Memoirs of Museum Victoria 80: 1-41 (2021) Published March 2021
1447-2554 (On-line)
httos://museumsvictoria.com.au/collections-research/journals/memoirs-of-museum-victoria/
DOI https://doi.org/10.24199/).mmv.2021.80.01
Indo-West Pacific and Australian species of Eucalliacidae with descriptions of four
new species (Crustacea: Axiidea)
(http://zoobank.org/urn:lsid:zoobank.org:pub:EA21667A-77A5-A11 D-9C1A-23ECFFF3D505)
Gary C. B. POORE (http:;//zoobank.org/urn:lsid:zoobank.org:author:c004d784-e842-42b3-bfd3-3174d359f8975)
(https://orcid.org/0000-0002-7414-183X )
Museums Victoria, GPO Box 666, Melbourne, Vic. 3001, Australia. Email: gpoore(?museum.vic.gov.au
Poore, G.C.B. (2021). Indo-West Pacific and Australian species of Eucalliacidae with descriptions of four new species
surveys of coral reefs and sandy shallow environments in the Indo-West Pacific and Australia have discovered 14
species of Eucalliacidae, of which four are new. All species are diagnosed, and Andamancalliax arafura sp. nov.,
Eucalliaxiopsis dworschaki sp. nov., Eucalliaxiopsis paradoxa sp. nov. and Eucalliaxiopsis patio sp. nov. are described as
new. The collection is an opportunity to re-diagnose other species and provide colour photographs of some. Calliaxina
xishaensis Liu and Liang, 2016, is synonymised with Calliaxina novaebritanniae (Borradaile, 1900).
Abstract
(Crustacea: Axiidea). Memoirs of Museum Victoria 80: 1—41.
Keywords Crustacea, Axiidea Eucalliacidae, taxonomy, new species
Introduction
Of eight families of callianassid-like Axiidea, Eucalliacidae
have the most complicated taxonomic history that was most
recently reviewed by Poore et al. (2019). Their revision and the
molecular phylogeny on which it was based (Robles et al. 2020)
depended in part on extensive collections made in the Indo-
West Pacific over the last couple of decades. These collections
also made it possible to re-diagnose known species and
describe others revealed as new during the molecular study.
Eucalliacidae comprise seven genera, diagnosed by Poore et
al. (2019), and 21 species listed by these authors. Six species are
from the Atlantic or Mediterranean and two are deep-sea. This
contribution deals only with those from coral reefs and shallow
environments in the Indo-West Pacific and Australia. Fourteen
species are covered here, of which four are described as new.
Methods
Much of the material comes from the Muséum nationale
d'Histoire naturelle, Paris (MNHN), including expeditions to
Papua New Guinea, Madang Province (PAPUA NIUGINI
stations), and New Ireland Province (KAVIENG 2014
stations). Another sizable Indo-West Pacific collection has
been accumulated by the Florida Museum of Natural History,
University of Florida (UF). Specimens were also examined
from Museums Victoria, Melbourne (NMV); the Australian
Museum, Sydney (AM); Western Australian Museum, Perth
(WAM); and Naturhistorisches Museum, Vienna (NHMW).
Unless otherwise stated, station prefixes and numbers belong
to systems initiated by the museum holding the material.
Size 1S expressed as carapace length (cl.), including
rostrum, in mm. Individuals marked with an asterisk (*) were
sequenced and contributed to molecular analysis (Robles et
al., 2020). Diagnoses have been prepared for all species and
coded into a DELTA database (Dallwitz, 2010). This database
was used to generate the diagnoses presented here; character
states in italics diagnose each species in at least one respect
from every other species. Colour photographs of fresh
specimens were taken in the laboratory shortly after collection
by Arthur Anker and Zdenek Duri&. Photographs 1n figs 12
and 25 were taken using a Leica 205C microscope and the
Leica Application Suite multifocus routine.
Eucalliacidae Manning and Felder, 1991
Eucalliinae Manning and Felder, 1991: 781 (misspelling).
Eucalliacinae Sakai, 1999: 108—109.— Sakai, 2018: 734—738 (partim).
Eucalliacidae.— Sakai, 2011: 491.— Sakai and Türkay, 2014: 190
(outdated key to genera).— Sakai, 2018: 734—738.— Poore et al., 2019:
122 (for complete synonymy).
Remarks. The family was diagnosed by Poore et al. (2019). It 1s
recognised most easily by the truncate setose apex of the
dactylus of maxilliped 3. Callianopsidae, which also share this
feature, differ in that the uropodal exopod lacks a dorsal plate,
indicated in eucalliacids by a secondary dense row of stout
setae diverging on the upper surface from the anterior margin.
Andamancalliax Sakai, 2011
Andamancalliax Sakai, 2011: 494—495.— Sakai, 2018: 738.—
Poore et al., 2019: 126.
Remarks. The genus differs from other eucalliacids in the
prominent sharp rostrum and the unequal dissimilar chelipeds, the
minor one having elongate fingers. The crista dentata of the type
species was not illustrated, but in the new species described here,
it comprises few sharp long spines in lieu of a row of similar even
teeth seen in other genera. Sakai (2011, 2018) stated that the
maxilliped 3 lacks an exopod but in the newly discovered female
of what appears to be a different species, a small exopod is present.
The genus was diagnosed by Sakai (2011) as having the male
pleopod 1 biarticulate, but this was changed by Sakai (2018) to
pleopod 1 absent. I believe itis biarticulate, as in other eucalliacids,
for the reasons given under remarks on the type species.
Andamancalliax andamanica (Sakai, 2002)
Calliax andamanica Sakai, 2002: 463—467, figs 1, 2.— Sakai,
2005: 201.
Andamancalliax andamanica Sakai, 2011: 495.— Sakai, 2018: 738.
Distribution. Thailand, Andaman Sea. Shelf, 31—61 m.
Remarks. Sakai (2002) referred to the holotype of Calliax
andamanica as female in the description and male in the figure
legends. His figure 2B of the "female Plp 1” from the holotype,
described as "uniramous, two-articled, distal article bilobed
distally”, is most probably from an immature male (cf. fig. 16q
of male pleopod | of Eucalliaxiopsis dworschaki sp. nov.).
Andamancalliax arafura sp. nov.
http://zoobank.org/urn:lsid:zoobank.org:act: | E5B7D96-E101-
45B8-A D22-7156C8B29B30
Figures 2, 3
Material examined. Holotype. Australia, NT, Arafura Sea, 9.2055° S,
133.6483° E, 155-158 m, oozy mud (RV Southern Surveyor stn
032BS006), AM P.74526 (female, 3.7 mm, without major cheliped).
Description of holotype. Carapace smooth; gastric-abdominal
regions together 4.3 times as long as width of these regions
together; branchiostegite fully calcified; cervical groove at 0.62
carapace length, scarcely obvious on branchiostegite.
Rostrum acute, strongly tapering, two-thirds length of
eyestalk. Anterolateral carapace lobe absent. ‘Thoracic sternite
7 1.6 times as long as wide, with well-defined median sulcus
over posterior half, smooth over medial half, weak lateral ridge
anterior to coxal articulation crossing pit at quarter of width.
Pleonite | without anterior transverse groove, without
sternal plates.
Eyestalk 1.5 times as long as greatest width, swollen laterally,
tapering distally around cornea, with defined apical lobe; cornea
wider than long. Antennular peduncle 1.8 times as long as width
of both eyestalks; article 2 twice as long as wide; article 3 as long
as article 2; article 3 with ventrolateral row of few setae,
continued onto flagellum. Antennal peduncle 2.2 times as long as
width of both eyestalks, overreaching antennule peduncle by
most of article 5; scaphocerite ovoid, longer than wide; article 4
G.C.B. Poore
c. 5 times as long as wide; article 5 0.7 length of article 4.
Maxilliped 3 basis with 4 mesial teeth along lower margin,
ischium with strongly expanded proximo-lower lobe, tapering to
two-thirds of its greatest proximal width; crista dentata of 3 short
basal spines, plus 4 long sharp spines, first 2 recurved, last 2
overlapping merus; merus upper margin 1.5 times as long as
ereatest width; carpus-dactylus together reaching back to mid-
ischium; dactylus as wide as long, with setose truncate apex;
exopod third length of upper margin of ischium.
Major cheliped missing. Minor cheliped (right) ischium c.
2.8 times as long as distal width, lower margin with sharp
subdistal spine; merus twice as long as broad, lower margin
convex, unarmed; carpus 1.1 times as wide as upper length,
margins carinate; propodus palm tapering, 0.9 times as wide
as upper palm length, upper margin rounded, distomesial
margin of palm oblique, distolateral margin of palm oblique,
with triangular tooth at base of finger; fixed finger twice
length of upper margin of palm, lateral cutting edge with
proximal sharp oblique tooth, obtuse distal tooth; dactylus as
long as fixed finger, 5 times as long as wide at base, cutting
edge with obtuse rounded tooth at about two-thirds.
Pereopod 2 merus 2.2 times as long as maximum width;
dactylus c. 5 times as long as upper margin of propodus.
Pereopod 3 merus 2.3 times as long as maximum width;
carpus 1.7 times as long as wide; propodus with lower margin
concave, 1.3 times as long as mid-length; dactylus less than
half as long as axial length of propodus. Pereopod 4 merus 3
times as long as maximum width; carpus 3 times as long as
wide; propodus setose, with long distal spiniform seta among
setose margin, as long as dactylus, with 2 long distal setae
overlapping dactylus. Pereopod 5 chelate.
Pleopod | uniarticulate, tapering. Pleopod 2 endopod 2.6
times as long as wide; appendix interna at midpoint of endopod,
reaching two-thirds remaining length of endopod. Pleopod 3
with appendix interna embedded in endopod.
Uropodal endopod ovoid, anterior margin more convex
than posterior margin, widest at midpoint, 1.7 times as long as
wide, without facial setae; exopod ovate, greatest dimension 1.6
times anterior margin, anterior margin straight, curving into
distal margin, sharper curve between distal and posterior
margins, with row of blade-like setae on distal posterior
margin; dorsal plate defined by weak longitudinal ridge,
extending half of exopod width, distal plate margin with a
dozen scattered spiniform setae of various sizes. Telson 1.6
times as wide as long, broadest over anterior half, lateral margin
evenly curving to posterior margin; posterior margin convex,
with posterolateral clusters of long setae; dorsal surface smooth.
Etymology. For the Arafura Sea (noun in apposition).
Distribution. Australia, Arafura Sea. Shelf, 151—158 m.
Remarks. The truncate setose dactylus of maxilliped 3,
presence of a dorsal plate, spike-like rostrum and long fingers
on the minor cheliped place the new species in Andamancalliax.
The sole specimen differs from the illustrations of A.
andamanica in the presence of a short exopod on maxilliped 3,
a distal spine on the lower margin of the ischium of the minor
cheliped, a tooth on the fixed finger of the minor cheliped, a
Indo-West Pacific and Australian Eucalliacidae 3
Figure 1. Live colour photographs: a, Calliaxina bulimba, Papua New Guinea. MNHN-IU-2013-7097; b, c, C. kensleyi, Saudi Arabia, UF 36699;
d, e, C. novaebritanniae, Papua New Guinea, MNHN-IU-2013-7062; f, Eucalliaxiopsis dworschaki, French Polynesia, UF 16286; g, E. dworschaki,
Papua New Guinea, MNHN-IU-2013-7081; h, E. inaequimana, French Polynesia, UF 29162; 1, E. inaequimana, French Polynesia, UF 29208.
Photos a, d, e, g: Z. Duri&; b, c, f, h, i, A. Anker. Various scales.
more oval uropodal endopod and a less pronounced dorsal ^ surface carinate and the anterior half elevated.
plate on the uropodal exopod. The few sharp spines that
constitute the crista dentata are unique within Eucalliacidae; Calliaxina Ngoc-Ho, 2003
the situation in A. andamanica was not reported. The dorsal
plate of the uropodal exopod of A. arafura is less well developed Calliaxina Ngoc-Ho, 2005: 495—494.— Sakai, 2011: 497 (part).—
than in A. andamanica, which was said to have the dorsal Poore etal., 2019: 126—127.
| G.C.B. Poore
J j / i
j-
WE IT -
—
2
——
KG
CY
K WX
NS
Figure 2. Andamancalliax arafura sp. nov. Holotype, Australia, NT, AM P.74526 (female, 3.7 mm): a, b, anterior carapace, eyestalks, antennule,
antenna, pleonite 1, dorsal, lateral views; c, pleonite 6, telson, uropod (c', detail of uropod exopod spiniform setae); d, thoracic sternite 7; e, f,
minor cheliped (right), mesial, lateral views; g, pereopod 2; h, pereopod 3; 1, J, pereopod 4, with detail of propodus, dactylus; k, pereopod 5. Scale
bars = | mm.
Indo-West Pacific and Australian Eucalliacidae
Figure 3. Andamancalliax arafura sp. nov. Holotype, Australia, NT, AM P.74526 (female, 3.7 mm): a, b, left maxilliped 3, lateral, mesial views; c,
left maxilliped 3, basis, merus, posterior view; d, pleonal sternite 1, pleopod 1; e, f, pleopods 2, 3. Scale bar = 1 mm.
Remarks. Calliaxina differs from Eucalliaxiopsis in lacking a
transverse ridge on the telson, lacking differentiation between
male and female major chelipeds, and always possessing an
exopod on maxilliped 3, sometimes vestigial (Poore et al.,
2019; Robles et al., 2020).
Calliaxina includes the type species, C. punica (de Saint
Laurent and Manning, 1982) from the western Mediterranean
plus four species from the Indo-West Pacific. Separation of
the species is difficult because characters defining each have
historically been incompletely documented. Juveniles of all
species tend to have larger eyes, more acute rostrums and
similar telsons, making differentiation on the basis of these
characters impossible. Adult males of four species are known;
juvenile males of one of these and of the fifth species have
presumably immature pleopods 1 (see Poore et al. [2019] and
discussions below under C. bulimba and C. novaebritanniae).
Liu and Liang’s (2016) key to species included one species
here placed in Eucalliaxiopsis and relied on the shape of the
rostrum and telson, both size-dependent features.
Key to species of Calliaxina
l. Maxilliped 3 exopod vestigial 2
— Maxilliped 3 exopod reaching at least third way along
ischium 3
2. Major cheliped propodus distomesial margin with setae
aligned in 2 groups of c. 10 and c. 6 setae; minor cheliped
distomesial margin with setae aligned in 2 scarcely separate
eroups of c. 20 and c. 8 setae; cheliped merus lower margin
with few denticles; Red Sea, Jordan, Saudi Arabia;
Madagascar C. kensleyi (Dworschak, 2005)
Major and minor chelipeds propodi distomesial margins
with setae aligned in 2 groups of c. 9 setae each; cheliped
merus lower margin with 2 or 3 proximal truncated
curved teeth and diminishing denticles more distally;
Papua New Guinea, SE Australia... s sh hh
C. bulimba (Poore and Griffin, 1979)
Maxilliped 3 exopod overlapping merus (except in
Juveniles) 4
Maxilliped 3 exopod reaching half-way along ischium;
male pleopod | article 2 3 times as long as wide; Japan,
East China Sea C. sakaii (de Saint Laurent, 1979)
Antennule peduncle reaching base of antenna peduncle
article 5; male pleopod 1 with broad subapical notch,
prominent appendix interna, triangular apex; Mediterranean
C. punica (de Saint Laurent and Manning, 1982)
Antennule peduncle reaching midpoint of antenna peduncle
article 5; pleopod | article 2 with narrow apical notch, short
appendix interna, apex prominently curved; Papua New
Guinea, Indonesia, NE Australia, Philippines, South China
Sea Pen em Polynesia: ». eene endete nde tat
C. novaebritanniae (Borradaile, 1900)
Calliaxina bulimba (Poore and Griffin, 1979)
Figures la, 4, 5, 12a, h
Callianassa bulimba Poore and Griffin, 1979: 257, fig. 21.
Calliax bulimba.—de Saint Laurent and Manning, 1982: 222.—
Sakai, 1999: 119, fig. 32a—-c.— Sakai, 2005: 202.
Calliaxina bulimba.—Sakai, 2011: 499.— Poore et al., 2019: 127,
146, fig. 19g, h.
Eucalliax bulimba.— D worschak, 2005: fig. 5c, d.
Eucalliax kensleyi.— Sakai, 2017: 1122-1124 (partim), fig. 2D.
Material examined. Australia. Qld, Britomart Reef front, 18° 17' S,
146° 38' E (NMV stn AIMS 57), NMV 712184 (female, 8.7 mm). Rib
Reef, 18.48° S, 146.86" E, October 1985, shallow lagoon, 8 m, (M.
Riddle stn R/10/1), NMV J71676 (male, 4.6 mm).
Papua New Guinea. Madang Province, lagoon, PAPUA NIUGINI
stations: 05° 10.2' S, 145° 50.4' E, 1-3 m (stn PR243), MNHN-
[U-2013-7097* (male, 4.5 mm); 05? 10.3' S, 145° 48.5' E, 1-18 m (stn
PR213), MNHN-IU-2013-7124 (female, 3.5 mm).
Diagnosis. Sternite 7 with transverse groove visible only
laterally, anteromedial lobe rounded. Antennule peduncle
reaching to midpoint of antenna peduncle article 5. Maxilliped
3 exopod vestigial, about twice as long as wide. Major cheliped
merus, lower margin with 2 or 3 proximal truncate teeth;
propodus distomesial margin with setae aligned in 2 similar
groups of c. 9 setae each. Male pleopod 1 article I linear, with
distal setae; article 2 short, oblique (juvenile form).
Colour. Exoskeleton translucent white (fig. 1a).
Distribution. Indonesia, Ambon; Papua New Guinea, Madang
and New Ireland provinces; Australia, Qld (type locality).
Coral reef lagoon, 1—18 m.
Remarks. Poore and Griffin’s (1979) simple figures are
supplemented here by illustrations of a newly discovered male
and female from Australia. The telson 1s widest proximally,
the anterior margins each side of the rostrum are concave, and
the distomesial margins of the propodi of the chelipeds bear
two widely separate small groups of c. 9 setae each. As is
typical of callianassid-like families, the rostrum of small
individuals 1s more acute than 1n adults and the cornea more
swollen. Separation of the anterior and posterior sections of
thoracic sternite 7 is weak, with only a slight inclination
laterally terminating in a sublateral pit; the posterolateral
margin carries groups of c. 6, 7 and 9 long setae (fig. 12h). As
figured by Dworschak (2005), pleonite 1 lacks obvious ventral
plates but bears two short rows of three or four long setae
anterior to the pleopods.
The 4.5-mm male from Papua New Guinea has a pleopod |
with long distal setae on article 1 and a short simple oblique
article 2 (fig. 5d). This is consistent with Poore and Griffin’s
(1979: fig. 21g) and Dworschak's (2005: fig. 5c, d) illustrations
of the much larger holotype (cl. 10 mm) and resembles those of
Eucalliaxiopsis inaequimana (see Dworschak, 2014: fig. 4j-l),
E. madagassa (see Ngoc-Ho, 2014: fig. 2S, as C. thomassini)
and E. patio sp. nov. Pleopod 1 of the 4.6-mm male from
Australia differs in having a bilobed article 2 with a longitudinal
crease and a separate appendix interna (fig. 5b). As argued by
G.C.B. Poore
Poore et al. (2019), this would appear to be an intermediate
form tending towards the more typical eucalliacid male
pleopod (e.g., fig. 7h, J). Undeveloped male pleopods 1 are
also seen in small juveniles of C. novaebritanniae (see below).
The small specimens from Papua New Guinea can be
distinguished from the holotype in having an apparently
broader uropodal endopod (1.25 times as long as wide vs 1.4
times). They did not possess the fine granular lateral surface
in the gape of the cheliped illustrated by Poore and Griffin
(1979). Sakai (1999: fig. 32) showed the cobblestone pattern
on the lower branchiostegite to be a little more extensive in
the holotype from Queensland than on the new material from
Papua New Guinea.
This 1s one of two species with a rudimentary exopod on
maxilliped 3, overlooked by Poore and Griffin (1979) but noted
on the holotype by Sakai (1999). The exopod bears a few short
setae. The other is C. kensleyi (Dworschak, 2005); the two
were differentiated by Dworschak (2005) but see further
comments under C. kensleyi below.
Sakai (2017) listed and figured an ovigerous female from
Ambon, Indonesia, as Eucalliax kensleyi but on biogeographical
erounds this is certainly C. bulimba.
Calliaxina kensleyi (Dworschak, 2005)
Figures 1b, c, 6, 7, 12b, c, 1
Eucalliax kensleyi Dworschak, 2005: 205, figs 1—4, 5a, b.— Sakai,
2017: 1122-1124 (partim), fig. 2A-C, E-G.
Calliaxina kensleyi.—Poore et al., 2019: 125, 127, 146, fig. 191.
Material examined. Saudi Arabia, Farasan Banks, Marka Island, sandy
cay, 18.22055° N, 41.32438° E (stn SAFA-010), UF 36699 (male, 5.9 mm).
Madagascar, Tuléar (now Toliara), Thomassin stn 648, MNHN-
IU-2014-10476 (female, 7.5 mm); Thomassin stn 650, MNHN-
IU-2016-8086 (female, 6.6 mm). Nosy Bé, MNHN-IU-2016-8084
(male, 7.4 mm).
Diagnosis. Sternite 7 with transverse groove visible only
laterally, anteromedial lobe rounded. Antennule peduncle
reaching to midpoint of antenna peduncle article 5. Maxilliped 3
exopod vestigial, about twice as long as wide. Major cheliped
merus, lower margin with 2 or 3 proximal truncate teeth;
propodus distomesial margin with setae aligned in 2 groups of
c. 10 and c. 6 setae. Male pleopod | article 2 about 2.5 times as
long as wide; appendix interna obsolete.
Colour. Exoskeleton mostly translucent white, gastric region,
epistome, upper parts of chelipeds pink (fig. Ib, c).
Distribution. Red Sea (Jordan, Saudi Arabia); western Indian
Ocean (Madagascar). Intertidal, shallow sediments.
Remarks. Calliaxina kensleyi shares a vestigial maxilliped
3 exopod with C. bulimba. The two species were compared by
Dworschak (2005) but the differences he listed are subtle and
deserve reinterpretation and addition. The more pronounced
rostrum of C. kensleyi is subtly so, but juveniles appear to have
sharper rostrum in both species. The telson of C. kensleyi was
Indo-West Pacific and Australian Eucalliacidae T
jl X» A) á
jj A AA 24 Wa
3 f KA y f
M
NS
NS
SR
NS SN
Figure 4. Calliaxina bulimba. Australia, Qld, NMV J12184 (female, 8.7 mm): a, anterior carapace, eyestalks, antennule, antenna; b, telson,
uropod; c, thoracic sternite 7; d, pleonal sternite 1; e, maxilliped 3; f, g, major cheliped (right), mesial, lateral views; h, minor cheliped (left),
mesial view; uropod. Scale bars = 1 mm.
CO
b-e
G.C.B. Poore
Figure 5. Calliaxina bulimba. Australia, Qld, NMV J71676 (male, 4.6 mm): a, left coxa 5, pleonite 1, pleopod 1 in situ, lateral view; b, c, pleopods
1, 2. Papua New Guinea, MNHN-IU-2013-7097 (male, cl. 4.5 mm): d, e, pleopods 1, 2. Scale bars = 1 mm.
said to be widest at its midpoint, whereas that of C. bulimba 1s
widest anteriorly; this difference is less obvious in smaller
specimens. The uropodal exopod is oval in C. kensleyi, more
tapering in C. bulimba, but again less clear in smaller
specimens. In both species, the major cheliped (the slightly
wider one) has a tooth on the fixed finger, whereas the minor
cheliped does not, with the apparent exception of the paratype
of C. kensleyi.
Despite their obvious morphological similarity, Calliaxina
kensleyi and C. bulimba were not the two most
phylogenetically related of the four species 1n Robles et al.'s
(2020) study. Calliaxina kensleyi was sister species to C.
novaebritanniae, and these two more related to C. sakait,
which if true suggests that the vestigial maxilliped 3 exopod
has evolved twice. Ovoid plates are visible on the sternite of
pleonite 1 (fig. 6c) but absent in E. bulimba (fig. 4d).
Dworschak (2005) did not describe the dentition of the
lower margin of the merus of the chelipeds of C. kensleyi; in
the new material there are few proximal denticles (fig. 6e, f).
All specimens of C. bulimba possess two or three proximal
truncated curved teeth and diminishing denticles more distally
(fig. 4f). The distomesial face of the propodus of the chelipeds
has two rows of submarginal setae in both species. On the
major cheliped of C. kensleyi, these setae align in two separate
groups of c. 10 and c. 6 setae (figs 6d, 12c); on the minor
cheliped, the setae align 1n two scarcely separate groups of c.
20 and c. 8 setae (fig. 6f; Dworschak, 2005: fig. 3a, c). On both
chelipeds of C. bulimba, distomesial setae align in two widely
separate groups of c. 9 setae each (fig. 4h). The distolateral
propodus of the chelipeds is granulated in a concavity at the
base of the fingers in some individuals of both species but 1s
absent on others, especially smaller specimens.
The two males identified here as C. kensleyi possess a
male pleopod 1 typical of several species of Calliaxina and
Eucalliaxiopsis: C. novaebritanniae, C. paradoxa, C.
punica, C. sakaii, Eucalliaxiopsis jonesi (Heard, 1989), E.
mcilhennyi (Felder and Manning, 1994) and E. panglaoensis
(all with a broad article 2, appendix interna and curved apex;
see fig. 7h, | and earlier papers (Dworschak, 2006, 2014;
Felder and Manning, 1994; Heard, 1989; de Saint Laurent
and Manning, 1982; ). As noted above, the male pleopod | of
C. bulimba differs from all of these, its second article lacking
an appendix interna and distal curved apex. The appendix
masculina on pleopod 2 of C. kensleyi 1s narrower than that
of C. bulimba.
sakai (2017) 1ncluded C. kensleyi 1n Eucalliax although
Indo-West Pacific and Australian Eucalliacidae 9
SSS uw. "m moo aa n o A sih T ji) f
a LLL
. ÁL z | AS UC |
[77 / ff // |
EN
N TCCT IAA
Wihhh
d-g
a-c, h
Figure 6. Calliaxina kensleyi. Madagascar, MNHN-IU-2014-10476 (female): a, anterior carapace, eyestalks; b, thoracic sternite 7; c, pleonal
sternite | (anterior uppermost); d, e, major cheliped (right), mesial, lateral views, with detail of mesial setae on propodus; f, g, minor cheliped
(left), mesial, lateral views, with detail of mesial setae on propodus. Scale bars = 1 mm.
10
Z
^ j - Ap p 7 oJ 9, //
77 WZ Z 4 E y A
cg 77 A A;
G.C.B. Poore
Ay
f
Figure 7. Calliaxina kensleyi. Saudi Arabia, UF 36699 (male): a, anterior carapace, eyestalks, antennule, antenna; b, maxilliped 3, exopod, basis,
ischium; c, telson, uropod; d, major cheliped (left), mesial view; e, major cheliped fingers (left), lateral view; f, minor cheliped (right), mesial view;
e, minor cheliped fingers (right), lateral view; h, 1, pleopods 1, 2. Madagascar, MNHN-IU-2014-8084 (male): J, pleopod 1. Scale bars = 1 mm.
the species has all the features of Calliaxina, however
diagnosed. His figure 2A-C, E-G of material from the Red
sea resembles the types from the nearby type locality, Aqaba.
His figure 2D of the cheliped of a female from Ambon has a
curiously triangular carpus. The location suggests C. bulimba,
a species he did not mention. He referred to E. kensleyi as
being from Aqaba and Moreton Bay (Calliaxina bulimba 1s
from Moreton Bay, Qld) but listed the type locality as Alona
Beach, the Philippines (the type locality of E. panglaoensis
Dworschak, 2006). The species was not listed by Sakai (2011).
Calliaxina novaebritanniae (Borradaile, 1900)
Figures Id, e, 8—10, 12d, e, j
Callianassa novae-britanniae Borradaile, 1900: 419, pl. 39 figs
]4a-d.
Callianassa (Callichirus) novae-britanniae.—Borradaile, 1903:
Indo-West Pacific and Australian Eucalliacidae 11
TZ
P g
m, details
Figure 8. Calliaxina novaebritanniae. Australia, NMV J71677 (female, 11.5 mm): a, carapace, pleon, dorsal; b, carapace, lateral; c, d, anterior
carapace, eyestalks, antennule, antenna, dorsal and lateral views; e, thoracic sternite 7; f, pleonal sternite 1; g, telson, uropod; h, maxilliped 3; 1,
maxilliped 3, crista dentata, basis, ischium; J, major cheliped (right), mesial with detail of merus margin, distal propodus; k, major cheliped
(right), distal propodus, dactylus, lateral; 1, minor cheliped (left), mesial view, with detail of merus margin, distal propodus; m, minor cheliped
(left), fixed finger, lateral. Scale bars = 1 mm.
12 G.C.B. Poore
LoL "
BE LBL 4
Eur rr y
2d eg igi” :
a AEE Da
f E
(- (Pc 6-6 c.
COC.
renr rer ae
(One
oF fe
tw e
Figure 9. Calliaxina novaebritanniae. Australia, NMV J71677 (female, 11.5 mm): a—c, pereopods 2—4; d, e, pleopods 1, 2. NMV J71678 (male,
8.7 mm): f, anterior carapace, eyestalks; g, telson; h, i, major cheliped (right), propodus, dactylus, mesial and lateral; j, k, minor cheliped (left),
propodus, dactylus, mesial and lateral; l, m, pleopods 1, 2. Scale bars = 1 mm.
Indo-West Pacific and Australian Eucalliacidae
Figure 10. Calliaxina novaebritanniae. Papua New Guinea, MNHN-IU-2014-8837 (male, 4.0 mm): a, anterior carapace, eyestalks, antennule,
antenna; b, pleonal sternite 1, right pleopod l(anterior uppermost); c, telson, uropod; d, maxilliped 3; e—g, pereopods 2—4; h, 1, pleopods 1, 2.
French Polynesia, UF 23954 (female, 5.1 mm): j, anterior carapace, eyestalks, antennule, antenna. Scale bars = 1 mm.
547.— Borradaile, 1904: 753. — De Man, 1928a: 48.—De Man, 192S8b:
29, 92, 93, 114 (part).
Calliax novaebritanniae.— de Saint Laurent and Manning, 1982:
211—224, figs 1c, 2b, 6c.— Sakai, 2005: 202.
Paraglypturus novaebritanniae.— Sakai, 1999: 123, fig. 32d-f.
Calliaxina novaebritanniae.—Ngoc-Ho, 2003: 493.— Sakai,
2011: 500—501.—Dworschak, 2018: 17-19, fig. 1b, c (synonymy,
notes). — Poore et al., 2019: 126, 127, 146.— Robles et al., 2020.
Calliaxina xishaensis Liu and Liang, 2016: 83—87, figs 1, 2. Syn.
nov.
not Callianassa (Callichirus) novaebritanniae.— Sakai, 1966: 161—
171 (record from Japan = C. sakaii [de Saint Laurent, 1979]).
not Callianassa (Callichirus) novaebritanniae var.—De Man,
1928b: fig. 20 (= C. punica [de Saint Laurent and Manning, 1982] fide
de Saint Laurent and Manning [1982]).
Material examined. Papua New Guinea. Madang Province, lagoon,
05° 10.2' S, 145? 50.4' E, 1-3 m (PAPUA NIUGINI stn PR243), MNHN-
IU-2013-7062* (ovigerous female, cl. 8.8 mm). New Ireland Province,
Nago Island, 02° 36.3' S, 150° 46.2' E, 3-12 m (KAVIENG 2014 stn
KRO6), MNHN-IU-2014-8837* (male, 4.0 mm); MNHN-IU-2013-7941*
(female, c. 4.0 mm).
French Polynesia, Moorea Island, NW motus, in channel between
14
islands and beach, 17.488393° S, 149.91342° W (stn BIZ-148), UF
23954 (female, 5.1 mm)
Australia, Qld, Great Barrier Reef. Myrmidon Reef, 18.27° S,
147.38* E, October 1985: lagoon with “Callianassa” mounds, 8 m, (M.
Riddle stn M/10/1), NMV J71677 (female, 11.6 mm); NMV J71678
(male, 8.7 mm); NMV J71669 (2 males, 8.4 mm; 6 ovigerous females,
6.9-10.3 mm; 1 female, 9.4 mm). Myrmidon Reef, 18.27? S, 147.38° E,
October 1985: shallow lagoon, 4 m, (M. Riddle stn M/10/2), NMV
J71670 (2 males, 11.1 mm; 3 ovigerous females, 10.4 mm); outer reef
flat, 2 m, (M. Riddle stn M/10/3), NMV J71673 (3 males). Rib Reef,
18.48" S, 146.56" E, October 1985: reef flat, 4 m, (M. Riddle stn
R/10/2), NMV J71671 (4 males; 16 females). reef flat, 8 m, (M. Riddle
stn R/10/1), NMV J71675 (6 males, smallest 5.5 mm; 4 females).
Lizard Island, 50 m W of Loomis beach, 14.6816? S, 145.4515? E, (stn
AUST-S 1-036), UF 16947 (ovigerous female, 9.0 mm). Lord Howe
Island, Old Settlement Beach, 31.5? S, 159.1? E (stn LHI 2017 059),
AM P.100430 (2 males, 11.9 mm, 14.6 mm).
Diagnosis. Sternite 7 with transverse groove visible only laterally,
anteromedial lobe rounded. Antennule peduncle reaching to
midpoint of antenna peduncle article 5. Maxilliped 3 exopod
reaching third to half-way along ischium (juveniles only) or
reaching to mid-merus. Major cheliped merus, lower margin with
2 or 3 proximal truncate teeth; propodus distomesial margin with
setae aligned in 2 similar groups of c. 9 setae each. Male pleopod
l article 2 twice as long as wide; appendix interna prominent.
Description of female. Carapace scattered with small shallow
depressions; gastric-abdominal regions together 4.6 times as long
as wide; branchiostegite calcified over dorsal half, separate from
wide ventral uncalcified anterior region and narrower triangular
uncalcified posterior section, the two separated from each other
by squarish calcified plate; posteroventral area without small
calcified plates; cervical groove at 0.57 carapace length, scarcely
obvious on branchiostegite; cardiac sulcus at 0.73 carapace length,
not meeting mid-dorsally, extending obliquely anteroventrally to
lower limit of calcified branchiostegite.
Thoracic sternite 7 1.35 times as long as wide, with well-
defined median sulcus over posterior third, smooth over medial
half, lateral ridge anterior to coxal articulation ending in pit at
quarter of width, with 5 posterolateral clusters of long setae.
Rostrum broadly triangular, length about 0.25 width of
eyestalks. Anterolateral carapace lobe half as long as rostrum,
with rounded apex, dorsal anterolateral margin oblique in
dorsal view as far back as anterodorsal angle of
branchiostegite, with c. 10 submarginal dorsal setae. Pleonites
1—6 lengths relative to cl: 0.42 : 0.47 : 0.30 : 0.30 : 0.32 : 0.47;
pleonite 1 with strong dorsal transverse groove, with pair of
oval sternal plates supporting pleopods, each with lateral row
of c. 20 setae; pleonites 3—5 with lateral tufts of setae; pleonite
6 with 8 lateral rows of setae.
Eyestalk 1.85 times as long as wide at base, tapering slightly
to cornea, then more rapidly to subacute apices, sometimes
with minute mesiodorsal tubercle; cornea round, slightly
domed, 0.6 width of maximum eyestalk width. Antennular
peduncle 2.5 times as long as width of both eyestalks; article 2
3 times as long as wide; article 3 0.6 length of article 2; articles
2 and 3 with ventrolateral row of long setae, continued onto
flagellum. Antennal peduncle 3.2 times as long as width of both
eyestalks, overreaching antennule peduncle by all of article 5;
G.C.B. Poore
scaphocerite ovoid, longer than wide; article 4 c. 7 times as long
as wide; article 5 half as long as article 4. Maxilliped 3 exopod
reaching to midpoint of merus; ischium with convex mesial
margin, expanding from narrow proximomesial corner;
ischium-merus 1.8 times as long as greatest width; crista
dentata of c. 25 even denticles on basis and ischium; carpus-
dactylus together as long as ischium—merus.
Chelipeds subequal, major 1.1 length of minor. Major
cheliped ischium c. 2.2 times as long as distal width, lower
margin with truncate denticles becoming more distinct distally;
merus 2.6 times as long as broad, lower margin with 4—5
truncate proximal denticles, diminishing distally; carpus 1.5
times as wide as upper length, margins carinate; propodus
ereatest width in middle of palm, as wide as upper palm length,
distomesial margin of palm with 2 submarginal groups each of
c. 8 setae plus nearby granules, distolateral margin of palm with
submarginal group of c. 10 setae between fingers; fixed finger
half as long as upper margin of palm, cutting edge with
microdenticles over proximal half, blunt triangular tooth third
way along; dactylus as long as fixed finger, twice as long as wide
at base, cutting edge concave over proximal half; submarginal
tufts of long setae on upper and lower mesial margins of carpus
and propodus, opposing mesial margins of fingers.
Minor cheliped ischium c. 2.3 times as long as distal width,
lower margin with truncate denticles becoming more distinct
distally; merus 1.7 times as long as broad, lower margin with
4—5 truncate proximal denticles, diminishing distally; carpus
1.5 times as wide as upper length, margins carinate; propodus
palm more evenly wide than major, 1.1 times as wide as upper
palm length, distomesial margin of palm with 2 submarginal
groups of c. 10 and c. 12 setae, distolateral margin of palm with
submarginal group of c. 10 setae, plus 2 smaller groups further
from margin between fingers; fixed finger 0.4 times as long as
upper margin of palm, mesial cutting edge with microdenticles,
blunt proximal tooth, lateral cutting edge microdenticulate
defining edge of lateral concavity at base of fixed finger, filled
with granules; dactylus overreaching fixed finger, 3 times as
long as wide at base, cutting edge curved; submarginal tufts of
long setae on upper and lower mesial margins of carpus and
propodus, opposing mesial margins of fingers.
Pereopod 2 merus 2.2 times as long as maximum width;
dactylus c. 3 times as long as upper margin of propodus.
Pereopod 3 merus twice as long as maximum width; carpus as
long as wide; propodus with strongly concave lower margin,
twice as long as mid-length; dactylus 2.5 times axial length of
propodus. Pereopod 4 merus 2.3 times as long as maximum
width; carpus 2.5 times as long as wide; propodus typically
setose, with 2 long distal setae overlapping dactylus.
Pleopod 1 article 1 without distal projection beyond article
2; article 2 longer than article 1. Pleopod 2 endopod 2.5 times as
long as wide; appendix interna about quarter length of endopod.
Uropodal endopod ovoid, anterior margin more convex
than posterior margin, widest about third way along, 1.5 times
as long as wide, with subdistal facial group of c. 8 long setae;
exopod 2.4 times as wide as long (length measured from
peduncle to anterior point of dorsal plate), distal and posterior
margins typically setose, with c. 20 blade-like setae near end of
posterior margin; dorsal plate extending almost over half of
Indo-West Pacific and Australian Eucalliacidae
exopod width, posterior margin with spiniform setae. Telson
1.7 times as wide as long, broadest at mid-length, posterolateral
corner more sharply rounded than lateral and posterior margins;
posterior margin convex, with lateral lines of long setae; dorsal
surface with median row of long setae at anterior quarter.
Adult male. As in female except as follows. Major cheliped
propodus, distomesial margin of palm with 2 submarginal groups
each of c. 8 setae, fixed finger with proximal mesial and lateral
eranulate ridges; dactylus cutting edge with basal blunt tooth.
Minor cheliped propodus, distomesial margin of palm with
2 submarginal groups of c. 12 and c. 15 setae, distolateral margin
of palm with submarginal groups of c. 30 and c. 15 setae; lateral
concavity at base of fixed finger, filled with numerous granules.
Pleopod 1 article 1 twice as long as greatest width; article
2 2.3 times as long as wide, appendix interna acute, without
hooks, subdistal lobe small, distal curved lobe acute,
occupying about third of whole. Pleopod 2 endopod 2.3 times
as long as wide; appendix masculina attached at c. 0.4 of
length, 3.5 times as long as distal width, distal margin convex-
truncate reaching 0.9 length of endopod, with c. 20 facial
setae near midpoint, c. 15 subdistal setae; appendix interna
rod-like, with hooks, about fifth length of appendix interna.
Variation. Branchiostegite always divided by oblique
longitudinal edge between calcified dorsal region and variously
uncalcified ventral region, always with midventral rectangular
plate, sometimes with posteroventral tessellated pattern (Sakai,
1999: fig. 32e), sometimes more or less calcified, often not
calcified. Rostrum more acute in smaller specimens (figs 3a, J).
Cornea larger in smaller specimens (fig. 3J). Maxilliped 3 exopod
reaching mid-ischium in some small specimens. Minor cheliped
propodus fixed finger proximal concavity variously granulate.
Colour. Exoskeleton mostly translucent white, middle of
branchiostegites pink (fig. Id, e).
Distribution. Papua New Guinea, Madang, New Britain (type
locality) and New Ireland provinces; Indonesia, Sulawesi, Bali;
Australia, N Qld; Philippines, Pulawan; French Polynesia.
Lagoon sediments, to 12 m.
Remarks. Calliaxina novaebritanniae 1s unique in the Indo-West
Pacific in having the exopod of maxilliped 3 reaching to the
middle of the merus in adults. Small genetic differences were
found between the pair from Nago Island (New Britain), one
from Madang, one from Palawan, Philippines (NHMW 25366),
and one from Indonesia (NHMW 25783) (Robles et al., 2020).
Nago Island and Madang, Papua New Guinea, are not far distant,
west and east respectively, from the type locality. Morphological
differences between them, the female from French Polynesia and
the large collection from the Great Barrier Reef, Australia, are
small. The telson and uropod of adults are the same, all have a
sulcus on the carapace. The maxillipedal 3 exopod reaches to
mid-merus except in two small specimens where it 1s shorter
than 1n adults, a phenomenon noted by Liu and Liang (2016) in
C. xishaensis. The rostrum is sharper and the eyestalks more
rounded in smaller specimens. Article 2 of pleopod 1 of the
holotype has two similar distal lobes on its 1nner margin (one the
appendix interna) and an apex strongly curving mesially (de
15
saint Laurent and Manning, 1982: fig. 6). The appendix interna
and second subdistal lobe are less developed in all the Australian
males in this collection (fig. 91). A juvenile male from Papua New
Guinea has a simple pleopod | with three obsolete distal lobes
(fig. 10hb), indicating that this limb metamorphoses with maturity.
The male pleopod 2 has a broad appendix masculina, with distal
and subdistal clusters of long setae, and appendix interna midway
on the endopod (fig. 101).
Calliaxina novaebritanniae co-occurs in one sample from
the Great Barrier Reef with individuals of C. bulimba trom
which it 1s difficult to distinguish at first glance. However, the
exopod of maxilliped 3 reaches to the middle of the merus in
most C. novaebritanniae but 1s vestigial 1n all C. bulimba.
The eyestalks of C. novaebritanniae are narrower than in C.
bulimba (almost twice as long as wide vs 0.8 times as long as
wide in adults) the antennal peduncles are narrower
(antennular peduncle article 2 3.5 times as long as wide vs
twice; antennal Ipeduncle article 4 6 times as long as wide vs
3 times). The telson of C. novaebritanniae is widest at its
midpoint whereas in C. bulimba it tapers from the base,
although the taper is less obvious in juveniles. Pereopods of
C. novaebritanniae are relatively broader than in C. bulimba
(meri of pereopods 2 and 3, 2.5 and 2.0 times as long as wide
vs 2.2 and 2.4 times). The rostrum is more acute in larger C.
novaebritanniae than in similarly sized C. bulimba but is
more acute in small specimens of both species.
Borradaile (1900) based his description on a single male of
total length 37 mm from New Britain (Papua New Guinea).
The holotype was illustrated by Borradaile (1900), de Saint
Laurent and Manning (1982) and Sakai (1999).
Notwithstanding the species’ long and complicated synonymy,
the material listed here and that from the Philippines and
Indonesia (Dworschak, 2018) are the first reported since. De
Man (1928a) described and illustrated a specimen he identified
as a variety of C. novaebritanniae; this was described as
Calliax (now Calliaxina) punica by de Saint Laurent and
Manning (1982), type locality, Salammbo, Gulf of Tunis. De
Man (1928b) identified material from the Maldives as C.
novaebritanniae; this was identified by Sakai (1999) as Calliax
(now Eucalliaxiopsis) aequimana (Baker, 1907) but is almost
certainly E. inaequimana (Dworschak, 2014).
In as far as can be decided from descriptions, C.
novaebritanniae 1s indistinguishable from C. xishaensis Liu
and Liang, 2016. The latter was described from two females
from the South China Sea, not far from Palawan, Philippines. A
specimen from this locality (NHMW 25360) was found to be
genetically similar to those from Papua New Guinea (the type
locality) and Indonesia, suggesting that the species has a wide
distribution. Calliaxina xishaensis is here synonymised with C.
novaebritanniae. Calliaxina sakaii 1s close by in Japan but is
morphologically and genetically quite remote (see below and
Robles et al., 2020).
Sakai’s (1999) designation of the holotype as a lectotype
was unnecessary.
16
Calliaxina sakaii de Saint Laurent in de Saint Laurent and
Le Loeuff, 19779
Figures 11, 12f, g
Callianassa (Callichirus) novaebritanniae.—Sakai, 1966): 161-
168, figs 1—4.
Calliax sakaii de Saint Laurent in de Saint Laurent and Le Loeuff,
1979: 95.— de Saint Laurent and Manning, 1982: 212, 222—223, figs
1g, 2c.— Sakai, 1987: 305—306.— Sakai, 2005: 203.
Paraglypturus sakaii.— Sakai, 1999: 124, fig. 33d, e.
Calliaxina sakaii.—Ngoc-Ho, 2003: 489, 493, 496, fig. 20J.—
Sakai, 2011: 502.— Sakai, 2018: 739.
Material examined. Japan, Tomioka, MNHN Th312 (holotype male,
10mm), MNHN Th313 (female), NMV J59763 (male, 6.7 mm; female,
7.0 mm; ex ULLZ-8894*).
Diagnosis. Sternite 7 with complete transverse V-shaped
groove, anteromedial lobe acute. Antennule peduncle reaching
to base of antenna peduncle article 5. Maxilliped 3 exopod
reaching third to half-way along ischium. Major cheliped
merus, lower margin with several proximal teeth; propodus
distomesial margin with setae aligned in 4 groups of 10, 5, 7
and 4 setae. Male pleopod | article 2 3 times as long as wide;
appendix interna prominent.
Remarks. Differences between C. sakaii and the more widespread
C. novaebritanniae were confirmed by re-examination of the
holotype and more recently collected material. The male pleopod
l has a bilobed proximal lobe and pleonal sternite | has a pair of
oval plates supporting the pleopods, both similar to C
novaebritanniae. |Calliaxina | sakaii differs from C.
novaebritanniae in the exopod of maxilliped 3 reaching half the
length of the ischium (vs overlapping the merus), a more acute
rostrum, fully calcified branchiostegites (vs weakly chitinised
over the lower half), having a deep sharp transverse groove on
thoracic sternite 7 (vs an obsolete ridge) and the posterior margin
of the telson concave (convex). The distomesial margin of the
propodus of the major cheliped has four groups of 4-10
submarginal setae, two groups on the minor cheliped (vs two
eroups on both chelipeds). A lateral concavity at the base of the
fixed finger is defined by a lower ridge on both chelipeds.
The species was described briefly in footnote number 14
by M. de Saint Laurent alone in de Saint Laurent and Le
Loeuff (1979).
Eucalliaxiopsis Sakai, 2011
Eucalliaxiopsis Sakai, 2011: 503—504.— Poore et al., 2019: 127—
128 (synonymy).
Remarks. Eucalliaxiopsis differs from Calliaxina in having a
strong ridge across the telson, lacking an exopod on maxilliped
3 (with one exception), the appendix masculina overlapping the
endopod of pleopod 2, and in the major cheliped of the male
usually being more robust, the palm longer and wider, than that
of the female. In Calliaxina, the telsonic ridge is absent or
obsolete, maxilliped 3 always possesses an exopod, the appendix
masculina does not reach the apex of the endopod of pleopod 2,
and chelipeds of males and females are not differentiated from
each other nor scarcely from the minor chelipeds. In as much as
G.C.B. Poore
can be deduced from published illustrations, the lower margin
of the merus of the chelipeds is smooth or with small tubercles
at its midpoint in Eucalliaxiopsis, whereas this margin bears
small proximal truncate teeth in Calliaxina. The post-rostral
dorsal area of some species of Eucalliaxiopsis (E. aequimana,
E.madagassa) has a broad median longitudinal ridge, seen also
in Eucalliax quadracuta (Biffar, 1970).
Eucalliaxiopsis includes seven species from the Indo-
West Pacific, of which three are newly described here, plus
three species from the Western Atlantic: E. cearaensis
(Rodrigues and Manning, 1992) from Brazil, E. jonesi from
the Bahamas and E. mcilhennyi from Florida, USA. The
species identified as EF. HWI from Hawaii by Robles et al.
(2020), which is genetically quite separate from six other
species, was not available for study.
Eucalliaxiopsis panglaoensis, E. dworschaki and E.
paradoxa, the last two being new species described here,
differ from the others. All possess a transverse telson ridge
beset with a row of short spiniform setae, a distally excavate
uropodal endopod, a cheliped carpus with two distal spines
on the upper margin, two mesiodistal lobes near the apex of
the lower lateral margin plus a submarginal distal ridge on the
mesial face. The carpus is similar to that of Eucalliax
quadracuta, sole member of its genus. The first two of this
eroup were found to be sister taxa by Robles et al. (2020) but
the others were not monophyletic.
Calliaxiopsis Sakai and Türkay, 2014, was synonymised
with Calliaxina by Poore and Dworschak (2017). Bakercalliax
Sakai, 2018, Heardcalliax Sakai, 2018, and Manningcalliax
Sakai, 2018, were all differentiated from Eucalliax, Calliaxina
and from each other largely on the basis of the male pleopod 1
but also on the relative sizes of the appendices interna and
masculina of pleopod 2. All were synonymised with
Eucalliaxiopsis by Poore et al. (2019), who argued that similar
forms of the male pleopod 1 are found in Eucalliaxiopsis and
Calliaxina and that some of the forms used as generic
characters by Sakai (2018) are characteristic of juveniles.
Key to Indo-West Pacific species of Eucalliaxiopsis
|. Telson with row of spiniform setae on transverse ridge;
cheliped carpus with 2 short grooves perpendicular to
distolateral margin near lower apex; uropodal endopod
with apical concavity 2
— Telson without spiniform setae on transverse ridge;
cheliped carpus distolateral margin smooth; uropodal
endopod ovate 4
2. Cheliped carpus upper margin with proximal hook and
subproximal submesial pit; cheliped propodus lateral face
with longitudinal ridge extending from near carpus to
base of finger; uropodal endopod with 8 short setae
between apical clusters; widespread in Indo-West Pacific
E. dworschaki sp. nov.
— A Cheliped carpus upper margin smooth; cheliped propodus
lateral face with longitudinal ridge extending proximally
slightly from base of finger; uropodal endopod with 10—
1] short setae between apical clusters 3
Indo-West Pacific and Australian Eucalliacidae
u g W 1 i NNNM N AAN
Figure 11. Calliaxina sakaii. Japan, NMV J59763 (male, 6.7 mm): a, telson, uropod; b, thoracic sternite 7; c, pleonal sternite | (anterior uppermost);
d, pleopod 1; e, f, major cheliped propodus, dactylus (right), mesial, lateral views; g, h, minor cheliped propodus, dactylus (left), mesial, lateral
views. Scale bars = | mm.
Chelipeds asymmetrical in male, major cheliped
propodus longer than wide and longer than in female;
distolateral lobe above lower margin of cheliped carpus
with acute apex, ridged, oblique; Philippines, Japan
E. panglaoensis (Dworschak, 2006)
9 9$890998989899296098909948900892849828696899539a490290894092969€809658928929€498
Chelipeds similar in both sexes, major cheliped palm little
longer than wide; distolateral lobe above lower margin of
cheliped carpus with rounded apex, longitudinally
grooved, perpendicular; NE Australia |...
E. paradoxa sp. nov.
892899 9999988399599299899292895929929240989935399»94€998599292988539295992993928929993999998853992949989499922252959929895395^»9*996
Maxilliped 3 with exopod; cheliped merus lower margin
with 2 denticles at midpoint, fixed finger with row of
equally spaced setae along lateral ridge; telson with
rounded posterior margin; female pleopod 2 with free
extension beyond rami; Madagascar s
E. madagassa (Sakai and Türkay, 2014)
Maxilliped 3 without exopod; cheliped merus lower
margin smooth, fixed finger with clusters of setae along
lateral ridge; telson with truncate or excavate posterior
margin; female pleopod 2 without extension beyond rami .
9989999999998 999909020849999892824883590989299982809992492929082984929258098839$9069908990924890060892860825898402599*92950929994€4909882€009260592282992929989296949899*90298€9092905849.849929898583964?538399€8906G8€€€900282924242569982992928€958
Cheliped propodus upper mesial face with row of clusters
of setae without associated transverse ridges; major
cheliped of male upper margin as long as wide, similar to
female; male pleopod | article 1 without distal setae,
article 2 parallel-sided, apically rounded, with marginal
setae, without appendix interna; 5 Australia...
E. aequimana (Baker, 1907)
Cheliped propodus upper mesial face with row of short
transverse ridges associated with clusters of setae; major
cheliped of male upper margin longer than wide,
dissimilar to female; male pleopod 1 not as above 6
18
G.C.B. Poore
pr =
Figure 12. Calliaxina spp. C. bulimba: a, major cheliped, mesial. C. kensleyi: b, c, major cheliped lateral, mesial. C. novaebritanniae: d, major
cheliped, mesial; e, minor cheliped, mesial. C. sakaii: f, g, minor cheliped mesial, lateral. Thoracic sterna: h, C. bulimba; 1, C. kensleyi; j,
C. novaebritanniae. Various scales.
6. Antenna peduncle 3 times as long as base of both eyes,
most of article 5 exceeding antennule; telsonic ridge
sharply elevated, with median notch; uropodal endopod
1.8 times as long as wide; female pleopod 2 without
appendix interna; widespread in Indo-West Pacific ...........
E. inaequimana (Dworschak, 2014)
— Antenna peduncle 2.4 times as long as base of both eyes,
half of article 5 exceeding antennule; telsonic ridge
slightly elevated, complete; uropodal endopod 1.5 times
as long as wide; female pleopod 2 with appendix interna;
Papua New Guinea E. patio sp. nov.
Peo eee heehee HHO HOO H ETE H HOHE H OHH HERE HH ESO HERE H EET
Eucalliaxiopsis aequimana (Baker, 1907)
Figures 13, 14, 25a, b
Callianassa aequimana Baker, 1907: 182-185, pl. 24 figs 1-8.—
Hale, 1927: 87, fig. 83.—Poore and Griffin, 1979: 245, figs 12, 13.
Callianassa (Callichirus) aequimana.— De Man, 1928b: 28, 93, 114.
Calliax aequimana.—de Saint Laurent and Manning, 1982:
222.— Sakai, 1988: 53, 61.— Sakai, 1999: 118—119 (not fig. 31).—Tudge
et al., 2000: 145.—Davie, 2002: 459.— Sakai, 2005: 202.
Eucalliax aequimanus.— Poore, 2004: 184, f1g.50e, f.
Calliaxina aequimana.—Sakai, 2011: 498—499.
Eucalliax aequimana.— Dworschak, 2014: 236, 244, figs 8, Oh, 1.
Bakercalliax aequimana.—Sakai, 2018: 738.
Material examined. Australia. NSW, Balmoral Beach, 33.8? S, 151.3? E,
AM P3636 (male, 20 mm).
Victoria. San Remo, NW from rock outcrop 1.1 km E of Back
Beach Rd (MRG transect 4), 38.53" S, 145.38? E, NMV J59759
(female, 9.6 mm). San Remo, channel bank end, 38.5233* S, 145.363? E,
NMV J59762 (female, 6.6 mm). Port Phillip Bay, Geelong arm, 3 m,
(NMV stn PPBES 953), 38.155? S, 144.545? E, NMV 716782 (4
females, 3.4—4.7 mm).
Tasmania. Waterhouse Island, 3—5 m, 40° 48' S, 147° 38.7' E
(Moverley stn 52), NMV J71685 (juv., 2.9 mm). Georges Bay, Steiglitz
Beach, 3—4 m, 41° 19.3'S, 148° 19.1' E (Moverley stn 42) NMV J71686
(juv., 2.9 mm).
South Australia. Port MacDonnell, 38.05? S, 140.7? E, NMV
Indo-West Pacific and Australian Eucalliacidae 19
WH TTT BN FA 3
Figure 13. Eucalliaxiopsis aequimana. Australia, NMV J71687 (male, 11.0 mm): a, carapace, dorsal view; b, carapace, lateral view; c, d, anterior
carapace, eyestalks, antennule, antenna, dorsal and lateral views; e, eyestalk, lateral view; fh, telson, dorsal, postero-oblique, lateral views; 1, right
uropod; j, maxilliped 3; k, 1, major cheliped (left), mesial and lateral views; m, n, minor cheliped (right), mesial and lateral views. Scale bars = 1 mm.
G.C.B. Poore
Figure 14. Eucalliaxiopsis aequimana. Australia, NMV J71687 (male, 11.0 mm): a, b, d, pereopods 2, 3, 5; e, pleonal sternite 1, right pleopod
l(anterior uppermost); g, h, left pleopods 1, 2, posterior views. NMV J759651 (female, 11.2 mm): c, pereopod 4; f, pleonal sternite 1, right pleopod
1; 1, left pleopod 1, mesial view; J, k, anterior carapace, antennule, antenna, lateral and dorsal views. Scale bars = 1 mm.
J16783 (male, 12.8 mm). Dutton Bay, eastern shore, 34.0489° S,
136.415° E, NMV J71688 (male, 12.2 mm; 3 females, 8.9-11.9 MM),
NMV J59651* (female, 11.2 mm). NMV J71687 (male, 11.0 mm).
Western Australia. Houtmans Abrolhos, WAM C9113 (male, 14.8
mm). Dalkeith, Swan River, WAM C1410 (male, 16.2 mm). Colpoy
Point, Garden Island, 32° 12'S, 115° 40' E, WAM C11975 (female, 14.4
mm). Rockingham, Point Peron, Cockburn Sound, 32° 11'S, 115° 43' E,
WAM C11973 (male, 12.9 mm). Fremantle Harbour, 32° 03' S,
115° 44' E, WAM C12030 (male, 20.3 mm). Mandurah, 32° 32' S,
115° 43' E, WAM C11978 (female, 15.8 mm). Bunbury, 33° 20' S,
115° 38' E, WAM C11990 (female, 10.1 mm). Harbour Board, Bunbury,
WAM C5056 (female, 21.3 mm). Koombana Beach, Bunbury,
33° 20' S, 115° 38' E, WAM C12029 (male, 14.9 mm). Leschenault
Estuary, Bunbury, 33° 20' S, 115° 38' E, WAM C11986 (male, 11.2
mm). Peel Inlet, 32° 36' S, 115° 43' E, WAM C11968 (male, 8.9 mm;
female, 17.6 mm). Albany, 32° 00'S, 117° 52'E, WAM C11994 (female,
13.0 mm). Albany, WAM C6792 (female, 15.9 mm). Cheyne Beach,
WAM C11987 (female, 19.8 mm). King George Sound, MNHN Th578
(female).
Diagnosis. Pleonite | with pleopods attached to pair of sternal
plates. Eyestalk about twice as long as wide. Antennule peduncle
reaching to base of antenna peduncle article 5. Maxilliped 3
exopod absent. Cheliped carpi distolateral margin square at
lower angle, propodi lateral face with oblique longitudinal ridge
extending from beyond mid-length of palm on to base of finger,
upper mesial face with row of clusters of long setae. Male
pleopod 1 article I without distal setae, article 2 parallel-sided,
apically rounded, with marginal setae, without appendix
interna. Female pleopod 2, appendix interna present. Uropod
endopod ovate. Telson without transverse row of spiniform setae.
Description of male. Carapace smooth, with pair of shallow
longitudinal groove posterior to rostrum; gastric—abdominal
regions together 4.5 times as long as wide; branchiostegite
calcified, with tessellated pattern of sulci; cervical groove at
0.6 carapace length, scarcely obvious on branchiostegite;
cardiac sulcus at 0.76 carapace length, not meeting mid-
dorsally, extending transversely across half of branchiostegite,
with complex branches dorsally.
Rostrum blunt or obsolete. Anterolateral carapace lobe
longer than rostrum, with rounded apex, anteriorly directed,
with numerous submarginal dorsal setae.
Thoracic sternite 7 1.15 times as long as wide, with well-
Indo-West Pacific and Australian Eucalliacidae
defined median sulcus over posterior half, lateral groove anterior
to coxal articulation poorly defined, oblique, not meeting medially,
with 3 posterolateral clusters of long setae. Pleonal sternite with
pair of swollen well marked areas anterior to ridge bearing
pleopods; without setae. Pleonite 6 lateral margin smooth.
Eyestalks 1.6 times as long as wide at base, tapering around
cornea, acute apical tubercle sometimes present; cornea
subcircular. Antennular peduncle 2.5 times as long as width of
both eyestalks; article 2 2.5 times as long as wide; article 3 0.6
times as long as article 2; articles 2 and 3 with ventrolateral row
of long setae, continued onto flagellum. Antennal peduncle 3
times as long as width of both eyestalks, overreaching antennule
peduncle by third of article 5; scaphocerite wider than long,
subcircular; article 4 c. 5 times as long as wide; article 5 0.6
length of article 4. Maxilliped 3 ischium with slightly convex
mesial margin, expanding from narrow proximomesial corner;
ischium—merus upper margin 1.5 times as long as greatest
width; crista dentata of c. 25 small teeth; carpus—dactylus
together almost as long as ischium—merus.
Chelipeds subequal, propodus of major cheliped about 1.2
times that of minor, of similar widths, major dactylus stouter
than that of minor. Major cheliped ischium twice as long as
distal width, lower margin with short distal tooth; merus 1.8
times as long as broad, lower margin barely convex, unarmed;
carpus 1.4 times as wide as upper length, upper margin carinate,
distomesial and distolateral margins simple; propodus greatest
width proximally, upper palm length 1.1 width, distomesial
margin of palm with 2 submarginal groups each of c. 10 setae
plus small submarginal bicuspid tooth, distolateral margin of
palm with submarginal group of c. 10 setae between fingers plus
small submarginal tooth; fixed finger half as long as upper
margin of palm, cutting edge with microdenticles over proximal
half, obsolete tooth at midpoint, with obsolete lateral ridge
extending on to palm; dactylus overreaching fixed finger, 2.2
times as long as width at base, cutting edge sinuous; submarginal
tufts of long setae on upper and lower mesial margins of carpus
and propodus, opposing mesial margins of fingers.
Minor cheliped ischium twice as long as distal width,
lower margin with distal tooth; merus twice as long as broad,
lower margin barely convex, unarmed; carpus 1.2 times as
wide as upper length, upper margin carinate, distomesial and
distolateral margins simple; propodus palm as wide as upper
palm length, upper margin carinate, with blunt distal tooth,
distomesial margin of palm with 2 submarginal groups of c. 10
and c. 12 setae, distolateral margin of palm with 2 submarginal
groups of c. 8 and 10 setae; fixed finger half as long as upper
margin of palm, cutting edge smooth, lateral concavity at base
of fixed finger sharply defined by ridge on distal palm; dactylus
barely overreaching fixed finger, 3.8 times as long as wide at
base, cutting edge sinuous; submarginal tufts of long setae on
upper and lower mesial margins of carpus and propodus,
opposing mesial margins of fingers.
Pereopod 2 merus twice as long as maximum width;
dactylus 3 times as long as upper margin of propodus.
Pereopod 3 merus twice as long as maximum width; carpus
1.6 times as long as wide; propodus with lower margin
concave, 1.6 times as long overall as mid-length; dactylus half
axial length of propodus. Pereopod 4 merus length 2.7 times
21
maximum width; carpus 2.7 times as long as wide; propodus
1.5 times as long as wide, typically setose, with | long distal
seta overlapping dactylus.
Pleopod | article | without distal setae; article 2 parallel-
sided, apically rounded, 1.8 times as long as article |, 4 times as
long as wide, apex with c. 10 marginal setae, without appendix
interna. Pleopod 2 endopod 2.4 times as long as wide; appendix
masculina overreaching endopod by about fifth its length, setose
along posterior face and distally; lobe-like appendix interna near
midpoint of appendix masculina. Pleopod 3 with appendix interna
submerged in endopod margin.
Uropodal endopod anterior margin convex, posterior margin
almost straight, widest about third way along, 1.7 times as long
as wide, apex broadly rounded, with 2 groups of long setae at
ends of anterior and posterior margins; exopod ovate, all
margins continuous, greatest dimension 1.5 times greatest width,
with row of blade-like distal setae on distal margin; dorsal plate
extending beyond half of exopod width, distal margin with
spiniform setae. Telson 1.5 times as wide as long, broadest at
midpoint, posterolateral corner rounded; posterior margin
deeply excavate, with posterolateral cluster of long setae plus
short spiniform seta; dorsal surface with sharp transverse ridge
at anterior third, notched and with few long setae at midpoint.
Female. Essentially as male except: pleonal sternite 1 with pair of
oval plates supporting pleopods, each with longitudinal row of 6—8
single setae emerging from pore. Pleopod | peduncle curved, with
dense group of plumose setae; article 2 twice as long as article 1.
Distribution. Australia, NSW (as far north as 33? S), Tas., Vic.,
SA, WA (as far north as 25? S). Intertidal to subtidal sediments.
Remarks. Eucalliaxiopsis aequimana is recognised by the
subequal chelipeds that are not sexually dimorphic. In a sample
of 14 large specimens, the ratio between the upper propodus
margins of major and minor chelipeds ranged from 1.1 to 1.3,
with insignificant difference between males and females. The
species 1s notable for the simple setose article 2 of the male
pleopod 1, longer than article 1, lacking an appendix interna and
acute apex.
The collection from Western Australia includes specimens
with carapace lengths ranging 8.9—20.5 mm, most are larger
than any from South Australia or Victoria, maximum cl. 12.8
mm. They differ most obviously in the near absence of a
prominent rostrum (fig. 13)).
sakars (2005) synonymy includes references to other
species from places outside southern Australia.
Eucalliaxiopsis dworschaki sp. nov.
http://zoobank.org/urn:lsid:zoobank.org:act: ESBF2226-256F-
4EF7-9DEB-DFD6955BB744
Figures If, g, 15—17, 25c-f
Eucalliax panglaoensis.—Dworschak, 2006: 356 (partim), fig.
5.— Kneer et al., 2013: 265.—Dworschak, 2018: 17 (partim; not fig. 1 =
E. panglaoensis).
Calliaxina panglaoensis.—Sakai and Türkay, 2014: 191—192, fig.
12.
Eucalliaxiopsis aff. panglaoensis.— Robles et al., 2020.
22 G.C.B. Poore
Figure 15. Eucalliaxiopsis dworschaki sp. nov. Holotype, MNHN-IU-2014-10003 (male, 8.9 mm): a, b, carapace, pleonite 1, dorsal and lateral
views; c, d, anterior carapace, eyestalks, antennule, antenna, dorsal and lateral views; e, thoracic sternite 7; f, pleonite 1, sternite (anterior
uppermost); g, pleonite 6, right lateral margin, oblique view; h, 1, maxilliped 3; J, maxilliped 3, crista dentata; k, left uropod; |, m, telson, dorsal
and lateral views. Scale bars = 1 mm.
Indo-West Pacific and Australian Eucalliacidae 23
dr P |o tht
T e T
—————————— |
e
|
a-l, p
m, n
O
Figure 16. Eucalliaxiopsis dworschaki sp. nov. Holotype, MNHN-IU-2014-10003 (male, 8.9 mm): a, b, major cheliped (left), mesial and lateral views;
c, d, major cheliped (left), carpus, propodus, dactylus, upper and lower views; e, f, minor cheliped (right), mesial and lateral views; g, h, minor
cheliped (right), carpus, propodus, dactylus, upper and lower views; 1-1, pereopods 2—5; m, right pleopod 1, mesial view; n, right pleopod 2, anterior
view; o, appendices masculina, interna, posterior view; p, right pleopod 3, posterior view. UF 28877 (male, 6.0 mm): q, pleopod 1. Scale bars = 1 mm.
24 G.C.B. Poore
Figure 17. Eucalliaxiopsis dworschaki sp. nov. Paratype, MNHN-IU-2017-1351 (female, 8.2 mm): a, b, major cheliped (right), mesial and lateral
views; c, carpus, lower distolateral margin, detail; d, e, minor cheliped (left), mesial and lateral views; f, carpus, lower distolateral margin, detail;
g, pleonite 1; h, pleonal sternite 1, left pleopod 1 in situ (anterior uppermost); 1, left pleopod 1, anterior view; J, k, left pleopod 2, posterior view,
lateral view of peduncle. Scale bars = 1 mm.
Indo-West Pacific and Australian Eucalliacidae
Material examined. Holotype. Papua New Guinea, New Ireland, NW
corner of Little Nusa Island, sand, 0-1 m, 02° 34.9' S, 150° 46.8' E
(KAVIENG 2014 stn KM13), MNHN-IU-2014-10003* (male, 8.9 mm).
Paratypes. Papua New Guinea. Collected with holotype, MNHN-
[U-2017-1351 (female, 8.2 mm). Madang Province, Riwo, mangrove,
05* 09' S, 145° 48.2' E, 1-2 m (PAPUA NIUGINI stn PR235), MNHN-
[U-2013-7081 (female, 7.3 mm).
French Polynesia, Moorea, Papetoai, near 17.49" S, 149.88° W: stn
BIZ-463, UF 28782* (female, 8.4 mm); stn BIZ-493, UF 28930 (female,
4.4 mm); stn BIZ-539, UF 28878* (male, 7.9 mm), UF 28877* (male,
6.0 mm); stn MIB-208, UF 16416 (female, 6.7 mm); stn MIB-195, UF
16286 (male, 8.8 mm); stn MIB-227, UF 16531 (male, 5.4 mm). Off
Nihimaru River estuary, 17.533° S, 149.9045° W, stn MIB-098, UF
15946 (male, 2.9 mm).
Other material. Australia, Qld, Great Barrier Reef, Myrmidon
Reef, 18.27? S, 147.38° E, October 1986: lagoon with “Callianassa”
mounds, 4 m, (M. Riddle stn M/10/2), NMV J71681 (male, 8.4 mm); 8
m, (M. Riddle stn M/10), NMV J71682 (female, 9.2 mm).
Marianas Island, W coast of Guam, near Fisheye Marine Park,
seagrass bed, 0.2-0.5 m (stn AA05), UF GUOK 10-0378, (male, 3.7
mm).
Madagascar, Toliara (as Tuléar), Thomassin stn 678, MNHN-
[U-2016-8083 (female, 8.9 mm).
Diagnosis. Pleonite 1 with pleopods attached to pair of sternal
plates. Eyestalk about twice as long as wide. Antennule peduncle
reaching to midpoint of antenna peduncle article 5. Maxilliped 3
exopod absent. Cheliped carpi distolateral margin with 5 rounded
lobes near lower margin separated by submarginal grooves
parallel to lower margin, second lobe with slight median
depression, propodi lateral face with horizontal longitudinal
ridge extending from near carpus to base of finger, upper mesial
face with row of clusters of long setae. Male pleopod | article |
linear, with distal setae; article 2 blade-like with subapical medial
notch. Female pleopod 2, appendix interna absent. Uropod
endopod ovate with excavate apex. Telson with row of spiniform
setae on ridge.
Description of holotype male. Carapace length 8.9 mm,
smooth; gastric-abdominal regions together 4.7 times as long
as wide; branchiostegite fully calcified; cervical groove at 0.60
carapace length, scarcely obvious on branchiostegite; cardiac
sulcus at 0.77 carapace length, not meeting mud-dorsally,
extending transversely across third of branchiostegite.
Rostrum acute, tapering to narrow tip, length about 0.4
width of eyestalks. Anterolateral carapace lobe almost as long
as rostrum, with rounded apex, anteriorly directed, with
numerous submarginal dorsal setae.
Thoracic sternite 7 1.2 times as long as wide, with well-
defined median sulcus over posterior half, lateral groove
anterior to coxal articulation well defined, oblique, meeting
medially, with 3 posterolateral clusters of long setae. Pleonal
sternite 1 with pair of swollen relatively unchitinised areas
anterior to ridge bearing pleopods; without setae. Pleonite 6
with small lateral blunt hook-like process at midpoint.
Eyestalks twice as long as wide at base, tapering to cornea
and acute apical tubercle; cornea subcircular. Antennular
peduncle 3 times as long as width of both eyestalks; article 2
3.5 times as long as wide; article 3 half as long as article 2;
articles 2 and 3 with ventrolateral row of long setae, continued
onto flagellum. Antennal peduncle 3.4 times as long as width
29
of both eyestalks, overreaching antennule peduncle by most
of article 5; scaphocerite wider than long, with acute apex;
article 4 c. 5 times as long as wide; article 5 0.65 length of
article 4. Maxilliped 3 ischium with slightly convex mesial
margin, expanding from narrow proximomesial corner;
ischium—merus upper margin 1.6 times as long as greatest
width; crista dentata of 12 spines, the most proximal reflexed;
carpus—dactylus together almost as long as ischium-merus.
Chelipeds unequal, of similar lengths, propodi of similar
widths, major dactylus stouter than that of minor. Major cheliped
(left in holotype) ischium twice as long as distal width, lower
margin with short spines becoming more distinct distally; merus
1.8 times as long as broad, lower margin mostly straight,
unarmed; carpus 1.4 times as wide as upper length, upper margin
carinate, with proximal hooked tooth, subproximal mesial pit,
distal tooth, distomesial margin with prominent lobe near lower
margin, distomesial face with lower submarginal ridge,
distolateral margin with rounded notch near upper margin, with
3 rounded lobes near lower margin separated by submarginal
erooves parallel to lower margin, second lobe with slight median
depression, 2 short setae in lower groove; propodus greatest
width in middle of palm, upper palm length equal to greatest
width, upper margin carinate, with rounded lobe projecting over
dactylus, lower margin carinate, strongly curved mesially, mesial
face with short distal uneven setose ridge below upper margin,
distomesial margin of palm almost straight, lateral face of palm
with prominent ridge running from tubercle near proximal
margin on to finger, oblique row of tubercles at proximal end of
ridge, each perforated for cluster of setae; fixed finger half length
of upper margin of palm, cutting edge with denticles over
proximal half, blunt triangular tooth at about midpoint; dactylus
as long as fixed finger, twice as long as wide at base, cutting edge
with blunt molar, with deflected tip; submarginal tufts of long
setae on upper and lower mesial margins of carpus and propodus,
opposing mesial margins of fingers.
Minor cheliped (right in holotype) ischium twice as long as
distal width, lower margin with distal spine; merus 1.7 times as
long as broad, lower margin mostly straight, unarmed; carpus
1.4 times as wide as upper length, upper margin carinate, with
proximal hooked tooth, subproximal mesial pit, distal tooth,
distomesial face with lower submarginal ridge, distolateral
margin with notch near upper margin, with 3 lobes near lower
margin separated by perpendicular submarginal grooves,
middle lobe apex rounded, with shallow median groove, 3
short setae in lower groove; propodus greatest width in middle
of palm, upper palm length equal to greatest width, as wide
distally as proximally, upper margin carinate, overhanging
mesial face, with rounded lobe projecting over dactylus, lower
margin carinate, strongly curved mesially, distomesial margin
of palm almost straight, lateral face of palm with prominent
ridge running from tubercle near proximal margin on to finger,
oblique row of tubercles at proximal end of ridge, each
perforated for cluster of setae; fixed finger 0.7 length of upper
margin of palm, width at base half width of palm, cutting edge
smooth; dactylus as long as fixed finger, 3.5 times as long as
wide at base, cutting edge straight; submarginal tufts of long
setae on upper and lower mesial margins of carpus and
propodus, opposing mesial margins of fingers.
20
Pereopod 2 merus twice as long as maximum width;
dactylus c. 2.5 times as long as upper margin of propodus.
Pereopod 3 merus 2.2 times as long as maximum width; carpus
1.8 times as long as wide; propodus with lower margin concave,
1.5 times as long overall as mid-length; dactylus 0.7 times
length of axial length of propodus. Pereopod 4 merus length 2.7
times maximum width; carpus 2.7 times as long as wide;
propodus 1.5 times as long as wide, typically setose, with 1
long distal seta overlapping dactylus.
Pleopod 1 article | distally setose; article 2 as long as article
l, 4 times as long as wide, with apex curved over subdistal
notch, appendix interna freely produced, unarmed. Pleopod 2
endopod 2.1 times as long as wide; appendix masculina
overreaching endopod by about half its length, setose along
posterior face and distally; appendix interna near base of
appendix masculina with 5 small hooks. Pleopod 3 with
appendix interna submerged in endopod margin.
Uropodal endopod anterior margin convex, posterior
margin convex, widest about third way along, 1.4 times as
long as wide, apex excavate, with rows of long setae at ends of
anterior and posterior margins, with 11 short setae between in
excavation, with subdistal group of facial setae; exopod ovate,
anterior margin straight, distal and posterior margins
continuous, greatest dimension 2.3 times anterior margin,
with row of blade-like distal setae on distal margin, c. 6 not
overlapping with densely setose distal margin; dorsal plate
extending almost half of exopod width, distal margin with
spiniform setae. Telson 1.8 times as wide as long, broadest at
midpoint, posterolateral corner squarish; posterior margin
sinuous, lateral regions most prominent, with posterolateral
cluster of long setae plus 2 short spiniform setae; dorsal
surface with sharp transverse ridge at anterior third, with 30
short spiniform setae, few long setae at midpoint.
Female. Essentially as male except: major cheliped palm more
tapering than in male, widest proximally. Pleonal sternite |with
pair of oval plates supporting pleopods, each with longitudinal
row of c. 20 setae in clusters of 4 or 5. Pleopod | peduncle with
mesial setose lobe longer than base. Pleopod 2 peduncle with
similar lobe directed mesially.
Colour. Exoskeleton mostly translucent white, upper parts of
chelipeds pink (fig. If, g).
Etymology. For Peter C. Dworschak, good friend and colleague,
and in recognition of his career devoted to the biology of
"thalassinideans .
Distribution. Madagascar, Philippines, Mariana Islands, Papua
New Guinea, Indonesia, French Polynesia. Intertidal to 8 m.
Remarks. | Eucalliaxiopsis | dworschaki 1s similar to
E. panglaoensis and E. paradoxa (see remarks under
Eucalliaxiopsis above). Eucalliaxiopsis dworschaki differs
from both species in possession of a proximal hooked spine
and subproximal-mesial pit on the upper margin of the carpus
of both chelipeds (figs 16g, 25d, e) and a lateral ridge extending
almost the entire length of the propodus of both chelipeds (figs
16b, 25b). The palm of the major cheliped of the male is a little
longer than wide, while it is 1.25 times as long as wide in
G.C.B. Poore
E. panglaoensis. The telson is relatively shorter (length: width
ratio 1.8 vs 1.6) and with a more sinuous posterior margin, and
the uropodal endopod is broader (length: width ratio 1.4 vs
1.6). Dworschak (2006; pers. comm. 29 September 2019)
reported a small spine on the merus of maxilliped 3 of the
allotype of E. panglaoensis, and of seven from Sulawesi, here
reidentified as E. dworschaki. None of the material examined
for this study, nor Dworschak's two individuals from Bali,
possess this spine. Eucalliaxiopsis paradoxa is compared
below.
Dworschak (2006: 356, fig. 5) remarked on and illustrated
two females from Panglao that differed from typical
E. panglaoensis. He noted the hook and pit on the upper margin
of the cheliped carpus and the longitudinal ridge on the
propodus, characters used here to differentiate E. dworschaki.
The genetic difference from E. panglaoensis from the type
locality in the Philippines (Robles et al., 2020) and consistent
morphology of E. dworschaki over a wide geographic range in
the Indo-West Pacific support recognition of two species.
Dworschak (2018) listed material of E. panglaoensis from
Sulawesi and Bali, Indonesia. He has now confirmed (pers.
comm. 30 October 2018) that this collection of five males and
four females also belongs to E. dworschaki. The two species
occur sympatrically at Panglao and a single individual of
E. dworschaki was recorded from Guam, not far from the
Philippines. A large sample of ghost shrimps from the Great
Barrier Reef, a sample that included specimens of Corallianassa
sp. (Callichiridae) and Thomassinia aimsae Poore, 1997
(Callianideidae), was dominated by E. paradoxa but also
included one specimen of E. dworschaki.
There is no genetic difference between the individual
from Papua New Guinea and the three sequenced from French
Polynesia.
Sakai and Türkay (2014) illustrated a single somewhat
distorted individual from Papua New Guinea that was
identified as Calliaxina panglaoensis. On the basis of its
recorded locality, the specimen is probably E. dworschaki.
Eucalliaxiopsis inaequimana Dworschak, 2014
Figures Ih, 1, 18, 25h
Callianassa aequimana.—Poore and Griffin, 1979: 245 (partim
from Qld).
Calliax aequimana.—Sakai,
Maldives), fig. 31.
Eucalliax inaequimana Dworschak, 2014: 236—244, figs 3—7, 9f,
g, 10e, f. — Dworschak, 2018: 17.
Eucalliaxiopsis inaequimana.—Poore et al., 2019: 125, 127, fig.
190, p.— Robles et al., 2020.
1999: 118-119 (partim from
Material examined. Papua New Guinea, New Ireland, NW corner of
Little Nusa Island, seagrass, 0-1 m, 02° 34.9' S, 150° 46.4' E
(KAVIENG 2014 stn KM11), MNHN-IU-2013-10006* (female, 5.8
mm), MNHN-IU-2013-10008* (male, 7.2 mm).
Australia. Qld. Great Barrier Reef, Myrmidon Reef, 18.27° S,
147.38° E, October 1986, 4 m (M. Riddle stn M/10/2), NMV J71689 (2
males, 7.1 mm; 5 females, 5.3—8.3 mm); 2 m (M. Riddle stn M/10/3),
NMV J71690 (female, 5.6 mm). Norwest Islet, Capricorn Group,
23.3° S, 151.7? E, AM P.10356 (male, 8.1 mm)
Mariana Islands, Guam, W coast, near Fish Eye Marine Park,
Indo-West Pacific and Australian Eucalliacidae
"
| |
“Ss
|
I
$
L^
ANM © We
Ma E neto ee
ar Te “a Jf a s
tod. tre EE
oo Meee "Ue
EX vt, PLN "»
* *
VU
IESU
Week
SEU
dM
pou
£e
He
Hn
Ej
2/
/ fe b, c
d-f
Figure 18. Eucalliaxiopsis inaequimana. French Polynesia, UF 16512 (male, 5.0 mm): a, anterior carapace, eyestalks, antennule, antenna; b,
pleopod 1. French Polynesia, UF 28903 (male, 5.4 mm): c, pleopod 1. Papua New Guinea, MNHN-IU-2014-10008 (male, 7.2 mm): d-f, telson,
dorsal, lateral and anterodorsal views. Scale bars a, d-f = 1 mm; scale bars b, c = 0.1 mm.
sand/rubble flat, 0.2-0.5 m, 13.471? N, 144.704° E (stn AA05), UF
27330 (female, 3.5 mm).
French Polynesia. Moorea Island, Motu Tiahura/Fareone channel,
17.4888° S, 149.9134° W (stn MIB-225), UF 16512 (male, 5.0 mm).
Papetoai, 17.4898°S, 149.884°W, (stn BIZ-463), UF 16479 (female, 3.9
mm), UF 28784* (male, 5.1 mm); stn BIZ-493 UF 28903 (male, 5.4
mm), UF 28929 (female, 5.1 mm). S of Nihimaru, 17.535° S, 149.904° W
(stn BIZ-616), UF 29162 (ovigerous female, 6.6 mm). Off Opunohu
public beach, 17.49143° S, 149.85138° W (stn BIZ-636), UF 29208 (male,
6.0 mm). Off Nihimaru river estuary, 17.533° S, 149.9045° W (stn MIB-
098), UF 15915 (male, 5.0 mm), UF 15945 (female, 4.0 mm). Gump reef,
in front of waterfront bungalows, 17.4902° S, 149.826° W (stn MIB-
224), UF 16498 (ovigerous female, 6.2 mm). Between Papetoai and
Hotel, 17.4908° S, 149.8871° W (MIB-227), UF 16535 (male, 2.9 mm),
UF 16542 (female, 4.6 mm; male, 4.1 mm).
Diagnosis. Pleonite | without pair of sternal plates. Eyestalk
about twice as long as wide. Antennule peduncle reaching to
base of antenna peduncle article 5. Maxilliped 3 exopod absent.
Cheliped carpi distolateral margin square at lower angle,
propodi lateral face without longitudinal ridge, upper mesial
face with row of short transverse ridges associated with more
distal clusters of setae. Male pleopod 1 article | linear, with
distal setae; article 2 short, oblique, or of single article with
narrower distal lobe. Female pleopod 2, appendix interna
absent. Uropod endopod ovate. Telson without transverse row
of spiniform setae.
Colour. Exoskeleton mostly translucent white, gastric region,
distal propodus of chelipeds with few pink chromatophores
(fig. Ih, 1).
Distribution. Australia, Cocos (Keeling) Island (type locality),
Qld, Great Barrier Reef; Papua New Guinea, New Ireland;
Indonesia, Sulawesi; Philippines, Panglao; French Polynesia.
Intertidal to 4 m.
Remarks. Dworschak (2014) distinguished this species, as
Eucalliax inaequimana, on several features including
inequality of the chelipeds in both sexes from E. aequimana.
Usually, only males of Eucalliaxiopsis have a significantly
larger major cheliped although not all descriptions are clear on
this point. The same is true of E. patio (described and compared
below) and both species differ from E. aequimana in the ways
listed by Dworschak (2014).
Robles et al.’s (2020) phylogram detected no genetic
difference between two individuals from the type locality,
two from Papua New Guinea and one from French Polynesia.
Dworschak (2014) recorded the maximum carapace length as
9.1 mm; the largest in this collection were a male of 7.2 mm
and ovigerous female of 6.2 mm. His illustrations and
description were comprehensive, and many specific details
appear on the new material, such as the transverse ridges on
the mesial faces of the chelipeds and distal tubercles on the
cheliped propodus. A broad postrostral obsolete median ridge
defined by shallow longitudinal grooves is typical of the new
material (fig. 18a) but was not mentioned by Dworschak
(2014). The feature appears to be more conspicuous in some
individuals than others (Dworschak, pers. comm. 29
September 2019). The male pleopod 1 is manifest in two
forms — a long article and shorter second article (fig. 18b; as
28
figured by Dworschak) — and a form where these appear fused
(fig. 18c).
Poore and Griffin’s (1979) specimen of Callianassa
aequimana from Queensland was reidentified as
E. inaequimana. Sakai's (1999) record of Calliax aequimana
from the Maldives is almost certainly referable to
E. inaequimana. Sakai (2018) omitted E. inaequimana from
his revision of Eucalliacinae.
Eucalliaxiopsis madagassa (Sakai and Türkay, 2014)
Figure 19
Calliaxiopsis madagassa Sakai and Türkay, 2014: 193, fig. 13.
Calliaxina thomassini Ngoc-Ho, 2014: 549, fig. 2.
Calliaxina madagassa.—Poore and Dworschak, 2017: 120, fig. 1.
Material examined. Madagascar Nosy Bé, W of Hell-Ville,
13.41562° S, 48.246485" E (stn MGNW-50), UF 14090 (ovigerous
female, 5.8 mm). Toliara (as Tuléar), Thomassin stn 676, MNHN-
[U-2016-8085 (ovigerous female, 5.8 mm).
Diagnosis. Eyestalk about twice as long as wide. Antennule
peduncle reaching to midpoint of antenna peduncle article 5.
Maxilliped 3 exopod present. Cheliped carpi distolateral margin
square at lower angle, propodi lateral face without longitudinal
ridge, upper mesial face with row of clusters of long setae. Male
pleopod 1 article 1 without distal setae, article 2 parallel-sided,
apically rounded, with marginal setae, without appendix interna.
Female pleopod 2, appendix interna absent. Uropod endopod
ovate. Telson without transverse row of spiniform setae.
Distribution. Madagascar.
Remarks. Poore and Dworschak (2017) discussed the synonymy
and priority of the species names before Calliaxina was divided
into two by Poore et al. (2019). The species is widespread in
Madagascar (Ngoc-Ho, 2014) and is recognised by rounded
posterolateral corners and convex posterior margin of the telson,
the continuous dense row of setae on the lateral margin of the
fixed finger of the minor cheliped, and the presence (usually) of
two or three tubercles at the midpoint of the lower margin of the
cheliped merus. The ovigerous female differs from that of the
male figured by Ngoc-Ho (2014) in having a slightly narrower
uropodal exopod and in having the chelipeds subequal — they
are unequal in males of most species of this genus.
Eucalliaxiopsis panglaoensis (Dworschak, 2006)
Figure 25g
Eucalliax panglaoensis Dworschak, 2006: 349—358, figs 1—4, 6, 7
(not fig. 5 = E. dworschaki sp. nov.).— Osawa and Fujita, 2016: 40—41,
fig. 3c.—Dworschak, 2018: 17, fig. 1 (partim).
Calliaxina panglaoensis.—Sakai, 2011: 501.
Eucalliaxiopsis panglaoensis.—Poore et al., 2019: 125, 127, 146,
fig. I9m.— Robles et al., 2020.
Material examined. Paratypes. Philippines, Panglao Island, 09° 38.3' S,
123? 49.6' E, MNHN Th15093 (female, 7.1 mm), MNHN Th1504 (male,
4.3 mm).
Diagnosis. Pleonite | with pleopods attached to pair of sternal
plates. Eyestalk about twice as long as wide. Antennule peduncle
G.C.B. Poore
reaching to midpoint of antenna peduncle article 5. Maxilliped 3
exopod absent. Cheliped carpi distolateral margin with 5 acute
teeth near lower margin separated by wide grooves parallel to
lower margin, second tooth with acute ridge, propodi lateral
face without longitudinal ridge, upper mesial face with row of
clusters of long setae. Male pleopod 1 article 1 linear, with distal
setae; article 2 blade-like with subapical medial notch. Female
pleopod 2, appendix interna absent. Uropod endopod ovate with
excavate apex. Telson with row of spiniform setae on ridge.
Distribution. Philippines, Panglao; Japan, Ryukus, Miyako
Group. Sandy beaches, intertidal to 4 m.
Remarks. Eucalliaxiopsis panglaoensis differs from E. paradoxa
and E. dworschaki (see remarks under Eucalliaxiopsis above
and these two species) in armature of the cheliped. The marginal
teeth at the lower distal angle of the carpus are more widely
spaced, and the second more sharply ridged than in the other
two. The longitudinal lateral ridge on the propodus is shorter
than in E. dworschaki but more prominent than in E. paradoxa
(fig. 25g; Dworschak, 2000).
The record of this species, rather than E. dworschaki,
from Japan is based on the illustration of the cheliped with a
short lateral propodal ridge (Osawa and Fujita, 2016: fig. 3c).
Eucalliaxiopsis paradoxa sp. nov.
http://zoobank.org/urn:|sid:zoobank.org:act:2 EEAC4EC-C3EA-
4D17-9102-4090CA6DF02E
Figures 20, 21, 25h, 1
Material examined. Holotype. Australia, Qld, Great Barrier Reef, Rib
Reef, 185.48? S, 146.86" E, October 1985, shallow lagoon, 4 m, (M.
Riddle stn R/10/2), NMV J71683 (male, 9.4 mm).
Paratypes. Collected with holotype. NMV J71679 (ovigerous
female, 9.4 mm), NMV J71684 (3 females, 9.8—10.9 mm). Australia,
Old, Great Barrier Reef, Myrmidon Reef, 18.27? S, 147.38" E, October
1985, lagoon with “Callianassa” mounds, 8 m, (M. Riddle stn M/10/1),
NMV J71680 (7 males, 3.9-10.3 mm; 7 females, 4.4—10.4 mm).
Diagnosis. Pleonite 1 with pleopods attached to pair of sternal
plates. Eyestalk about twice as long as wide. Antennule peduncle
reaching to midpoint of antenna peduncle article 5. Maxilliped 3
exopod absent. Cheliped carpi distolateral margin with 5 acute
teeth near lower margin separated by submarginal oblique
grooves, second tooth with prominent rounded ridge, propodi
lateral face with short horizontal longitudinal ridge extending
from beyond mid-length of palm to base of finger, upper mesial
face with row of clusters of long setae. Male pleopod | article |
linear, with distal setae; article 2 blade-like with subapical
medial notch. Female pleopod 2, appendix interna absent.
Uropod endopod ovate with excavate apex. Telson with row of
spiniform setae on ridge.
Description of holotype male. Carapace length 9.4 mm,
smooth; gastric-abdominal regions together 4.7 times as long
as wide; branchiostegite fully calcified; cervical groove at 0.63
carapace length, scarcely obvious on branchiostegite; cardiac
sulcus at 0.8 carapace length, not meeting mid-dorsally,
extending transversely across quarter of branchiostegite.
Rostrum acute, tapering evenly over most of length, length
0.5 width of eyestalks. Anterolateral carapace lobe 0.6 length
Indo-West Pacific and Australian Eucalliacidae 29
"s
|: 5. PE
— RII
^ M
\ LAS : (us $E
Figure 19. Eucalliaxiopsis madagassa. Madagascar, UF 14090 (ovigerous female, 5.8 mm): a, b, anterior carapace, eyestalks, antennule, antenna,
dorsal and lateral views; c—e, telson, dorsal, posterior and lateral views; f, major (left) cheliped, mesial view; g, major (left) cheliped, propodus,
dactylus, lateral view; h, minor (right) cheliped, mesial view; 1, minor (right) cheliped, propodus, dactylus, lateral view. Scale bars = 1 mm.
30 G.C.B. Poore
Q)
PAS :
“ee PE, ZA
A
Figure 20. Eucalliaxiopsis paradoxa sp. nov. Holotype, NMV J71683 (male, 9.4 mm): a, b, carapace, dorsal and lateral views; c, d, anterior
carapace, eyestalks, antennule, antenna, dorsal and lateral views; e, maxilliped 3; f, g, major cheliped (left), mesial and lateral views, with detail
of distolateral corner of carpus; h, 1, minor cheliped (right), mesial and lateral views, with detail of distolateral corner of carpus; J, k, m, pereopods
2, 3, 5. Paratype, NMV J71680 (female, 9.3 mm): 1, pereopod 4. Scale bars = 1 mm.
Indo-West Pacific and Australian Eucalliacidae 31
EAR? PINTOR
ITA
p q
Figure 21. Eucalliaxiopsis paradoxa sp. nov. Holotype, NMV J71683 (male, 9.4 mm): a, thoracic sternite 7; b, pleonitel sternite, right pleopod 1
(anterior uppermost); c, pleonite 6, telson, lateral view; d, pleonite 6, left lateral oblique view; e, right uropod; f, telson; g, h, pleopod 1, mesial
and posterior views; 1, pleopod 2, posterior view. Paratype, NMV J71679 (ovigerous female, 9.4 mm): j, k, anterior carapace, eyestalks, antenna,
dorsal and lateral views; l, m, major cheliped (left), mesial and lateral views; n, o, minor cheliped (right), mesial and lateral views; p, q, pleopods
1, 2. Paratype, NMV J71684 (female, 10.4 mm): r, minor cheliped carpus, distolateral margin. Scale bars = 1 mm.
32
rostrum, with rounded apex, anteriorly directed, with
numerous submarginal dorsal setae.
Thoracic sternite 7 1.3 times as long as wide, with well-
defined median sulcus over posterior half, lateral groove
anterior to coxal articulation shallow, oblique, meeting
medially, with 7 posterolateral clusters of 2 or 3 long setae.
Pleonal sternite 1with pair of swollen relatively unchitinised
areas anterior to ridge bearing pleopods. Pleonite 6 with small
lateral blunt hook-like process at midpoint.
Eyestalk 2.2 times as long as wide at base, tapering to
cornea and acute apical lobe; cornea subcircular; apical lobe
extended dorsally. Antennular peduncle 3 times as long as
width of both eyestalks; article 2 3.5 times as long as wide;
article 3 half as long as article 2; articles 2 and 3 with
ventrolateral row of long setae, continued onto flagellum.
Antennal peduncle 3.4 times as long as width of both
eyestalks, overreaching antennule peduncle by half of article
5; scaphocerite wider than long, with acute apex; article 4c. 5
times as long as wide; article 5 0.6 length of article 4.
Maxilliped 3 ischium with slightly convex mesial margin,
expanding from narrow proximomesial corner; ischium-
merus upper margin 1.7 times as long as greatest width; crista
dentata of 12 spines, the most proximal reflexed; carpus—
dactylus together almost as long as ischium—merus.
Chelipeds unequal, major propodus 1.2 times as long as
that of minor, both of similar widths, major dactylus stouter
than that of minor. Major cheliped (right 1n holotype) ischium
twice as long as distal width, lower margin with short spines
becoming more distinct distally; merus twice as long as
broad, lower margin mostly straight, unarmed, upper margin
with distal tooth; carpus 1.2 times as wide as upper length,
upper margin carinate, unarmed except for distal tooth,
distomesial margin with prominent lobe near lower margin,
distolateral margin with acute tooth near upper margin, with 3
acute teeth near lower margin separated by submarginal
oblique grooves, second tooth with prominent rounded ridge,
3 short setae in lower groove; propodus widest proximally,
tapering, upper palm length barely exceeding greatest width,
upper margin straight, carinate, with rounded lobe not
projecting over dactylus, lower margin carinate, strongly
curved mesially, mesial face with short distal uneven setose
ridge below upper margin, distomesial margin of palm almost
straight, lateral face of palm with short horizontal ridge, about
fifth length of palm, extending on to finger, 4 rimmed
tubercles near proximal margin, | at midpoint of palm, | near
lower margin, each perforated for cluster of setae; fixed finger
half length of upper margin of palm, cutting edge with
denticles over proximal half, blunt triangular tooth near
midpoint; dactylus as long as fixed finger, twice as long as
wide at base, cutting edge with blunt proximal molar, with
straight tip; submarginal tufts of long setae on upper and
lower mesial margins of carpus and propodus, opposing
mesial margins of fingers.
Minor cheliped (left 1n holotype) ischium twice as long as
distal width, lower margin with distal spines; merus twice as
long as broad, lower margin mostly straight, unarmed; carpus
1.2 times as wide as upper length, upper margin carinate,
unarmed except for distal tooth, distomesial face with lower
G.C.B. Poore
submarginal ridge, distolateral margin with acute tooth near
upper margin, with 3 teeth near lower margin separated by
submarginal oblique grooves, second tooth acute with
prominent rounded ridge, 2 short setae in lower groove;
propodus greatest width proximally, tapering, upper palm
length equal to greatest width, palm tapering, upper margin
carinate, overhanging mesial face, with rounded lobe projecting
over dactylus, lower margin carinate, strongly curved mesially,
mesial face with 4 blunt teeth at associated with upper row of
clusters of setae, distomesial margin of palm almost straight,
lateral face of palm with prominent ridge running from two-
thirds length of palm to middle of finger, 5 rimmed tubercles
near proximal margin of which | near midpoint of palm is
more distal, each perforated for cluster of setae; fixed finger 0.7
length of upper margin of palm, width at base half width of
palm, cutting edge smooth; dactylus as long as fixed finger, 3.2
times as long as wide at base, cutting edge straight; submarginal
tufts of long setae on upper and lower mesial margins of carpus
and propodus, opposing mesial margins of fingers.
Pereopod 2 merus twice as long as maximum width;
dactylus c. 3 times as long as upper margin of propodus.
Pereopod 3 merus twice as long as maximum width; carpus
1.8 times as long as wide; propodus with lower margin
concave, twice as long overall as mid-length; dactylus 0.7
times length of axial length of propodus. Pereopod 4 merus
length 2.2 times maximum width; carpus 2.5 times as long as
wide; propodus as long as wide, typically setose, with | long
distal seta overlapping dactylus.
Pleopod 1 article 1 distally setose; article 2 as long as
article 1, 4 times as long as wide, with apex curved, appendix
interna lobe-like, not produced, unarmed. Pleopod 2 endopod
twice as long as wide; appendix masculina overreaching
endopod by about third its length, triangular 1n cross-section,
setose along posterior face and distally; appendix interna near
base of appendix masculina without hooks.
Uropodal endopod anterior margin convex, posterior
margin convex, widest about third way along, 1.4 times as
long as wide, apex excavate, with rows of long setae at ends of
anterior and posterior margins, with 8 short setae between in
excavation, with subdistal group of facial setae; exopod ovate,
anterior margin straight, distal and posterior margins
continuous, greatest dimension 2.2 times anterior margin,
with row of blade-like distal setae on distal margin, c. 6 not
overlapping with densely setose distal margin; dorsal plate
extending almost half of exopod width, distal margin with
spiniform setae. Telson 1.6 times as wide as long, broadest at
midpoint, posterolateral corner rounded; posterior margin
sinuous, lateral regions most prominent, with posterolateral
cluster of long setae plus 2 short spiniform setae; dorsal
surface with sharp transverse ridge at anterior third, with 36
short spiniform setae, few long setae at midpoint
Female. Essentially as male except: major cheliped palm
tapering, upper length 0.9 greatest width, upper margin convex,
depressed distally, lateral ridge longer than in male, fixed finger
broader than in male, crenellate proximal and distal to tooth.
Pleonal sternite |with pair of oval plates supporting pleopods,
each with longitudinal row of setae. Pleopod 1 peduncle with
Indo-West Pacific and Australian Eucalliacidae
mesial setose lobe longer than base. Pleopod 2 peduncle with
similar mesial setose lobe; endopod without appendix interna.
Etymology. Paradoxa (Latin), reflecting the subtle differences
from E. panglaoensis and co-occurring E. dworschaki, and a
tribute to the collector’s name, Martin Riddle.
Distribution. Australia, Qld, central Great Barrier Reef (18° S).
Subtidal coral reef lagoons.
Remarks. Eucalliaxiopsis paradoxa shares several features
with E. panglaoensis and E. dworschaki (see remarks under
Eucalliaxiopsis above).The new species differs from these two
in having eight short setae in the uropodal endopod excavation
(fig. 21e; 11 in the other species), a short longitudinal ridge at
the base of the finger on the lateral face of the chelipeds, the
propodus of the male cheliped tapering (more rectangular in
the others), and the middle distolateral cheliped carpal tooth
being oblique and sharply ridged (figs 20g, 1, 21m, o, r, 25h). In
E. dworschaki, the ridge on the palm extends almost its entire
length, and the middle carpal lobe is perpendicular and with a
median groove. Besides having fewer short setae at the end of
the uropodal endopod, Eucalliaxiopsis paradoxa differs from
E.panglaoensis in the upper margin of the male major cheliped
palm being as long as wide (vs 1.3 times as long as palm width),
the palm of the female major cheliped being relatively longer
(1.1 vs 0.9 times as long as greatest width), the uropodal
endopod being more tapered (more oval in E. panglaoensis)
and the sinuous posterior margin of the telson (vs straight).
Eucalliaxiopsis patio sp. nov.
http://zoobank.org/urn:lsid:zoobank.org:act: F5884500-4430-
493B-9BCD-CA5E769F846E
Figures 22—24
Eucalliaxiopsis PNG-1153C.— Robles et al., 2020.
Material examined. Holotype. Papua New Guinea, New Ireland
Province, Patio Island, 02? 36.2' S, 150? 31.6' E, 6—8 m, coral rubble
(KAVIENG 2014 stn KB38), MNHN-IU-2014-2536* (female, cl. 4.6
mm).
Paratype. Collected with holotype (MNHN-IU-2014-2539 (male,
cl. 4.3 mm, with male and female bopyrid isopods under left
branchiostegite).
Diagnosis. Pleonite I without pair of sternal plates. Eyestalk 1.5
times as long as wide. Antennule peduncle reaching to midpoint
of antenna peduncle article 5. Maxilliped 3 exopod absent.
Cheliped carpi distolateral margin square at lower angle, propodi
lateral face without longitudinal ridge, upper mesial face with
row of short transverse ridges associated with more distal clusters
of setae. Male pleopod | of single article with narrower distal
lobe. Female pleopod 2, appendix interna present. Uropod
endopod ovate. Telson without transverse row of spiniform setae.
Description of holotype female. Carapace length 4.6 mm,
smooth; gastric-abdominal regions together 4.2 times as long
as wide; branchiostegite fully calcified; cervical groove at 0.67
carapace length, scarcely obvious on branchiostegite; cardiac
sulcus at 0.83 carapace length, not meeting mid-dorsally,
extending transversely across two-thirds of branchiostegite.
33
Rostrum broadly rounded-triangular, length about 0.2
width of eyestalks. Anterolateral carapace lobe as long as
rostrum, with rounded apex, depressed anteriorly, with c. 5
submarginal dorsal setae. Pleonites 1—6 lengths relative to cl:
0.46 : 0.67 : 0.45 : 0.33 : 0.41: 0.51; pleonite 1 with strong dorsal
transverse groove, without pair of sternal plates; pleonites 3—5
with lateral tufts of setae; pleonite 6 with 8 lateral rows of setae.
Thoracic sternite 7 1.2 times as long as wide, with well-
defined median sulcus over posterior half, smooth over medial
half, lateral ridge anterior to coxal articulation crossing pit at
quarter of width, meeting medially, with 3 posterolateral
clusters of long setae.
Eyestalk 1.7 times as long as wide at base, swollen laterally,
tapering to cornea and acute apical tubercle; cornea wider than
long, depressed anteriorly. Antennular peduncle twice as long
as width of both eyestalks; article 2 twice as long as wide;
article 3 as long as article 2; articles 2 and 3 with ventrolateral
row of long setae, continued onto flagellum. Antennal peduncle
2.4 times as long as width of both eyestalks, overreaching
antennule peduncle by half of article 5; scaphocerite ovoid,
longer than wide; article 4 c. 5 times as long as wide; article 5
0.8 length of article 4. Maxilliped 3 ischium with slightly
convex mesial margin, expanding from narrow proximomesial
corner; ischium—merus upper margin twice as long as greatest
width; crista dentata of 6 spines, the 2 most proximal largest;
carpus—dactylus together almost as long as ischium—merus.
Chelipeds unequal, major carpus-propodus upper margin
1.1 length of minor, propodus 1.2 times as wide as minor.
Major cheliped (left in holotype) ischium twice as long as
distal width, lower margin with needle-like spines becoming
more distinct distally; merus 1.7 times as long as broad, lower
margin convex, unarmed; carpus 1.2 times as wide as upper
length, margins carinate; propodus greatest width in middle of
palm, upper palm length 1.15 times greatest width, distomesial
margin of palm with submarginal group of 2 setae, small
tubercle, distolateral margin of palm with submarginal group
of c. 6 setae between fingers; fixed finger 0.4 length of upper
margin of palm, cutting edge with miucrodenticles over
proximal half, blunt triangular tooth at about midpoint;
dactylus as long as fixed finger, twice as long as wide at base,
cutting edge with deflected tip; submarginal tufts of long setae
on upper and lower mesial margins of carpus and propodus,
Opposing mesial margins of fingers; 3 short transverse ridges
associated with setae on submesial upper margin.
Minor cheliped (right in holotype) ischium c. 2.3 times as
long as distal width, lower margin with needle-like spines
becoming more distinct distally; merus 1.7 times as long as
broad, lower margin convex, unarmed; carpus 1.2 times as wide
as upper length, margins carinate; propodus palm more tapering
than major, 0.95 times as wide as upper palm length, distomesial
margin of palm with submarginal group of 4 12 setae,
distolateral margin of palm with submarginal group of c. 4
setae; fixed finger half length of upper margin of palm, mesial
cutting edge straight, smooth, cutting edge straight, fixed finger
with smooth lateral ridge defining edge of lateral concavity at
base of fixed finger, without granules; dactylus as long as fixed
finger, 3 times as long as wide at base, cutting edge straight;
submarginal tufts of long setae on upper and lower mesial
34 G.C.B. Poore
Figure 22. Eucalliaxiopsis patio sp. nov. Holotype, MNHN-IU-2013-2536 (female, 4.1 mm): a, habitus, dorsal; b, carapace, lateral view; c,
thoracic sternite 7; d, pleonitel sternite, right pleopod 1; e, f, anterior carapace, eyestalks, antennule, antenna, dorsal and lateral views; g, pleonite
6, telson, uropod; h, uropod exopod, margin, dorsal plate; 1, J, telson, lateral and dorso-anterior views; k, maxilliped 3; 1 , maxilliped 3, crista
dentata, basis, ischium. Scale bars = 1 mm.
Indo-West Pacific and Australian Eucalliacidae
39
a-h
Figure 23. Eucalliaxiopsis patio sp. nov. Holotype, MNHN-IU-2013-2536 (female, 4.1 mm): a, major cheliped (left), mesial; b, major cheliped
(left), distal propodus, dactylus, lateral; c, minor cheliped (right), mesial view; d, minor cheliped (right), distal propodus, dactylus, lateral; e—h,
pereopods 2-5; 1, J, pleopods 1, 2. Scale bars = 1 mm.
margins of carpus and propodus, opposing mesial margins of
fingers; 2 short transverse ridges associated with setae on
submesial upper margin, more prominent distally.
Pereopod 2 merus 1.8 times as long as maximum width;
dactylus c. 3 times as long as upper margin of propodus.
Pereopod 3 merus 2.2 times as long as maximum width;
carpus 1.8 times as long as wide; propodus with lower margin
almost straight, 1.8 times as long as mid-length; dactylus half
as long as axial length of propodus. Pereopod 4 merus twice
as long as maximum width; carpus 3 times as long as wide;
propodus typically setose, with distal spiniform setae among
setose margin, with 2 long distal setae overlapping dactylus.
Pleopod | article 1 without distal projection beyond article
2; article 2 longer than article 1. Pleopod 2 endopod 3 times as
long as wide; appendix interna at midpoint of endopod.
Uropodal endopod ovoid, anterior margin more convex
36
EJ
WEN SS
G.C.B. Poore
Figure 24. Eucalliaxiopsis patio sp. nov. Paratype, MNHN-IU-2013-2539 (male, 4.6 mm): a, b, anterior carapace, eyestalks, dorsal and lateral
views; c, major cheliped (right), mesial; d, major cheliped (right), propodus, dactylus, upper; e, minor cheliped (left), mesial view; f, minor
cheliped (left), propodus, dactylus, upper; g, h, pleopods 1, 2. Scale bars = 1 mm.
than posterior margin, widest about third way along, 1.5 times
as long as wide, with subdistal group of facial setae; exopod
ovate, anterior margin straight, distal and posterior margins
continuous, greatest dimension 2.2 times anterior margin, with
row of blade-like distal setae on distal margin, c. 6 not
overlapping with densely setose distal margin; dorsal plate
extending almost half of exopod width, distal margin with
spiniform setae. Telson 1.6 times as wide as long, broadest over
anterior half, posterolateral corner evenly rounded to posterior
margin; posterior margin barely convex, with posterolateral
clusters of long setae; dorsal surface with obscure rounded
transverse ridge at anterior third, without median notch.
Paratype male. Carapace length 4.3 mm. Eyestalks 1.5 times
as long as wide at base, swollen laterally, tapering to cornea
and acute apical tubercle; cornea wider than long, depressed
anteriorly Postrostral dorsal area with pair of shallow pits.
Chelipeds unequal, major carpus-propodus upper margin
1.1 length of minor, propodus 1.3 times as wide as minor.
Major cheliped (right) ischium twice as long as distal width,
lower margin with denticles, | distal spine; merus 1.7 times as
long as broad, lower margin convex, unarmed; carpus 1.4
times as wide as upper length, margins carinate; propodus
ereatest width in middle of palm, upper palm length 1.15
times greatest width, distomesial margin of palm with
submarginal group of 2 setae plus tubercle; fixed finger 0.35
length of upper margin of palm, cutting edge with
microdenticles over proximal half, blunt triangular tooth near
midpoint; dactylus as long as fixed finger, twice as long as
wide at base, cutting edge irregular, with deflected tip;
submarginal tufts of long setae on upper and lower mesial
margins of carpus and propodus, opposing mesial margins of
fingers; 4 short transverse ridges associated with setae on
submesial upper margin.
Minor cheliped (left) ischium c. 2.3 times as long as distal
width, lower margin with denticles, | distal spine; merus 1.8
times as long as broad, lower margin convex, unarmed; carpus
1.1 times as wide as upper length, margins carinate; propodus
palm more tapering than major, 0.95 times as wide as upper
palm length, distomesial margin of palm with 2 submarginal
Indo-West Pacific and Australian Eucalliacidae 37
Figure 25. Eucalliaxiopsis spp. E. aequimana: a, b, major cheliped, mesial. E. dworschaki, Papua New Guinea, MNHN-IU-2013-10003: c, d,
major cheliped lateral, upper margin. E. dworschaki, Philippines, NHMW 20923: e, f, major cheliped carpus lower lateral angle, upper margin.
E. panglaoensis, NHMW 20922: g, minor cheliped, lateral. E. inaequimana: h, major cheliped, mesial. E. paradoxa: h, 1, major cheliped lateral,
mesial. Photos e-g: P.C. Dworschak. Various scales.
38
eroups of 2—3 setae; fixed finger 0.4 length of upper margin of
palm, mesial cutting edge straight, smooth; dactylus as long as
fixed finger, 2.8 times as long as wide at base, cutting edge
straight; submarginal tufts of long setae on upper and lower
mesial margins of carpus and propodus, opposing mesial
margins of fingers; 3 short transverse ridges associated with
setae on submesial upper margin, more prominent distally.
Pleopod 1 articles indistinguishable; article 1 with 1 short, 4
long distal setae; article 2 a short triangle, half as wide as article
|. Pleopod 2 endopod 2.7 times as long as wide; appendix
masculina attached at mid-length, 5 times as long as width,
distal margin rounded, exceeding endopod by fifth of its length,
with c. 9 facial setae near midpoint, c. 14 subdistal setae;
appendix interna rod-like, about 0.4 length of appendix interna.
Etymology. From Patio Island, Papua New Guinea, the type
locality (noun in apposition).
Distribution. Papua New Guinea. Coral rubble, 6—8 m.
Remarks. The holotype was sister taxon to five individuals of
E. inaequimana on the phylogenetic tree of Robles et al. (2020).
Both species have submarginal mesial transverse ridges on the
cheliped propodi from which tufts of long setae emerge; in other
species of Eucalliaxiopsis the same tufts are not supported in
this way. The male pleopod 1 of both species has a simple
second article, free or fused, a form seen too in E. madagassa
(see Poore and Dworschak, 2017: fig. IC, D), Eucalliax
quadracuta and Calliaxina bulimba (see above). The typical
article 2 of species of Eucalliaxiopsis 1s flattened with a distal
oblique notch. — Eucalliaxiopsis patio differs from
E. inaequimana in shorter, more swollen eyestalks (1.5 vs 1.8
times as long as wide), slightly shorter rostrum (quarter vs fifth
length of eyestalk), shorter antenna peduncle (2.4 vs 3.0 times as
long as base of both eyes), more compact antennular and
antennal peduncular articles, the telsonic ridge being only
slightly elevated and complete (vs clearly elevated, with median
notch), and a broader uropodal endopod (1.5 vs 1.8 times as long
as wide). The appendix interna on the female pleopod 2 is
present while it 1s absent in E. inaequimana. It 1s possible that
this difference may be related to the female's small size;
Dworschak (2006) noted that the smallest female of
E.panglaoensis possessed an appendix interna while larger ones
did not. Two individuals were collected from the type locality,
with carapace lengths of 4.3 and 4.6 mm. The largest known
specimen of E. inaequimana has a carapace length of 9.1 mm.
Identification of these specimens using Sakai's (2011) key to
species of Calliaxina leads to C. aequimana, a southern
Australian species. This species, now Eucalliaxiopsis
aequimana, lacks mesial ridges on the chelipeds and has a
female-like male pleopod 1.
Pseudocalliax Sakai, 2011
Pseudocalliax Sakai, 2011: 505—506.— Sakai, 2018: 744.— Poore
et al., 2019: 128, 146, figs 18a, k, 19e, r.
Remarks. The type and only species was placed in Eucalliacinae,
now Eucalliacidae, as a species of Calliax, by Sakai (2005).
Sakai (2011) erected the new genus Pseudocalliax for it in the
G.C.B. Poore
same subfamily. No molecular sequences were available to
Robles et al. (2020) to challenge this placement that has good
morphological support (Poore et al., 2019). The genus shares
with the three species of Calliax the characteristic short fixed
finger on the minor cheliped.
Pseudocalliax tooradin (Poore and Griffin, 1979)
Figure 26
Callianassa tooradin Poore and Griffin, 1979: 275—277, fig. 36.
Calliax tooradin.—Sakai, 1988: 61.— Davie, 2002: 459.— Sakai,
2005: 204.
Paraglypturus tooradin.— Sakai, 1999: 124, fig. 33a—c.—Poore,
2004: 184, fig. 50h, 1.
Pseudocalliax tooradin.— Sakai, 2011: 506.
Material examined. Australia, Vic., Western Port, Crib Point,
38° 20.23' S, 145° 13.38' E, 5 m (CPBS stn LIN), NMV J301 (holotype
female, 5.2 mm), NMV J302 (2 paratype females); 38° 21.17’ S,
145° 13.15' E,2 m (CPBS stn 000), NMV J303 (paratype male, 6.5 mm).
San Remo, channel edge, E. of No. 7 beacon, 38° 32'S, 145° 23' E(MRG
Transect 1), NMV J59760 (male, 5.1 mm); N from 200 m E of Back
Beach Rd to channel edge, 38° 32'S, 145° 23' E (MRG transect 2), NMV
J59761 (2 males, 4.2, 6.0 mm). Swan Bay, Edwards Point, 38° 13.3' 5,
144° 41.4' E, 2 m, NMV J16722 (juvenile, 1.5 mm).
Distribution. Australia, Vic., entrances of Western Port and
Port Phillip Bay. Subtidal, c. 2 m.
Remarks. Poore and Griffin (1979) provided only a short
description and simple figures. Here, the antennae, chelipeds,
terminal articles of pereopods 3 and 4, male pleopods, telson
and uropod are figured. The species is notable for the setose
thoracic sternite 7 and ventroposterior surface of the coxa—
ischium of pereopod 5, a feature diagnostic for the genus (fig.
26b). The antenna bears a free scaphocerite, longer than
broad, with a rounded apex (fig. 26a). The exopod of
maxilliped 3 typically reaches the middle of the merus but is
shorter on smaller 1ndividuals. While the fixed finger of the
minor cheliped is shorter than the dactylus in most individuals
it is almost as long 1n one male. The propodus of pereopod 3
is suboval, little longer along its upper margin than its greatest
width, and densely setose on its lateral face. The propodus of
pereopod 4 1s elongate-oval, 1.5 times as long along its upper
margin than its greatest width, with a distal long spiniform
setae on the lower margin, and densely setose on its lateral
face. The male pleopod 1, overlooked by Poore and Griffin
(1979), has a shorter second article with an apical notch (fig.
26g). The peduncle of the male pleopod 2 is longer than
broad; the appendix interna is short and lacks hooks; no
appendix masculina is present (fig. 26h). The appendix interna
on the endopod of pleopod 3 1s triangular, longer than broad,
emerging by about half its length (fig. 26]). The uropodal
endopod is oval, 1.8 times as long as wide, with marginal
setae; the exopod is 1.6 times as long as wide, with short
spiniform setae along its apical margin, with a well-defined
dorsal plate with c. 6 short spiniform setae and many longer
setae (fig. 26f). A dorsal oval, cardiac prominence and cardiac
sulcus are all absent; all known material is in NMV (ct.
contradictory statements and figures in Sakai, 1999, and
Sakai, 2011).
Indo-West Pacific and Australian Eucalliacidae 39
J
LAE
| 7 TIL X
N M
N
N S
Pres | N
| i
a-f
Figure 26. Pseudocalliax tooradin Poore and Griffin, 1979. Australia, Vic., Western Port, NMV J303 (paratype male, 6.5 mm): a, anterior
carapace, eyestalks, antennule, antenna; b, posterior carapace, pleonite 1, coxa 4, thoracic sternite 7, coxa-basis 5, pleopod 1; c, maxilliped 3, with
crista dentata; d, e, propodus, dactylus, pereopods 3, 4; f, telson, uropod; g, pleopod 1; h, pleopod 2; j, appendix interna, pleopod 3. NMV J301
(holotype female, 5.2 mm): 1, pleopod 2. Scale bars = 1 mm.
40
Acknowledgements
I thank Philippe Bouchet for his organisation of the Kavieng
Lagoon Biodiversity Survey (Principal Investigators: Philippe
Bouchet, Jeff Kinch), part of the of La Planéte Revisitée
expeditions organised jointly by Muséum national d'Histoire
naturelle, Pro-Natura International and Institut de Recherche
pour le Développement, with support from Papua New
Guinea's National Fisheries Authority. The organisers
acknowledge supporting funding from the Total Foundation,
the Laboratoire d'Excellence Diversités Biologiques et
Culturelles (LabEx BCDiv), the Laboratoire d'Excellence
Diversités Biologiques et Culturelles (LabEx BCDiv, ANR-10-
LABX-0003-BCDiv), the Programme Investissement d'Avenir
(ANR-II-IDEX-0004-02), the Fonds Pacifique and CNRS
Institut Ecologie et Environnement. The expedition was
endorsed by the New Ireland Provincial Administration and
operated under a Memorandum of Understanding with the
University of Papua New Guinea. I am grateful to Laure
Corbari, Paula Lefevre-Martin and Anouchka Krygelmans at
MNHN and Zdeněk Duri&, University of Ostrava, Czech
Republic for help in making the collections available. I
acknowledge all the divers who collected samples, the
expeditioners who sorted them in the field.
I especially thank Peter Dworschak for checking and
photographing NHMW . material of X Eucalliaxiopsis
panglaoensis and E. dworschaki and for valuable comments
on the manuscript. I thank too Gustav Paulay, Amanda Bevis
and Arthur Anker for the loan of collections from the Florida
Museum of Natural History, University of Florida, so too
stephen Keable, Australian Museum, and Andrew Hosie,
Western Australian Museum. I am grateful to Martin Riddle,
Australian Institute of Marine Sciences, Townsville, for the
gift of eucalliacid specimens from the Great Barrier Reef.
Arthur Anker and Zdeněk Ďuriš kindly allowed me to publish
their colour photographs taken in the field.
This study was supported by the National Taxonomy
Research Grant Program (Grant numbers CN216-14 and
CBG18-06) from the Australian Biological Resources Study
and the MNHN Crosnier Fund in Paris.
References
Baker, W.H. 1907. Notes on South Australian decapod Crustacea. Part
V. Transactions of the Royal Society of South Australia 31: 173—
190, pls 23-25. http://biodiversitylibrary.org/page/4291 3923
Biffar, I. A. 1970. Three new species of callianassid shrimp (Decapoda,
Thalassinidea) from the western Atlantic. Proceedings of the
Biological Society of Washington 83: 35-50. https://
biodiversitylibrary.org/page/34572647
Borradaile, L.A. 1900. On the Stomatopoda and Macrura brought by
Dr. Willey from the South Seas. Pp. 395—428, pls 36—39 in: Willey,
A. (ed.), Zoological results based on the material from New Britain,
New Guinea, Loyalty Islands and elsewhere collected during the
years 1695, 1596, and 1897. Vol. 4. Cambridge University Press:
Cambridge. https://biodiversitylibrary.org/page/21340199
Borradaile, L.A. 1903. On the classification of the Thalassinidea.
Annals and Magazine of Natural History (ser. 7) 12: 534—551 +
Addendum on p.638. http://biodiversitylibrary.org/page/29993300
G.C.B. Poore
Borradaile, L.A. 1904. Marine crustaceans. XIII. The Hippidea,
Thalassinidea and Scyllaridea. Pp. 750—754 in: Gardner, J.S. (ed.),
The fauna and geography of the Maldive and Laccadive
Archipelagoes. Vol. 2 (3). Cambridge University Press: Cambridge.
http://biodiversitylibrary.org/page/10778854
Davie, P.J.F. 2002. Crustacea: Malacostraca: Phyllocarida,
Hoplocarida, Eucarida (Part 1). Vol. 19.3A. CSIRO Publishing:
Melbourne. xii, 551 pp.
Dworschak, P.C. 2005. A new species of Eucalliax Manning & Felder,
1991 (Decapoda: Callianassidae) from the Red Sea. Proceedings of
the Biological Society of Washington 118: 209—217. https://doi.
org/10.2988/0006-324X(2005)118[209: ANSOEM |2.0.CO;2
Dworschak, P.C. 2006. A new species of Eucalliax Manning & Felder,
1991 (Decapoda: Callianassidae) from the Philippines. Raffles
Bulletin of Zoology 54: 349—359.
Dworschak, P.C. 2014. The Axidea (Crustacea, Decapoda) of Cocos
(Keeling) and Christmas Islands, with description of a new species of
Eucalliax Manning & Felder, 1991. Raffles Bulletin of Zoology,
Supplement 30: 230—245. https://Ikcnhm.nus.edu.sg/rbz/supplement-
no-30/
Dworschak, P.C. 2018. Axiidea of Panglao, the Philippines: families
Callianideidae, | Eucalliacidae and Callichiridae, with a
redescription of Callianassa calmani Nobili, 1904. Annalen des
Naturhistorischen Museums in Wien, Serie B 120: 15—40.
Felder, D.L., and Manning, R.B. 1994. Description of the ghost shrimp
Eucalliax mcilhennyi, new species, from south Florida, with
reexamination of its known cogeners (Crustacea: Decapoda:
Callianassidae). Proceedings of the Biological Society of Washington
107: 340—353. https://biodiversitylibrary.org/page/35514977
Hale, H.M. 1927. The crustaceans of South Australia. Part I. South
Australian Government Printer: Adelaide. 201 pp.
Heard, R.W. 1989. Calliax jonesi, n. sp. (Decapoda: Thalassinidea:
Callianassidae) from the Northwestern Bahamas. Gulf Research
Reports 8: 129—136. https://doi.org/10.18785/grr.0802.05
Kneer, D., Asmus, H., and Jompa, J. 2013. Do burrowing callianassid
shrimp control the lower boundary of tropical seagrass beds?
Journal of Experimental Marine Biology and Ecology 446: 262—
272. http://dx.doi.org/10.1016/j.jembe.2013.05.023
Liu, W., and Liang, X. 2016. A new species of the genus Calliaxina
Negoc-Ho, 2003 from the South China Sea (Crustacea, Decapoda,
Axidea, Callianassidae). ZooKeys 635: $81-88. https://doi.
org/10.3897/zookeys.635.10385
Man, J.G. de 1928a. A contribution to the knowledge of twenty-two
species and three varieties of the genus Callianassa Leach.
Capita Zoologica 2: 1—56.
Man, J.G. de 1928b. The Decapoda of the Siboga-Expedition. Part 7.
The Thalassinidae and Callianassidae collected by the Siboga-
Expedition with some remarks on the Laomediidae. Siboga-
Expéditie 39a6: 1-187.
Ngoc-Ho, N. 2003. European and Mediterranean Thalassinidea
(Crustacea, Decapoda). Zoosystema 25: 439—555. http://sciencepress.
mnhn.fr/en/periodiques/zoosystema/25/3/thalassinidea-crustacea-
decapoda-d-europe-et-de-mediterranee
Negoc-Ho, N. 2014. Six species of Axiidea and Gebiidea from the Indo-West
Pacific (Crustacea, Decapoda). Zoosystema 36: 545-561. http://
sciencepress.mnhn.fr/en/periodiques/zoosystema/36/3/six-especes-d-
axiidea-et-de-gebiidea-de-I-indo-pacifique-ouest-crustacea-decapoda
Osawa, M., and Fujita, Y. 2016. Stomatopods and decapods of Axiidea,
Gebiidea and Anomura (Crustacea: Malacostraca) from Irabu-jima and
Shimoji-jima Islands, Miyako Group, southern Ryukyus, Japan [in
Japanese with English abstract and figure captions]. Fauna Ryukyuana
28: 37—56. http://w3.u-ryukyu.ac.]p/naruse/lab/2016E.html
Indo-West Pacific and Australian Eucalliacidae
Poore, G.C.B. 2004. Marine decapod Crustacea of southern Australia.
A guide to identification (with chapter on Stomatopoda by Shane
Ahyong). CSIRO Publishing: Melbourne. 574 pp.
Poore, G.C.B., and Dworschak, P.C. 2017. Family, generic and species
synonymies of recently published taxa of ghost shrimps (Decapoda,
Axidea, Eucalliacidae and Ctenochelidae): cautionary tales.
Zootaxa 4294: 119—125. http://doi.org/10.11646/zootaxa.4294.1.6
Poore, G.C.B., Dworschak, P.C., Robles, R., Mantelatto, F.L., and Felder,
D.L. 2019. A new classification of Callianassidae and related
families (Crustacea: Decapoda: Axiidea) derived from a molecular
phylogeny with morphological support. Memoirs of Museum
Victoria 78: 73—146. https://doi.org/10.24199/1.mmv.2019.78.05
Robles, R., Dworschak, P.C. Felder, D.L., Poore, G.C.B., and
Mantelatto, F.L. 2020. A molecular phylogeny of Callianassidae
and related families (Crustacea: Decapoda: Axiidea) with
morphological support. /nvertebrate Systematics 38: in press.
https://doi.org/10.1071/1S19021
Poore, G.C.B., and Griffin, D.J.G. 1979. The Thalassinidea (Crustacea:
Decapoda) of Australia. Records of the Australian Museum 32:
217—321. http://do1.org/10.3853/).0067-1975.32.1979.457
Rodrigues, S.d.A., and Manning, R.B. 1992. Two new callianassid
shrimps from Brazil (Crustacea: Decapoda: Thalassinidea).
Proceedings of the Biological Society of Washington 105: 324—
330. https://biodiversitylibrary.org/page/35607497
Saint Laurent, M. de 1979. Note 14, in de Saint Laurent, M. and Le
Loeuff, P., Campagnes de la Calypso au large des côtes Atlantiques
Africaines (1956 et 1959) (suite) 22. Crustacés Décapodes
Thalassinidea. I. Upogebiidae et Callianassidae. In: Forest, J.
(ed.), Résultats Scientifiques des Campagnes de la Calypso. Fasc.
11 (22). Annales de l'Institut Océanographique, Monaco et Paris
55 Suppl.: 95.
saint Laurent, M. de, and Le Loeuff, P. 1979. Campagnes de la
Calypso au large des cótes Atlantiques Africaines (1956 et 1959)
(suite). 22. Crustacés Décapodes Thalassinidea. I. Upogebiidae et
Callianassidae. In: Forest, J. (ed. Résultats Scientifiques des
Campagnes de la Calypso. Fasc. 11 (22). Annales de l'Institut
Océanographique, Monaco et Paris 55 suppl.: 29-101.
Saint Laurent, M. de, and Manning, R.B. 1982. Calliax punica, espèce
nouvelle de Callianassidae (Crustacea, Decapoda) des eaux
méditerranéennes. Quaderni del Laboratorio di Tecnologia della
Pesca 3: 211—224.
41
Sakai, K. 1966. On Callianassa (Callichirus) novaebritanniae
Borradaile (Thalassinidea, Crustacea) from Japan. Journal of the
Faculty of Agriculture, Kyushu University 14: 161—171.
Sakai, K. 1987. Two new Thalassinidea (Crustacea: Decapoda) from
Japan, with the biogeographical distribution of the Japanese
Thalassinidea. Bulletin of Marine Science 41: 296-308.
http://www.ingentaconnect.com/content/umrsmas/
bullmar/1987/0000004 1/00000002/art00018
Sakai, K. 1988. A new genus and five new species of Callianassidae
(Crustacea: Decapoda: Thalassinidea) from northern Australia. The
Beagle, Occasional Papers of the Northern Territory Museum of Arts
and Sciences 5: 51—69. https://biodiversitylibrary.org/page/55688670
sakai, K. 1999. Synopsis of the family Callianassidae, with keys to
subfamilies, genera and species, and the description of new taxa
(Crustacea: Decapoda: Thalassinidea). Zoologische Verhandelingen
326: 1-152. http://www.repository.naturalis.nl/record/219414
Sakai, K. 2002. Callianassidae (Decapoda, Thalassinidea) in the
Andaman Sea, Thailand. Phuket Marine Biological Center
Special Publication 23: 461—532.
Sakai, K. 2005. Callianassoidea of the world (Decapoda:
Thalassinidea). Crustaceana Monographs 4: 1—285.
Sakai, K. 2011. Axioidea of the world and a reconsideration of the
Callianassoidea (Decapoda, Thalassinidea, Callianassida).
Crustaceana Monographs 13: 1-616.
sakai, K. 2017. A second report on material from Dr. Mortensen's
collection of Thalassinidea and Callianassidea (Decapoda) 1n the
Zoological Museum, Copenhagen. Crustaceana 90: 1117-1144.
https://do1.org/10.1163/15685403-00003583
Sakai, K. 2018. A revised classification of genera in the subfamily
Eucalliacinae Manning & Felder, 1991 [sensu Sakai], with
confirmation of the validity of Calliaxiopsis madagassa Sakai &
Türkay, 2014 (Decapoda, Thalassinidea auct.). Crustaceana 91:
733—745. http://doi.org/10.1163/15685403-00003789
Sakai, K., and Türkay, M. 2014. A review of the collections of the
Infraorders Thalassinidea Latreille, 1831 and Callianassidea
Dana, 1852 (Decapoda, Pleocyemata) lodged in three German
museums, with revised keys to the genera and species. Crustaceana
87: 129—211. http://doi.org/10.1163/15685403-00003281
Tudge, C.C., Poore, G.C.B., and Lemaitre, R. 2000. Preliminary
phylogenetic analysis of generic relationships within. the
Callianassidae and Ctenochelidae (Decapoda: Thalassinidea:
Callianassoidea). Journal of Crustacean Biology 20 (Special Issue
2): 129-149. https://doi.org/10.1163/1937240X-90000015
Memoirs of Museum Victoria 80: 43-58 (2021) Published 2021
1447-2554 (On-line)
httos://museumsvictoria.com.au/collections-research/journals/memoirs-of-museum-victoria/
DOI https://doi.org/10.24199/j.mmv.2021.80.03
Initiation and early development of the postcanine deciduous dentition in the
dasyurid marsupial Dasyurus viverrinus
WINTER PATRICK LUCKETT!**, NANCY HONG LUCKETT?**, AND TONY HARPER?*
Abstract
! Center for Functional Anatomy and Evolution, Johns Hopkins University School of Medicine, Baltimore, Maryland, USA
? Caribbean Primate Research Center Museum, University of Puerto Rico, Medical Sciences Campus, San Juan, Puerto
Rico, USA
? DeBusk School of Osteopathic Medicine, Lincoln Memorial University, Knoxville, Tennessee, USA.
* To whom correspondence should be addressed. Email: anthony.harper@|munet.edu
** Deceased
Luckett, W.P., Hong Luckett, N., and Harper, T. 2021. Initiation and early development of the postcanine deciduous
dentition in the dasyurid marsupial Dasyurus viverrinus. Memoirs of Museum Victoria 80: 43—58.
There has been disagreement for more than 100 years concerning the presence or absence of deciduous and
successional third premolars in the dentition of the Australian dasyurid marsupial Dasyurus viverrinus as well as 1n other
species of the genus Dasyurus. Most authors during the 19th and 20th centuries have considered the missing premolar in
Dasyurus to be the third premolar family in both jaws, in part because of the reduction in size of the third deciduous
premolar in many other genera of dasyurids. While other authors, found "the deciduous premolar to be constantly present
in the young mammary foetus as a small and precociously calcified vestigial tooth". However, the fate of this deciduous
tooth, and its possible successor in later developmental stages, was never described; and the vestigial dp3 and its possible
successor were assumed to undergo absorption during foetal life. With access to later developmental stages of Dasyurus
viverrinus, via the extensive collections of Professor J.P. Hill, we present new evidence for the later development of dP3
and P3 in both jaws, the probable eruption of the successional P3 in both jaws and evidence that dP2 1s the missing tooth
in both jaws of this dasyurid species.
Keywords
Introduction
During the years 1895-1905, when he was a Demonstrator of
Biology at the University of Sydney, Australia, Professor James
P. Hill collected a large sample of juveniles of the dasyurid
marsupial Dasyurus viverrinus, ranging from newborn young
to individuals about four months old. The species was still
relatively common in New South Wales at the time and the
animals lived relatively well in captivity. Many of these
captive-bred dasyurids produced the dated pouch young that
are the subject of this paper. Although Hill and colleagues
published several papers on the early development, placentation
and reproduction in general of Dasyurus, only one paper dealt
specifically with the development of the pouch young.
An extensive series on the development of the growth stages
in the pouch young of Dasyurus viverrinus was examined in a
monograph by Hill and Osman Hill (1955). The authors
presented 16 figures of the pouch young, and they described in
detail the external morphology of the developing young in a
series of stages labelled A to P. These ranged from unattached
newborn young outside and inside the pouch, measuring 5.5—
Dasyurus, deciduous dentition, dental development, dental homologies, pouch young
6.0 mm greatest length (GL) and 2.5 mm head length (HL;
stage A), up to adolescent young that were four months old
(stage P). These oldest young were freely moving about outside
the pouch and measured about 60 mm HL. However, no
description or figures of the microscopic anatomy of the
developing teeth were presented. Unfortunately, Hill passed
away in 1954 during the preparation of their manuscript. We
suspect that Hill would have published a detailed description of
the developing dentition if he had lived longer. After his death,
at least a portion of his collections of mammalian embryos and
young animals was donated to the Hubrecht Laboratory of
Comparative Embryology, Utrecht, Netherlands. These
included a series of histological sections of some of the
Dasyurus viverrinus pouch young described by Hill and
Osman Hill (1955) and some older juveniles preserved as
alcohol specimens. A few of the alcohol specimens from Hill's
collection were borrowed and sectioned by Professor Louis
Bolk, University of Amsterdam, Netherlands, and then returned
to the Hubrecht Laboratory of Comparative Embryology.
44
Materials and methods
It 1s rare to be able to histologically examine closely related
stages of early developing pouch young for any marsupial,
and we were able to study three unattached intrauterine
embryos and 22 early developing stages of pouch young
attached to the nipple for Dasyurus viverrinus from the Hill
collection. The pouch young examined range in age from
about 30 hours old, measuring about 6 mm GL, to 40—41 days
old, and measuring about 29 mm GL. Given that this species
appears to be a useful model for the developmental
relationships of the dentition 1n the extinct dasyuromorphian
Thylacinus cynocephalus (see Luckett et al., 2019), along with
other marsupicarnivore taxa, we present this overview of
early dental development in Dasyurus viverrinus. These
studies were carried out over a period of several years at the
Hubrecht Laboratory of Comparative Embryology before the
embryological collections were transferred to their present
home in the Museum für Naturkunde, Berlin, Germany.
It should be noted that Dasyurus viverrinus 1s probably
extinct on mainland Australia, with a last sighting on January
1963 in the suburbs of Sydney (Dickman et al., 2001). The
species persists in Tasmania , although it 1s vulnerable there
for several reasons, including climate change and disease,
among other possibilities (Fancourt, 2016).
A brief overview of our findings on dental development in
Dasyurus was presented previously (Luckett, 1989, 1993). We
have made new drawings of four of the developing pouch
young (fig. 1) examined by us from the Hill collection, ranging
from an early attaching pouch young of about 30 hours old to
an embryo of about 41 days old, measuring about 29 mm GL
and 18 mm HL. Most genera of dasyurids, peramelids and
didelphids have three premolars in both jaws of adults. This is
presumably the primitive condition for marsupials (Cifelli et
al., 1996). Emphasis in our study is given to the evidence for
loss of dP2 in this dasyurid with two premolars, and the
accelerated development of dP3 and P3, when compared with
these features in dasyurids with three premolars. A summary
of the major features of early development for the deciduous
and successional dentition in marsupials is presented ın fig. 2.
Results
Early development of the dental lamina
Hill and Osman Hill (1955) noted that the earliest date of
gestation was 16 days in their sample of Dasyurus viverrinus
embryos. The earliest evidence of a dental lamina that we
found was detected in the maxilla of three intrauterine
embryonic stages of 5.5—6 mm GL. In the youngest of these
embryos, the dental lamina was detected bilaterally in the
upper jaw as a localised thickening of the oral epithelium that
was associated with a very early differentiation of bone (or
prebone) in the distal portion of the developing maxilla. In
contrast, the dental lamina and developing bone were not yet
detected in the premaxillary region of the upper jaw. The
more mature intrauterine young showed dental lamina
thickenings in both the premaxilla and maxilla regions of the
upper jaw. The dental lamina was not yet evident 1n the lower
W.P. Luckett, N. Hong Luckett & T. Harper
Jaw of the youngest intrauterine embryo. As explained by Hill
and Osman Hill (1955), the newborn young of Dasyurus
viverrinus are able to find their way to the mother’s pouch,
unaided by the mother and helped by their own well-developed
forelimbs that have very sharp deciduous claws.
In the youngest pouch young attached to the mother’s
nipple, examined at about 30 hours old and measuring 6 mm
GL, a continuous dental lamina was present bilaterally in both
the upper and lower jaws. This specimen was illustrated as
fig. 5 by Hill and Osman Hill (1955) and we have redrawn this
important specimen in our fig. la. The HL of this pouch
young was 3.25 mm. It should be noted here that all of our
measurements from the Hill collection are taken from
specimens that had been placed in spirit fixation by Hull. In
the upper jaw, three early-bud thickenings are evident on the
dental lamina (see fig. 2a for the relations between the dental
lamina and an early bud). The most rostral of these is
associated with the premaxillary ossification, the next is
adjacent to the rostral end of the developing maxillary bone,
and the distal bud occurs at the caudal end of the dental
lamina and is associated with the distal extent of the maxillary
ossification. Based on their bony relationships and comparison
with later ontogenetic stages, these tooth buds can be
identified as dI2 or dI3 anteriorly, dC and dP3, respectively.
The dP3 bud lies beneath the level of the anterior half of the
eye. An overview of the major features of dental development
for the postcanine dentition in the upper and lower jaws is
summarised in Tables ] and 2.
The bud for the early developing incisors in the upper jaw
does not occur at the rostral-most extent of the premaxilla;
instead, it is positioned somewhat more distolateral. It is unclear
whether this developing tooth germ is dI2 or dI3 at this early
stage. The late or retarded development of dll in the upper jaw
of dasyurids, peramelids and didelphids was noted by Thomas
(1887). Later, Guiler and Heddle (1973) suggested that the late
development and eruption of dll helped the continued suckling
of the young. In the lower jaw, a large early bud 1s evident at the
rostral extent of the dentary ossification. Two small bud-like
thickenings occur distal to the rostral early bud (presumably
dil), but these are not as distinct as the dil. It should be noted
here that adult dasyurids possess four upper and three lower
incisors, in contrast to the presumably primitive condition in
ancestral marsupials and didelphids, which possessed five
upper and four lower incisors. It is unclear to us which incisor
has been lost 1n each jaw of Dasyurus, so we will simply call
them [1-4 above and 11-3 below.
We next examined a three-day-old embryo measuring 7
mm GL and 4 mm HL (see fig. 6 in Hill and Osman Hill,
1955). Two small deciduous incisors were in an early-bud stage
rostrally 1n the upper jaw. The moderately sized deciduous
canine was in a more distinct early-bud stage. It had a more
darkly stained abnormal buccal portion and a more normal
pale-stained lingual portion. Based on later developing stages,
the darkly stained buccal portion represents the primordium of
the rudimentary deciduous canine, and the more normal
lingual portion represents the primordium of the successor
canine. These modified relationships for the developing
deciduous and successional incisors and canines were
Initiation and early development of the postcanine deciduous dentition in the dasyurid marsupial Dasyurus viverrinus
Table 1. Development of Dasyurus viverrinus upper postcanine dentition
30 hour PY
6 mm GL
(3.25 mm HL)
5—6 day PY
8 mm GL
(4.5 mm HL)
7 day PY
9 mm GL
(5.5 mm HL)
10 day PY
10.5 mm GL
(6.5 mm HL)
10 day PY
11 mm GL
(7 mm HL)
14 day PY
13 mm GL
(8 mm HL)
14 day PY
13.5 mm GL
(8 mm HL)
15-16 day PY
14mm GL
(9 mm HL)
19 day PY
17 mm GL
(10 mm HL)
~19-20 day
PY
16-17 mm GL
~19 day PY
16-18 mm GL
<
<
EN
C
Early bud
No trace No trace
No trace No trace Early to
middle bud
a
E
Slight No trace rly
swelling of
N
Early cap Tiny bud-like | Middle to late
thickening bell, flat
lamina
Early cap No trace Small, late
bell, thin
dentin, flat
successional
lamina
Early bell No trace Moderately
developed
dentin,
successional
lamina
mesially
Late cap to No trace Moderately
thick dentin,
thin enamel;
successional
lamina
mesially
Very early
bud-like
thickening
Late bud to
early cap
Middle to late
Early cap
cap
Early
bud- like
swelling
Middle bell
Middle bell
middle bell
Early cap
Late bud to
early cap
lamina
No trace Early to
middle bell,
flat
successional
lamina
successional
Early bell No trace Moderately
developed
dentin,
successional
lamina
mesially
early bell
46 W.P. Luckett, N. Hong Luckett & T. Harper
25 day PY
20 mm GL
(12.5 mm HL)
Middle to late | No trace thick dentin, | Early to Late bell, Early cap
thin enamel; | middle cap possible
lingual odontoblasts
successional
lamina
No trace Moderately | Late bell, Moderately | Middle to late
thick dentin, | early developed bell
thin enamel; | odontoblasts | dentin, thin
lingual enamel on
successional metacone
lamina
moderately No trace Moderately | Late bell, thin | Moderately | Middle to late
thick dentin, thick dentin, | dentin thick dentin, | bell
moderately thin enamel; thin enamel
developed mesio- on metacone
enamel lingual
successional
lamina intact
Moderately | No trace Moderately | Late bell, thin | Moderately | Late bell with | Early to
thick dentin, thick dentin, | dentin thick dentin | thin dentin middle bud
moderately thin enamel; and enamel
developed incomplete on metacone
enamel mesio-lingual
successional
lamina
Note: GL, greatest length; HL, head length; PY, pouch young
~30-35 day PY
~23 mm GL
~35 day PY
~23—25 mm GL
13.5 mm HL
~40-41 day PY
~29 mm GL
18 mm HL
Table 2. Development of Dasyurus viverrinus lower postcanine dentition
30 hour PY No trace No trace
6 mm GL bud-like
(3.25 mm HL) thickening
5—6 day PY No trace No trace Middle to late
8 mm GL
(4.5 mm HL)
5—6 day PY No trace No trace Late bud to
5.5 mm GL early cap
(4.5 mm HL)
6-7 day PY No trace No trace Late bud
9 mm GL
(5 mm HL)
10 day PY Flattened No trace
11 mm GL early bud
(7 mm HL)
14 day PY Flattened late | Possible
13 mm GL bud to early | slight
(8 mm HL) cap swelling
Middle bell, Early bud
short flat
successional
lamina
lingually
Initiation and early development of the postcanine deciduous dentition in the dasyurid marsupial Dasyurus viverrinus 47
Stage {apt j|dp — dp — fmt — |m | — |m ——
~14 day PY
13.5 mm GL
(8 mm HL)
-15-16 day PY
14 mm GL
(9 mm HL)
19 day PY
17 mm GL
(10 mm HL)
~19-20 day PY
16-18 mm GL
Bolk
25 day PY
20 mm GL
(12.5 mm HL)
~30-35 day PY
~23 mm GL
Bolk
~35 day PY
23—25 mm GL
Bolk
13.5 mm HL
~40-41 day PY
~29 mm GL
Bolk
18 mm HL
Late bud to
early cap
Early cap
Late cap to
early bell
Early bell
slight
swelling of
dental lamina
slight
swelling of
dental lamina
slight
swelling of
dental lamina
Possible
slight
swelling
Middle bell
Late bell, thin
dentin
Late bell,
moderately
developed
dentin, thin
enamel
Moderately
thick dentin,
moderately
developed
enamel
Late bell, no
odontoblasts,
lingual
successional
lamina
small
abnormal
bell,
moderately
developed
dentinal cap
Moderately
developed
dentin;
mesio-lingual
successional
lamina
Small,
moderately
thick dentinal
arc, thin
enamel
Small, thick
dentin, thin
enamel
Small,
abnormal
dentinal mass,
with thin
enamel
Abnormal,
moderately
thick dentinal
arc with thin
enamel
Tiny, solid
dentinal mass
with thin
enamel
Possible early | Middle bud
bud-like
swelling
m i BEN
bud-like
Middle to late
bell
swelling
Middle to late | Late cap
bell
Late bell, thin | Middle to late
bell
to moderately
Late bell, Early bell o
Possible early
bud-like
swelling
Early
bud-like
swelling at
mesial end of
dp3
Early bud
Moderately
sized, middle
to late cap,
mesial to
abnormal dp3
Moderately
thick dentin
and
moderately
developed
enamel on
protoconid
developed
dentin
moderately
developed
dentin, thin
enamel
Moderately
large, early to
middle bell
Moderately
thick dentin,
moderately
Moderately
thick dentin,
thin enamel
Middle to late
bell
developed
enamel on
protoconid
Thick dentin,
moderately
thick enamel
on protoconid
Late bell,
moderately
developed
dentin
Probable
early bud
Moderately
large, late
bell, possible
odontoblasts
Moderately
thick dentin,
moderately
developed
enamel on
protoconid
Note: GL, greatest length; HL, head length; PY, pouch young
48 W.P. Luckett, N. Hong Luckett & T. Harper
Figure 1. Four early pouch young of Dasyurus viverrinus: a, 30 hours old, 3.25 mm head length (HL); b, 5—6 days old, 4.5 mm HL; c, 14 days old,
8 mm HL; d, 25 days old, 12.5 mm HL.
Initiation and early development of the postcanine deciduous dentition in the dasyurid marsupial Dasyurus viverrinus 49
as = - ut - d " — —
B "T « wm , - Ld > "T x
e t. = = å : 7 2 I os At p T€ *
3215 SIDOCHS iG, "apta nmi
: - = ™ * » D as P
PRI.IS
Ze a
> = ~ " + = + = 3 Ww £m E3
=", AZ oye > -. = & = = -—— a T B= -—— =
Sr-seno® "ITIT 1414-2431. l 4 la
= 3 à : a
"me
ees
"n
1
i
="
I.
"Ea.
. re "ng
* m =."
u—— o ao mm, e mme 1 e" , =
w- wa s: eS ea" Atl te Ds » 4
TEOR TAS
PEL i
= 2. Feu ao T
=”. —
= e——— Ss we += E
ore. APs Vn ; '
| |
m ru. morum mE T VE
eRIrriccpDcestrnrrvr uo id
Figure 2. Transverse sections of early developmental stages of the dentition 1n marsupials: a, early tooth bud forming from the dental lamina; b,
early-cap stage; c, middle-bell stage with elongate dental lamina; d, late-bell stage with odontoblasts and early lingual successional lamina; e,
well-developed late-bell stage with dentin and enamel. A successional early-cap stage develops from the lingual successional lamina, showing
early fragmentation of the dental lamina. Abbreviations: AM, ameloblasts; D, dentin; DL, dental lamina; DP, dental papilla; E, enamel; IEE,
inner enamel epithelium; OD, odontoblasts; OEE, outer enamel epithelium; SL, successional lamina; SR, stellate reticulum; TB, tooth bud.
previously described in detail for marsupials (Luckett, 1993).
The dental lamina was reduced distal to the developing canine.
The lamina became thickened again distally at the level of the
rostral end of the developing eye. It then gave rise to a moderate
size early- to middle-bud stage dP3. The dental lamina and the
maxillary bone disappeared distal to the dP3 bud.
In a slightly older embryo, 5—6 days old and measuring 8
mm GL and 4.5 mm HL (see fig. 7, Hill and Osman Hill, 1955,
and our fig. 1b), three early developing incisors are now
evident in the premaxillary region of the upper jaw. The
anterior two incisors are moderately sized and flattened in the
early- to middle-bud stages. The third incisor 1s moderately
large and more spherical in the middle-bud stage, and is
located nearer the distal end of the premaxilla. It has a smaller
darkly stained buccal portion and a larger lingual lobular
portion with lighter, normal-appearing cells. Based on its
appearance in later developmental stages, these represent the
buccal deciduous incisor and the more normal-appearing
lingual successor incisor.
A moderately large late-bud to early-cap stage canine
develops at the rostral extent of the maxilla. This also consists
of a smaller darker buccal portion and a larger lingual paler-
staining portion, representing the future deciduous and successor
canines, respectively. The dental lamina 1s reduced distal to the
developing canine and continues distally towards the level of
the middle of the eye. At this region, the dental lamina enlarges
and gives rise to a moderately large early-cap stage dP3, formed
by invagination of the underlying dental papilla cells (see fig. 2b
for an example). The dental lamina then disappears a short
distance distal to this tooth, near the distal end of the eye.
50
In the lower jaw, three developing incisors are in early- to
late-cap stages at the rostral extent of the dentary. The dil is
in a late-cap stage, with possible odontoblasts buccally and a
lingual projection for an early successor bud for il. The di2
has an early-cap stage buccally and a distolingual projecting
lamina for a possible successor 12. The smaller di3 has a less
distinct buccal early cap with a relatively indistinct lingual
successional lamina. The moderately sized dc is in a late-bud
stage with a lingual successional ridge. The dental lamina
continues distally as a thin ridge with no suggestion of a dpl
or dp2. The dental lamina then thickens again distally,
beneath the level of the distal portion of the eye, and gives rise
to a moderately large late-bud to early-cap stage dp3. The
dental lamina then ends distal to this developing tooth.
In a 10-day-old pouch young with a 6.5 mm HL and a
10—10.5 mm GL (see fig. 9 in Hill and Osman Hill, 1955),
there is little change in the developing incisor and canine
regions of the upper jaw. The dental lamina immediately
distal to the canine exhibits a somewhat flattened early bud-
like thickening for a possible primordium of dP1, but this is
not very distinct. The dental lamina is then reduced and
extends distally. At the level of the middle portion of the eye,
the dental lamina thickens again and gives rise to a moderately
large early-cap stage dP3. The dental lamina then ends distal
to this tooth. In the lower jaw, there is also a moderately sized
early-cap stage dp3 and no trace of a developing dpl.
In a slightly larger 10-day-old pouch young (7 mm HL
and 1] mm GL), several distinct changes have occurred
compared with the preceding specimen. The developing
incisor region remains similar, whereas the deciduous canine
has a tiny buccal nodule associated with a large distolingual
projecting late-bud to early-cap stage successor canine in the
upper jaw. Immediately following the canine is a tiny,
somewhat flattened, probable early bud for dPl. The dental
lamina is reduced distal to this early bud and extends distally
to underlie the eye, where it enlarges to form a moderately
sized middle-cap stage dP3. There was no distinct swelling of
the dental lamina between the dP3 and the probable early-bud
stage dPl. The dental lamina extends slightly distal to dP3
before it disappears.
Note that in the early developing pouch young, there is
little space in the jaws for the developing anterior dentition,
due in part to the greatly enlarged tongue and its intimate
association with the large nipple (fig. 3). This often results in
ereat compression and flattening of the more anterior
developing teeth, whereas there is less compression distally in
the region of the developing dP3 and molars.
In the lower jaw, there is also a small, flattened early-bud
stage for dpl. The dental lamina is then reduced as it extends
distally to form a moderately sized early- to middle-cap stage
dp3. The dental lamina then ends distal to dp3. As in dasyurids
with three premolars, the sequence of early development for
the premolars in both jaws 1s dP3 > dP1 > dP2. As noted in
this and later stages, it is the late-developing dP2 that is lost 1n
both jaws of dasyurids with only two premolars.
In an older 14-day-old pouch young, with 8 mm HL and
13 mm GL (see fig. 10 in Hill and Osman Hill, 1955, and our
fig. Ic), the developing relationships for dll and dI2 in the
W.P. Luckett, N. Hong Luckett & T. Harper
upper jaw were similar to those of the previous stage. In
contrast, dI3 has an early cap knot enclosing a tiny dentinal
arc. The small distolingual successional bud for I3 1s still
relatively small. A small buccal epithelial knot is evident for
dC, and there is a large middle-bud stage successor for the
canine that is associated with a deep maxillary alveolus. A
small, flattened late-bud to early-cap dP! follows the canine
immediately, and then the dental lamina is reduced distal to
this. There is a possible slight swelling of the dental lamina
beneath the anterior end of the eye, but this is not very distinct.
The dental lamina is then reduced distal to this slight swelling.
The dental lamina enlarges further distally and gives rise to a
moderately sized early- to middle-bell stage dP3 beneath the
middle third of the eye (see fig. 2c for a middle-bell stage
tooth). This tooth is still intact with its primary dental lamina
origin. A flattened lingual successional lamina extends mesial
to dP3. Distal to dP3 is a moderately sized late-bud stage M1
underlying the distal end of the large eye. The dental lamina
ends distal to this tooth.
In the lower jaw, the dil is small and cap like, enclosing
thin distinct dentin. Distolingual to this is the larger early-bud
stage successor 1l. The di2 1s also a small cap with an irregular
dentinal fragment; a slightly larger successor 12 is placed
distolingually in a late-bud to early-cap stage. The tiny di3
cap lacks dentin, and its distolingual successor ridge lacks a
distinct successor tooth. The small, dark cap for dc lacks
dentin and has a distolingual middle-bud stage successor
canine. The small, flattened dpl follows immediately and is in
the late-bud to early-cap stage. There 1s no distinct evidence
for a dp2 swelling. Somewhat more distally there is a small
middle-bell stage dp3 with a short, flattened lingual
successional lamina. Immediately distal to this tooth is a
moderately sized early bud for ml. The dental lamina
disappears distal to this developing tooth.
In a slightly larger 14-day-old pouch young (13.5 mm GL
and 8 mm HL; see fig. 10 in Hill and Osman Hill, 1955), some
notable changes are evident in the canine and postcanine
dentition. The successor canine 1s now in the early- to middle-
bell stage in the upper jaw. The tiny, flattened dPl is in the
early-cap stage. The dental lamina becomes reduced distal to
this tooth and then enlarges slightly to form a possible
primordium for a rudimentary dP2. However, the dental
lamina is reduced distal to this slight swelling and then
enlarges further distally and gives rise to a moderately large
middle- to late-bell stage dP3. This tooth has moderately
developed stellate reticulum, and a short, slender lingual
successional lamina extends mesial to this tooth (see fig. 2d
for a late-bell stage with a lingual successional lamina). The
dP3 lies beneath the middle region of the eye. The primary
dental lamina extends distal to dP3 and gives rise to a
moderately large late-bud M1 beneath the distal region of the
eye. The dental lamina then disappears distal to this bud.
In the lower jaw, the successor canine is now in the late-
bud to early-cap stage. This is followed immediately by the
small, elongate late-bud to early-cap stage dpl. The dental
lamina is slightly swollen distal to this tooth, but this is not
very significant. Further distally, the small dp3 is in the late-
bell stage with moderately developed stellate reticulum but no
Initiation and early development of the postcanine deciduous dentition in the dasyurid marsupial Dasyurus viverrinus 51
Figure 3. Transverse section through the head at the level of the developing eyes in a 10-day-old Dasyurus viverrinus embryo ( 7 mm head length).
Note the close compression between the large tongue (T) and the nipple (N). No developing teeth are evident.
dentin. There is a lingual successional lamina that extends
mesial to dp3 and terminates with a slight bud-like swelling.
Distal to dp3 is a large middle-bud stage ml, and then the
dental lamina disappears distal to this.
In a slightly older pouch young (13-15 mm GL and 9 mm
HL) estimated to be 15—16 days old, a significant change has
occurred in the postcanine region of the upper jaw. The small
dPl is in the early-cap stage and the dental lamina 1s greatly
reduced distal to this tooth without any suggestion of a
swelling for a rudimentary dP2. Further distally, the small to
moderate sized dP3 is in the late-bell stage with thin dentin on
its apex. The tooth 1s relatively superficial with a short, intact
primary dental lamina stalk to the oral epithelium. The tooth
lies beneath the anterior 75 of the eye. The slender lingual
successional lamina extends mesial to the tooth and then
enlarges to form a moderately sized early-cap stage successor
P3. The successor P3 extends mesially beneath the anterior
margin of the eye. Distal to this, a moderately large middle- to
late-cap stage M1 develops beneath the level of the middle of
the eye. The dental lamina then disappears distal to this tooth.
In the lower jaw, the dpl is a moderately sized early-cap
stage. The dental lamina 1s reduced distal to this tooth; there
is a slight swelling distally, but this 1s not very distinct.
Further distally, the dental lamina enlarges again and gives
rise to a small to moderately sized, somewhat abnormal dp3
with an irregular, moderately developed dentinal cap. There is
a short, primary dental lamina stalk to the oral epithelium.
The tooth is in a shallow bony alveolus and has a flattened
lingual successional lamina. Distal to this tooth is a large
middle-bell stage ml. The dental lamina disappears distal to
the developing molar. In both jaws, the dP3 appear to be
relatively smaller than 1n earlier stages and they lie closer to
the oral epithelium.
In the later developmental stages, we will only discuss the
postcanine development of the Dasyurus pouch young
because there 1s little controversy concerning the development
of the incisor and canine regions. [n a 19-day-old pouch young
(I7 mm GL and 10 mm HL; see fig. 11 in Hill and Osman
02
Hill, 1955), the small dPl is somewhat flattened or compressed
and has now attained the early-bell stage in the upper jaw. The
dental lamina is reduced distal to this tooth and becomes
detached from the oral epithelium. The dental lamina
becomes reattached further distally and forms an early bud-
like swelling; this possibly represents the rudiment of a dP2.
The dental lamina is then reduced again and extends further
distally; it then enlarges to form a small late-bell stage dP3.
There is moderately developed dentin but no enamel on this
small tooth. It lies beneath the middle of the eye in a shallow
bony alveolus. A lingual successional lamina extends mesially
from dP3 and forms a slight bud-like thickening. As noted in
the later developmental stages, this thickening is the
primordium for the later developing successor P3. The dental
lamina extends distal to dP3 and then enlarges to form a
moderately large middle-bell stage M1. This tooth lies
beneath the distal half of the eye; the dental lamina disappears
distal to this tooth.
In the lower jaw, dpl 1s a moderately sized, late-cap to early-
bell stage tooth with a shallow bony alveolus. The dental lamina
is slightly swollen distal to this tooth (possibly representing the
site of the lost dp2); then further distally, the dental lamina
thickens again and gives rise to a small late-bell stage dp3 with a
moderately developed layer of dentin. The lingual successional
lamina of this tooth extends mesially, where it is slightly
thickened terminally. The dental lamina extends distal to this
tooth and gives rise to a large middle- to late-bell stage ml. The
dental lamina disappears distal to this tooth.
In a later pouch young of 19—20 days old (16-18 mm GL),
sectioned by Dr Louis Bolk, the dPl is a small tooth in the late-
cap to early-bell stage 1n the upper jaw. The dental lamina distal
to this tooth is detached from the oral epithelium. There is no
trace of a possible rudimentary dP2. Further distally, the dental
lamina reappears and gives rise to a small, late-bell stage dP3
with moderately thick dentin and a thin film of early enamel.
The lingual successional lamina of dP3 extends mesially and
gives rise to a small late-bud to early-cap stage successor P3,
which lies anterior to dP3 (see fig. 2e for a late-bell stage dP3
and its successor early-cap stage P3). Distal to dP3, the dental
lamina gives rise to a moderately large early- to middle-bell
stage M1. The dental lamina then disappears distal to this tooth.
In the lower jaw, the moderately sized dpl is in the early-
bell stage. The tooth 1s somewhat compressed and lies in a
shallow bony alveolus. There is only a slight possible swelling
of the dental lamina distal to this tooth 1n the region of the
missing dp2. Further distally, the dental lamina thickens again
and gives rise to a small late-bell stage dp3 with a moderately
thick arc of dentin. There is also a thin layer of darkly stained
enamel. The slender lingual successional lamina adjacent to
dp3 extends mesially and 1s enlarged as a slight early bud-like
swelling for the future successional p3. The dental lamina is
reduced distal to dp3 and then enlarges again to form a large
middle- to late-bell stage ml. Distal to this tooth is a
moderately large late-cap stage for m2. The dental lamina
disappears distal to this tooth.
In another 19—20-day-old pouch young (10 mm HL and
16-17 mm GL), there are slight advancements for some of the
developing teeth. A moderately sized dPl is 1n the early-bell
W.P. Luckett, N. Hong Luckett & T. Harper
stage in the upper jaw. There is no distinct evidence for a
rudimentary dP2 swelling distal to this tooth. The dental
lamina thickens further distally and gives rise to a small to
moderately sized late-bell stage dP3 with moderately
developed dentin on its crown. There is a shallow bony
alveolus for the tooth, which lies beneath the anterior third of
the eye. The lingual successional lamina of dP3 extends
mesially and thickens to give rise to a small early-cap stage
successor P3. Distal to the dP3, the dental lamina thickens
again and gives rise to a moderately large middle-bell stage
M1. This tooth is positioned beneath the middle of the eye.
The dental lamina thins and then disappears distal to MI.
In the lower jaw, a moderately sized dpl is 1n the late-cap
to early-bell stage. There is no distinct evidence for a
rudimentary dp2 distal to this tooth. Further distally, there 1s
a small, somewhat abnormal dp3 with a moderately developed
dentinal arc but no stellate reticulum. The lingual successional
lamina of dp3 ıs slightly thickened mesially and then gives
rise to a small middle-bud stage successor p3 further
anteriorly. Distal to dp3, the dental lamina enlarges and gives
origin to a large middle- to late-bell stage ml. Distal to this
tooth, the dental lamina gives rise to a moderately sized late-
cap stage m2. The dental lamina then disappears distal to this
tooth. Note that in the 19—20-day-old pouch young, the
dentition in the lower jaw is accelerated in its development
compared with that in the upper jaw; this trend continues to
increase in later developmental stages.
In a later 25-day-old pouch young (20 mm GL and 12.5
mm HL; see fig. 12 in Hill and Osman Hill, 1955, and our
fig. Id) that has been sectioned longitudinally, dPl is a small
to moderately sized tooth in the middle- to late-bell stage in
the upper jaw (fig. 4). As in the previous stage, there is no
suggestion of a dP2 rudiment. Further distally, the small to
moderately sized dP3 has relatively thick dentin and thin
enamel. The tooth is located beneath the anterior 1⁄3 of the eye.
The lingual successional lamina of dP3 extends mesially and
thickens to form a moderately large early to middle-cap stage
successor P3. The deciduous and successor P3 appear to arise
from a common primary dental lamina stalk. This is due to
the partial fragmentation of the primary dental lamina stalk
in later stages of development (compare fig. 4 with 2e). Distal
to the developing dP3/P3 complex, the M1 is now in a large
late-bell stage with possible early odontoblasts but no dentin.
This tooth underlies the middle of the eye. A moderately sized
early-cap stage M2 develops distal to Ml. The dental lamina
then disappears distal to this tooth.
In the lower jaw, dpl 1s now a moderately large middle-bell
stage tooth, developing immediately distal to the large
developing canine. There is no distinct evidence for a rudiment
of dp2. Further distally, the small to moderately sized dp3 is
partially covered with a thick layer of dentin and a thin layer of
enamel. Mesiolingual to the small dp3, the lingual successional
lamina gives rise to a larger early-bud stage p3. Further distally
is a large late-bell stage m1 with moderately developed dentin
on the apex of the tall protoconid. Distal to this tooth, the
dental lamina gives rise to a large middle- to late-bell stage
m2. A possible early bud for m3 lies distal to this tooth, but
problems with the tissue make it difficult to be certain of this.
Initiation and early development of the postcanine deciduous dentition in the dasyurid marsupial Dasyurus viverrinus
bray
7 Pein
Fag eg =j
"uu Ores LT
ki
_ hay”)
EE, ON un EET
"o pA d
Cr
Se
Qu.
53
= 8H ^. a «@
q%
, TF i 2 IE - -
LLEDELPEEEECEETGERI CEDERE
L =
pac. ee COCOCOOEC EE
a
A n ae T bags
Oe : a rt — ——— =. ee s: — à ——
=r iae _— ras — -
—Ü
1 2
Figure 4. Parasagittal section through the dentition 1n a 25-day-old pouch young (12.5 mm head length) showing the developing teeth between
dPl and M2 in the upper jaw. Arrowhead refers to the site of the missing dP2. Abbreviation: D, location of developing dP3 follicle.
In a 30—35-day-old pouch young (23-24 mm GL and 13.5
mm HL; see fig. 13 in Hill and Osman Hill, 1955), the dP1 is
now a moderately sized tooth with moderately thick dentin
and thin to moderately developed enamel on its crown in the
upper jaw. The tooth lies in a shallow bony alveolus, just
below the oral epithelium. This 1s related 1n part due to the
large canine that partially underlies the smaller dPl
throughout its length. There is no trace of a rudimentary dP2.
Further distally, the dental lamina thickens and gives rise to a
small, somewhat elongate dP3 with moderately thick dentin
and a partially disrupted layer of enamel. The tooth lies
anterior to the developing eye. The lingual successional
lamina of dP3 extends mesially and gives rise to a larger
moderately sized late-bell stage successor P3 with
odontoblasts and a thin layer of predentin on its crown. The
P3 extends both anterior and posterior to dP3 because of its
larger size. There is a normally sized developing bony
alveolus for P3, whereas a distinct bony alveolus is lacking for
the small dP3. Instead, the small deciduous tooth lies more
superficially, in the apex of the deeper alveolus for the larger
P3. Distal to the dP3/P3 complex, the large M1 has moderately
thick dentin and thin enamel on its elevated metacone. There
is a flattened residual lingual lamina along the extent of the
tooth. This tooth lies beneath the anterior half of the eye. A
moderately large middle- to late-bell stage M2 lies beneath
the distal half of the eye. The dental lamina disappears distal
to this tooth.
In the lower jaw, dpl is a relatively large tooth with
moderately developed dentin and thin enamel on its apex.
There is no suggestion of a rudimentary dp2. Further distally,
the small dp3 has a relatively thick dentinal arc overlain by a
thin film of enamel. The enamel is covered by inactive cuboidal
ameloblasts. Lingual to the small abnormal dp3 is a thin
successional lamina; this extends further mesially and gives
rise to a moderately large early- to middle-bell stage p3 with a
loosening of its stellate reticulum. Distal to the dp3/p3
complex, the ml is a large tooth with moderately thick dentin
and thin to moderately developed enamel on the apex of its tall
protoconid. The tooth has a short, flat residual lamina. Distal
to this tooth is a large m2, also with moderately developed to
moderately thick dentin and thin enamel on its tall protoconid.
The m2 also has a short, flat residual lamina. A moderately
large m3 lies distal to m2 and is in the middle- to late-bell
stage. The dental lamina disappears distal to this tooth.
Another pouch young 30-35 days old (23 mm GL) was
sectioned by Louis Bolk and showed some small differences
with the previous specimen. The dPl is small to moderately
sized and is in the late-bell stage with early odontoblasts and
thin predentin in the upper jaw. The dpl has a short, flat
lingual successional lamina. Again, there 1s no suggestion of a
rudimentary dP2. The small, somewhat abnormal dP3 has
moderately thick dentin and possibly a thin film of enamel.
Mesio-lingual to dP3 is a moderately sized late-bell stage P3
with very early odontoblasts. The elongate lingual
successional lamina is fragmented in places and it is not
clearly connected to dP3, in contrast to earlier stages. Distal
to dP3 is a large late-bell stage M1 with moderately developed
dentin and thin enamel on the tall metacone. A prominent,
flattened residual lamina is present lingually. Distal to this
tooth is a moderately large middle- to late-bell stage M2. The
dental lamina disappears distal to this tooth.
In the lower jaw, the moderately large late-bell stage dpl
has thin predentin on the apex of its single cusp; it immediately
follows the large canine. There is no suggestion of a
rudimentary dp2. Further distally is a small, abnormal
dentinal mass for the rudimentary dp3 with a thin layer of
enamel on the surface of the dentin. The primary dental
lamina connection to the oral epithelium persists. Anterior to
the abnormal dp3 is a moderately sized middle- to late-cap
stage p3. Only a few fragmented epithelial nodules represent
94
the earlier remnants of the lingual successional lamina from
dp3. Distal to dp3 is the large m1 with moderately thick dentin
and thin to moderately developed enamel on the apex of its
tall protoconid. A thin, flattened residual lamina is evident
mesially. Distal to this is a large late-bell stage m2 with
moderately developed dentin and thin enamel on the apex of
the tall protoconid. There is also a prominent, short residual
lamina lingually. Distal to this tooth is a moderately sized
early-bell stage m3; the dental lamina then disappears distal
to this tooth.
In a later pouch young of about 41 days old (29 mm GL
and 18 mm HL; see fig. 14 in Hill and Osman Hill, 1955), also
sectioned by Louis Bolk, further changes occurred, especially
with regards to the dP3 and P3 in both jaws. In the upper jaw,
the small dP! now has moderately thick dentin and moderately
developed enamel on the apex of the unicuspid tooth. There is
a short, flattened lingual successional lamina, and again no
trace of a rudimentary dP2. Further distally, there is a small
dP3 with moderately thick dentin and moderately developed
enamel. Ameloblasts are low cuboidal and probably are no
longer functional. Fragmented strands of the lingual
successional lamina extend anteriorly and give rise to a
moderately sized late-bell stage successor P3 with thin early
predentin on its apex. Further distally, the large M1 appears; it
has moderately thick dentin and enamel on its tall disto-
buccal metacone. Distal to this tooth is a large late-bell stage
M2. This tooth also has an elevated disto-buccal cusp that has
odontoblasts and a very thin layer of predentin. Following this
tooth is a moderately sized early to middle-bud stage M3. The
dental lamina then disappears distal to this developing tooth.
In the lower jaw, dpl is a moderately sized tooth with a
relatively thick layer of dentin and a moderately developed
layer of enamel (partially disrupted). Its primary dental lamina
stalk is still attached to the oral epithelium. Only a slight
suggestion of the thin lingual successional lamina is evident
mesially. There is no trace of a rudimentary dp2. Distal to dpl
is a very small, abnormal dp3 with a prominent dentinal mass.
There is also a very thin film of enamel, although there are no
distinct remnants of ameloblasts. The tooth is considerably
reduced in size compared with earlier developmental stages.
The primary dental lamina connection of dp3 with the oral
epithelium and its lingual successional lamina are also broken
in places. Nevertheless, the fragmented lingual successional
lamina extends mesially and gives rise to a moderately large
late-bell stage successor p3. The p3 has well-developed stellate
reticulum and possibly early odontoblasts, although this is not
clear. The tiny dp3 lies more superficial than its larger
successor and lacks a distinct bony alveolus.
Distal to dp3 is a large ml with thick dentin and
moderately thick enamel on its tall, mesio to buccal
protoconid. The tooth lies in a deep bony alveolus. Distal to
ml is a large m2 with moderately thick dentin and moderately
developed enamel on its tall protoconid. Further distally, m3
is a moderately large tooth in the late-bell stage with a
moderately developed layer of dentin on its tall protoconid.
There are also early ameloblasts on the tooth cusp, but no
enamel. There is a well-developed lingual residual lamina
mesially on the tooth. Distal to this tooth is a possible early
W.P. Luckett, N. Hong Luckett & T. Harper
bud for m4 developing on both sides of the jaw, but tissue
disruption makes this difficult to confirm. The dental lamina
disappears distal to this region.
Later development and eruption of the dentition in
Dasyurus viverrinus
We would like to have been able to microscopically examine
later developmental stages of the dentition in Dasyurus
viverrinus, but at the time we were working at the Hubrecht
Laboratory of Comparative Embryology, later stages were not
available. Many older specimens, from 46 days old to about
120 days old, were described by Hill and Osman Hill (1955),
but only a few brief comments were provided by them
concerning the early eruption of a few teeth. Presumably,
these later stages of alcohol specimens were included in the
Hill collection when it was moved with the Hubrecht
collection to the Museum für Naturkunde.
Concerning the later development and eruption of teeth in
Dasyurus viverrinus, Hill and Osman Hill (1955) cited the
earlier studies by Thomas (1887) and especially Woodward
(1896), and accepted their beliefs that P3 is the tooth that has
been suppressed in this species with two premolars. They all
agreed that a vestigial dP3 developed in the jaws and that the
lingual successional lamina of this tooth was much swollen
and probably represented a rudiment for the successor P3,
although it probably does not develop much further. All
agreed that the vestigial dP3 1s present but does not erupt and
that the swollen primordium of P3 does not differentiate much
further or erupt.
It seems clear to us that none of these authors
microscopically examined later developmental stages of
Dasyurus viverrinus beyond the “much swollen" stage of P3.
In our studies, this stage occurred at 15-20 days of
development. Indeed, in some 19—20-day-old pouch young,
the successor P3 was already in the late-bud to early-cap
stage. Between 20 and 41 days of development in our study,
the P3 developed normally in both jaws, attaining the late-bell
stage. In contrast, the dP3 in both jaws became relatively
smaller and more abnormal in these later developmental
stages; this would be consistent with continued reduction and
non-eruption of dP3 in later stages.
The absence of a developing dP2 and the normal
development of the successor P3 in the 25—41-day-old pouch
young in our study provide a strong basis for our belief that
dPl and P3 are the two erupting premolars 1n both jaws of
later developmental stages 1n Dasyurus viverrinus. Hopefully,
future investigators will microscopically examine the later
developmental stages and early eruption of the jaws in
Dasyurus viverrinus to corroborate (or refute) our hypothesis
of dental homologies.
Comparison of Dasyurus viverrinus with the three-
premolared dasyurids Sminthopsis virginiae (Luckett and
Woolley, 1996) and Antechinus stuartii (Luckett and Hong
Luckett, pers obs) shows that there 1s a similar pattern 1n the
early postcanine development of the premolars in these two
eroups, despite the loss of one deciduous premolar in the
Dasyurus species. While the deciduous premolars differentiate
Initiation and early development of the postcanine deciduous dentition in the dasyurid marsupial Dasyurus viverrinus OO
and develop in a posterior to anterior series (dP3 > dP2 > dPI)
in both jaws of the didelphids Didelphis and Monodelphis, the
dasyurids show a different developmental sequence of dP3 »
dPl » dP2. In Sminthopsis virginiae, a previous study showed
that dP2 was relatively late in its initiation, not appearing until
about 20 days of pouch young development (Luckett and
Woolley, 1996). The same is true for Antechinus stuartii. As
shown ın our developmental series of Dasyurus viverrinus, it
is this later developing dP2 that has been lost in this species
with only two premolars. In our Dasyurus viverrinus series, it
was during the 15 to 20 days of development that there was a
slight suggestion of thickening of the dental lamina between
dPl and dP3; this probably represented a rudimentary attempt
to develop a dP2. In the later stages of development, from 25 to
41 days, there was no longer any sign of a rudimentary dP2.
Another interesting and unusual condition in Dasyurus
viverrinus, when compared with the dasyurids with three
premolars, 1s the nature of the development of dP3 in both jaws.
The dP3 is the first postcanine tooth to initiate differentiation
in both jaws, as also occurs in all three-premolared dasyurids
examined, as well as in didelphids. In contrast with these
marsupials with three premolars, however, the dP3 in Dasyurus
undergoes an abnormal state of development in later stages in
both jaws, including a relative reduction in size and having a
relative superficial position in the jaw with only minimal
development of a bony alveolus. This abnormal development of
dP3 is even more noticeable in the lower jaw. There is a large
amount of dentin but only minimal amounts of enamel. In
contrast, the successional P3 is developing normally in both
jaws and it 1s quickly larger in size and deeper in the jaw than
its deciduous predecessor. Although we could not follow later
stages histologically, it is the normal developing successor P3
that erupts adjacent to dP1 in both jaws. In contrast, we are
unaware of any evidence for eruption of the small, abnormal
dP3 in Dasyurus viverrinus.
Another significant difference between Dasyurus
viverrinus and the dasyurids with three premolars is the
accelerated rate of development and eruption of P3 in Dasyurus,
when compared with these other dasyurids and with didelphids.
In the 97-day-old Sminthopsis virginiae examined by us (see
Luckett and Woolley, 1996), M1-2 are erupted in both jaws and
M3 ıs partially (75) erupted in the upper jaw. In the lower jaw,
m3 1s almost completely erupted and the protoconid of m4 is in
an early stage of eruption. The dP! to dP3 are erupted in both
jaws, whereas the moderately large and well-developed
successor P3 is still unerupted in both jaws.
In contrast, there 1s no sign of an erupted or unerupted
dP3 in either jaw of Dasyurus viverrinus at about 95 days old,
and dPl is in early eruption. The successor P3 is in early
eruption at about 98 days old; this 1s about the same time as
the early eruption of M1. These data on Dasyurus viverrinus
eruption are from the study by Merchant et al. (1984),
although we have changed the names of their premolars ("first
and second upper premolars") to correspond to our more
precise and correct terminology because they considered dP2
to be present and P3 to be lost. As with most other studies on
Dasyurus viverrinus, Merchant et al. (1984) did not
microscopically examine any of their extensive series of
developing pouch young. We also note that these authors
found no trace of an erupted dP3 ın earlier or later stages of
development; this 1s consistent with our findings of abnormal
development of dP3 in later stages of development.
Variation in the fate of dP3 within Dasyurus
Neither Hill and Osman Hill (1955) nor Merchant et al. (1984)
could detect any evidence for the eruption of a rudimentary
dP3 in Dasyurus viverrinus, and we have not seen such a
tooth in any of the juvenile or subadult skulls that we have
examined. However, in another Dasyurus species that we
have studied, Dasyurus albopunctatus, we have noted similar
developmental stages to those of Dasyurus viverrinus, as well
as an unusual condition during later developmental stages and
early eruption (Luckett pers obs). Our specimens of Dasyurus
albopunctatus consist of microscopic sections of two early
pouch young and a larger number (26) of skulls of juvenile
and subadult specimens with erupting postcanine dentitions.
In the youngest specimen (fig. 5) that we examined
microscopically (AMNH 195149; 12 mm HL), the postcanine
region contained a moderately large late-bell stage dP1 with no
Figure 5. Dasyurus albopunctatus pouch young (AMNH 195149, 12 mm
head length). Scale bar is 5 mm.
06
odontoblasts in the upper jaw. There was a diastema for the
missing dP2 with no swelling of the dental lamina. Further
distally was a moderately sized dP3 with moderately thick dentin
and moderately developed enamel. Extending mesially from the
dP3 was a lingual successional lamina that gave rise to an early-
to middle-bud stage successional P3. Further distally was a large
M1 with moderately developed dentin but no enamel. Distal to
this was an early- to middle-cap stage for M2; the dental lamina
ended distal to this tooth. This specimen is very similar in its
developmental features to that of our Dasyurus viverrinus
25-day-old pouch young (12.5 mm HL). A later developmental
stage of Dasyurus albopunctatus (AMNH 193967; 32 mm HL)
was considerably advanced. The dPl had thick dentin and
enamel, and again, there was no trace of a rudimentary dP2 in
the upper jaw. The now tiny calcified dP3 was elongate and
slender, considerably reduced in relative size compared with the
previous specimen; it was very close to the overlying alveolar
margins. Deeper in the jaw and lingual to this was a moderately
large successor P3, with thick dentin and enamel. This specimen
was considerably more advanced in its development compared
with our 41-day-old Dasyurus viverrinus.
In a slightly later juvenile skull of Dasyurus albopunctatus
(AM M24313; skull damaged; not measured), the second to
fourth incisors were in early eruption in the upper jaw and the
canine was in an earlier stage of eruption. The dPl was 4-7
erupted and there was no trace of a dP2. Immediately distal to
this, the moderately sized successor P3 was in very early
eruption, less than that of dPl. Lying on the apex of the P3
crown was a tiny, elongate and pearl-shaped dP3 on both sides
of the jaw. The tiny dP3 had a crown height of 1.3 mm on the
right side and 1.4 mm on the left side. The M1 was almost
completely erupted and M2 was in early eruption. In comparison
with the data on Dasyurus viverrinus from Merchant et al.
(1984), this specimen would be 95—98 days old. In the lower jaw,
the incisors are almost completely erupted, as is the canine. The
dpl is also almost completely erupted. The successor p3 1s about
^5 erupted and there is no trace of a tiny dp3. The ml is almost
completely erupted and m2 1s about 2 erupted.
In nine juvenile skulls of Dasyurus albopunctatus from
later developmental stages that we examined, we could see the
tiny dP3 lying adjacent to the erupting P3 in the upper jaw in
skulls where the P3 was not completely erupted (see fig 6a—d).
It would be incorrect to say that the tiny dP3 were erupted,
and we prefer to consider them to be displaced during the
eruption of P3. The oldest specimen that we examined with
the tiny dP3 was a partially damaged juvenile skull (AMNH
151980; 43.51 mm Skull Length). The dPl was erupted and
P3 was almost completely erupted on the right side of the
upper jaw. The MI] was erupted and M2 was almost
completely erupted. In the lower jaw, dpl, p3 ml and m2 were
erupted and m3 was about ?4 erupted. As in all the juvenile
specimens examined by us for this species, there was no trace
of a dp3 1n the lower jaw. This specimen was briefly noted by
late (1947, p. 142) who stated that the "upper and lower fourth
premolars are absent. The milk P4, however, can still be
detected". As we have shown in this and earlier developmental
stages, it is dP2 that is the missing tooth in both jaws, and P3
(his fourth premolars) 1s developed in both jaws. It was the
W.P. Luckett, N. Hong Luckett & T. Harper
tiny dP3 (his “milk P4") that he detected in the upper jaw.
In later developmental stages of Dasyurus albopunctatus,
in which P3 was completely or almost completely erupted in
the upper Jaw, the tiny dP3 was absent in most cases. However,
in a few instances of some specimens with P3 erupted, tiny
tooth-like fragments of a probable apical or basal remnant of
dP3 were found unilaterally (AMNH 151973, 151971). The
oldest juvenile that we found with a slender root remnant of
dP3 unilaterally (fig. 6d) was in a male (BBM-NG 97868;
47.25 mm Skull Length) with dP1, P3, MI and M2 erupted in
the upper jaw, and M3 was about 4 erupted.
We suggest that the pattern of dental development and
eruption in Dasyurus albopunctatus is an intermediate
condition between that of the dasyurids with three premolars
that we have examined and Dasyurus viverrinus. Both of our
species of Dasyurus have a similar accelerated rate of
development for the eruption of P3 at about the same time as
MI and M2, compared with that for the dasyurid species
Sminthopsis and Antechinus with three premolars. The
ereatly reduced dP3 adjacent to the erupting P3 1n the upper
Jaw of Dasyurus albopunctatus 1s an 1ntermediate condition
between the presence of an erupted dP3 in the dasyurids with
three premolars and its absence in Dasyurus viverrinus.
Although we have not made an extensive search for
rudimentary dP3 remnants in other species of Dasyurus, we
suspect that they can and will be found in some of these
species. We have seen one such probable tiny dP3 in Dasyurus
geoffroii and Dasyurus hallucatus, and we have seen a similar
condition of accelerated eruption of P3 in these two species.
We also note that Archer (1975, p. 255) reported the presence
of a rudimentary spicule-like tooth in the position of the
“normally absent" dP3 in Dasyurus geoffroii (WAM M6370);
we suspect this was also a dP3 fragment.
A final thought. Although Dasyurus viverrinus 1s considered
to be extinct on mainland Australia, we hope that investigators
in Tasmania will help complete our studies on the later
development and eruption of the dentition in this species, which
still exists there but is threatened. Investigators there have
studied many other aspects of the biology of this interesting
species, and we hope that this paper will stimulate some to
further support or challenge our findings on dental development.
Acknowledgements
We are grateful to all the personnel from the Hubrecht
Laboratory of Comparative Embryology, from the Director to
the kitchen staff, for making our numerous stays in Utrecht
and at their laboratory a special experience for us, both
scientifically and personally, during our studies in their
collections. Our colleague and friend Patricia Woolley in
Australia helped considerably with the preparation and
examination of the specimens of Dasyurus albopunctatus in
her care. Colleagues at the American Museum of Natural
History in New York, and at the Bernice Bishop Museum in
Honolulu, Hawaii, helped considerably with specimens in
their care. Our colleague Stephanie Canington at Johns
Hopkins helped greatly in the organisation of the manuscript.
Initiation and early development of the postcanine deciduous dentition in the dasyurid marsupial Dasyurus viverrinus 57
Figure 6. Dasyurus albopunctatus pouch young: a, (AMNH 190927; 36.64 mm skull length). Erupting teeth in the upper jaw with canine about 1⁄2
erupted. The dP1 is almost completely erupted and P3 is in early eruption. A tiny, slender dP3 is lying on the distal margins of the erupting P3,
pointing posteriorly; its apex is not evident. M1 is erupted and the M2 is about 74 erupting (not shown); b, (AMNH 221650; 37.53 mm skull length)
slightly older than the preceding. The dP1 is erupted in the upper jaw and P3 is erupting (2-7). A tiny, elongate dP3 is evident along the posterior
margins of the erupting P3; c, (BBM — NG 28247; 37.89 mm skull length). The dP1 is erupted, and the P3 is almost completely erupted in the upper
Jaw. A tiny, slender and elongate dP3 is evident along the distal margin of P3 and its root extends distally beneath the anterior opening of the
infraorbital canal; d, (BBM — NG 97868; 47.25 mm skull length). In this older young, the P3 is almost completely erupted in the upper jaw. A tiny,
slender root remnant of dP3 is evident, distal to the buccal end of P3.
08
References
Archer, M. 1975. Abnormal dental development and its significance in
dasyurids and other marsupials. Memoirs of the Queensland
Museum 17: 251—265.
Archer, M. 1976. The dasyurid dentition and its relationships to that of
didelphids, thylacinids, borhyaenids (Marsupicarnivora) and
peramelids (Peramelina: Marsupialia). Australian Journal of
Zoology Supplementary Series 39: 1—34.
Cifelli, R.L., Rowe, T.B., Luckett, W.P., Banta, J., Reyes, R., and
Howes, R.I. 1996. Fossil Evidence for the origin of the marsupial
pattern of tooth replacement (letter). Nature 379: 715-718.
Dickman, C.R., Lunney, D., and Matthews, A. 2001. Ecological
attributes and conservation of dasyurid marsupials in New South
Wales, Australia. Pacific Conservation Biology T. 124—133.
Fancourt, B.A. 2016. Diagnosing species decline: a contextual review
of threats, causes, and future directions for management and
conservation of the eastern quoll. Wildlife Research 43: 197—211.
Flower, W.H. 1869. Remarks on the homologies and notation of the
teeth of the Mammalia. Journal of Anatomy and Physiology 3:
262—278.
Guiler, E.R., and Heddle, R.W.L. 1973. The eruption and growth of
teeth in the Tasmanian Devil, Sarcophilus harrisii (Marsupialia:
Dasyuridae). Papers and Proceedings of the Royal Society of
Tasmania 108: 137—140.
Hill, J.P., and Osman Hill, W.C. 1955. The growth-stages of the pouch-
young of the Native Cat (Dasyurus viverrinus) together with
observations on the anatomy of the new-born young. Transactions
of the Zoological Society of London 28: 349—352.
Luckett, W.P. 1989. Developmental evidence for dental homologies in
the marsupial family Dasyuridae. Anatomical Record 223: 70A.
W.P. Luckett, N. Hong Luckett & T. Harper
Luckett, W.P. 1993. An ontogenetic assessment of dental homologies
in therian mammals. Pp. 182—204 in: F. S. Szalay, M. J. Novacek,
and M. C. Mckenna (eds), Mammalian phylogeny: Mesozoic
differentiation, multituberculates, monotremes, early therians,
and marsupials. Springer-Verlag: New York.
Luckett, W.P., and Woolley, P.A. 1996. Ontogeny and homology of the
dentition in dasyurid marsupials: development in Sminthopsis
virginiae. Journal of Mammalian Evolution 3: 327-364.
Luckett, W.P., Hong Luckett, N., and Harper, T. 2019. Microscopic
analysis of the developing dentition in the pouch young of the
extinct marsupial Thylacinus cynocephalus, with an assessment
of other developmental stages and eruption. Memoirs of Museums
Victoria 78:\—21.
Merchant, J.C., Newgrain, K., and Green, B. 1984. Growth of the
eastern quoll, Dasyurus viverrinus (Shaw), (Marsupialia) in
captivity. Australian Wildlife Research 11: 21—29.
late, G.H.H. 1947. Results of the Archbold Expeditions. No. 56. On
the anatomy and classification of the Dasyuridae (Marsupialia).
Bulletin of the American Museum of Natural History 88: 97—156.
Thomas, O. 1887. On the homologies and succession of the teeth in the
Dasyuridae, with an attempt to trace the history of the evolution of
mammalian teeth in general. Philosophical Transactions of the
Royal Society of London. B. 178: 443—402.
Wilson, J.T., and Hill, J.P. 1897. Observations upon the development
and succession of the teeth in Perameles; together with a
contribution to the discussion of the homologies of the teeth in
marsupial animals. Quarterly Journal of Microscopical Sciences
39: 427-588.
Woodward, M.F. 1896. On the teeth of the Marsupialia, with especial
reference to the premilk dentition. Anatomischer Anzeiger 12: 281
— 29].
Wroe, S. 1999. The geologically oldest dasyurid, from the Miocene of
Riversleigh, north-west Queensland. Palaeontology 42: 501—527.
Memoirs of Museum Victoria 80: 59-99 (2021) Published 2021
1447-2554 (On-line)
httos://museumsvictoria.com.au/collections-research/journals/memoirs-of-museum-victoria/
DOI https://doi.org/10.24199/|.mmv.2021.80.04
A review of the Australasian genus Pseudophycis (Gadiformes: Moridae),
redescribing its four species and resurrecting the name Physiculus palmatus
Klunzinger, 1872, for the Australian Red Cod
MARTIN F. Gomon! 4t, CARL D. STRUTHERS? and JoDIE KEMP”
' Museums Victoria, Melbourne Museum, 11 Nicholson Street, Carlton, Victoria, 3053, Australia.
Email: mgomon@museum.vic.gov.au
^ Museum of New Zealand Te Papa Tongarewa, 467 Cable Street, Wellington, New Zealand. Email: CarlS@tepapa.govt.nz
* 25 Grigg Court, Wallington, Victoria, 3222, Australia. Email: jodie@hindson.com.au
* Corresponding author
Gomon, M.F., Struthers, C.D. and Kemp, J. 2021. A review of the Australasian genus Pseudophycis (Gadiformes:
Moridae), redescribing its four species and resurrecting the name Physiculus palmatus Klunzinger, 1872, for the
The commercially fished Red Cod Pseudophycis bachus Forster in Bloch and Schneider, 1801, 1s shown on the basis
of both morphological and genetic evidence to be confined to New Zealand waters. ‘The separation of the closely related but
distinct Australian cognate brings the number of species in the Australasian genus Pseudophycis to four. The name
Physiculus palmatus Klunzinger, 1872, which was long thought to be a junior synonym of Pseudophycis barbata Günther,
1862, 1s demonstrated to have been originally proposed for the Australian endemic. Pseudophycis palmata (new combination)
differs from P. bachus 1n having a prominent black blotch or spot basally on the pectoral fin that does not extend dorsally
onto the body, in contrast to distinctly extending onto body, the second dorsal fin with 47—56 rather than 40—45 rays, the anal
fin with 50—57 rather than 42—48 rays and the vertebral column with 47—50 rather than 44—46 total vertebrae. Diagnoses,
colour descriptions, images and distributions for all four species and a key to members of the genus are provided.
Abstract
Australian Red Cod. Memoirs of Museum Victoria 80: 59—99.
Keywords Teleostei, Actinopterygii, morphology, re-description, comparison, distribution, COI
Introduction
In an annotated catalogue of gadiform fishes of the world,
Cohen et al. (1990) treated the morid genus Pseudophycis as
comprising three species: Pseudophycis bachus Forster in
Bloch and Schneider, 1801, P. barbata Günther, 1863, and P.
breviuscula Richardson, 1846, all confined to the temperate
waters of New Zealand and Australia. The taxonomy followed
Paulin's (1983) review of New Zealand species of Moridae
that concluded that only three are present in New Zealand and
Australian waters, despite the historical confusion over which
names apply to the various Pseudophycis species. Paulin did,
however, observe meristic variations in fin ray and scale
counts between New Zealand specimens and the limited
number of Australian specimens of P. bachus at his disposal,
saying "examination of a larger sample of Amustralian
specimens might show some differences but, in view of the
variability within species of Moridae, there would probably
be little justification for separating the populations at the
species level" (Paulin, 1983, p. 92). Subsequent authors (e.g.
Gomon in Gomon et al., 1994; Kuiter, 1993; Last et al., 1983;
Paxton and Hanley in Paxton et al., 1989; Paxton et al., 2006;
Yearsley et al., 1999) dealing with temperate Australian fish
biodiversity followed Paulin (1983) and Cohen et al. (1990) in
treating the Australian Red Cod as conspecific with the New
Zealand species.
smith et al. (2008) detected genetic differences between
Australasian samples of Pseudophycis using the COI locus.
Their work included eight samples of P. bachus, four each
from Australia and New Zealand, six samples of P. barbata
from Australia, but no samples of the third species, P.
breviuscula. They found differences between the P. bachus
samples from the two countries that were equivalent to
differences between P. barbata and each of the two P.
bachus morphs, suggesting species-level differences
between all three. These genetic discrepancies were
supported by work of Kemp (2010), who observed that there
are a number of differences between individuals from
Australian and New Zealand waters and that morphometric
and meristic characteristics of Pseudophycis species in
Australian waters have been poorly documented. She
compared 50 Australian specimens with 160 from New
Zealand, both series identified as P. bachus, and found
60
significant differences in mean values for the second dorsal
(50.2 vs. 42.8, respectively) and anal (52.1 vs. 45.0) fin ray
counts, as well as pyloric caeca (9.6 vs. 6.0). These
observations provided the incentive to further compare the
Australian and New Zealand populations with each other
and with the other two long-recognised members of the
genus, P. barbata and P. breviuscula. The outcome was a
recognition of four easily distinguished species in the genus
and the initiation of research on the scientific name for the
Australian Red Cod.
The Australian Red Cod is a relatively common demersal
species, distributed in the shelf waters of south-eastern
Australia (Gomon in Gomon et al., 2008). It 1s an important
prey species for some high trophic level predators, including
little penguins, Eudyptula minor (Chiaradia et al., 2003;
Cullen et al., 1992; Montague and Cullen, 1988), Australian
fur seals, Arctocephalus pusillus doriferus (Gales and
Pemberton, 1994; Hume et al., 2004; Kirkwood et al., 2008;
Litnan et al, 2007) and New Zealand fur seals,
Arctocephalus forsteri (Page et al., 2005). The trophic role of
Australian Red Cod as prey, coupled with its relatively
common occurrence, suggests that this species 1s particularly
important in Australian waters. Humans include these fishes
as part of the non-targeted bycatch consumed annually,
although the species is more frequently discarded than
retained (pers. comm. M. Tudman, Bycatch Reduction
Program Manager, Australian Fisheries Management
Authority, 2008).
This contribution provides a name for the endemic
Australian Red Cod, a detailed description that distinguishes
it from the New Zealand P. bachus, descriptions for the four
Species in the genus and a dichotomous key to the species.
Methods
Morphometric methodology mostly followed Paulin (1983),
Trunov (1990) and Markle and Melendez (1988);
measurements were taken directly (point-to-point) except
that measurements between fins were horizontal distances
between vertical projections at the origins of each fin,
caudal peduncle length was taken from the posterior end of
the anal fin base to the hypural joint, caudal-fin length was
from the hypural joint to the fin tip, and lengths of gill
rakers and filaments were taken at or adjacent to the angle
of the gill arch. In lists of specimens examined, numbers of
specimens and their standard lengths in mm are placed in
parentheses after registration numbers, except for lots
containing only a single specimen where only the length is
presented. Meristic methods are those of Hubbs and Lagler
(1947) where counts of unpaired fins and vertebrae were
taken from radiographs, the number of trunk centra was
counted from the cranium to the last centrum with pleural
ribs and counts of tail centra exclude the urostyle. Selected
meristic and relative morphometric ranges for the four
congeners are presented in Tables 2—4. Other materials
examined are in the ichthyological collections of the
Australian Museum (AMS), Natural History Museum
(formerly British Museum [Natural History]; BMNH),
M.F. Gomon, C.D. Struthers & J. Kemp
Australian National Fish Collection (CSIRO), Museums
Victoria (NMV), Museum of New Zealand Te Papa
Tongarewa (NMNZ), South Australian Museum (SAMA),
Staatliches Museum für Naturkunde, Stuttgart (SMNS) and
Western Australian Museum (WAM).
Genetic material and sequences. A genetic analysis of
mitochondrial cytochrome oxidase subunit I (COI) gene was
carried out on 72 sequences from muscle tissues, representing
5 terminal taxa of the family Moridae.
The dataset included 61 sequences from the BOLD
database (www.boldsystems.org) and 11 sequences newly
generated for this study (see Appendix | for list of material
and BOLD and GenBank accession numbers; vouchers for
tissues yielding sequences in the material examined lists are
indicated by a dagger ^?) including 18 specimens of
Pseudophycis bachus from New Zealand, 23 P. barbata from
Australia and New Zealand, 12 P. breviuscula from Australia
and New Zealand, I2 P. palmata from Australia, and 7
Auchenoceros punctatus from New Zealand as a morid
outgroup.
Genomic DNA was extracted from the 11 (7 P. bachus
[including neotype], 2 P. breviuscula and 2 P. barbata)
additional ethanol-preserved muscle tissues (Appendix 1)
using DNeasy blood and tissue kit (Qiagen). A fragment of
the COI gene was PCR amplified and sequenced using
thermocycling conditions and primers (FishF2 and FishR1)
from Ward et al., 2005). PCR products were purified by
digestion with the ExoProStar (Illustra) or with the Zymo
DNA Clean and Concentrator (Zymo Research, USA),
following the manufacturer’s instructions. PCR products
were sequenced in both directions on an ABI-3730 (Massey
University Genome Service, Palmerston North, New
Zealand or Macrogen, Seoul, South Korea). Newly
generated sequences were deposited in GenBank (see
Appendix | for a list of voucher specimens and their
accession numbers).
Phylogenetic analyses. All 72 sequences were individually
aligned in ClustalW using the software Geneious Prime
v10.0.5. The COI alignment contained no insertions or
deletions. Maximum likelihood, neighbour joining and
maximum parsimony trees were used to visualise distance
relationships within and between species; node support was
assessed with 1,000 bootstrap replications of each tree. For
the maximum likelihood analyses, the most appropriate
model of sequence evolution for each dataset was determined
using the Akaike information criterion in ModelTest; the
HKY + G model was selected (Hasegawa et al., 1985) because
it was the best performing of 24 different nucleotide
substitution models tested in the model selection option of
MEGA version X (Kumar et al., 2018). A discrete gamma
distribution was used to model evolutionary rate differences
between sites (5 categories, +G, parameter = 0.3772). In
addition, a neighbour joining tree was estimated using
p-distances (uncorrected distances). The p-distance is the
proportion of nucleotide sites at which two sequences being
compared are different. It is obtained by dividing the number
of nucleotide differences by the number of nucleotides
Australasian red cods
compared. It does not make any correction for multiple
substitutions at the same site, substitution rate biases (e.g.
differences in the transitional and transversional rates), or
differences in evolutionary rates between sites. For the
maximum parsimony analyses, a heuristic search algorithm
with 1000 random addition sequence replicates and tree
bisection and reconnection branch swapping methodology
was used. Nodal support was tested with 500 bootstrap
pseudo-replicates, with ten random addition replicates for
each pseudo-replicate.
Multivariate analysis of morphological data
To investigate the a priori grouping by species, a canonical
analysis of principal coordinates (CAP) was performed using
normalised Euclidean distances between specimens
(Anderson and Willis, 2003). CAP is equivalent to a classical
discriminant analysis. Leave-one-out mis-classification error
(Lachenbruch and Mickey, 1967) was used to obtain a direct
measure of the ability of the CAP discriminant model to
identify species on the basis of the 20 characters. This cross-
validation provided a rigorous assessment of the
distinctiveness of the four species of Pseudophycis. The
following 20 characters, measured in 124 Pseudophycis
specimens of the four species (see material examined), were
used in the analysis: anal fin base length, barbel length, caudal
peduncle depth, caudal peduncle length, caudal fin length,
first dorsal fin base length, first dorsal fin longest ray length,
head length, orbit diameter, pectoral fin base width, pectoral
fin length, pelvic fin length, postorbital length, pre-dorsal fin
length, pre-anal fin length, pre-pectoral fin length, pre-pelvic
fin length, pelvic fin origin to anal fin origin length, second
dorsal fin base length, and snout length.
Genus Pseudophycis Gunther, 1862
Pseudophycis Günther, 1862: 350, type species: Lota breviuscula
Richardson, 1846, by monotypy.
Austrophycis Ogilby, 1897: 90, type species: Austrophycis
megalops Ogilby, 1897 (= P. breviuscula) by monotypy.
Physiculus (Pseudophycis) Whitley, 1956: 403,
decision.
taxonomic
Diagnosis. Morid fishes with an elongate body. Luminescent
organs absent. Snout broadly rounded in dorsal view, not
projecting greatly beyond mouth, length about equal to
interorbital width. Eye diameter much less than postorbital
length. Each jaw with broad band of small, depressible,
caniniform teeth of uniform size. Vomerine teeth absent. Chin
with well-developed, often small, barbel. Branchiostegal rays
seven. Gill rakers of outer branchial arch short or of moderate
length. Otolith with ostium approximately equal to the cauda
(1:1 to 1:1.4), the crista superior as long as or longer than the
crista inferior; otolith thickness 20—22% of its length (Paulin,
1983). Scales small, covering body and head; extending onto
loose membranes enveloping the bases of dorsal and anal fins;
lateral line pores at ends of short tubes from naked strip not
associated with individual scales. Two dorsal fins and one anal
fin, first dorsal slightly taller than, immediately adjacent to and
Joined to second by low membrane, with 8—14 rays, first ray not
61
prolonged; second dorsal and anal fins with elongate bases, of
nearly uniform height; caudal fin separate, rounded or truncate.
Ventral fins composed of five or six rays, the two outermost
longest and projecting beyond fin membrane but not greatly
prolonged.
Etymology. The feminine name Pseudophycis is an
amalgamation of the Greek words pseudos, meaning “lie” or
"false", and phykis, "a fish living among seaweeds” (Brown,
1954) and the source word of the scientific name for the North
Atlantic gadid genus Phycis Walbaum, 1792, in reference to the
overall resemblance of species of the two genera to one another.
Distribution. Species of the genus are endemic to coastal
waters of temperate Australia and New Zealand.
Remarks. Species referable to the genus Pseudophycis were
described or treated as members of seven morid genera based
on the superficial resemblances of species in the genera to
one another. These include: Gadus Linnaeus, 1758, type
species Gadus morhua Linnaeus, 1758, by subsequent
designation of Jordan and Gilbert (1883: 802); Enchelyopus
Bloch and Schneider, 1801, type species Gadus cimbricus
Bloch and Schneider, 1801, by subsequent designation of
Jordan and Evermann (1898: 2560); Lota Oken, 1817, type
species Gadus lota Linnaeus, 1758, by subsequent tautonomy
(Fricke et al., 2019); Lotella Kaup, 1858, type species Lota
phycis Temminck and Schlegel, 1846, by monotypy and
Physiculus Kaup, 1858, type species Physiculus dalwigki
Kaup, 1858, by monotypy (see species treatments for details).
Austrophycis Ogilby, 1897, caused particular confusion until
sazanov (2001: 343) identified the type specimen of A.
megalops as P. breviuscula (Richardson, 1846). The genus
Pseudophycis comprises four species.
Genetic analysis. Concerted efforts to document genetic
sequences for the COI gene across Australasian fish species as
part of the Fish Barcode of Life project provided an additional
means of testing suspect species concepts. A preliminary
comparison of sequences of New Zealand and Australian
specimens identified as P. bachus and P. barbata in BOLD had
already revealed potentially cryptic sister species on either side
of the Tasman Sea. Sequences for specimens identified as P.
bachus had low divergence among specimens within Australia
(0.002) and within New Zealand (0.000) but high sequence
divergence in the pooled data (0.086) typical of species pairs
(Smith et al., 2008: 8, fig. 5).
A comparison of a larger set of sequences for Australian
and New Zealand specimens identified as species of
Pseudophycis, plus sequences of specimens of Auchenoceros
punctatus as an outgroup, generated a tree with five inferred
species branches, four having a common basal node for
vouchers identifiable as P. barbata, P. breviuscula, P. bachus
and P. palmata (Ward pers. comm.; fig. 1). Importantly, the
branches of P. bachus and P. palmata, previously thought to
be conspecific, are of about the same lengths as those of
P. barbata and P. breviuscula, despite the morphological
differences distinguishing the latter two (Table 1).
62
Key to species of Pseudophycis
l. Caudal margin truncate with angular corners in specimens
larger than about 150 mm SL, central caudal fin rays
distinctly shorter than those extending to the corners; basal
portion of pectoral fin with distinct dark blotch or spot 2
— Caudal margin rounded with rounded corners, central
caudal fin rays equal in length or longer than those
extending to the corners; no distinct dark blotch or spot
basally on pectoral fin 3
2. Dark blotch or spot basally on pectoral fin extending
dorsally onto body; second dorsal fin with 40—45 rays;
anal fin with 42—48 rays; total vertebrae 44—46
— Dark blotch or spot basally on pectoral fin not extending
dorsally onto body; second dorsal fin with 47—56 rays;
anal fin with 50—57 rays; total vertebrae 47—50
3. Scales above lateral line 16—22; second dorsal fin with
54-59 rays; anal fin with 54—63 rays; pyloric caeca 14—20;
total vertebrae 48—51 Pseudophycis barbata
— Scales above lateral line 7—9; second dorsal fin with 44—52
rays; anal fin with 49—56 rays; pyloric caeca 6-9; total
vertebrae 42—45 Pseudophycis breviuscula
Pseudophycis palmata (Klunzinger, 1872)
Proposed name: Australian Red Cod (Australian Standard)
Figures 1, 2, 3A, 4, 5; Tables 1—4
Physiculus palmatus Klunzinger, 1872: 38. Type locality:
Hobsons Bay, Victoria, Australia. Types: SMNS 1589.
Pseudophysis barbatus (nec Günther, 1862). McCoy, 1878: 29, pl.
20 (in part; description).
Pseudophycis bacchus (nec Forster in Bloch and Schneider, 1801).
Günther, 1880a: 28 (Twofold Bay, NSW ); Waite, 1899: 119 (distribution).
Pseudophycis bachus (nec Forster in Bloch and Schneider, 1801).
Ogilby, 1886: 48 (list, in part); Edgar etal., 1982: 32, fig. 17 (description,
in part); Last et al., 1983: 234, fig. 21.7 (description, in part); Paulin,
1983: 93 (distribution, in part); Hutchins and Swainston, 1986: 34, 124,
fig. 113 (description); May and Maxwell, 1986: 194 (description);
Paxton and Hanley in Paxton et al., 1989: 302 (list, 1n part); Grant,
1991: 75, fig. 164 (list, in part); Gomon in Gomon et al., 1994: 333, fig.
M.F. Gomon, C.D. Struthers & J. Kemp
297 (description, in part); Yearsley et al., 1999: 87, fig. (description);
Paxton et al., 2006: 616 (taxonomy, in part); Gomon in Gomon et al.,
2008: 313, fig. (description, 1n part).
Physiculus bachus (nec Forster in Bloch and Schneider, 1801).
Waite, 1904: 24; Stead, 1906: 86 (description, in part); Waite, 1907: 18,
fig. (South Australia); Stead, 1908: 48, pl. 16; Waite, 1921: 67;
McCulloch, 1921: 42; McCulloch, 1922: XVII, 32; Waite, 1923: 92,
fig. (description, in part); Lord and Scott, 1924: 8, 43 (description, in
part); Lord, 1927: 13; McCulloch, 1927: 32, pl xi, fig. 112a (list); Waite,
1928: 6 (listed); McCulloch, 1929: 129; McCulloch, 1930: 129 (in
part, listed); Norman, 1935: 3; Norman, 1937: 54, 55 (in part, listed);
Munro, 1961: 62, fig. 441, (description; in part); Scott, 1962: 84, fig.
(description, in part); Whitley, 1962: 58; Whitley, 1964: 40 (list, in
part); Walker, 1972: 2; Suda, 1973: 2150—2152 (distribution); Scott et
al., 1974: 95, 96, fig. (description, in part).
Pseudophycis barbata (nec Günther, 1862). Kuiter, 1993: 59, fig.
(description, in part).
Diagnosis. First dorsal fin with. 10—12 rays, second dorsal fin
with 47—56 rays; anal fin with 50—57 rays; total vertebrae 47—
50; nostrils located about two-thirds to three-quarters of the
way from snout tip to eye; gill rakers of outer arch of moderate
length, almost as long near angle as opposing gill filaments;
chin barbel short, 6-17% HL; scales above lateral line in
oblique series from base of first dorsal fin ray 11—15; oblique
rows of scales intersecting with lateral line 96—116; pyloric
caeca 8-10; caudal fin truncate with angular corners in
specimens larger than about 150 mm SL, middle rays shorter
than rays extending to corners; dark blotch basally on pectoral
fin not extending onto side above fleshy pectoral fin base. A
large species reaching at least 598 mm TL or approximately
532 mm SL (Kemp, 2010: 26).
Description. (Values for non-type specimens when different
from type in parentheses; see Tables 2—4 for summary of
selected meristic and comparative morphometric values.) First
dorsal fin 11 (10—12, rarely 10, first ray usually minute); second
dorsal fin 56 (47—56, rarely 47 or 54—55); anal fin 55 (50—57,
rarely less than 51); pectoral fin 22 (22-27); pelvic fin 5 (5 or 6,
rarely 6); caudal fin 37 (35—41) rays; gill rakers 4 + 10 (3—4 +
9—11 = 12-15); lateral line pores not associated with individual
scales; oblique scale rows intersecting with lateral line
unknown (96-116), scales 1n oblique series above lateral line
15 (11—15), scales in oblique series below lateral line unknown
(28—40); vertebrae 16 + 34 (15-18 + 31-34) = 50 (47—50);
pyloric caeca 10 (8—10).
Table 1. Estimates of evolutionary divergence over sequence pairs within (left) and between (right) species. Kimura-2-parameter genetic distances
as averages over all sequence pairs within species are in the left column, with standard error estimates on the right (left table). Genetic distances
as averages over all sequence pairs between species are below the diagonal with standard error estimates above it (right table).
Between species
Distance below and Standard Error above diagonal
Species Within species
standard
N Distance Error A. punctatus
A. punctatus ji 0.002 0.001
P. bachus 18 0.005 0.001 0.160
P. breviuscula 12 0.001 0.001 0.170
P. palmata 12 0.005 0.002 0.158
P. barbata 23 0.003 0.001 0.171
P. bachus P. breviuscula | P. palmata P. barbata
0.017 0.017 0.017 0.017
0.015 0.013 0.015
0.143 0.016 0.011
0.092 0.139 0.014
0.127 0.085 0.128
63
Australasian red cods
Table 2. Selected counts for types and representative specimens of the four species of Pseudophycis.
N
AIP PISFUBIU guv
DINISNIAIAG “J
əd) N A9p pis F ue&oui
0c - VI
9S - 8t
cc 7 9I
COL- tcl
St - ce
ISULI
DIDgGADG 'd
əƏdÁ}| N A9p pis F ueoui
yc - 9c
cl - OL
9€] -TOI
6t -tt
01 -9
Vc - 6l
6-9
9] - VI
e-v
ISUBI
SNYIDG 'd
ISUB.I
0043} N Aop pis F ue&oui
nud ‘J
92992 OIIO[Ád
OUT] [&19]e| ^O[9q so[eog
OUT] TEINE] 9A0qe so[eog
SMOI 9[09S 9SIOASUUI[,
SABI UY [epned eon,
sÁKvI ur [epneo JUSLINIOId IOMO'T]
SÁLI UY [epneo (pououeiq) [edr»uuq
SÁLI ur [epneo juaumooud 1odd()
SIDYPI [[I8 [RIOT
SJo*e1 [fis ədd N
SIDYCI [IIo I20'T
IVIGOLIOA [VIOL
3UJQ33I9A [Epn€
IBIQOLIOA [epneoodq
sABI UY [eJO0]2od
SAEI uj euy
sABl UY [es1op puooog
SABI UY [BSIOP 3SILT
J3]9€.IEQ2 JI)SLI9 [AI
64 M.F. Gomon, C.D. Struthers & J. Kemp
Table 3. Frequencies of selected meristic characters in Pseudophycis species. Shaded values are those of types.
Second dorsal fin rays 40 41 42 43 44 45 46 47 48 49 50 51 52 33 54 #55 56 57 58 39 N
P. palmata 2 8 4 10 6 7 4 3 2 1] 47
P. bachus 1 4 13 10 4 | 33
P. barbata 7 90 F 5 5 D 36
P. breviuscula | 29M 13 5 141 1 2 2 48
Anal fin rays 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 N
P. palmata l 5$ 4 Il 7 Big 3s 7 48
P. bachus 1] 4 5 8 8 6 | 33
P. barbata 2 4 7 8 6 5 ]| 1 1 1 36
P. breviuscula 7 Nu > 58 & 5S 4 | 46
Total caudal fin rays 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 4l N
P. palmata 3 10 6 19 2 |] | 42
P. bachus ] 1 3 EOS 9 1 2 23
P. barbata T m 5 1] 18
P. breviuscula fm 2 4 7 12 7 4 37
Caudal vertebrae 27 28 29 30 31 32 33 34 35 36 37 N
P. palmata 1 13 26 6 46
P. bachus 1 9 18 5 33
P. barbata 4 11 12 NEM 1 35
P. breviuscula 4 $239. 18 3 48
Total vertebrae 42 43 44 45 46 47 48 49 50 5I N
P. palmata 2 10 29 6 47
P. bachus 6 20 7 33
P. barbata 2 8 19 6 35
P. breviuscula 3 18 21 6 48
Scales above lateral line 7 8 9 10 Il 12 13 14 #15 16 17 18 19 20 21 22 N
P. palmata 4 10 4 4 5 27
P. bachus 6 12 16 34
P. barbata 4 8 10 2 3 1 2 30
P. breviuscula 7 13 2 22
Pyloric caeca 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
P. palmata | 2 95 8
P. bachus 29 29
P. barbata 2 T 58 3 2 l 20
P, breviuscula 4 4 8
65
Table 4. Selected proportional measurements for types and representative specimens of the four species of Pseudophycis.
Australasian red cods
sc Oc-*-9tl FSI-vVIEL LcI|St SI+tLecl €s1-98 98 LE CIFLEL 9Ssi-cilE tetl|ct vi-*-cci e€si-66 EOI sua] uy [epne;)
LC CIFIOl 91c-991 9Li1|$£ S$c-*c0c 6PeC-LELe cl |Ot OCFLIL Vic-siIF O9I|It SIt+tevrl eLi-Lil I Sil sug] UY ood
OC OITFLSI SLI-O9ET LOLI SE ETFS sl SLI-CTE CII [8 ELATLI vol-9PECLI;cce OTLFS8SI LLI-Stel 99i YISsUs] UY [E10]9eqd
OC 8 CHESS 099-8t8 SOSSE CCcrFOLS VPES-e9VG lS |; LIFlLOS SES-VSPCcOS te 9c-* lI IS VLS-OSV OOS sug] eseq uy euy
óc SIFLIOS CO9-OES OSS|SE Lc-*S8YS ECcO-VOS CESSE LIFLeS c9sS-98p L tS t€ OcrEcsS LIOS-o6LV STS ysu] eseq UY JesIop puooeg
Sl OTLFCII 8cI-98 06 [St VIFOOI OSI-OL 9L {Se CIFOTL QSI-S6 LOI|It OTOCI €LI-SS ELI ABI JSOSUO] UY [ESIOD SIL
oc LcC-*90lI FP6el-6L 66 [SE CI+F+C6 9t€t1-89 ES {Le GOOFOTL TELCO vollce cl+vol Pol-s9 col sug] eseq UY [eSIOp JSIHT
LT Vc-*IFcc SST-OST vOc|c€ €e-s8soc s'€e-cocoLc|L€E DIL FPVST LSC-SCCCYVCIOE v'C*9YC SOE-S'SI vr yc utsuo UY peue 0) UISHO UY ped
LT GTI-*CLI VIC-6€1 USI|S€ GIFE6L 9€c-r9TL ISI ISE TIF86l CCC-O0LT O9 6I|I€ OCTFS OT 09c-cSI TSI sus] UY orA[ed-adq
6T OLFO9T SBT-SHZ PLT SE SIFT LX€-L'SCL'SC 8€ OL FOLT C0€-Ssc89c|cc CLFEL BT 9C€-€9c SLT sus] UY [e1ojood-alg
LT 6T1*08€ PIP-O'SE rrise SECFS bY OIS-OSEST ILE LIFO ECD ELO-HNOEVTHIIE SC-*9€vr OSP-GLE SIP sud] UY [eue-oJd
6T OTFOOE HTIE-SLZOIE/SE LI FS TE V'LE-C6C V PE |8E TIFFS 67 STE-SLCCS8C|CE TIL FOOE L'c€-VS8c TIE sus] UY [eSIOp-a1q
ST LO-TE€9 SL-6* vC |vr€ TIF99 Á96-L*r GY |9€ JOFFE SH-HT TE |TE BOFSE GOP-LT OF sud joqieg
6T SOFSTI TEL-OTE VEISE TI FOS] SZI-€CI ETI 8€ VvO-*6€lI SHI-STIOELIEE VOFTSI C9I-9'€I OSI psu mel 1edd )
60 SOFTO OL-T'S 6S |SE LOFI8 96-S'9 CL |8€ SOFOS O6-TL SLICE DOFSL V6-L9 9L auo] jnoug
6T C€OFOT FCt-€I Ic|vt€ 90-97 Lt£-LI SE COFST E€-ST ÇT c€ vO-*CC CE-FI LZ qidop jerq1oqng
6T VOFEO FL-SS v9 |vt€ SOFOS À $$8-S9 SE 90-98 66-CL 88 c€ 907-706 001-6L LS [pr^ perqu]
60 80-*€E€I €TI-F'II ZvI|S€ 6I*67v1 LLI-SL CCL|8€ 807-*CVI F9I-FZL TL vI|E€ 607*07TI 091-CCI T'EI YIsugy [e3qJo1soqd
60 80-*CL LS-C9 TL |SE 60F69 Á€$8-6F 6v |8€ GOFTO VSg8-9t OS |c€ GOFTL L6-€S EL Iojouuerp [RUGIO
LT VIF8Tl CSI-SOL LU cI|£€ vI-*-9€I 6LY-0 II LE UVIT*STII OSI-TOLLILIO€ OC-*6€I F£SI-COI STI (9&2) yıdəp prox
6c 90-*S8*vC 09c-t'e€c S cc|Sc O9TI-SS8C 9TIE-€€ccec 8€ BOFILT 9'6c-6scse9c|ec 607-*8.LC 00€-6' Sc TOZ sus] peoH
6T SOFTL SS-LS 8t |SE OI-*69 C6-CS VS |8€ LOFI6 SOI-LL S8 [IE GOFI6 S'0I-L9 68 sus] s[punped [epne;)
6T €0*t€t St-6€ Ov |SE OLFSr CS-€€ VE |8€ VOT*ST G6S-BE S8€|cCcC VOFOS 6S-LIt SS dap əppunpəd jepne;)
ST SOFSIT €'€c-9'0c STZ VE OTF €6C-L'6I 9€ PIFOOT LET-HSIS6IIIE SIFOTI S9c-L81I SET (uIsIo uy peue) udop Apog
TS %
6L1 -¥'6S CSI I€S- O78 v6c 6€S-OIT ISE O8E-S'EL TLI (ww) qjsuo'T p.repuejs
N Aeppjscueour oSgu&e1 əd | N Aeppjscueoui osuvrl odd) | N AS3pDpIScUPQ9UI — ssuBl əd} | N Asppiscxueour oSue1 — odÁ JU3UIQ3JnSe2][AI
DINISNIAIAG d DIDGADG d snunq d nud “J
66 M.F. Gomon, C.D. Struthers & J. Kemp
NMNZ P.045835| NZ. ECNI| FNZC252-09
NMNZ P.053551| NZ. Bay of Islands
NMNZ P.044103| NZ. White Island | FNZC280-09
NMNZ P.037124] NZ. White Island | FNZC189-09
NIWA no voucher SER6] NZ. Ngawi] FNZAG08-08
NIWA. no voucher SERS| NZ. | FNZA387-06
NIWA no voucher SERAH NZ. | FNZA386-08
NIWA no voucher SER3| MZ. | FNZAXES-06
NIWA no voucher SBR7|NZ. Ngawil FNZAGQ9-08
NIWA no voucher SER2| NZ. | FNZA384-08
NIWA no voucher SER1[ NZ, | FNZA383-06
NMNZ P.052745|NZ. Capre Brett
NMNZ P.037109| NZ. White Istand| FNZC188-09
| CSIRO H 7949-13 AUS, SA, GABIBW-A13730
99955 |L CSIRO no voucher] BW-1698] AUS. NSW. S of Diaster Bay| FOAD138-05
CSIRO H 3791-01] AUS. VIC. $ of Gabo Eland| FOADI35-05
CSIRO H 4500-01|AUS. VEC. 5 of Cape Everard| FOAD141-05
| CSIRO no voucher|BW-1699| AUS. NSW. 5 of Diaster Bay| FGADI39-05 -
CSIRO H 7539-03| AUS. TAS. E of Orford| FOACUSO-14
| CSIRO H 7904-03| AUS. SA. GAB|BW-A13489
CSIROno voucher|&W-1697| AUS. NSW. N of Cape Howe] FOADI37-05
CSIRO no voucher|EW-1700| AUS. NSW. S of Diaster Bay] FOADI40-05.
CSIRO no voucher jT 10004| AUS. SA. GAB|BW-AT4L20
CSIRO H 7698-09| AUS. TAS. Huon Commonwealth Marine Reserve| BW-A13043
| MMNZ P. 046285 | HZ. Bay of Iskandis| FNZC272-09
MMNZ P.046285-1|NZ. Bay of Iands|FNZC271-09 ——
CSIRO H 6845-01/3|AUS. NSW. E of Broken Bay] FOAKG10-10 ———
CSIRO H 6838-08) AUS. NSW. E of Broken Bay] FOAKÉ32-10 b.
NMAN P.052719| MZ. Ranfurly Bank :
| CSIRO H 6836-08/2] AUS. NSW. E of Broken Bay| FOAKG04-
CSIRO H 6845-011] AUS. NSW. E of Broken Bay| FOAKB26-10.
CSIRO H 6845-01/2] AUS. NSW. E of Broken Bay| FOAKBL;
CSIRO H 6980-04) AUS. TAS. E of Tasmania | BW-ABD56
CSIRO H 6991-01|AUS, TAS. E of Tasmaría|EW-ABO67
CSIRO no voucher] GT 7975] AUS. TAS. The Friars] BW-A13029-
NMW A 31132-001 AUS. TAS. off Taroona| BW-A12965
CSIRO no voucher! GT 7974] AUS. TAS. The Friars] BW-A:
CSIRO no voucher| BW-1693|AUS. VIC. Bass Strait| FOAD133-05 -
J| CSIRO H 7715-01]AUS. TAS. Munro Bight] BW-A13031 ——
CSIRO H 4225-01] AUS. TAS. S of Port Arthur] FOAD136-05 _
-
Wut.
CSIRO urreg GT 7976|AUS. TAS. The Friars| BW-A13030
CSIRO H 7717-01|AUS. TAS. Hinsby Beach|BW-A13032
CSIRO no voucher| BW-1692| AUS. VIC. Bass Strait| FOAD132-05.
SS NMNZ P.044349] NZ. Chatham Rise] FNZA558-08
NIWA no voucher RCOS| N2. S of Auckland Island| FNZA351-07-
NIMNZ P.044350|N2. Chatham Rise| FN2A559-08
NMNZ P.053749| NZ. Stewart Island
asses || NIWA no voucher RCO1| NZ. ME of Campbell Island|FNZ949-07
NIWA no voucher RECHI] NZ. NE of Campbe! EHand|FNZ950-07
NIWA no voucher RCO6| NZ. S of Auckland Esland| FNZA352-07
NIWA no voucher RCO?7| NZ. |FNZASEB-08
NIWA no voucher ROOS] NZ.|FNZA389-08
NIWA no voucher ROOSI NZ. |FNZA390-08
NMNZ P.044338| MZ. ECSTIFNZASS5-08
NMNZ P.044339| NZ. ECSI]FNZAS56-08
NMNZ P.044348| NZ. Chatham Rise
NMMHZ P.053748| NZ. Stewart Island
NMNZ P.053750| NZ. Stewart Island
NMNZ P.053751|NZ. Stewart Island
NMNZ P.053752| NZ, Stewart Island
NMNZ P.054&828| NZ. Whanganui Bar| Neotype |
NIWA no voucher PCO2| NZ. WESI] FNZA334-07
NIMNZ P.045575|NZ. WCSI| FN2C107-09
39/9/99 |. NMINZ P.045S76|NZ. WCSI] FNZCC108-09
NMNZ P.045577]NZ. WCST| FNZC109-09 A. punctatus
NIWA na voucher PCO1| NZ. WESH FNZA333-07
NIMNZ P.045573|NZ. WCSI| FNZC- 105-09
NMNZ P.045574| NZ. WCSI| FNZC 106-09
k
0.05
Figure 1. Hasegawa-Kishino-Yano maximum likelihood tree of 65 COI sequences from four purported species of Pseudophycis, along with seven
sequences for an outgroup species, Auchenoceros punctatus. Percentage bootstrap values followed by bootstrap values in p-distance neighbour
joining and maximum parsimony trees are given for all well supported nodes (2 of 3 exceeding 80%). Specimen numbers are those of registered
museum vouchers or sequence numbers in the Barcode of Life Database (BOLD, http://www.barcodinglife.org/). o
Australasian red cods 6/
20mm
E d
CN
=a IN
^ $
a bh
^w
*
,
z — -
g UV -
jd 7 7 -
20 mm
Figure 2. Pseudophycis palmata. A, B, CSIRO H 7366-01, 265 mm SL, Storm Bay, east of Variety Bay on North Bruny Island, Tasmania,
Australia, fresh specimen, lateral view of body and lateral view of head and anterior body with black pectoral blotch, respectively, (photographs
C. Devine, CSIRO); C, SMNS 1589, holotype, 172 mm SL, Port Phillip, Hobsons Bay, Victoria, Australia (photograph C. Struthers, NMNZ).
60
M.F. Gomon, C.D. Struthers & J. Kemp
P
- Gr.
-A0
P. palmata F. bachus
(S) Holotype ^ (9) Nectype
© data @ data
> othermaterial 9 other material
150
P. barbata
@) Holotype
@ data
^ ether material y
120 l 180
P. breviuscula
(9) Holotype
@ data
4
^? ether material
120 150 ` 180
Figure 3. Collection localities for specimens of Pseudophycis spp. in museums. A, P. bachus, green and P. palmata, orange; B, P. barbata, blue;
C, P. breviuscula, red.
Australasian red cods 69
Caudal Peduncle Length vs SL
Q P. palmata holotype
& P, palmata
e P. barbata
Q P. palmata holotype
9 P. palmata
e P. barbata
© P.nolmata holotype
Ə P. palmata
e F. barbata
Q P. palmata holotype
e P. palmatu
@ P. barbata
Figure 4. Plots of proportional measurements (76 SL) against standard lengths for non-type specimens of Pseudophycis palmata, P. barbata and
holotype of P. palmata. A, caudal peduncle length; B, interorbital width; C, barbel length; D, pelvic fin length.
10
M.F. Gomon, C.D. Struthers & J. Kemp
Resemblance: D1 Euclidean distance
0.2
0.1
CAP2
-0.1 -
-0.2
-0.2 -0.1
CAP 1
Key
3€ P palmata Holotype
A P palmata
MX P. bachus Neotype
O P bachus
$- P barbata Holotype
O P barbata
A P. breviuscula Holotype
© P breviuscula
1 0.2
Figure 5. Scatter plot of canonical analysis of principal coordinates scores on the first and second canonical axes for 124 specimens of
Pseudophycis, including types.
Body moderately slender, compressed laterally (fig. 2),
greatest depth at anal fin origin 23.6 (18.7-26.5)% SL,
tapering uniformly from second dorsal fin origin to shallow
caudal peduncle; caudal peduncle moderately short, 8.9 (6.7—
10.8)% SL, strongly compressed, depth subequal to orbital
diameter. Distance between middle of anus and base of anal
fin slightly less than half suborbital depth. Body cavity
extending to above origin of anal fin.
Head acute, of moderate size, length 26.1 (25.9—-30.0)%
SL, width 14.5 (15.3—21.6)% SL and depth 12.8 (10.2—18.4)%
SL; snout of moderate length 7.6 (6.7—9.1)96 SL, not projecting
in advance of upper jaw, rounded in dorsal view. Nostrils
small, located about two-thirds to three-quarters of the way
from snout tip to eye, distance from nostril to orbital margin
less than (equal to or less than) diameter of combined nostrils;
nostrils positioned above horizontal through centre of eye;
posterior opening larger than (about half size to larger than)
anterior opening, separated from it by raised skin flap; most of
margin (most or just posterior opening) encircled by tubular
flap. Interorbital broad, slightly convex. Eye of moderate size,
orbital diameter 28.0 (18.9—31.5)96 HL, 1.33 (0.66—1.87) times
in interorbital space, 2.41 (1.65—7.06) times suborbital
distance, circular, upper edge of eye adjacent to dorsal margin
of head in lateral view, transparent skin covering eye faintly
pigmented near orbital dorsal margin. Postorbital moderately
long, 0.91 (0.55—1.01) times length of upper jaw. Mouth large,
terminal, upper jaw terminating posterior to (at or posterior
to) vertical through posterior margin of eye. Jaw teeth
caniniform, slightly curved, depressible, band of up to four or
five irregular rows in upper jaw with distinct hiatus at
symphysis; teeth in outer row more regularly arranged than in
inner rows; band tapering near rear of Jaw. Teeth of lower Jaw
similar in form to those of upper jaw; band of two or three
rows with broader patch on either side of symphysis, tapering
to single, widely spaced row posteriorly; rows almost
contiguous across symphysis. Vomerine teeth absent.
Australasian red cods
Opercular bones strong; upper extremity of gill opening at
horizontal through middle of eye; gill membranes continuous
across isthmus. Gill rakers on outer arch slender, of moderate
length, about 0.8 to 1.3 times length of opposing gill filaments,
8.4—12.2 times in head, their inner margin denticulate. Chin
barbel short, subconical 11.3 (6.0—17.4)96 HL.
Small cycloid scales covering all of head, including gular
region and isthmus, and body except for branchiostegal
membranes, surface of maxilla and premaxilla, lower lip and
distal parts of fins; thick mucus covering obscuring scales and
pores in freshly preserved material. Most head pores tiny,
following main cephalic sensory canals; row of slightly raised
pores from nostrils to tip of snout and then posteriorly just
above lower edge of suborbital; row of enlarged mandibular
pores on underside of lower jaw. Lateral line comprising
widely spaced pores on short tubes arising from narrow scale-
less gap, anterior end curved upwards slightly, then gradually
descending to lateral midline below posterior 25% of second
dorsal fin, remaining on lateral midline posteriorly.
Membranes of first and second dorsal fins continuous at
base; first dorsal originating distinctly behind vertical through
pectoral fin base; anterior two-thirds of second dorsal of
uniform height, lOth to 12th ray from posterior end of fin
longest, its height about 1.4 times length of 2nd ray at anterior
end of fin, last ten or so rays progressively shorter; rays of both
dorsal fins mostly unbranched, only last 13 to 16 rays, apart
from last one to three, branched. Fleshy, fine scale-covered
basal sheath on third or more of first dorsal and anterior
portion of second dorsal fins; fin rays interconnected by
membranes to tips, sheath gradually decreasing slightly in
coverage and thickness posteriorly, encompassing about half
of second dorsal fin near its insertion; sheath extending onto
body for anterior third of combined dorsal fin base, broadest
anteriorly, narrower posteriorly. Profile of anal fin like second
dorsal fin with comparable unbranched and branched rays.
Anal fin enclosed in broad fleshy sheath like dorsal fins; sheath
also extending onto body for anterior third or less of fin.
Caudal fin truncate with distinct dorsoposterior and
ventroposterior corners in adults, posterior margin with slight
convex curve; longest rays to corners, middle rays about
85—90% length of longest rays; fin more rounded in juveniles;
base of fin covered by indistinct sheath sharply demarcated
from scales of caudal peduncle. Pectoral fin tip reaching (not
quite to or to) vertical through anal fin origin, sixth or seventh
ray longest. Pelvic fin inserted anterior to vertical through
posterior edge of preopercle (more posteriorly in some
Specimens); outer two rays longer than inner rays; second ray
longest, 15.1 (11.7-17.3)76 SL, nearly twice length of
subsequent ray, reaching vertical through first dorsal fin origin.
Fresh colour. (Based on images of non-type material; fig. 2A,
B.) Medium brown above extending ventrally to about ventral
portion of pectoral fin base, white below, suffused with pinkish
hue, especially above anal fin base; lateral line slightly paler at
least anteriorly. Underside of head, jaws and barbel white,
sometimes tinged with pink. Dorsal, caudal and distal half of
anal fins medium brown; proximal half of anal fin white,
especially anteriorly, with pink hue; dorsal and anal fins with
‘1
fine black edge; posterior edge of caudal fin with broad black
margin. Pectoral fin medium brown with semi-circular black
basal spot covering dorsal 80% of proximal edge of fin,
extending little 1f at all onto side dorsal to fin base. Pelvic fin
rays white with pink hue.
Preserved colour. Mostly pale (upper half of head and body
pale dusky to dusky, lower half very pale, frequently pearly
white. Dorsal, caudal and distal half of anal fins pale dusky;
distal edges of dorsal and anal fins with fine dark margin;
posterior edge of caudal fin broadly dark; pelvic fin, pectoral
fin and basal half of anal fin very pale; pectoral fin with
prominent dark spot (faded in type) covering dorsal half or
more of basal edge, not extending onto side of body dorsally.
Etymology. The specific epithet palmata appears to be Latin
for “embroidered with palm branches”, although the reason for
the name is unknown.
Distribution. Endemic to coastal temperate waters of south-
east Australia at least from Port Lincoln, Spencer Gulf, South
Australia (34° 44' S, 135° 52' E, SAMA F2766), to Port
Stephens, New South Wales (32° 49' S, 152° 05' E, AMS
1.25865-003), including all of Tasmania (fig. 3a). An unverified
record at Coles Point, South Australia, 34° 22' 06” S, 135° 21'
09" E (SAMA F11864), may extend the distribution slightly
farther to the west (fig. 3A). Occurs on soft bottom habitat
at 2-115 m.
Remarks. Pseudophycis palmata 1s closely related to the New
Zealand P. bachus, with which it was confused (Günther, 1880a:
28; McCulloch, 1921: 42; Ogilby, 1886: 48; Waite, 1904: 24).
Both differ from the remaining two congeners by the possession
of a black spot or blotch at the base of the pectoral fin and a
truncated caudal fin margin in adults. The two also differ from
the others in having the lower half of the body and the basal half
or more of the anal fin mostly white, rather than tan to brown,
although these areas are occasionally suffused with orange to
pink in specimens of all four species. Morphometrically, the
pair appear to have a deeper caudal peduncle (3.8—5.9, mean
4.7% SL vs. 3.3—5.2, mean 4.4% SL), shorter barbel (1.7—4.9,
mean 3.5% SL vs. 4.7—9.6, mean 6.5% SL) and shorter or longer
head (25.9—30.0, mean 27.4% SL vs. 23.3—31.6, mean 28.8 in P.
barbata and 23.4—26.0, mean 24.8% SL in P. breviuscula), as
well as other relative lengths of features that correspond with
the general body form. All four species in the genus are
separable by vertical fin ray, scale and vertebral counts, as
identified 1n the above key and in Table 2. Both P. palmata and
P. bachus attain a large size, as does Pseudophycis barbata
(well over 600 mm SL), while P. breviuscula 1s the smallest
species, reaching only about 150 mm SL.
The two P. bachus-like species are very similar to each
other proportionally, although the eye of the Australian
species is slightly larger than that of P. bachus, the orbital
diameter 5.3—9.7, mean 7.4% SL vs. 4.6—8.1, mean 6.2% SL,
the paired fins proportionally shorter, pectoral fin 13.5—17.7,
mean 15.8% SL vs. 14.6—19.4, mean 17.1% SL and pelvic fin
11.7-17.3, mean 14.3% SL vs. 11.5—21.1, mean 16.7% SL, and
caudal fin similarly shorter 9.9—15.3, mean 12.2% SL vs.
11.2-15.6, 13.7% SL. Pseudophycis palmata is readily
[2
separable from P. bachus by the smaller pectoral fin blotch
that fails to extend onto the body above the pectoral fin base.
It also differs subtly from P. bachus in having the distal half
of the anal fin brownish with a fine black margin rather than
whitish, like the basal half, and the black margin confined to
the posterior lobe of the fin, if it is present at all. The
Australian cognate has fewer transverse scale rows (96-116
vs. 102-136 in P. bachus) but more pyloric caeca (8 — 10 vs.
6), anal fin rays (50—57 vs. 42—48) and second dorsal fin rays
(47-56 vs. 40—45).
In the course of exploring the taxonomic identity of the
Australian Red Cod, the species to which the name Physiculus
palmata Klunzinger, 1872, 1s referable became less and less
clear. The name was regarded as a junior synonym of P.
barbata for more than 80 years (McCulloch, 1929: 129).
Klunzinger’s (1872) original description is inadequate for
separating the three species of Pseudophycis occurring at or
in the vicinity of the type locality. A specimen (SMNS 1589)
in the Stuttgart Museum, the repository of Klunzinger's type
material, registered the year the name was published,
apparently collected at the type locality and clearly identified
by Klunzinger as that species, was regarded as a syntype by
Fricke (1992: 13; 2005: 48). It 1s much smaller (173 mm SL)
than the 50 cm length given in the description, implying
Klunzinger was aware of or had other material. The dark spot
on the base of the pectoral fin that 1s diagnostic for the species,
as well as dark pigment on the distal edge of the caudal fin,
has completely faded. The only other specimen of
Pseudophycis (SMNS 2242) dating from that approximate
time currently in the Stuttgart collection was identified by
Klunzinger in 1877 and is unlikely to have been available
when the description was published. We therefore follow
Fricke in regarding SMNS 1589 as the only known type.
Although the three species occurring near the type
locality are clearly separable by morphological characters, the
colours and markings on the type specimen that would have
been diagnostic have faded. Meristic characters including
vertebral numbers, fin ray and scale counts have ranges that
overlap slightly in the two most likely candidate species, P.
barbata and the Australian P. bachus cognate. Unfortunately,
the type specimen of P. palmata has meristic values that fall
in the overlap zone for all but three characters, the number of
scales above the lateral line 15 (11—15 in P. bachus-like vs.
16—22 in P. barbata), total caudal fin rays 37 (35—41 in P.
bachus-like vs. 32—35 in P. barbata) and pyloric caeca 10
(8—10 in P. bachus-like vs. 14—20 1n P. barbata) that favour its
identity as the P. bachus cognate (Table 1). A comparison of
relative morphometric values for the type with those of these
two species, however, revealed clear support for the identity of
the type as the P. bachus-like species with eight of the type's
relative measurements (head length, caudal peduncle length,
caudal peduncle depth, post-orbital length, interorbital width,
barbel length, pelvic fin length and caudal fin length)
positioned closer to the P. bachus-like species proportional
curves relative to standard length (e.g. fig. 4) and curves for
the same measurements (not head length) equally close to the
proportional curve relative to its head length. Only predorsal
fin length has clearly different proportional curves for the P.
M.F. Gomon, C.D. Struthers & J. Kemp
bachus-like species and P. barbata, with the predorsal value
for the type of P. palmata falling equidistant between the
curves of the two species for that measurement.
The diagnostics of a CAP analysis revealed that 96.8% of
124 specimens of Pseudophycis were correctly classified as
their respective species based on the 20 characters examined.
By species, the percentage of individuals correctly classified
by the CAP discriminant model was 96.6% for P. palmata
(with one misclassified as P. bachus), 97.3% for P. bachus
(with one misclassified as P. palmata), 94.3% for P. barbata
(with one misclassified as P. palmata) and 100% for P.
breviuscula. Separation of the four species of Pseudophycis 1s
shown in fig. 5, with some overlap of P. palmata and P.
bachus. SMNS 1589 (holotype of P. palmata) 1s grouped
within the other specimens of P. palmata and 1s well separated
from P. barbata. Consequently, the CAP analysis and fig. 5
support the taxonomic decision to resurrect Pseudophycis
palmata as the appropriate name for the Australian endemic
previously thought to be conspecific with P. bachus. Overlap
of P. palmata and P. bachus 1s consistent with the historical
confusion involving the two species.
Despite its close relationship with P. bachus, the first
known detailed description of this species appears to be that
of McCoy (1878) who based his description of P. "barbatus"
almost entirely on specimens of the Australian P. bachus-like
species. That species was probably the common representative
of the genus in the Melbourne markets at the time. Meristic
and morphometric data presented by McCoy appear to be
entirely attributable to specimens of P. palmata, with only the
illustration (McCoy, 1878: pl. 20) based on a specimen of P.
barbata. Although several of McCoy's specimens were either
lost or obscured by early collection practices, NMV A23366-
001 is likely to be the specimen featured in the illustration,
while counts and measurements were probably taken from
NMV 43104, 43105, A841 and A23366-002. Other old NMV
collection specimens of the new species that lack documented
provenance probably comprised the remaining three.
Considering the frequent occurrence of this species at the
type locality of P. palmata, together with the strong
morphological support discussed above, we consider the name
to be applicable to the Australian P. bachus-like cognate.
Paulin (1983) failed to deal with the name in the synonymies
of the three species he recognised.
This species has the most restricted range of Australian
Pseudophycis species, with no records of it west of Spencer
Gulf, South Australia. Its latitudinal limits approach those of
P. bachus in New Zealand, as do those of the two species
occurring in both Australia and New Zealand where
bathymetrically feasible.
Material examined. Type. Physiculus palmatus SMNS 1589 (172,
holotype) Port Phillip, Hobsons Bay (northernmost section of Port
Phillip Bay immediately south of Melbourne), Victoria.
Other material. (51 non-type specimens examined for meristic or
morphometric values, 90.1—380 mm SL; see Appendix 2 for additional
material in Australasian collections.) Australia, New South Wales:
AMS 1.34462-004 (2, 230—233) north-east of Lookout Point, Twofold
Bay, 37° 4.2'S, 149° 56.1' E, 100 m, J.K. Lowry and S.J. Keable, 26—27
November 1988; AMS 1.34567-001 (146) middle of Long Beach,
Australasian red cods
Batemans Bay, 35° 42'S, 150° 13' E, 50 m, J.K. Lowry and S.J. Keable,
23—24 November 1988; AMS 1I.34569-003 (112) east of Lookout Point,
Twofold Bay, 37° 46'S, 149° 56' E, 50 m, J.K. Lowry and S.J. Keable,
26—27 November 1988; AMS 1.34570-001 (3, 117—190) east of
Lookout Point, Twofold Bay, 37° 46' S, 149° 55' E, 50 m, 26-27
November 1988. Victoria: NMV A840-001 (2, 95.5211) old
collection, no data; NMV A840-002 (2, 198-202) old collection, no
data; NMV A3859 (187) eastern Bass Strait, 6 km west-south-west of
Cape Conran, 37° 49.8' S, 148° 40' E, 26 m, BSS 208 T, M.F. Gomon
and R.S. Wilson, 30 July 1983; NMV AS$8870-001 (4, 95.7—113) and
NMV A$870-002 (121) Bass Strait, 1 km off Lake Tyers, 37° 51.1' S,
148° 9' E, 15 m, Marine Science Laboratories, 5 June 1984. Tasmania:
AMS I.23880-004 (192) north of George Town, 40 57.90' S, 146 46.20'
E, 50 m, K. Graham and FRV Kapala, 13 July 1980; AMS I.34952-003
(258) mouth of Fortescue Bay, 43° 7.77' S, 147° 59.47' E, 50 m, J.K.
Lowry and K. Dempsey, trawl, 9-10 April 1994; CSIRO H 4229-01'
(380) south of Port Arthur, 43° 17.3' S, 147? 47.1' E-43? 16.5' S, 147°
49.6' E, 115—119 m, B. Evans, 27 May 1996; CSIRO H 6205-02 (136)
Battery Point, CSIRO wharf, 42° 53' S, 147° 20' E, H. Motomura, 20
February 2005; CSIRO H 7366-01' (265) Storm Bay, east of Variety
Bay on North Bruny Island, 43° 12.17' S, 147° 27.46' E, 40—45 m, hook
and line, A. Pender, 6 May 2012; CSIRO H 7716-01' (350) Munro
Bight, 43° 11'S, 147° 59' E, 22 m, A. Pender , January 2012; CSIRO H
7T117-01* (362) Hinsby Beach, Taroona, 42? 57.22' S, 147? 20.82' E, 2
m, A. Pender, February 2012; CSIRO T 1186-02" (8, 110-262) Nutgrove
Beach, Sandy Bay, Derwent River, P.R. Last, 19 May 1980; CSIRO T
1417 (113 mm SL) Derwent Estuary, 7 m, P.R. Last; NMNZ P.024340
(4: 142—197) Nakyrare Beach, Derwent Estuary, 43° 3.000' S, 147°
22.000' E, FV Ophelia, 29 March 1988; NMV A 1218-001 (316),
NMV A 1218-002 (318) central Bass Strait, 20 km north-north-east of
North Point, 40? 31.8' S, 145° 22.8' E, 44 m, BSS 116 T, M.F. Gomon,
G.C.B. Poore and P. Forsyth, 4 November 1980; NMV A1275 (378)
central Bass Strait, 23 km east of Cape Rochon, Three Hummock
Island, 40° 22.8' S, 145° 16.998' E, 40 m, BSS 112 T, M.F. Gomon,
G.C.B. Poore and P. Forsyth, 3 November 1980; NMV A1528-001 (6,
73.5—161) and NMV A1528-002 (3, 93.6—151) central Bass Strait, 30
km north of Wynyard, 40° 33.07' S, 145° 44.69' E, 67.7 m, 4 February
1981; NMV A 31132-001* (318) off Taroona between Taroona and
Alum Cliffs, 42? 57.470' S, 147? 20.797' E, 6 m, hook and line, B.
Barlow, 10 May 2014.
Pseudophycis bachus (Forster in Bloch and Schneider,
1801)
Common name: New Zealand Red Cod (new Australian name);
red cod, hoka (New Zealand)
Figures 1, 3A, 5, 6; Tables 1—4
Enchelyopus bachus Forster 1n Bloch and Schneider, 1801: 53.
Type locality: Queen Charlotte Sound, New Zealand. No types known.
Based on manuscript description of Gadus bacchus by Forster.
Gadus bacchus. Cuvier, 1817: 486; Forster in Lichtenstein, 1844:
120, 420; Whitehead, 1978: 40; Hoare, 1982: 269.
Lota bacchus Cuvier, 1829: 334; Richardson, 1846: 61.
Brosmius venustus Richardson and Gray, 1843: 222 (generic
referral of Parkinson's unpublished manuscript name Blennius
venustus, written on the painting used by Forster for his description of
Gadus bacchus). Richardson, 1843: 27; Taylor, 1855: 413.
Enchelyopus bacchus. Lichtenstein, 1844: 419 (1ndex only).
Lotella bacchus. Günther, 1862; 347; Hutton and Hector, 1872: 46,
115; Hector, 1875: 239; Hector, 1884: 55; Hector, 1886: 28; Hutton,
1875: 134; Thomson, 1877: 485; Thomson, 1878: 326; Thomson, 1879:
382; Dambeck, 1879: 536, 547, 555; Parker, 1882: 263; Parker, 1883:
[à
234, 235, pl. 33; Sherrin, 1886: 16, 17, 93, 304; Thomson, 1890: 370, pl.
28; Beattie, 1891: 71,81, 82, pl. 12, pl. 13, pl. 14, pl. 15; Thomson, 1892:
212; Ayson, 1900: 14; Mair, 1903: 319; Ayson, 1907: 22; Johnson,
1921: 473; Carter and Malcolm, 1926: 647; Malcolm, 1926: 658;
Svetovidov, 1937: 1285; Svetovidov, 1948: 17, 60 (anatomy).
Pseudophycis bacchus. Günther, 1880a: 26 (Port Hardy, D'Urville
Island); Murray, 1895: 599 Gill, 1893: 94, 95 100, 120 (list); Karrer,
1971: 153, 179, 180, 185, 195; Habib, 1975: 1; Ayling and Cox, 1982:
142, pl 9. (description).
Pseudophycis bachus. Günther, 1880b: 542—543, fig. 248; Ogilby,
1886: 48 (list, in part); Hutton, 1890: 282; Fitch, 1972: 570, 573;
Marshall and Cohen, 1973: 490; Edgar et al., 1982: 32, fig. 17
(description, in part); Paulin, 1983: 91 (description, taxonomy, in part);
Paulin and Stewart, 1985: 22; Paul, 1986: 57, fig. (1n part); Francis
1988: 21, pl. 18; Paulin, 1988: 450, 451, 453; Paxton and Hanley in
Paxton et al., 1989: 302 (list, in part); Paulin et al., 1989: 119 (keyed),
255 (list); Cohen in Cohen et al., 1990: 373 (taxonomy, in part); Paulin
in Amaoka et al., 1990: 155, fig. 103 (description, in part); Paulin and
Roberts, 1992: 130, fig. 62a (description, 1n part); Kuiter, 1993: 59
(description, in part); Gomon in Gomon et al., 1994: 333 (description,
in part); Francis, 1996: 20, pl. 18; Horn, 1996: 151, 158; Kuiter, 1997:
50 (description, in part); Paulin, 1998: 52, fig. (description); Paul,
2000: 57 (description); Francis, 2001: 25, pl. 19; Beentjes and Renwick,
2001: 315, 316; Paxton et al., 2006: 616 (taxonomy, in part); Hirt-
Chabbert, 2006: 39; Gomon in Gomon et al., 2008: 313 (description, in
part); Roberts et al., in Gordon et al., 2009: 532 (listed); McMillan et
al., 2011a: 161, 162; McMillan et al., 2011b: 94; Francis, 2012: 5; Horn
et al., 2012: 624, 625, 627—629, 631—633; Roberts et al., 2014: 18
(listed); Struthers et al., in Roberts et al., 2015: 864, fig. 107.20
(description); Roberts et al., 2015: S164 (listed); Roberts et al., 2017:
8] (listed), Roberts et al., 2019: 90 (listed).
Physiculus bacchus. Günther, 1887: 87; Goode and Bean, 1895:
365, 549; Hutton, 1896: 316; Hutton, 1904: 48 (listed); Thomson, 1906:
551; Thomson and Anderton, 1921: 74; Thomson and Thomson, 1923:
111; Frost, 1924: 609; Frost, 1926: 488, 490; Young, 1925: 370; Archey
in Speight, Wall and Laing, 1927: 203; Anonymous, 1931: 32; Frost,
1933: 140; Benham, 1934: 31; Benham, 1935: 22; Benham, 1938: 56;
Graham, 1938: 405; Graham, 1939: 364; Doogue and Moreland, 1960:
197, 288; Doogue and Moreland, 1961: 208, 316; Moreland, 1963: 20;
Webb, 1966: 52, fig. 2.8, 70, 128, table 3.4, 164, 209, 230, 231, 234,
238—240, 257, 263, 266, 280, 294b, 294c; Webb, 1972b: 43; Webb,
1973: 307—309; Heath and Moreland, 1967: 37, 56; Whitehead, 1969:
pl. 11; Anonymous, 1971: 17; Anonymous, 1972c: 47; Watkinson and
Smith, 1972: 31; Knox and Kilner, 1973: 354; Vooren, 1974: 43, 44.
Physiculus bachus. Stead, 1906: 86 (in part); Waite, 1907: 18
(listed); Zietz, 1909: 266; Waite, 1909: 51, 52, 57, 134; Waite, 1911:
162, 183, 259, 265, 2770, pl. 31; Thomson, 1913: 233; Phillipps, 1918:
271; Phillipps, 1921: 121, 125; Phillipps and Hodgkinson, 1922: 95;
Waite, 1923: 92 (1n part); Ayson, 1924: 7; Lord and Scott, 1924: 8, 43;
Phillipps, 1926: 528; Lord, 1927: 13; Phillipps, 1927a: 128; Phillipps,
1927b: 23, 60; Phillipps, 1927c: 12; Waite, 1928: 6 (listed); McCulloch,
1929: 129 (in part); Young, 1929: 141; Anonymous, 1930: 28; Finlay,
1930: 47; Anonymous, 1934: 43; Anonymous, 1935: 34; Norman,
1935: 3; Benham, 1936: 26; Hefford, 1936: 71, 74; Cunningham, 1937:
898, Norman, 1937: 54, 55 (in part, listed); Shorland, 1937: 223;
Wilson, 1937: 31; Johnston, 1938: 47; Munro, 1938: 62; Graham,
1939b: 364; Fowler, 1940: 758; Rapson, 1940: 35; Phillipps, 1947: 42;
Phillipps, 1948: 129; Shorland, 1948: 109; Laird, 1949: 14, 19, 36, 37,
39, 53, 56, 60, 6l, 137, 145, 146; Phillipps, 1949: 24, 59; Shorland,
1950: 35; Laird, 1951: 287, 298, 306, 308; Laird, 1952: 589, 590, 595,
596, 600; Graham, 1953: 166, 173, 399; Manter, 1954. 498, 545, 547,
549, 559; Robinson, 1955: 10, 71, 105, pls 9 and 14; Anonymous, 1957:
69; Kaberry, 1957: 90; Moreland, 1957: 34, 36; Parrott, 1957: 47, 175;
Anonymous, 1958: 73; Parrott, 1958: 117; Anonymous, 1959: 70;
74 M.F. Gomon, C.D. Struthers & J. Kemp
d
=
-> * - e - -
m. "u^ |
il » oa € Ys “a
— ` è - ` ^ " T i
| Qi +. a p
= 9 ~~ E
= ww. Da <
Figure 6. Pseudophycis bachus. A, B, NMNZ P.054828, neotype, 351 mm SL, 2.5 km off coast from Whanganui River bar, Whanganui, New
Zealand, fresh specimen, lateral view of body and anterior body showing black pectoral blotch respectively (photographs C. Struthers, NMNZ);
C, unpublished line drawing by S. Parkinson of Enchelyopus bachus Forster in Bloch and Schneider, 1801 (reproduced from Whitehead, 1969: pl. 31).
Australasian red cods
Robinson, 1959: 152; Anonymous, 1960: 70; Parrott, 1960: 67, 164;
Meglitsch, 1960: 321—323; Scott, 1962: 84 (in part); Gorman, 1963: 29;
Graham, 1963: 167; Doogue and Moreland, 1964: 205, 311; Street,
1964: 18; Anonymous, 1965: 15, 22; Churchman, 1965: 56; Doogue
and Moreland, 1966: 205, 311; Elder, 1966: 96, 97; Howell, 1966: 33;
Paul, 1966: 372, 373; Svetovidov, 1967: 1685, 1686, 1689, 1690;
Sorensen, 1968: 148; Tong and Elder, 1968: 64; Doogue and Moreland,
1969: 205, 311; Russell, 1969: 108; Cowper, 1970: 45; Godfriaux,
1970: 257; Iwai et al., 1970: 21; Shuntov, 1970: 373, 374, 376; Sorensen,
1970: 4, 17; Coakley, 1971: 24; Russell, 1971a: 9, 19, 21, fig. 3, 38, 41,
94, 173, table 10, fig. 13, 191, 197; Russell, 1971b: 83; Anonymous,
1972a: 229; Anonymous, 1972b: 187—189, 278; Doak, 1972: 19, 101,
131; Hewitt and Hine, 1972: 92; Iwai et al., 1972: 29, 36; Shuntov,
1972: 339; Walker, 1972: 2; Webb, 1972a: 16; Suda, 1973: 2150-2152;
Waugh in Williams, 1973: 257, 274; Williams, 1973: 427; Godfriaux,
1974: 502; Ryan, 1974: 133, 135; Scott et al., 1974: 95, 96 (in part).
Lotella bachus. Ayson, 1908: 28; Rendahl, 1926: 2.
Physiculus backus. Fowler, 1940: 758 (near Loba, New Zealand).
Physiculus (Pseudophycis) bachus. Graham, 1956: 166; Whitley,
1956: 403; Whitley, 1968: 40 (list).
Pscudophycis bachus. Doogue and Moreland, 1982: 218, fig.
(misspelling).
Diagnosis. First dorsal fin 11—13 rays, second dorsal fin 40—45
rays; anal fin 42—48 rays; total vertebrae 44—46; scales above
lateral line 1n oblique series from base of first dorsal fin ray
10-12; oblique rows of scales intersecting with lateral line
102-136; pyloric caeca 6; caudal peduncle moderately short
28.0—38.9% HL; barbel short, 8.6—16.9% HL; caudal fin
truncate with angular corners in specimens larger than about
150 mm SL, middle rays shorter than rays extending to corners;
dark blotch basally on pectoral fin extending well onto side
above fleshy pectoral fin base; underside of head and body
whitish; anal fin mostly whitish with faint narrow black distal
margin only posteriorly, if at all. A large species reaching at
least 650 mm SL.
Description. (Values for neotype with those for non-type
specimens when different in parentheses; see Tables 2—4 for
summary of selected meristic and comparative morphometric
values.) First dorsal fin 11 (11—13, rarely 13, first ray usually
minute); second dorsal fin 42 (40—45, usually 42 or 43); anal fin
45 (42—48, usually 45—47); pectoral fin 24 (22-25, rarely 22);
pelvic fin 5; caudal fin 36 (33-39); gill rakers 4 + 10 (4—5 +
10-12 = 14—16); lateral line pores not associated with individual
scales; oblique scale rows intersecting with lateral line 112
(102—136); scales 1n oblique series above lateral line 11 (10—
12), scales in oblique series below lateral line 30 (26—34, rarely
33 or 34); vertebrae 16 + 29 (16—17 + 27—30 = 44—46); pyloric
caeca 6.
Body moderately slender, compressed laterally (fig. 6),
greatest depth at anal fin origin 19.5 (18.4—23.7)% SL,
tapering uniformly from second dorsal fin origin to shallow
caudal peduncle; caudal peduncle short, 8.5 (7.7—10.5)% SL,
strongly compressed, depth less than orbital diameter.
Distance between middle of anus and base of anal fin less
than suborbital depth. Body cavity extending posteriorly to
above origin of anal fin.
Head acute, of moderate size, length 26.5 (25.9—29.6)96
SL, its width 14.4 (13.4-17.7)% SL and depth 11.7 (10.2—
15.6)% SL; snout of moderate length 7.5 (7.1-9.0)% SL, not
19
projecting in advance of upper jaw, rounded in dorsal view.
Nostrils small, located about two-thirds to three-quarters of
the way from snout tip to eye, distance from nostril to orbital
margin equal to or greater than diameter of combined nostrils;
nostrils positioned above horizontal through centre of eye;
posterior opening larger than anterior, separated from it by
raised skin flap; posterior opening with tubular flap encircling
margin. Interorbital of moderate width, very slightly convex.
Eye of moderate size, orbital diameter 21.1 (17.0—30.4)% HL,
1.58 (0.98—2.00) times in interorbital space, 2.20 (1.50—4.25)
times suborbital distance, circular, upper edge of eye adjacent
to dorsal margin of head in lateral view, transparent skin
covering eye faintly pigmented near orbital dorsal margin.
Postorbital moderately long, 1.01 (0.89—1.22) times length of
upper jaw. Mouth large, terminal, upper jaw terminating at
vertical through posterior margin of eye. Jaw teeth caniniform,
slightly curved, depressible, band of up to four or five irregular
rows in upper jaw with distinct hiatus at symphysis; teeth in
outer row more regularly arranged than in inner rows; band
tapering near rear of jaw. Teeth of lower jaw similar in form
to those of upper jaw; band of two or three rows with broader
patch on either side of symphysis, tapering to single, widely
spaced row posteriorly; rows almost contiguous across
symphysis. Vomerine teeth absent. Opercular bones strong;
upper extremity of gill opening at horizontal through middle
of eye; gill membranes continuous across isthmus. Gill rakers
on outer arch slender, of moderate length, almost as long near
angle as opposing gill filaments, 12.8 (9.5—12.8) times in
head, their inner margin denticulate. Chin barbel short,
subconical 12.0 (8.6—16.9)96 HL.
small cycloid scales covering all of head, including
isthmus and gular region, and body except for branchiostegal
membranes, surface of maxilla and premaxilla, lower lip and
distal parts of fins; thick mucus covering obscuring scales and
pores in freshly preserved material. Most head pores tiny,
following main cephalic sensory canals; row of slightly raised
pores from nostrils to tip of snout and then posteriorly just
above lower edge of suborbital; row of enlarged mandibular
pores on underside of lower jaw. Lateral line comprising
widely spaced pores on short tubes arising from narrow scale-
less gap, anterior end curved upwards slightly, then gradually
descending to lateral midline below posterior 25% of second
dorsal fin, remaining on lateral midline posteriorly.
Membranes of first and second dorsal fins continuous at
base; first dorsal originating vertically above pectoral fin
base; anterior two-thirds of second dorsal of uniform height,
7th to 9th ray from posterior end of fin longest, its height
about 1.4 times length of 2nd ray at anterior end of fin,
subsequent rays progressively shorter; rays of both dorsal fins
mostly unbranched, only last 13 to 16 rays of second dorsal,
apart from last one to three, branched. Fleshy, fine scale-
covered basal sheath on third or more of first dorsal and
anterior portion of second dorsal fins; fin rays interconnected
by membranes to tips, sheath gradually decreasing 1n coverage
and thickness posteriorly, encompassing about half of second
dorsal fin near its insertion; sheath extending onto body for
anterior third of combined dorsal fin base, broadest anteriorly,
narrowing posteriorly. Profile of anal fin like that of second
10
dorsal fin, although shallower posteriorly, with comparable
unbranched and branched rays. Likewise, anal fin enclosed in
broad fleshy sheath that 1s like that of dorsal fins; sheath also
extending onto body for anterior third or less of fin. Caudal fin
truncate with distinct dorsoposterior and ventroposterior
corners in adults, posterior margin with little if any convex
curve; longest rays to corners, middle rays about 85—90%
length of longest rays; fin more rounded in juveniles; base of
fin covered by indistinct sheath sharply demarcated from
scales of caudal peduncle. Pectoral fin tip variably reaching
almost to, to or past vertical through anal fin origin, sixth or
seventh ray longest. Pelvic fin inserted anterior to vertical
through posterior edge of preopercle (more posteriorly in
some specimens); outer two rays longer than inner rays;
second ray longest, 16.0 (11.5—21.1)% SL, nearly twice length
of subsequent ray, reaching past a vertical through first dorsal
fin origin.
Fresh colour. (Based on images of neotype; fig. 6A, B.) Medium
brown above extending ventrally to level of ventral edge of
pectoral fin base, white below, suffused with pinkish hue,
especially above anal fin base; lateral line slightly paler at least
anteriorly. Underside of head, jaws and barbel white, tinged
with pink. Dorsal and caudal fins medium brown, caudal paler
with reddish tinge ventrally; anal fin white with pink hue;
dorsal fins with fine black distal margin; caudal fin margin with
broader, more diffuse black margin; anal fin with faint black
distal margin, darkest posteriorly. Pectoral fin medium brown
with semi-circular black basal spot covering dorsal half of fin
edge proximally, extending well onto side of body above fin
base; ventroposterior margin of fin pale to translucent. Pelvic
fin rays white with pink hue.
Preserved colour. Upper half of head and body pale dusky
to dusky, lower half very pale, frequently pearly white.
Dorsal and caudal fins pale dusky; distal edge of dorsal fin with
fine dark margin; posterior edge of caudal fin broadly dark;
anal fin very pale, distal edge of fin posteriorly with fine dark
margin in some; pelvic fin, pectoral fin and basal half of anal
fin very pale; pectoral fin with prominent dark spot covering
dorsal half or more of basal edge that extends onto side above
pectoral fin base.
Etymology. The name bachus is an altered spelling of bacchus,
the Greek god of wine, adopted for the wine-red colouration
assumed shortly after capture but lost soon after death.
Distribution. Endemic to New Zealand, occurring around both
the North and South Islands, and reaching the Chatham Islands
in the east (fig. 3A). A demersal species on soft bottom at 2—570
m depth.
Remarks. Pseudophycis bachus was originally described as
Enchelyopus bachus Forster in Bloch and Schneider, 1801,
based on Forster’s manuscript description of “Gadus bachus",
subsequently published by Lichenstein (1844: 120). Forster’s
drawing No. 180, on the back of which is pencilled “ex Queen
Charlotte Sound”, is evidently an illustration of the fish on
which the description was based. Although both Bloch and
Schneider (1801: 53) and Lichtenstein gave the origin of the
M.F. Gomon, C.D. Struthers & J. Kemp
Specimen simply as “in the seas around New Zealand”,
Whitehead (1969: pl. 11), Paulin (1983: 91) and Fricke et al.
(2019) regarded Queen Charlotte Sound, the presumed
collection locality of the specimen implied in the note on
Forster’s illustration, as the type locality. However, Hoare’s
(1982: 269) reproduction of Forster’s Resolution Journal has a
footnote stating “Gadus bacchus of Descr. Anim., p. 120 and
Forster drawing 180 (undated). The description is from a
specimen of 22 inches (559 mm), dated 13 April 1773”. That
date puts the type locality as Dusky Sound from a larger fish.
Paulin (1983: 92) provided a detailed discussion of the origin
and various iterations of Bloch and Schneider’s name.
An unfinished drawing by Parkinson (vol. 2, no. 5, ex
Totarra ‘nue, 404 mm tot. 1.) reproduced by Whitehead (1969:
pl. 11; here as fig. 6C), has “18, Blennius venustus” pencilled
on the reverse side and 1s the basis for Richardson and Gray’s
(1843: 222) Brosmius venustus. The fish figured is clearly an
example of P. bachus, despite the incomplete nature of the
illustration. Totaranui 1s the Maori name for Queen Charlotte
sound. The scientific name is regarded as unavailable because
no distinguishing features were provided by the authors
(Fricke et al., 2019). The illustrated characters agree with
those of specimens from New Zealand identified as P. bachus.
Because no type specimen of P. bachus 1s known (Fricke
et al., 2019), the designation of a neotype for P. bachus 1s
considered justified. A specimen (NMNZ P.054828, 351 mm
SL; fig. 6a) collected from 2.5 km off the coast from
Whanganui River bar, Whanganui, New Zealand, is proposed
as the neotype for P. bachus. Accordingly, Whanganui, New
Zealand, becomes the type locality of P. bachus under Article
76.3 (ICZN, 1999), replacing the original type locality Queen
Charlotte Sound, New Zealand.
Material examined. Neotype. NMNZ P.054828' (351) 2.5 km off the
coast from Whanganui River bar, Whanganui, New Zealand, 39° 53'S,
174° 49' E, 18 m, C. Papple, 10 October 2012.
Other material. (38 non-type specimens examined for meristic or
morphometric values, 110—539 mm SL; see Appendix 2 for additional
material in Australasian collections.) New Zealand, North Island:
NMNZ P.001718 (539) off Castlepoint, Wairarapa, 40° 54' S, 176° 13'
E, 73-110 m, F. Abernethy, 8 July 1955; NMNZ P.033899 (5, 121—202)
off Raglan, Waikato, 37° 48.33' S, 174° 34.00' E, RV Kaharoa, 61—63
m, 26 October 1996. South Island: NMNZ P.025037 (2, 479—512)
Blueskin Bay, Otago Peninsula, Otago, 45° 43.28' S, 170° 40.33' E,
20-22 m, C.D. Roberts and C.D. Paulin, 9 May 1990; NMNZ P.025129
(4, 137—192) Entrance mole, Otago Harbour, Otago, 45° 46.45' S, 170°
43.23' E, 6—9 m, C.D Roberts, 9 May 1990; NMNZ P.027580 (239)
Harrold's Bay, Halfmoon Bay, Stewart Island, 46° 53.75' S, 168° 9.25'
E, 2-5 m, NMNZ Stewart Island field team, 4 March 1992; NMNZ
P.032385 (2, 328—395) Mooring, head of Gold Arm, Charles Sound,
Fiordland, 45° 8.55' S, 167° 8.78' E, 5-10 m, NMNZ Fiordland 1995
field team, 24 March 1995; NMNZ P.032393 (3, 292—309) Mooring at
Toe Cove, head of Nancy Sound, Fiordland, 45° 10.55' S, 167° 8.85' E,
25 m, NMNZ Fiordland 1995 field team, 26 March 1995; NMNZ
P.03599] (388) Flowerpot Rock, Jackson's Bay, West Coast, 43° 58.03'
S, 168° 37.30' E, 5-8 m, NMNZ Jackson-Haast 1999 field team, 7
February 1999; NMNZ P.044338' (136) south of Timaru, Canterbury,
44° 45.04' S, 171° 18.40' E, 26-31 m, RV Kaharoa, 3 June 2007;
NMNZ P.044339' (176) south off Timaru, Canterbury, 44° 45.04' S,
171° 18.40' E, 26-31 m, RV Kaharoa, 3 June 2007; NMNZ P. 047709
(229) Lyttelton Port, Canterbury, 43° 36.33' S, 172° 43.10' E, NIWA
Australasian red cods
Port Survey, 4 November 2004; NMNZ P.049392 (343) c. 7 km east-
north-east of Kaikoura Peninsula, 42° 24.77' S, 173° 48.22' E, 93 m,
C.D. Struthers, 16 November 2010; NMNZ P.049401 (370) c. 6 km
north-east of Kaikoura Peninsula, 42° 23.60' S, 173° 47.59' E, 49 m,
C.D. Struthers, 16 November 2010; NMNZ P.049402 (545) c. 5 km
east-south-east of Kaikoura Peninsula, 42° 26.77' S, 173° 46.39' E, 94
m, C.D. Struthers, 17 November 2010; NMNZ P.049403 (519) c. 5 km
south off Kaikoura Peninsula, 42 28.09' S, 173 43.02' E, 91 m, C.D.
Struthers, 19 November 2010; NMNZ P.049406 (485) and NMNZ
P.049407 (467) c. 3 km south off Kaikoura Peninsula, 42° 24.72' S,
173° 45.22' E, 47 m, C.D. Struthers, 17 November 2010; NMNZ
P.049678 (358) Bay View, end of Franklin Road, Hawke's Bay, 10—15 m,
C.D. Struthers and D.H. Struthers, 27 December 2010; NMNZ
P.052508 (297) and NMNZ P.052509 (290) south of Pegasus Canyon
mouth, Canterbury Bight, 43° 33.99' S, 173° 33.44' E, 86 m, RV
Tangaroa, 13 May 2011; NMNZ P.053748' (383), NMNZ P.053749'
(405), NMNZ P.053750' (368), NMNZ P.053751' (373) and NMNZ
P.053752' (337) Port Pegasus; Stewart Island, 47? 13.20' S, 167? 41.38'
E, 64 m, C.D. Struthers, 20 February 2012. Chatham Rise: NMNZ
P.044348' (273) central Chatham Rise, 43? 47.42' S, 179? 30.01' W,
327—328 m, RV Tangaroa, 31 December 2007; NMNZ P.044349'
(382) central Chatham Rise, 43° 47.42' S, 179° 30.01' W, 327—328 m,
RV Tangaroa, 31 December 2007; NMNZ P.044350' (297) central
Chatham Rise, 43° 43.78' S, 179° 24.00' W, 367—375 m, RV Tangaroa,
3] December 2007.
Pseudophycis barbata Günther 1862
Common name: Bearded Rock Cod (Australian Standard);
southern bastard cod (New Zealand)
Figures 1, 3B, 4, 5, 7; Tables 1—4
Pseudophycis barbatus Günther, 1863: 116. Type locality:
Victoria, South Australia. Holotype: BMNH 1863.1.15.38 (skin in
alcohol).
Pseudophycis barbatus. McCoy, 1878: 29, pl. 20 (in part,
description); Johnston, 1883: 126 (description); Ayling and Cox, 1982:
144, fig. (description).
Lotella grandis Ramsay, 1881: 462. Type locality: Wollongong,
New South Wales. Holotype: AMS I.696 (decision by Paulin, 1983: 94).
Lotella grandis. Steindachner, 1901: 509 (description).
Physiculus barbatus. Zietz 1909: 266; Waite, 1923: 91, fig.
(description); Lord and Scott, 1924: 8, 43 (description); McCulloch,
1927: 32 (listed); Waite, 1928: 6 (listed); McCulloch, 1929: 128 (list);
Norman, 1937: 55 (listed); Munro, 1938: 62, fig. 440 (description);
Whitley, 1955: 119 (taxonomy); Scott, 1962: 84, fig. (description);
Whitley, 1964: 40 (list); Svetovidov, 1967: 1686; Scott et al., 1974: 95,
fig. (description).
?Pseudophycis breviusculus (nec Richardson, 1846) Graham,
1939: 405 (after Paulin, 1983: 93).
Pseudophycis breviusculus (nec Richardson 1846). Habib, 1975:
32—57.
Physiculus (Pseudophycis) breviculus (nec Richardson, 1846).
Graham, 1956: 173 (in part, locality implies multiple species;
misspelling).
Physiculus (Pseudophycis) breviusculus (nec Richardson, 1846)
Whitely, 1956: 403 (in part?).
Pseudophycis barbata. Paulin, 1983: 94, fig. 10 (description, new
record for NZ); Paulin and Stewart, 1985: 22; Hutchins and Swainston,
1986: 34 124, fig. 114 (description); May and Maxwell, 1986: 195
(description); Paul, 1986: 58, fig; Francis, 1988: 21, pl. 19; Paulin,
1988: 453; Paxton and Hanley in Paxton et al., 1989: 302 (list); Paulin
et al., 1989: 119 (key), 255 (listed); Cohen in Cohen et al., 1990: 374
[1
(taxonomy); Paulin in Amaoka et al., 1990: 156 (description); Kuiter,
1993: 59 (description); Gomon in Gomon et al., 1994: 334 (description);
Francis, 1996: 21, pl. 19; Horn, 1996: 157; Kuiter, 1997: 50 (description);
Paulin, 1998: 67, fig. (description); Paul, 2000: 58; Francis, 2001: 25,
pl. 18; Hutchins, 2001: 23 (description); Paxton et al., 2006: 616 (list);
Hirt-Chabbert, 2006: 40; Gomon in Gomon et al., 2008: 314
(description); Roberts et al. in Gordon et al., 2009: 532 (listed);
McMillan et al., 201 1a: 161, 162; McMillan et al., 2011b: 94; Francis,
2012: 52; Roberts et al., 2014: 18 (list); Struthers et al. 1n Roberts et al.,
2015: 863, fig. 107.21 (description); Roberts et al., 2015: S164; Roberts
et al., 2017: 81 (list), Roberts et al., 2019: 90 (listed).
Diagnosis. First dorsal fin with. 10—11 rays, second dorsal fin
with 54—59 rays; anal fin with 54—63 rays; total vertebrae 48—
51; scales above lateral line in oblique series from base of first
dorsal fin ray 16—22; oblique rows of scales intersecting with
lateral line 123—162; pyloric caeca 14—20; caudal peduncle
short 13.5-18.6% HL; chin barbel of moderate length, 16.5—
35.1% HL; caudal fin rounded without angular corners, the
middle rays equal to or longer than rays above and below; no
distinct, dark blotch basally on pectoral fin although fin base
sometimes overall dark; underside of head and body tan to
brown; anal fin tan to brown with distinct black distal margin.
A large species reaching at least 620 mm SL.
Description. (Values for non-type specimens when different
from type in parentheses; see Tables 2—4 for summary of
selected meristic and comparative morphometric values.) First
dorsal fin 10 (10—11), first ray small to minute; second dorsal fin
59 (54-59, rarely 59); anal fin 59 (54—63); pectoral fin 25 (24—
27, rarely 24); pelvic fin 5; caudal fin 33 (32—35 rays); gill rakers
unknown (3—4 + 8-11 = 12-14); lateral line pores not associated
with individual scales; oblique scale rows intersecting with
lateral line unknown (123-162); scales in oblique series above
lateral line unknown (16—22), scales in oblique series below
lateral line unknown (38—56, rarely less than 45); vertebrae
unknown (14—16 + 33-37, rarely 37 = 48—51); pyloric caeca
unknown (14—20).
Body of moderate depth, moderately compressed laterally
(fig. 7b), greatest depth at anal fin origin unknown (19.7—
29.3)% SL, tapering uniformly from second dorsal fin origin
to shallow caudal peduncle; caudal peduncle short, 5.4 (5.2—
9.2)70 SL, strongly compressed, depth subequal to orbital
diameter. Distance between middle of anus and base of anal
fin slightly less than suborbital depth. Body cavity extending
to above origin of anal fin.
Head acute, of moderate size, length 23.3 (23.3—31.6)% SL,
width unknown (14.9—19.8)76 SL and depth unknown (11.0—
17.9)% SL; snout of moderate length 7.5 (6.5—9.6)96 SL, not
projecting in advance of upper jaw, rounded in dorsal view.
Nostrils small, located about two-thirds to three-quarters of the
way from snout tip to eye, distance from nostril to orbital
margin about equal to or greater than diameter of combined
nostrils; nostrils positioned above horizontal through centre of
eye, both with low tubular rim; posterior opening about half
size of anterior, separated from it by raised skin flap. Interorbital
of moderate width, very slightly convex. Eye of moderate size,
orbital diameter 20.8 (16.8—28.5)% HL, unknown (0.91—1.68)
times in interorbital space, unknown (1.46—4.71) times
suborbital distance, circular, upper edge of eye adjacent to
18
M.F. Gomon, C.D. Struthers & J. Kemp
50mm
50 mm
Figure 7. Pseudophycis barbata. A, NMNZ P.037124, 450 mm SL, Bay of Plenty, east of north-east point, North Island, New Zealand (photograph
C. Struthers, NMNZ); B, BMNH 1863.1.15.38, holotype of Pseudophycis barbata, 394 mm SL, Victoria, South Australia (photograph © The
Trustees of the Natural History Museum, London).
dorsal margin of head in lateral view. Postorbital moderately
long, 1.00 (0.52-1.21) times length of upper jaw. Mouth large,
terminal, upper jaw terminating at vertical through posterior
margin of eye. Jaw teeth caniniform, slightly curved,
depressible, band of up to four or five irregular rows in upper
jaw with distinct hiatus at symphysis; teeth in outer row more
regularly arranged than in inner rows; band tapering near rear
of jaw. Teeth of lower jaw similar in form to those of upper jaw;
band of two or three rows with broader patch on either side of
symphysis, tapering to single, widely spaced row posteriorly;
rows almost contiguous across symphysis. Vomerine teeth
absent. Opercular bones strong; upper extremity of gill opening
at horizontal through middle of eye; gill membranes continuous
across isthmus. Gill rakers on outer arch slender, moderately
short, unknown (about 0.6—0.8) times length of opposing gill
filaments near angle, unknown (19—22) times in head length,
slightly denticulate. Chin barbel of moderate length, subconical
21.1 (16.5—25.3)96 HL.
Very small cycloid scales covering all of head and body
except for branchiostegal membranes, surface of maxilla and
premaxilla, lower lip and distal parts of fins; thick mucus
covering obscuring scales and pores in freshly preserved
material. Most head pores tiny, following main cephalic
sensory canals; row of slightly raised pores from nostrils to
tip of snout and then posteriorly just above lower edge of
suborbital; row of enlarged mandibular pores on underside of
lower jaw. Lateral line comprising widely spaced pores on
short tubes arising from narrow scale-less gap, anterior end
Australasian red cods
curved upwards slightly, then gradually descending to lateral
midline below posterior 25% of second dorsal fin, remaining
on lateral midline posteriorly.
Membranes of first and second dorsal fins continuous at
base; first dorsal originating distinctly behind vertical through
pectoral fin base; anterior two-thirds of second dorsal of
uniform height, 7th to 9th ray from posterior end of fin
longest, its height about 1.4 times length of 2nd ray at anterior
end of fin, last ten or so rays progressively shorter; rays of
both dorsal fins mostly unbranched, only last 13 to 16 rays,
apart from last one to three, branched. Fleshy, fine scale-
covered basal sheath on third or more of first dorsal and
anterior portion of second dorsal fins; fin rays interconnected
by membranes to tips, sheath gradually decreasing slightly in
coverage and thickness posteriorly, encompassing about half
of second dorsal fin near its insertion; sheath extending onto
body for anterior third of combined dorsal fin base, broadest
anteriorly, narrowing posteriorly. Profile of anal fin like that
of second dorsal fin, although less deep posteriorly, with
comparable unbranched and branched rays. Likewise, anal fin
enclosed in broad fleshy sheath that is like that of dorsal fins;
sheath also extending onto body for anterior third or less of
fin. Caudal fin distinctly rounded without obvious
dorsoposterior and ventroposterior corners in adults; all but
anterior-most rays of similar length; base of fin covered by
indistinct sheath with much smaller scales (sheath sharply
demarcated from scales of caudal peduncle). Pectoral fin tip
variably reaching not quite to, or past vertical through anal fin
origin, sixth or seventh ray longest. Pelvic fin inserted anterior
to vertical through posterior edge of preopercle; outer two
rays longer than inner rays; second ray longest, 13.3 (13.3—
24.9)% SL, nearly twice length of subsequent ray, reaching
vertical through first dorsal fin origin.
Fresh colour. (Based on images of non-type material; fig. 7A.)
Medium to dark reddish brown above, extending ventrally to
level of ventral portion of pectoral fin base, white below in
smaller individuals, large individuals becoming brown
ventrally and often much darker; lateral line not distinctively
coloured. Underside of head, jaws and barbel white, tinged with
pink to orange, becoming more orange to brown in larger
individuals; ventral margin of suborbital dusky to dark. Dorsal
and caudal fins of similar colour to brown of sides, anal fin pink
or orange in smaller individuals, becoming brown like other
median fins in large individuals, dorsal, caudal and anal fins
with distinct broad to narrow black margin distally, margin on
caudal fin broadest. Pectoral fin orange to brown with faintly
darker semi-circular brown blotch basally, covering dorsal
80% of edge of fin proximally. Pelvic fin rays white with pink
to orange hue, becoming brownish in large individuals.
Preserved colour. Head and body dusky to dark dusky; underside
of head, belly and side adjacent to anal fin pale, especially in
small specimens, extent of pale underside less in large individuals.
Dorsal, caudal and anal fins dusky to dark dusky, anal fin often
less dark than dorsal and caudal; distal edges of dorsal, caudal
and anal fins with distinctly dark margins, dark margin on caudal
fin broad; pectoral fin broadly dusky basally, becoming pale
toward outer margin. Pelvic fin pale dusky.
19
Etymology. The specific epithet barbatus 1s Latin for “bearded”
in reference to the chin barbel, which 1s characteristic of this
species, its congeners and many other members of the family.
Distribution. Endemic to coastal waters of Australia and New
Zealand from Rottnest Island, Western Australia (32° OI' S,
115° 30' E), to Port Stephens, New South Wales (32° 30'S, 152°
35' E), including all of Tasmania and around both the North and
South Islands of New Zealand, reaching the Chatham Islands
in the east (fig. 3B). A demersal species on rocky bottom at | to
at least 520 m. Although found at considerable depths in New
Zealand waters, this is a shallow reef-dwelling species in
southern Australia, where it shelters in caves and beneath
overhangs during daylight hours, venturing out at night to feed.
Remarks. Pseudophycis barbata has an overall darker
colouration than its congeners, often with a reddish hue in fresh
material, and distinct black margins to the dorsal, caudal and
anal fins. [n particularly dark individuals, the basal portion of
the pectoral fin 1s similarly dark but lacks the distinct black
spot present in P. bachus and P. palmata. Pseudophycis
barbata 1s easily separable from P. breviuscula by the more
numerous scales (16—22 vs. 7—9) 1n a transverse row between
the dorsal fin origin and lateral line.
As mentioned above under Remarks for P. palmata,
McCoy's (1878: 29) treatment of P. barbata, the first published
after Günther's original description, was largely based on
specimens of P. palmata, but the accompanying illustration 1s
of a large specimen of P. barbata. Although Ramsay’s (1881)
description of Lotella grandis 1s inadequate for a conclusive
identification of the species, the lone type specimen (AMS
1.696) is clearly P. barbata. Early taxonomic confusion
resulted in Steindachner (1901: 509) reporting P. barbata
from New Zealand as L. grandis, Norman (1937: 55)
speculating that P. barbata (as Physiculus barbatus) may be
identical with P. bachus, and Graham (1938: 399) and Habib
(1975) treating it in New Zealand as P. breviusculus. The last
stems from our assumption that P. breviusculus does not
occur in the waters of the South Island based on specimens
examined and reliable identification records.
Material examined. Types. Pseudophycis barbatus BMNH
1863.1.15.38 (394, holotype) Victoria, South Australia (fig. 7a); Lotella
grandis AMS 1.696 (503, holotype) Wollongong, New South Wales.
Other material. (38 specimens examined for meristic or
morphometric values, 111—531 mm SL; see Appendix 2 for additional
material in Australasian collections.) Australia, Victoria: CSIRO H
3791-01" (340) south of Gabo Island, 37? 43.30' S, 149° 55.20' E-37°
41.10' S, 149° 57.10' E, 116-107 m, A. Graham, 17 September 1994;
CSIRO H 4500-01' (410) south of Cape Everard, 38° 07.81' S, 149?
30.87' E, 156 m, A. Williams and M. Lewis, 13 January 1997; NMV
A2248 (5, 134—185) Portland Harbour, halfway along lee breakwater,
adjacent to oil wharf, 38° 20.916' S, 141° 37.398' E, 7-12 m, R. Kuiter,
R. Wilson and I. Head, 22 October 1981; NMV A2261-001 (4, 149—180)
Portland Harbour, end of lee breakwater, 38? 21' S, 141° 36' E, 12 m, R.
Kuiter, R. Wilson and I. Head, 21 October 1981; NMV A13046 (203)
eastern Bass Strait, 110 km E of Paradise Beach, 38° 18.7' S, 148? 50.7'
E, 201-208 m, M. Gomon, 7 August 1993. Tasmania: AMS I.20079-
009 (90.1) south side of Rocky Cape, in National Park, 40° 51' S, 145°
31'E, 2-8 m, B.C. Russell, 8 December 1977; CSIRO H 7539-03! (185)
south-east of Orford, rock point W of Triabunna woodchip mill, 42°
80
32.92' S, 147° 54.80' E, 3 m, P.L Last, W. White and J. Pogonoski, 01
April 2014. South Australia: CSIRO CA 3526 (410 mm SL) Great
Australian Bight, 32° 11.8' S, 131° 22.4' E-32° 13.4' S, 131° 22.2' E, 60
m, 7 December 1981; CSIRO H 7949-13! (2, 47—70) Great Australian
Bight, 33° 20.20' S, 130° 15.42' E33? 20.20' S, 130° 16.26' E, 191-188
m, A. Graham, J. Pogonoski, M.F. Gomon and D.J. Bray, 15 December
2015. Western Australia: WAM P.26621.003 (135) Porpoise Bay,
32?00' S, 115°30' E, 1 m. New Zealand, North Island: NMNZ P.01930
(514) Wellington, Ohau Point, Makara Coast, 41 14.00' S, 174 39.00' E,
18 m, J. Moreland, 10 June 1956; NMNZ P.01492] (2, 207—240) Three
Kings Islands, west end of Great Island, 34^ 8.5' S, 172° 9.1' E, 5—7 m,
G.S. Hardy and A.L. Stewart, 28 November 1983; NMNZ P.037109*
(518) Mahina Knoll, NW of White Island, Bay of Plenty, 37° 20.46' S,
177? 5.43' E, 303 m, NMNZ/MARS White Island field team, 22 March
2009; NMNZ P.037124* (450) east of north-east point; White Island,
Bay of Plenty, 37° 30.96' S, 177? 13.54' E, 296 m, NMNZ/MARS
White Island field team, 19 March 2009; NMNZ P.044103' (250)
southeast of Club Rock; White Island, Bay of Plenty, 37? 32.35' S, 177°
11.92' E, 99 m, NMNZ/MARS White Island field team, 16 March
2009; NMNZ P.044272 (376) and NMNZ P.044273 (361) Three Kings
Islands, northern edge of Three Kings Shelf; north off Princess Islands,
114m, NMNZ/MARS Three Kings field team, 10 March 2010; NMNZ
P.045835' (197) east off Parengarenga Harbour entrance, 34? 30.93' S,
173° 18.05' E, 176 m, RV Kaharoa, 4 August 2009; NMNZ P.046563
(339) Three Kings Islands, at anchor, Northwest Bay; Three Kings
Island, 34 9.16' S, 172 8.06' E, 27 m, C.D Struthers, 6 March 2010;
NMNZ P.052585 (339) Northland, off North Cape, 34° 16.47' S, 173°
0.80' E, 130-132 m, RV Tangaroa, 25 March 2011; NMNZ P.052745'
(443) eastern side of Motkokako Island, Cape Brett, 35° 9.90' S, 174°
20.27" E, S. Tindale, 7 September 2011; NMNZ P.053551' (531) Kingfish
Reef, Bay of Islands, 35° 11.20' S, 174° 15.40' E, 35 m, 5. Tindale, 8
April 2012. South Island: NMNZ P.035978 (2, 234—266) West Coast,
Open Bay Island, south end Popotai Islet, 43° 51.82' S, 168° 52.48' E,
14-19 m, NMNZ Jackson-Haast field team, 14 February 1999; NMNZ
P.036535 (3, 186—256) West Coast, Open Bay Island, south end Popotai
Islet, 43? 51.82' S, 168° 52.48' E, 14-19 m, NMNZ Jackson-Haast field
team, 14 February 1999; NMNZ P.037525 (4, 111—148) West Coast,
North of Murphy Beach, Whakapohai Rocks, 43° 42.27' S, 169° |4.33'
E, 12-14 m, NMNZ Haast-Buller field team, 18 February 2000. NMNZ
P.053753 (281) off Snares Islands, 47? 59.99' S, 166? 36.25' E, 160 m,
NMNZ/MARS Auckland Island field team, 21 February 2012; NMNZ
P.053754 (390) Stewart Island, North Arm, Port Pegasus, 47° 10.73' S,
167? 40.95' E, 38 m, NMNZ/MARS Auckland Island field team, 20
February 2012.
Pseudophycis breviuscula (Richardson 1846)
Common name: Bastard Red Cod (Australian Standard);
northern bastard cod (New Zealand)
Figures 1, 3C, 5, 8; Tables 1—4
Lota breviuscula Richardson, 1846: 61, Pl. 38 (figs 1-2). Type
locality: Bay of Islands, New Zealand. Holotype: BMNH
1855.9.19.1182.
Pseudophycis breviusculus. Günther, 1862: 350; Günther, 1863:
116; Hector in Hutton and Hector, 1872: 116, pl. 8; Hutton in Hutton
and Hector, 1872: 47; Dambeck, 1879: 536, 547, 555; Hector, 1884: 55;
Hector, 1886: 28; Sherrin, 1886: 304; Gill, 1893: 120 (list); Hutton,
1904: 48; Thomson, 1906: 551; Young, 1925: 370; Graham, 1938: 405;
Graham, 1939b: 365; Ayling and Cox, 1982: 143, fig. (description).
Austrophycis megalops Ogilby, 1897: 91. Type locality: Maroubra
Bay, New South Wales, Australia. Holotype: AMS 1.3655.
Austrophycis megalops. McCulloch, 1927: 32 (list); McCulloch,
M.F. Gomon, C.D. Struthers & J. Kemp
1929: 129 (list); Munro, 1938: 62, fig. 443 (description); Whitley, 1964:
40 (list); Paxton and Hanley in Paxton et al., 1989: 302 (list).
?Pseudophycis breviusculus. Graham, 1939: 399.
Physiculus (Pseudophycis) breviusculus. Graham 1956: 173, 174
fig.; Whitley, 1956: 403 (list); Svetovidov, 1967: 1686, 1689; Whitley,
1968: 40 (list).
Pseudophycis breviuscula. Paulin, 1983: 93 (description,
taxonomy); Francis, 1988: 21; Paxton and Hanley in Paxton et al.,
1989: 302 (list); Paul, 1986: 58; Paulin, 1988: 450, 451, 453; Paulin et
al., 1989: 119 (key), 255 (list); Cohen in Cohen et al., 1990: 375
(taxonomy); Paulin and Roberts, 1992: 128, fig. 68a (description);
Kuiter, 1993: 60 (description); Gomon in Gomon et al., 1994: 335
(description); Francis, 1996: 21; Paul, 2000: 58; Francis, 2001: 25;
Hutchins, 2001: 23 (distribution); Sazonov, 2001: 293 (taxonomy of A.
megalops), Paxton et al., 2006: 616 (list); Gomon in Gomon et al.,
2008: 314 (description); Roberts et al. in Gordon et al., 2009: 532 (list);
McMillan et al., 2011a: 161, 162; McMillan et al., 2011b: 94; Francis,
2012: 52; Struthers et al., 1n Roberts et al., 2016: 864, fig. 107.22
(description); Roberts et al., 2015: S164; Roberts et al., 2017: 81,
Roberts et al., 2019: 90 (listed).
JAustrophycis marginata (nec Günther, 1878). Cohen in Cohen et
al., 1990: 356 (taxonomy of A. megalops).
Diagnosis. First dorsal fin with 8—10 rays, second dorsal fin
with 44—52 rays; anal fin with 49—56 rays; total vertebrae 42—
45; nostrils adjacent to anterior margin of orbit, interval
between nostril and orbital margin less than diameter of
combined nostrils; posterior nostril with raised anterior border
but without tubular flap posteriorly; gill rakers of outer arch
moderately short, those near angle much shorter than opposing
gill filaments; caudal peduncle short 28.8—33.4% HL; chin
barbel of moderate length, 23.4—30.5% HL; scales above lateral
line in oblique series from base of first dorsal fin ray 7—9;
oblique rows of scales intersecting with lateral line 77—93;
pyloric caeca 7—8; caudal fin rounded without angular corners,
the middle rays equal to or longer than the rays above and
below; no distinct dark blotch at base of pectoral fin; underside
of head, body and anal fin tan to brown, anal fin with fine black
distal margin. A small species reaching at least 151] mm SL.
Description. (Values for non-type specimens when different
from type in parentheses; see Tables 2—4 for summary of
selected meristic and comparative morphometric values.) First
dorsal fin 9 (8—10, rarely 8), first ray often minute; second
dorsal fin 46 (44—52, rarely less than 46); anal fin 50 (49-56);
pectoral fin 21 (20—23); pelvic fin 4 (4—5); caudal fin 26 (26—32,
rarely 26); gill rakers 3 (23) + 8 (7—8) = 9-12; lateral line
pores not associated with individual scales; oblique scale rows
intersecting with lateral line 93 (77-93); scales in oblique
series above lateral line 7 (7—9), scales 1n oblique series below
lateral line 23 (22-28, rarely 28); vertebrae 13 (11—14, rarely 11)
+ 31 (30—33) = 42-45, rarely 42; pyloric caeca 7-8.
Body of moderate depth, moderately compressed laterally
(fig. 8), greatest depth at or just in advance of anal fin origin
22.8 (20.6—23.3)% SL, tapering gradually from second dorsal
fin origin to posterior portion of fin and then more steeply to
shallow caudal peduncle; caudal peduncle short, 4.8 (5.7—
8.5)% SL, strongly compressed, depth subequal to orbital
diameter. Distance between middle of anus and base of anal
fin less than diameter of posterior nostril. Body cavity
extending to above origin of anal fin.
Australasian red cods
81
10 mm
Figure 8. Pseudophycis breviuscula. A, CSIRO H 4384-01, 110 mm SL, Albany, Western Australia (photograph compliments CSIRO Marine
Research); B, BMNH 1855.9.19.1182, holotype of Lota breviuscula, 152 mm SL, Bay of Islands, New Zealand (photograph © The Trustees of the
Natural History Museum, London).
Head acute, moderately short, length 25.8 (23.4—26.0)%
SL, its width 16.6 (12.4—17.9)% SL and depth 12.1 (10.8—15.2)%
SL; snout moderately short 5.9 (5.1—7.0)% SL, not projecting in
advance of upper jaw, rounded in dorsal view. Nostrils small,
located on posterior half of snout just in front of eye, distance
from nostrils to orbital margin less than diameter of combined
nostrils; nostrils positioned above horizontal through centre of
eye; diameter of posterior opening about 1.5 diameter of
anterior, separated from it by raised skin flap; posterior
opening without tubular flap encircling posterior margin.
Interorbital of moderate width, slightly convex. Eye of
moderate size, orbital diameter 27.4 (24.7—35.7)% HL, 0.91
(0.53—1.10) times 1n interorbital space, 3.72 (2.20—5.78) times
suborbital distance, circular, upper edge of eye just below
dorsal margin of head in lateral view, skin covering eye
unpigmented. Postorbital moderately long, 1.09 (0.97—1.50)
times length of upper jaw. Mouth large, terminal, upper jaw
terminating just posterior to vertical through posterior margin
of eye. Jaw teeth small, caniniform, slightly curved,
depressible, band of up to four or five irregular rows 1n upper
Jaw with narrow hiatus at symphysis; band tapering near rear
of jaw. Teeth of lower jaw similar in form to those of upper
Jaw; band of several rows with broader patch on either side of
symphysis, tapering posteriorly; rows almost contiguous
across symphysis. Vomerine teeth absent. Opercular bones
strong; upper extremity of gill opening at horizontal through
middle of eye; gill membranes continuous across isthmus. Gill
rakers on outer arch club-shaped, moderately short, about
0.3—0.8 times length of opposing gill filaments at angle, 15—23
times in head, slightly denticulate. Chin barbel of moderate
length, subconical 21.0 (19.6—30.5)% HL.
Moderately small cycloid scales covering all of head and
body except for branchiostegal membranes, surface of maxilla
and premaxilla, lower lip and distal parts of fins; very thick
mucus covering obscuring scales and pores in freshly
preserved material. Most head pores tiny, following main
cephalic sensory canals; row of slightly raised pores extending
from tip of snout posteriorly just above lower edge of
suborbital; row of enlarged mandibular pores on underside of
lower jaw. Lateral line comprising pores on tubes arising
above upper end of gill opening, anterior end curved upwards
slightly, then gradually descending to lateral midline below
82
posterior third of second dorsal fin, remaining on lateral
midline posteriorly.
Membranes of first and second dorsal fins continuous at
base; first dorsal originating distinctly behind vertical through
pectoral fin base; anterior two-thirds of second dorsal of
uniform height, 7th to 9th ray from posterior end of fin longest,
its height about 1.2 times length of 2nd ray at anterior end of
fin, last eight or so rays progressively shorter; rays of both
dorsal fins mostly unbranched, only about last 14 or 15 rays,
except last few, branched. Fleshy basal sheath on base of first
dorsal and anterior portion of second dorsal fins not especially
prominent with scales apparently confined to basal margin of
fin; fin rays interconnected by membranes to tips; sheath more
obvious on body below much of combined dorsal fin base,
broadest anteriorly, narrowing posteriorly. Profile of anal fin
similar to that of second dorsal fin, with comparable unbranched
and branched rays. Fleshy sheath on and below anal fin similar
to that of dorsal fins. Caudal fin rounded without distinct
dorsoposterior and ventroposterior corners, posterior margin
distinctly convex; all but anteriormost rays of similar length;
base of fin covered by indistinct sheath (sheath demarcated
from scales of caudal peduncle). Pectoral fin tip reaching past
vertical through anal fin origin, seventh or eighth ray longest.
Pelvic fin inserted anterior to vertical through posterior edge of
preopercle; outer two rays longer than inner rays; second ray
longest, 17.6 (16.6—21.6)% SL, two to four times length of
subsequent ray, reaching vertical through first dorsal fin origin.
Fresh colour. (Based on images of non-type material; fig. 8B.)
Medium brown to pale brown above, paler below with white
chest and belly in smaller individuals, bronze in larger
individuals; lateral line not distinctive. Underside of head and
jaws brownish; ventral edge of suborbital darker brown; barbel
white. Dorsal, anal and caudal fins very pale brown in smaller
individuals, darker in large individuals; fins with distinct broad
to narrow black margin distally, more diffuse in large individuals.
Pectoral fin orange with very faint semi-circular brown blotch
basally. Pelvic fin rays white with pink to orange hue.
Preserved colour. Head, body and fins pale dusky to
dusky, chest and belly very pale, ventral edge of suborbital
darker; distal edges of dorsal, caudal and anal fin with diffuse
darker margins.
Etymology. The name breviuscula is Latin for “rather short”,
probably in reference to the relatively small maximum size of
the species compared with others of the genus, although
Richardson separated it from other New Zealand morids simply
by fin counts.
Distribution. Endemic to coastal waters of Australia and New
Zealand, from Perth, Western Australia (32° Ol' S, 115? 30' E),
to Tweed Heads, New South Wales (28° 14' S, 153° 50' E),
including all of Tasmania and around the North Island of New
Zealand (fig. 3C). A demersal reef-dwelling species at 0—273 m,
although most often encountered at less than 100 m on rocky
and boulder reets (Struthers et al. 1n Roberts et al., 2016: 864).
Remarks. P. breviuscula 1s the smallest of the four species in
the genus, reaching less than half the maximum length of its
M.F. Gomon, C.D. Struthers & J. Kemp
congeners. It also occurs in slightly warmer waters compared
with the other three members of the genus, reaching well onto
the northern New South Wales coast in eastern Australia and
around New Zealand's North Island.
Paulin (1983: 94) provided a thorough synonymy of P.
breviuscula from a New Zealand perspective but failed to
mention Austrophycis megalops Ogilby, 1897, which was
based on a specimen from New South Wales, Australia. This
omission was possibly due to the widespread uncertainty
about the identity of Waite's shrivelled 65 mm type specimen.
some authors regarded Ogilby's species as congeneric with
Günther's (1878: 19) A. marginatus based on material from
the south-eastern Pacific and others thought the two were
likely to be conspecific (Cohen in Cohen et al., 1990: 356).
sazonov (2001: 343) reported that he had examined the type
specimen and found it to be P. breviuscula relegating the
name A. megalops to synonymy with that species.
Material examined. Types. Lota breviuscula BMNH 1855.9.19.1182
(152, holotype) Bay of Islands, New Zealand (fig. 8a); Austrophycis
megalops AMS 1.3655 (65, holotype) Maroubra Bay, New South
Wales, Australia, 33° 57' S, 151° 16' E, T. Whitelegge, 1897 (after
sazonov, 2001: 343, holotype, not re-examined for this study).
Other material. (47 specimens examined for meristic or
morphometric values, 70.2—139 mm SL; see Appendix 2 for additional
material in Australasian collections.) Australia, Victoria: NMV
A2261-002 (2, 106-111) Portland Harbour, end of lee breakwater, 38°
21' S, 141° 36' E, 12 m, R. Kuiter, R. Wilson and I. Head, 21 October
1981; NMV ASS82 (2, 84.0-127) Bass Strait, 80 km south-east of
Loch Sport, 38° 34.3' S, 148° 18.2' E, 86 m, Victorian Marine Sciences
Laboratory, 6 June 1984. Tasmania: CSIRO H 7698-09* (66) Huon
Commonwealth Marine Reserve, 43° 42.72' S, 147° 11.32' E—43?
42.97" S, 147° 10.35' E, 122 m, A. Graham and J. Pogonoski, 8 April
2015. Western Australia: WAM P.25342.004 (112) Cape Naturaliste,
33?32' S, 115*0T' E, J. Scott, 16 February 1964; WAM P.25343.017 (2,
108-119) Fremantle, 32°02' S, 115°40' E, L.M. Marsh et al, 24 June
1975; WAM P.26616.005 (125) Point Clune, 32°00' S, 115°30' E, 8 m,
J.B. Hutchins et al, 29 March 1979; WAM P.28297.006 (5, 59.4—139)
Lucky Bay, 34^08' S, 122°15' E, 8-10 m, J.B. Hutchins, 13 April 1984;
WAM P.28300.005 (5, 63.8—131) Lucky Bay, 34°05' S, 122°15' E, 11—
12 m, J.B. Hutchins et al, 16 April 1984. New Zealand, North Island:
NMNZ P.028044 (9, 532-127) Matatuahu Point, Tawharanui Peninsula,
Hauraki Gulf, 36? 23' S, 174° 49' E, 0—5 m, A.L Stewart and C.D.
Paulin, 8 April 1992; NMNZ P.028118 (7, 62—119) Onepoto Bay, Hicks
Bay, East Cape, 37° 35.25' S, 178° 18.00' E, 0-3 m, NMNZ East Cape
1992 field team, 4 May 1992; NMNZ P.029805 (3, 55-135) Waihau
Bay, Bay of Plenty, 37° 36.8' S, 177° 54.6' E, 4-6 m, NMNZ East Cape
1993 field team, 27 January 1993; NMNZ P.030036 (4, 103-135)
inside of Tuamotu Island, Gisborne Harbour, 38? 42.2' S, 178? 2.4' E,
4—7 m, NMNZ East Cape 1993 field team, 21 January 1993; NMNZ
P.046263 (103) north of Tom Bowling Bay; North Cape, 34^ 22.56' 5,
172? 55.28' E, 61—72 m, RV Tangaroa, 14 July 2009; NMNZ P.046285'
(2, 72.2—81.4) east of Purerua Peninsula, Bay of Islands, 35° 6.36' S,
174° 17.10' E, 119—121 m, RV Tangaroa, 7 July 2009; NMNZ P.048310
(70.4) western end of Omapere wharf, 35° 32.05' S, 173° 23.14 E, 4 m,
NMNZ & AIM Northland 2011 field team, 13 February 2011; NMNZ
P.048311 (70.5) western end of Omapere wharf, 35° 32.05' S, 173°
23.14' E, 4 m, NMNZ & AIM Northland 2011 field team, 13 February
2011; NMNZ P.048312 (82.6) western end of Omapere wharf, 35°
32.05' S, 173° 23.14' E, 4 m, NMNZ & AIM Northland 2011 field
team, 13 February 2011; NMNZ P.048380 (124), NMNZ P.048381
(96.8) and NMNZ P.048382 (3, 59.9-101) reef inside southern
Australasian red cods
headland of Hokianga Harbour, 35° 32.01' S, 173° 22.10' E, 5-8 m,
WCN 11/09, NMNZ & AIM Northland 2011 field team, 15 February
2011; NMNZ P.049600 (84.8) and NMNZ P.049703 (93) Tauroa Point,
Ahipara, 35° 10.48' S, 173° 2.73' E, 21 m, WCN 11/35, NMNZ & AIM
Northland 2011 field team, 22 February 2011; NMNZ P.049708 (100)
Tauroa Point, Ahipara, 35° 9.96' 5, 173° 3.12' E, 14m, NMNZ & AIM
Northland 2011 field team, 22 February 2011; NMNZ P.051786 (119)
Tauroa Point, Ahipara, 35° 10.48' S, 173° 2.73 E, 21 m, NMNZ &
AIM Northland 2011 field team, 22 February 2011; NMNZ P.057218'
(78.5) and NMNZ P.052719' (82.3) Ranfurly Bank, 37? 32.78' S,
178° 53.42' E, 68—70 m, RV Tangaroa, 30 May 2011.
Acknowledgements
We thank P. McMillan for providing insightful comments on
the manuscript. We are indebted to George Habib, who
provided a wealth of information about the morphology of
P. bachus in his unpublished thesis (Habib, 1975), and have
taken the liberty of including the vast majority of his
nomenclatural citations in the above synonymies, as well as
Larry Paul's unpublished bibliography. Amanda Hay and Sally
Reader (AMS), John Pogonoski (CSIRO), Jeremy Barker and
Romain Crechriou (NMNZ), and James Maclaine (BMNH)
provided radiographs of the types of the four species of the
genus. We are particularly grateful to John Pogonoski for
access to sequence data and for arranging the collection of
fresh material and to the angler Andrew Pender for assisting.
We are deeply grateful to Lara Shepard (NMNZ) who
extracted and prepared 11 additional sequences (including the
Neotype of P. bachus) to supplement existing BOLD
sequences. Alastair Graham (CSIRO), Mark McGrouther
(AMS), Glenn Moore and Mark Allen (WAM) and Dianne
Bray (NMV) for access to specimens. Ken Graham for his
collection of specimens and images. Bob Ward (CSIRO) made
available CO] sequences in his care and provided useful
comments on the manuscript. Scott Tindale assisted with the
collection of specimens. Special thanks go to Jeremy Austin
for his failed attempt to amplify adequate lengths of CO1 from
the purported type of P. palmata for comparison with those of
the three Australian species of Pseudophycis. We thank NIWA
skippers, crew and science staff (especially Peter McMillan
and Dan MacGibbon) of both RV Tangaroa and RV Kaharoa
for the important help and ongoing collecting, depositing of
Specimens, tissue samples and photographs to Te Papa. MV
Tranquil Image (Western Workboats), G. Gibbs, and S. Kelly
aided in logistics for Te Papa field collections. Collecting of
fresh material was also aided by Te Papa Collection
Development Programme (AP 3126). This work was supported
(in part) by the NZ National Institute of Water and Atmospheric
Research Ltd Core Funded Coasts and Oceans Programme 2:
Biological Resources subcontract for fundamental knowledge
of marine fish biodiversity with the Museum of New Zealand
Te Papa Tongarewa.
References
Amaoka, K., Matsuura K., Inada T., Takeda, M., Hatanaka, H., and
Okada K. (eds). 1990. Fishes collected by the R/V Shinkai Maru
around New Zealand. Japan Marine Fishery Resource Research
Center: Tokyo. 410 pp.
83
Anderson, M.J., and Willis, T.J. 2003. Canonical analysis of principal
coordinates: a useful method of constrained ordination for ecology.
Ecology 84: 511—525.
Anonymous. 1930. Appendix 2. P. 28 in: New Zealand Marine
Department annual report for the year 1929—1930. New Zealand
Government: Wellington. 41 pp.
Anonymous. 1931. Appendix 1. P. 32 in: New Zealand Marine
Department annual report for the year 1930—1931. New Zealand
Government: Wellington. 43 pp.
Anonymous. 1934. Appendix 3. P. 43 in: New Zealand Marine
Department annual report for the year 1933—1934. New Zealand
Government: Wellington. 43 pp.
Anonymous. 1935. Appendix 3. P. 34 in: New Zealand Marine
Department annual report for the year 1934—35. New Zealand
Government: Wellington. 40 pp.
Anonymous. 1957. New Zealand Marine Department annual report for
the year 1956—1957. New Zealand Government: Wellington. 83 pp.
Anonymous. 1958. New Zealand Marine Department annual report for
the year 1957—1958. New Zealand Government: Wellington. 87 pp.
Anonymous. 1959. New Zealand Marine Department annual report for
the year 1958—1959. New Zealand Government: Wellington. 85 pp.
Anonymous. 1960. New Zealand Marine Department annual report for
the year 1959—1960. New Zealand Government: Wellington. 85 pp.
Anonymous. 1965. Product requirements and permissible temperatures
and times. Pp. 15, 22 in: Fish, and requirements for the handling,
preparation, and distribution of fish: New Zealand Standard
Specification, 2003(1). 40 pp.
Anonymous. 1971. Marine Department report on fisheries for 1971.
New Zealand Government: Wellington, New Zealand. 38 pp.
Anonymous. 1972a. Report of the Kaiyo-maru surveys off New Zealand.
Japanese Fisheries Agency, Tokyo. Vol 1: 292 pp.
Anonymous. 1972b. Report of the Kaiyo-maru surveys off New Zealand
(tables, figures and photographs). Japanese Fisheries Agency:
Tokyo. Vol 2: 290 pp.
Anonymous. 1972c. New Zealand Ministry of Agriculture and Fisheries
Report on Fisheries for 1972. New Zealand Government:
Wellington. 75 pp.
Archey, G.E. 1927. The native fishes of Canterbury. P. 203 in: Speight,
R., Wall, A., and Laing, R.M. (eds), Natural history of Canterbury.
Philosophical Institute of Canterbury: Christchurch.
Ayling, T., and Cox, G.J. 1982. Collins guide to the sea fishes of New
Zealand. William Collins Publishers Ltd: Auckland. 343 pp.
Ayson, L.F. 1900. Report on experimental trawling. New Zealand
Marine Department Annual Report for the year 1899—1900. New
Zealand Government: Wellington. 34 pp.
Ayson, L.F. 1907. Interim report on experimental trawling. P. 22 in: New
Zealand Ministry of Agriculture and Fisheries Report 'on Fisheries
for 1906—1907. New Zealand Government: Wellington. 26 pp.
Ayson, L.F. 1908. Report on experimental trawling. New Zealand
Ministry of Agriculture and Fisheries Report 'on Fisheries for
1907-1908. New Zealand Government: Wellington. 31 pp.
Ayson, L.F. 1924. New Zealand Fish and Fisheries. New Zealand
Government: Wellington. 32 pp.
Beattie, J.M. 1891. On the anatomy of the red cod (Lotella bacchus).
Transactions and Proceedings of the New Zealand Institute 23:
71-83.
Beentjes, M.P., and Renwick, J.A. 2001. The relationship between red
cod, Pseudophycis Bachus, recruitment and environmental
variables in New Zealand. Environmental Biology of Fishes 61:
315-328.
Benham, W.B. 1934. Annual report on the Portobello Marine Fish
Hatchery and biological station. Pp. 29-31 in New Zealand
Marine Department annual report for the year 1933—1934. New
Zealand Government: Wellington. 43 pp.
34
Benham, W.B. 1935. Annual Report on the Portobello Marine Fish
Hatchery and Biological Station. Pp. 20—22 in: New Zealand
Marine Department annual report for the year 1934—35. New
Zealand Government: Wellington. 40 pp.
Benham, W.B. 1936. Annual Report on the Portobello Marine Fish
Hatchery and Biological Station. Pp. 26—27 in: New Zealand
Marine Department annual report for the year 1955—1956. New
Zealand Government: Wellington. 47 pp.
Benham, W.B. 1938. Appendix 1. Annual Report on the Portobello
Marine Fish Hatchery and Biological station. In New Zealand
Marine Department annual report for the year 1937—1938. New
Zealand Government: Wellington. 60 pp.
Bloch, M.E., and Schneider, J.G. 1801. M. E. Blochii, Systema
Ichthyologiae Iconibus cx Ilustratum. Post obitum auctoris opus
inchoatum absolvit, correxit, interpolavit Jo. Gottlob Schneider,
Saxo. Berolini. Sumtibus Auctoris Impressum et Bibliopolio
Sanderiano Commissum. i-lx + 1—584, pls 1—110.
Brown, R.W. 1954. Composition of scientific words. G.W. King
Printing Co.: Baltimore. MD.
Carter, C.L., and Malcolm, J. 1926. Food values of New Zealand fish.
Part 5. The fats of the red cod in relation to its food. Transactions
and Proceedings of the New Zealand Institute 56: 647—650.
Churchman, J. (ed.) 1965. Science Survey, Jackson Bay; 1965. Zoology.
Science Record Otago 15: 56.
Coakley, A. 1971. The biological and commercial aspects of the
elephant fish. 1. The commercial fishery. New Zealand Marine
Department, fisheries technical report 76. New Zealand
Government: Wellington. 25 pp.
Cohen, D.M., Inada, T., Iwamoto, T., and Scialabba, N. 1990. FAO
Species Catalogue. Vol 10. Gadiform fishes of the world. FAO:
Rome. 442 pp.
Cowper, T.R. 1970. Scientific reports of cruises of T.S. Fukushima
August 31 - October 5 1964, June 8 - July 19 1965, and F.V. Suruga
Maru September 27 - December 2 1965. Commonwealth Scientific
and Industrial Research Organization Division of Fisheries and
Oceanography Report 48: 1—47.
Chiaradia, A., Costalunga, A., and Knowles, K. 2003. The diet of little
penguins, Eudyptula minor, at Phillip Island, Victoria, in the
absence of a major prey—pilchard, (Sardinops sagax). Emu 103:
43-48.
Cullen, J.M., Montague, T.L., and Hull, C. 1992. Food of little
penguins Eudyptula minor in Victoria: comparison of three
localities between 1985 and 1988. Emu 91: 318—341.
Cunningham, M.M. 1937. Further data on the vitamin D content of
New Zealand fish liver oils. New Zealand Journal of Science and
Technology 18: 598—890.
Cuvier, G. 1817. Le Régne Animal, distribué d'aprés son organisation,
pour servir de base a Uhistoire naturelle des animaux et
d'introduction à l'anatomie comparée. Paris: Déterville 2: 1-xvi +
1-532.
Cuvier, G. 1829. Le Régne Animal, distribué d'aprés son organisation,
pour servir de base à Uhistoire naturelle des animaux et
d'introduction à l'anatomie comparée. Paris: Déterville 2nd ed,
2: 1-xv + 1-406.
Dambeck, K. 1879. Appendix A. Geographical distribution of the
Gadidae or the cod family, in its relation to fisheries and commerce
in II. Pp. 531—557 in: Part IV: Report of the Commissioner for
1877. United States Commission of Fish and Fisheries:
Washington, DC. 981 pp.
Doak, W.T. 1972. Fishes of the New Zealand region. Hodder and
Stoughton: Auckland, New Zealand. 132 pp, 48 pl.
Doogue, R.B., and Moreland, J.M. 1960. New Zealand sea anglers’
guide. First edition. A.H. and A.W. Reed: Wellington. 289 pp.
M.F. Gomon, C.D. Struthers & J. Kemp
Doogue, R.B., and Moreland, J.M. 1961. New Zealand sea anglers’
guide. Second edition. A.H. and A.W. Reed: Wellington. 318 pp.
Doogue, R.B., and Moreland, J.M. 1964. New Zealand sea anglers’
guide. Third edition. A.H. and A.W. Reed: Wellington. 317 pp.
Doogue, R.B., and Moreland, J.M. 1966. New Zealand sea anglers’
guide. Fourth edition. A.H. and A.W. Reed: Wellington. 317 pp.
Doogue, R.B., and Moreland, J.M. 1969. New Zealand sea anglers’
guide. Fifth edition. A.H. and A.W. Reed: Wellington. 313 pp.
Doogue, R.B., and Moreland, J.M. 1982. New Zealand sea anglers’
guide. Ninth edition. A.H. and A.W. Reed: Wellington. 320 pp.
Edgar, J.E., Last, P.R., and Wells, M.W. 1982. Coastal fishes of
Tasmania and Bass Strait. Cat & Fiddle Press: Hobart. 176 pp,
142 figs.
Elder, R.D. 1966. Larval teleosts in the plankton of Wellington
Harbour. Unpublished MSc thesis, Victoria University of
Wellington, New Zealand. 114 pp.
Finlay, J.H. 1930. Appendix 5. Report on the examination of the scales
of quinnat salmon for the determination of age and growth. Pp.
44—63 in: New Zealand Marine Department report on fisheries
for 1930. 41 pp.
Fitch, J.E., and Barker, L.W. 1972. The fish family Moridae in the
eastern North Pacific with notes on morid otoliths, caudal
skeletons, and the fossil record. Fishery Bulletin United States
Department of Commerce 70(3): 565—584.
Fowler, H.W. 1940. The fishes obtained by the Wilkes Expedition
1838—1842. Proceedings of the American Philosophical Society
82: 733—800.
Francis, M.P. 1988. Coastal fishes of New Zealand: a diver's
identification guide. Heinemann Reed: Auckland. 63 pp.
Francis, M.P. 1996. Coastal fishes of New Zealand: an identification
guide. Revised edition. Reed Publishing: Auckland. 72 pp.
Francis, M.P. 2001. Coastal fishes of New Zealand: An identification
guide. Third edition. Reed Publishing: Auckland. 103 pp.
Francis M.P. 2012. Coastal fishes of New Zealand: identification,
biology, behaviour. Fourth edition. Craig Potton Publishing:
Nelson. 268 pp.
Fricke, R. 1992. Types in the fish collection of the Staatliches Museum
für Naturkunde in Stuttgart. Part 2. The Klunzinger collection
Stuttgarter Beitrdge zur Naturkunde. Serie A (Biologie) 473:
1-25.
Fricke, R. 2005. Types in the fish collection of the Staatliches Museum
für Naturkunde in Stuttgart, described in 1845-2004. Stuttgarter
Beitrdge zur Naturkunde. Serie A (Biologie) 684: 1—95.
Fricke, R., Eschmeyer, W.N., and Van der Laan, R. (eds.). 2019.
Eschmeyer's catalog of fishes: genera, species, references.
Accessed at: http:;//researcharchive.calacademy.org/research/
ichthyology/catalog/collections.asp on 16 April 2019.
Frost, G.A. 1924. Otoliths of fishes from the tertiary formations of
New Zealand. Transactions and Proceedings of the New Zealand
Institute 55: 605—014.
Frost, G.A. 1926. A comparative study of the otoliths of the
neopterygian fishes (continued). XIII. Order Anacanthini. Annals
and Magazine of Natural History Series 9 (18)107: 483—490.
Frost, G.A. 1933. Otoliths of fish from the tertiary formations of New
Zealand. Transactions and Proceedings of the New Zealand
Institute 63: 33—141.
Gales, R., and Pemberton, D. 1994. Diet of the Australian fur seal in
Tasmania. Australian Journal of Marine and Freshwater
Research 45: 653-664.
Gill, T. 1893. A comparison of antipodal faunas. Memoirs of the
National Academy of Sciences 6(5): 91—121.
Godfriaux, B.L. 1970. Food of predatory demersal fish in Hauraki
Gulf. 2: Five fish species associated with snapper. New Zealand
Journal of Marine and Freshwater Research 4(3): 248—260.
Australasian red cods
Godfriaux, B.L. 1974. Food of snapper in western Bay of Plenty, New
Zealand. New Zealand Journal of Marine and Freshwater
Research 8&(3): 473—504.
Gomon, M.F., Glover, C.J.L., and Kuiter, R.H. 1994. The fishes of
Australia’s south coast. Flora and Fauna of South Australia
Handbooks Committee: Adelaide, Australia. 992 pp.
Gomon, M.F., Bray, D.J., and Kuiter, R.H. 2008. Fishes of Australia’s
southern coast. New Holland Publishers: Melbourne, Australia.
928 pp.
Goode, G.B., and Bean, T.H. 1895. Oceanic ichthyology, a treatise on
the deep-sea and pelagic fishes of the world, based chiefly upon
the collections made by the steamers Blake, Albatross, and Fish
Hawk in the northwestern Atlantic. Special Bulletin of the United
States National Museum. Government Printing Office:
Washington, DC. 553 pp.
Gorman, T.B.S. 1963. Biological and economic aspects of the elephant
fish Callorhynchus milii Bory in Pegasus Bay and the Canterbury
Bight. New Zealand Marine Department, Fisheries Technical
Report 6. New Zealand Government: Wellington. 54 pp.
Graham, D.H. 1938. Fishes of Otago Harbour and adjacent seas with
additions to previous records. Transactions and Proceedings of
the Royal Society of New Zealand 68(3): 399—419.
Graham, D.H. 1939. Breeding habits of the fishes of Otago Harbour
and adjacent seas. Transactions and Proceedings of the Royal
Society of New Zealand 69: 361—372.
Graham, D.H. 1953. A treasury of New Zealand fishes. First edition.
A.H. and A.W. Reed: Wellington. 404 pp.
Graham, D.H. 1956. A treasury of New Zealand fishes. Second edition.
A.H. and A.W. Reed: Wellington. 424 pp.
Graham, J. 1963. The North Otago shelf fauna. Part III — Chordata,
Sub-phylum Gnathostomata. Transactions of the Royal Society of
New Zealand, Zoology 3: 165—170.
Grant, E.M. 1991. Fishes of Australia. EM Grant Pty Ltd.: Brisbane.
480 pp.
Günther, A. 1862. Catalogue of the fishes in the British Museum.
Catalogue of the Acanthopterygii, Pharyngognathi and
Anacanthini in the collection of the British Muesum. 4. Department
of Zoology, British Museum (Natural History): London. 534 pp.
Günther, A. 1863. On new species of fishes from Victoria, South
Australia. Annals and Magazine of Natural History (Series 3)
11(62): 114—117.
Günther, A. 1878. Preliminary notices of deep-sea fishes collected
during the voyage of H.M.S. ‘Challenger’. Annals and Magazine
of Natural History (Series 5) 2(7, 8, 9): 17—28; 179—187; 248—251.
Günther, A. 1880a. Report on the shore fishes procured during the
voyage of H.M.S. Challenger in the years 1873—1876. Report on
the scientific results of the voyage of H.M.S. Challenger during
the years 1873—76. Zoology. 1(6) 1—82.
Günther, A. 1880b. An introduction to the study of fishes. A. and C.
Black: Edinburgh. 720 pp.
Günther, A. 1887. Report on the deep-sea fishes collected by H.M.S.
Challenger during the years 1873—76. . Report on the scientific
results of the voyage of H. M. S. Challenger during the years
1873—1876. Zoology 22(57): 1—268.
Habib, G. 1975. Aspects of the biology of the red cod, Pseudophycis
bachus. Unpublished PhD thesis, University of Canterbury. 203 pp.
Hasegawa, M., Kishino, H., and Yano, T. 1985. Dating the human-ape
split by a molecular clock of mitochondrial DNA. Journal of
Molecular Evolution 22: 160—174.
Heath, E., and Moreland, J.M. 1967. Marine fishes of New Zealand.
A.H. and A.W. Reed: Wellington. 56 pp.
Hector, J. 1872. Notes on edible fishes. Pp. 97—133 in: Hutton, F.W and
Hector, J. (eds), Fishes of New Zealand. Colonial Museum and
Geological Survey Department: Wellington. 133 pp.
89
Hector, J. 1875. Notes on New Zealand ichthyology. Transactions and
Proceedings of the New Zealand Institute T. 239—250.
Hector, J. 1884. The fisheries of New Zealand in Handbook of New
Zealand, 1883. Bulletin of the United States Fisheries Commission
4: 53—55.
Hector, J. 1886. Fisheries. Pp. 26-28 in: J. Hector (ed.), Handbook of
New Zealand. Government Printer: Wellington. 120 pp.
Hefford, A.E. 1936. New Zealand fishes and fisheries Pp. 71—77 1n:
Handbook for New Zealand. Australian and New Zealand
Association for the Advancement of Science |Prepared for
Auckland Meeting, January, 1937]. Government Printer:
Wellington. 157 pp.
Hewitt, G.C., and Hine, P.M. 1972. Checklist of parasites of New
Zealand fishes and of their hosts. New Zealand Journal of Marine
and Freshwater Research 6(1 and 2): 69-114.
Hirt- Chabbert, J. 2006. Fish species of New Zealand. A photographic
guide. Reed Publishing: Auckland. 135 pp.
Hoare, M.E. 1982. The Resolution Journal of Johann Reinhold
Forster, 1772—1775. In 4 vols. Hakluyt Society: London. 831 pp.
| Vol. 831: xvii + 831—182, 836 pls, 831 maps; vol. 832: viii + 183—
370, 838 pls, 835 maps; vol. 833: vii + 371—553, 839 pls, 835 maps;
vol. 834: vil + 555—831, 839 pls, 836 maps].
Howell, M. 1966. A contribution to the life history of Bucephalus
longicornutus (Manter, 1954). Zoology Publications from
Victoria University of Wellington 40. Victoria University of
Wellington: Wellington. 42 pp.
Horn, P.L. 1996. Age and growth of red cod (Pseudophycis bachus) off
the south-east coast of South Island, New Zealand. New Zealand
Journal of Marine and Freshwater Research 30(2): 151—160.
Horn, P.L., Forman, J.S., and Dunn, M.R. 2012: Dietary partitioning
by two sympatric fish species, red cod (Pseudophycis bachus) and
sea perch (Helicolenus percoides), on Chatham Rise, New
Zealand. Marine Biology Research 8(7): 624—634.
Hubbs, C.L., and Lagler, K.F. 1947. Fishes of the Great Lakes Region.
Bulletin of the Cranbrook Institute of Science 26: 1—135.
Hume, F., Pemberton, D., Gales, R., and Hindell, M. 2004. Spatial and
temporal variation in the diet of a generalist predator, the
Australian fur seal (Arctocephalus pusillus doriferus), at
lasmanian breeding colonies and haulouts. Marine Biology
144(3): 407—415.
Hutchins, J.B., and Swainston, R. 1986. Sea fishes of southern
Australia. Swainston Publishing: Perth. 180 pp.
Hutchins, J.B. 2001. Checklist of the fishes of Western Australia.
Records of the Western Australian Museum Supplement 63: 9—50.
Hutton, F.W. 1875. Fauna of Otago, Appendix C to part 1, Geology of
Otago. Pp. 128-139 in: Hutton, FW. and G.H.F. Ulrich (eds),
Report on the geology and goldfields of Otago. Provincial Council
of Otago: Dunedin. 245 pp.
Hutton, F.W. 1890. List of New Zealand fishes. Transactions and
Proceedings of the New Zealand Institute 22: 275—285.
Hutton, F.W. 1896. Notes on some New Zealand fishes, with description
of a new species. Transactions and Proceedings of the New
Zealand Institute 28: 314—318.
Hutton, F.W. 1904. Index Faunae Novae Zealandiae. Dulau and
Company: London. 372 pp.
Hutton, F.W., and Hector J. 1872. Fishes of New Zealand. Colonial
Museum and Geological Survey Department: Wellington. 133 pp.
Iwai, T., Nakamura, I., Inada, T., Ikeda, I., Sato, T., and Hatanaka, H.
1970. A study of the classification of fishes in the new overseas
fishing grounds. A taxonomic study of the bottom fishes in the
Chatham Rise area of New Zealand. Special report, May 1970.
Agriculture Department, Kyoto University and Far Seas Fisheries
Research Laboratory: Kyoto. 29 pp.
86
Iwai, T., Nakamura, I., Inada, T., Ikeda, I., Sato, T., and Hatanaka, H.
1972. A study of the classification of fishes in the new overseas
fishing grounds. A taxonomic study on New Zealand inshore
benthic fishes. Special Research Report, May 1972. Agriculture
Department, Kyoto University and Far Seas Fisheries Research
Laboratory: Kyoto. 39 pp.
Johnson, D.E. 1921. The food values of New Zealand fish: Part II.
Transactions and Proceedings of the New Zealand Institute 53c:
472—475.
Johnston, R.M. 1883. General and critical observations on the fishes of
Tasmania; with a classified catalogue of all known species. Papers
and Proceedings of the Royal Society of Tasmania for 1882: 54—
144.
Johnston, W.T.G. 1938. A brief note on the spinal nerves of the red cod
(Physiculus bachus). Transactions and Proceedings of the Royal
Society of New Zealand 68: 47—48.
Jordan, D.S., and Gilbert, C.H. 1883. Synopsis of the fishes of North
America. Bulletin of the United States National Museum No. 16.
Government Printing Office: Washington, DC. 1018 pp.
Jordan, D.S., and Evermann, B.W. 1898. The fishes of North and
Middle America: a descriptive catalogue of the species of fish-like
vertebrates found in the waters of North America north of the
Isthmus of Panama. Part III. Bulletin of the United States National
Museum No. 47. Government Printing Office: Washington, DC.
3136 pp.
Kaberry, A.C. 1957. Sea fisheries. Pp. 88—96 in: Callaghan, F.R. (ed.),
science in New Zealand. Handbook for the 1957 Australian and
New Zealand Association for the Advancement of Science
Conference. A.H. and A.W. Reed: Wellington. 272 pp.
Karrer, C. 1971. Die otolithen der Moridae (Teleostei, Gadiformes)
und ihre systematische Bedeutung. Zoologische Jahrbucher,
abteilung fur systematik okologie und geographie der tiere 98:
153-204.
Kaup, J.J. 1858. Uebersicht der Familie Gadidae. Archiv für
Naturgeschichte 24(1): 85—93.
Kemp, J. 2010. The population dynamıcs of red cod, Pseudophycis
bachus. A contribution to understanding the trophic role of this
important prey species. Unpublished PhD thesis, Department of
Zoology, University of Melbourne, Australia. 165 pp.
Kirkwood, R., Hume, F., and Hindell, M. 2008. Sea temperature
variations mediate annual changes in the diet of Australian fur seals
in Bass Strait. Marine Ecology Progress Series 369: 297—309.
Klunzinger, C.B. 1872. Zur Fischfauna von Süd-Australien. Archiv für
Naturgeschichte 38(1): 17—47, pl. 2.
Knox, G.A., and Kilner, A.R. 1973. The ecology of the Avon-Heathcote
Estuary. Unpublished Report to the Christchurch Drainage Board
by the Estuarine Research Unit, Department of Zoology,
University of Canterbury, Christchurch. 358 pp.
Kuiter, R.H. 1993. Coastal fishes of south-eastern Australia.
University of Hawaii Press: Honolulu. 437 pp.
Kuiter, R.H. 1997. Guide to sea fishes of Australia. A comprehensive
reference for divers and fishermen. New Holland Publishers:
Frenchs Forest, Australia. 434 pp.
Kumar, 5., Stecher, G., Li, M., Knyaz, C., and Tamura, K. 2018. MEGA
X: Molecular evolutionary genetics analysis across computing
platforms. Molecular Biology and Evolution 35: 1547—1549.
Lachenbruch, P.A., and Mickey, M.R. 1967. Estimation of error rates
in discriminant analysis. Technometrics 10: 1—11.
Laird, M. 1949. Studies on haematozoa of New Zealand and some
adjacent islands. Unpublished MSc thesis, Victoria University of
Wellington, New Zealand. 158 pp.
Laird, M. 1951. Studies on the trypanosomes of New Zealand fish.
Proceedings of the Zoological Society of London 12\(part II):
285—309.
M.F. Gomon, C.D. Struthers & J. Kemp
Laird, M. 1952. New haemogregarines from New Zealand marine
fishes. Transactions and Proceedings of the Royal Society of New
Zealand 79(3 and 4): 589—600.
Last, P.R., Scott, E.O.G., and Talbot, F.H. 1983. Fishes of Tasmania.
lasmanian Fisheries Development Authority: Hobart. 563 pp.
Lichtenstein, M.H.C. 1844. Descriptiones animalium quae in itinere
ad Maris Australis terras per annos 1772 1773 et 1774 suscepto,
collegit observavit et delineavit loannes Reinoldus Forster ...
nunc demum editae ... Henrico Lichtenstein. Berlin. 423 pp.
Linnaeus, C. 1758. Systema Naturae, Ed. X. (Systema naturae per
regna tria naturae, secundum classes, ordines, genera, species,
cum characteribus, differentiis, synonymis, locis. Tomus I. Editio
decima, reformata.) Holmiae. 1: 1-11 + 1-824.
Littnan C.L., Arnould, J.P. Y., and Harcourt, R.G. 2007. Effect of
proximity to the shelf edge on the diet of female Australian fur
seals. Marine Ecology Progress Series 338: 257—267.
Lord, C.E. 1927. A list of the fishes of Tasmania. Journal of the Pan-
Pacific Research Institution 2(4): 11-16.
Lord, C.E, and Scott, H.H. 1924. A synopsis of the vertebrate animals
of Tasmania. Oldham, Beddome and Meredith: Hobart. 340 pp.
Mair, G. 1903. Notes on fish found in the Piako River. Transactions
and Proceedings of the New Zealand Institute 35: 319—320.
Malcolm, J. 1926. Food values of New Zealand fish. Part 6. The vitamin
A content of mutton-bird oil and of some fish oils. Transactions
and Proceedings of the New Zealand Institute 56: 650—658.
Manter, H.W. 1954. Some digenetic trematodes from the fishes of New
Zealand. Transactions of the Royal Society of New Zealand 82(2):
475—568.
Markle, D. F., and Meléndez C., R. 1988. A new species of Laemonema
from off Chile, with a redescription of L. globiceps Gilchrist
(Pisces: Moridae). Copeia 1988(4): 871—876.
Marshall, N.B., and Cohen, D.M. 1973. Fishes of the western North
Atlantic. Order Anacanthini (Gadiformes). Characters and
synopses of families. Memoirs of the Sears Foundation for
Marine Research 1(6): 479—495.
May, J.L., and Maxwell, J.G.H. 1986. Field guide to trawl fish from
temperal waters of Australia. CSIRO Division of Fisheries
Research: Hobart. 492 pp.
McCoy, F.R. 1878—90. Prodromus of the zoology of Victoria; figures
and descriptions of the living species of all classes of the Victorian
indigenous animals. Government Printer: Melbourne. 2 vols. 1:
375 pp; 2: 200 pp.
McCulloch, A.R. 1921. Check-list of the fish and fish-like animals of
New South Wales, part 11. Australian Zoologist: 2(1921—1922,
part 2): 24—68.
McCulloch, A.R. 1922. Check-list of the fish and fish-like animals of
New South Wales. Australian Zoological Handbook no. 1. Royal
Zoological Society of New South Wales: Sydney. 104 pp.
McCulloch, A.R. 1927. The fishes and fish-like animals of New South
Wales. Sydney: Royal Zoological Society of New South Wales:
Sydney. 104 pp.
McCulloch, A.R. 1929-30. A check-list of the fishes recorded from
Australia. Parts I-IV. Memoirs of the Australian Museum, Sydney
5: 1-534 (Pt I: 1-144, II: 145—329, III: 329—436, IV: 437—534).
McMillan P.J., Francis, M.P., Paul, L.J., Marriott, P.J., Mackay, E., Baird,
S.-J., Griggs, L.H., Sui, H., and Wei, F. 2011a. New Zealand fishes.
Vol. I: A field guide to common species caught by bottom and midwater
fishing. New Zealand Aquatic Environment and Biodiversity Report
No. 66. Ministry of Fisheries: Wellington. 329 pp.
McMillan P.J., Francis, M.P., James, G.D., Paul, L.J., Marriott, P.J.,
Mackay, E., Wood, B.A., Griggs, L.H., Sui, H., and Wei, F. 2011b.
New Zealand fishes. Vol. 2: A field guide to less common species
caught by bottom and midwater fishing. New Zealand Aquatic
Environment and Biodiversity Report No. 75. Ministry of Fisheries:
Wellington. 181 pp.
Australasian red cods
Meglitsch, P.A. 1960. Some coelozoic myxosporidia from New Zealand
fishes. I. General, and family Ceratomyxidae. Transactions of the
Royal Society of New Zealand 88(2): 265—350.
Moreland, J.M. 1957. Report on the fishes. Pp. 34, 36 in: Knox, G.A.
(ed.), General account of the Chatham Islands 1954 expedition.
New Zealand Department of Scientific and Industrial Research
Bulletin 122. Biology Department, Canterbury University College:
Christchurch. 37 pp.
Moreland, J.M. 1963. Native sea fishes. Nature in New Zealand series.
A.H. and A.W. Reed: Wellington. 64 pp.
Montague, T. L., and Cullen, J.M. 1988. The diet of the Little Penguin
Eudyptula minor at Phillip Island, Victoria. Emu 88, 139—149.
Munro, I.S.R. 1938. Handbook of Australian fishes. Fishery Newsletter
16(11): 1-172.
Munro, LS.R. 1961. Handbook of Australian fishes. Nos 1-42.
Australian Fisheries Newsletter 15—17, 19, 20: 1-172 (published
as separates 1956—1961).
Murray, J. 1895. Summary of the scientific results obtained at the
sounding, dredging, and trawling stations of H.M.S. Challenger.
Report of the scientific results of the voyage of the H.M.S.
Challenger during the years 1872-76. A summary of the scientific
results Pt 1: xxxii-liui + 1—796, pls I-IX, charts 791A—743,
diagrams 791—714.
Norman, J.R. 1935. Coast fishes, Part I. The South Atlantic.
"Discovery" Report 12: 1—58.
Norman, J.R. 1937. Coast fishes. Part II. The Patagonian region.
"Discovery" Report 16: 1—150, pls. 1—5.
Oeilby, J.D. 1886. Catalogue of the fishes of New South Wales with
their principal synonyms. Report of the Commissioner of Fisheries
of New South Wales. Department of Fisheries: Sydney. 67 pp.
Ogilby, J.D. 1897. New genera and species of Australian fishes.
Proceedings of the Linnean Society of New South Wales 22(1):
62-95.
Oken, L. 1817. V. KI. Fische. Isis oder Encyclopádische Zeitung von
Oken 8 (148): 1779-1782.
Page, B., McKenzie, J., and Goldsworthy, S.D. 2005. Dietary resource
partitioning among sympatric New Zealand and Australian fur
seals. Marine Ecology Progress Series 293: 283—302.
Parker, T.J. 1882. On a new method of preserving cartilaginous
skeletons and other soft animal structures. Transactions and
Proceedings of the New Zealand Institute 14: 258—264.
Parker, T.J. 1883. On the connection of the air bladders and the
auditory organ in the red cod (Lotella bacchus). Transactions and
Proceedings of the New Zealand Institute 15: 234—236.
Parrott, A.W. 1957. Sea angler’s fishes of New Zealand. Hodder and
Stoughton: London. 176 pp.
Parrott, A.W. 1958. Fishes from the Auckland and Campbell Islands.
Records of the Dominion Museum, Wellington 3: 109-119.
Parrott, A.W. 1960. The queer and rare fishes of New Zealand. Hodder
and Stoughton: London. 192 pp.
Paul, L.J. 1966. Red Cod. Pp. 372—373 in: McLintock, A.H. (ed.), An
encyclopaedia of New Zealand (3 volumes). Government Printer:
Wellington. vol 1: 928pp, vol 2: 894pp and vol 3: 847 pages.
Paul, L.J. 1986. New Zealand fishes: an identification guide. Auckland,
Reed Methuen Publishers Ltd. 184 pp.
Paul, L.J. 2000. New Zealand fishes: identification, natural history
and fisheries. Revised edition. Reed Publishing: Auckland. 253 pp.
Paulin, C.D. 1983. A revision of the family Moridae (Pisces:
Anacanthini) within the New Zealand region. National Museum
of New Zealand Records 2(9): 851—126.
Paulin, C.D. 1988. Swimbladder structure in Morid cods (Pisces:
Gadiformes). Copeia 2: 450—454.
Paulin, C.D. 1998. Common New Zealand Marine Fishes. Canterbury
University Press: Christchurch, New Zealand. 80 pp.
o
Paulin, C.D., and Roberts, C.D. 1992. The rockpool fishes of New
Zealand. Te ika aaria o Aotearoa. Museum of New Zealand Te
Papa Tongarewa: Wellington. 177 pp.
Paulin, C.D., and Stewart, A.L. 1985. A list of New Zealand teleost
fishes held in the National Museum of New Zealand. National
Museum of New Zealand Miscellaneous Series 12. National
Museum of New Zealand: Wellington. 63 pp.
Paulin, C.D., Stewart, A.L., Roberts, C.D., and McMillan, PJ. 1989.
New Zealand fish a complete guide. National Museum of New
Zealand Miscellaneous Series. No. 19. National Museum of New
Zealand: Wellington. 279 pp, 8 pls. [Also reprinted in 2001].
Paxton, J.R., Hoese, D.F., Allen, G.R., and Hanley, J.E. 1989.
Zoological Catalogue of Australia. Vol. 7. Pisces: Petromyzontidae
to Carangidae. Australian Government Publishing Service:
Canberra, Australia. 665 pp.
Paxton, J.R., Gates, J.E., Bray, D.J., and Hoese, D.F. 2006. Moridae,
Pp. 608—617 in: Hoese, D.F. Bray, D.J. Paxton, J.R. and Allen,
G.R. (eds), Fishes, Pp 1—-xxiv, 1-670. In, Beesley, P.L. and Wells,
A. (eds) Zoological catalogue of Australia. ABRS and CSIRO
Publishing, Australia Volume 35, Part 1.
Phillipps, W.J. 1918. Edible fishes of Wellington. New Zealand
Journal of Science and Technology 1: 268—271.
Phillipps, W.J. 1921. Notes on the edible fishes of New Zealand with a
record of fishes exposed for sale in Wellington during 1918. New
Zealand Journal of Science and Technology 4(3): 114—125.
Phillipps, W.J. 1926. New or rare fishes of New Zealand. Transactions
and Proceedings of the New Zealand Institute 56: 528—537.
Phillipps, W.J. 1927a. Notes on New Zealand fishes. Transactions and
Proceedings of the New Zealand Institute 58(1 and 2): 125—135.
Phillipps, W.J. 1927b. Bibliography of New Zealand fishes. New
Zealand Marine Department Fisheries Bulletin 1: 68 pp.
Phillipps, W.J. 1927c. A check-list of the fishes of New Zealand.
Journal of the Pan-Pacific Research Institution 2(1): 9—15,
Phillipps, W.J. 1947. A list of Maori fish names. Journal of the
Polynesian Society 56: 41—51.
Phillipps, W.J. 1948. Fishes taken in Wellington Harbour. Pacific
Science 2: 128—130.
Phillipps, W.J. 1949. Native fishes. Nature in New Zealand series.
A.H. and A.W. Reed: Wellington. 60 pp.
Phillipps, W.J., and Hodgkinson, E.R. 1922. Further notes on the
edible fishes of New Zealand. New Zealand Journal of Science
and Technology 5(2): 91-97.
Ramsay, E.P. 1881. Description of two new species of Australian
fishes. Proceedings of the Linnean Society of New South Wales
5(4): 462—463.
Rapson, A.M. 1940. The reproduction, growth, and distribution of the
lemon soles (Pelotretis flavilatus Waite) of Tasman Bay and
Marlborough Sounds. Fisheries Bulletin 7. New Zealand Marine
Department: Wellington. 56 pp.
Rendahl, H. 1926. Papers from Dr Th. Mortensen's Pacific Expedition
1914-1916. XXX. Fishes from New Zealand and the Auckland-
Campbell Islands. Videnskabelige Meddelelser fra Dansk
Naturhistorik Forening Kjøbenhavn 81: 1-14.
Richardson, J. 1843. Report on the present state of the ichthyology of
New Zealand. Report of the British Association for the
Advancement of Science 12: 12—30.
Richardson, J. 1846. Ichthyology of the voyage of H.M.S. Erebus &
Terror, under the command of Captain Sir James Clark Ross,
R.N., F.R.S. Pp. 53-74 in: J. Richardson, and J.E. Gray (eds.), The
zoology of the voyage of H.M.S. Erebus & Terror, under the
command of Captain Sir J.C. Ross, R.N., F.R.S., during the years
1639 to 1843. E.W. Janson: London. 139 pp.
88
Richardson, J., and Gray, J.E. 1843. List of fish hitherto detected on the
coasts of New Zealand. Vol. 2. Pp. 206—228 in: Dieffenbach, E.
(ed), Travels in New Zealand, with the geography, geology,
botany and natural history of that country. 2 volumes. Fauna of
New Zealand. J. Murray: London. 396 pp.
Roberts, C.D., Paulin, C.D., Stewart, A.L., McPhee, R.P., and
McDowall, R.M. 2009. Checklist of New Zealand Chordata:
Living lancelets, jawless fishes, cartilaginous fishes and bony
fishes. Pp. 527-536 in: Gordon D.P. (ed), The New Zealand
Inventory of Biodiversity. Volume I. Kingdom Animalia.
Canterbury University Press: Christchurch. 568 pp.
Roberts, C.D, Stewart, A.L, and Struthers, C.D. 2014. Checklist of the
fishes of New Zealand. Museum of New Zealand Te Papa
Tongarewa. Accessed at: https://collections.tepapa.govt.nz/
document/10564 on 10 July 2019.
Roberts, C.D, Barker, J.J, Stewart A.L, Struthers, C.D, and Kortet, S.
2015. Checklist of the fishes of New Zealand. Pp. S147—S178 1n:
Roberts, CD, Stewart, A.L., and Struthers, C.D. (eds), The fishes of
New Zealand. Volume 1. Te Papa Press: Wellington. 2000 pp.
Roberts, C.D, Stewart, A.L., Struthers, C.D., Barker, J.J., and Kortet,
S. 2017. Checklist of the Fishes of New Zealand. Online Version 1.0.
Museum of New Zealand Te Papa Tongarewa. Accessed at: https://
collections.tepapa.govt.nz/document/10564 on 10 July 2018.
Roberts, C.D, Stewart, A.L., Struthers, C.D., Barker, J.J., and Kortet,
S. 2019. Checklist of the Fishes of New Zealand. Online Version 1.1.
Museum of New Zealand Te Papa Tongarewa. Accessed at: https://
collections.tepapa. govt.nz/document/10564 on 10 July 2019.
Robinson, E.S. 1955. A systematic study of some cestodes from New
Zealand marine fishes and marine mammals. Unpublished MSc
thesis, Victoria University of Wellington, New Zealand. 132 pp.
Robinson, E.S. 1959. Records of cestodes from marine fishes of New
Zealand. Transactions of the Royal Society of New Zealand 86(1):
143—152.
Russell, B.C. 1969. A checklist of the fishes of Goat Island, North
Auckland, New Zealand, with an analysis of habitats and
associations. Tane 15: 105-113.
Russell, B.C. 1971a. Ecological relationships of rocky reef fishes of
north-eastern New Zealand. Unpublished MSc thesis, University
of Auckland New Zealand. 220 pp.
Russell, B.C. 1971b. A preliminary annotated checklist of fishes 1n the
Poor Knights Islands. Tane 17: 81—90.
Ryan, P.A. 1974. The fishes of Lake Ellesmere, Canterbury. Mauri
Ora 2: 131-136.
sazonov, Y.I. 2001. Notophycis — a new genus of fish of the family
Moridae (Gadiformes) with the description of a new species and
two new subspecies, and notes on the state of the genus
Austrophycis. Voprosy Ikhtiologii 41(3): 293—303. [In Russian.
English translation in Journal of Ichthyology 41(5): 343—353.]
scott, T.D. 1962. The marine and freshwater fishes of South Australia.
Handbook of the flora and fauna of South Australia issued by the
South Australian branch of the British Science Guild. Government
Printer: Adelaide. 338 pp.
Scott, T.D., Glover, C.J.M., and Southcott, R.V. 1974. The marine and
freshwater fishes of South Australia. Second Edition. Government
Printer: Adelaide. 392 pp.
sherrin, R.A.A. 1886. Handbook of the fishes of New Zealand. Wilson
and Horton: Auckland. 307 pp.
Shorland, F.B. 1937. New Zealand fish oils. Nature, London 140: 223—
224
Shorland, F.B. 1948. Researches on fats and related constituents by
New Zealand workers. A review — Part III. Journal of the New
Zealand Institute of Chemistry 12: 105—122.
Shorland, F.B. 1950. The aquatic animal oil resources of New Zealand.
New Zealand Journal of Science and Technology (B) 32(2): 30—41.
M.F. Gomon, C.D. Struthers & J. Kemp
Shuntov, V.P. 1970. Some aspects of the seasonal distribution of shelf
fishes in the New Zealand area. Journal of Ichthyology 10(3):
372—380.
Shuntov, V.P. 1972. Fishes of the upper bathyal zone of the New
Zealand plateau. Journal of Ichthyology 11(3): 336—345.
Smith, P.J., Steinke, D., McMillan, P.J. McVeagh, S.M., and Struthers,
C.D. 2008. DNA database for commercial marine fish. New
Zealand Aquatic Environment and Biodiversity Report 22: 62 pp.
Accessed at: https://fs.fish.govt.nz/Doc/21588/AEBR 22.pdt.
ashx on 10 July 2019.
Sorensen, J.H. 1968. Demersal trawling in New Zealand in Symposium
on demersal fisheries. Proceedings of the Indo-Pacific Fisheries
Council 13(3): 139-150.
Sorensen, J.H. 1970. Nomenclature of New Zealand fish of commercial
importance. New Zealand Marine Department, Fisheries Technical
Report 56. New Zealand Government: Wellington. 79 pp.
stead, D.G. 1906. Fishes of South Australia, a popular and systematic
guide to the study of the wealth within our waters. William
Brooks: Sydney. 278 pp.
Stead, D.G. 1908. The edible fishes of New South Wales, their present
importance and their potentialities. Government printer: Sydney.
124 pp, 81 plates.
Steindachner, F. 1901. Fische aus dem Stillen Ocean. Ergebnisse einer
Reise nach dem Pacific (Schauinsland 1896—97) Denkschriften
der Kaiserlichen Akademie der Wissenschaften in Wien,
Mathematisch-Naturwissenschaftliche Classe 37(18): 206—208.
street, R.J. 1964. Feeding habits of the New Zealand fur seal
Arctocephalus forsteri. New Zealand Marine Department,
Fisheries Technical Report 9. New Zealand Marine Department:
Wellington. 20 pp.
Struthers, C.D., Gomon, M.F., and Last, P.R. 2015. 107 Family
Moridae. Pp. 839-866 in: Roberts, C.D., Stewart, A.L., and
Struthers C.D. (eds), The fishes of New Zealand. Te Papa Press:
Wellington. Vol. 1: SI-S256: vol. 2: 1—576; vol. 3: 577—1152; vol.
4: 1153-1748.
suda, A. 1973. Development of fisheries for non-conventional species.
Journal of the Fisheries Research Board of Canada 30(12): 2121—
2158.
Svetovidov, A.N. 1937. Uber die Klassification der Gadiformes oder
Anacanthini. Bulletin de L'academie des Sciences de L'U.R.S.S.
Classe des Sciences Mathematiques et Naturelles Serie
Biologique 4: 1281—1287.
Svetovidov, A.N. 1948. Treskoobraznye [Gadiformes]. Pp. 1-222,
tables 1—72 1n Pavlovskii, E.N. and Shtakel’berg A.A. (eds.),
Fauna of the U.S.S.R. Volume 9. Zoological Institute of the
Academy of Sciences of the U.S.S.R.: New Series number 34.
Izdateľstvo Akademie Nauk Moskva - Leningrad, 1948.
[Translated from Russian by Israel Program for Scientific
Translations Jerusalem 1962].
Svetovidov, A.N. 1967. K poznaniyu semeistva Moridae (Pisces,
Gadiformes), Zoologicheskii Zhurnal, 46(11): 1684-1693, figs
1-3.
Taylor, R. 1855. Te tka a Maui. First Edition. Wertheim and McIntosh:
London. 490 pp.
Temminck, C.J., and Schlegel, H. 1846. Pisces. Pp. 173—269 in: von
Siebold, P.F. de (ed.), Fauna Japonica, sive descriptio animalium,
quae in itinere per Japoniam ... suscepto annis 1823-1830 collegit,
notis, observationibus et adumbrationibus illustravit Ph. Fr. de
siebold. Lugduni Batavorum [Leiden] (A. Arnz et soc.).
Thomson, G.M. 1890. Parasitic Copepoda of New Zealand, with
descriptions of new species. Transactions and Proceedings of the
New Zealand Institute 22: 353—376.
Thomson, G.M. 1892. Notes on sea fishes. Transactions and
Proceedings of the New Zealand Institute 24: 202—215.
Australasian red cods
Thomson, G.M. 1906. The Portobello Marine Fish-hatchery and
Biological station. Transactions and Proceedings of the New
Zealand Institute 38: 529—558.
Thomson, G.M. 1913. The natural history of Otago Harbour and the
adjacent sea, together with a record of the researches carried on at
the Portobello Marine Fish-hatchery. Transactions and
Proceedings of the New Zealand Institute 45: 225—251.
Thomson, G.M., and Anderton, T. 1921. History of the Portobello
Marine Fish-hatchery and Biological Station. Bulletin of the
Board of Science and Art, New Zealand 2. Marcus F. Marks,
Government Printer: Wellington. 131 pp.
Thomson, G.S., and Thomson, G.M. 1923. The economic value of
whalefeed. New Zealand Journal of Science and Technology 6:
111-114.
Thomson, P. 1877. Fish and their seasons. Transactions and
Proceedings of the New Zealand Institute 9: 484—490.
Thomson, P. 1878. The Dunedin fish supply. Transactions and
Proceedings of the New Zealand Institute 10: 324—330.
Thomson, P. 1879. Our fish supply. Transactions and Proceedings of
the New Zealand Institute 11: 380—380.
Tong, L.J., and Elder, R.D. 1968. Distribution and abundance of
demersal fish from trawl stations in the Bay of Plenty, New
Zealand, 1961-63. New Zealand Journal of Marine and
Freshwater Research 2: 49—66.
Trunov, I.A. 1990. Fishes of the family Moridae from the Southeast
Atlantic (Paralaemonema gen. et sp. n). Voprosy Ikhtiologii,
30(2): 192-200.
Vooren, C.M. 1974. An analysis of the statistics on the fishery for
tarakihi, Cheilodactylus macropterus (Bloch and Schneider), in
New Zealand waters from 1936 to 1969, with notes on the trawl
fishery in general. Fisheries Research Bulletin. New Zealand
Ministry of Agriculture and Fisheries 7: 44 pp.
Waite, E.R. 1899. Scientific results of the trawling expedition of
H.M.C.S. "Thetis", off the coast of New South Wales in February
and March, 1898. Memoirs of the Australian Museum 4(1): 2-132.
Waite, E.R. 1904. A synopsis of the fishes of New South Wales.
Memoirs of the New South Wales Naturalists’ Club 2. S. D.
Townsend and Co. Printers: Sydney. 59 pp.
Waite, E.R. 1907. A basic list of the fishes of New Zealand. Records of
the Canterbury Museum 1: 3—39.
Waite, E.R. 1909. Scientific results of the New Zealand Government
Trawling Expedition, 1907. Records of the Canterbury Museum
1(2): 45-156.
Waite, E.R. 1911. Scientific results of the New Zealand Government
Trawling Expedition, 1907. Records of the Canterbury Museum
1(3): 157—268.
Waite, E.R. 1921. Illustrated catalogue of the fishes of South Australia.
Records of the South Australian Museum 1921—1924 2: 55—75.
Waite, E.R. 1923. The fishes of South Australia. Handbook of the flora
and fauna of South Australia Issued by the British Science Guild
(South Australian branch). R.E.E. Rogers: Adelaide. 243 pp.
Waite, E.R. 1928. A catalogue of the marine fishes of South Australia.
Journal of the Pan-Pacific Research Institute 3(1): 3—10.
Walbaum, J.J. 1792. Petri Artedi sueci genera piscium. In quibus
systema totum ichthyologiae proponitur cum classibus, ordinibus,
generum characteribus, specierum differentiis, observationibus
plurimis. Redactis speciebus 242 ad genera 52. Ichthyologiae pars
III. Ant. Ferdin. Rose, Grypeswaldiae [Greifswald]. Part 3: 1—v111,
1—723, pls 1-3.
Walker, M.H. 1972. The biology of the southern rock cod PAysiculus
barbatus Günther (Gadiformes, Teleostei). Tasmanian Fisheries
Research 6(1): 1-18.
89
Ward, R. D., Zemlak, T.S., Innes, B.H., Last, P.R., and Herbert, P.D.
2005. DNA barcoding Australia's fish species. Philosophical
Transactions of the Royal Society B-Biological Sciences
360(1462): 1847-1857.
Watkinson, J.G., and Smith, R. 1972. New Zealand fisheries. Published
in conjunction with the fifteenth session of the Indo-Pacific
Fisheries Council, held at Wellington, New Zealand, in October
1972. Government Printer: Wellington. 91 pp.
Waugh, G.D. 1973. Fish and fisheries. Pp 251—284 in Williams, G.R.
(ed.), The natural history of New Zealand. An ecological survey.
A.H. and A.W. Reed, Wellington.
Webb, B.F. 1966. A study in the biology of the fish population of the
Avon-Heathcote Estuary, Christchurch. Unpublished MSc thesis,
University of Canterbury, New Zealand. 304 pp.
Webb, B.F. 1972a. Bottom trawling in Cook Strait and western Taranaki
Bight. New Zealand Marine Department, Fisheries Technical
Report 77. New Zealand Government: Wellington. 20 pp.
Webb, B.F. 1972b. Report on the investigations of the “Lloret Lopez
II" — 8 January to 2 April 1970. Section 3. Crab survey — 18
February to 27 February 1970. New Zealand Marine Department,
Fisheries Technical Report 97 New Zealand Government:
Wellington. 43 pp.
Webb, B.F. 1973. Fish populations of the Avon-Heathcote Estuary. 5.
Records of less common species. New Zealand Journal of Marine
and Freshwater Research (A); 307-321.
Whitehead, P.J.P. 1969. Forty drawings made by the artists who
accompanied Captain James Cook on this three voyages to the
Pacific, 1768—71, 1772—75, 1776—80, some being used by authors
in the description of new species. British Museum (Natural
History): London. I-X X XI [72 pp], pls 1—36.
Whitehead, P.J.P. 1978. The Forster collection of zoological drawings
in the British Museum (Natural History). Bulletin of the British
Museum (Natural History). 6(2): 25—47.
Whitley, G.P. 1955. Sidelights on New Zealand ichthyology. Australian
Zoologist 12(2): 110—119.
Whitley, G.P. 1956. Name-list of New Zealand fishes. Pp. 397—415 in
Graham, D.H. (ed.) A treasury of New Zealand fishes. 2nd Edition.
Reed: Wellington. 424 pp.
Whitley, G.P. 1962. Marine fishes of Australia. Volumes 1 and 2.
Jacaranda Press: Brisbane. 288 pp.
Whitley, G.P. 1964. A survey of Australian Ichthyology. Proceedings
of the Linnean Society of New South Wales 89(1): 11—127.
Whitley, G.P. 1968. A checklist of the fishes recorded from the New
Zealand Region. Australian Zoologist 15(1): 1—102.
Williams, G.R. (ed.) 1973. The natural history of New Zealand. An
ecological survey. A.H. and A.W. Reed: Wellington. 434 pp.
Wilson, C.A. 1937. Annual report on the Portobello Marine Fish
Hatchery and Biological Station. Pp. 31—32 in: Annual Report on
Fisheries, New Zealand Marine Department for 1936—37. New
Zealand Government: Wellington. 50 pp.
Yearsley, G.K., Last, P.R., and Ward, R.D. 1999. Australian seafood
handbook. An identification guide to domestic species. CSIRO
Marine Research and Fisheries Research Development
Corporation: Hobart. 461 pp.
Young, M.W. 1925. Physiculus (Lotella) rhacinus (Forster). A record
of its capture in Otago waters; with some notes on its range and
vernacular nomenclature. New Zealand Journal of Science and
Technology 7(5): 369—371.
Young, M.W. 1929. Marine fauna of the Chatham Islands. Transactions
and Proceedings of the New Zealand Institute 60(1): 136—160.
Zietz, A.H. 1909. A synopsis of the fishes of South Australia.
Transactions of the Royal Society of South Australia 33(part 3):
263-269.
90 M.F. Gomon, C.D. Struthers & J. Kemp
Appendix |. COI sequences and source information for Pseudophycis spp featuring in Figure 1.
Species Source Voucher Reg No./ Country Collection Locality BOLD GenBank
Institution Sample ID No. Sequence ID accession
A. punctatus NMNZ P.045573 New Zealand South Island, west coast FNZC105-09 MN200065
A. punctatus NMNZ P.045574 New Zealand South Island, west coast FNZC106-09 MN200089
A. punctatus NMNZ P.045575 New Zealand South Island, west coast FNZC107-09 MN200090
A. punctatus NMNZ P.045576 New Zealand South Island, west coast FNZC108-09 MN200094
A. punctatus NMNZ P.045577 New Zealand South Island, west coast FNZC109-09 MN200092
A. punctatus NIWA no voucher PCOI New Zealand South Island, west coast FNZA333-07 MN200088
A. punctatus NIWA no voucher PCO2 New Zealand South Island, west coast FNZA334-07 MN200093
P. bachus NIWA no voucher RCOI New Zealand Campbell Island FNZ949-07 MN20003 1
P. bachus NIWA no voucher RCO4 New Zealand Campbell Island FNZ950-07 MN200023
P. bachus NIWA no voucher RCO5 New Zealand Auckland Islands FNZA35 1-07 MN200039
P. bachus NIWA no voucher RCO6 New Zealand Auckland Islands FNZA352-07 MN200027
P. bachus NIWA no voucher RCO7 New Zealand no data FNZA388-08 MN200026
P. bachus NIWA no voucher RCO8 New Zealand no data FNZA389-08 MN200030
P. bachus NIWA no voucher RCO9 New Zealand no data FNZA390-08 MN200028
P. bachus NMNZ P.044338 New Zealand South Island, south of Timaru FNZA555-08 MN200037
P. bachus NMNZ P.044339 New Zealand South Island, south of Timaru FNZA 556-08 MN200029
P. bachus NMNZ P.044348 New Zealand Chatham Rise FNZA557-08 MN200062
P. bachus NMNZ P.044349 New Zealand Chatham Rise FNZA558-08 MN200024
P. bachus NMNZ P.044350 New Zealand Chatham Rise FNZA559-08 MN200040
P. bachus NMNZ P.053748 New Zealand Stewart Island, Port Pegasus MN200063
P. bachus NMNZ P.053749 New Zealand Stewart Island, Port Pegasus MN200069
P. bachus NMNZ P.053750 New Zealand Stewart Island, Port Pegasus MN200076
P. bachus NMNZ P.053751 New Zealand stewart Island, Port Pegasus MN200075
P. bachus NMNZ P.053752 New Zealand Stewart Island, Port Pegasus MN200035
P. bachus NMNZ P.054828 (Neotype) New Zealand North Island, Whanganui Bar MN200038
P. barbata CSIRO H 3791-01 Australia VIC, Gabo Island FOAD135-05 MN200087
P. barbata CSIRO H 4500-01 Australia VIC, Cape Everard FOAD 141-05 MN200080
P. barbata CSIRO H 7539-03 Australia TAS, Orford FOAO050-14 MN200085
P. barbata CSIRO H 7904-03 Australia SA, Great Bight FOAPO09- 16 MN200086
P. barbata CSIRO H 7949-13 Australia SA, Great Bight FOAP215-16 MN200079
P. barbata CSIRO no voucher Australia NSW, Cape Howe FOAD137-05 MN200083
P. barbata CSIRO no voucher Australia NSW, Diaster Bay FOAD138-05 MN200078
P. barbata CSIRO no voucher Australia NSW, Diaster Bay FOAD139-05 MN20008 1
P. barbata CSIRO no voucher Australia NSW, Diaster Bay FOAD 140-05 MN200082
P. barbata CSIRO no voucher GT 10004 Australia SA, Great Bight FOAP335-17 MN200084
P. barbata NIWA no voucher SBRI New Zealand no data FNZA383-08 MN200073
P. barbata NIWA no voucher SBR2 New Zealand no data FNZA384-08 MN200072
P. barbata NIWA no voucher SBR3 New Zealand no data FNZA385-08 MN200074
P. barbata NIWA no voucher SBR4 New Zealand no data FNZA386-08 MN200070
P. barbata NIWA no voucher SBR5 New Zealand no data FNZA387-08 MN200066
P. barbata NIWA no voucher SBR6 New Zealand North Island, Ngawi FNZA608-08 MN200036
P. barbata NIWA no voucher SBR7 New Zealand North Island, Ngawi FNZA609-08 MN200068
P. barbata NMNZ P.037109 New Zealand North Island, White Island FNZC188-09 MN200091
P. barbata NMNZ P.037124 New Zealand North Island, White Island FNZC189-09 MN200077
P. barbata NMNZ P.044103 New Zealand North Island, White Island FNZC280-09 MN20007 1
P. barbata NMNZ P.045835 New Zealand North Island, East coast FNZC252-09 MN200067
P. barbata NMNZ P.052745 New Zealand North Island, Cape Brett MN200025
P. barbata NMNZ P.053551 New Zealand North Island, Bay of Islands MN200033
P. breviuscula CSIRO H 6838-08 Australia NSW, Broken Bay FOAK632-10 MN200059
Australasian red cods
Species
P. breviuscula
P. breviuscula
P. breviuscula
P. breviuscula
P. breviuscula
P. breviuscula
P. breviuscula
P. breviuscula
P. breviuscula
P. breviuscula
P. breviuscula
P. palmata
P. palmata
P. palmata
P. palmata
P. palmata
P. palmata
P. palmata
P. palmata
P. palmata
P. palmata
P. palmata
P. palmata
Source
Institution
CSIRO
CSIRO
CSIRO
CSIRO
CSIRO
CSIRO
CSIRO
NMNZ
NMNZ
NMNZ
NMNZ
NMV
NMV
CSIRO
CSIRO
CSIRO
CSIRO
CSIRO
CSIRO
CSIRO
CSIRO
CSIRO
CSIRO
Voucher Reg No./
sample ID No.
H 6838-08/2
H 6845-01/1
H 6845-01/2
H 6845-01/3
H 6980-04
H 6991-01
H 7698-09
P.046285
P.046285-1
P.052718
P.052719
A 26125-002
A 31132-001
H 4229-01
H 7366-01
H 7716-01
H 7717-01
no voucher BW- 1692
no voucher BW-1693
no voucher BW- 1694
no voucher GT 7974
no voucher GT 7975
no voucher GT 7976
Country
Australia
Australia
Australia
Australia
Australia
Australia
Australia
New Zealand
New Zealand
New Zealand
New Zealand
Australia
Australia
Australia
Australia
Australia
Australia
Australia
Australia
Australia
Australia
Australia
Australia
Collection Locality
NSW, Broken Bay
NSW, Broken Bay
NSW, Broken Bay
NSW, Broken Bay
TAS, east coast
TAS, east coast
TAS, northeast
North Island, Bay of Islands
North Island, Bay of Islands
North Island, Ranfurly Bank
North Island, Ranfurly Bank
VIC, Port Phillip Bay
TAS, east coast
TAS, southeast
TAS, North Bruny Island
TAS, Munro Bight
TAS, Hinsby Beach
VIC, Bass Strait
VIC, Bass Strait
VIC, Bass Strait
TAS, east coast
TAS, east coast
TAS, southeast
BOLD
sequence ID
FOAK604- 10
FOAK626-10
FOAK612-10
FOAK610-10
FOAK240-10
FOAK247-10
FOAO011-15
FNZC272-09
FNZC271-09
FMVIC234-08
FOAO533-15
FOAD1306-05
FOAO5909-15
FOAO000-15
FOADI32-05
FOAD133-05
FOAD 134-05
FOAOS596-15
FOAO597-15
FOAO598-15
GenBank
accession
MN200053
MN200054
MN200055
MN200060
MN200057
MN200056
MN200064
MN200058
MN200061
MN200032
MN200034
MN200052
MN200043
MN20004 1
MN200048
MN200047
MN20005 1
MN200050
MN200044
MN200042
MN200045
MN200046
MN200049
91
92
M.F. Gomon, C.D. Struthers & J. Kemp
Appendix 2. Specimens registered in Australasian collections not used for compiling morphological data. Not all specimens listed were examined
in the course of the study.
Physiculus palmata
(78 specimens, 30—410 mm SL.) Australia: AMS 1.7534 (310)
no locality, 1905. New South Wales: AMS 1.15024 (420)
Merimbula, 36°53' S, 149°56' E, 1908; AMS I.34458-001 (87)
one third of way to Tollgate Island from Three Islet Reef
Batemans Bay, 35°44' S, 150°15.5' E, 100 m, 23-24 November
1988; AMS 1.34461-001 (190) Lookout Point, Twofold Bay,
37°4.5' S, 149°55' E, 50 m, 26-27 November 1988; AMS
1.34566-001 (225) Batemans Bay west end of Long Beach,
35°42' S, 150°13' E, 50 m, 23-24 November 1988; AMS
1.34568-001 (128) North Head Beach, Batemans Bay, 35°43’
S, 150°16' E, 50 m, 23-24 November 1988; CSIRO H3537-01
(5, 54-97) south of Disaster Bay, 37°24.2' S, 149?58.4
E-37?22.9' S, 149°58.7' E, 42-44 m, 13 August 1993.
Victoria: NMV A639 (221) off Phillip Island, 38?39' S,
145°19.8' E, 07 August 1979; NMV A836 (2, 104—138) Port
Phillip Bay, 38°06' S, 144°52.8' E, 1970; NMV A837 (2, 129—
133) Port Phillip Bay, 38°06' S, 144°52.8' E, 1971; NMV A838
(2, 134—146) Port Phillip Bay, 3.2 km (2 miles) Port Phillip
Bay, west of Sandringham, 37°57' S, 144°57' E, 30 March
1971; NMV A839 (250) Port Phillip Bay, 38°06' S, 144°52.8'
E, 25 July 1927; NMV A841 (2, 245—250) Port Phillip Bay,
Hobsons Bay, 37°52.2' S, 144°55.8' E, September 1867; NMV
A846 (2, 190—207) Port Phillip Bay, Hobsons Bay, 37°52.2' S,
144°55.8' E, September 1867; NMV A848 (315) no data, old
collection; NMV A2285 (51.4) central Bass Strait, 38 km
southwest of Cape Paterson, 38°55.5' S, 145°17' E, 70 m, 12
November 1981; NMV A2667 (51.8) Eastern Bass Strait, 8 km
south of South East Point, Wilsons Promontory, 39°12.9' S,
146°27.3' E, 65 m, 18 November 198]; NMV AIO0580 (242)
Western Port, 5 km north of Cowes, 38°26.1' S, 145?15.3' E, 20
m, 22 October 1986; NMV A20816 (2, 201—210) no data, old
collection, August 1864; NMV A26125-002 (61.0) Port
Phillip Bay, central part of bay, east of St Leonards, 38°12.8'
S. 144*50' E, 24 m, 12 December 1996; NMV A23366-002
(401) no data, old collection; NMV A31156-001 (237) Port
Phillip Bay, Hobsons Bay, 37.87°S, 144.93°E; NMV A31157-
001 (223) same collection data as NMV A31156-001.
Tasmania: AMS IB.1192 (142) d'Entecasteaux Channel,
simpsons Bay, 43°17' S, 147°18' E, 7 July 1942; AMS 1.10287
(140), Oyster Bay, 42°40' S, 148°03' E, 1909; AMS 1.14182
(300) Port Arthur, 43°09' S, 147°51' E, 13 April 1917; AMS
1.14183 (248) Port Arthur, 43?09' S, 147?51' E, 13 April 1917;
AMS 1.6243 (62) NW coast: Ulverston, 41?10' S, 146?11' E,
1903; AMS 1.6275 (340) Tamar River Heads, 41?20' S, 147°02'
E, 1903; AMS 1.6276 (245) Tasmania, Tamar River Heads,
41°20' S, 147?02' E, 1903; AMS 1.9259 (252) Port Arthur,
43°09' S, 147°S1' E, 1908; AMS 1.9989 (177) Bass Strait, east
of Flinders Island, 40?01' S, 148°42' E, 1909; AMS 1.9990
(195) Bass Strait, east of Flinders Island, 40?01' S, 148?42' E,
1909; NMV A1218-003 (2, 297—299) Central Bass Strait, 20
km north-northeast of North Point, 40°31.8' S, 145°22.8' E, 44
m, BSS 116 T, M.F. Gomon, G.C.B. Poore, and P. Forsyth, 4
November 1980; NMV A1289 (294) central Bass Strait, 23
km east of Cape Rochon, Three Hummock Island, 40°22.2' S,
145°17' E, 40 m, 3 November 1980; NMV A1381 (38.5)
central Bass Strait, 6 km northeast of Stanley, 40°48.8' S,
145°22' E, 22 m, 4 November 1980; NMV A1479 (67.2) central
Bass Strait, 32 km west-southwest of Settlement Point,
Flinders Island, 40°9.95' S, 147?31.8' E, 51—52 m, 6 February
1981; NMV A1535 (8, 163—220) central Bass Strait, 32 km
northwest of Devonport, 40°56' S, 146°5.4' E, 68—64 m, 4
February 1981; NMV A9776 (272) near Marlo Reef, 37°48' S,
148°31.8' E, 1991; NMV A9777 (276) Marlo Reef, 37°48' S,
148°31.8' E, 1991; NMV A20556 (202) Bass Strait, east coast
of Flinders Island, 40° S, 148°20' E, 73 m, 16 June 1909;
NMV A21590 (4, 150-182) Bass Strait, east of Flinders
Island, 40°S, 148°33' E, 1909; WAM P.27554.001 (186) Spring
Bay, 42°32' S, 147°55' E, 1-8 m; South Australia: SAMA F
2777 (1) Gulf St Vincent, 34°11' S, 138°9' E, 14 July 1953;
SAMA F4624 (8) Robe, 37°10' S, 139°45' E, 9 September
1979; SAMA F7172 (1) Spencer Gulf, Port Lincoln, 34°44' S,
135°52' E, 1992; SAMA FI10581 (1), Robe, bay near river
mouth, 16 March 2003; SAMA F10855 (1) Investigator Strait,
35°24'28" S, 137°54'40" E, 16 December 2006; SAMA
F10900 (1) Investigator Strait, 35°19' 09" S, 137?46' 05" E, 15
December 2006; SAMA F11864 (1) Great Australian Bight,
Coles Point, 34?22'06" S, 135°21'09" E, 21 March 2003;
SAMA F12755 (1) Victor Harbour, 35?33' S, 138°37' E, 14
september 2003.
Pseudophycis bachus
(416 specimens, 21-573 mm SL.) New Zealand, North
Island: NMNZ P.001129 (373) Wellington, Ngauranga,
Wellington Harbour, 41715' S, 174°50' E, 3 August 1952;
NMNZ P.001809 (174) North Auckland, off Kaipara Bar,
36°24' S, 174°9.5' E, 183 m, August 1955; NMNZ P.002271
(227) Wellington, Wellington Harbour, off Petone, 41°14.0' 5,
174°52.5' E, 13-18 m, 22 August 1957; NMNZ P.002372
(neurocranium) Wellington, York Bay, Wellington Harbour,
41°15.9' S, 174°54.2' E, 10-11 m, 31 May 1953; NMNZ
P.002440 (2, otoliths Wellington, Wellington Harbour,
41°16.5' S, 174°51.0' E, 1953; NMNZ P.003011 (otoliths and
skeleton) Wellington, Paraparaumu Beach, 40*53' S, 174°56'
E, 8 January 1961; NMNZ P.004788 (11, 71—128) Wellington,
Palliser Bay, 41°26.3' S, 175°3.0' E, 64-82 m, 15 February
1968; NMNZ P.006562 (10, 73—99) north of Kapiti Island, off
Foxton, 40°30.5' S, 174°53.0' E, 101 m, 1 March 1976; NMNZ
P.006802 (2, 212—243) Bay of Plenty, 8 km north of Mayor
Island, 37°12' S, 176°15' E, 366 m, 28 September 1962; NMNZ
P.007357 (otoliths) Wellington, Te Mimi, south end of Kapiti
Island, 40°52.35' S, 174°54.60' E, 3 m, 22 August 1977;
NMNZ P.00744] (otoliths) Wellington, 11 January 1978;
NMNZ P.008363 (3, 90—94) South Auckland, east-northeast
of Tolaga Bay, 38°15.2' S, 178°38.6' E, 139 m, 16 January
1979; NMNZ P.009415 (84) Gisborne, Matakaoa, East Cape,
37°34' S, 178°20' E, 15 m, 26 June 1988; NMNZ P.009823 (3,
79-112) Taranaki, west-northwest of Cape Egmont, 38°48.8'
S, 173°29.6' E, 146 m, 9 January 1981; NMNZ P.010543 (315)
Bay of Plenty, north of Mayor Island/east of Slipper Island,
Australasian red cods
37°4.95' S, 176°12.70' E, 315—352 m, 18 April 1981; NMNZ
P.014082 (2, 107-109) Wellington, off Castle Point, 40°56.25'
S, 176°22.80' E, 115-140 m, 17 April 1975; NMNZ P.016708
(10, 32-68) Wellington, east of Cape Campbell, 41°44.15' S,
174°27.65' E, 47 m, 15 December 1978; NMNZ P.017108 (293)
laranaki, Seal Rocks, Sugar Loaf Islands, New Plymouth,
39°3.25' S, 174°0.20' E, 30 m, 24 March 1985; NMNZ
P.017508 (2, 96-100) Wellington, Hikurangi Trench, 40°54.8'
S, 176°25.4' E, 140 m, 17 April 1976; NMNZ P.017509 (102)
Wellington, Hikurangi Trench, 40*57.7' S, 176°20.2' E, 115 m,
17 April 1976; NMNZ P.018714 (2, 52-57) Manawatu,
southwest of Whanganui, 40°22.65' S, 174°22.80' E, 62—80 m,
17 July 1985; NMNZ P.019115 (57) Gisborne, east of Tolaga
Bay, 38°23.05' S, 178°26.65' E, 30 m, 11 January 1980; NMNZ
P.019331 (50) Hawke's Bay, Cape Kidnappers, 39°39' S,
177°10' E, 36 m, 19 October 1969; NMNZ P.023430 (230)
Gisborne, Matakaoa, East Cape, 37°34' S, 178°20' E, 15 m, 26
June 1988; NMNZ P.029685 (5, 310—360) off Mohaka, 39°15'
S. 177°20' E, 17 November 1992. South Island: AMS I.14733
(440) Portobello, Otago Harbour, 45°51' S, 170?39' E, 13
December 1918; AMS 1.14734 (550) Otago, Blueskin Bay,
45?44' S, 170?35' E, 29 November 1918; NMNZ P.001753
(148) Otago, edge of Karitane Canyon, northeast of Tairoa
Head, 45°38.5' S, 171°2.0' E, 220 m, 14 August 1955; NMNZ
P.006548 (2, 90—109) Marlborough, Western Cook Strait; ca
14 km northeast of Stephens Island, 40°33' S, 174°7' E, 130—
132 m, 4 March 1976; NMNZ P.006704 (278) Canterbury,
northeast Mernoo Bank, Chatham Rise, 43?10.5' S, 174?58.5'
E, 298—422 m, 23 June 1975; NMNZ P.007180 (305) Snares
Islands, west side of western chain, Snares Island, 48°3' S,
166°30' E, 120 m, 4 December 1976; NMNZ P.007349 (200)
Marlborough, Kaikoura area, 41°20' S, 174°9' E; NMNZ
P.007442 (otoliths) Marlborough, ‘Run Under Point’; Cook
Strait between Port Underwood and Tory Channel, 41°18.25'
S, 174°14.55' E, 19 January 1978; NMNZ P.007457 (505)
Canterbury, Western Chatham Rise, off Mernoo Bank,
43°16.45' S, 174°55.50' E, 220 m, 11 December 1977; NMNZ
P.007730 (12, 31-123) Marlborough, Cloudy Bay, 41°26.1' S,
174°15.9' E, 59—64 m, 28 January 1979; NMNZ P.008107 (79)
Nelson, 6.4 km northwest of Farewell Spit, 40°27.0' S,
172°48.5' E, 70 m, 10 March 1976; NMNZ P.008355 (185)
Southland, Crooked Arm, Fiordland, 45°25' S, 166°58' E, 16
m, 7 January 1977; NMNZ P.008356 (14, 67-105)
Marlborough, Cloudy Bay, 41°26.35' S, 174°9.70' E, 27-28 m,
28 January 1979; NMNZ P.008365 (18, 60—118) Marlborough,
Cloudy Bay, 41°26.35' S, 174°9.70' E, 27—28 m, 28 January
1979; NMNZ P.009282 (5, 228—360) Canterbury, Western
Chatham Rise, off Mernoo Bank, 43°16.45' S, 174°55.50' E,
220 m, 11 December 1977; NMNZ P.009283 (7, 170—213)
Canterbury, Western Chatham Rise, off Mernoo Bank,
43°16.45' S, 174°55.50' E, 220 m, 11 December 1977; NMNZ
P.010598 (2, 168—170) Otago, off Oamaru, 45*5' S, 170*59' E,
46 m, July 1962; NMNZ P.010647 (115) Otago, Cape
Wanbrow, off Oamaru, 45°7' S, 171°3' E, 100-101 m, June
1963; NMNZ P.010703 (65) Otago, Oamaru, 45°7' S, 174722
E, 73 m, March 1973, NMNZ P012069 (14, 57-75)
Marlborough, Mernoo Bank, 43°6.1' S, 175*20.5' E, 153 m, 12
January 1979; NMNZ P.012088 (2, 65-80) Marlborough,
93
Cloudy Bay, 41°26.35' S, 174°9.70' E, 27—28 m, 28 January
1979; NMNZ P.013119 (490) Snares Islands, Puysegur Trench,
46°49.15' S, 165°50.50' E, 459—515 m, October 1982; NMNZ
P.016344 (272), Snares Islands, off North Promontory, 48*0'
S, 166°36' E, 110 m, 5 December 1984; NMNZ P.017527 (2,
34—35) Stewart Island, Foveaux Strait, 46°30' S, 167°30' E,
May 1976; NMNZ P.017876 (12, 58—80) Nelson, north of
Cape Farewell, 40*4.65' S, 172*57.09' E, 102 m, 14 December
1978; NMNZ P.0O17879 (2, 36—60) Canterbury, northern
Canterbury Bight, off Waiau River mouth, 42°36.8' S,
173°40.4' E, 81 m, 16 December 1978; NMNZ P.017884 (80)
Nelson, north of Cape Farewell, 40°8.75' S, 173*11.15' E, 90
m, 14 December 1978; NMNZ P.O17885 (5, 38—46)
Canterbury, northern Canterbury Bight, off Kaikoura
Peninsula, 42°39.30' S, 173°35.95' E, 130 m, 16 December
1978; NMNZ P.017891 (12, 28—40) Marlborough, off Cape
Campbell, 41°42.1' S, 174°25.5' E, 60 m, 15 December 1978;
NMNZ BP017892 (15, 33-64) Canterbury, northern
Canterbury Bight, off Kaikoura Peninsula, 42°38.15' S,
173*39.75' E, 91 m, 16 December 1978; NMNZ P.017893 (15,
2]-46) Marlborough, Cook Strait, east of Cape Campbell,
41°46.8' S, 174°28.6' E, I8 m, 15 December 1978; NMNZ
P.018854 (48) Marlborough, east of Flaxbourne Depression,
41°59.9' S, 174°26.9' E, 100 m, 19 January 1982; NMNZ
P.018865 (45) Marlborough, east of Flaxbourne Depression,
4|*59.50' S, 174°30.55' E, 100 m, 19 January 1982; NMNZ
P.018878 (69, 26—75) Canterbury, Canterbury Bight/southeast
of Timaru, 44°43.4' S, 171754.7 E, 95 m, 16 January 1982;
NMNZ P.019322 (2, 45) Westland, northwest of Hokitika,
42?34.18' S, 170°15.19' E, 204 m, 10 December 1978; NMNZ
P.019509 (99, 29—55) Canterbury, northeast of Clarence River
mouth/central Campbell Bank, 42°6.00' S, 174°6.95' E, 84—86
m, 24 November 1982; NMNZ P.019831 (500) Southland,
North Port, Fiordland, 45°59' S, 166°34' E, 27 m, 8 May 1986;
NMNZ P019949 (205) Southland, 30 Fathom Point,
Fiordland, 45°43.3' S, 166°30.3' E, 36—37 m, 13 May 1986;
NMNZ P.020802 (110) East coast South Island, 1982; NMNZ
P.020806 (2, 72—76) East coast South Island, 1982; NMNZ
P.025063 (3, 88-137) Otago, off Tairoa Head, Otago
Peninsula, 45*45' S, 170*45' E, 1990; NMNZ P.025077 (3, 96—
135) Otago, off Otago Peninsula, 45°36.55' S, 170°51.88' E,
41-59 m, 10 May 1990; NMNZ P.025093 (8, 76—116) Otago,
off Otago Peninsula, 45°41.85' S, 170°58.72' E, 97-100 m, 10
May 1990; NMNZ P.025186 (90) Otago, Blueskin Bay, Otago
Peninsula, 45°43.28' S, 170°40.33' E, 20-22 m, 9 May 1990;
NMNZ P.025782 (2, 443—480) Canterbury, Pegasus Canyon,
43°23.78' S, 173°40.50' E, 113-109 m, 1 June 1990; NMNZ
P.030708 (7, 87—120) Snares Islands, Southern Snares Shelf,
48°30.75' S, 166°58.50' E, 134-136 m, 1 April 1993; NMNZ
P.032382 (420) Southland, Waterfall mooring, head of Bligh
Sound, Fiordland, 44°50' S, 166°32' E, 8—10 m, 21 March
1995; NMNZ P.032398 (3, 395—410) Southland, mooring at
Precipice Cove, Bradshaw Sound, Fiordland, 45°15' S, 167°10'
E, 20 m, 28 March 1995; NMNZ P.036007 (2, 266—300)
Westland, outer Frog Rock, 43°58.52' S, 168°33.48' E, 14—20
m, 11 February 1999; NMNZ P.036769 (2, 120-130)
Canterbury, southwest of Timaru, 44°35.71' S, 171°12.55' E,
18—19 m, 20 December 1998; NMNZ P.045793 (104, C&S)
94
Marlborough, Cloudy Bay, 41°26.1' S, 174°15.9' E, 59-64 m,
28 January 1979. Bounty Islands: NMNZ P.006643 (573)
Bounty Platform, southeast of Islands, 48°7.25' S, 179°16.25'
E, 230—238 m, 18 November 1975. Auckland Islands: NMNZ
P.007136 (264) northwest Auckland Islands/ Campbell
Plateau, 50°10.35' S, 167°43.10' E, 120 m, 21 January 1977.
Chatham Rise: NMNZ P.008357 (2, 78—79), Chatham Rise,
Mernoo Bank, 43°36' S, 175°31' E, 375 m, 12 February 1954;
NMNZ P.008358 (66) Mernoo Bank, Chatham Rise, 42°59.4'
S, 175°30.5' E, 112 m, 23 January 1954; NMNZ P.009414 (2,
94—188) east of Chatham Islands, 43?30.95' S, 176°9.25'W,
176—205 m, 22 May 1987; NMNZ P.020910 (4, 100—125)
Subantarctic Slope, 43°39.95' S, 175°51.40'W, 220—246 m, 28
May 1987; NMNZ P.020922 (270) northeast of Chatham
Islands, 43°33.6' S, 176°0.5'W, 228—234 m, 26 May 1987;
NMNZ P.020952 (273) east of Chatham Islands, 43°30.95' S,
176°9.25'W, 176—205 m, 22 May 1987; NMNZ P.020989 (2,
127-129) east of Chatham Islands, 43°39.15' S, 175°52.10'W,
216—244 m, 24 May 1987; NMNZ P.035283 (142) Urry Bank,
Chatham Rise, 44°9.0' S, 176°6.5' E, 126 m, October 1979.
Campbell Island: NMNZ P.009284 (390) Campbell Island
Rise, northeast of Island, 51°51' S, 169*40' E, 250—271 m, 10
April 1982; NMNZ P.012110 (530), Campbell Island Rise,
northeast of Island, 51?51' S, 169*40' E, 250—271 m, 10 April
1982.
Pseudophycis barbata
(211+ specimens, 26—620 mm SL.) Australia: AMS IB.7565
(465) no locality, 1966. New South Wales: AMS 1.16970-014
(176) Boydtown, Nullica Bay, 37°6' S, 149°53' E, 13 March
1972; AMS I.19833-003 (5, 48—60) east of Ulladulla, 35°20' S,
150*51' E, 128 m, 14 May 1974; AMS 1.25974-003 (91) Eden,
eastern Bass Strait, 37°S' S, 149?55' E, 18—46 m, 26 November
1984; AMS I.27359-008 (270) Quarantine Beach inside North
Head, 33°49' S, 151°18' E, 6 April 1967; AMS I.27359-000 (4,
105-180) Quarantine Beach inside North Head, 33°49' S,
151°18' E, 6 April 1967; AMS 1.28908-001 (305) east of
Shoalhaven Bight, 34°53' S, 151?06' E, 18 April 1985; AMS
1.34570-002 (140) east of Lookout Point Twofold Bay, 37?46'
S, 149°55' E, 26—27 November 1988; AMS I.34854-003 (115)
off Newcastle, 33?2' S, 151?58 E, 117-121 m, 24 March 1993;
AMS IB.8192 (514) Eden, 37°4' S, 149°55' E, 9 June 1968;
CSIRO A 1117 (72 mm TL) between Cronulla and Eden,
October 1948; CSIRO B 3455 (4, 59-96 mm TL) off Moruya
at “The Pines Close", 35°55' S, 150°10' E, 90 m, 28 April 1939.
Victoria: AMS L16987-006 (5, 75-150) Petersborough,
estuary, near boat ramp, 38°37' S, 142°52' E, 6 m, 21 March
1972; CSIRO H 3793-03 (83) south of Gabo Island, 57?44.0'
S. 149°58.0' E-37?*42.3 S, 149°59.5' E, 108-115 m, 17
september 1994; NMV 30055 (502) Western Port, 38°22.2' S,
145°22.2' E, October 1858; NMV 43104 (375) Port Phillip
Bay, Hobsons Bay, 37°52.2' S, 144°55.8' E, October 1878;
NMV 43105 (375) Port Phillip Bay, Hobsons Bay, 37°52.2' S,
144°55.8' E, October 1879; NMV A842 (252) No location
data, | January 1971; NMV A2941 (102) Port Phillip Heads,
38°16.8' S, 144°37.8' E, 1864; NMV AI0567 (225) Western
Port, 5 km north of Cowes, 38°26.1' S, 145°15.3' E, 20 m, 22
M.F. Gomon, C.D. Struthers & J. Kemp
October 1986; NMV A23366-001 (438) no data, old
collection. Tasmania: AMS _ 1.17545-016 (70) Eaglehawk
Neck, 43?2' S, 147°56' E, 29 November 1972; AMS I.17555-
011 (6, 62—95) The Gardens, north of Binalong Bay, 41°13' S,
148°13' E, 1 m, 6 December 1972; AMS L.20086-001 (75)
spring Beach, 42°35' S, 147°54' E, 2-4 m, 16 December 1977;
AMS I.34952-003 (260) Mouth of Fortescue Bay, 43°07'46" S,
147°59'28" E, 9-10 April 1994; CSIRO B 1259 (6, 50—62 mm
TL) NE coast, 43°03' S, 148°03' E, 17 December 1976; CSIRO
C 1405 (165) St Helens, 28 February 1951; CSIRO H 1151-02
(90) 40°55.05' S, 147?21.35' E, 33 m, 17 June 1987; CSIRO T
1105 (26) east of Babel Island, 120 m, 12 April 1984; CSIRO
T 1252 (1) St Helens, 41?25' S, 148°16' E, 30 m; CSIRO T 1523
(1) St Helens Point, east coast of Tasmania, 25 February 1982;
CSIRO T 1625-01 (27) Flinders Island; WAM P.27553.002
(103) Mercury Passage, 42?33' S, 147°57' E, 7-8 m; WAM
P.27554.002 (2, 136-206) Spring Bay, 42?32' S, 147°55' E, 1-8
m; WAM P.27559.002 (2, 74—94) Saint Helens Point, 41?16' S,
148°22' E, 3 m; WAM P.27560.002 (2, 111—296) Bridport,
41°00' S, 147?23' E, 8-9 m; South Australia: AMS 1.18470-
005 (191) Robe, southwest coast, 37°10' S, 139°45' E, 1 m, 3
October 1975; AMS I.20180-021 (5, 69-112) Kangaroo Island,
Penneshaw, 35°44' S, 137°58' E, 0—5 m, 9 March 1978; CSIRO
CA 3516 (281 mm TL) west of Investigator Group, Great
Australian Bight, 33°43.8' S, 132°07.8' E-33°45.1' S, 132°08.9'
E, 180-184 m, 8 December 1981; SAMA AMSTACIO2 (1)
Great Australian Bight, Anxious Bay, 33°20'03" S, 13473847"
E, 25 February 1981; SAMA AMSTACISI (1) 30 miles west
of Robe, 37°09'47" S, 139°12'31" E, 7 April 1981; SAMA
AMSTAC213 (1) 4.5 miles west of Beachport, 37°29' S,
139*55' E, 8 April 1981; SAMA AMSTAC288 (1) Cape
Buffon, 1 April 1981; SAMA AMSTAC289 (1) Cape Buffon,
] April 1981; SAMA AMSTAC292 (1) 2 miles west of Cape
Buffon, 1 April 1981; SAMA AMSTACT7II (1) Great
Australian Bight, South East Isles, 34°20' S, 123°42' E, 26 July
1981; SAMA AMSTACI331 (1) Spencer Gulf, between
Wardang Island and Tipara Reef, 34°12'06" S, 137°18'24" E;
SAMA AMSTACIA90 (1) Kangaroo Island, 2-3 miles off
West Bay, 36°03'40" S, 137°12'39" E, 16 January 1982; SAMA
AMSTAC1602 (1) off Port MacDonnell, 38°03'S, 140°42'E, 1
January 1982; SAMA F505 (1) 1918; SAMA FI1012 (1) Gulf St
Vincent, 35°10' S, 137?55' E, 1928; SAMA F1144 (1) 1928;
SAMA 1145 (1); SAMA 1146 SAMA 1736 (1) St Vincent
Gulf, Port Wakefield, 34°11' S, 138°29' E, 8 July 1932; SAMA
F2011 (1) Spencer Gulf, Moonta, 34°3' S, 137?34' E, 14
October 1937; SAMA F2031 (1) Eyre Peninsula, Venus Bay,
33°12' S, 134°40' E, 29 April 1938; SAMA F2766 (1) Spencer
Gulf, Port Lincoln, 34?44' S, 135°52' E, 28 January 1953;
SAMA F3045 (1) Adelaide, Outer Harbour, 34°47' S, 138°29'
E, 26 January 1962; SAMA F3377 (1) Kangaroo Island,
Stokes Bay, 35°37' S, 137°12' E, 15 August 1966; SAMA
F3392 (1) Kangaroo Island, Stokes Bay, 35°37' S, 137°12' E,
15 August 1966; SAMA F3649 (1) Kangaroo Island, Osmanli
Reef, D’Estrees Bay, 35°59' S, 137?38' E, 13 August 1966;
SAMA F3972 (1) near Coffin Bay, Farm Beach, 34°31' S,
135°23' E, 31 August 1974; SAMA F3980 (1) Encounter Bay,
Port Elliott, Bashams Beach, 35?32' S, 138°41' E, 13 October
1974; SAMA F4093 (1) Encounter Bay, 35?33' S, 138°38' E,
Australasian red cods
20 July 1975; SAMA F4281 (1) Kangaroo Island, Emu Bay,
35°35' S, 137°31' E, 21 January1968; SAMA F5162 (1) Port
MacDonnell, 38°3' S, 140°42' E, 1984; SAMA F5204 (1) Gulf
St. Vincent, 34°26' S, 137?55' E, June 1984; SAMA F5529 (1)
Kangaroo Island, Penneshaw, 35°43' S, 137°56' E, 29 October
1985; SAMA F6416 (1) Spencer Gulf, Cowell, 33°41’ S,
136°55' E, 1988; SAMA F7174 (1) Spencer Gulf, 34°44' S,
135°52' E, 17 February 1993; SAMA F9097 (1) Kangaroo
Island, north of Hog Bay, 35°43' S, 137°57' E, 20—22 m, 6 June
1954; SAMA F9576 (1) Investigator Strait, Althorpe Islands,
35°22'00" S, 136°52'00" E; SAMA F10526 (1) Investigator
Strait, 17 km N of Point Marsden, 35?24'58" S, 137?38'15" E,
28 June 2001; SAMA F10723 (1) Great Australian Bight,
32°15'31" S, 132°39'15" E, 20 April 2002; SAMA F10749 (1)
Great Australian Bight, 34?01'26" S, 134?28'34" E, 18 April
2002; SAMA FI11194 (1) Gulf St Vincent, 35?16'54" S,
138°09'36" E, 17 May 2007; SAMA FI11195 (1) Gulf St
Vincent, 35°16'54" S, 138°09'36" E, 17 May 2007; SAMA
F11196 (1) Gulf St Vincent, 35?16'54" S, 138?09'36" E, 17
May 2007; SAMA F14170 (1) Rivoli Bay, 37°31'44" S,
140°00'04" E, 6 April 2009. Western Australia: AMS 1.12324
(225) Great Australian Bight, southwest of Eucla, 32?00' S,
128?00' E, September 1912; CSIRO H 4383-08 (72) Bunbury,
inner harbour, general berth, 33°19.54' S, 115°39.57' E, 10.5
m, 6 March 1996; CSIRO H 4904-07 (108) Bunbury, outer
harbour (disused jetty groyne), 3.5 m, 6 March 1996; NMV
A9232 (350) Great Australian Bight, 120 km south of Middini
Beach, 33°17.1' S, 127°29.7' E, 162-160 m, 14 February 1990;
SAMA F73 (1) Abrolhos Islands, 28°45' S, 113°47' E, 22 April
1913; WAM P.1794.001 (365) Hopetoun, 33°57' S, 120°07' E;
WAM P.7687.001 (350) Albany, 35?00' S, 117°52' E; WAM
P.14596.001 (lost?) 31°54' S, 110°10' E; WAM P.26119.001
(149) Lookout Point, 34?53' S, 118?25' E; WAM P.29035.009
(270) 34?03' S, 122?00' E; WAM P.29339.001 (160) Mandurah.
Tasman Sea: NMNZ P.009285 (280) southern Lord Howe
Rise, 38? S, 168° E, 260 m, 7 December 1993; NMNZ
P.030825 (460) southern Lord Howe Rise, 38? S, 168? E, 400—
405 m, 31 August 1993; NMNZ P.031243 (540) southern Lord
Howe Rise, 38? S, 168? E, 260 m, 7 December 1993. New
Zealand, North Island: NMNZ P.000256 (135) Auckland,
Hauraki Gulf, 36°30' S, 175*0' E, September 1920; NMNZ
P.001236 (486) Wellington, Makara, 41°13.0' S, 174°42.5' E,
40 m, 28 February 1953; NMNZ P.001462 (528) Wellington,
Cape Terawhiti, 41717' S, 174°37' E, 9 m, 28 February 1954;
NMNZ P.001970 (165) Bay of Plenty, northwest of Mayor
Island, 37°15' S, 176°12' E, 146-219 m, 18 August 1956;
NMNZ P.002233 (379) Wellington, North of Castle Point,
41°37' S, 175°16' E, 65 m, 25 September 1957; NMNZ
P.002795 (500) Wellington, South of Titahi Bay, 41°6' S,
17450 E, 3 m, 12 July 1959; NMNZ P.006783 (308)
Wellington, Breaker Bay, Seatoun, 41°20' S, 174°50' E, 9
October 1973; NMNZ P.007789 (92) Hawke's Bay, 30 km east
of Portland Island, 39°18.25' S, 178°12.00' E, 258—306 m, 27
January 1979; NMNZ P.008360 (116) Bay of Plenty, southeast
of Mayor Island, 37°22.5' S, 176°22.0' E, 207-219 m, 27
February 1957; NMNZ P.008361 (8, 74—120) South Auckland,
east-northeast of Tolaga Bay, 38°15.2' S, 178°38.6' E, 139 m,
l6 January 1979; NMNZ P.009286 (2, 322-331) South
95
Auckland, Anchor Reef, southeast corner Whale Island,
37*5l' S, 176°59' E, 1 July 1998; NMNZ P.010327 (3, 315—352)
Bay of Plenty, north of Mayor Island/east of Slipper Island,
37*4.95' S, 176°12.70' E, 315—352 m, 18 April 1981; NMNZ
P.013608 (550) Wellington, Mana Island, 41*5' S, 174^52' E, 74
m, 12 March 1983; NMNZ P.014893 (2, 360—410) Three
Kings Islands, NW Bay, Great Island, 34°9.0' S, 172°8.5' E, 14
m, 25 November 1983; NMNZ P.017924 (3, 42—48), off Mayor
Island, Bay of Plenty, 37°14.35' S, 176°21.15' E, 218—225 m, 13
December 1975; NMNZ P.018168 (422) Bay of Plenty, off east
side of Mayor Island, 37°18' S, 176718 E, 37-91 m, I7
February 1986; NMNZ P.023405 (385) Gisborne, Waiaka Bay
near Lottin Point, East Cape, 37°33' S, 178°9' E, 6 m, 24 June
1988; NMNZ P.028461 (288) Gisborne, southeast of Cape
Runaway, East Cape, 37°32.9' S, 178*0.5' E, 8—12 m, 24 April
1992; NMNZ P.030132 (570) Gisborne, Monowai Reef,
38°35.9' S, 178°16.7' E, 15-21 m, 20 January 1993; NMNZ
P.030137 (286) Gisborne, inside of Tuamotu Island, Gisborne
Harbour, 38°42.2' S, 178°2.4' E, 4-7 m, 21 January 1993;
NMNZ P.031312 (279) Hawke’s Bay, “White Cliffs’, ~3 km
south of Cape Kidnappers, 39°42' S, 177°3' E, 40 m, 23
January 1994; NMNZ P.031697 (200) Bay of Plenty, southern
Kermadec Ridge, 37°32.90' S, 177°6.12' E, 325—327 m, 14
January 1995; NMNZ P.031923 (114) Bay of Plenty, southern
Colville Ridge, 36°57.12' S, 176°15.90' E, 336-339 m, 9
January 1995; NMNZ P.033156 (340) Wellington, north end
of Mana Island, 41°4.63' S, 174°47.40' E, 10-15 m, 8 March
1996; NMNZ P.033318 (160) Wellington, north end of Mana
Island, 41°4.63' S, 174°47.40' E, 10-15 m, 8 March 1996;
NMNZ P.033569 (245) Bay of Plenty, Long Point, Mahia
Peninsula, 39°10' S, 177*49' E, 8 m, 4 January 1995; NMNZ
P.034786 (520) Hawke's Bay, White Cliffs, northern end of
Ocean Beach, 39°41' S, 177°3' E, 20 m, 27 April 1997; NMNZ
P.036897 (440) South Auckland, Anchor Reef, southeast
corner Whale Island, 37°51' S, 176°59' E, 1 July 1998; NMNZ
P.036907 (375) South Auckland, east side of White Island,
37°31' S, 177°12' E, 160 m, 4 July 1998; NMNZ P.041342
(380) Northland, 232 m, 25 January 2005. South Island:
NMNZ P.005345 (2, 127) Nelson, Central Eastern Challenger
Plateau, west of Farewell Spit, 40°37.5' S, 171°37.5' E, 247 m,
3 March 1971; NMNZ P.007707 (353) Canterbury, Mernoo
Bank, 43°23.0' S, 175°6.8' E, 124—129 m, 12 January 1979;
NMNZ P.008031 (489) Marlborough, Kaikoura region, 42°25'
S, 173°43' E, 109-128 m; NMNZ P.009008 (2, 290—380)
Westland, Hokitika Canyon, 42°13' S, 170*34' E, 305—380 m,
12 August 1979; NMNZ P.009465 (420) Marlborough,
Kaikoura region, 42°25' S, 173°43' E; NMNZ P.016345 (300)
Snares Islands, off North Promontory, 48*0' S, 166°36' E, 110
m, 5 December 1984; NMNZ P.016889 (422) Southland, west
of Richards Point, Bradshaw Sound, Fiordland, 45°16.7' S,
167°0.7' E, 15-21 m, 27 February 1985; NMNZ P.016933 (2,
150-177) Southland, off Seymour Island, Doubtful Sound,
Fiordland, 45°18' S, 167°0' E, 12 m, 28 February 19855; NMNZ
P.016970 (460) Southland, off Seymour Island, Doubtful
sound, Fiordland, 45°18' S, 167°O' E, 12 m, 28 February 1985;
NMNZ P.017874 (65) Westland, NW off Hokitika, 40°38.48'
S, 170°11.42' E, 169 m, 11 December 1978; NMNZ P.021159
(620) Southland, mouth of Caswell Sound, Fiordland, 44°58.9'
96
S, 167°7.6' E, 48 m, 15 February 1987; NMNZ P.023949 (430)
Stewart Island, off Hebe Island, Port Pegasus, 47°11.8' S,
167°38.5' E, 10-16 m, 28 January 1989; NMNZ P.027612 (2,
195—256) Stewart Island, SE Point Rosa Island, Port Pegasus,
47°9.9' S, 167742.0 E, 0-9 m, 10 March 1992; NMNZ
P.027622 (390) Stewart Island, 13 Fathom Point, Whale
Passage, Port Pegasus, 47°11.00' S, 167°43.05' E, 20 m, 13
March 1992; NMNZ P.0278770 (225) Stewart Island, SE Point
Rosa Island, Port Pegasus, 47°9.9' S, 167°42.0' E, 0—9 m,
March 1992; NMNZ P.030270 (133) Southland, “Little Cove’,
Acheron Passage, Fiordland, 45°39.88' S, 166°44.78' E, 0—10
m, 21 March 1993; NMNZ P.030520 (320) Southland, “46
fathom point", Broughton Arm, Breaksea Sound, Fiordland,
45°33.35' S, 166°57.95' E, 2-18 m, 21 March 1993; NMNZ
P.030554 (330) Southland, Peninsula opposite Oak Island,
Wet Jacket Arm, Fiordland, 45?38.65' S, 166°51.90' E, 0—33
m, 28 March 1993; NMNZ _ P.030559 (310) Southland,
Stephens Cove, Fiordland, 45*36' S, 166°40' E, 7 m, 18 March
1993; NMNZ P.030940 (3, 84—183) Tasman, Taupo Point,
Abel Tasman National Park, 40*47.5' S, 172*57.0' E, 4—8 m, 19
November 1993; NMNZ P.032260 (157) Southland, | nautical
mile south of Deas Cove, south side of Thompson Sound,
Fiordland, 45°12.79' S, 166°57.31' E, 8-24 m, 28 March 1995;
NMNZ P.033439 (475) Stewart Island, south of Stewart
Island, Campbell Plateau, 48°47.78' S, 166°47.26' E, 158 m, 5
March 1996; NMNZ P.035083 (140) Westland, Bridget Point,
Milford Sound; Fiordland, 44°38.61' S, 167?54.86' E, 6—14 m,
5 April 1998; NMNZ P.035981 (462) Westland, point south of
Teer Creek, 44^0' S, 168°29' E, 15-18 m, 13 February 1999.
Chatham Rise: NMNZ P.020957 (2, 265) east of Chatham
Islands, 43°30.95' S, 176°9.25'W, 176—205 m, 22 May 1987;
NMNZ P.021008 (378) east of Chatham Islands, 43?31' S,
176°7'W, 206-226 m, 24 May 1987; NMNZ P.026557 (5,
143—255) channel between Point Munning and Te Whakuru
Island, Chatham Island, 43°44.3' S, 176°12.0'W, 0—3 m, 15
February 199]; NMNZ P.026670 (245) Cape Fournier,
Owenga, Chatham Island, 44°2.0' S, 176°19.5'W, 15—17 m, 10
February 1991; NSMT 32967 (537) Wanganella Bank, 32°41.6'
S. 167°42' E, 123—405m, 12 December 1989.
Pseudophycis breviuscula
(636 specimens, 15-196 mm SL). Australia, New South
Wales: AMS 1.3982 (152) off Newcastle, 32?56' S, 151°56' E,
4 March 1898; AMS 1.3983 (170) off Newcastle, 32°58' S,
151°55' E, 4 March 1898; AMS A.10105 (138) Port Jackson,
33°50' S, 151°10' E, 1881; AMS I.16879-001 (105) Jervis Bay,
off Darling Road, 35°3' S, 150°44' E, 22 September 1971;
AMS 1.17178-016 (65) Port Jackson, near Manly, 33°50' S,
151°16' E, 13 August 1972; AMS 1.19893-024 (4, 67-128)
south of Nadgee River mouth, north end of Blackpoint, 37°30!
S, 149°58' E, 0—5 m, 26 August 1976; AMS 1I.20065-002 (27,
35—46) off Ulladulla, 35°21' S, 150°49' E, 0—250 m, 27
October 1977; AMS I.20472-002 (2, 40-43) east of Green
Cape, 36°24' S, 150°18' E, 0-128 m, 1 November 1977; AMS
1.20568-002 (2, 130-170) east of Tweed Heads, 28°14' S,
153°50' E, 132-137 m, 2 June 1978; AMS [.20653-008 (119)
and AMS 1[.20653-013 (59) east of Hat Head, 31°5' S, 31°2' S,
M.F. Gomon, C.D. Struthers & J. Kemp
153°13' E, 155 m, 24 August 1977; AMS I.21366-019 (5, 35—
45) off Newcastle, 33°17' S, 153?5' E, 28 November 19791;
AMS 1.21797-003 (127) east of Tuggerah Lake, 33°8' S,
151°54' E, 115 m, 17 July 1978; AMS 1.21798-002 (4, 100-120)
east of Tweed Heads, 28°14' S, 153?50' E, 132-137 m, 2 June
1978; AMS L22873-002 (115) southeast of Cape Byron,
28?43' S, 153?49' E, 131 m, 1 November 1978; AMS 1.23379-
006 (42) Coffs Harbour, boat harbour, 30?20' S, 153°20' E,
0—6 m, 3 May 1977; AMS 1I.23685-001 (132) Smoky Cape,
Coffs Harbour, Scott Point, Nambucca Heads, 30°43' S,
153°16' E, 134-151 m, 10 October 1978; AMS 1.23687-001
(82) Ballina - Tweed Heads, 28°4' S, 153°50' E, 137 m, 16
August 1978; AMS LI.23688-001 (3, 117—165) Ballina - Tweed
Heads, east of Brunswick Heads, 28?25' S, 153?48' E, 119 m, 3
June 1978; AMS 1.23692-001 (2, 122-145) Ballina - Tweed
Heads, 28?34' S, 153°50' E, 146—150 m, 18 August 1978; AMS
1.23870-006 (106) Sydney-Newcastle, 33°40' S, 152°56' E, 720
m, 20 December 1976; AMS L.24367-003 (2, 37—48) off
sydney, 33°43' S, 151°54' E, 430—541] m, 27 October 1983;
AMS 1.24440-002 (4, 35-45) east of Twofold Bay, 37?03' S,
150 20' E, 149 m, 1 November 1977; AMS I.25865-003 (145)
off Port Stephens, 32?49' S, 152?2' E, 40—46 m, 10 April 1985;
AMS 1.25893-001 (196) off Twofold Bay, 37°5' S, 149°55' E,
18—46, 25 November 1984; AMS 1.26239-005 (118) east of
Wooli, 29?49' S, 153?24' E, 36—54 m, 25 March 1985; AMS
1.26444-002 (112) northeast of Broken Bay, 33°29' S, 151°49'
E, 142-137 m, 13 March 1986; AMS 1I.26451-005 (4, 51—99)
Sydney, off Broken Bay, 33°35' S, 151?4]' E, 134—135 m, 10
February 1986; AMS 1.26906-009 (93) Iluka, 29°24' S,
153°21' E, 1987; AMS 1.26919-002 (42) northeast of Jervis
Bay, off Point Perpendicular, 35?5' S, 150°55' E, 128 m, 13
December 1984; AMS I.27064-006 (91) 35?0' S, 150?45' E,
2—7 m, January 1987; AMS 1.27179-010 (43) 30°40' S, 159°0
E, 0-229 m, 20 September 1987; AMS 1.27322-005 (141) off
Tuncurry, 32°08' S, 152°31' E, 1 October 1985; AMS 1.27323-
004 (104) east of Camden Head, 31?42' S, 152?49' E, 2 October
1985; AMS L.27670-001 (93) off Coffs Harbour, 30?26' S,
153°22' E, 25 July 1981; AMS 1.31483-003 (135) off Evans
Head, 29°00' S, 153°49' E, 6 May 1990; AMS 1.32120-001
(109) off Clarence River, 29?24' S, 153?35' E, 1-2 May 1990;
AMS 1.34467-001 (2, 143—162) off Wollongong, 34?28' S,
151?2' E, 100 m, 6—7 May 1993; AMS I.34472-002 (3, 90—150)
off Wollongong, 34?26' S, 150°58' E, 7-8 May 1993; AMS
1.34474-001 (94) off Wollongong, 34°28' S, 151°2' E, 100 m,
7-8 May 1993; AMS 1.34475-001 (128) off Wollongong,
34°28' S, 151?2' E, 100 m, 7-8 May 1993; AMS 1I.34557-003
(96) off Wollongong, 34?26' S, 150°57' E, 50 m, 6-7 May
1993; AMS I.34715-001 (2, 85-115) Botany Bay channel off
revetment, 33?59' S, 151°12' E, 16 December 1978; AMS
1.34894-001 (125) off Wollongong, 34°0' S, 151°0' E, 28-29
March 1994; AMS I.35422-001 (2, 95-120) northeast of Coffs
Harbour, 30°15.75' S, 153°21.98' E, 98 m, 12-13 August 1993;
AMS I.35424-001 (3, 120—135) east of Coffs Harbour, 30°17'
S, 153°13' E, 50 m, 8-9 September 1994; AMS I.35427-001
(2, 86—93) east of Coffs Harbour, 30°17' S, 153°13' E, 50 m, 9
september 1994; AMS I.40321-006 (130) southeast of Yamba,
29°39' S, 153°41' E, 5 July 1999; AMS I.40491-001 (6, 854—125)
off Wollongong, 32°26' S, 150°57' E, 50 m, 6-7 May 1993;
Australasian red cods
AMS 1.44627-019 (79) Tathra, Baronda Headland, south side,
36°41'11" S, 149°59'54" E, 8 April 2008; AMS 1.44627-020
(81) Tathra, Baronda Headland, south side, 36°41'11" S,
149*59'54" E, 8 April 2008; AMS 1.44632-006 (2, 100)
Tathra, Kianniny boat ramp, 36°44'15" S, 149°58'60" E, 9
April 2008; AMS 1.44823-022 (97) north side of Moon Island,
33°05'12" S, 151°40'16" E, 5 May 2009; AMS 1.45025-004 (4,
96-115) Colliers Beach, inlet near Mollymook Golf Course,
35°20'46" S, 150?28'36" E, 10 March 2010; AMS I.45025-005
(2, 100-115) Colliers Beach, inlet near Mollymook Golf
Course, 35?20'46" S, 150?28'36" E, 10 March 2010; AMS
1.45027-018 (2, 65-75) Jones Beach, Mollymook, 35°19'19" S,
150?29' E, 11 March 2010; AMS L.45633-057 (6, 71—95)
Washerwomans Beach, 35?14'39" S, 150?32'09" E, 16 March
2011; AMS IA.1955 (72) off Green Cape, 13—35 km northeast
of cape, 37°4' S, 150°9' E, 71-84 m, June 1924; AMS IA.1956
(80) and AMS IA.1957 (60) 13-35 km northeast of Green
Cape, 37°4' S, 150°9' E, 71-84 m, June 1924; AMS IA.2966
(125) 16-19 km northeast of Sydney Harbour, 33°' S, I51°E,
110-146 m, 1926; AMS IA.6898 (75) 5 km off Broughton
Island, 32?37' S, 152?22' E, 82-91 m, 29 May 1936; AMS
[B.4359 (110) east of Tuggerah Lakes, 33?20' S, 151°35' E,
229—260 m, 19 June 1959; AMS IB.7005 (147) off Port
Stephens, 32° S, 152° E, 1964; CSIRO A 1622 (84 mm TL)
Pambula Bay, 11 m, 13 May 1950; CSIRO A 1639 (97 mm TL)
Twofold Bay, off Eden, 10.8 m, 5 May 1950; CSIRO A 1640
(83 mm TL) Twofold Bay, off Eden, 10.8 m, 5 May 1950;
CSIRO H 3575-01 (2, 60—70) east of Merimbula, 36°55.4' S,
149°56.8' E—36°54.6' S, 149°58.0' E, 33—40 m, 4 August 1993;
CSIRO H 4258-04 (107) south of Green Cape, 37°21.23' S,
150°06.03' E-37?20.1' S, 150°06.52' E, 90—94 m, 7 May 1996;
CSIRO H 4773-01 (148) east of Yamba, 29°24' S, 153?35
E-29*23' S, 153?35' E, 68—71 m, 17 April 1996; CSIRO H
4773-02 (4, 132-158) east of Yamba, 29?24' S, 153?35'
E-29*23' S, 153?35' E, 68—71 m, 17 April 1996; CSIRO H
5962-01 (2, 105-142) northeast of Coffs Harbour, 29°50' S,
153°27' E-29*48' S, 153°27' E, 66-68 m, 15 April 1996;
CSIRO H 6838-08 (4, 103—160) east of Broken Bay, 33°32.3'
S. 151°30.9' E-33?28.3' S, 151?32.5' E, 60—62 m, 27 June
2006; CSIRO H 0845-01 (3, 117-181) east of Broken Bay,
33°29.4' S, 151?32.2' E-33?33.7' S, 151?29.8' E, 60—62 m, 29
June 2006; CSIRO T 1434 (1) off Port Stephens, 32°44' S,
152°16' E-32?43' S, 152°23' E, 83-104 m, 20 August 1979;
NMV A6437 (31.0) 65 km east of Nowra, 34?52.9' S, 151°22.7'
E, 23 October 1988; NMV A6438 (31.3) 52 km east-southeast
of Nowra, 34°56.1' S, 151°14.7' E, 21 October 1988; NMV
A13051 (2, 52.4—68.5) 12 km east-northeast of Bermagul,
36°23.3' S, 150°10.7' E, 72-69 m, 15 August 1993. Victoria:
NMV A7531 (55.9) Batison Point, tide pool, 37°34.2' S,
149°46.2' E, I m, 6 April 1989; NMV A7500 (55.9) Gabo
Island, harbour on southeast side, 37°34.2' S, 149°55.2' E, 4 m,
4 April 1989; NMV A13050 (68.8) Disaster Bay, 37°16.3' S,
149*57.9' E, 24—29 m, 11 August 1993; NMV A2682 (28.1)
central Bass Strait, 26 km southeast of Aireys Inlet, 38°39.8'
S, 144°18.2' E, 79 m, 19 November 1981; NMV A3776 (2,
72.2—T1.2) eastern Bass Strait, 24 km southwest of Lakes
Entrance, 38?03' S, 147?49.8' E, 45 m, 1 October 1983; NMV
A384] (4, 58.9-79.3) eastern Bass Strait, 28 km south-
97
southwest of Marlo, 37°58.8' S, 148°27' E, 51 m, 30 July 1983;
NMV A5812 (3, 46.8—61.8) eastern Bass Strait, 40 km south-
southwest of Lakes Entrance, 38°18' S, 147°37' E, 55 m, 31
July 1983; NMV A835 (108) Bass Strait, 24 km (16 miles)
south-southwest of Lakes Entrance, 38°7' S, 147°51.8' E, 29—
37 m, 27 April 1948; NMV A8775 (38.3) Bass Strait, 30 km
east of Gabo Island, 37°37.2' S, 150°16.7' E, 432 m, 14 October
1984; NMV A20817 (74.5) southeast of Lakes Entrance,
38°10.2' S, 148°4.8' E, 1971; NMV A20818 (4, 48.3—80.0) no
collection data; NMV A29091-001 (80.5) Portland, inner
harbour, South Henty, 38°21' S, 141°36' E, 13 m, 1 May 1996.
Tasmania: AMS 1.43935-001 (78) East of Fortescue Bay,
north of Hippolyte Rocks, 43°0642" S, 148°03'27" E, 9-10
April 1994; CSIRO H 6980-04 (42) southern Tasman Sea,
40°48.97' S, 150?58.30' E-40?49.16' S, 150°56.54' E, 392-185
m, 21 June 2009; CSIRO H 6991-01 (36) southern Tasman
Sea, 40°48.35' S, 152?16.42' E—40?48.53' S, 152°15.25' E,
174-91 m, 21 June 2009; CSIRO T 1952 (150) Frederick
Henry Bay, 25 m, 19 September 1983; NMV A2626 (47.2)
eastern Bass Strait, 100 km northeast of North Point, Flinders
Island, 38?52.6' S, 148?25.2' E, 130 m, 15 November 1981;
NMV A2676 (35.4) central Bass Strait, 35 km north of Cape
Wickham, King Island, 39°13.6' S, 143°55.6' E, 85 m, 23
November 198]; NMV A3789 (40.7) eastern Bass Strait, 18
km north-northeast of Deal Island, 39°19.2' S, 147?277 E, 63
m, | October 1983; NMV A6435 (25.8) 68 km east of Cape
Tourville, 42°3.9' S, 149°11.9' E, 27 October 1988; NMV
A6439 (2, 24.3—34.0) 52 km east-northeast of Cape Tourville,
42°2.4' S, 148°58.3' E, 28 October 1988; NMV A6440 (3,
17.7—22.2) 54 km east-northeast of Cape Tourville, 42?02.1' S,
148°58.4' E, 28 October 1988; NMV A6909 (30.5) 78 km
south of Point Hicks, 38°30.1' S, 149°15.5' E, 25 October 1988;
NMVA26688-003 (2, 65.0—76.4) Port Phillip Bay, off Seaford,
artificial reef, 38705.25' S, 145°05.95' E; NMV A31158-001
(101) Port Phillip Bay, off Carrum, 7 April 2011; NMV
A31159-001 (95.5) and NMV A31159-002 (87.9) Port Phillip
Bay, 28 March 2011; WAM P.27554.021 (127) Spring Bay,
42?32' S. 147°55' E, 1-8 m. South Australia: AMS 1.20167-
021 (69) Kangaroo Island, Knob Point, 2 km east of Stokes
Bay, 35°37' S, 137°15' E, 15 m, 5 March 1978; AMS 1.20168-
013 (77) Kangaroo Island, Hanson Bay, 36°OI' S, 137°52' E, 6
March 1978; AMS I.20171-022 (41) Kangaroo Island, Vivonne
Bay, 36?0' S, 137°11' E, 0-2 m, 6 March 1978; CSIRO H 5337-
Ol (2, 73—86) Great Australian Bight, 33?16.00' S, 130°43.15'
E—33?16.60' S, 130°48.63' E, 137 m, 11 May 2000; CSIRO H
5338-01] (4, 69-125) Great Australian Bight, 31°50.05' S,
130°45.90' E-31*50.32' S, 130°45.10' E, 55 m, 14 May 2000;
SAMA AMSTACS89 (4) Great Australian Bight, 8 nautical
miles south of Point Weyland, 33°22'49" S, 134°37'53" E, 18
September 1981; SAMA AMSTAC1660 (1) Great Australian
Bight, 6 miles off Venus Bay, 33°18'S, 134°35'E, 1 July 1982;
SAMA F3948 (1) northern Great Australian Bight, 32°24' S,
133°30' E, 42 m, 5 May 1973; SAMA F9096 (1) Kangaroo
Island, Nepean Bay, 35°38' S, 137°46' E, 54 m, 28 April 1981;
SAMA F9098 (1) Great Australian Bight, Anxious Bay,
33°20'03" S, 134°38'47" E, 25 February 1981; SAMA F9099
(1) Great Australian Bight, Nuyts Archipelago, off Goat
Island, 32°17'00" S, 133°30'00" E, 40 m, 28 February 1981;
98
SAMA F10955 (1) Investigator Strait, 35°26'43" S, 137°56 42"
E, 17 May 2007; SAMA F10990 (1) Investigator Strait,
35°24'28" S, 137°54'40" E, 17 May 2007; SAMA F14583 (1)
22 May 1905. Western Australia: AMS 1.20229-021 (90)
Cockburn Sound, | km south of Carnac Island, 32°10' S,
115?40' E, 6-8 m, 26 March 1978; AMS I.20247-010 (2, 58—
63) Rottnest Is, Kingston Reefs, 31°59' S, 115?33' E, 12 April
1978; CSIRO H 4384-01 (110) Albany, Princess Royal
Harbour, 35°02.02' S, 117°53.05' E, 7 m, 28 February 1996;
WAM P.2999.001 (120) Mandurah, 32?32' S, 115°43' E; WAM
P.7409.001 (174) Augusta, 34°19' S, 115°09' E; WAM
P.21913.001 (135) Wilson Inlet, 34?59' S, 117?26' E; WAM
P.25195.019 (3, 47—56) Cape Naturaliste, 33°32' S, 115?02' E,
l-5 m; WAM P.26006.003 (46) 34?07' S, 122°16' E, 13 m;
WAM P.26009.006 (2, 65—70) Lucky Bay, 34?00' S, 122? |4' E,
13 m; WAM P.26600.008 (4, 30—76) Albany, 35?08' S, 117°38'
E; WAM P.26608.016 (2, 50-75) Cheyne Beach, 34°53' S,
118°25' E, 12-15 m; WAM P.26621.003 (117) Porpoise Bay,
32°00' S, 115°30' E, 1 m; WAM P.28292.008 (9, 45-121)
Lucky Bay, 34°00' S, 122°14' E, 7-10 m; WAM P.28293.011
(67) Lucky Bay, 34°00' S, 122°14' E, 5-7 m; WAM
P.28296.013 (5, 45—96) 34?08' S, 122°15' E, 5-6 m; WAM
P.28298.004 (24, 42-118) Lucky Bay, 34°08' S, 122°15' E, 24
m; WAM P.28513.006 (92) Duke of Orleans Bay, 33°54' S,
122°37' E, 5 m; WAM P.28523.006 (3, 38—70) Augusta, 34°19'
S. 115°10' E, 12-13 m. New Zealand, North Island: AMS
I.18281-005 (6, 75—90) Auckland, Goat Island, 18 m, 1975;
AMS 1.18282-003 (8, 65-105) Auckland, Goat Island, 57°S,
168°E, 20 m, 31 March 1975; NMNZ P.002281 (4, 80—106)
southeast of Mayor Island, 37°22.50' S, 176°22.00' E, 207—219
m, 27 February 1957; NMNZ P.002289 (69) south of Mayor
Island, 37°19.5' S, 176°16.5' E, 102 m, 27 February 1957;
NMNZ P.002299 (102) Manakau Harbour, above Weymouth,
37°2.45' S, 174°50.25' E, 0-5 m, 5 January 1957; NMNZ
P.003151 (10, 78—117) Urupukapuka Island, Bay of Islands,
35°12.32' S, 174°14.40' E, 2-7 m, February 1961; NMNZ
P.003616 (2, 73—79) 22.5 km east of White Island, 37?30' S,
177°26' E, 192 m, 3 April 1963; NMNZ P.003756 (130) Napier
breakwater, 39°28.50' S, 176°55.25' E, 9 m, March 1964;
NMNZ P.005275 (132) off Kaipara Harbour, 36°26.0' S,
173*50.5' E, 115 m, 9 January 1971; NMNZ P.005866 (2, 93—
109) northeast of Motiti Island, 37°39' S, 176°33' E, 64 m, 14
April 1972; NMNZ P.005969 (2, 93—99) main channel off
Kopumiti Point, Whangaroa Harbour, 35°2' S, 173*45' E, 9-15
m, 22 February 1974; NMNZ P.006801 (75) northern
Taranaki Bight, Aotea Seamount, 38°13.5' S, 173°54.0' E,
135-137 m, 13 November 1971; NMNZ P.007794 (8, 51-72) 9
km north of Motuhara Island, 37°48.15' S, 177°1.10' E, 72-84
m, 20 January 1979; NMNZ P.007865 (10, 60—83) north of
Mayor Island, 37°10.90' S, 176°10.75' E, 198-273 m, 22
January 1979; NMNZ _ P.007899 (3, 55-110) between
Motuhara Island and Rurima Inlets, 37°51.75' S, 176°55.90' E,
34—39 m, 21 January 1979; NMNZ P.008349 (4, 68-121)
north of Mayor Island, 37°10.90' S, 176°10.75' E, 198—273 m,
22 January 1979; NMNZ P.008362 (9, 54—79) east-northeast
of Tolaga Bay, 38°15.2' S, 178°38.6' E, 139 m, 16 January
1979; NMNZ P.008364 (12, 15-86) off Mayor Island, 37°9.1'
S. 176°24.4' E, 753-826 m; NMNZ P.008461 (108) off
M.F. Gomon, C.D. Struthers & J. Kemp
Kohinga point, Bay of Islands, 35710' S, 174°10' E, 5 December
1973, NMNZ P.008463 (74) Goat Island, Leigh, 36°16' S,
174°48' E, 1970; NMNZ P.008472 (120) Whatawhiwhi,
Doubtless Bay, 34°53.00' S, 173°24.25' E, 17 November 1963;
NMNZ P.009003 (2, 73—76) Spirits Bay, Northland, 34°27' S,
172°50' E, 4 m, 14 November 1963; NMNZ P.009796 (56)
southeast of Three Kings Islands, 34°20.2' S, 172*21.8' E, 121
m, 2 February 1981; NMNZ P.009802 (75) Ranfurly Bank,
East Cape, 37°38.4' S, 178°51.7' E, 79—83 m, 22 January 1981;
NMNZ P.009809 (3, 49—71) off Ninety Mile Beach, 34°41.9'
S, 172°33.5' E, 103 m, 10 January 1981; NMNZ P.009813 (61)
off Raglan Harbour, 37°48.0' S, 174°14.7' E, 103 m, 13 January
1981; NMNZ P.009817 (4, 68—90) off Parengarenga Harbour,
34°32' S, 173°6' E, 93-102 m, 27 January 1981; NMNZ
P.009828 (6, 59—122) northwest Ahipara, 34°50.0' S, 172°46.1'
E, 90 m, 10 January 1981; NMNZ P.010431 (63) off Mahia
Peninsula, 39°10' S, 178*0' E, 15 m, 14 April 1981; NMNZ
P.011874 (95) 2.4 km west of Cape Colville, Hauraki Gulf,
36°37' S, 175°28' E, 40-70 m, 17 February 1976; NMNZ
P.012089 (58) northeast of Ninepin Rock, Bay of Islands,
35*8.8' S, 174°10.9' E, 66—79 m, 1 December 1971; NMNZ
P.012091 (103) North Cape, 34°25' S, 173°3' E, 109-146 m, 8
October 1964; NMNZ P.012093 (108) north of the Noises,
Hauraki Gulf, 36°42' S, 174*58' E, 46 m, 17 May 1965; NMNZ
P.014301 (12, 72-120) Matai Bay, south side of middle
headland, Othngahunga Bay, 34°50! S, 173°25' E, 7-13 m, 18
August 1983; NMNZ P.014349 (2, 90—97) Waikato Bay, south
end of Matai Bay, Northland, 34^50' S, 173°25' E, 3-5 m, 19
August 1983; NMNZ P.014380 (2, 100—109) north end of
Taupo Bay, 34°59.17' S, 173°43.00' E, 7-8 m, 20 August 1983;
NMNZ P.014397 (3, 75—92) Oakura Bay, Northland, 35°23' S,
174°21' E, 4-6 m, 21 August 1983; NMNZ P.015199 (108)
channel between Henry Island and Cape Home, Oakura Bay,
35°23.0' S, 174?22.2' E, 14-17 m, 23 February 1984; NMNZ
P.015305 (110) south of Tutukaka Harbour entrance,
Northland, 35°37.36' S, 174°32.55' E, 13 m, 19 February 1984;
NMNZ P.016983 (34) seawater intake, New Plymouth
Powerhouse, 39°3' S, 174°5' E, 1983; NMNZ P.018115 (110)
off marine laboratory, Island Bay, 41721' S, 174°45.89' E, 15
m, 22 January 1986; NMNZ P.018200 (3, 850—111) reef in
northern Crater Bay; Mayor Island, 37°17.2' S, 176°16.4' E, 12
m, 19 February 1986; NMNZ P.018223 (96) Mount Manganui,
Bay of Plenty, 37°37.5' S, 176°10.4' E, 0—3 m, 13 February
1986; NMNZ P.018258 (88) Tauranga Bay, Mayor Island,
37°18.4' S, 176715.8' E, I2 m, 18 February 1986; NMNZ
P.018290 (3, 62-100) off Rabbit [Motuotou] Island, Mount
Maunganui, 37°38.0' S, 176°11.6' E, 6-15 m, 14 February
1986; NMNZ P.021081 (7, 83-134) off Bell Block, New
Plymouth, 39°1' S, 174°9' E, 9 m, 13 December 1986; NMNZ
P.O21541 (4, 52-83.2) rocks off Whangamata Beach,
Coromandel, 37°12.88' S, 175°53.65' E, 17 m, 29 November
1987; NMNZ P.021645 (72.8) east side of Great Mercury
Island, Coromandel, 36°37.05' S, 175°50.23' E, 15 m, 2
December 1987; NMNZ P.021767 (3, 59—89.3) pools between
Jackson and Fantail Bays, Coromandel, 36°32' S, 175°20' E,
0-3 m, 8 December 1987; NMNZ P.021797 (10, 72.1—99.8)
rocks off Whangamata Beach, Coromandel, 37°12.88' S,
175°53.65' E, 17 m, 29 November 1987; NMNZ P.021883 (95)
Australasian red cods
Firth of Thames, 37°0' S, 175°20' E, 30 January 1965; NMNZ
P.023179 (93) Matakaoa, East Cape, 37°34' S, 178°20' E, 16 m,
25 June 1988; NMNZ P.023211 (6, 81—113) Waiaka Bay near
Lottin Point, East Cape, 37°33' S, 178°9' E, 6 m, 24 June 1988;
NMNZ P.024349 (72) Higgins Wharf, Napier, 39°30' S,
176*50' E, 22 March 1988; NMNZ P.026295 (110) Charity
Reef, Pourerere, 40°6.2' S, 176°53.5' E, 12 m, 19 January 1991;
NMNZ P.026356 (66) Pauanui Point Reef, East Coast, 40°4.4'
S, 176°53.8' E, 7-10 m, 16 January 1991; NMNZ P.028100 (4,
509—120) Okakari Point, Northland, 36°15' S, 174°46' E, 2—3 m,
9 April 1992; NMNZ P.028204 (5, 86-151) Midway Point,
south of Lottin Point, East Cape, 37°32.6' S, 178°12.9' E, 15—
17 m, 2 May 1992; NMNZ P.028237 (5, 59-110) west side of
Orete Point, Te Kaha, 37°35.25' S, 177°53.15' E, 11-12 m, 3
May 1992; NMNZ P.028271 (2, 95-131) bay west of Lottin
Point, Waiaka Bay, East Cape, 37°32.9' S, 178°8.7' E, 15-20
m, | May 1992; NMNZ P.028389 (2, 62—68) south of Tohora
Pirau, Lottin Point, 3732.7 S, 178°10.0' E, 7-10 m, 2 May
1992; NMNZ P.028428 (4, 74—87) Kaipiro Reef, Maraetai
Bay, Te Kaha, Bay of Plenty, 37*42.6' S, 177°41.7' E, 19-21 m,
30 April 1992; NMNZ P.028460 (98) Kaipiro Reef, Maraetai
Bay, Te Kaha, Bay of Plenty, 37°42.6' S, 177°41.7' E, 19-21 m,
30 April 1992; NMNZ P.029790 (2, 105—130) off Horoera
Point, East Cape, 37°37.8' S, 178°28.9' E, 8—10 m, 24 January
1993; NMNZ P.029846 (2, 57—64) between Moutahiauru
Island and Koutunui Head, East Cape, 38°3.35' S, 178°22.20'
E, 9 m, 25 January 1993; NMNZ P.029855 (3, 60-75)
Whanarua Bay, Bay of Plenty, 37°40.0' S, 177*46.7 E, 15-21
m, 28 January 1993; NMNZ P.029875 (2, 62-75) between Te
Araroa and Horoera, East Cape, 37°37.6' S, 178°25.0' E, 03
m, 24 January 1993; NMNZ P.029969 (8, 45—65) northeast
Waipiro Bay, East Cape, 38°0.0' S, 178°23.1' E, 21 m, 25
January 1993; NMNZ P.030070 (3, 63—120) Tatapouri Beach,
Gisbourne, 38°39.2' S, 178*9.9' E, 6-8 m, 22 January 1993;
NMNZ P.030121 (5, 60—75) eastern Whanarua Bay, Bay of
Plenty, 37740.5' S, 177°47.4' E, 8 m, 28 January 1993; NMNZ
P.030607 (2, 70—117) Port of Napier, 39°28' S, 176°55' E, 23
March 1993; NMNZ P.030609 (7, 70—92) Gisborne Wharf,
99
Poverty Bay, 38°40.5' S, 178°1.5' E, 8 m, 4 December 1992;
NMNZ P.030615 (3, 78—117) Gisborne Wharf, Poverty Bay,
385'4]' S, 178*2' E, 18 May 1993, NMNZ P.030617 (2, 62—73)
Gisborne Wharf, Poverty Bay, 38*40' S, 178°1' E, March 1993;
NMNZ P.030631 (4, 71—104) Port of Napier, 39°29' S, 176°55'
E, 25 June 1993; NMNZ P.030685 (2, 87—106) Port of Napier,
39*21.9' S, 176°54.1' E, 5 m, 22 September 1992; NMNZ
P.030692 (19, 49—103) Gisborne Wharf, Poverty Bay, 38°40.8'
S, 178°1.1' E, 23 June 1993; NMNZ P.033570 (119) Long
Point, Mahia Peninsula, 39°10' S, 177°49' E, 8 m, 4 January
1995; NMNZ P.033644 (6, 50-110) Whangawehi, Mahia
Peninsula, 39°7' S, 177°54' E, 14 m, 25 January 1995; NMNZ
P.034527 (90) off Great Exhibition Bay, Northland, 34°40.4' S,
173°31.0' E, 182 m, November 1977; NMNZ P.035537 (10,
77-105) Archway, east end of Whale (Moutohora) Island,
37*5].44' S, 176°59.39' E, 12-17 m, 1 June 1998; NMNZ
P.035560 (3, 90-140) Rurima Islets, 37°49.78' S, 176°52.63' E,
7-10 m, 2 June 1998; NMNZ P.035584 (8, 82-139) North Bay,
Whale (Motuhora) Island, 37°51.05' S, 176°58.57' E, 13-15 m,
3 June 1998; NMNZ P.036587 (23, 66—112) south Whale
(Motuhora) Island, 37*51.70' S, 176°58.43' E, 8—12 m, 22 April
1999; NMNZ P.036641 (8, 82-118) Nursery Cove, White
Island, 37°31.42' S, 177°10.37' E, 5-16 m, 23 April 1999;
NMNZ P.036667 (7, 77-94) off Homestead Point, White
Island, 37°31.77' S, 177°10.68' E, 8-14 m, 23 April 1999;
NMNZ P.036698 (5, 77-116) west end of White Island,
37°51.05' S, 176°57.63' E, 12-16 m, 24 April 1999; NMNZ
P.036723 (22, 65-95) southeast MacEvans Bay; Whale
(Motuhora) Island, 37°51.57' S, 176°59.12' E, 12-17 m, 26
April 1999; NMNZ P.048348 (2, 62.1—67.9) off Kaweura,
midway between South Head, Omapere and Maunganui Bluff,
35°38.14' S, 173°26.09' E, 0—10 m, 14 February 2011; NMNZ
P.048431 (65.8) first coast beach south of southern headland
of Hokianga Harbour, 35°32.93' S, 173°22.01' E, 16 February
2011. South Island: NMNZ P.033548 (2, 110-133) Foul
Point, Abel Tasman, 40°54' S, 173°4' E, 8 m, 3 December
1993.
Memoirs of Museum Victoria 80: 101-112 (2021) Published 2021
1447-2554 (On-line)
httos://museumsvictoria.com.au/collections-research/journals/memoirs-of-museum-victoria/
DOI https://doi.org/10.24199/j.mmv.2021.80.05
Review of the Australian endemic odontocerid genus Barynema and status of
Australian Marilia (Trichoptera)
(http://zoobank.org/urn:|sid:zoobank.org:pub:827 E8E]E-E6C4-424C-A4A 2-2124128332F0)
ALICE WELLS" (http://zoobank.org/urn:|sid:zoobank.org:author:0D7A8359-1249-4DED-9D5F-DBF5FCD17876)
AND ROSALIND M. ST CLAIR? (http://zoobank.org/urn:|sid:zoobank.org:author:cO04d784-e842-42b3 -bfd3-317d359f8975)
' Australian National Insect Collection, CSIRO, PO Box 1700, Canberra, ACT 2601 Australia.
* Museums Victoria, GPO Box 666, Melbourne, Vic. 3001, Australia
* ‘To whom correspondence should be addressed. Email: alice.wells@csiro.au
Abstract
Wells, A. and St Clair, R.M. 2021. Review of the Australian endemic odontocerid genus Barynema and status of
Australian Marilia (Trichoptera). Memoirs of Museum Victoria 80: 101—112.
In this review of Australian Odontoceridae, we revise details of the two established species 1n the endemic genus
barynema Banks — B. costatum Banks and B. australicum Mosely — and describe six new congeners: B. paradoxum sp.
nov., B. lorien sp. nov., B. lobatum sp. nov., B. dilatum sp. nov., B. dolabratum sp. nov. and B. goomburra sp. nov. For the
only other odontocerid genus recorded for Australia, Marilia Müller, we discuss the present status of the three described
species — M. bola Mosely, M. aenigmata Neboiss and M. fusca Kimmins — and outline our efforts and those of others to
resolve problems of species delimitation based on morphology. We select a new replacement name for Marilia fusca and
provide brief notes on the larvae of both genera.
Keywords
venation, CO1 data, distributions, homonym
Introduction
The family Odontoceridae is one of several groups among
Australian Trichoptera, upon which Arturs Neboiss (late of
Museums Victoria) made some preliminary studies but then
set them aside. In 2003, he published a new Tasmanian
species of Marilia Müller, 1878 (M. aenigmata), thus bringing
to three the Australian species reported for this genus.
Barynema Banks, 1939, the only other odontocerid genus
recorded for Australia, 1s endemic, comprising two established
species. Discrimination between adult males of these two
Barynema species and a further six species, newly described
here, is reasonably easy based on male genitalic features,
augmented for some by thoracic features, but this 1s not so for
discrimination between adult specimens referrable to Marilia.
The genus Marilia has almost a worldwide distribution.
Features of the genus are discussed in detail in works by Oláh
and Johanson (2010) and Yang et al. (2017). Oláh and
Johanson (2010) found that "[m]any species have similar male
genitalia, and it is difficult to differentiate all species by
examining the phallic apparatus alone" (p. 73). Working with
east Asian species, they advocated discrimination of species
based on combined genitalic features and cephalic setal wart
patterns.
The three species of Marilia described from Australia —
Marilia bola Mosely, 1953, and M. fusca Kimmins, 1953
(both described in the work by Mosely and Kimmins, 1953),
and M. aenigmata — all have very uniform male and female
genitalia. Differentiation of the first two appears, on paper, to
be relatively simple. Males of Marilia bola have the eyes
holoptic (almost touching the vertex) and a tuft of long setae
on the anal lobe of the hind wing, whereas males of M. fusca
have the eyes dichoptic (not approximated) and lack the tuft
of setae on the wing. The female of M. bola was described
and illustrated, but not the female of M. fusca. Neboiss, 1n
describing the Tasmanian M. aenigmata, gave a small table of
comparison of features of all three species, noting that M.
aenigmata exceeds M. bola in size and, in comparison with
M. bola, lacks Fork 3 in the female forewing and has hindwing
Fork 1 sessile, not stalked (petiolate).
Confusing any simple separation of species, however, in
preliminary studies on Australian Marilia specimens in the
considerable Museums Victoria collection, Brian Armitage
(in 1990) recognised two major sets among Marilia specimens
from sites along the length of the Great Dividing Range, from
central Victoria to far north-eastern Queensland, and labelled
Specimens accordingly. He designated these Marilia Sp. A
and Marilia Sp. B, based mainly on wing features. In several
samples from a single site, he recognised both forms. Males
of both sets have the compound eyes holoptic and, 1n their
genitalic features, exhibit no clearly consistent differences.
Females are inseparable on genitalic features. Both sexes of
Marilia Sp. B have Fork | in the hind wing petiolate, and the
associated females have forewing Fork 3 present. Thus,
Marilia Sp. B could be Marilia bola.
102
Armitage’s Sp. A has Fork 1 in the hindwing sessile and the
associated females lack forewing Fork 3. It shares these wing
features and genitalic characteristics with M. fusca and M.
aenigmata. However, the eyes of the type specimen of M. fusca
as described by Kimmins (in the work by Mosely and Kimmins,
1953) are dichoptic; thus, Marilia sp. A 1s not conspecific with
M. fusca. Or, conceivably, it could be if the situation is as Olah
and Johanson (2010) determined for their newly described
South-East Asian species Marilia malickyi — that there 1s “[1]
ntraspecific variation in the interocular distance” (p. 74).
Armitage’s Sp. A does conform morphologically with M.
aenigmata. The body size of mainland specimens varies
considerably, with many being much smaller than the
Tasmanian specimens.
The only specimens in the available collections that
concur completely with the description of M. fusca are in
several small samples collected from streams in the
Mount Spec State Forest (to the north of Townsville in north-
east Queensland) and a stream near Tully. Surprisingly,
no dichoptic males have been identified among samples
from further south to the Sydney region or the Oxley Rivers
region of New South Wales from whence the type and
paratypes, respectively, were taken, nor further to the north
in Queensland.
None of this is particularly satisfactory and does not
corroborate the equally unsatisfactory preliminary results
from the limited patchy and geographically scattered COl
data from adults and larvae that are available on the
Biodiversity of Life Database (BOLD; http://www.
boldsystems.org). The BOLD data suggest there are at least
eight species of Marilia in Australia, most with large genetic
distances of at least 10% between them. This is apparent from
the very limited number of specimens available for genetic
analysis. More collecting and analysis will probably reveal
further species. Three specimens from north-east Queensland,
from localities from which specimens identified by Armitage
as sp. B were collected, have venation that differs from both
M. aenigmata and M. bola.
similarly puzzling 1s the available information on larvae
of Australian species of Marilia. Larvae and pupae from the
Yarra River at Reefton, Victoria, were described by
Drecktrah (1990) as those of M. fusca. He gave no indication
of how the identification was made, and it 1s impossible to be
certain from the anterior view if the pupal head illustrated by
Drecktrah would have emerged as female or male, holoptic or
dichoptic. It now seems very unlikely that the larvae
described by Drecktrah are M. fusca. In 2004, Dean et al.
published a key for discrimination of late instar larvae of
Barynema and Marilia, and separation of three species of
Marilia, identified as M. bola, M. fusca and M. aenigmata;
photographic images are given to illustrate diagnostic
features used in the key. Marilia fusca and M. aenigmata
were separated in the key simply by geography, and the
authors comment that their larvae are similar and may
eventually be found to be the same species. In recent
collecting of Marilia larvae from New South Wales and
Queensland, St Clair (unpublished) has noticed further small
differences. Identification of larvae of Marilia species 1s
A. Wells & R.M. St Clair
therefore not possible until larvae can be associated with
known adults. All available specimens can be assigned to
two larval types that align with the names given by Dean et
al. (2004). These are probably better labelled “Marilia larval
sp. 1" (was bola) and “Marilia larval sp. 2” (was fusca) since
such confusion is now recognised. Further studies involving
association of adults and close morphological examination of
larvae are required.
Marilia fusca 1s a junior secondary homonym of the name
Anisocentropus fuscus Banks, 1905 (synonymised with
Marilia flexuosa Ulmer, 1905, by Betten, 1934), so here we
select a replacement name.
Overall this 1s a confusing mix, probably only solved by a
thorough and comprehensive combined morphological and
molecular phylogenetic study. For the present, it 1s not possible
to assign Australian specimens of Marilia to species. Thus,
we can offer no further insight into Australian Marilia. The
late Arturs Neboiss would understand.
Material and Methods
Most of the material studied is in the collection of Museums
Victoria, Melbourne (NMV) and bears the standard NMV
registration number. Genitalic specimens that were
macerated and cleared by Neboiss are tagged with PT-
numbers and several others have WTH (Wet ‘Tropics
Heritage) numbers or BOLD identifications. A small number
of specimens are in the Australian National Insect Collection
(ANIC), Canberra, or will be lodged in the Queensland
Museum (QM). Images of types in the Natural History
Museum, London (BMNH) were provided by Dr Ben Price.
Other images were taken at ANIC by AW and were prepared
using a stereomicroscope linked to a Leica Application Suite
(version 4.2) to integrate multiple images; some of the images
are of cleared, others of intact, specimens. Plates were
prepared in Adobe Photoshop (version 12).
The terms applied to wings follow Mosely and Kimmins
(1953), and the terms applied to genitalic structures follow
Yang et al. (2017), save for structures that 1n ventral view
appear beside the phallus, for which we follow Mosely and
Kimmins in using the term “upper penis cover’. This latter
structure could represent tergite X or the phallobase, but it
appears to arise further ventrad than one would expect for the
former and to be independent of the phallus, so probably is
not homologous with the latter.
Taxonomy
Marilia Miller
Marilia fusca Kimmins (in the work by Mosely and Kimmins),
1953: 167, fig. 112.
Marilia disjuncta nom. nov., new replacement name for Marilia
fusca Kimmins, preoccupied by Anisocentropus fuscus Banks, 1905,
a junior synonym of Marilia flexuosa Ulmer, 1905.
Australian Odontoceridae reviewed
Barynema Banks
Figures 1—35
Barynema Banks 1939: 483, type species: Barynema costatum
Banks, 1939 by monotypy.
In their treatment of the Australian endemic genus Barynema,
Mosely and Kimmins (1953) discussed its early placement in
the family Calamoceratidae and their rationale for transferring
the genus to the family Odontoceridae on the grounds that
Barynema lacks the median cell in the forewing. Adults of
Barynema species are distinguished from Australian
representatives of Marilia by having a pair of setose warts on
the mesoscutum, whereas Marilia has two rows of setae;
males of many specimens of Marilia have holoptic compound
eyes, not seen in any Barynema. Two species of Barynema —
B. australicum Mosely, 1953, and B. goomburra sp. nov. —
also have a pair of setate warts posteriorly on the
mesoscutellum, a characteristic that appears to be absent in
all other Odontoceridae. This could be considered a
distinguishing feature at the genus level but given the very
close similarity of other male and female features of species
assigned to Barynema, we believe all eight species are
appropriately referred to a single genus. Similar variation in
presence and absence of mesoscutal and mesoscutellar setal
warts and their arrangement is seen in the closely related
Philorheithridae (Neboiss, 1977).
In the inferior appendages of the males of some species of
Barynema (e.g. B. costatum and B. australicum), the harpago
appears to be fused with the coxopodite (or lost?). In other
species, a rather similar structure (when viewed laterally)
appears to be simply an extension of the coxopodite that 1s
probably homologous with the structure termed
"subapicodorsal lobe of an inferior appendage” by Yang et al.
(2017, p. 88). The socketed harpago forms a smaller, but
morphologically similar, structure (e.g. B. lobatum sp. nov.)
or is reduced to a small triangular (B. dilatum sp. nov.) or
subquadrate (B. dolabratum sp. nov.) lobe laterad of the
extended coxopodite; it usually bears an area of short peg-like
black setae. A similar situation appears to occur in the east
Asian species Psilotreta malickyi Oláh and Johanson, 2010,
although in that species the reduced harpago is a mesal
structure. In females of Barynema, the apical lobes are stout
structures on abdominal segment X, while in Marilia they are
absent or fused with tergite X.
Here, new records and images are given for each of the
two established species of Barynema: B. costatum from
Victoria and B. australicum from north-eastern New South
Wales. Thoracic and female genitalic features are described
and illustrated for these species. In addition, six new species
are described, based on male and female thoracic and
cenitalic features, and a key is provided for the genus. The
genus has been collected along the Great Dividing Range of
eastern Australia but has not been recorded further west; in
the south, the genus 1s not recorded from west of the central
ranges of Victoria or from Tasmania. Genetic data from
BOLD suggest that additional species are present in Australia.
Larvae of a few species can be associated with the adult
103
using the COI barcode. The larvae show subtle differences
that may enable species separation, but this 1s best left until
more species are associated. The larval and pupal descriptions
of Barynema costatum by Cartwright and Dean (1987) may
not be that species and may not be adequate to separate larvae
of related species.
Key to males of Barynema Banks.
l. Mesoscutellum subcircular to rectangular, bearing small
paired setate warts separate from each other and close to
posterior margin (figs 29, 33) 2
- Mesoscutellum ovoid, with large paired setate warts
fused and covering most of mesoscutellum (fig. 5) 3
2. Inferior appendages, each with harpago in ventral view
bearing abbreviated area of short stout black peg-like
setae subapicomesally; coxopodite with short mesal lobe
bearing similar, but tapered, setae (fig. 32) l..
B. australicum Mosely
- Inferior appendages, each with harpago in ventral view
bearing elongate area of short stout black peg-like setae
subapicomesally; coxopodite without mesal lobe (fig. 35)
B. goomburra sp. nov.
3. Inferior appendages, each with brush of short, stout black
setae on harpago subapicomesal, elongate, extending
along distal half of mesal margin (figs 3, 6) oon
B. costatum Banks
- Inferior appendages, each with brush of short stout black
setae on harpago apical and rounded, not elongate (figs 9,
13, 18, 21, 25) 4
4. Lobes of upper penis cover in ventral view expanded
apicolaterally (figs 21, 25) 5
- Lobes of upper penis cover in ventral view tapered,
acuminate to rounded apically, but not expanded
apicolaterally (figs 9, 13, 15, 18) 6
5. Apicolateral lobes of upper penis cover in ventral view
rounded (fig. 21) B. dilatum sp. nov.
- Apicolateral lobes of upper penis cover in ventral view
sharply triangular, pick-shaped (fig. 25) oe
B. dolabratum sp. nov.
6. Inferior appendages, each with coxopodite in ventral
view about 2 times as long as wide (figs 13, 15)
B. lorien sp. nov.
- [nferior appendages each with coxopodite in ventral view
subquadrate (figs 9, 18) 7
7. Coxopodites in ventral view, each with mesal margin
rounded (fig. 18) B. lobatum sp. nov.
- Coxopodites in ventral view, each with mesal margin
angled obliquely from base (fig. 9) . B. paradoxum sp. nov.
104
Barynema costatum Banks
Figures 1, 3—8
Barynema costatum Banks, 1939: 484, figs 43, 51, 54.
Material examined. Holotype. male, Victoria, Mount Donna Buang,
6—7 December, Darlington (ANIC, ex CZM, dry on a pin). Victoria: 1
male (dissected), Cement Creek near Warburton, 4.x1.1972, P. Zwick
(NMV Tri-26514, PT-1389). Victoria: 1 adult female, same data
(NMV Tri-26517, PT 1890); 1 male (pharate adult, dissected), small
trib. Snobs Creek, Snobs Road crossing bridge, 11.6 km u/s Eildon
Road, 31.x.1981, J. Dean (NMV Tri-26506); 1 female (reared), Back
Creek, 1 km NE of Noorinbee, 13.x.1982, A. Bolton, reared (NMV
Tr1-26518).
Diagnosis. Males, when freshly caught or dried, have on the
black forewing a band of white and golden hairs angled across
the wing at about 3/5 length and a streak of golden scales and
hairs between Al and Cu2; on the inferior appendages, a rather
elongate hairbrush-like cluster of short and blunt black setae
line the inner subapical or apical region of the harpago, features
that distinguish them from B. paradoxum sp. nov. with similar
black wings, but with the distal band of hair on the forewing
wing only slightly curved and the harpago with a rounded
cluster of short black setae apically; in ventral view, the basal
section of the coxopodite is broadly subrectangular in B.
costatum, but more rounded in B. paradoxum, and the upper
penis cover with each lobe expanded laterally toward the apex,
rather than tapered or rounded.
Description (revised after Mosely and Kimmins, 1953).
Mesothorax with scutellum subquadrate, without
mesoscutellar setate warts.
Male. Body and wings (figs 1, 3, 4) black, forewings each
with gold band along proximal section of Al and white band
across vein anastomoses at about 3/5 wing length; length of
each forewing 9.5 mm (n = 1). Mesoscutellum ovoid, without
setate warts. Abdominal sternite VII bearing median
subquadrate lobe. Genitalia: Pre-anal appendages in dorsal
view stoutly conical, about length of inferior appendages; upper
penis cover elongate, wrapped lateroventrad of phallus, flared
and widest towards apex; inferior appendages in ventral view
with coxopodite stout, subquadrate basally; harpago in ventral
view slender, with elongate apicomesal brush of sharp, stout
black setae lining distal half, giving hairbrush-like appearance.
Female. Terminalia: Distal abdomen bearing pair of short,
stout, apically truncate apical lobes; striated plates ventrally
on segment IX.
Distribution. Found in central and eastern Victoria.
Remarks. Very few specimens of B. costatum have been
collected — many of the specimens previously identified as B.
costatum are assigned here to the new species Barynema
paradoxum sp. nov. BOLD data groups the two, with only a
short distance between them. One of the few confirmed B.
costatum specimens 1s a pharate pupa from a tributary of Snobs
Creek on the north-western edge of the Great Dividing Range
in central Victoria, images of which are included here (figs
5—8), particularly to show the form of the mesoscutellum that is
obscured by the pin on the dried type.
A. Wells & R.M. St Clair
Barynema paradoxum sp. nov.
http://zoobank.org/urn:lsid:zoobank.org:act:62A5E978-BCFE-
49A3-829D-4FO8FB542881
Figures 2, 9-12
Material examined. Holotype. male, New South Wales, 8 km N of
Nowra, 21.x.1966, N.D. (NMV Tri-27118, P'T-1646).
Paratypes. New South Wales: 2 males, data as for holotype,
21.x.1966, N.D. (NMV Tri-27113); 4 males, data as for holotype,
21.x.1966, N.D. (NMV Tri-27115); 1 male, Minnamurra Falls, N of
Kiama, 25.111.1973, A. Neboiss (NMV Tri-27114); 2 males, Mumbulla
Creek, near Bega, 20.x1.1978, I. Campbell (NMV Tri-27110); 3 males,
| female, Minnamurra Falls, 22.x.1982, G. Theischinger (NMV Tri-
27139); 2 males, Bundanoon, 34° 39' S 150° 18' E, 1x.1983, G.
Theischinger (NMV Tri-27137).
Other material. New South Wales: 1 male [pinned], Brown
Mountain, 2.x11.1956, E.F. Riek (ANIC); 2 males [pinned], Macquarie
Falls, 14.1x.1960, D.H. Colless (ANIC); 3 males [pinned], upper
Kangaroo Valley, 24.1x.1960, E.F. Riek (ANIC); 1 male, eastern Fall,
Clyde Mountain, 26.x.1960, E.F. Riek (ANIC); 2 males, 1 female,
Minnamurra Falls, 23.x.1962, D.K. McAlpine (NMV Tri-27062; 2
males, 1 female, Minnamurra Falls (NMV TRI-27062); 1 male, 1
female, New South Wales, Macquarie Pass, 13x.1986, "G. Thei. & L.
Mu." [G. Theischinger and L. Muller] (NMV Tri-27133); 1 male, New
South Wales, Macquarie Rivulet, W of Shell Harbour, 34° 34' S
150° 41' E. 4.1.1990, G. Theischinger (NMV Tri-27134); 1 male, same
data (NMV Tri-27070); 1 male, Bundanoon, Fairy Bower, 35° 39' S
150° 18' E, 1x.1991, G. Theischinger (NMV Tri-27135); 2 male, same
data (NMV TRI-27137); 1 male, same data (NMV TRI-27138); 1
female, New South Wales, Yadboro Creek, Budawang Range, 40 km
SW of Nowra, 35° 22' S 150° 03' E, x1.1991, G. Theischinger (NMV
1r1-27136); 1 female, Yadboro Creek, Budawang Range, 40 km SW of
Nowra, x1.1991, G Theischinger, 35° 22' S 150° 03' E (NMV TRI-
27136); 1 male, South East Forests National Park, trail near Monaro
Highway, malaise in Hopping Joe Creek, 37° 12' 58" S 149° 18' 37" E,
5.x11.2004—12.1.2005, C. Lambkin, N. Starick (ANIC); 16 males 1
female, East Boyd State Forest, Anteaters Road, 55 km SE Bombala
Forest, 37? 12' 18" S 149? 42' 24" E, 6.x11.2004—-12.1.2005, C. Lambkin,
N. Starick (ANIC); 1 male, New South Wales, Polblue Creek,
Barrington Tops Forest Road, 31° 57' S 151° 26' E, 2.x11.2007, A.
Glaister, J. Dean and R. St Clair (NMV Tri-54560); 1 male, tributary
of Macquarie Rivulet off Clover Hill Road, 29.1x.2017, Z. Billingham
(NMV Ento 2018-246, JOS-424); 1 male, Minnamurra Creek, off
Minnamurra Rainforest Walk, 3.x.2017, Z. Billingham (NMV Ento
2018-246, JOS-423); 13 males, 1 female, Budawang National Park,
Mount Budawang Road, 35.4563 S 149.4455 E, 16.1.2019, K.M.
Bayliss, J. Lumbers and D.K. Yeates (ANIC). Victoria: Coopracambra
National Park, malaise trap over Beeline Creek, 27 km NNE of Cann
River, 5.x11.2004—12.1.2005, C. Lambkin, N. Starick (ANIC).
Diagnosis. Males of Barynema paradoxum resemble those of
B. costatum in having distinctive black wings with a median
white band across the area of vein anastomoses and a band of
bright yellow hairs between veins Cu2 and Al. But in B.
paradoxum, the white band 1s slightly curved, not angled, and
the area of golden setae is smaller. Like B. costatum, B.
paradoxum shares with B. dilatum sp. nov., B. lorien sp. nov.
and B. dolabratum sp. nov. the absence of setate warts on the
mesoscutellum and, as with those three species, the male of
this new species has a rounded club of short, stout black setae
apically on the distal extremity of each inferior appendage, not
an elongate brush as in B. costatum. Together with B. lorien
Australian Odontoceridae reviewed 105
t
LI »
"s i
EI is ^
Figures 1—8, Barynema species. 1, 3, 4, Barynema costatum Banks holotype male: 1, body and wings, dorsal; 3, 4, genitalia, ventral and lateral,
respectively. 2, B. paradoxum sp. nov., New South Wales, Upper Kangaroo Valley, body and wings, dorsal; 5-8, B. costatum, male, Victoria,
tributary of Snobs Creek (NMV TRI-27406): 5, mesothorax, dorsal; 6—8, genitalia, ventral, lateral, and dorsal, respectively.
Abbreviations: cox. = coxopodite; har. = harpago; ph. = phallus; pre. app. = pre-anal appendages; up. p. = upper penis cover.
106
and B. lobatum sp. nov., B. paradoxum has the ventrolateral
lobes of the upper penis cover tapered apically, rather than
expanded. Barynema paradoxum is characterised by the
coxopodite of each male inferior appendage subquadrate, not
longer than wide in ventral view and not produced to form a
rounded lobe at its apicomesal angle.
ore. app.
10
har.
COX.
A. Wells & R.M. St Clair
Description. Mesothorax without mesoscutellar setate warts.
Body and wings black, each forewing with slightly curved band
of white setae across vein anastomoses.
Male. Length of each forewing 6.2-9.7 mm (n = 10).
Abdominal segment VII bearing small, sharp, sclerotised
median spur. Genitalia: Pre-anal appendages stout, apices
pre.app. 1l
Figures 9-17, Barynema species. 9-12, B. paradoxum sp. nov., holotype, New South Wales, Nowra (NMV TRI 27118, PT-1646): 9-11, male
genitalia, ventral, lateral, and dorsal, respectively; 12, female, New South Wales, Yadboro Creek, Budawang Range, 40 km SW of Nowra (NMV
T RI-27136) terminalia, ventral. 13—17, B. lorien sp. nov.: 13, 14, holotype male, New South Wales, Lansdowne via Taree (NMV TRI-27061, PT-
1564), genitalia ventral and lateral, respectively; 15, 16, paratype male, Queensland, Lamington National Park (NMV TRI-27061), genitalia,
ventral and lateral, respectively; 17, paratype female (NMV TRI-27061), terminalia, ventral.
Abbreviations: api. lob. = apical lobe; cox. = coxopodite; har. = harpago; ph., phallus; pre. app. = pre-anal appendages; up. p. = upper penis cover.
Australian Odontoceridae reviewed
narrowly rounded in dorsal view; lobes of upper penis cover
in ventral view tapered to acuminate apices; inferior
appendages, each with coxopodite in ventral view stout,
subquadrate basally, harpago about length of coxopodite,
Slender with a cluster of short, bristle-like dark setae on
rounded club-shaped apex.
Female. Length of each forewing 9.0 mm (n = 1).
Terminalia: Distal abdomen bearing pair of short apical lobes,
stout basally, rounded laterally and tapered to rounded apices;
striated plates ventrally on segment IX.
Distribution. Widespread in eastern New South Wales,
extending into far eastern Victoria, possibly overlapping with
B. costatum.
Etymology. Named for the past confusion over this species, and
the paradox presented by the variability in male genitalic
structures. Most specimens were identified previously as
b. costatum.
Barynema lorien sp. nov.
http://zoobank.org/urn:lsid:zoobank.org:act: E8CB61 BO-BA99-
4CC9-8A92-E94F3037EISD
Figures 13-17
Material examined. Holotype. male, New South Wales, Lansdowne
via Taree, 29.1x.1985, G.W. Williams (NMV TRI-27071, PT-1564)
Paratypes. Queensland: 2 males, 1 female, [Lamington| National
Park, 1.x1.1954, T.E Woodward (NMV TRI-27060); 1 male,
Lamington National Park, 15.x1.1955, Yeo (NMV TRI-27069); 1 male
(reared from pupa), Tamborine Mountain, 111.1962, K. Korboot (NMV
TRI-27068); 1 female (reared from pupa), same data (NMV TRI-
27067); 3 males, | female, Lamington National Park, x1.1982, T.
Hinger (NMV TRI-27061); 1 male, Lamington National Park, x1.1982,
G. Theischinger (NMV TRI-27065).
Other material. New South Wales: 1 male 1 female, Wentworth
Falls, 22.x1.1960, C.N. Smithers (NMV TRI-27059); 1 male, same
data (NMV TRI-27070); 1 male, [Barrington Tops State Forest],
Manning River, Pheasant Creek Road, 3.x11.2007, A. Glaister, J. Dean
and R. St Clair (NMV TRI-54568, JOS-237).
Diagnosis. Resembling B. paradoxum, B. costatum, and
B. lobatum sp. nov. in having males with the pre-anal
appendages stout, apically rounded. The male differs from
that of B. costatum in having each inferior appendage
terminating in a small rounded area of short black setae, not
an elongate brush. It is distinguished from B. costatum by
having the lobes of the upper penis cover in ventral view
acute apically, not flared distally as in B. costatum, and 1s
distinguished from B. paradoxum by having the basal region
of each inferior appendage subrectangular, not subquadrate,
and from B. lobatum sp. nov. which has the mesal angle more
strongly produced, rounded. Females resemble those of
B. lobatum, having the apical lobes short, stout, and stepped
(obliquely truncate).
Description. Mesothorax without mesoscutellar setate warts.
Male. Length of each forewing 6.8-7.5 mm (n = 4).
Abdomen with small sharply pointed spur medially on
sternite VII. Genitalia: Pre-anal appendages stout, rounded
apically. Upper penis cover forming pair of elongate lobes of
107
more or less uniform width for most of length, tapered
slightly to apex. Inferior appendages each with coxopodite
basally long, subrectangular to ovoid in ventral view, without
any tufts of setae or mesal lobes, harpago slender at base,
slightly dilated distally, with round pad of short, stout black
setae apically.
Female. Length of each forewing 8.3—9.6 mm (n = 3).
lerminalia: Apical lobes, slightly stepped toward rounded
apices.
Distribution. Found from eastern New South Wales, from the
Blue Mountains to the west of Sydney to south-eastern
Queensland.
Etymology. Named after the Lorien Wildlife Refuge and
Conservation Area near Lansdowne, New South Wales.
Barynema lobatum sp. nov.
http://zoobank.org/urn:Isid:zoobank.org:act:5985 E223-FCó65$-
48BA4-A1C4-19D51 BDS5E0C2
Figures 18—20
Material examined. Holotype. male, Queensland, Montville, Bon
Accord Falls, 27.1x.1955, A.N. Burns (NMV Tri-27064).
Paratypes. Queensland: 3 male, 1 female, Montville, Bon Accord
Falls, 29.1x.1955 A. N. Burns (NMV TRI-27063); 1 male, same data
(NMV '11-27066); 1 male, south-east Queensland, Stony Creek,
Conondale Range, 10.vii1.1988, S. Bunn (NMV Tri-27120).
Diagnosis. In most features, 5. lobatum sp. nov. resembles B.
lorien sp. nov. but alone among congeners, this species has the
apicomesal angle of the otherwise subquadrate coxopodite of
the inferior appendages produced and rounded distally; the
pre-anal appendages are tapered distally, and a small rounded
mesal process occurs on sternite VII. The female is
indistinguishable from those of B. lorien, both having stepped
(obliquely truncate) apical lobes.
Description. Thorax with mesoscutellum almost subquadrate,
pale, margin dark, lacking setate warts.
Male. Length of each forewing 5.2-7.2 mm (n = 5).
Sternite VII with small, apically rounded median tab.
Genitalia: Pre-anal appendages stout in dorsal view, tapered
to rounded apices, in lateral view almost same width
throughout, apically rounded. Lobes of upper penis cover in
ventral view constricted distally to form sharp tips, in lateral
view stout, rounded apically. Inferior appendages each with
coxopodite in ventral view stout, apicomesal angle slightly
produced, rounded; harpago narrow near base, cluster of
short, dark, bristle-like setae apically.
Female. Length of each forewing 8.6 mm (n = l).
Terminalia: Distal abdomen bearing pair of apical lobes, stout
basally, narrowed laterally, and produced to rounded apex.
Distribution. Known only from north of Brisbane in the
Sunshine Coast region of south-eastern Queensland.
Etymology. Named for the expanded apicomesal angles of the
inferior appendages.
108 A. Wells & R.M. St Clair
pre. app.
ir
E
LO
d. lob.
pre. app.
har.
| d. lob.
m v- 7 Pa
7 "
-s A p. -.
Figures 18-26, Barynema species. 18-20, B. lobatum sp. nov.: 18, holotype male, Queensland, Montville, 27.1x.1955, (NMV Tri-27064), genitalia
ventral; 19, paratype male (NMV 27120), lateral; 20, paratype female (NMV TRI-27063) terminalia, ventral. 21—24, B. dilatum sp. nov.: 21—23,
holotype, male (NMV WTH-2966, PT-2033) genitalia ventral, lateral, and dorsal, respectively; 24, paratype female (Python Creek NMV),
terminalia, ventral. 25, 26, B. dolabratum sp. nov. holotype male, (Oliver Creek NMV), genitalia, ventral and lateral, respectively.
Abbreviations: api. lob. = apical lobe; d. lob. = dorsal lobe of inferior appendages; har. = harpago; ph. = phallus; pre. app. = pre-anal appendages;
up. p. = upper penis cover.
Australian Odontoceridae reviewed
Barynema dilatum sp. nov.
http://zoobank.org/urn:lsid:zoobank.org:act:26539E9C-AFA3-
4F1B-BD16-B4C2F76A38E8
Figures 21—24
Material examined. Holotype. male, north Queensland, Carron Creek,
Kirrama State Forest, April 1993, G. Theischinger, 18° 06'S 145° 41' E
(NMV WTH-2966 PT-2033).
Paratypes. North Queensland: 5 males, Carron Creek, Kirrama
State For., 17° 50' S 145° 35' E, April 1993 (NMV WTH-1171); 5
males, same data (NMV WTH-1174); 5 males, same data (NMV
WTH-1172); 5 males, same data (NMV WTH-1173); 5 males, same
data (NMV WTH-1174); 5 males, same data (NMV WTH-1175); 5
males, same data (NMV WTH-1176); 3 males, same data (NMV
WTH-1345); 7 males, north Queensland, Goodard Creek, Kirrama
state Forest, April 1993, G. Theischinger, 18° 06' 5 145° 41' E(NMV
WTH-1040); 7 males, same data (NMV WTH-1041); 17 males, 6
females, stream on Tully Gorge Road, 6.7 km d's of power station, M.
Shackleton and J. Mynott, 8.v.2011 (NMV Tri-54556).
Other material. North Queensland: 3 females, upper Mulgrave
River via Gordonvale, 29-30 April 1970, S.R. Curtis (NMV WTH-
0786); 5 male, same data (WTH-2654); 1 female, Lock-Davies Creek
Road, Lamb Range, Mareeba District, 10 November 1974, M.S.
Moulds (WTH-0437 PT-2028); 1 female, upper Freshwater Creek,
Whitfield Range, Cairns, 24 August 1974, MV-light, MS Moulds
(WTH-0615); 1 male, same data (NMV WTH-0603); 1 male, same
data (NMV WTH-0604); 1 male, upper Freshwater Creek, Whitfield
Range, near Cairns, 15 December 1974, MS Moulds (NMV WTH-
0606); 1 male, 1 male, same data (NMV WTH-0605); 1 male, same
data (NMV WTH-0607); 2 females, same data (NMV WTH-06014); 1
male, the Crater, near Herberton, 18 December 1974, M.S. Moulds
(NMV WTH-0602); 1 female, Mareeba, Davies Creek Road, 21
January 1976, Waltord-Huggins (NMV WTH-0616); 1 male, State
Forest, 24 km along Goldsborough Road near Gordonvale, 27.x11.1980,
M.S. and B.J. Moulds (NMV WTH-1350); 1 male, Behana Gorge,
Cairns, 16 November 1982, T. Hinger, 17° 11' S 145° 50' E (NMV
WTH-0608); 2 females, same data (NMV WTH-0609); 1 male,
Mossman Gorge, Daintree National Park, 17 November 1988, MV It,
K. Walker (NMV WTH-0595); 1 male, river on Lake Morris Road,
Cairns, 3.v.2011, 16.9412 145.71762 (NMV EPAVTI22); 2 males, 5
females, river on Lake Morris Road, Cairns, 16.9412 145.71762,
3.v.2011, J. Mynott and M. Shackleton (NMV Tri-54557); 1 male,
small creek beside Josephine Falls, M. Shackleton and J. Mynott,
6.v.2011 (NMV Tri-54559); 1 male, 1 female, Josephine Falls, 17.4338
145.8630, Shackleton and Mynott 110506-7, 6.v.2011 (NMV Tri-
54558); 3 males, Dunn? Creek at Bridge 11, Kirrama Range Rd, ~14
km from national park sign, —18.2138 S 145.7982 E, 24.x.2017, D.
Cartwright and R. St Clair; 1 male, Mulgrave Road, Goldsborough
Valley Campsite, Wooroornoonan National Park, 17.2374 S
145.7733 E, 26.x.2017 (NMV JOS 451); 1 male, Python Creek in Tully
Gorge Road, ~52 km NW of Tully, 17.76628 145.5895E, 2 November
2017, D. Cartwright and R. St Clair (QM JOS-448).
Diagnosis. The male of Barynema dilatum closely resembles
that of B. dolabratum sp. nov. 1n having the inferior appendages
each with the harpago reduced to a small apically setose ventral
lobe and the coxopodite in lateral view produced and curved
ventrad distally. In B. dolabratum, the upper penis cover in
ventral view appears to form two lobes apically, with the
ventral lobe expanded and rounded laterally, in contrast with B.
dolabratum, which has the upper penis cover in ventral view
pick-shaped apically.
109
Description. Mesothorax with mesoscutellum shield-shaped,
without setate warts; fresh adult males with body and wings
dark except white area at anastomosis on wings.
Male. Length of each forewing 9.3—10.3 mm (n = 10).
sternite VII without median tab or spur. Genitalia: Pre-anal
appendages in dorsal view broadest at about midpoint,
constricted towards base. Upper penis cover distally bilobed,
dorsal lobe tapered apically in ventral view, rounded in
lateral view, ventral lobe expanded and rounded laterally
towards apex. Inferior appendages each with coxopodite base
short, stout, produced to form a dorsal lobe with slender neck
before slightly dilated apex bearing short stubby black setae,
harpago short, rod-shaped, bearing dense brush of short
black setae apically.
Female. Length of each forewing 11.8—17.7 mm (n = 10).
Terminalia: Apical lobes conical, tapered to darkly sclerotised
apices.
Distribution. From north-eastern Queensland, west of Tully to
the Cairns district.
Etymology. The name is derived from the Latin dilato, to
extend, for the lateral swellings on the upper penis cover lobes.
Barynema dolabratum sp. nov.
http://zoobank.org/urn:|sid:zoobank.org:act:/OCBASA9-B547-
4657-9FF7-F5D89A A BE20E
Figures 25, 26
Material examined. Holotype. male, north Queensland, Gap Creek,
10.11.1982, M.S. Moulds (NMV W'TH-0599, P'T-1176).
Paratypes. North Queensland: 1 male, Gap Creek, Mount
Finlayson Range, S of Cooktown, 25 November 1974, M.S. Moulds
(NMV WTH-00601); 1 male, Gap Creek, 10 February 1982, M.S.
Moulds (NMV WTH-0600); 1 male, Oliver Creek on Bloomfield
Road, 8 km S of Cape Tribulation, 16.1377 S 145.4408 E, 29.x.2017, D.
Cartwright and R. St Clair (QM); 1 male, data as above, D. Cartwright
and R. St Clair, NMV (JOS-452).
Diagnosis. This species, known only from males, closely
resembles that of B. dilatum, but 1s distinguished by the slightly
smaller body, darker body, mesoscutal setate warts elongate-
ovoid, and the sharp, pick-shaped form of the upper penis cover
lobes in ventral view.
Description. Mesothorax with mesoscutellum shield shaped,
without setate warts.
Male. Length of each forewing 9.0—10.6 mm (n = 5). Small
white area around lower part of wing at anastomosis. Sternite
VII without median spur or tab. Genitalia: Pre-anal
appendages stout, apically rounded in ventral view. Upper
penis cover lobes produced distally, pick-shaped apicolaterally
in ventral view, in lateral view triangular apico-dorsally.
Inferior appendages each with coxopodite broad at base, 1n
lateral view produced in slender, curved dorsal lobe bearing
cluster of stubby black setae apically; harpago forming short
apically truncate lobe bearing stout peg-like black setae at tip.
Female. Unknown.
Distribution. Collected from Cape York, Queensland, from the
two sites to the north of Cairns and south of Cooktown.
110
Etymology. From the Latin dolabratus, meaning pick-shaped
for the appearance of the upper penis cover lobes.
Barynema australicum Mosely
Barynema australicum Mosely, in Mosely and Kimmins, 1953:
162, figs 108, 109.
Figures 27—32
Material examined. Holotype. male, New South Wales, Ebor, 5.1.1916,
R.J. Tillyard, (BMNH) [head and abdomen mounted in balsam,
images courtesy B. Price, BMNH]
New South Wales: 1 female, Wilson River Reserve near Bellangry,
5.x11.1986, G. Theischinger (NMV TRI-26493); 1 male, Coomboodja
Creek, Washford National Park, 29° 16' S 152° 22' E, 5.1.1986,
Theischinger (NMV Tri-27119, P1-1655); 2 females, same data (NMV
Tri- 27116); 1 male ,1 female, “Cockerawo... Creek", 23 km WNN
Bellangry, 8.x11.1986, 730 m, G. Theischinger (NMV TRI-26505); 19
males 1 female, Orara West State Forest, Tuckers Knob, 29° 41' S
152° 48' E, 27.x1.1990, G. Theischinger (NMV TRI-27117); 1 male,
Manning River, Pheasant Creek Road, A. Glaister, J. Dean and R. St Clair,
3.x11.2007, 31° 53' S 151° 29' E (NMV TRI-54569, JOS-238); 1 male,
Never Never River, Whitneys Road, —30.33001S 152.86222E, 10.
x1.2010, 10110-5, MS 747 [M. Shackleton] (NMV TRI-54570, JOS- 108).
Diagnosis. Distinguished from most other species of Barynema
by having a pair of setate warts on the mesoscutellum, a feature
shared with B. goomburra sp. nov., from which it differs by
having male genitalia in ventral view with the coxopodite of
each inferior appendage subquadrate, and in both ventral and
lateral views the harpago with a short, slender basal portion
before the swollen terminal section that bears a broader
hairbrush-shaped area of short blunt black setae, rather than an
elongate toothbrush-shaped region as in B. goomburra sp. nov.
Description. Male. Length of each forewing 6.4—7.8 mm (n =
10). Sternite VII bearing apically rounded median tab.
Genitalia: see Mosely and Kimmins, 1953: 162).
Female. Length of each forewing 8.4—-10 mm (n = 3).
Terminalia: Apical lobes on abdominal segment X short,
broad, almost quadrate.
Distribution. Found in north-east New South Wales, in the
Barrington Tops-Wauchope and mid north coast regions.
Remarks. Two specimens among those that have been
sequenced for the BOLD project can be referred to B.
australicum. Each appears in a different cluster on the current
BOLD ‘Taxon Identification Tree. This is due to either
contamination of the COI gene or the presence of sibling
species. Several more specimens are required before this can
be resolved. This species, together with specimens here referred
to B. dilatum sp. nov., show no presently resolvable relationships.
Barynema goomburra sp. nov.
http://zoobank.org/urn:lsid:zoobank.org:act:3BS54EDD-SAEB-
4E71-903C-DEEOAEEF26EE
Figures 33—35
Material examined. Holotype. male, Queensland, Goomburra State
Forest, NE of Warwick, 28° 03'S 152° 07' E, 20.1.1986, G. Theischinger
(NMV TRI- 27112).
A. Wells & R.M. St Clair
Paratypes. New South Wales: 1 male, 4 females, Styx River, Hyatt
Flat, 8.x11.1998, G. Theischinger (ANIC).
Diagnosis. Adults of this species closely resemble those of B.
australicum in having a pair of setose warts on the
mesoscutellum; the males of both species have a brush of short,
blunt black setae terminally on each harpago and, in lateral
view, the pre-anal appendages are broad-based and gradually
tapered distally. The male of B. goomburra 1s characterised by
having the inferior appendages narrower than those of B.
australicum and the coxopodites lacking apicomesal clusters of
setae that are present in B. australicum. The male of B.
goomburra resembles that of B. costatum with the harpago
bearing an elongate and narrow brush of stout black setae
occupying almost its entire inner distal margin, but differs
from B. costatum in that B. goomburra has a subcircular to
rectangular mesoscutellum bearing small paired setate warts
separate from each other and close to the posterior margin,
whereas the mesoscutellum of B. costatum is ovoid and with
large paired setate warts fused and covering most of the
mesoscutellum.
Description. Mesothorax with mesoscutellum bearing pair of
setate warts close to distal margin.
Male. Length of each forewing 6.5-7.2 mm (n = 2)
Abdominal segment VII bearing stoutly rounded midventral
tab. Genitalia: Pre-anal appendages in lateral view elongate
triangular; upper penis cover in ventral view forming pair of
short, stout, apically expanded structures; inferior appendages in
ventral view each with coxopodite about equal width throughout
length, without apicomesal brush of setae, harpago not clearly
delineated, with somewhat stout, short, blunt black setae lining
entire mesal side, giving toothbrush-like appearance.
Female. Length of each forewing 8.0—9.6 mm (n = 4).
Terminalia: Apical lobes broad-based, arising close to each
other, then tapered to narrowly rounded apices.
Distribution. Collected from just north of the New South
Wales-Queensland border, and from the Styx River in the
Northern Tablelands area of New South Wales.
Remarks. No specimens recognisable as B. goomburra are among
material for which molecular (COI) data are available at present.
Etymology. Named for the holotype locality.
Acknowledgements
We thank, particularly, staff of Museums Victoria Entomology
section for making both of us welcome, for making available
their extensive odontocerid collection and for providing
laboratory space to RSC. The Australian National Insect
Collection, CSIRO, Canberra, is thanked for providing
laboratory facilities for AW. Dr Ben Price, Natural History
Museum, London, kindly supplied images of the type of
Barynema australicum.
Material from Queensland collected by Michael
Shackleton was taken under collecting permits WITKIO27111
and that collected by David Cartwright and Ros St Clair under
the Entomological Society of Queensland collecting permits
WITK15549915 and TWB/02/2015. Material from New South
Australian Odontoceridae reviewed 111
Figures 27-35, Barynema species. 27, 28, B. australicum Mosely, holotype male (BMNH): 27, genitalia, lateral (on microscope slide); 28, part
of body and wings of holotype (images, courtesy B. Price, BMNH). 29-32, B. australicum, New South Wales, Orara West State Forest (NMV-
27117): 29, male mesothorax dorsal; 30, female, terminalia ventral; 31, 32, male, genitalia, lateral and ventral, respectively. 33—35, B. goomburra
sp. nov., holotype male, Queensland, Goomburra State Forest, NE of Warwick (NMV TRI-27112): 33, mesothorax dorsal; 34, 35, genitalia lateral
and ventral, respectively.
Abbreviations: har. = harpago; mes. lob. = mesal lobe of coxopodite; pre. app. = pre-anal appendages; set. wt. = setate warts on mesoscutellum;
up. p. = upper penis cover.
112
Wales was collected by Michael Shackleton under Scientific
Research Permit PO7/0095 and National Parks Service
scientific License 512404; by Alena Glaister, Ros St Clair,
and John Dean under Scientific Research Permit PO7/0095-
1.0, and National Parks Service Scientific License S12404;
and by Zac Billingham as bycatch under National Parks
Service Scientific License SL101930.
Material from Queensland was collected under Scientific
Research Permit numbers WITK06190909 (May 2010)
and WITK10277111 (8 Nov 2011—7 Nov 2013). Material
from Victoria was collected under Scientific Research
Permits 10005961 (19 Aug 2012-31 Aug 2013).
Material from Queensland was collected under Scientific
Research Permit numbers WITK006190909 (May 2010)
and WITKIO277111 (8 Nov 2011—7 Nov 2013). Material
from Victoria was collected under Scientific Research
Permits 10005961 (19 Aug 2012-31 Aug 2013).
Material from Queensland was collected under Scientific
Research Permit numbers WITK06190909 (May 2010)
and WITKIO277111 (8 Nov 2011—7 Nov 2013). Material
from Victoria was collected under Scientific Research
Permits 10005961 (19 Aug 2012-31 Aug 2013).
References
Banks, N. 1939. Trichoptera. Bulletin of the Museum of Comparative
Zoology, Harvard 85: 439—504.
Betten, C. 1934. The caddisflies or Trichoptera of New York State. New
York State Museum Bulletin No. 292. The University of the State
of New York: Albany. 576 pp. doi.org/10.5962/bhl.title.132984
A. Wells & R.M. St Clair
Cartwright, D.C., and Dean, J.C. 1987. Descriptions of the immature
stages of Barynema costatum Banks from Australia (Trichoptera:
Odontoceridae). Aquatic Insects 9: 27-32. dol.
org/10.1080/01650428709361267
Dean, J.C., St Clair, R.M., and Cartwright, D.I. 2004. /dentification
keys to Australian families and genera of caddis-fly larvae
(Trichoptera). Identification and ecology guide. No 50.
Cooperative Research Centre for Freshwater Ecology: Albury,
NSW. 131 pp.
Drecktrah, H.G. 1990. Larval and pupal descriptions of Marilia fusca
(Trichoptera: Odontoceridae). Entomological News 101: 1-108.
doi.org/10.11646/zootaxa.1362.1.3
Mosely, M.E., and Kimmins, D.E. 1953. The Trichoptera (Caddis-flies)
of Australia and New Zealand. British Museum (Natural History):
London. 550 pp. doi.org/10.5962/bhl.title.118696
Müller, F. 1880[“1878”]. Sobre as casas construidas pelas larvas de
insectos Trichopteros da Provincia de Santa Catharina. Archivos
do Museu Nacional, Rio de Janeiro 3(1878): 99-134, 209—214.
Neboiss, A. 1977. A taxonomic and zoogeographic study of Tasmanian
caddis—flies (Insecta: Trichoptera). Memoirs of Museum Victoria
38: 1-208. doi.org/10.24199/1.mmv.1977.38.01
Neboiss, A. 2003 [72002"]|. New genera and species, and new records,
of Tasmanian Trichoptera (Insecta). Papers and Proceedings of
the Royal Society of Tasmania 136: 43—82. doi.org/10.26749/
rstpp.136.43
Olah, J., and Johanson, K.A. 2010. Description of 33 new species of
Calamoceratidae, Molannidae, Odontoceridae and
Philorheithridae (Trichoptera), with detailed presentation of their
cephalic setal warts and grooves. Zootaxa 2457: 1-128. doi.
org/10.11646/zootaxa.2457.1.1
Yang, L.-F., Yuan, H.-Y., and Morse, J.C. 2017. Lannapsyche and
Marilia species of China (Trichoptera: Odontoceridae). Zootaxa
4320(1): 81-99. doi.org/10.11646/zootaxa.4320.1.5
Memoirs of Museum Victoria 80: 113-152 (2021) Published 2021
1447-2554 (On-line)
httos://museumsvictoria.com.au/collections-research/journals/memoirs-of-museum-victoria/
DOI https://doi.org/10.24199/j.mmv.2021.80.06
New species of squat lobsters of the genus Munida from Australia
(http://zoobank.org/urn:|sid:zoobank.org:pub:EA21667A-77A5-411D-9C1A-23ECFFF3D505)
ANNA W. McCCALLUM!, SHANE T. AHYONG? AND NIKOS ANDREAKIS>
! Museums Victoria, GPO Box 666, Melbourne VIC 3001, Australia. Email: amccallum(?museum vic.gov.au
* Australian Museum Research Institute, 1 William St, Sydney NSW 2010, Australia, and School of Biological, Earth
and Environmental Sciences, University of New South Wales, Kensington NSW 2052, Australia.
Email: shane.ahyong@austmus.gov.au
* College of Science and Engineering, James Cook University, Townsville QLD 4814, Australia.
Abstract
McCallum, A.W., Ahyong, S.T. and Andreakis, N. 2021. New species of squat lobsters of the genus Munida from
Australia. Memoirs of Museum Victoria 80: 113—152.
This study reports on new squat lobsters of the genus Munida collected during recent surveys of
Australia's continental margins. We report on 33 species of Munida including seven new species and 14
new range extensions for Australia. More than 500 specimens were collected, mostly from the western
continental margin of Australia, but also including a new species from deep water (22000 m) off Tasmania.
We provide new data on the colour patterns of some species and include molecular data from two
mitochondrial markers (16S rRNA and COI) to support the taxonomic status of the new species.
Introduction
Australia has a vast marine realm, the third largest jurisdiction
in the world, encompassing tropical and temperate biomes and
connected to the highly biodiverse Indo-West Pacific region.
Over the last decade, efforts to document the biodiversity of
Australia's deep seafloor habitats have grown, as a system of
Marine National Parks were established and monitored.
sampling of Australia’s deep seafloor has revealed a high
proportion of new species and significant range extensions, but
most of these records await detailed taxonomic description.
Squat lobsters (Chirostyloidea and Galatheoidea) are
among the most diverse groups of decapod crustaceans in
deep waters, and there have been intensive efforts to describe
and revise species and higher taxa from the group
(Macpherson and Baba, 2011). This has been assisted by the
availability of taxonomic resources such as synoptic works
(e.g. Baba, 2005; Baba et al., 2008) and keys (Taylor and
Poore, 2010). In addition, molecular-based approaches are
helping to identify overlooked species that show only subtle
morphological differences (Poore and Andreakis, 2012).
Munida is one of the largest genera of squat lobsters,
currently comprising 297 species (WoRMS, 2021). The most
recent major taxonomic study of Munida in Australia
recorded 19 species (Ahyong and Poore, 2004). Additional
records have since been added (e.g. Ahyong, 2007; Baba,
2005; Poore et al., 2008); so, to date, 32 species of Munida
have been documented from Australia.
Here, we report the specimens of Munida collected during
several deep-water surveys from 2005 to 2015, including
surveys of the continental margin of Western Australia, the
Great Australian Bight, Tasmanian seamounts, and the eastern
Australian continental margins and abyss. We describe and
illustrate new species and record new occurrences of
previously described taxa. The synonymies for each species
are restricted to papers published after the compilation of
Baba et al. (2008). Where available, we include molecular
data from two mitochondrial markers (168 and COI) to
support the taxonomic status of the species.
Materials and methods
Sampling
Specimens were collected using beam trawls and epibenthic
sleds ın surveys aboard the FRV Southern Surveyor of the
south-western continental margin of Australia (SS10/2005) and
north-western continental margin (8505/2007); and surveys
aboard the RV Investigator of the Great Australian Bight
(IN2015 COI. 042) and the continental margin and abyss of
eastern Australia (IN2017 V03). A small number of specimens
were collected from south-west Tasmania (TT 01/2008) using
the remotely operated vehicle Jason aboard the RV Thomas G
Thompson. Specimens collected from well-sampled sites on
Tasmanian seamounts (SSO1/2008, SSO2/2007) were reviewed
and represent well-known species previously reported for the
area; they are not redescribed herein.
114
Morphological methods
Specimen measurements in Material examined refer to
postorbital carapace length (pcl), measured dorsally from the
base of the rostrum (situatued at the level of the orbit) to the mid-
posterior margin of the carapace, and where the rostrum 1s intact,
carapace length (cl) is measured from the rostral apex to the mid-
posterior margin of the carapace. The angle of the frontal-margin-
from-the-midline is measured as the angle of the intersection
between an imaginary line along the frontal margin and the
median axis. Thus, a transverse margin corresponds to an angle
of 90°. The lengths of articles of the cheliped are measured along
the dorsal margin and those of ambulatory legs and maxilliped 3
are measured along the extensor margin and exclude spines.
Abbreviations used are Mxp3, maxilliped 3; P1, pereopod 1; P2—
4, pereopods 2-4; M, male; F, female; ovig., ovigerous.
Specimens are deposited in the collections of Museums
Victoria, Melbourne (NMV), the Western Australian Museum
(WAM), the Australian Museum, Sydney (AM), Muséum
national d'Histoire naturelle, Paris (MNHN) and the South
Australian Museum, Adelaide (SAM). Other abbreviations: WA,
Western Australia; acq. refers to the Commonwealth Scientific
and Industrial Research Organisation (CSIRO) acquisition
number allocated to the specimen on board the vessel at the
time of collection.
Molecular analysis
Material collected from south-western Australia (SS10/2005),
being mostly preserved 1n formalin, was not sequenced.
Results
A.W. McCallum, S.T. Ahyong & N. Andreakis
Total DNA was extracted from 50-100 mg of abdominal
tissue or pereopod of the target specimen preserved in ethanol
following the salt-based extraction procedure described by
Aljanabi and Martinez (1997) with minor modifications. The
partial mitochondrial cytochrome oxidase subunit I (COI) and
165 rDNA gene (165 fragment 2) were polymerase chain reaction
(PCR) amplified following primer combinations, reaction
conditions and thermal cycling profiles established previously
(Cabezas et al., 2012). Quantity and length of the PCR products
were examined by 1% gel electrophoresis against known DNA
standards. PCR reactions were sent to Macrogen Inc. (Korea,
www.macrogen.com) for purification and direct sequencing in
both directions. | Electropherograms were assembled in
sequencher v4.9 and sequences were initially aligned in Bioedit
v7.0.9 (Hall, 1999) together with 16S and COI sequences from
previous works (Cabezas et al., 2009, 2011; Machordom and
Macpherson, 2004; Macpherson and Machordom, 2005;
Rodriguez-Flores et al., 2019). Final alignments of each of the
loci were performed using MAFFT (Katoh et al., 2002).
Uncorrected divergences (p) were calculated using MEGA 10.04
(Kumar et al., 2018). GenBank accession numbers for the new
sequences are given in Table |. We have not provided the
divergence values among all pairs of closely related species
because in the genus Munida the amount of molecular data 1s still
scarce (excluding the present paper, the sequences of only 72
species are available). Nevertheless, when the molecular data
from a new species and its morphological closest relative are
available, we have included the divergence values in the Remarks.
Table 1. Specimens studied for mitochondrial DNA sequences (COI and 165), including registration codes, survey, station, and GenBank accession numbers
Species Reg. no. 16S COI Surve
Munida agave NMV J56099 MK847949 MK848000 S5505/2007 161
Munida agave NMV J56008 MK847961 MK84s8011 5305/2007 116
Munida asprosoma NMV J56393 MK847955 MK848006 S5505/2007 155
Munida asprosoma NMV J56016 MK847971 MK848022 5505/2007 68
Munida asprosoma NMV J57258 MK847950 MK848001 S5505/2007 155
Munida babai NMV J55042 na MK848021 SS 10/2005 170
Munida distiza NMV J56487 MK847947 MK847998 5505/2007 11
Munida leeuwin sp. nov. NMV J55046 MK847968 MK848018 SS 10/2005 170
Munida leeuwin sp. nov. NMV J56100 MK847954 MK848005 5305/2007 82
Munida leeuwin sp. nov. NMV J55046 MK847967 MK848017 SS 10/2005 170
Munida gracilis NMV J55107 MK847963 MK$848013 SS 10/2005 32
Munida gracilis NMV J55107 MK847964 MK848014 SS 10/2005 32
Munida gracilis SAM C7658 MK847932 na BPZ 2010 500
Munida compressa NMV J55980 MK847946 na 5505/2007 176
Munida compressa NMV J5598 1 MK847944 MK847996 S5505/2007 189
Munida endeavourae NMV J59312 MK847934 MK847986 1101/2008 J2-390-015
Munida endeavourae NMV J59310 MK847933 na 1101/2008 J2-389-006
Munida gordoae NMV J56420 MK847957 MK848008 3305/2007 62
Munida gordoae NMV J56420 MK847956 MK848007 5505/2007 62
Munida abrolhos sp. nov. NMV J55279 MK847962 MK848012 3305/2007 70
Munida abrolhos sp. nov. NMV J55262 MK847943 MK847995 5305/2007 1
Munida leagora NMV J56018 MK847951 MK848002 SS05/2007 77
Munida leagora NMV J56004 MK847970 MK848020 S5505/2007 143
Munida leagora NMV J56004 MK847969 MK848019 S5505/2007 143
Munida leagora NMV J55999 MK847942 MK847994 5505/2007 143
Munida pectinata NMV J55268 MK847939 MK847991 S5505/2007 62
Munida philippinensis NMV J56003 MK847953 MK848004 5505/2007 143
Munida philippinensis NMV J56003 MK847952 MK848003 SS05/2007 143
Munida compacta NMV J56411 MK84794]1 MK847993 SS05/2007 57
Munida compacta NMV J56402 MK847937 MK847989 SS05/2007 15
Munida compacta NMV J56412 MK847938 MK847990 SS05/2007 56
Munida roshanei NMV J5599] MK847958 MK848009 S5505/2007 97
Munida roshanei NMV J56009 MK847960 na 5505/2007 125
Munida roshanei NMV J56400 MK847940 MK847992 5305/2007 116
Munida julumunyju sp. nov. NMV J55064 MK847966 MK848016 SS 10/2005 152
Munida julumunyju sp. nov. NMV J55979 MK847945 MK847997 S5505/2007 34
Munida heteracantha NMV J55038 MK847965 MK848015 SS 10/2005 146
Munida galalala sp. nov. WAM C78558 MK847959 MK848010 SS05/2007 156
Munida jurunjurun sp. nov. WAM C78561 MK847948 MK847999 SS05/2007 63
Munida lutruwita sp. nov. NMV J67480 MK847935 MK847987 1101/2008 J2-387-022
Munida lutruwita sp. nov. NMV J67474 MK847936 MK847988 1101/2008 J2-387-023
Australian Munida
Systematics
Munididae Ahyong, Baba, Macpherson and Poore, 2010
Munida abrolhos sp. nov.
http://zoobank.org/urn:lsid:zoobank.org:act:14DA5265-EOES5-
47B5-B4B0-93296A355921
Figures 1, 2, 3A
Munida sp. MoV 5214. — Poore et al., 2008: 21 (south-western
Australia, 201—206 m).
Munida aft. rubiesi. — Poore et al., 2008: 20 (part), unnumbered
fig. — McEnnulty et al., 2011: app. 1.
Munida sp. MoV 5526. — Poore et al., 2008: 21.
Munida keiensis. — McEnnulty et al., 2011: app. 1.
Type material. Holotype: WAM C78556, ovigerous female (cl 23 mm, pcl
14 mm), Abrolhos, Western Australia, 29° 00.594' S, 113° 42.78' E to
29° 01.512' S, 113°43.32' E, 700—704 m, SS10/2005/85, 2 December 2005.
Paratypes (all Western Australia): NMV J55036, 6 ovigerous
females (cl 18.9 mm, pcl 11.2 mm to cl 25.9 mm, pcl 15.7 mm), 6
females (cl 14.0 mm, pcl 8.1 mm to cl 19.0 mm, pcl 12.5 mm), 10 males
(cl 15.0 mm, pcl 8.9 mm to cl 22.8 mm, pcl 14.6 mmy), collected with
holotype; NMV J55262, 1 ovigerous female (cl 27.5 mm, pcl 18.3 mm),
| female (cl 14.5 mm, pcl 8.4 mm), Barrow L1 transect, 20° 59.412' S,
114° 07.896' E to 20° 59.13' S, 114? 08.394' E, 700 m, S805/2007/1, 9
June 2007; NMV J55279, 1 specimen, Mermaid L24 transect,
16° 44.286' S, 119° 15.042' E to 16? 43.794' S, 119° 15.48' E, 693—698
m, $5505/2007/70, 17 June 2007; WAM C78557, 1 male (cl 22.6 mm, pcl
13.0 mm), Ningaloo South, 22° 03.57' S, 113° 43.74' E to 22° 04.026' S,
113° 43.26' E, 658—754 m, SS10/2005/149, 10 December 2005.
Description. Carapace. Length and width subequal, widest at
midlength. Dorsal surface with main transverse ridges mostly
uninterrupted, without secondary transverse striae between
main ridges; ridges and striae lined with short, non-iridescent
setae. Gastric region with large pair of epigastric spines behind
supraocular spines and 2 or 3 pairs of small epigastric spines;
without median row of spines behind rostrum. Hepatic region
eranular; parahepatic spine present. Anterior part of branchial
region between cervical groove and postcervical groove with |
or 2 ridges and sometimes lor 2 short striae; postcervical spine
present; posterior part of branchial region with 5 transverse
ridges (excluding posterodorsal ridge). Cardiac region with 3
main transverse ridges. Intestinal region with 2 lateral striae;
posterodorsal ridge distinct, without secondary stria. Frontal
margin inclined posteriorly at 110° from midline. Lateral
margin slightly convex; anterolateral spines parallel, directed
slightly upwards, reaching sinus between rostrum and
supraocular spine; hepatic marginal spine anterior to cervical
eroove, much shorter than anterolateral spine; branchial margin
with 4, occasionally 5, spines (additional third spine small).
Rostrum spiniform; curving dorsally, 0.6—0.7 x pcl; supraocular
spine length 0.3 length x rostrum length. Epistomial ridge
straight, ending at antennal gland; mesial protuberance distinct.
Thoracic sternum. Median length of sternal plastron
(sternites 4—7) 0.6 x width of sternite 7. Thoracic sternites
suface smooth, sternites 4 with few striae. Sternite 3 0.5 x
width of sternite 4. Sternite 4 anterior margin subtriangular,
narrowly contiguous with sternite 3.
115
Abdomen. Somite 2 with 8—10 large spines, evenly spaced
along anterior ridge; with stria behind anterior ridge. Somites
3-4 with 2 striae behind anterior ridge. Somite 6
posteromedian margin slightly concave. Telson with numerous
transverse squamae; greatest width 1.6 x midlength;
anterolateral margin concave.
Eye. Maximum corneal diameter 0.35 x distance between
anterolateral spines.
Antennule. Basal article (distal spines excluded) not
overreaching corneae; distolateral and distomesial spines
subequal; 2 lateral spines, proximal smaller, longer lateral
spine reaching end of distal spines.
Antenna. Article | with distomesial spine reaching distal
margin of article 2. Article 2 distomesial spine nearly
reaching distal margin of article 4; distolateral spine reaching
midlength of article 3. Articles 3 and 4 unarmed.
Maxilliped 3. Ischium 1.8 x length of merus, with small
flexor distal spine. Merus flexor margin with large spine and
small distal spine; extensor margin without distal spine.
P1. 2.0-2.5 pcl, with plumose setae on inner margins, and
some iridescent setae, merus 0.8—0.9 pcl, with row of 6 spines
on dorsal margin; distomesial spine reaching midlength of
carpus. Carpus 0.4 x length of merus, length 0.9—1.1 x width,
with 5 spines along the mesial margin. Propodus 1.0—1.4 x
merus length, fingers longer than palm, 0.5-0.6 x total
propodus length; pollex with subdistal spine, outer margin
unarmed; dactylus outer margin unarmed.
P2-4. Long, slender, with few small scales on lateral
surfaces of meri, carpi and propodi; extensor margin with
plumose setae and few iridescent setae. P2 and P3 similar in
length, P4 shorter (P3 merus 0.9—1.0 x length of P2 merus, P4
merus 0.8 x length of P3 merus). P2 1.92.1 x pcl; merus
0.6—0.8 x pcl, length 6 x width, 3—4 x carpus length and 1.6 x
propodus length, extensor margin with 9 spines including
distal spine, flexor margin with 4 spines and well-developed
distal spine; carpus with 2 extensor spines a distal flexor
spine; propodus length 5.5—6.5 x height, with 5 movable
flexor spines; dactylus 0.8—0.9 x propodus length, gently
curved, length 6—7 x width, extensor margin densely lined
with stiff short setae on distal half, flexor margin with 8 small
moveable spines, space between spines increasing distally,
unarmed along distal 1/5. End of P2 carpus overreaching end
of PI merus. P3 with similar spination and article proportions
as P2; merus, propodus and dactylus as long as those of P2.
PA Jength 0.85 x P2 length; merus 0.5—0.6 x pcl; merocarpal
articulation reaching hepatic marginal spine of carapace.
Egg diameter. 0.5 mm.
Colour. Carapace and abdominal somites 2—3 pink. Rostrum
and supraocular spines white. Pl pale pink with white fingers,
P2—4 pale pink on meri and carpi, white on propodi and dactyli.
Genetic data. COI and 16S; see Table 1.
Etymology. After the type locality near the Abrolhos Islands;
used as a noun in apposition.
Remarks. Munida abrolhos sp. nov. 1s similar to M. andamanica
Alcock, 1894, M. rosula Macpherson, 1994, and M. curvirostris
Henderson, 1885, with a dorsally curving spiniform rostrum, P1
116 A.W. McCallum, S.T. Ahyong & N. Andreakis
Figue 1. Munida abrolhos sp. nov., holotype, ovigerous female cl 23 mm, pcl 14 mm (WAM C78556): A, carapace and abdomen, dorsal view; B,
rostrum, lateral view; C, right chela, dorsal view; D, left antenna and antennule, ventral view; E, sternum; F, abdominal somite 6, telson and right
uropod. G, ovigerous female cl 22.9 mm, pcl 14.4 mm (NMV J55036), anterolateral margin of carapace. Scale: A-C, F = 5 mm, D, E, G = 2 mm.
Australian Munida 117
Figure 2. Munida abrolhos sp. nov., holotype, ovigerous female cl 23 mm, pcl 14 mm (WAM C78556): A, right P2 dactylus, lateral view; B, right
P2, lateral view; C, right P3, lateral view; D, right P4 lateral view; E, left maxilliped 3, lateral view. Scale A, E = 2 mm, B-D = 5 mm
118 A.W. McCallum, S.T. Ahyong & N. Andreakis
A
EA cA
t :
|
— o aes tars
LI
Figure 3. A, Munida abrolhos sp. nov., female paratype, cl 27.5 mm, pcl 18.3 mm (NMV 755262); B-D, Munida julumunyju sp. nov., undetermined
paratype from NMV J55979, juvenile paratype, cl 9.2 mm, pcl 10.8 mm (NMV J55061), juvenile paratype cl 10.9 mm, pcl 6.6 mm (NMV
J55062); E, Munida lutruwita sp. nov. ovigerous female, cl 14.3 mm, pcl 10.6 mm, (AM P103229). Photos: K. Gowlett-Holmes, CSIRO.
Australian Munida
fixed finger with only subterminal spine (without marginal spines
on lateral margin), and abdominal somite 2 with a row of 6—8
spines and at most 4 transverse ridges. Most clearly the new
species differs from these species as it usually has only 4 branchial
spines, although sometimes a smaller third branchial spine is
present. In addition, postcervical spines, present in M. abrolhos
sp. nov., are always absent in the aforementioned species.
Of those species with 4 branchial spines, M. abrolhos sp.
nov. is most similar to M. keiensis Baba, 2005, in having
subequal distal spines of the basal antennular article, and the
distomesial spine of antennal article 2 overreaching article 3
but not distinctly overreaching article 4. The two species can
be distinguished by the shape of the anterior margin of
thoracic sternite 4, which is broadly rounded in M. keiensis
but subtriangular in M. sp. nov.
Sequence divergence between M. abrolhos sp. nov. and M.
rosula is 3% for COI and 0.8% for 168.
Distribution. Presently known only from off Western Australia,
658—754 m.
Munida galalala sp. nov.
http://zoobank.org/urn:lsid:zoobank.org:act:83168BC4-60EA-
4710-A32B-42A AFFF985CA
Figures 4, 5
Type material. Holotype. WAM C78558, male (cl 17.8 mm, pcl
11.5 mm), Western Australia, Leveque L27 transect, 14^ 33.432' S,
121° 20.388' E to 14° 2.772 S, 121° 19.644' E, 924-1101 m,
$S05/2007/156, 3 July 2007 to 4 July 2007.
Description. Carapace. Length 1.1 x greatest width, widest at
midlength. Dorsal surface with main transverse ridges mostly
uninterrupted and some short secondary transverse striae
between main ridges on anterior half; ridges and striae lined
with short, non-iridescent setae. Gastric region slighly elevated,
with 2 pairs of epigastric spines, longest pair behind supraocular
spines. Hepatic region granular; parahepatic spine absent.
Anterior part of branchial region between cervical groove and
postcervical groove with few short scale-like ridges and
tubercles; postcervical spine absent; posterior part of branchial
region with 5 main transverse ridges (excluding posterodorsal
ridge) and few short secondary striae laterally between main
ridges. Cardiac region with 4 main transverse ridges. Intestinal
region with short median stria; posterodorsal ridge distinct,
slightly convex medially, without secondary stria. Frontal
margin inclined posteriorly at 110° from midline. Lateral
margins slightly convex; anterolateral spines parallel,
horizontal, reaching sinus between rostrum and supraocular
spine; marginal hepatic spine anterior to cervical groove also
strong, although distinctly shorter than anterolateral spine;
branchial margin with 5 spines. Rostrum spiniform, gentle
curving upwards, length 0.7 pcl; supraocular spine 0.45 x
length of rostrum. Epistomial ridge curved ending anterior to
antennal gland; mesial protuberance distinct.
Thoracic sternum. Surface smooth, without striae. Sternite
3 0.4 width of sternite 4; median length of sternal plastron
(sternites 4—7) 0.6 width of sternite 7. Sternite 4 anterior
margin subtrapezoid, broadly contiguous with sternite 3.
119
Abdomen. Somite 2 with 7 prominent spines along
anterior transverse ridge. Somites 2-4 each with 1
uninterrupted stria behind anterior ridge, without striae at
lateral margins. Somite 6 posteromedian margin almost
straight. Telson with numerous transverse squamae; greatest
width 1.5 x median length; anterolateral margin concave.
Eye. Maximum corneal diameter 0.15 x distance between
anterolateral spines.
Antennule. Basal article (distal spines excluded)
overreaching corneae; well-developed distolateral spine much
longer than short distomesial spine; 2 lateral spines, proximal
smaller, not exceeding distal spines.
Antenna. Article | with strong distomesial spine not
reaching distal margin of article 2. Article 2 distomesial spine
not overreaching distal margin of article 3; distolateral spine
reaching distal margin of article 3. Article 3 distomesial spine
almost reaching distal margin of article 4. Article 4 unarmed.
Maxilliped 3. Ischium 1.3 x merus length, with small
flexor distal spine. Merus with 2 large spines on flexor margin
and | small spine; extensor margin unarmed.
P1. 3.0 x pcl, covered in plumose setae, without iridescent
setae, merus 1.2 x pcl, with row of 6 dorsal spines and 2 rows of
spines on mesial margin; distal spines strong, distomesial spine
not reaching midlength of carpus. Carpus 0.6 x merus length,
length 2.6 x width, with spines along mesial and dorsal margins.
Propodus 1.2 x merus length, fingers slightly shorter than palm,
0.5 x total propodus length; pollex with small subdistal spine,
margin unarmed; dactylusouter margin unarmed.
P2—4. Moderately long, slender, with numerous scales on
lateral surfaces of meri; extensor margin with row of plumose
setae. P2 length 2.1 x pcl; merus as long as pcl, length 7x
height, 3.5 x carpus length and 1.4 x propodus length, with
well-developed spines on extensor margin, increasing in size
distally, flexor margin with row of small spines and well-
developed distal spine; carpus with large spine and distal spine
on extensor margin, distal spine on flexor margin; propodus
length 6.5 x height, with 5 small movable flexor spines;
dactylus compressed, slightly curved, 0.6 x propodus length,
length 5.5 x width, with 9 movable spines evenly spaced along
flexor margin including spine at base of unguis. End of P2
carpus reaching end of P1 merus. P3 missing. P4 length 0.8 x
P2 length; merus 0.7 x pcl; merocarpal articulation almost
reaching hepatic marginal spine of carapace.
Genetic data. COI and 16S; see Table 1.
Etymology. Named galalala, meaning lobster in Dambimangari
language, used as a noun in apposition.
Remarks. Munida galalala sp. nov. belongs to the group of
species having five spines on the lateral branchial margins of
the carapace, smooth thoracic sternites, small eyes, and spines
on the anterior ridge of abdominal somite 2. The antennal
peduncle is most similar to Munida parvioculata Baba, 1982,
both species having a distinct distomesial spine on antennal
peduncle article 3. The new species differs in:
- the generally smooth surface of the carapace with widely
spaced transverse striae, compared to rugose with interrupted
transverse ridges in M. parvioculata
120 A.W. McCallum, S.T. Ahyong & N. Andreakis
B j C Re
e
e
~
~
em
~~
~
=
eomm
>
2.232?) )
Figure 4. Munida galalala sp. nov., holotype, male 17.8 mm (WAM C78558): A, carapace and abdomen, dorsal view; B, right chela, dorsal view;
C, left antenna and antennule, ventral view; D, abdominal somite 6, telson and right uropod. E, sternum. Scale: A-E = 2 mm.
Australian Munida
121
Figure 5. Munida galalala sp. nov., holotype, male 17.8 mm (WAM C78558): A, left P2 dactylus, lateral view; B, left P2, lateral view; C, left P4,
lateral view; D left maxilliped 3, lateral view. Scale A = 1 mm, B-D = 2 mm
- the unarmed lateral margin of the cheliped pollex (with 2
spines in M. parvioculata)
- arow of 7 spines on abdominal somite 2 versus a single
pair in M. parvioculata.
Munida galalala can be distinguished from all other
species in this group (1.e. M. clevai Macpherson, 2009, M.
ampliantennulata Komai, 2011, M. profunda Macpherson and
de Saint Laurent, 1991, M. endeavourae Ahyong and Poore,
2004, M. pollioculus Komai and Higashiji, 2016, and M. typhle
Macpherson, 1994) by the presence of a spine on antennal
peduncle article 3.
Distribution. Presently known only from off north-western
Australia, 924—1101 m.
Munida julumunyju sp. nov.
http://zoobank.org/urn:lIsid:zoobank.org:act: A4C FA E49-1832-
4C56-BDED-A68F843BB9F4
Figures 3B—D, 6, 7
Munida rubridigitalis. — Poore et al., 2008: 20, unnumbered fig.
(upper right) — McEnnulty et al., 2011: app. 1,2.
Type material. Holotype: WAM C78559, female cl 22.4 mm, pcl 15.8
mm), Western Australia, Onslow L19 transect, 20° 07.962' S, 114? 587]' E
to 20? 07.584' S, 114? 58.416' E, 415—470 m, SS05/2007/15, 11 June 2007.
Paratypes (all Western Australia): NMV J56082, 1 female (cl 24.4
mm, pcl 16.3 mmy), collected with holotype; NMV J55979, ] male (cl
22.0 mm, pcl 15.0 mm), | ovigerous female (cl 18.8 mm, pcl 13.3 mm),
Dampier L20 transect, 19° 43.776' S, 115° 21.216' E to 19° 43.56' S,
115? 20.598' E, 389—423 m, SS05/2007/34, 12 June 2007; NMV
J55061, 1 juvenile (cl 9.2 mm, pcl 10.8 mm), Carnarvon, 24^ 33.12' S,
112? 15.12? E to 24? 33.804' S, 112? 15.18' E, 396—404 m,
5510/2005/122, 7 December 2005; NMV J55062, 1 juvenile (cl 10.9
mm, pcl 6.6 mm), Red Bluff, 23° 59.196' S, 112° 32.04' E to
23? 597724' S, 112? 31.74' E, 411 m, SS10/2005/130, 8 December 2005;
WAM C78560, 2 males (cl 22.6 mm, pcl 14.8 mm; cl 27.0 mm, pel 19.2
mm), 1 female (cl 22.6 mm, pcl 16.0 mm), Point Cloates, 22° 50.808' S,
113? 20.28' Eto 22° 51.228' S, 113? 19.98' E,420—430 m, SS10/2005/137,
9 December 2005; NMV J55060, 1 male (cl 24.2 mm, pcl 16.7 mm),
Ningaloo South, 22° 04.374' S, 113° 45.36' E to 22° 04.968' S,
113? 45.36' E, 391—396 m, SS10/2005/148, 10 December 2005; NMV
J55064, 1 male (broken rostrum; pcl 10.8 mm), Ningaloo South,
22? 04.314' S, 113? 45.36' E to 22? 04.854' S, 113? 45.36' E, 387—399 m,
$S10/2005/151, 10 December 2005; NMV J55059, 1 female (cl 23.2
mm, pcl 15.9 mm), Ningaloo North, 21° 58.212' S, 113° 47.46' E to
21° 58.806' S, 113° 47.1' E, 373—382 m, SS10/2005/165, 12 December
2005; NMV J55058, 2 males (cl 17.0 mm, pcl 11.1 mm; cl 25.8 mm, pcl
18.4 mm), Barrow Island, 21° 00.402' S, 114° 22.86' E to 21° 00.042' S,
114? 22.5' E, 399—408 m, SS10/2005/172, 13 December 2005.
Other material examined. New Caledonia: MNHN-IU-2014-15475, 2
females (cl 14.6 mm, pcl 9.1 mm; cl 18.5, pcl 11.5), 3 males (cl 14.3—
16.0 mm, pcl 8.5—10.1 mm), east coast, 21° 14.84' S 165° 55.49' E, 450—
122 A.W. McCallum, S.T. Ahyong & N. Andreakis
Figure 6. Munida julumunyju sp. nov., holotype, ovigerous female cl 22.4 mm, pcl 15.8 mm (WAM C78559): A, carapace and abdomen, dorsal
view; B, right chela, dorsal view; C, right antenna and antennule, ventral view; D, sternum; E, telson; F, rostrum, lateral view. Munida julumunyju,
New Caledonia, male cl. 18.2, pcl 12.2 (MNHN-IU-2014-15475): G, rostrum, lateral view. A-D, G = 5 mm, E-F = 2 mm.
Australian Munida 123
Figure 7. Munida julumunyju sp. nov., holotype, ovigerous female cl 22.4 mm, pcl 15.8 mm (WAM C78559). A, right P2 dactylus, lateral view; B,
right P2, lateral view; C, right P3, lateral view; D, right P4, lateral view; E, left maxilliped 3, lateral view. Scale A-E = 2 mm.
124
490 m, HALIPRO 1 CP869, 23, March 1994; MNHN-IU-2014-15474,
| female (cl 15.5 mm, pcl 10.3 mm), Norfolk Ridge, 22° 10' S
167° 15.2' E, 495-515 m, BIOCAL CP109, 9 September 1985.
Description. Carapace. Length 0.9 x greatest width, widest at
midlength. Dorsal surface with main transverse ridges mostly
uninterrupted, with secondary transverse striae between main
ridges; ridges and striae lined with short, non-iridescent setae.
Gastric region with 3—6 pairs of epigastric spines, longest pair
behind supraocular spines. Hepatic region with short striae; small
parahepatic spine sometimes present. Anterior part of branchial
region between cervical groove and postcervical groove with
about 6 ridges and some shorter striae; posterior part of branchial
region with about 12 transverse ridges (excluding posterodorsal
ridge). Cardiac region with 3 or 4 main transverse ridges. Intestinal
region with 2 or 3 striae; posterodorsal ridge distinct, with
secondary stria. Frontal margin inclined posteriorly at 105° from
midline. Lateral margin slightly convex; anterolateral spines
parallel, horizontal, just reaching sinus between rostrum and
supraocular spine; marginal hepatic spine anterior to cervical
eroove, much shorter than anterolateral spine; branchial margins
with 5 spines. Rostrum laterally compressed; dorsal margin
straight, inclined dorsally, ventral margin strongly convex, deepest
slightly anterior to midlength, length 0.4—0.5 x pcl; supraocular
spine 0.4 x length of rostrum. Epistomial ridge straight, ending at
antennal gland; mesial protuberance distinct.
Thoracic sternum. Median length of sternal plastron
(sternites 4—7) 0.5 x width of sternite 7. Sternites 4—5 with
Striae; sternite 6 with few striae. Sternite 3 0.4 width of
sternite 4. Sternite 4 anterior margin subtrapezoid, narrowly
contiguous with sternite 3.
Abdomen. Somite 2 with 8 small spines evenly spaced along
anterior ridge. Somites 2—4 with about 5, 7 and 12 uninterrupted
striae behind anterior ridge, respectively, and squamae at lateral
margins. Somite 6 posteromedian margin almost straight.
Telson with numerous transverse squamae; greatest width 1.7 x
median length; anterolateral margin concave.
Eye. Maximum corneal diameter 0.3 x distance between
anterolateral spines.
Antennule. Basal article (distal spines excluded) not
overreaching corneae; distolateral and distomesial spines
subequal; 2 lateral spines, proximal smaller, longer lateral
Spine exceeding distal spines.
Antenna. Article | with distomesial spine reaching
midlength of article 2. Article 2 with distomesial spine
reaching distal margin of article 4; distolateral spine almost
reaching distal margin of article 3. Article 3 and 4 unarmed.
Maxilliped 3. Ischium 1.8 x merus length, with flexor
distal spine. Merus with large spine and small distal spine on
flexor margin; extensor margin unarmed.
Pl. 1.6-1.9 pcl (females), 1.7—2.1 pcl (males), covered in
plumose setae and iridescent setae in inner margin; merus
0.6—0.7 pcl (females), 0.7—0.8 pcl (males), with row of 5 small
spines on dorsal margin; distomesial spine reaching midlength
of carpus. Carpus 0.4 (females), 0.4—0.5 (males) x merus
length, length 0.9—1.] x width, with 5 spines along the mesial
margin. Propodus 1.2-1.3 (females), 1.1—1.6 (males) x merus
length, dactylus longer than palm, 0.5 x total propodus length;
dactylus and pollex outer margin unarmed.
A.W. McCallum, S.T. Ahyong & N. Andreakis
P2-4. Relatively stout, with scales on lateral surface of
meri, carpi and propodi; extensor margin with plumose setae
and iridescent setae. Meri shorter posteriorly (P3 merus 0.9 x
P2 merus length, P4 merus 0.8 x P3 merus length). P2 1.5—2.2
x pcl; merus 0.6—0.8 x pcl, length 4 x width, 2.6—3.0 x carpus
length and 1.3-1.6 x propodus length, extensor margin with
11-17 spines, flexor margin with acute ridges and well-
developed distal spine; carpus with 2 large spines and 2 or 3
smaller spines on extensor margin, distal spine on flexor
margin; propodus length 5 x height, with 6—8 movable flexor
spines; dactylus 0.7—0.9 x propodus length, curved, length 5—6
x width, extensor margin densely lined with stiff long setae on
distal half, flexor margin with 8—12 spines, space between
spines increasing distally, unarmed along distal 1/5. End of P2
carpus almost reaching end of P1 merus. P3 with similar
spination and article proportions as P2; merus slightly shorter
than P2 merus (0.9); propodus and dactylus as long as those of
P2. P4 length 0.8 x P2 length; merus 0.5 x pcl; merocarpal
articulation reaching hepatic marginal spine of carapace.
Egg diameter. 0.5 mm.
Colour. Carapace and abdominal somites 2-3 orange,
remaining abdomen and telson white. Rostrum white with red
subdistal spot, supraocular spines orange. Chelipeds and
walking legs with transverse white/pale orange and dark orange
bands; distal half of palm and proximal half of cheliped fingers
orange, distal half of fingers of cheliped white; dactyli of
walking legs white.
Genetic data. COI and 16S; see Table 1.
Etymology. Named julumunyju with approval of the Kariyarra
people. The word julumunyju means prawn in Kariyarra
language; used as a noun in apposition.
Remarks. Munida julumunyju sp. nov. is very similar to M.
rubridigitalis Baba, 1994, described from Queensland, Australia.
Both species have a laterally compressed rostrum with a red
mark and red cheliped fingers, the second abdominal somite with
8 or 9 spines along the anterior ridge and subequal distal spines
on the basal antennular article. Comparison of M. julumunyju
with paratypes of M. rubridigitalis and additional specimens
from eastern Australia found that the two species differ chiefly in
the shape of the rostrum. The rostrum of both species is laterally
compressed, but shallower and more evenly tapered in M.
rubridigitalis. In M. rubridigitalis, the ventral rostral margin 1s
gently convex with the dorsal and ventral margins parallel for the
proximal half or slightly more, after which they gently converge
to the apex. In M. julumunyju sp. nov., however, the rostrum is
deeper, with the dorsal and ventral margins distally diverging,
reaching the greatest depth slightly anterior to the midlength and
then converging to the apex, making the ventral margin more
strongly convex than in M. rubridigitalis. In addition, M.
rubridigitalis usually has a spine on the mesial margin of the
antennal article 2 (occasionally present only on one side), which
is always absent in M. julumunyju. Colour-in-life may also be
helpful 1n distinguishing these species. The new species has a red
patch on the pterygostomian flap below the linea anomurica,
which is noted as absent in M. rubridigitalis by Baba (1994). In
M. julumunyju sp. nov. the fingers are completely red with a
Australian Munida
white tip, whereas M. rubridigitalis is described with only the
distal half of the fingers red.
We examined six specimens identified as M. rubridigitalis
from New Caledonia in the collections of the MNHN, and
herein we identify these specimens as M. julumunyju sp. nov.
These specimens agree with M. julumunyju sp. nov. 1n rostral
form and lack of a spine on the mesial margin of antennal article
2. Specimens reported and figured from New Caledonia and the
Loyalty Islands as Munida sp. by Macpherson (1994: fig. 13b,
90) also agree with M. julumunyju 1n rostral form and the colour
of the fingers, which are described as red with a white tip.
sequence divergence between M. julumunyju sp. nov. and a New
Caledonian specimen of “M. rubridigitalis" (MNHN-
[U-2014-15474) is 4% (COI) and 0.6% (16S). Thus, further study
is required to determine if other reported specimens of "M.
rubridigitalis" from the New Caledonian region are conspecific
with, or distinct from, M. julumunyju sp. nov. The apparently
disjunct distribution of M. julumunyju sp. nov. suggests that it
can be expected to occur at intermediate localities, possibly off
southern Indonesia and Papua New Guinea.
Distribution. Presently known from off Western Australia, 373—
450 m. New Caledonia, 450—515 m. Loyalty Islands, 540 m.
Munida jurunjurun sp. nov.
http://zoobank.org/urn:lsid:zoobank.org:act: CD77DA72-B760-
4983-9252-6BC62CC7CE50
Figures 8,9
Type material. Holotype: WAM C78561, ovigerous female (cl 14.7
mm, pcl 9 mm), Western Australia, off Imperieuse Reef, 17° 35.982' S,
118? 59.076' Eto 17? 38.574' S, 119° 01.26' E,222-319m,S8805/2007/63,
16 June 2007.
Description. Carapace. Length 1.1 x greatest width, widest at
midlength. Dorsal surface with numerous uninterrupted
transverse ridges and secondary transverse striae between main
ridges; ridges and striae lined with short, non-iridescent setae.
Gastric region with 5 pairs of epigastric spines, longest pair
behind supraocular spines. Parahepatic, postcervical and dorsal
branchial spine present. Anterior part of branchial region
between cervical groove and postcervical groove with 3 main
ridges; posterior part of branchial region with 6 main transverse
ridges (excluding posterodorsal ridge) and 5 secondary striae
laterally between main ridges. Cardiac region with 5 main
transverse ridges. Intestinal region with transverse ridge,
posterodorsal ridge and secondary stria. Frontal margin inclined
posteriorly at 112° from midline. Lateral margins slightly
convex; anterolateral spines parallel, horizontal, overreaching
sinus between rostrum and supraocular spine; small hepatic
marginal spine in front of cervical groove (0.15 x length of
anterolateral spine); branchial margin with 4 spines. Rostrum
spiniform, horizontal, 0.7 x pcl; supraocular spine 0.5 x length of
rostrum. Epistomial ridge straight ending slightly anterior to
antennal gland; mesial protuberance distinct.
Thoracic sternum. Sternal surface smooth, sternite 4 with
few short striae. Sternite 3 0.4 width of sternite 4; midlength
of sternal plastron (sternites 4—7) 0.5 width of sternite 7.
Sternite 4 anterior margin broadly rounded.
125
Abdomen. Somite 2 with 2 pairs of small spines at lateral
margins of anterior transverse ridge. Somites 2—4 each with 2
or 3 uninterrupted striae behind anterior ridge and some
shorter striae. Somite 6 posteromedian margin almost
straight. Telson with numerous transverse squamae; greatest
width 2.0 x median length; anterolateral margin almost
straight or shallowly concave.
Eye. Maximum corneal diameter 0.36 x distance between
anterolateral spines.
Antennule. Basal article (distal spines excluded)
overreaching or reaching end of corneae; 2 well-developed
distal spines, distomesial slightly longer than distolateral; 2
lateral spines, proximal small, distolateral spine exceeding
both distal spines.
Antenna. Article 1 with strong distomesial spine
overreaching distal margin of article 4. Article 2 with strong
distomesial spine overreaching distal margin of article 4;
distolateral spine reaching distal margin of article 4; 2 small
lateral spines on mesial margin. Articles 3 and 4 unarmed.
Maxilliped 3. Ischium 1.45 x merus length, with strong
flexor distal spine; merus with strong spine on flexor margin and
small spine distally, with small spine on distal extensor margin.
P1. length 3.0 x pcl, with iridescent setae on inner margin.
Merus 1.25 x pcl, with a row of 5 dorsal spines and row of 5
long, close set spines on mesial margin; distal spines strong,
distomesial spine not reaching midlength of carpus. Carpus 0.4
x merus length, length 2.6 x width, with spines along mesial
and dorsal margins. Propodus 1.1 x merus length, fingers 0.5 x
total propodus length, with 2 small distolateral spines; dactylus
with small proximal spine small subdistal spine.
P2-4. Long and slender, with numerous scales on lateral
surfaces of meri; margins with row of plumose setae and
iridescent setae on ischium and merus. P2 length 2.6 x pcl; merus
as long as pcl, length 6 x height, 4.0 x carpus length and 1.2 x
propodus length, extensor margin spinose, flexor margin with
small spine near distal one-fifth and well-developed distal spine;
carpus extensor margin with 5 small spines (broken on right P2
of the holotype) and prominent distal spine, flexor margin with
distal spine; propodus length 9.3 x height, with 11 small movable
flexor spines; dactylus compressed, slightly curved, length 0.5 x
propodus length and 5 x height, with 10 evenly spaced spines
along distal 0.8 of flexor margin. End of P2 carpus reaching end
of Pl merus. P3 with similar spination and article proportions as
P2; merus slightly shorter than P2 merus (0.85); propodus and
dactylus as long as those of P2. P4 length 0.9 x P2 length; merus
0.7 x pcl, 0.8 x P3 merus length; propodus 0.85 and dactylus
0.95 x length of those of P3; merocarpal articulation slightly
overreaching anterolateral corner of carapace.
Genetic data. COI and 16S; see Table 1.
Etymology. Named jurunjurun with the approval of Bardi
elders, after Jurun jurun, meaning crayfish 1n Bardi; used as a
noun in apposition.
Remarks. Munida jurunjurun sp. nov. is closest to M. acantha
Macpherson, 1994, from New Caledonia, both species having
antennal articles | and 2 with long mesial spines overreaching
article 4, antennule with distomesial spine longer than
126 A.W. McCallum, S.T. Ahyong & N. Andreakis
Figure 8. Munida jurunjurun sp. nov., holotype, ovigerous female cl 14.7 mm, pcl 9 mm (WAM C78561). A, carapace and abdomen, dorsal view; B,
right chela, dorsal view; C, right antenna and antennule, ventral view; D, sternum; E, abdominal somite 6, telson and right uropod. Scale: A-E = 2 mm.
Australian Munida
distolateral spine, a smooth thoracic sternum, and abdominal
somite 2 with small spines limited to the lateral margins of the
anterior ridge. The new species differs from M. acantha in
having 4 rather than 5 branchial carapace spines. In addition,
the new species has a distinct row of spines on the mesial
margin of the Pl merus, which are close-set on the distal half
of the article, rather than more evenly spaced along the distal
0.6 as in M. acantha. Sequence divergence between M. acantha
and M. jurunjurun sp. nov. is 8% for COI and 3.5% for 16S.
Of those species with 4 branchial spines, M. jurunjurun
127
sp. nov. is similar to M. albiapicula Baba and Yu, 1987, M.
zebra Macpherson, 1994, M. volantis Macpherson, 2004, and
M. nesiotes Macpherson, 1999, all of which have a long mesial
spine on antennal articles 1 and 2. In these species, however,
the spines on the anterior ridge of abdominal somite 2 are
evenly spread along the entire margin, rather than placed at
the lateral extremities.
Distribution. North-western Australia, off Imperieuse Reef,
222—319 m
Figure 9. Munida jurunjurun sp. nov., holotype, ovigerous female cl 14.7 mm, pcl 9 mm (WAM C78561): A, right P2 dactylus, lateral view; B,
right P2, lateral view; C, right P3, lateral view; D, right P4, lateral view; E, left maxilliped 3, lateral view. Scale A= 1 mm, B-E = 2 mm.
128
Munida leeuwin sp. nov.
http://zoobank.org/urn:lsid:zoobank.org:act:6D615718-C84B-
4]6F-891 A-4D9FA BFB7592
Figures 10, 1]
Munida sp. MoV 5176. — Poore et al., 2008: 20: unnumbered
colour fig. (lower right) (south-western Australia, 101—100 m).
Type material. Holotype. WAM C78562, male (cl 8.1 mm, pcl 5.3
mm), Western Australia, Barrow Island, 20° 59.082' S, 114° 54.42' E
to 20° 59.67 S, 114° 54.54' E, 100-101 m, SS10/2005/170,
13 December 2005.
Paratypes (all Western Australia) WAM C78563, 1 ovigerous
female (cl 7.2 mm, pcl 5 mm), 7 females (cl 6.0 mm, pcl 3.8 mm to cl
5.5 mm, pcl 5.5 mm), 7 males (cl 6.3 mm, pcl 3.8 mm to cl 9.1 mm, pcl
6.2 mm), collected with holotype; NMV J55046, 1 male (cl 8.7 mm,
pel 5.9 mm), 1 ovigerous female (cl 7.9 mm, pcl 5.2 mm), collected
with holotype; NMV J55100, 2 ovigerous females (cl 7.7 mm, pcl 5.0
mm; cl 7.8 mm, pcl 5.1 mm), | female (cl 7.8 mm, 5.0 mm), collected
with holotype; NMV J56100, 1 juvenile (cl 4.4 mm, pcl 3.0 mm), 1
ovigerous female (broken rostrum; pcl 4.8 mm), Imperieuse L23
transect, 18° 27.612' S, 120° 08.682' E to 18° 27.72' S, 120° 08.682' E,
80—81 m, SS05/2007/82, 16 June 2007.
Description. Carapace. Length 1.1 x greatest width, widest at
midlength. Dorsal surface with main transverse ridges mostly
uninterrupted, without secondary transverse striae between
main ridges; ridges and striae lined with short, non-iridescent
setae and few long iridescent setae. Gastric region with 5 or 6
pairs of epigastric spines, longest pair behind supraocular spines,
with median row of 2 or 3 small spines behind rostrum. Hepatic
region with 3 or 4 spines on dorsal surface; parahepatic spines
present. Anterior part of branchial region between cervical
eroove and postcervical groove with 3 ridges and | or 2 small
spines; | postcervical spine; posterior part of branchial region
with 4 or 5 main transverse ridges (excluding posterodorsal
ridge) and few shorter secondary striae between main ridges.
Cardiac region with 3 main transverse ridges. Intestinal region
without striae; posterodorsal ridge distinct, without secondary
stria. Frontal margin inclined posteriorly at 115° from midline.
Lateral margin slightly convex; anterolateral spines parallel,
horizontal, not reaching sinus between rostrum and supraocular
spine; hepatic marginal spine shorter than anterolateral spine;
branchial margin with 5 spines. Rostrum spiniform, slightly
sinuous in profile, length 0.5 x pcl; supraocular spine 0.3 x length
of rostrum. Epistomial ridge curved, ending anterior to antennal
gland; mesial protuberance distinct.
Thoracic sternum. Sternital surface smooth, sternite 4 with
few long striae. Sternite 3 0.4 width of sternite 4; midlength of
sternal plastron (sternites 4—7) 0.7 width of sternite 7. Sternite
4 anterior margin truncate, entirely contiguous with sternite 3.
Abdomen. Somite 2 without spines. Somites 2—4 each with
2 or 3 uninterrupted striae behind anterior ridge and striae at
lateral margins. Somite 6 posteromedian margin almost
straight. Telson with numerous transverse squamae; greatest
width 2.0 x median length; anterolateral margin concave.
Eye. Maximum corneal diameter 0.35 x distance between
anterolateral spines.
Antennule. Basal article (distal spines excluded) not
overreaching corneae; distolateral and distomesial spines
A.W. McCallum, S.T. Ahyong & N. Andreakis
subequal; 2 lateral spines, proximal smaller, longer lateral
spine exceeding distal spines.
Antenna. Article 1 with distomesial spine reaching
midlength of article 2. Article 2 distomesial spine slightly
overreaching distal margin of article 5; distolateral spine almost
reaching distal margin of article 3. Article 5 unarmed or with
small distolateral spine. Article 4 unarmed.
Maxilliped 3. Ischium 1.6 x merus length, with distal
flexor spine. Merus with 3 well-developed spines on flexor
margin; extensor margin with small distal spine.
Pl. length 3.1—4.4 pcl (males), 2.8—3.0 pcl (females), with
dense covering of iridescent setae on inner margins of merus
(without plumose setae), merus 1.3—1.4 (males), 1.0—1.1 (females)
x pcl, with row of 5 subtriangular spines on dorsal and mesial
margin; distomesial spine not reaching midlength of carpus.
Carpus 0.3-0.4 x merus length, length 1.9 (males), 2.02.4
(females) x width, with spines along mesial margin. Propodus
1.6-1.7 (males), 1.4 (females) x merus length; fingers 0.4—0.6
(males), 0.5—0.6 (females) x total propodus length; pollex with
row of small spines along outer margin; dactylus with 3 small
spines on outer margin.
P2—4. Moderately long and slender, with scales on lateral
surfaces of meri; extensor margin with plumose setae and
iridescent setae. P2 length 2.1-2.6 x pcl; merus as long as
carapace, length 6.4 x height, 3.4 x carpus length and 1.3 x
propodus length; extensor margin spinose; flexor margin with
acute ridges, | or 2 spines and well-developed distal spine;
carpus with 4 small extensor spines, distal spine on extensor and
flexor margin; propodus length 7 x height, with 10—14 movable
flexor spines; dactylus compressed, almost straight, 0.7—0.9 x
propodus length, length 6—7 x height, flexor margin with 7—12
spines, unarmed along distal 1/3. End of P2 carpus not reaching
end of Pl merus. P3 with similar spination and article
proportions as P2; merus slightly shorter than P2 merus (0.8);
propodus and dactylus as long as those of P2. P4 length 0.8 x P2
length; merus 0.6—0.7 x pcl, 0.9 x P3 merus length; merocarpal
articulation almost reaching marginal hepatic spine of carapace.
Genetic data. COI and 16S; see Table 1.
Etymology. Named after the Leeuwin current which flows off
the west coast of Australia; used as a noun in apposition.
Remarks. Munida leeuwin sp. nov. is most similar to M. roshanei
Tirmizi, 1966, M. janetae Tirmizi and Javed, 1992, and M.
arabica Yirmizi and Javed, 1992, described from the western
Indian Ocean. These three species are very similar to each other
and have been distinguished by the length of the pereopod 1
chela, the ratio of the length of the fingers to the propodus palm,
and the shape of sternite 3. In his key, Baba (2005) characterises
M. janetae as having cheliped fingers that are distinctly longer
than the palm, while the fingers are shorter than the palm in M.
roshanei and M. arabica. In M. leeuwin sp. nov., the fingers are
usually as long as the palm but are occasionally longer or shorter
than the palm (0.4—0.6 x propodus length). We tentatively
describe this species as new based on a combination of subtle
differences from the aforementioned species and significant
molecular divergence from material we identify as M. roshanei.
In M. leeuwin sp. nov., the dactlyli of P2—4 are slender and
Australian Munida 129
Figure 10. Munida leeuwin sp. nov., holotype, male cl 8.1 mm, pcl 5.3 mm (WAM C78562): A, carapace and abdomen, dorsal view; B, right chela,
dorsal view; C, left antenna and antennule, ventral view; D, sternum; E, abdominal somite 6, telson and right uropod. Scale: A-E = 2 mm.
130
unarmed on the distal one-third of the flexor margin, with the
ultimate spine closer to the penultimate spine than the unguis.
This differs from M. janetae in which the dactyli have spines
regularly arranged along the entire flexor margin (Tirmizi and
Javed, 1992). Illustrations of M. arabica show the dactyli to be
similar to those of M. leeuwin sp. nov., but M. arabica can be
distinguished by the presence of distal spines on antennal article
4, which are always absent in M. leeuwin sp. nov. The type
description of M. roshanei lacks a description or illustration of
the dactyli, as does that of Lewinsohm (1969) for nearby Red
sea specimens. Specimens identified as M. roshanei from the
Phillipines (Baba, 1988) and Australia (present study), however,
A.W. McCallum, S.T. Ahyong & N. Andreakis
have the dactyli with spines regularly arranged along the entire
flexor margin. Although the spination of the P2—4 dactyli of the
type material of M. roshanei remains to be confirmed, given the
brevity of the original description and without access to the
type, we fully describe M. leeuwin as new to improve the
taxonomy of this difficult group.
The genetic sequences of M. leeuwin are highly divergent
from all other species analysed. Despite their morphological
similarities, M. leeuwin and our specimens of M. roshanei are
divergent by 12% in COI.
Distribution. Presently known only from off Western Australia,
658—754 m.
Figure 11. Munida leeuwin sp. nov., holotype, male cl 8.1 mm, pcl 5.3 mm (WAM C78562): A, right P2 dactylus, lateral view; B, right P2, lateral
view; C, right P3, lateral view; D, right P4, lateral view; E, left maxilliped 3, lateral view. Scale A-E = 1 mm.
Australian Munida
Munida lutruwita sp. nov.
http://zoobank.org/urn:lsid:zoobank.org:act:14904374-57EC-
4548-A4D7-ACA713F712C9
Figures 3E, 12, 13
Munida cf. manqingae. — Farrelly and Ahyong, 2019: 13,55, fig. 99.
Type material. Holotype: NMV J67481, ovigerous female (cl 11.7 mm,
pcl 7.8 mm), Tasmania, south of Hobart, Z39 Seamount, 44° 23.346' S,
147° 16.376' E, 2040 m, TT 01/2008/J2-387-003, 25 December 2008.
Paratypes (all Tasmania): NMV J67474, 2 ovigerous females (cl 9.5
mm, pcl 7.1 mm; cl 9.6 mm, pcl 7.4 mm), Z39 Seamount, 44° 23.32' S,
147? 15.349' E, 1599 m, TT 01/2008/J2-387-023, 26 December 2008;
NMV J67475, 2 damaged ovigerous females (cl 10.6 mm, pcl 7.3 mm;
cl 11.2 mm , pcl 7.9 mm), Z39 Seamount, 44° 22.994' S, 147° 15.09' E,
1893 m, TT 01/2008/J2-387-008, 25 December 2008; NMV J67480, 1
ovigerous female (cl 11.5 mm, pcl 79 mm), Z39 Seamount,
44? 23.295' S, 147? 15.348' E, 1616 m, TT 01/2008/J2-387-022, 26
December 2008; NMV J67472, | male (abdomen missing; cl 10.9 mm,
pel 6.3 mm), Z39 Seamount, 44° 23.345'S 147° 16.277'E, 1990—2004
m, TT 01/2008/J2-387-004, 25 December 2008.
Other material examined. AM P103229, 1 ovigerous female (cl 14.3
mm, pcl 10.0 mm), Great Australian Bight, 35° 22.627' S,
132° 19.166' E, 1689-1784 m, from crevice in dead coral,
IN2015-C01-042, 6 November 2015.
Description. Carapace. As long as greatest width, widest at
midlength. Dorsal surface with main transverse ridges mostly
uninterrupted, without secondary transverse striae between
main ridges; ridges and striae lined with short, non-iridescent
setae. Gastric region with 3 pairs of epigastric spines and 1 or
2 small additional spines, without median row of spines behind
rostrum. Hepatic region without spines on dorsal surface.
Anterior part of branchial region between cervical groove and
postcervical groove with 2 or 3 short tuberculate ridges and
often | small spine anteriorly; posterior part of branchial region
with 5 transverse ridges (excluding posterodorsal ridge).
Cardiac region with 2 main transverse ridges. Intestinal region
without striae; posterodorsal ridge distinct, without secondary
stria. Frontal margin strongly oblique, inclined posteriorly at
115° from midline. Lateral margin slightly convex; anterolateral
spine very small, far from reaching sinus between rostrum and
supraocular spine; hepatic marginal spine slightly smaller than
anterolateral spine; branchial margin with 5 spines. Rostrum
spiniform, 0.5 x pcl; supraocular spine 0.25 x length of rostrum,
exceeding eyes. Epistomial ridge straight ending at antennal
gland; mesial protuberance distinct.
Thoracic sternum. Sternal suface smooth, sternite 4 with
only few striae. Sternite 3 0.4 x width of sternite 4. Sterinte 4
anterior margin triangular, narrowly contiguous with sternite
3. Midlength of sternal plastron (sternites 4—7) 0.5 x width of
sternite 7.
Abdomen. Somites smooth without spines, distinct ridges
or striae. Somite 6 posteromedian margin slightly concave.
lelson with few striae; greatest width 1.2 x median length;
anterolateral margin weakly concave.
Eye. Maximum corneal diameter 0.18 x distance between
anterolateral spines.
Antennule. Basal article (distal spines excluded)
overreaching corneae; distolateral spine much longer than
131
distomesial spine; 2 lateral spines, proximal smaller, longer
lateral spine not reaching end of distolateral spines.
Antenna. Article | distomesial spine almost reaching
distal margin of article 2. Article 2 distomesial spine reaching
distal margin of article 3; distolateral spine not reaching
midlength of article 3. Articles 3 and 4 unarmed.
Maxilliped 3. Ischium 1.9 x merus length, without flexor
distal spine. Merus with large median spine and distal spine
on flexor margin; extensor margin without distal spine.
P1. Length 2.4—3.2 x pcl, covered in rows of short plumose
setae. Merus length 0.9—1.1 x pcl, with row of 2 large spines
and 2 small spines on dorsal margin, 1 strong spine on
dorsolateral margin, and 4 spines on mesial margin,
distomesial spine not reaching midlength of carpus. Carpus
0.5 x merus length, length 3.0 x width, with 6 spines along
mesial margin. Propodus 1.3 x merus length, palm with row
of 3 or 4 spines on dorsal surface of palm, fingers 0.4—0.5 x
total propodus length, without spines on outer margins.
P2-4. Long and slender, with few small scales on lateral
sides of meri and carpi; extensor margin with short plumose setae
and few longer setae. P2 1.8—2.3 x pcl; merus 0.7-0.8 x pcl,
length 8.0 x width, 3.0 x carpus length and 1.5 x propodus
length, extensor margin with 5—7 spines, flexor margin with 3
spines and well-developed distal spine; carpus extensor margin
with spine at midlength and distal end, flexor margin with distal
spine; propodus length about 8 x height, with 5 movable flexor
spines on flexor margin; dactylus gently curved distally, 0.6—0.7
x propodus length, length about 7 x height, extensor margin
densely lined with stiff short setae on distal half, flexor margin
armed along entire length with 12—14 movable spines including
spine at base of unguis. End of P2 carpus not reaching end of PI
merus. P3 with similar spination and article proportions as P2;
merus 0.9 x P2 merus length, propodus and dactylus as long as
those of P2. P4 length 0.7—0.8 x P2 length; merus length 0.3—0.5
x pcl; propodus and dactylus similar in length to those of P3;
merocarpal articulation reaching hepatic marginal spine carapace.
Egg diameter. 0.65 mm.
Colour in life. Carapace pink anteriorly fading to white at
posterior, abdominal somite 2 white, somites 3—6 pink. P1 and
P2-4 white.
Genetic data. COI and 16S; see Table 1.
Etymology. Named lutruwita, the original name of Tasmania in
palawa kani,the language of the Tasmanian Aboriginal people,
with the approval of the Tasmanian Aboriginal Centre; used as
a noun in apposition.
Remarks. Munida lutruwita sp. nov. is very close to M.
manqingae Liu, Lin and Huang, 2013, described from a single
female specimen collected from hydrothermal vent fields at
2218 m in the south-western Indian Ocean. The spination of the
antenna and antennule is identical between the two species, but
the new species differs from M. manqingae 1n the following:
- the anterior branchial surface of M. lutruwita is rugose,
with 2 or 3 rows of small tubercles and a small spine
anteriorly, but smooth in M. manqingae.
- the P2 dactylus has 12-14 movable flexor spines in M.
lutruwita, but only 10 in M. manqingae.
132 A.W. McCallum, S.T. Ahyong & N. Andreakis
Figure 12. Munida lutruwita sp. nov., holotype, ovigerous female, cl 11.7 mm, pcl 7.8 mm (NMV J67481): A, carapace and abdomen, dorsal view;
B, right chela, dorsal view; C, right antenna and antennule, ventral view; D, sternum; E, telson. Scale: A-B = 1 mm, C-E = 2 mm.
Australian Munida
Munida lutruwita is also very similar to Munida
magniantennulata Baba and Türkay, 1992, described from
hydrothermal vents in the Lau Basin near Fiji, and the recently
described, M. alba Liu, Li and Lin, 2020, from the Eastern
Pacific Rise. Differences between the three species are as follows:
- the antennal article | mesial spine reaches the end of
article 2 1n M. lutruwita and M. alba, but does not reach as far
as the midpoint of article 2 1n M. magniantennulata.
- the supraocular spines are parallel or slightly convergent,
overreaching the eyes in M. lutruwita, while in M.
magniantennulata and M. alba, the suproacular spines are
133
slightly divergent and do not overreach the eyes.
- the frontal margins of the carapace are oblique in M.
lutruwita and M. alba rather than near-transverse in M.
magniantennulata.
- M. lutruwita and M. magniantennulata further differ
from M. alba in the presence of the distal flexor spine on the
maxilliped 3 merus (absent in M. alba) and unarmed outer
margin of the cheliped pollex (spinose in M. alba).
Distribution. Off southern Tasmania and the Great Australian
Bight, 1599-2040 m.
Figure 13. Munida lutruwita sp. nov., holotype ovigerous female, cl 11.7 mm, pcl 7.8 mm (NMV J67481): A, right P2 dactylus, lateral view; B,
left P2, lateral view; C, left P3, lateral view; D, left P4, lateral view; E, left maxilliped 3, lateral view. Scale = 1 mm.
134
Munida maatijadakurnaaku sp. nov.
http://zoobank.org/urn:lsid:zoobank.org:act:354E2119-60D1I-
498B-9595-32D05B1968BF
Figures 14, 15
Munida aff. rubiesi Macpherson, 1991. — Poore et al., 2008.
Type material. Holotype: WAM C78564, male (rostrum broken; pcl
9.0 mm), Western Australia, south-west of Kalbarri, 27° 56.106' S
113? 4.86' E to 27? 56.646' S 113? 5.28' E, 417—428 m, beam trawl,
$510/2005/98, 4 December 2005.
Description. Carapace. Length 1.2 x greatest width, widest at
midlength. Dorsal surface with numerous uninterrupted
transverse ridges and secondary transverse striae between
main ridges; ridges and striae lined with short, non-iridescent
setae and scattered long setae. Gastric region with 4 pairs of
epigastric spines, longest pair behind supraocular spines.
Hepatic region with short scales; parahepatic spine present.
Anterior part of branchial region between cervical groove and
postcervical groove with dorsal spine and 5 or 6 main ridges; |
postcervical spine; posterior part of branchial region with 8
main transverse ridges (excluding posterodorsal ridge) and 5
secondary striae laterally between main ridges. Cardiac region
with 5 main transverse ridges. Intestinal region with 2
transverse ridges, posterodorsal ridge distinct, with secondary
stria. Frontal margin inclined posteriorly at 106° from midline.
Lateral margins slightly convex; anterolateral spine slightly
divergent, horizontal, overreaching sinus between rostrum and
supraocular spine; hepatic marginal spine distinctly smaller
than anterolateral spine; branchial margin with 5 spines.
Rostrum broken; supraocular spines 0.4 x pcl, exceeding eyes.
Epistomial ridge straight ending slightly anterior to antennal
gland; mesial protuberance distinct.
Thoracic sternum. Sternal surface smooth, sternites 4 and
5 with few short striae. Sternite 3 0.4 x width of sternite 4;
median length of sternal plastron (sternites 4—7) 0.7 x width
of sternite 7. Sternite 4 anterior margin subtriangular,
narrowly contiguous with sternite 3.
Abdomen. Somite 2 with 5 pairs of spines on anterior
transverse ridge. Somites 2—4 each with 5 or 6 uninterrupted
striae behind anterior ridge. Somite 6 posteromedian
marginslightly convex, posterolateral margins slightly produced.
Telson with numerous transverse squamae; greatest width 1.6 x
median length; anterolateral margin slightly concave.
Eye. Maximum corneal diameter 0.4 x distance between
anterolateral spines.
Antennule. Basal article (distal spines excluded) overreaching
corneae; 2 long, subequal distal spines; 2 lateral spines, proximal
smaller, distolateral spine not exceeding distal spines.
Antenna. Article 1 with distomesial spine overreaching
distal margin of article 2. Article 2 with strong distomesial
spine significantly overreaching distal margin of article 4;
distolateral spine reaching distal margin of article 3. Articles
3 and 4 unarmed.
Maxilliped 3. Ischium 1.5 x merus length, with strong flexor
distal spine; merus with strong spine on flexor margin and small
spine distally, without spine on distal extensor margin.
Pl. Length 2.8 x pcl, with long plumose setae and
A.W. McCallum, S.T. Ahyong & N. Andreakis
iridescent setae, setae longest on dorsal surfaces. Merus length
1.1 x pcl, with a row of 8 dorsal spines and row of 4 spines on
mesial margin; distal spines strong, distomesial spine not
reaching midlength of carpus. Carpus 0.4 x merus length,
length 1.9 x width. Propodus 1.1 x merus length, fingers 0.6 x
total propodus length; pollex with row of 5 spines on lateral
margin; dactylus with row of 3 spines on dorsal margin, 5
spines on lateral margin and | small subdistal spine.
P2-4. Long, slender, with numerous scales on lateral sides
of meri; extensor margins with row of plumose and iridescent
setae. P2 length 2.3 x pcl, merus as long as carapace, length
about 7 x height, 4.0 x carpus length and 1.9 x propodus
length, row of spines on extensor margin, flexor margin row
of spines and well-developed distal spine; carpus with 2 small
spines and 2 large spines on extensor margin, distal spine on
flexor margin; propodus length 5.3 x height, with 9 small
movable flexor spines; dactylus compressed, almost straight,
as long as propodus length, length 8.6 x height, with 7
movable spines along the flexor margin, distal one-quarter
unarmed. P3 with similar spination and article proportions as
P2; merus slightly shorter than P2 merus (0.75); propodus and
dactylus slightly shorter than those of P2. P4 length 0.6 x P2
length; merus 0.4 x pcl, length 0.6 x P3 merus length;
propodus 0.8 and dactylus 0.9 x as long as those of P3.
Etymology. Named maatijada for crawling and kurnaaku for
crayfish/yabbie in Nhanda language at the Nhanda Language
Day (2 July 2019) at Bundiyarra-Irra Wanga Language Centre
in Geraldton; used as a noun in apposition.
Remarks. Despite the broken rostrum in the holotype, Munida
maatijadakurnaaku sp. nov. 1s clearly distinguished by a
number of diagnostic characters. It is most similar to M.
aequalis Ahyong and Poore, 2004, from eastern Australia,
which also has long and subequal distal spines on the basal
antennular article, a subtriangular sternite 4, slender P2—4
dactyli and similar antennal spination. The two species can be
distinguished by:
- the supraocular spines overreach the eyes in M.
maatijadakurnaaku but do not reach the end of the eyes in M.
aequalis
- antennal article 2 has the distomesial spine significantly
overreaching article 4 in M. maatijadakurnaaku, but only
slightly overreaching article 4 1n M. aequalis
- the P2—4 dactyli are as long as their respective propodi
in the new species, with only the distal one-quarter unarmed,
rather than slightly shorter than the propodus and unarmed on
the distal one-third in M. aequalis.
Distribution. Known only from Western Australia, 417—428 m.
Munida agave Macpherson and Baba, 1993
Figures 16A
Munida agave Macpherson and Baba, 1993: 387, figs 1, 2 (type
locality: Philippines). — Baba et al., 2008: 84. — Baba et al., 2009:
139, fig. 115.
Material examined. Western Australia: NMV J56008, 1 female (cl
11.6 mm, pcl 10.4 mm), Broome L25 transect, 16° 45.156' S,
Australian Munida 135
Figure 14. Munida maatijadakurnaaku sp. nov., holotype, 1 male with missing rostrum, pcl 9.0 mm (WAM C78564): A, carapace and abdomen,
dorsal view; B, right chela, dorsal view; C, right antenna and antennule, ventral view; D, sternum; E, telson. Scale A-E = 2 mm.
136
A.W. McCallum, S.T. Ahyong & N. Andreakis
Figure 15. Munida maatijadakurnaaku sp. nov., ] male with missing rostrum, pcl 9.0 mm (WAM C78564): A, right P2 dactylus, lateral view; B,
left P2, lateral view; C, left P3, lateral view; D, left P4, lateral view; E, left maxilliped 3, lateral view. Scale: A-E = 1 mm.
121° 027796 E to 16° 44.592' S, 121° 02.208' E, 100-108 m,
$505/2007/116, 30 June 2007; NMV J56099, Adele L28 transect,
14° 33.732' S, 122? 55.092' E to 14? 33.684' S, 122? 54.906' E, 95-105
m, $505/2007/161, 4 July 2007.
Colour. Carapace and abdominal somites 2—5 pale orange with
orange striae and spines, telson whiteish. Rostrum and
supraocular spines orange. Pl and P2-4 pale orange with
orange striae.
Genetic data. COI and 16S; see Table 1.
Remarks. This specimen agrees well with the description of the
holotype from the Phillipines, having arcuate striae on sternites
3—6 and two pairs of spines on the anterior ridge of abdominal
somite 2. This 1s the first record of the species from Australia.
Distribution. Japan, Philippines, Indonesia, Taiwan, 89-549 m.
North-western Australia, 55—108 m.
Australian Munida 13/
Figure 16. A, Munida agave Macpherson and Baba, 1993, female, cl 11.6 mm, pcl 10.4 mm (NMV J56008); B, Munida armilla Macpherson, 1994,
male, cl 16.1 mm, pcl 10.2 mm (NMV J55081); C-D, Munida asprosoma Ahyong and Poore, 2004, male, cl 13.2 mm, pcl 8.0 mm (J55076),
ovigerous female, cl 17.4 mm, pcl 10.7 mm (NMV J56016). Photos: K. Gowlett-Holmes.
138
Munida armilla Macpherson, 1994
Figure 16B
Munida armilla Macpherson, 1994: 446, figs 6, 65 [type locality:
New Caledonia]. — Baba et al., 2008: 87. — Macpherson, 2013: 296.
Munida aff. amathea — Poore et al., 2008: 20.
Material examined. Western Australia: NMV J55081, 1 male (cl 16.1
mm, pcl 10.2 mm),
Abrolhos, 28° 29.37' S, 113° 25.14' E to 28° 30.06' S, 113° 25.5' E,
416—431 m, SS10/2005/95, 2005.
Colour. Carapace and abdominal somites pink/white with
orange/reddish striae and spines. Rostrum white with red tip,
supraocular spines red at base and white distally, anterolateral
spines red. Walking legs with orange/red bands. Chela with
orange bands.
Genetic data. Not available.
Remarks. This single specimen differs slightly from the type
material of M. armilla Macpherson, 1994. In our specimen the
basal article of the antennule has subequal distal spines while
in the holotype the distomesial spine is slightly shorter than the
distolateral. In our specimen the carapace has interupted striae
while the holotype has numerous scales. This is the first record
of the species from Australia.
Distribution. New Caledonia, Matthew and Hunter Islands,
Tuscaroa Bank, Tonga, French Polynesia (Tarava seamounts,
Tuamoto and Society Archipelagos), 233—710 m. Western
Australia, 416—431 m.
Munida asprosoma Ahyong and Poore, 2004
Figure 16C—D
Munida asprosoma Ahyong and Poore, 2004: 20, fig. 3 (type
locality: east of Broken Bay, New South Wales, Australia). — Baba et
al., 2008: 87. — Baba et al., 2009: 146, figs 123—126. — Poore et al.,
2011: pl. 16D. — McEnnulty et al., 2011: app. 1.
Material examined. Western Australia: NMV J56016, 2 ovigerous
females (cl 16.3 mm, pcl 10.2 mm; cl 17.4 mm, pcl 10.7 mm), Mermaid
L24 transect, 16° 38.064' S, 119° 09.216' E to 16° 38.766' S,
119? 08.034' E, 983—993 m, 8805/2007/68, 17 June 2007;
NMV J56096, 1 female (cl 13.9 mm, pcl 8.3 mm), 1 juvenile (cl
10.3 mm, pcl 6.0 mm), Mermaid L24 transect, 16° 44.286' S,
119° 15.042' E to 16° 43.794' S, 119° 15.48' E, 693-698 m,
SS05/2007/70, 17 June 2007; NMV J56393, 2 females (pcl 6.7-8.1
mm; #B, ZA), 1 male (pcl 5.0 mm; #C), Leveque L27 transect,
14° 33.06' S, 121° 15.366' E to 14? 33.588' S, 121° 16.56' E, 1021—1023
m, SS05/2007/155, 3 June 2007; NMV J57258, 1 ovigerous female (cl
20.6 mm, pcl 12.7 mm), $805/2007/155; NMV J55077, 1 male (cl 20.4
mm, pcl 12.2 mm), Perth Canyon, 31° 57.9' S, 115° 06.3' E to
31° 56.982' S, 115? 07.08' E, 928-1170 m, SS10/2005/73, 30 November
2005; NMV J55078, 4 ovigerous females (cl 18.7 mm, pcl 10.7 mm to
cl 22.1 mm, pcl 13.6 mm), 19 females (cl 14.4 mm, pcl 8.6 mm to cl
23.5 mm, pcl 14.5 mm), 11 males (cl 12.4 mm, pcl 7.4 mm to cl 26.5
mm, pcl 15.9 mm), SS10/2005/73; NMV J55076, 3 males (cl 13.2 mm,
pcl 8.0 mm to cl 21.5 mm, pcl 12.8 mm), Abrolhos, 29° 00.594' S,
113? 42.78' E to 29? 01.512' S, 113? 43.32' E, 700—704 m, SS10/2005/85,
2 December 2005; NMV J55079, 1 female (cl 16.9 mm, pcl 10.4 mm),
5 males (cl 15.9 mm, pcl 9.6 mm to cl 26.1 mm, pcl 16.1 mm),
SS10/2005/85.
A.W. McCallum, S.T. Ahyong & N. Andreakis
Colour. Carapace, abdomen, chela and P2—4 pale pink. Reddish
on distal portion of fingers, antenna and posterior margin of
carapace. One specimen photographed is different in colour
from the other two photographed specimens. This specimen
was collected from the Abrolhos station at ~/00 m (male, cl
13.2 mm, pcl 8.0 mm, NMV J55076). The carapace is white
with orange on the striae and abdominal somites 2—3, P2—4 are
white, the chelae are orange with white fingers.
Genetic data. COI; see Table 1.
Remarks. The present specimens of M. asprosoma from Western
Australia accord well in most respects with those from eastern
Australia (Ahyong and Poore, 2004). Three juveniles (NMV
J56393; pcl 5.0—8.1 mm), however, differ from adults in having
lesser developed abdominal spination: the median pair of spines
on the anterior ridge of abdominal somite 2 is well developed but
spines laterad are either incipent or minute, and the anterior ridge
of somite 3 is unarmed. Thus, the diagnostic spination of the
abdominal somites may not be fully developed in juveniles and
care should be taken when identifying small specimens.
The COI sequences of M. asprosoma were only 1.3%
divergent from Munida hoda Macpherson, Rodriguez-Flores
and Machordom, 2017, from Mozambique. Intraspecific
divergence between the three specimens sequenced here was
0.3—0.6%. These species share a number of morphological
characters including: the presence of 5 spines on the branchial
lateral margins of the carapace, strongly oblique frontal
carapace margins, absence of secondary striae between the
widely spaced primary striae, spines along the anterior ridge
of the abdominal somite 2, large eyes, and the distomesial
spine of the antennular article | shorter than the distolateral
spine. They can easily be distinguished by the presence of
spines on abdominal somite 3 in adults of M. asprosoma, and
the flexor spination of the P2 dactyli, with 7—9 spines in M.
asprosoma and only 4 spines in M. hoda. One of the
specimens photographed had a different colour pattern from
the others (NMV J55076, male pcl 8.0 mm; see above) but we
could find no other morphological characters to distinguish
this specimen from the others. Similarly, Baba et al. (2009)
showed a number of distinct colour morphs of M. asprosoma
from Taiwan, not dissimilar to the variation reported here,
and in some cases different from that of the holotype (Poore
et al. 2011: pl. 16D).
Distribution. Eastern Australia (New South Wales and
Queensland), Vanuatu, Taiwan, 495—1802 m. Western Australia,
700—1170 m.
Munida babai Tirmizi and Javed, 1976
Munida babai Tirmizi and Javed, 1976: 81—85, fig. 1, 2 (type
locality: off Natal, South Africa). — Baba et al., 2008: 88. —
McEnnulty et al., 2011: app. 1.
Material examined. Western Australia: NMV J55044, 2 males (cl 7.7
mm, pcl 5.1 mm to cl 7.8 mm, pcl 5.3 mm), Ningaloo North,
21? 58.704' S, 113? 49.2' E to 21? 59.052' S, 113? 492' E, 170—177 m,
$510/2005/152, 10 December 2005; NMV J55041, 2 males (cl 7.8 mm,
pel 5.3 mm; cl 9.2 mm, pcl 5.9 mm), Ningaloo North, 21° 59.172' S,
113? 49.2' E to 21° 59.79' S, 113? 49.14' E, 165—166 m, SS10/2005/153,
Australian Munida
11 December 2005; NMV J55042, 3 females (cl 6.0 mm, pcl 3.8 mm;
cl 6.1 mm, pcl 4.0 mm), 4 males (cl 7.7 mm, pcl 5.0 mm; cl 8.1 mm, pcl
5.7 mm), Barrow Island, 20° 59.082' S, 114° 54.42' E to 20° 59.67' S,
114° 54.54' E, 100-101 m, SS10/2005/170, 13 December 2005.
Genetic data. CO1; see Table 1.
Remarks. Originally described from off South Africa (off Natal),
M. babai has subsequently been reported from shelf depths
across the Indian Ocean as far east as Hong Kong (Baba, 1988).
It can be distinguished by the presence of spines on the anterior
margin of abdominal somite 4 and very short supraocular spines.
As noted by Baba (1988), the number of spines on the abdominal
somites is variable. We found abdominal somite 2 with 5—9
spines, somite 3 with 2—5, and somite 4 with 2—5 spines. The P2
dactylus is 0.75 the length of the propodus in Australian
specimens compared to 0.64 for the type (based on Tirmizi and
Javed, 1976: fig. 2D), and 0.84 for the Albatross material from
Hong Kong and the Phillipines (Baba, 1988). This is the first
record of the species from Australia.
Distribution. South Africa, Madagascar, Hong Kong, Malaysia,
70—456 m. Western Australia, 100—177 m.
Munida benguela de Saint Laurent and Macpherson, 1988
Munida benguela de Saint Laurent and Macpherson, 1988: 106,
figs 1, 2a, 2c, 3a, 3d, 3f-1 (type locality: south of Namibia). — Baba et
al., 2008: 89.
Material examined. Western Australia: NMV 3756405, 1 male
(damaged; cl 11.6 mm, pcl 8.2 mm), SSO5/2007/176, Kulumburu L29
transect, 13? 13.482' S 123? 23.742' E to 13? 13.338' S 123? 23.286' E,
392 m, 5 July 2007.
Genetic data. Not available.
Remarks. Although this specimen is damaged, most diagnostic
characters are evident. In M. benguela, the P2 dactylus has 6—8
spines with the ultimate being distant from the unguis. Similarly,
our specimen has 8 spines and is unarmed on the distal one-
third. In M. benguela, the fixed finger of the chela has at least 4
spines on the lateral margin which agrees with our specimen.
However, our specimen lacks any spines on the mesial margin
of the moveable finger while M. benguela has a subdistal spine
and an additional 2—4 spines on the mesial margin.
Distribution. South African coast between S Namibia and
Natal, and Madagascar; 352-1000 m. North-west Australia,
302 m.
Munida compacta Macpherson, 1997
Figure 17A-C
Munida compacta Macpherson, 1997: 605—606, fig. 2 (type
locality: Kei Islands, Indonesia). — Baba et al., 2008: 90.
Munida andamanica. — Poore et al., 2008: 19. — McEnnulty et
al., 2011: app. 1,2.
Material examined. Queensland. AM P89035, 2 ovigerous females (pcl
11.7-13.5 mm), east of Cape York, 10° 29.810' S, 144° 01.380' E, 596 m,
RV Franklin, FRO688-02, 20 August 1988. Western Australia. AM
P72138, 1 ovigerous female (cl 26.5 mm, pcl 19.7 mm), 240 km north-
west of Port Hedland, 18° 06' S, 117? 45' E, 500 m, RV Soela, SO2/82/31,
139
coll. J. Paxton, 7 April 1982; NMV J56402, 1 male (cl 14 mm, pcl 7.0
mm), Onslow L19 transect, 20° 07.962' S, 114° 58.71' E to 20° 07.584' S,
114° 58.416' E, 415—470 m, S805/2007/15, 11 June 2007; NMV J56409,
4 females (cl 18.8 mm, pcl 11.6 mm; cl 26.5 mm, pcl 18.0 mm), Dampier
L20 transect, 19° 43.548' S, 115° 20.604' E to 19? 43.764' S,
115? 21.144' E, 415—428 m, S805/2007/28, 12 June 2007; NMV J56414,
] male (cl 14.5 mm, pcl 7.5 mm), SSO5/2007/28; NMV J56408, 1 male
(cl 17.9 mm, pcl 11.3 mm), Hedland L22 transect, 18° 34.194' S,
117? 27.864 E to 18? 34.062' S, 117° 28.626' E, 401—405 m,
SS05/2007/52, 14 June 2007; NMV J55266, 1 female (cl 13.5 mm, pcl
5.5 mm), Imperieuse L23 transect, 17° 21.492' S, 118° 57.312' E to
17? 20.88' S, 118° 56.802' E, 437—446 m, SS05/2007/56, 15 June 2007;
NMV J56412, 2 males (cl 24.7 mm, pcl 16.5 mm; cl 25.0 mm, pcl 16.6
mm), SSO5/2007/56; NMV J56411,3 males (cl 15.7 mm, pcl 9.5 mm to
cl 18.0 mm, pcl 11.2 mm), | ovigerous female (cl 27.3 mm, pcl 18.1
mm), Imperieuse L23 transect, 17° 31.734 S, 118° 50.6l' E to
17? 32.508' S, 118? 50.352' E, 403-407 m, SS05/2007/57, 15 June 2007;
NMV J56426, | female (cl 14.4 mm, pcl 7.6 mm), 5805/2007/57; NMV
J55260, 3 ovigerous females (cl 23.9 mm, pcl 16.0 mm to cl 25.9 mm,
pel 24.0 mm), Imperieuse L23 west transect, 17° 31.044' S,
118° 51.162' Eto 17? 31.716' S, 118° 50742 E,405—406 m, SS05/2007/64,
16 June 2007; NMV J55265, 1 male (cl 12.4 mm, pcl 7.5 mm),
$505/2007/64; NMV J55990, 1 female (18.9 mm, pcl 13.4 mm), 1
Juvenile (cl 9.5 mm, pcl 8.4 mm), SSO05/2007/64; NMV J56406, 1 male
(cl 11.5, pcl 10.5 mm), SSO5/2007/64; NMV J56410, 1 ovigerous female
(cl 24.5 mm, pcl 16.7 mm), Leveque L27 transect, 14° 50.814' S,
121° 26.436' E to 14° 5094' S, 121° 28.164' E, 382-401 m,
3305/2007/102, 26 June 2007; NMV J56080, 8 males (cl 19.9 mm, pcl
14.7 mm to cl 26.7 mm, pcl 16.9 mm), 3 females (cl 21.9 mm, pcl 14.8
mm to cl 25.7 mm, pcl 18.3 mm), Leveque L27 transect, 14° 51.198' S,
121° 25.878 E to 14° 50724' S, 121° 27.012" E, 396-403 m,
SS05/2007/144, 2 July 2007; NMV J56081, 2 females (cl 20.6 mm, pcl
12.6 mm; cl 22.4 mm, pcl 15.1 mm), | juvenile (cl 14.9 mm, pcl 9.2
mm), Ashmore L30 transect, 12° 28.884' S, 123° 25.062' E to
12? 29.958' S, 123? 25.002' E, 397—405 m, SS05/2007/189, 6 July 2007;
NMV J55994, 4 ovigerous females (cl 22.4 mm, pcl 15.1 mm to cl 23.5
mm, pcl 15.6 mm), | female (cl 24.1 mm, pcl 16.3 mm), 3 males (cl 19.6
mm, pcl 12.9 mm to cl 24.4 mm, pcl 16.3 mm), Ashmore L30 transect,
12? 31.77' S, 123? 25.638' E to 12? 30.828' S, 123? 25.362' E, 401—404
m, SS05/2007/192, 6 July 2007; NMV J55051, 1 female (cl 14.4, pcl 9.0
mm), Barrow Island, 21° 00.402' S, 114° 22.86' E to 21° 00.042' S,
114? 22.5' E, 399-408 m, SS10/2005/172, 13 December 2005.
Colour. Carapace and abdominal somites 2—4 pale orange/
pink. Rostrum red, supraocular spines white or red and white
on distal half. Pl pale orange/pink with white fingers, P2—4
pale orange on meri and carpi, white on propodi, dactyli white
with red tips.
Genetic data. COI and 16S; see Table 1.
Remarks. Munida compacta 1s very close to M. rubridigitalis
Baba, 1994, and M. julumunyju sp. nov. from eastern and
western Australia, respectively, and M. rhodonia, from New
Caledonia. These species can be distinguished by:
- the dactylus of P2 is similar in length (0.8—1.0) to the
propodus in M. compacta and distinctly shorter (0.8) in
M. rhodonia
- chelipeds with well-developed spines on the dorsal face
of the palm in M. compacta, which are instead very small in
M. rhodonia.
While the length of the distomesial spine of the Pl merus
was used to differentiate these species (Baba, 1997), we found
140 A.W. McCallum, S.T. Ahyong & N. Andreakis
I:
Figure 17. A-C, Munida compacta Macpherson, 1997, female, dorsal view and lateral (NMV J56409), female 18.9 mm, pcl 13.4 mm (NMV
J55990); D, Munida endeavourae Poore and Ahyong, 2004, ovigerous female, cl 21.7 mm, pcl 13.9 mm (NMV J55052); E, Munida gordoae
Macpherson, 1994 (NMV J56420). Photos: K. Gowlett-Holmes, CSIRO.
Australian Munida
that that the length of this spine varied in our specimens of M.
compacta and did not always overreach the midlength of the
carpus. Also, the P2 dactylus 1n M. compacta 1s described as
clearly shorter than the propodus, but in our specimens, the
P2 dactylus was 0.8—1.0 times the propodus length.
The sequences of M. compacta from north-western
Australia and M. rhodonia from New Caledonia were 1.2%
divergent for COI and 0.2% divergent for 165.
The present specimens represent the first confirmed
records of M. compacta from Australia.
Distribution. Indonesia, Kei Islands, 246—694 m. Queensland
and Western Australia, 397—470 m.
Munida compressa Baba, 1988
Munida compressa Baba, 1988: 91, figs 33, 34 (type locality:
Moluccas, Indonesia). — Baba et al., 2008: 91. — Baba et al., 2009:
152, figs 130—134. — Poore et al., 2011: pl. 16H (colour).
Material examined. Western Australia: NMV J55980, 1 male (cl 21.2
mm, pcl 13.0 mm), Kulumburu L29 transect, 13° 13.482' S,
123? 23.742' E to 13° 13.338' S, 123° 23.286' E, 392 m, SS05/2007/176,
5 July 2007; NMV J55981, 4 males (cl 12.0 mm, pcl 8.2 mm; cl
18.6 mm, pcl 12.1 mm), Ashmore L30 transect, 12° 28.884' S,
123? 25.062" E to 12? 29958' S, 123? 25.002' E, 397-405 m,
SS05/2007/189, 6 July 2007.
Genetic data. 16S and COI; see Table 1.
Remarks. This 1s the first record of the Munida compressa
from Australia. Sequences from our material and a specimen
from the Solomon Islands (Machordom and Macpherson,
2004) were 0.2% divergent for COI and invariant for 165.
Distribution. Indonesia, Japan, Taiwan, Arafura Sea, 180—668
m. North-west Australia, 392—405 m.
Munida distiza Macpherson, 1994
Munida distiza Macpherson, 1994: 459, figs 14, 68, 69 (type
locality: New Caledonia). — Baba et al., 2008: 93. — Macpherson,
2013: 300.
Material examined. NMV J56487, 1 ovigerous female (cl 20.3 mm,
pel 12.6 mm), 1 male (cl 18.7 mm, pcl 12.4 mm), Barrow L1 transect,
21° 00.816' S, 114° 39.15' E to 21° 00.78' S, 114° 38.898' E, 258—271 m,
SS05/2007/11, 10 June 2007.
Genetic data. COI and 16S; see Table 1.
Remarks. COI sequences from this material were 4-5%
divergent from sequences of Munida distiza Macpherson,
1994, from New Caledonia. However, we could not find any
distinguishing morphological characters.
Distribution. Philippines, New Caledonia, Loyalty Islands,
Matthew and Hunter Islands, French Polynesia, 150—540 m.
North-west Australia, 258—271] m.
Munida endeavourae Ahyong and Poore, 2004
Figure 17D
Munida endeavourae Ahyong and Poore, 2004: 26, fig. 5 (type
locality: south-east of Green Cape, New South Wales, Australia). —
141
Baba et al., 2008: 94. — Yaldwyn and Webber, 2011: 211. — Farrelly
and Ahyong, 2019: 13,54. — Yan et al. 2020: 2, tab. 1.
Munida grievae Vereshchaka, 2005: 140, fig. 3A—F (type locality:
Bay of Plenty, New Zealand).
Munida sp. MoV 5199. — Poore et al., 2008: 21, unnumbered
figure (lower right). —McEnnulty et al., 2011, app. 1, 2.
Material examined. Western Australia: NMV J55052, 1 ovigerous
female (cl 21.7 mm, pcl 13.9 mm), Albany, 35° 26.046' S, 118° 21.06' E
to 35? 26.19' S, 118? 20.64' E, 912—922 m, SS10/2005/28, 23 November
2005. Tasmania: MV J59312, 1 specimen, Cascade Plateau,
43° 49/706' S, 150° 29.999' E, 1061 m, TT 01/2008/J2-390-015, 4
January 2009; MV J59310, 1 specimen, Hill off St. Helens,
41° 14.349' S, 148° 49.293' E, 1309 m, TT 01/2008/J2-389-006, 1
January 2009.
Colour. Carapace, abdomen, chela and P2—4 pink. Eggs red.
Genetic data. COI and 16S; see Table 1.
Remarks. Poore et al. (2008) and McEnnulty et al. (2011)
recorded M. endeavourae from south-western Australia as
"Munida sp. MoV 5199”; the present record is the first
confirmation of the species from the area.
Distribution. South-eastern Australia from south-east of Green
Cape to Tasmania, 620—1700 m. South-western Australia, 912—
022? m
Munida gordoae Macpherson, 1994
Figure. I7E
Munida gordoae Macpherson, 1994: 469, fig. 18 (type locality:
Chesterfield Islands). — Baba et al., 2008: 97.
Munida aff. volantis. — Poore et al., 2008, 20, unnumbered fig.
— McEnnulty et al., 2011: 26, app. 1,2.
Material examined. Western Australia: NMV J56420, 3 ovigerous
females (cl 5.7 mm, pcl 3.5 mm to cl 8.2 mm, pcl 5.3 mm), 8 males (cl 5.1
mm, pcl 2.9 mm to cl 8.1 mm, pcl 6.1 mm), 2 juveniles (cl 4.8 mm, pel 3.1
mm; cl 5.1 mm, pcl 3.2 mm), Imperieuse L23 east transect, 17° 35.706' S,
118° 58.902' E to 17° 35.346' S, 118? 58.794' E, 140—108 m, SS05/2007/62,
16 June 2007; NMV J55087, 3 males (cl 10.0 mm, pcl 6.3 mm to cl 11.2
mm, pcl 7.2 mm), Two Rocks, 31° 37.452' S, 115° 00.24' E to 31° 37.71' S,
115° 00.18' E, 205-210 m, SS10/2005/11, 19 November 2005; NMV
J55085, 1 male (cl 12.0 mm, pcl 6.3 mm), Perth Canyon, 31^ 55.26' S,
115° 12.12' E to 31° 55.446' S, 115? 11.76' E, 194—232 m, SS10/2005/69,
29 November 2005; NMV J55088, | female (cl 11.0 mm, pcl 6.3 mm),
Abrolhos, 28° 59.328' S, 113? 47.04' E to 28° 59:784' S, 113° 47.28' E,
180—183 m, SS10/2005/91, 3 December 2005; NMV J55086, 5 ovigerous
females (cl 7.3 mm, pcl 4.8 mm to cl 11.2 mm, pcl 7.4 mm), 1 damaged
male, Kalbarri, 27? 55.716' S, 113? 08.28' E to 27° 56.022' S, 113° 08.64" E,
252—253 m, SS10/2005/99, 4 December 2005.
Colour. Carapace and abdominal somite 2—3 pink and orange
patterning. Abdominal somite 4—6 with white markings.
Rostrum and supraocular spines orange/pink. Chela and P2-4
orange/red with white bands.
Genetic data. COI and 16S.
Remarks. These are the first records of M. gordoae from
Australia. Sequence divergence between our north-western
Australian specimens of M. gordoae and those from New
Caledonia was only 0.2% for COI and 0.4% for 16S.
142
Distribution. New Caledonia, Loyalty Islands, Matthew and
Hunter Islands, and Chesterfield Islands, Vanuatu, Fiji, 850—500
m. Western Australia, 180—232 m.
Munida gracilis Henderson, 1885
Figure 18
Munida gracilis Henderson, 1885: 412 (type locality: New
Zealand, 38° 50' S, 169? 20' E). — Baba et al., 2008: 97. — Yaldwyn
and Webber, 2011: 212. — Yan et al. 2020: 2, tab. 1.
Munida chydaea Ahyong and Poore, 2004: 24, fig. 4 (type locality:
east of Brush Island, New South Wales, Australia). — Poore, 2004:
234, fig. 64b. — Baba, 2005: 260. Syn. nov.
Munida disgrega Baba, 2005: 103, figs 40, 41 (east of Victoria,
Australia). — Poore et al., 2008: 19. — McEnnulty et al., 2011: app. 1.
Syn. nov.
Material examined. South Australia: SAM C7658, 1 ovigerous female
(cl 32.3 mm, pcl 18.5 mm), | damaged specimen (cl 18.5 mm, pcl 10.6
mm), Great Australian Bight, 33° 27.09' S, 130° 41.19' E, 500 m, BPZ
2010/500, 2010.
Western Australia: NMV J55107, 2 females (cl 24.8 mm, pcl 13.7
mm; cl 26.1 mm, pcl 15.5 mm), 3 males (cl 20.6 mm, pcl 11.2 mm to cl
21.9 mm, pcl 12.1 mm), Bald Island, 35° 14.022' S, 118° 39.84' E to
35° 13.674' S, 118° 40.5' E, 710—728 m, SS10/2005/32, 2005; NMV
J55106, 6 females (cl 11.4 mm, pcl 6.3 mm to cl 25.4 mm, pcl 14.3
mm), 10 males (cl 12.4 mm, pcl 7.4 mm to cl 24.0 mm, pcl 13.6 mm),
Bald Island, 35? 14.022' S, 118? 39.84' E to 35? 13.674' S, 118? 40.5' E,
710—728 m, SS10/2005/32, 23 November 2005; NMV J55083, 3 males
(cl 27.9 mm, pcl 19.5 mm to cl 47.8 mm, pcl 34.9 mmy), Pt Hillier,
35° 22.902' S, 117° 12.42' E to 35° 22.902' S, 117° 12.42' E, 539 m,
SS10/2005/19, 2005; NMV 755080, 1 female (pcl 7.9 mm), Albany,
35? 22.29' S, 118? 19.98' E to 35? 22.644' S, 118? 19.26' E, 685—695 m,
A.W. McCallum, S.T. Ahyong & N. Andreakis
SS10/2005/27, 2005; NMV J55084, 16 females (cl 20.9 mm, pcl 11.9
mm to cl 36.6 mm, pcl 19.6 mm), 19 males (cl 14.3 mm, pcl 9.0 mm to
cl 30.2 mm, pcl 17.9 mm), Albany, 35° 22.14' S, 118° 20.1' E to
35? 22.518' S, 118? 19.32' E, 676—680 m, SS10/2005/29, 2005; NMV
J55082, 1 female (cl 9.1 mm, pcl 7.0 mmy), 2 males (cl 17.4 mm, pcl 7.8
mm; cl 15.1 mm, pcl 9.9 mm), Bald Island, 35° 12.81' S, 118° 39.06' E
to 35? 12.24' S, 118° 40.14' E, 408—431 m, SS10/2005/34, 2005.
New Zealand: NIWA 53772, | female (cl 23.3 mm, pcl 15.8 mm),
44? 09.47' S, 174? 33.32' W to 44? 09.48' S, 174? 33.56' W, 520—650 m,
TANO905/103, 26 June 2009; NIWA 54087, 1 ovigerous female (cl
21.0 mm, pcl 12.2 mm), Diamondhead Peak B, Andes Seamounts,
44° 08.97' S, 174° 45.41' W to 44? 09.02' S, 174? 45.63' W, 519—609 m,
TANO905/113, 27 June 2009; NIWA 54108, 1 female (cl 24.4 mm, pcl
13.9 mm), Diamondhead Peak B, Andes Seamounts, 44° 08.99' S,
174? 46.09' W to 44? 09.01' S, 174° 46.3' W, 830—900 m, TAN0905/114,
27 June 2009; NIWA 63655, 4 males (pcl 5.4-7.7 mm), Site 3a
seamount, Hikurangi Margin, 41° 19.16'S, 176° 11.84' Eto 41° 19.28'S,
176° 11.53' E, 495 m, TAN1004/66, 21 April 2010.
Genetic data. CO1 and 16S; see Table 1.
Remarks. Munida gracilis 1s a common species in New
Zealand, usually from depths of 300—600 m with a recorded
range of about 100-1200 m (Yan et al. 2020), that is
morphologically closest to the Australian Munida chydaea
Ahyong and Poore, 2004. COI sequences of specimens
corresponding to Munida chydaea Ahyong and Poore, 2004,
from south-western Australia, however, were only 0.9-1.0%
divergent from M. gracilis from New Zealand and 0.2%
divergent for 165. This low level of sequence divergence led us
to further examine the morphological distinctions between M.
gracilis and M. chydaea. Ahyong and Poore (2004)
distinguished the two species based on the number of anterior
(FA 0 Xu
| s RN
South-west Australia
Great Australian Bight
a
Tasmania
Se
New Zealand
Figure 18. Munida gracilis Henderson, 1885. Variation of P2 dactyli. A. female cl 32 mm, 18.3 mm; B. male cl 26.2 mm, pcl 15.5 mm (NMV
J55048); C, ovigerous female, cl 32.3 mm, pcl 18.5 mm (SAM C7658); D, male cl 21.2 mm, pcl 11.9 mm (NMV J53574); E, female, cl 30.0 mm
(J53574); F, female cl 23.5 mm, pcl 15.8 mm (NIWA 53772); G, ovigerous female, cl 21.0 mm, pcl 12.2 mm (NIWA 54087).
Australian Munida
spines on abdominal somite 3 (1 or 2 spines in M. chydaea; 4
spines in M. gracilis), the length of the unarmed flexor margin
of the P2 dactyli (distal one-quarter in M. chydaea versus
distal one-third in M. gracilis), spinules on the outer margin of
antennal articles 3 and 4 in M. chydaea (absent in M. gracilis)
and more numerous transverse abdominal striae in M.
chydaea. Our comparisons between new Australian and New
Zealand specimens, however, failed to identify consistent
distinguishing features. Although the many specimens
examined by Ahyong and Poore (2004), primarily from from
eastern Australia, were consistent in the aforementioned
features, Specimens examined herein from southern Australia
(Tasmania, South Australia and Western Australia) and New
Zealand exhibit morphological overlap. Thus, the shape and
armature of the P2 dactyli in southern Australian specimens is
variable, with the flexor margin unarmed on the distal one-
fifth to one-third (fig. 21 A—E). Similar variation was seen in
the eight New Zealand specimens we examined; in most
specimens, the distal one-third of the P2 dactylus was unarmed
(fig. 21F) but in one ovigerous female (pcl 12.2 mm; NIWA
54087; Fig. 21G), the distal one-quarter was unarmed.
similarly, abdominal somite 3 1s variously armed with 2—4
spines, albeit usually 4 in adult New Zealand specimens, and
almost always 2 in adult southern Australian specimens.
Another character used to distinguish M. chydaea was the
presence of outer spinules on the third and fourth antennal
article, but such spinules were present on all eight of the
specimens of M. gracilis we examined from New Zealand.
Thus, considered as a whole, Australian material is not reliably
morphologically separable from New Zealand specimens, and
given the minimal divergence between New Zealand and
Western Australian sequences, we consider both populations
as probably conspecific.
This brings Munida disgrega Baba, 2005, to our attention,
which was described from 4 small specimens (cl 10.1—13.0
mm) collected from south-eastern Australia and noted as very
close to M. chydaea and M. gracilis. In M. disgrega, the flexor
margin of the dactylus 1s unarmed on the distal one-quarter to
one-fifth, which is encompassed by the newly observed
variation in M. gracilis and M. chydaea. Other distinguishing
features of M. disgrega, such as the length of the chela, the
lesser striation and broader anterior margin of the thoracic
sternum, and proportionately wider eyes apppear to be
allometric differences given the small size of the type
specimens. Consequently, we cannot reliably distinguish M.
disgrega from M. gracilis or M. chydaea
Although we do not have molecular data from eastern
Australia (type region of M. chydaea), on the basis of the low
molecular divergence (between New Zealand and south-
western Australian specimens) and morphological variability
within southern Australian specimens that encompasses those
from New Zealand and eastern Australia, we regard M.
chydaea and M. disgrega as junior synonyms of M. gracilis.
Munida gracilis 1s closely related to, but clearly distinct from,
M. haswelli, with 7.6% divergence in COI and 3.3% in 165.
Distribution. Southern Australia (Sydney to south-western
Australia), 146—700 m. New Zealand, 365—610 m.
143
Munida haswelli Henderson, 1885
Figure 19A
Munida haswelli Henderson, 1885: 411 (type locality: off southern
New South Wales, Australia). — Baba et al., 2008: 98. — McEnnulty
et al., 2011: app. 1, 2. — Farrelly and Ahyong, 2019: 13, 54, fig. 96.
Material examined. Western Australia: NMV J60017, 2 males (cl 19.5
mm, pcl 12.3 mm; cl 19.6 mm, pcl 12.5 mm), Ashmore L30 transect,
12? 26.058' S, 123? 36.078' E, 125 m, 8805/2007/186, 6 June 2007;
NMV 3755102, 1 male (cl 12.1 mm, pcl 7.4 mm), Two Rocks,
31° 37.452' S, 115? 00.24' E to 31? 37.71' S, 115? 00.18' E, 205—210 m,
$S10/2005/11, 19 November 2005; NMV J55103, 1 male (cl 19.6 mm,
pel 12.8 mm), SS10/2005/11; NMV J55104, 3 ovigerous females (cl
14.0 mm, pcl 9.0 mm to cl 15.4 mm, pcl 10.2 mm), 2 males (cl 11.4 mm,
pel 7.2 mm; cl 16.4 mm, pcl 10.4 mm), Bald Island, 35° 11.442' S,
118° 38.7' E to 35? 11.25' S, 118° 39' E, 147—157 m, SS10/2005/35, 24
November 2005; NMV J55105, 5 ovigerous females (cl 11.5 mm, pcl
7.5 mm to cl 15.2 mm, pcl 8.9 mm), 5 males (cl 12.3 mm, pcl 7.9 mm
to cl 16.4 mm, pcl 11.3 mm), Bald Island, 35° 11.406' S, 118° 38.94' E.
to 35? 11.514' S, 118? 38.76' E, 161-169 m, SS10/2005/38, 24 November
2005; NMV J55108, 4 ovigerous females (cl 14.4 mm, pcl 9.3 mm to cl
16.0 mm, pcl 10.8 mm), 9 females (cl 11.3 mm, pcl 7.7 mm to cl 16.1
mm, pcl 11.2 mm), 18 males (cl 13.6 mm, pcl 9.1 mm; cl 21.4 mm, pcl
14.5 mm), Albany, 35° 21.276' S, 118° 17.94' E to 35° 21.348' S,
118° 17776' E, 179 m, SS10/2005/47, 25 November 2005; NMV J55109,
4 females (largest with broken rostrum; pcl 6.2-9.5 mm), 3 males (cl
11.9 mm, pcl 7.6 mm; cl 13.9 mm, pcl 9.0 mm), Pointt Hillier,
35? 22 A1' S, 117? 11.82' E to 35? 22.404' S, 117? 12.24' E, 195-196 m,
SS10/2005/57, 27 November 2005; NMV J55099, 3 ovigerous females
(cl 11.2 mm, pcl 7.5 mm to cl 11.5 mm, pcl 7.7 mm), 11 males (one with
rhizocephalan externa; cl 8.6 mm, pcl 6.1 mm to cl 11.8 mm, pcl 8.7
mm), Ningaloo North, 21° 59.172' S, 113° 49.2' E to 21° 59.79" S,
113° 49.14' E, 165-166 m, SS10/2005/153, 11 December 2005; NMV
J55101, 1 ovigerous female (cl 10.4 mm, pcl 7.2 mm), Ningaloo North,
21° 56.628' S, 113° 50.46' E to 21? 57.09' S, 113° 50.28' E, 132-134 m,
SS10/2005/163, 12 December 2005.
Colour. Carapace and somites 2—4 pale orange, somites 5—6
and telson white. Rostrum and supraocular spines orange.
Chela orange/pink with red bands on distal half of palm. P2—4
whitish pink with red bands on middle of propodus.
Genetic data. COI and 16S; see Table 1.
Remarks. Munida haswelli and Munida gracilis are closely
related, with 7.6% divergence in COI and 3.3% divergence in
165.
Distribution. Central New South Wales, south to Victoria,
lasmania, South Australia, the Great Australian Bight and
Western Australia, 121—329 m.
Munida heteracantha Ortmann, 1892
Munida heteracantha Ortmann, 1892: 255, pl. 11 fig. 12, 121, 12k
(type locality: Sagami Bay, Japan). — Baba et al., 2008: 99. — Poore
et al., 2008: 19. — McEnnulty et al., 2011: app. 1. — Castro, 2011: 16
Munida sp. MoV 5214. — Poore et al., 2008: 21.
Material examined. Western Australia: NMV J55037, ovigerous
female (cl 9.4 mm, pcl 6.35 mm), | ovigerous female (cl 9.5 mm, pcl
7.2 mm), 4 females (cl 8.3 mm, pcl 5.3 mm to cl 9.3 mm, pcl 6.6 mmy),
4 males (cl 6.9 mm, pcl 4.4 mm to cl 10.5 mm, pcl 6.7 mm), 3 juveniles
(cl 6.1 mm, pcl 4.1 mm to cl 6.6 mm, pcl 4.5 mm), Ningaloo South,
144 A.W. McCallum, S.T. Ahyong & N. Andreakis
Figure 19. A, Munida haswelli Henderson, 1885, male cl 19.55 mm (NMV J55103), pcl 12.81 mm; B-D, Munida leagora Macpherson, 1994, |
Juvenile cl 12.2 mm, pcl 7.5 mm (NMV J56018), undetermined specimen (NMV J55999; NMV J56004). Photos: K. Gowlett-Holmes.
Australian Munida
22° 04.77' S, 113° 47.76' E to 22° 05.238' S, 113° 47.64' E, 201-206 m,
SS10/2005/146, 10 December 2005; NMV J55038, 1 male (cl 10.7, pcl
7.4 mm), 1 female (cl 7.5 mm, pcl 5.0 mm), 5510/2005/146; NMV
J55040, 1 male (cl 10.5 mm, pcl 7.0 mm), | ovigerous female (cl 9.9
mm, pcl 7.1 mm), 1 female (cl 7.6 mm, pcl 5.2 mm), Ningaloo North,
21° 58.704'S 113° 49.2 'E to 21° 59.052'S 113° 49.2'E, 170—177 m,
S$$10/2005/152, 10 December 2005.
Genetic data. Not available.
Remarks. Munida heteracantha Ortmann, 1892 has been
recorded widely across the western Pacific, including from
Queensland, Australia. Our specimens show some variation
from the lectotype from Japan described by Macpherson and
Baba (1995). The lectotype has a pair of small parahepatic
spines, which are absent in all our material. In most of our
specimens the distolateral spine of the basal antennular article
is slightly longer than the distomesial spine, while in the
lectotype the distal spines are subequal. Macpherson and Baba
(1993) noted that some specimens of M. heteracantha have 2
small median spines on abdominal somite 3, and half of the
specimens here have 1—6 spines. Only three specimens had the
P2 attached, and these show the dactyli with 7—8 spines on the
flexor margin, compared to only 5 spines in the lectotype.
Munida heteracantha 1s also similar to Munida macphersoni
Cabezas, Lin and Chan, 2011, but differs in the length of the
supraocular spines, which are very short in M. heteracantha
(0.34 x rostral length compared to 0.5 in M. macphersoni).
Distribution. Japan, Philippines, and Indonesia, off Central
Queensland, New Caledonia, Fiji, 100—322 m. South-western
Australia, 170—177 m.
Munida leagora Macpherson, 1994.
Figure I9B-D
Munida leagora Macpherson, 1994: 485, figs 26,76 (type locality:
New Caledonia). — Baba et al., 2008: 104.
Material examined. Western Australia: NMV J56004, 1 ovigerous
female (cl 13.8 mm, pcl 8.1 mm), | male (cl 13.0 mm, pcl 8.0 mm),
Leveque L27, 14° 58.362' S, 121° 38.556' E to 14° 57.762' S,
121° 39.264' E, 228—232 m, 5805/2007/143, 2 July 2007; NMV J55999,
5 males (cl 15.7 mm, pcl 9.5 mm to cl 20.2 mm, pcl 12.3 mm), 1 male
with bopyrid (cl 14.9 mm, pcl 8.6 mm), | ovigerous female (cl 16.5
mm, pcl 10.2 mm), 8805/2007/143; NMV J56018, 1 juvenile (cl 12.2
mm, pcl 7.5 mm), Mermaid L24 east transect, 17^ 02.838' S,
119° 39.684' E to 17° 03.708' S, 119° 41.358' E, 424—456 m,
SS05/2007/77, 18 June 2007.
Colour. Carapace and abdominal somites 2—4 pale orange,
somites 5—6 and telson white. Rostrum and supraocular spines
pale orange. Pl and P2—4 meri with orange spots at base of
spines and on striae.
Genetic data. COI and 16S; see Table 1.
Remarks. Munida leagora was described from New Caledonia,
and the present specimens represent the first records of the
species from Australia. Our specimens show some minor
variation compared to the type description, including the
presence of | or 2 small spines on the lateral margins of the
anterior ridge of abdominal somite 2, and the presence of
145
parahepatic spines in some specimens. Munida leagora 1s
very similar to Munida alia Baba, 1994, described from a
single specimen in Queensland. We compared our specimens
of M. leagora to the holotype of M. alia and confirmed that
these species are distinct. In Baba's (2005) key to Munida,
these two species are separated by the length of the distomesial
spine of antennal article 1, which reaches the end of article 2
in M. alia and reaches or overreaches the distal end of article
3 in M. leagora. In addition, M. alia lacks a pair of postcervical
spines, which are always present in our specimens of
M. leagora.
Divergence in COI sequences between specimens of M.
leagora from north-western Australia and New Caledonia is
<0.5%. The wide transverse yellow and purple bands on the
carapace described for New Caledonian specimens are absent
in all the specimens examined here.
Distribution. New Caledonia, Loyalty Islands, Chesterfield
Islands, Vanuatu, Bayonnaise Bank, Fiji and Tonga, 240—610
m. North-west Australia, 232—450 m.
Munida magniantennulata Baba and Türkay, 1992
Figure 20A
Munida magniantennulata Baba and Türkay, 1992: 205, figs 2,3
(type locality: Lau Basin). — Baba et al., 2008: 105. — Farrelly and
Ahyong, 2019: 13,54. fig. 97.
Not Munida magniantennulata. — Baba, 1994a: 12 (2M. typhle
Macpherson, 1994)
Material examined. New South Wales: NMV J73001, 3 ovigerous
females (cl 10.6 mm, pcl 7.2 mm to cl 13.4 mm, pcl 12.5 mm), Central
Eastern CMR, 30° 05.862' S, 153° 53.922' E to 30° 07.158' S,
153° 52.47' E, 2429-2518 m, IN2017. v03/086, 5 June 2017.
Colour. Carapace, abdomen, cheliped and P2—4 pink. Eggs red.
Genetic data. Not available.
Remarks. The type specimens of M. magniantennulata are
described as having the P2 dactylus 0.5—0.6 times propodus
length, 6.6 times as long as high, and lined with 10 movable
spines. Our specimens have a very similar P2 dactylus, which
is 0.6—0.7 times the propodus length, 5—6 times as long as high,
with 9—10 movable spines on the flexor margin. The chelipeds
of all our specimens lack spines on the outer margin of the
fingers or on the dorsal face of the palm, which agrees with the
type material. All the specimens have two small tubercle-like
spines on abdominal somite 2.
These specimens differ from the holotype in the length of
the mesial spine on the first antennal article, which reaches
the midlength of article 2 in these specimens but is very short
in the holotype.
The specimens recorded by Baba (1994) as M.
magniantennulata from off central Queensland are referred
to Munida typhle Macpherson 1994 (see Remarks for that
species).
Distribution. Lau Basin, 1750—2003 m. Eastern Australia,
2429-2518 m.
146 A.W. McCallum, S.T. Ahyong & N. Andreakis
Figure 20. A, Munida militaris Henderson, 1885, ovigerous female cl 15.0 mm, pcl 9.4 mm, (NMV J55033); B, Munida magniantennulata Baba
and Türkay, 1992, ovigerous female (NMV J73001); C, Munida pectinata Machordom and Macpherson, 2005, male (NMV J55268); D. Munida
roshanei Tirmizi, 1966, male 11.1 mm, pcl 7.2 mm (NMV J55261). Photos: K. Gowlett-Holmes, CSIRO.
Australian Munida
Munida militaris Henderson, 1885
Figure 20B
Munida militaris Henderson, 1885: 410 (type locality: off Mataku,
Fiji Islands). — Baba, 2008: 108 (synonymies, type data). — Baba et
al., 2009: 173, figs 153—155 (in part) (Taiwan, 190—1183 m). — Poore
et al., 2011: pl. 17E (colour).
Not Munida militaris Baba et al., 2009: 173 (1n part) (Taiwan) (=
M. lanciaria Cabezas et al., 2011).
Munida aff. Rubiesi — Poore et al., 2008, 20 (part), unnumbered fig.
Munida MoV 5183. — McEnnulty et al., 2011: app. 1,2.
Material examined. Western Australia: NMV J55033, 1 ovigerous
female (cl 15.0 mm, pcl 9.4 mm), 31° 36.528' S 114° 58.86' E to
31° 37.038' S 114° 58.26' E, 329—370 m, SS10/2005/06, 19 November
2005; NMV J55035, 1 ovigerous female (cl 15.0 mm, pcl 10.2 mm),
near Abrolhos islands, 28° 29.37' S 113° 25.14' E to 28? 30.06' S
113? 25.5' E, 416—431 m, SS10/2005/95, 4 December 2005.
Genetic data. Not available.
Colour. Carapace and somites 2—4 orange and white, somites
5—6 and telson white. Rostrum and supraocular spines orange
on base and tips and white in the middle. Chela white and
orange, and orange/red bands on distal half of fingers. P2—4
transparent white/orange with orange/red across the middle of
propodus and tips of dactyli.
Remarks. The specimens here agree with the lectotype
description of M. militaris by Baba and Macpherson (1991).
Munida militaris closely resembles M. benguela de Saint
Laurent and Macpherson, 1985, but can be distinguished by the
following features:
- moveable finger of the cheliped bears a single basomesial
spine
- P2-4 dactyli with about 10 ventral spines, the untimate
at the base of the unguis.
Our specimens differ slightly from the illustrated
lectotype material from Fiji and Ambon. The lectotype has
the distomesial spine of antenna article 2 described as
occasionally overreaching the end of the peduncle, while in
both our specimens, the distomesial spine distinctly
overreaches the distal end of the peduncle.
Distribution. Taiwan, Indonesia, Queensland, New Caledonia,
Vanuatu, Wallis and Futuna, Fiji, T-onga, 190-1183 m. South-
western Australia, 329—431 m.
Munida pectinata Machordom and Macpherson, 2005
Figure 20C
Munida pectinata Machordom and Macpherson, 2005: 828, fig. 3
(type locality: New Caledonia). — Baba, 2008: 112. — Komai, 2011:
359, fig. 10, 11D (colour) (Japan 96-221 m). — Komai, 2012: 38 (Izu
islands, 174—192 m).
Material examined. Western Australia: NMV 755268, 4 males (2
damaged; cl 10.8 mm, pcl 6.5 mm; cl 18.4 mm, pcl 10.7 mm),
17° 35.706' S, 118? 58.902' E to 17? 35.346' S, 118? 58.794' E, 108—140
m, SS05/2007 stn 62, 16 June 2007.
Colour. Carapace and somites 2—4 pale orange with dark
orange markings, somites 5—6 and telson pale orange. Rostrum
147
and supraocular spines orange. Chela merus pink with red
bands, remaining chela mottled orange. P2—4 white with
orange/red bands.
Genetic data. COI and 16S; see Table 1.
Remarks. These Australian specimens of M. pectinata agree
well with illustrations of type material from New Caledonia,
extending the range to eastern Indian Ocean. The north-western
Australian sequences of COI (639 bp) and 165 were identical to
two sequences from New Caledonia. This is the first record of
M. pectinata from Australia.
Distribution. New Caledonia, Japan and north-western
Australia, 96—240 m.
Munida pherusa Macpherson and Baba, 1993
Munida pherusa Macpherson and Baba, 1993: 408, fig. 15 (type,
locality: Philippines). — Baba et al., 2008: 112. — Baba et al., 2009:
178, figs 158—159. — Kim et al., 2016: 9, fig. 9 (Korea, 112—117 m).
Material examined. Western Australia: NMV J55097, ] specimen,
Ningaloo South, 22° 04.002' S, 113° 48.66' E to 22° 04.248' S,
113? 48.9' E, 101-106 m, SS10/2005/144, 10 December 2005; NMV
J13307, 9 ovigerous females (cl 7.7 mm, pcl 4.5 mm to cl 11.4 mm, pcl
7.3 mm), 2 females (cl 8.3 mm, pcl 4.9 mm; cl 9.1 mm, pcl 7.3 mm), 7
males (cl 7.3 mm, pcl 4.9 mm to cl 12.7 mm, pcl 7.7 mm), North-west
Shelf, between Port Hedland and Dampier, 18° 50' S, 117° 39' E to
18? 50' S, 117? 39' E, 175 m, NWA stn 29, 6 June 1983.
Remarks. In addition to one specimen of M. pherusa collected
in 2005 in north-western Australia, another 17 specimens are
reported here from a survey of the North-West Shelf in 1983.
The specimens show that the length of the disto-mesial spine
on antennal article 2 1s slightly variable in length, sometimes
just reaching the end of the peduncle and in some specimens,
including the holotype, it slightly overreaches the peduncle. In
the illustrated holotype, the cheliped finger is distinctly shorter
that the palm, while in all of our specimens, the cheliped finger
and palm are subequal in length.
These are the first records of M. pherusa from Australia.
Distribution. Japan, Philippines, Indonesia, Korea, 73—167 m.
North-western Australia, 101—178 m.
Munida philippinensis Macpherson and Baba, 1993
Munida philippinensis Macpherson and Baba, 1993: 410, fig. 16
(type locality: Philippines). — Baba et al., 2008: 112.
Material examined. Western Australia: NMV J56003, 4 females (cl
7.9 mm, pcl 4.8 mm to cl 10.1 mm, pcl 9.0 mm), 12 males (cl 7.5 mm,
pel 4.8 mm to cl 11.2 mm, pcl 7.4 mm), Leveque L27, 14? 58.362' S,
121° 38.556' E to 14° 57.762' S, 121° 39.264' E, 228—232 m,
SS05/2007/143, 2 July 2007.
Genetic data. COI and 16S; see Table 1.
Remarks. This 1s the first record of the species from Australia.
Distribution. Philippines, Indonesia, 146—297 m. North-west
Australia, 228—222 m.
148
Munida pilorhyncha Miyake and Baba, 1966
Figure 21
Munida pilorhyncha Miyake and Baba, 1966: 81, figs 1, 2 (type
locality: Tosa Bay, Japan). — Baba et al., 2008: 112 (synonomies, type
data). — Baba et al., 2009: 180, figs 160—162 (Taiwan).
Munida sp. MoV 5200. — Poore et al., 2008: 20, unnumbered fig.
(lower right). —McEnnulty et al., 2011: app. 1,2.
Material examined. Western Australia: NMV J55145, 1 female (cl 21.5
mm, pcl 16.8 mm), Bunbury, 33° 00.504' S, 114° 34.26' E to 33° 00.12' S,
114° 34.5' E, 414—421 m, SS10/2005/13, 20 November 2005.
Colour. Carapace and somites 2—4 pale orange. Rostrum
orange. Supraocular spines white. Cheliped with orange/red
spots at base of spines and orange/red at distal ends of chela
fingers.
Genetic data. Not available.
Remarks. Poore et al. (2008) and McEnnulty et al. (2011) reported
the present specimens as “Munida sp. MoV 5200”; this is the first
confirmed record of Munida pilorhyncha from Australia.
Distribution. Japan, South China Sea, Philippines, Taiwan, Kei
Islands, Indonesia, 200—366 m. South-western Australia, 414—
42] m.
Munida roshanei Tirmizi, 1966
Figure 20D
Munida roshanei Tirmizi, 1966: 192, fig. 13 (type locality: Gulf of
Oman). — Baba, 2008: 116.
Material examined. Western Australia: NMV J55261, 1 male (cl 11.1
mm, pcl 7.2 mm), Barrow L1 transect, 21° 02.148' S, 114° 53.28' E to
21° 01.992' S, 114? 53.142' E, 90-100 m, S805/2007/8, 10 June 2007;
NMV J55991, 16 ovigerous females (cl 8.4 mm, pcl 5.0 mm to cl 10.9
mm, pcl 7.0 mm), 7 females (cl 8.5 mm, pcl 5.3 mm to cl 10.9 mm, pcl
6.7 mm), 22 males (cl 8.4 mm, pcl 4.9 mm to cl 11.2 mm, pcl 6.4 mm),
Mermaid L24 transect, 17? 46.104' S, 120? 43.152' E to 17? 45.948' S,
120? 42.942' E, 97-109 m, SS05/2007/97, 20 June 2007; NMV J56400,
2 males (cl 8.9 mm, pcl 5.9 mm; cl 13.5 mm, pcl 8.0 mm), 2 ovigerous
females (cl 9.9 mm, pcl 5.6 mm; cl 11.8 mm, pcl 6.8 mm), 3 females (1
damaged; cl 9.5 mm, pcl 5.6 mm to cl 10.0 mm, pcl 5.7 mm), | male (cl
$5.0 mm, 5.9 mm), Broome L25 transect, 16? 45.156' S, 121° 02.796' E
to 16? 44.592' S, 121? 02.208' E, 100-108 m, SS05/2007/116, 30 June
2007; NMV J56009, 2 ovigerous females (cl 10.9 mm, pcl 7.2 mm; cl
11 mm, pcl 7.8 mm), 1 male (cl 7.8 mm, pcl 4.7 mm), Lacepede L26
transect, 15? 48.672' S, 121? 03.738' E to 15? 48.426' S, 121? 03.654' E,
90—107 m, SSO5/2007/125, 1 July 2007; NMV J56098, 4 males (cl 8.4
mm, pcl 5.1 mm to cl 11.7 mm, pcl 7.0 mm), 1 female (cl 10.6 mm, pcl
6.7 mm), Adele L28 transect, 14° 33.732' S, 122° 55.092' E to
14° 33.684' S, 122° 54.906' E, 95-105 m, 8805/2007/161, 4 July 2007;
NMV J56395, 1 ovigerous female (cl 14.1 mm, pcl 8.6 mm), | female
(cl 9.1 mm, pcl 5.2 mm), 3 males (cl 11.3 mm, pcl 6.9 mm to cl 11.8
mm, pcl 7.8 mm). Ashmore L30 transect, 12° 26.7' S, 123° 36.048' E
to 12° 26.964' S, 123° 36.588' E, 95 m, SS05/2007/188, 6 July 2007;
NMV J56007, 1 ovigerous female (cl 11.3 mm, pcl 7.2 mm), | female
(cl 10.0 mm, pcl 6.3 mm), Ashmore L30 transect, 12° 25.944' S,
123° 35.784' E to 12° 26.064' S, 123° 35.868' E, 111 m, 5805/2007/196,
6 July 2007; NMV J55096, 1 male (missing chelipeds and rostrum; pcl
7.3 mm). Kalbarri, 27° 48.48' S, 113° 17.82' E to 27? 48.756' S,
113? 17.94' E, 112-123 m, SS10/2005/96, 4 December 2005; NMV
A.W. McCallum, S.T. Ahyong & N. Andreakis
J55047, 1 ovigerous female (missing chelipeds; cl 11.6, pcl 7.1 mm), 1
male (cl 12.8 mm, pcl 8.0 mm), 1 juvenile (cl 9.0 mm, pcl 5.4 mm),
Barrow Island, 21° 01.896' S, 114° 53.52' E to 21° 02.064' S,
114° 53.28' E,93m, SS10/2005/169, 13 December 2005; NMV J55045,
| female (cl 7.0 mm, pcl 5.0 mm), 6 males (cl 8.0 mm, pcl 4.3 mm to cl
12.7 mm, pcl 5.5 mm), Barrow Island, 20° 59.082' S, 114° 54.42' E to
20° 59.67' S, 114° 54.54’ E, 100-101 m, SS10/2005/170, 13 December
2005; NMV J55048, 1 male (cl 10.2 mm, pcl 5.8 mm), SS10/2005/170.
Genetic data. COI and 16S; see Table 1.
Remarks. Munida roshanei 1s reported for the first time from
Australia. Our specimens have much longer supraocular spines
(0.36 times rostrum length) than figured for the type (0.2 times
rostrum length) (Tirmizi, 1966: fig. 13). Longer supraocular
spines are also present on the specimen from the Red Sea
illustrated by Lewinsohn (1969). Our specimens all lack a row of
median gastric spines behind the rostrum, whereas the type has
a row of 3 median gastric spines behind the rostrum, and in other
specimens 1 or 2 spines are reported (Baba, 1988; Tirmizi and
Javed, 1993). There is clear sexual dimorphism in this species
with males having large, gaping cheliped fingers. All of our
specimens have cheliped fingers subequal to the palm in length.
Distribution. Indian Ocean (Gulf of Oman and Gulf of Aden,
Red Sea, Andaman Sea and Mozambique Channel), and
Phillipines, 16—528 m. Western Australia, 93—123 m.
Munida rubridigitalis Baba, 1994
Figure 22
Munida rubridigitalis Baba, 1994a: 13, fig. 6 (type locality: off
Central Queensland). — Ahyong and Poore, 2004: 41. — Poore, 2004:
234 (compilation). — Baba, 2005: 273. — Baba et al., 2008: 117.
Not Munida rubridigitalis — Poore et al., 2008: 20 (south-western
Australia, 396—411 m) (= Munida julumunyju sp. nov.).
? Munida rubridigitalis. — Macpherson, 1997: 610.
Munida sp. — Macpherson, 1994: 558, figs 13b, 90 (2 Munida
julumunyju sp. nov.).
? Munida rubrodigitalis [sic]. — Macpherson, 1999: 423, fig. 4e.
Type material. Paratypes: QM W19726, 2 males (pcl 10.0-12.7 mm), 3
ovigerous females (pcl 10.9—12.1 mm), 1 female (9.5 mm), Queensland,
Coral Sea, 17? 51.13' S 147° 8' E, 497—503 m, Cidaris Station 47-2, 16
May 1986.
Other material examined. Queensland: AM P42278, 1 male (pcl 14.7
mm, cl 20.5 mm), 1 ovigerous female (pcl 16.6 mm, cl 23.0 mm),
north-east of Tweed Heads, 27? 55—57' S, 154° 03' E, 549 m, trawl,
K78-23-09, 6 November 1978.
New South Wales: AM P88982, 1 male (pcl 12.6 mm, cl 17.8 mm),
4 ovigerous females (pcl 12.4 mm, 17.3 mm to pcl 14.7 mm, cl 20.6
mm), north-east of Tweed Heads, 28° 01.8' S, 153° 58.8' E, 549 m,
trawl, K78-09-05, 2 June 1978; AM P31504, 2 ovigerous females (pcl
13.1 mm, 18.9 mm; pcl 15.7 mm, cl 22.6 mm), south-east of Cape
Byron, 28° 41—44' S, 153° 51' E, 156 m, K78-17-21, 5 April 1978; AM
P31423, 1 female (pcl 16.0 mm, cl 22.5 mm), north-east of Sugarloaf
Point, 32? 15' S, 153* 02' E, 457 m, trawl, K78-03-04, 5 April 1978;
AM P31502, 1 male (pcl 13.4 mm, cl 19.5 mm), 1 female (pcl 13.1 mm,
cl 18.4 mm), north-east of North Solitary Island, 29° 53—50' S,
153° 42—43' E, 457 m, trawl, K78-06-07, 24 April 1978; AM P66658,
2 females (pcl 10.4 mm, cl 14.9 mm; pcl 12.2 mm, cl 18.0 mm), north-
east of Long Reef, 33° 42'S, 151° 42' E, K85-21-06, 439—466 m, K85-
21-06, 19 December 1985.
Australian Munida
149
Figure 21. Munida pilorhyncha Miyake and Baba, 1966, female, cl 21.5 mm pcl 16.8 mm, (NMV J551451).
l )
va yx
R
2mm
Figure 22. Munida rubridigitalis Baba, 1994. Baba, 1994, paratype, male cl 16.2 mm, pcl 10.2 mm (QM W19727): A, rostrum; B, right P2
dactylus and propodus. Scale: A-B = 2 mm
Genetic data. Not available
Remarks. Munida rubridigitalis, described from Queensland,
has been also reported from New South Wales, north-western
Australia, New Caledonia, Vanuatu, Indonesia (Kei islands)
(Macpherson, 1994, 1997, 1999; Ahyong and Poore, 2004; Baba
et al., 2008; Poore et al., 2008). The north-western Australian
records of M. rubridigitalis are herein shown to be referable to
a separate species, M. julumunyju sp. nov., which differs chiefly
in having a deeper, more strongly curved rostrum (see account
of that species). We compared paratypes and other Australian
material of M. rubridigitalis to six MNHN specimens identified
as M. rubridigitalis from New Caledonia (see material listed
under M. julumunyju). These New Caledonian specimens are
herein referred to M. julumunyju sp. nov., as are specimens
reported from New Caledonia and the Loyalty Islands as
Munida sp. by Macpherson (1994). Thus, other records of M.
rubridigitalis from New Caledonia, Kei Islands and Vanuatu
could also be referable to M. julumunyju sp. nov. (see Remarks
for that species). At present, M. rubridigitalis sensu stricto 1s
known only from eastern Australia.
150
Distribution. Eastern Australia, from Queensland and New
South Wales, 156—549 m.
Munida sacksi Macpherson, 1993
Munida sacksi Macpherson, 1993: 438 (part), fig. 6 (type locality:
Philippines). — Baba et al., 2008: 119.
Munida sp. MoV 5217. — Poore et al., 2008: 21. —McEnnulty et
al., 2011: app. 1.
Material examined. Western Australia: NMV J55039, 1 male
(cl 11.6 mm, pcl 8.2 mm), Ningaloo South, 22° 04.314' S, 113° 45.36' E
to 22? 04.854' S, 113° 45.36' E, 387—399 m, SS10/2005/151, 10
December 2005.
Genetic data. Not available.
Remarks. Munida sacksi was described from the Philippines,
based on a single female, missing the chelipeds. The present
specimen, reported by Poore et al. (2008) as "Munida sp. MoV
5217”, represents the first record of the species from Australia.
Distribution. Philippines, 300—330 m. Western Australia, 387—
390 m.
Munida shaula Macpherson and de Saint Laurent, 2002
Munida shaula Macpherson and de Saint Laurent, 2002: 474, figs
3A-C, E-H [type locality: Réunion Island]. — Baba et al., 2008: 117.
Munida sp. MoV 5215. — Poore et al., 2008: 21. — McEnnulty et
al., 2011: app. 1.
Material examined. Western Australia: NMV J55111, 1 ovigerous
female (cl 15.3 mm, pcl 9.9 mm), Ningaloo North, 21° 58.212' S,
113? 47.58' E to 21? 58.752 S, 113? 47.46' E, 324—356 m, SS10/2005/157,
11 December 2005.
Genetic data. Not available.
Remarks. This specimen, reported as "Munida sp. MoV 5215”
by Poore et al. (2008), agrees well with Munida shaula,
previously recorded from the western Indian Ocean (Reunion
Island, Madagascar and Zanzibar). This is the first confirmed
record of M. shaula from Australia.
Distribution. Zanzibar, Madagascar, La Réunion and
Mozambique, 263—510 m. Western Australia, 324—356 m.
Munida typhle Macpherson, 1994
Munida magniantennulata. — Baba, 1994: 12.
Munida typhle Macpherson, 1994: 549, fig. 60 (type locality: New
Caledonia). — Baba et al., 2008: 126. — Baba et al., 2009: 200, figs
181—182. — Poore et al., 2011: pl. 18H (colour). — Macpherson, 2013:
306. — Macpherson et al., 2017: 54.
Munida cf. magniantennulata. — Farrelly and Ahyong, 2019: 13, 55,
fig. 98.
Material examined. Queensland: QM W 19722, 1 female (cl 12 mm, pcl
7.5 mm), Coral Sea, 17° 45.04' S, 147? 48.014' E, 1223-1228 m, CIDARIS
I stn 20-4, 10 May 1986; OM W 19721, 1 female (cl 7.5 mm, pcl 5.0 mm),
Coral Sea, 16? 50.133' S, 147? 10.1' E, 1607-1609 m, CIDARIS I stn 35-3,
14 May 1986; NMV J72915, 1 ovigerous female cl 21.9 mm, pcl 13.8
mm, Coral Sea CMR, 23? 37.872' S, 154? 39.582' E to 23° 39.54' S,
154° 38.628' E, 1761-1770 m, IN2017_v03 stn 128, 13 June 2017.
A.W. McCallum, S.T. Ahyong & N. Andreakis
Genetic data. Not available
Remarks. The present specimens referred to M. typhle were
recorded by Baba (1994) from central Queensland as M.
magniantennulata. These two species are very similar overall,
but the cheliped of M. typhle has spines present on the dorsal
face of the palm and 2 lateral spines on the proximal half of the
fixed finger, which are absent in M. magniantennulata. In
addition, the P2—4 dactyli are longer in M. typhle (0.8 times the
propodus compared to 0.5—0.6 in M. magniantennulata); and
abdominal somite 2 has 4 spines on the anterior ridge while M.
magniantennulata has 2 spines. In the Queensland specimens
examined here, the P2 dactylus has 7—8 spines along the flexor
margin compared to the holotype of M. typhle, with 9 spines.
The QM registration numbers published by Baba (1994) were
listed incorrectly and have been corrected here. The ovigerous
female (NMV J72915; Ahyong and Farrelly, 2019: fig. 98)
collected during the recent [nvestigator voyage 1s much larger
than most specimens collected previously. This large female
differs from other specimens in lacking spines on the cheliped
dactylus, and the spines on abdominal somite 2 are proportionally
longer (similar in length to the branchial margin spines) and
limited to the median part of the anterior ridge.
Distribution. Somalia coast, Seychelles, southern Madagascar,
Taiwan, New Caledonia, Vanuatu, French Polynesia, 500—1940
m. Queensland, 1607—1761 m.
Acknowledgments
This work was supported by a Postdoctoral Fellowship from
the Australian Biological Resources Study. Funding for the
surveys was provided by the Commonwealth Department of
the Environment and the CSIRO Wealth from Oceans
Flagship. Thanks to Karen Gowlett-Holmes (CSIRO) for
permission to reproduce her colour images of squat lobsters.
We are grateful to Chris Rowley and Melanie Mackenzie
(both Museum Victoria) for collection management support.
We thank the following staff and their institutions for the loan
of specimens: Andrea Crowther (South Australian Museum),
Kareen Schnabel (NIWA), and Peter Davie (Queensland
Museum). Thanks to Laure Corbari (MNHN) for access to
collections and the loan of specimens. We are grateful to the
following indigenous organisations and community members
for their assistance and for sharing their language to name the
new species: the Tasmanian Aboriginal Centre, Kevin George,
the Kariyarra Aboriginal Corporation, the Dambimangari
Aboriginal Corporation, Dr Steve Kelly and all those from the
Nhanda community who attended the Nhanda Language Day,
Bundiyarra - Irra Wangga Language Centre and the Wangka
Maya Pilbara Aboriginal Language Centre. Finally, we
acknowledge the extraordinary work of Indigenous Language
Centres across Australia in revitialising and preserving
Aboriginal languages.
References
Ahyong, S.T., Baba, K., Macpherson, E., and Poore, G.C.B. 2010. A
new classification of the Galatheoidea (Crustacea: Decapoda:
Anomura). Zootaxa 2676: 57—68.
Australian Munida
Ahyong, S.T., and Poore, G.C.B. 2004. Deep-water Galatheidae
(Crustacea: Decapoda: Anomura) from southern and eastern
Australia. Zootaxa 472: 3—16.
Alcock, A. 1894. Natural history notes from H.M. Royal Indian
Marine Survey Steamer "Investigator", commander R.F. Hoskin,
R.N., commanding. — Series II, No. 1. On the results of deep-sea
dredging during the season of 1890—91 (continued). Annals and
Magazine of Natural History (ser. 6) 13: 321—334.
Aljanabi, S.M. and Martinez, I., 1997. Universal and rapid salt-
extraction of high quality genomic DNA for PCR-based
techniques. Nucleic acids research 25(22): 4692—4693.
Baba, K. 1988. Chirostylid and galatheid crustaceans (Decapoda:
Anomura) of the “Albatross” Philippine Expedition, 1907—1910.
Researches on Crustacea, Special Number 2: 1-203.
Baba, K. 1994. Deep-sea galatheid crustaceans (Anomura: Galatheidae)
collected by the 'Cidaris I’ Expedition off central Queensland,
Australia. Memoirs of the Queensland Museum 35: 1-21.
Baba, K. 2005. Deep-sea chirostylid and galatheid crustaceans
(Decapoda: Anomura) from the Indo-West Pacific, with a list of
species. Galathea Reports 20: 1-317.
Baba, K., and Türkay, M. 1992. Munida magniantennulata, a new
deepsea decapod crustacean from active thermal vent areas of
Valu-Fa-Ridge in the Lau Basin, SW-Pacific (Anomura:
Galatheidae). Senckenbergiana Maritima 22: 203—210.
Baba, K., Macpherson, E., Poore, G.C.B., Ahyong, S.T., Bermudez, A.,
Cabezas, P., Lin, C.-W., Nizinski, M., Rodrigues, C. and Schnabel,
K.E. 2008. Catalogue of squat lobsters of the world (Crustacea:
Decapoda: Anomura—families Chirostylidae, Galatheidae and
Kiwaidae). Zootaxa, 1905: 1—220.
Cabezas, P., Sanmartin,I., Paulay, G., Macpherson, E. and Machordom,
A. 2012. Deep under the sea: unraveling the evolutionary history
of the deep-sea squat lobster Paramunida (Decapoda, Munididae).
Evolution 66: 1878—1896.
Cabezas, P., Macpherson, E., and Machordom, A. 2009. Morphological
and molecular description. of new species of squat lobster
(Crustacea: Decapoda: Galatheidae) from the Solomon and Fiji
Islands (South-West Pacific). Zoological Journal of the Linnean
Society 156: 465—493.
Cabezas, P., Lin, C.W., and Chan, T. Y. 2011. Two new species of the
deep-sea squat lobster genus Munida Leach, 1820 (Crustacea:
Decapoda: Munididae) from ‘Taiwan: morphological and
molecular evidence. Zootaxa 3036: 26—38.
Castro, P. 2011. Catalog of the anomuran and brachyuran crabs
(Crustacea: Decapoda: Anomura, Brachyura) of the Hawaiian
Islands. Zootaxa 2947: 1-154.
de Saint Laurent, M., and Macpherson, E. 1988. Munida benguela,
espece nouvelle d'Afrique du Sud. Comparaison avec Munida
sanctipauli Henderson, 1885 (Crustacea: Decapoda: Galatheidae).
Bulletin du Muséum national d'Histoire naturelle, Paris A: 105—
115.
Hall, T.A. 1999. BioEdit A User-Friendly Biological Sequence
Alignment Editor and Analysis Program for Windows 95/98/NT.
Nucleic Acids Symposium Series 41: 95—98.
Henderson, J.R. 1885. Diagnoses of new species of Galatheidae
collected during the "Challenger" expedition. Annals and
Magazine of Natural History (ser. 5) 16: 407—421.
Katoh, K., Misawa, K., Kuma, K.I., and Miyata, T. 2002. MA FFT: a
novel method for rapid multiple sequence alignment based on fast
Fourier transform. Nucleic Acids Research 30: 3059-3066.
Kim, J. N., Kim, M. H., Choi, J. H., and Im, Y. J. 2016. Galatheoid
squat lobsters (Crustacea: Decapoda: Anomura) from Korean
waters. Fisheries and Aquatic Sciences 19(1): 34.
151
Komai, T. 2011. Squat lobsters of the genus Munida (Crustacea:
Decapoda: Anomura: Munididae) from the Ogasawara Islands,
with descriptions of four new species. National Museum of Nature
and Science, Tokyo 47: 339—365.
Komai, T. 2012. Squat lobsters of the genus Munida Leach, 1820
(Crustacea: Decapoda: Anomura: Munididae) from the Sagami
sea and Izu Islands, central Japan, with descriptions of 10 new
species. Natural History Research 12(1): 1—69.
Kumar, S., Stecher, G., Li, M., Knyaz, C., and Tamura, K. 2018. MEGA
X: molecular evolutionary genetics analysis across computing
platforms. Molecular Biology and Evolution 35: 1547-1549.
Lewinsohn, C. 1969. Die Anomuren des Roten Meeres (Crustacea
Decapoda: Paguridea, Galatheidea, Hippidea). Zoologische
Verhandelingen, Leiden 104: 1—213, pls 1-2.
Liu, X.M., Lin, R.C., and Huang, D.Y. 2013. A new species of deep-sea
squat lobster of the genus Munida Leach, 1820 (Crustacea:
Decapoda: Anomura: Munididae) from a hydrothermal field in
the southwestern Indian Ocean. Zootaxa 3734: 380—384.
Liu, X., Li, X., and Lin, R. (2020) A new squat lobster species of the
genus Munida Leach, 1820 (Crustacea: Anomura: Galatheoidea:
Munididae) from hydrothermal vents on the Eastern Pacific Rise.
Zootaxa 4743: 131—136.
Machordom, A., and Macpherson, E. 2004. Rapid radiation and
cryptic speciation in galatheid crabs of the genus Munida and
related genera in the South West Pacific: molecular and
morphological evidence. Molecular Phylogenetics and Evolution
33: 259-279.
Macpherson, E. 1994. Crustacea Decapoda: Studies on the genus
Munida Leach, 1820 (Galatheidae) in New Caledonia and adjacent
waters with descriptions of 56 new species. Pp 421—569 in:
Crosnier, A. (ed), Résultats des Campagnes MUSORSTOM,
volume 12. Muséum National d'Histoire Naturelle: Paris.
Macpherson, E. 1997. Crustacea Decapoda: species of the genera
Agononida Baba & de Saint Laurent, 1996 and Munida Leach,
1820 (Galatheidae) from the KARUBAR cruise. Pp 597—612 1n:
Crosnier, A. and Bouchet, P. (eds), Résultats des Campagnes
MUSORSTOM, volume 16. Muséum National d'Histoire
Naturelle: Paris.
Macpherson, E. 1999. Crustacea Decapoda: species of the genera
Crosnierita Macpherson, 1998, Munida Leach, 1820, and
Paramunida Baba, 1988 (Galatheidae) collected during the
MUSORSTOM 9 cruise to the Marquesas Islands. Pp 415—423 in:
Crosnier, A. (ed), Résultats des Campagnes MUSORSTOM,
volume 21. Muséum National d'Histoire Naturelle: Paris.
Macpherson, E. 2013. New species and new occurences of squat
lobsters (Crustacea, Decapoda, Munididae, Eumunididae) from
French Polynesia. Pp 287-309 in: Ahyong S.T., Chan T.-Y.,
Corbari L., and Ng P.K.L. (eds), Tropical deep-sea benthos volume
27. Muséum National d'Histoire Naturelle: Paris.
Macpherson, E., and Baba, K. (1993) Crustacea Decapoda: Munida
Japonica Stimpson, 1858, and related species (Galatheidae). Pp 381—
420 in: Crosnier, A. (ed.), Résultats des Campagnes MUSORSTOM,
volume 10. Muséum National d'Histoire Naturelle: Paris.
Macpherson, E., and Machordom, A. 2005. Use of morphological and
molecular data to identify three new sibling species of the genus
Munida Leach, 1820 (Crustacea, Decapoda, Galatheidae) from
New Caledonia. Journal of Natural History 39: 819—834.
Macpherson, E., and Baba, K. 2011. Taxonomy of squat lobsters. Pp
40—73 1n: Poore, G.C.B., Ahyong, S.T., and Taylor, J. (eds), The
biology of squat lobsters. CSIRO Publishing, Australia.
Macpherson, E., Rodríguez-Flores, P.C., and Machordom, A. 2017.
New sibling species and new occurrences of squat lobsters
(Crustacea, Decapoda) from the western Indian Ocean. European
Journal of Taxonomy 343: 1—61.
152
McEnnulty, F.R., Gowlett-Holmes, K.L., Williams, A., Althaus, F.,
Fromont, J., Poore, G.C.B., O'Hara, T.D., Marsh, L., Kott, P.,
Slack-Smith, S., Alderslade, P., and Kitahara, M.V. 2011. The
deepwater megabenthic invertebrates on the western continental
margin of Australia (100-1100 m depths) composition,
distribution and novelty. Records of the Western Australian
Museum Supplement 80: 1—191.
Miyake, S., and Baba, K. 1966. Two new species of the family
Galatheidae from the Tosa Bay, Japan. Journal of the Faculty of
Agriculture, Kyushu University 14: 81-88.
Ortmann, A.E. 1892. Die Decapoden-Krebse des Strassburger
Museums, mit besonderer Berücksichtigung der von Herrn Dr.
Dóderlein bei Japan und bei den Liu-Kiu-Inseln gesammelten und
zur Zeit im Strassburger Museum aufbewahrten Formen. IV. Die
Abtheilungen Galatheidea und Paguridea. Zoologische
Jahrbiicher, Abtheilung fiir Systematik, Geographie und Biologie
der Thiere 6: 241—326.
Poore, G.C.B. 2004. Marine decapod Crustacea of southern
Australia. A guide to identification (with chapter on Stomatopoda
by Shane Ahyong). CSIRO Publishing: Melbourne. 574 pp.
Poore, G.C.B., Ahyong, S.T., and Taylor, J. 2011. The biology of squat
lobsters. CSIRO Publishing: Melbourne. 363 pp.
Poore, G.C.B., and Andreakis, N. 2012. The Agononida incerta
species complex unravelled (Crustacea: Decapoda: Anomura:
Munididae). Zootaxa 3492: 1—29.
Poore, G.C.B., McCallum, A.W., and Taylor, J. 2008. Decapod
Crustacea of the continental margin of southwestern and central
Western Australia: preliminary identifications of 524 species
from FRV Southern Surveyor voyage SS10-2005. Museum
Victoria Science Reports 11: 1-106.
A.W. McCallum, S.T. Ahyong & N. Andreakis
Rodríguez-Flores, P.C., Machordom, A., Abelló, P., Cuesta, J.A., and
Macpherson, E. 2019. Species delimitation and multi-locus
species tree solve an old taxonomic problem for European squat
lobsters of the genus Munida Leach, 1820. Marine Biodiversity
49: 1751-1773.
lirmizi, N.M. 1966. Crustacea: Galatheidae. The John Murray
Expedition 1933—34. Scientific Reports 11: 167—234.
Tirmizi, N.M., and Javed, W. 1976. A new species of Munida from the
Indian Ocean with a redescription of a syntype of Munida spinulifera
Miers, 1884 (Decapoda, Galatheidea). Crustaceana 31: 81-89.
Tirmizi, N.M., and Javed, W. 1992. Two new species of Munida Leach,
1820 (Decapoda, Anomura, Galatheidae) from the Indian Ocean.
Crustaceana 62: 312—318.
lirmizi, N.M., and Javed, W. 1993. Indian Ocean galatheids
(Crustacea: Anomura). Marine Reference Collection and
Resource Centre, University of Karachi: Karachi.
Vereshchaka, A.L. 2005. New species of Galatheidae (Crustacea:
Anomura: Galatheoidea) from volcanic seamounts off northern
New Zealand. Journal of the Marine Biological Association of
the United Kingdom 85: 137—142.
WoRMS Editorial Board 2021. World Register of Marine Species.
Available from http://www w.marinespecies.org at VLIZ. Accessed
2021-04-07. doi:10.14284/170
Yaldwyn, J.C., and Webber, W.R. 2011. Annotated checklist of New
Zealand Decapoda (Arthropoda: Crustacea). Tubinga 22: 171—272.
Yan, R.-J., Schnabel, K.E., Rowden, A.A., Guo, X.-Z., and Gardner,
J.P.A. 2020. Population structure and genetic connectivity of
squat lobsters (Munida Leach, 1820) associated with vulnerable
marine ecosystems in the southwest Pacific Ocean. Frontiers in
Marine Science 6(791): 1-18.
Memoirs of Museum Victoria 80: 153-157 (2021) Published 2021
1447-2554 (On-line)
httos://museumsvictoria.com.au/collections-research/journals/memoirs-of-museum-victoria/
DOI https://doi.org/10.24199/j.mmv.2021.80.07
Phylogenetic placement of a recently discovered population of the threatened alpine
She-oak skink Cyclodomorphus praealtus (Squamata: Scincidae) in Victoria
JOANNA SUMNER!*, MARGARET L. HAINEsS!, PETER LAWRENCE’, JENNY LAWRENCE? AND NICK CLEMANN*
! Museums Victoria, GPO Box 666, Melbourne VIC 3001
? 2 Rose Street, Heyfield VIC 3858
* Parks Victoria, Licola Road, Heyfield VIC 3858
* Arthur Rylah Institute for Environmental Research, Department of Environment, Land, Water and Planning, PO Box 137,
Heidelberg VIC 3084 (Nick.Clemann@delwp.vic.gov.au)
* to whom correspondence should be addressed (jsumner@museum.vic.gov.au)
Abstract
sumner, J., Haines, M.L., Lawrence, P., Lawrence, J. and Clemann, N. 2021. Phylogenetic placement of a recently
discovered population of the threatened alpine she-oak skink Cyclodomorphus praealtus (Squamata: Scincidae) in
Victoria. Memoirs of Museum Victoria 80: 153—157.
The alpine she-oak skink Cyclodomorphus praealtus is a threatened alpine endemic lizard from the mainland of
Australia. The species 1s previously known from disjunct populations in Kosciuszko National Park in New South Wales
and three isolated localities in the Victorian Alps. The New South Wales and Victorian populations represent separate
evolutionarily significant units. In 2011, a fourth Victorian population was discovered. We conducted a phylogenetic
analysis and determined that the newly discovered population is discrete and may have been separated from other
populations since the end of the last glacial maxima. This population requires separate management.
Keywords
Introduction
The alpine she-oak skink Cyclodomorphus praealtus Shea
(1995) is restricted to sky island plains (sensu Koumoundouros
et al., 2009) above 1500 m elevation in the mainland
Australian alpine bioregion (Cogger, 2014). The species has
been recorded in New South Wales (NSW) at Kosciuszko
National Park and in Victoria at the Bogong High Plains,
around Mt Hotham, Mt Higginbotham and Mt Loch, and on
the Dargo High Plains at Lankey and Omeo Plains (Clemann,
2011; fig. 1). The Victorian sites are all within approximately
30 km of each other (Table 1). The species has specific habitat
requirements, occurring in alpine heathland and alpine grassy
heathland. These habitats generally have a disjunct occurrence
and are within a matrix of other alpine and sub-alpine habitats
in which the alpine she-oak skink is not known to occur.
Within some locations, the species distribution is further
fragmented by ski resort buildings and groomed ski slopes,
roads and tracks. The species is listed as nationally
endangered under the federal Environment Protection &
Biodiversity Conservation Act 1999, threatened in Victoria
under that state's Flora and Fauna Guarantee Act 1988,
critically endangered in Victoria by the Department of
Sustainability and Environment (2013) and endangered in
NSW under the Threatened Species Conservation Act 1995.
Cyclodomorphus praealtus, phylogenetic relationship, conservation, threatened species
The species is considered at risk from climate change
(Clemann, 2003; Koumoundouros et al., 2009) and is a high
priority for conservation management.
Populations of C. praealtus in NSW and Victoria are
reciprocally monophyletic at the mtDNA ND4 loci, with a
4.28% net sequence divergence between regions, and it was
recommended that they be treated as separate evolutionarily
significant units (Koumoundouros et al., 2009). The three
known Victorian populations exhibit strong genetic structure,
with no current inter-population gene flow, despite evidence
for historical connectivity (Koumoundouros et al., 2009).
This concurs with their present disjunct distribution on high
elevation plateaux and peaks in alpine meadows that are
separated by valleys of eucalypt forests.
In 2011, C. praealtus was discovered at a fourth Victorian
locality — the Wellington Plains (Clemann et al., 2016). This is
the southern-most area where this species has been recorded
and is 58 km from the closest Victorian population at Lankey
Plain. Here we present a phylogenetic analysis to determine
the relationship between this new population and those
studied by Koumoundouros et al. (2009). Our results provide
information that will assist the conservation management of
this species.
154 J. Sumner, M.L. Haines, P. Lawrence, J. Lawrence & N. Clemann
Table 1. Divergence among five populations of Cyclodomorphus praealtus in Victoria (VIC) and New South Wales (NSW). Uncorrected
p-distance (number of base substitutions per site averaged over all sequence pairs between groups; bottom) and straight-line distance (km)
between locations (top).
Bogong High Plains, | Mt Hotham, Lankey Plain, Wellington Plains, Mt Kosciuszko,
VIC VIC VIC VIC NSW
Bogong High Plains, VIC |- — — o |31 — — a — 96 a
Mt Hotham, VIC pool — — — [|- — Oy — — J7l — [T
Elevation
| Om
[zx] 400 m
|» | 800m
—3 1200 m
EE 1600+ m
Mt Kosciuszko}
1
77
^ » + ,
| " Op)
ns E
r è la
m
. a y
y exwWellinaton]Plains
Tasman Sea
Figure 1: Elevation map of the mainland Australian alpine region indicating the five major populations of Cyclodomorphus
praealtus, including the new location of Wellington Plains. Elevation is indicated by light, mid and dark grey areas at 500 m
intervals, with highest elevations at or above 1500 m above sea level. Adapted from fig. 1; Koumoundouros et al. (2009).
Phylogenetic placement of a recently discovered population of the alpine she-oak skink
Methods
Discovery of this population of C. praealtus and collection of
tissue samples is described by Clemann et al. (2016). Tissue
samples (tail tips) were collected from two sub-adult C.
praealtus from the Wellington Plains (1530 m elevation; fig.
1) in November 2011.
We extracted genomic DNA using a Qiagen DNeasy®
Blood and Tissue Kit according to the manufacturer’s
instructions (www.qgiagen.com). An 850 base pair region of
the mtDNA NADH dehydrogenase subunit 4 (ND4) gene was
chosen for sequencing because it has useful levels of
variability in this species and in related skink groups (Chapple
and Keogh, 2004; Koumoundourus et al., 2009). ND4 was
amplified according to the protocols and conditions in
Koumoundouros et al. (2009) using the primer pair ND4I
159
© TGACTACCAAAAGCTCATGTAGAAGC 3), and
tRNA-leu (© TACTTTTACTTGGATTTGCACCA 3;
Chapple and Keogh, 2004). The resulting polymerase chain
reaction product was purified using ExoSAP-IT®
(Affymetrix), and the purified products were sent to Macrogen
(South Korea) for sequencing.
Forward and reverse sequences were assembled in Geneious
R6.1.8 (Biomatters Ltd.) and were aligned against 103 published
sequences and outgroups for this species (Koumoundouros et
al., 2009) using default settings in ClustalW. We translated the
protein-coding regions into amino acids and did not observe
stop codons or indels. IUPAC ambiguity codes were used for
heterozygous sites. We trimmed the alignments to 758 base
pairs because the end of the sequences could not be aligned due
to the length-variable loops and stems of the tRNA genes. The
Wellington Plains sequences were deposited in GenBank.
Tiliqua adelaidensis
Cyclodomorphus melanops
C. gerrardii
0.99
C. praealtus
-— IE
0.05
C. michaeli
Kosciuszko NP Cp105
L Kosciuszko NP Cp104
Ir Kosciuszko NP Cp107
l Kosciuszko NP Cp103
Bogong HP Cp077
NEW SOUTH
WALES
jog |! Bogong HP Cp028
Bogong HP Cp022
Bogong HP Cp023
Lankey Plain Cp042
r Lankey Plain Cp0 12
Mt Hotham Cp004
| Bogong HP Cp016
| Bogong HP Cp001
Wellington Plains CpTile5
Bogong HP Cp109
Bogong HP Cp015
Bogong HP Cp026
Mt Hotham Cp005
Bogong HP Cp054
Mt Hotham Cp002
Bogong HP Cp035
Bogong HP Cp009
VICTORIA
Figure 2: A Bayesian consensus tree of the mtDNA ND4 sequences, depicting the relationship between unique haplotypes at
each locality (Bogong High Plains, Lankey Plain, Mt Hotham, Wellington Plains and Kosciuszko National Park) for
Cyclodomorphus praealtus. Bayesian posterior probabilities are shown at major nodes.
156
To determine the relationship of the Wellington Plains
population to all other known populations, we created a
phylogenetic tree. Only unique haplotypes were used. We
used Modeltest 3.7 (Felsenstein, 1985) with the PAUP* plug-
in run within Geneious R6.1.8 to determine which of the 56
potential models of DNA sequence evolution was most
suitable for our data. The GTR+G model of evolution was
selected as the most appropriate model using the Akaike
information criterion (Akaike, 1974). The MrBayes version
3.2.6 (Huelsenbeck et al., 2001; Ronquist and Huelsenbeck,
2003) plug-in within Geneious R6.1.8 was used to conduct a
Bayesian Markov chain Monte Carlo phylogenetic analysis
using two million generations sampled every 500 generations,
with four heated chains sampling independently and a 25%
burn-in. Chain convergence was confirmed by examining the
log trace in Geneious and estimated sample size values > 200.
The mean between group distance was calculated among all
five populations in MEGAO (Tamura et al., 2006).
To infer the relationship between the mitochondrial ND4
sequences from Wellington Plains and the published
haplotypes in Victoria, we created a statistical parsimony
network using the program TCS (Clement et al., 2000) using a
95% statistical confidence limit for the maximum number of
nucleotide substitutions between two haplotypes.
Results
The ND4 sequences comprised 758 base pairs, including 63
variable sites and 50 parsimony informative sites. The
B Lankey Plains
L] Mt Hotham
O Bogong High Plains
Wellington Plain
J. Sumner, M.L. Haines, P. Lawrence, J. Lawrence & N. Clemann
sequences from the two Wellington Plains individuals were
identical and differed from all previously known haplotypes.
The Bayesian consensus tree (fig. 2) revealed that the ND4
haplotype from Wellington Plains falls ^ within the
monophyletic Victorian lineage and did not group with any
other populations. The Wellington Plains haplotype differed
from the populations in Victoria by 1.6-1.9% and from the
NSW population by 5.9% (Table 1).
A haplotype parsimony network of all ND4 sequences
generated in TCS (fig. 3) indicates that the Wellington Plains
haplotype forms a third distinct haplogroup cluster, separate
from all other Victorian haplotypes, and that they cluster
more closely with the north-eastern haplogroup that includes
individuals from Bogong High Plains and Mt Hotham. Eight
nucleotide changes separate the Wellington Plains sample
from the closest haplotype from the Bogong High Plains.
Discussion
Analysis of mtDNA ND4 sequences of two C. praealtus
individuals from Wellington Plains indicates the presence of a
haplotype that is not found in any other population across the
restricted range of this alpine endemic species. Further work
using multiple nuclear genes is needed before we can confirm
that the Wellington Plains population is isolated from the
other Victorian populations as the current data suggests. It 1s
not possible to determine the level of genetic diversity within
the Wellington Plains population due to the small sample size.
Figure 3: Population structure of Victorian Cyclodomorphus praealtus according to ND4 mitochondrial haplotype network.
Black indicates individuals from Lankey Plain, dark grey indicates those from Mt Hotham, white indicates those from Bogong
High Plains and diagonal stripes indicate those from Wellington Plains. The network structure indicates 3 haplogroups (1, 11 and
111) within Victoria. Each circle represents a unique haplotype, with the circle size indicative of frequency and sample sizes
within each circle. Empty circles represent missing haplotypes and differ by one base pair from the closest haplotype.
Phylogenetic placement of a recently discovered population of the alpine she-oak skink 157
The Wellington Plains population is the most divergent of
the populations in Victoria, with 1.6—1.9% sequence divergence
from the other populations, compared with the 0.9-1.2%
divergence among the other Victorian populations. Using the
conventional vertebrate mtDNA clock calibration of 2%
sequence divergence per million years (Avise, 2004), suggests
a divergence time between Wellington Plains and the other
populations in Victoria of between 500 OOO and one million
years before present. This places the divergence during the late
Pliocene to early Pleistocene, during which climatic
oscillations intensified resulting in rapid fluctuation between
cool-dry and warm-wet conditions across south-eastern
Australia (Markgraf et al., 1995). However, this predates the
most recent glacial period from approximately 25 000—18 000
years before present, during which the alpine habitat extended
into the valleys connecting the mountain peaks, allowing gene
flow between populations of other alpine endemics.
In 2019 severe bushfires burned across the entire Wellington
Plains plateau and, as a result, the status of this population is
now uncertain. Surveys to determine whether the population
still remains on the Wellington Plains are an urgent priority,
both to confirm the status of this population and to identify any
other specific threats. Threats already identified for C. praealtus
in the Victorian Alps include climate change, loss and
degradation of habitat (due to a range of processes, including
Several severe fires in the last decade, construction and
maintenance of infrastructure and roads, grazing and trampling
by exotic herbivores, and recreational activities), and predation
by exotic carnivores (Clemann, 2003, 2013). Historically, loss
and degradation of the habitat of C. praealtus due to cattle
erazing also occurred in the Alpine National Park, and damage
from this impact remains evident in parts of this lizard’s range
in Victoria (N. Clemann pers. obs.). Other reptiles endemic to
the mainland alpine region also occur on the Wellington Plains,
including threatened species such as the alpine bog skink
Pseudemoia cryodroma and the tussock skink P. pagenstecheri.
The fact that this population of C. praealtus remained unknown
until so recently demonstrates that further surveys of Victorian
alpine environments are needed if we are to document and
effectively manage the biodiversity of this region, especially in
the face of increasingly frequent and devastating bushfires.
Acknowledgements
Tissue samples were collected under a permit (number
100006167) granted by the Victorian Department of
Environmental Research, Department of Environment, Land,
Water and Planning (DELWP), and with approval from
Animal Ethics Committees at DELWP (approval number
15/08). We thank Wayne McCallum (Ranger, Parks Victoria,
Heyfield) who assisted in transporting survey tiles and
establishing tile transects and Tarmo Raadik for helpful
comments on a draft of this paper.
References
Akaike, H. 1974. A new look at the statistical model identification.
IEEE Transactions on Automatic Control 16: 3—14.
Avise, J.C. 2004. Molecular markers, natural history and evolution,
2nd edition. Sinauer Associates Inc: Sunderland MA. 655 pp.
Chapple, D.G., and Keogh, J.S. 2004. Parallel adaptive radiations in
arid and temperate Australia: molecular phylogeography and
systematics of the Egernia whitii (Lacertilia: Scincidae) species
eroup. Biological Journal of the Linnean Society 83: 157—173.
Clemann, N. 2003. Flora and Fauna Guarantee Act, action statement
No. 113. Alpine She-oak Skink Cyclodomorphus praealtus.
Department of Sustainability and Environment, East Melbourne,
Victoria.
Clemann, N. 2011. Survey and monitoring of threatened Victorian
alpine herpetofauna: results for the 2010—11 season. Arthur Rylah
Institute for Environmental Research, Department of
Sustainability and Environment, Heidelberg, Victoria.
Clemann, N. 2013. Survey and monitoring of threatened Victorian
alpine herpetofauna: results for the 2011—12 season. Arthur Rylah
Institute for Environmental Research, Department of
Sustainability and Environment, Heidelberg.
Clemann, N., Lawrence, J., and Lawrence, P. (2016). A new Victorian
locality for the threatened Alpine She-oak Skink Cyclodomorphus
praealtus. The Victorian Naturalist 133: 51—54.
Clement, M., Posada, D.C.K.A., and Crandall, K.A. 2000. TCS: a
computer program to estimate gene genealogies. Molecular
Ecology 9: 1657—1659.
Cogger, H. 2014. Reptiles and amphibians of Australia, 7th edition.
CSIRO Publishing: Melbourne. 1080 pp.
Department of Sustainability and Environment. 2013. Advisory list of
threatened vertebrate fauna in Victoria — 2013. Department of
Sustainability and Environment, East Melbourne, Victoria.
Felsenstein, J. 1985. Confidence limits on phylogenies: an approach
using the bootstrap. Evolution 39: 783-791.
Huelsenbeck, J. P., Ronquist, F., Nielsen, R., and Bollback, J. P. 2001.
Bayesian inference of phylogeny and its impact on evolutionary
biology. Science 294: 2310—2314.
Koumoundouros, T., Sumner, J., Clemann, N., and Stuart-Fox, D.
2009. Current genetic 1solation and fragmentation contrasts with
historical connectivity in an alpine lizard (Cyclodomorphus
praealtus) threatened by climate change. Biological Conservation
142: 992-1002.
Markeraf, V., McGlone, M., and Hope, G., 1995. Neogene
paleoenvironmental and paleoclimatic change in southern
temperate ecosystems — a southern perspective. Trends in Ecology
and Evolution 10: 143—147.
Ronquist, F., and Huelsenbeck, J.P. 2003. MrBayes 3: Bayesian
phylogenetic inference under mixed models. Bioinformatics 19:
1572-1574.
Shea, G.M. 1995. A taxonomic revision of the Cyclodomorphus
casuarinae complex (Squamata: Scincidae). Records of the
Australian Museum 4T. 83-115.
Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar 5. 2013.
MEGAO: Molecular Evolutionary Genetics Analysis version 6.0.
Molecular Biology and Evolution 30: 2725-2729.
Memoirs of Museum Victoria 80: 159-168 (2021) Published 2021
1447-2554 (On-line)
httos://museumsvictoria.com.au/collections-research/journals/memoirs-of-museum-victoria/
DOI https://doi.org/10.24199/j.mmv.2021.80.08
The unusual genus Ramtheithrus (Trichoptera: Philorheithridae)
RosALIND M. ST CLAIR
Museums Victoria, GPO Box 666, Melbourne VIC 3001. rstclair@museum.vic.gov.au
St Clair, R.M.. 2021. The unusual genus Ramiheithrus (Trichoptera: Philorheithridae). Memoirs of Museum Victoria 80:
The descriptions of males of the two described species of Ramiheithrus (R. virgatus Neboiss and R. kocinus
Neboiss) are expanded using additional material. The female, pupa and larva of Ramiheithrus virgatus are described for
the first time for the genus. Preliminary genetic barcoding analysis suggests the presence of additional undescribed species
that are only known as larvae. The unusual larval habitat 1s described and issues relating to this are discussed.
Abstract
159-168.
Keywords Australia, groundwater habitat, COI gene, pectinate antennae
Introduction
The genus Ramiheithrus was created for two species, one each
in Victoria and Tasmania, by Neboiss (1974) with only adult
males known at the time. Information here brings the number of
species in the genus to four but the two additional species are
known only as larvae. The descriptions of males of the two
described species are revised here, partly based on specimens
from additional sites. Figures indicating differences from the
original descriptions, or those showing additional information,
are included for males. The adult female, pupa and larva of
Ramiheithrus virgatus Neboiss are described. The larva of R.
virgatus is compared with the larvae of two additional species.
The "rami" in Ramiheithrus refers to the distinctive
pectinate antennae. Pectinate antennae are otherwise unknown
in Trichoptera, except for three species of the Odontoceridae
genus Phraepsyche from South East Asia (Olah and Johanson,
2010) although the form of the pectination is apparently
different. A fossil trichopteran with yet another form of
pectination is discussed in Gao et al. (2016).
Few females of Philorheithridae are described and there is
variation between species in genera where more than one species
is known. Philorheithrus now has females of four species
described, and these show considerable variation in shape of
genitalia (Henderson and Ward, 2006; Mosely and Kimmins,
1954). This suggests that females of other Ramiheithrus species
may differ from the description below. The vaginal apparatus of
R. virgatus is illustrated below but there is no information on
other Philorheithridae females to compare with.
Larvae of Ramiheithrus have very rarely been collected.
The few available specimens provide information on variation
in the larvae and the likely reason for this rarity.
DNA barcoding data is preliminary but has assisted
taxonomic decisions.
Material and methods
The terminology here follows Henderson and Ward (2006)
and Holzenthal et al. (2007) but not Neboiss (1974).
All specimens are lodged in the Museum of Victoria (NMV)
and have been assigned registration (TRI) numbers. Reared
specimens usually include the case with pupal closure
membranes and larval sclerites, pupal skin and adult. The adult
has not emerged from the pupal skin in some cases and wing
venation cannot be discerned. Tissue samples sent to the
Barcode of Life Data System (BOLD; http://www.boldsystems.
org) for sequencing and analysis have been allocated L'TUT
numbers. Information on the methods used for sequencing and
cene segment sequenced are available on the BOLD website.
Data for specimens included in fig. 24 and Table | are available
from the BOLD website. The neighbour joining tree (fig. 24)
was produced on the BOLD website using a Kimura 2 parameter
and BOLD aligner (amino acid—based HMM) and produced in
Newick format using MEGA 7 on 26 October 2019.
Taxonomy
Ramiheithrus Neboiss
Type species: Ramtheithrus virgatus Neboiss
The information here uses and extends that given by Neboiss
(1974).
Diagnosis. This genus 1s strikingly unique with the antennae of
the adult pectinate on the basal half (fig. 1). In males, the superior
appendages are fused to segment IX and in basal half to each
other to form a hood over the genitalia (figs 2, 3, 22). This 1s like
the hood in Kosreithrus and, to a lesser extent, some species of
Aphilorheithrus. In Ramiheithrus, the superior appendages have
160
the ventral surfaces covered with moderately long spines in the
distal third. The inferior appendages are short and very simple,
most similar to those of Kosrheithrus. As with most
Philorheithridae, the forewing has vein R1 joining R2 just before
the wing margin in both sexes. However, this join is not present
in some specimens in some populations of R. virgatus (fig. 5) and
R. kocinus (fig. 23) and seems to be absent in at least some
species in other genera. The forewing has O to 5 crossveins
present between Sc and the costa proximal to the level of the r
vein in both species, fewer than most Aphilorheithrus species but
otherwise unusual in the family (fig. 5). The hind wing of both
sexes with Sc and RI merged for a short distance before
separating and diverging again (fig. 5). Spiracles on pleura
ventrally on segments 2 to 4 enlarged, elongate and variably
fleshy, smaller and more rounded on segments 5 to 8, only lightly
sclerotised around them (fig. 4).
In the larva, the anterior part of the frontoclypeal apotome
is almost twice as wide as posterior to the constriction (figs 10,
24, 26). On the mid leg, the strong dark distal spine on the tibia
remains despite the segment being fused with the tarsus (fig.
14). This spine is not present in other Australian Philorheithridae
genera, although long and short pale setae are often present in
this region. The larval case has the posterior opening almost
completely closed by larger sand grains and large flat mineral
particles but with gaps between these particles (fig. 17).
Generic diagnoses are not given for females or pupae
because they are known from one species only.
Description. Head: pilifers absent; maxillary palps 5-segmented,
long and slender in both sexes; labial palps short, about as long
as maxillary palps segments one and two combined; antennae
about as long as forewing, first segment stout, slightly longer
than vertical diameter of eye, second segment very short, next
14 to 16 segments with long lateral branches, becoming shorter
on the more distal segments, first 2 or 3 segments may have
branched rami (fig. 1); a pair of small anterior setal warts near
midline, pair of large, elongate, kidney-shaped posterior setal
warts and pair of posterolateral setal warts encircling posterior
half of eye. Thorax: 2 pairs of warts on pronotum, most medial
pair elevated; | pair of rounded scutal warts, usually larger than
scutellar warts; male forewing length 9 to 12 mm and lobe on
anal margin strongly sclerotised, apex broad apically truncate,
forks 1, 2, 3 and 5 present, male hind wing with forks 1, 2, 3 and
5, fork 3 footstalk of variable length. Abdomen: a small
projection on sternite VII, variable in size.
Male genitalia: superior appendages moderately long, deeply
excised, very broad and fused basally to segment IX and each
other forming a hood, ventral surface of each with short pointed
spines covering apical half; segment X (trilobed hood-like plate
of Neboiss, 1974) trilobed, lateral lobes similar to each other but
different to median lobe; inferior appendages a simple short
broad plate, sometimes scooped out apically, almost bilobed in
some specimens (figs 2, 3, 22). Phallus narrow, tapering apically.
Larva. Final instar about 9 to 12 mm long. Head: rounded
and somewhat flattened dorsally; strong carinae present just
above the eye from the anterior margin to about three quarters
head length, forming the lateral margin of the head on each
side; region between the carinae sloping ventrally near each
R.M. St Clair
carina which are raised above the head surface, roughened by
minute protuberances; antennae very short, close to front of
head and below carinae; labrum with 3 pairs of setae at about
3/4 length and another 3 pairs of short stout setae on front
margin, lateral two pairs curved along margin; ventral apotome
about 1/15 length of ventral ecdysial line; head setation as in
fig. 10, most setae on the dorsal surface (but not on the carina)
are short and very pale usually bent over or lying flat. Thorax:
metanotum with 3 pairs of sclerites, anteriomedial pair about 4
times as long as posterior pair (figs 11, 24); prosternum with a
large posterior central sclerite (figs 12, 25); mesosternum with 2
pairs of closely aligned sclerites medially, smaller and paler
than pronotal sclerite, posterior pair rectangular, anterior pair
tapering laterally (fig. 12); forelegs each with cluster of more
than 12 stout black setae centrally on anterior face of femur, all
arising from same point (fig. 13), tibial spur about 1/3 tarsal
length, tarsal claw about half as long as tarsus, apical spine of
tarsal claw almost as long as tarsal claw and lying closely along
its length; mid leg tarsal claw about 1/5 tibiatarsus, basal spine
of claw almost as long as tarsal claw and lying closely along its
length; hind legs much longer than forelegs, tarsal claw about
half tarsal length, 2 tibial spines on each tibiae about 1/3 tarsal
length, 1 on anterior face, 1 ventral, a group of short spines
apicoventrally (fig. 14). Abdomen: tergite IX short, not
completely covering the segment, lightly sclerotised, with
fringe of about 14 long setae and about 30 short or moderate
length setae (fig. 15). The lightly sclerotised channel running
ventrally from the base of anal claw towards the ventral
junction of the prolegs 1s deeper and more obvious than in some
other genera (fig. 16). This channel is darkly sclerotised at the
deepest point near the base of the anal claw. Anal claws with
tooth almost 1/2 length of claw.
Ramtheithrus virgatus Neboiss, 1974:
Figures 1-21
Type Material. Holotype male, Victoria. McKay Creek, Sassafras Gap,
36° 36'S 147? 4T E, 2 February 1974, A. Neboiss (NMV TRI-4558).
Paratypes 8 males, collected with holotype (NMV TRI-4559 to 4566).
Other Material examined. New South Wales. Alpine Creek
Kiandra, 35? 52' S 148° 29' E, 20 January 1966, 3 males 2 females
(NMV TRI-29289), 16 January 1968, 1 male (NMV TRI-29288), 13
December 1974, 2 males, 3 females (NMV TRI-29290), E.F. Riek.
Victoria. Roadside trickles 1.2 km N of Sassafras Gap, —36.6° E
14779? S, 10 February 2010, 1 larva (LTUT720-12) (NMV TRI-
54703), D. Cartwright and R. St Clair, 19 December 2013, 1 larva
(NMV TRI-55169), D. Cartwright; Roadside seep 1.6 km N of Sassafras
Gap, 10 February 2010, | larva (NMV TRI-55167), 11 February 2010,
preserved assorted dates to 21 February 2010, 3 reared males, 1 reared
female, 2 male pupae, 1 female pupa all with larval case and sclerites,
6 larvae (NMV TRI-54806 to 54815), D. Cartwright and R. St Clair;
Whites Bridge Mt. Buller Road 5 km SE Mirimbah, 37° 08' S
146° 26' E, 22 Mar 1985, 1 male A. Neboiss (NMV TRI-29291), 1 male,
2 Jan 2011, M. Shackleton (LTUT723-12) (NMV TRI-54702).
Diagnosis. As for the generic diagnosis with the following
additions. Male genitalia with segment X median lobe elongate,
longer than lateral lobes (figs 2, 3).
Larva distinguishable from larvae of the two other species
in the genus by the absence of small anterior sclerites on the
The unusual genus Ramiheithrus (Trichoptera: Philorheithridae)
spiracle
161
Figures 1—4. Ramiheithrus virgatus male: 1, Sassafras Gap body lateral; 2, Mt Buller genitalia ventral; 3, Kiandra genitalia lateral; 4, Mt Buller
abdomen lateral showing elongate spiracles on segments. ia = inferior appendage, sa = superior appendage, IX = segment IX, X = segment X.
prosternum, the more strongly developed brush of small
spines apically on the hind legs (fig. 14) and the reddish-brown
head and thorax (fig. 11). Collection of additional larval
specimens of the two undescribed species may show these
larval characters to not be as diagnostic.
Description. Revised after Neboiss (1974). As for the generic
description with the following. Antennae rami dark brown,
antennal segments yellowish. Forewings irregularly mottled
ereyish brown, a distinct pale oval spot close to wing margin
within fork 3, smaller and less conspicuous ones between the
veins above and below it (fig. 1); R1 joins R2 in males and females
although R1 joins the wing margin instead in most specimens
collected near Kiandra (fig. 5) and a few from Sassafras Gap.
Male genitalia: segment X median lobe laterally
compressed, lobe longer than lateral lobes; lateral lobes flat,
somewhat truncate in lateral view; phallus comes to a point
apically, curved downwards ventrally; inferior appendages
somewhat truncate distally in ventral view, irregular or with a
concavity (rarely 2) apically in some specimens (figs 2, 3).
Female. Antennal rami on segments 3 to 11, 12, or 13, rami
less than half the length of those in males. Forewings with
forks | to 5 present, forks 3 and 4 on long footstalks, hind
wings similar to male (fig. 5). Sternite VIII with a band of
short pale setae along posterior margin (figs 6, 7). Genitalia:
tergite IX very broad and sclerotised dorsally, narrowly cleft
mesally, medial notch on posterior margin. With a pair of
depressions laterally on segment, with a weak carina along
dorsal margin of each. Sternite [X with triangular sclerotised
area on anterior half of segment, fleshy laterally and posteriorly
(figs 6—9). Simple, apical lobes fused with segment X or lost.
Pupa. Head with a pair of prominent rounded, tuberculate
warts on the frons taking up most of the width of the frons
which are similar to, but more prominent than, those of
Aphilorheithrus and Kosrheithrus; a pair of long setae
dorsally medially on the head between the antennae, a second
pair just dorsal to the tuberculate warts (fig. 15), labrum with
3 pairs of setae in each dorsolateral corner; mandibles blade-
like in apical half, narrowing to a point, straight and serrate
on inner margin, rounded and smooth on outer margin, with a
pair of medium length setae basally (fig. 19); each scape with
medium length setae, 1 pair mesal dorsal and | pair distal
ventral (fig. 18). Legs without swimming fringes, rarely a
weak fringe on at least one mid leg. Abdomen with pairs of
162 R.M. St Clair
Figures 5—9. Ramiheithrus virgatus female: 5, Kiandra right fore and hind wings; 6, Kiandra genitalia lateral; 7, Sassafras Gap genitalia lateral;
8, Sassafras Gap genitalia dorsal; 9 Sassafras Gap genitalia ventral. d = depression.
The unusual genus Ramiheithrus (Trichoptera: Philorheithridae) 163
Figures 10-17. Ramiheithrus virgatus Sassafras Gap larva: 10, head dorsal; 11, head, thorax and first abdominal segment dorsal; 12, head, thorax
and first abdominal segment ventral; 13, foreleg anterior face lateral; 14, legs posterior face lateral; 15, abdominal segment IX dorsal; 16, last
abdominal segment ventrolateral; 17, case and posterior closure. cs = cluster of setae, pc = particles closing posterior opening.
164
R.M. St Clair
Figures 18-21. Ramiheithrus virgatus Sassafras Gap pupa: 18, shed cuticle head and thorax dorsal; 19, anterior of head ventral; 20, shed cuticle
abdomen dorsal; 21, last abdominal segment ventral.
anterior dorsal hook plates on segments 3 and 4 each with 2 to
4 teeth, segments 5, 6 and 7 each with 3 to 6 teeth; pair of
posterior hook plates on segment 5 each composed of a row of
16 to 25 spines, many bifid (usually different number on each
side) covering most of the width of the segment and with a
short gap between each plate, spines as long as plates (fig. 20).
Last abdominal segment elongate subtriangular, with 2 pairs
of long setae mesally, ventrally (fig. 21). Anal processes as for
the family: lightly sclerotised, long, very narrow and slightly
curved apically, each with a short dark pigment band close to
the apex and without setae (figs. 20, 21). Larval case with
anterior pupal closure a disc of silk without any openings
holding on a capping stone.
Larva. As for diagnosis. Final instar larva head capsule
width across eyes 1.3 to 1.4 mm.
Remarks. Note that the variation found in wing and genitalic
structures of the male were found in all populations.
The unusual genus Ramiheithrus (Trichoptera: Philorheithridae)
Ramiheithrus kocinus Neboiss, 1974.
Figures 2223
Type Material. Holotype male: Tasmania. Small creek in forest,
Corinna. 5 November 1972. A. Neboiss and G. Kocins (NMV TRI-
4567). 1 Paratype collected with holotype (NMV TRI-4568).
Other Material Examined. lasmania. Creek crossing Gordon
River Road. 42.887° S 146.379" E, 11 January 2012, 1 male
(LIUTI103-12) (NMV TRI-54701) M. Shackleton and J. Mynott.
Diagnosis. As for the generic diagnosis with the following
additions. Male genitalia with segment X median lobe broad,
shorter than lateral lobes (fig. 22).
Description. Revised after Neboiss (1974). As for the generic
description with the following. Type specimens blackish with
faint paler irregular mottling on forewings of which the most
conspicuous is a pale area covering cross veins s, r-m and m,
and extending along back along M1 about half the length of the
wing. Gordon River Road specimen greyish brown with
indistinct white mottling and spots, forewing 9 to 9.5 mm long.
R2 joining R3 in type specimens only, fork | with or without a
short footstalk. Forewings of male with vein A2 long in type
specimens, short in Gordon River Road specimen (fig. 23).
Male genitalia. Phallus broad apically; segment X lateral
lobes with a few moderately long spines medially; inferior
appendages come to a slight point laterally (fig. 22).
Female, pupa and larva unknown.
Remarks. This species is known from only two specimens from
the type locality and one specimen from a site (Gordon River
Road) about 170 km southeast of the type locality. DNA
information is only available for the southern specimen. There
is some variation in wing colour and venation and male
genitalia but with so few specimens available they are
considered conspecific for now.
Additional presumed species of Ramiheithrus
Larvae found at two localities in the Yarra Ranges National
Table 1. Specimen details for sequenced Ramiheithrus
169
Park are included here and are the only other species known
in the larval stage. This enables preparation of the generic
diagnosis and description. The distinctness of these two
Species 1s based on the genetic distance, as discussed in the
preliminary genetic analysis below.
Ramtheithrus sp. 1
Figures 24—25
As for the larval generic diagnosis and description with the
following additions.
Description. Larval head capsule yellowish brown, width
across eyes 1.4 mm, body length 12 mm. The only mid leg on
the one specimen has the remnant tibial spine about 1/3 as long
as that of R. virgatus; prosternum with pair of small sclerites
immediately anterior to the large central sclerite (fig. 24). These
characters may not enable separation from larvae of other
species when variation within each species is known.
Philorheithrus larvae also show almost no variation between
the three species recognised (Henderson and Ward, 2006).
Material examined. Victoria: Alderman Creek at Track 32, Yarra
Ranges National Park, 37.72]? S 145.94]? E, 5 November 2009, |
larva, J. Dean and R. St Clair (LTUT721-12) (NMV TRI54435).
Ramtheithrus sp. 2
Figure 26
Description. Adult unknown. Larva. As for generic diagnosis
and description. Head capsule yellowish brown, width across
eyes 1.5 mm, body length 12 mm. Case posterior closure
comparatively flat with attached particles smaller and sparser
than in the other two species.
Material examined. Victoria: Contentment Creek site ETT4DS RS,
CAPIM Black Spur Weir Project, 10 January 2013, 1 larva (LTUT1385-
14) (NMV TRI-55176); Contentment Creek, CAPIM Black Spur Weir
Project, 10 January 2015, | larva (NMV TRI-54816).
MV Registration Accession No. Life stage
No. (TRI)
54701
BOLD Process ID | COI GenBank BOLD BIN No.
Accession No.
B
o
m
ABV8840
LTUT721-12 JOS152 Larva
54702 LTUTI385-14 EPAVT54 Larva
54437 LIUT720-12 JOSI51 Larva
54703 LIUT723-12
KX292939
JOS154 Adult male
54435 LIUTIIOS-12 JOS316 Adult male
KX293205 ACC8741
166 R.M. St Clair
Figures 22 — 23. Ramiheithrus kocinus Gordon River Road male: 22, genitalia ventral: 23, left forewing (rotated 180° for comparison with other
wings). Figures 24 — 26. Ramiheithrus sp. 1 larva: 24, head and thorax dorsal; 25, head and thorax ventral. Ramiheithrus sp. 2 larva: 26, head
dorsal. ia = inferior appendage, sa = superior appendage, X = segment X.
The unusual genus Ramiheithrus (Trichoptera: Philorheithridae)
Discussion of COI data
An abbreviated COI taxon identification tree is shown in fig.
27 and information on specimens is provided in Table |. Only
one specimen was barcoded from each of five localities.
Usually, at least five specimens over the range of the species
are required to confirm genetic distinctness. Thus, more
sequencing is required to confirm the current interpretation.
The COI taxon identification tree indicates that the two
larvae from the Yarra Catchment (LTUT721-12 and
LTUT1385-14) are genetically very different from each other
and from other specimens (fig. 27). Because there is no adult
specimen available from either locality, these species are not
being formally described.
The genetic distance between the specimen of
Ramiheithrus virgatus from near the type locality (LTUT720-
12) and the specimen from near Mt Buller (LTUT723-12) is
close to 5%. This is greater than often considered necessary to
indicate distinct species. However, no consistent
morphological features were found to support recognition of
167
the Mt Buller population as a new species. The generally large
distances between all specimens indicate that the commonly
applied 2% or 3% threshold for species separation may not
apply to this genus. As a result, all the Victorian (apart from
the larvae from the Yarra catchment) and New South Wales
specimens are here assigned to the one species.
Discussion of larval habitat and its implications
Larvae of Ramiheithrus virgatus have been collected for the
first time. The first larva collected was in a roadside trickle
that is only present after rain and which was dry the day
following collection. The trickle appeared as a point where a
narrow conduit of groundwater reached the surface, rather
than just a point where a broad area of groundwater happened
to reach the surface. Investigation found pupae and more
larvae in saturated coarse gravel behind a large mound of
moss. The seep was less than two square metres on a vertical
area of road cutting. Water flowed into the roadside ditch from
this area in rainy conditions. This locality was very close to
Ramtheithrus|L TUT 721-12] RCUAIdermanCreekatT rack3 2|BOLD\0/2ABV8839
Ramiheithrus|LT UT 1103-12|CreekcrossingGordonRRd|BOLD WO /2ACC8/41
Ramtiheithrus|L T UT /723-12]White sBnidgeonMtBullerRd|BOLD\0/2ABV8340
— Ramiheithrusvirgatus|LT UT 7 20-12|Roadsideseep 1.2 kmNEustaceG apRd|BOLD'07 2ABV9442
Ramiheithrus|LT UT 1385-14|ContentmentCKk054BlackSpur.Sweep|BOLD V0 72ACM3556
I—1
0.0100
Figure 27. BOLD Taxon identification tree.
168
the type locality and an adult was collected at light at this new
locality soon after finding the larvae and pupae. Some pupae
were reared to the adult stage. No similar localities were
found nearby, despite extensive searching.
After the habitat was recognised, attempts were made to
find similar habitats on the Mt Buller Road, the only other
locality in Victoria where adults have been collected. No such
habitat or Ramiheithrus larvae were found. Areas where
eround water was flowing into roadside ditches following rain
were found but not associated with a particular moss and not
appearing to lead to a gravelly conduit. Presumably, such
areas are present but not on the roadside, at least at the time of
searching. Being so small, such habitats would be extremely
difficult to locate hidden within the vegetation.
The only specimen of Ramiheithrus sp. 1 was collected at a
standard riverine habitat. However, as only one larva was
collected, despite the site being sampled on numerous occasions
by the Environment Protection Authority Victoria over a 20-year
period, this clearly is not the preferred habitat of the species.
This larva was presumably washed in from its usual habitat. A
similar but smaller area of moss was noted on a road cutting
about 100 metres uphill from the site but not investigated.
The specimens of Ramiheithrus sp. 2 were collected from
very small trickles, a slightly different habitat to that of
Ramiheithrus virgatus. Several specimens were collected;
therefore, this appears to be their habitat.
The assumption is made that the habitat is similar for all
species of Ramiheithrus. The fact that only a single larva has
been found in a true riverine habitat supports the fact that the
main habitat is unusual, and soaks like that where R. virgatus
was collected near Sassafras Gap are considered the most likely.
Although found in alpine areas, this genus has not been
found above 1500 metres. This also could be related to the
habitat as it would occur lower down the mountain where
eround water seeps out of conduits and associated with a
particular type of moss.
The fact that collection of the larvae is so difficult means
that species in this genus will be difficult to manage.
Ramiheithrus virgatus 1s listed as vulnerable 1n Victoria and
R. kocinus is listed as threatened in Tasmania. The adults are
rarely found and in low numbers when they are collected.
However, E. Riek collected adults at the one locality four
times over 1] years. Adult specimens have been collected
from the White Bridge locality on more than one occasion,
although collecting on other occasions was unsuccessful. It 1s
possible that adults usually remain near the larval habitat.
largeted collecting would be extremely difficult due to the
very patchy nature of the habitat.
With the larvae and adults probably living in small areas
of habitat spread over a wide area, could this be the reason
R.M. St Clair
why adults have rami-bearing antennae. Presumably they
have a sensory function. Gao et al. (2016) suggested rami
enable greater sensory function for detection of pheromones
or volatile chemicals from food. It is possible the rami in
Ramiheithrus are used to locate other adults in highly
localised habitat patches.
The absence of swimming fringes on the mid legs of the
pupae may be an adaptation to the larval habitat as the pupae
were not collected in free water. At this stage, the pupa of
only one species 1s known so this may not be typical of all
Ramiheithrus pupae. Examination of pupae from most
Australian Philorheithridae genera found they have swimming
fringes. One of the two species of Philorheithridae pupae
described from New Zealand, Philorheithrus agilis 1s found
in swift streams has swimming fringes while Philorheithrus
litoralis has a very weak fringe of few pale setae and is found
in small streams or seepages (Henderson and Ward, 2006).
Two females of Ramiheithrus virgatus reared from pupae
had many well-developed eges 1n the abdomen. This may be
another adaptation to the unusual habitat, but because it 1s not
known how many philorheithrid species are similarly
advanced when emerging, this cannot be confirmed.
Acknowledgements
I am very grateful to David Cartwright for organising our
collecting trip and finding the larval habitat of Ramiheithrus
virgatus. John Dean is thanked for improving the manuscript
and David Cartwright for very helpful reviewer comments.
References
Gao T., Shih C., Labandeira C.C., Santiago-Blay J.A., Yao Y., and Ren
D. 2016. Convergent evolution of ramified antennae in insect
lineages from the Early Cretaceous of Northeastern China.
Proceedings of the Royal Society B 283: 20161448. http://dx.doi.
org/10.1098/rspb.2016.1448
Henderson, I.M., and Ward, J.B. 2006. Four new species of the caddis
genus Philorheithrus (Trichoptera: Philorheithridae) from New
Zealand. Records of the Canterbury Museum 20, 21-33.
Holzenthal, R.W., Blahnick, R.J., Prather, A.L., and Kjer, K.M. 2007.
Order Trichoptera Kirby, 1813 (Insecta), Caddisflies. Zootaxa
1668: 639—698.
Mosely, M.E., and Kimmins, D.E. 1953. The Trichoptera (Caddis-flies)
of Australia and New Zealand. British Museum (Natural History):
London. 550 pp. https://doi.0rg/10.5962/bhl.title.118696
Neboiss, A. 1974. A new caddis-fly genus from Victoria and Tasmania
(Philorheithridae: Trichoptera). Victorian Naturalist 49: 322—325.
Oláh, J., and Johanson, K.A. 2010. Description of 33 new species of
Calamoceratidae, Molannidae, Odontoceridae and
Philorheithridae (Trichoptera), with detailed presentation of their
cephalic setal warts and grooves. Zootaxa 2457: 1—128. https://doi.
org/10.11646/zootaxa.2457.1.1
Memoirs of Museum Victoria 80: 169-181 (2021) Published 2021
1447-2554 (On-line)
httos://museumsvictoria.com.au/collections-research/journals/memoirs-of-museum-victoria/
DOI https://doi.org/10.24199/j.mmv.2021.80.09
George Lyell and Frederick Parkhurst Dodd: authority and expertise in nineteenth-
century Australian entomology
DEIRDRE COLEMAN
https://hindanexpert.unimelb.edu.au/profile/50297-deirdre-coleman
Robert Wallace Chair of English, English and Theatre Studies, School of Culture and Communication, University of
Melbourne, Parkville VIC 3010, Australia. (colemand(?unimelb.edu.au)
Abstract
Coleman, D. 2021. George Lyell and Frederick Parkhurst Dodd: authority and expertise in nineteenth-century
Australian entomology. Memoirs of Museum Victoria 80: 169-181.
This article focuses on the correspondence and careers of two lepidopterists, George Lyell and F. P. Dodd. Drawing
on Dodd's unpublished letters to Lyell during the late nineteenth-century rage for butterflying, it examines how private
acquisition gave way to the professional activity of collecting and, in Lyell's case, the eventual gifting of a large and
significant collection of moths and butterflies to the National Museum of Victoria from 1932 through to 1946. The article
also examines how issues of authority and expertise were measured and contested among collectors in this period.
Keywords
Introduction
Professionalisation in nineteenth-century life sciences 1s a lively
topic within British and North American histories of science,
but it is a topic less examined in the Australian context. This
article extends current debates by examining the correspondence
between two self-taught Australian lepidopterists, Frederick
Parkhurst Dodd (1861—1937) and George Lyell (1866-1951).
Both were private collectors, born in the shadow of the
Grampians in south-west Victoria, but that is where the
similarities end. Lyell built a large collection of Lepidoptera
while working full-time in business, whereas Dodd supported a
large family through selling his specimens. The article begins
with Lyell’s decision in 1932 to donate his large collection to the
National Museum of Victoria. It then moves back in time to an
examination of Dodd’s letters to Lyell from 1897—1904. These
letters, while reflecting informal one-to-one transactions of
exchange, donation and purchase, operate within a much larger
push and pull of external factors. These external factors include
a wide network of people who were themselves subject to a
thicket of protocols, depending on their perceived status within
the group. Furthermore, the complexity and interdependence of
the various people involved in the science of entomology led to
many disputes about who exactly qualified as professionals.
Arguments as to who held the most requisite authority and
expertise were particularly acute during what has been dubbed
the Period of the Amateurs, 1890—1930 (Mackerras, 1949).
F. P. Dodd, George Lyell, lepidoptery, collecting, correspondence, professionalisation, National Museum of Victoria
The George Lyell collection
In March 1946, Richard Pescott (1905—1986), Director of the
National Museum of Victoria, informed the Australian
Broadcasting Corporation’s Melbourne office that the first
instalment of a magnificent collection of Australian butterflies
and moths was about to be exhibited in the main hall of the
museum on Russell Street. The collector was George Lyell
(1866-1951; fig. 1), and his gift to the museum was so large
that it had to be exhibited in relays, from | April 1946 until
mid-year. The announcement contained an overall description
of the collection as well as information gleaned from an
interview with Lyell about his gift to the state of Victoria.
Although the whole appeared under Pescott’s name, the real
author was journalist and naturalist Charles Barrett (1879-
1959). After the Australian Broadcasting Corporation
published the piece, Barrett then circulated it to The Herald,
The Sun, The Age and The Argus.
We learn from Barrett’s interview that Lyell had decided to
donate his collection after suffering a serious illness in 1932.
In the 14 years since then, he had devoted himself to the
colossal task of preparing more than 50 000 individual
specimens for the handover, remounting and resetting many of
them in the process. His aim was to build for the museum “the
most comprehensive collection of Australian moths and
butterflies ever known”. At the time of Barrett’s writing, the
collection numbered 51 216 specimens, consisting of 11 721
butterflies and 39 495 moths, representing 6177 species all
told. World-renowned authorities had already named 534 type
170
specimens, but new species were still being discovered and
named within the collection. In addition to praising Lyell’s
ereat scientific knowledge and technical skill, Barrett
emphasised that the gift had been unconditional, Lyell having
taken the “broadminded scientific view" to amalgamate the
Museum’s collection with his own. In this way, gaps would be
filled, ensuring that the collection would be “truly
representative of Australian entomology’. Barrett concluded
with a brief overview of the collection’s highlights, such as the
“particularly beautiful” swallowtail butterflies and the “lovely
Blue butterfly, Papilio ulysses". It was in the moths, however,
Figure 1. George Lyell as a young man.
D. Coleman
that the collection approached perfection (Melbourne
Museum, Notice to Manager, ABC, AB 576, 29 March 1946).
Lyell was born at Ararat, Victoria, in 1866, the fourth of
eight children (Hewish, 2014). His father was a printer born in
scotland and his mother was English. Apparently, he showed
little interest in. natural history until he caught his first
butterfly, a caper white, at Albert Park in 1888. Wanting to
know more about this creature, the 22-year-old contacted
Frank Spry (1858—1922) who immediately introduced him to
the Field Naturalists’ Club of Victoria, which was founded in
1880. While attending meetings regularly over the course of
George Lyell and Frederick Parkhurst Dodd: authority and expertise in nineteenth-century Australian entomology 171
the following year, Lyell continued to collect at Albert Park,
where he distinguished himself by collecting 13 lesser
wanderers, a butterfly that had not been recorded in southern
Victoria for well over a decade. He also made occasional
visits to other well-known hunting grounds: Murrumbeena,
Springvale, Hampton and Cheltenham.
In 1890, Lyell moved to Gisborne in central Victoria to
work as bookkeeper for the town’s largest business, Cherry &
sons Pty. Ltd., timber merchants and manufacturers of dairy
equipment. Later, as Lyell rose to Manager and then Director,
the firm developed an export business 1n entomological supplies
such as nets, mounting boards, pins, forceps, cotton wool, boxes
and cabinets (Hewish, 2014). Here, in this small country town
outside Melbourne, Lyell lived for the rest of his life. His
collecting was confined to Victoria and New South Wales,
except for one trip each to South Australia, Tasmania and
southern Queensland. Nevertheless, he corresponded and
exchanged Australia-wide with scores of notable entomologists
such as A. J. Turner and R. Illidge of Brisbane, G. M. Goldfinch
of Sydney, G. B. Lower of Adelaide and F. P. Dodd of Kuranda,
north Queensland. He also co-authored, with G. A. Waterhouse,
The Butterflies of Australia (1914). This extensive exchange
network across Australia resulted in long series of individual
species, a notable and highly valuable scientific feature of
Lyell's collection.
In outlining Lyell's career, Barrett paid particular attention
to Lyell's triumph over the largest obstacles facing collectors,
namely housing his collection and protecting it from the
scourges of pest infestation and mould. Lyell achieved this by
devising a small display cabinet of six or eight drawers,
constructing it in such a way that each subsequent unit could
be fitted together to make more cabinets, similar to the way in
which a bookcase might be enlarged. In the 1890s, at the start
of his collecting career, Lyell could only afford to build one of
these cabinets annually, but by 1932 he owned more than fifty,
built by Cherry & Sons. What Barrett did not know, or chose
not to disclose, was that Lyell had approached Sir Macpherson
Robertson in 1934 for £500 to build the many extra cabinets he
needed to house his gift. Robertson, founder of the
MacRobertson Confectionery Company in the Melbourne
inner-city suburb of Fitzroy, was one of Australia's richest and
most successful businessmen. Whereas Cherry & Sons
struggled after the Depression, business remained strong for
Robertson who contributed generously to the upcoming
centenary of Melbourne's founding in 1835, including a
substantial donation towards the building of the city's
herbarium. In essence, Lyell asked Robertson to do for
Australian Lepidoptera what he had recently done for botany.
signing off anonymously as a collector and fellow-Scot, the
normally modest Lyell took the opportunity to boast that his
collection would be "an object lesson to all the museums of the
world and a lasting scientific attraction to Melbourne". Lyell
finished by inviting Robertson to make enquiries of the
Museum Director, D. J. Mahony, an invitation promptly taken
up by the confectionary magnate (Melbourne Museum,
Archive Box 579, 27 December 1934). [n his response, Mahony
revealed Lyell's identity and confirmed that a shortage of
money was indeed hampering the progress of his gift. In
praising the collection as “the best of its kind’, Mahony
described the meticulous way in which Lyell cared for his
insects. Not only did he perform yearly stocktakes to check on
their condition, he also compiled annual balance sheets
showing acquisitions, as well as insects discarded or
exchanged. Mahony confirmed that "Every specimen is
therefore fully documented" (Melbourne Museum, Archive
Box 579, 9 January 1935). In the end, Robertson declined to
support Lyell, arguing that he had already over-committed
himself in support of the city's centenary.
George Lyell and Frederick Parkhurst Dodd
When interviewing the elderly Lyell in 1945, Barrett asked him
which was the favourite of his 6177 insect species. Lyell at first
parried the query, declaring “you have set me a poser. They are
all beautiful’. In the end he confessed that it was the Queensland
wood moth Dudgeonea actinias Turner, bred "from a rotting log
in a creek bed at Townsville" by Frederick Parkhurst Dodd (fig.
2). In 1905, Cyclone Leonta buried the log under 30 feet of flood
debris. Of the 13 specimens bred by Dodd, seven are in the Lyell
collection (fig. 3). While Dodd was just one of Lyell's many
Australian correspondents, we know a lot about their relationship
because there is an extensive run of letters from Dodd to Lyell in
the Melbourne Museum archive. Although, unfortunately,
Lyell's letters to Dodd do not appear to have survived, the
correspondence reveals the many interdependent players and
complex processes at work in shaping the Australian
entomological community during the late nineteenth century.
The collecting, exchanging and selling of insects was
serious business in the years leading up to Australian Federation
in 1901, evident in the brisk and lively circulation, both locally
and internationally, of collectors, publications, specimen boxes
and letters. Given the enthusiasm for Lepidoptera, there was
serious money to be made, especially on large and brightly
coloured tropical specimens. The story of Conrad Kelsall, an
English immigrant farmer who settled 1n the rainforest of north
Queensland, is instructive. Within four short months in 1903,
we see the rise and fall of Kelsall’s hopes for a tidy profit from
butterflying on the Little Mulgrave River. In letters to his sisters
back in Devon, he began with great confidence, declaring his
tropical home as “so new & unexplored that one is almost
certain of making new finds”. With the help of an indigenous
man nicknamed Paddy, who captured about a dozen males of
the large birdwing butterfly Ornithoptera euphorion Gray,
Kelsall asked 6d for each of them from Alfred Bell, an insurance
agent and butterfly enthusiast based in Cairns. Later, for a box
of 100 butterflies, Bell paid Kelsall 25/-, proposing that, instead
of cash transactions, his profit would double if he agreed in
future to “run on halves" and "take some risks". Once the
business was “in full swing", Bell envisaged that similar boxes
might average out at “£3 or £4 per hundred". Although new to
the collecting business, Bell boasted international contacts with
the famous lepidopterist Walter Rothschild, as well as with
Watkins and Doncaster, the English natural history dealers. Bell
was also supplying insects to Lyell and Waterhouse in Sydney,
at that time preparing their catalogue of Australian butterflies.
But within a few months, Kelsall confessed to his sisters that he
172
and his business partner needed “to modify our castles
considerably". After failing to catch anything in an expedition
to Lake Barrine, they returned to discover that all but 14 of the
100 insects they had sent to the Australian Museum had been
rejected. Worse was to come in the shape of an insulting and
caddish letter from the English dealers who purchased only two
of the butterflies sent over. Claiming that the rest were too
damaged, they promised to return them all to Queensland but
no box arrived, leaving Kelsall to conclude, ruefully, that “It 1s
easy swindling a person 12 000 miles away" (Lambkin, 2013).
While Kelsall was one of many minor part-time enthusiasts,
Frederick. Parkhurst Dodd is now regarded as a leading
Queensland collector. Born in Wickliffe, Victoria, one
stagecoach stop from Lyell's birthplace in Ararat, he was the
son of a pound-keeper and the eldest of eight children
(Monteith, 1991; Neboiss, 1986). After the family moved to
Stawell, on the edge of the Mallee, Dodd was educated at the
same local state school as Lyell. Here the similarities stop.
While Lyell went on to lead a settled life in a rural town within
easy reach of Melbourne, Dodd joined the bank in Victoria and
was then shunted around to various bank jobs 1n Queensland,
starting in remote Townsville in 1884. He never returned to live
in Victoria. Apart from six years in Brisbane, where he met and
learned much from a number of prominent entomologists
connected to the Queensland Museum and the Natural History
D. Coleman
Society, Dodd’s early life as a bank clerk took place a long way
from the metropolitan scientific societies of Brisbane,
Melbourne and Sydney. Eventually, hating the confinement of
office work, and determined to become a full-time collector, he
left the bank and eventually settled in 1904 in Kuranda, a tiny
town on the Atherton Tableland. The area was rich in insects,
but all his entomological books and journals had been destroyed
by Townsville’s Cyclone Leonta the year before. In Kuranda
there were no local libraries and no entomological societies or
meetings in which he could participate.
In Dodd’s letters to Lyell, we see the value, and indeed the
necessity, of correspondence that connected him to
Melbourne’s scientific and collecting community, including
the Victorian Field Naturalists’ Club and the National
Museum of Victoria. Lyell kept Dodd connected to
professional societies and their activities, including access to
the all-important journals. Membership of these societies and
subscriptions to their publications were expensive, often
beyond Dodd’s means, but when business was good, he turned
to Lyell for suggestions as to who might propose and second
his admission. In addition to Waterhouse and other prominent
entomologists at the Australian Museum in Sydney, Lyell
counted Walter Froggatt (1858—1937) as a friend. Founder of
the Naturalists’ Society of New South Wales in 1891, Froggatt
published regularly on Australian entomology in
Figure 2. Dudgeonea actinias ‘Turner.
174
the Proceedings of the Linnean Society of New South Wales.
After Froggatt was appointed government entomologist to the
New South Wales Agricultural Department in 1896, Dodd
asked Lyell to mention him in case the Department wanted to
purchase some of his specimens (Museums Victoria Archives,
OLDERS YSTEM~03023, AB 00368, 24 March 1901).
Dodd’s correspondence with Lyell is rich in self-description,
shedding light on the so-called divide between mere collectors
and entomologists. The label of mere collector had been hurled
by Gerard Krefft, controversial Curator of the Australian
Museum, at William John Macleay during a parliamentary
investigation into the museum in 1874 (Ville, Wright, and Philp,
2020). Although this divide between the true scientist and the
mere collector was more rhetorical than real, it was deeply
embedded in nineteenth-century thinking about who exactly
possessed the authority and expertise to speak for entomology.
In 1838, the British entomologist John Obadiah Westwood
(1805-1893) described as the very “lowest class of
entomologists” those "whose sole object 1s the procuring, either
by capture or by purchase, of a collection of handsome insects,
to be placed in drawers without any arrangement other than
that of beauty and colour or size" (Wale, 2019, pp 405—406). As
an insect breeder and naturalist, Dodd was far from this lowest
class. His deep knowledge of the bush around him and pride in
his technical skills are clear in his letters, which are full of
observations about the habits and life histories of 1nsects— their
location and distribution, their food plants, their relationship to
other species and genera, their enemies and their mechanisms
for self-defence. Many of Dodd's fine-grained observations
stemmed from tireless watching of the insects with which he
lived intimately, both at home in breeding boxes, in the bush
beyond, and in his Kuranda garden, planted with especially
chosen flower and tree species.
Despite his expertise, it is notable that Dodd never describes
himself as an entomologist. Instead, his insects are
"entomological material” and he himself is a “worker in
Entomology”. He even apologised to Lyell in his first letter for
addressing him as entomologist on the envelope, explaining
that he wanted to ensure the letter reached him (December
1897). There are several explanations for why Dodd refused to
call himself, or anyone else he admired, an entomologist. The
first reason was his dislike of the entomological fraternity: “I
have a very poor opinion of Entomologists generally", he tells
Lyell. In particular, he had little time for the growing number of
sedentary and salaried museum men whom he regarded as far
less knowledgeable and skilful than himself. Writing to Lyell 1n
1901 about J. A. Kershaw (1866-1946), later curator and then
Director of the National Museum of Victoria, Dodd places him
contemptuously amongst the “amateur Entomologists", with the
word "amateur" doubly underlined for emphasis (National
Museum of Victoria, 15 July 1901). The reason for his dismissal
of Kershaw and others stemmed from his pride as an insect
breeder with first-hand eye-witness experience. Even Froggatt,
author of Australian Insects (1907), the first comprehensive
textbook on Australian entomology, failed to come up to scratch
in Dodd’s opinion. While he conceded to Lyell that Froggatt
“may be a good entomologist” he added that “he had better
drop writing the life histories of moths”. According to Dodd,
D. Coleman
Froggatt had been duped by a Newcastle collector called
Thornton into believing that the larvae of Endoxyla encalypti
had bored as deep as five feet into the wattle tree roots, “high
class rubbish” that had been published in the Proceedings of the
Linnean Society of New South Wales (National Museum of
Victoria, 1 January 1898). Elsewhere, Dodd refers to Froggatt
(anonymously) as “an Australian Munchhausen” for producing
the same exaggerated observations (Dodd, 1916).
Keen to read the latest essays, notes, and pamphlets about
insects, Dodd published some important discoveries of his
own in entomological and natural history journals, both
Australian and international. Geoff Monteith gives two
examples of the ways in which Dodd was ahead of his time in
understanding the life histories of insects. Dodd 1s now known
for his breakthrough insights into the symbiosis between
ereen tree ants and the highly prized butterfly Liphyra
brassolis Westwood. Also notable was his detection of the
mimicry between the rare swallowtail butterfly, Papilio
laglazei Depuiset, and the poisonous day-flying moth, Alcides
agathyrsus Kirsch (Monteith, 1991). However, with no access
to large reference collections and short on time, Dodd was, as
he confessed to Lyell, “but poorly acquainted with the names
of our [Australian] insects’ (National Museum of Victoria, 11
October 1897). A few months later, having picked up on the
fact that Lyell was “well posted in the names”, he asked him
for help, confessing that
unfortunately hundreds of my species are yet
unknown to me by name. I shall do all I can to
get them identified + hope to get a list compiled
such as yours. When furnishing particulars of
specimens sent, or even acknowledging
exchanges, can you kindly add names of sub
family + family of individual specimens; in
many cases the generic name + view of the moth
does not tell me what the insect 1s (National
Museum of Victoria, 11 December 1897).
Before long, he was thanking Lyell for the trouble he had
taken in supplying him with names (National Museum of
Victoria, 12 February 1898).
Dodd’s failure to master the precise names of insects did
not mean that he despised the systematists. In fact, he was
extremely proud of the great attention shown to his collection
by Brisbane-based Dr Alfred Jefferis Turner (1861-1947), an
expert in classification who would often travel to Townsville,
and later Kuranda, to study, describe and name Dodd’s insects
(National Museum of Victoria, 29 September 1900). You can
hear Dodd’s pride in a comment he made to Lyell of a small
syntomid he sent on to him. Turner, he wrote, regarded the
Specimen “as a great prize, and in fact he thinks very
favourably of all the kinds I am sending you. He often calls
upon me, to examine my collections, + learn if I have anything
fresh in the way of captures, or from my breeding boxes”.
Rowland Illidge, Dodd's mentor during his years in Brisbane,
was another expert identifier, helping him to name hundreds
of species. Despite his self-confessed deficiencies in this
arena, Dodd was never cowed. When Lyell returned a large
hawk moth, believing it was not the moth Dodd had promised
George Lyell and Frederick Parkhurst Dodd: authority and expertise in nineteenth-century Australian entomology 175
him, Dodd exploded with irritation. In this instance, where
the differences between species were scarcely perceptible,
Dodd’s experience as a breeder gave him that extra degree of
self-certainty (National Museum of Victoria, 27 May 1901).
On balance, rarity was a strong possibility in the remote
Queensland tropics, but how could Dodd always be certain,
lacking expert associates and reference materials? Perhaps his
rare insects were common elsewhere? Furthermore, in several
letters, responding to Lyell’s doubts about identifying a
particular specimen, Dodd asked him to "refrain from getting
fresh species named" until he had corresponded with Turner on
the matter. If the insect was indeed rare, Dodd could only get
full credit for the discovery after Turner's identification. More
often, to his regret and frustration, he confessed to Lyell that he
carelessly sent away unnamed things, perhaps
some reared with great care + trouble, to find
some day that they have been described from
"Somebody" collection, having been taken or
bred in Queensland!! This is very annoying to
me. I have bred more Zeuzeridae than anyone
living or dead, and my name is never mentioned
in connection with the new things. Also I have
bred more Charagiae [Aenetus] than anyone else.
As to Xylos I have bred over 50 species in north
Q’land, including those I got at Charters Towers
years ago, perhaps 60 species. I don’t know how
many species I bred in south Q’land (National
Museum of Victoria, 26 November 1900).
Clearly, Dodd resented the anonymity that came with living
so far away from the centres of entomological research. Given
the toil of collecting rare and elusive insects, this was
understandable. Why should others, often wealthy purchasers,
be given the credit for his work? This sometimes made him
quite vain about being acknowledged for the discoveries he had
made. In a letter of June 1898, he followed up with Lyell on one
of his moths: "Oh, when getting that beautiful Oecophoridae
named did you credit me with breeding it? I have one left and
Dr Turner was charmed with it” (National Museum of Victoria,
9 June 1898). At other times, however, he begged Lyell to
conceal information about what and where he was collecting.
The wish to be acknowledged for the very details he needed to
conceal reveals the painful bind in which he found himself
(Monteith, personal communication, 6 July 2015).
Lyell understood his correspondent's dilemma and was
happy to observe the friendly protocol of sending all queries
about names to Turner before consulting anyone else. In
return, Dodd made a point of impressing on Lyell how much
he trusted him. For instance, Dr Turner was, he told Lyell,
anxious to name one of his insects as new but he only had two
specimens, one of which he had sent to Lyell. "No other
collector would have done that", he declared. Nevertheless,
Dodd's inability to name insects scientifically remained
something of a sore point, leading him many years later to
pronounce, defensively, to J. A. Kershaw:
It is too severe a mental strain for a professional
collector to attempt to learn the names of the
thousands of insects which pass through his
hands, so I seldom can supply names . . . Years
ago I had a long list of names of Lepidoptera,
but lost it in the Townsville cyclone. I could not
replace it, a busy life of collecting has prevented
my endeavouring to make another.
Dodd's boast was that he possessed other skills, such as
his detective work in locating and hatching out insects, then
setting them perfectly, reminding Kershaw at the end of his
letter: "I can send nicely set bugs ants &c &c 1f the Mus[eum|
cares for same" (National Museum of Victoria, | June 1911).
Building Trust
Dodd’s first letter to Lyell, dated 9 September 1897, enquired if
he might be included in his circle of “exchanging
correspondents” (National Museum of Victoria, 9 September
1897). Dodd had often seen Lyell’s “nicely set insects ... perfect
in every way" in Queensland, so he was confident that their
exchanges would not just be rewarding but (even more
importantly) equal. A perfectionist, Dodd often complained
about the low standards of others. In fact, he told Lyell he did
not want Melbourne entomologists to know that he had a large
number of insects for exchange, his reason being that "several
of them do not set well enough to please me - as a rule I get
inferior material to my own”. Kershaw, for instance, had proved
disappointing, palming off on him "faded, damaged, or
common specimens’ for the “rare or beautiful things" he had
been sent. Lyell was probably sympathetic; like Dodd, he was
proud of his meticulous standards of preservation and
mounting. Notably, although Barrett would later describe
Lyell’s gift to the National Museum as unconditional, there
was, in fact, one condition. When it came to amalgamating his
collection with the Museum’s, Lyell stipulated that his own was
to take precedence. While anything worth saving from “the
smaller and poorer old museum collection” would be remounted
for inclusion, he demanded that most of the museum’s
specimens be scrapped (Melbourne Museum, Archive Box 579,
27 December 1934; Lyell to Robertson).
Despite Lyell’s meticulously high standards, Dodd soon
found cause to chastise him for the arrival of 26 damaged
specimens, including some with “one or both antennae broken
and missing’. Suddenly, the mutual trust and reciprocity that
was to cement their relationship was threatened. The
geographical balance and complementarity that Dodd was
seeking between Victorian and Queensland specimens was
also jeopardised:
In looking through the exchange lately received
I regret to notice that many of the specimens are
imperfect, or rubbed, and others seem rather
old. You may remember my request for clean
and perfect insects, and I trust future lots will be
a great improvement on this ... I have a large
collection and the condition of same is first
class. I keep no damaged specimens that I can
replace with perfect ones and I am sorry to say
that my Victorian collection compares very
176
poorly with my own; in fact they spoil the
appearance of the others. Therefore I want no
more damaged things and no matter how rare a
species 1S, please do not send it to me unless
perfect in every particular. I cannot prize a thing
with a great gap or gaps in its wings, antennae
missing, or badly rubbed &c &c. Should you
care to continue these exchanges may I hope
that you will kindly place me upon your first.
class list ... (National Museum of Victoria,
12 February 1898).
Behind Dodd 's fastidiousness lay the fear that Lyell was not
taking him seriously enough. Perhaps Lyell regarded him as a
mere collector? This anxiety is evident in the way in which the
adjective first class shifts in this paragraph, from the insects in
Dodd’s collection to the list of Lyell’s correspondents. Keen to
reinforce his standing as a first-class collector with a first-class
collection, he reminded his Melbourne correspondent of the
abundance he enjoyed as a tropical collector. Unlike many who
were obliged to capture “almost everything that flies", he had
the geographical advantage of refusing hundreds when out in
the fields. The spectre of being branded as a mere collector,
isolated from professional networks, also prompted Dodd to
say that, should anyone enquire of a particular insect, then
perhaps you will have it mentioned they are in
collections Lyell et Dodd, not taken by me as if I
was a mere collector. I fear there is an
impression abroad that I want specimens for
others and not myself and that that is why I
“haggle” for only first class specimens, should
therefore you have any such impression pray
dismiss it.
In other words, Dodd wanted it to be known that, instead
of collecting insects solely for exchange, he was proud to
retain many of the most perfect and beautiful insects for his
own collection (National Museum of Victoria, 16 July 1898).
This early rupture was soon healed when Dodd received a
parcel whose contents were "perfect in every way”. Writing to
thank him, Dodd made no apology for being fastidious. In
fact, as if to underline the absence of any apology, he added
bluntly that Lyell’s new parcel contained “several common
things" he did not want. These he would return straight away.
Unable to resist reiterating the point about tropical abundance,
he had to concede, in fairness, that he was able to catch more
in 24 hours than Lyell could catch in five days, but that
discrepancy did not mean he had to accept "poor or broken
things from a Victorian collector". Nevertheless, the
relationship was important to him so that meant an on-going
commitment to the delicate task of building trust and
reliability. When Lyell received a rare and expensive butterfly,
Ogyris genoveva Hewitson, and one of its antennae was
missing, Dodd insisted that the specimen was absolutely
perfect when despatched from Cairns; nevertheless, he
immediately sent a damaged specimen with "one good
antenna to replace the lost one" (National Museum of
Victoria, 26 October 1900, 26 November 1901). As part of the
D. Coleman
rules governing their exchange, Dodd also assured Lyell that
he could return anything he did not want for credit.
This gentlemanly exchange of first-class specimens
continued for another couple of years until August 1900 when
Dodd informed Lyell that altered circumstances meant he was
unable to continue indulging in this pleasurable pastime. With a
erowing family and a costly relocation from Brisbane to
Townsville — a place of “higher prices for everything" — he must
now leave off his gentlemanly pursuits (National Museum of
Victoria, 27 August 1900). To Kershaw, whom he hoped would
purchase insects for the National Museum of Victoria, he wrote
that instead of gracing his friends’ cabinets, he must now look
upon his "beloved specimens ... from an £8 point of view”.
“Most of my best things are reared”, he boasted, adding "I keep
no rubbish, and no one need fear at any time that I will victimize
my correspondents". Despite the taint of trade — making dollars
— Dodd nevertheless insisted that his business was an honourable
calling. Furthermore, he would keep himself at arm's length
from commerce by employing an agent (National Museum of
Victoria, 17 September 1900, 31 May 1901). By 1904, he
declared that "business with the dealer fraternity is so
unsatisfactory" that he was badly 1n need a larger pool of reliable
correspondents. Dispensing with middlemen, he now preferred
to deal directly with collectors and museum personnel (National
Museum of Victoria, 4 May 1904).
Once Dodd had turned commercial dealer, he encountered
a host of rules and protocols governing selling, buying and
eifting. These activities were linked, not just to questions of
honour and trust between correspondents, but to perceptions
of social class and educational background (Lucas, 2013).
There was, for instance, the delicate matter of promising
certain correspondents first option on rare or large insects. So
great was the offence if these sought-after insects were
subsequently seen in others’ collections that, if Dodd was
planning to initiate a new contact, he would first ask
permission from his established correspondents. It was also
bad form to share the secret of a special location without
seeking permission. For instance, Dodd claimed to be the first
to let his mentor Rowland Illidge into the secret of where to
find two species of the extremely valuable Aenetus (A.
ramsayi Scott and A. lewinii Walker) outside Brisbane. To
Lyell he divulged: “I was the first 1n Queensland to find and
breed these and at once informed Illidge and we several times
went out together. | went away for 12 months + he took
[Reggie] Relton into ‘mateship’ without consulting me”.
Illidge had also found Aenetus exuviae when out in the bush
on his own and not let on to Dodd about his discovery. Finally,
Dodd liked a correspondent to give full details of unusual
insects. When it came to conveying such information, Oswald
Lower, a pharmacist in Broken Hill, was one of the very slim
ones, he complained. Lower also offended Dodd by lacking
an eye for beauty. The closest he got to praising Dodd's
settings, or a particular insect, was to ask him to "send another
pair”. Instead of such obliquity, Dodd preferred directness. He
liked correspondents “to express pleasure over a beauty or a
rarity’: “I get quite cross when I send away a lovely thing if
the receiver does not ‘enthuse’ a little”. Lyell must have
remonstrated over these complaints about Lower and others
George Lyell and Frederick Parkhurst Dodd: authority and expertise in nineteenth-century Australian entomology 177
because Dodd conceded: "You are right, biz is biz and I
should get all I can. As a seller it matters nothing to me what
the buyer 1s like, I suppose (National Museum of Victoria, 12
August 1901, 6 July 1904).
As a commercial dealer Dodd touted his insects via
several selling points. Rarity, beauty and large size were chief.
So too, as we have seen, was endorsement by an expert
classifier like Turner. The other selling point was his talent as
an insect breeder. When circulating sale lists with prices,
some pages contained a banner heading stating that all
specimens had been bred. In particular, he was proud of his
high-priced things, such as his Xylos, stuffed wood-boring
moths, bred and reared by him. In his eyes these Xylos were
perfect in every way. With every skerrick of fat scrupulously
removed, they were (he boasted) very unlikely to turn greasy
(National Museum of Victoria, 17 September 1900). Dodd's
letters also contain detailed descriptions of his breeding
routines. Sometimes he would watch all day until late at night
for a large and rare wood-boring moth to hatch. Then, sleeping
only for a few hours, he would wake to find his vigilance had
been in vain: his valuable moth had emerged and rubbed its
wings. Moths in the "restless" but "handsome" family of
Notodontidae were particularly prone to offend in this regard,
often emerging after he had retired (National Museum of
Victoria, 24 March 1901). It was necessary to keep vigil 1n the
bush as well, tending the larvae of insects for years before
cutting and transporting the timber home for closer
monitoring on the eve of emergence. Sometimes, to Dodd’s
chagrin, local aboriginals ate the grubs he was watching over.
That these grubs were a traditional and highly nutritious food
source for Indigenous people cut no ice with Dodd. He was
always very testy in his letters when mentioning this so-called
theft of his livelihood. His son Walter D. Dodd (1891-1965),
also a naturalist, understood better than his father the
symbiosis between Indigenous people and country. From
Walter Dodd’s observations, it was clear that customary ways
of living on country entailed a balanced economy of nature.
Writing about some very large wood moths he had caught
south-east of Perth in 1912, he noted that “The blacks were
very fond of ‘the grub’”. Captive to the prevailing discourse
surrounding the “inevitable dying out” of the Aboriginal race,
Walter Dodd added that since indigenous people had become
extinct 1n certain localities, ^whole patches of wattle forests
were laid low, there being no check upon the breeding of these
insects" (The North Queensland Register, 13 April 1935).
The highest priced moth Dodd ever offered for sale was
Aenetus mirabilis Rothschild, a species found only in north
Queensland (fig. 4). His excitement at sourcing this large moth
can be heard in his warning to certain favoured correspondents
to "save up your pennies" for a pair (National Museum of
Victoria, 26 November 1900). He had read about this moth 1n
a Journal article published by Walter Rothschild 1n 1894, in
which the location was disclosed as Cedar Bay, North
Queensland. This was a very remote spot 40 kilometres south
of Cooktown and accessible only by boat or by foot
(Rothschild, 1894). Dodd spent weeks and “a great deal of
time and trouble" searching for this moth, at a cost of over
£60, so he was obliged to charge highly for it. He assured
Lyell, one of the first collectors he contacted regarding his
precious discovery, that A. mirabilis was unlikely to be found
in private collections, or even in the British Museum or any
Australian museum “for many a long day, unless through me”.
As for Lyells hint that the Victorian Government's
entomologist Charles French (1842-1933) owned an A.
mirabilis, Dodd was dismissive, imagining that it must be a
damaged specimen, not perfect like those now in his
possession. He asked that Lyell keep quiet about his discovery
as demand for specimens was going to be strong, and Dodd
wanted to prioritise overseas collectors because they would
pay considerably higher prices than those fetched in Australia.
At first, Dodd asked Lyell for 60/— to 100/— [£3—£5] per
pair for A. mirabilis. This approximates to a price range of
£350—£585, or AUD $660-$1100 in today’s purchasing power,
the wide range reflecting the size, condition and appearance
of the insects. Dodd believed this price range was fair and
reasonable. His justification lay in the relative pricing of
Aenetus ramsayi, a species of Aenetus that he had managed to
sell to English collectors for £4—£6 per pair, even though this
moth had been known for a long time and was well distributed,
unlike the rare and “very fine” A. mirabilis. A. ramsayi was
also smaller than A. mirabilis, the female of which averaged
wing spans of 6.5 inches. In the end, Dodd settled on a lower
quotation of 55/— to 75/— per pair for Lyell, reducing the cost a
little because he realised his friend would find it impossible to
obtain such rarities if he “stuck at their money value”. He
asked Lyell not to mention this discount as he also planned to
sell to his competitors (i.e. Australian collectors he disliked
such as Lower, a member of the questionable dealer fraternity;
National Museum of Victoria, 26 November 1900). Charles
French was another he distrusted, telling Lyell that French
had the nerve to ask for his precious Xylos but still hadn’t sent
on the beetles he owed him (National Museum of Victoria, 17
March 1901). Lyell, on the other hand, belonged to Dodd's
category of reliable correspondents. In fact, so reliable was
Lyell that when, a few months later, wealthy clients had failed
to send on remittances, Dodd asked him to pay up-front
before he had even despatched the specimen box (National
Museum of Victoria, 4 February 1901). He also asked that
Lyell pay him a little every month to help keep him afloat
between transactions.
When it came to selling his A. mirabilis, Dodd pitched his
highest price to Lower — £5 for a single pair. In the end, he
sold him a pair for £4, a price that he claimed pleased Lower
very much. Dodd himself was happy with the transaction.
Given Lower’s wide network and authority in the field, this
sale would prove a good advertisement for Dodd’s insects (13
June 1901). In general, Dodd figured that it made good
business sense to sell his A. mirabilis cheaper to Australian
correspondents because this would advertise the perfection of
his preservation techniques. Despite this, Dodd held himself
aloof and was never less than testy with most of the dealer
fraternity, believing that his southern brethren were all down
on him because, after 1900, he would only sell and not
exchange his grand tropical species for anything they could
supply (National Museum of Victoria, 12 August 1901).
178
Conclusion
In July 1910, G. A. Waterhouse travelled from Sydney to the
Atherton Tableland for a week of collecting. Staying in the
Kuranda Hotel, he spent a good deal of time with Dodd and his
family who were warmly hospitable. From here, Waterhouse
wrote to Lyell, describing his first impressions of Dodd. There
was much to like about the man. He was clearly an immensely
enthusiastic collector who generously lent his sons to visitors
like himself for collecting trips. He was pernickety, though, a
charge that Dodd would have been proud to acknowledge. In
running his business, however, Waterhouse declared him
unmethodical, with barely one per cent of his pinned insects
labelled with dates. Where there were dates, he suspected that
they were a “mere matter of recollection’. His classifications
were sloppy too, with “similar groups of insects ... mixed up
anyhow” (National Museum of Victoria, AB 369; 17 July 1910).
From Dodd’s correspondence with the English dipterist Colbran
Wainwright in the same year as Waterhouse’s visit, this
somewhat cavalier attitude about details can be seen in his
Figure 4. Aenetus mirabilis Rothschild (female).
D. Coleman
postscript to one specimen box: “The localities are roughly
marked off on the lids of the cigar boxes. The next lot will be
arranged better, and month of capture given” (Royal
Entomological Society, 24 August 1910).
As Waterhouse’s week in Kuranda neared the end, he
informed Lyell that Dodd’s “tourist business brings the most
money’ meaning that “attention to scientific detail suffers in
consequence’ (National Museum of Victoria, AB 369; 17 July
1910). By tourist business, Waterhouse was referring to Dodd's
recent commercial initiative: the opening of his house to
members of the public for an entrance fee. Before 1910, Dodd
had always welcomed visitors curious to view his collections
and see him at work, setting and preserving his specimens, but
with entomology a full-time business for supporting his large
family, he decided to charge a fee for this. Here we see him in a
three-piece suit, posing in his garden with a butterfly net for one
of his paying tourists (fig. 5). Dodd was quite the showman in
this new business venture, an empresario who used special
lighting effects and other tricks to impress his visitors with the
mystery and beauty of his insects, turning his home into a semi-
George Lyell and Frederick Parkhurst Dodd: authority and expertise in nineteenth-century Australian entomology 179
- -— b E
Figure 5. F. P. Dodd in his garden at Kuranda. Image courtesy of Queensland Museum.
180
public commercial site and museum. Into sober, scientific
scrutiny, he injected an older element of spectacle and magic,
performing his insects with dramatic exhibitions which mingled
natural science, wonder and magic. This was the case even when
his visitors were some of the top people in the field, such as
Walter Baldwin Spencer and A. J. Gilruth, who visited in 1911.
Margaret Fountaine (1862-1940), a globe-trotting British
lepidopterist who had recently settled with her lover not far
from Kuranda, left her own account of calling to see Dodd's
collection in 1916. Waiving the usual admittance fee of one
shilling each, Dodd greeted them heartily as fellow
entomologists, and they had a delightful time taking tea and
revelling in his exhibits. Fountaine was impressed by Dodd's
knowledge of Britain’s scientific scene. He had read her articles
in the Entomologist and in the Transactions of the
Entomological Society of London. After talking entomological
shop for a while, Dodd tried, with a “shrewd, penetrating”
look, to dissuade Fountaine from thoughts of farming in the
area. He argued, as others had done, that her prospects of
Success were dim. As she left, she invited him to come over
and see her Malay and Java butterflies, an idea that seemed to
delight him, but it would not be for a week or so (he claimed)
because he was so busy. Fountaine’s diary entry concludes:
We both liked Mr Dodd very much, and I
believe the old man wishes to be a good friend
to us, especially as he sees that we are not going
to be in any way rival dealers, which naturally,
as he makes his living out of this business, he
could not be expected to look upon with any
favour (L. Joanne Green, personal
communication, 30 June 2019).
Fountaine’s own eye was shrewd and penetrating in
concluding that their reception would not have been so
friendly had they planned to set up as business competitors.
We have seen Dodd move from exchange to commerce,
transacting a business in which there were no fixed prices to
guide him in determining the value at which he should trade a
specimen. Beauty, colour, size and rarity were key
determinants of cost, but perhaps most important was the
symmetry and neatness of the setting, allowing the specimens’
natural attributes to be seen. Since he was well known for his
personal skill in preserving specimens, he believed his
reputation in this regard entitled him to charge extra. At first
Dodd is uneasy about his new dealer persona, embarrassed to
be treating his insects as commodities instead of exchanging
them for pleasure. He also worried, at the outset, that seasoned
dealers and collectors like Lower would see him as green and
try to take advantage of him. But in general he regarded trade
as honourable. He needed to get his insects out through the
proper channels and did not see any of this as injurious to the
pursuit of science. In sum, he was well above J. O. Westwood's
definition of the very "lowest class of entomologists”, a
collector with inert drawers of “handsome insects”.
Despite Dodd's many promises to Lyell, Kershaw and
others that he would start to be more methodical in preserving
dates and locations, as well as keep lists of his insects, he kept
on failing to do so. As for keeping a collection of named
D. Coleman
specimens to guide him, this would not only be too cumbersome
but also beyond what he could afford (National Museum of
Victoria, | June 1911). It is difficult to determine if his
shortcomings regarding taxonomic identification. negatively
affected his pricing. Although many of the letters contain lists
with prices attached, we see him in his correspondence
attempting to establish equivalencies and differences in value
from one specimen to the next. Isolation, doubts about
identification and the difficulty of knowing for certain 1f one's
captures were rare were all inhibiting factors. The best he could
do was to offer the insects in as perfect a condition as possible,
along with close observation of their life histories. How did he
classify himself? In the end, Dodd saw himself, not as an
entomologist but as a professional collector, training up his four
sons to be useful, all-round collectors across the various orders
(National Museum of Victoria, 6 December 1912). One son,
Alan Parkhurst Dodd (1896-1981), would in fact become a
distinguished entomologist, collecting and importing live
specimens of the Cactoblastis moth from Argentina to destroy
the prickly pear that had spread over millions of acres of
Queensland farmland. In Alan, F. P. Dodd's legacy lived on.
Acknowledgements
My thanks to Dr Geoff Monteith, entomologist at the Queensland
Museum, for his generous and expert annotation of my
transcription of the Dodd—Lyell correspondence in Melbourne
Museum’s archives. Thanks also to L. Joanne Green for sharing
her transcriptions of Margaret Fountaine’s diaries, held in
Norwich Castle Museum, UK, and to Geoff Thompson at
Queensland Museum for speedily supplying the image of Dodd
in his Kuranda garden. My collaborators at the Melbourne and
Australian Museums, archivists Nik McGrath and Vanessa
Finney, and entomologist Simon Hinkley, must also be thanked.
This paper has been funded by the McCoy Seed Fund, a
collaboration between the University of Melbourne and
Museums Victoria, and the Australian Research Council Linkage
Grant, “Merchants and Museums’ (LP160101761).
References
Barrett, C. Typescript of article on Lyell collection; Melbourne
Museum, Notice to Manager, ABC, AB 576, 29 March 1946.
Dodd, F. P. to George Lyell, 1897-1904; Museums Victoria Archives,
1897-1904; OLDERSYSTEM~03023, AB 00368.
Dodd, F. P. 1916. Notes on the great Australian Cossidae. Pp 33—44 in
Oberthür, C. Houlbert, C. and Dodd, F.P. (eds), Contributions à
l'itude des grandes Lépidoptères d'Australie. Études
Lépidoptérologie Comparée. Fasc. 11: 1—120.
Dodd, W.D. 1935. Meanderings of a naturalist. The North Queensland
Register (Qld.: 1907—1954) 13 April, p. 77.
Froggatt, W.W. 1907. Australian insects. William Brooks: Sydney. 449
pp.
Hewish, M. 2014. Biographical notes on George Lyell, Victorian
lepidopterist. Part 1. Victorian Entomologist 44, 5: 96—106.
Lambkin, K.J. 2013. Conrad Kelsall: “Butterflying’ on the Little
Mulgrave River, north Queensland, in 1903. Archives of Natural
History 40: 111—118.
Lucas, A.M. 2013. Specimens and the currency of honour: the museum
trade of Ferdinand von Mueller. Historical Records of Australian
Science 24: 15—39.
George Lyell and Frederick Parkhurst Dodd: authority and expertise in nineteenth-century Australian entomology 181
Mackerras, I.M. 1949. Alfred Jefferis Turner and amateur entomology
in Australia. Proceedings of the Royal Society of Queensland 60:
69-87.
Melbourne Museum. Archive Box 579; Collections — George Lyell
Collection — 23 July 1932 — 15 January 1952.
Monteith, G. 1991. Frederick Parkhurst Dodd: the butterfly man of
Kuranda. Queensland Museum: Brisbane, Queensland. 46 pp. ill.
(some col.), | map, ports.
National Museums of Victoria. Correspondence Gustavus Athol
Waterhouse and George (Geo) A. Lyell (1891-1947).
OLDERSYSTEM~03030; Museums Victoria Archives.
Neboiss, A. 1986. Lyell, George (1866-1951). Australian dictionary of
biography, National Centre of Biography, Australian National
University: Canberra.
The North Queensland Register.
Queensland.
Olsen, P., and Russell, L. 2019. Australia’s first naturalists: Indigenous
peoples’ contribution to early zoology. National Library Australia
Publishing: Canberra. 228 pp.
1892-1984. Charters Towers,
Rothschild, W. 1894. On a new species of the Hepialid genus Oenetus.
The Annals and Magazine of Natural History; Zoology, Botany, and
Geology Series 6, 13: 440.
Royal Entomological Society. Archives, London. F. P. Dodd to Colbran
Wainwright, 24 August 1910.
Thearle, M. J. 1990. Turner, Alfred Jefferis (1861—1947). Australian
dictionary of biography. National Centre of Biography, Australian
National University: Canberra.
Ville, S., Wright, C., and Philp, J. 2020. Macleay's choice: transacting
the natural history trade in the nineteenth century. Journal of the
History of Biology 53: 345—375.
Wale, M. 2019. Editing entomology: natural-history periodicals and the
shaping of scientific communities in nineteenth-century Britain.
The British Journal for the History of Science 52: 405—406.
Waterhouse, G. A. to Lyell, 10—17 July, 1910. Archive-Box 369;
Museums Victoria Archives, Stack 13, Bay 1.
Waterhouse, G. A. and Lyell G. 1914. The butterflies of Australia.
Angus and Robertson: Sydney. 239 pp.
Memoirs of Museum Victoria 80: 183-191 (2021) Published 2021
1447-2554 (On-line)
httos://museumsvictoria.com.au/collections-research/journals/memoirs-of-museum-victoria/
DOI https://doi.org/10.24199/j.mmv.2021.80.10
Parasitoids of the uniquely social colletid bee Amphylaeus morosus (Hymenoptera:
Colletidae) in Victoria
Lucas R. HEARN”, MARK I. SrEvENS^?, MICHAEL P. SCHWARz! and BEN A. PARSLOW?
! College of Science and Engineering, Flinders University, GPO Box 2100, Adelaide South Australia 5001, Australia
? Earth and Biological Sciences, South Australian Museum, GPO Box 234, Adelaide South Australia 5001, Australia
? School of Biological Sciences, University of Adelaide South Australia 5005, Australia
'" Corresponding author: Lucashearn7? gmail.com
Hearn, L.R., Stevens, M.I., Schwarz, M.P. and Parslow, B.A. 2021. Parasitoids of the uniquely social colletid bee
Understanding how nest parasites contribute to brood mortality rates 1n host species 1s an 1mportant step towards
uncovering the potential implications for host behaviour. This can be especially important for understanding the evolution
of social living, where defence against parasites is often posited as a major benefit of cooperative nesting. Only two
parasitoid species have previously been reported for the only known social colletid bee, Amphylaeus morosus: the
ecasteruptiid wasp, Gasteruption primotarsale, and the mutillid, Ephutomorpha tyla. Here we report six additional
parasitoid species of A. morosus: the gasteruptiid wasps G. atrinerve, G. globiceps, G. melanopoda and G. cinerescens;
the bombyliid fly Anthrax maculatus; and the mutillid wasp Ephutomorpha aff. varipes. The mechanisms of parasitism
for these eight parasitoid species are described in combination with how they operate throughout the host brood rearing
Abstract
Amphylaeus morosus (Hymenoptera: Colletidae) in Victoria. Memoirs of Museum Victoria 80: 183—191.
period and whether benefits of social nesting vary across the season.
Keywords Bombyliidae, Gasteruptiidae, host-association, Hylaeinae, Mutillidae, parasitism
Introduction
Detailed host and parasite association data are important
yet rarely explored for primitively social hosts, where
defence against parasites is posited to be a driver of
cooperative nesting. For insect parasitoids, the value of this
information is often emphasised but is heavily weighted
towards key taxon groups, such as Ichneumonidae,
Braconidae, Chalcididae, Encyrtidae, Tachinidae and
Bombyliidae, that are of economic importance (Heraty,
2017). Entomophagous insect associations with non-apid
bees largely get overlooked but can have substantial
consequences for brood mortality, behaviour and
demography of host species (Segers et al., 2016; Smith et
al., 2017). Additionally, parasite—host interactions in bees
are seldom observed over their full life history, meaning the
full series of parasites attacking a single host is often
understated. In the small carpenter bees Ceratina dupla
Say, 1837, and C. calcarata Robertson, 1900, Vickruck et
al. (2010) reared a total of eight parasite species from brood
cells after sampling nests across a six-month period. Wcislo
et al. (2004) similarly sampled nests of the halictine bee
Megalopta genalis (Meade-Waldo, 1916) across one year
and reported four brood parasites infiltrating nests.
However, Smith et al. (2017) noted that the full effect these
brood parasites may have on the social nesting of M. genalis
is hard to fully assess due to insufficient field data. For
analogous species, the need for descriptive biological
information combined with rigorous sampling across the
colony life cycle is often needed to determine the true
diversity and effect of brood parasitism.
The Australian hylaeine bee, Amphylaeus morosus
(Smith, 1879) (Colletidae: Hylaeinae), is the only species in
the hyper-diverse bee family Colletidae that is unambiguously
known to exhibit social nesting. Social nesting in this species
is very simple, with no known reproductive hierarchies or
morphological differentiation between nestmates. Amphylaeus
morosus has a semelparous and univoltine life cycle and may
form social or solitary nests within the same population
(Spessa et al., 2000). In the Dandenong Ranges, A. morosus
uses naturally abscissed dead fronds of the rough fern tree
Cyathea australis to construct linear nests out of the pithy
interior. Like many hylaeine bees, A. morosus mass provision
cells with a mixture of pollen and nectar before ovipositing
into the cells.
spessa et al. (2000) first reported a species of
Gasteruption wasp, later identified as Gasteruption
primotarsale Pasteels, 1957 (Gasteruptiidae) (Parslow et al.,
184
2020), attacking nests of A. morosus in the Dandenong
Ranges, Victoria, while a species of mutillid wasp,
Ephutomorpha tyla Hearn, Williams & Parslow, 2019
(Mutillidae), was recently reported entering nests late in the
brood rearing season (Hearn et al., 2019). Spessa et al. (2000)
found that social nesting in A. morosus seemed to provide
only minimal benefits in reducing parasitism by G.
primotarsale. However, that study did not consider possible
defence benefits against other parasites, and indeed no other
parasites were identified in that study. Gasteruption
primotarsale parasitises the earliest brood during nesting
period and may therefore only explain potential benefits of
social nesting during the early stages of brood provisioning.
Additionally, observations of E. tyla adults in the nest
towards the end of brood-rearing (Hearn et al., 2019) suggest
that E. tyla may exploit the mature larvae of A. morosus
towards the end of its nesting period. It is important to
understand the full suite of parasites that attack A. morosus
because if these parasites operate at other times in the nesting
period, that information will further our understanding of
why social nesting in A. morosus persists until brood
maturation. In south-eastern Queensland, Houston (1969)
reported a range of parasites and parasitoids attacking A.
morosus nests, including the wasps Agamerion pulchra
(Pteromalidae: | Cleonyminae), Coelopencyrtus | spp.
(Encyrtidae), Gasteruption sp. (Gasteruptiidae) and an acarid
mite. However, in the Dandenong Ranges, little is known
about the full range of parasites that might be involved.
Here, we identify eight different parasitoid species that
attack A. morosus, including novel host records for the
Gasteruption wasps G. atrinerve (Kieffer, 1911), G. globiceps
Pasteels, 1957, G. melanopoda Pasteels, 1957, and G.
cinerescens Schletterer, 1885, the bombyliid fly Anthrax
maculatus Macquart, 1846 (Diptera: Bombyliidae), and the
mutillid wasp Ephutomorpha aff. varipes (André, 1895). We
examine the specific mechanisms of parasitism and eclosion
timings of these parasitoids, which have been poorly
understood. It is important that the respective host associations
are well documented to fully recognise how these multiple
parasitoid species may influence the nesting behaviour of the
only known social bee in the colletid family.
Materials and methods
Nest collections
Nests of Amphylaeus morosus were collected from naturally
abscissed fronds that haphazardly fall around the base of
the rough tree fern Cyathea australis R.Br. Domin. These
nests were collected in the Gembrook, Cockatoo and
Marysville regions of the Dandenong Ranges, Victoria,
Australia. Nests were sampled over five collection periods:
4—6 December 2017, 6-8 December 2018, 21—22 November
2019, 11 January 2020 and 27 February 2020. The collection
region primarily consists of cool temperate montane habitat
dominated by tall canopies of Eucalyptus regnans F. Muell
and E. viminalis Labill, with a mixture of ferny, shrubby
and grassy understories. Nests were collected early in the
morning, late in the afternoon or during periods of light
L.R. Hearn, M.I. Stevens, M.P. Schwarz & B.A. Parslow
rain when bees were inactive to ensure all colony members
were present. Nest entrances were sealed upon collection
and all nests were stored in cool insulated boxes and
transported to the laboratory where they were stored at
10°C until processed.
Parasitism data
Nests were dissected lengthwise and the contents, including
adult female A. morosus, immatures and nest parasitoids,
were recorded. Where possible, parasitised cells were
carefully extracted from the nests and left to develop in Petri
dishes at ambient room temperature. Petri dishes were kept
moist by occasionally spraying filter paper rectangles inside
each dish with water. Once the specimens had reached
adulthood, defined as fully mature and mobile, they were
placed in 99% ethanol for preservation and later identification.
For parasitoids, where the pupal stages form cocoons (e.g.
Mutillidae), at least one pupal case from each nest was
dissected in coordination with the nest being opened to
determine the developmental stage of each immature.
Not all the Gasteruption specimens were successfully
reared to pupae or adulthood because developmental rates for
Gasteruption species lagged significantly behind host
maturation rates; due to this, the specific parasitisation rates
for each Gasteruption species were unable to be determined.
Further, the scarcity of larval descriptions based on
morphology for the genus Gasteruption made it impossible to
discriminate species at the larval stage (Bogusch et al., 2018).
Therefore, the parasitisation rates for each species are
combined and treated at the genus level Gasteruption.
Specimen identification
Specimens were examined using a Nikon SMZIOO0
stereomicroscope at the South Australian Museum, Adelaide,
Australia. Images were taken using a Visionary Digital LK
imaging system (Dun, Inc.) with a Canon EOS 5DsR camera
at Flinders University, Adelaide, Australia. Images were
produced using Zerene Stacker (Zerene Systems LLC)
software and cropped and resized in Photoshop CS5.
Material examined in this study were initially identified
using the following keys: Amphylaeus morosus specimens were
identified using Houston’s (1975) key to Australian hylaeine
bees; Gasteruption atrinerve, G. globiceps, G. melanopoda, G.
primotarsale and G. cinerescens were identified by B.A.
Parslow (South Australian Museum) using Pasteel’s (1957) key
to the Australian Gasteruption and comparison with type
material; Ephutomorpha tyla specimens were identified by
L.R. Hearn by comparing specimens with type material held at
the South Australian Museum; and Anthrax maculatus was
identified by X. Li (Florida Museum). Voucher specimens for
the examined species have been deposited at the Melbourne
Museum (Table S1).
DNA sequencing for the eight parasitoids of A. morosus
was performed by the Canadian Centre for DNA Barcoding at
the Biodiversity Institute of Ontario using standard protocols
(Ivanova et al., 2006; Table S1).
Parasitoids of the uniquely social colletid bee Amphylaeus morosus (Hymenoptera: Colletidae) in Victoria 185
Table 1. Prevalence of parasitoid species 1n host nests and brood cells at each collection period. Mean parasitised cells calculated from parasitised
nests only”.
Nest collection Parasitised nests
Year Total Total Gasteruption Anthrax Ephutomorpha Ephutomorpha
nests cells maculatus tyla
Earlysummer 85 400 16 0 9
2017
Early summer 6 29 0 2 0
2018
Late spring 27 | 124 7 0 V
2019
Mid-summer 26 109 l f 2
2020
Late summer 16 78 3 0 4
2020
Total 160 740 27 4 15
Results
Nest architecture and composition
In the Dandenong Ranges, females of A. morosus construct their
nests in dead abscissed fronds of the rough fern tree Cyathea
australis by excavating the pithy interiors of the stems to create
an unbranched linear tunnel. Nests were on average 212.63 +
59.39 mm long (mean + standard deviation; N = 156) with nest
entrance diameters of 5.65 + 0.61 mm (N = 52). In other regions,
nests also occur in the dead flower scapes of Xanthorrhoea spp.
(L. Hearn, personal observation). The tunnel is lined with a
cellophane-like material, a characteristic common to hylaeine
bees, that is thought to act as a waterproofing and antimicrobial
agent (Almeida, 2008). Provisioning of brood cells generally
begins in mid-spring, and cells are laid sequentially starting
from the distal end of the fern frond towards the proximal end.
Brood production can last until mid-summer across the
Dandenong Ranges populations, allowing different parasitoid
species to attack at different brood development stages (fig. 1).
Nest architecture in A. morosus can be broadly categorised
into nests with brood cells interspersed with vestibules and
nests with brood cells laid sequentially (fig. 2). Vestibules are
empty spaces containing no provisions or brood and are
common in many stem-nesting Hymenoptera (Danks, 1971).
In A. morosus, vestibular cells are frequently found 1n solitary
nests, but nest burrows are fully excavated before the first cell
is provisioned. This limitation to nest length once cell
provisioning has begun suggests that there may be a trade-off
between the number of potential brood cells and constructing
vestibular cells to deter nest parasitoids.
Host associations
Gasteruption Latreille, 1796 (fig. 3a). Gasteruption 1s the
most abundant parasitoid of A. morosus in terms of nests
parasitised, parasitising 16.9% (27/160) nests across all
collection periods (Table 1). Of the nests parasitised by
Gasteruption, only the first three brood cells were found to
contain parasitoid immatures. Gasteruption parasitised cells
were often followed by vestibular cells (11/35 parasitised cells),
Parasitised cells (total/mean)*
Gasteruption Anthrax Ephutomorpha Ephutomorpha
aff. varipes maculatus tyla aff. varipes
0 22/1.38 0/0 37/4.11 0/0
0 0/0 7/3.5 0/0 0/0
0 9/1.29 0/0 0/0 0/0
l 1/1 15/7.5 4/2 8/8
0 3/1 0/0 26/6.5 0/0
1 35/1.29 22/5.5 67/4.47 8/8
detritus (9/35) or provisioned cells that failed to develop (4/35).
The larvae of Gasteruption are predator-inquilines in the
nests of A. morosus where they kill the host egg or developing
host larva before consuming the entire host provisions
(Bogusch et al., 2018; Parslow et al., 2020). They then construct,
using anal secretions, dark semi-cocoons above and below the
larvae separating the parasitised cell from the rest of the nest
(Eardley and Daly, 2007; Malyshev, 1968; Westrich, 2018).
Although some species of Gasteruption have been reported to
consume the contents of multiple adjacent cells (Donovan,
2007; Malyshev, 1968; Westrich, 2018), Gasteruption
immatures were only observed to occupy a single host cell in
our nests of A. morosus.
Adult eclosion of Gasteruption occurred far later in the
season compared with A. morosus (fig. 4). In most cases,
Gasteruption brood were still at a late larval stage at the time
A. morosus cells were reaching adult eclosion. Five species of
Gasteruption were reared from host nests. One of these,
Gasteruption primotarsale Pasteels, 1957, has been previously
recorded from nests of A. morosus (Spessa et al., 2000). The
novel host association for G. atrinerve (Kieffer, 1911); G.
globiceps Pasteels, 1957; G. melanopoda Pasteels, 1957; and
G. cinerescens Schletterer, 1885, were determined using
adults reared from host nests.
Anthrax maculatus Macquart, 1846 (fig. 3d). Four nests were
found to be parasitised by the bombyliid fly Anthrax maculatus
across two separate sampling periods. Anthrax maculatus was
never directly observed ovipositing into or hovering around the
nests of A. morosus. Yet, developing A. maculatus immatures
were found occupying both single and consecutive A. morosus
brood cells, accounting for 24.1% (7/29) and 13.8% (15/109) of
the total brood cells across the early summer (December 2018)
and mid-summer (January 2020) collection periods, respectively.
The pupae of A. maculatus were primarily observed occupying
cells in the middle of the nests, but in one instance, every cell in
the nest contained parasitised immatures. All brood cells
parasitised by A. maculatus contained late-stage pupae when
the nest was opened, and in nests containing both A. maculatus
186 L.R. Hearn, M.I. Stevens, M.P. Schwarz & B.A. Parslow
Ephutomorpha aff. vanpes
A
= B.
+ =
T i J" d
n a
— ux. Ww
Ephutomorpha tyla
Anthrax maculatus "m ——
Gasteruption
Amphylaeus morosus
Brood
development
Brood
production
Nest founding
Overwintering
Mating
Adult
eclosion
AUTUMN WINTER SPRING. SUMMER
Figure 1. Annual cycle of Amphylaeus morosus across the full univoltine, semelparous life cycle in the Dandenong Ranges, Victoria (grey). The
timings of nest parasite attacks (coloured) were estimated from rates of occurrence in nests across the brood development period.
Figure 2. Nest dissections showing the two typical nesting structures for Amphylaeus morosus in the Dandenong Ranges: a, typical structure of a
solitary nest; b, close-up of brood cells directly followed by a pithy cell plug, interspersed with vestibular cells; c, typical structure of a social
nest; d, close-up of brood cells laid sequentially. Scale bar = 10 mm.
Parasitoids of the uniquely social colletid bee Amphylaeus morosus (Hymenoptera: Colletidae) in Victoria 187
Figure 3. Images of the parasitoids reared from Amphylaeus morosus nests: a, lateral habitus of Gasteruption globiceps; b, lateral habitus of
Ephutomorpha tyla; c, lateral habitus of Ephutomorpha aff. Varipes; d, lateral habitus of Anthrax maculatus e, Ephutomorpha aff. varipes larvae
feeding on A. morosus pupae (photo credit James Dorey, 2020). Scale bar = 1.0 mm.
188
immatures and unparasitised host immatures, the host brood
cells contained mid- to late-stage pupae. The pupae of A.
maculatus were packed into the host brood cells and eclosed to
adults within minutes of being extracted from the brood cell in
the nest. The emergence of adult A. maculatus therefore
appeared to be stimulated by disturbance but still synchronised
with host adult eclosion (fig. 4).
Ephutomorpha tyla Hearn, Williams, and Parslow, 2019
(fig. 3b). The host association for Ephutomorpha tyla has
already been described by Hearn et al. (2019). Here, we present
additional details based on new data. In two nests, a single
adult female E. tyla was observed trying to break through the
most proximal cell in the nest, while in a further 21 instances,
adult females were observed waiting in the nest entrance.
Ephutomorpha tyla does not appear to specifically target
certain nest types, attacking nests with up to 14 brood cells or
nests with only four brood cells interspersed with vestibules. A
total of 29 nests contained either parasitised immatures, an
adult female E. tyla in the entrance, or both. No adult female A.
morosus were present in 69% (20/29) of these nests.
Number of emergences
JANUARY
FEBRUARY
L.R. Hearn, M.I. Stevens, M.P. Schwarz & B.A. Parslow
Parasitised brood cells consisted of brown papery cocoons
that occupied the entirety of the brood cell. As the E. tyla
immatures developed, the brood cells became darker and
increasingly difficult to open. In nine affected nests, all brood
cells were parasitised by E. tyla, with damaged partitions
between cells. The body sizes of male and female E. tyla were
generally consistent. However, in some cases there were
marked differences in body size within each sex.
Ephutomorpha aff. varipes (André, 1895) (fig. 3c). Larvae of
Ephutomorpha aff. varipes were observed as external
parasitoids of the mature larvae, prepupae and pupae of A.
morosus and were observed feeding on young pupae (fig. 3e).
Larvae of E. aff. varipes remained on their host until mature
before producing a light-brown silk-like cocoon and eclosing
as an adult. The ectoparasitoid larva of E. aff. varipes were
observed on multiple consecutive A. morosus immatures in one
nest. The first three brood cells of the parasitised nest contained
fully healthy A. morosus immatures, whereas the next eight
brood cells were occupied by parasitised larvae, all of which
eclosed as males. Ephutomorpha aff. varipes was observed
ame /Amphylaeus morosus
ee œs» Anthrax maculatus
Ephutomorpha aff. varipes
» «= «= «© «© Ephutomorpha tyla
****»*** Gasteruption
SS S o ae oe S
S aS S QoS S
MARCH APRIL MAY
Date reached adulthood
Figure 4. Eclosion phenologies of Amphylaeus morosus and its nest parasites. Emergence observations are only reported for the provisioning and
rearing phase during 2019. Host emergences are only reported for nests containing parasitised brood.
Parasitoids of the uniquely social colletid bee Amphylaeus morosus (Hymenoptera: Colletidae) in Victoria 189
parasitising several species that occupy excised Cyathea
australis fronds, including another mass provisioning bee,
Hylaeus sp., and a crabronid wasp, Pison sp. While, on
numerous occasions, females were observed in the nest
entrance of the allodapine bee, Exoneura robusta Cockrell,
1922, no parasitic association has been confirmed.
Other enemies
Of the 243 potentially viable A. morosus nests collected,
34.2% (83/243) contained no A. morosus adults or brood cells
and had been superseded or temporarily occupied by other
insect species. Twenty-four of these nests were occupied by
Pison sp. (Hymenoptera: Crabronidae), two nests were
occupied by the _ pteromalid wasp of the genus
Eupelmophotismus (Hymenoptera: Pteromalidae), while one
nest contained recently eclosed encyrtid wasps from the genus
Coelopencyrtus (Hymenoptera: Encyrtidae). Five nests
contained clerid beetle larvae (Coleoptera: Cleridae),
including two instances of nests with A. morosus immatures
and adults that contained beetle larvae in the nest entrance.
Discussion
Nest parasitoids are known to have detrimental effects on the
survival and productivity of bees (Vickruck et al., 2010; Wcislo
et al., 1994). Of the parasitoid species that attack A. morosus,
the predator-inquilines of the genus Gasteruption were the
most prevalent, but least detrimental, only parasitising a mean
of 1.29 cells per infiltrated nest, with 16.9% of nests being
infiltrated. We never observed Gasteruption entering nests of
A. morosus, possibly because our nest collections were
restricted to cool weather conditions when insect activity was
low; it is likely that Gasteruption wait for the adult bee to leave
before infiltrating the nest and ovipositing in an open brood cell
(Macedo et al., 2012; Parslow et al., 2020). Parasitisation by
Gasteruption was only observed in single female nests, which
suggests that multifemale nests are guarded by one female
while other individuals collect provisions, restricting the
Opportunity for wasps to oviposit (Parslow et al., 2020). The
extended development time of Gasteruption in A. morosus
nests has been similarly reported in Gasteruption
brachychaetum Schrottky, 1906a, larvae in nests of Hylaeus
aff. guaraniticus (Schrottky, 1906b) (Macedo et al., 2012). The
resulting asynchrony in adult emergence between Gasteruption
immatures and host could be attributed to delaying their
eclosion until hosts have started establishing new nests, which
may explain observations of Gasteruption pupae in
overwintering A. morosus nests (L. Hearn, personal
observation). For Gasteruption, parasitising the distal nest cells
could be a factor of this extended development period and
avoiding being disturbed by emerging bees and other emerging
parasitoids. There is limited information on Gasteruption host
specialisation, with a large proportion of records based on
single observations (Parslow et. al. 2020). It 1s unlikely that A.
morosus 1s the only host for G. atrinerve, G. globiceps, G.
melanopoda and G. cinerescens because their distributions
extend beyond the distribution of A. morosus (Atlas of Living
Australia 2021; Parslow, 2020; Pasteels, 1957).
In contrast, parasitisation by the dipteran Anthrax maculatus
had a greater effect when invading A. morosus nests, parasitising
5.5 brood cells on average across A. maculatus infiltrated nests.
Previous studies have suggested that adult bombyliid females
identify a host nest and oviposit directly into the nest entrance
(Bohart et al., 1960). However, there are also reports of adults
ovipositing haphazardly onto the ground, leaving the planidium
to search for a host nest (Yeates and Greathead, 2008). This latter
scenario could be likely in the Dandenong Ranges given the high
density of A. morosus nests that can occur. It was unknown if the
larvae of A. maculatus feed on both the immatures and provisions
in a cell. Gerling and Hermann (1976) reported early instar
larvae of the bombyliid fly, Xenox tigrinus (Evenhuis, 1984)
(previously Anthrax tigrinus), feeding on the pollen bread in
Xylocopa virginica (Linnaeus, 1771) nests. However, bombyliid
fly immatures are also known to feed on the mature larvae of
their hosts (Felicioli et al., 2017; Minckley, 1989). The delay in
adult eclosion by A. maculatus compared with its host is
consistent with observations by Minckley (1989) of Anthrax
xylocopae (Marston, 1970) delaying emergence to synchronise
with its host. This 1s because adults are not able to break through
the cell partitions and therefore must wait for hosts to emerge
(Gerling and Hermann, 1976). This could explain why A.
maculatus puparium in our current study appeared to be
stimulated by disturbance when removed from their cells.
In our study, Ephutomorpha tyla was the most abundant and
destructive nest parasitoid 1n terms of both the number of brood
cells parasitised and (potentially) adult hosts killed.
Ephutomorpha tyla was rarely observed in nests with an adult
host present, supporting similar reports of mutillids forcefully
removing or killing host guards before ovipositing (Brothers et
al., 2000). Adult E. tyla were generally observed in the nest
entrances and on some occasions attempting to break through
the cell closest to the entrance, suggesting that E. tyla may open
the brood cell closest to the entrance to check for host brood
before ovipositing. The size differences between reared adults of
E. tyla are likely due to differences in the consumed host
immatures. For instance, in A. morosus, the males are generally
smaller than the females (Spessa, 1999). Additionally, the
amount of provisions in each brood cell can vary dramatically,
which can influence the size of the host immatures and
subsequently the ectoparasitoid feeding on it (Brothers, 1989).
Comparatively, the size differences observed in adults of E. aff.
varipes support the notion that 1t 1s likely a parasitoid of multiple
insect hosts; this accords with reports by Mickel (1928) that
variation in body sizes within mutillid species is linked to them
exploiting a range of hosts of varying size. Ephutomorpha aff.
varipes was observed in nests of numerous different host species
including the allodapine bee, Exoneura robusta Cockerell,
1922. However, given Brothers’ Rule (Brothers et al., 2000),
which states mutillids will only attack fully enclosed immatures,
it is unlikely that such a condition is universal given that E.
robusta progressively rears its brood in open linear nests. These
observations suggest that E. aff. varipes 1s a generalist parasitoid
of hosts using Cyathea australis as a nesting substrate, rather
than any specific hymenopteran host, which accords with the
notion that some mutillid species are adapted to specific
situations rather than hosts (Brothers, 1989).
190
Attack by wingless parasitoids such as mutillid wasps is
uncommon in stem-nesting bees (Ronchetti and Polidori,
2020). Michener (1985) suggested that this may be because
predators need to search in a three-dimensional space looking
for sparsely distributed nesting sites, whereas ground-nesting
hymenopteran entrances can be found using a two-
dimensional search pattern. In A. morosus, the high rates of
parasitism might be attributable to the high density of their
nesting substrate around mature tree ferns (Groulx and
Forrest, 2018). This high density of nesting sites may act in a
similar system to the ground nesting aggregations of halictid
bees, where nesting sites are abundant, and parasitism can be
prevalent ( Wcislo, 1996).
The mechanisms of parasitism and bionomy of parasitoids
has generally been poorly understood. Our study finds that
parasitoids of A. morosus have adapted to host nesting
behaviour and suggests variation 1n the oviposition chronology
of each parasitoid species, with Gasteruption wasps ovipositing
at the beginning of brood provisioning, A. maculatus
ovipositing across the middle stages of brood development and
the two mutillid species ovipositing in nests at the end of the
season. This variation in parasitoid pressure could have
implications for understanding the factors driving social
nesting in the only known social bee in the family Colletidae.
Acknowledgements
We thank Terry Houston for his insightful and thorough
comments on this manuscript. This project was supported by
The Holsworth Wildlife Research Endowment & The
Ecological Society of Australia awarded to L.R.H. and in part
funded by an Australian Biological Resources Study National
Taxonomy Research Grant Programme grant RF217-14 to
B.A.P. Nests were obtained under the scientific collection
permit 10008943 for Victoria. Thank you to James Dorey
Photography for imaging of the parasitised bee pupa.
References:
Almeida, E.A.B. 2008. Colletidae nesting biology (Hymenoptera:
Apoidea). Apidologie 39: 16-29. https://do1.org/10.1051/
apido:2007049
André, E. 1895. Mutillides d’Australie nouvelles ou imparfaitement
connues. Mémoires de la Société Zoologique de France 8: 475—517.
Atlas of Living Australia — Spatial Portal. AOO and EOO Tool
— Amphylaeus morosus (Australia) at https://spatial.ala.org.au/.
Accessed 21 April 2021.
Bogusch, P., van Achterberg, C., Silhán, K., Astapenková, A., and
Heneberg, P. 2018. Description of mature larvae and ecological
notes on Gasteruption Latreille (Hymenoptera, Evanioidea,
Gasteruptiidae) parasitizing hymenopterans nesting 1n reed galls.
Journal of Hymenoptera Research 65: 1—21. https://doi.org/10.3897/
]hr.65.26645
Bohart, G.E., Stephen, W., and Eppley, R. 1960. The biology of
Heterostylum robustum (Diptera: Bombyliidae), a parasite of the
alkali bee. Annals of the Entomological Society of America 53:
425—435. https://doi.0org/10.1093/aesa/53.3.425
Brothers, D.J. 1989. Alternative life-history styles of mutillid wasps
(Insecta, Hymenoptera). Pp 279-291 in: Bruton, M.N. (ed),
Alternative Life-History Styles of Animals. Springer: Dordrecht,
Netherlands. https://doi.org/10.1007/978-94-009-2605-9_ 14
L.R. Hearn, M.I. Stevens, M.P. Schwarz & B.A. Parslow
Brothers, D.J., Tschuch, G., and Burger, F. 2000. Associations of
mutillid wasps (Hymenoptera, Mutillidae) with eusocial insects.
Insectes Sociaux 47: 201—211. https://doi.org/10.1007/PL00001704
Cockerell, T.D.A. 1922. Australian bees in the Queensland Museum.
Memoirs of the Queensland Museum 7: 257-279.
Danks,H.V. 1971. Biology of some stem-nesting aculeate Hymenoptera.
Transactions of the Royal Entomological Society of London 122:
323—395. https://doi.org/10.1111/j.1365-2311.1971.tb00526.x
Donovan, B.J. 2007. Apoidea (Insecta: Hymenoptera) Fauna of New
Zealand 57. Landcare Research Ltd: Christchurch, New Zealand.
Eardley, C., and Daly, H.V. 2007. Bees of the genus Ceratina Latreille
in southern Africa (Hymenoptera, Apoidea). Entomofauna 13:
1-94.
Evenhuis, N.L. 1984. Revision of the Bombylius comanche group of
the new World (Diptera: Bombyliidae). International Journal of
Entomology 26: 291—321.
Felicioli,A.,Ambroselli,S.,Cilia,G.,and Sagona,S.2017. Parasitization
of a wild and reared population of the solitary bee Osmia
cornuta Latr. by the parasitoid Anthrax anthrax Schrank (Diptera,
Bombyliidae): comparison between two types of artificial
nest. Journal of Apicultural Research 56: 598—605. https://doi.org/
10.1080/00218839.2017.1343019
Gerling, D., and Hermann, H. 1976. The oviposition and life cycle of
Anthrax tigrinus (Diptera: Bombyliidae), a parasite of carpenter
bees (Hymenoptera: Xylocopidae). Entomophaga 21: 227—233.
https://doi.org/10.1007/BF02371755
Groulx, A.F., and Forrest, J. R.K. 2018. Nesting aggregation as a predictor
of brood parasitism in mason bees (Osmia spp.). Ecological
Entomology 43: 182—191. https://do1.org/10.1111/een.1248
Hearn, L.R., Williams, K.A., Stevens, M.I., Schwarz, M.P., Davies,
O.K., and Parslow, B.A. 2019. Description and novel host records
for a new species of Australian mutillid wasp (Hymenoptera:
Mutillidae) from hylaeine bee nests (Hymenoptera: Colletidae).
Austral Entomology 58: 524—532. https://doi.org/10.1111/aen.12414
Heraty, J. 2017. Parasitoid Biodiversity and Insect Pest
Management. Insect Biodiversity 603-625. https://doi.
org/10.1002/978 1118945568 .ch19
Houston, T. 1969. The systematics and biology of Australian Hylaeine
bees (Hymenoptera: Colletidae). Unpublished PhD thesis,
University of Queensland, Hertfordshire, St Lucia.
Houston, T.F. 1975. A revision of the Australian hylaeine bees
(Hymenoptera: Colletidae). I. Introductory material and the
genera Heterapoides Sandhouse, Gephyrohylaeus Michener,
Hyleoides Smith, Pharohylaeus Michener, Hemirhiza Michener,
Amphylaeus Michener and Meroglossa Smith. Australian Journal
of Zoology Supplementary Series 23: 1-135. https://dol.
org/10.1071/AJZS036
Kieffer, J.J. 1911. Etude sur les évaniides exotiques [Hym.] du British
Muséum de Londres, Annales de la Société Entomologique de
France 80: 151—231.
Latreille, PA. 1796. Précis des caractéres génériques des insectes,
disposés dans un order naturel par citoyen Latreille. Brive: F.
Bourdeaux xiv 201: 5.
Linnaeus, C. 1771. Mantissa plantarum, altera. Generum editionis VI &
Specierum editionis II. Impensis Direct Laurentii Salvii: Hol miae.
Macedo, A.C.C., Cordeiro, G.D., and Alves-dos-santos, I.
2012. Entering behavior of Gasteruption brachychaetum Schrottky
(Hymenoptera: Gasteruptiidae) into a nest of Hylaeus Fabricius
(Hymenoptera, Colletidae). Revista Brasileira de Entomologia 56:
325-328. https://doi.org/10.1590/S0085-56262012005000049
Marston, N. 1970. Revision of new world species of Anthrax (Diptera:
Bombyliidae), other than the Anthrax albofasciatus group.
Smithsonian Contributions to Zoology 43: 5-18. https://doi.
org/10.5479/s1.00810282.43
Parasitoids of the uniquely social colletid bee Amphylaeus morosus (Hymenoptera: Colletidae) in Victoria 191
Macquart, M. 1846. Diptéres exotiques nouveaux ou peu connus.
Supplément. Extrait des Mémoires de la Société royale des
Sciences, de l'Agriculture et des Arts de Lille 1844: 133—364.
Malyshev, S.I. 1968. Genesis of the Hymenoptera. Pp 3-9 in: Genesis
of the Hymenoptera and the phases of their evolution. Methuen:
London.
Meade-Waldo, G. 1916. LIII.—Notes on the Apide (Hymenoptera) 1n
the collection of the British Museum, with descriptions of new
species. Annals and Magazine of Natural History 17: 448—470.
Michener, C.D. 1985. From solitary to eusocial: need there be a series
of intervening species? Fortschritte der Zoologie (Stuttgart) 31:
293-305.
Mickel, C.E. 1928. Biological and taxonomic investigations on the
mutillid wasps. Bulletin of the United States National Museum.
https://do1.org/10.5479/s1.03629236.143.1
Minckley, R.L. 1989. Host records and biological notes for two Anthrax
species in Arizona (Diptera: Bombyliidae). Journal of the Kansas
Entomological Society 62: 274-278. https://doi.org/10.1093/
zoolinnean/zlaa005
Parslow, B.A. 2020. Systematics and host associations of the
Australian Gasteruption (Gasteruptiidae: Evanioidea).
Unpublished PhD thesis, Flinders University, Adelaide.
Parslow, B.A., Schwarz, M.P., and Stevens, M.I. 2020. Review of the
biology and host associations of the wasp genus Gasteruption
(Evanioidea: Gasteruptiidae). Zoological Journal of the Linnean
Society 189: 1105—1122.
Pasteels, J. 1957. Revision du genre Gasteruption (Hymenoptera:
Evanoidea: Gasteruptionidae). Espéces Australiennes. Mémoires
de l'Institut Royal des Sciences Naturelles de Belgique 56: 1—125.
Robertson, C. 1900. Some Illinois Bees. Transactions of the Academy
of Science of St. Louis 10: 47—55.
Ronchetti, F., and Polidori, C. 2020. A sting affair: a global quantitative
exploration of bee, wasp and ant hosts of velvet ants. PLOS ONE
15: e0238888. https://doi.org/10.1371/journal.pone.0238888
say, T. 1837. Descriptions of new species of North American
Hymenoptera, and observations on some already described.
Boston Journal of Natural History 1: 361—416.
schletterer, A. 1885. Die Hymenopteren-gattung Gasteruption Latr.
(Foenus, aut). Verhandlungen der | Kaiserlich-Kóniglichen
Zoologisch-Botanischen Gesellschaft in Wien 35: 267—326.
Schrottky, C. 1906a. Neue Evaniiden aus Paraguay (Hym .). Zeitschrift
für systematische Hymenopterologie und Dipterologie 6: 56—62.
Schrottky, C. 1906b. Contribución al conocimiento de los himenópteros
del Paraguay. II. Anales Científicos Paraguayos 6: 1—32
Supplementary material
Segers, F.H.I.D., von Zuben, L., and Grüter, C. 2016. Local differences
in parasitism and competition shape defensive investment in a
polymorphic eusocial bee. Ecology 97: 417—426. https://doi.
org/10.1890/15-0793.1
smith, F. 1879. Descriptions of new species of Hymenoptera in the
collection of the British Museum. British Museum: London. 240 pp.
Smith, A., Harper, C., Kapheim, K., Simons, M., Kingwell, C., and
Weislo, W. 2017. Effects of social organization and resource
availability on brood parasitism in the facultatively social
nocturnal bee Megalopta genalis. Insectes Sociaux 65: 85—93.
https://do1.org/10.1007/sO0040-017-0590-7
Spessa, A. 1999. The behavioural and population ecology of an
Australian native bee, Amphylaeus morosus Smith (Colletidae:
Hylaeinae). Unpublished PhD thesis, Australian National
University, Canberra.
Spessa, A., Schwarz, M.P., and Adams, M. 2000. Sociality in
Amphylaeus morosus. Entomological Society of America 93: 684—
692. https://doi.org/10.1603/0013-8746(2000)093[0684:S IAM HC
|2.0.CO;2
Vickruck, J., Huber J., and Richards, M. 2010. Natural enemies of the
bee genus Ceratina (Hymenoptera: Apidae) in the Niagara region,
Ontario, Canada. Journal of the Entomological Society of Ontario
141: 11-26.
Weislo, W.T. 1996. Parasitism rates 1n relation to nest site 1n bees and
wasps (Hymenoptera: Apoidea). Journal of Insect Behavior 9:
643—656. https://doi.org/10.1007/BF02213885
Weislo, W.T., Minckley, R.L., Leschen, R.A., and Reyes, S. 1994.
Rates of parasitism by natural enemies of a solitary bee, Dieunomia
triangulifera (Hymenoptera, Coleoptera and Diptera) in relation to
phenologies. Sociobiology 23: 265—265.
Woislo, W.T., Arneson, L., Roesch, K., Gonzalez, V., Smith, A., and
Fernández, H. 2004. The evolution of nocturnal behaviour in
sweat bees, Megalopta genalis and M. ecuadoria (Hymenoptera:
Halictidae): an escape from competitors and enemies? Biological
Journal of the Linnean Society 83: 377—387. https://doi.org/10.1111/
j.1095-8312.2004.00399.x.
Westrich, P. 2018. Die Wildbienen Deutschlands vol 821. Eugen Ulmer
Verlag: Stuttgart.
Yeates, D.K., and Greathead, D. 2008. The evolutionary pattern of
host use in the Bombyliidae (Diptera): a diverse family of
parasitoid flies. Biological Journal of the Linnean Society 60: 149—
185. https://doi.org/10.1111/j.1095-8312.1997.tb01490.x
Table S1. Table showing BOLD sequencing reference number and voucher number for deposited material. All material deposited at Melbourne
Museum.
Family Species Melbourne Museum Voucher number BOLD reference number
Gasteruptiidae Gasteruption primotarsale HY M-97074 OZBOL2593-21
Gasteruptiidae Gasteruption globiceps HY M-97075 OZBOL2607-2 1
Gasteruptiidae Gasteruption atrinerve HY M-97076 OZBOL2600-21
Gasteruptiidae Gasteruption cinerescens HY M-97077 OZBOL2605-21
Gasteruptiidae Gasteruption melanopoda HY M-97078 N/A
Bombyliidae Anthrax maculatus DIP-2590 OZBOL2594-21
Mutillidae Ephutomorpha tyla HY M-97079 OZBOL2596-21
Mutillidae Ephutomorpha aff. varipes HY M-97080 OZBOL2599-2]
Memoirs of Museum Victoria 80: 193-205 (2021) Published 2021
1447-2554 (On-line)
httos://museumsvictoria.com.au/collections-research/journals/memoirs-of-museum-victoria/
DOI https://doi.org/10.24199/j.mmv.2021 80.11
Early land plants from the Lower Devonian of central Victoria, Australia, including a
new species of Salopella
FEARGHUS R. McSwEENEY'*, JEFF SHIMETA* AND JOHN ST J.S. BUCKERIDGE '”
! Earth and Oceanic Systems Group, RMIT University, GPO Box 2476, Melbourne VIC 3001, Australia
* Centre for Environmental Sustainability and Remediation, School of Science, RMIT University, GPO Box 2476,
Melbourne VIC 3001
> Museums Victoria, GPO Box 666, Melbourne VIC 3001, Australia
*To whom correspondence should be addressed. Email: tidal75@gmail.com
Abstract McSweeney, F.R., Shimeta, J. and Buckeridge, J.S. 2021. Early land plants from the Lower Devonian of central Victoria,
Australia, including a new species of Salopella. Memoirs of Museum Victoria 80: 193—205.
Early land plants with elongate sporangia held in the palaeobotanical archives of Museums Victoria were examined.
The fossil plants are from Yea ("upper Silurian) and near Matlock (Lower Devonian) in central Victoria, and are of interest
because they contribute to our understanding of the evolution of early land plants in a region in which research has been
limited. Both Salopella australis and Salopella caespitosa were originally described over 30 years ago and this
reinvestigation has resulted in the emending of the diagnosis of Salopella australis and the erection of a new morphotaxon
Salopella laidae sp. nov. based primarily on differing branching architecture and sporangial morphology. Salopella
laidae comes from Yea Formation and possesses regular 1sotomous branching over at least two orders of branching,
terminating in elongate sporangia that are wider than their subtending axes, differing from S. australis, which possesses
only one dichotomy emanating from at least two erect parallel parent axes with sporangia that are the same width as their
subtending axes. A recently collected specimen of Salopella caespitosa was also examined and adds to our understanding
of this taxon, which was previously only known from one specimen. Consideration is given to the possible sources of these
early land plants based on other early land plants with a similar grade of organisation.
Keywords
embryophytes, rhyniophytoids, Baragwanathia flora, Devonian, Victoria
Introduction
Fossil plants have been known in Victoria since the 19th century
(Nicholas, 1875). Palaeobotanical studies on the Baragwanathia
flora (Jaeger, 1966) from the Silurio-Devonian of Australia have
primarily been limited to the first half of the twentieth century
(Cookson 1935, 1937, 1949; Lang and Cookson, 1927, 1930,
1935) and further expanded with Tims (1980), Tims and
Chambers (1984) and McSweeney et al. (2020). The majority of
plant fossils have been uncovered in the Melbourne Zone (fig.
1), and some further fragmentary remains have been found
further south in the Mathinnia Group of northeastern Tasmania
(Baillie et al., 1989; Banks, 1962; Cookson, 1937; Powell et al.,
1993). New data on early land plants from Australia, which was
once part of northeastern Gondwana during the Silurio-
Devonian periods, is of significance globally because it allows
comparisons between floral assemblages in Laurussia (Europe,
the United States and Canada), mid-palaeolatitude (Argentina)
and high palaeolatitude (Bolivia and Brazil) western Gondwana
sites and Chinese sites (North and South China Plates; Torsvik
and Cocks, 2019). Furthermore, the new data allow for more
data to be acrued to test the hypothesis of a Lower Devonian
northeastern Gondwana phytogeographic unit within which both
South China and Australia were parts or subunits of, according
to Hao and Gensel (1995, 1998, 2001) and Wang et al. (2002).
This paper records one new taxon after an investigation of
early land plant material with elongate sporangia collected by
Tims and Chambers (1984) from the ?upper Silurian-Lower
Devonian Yea Formation, the Humevale Formation near Yea
and the Lower Devonian Wilson Creek Shale Formation near
Matlock in central Victoria (fig. 1). Early land plants
possessing elongate sporangia with tapering apices of either
rounded or pointed tips and with fusiform or elongate parallel
sided sporangia characteristic of rhyniophytes/rhyniophytoids
(sensu Edwards & Edwards 1986) were described by Tims
and Chambers (1984) and assigned to Salopella australis and
Salopella caespitosa. The specimens described herein are
compressions/impressions with little anatomical detail
preserved and belong to the same morphogenus Salopella
Edwards and Richardson, 1974. One new specimen of S.
caespitosa, only the second so far recorded, was also
194
examined and is of siginifcance to our understanding of this
morphotaxon because it was preserved in semi-relief as a
coalified compression/impression.
Locality, stratigraphy and age
The Melbourne Zone is a triangular stuctural region occuping
central Victoria bounded by the Heathcote Fault in the west and
Governor Fault in the east, opening towards the south
(VandenBerg and Gray, 1988). The Wilson Creek Shale extends
across the Melbourne Zone (VandenBerg, 1975; VandenBerg et
al., 2006), and based on the conodont fauna, is considered to be
middle Pragian—Emsian (Mawson and Talent, 1994). It comprises
mudstone and shale units, characteristic of deep water and anoxic
conditions, with Uncinatograptus thomasi (=Monograptus
thomasi) Jaeger, 1966, found throughout and Neomonograptus
New South Wales
F.R. McSweeney, J. Shimeta & J.S. Buckeridge
notoaequabilis (=Monograptus aequabilis notoaequabilis)
Jaeger et al., 1969, in the upper half (Edwards et al., 1997, 1998;
Lenz 2013; VandenBerg, 1988; VandenBerg et al., 2006). The
outcrop examined occurs on Frenchmans Spur track,
approximately 10 km west of Matlock, and is the type location of
the rhyniophytoids Salopella australis and S. caespitosa, and the
early "trimerophyte-grade" (sensu lato Banks 1975) plant
Dawsonites subarcuatus (Tims and Chambers, 1984).
The Humevale Siltstone and Yea Formation occur in the
western part of the Melbourne Zone (Edwards et al., 1997;
VandenBerg, 1988) and both are exposed near Yea. The dating
of the exposures at Ghin Ghin Road and Limestone Road, Yea,
as Pridolian and Ludlovian respectively by Garratt and
Rickards (1984, 1987), Garratt et al. (1984), Rickards and
Garratt (1990), and Rickards (2000) are contentious for a
number of workers (Banks 1980; Cleal and Thomas, 1999;
Australia
500 km
"T : | » in.
Victoria 3. = o
2 N XO,
X i | A
> NE Mm
E ' | -NA
Melbeuyrne,
Y Vilsons Promontory
Darraweit Guim Province
Bass Strait
King
f) send
. Flinders
) Island — Mount Easton Province
| d
0 30 100 iz : =<) e Fossil locations
m ^X. Tasmania Clarke Island 1, Yea 2. Matlock
Figure |. Map of Victoria, Australia, showing the fossil locations within the Melbourne Zone. Location |. Yea, Ghin Ghin Road, Limestone Road
(37° 12.38' S, 145° 25.39’ E). Location 2. Matlock, Frenchmans Spur (37° 25.82’ S, 146° 77.24’ E.), the type location of Salopella australis and
S. caespitosa (Tims and Chambers, 1984). Source: adapted from Moore et al. (1998: fig. 2).
Early land plants trom the Lower Devonian of central Victoria, Australia, including a new species of Salopella 195
Edwards et al., 1979; Edwards et al., 1997; Hao and Gensel,
2001; Hueber, 1983, 1992). Hueber (1983) considered the
morphological and anatomical complexity of Baragwanathia
longifolia more akin to a Lower to Middle Devonian age and
noted the complex nature of the conspecific taxa Yarravia
(=Hedeia) to further that point, McSweeney et al. (2021).
Hueber (1992) suggested differences between the
Baragwanathia from the two horizons at Yea were likely
intraspecific and considered the interpretation of graptolites by
Garratt and Rickards (1984) as subjective because preservation
was poor. Additionally, Hueber (1992) highlighted that the
purported 24 million year difference between the two horizons
had resulted in little evolutionary change, as did Hao and
Gensel (2001: 103), yet massive differences occurred over 3
million years between the Cooksonia spp. found in Ireland
(Edwards et al., 1983) and the younger Lower Plant Horizon of
Yea. Edwards et al. (1979: 321) questioned the interpretation of
the age of Maoristrophia banksi and the graptolites not
occurring on the same plane as the Baragwanathia in the
Lower Plant Horizon. Finally, Edwards et al. (1997: 22)
consider the Humevale and Yea Formations at Yea to be part
of the Norton Gully Sandstone Formation.
The Yea and Humevale Formations espoused by Garratt
(1978) are retained because they provide a stratigraphic
framework for the area (McSweeney et al., 2020: fig. 2 —
stratigraphical comparison chart and Ghin Ghin Road
exposure). However, a Lower Devonian age will be used when
assigning an age to specimens at Yea to account for these
differing interpretations.
Materials and methods
The collection site of early land plants from Limestone Road,
Yea, 1s heritage listed, with further collecting forbidden; in
addition, the Frenchmans Spur locality 1s heavily overgrown
and, for the most part, inaccessible. The specimens described
herein are from Museum Victoria's palaeontological archives
and were collected by J.D. Tims and J. Douglas in the 1970s
and early 1980s, and one specimen S. caespitosa (NMV
P235941) collected by C. Earp and M. Pepper, 19 m from the
Devil's Elbow road cutting on Ghin Ghin Road, Yea, central
Victoria, Australia.
The specimens collected by Tims and Douglas are
preserved as fine compressions/impressions, and even after
maceration with Schultze's solution and acetate film pulls (see
Tims and Chambers, 1984: 266), no evidence of internal
anatomy remains. The S. caespitosa collected by Earp and
Pepper is coalified and a fragment was taken from the lowest
part of the parent axis of NMV P23594].2 using a fine steel
needle. Additionally, a fragment was dislodged from the
centre of the basal dark presumed sporogenous region of
sporangia two and four on NMV P23594].1. These fragments
were placed onto aluminium stubs for scanning electron
microscope analysis under low vacuum on an FEI Quanta 200
ESEM at RMIT University’s RMIT Microscopy and
Microanalysis Facility (RMME).
Images were taken at Museums Victoria (Carlton) using a
Leica M205 C microscope and Leica Application Suite
software version 3.8.0. Images were edited using Adobe
Illustrator CC 2017 and morphological measurements were
taken using ImageJ software. Dégagement was undertaken on
the Museums Victoria material archived by Tims (1974,
1980), Tims and Chambers (1984) and J. Douglas.
Institutional abbreviations
NMV P, Museum Victoria Palaeontology Collection,
Melbourne, Australia. The use of .1 and .2 at the end of NMV
P refer to part and counterpart, respectively. All specimens
including the samples placed on stubs for scanning electron
microscope analysis are housed in the Palaeontological
Section, Museums Victoria, Melbourne.
Systematic palaeobotany
Plantae. /ncertae sedis
Genus. Salopella Edwards and Richardson, 1974
Type Species. Salopella allenii Edwards and Richardson, 1974
Salopella australis Tims and Chambers, 1984 (fig. 2A—G; line-
drawing fig. 6A)
Salopella australis Tims and Chambers (1984: pl. 32, figs. 1—6; pl.
34, figs. 4, 5; text-fig. 2A—C)
Emended diagnosis (after Tims and Chambers, 1984). New
information in bold. Axes 0.9—2.4 mm wide with central line,
at least two long aligned parallel parent axes with one
dichotomy each resulting in narrower shorter daughter
axes terminated by a single sporangium on each. Plant at
least 80 mm high. No obvious branching at the base of the
sporangia. Sporangia 6.5—14.0 mm high and 1.3—2.0 mm wide,
with parallel sides in the lower two-thirds of the presumed
fertile portion. Sterile sporangia apex tapering to a point in the
upper third. Spore characters unknown.
Locality. Frenchmans Spur Track, 10 km west of Matlock,
Victoria. 37° 25.82' S, 146° 77.24' E.
Stratigraphy and age. Wilson Creek Shale, mid-Pragian-
Emsian, Lower Devonian (Carey and Bolger, 1995; Mawson
and Talent, 1994).
Note: Two specimens assigned to S. australis by Tims and
Chambers (1984) from Limestone Road have been transferred
to Gen. et sp. indet. because the specimens are too poorly
preserved to unequivocally assign to any taxon. These are
NMV P229617 and NMV P157323; NMV P157323 (Jack
Douglas Private Collection) was figured by Tims and
Chambers (1984: pl. 32, figs 5, 6 and text-fig. 2b) but possesses
a completely different branching architecture to the holotype
for S. australis and has poorly defined sporangia. Specimen
NMV P157323 has been re-drawn here (fig. 6B) for
comparison to S. australis (ig. 2A-E). Specimen NMV
P50011 from Limestone Road has been moved out of S.
australis to a new Salopella species (see below). Most
specimens assigned to the Wilson Creek Shale by Tims and
Chambers (1984) on Frenchmans Spur track are considered S.
australis because they have subtending axes the same width
196
as their sporangia (e.g. NMV P50014, NMV P33219 and
NMV P50008 [holotype]). Only in cases where this character
is equivocal are specimens assigned to Gen. et sp. nov. (e.g.
NMV P50010).
Description. Salopella australis possessed an erect habit with
at least two long parent axes aligned parallel to each other and
with one distal dichotomy on each resulting 1n narrower shorter
daughter axes, each terminating in an elongate sporangium
with an acuminate apex. A slight indentation occurs on some
sporangia at the darker carbonaceous area and sterile interface,
and proximally the dark carbonaceous area tapers inwards on
the daughter axes.
Remarks. A reassessment of the morphospecies Salopella
australis as originally determined by Tims and Chambers
(1984) has necessitated the removal of some of the specimens
attributable to it, primarily due to differing branching
architectures and poor preservation. Tims and Chambers
(1984: 268) noted four species with two dichotomies, but only
three were found; presumably, the fourth is in a private
collection. Nonetheless, all the specimens figured in Tims and
Chambers (1984) were examined. Tims and Chambers (1984:
270) described S. australis as "open-branched" (Tims and
Chambers, 1984: pl. 32, fig. 5, 6) with at least two dichotomies
of widely dichotomising daughter axes emanating from one
parent axis, and up to at least 145 mm in length (fig. 6B).
However, this was found to occur on only three specimens
from Limestone Road and was not found on the holotype (fig.
2D, E — double arrows between aligned parent axes).
The holotype possessed two aligned parent axes, with one
of the parent axes dichotomising into shorter narrower
daughter axes. The other parent axis was not as well
preserved. However, another specimen with better
preservation (fig. 2A, C) shows both parent axes aligned and
dichotomising into shorter narrower daughter axes terminated
with elongate sporangia that are no wider than their
subtending axes. Tims and Chambers (1984: pl. 32, fig. 4)
partly illustrated this specimen with only one of the parent
axes shown. However, Tims and Chambers (1984) did not
mention or show the other parent axis aligned parallel to this
axis. Furthermore, there was an additional specimen in the
collection not figured by Tims and Chambers (1984), likely
due to its poor preservation, but which also had two aligned
almost parallel axes and is similar to the holotype with two
parent axes aligned and with one of the parent axes possessing
a single dichotomy with short daughter axes terminated in
elongate sporangia (fig. 2B). Even taking into account the
effects of degradation of the specimens before fossilisation
and the effects of ocean currents on orientation of the axes,
the Limestone Road specimens appears to have more in
common with S. caespitosa than S. australis, with two
dichotomies and relatively longer daughter axes from the
ultimate dichotomy (fig. 6B).
This emendation has resulted in the maximum known
length of S. australis being reduced from 145 mm to 80 mm
and the reduction of known dichotomies to one, with the
sporangial dimensions and morphology remaining the same.
Specimens attributed to S. australis herein (fig. 2A—E) were
F.R. McSweeney, J. Shimeta & J.S. Buckeridge
deposited in a deep marine quiescent environment of the
Wilson Creek Shale, and like the holotype, possessed parallel
erect axes. This branching architecture of erect parallel
aligned axes was found only in three specimens, including the
holotype. All the other specimens bar one, which is defined
below, are too poorly preserved to attribute to any taxon.
Parsimony suggests that parallel axes that dichotomise at the
same level, with axes of comparable widths, terminating in
elongate sporangia on short daughter axes also of equal
dimensions, that have been transported a considerable
distance belong to the same plant (sensu lato Wang and Hao,
2004; Edwards et al., 2015; Edwards and Li, 2018a) and are
representative of its true branching architecture. We
acknowledge that we have failed to show organic connection,
and current alignment could conceivably result in this axial
configuration, but the likelihood of this occurring to three
separate specimens with characters such as branching and
sporangia occurring at the same height and with the same
dimensions is unlikely. We postulate that the parallel aligned
axes may have emanated from a rhizomatous region because
there was no converging of the parent axes. Two of these
parallel aligned specimens were included in Tims and
Chambers (1984) but noticeably in both cases, only one of the
parent axes was visible (Tims and Chamber, 1984: text-fig.
2A, pl.32, figs. 1, 2, 4). Additionally, the line-drawing of S.
australis in Tims and Chambers (1984: text-fig. 2a) shows the
daughter axes of the parent axes with slightly differing
lengths, which was based on Tims and Chambers (1984: pl.
32, fig. 1). But a closer examination of this specimen
(holotype; fig. 2D) shows the daughter axes are preserved on
different levels of lamina, with the perceived shorter daughter
axis (upper arrow) partly obscured by another axis.
The specimens removed from Salopella australis (Yims
and Chambers, 1984: pl. 32, figs 3,5) and placed in Gen. et sp.
indet. include isolated poorly preserved sporangia from both
the Wilson Creek Shale on Frenchmans Spur (fig. 2F, G) and
specimens from Limestone Road because the preservations
were generally poor and the branching architectures greatly
differed to the holotype. One of the excluded specimens
(Tims and Chambers, 1984: pl. 32, fig. 3) with differing
branching architecture to S. australis is described below as a
new morphospecies. Thus, S. australis is no longer
represented in the flora of the Lower Plant Horizon.
Salopella caespitosa Tims and Chambers, 1984 (fig 3A—I
(holotype) and fig. 4A—E)
Material: NMV P50016 (holotype) and NMV P235941 both with
part and counterpart.
The circumscription of Salopella caespitosa was based on a
single specimen with its counterpart from the Wilson Creek
Shale Formation on Frenchmans Spur Track approximately 10
km west of Matlock in central Victoria. No new data have
been added on this taxon since its inception. The discovery of
a new specimen from the base of the Humevale Formation on
Ghin Ghin Road near Yea preserved in semi-relief contributes
information on its dimensions, gross morphology and
temporal range.
Early land plants from the Lower Devonian of central Victoria, Australia, including a new species of Salopella 197
Figure 2. Salopella australis displaying parallel parent axes dichotomising into much shorter daughter axes that are terminated with elongate
sporangia, delineated with a constriction just above dark sporogeneous region. All from Wilson Creek Shale on Frenchmans Spur track, 10 km
west of Matlock. A, erect parent axes parallel to each other, dichotomising into two elongate sporangia from Wilson Creek Shale. Re-photographed
here; originally published in Tims and Chambers (1984: pl. 32, fig. 4) and Tims (1980: fig. 4.1.9). Specimen NMV P50014. B, forked dichotomy
terminated by sporangia from Wilson Creek Shale. And to the right hand side of the forked axis is another long axis, which based on its
orientation may also be part of the same plant. Constriction at arrow, lower arrow at dichotomy and double arrow at two aligned axes. Specimen
NMV P33219. C, close-up of fructification in A, sporangia barely extend beyond the confines of their subtending axes, with slight constriction
present above sporogeneous region (at arrow). Specimen NMV P50014. D, E, holotype, part and counterpart. On part, constriction at arrow in
sporangium. On counterpart, both parent axes are parallel to each other (at dotted arrow). Re-photographed here, originally published in Tims
and Chambers (1984: pl. 32, figs. 1, 2). Specimens NMV P50008.1 and NMV P50008.2, respectively. F, Gen. et sp. indet. — short daughter axes
terminated 1n elongate sporangia. The cortex may be absent from subtending axes, with only the central line visible. The lack of cortex prevents
assigning to S. australis as width of subtending axis to sporangial width is required. Originally photographed by Tims (1980: fig. 4.1.13).
Specimen NMV P50010.2. G, S. australis, with two short daughter axes, with constriction at arrow of the sporangium, which is the same width
as its subtending axis. Specimen NMV P202886.
198
Description. The new specimen’s length is 135 mm and consists
of two synchronous dichotomies with longer than wide
sporangia terminating each axis. The naked slender axes are
0.8—1.5 mm wide, with the axial width decreasing equally after
each dichotomy. The first dichotomy occurs c. 80 mm from the
base of the fossil and c. 31 mm from the second dichotomy (fig.
4A at lower arrow). The subtending axes to the sporangia are
0.9-1.0 mm wide and 22-25 mm high with some slight
variation in the width along all four axes and a slight narrower
evident beneath sporangia three and four (fig. 4B, the subtending
axis to sporangium four pinches slightly about | mm below the
sporangium). The sporangia are fusiform 1.5—2.0 mm wide and
4.8—6.0 mm high with the subtending axis slightly widening
into the base of each sporangium. The widest part of the
sporangia occurs in the lowest quarter length, followed by a
gentle tapering to rounded sporangial tips. A sporangial wall is
evident primarily but 1s not confined to the basal parts of the
sporangia measuring 0.2—0.3 mm wide and is continuous with
the subtending axes. Sporangia two, three on the part and four
on the counterpart possess what appears to be an infilled oval
presumed sporogenous area, which are no greater than 1.2 mm
wide and 1.5 mm high. Sporangium four on the counterpart
shows a fine linear cavity 0.15 mm wide entering the base of
the sporogenous area and sporangium three on the part shows
similar but larger opening beneath the sporogenous area, and
beneath this is a fine central axis 0.1 mm wide; beneath
sporangium two on the subtending axis, this axis is 0.2 mm
wide. Sporangium two (part) upper half possesses longitudinally
oblique striations, 0.06—0.6 mm apart.
Remarks. Comparison to holotype. The new specimen
measures 50 mm longer than the holotype (fig. 3), and its axial
width 1s broadly in range with the holotype, which measures
1.1-1.9 mm wide according to Tims and Chambers (1984).
What appears to be the widening of the parent axis in the
specimen (fig. 4À) 1s where the first dichotomy occurs, with the
two daughter axes aligned for 26 mm before diverging for the
remaining 5 mm before the second dichotomy. From the
holotype, the best examples of branching to compare to the
specimen were found on the part specimen (right-hand side)
with isotomous dichotomies subtending sporangia one-seven
(fig. 3A, fig. 6D). Proximally on the axes ultimately terminate
in sporangia one-seven show the axes emanating from a
horizontal axis. This horizontal axis may represent part of a
rhizomatous system or a distorted axis. Tims and Chambers
(1984) appear to have considered this a dichotomy because no
other part of the fossil would give three dichotomies. However,
it is equivocal as to whether it is a distorted axis with a
dichotomy. Nonetheless, the axes of the new specimen
examined are noticeably less flexuous than the holotype; for
example, on the holotype axes leading to sporangia eight and
nine showing changes in orientation of about 45? in conjunction
with the daughter axes of dichotomies occurring at 10° and 45°.
These differences possibly represent differences in both current
strength during deposition and the level of degradation of each
of the plants. There is a noticeable variation in the distance
between the ultimate branching points and sporangia in the
holotype, from c. 6 mm as seen in sporangium 12, to c. 26 mm
F.R. McSweeney, J. Shimeta & J.S. Buckeridge
for sporangium seven, and up to at least 57 mm for sporangium
eight, where the presumed branching point is not visible. The
axes decreased after each dichotomy, as noted by Tims and
Chambers (1984), but with the specimen examined herein there
is a much greater decrease in axial width after the first
dichotomy. Examination of the holotype did reveal a slight
narrowing in the subtending axes (fig. 3D—F) of most of the
sporangia (Tims and Chambers 1984: pl. 34, fig. 3); this was
observed beneath two of the sporangia on the specimen, but in
both cases may be artefacts of preservation, and more
specimens are required to confirm this character.
The size range of the sporangia in the holotype, 3.2—6.0
mm high and 1.3—2.0 mm wide (Tims and Chambers, 1984),
is similar to the specimen examined herein, and both have a
comparable average height to width ratio of 2.6 (Morris and
Edwards, 2014: table 3) for the holotype and 3.2 herein. The
holotype shows slight variation in the location of the widest
point of the sporangia, occurring either in the lowest quarter
(fig. 4F), like with NMV P23594] (fig. 4C) or midway (fig.
3D). The minor difference 1s possibly accounted for by the
different types of preservation. The specimen NMV P2359]
shows these sporangial bodies 1n semi-relief and indicate they
were not flattened bodies. Furthermore, examination of
sporangia of the specimen revealed an oval presumed
sporogenous region in the basal part of the sporangia, which
is also present on sporangium 13 of the holotype (fig. 3H).
lims and Chambers (1984: pl. 33, figs 3—4) noted that on
sporangium 13 of the holotype it may either be a double
sporangium or dissociation of the sporangial wall giving the
appearance of a double sporangium. The evidence of a
sporogenous area basally and relatively thick sporangial walls
from the specimen examined herein (fig. 4B) suggests either a
crushed sporangium or stage of senescence pertaining to
dehiscence. Furthermore, some of the sporangia in the
holotype have a darkened presumed sporogenous area
completely filling insides of the sporangia (fig. D—F), which
may have resulted from the breakdown of the wall holding the
sporogenous area prior to fossilisation, as the sporogenous
area occurs as a basal oval body on all sporangia of the
specimen examined.
Tims and Chambers (1984: pl. 33, fig. 3) found central
lines of 0.2 mm diameter throughout the specimen, one of
which was beneath sporangium 13. On the specimen NMV
P235941, the central line was found to connect to base of the
sporogenous region (fig. 4B, C), which Tims and Chambers
(1984) had postulated. Tims and Chambers (1984) noted some
axes of the holotype to dichotomise (c. 6.0 mm) relatively
close to the base of the sporangia (fig. 3C); however, this was
not the case with NMV P23594].
The presence of longitudinal oblique striations on the upper
half of sporangium two may reflect cell orientation and possible
twisting as a means of dehiscence. Obliquely orientated cells in
the sporangia have been recorded for some S. allenii and absent
for S. marcensis (Fanning et al., 1992; Morris and Edwards,
2014), and throughout the entire sporangia and subtending axes
of Tortilicaulis (Edwards et al., 1994). There was no indication
of twisting found for the subtending axes of the specimens
sporangia, Suggesting it may only affect the upper part of the
Early land plants from the Lower Devonian of central Victoria, Australia, including a new species of Salopella 199
Qe wp "VIE. *
« m gt =
-—
|
aÃ- g
pmm
i -—
A — E t E “ae
9 A > z . B
Figure 3. Salopella caespitosa (holot
P202987.1) and counterpart (NMV P202987.2), respectively; numbering follows Tims and Chambers (1984, pl. 33, fig. 1). Counterpart images
are reversed to be in the same orientation as the part specimen. A, on right-hand side of part specimen, double isotomous dichotomies lead to
sporangia one—seven. Note, at the arrows, there 1s perpendicular branching that 1s suggestive of a rhizomatous system. C, sporangium 12; at the
arrow there is another axis that is terminated in a sporangium that is partially visible. Specimen NMV P202987.1. D—F, Evidence of a slight
constriction beneath sporangia at arrows. D, sporangia eight and nine (on the left). Widest part of each sporangium occurring approximately
midway along their length. Note, rephotographed; originally published in Tims and Chambers (1984: pl. 34, fig. 3). Specimen NMV P202987.1.
E, sporangium 22 is c. 4.06 mm long and 1.4 mm wide. The axis decreases from 1.2 mm proximally to 0.5 mm just beneath the sporangium.
Specimen = NMV P202987.2. F, sporangia four (right) and five, both sporangia are slightly wider in the lower quarter of each sporangia.
specimen = NMV P202987.2. G, sporangium 22, appears to be two immature sporangia juxtaposed. At arrow, the apex (rounded) of the smaller
fusiform sporangium is apparent. Specimen NMV P202987.1. H, sporangium two, lower arrow at walls surrounding presumed oval sporogeneous
area, which reaches approximately halfway the length of the sporangium to the upper arrow. Specimen NMV P202987.1. I, sporangium 13,
arrows at walls surrounding sporangeneous area and upper arrow showing extent of oval sporogenous body. The walls does not recombine
apically like in sporangium two, suggesting it may have been crushed, or hidden, beneath the matrix. Rephotographed; originally figured by Tims
and Chambers (1984: pl. 33, fig. 3). Specimen NMV P202987.2.
200
sporangia; however, this is conjectural. As noted by Morris and
Edwards (2014: 42), sporangia containing spores are required
for unequivocal identification and assessment of relationships.
F.R. McSweeney, J. Shimeta & J.S. Buckeridge
more data. The presence of this specimen at the base of the
Humevale Formation potentially suggests a late Silurian age
(Rickards, 2000). However, as outlined in the stratigraphy
section, we suggest a Lower Devonian age range for specimens
found at Ghin Ghin Road until unequivocal evidence of age
becomes available.
While the specimen described is three-dimensionally
preserved, we believe erecting a new taxon to segregate it from
the form genus would be premature and we should wait for
uz | Ty" MORTEM yee. ON, o,
Figure 4. Salopella caespitosa NMV P235941 from Devil's Elbow on Ghin Ghin Road, northwest of Yea. A, overview of whole specimen. NMV
P235941.1. B, arrow (Vt) at vascular trace entering base of oval presumed sporogenous body of sporangium four, and the subtending axis to
sporangium four pinches slightly about 1 mm below the sporangium. Lower arrow at region where subtending axis is continuous with sporangial
wall and upper arrow shows extent of sporangial body of sporangium three. Note, for both sporangia, the distal parts appear to be hidden in the
matrix. NMV P23594].2. C, lower arrow (Vt) at vascular trace entering base of oval sporogenous body, with upper arrow at distal extent of
sporogenous body on sporangium two on the counterpart. Note, no longitudinally oblique striations are evident in upper half of sporangium but
are evident on the part specimen. NMV P235941.2. D, sporangium two at arrow longitudinal oblique striations on the upper half of the
sporangium. NMV P23594].1. E, close-up of parent axis with longitudinal striations. NMV P235941.1.
Early land plants from the Lower Devonian of central Victoria, Australia, including a new species of Salopella 201
Plantae. /ncertae sedis
Genus. Salopella Edwards and Richardson, 1974
Salopella laidae McSweeney, Shimeta and Buckeridge, sp. nov.
(fig. 5A, B, fig. 6D)
Salopella australis Tims and Chambers (1984: pl. 32, fig. 3, text-
fig. 2C)
Diagnosis. Plant at least 55 mm long, tuft branching
architecture, with sporangia all reaching the same height, with
naked dichotomously synchronous branched axes up to 3.2 mm
wide basally and 1.3 mm below sporangia. Axial width
decreases after each dichotomy. Isotomous branching angles
small, 30°—40° for the ultimate dichotomies and 15?—50? for
basal dichotomies. At least two orders of branching. Branching
10.0—14.0 mm below sporangia. Eight sporangia, elongate sub-
fusiform 9.7—-11.0 mm high and up to 2.5 mm at widest section
in mid region, and wider than subtending axes, obtuse apices.
Etymology. Named for Mrs Peg Laid who kindly gave
permission to collect fossil specimens from her property on
Ghin Ghin Road, Yea.
— O
Holotype. NMV PS50011.1 and NMV P50011.2, part and
counterpart respectively, figured by Tims and Chambers, 1984:
pl. 32, fig. 3 and text-fig. 2C
Locality. Location 4, Brackley's cutting (Harris and Thomas,
1941) Limestone Road, 2 km southeast of Yea. Note: exposure
referred to as locality 62 in Couper (1965). 37° 12.38' S, 145°
25.39' E.
Stratigraphy and age. Location 4 (Harris and Thomas, 1941:
303) Yea Formation (Garratt 1978), Lower Devonian (Pragian;
Edwards et al., 1997; Rickards, 2000; Rickards and Garratt,
1990).
Salopella laidae sp. nov. (fig. 5A, B, fig. 6C)
Description. Specimen preserved as a faint white compression
on blue-grey claystone with six of the eight sporangia preserved.
There is no clear sporogenous area within the sporangia.
However, sporangia five, seven and eight (fig. 6C) on the part
(fig. 5A) possess darkened creamy-grey regions extending up
two-thirds of their lengths and possibly represent a
sporogeneous region. No internal anatomy or spores were
Figure 5. Salopella laidae sp. nov. (holotype) NMV P50011.1 and NMV P50011.2, part and counterpart, respectively, with counterpart reversed
to be in the same orientation as part specimen. From location 4 (Brackley’s cutting) on Limestone Road, Yea. A, double isotomous dichotomy
visible, terminated with eight elongate sporangia, five visible. At lower arrow central line and at F, folding of tissue. On sporangium seven
?sporogenous region highlighted. Rephotographed; originally figured by Tims and Chambers, 1984: pl. 32, fig. 3 and text-fig. 2C. B, arrow at
daughter axis missing on part present.
202
recovered when Tims and Chambers (1984) examined this
specimen. The sporangia are slightly wider than the widths of
their subtending axes and do not taper distally but come to a
rounded apical region. There are two synchronous dichotomies
clearly visible, with the axial width decreasing only after each
dichotomy. Folding of tissue appearing as a longitudinal
lineation along the edges of the axes and sporangia are visible;
no evidence of dehiscence mechanism is present (fig. 5A).
Comments and comparison with other species. The diagnosis
and description of this taxon is based on one specimen (part
and counterpart). While we are mindful of issues in naming a
new species on one specimen, we have done so because of the
shape of the sporangia and compact branching architecture that
set it apart from other rhyniophytoids (Table 1). The use of the
paraphyletic genus Salopella (Edwards et al., 1994) is to
emphasise its gross morphology and to follow previous workers
(Tims and Chambers, 1984) in identifying Victorian flora.
However, we note that work done by Edwards et al. (1994) on
in situ Salopella spores demonstrated significant diversity, that
can be difficult to ascertain because of convergence of some
sporangial shapes (Edwards et al. 2001: 11), making assertions
on palaeogeographic distribution and spread unwise without
palynological evidence. Tims and Chambers (1984) originally
assigned this specimen to S. australis, but Salopella laidae sp.
nov. differs to S. australis in a number of its characters (fig. 6
— comparative line drawings of Australian Salopella). Salopella
laidae sp. nov. possesses sporangia that are clearly delineated
from their subtending axes, differing noticeably from coeval S.
australis (fig. 2A—E) where the sporangia are as wide as their
= -e = = = «= &
A B
F.R. McSweeney, J. Shimeta & J.S. Buckeridge
subtending axes. Furthermore, the sporangia in S. laidae sp.
nov. do not taper from half-way to one-third from their apices
as in S. australis; instead, they hold their sporangial widths
before terminating with rounded apices. While the sporangial
apices appear obtuse, this cannot be assumed to have been the
case in life, as Morris and Edwards (2014: 40) found when
examining S. allenii that compressed specimens possessed
rounded apices of varying degrees, except that one specimen of
S. allenii that was preserved in 3D had a pointed apex. The
parent axes leading to the ultimate dichotomy in S. australis
are long, erect and aligned parallel to each other (fig. 2A), being
easily distinguished from S. /aidae, where the axes leading to
the ultimate dichotomy are at an angle to the vertical.
Furthermore, S. australis only possesses one dichotomy, while
S. laidae possesses two, or possibly three, as suggested in Tims
and Chambers (1984: text-fig. 2C). However, it should be noted
the proximal axes of S. laidae sp. nov. are orientated away from
each other, suggesting they may have come from a rhizomatous
axis instead of a dichotomising one.
One of the parent axes of S. laidae sp. nov. 1s incomplete,
but likely possessed four sporangia (fig. 6C). This 1s based on
the relative dimensions, orientation and positions of both
parent axes to each other, and that four sporangia terminate
the daughter axes of the other parent axis.
The sporangia of Salopella caespitosa are ovate to fusiform
and up to 6.0 mm high and 2.0 mm wide (Tims and Chambers,
1984), which is approximately half as high than S. laidae.
Furthermore, the axes of S. caespitosa are more gracile than
those of S. laidae, as the latter reached a maximum width of 1.9
C
Figure 6. Line-drawings of Victorian early land plants with longer than wider sporangia. A, Salopella australis from Wilson Creek Shale on
Frenchmans Spur track, near Matlock. Specimen NMV P50014. B, Gen. et sp. indet. from Limestone Road, Yea. Originally placed in S. australis
but branching architecture clearly differs. Specimen NMV P157323. C, Salopella laidae sp. nov. from Limestone Road, Yea. NMV P50011. D,
Salopella caespitosa (holotype) from Wilson Creek Shale on Frenchmans Spur track, near Matlock. Specimen NMV P202987. E, Salopella
caespitosa from Ghin Ghin Road, Yea. Specimen NMV P23594].
Early land plants trom the Lower Devonian of central Victoria, Australia, including a new species of Salopella 203
mm proximally and 1 mm beneath the sporangia, whereas for
S. laidae axes were at least 3.2 mm proximally and 1.3 mm
beneath the sporangia. In comparison to other Salopella
globally, the sporangia of S. marcensis and S. xinjiangensis are
much smaller than S. /aidae, reaching a maximum length of 3.4
mm and 3.5 mm long, respectively, and both much narrower
(Morris and Edwards, 2014: table 3). Moreover, the sporangia
of S. xinjiangensis are tongue-shaped (Cai et al., 1993; Dou and
sun, 1983), but S. marcensis sporangia are similar in gross
morphology to S. laidae, being elongate and tapered at their
apices according to Fanning et al. (1992). Salopella marcensis
are much smaller plant than S. laidae, reaching 6.38 mm high,
while S. laidae reached at least 55 mm high (Fanning et al.,
1992: 174). While disarticulation for S. marcensis during
transport seems likely, the isotomously branched axes bearing
the sporangia for S. marcensis are much smaller than for S.
laidae, ranging 0.05—0.5 mm wide (Fanning et al., 1992).
In Fanning et al. (1992: fig. 35), there is a silhouette of S.
marcensis that shows a sporangium occurring on a lateral
axis below a further bifurcation, indicating in this case at
least that sporangia did not necessarily occur at approximately
the same level, as is the case with S. /aidae sp. nov. Finally,
the type species of Salopella, S. allenii possessed fusiform or
spear-shaped sporangia (Edwards and Richardson, 1974;
Morris and Edwards, 2014) — significantly different to those
of S. laidae sp. nov.
Discussion
Edwards and Richardson (1974) established Salopella based on
one Lochkovian specimen of Salopella allenii from Brown
Clee Hill, Shropshire (England); they noted its affinities to
Rhyniaceae and that S. allenii possessed axes with dimensions
that were between the range seen for Rhynia gwynne-vaughani
and R. major (= Aglaophyton majus), with sporangia similar to
both but lacking internal anatomy as seen in the Rhynie chert
specimens (Edwards et al. 2017). Various workers have
hypothesised that rhyniophytes/rhyniophytoids occupied
ephemeral ruderal terranes, such as wetlands and deltas,
whereby the rhyniophytes/rhyniophytoids completed their life
cycles over short periods (Edwards, 2003; Edwards and Davies,
1990; Morris et al., 2011; Raymond et al., 2006; Wellman et al.,
2000), possibly with some forming dense monotypic stands,
such as the well-preserved aligned axes found near a fossilised
channel from the Lower Old Red Sandstone deposits of Brecon
Beacons (Edwards and Fanning, 1985: 156). According to
Lavender and Wellman (2002), Edwards and Richardson
(2004), and Raymond et al. (2006), seasonal conditions would
have suited the short life cycles of rhyniophytes/rhyniophytoids.
The location of the Melbourne Zone c. 30? south of the equator
during the Lower Devonian (Torsvik and Cocks, 2019: fig. 9)
suggests that the terrestrial sources for these deposits were
likely also influenced by a seasonal climate, suiting the short
life cycle of rhyniophyte/rhyniophytoids.
Furthermore, Edwards and Richardson (2004), when
investigating the Lower Devonian calcrete palaeosols on the
Avalonian Terrane, proposed rhyniophytes/rhyniophytoids as
likely pioneer taxa because they were found on calcrete
palaeosols that had formed in unstable interfluvial areas, with
more advanced coeval plants, such as the zosterophylls or
lycopsids, inhabiting more stable terranes to better
accommodate their longer life cycles (Wellman et al., 2000).
According to Powell et al. (2003: 29), there was a gradual
shallowing of marine facies from the western margins of the
Melbourne Zone in the Darraweit Guim Province, and
eastward movement of the shoreline during the upper Silurian—
Lower Devonian, which may have provided similar unstable
conditions for rhyniophytes/rhyniophytoids, because
palaeocurrents at areas in Yea and Matlock indicate a west or
southwesterly source from the western parts of Victoria, which
was terrestrial at the time (Powell et al., 2003: 23). Edwards
and Davies (1990: fig. 16.3) noted the decline of rhyniophytes/
rhyniophytoids from Laurussian sites during the late Pragian
and Emsian stages of the Lower Devonian, possibly due to the
proliferation of zosterophylls early in the Devonian. It is
possible the uplift of the Tabberaberan highlands towards the
end of the Lower Devonian in Victoria (Powell et al., 2003: 32)
may have provided ideal unstable conditions for rhyniophytes/
rhyniophytoids into the Emsian but work on the palaeoflora
from the Norton Gully Sandstone Formation has been limited.
Finally, there is a noticeable difference in the number of
rhyniophyte/rhyniophytoid taxa from Yunnan, China, in what
was once part of the South China Block located at and north
of the equator during the Lower Devonian (Torsvik and
Cocks, 2019: fig. 9a), and those found in the Baragwanathia
floral assemblage. According to Hao and Xue (2013: fig. 5.3),
rhyniophytes/rhyniophytoids make up a small percentage (c.
2.1%) of the taxonomic groups found in the Posongchong
Flora. Recently, Edwards and Li (2018b) erected
Polycladophyton gracilis and Jiangyounia gengi possessing a
erade of organisation belonging to Rhyniophytina. However,
Salopella specimens have not yet been recovered (Hao and
Xue, 2013: 193), suggestive of some level of 1solation between
the two regions.
Conclusions
Defining taxa based on gross morphological characters alone
has limitations because it excludes cryptic characteristics and
likely results in one morphospecies encompassing a number
of distinct species. However, this study and the work of Tims
and Chambers (1984) has provided a morphological
framework from which new Victorian taxa may be defined,
providing an impetus for further research.
Acknowledgements
We thank Museums Victoria and especially the Vertebrate
Palaeontology manager Tim Ziegler for facilitating access to
their collection of Salopella spp., and for organising the use of
the M205 C Leica microscope to photograph specimens. Dr
Michael Garratt for his help in Yea. Mrs Peggy Laid for access
to her property on Ghin Ghin Road, Yea, and Dr J. Tims who
met with FMcS and JB on 14 March 2018. Clem Earp in
corresponding with F. McSweeney on specimens he collected in
the Yea and Alexandra. This work was supported by an
Australian Government Research Training Program Scholarship.
204
Disclosure statement
No potential conflict of interest was reported by the authors.
References
Baillie, P.W., Hills, P.B., and Banks, M.R. 1989. An outlier west of Tamar.
Geological Society of Australia Special Publication 15: 236—237.
Banks, H.P. 1975. Reclassification of Psilophyta. Taxon 24: 401—413.
Banks, H.P. 1980. Floral assemblages in the Siluro—Devonian. Pp.
1-24 in: Dilcher, D.L. and Taylor, T.N. (eds), Biostratigraphy of
fossil plants: successional and palaeoecological analyses.
Dowden, Hutchinson and Ross: Stroudsburg, PA.
Banks, M.R. 1962. The Silurian and Devonian Systems. Journal of the
Geological Society of Australia 9: 177-188.
Cai, C-Y., Dou, Y-W., and Edwards, D. 1993. New observations on a
Pridoli plant assemblage from north Xinjiang, northeast China,
with comments on its evolutionary and palaeogeographical
significance. Geological Magazine 130(2): 155-170.
Carey, S.P., and Bolger, P.F. 1995. Conodonts of disparate Lower
Devonian zones, Wilson Creek Shale, Tyers-Walhalla area,
Victoria, Australia. Alcheringa 19(1): 73—86.
Cleal, C., and Thomas, B.A. 1999. Plant fossils: the history of land
vegetation. The Boydell Press: Woodbridge, Suffolk. 188 pp.
Cookson, I.C. 1935. On plant-remains from the Silurian of Victoria,
Australia, that extend and connect floras hitherto described.
Philosophical Transactions of the Royal Society of London B
225: 127-148.
Cookson, I.C. 1937. The occurrence of fossil plants at Warrentinna,
lasmania. Papers and Proceedings of the Royal Society of
Tasmania 1936: 73—TT.
Cookson, I.C. 1949. Yeringian (Lower Devonian) plant remains from
Lilydale, Victoria, with notes on a collection from a new locality
in the Siluro-Devonian sequence. Memoirs of the National
Museum of Victoria 16: 117—131.
Couper, J. 1965. Late Silurian to Early Devonian stratigraphy of the
Yea—Molesworth District, Victoria. Proceedings of the Royal
Society of Victoria 79: 1-8.
Dou, Y.-W., and Sun, Z.-H. 1983. Devonian Plants. Pp. 561—594 in:
Paleontological atlas of Xinjiang. Vol. 2, Late Palaeozoic Section.
Geological Publishing House: Beijing (In Chinese).
Edwards, D. 1979. A late Silurian flora from the Lower Old Red
sandstone of south-west Dyfed. Palaeontology 22: 23-52.
Edwards, D. 2003. Embryophytic sporophytes in the Rhynie and
Windyfield cherts. Transactions of the Royal Society of
Edinburgh: Earth Sciences 94: 397-410.
Edwards, D., and Davies, M.S. 1990. Interpretations of early land
plant radiations: ‘facile adaptationist guesswork’ or reasoned
speculation? Pp. 351—376 in: Taylor, P.D. and Larwood, G.P. (eds),
Major Evolutionary radiations. Systematics Association Special
vol. 42. Oxford University Press: New York, NY.
Edwards, D., and Edwards, D.S. 1986. A reconsideration of the
Rhyniophytina Banks. Pp. 199—220 in: Spicer, R.A. and Thomas,
B.A. (eds), Systematic and taxonomic approaches in palaeobotany.
Systematics Association Special vol. 31. Oxford University Press:
Oxford.
Edwards, D., and Fanning, U. 1985. Evolution and environment in the
late Silurian—early Devonian: the rise of the pteridophytes.
Philosophical Transactions of the Royal Society of London B 309:
147-165.
Edwards, D., and Li, C.-S. 2018a. Diversity in affinities of plants with
lateral sporangia from the Lower Devonian of Sichuan Province,
China. Review of Palaeobotany and Palynology 258: 98—111.
F.R. McSweeney, J. Shimeta & J.S. Buckeridge
Edwards, D., and Li, C.-S. 2018b. Further insights into the Lower
Devonian terrestrial vegetation of Sichuan Province, China.
Review of Palaeobotany and Palynology 253: 37—48.
Edwards, D., and Richardson, J.B. 1974. Lower Devonian (Dittonian)
plants from the Welsh Borderland. Palaeontology 17(2): 311—324.
Edwards, D., and Richardson, J.B. 2004. Silurian and Lower Devonian
plant assemblages from the Anglo-Welsh Basin: a palaeobotanical
and palynological synthesis. Geological Journal 39: 375—402.
Edwards, D., Fanning, U., and Richardson, J.B. 1994. Lower Devonian
coalified sporangia from Shropshire: Salopella Edwards &
Richardson and Tortilicaulis Edwards. Botanical Journal of the
Linnean Society 116: 89-110.
Edwards, D., Bassett, M.G., and Rogerson, E.C.W. 1979. The earliest
vascular land plants: continuing the search for proof. Lethaia 12:
313-324.
Edwards, D., Feehan, J., and Smith, D.G. 1983. A late Wenlock flora
from Co. Tipperary, Ireland. Botanical Journal of the Linnean
Society 86: 19-36.
Edwards, D., Kenrick, P., and Dolan, L. 2017. History and
contemporary significance of the Rhynie cherts-our earliest
preserved terrestrial ecosystem. Philosophical Transactions of the
Royal Society B 373: 20160489.
Edwards, D., Morel, E., Poiré, D.G., and Cingolani, C.A. 2001. Land
plants in the Devonian Villavicencio Formation, Mendoza Province,
Argentina. Review of Palaeobotany and Palynology 116: 1—18.
Edwards, D., Yang, N., Hueber, F.M. and Li, C.-S., 2015. Additional
observations on Zosterophyllum yunnanicum Hsü from the Lower
Devonian of Yunnan, China. Review of Palaeobotany and
Palynology 221: 220—229.
Edwards, J., Olshina, A., and Slater, K.R. 1997. Nagambie and part of
Yea 1:100 000 map geological report. Geological Survey of
Victoria Report 109: 1—142.
Edwards, J., Wohlt, K.E., Slater, K.R., Olshina, A., and Hutchinson,
D.F. 1998. Heathcote and parts of Woodend and Echuca 1:100 000
map area geological report, Geological Survey of Victoria Report
108: 1-215.
Fanning, U., Edwards, D., and Richardson, J.B. 1991. A new
rhyniophytoid from the late Silurian of the Welsh Borderland.
Neues Jahrbuch fiir Geologie und Paldontologie, Abhandlungen
183(1—3): 39-47.
Fanning, U., Edwards, D., and Richardson, J.B. 1992. A diverse
assemblage of early land plants from the Lower Devonian of the
Welsh Borderland. Botanical Journal of the Linnean Society 109:
161—188.
Garratt, M.J. 1978. New evidence for a Silurian (Ludlow) age for the
earliest Baragwanathia flora. Alcheringa 2: 217—224.
Garratt, M.J., and Rickards, R.B. 1984. Graptolite biostratigraphy of
early land plants from Victoria, Australia. Proceedings of the
Yorkshire Geological Society 44(4): 377—384.
Garratt, M.J., and Rickards, R.B. 1987. Pridoli (Silurian) graptolites in
association with Baragwanathia (Lycophytina). Bulletin of the
Geological Society of Denmark 35: 135—139.
Garratt, M.J., Tims, J.D., Rickards, R.B., Chambers, T.C., and
Douglas, J.G. 1984. The appearance of Baragwanathia
(Lycophytina) 1n the Silurian. Botanical Journal of the Linnean
Society 89: 355—358.
Hao, S.-G., and Gensel, P.G. 1995. A new genus and species, Celatheca
beckii, from the Siegenian (Early Devonian) of southeast Yunnan,
China. /nternational Journal of Plant Sciences 156(6): 896—900.
Hao, S.-G., and Gensel, P.G. 1998. Some new plant finds from the
Posongchong Formation of Yunnan, and consideration of a
phytogeographic similarity between South China and Australia
during the Early Devonian. Science in China (Series D) 41(1): 1—13.
Early land plants trom the Lower Devonian of central Victoria, Australia, including a new species of Salopella 205
Hao, S.-G., and Gensel, P.G. 2001 . The Posongchong floral assemblage of
southeast Yunnan, China — diversity and disparity in Early Devonian
plant assemblages. Pp. 103-119 in: Gensel, P.G., and Edwards, D.
(eds), Plants invade the land: evolutionary and environmental
considerations. Columbia University Press: New York, NY.
Hao, S.-G., and Xue, J.-Z. 2013. The early Devonian Posongchong flora
of Yunnan — a contribution to an understanding of the evolution and
diversity of vascular plants. Science Press: Beijing. 366 pp.
Harris, W.J., and Thomas, D.E. 1941. Notes on the Silurian rocks of
the Yea district. Mining and Geological Journal 2: 302—304.
Hueber, F.M. 1983. A new species of Baragwanathia from the Sextant
Formation (Emsian), Northern Ontario, Canada. Botanical
Journal of the Linnean Society 86: 57-79.
Hueber, F.M. 1992. Thoughts on the early lycopsids and zosterophylls.
Annals of the Missouri Botanical Garden 19: 474—499.
Jaeger, H. 1966. Two late Monograptus species from Victoria,
Australia and their significance for dating the Baragwanathia
flora. Proceedings of the Royal Society of Victoria 79: 393—413.
Jaeger, H., Stein, V., and Wolfart, R. 1969. Fauna (Graptolithen,
Brachiopoden) der unterdevonischen Schwarzschiefer Nord-
Thailands. Neues Jahrbuch fiir Geologie und Paldontologie 133:
171—190 (1n German).
Lang, W.H., and Cookson, I.C. 1927. On some Early Palaeozoic plants
from Victoria, Australia. Memoirs and Proceedings of the
Manchester Literary and Philosophical Society 7\(5): 41—51.
Lang, W.H., and Cookson, I.C. 1930. Some fossil plants of early
Devonian type from the Walhalla Series, Victoria, Australia.
Philosophical Transactions of the Royal Society of London B 219:
133-166.
Lang, W.H., and Cookson, I.C. 1935. On a flora, including vascular
land plants, associated with Monograptus,1n rocks of Silurian age
from Victoria, Australia. Transactions of the Royal Society of
London B 224: 421-449.
Lenz, A.C. 2013. Early Devonian graptolites and graptolite
biostratigraphy, Arctic Islands, Canada. Canadian Journal of
Earth Sciences 50(11): 1097-1115.
Lavender, K., and Wellman, C.H. 2002. Lower Devonian spore
assemblages from the Arbuthnott Group at Canterland Den in the
Midland Valley of Scotland. Review of Palaeobotany and
Palynology 118: 157—180.
Mawson, R.,and Talent, J.A. 1994. Age of an Early Devonian carbonate
fan and isolated limestone clasts and megaclasts, East-Central
Victoria. Proceedings of the Royal Society of Victoria 106: 31—70.
McSweeney, F.R., Shimeta, J., and Buckeridge, J.S. 2020. Two new
genera of early Tracheophyta (Zosterophyllaceae) from the upper
silurian-Lower Devonian of Victoria, Australia. Alcheringa
44(3): 379-396.
McSweeney, F.R., Shimeta, J. and Buckeridge, J.S. 2021. Yarravia
oblonga Lang & Cookson, 1935 emend. from the Lower Devonian
of Victoria, Australia. Alcheringa https://doi.0rg/10.1080/0311551
8.2021.1958257
Moore, D.H., VandenBerg, A.H.M., William, C.E., and Magart,
A.P.M. 1998. Palaeozoic geology and resources of Victoria.
AGSO Journal of Australian Geology & Geophysics 17: 107—122.
Morris, J.L., and Edwards, D. 2014. An analysis of vegetational change
in the Lower Devonian: new data from the Lochkovian of the
Welsh Borderland, U.K. Review of Palaeobotany and Palynology
211: 28—54.
Morris, J.L., Wright, V.P., and Edwards, D. 2011. Siluro—Devonian
landscapes of southern Britain: the stability and nature of early
vascular plant habitats. Journal of the Geological Society, London
169: 173-190.
Nicholas, W. 1875. Report on the country between Tallarook and
Longwood. Report of Progress on the Geological Survey of Victoria
2: 118-121.
Powell, C. McA., Baillie, P.W., Conaghan, P.J., and Turner, N.J. 1993.
The mid-Palaeozoic turbiditic Mathinna Group, northeast
Tasmania. Australian Journal of Earth Sciences 40: 169—196.
Powell, C. McA., Baillie, P.W., and VandenBerg, A.H.M. 2003.
Silurian to mid-Devonian basin development of the Melbourne
Zone, Lachlan Fold Belt, southeastern Australia. Tectonophysics
375: 9-36.
Raymond, A., Gensel, P., and Stein, W.E. 2006. Phytogeography of
late Silurian macrofloras. Review of Palaeobotany and Palynology
142: 165-192.
Rickards, R.B. 2000. The age of the earliest club mosses: the Silurian
Baragwanathia flora in Victoria, Australia. Geological Magazine
137(2): 207—209.
Rickards, R.B., and Garratt, M.J. 1990. Pridoli graptolites from the
Humevale Formation at Ghin Ghin and Cheviot, Victoria, Australia.
Proceedings of the Yorkshire Geological Society 48: 41—46.
Tims, J.D. 1974. The Lower Devonian flora of the Wilson Creek
Shales. Unpublished B.Sc. (Honours) thesis, University of
Melbourne, Victoria, Australia.
Tims, J.D. 1980. The early land flora of Victoria. Unpublished PhD
thesis, University of Melbourne, Victoria, Australia. 233 pp.
Tims, J.D. and Chambers, T.C. 1984. Rhyniophytina and
Trimerophytina from the early land flora of Victoria, Australia.
Palaeontology 27(2): 265—2770.
Torsvik, T.H., and Cocks, L.R.M. 2019. The integration of
palaeomagnetism, in the geological record and mantle tomography
in location of ancient continents. Geological Magazine 156: 1-19.
Wang, D.-M., and Hao, S.-G. 2004. Bracteophyton variatum gen. et. sp.
nov., an Early Devonian plant from the Xujiachong Formation of
Yunnan, China. International Journal of Plant Science 165(2):
337—345.
Wang, D.-M., Hao, S.-G., and Liu, Z. 2002. Researches on plants from
the Lower Devonian Xujiachong Formation in the Qujing District,
Eastern Yunnan. Acta Geologica Sinica 76(A): 393—407.
Wellman, C.H., Habgood, K., Jenkins, G., and Richardson, J.B. 2000.
A new plant assemblage (microfossil and megafossil) from the
Lower Old Red Sandstone of the Anglo-Welsh Basin: its
implications for the palaeoecology of early terrestrial ecosystems.
Review of Palaeobotany and Palynology 109(3—4), 161—196.
VandenBerg, A.H.M., 1975. Definitions and descriptions of Middle
Ordovician to Middle Devonian rock units of the Warburton District
East Central Victoria. Geological Survey of Victoria Unpublished
Report 1975/6. pp. 1—52.
VandenBerg, A.H.M. 1988. Silurian—Middle Devonian. Pp. 103—141 in:
Douglas, J.G., and Ferguson, J.A., (eds), Geology of Victoria (2nd
ed). Victorian Division, Geological Society of Australia: Melbourne.
VandenBerg, A.H.M., and Gray, D.R. 1988. Melbourne Zone. Pp. 11—14
in: Douglas, J.G. and Ferguson, J.A., (eds), Geology of Victoria (2nd
ed). Victorian Division, Geological Society of Australia: Melbourne.
VandenBerg, A.H.M., Cayley, R.A., Willman, C.E., Morand, V.J.,
seymon, A.R., Osborne, C.R., Taylor, D.H., Haydon, S.J., McLean,
M., Quinn, C., Jackson, P., and Sandford, A.C. 2006. Walhalla-
Woods Point-Tallangallook, special map area geological report,
Geological Survey of Victoria Report 127. Department of Primary
Industries: Melbourne. 448 pp.