stage.

Elis Wyn Knight-Jones: pioneering marine biologist and polychaete taxonomist (1916-2012)

369

Figure 2. Wyn Knight-Jones. A, with Mary Morgan-Jones at University College of North Wales, Bangor, circa 1939; B, with Mary, digging at

Abersoch, northwest Wales in 1940; C, on leave in Brussels, March 1945; D, in dry suit, with daughter Carolyn, circa 1958.

Wyn then applied for (June) and successfully obtained (July) a

Meyricke scholarship of up to £100 p.a. to Jesus College,

Oxford, supported by positive testimonials from Brambell,

R.W. Dodgson OBE (Ministry of Agriculture & Fisheries,

Conwy; and close relative of ‘Lewis Carroll’) and University

College Principal, D. Emrys Evans. The ‘Scheme of Research’,

appended to his letter of application, began “To complete my

studies of the histology of the nervous system of Hemichordata

and Urochordata, and if possible to extend them to Polyzoa,

Phoronidea, and Brachiopoda, in the hope that such work

might throw further light on the phylogenetic relations of these

groups to one another and to the Chordates and Echinoderms.”

He ended with “I plan to spend two years at Oxford, and to

enter for the degree of DPhil.” He was accepted at Jesus

College in October. His first two papers were published on the

settling behaviour of oyster larvae (with H.A. Cole) and on a

new record of Phoronis. With the outbreak of war, he scarcely

completed the Michaelmas term. Wyn and Mary married on

December 9, and he was commissioned in the Royal Artillery,

joining the Officers Training Corps at Colwyn Bay.

War Service (1940-1946)

Relatively little is known of Wyn’s war years. He rarely talked

of them, as was common for many of those involved. He

served much of the war based in the United Kingdom. He was

successively Gun Position Officer, Command Post Officer and

Regimental Survey Officer in regiments of the 3rd Division

and 15 th (Scottish) Division. He attended courses in Physical

Training and Artillery Survey, and competed in Divisional

boxing and cross-country running. In addition, he was

secretary to several Officers’ Messes and President of a

Regimental Institute. In 1944, he was in service in Western

Europe, landing around D-Day+10 (i.e., ca. June 16). He was

promoted to Captain and Troop Commander that October (fig.

2C). Wyn and Mary’s first son, Peter, was born in November.

Wyn was wounded at the Rhine crossing near Wesel on 26

March 1945. He was in the front of an armoured vehicle when

an armour-piercing shell struck. By strange coincidence,

reminiscent of his father’s wounding in 1916, he was hit by two

shell fragments. In Wyn’s case the wounds were to the chest,

370

A.S.Y. Mackie, G. Oddy, P. Knight-Jones, J.S. Ryland, E. Naylor & I.S.M. Psalti

and he soon found it difficult to breathe and impossible to

walk or exert himself. He was invalided home; firstly to

Botleys Park Hospital, Chertsey, in Surrey, then to

Caernarfonshire & Anglesey Hospital in Bangor. While

recuperating, he corresponded with several fellow officers,

who affectionately addressed him by the nickname ‘Jonah’.

The war in Europe was ending and they were pre-occupied

with logistical and administrative matters. Once censorship

was lifted, they revealed they were in a small village 20 miles

NE of Hamburg. Following his recovery (but with shell

fragments still in situ), Wyn was Troop Commander in a

Training Regiment until he was demobbed (18 April 1946). He

was mentioned in Dispatches (for distinguished service) and

this was published in the London Gazette on the 4 th April.

DPhil (1946-1950)

Wyn wished to complete his DPhil at Oxford. His application

for a ‘Further Education and Training Scheme’ grant from the

Ministry of Agriculture and Fisheries (MAF) was successful

and, on 27 th June 1946, he was awarded £320 p.a. plus tuition

fees to complete his DPhil at Oxford. The following month he

was appointed Senior Scientific Officer at MAF, but granted

leave for his studies. In 1946, he attended the Trinity and

Michaelmas Terms at Oxford, conducting his research under

Dr William Holmes, before returning to fisheries research for

the Ministry. From June 1947 to February 1950 he was

engaged (with R.E. Savage and H.A. Cole) in establishing a

laboratory at Burnham-on-Crouch, Essex. The main aim of

the new laboratory was to elucidate the conditions necessary

for the revival of the Essex oyster industry. Indeed, his renewed

research on oysters with Cole produced the landmark paper in

which the phenomenon of gregarious settlement was first

described (Cole and Knight-Jones, 1949).

In March 1948, he received permission from Oxford to

change the title of his thesis from ‘A Study of the Nervous

Systems of Hemichordata and Urochordata’ to ‘On the

Nervous System, Behaviour and Development of Saccoglossus.’

A year later he tentatively enquired about his status and of

submitting his thesis. The Steward at Jesus College informed

him that his name had been kept on the books and that “By

virtue of the fact that we have to claim dues and fees from the

Ministry each term, you are not such an obscure member as

you may think, except for one short period when we really did

lose sight of you.” Wyn completed his thesis and obtained his

DPhil in 1950.

Bangor (1950-1956)

Wyn had an interview for the post of Director at the forthcoming

Marine Station at University College of North Wales in May

1949. He was one of five shortlisted candidates, but was

unsuccessful. Fabius Gross, the Austrian scientist famed for his

experiments on the effects of chemical fertilisers on the growth

of phytoplankton and fish, got the job (Psalti, 2001). However, in

December, Wyn was successfully appointed Lecturer in Marine

Zoology (at a salary of £900 p.a.) under Gross. He started work

on 1 February 1950. Unfortunately, Gross soon became ill with

leukaemia and he died in June 1950, aged 44. Wyn became

Acting Director, but was again unsuccessful in becoming

Director in 1951; Dennis Crisp was appointed. Many believed

his earlier undergraduate exploits at the University had acted

against Wyn and that his subsequent designation as Deputy

Director was very much a consolation prize. However, the

University had to also avoid the nepotism trap as Wyn's father

was then Treasurer of the University College.

He contributed much to the early success of the new marine

station that was established at Westbury Mount at Menai Bridge

in 1952. The original Westbury Mount House was demolished in

2012 to be redeveloped as a new Innovation Centre (SEACAMS),

bringing researchers and businesses together. Wyn got on well

with the new Director and, in fact, they lived in adjacent houses

in Bangor and Wyn’s younger son Philip (born August 1948)

remembers playing with Crisp’s son Graham. Wyn and Mary’s

daughter Carolyn was born in June 1954.

He was one of a select and hardy band of pioneering divers

who began using SCUBA to further their scientific research in

the late 1940s and 1950s. This increased access to, and use of,

SCUBA ultimately led to the founding of the British Sub-Aqua

Club in 1953 (Rogerson, 2013). Wyn recalled his own experiences

at this time (Knight-Jones, 1998), “We acquired dive masks and

snorkels in 1953 and an aqualung in 1954.” Syed Zahoorul

Qasim was Wyn’s first research student, arriving in October

1954. They collaborated, as a sideline to Qasim’s PhD work on

primary production, on studying the responses of various

animals to pressure. One in situ experiment in 1955 saw Wyn

observing Eurydice on the seabed of Menai Straits, while Qasim

above kept the dinghy on station. Wyn had just finished when he

noticed the seabed “rushing by at astonishing speed”. He

surfaced and, seeing the concerned look on Qasim’s face, hauled

himself aboard without delay. They had travelled a considerable

distance south, but managed to row north against the current and

found “a kindly eddy“ that helped them home. Qasim was the

first student from Menai Bridge to obtain a PhD in Marine

Biology (1956). He was later (1967) awarded a DSc and played a

significant part in founding the National Institute of

Oceanography in Goa. In the 1980s he became Secretary to the

Indian Government in the Department of Ocean Development,

and initiated India’s explorations in Antarctica. Wyn’s diving

exploits became renowned and his leaking dry suit, evidently ill

fitting his slender frame (fig. 2D), more often than not resulted in

him getting wet and numbingly cold.

Wyn published 17 papers on a range of subjects between

1951 and 1955. These included ciliary beating in Metazoa,

invertebrate larvae at Naples, animal distributions in the rocky

intertidal and sublittoral, responses of plankton to changes in

hydrostatic pressure, and two from his own DPhil studies. His

laboratory experiments on gregariousness during the settlement

of barnacles (Knight-Jones, 1953) became a classic work in

experimental biology (Toonen, 2005), and his insights into

metachronism and ciliary beat (Knight-Jones, 1954) was clearly

the product of a very original mind. He built a mechanical model

from Meccano® to demonstrate ciliary movement to students.

Unfortunately, this was no longer working when he showed it to

the senior author in the 1990s.

Throughout this period, Wyn remained ambitious for career

progression and, in 1954, he applied for the Chair of Zoology at

Elis Wyn Knight-Jones: pioneering marine biologist and polychaete taxonomist (1916-2012)

371

Figure 3. Wyn Knight-Jones. A, examining seaweed for polychaetes with Phyllis in Russia, September 1996; B, with Phyllis, 2005.

Bedford College, University of London. While this was

unsuccessful, he had more luck when interviewed by Council

members at the University College of Swansea in 1956.

Swansea (1956-1981)

As the first Professor of Zoology at Swansea, Wyn was

immediately tasked with organising the new Department. He

delivered his inaugural lecture ‘Marine Biology in Wales’ on

the 4 December 1956 (Knight-Jones, 1957), primarily describing

his work, and that of his former colleagues and student Dr

Qasim, to date. He finished by mentioning his current staff - Dr

Ernest Naylor, recently joined marine ecologist and isopod

expert, and Mr Macfadyen “of terrestrial habits” - and outlining

the great opportunities he saw for Marine Biology at Swansea.

These ranged from fouling organisms in Swansea docks, shore

ecology and local fisheries to making use of the Dale Fort Field

Centre and diving the clear waters around Skokholm Island in

southwest Wales.

Wyn was soon busy and, continuing his work at Menai

Bridge on pressure responses, similarly installed tall glass tubes

in the stairwell of the Natural Science Building. In addition, he

carried out research on the settlement of Spirorbinae, underwater

surveys, intraspecific competition, and the biology of cirripede

larvae. Marine biology was becoming a major subject matter in

the University and a paper with his first research student at

Swansea (Phillipu Hewa Don Hemasiri De Silva) marked the

start of his career as a polychaete taxonomist (De Silva and

Knight-Jones, 1962). Spirorbins were to be a profitable research

field both for Wyn and many subsequent students.

Diving was an important activity and the clear waters of

southwest Wales were readily accessible for fieldwork. Both his

sons and colleagues have similar memories of some of his

exploits. Typically, they recall being left alone in the small boat

while Wyn disappeared below with the instruction “Just follow

the bubbles, old boy.” This was rather worrying and no easy task,

for he hardly seemed to breathe! Even more colourful escapades

ensued. In 1965, the family toured France and Spain on holiday.

However, as usual, Wyn was actively collecting at every

opportunity. In Spain, he attracted the attention of the Spanish

naval police when he inadvertently dived near Franco’s yacht. A

couple of years later, returning from a successful diving

expedition he led to Chios in the Aegean, Wyn had to convince

Greek Customs officials that that he was not removing marine

antiquities from the country; he was taking only the insignificant

little tube worms that were attached to fragments of amphorae!

Julie Bailey-Brock later published an account of the Chios

spirorbins (Bailey, 1969).

Wyn was generous in providing help, advice and ideas to

colleagues and students, and would unselfishly edit and

enhance their manuscripts and other writings. He would

regularly collect material for his undergraduate practical

classes and postgraduate students, and always led by example.

Wyn held his student audience’s attention through his quiet

charm, humour, and droll sometimes risque delivery. As a

professor he was never a ‘committee man’ and often had to be

reminded that he should have been in a particular meeting ten

minutes ago! He published regularly and produced 24 papers

between 1956 and 1968, including important contributions to

the study of intraspecific competition between sedentary

marine animals (Knight-Jones and Moyse, 1961), and to the

systematics of marine leeches (Knight-Jones, 1962).

However, family life changed in October 1968 when he

and Mary divorced. A relationship subsequently developed

with Phyllis Fisher, a keen SCUBA diver he had met at a field

outing at Dale Fort (Mackie et al., 2011) and, after a whirlwind

romance, they married in July 1969. Phyllis quickly took an

interest in his work. She was made a Research Associate at the

University in 1970, and the following year accompanied Wyn

on a two-month research and teaching visit to South Africa.

Wyn was interviewed by the Cape Times and, talking about

their work on spirorbins, said “It’s ridiculous that these

creatures should be our bread and butter, but we are quite

hooked on them now.” This visit was followed in later years by

collecting trips to many countries and together they became

the foremost taxonomic experts on this group of polychaetes.

The birth of their daughter Gaynor in July 1972 did little to

slow them down. They took a cruise from Lisbon to Funchal,

372

A.S.Y. Mackie, G. Oddy, P. Knight-Jones, J.S. Ryland, E. Naylor & I.S.M. Psalti

Las Palmas, Tenerife and Lanzarote in 1974, and another from

Casablanca to Gibraltar in 1976, gaining access to collecting

opportunities at ports in the Canary Islands, Senegal, Sierra

Leone, Cape Verde Islands, Madeira and Spain. In the following

years, fieldwork was generally more modest, with Phyllis

obtaining her MSc in 1977 and her PhD in 1980 from Swansea,

and Wyn being awarded a DSc from Oxford in 1977. Then,

they finally realised their long-planned South American trip,

collecting in Brazil, Argentina, Patagonia and Peru from

February to April 1981 (Knight-Jones and Knight-Jones, 1991).

In May 1980, Wyn had written to the University College

Principal asking to retire in 1981, when he would be 65. The

reply noted that the normal retirement age was, “as you know,

67” and his request to retire early would have to be approved

by College Council. This was granted and Wyn officially

retired in October 1981. A meeting was held in his honour at

the Linnean Society in London on 16 December 1982. The

Proceedings, titled ‘Biology of Marine Invertebrates’, were

published in the Zoological Journal of the Linnean Society in

1984, and included 17 papers and an introduction by the editor

(Ryland, 1984). The Department of Zoology in Swansea

presented Wyn with a bound volume.

Retirement (1981-2002)

On retirement, Wyn showed little sign of taking it easy. He and

Phyllis always welcomed fellow scientists and friends to their

house Bryngwyn on Gower, South Wales. Together, they

continued to work and publish on polychaetes, collecting at

locations in Britain and abroad (Mackie et al., 2011). They

successfully applied for an Anglo-Australian fellowship from

the Royal Society and, in 1983, embarked on a three-month

collecting tour of Australia, taking in the First International

Polychaete Conference (IPC) at the Australian Museum,

Sydney. Phyllis attended the first five Polychaete conferences

(1983-1995), but Wyn did not always accompany her - saying

someone “had to stay and look after the cat.” However,

wherever possible, they would go together. Travels abroad

included Turkey (1987), Faroe Islands (BIOFAR Symposium),

Sweden and Norway (1991), France, plus Fourth IPC (1992),

New Zealand and Hawaii (1993), Iceland (BIOICE project,

1994), and Russia (fig. 3A), also attending the 31 st European

Marine Biological Symposium in St Petersburg (1996). Wyn

was still certified as fit to dive aged 77, but was restricted to

sheltered conditions and a maximum depth of 20 m.

Wyn supported Phyllis (fig. 3B) throughout her art project

on the Welsh Slate industry and during her illness at the turn

of the century (Mackie et al., 2011). At the same time he

himself was finding it harder to concentrate, but he persevered

and completed his last scientific paper (Knight-Jones and

Knight-Jones, 2002).

Health (2002-2012)

Wyn remained in good health throughout the 1990s. Photographs

of him at home and on fieldwork show him as active as ever. One

photograph from 1997 shows him sitting on the ridge of the roof

at Bryngwyn, busy repairing the chimney! His last known fieldtrip

was to Salcombe and Looe, southwest England in October 2003,

only a few weeks after a hip replacement operation. In May 2004,

he was elected a Fellow Honoris causa of The Linnean Society of

London. His last driving licence was issued in December 2003,

however, there were increasing signs of ill health and in 2005 he

had his first visit to a memory consultant. As his health

deteriorated over the following years, he was nursed at home by

Phyllis. Plans were made for them to join their daughter Gaynor

and family at Sale, near Manchester. Unfortunately, Phyllis’

health was failing also and she passed away in January 2009.

Wyn, suffering from Alzheimer’s Disease, moved to Sale and

was lovingly cared for until his death from pneumonia on the 9th

February 2012, a month short of his 96 th birthday.

Reminiscences

Many letters and e-mails were received following Wyn’s death.

These cannot all be included here; however, those that are

provide an insight into the respect and affection he received from

all who came in contact with him.

His influence on his former students was everlasting. Pete

Vine wrote “He was a really important figure in my life and I

shall never forget the encouragement he gave me.” Julie Brock

recalled learning “to dive in Abereiddy quarry, collecting slate

with spirorbids on them. At times it was very cold and Prof

would sit in the boat after a dive, drink his bottle of cold water

and munch on an apple. He will always be a very gracious and

patient advisor.”

Those who visited him at Bryngwyn had similar thoughts.

Nechama Ben-Eliahu: “Years ago I visited with them both in

Swansea, and it was an important and memorable visit for me.”

Tara Macdonald: “He certainly left an inspiring legacy - and I

won’t forget his excitement about his work, even well after

retirement. He was a kind man, and I appreciated that as a young

scientist.” Chris Mettam wrote that Wyn had a “long and creative

life that anyone could be proud of. It was an honour as well as a

delight to know him.”

Wyn in the field was equally memorable. Mike Kendall:

“The abiding memory I have of him comes from the late 70’s

when he and a field team, all dressed in wet-suits, called into the

Robin Hood’s Bay lab for coffee totally unannounced. His

arrival totally panicked Jack Lewis who wasn’t used to that sort

of thing, but amused the rest of us.” Greg Rouse: “I’ll always

remember the time I met him and Phyllis at Heron Island. I was

new to polychaetes but they were kind to me. Wyn impressed me

immensely in that he carried their SCUBA tanks out the reef

crest, more than 500 m! He was in his mid-60s at the time.”

Helmut Zibrowius remarked on Wyn’s energy: “I met them last

in the Faroes (BIOFAR Symposium) in 1992. Wyn then was still

agile in the tidal zone between boulders looking for spirorbids.

They were a kind help when young I touched to spirobids (now I

am retired, too).” Victor Gallardo recalled Wyn and Phyllis

visiting Chile in 1981 and remembered Wyn’s humorous

comment on “the stately attitude of a humble street dog.”

Wyn’s qualities were recognized widely. Brian Morton wrote

“Very sad. Another one of the ‘Greats’ gone. But he had a long,

productive, active and eminent life.” Pat Hutchings and Steve

Hawkins were of a similar mind, “He was a scholar and a gent.”

Elis Wyn Knight-Jones: pioneering marine biologist and polychaete taxonomist (1916-2012)

373

Publications (by year)

Cole, H.A., and Knight-Jones, E.W. 1939. Some observations and

experiments in the setting behaviour of larvae Ostrea edulis.

Journal du Conseil International pour I’Exploration de la Mer

14(1): 86-105.

Knight-Jones, E.W. 1939. A new record of Phoronis hippocrepia

Wright. Nature 144(3654): 836.

Knight-Jones, E.W. 1940. The occurrence of a marine leech, Abranchus

blennii n. sp., resembling A. sexoculatus (Malm), in North Wales.

Journal of the Marine Biological Association of the United

Kingdom 24: 533-541.

Knight-Jones, E.W. 1948. Elminius modesta: another imported pest of

east coast oyster beds. Nature 161(4084): 201-202.

Cole, H.A., and Knight-Jones, E.W. 1949. The setting behaviour of

larvae of the European flat oyster, Ostrea edulis L., and its influence

on methods of cultivation and spat collection. Fishery Investigations,

London, Series 2 17(3): 1-39.

Cole, H.A., and Knight-Jones, E.W. 1949. Quantitative estimation of

marine nannoplankton. Nature 164(4173): 694-696.

Knight-Jones, E.W. 1949. Bilateral asymmetry shown by the metachronal

waves in protochordate gill slits [correction]. Nature 163(4136):

220 .

Knight-Jones, E.W., and Millar, R.H. 1949. Bilateral asymmetry shown

by the metachronal waves in protochordate gill slits. Nature

163(4134): 137-138.

Knight-Jones, E.W., and Waugh, G.D. 1949. On the larval development

of Elminius modestus Darwin. Journal of the Marine Biological

Association of the United Kingdom 28(2): 413-428.

Knight-Jones, E.W. 1950. Excursion to Black Rocks, Anglesey.

Proceedings of the Llandudno, Colwyn Bay and District Field

Club 23: 23-24.

Knight-Jones, E.W., and Stevenson, J.R 1950. Gregariousness during

settlement in the barnacle Elminius modestus Darwin. Journal of

the Marine Biological Association of the United Kingdom 29(2):

281-297.

Knight-Jones, E.W. 1951. Aspects of the settling behaviour of larvae of

Ostrea edulis on Essex oyster beds. Rapports et Proces-Verbaux des

Reun ions du Conseil Permanen t International pour VExploration de

la Mer 128 (Contributions to Special Scientific Meeting, Edinburgh,

October 1949, Part 2: Shellfish Investigations): 30-34.

Knight-Jones, E.W. 1951. Gregariousness and some other aspects of the

settling behaviour of Spirorbis. Journal of the Marine Biological

Association of the United Kingdom 30(2): 201-222.

Knight-Jones, E.W. 1951. Preliminary studies of nanoplankton and

ultraplankton systematics and abundance by a quantitative culture

method. Journal du Conseil International pour L’Exploration de

La Mer 17(2): 139-155.

Knight-Jones, E.W., and Walne, PR. 1951. Chromulina pusilla Butcher,

a dominant member of the ultraplankton. Nature 167(4246): 445-

446.

Knight-Jones, E.W. 1952. On the nervous system of Saccoglossus

cambrensis (Enteropneusta). Philosophical Transactions of the

Royal Society of London B 236(634): 315-354, pis 32-35.

Knight-Jones, E.W. 1952. Reproduction of oysters in the Rivers Crouch

and Roach, Essex, during 1947, 1948 and 1949. Fishery

Investigations, London, Series 2 18(2): 1 —48.

Crisp, D.J., and Knight-Jones, E.W. 1953. The mechanism of aggregation

in barnacle populations: a note on a recent contribution by Dr H

Bames. Journal of Animal Ecology 22(2): 360-362.

Knight-Jones, E.W. 1953. Some further observations on gregariousness

in marine larvae. British Journal of Animal Behaviour 1: 81-82.

Knight-Jones, E.W. 1953. Laboratory experiments on gregariousness

during setting in Balanus balanoides and other barnacles. Journal of

Experimental Biology 30(4): 584-598, pi. 16.

Knight-Jones, E.W. 1953. Decreased discrimination during setting

after prolonged planktonic life in larvae of Spirorbis borealis

(Serpulidae). Journal of the Marine Biological Association of the

United Kingdom 32(2): 337-345.

Knight-Jones, E.W. 1953. Feeding in Saccoglossus (Enteropneusta).

Proceedings of the Zoological Society of London 123(3): 637-654.

Knight-Jones, E.W., and Crisp, D.J. 1953. Gregariousness in barnacles

in relation to the fouling of ships and to anti-fouling research.

Nature 171(4364): 1109-1110.

Knight-Jones, E.W. 1954. Relations between metachronism and the

direction of ciliary beat in Metazoa. Quarterly Journal of

Microscopical Science 95(4): 503-521.

Knight-Jones, E.W. 1954. Notes on invertebrate larvae observed at

Naples during May and June. Pubblicazioni della Stazione

Zoologica di Napoli 25(1): 135-144.

Crisp, D.J., and Knight-Jones, E.W. 1955. Discontinuities in the

distribution of shore animals in North Wales. Report of Bardsey

Bird and Field Observatory 2: 29-34.

Knight-Jones, E.W. 1955. The gregarious setting reaction of barnacles

as a measure of systematic affinity. Nature 175(4449): 266.

Knight-Jones, E.W., and Qasim, S.Z. 1955. Responses of some marine

plankton animals to changes in hydrostatic pressure. Nature

175(4465): 941-942.

Knight-Jones, E.W., and Jones, W.C. 1956. The fauna of rocks at

various depths off Bardsey. I. Sponges, coelenterates and

bryozoans. Report of Bardsey Bird and Field Observatory 3:

23-30.

Gross, J., and Knight-Jones, E.W. 1957. The settlement of Spirorbis

borealis on algae. Report of the Challenger Society 3(9): 18.

Knight-Jones, E.W. 1957. Marine Biology in Wales. Inaugural lecture

of the Professor of Zoology delivered at the College on December

4, 1956. University College of Swansea: 26 pp.

Knight-Jones, E.W., Jones, W.C., and Lucas, D. 1957. A survey of a

submarine rocky channel. Report of the Challenger Society

3(9): 20.

Qasim, S.Z., and Knight-Jones, E.W. 1957. Further investigations on

the pressure reponses of marine animals. Report of the Challenger

Society 3(9): 21.

Knight-Jones, E.W., and De Silva, P.H.D.H. 1959. The setting

behaviour and ecology of Spirorbinae (Serpulidae). Proceedings of

the XVth International Congress of Zoology: 241-242.

Knight-Jones, E.W., and Macfadyen, A. 1959. The metachronism of

limb and body movements in annelids and arthropods. Proceedings

of the XVth International Congress of Zoology: 969-971.

Knight-Jones, E.W., and Qasim, S.Z. 1959. Effects of pressure pulses

on the behaviour of some plankton animals. Proceedings of the

46th Session of the Indian Science Congress Association Part III

Abstracts: 376

Knight-Jones, E.W., and Moyse, J. 1961. Intraspecific competition in

sedentary animals. Pp. 72-95 in: Milthorpe, F. L. (ed). Mechanisms

in Biological Competition. Symposia of the Society for

Experimental Biology, Cambridge No. 15.

de Silva, P.H.D.H., and Knight-Jones, E.W. 1962. Spirorbis corallinae n.

sp. and some other Spirorbinae (Serpulidae) common on British

shores. Journal of the Marine Biological Association of the United

Kingdom 42:601-608.

Gee, J.M., and Knight-Jones, E.W. 1962. The morphology and larval

behaviour of anew species of Spirorbis (Serpulidae). Journal of the

Marine Biological Association of the United Kingdom 42(3): 641-

654.

Knight-Jones, E.W. 1962. Appendix B. The systematics of marine

leeches. Pp. 169-196 in: Mann, K.H. (ed). Leeches (Hirudinea).

Their structure, physiology, ecology and embryology. Pergamon

Press: Oxford.

374

A.S.Y. Mackie, G. Oddy, P. Knight-Jones, J.S. Ryland, E. Naylor & I.S.M. Psalti

Qasim, S.Z., Rice, A.L., and Knight-Jones, E.W. 1963. Sensitivity to

pressure changes in teleosts lacking swimbladders. Journal of the

Marine Biological Association of India 5(2): 289-293.

Harris, T., and Knight-Jones, E.W. 1964. Spirorbis infundibulum sp. nov.

(Polychaeta: Serpulidae) from Tenarea shelves on the Costa Brava.

Annals and Magazine of Natural History, Series 137: 347-351.

Knight-Jones, E.W., and Llewellyn, L.C. 1964. British marine leeches.

Report of the Challenger Society 3(16): 25.

Knight-Jones, E.W., and Morgan, E. 1964. Adaptive aspects of

barosensititity. Report of the Challenger Society 3(16): 29.

Knight-Jones, E.W., and Thorpe, D.H. 1964. Orientation of locomotion

in echinoderms. Report of the Challenger Society 3(16): 27.

Morgan, E., Nelson-Smith, A., and Knight-Jones, E.W. 1964.

Responses of Nymphon gracile (Pycnogonida) to pressure cycles

of tidal frequency. Journal of Experimental Biology 41: 825-836.

Knight-Jones, E.W., and Morgan, E. 1966. Responses of marine

animals to changes in hydrostatic pressure. Pp. 267-299 in:

Barnes, H. (ed). Oceanography and Marine Biology. An Annual

Review. Vol. 4. George Allen & Unwin Ltd: London.

Bailey, J.H., Nelson-Smith, A., and Knight-Jones, E.W. 1967. Some

methods for transects across steep rocks and channels. Underwater

Association Report 1966-67: 107-111.

Crisp, D.J., Bailey, J.H., and Knight-Jones, E.W. 1967. The tube-worm

Spirorbis vitreus and its distribution in Britain. Journal of the Marine

Biological Association of the Un ited Kingdom 47(3): 511-521.

Knight-Jones, E.W., and Qasim, S.Z. 1967. Responses of Crustacea to

changes in hydrostatic pressure. Pp. 1132-1150 in: Proceedings

Symp Crustacea held at Ernakulam, 1965, Part 3. Marine

Biological Association of India: Mandapam Camp, India.

Moyse, J., and Knight-Jones, E.W. 1967. Biology of cirripede larvae. Pp.

595-611 in: Proceedings Symp Crustacea, Ernakulam, 1965, Part

2. Marine Biological Association of India: Mandapam Camp, India.

Singarajah, K.V., Moyse, J., and Knight-Jones, E.W. 1967. The effect of

feeding upon the phototactic behaviour of cirripede nauplii.

Journal of Experimental Marine Biology and Ecology 1: 144-153.

Jones, D.A., Knight-Jones, E.W., Moyse, J., Babbage, P.C., and

Stebbing, A.R.D. 1968. Some biological problems in the Aegean.

Underwater Association Report 1968: 73-78.

Knight-Jones,E.W. 1970. Biology underpressure [BookReview: High

Pressure Effects on Cellular Processes, Ed. A.M. Zimmermann

(1970). Cell Biology: A Series of Monographs. Academic, New

York & London, 324 pp.]. Nature 228(5267): 190.

Knight-Jones, E.W., Bailey, J.H., and Issac, M.J. 1971. Choice of algae

by larvae of Spirorbis, particularly Spirorbis spirorbis. Fourth

European Marine Biology Symposium : 89-104.

Knight-Jones, E.W., Knight-Jones, P, and Vine, PJ. 1972. Anchorage

of embryos in Spirorbinae (Polychaeta). Marine Biology (Berlin)

12(4): 289-294.

Knight-Jones, E.W., Knight-Jones, P., and Bregazzi, PK. 1973.

Helicosiphon biscoeensis Gravier (Polychaeta: Serpulidae) and

its relationship with other Spirorbinae. Zoological Journal of the

Linnean Society 52(1): 9-21.

Knight-Jones, E.W., Knight-Jones, P., and Llewellyn, L.C. 1974.

Spirorbinae (Polychaeta: Serpulidae) from southeastern Australia.

Notes on their taxonomy, ecology, and distribution. Records of the

Australian Museum 29(3): 107-151.

Knight-Jones, P., and Knight-Jones, E.W. 1974. Spirorbinae

(Serpulidae: Polychaeta) from South Africa, including three new

species. Marine Biology (Berlin) 25(3): 253-261.

Knight-Jones, E.W., Knight-Jones, P., and Al-Ogily, S.M. 1975.

Ecological isolation in the spirorbidae. Pp. 539-561 in: Barnes,

H.B. (ed). Proceedings of the Ninth European Marine Biology

Symposium, Oban 1974. Aberdeen University Press: Aberdeen.

Knight-Jones, P., Knight-Jones, E.W., and Kawahara, T. 1975. A

review of the genus Janua, including Dexiospira (Polychaeta:

Spirorbinae). Zoological Journal of the Linnean Society 56(2):

91-129.

Knight-Jones, R, Knight-Jones, E.W., Thorp, C.H., and Gray, P.W.G.

1975. Immigrant Spirorbids (Polyclaeta Sedentaria) on the

Japanese Sargassum at Portsmouth, England. Zoologica Scripta

4: 145-149.

Al-Ogily, S.M., and Knight-Jones, E.W. 1977. Anti-fouling role of

antibiotics produced by marine algae and bryozoans. Nature

265(5596): 728-729.

Knight-Jones, E.W., and Nelson-Smith, A. 1977. Sublittoral transects

in the Menai Straits and Milford Haven. Pp. 379-389 in: Keegan,

B.F., O’Ceidigh, P. and Boaden, P.J.S. (eds), Biology of benthic

organisms: 11th European Symposium on Marine Biology,

Galway, October 1976. Pergamon Press: Oxford.

Knight-Jones, P., and Knight-Jones, E.W. 1977. Taxonomy and ecology

of British Spirorbidae (Polychaeta). Journal of the Marine

Biological Association of the United Kingdom 57: 453-499.

Knight-Jones, P., Knight-Jones, E.W., and Dales, R.P. 1979. Spirorbidae

(Polychaeta Sedentaria) from Alaska to Panama. Journal of

Zoology 189(4): 419-458.

Knight-Jones, E.W., and Knight-Jones, P. 1980. Pacific spirorbids in

the East Atlantic. Journal of the Marine Biological Association of

the United Kingdom 60(2): 461-464.

Al-Ogily, S.M., and Knight-Jones, E.W. 1981. Circeis paguri, the

spirorbid polychaete associated with the hermit-crab Eupagurus

bernhardus. Journal of the Marine Biological Association of the

United Kingdom 61: 821-826.

Knight-Jones, R, and Knight-Jones, E.W. 1984. Systematics, ecology

and distribution of southern hemisphere spirorbids (Polychaeta;

Spirorbidae). Pp. 197-210 in: Hutchings, P. A. (eds). Proceedings

of the First International Polychaete Conference, Sydney 1983.

The Linnean Society of New South Wales: Sydney.

Llewellyn, L.C., and Knight-Jones, E.W. 1984. A new genus and

species of marine leech from British coastal waters. Journal of the

Marine Biological Association of the United Kingdom 64:

919-934.

Thorp, C.H., Knight-Jones, P., and Knight-Jones, E.W. 1986. New

records of tubeworms established in British harbours. Journal of

the Marine Biological Association of the United Kingdom 66(4):

881-888.

Knight-Jones, E.W., and Fordy, M.R. 1987. Post hatching stages of a

Branchellion sp. (Hirudinea: Piscicolidae) from La Reunion. Pp.

27-35 in: Rao, T.S.S. (ed). Contributions in Marine Sciences: a

special collection of papers to felicitate Dr. S.Z. Qasim, secretary

to the Government of India, Department of Ocean Development,

on his sixtieth birthday. Dr. S.Z. Qasim Sastyabdapurti Felicitation

Committee, National Institute of Oceanography: Dona Paula, India.

Chughtai, I., and Knight-Jones, E.W. 1988. Burrowing into limestone

by sabellid polychaetes. Zoologica Scripta 17: 231-238.

Hussain, N.A., and Knight-Jones, E.W. 1989. The marine fauna of the

Cullercoats District 25. Hirudinea. Report of the Dove Marine

Laboratory, 3rd Series 38: 1-15.

Gibson, R., and Knight-Jones, E.W. 1990. Platyhelminthes, Nematoda,

Nemertea. Pp. 181-200 in: Hayward, P.J. and Ryland, J.S. (eds).

The marine fauna of the British Isles and north-west Europe. 1.

Introduction and protozoans to arthropods. Clarendon Press:

Oxford.

Knight-Jones, E.W., and Ryland, J.S. 1990. Priapulida, Sipuncula,

Echiura, Pogonophora, and Entoprocta. Pp. 307-321 in: Hayward,

P.J. and Ryland, J.S. (eds). The marine fauna of the British Isles

and north-west Europe. 1. Introduction and protozoans to

arthropods. Clarendon Press: Oxford.

Elis Wyn Knight-Jones: pioneering marine biologist and polychaete taxonomist (1916-2012)

375

Knight-Jones, E.W., and Ryland, J.S. 1990. Hemichordata and

Urochordata. Pp. 872-904 in: Hayward, P.J. and Ryland, J.S.

(eds). The marine fauna of the British Isles and north-west

Europe. 2. Molluscs to chordates. Clarendon Press: Oxford.

Nelson-Smith, A., Knight-Jones, P., and Knight-Jones, E.W. 1990.

Annelida. Pp. 201-306 in: Hayward, P.J. and Ryland, J.S. (eds).

The Marine Fauna of the British Isles and North-West Europe:

Volume I: Introduction and Protozoans to Arthropods. Clarendon

Press: Oxford.

Wright, J.M., and Knight-Jones, E.W. 1990. Ciliophora. Pp. 14-25 in:

Hayward, P.J. and Ryland, J.S. (eds). The Marine Fauna of the

British Isles and North-West Europe: Volume I: Introduction and

Protozoans to Arthropods. Clarendon Press: Oxford.

Knight-Jones, P., and Knight-Jones, E.W. 1991. Ecology and

distribution of Serpuloidea (Polychaeta) round South America.

In: Petersen, M.E. and Kirkegaard, J.B. (eds), Systematics,

biology and morphology of world Polychaeta. Proceedings of

the 2nd International Polychaete Conference, Copenhagen

1986. Ophelia Supplement 5: 579-586.

Knight-Jones, P., Knight-Jones, E.W., and Buzhinskaya, G. 1991.

Distribution and interrelationships of northern spirorbid genera.

In: Reish, D. J. (eds). Proceedings of the Third International

Polychaete Conference, Long Beach. 1989. Bulletin of Marine

Science 48: 189-197.

Knight-Jones, P, Knight-Jones, E.W., and Ergen, Z. 1991. Sabelliform

polychaetes, mostly from Turkey’s Aegean coast. Journal of

Natural History 25(4): 837-858.

Knight-Jones, P., and Knight-Jones, E.W. 1992. Spirorbid distribution,

including a new Madeiran subgenus. Polychaete Research

Newsletter 14: 10.

Knight-Jones, P, and Knight-Jones, E.W. 1994. Spirorbidae

(Polychaeta) from Signy Island, South Orkneys, including three

new species. Ophelia 40(2): 75-94.

Gibson, R., and Knight-Jones, E.W. 1995. Flatworms and ribbon

worms. Pp. 136-164 in: Hayward, P.J. and Ryland, J.S. (eds).

Handbook of the Marine Fauna of north-west Europe. Oxford

University Press: Oxford.

Hussain, N.A., and Knight-Jones, E.W. 1995. Fish and fish-leeches on

rocky shores around Britain. Journal of the Marine Biological

Association of the United Kingdom 75(2): 311-322.

Knight-Jones, E.W., Knight-Jones, P, and Nelson-Smith, A. 1995.

Annelids. Pp. 165-277 in: Hayward, P.J. and Ryland, J.S. (eds).

Handbook of the Marine Fauna of north-west Europe. Oxford

University Press: Oxford.

Knight-Jones, E.W., and Ryland, J.S. 1995. Priapulids, sipunculans,

echiurans and entoprocts (Phyla Priapulida, Sipuncula, Echiura

and Entoprocta). Pp. 278-288 in: Hayward, PJ. and Ryland, J.S.

(eds), Handbook of the Marine Fauna of north-west Europe.

Oxford University Press: Oxford.

Knight-Jones, E.W., and Ryland, J.S. 1995. Acorn-worms and sea

squirts (Phyla Hemichordata and Urochordata). Pp. 687-711 in:

Hayward, P.J. and Ryland, J.S. (eds). Handbook of the Marine

Fauna of north-west Europe. Oxford University Press: Oxford.

Knight-Jones, P, and Knight-Jones, E.W. 1995. Spirorbidae (Polychaeta)

from Madeira including a new species and subgenus of Spirorbis.

In: Keyser, D. and Whatley, R. (eds), Zur Zoogeographie und

Systematik insbesondere der Polychaeten und Ostracoden zu

Ehren von Dr. habil. Gesa Hartmann-Schroder und Prof. Dr. Dr.

h. c. Gerhard Hartmann. Mitteilungen aus dem Hamburgischen

Zoologischen Museum und Institut 92 (Ergbd): 89-101.

Knight-Jones, E.W. 1996. Some marine stations and their founders.

Newsletter of the SOS Alumni Society, University of Wales, Bangor

Summer 1996: 6-9.

Knight-Jones, E.W. 1997. Professor Ernest Naylor, B.Sc. (Sheffield),

Ph.D., D.Sc. (Liverpool). Estuarine, Coastal and Shelf Science

44(2): 131-138.

Knight-Jones, E. W., Knight-Jones, P., Oliver, P.G., and Mackie, A.S.Y.

1997. A new species of Hyalopomatus (Serpulidae: Polychaeta)

which lacks an operculum: is this an adaptation to low oxygen? In:

Naumov, A.D., Hummel, H., Sukhotin, A.A. and Ryland, J.S. (eds).

Interactions and Adaptation Strategies of Marine Organisms.

Hydrobiologica 355: 145-151.

Knight-Jones, E.W. 1998. The Good Ship “Nautilus” In: 50 Years of

Marine Science. Newsletter of the SOS Alumni Society, University

of Wales, Bangor Spring 1998: 16-17.

Knight-Jones, E.W., and Knight-Jones, P. 2002. Four new species of

Eisothistos (Anthuridea: Isopoda) from tubes of Spirorbidae

(Serpuloidea: Polychaeta). Journal of Natural History 36(12):

1397-1419.

Other References

Anon 1956. Zoology in University College, Swansea: Prof. E. W.

Knight Jones. Nature 177(4502): 261.

Anon 1957. Membership of the Nature Conservancy. Nature

179(4567): 947.

Bailey, J.H. 1969. Spirorbinae (Polychaeta: Serpulidae) from Chios

(Aegean Sea). Zoological Journal of the Linnean Society 48:

365-385.

Mackie, A.S.Y., Oddy, G., and Morgenroth, H. 2011. Phyllis Knight-

Jones -A remarkable life (1933-2009). Proceedings of the 10th

International Polychaete Conference, Lecce, Italy 2010. Italian

Journal of Zoology 78(S1): 347-355.

Psalti, I.S.M. 2001. Across the Bridge. An informal chronical: From

the Marine Biology Station, UCNW, to the School of Ocean

Sciences, UWB 1948-98. Alumni Society of the School of Ocean

Sciences, University of Wales, Bangor: Bangor.

Rogerson, S. 2013. In the beginning ... SCUBA 14: 96-98. [www.bsac.

com/page. asp?section=4340§ionTitle=60+years+of+BS

AC+1953+-1-2013]

Ryland, J.S. 1981. Professor E. W. Knight-Jones. University College of

Swansea. Report of the Council 61: 127-128.

Street, H.E. 1957. University College of Swansea: new science

laboratories. Nature 179(4551): 124-126.

Tebble, N. 1963. Leeches [Book Review: Leeches (Hirudinea). Their

structure, physiology, ecology and embryology by K.H. Mann,

with an appendix on the systematics of marine leeches by Prof.

E.W. Knight-Jones. International Series of Monographs on Pure

and Applied Biology. Division: Zoology Vol. 11). Pergamon Press,

London & New York. 201 pp.]. Nature 200(4909): 823.

Toonen, R.J. 2005. JEB Classics: Foundations of gregariousness in

barnacles. Journal of Experimental Biology 208(10): 1773-1774.

[http://jeb.biologists.org/content/208/10/1773.full]

Obituaries

Anon 2012. Wyn Knight-Jones. The Daily Telegraph, 7 March 2012

[www.telegraph.co.uk/news/obituaries/9126912/Professor-Wyn-

Knight-Jones.html]

Naylor, E., Ryland, J., Oddy, G., and Oddy, R. 2012. Elis Wyn Knight-

Jones. The Bridge July 2012: 16-17. [www.bangor.ac.uk/

oceansciences/news/alumni_newsletters/the_bridge_ 2012 .pdf]

Ryland, J., Naylor, E., Mackie, A., and Stebbing, T. 2014. Elis Wyn

Knight-Jones, HonFLS (1916-2012). The Linnean 30(1): 31-35.

Memoirs of Museum Victoria 71:377-378 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Telesphore Gottfried Pillai (1930 - 2013)

obituary

Alexander I. Muir

Department of Life Sciences, The Natural History Museum, Cromwell

Rd., London SW7 5BD, UK (a.muir@nhm.ac.uk)

Gottfried was born on the 31 st . of December, 1930, in Puttalam,

Ceylon. His parents meant to call him Godfrey, but the German

priest who baptised him entered the name incorrectly in his

wrote to him in German, as he had never learned the language.

Ceylon was still a British colony in 1930, but is now

independent and since 1972 has been known as Sri Lanka.

Although he was not a lover of all animals (he remembered

being trapped in the lavatory by a snake as a boy) he studied

Zoology, and Marine Ecology & Fisheries, at university, gaining

BSc degrees from the University of Ceylon (1956) and the

University of London (1965). In 1970 he gained a PhD in Zoology

from the University of Ceylon, with Sir Maurice Yonge as his

External Examiner.

It was when he was at University that Gottfried began to

seriously study polychaetes as a hobby in the evenings and

weekends, and this continued after he entered the world of paid

employment. It was also while he was at University that he met

his wife Toni. They had three children: Kristina, Johann and

Karen. They still remember trips to rocky beaches and the family

trailing behind him with buckets and empty baby food jars to

collect specimens.

From 1956 to 1968 Gottfried was Superintendent of the

Brackish-water Fisheries Development Division of the

Fisheries Department, Ceylon, and then from 1968 until his

retirement in 1986 he was employed by the Food and

Agriculture Organization (FAO) of the United Nations. For

the FAO he worked on inland fisheries development in West

Irian; lagoons, lakes and aquaculture in Tunisia; aquaculture

development in Tanzania; an integrated fishery, fishery biology

and fish culture development project in Nepal, and short-term

consultancies in Afghanistan, North Yemen and Egypt. In

1982 he became Chief Technical Adviser of the African

Regional Aquaculture Centre in Port Harcourt, Nigeria. This

was a multinational UNDP project executed by the FAO. It

was affiliated to the University of Port Harcourt, for post¬

graduate level teaching and training of aquaculturists from

African countries, besides establishing a Centre for

Aquaculture Development and Research.

Telesphore Gottfried Pillai at Gottfried and Toni’s 50th wedding

anniversary celebrations in 2009 (photograph by Mr. John

Cunningham).

After retirement he moved to England, and since 1987 he

continued his polychaete research as a hobby, at first as a visitor

but then as a Scientific Associate of the Natural History

Museum, London.

Gottfried’s early published works - on the polychaete faunas

of Sri Lanka, the Philippines and Indonesia - are still in use

today, and the specimens they are based on are often studied by

polychaete taxonomists. He separated the family Spirorbidae

from the Serpulidae, and Phyllis Knight-Jones named a subgenus

(later raised to genus) Pillaiospira after him in 1973. His later

works concentrated on these two groups, and display his

observations of small details in writing and in his beautiful line

drawings. He left several unfinished manuscripts, which

colleagues will want to edit or complete for publication.

Gottfried was a good man and a committed Christian,

attending church almost daily in his retirement. He loved his

fellow man. It was his custom, if anyone spoke to him in an

unkindly way, to listen and then say “God bless you” before

walking on.

Pat Hutchings remembers him as a true gentleman always

offering good quality tea in the laboratory at the Natural History

Museum and she encouraged him to complete the paper on the

serpulid fauna of the Kimberley region in Western Australia

based on material collected by her. She remembers having to get

his lovely drawings digitised; he never really entered the modern

IT world. Pat says “It was a pleasure knowing him and working

with him on this large paper which had a fairly long gestation

period and he was always receptive to comments”.

378

A. Muir

In 1987 Harry ten Hove decided to spend 10 days in the

collections of the NHM, London. He says “Gottfried and his

wife Toni kindly offered me hospitality in their home. I remember

that as a happy stay, we had a lot of laughs during dinners and the

evenings, sharing experiences (not only tots of whiskey) or

simply watching one of the utterly British comic TV series. In

the Museum and in his home we discussed serpulids widely,

often bent over his numerous keenly observed and detailed line

drawings. Back in Amsterdam, I sent him the fairly extensive

ZMA collections of the genus Serpula sensu lato, and he started

to study this difficult taxon. His first results on Spiraserpula

triggered me to search for more material of this overlooked taxon

in my as yet unidentified collections from the Canary and Cape

Verde Islands and Indonesia, as well as during dives in the

Caribbean. Our initial 4 species exploded to 18, almost all new

to science (Pillai & ten Hove 1994). When our views occasionally

disagreed, he accepted the criticism of his younger colleague

graciously. After a carefully phrased but nevertheless particular

radical comment on one of his manuscripts from my side he

answered by dedicating his next reprint “to Harry with, as usual,

my highest personal regards”. I will always remember Gottfried

as a nice, patient and gentle man, a real gentleman”.

Gottfried died after a brief illness on the 24 th . of September,

2013, leaving his wife, three children and a grandson.

I would like to thank Toni Pillai, David George, Harry ten

Hove and Pat Hutchings—their comments benefitted this

obituary greatly.

Bibliography

Pillai, T.G. 1958. Studies on a brackish-water polychaetous annelid,

Marphysa borradailei, sp. n. from Ceylon. Ceylon Journal of

Science (Biological Sciences) 1(2): 94-106.

Pillai, T.G. 1960. Some marine and brackish-water Serpulid Polychaeta

from Ceylon, including new genera and species. Ceylon Journal of

Science (Biological Sciences) 3: 1-40.

Pillai, T.G. 1961. Annelida Polychaeta of Tambalagam Lake, Ceylon.

Ceylon Journal of Science (Biological Sciences) 4(1): 1-40.

Pillai, T.G. 1962. Fish Farming Methods in the Philippines, Indonesia

and Hong Kong. FAO Fisheries Division, Biology Branch, Technical

Paper 18: 1-68.

Pillai, T.G. 1965. Annelida Polychaeta from the Philippines and Indonesia.

Ceylon Journal of Science (Biological Sciences) 5(2): 110-177.

Pillai, T.G. 1970. Studies on a collection of spirorbids from Ceylon,

together with a critical review and revision of spirorbid systematics,

and an account of their phylogeny and zoogeography. Ceylon

Journal of Science (Biological Sciences) 8(2): 100-172.

Pillai, T.G. 1971. Studies on a collection of marine and brackish-water

polychaete annelids of the family Serpulidae from Ceylon. Ceylon

Journal of Science (Biological Sciences) 9(2): 88-130.

Pillai, T.G. 1972. A review and revision of the systematics of the

genera Hydroides and Eupomatus together with an account of their

phylogeny and zoogeography. Ceylon Journal of Science

(Biological Sciences) 10(1): 7-31.

Pillai, T.G. 1973. Pests and predators in coastal aquaculture systems

of the Indo-Pacific Region. In Pillay, T.V.R. [Ed.] Coastal

Aquaculture in the Indo-Pacific Region. Fishing News (Books)

Ltd., West Byfleet and London. Pp. 456-470.

Pillai, T.G. 1975. Possibilities de Faquaculture et developpement de la

Oche en eaux douce et saumatre en Tunisie. Bulletin Peches

Salammbo 2: 69-131.

Pillai, T.G. 1976. CIFA/75/SE 19. Possibilities for aquaculture

development in Tunisia. CIFA Technical Papers 4 (supplement 1):

216-240.

Pillai, T.G., and Sollows, J.D. 1980. Cage culture of fish (carps) in

Nepal. A report prepared for the integrated fisheries and fish

culture development project in Nepal. FAO Field Document FI/

FIRA 8: 1-33.

Pillai, T.G. 1993. A review of some Cretaceous and Tertiary serpulid

polychaetes of the genera Cementula and Spiraserpula Regenhardt,

1961, Laqueoserpula Lommerzheim, 1979 and Protectoconorca

Jager, 1983. PaFontologische Zeitschrift 67(1-2): 69-88.

Pillai, T.G., and Hove, H.A. ten, 1994. On Recent species of

Spiraserpula Regenhardt, 1961, a serpulid polychaete genus

hitherto known only from Cretaceous and Tertiary fossils. Bulletin

of the Natural History Museum, Zoology Series 60(1): 39-104.

Pillai, T.G. 2008. Ficopomatus talehsapensis , a new brackish-water

species (Polychaeta: Serpulidae: Ficopomatinae) from Thailand,

with discussions on the relationships of taxa constituting the

subfamily, opercular insertion as a taxonomic character and their

taxonomy, a key to its taxa, and their zoogeography. Zootaxa

1967: 36-52.

Pillai, T.G. 2009. Knightjonesia,a.new genus (Polychaeta: Spirorbidae)

with a winged opercular peduncle, and its taxonomy. Zootaxa

2059: 46-50.

Pillai, T.G. 2009. A revision of the genera Galeolaria and Pyrgopolon

(Polychaeta: Serpulidae), with discussions on opercular insertion

as a character in their taxonomy and relationships, and their

zoogeography. Zootaxa 2060: 47-58.

Pillai, T.G. 2009. Descriptions of new serpulid polychaetes from the

Kimberleys of Australia and discussion of Australian and Indo-

West Pacific species of Spirobranchus and superficially similar

taxa. Records of the Australian Museum 61(2-3): 93-199.

Murray, A.; Hutchings, P, and Pillai, T.G. 2010. Note on Hydroides

malleolaspinus from the Kimberleys of Western Australia

(Polychaeta: Serpulidae). Records of the Australian Museum 62(2-

3): 393-394.

Memoirs of Museum Victoria 71:379-380 (2014) Published December 2014

ISSN 1447-2546 (Print) 1447-2554 (On-line)

http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/

Web site review: Kupriyanova, E.K., Wong, E., & Hutchings, P.A. (eds) 2013.

Invasive Polychaete Identifier - an Australian perspective.

Version 1.1, 04 Dec 2013. http://polychaetes.australianmuseum.net.au/

Brian Paavo

Benthic Science Limited, 595 Brighton Road, Westwood, Dunedin, New Zealand 9035. http://www.benthicscience.com/

Glasby, Wilson, and Hutchings (2003) and other contributors

through CSIRO Publishing, provided the award-winning

Polychaete Identification Guide CD-ROM over a decade ago.

The Guide remains an excellent, if aged, tool familiar to many

student and professional researchers alike. The Australian

Museum demonstrates similar interactive skill with their

newest contribution - the Invasive Polychaete Identifier. The

Identifier is a clear effort to promote awareness of invasive

spionid, serpulid, and sabellid species of Australia

(Kupriyanova, Wong, & Hutchings, 2013). Do these invaders

bring homogeneous doom to our coast? Or do they prop up

biodiversity and ecosystem function? Before researchers can

answer such questions they must first be able to reliably

separate exotics which are expanding their range from

indigenous taxa. Monitoring programmes, our first-line of

defence at harbour and mariculture sites, have difficulty

contributing to a cohesive national picture due to the widely

varying resources available to them. Records from the grey

literature, such as technical consulting reports, also have the

potential to provide reliable datasets if only it were possible to

provide some assurance of identification uniformity. The

Australian Museum’s Invasive Polychaete Identifier attempts

to bring some uniformity and order to the chaos and it does so

with style.

The Identifier provides a simple, dynamic user interface

with engaging polychaete imagery throughout. It seems to

have been effectively designed as a compromise for its

apparent audience. It doesn’t offend specialists with ponderous

click-throughs to get to the species lists, yet it also supports

workers with limited polychaete experience. Dynamic features

were occasionally corrupted so a few workers accessing the

Identifier on small screens may find themselves confused at

times by disjointed layouts really intended for 1024 x 768 pixel

or larger displays. The page design is a bit wasteful of screen

real estate, perhaps in an attempt to be less intimidating, but it

behaved well in Firefox, Chrome, and IE browsers.

Like so many polychaete workers I’ve often shuddered at

the poorly-preserved mess some field staff bring back to be

identified. Since it seems likely that consulting laboratories

form a substantial part of the Identifier’s audience, I found

myself wishing that the treatement of polychaete fixation,

preservation, and examination methods was more

comprehensive and prominent in the menu structure instead of

buried at the bottom of an introductory page. Access to the

bibliography and recommended references is tortured and

incomplete, but hopefully that will be fixed in the next revision.

Overall, the writing is stilted with ambiguous punctuation and

grammar in an obvious attempt to be concise, but the essence

of the Identifier is its species list, well-documented character

states, fabulous imagery, and clear four colour key providing

authoritative status for native, cryptogenic, introduced &

established, and potentially invasive species. Although the key

is clear, humans tend to associate values with colours such as

red, yellow, green, and blue so in addition to helping the

colour-blind, a more neutral icon system could be deployed in

future revisions.

The Identifier provides three ways of accessing the same

information. A full species list gives the user quick access to

exceptional and frequently annotated illustrations in multiple

resolutions alongside clear character statements. It is clear that

the authors have taken pains to provide images of the whole

animal, anterior features, tube structure, and standout somatic

and chaetal characteristics. I found the comparative comments

regarding other species which look similar to be enormously

helpful. I was also happily surprised by the provision of

contact details for specialists - a true testament to the

dedication of the authors to providing a valuable service to

Identifier subscribers . I was, however, disappointed with some

of the unqualified comments on geographic distribution. If the

intent of the Identifier is to help track species invasions, it is

logically counterproductive to encourage technicians to

discriminate similar species by geographic distribution rather

than character states. The ‘Quickfinder’ provides access to the

same information using a drop-down menu structure whereas

a classic pictorial key can be accesed through the

unambiguously named ‘Identification tool.’

The most useful tool to polychaete neophytes is the

gorgeously illustrated glossary. An enormous amount of work

380

B. Paavo

is apparent in the illustrations with a clear eye toward bright

and darkfield stereomicroscope users where it would have

been easy, instead, to include SEM images so frequently

dismissed by monitoring technicians. The authors’ technical

skill can be most appreciated in the natural colour images of

exquisitely mounted specimens with excellent depth-of-field;

even when illustrating those pesky soft radiolar features of

sabellids. While the pictures are very informative, some of

their value is lost when the Identifier provides them in a single

fixed resolution. Posting thumbnails linked to higher-resolution

images is such a common and useful feature for workers using

different kinds of screens that I was puzzled by its sporadic

use in the Identifier.

Fundamentally, the Identifier is a response to the ever¬

present demand by technicians to have good pictures which

they can use to process collections quickly and reliably. The

illustrations are of unparalleled diagnostic (and frequently

artistic) quality and they are extremely valuable even though

the ‘picture-book identification method’ is addictive and

inherently dangerous as it can lead to a multi-choice selection

process instead of promoting accurate identification practices.

The Identifier mitigates this problem by providing clear access

to character states which are reliably linked to the excellent

glossary. This design will hopefully encourage responsible

technicians to associate structures with descriptions and help

them develop useful skills in other groups.

The web was invented by scientists and it is in our nature

to let information be as free and as accessible as possible, so I

am confident that the authors had to put such a useful tool

behind a paywall only under duress and pragmatic funding

limitations. The pricing structure reflects a clear effort to trade

value for value with the end users.

Students are asked to pay a one-time fee of AU$50, while

professionals are charged AU$300, and businesses AU$500. I

think many workers will be watching to see if this funding

model is successful. The cost to a ‘developed country’

classroom or business is small and if this level of funding is

adequate to provide timely updates as more invasives are

identified, then the value for money is excellent and well-worth

our support in the hopes that the Identifier can continue to

develop. Overall, I think the biggest drawback of the Identifier

is its isolationist structure. Although publicly accessible

databases like the World Register of Marine Species and

Encyclopedia of Life can’t link to the Identifier, I don’t

understand why the Identifier doesn’t link its users out to such

increasingly useful resources.

The Invasive Polychaete Identifier is a useful and beautiful

tool I will use professionally to identify taxa and as a training

utility. The authors and the Australian Museum deserve

applause for providing such useful information in a readily

accessible and affordable format which is sure to benefit

private and governmental monitoring technicians, students,

and academics,

Glasby, C.J., Wilson, R.S., & Hutchings, RA. 2003. Polychaetes

- An interactive identification guide. CD-ROM ISBN:

9780643067028