IV ... MYCOTAXON 115

MYCOTAXON

VOLUME ONE HUNDRED FIFTEEN — TABLE OF CONTENTS

COVER SECTION

RESEARCH ARTICLES

A new species of Ophiocordyceps (Clavicipitales, Ascomycota) from

southwestern China Ji-Yue Chen, Yong-Qiang Cao,

Da-Rong Yang & Ming-Hua Li

Rediscovery of Microporellus iguazuensis in southern Brazil

Mateus A. Reck, Mauro C. Westphalen & Rosa Mara B. da Silveira

A new species of Hyphodiscus (Helotiales) on Stereum

Kadri Partel & Kadri Példmaa

Chaetomium siamense sp. nov., a soil isolate from Thailand, produces

a new chaetoviridin, G Chaninun Pornsuriya,

Kasem Soytong, Supattar Poeaim, Primmala Khumkomkhet,

Fu-Cheng Lin, Hong Kai Wang & Kevin David Hyde

New taxa and new reports of Phyllospora (lichenized Ascomycotina)

from India Gaurav K. Mishra,

Dalip K. Upreti, Sanjeeva Nayaka & Biju Haridas

New records of lichenicolous and lichenized fungi: 7. More notes on

taxa from North America James C. Lendemer & Kerry Knudsen

Phyllactinia sebastianiae sp. nov. on Sebastiania brasiliensis

Maria Graciela Cabrera & Gernot Vobis

Two new species of Lyophyllum s.l. (Basidiomycota, Agaricomycetes)

from La Palma (Canary Islands, Spain)

Rose Marie Dahncke, Marco Contu & Alfredo Vizzini

Two new alectoronic acid-containing Parmotrema species from

the coast of SAo Paulo State, southeastern Brazil

Marcelo P. Marcelli, Michel N. Benatti & John A. Elix

New or noteworthy records of Caloplaca (Teloschistaceae) from Poland

Karina Wilk

Aspicilia subfarinosa, the correct name for A. substerilis

Ayhan Senkardesler & Mohammad Sohrabi

Building the jigsaw puzzle of the critically threatened Pleurotus nebrodensis:

historical collection sites and emended description

Maria Letizia Gargano, Alessandro Saitta,

Georgios I. Zervakis & Giuseppe Venturella ....

Diplotomma, Lecanora, and Xanthoria lichen species new to Turkey

Yalcin Karagéz, Ali Aslan, Kenan Yazic1 & André Aptroot

JANUARY-MARCH 2011... V

First report of Conidiobolus coronatus in Turkey

Cafer Eken, Saban Giiclit & Kibar Ak..... 121

Carbonea, Gregorella, Porpidia, Protormnicarea, Rinodina, Solenopsora,

and Thelenella lichen species new to Turkey

Kadir Kinalioglu & André Aptroot..... 125

Type studies of the Russula species described by W.A. Murrill 1.

R. roseiisabellina, R. sericella, and R. obscuriformis

Bart Buyck & Slavomir Adamé¢ik..... 131

New species and new records of Crepidotus from the northwest

region of Sao Paulo State, Brazil Marina Capelari..... 145

Pilidiella crousii sp. nov. from the northern Western Ghats, India

Kunhiraman C. Rajeshkumar, Rahul P. Hepat,

Subhash B. Gaikwad & Sanjay K. Singh..... 155

Calocera bambusicola sp. nov. and C. sinensis newly recorded.

from Taiwan Sheng-Hua Wu, Kelly Shih & Shih-Yi Yu..... 163

Stachybotrys subreniformis, new from soil in China

Qi-Rui Li & Yu-Lan Jiang. .... 171

New species of Koorchaloma and Ciliochorella from xeric forests

in Argentina Natalia Allegrucci, Lorena Eliades,

Marta Cabello & Angélica Arambarri..... 175

A new taxonomic classification for species in Gomphus sensu lato

Admir J. Giachini & Michael A. Castellano..... 183

New records of Uredinales from Fairy Meadows, Pakistan

N.S. Afshan, A.N. Khalid, A.R. Niazi & S.H. Iqbal..... 203

Observations on Melanoleuca. Type studies—3

Roberto Fontenla & Roberto Para..... 215

Coprinopsis neophlyctidospora sp. nov., a new ammonia fungus

from boreal forests in Canada Jay K. Raut, Akira Suzuki,

Toshimitsu Fukiharu, Kiminori Shimizu,

Susumu Kawamoto & Chihiro Tanaka. .... 227

Stachybotrys thaxteri sp. nov. and the nomenclatural status of

three Stachybotrys species De-Wei Li..... 239

Two new species of Phialophora from soil

Yue-Ming Wu & Tian-Yu Zhang. .... 251

Phlebiopsis mussooriensis (Agaricomycetes), a new corticioid species

from India Priyanka, G.S. Dhingra & Navneet Kaur. .... 255

Pseudocolus fusiformis, an uncommon stinkhorn new to

Turkish mycobiota Igaz Akata & Hasan Huseyin Dogan..... 259

New lichen records from Turkey — 2: Aspicilia, Protoparmeliopsis,

and Ramalina Ayhan Senkardesler & Orcgun Fuat Calba. .... 263

Tropical Trametes lactinea is widely distributed in the eastern USA

Josef Vlasak & Ji#i Kout..... 271

A new species of Nephroma (Nephromataceae) from the Tibetan

Plateau Qiong Tian, Li-Song Wang,

Hai-Ying Wang & Zun-Tian Zhao. .... 281

v1... MYCOTAXON 115

Studies in Erysiphales anamorphs (4): Species on Hydrangeaceae

and Papaveraceae Anke Schmidt & Markus Scholler

Paecilomyces wawuensis, a new species isolated from soil in China

Jin He, Jichuan Kang, Bangxing Lei & Tingchi Wen

Mycosphaerella nyssicola revisited: a species distinct from M. punctiformis

Andrew M. Minnis, Amy Y. Rossman & Richard T. Olsen

Acaulospora soloidea, a new arbuscular mycorrhizal fungus from

rhizosphere soils of Murraya paniculata

J.D. Vaingankar & B.F. Rodrigues

Conidial fungi from semi-arid Caatinga biome of Brazil.

New species and records for Thozetella Flavia Rodrigues Barbosa,

Silvana Santos da Silva, Patricia Oliveira Fiuza

& Luis Fernando Pascholati Gusmao

Chrysothrix flavovirens, Lepraria elobata, and Ochrolechia arborea

new to Portugal Sandrina Azevedo Rodrigues, Tor Tonsberg,

Arsenio Terrén-Alfonso & Amadeu M.V.M. Soares

Lichenological notes 2: Lichenothelia convexa, a poorly known

rock-inhabiting fungus Jana Kocourkova & Kerry Knudsen

Mortierellomycotina subphyl. nov., based on multi-gene genealogies

K. Hoffmann, K. Voigt & P.M. Kirk

‘Three species excluded from Melanopsamma (Ascomycetes)

You-Zhi Wang

Tubakia seoraksanensis, a new species from Korea

Hye Young Yun & Amy Y. Rossman

Two new species of Hymenochaete (Hymenochaetales) from China

Shuang-Hui He & Hai-Jiao Li

Rare or little known corticioid basidiomycetes from southern

Belarus Eugene Yurchenko & Heikki Kotiranta

Conidial morphology changes in four Phyllosticta species Jing Jin

Notes on some Japanese smut fungi. 5. Anthracoidea blepharicarpae

and A. dispalatae, spp. nov. Cvetomir M. Denchev,

Teodor T. Denchev, Muneo Michikawa & Makoto Kakishima

Notes on two species of Boletellus (Boletaceae, Boletales) from China

Nian-Kai Zeng & Zhu L. Yang

Aspergillus flavus — primary causative agent of aflatoxins

in dried figs H. Imge Oktay, Dilek Heperkan,

Emrah Yelboga & Nevin Gul Karaguler

A new species and a new record of Pyxine (Physciaceae) with

norstictic acid from Sao Paulo State, Brazil

Patricia Jungbluth, Marcelo Pinto Marcelli & Klaus Kalb

Marine fungi from Sarushima Island, Japan, with a phylogenetic

evaluation of the genus Naufragella Mohamed A. Abdel-Wahab

Paraconiothyrium babiogorense sp. nov., a new endophyte from

fir club moss Huperzia selago (Huperziaceae) Julia Budziszewska,

Wojciech Szyputa, Mateusz Wilk & Marta Wrzosek

JANUARY-MARCH 2011... VII

Additional species of Graphis from Maharashtra, India

Gayatri Chitale, Urmila Makhija & Bharati Sharma. .... 469

Septobasidium sichuanense (Septobasidiaceae) from China

Suzhen Chen & Lin Guo..... 481

Hypogymnia irregularis (Ascomycota: Parmeliaceae)—

a new species from Asia Bruce McCune..... 485

Marasmius galbinus, a new species from China

Chun-Ying Deng & Tai-Hui Li..... 495

A new Puccinia on Thymelaea from Turkey

Sevda Kirbag, M. Catherine Aime & Murat Kursat..... 501

Pucciniastrum enkianthi nom. nov., a replacement name for

PB. hakkodaense Ying-Mei Liang & Makoto Kakishima. .... 505

Morphological studies in Dothideomycetes: Elsinoe (Elsinoaceae),

Butleria, and three excluded genera

Yanmei Li, Haixia Wu, Hang Chen & Kevin D. Hyde. .... 507

BOOK REVIEWS AND NOTICES Else C. Vellinga (EDITOR)..... 521

MycoBIOTAS ONLINE

Abstracts of newly posted annotated regional species lists = 8 8 ~— ..... 534

NOMENCLATURE

Nomenclatural novelties proposedin volume 115 0 537

PUBLICATION DATE FOR VOLUME ONE HUNDRED FOURTEEN

MycorTaxon for OCTOBER-DECEMBER, VOLUME 114 (I-v1 + 1-522)

was issued on February 11, 2011

vill ... MYCOTAXON 115

REVIEWERS — VOLUME ONE HUNDRED FIFTEEN

‘The Editors express their appreciation to the following individuals who have,

prior to acceptance for publication, reviewed one or more of the papers

prepared for this volume.

M. Catherine Aime

Vladimir Antonin

Andre Aptroot

Angélica Margarita

Arambarri

Ulf Arup

Zeliha Bahcecioglu

D. Joseph Bagyaraj

Victor M. Bandala

Gerald L. Benny

Svetoslav Ganchev Bobev

Uwe Braun

Peter Buchanan

Palmira Carvalho

Rafael E Castafieda Ruiz

Wolfgang Damon

Yu-Cheng Dai

Cvetomir M. Denchev

Enrique Descals

Dennis E. Desjardin

Arve Elvebakk

Theodore L. Esslinger

Fernando Esteve-Raventdés

Lidia Itati Ferraro

André Fraiture

Alan Fryday

Ricardo Galan Marquez

Ester Gaya

Paolo Giordani

Mireia Giralt

Shouyu Guo

Ying-Lan Guo

Luis Fernando Pascholati

Gusmao

M. Gokhan Halici

Nils Hallenberg

Roy E Halling

Maria Havrylenko

Shuang-Hui He

Hsiao-Man Ho

Charles S. Hodges

Sybren de Hoog

Seppo Huhtinen

Elsad Huseyin

Kuulo Kalamees

Mitko Karadalev

Abdullah Kaya

Bryce Kendrick

Alexander Khodosovtsev

Paul M. Kirk

Fatma Nese Kok

Irmgard Krisai-Greilhuber

James C. Lendemer

De-Wei Li

Tai-Hui Li

Jun-Feng Liang

Laszlé Lékés

Robert Liicking

C. Manoharachary

Eric H.C. McKenzie

Luis C. Mejia

David W. Minter

Bertrand de Montmollin

Pierre- Arthur Moreau

Gabriel Moreno

Keiichi Motohashi

Akira Nakagiri

Karen Nakasone

Lorelei L. Norvell

Walter Obermayer

Alan Orange

Katarina Pastir¢éékova

Omar Paino Perdomo

Shaun R. Pennycook

Marcin Piatek

Mario Rajchenberg

Victor J. Rico

Peter Roberts

Andrea Irene Romero

Amy Y. Rossman

Malgorzata

Ruszkiewicz-Michalska

Vildes Maria Scussel

B.M. Sharma

John W. Sheard

Carol A. Shearer

Roger Graham Shivas

G.P. Sinha

Harrie J.M. Sipman

Matthew E. Smith

Leo Spier

Kazuaki Tanaka

Einar Timdal

Chaiwat To-anun

Matthew J. Trappe

Celal Tuncer

Kalman Vanky

Gerard J.M. Verkley

Orvo Vitikainen

Yun Wang

Stéphane Welti

Daniel Winkler

Yusuf Yanar

Zhu Liang Yang

Wen-Ying Zhuang

Mikhail Zhurbenko

JANUARY-MARCH 2011... IX

FROM THE EDITOR-IN-CHIEF

WELCOME TO MycoTaxON ONLINE! When we wrote, “Print is dead. Long live the

pixel!” a few months ago, we somehow hoped that with the end of press and postal

delays our first volume would just leap onto the website all by itself. Alas — the quantity

of editorial work remains the same, and a late MycoTaxon 114 led to an equally late

Mycotaxon 115, while we adjusted our workflow for on-line publication and revised

author instructions for what we all hope is the very last time. Although the first online

volume is late, our taxonomic insights are now accompanied by free living color. Enjoy!

COVER SECTION — We have combined the former editorial ‘front matter’ (masthead

information, table of contents, publication dates) and ‘back matter’ (reviewer list,

editorial letter, errata, submission protocols) into one free access PDF, opening now

with an original drawing chosen from among current papers and ending with our belief

that good taxonomy is vital to everyone. (Special thanks to Noni Korf Vidal for the

refurbished logo!). The author index has disappeared—no longer needed in the Google

era. The 101 new names proposed or typified in our first online edition stand in a

separate handy, free-access PDF at the end of the volume.

“WEBLISTS” ARE REGIONAL MYCOBIOTAS — When we first set up the MycoTaxon

regional annotated species list webpage, we called the posted PDFs ‘weblists’ to convey

the idea that these papers were available for free download from the Internet. However,

that term does not fully describe what these works encompass — nomenclature,

geography, ecology, substrata, and (often) brief descriptions or illustrations. Only when

revising how to submit such works for posting on our non-journal website, did I realize

that these treatments are, in fact, ‘mycobiotas’ (a term used instead of ‘mycoflora to

emphasize that fungi are Nor plants).

Obviously, Mycotaxon still publishes mycobiotas presenting original and complete

taxonomic research in its online journal. For that reason, we will continue to refer to the

less comprehensive distributional compilations as ‘weblists’ Pages 534-536 announce

six additions to our website and cites authors, titles, and abstracts for species reported

from Central America (Nicaragua, Panama), South America (Brazil), Europe (Greece,

Italy), and the Mid-East (Turkey).

OPEN ACCESs — Our cover section, book reviews, weblist abstracts, and nomenclatural

pages are freely available to anyone on the Internet, and we encourage authors to offer

their papers for immediate release by paying a $20/page open access fee. MycOTAXON

115 offers open access articles by Cabrera & Vobis (53-63), Raut & al. (227-238), D.-W.

Li (239-250), Schmidt & Schlosser (287-301), J. He & al. (303-310), S.A. Rodrigues & al.

(335-344), Y.-Z. Wang (365-368), S.-H. He & H.-J. Li (375-382), Oktay & al. (425-433),

and McCune (485-494). Special thanks are due them for showing that MycoTAxon is

well on its way to becoming a fully open access journal.

Warm regards,

LORELEI NORVELL,

Mycotaxon Editor-in-Chief

28 April 2011

xX... MYCOTAXON 115

ERRATA FROM PREVIOUS VOLUMES

VOLUME 114

p. iv, line 31 for: Gregario Delgado 231 read: Gregorio Delgado 231

p 342,page number for: no page number read: 342

p. 375, header for: Minimelanolocus chimonanthi read: Minimelanolocus chimonanthi

p- 377, line 2 for: 377-393 read: 377-392

A481, abstract, line 6 for: lividina read: fascicularia

p. 483, line 14 for: lividina Hjortstam read: fascicularia (Rick) Burds. & Nakasone

p- 517, line 31 for: 377-393 read: 377-392

JANUARY-MARCH 2011... XI

FOUR EASY STEPS TO SUCCESSFUL MYCOTAXON PUBLICATION IN 2011

Prospective Mycoraxon authors should download instructions PDF, review and

submission forms, and other helpful templates by clicking the ‘file download page’ link

on our INSTRUCTIONS TO AUTHORS page before preparing their manuscript. Below is a

summary of our simple ‘4-step’ publication process.

Step 1—PEER REviEW: Authors send a formatted text document with illustration files

and Mycotaxon Reviewer Comments Form to 2-3 experts for peer review. Authors

should (i) ask peer reviewers to Email the revised manuscripts and comment forms

to both authors and the Editor-in-Chief <editor@mycotaxon.com> and (ii) revise their

manuscript according to reviewer suggestions before submitting all text files to the

Nomenclature Editor for nomenclatural review. NEW: doi reference numbers must be

added to cited references prior to sending a manuscript out for review. (See MycoTAXON

112: 514-515.)

Step 2—NOMENCLATURAL REVIEW: Authors next Email their revised master text file

(containing footnotes, tables and captions but NO illustrations) to the Nomenclature

Editor <PennycookS@LandcareResearch.co.nz> for accession and pre-submission

review. The Email message MUST include the word ‘Mycoraxon’ on the subject line

and MUST include names and Email addresses of all peer reviewers. The Nomenclature

Editor will return annotated files with a list of needed corrections to the authors and

Editor-in-Chief.

Step 3—FINAL SUBMISSION: After authors receive their manuscript accession number

and make revisions requested during nomenclatural review, they should send (i) a

completed Mycotaxon submission form; (ii) separate text files for main text, tables,

and legends; and (iii) art files to the Editor-in-Chief <editor@mycotaxon.com>. Only

text and image files considered ready for immediate publication should be sent at this

time. The Editor-in-Chief will try to acknowledge receipt of files within two weeks.

Authors are asked to wait at least 14 days before sending a follow-up query (without

attachments) to avoid unnecessary Email traffic near publication deadlines or during

temporary closures of the editorial office.

Step 4—PRESS PREPARATION: After preparing a PDF from the author’s text and art files,

the Editor-in-Chief sends journal entries for the nomenclatural novelties with the PDF

proof to all coauthors for approval. Editorial errors are always corrected free of charge,

but authors who ask the Editor-in-Chief to correct errors present in their original files

will be charged $10 per correction (minimum charge of $40). Payment arrangements for

all fees should be made by writing the Business Manager <subscriptions@mycotaxon.

com>.

MycorTaxon frequently updates its webpages where we regularly post abstracts, table

of contents, book reviews, indices, important announcements, and revised instructions

and forms. We invite everyone to browse both the official MycoTaxon site download

distributional weblists (regional mycobiotas) and the MycoTaxon ONLINE journal site

via the two urs below:

MYCOTAXON LTD: www.mycotaxon.com

MYCOTAXON ONLINE: www.ingentaconnect.com/content/mtax/mt

MYCOTAXON

Volume 115, pp. 1-4 January-March 2011

DOT: 10.5248/115.1

Anew species of Ophiocordyceps (Clavicipitales, Ascomycota)

from southwestern China

Ji- Yur CHEN", YONG-QIANG Cao!, Da-RonG YANG" & Minc-Hva Lr’

*Key Laboratory of Tropical Forest Ecology, Xishuangbannan Tropical Botanical Garden,

Chinese Academy of Sciences, Kunming 650223, Yunnan, China

?Kunming Institute of Zoology, Chinese Academy of Sciences,

Kunming 650223, Yunnan, China

*CORRESPONDENCE TO: chenjy@xtbg.ac.cn, yangdr@xtbg.ac.cn

ABsTRACT — Anew species of caterpillar fungus, Ophiocordyceps laojunshanensis, is described

based on specimens collected from southwestern China. This species is characterized by

slender stromata, sparse perithecia, and the unique habitat of growing in mosses. Its habitat,

gross morphology, and microscopic features are illustrated and relationships to similar

species discussed.

Key worps —Cordyceps, Ophiocordyceps sinensis, Ophiocordycipitaceae, taxonomy

Introduction

The genus Cordyceps includes over 400 species, of which 120 species have

been reported in China (Liang 2007). Although the genus was formerly classified

in the Clavicipitaceae, based on recent results of the multi-gene phylogeny of

Cordyceps sensu lato, the taxonomy of both Cordyceps and the Clavicipitaceae

has been revised.

A new family Ophiocordycipitaceae has been proposed based on the

genus Ophiocordyceps Petch, which has been emended by Sung et al. (2007).

Ophiocordyceps is now characterized by stromata that are darkly (or rarely

brightly coloured) pigmented, tough, fibrous, pliant to wiry and rarely fleshy,

often with aperithecial apices or lateral pads, perithecia that are superficial to

completely immersed and arranged ordinally or obliquely (Sung et al. 2007).

In the past three years, the authors undertook numerous mycological

explorations to mountainous Northern Yunnan, where they collected many

specimens of caterpillar fungi that grow among mosses and have morphological

features that do not correspond to any previously described taxa. One new

species, Ophiocordyceps laojunshanensis, is described and illustrated in this

paper.

2... Chen & al.

Materials & methods

Field notes were taken for gross morphology of fresh ascomata and habitat. Detailed

macroscopic features were examined under a stereomicroscope (Carl Zeiss Discovery

12). Microscopic examination of ascomata and measurements of microscopic structures

were made from freehand sections under a microscope (Olympus 520). The sections

were mounted in 5% aqueous KOH and then Cotton-blue lactophenol. The holotype of

Ophiocordyceps laojunshanensis was deposited in the Cryptogamic Herbarium, Kunming

Institute of Botany, Chinese Academy of Sciences (KUN-HKAS 57066). Isolates from

fresh ascomata of O. laojunshanensis were maintained on potato dextrose agar with 1%

peptone (PPDA) using techniques described by Liu et al (1989), all isolates were kept in

Key Laboratory of Tropical Forest Ecology, Xishuangbannan Tropical Botanical Garden,

Chinese Academy of Sciences (No. laol-lao20).

Taxonomy

Ophiocordyceps laojunshanensis J.Y. Chen, Y.Q. Cao & D.R. Yang, sp. nov. Fig. 1

MycoBank MB 517206

Stromatibus clavatis, singularibus, 47.0-93.0 mm longis, 1.0-3.9 mm crassis. Capitulis

cylindricis, 8.5-17.0 mm longis, prophyro—brunneis vel atro—brunneis, apis acerosis

sterilibus 3.5-8.0 mm longis. Perithecia globosa, 200-300 x 200-350 jum; Stipitibus, 25.0-

72.0 mm longis; Asci clavuli, cylindraci, 165-275 x 11.5-14.5 um. Ascosporis hyalinis,

filiformis, multiseptatis, 130-250 x 5.0-6.0 um.

Type: China: Yunnan Province, Lijiang Naxi Autonomous Prefecture, Laojunshan

mountain, 26°37°33.76N 99°42’58.07E, alt. 3974 m; under Rhododendron mariae Hance;

associated with Oncophorus wahlenbergii Brid. and Pleurozium schreberi (Brid.) Mitt., 8

May 2009, Ji-yue Chen 09032.(HOLOTYPE: KUN-HKAS 57066).

ErymMo.oey: The epithet refers to the type locality, Laojunshan Mountain

Stromata clavate, slender, simple, rarely 2 or 3 from host head, rarely 1 from

host head and another from the terminal region, 47.0-93.0 mm long, 1.0-3.9

mm in diam. Ascogenous portion almost 1/5 to 1/3 of the stromata length,

cylindrical, 8.5-17.0 mm long, purplish to dark brown. Apex sterile acuminate,

3,5-8.0 mm long. Perithecia, globoid, 200-300 x 200-350 tum. arranged loosely

in irregular lateral cushions. Stipe 25.0-72.0 mm long. Asci clavate, 165.0-275.0

x 11.5-14.5 um. Ascospores hyaline, filiform, septate, 130.0-250.0 x 5.0-6.0

um (Fic. laf).

Colonies (F 1c. 1g-l) grew very slowly, only up to 6-10 mm in diameter

after 2 months on PPDA at 16°C. They were white at first, then became

brown-yellow or black brown, and sparse white mycelia emerged 3 month

later, with conidiophore and conidia, reverse blackish brown. Conidiophore,

hyaline, branching or non-branching; conidiogenous cell phialidic, hyaline,

with verrucose, acerate, 15-39(-50) um long; Conidia, hyaline, long elliptic,

6.0-13.5 x 3.0-4.0 um, one or two encased in a mucus drop.

Host: Larvae of Thitarodes yunnanensis Nielsen et al. (Hepialus yunnanensis

Yang et al.)

Ophiocordyceps laojunshanensis sp. nov. (China) ... 3

“gz

ae’.

Fic 1. Ophiocordyceps laojunshanensis—a. habitat; b. fresh fruiting body; c. dry fruiting bodies;

d. ascogenous portion, bar = 2 mm; e. ascus with ascospore, bar = 20 um; f. ascus tip, bar = 20

um; g—h. culture (bar = 5 mm): g. surface, h. reverse; i. colonies, bar = 20 mm; j. conidiophore and

conidia, bar = 20 um; k. conidiophore (detail), bar = 25 um; |. conidia (detail), bar = 10 um.

ADDITIONAL SPECIMENS EXAMINED: CHINA: YUNNAN PROVINCE, Lijiang Naxi

Autonomous Prefecture, Laojunshan mountain, 26°37'03.98N 99°42°18.02E to

26°37°82.71N 99°42797.86E, alt. 3874-4075 m. Under Abies delavayi Franch and

Rhododendron mariae Hance. Associated with Oncophorus wahlenbergii Brid., Dicranum

muehlenbeckii Bruch & Schimp. or Pleurozium schreberi (Brid.) Mitt., 8 May 2009, Ji-yue

Chen 09033-09035.

Discussion: Ophiocordyceps laojunshanensis is characterized by slender

stromata, sparse perithecia, and its unique habitat of growing among mosses.

It strongly resembles the most precious caterpillar fungus, O. sinensis (Berk.)

G.H. Sung et al., and is often sold together with that fungus. The two species

could be living in the same host larvae, except that O. laojunshanensis is found

most often growing among mosses, while O. sinensis appears to grow more

frequently in grasslands. Morphologically, O. laojunshanensis differs from O.

sinensis by having a slimmer stroma with a shorter ascogenous portion and

relatively sparse irregular perithecia compared to the close ordered perithecia

found in O. sinensis.

A... Chen & al.

Acknowledgments

The authors would like to thank Prof. Mu Zang (Kunming Institute of Botany,

Chinese Academy of Sciences) for his valuable suggestions and discussion. They also

give thanks to Dr. Yun Wang (Plant & Food Research, New Zealand) and Mr. Daniel

Winkler (MushRoaming, USA) for serving as pre-submission reviewers, Dr. Nicholas

Cummings (Plant & Food Research, New Zealand) for reviewing English, Prof. X.J. Li

(Kunming Institute of Botany, Chinese Academy of Sciences) for identifying the moss

species. This study was supported by the Knowledge Innovation Program of the Chinese

Academy of Sciences Project (No. KSCX2-Y W-G-024), the Natural Science Foundation

of Yunnan (No. 2007C105M), and West doctor Project of West Light Foundation of The

Chinese Academy of Sciences.

Literature cited

Liang ZQ. 2007. Cordyceps, Flora Fungorum Sinicorum. Science Press, Beijing. 32: 1-190.

Liu XJ, Guo YL, Yu YX, Zeng W. 1989. Isolation and identification of the anamorphic stage of

Cordyceps sinensis (Berk.) Sacc. Acata Mycologica Sinica 8: 35-40.

Sung GH, Hywel-Jones NL, Sung JM, Luangsa—aard J, Shrestha B, Spatafora JW. 2007. Phylogenetic

classification of Cordyceps and the clavicipitaceous fungi. Studies in Mycology 57: 5-59.

doi:10.3114/sim.2007.57.01

MYCOTAXON

Volume 115, pp. 5-10 January-March 2011

DOT: 10.5248/115.5

Rediscovery of Microporellus iguazuensis

in southern Brazil

Mateus A. REcK, Mauro C. WESTPHALEN

& RosA MARA BORGES DA SILVEIRA

Universidade Federal do Rio Grande do Sul, Departamento de Boténica

Ay. Bento Goncalves, 9500, 91501-970, Porto Alegre, RS, BRAZIL

CORRESPONDENCE TO: mateus_reck@yahoo.com.br

Asstract — Microporellus iguazuensis is redescribed from the southern Atlantic rainforest

of Brazil 23 years after its original description. The species is characterized by stipitate

basidiomata, smooth ellipsoid basidiospores, simple-septate generative hyphae, dextrinoid

skeletal hyphae, and a root-parasite habit. In the present work this noteworthy polypore is

described, illustrated and its taxonomy discussed.

Key worps — Polyporaceae, Basidiomycota, neotropical fungi

Introduction

The genus Microporellus Murrill comprises about 19 accepted species

worldwide with a predominantly tropical distribution (Kirk et al. 2008).

Microporellus was originally described as a segregate from the also tropical

genus Microporus P. Beauv., which presents a trimitic hyphal system and

coralloid dichophytic elements along the dissepiments (Ryvarden & Johansen

1980), features lacking in Microporellus. The taxonomic concept of the genus

(Decock 2007) includes pileate species with a dimitic hyphal system and, mostly,

dextrinoid skeletal hyphae and subglobose spores. The following species are

known from Brazil: M. brasiliensis Ryvarden & Decock (Decock & Ryvarden

2002), M. dealbatus (Berk. & M.A. Curtis) Murrill (Loguercio-Leite & Wright

1991), M. obovatus (Jungh.) Ryvarden (Rajchenberg & Meijer 1990), and

M. terrestris (Gibertoni & Ryvarden) Decock (Decock 2007).

In the present paper, we report the occurrence of a rare and poorly known

Microporellus species that was collected during polypore surveys in the Atlantic

rainforest. This ecosystem is located throughout most of the Brazilian Atlantic

coast from the northeast to the south, covering the lower eastern slopes of the

6 ... Reck, Westphalen & Silveira

mountain ranges (Morellato & Haddad 2000). It experiences a warm climate

with abundant rainfall and, as one of the world’s most endangered forests, is

considered a hotspot worthy of conservation and research (Mittermeier et al.

2005).

Materials & methods

Basidiomes were collected between March 2007 and March 2009 in the northeast

region of Rio Grande do Sul State, southern Brazil. Macro- and microscopical analyses

followed usual polypore protocols (Nutiez & Ryvarden 2001). Microscopic examinations

were made from freehand sections mounted in a drop of 5% KOH solution and 1%

phloxine solution; amyloid or dextrinoid reactions were observed in Melzer’s reagent.

The cyanophilous reaction was observed in cotton blue. Abbreviations follow Coelho

(2005): Dm = diameter mean, Lm x Wm = means of length and width, Q = range

of length/width ratios, Qm = length/width mean, and n = x/y, with x = number of

measurements from y = number of specimens. Color names and codes follow Kornerup

& Wanscher (1978). All the specimens are preserved at the ICN Herbarium (UFRGS).

Taxonomy

Microporellus iguazuensis Rajchenb., Mycotaxon 28: 111, 1987. Figs 1-8

SPECIMENS EXAMINED: BRAZIL. Rio Grande do Sul State, Dom Pedro de Alcantara,

RPPN Mata do Professor Baptista, 27.III.2007, leg. M.A. Reck 035/07 (ICN 139893);

Porto Alegre, Refugio da vida Silvestre Morro Santana, 30.11.2007, leg. M.C. Westphalen

003/07 (ICN 154057); leg. M.C. Westphalen 006/07 (ICN154060); 13.III.2009, leg.

M.A.Reck 004/09 (ICN154263).

Basidiomes annual, lateral to eccentrically stipitate, coriaceous and flexible

when fresh, corky and rigid upon drying. Pileus up to 6.0 x 4.0 cm, flabellate-

spathulate, with fusions between one or more parts of them, margin regular,

some incurved upon drying; upper surface glabrous to slightly velutinate,

zonate in shades of orange red (8.B7) and pastel red (8.A4), becoming pale upon

drying, dull red (8.C3) with reddish brown zones (9.E6); stipe erect, lateral to

eccentric, velutinate, light brown (7.D8), dark brown (8.F7) upon drying, up to

6.0 cm long and 5.0 mm wide; pore surface orange grey (5.B2; 6.B2) to greyish

orange (5.B3), pores irregular, round to angular, 1-2/mm, shallow, up to 1 mm

deep, decurrent on the stipe and, then, becoming daedaloid, dissepiments thick,

entire; margin sterile, context very thin, concolorous with the pore surface, up

to 2.5 mm.

Hyphal system dimitic, Generative hyphae simple septate, 2.5-5.0 um wide,

hyaline, in the trama Dm = 3.5, in the context Dm = 3.85, thin to slightly

thick-walled, rarely branched, in the stipe Dm = 3.73, pale yellow to brown,

with some branches; skeletal hyphae 3.5-7.5 um wide, unbranched, thick-

walled, with wide lumen, dextrinoid (strongly dextrinoid when seen in mass),

hyaline to pale cinnamon, in the trama Dm = 4.64, in the context Dm = 5.24

Microporellus iguazuensis new to Brazil ... 7

Fics. 1-2. Basidiome of Microporellus iguazuensis (ICN 154263)

1. Connected to roots of Ocotea indecora, showing the hymenophore. 2. Upper surface.

and parallel, in the stipe Dm = 5.11, pale yellow to rusty brown (all hyphae

measurements n = 100/2). Cystidia lacking, but fusoid cystidioles can be found

in the dissepiment edges. Basidia clavate 25.0-35.0 x 9.0-10.0 um, tetraspored,

with long sterigmata. Basidiospores broadly ellipsoid to ellipsoid, obovate,

asymmetric in side view, smooth and hyaline, thin- to slightly thick-walled,

generally with one big oil drop or a sparse oily content, IKI-, acyanophilous,

7.5-9.0 x 5.5-6.5 um, Lm x Wm = 8.08 x 5.99, Q = 1.23-1.60, Qm = 1.35,

n= 100/2.

CuLTuRE: Unknown. Attempts to obtain cultures from the context and spore

print, using Malt Extract and Potato Dextrose Agars, were unsuccessful.

SupsTRATA: Found on the ground among the litter, but connected to roots

of living trees of Ocotea indecora (Schott) Mez (Lauraceae). Type of rot

unknown.

DisTRIBUTION: Previously known only from the type locality, in the forest of

Iguazu National Park, in NE Argentina (Rajchenberg 1987), and now found

in the Rio Grande do Sul state, southern Brazil, in two different sites of the

Atlantic rainforest. If the species follows the host distribution, it could be

widely distributed in forest systems where O. indecora (or perhaps other related

species of Ocotea Aubl.) occur. In Brazil, O. indecora is distributed from Bahia

to Rio Grande do Sul states (Sobral et al. 2006).

8 ... Reck, Westphalen & Silveira

Fics. 3-8. Microporellus iguazuensis (ICN 139893).

3. Cystidioles from dissepiment edges. 4. Basidiospores. 5. Basidia.

6. Generative hyphae from trama and context. 7. Skeletal hyphae. 8. Generative hyphae from stipe.

ADDITIONAL SPECIMEN EXAMINED: ARGENTINA. Misiones, Parque Nacional Iguazu,

ad viam Apept, 08.III.1980, leg. J.E. Wright M-3379 (BAFC 30708 holotype).

Remarks: Microporellus iguazuensis is an interesting polypore distinguished

by its lateral to eccentric stipitate basidiome with flabelliform pileus and

irregular large pores decurrent on the stipe. Microscopically it is characterized

by a dimitic hyphal system with simple septate generative hyphae and strongly

dextrinoid skeletal hyphae, large basidia, and ellipsoid to obovate basidiospores.

Moreover, it presents a parasitic habit, growing on living roots of laurel trees

Microporellus iguazuensis new to Brazil ... 9

(Fic. 1). Macroscopically, M. iguazuensis can be confused with some species

of Polyporus P. Micheli ex Adans. that present a dark stipe and large pores (like

P. guianensis Mont.). However, Polyporus species differ microscopically by

clamped generative and non-dextrinoid skeleto-binding hyphae.

Heterobasidion annosum (Fr.) Bref., an important root-rot pathogen of

conifers, also presents a dimitic hyphal system with simple septate generative

and dextrinoid skeletal hyphae but, in contrast with M. iguazuensis, has sessile

basidiomes and minutely echinulate basidiospores (Gilbertson & Ryvarden

1986).

Decock (2007) cited the main morphological features of Microporellus as

follows: light-weight pileate basidiomata possessing a white to pale cream

context and trama, a dimitic hyphal system with unbranched skeletal hyphae,

non- to dextrinoid vegetative hyphae, and slightly thick-walled spores with

cyanophilous walls, generally containing an oil drop. Microporellus iguazuensis

fits in this circumscription in some characters states, but it is the only species of

the genus that combines simple septate generative hyphae, dextrinoid skeletal

hyphae and a phytopathogenic habit. Most Microporellus species, including the

type species, also present ventricose and thick-walled cystidia (Decock 2007), a

feature absent in M. iguazuensis.

The unique combination of features in M. iguazuensis suggests that it should

not be included in either Microporellus or Heterobasidion Bref., but perhaps

represents a distinct genus. However, we think that these morphological data

are not distinct enough to circumscribe a new genus to accommodate this

species; further studies are necessary, including cultural characteristics and

molecular data. Our attempts to obtain cultures from the context and spore

print, using MEA and PDA, were not successful. Maybe further attempts using

other media will succeed in initiating mycelial growth.

Acknowledgements

The authors thank Dr. Karen Nakasone (USDA, USA) and Dr. Mario Rajchenberg

(CIEFAP, Argentina) for the critical revision. Martin Grings (UFRGS, Brazil) and Dr.

Vagner Cortez (UFPR, Brazil) are acknowledged for botanic identifications and valuable

suggestions, respectively. CAPES and CNPq (Brazil) are acknowledged for financial

support.

Literature cited

Coelho G. 2005. A Brazilian new species of Auriporia. Mycologia 97: 266-270. doi: 10.3852/

mycologia.97.1.263

Decock C. 2007. On the genus Microporellus with two new species and one recombination

(M. papuensis spec.nov., M. adextrinoideus spec. nov., and M. terrestris comb. nov.). Czech

Mycol. 59: 153-170.

Decock C, Ryvarden L. 2002. Two undescribed Microporellus species and notes on M. clemensiae,

M. setigerus, and M. subincarnatus. Czech Mycol. 54: 19-30.

10 ... Reck, Westphalen & Silveira

Gilbertson RL, Ryvarden L. 1986. North American polypores. Vol. 1. Abortiporus—Lindtneria. Oslo

(Norway): Fungiflora. 433 p.

Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth and Bisby’s dictionary of the fungi.

10® ed. Wallingford (UK): CABI. 771 p.

Kornerup A, Wanscher JH. 1978. Methuen handbook of colour. 3 ed. London (UK): Eyre

Methuen.

Loguercio-Leite C, Wright JE. 1991. Contribution to a biogeographical study of the austro-american

xylophilous polypores (Aphyllophorales) from Santa Catarina Island, SC., Brazil. Mycotaxon 41:

161-166.

Mittermeier RA, Gil PR, Hoffman M, Pilgrim J, Brooks T, Mittermeier CG, Lamoreux J, Fonseca

ABG. 2005. Hotspots revisited: Earth’s biologically richest and most endangered terrestrial

ecoregions. Chicago (USA): University of Chicago Press. 392 p.

Morellato LPC, Haddad CEB. 2000. Introduction: the Brazilian Atlantic Forest. Biotropica 32:

786-792. doi: 10.1111/j.1744-7429.2000.tb00618.x

Nufiez M, Ryvarden L. 2001. East Asian polypores. Oslo (Norway): Fungiflora. 168 p.

Rajchenberg M. 1987. New South American Polypores. Mycotaxon 28: 111-118.

Rajchenberg M, Meijer AAR. 1990. New and noteworthy polypores from Parana and Sao Paulo

Sates, Brazil. Mycotaxon 38: 173-185.

Ryvarden L, Johansen I. 1980. A preliminary polypore flora of East Africa. Oslo (Norway):

Fungiflora. 636 p.

Sobral M, Jarenkow JA, Brack P, Irgang I, Larocca J, Rodrigues RS. 2006. Flora arbérea e arborescente

do Rio Grande do Sul, Brasil. Sao Carlos/Porto Alegre (Brazil): RiMa/Novo Ambiente. 350 p.

MYCOTAXON

Volume 115, pp. 11-17 January-March 2011

DOT: 10.5248/115.11

A new species of Hyphodiscus (Helotiales) on Stereum

KADRI PARTEL'® & KADRI POLDMAA*

‘Department of Botany, Institute of Ecology and Earth Sciences, University of Tartu

Lai 40, EE-51005, Tartu, Estonia

*Mycological Herbarium, Institute of Agricultural and Environmental Sciences,

Estonian University of Life Sciences, Riia 181, EE-51014 Tartu, Estonia

*CORRESPONDING AUTHOR: kadri.partel@ut.ee

ApsTRAcT — A new species, Hyphodiscus stereicola, is described based on material from

Northern Europe, the Canary Islands, and North America. In all of these, greenish apothecia

grew on decayed basidiomata of Stereum spp. Morphology and host specialisation of the new

species are compared with those of other members of the genus.

Key worps — fungicolous ascomycetes, rDNA, taxonomy

Introduction

Hyphodiscus is a genus in the order Helotiales characterised by hairy

apothecia that are formed on dead, often decorticated, deciduous or coniferous

wood. Several species occur on decaying fruitbodies of polypores and corticioid

fungi.

Several years ago a light glaucous fungus was found on old basidiomata

of Stereum in Mexico. The material was sent for identification to the late Ain

Raitviir (Tartu, Estonia), who made some hand-written remarks about the

delimitation of this fungicolous species as a member of the genus Hyphodiscus.

Soon a similar specimen was collected in Northern Europe, from Estonia. In

autumn 2008, additional material was found from La Gomera (Canary Islands)

and Estonia. All four collections are similar in their morphology and host. As

these represent a unique combination of characters in the genus Hyphodiscus, a

new species will be described herein.

Materials & methods

Living ascomata were studied in tap water, 3% aqueous KOH solution, Melzer’s reagent

(MLZ) and Lugol’s solution (LUG). Microphotos and measurements of microscopical

elements were taken from living cells of unsquashed freehand sections under cover

12 ... Partel & Példmaa

glasses. The colour names and codes were adopted from Kornerup & Wanscher (1967).

DNA was extracted and the ribosomal DNA ITS regions and 5’ end of the large subunit

amplified and sequenced according to the protocol described by Példmaa (2011). The

primers ITS1F and LR5 were used for PCR and sequencing. The holotype of the new

species is deposited in the mycological herbarium of the Natural History Museum of the

University of Tartu (TU). The DNA sequences were deposited to EMBL and the UNITE

database (Kéljalg et al. 2005).

Taxonomy

Hyphodiscus stereicola Raitv., Partel & K. Poldmaa, sp. nov. PLATE 1

MycoBank MB 518733

Apothecia gregaria, subsessilia, cupulata, 300-600 ym diametro, margine piloso,

viridi-albo, disco olivaceo. Pili cylidracei, obtusi, incrustati, septati, 31-62 x 2-2.8 ym.

Excipulum ectale gelatinosum, cellulis venetis; medulla textura intricata composita,

brunneolo-aurantiaca. Asci cylindraceo-clavati, octospori, 37-47 x 5-6 um longi, basi

uncinati, poris in solutione iodi non coloratis. Ascosporae hyalinae, ellipsoideae, apicibus

obtusis, biguttulatae, 7.6-11.5 x 2.6-4 um. Paraphyses filiformes, 1.5-2 um in diametro.

Fungicolae ad basidiomata Stereumorum.

HoLotype — ESTONIA. JécEva Co., Puurmani Community, Alam-Pedja Nature

Reserve, ca 50 m SW from the beginning of the Kirna hiking trail, mixed forest

with dominant Populus tremula, 58.544°N, 26.233°E, on decaying basidiomata of

Stereum subtomentosum Pouzar, 8 Oct 2008, leg. Kadri Példmaa, TU 104241 [EMBL

FN995636].

EryMoLocy — named after the host genus.

EcoLoey — fungicolous, growing on old basidiomata of Stereum spp.

APOTHECIA densely gregarious, subsessile to shortly stipitate. Disc almost flat

to slightly depressed, 300-600 um in diameter, olivaceous (1E5), RECEPTACLE

at first deeply cup-shaped, later saucer-shaped, externally and at the margin

with numerous greenish-white (25A2-3) hairs. Ectal excipulum composed

of gelatinous, more or less parallel, slightly interwoven, bluish-green (25B7)

pigmented cells terminating above the surface into cylindrical hairs (10-19 x

2-2.2 um). Medullary excipulum brownish-orange (5C6), of textura intricata.

Hairs greyish green (30C3), mostly straight, cylindrical, slightly pointed, thin-

walled, 0-3-septate, 31-62 x 2-2.8 um, without iodine reaction; wall (except the

base) covered with loose irregular-tuberculate greyish green warts. Pigment in

excipulum and hair walls dissolving in KOH, apothecia extracting pale yellow

hue into KOH solution. Asci arising from croziers, 8-spored, cylindric-clavate,

conically pointed at apex, apical pore not staining in Lugol's or Melzer's reagent

(with or without KOH pretreatment), 37-47 x 5-6 um. Ascosporss ellipsoid

with obtuse apices, hyaline, smooth, biguttulate (one lipid body at each end,

1-2.8 um in diameter), aseptate, biseriate or irregularly seriate in asci, 7.6-11.5

x 2.6-4 um. Parapuyses filiform, with 2-3 septa, not exceeding the asci,

approximately as long as the asci, 1.5-2 um in diameter, filled with fine green

Hyphodiscus stereicola sp. nov. on Stereum ... 13

PLATE 1. Hyphodiscus stereicola. a, b. apothecia; c. paraphyses; d. asci; e. asci (in Melzer’s);

f. Hairs and upper part of excipulum; g. ascospores; h. ectal excipulum; i. medullary excipulum;

(a-d, f, g,i= holotype); e, h = TU 104272. All microscopical subjects (except e) were mounted in

water. Scale bars: a = 500 um; b = 300 um; c-e, g = 5 um; f, h, i = 10 um.

14... Partel & Példmaa

vacuolar bodies, simple or branched only at the base, gradually sligthly tapering

towards the apex.

ADDITIONAL SPECIMENS EXAMINED: ESTONIA. PARNU Co., Saarde Community, W

of Reinu, Nigula Nature Reserve, Picea abies nemoral forest, 58.04183°N, 24.72383°E,

on dead basidiomata of Stereum subtomentosum, 26 Aug 2003, leg. I. Parmasto, TAAM

181316. MEXICO. Cuinuanua, Sierra Madre Occidental, Cascada de Basaseachi,

above the left riverbank at the bottom of the waterfall, 28.16944°N, 108.20694°W, alt. ca

1650 m, in mixed forest, on dead basidiomata of Stereum ostrea (Blume & T. Nees) Fr., 24

Jul 1994, leg. J. Hafellner 38772, TAAM 200599. SPAIN. Canary IsLanps. La Gomera,

Garajonay National Park, near El Cedro, in laurel forest, 28.13090°N, 17.21319°W, alt ca

800 m, on dead basidiomata of Stereum ostrea, 2 Dec 2008, leg. K. Példmaa; TU 107690

[EMBL FR686966]; leg. K. Partel, TU 104272.

ComMENTS. Hyphodiscus stereicola clearly differs from other species in the

genus due to a unique combination of characters: olivaceous disc, greyish green

hairs, and the comparatively large ellipsoidal ascospores. Characteristic of the

species is also its fungicolous habit and specialization to old basidiomata of

Stereum.

It is similar to H. viridipilosus (Graddon) Baral which also has green hairs

and ellipsoidal ascospores. ‘This species, growing on deciduous wood, is

characterized by an ochraceus apothecial disc (Graddon 1974, Baral 1993). The

asci and ascospores are smaller (ca 3-4 x 1.5-2 um) than in H. stereicola. There

are several yet undescribed species shown in Hans Otto Baral’s detailed drawings

(Baral & Marson 2005), none of which seems to resemble H. stereicola.

Hyphodiscus stereicola reveals substrate specificity, as all the specimens have

been collected on Stereum spp. Found either on the pileus or on the hymenium,

it appears to prefer decaying basidiomata. In the two collections from boreal

forests in Estonia the host is S. subtomentosum. ‘The morphologically very

similar species, S. ostrea having a southern distribution, serves as the host for

the other specimens, collected in Mexico and the Canary Islands. In Estonia

and La Gomera the collection habitats represent primeval forests with many

fallen rotting trunks.

Although the fungicolous lifestyle is rare among the Helotiales, members of

Hyphodiscus tend to grow on fruitbodies of basidiomycetes. The most common

of these, H. hymeniophilus (P. Karst.) Baral, grows on decaying basidiomata of

Antrodia serialis (Fr.) Donk, Antrodiella hoehnelii (Bres.) Niemela, Piptoporus

betulinus (Bull.) P. Karst., Polyporus varius (Pers.) Fr. and Trametes versicolor (L.)

Lloyd (Helfer 1991). Clavidisculum stereicola (Cooke) Raitv., later synonymised

with H. hymeniophilus by Raitviir (2004), was reported to grow on Stereum sp.

(Raitviir 1970).

In addition, H. theiodeus (Cooke & Ellis) W.Y. Zhuang occurs on Peniophora

spp. (Zhuang 1988) and other wood-decaying basidiomycetes, while

H. incrustatus (Ellis) Raitv. has been found on old Polyporus spp. (Raitviir

Hyphodiscus stereicola sp. nov. on Stereum ... 15

2004). Hosoya et al. (2010) speculated that fungicolous association might

stimulate formation of ascomata in the whole genus, as suggested by the

frequent observation of other fungi near Hyphodiscus fruitbodies.

Hyphodiscus stereicola is one of the few species of apothecial ascomycetes

that is found on basidiomata of species of Stereum. At the same time members

of this basidiomycete genus serve as hosts to a number of representatives of the

Hypocreales, the ascomycete order richest in fungicolous associations. Besides

several species of Hypomyces (Példmaa 2003, Rogerson & Samuels 1993) and

Sphaerostilbella, these include also Nectriopsis oropensoides (Rehm) Samuels.

Despite the overall low host-specificity of members of these fungicolous genera

growing on aphyllophoroid basidiomycetes (Példmaa 2000, Rogerson &

Samuels 1993), the majority of the species inhabiting Stereum are found only on

basidiomata of this genus. The annual, dimitic, comparatively soft basidiomata

apparently provide a specific niche, in contrast to the mostly perennial, di- or

trimitic, tough basidiomata of many aphyllophoroid genera which host other

fungicolous ascomycetes, including Hyphodiscus. Such specialisation could also

be explained by the phylogenetic component as the genus Stereum (Russulales)

is not closely related to most of the other aphyllophoroid genera distributed

across the Agaricomycetes.

The asexual stages of Hyphodiscus species have been described in the

anamorph genus Catenulifera: C. rhodogena (EF Mangenot) Hosoya for

H. hymeniophilus and unnamed Catenulifera spp. for H. pinastri R. Galan &

Raitv., H. theiodeus, and H. otanii Hosoya (Galan & Raitviir 2004, Hosoya

2002). Our attempts to isolate the most recent collections into pure culture

were not successful.

The genus Hyphodiscus has been accepted as a member of Hyaloscyphaceae

by most authors (Verkley 1993, 1996; Hosoya 2002; Raitviir 2004, Hosoya et

al. 2010) with unclear affinities based on rDNA sequences (Untereiner et al.

2006, Bogale et al. 2010). However, rDNA ITS and SSU sequences reveal that

H. hymeniophilus is related to members of Hyaloscyphaceae and Dermateaceae

but also to anamorphic helotialean root endophytes like Phialocephala

(Vibrisseaceae) (Untereiner et al. 2006, Bogale et al. 2010). The true phylogenetic

relationships of Hyphodiscus species are currently being clarified (R. Galan pers.

comm.). The rDNA ITS region of the two Estonian specimens of H. stereicola

were identical, whereas that of the La Gomeran material differed in 6 bp. A

BLAST search of ITS regions found only weak correspondence between the

type of H. stereicola and databased sequences from identified species (a best

match of 84% with H. hymeniophilus and Catenulifera brachyconia (W. Gams)

Bogale & Unter.). However, the true phylogenetic affinities of H. stereicola

remain unclear due to the lack of sequence data for most of the species of this

and related genera.

16 ... Partel & Példmaa

Acknowledgments

We acknowledge the contribution of the late Ain Raitviir to the initiation of this

study. We thank Josef Hafellner (Austria, Graz) and Ilmi Parmasto (Estonia, Tartu) for

providing specimens for study. We are also indebted to Erast Parmasto for identifying

the Stereum species and for the revision of the Latin and to Bellis Kullman for technical

assistance. We thank Ricardo Galan (Alcala de Henares, Spain) and Seppo Huhtinen

(Turku, Finland) for reviewing the manuscript. This study was funded by the Estonian

Science Foundation (grant 6939), the Estonian Ministry of Education and Science

(projects SFO180153s08 and SFO180012s09) and the European Union through the

European Regional Development Fund (Center of Excellence FIBIR).

Literature cited

Baral HO. 1993. Beitrage zur Taxonomie der Discomyceten III. Zeitschrift fur Mycologie 59(1):

3-22.

Baral HO, Marson G. 2005. In Vivo Veritas. Over 10000 of fungi and plants, with materials on vital

taxonomy and xerotolerance. 3. ed. DVD-ROM.

Bogale M, Orr M-J, O’Hara MJ, Untereiner WA. 2010. Systematics of Catenulifera (anamorphic

Hyaloscyphaceae) with an assessment of the phylogenetic position of Phialophora hyalina.

Fungal Biology 114: 396-409. doi:10.1016/j.funbio.2010.02.006

Galan R, Raitviir A. 2004. Deux Hyaloscyphaceae jaunes. Bulletin de la Société Mycologique de

France 120: 187-198.

Graddon WD. 1974. Some new discomycete species. Transactions of British Mycological Society

63(3): 475-485. doi:10.1016/S0007-1536(74)80095-1

Helfer W. 1991. Pilze auf Pilzfruchtkérpern. Libri Botanici 1. IGW Verlag. Eching. 157 pp.

Hosoya T. 2002. Hyaloscyphaceae in Japan (6): the genus Hyphodiscus in Japan and its anamorph

Catenulifera gen. nov. Mycoscience 42: 611-622.

Hosoya T, Han J-G, Sung G-H, Hirayama Y, Tanaka K, Hosaka K, Tanaka I, Shin H-D. 2010.

Molecular phylogenetic assessment of the genus Hyphodiscus with description of Hyphodiscus

hyaloscyphoides sp. nov. Mycological Progress. Published online 20 Aug. 2010. doi:10.1007/

$11557-010-0693-2

Kornerup A, Wanscher JH. 1967. Methuen Handbook of Colour. 2" edition. Methuen & Co Ltd.

London. 243 pp.

Kéljalg U, Larsson K-H, Abarenkov K, Nilsson RH, Alexander IJ, Eberhardt U, Erland S, Hoiland

K, Kjoller R, Larsson E, Pennanen T, Sen R, Taylor AFS, Tedersoo L, Vralstad T, Ursing BM.

2005. UNITE: a database providing web-based methods for the molecular identification

of ectomycorrrhizal fungi. New Phytologist 166: 1063-1068. doi:10.1111/j.1469-8137.2005.

01376.x

Példmaa K. 2000. Generic delimitation of the fungicolous Hypocreaceae. Studies in Mycology 45:

83-94,

Példmaa K. 2003. Three species of Hypomyces growing on basidiomata of Stereaceae. Mycologia

95(5): 921-933. doi:10.2307/3762020

Példmaa K. 2011. Tropical species of Cladobotryum and Hypomyces producing red pigments.

Studies in Mycology 68: 1-34. doi:10.3114/sim.2011.68.01

Raitviir A. 1970. Synopsis of the Hyaloscyphaceae. Scripta Mycologica 1. Institute of Zoology and

Botany. Tartu. 115 pp.

Raitviir A. 2004. Revised Synopsis of Hyaloscyphaceae. Scripta Mycologica 20. Estonian Agricultural

University, Institute of Zoology and Botany. Tartu. 132 pp.

Hyphodiscus stereicola sp. nov. on Stereum ... 17

Rogerson CT, Samuels GJ. 1993. Polyporicolous species of Hypomyces. Mycologia 85: 231-272.

doi: 10.2307/3760461

Untereiner WA, Naveau FA, Bachewich J, Angus A. 2006. Evolutionary relationships of Hyphodiscus

hymeniophilus (anamorph Catenulifera rhodogena) inferred from {-tubulin and nuclear

ribosomal DNA sequences. Canadian Journal of Botany 84: 243-253. doi:10.1139/B05-165

Verkley GJM. 1993. Ultrastructure of the ascus apical apparatus in Hymenoscyphus and other

genera of the Hymenoscyphoideae (Leotiales, Ascomycotina). Persoonia 15: 303-340.

Verkley GJM. 1996. Ultrastructure of the ascus apical apparatus in genera Lachnum and Trichopeziza

(Hyaloscyphaceae, Ascomycotina). Nova Hedwigia 63: 215-228.

Zhuang W-Y. 1988. Notes on Lachnellula theiodea. Mycotaxon 31: 411-416.

MYCOTAXON

Volume 115, pp. 19-27 January-March 2011

DOT: 10.5248/115.19

Chaetomium siamense sp. nov., a soil isolate from Thailand,

produces a new chaetoviridin, G

CHANINUN PoRNSURIYA’, KASEM SOYTONG?, SUPATTAR POEAIM},

SOMDEJ] KANOKMEDHAKUL*‘, PRIMMALA KHUMKOMKHET*

Fu-CHENG LIN*, HONG KAI WANG? & KEVIN Davip HypE%7

' Department of Biology, Faculty of Science, Srinakharinwirot University

Bangkok 10110, Thailand

2Department of Plant Pest Management Technology, Faculty of Agricultural Technology &

’Department of Applied Biology, Faculty of Science — King Mongkut’s Institute

of Technology, Ladkrabang (KMITL), Bangkok 10520, Thailand

‘Natural Products Research Unit, Department of Chemistry & Center of Excellence

for Innovation in Chemistry, Faculty of Science, Khon Kaen University,

Khon Kaen 40002, Thailand

5College of Agriculture and Biotechnology, Biotechnology Institute, Zhejiang University

Kaixuan Road, Hangzhou 310029, P.R. China

°School of Science, Mae Fah Luang University, Thasud, Chiang Rai 57100, Thailand

"Botany and Microbiology Department, College of Science, King Saud University,

Riyadh, Saudi Arabia

CORRESPONDENCE TO *: “chaninun@swu.ac.th

ABSTRACT — Chaetomium siamense sp. nov., isolated from soil in a pineapple plantation

in Thailand, is described and illustrated. The new species is similar to C. cupreum in

having superficial globose or ovate ascomata with red circinate ascomatal hairs but can be

distinguished by its fusiform ascospores with two apical germ pores. Phylogenetic analysis of

ITS rDNA sequence data also supports C. siamense as distinct. Investigation of the secondary

metabolites of C. siamense led to the isolation of one new (chaetoviridin G) and seven known

compounds (ergosterol, 24(R)-5a,8a-epidioxyergosta-6-22-diene-3B-ol, ergosterylplamitate,

cochliodone D, chaetoviridin A, chaetoviridin F, chrysophanol).

Key worps — Ascomycota, Chaetomiaceae, novel compound

Introduction

Chaetomium Kunze, established in 1817, is an ascomycete genus in the family

Chaetomiaceae (von Arx et al. 1986). Chaetomium is one of the largest genera of

saprotrophic ascomycetes, comprising more than 300 species worldwide (Seth

1970, von Arx et al. 1986, Cano & Guarro 1987, Carris & Glawe 1987, Moustafa

& Ess El-Din 1989, Horie & Udagawa 1990, Abdullah & Zora 1993, Udagawa et

20 ... Pornsuriya & al.

al. 1994, Gené & Guarro 1996, Decock & Hennebert 1997, Udagawa et al. 1997,

Rodriguez et al. 2002, Wang & Zheng 2005a,b). Chaetomium is characterized

by superficial ascomata, usually covered with hairs or setae, surrounding a

rather wide ostiolar pore at the apex. The ascospores are aseptate, brown or

gray-olivaceous, and with one or two germ pores (von Arx et al. 1986).

During a study on antagonistic fungi for controlling root rot disease of

pineapple, numerous strains of Chaetomium were isolated from soil using a

baiting technique (Soytong & Quimio 1989). Although several species have

been only recently recorded for Thailand (Pornsuriya et al. 2008), one isolate

could not be identified as any known Chaetomium species. ‘This isolate is here

described and illustrated as Chaetomium siamense sp. nov., and is compared

with C. cupreum, the most similar species. Molecular evidence, also provided,

supports this species as an independent taxon.

Materials & methods

Sampling, isolation and morphological study

Soil samples were collected from pineapple plantations in Phatthalung Province,

Thailand, during August to November 2007. They were placed in clean plastic bags

for transport to the laboratory at King Mongkut’s Institute of Technology Ladkrabang,

Bangkok, Thailand. Chaetomium species were originally isolated by the baiting technique

described by Soytong & Quimio (1989). Chaetomium species developing on baits were

observed daily and their ascomata transferred to glass slides with a small amount of

sterilized water before being spread on water agar (WA) in a 9-cm diameter Petri dish

and then incubated for 24 h at room temperature, Individual colonies were transferred

onto potato dextrose agar (PDA) and corn meal agar (CMA) for identification.

Morphological structures of the new species were observed under compound and

scanning electron microscopes. The holotype is deposited in Biocontrol Research Unit

and Mycology Section (KMITL).

DNA extraction, polymerase chain reaction (PCR) and data analysis

Genomic DNA was extracted from a mycelial culture grown in potato dextrose broth

(PDB) by using Dneasy Plant Mini kit (Qiagen, Hilden, Germany). Polymerase chain

reaction (PCR) amplification of the internal transcribed spacer (ITS1, 5.88 and ITS2

regions) was performed with primer pair PN3 and PN16 (Neuvéglise et al. 1994). The

reaction was carried out in 25 ul volumes containing 1 ul genomic DNA, 0.5 ul dNTPs,

1 pl of each primer and 0.2 ul Taq DNA polymerase in 2.5 ul PCR buffer. Amplifications

were performed with an initial denaturation step of 95°C for 5 min followed by 35

cycles of 94°C for 1 min, 60°C for 2 min and 72°C for 3 min and a final extension of

72°C for 5 min. The PCR product was separated on an agarose gel and purified for

DNA sequencing by the U-gene Gel Extraction Kit II (U-gene Biotechnology Co, P.R

China). DNA sequences of related species, based on the ITS including 5.8S gene data,

were retrieved from GenBank (TABLE 1). Chaetomium nigricolor and Chaetomium sp.

15004 were used as outgroup. All sequences were assembled using BioEdit ver. 7.0.2

and aligned using ClustalX ver 1.83. Phylogenetic relationships were determined by

Chaetomium siamense sp. nov. (Thailand) ... 21

TABLE 1. Chaetomium species and isolates used in this study

ISOLATES : ITS GENBANK i HOST/SUBSTRATE i GEOGRAPHIC

} ACCESSION No. } i ORIGIN

hinese child

C. atrobrunneum

C. cupreum

Macrotermitinae nest

__&. globosum chrysanthemum

C. longicolleurm

C. murorum deteriorated painting

“GE pachypodioides

__Chaetomium sp. 15004

: Chaetornium sp. INBI2-26(-)

C. thermophilum EF550983

heuristic search under neighbor joining (NJ) using PAUP* 4.0b8 (Swofford 2001). Tree

was drawn using Treeview.

Identification of metabolites

Erlenmeyer flasks (1 L) containing 200 ml PDB were inoculated with mycelial

plugs from a 5-day-old culture of C. siamense. The flasks were incubated for 4 weeks

on stationary state at 27-30°C. Mycelium mats were then harvested, air dried, ground,

and extracted with a series of methanol, ethyl acetate and hexane. The crude extract was

loaded onto a silica gel column. The column was successively eluted to obtain different

fractions and monitored by TLC, and reduced to one active fraction. The chemical

structures isolated from dried mycelial mats of C. siamense were elucidated on the basis

of spectroscopic evidence (IR, 'H NMR, and ?C NMR and 2D-NMR).

Taxonomy & discussion

Chaetomium siamense Pornsuriya & Soytong, sp. nov. Figs 1

MycoBank MB 506801

Coloniae modica bardus crescents in agaris PDA et CMA, cum mycelio aerio; reversum

rubus. Mycelium ex hyphis hyalinis vel subhyalinis, septatis, laevibus, 1.8-2.3 um diam

compositum. Ascomata superficialia, globosae, ovata, ostiolata, fuscobrunneum in

refulgens, paramariae ad 87-148 x 107-177 um. Peridium fuscobrunneum et ex textura

angularis; epidermoidea ex fuscus, paramariae ad 2.8-5.7 x 5.1-10.4 um. Ascomatal

pili abundantibus, simplici, aurantiacus in refulgens, spira in ultima parte et ex septati,

22 ... Pornsuriya & al.

Figure 1. Chaetomium siamense. A. Ascoma viewed under a scanning electron microscope.

B. Ascoma viewed under a light microscope. C-D. Arcuate ascomatal hairs with swollen basal

cells (arrowed) viewed under a scanning electron microscope. E. Peridium viewed under a

light microscope. F. Asci viewed under a light microscope. G. Ascospores viewed under a light

microscope. H. Ascospores viewed under a scanning electron microscope. I. Fusiform ascospores

with two apical germ pores (arrowed). J. Ascospore viewed under a scanning electron microscope.

Bars: A, B = 50 um; C, E-G = 10 um; D, H = 5 wm; I, J= 2 pm.

Chaetomium siamense sp. nov. (Thailand) ... 23

Figure 2. Comparison of the characteristics of Chaetomium cupreum (A-D) and C. siamense (E-

H). Bars: A, E = 50 um; B-D, F-H = 10 um.

1.3-4 um diam, 170 um longi. Pili laterals recti, leviter, verrucosi, paramariae ad 56-

160 um longi. Asci numerosis, fasciculati, clavati, pedicellati, 8-spori, 9-14 x 28-40 um.

Ascosporae fusiformia, fascobrunnneum, laevibus, 4.3-5 x 11.1-13.5 um, cum 2 poro

germinalibus apicali visibile.

Hototype: Thailand, Phatthalung, isolated from soil in a pineapple plantation, 27

September 2007, Chaninun Pornsuriya TMACCO01, deposited in herbarium of the

Biocontrol Research Unit and Mycology Section, King Mongkut’s Institute of Technology

Ladkrabang (KMITL), Bangkok 10520, Thailand.

ETYMOLOGY: siamense refers to Thailand (Siam), country of origin.

Colonies on PDA and CMA growing moderately slowly, covering 9 cm Petri

dish surface after 14 days at room temperature, with aerial mycelium; becoming

red due to red pigment exudates when young, yellow when old and formation

of ascomata. Mycelium composed of hyaline to subhyaline, septate, smooth

hyphae, 1.8-2.3 um diam. Ascomata discrete, maturing within 10-14 days,

superficial, globose or ovate, ostiolate, dark brown in reflected light, 87-148 x

107-177 um. Peridium dark brown, of textura angularis; outer layer composed

of brown, thick-walled cells measuring 2.8-5.7 x 5.1-10.4 um. Ascomatal hairs

abundant, unbranched, red or orange-red in reflected light, apically circinate

or coiled, regularly septate and forming a dense tuft around the ostiole, finely

verrucose towards the tip, up to 170 um long, 1.3-4 tm diam near the base.

Lateral hairs less abundant, straight, finely verrucose, 56-160 tm long. Asci

numerous, fasciculate, clavate, stalked, 8-spored, 9-14 x 28-40 um. Ascospores

fusiform, dark brown at maturity smooth and rather thick-walled, 4.3-5 x

11.1-13.5 um, with two apical germ pores.

24 ... Pornsuriya & al.

Chaetomium nigricolor EU543258

Chaetomium sp. EU750692

Chaetomium bostrychodes EU520130

os Lio fen funicola EU552109

Chaetomium funicola EU139246

‘6 Chaetomium murorum GQ376100

Chaetomium globosum FJ538594

Chaetomium sp. AJ620951

e is Chaetomium hispanicum DQ069021

Chaetomium sp. DQ093660

98 Chaetomium siamense sp. nov.

am [ Chaetomium cupreum AB509373

96 Chaetomium cupreum AB509370

Chaetomium cupreum AB509366

67. Chaetomium cupreum AB509367

Chaetomium cupreum AB509369

Chaetomium cupreum AB509371

Chaetomium cupreum AB511968

Chaetomium atrobrunneum FJ595483

Chaetomium longicolleum GQ922525

Chaetomium thermophilum GQ922527

Chaetomium pachypodioides GQ922526

Ficure 3. Phylogenetic tree of Chaetomium spp. from GenBank including Chaetomium siamense

constructed after distance-based analysis of ITS1 and 5.8S regions of rDNA. Numbers at the

branches indicate the percentage of bootstrap values after 1000 replications. The outgroup taxa are

Chaetomium nigricolor and Chaetomium sp.

COMMENTS: Chaetomium is a large ascomycete genus with species inhabiting

various cellulose-based substrates including paper and plant compost. After

review of the genus by von Arx et al. (1986) several new species have been

described: C. biporatum (Cano & Guarro 1987), C. histoplasmoides (Carris &

Glawe 1987), C. sinaiense (Moustafa & Ess El-Din 1989), C. subcurvisporum

Chaetomium siamense sp. nov. (Thailand) ... 25

O ©O OH

6 7 8

Figure 4. Compounds isolated from Chaetomium siamense. 1. chaetoviridin G; 2. ergosterol;

3. 24(R)-5a,8a-epidioxyergosta-6-22-diene-3B-ol; 4. ergosterylplamitate; 5. cochliodone D;

6. chaetoviridin A; 7. chaetoviridin F; 8. chrysophanol.

(Abdullah & Al-Bader 1989), C. myricicola (Horie & Udagawa 1990),

C. mesopotamicum (Abdullah & Zora 1993), C. novae-caledoniae (Udagawa

et al. 1994), C. floriforme (Gené & Guarro 1996), C. cuyabenoensis (Decock

& Hennebert 1997), C. umbratile (Udagawa et al. 1997), C. macrostiolatum,

C. olivicolor, C. tarraconense (Rodriguez et al. 2002) C. acropullum (Wang

& Zheng 2005a), and C. ampulliellum (Wang & Zheng 2005b). Chaetomium

siamense can be distinguished from other species by its superficial, spherical or

ovate ascomata with angular brown walls. Ascomatal hairs are red or orange-red

in reflected light, arcuate, apically circinate or coiled, septate and ascospores are

fusiform with two apical germ pores. The new species was initially identified

as C. cupreum L.M. Ames, which produces red pigment in agar medium and

which also produces superficial spherical or ovate ascomata (Fics. 2A,E) with a

peridium of angular brown-walled cells.

Ascomatal hairs are red, arcuate, apically circinate or coiled and septate

(Fics. 2B,F). However, ascospore morphology easily separates the new species

26 ... Pornsuriya & al.

from C. cupreum (Fics. 2H,D). The longer (11.1-13.5 um) fusiform ascospores

with two apical germ pores (Fic. 2H) of C. siamense clearly differ from the

shorter (7-10 tum) reniform ascospores with a single apical germ pore (Fic.

2D) that characterize C. cupreum. Although the phylogenetic analysis indicates

that C. siamense is related to C. cupreum, sequence differences (as shown by the

separate branch tips, Fic. 3) clearly support C. siamense as a distinct species.

Investigation of the secondary metabolites from crude extracts of dried

mycelial mats of C. siamense led to the isolation of a new compound named

chaetoviridin G (1). Seven other known compounds — ergosterol (2),

24(R)-5a,8a-epidioxyergosta-6-22-diene-3B-ol (3), ergosterylplamitate (4),

cochliodone D (5), chaetoviridin A (6), chaetoviridin F (7), and chrysophanol

(8) — were also identified. Structures were elucidated based on spectroscopic

evidence (IR, 'Hd NMR, and °C NMR and 2D-NMR). Compounds 2-8 (Fic. 4)

have also been reported from C. cochliodes (Phonkerd et al. 2008).

Acknowledgments

We are grateful to Drs Eric McKenzie and Chaiwat To-anun for kindly reviewing

the manuscript. The first author would like to acknowledge Sommart Pornsuriya for his

kind assistance in collecting soil samples.

Literature cited

Abdullah SK, Al-Bader SM. 1989. A new thermotolerant species of Chaetomium from Iraqi forest soil.

International Journal of Mycology and Lichenology 4: 83-92.

Abdullah SK, Zora SE. 1993. Chaetomium mesopotamicum, a new thermophilic species from Iraqi

soil. Cryptogamic Botany 3: 387-389.

Arx JA von, Guarro J, Figueras MJ. 1986. The Ascomycete genus Chaetomium. Beihefte zur Nova

Hedwigia 84: 1-162.

Cano J, Guarro J. 1987. Soil ascomycetes from Spain. XII. Chaetomium biporatum sp. nov. Nova

Hedwigia 44: 543-546.

Carris LM, Glawe DA. 1987. Chaetomium histoplasmoides, a new species isolated from cysts of

Heterodera glycines in Illinois. Mycotaxon 29: 383-391.

Decock C, Hennebert GL. 1997. A new species of Chaetomium from Ecuador. Mycological Research

101: 309-310. doi:10.1017/S0953756296002456

Gené J., Guarro J. 1996. A new Chaetomium from Thailand. Mycological Research 100: 1005-1009.

doi: 10.1016/S0953-7562(96)80055-4

Horie Y, Udagawa S. 1990. New or interesting Chaetomium species from herbal drugs. Transactions

of the Mycological Society of Japan 31: 249-258.

Moustafa AF, Ess El-Din EK. 1989. Chaetomium sinaiense sp. nov., a new soil ascomycete from

Egypt. Canadian Journal of Botany 67: 3417-3419. doi:10.1139/b89-416

Neuvéglise C, Brygoo Y, Vercambre B, Riba R. 1994. Comparative analysis of molecular and biological

characteristics of strains of Beauveria brongniartii isolated from insects. Mycological Research 98:

322-328. doi:10.1016/S0953-7562(09)80460-7

Phonkerd N, Kanokmedhakul S, Kanokmedhakul K, Soytong K, Prabpai S, Kongsaeree P. 2008. Bis-

spiro-Azaphilones and Azaphilones from the fungus Chaetomium cochliodes VTh01 and C. cochliodes

CTh05. Tetrahedron 64: 9636-9645. doi:10.1016/j.tet.2008.07.040

Chaetomium siamense sp. nov. (Thailand) ... 27

Pornsuriya C, Lin FC, Kanokmedhakul S, Soytong K. 2008. New record of Chaetomium species

isolated from soil under pineapple plantation in Thailand. Journal of Agricultural Technology 4:

91-103.

Rodriguez K, Stchigel A, Guarro J. 2002. Three new species of Chaetomium from soil. Mycologia

94: 116-126. doi:10.2307/3761851

Seth HK. 1970. A monograph of the genus Chaetomium. Nova Hedwigia 37: 1-133.

Soytong K, Quimio TH. 1989. A taxonomic study on the Philippine species of Chaetomium. The

Philippine Agriculturist 72: 59-72.

Swofford DL. 2001. PAUP*: Phylogenetic analysis using parsimony (*and other methods), version

4.0b8. Sunderland : Sinauer Associates.

Udagawa S, Uchiyama S, Kamiya S. 1994. Two new species of pyrenomycetous Ascomycetes from New

Caledonia. Mycoscience 35: 319-325. doi:10.1007/BF02268501

Udagawa S, Toyazaki N, Yaguchi T. 1997. A new species of Chaetomium from house dust.

Mycoscience 38: 399-402. doi:10.1007/BF02461679

Wang XW, Zheng RY. 2005a. Chaetomium acropullum sp.nov. (Chaetomiaceae, Ascomycota), anew

psychrotolerant mesophillic species from China. Nova Hedwigia 80:413-417. doi:10.1127/0029-

5035/2005/0080-0413

Wang XW, Zheng RY. 2005b. Chaetomium ampulliellum sp.nov. (Chaetomiaceae, Ascomycota) and

similar species from China. Nova Hedwigia 81: 247-255. doi:10.1127/0029-5035/2005/0081-

0247

MYCOTAXON

Volume 115, pp. 29-44 January-March 2011

DOT: 10.5248/115.29

New taxa and new reports of Phyllopsora

(lichenized Ascomycotina) from India

GAURAV K. MisHra’, DALIP K. UPRETI*, SANJEEVA NAYAKA! &

Byu HARIDAS?

‘Lichenology Laboratory, National Botanical Research Institute (NBRI-CSIR)

Rana Pratap Marg, Lucknow 226001, India

2Microfungi e& Lichens Unit, Tropical Botanic Garden and Research Institute

Palode, Thiruvananthapuram 695562, India

CORRESPONDENCE TO *: upretidk@rediffmail.com

AsstTracT— Anaccount of 14 species of Phyllopsora from India is provided. P. catervisorediata

and P himalayensis are described as new species, while P corallina var. subglaucella as a

new variety. P albicans, P. breviuscula, P. chlorophaea, P. confusa, P. isidiotyla, P. kalbii,

P. mauritiana, P. nemoralis, P. subcrustacea, and P. swinscowii are new records for the Indian

lichen biota.

Key worps— Ramalinaceae, Ascomycetes, squamulose, taxonomy

Introduction

The genus Phyllopsora is characterised by a crustose to squamulose thallus,

thin to thick, white to brown to reddish brown prothallus, minute to subfoliose

squamules which are corticated on upper side, green alga photobiont, convex,

biatorine apothecia with a hyaline to pale yellow epihymenium, hyaline to

reddish-brown exciple, hyaline to yellowish-brown hymenium, hyaline or

golden yellow to brownish hypothecium, simple to conglutinated paraphyses,

8-spored asci and hyaline, simple, ellipsoid, bacilliform to fusiform ascospore.

The species of Phyllopsora mostly inhabit bark but sometimes grow on rock and

bryophytes. The species exhibit wide ranges of altitudinal distribution from sea

level up to an height of 3000 m.

Phyllopsora (Ramalinaceae) is a common lichen genus in tropical and

subtropical areas of the world. Swinscow & Krog (1981) revised the East

African species of Phyllopsora and reported the occurrence of eleven species

from the region. Brako (1989, 1991) monographed the neotropical flora and

enumerated eighteen species and eight varieties. Timdal & Krog (2001) studied

30 ... Mishra & al.

the East African and Mascarene Phyllopsora species. Elix (2006a, b) recorded

five new species of Phyllopsora from Australia and for the first time Timdal

(2008) described sorediate Phyllopsora species from Peru.

Upreti et al. (2003) described five species of Phyllopsora from India. Later,

Awasthi (2007) updated the occurrence of six taxa of Phyllopsora from India,

where P. kiiensis (Vain.) Gotth. Schneid. was considered to be a synonym

of PB haemophaea (Nyl.) Mull. Arg. However, it is clear from our study and

according to Timdal & Krog (2001) that P. kiiensis is a distinct species, while

P. haemophaea is a synonym of P. furfuracea (Brako 1991). The known taxa of

Phyllopsora from India prior to the present communication include P. buettneri

(Mull. Arg.) Zahlbr., PB corallina (Eschw.) Mill. Arg., P furfuracea, P. kiiensis,

P. manipurensis (Mill. Arg.) Gotth. Schneid., P parvifolia (Pers.) Mull. Arg. var.

parvifolia, and P. parvifolia var. subgranulosa (Tuck.) Mull. Arg. The present

investigation adds further 13 taxa of Phyllopsora to the Indian lichen biota,

including two new species and one new variety. The description and illustration

of P furfuracea is also provided here for better understanding of the taxa.

Materials & methods

The present study is based on the lichen specimen preserved at the herbarium of

the National Botanical Research Institute, Lucknow (LWG), which also includes the

personal herbarium of Dr. Awasthi (LWG-AWAS). The specimens were examined

morphologically, anatomically, and chemically. Thin hand-cut sections of apothecia and

thallus were mounted in plain water, cotton blue and 5% KOH and observed under

a compound microscope. For chemical spot tests the usual reagents of K, C and P

were used. TLC was performed in solvent system A, following Walker & James (1980).

Swinscow & Krog (1981) was followed for the terminology of cortex types.

Key to the Indian Phyllopsora taxa

1. Thallus isidiate or sorediate..... 0... cece cnet n een e ee 2

Late” Dallas otherwise. sccm wteet scene: choy hetnstime doa eating W dhaet aati atime sie eta 5 11

2; Thallus:sorediate ... 222 ye sus peel VR oe HE PR pee P. catervisorediata

Dar. halls isidiates’ 5163 tins 4 a hikgad eaten tea bss PRS Aa Me aba durd Seth das 3

3. Isidia mostly globular. ....... 0.0. cece nee e nas 4

3a. Isidiamosthycylindrical. . 0. .ccce ced tie ed een ed tee ced wale e tied nae ne 5

4. Thallus greenish, upper cortex type 2; apothecia brown to black, K-.... P. kalbii

4a. Thallus yellowish, upper cortex type 1-2; apothecia dark brown, K+ yellow

Jie, Shai BY SAE Tei nd Te Aap nee te os P. himalayensis

5. Squamules 0.3-1.5 mm wide .... 0.0... ccc cece nee nee 6

5a. Squamules 0.1-0.3 mm Wide. ...... 0.0... cece cece ence een ee eae 8

6. Thallus containing methyl 2,7-dichloropsoromate and methyl 2,7-dichloronor-

PSOLOMIALE 8 ees oe cae ee ee es ane Becton ee EY ed Reng ates te DE P. swinscowti

19.

19a.

Phyllospora in India... 31

Thallus chemistry otherwise. 0.0.0.0... 00. c ec cecceee eee ence n eens 7

Thallus containing furfuraceic acid .... 2... eee eee P. kiiensis

Thallus lacking furfuraceic acid ..............0...000,4 P. corallina vay. corallina

Thallus K-, containing furfuraceic acid......... 0... P. furfuracea

Thallus K+ yellow, lacking furfuraceic acid ..... 0.0... cece eee eee 9

Isidia mostly bulbate at the base, thick; apothecia brown

Sete nS A PS Oe eee tae P. corallina var. subglaucella

Isidia simple or coralloid, common to abundant; apothecia brown to black... 10

Isidia thick, irregular shaped; upper cortex thin, gelatinous ......... P isidiotyla

Isidia thin, short; upper cortex type 1-2............... 02 eee eee P. nemoralis

Squamules 0.1-0.3 mm Wide. 0.0.0... cece ene eee n eens 12

. Squamules 0.3-1.5 mm Wide. ..... 0... cece eee en een ees 16

Prothallus reddish brown to black; squamules ascending ........ P. chlorophaea

Prothallus white or red; squamules adnate to ascending ................... 13

Prothallus red; hypothecium colourless ......... P. parvifolia var. subgranulosa

Prothallus white; hypothecium yellowish to reddish brown ................ 14

Squamules yellowish to greenish; hypothecium dark brown ..... P. manipurensis

. Squamules greenish; hypothecium golden yellow to reddish brown ......... 15

Ascospores 11-18 x 2-3 um; apothecia with fibrillose margin... P subcrustacea

. Ascospores 8-11 x 1-2 um; apothecia glabrous margin.............. P. confusa

Thallus:PD+orangesred Seika. 142 8R hs a Aiwa ab Abd 17

roi avsV Nuch 218 os Say Rien kon, Here Ronee meee AAD, ere RS ih A cI RV Som BY fo 18

Squamules mostly pruinose, strongly pubescent, not imbricate ...... P. buettneri

. Squamules not pruinose, rarely pubescent, imbricate................ P. albicans

Squamules mostly ascending, upper side yellowish brown,

pubescent at margin .......... 0... cece eee eee eee P. parvifolia var. parvifolia

. Squamules adnate to ascending, upper side greenish, margin occasionally

pubescent Shs ee shee he Raue og teh eed BM Mel ee tei lene, hat aco, Polis gate 2 as 19

Squamules closely adnate, overlapping; hypothecium colourless to pale brown

cies He set ght Bt ged 5 ME gar A eG cee LB gl ME od a P. mauritiana

Squamules ascending; hypothecium golden yellow to brown ........ P. buettneri

The species

Phyllopsora albicans Mill. Arg., Bull. Soc. R. Bot. Belg. 32: 132 (1893). Fic. 1

Prothallus thin to thick, reddish brown. Thallus squamulose, ascending, mainly

imbricate, elongate, incised to deeply divided, 0.3-1.0 mm wide; upper surface

glabrous to slightly pubescent, pale green to dark green, plane to convex, margin

pubescent. Isidia absent. Cortex 1-2 type, 12-20 tm thick; medulla containing

crystals, dissolving in K.

32 ... Mishra & al.

Apothecia rare, up to 1.5 mm diam.; disc plane to convex, reddish brown;

margin raised. Exciple reddish-brown; epihymenium hyaline; hymenium

colourless to pale yellow; hypothecium golden yellow and containing crystals

which dissolve in K. Ascospores hyaline, simple to narrowly ellipsoidal to

bacilliform, 6-10 x 1-2 um. Pycnidia not seen.

CHEMISTRY — ‘Thallus K-, C-, KC-, PD+ yellow orange; argopsin and pannarin

in TLC.

SPECIMENS EXAMINED — INDIA: Arunachal Pradesh, Upper SIANG DISTRICT, Jengging,

Apanavan area, alt. 1014 m, on bark, 18.11.2008, D.K. Upreti, U. Dubey, R. Khare & G.

Mishra 08-009322 (LWG), West SIANG DiIsTRICT, Eyi village, on bark, 17.10.2007, U.

Dubey s.n. (LWG), Kerala, PALGHaT DiIsTRICcT, Silent Valley National Park, on Mesua

ferea bark, 24.11.2006, B. Haridas 06-014751 (LWG).

Remarks — Phyllopsora albicans is distinguished by the elongated, often

imbricate squamules. It is close to P. buettneri in having a PD+ orange reaction

(pannarin or related compounds), but the later species differs in having pruinose,

strongly pubescent squamules containing additionally zeorin. P. albicans was

earlier reported from the montane habitats of Africa, Costa Rica, Philippines

and Taiwan, between altitudes of 540-2000 m (Swinscow & Krog 1981, Timdal

& Krog 2001). In India, the species is distributed in tropical to subtemperate

areas in the state of Arunachal Pradesh and Kerala between altitudes 500-1500

m. It is a new record for the country.

Phyllopsora breviuscula (Nyl.) Mill. Arg., Bull. Herb. Boissier 2(App. 1):

45 (1894). Fic. 2

= Lecidea breviuscula Nyl., Annls Sci. nat., Bot., ser. 4, 19: 339 (1863).

Prothallus thick and reddish brown. Thallus squamulose; squamules adnate,

ascending to elongate, crenulate to incised 0.3-1.0 mm wide; upper surface

glabrous, pale green to green, plane to convex, sometime fibrillose at the

margin. Isidia absent. Cortex 2 type, 20-35 um thick; medulla containing

crystals dissolving in K.

Apothecia common, up to 1.5 mm in diam.; disc plane to convex, reddish-

brown; margin slightly raised and glabrous; exciple pale brown; epihymenium

hyaline to pale yellow; hymenium hyaline; hypothecium reddish brown,

containing crystals which dissolve in K. Ascospores hyaline, simple to fusiform,

6-11 x 2-3.5 um. Pycnidia not seen.

CHEMISTRY — Thallus K-, C-, KC-, PD-; no lichen substance in TLC.

SPECIMENS EXAMINED — INDIA: Karnataka, CHIKMAGALURE DISTRICT, Chamudi Ghat,

Kuvettu, alt. 104 m, on bark of trees in evergreen forest, 15.01.2008, H.T. Lumbsch, D.K.

Upreti & P.K. Divakar 19740/B (LWG).

Remarks — Phyllopsora breviuscula is distinguished by the large, partly

imbricate squamules and the reddish brown hypothecium. The Indian specimen

Phyllospora in India ... 33

contains crystals in medulla and hypothecium, but no lichen substances were

detectedin TLC. It is close to B parvifolia in having large squamules and reddish

brown prothallus but the latter species differs in forming more plane squamules

with phyllidia on the lobe margins in the inner part of the thallus. P breviuscula

was earlier known from Cuba, Mauritius, and La Réunion between altitudes

of 300-1390 m (Timdal & Krog 2001). In India, the species is collected from

tropical areas of Karnataka in western Ghat between altitudes of 100-500 m,

and is a new species from the country.

Phyllopsora catervisorediata G.K. Mishra, Upreti & Nayaka, sp. nov. FIG. 3

Mycosank MB 518498

Thallus squamulosus; squamulae ascendentes, elongatae, luteo-virescentes, sorediatae.

Apothecia ignota.

Ho otyre — Inp1a: Uttarakhand, BAGESHWAR DISTRICT, enroute to Pindari glacier,

from Dwali to Khati, alt. 2734-3210 m, on bark, 13.05.2007, S. Joshi & Y. Joshi 07-

008932 (LWG).

EryMo.ocy: From the latin noun caterva (= group or heap), referring to the appearance

of the soredia.

Prothallus indistinct. Thallus squamulose, closely adnate, rounded to elongate,

sometimes ascending, 0.1-0.5 mm wide; upper surface glabrous, pale green to

yellowish, plane to convex, epruinose, sorediate. Soredia farinose, developing

from the margin of squamules, forming heaps. Cortex of type 2, 5-10 tm thick;

medulla containing crystals dissolving in K.

Apothecia and pycnidia not seen.

CHEMISTRY — ‘Thallus K+ yellow, C-, KC-, PD-; atranorin in TLC.

Remarks — Phyllopsora catervisorediata is characterized by the marginally

sorediate squamules and the indistinct prothallus. The soredia forms heaps

on the margin of the squamules. It is close to P soralifera Timdal, in having

sorediate squamules and cortex of type 2, but the latter species differs in having

capitate soredia and in lacking lichen substances. P. catervisorediata is known

from its type locality in the Western Himalayas, where it was found growing on

bark of tree in moist and humid forest at an altitude of 2730 m.

Phyllopsora chlorophaea (Mull. Arg.) Zahlbr., Denkschr. Akad. Wiss. Wien 83: 133

(1909). Fic. 4

= Psora chlorophaea Mill. Arg., Flora 70: 320 (1887).

Prothallus reddish brown to black. Thallus squamulose, ascending, overlapping,

elongate, minute 0.1-0.3 mm wide; upper surface glabrous above, pale brown,

plane to convex, sometime fibrillose at the margin. Isidia absent. Cortex of type

1-2, 5-10 um thick; medulla containing crystals that dissolve in K.

Apothecia and pycnidia not seen.

34 ... Mishra & al.

CHEMISTRY — Thallus K-, C-, KC-, PD-; + atranorin in TLC.

SPECIMENS EXAMINED — INDIA: Karnataka, SHimoGa D1sTRICcT, Sharavati Ghat, near

Gersoppa, alt. 718 m, in evergreen forest, on bark, 16.01.2008, H.T. Lumbsch, D.K. Upreti

& PK. Divakar 19744Q (LWG), Orissa, GANJAM DisTRICT, foothills of Mahendragiri,

Burukhat area, on bark, 04.03.1986, D.D. Awasthi, G. Awasthi, R. Mathur & P. Srivastava

86-184 (LWG-AWAS).

Remarks — Phyllopsora chlorophaea is distinguished by minute, lacinulate

squamules and reddish brown prothallus. It is close to BP mediocris Swinscow

& Krog in having reddish-brown prothallus and in cortex type, but the latter

species differs in having medium sized, 0.3-1.0 mm wide squamules and in

lacking lichen substances. P. chlorophaea is a pantropical species earlier reported

from montane rainforest and humid woodland in Kenya, Peru, Mauritius,

Tanzania, between altitudes of 600-1600 m (Broko 1991, Swinscow & Krog

1981, Timdal & Krog 2001, Timdal 2008). In India, the species is recorded from

tropical to subtemperate areas in the states of Karnataka and Orissa, between

altitudes of 200-800 m. It is a new to India.

Phyllopsora confusa Swinscow & Krog, Lichenologist 13: 229 (1981). Fi. 5

Prothallus white to reddish brown. Thallus squamulose, adnate to ascending,

overlapping, minute, 0.1-0.3 mm wide; upper surface glabrous, pale to green,

plane to convex, finely pubescent along the margin. Isidia absent. Cortex of

type 2, 10-20 um thick; medulla containing crystals dissolving in K.

Apothecia common, up to 1.0 mm in diam., disc plane to convex, reddish-

brown, margin slightly raised and glabrous; exciple colourless to pale brown;

epihymenium hyaline; hymenium colourless; hypothecium reddish brown,

containing crystals which dissolve in K. Ascospores hyaline, simple, narrowly

ellipsoid, 8-11 x 2-3 um. Pycnidia not seen.

CHEMISTRY — Thallus K-, C-, KC-, PD-; no lichen substance in TLC.

SPECIMENS EXAMINED — INDIA: Assam, NorRTH CACHAR HILLS DIsTRICT, Mahur

area, on bark, 01.08.2005, D.K. Upreti & J. Rout 05-002958 (LWG), Himachal Pradesh,

KANGRA DISTRICT, Macleodganj, alt. 1600-1800 m, on Quercus leucotrichophora bark,

13.05.2001, D.K. Upreti & S. Nayaka 01-75209 (LWG), Karnataka, SHIMOGA DISTRICT,

Sagara, Holebagilu, alt. 623 m, on bark of Knema attenuata, 16.03.2001, S. Nayaka 01-

022794 (LWG); Homnemardu Island, alt. 621 m, on bark of Olea dioica, 19.03.2001,

S. Nayaka 01-66143 (LWG); Muppane, alt. 626 m, on bark of Memecylon terminale

bark, 21.03.2001, S. Nayaka 01-66193, 01-66169 (LWG); Negiloni, alt. 710 m, on bark,

18.03.2001, S. Nayaka 01-107249 (LWG); 3km before Agumbe Ghat from Koppa, alt.

649 m, on evergreen forest, on bark, 14.01.2008, H.T. Lumbsch, D.K. Upreti & PK.

Divakar 1973/G (LWG); Kerala, ERNAKULAM DISTRICT, BS Thattekkad, alt. 430 m, on

bark, 21.12.2006, B. Haridas 06-009600 (LWG); PALGHAT DIsTRICT, Parambikulam

Wildlife Sanctuary, alt. 610 m, on bark, 14.11.2006, B. Haridas 06-009823, 06-015954

(LWG); M.C.L. Mine area Walayar forest, alt. 300 m, on bark, 22.03.1985, D.D. Awasthi,

R. Tiwari & R. Mathur 85.21 (LWG); SIRUVANI DISTRICT, alt. 810 m, on bark, 16.11.2006,

Phyllospora in India ... 35

Pee ARS a4

Ficures 1-8. Habit. 1. Phyllopsora albicans; 2. P. breviuscula; 3. P. catervisorediata (holotype);

4. P. chlorophaea; 5. P. confusa; 6. P. corallina var. subglaucella; 7. P. furfuracea; 8. P. himalayensis.

Bar = 2mm

36 ... Mishra & al.

B. Haridas 06-009599 (LWG); TRIVENDRUM DIsTRICT, ABP, Athirumala, Pathalamathy,

alt. 1250 m, on bark, 25.04.2006, B. Haridas 06-009602 (LWG); Uttarakhand, Paurt

DISTRICT, Pauri Kandoliya, on bark of Cedrus deodara, 19.06.2005, V. Shukla & Y. Joshi

s.n. (LWG).

Remarks — ‘The most characteristic features of P confusa are the minute,

ascending squamules and the absence of lichen substances. It is close to

P. isidiotyla in having reddish-brown prothallus and minute squamules but

the latter species differs in having longer ascospores and fibrillose apothecia.

Phyllopsora confusa is a pantropical species earlier reported from montane

rainforest and humid woodland in Kenya, La Réunion, Mauritius, and Tanzania

between altitudes of 130-2000 m (Brako 1991, Swinscow & Krog 1981, Timdal

& Krog 2001). In India, the species is recorded from tropical to temperate areas

in the states of Assam, Himachal Pradesh, Karnataka, Kerala, and Uttarakhand

and occurs between altitudes of 300-1800 m. It is new to India.

Phyllopsora corallina var. subglaucella G.K. Mishra, Upreti & Nayaka, var. nov.

MycoBank MB 518499 FIG. 6

Thallus squamulosus; squamulae ascendentes, elongatae, luteo-virescentes. Apothecia

convexa, badio-fusca. Ascosporae ellipsoideae.

Hototypre — Inpia: Uttarakhand, PITHORAGARH DISTRICT, on way to Thalkedar

Temple, alt. 1900-2400 m, on bark, 27.06.1983, D.K. Upreti 212878 (LWG).

EryMo.oey: From the similarity to var. glaucella.

Prothallus thin, white to reddish. Thallus squamulose, closely adnate, rounded

to elongate, sometimes ascending, 0.1-0.3 mm wide; upper surface glabrous,

pale green to yellowish, plane to convex, sometimes fibrillose at the margin,

isidiate. Isidia cylindrical, thick, commonly bulbate at the base. Cortex of type

1-2, 5-8 wm thick; medulla containing crystals dissolving in K.

Apothecia common, up to 1.5 mm in diam.; disc plane to convex, brown;

margin slightly raised. Exciple colourless; epihymenium hyaline; hymenium

colourless; hypothecium colourless to pale brown. Ascospores hyaline, narrowly

ellipsoid, 4-8 x 1-2 um. Pycnidia common, yellow to brown, immersed in

thallus; conidia rod-shaped, straight 6-15 x 1-2 um.

CHEMISTRY — Thallus K+ yellow, C-, KC-, PD-; atranorin in TLC.

Remarks — Phyllopsora corallina var. subglauceila is distinguished by the

cylindrical to bulbate base of the isidia, cortex type 1-2 and presence of

atranorin. It is close to the neotropical P. corallina var. glauceila (Vain.) Brako

in having bulbate isidia, but the latter variety differs in having a cortex of type 2

and in containing different lichen substances, mainly vicanicin (Brako 1991).

‘This species is known from its type locality in the Western Himalayas, where

it was found growing on bark of Quercus leucotrichophora and Cedrus deodara

in moist and humid forest between altitudes of 1900-2500 m.

Phyllospora in India ... 37

ADDITIONAL SPECIMENS EXAMINED — INDIA: Uttarakhand, BAGESHWAR DISTRICT,

Dhakuri to Khati (en route to Pindari), alt. 2590 m, on bark, 20.05.1950, D.D. Awasthi

& A.M. Awasthi 683, 676, 767 (LWG-AWAS); Loharkhet, Pindari Glacier, alt. 1760 m,

on bark, 09.05.2007, S. Joshi & Y. Joshi 07-010710 (LWG); PITHORAGARH DISTRICT,

Chandak Forest, alt. 1550 m, on Quercus leucotrichophora, May 2006, S. Bhatt, 06-

009206, 06-010866 (LWG); Gangoli Hat, Hoat Kali Sacred Grove, on Cedrus deodara, H.

Singh s.n. (LWG); Gori-ganga catchment, East Ghandhura, alt. 1600-2000 m, on bark,

03.10.2002, V. Pant 02000876, 02000880 (LWG); Narain Nagar, alt. 1500 m, on bark,

11.05.1977, O.P. Arora s.n. (LWG); Thakala Forest, alt. 1800m, on bark, 29.10.2002, V.

Pant 02000673 (LWG).

Phyllopsora furfuracea (Pers.) Zahlbr., in Engler & Prantl, Nat. Pflanzenfam. 1(1*):

138 (1905). Fic. 7

= Lecidea furfuracea Pers., in Gaudichaud, Voy. Uran.: 192 (1827).

Prothallus well developed, thin, white. Thallus squamulose; squamules closely

adnate, isodiametric, minute, 0.1-0.3 mm wide; upper surface glabrous,

yellow green to green, rarely pubescent at margin, isidiate. Isidia common,

simple, cylindrical, glabrous, rarely branching, sometimes arising directly

from prothallus. Cortex of type 2, 7-10 wm thick; medulla containing crystals

dissolving in K.

Apothecia common, up to 0.5-1.0 mm in diam.; disc plane to convex, brown,

sometimes fibrillose at base; margin indistinct, paler than the disc. Exciple

colourless to pale brown; epihymenium hyaline; hymenium and hypothecium

pale brown throughout, the latter containing crystals which dissolve in K.

Ascospores hyaline, simple, narrowly ellipsoidal, 5-6(-7) x 2-3 tum. Pycnidia

not seen.

CHEMISTRY — Thallus K-, C-, KC-, PD-; furfuraceic acid in TLC.

SPECIMENS EXAMINED — INDIA: Kerala, PALGHAT DISTRICT, Parambikullam, Wildlife

Sanctuary, alt. 450 m, on bark, 14.11.2006, B. Haridas, 06-009609 (LWG); Thirssur,

Sholayar Range, Mukkanipara, alt. 450 m, on bark, 28.10.2006, B. Hridas 06-009609

(LWG); Uttarakhand, Pauri District, Srinagar, Dhari Devi Temple, on Mangifera

indica, 26.06.2005, V. Shukla & Y. Joshi 05-005278 (LWG); Khirshu, on Quercus,

18.06.2005, V. Shukla & Y. Joshi 05-005103 (LWG); PITHORAGARH DISTRICT, Chandak

Forest, alt. 1550m, on Quercus leucotrichophora, May 2006, S. Bhatt, 06-010888 (LWG);

Ginni band, on bark, 30.10.2009, D.K. Upreti, S. Joshi, H. Rai, R. Khare, G.K. Mishra

& A. Dwivedi 09-012601 (LWG); Munsiyari, Khuliya Top, alt. 2700-3000 m, on bark,

31.10.2009, D.K. Upreti, S. Joshi, H. Rai, R. Khare, G.K. Mishra & A. Dwivedi 09-012602

(LWG).

Remarks — Phyllopsora furfuracea is characterized by minute squamules and

isidia directly attached to the prothallus. It is close to P. nemoralis in having

usually white prothallus and minute squamules but the latter species differs in

having smaller isidia and containing argopsin and atranorin. Two other species

P. dolichospora Timdal & Krog and PB furfuracea, are close to P. furfuracea in

chemistry but they are morphologically different.

38 ... Mishra & al.

The species is a pantropical species earlier reported from montane rainforest

and humid woodland of Australia, Belize, Brazil, Colombia Cuba, Cuzco,

Dominican Republic, East Africa, Ethiopia, Ecuador, French Guiana, Ivory

Coast, Jamaica, Java, Kenya, La Réunion, Loreto, Madagascar, Mexico, Peru,

Tanzania, United States, and Venezuela from sea level to an altitude of 2400 m

(Brako 1991, Swinscow & Krog 1981, Timdal & Krog 2001, Timdal 2008). It is

anew record for the Indian mycota and reported from the states of Kerala and

Uttarakhand between altitudes of 300-2500 m.

Phyllopsora himalayensis G.K. Mishra, Upreti & Nayaka, sp. nov. Fic. 8

MycosBank MB 518500

Thallus squamulosus; squamulae ascendentes, elongatae, luteo-virescentes. Apothecia

convexa, badio-fuscescentia. Ascosporae ellipsoideae vel fusiformes.

Ho.orypus - Inp1a: Himachal Pradesh, KuLLu District, Great Himalayan National

Park, Shilt, alt. 2800 m, on bark, 04.11.2002, S. Nayaka & R. Srivastava 02-001037

(LWG).

EryMo.ocy: From the Himalayas, the type locality.

Prothallus thin, white. Thallus squamulose; squamules closely adnate, rounded

to elongate, ascending to overlapping, crenulate to incised, 0.1-0.5 mm wide;

upper surface glabrous, pale green to yellow, plane to convex, pubescent along

the margin, isidiate. Isidia mostly globular. Cortex of type 1-2, 7-10 um thick,

with scattered crystal dissolving in K; medulla containing crystals dissolving

in K,

Apothecia common, up to 2.0 mm in diam.; disc plane to convex, brown

to dark brown; margin raised. Exciple colourless; epihymenium hyaline to

pale yellow; hymenium colourless; hypothecium colourless to pale yellow,

containing crystals which dissolve in K. Ascospores hyaline, simple, narrowly

ellipsoid to fusiform, 5-10 x 1-2.5 um. Pycnidia common, orange to brown,

immersed in the thallus; conidia rod-shaped, straight, 6-12 x 1-1.5 um.

CHEMISTRY — Thallus K+ yellow, C-, KC-, PD-; atranorin in TLC.

ADDITIONAL SPECIMENS EXAMINED — INDIA: Himachal Pradesh, KULLU DISTRICT,

Great Himalayan National Park, Shilt, alt. 2800 m, on bark, 04.11.2002, S. Nayaka &

R. Srivastava, 02-001152, 02-001113, 02-001077 (LWG); Pardi, alt. 3140 m, on bark,

05.11.2002, S. Nayaka & R. Srivastava, 02-001244 (LWG); Uttarakhand, BAGESHWAR

pisTRict, Dhakuri to Khati, en route to Pindari Glacier, alt. 2210-2734 m, on bark,

20.05.1950, D.D. Awasthi & A.M. Awasthi, 683 (LWG-AWAS); 12.05.2007, S. Joshi & Y.

Joshi, 07-008931 (LWG); Tehri Garhwal, above Jamnotri, alt. 3657 m, on bark of Quercus

tree, 22.06.1951, D.D. Awasthi 904 (LWG-AWAS).

Remarks — Phyllopsora himalayensis is distinguished by the rounded to

elongate, convex, pale green to yellow squamules, the globular isidia, and the

colourless to pale yellow hypothecium. The new species is close to P. kalbii in

Phyllospora in India ... 39

having globular isidia and dark brown apothecia, but P himalayensis differs in

having a cortex of type 2 and in lacking lichen substances.

Phyllopsora himalayensis occurs in temperate areas of the Himalayas in

Himachal Pradesh and Uttarakhand between alt. 1500-3140 m. It grows on

rough bark trees in moist and humid forests.

Phyllopsora isidiotyla (Vain.) Riddle, Mycologia 15: 81. (1923). Fic. 9

= Lecidia isidiotyla Vain., Etud. Lich. Bresil 2: 49 (1890).

Prothallus thick pale brown. Thallus squamulose; squamules adnate, granular

to elongate, minute, 0.1-0.3 mm wide; upper surface glabrous, yellowish-green,

fibrillose at the margin, isidiate. Isidia abundant, thick, cylindrical, rarely

branched. Cortex thin, gelatinous, to 5 um thick; medulla containing crystals

dissolving in K.

Apothecia common, up to 1.0 mm in diam.; disc plane to convex, yellow-

brown to brown; margin raised. Exciple pale yellow; epihymenium hyaline

to pale yellow; hymenium golden yellow; hypothecium pale yellow-brown,

containing crystals which dissolve in K. Ascospores hyaline, simple, ellipsoid

to fusform, 6-11 x 1-2 um. Pycnidia not seen.

CHEMISTRY — Thallus K+ yellow, C-, KC-, PD-; atranorin in TLC.

SPECIMENS EXAMINED — INDIA: Assam, NorTH CACHAR HILLs pisTrIctT, Haflong, on

bark, 01.08.2005, D.K. Upreti & J. Rout 05-002963 (LWG); Bihar, PACHIM CHAMPARAN

pisTRicT, Don Hills, Devatapatta, on bark, 20.02.1995, D.K. Upreti & J. Tandon 213288

(LWG); Himachal Pradesh, CHamBa DIsTRICT, in and around Khajiar, alt. 2000 m,

on bark, 15.05.2001, D.K. Upreti & S. Nayaka 01-75441 (LWG); Karnataka, SHIMOGA

DISTRICT, Sagara, Moolagadde, alt. 600 m, on bark of Calycopetris floribunda, 22.3.2001,

S. Nayaka 01-104966 (LWG); Kerala, PALGHAT DISTRICT, Sailent valley National Park,

alt. 810 m, on bark, 16.11.2006, B. Haridas, 06-007945 (LWG); Sikkim, SouTH SIKKIM

DISTRICT, 20 km before Temi tea, state, alt. 1500 m, on bark, 31.03.2001, D.K. Upreti

& S. Chatterjee 01-26673 (LWG); SouTH SIKKIM DisTRIcT, Narnchi 15 km towards

Jagthang, alt. 1000 m, on bark, May 2006, D.K. Upreti & S. Chatterjee 219565 (LWG);

Tamil Nadu, PaALN1 HILLs, Perumal to Palni road side, via short cut road, alt 1524 m,

on bark, 15.12.1970, K. P. Singh 70.951 (LWG-AWAS); Uttarakhand, Pauri DISTRICT,

near Kiyonkaleshwar Temple, on Pinus, 19.06.2005, V. Shukla & Y. Joshi 05-005449,

05-005443 (LWG); PITHORAGARH DISTRICT, Chandak Forest, alt. 1500 m, on Quercus

leucotrichophora, May 2006, S. Bhatt 06-001088/B (LWG); Gori-ganga catchment,

Thakala forest, alt. 1400 m, on bark of Madhuca longifolia, 29.10.2002, V. Pant 02000616

(LWG); Saurlekh forest area, Near Microwave Station, alt. 2700 m, on bark, 30.09.1990,

D.K. Upreti & G.N. Hariharan 202253 (LWG); on way to Thalkedar temple, alt. 1900-

2400 m, on bark, 27.06.1993, D.K. Upreti 212849/B (LWG).

Remarks — Phyllopsora isidiotyla is distinguished by abundant isidia and

granular squamules. It is close to P furfuracea in having minute squamules and

thick isidia, but the latter species contains furfuraceic acid.

The species is earlier reported from Brazil, Costa Rica, Venezuela, and

United States, from sea level to an altitude of 3000 m (Brako 1991). In India

AQ ... Mishra & al.

it is known from tropical to temperate areas in the states of Assam, Himachal

Pradesh, Karnataka, Kerala, Sikkim, Tamil Nadu, and Uttarakhand, between

altitudes of 600-2700 m. It is new to the Indian lichen biota.

Phyllopsora kalbii Brako, Flora Neotropica Monograph 55: 51 (1991). Fic. 10

Prothallus thin, white to pale brown. Thallus squamulose; squamules closely

adnate to overlapping, crenulate to incised, 0.1-0.3 mm wide; upper surface

glabrous, pale green, convex, pubescent along the margin, isidiate. Isidia

mostly globular. Cortex of type 2, 5-17 um thick; medulla containing crystals

dissolving in K.

Apothecia common, up to 2.0 mm in diam.; disc plane to convex, brown to

black; margin raised. Exciple pale brown; epihymenium hyaline; hymenium

pale yellow; hypothecium colourless to pale yellow-brown, containing crystals

which dissolve in K. Ascospores hyaline, simple, narrowly ellipsoid to fusiform,

5-12 x 2-3 um. Pycnidia yellowish; conidia straight, 4-6 x 1 um.

CHEMISTRY — Thallus K-, C-, KC-, PD-; no lichen substance in TLC.

SPECIMENS EXAMINED — INDIA: Madhya Pradesh, Dinpori District, 13 km, before

Kabir from Chauradader, alt. 640 m, on Shorea robusta tree trunk, 06.07.2005, D.K.

Upreti, S. Nayaka & Satya 05-005704 (LWG); Around Jagatpur Forest Rest House, alt.

640 m, on Shorea robusta tree trunk, 05.07.2005, D.K. Upreti, S. Nayaka & Satya 05-

005578 (LWG); Tarwartola near to Chauradeder, alt. 640 m, on Shorea robusta tree

trunk, 06.07.2005, D.K. Upreti, S. Nayaka & Satya 05-005662, 05-005882/B (LWG).

Remarks — Phyllopsora kalbii is distinguished by the globular isidia, mostly

rounded, convex squamules, and brown to black apothecia. It is close to

P. corallina var. santensis (Tuck.) Brako in having globular to cylindrical isidia

and dark brown apothecia, but the latter taxon differs in chemistry (mainly

argopsin).

The species is a pantropical species earlier reported from Brazil, Dominican

Republic, Kenya, Tanzania, and United States between altitudes of 300-2400

m (Brako 1991). In India, P. kalbii is known from tropical areas in the state of

Madhya Pradesh, between altitudes of 300-650 m. It is new to the Indian lichen

biota.

Phyllopsora mauritiana (Taylor) Gotth. Schneid., Biblioth. Lichenol. 13: 177 (1980,

1979’). Fic. 11

= Lecidea mauritiana Taylor, London J. Bot. 6: 151 (1847).

Prothallus thick, reddish-brown. Thallus squamulose; squamules closely adnate,

overlapping, mostly isodiametric, 0.3-1.0 mm wide; upper surface glabrous,

green, plane to convex, fibrillose at the margin. Isidia absent. Cortex of type 2,

8-20 um thick; medulla containing crystals dissolving in K.

Apothecia common, up to 1.0 mm in diam.; disc plane to convex, pale brown

Phyllospora in India... 41

Ficures 9-14. Habit. 9. Phyllopsora isidiotyla; 10. P kalbii; 11. PB. mauritiana; 12. P. nemoralis;

13. P. subcrustacea; 14. P. swinscowii. Bar = 2 mm

to brown; margin slightly raised and sometimes fibrillose. Exciple colourless to

brown; epihymenium hyaline; hymenium hyaline to yellowish; hypothecium

golden yellow, containing crystals which dissolve in K. Ascospores hyaline,

simple, bacilliform, narrowly ellipsoid to fusiform, 6-9 x 1-2 um. Pycnidia

yellowish; conidia straight, 4-8 x 1 um.

CHEMISTRY — Thallus K-, C-, KC-, PD-; no lichen substances in TLC.

SPECIMENS EXAMINED — INDIA: Kerala, PALGHAT DISTRICT, Siruvani, alt. 810 m, on

bark, 16.11.2006, B. Haridas 06-009686, 06-009824 (LWG); Tamil Nadu, PALNI HILLs,

Kodaikanal road, on way to Gumparai, alt. 914 m, on bark, 23.12.1970, K.P. Singh

70.1268 (LWG-AWAS); Shola near 18" mile of Kodaikanal road, alt. 1066 m, G. Foreau,

S.J. 4141 (LWG-AWAS).

42 ... Mishra & al.

Remarks — The most characteristic feature of P. mauritiana is large, adnate,

mostly isodiametric squamules, and golden yellow hypothecium. It is close to

P. breviuscula in squamule and prothallus characters, but the later species forms

thicker, elongated lobes.

Phyllopsora mauritiana was earlier reported from humid submontane forest

in Tanzania and Mauritius between altitudes of 600-1500 m (Timdal & Krog

2001). In India it is recorded from tropical to temperate areas in the state of

Kerala and Tamil Nadu between altitudes of 800-1066 m. It is a new species

for the country.

Phyllopsora nemoralis Timdal & Krog, Mycotaxon. 77: 85 (2001). Fig. 12

Prothallus thin, reddish brown. Thallus squamulose; squamules adnate,

granular to elongate, minute, 0.1-0.3 mm wide; upper surface glabrous, green,

fibrillose at the margin, isidiate. Isidia abundant, thin, short, cylindrical, rarely

branched. Cortex of type 1-2, 10-15 um thick; medulla containing crystals

dissolving in K.

Apothecia common, up to 2.0 mm in diam; disc plane to convex, dark brown

to black; margin raised. Exciple colourless; epihymenium hyaline; hymenium

colourless; hypothecium pale brown, containing crystals which dissolve in K.

Ascospores hyaline, simple, ellipsoid to fusform, 6-11 x 1-2 um. Pycnidia not

seen.

CHEMISTRY — ‘Thallus K+ yellow, C-, KC-, PD-; containing + argopsin and

atranorin in TLC.

SPECIMENS EXAMINED — INpIA: Assam, NORTH CACHAR HILLs DISTRICT, Hoflong, on

bark, 01.08.2005, D.K. Upreti & J. Rout 05-003568 (LWG); Mahur, on bark, Sept. 2005,

D.K. Upreti & J. Rout 05-009945/A (LWG).

Remarks — Phyllopsora nemoralisis characterized by the thin, small, shortisidia

and the colourless hymenium. It is close to P halei (Tuck.) Zahlbr., in having

a reddish brown prothallus and in the presence of atranorin, but that species

differs in having thick, erect isidia and a dark reddish brown hypothecium.

‘The other isidiate species, P. isidiotyla, differs in cortex type, while P furfuracea

contains furfuraceic acid.

Phyllopsora nemoralis was earlier known from woodland in Tanzania, La

Réunion and South Africa between altitudes of 1550-2010 m (Timdal & Krog

2001). In India it is recorded from temperate areas in the state of Assam at an

altitude of 1014 m. The species is new to the Indian lichen biota.

Phyllopsora subcrustacea (Malme) Brako, Mycotaxon 35(1): 15,1989. FIGURE 13

= Lecidea corallina var. subcrustacea Malme, Ark. Bot. 28A(7): 47. 1936.

Prothallus thick, reddish brown to red. Thallus squamulose; squamules first

adnate, later ascending, overlapping, minute 0.1-0.3 mm wide; upper surface

Phyllospora in India ... 43

glabrous, yellow-green to green, plane to convex, finely pubescent along the

margin. Isidia absent. Cortex of type 2, 8-20 tm thick, medulla containing

crystals dissolving in K.

Apothecia common, up to 1.5 mm in diam.; disc plane to convex, reddish-

brown; margin slightly raised and fibrillose. Exciple colourless to pale brown;

epihymenium hyaline; hymenium colourless to pale yellow; hypothecium

golden yellow, containing crystals which dissolve in K. Ascospores hyaline,

simple, narrowly ellipsoid to fusiform, 12-21 x 2-3 um. Pycnidia not seen.

CHEMISTRY — Thallus K-, C-, KC-, PD-; no lichen substances in TLC.

SPECIMENS EXAMINED — INDIA: Karnataka, SHIMOGA DISTRICT, Sagara to Talgappa,

Ulanhalli, alt. 697 m, on bark in evergreen forest, 16.02.2008, H.T. Lumsch, D.K. Upreti

& P.K. Divakar 19742/0/2 (LWG); Sagara, Muppane, alt. 626 m, on bark, 21.03.2001,

S. Nayaka 01-66191 (LWG); Shavauti River Basin, Holebagilu, alt. 650 m, on bark of

Diospyros crumenata, 16.03.2001, S. Nayaka 01-222798, 01-22276 (LWG); Kerala, IDUKKI

DISTRICT, Adimali Forest range, Chekuthon Mukku, alt. 750 m, on Turpinia malabarica

bark, 16.02.2006, B. Haridas 06-009606 (LWG); PALGHAT DIsTRICT, Parambikulam

Wildlife Sanctuary, alt. 800 m, on bark, 14.11.2006, B. Haridas 06-009603 (LWG).

Remarks — Phyllopsora subcrustacea is characterized by the minute, adnate to

ascending squamules and the fibrillose apothecia. It is close to P manipurensis

in having adnate squamules and in the absence of lichen substances but

that species differs in having small ascospores 5-10 x 2-2.5 um and a white

prothallus.

The species was earlier reported only from Paraguay (Brako 1991). In India

this species is known from tropical areas in the states of Karnataka and Kerala

between the altitudes of 300-800 m. It is new for the country.

Phyllopsora swinscowii Timdal & Krog, Mycotaxon 77: 88 (2001). Fic. 14

Prothallus thick, red to reddish brown. Thallus squamulose; squamules adnate,

overlapping, isodiametric, scattered when young, slightly imbricate, crenulate

to incised, 0.3-1.0 mm wide; upper surface glabrous, greenish to yellowish-

brown, sometimes pubescent along the margin, isidiate. Isidia common, simple,

cylindrical, medium thick, attached to the margin of the squamules. Cortex of

type 1-2, 5-10 um thick; medulla containing crystals dissolving in K.

Apothecia common, up to 1.5 mm in diam.; disc plane to convex, pale brown

to brown; margin slightly raised. Exciple colourless; epihymenium hyaline;

hymenium golden yellow; hypothecium colourless to pale yellow-brown,

containing crystals which dissolve in K. Ascospores hyaline, simple, narrowly

ellipsoid to fusiform, 5-8 x 1-2 um. Pycnidia not seen.

CHEMISTRY — Thallus K-,C-, KC-, PD+ orange; methyl 2,7-dichloropsoromate

and methyl 2,7-dicholoronorpsoromate in TLC.

SPECIMENS EXAMINED — Inp1a: Karnataka, SHIMOGA DISTRICT, Sagara, Mattikoppa,

alt. 603 m, on bark of Holigarna sp., 17.03.2001, S. Nayaka, 01-67383, 01-67390 (LWG);

A4 ... Mishra & al.

Hubse, alt. 594 m, on bark of Diospyros crumenata, S. Nayaka 01-222743, 01-67393/B

(LWG); Kerala, [pUKKI DisTRICcT, Pariyar Tiger, Reserve, Thekkady, Cheveloda, on bark,

22.03.2006, B. Haridas, 06-007969 (LWG).

REMARKS — Phyllopsora swinscowii is characterized by the PD+ orange reaction

and the red, thick prothallus. It is close to P africana Timdal & Krog, and

P. martinii Swinscow & Krog in having a PD+ orange reaction but both those

species contain different lichen substances.

The species has earlier been reported from woodland in East Africa, Kenya,

Mauritius, and Tanzania between altitudes of 300-1900 m (Timdal & Krog

2001). In India it is recorded from tropical areas in the states of Karnataka and

Kerala, between altitudes of ca. 100-600 m. It is a new species for the country.

Acknowledgements

We thank the director of the National Botanical Research Institute, Lucknow for

providing laboratory facilities, the Ministry of Environment and Forests and the council

of scientific and Industrial Research (CSIR-SIP 005), New Delhi for financial support,

members of Lichenology laboratory for their cooperation, Drs. Einar Timdal and G.P.

Sinha for their valuable comments on the manuscripts.

Literature cited

Awasthi DD. 2007. A compendium of the macrolichens from India, Nepal and Sri Lanka. Bishen

Singh Mahendra Pal Singh, Dehra Dun, India.

Brako L. 1989. Reevalutaion of the genus Phyllopsora with taxonomic notes and introduction of

Squamacidia gen. nov. Mycotaxon 35: 1-19.

Brako L. 1991. Phyllopsora (Bacidiaceae). Fl. Neotrop. Monogr. 55: 1-66.

Elix JA. 2006a. Five new species of Phyllopsora (lichenized Ascomycota) from Australia. Australas.

Lichenol. 58: 4-13.

Elix JA. 2006b. Additional lichen records from Australia 62. Australas. Lichenol. 60: 6-12.

Swinscow TDV, Krog H. 1981. The genus Phyllopsora, with a report on East African species.

Lichenol. 13(3): 203-247. doi:10.1017/S0024282981000315

Timdal E, Krog H. 2001. Further studies on African species of the lichen genus Phyllopsora

(Lecanorales). Mycotaxon 77: 57-89.

Timdal E. 2008. Studies on Phyllopsora (Ramalinaceae) in Peru. Lichenol. 40(4): 337-362.

Upreti DK, Divakar PK, Nayaka S. 2003. Notes on species of the lichen genus Phyllopsora in India.

Biblioth. Lichenol. 86: 185-191.

Walker FJ, James PW. 1980. A revised guide to microchemical techniques for the identification of

lichen products. Bull. Brit. Lich. Soc. 46(Suppl.): 13-29.

MYCOTAXON

Volume 115, pp. 45-52 January-March 2011

DOT: 10.5248/115.45

Studies in lichens and lichenicolous fungi: 7.

More notes on taxa from North America

JAMES C, LENDEMER*™’ & KERRY KNUDSEN?

'Cryptogamic Herbarium, Institute of Systematic Botany, The New York Botanical Garden,

Bronx, NY 10458-5126, USA

The Herbarium, Dept. of Botany & Plant Sciences, University of California,

Riverside, CA 92521-0124, USA

CORRESPONDENCE TO *: ‘jlendemer @nybg.org & ’knudsen@ucr.edu

ABSTRACT— Acarosporacomplanata, Fellhaneropsis myrtillicola, and Lecanora stramineoalbida

are reported new for North America north of Mexico. Acarospora superfusa is confirmed

as occurring in North America. Biatorella rappii is placed in synonymy with Ramonia

microspora.

Key worps— Appalachian Mountains, Magnusson, Sonoran Desert, SE coastal plain.

1. Acarospora complanata H. Magn., Svensk. Bot. Tidskr. 18: 332. 1924.

TyPE: FRANCE. PROVENCE-ALPES-COTE D’azur: Var Dist., Massif volcanique de la

Courtine, pres Ollisules, 1923, de Crozals (hb. B. de Lesd.[n.v.-presumed destroyed],

holotype; UPS! isotype).

Acarospora complanata was described from France (Magnusson 1924) and

Magnusson recognized it as occurring in Africa and Mexico (Magnusson 1929,

1956). The species forms a brown areolate orbicular thallus with inconspicuous

immersed apothecia and an effigurate margin with narrow lobes, a hymenium

80-90 uum high, paraphyses at mid-height mostly 2-2.5 um in diameter, and a

cortex that contains gyrophoric and lecanoric acids (KC+ pink). For a fuller

description see Magnusson (1929).

Morphologically, the species does not appear related to A. molybdina

(Wahlenb.) Trevis, A. macrocyclos Vain., or A. wahlenbergii H. Magn., which have

thicker rugulose thalli, thinner paraphyses, and pseudo-lecanorine apothecia

often in convex areoles. Instead, A. complanata appears morphologically

more closely related to A. trachyticola (Miill. Arg.) Hue, currently known only

from Peru (Magnusson 1929), from which it differs mainly in having a lower

A6 ... Lendemer & Knudsen

hymenium (80-90 vs. 100-120 um) and producing gyrophoric and lecanoric

acids (absent in A. trachyticola).

The concept of Acarospora complanata as revised by Clauzade & Roux

(Clauzade et al. 1981) differs from Magnusson’s concept of the species

(Magnusson 1929), which is the species concept used here. Acarospora

complanata sensu Magnusson (1929) has a thallus that reacts KC+ pink

(gyrophoric and lecanoric acids), but Clauzade & Roux (Clauzade et al. 1981)

synonymized seven species with A. complanata that all lack these substances.

These authors probably included more than one taxon in their concept of

A. complanata and a revision of their material is needed.

Acarospora complanata was included in the checklist of lichens of North

America north of Mexico (Egan 1987) because A. obscura H. Magn., which

was reported by Magnusson (1956) from California, was one of the seven

species synonymized with A. complanata by Clauzade & Roux (Clauzade et al.

1981). The type specimen of A. obscura was collected in Mexico and was in the

herbarium of Bouly de Lesdain. It is presumed to be lost, but Magnusson (1929,

1956) treated A. obscura as a C- and KC-, species with a non-effigurate and

non-orbicular thallus. The one specimen identified as A. obscura by Magnusson

that was seen during the Sonoran Flora Project, was actually A. veronensis

A. Massal. (Knudsen 2008).

Bruce McCune collected A. complanata s. str. in Montana just west of Pine

Butte Swamp in the limestone steppes and we here report the species as new

to North America north of Mexico. The McCune specimen is overgrowing

another lichen, but the behavior appears competitive (for space) rather than

parasitic.

NortH AMERICAN SPECIMEN EXAMINED— U.S.A. MONTANA. TETON Co.: 47°50°N,

112°36’W, 1480 m, on limestone outcrops, viii.1985, McCune 15165 (hb. McCune).

2. Acarospora superfusa H. Magn., Meddel. Géteborgs Bot. Tradgard 5: 65.

1930.

Type: U.S.A. NEw Mexico: Las Vegas, 2000 m., 1927, Broward (hb. de Lesd. [n.v.-

presumed destroyed], holotype; UPS!, isotype).

During the Sonoran Flora Project, a small number of specimens of Acarospora

superfusa were seen, including the isotype. These were distinctly pruinose and

broadly attached to the substrate because the specimens were predominately

reduced or young and, consequently, Knudsen (2008) included A. superfusa

within a broad concept of A. veronensis.

The study of additional, recently collected specimens led to the observation

that unlike Acarospora veronensis, mature specimens of A. superfusa have larger

pruinose areoles (0.5-1.5 vs. 0.2-0.5 um) and one apothecium per areole (rather

than up to six smaller apothecia) (Magnusson 1929, 1930; Knudsen 2008) The

North American lichen records 7 ... 47

Figure 1. A, a complanata (McCune 15165, scale = 1.0 mm). B-C, Lecanora

stramineoalbida (Lendemer 20785, scale = 1.0 mm and 0.25 mm respectively).

areoles of A. superfusa become gomphate (i.e., have an elongated mycelial base),

and eventually lobulate and squamulose, developing a short stout stipe half the

width of the squamule, rather than remaining broadly attached to the substrate

as in A. veronensis. Otherwise, as observed by Magnusson (1930), in terms of

cortical measurements, etc., A. superfusa is similar to A. veronensis.

Acarospora superfusa can also be confused with A. nicolai B. de Lesd. or

pruinose specimens of A. obpallens (Nyl. ex Hasse) Zahlbr. However, both

species produce gyrophoric and lecanoric acids. Thalli of A. obpallens further

A8 ... Lendemer & Knudsen

differ by the presence of faveoles (Knudsen 2008), while A. nicolai differs in not

becoming squamulose (Knudsen & Morse 2009). All three of the above species

are sympatric from the Greater Sonoran Desert Region eastward to Oklahoma

in the Great Plains.

Acarospora versicolor Bagl. & Carestia, which occurs in Europe and Siberia

(Magnusson 1929; Clauzade et al. 1981), also appears to be closely related to

A. superfusa, but has a higher hymenium on average (100-110 vs. 80-90 um), a

slightly thicker cortex, and narrower paraphyses (1.0-1.5 vs. 1.8-2.5 um).

While revising specimens at the Farlow Herbarium (FH) a specimen of

Acarospora superfusa from New Mexico was discovered that Magnusson had

identified as A. cinereoalba (Fink) H. Magn. Based on this evidence it is likely

that all the reports of A. cinereoalba from New Mexico by Magnusson (1930)

are A. superfusa. Acarospora cinereoalba was originally described by Fink

(1899) from Illinois and Minnesota as a variety of A. cervina (Ach.) A. Massal.

We consider A. cinereoalba to be a pruinose morphotype of A. veronensis.

While such pruinose specimens of A. veronensis are rare in North America

they do occur, especially near waterfalls or on rocks were water settles and

evaporates. Specimens of A. superfusa that are young or reduced and have not

become gomphate or stipitate may be indistinguishable from pruinose forms of

A. veronensis.

The protologue of Acarospora superfusa (Magnusson 1930) does not include

an etymology. It is not known what Magnusson meant by the inclusion of

“fusa” in the epithet. While he might have meant “fusca” (brown) alluding to a

similarity to Acarospora fusca B. de Lesd., he nonetheless retained the original

spelling 26 years later (Magnuson 1956) and we do the same here.

SPECIMENS EXAMINED— CANADA. SASKATCHEWAN: Rural Municipality of Waverley

No. 44, Grasslands National Park, eroded bluff overlooking McGowan Creek Valley, on

acidic rock, 49°03’54”N, 106°3127”W, 899 m, 19.vi.2009, Freebury 859 (hb. Freebury);

eroded hilltop on mixed-grass prairie, on acidic sandstone, 898 m, 12.ix.2009, Freebury

999 (hb. Freebury). U.S.A. CALIFORNIA. SAN BERNARDINO Co.: San Bernardino

Mountains, Clark Mountains, east edge of wash south of Pachalka Springs, 35°30°44”

N, 115°37°17”W, 1548 m, on Hcl- boulder, rare, 11.x.2009, Knudsen 11769 & Pietrasiask

(UCR). San DigGo Co.: Anza Borrego Desert State Park, Plum Canyon, 33°06'28"N,

116°25’43”W, 688 m, on granite boulder in wash, rare, 22.ix.2005, Knudsen 3665 e&

Marsden (UCR). OKLAHOMA. GREER Co.: Quartz Mountain Arts & Conference

Center, along New Horizon Trail, 34°53’35”N, 99°18'05” W, 482-588 m, on pink granite

outcrops, 10.iv.2007, Morse 15048 & Ladd (KANU, NY, UCR).

3, Fellhaneropsis myrtillicola (Erichsen) Sérus. & Coppins, Lichenologist,

28(3): 199. 1996.

TyPE: GERMANY: Schleswig-Holstein, Lauenburg, im Sachsenwald bei Friedrichsruh, an

Vaccinium myrtillus am Rande des Reviers Saupark, 2.xi.1924, Erichsen (HBG [n.v.],

holotype).

North American lichen records 7... 49

Figure 2. A, Acarospora superfusa (Freebury 999, scale = 0.5 mm). B, Ramonia microspora

(Lendemer 20125, scale = 0.2 mm). C, Fellhaneropsis myrtillicola (Buck 50138, scale = 0.2 mm).

During the 2006 H.L. Bloomquist Foray, William Buck collected an interesting

foliicolous lichen on Rhododendron leaves at the base of a waterfall at a high

elevation site in the southern Appalachian Mountains. Foliicolous lichens

50 ... Lendemer & Knudsen

are not uncommon on evergreen leaves in high humidity microhabitats in

this region; however they are only rarely collected. This collection remained

unidentified until recently when Robert Liicking agreed to examine it and

determined it to represent Fellhaneropsis myrtillicola. This is the first report of

the species from North America and at his request we are publishing it here.

Fellhaneropsis Sérus. & Coppins resembles Fellhanera Vézda in most respects,

differing in exciple type and in having filiform-sigmoid (vs. bacilliform)

conidia (Sérusiaux 1996; Liicking 2008). Although Fellhanera species are

common in the southern Appalachians, using the key provided by Harris &

Lendemer (2009) none can easily be confused with Fellhaneropsis on account

of the different conidia. Felhaneropsis myrtillicola can be separated from other

Pilocarpaceae in the region by its filiform-sigmoid conidia, 3-septate hyaline

ascospores, and very small dark brownish-black convex immarginate apothecia.

For a full description see Sérusiaux (1996). Fellhaneropsis vezdae (Coppins & P.

James) Sérus. & Coppins has also been reported from western North America

(Tenbserg 1997), however it differs from E myrtillicola in having 5-septate

ascospores,

SPECIMEN EXAMINED— U.S.A. NORTH CAROLINA. JACKSON Co.: Nantahala National

Forest, Panthertown Valley, vicinity of Schoolhouse Falls along Greenland Creek, 1190

m, hemlock-pine-hardwood forest with gneissic exposures, on Rhododendron leaves,

29.iv.2006, Buck 50138 (NY).

4. Lecanora stramineoalbida Vain., J. Bot. 34: 35. 1896.

Type: SAINT VINCENT: Richmond Valley, Elliott 239 (TUR-V 5582 [n.v.], holotype).

While collecting on Sapelo Island, Georgia, in December 2009, the first author

collected an unusual Lecanora species with a dark (vs. hyaline) hypothecium

on Juniperus in a dense coastal maritime forest. Using the revision of Lecanora

species with dark hypothecia by Lumbsch et al. (1996) the collection keyed to

L. stramineoalbida, a rare species from the West Indies. This is the first report of

the species from North America. Lecanora stramineoalbida can be recognized by

its corticolous habit, sessile apothecia, epihymenium with crystals that dissolve

in K, brown K- hypothecium, and the production of 2’-0-methylperlatolic acid

in addition to atranorin. For a full description refer to Lumbsch et al. (1996).

SPECIMEN EXAMINED— U.S.A. GEORGIA. McINTOSH Co. : Sapelo Island, behind Nanny

Goat Beach, on Juniperus branch, 15.xii.2009, Lendemer 20785 (NY).

5, Ramonia microspora Vézda, Folia Geobot. Phytotax., 1: 162. 1966.

TyPE: ARGENTINA. JUjUY PRov.: Laguna de la Brea, 1901, R.E. Fries (S [n.v.], holotype)

= Biatorella rappii Zahlbr., Ann. Mycol. 29: 82. 1931, syn. nov.

[non Ramonia rappii Vézda 1966}.

Type: U.S.A. FLORIDA. SEMINOLE Co.: Mecca, xii.1923, on Carpinus, Rapp (W [n.v.],

holotype; FLAS-27141!, isotype).

North American lichen records 7... 51

Ramonia microspora is a minute, easily overlooked, crustose lichen that is

widespread throughout the Coastal Plain of southeastern North America. For

a full description see Vézda (1966). It can be distinguished from other species

of Ramonia using the key to the genus provided by Lendemer & Knudsen

(2008). Recently Richard Harris pointed out that the type of Biatorella rappii is

conspecific with R. microspora. Although B. rappii is the older name, the epithet

“rappii” is preoccupied in Ramonia by R. rappii Vézda. Thus B. rappii should

be placed in synonymy with R. microspora, and we do so here. A selection of

specimens documenting the geographic distribution of this species in North

America is provided below.

SPECIMENS EXAMINED— U.S.A. ARKANSAS. FRANKLIN Co.: Ozark National Forest,

Boston Mountain Ranger District, Shores Lake, 17.x.2005, Harris 51759-A (NY).

GEORGIA. CANDLER Co.: Charles Harold TNC Preserve, 22.xii.2009, Lendemer et al.

21756 (NY). PreRcE Co.: Little Satilla Wildlife Management Area, 21.xii.2009, Lendemer

et al. 21515 (NY). LOUISIANA. EAST BATON ROUGE PaRISH: Burden Research Plantation,

16.v.1979, Tucker 18603-A (NY). Missouri. BUTLER Co.: Big Cane Conservation Area,

23.x.2001, Harris 45255 (NY). NORTH CAROLINA. CAMDEN Co.: Dismal Swamp State

Park, 10.xii.2009, Lendemer 20125 & Williams (NY). CARTERET Co.: Bogue Banks,

Theodore Roosevelt Natural Area, 20.iii.2003, Buck 43860 (NY). JONES Co.: Croatan

National Forest, Catfish Lake South Wilderness, 17.iii.2003, Buck 43723 (NY). PENDER

Co.: Holly Shelter Game Land, 18.iii.2003, Buck 43757 (NY). SoUTH CAROLINA.

AIKEN Co.: Savannah River Bluffs Heritage Preserve, 13.iii.2010, Harris 55994-A (NY),

Lendemer 21954 (NY).

Acknowledgments

We thank our reviewers, Alan Fryday and M. Gékhan Halici. For the loan of

specimens we thank the curators of F FH, KANU, KRAM and UPS as well as A. Flakus

(Poland) and Bruce McCune (Oregon State University).

Literature cited

Clauzade G, Roux C, Rieux R. 1981 [1982]. Les Acarospora de Europe occidentale et de la region

méditerranéenne. Bulletin du Musée d’Histoire Naturelle de Marseille 41: 41-93.

Egan RS. 1987. A fifth checklist of the lichen-forming, lichenicolous and allied fungi of the

continental United States and Canada. The Bryologist 90(2): 77-173. doi:10.2307/3242609

Fink B. 1899. Contributions to a knowledge of the lichens of Minnesota, IV. Lichens of the Lake

Superior Region. V. Lichens of Minnesota Valley and southwestern Minnesota. Minnesota

Botanical Studies 18-19: 215-329.

Harris RC, Lendemer JC. 2009. The Fellhanera silicis group in eastern North America. Opuscula

Philolichenum 6: 157-174.

Knudsen K. 2007 [2008]. Acarospora In: Nash II, TH, Gries, C, Bungartz, F. (eds.). Lichen Flora

of the Greater Sonoran Region, Vol. 3. Lichens Unlimited, Arizona State University, Tempe,

Arizona, pp. 1-38.

Knudsen K, Morse CA. 2009. Acarospora nicolai (Acarosporaceae), a rediscovered species. The

Bryologist 12: 147-151. doi:10.1639/0007-2745-112.1.147

Lendemer JC, Knudsen K. 2008. Ramonia vermispora, a new species from the Sonoran Desert

region of southwestern North America. Opuscula Philolichenum 5: 83-88.

52 ... Lendemer & Knudsen

Licking R. 2008. Foliicolous Lichenized Fungi Flora Neotropica Monograph, 103. Published by

The New York Botannical Garden Press, 866 pp.

Lumbsch HT, Guderley R, Elix JA. 1996. A Revision of Some Species in Lecanora Sensu Stricto

with a Dark Hypothecium (Lecanorales, Ascomycotina). The Bryologist 99(3): 269-294.

doi: 10.2307/3244300

Magnusson AH. 1924. New species of the genus Acarospora. Svensk Botanisk Tidskrift 18:

329-342.

Magnusson AH. 1929. A monograph of the genus Acarospora. Kungl. Svenska Vetenskaps-

Akademiens Handlingar, Stockholm, ser. 3, 7(4): 1-400.

Magnusson AH. 1930. The lichen genus Acarospora in New Mexico. Meddelelser fran Géteborgs

Botaniska Tradgard 5: 55-72.

Magnusson AH. 1956. A second supplement to the monograph of Acarospora with keys. Goteborgs

Kungl. Vetensk.- & Vitterhets.-Samhalles Hand1., sjatte foljden ser. B 6(17): 1-34.

Sérusiaux E. 1996. Foliicolous lichens from Madeira, with the description of a new genus and two

new species and a world-wide key of foliicolous Fellhanera. The Lichenologist 28(3): 197-227.

doi:10.1006/lich.1996.0019

Tonsberg T. 1997 [1998]. Additions to the lichen flora of North America VI. The Bryologist 100(4):

522-524. doi:10.2307/3244417

Vézda A. 1966. Flechtensystematische Studien II. Die Gattungen Ramonia Stiz. und Gloeolecta

Lett. Folia Geobot. Phytotax. 1: 154-175. doi:10.1007/BF02989091

MYCOTAXON

Volume 115, pp. 53-63 January-March 2011

DOT: 10.5248/115.53

Phyllactinia sebastianiae sp. nov. on Sebastiania brasiliensis

MARIA GRACIELA CABRERA! & GERNOT VOBIS?

"Universidad Nacional del Nordeste, Facultad de Ciencias Agrarias,

Sargento Cabral 2131, 3400, Corrientes, Argentina

*Universidad Nacional del Comahue, Centro Reg. Universitario Bariloche Quintral,

1250, 8400 San Carlos de Bariloche, Rio Negro, Argentina

* CORRESPONDENCE TO: cabrera@agr.unne.edu.ar

ApsTRAcT — The new powdery mildew species Phyllactinia sebastianiae on Sebastiania

brasiliensis (Euphorbiaceae) is described. This species was collected in Corrientes, Argentina,

and is well characterized by conidiophores with twisted foot-cells and dimorphic conidia

(lanceolate primary conidia and oblanceolate to ellipsoid-ovoid secondary conidia),

indicating an anamorph belonging in the genus Streptopodium. Detailed descriptions and

illustrations of both anamorph and teleomorph states of the new species are given, and it is

compared with morphologically similar taxa.

Key worps — Erysiphales, taxonomy

Introduction

Recent collections ofinfectedleaves of Sebastiania brasiliensis (Euphorbiaceae)

from local forests of Corrientes, a northeastern province of Argentina, showed

severe symptoms of powdery mildew. Sebastiania brasiliensis is a native tree

of South American subtropical rain forests phytogeographically characterized

as “Provincia Paranaense” ‘The region has a warm and humid climate, with

precipitations of about 1500 mm per year, more abundant in summer. The

medium temperature of the year in this region is 20-21°C (Cabrera 1976).

S. brasiliensis (“lecheron” or “palo de leche”) grows wild in Corrientes in virgin

forests, along path edges and ditches, or untilled landscapes. It is a species

without timber value but is used as an ornamental due to its conspicuous waxy

leaves.

The anamorphic genus Oidium Link. seems to be the predominant

representative of Erysiphales on plants of the Euphorbiaceae in the “Paranaense”

region. Many species (eg. Acalypha wilkesiana Maéll.-Arg., Croton

bonplandianus Baill, C. glandulosus L., Euphorbia heterophylla L., E. hirta L.

var. hirta, E. tithymaloides L., Jatropha curcas L., J. breviloba (Morong) Pax &

54 ... Cabrera & Vobis

K. Hoffm., Manihot esculenta Crantz, Microstachys hispida (Mart.) Govaerts)

are infected by Oidium spp. These unpublished data supplement the data

given in Amano (1986), who listed only Oidium spp. and Phyllactinia suffulta

(Rebent.) Sacc. on Sebastiania sp.

Other South American records of Phyllactinia Lév. refer to collections on

Erythrina spp. (Fabaceae) and Morus alba L. (Moraceae) (Mazzanti & Cabrera

1985). Additional South American species (Braun 1987, Havrylenko 1995,

Havrylenko et al. 2006) include Phylactinia adesmiae Havryl. on Adesmia

(Fabaceae), P. ampulliformis Havryl. on Discaria (Rhamnaceae), P. antarctica

Speg. on Ribes (Grossulariaceae), and P. chubutiana Havryl. et al. on Lycium

(Solanaceae) from Argentina and P. caricaefolia Viégas on Carica (Caricaceae)

and P. chorisiae Viégas on Chorisia (Bombacaceae) from Brazil.

In this work, a new powdery mildew on S. brasiliensis is treated in detail and

compared with allied species.

Materials & methods

During 2007 and 2008, leaves showing symptoms of powdery mildew were collected

from adult plants in the field. All sites are situated in the province of Corrientes,

Argentina (see MATERIAL EXAMINED).

Anatomical observations

The fungal fruiting bodies were carefully scraped from the leaf surfaces with

moistened pointed dissection needles and mounted in distilled water. The specimens

were then stained and embedded with lactophenol cotton blue (LB) (Gams et al.

1980). Penicillate cells were stained with lactofuchsin (LF) (Carmichael 1955) over

a small flame (Shin & Lee 2002). Hyphae, conidiophores, and conidia were stripped

from the leaf surfaces with clear adhesive tape and mounted in water, LB, or LF on a

microscope slide with the fungal material uppermost. Dried herbarium material was

first restored by boiling a small piece of infected leaf in a drop of lactic acid (Shin & La

1993) before being examined as described above. In order to observe the endophytic

mycelium, the technique of leaf clearing of Liberato et al. (2005) was used. In each case,

fifty measurements of structures of taxonomical value (x 400 magnification) were made,

with the average given in parentheses.

CONIDIAL GERMINATION — Conidial germ tubes were observed by incubation on

glass slides in damp chambers at room temperature and pressing a sporulating leaf surface

directly onto a slide or dislodging conidia by tapping an infected leaf (Boesewinkel 1980,

Cook & Braun 2009). In addition, the inoculation on the epidermis of onion scales was

used (To-anum et al. 2005). In both cases, the conidia were incubated at 20°-25°C for

24 h until microscopic observation.

LIGHT MICROscopy — Micrographs were taken with a NIKON SC 102 light

microscope and a camera Sony Cyber-shot 4.1 mpegmovie VX.

SCANNING ELECTRON MICROSCOPY — Fresh leaves with the most suitable areas with

powdery mildew symptoms were selected for detailed study. Small pieces about 5 mm?

were cut out and fixed for 48 h in FAA. The samples were washed, dehydrated, critical

Phyllactinia sebastianiae sp. nov. (Argentina) ... 55

point dried, and sputter coated with gold according to D‘ Ambrogio de Argtieso (1976).

SEM preparations were observed in a JEOL 5800 LV microscope.

Taxonomy

Phyllactinia sebastianiae M.G. Cabrera & Vobis, sp. nov. Figures 1-6

MycoBank MB 518796

Phyllactiniae robiniae morphologice valde similis, sed conidiophoris ad 287.5 um longis,

conidiis ad 120 x 28 um, conidiis secundariis oblanceolatis vel ellipsoideis-ovoideis, truncis

cellularum penicillatarum chasmotheciorum minoribus, 25-30 x 15-25 um, simplicibus

vel bifurcatis, ascis 2-sporis.

Type: Argentina, Corrientes province, Santa Ana de los Guacaras, on living leaves of

Sebastiania brasiliensis Spreng. (Euphorbiaceae), 6 Jun. 2007, M.G. Cabrera. (Collection

Ne 442; CTES 0591005, holotype; BCRU 05146, isotype).

EryMoLocy: derived from the name of the host genus, Sebastiania.

Symptoms ‘The symptoms of typical powdery mildew were restricted to the

leaves of Sebastiania brasiliensis trees. Forming at first rounded to irregular

patches of 0.5 to 1 cm in diameter, the fungal parasite developed typical mycelia

on both sides of the leaves, predominantly on the adaxial surface (Fic. 1 AB).

‘The infections varied and were more abundant on mature than on young leaves.

During mycelial development, the leaves changed in color from green to yellow

and copper-colored. At a later stage, the most affected areas turned golden-

brown (Fic. 1B). The leaves lost their flexibility, dried, and became fragile but

kept their flat form. Extensively colonized leaves showed slight chlorosis and

later developed a tan necrosis (Fic. 1AB).

The initial mycelia were white, causing a yellowing of the host tissue.

Subsequently, the mycelia became denser and changed to yellowish or ash-

colored by producing abundant conidia. At this stage, the fungus showed the

typical powdery aspect. A hyperparasitic Cladosporium sp. frequently slowed

down the development of the mycelium, finally destroying it, and darkening

the surface of the leaves.

Throughout the year, the foliage of the trees of S. brasiliensis was attacked

by the powdery mildew in an irregular manner. During the summer, from

November to April, the mycelia were scarce, rather opaque, and shriveled. Only

slight production of turgescent conidia could be observed. The more remarkable

infections were detected during the cold and frosty winter months from May

to August, but sometimes also through all seasons, especially on trees growing

in shady habitats or in perennially humid environments. In severe attacks,

the diseased plants appeared highly deteriorated with completely defoliated

branches.

MyceELIuM Two types of mycelia developed: external and internal.

The ectophytic mycelium is amphigenous, at first delicate, later becoming

dense, effuse at maturity, moderately thick and subpersistent, more compressed

56 ... Cabrera & Vobis

Figure 1. Phyllactinia sebastianiae aspect. A. Powdery mildew symptoms and occurrence

of chasmothecia on S. brasiliensis leaves. B. Mycelia covering the adaxial surfaces (1 and 3),

and abaxial surfaces (2 and 4). C. Group of immature and mature chasmothecia on mycelium.

D. Chasmothecium with acicular appendages

with age. The mycelium is initially whitish, later yellow. Finally, the external

mycelium covers the whole surface of the leaf (Fic. 1AB). The ectophytic

hyphae are almost straight to sinuous, sometimes geniculate, hyaline, thin-

walled, smooth and septate, branched, with long cells, 44(72.5)140 x 3.75(5.8)8

uum (Fic. 3CD). Appressoria are solitary, variable in shape, ranging from nipple-

shaped, lobed to almost coralloid to hooked or slightly forked (Fics. 3F 6E).

‘The appressoria are generally not very abundant.

In addition, a typical endophytic mycelium is developed (Fic. 3C). In

transverse sections of the leaf, hyaline, branched hyphae were observable

within the host plant tissue (Fic. 5A). Globose haustoria formed terminally on

short hyphal side branches (Fic. 5B). Ectophytic and endophytic mycelia are

connected by hyphae emerging through the stomata (Fic. 3C).

ConipiopHoRrEs The anamorphic structures are characterized by hyaline

conidiophores, which arise directly from the external mycelium (Fic. 3D). They

are 75(158)287 um long and 5(6.78)8 um wide. The basal septa are situated

above the junctions with the supporting ectophytic hyphae, up to about 7.5 um

Phyllactinia sebastianiae sp. nov. (Argentina) ... 57

Ficure 2. Characteristics of Phyllacinia sebastianiae conidia. AC. Primary conidia. DE. Secondary

conidia. Germ tube development in B, C and E. (Bar: 25 um)

(Fic. 6E). The long foot-cell, 37(158)250 x 5(6.78)8 tum, is twisted in 1-3 loops

or sinuous at its base (Fic. 3D) and followed by 1 or 2 shorter cells (Fic. 6E).

Conipia The conidia are developed singly at the apex of the conidiophore

(Fic. 6E). Sometimes two conidia are produced successively. They are one-

celled and hyaline with thin walls. Young conidia are slightly rough, becoming

rougher or slightly reticulate when mature (Fics. 2DE 3E). In young conidia,

the cytoplasm is hyaline with abundant vacuoles of different sizes (Fic. 2A).

Oil drops can also be observed (Fic. 2B). Two types of conidia are produced

(Fic. 6E). The primary conidia are lanceolate and apically pointed (Fics. 2AC

4E), whereas the secondary conidia are more oblanceolate to ellipsoid-ovoid

(Fics. 2DE 3F). Primary and secondary conidia have similar sizes (57.5(78)120

x 14(24)28 um).

CONIDIAL GERMINATION ‘The germ tubes are usually produced in a subapical

position, sometimes also laterally or at both apices. They are 70-95 um long and

develop unlobed or multilobed appressoria (Fics. 2BCE 3F 6E). Under natural

conditions, the germination rate for both primary and secondary conidia was

moderate (70%). Laboratory assays demonstrated a lower germination rate,

23% for the incubation method on glass slides, and 29% for inoculation on

onion scales.

58 ... Cabrera & Vobis

Ficure 3. Teleomorphic structures of Phyllactinia sebastianiae (holotype). A. Anatomical structures

of ascomata. B. Superficial vision of numerous filaments and penicillate cell. C. Peridial cells and

basal penicillate cell D- Immature ascus and ascospores E. Pedicellate immature ascus. F. Immature

ascospores. ((Bar: A,B, 50 tum; C,F. 25 um; D. 15 wm; E. 12 um)

CHASMOTHECIA The chasmothecial ascomata are gregarious or scattered

on both surfaces of the leaves (Fic. 1AC). They are spherical when young

(Fic. 4A), becoming later distinctly depressed at the lower side (Fic. 1D). The

color of the initials of the fruiting bodies is white, changing to pale yellow

and orange, and finally turns dark brown or nearly black when mature (Fic.

1CD). The well developed chasmothecia have diameter of 142(180)250 um. The

peridium consists of polygonal cells with thick and dark walls. (Fics. 3A 4A

6A). They measure 6.25(10)12.5 um in diameter.

APPENDAGES Each individual fruiting body presents two types of appendages:

acicular appendages and penicillate cells.

The acicular appendages are arranged in equatorial position. Each

chasmothecium bears 9(17)22 acicular appendages (Fic. 3A), which are rigid,

hyaline, with thick walls, having a crystalline or vitreous appearance (Fic. 1D).

Their bases are swollen, forming a 27.5(32.5)40 um diam., globular structure,

and the apexes are pointed (Fic. 6AC). The acicular appendages are variably long

(107(195)312.5 um), generally exceeding the diameter of the chasmothecium.

Phyllactinia sebastianiae sp. nov. (Argentina) ... 59

Figure 4. SEM Micrographs of Phyllactinia sebastianiae. A. Development of penicillate cells on

chasmothecia. B. Young penicillate cells and acicular appendages of immature ascoma (500x).

C. Hypha protruding from a stoma (2000x). D. Conidiophores and hyphae of external mycelium

and conidiophores (1000x). E. Rough conidium outer surface (1700x). F. Germ tube with

appressorium of secondary conidium (700x)

The penicillate cells, which are located on the upper side of the ascoma

(Fics. 3B 4B), are composed of a stem that bears free thin filaments (Fics. 4B

6B) and is connected to the peridium and protrudes from the surface of the

ascoma wall (Fic. 4C). The stem is roughly cylindrical, 25-30 x 15-25 um,

occasionally bifurcate in its upper part and extending into numerous, thin,

25-70 um long filaments. The stem walls are thin and the filaments are embedded

in a mucilaginous mass that covers completely the top of the chasmothecium

(Fic. 3B).

ASCI AND ASCOSPORES Various specimens, collected from the same sites

during different periods over two years, were investigated, but material with

totally mature asci was never observed. The description is based on collections

obtained in winter, the most favourable season for growth and development of

reproductive structures. The asci are arranged in clusters inside the ascoma.

They are broadly clavate to globoid, with well-developed pedicels (Fics. 4DE

6D).

The ascus walls are thin and hyaline. The asci are 50-57.5 x 32.5-37.5

tum. It is estimated that about 10% of the asci produce ascospores under the

above characterized natural conditions. A number of 2-3 ascospores per ascus

perhaps can be observed. The ascospores are hyaline, ellipsoidal to ovoid

(Fic. 6D), having a dense cytoplasm, which contains 2-3 yellow oil drops

(Fics. 2F), They are 25-37.5 um long and 18-22.5 um wide.

ADDITIONAL SPECIMEN EXAMINED: ARGENTINA. CORRIENTES PROVINCE, Santa Ana

de los Gudcaras, near National Route 12 (S 27°2’; W 58°23’), 4 June 2007, R.E. Alvarez

Ne 441 (CTES 0591004).

60 ... Cabrera & Vobis

Ficure 5. Phyllactinia sebastianiae A. Endophytic hyphae within S. brasiliensis leaf. B. Formation

of haustoria.

Discussion

Although the median temperature of the year in the Paranaense

phytogeographical region is 20-21°C (Cabrera 1976), in the province of

Corrientes the temperature ranges from —2.8°C to 42.4°C (median temperature

26.8°C) (Sanchez et al. 2007). This thermic variation is important for its

influence on chasmothecial maturity. During the growing season the fungus

produces mainly the anamorphic stage. Ascospores were usually immature.

The fungus exhibits the typical anamorphic morphology of Streptopodium

R.Y. Zheng & G.Q. Chen as circumscribed by Braun (1987), characterized

by a hemiendophytic mycelium that enters the leaf tissue through stomata

(Fic. 3C) and dimorphic conidia (Fic. 6E). The conidia outer walls are verrucose

when viewed by SEM (Fic. 3E), and the conidiophores have sinuous bases

(Fic. 3DF). Ascoma characters agree with those of the genus Phyllactinia.

Amano (1986) registered Oidium sp. and Phyllactinia suffulta on Sebastiania

sp. However, the anamorph of P guttata (Wallr.) Lév. (the current name for

P. suffulta) belongs to Ovulariopsis Pat. & Har. (Takamatsu et al. 2008), which

is characterized by straight conidiophores. The anamorph of the fungus we

observed on S. brasiliensis does not belong to Ovulariopsis, and the teleomorph

is not conspecific with P. guttata (Braun 1987). Furthermore, the conidiophore

foot-cells are spirally twisted or sinuous. Several Phyllactinia spp. with twisted

Phyllactinia sebastianiae sp. nov. (Argentina) ... 61

Ficure 6. Phyllactinia sebastianiae (holotype). A. Chasmothecium with peridial cells

and appendages. B. Numerous filaments on penicillate cells. C. Acicular appendage with

swollen base. D. Pedicellate ascus and ascospores. E. Conidiophores with sinuous basal

cells. F. Primary and secondary conidia. (Bar: A, 20 um; B, 40 um; C-F, 20 um)

conidiophore foot-cells and dimorphic conidia are known, butall of them inhabit

hosts of unrelated families. Phyllactinia robiniae U. Braun & Yafiez-Morales is

morphologically close to P. sebastianiae but differs in having shorter (70-130

um) conidiophores, narrower (40-70 x 12-22 tum) clavate secondary conidia,

penicillate cells with narrower stems (25-50 x 8-18 tm), several short terminal

branchlets, and 2-spored asci (Braun & Yafiez-Morales 2009). Phyllactinia

erythrinae-americanae Yafiez-Morales & U. Braun (Braun & Yafiez-Morales

2009) is distinguished by its conidiophores with basal septa elevated 10-35 um

above the junction with the supporting hypha. Furthermore, the twisted part

of the conidiophores is usually confined to the portion below the basal septum.

The Phyllactinia sp. on Erythrina spp. in Argentina (Mazzanti de Castanén &

62 ... Cabrera & Vobis

Cabrera de Alvarez 1985) is morphologically rather close to the latter species

but differs in having larger chasmothecia with a larger number of appendages.

The taxonomy of these collections from Argentina is not yet clear (Braun &

Yafiez-Morales 2009). Phyllactinia caricaefolia on Carica papaya in Brazil

is also characterized by forming dimorphic conidia but this species is easily

distinguishable from P. sebastianiae by its much smaller ascomata and distinctly

clavate secondary conidia (Viégas 1944, Liberato et al. 2004). Streptopodium

caricae Liberato & R.W. Barreto (Liberato et al. 2004) is probably the anamorph

of P. caricaefolia. Phyllactinia chorisiae on Chorisia speciosa in Brazil is another

species with dimorphic conidia, but the conidiophores are straight and the

secondary conidia distinctly clavate (Liberato 2007). Phyllactinia dalbergiae

Piroz. on hosts of the Fabaceae possesses conidiophores with twisted foot-cells,

but the conidia are uniformly clavate (Mukerji 1968, Braun 1987).

Acknowledgements

We are much obliged to Dr. Havrylenko and Dr. Braun for their valuable suggestions

on the original manuscript and to Ing. Agr. R-E. Alvarez for his valued collaboration in

collecting specimens. Financial support for this research was provided by Universidad

Nacional del Nordeste.

Literature cited

Amano (Hirata) K 1986. Host range and geographical distribution of the powdery mildews fungi.

Japan Scientific Societies Press, Tokyo. 741 p.

Boesewinkel HJ. 1980. The morphology of imperfect states of powdery mildews (Erysiphaceae).

Botanical Review 46(2):167-224. doi. 10.1007/BF02860869

Braun U 1987. A monograph of the Erysiphales (powdery mildews). Beihefte zur Nova Hedwigia

89: 1-700.

Braun U Yafiez-Morales M 2009. Phyllactinia and Ovulariopsis species on legumes. Mycotaxon

109: 145-160.

Cabrera AL. 1976. Regiones fitogeograficas Argentinas. Enciclopedia Argentina de Agricultura y

Jardineria 2(1): 1-85. Kluger WF (ed). ACME Buenos Aires.

Carmichael JW. 1955. Lacto-fuchsin: A new medium for mounting fungi. Mycologia 47: 611.

Cook RTA, Braun U. 2009. Conidial germination patterns in powdery mildews. Mycological

Research 113: 616-636. doi: 10.1016/j.mycres.2009.01.010

D*‘Ambrogio de Argiieso A. 1986. Técnicas de preparacién del material para ser observado con

MEB (microscopio electrénico de barrido). 60-63, in: Manual de Técnicas en Histologia

Vegetal. Editorial Hemisferio Sur SA. Buenos Aires, Argentina.

Gams W, Aa HA van der, Plaats-Niterink AJ van der, Samson RA & Stalpers JA. CBS Course of

Mycology. 2™. ed. 1980. Centraalbureau voor Schimmelcultures Baarn (The Netherlands).

ERLA, Amsterdam-Zuid.

Havrylenko M, Takamatsu S, Divarangkoon R, Braun U. 2006. Phyllactinia chubutiana: a new species

of Erysiphales from Patagonia (Argentina). Mycoscience 47: 237-241. doi:10.1007s10267-006-

0301-0

Havrylenko M, Takamatsu S. 2005. Notes on Erysiphales (Ascomycetes) from Patagonia, Argentina.

Mycoscience 46: 32-38. doi: 10.1007/s 10267-004-0209-5

Phyllactinia sebastianiae sp. nov. (Argentina) ... 63

Liberato JR. 2007. Taxonomic notes on two powdery mildews: Phyllactinia chorisiae and

Ovulariopsis wissadulae (Erysiphaceae: Phyllactinieae). Mycotaxon 101: 29-34.

Liberato JR, Barreto RW, Louro RP. 2004. Streptopodium caricae sp. nov., with a discussion of

powdery mildews on papaya, and emended descriptions of the genus Streptopodium and

Oidium caricae. Mycological Research 108: 1185-1194. doi: 10.1017/S0953756204000991

Liberato JR, Barreto RW, RG Shivas. 2005. Short Research Notes. Leaf-clearing and staining

techniques for the observation of conidiophores in the Phyllactinoideae (Erysiphaceae).

Australasian Plant Pathology 34: 401-404.

Mazzanti de Castatiién MA, Cabrera de Alvarez MG. 1985. Estudio de ofdios (formas sexuales

y asexuales) registrados sobre cinco especies ornamentales en Corrientes, Argentina. 2°

Congreso Latinoamericano de Fitopatologia. Tomo I. Micologia book of abstracts. Buenos

Aires: 303-312.

Mukerji KG. 1968. Phyllactinia dalbergiae. C.M.I. descriptions of pathogenic fungi and bacteria. N°

186. Eastern Press Ltd., London.

Sanchez JE, Aleman JA, Prosdocimi A, (eds.). 2008. Atlas total clarin de la Republica Argentina.

Corrientes. Arte Grafico Editorial Argentino SA.Buenos Aires. Tomo 11.

Shin HD, La YJ. 1993. Morphology of edge lines of chained immature conidia on conidiophores in

powdery mildews fungi and their taxonomic significance. Mycotaxon 46: 445-451.

Shin HD, Lee HJ. 2002. Morphology of penicillate cells in the genus Phyllactinia and its taxonomic

application. Mycotaxon vol. 83: 301-325.

Takamatsu S, Inagaki M, Niinomi S, Khodaparast SA, Shin HD, Grigaliunaite B, Havrylenko M.

2008. Comprehensive molecular phylogenetic analysis and evolution of the genus Phyllactinia

(Ascomycota: Erysiphales) and its allied genera. Mycological Research 112: 299-315 doi:

10.1016/jmycres.2007.11014

To-anun C, Kom-un S, Sunawan A, Sato Y, Takamatsu S. 2005. A new subgenus, Microidium, of

Oidium (Erysiphaceae) on Phyllanthus. Mycoscience 46: 1-8. doi: 10.1007/s10267-004-0202-z

Viégas AP. 1944. Alguns fungos do Brasil II. Ascomycetes. Bragantia 4(1-6): 1-392.

MYCOTAXON

Volume 115, pp. 65-71 January-March 2011

DOT: 10.5248/115.65

Two new species of Lyophyllum s.1.

(Basidiomycota, Agaricomycetes)

from La Palma (Canary Islands, Spain)

RosE MARIE DAHNCKE!, MARCO CONTU? & ALFREDO VIZZINI3*

'Finca ‘Los Castafieros’, 38710 Brena Alta - La Palma (Islas Canarias), Espana

2Via Marmilla, 12 (I Gioielli 2), 1-07026 Olbia (OT), Italy

’Dipartimento di Biologia Vegetale - Universita degli Studi di Torino

Viale Mattioli 25, I-10125, Torino, Italy

*CORRESPONDENCE TO: alfredo. vizzini@unito.it

ABSTRACT — Two new species in the genus Lyophyllum collected in La Palma (Canary Islands),

L. fuscobrunneum and L. impudicum, are here described and taxonomically delimited based

upon morphological data. For each species detailed descriptions, microscopical drawings,

and plates are provided.

Key worps — Agaricales, Lyophyllaceae, taxonomy, biodiversity

Introduction

The present paper deals with two new species belonging to Lyophyllum

P. Karst. emend. Kithner s.1., L. fuscobrunneum and L. impudicum, collected in

La Palma, Canary Islands, by Rose Marie Dahncke. Three papers concerning

Lyophyllum species from La Palma have been already published in the recent

past by the present authors (Dahncke et al. 2009, 2010; Vizzini & Contu 2010)

but it is obvious that this genus is very well represented in this island and that

careful studies could easily lead to the discovery of new taxa since nobody other

than RMD has conducted extensive collections and studies on it there.

Materials & methods

The macromorphological descriptions follow the detailed field notes taken for each

collection on fresh material. The micromorphological descriptions are based both upon

study of fresh and herbarium material. Dried material was revived in 2% KOH and

stained in Congo red and Phloxine B. Cotton Blue was used to highlight the siderophilous

granulation in the basidia (Baroni 1981). Spore measurements are based on means of

30 spores. The width of basidia was measured at the thickest part, and the length was

66 ... Dahncke, Contu & Vizzini

measured from the apex (sterigmata excluded) to the basal septum. We followed the

taxonomic concept of Bon (1999) and Kalamees (2004) for the Lyophyllaceae because

a natural (molecular based) classification has not yet been proposed for this group,

despite the important preliminary study by Hofstetter et al. (2002). Author citations

follow the IPNI Authors website and the Index Fungorum Authors of Fungal Names

website. Herbarium abbreviations are according to Thiers (2010). All examined material

is housed at WU (Herbarium of the Department of Plant Systematics and Evolution,

Faculty of Life Sciences, Universitat Wien). Latin descriptions of the new taxa are

deposited in MycoBank (http://www.mycobank.org).

Taxonomy

Lyophyllum fuscobrunneum Dahncke, Contu & Vizzini, sp. nov. Figs. la, 2a—c

MycoBank MB518872

Pileus 3-8 cm latus, parce carnosus, convexus, castaneo-brunneus, ad medium fusco-

brunneus et obtuse lateque umbonatus, siccus, estriatus, hygrophanus, aetate pallescens.

Lamellae latiusculae, subconfertae, uncinato-adnatae, cremeae deinde griseo-brunneae,

nigrescentes. Stipes 4-6 x 1-1.5 cm, cylindricus, haud bulbosus, albus vel leviter brunneus,

politus. Caro parce conspicua, alba, cartilaginea, nigrescens. Odor saporque farinae

recentis. Sporae 5.2-6.7 x 3.7-4.5 um, late ellipsoideae vel ellipsoideae, obtusae, leves.

Basidia 30-50 x 7-9 um, tetraspora. Cellulae marginales 20-35 x 3-7.5 um, plerumque

fusiformes vel cylindro-flexuosae. Pilei cutis ex hyphis iacentibus, radialibus vel laxe

intertextis, 2-8 um latis efformata. Fibulae numerosae.

Hoxorypws: Hispania, Insulae Canariae, in insula La Palma dicta, ad locum dictum

Hoyo del Rehielo, 26.X1.2009, leg. R.M. Dahncke (WU 30641).

Erymo.oey. The specific epithet, derived from the Latin adjectives fuscus (dark) and

brunneus (brown), refers to the dark brown-pigmented pileus.

PiLeus 3-8 cm wide, not very fleshy, elastic-cartilaginous, at first broadly convex

with an inrolled margin, then expanding, at centre with a broad, low and obtuse

umbo, dry, glabrous, chestnut-brown with a dark brown to fuscous centre,

hygrophanous and fading with age, non-striate, without pruina. LAMELLAE

moderately close, uncinate-adnate, thin, cream then greyish-brown with age,

staining brown then black when bruised. Stipe 4-6 x 1-1.5 cm, cylindric-

equal, without an inflated basis and lacking a bulb, polished, white, stuffed

with a thick white pith. ConTExT thick in the disk but progressively thinning

towards the pileus margin, white, staining black; smell and taste mealy. SPoRE

PRINT white.

Spores 5.2-6.7 x 3.7-4.5 um, on average 6.25 x 4.22 um, hyaline, cyanophilous,

carminophilous, broadly ellipsoid to ellipsoid, smooth, with a single, central,

ellipsoid oil-drop, apex obtuse (Fic. 2a). Basip1a 30-50 x 7-9 um, clavate,

somewhat hygrophoroid, four-spored, with basal clamp-connection (Fic. 2b);

SUBHYMENIUM made up of elongate to inflated elements. HyMENOPHORAL

Ficure 1 (right). Basidiomes. a. Lyophyllum fuscobrunneum. b. L. impudicum. Scale bars = 4 cm

Lyophyllum spp. nov. (Canary Islands, Spain) ...

68 ... Dahncke, Contu & Vizzini

TRAMA regular, consisting of hyaline hyphae often turning golden brown in 2%

KOH. MARGINAL CELLS (cheilocystidia) 20-35 x 3-7.5 um, mostly fusiform to

cylindro-flexuose, inconspicuous, hyaline, thin-walled (Fic. 2c). PILEIPELLIS

a cutis of differentiated, repent to loosely interwoven, cylindrical, smooth

hyphae, 2-8 um wide, with dominant parietal pigment; suprapellis an ixocutis

of very thin elements 2-3 um wide; subpellis and pilei trama with progressively

wider hyphae. STIPITIPELLIs a cutis of elongate hyphae. CLAMP CONNECTIONS

present at all septa. THROMBOPLEROUS HYPHAE not observed.

Hapitat. Gregarious near Cistus symphytifolius Lam. (Cistaceae) in a forest

dominated by Pinus canariensis C. Sm. (Pinaceae). Autumn. Thus far known

only from La Palma, in the Canary Islands.

CoMMENTs. Among the closest European species, Lyophyllum bonii Contu

(Consiglio & Contu 2002) has a paler pileus with no umbo, decurrent lamellae,

and larger, less elongate spores. L. ignobile (P. Karst.) Clémengon shows a

dark brown pigmented pileus, but differs in having different, non-mealy smell

and taste, more elongate and narrower spores, definitely shorter and non-

hygrophoroid basidia, and encrusted pigment in the pileipellis (Clémencon

1982, 1986; Bon 1999; Consiglio & Contu 2002). The recently described

L. brunneo-ochrascens E. Ludw. has an umbilicate pileus and larger spores

(“7-9.5 x 4.5-6 um” in the type; Ludwig 2001) whilst L. pulvis-horrei E. Ludw.

& Koeck (Ludwig 2001), also with small, broadly ellipsoid spores, differs

in having adnate to decurrent gills, a different smell, and smaller basidia.

Among the extra-European species keyed out by Clémencon & Smith (1983)

L. fistulosum Clémencon & A.H. Sm. and L. gracile Clémengon & A.H. Sm.

have bigger spores, often longer than 8 tm, shorter basidia (“27-33” um long),

and a more farinose-rancid smell. Finally, L. chamaeleon Clémengon & A.H.

Sm. is close to L. fuscobrunneum in having very elongate, “37-45 x 5-7” um

basidia and a context with a mealy smell, but its spores are longer, narrower,

and very elongate (“7.1-8.8 x 3.5-4.4” um in the type).

Lyophyllum impudicum Dahncke, Contu & Vizzini, sp. nov. Figs. 1b, 2d-f

MycoBank MB518873

Pileus 2-3.5 cm latus, parce carnosus, convexus, ad medium umbonatus, in juventute

cremeo-ochraceus deinde brunneus, ad medium fuscus, siccus, estriatus, hygrophanus,

aetate pallescens, sericeus. Lamellae subconfertae, adnatae, albae, immutabiles. Stipes 3-4

x 0.3-0.6 cm, cylindricus, haud bulbosus, albus vel leviter brunneus, politus. Caro parce

conspicua, alba, immutabilis. Odor gravis, malus; sapor non notatus. Sporae 4.5-6.7 x

3.2-4.5 um, late ellipsoideae vel ellipsoideae, obtusae, leves. Basidia 25-35 x 7-8.5 um,

tetraspora. Cellulae marginales nullae vel inconspicuae. Pilei cutis ex hyphis iacentibus,

radialibus, 3-10 um latis efformata. Fibulae numerosae.

Hoxorypus: Hispania, Insulae Canariae, in insula La Palma dicta, ad locum dictum

Cumbre Vieja, 12.X1I.2009, leg. R.M. Daéhncke (WU 30642).

Lyophyllum spp. nov. (Canary Islands, Spain) ... 69

Ficure 2. Basidiomes. Microscopical features. Lyophyllum fuscobrunneum (from the holotypus).

a. Spores. b. Basidia. c. Marginal cells. L. impudicum (from the holotypus). d. Spores. e. Basidia.

f. Marginal cells. Scale bar = 10 um

EryMoLoey. The specific epithet, derived from the Latin adjective impudicus (= indecent,

shameless, stinking, disgusting), means an evil-smelling, stinking species.

PiLeus 2-3.5 cm wide, not fleshy, not cartilaginous, at first broadly convex

to convex-paraboloid, then convex but never expanding, with a small and

rounded central umbo, dry, in young basidiomes pale ochre-cream then

light brown with a darker, fuscous centre, hygrophanous and fading with age.

LAMELLAE moderately close to close, adnate to adnate-emarginate, thin, white,

not staining when bruised. Sripg 3-4 x 0.3-0.6 cm, subequal, white, brownish

in old basidiomes, surface polished. CoNTEXT thin, white, unchanging; smell

unpleasant, disgusting; taste not recorded. SPORE PRINT white.

Spores 4.5-6.7 x 3.2-4.5 um, on average 6.15 x 4.27 um, hyaline, cyanophilous,

carminophilous, broadly ellipsoid to ellipsoid with an obtuse to slightly

tapered apex, with a single, central, ellipsoid oil-drop, smooth, thin-walled,

very slightly thick-walled only when old (Fic. 2d). Basrp1a 25-35 x 7-8.5 um,

clavate, four-spored, with basal clamp-connection (Fic. 2e); SUBHYMENIUM

70 ... Dahncke, Contu & Vizzini

made up of elongate to inflate, hyaline elements. HYMENOPHORAL TRAMA

regular, composed of thin, hyaline hyphae. MARGINAL CELLS (cheilocystidia)

inconspicuous, cylindric-flexuose to subfusiform (Fic. 2f). PILEIPELLIs a

compact undifferentiated cutis of repent, cylindric, smooth hyphae, 3-10

um wide, with dominant parietal pigment; subpellis scarcely differentiated,

suprapellis not or very scarcely gelatinized. STIPITIPELLIS a cutis of elongate

hyphae. CLAMP CONNECTIONS present at all septa. THROMBOPLEROUS HYPHAE

not seen.

Hapitat. Under Cistus symphytifolius, in small groups. Autumn.

COMMENTS. L. impudicum is well circumscribed on the basis of the pale cream-

ochraceous turning brown and umbonate pileus, the unchanging context with

an unpleasant smell, and small, ellipsoid spores on four-spored basidia. There

are no similar species in the literature since all the non-staining and non-

caespitose species thus far known have globose to subglobose spores.

Acknowledgements

Our most sincere thanks are due to Prof. I. Krisai-Greilhuber (Department of

Systematic and Evolutionary Botany, University of Vienna, Vienna, Austria) and to

Prof. K. Kalamees (Institute of Ecology and Earth Sciences University of Tartu, Tartu,

Estonia) for their pre-submission reviews.

Literature cited

Baroni TJ. 1981. The genus Rhodocybe Maire (Agaricales). Beihefte zur Nova Hedwigia 67: 1-194.

Bon M. 1999. Flore Mycologique d’Europe. Les Collybio-marasmioides et ressemblants. Doc Mycol

Mémoire hors-série n. 5. Amiens. 171 pp.

Clémencon H. 1982. Types studies and typifications in Lyophyllum (Agaricales). I. Staining species.

Mycotaxon 15: 67-94.

Clémencon H. 1986. Schwarzende Lyophyllum-Arten Europas. Zeitschr ftir Mykol 52 (1): 61-84.

Clémencon H, Smith AH. 1983. New species of Lyophyllum (Agaricales) from North America and

a key to the known staining species. Mycotaxon 17: 379-437.

Consiglio G, Contu M. 2002. Il genere Lyophyilum P. Karst. emend. Kihner, in Italia. Riv Micol

45(2): 99-181.

Dahncke RM, Contu M, Vizzini A. 2009. Some rare, critical, interesting taxa of the genus Lyophyllum

s.l. (Basidiomycota, Agaricomycetes) from La Palma (Canary Islands, Spain). Osterr Z Pilzk 18:

129-139,

Dahncke RM, Contu M, Vizzini A. 2010. New taxa in the genus Lyophyllum s.l. from La Palma

(Canary Islands, Spain). Mycotaxon 111: 323-330. doi:10.5248/111.323

Hofstetter V, Clémengon H, Vilgalys R, Moncalvo J-M. 2002. Phylogenetic analyses of the

Lyophylleae (Agaricales, Basidiomycota) based on nuclear and mitochondrial rDNA sequences.

Mycol Res 106: 104-1059. doi:10.1017/S095375620200641X

Kalamees K. 2004. Palearctic Lyophyllaceae (Tricholomataceae) in Northern and Eastern Europe

and Asia. Scripta Mycol 18: 3-134.

Ludwig E. 2001. Pilzkompendium, Bd.1 Beschreibungen: Die kleineren Gattungen der

Makromyzeten mit lamelligem Hymenophor aus den Ordnungen Agaricales, Boletales und

Polyporales. Eching.

Lyophyllum spp. nov. (Canary Islands, Spain) ... 71

Thiers B. 2010. [continuously updated] Index Herbariorum: A global directory of public herbaria

and associated staff. New York Botanical Garden’s Virtual Herbarium. http://sweetgum.nybg.

org/ih/

Vizzini A, Contu M. 2010. Lyophyllum rosae-mariae sp. nov. (Basidiomycota, Agaricomycetes) from

La Palma (Canary Islands, Spain). Mycosphere 1(1): 83-86.

MYCOTAXON

Volume 115, pp. 73-81 January-March 2011

DOT: 10.5248/115.73

Two new alectoronic acid-containing Parmotrema species from

the coast of Sdo Paulo State, southeastern Brazil

MARCELO P. MARCELLI’, MICHEL N. BENATTI? & JOHN A. ELIX 3

Instituto de Botdnica, Niicleo de Pesquisa em Micologia

Caixa Postal 3005, Séo Paulo / SP 01031-970, Brazil

3Research School of Chemistry, Building 33, Australian National University

Canberra, A.C.T. 0200, Australia

CORRESPONDENCE TO: ‘mpmarcelli@msn.com,

2michelbenatti@yahoocombr &John.Elix@anu.edu.au

ApstTracT— Descriptions are presented for two new Parmotrema species containing

alectoronic acid, PR conidioarcuatum and P pycnidiocarpum, resulting from a survey of

Parmeliaceae species in natural ecosystems and urbanized coastal areas of southeastern

Brazil.

Key worps— Parmotrema maraense, Parmotrema subrugatum

Introduction

The genus Parmotrema A. Massal. is characterized by lobes with broad,

rotund apices and naked lower margins, the absence of pseudocyphellae,

the frequent occurrence of marginal cilia, simple rhizines, and thick-walled,

ellipsoid ascospores (Brodo et al. 2001, Nash & Elix 2002). More than 300

species are known worldwide (Nash & Elix 2002), and about one third of them

occur in Brazil.

Two new species containing alectoronic acid were discovered by the authors

during research on the broad-lobed species of Parmeliaceae at the coast in Sao

Paulo State, Brazil, at the same localities cited in Benatti et al. (2010).

Both new species lack vegetative propagules, and are corticolous in coastal

mangrove or restinga forests. More morphological and chemical comparisons

with other somewhat similar species can be found in Benatti (2005).

Material & methods

Specimens were distinguished by morphological characters using standard

stereoscopic and light microscopes. Anatomical sections, including those of apothecia

7A ... Marcelli, Benatti & Elix

and pycnidia, were made with a razor blade by hand. The chemical constituents were

checked by spot tests with potassium hydroxide (K), sodium hypochlorite (C) and

para-phenylenediamine (P), and also examined under UV light (360 nm). Chemical

constituents were identified by thin-layer chromatography (TLC) using solvent C

(Bungartz 2001), high performance liquid chromatography (HPLC) (Elix et al. 2003)

and comparison with authentic samples.

We have encountered problems dealing with the many morphological terms present

in the literature. For the purpose of this paper, we consider that lacinules represent

adventitious, ribbon-like secondary outgrowths from the primary lobe margins

(Marcelli et al. 2007). Lobules are similar, but short and rounded.

The diagnosis for each taxon refers exclusively to observations of the holotype

specimen and the English descriptions and comments to all the material studied.

The species

Parmotrema conidioarcuatum Marcelli, Benatti & Elix, sp. nov. FIG. 1

MycoBank MB 518890

Species cum thallo similis Parmotrematis subrugati sed lobis latioribus, lacinulis multum

longioribus et ramosioribus, lobulis aggregatis saepe submarginalibus formans, ciltis

saepe majoribus, margine inferne eburnea solum subter apothecia vel lacinulis, apotheciis

cum margine semper eciliata, sporis minoribus et conidia variabiliter arcuatis differt.

atranorinam, chloroatranorinam, acidum alectoronicum, acidum f-alectoronicum,

acidum dehydrocollatolicum et acidum dehydroalectoronicum continens.

Hotortype: Brazil, Sao Paulo State, Municipality of Ilha Comprida, near the raft to

Cananéia, low “restinga’” vegetation, corticolous, under partial sunlight, leg. A.A.

Spielmann, M.P. Marcelli, L.S. Canéz, & M.N. Benatti 964, 03-IV-2004 (SP).

ErymMo.oey: This species is named after the arcuate conidia.

THALLUS up to 23 cm in diameter, subcoriaceous, ramulicolous, pale greenish

gray but becoming dark gray in the herbarium, lobed to sublobed. LoBeEs

irregularly branched, (3.5-)8.0-18.0 mm wide, crowded, weakly to strongly

ascending, generally unattached; apices + plane to subconvex, subrotund

(primary lobes) to irregular and partially lacinulate; margin subcrenate to

irregularly dissected, +plane to ascending as it begins to form lacinules and/

or apothecia, irregularly weakly incised, ciliate. UPPER SURFACE continuous to

irregularly cracked, smooth to subrugose; MACULAE distinct and punctiform

to linear when present on the stipes and amphithecia of the apothecia, laminal

maculae rare and weak. LACINULES usually long, 0.3-17.5 x 0.2-2.3 mm,

regularly spreading from lobe margins or apices, abundant at thallus center,

initially simple but becoming irregularly branched, subcanaliculate, truncate

or acute, ciliate, underside generally white, often mixed with tiny ciliate lobules

which may develop into peculiar, scattered, submarginal, small, bouquet-shaped

agglomerations, 3.0-8.0 mm wide. SOREDIA, PUSTULES and ISIDIA absent. CILIA

black, simple or rarely furcate, 0.4-4.5 x ca. 0.05 mm, abundant at the lateral

margins of the lobes but sparse at the apices. MEDULLA white, with scattered

Parmotrema spp. nov. (Brazil) ... 75

Figure 1. The holotype of P. conidioarcuatum and the bouquet of lobules

typical of the species (arrow and detail). Bar = 1 cm.

orange, pigmented spots. Lower suRFACE black, shiny, smooth to rugose or

veined, free of rhizines when not contacting the substrate, MARGINAL ZONE

shiny, usually brown, but turning white, cream or sometimes variegate under

lacinules or apothecia, smooth to subrugose, 1.0-8.0 mm wide, naked; RHIZINES

black, simple, furcate to irregularly branched, 0.10-2.30 (3.80) x 0.05 (-0.10)

mm, frequent to abundant, in scattered groups. APOTHECIA submarginal or

subapical, sometimes originating from subcanaliculate lobe apices, common,

concave when young but becoming fissured and distorted with age, up to 25.2

mm wide, margins smooth to subcrenate, rarely lacinulate, always eciliate,

76 ... Marcelli, Benatti & Elix

with very inflated stipes, amphithecia and stipe smooth at first then strongly

veined and rugose or folded with age; disc brown, epruinose, imperforate;

ASCOSPORES ellipsoid, 19.0-25.0 x 9.5-12.5 um, epispore 1.5-2.0 um thick;

PycnipiA submarginal, common, particularly abundant on the lacinules, with

black ostioles; conrp1a variable inside a single pycnidium, bacilliform or short

filiform, often arcuate, sigmoid or contorted into several different shapes,

5.0-7.5 x ca. 1.0 um.

COLOR REACTIONS: upper cortex K+ yellow, UV-; medulla K+ weakly yellowish,

C-, KC+ rose, P-, UV+ bluish green, and scattered spots of an orange, K+ dark

reddish pigment.

TLC/HPLC: cortical atranorin (minor) and chloroatranorin (minor); medullary

alectoronic acid (major), B-alectoronic acid (minor), dehydrocollatolic acid

(minor), and dehydroalectoronic acid (trace).

CoMMENTs: This species produces no vegetative propagules, has densely ciliate

margins with abundant, long and branched lacinules, a brown lower marginal

zone that turns white or cream colored only under lobes with apothecia and/

or lacinules. The apothecia have smooth to subcrenate, eciliate margins, with

ascospores up to 25.0 um long, and a white medulla containing frequent spots

of an orange, K+ dark reddish pigment.

However, the most striking characteristics of P. conidioarcuatum are the

formation of tiny ciliate lobules, especially at submarginal parts of the thallus,

lobules which eventually aggregate into small bouquets, and, most notably, the

bacilliform or short filiform conidia that are often variably arcuate (arched,

sigmoid, sinuous, subcrescent, somewhat unciform and several other shapes)

intermixed with some linear conidia. Together, these characters readily

distinguish P conidioarcuatum from other Parmotrema species containing

alectoronic acid. It is also one of the species with the broadest lobes in the

genus.

We found no reference to Parmotrema species bearing similar small

bouquets of lobules, nor are they present in any other Brazilian species known

to us. Initially, we considered the possibility that this was due to some kind of

deformation of the lacinules, but these lobules are clearly very common and

consistent, differing in shape from the lacinules and with such regularity on the

upper cortex, that they constitute a very unique morphological characteristic of

the species. In addition, we had access to other specimens collected from inland

Sao Paulo State, which have the same lobular bouquets (in early development),

arcuate conidia and the other specific characteristics.

At first glance, P. conidioarcuatum might be mistaken for P subrugatum

(Kremp.) Hale, which invariably has unciform conidia (4.0-6.0 um) and

larger ascospores (26.0-39.0 um). Sterile specimens of P. subrugatum (M1!)

are readily distinguished by the much narrower, more sparingly ciliate lobes,

Parmotrema spp. nov. (Brazil) .... 77

the continuously white borders under the margins of all lobes, the absence

of the lobular bouquets, and the simple to dichotomously branched lacinules

(Benatti et al. 2010). In contrast, the lacinules of P conidioarcuatum are more

canaliculate, irregularly branched, densely ciliate, and grow crowded along the

lobe margins; in addition they are sometimes more rugose due the accumulation

of pycnidia.

Because of the dense marginal lacinulae and cilia, P conidioarcuatum is

probably more closely related to the P. wainioi subgroup, as they have similarly

sized ascospores and conidia as well as a brown marginal zone on the underside.

The unusually shaped conidia present in P. conidioarcuatum are believed to be

derived from bacilliform or short filiform conidia.

Parmotrema maraense Hale (Hale 1990) has narrower lobes, with margins

bearing sparingly branched lacinules, as well as more lacinulate and ciliate

apothecia (Benatti 2005, Benatti et al. 2010), and short bacilliform conidia

(Klaus Kalb, pers. comm.).

Parmotrema pycnidiocarpum Benatti, Marcelli & Elix, sp. nov. FI. 2

MycoBank MB 518892

Species cum thallo simili Parmotrematis subrugati sed pycnidiis absentibus in lobis,

apotheciis bullatis et multum pycnidiatis, cum pigmento aurantiaco disposito sub hymeniis

et ad marginem differt. Atranorinam, chloroatranorinam, acidum alectoronicum,

acidum «-collatolicum, acidum f-alectoronicum, acidum -collatolicum, acidum

dehydrocollatolicum, methyl pseudoalectoronatum, et methyl pseudo-a-collatolatum

continens.

HotoryPe: Brazil, Sao Paulo State, Municipality of Iguape, Barra do Ribeira, between

Suamirim “River” and the ocean, low “restinga” vegetation growing on inundated soil,

on small tree branch in the wood, leg. M.P. Marcelli & O. Yano 6663, 17-VII-1989 (SP).

EryMo.oey: This species is named after the peculiar distribution of the pycnidia.

THALLUS up to 14.5 cm wide, submembranaceous, ramulicolous, pale

grayish green, becoming darker in the herbarium, lobate to sublobate. LoBEs

1.5-3.5(-5.0) mm wide, irregularly branched, imbricate to crowded, adnate,

ascending when fertile, adnate to loosely adnate or unattached; apices tplane

to subconvex when fertile, subrotund to irregular; margin smooth near

the apices, +flat to ascending and subundulate, entire to irregularly incised,

irregularly sublacinulate, ciliate. UPPER SURFACE continuous but becoming

irregularly cracked with age, smooth to subrugose. MACULAE present only on

some amphithecia and stipes, weak, punctiform, sometimes aggregated and

linear. ADVENTITIOUS LACINULES sparse, simple or irregularly ramified, flat,

0,3-1.3 x 0,2-1.1 mm, irregularly distributed along the lobe margins, truncate

or acute, underside concolorous with the lower margin or cream on fertile

lobes, occasionally intermixed with some small irregular lobules. Cri1a black,

simple to rarely furcate or irregular, 0.1-1.5 x ca. 0.05 mm, frequent along the

78 ... Marcelli, Benatti & Elix

margins but sparse at the lobe apices. MEDULLA white, invariably with orange

pigmentation below the hymenium as apothecia mature, pigmented also at

some apices and margins of older lobes. SOREDIA, PUSTULES and ISIDIA absent.

Lower suRFACE black, shiny, smooth to subrugose or weakly veined; MARGINAL

ZONE shiny, brown, smooth to weakly veined, 0.5-3.5 mm wide, naked, turning

cream under lobes with apothecia; RHIZINEs black, simple, furcate or irregularly

branched, 0.10-0.80(-1.30) x ca. 0.05(-0.10) mm, frequent to abundant,

occasionally becoming agglutinated, usually scattered but partly in groups.

Apothecia submarginal or subterminal, in part originating from subcanaliculate

lobe apices, concave to urceolate, becoming rugose and distorted with age, up to

5.2 mm wide, eciliate, stipes highly inflated and bullate, margins smooth when

young, then crenate, amphithecia and stipes smooth when young but becoming

rugose or vertically folded; disc brown, epruinose, imperforate; ascospores

absent, no asci observed in hymenia; pycnidia frequent to very abundant on

the stipes and amphithecia, rarely submarginal on apotheciate lobes, with black

ostioles; conidia short, unciform, 3.0-5.0 x ca. 1.0 um.

COLOR REACTIONS: upper cortex K+ yellow, UV-; medulla K-, C-, KC+ rose,

P-, UV+ bluish green, with a K+ dark reddish, orange pigment (unknown

anthraquinone) below the hymenia of all mature apothecia.

TLC/HPLC: cortical atranorin (minor) and chloroatranorin (minor); medullary

alectoronic acid (major), a-collatolic acid (minor), B-alectoronic acid (trace),

B-collatolicacid (trace),dehydrocollatolicacid(trace),methylpseudoalectoronate

(trace) and methyl pseudo-a-collatolate (trace).

ComMMENTs: ‘This alectoronic acid-containing species is characterized by

narrow, ciliate lobes, the absence of vegetative propagules, eciliate apothecia

with highly inflated, bullate stipes, pycnidia mainly on the amphithecia and

stipes of the apothecia, very small unciform conidia, and an orange-pigmented

medulla around the hymenium.

‘The orange medullary pigment (K+ dark reddish, possibly an anthraquinone)

which is frequently deposited under and around the hymenia of apothecia,

appears also in the medulla of some of the older lobes (often those beginning

to form apothecia).

Particularly notable is the uncommon distribution pattern of the pycnidia.

‘They grow almost exclusively on the amphithecia and stipes of the apothecia.

Only rarely some submarginal pycnidia are found on the lobes, precisely where

apothecial initials are being formed, around the edge of the juvenile disc.

The shape of the highly inflated stipes somewhat resemble large “skirts”

as they begin to form, with the resulting lobe apices becoming more convex,

especially the subapical ones. In this aspect, they differ from all other Brazilian

species with inflated apothecia (Hale 1965, Fleig 1997, Louwhoff & Elix 1999,

Parmotrema spp. nov. (Brazil) ...

Ficure 2. Both sides of the holotype of P pycnidiocarpum.

Bar = 1 cm.

80 ... Marcelli, Benatti & Elix

Eliasaro 2001, Kurokawa & Lai 2001, Canéz 2005, Spielmann 2005), where the

apothecial pedicel is always +cylindrical.

The conidia shape and size place this species in the P. subrugatum subgroup

(Benatti et al. 2010). However, the lower marginal zone of P. pycnidiocarpum

varies from brown on the distal lobes to cream on those bearing apothecia, in

contrast to the almost entirely white margins of P subrugatum (Benatti et al.

2010).

Acknowledgements

The authors wish to thank Harrie Sipman (Berlin) and Lidia Ferraro (Corrientes)

for the critical revision of the manuscript and help with the Latin diagnosis, and Klaus

Kalb for information on the conidia of the P maraense type specimen. This work

could not have been accomplished without the support of the Conselho Nacional de

Desenvolvimento Cientifico e Tecnolégico (CNPq) for a Master Scholarship to the

second author and a Research support grant to the first author.

Literature cited

Benatti MN. 2005. Os géneros Canomaculina, Parmotrema e Rimelia (Parmeliaceae, Ascomycetes)

no litoral centro-sul do Estado de Sdo Paulo. Mastership dissertation, Instituto de Botanica,

Sao Paulo. 389 p.

Benatti MN, Marcelli MP, Elix JA. 2010. Two new species of the Parmotrema subrugatum

group from the coast of SAo Paulo State, southeastern Brazil. Mycotaxon 112: 377-388.

doi: 10.5248/112.377

Brodo IM, Sharnoff SD, Sharnoff S. 2001. Lichens of North America. Yale University Press. New

Haven & London. 795 p.

Bungartz F. 2001. Analysis of lichen substances. http://nhc.asu.edu/lichens/lichen_info/tlc.jsp#

TLC2. Accessed on July 2008.

Canéz LS. 2005. A familia Parmeliaceae na localidade de Fazenda da Estrela, municipio de Vacaria,

Rio Grande do Sul, Brasil. Mastership dissertation, Instituto de Botanica, S40 Paulo, 302 p.

Eliasaro S. 2001. Estudio taxonomico y floristico sobre las parmeliaceae sensu stricto (Ascomycota

liquenizados) del Segundo Planalto del Estado de Parana, Brasil. Tesis de Doctorado. Facultad

de Ciencias Exactas y Naturales, Universidad de Buenos Aires. Buenos Aires.

Elix JA, Giralt M, Wardlaw JH. 2003. New chloro-depsides from the lichen Dimelaena radiata.

Bibliotheca Lichenologica 86: 1-7.

Fleig M. 1997. Os géneros Parmotrema, Rimelia e Rimeliella (Lichenes-Ascomycota, Parmeliaceae)

no Rio Grande do Sul, Brasil. Tese de Doutorado, Instituto de Biociéncias da Universidade de

Sao Paulo. 250 p.

Hale ME. 1965. A Monograph of the Parmelia subgenus Amphigymnia. Contributions from the

United States National Herbarium 36(5): 193-358.

Hale ME. 1990. New species of Parmotrema (Ascomycotina: Parmeliaceae) from Tropical America.

Bibliotheca Lichenologica 38: 109-119.

Kurokawa S, Lai MJ. 2001. Parmelioid lichen genera and species in Taiwan. Mycotaxon 77:

225-284.

Marcelli MP, Jungbluth P, Benatti MN, Spielmann AA, Canéz LS, Cunha IPR, Martins MEN. 2007.

Some new species and combinations of Brazilian lichenized fungi. Bibliotheca Lichenologica

96: 209-227,

Parmotrema spp. nov. (Brazil) ... 81

Louwhoff SHJJ, Elix JA. 1999. Parmotrema and allied lichen genera in Papua New Guinea.

Bibliotheca Lichenologica 73: 1-152.

Nash TH II, Elix JA. 2002. Parmotrema. Pp. 318-329, in: Nash et al. (Eds). Lichen flora of the

greater Sonoran Desert Region. Volume 1. Lichens Unlimited, Arizona State University, Tempe,

Arizona, USA.

Spielmann AA. 2005. A familia Parmeliaceae (fungos liquenizados) nos barrancos e peraus da

encosta da Serra Geral, Vale do Rio Pardo, Rio Grande do Sul, Brasil. Masters Dissertation,

Instituto de Botanica, Sao Paulo. 204 p.

MYCOTAXON

Volume 115, pp. 83-98 January-March 2011

DOT: 10.5248/115.83

New or noteworthy records of Caloplaca

(Teloschistaceae) from Poland

KARINA WILK

Laboratory of Lichenology, W. Szafer Institute of Botany, Polish Academy of Sciences

Lubicz 46, Krakéw PL-31-512, Poland

CORRESPONDENCE TO: k.wilk@botany.pl

AsstTract— Caloplaca atroalba, C. dichroa, C. marmorata, C. oasis, and C. pseudofulgensia

are reported as new to Poland. Two other taxa: C. albopruinosa and C. pusilla are discussed

in view of modern approaches. The species reported here were mainly collected in the Polish

Carpathians. Additionally, C. atroalba is reported as new to Ukraine. Detailed taxonomic

descriptions and comments are provided for the treated taxa.

Key worps— Central Europe, geographical distribution, lichenized fungi, taxonomy

Introduction

According to the checklist of the Polish lichen biota (Fattynowicz 2003) and

the most recent publications (Bielczyk 2003, Ceynowa-Gieldon & Adamska

2005, Wilk & Flakus 2006, Sliwa & Wilk 2008), 67 species of Caloplaca are

known from Poland. The genus is relatively well-known in Poland, as it is

in neighboring countries (Germany, Czech Republic, Slovakia, Ukraine).

Among the authors that mostly contributed to this knowledge in Poland,

Tobolewski (1956, 1958), Glanc & Tobolewski (1960), Nowak (1960, 1961),

Nowak & Tobolewski (1975), and Alstrup & Olech (1988, 1992) are the best

representatives.

The author has already reported on her 2004-2008 study of the taxonomic

diversity of calcicolous Caloplaca species in the Polish Western Carpathians

(Wilk 2008). In the course of this survey, several species were recognised as new

to Poland. Some of them were reported recently (i.e., Wilk & Flakus 2006, Sliwa

& Wilk 2008), and the remainder is presented here: C. atroalba, C. dichroa,

C. marmorata, C. oasis, and C. pseudofulgensia. In addition, several noteworthy

species were found in the area; two of them (C. albopruinosa and C. pusilla)

are discussed in detail also in this study. Recently, the taxonomic placement

84 ... Wilk

of the latter two species has been changed and they are presented here in their

modern sense.

Material & methods

Specimens collected by the author and further material obtained from KRAM, KTC,

UGDA, and herbaria of the Gorce National Park (GPN) and the Pieniny National Park

(PPN) were examined. Additional reference material was studied in the Minnesota

herbarium (MIN).

Morphological characters were measured on dry material using a dissecting

microscope. Thallus color was compared with the color standard by Séguy (1936).

Anatomical characters were measured from hand-cut sections and squash preparations

mounted in water. The structure of paraphyses and cortical tissues were observed in 25%

KOH (K). The granulation of tissues was observed in polarized light; pol+/ pol- indicates

that granules do/do not reflect polarized light. Solubility of granules and/or crystals was

tested with K and 65% nitric acid (N). Chemicals used in spot test reactions were: K,

Lugol's iodine [0.3% IK]] (I) and N. The terminology for tissues follows Bungartz (2002),

Ryan et al. (2002) and Gaya (2009). Systematic nomenclature of lichen associations and

species concepts follow Roux et al. (2009), and additional lichen association data are

provided by Gaya (2009).

Taxonomy

Caloplaca albopruinosa (Arnold) H. Olivier, Mém. Soc. Sci. Nat. Math.

Cherbourg 37: 147 (1909).

THALLUs endolithic or partially epilithic, thin, continuous to slightly cracked,

white or grey (Séguy 1936, color code: 494), rarely limited by a dark grey

prothallus; without vegetative propagules. APOTHECIA zeorine, abundant, in

groups or more rarely slightly scattered, timmersed at first, becoming sessile,

round or slightly angular by mutual compression or flexuose, 0.2-1.2 mm

diam., leaving pits in the rock when detached; disc at first slightly concave,

then flat, black (Séguy 1936, color codes: 527, 528), more or less white or

bluish due to pruina; proper margin persistent, thick, smooth (margin

sometimes discontinuous and slightly cracked in young apothecia), distinctly

raised above the disc, black, white or bluish due to pruina; thalline margin

inconspicuous or suppressed. Parathecium well developed, thick, 65-170 um,

prosoplectenchymatous, lumina of cells elongated or slightly oval, outer part

blackish. Amphithecium much reduced with few algae, cortex sometimes well

developed up to 50 um, paraplectenchymatous, cells with big round lumina,

almost completely filled by small, yellow brown crystals (pol+, insoluble in

K, soluble in N). Epihymenium granular, grey. Hymenium hyaline, without

crystals, 80-115 um tall. Paraphyses simple, constricted at septa, 1-2(-3) apical

cells slightly thickened, up to 5 um wide. Hypothecium hyaline, with many

Caloplaca in Poland ... 85

oil droplets, paraplectenchymatous. Asci 8-spored, spores polaribilocular,

thin-walled, 12-16.5 x 6.5-10 um, isthmus 2-4(-5) um wide. Pycnrpia

rather common, immersed in rock or thallus; ostiolum black, distinct; conidia

colorless, ellipsoid to ovoid, 2-3.5 x 1-1.5 um.

SPOT TEST REACTIONS: thallus K-, epihymenium K+ violet, KN+ violet-

brown and outer part of parathecium K+ violet.

DIsTRIBUTION AND ECOLOGY — Caloplaca albopruinosa has a Central Europe-

Mediterranean distribution (Nimis et al. 1987). It grows on limestone and

dolomite rocks in sun-exposed places in the subalpine and alpine belts (e.g.,

Alps, Apennines) and occasionally at lower elevations (Nimis 1993, Nimis et

al. 1996a, Muggia et al. 2008). The species is characteristic of the association

Bagliettoetum marmoreae Roux 1978.

In Poland C. albopruinosa is rare, occurring in the Carpathians only in Tatra

Mts. Eitner (1901) also reported the species from the Sudety Mts. It grows on

limestone boulders in sun-exposed situations ca. 1200 m in montane glades.

ExsICCATES SEEN — Arnold, Lich. Exsicc. 1222 (sub Pyrenodesmia agardhiana)

(KRAM).

SPECIMENS EXAMINED — PoLANp. Western Carpathians, West Tatra Mts: Dolina

Chochotowska valley, Polana Dudowa glade, alt. 1185 m, 49°14’°58”N/19°49°37E, 16

Jul 2004, L. Sliwa 3151, 3169, K. Wilk 2157 (KRAM), Dolina Koscieliska valley, Przystop

Mietusi glade, 49°15’48”N/19°53’22”E, 15 Jul 2004, L. Sliwa 3026 (KRAM).

COMMENTS — Caloplaca albopruinosa is characterized by an endolithic

thallus and black, white pruinose apothecia with thick proper margin. The

amphithecium is reduced with few algae. The epihymenium is grey and reacts

K+ violet.

Together with C. alociza (A. Massal.) Mig., C. badioreagens Tretiach &

Muggia and C. erodens Tretiach et al., C. albopruinosa forms a group of

species characterized by black apothecia and an endolithic thallus. Caloplaca

albopruinosa (= C. agardhiana auct., see Muggia et al. 2008 for nomenclature)

is a problematic species, considered by some authors as a synonym to

C. alociza. The presence or absence of crystals in the hymenium was a primary

key character used to distinguish both species (Clauzade & Roux 1985, Nimis

1992), but recent studies indicate that crystals may occur in C. albopruinosa as

well as in C. alociza (Muggia et al. 2008). Current concepts separate C. alociza

from C. albopruinosa by a thin evanescent apothecial margin and by more

rarely white pruinose apothecia. A brownish grey epihymenium (K+ brownish

red) and paraphyses neither apically thickened and nor constricted at the septa

distinguish C. badioreagens from C. albopruinosa (Tretiach & Muggia 2006). In

comparison to C. albopruinosa, C. erodens has smaller apothecia with distinct

thin proper margins and an endolithic-epilithic thallus producing grey soredia.

This species occurs mostly as a sterile form (Tretiach et al. 2003).

86 ... Wilk

Caloplaca atroalba (Tuck.) Zahlbr., Cat. Lich. Univ. 7: 68 (1930). PLATE 1

THALLUS epilithic, thin, areolate or continuous, brownish grey or creamy

brownish (Séguy 1936, color codes: 234, 235, 338, 339), epruinose, rarely limited

by a grey prothallus; without vegetative propagules. Areoles irregular, flat,

with uneven surface. Thallus cortex paraplectenchymatous, without crystals;

algal layer continuous; medulla prosoplectenchymatous. APOTHECIA Zeorine,

abundant, in the centre of the thallus, crowded, sessile from the beginning,

round or angular by mutual compression, small, up to 0.5 mm diam.; disc

flat, dark brown (Séguy 1936, color code: 117), epruinose; proper margin

persistent, thin, concolorous with disc, epruinose; thalline margin usually

persistent or +reduced, but visible at least at the base of apothecia. Parathecium

well developed, 50-65 um thick, paraplectenchymatous, lumina of cells oval

or round, outer part brown and without crystals. Amphithecium present,

algae abundant, cortex poorly developed. Epihymenium brownish grey or pale

brown. Hymenium hyaline, sometimes with fine crystals (pol-, insoluble in K),

85-115 um tall. Paraphyses simple or slightly branched, constricted at septa,

1-3 apical cells slightly thickened, up to 5 um wide, or apical cells not thickened.

Hypothecium hyaline, sometimes with fine crystals (pol-, insoluble in K).

Asci 8-spored, spores polaribilocular or occasionally 1-locular, thin-walled,

11.5-15 x 6-9.5 um, isthmus ca. 1.7 um wide, often incomplete or poorly

formed. Pycnipia inconspicuous, immersed in thallus; conidia not observed.

SPOT TEST REACTIONS: thallus K+ violet, epihymenium and outer part of

parathecium K+ violet.

DIsTRIBUTION AND ECOLOGY — Caloplaca atroalba is widely distributed in

the temperate zone of North America (Wetmore 1994, 2007) and is reported

from Austria (Hafellner & Tiirk 2001) and Sweden (Santesson et al. 2004) in

Europe. It grows on calcareous and occasionally non-calcareous rocks such as

limestone, dolomite, or sandstone (data from MIN herbarium labels, Johnsen

1965, Wetmore 1994, Hafellner 2001).

In the Carpathians (Pieniny and Tatra Mts) and Gory Swietokrzyskie Mts,

the species grows on limestone and calcareous sandstones in sun-exposed sites

up to 1100 m. This is the first report of the species from Poland and Ukraine.

SPECIMENS EXAMINED — POLAND. Western Carpathians, Pieniny Mts, limestone

outcrops by Czorsztyn Castle, alt. ca. 600 m, 49°26 11”N/20°18'48”E, 5 Jun 2005, K. Wilk

3470b (KRAM); West Tatra Mts, Dolina Chochotowska valley, Polana Chochotowska

glade, alt. 1105 m, 49°1416”N/19°47°47”E, 16 Jul 2004, L. Sliwa 3118 (KRAM). Géry

Swietokrzyskie Mts, Kielce County: Wesota town above Wierna Rzeka river, hill near

railway, 31 Aug 1976, K. Toborowicz (KTC-6332).

ADDITIONAL MATERIAL EXAMINED — UKRAINE. Khmelnitskyi region, Kamianets

Podilskyi district, National Park “Podilskyi Tovtry”: Kitaihorod, 15 km SE of Kamianets

Podilskyi, 48°38'25”N/26°46'58"E, 24 Jun 2003, P Czarnota 3793 (KRAM), Bagota

on the Dniester near Stara Ushytsia, 30 km SE Kamianets Podilskyi, alt. 259 m,

48°35’ 10”N/26°59°57”E, 25 Jun 2003, J. Kiszka (KRAM-L 63304).

Caloplaca in Poland ... 87

here

section of apothecium; scale bar= 150 tum. C - ascospores; scale bar= 20 um.

COMMENTS — Caloplaca atroalba is characterized by a creamy brown,

epruinose, areolate thallus. The brown, epruinose apothecia usually have a

persistent thalline margin. Spores have a thin isthmus (ca. 1.7 um diam) and

are often poorly formed. The epihymenium is brown and K+ violet.

Caloplaca atroalba can be similar to C. albovariegata (B. de Lesd.)

Wetmore, C. chalybaea (Fr.) Mill. Arg., C. diphyodes (Nyl.) Jatta, C. pratensis

Wetmore, and C. variabilis (Pers.) Mull. Arg. According to Wetmore (1994),

C. atroalba is more common in Europe than currently thought but has been

often misidentified as C. diphyodes. The latter, however, differs by producing

spores with a wider isthmus (> 3 um diam.) and a shorter (usually < 100 um)

hymenium. An additional distinguishing feature is the parathecial structure,

which is prosoplectenchymatous in C. diphyodes (Wunder 1974, Oksner 1993,

Kondratyuk et al. 2004).

Caloplaca albovariegata can be distinguished from C. atroalba by its

distinct grey areolate thallus with areoles constricted at the base. Moreover,

C. albovariegata has a discontinuous algal layer (algal clusters separated from

one another by vertical columns of hyphae) and a necral layer over the cortex.

‘The species is known only from North America, but Wetmore (1994) notes that

it probably also occurs in Europe.

Caloplaca atroalba may also be confused with C. chalybaea and C. variabilis,

even though in the two latter species thalli and apothecia are covered by

conspicuous white pruina (hyaline crystals visible in section, pol+, insoluble

in K) and produce spores with considerably wider isthmuses. Moreover, the

apothecia of C. chalybaea are + immersed in the thallus and have a hypothecium

88 ... Wilk

that consists of distinct rows of small isodiametric cells (Wetmore 1994).

Finally, Wetmore (2009) recognises C. atroalba as a non-sorediate counterpart

of C. pratensis, recently described from North America.

Caloplaca dichroa Arup, Lichenologist 38: 13 (2006).

THALLUS epilithic, 0.1-0.4 mm thick, granular-areolate, sometimes with small

indistinct lobes at margin, yellow, yellowish orange or dark orange (Séguy

1936, color codes: 256, 257, 201), often occurring with yellow and orange

thalli side by side, prothallus seldom present, concolorous with thallus. Areoles

continuous to scattered, irregular, flat to convex, often with slightly incised

margins; blastidia and granules numerous on the surface and margin of areoles,

usually covering most of the thallus, 30-90 tm diam. Thallus cortex very thin,

up to 10 um; medulla with many yellow crystals. APOTHECIA zeorine, present

or absent, not abundant, scattered in the centre and near margins of the thallus,

slightly immersed at first, then sessile, round or flexuose when old, 0.5-1.5

mm diam.; disc flat, somewhat convex in old apothecia, orange (Séguy 1936,

color codes: 211, 246); proper margin concolorous with disc or slightly paler,

smooth; thalline margin thick and prominent at first, becoming reduced and

visible at the base of apothecia, smooth or crenulate, or alternatively tpersistent

and only slightly reduced. Parathecium thin or thick, prosoplectenchymatous,

lumina of cells oval or round. Amphithecium often reduced and visible only at

the base of apothecium, algae abundant and in groups. Epihymenium granular,

brownish yellow. Hymenium hyaline, 65-95 um tall. Paraphyses simple, slightly

branched or anastomosing, with oil droplets, 1-3(—5) apical cells thickened, up

to 5-8 um wide, or apical cells not thickened. Hypothecium hyaline, with oil

droplets, prosoplectenchymatous. Asci 8-spored, spores polaribilocular, thick-

walled (1-2 um wide), 10-15 x 5-8 um, isthmus 2.0-4.5 um wide. PycNIDIA

common, numerous, immersed; ostiolum orange; conidia colorless, bacilliform

2-3(-4) x 1 wm.

SPOT TEST REACTIONS: thallus K+ purple, medulla K-, epihymenium K+

purple.

DISTRIBUTION AND ECOLOGY — Caloplaca dichroa is widespread in Europe

(Arup 2006, Vondrak et al. 2009), where it grows on calcareous substrata such

as limestone rocks, boulders, pebbles, and (rarely) concrete and mortar (Arup

2006). It prefers sun-exposed sites, occurs at varying altitudes (Arup 2006,

Vondrak et al. 2007), and is typically inland, away from maritime influences

(Vondrak et al. 2009).

The species seems to be common in the Carpathian (Pieniny, Tatra, Beskid

Maty) mountain ranges on limestone and calcareous sandstones mainly in

sun-exposed sites, usually on south-facing vertical rock walls or upper rocky

outcrops at 500-1800 m. This is the first report of the species from Poland.

Caloplaca in Poland ... 89

SPECIMENS EXAMINED — POLAND. Western Carpathians, Beskid Maly Mts, Zamczysko

above Lysina village, alt. 756 m, 49°44°52”N/19°18'17"E, 22 Sept 2005, K. Wilk 3945b

(KRAM); Pieniny Mts, Zielone Skatki rocks by Czorsztyn lake, NE of Falsztyna, alt.

ca. 580 m, 49°25°56”N/20°17°35”E, 6 Jun 2005 and 12 Nov 2005, K. Wilk 3484, 3485,

4137, 4138 (KRAM); West Tatra Mts: Wawdéz Krakéw canyon, alt. 1100 m, 15 Jul 2004,

K. Wilk 2141 (KRAM), below Mnichy Chochotowskie, E of Skorusi Zleb, alt. 1300 m,

49°14’29"N/19°47°43”E, 19 Jul 2004, K. Wilk 2177 (KRAM), Mnichy Chochotowskie, S$

slope, alt. 1488 m, 49°14’40”N/19°47°42”E, 19 Jul 2004, K. Wilk 2183 (KRAM), Rzedy

below Ciemniak, alt. 1800 m, 49°13’75”N/19°53’80"E, 11 Jul 2004, K. Wilk 2109b, 2111

(KRAM).

ADDITIONAL MATERIAL EXAMINED — UKRAINE. Kamelnitskyi region, Kamianets

Podilskyi district, National Park “Podilskyi Tovtry”?, Privorita near Makiv, 10 km N

of Kamianets Podilskyi, alt. 223 m, 48°47°27”N/26°38'41”E, 25 Jun 2003, U. Bielczyk

(KRAM-L 48993).

COMMENTS — Caloplaca dichroa is characterized by a yellow or dark orange

granular-areolate thallus (often both color morphs occur side by side). It

produces vegetative propagules, such as blastidia and granules that usually

cover the thallus entirely. The distinctly thickened spore walls are diagnostic.

This species is included within the C. citrina group (Arup 2006). Specimens

of C. dichroa with thin, weakly developed thalli may be difficult to distinguish

from C. citrina (Hoffm.) Th. Fr, which is differentiated by its distinctly

sorediate, yellow-colored thalli and thin-walled spores. Caloplaca arcis (Poelt

& Vézda) Arup is distinguished from yellow-colored forms of C. dichroa by its

thicker thallus with distinct marginal lobes and thin-walled spores. According

to Vondrak et al. (2009), C. dichroa can also be confused with C. austrocitrina

Vondrak et al. and C. limonia Nimis & Poelt, but the latter two species produce

thicker thalli. Additionally, C. limonia produces larger vegetative diaspores and

a more intensely yellow thallus.

Caloplaca calcitrapa Nav.-Ros. et al., which also produces thick-walled, sand-

glass spores, is distinguished by its complete absence of vegetative diaspores

(Navarro-Rosinés et al. 2000).

Caloplaca dichroa has often been confused with C. coronata (Kremp. ex

Kérb.) J. Steiner, which produces a more distinctly isidiate thallus and smaller,

thin-walled spores (see Arup 2006 for comments).

Caloplaca marmorata (Bagl.) Jatta, Sylloge Lich. Ital.: 251 (1900).

THALLUS endolithic, without prothallus. AporHEciA pseudolecanorine,

abundant, scattered or in groups, immersed in rock at first, then sessile, round or

slightly angular by compression, 0.2-0.7 mm diam.,; disc flat or slightly convex,

more rarely strongly convex, rust to brownish orange (Séguy 1936, color code:

171, 172), epruinose; proper margin persistent, raised, particularly in young

apothecia rather thick, smooth, slightly paler than disc; thalline margin not

visible. Parathecium well developed, thick, 85-170 um, prosoplectenchymatous,

90 ... Wilk

lumina of cells oval. Amphithecium much reduced, algae grouped at the base

of apothecium. Epihymenium granular, reddish yellow. Hymenium hyaline,

85-110 um tall. Paraphyses simple or slightly branched, with irregular lumina,

1-4 apical cells slightly thickened, up to 5 wm wide. Hypothecium hyaline,

without crystals and oil droplets, prosoplectenchymatous. Asci 8-spored,

spores polaribilocular, thin-walled, 12.5-17 x 5.5-8.5 um, isthmus 1.5-3.5 um

wide. PycNIDIA not observed.

SPOT TEST REACTIONS: epihymenium K+ purple.

DIsTRIBUTION AND ECOLOGY — Caloplaca marmorata is widespread in Europe,

the Near East and north Africa (Navarro-Rosinés & Hladun 1996) and is also

reported from North America (Wetmore 2007). It is a pioneer taxon occupying

hard calcareous pebbles and rocks, e.g. pure limestone, marble, gypsum or

sandstones (Nimis & Poelt 1987, Nimis et al. 1996b, Navarro-Rosinés & Hladun

1996). It grows in sun-exposed and dry microhabitats at varying altitudes

(Nimis 1993, Navarro-Rosinés & Hladun 1996). The species is characteristic of

the association Caloplacetum lacteae-marmoratae Roux 2009.

In the Carpathians, the species was found only in Pieniny Mts, where it

grows on sun-exposed limestone sites at 500-1000 m. This is the first report

from Poland.

SPECIMENS EXAMINED — POLAND. Western Carpathians, Pieniny Mts, near summit of

Trzy Korony, 4 May 1957, J. Nowak (KRAM-L 4401); Mate Pieniny Mts: Dolina Biatej

Wody valley, near Jaworki village, 8 Jun 1968, Jj, Nowak (KRAM-L 18696), near Jaworki

village, Sottysie Skatki rocks, alt. 580 m, 49°24’20”N/20°32'30"E, 3 Jun 2005, K. Wilk

3395 (KRAM), Jaworki village, 1888, W. Boberski (KRAM-L 20914).

ADDITIONAL MATERIAL EXAMINED — UKRAINE. Kamelnitskyi region, Kamianets

poilskyi district, National Park ,,Podolskyi Tovtry”: Chotiri Kavalyeri near Vyerbka,

13 km N of Kamianets Podilskyi, alt. 289 m, 48°48'24”N/26°35'54”E, 25 Jun 2003, J.

Kiszka (KRAM-L 49147), Kitaihorod, 15 km SE of Kamianets Podilskyi, alt. 141 m,

48°38'25"N/26°46°58E, 24 Jun 2003, M. Kukwa (KRAM-L 48718), Tovtra Vyerbyetska

Reserve, alt. 289 m, 48°48’24”N/26°35’54”E, 25 Jun 2003, L. Sliwa 1964 (KRAM), ibid.,

A. Zalewska (KRAM-L 49328).

COMMENTS — Caloplaca marmorata is characterized by an endolithic thallus

and rusty or brownish orange, small apothecia with well developed proper

margins. The parathecium is thick, and the amphithecium is reduced but with

algae usually visible at the base of apothecium. The epihymenium is yellowish

red and the spores have a thin (< 3 um) isthmus.

The species belongs to the C. lactea group (Navarro-Rosinés & Hladun

1996), within which it could be confused with C. lactea (A. Massal.) Zahlbr.,

C. lacteoides Nav.-Ros. & Hladun, and C. nashii Nav.-Ros. et al. Caloplaca lactea

has orange apothecia, persistent and thin proper margins, and broadly ellipsoid

spores. Caloplaca lacteoides is differentiated by yellow, more rarely brownish

orange apothecia, simple paraphyses with strongly thickened apical cells, an

upper parathecium that is distinctly paraplectenchymatous, and very long

Caloplaca in Poland ... 91

(< 25 um) spores. Caloplaca nashii produces paler apothecia that are orange and

never brownish or rusty, a thin parathecium, simple paraphyses with narrow or

slightly thickened apical cells, and distinctly narrower spores (see also Navarro-

Rosinés et al. 2001).

Caloplaca oasis (A. Massal.) Szatala, Magyar Bot. Lapok 31: 120 (1932).

THALLUs strongly reduced and only some small granules or areoles visible at

thallus margin, pale yellow (Séguy 1936, color code: 290), rounded in shape;

without prothallus and vegetative propagules. APOTHECIA pseudolecanorine

or zeorine, abundant, crowded, sessile, round or angular by compression,

0.1-0.3 mm diam.; disc flat or slightly convex, orange (Séguy 1936, color codes:

196, 211), epruinose; proper margin very thin, not prominent, slightly raised

or level with disc, smooth, concolorous with or slightly paler than disc; thalline

margin much reduced, only in young apothecia visible. Parathecium thin, ca.

60 um, prosoplectenchymatous, hyphae radiating with oval to elongated cells.

Amphithecium +reduced, with numerous algae, cortex poorly developed.

Epihymenium granular, yellow. Hymenium hyaline, 75-85 um tall. Paraphyses

simple or slightly branched above, 1-2 apical cells thickened, up to 7 um wide.

Hypothecium hyaline, without crystals or oil droplets, prosoplectenchymatous,

hyphae irregular, ca. 40-50 um high. Asci 8-spored, spores polaribilocular,

thin-walled, 8.5-13.5 x (4.0-)4.8-6.8 tum, isthmus 3-5 um wide. PycNnipIa not

observed.

SPOT TEST REACTIONS: thallus K+ purple, medulla K-, epihymenium K+

purple.

DISTRIBUTION AND ECOLOGY — Caloplaca oasis, which is widespread in Europe

(Arup 2009), is also reported from Western Asia (John et al. 2004) and North

Africa (Thor & Nascimbene 2010). The species grows mainly on pure limestone,

concrete and mortar (Arup 2009), where it occurs as free living or a parasitic

lichen growing on endolithic Verrucaria s. lat. The species is characteristic for

the associations Aspicilietum calcareae Du Rietz 1925 emend. Roux 1978 and

Caloplacetum citrinae Beschel ex Klement 1955.

The species was found in the Carpathians (Gorce Mts) at elevations up to 550

m and in the Pomeranian lowlands, where it grows on calcareous sandstones

and concrete. ‘This is the first report of the species from Poland.

SPECIMENS EXAMINED — POLAND. Western Carpathians, Gorce Mts, Park Dworski in

Poreba Wielka, alt. 550m, 5 Oct 1993, P Czarnota(GPN 49/94). Pomeranian Voivodeship,

Wadzydze Landscape Park: Czarlina village, near bus stop, 13 Sept 2006, K. Wilk 7271

(UGDA), southern part of Wdzydze Tucholskie village, 53°58’05”N/17°55'°32”E, 13 Sept

2006, E. Adamska, W. Gruszka & L. Sliwa 3668a (UGDA).

COMMENTS — Caloplaca oasis is characterized by a reduced thallus and small

dark orange apothecia with thin proper margins.

92 ... Wilk

Arup (2009), who discusses the species in detail in the recent monograph

on the C. holocarpa group, notes that C. oasis has been often misidentified as

C. holocarpa (Ach.) A.E. Wade, especially when growing on anthropogenic

substrates. However, C. holocarpa produces more yellow-tinged apothecia with

thicker, more prominent proper margins and spores with a broader isthmus

(see Arup 2009). Well-developed parasitic C. oasis specimens may also be

confused with C. polycarpa (A. Massal.) Zahlbr., which can be distinguished by

larger apothecia with thicker margins and more distinct, thicker orange thalli

(see Arup 2009 for more details).

Caloplaca pseudofulgensia Gaya & Nav.-Ros., Biblioth. Lichenol. 101: 69 (2009).

THALLUS placodioid, rosettes 2-14 mm in diam., 0.1-0.4 mm thick, single or

often forming bigger congregations, yellow, creamy yellow, orange, brownish

orange, sometimes pale yellow to greenish yellow in shade (Séguy 1936, color

codes: 246, 226-230, 211-215), thallus in the centre often whitish, surface

rough, matt, pruinose (pruina concolorous with thallus); without prothallus

and vegetative propagules. Marginal lobes 0.5-2 mm long and 0.1-0.5(-0.8)

mm wide, closely adjacent to each other, richly and rather irregularly branched,

convex in the centre of thallus, but flat and slightly broadening at tips; surface of

lobes wrinkled and with delicate furrows along. Internal areoles flat to convex,

irregular or resembling small sublobules; young thallus often lacking internal

areoles, and then lobes forming from the centre. Thallus cortex distinct, thin

or sometimes thick, paraplectenchymatous, without necral layer, with hyaline

crystals (pol+, insoluble in K, soluble in N); algal layer tcontinuous; medulla

dense, with numerous hyaline crystals (pol+, insoluble in K, soluble in N).

APOTHECIA zeorine or pseudolecanorine, abundant, in centre of thallus, sessile

from the beginning, crowded, rarely scattered, round or angular and flexuose

by compression, 0.2-0.8(-1) mm diam.; disc flat, then convex, dark orange or

brownish orange (Séguy 1936, color codes: 186, 196, 201, 202), epruinose or

slightly pruinose; proper margin persistent, slightly paler than disc; thalline

margin present at first, then disappearing, thick, smooth or rough, even or

slightly cracked, pruinose; sometimes thalline margin excluded from the

beginning and only proper margin visible. Parathecium thin or thick, 25-60 tm,

prosoplectenchymatous, lumina of cells oval. Amphithecium well developed or

t+reduced, algaein groups orformingacontinuouslayer,sometimesamphithecial

tissue loose and with holes, with a paraplectenchymatous cortex, with hyaline

crystals (pol+, insoluble in K, soluble in N). Epihymenium granular, brownish

yellow. Hymenium hyaline, 65-90 um tall. Paraphyses simple or seldom

slightly branched, 1-2(-3) apical cells thickened, up to 6-6.5(-7.5) um wide.

Hypothecium hyaline, with numerous oil droplets, prosoplectenchymatous.

Asci 8-spored, spores polaribilocular, thin-walled, 7-13 x 3-6.5 um, isthmus

2.5-5 wm wide. Pycnip1A not observed.

Caloplaca in Poland ... 93

SPOT TEST REACTIONS: thallus K+ purple, J-, N-, medulla K-, J-, N-,

epihymenium K+ purple.

DIsTRIBUTION AND ECOLOGY — Caloplaca pseudofulgensia is widespread in

Europe (Gaya 2009), where it grows on calcareous rocks in warm and sun-

exposed places on north-exposed vertical walls. This nitrophilous species

belongs to the association Caloplacetum arnoldii Clauzade & Roux 1975 (corr.

Roux 2009; see also Gaya 2009).

The species was found in the Carpathian Pieniny and Tatra mountain

ranges, where it is not rare. It grows on limestone in sun-exposed to shaded

sites, mostly on vertical rock walls at 500-1700 m. This is the first report of the

species from Poland.

EXxsICCATES SEEN — Arnold, Lich. Exsicc. 1372 (sub Physcia pusilla) (KRAM).

SPECIMENS EXAMINED — PoLAND. Western Carpathians, Male Pieniny Mts, near

Jaworki village, Soltysie Skatki rocks, alt. 580 m, 49°24’20”N/20°32’30”E, 3 Jun 2005,

K. Wilk 3415 (KRAM); West Tatra Mts: Gtadkie Jaworzynskie, 18 Aug 1925, J. Motyka

(KRAM-L 10527), Dolina Koécieliska valley, 16 Jul 1912, W. Augustynowicz (KRAM-L

571), Dolina KoScieliska valley, alt. 1000 m, 25 Jul 2004, K. Wilk 2264 (KRAM), Stoly

above Dolina Koéscieliska valley, S slope, alt. 1400 m, 26 Jul 2004, K. Wilk 2277 (KRAM),

Waw6z Krakow canyon, alt. 1100 m, 15 Jul 2004, K. Wilk 2155 (KRAM), Waw6z Krakow

canyon, slope of Saturn, alt. 1500 m, 29 May 1959, J. Nowak (KRAM-L 8868), Kominy

Tylkowe, by trail from Przetecz Iwaniacka pass, alt. 1700 m, 5 Jul 1955, J. Nowak (KRAM-

L 4796), Kalacka Turnia, above Suchy Zleb, 9 Jul 1957, J. Nowak (KRAM-L 2472),

below Mnichy Chochotowskie, E of Skorusi Zleb, alt. 1300 m, 49°14’29”N/19°47°43”E,

19 Jul 2004, K. Wilk 2178 (KRAM), W slope of Wielka Swistéwka, in the direction to

Kobylaszowy Zleb, 27 Jun 2004, A. & M. Ronikier (KRAM-L 55074); High Tatra Mts,

Kalacka Turnia, alt. 1300 m, 9 Jul 1957, J, Nowak (KRAM-L 122).

ADDITIONAL MATERIAL EXAMINED — SLOVAKIA. SPI8, [uboviia Castle, s.d., s.coll.

(KRAM-L 20803).

COMMENTS — Caloplaca pseudofulgensia is characterized by a placodioid,

yellow to orange thallus covered by a distinct, concolorous pruina. Marginal

lobes are flat and broad at tips and the lobe surfaces are wrinkled and furrowed.

Dark orange apothecia contrast with the thallus.

The species belongs to the C. saxicola group (Gaya 2009), of which C. pusilla

is the most similar. However, C. pusilla produces robust, convex, bigger, less

branched lobes with surfaces that have neither wrinkles nor furrows and

a thallus that is often salmon colored and white pruinose; furthermore its

apothecia, which are initially immersed in the thallus, produce bigger spores.

Caloplaca saxicola (Hoffm.) Nordin differs from C. pseudofulgensia in its

intensely orange, epruinose, smooth thallus. The thalline lobes, which are

usually short to strongly reduced, convex, ascend slightly from the rock surface.

Its apothecia, which are initially immersed in the thallus before becoming

sessile and aggregated, produce bigger spores.

94 ... Wilk

Morphologically, C. pseudofulgensia can be very similar to C. aurea (Schaer.)

Zahlbr., a species that belongs to another taxonomical group but which produces

1- or polaribilocular spores with pointed apices and a greatly reduced isthmus

and considerably longer (< 20 um) size. Caloplaca aurea also produces a thicker,

epruinose thallus that does not form the rosettes typical of C. pseudofulgensia.

Caloplaca pusilla (A. Massal.) Zahlbr., Annal. Naturhist. Hofmuseums

Wien 4: 353 (1889).

THALLUs placodioid, rosettes 2-10 mm in diam., 0.3-0.4 mm thick, single or

usually forming bigger congregations, yellow ochre, pinkish or salmon, often

whitish in the centre (Séguy 1936, color codes: 185, 189-190, 203, 205, 215),

surface white pruinose, especially in the centre of thallus, where necrosis may

also occur; without prothallus and vegetative propagules. Marginal lobes 0.5-2

mm long and 0.2-0.5 mm wide, closely adjacent to each other or sometimes

overlapping, convex or flat and broad at tips. Internal areoles convex, rounded

to elongated, or areoles absent and lobes forming from the centre. Thallus

cortex thin to thick, 13-80 um, scleroplectenchymatous, without necral

layer; layer of algae not continuous; medulla loose, with or without crystals.

APOTHECIA zeorine or pseudolecanorine, abundant, in centre of thallus,

crowded or scattered, immersed at first, then sessile and often constricted at the

base, rounded or angular by compression, 0.2-1 mm diam.; disc flat or slightly

convex, dark orange, brownish orange or blood-red, more rarely reddish

orange (Séguy 1936, color codes: 126, 161, 168, 171, 186, 202, 247), sometimes

slightly white pruinose; proper margin persistent, slightly raised or level with

disc, concolorous with disc or slightly paler; thalline margin persistent or

disappearing, sometimes heavily white pruinose. Parathecium thin, 30-42

um, sclero-prosoplectenchymatous. Amphithecium with numerous algae in

groups or forming a continuous layer, sometimes amphithecial hyphae loose,

cortex thick, with crystals. Epihymenium granular, brown or reddish golden.

Hymenium hyaline, 60-90 pm tall. Paraphyses simple or slightly branched,

1-2(-4) apical cells thickened, up to 8(-10) um wide. Hypothecium hyaline,

without oil droplets and crystals, prosoplectenchymatouseous. Asci 8-spored,

spores polaribilocular, thin-walled, 8.5-15 x 4-8.5 uum, isthmus 2.5-5 tum wide.

Pycnipia infrequent, inconspicuous, immersed; conidia colorless, ellipsoid to

bacilliform, 3 x 1.5 um.

SPOT TEST REACTIONS: thallus K+ purple, J-, N-, medulla K-, J-, N-,

epihymenium K+ purple.

DIsTRIBUTION AND ECOLOGY — ‘The widely distributed Caloplaca pusilla is

probably cosmopolitan (Gaya 2009). The species grows on natural calcareous

rocks and mortar, is known from varying altitude and exposures, and prefers

eutrophic environments. It is characteristic of the association Caloplacetum

Caloplaca in Poland ... 95

pusillae Du Rietz ex Kaiser 1926 but may also be found in the Caloplacetum

arnoldii association (see Gaya 2009).

The species, which appears widely distributed in Poland, was found in

the Carpathians (Gorce and Pieniny Mts) and in the lowlands in Warmian-

Masurian province. More herbaria materials need revision to determine the

true distribution, because C. pusilla has previously been filed under the name

C. saxicola (Fattynowicz 2003). In Poland the species occurs on limestone,

calcareous sandstones, and (commonly) concrete in sunny sites at up to

980 m.

SPECIMENS EXAMINED — POLAND. Western Carpathians, Gorce Mts, Boginka

rock, above valley of Lubarski stream, alt. 680 m, 15 Aug 1967, K. Glanc (KRAM-

L 27476); Pieniny Mts: Popieska Skatka rock by Sronowickie lake, alt. 560 m,

49°24’48"N/20°19°50"E, 5 Jun 2005, K. Wilk 3457 (KRAM), below summit of Trzy

Korony, 4 May 1957, J. Nowak (KRAM-L 3786, KRAM-L 3790), Czorsztyn, s.d., s.coll.

(KRAM-L 20787), Podtazce, 10 Oct 1999, J. Kozik (PPN), Ociemny Wierch, 5 May 1955,

J. Nowak (KRAM-L 3245), Zielone Skatki rocks by Czorsztyn lake, NE of Falsztyna,

alt. 588 m, 49°25’56"N/20°17°35”E, Nov 2005, K. Wilk 4131 (KRAM); Male Pieniny

Mts, Zabaniszcze, Gora Trzy Skatki Mt., alt. 740 m, Aug 1980, K. Toborowicz (KTC).

Warmian-Masurian province, Gizycko County, Szymonka village, concrete bridge

among meadows, 11 Jun 1974, L. Olesinski (KRAM-L 30631).

COMMENTS — Caloplaca pusilla is characterized by a placodioid, yellow ochre,

pinkish or salmon colored thallus with long and + convex marginal lobes that

are tightly attached to the substratum.

Caloplaca pusilla, which was was treated as a synonym of C. saxicola for

many years, has been just recently recovered as independent by Gaya (2009).

Caloplaca saxicola differs from C. pusilla by an epruinose thallus with short to

strongly reduced lobes that ascend distinctly from the rock, apothecia that are

initially immersed in thallus and form finely, bigger and strongly aggregated

clusters. The spores of C. saxicola are longer and narrower than in C. pusilla. To

distinguish C. pusilla from C. pseudofulgensia, see remarks under that species.

Caloplaca pusilla often grows together with C. arnoldii (Wedd.) Zahlbr.

and C. clauzadeana (Gaya) Nav.-Ros. & Cl. Roux. In comparison to C. pusilla,

C. arnoldii has a distinctly reddish and smaller thallus, whereas C. clauzadeana

has strongly convex lobes with yellowish tips and much narrower ellipsoid

spores. For more details see Gaya (2009).

Acknowledgements

I am grateful to E. Gaya (Durham, USA) and U. Arup (Lund, Sweden) for peer-

reviewing the manuscript and providing valuable suggestions and improvements.

I also thank L. Sliwa (Krakow, Poland) for revising and commenting an early version

of the paper. U. Arup is acknowledged for confirming the C. dichroa identification. The

curators of the herbaria are thanked for sending the material for study. CM. Wetmore

(St. Paul, USA) is thanked for hospitality and constructive discussions during my visit

96 ... Wilk

to the Minnesota herbarium. Financial support was provided by the Ministry of Science

and Higher Education, grant no. N N303 294334.

Literature cited

Alstrup V, Olech M. 1988. Additions to the lichen flora of the Polish Tatra Mountains. Zeszyty

Naukowe Uniwersytetu Jagielloriskiego [Prace Botaniczne] 17: 179-183.

Alstrup V, Olech M. 1992. Additions to the lichen flora of the Polish Tatra Mountains. III. Zeszyty

Naukowe Uniwersytetu Jagielloriskiego [Prace Botaniczne] 24: 179-184.

Arup U. 2006. A new taxonomy of the Caloplaca citrina group in the Nordic countries, except

Iceland. Lichenologist 38(1): 1-20. doi:10.1017/S0024282905005402

Arup U. 2009. The Caloplaca holocarpa group in the Nordic countries, except Iceland. Lichenologist

41(2): 111-130. doi:10.1017/S0024282909008135

Bielczyk U. (ed.). 2003. The Lichens and Allied Fungi of the Polish Carpathians - An Annotated

Checklist. Biodiversity of the Polish Carpathians, Vol. 1, W. Szafer Institute of Botany, Polish

Academy of Sciences, Krakéw. 342 pp.

Bungartz F. 2002. Morphology and anatomy of the fertile structures. 24-35, in: Nash TH II, Ryan

BD, Gries C, Bungartz F. (eds.), Lichen Flora of the Greater Sonoran Desert Region. 1. Tempe:

Lichens Unlimited, Arizona State University.

Ceynowa-Gieldon M, Adamska E. 2005. Caloplaca ruderum, a lichen species new to Poland. Polish

Botanical Journal 50(1): 75-76.

Clauzade G, Roux C. 1985. Likenoj de Okcidenta Europo. Ilustrita Determinlibro. Bulletin de la

Société Botanique du Centre-OQuest, Nouvelle Série - Numéro Spécial 7. Royan, France. 893

Pp.

Eitner E. 1901. II Nachtrag zur Schlesischen Flechtenflora. Jahresbericht der Schlesischen

Gesellschaft fiir vaterlandische Cultur 78: 5-27.

Faltynowicz W. 2003. The lichens, lichenicolous and allied fungi of Poland. An annotated checklist.

W. Szafer Institute of Botany, Polish Academy of Sciences, Krakow. 435 pp.

Gaya E. 2009. Taxonomical revision of the Caloplaca saxicola group (Teloschistaceae, lichen-

forming Ascomycota). Bibliotheca Lichenologica 101: 1-191.

Glanc K, Tobolewski Z. 1960. Porosty Bieszczadéw Zachodnich. Poznanskie Towarzystwo Przyjaciét

Nauk. Wydziat Matematyczno-Przyrodniczy. Prace Komisji Biologicznej 21(4): 1-108.

Hafellner J. 2001. Bemerkenswerte Flechtenfunde in Osterreich. Fritschiana 28: 1-30.

Hafellner J, Tiirk R. 2001. Die lichenisierten Pilze Osterreichs - Eine Checkliste der bisher

nachgewiesenen Arten mit verbreitungsangaben. Stapfia 76: 1-167.

John V, Seaward MRD, Sipman HJM, Zedda L. 2004. Lichens and lichenicolous fungi from Syria,

including a first checklist. Herzogia 17: 157-177.

Johnsen AB. 1965. Some lichens from West Fork, Coconino County, Arizona. Bryologist 68(2):

241-243. doi:10.2307/3241026

Kondratyuk S, Khodosovtsey A, Oksner AN. 2004. Caloplaca. 38-235, in: Khodosovtsev A,

Kondratyuk S, Makarova I, Oksner A. (eds.), Handbook of the lichens of Russia. 9. Fuscideaceae,

Teloschistaceae. Russian Academy of Sciences, St. Petersburg.

Muggia L, Grube M, Tretiach M. 2008. A combined molecular and morphological approach to

species delimitation in black-fruited, endolithic Caloplaca: high genetic and low morphological

diversity. Mycological Research 112: 36-49. doi:10.1016/j.mycres.2007.02.001

Navarro-Rosinés P, Hladun NL. 1996. Les especies saxicolo-calcicolas del grupo de Caloplaca lactea

(Teloschistaceae, liquenes), en las regiones mediterranea y medioeuropea. Bulletin de la Société

linnéenne de Provence 47: 139-166.

Caloplaca in Poland ... 97

Navarro-Rosinés P, Gaya E, Hladun NL. 2001. Caloplaca nashii sp. nov. (Teloschistaceae, Lichenes),

a North American species of the C. lactea-group growing in caliche. Mycotaxon 79: 29-41.

Navarro-Rosinés P, Gaya E, Roux C. 2000. Caloplaca calcitrapa sp. nov. (Teloschistaceae) un nuevo

liquen saxicolo-calcicola mediterrdneo. Bulletin de la Société linnéenne de Provence 51:

145-152.

Nimis PL. 1992. Chiavi analitiche del genere Caloplaca Th. Fr. in Italia (Lichenes, Teloschistaceae).

Notiziario della Societ¢ Lichenologica Italiana 5: 9-28.

Nimis PL. 1993. The Lichens of Italy. An annotated catalogue. Monografia XII. Bollettino del

Museo Regionale di Scienze Naturali — Torino. 897 pp.

Nimis PL, Poelt J. 1987. The lichens and lichenicolous fungi of Sardinia (Italy): an annotated list.

Studia Geobotanica 7 (Supplement 1): 1-269.

Nimis PL, Monte M, Tretiach M. 1987. Flora e vegetazione lichenica di aree archeologiche del

Lazio. Studia Geobotanica 7: 3-161.

Nimis PL, Ottonello D, Tretiach M. 1996a. Some new or interesting lichen records from Taormina

(E Sicily). Bollettino del Museo Regionale di Scienze Naturali — Torino 14(1): 117-138.

Nimis PL, Poelt J, Tretiach M. 1996b. Lichens from the gypsum Park of the northern Apennines (N

Italy). Cryptogamie, Bryologie Lichenologie 17(1): 23-38.

Nowak J. 1960. Naskalne zespoly porost6w Wyzyny Krakowsko-Czestochowskiej [Saxicolous

associations of the lichens of Cracow-Czestochowa Upland]. Fragmenta Floristica et

Geobotanica 6: 22-392.

Nowak J. 1961. Porosty Wyzyny (Jury) Krakowsko-Czestochowskiej [The lichens of the Krakéw-

Czestochowa Upland]. Monographiae Botanicae 11(2): 1-128.

Nowak J, Tobolewski Z. 1975. Porosty polskie. Opisy i klucze do oznaczania porostéw w Polsce

dotychczas stwierdzonych lub prawdopodobnych. Paristwowe Wydawnictwo Naukowe,

Warszawa — Krak6éw. 1177 pp.

Oksner AM. 1993. Flora lishaynikiv Ukraini. Vol. 2(2). Naukova Dumka, Kiiv. 541 pp.

Roux C, Bultmann H, Navarro-Rosinés P. 2009. Syntaxonomie des associations de lichens saxicoles-

calicoles du sud-est de la France. 1. Clauzadeetea immersae, Verrucarietea nigrescentis, Incertae

saedis. Bulletin de la Société linnéenne de Provence 60: 151-175.

Ryan BD, Bungartz F, Nash TH HI. 2002. Morphology and anatomy of the lichen thallus. 8-23, in:

Nash TH III, Ryan BD, Gries C, Bungartz F. (eds.), Lichen Flora of the Greater Sonoran Desert

Region. 1. Lichens Unlimited, Arizona State University, Tempe, Arizona.

Santesson R, Moberg R, Nordin A, Tonsberg T, Vitikainen O. 2004. Lichen-forming and

Lichenicolous Fungi of Fennoscandia. Museum of Evolution, Uppsala University, Uppsala,

Sweden. 359 pp.

Séguy E. 1936. Code Universel des Couleurs. Encyclopédie Pratique du Naturaliste 30. Paul

Lechevalier, Paris.

Sliwa L, Wilk K. 2008. Is a remarkable species — Caloplaca flavescens (lichenized fungi) — new to the

Polish lichen biota? Acta Mycologica 43(2): 207-213.

Thor G, Nascimbene J. 2010. An annotated checklist and bibliography of lichens and lichenicolous

fungi of Libya. Cryptogamie Mycologie 31(1): 67-95.

Tobolewski Z. 1956. Materialy do flory porostow Tatr. Poznariskie Towarzystwo Przyjaciét Nauk.

Wydziat Matematyczno-Przyrodniczy. Prace Komisji Biologicznej 17(2): 3-34.

Tobolewski Z. 1958. Porosty Pienin. Poznariskie Towarzystwo Przyjaci6t Nauk. Wydziat

Matematyczno-Przyrodniczy. Prace Komisji Biologicznej 17(5): 1-124.

Tretiach M, Muggia L. 2006. Caloplaca badioreagens, a new calcicolous, endolithic lichen from

Italy. Lichenologist 38(3): 223-229. doi:10.1017/S0024282906005305

98 ... Wilk

Tretiach M, Pinna D, Grube M. 2003. Caloplaca erodens [sect. Pyrenodesmia], a new lichen species

from Italy with an unusual thallus type. Mycological Progress 2(2): 127-136. doi:10.1007/

$11557-006-0050-7

Vondrak J, Kocurkova J, Palice Z, Li8ka J. 2007. New and noteworthy lichens in the Czech Republic

— genus Caloplaca. Preslia 79: 163-184.

Vondrak J, Riha P, Arup U, Sechting U. 2009. The taxonomy of the Caloplaca citrina group

(Teloschistaceae) in the Black Sea region; with contributions to the cryptic species concept in

lichenology. Lichenologist 41(6): 571-604. doi:10.1017/S0024282909008317

Wetmore CM. 1994. The lichen genus Caloplaca in North and Central America with brown or

black apothecia. Mycologia 86(6): 813-838. doi:10.2307/3760596

Wetmore CM. 2007. Caloplaca. 179-220, in: Nash TH IU, Gries C, Bungartz F. (eds.), Lichen Flora

of the Greater Sonoran Desert Region. 3. Tempe: Lichens Unlimited, Arizona State University.

Wetmore CM. 2009. New species of Caloplaca (Teloschistaceae) from North America. Bryologist

112(2): 379-386. doi:10.1639/0007-2745-112.2.379

Wilk K. 2008. Kalcyfilne gatunki rodzaju Caloplaca w polskich Karpatach Zachodnich. Doctoral

thesis, W. Szafer Institute of Botany, Polish Academy of Sciences, Krakéw. 158 pp.

Wilk K, Flakus A. 2006. Four species of Caloplaca (Teloschistaceae, lichenized Ascomycota) new to

Poland. Mycotaxon 96: 61-71.

Wunder H. 1974. Schwartzfruchtige, saxicole Sippen der Gattung Caloplaca (Lichenes,

Teloschistaceae) in Mitteleuropa, dem Mittelmeergebiet und Vorderasien. Bibliotheca

Lichenologica 3: 1-186.

MYCOTAXON

Volume 115, pp. 99-106 January-March 2011

DOT: 10.5248/115.99

Aspicilia subfarinosa, the correct name for A. substerilis

AYHAN SENKARDESLER™ & MOHAMMAD SOHRABI?

‘Biology Department, Faculty of Science, Ege University, 35100 Izmir, Turkey

?Plant Biology, Department of Biological and Environmental Sciences,

PO. Box 65, 00014, Helsinki University, Finland

e& Department of Plant Science, University of Tabri, 51666, Tabriz, Iran

CORRESPONDENCE TO *: !Ayhan.Senkardesler@ege.edu.tr & ?mohammad.sohrabi@helsinki.fi

AsstTractT— Lecanora subfarinosa is lectotypified and transferred to the genus Aspicilia, where

it is recognized as the correct name for A. substerilis. Lecanora farinosa f. subopegraphoides,

which is also lectotypified, is reduced to a synonym of A. subfarinosa. Aspicilia subfarinosa is

newly reported from France, Israel, Iran, Iraq, and Turkey.

Key worps— Ascomycetes, Croatia, Greece, Italy, Syria

Introduction

We began our study of Aspicilia in SW Asia by examining all available

types, which gave us an opportunity to look for earlier names for A. substerilis

(Sipman 2007), aname recently published for a widespread, common species in

our study area that has been confused with A. farinosa (Flérke) Hue. However,

determination of the earliest available name was made difficult because so many

new species have been described from the arid lands of SW Asia (Azerbaijan,

Iran, Iraq, Lebanon, Syria and Turkey), SE Europe (Greece), and N Africa

(Algeria, Egypt, Tunisia).

Aspicilia appears particularly diverse in SW Asia, where Julius Steiner

described 44 representatives of Lecanora sect. Aspicilia (Steiner 1893, 1894,

1895, 1898, 1899, 1902, 1904, 1905, 1909, 1910, 1919a, b, 1921). R.G. Werner

next described 18 new taxa in Aspicilia (Maire & Monod 1950, Werner 1936,

1938, 1954, 1956, 1957a,b, 1963, 1966, 1979). O. Szatala described 10 more

species (Szatala 1929, 1931, 1939, 1941, 1943, 1956), and another 10 were

proposed by A.N. Oxner (Kopaczevskaja et al. 1971, Oxner 1929, 1933, 1939,

1940). Altogether 55 (of 82) taxa described from SE Europe and SW Asia

appeared as potential older names for A. substerilis. Of these, 27 taxa had either

been originally proposed at or later raised to the species level prior to Sipman’s

100 ... Senkardesler & Sohrabi

500 1.000 Kilometers

(a ae Ser

Figure 1. Distribution of Aspicilia subfarinosa.

A = Localities cited in Sipman (2007), @ = Specimens examined.

2007 description of A. substerilis. Examination of the 27 types revealed that

one, Lecanora subfarinosa, was conspecific with Aspicilia substerilis. Among the

remaining 28 infraspecific taxa, only the type specimen of Lecanora farinosa f.

subopegraphoides appeared to be also conspecific with Aspicilia substerilis.

Materials & methods

The study presented here is based mainly on herbarium material kept in BC, BCN,

BP, G, GZU, KW, W and WU. Most of type specimens in Aspicilia slat. described by

A.N. Oxner, J. Miller Argoviensis, J. Steiner, O. Szatala and R.G. Werner have been

revised. Extensive herbarium collections of Aspicilia calcarea and A. farinosa (incl.

synonyms) were examined by the first author. The specimens were studied in the usual

way by stereomicroscope and compound microscope, and all measurements (ascospores,

conidia, and other apothecial structures) were made in microscopic preparations in

tap water. To study ascus structure, Lugol’s solution was added to sections and squash

preparations after pre-treatment with 10% KOH.

Selected specimens were analysed for secondary metabolites by high performance

thin-layer chromatography (HPTLC) in accordance with Arup et al. (1993), using a

CAMAG Nanomat 4 sample applicator and a CAMAG Horizontal Development

Chamber.

Additional specimen information obtained from collection labels is presented in

English. Label data is abbreviated where necessary and reorganized for easy access with

site information preceding collection data.

Aspicilia subfarinosa correct name for A. substerilis ... 101

Taxonomy

Aspicilia subfarinosa (J. Steiner) Senkard. & Sohrabi, comb. nov. Fic. 2

MycoBank MB 518413

= Lecanora subfarinosa J. Steiner, Ann. Naturhist. Mus. Wien 34: 38 (1921).

Typus: [Syria] Mesopotamia, in summo cacumine Tschil Miran montium Dschebel

Sindschar, ad rupes substrato calcareo, ca. 1400 m, 9.6.1910, H.F. von Handel-Mazzetti

3297 (W 1920-827!-lectotypus, hic designatus, W 1929-2110!-isolectotypus)

= Aspicilia substerilis Sipman, Biblioth. Lichenol. 96: 267 (2007), syn. nov.

Typus: “Greece, W Aegean, Nomos Evvias, Eparchia & Dimos Karistos: E Evvia,

Agios Dimitrios Gorge, c. 350 m., calcareous, N-facing cliffs and boulders along

dry stream in ravine, 30.9.2005, H. Sipman & Th. Raus 54305 [B-holotype, Sipman

(2007)]

= Lecanora farinosa f. subopegraphoides Werner, Bull. Soc.

Bot. France 103(7-8): 462 (1956), syn. nov.

= Aspicilia farinosa f. subopegraphoides (Werner) S.Y. Kondr., in

Kondratyuk & Zelenko, Ukr. Bot. Zhurn. 59: 603 (2002).

Typus: “Syrie: monts Ansarieh (Alaouites), région de Slenfé, versant Est dans le

Cedretum, 1200-1300 m., sur les rochers calcaires, 27.8.1938, R.G. Werner” (BC!-

lectotypus, hic designatus, BC!-isolectotypus).

ECOLOGY AND DISTRIBUTION— On the upper surface of well-lit, exposed limestone

outcrops. Widespread in the Mediterranean (Fic. 1).

KEY CHARACTERS— ‘This species is characterized by a thin, continuous to

fissured, chalky-white thallus with farinose surface, apothecia separated from

thallus by a fissure when dry, 4-spored asci, medium sized to large ascospores

of 20-37 x 20-25 um in size, rather short to medium sized conidia of 7-18 um

in length, and by the absence of secondary metabolites.

EXPANDED DESCRIPTION [based on Steiner (1921), Sipman (2007), and our

own observations]— Thallus crustose, forming large patches usually over 5

cm wide, chalky white, farinose, continuous or more or less fissured around

the ascocarps, 0.1-1.5 mm thick; margins without black prothallus, but with a

groove between two adjacent thalli; cortex with paraplectenchymatous tissue

constructed of less branched, moniliform-like and perpendicular hyphae and

occasionally with a necrotic layer up to 60 tm thick; algal layer c. 60 «um thick,

filled with small crystals; medulla white or occasionally becoming ochre in

lower parts, composed of branched and reticulate hyphae and filled by larger, c.

5-10 um wide crystals. Apothecia c. 0.2-0.8(-1.0) mm wide, immersed in the

thallus and separated from it by a fissure when dry, without thalline margin,

rounded or lobulate to elongate, often in groups seemingly originating from

disintegrated larger apothecia, with grey, white-pruinose, concave disc and

white, raised margins and sterile ridges (columellae); hymenium 100-150

pum tall, hyaline, clear, I+ persistently weak blue or partly turning to yellow;

paraphyses in upper parts branched and submoniliform and 4-5 um wide,

in lower part 2.5-4 tum wide, loose, not branched; epithecium dark brown to

102 ... Senkardesler & Sohrabi

green, N+ green; hypothecium colourless, without algal layer below; asci of

Aspicilia-type, subclavate, usually sterile, c. 95-130 x 23-44 um; ascospores

simple, hyaline, 2-4 in asci, c. 20-37 x 16-35 um, usually absent. Pycnidia

immersed, flask-like, with a black and punctiform ostiole; conidia filiform,

straight, 6-18 x 0.6-1 um.

SECONDARY METABOLITES— None detected by HPTLC.

ADDITIONAL SPECIMENS EXAMINED: FRANCE: Forcalquier, Les Moures, Provence,

600 m — on calcareous stone, 18 Aug. 1969, G. Clauzade & X. Llimona (BCN-lich. 41

as A. farinosa). ISRAEL: C. Negev, NEAR AVDATH — on calcareous stone, 16 Apr. 1974,

}. Garty 36(7 as L. farinosa) (GZU s.n as L. farinosa); NEAR BEER-SHEBA, Nizana road

— on hard limestone, 17 Mar. 1947, Y. Gutter (BCN-lich. 279 as L. farinosa). IRAN:

Lorestan Prov., ALIGUDARZ DISTRICT, Oshtran Kouh, “Schuturun Kuh, Luristan’ — no

date, S.D. Strauss (W s.n. as L. farinosa); East Azerbaijan, MARAND DISTRICT 32 km N of

Marand, 38.6763 N, 45.6573 E, 1440 m — 2 Nov. 2007, M.Sohrabi, H.Sipman, U.Sachting

& M.R. Asef. (hb. Sohrabi, MS010094). IRAQ: ‘Mesopotamia, SEIRAMUN prope Mossul,

ca. 250 m — on calcareous stone, no date, H.R von Handel-Mazzetti, as L. farinosa

(WU 40899); Kurdistania Turcica, MosuL, ON MAR JakuB — Jun 1910 F Nabelek (BP

42430 as L. farinosa); ca. 800 m — no date, Nabelek (W s.n. as A. farinosa). SYRIA: Ain

Arus, between Rakka & Urea, near Dschidle (Dicle), at Belich R. spring, ca. 350 m

— on calcareous stone, 3 Jul. 1910, H.E von Handel-Mazzetti 1843 (W 1929-15582 as

L. farinosa, with L. platycarpa f. pruinosa & L. contorta var. glaucopruinosa); Dschebel

Sindschar, NEAR DscHADDALE between Dschaddale & El Chattunije, ca. 600 m — on

tufa-like calcareous stone, 10 Jun. 1910, H.E von Handel-Mazzetti 1543 (WU 40901 as L.

farinosa); EL MAGHARAD MT on SINDSCHAR, ca. 700-1000 m — on calcareous stone, 8

Jun. 1910, H.R von Handel-Mazzetti 1375 (WU 40903 as L. farinosa); ca. 1000 m — on

calcareous stone, 9 Jun. 1910, H.R von Handel-Mazzetti 1437 (WU 40897 as L. farinosa);

TscuiL Mt. sumMIT, ca. 1400 m — on calcareous stone, 9 Jun. 1910, H.E. von Handel-

Mazzetti 3295 (WU 40894 as L. farinosa); Haleb (Aleppo), near train station, ca. 380

m — on calcareous stone, 15 Mar. 1910, H.E von Handel-Mazzetti 162 (WU 40900 as

L. farinosa); Alaouites, QAsTAL EL Moag, in Baér 40 km from Lattaquié (Muhafazah)

on the road to Antioche (Hatay) — on calcareous-siliceous stone, 3 Sep. 1938, R.G.

Werner, (BC s.n. as L. farinosa f. subopegraphoides jointly with type specimens of L.

angulata). TURKEY: Bithynia, OsMANKGJ (OsMANKOy), Gdkszu (Géksu), in tree grove

on limestone cliff, 300 m — 6 Oct. 1918, I. Gyérffy de Szigeth (BP 42433 as “L. calcarea

var. concreta f. farinosa”); BANK OF TiGRipIs (TiGRIS) RIVER BETWEEN SERT (SIIRT)

& DsSCHESIRET-IBM-OMAR (CIZRE), near Fiindiik, ca. 1100 m — on calcareous stone,

18 Aug. 1910, H.R von Handel-Mazzetti 3036 (W 1929-15666 & WU 40893, both as L.

farinosa); between Balak & Fiindiik, ca. 500 m — on calcareous stone, 18 Aug. 1910, H.F

von Handel-Mazzetti 3018 (WU 40893 as L. farinosa) & 3041 (WU 40904 as L. farinosa).

Afyon, S6GUT Mrs, between Korpeli & Sankéy, 3rd km, 37°54.96’ N, 30°06.16’ E, 1160

m — 24 Jun. 2009, A. Senkardesler (EGE 39734); AHIR Mt, between Arizlar & Cepni,

3rd km, 38°34.02’ N, 30°03.90’ E, 1300 m — 23 Apr. 2010, A. Senkardesler (EGE 39735);

between Yaga & Calhisar, 4rd km, 38°39.90’ N, 30°04.26’ E, 1490 m — 23 Apr. 2010,

A. Senkardesler (EGE 39736); between Arharim & Karadirek, 2nd km, 38°36.00° N,

30°11.28’ E, 1280 m — 23 Apr. 2010, A. Senkardesler (EGE 39737); between Gedikevi &

Alibeyce, Ist km, 39°08.82’ N, 31°04.56’ E, 1130 m — 24 Mai 2010, A. Senkardesler (EGE

39738); between Salihler & Toklucak, Ist km, 39°02.88’ N, 31°22.74 E, 980 m — 24

Mai 2010, A. Senkardesler (EGE 39739). SULTAN Mrs, 0.5 km south of Kirca, 38°30.60°

Aspicilia subfarinosa correct name for A. substerilis ... 103

subfarinosa (EGE 39735, central), with the deeply cracked-areolate surface of A. calcarea (EGE

39735, left; EGE 39735, right).

N, 31°13.86’ E, 1120 m — 25 Mai 2010, A. Senkardesler (EGE 39740); between Pazaragac

& Inli, 5th km, 38°31.80’ N, 30°49.38’ E, 1060 m — 25 Mai 2010, A. Senkardesler (EGE

39741). Usak, BETWEEN DELIHIDIRLI & COKAKLI, 0.5 km, 38°20.58’ N, 29°34.56’ E, 910

m — 14 Mai 2010, A. Senkardesler (EGE 39742). ULUBEY CANYON, between Alfaklar &

Pasalar, 4th km, 38°24.90° N, 29°30.42’ E, 860 m — 14 Mai 2010, A. Senkardesler (EGE

39743).

COMMENTS— Steiner (1915) provides a description with 4 ascospores per

ascus for this species under the name Lecanora farinosa but admittedly never

studied original material. Therefore he was unable to decide which of the two

was correct, “Lecanora farinosa sensu J. Steiner” or “A. farinosa (Florke) Hue’,

which has asci with up to 8 ascospores (Sipman 2007, Nordin & Roux 2009).

All specimens of Lecanora farinosa sensu J. Steiner listed in Steiner (1910, 1915,

1921), Szatala (1927, 1941) and Senkardesler & L6kés (2010) that we examined

appear to belong to the species described by Sipman (2007) and not to

“A. farinosa (Florke) Hue”.

The species A. subfarinosa was based on its longer conidia compared with

A. farinosa sensu J. Steiner (11-18 tm vs. 7-12 um). However, the cited specimen

from Iran has conidia 11-14 um long and a specimen from Israel, covered only

with pycnidia, has longer (9-16 tum) conidia. Together with the similar external

104 ... Senkardesler & Sohrabi

thallus morphology for both species, the intermediate conidial lengths suggest

that there are no informative morphological differences between A. subfarinosa

and A. farinosa sensu J. Steiner.

The short description of Lecanora farinosa f. subopegraphoides is based only

on the farinose surface and absence of areoles, which our study confirms. We

also observed fissures around the ascocarps and 4-spored asci and detected no

secondary metabolites. For these reasons, we synonymize here A. farinosa var.

subopegraphoides and A. substerilis with A. subfarinosa.

‘The type specimen for a second form described by Szatala (1943), A. farinosa

f. ochracea, has not been found even after diligent searches in BP, W, and WU.

Probably it was lost during World War II. Verseghy (1964, 1968, 1974, 1981)

did not report this type specimen from BP, either.

Aspicilia subfarinosa is very similar to and could be confused with A. calcarea

(L.) Kérb., but their surface structure is evidently different: A. subfarinosa has a

farinose smooth surface with occasional very fine cracks, while A. calcarea has

a deeply cracked-areolate surface (Fic. 2). Another difference between both

species is the fissures around the apothecia in dry condition: A. subfarinosa has

immersed apothecia, which are separated from the thallus by a fissure, while

this is not a trait of A. calcarea.

Conclusion

Although A. subfarinosa and A. farinosa seem to be well defined species,

the names have a complicated application history in some publications and

checklists, chiefly in those dealing with southwest Asian and Mediterranean

lichen flora. During this study it became clear that in the herbaria indicated

above, a large number of examined specimens should be referred to A. farinosa.

‘There are also some specimens in the A. calcarea complex, tentatively filed

under A. farinosa or vice versa, deposited in different herbaria, that may need

to be referred to A. subfarinosa after the number of ascospores per ascus and

occurrence of fissures around the apothecia have been noted.

Acknowledgments

The authors wish to thank to Dr Harrie J.M. Sipman (Berlin) and Dr Orvo Vitikainen

(Helsinki) for revision and helpful comments on the draft of this paper. Fresh material

was collected by the first author with the support of The Scientific and Technological

Research Council of Turkey (TUBITAK) under project number 1061628. The studies in

G were supported by the Science-Technology Application and Research Centre of Ege

University (EBILTEM); studies in BC, BCN and KW by Ege University Faculty of Science

(09 FEN 55 & 10 FEN 9) and by TUBITAK (106T628); studies in BP and W by two

mobility programs of TUBITAK; studies in WU by an award from the Synthesys Project

(AT-TAF-3435) which is financed by the European Community Research Infrastructure

Action under the FP6 “Structuring the European Research Area” Programme.

Aspicilia subfarinosa correct name for A. substerilis ... 105

Literature cited

Arup U, Ekman S, Lindblom L, Mattsson J-E. 1993. High performance thin layer chromatography

(HPTLC), an improved technique for screening lichen substances. Lichenologist 25(1): 61-71.

doi:10.1006/lich.1993.1018

Kondratyuk SY, Zelenko SD. 2002. New lichens and lichenicolous fungi from Israel and the Near

East. Ukr. Bot. Zhurn. 59: 598-607.

Kopachevskaya EG, Makarevich MF, Oxner AN, Rassadina KA. 1971. Handbook of the lichens of

the USSR. 1. Pertusariaceae, Lecanoraceae and Parmeliaceae. Leningrad.

Maire R, Monod T. 1950. Etudes sur la flore et la végétation du Tibetsi. Mémoires de l'Institut

Francais d’Afrique Noire 8. Paris, Dakar. 140 pp.

Nordin A, Roux C. 2009. Proposal to conserve the name Aspicilia farinosa (Ascomycota:

Pertusariales: Megasporaceae) with a conserved type. Taxon 58(1): 292.

Oxner AN. 1929. Neue Arten von Aspicilia aus zentral Asien. Izv. Kievsk. Bot. Sada: 87-88.

Oxner AN. 1933. Species lichenum novae ex Asia. Bot. Zhurn. (Kiev) 7/8: 167-172.

Oxner AN. 1939. Contribution to the lichen flora of Middle Asia. Zhurn. Inst. Bot. Vseukrajins’k.

Akad. Nauk 20: 111-136.

Oxner AN. 1940. New and little-known lichens for the USSR. Zhurn. Inst. Bot. Vseukrajins’k.

Akad. Nauk 1 (1): 101-109.

Senkardesler A, L6kés L. 2010. Reassessment of lichen collections from Turkey deposited in

Hungarian Natural History Museum and examined by Odon Szatala. Acta Bot. Hung. 52 (1-2):

197-215. doi: 10.1556/ABot.52.2010.1-2.¢4

Sipman HJM. 2007. New lecanoroid lichens from Greece. Bibliotheca Lichenologica 96: 267-277.

Steiner J. 1893. Beitrage zur lichenflora Griechenlands und Agyptens. Akad. Wiss. Wien

Sitzungsber., Math.-Naturwiss. K]. 52: 152-167.

Steiner J. 1894. Flechten. 262-266, in: E Halacsy (ed.): Botanische Ergebnisse einer im Auftrag der

hohen Kais. Akademie der Wissenschaften unternommenen Forschungsreise in Griechenland.

Denkschr. Kaiserl. Akad. Wiss., Wien. Math.-Naturwiss. KL 61.

Steiner J. 1895. Ein Beitrag zur Flechtenflora der Sahar. Akad. Wiss. Wien Sitzungsber., Math.-

Naturwiss. Kl. 104: 384-393.

Steiner J. 1898. Prodromus einer Flechtenflora des griechischen Festlandes. Akad. Wiss. Wien

Sitzungsber., Math.-Naturwiss. K1. 107: 103-189.

Steiner J. 1899. Flechten. 222-238, in: C. Fritsch (ed.): Beitrag zur Flora von Konstantinopel.

Bearbeitung der von J. Nemetz in den Jahren 1894-1897 in den Umgebungen von

Konstantinopel gesammelten Pflanzen. I. Kryptogamen. Denkschr. Kaiserl. Akad. Wiss., Wien.

Math.-Naturwiss. KL. 48.

Steiner J. 1902. Zweiter Beitrag zur Flechtenflora Algiers. Verh. Zool.-Bot. Ges. Wien 52: 469-487.

Steiner J. 1904. Flechten auf Madeira und den Kanaren gesammelt von J. Bornmiiller in den Jahren

1900 und 1901. Oesterr. Bot. Z. 54: 399-409. doi:10.1007/BF01793846

Steiner J. 1905. Lichenes. 369-384, in A Penther, E Zederbauer (eds.): Ergebnisse einer

naturwissenschaftlichen Reise zum Erdschias-Dagh (Kleinasien). Ann. Naturhist. Mus. Wien

20.

Steiner J. 1909. Lichenes. 107-123, in: H. von Handel-Mazzetti (ed.): Botanische Reise in das

Pontische Randgebirge. Ann. Naturhist. Mus. Wien 23.

Steiner J. 1910. Lichenes Persici coll. a cl. Consule Th. Strauss. Ann. Mycol. 8: 212-245.

Steiner J. 1915. Adnotationes lichenologicae, HI. Oesterr. Bot. Z. 65: 278-292. doi:10.1007/

BF01660996

106 ... Senkardesler & Sohrabi

Steiner J. 1919. Beitrage zur Kenntnis der Flora Griechenlands. Bearbeitung der anlasslich der

zweiten Wiener Universitatsreise im April 1911 in Griechenland gesammelten Pflanzen - C.

Lichenes. Verh. Zool.-Bot. Ges. Wien 61: 52-101.

Steiner J. 1919. Flechten aus Transkaukasien. Ann. Mycol. 17: 1-32.

Steiner J. 1921. Lichenes aus Mesopotamien und Kurdistan sowie Syrien und Prinkipo. Ann.

Naturhist. Mus. Wien 34: 1-68.

Szatala O. 1927. Lichenes in Asia minore ab directore Dr. Stefano Gyérffy de Szigeth (Budapest) et

Dr. Josefo Andrasovszky collecti. Folia Crypt. 1: 271-278.

Szatala O. 1929. Beitrage zur Flechtenflora von Bulgarien. I. Magyar Bot. Lapok 28: 82-99.

Szatala O. 1931. Uj zuzmék. II. Neue Flechten. II. Magyar Bot. Lapok 30: 135-136.

Szatala O. 1941. Lichenes in Armenia, Kurdistania, Palaestina et Syria annis 1909-1910 a cl. Fr.

Nabelek collecti. Borbdsia 3: 70-80.

Szatala O. 1943. Lichens. 16-58, in: KH Rechinger (ed.): Flora Aegaea — Flora der Inseln und

Halbinseln des Agaischen Meeres. Wien, Denkschr. Kaiserl. Akad. Wiss., Wien. Math.-

Naturwiss. Kl. 105/1.

Szatala O. 1956. Neue Flechten. V. Ann. Hist.-Nat. Mus. Natl. Hung. 7: 271-282.

Verseghy K. 1964. Typen-Verzeichnis der Flechtensammlung in der Botanischen Abteilung des

Ungarischen Naturwissenschaftlichen Museums. Természettudomanyi Muzeum, Budapest.

Verseghy K. 1968. Nachtrag I. zum “Typenverzeichnis der Flechtensammlung in der Botanischen

Abteilung des Ungarischen Naturwissenschaftlichen Museums”. Fragm. Bot. 6: 41-55.

Verseghy K. 1974. Nachtrag II. zum “Typenverzeichnis der Flechtensammlung in der Botanischen

Abteilung des Ungarischen Naturwissenschaftlichen Museums”. Studia Bot. Hung. 9: 23-29.

Verseghy K. 1981. Nachtrag III. zum “Typenverzeichnis der Flechtensammlung in der Botanischen

Abteilung des Ungarischen Naturwissenschaftlichen Museums”. Stud. Bot. Hung. 15: 45-47.

Werner RG. 1936. Contributions a la flore cryptogamique du Maroc. Fascicule XVI. Bull. Soc. Sci.

Nat. Maroc 16: 258-260.

Werner RG. 1938. Contribution a la flore cryptogamique du Maroc. Fasc. XVII (Algae, Lichenes et

Fungi). Bull. Soc. Sci. Nat. Maroc 18(2): 126-135.

Werner RG. 1954. Lichens et champignons nord-africains. Rev. Bryol. Lichenol. 23 (1-2):

197-213.

Werner RG. 1956. Notes de lichénologie libano-syrienne. III. Bull. Soc. Bot. France 103(7-8):

461-467.

Werner RG. 1957a. Notes de lichénologie libano-syrienne. IV. Bull. Soc. Bot. France 106: 321-326.

Werner RG. 1957b. Contributions a la flore cryptogamique du Maroc. Fascicule XXI. Bull. Soc.

Hist. Nat. Afrique N. 48: 441-453.

Werner RG. 1963. Flore lichénique du Maroc meridional. Rev. Bryol. Lichénol. 32(1-4): 270-278.

Werner RG. 1966. Notes de lichénologie libano-syrienne et égyptienne VIII. Bull. Soc. Bot. France

113: 74-83.

Werner RG. 1979. La flore lichénique de la Cordillere Betico-Rifaine. Etude phytogeographique et

écologique. Collect. Bot. (Barcelona) 11(17): 409-471.

MYCOTAXON

Volume 115, pp. 107-114 January-March 2011

DOT: 10.5248/115.107

Building the jigsaw puzzle of the critically endangered

Pleurotus nebrodensis: historical collection sites and

an emended description

MarIA LETIZIA GARGANO’, ALESSANDRO SAITTA’,

GeEorGIOs I. ZERVAKIS? & GIUSEPPE VENTURELLA*

' Dipartimento di Scienze Botaniche, Universita di Palermo, Via Archirafi 38,

I-90123 Palermo, Italy

? Laboratory of General and Agricultural Microbiology, Department of Agricultural Biotechnology.

Agricultural University of Athens. Iera Odos 75, 11855 Athens, Greece

CORRESPONDENCE TO: ‘ ml.gargano@unipa.it, ' asaitta@unipa.it,

* gvent@unipa.it e& ? zervakis@aua.gr

AssTRACT — Historical collection sites of the critically endangered Pleurotus nebrodensis

were retraced in Sicily (southern Italy) using recently rediscovered documents and through

interviews with local people. These localities were visited in 2009 and checked for the presence

of this rare mushroom, confirming a continuing decline in fruiting. An emended description

of the taxon is provided based on observations on abundant recently collected material.

The need for more incisive action to safeguard this valuable mushroom by the University of

Palermo, Regional Park of Madonie Administration and policy makers is emphasized.

Key worps — threatened macrofungi, mushroom collection, IUCN, Cachrys ferulacea,

macromycete conservation

Introduction

After the death on 30 October 1887 of Giuseppe Inzenga, the mycologist who

described Pleurotus nebrodensis [as Agaricus nebrodensis], Ferdinando Alfonso

Spagna replaced him as director of the periodical Nuovi Annali di Agricoltura

Siciliana and continued some of the mycological research started by Inzenga.

In his paper on poisonous fungi growing in Sicily, Spagna (1902) also added

a list of edible species appreciated by local populations for their organoleptic

characters that included P. nebrodensis, “the most delicious mushroom growing

in Sicily” Unzenga 1863).

This mushroom, which has been a sought-after edible since ancient times,

remains prized (Venturella 2005) today. The recent rediscovery of Spagna’s paper

108 ... Gargano &al.

has permitted a new piece to be added to the ongoing “jigsaw puzzle” of the

critically endangered P. nebrodensis. In addition to clarifying morphological,

taxonomical, and genetic features and in situ and ex situ conservation strategies

(Venturella 2000, Zervakis et al. 2001, Zervakis & Venturella 2002), we are now

able to identify the historical collection sites of P. nebrodensis that Inzenga

(1865-68) omitted from his publication, provide an emended description of the

species, and evaluate its declining fruiting productivity over the last centuries.

Materials & methods

Based on data reported by Spagna over one hundred years ago, we conducted

cartographic analysis, field investigations, and in-depth interviews of cattle farmers,

working for many years in the Regional Park of Madonie (northern Sicily). Two

localities were established and mapped (scale 1:50.000). Additional field investigations

during spring 2009 verified the presence of basidiomata of P. nebrodensis. Macroscopic

and microscopic features were evaluated according to Largent et al. (1977) and Largent

(1986). Macroscopic features include pileus size, shape, and color; margin shape and

surface; pileus surface and flesh; lamellar characters; stipe characteristics; presence

or absence of veil on stipe; type of basidioma attachment; spore print. Colors refer to

the RAL matching system. Microscopic features evaluated were hyphal system; hyphal

wall; septations; hyphal branching; hyphal inflations; specialized hyphae; pigmentation;

type of pellis; trama, position, type, shape, pigmentation and incrustations of cystidia;

basidia and basidioles; spore features; chemical reactions. The collected basidiomata

were identified, analysed in our laboratory, and are now preserved in the PAL fungal

dried reference collection.

Specimens collected

Field investigations carried out in the Madonie area during spring 2009 confirmed the

presence of a very low number of basidiomata of P. nebrodensis (Fic. 1). The detection

of ripe and unripe basidiomata is complicated by excessive collecting by mushroom

pickers. Progressive erosion of soils and changes in habitat at higher altitudes should

also be considered as factors contributing to the decline of P. nebrodensis. In some years

the irregular precipitation in the Madonie area heavily reduced fructification. Modern

collections are limited strictly to localities belonging to the territories of Isnello and

Petralia Sottana (only 50 kilometres apart) and Polizzi Generosa (a small town 16

km from Petralia Sottana). In the reported localities the number of ripe basidiomata

observed from April to May usually did not exceed 25-30 in the more protected areas

and 5-15 in habitats subject to a high anthropogenic pressure. The lowest collection

locality is Mandria del Colle (1260 m) while the highest is Pizzo Carbonara (1979 m).

Original and emended descriptions

Pleurotus nebrodensis (Inzenga) Quél., Enchir. fung.: 148 (1886). Fics 1-2

= Agaricus nebrodensis Inzenga, Giorn. Reale Ist. Incoragg. Agric. Sicil. Palermo 1: 161

(1863). [TypE (Venturella 2000): lectotype — Inzenga (1863: fig. 1);

epitype — PC, Agaricus nebrodensis).

Pleurotus nebrodensis (Italy) ... 109

OFS. as

Fic. 1. Pleurotus nebrodensis. Basidiomata.

EryMo.oey: from the name of the Nebrodi mountain chain of northern Sicily. (Since

old maps did not differentiate between the Nebrodi and Madonie mountain chains,

botanists applied the name Nebrodi to both areas.)

110 ... Gargano &al.

ORIGINAL DESCRIPTION (Inzenga 1863): Ag. magnus caespitosus, albus, vel dilute

sub-flavus, pileo carnoso nargine revoluto, lamellis confertis lineari-lanceolatis,

liberis, decurrentibus in stipite sublaterali, versus basim permixtis.

Fungi umbilicum exprimentes, simul albi C_B.P. — Fungi plures simul, albi, ad

arborum radices, esculenti J. B. - Cup. H. Cath. pag. 80.

Pileus junior laevigatus, albus, subumbonatus, demum dilute flavus, irregulari,

modo ex epidermide diffracia rimoso-tessulatus, gregarious, caespitosus, aliquando

ob coacervata insitaque individua ramosus: 2-5 unc. latus, et ultra. — Stipes rare

centralis, supra dilatatus atque in pileo diffuses, brevis, subnullus, basi attenuates.

Lamellae confertae tenues, lineari-lanceolate, longo decurrentes sub striarum forma

versus stipitis basim productae. Lamellulae numerosae, breviores lanceolatae,

longiores postice rotundatae. Caro fibrosa, subtenax, saporis gratissimi, ac odoris

farina molitae, albida, sicca dilute-flava. Sporidia alba.

Agarico Eryngii DC. characteribus variis consimilis, sed magnitudine, colore

albido pilei sporidiorumque, stipite breviore, lamellis confertis, angustis, lineari-

lanceolatis omnino distinctus.

In montium culminibus Siciliae, Nebrodibus magis obvia e radicibus

marcescentibus Elaeoselini Asclepii Bert., Opopanacis Chironti Koch., etc. Aprili,

Majo nive dilabente. Esculentus!

EMENDED DESCRIPTION (based on recent collections): BAsIDIOMATA sturdy

and fleshy. PILEUs s1zE 3.0-14.5 cm (width), 3.7-13.5 cm (length); applanate,

uplifted, shallowly depressed or convex in side view; ovoid or conchate in top

view; unicolorous, light ivory, sometimes bicolorous, cream to ivory. MARGIN OF

PILEUS plane, incurved, uplifted, incurved or involute in cross section, entire to

eroded in surface view. SURFACE OF MARGIN entire or eroded, smooth. SURFACE

OF PILEUS shiny or translucent, dry, cracking-glabre, smooth or glabrous. FLESH

of pileus, cream, with consistency hard-tough to turgid, without color changes,

sulphur-yellow when dry, 1-2 mm thick at the margin and 1-4 cm thick at the

center. Taste mild and farinous. LAMELLAE 4-8 mm width, 2.5-7.5 cm length,

attachment adnexed to decurrent, gills spacing subdistant to close, moderately

broad in thickness, light ivory colored, margin of gills smooth to eroded, face

of gills waxed, lamellulae present, extending one-half to one-third the length

of gills. Stipe 1.4-3 cm width, 2.1-7.5 cm length, terete in cross section, equal

to bulbose, slightly tapered to tapered at the base in longitudinal view. STIPE

SURFACE smooth, light ivory colored. STIPE CONSISTENCY fibrous, flesh solid

to stuffed. Stipe eccentrically or lateral attached to pileus, inserted in the root

residues of Cachrys ferulacea, basal tomentum and veil absent. GROWTH HABIT

solitary or connate. TYPE OF BASIDIOMATA ATTACHMENT: stipitate. SPORE

PRINT light ivory to cream. SpoREs 12.5-15.1(-18) x 5.2-6.1 um, cream,

heterotrophic, asymmetrical, phaseoliphorm, smooth, hyaline, guttulate.

BasIpIA with basidioles, 4-spored, 40-50 x 10-11.5(-14)um, sterigmata 3-4.5

um. CHEILOCYSTIDIA 50-60 x 6,2-7.5(-9) um, leptocystidia type, clavate, apex

mucronate to capitulate. HyPHAL sYSTEM monomitic. HyPHAL WALL thin.

Pleurotus nebrodensis (Italy) ... 111

10 pm

10pm

Fic. 2. Pleurotus nebrodensis microscopic characters:

a. cheilocystidia; b. basidiospores; c. basidia; d. hyphal system of hymenium; e. pellis.

HyPpHae septate with clamp connections. SPECIALIZED HYPHAE absent, no

pigmentation. PELLIs topography in two layers, 5-10 wm width, enterocutis,

element of pellis absent (Fic. 2).

SPECIMENS EXAMINED: All on Cachrys ferulacea (L.) Calest. (Apiaceae) root residues

— ITALY. SictLy: PROVINCE OF PALERMO, Isnello: Bevaio del Faggio, 1355 m, A. Saitta,

001, 5 May 2009 (PAL); Mandria del Colle, 1260 m, A. Saitta, 002, 24 April 2009 (PAL);

Pizzo Carbonara, 1979 m, A. Saitta, 003, 28 May 2009 (PAL); Valle Pelata, 1745 m, A.

Saitta, 004, 20 May 2009 (PAL); Petralia Sottana: Monte Ferro, 1906 m, A. Saitta, 005,

30 May 2009 (PAL); Monte Mufara, 1685 m, A. Saitta, 006, 26 May 2009 (PAL); Pizzo

Carbonara, 1979 m, A. Saitta, 007, 28 May 2009 (PAL); Valle di Zottafonda, 1843 m, A.

Saitta, 008, 29 May 2009 (PAL); Vallone Faguare, 1380 m, G. Venturella & ML Gargano,

009, 12 May 2009 (PAL); Polizzi Generosa: Cozzo Cerasa, 1687 m, A. Saitta, 010, 18

May 2009 (PAL); Monte dei Cervi, 1794 m, A. Saitta, 011, 23 May 2009 (PAL); Piano

della Madonna, 1692 m, A. Saitta, 012, 3 May 2009 (PAL); Pizzo Colla, 1676 m, A. Saitta,

013, 8 May 2009 (PAL).

CuLTuRE PDA: pigments absent, reverse colour unchanged, dikaryotic colonies

mostly presenting a loose submerged and suppressed aerial mycelium, more or

less zonate and radial, growth margin even and regular, colour light ivory to

ivory; thin-walled hyphae, hyaline in aqueous KOH and Melzer’s reagent, with

112 ... Gargano &al.

Ubi KS WAS ae \

Died

SF : Sak) Deda

24020 2437000 2438000

Fic. 3. Vallone Faguare locality (map scale 1:50000).

abundant clamp-connections, occasional production of microdroplets, singly

on short secretory sterigmata on aerial hyphae (nematode trapping devices);

optimal mycelium growth at 18-25°C (growth rate: 1.2 mm day'').

Discussion

Mr Norata, one of the cattle farmers interviewed, now a grey-headed

gentleman in his 90s, provided the critical evidence enabling us to rediscover

the historical collection sites of P. nebrodensis. In an enthusiastic and moving

reconstruction of his working life in the pasture areas of Madonie, including

memories of fear as a young boy during lonely nights guarding his cows, Mr

Norata pointed out the sites which, at the beginning of the 20th century, were

best for collecting this valuable mushroom. He also recounted his observation

of the progressive decline of P. nebrodensis, which he attributed to intense

exploitation of the area by cattle farmers and progressive loss of habitat

due to road building. On the basis of Mr Norata’s information and our field

observations we identified the two collection localities reported by Alfonso

Spagna, which he named as “Canna” and “Dragonara”. These are fiefdoms of

the property of Baron Nicolé Turrisi Colonna’s heirs. The two localities, nesting

in a deep valley of the Madonie Mountains (northern Sicily) named Vallone

Pleurotus nebrodensis (Italy) ... 113

Faguare (Fic. 3), currently belong to the lands of Petralia Sottana (province

of Palermo). The precise coordinates (Gauss Boaga coordinate, ed. 1950) are

4191750 N and 2436300 E. ‘Their vegetation is characterized by wide-ranging

pastures of Cachrys ferulacea intensively exploited for grazing until 1989 when

the Regional Park of Madonie was established.

The new rules introduced by the Madonie National Park Administration

have not interrupted the stream of mushroom pickers stimulated by the high

economic value of PB nebrodensis (50-60 euro per kg). After inclusion of this rare

mushroom as Critically Endangered in the IUCN Red List of Threatened Species,

G. Venturella (Head of the Laboratory of Mycology in Palermo) persuaded the

Park of Madonie administration to issue a conduct code for mushroom pickers.

Unfortunately, mainly due to a lack of trained staff, the level of practical control

by forest rangers has been insufficient to prevent an increase in mushroom

picker pressure on the collection sites. As a consequence, unripe basidiomata

are collected every spring, increasing the decline of P. nebrodensis. Now, a very

low number of ripe basidiomata is collected in the area of Vallone Faguare, and

this present situation clearly contradicts Spagna’s report in 1902 and the direct

evidence gained through our interviews. At that time “abundant collections of

the renowned mushroom” were reported by the local population. The presence

of ripe basidiomata of P. nebrodensis has progressively decreased during the

last centuries and the population is now severely fragmented (Venturella 2005).

In 2009, an investigation carried out in Sicily (southern Italy) during the period

of fructification (April-June) confirmed the negative trend and the need for

more incisive action by the University, Park Administration, and policy makers

to safeguard the existence of this important taxon.

Acknowledgements

The authors wish to thank Dr Bertrand de Montmollin (Switzerland) and Dr David

Minter (United Kingdom) for critically reviewing the manuscript. This study was carried

out in the frame of a research grant awarded by the Italian Ministry of University and

Research (MIUR) entitled Caratterizzazione bio-morfologica, ecologica, produttiva

e qualitativa di Pleurotus nebrodensis (Inzenga) Quél., raro basidiomicete a rischio di

estinzione/ Bio-morphological, ecological, productive and qualitative characterization

of Pleurotus nebrodensis (Inzenga) Quél., rare basidiomycete at risk of extinction. Thanks

are also due to Mrs Stefania Paglialunga for the drawing of microscopic characters.

Literature cited

Alfonso Spagna EF. 1902. Dei funghi velenosi. Nuovi Annali di Agricoltura Siciliana 13: 129-142.

Inzenga G. 1863. Nuova specie di agarico del Prof. Giuseppe Inzenga. Giornale.del Reale Istituto

dIncoraggiamento di Agricoltura, Arti e Manifatture in Sicilia 1: 161-164.

Inzenga G. 1865-68 (“1865). Funghi Siciliani, Centuria I. Tipografia Lao, Palermo.

Largent DL. 1986. How to identify mushrooms to genus. I: macroscopic features. Eureka, CA.

166 pp.

114 ... Gargano &al.

Largent DL, Johnson D, Watling R. 1977. How to identify mushrooms to genus. HI: microscopic

features. Eureka, CA. 148 pp.

Venturella G. 2000. Typification of Pleurotus nebrodensis. Mycotaxon 75: 229-231.

Venturella G. 2005. Pleurotus nebrodensis. In de Montmollin B, Strahm W. (eds). The Top 50

Mediterranean Island Plants: Wild plants at the brink of extinction, and what is needed to save

them. IUCN/SSC Mediterranean Islands Plant Specialist Group, IUCN, Gland, Switzerland

and Cambridge, UK.

Zervakis G, Venturella G. 2002. Mushroom breeding and cultivation enhances ex situ conservation

of Mediterranean Pleurotus taxa. Pp. 351-358, in: Engels JMM et al. (eds) 2002: Managing Plant

Genetic Diversity. CABI Publishing, UK.

Zervakis G, Venturella G, Papadopoulou K. 2001. Genetic polymorphism and taxonomic

infrastructure of the Pleurotus eryngii species-complex as determined by RAPD analysis,

isozyme profiles and ecomorphological characters. Microbiology 147: 3183-3194.

MYCOTAXON

Volume 115, pp. 115-119 January-March 2011

DOT: 10.5248/115.115

Diplotomma, Lecanora, and Xanthoria lichen species

new to Turkey

YALGIN KARAGGz', ALI ASLAN’, KENAN YAZICI?* & ANDRE APTROOT‘

‘Department of Biology, Science Faculty, Atatiirk University, TR-25240, Erzurum, Turkey

Biology Department, Kazim Karabekir Education Faculty, Atatiirk University, Erzurum, Turkey

3Biology Department, Science Faculty, Karadeniz Technical University, 61080, Trabzon, Turkey

“ABL Herbarium G.v.d.Veenstraat 107, NL-3762 XK Soest, The Netherlands

* CORRESPONDENCE TO: kcagri_1997@yahoo.com

AsstTract — During a recent excursion in Kemaliye district of Erzincan region (Turkey),

we sampled lichens from 6 localities, among which Diplotomma hedinii, Lecanora valesiaca,

and Xanthoria weberi were determined as new to Turkey and the Middle East and X. weberi

also new to Asia. Geographic distribution, substrate, chemistry, and comparisons with

morphologically similar taxa are presented.

Key worps — Ascomycota, biodiversity

Introduction

The lichen flora of Turkey, as in many parts of the world, is still incomplete.

Although many recent studies (Candan & Turk 2008, Candan & Halici 2009,

Halici & Giivenc 2008, Halici & AKsoy 2009, Yazici & Aslan 2009, Yazici et al.

2008, 2010a,b) contributed to the lichen flora of Turkey, unexplored regions of

the country are still larger than the explored ones. Therefore, more studies are

needed to form a complete lichen flora of Turkey.

Although part of Erzincan flora has been previously described (Yazici &

Aslan 2003), no studies were carried out around Kemaliye district.

Material & methods

Some lichen species were collected from 6 localities in June and July 2009. Air-dried

samples were examined with Nikon SMZ1500 stereomicroscope and a Nikon Eclipse

80i light microscope. Identifications were determined by consulting using books (Poelt

1974, Smith et al. 2009) and papers (Upreti & Chatterjee 1998, Aptroot et al. 2009,

Lindblom 2006).

The Kemaliye district has many deep valleys, high mountains, and plateaus.

Continental climate dominates the higher altitudes while a mediterranean-type

116 ... Karagéz & al.

microclimate is present on the valley floors. The district’s largest valley is Karasu Valley,

and other valleys have been carved by branches of the Karasu River, which reaches Keban

Dam Lake just beyond the district border. The presence of Keban Lake dramatically

alters climatic conditions at the valley bottoms, where summer temperatures and

humidity significantly increase compared to near regions (Bulut 2006). Dominant plant

cover in the district is mountain steppe. Frequent patches of squat trees like Quercus sp.

and Juniperus sp., as well as Rosa canina shrubs can be seen over on the hills. The valleys

are mostly covered by fruit trees of anthropogenic origin.

The collection site is a well-lit, windswept, open area with gently sloped terrain with

grass and rocks. The stream is mostly surrounded by fruit trees. Quercus, Populus and

Rosa trees are dominant in the vicinity, with Salix and Carpinus occasionally present.

The climate is characterized by cold, snowy winters and hot, dry summers. Mean annual

temperature is16. 6°C. The mean annual rainfall is about 380.6 mm, with a precipitation

range of 206-633 mm. Mean annual humidity is 62% (Akman 1999).

Vouchers are stored in the herbarium of the Biology Department, Kazim Karabekir

Education Faculty, Ataturk University, Erzurum, Turkey (ATAKKEF).

Species

Diplotomma hedinii (H. Magn.) P. Clerc & Cl. Roux, (as “hedinianum”) Crypto-

gamica Helvetica 19: 292. 2004.

SPECIMEN EXAMINED: TURKEY. Erzincan: KEMALIYE, Avaz place, Avukatin gesmesi

(Lawyer’s spring), 38°28'28”N, 39°13'02”E, on calcareous rock, 1375 m, 15.06.2009,

ATAKKEF-450.

‘Thallus white or pale to dark grey, thin or thick, often wide-spreading, smooth

or rimose-cracked or sometimes granular, + determinate; prothallus absent.

Apothecia 0.3-0.8(-1.5) mm diam.; disc flat at first, soon + convex, often

pruinose; thalline exciple sometimes present, white, sometimes + crenulate;

true exciple inconspicuous; epithecium brown; hymenium 45-75 um tall,

colourless. Asci 55(-65) x (10-)17(-24) um. Ascospores 15-20 x 7-11um,

(1-)3-septate, not longitudinalsepta, frequently curvedand mostlysubmuriform

at maturity. Thallus C-, K-, KC-, Pd-, UV-.

Diplotomma hedinii is mainly a temperate species of exposed calcareous

rocks and sandstone outcrops in more or less sunny conditions. Previously

known from Africa, Asia, Europe, and Central and North America; new to

Turkey and the Middle East.

RemMARKs—Diplotomma hedinii is similar to D. alboatrum, but D. alboatrum

has 15-24 x 8-10 um ascospores with longitudinal septa and which are less

frequently curved.

Lecanora valesiaca (Miill. Arg.) Stizenb., Ber. Thatigk. St. Gallischen Naturwiss.

Ges. 81: 342.1882

SPECIMENS EXAMINED: TURKEY. Erzincan: KEMALIYE, Mezbanbas: place, 6.5 km

SW of Sirakonak, 38°25°54”N, 39°11715”E, on siliceous rock, 1851 m, 10.06.2009,

Three lichens new to Turkey ... 117

ATAKKEF-—453; 900 m SW of Kekikpinari, 38°27°30”N, 39°08'37”E, on siliceous rock,

1275 m, 10.06.2009, ATAKKEF-456; Geso Bogazi place, 1700 m NE of Yesilyamac,

38°3400"N, 39°16715”E, on siliceous rock, 1682 m, 11.06.2009, ATAKKEF-455; Avaz

place, Avukatin Cesmesi (Lawyer's Spring), 38°28'28”N, 39°13°02”E, on siliceous rock,

1375 m, 15.06.2009, ATAKKEF-452; vicinity of Citkiy, 38°3622”N, 39°06'45”E, on

siliceous rock, 1030 m, 12.07.2009, ATAKKEF-454.

Thallus up to 3.0 cm diameter, + white, rosettes, pruinose, flat, frequently

slightly undulate margins, yellow-greenish under the pruina, centrally areolate;

thallus lobes rounded, older lobes not hollow; marginal lobes, 0.5-1.1 mm

wide, (0.9-)1.0-2.0(-2.1) mm long, flattened, bifurcate and verrucose; upper

surface, pruinose., Apothecia sessile to adnate, in the centre of the thallus

0.3-1.0(-1.3) mm diam., discs, yellow-brown light brown, pruinose, convex

at maturity; margins thick, entire, covering the discs at first, thin, curved at

maturity; epithecium brown; hypothecium pale yellow; paraphyses mainly

cylindrical, unbranched, apices swollen; asci cylindrical-clavate, 8-spored,

(25-)32-40(-42) x (11-)12-14(-15) tum; ascospores oval-ellipsoid, (8-)9-12

x 4-6(-7) um. Thallus and medulla K-, C-, KC+ yellow, PD-.

Lecanora valesiaca grows on sloping faces of lime-poor, hard, base-rich rocks

containing some calcium in warm-dry situations, and above all on south-facing

exposed sites in the interior alpine dry valleys. Previously known from Asia,

Europe, and North America; new to Turkey and the Middle East.

ReMARKS—Lecanora valesiaca is very similar to L. freyi, but L. valesiaca has

thin lobes, a thicker margin, and verrucose lobe ends while L. freyi has thick

lobes, a thin margin, and smooth lobe ends. Although both species possess

similarly sized apothecia and ascospores, apothecia with incurved margins

and yellow brown discs will separate L. valesiaca from L. freyi, characterized

by apothecia with entire margins and flat, blackish green discs. The incurved

apothecial margins, verrucose lobe ends, and pruinose thallus also distinguish

L. valesiaca from Protoparmeliopsis muralis var. muralis.

Xanthoria weberi (S.Y. Kondr. & Karnefelt) Aptroot, Herzogia 22: 151 (2009)

SPECIMEN EXAMINED: TURKEY. Erzincan: KEMALIYE, 1200 m, SE of Dutluca,

38°37 25°N, 39°07'42”E, on calcareous rock, 1165 m, ATAKKEF-451.

Thallus foliose, up to 4(-5) mm wide, forming small thalli, adnate to loosely

adnate. Lobes horizontal to somewhat ascending, dorsiventral, flat, 0.3-0.5

mm wide, lobe tips often incurved, outermost parts of mature lobes + truncate.

Upper surface yellow to orange, smooth. Lower surface white. Cortex layers

paraplechtenchymatous. Photobiont trebouxioid, green, unicellular. Medulla

reticulate, of short cells. Rhizines mostly present (abundantly in a few specimens

seen), white, yellow when exposed, attached or free. Soralia in lobe tips, often

forming small bird nest soralia, soredia yellow. Apothecia rare, 0.7-2.0 mm

wide. Ascospores 12.5-14 x 7-7.5 um, septum 2.8-4.5 um thick. Pycnidia

118 ... Karagéz & al.

laminal, common, orange. Conidia bacilliform, 3.3-3.5 um long. Cortex and

apothecia K+ purple, C-, PD-, I-; medulla K-, C-, PD-, I-.

X. weberi grows in dry habitats on a variety of substrates, both bark and rock

as well as on man-made substrates such as concrete and tombstone. Previously

known from Europe and North America; new to Turkey and Asia.

REMARKS—Aanthoria weberi resembles X. gallowayi, X. oregana, and X. fulva.

Xanthoria weberi has shorter and slightly wider lobes with more incurved

lobe tips than X. gallowayi, and where X. weberi sometimes has apothecia and

frequently conspicuous pycnidia, no apothecia and pycnidia have been noted

for X. gallowayi (Kondratyuk & Karnefelt 1997). Xanthoria weberi has longer

lobes and abrighter yellow pigmented upper surface than X. fulva, from which it

is also distinguished by its dichotomously branched lobes, with more distinctly

truncate lobe tips and relatively long internodes. The small bird nest-like soralia

that occur mostly in the lobe tips and narrower, more regular dichotomously

branched lobes in X. weberi help to differentiate it from X. oregana.

Acknowledgements

We are grateful to Dr. Paolo Giordani and Dr. Leo Spier for linguistic revision and

helpful comments on an earlier draft of this manuscript.

Literature cited

Akman Y. 1999. Climate and bioclimate (The methods of bioclimate and climate types of Turkey).

1*Edn., Kariyer Matbaacilik Ltd., Sti, Ankara.

Aptroot A, Schumm F, Gabriel R. 2009. Lichens new to the Azores collected on Terceira. Herzogia

22: 147-152.

Bulut Z. 2006. Kemaliye (Erzincan) ilcesi ve yakin ¢evresinin alternatif turizm kapsaminda

rekreasyonel turizm potansiyelinin belirlenmesi. Doktora Tezi. Atatiirk Universitesi Fen

Bilimleri Enstitiisi, Erzurum.

Candan M, Turk AO. 2008. Lichens of Malatya, Elazig and Adiyaman provinces (Turkey).

Mycotaxon 105: 19-22.

Candan M, Halici MG. 2009. Two new lichenicolous Arthonia species from Turkey. Mycotaxon

107: 209-213.

Halici MG, Guvenc S. 2008. Lichens from the Mediterranean phytogeographical region of Turkey.

Cryptogamie Mycologie 29(1): 95-106.

Halici MG, Aksoy A. 2009. Lichenised and Lichenicolous Fungi of Aladaglar National Park (Nigde,

Kayseri and Adana Provinces) in Turkey. Turkish Journal of Botany 33(3): 169-189.

Kondratyuk S, Karnefelt I. 1997. Josefpoeltia and Xanthomendoza, two new genera in the

Teloschistaceae (lichenized Ascomycotina). Bibliot. Lichenol. 68: 19-44.

Lindblom L. 2006. Xanthomendoza galericulata, a new sorediate lichen species, with notes on similar

species in North America. Bryologist 109(1): 1-8. doi:10.1639/0007-2745(2006) 109[0001:

XGANSL]2.0.CO;2

Poelt J. 1974. Bestimmungsschliissel europaischer Flechten. J. Cramer, Vaduz. 757 p.

Smith CW, Aptroot A, Coppins BJ, Fletcher A, Gilbert OL, James PW, Wolseley PA, Orange A.

2009. The Lichens of Great Britain and Ireland. The British Lichen Society, London. 1046 p.

Three lichens new to Turkey ... 119

Upreti DK, Chatterjee S. 1998. Lichen genus Lecanora subgenus Placodium in India Feddes

Repertorium 109(3-4): 279-289.

Yazici K, Aslan A. 2003. Lichens from the regions of Gumushane, Erzincan and Bayburt (Turkey).

Cryptogamie Mycologie 24(3): 287-300.

Yazici K, Aptroot A, Etayo J, Aslan A, Guttova A. 2008. Lichens from the Batman, Mardin,

Osmaniye, and Sivas regions of Turkey. Mycotaxon 103: 141-144.

Yazici K, Aslan A. 2009. Lichen species new to Turkey and Asia. Mycotaxon 108: 463-466.

Yazici K, Aptroot A, Aslan A, Etayo J, Spier L, Karagoz Y. 2010a. Lichenized and lichenicolous fungi

from nine different areas in Turkey. Mycotaxon 111: 113-116. doi:10.5248/111.113

Yazici K, Elix JA, Aslan A. 2010b. Some parmelioid lichens new to Turkey and Asia. Mycotaxon

111: 489-494, doi:10.5248/111.489

MYCOTAXON

Volume 115, pp. 121-124 January-March 2011

DOT: 10.5248/115.121

First report of Conidiobolus coronatus in Turkey

CAFER EKEN*”’, SABAN GUGLU? & KIBAR AK?

'Graduate School of Natural and Applied Sciences, Ardahan University, Ardahan,75000,Turkey

2Department of Plant Protection, Faculty of Agriculture, Atatiirk University, Erzurum,25240, Turkey

*Black Sea Agricultural Research Institute, Gelemen, Samsun,55001, Turkey

*CORRESPONDENCE TO: cafereken@hotmail.com

AsstTract — Conidiobolus coronatus (Entomophthorales, Zygomycota) was isolated from

infected specimens representing an Issus sp. Issidae, Hemiptera) collected from the Trabzon

province of Turkey. The species, which represents a new record for the Turkish mycoflora, is

described briefly and illustrated.

KEY worDs — insect, entomopathogenic fungi, hazelnut

Introduction

Members of the widespread order Entomophthorales (Zygomycota) are

predominantly pathogens of insects and mites (Pell et al. 2001). Species of

Conidiobolus, most notably the ubiquitous C. coronatus, are recorded as

widespread soil saprophytes utilising a variety of substrates, including plant

detritus, living plants, different dead arthropods and the fruiting bodies

of other fungi in various regions of the world (MacLeod & Miiller-Kégler

1973, Keller 1987, Sajap et al. 1997, Dromph et al. 2001, Laxman et al. 2005,

Manning et al. 2007, Comerio et al. 2008). Conidiobolus coronatus, mainly

tropical strains, is known to cause disease in both insects and humans (Ribes et

al. 2000, Prabhu & Patel 2004); the disease has been named rhinophyco-

mycosis, rhinophycomycosis entomophthorae, rhinoentomophthoromycosis,

and conidiobolomycosis (King 1979, Ochoa et al. 1996, Yang et al. 2010).

Material & methods

Dead insects collected in 2008 from a hazelnut orchard in in the Black Sea region

of Turkey were cultured for entomopathogenic fungi. After the cadavers were washed

in a solution of 2% sodium hypochlorite for 1 min, they were dried on filter paper.

After transfer to Petri dishes containing 20 ml of PDA, the cadavers were incubated

at 25°C for 1 week with high humidity (80 + 10% rh). Colonies of filamentous fungi

122 ... Eken, Giiclii & Ak

emerging from each cadaver and identifiable as the genus Conidiobolus were transferred

to PDA and identified to species using the relevant literature (Emmons & Bridges 1961,

Prasertphon 1963, MacLeod & Miiller-Kégler 1973, King 1979, Keller 1987, Humber

1997, Hatting et al. 1999, Toledo et al. 2007, Comerio et al. 2008). After identification,

all isolates were deposited in the fungal collection of Department of Plant Protection,

Faculty of Agriculture, Atatiirk University, Erzurum-Turkey.

Results

The description and illustration of Conidiobolus coronatus given below

are based on the Turkish collections of the material. This is the first report of

C. coronatus from Turkey.

Ficure 1. Conidiobolus coronatus: A— primary conidium and germinating primary conidium;

B— primary conidia and secondary conidia produced on germ tube arising from primary conidia;

c— villose conidia may be the equivalent of resting spores in this species. Bar = 20 um.

Conidiobolus coronatus (Costantin) A. Batko, Entomophaga,

Mem. Hors. Ser. 2: 129. 1964. Fig. 1

CoLontgs (PDA) expanding, hyaline, soon with irregular radial blooms; at

25°C reaching 85 mm diam. after 2 days; PRIMARY CONIDIA (Fic. 1A) globose,

with more prominent basal papilla tapering toward obtuse apex; variable in

size, (23.2-)32.1(-46.8) x (18.1-)24.6(-35.1) tm; basal papilla prominent with

pointed apex, forcibly discharged; sECONDARY CONIDIA (Fic. 1B) forming

singly and forcibly discharged or (more commonly) producing many forcibly

discharged secondary microconidia on short germ tubes arising from primary

conidia; CONIDIOPHORES simple, unbranched; VILLOSE CONIDIA (resting spores;

Fic. 1c) resembling primary conidia but covered with villose appendages

(unique to this species), (19.9-)25.8(-34.8) um diam.

SPECIMEN EXAMINED: On cadavers of Issus sp. Ussidae, Hemiptera). TURKEY: TRABZON

PROVINCE, Of district, Corylus avellana L. (Corylaceae) orchards, 40°51’30"N,

40°167007E, alt. 160 m, VI-VIII 2008, coll. K AK (KA 123).

Conidiobolus coronatus new to Turkey ... 123

Discussion

Conidiobolus coronatus, originally isolated from a culture of Agaricus

campestris L. (possibly derived from a dead insect hidden between the lamellae),

was described in 1897 as Boudierella coronata Costantin (MacLeod & Miiller-

Kégler 1973). Since then it has been isolated from numerous and diverse

sources (MacLeod & Miiller-Kégler 1973, King 1979, Keller 1987, Sajap et al.

1997, Dromph et al. 2001, Laxman et al. 2005, Manning et al. 2007, Comerio

et al. 2008). Utilization of the species as a biological control is limited by its

potential to cause human disease (King 1979, Ochoa et al. 1996, Ribes et al.

2000, Prabhu & Patel 2004).

Diameters of both the primary and villose conidia measured in this study

fell within the ranges observed by Emmons & Bridges (1961; primary conidia:

36-44 um), Prasertphon (1963; primary: 25-61 tm; villose: 8-42 um), Keller

(1987; primary: 37-74 tm; villose: 16-42 um), Hatting et al. (1999; primary:

41.5-66 x 30-48 um), Toledo et al. (2007; primary: 17.6-39.5 x 24.7-29.6 um;

villose: 19.8-24.7 um), and Comerio et al. (2008; primary: 30-38 um).

Acknowledgments

We are grateful to Dr. Celal Tuncer and Dr. Yusuf Yanar for reviewing the

manuscript.

Literature cited

Comerio RM, Andorno AV, Botto EN. 2008. Conidiobolus coronatus isolation from a pest aphid of

chives (Allium schoenoprasum L.). Revista Iberoamericana de Micologia 25: 193-195.

Dromph KM, Eilenberg J. Esbjerg P. 2001. Natural occurrence of entomophthoralean fungi

pathogenic to collembolans. Journal of Invertebrate Pathology 78: 226-231. doi: 10.1006/

jipa.2002.5077

Emmons CW, Bridges CH. 1961. Entomophthora coronata, the etiologic agent of a phycomycosis of

horses. Mycologia 53: 307-312. doi: 10.2307/3756277

Hatting JL, Humber RA, Poprawski TJ, Miller RM. 1999. A survey of fungal pathogens of aphids

from South Africa, with special reference to cereal aphids. Biological Control 16: 1-12. doi:

10.1006/bcon.1999.0731

Humber RA. 1997. Fungi: identification. 153-185, in LA Lacey (ed.), Manual of Techniques in

Insect Pathology. London, Academic Press.

Keller S. 1987. Arthropod-pathogenic Entomophthorales of Switzerland. I. Conidiobolus,

Entomophaga and Entomophthora. Sydowia 40: 122-167.

King DS. 1979. Systematics of fungi causing entomophthoramycosis. Mycologia 71: 731-745. doi:

10.2307/3759185

Laxman RS, Sonawane AP, More SV, Rao BS, Rele MV, Jogdand VV, Deshpande VV, Rao MB. 2005.

Optimization and scale up of production of alkaline protease from Conidiobolus coronatus.

Process Biochemistry 40: 3152-3158. doi: 10.1016/j.procbio.2005.04.005

MacLeod DM, Miiller-Kégler E. 1973. Entomogenous fungi: Entomophthora species with pear-

shaped to almost spherical conidia (Entomophthorales: Entomophthoraceae). Mycologia 65:

823-893. doi: 10.2307/3758521

124 ... Eken, Giiclii & Ak

Manning RJ, Waters SD, Callaghan AA. 2007. Saprotrophy of Conidiobolus and Basidiobolus in leaf

litter. Mycological Research 111: 1437-1449. doi: 10.1016/j.mycres.2007.08.019

Ochoa LF, Dubque CS, Velez A. 1996. Rhinoentomophthoromycosis. Report of two cases. Journal

of Laryngology and Otology 110: 1154-1156. doi: 10.1017/S002221510013600X

Pell JK, Eilenberg J, Hajek AE, Steinkraus DC. 2001. Biology, ecology and pest management

potential of Entomophthorales. 71-153, in TM Butt et al. (eds.), Fungi as Biocontrol Agents.

Wallingford, CABI Publishing. doi: 10.1079/978085 1993560.0071

Prabhu RM, Patel R. 2004. Mucormycosis and entomophthoramycosis: a review of the clinical

manifestations, diagnosis and treatment. Clinical Microbiology and Infection 10 (Suppl 1):

31-47. doi: 10.1111/j.1470-9465.2004.00843.x

Prasertphon S. 1963. Conidial formation in Entomophthora coronata (Costantin) Kevorkian.

Journal Insect Pathology 5: 318-335.

Ribes JA, Vanover-Sams CL, Baker DJ. 2000. Zygomycetes in human disease. Clinical Microbiology

Reviews 13: 236-301. doi: 10.1128/CMR.13.2.236-301.2000

Sajap AS, Atim AB, Husim H, Wahab YA. 1997. Isolation of Conidiobolus coronatus (Zygomycetes:

Entomophthorales) from soil and its effect on Coptotermes curvignathus (Isoptera:

Rhinotermitidae). Sociobiology 30: 257-262.

Toledo AV, Remes Lenicov AMM de, Lépez Lastra CC. 2007. Primer registro de Conidiobolus

coronatus (Zygomycetes: Entomophthorales) en crias experimentales de dos especies plaga del

maiz: Delphacodes kuscheli y D. haywardi (Hemiptera: Delphacidae) en la Argentina. Boletin de

la Sociedad Argentina de Botanica 42: 169-174.

Yang X, Li Y, Zhou X, Wang Y, Geng S, Liu H, Yang Q, Lu X, Hiruma M, Sugita T, Ikeda S, Ogawa

H. 2010. Rhinofacial conidiobolomycosis caused by Conidiobolus coronatus in a Chinese rice

farmer. Mycoses 53: 369-373. doi: 10.1111/j.1439-0507.2009.01716.x

MYCOTAXON

Volume 115, pp. 125-129 January-March 2011

DOT: 10.5248/115.125

Carbonea, Gregorella, Porpidia, Protomicarea, Rinodina,

Solenopsora, and Thelenellia lichen species new to Turkey

KADIR KINALIOGLU * & ANDRE APTROOT ”

' Giresun University, Faculty of Science and Arts, Department of Biology, 28049, Giresun, Turkey

? Adviesbureau voor Bryologie en Lichenologie,

G.v.d. Veenstraat 107, NL-3762 XK Soest, The Netherlands

*CORRESPONDENCE To: *kkinalioglu@hotmail.com & andreaptroot@gmail.com

ApsTRACT—Seven species of lichenized fungi (Carbonea vorticosa, Gregorella humida,

Porpidia tuberculosa, Protomicarea limosa, Rinodina turfacea, Solenopsora holophaea, and

Thelenella modesta) are new to Turkey. Gregorella humida is also new to Asia. For each a short

description is presented.

Key worps —biota, Giresun, Ordu

Introduction

Since John (2004) listed 361 papers referring to lichens from Turkey, many

additional studies have been carried out on Turkish lichen biota (e.g., Aptroot

& Yazici 2009, Aslan et al. 2005, Candan & Ozdemir Turk 2008, Cobanoglu et

al. 2008, Halici & Aksoy 2006, Kinalioglu 2010, Oztiirk & Gitveng 2010, Oran

& Oztiirk 2010, Yazic1 & Aptroot 2008). However, there are still a high number

of records for lichen species yet to be added. This contribution reports further

first records of species new to Turkey.

Materials & methods

The collections were identified with various lichen guides (Brodo et al. 2001, Purvis

et al. 1992, Smith et al. 2009, Wasser & Nevo 2005, Wirth 1995). They are deposited in

the herbarium of the Faculty of Science and Arts, Giresun University, Giresun, Turkey.

The collector and collection number are given in parentheses after the locality details.

Species recorded

Carbonea vorticosa (Flérke) Hertel

A detailed description is provided by Chambers et al. ( 2009).

SPECIMEN EXAMINED: TURKEY. Orpwu: Kumru, Saricicek high plateau, 40°45’28”N,

37°12’51"E, 1521 m, 16 Jul. 2005, on siliceous rock, (herb. Kinalioglu 1802).

126 ... Kinahoglu & Aptroot

Thallus brownish, subsquamulose to eroded-dispersed. Apothecia 0.2-0.7 mm

diam., scattered; disc black, concave, rarely plane. Epihymenium dark blue.

Ascospores 7.5-12 x 3.7-5 um, colourless, simple. Thallus C-, K-, KC-, PD+

orange.

Carbonea vorticosa is often overlooked. In other parts of its range, it grows

on siliceous rock, boulders, and walls in upland to high montane habitats. In

Turkey, it was collected only from siliceous rock in a sun exposed area.

Known from Europe, Asia, Australasia, Antarctica, North America and

South America (Andreev 2003). New to Turkey.

Gregorella humida (Kullh.) Lumbsch

Detailed descriptions are provided by Lumbsch et al. (2005) and Woods (2009).

SPECIMEN EXAMINED: TURKEY. Orpw: Unye, the top of Unye castle, 40°05’46”N,

37°14’22”E, 245 m, 07 Aug 2004, on siliceous rock, (herb. Kinalioglu 1800).

Thallus bluish grey, consisting of roundish goniocysts. Photobiont Nostoc.

Apothecia 0.2-0.7 mm diam., numerous, roundish; disc convex, colourless

when young, red-brown when mature, true exciple yellowish. Hymenium I-.

Ascospores colourless, 12.5-20 x 6.5-10 um. Thallus C-, K-, KC-, PD-.

Gregoriella humida is probably much overlooked. In other parts of its

range, it is a pioneer lichen, growing on well drained acidic to somewhat basic,

+ clayey soil exposed on steep banks such as in disused railway cuttings, on

tipped material on roadsides and on the ground in old lead mines. In Turkey, it

was collected only from siliceous rock.

Known from Europe (Cezanne et al. 2003). New to Asia.

Porpidia tuberculosa (Sm.) Hertel & Knoph

A detailed description is provided by Fryday et al. ( 2009).

SPECIMEN EXAMINED: TURKEY. GirEsuN: Kesap, Degirmenagzi village, sea shore,

40°58'20°N, 38° 37°23”E, 0m, 11 Apr. 2010, on siliceous rock, (herb. Kinalioglu 1809).

Thallus white to pale blue-grey, sometimes rusty red in parts; prothallus dark

brown-black; soralia 0.1-0.8 mm diam., round to irregular; soredia pale grey or

blue-grey. Apothecia not observed. Medulla and soralia C-, K-, KC-, I+violet,

PD-.

In other parts of its range, P tuberculosa is a common species found on

siliceous rocks, walls, pebbles, and rarely on worked timber. In Turkey, it was

collected only from siliceous rock at the sea shore.

Known from North America, South America, Asia, Europe, Macaronesia

(Fryday et al. 2009). New to Turkey.

Protomicarea limosa (Ach.) Hafellner

A detailed description is provided by Coppins (2009).

SPECIMEN EXAMINED: TURKEY. GirEsun: Dereli, E of Kuzu golii high plateau,

40°34’42°N, 38°29°21”E, 2200 m, 09 Aug. 2008, on dead grass, (herb. Kinalioglu 1803).

Seven lichens new to Turkey... 127

Thallus greyish. Apothecia 0.25-0.9 mm diam., black. Epihymenium and

hymenium greenish, K-; hymenial gel I+red; hypothecium K+orange.

Ascospores colourless, narrowly ellipsoid, 10-15 x 3.5-5 um. Thallus C-, K-,

KC-, PD+ orange-red.

This rare species is found on acid soil, over mosses or humus mostly above

900 m. In Turkey, P limosa was collected only from dead grass in sun exposed

areas at high elevation.

Known from Europe and North America (Smith et al. 2009). New to Asia.

Rinodina turfacea (Wahlenb.) Korb.

Detailed descriptions are provided by Brodo et al. (2001) and Thomson (1997).

SPECIMEN EXAMINED: TURKEY. GirEsun: Dereli, E of Kuzu golii high plateau,

40°34’42”N, 38°29°21”E, 2200 m, 09 Aug. 2008, on moss, (herb. Kinalioglu 1808).

Thallus thick, pale brownish or grey. Apothecia abundant, 0.5-1.8 mm diam.;

disc dark brown to black; concolourous with thalline exciple. Ascospores thick-

walled, brown, Physcia-type, 22.5-35 x 10-15 wm. Thallus C-, K-, KC-, PD-.

Rinodina turfacea is found on soil, moss, decaying vegetation, peat and

wood in arctic or alpine sites. In Turkey, it was collected only from moss in sun

exposed areas at high elevation.

‘This species is known from Europe, Asia, North America, and South America

(Brodo et al. 2001, Kotlov 2008, Redchenko et al. 2010). New to Turkey.

Solenopsora holophaea (Mont.) Samp.

A detailed description is provided by Gilbert at al. ( 2009).

SPECIMENS EXAMINED: TURKEY. Orbw: Fatsa, Yalikoy, sea shore, 0 m, 13 Jul. 2005, on

siliceous rock, (herb. Kinalioglu 1798). Giresuw: Dereli, E of Kuzu golii high plateau,

40°34’42”N, 38°29°21”E, 2200 m, 09 Aug. 2008, on soil, (herb. Kinalioglu 1799).

Thallus squamulose to 3 mm wide, upper surface red-brown when dry and

olive green when wet. Apothecia 0.5-1.2 mm diam., numerous, disc dark

reddish brown to black. Ascospores 2-celled, colourless, 12.5-17 x 4 um in size.

Thallus C-, K-, KC-, PD-.

In other parts of its range, this species grows on soil and soft rocks chiefly

in slightly sheltered clefts on vertical cliffs or old walls at the coast. In Turkey, it

was collected from siliceous rock at the sea shore and from soil in sun-exposed

areas at high elevation.

Solenopsora holophaea is known from Africa, Asia, Europe, Macaronesia,

North America, and South America (Giivenc & Oztiirk 1999, Smith et al. 2009).

New to Turkey.

Thelenella modesta (Ny1.) Nyl.

Detailed descriptions are provided by Smith et al. (2009) and Wasser & Nevo (2005).

SPECIMEN EXAMINED: TURKEY. Orpu: Kumru, Ericek high plateau, 40°53'35”N,

37°13'48"E, 1120 m, 16 June 2005, on fuglans regia L. Juglandaceae), (herb. Kinalioglu

1813).

128 ... Kinahoglu & Aptroot

Thallus pale yellowish-grey. Perithecia 0.3-0.8 mm diam., rounded, sparse.

Ascospores muriform, colourless, 25-42 x 10-17 um. Thallus C-, K-, KC-,

PD-.

Elsewhere in its range growing on + rough bark of wayside or parkland

Fraxinus, twigs of Crataegus, and smooth bark of Quercus agrifolia and Juglans

californica. In Turkey, we recorded it from the trunk of Juglans regia.

Thelenella modesta is known from Europe, North America, Asia, Africa, and

Australia (Smith et al. 2009, Wasser & Nevo 2005). New to Turkey.

Acknowledgements

I would like to thank Dr. A. Khodosovtsev & A. Orange for reviewing this paper.

Literature cited

Andreev MP. 2003. Carbonea. 120-131, in NS Golubkova (ed.) Handbook of the Lichens of Russia.

8. Bacidiaceae, Catillariaceae, Lecanoraceae, Megalariaceae, Mycobilimbiaceae, Rhizocarpaceae,

Trapeliaceae. St. Petersburg: Russian Academy of Science. (in Russian)

Aptroot A, Yazici K. 2009. Opegrapha pauciexcipulata, a new corticolous lichen from Turkey.

Mycotaxon 108: 155-158.

Aslan A, Vézda A, Yazici K, Karagoz Y. 2005. New foliicolous lichen records for the lichen flora of

Turkey. Cryptogamie, Mycologie 26(1): 61-66.

Brodo IM, Sharnoff SD, Sharnoff S. 2001. Lichens of North America. Yale University Press,

London.

Candan M, Ozdemir Tiirk A. 2008. Lichens of Malatya, Elazig and Adryaman provinces (Turkey).

Mycotaxon 105: 19-22.

Cezanne R, Eicher M, Lumbsch HT. 2003. Muelleropsis humida — eine tibersehene Flechte?

Herzogia 16: 161-166.

Chambers SP, Galloway DJ, James PW. 2009. Carbonea (Hertel) Hertel (1983). 278-280, in CW

Smith et al. (eds.), The Lichens of Great Britain and Ireland. British Lichen Society, London.

Cobanoglu G, Sevgi E, Sevgi O. 2008. Epiphytic lichen mycota of, and new records from, Serif

Yiksel research forest, Bolu, Turkey. Mycologia Balcanica 5: 135-140.

Coppins BJ. 2009. Protomicarea Hafellner (2001). 751-752, in CW Smith et al. (eds.), The Lichens

of Great Britain and Ireland. British Lichen Society, London.

Fryday AM, Gilbert OL, Galloway DJ, Coppins BJ. 2009. Porpidia Korb. (1855). 739-748, in CW

Smith et al. (eds.), The Lichens of Great Britain and Ireland. British Lichen Society, London.

doi:10.1017/S0024282904014628

Gilbert OL, Purvis OW, James PW. 2009. Solenopsora A. Massal. (1855). 842-843, in CW Smith et

al. (eds.), The Lichens of Great Britain and Ireland. British Lichen Society, London.

Giiveng S, Oztiirk S. 1999. Lichens in the north-east regions of Cyprus. Feddes Repertorium 110

(5-6): 455-463.

Halica MG, Aksoy A. 2006. Saxicolous and terricolous lichens of Sirvan Mountain (Pinarbasi,

Kayseri). Tr. J. Bot. 30: 477-481.

John V. 2004. Lichenological studies in Turkey and their relevance to environmental interpretation.

Abstract book, XI OPTIMA meeting 5-11.9.2004, Belgrade: 45.

Kinalioglu K. 2010. Lichens of Ordu Province, Turkey, Mycotaxon 112: 357-360.

Kotlov YV. 2008. Rinodina. 309-359, in NS Golubkova (ed.), Handbook of the Lichens of Russia.

10. Agyriaceae, Anamylosporaceae, Aphanopsidaceae, Arthrorhaphidaceae, Brigantiaeaceae,

Seven lichens new to Turkey ... 129

Chrysotrichaceae, Clavariaceae, Ectolechiaceae, Gomphillaceae, Lecanoraceae, Lecideaceae,

Mycoblastaceae, Phlyctidaceae, Physciaceae, Pilocarpaceae, Psoraceae, Ramalinaceae,

Stereocaulaceae, Vezdaeaceae, Tricholomataceae. Nauka. St-Petersburg: Russian Academy of

Science. (in Russian)

Lumbsch HT, del Prado R, Kantvilas G. 2005. Gregorella, a new genus to accommodate Moelleropsis

humida and a molecular phylogeny of Arctomiaceae. The Lichenologist 37(4):291-302.

doi:10.1017/S002428290501532X.

Oztiirk $, Giiveng S. 2010. Additional lichen records from the western Black Sea region of Turkey.

Acta Botanica Hungarica 52(1-2): 159-175. doi:10.1556/ABot.52.2010.1-2.14.

Oran S, Oztiirk S. 2010. Three lichenized fungi new to Turkey. Mycotaxon112: 389-392.

Purvis OW, Coppins BJ, Hawksworth DL, James PW, Moore DM. 1992. The lichen flora of Great

Britain and Ireland. Natural History Museum & British Lichen Society, London.

Redchenko O, Koénar J, Gloser J. 2010. A contribution to lichen biota of the central part of

Spitsbergen, Svalbard Archipelago. Pol. Polar Res. 31 (2): 159-168. doi: 10.4202/ppres.2010.09

Smith CW, Aptroot A, Coppins BJ, Fletcher A, Gilbert OL, James PW, Wolseley PA. 2009. The

Lichens of Great Britain and Ireland. British Lichen Society, London.

Thomson JW. 1997. American Arctic Lichens. 2. The Microlichens. The University of Wisconsin

Press, Madison.

Wasser SP, Nevo E. 2005. Lichen-forming, Lichenicolous, and Allied Fungi of Israel. International

Center for Cryptogamic Plants and Fungi, Institute of Evolution, University of Haifa, Israel.

Wirth V. 1995. Die Flechten Baden-Wirttembergs. Ulmer, Stuttgart.

Woods RG. 2009. Gregorella Lumbsch (2005). 417, in CW Smith et al. (eds.), The Lichens of Great

Britain and Ireland. British Lichen Society, London.

Yazic1 K, Aptroot A. 2008. Corticolous lichens of the city of Giresun with descriptions of four

species new to Turkey. Mycotaxon 105: 95-104.

MYCOTAXON

Volume 115, pp. 131-144 January-March 2011

DOT: 10.5248/115.131

Type studies of Russula species described by W.A. Murrill, 1.

R. roseiisabellina, R. sericella, and R. obscuriformis

BART Buyck! & SLAVOMIR ADAMCIK?

’ Muséum National d’Histoire Naturelle, Dépt. Systématique et evolution

UMR7205, Paris F-75005 France

? Institute of Botany, Slovak Academy of Sciences, Department of Cryptogams

Diubravské cesta 9, Bratislava SK-84523 Slovakia

CORRESPONDENCE To?'buyck@mnhn.fr & *slavomir.adamcik@savba.sk

Asstract — The study of the North American russulas remains severely handicapped by the

lack of sufficient microscopic detail on approximately one third of the described taxa. In this

contribution, microscopic features are examined and illustrated in detail for three of Murrill’s

type specimens. The authors reinterpret these data in combination with the macroscopic

features supplied in the original diagnoses and propose amore appropriate infrageneric

placement of the taxa: (i) R. roseiisabellina is not close to R. sericeonitens (subgenus Russula) as

suggested in Murrill’s protologue, nor is ita synonym of R. rimosa (subgenus Heterophyllidia)

as suggested by Hesler — it is a typical member of the R. foetens group (subgenus Ingratula);

(ii) R. sericella is absolutely unrelated to R. obscuriformis as suggested in Murrill’s protologue

and probably fits within subgenus Russula or Tenellula; and (iii) R. obscuriformis is similar

to the recently described R. texensis in Russula sect. Xerampelinae, but new collections are

needed to verify whether it possesses the typical field characters of this group.

Key worps — Florida, micromorphology, Russulaceae, taxonomy

Introduction

William Murrill (1869-1957) was without any doubt one of the most colorful

and influential personalities among 20th century mycologists in America

(Weber 1961). His prolific description of new taxa has given him avery

controversial reputation, also in the case of Russula Pers., and Murrill surpasses

by far his fellow mycologists with a total of 111 newly described Russula species,

most collected near Gainesville, Florida (Buyck 2007).

As a professional mycologist, Murrill started his career at the New York

Botanical Garden, where he was probably influenced and stimulated towards

description of new taxa by the nomenclatural views and ambitions of the

newly imposed “American Code for nomenclature” at the New York Botanical

132 ... Buyck & Adamétik

Garden (Weber 1961). Murrill usually published his new russulas without any

critical revision or discussion of related or similar taxa and without placing

or grouping them into a subgeneric classification scheme. His descriptions

were very short and mainly oriented towards field characters at a time when

the study of the microscopic features of European Russula (Maire 1910, Melzer

1934) had already reached the degree of precision that is still in use today.

Judging from published synonymies (Bills 1984, Bills & Miller 1984) and our

own experience with his collections, it is therefore not surprising that Murrill

had probably difficulties in recognizing his own taxa (see commentary under

R. roseiisabellina below for example).

Hesler (1960, 1961) and Singer (1947, 1958) were the only mycologists who

ever tried to add something more substantial to Murrill’s original diagnoses.

Hesler published very short notes on microscopic features for many of Murrill’s

types, but even the kind of precision Hesler added for spores and elements

of the pileipellis is still largely insufficient to allow for good interpretations

and comparisons with modern descriptions of Russula. More recently,

afew other mycologists (e.g., Bills 1984, Bills & Miller 1984, Kibby & Fatto

1990) have studied at least some of Murrill’s collections but mostly without

publishing the features they examined on Murrill’s types. In a few instances,

these re-examinations eventually resulted in proposed synonymies or different

interpretations for some of Murrill’s taxa.

With taxonomic expertise on Russula having literally vanished in North

America over the past decennia (Buyck 2007) and in the absence of precise data

on Murrill’s types, the study of the North American russulas remains severely

handicapped by the lack of sufficient microscopic detail on approximately one

third of the described russulas on the continent.

This paper is the second of aseries of detailed and_ illustrated

microscopic revisions of Murrill’s taxain an effort to promote and stimulate rapid

progress in the study of American Russula (see Adam¢ik & Buyck 2010). We

also try to place the examined species in the latest available (mainly European)

classifications of the genus. And even if such a placement remains very tentative

in the absence of more precise data on fresh material, our observations suggest

in most cases very different affinities for most of the examined species.

One character shared by nearly all taxa in this contribution concerns the

color change on bruising or on drying: nearly all examined taxa supposedly

exhibit a distinct browning of at least part of the fruit bodies: R. roseiisabellina

(Murrill 1943) has lamellae “becoming brownish where bruised”, R. sericella

(Murrill 1945) was described with a stipe “becoming pale-brownish when

handled”. Finally, we also include here R. obscuriformis (Murrill 1945), which

was considered to be a synonym of R. sericella by Singer (Singer in sched.).

Type studies — Murrill Russula species ... 133

Materials & methods

Micromorphological characters were observed in Olympus CX-41 and Nikon Eclipse

E400 microscopes using an oil-immersion lens at a magnification of 1000x. All drawings

of microscopical structures — except of spores - were made with ‘camera lucida using a

Nikon Y-IDT drawing attachment at a projection scale of 2400x. Contents of hymenial

cystidia and pileocystidia in the illustrations are indicated schematically, except for a

single element where contents are indicated as observed in Congo red preparations

from dried material. Spores on the lamellae were observed in Melzer’s reagent. All

other microscopic observations were made in ammoniacal Congo red, after a short

aqueous KOH pre-treatment to improve tissue dissociation through gelatinous matrix

dissolution. All tissues were also examined for the presence of ortho- or metachromatic

contents or incrustations in cresyl blue as explained in Buyck (1989).

Spores were scanned with an Olympus Artcam camera and measured using Quick

Micro Photo (version 2.1) software. Enlarged scanned pictures of spores were used

for measuring with an accuracy of 0.1 um and for drawing. Q gives length/width ratio

of the spores. Measurements exclude ornamentation. Statistics for measurements of

microscopical characters are given as mean value (boldface) plus/minus standard

deviation and are based on 30 measurements. Values in parentheses give measured

minimum or maximum values. An estimate for spore ornamentation density is given

following Adam¢ik & Marhold (2000).

Names for infrageneric taxa follow the classification system proposed by Romagnesi

(1985, 1987).

Taxonomy

Russula obscuriformis Murrill, Lloydia 7(4): 312. 1945. Fics 1-6

ORIGINAL DESCRIPTION AND TYPIFICATION — Pileus convex to slightly depressed,

solitary, 8 cm broad; surface dry, smooth, at length glabrous, dark-roseous with bay

center, darker on drying, margin even or slightly striate, entire, peeling readily; context

thin, white, discolored on drying, odorless, mild; lamellae adnate, mostly equal, few

forked, broad, medium distant, entire, white; spores subglobose to broadly ellipsoid,

finely tuberculate, stramineous in mass, about 8 um long; cystidia none; stipe equal,

smooth, glabrous, white, 5 x 2 cm.

Type collected by W. A. Murrill under an oak at LaCrosse, Alachua Co., Fla., July 13,

1938 (F 15536). Suggesting R. obscura Romell but differing in color and spore color. The

gills in dried specimens are distinctly gray. [Holotype at FLAS sub nr. F15536].

MICROSCOPIC FEATURES — Sporss broadly ellipsoid, (7.3-)7.7-8.1-8.4(-8.7)

x (6.2-)6.4-6.7-7(-7.4) um, Q = (1.11-)1.15-1.2-1.25(-1.27); ornamentation

rather dense, subreticulate to reticulate, composed of conical to hemispherical,

often large, strongly amyloid warts, ca (3-)5-7(-8) warts in a 3 um diam. circle,

measuring 0.5-0.7 um high, interconnected by fine line connections (2-6 in a

circle) or fused in ridges (0-4 fusions in the circle); suprahilar plage amyloid.

BASIDIA (32-)37.5-40.5-43.5(-45) x (10-)11-12-13(-13.5) um, 4-spored,

clavate. SUBHYMENIUM pseudoparenchymatic. LAMELLAR TRAMA mainly

composed of large spherocytes. HYMENIAL CysTIDIA widely dispersed, less

134 ... Buyck & Adamétik

‘So

eV, RF,

Fics. 1-2. Russula obscuriformis (holotype). 1. Pileocystidia, with contents indicated in one element

as seen in Congo red. 2. Hyphal terminations near cap margin. Scale bar = 10 um.

Type studies — Murrill Russula species ... 135

Fics. 3-6. Russula obscuriformis (holotype). 3. Basidia. 4. Basidiola. 5. Spores in Melzer’s reagent.

6. Hymenial cystidia with contents indicated in one element as seen in Congo red.

Scale bar = 5 um for spores, 10 tum for the other elements.

than 500/mm? and very difficult to observe except near gill edge, measuring

ca, 56-80 x 9-14 um on sides, clavate to fusiform-pedicellate, mucronate-

appendiculate, thin-walled, with few and ill-defined, SV-negative contents

that are not strongly refringent in KOH. MARGINAL CELLS not differentiated.

PILEIPELLIs orthochromatic in cresyl blue, without incrustations, not sharply

delimited from the underlying spherocytes of the context, vaguely divided in

a rather poorly gelatinized subpellis and a more dense suprapellis of intricate

to ascendant hyphae, with poorly differentiated pileocystidia. Hyphal endings

thin-walled and easily collapsing, near margin with terminal cells measuring

(19-)24.5-34.2-44(-55) x (2.5-)3-3.2-4(-4.5) wm, slender, attenuated or

136 ... Buyck & Adamétik

cylindrical, with apex often more or less abruptly, irregularly or repeatedly

constricted and only 1.5-2.5 um diam., occasionally clavate; subapical cells

shorter and often somewhat larger in diam., often branched. Pileocystidia

scarce and indistinct, single-celled, arising from the subpellis, cylindrical to

subclavate, ca. 4-5.5(7.5) um wide, with poorly differentiated, granular contents

that do not react to sulphovanillin. CLAMP CONNECTIONS absent in all parts.

COMMENTARY — R. obscuriformis differs from all other species discussed in

this paper by the spores that are “stramineous in mass” — an observation that

confirms at least that Murrill did distinguish between pale and darker spore

prints in Russula. Itis therefore difficult to understand why Singer synonymizes

this species with R. sericella (having a white spore print), which has indeed a

completely different pileipellis under the microscope.

The discoloring context should, in our opinion, be interpreted as ‘graying’

context because of the comparison to “R. obscura Romell” (= R. vinosa

Lindblad) and the mention of the distinctly grayish lamellae on drying. This

graying context, together with the odorless flesh and the very prominent

reticulation of the spores, is a combination of characters that does not suggest

a place in Russula sect. Xerampelinae (Singer) Jul. Schaff. However, the recently

described R. texensis (Buyck et al. 2008) is a fishy Russula with grayish-brownish

discoloring context and a weak fishy smell. It has an overall similar color and

also similar features of spores and pileipellis. The two taxa differ nevertheless by

the much more pronounced reticulation of the spores in R. obscuriformis and

the very scarce, smaller and hardly prominent pileocystidia. The spore print

color of R. texensis was noted as ‘pale’ on the gills (a sufficient spore print was

not obtained). A dark cream to pale ochre spore print may therefore still be

possible and could perhaps match the ‘stramineous’ color noted by Murrill for

R. obscuriformis. It can therefore not be excluded for the moment that Murrill’s

species is a good member of sect. Xerampelinae.

The use of the synoptic key by Kibby & Fatto (1990) is quite frustrating

in the case of R. obscuriformis since the interpretation of many features (in

particular cap color, spore print color, peeling and bruising), does not allow for

unambiguous coding and therefore does not lead to any reliable identification.

Russula roseiisabellina Murrill, Lloydia 6(3): 216. 1943. EIGS 7-13

ORIGINAL DESCRIPTION AND TYPIFICATION —Pileus convex to depressed, 4.5-6 cm

broad; surface glabrous, slightly viscid, the cuticle not readily separable, rosy-isabelline,

margin entire, somewhat striate; context rather thick, white, unchanging, sweet,

odorless; lamellae adnate, narrow, close, entire, mostly equal, scarcely any forked,

white to pallid, becoming brownish where bruised; spores white in mass, globose or

subglobose, distinctly echinulate, 6-7 jum; stipe tapering downward, smooth, glabrous,

white, unchanging on drying but brownish where bruised, 4-6 x 1-1.5 cm.

Type collected under an evergreen oak on the west shore of the Prairie, near

Gainesville, Fla., June 19, 1938 (F 16365). Also collected under oaks at the Tung-oil

Type studies — Murrill Russula species ... 137

Fics. 7-9. Russula roseiisabellina (holotype). 7. Pileocystidia, with contents indicated in one

element as seen in Congo red. 8. Hyphal terminations in cap center. 9. Hyphal terminations near

cap margin. Scale bar = 10 um.

138 ... Buyck & Adamétik

Mill, west of Gainesville, June 15, 1938, by Margaret Johnson (F 17209), and in the

same locality, June 22, 1938, by West and Murrill (F 17210). This species seems to prefer

soil with some lime in it. It is rare, and is found alone or, at most, two near together.

[Holotype at FLAS sub nr. F16365].

MICROSCOPIC FEATURES — SPORES ellipsoid, (6.1-)6.7-7.1-7.6(-8) x (4.7-)

4.8-5.1-5.4(-5.9) um, Q = (1.18-)1.29-1.39-1.49(-1.54); ornamentation

dens (with 7-10(-13) warts in a 3 wm circle), composed of low and obtuse,

amyloid warts measuring 0.2-0.3 um high, mostly isolated, with some very

rare connectives or twinned warts (0-2 fusions in the circle) on some spores;

suprahilar plage inamyloid. BAstp1a (35-)40-42.6-45(-46) x (9-)9.5-10.3-11

(-11.5) wm, 4-spored, clavate. SUBHYMENIUM pseudoparenchymatic, small-

celled. LAMELLAR TRAMA mainly composed of large spherocytes. HYMENIAL

CYSTIDIA dispersed, often less than 600/mm? but more numerous on gill

edge, measuring (35.5-)47.5-56.4-65.5(-70) x (7.5-)8.5-10.2-12(-14) um,

fusiform-pedicellate, mucronate-appendiculate, thin-walled, with SV-negative,

crystalline-granular contents, that are strongly refractive in KOH. MARGINAL

CELLS undifferentiated. PILEIPELLIs near the surface slightly metachromatic in

cresyl blue, not sharply delimited from the underlying context, thin, vaguely

divided in a poorly gelatinized subpellis of intermingled hyphae, and a

suprapellis of more branched and intricate endings with many pileocystidia

near the surface only. Hyphal endings thin-walled, often branched at the first

or second subapical cell, overall slightly narrower and with shorter terminal

cells in cap center compared to cap margin; terminal cells near margin

measuring (12-)15.5-21.6-28(-42.5) x 4-4.8-5.5(-6) wm, subcylindrical or

mostly somewhat narrowing upward, in cap center (12.5-)15.5-19.8-24(-29)

x (3-)3.5-3.8-4(—5) tum, less narrowing but on the contrary more often slightly

inflated at the tip and subcapitulate; subapical cells mostly equal in width,

often branched. Pileocystidia present near surface only, numerous, unicelled,

(23.5-)31-42.1-53(-68) x (3.5-)4.5-5.2-6(-6.5) tum with the largest one

near the cap margin, narrow, fusiform to typically subulate with mucronate

tips, thin-walled; contents granular-crystalline, often concentrated in upper

half or middle portion of the cystidium, insensitive to sulfovanillin. CLAMP

CONNECTIONS absent in all parts.

COMMENTARY — Because of the mention of the white spore print, the mild taste,

and a weakly striate cap margin in the original description, this species keys

out to R. subgen. Heterophyllidia Romagn. when using most keys for European

russulas (Bon 1988, 2002a,b; Romagnesi 1985). Using the synoptic key of Kibby

& Fatto, the easy and straightforward coding of features (FHKNPTV) leads

directly to R. decora Shaffer. The latter species is a member of the R. nigricans

group (R. subgen. Compactae (Fr.) Bon) and therefore absolutely not a close

match for Murrill’s type.

Type studies — Murrill Russula species ... 139

Fics. 10-13. Russula roseiisabellina (holotype). 10. Basidia. 11. Basidiola. 12. Spores in Melzer’s

reagent. 13. Hymenial cystidia with contents indicated in one element as seen in Congo red.

Scale bar = 5 um for spores, 10 um for the other elements.

Our own observations on features of spores and particularly of pileipellis

place R. roseiisabellina without any doubt in R. subgen. Ingratula Romagn.

(perhaps close to R. ventricosipes Peck): the non-amyloid suprahilar spot, the

slender, narrow, mucronate pileocystidia, the weak metachromatic reaction

of the suprapellis elements in cresyl blue, and finally the spore ornamentation

consisting of low, mostly isolated and obtuse warts are all well known features

for other taxa in this group. The metachromatic reaction in cresyl blue and the

type of spore ornamentation may also remind of R. subsect. Cyanoxanthinae

Singer (R. subgen. Heterophyilidia) but the latter species group differs by

a different and very characteristic type of pileocystidia and in having strongly

incrusted, metachromatic hyphal ends, which are quite different from the ones

observed here.

140 ... Buyck & Adamétik

R. roseiisabellina therefore appears to be a good and perhaps rare species

that does not correspond to any of the already described members of subgen.

Ingratula in North America. Whether it is very characteristic in the field is

unlikely: our examination of the second specimen identified and mentioned

as such in the protologue by Murrill reveals a clearly different species of the

R. foetens-group with very different spores.

Hesler (1960), who has published a “type-study” with some notes on the

spores and pileipellis of R. roseiisabellina, describes a quite different type of

pileipellis, reminiscent of R. virescens (Schaeff.) Fr., and concludes that Murrill’s

species is identical to R. rimosa Murrill, reducing the latter into synonymy.

However, as the senior author has had access to Hesler’s personal files and

duplicate collections at TENN, it is evident that the disagreement between

Hesler’s and our own observations can be easily explained by the fact that

Hesler never examined the type, but relied for his publication on a different,

but misidentified specimen sent to him by Murrill.

The essential features of R. roseiisabellina reside with the pinkish flush on

the cap, the pale spore print (described as white, but given the imprecision at

that period, a pale cream spore print can not be excluded), mild taste, browning

context at least for the gills, and absence of a distinct smell. The importance of

its association with Quercus on limy soil remains to be verified, but may help in

separating it from small individuals of R. ventricosipes, a typical pine associate

on sandy soil possessing equally a pinkish flush on the cap.

Russula sericella Murrill, Lloydia 7(4): 313. 1945. Fics 14-21

ORIGINAL DESCRIPTION AND TYPIFICATION — Pileus convex to depressed, 5-7 cm broad;

surface dry, smooth, finely pruinose, vinosous on the disk, paler toward the margin,

which is entire and very slightly striate at times; context white, unchanging, odorless,

mild; lamellae adnate, many forked at the very base, few inserted, close, narrow, entire,

white, gray when dried; spores globose or subglobose, plainly short-tuberculate, white

in mass, 6-7 tum; cystidia none; stipe usually equal, stuffed, smooth, glabrous, white,

becoming pale-brownish when handled, 5-7 x 1.5-2 cm.

Type collected by W. A. Murrill under a live-oak in Gainesville, Fla., June 1, 1938 (F

12075). Also collected several times under frondose trees in Alachua Co. and once in

Clay Co., Fla. Closely related to Kauftman’s R. sericeonitens but easily distinguished by the

change in the color of the stipe. Spores tuberculate; not echinulate as in R. xerampelina

Fr. [Holotype at FLAS sub nr. F12075].

MICROSCOPIC FEATURES — Spores subglobose to broadly ellipsoid, (7.3-)

7.5-7.8-8.1(-8.5) x (6.3-)6.5-6.8-7(-7.4) um, Q = (1.07-)1.11-1.16-1.21

(-1.35); with a dense subreticulate ornamentation (ca (7-)8-10(-11) elements

in a 3 wm circle), composed of broadly conical, amyloid, warts measuring

0.4-0.6 um high, with numerous line connections ((0-)2-5(-6) connections

in a 3 um circle) or locally fused in short or long ridges (0-4(-5) fusions in

the circle); suprahilar plage amyloid. Basip1a (37-)39,.5-42.2-45(-48) x

Type studies — Murrill Russula species ... 141

fan

Fics. 14-16. Russula sericella (holotype). 14. Pileocystidia, with contents indicated in one element

as seen in Congo red. 15. Hyphal terminations in cap center. 16. Hyphal terminations near cap

margin. Scale bar = 10 um.

142 ... Buyck & Adamétik

Fics. 17-21. Russula sericella (holotype). 17. Basidia. 18. Basidiola. 19. Spores in Melzer’s reagent.

20. Hymenial cystidia with contents indicated in one element as seen in Congo red. 21. Marginal

cells of gill edge. Scale bar = 5 um for spores, 10 um for the other elements.

(10-)11-11.9-12.5(-13) um, 4-spored, clavate. SUBHYMENIUM small-celled.

LAMELLAR TRAMA with many very large spherocytes. HYMENIAL CYSTIDIA on

sides moderately numerous (1000-1500/mm/’), hardly emergent, originating in

the subhymenium, measuring (49-)52.5-63.3-74(-89) x (7-)8-9.3-10.5(-11)

um, mostly obtuse, occasionally mucronate or appendiculate (up to 4 um long),

thin-walled, with SV-negative contents. MARGINAL CELLS on edge of gills very

small and slender, hardly differentiated, ca. 7-18 x 2.5-4 um. PILEIPELLIs

orthochromatic in cresyl blue, without incrustations, not sharply delimited

from the underlying large spherocytes of the context, thin, vaguely divided in

Type studies — Murrill Russula species ... 143

a rather poorly gelatinized subpellis and a thin, discontinuous and disrupted

suprapellis of intricate, small-celled and highly branched hyphal endings; these

very thin-walled and also with thin septa; terminal cells very small and short,

measuring (8-)12.5-17-21.5(-27) x (2.5-)3.5-4.1-4.5(-5) tm, mostly very

irregular and often nodulose in form, with local contortions and inflations, not

attenuated but rounded-obtuse or somewhat inflated near the tips, in the centre

of pileus similar, somewhat more regular and with terminal cells of similar size,

(8.5-)11.5-14.7-18(-20) x (2.5-)3-3.6-4.5(-5) wm. Pileocystidia distinct,

dispersed, 1-3 celled, of very variable length, mostly situated at the cap surface

and with terminal cells 12-17.5-23.5 x 5.5-6.6-8 um, ellipsoid, fusiform or

rarely clavate, obtuse, but some also longer and cylindrical, ascending from

the subpellis, absent in the underlying trama; contents granular to crystalline,

refringent, hardly reacting with sulfovanillin. CLAMP CONNECTIONS absent in

all parts.

COMMENTARY — ‘The only mycologist who published on the type of R. sericella

was Hesler (1960), unfortunately without any comment on the quite distinctive

pileipellis. Singer also examined the type as evidenced by the note he left

with the type specimen stating that “R. sericella = R. obscuriformis Murrill =

R. xerampelina”. We disagree completely with the proposed synonymy, these

three taxa being very different as shown here.

Using the synoptic key of Kibby & Fatto (1990) the combination of

A?KNPT (with the question mark allowing for variation in our interpretation

of the second feature: the “readily” peeling cap) leads either to R. rosea Quél.

(choosing I = %4-% peeling ) or to R. sericeonitens Kauffman (choosing J =

% to completely peeling), the latter being indeed the species that is suggested

by Murrill himself as being very close to R. sericella. Both species are quite

different from R. sericella.

Use of European Russula-keys results in similar placements as for some of

the species discussed above and leads to the mild or faintly acrid species around

R. krombholzii Shaffer in R. subgen. Russula when using Romagnesi’s key (1985)

or to a placement in R. subgen. Tenellula Romagn. with Bon’s key (2002).

Acknowledgements

The authors would like to thank the curators of the mycological herbaria of FLAS

(Gainesville, Florida) and TENN (Knoxville, Tennessee) for their efficiency and R.H.

Petersen at TENN for access to Hesler’s personal notes and duplicate specimens. A study

visit to the Paris’ Herbarium by Adam¢ik was funded through the Synthesys program

of the European Union (FR-TAF-3122 and FR-TAF-5110), his further studies funded

national project Vega 2/0028/11. Overseas travel of the senior author has been funded

by the research program “Etat et structure phylogénétique de la biodiversité actuelle

et fossile” (Dir. Ph. Janvier) at the Paris’ Museum. Reviewers of the manuscript, André

Fraiture and Pierre-Arthur Moreau, are acknowledged for valuable comments.

144 ... Buyck & Adamétik

Literature cited

Adam¢ik S, Buyck B. 2010. Re-instatement of Russula levyana Murrill as a good and distinct

American species of Russula section Xerampelinae. Cryptog. Mycol. 31(2): 119-135.

Adamé¢ik S, Marhold K. 2000. Taxonomy of the Russula xerampelina group. I. Morphometric study

of the Russula xerampelina group in Slovakia. Mycotaxon 76: 463-479.

Bills GE. 1984. Southern Appalachian russulas. II. Mycotaxon 21: 491-517.

Bills GK Miller OK. 1984. Southern Appalachian Russulas. I. Mycologia 76(6): 975-1002.

doi: 10.2307/3793015

Bon M. 1988. Clé monographique des russules dEurope. Doc. Mycol. 18(70-71): 1-120.

Bon M. 2002a. Nouvelles clés des Russules (1). Doc. Mycol. 32(125): 43-165.

Bon M. 2002b. Nouvelles clés des Russules (2). Doc. Mycol. 32(127-128): 49-67.

Buyck B. 1989. Valeur taxonomique du bleu de crésyl pour le genre Russula. Bull. Soc. Mycol.

France 105(1): 1-6.

Buyck B. 2007. A new initiative towards the study of Russula in the eastern USA. Pagine Micol.

27: 81-86.

Buyck B, Adaméik S, Lewis DP. 2008. Russula section Xerampelinae in Texas. Cryptog. Mycol.

29(2): 121-128.

Hesler LR. 1960. A study of Russula Types. Mem. Torrey Bot. Club 21: 1-59.

Hesler LR. 1961. A study of Russula Types. IL Mycologia 53: 605-625. doi:10.2307/3756461

Kibby G, Fatto RM. 1990. Keys to the species of Russula in northeastern North America., 3" ed.

Somerville, Kibby-Fatto Enterprises.

Melzer V. 1934. Contribution a l'étude microscopique des Russules. Bull. Soc. Mycol. France 50:

218-225.

Murrill WA. 1943. More new fungi from Florida. Lloydia 6: 207-228.

Murrill WA. 1945 [“1944”]. More fungi from Florida. Lloydia 7: 303-327.

Maire R. 1910. Les bases de la classification dans le genre Russula. Bull. Soc. Mycol. France 26:

49-125,

Romagnesi H. 1985. Les Russules d'Europe et d'Afrique du Nord, 2"4 ed. Vaduz: J. Cramer.

Romagnesi H. 1987. Status et noms nouveaux pour les taxa infragénériques dans le genre Russuia.

Doc. Mycol. 18: 39-40.

Singer R. 1947. Type studies on Basidiomycetes III]. Mycologia 39(2): 171-189.

doi: 10.2307/3755005

Singer R. 1958. New and interesting species of Basidiomycetes V. Sydowia 11: 141-272.

Weber GE 1961. William Alphonso Murrill. Mycologia 53(6): 543-557.

MYCOTAXON

Volume 115, pp. 145-153 January-March 2011

DOI: 10.5248/115.145

New species and new records of Crepidotus from the

northwest region of Sao Paulo State, Brazil

MARINA CAPELARI

Instituto de Botdnica, Niicleo de Pesquisa em Micologia

Av. Miguel Stéfano, 3687, Sao Paulo, 04301-902, SP, Brazil

CORRESPONDENCE TO: mcapelariibot@yahoo.com

AsstTract — The study of Agaricales collections gathered in the northwest region of Sao

Paulo State, Brazil revealed the occurrence of four species of Crepidotus. Two of them,

C. flavus and C. longicystidiatus, are proposed as new, while C. apodus and C. defibulatus are

recorded for the first time in the northwest region of Sao Paulo State.

Key worps — diversity, South America, taxonomy

Introduction

The genus Crepidotus (Fr.) Staude includes members with a lignicolous

habit, pleurotoid basidiomata often bearing a reduced stipe, and pilei that are

glabrous to densely villose especially near the rear portion. The spore print is in

shades of pale brown or sometimes yellowish, and spores that may be smooth

or ornamented but which always lack a germ pore. Pleurocystidia are normally

absent, but cheilocystidia are mostly present. Hyphae may be clamped or not.

Spore ornamentation and the presence or absence of clamp connections are

the basis of infrageneric classification in Crepidotus by Singer (1947, 1973) and

Hesler & Smith (1965). In her study of European species, Senn-Irlet (1995)

based her infrageneric classification on pileus trama type, including the

presence or absence of a gelatinous layer.

In Brazil, Crepidotus is represented by 36 taxa, of which 10 — C. apodus,

C. applanatus var. subglobiger, C. candidus, C. catamarcae, C. crocophyllus,

C. defibulatus, C. martinii, C. palmarum, C. polylepidis, C. quitensis, C. rubriceps,

C. scymnodes, C. stromaticus, C. tigrensis, C. uber, C. variabilis — occur in Sao

Paulo State (Capelari 2007). Parana and Rio Grande do Sul are the states with

the next highest numbers of known species (Senn-Irlet & Meijer 1998, Rick

1930, 1938, 1961). Singer (1989) cited two species for Amazonas (C. igapoensis,

146 ... Capelari

C. pilosiceps), which are known only by the types. Singer (1973) described

C. guzmanii and mentioned C. truncatus for Pernambuco State. For the state

of Rio de Janeiro, Singer (1973) cited C. albidus var. bisporus and both he and

Bandala et al. (2006) mentioned C. septicoides.

This paper, which deals with collections from forest fragments in the

northwest region of Sao Paulo State, proposes two newspecies: C. longicystidiatus

and C. flavus.

Materials & methods

Materials were collected in four private forest remnants within the northwest region

of Sao Paulo State. These remnants are composed of semideciduous seasonal forest,

which is very fragmented and surrounded by either sugar cane or orange plantations or

pasture. The human impact on these places probably will not be reverted and they tend

to disappear.

For microscopic analyses, dried material was rehydrated in 70% ethanol followed

by 5% KOH. For spore and cheilocystidia dimensions, 20 measurements were taken

for each specimen; Qm represents the mean length/width quotient of the total spores

measured. All microscopic illustrations were made with the aid of a drawing tube. The

colors of fresh material, when possible, were compared with those described by Ktippers

(1979), and the specimens were deposited at the herbarium of the Instituto de Botanica

(SP).

Taxonomy—new species

Crepidotus flavus Capelari, sp. nov. Figs 1a, 2

MycoBank MB 519063

Pileus 3-17 mm latus, flabellatus, flavus vel ochraceus, brunneus prope substrato,

pruinosus, margine flava vel ochracea, involuta. Lamellae adnatae, flavae vel ochraceae.

Stipes nullus. Basidiosporae 8.7 x 8.7 um, globosae, valde verruculosae. Pleurocystidia

nulla. Cheilocystidia 19.3-29.2 x (5.2-) 7.0-9.2 um, numerosa, flageliformia, leavia,

interdum cum apicibus incrustatis. Trama pileorum flavida, hyphae fibulatae, 6.2-12.5 um

latae. Trama lamellarum regularis, flavida, hyphae fibulatae, 6.2-8.7 um latae. Pileipellis

ex hyphis repentibus vel erectiusculis, fibulatis. Gregarius, supra trunco caduco.

Type: BRAZIL, SP, Matao, (21°37'14”S 48°32’ 14”W), 12 December 2007, F. Karstedt 1011

(holotypus in herbarium SP asservatur).

Erymo.oey: Latin, yellow, the basidiomata color.

MACROCHARACTERS: Pitgus 3-17 mm broad, flabelliform, yellow to

ochraceous, brown near the attachment to the substrate, margin yellow to

ochraceous yellow, pruinose at the rear portion, dry, not hygrophanous, margin

plane to slightly incurved, smooth. LAMELLAE adnate, diverging from acommon

central point, distant, with 1-2 series of lamellulae, yellow to ochraceous. STIPE

absent. CONTEXT yellowish, thin.

MICROCHARACTERS: BASIDIOSPORES 8.7 x 8.7 um, Q. = 1.0, uniformly globose,

ornamented, strongly verrucose, light brown, thick-walled, inamyloid. BAsipIA

Crepidotus spp. nov. (Brazil) ... 147

Fig. 1. A. Crepidotus flavus (type); B. Crepidotus longicystidiatus (type). Bars = 1 cm.

148 ... Capelari

not seen. PLEUROCYSTIDIA absent. CHEILOCYSTIDIA 19.3-29.2 x (5.2-)7.0-9.2

um, numerous, turning the margin completely sterile, ventricose, smooth,

hyaline, thin-walled, some with apical encrustations, clamp connections at

the base not seen. PILEUs TRAMA thin, yellowish, with cylindrical, thin-walled

hyphae, 6.2-12.5 um diam, hyaline, clamped, ungelatinized. HYMENOPHORAL

TRAMA regular, yellowish, with cylindrical, slightly thin-walled hyphae, 6.2-8.7

um diam, hyaline, clamped, ungelatinized. PILEIPELLIs light brown, a cutis of

prostate to some loose and suberect yellowish to light brownish hyphae, 3.7 um

diam, thick-walled, clamped.

HABIT AND HABITAT: Gregarious, on fallen trunk.

COMMENTSs: Macroscopically, this material fits very well with the illustration

of Crepidotus stromaticus (Cooke & Masse) Sacc. published by Hemmes &

Desjardin (2002). According to these authors, C. stromaticus from Hawaii had

been previously referred to C. citrinus Petch and C. sulphurinus Imazeki & Toki.

Literature on C. stromaticus is limited, although it was cited for Brazil by Rick

(1961) in material that needs revision.

Pilat (1950) described the Australian type material of C. stromaticus as

“albido-isabellino ... Pileus 10-15 mm. latus ... Sporae ... distincte dense

obtuse verrucosae, 8-8.5 x 6.7-7.5 pw”, and considered it identical to C. pogonatus

(Kalchbr.) Sacc. However, in the same paper, he described the basidiospores of

C. pogonatus as “punctato-verrucosae ... 5-5.6 4 diam.,” much smaller than

he measured for C. stromaticus. On the other hand, Singer (1955) described

the type of C. stromaticus as “strongly punctate and somewhat rough, about

7-7.5 «wm in diameter” and regarded C. stromaticus so close to C. nephrodes

that a specific separation could hardly be justified. Information by Ripkova et

al. (2005) and Bandala et al. (2008) suggests that C. nephrodes is a different

taxon and should even be considered a synonym of C. crocophyllus, a broadly

distributed temperate fungus with variable pigmentation that was already

mentioned for Sao Paulo State by Rick (1930, 1961).

Crepidotus sulphurinus (Imazeki & Toki 1954), according to the protologue,

has bisporic basidia and basidiospores that are 7-10 x 6-9 um, subglobose,

apiculate, brownish-yellow, and echinulate-verrucose. Crepidotus flavus, on the

other hand, produces truly globose, perhaps less ornamented basidiospores (as

far as I know there are no available MEV photographs of C. sulphurinus), and

ventricose cheilocystidia (some apically encrusted) and not clavate as illustrated

by Imazeki & Toki (1954).

Singer (1953) identified a yellow Crepidotus from Argentina as C. citrinus

growing together on the same trunk with another species he identified as

C. fulvifibrillosus Murrill, which Ripkova et al. (2005) consider a synonym of

C. crocophyllus. Crepidotus citrinus was described from Sri Lanka and, according

Crepidotus spp. nov. (Brazil) ... 149

Lh, WW \ ee che SLAG

Fig. 2. Crepidotus flavus (type):

a. basidiospores; b. cheilocystidia. Bars = 10 um.

to Singer (1955), the type has globose basidiospores that are 7-8 x 7-8 um,

with strongly imbedded spinules that project slightly beyond the episporium so

that the spore surface appears rough in immersion oil. Singer (1955), however,

did not mention cheilocystidia size and shape. The Argentinean material of

the same species described by Singer (1953) has globose basidiospores that are

6.8-8.3 um, 2-, 3-, or 4-spored basidia, and hyaline to light yellow versiform

cheilocystidia, the majority of which have irregular excrescences but lack

encrustations and which measure (15.0-)27.5-42 x (4.0-)6.8-11(-14.5) um.

No other modern description of C. citrinus was found in order to clarify the

cheilocystidia. Indeed, C. citrinus sensu Singer appears to be the closest species

to the new Brazilian one, but they differ in cheilocystidia shape and size.

Horak (1978) described two species with yellow colors and encrusted

cheilocystidia—C. aureus from New Caledonia and C. parietalis from New

Zealand—that can be compared with C. flavus. Crepidotus flavus differs from

C. aureus in basidioma dimensions, less ornamented pileus surface, and

basidiospore and cheilocystidial morphology, with C. aureus producing smaller

(6-7 um), subglobose spores and cheilocystidia that are fusoid to lageniform,

basally thin-walled and apically thick-walled (< 1.5 um). From C. parietalis,

C. flavus differs in pileus color (paler in C. parietalis) and especially by the

basidiospore dimension and shape (5-6.5 wm and globose in C. parietalis) and

the absence of thick-walled hyphae at the pileipellis.

150 ... Capelari

Crepidotus longicystidiatus Capelari, sp. nov. Fics 1B, 3

MycoBank MB 519064

Pileus 3-7 mm latus, primum flabellatus, deinde convexus vel plano-convexus, dorsaliter

affixus in substrato tum circularis vel reniformis, subroseus, pilosus; margine plana ad

involutam. Lamellae adnatae, vinaceo-roseae. Stipes nullus. Basidiosporae (6.2-)7.5(-8.7)

x 6.2-7.5 um, globosae vel subglobosae, verruculosae. Basidia 20-25 x 5.0-6.0 um, clavata,

tetraspora. Pleurocystidia nulla. Cheilocystidia 60-116 x 5.0-7.0 um (14.0 um apicem),

cylindracea ad flexuosa, hyalina, cum fibulis in base. Trama lamellarum regularis, hyphae

fibulatae, 6.2-11.2 um latae. Pileipellis ex hyphis repentibus composite, fibulatae, 6.2-10.0

um latis. Gregarius ad ramo putridos.

Type: BraziL, SP, Turmalina, (20°00'13”S 50°26’02”W), 27 November 2007, Capelari

4358 (holotypus in herbarium SP asservatur).

ErymMo.oey: Latin, because of the very long cheilocystidia.

MACROCHARACTERS: PILEUS 3-7 mm broad, flabelliform in primordial

stages, becoming convex or plane-convex, dorsally attached to substrate, then

circular, subcircular or more or less reniform when seen from hymenophore,

light pinkish, dry, not hygrophanous, surface pilose, margin plane to incurved,

smooth, LAMELLAE adnate to acommon central or excentric point, distant, wit

1-2 series of lamellulae, vinaceous pink (near N,,A,.M.,), edges lighter. STIPE

absent. CONTEXT thin.

MICROCHARACTERS: BASIDIOSPORES (6.2-)5.0-7.0(-8.7) x 6.2-7.5 um, Q.

= 1.19, globose to subglobose, ornamented, verrucose, ferruginous-brown,

slightly thick-walled, inamyloid. Basip1a 20-25 x 5.0-6.0 uum, clavate, four-

spored, hyaline, thin-walled. BAsIDIOLEs numerous. PLEUROCYSTIDIA absent.

CHEILOCYSTIDIA 60-116 x5.0-7.0 tum, up to 14.0 um at the apex), numerous,

cylindrical, narrowly clavate, flexuous, smooth, hyaline, slightly thin-walled,

clamped at the base. PILEUs TRAMA thin, of cylindric, slightly thin-walled

hyphae, 6.2-10 um diam, hyaline, clamped, ungelatinized. HyMENOPHORAL

TRAMA regular, of cylindric, slightly thin-walled hyphae, 6.2-11.2 um diam,

hyaline, clamped, constricted at the septum, ungelatinized. PILEIPELLIs a

cutis of undifferentiated flexuous hyphae, 6.2-10 um diam, hyaline to slightly

brownish, slightly thick-walled, clamped, with small clamp connections. PILEUs

HYPHAE at the substrate hyaline slightly brownish hyphae, 2.5-3.7 um diam,

moderately thick-walled, sometimes encrusted, branched, clamped.

HABIT AND HABITAT: Gregarious, on fallen branch.

CoMMENTSs: Of the species with pink or pinkish pilei or lamellae, the new

species can be compared with C. roseus Singer, C. roseolus Singer, and

C. velutinoaffinis Singer, described in Singer’s 1973 monograph of Crepidotus

for the Neotropics.

Crepidotus roseus differs in basidiospore morphology and cheilocystidia

size and is characterized by less broad (6.5-7.0 x 5.3-5.8 tm) subglobose

basidiospores and smaller (30-48 x 7.5-13 tm) cheilocystidia. The new

Crepidotus spp. nov. (Brazil) ... 151

Fig. 3. Crepidotus longicystidiatus (type):

a. basidiospores; b. basidia; c. basidioles; d. cheilocystidia. Bars = 10 um.

species differs similarly from C. roseolus, which has smaller (5.0-6.2 um, most

~5.5 um) punctate globose basidiospores and cheilocystidia that are 32-35 x

6.7-9.3 tum, ventricose in the lower and upper portions and slightly constricted

in the middle, and often with one or two finger-like appendages. Crepidotus

velutinoaffinis differs in its small (2 x 1 mm) stipe (lacking in C. longicystidiatus)

and cheilocystidia, which are 40-61 x 3.8-7 um, cylindric or cylindric-

subclavate to slightly ventricose with apices that are mostly subcapitate or at

least slightly constricted just below the apex or occasionally equal and rounded

or attenuate (rarely acute).

152 ... Capelari

Crepidotus rubrovinosus Bandala et al. (2006), with a reddish or red-wine

pileus described from Mexico, differs in its persistently reddish fimbriate

lamellar edges, oblong/ellipsoid basidiospores with a suprahilar depression and

ornamentation comprising short, broad and sinuous blunt bulges and ridges

that often anastomose to form a subreticulate pattern, and cheilocystidia that

are cylindric-clavate to clavate, narrowly utriform, 35-138(-147) x 3-7(-8)

pum, occasionally septate, sinuous toward the base, apex rounded or subcapitate,

rarely attenuated, and, at times, bifurcate or lobate (Bandala et al. 2006).

Taxonomy—new records

Crepidotus apodus Capelari, Hoehnea 34: 76. 2007.

MATERIAL EXAMINED: BrazIL, SP, Onda Verde, 20°2’08”S 48°49°35”W, 09 December

2008, Capelari 4426 (SP).

COMMENTS: Crepidotus apodus produces many very small yellowish basidiomata

that colonize shrubs on the forest floor. It was described from Parque Estadual

das Fontes do Ipiranga (south of Sao Paulo city), and since its publication,

it has frequently been collected in other protected areas of Sado Paulo State.

Description and illustrations can be found in Capelari (2007).

Crepidotus defibulatus Singer, in Singer & Digilio, Lilloa 25: 410. 1952 [“1951”].

MATERIAL EXAMINED: BRAZIL, SP, Turmalina, 20°00°13”S 50°26’02”W, 27 November

2007, Capelari 4348 (SP).

COMMENTs: Crepidotus defibulatus is one of the few Crepidotus species with

ornamented basidiospores and clampless hyphae. It occurs in Argentina (Singer

1973, type locality) and Sao Paulo State, Brazil (Capelari 2007). Descriptions

can be found in Singer & Digilio (1952), Singer (1973), and Capelari (2007,

with illustrations).

Acknowledgements

The author thanks Dr. Tarciso de Sousa Filgueiras, for assisting with the Latin

descriptions, Dra. Noemia K. Ishikawa, Instituto Nacional de Pesquisas da Amazénia,

for sending some useful literature and Klei Sousa for inking the illustrations. I also thank

Victor M. Bandala, Instituto de Ecologia, Biodiversidad y Sistematica, Mexico, and

M. Catherine Aime, LSU AgCenter, U.S.A., for their careful review of the manuscript,

and Shaun Pennycook for his comments on the manuscript. This study was supported by

Fundagao de Amparo a Pesquisa do Estado de S40 Paulo (FAPESP, grant 04/04820-3).

Literature cited

Bandala VM, Montoya L, Horak E. 2006. Crepidotus rubrovinosus sp. nov. and Crepidotus septicoides,

found in the cloud forest of Eastern Mexico, with notes on Crepidotus fusisporus var. longicystis.

Mycologia 98: 131-140. doi:10.3852/mycologia.98.1.131

Crepidotus spp. nov. (Brazil) ... 153

Bandala VM, Montoya L, Mata M. 2008. Crepidotus crocophyllus found in Costa Rica and

Mexico and revision of related species in subsection Fulvifibrillosi. Mycologia 100: 335-346.

doi: 10.3852/mycologia.100.2.335

Capelari M. 2007. O género Crepidotus no Parque Estadual das Fontes do Ipiranga, S40 Paulo, SP,

Brasil e descrigaéo de duas novas espécies. Hoehnea 34: 75-85.

Hemmes DE, Desjardin DE. 2002. Mushrooms of Hawaii: an identification guide. Ten Speed Press:

Berkeley.

Hesler LR, Smith AH. 1965. North American species of Crepidotus. Hafner Publishing Company:

New York.

Horak E. 1978 [“1977”]. Crepidotus episphaeria and related species from the southern hemisphere.

Berichte der Schweizerischen Botanischen Gesellschaft 87: 227-235.

Imazeki R, Toki S. 1954. Higher fungi of Asakawa Experiment Forest. Bulletin of the Government

Forest Experiment Station 67: 20-71

Kuppers H. 1979. Atlas de los colores. Blume: Barcelona.

Pilat A. 1950. Revision of the types of some extra-european species of the genus Crepidotus Fr.

Transactions of the British Mycological Society 33: 215-249. doi:10.1016/S0007-1536(50)

80077-3

Rick J. 1930. Contributio IV ad monographiam Agaricearum Brasiliensium. Brotéria, Série

Botanica 24: 97-118.

Rick J. 1938. Agarici Riograndenses. Lilloa 3: 399-455.

Rick]. 1961. Basidiomycetes Eubasidii in Rio Grande do Sul - Brasilia 5. Agaricaceae. Iheringia série

Botanica 8: 296-450.

Ripkova S, Aime MC, Lizén P. 2005. Crepidotus crocophyllus includes C. nephrodes. Mycotaxon 91:

397-403.

Senn-Irlet B. 1995. The genus Crepidotus (Fr.) Staude in Europe. Persoonia, 16: 1-80.

Senn-Irlet B, Meijer AAR de. 1998. The genus Crepidotus from the state of Parana, Brazil. Mycotaxon

66: 165-199,

Singer R. 1947. Contribution toward a monograph of the genus Crepidotus. Lilloa 13: 59-95.

Singer R. 1953. Quelques agarics noveaux de lArgentine. Revue de Mycologie 18: 3-23.

Singer R. 1955. Type studies on Basidiomycetes. VIII. Sydowia 9: 367-431.

Singer R. 1973. The genera Marasmiellus, Crepidotus and Simocybe in the Neotropics. Beihefte zur

Nova Hedwigia 44: 1-517.

Singer R. 1989. New taxa and new combinations of Agaricales (Diagnoses fungorum novorum

Agaricalium IV). Fieldiana, Botany, n.s. 21: 1-133.

Singer R, Digilio APL. 1952 [“1951”]. Prédromo de la flora Agaricina argentina. Lilloa 25: 5-461.

MYCOTAXON

Volume 115, pp. 155-162 January-March 2011

DOT: 10.5248/115.155

Pilidiella crousii sp. nov.

from the northern Western Ghats, India

KUNHIRAMAN C. RAJESHKUMAR?’, RAHUL P. HEPAT,

SUBHASH B. GAIKWAD & SANJAY K. SINGH?

National Facility for Culture Collection of Fungi,

MACS’ Agharkar Research Institute, G.G. Agarkar Road, Pune, India

CORRESPONDENCE TO: ! rajeshfungi@gmail.com &? singhsksingh@rediffmail.com

AssTRACT — The coelomycete genus Pilidiella (Schizoparmaceae, Diaporthales) was recently

revised to include species with hyaline to pale brown conidia in contrast to the dark brown

conidia of Coniella. The present paper describes a new species of Pilidiella, P. crousii, based

ona molecular phylogenetic analysis of the ITS nrDNA and its unique conidial morphology.

Pilidiella crousii is associated with severe fruit drop of Terminalia chebula (Combretaceae) in

natural forests of Mahabaleshwar in the Western Ghats of India.

Key worps — anamorphic fungi, plant pathogen, Schizoparme

Introduction

The exploration of microfungal diversity of the Western Ghats, which is one

of the biodiversity hot spots of the world, is the prime goal of the National

Fungal Culture Collection of India (NFCCI). The NFCCI aims to explore

fungi from this region for their biotechnological and bioprospecting potential

(Rajeshkumar et al. 2010; Singh et al. 2009). During July 2010 a routine survey

was conducted to explore the microfungal diversity in the natural forests of

Mahabaleshwar, situated in the northern part of the Western Ghats, India, at

17°58’N and 73°43’E. Discovered during this survey, an interesting species of

Pilidieila Petr. & Syd. was found on fallen fruits of Terminalia chebula, associated

with severe fruit infection followed by fruit drop. The aim of the present study

is to identify the species of Pilidiella associated with fruit drop of Terminalia in

India.

Materials & methods

ISOLATES AND MORPHOLOGY — Conidiomata of the fungus were directly isolated

from the surface of fallen fruits and observed under a Nikon Binocular stereo microscope

156 ... Rajeshkumar & al.

(Model SMZ — 1500 with Digi-CAM, Japan). Single conidial cultures were established

on 2% Potato Dextrose Agar plates (PDA; Crous et al. 2009). For morphotaxonomic

studies and photomicrographs an Olympus CX-41 (Japan) microscope was used.

Conidia and conidiomata were mounted in lactic acid cotton blue and measured using

an ocular micrometer, with 30 observations per structure. Colony characteristics in

culture were studied on different media, viz. 2% Malt Extract Agar (MEA), Potato

Carrot Agar (PCA), and PDA (Crous et al. 2009). Herbarium specimens were deposited

in Ajrekar Mycological Herbarium (AMH); the culture was accessioned and preserved

in the National Fungal Culture Collection of India (WDCM-932), Agharkar Research

Institute, Pune, India.

POLYMERASE CHAIN REACTION AND SEQUENCING — Total DNA was extracted from

cultures grown on PDA plates for two weeks at 25 °C, using a DNA extraction kit as

per the manufacturer’s instructions (MP Biomedicals GmbH, Germany). Fragments

containing the region encoding the ITS 1-5.8S-ITS 2 were amplified using primer pairs

ITS4 (5’-TCC TCC GCT TAT TGA TAT GC-3’) and ITS5 (5°-GGA AGT AAA AGT

CGT- AAC AAG G-3’) (White et al. 1990). PCR was performed in a 25 ul reaction

using 2 ul of template DNA (10 ng - 25 ng), 0.5 U of Taq DNA polymerase (Genei,

Bangalore, India), 2.5 ul of 10OX Taq DNA polymerase buffer, 0.5 ul of 200 uM of each

dNTPs (Genei, Bangalore, India), 0.5 ul of 10 pmol primer, H,0 (Sterile Ultra Pure

Water, Sigma) qsp 25 yl. Amplification was performed on an Eppendorf Mastercycler

AG using the following parameters: 5 min step at 95 °C, followed by 30 cycles of 1 min

at 95 °C, 30s at 56 °C and 1 min at 72 °C for ITS region amplification, then a final 7 min

extension step at 72 °C. The PCR products were purified with Axygen PCR cleanup kit

(Axygen Scientific Inc, CA, USA) and sequenced using the BigDye Terminator v3.1

Cycle Sequencing Kit (Applied Biosystems, USA). The sequencing reactions were run

on an ABI 3100 automated DNA sequencer (Applied Biosystems, USA).

SEQUENCE ALIGNMENT AND PHYLOGENETIC ANALYSIS — Sequence alignment of

partial ITS1-5.8S-ITS2 of B crousii was performed manually using the text editor option

of the software Molecular Evolutionary Genetics Analysis (MEGA) software v4.0.

(Tamura et al. 2007). The manually edited sequences of NFCCI 2213 were deposited

in the NCBI sequence nucleotide database (HQ264189). They were also subjected to a

BLAST search. The partial ITS sequences were aligned using Clustal W together with

the homologous regions of ITS of closely related species of Pilidiella and Schizoparme

Shear. For ITS, the matrix was analyzed with the Maximum Parsimony method using

the Tamura model (Tamura et al. 2007) to calculate the sequence divergence, and

the bootstrap consensus tree inferred from 1000 replicates is taken to represent the

evolutionary history of the taxa analyzed. All positions containing gaps and missing

data were eliminated from the dataset (Complete Deletion option).

Results

DNA pHyYLoGcENy — For the phylogenetic analysis of the genus Pilidiella,

the alignment of 557 bp of the ITS sequence data included 450 positions in the

final data set. The analysis of ITS1-5.8S-ITS2 sequence presented here (Fic.

1) reveals a significant association of Schizoparme and its anamorphic genus

Pilidiella. The phylogenetic analysis based on ITS sequences resulted in four

Pilidiella crousii sp. nov. (India) ... 157

66 ) AY339344.1| Pilidiella quercicola

DQ914688.1| Pilidiella quercicola

AB465200.1| Pilidiella sp. B8-71

AY339348.1| Schizoparme straminea

AY339330.1| Pilidiella diplodiella

AY339331.1| Pilidiella diplodiella

AY339334.1| Pilidiella diplodiopsis

AY339333.1| Pilidiella diplodiopsis

EU301051.1| Pilidiella diplodiella

\_ AY339346.1| Pilidiella sp. STE-U 3828

HQ117851.1| Pilidiella sp. E8514b

FN908875.1| Pilidiella granati

AY339342.1| Pilidiella granati

(eee Pilidiella eucalyptorum

EU301050.1| Pilidiella eucalyptorum

AY339340.1| Pilidiella eucalyptorum

AY339343.1| Pilidiella macrospora

AF265658.1| Cryphonectria cubensis

100

Fic. 1. Phylogenetic tree based on aligned internal transcribed spacer sequences of Schizoparme

and its anamorphic species of Pilidiella. The consistency index is (0.660000), the retention index

is (0.821053), and the composite index is 0.674127 for all sites and parsimony-informative sites.

The percentage of replicate trees in which the associated taxa clustered together in the bootstrap

test (1000 replicates) is shown next to the branches. The MP tree was obtained using the Close-

Neighbour-Interchange algorithm with search level 3 in which the initial trees were obtained with

the random addition of sequences (10 replicates). The tree is drawn to scale; with branch lengths

calculated using the average pathway method and are in the units of the number of changes over

the whole sequence.

major clades, P diplodiella (Speg.) Crous & Van Niekerk, P. diplodiopsis Crous

& Van Niekerk, P quercicola (Oudem.) Petr. and S. straminea Shear clustered

together and formed a major group. Pilidiella eucalyptorum Crous & M.J.

Winef. formed a unique clade (100% similarity). P macrospora (71% similarity)

clustered as a unique clade. The new species, P. crousii, clustered with Pilidiella

sp. (HQ 117851.1) (52% similarity), which was sister to PB granati (Sacc.) Aa.

Cryphonectria cubensis (Bruner) Hodges was chosen as outgroup, as it belongs

to the Cryphonectria-Endothelia complex that is allied to the Schizoparme

complex (Castlebury et al. 2002).

158 ... Rajeshkumar & al.

TAXONOMY — Based on a DNA comparison with other species currently

in GenBank (Fic. 1), and its unique morphological characters (Fic. 2), such

as the highly variable conidial shape, size and length-width ratio, the species

of Pilidiella from Terminalia can be distinguished from the other taxa in this

genus, and hence is described as new to science.

Pilidiella crousii Rajeshkumar, S.K. Singh & Hepat, sp. nov. Fic. 2

MycoBank MB 518897

In fructis. Pycnidia globosa vel subglobosa, 124-280 x 115-190um, laeves, pariete

mutltitunico ex 2-4 stratis et textura angulari. Conidiophora 15-25 x 2.5-3 um, simplicia

velramose. Cellulae conidiogenae 6-12 x 2-3um, simplices, laeves. Conidia primo hyalinia,

deinde pallida vel modice brunnea, forma et amplitudine valde variabilibus, laevia,

ellipsoidea vel anguste ellipsoidea, apice acute rotundato vel subobtuso, basi truncata,

(6-)7-12(-13.5) x (2.5-)3-5 um (plus minusve 9.5 x 4.0 um), ratione longitudinis/

latitudinis = 2.2-2.3.

Hototyee: India, Mahabaleshwar, Western Ghats, Maharashtra, on fallen fruits of

Terminalia chebula (Combretaceae) July 2010, K.C. Rajeshkumar (AMH 9406; ex-type

culture NFCCI 2213.)

ETYMOLOGY: ‘crousii? named in honour of Prof. dr. Pedro W. Crous, Director,

Centraalbureau voor Schimmelcultures, Fungal Biodiversity Centre, Utrecht, The

Netherlands, for his scientific contribution to this fungal group.

On fruits, forming pustule-like structures erupting through pericarp, scattered

over fruit surface; conidiomata aggregated in a dark reddish brown mass.

Conidiomata pycnidial, globose to sub-globose, 124-280 x 115-190 um,

smooth; wall of textura angularis, initially hyaline, becoming pale to medium

brown, consisting of 2-4 layers. Conidiophores developing from a basal or

central, hyaline cushion of cells, simple or branched, densely packed, encased

in mucous, 15-25 x 2.5-3 wm. Conidiogenous cells simple, smooth, 6-12 x

2-3um. Conidia initially hyaline, becoming pale to medium brown when

mature, smooth, highly variable in shape and size, straight, occasionally slightly

curved, ellipsoidal to narrowly ellipsoidal, with subobtuse apex and base or

truncate base in a few conidia, but acutely rounded apices also present in

others, bi- to multiguttulate, (6-)7-12(-13.5) x (2.5-)3-5 um (mean 9.5 x 4.0

um), length-width ratio = 2.2-2.3.

TELEOMORPH: Unknown; no sexual state or fungus resembling Schizoparme

was present on any specimen examined.

Colonies on PDA fast growing, 79 mm diam after 7 days and 90 mm diam

after 10 days, white initially, later turning pale brown to dark brown, floccose,

reverse pale to dark brown. Colonies on MEA fast growing, 80 mm diam after

7 days, initially white, brownish when mature, margin irregular, reverse dark

gray-brown. Colonies on PCA fast growing, 60 mm diam after 7 days, pale

brown margin regular, colonies reverse dark brown.

Pilidiella crousii sp. nov. (India) ... 159

: &

Fic. 2. Pilidiella crousii (holotype). a. Fallen fruits of Terminalia chebula. b-d. Conidiomata on

fruits. e-h. Pycnidia in culture. i. Conidiophores developing from basal pad of tissue. j. Pycnidial

wall. k-. Variable shaped conidia. Bars: k, | = 10 um.

160 ... Rajeshkumar & al.

Discussion

Petrak & Sydow (1927) established the genus Pilidiella with hyaline to pale

brown conidia, differentiating it from Coniella Hohn., which has dark brown

conidia. Later, von Arx (1957, 1972) also supported the differentiation of these

genera based on their conidial pigmentation. However, Sutton (1980) and Nag

Raj (1993) treated Pilidiella as a synonym of Coniella.

Castlebury et al. (2002) determined that Pilidiella with its teleomorph

Schizoparme formed a distinct lineage within the Diaporthales, representing

a genus separate from Coniella. Later, Van Niekerk et al. (2004) conducted an

extensive study of the group, including a thorough molecular analysis based

on ITS, EF1-a and LSU gene sequence data. Based on all three data sets, they

confirmed the separation of Pilidiella (typified by P. quercicola (Oudem.) Petr.

[=P castaneicola]) from Coniella (typified by C. pulchella Hohn. [= C. fragariae]).

Pilidieila is characterized by having species with hyaline to pale brown conidia

with a length-width ratio >1.5 in contrast to dark brown conidia of Coniella

with length-width ratio <1.5.

Samuelsetal. (1993) linkedseveralspecies of Coniellato speciesof Schizoparme,

which they regarded as a member of Diaporthales (Melanconidaceae).

However, Castlebury et al. (2002) suggested that the Schizoparme-complex is

representative of an undescribed family in the Diaporthales, with Coniella and

Schizoparme-Pilidiella as separate genera. In a further study, Rossman et al.

(2007) established Schizoparmaceae Rossman (type genus: Schizoparme) to

accommodate these genera, with diagnostic characteristics “Ascomata fusca

vel nigra, collapsa, erumpentia, superficialentia. Asci annulo apicali distincto

praediti, ad maturitatem separati, paraphyses nullae. Ascosporae non septatae”.

The pycnidial anamorphs of this family are Coniella and Pilidiella. The type

species of Schizoparme is S. straminea, which is linked to the anamorph Pilidiella

castaneicola (Ellis & Everh.) Arx. In contrast with the Schizoparme teleomorphs

associated with Pilidiella, no teleomorph has thus far been reported for Coniella

(Rossman et al. 2007).

In India, Sharma et al. (1985) studied the genus Coniella from Eucalyptus

plantations in Kerala State. They reported C. castaneicola (Ellis & Everh.)

B, Sutton and C. fragariae (Oudem.) B. Sutton causing a leaf spot disease in

E. grandis and E. tereticornis. Van Niekerk et al. (2004) pointed out that the

isolates from Eucalyptus treated as C. fragariae should be recognized as

P. eucalyptorum. Coniella granati (Sacc.) Petr. & Syd. was reported as a saprobe

on leaf litter of Tectona grandis (Mary & Sankaran 1991; Sankaran 1994).

Rajeshkumar (2007) explored the pathogenic microfungal diversity in natural

forests in the Kerala part of the Western Ghats, and reported four species of

Coniella: C. australiensis Petr. on Macaranga peltata, C. minima B. Sutton &

Thaung on Garcinia gummi-gutta, C. petrakii B. Sutton on Careya arborea and

Syzygium caryophyllatum, and C. fragariae on more than 10 different hosts

plants in natural forests.

Pilidiella crousii sp. nov. (India) ... 161

Coniella spp. have been reported as important foliar pathogens of Terminalia

spp. in India. Conieila terminaliae (Firdousi et al. 1994) was identified as a new

species causing necrotic spots on Terminalia tomentosa (IMI 823384) from

the forests of Gopalpura (Sagar), Madhya Pradesh. This species is close to

C. fragariae in shape and colour of its pycnidia and conidia, but its conidia are

smaller (2—8 x 3—5 pm) and globose to subglobose in shape. Rajeshkumar

(2007) also recorded foliar diseases caused by Coniella fragariae on Terminalia

chebula and T. paniculata in natural forests of Kerala. Coniella macrospora (van

der Aa 1983) is the only species under this genus so far recorded on Terminalia

ivorensis from the Ivory Coast, but its conidia are much larger, (18.3-)25-29

(-32.5) x (13-)16-20(-21.5) um.

In the present study, Pilidiella crousii is proposed as a new species based

on the ITS sequence analysis (Fig. 1) and highly variable shape and size of its

conidia (Fic. 2). The morphological characteristics of P granati differ from

those of the new species. In P granati the conidia are ellipsoidal, 9-16 tm

long, and length- width ratio is 1.9. In PB crousii, the conidia are ellipsoidal

or narrowly ellipsoidal, (6-)7-12(-13.5) um long, with a length -width ratio

of 2.2-2.3. The conidial length-width ratio of P crousii is close to that of P.

diplodieila, but the conidia in P. diplodiella are longer. Also the ITS sequence

analysis clearly differentiates these two species.

Appendix

In their treatment of Pilidiella and Coniella, Van Niekerk et al. (2004)

referred to Coniella macrospora as “Pilidiella macrospora”, but did not make a

valid combination. This combination is proposed here:

Pilidiella macrospora (Aa) Crous & Van Niekerk, comb. nov.

MycoBank MB 517391

BasionymM: Coniella macrospora Aa, Proc. Kon. Ned. Akad. Wetensch., C 86: 121. 1983.

Acknowledgements

We are indebted to Amy Y. Rossman, Systematic Mycology & Microbiology Lab.,

USDA, ARS, Beltsville, U.S.A., and Uwe Braun, Martin-Luther-University, Institute of

Biology, Department of Geobotany and Botanical Garden, Herbarium, Halle (Saale),

Germany, for reviewing this manuscript. Thanks are also due to Department of Science

and Technology (DST), Government of India, New Delhi for providing financial support

under IRHPA programme for setting up the state-of the-art National Facility for Culture

Collection of Fungi (No. SP/SO/PS-55/2005) at MACS’Agharkar Research Institute,

Pune, India and the Director, MACS’ARI for providing facility.

Literature cited

Aa HA van der. 1983. A new species of Coniella. Proceedings of the Koninklijke Nederlandse

Akademie van Wetenschappen, C 86: 121-125.

Arx JA von. 1957. Revision der zu Gloeosporium gestellten Pilze. Verhandelingen der Koninklijke

Nederlandse Akademie van Wetenschappen, Afd. Natuurkunde, 2de Reeks, 51(3). 153 p.

162 ... Rajeshkumar & al.

Arx JA von. 1972. Centraalbureau voor Schimmelcultures, Baarn and Delft, progress report

1971. Verhandelingen der Koninklijke Nederlandse Akademie van Wetenschappen, Afd.

Natuurkunde, 2de Reeks, 61(3): 50-69.

Castlebury LA, Rossman AY, Jaklitsch WJ, Vasilyeva LN. 2002. A preliminary overview of the

Diaporthales based on large subunit nuclear ribosomal DNA sequences. Mycologia 94:

1017-1031. doi:10.2307/3761867

Crous PW, Verkley GJM, Groenewald JZ, Samson RA (eds). 2009. Fungal biodiversity. CBS

Laboratory Manual Series. Centraalbureau voor Schimmelcultures, Utrecht, Netherlands.

Firdousi SA, Sharma CD, Vyas KM. 1994. A new species of Coniella from India. Acta Botanica

Indica 22: 134-135.

Mary MV, Sankaran KV. 1991. Ex-situ decomposition of leaf litters of Tectona grandis, Eucalyptus

tereticornis and Albizia falcataria. Kerala Forest Research Institute Research Report No. 71.

Kerala Forest Research Institute, Peechi, Thrissur, Kerala.

Nag Raj TD. 1993. Coelomycetous anamorphs with appendage-bearing conidia. Waterloo, Ontario:

Mycologue Publications. 1101 p.

Petrak F, Sydow H. 1927. Die Gattungen der Pyrenomyzeten, Sphaeropsideen und Melanconieen. 1.

Teil: Die phaeosporen Sphaeropsideen und die Gattung Macrophoma. Repertorium Specierum

Novarum Regni Vegetabilis 42. 551 p.

Rajeshkumar KC, Singh PN, Yadav LS, Swami VS, Singh SK. 2010. Chaetospermum setosum sp. nov.

from the Western Ghats, India. Mycotaxon 113: 397-404.

Rajeshkumar KC. 2007. Diversity of plant pathogenic fungi in natural forests in the Western Ghats,

India. Ph.D thesis, FRI University, Dehradun, India. 201 p.

Rossman AY, Farr DE, Castlebury LA. 2007. A review of the phylogeny and biology of the

Diaporthales. Mycoscience 48: 135-144. doi:10.1007/s10267-007-0347-7

Samuels GJ, Barr ME, Lowen R. 1993. Revision of Schizoparme (Diaporthales, Melanconidaceae).

Mycotaxon 46: 459-483.

Sankaran, KV. 1994. Fungi associated with the decomposition of teak and Albizia leaf litter in

Kerala. Indian Forester 120(5): 446-454.

Sharma JK, Mohanan C, Florence EJM. 1985. Disease survey in nurseries and plantations of forest

tree species grown in Kerala. Kerala Forest Research Institute Research Report No. 36. Kerala

Forest Research Institute, Peechi, Thrissur, Kerala. 320 p.

Singh SK, Singh PN, Yadav LS, Hepat RP. 2009. A new species of Gonatophragmium from Western

Ghats, India. Mycotaxon 110: 183-187.

Sutton BC. 1980. The Coelomycetes: fungi imperfecti with pycnidia, acervuli, and stromata. Kew,

Surrey, UK: Commonwealth Mycological Institute. 696 pp.

Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis

(MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596-1599. doi:10.1093/

molbev/msm092

Van Niekerk JM, Groenewald JZ, Verkley GJM, Fourie PH, Wingfield MJ, Crous PW. 2004.

Systematic reappraisal of Coniella and Pilidiella, with specific reference to species occurring

on Eucalyptus and Vitis in South Africa. Mycological Research 108: 283-303. doi:10.1017/

$0953756204009268

White TJ, Bruns T, Lee J, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal

RNA genes for phylogenetics. 315-322, in: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds)

PCR protocols: a guide to methods and applications. Academic, San Diego.

MYCOTAXON

Volume 115, pp. 163-169 January-March 2011

DOT: 10.5248/115.163

Calocera bambusicola sp. nov. and C. sinensis

newly recorded from Taiwan

SHENG-Hua Wv%, KELLY SHIH & SHIH-Y1I Yu

Department of Botany, National Museum of Natural Science,

Taichung, Taiwan 404, ROC

CORRESPOND TO *: shwu@mail.nmns.edu.tw

ApstTract — Calocera bambusicola is presented as a new species, based on specimens

collected from rotten culms of bamboo (Pseudosasa usawai) near a sulfur hot spring on

Yangminshan mountain in Yangminshan National Park, Taipei, Taiwan. This new species

morphologically resembles C. sinensis but differs in its much smaller basidiocarps, narrower

basidiospores, much narrower contextual hyphae, and growth on bamboo culms. ITS

differences also separate these two species. A key to species of Calocera with nodose-septate

hyphae is provided, and C. sinensis is newly reported from Taiwan.

Key worps — Dacrymycetaceae, Dacrymycetales, taxonomy

Introduction

The genus Calocera (Fr.) Fr. (Dacrymycetaceae J. Schrot., Dacrymycetales

Henn.) is ecologically saprobic, causing a brown rot in wood. McNabb (1965)

treated twelve species and infraspecific varieties in his worldwide monograph

of Calocera, among which only four species possess clamped hyphae. Reid

(1974), who treated five Calocera species in his monographic survey of British

Dacrymycetales, included a new species, C. pallidospathulata D.A. Reid. Peng et

al. (1992) recognized six species of Calocera from China, including the newly

described species C. mangshanensis B. Liu & L. Fan (Liu & Fan 1989) and

C. morchelloides B. Liu & L. Fan (Liu & Fan 1990). The three species published

after McNabb’s (1965) monographic work all have simple-septate hyphae.

Previous taxonomic study of Calocera was based on morphological analyses.

DNA sequence analyses have never been used to test species delimitations. So

far, only Calocera cornea (Batsch) Fr. and C. viscosa (Pers.) Fr. sequences have

been submitted to the GenBank database (Shirouzu et al. 2009).

In 1999-2001, several specimens of Calocera were collected from rotten culms

of the bamboo species Pseudosasa usawai near a sulfur spring on Yangminshan

164 ... Wu, Shih & Yu

mountain in Taipei, Taiwan. Basidiocarps of these Calocera specimens are

very small and bear nodose-septate hyphae. Morphological and ITS sequence

analyses reveal that these specimens represented an undescribed species,

C. bambusicola, which is described here. Calocera sinensis, which resembles the

new species, is here reported for the first time from Taiwan.

Materials & methods

MorpuHo.tocy — Specimens for this study were collected in Taiwan during 1992-

2007 and are deposited at the herbarium of the National Museum of Natural Science of

ROC (TNM). For microscopic observations, the sections were stained with 1 % aqueous

Phloxine in 5 % KOH. Melzer’s reagent (IKI) was employed to detect amyloidity and

dextrin oidity.

PHYLOGENY — DNA was extracted from dried fruiting body tissue or cultured

mycelia as described in Wu et al. (2007) from eight strains representing six species

(TaBLE 1). Both DNA strands were sequenced by ITS1 and ITS4 primers (White et al.

1990). Consensus data from the forward and reverse sequences were matched using

BioEdit 7.0.4.1 (Hall 1999). Alignment was performed using Clustal X 1.83 (Thompson

et al. 1997) and adjusted by hand also using BioEdit 7.0.4.1. The optimized alignment

file was analyzed by maximum parsimony (MP) in PAUP 4.0b10 (Swofford 2003). The

analytical parameter preferences are described in Wu et al. (2007). Bootstrap analysis

(Hillis & Bull 1993) was performed with 1,000 replicates with random addition

sequences to obtain estimates of the reliability of the nodes.

TABLE 1. Taxa used in this study, along with their strain/specimen numbers,

origins and GenBank accession numbers.

SPECIES* : STRAIN/SPECIMEN NO. : ORIGIN ! GENBANK ACCESSION NO.

Calocera bambusicola Wa 9910-12 Taipei, Taiwan i FJ195751

C. cornea Wa 0606-1 Taichung, Taiwan : FJ195752

C. sinensis ?Wu 0703-6 Nantou, Taiwan ?FJ195754

C. sinensis Wu 0505-3 'Nantou, Taiwan Wu 0505-3

C. sinensis :JCH 070726 :Chiayi, Taiwan iFJ195755

C. viscosa ?Wu 9905-30 : Taichung, Taiwan ?FJ195756

Dacrymyces sp. ?FPL8953 ‘USA DQ205684

Guepiniopsis buccina : AFTOL-ID 888 Washington, USA :DQ206986

Taxon names in bold indicate sequences from this study.

Taxonomy

Key to five species of Calocera with nodose-septate hyphae

1a. Basidiospores 1=septate ces scoce-wsscee soon aged deere matmie ieonanudlin dipie sont nh Sweeping Hees 2

1b. Basidiospores 1-3-septate. 0.0... cece nent tenn ee eens 4

2a. Basidiocarps tiny, shorter than 1.5 mm; contextual hyphae 1.5-3.3 um diam.;

basidiospores mostly narrower than 4.3 um...............0000% C. bambusicola

2b. Basidiocarps 3-25 mm high; contextual hyphae 3-7.5 um diam.;

basidiospores wider than 4.3 Um 0.0.0... eee eee cnet nee een eee 3

Calocera bambusicola sp. nov. (Taiwan) ... 165

3a. Basidiocarps large, up to 25 mm high; clamped dikaryophyses lacking

eis eee eva so4 ely bg ak guia sched pel ale GRE baat Gad coh el C. fusca Lloyd

3b. Basidiocarps smaller, rarely exceeding 10 mm high; clamped dikaryophyses

PAEESENE I Lie, he a ete pehcer yl aiate ceive hegeranaMegelneyt slate ght dhgty ie ale IG ce Laven ssa C. sinensis

4a. Basidiocarps cylindrical, spathulate, petaloid, or palmately lobed;

basidiospores 11-15.5 um long.................000.0 08 C. guepinioides Berk.

4b. Basidiocarps subulate or fusiform; basidiospores 13.5-17.5 um

LOTT Caper oat torah nl kets es, ath Manley dbetl aes etetns Shetanh ee C. macrospora Brasf.

Fic. 1. Basidiocarps of Calocera bambusicola (Wu 9910-10). (scale bar = 1 cm).

Calocera bambusicola Sheng H. Wu, sp. nov. Fic. 1,2 a-c

MycoBank MB 516557

Basidiocarpi gregarii, aurantiaci, simplices, clavati vel cylindrici, 0.1-0.3 mm diametro,

ad 1.5 mm alti. Hyphae fibulatae. Cystidia desunt. Probasidia subclavata, 20-35 x 4-5

um, deinde bifurcate. Basidiosporae ellipsoidea, 9-12 x 3.3-4.5 um, 1-septatae, laeves,

tenuitunicatae.

HoLotypPe — Taiwan. Taipei City: Yangminshan National Park, Hsiaoyukeng, 25° 11

N 121°33°E, alt. 700 m, on culm of Pseudosasa usawai, leg. S.H. Wu et al., Oct. 23, 1999,

Wu 9910-10 (TNM F9942).

EryMoLocy — referring to the habitat of this species.

Basidiocarps gregarious, yellow-orange when fresh, orange-brown when dry,

gelatinous-cartilaginous when soaked, corneous when dry, simple, clavate or

cylindrical, terete or slightly flattened, unbranched, apically blunt, 0.1-0.3 mm

diam., up to 1.5 mm high. Hymenium amphigenous, surface smooth. Context

with dense texture; hyphae nodose-septate, colorless, 1.5-3.3 um diam., walls

thin or up to 0.5 um diam. Cystidia lacking. Probasidia subclavate, 20-35 x

4-5 um, becoming bifurcate. Basidiospores ellipsoid, adaxially concave, slightly

166 ... Wu, Shih & Yu

curved, colorless, 9-12 x 3.3-4.5 um, smooth, thin-walled, with one septum

when mature, bearing a distinct apiculus, IKI-, germination not seen.

EcoLocy & DisTRIBUTION — All specimens of Calocera bambusicola were

collected from culms of Pseudosasa usawai, beside a sulfur spring; so far known

only from northern Taiwan.

ADDITIONAL SPECIMENS EXAMINED — Taiwan. Taipei City: Yangminshan National

Park, Hsiaoyukeng, 25° 11’ N 121°33’E, alt. 700 m, on culm of Pseudosasa usawai, leg.

S.H. Wu et al., Oct. 23, 1999, Wu 9910-12 (INM F9943); Dec. 30, 1999, Wu 9912-19

(TNM F10187), Wu 9912-20 (TNM F10188), Wu 9912-24 (TNM F10189); Oct. 30,

2000, Wu 0010-205 (TNM F12263); Jun. 15, 2001, Wu 0106-18 (TNM F13446), Wu

0106-19 (TNM F 13447), Wu 0106-24 (TNM F13449).

Remarks — Calocera bambusicola is distinct from other species of this genus

in having very tiny basidiocarps and by growing on culms of bamboo. This

new species resembles C. sinensis in having clamped hyphae and similar

basidiospores, but differs in having much smaller basidiocarps, narrower

basidiospores, and much narrower contextual hyphae.

Calocera sinensis McNabb, New Zealand J. Bot. 3: 36. 1965. Fic. 2 D-G

Basidiocarps gregarious, yellow to orange when fresh, orange-brown when dry,

gelatinous-cartilaginous when soaked, corneous when dry, simple, cylindrical-

clavate or spathulate, rarely branched, apically blunt or rarely pointed,

0.5-1.5 mm diam., up to 8mm high. Hymenium amphigenous, surface smooth.

Context with dense texture; hyphae nodose-septate, colorless, 3-7 um diam.,

with 0.5-2 um thick walls. Cystidia lacking. Hyphidia simple or branched.

Probasidia subclavate, 25-40 x 3-4 um, becoming bifurcate. Basidiospores

ellipsoid, adaxially concave, slightly curved, colorless, 9-13 x 4.3-5.5 um,

smooth, thin-walled, with one septum when mature, bearing a distinct apiculus,

IKI-, germination by conidia or by germ tubes.

EcoLocy & DisTRIBUTION — This species grows on both gymnosperms

and angiosperms in Taiwan, and causes a wood brown rot. Known from China

(McNabb 1965, Peng et al. 1992) and Taiwan (this study).

SPECIMENS EXAMINED — Taiwan. Taoyuan Hsien: Takuanshan, alt. 1,500 m, on log, leg.

S.H. Wu & S.W. Chou, 20 Jul 1999, Wu 9907-7 (TNM F9939). MIAOLI HSIEN: Kuanwu-

Hsuehchien, Peikenghsi Abandoned Trail, 24° 27’ N 121°03’ E, alt. 1800 m, on wood, leg.

WN. Chou, 9 Oct 1995, CWN 01311 (TNM F4397). Taichung Hsien: Anmashan, 24° 16’

N 120°00’ E, alt. 2,250 m, on trunk of gymnosperm, leg. SH. Wu & H.J. Chan, 8 Nov

1997, Wu 9711-30 (TNM F9382); on rotten trunk of angiosperm, leg. S.H. Wu et al., 10

May 1999, Wu 9905-25 (TNM F9937); Tashueishan Forest Road, alt. 1200 m, leg. S.Z.

Chen, 31 May 1999, Chen 865 (TNM F9919). Nantou Hsien: Hsitou, 23° 40’ N 120°47’

E, alt. 1200 m, on stump of Cryptomeria japonica, leg. S.H. Wu, 19 Jun 1993, Wu 9306-11

(TNM F1054), Wu 9306-12 (TNM F1050); on stump of Cryptomeria japonica, leg. S.H.

Wu, 27 Jul 1993, Wu 9307-78 (TNM F1243); on trunk of Cryptomeria japonica, leg. S.H.

Wu, 6 Apr 1997, Wu 9704-19 (INM F8604); on rotten wood of gymnosperm, leg. S.H.

Calocera bambusicola sp. nov. (Taiwan) ... 167

Fic. 2. Calocera bambusicola (Wu 9910-10: A-C); C. sinensis (Chen 865: D-G). Contextual

hyphae (A, D); hyphidia (E); basidia (B, F); basidiospores (C, G). (scale bars = 10 um).

Wu, 3 May 2005, Wu 0505-3 (TNM F18731); on branch of gymnosperm, leg. S.H. Wu

& S.Z. Chen, 6 Jul 2007, Wu 0703-6 (TNM F20958); Sunlinhsi, 23° 38’ N 120°47’ E, alt.

1700 m, on fallen branch of Cryptomeria japonica, leg. S.H. Wu, 1 Jul 1992, Wu 9207-42

(TNM F0272); 19 Sep 1992, Wu 9209-88 (TNM F0361); Yushan National Park, Tatachia,

23° 29° N 120°54’ E, alt. 2600 m, on decorticated branch of angiosperm, leg. S.H. Wu, 25

Nov 1993, Wu 9311-106 (TNM F1520). Ilan Hsien: Chilanshan, 24° 41’ N 121°28’ E, alt.

400 m, on wood of angiosperm, leg. S.H. Wu, 18 Nov 1992, Wu 9211-17 (INM F0486).

REMARKS — Calocera sinensis has only been reported from China (McNabb

1965, Peng et al. 1992). In Taiwan, this species was collected from temperate

to subtropical belts and is fairly common. Calocera fusca is allied to C. sinensis,

but differs from the latter in having larger basidiocarps and lacks clamped

dikaryophyses. Calocera fusca was reported from New Zealand, Australia, and

Juan Fernandez Islands (McNabb 1965), and China (Peng et al. 1992). However,

further study should be performed to evaluate the importance of the features

used for separating these two species.

Results and discussion on analysis of the ITS region

Amplification of the ITS region yielded PCR products approximately 530 bp

long. The final alignment of the 8 sequences included 533 positions. Excluding

the ambiguous sites at both ends, 452 sites were used for the MP analysis. Only

168 ... Wu, Shih & Yu

Calocera sinensis

Calocera sinensis Wu 0703-6

Calocera sinensis Wu 0505-

Calocera bambusicola Wu 9910-

Calocera viscosa Wu 9905-

Calocera cornea Wu 0606-

Dacrym yces sp.

Guepiniopsis buccina DQ206986

Fic. 3. The most parsimonious tree derived from ITS DNA sequence data. Bootstrap values

are shown at nodes supported by no less than 50% from 1000 replicates. TL = 293, CI = 0.846,

RI = 0.724.

one most parsimonious tree (293 steps, CI = 0.846, RI = 0.724) was retained

in this analysis. Of the 452 included sites, 264 were constant, 96 were variable

but parsimoniously uninformative, and 92 were parsimoniously informative.

Bootstrap percentages were assigned above the branches. Three strains of

C. sinensis were clustered together with 100% bootstrap support, and they were

further clustered together with C. bambusicola, supported by a 51% bootstrap

value (Fic 3).

Calocera bambusicola sp. nov. (Taiwan) ... 169

The phylogenetic analysis indicates that the two species with clamp

connections (C. bambusicola, C. sinensis) are more closely allied to each other

than to two other species without clamp connections (C. cornea, C. viscosa).

The three studied C. sinensis strains are identical in the alignment matrix of

the 452 sites, after excluding the ambiguous sites at both ends. However, there

were 32 transition, 49 transversion, and 29 deletions between C. bambusicola

and C. sinensis, showing a 23.34% difference between the two species. Our

ITS sequence analysis strongly supports C. bambusicola as independent from

C. sinensis.

Acknowledgements

The author is indebted to Dr. Nils Hallenberg and Dr. Peter Roberts for reviewing

this paper, also to Ms. S.Z. Chen and Mr. WN. Chou for contributing some collections

for this study. This study was supported by the National Science Council of ROC

(No. NSC 97-2621-B-178-001) and National Agriculture Council of ROC (No. 97AS-

11.1.2-FB-e2).

Literature cited

Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program

for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41: 95-98.

Hillis DM, Bull JJ. 1993. An empirical test of bootstrapping as a method for assessing confidence in

phylogenetic analysis. Syst. Bio. 42: 182-192.

Liu B, Fan L. 1989. Two new species of Dacrymycetaceae from China. Acta Mycol. Sin. 8: 22-24.

Liu B, Fan L. 1990. New species and new variety of Dacrymycetaceae in China. Acta Mycol. Sin.

9: 12-19.

McNabb RER.1965. Taxonomic studies in the Dacrymycetaceae II. Calocera (Fries) Fries. New

Zealand J. Bot. 3: 31-58.

Peng, YB, Liu B, Li F. 1992. Flora Fungorum Sinicorum vol. 2. Tremellales et Dacrymycetales.

Science Press, Beijing, 151 pp. + 2 pls.

Reid DA. 1974. A monograph of the British Dacrymycetales. Trans. Brit. Mycol. Soc. 62: 433-494.

doi: 10.1016/S0007-1536(74)80060-4

Shirouzu T, Hirose D, Tokumasu S. 2009. Taxonomic study of the Japanese Dacrymycetes. Persoonia

23: 16-34. doi:10.3767/003 158509X468443

Swofford DL. 2003. PAUP* - Phylogenetic Analysis Using Parsimony (*and Other Methods).

Version 4. Sinauer Associates, Massachusetts.

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTAL X windows

interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.

Nucl. Acids Res. 25: 4876-4882.

White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal

RNA genes for phylogenetics. In Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds), PCR

Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, pp.

315-322.

Wu SH, Wang DM, Tschen E. 2007. Brunneocorticium pyriforme, a new corticioid fungal

genus and species belonging to the euagarics clade. Mycologia 99: 302-309. doi:10.3852/

mycologia.99.2.302

MYCOTAXON

Volume 115, pp. 171-173 January-March 2011

DOT: 10.5248/115.171

Stachybotrys subreniformis, new from soil in China

Q1-Ru1 Li & Yu-LAN JIANG*

Department of Plant Pathology, Guizhou University, Guiyang, Guizhou, 550025, China

*CORRESPONDENCE TO: yljchsd@163.com

AssTRACT — A new species of Stachybotrys from soil in China, S. subreniformis, is illustrated

and described. It differs from similar species mainly by producing smaller conidia and

shorter conidiophores. The type specimen (dried culture) and living culture are deposited in

the Plant Pathology Herbarium of Guizhou University (HGUP).

Key worps — soil fungi, taxonomy, dematiaceous hyphomycetes

Introduction

During an investigation of soil dematiaceous hyphomycetes in Guizhou

Province, Southwestern China in 2009, one isolate possessing the typical

characters of Stachybotrys Corda was obtained from forest soil and found to

differ from described species of Stachybotrys in conidial and conidiophore

morphology. The new taxon is illustrated and described below.

Materials & methods

Fifteen soil samples were collected from Duyun, Guizhou Province. The methods of

sample collection, isolation and identification of fungi, and preparation of dried cultures

were as previously reported by Jiang & Zhang (2007). Conidia and conidiophores

were placed in a drop of 85% lactic acid and examined and photographed using light

microscopy. Thirty mature conidia and phialides were measured by using a UB200i

microscope (Chongqing UOP Photoelectric Technology Co., China) at 1000x

magnification. The fungi are described from cultures grown at 25°C on corn meal agar

(CMA).

Taxonomy

Stachybotrys subreniformis Q.R. Li & Y.L. Jiang, sp. nov. FIG. 1 A-B

MycoBank MB 519085

Coloniae effusae, densae, pilosae, griseae vel nigrae. Mycelium superficiale vel immersum.

Hyphae hyalinae, ramosae, septatae, laeves, 5-7 um crassae. Conidiophora macronemata,

mononemata, erecta vel flexuosa, ramosa, septatae, hyalinae vel artobrunnea, 48-98 x

172 ... Li & Jiang

- eon = _

Fic. 1a—B. Conidia and conidiophores of Stachybotrys subreniformis. (Bars = 20 um)

5.0-7.5 um. Phialides brunnea, obovatae, laeves, 8.0-11.5 x 4.5-6.0 um. Conidia sphaerica

vel reniformia, aseptata, atrobrunnea, verruculosa, 6.0-9.5 x 4.5-7.5 um.

Ho.orype: CHINA. GuizHou Province, Duyun, from forest soil, 15 December 2009,

QR. Li, HGUP,,1051.

EryMOLoGy: in reference to the slightly reniform shape of many of the conidia.

CoLontgs on CMA effuse, dense, hairy, grey to black, colourless at first, then

becoming dark with production of abundant anamorphic structures. MYCELIUM

superficial and immersed: hyphae hyaline, branched, septate, smooth, 5-7 um

wide. CONIDIOPHORES macronematous, mononematous, erect or flexuous,

branched, septate, hyaline to dark brown, 48-98 x 5.0-7.5 um, tapering toward

the apex which bears terminal phialides in a whorl of 2-7 around a central

phialide. PHIALIDEs brown, obovate, smooth, 8.0-11.5 x 4.5-6.0 (av. 9.3 40.9 x

5.3 + 0.4, n= 30) um, with conspicuous collarettes. ConIpIA aggregated in slimy

masses, spherical or slightly reniform, nonseptate, dark brown, verruculose,

6.0-9.5 x 4.5-7.5 (av. 7.6 + 1.0 x 6.1 + 0.8, n = 30) um.

In the key to Stachybotrys species (Pinruan et al. 2004), seven species

produced reniform conidia. They are S. nephrodes McKenzie (McKenzie 1991),

S. sinuatophora Matsush. (Matsushima 1971), S. reniverrucosa Whitton et al.

(Whitton et al. 2001), S. nephrospora Hansf. (Hansford 1943), S. reniformis

Tubaki (Tubaki 1963) and S. renisporoides K.G. Karand. et al. (Karandikar et

al. 1992) and S. oenanthes M.B. Ellis (Ellis 1971). However, only S. oenanthes

produces ovoid to reniform conidia, which is very close to S. subreniformis.

Conidia of S. subreniformis (6.0-9.5 x 4.5-7.5 tym) are smaller than those of

S. oenanthes (9-12 x 4.5-8 um). In addition, the conidiophores of S. subreniformis

(48-98 wm) are shorter than those of S. oenanthes (up to 190 um).

Acknowledgments

The authors are grateful for pre-submission comments and suggestions provided by

Dr. E.H.C. McKenzie, Dr D.W. Li, and Prof. Y.L. Guo. This project was supported by the

National Science Foundation of China (no. 31060005).

Stachybotrys subreniformis sp. nov. (China) ... 173

Literature cited

Ellis MB. 1971. Dematiaceous hyphomycetes. X. Mycological Papers 125: 1-30.

Hansford CG. 1943. Contributions towards the fungus flora of Uganda. V. Fungi imperfecti.

Proceedings of the Linnean Society of London 155: 34-67. doi: 10.1111/j.1095-8312.1943.

tb00340.x

Jiang YL, Zhang TY. 2007. Notes on soil dematiaceous hyphomycetes from Shennongjia

Natural Conservation Area, Hubei Province I. Mycosystema 26(1): 17-21. doi: CNKI:SUN:

JWXT.0.2007-01-004

Karandikar KG, Kulkarni SM, Patwardhan PG. 1992. Some new and interesting hyphomycetes

from India. Biovigyanam 18(2): 78-81.

Matsushima T. 1971. Mycological reports from New Guinea and the Solomon Islands. 7. Some

interesting fungi imperfecti. Bulletin of the National Science Museum, Tokyo, 14: 460-480.

McKenzie EHC. 1991. Dematiaceous hyphomycetes on Freycinetia (Pandanaceae). 1. Stachybotrys.

Mycotaxon 41: 179-188.

Pinruan U, McKenzie EHC, Jones EBG, Hyde KD. 2004. Two new species of Stachybotrys, and a key

to the genus. Fungal Diversity 17: 145-157.

Tubaki K. 1963. Notes on the Japanese hyphomycetes. I. Chloridium, Clonostachys, Ishmospora,

Pseudobotrytis, Stachybotrys and Stephanoma. Transactions of the Mycological Society of Japan

A: 83-90.

Whitton SR, McKenzie EHC, Hyde KD. 2001. Microfungi on the Pandanaceae: Stachybotrys, with

three new species. New Zealand Journal of Botany 39: 489-499. doi: 10.1080/0028825X.2001

-9512752

MYCOTAXON

Volume 115, pp. 175-181 January-March 2011

DOT: 10.5248/115.175

New species Koorchaloma and Ciliochorella

from xeric forests in Argentina

NATALIA ALLEGRUCCI*, LORENA ELIADES, MARTA CABELLO

& ANGELICA ARAMBARRI

Instituto de Botanica Spegazzini, Facultad de Ciencias Naturales y Museo,

Universidad Nacional de La Plata, 53 # 477, La Plata (1900),

Provincia de Buenos Aires, Argentina

* CORRESPONDENCE TO: nataliaallegrucci@yahoo.com

AssTRACT— Two new species, Koorchaloma scutiae and Ciliochorella buxifoliae, isolated

from leaf litter of Scutia buxifolia forest are described, illustrated, discussed, and compared

with similar species. The specimens were collected in Magdalena, Buenos Aires province,

Argentina. The type specimens are deposited in LPS. Keys are provided to all species of both

genera.

Key worps— anamorphic fungi, taxonomy

Introduction

Xeric forests dominated by Scutia buxifolia Reissek (Rhamnaceae) and Celtis

tala Gillies ex Planch. (Ulmaceae) represent the most important woodland

community (“La Pampa”) in the eastern plains of Buenos Aires Province,

Argentina (South America). They range from the banks of the Parana River to

the suburbs of Mar Chiquita town. The District of Magdalena has one of the

most well preserved native forest areas, with an environmental heterogeneity

that determines the variability in vegetation composition. Wooded ranges

run parallel to the La Plata River, where the forest grows on highly calcareous

substrates derived from Quaternary sea transgressions and regressions (Sanchez

et al. 1976).

Several works have examined the fungal communities on decaying leaf litter

of Scutia buxifolia and Celtis tala (Allegrucci et al. 2004, 2005, 2007; Crous

et al. 2005). Yanna et al. (2001) noted that fungal species composition varies

according to the different hosts and sites, which is particularly evident in the

xeric forests of the Buenos Aires province (Allegrucci et al. 2009). This paper

176 ... Allegrucci & al.

describes two new species, Koorchaloma scutiae and Ciliochorella buxifoliae,

recently recovered from S. buxifolia leaf litter during biodiversity surveys of

this region.

Materials & methods

STUDY sITE— The study area lies in the Magdalena District, 20 km southeast of

Magdalena town (35°11’S, 57°17°W) in the province of Buenos Aires, Argentina in

a forested area dominated by Scutia buxifolia (“coronillo”) and Celtis tala (“tala”) and

covering marine shell deposits that form parallel ridges along the coastline. See Arturi

et al. (1997) for details on climate and forest ecology.

SAMPLE COLLECTION— Samples of leaf litter were collected from the forest, placed

in zip-lock bags for transport to the laboratory, and stored in a refrigerator at 4°C until

processed. Plant material was incubated at 25°C in Petri dish moist chambers (Eliades et

al. 2007). Samples were examined over four weeks. Fungal species were examined with

a Wild MB stereo microscope and a Dialux 20 Leitz microscope.

SCANNING ELECTRON Microscopy— For the determination of fungal species in

their natural substrate (leaf litter), material remained in formaldehyde at 1% for 4 hours

and then postfixed with 2% formaldehyde for 12 hours. The fixative was removed by

means of three consecutive washes with distilled water for subsequent dehydration.

The fixing of the cultured material was modified with respect to time: a fixation was

carried out in 1% formaldehyde for 3 hours and post-fixation in 2% formaldehyde for

4 hours. All the samples were then dehydrated in graded series of 30%, 50%, 70% and

100% ethanol (45 min in each concentration), the ethanol was replaced by liquid CO,

and the samples dried by Critical Point (Blazers equipment, CP-30). All the samples

were mounted onto double-sided carbon tape and gold plated in a Joel Fine Ion Sputter,

JCF 100. Observations and photomicrographs were obtained with a Scanning Electron

Microscope, JMS-T 100, and with a JEOL Model 6340 LV Scanning Electron Microscope

belonging to the Service of Electron Microscopy of the Museum of Natural Sciences of

La Plata, Buenos Aires.

Taxonomy

Koorchaloma scutiae Alleg., Fliades & Aramb., sp. nov. PLaTE 1

MycoBank MB518290

Foliicola conidiomata stromatica, dispersa, alba vel flavida gelatinosa usque 40-60

um diam. Stroma basale parva ex cellulis isodiametricibus, atrobrunneis vel brunneis

compositae. Setae penitus conidiomatis intersparsae, sterile, solitariae, non-ramosae,

erectae, rectae, laeves, crassitunicatae, septate, brunneae, ad epicem pallidorae 170-

400 um longae, 10-15 um latae ad basem, 3-5 um latem ad apicem. Conidiophora

macronematosa, erecta, ramosa, tenuitunicata, laevia, hyalina. Cellulae conidiogenae

discretae, monoblasticae, terminales, subcylindricae, cum collario, laeves hyalinae 10-15

x 2-2.7 um. Conidia 18-20 x 1.8-2 um fusiformia ad apice rotundata ad basim truncata,

laevia hyalina utrique appendices mucosas ferentia, in masso gregaria.

Typus: Argentina, Buenos Aires, Magdalena, in foliis mortuis Scutia buxifolia, Cazau

48245 (LPS, holotypus), May 2004

EryMo.oey: referring to substrate genus, Scutia.

Koorchaloma and Ciliochorella spp. nov. (Argentina) ... 177

Fe : a = ry

PLATE 1. Koorchaloma scutiae. A. Conidiomata on natural substrate. B. Detail of

conidiomata. C. Conidiophores, conidiogenous cells, conidia and setae. D. Conidium.

Folicolous conidiomata stromatic, scattered, pulvinate, gelatinous, white to

creamy, rounded or irregular in outline, setose, 40-60 um diam. Basal stroma

thin of textura angularis with 4-5 layers of thick walled cells, dark brown. No

margin was observed. Conidiomatal setae marginal and frequently interspersed,

through the basal stroma straight, smooth walls, subcylindrical, unbranched,

multiseptate, thick walled dark brown at the base, pale brown in the apex,

170-400 um at the terminal cell which has telescopic growing. Conidiophores

arising from the upper layer of cells of the basal stroma, irregularly branched,

septate, hyaline, invested in mucus.

Conidiogenous cells discrete, monoblastic, subcylindrical with flaring

collarettes, colourless, smooth 10-15 x 2-27 um. Conidia 18-20 x 1.8-2 um

fusiform to slightly sigmoid with rounded base and truncated apex, mucoid

appendage bearing in both extremes, funnel shape, mean conidium length/

width 10:1.

COMMENTS: Koorchaloma Subram. was proposed by Subramanian (1953) for

the type species, K. madreeya Subram., collected on dead, rotting culms of

Oryza sativa in India. The genus is characterized by sporodochial to acervular

setose conidiomata (with setae either marginal or interposed through the basal

stroma), holoblastic conidiogenesis, and unicellular, colourless, and fusiform

conidia that bear mucoid appendages either only apically or at both ends

(Nag Raj 1984, 1993). Nag Raj (1993) recognized five species: K. madreeya,

K. bambusae Nag Raj, K. jamaicensis Nag Raj, K. occidentalis Nag Raj (Nag Raj,

178 ... Allegrucci & al.

1984), and K. okamurae I. Hino & Katum. (Hino 1961). Since this publication,

five more species have been described — K. novojournalis Yanna et al. (Yanna

et al. 1998), K. galateae Kohlm. & Volkm.-Kohlm. (Kohlmeyer & Volkmann-

Kohlmeyer 2001), K. spartinicola V.V. Sarma et al. (Sarma et al. 2001),

K. dimorpha Matsush. (Matsushima 2003), and K. europaea Treigiené (Treigiené

2006).

The new species, K. scutiae, which grows throughout the year on Scutia

buxifolia leaf litter, is differentiated from other Koorchaloma species by its

longer and wider conidia (length/width ratio = 10:1). Its macronematous

conidiophores resemble those of K. novojournalis, which can be distinguished

by shorter conidia (mean length/width ratio = 3.5:1). Koorchaloma scutiae is

also resembles K. jamaicensis, described from grass blades in Jamaica, in setal

structure and sporodochia, but the latter species produces distinctly broader

conidia (mean conidium length/width ratio = 5.3:1).

Although two Koorchaloma species have Kananascus teleomorphs (Nag Raj

1984, 1993), no teleomorph is known for Koorchaloma scutiae.

Key to Koorchaloma species

aisMarine labitat : ee.c 9 apg! 3 sts piesa pals isis wes Bk Giel s ol dte ami a eh 2

Ib-Non-marine habitat, a5 5a lh conse cahcee UL eee eats Sol ete ool as Bean 3

2a. Mean conidium length/width ratio = 3.4:1...............00.0.00005. K. galateae

2b. Mean conidium length/width ratio = 2.9:1................0000005 K. spartinicola

3a. Species with Acremonium synanamorphosis.................0.0. 00. K. dimorpha

3b. Species without synanamorphosis ........... 0.0. e cece cece teen eee ees 4

4a. Conidia bearing mucoid appendage usually at the apex only,

conidioma not gelatinous ....... 0... cece eet en en een eee 5

4b. Conidia bearing mucoid appendage usually at the apex only or at both ends,

ConidiomajeelatityGUs: A) 2, ie oeet rassteen coo aeons eesti se aaaroee we tegie tdetigael es 6

5a. Mean conidium length/width ratio =2.8:1...................0.008. K. okamurae

5b. Mean conidium length/width ratio = 3.7:1................ 00.00.08. K. madreeya

6a. Conidia bearing mucoid appendage usually at the apex only.......... K. europaea

6b. Conidia bearing mucoid appendage at both ends ............... 0... eee ee ee 7

Fax Omid das USI OPIS eas asc Sh,cosed flay tea of nth ea eB oalle od Laat d goad a Mead Lanbte thoes 8

7b. Gomidia naviculates; 007 wee i. ye geese gh: patie uh: gate UR eh ees pave GU ee 9

8a. Conidiophores reduced to conidiogenous cells .................0005 K. bambusae

8b. Conidiophores macronematous ...... 0.00. cece cette e een e nas 10

9a. Excipulum well developed; mean conidium length/width ratio = 5.3:LK. jamaicensis

9b. Excipulum less developed; mean conidium length/width ratio = 3.9:1K. occidentalis

10a. Mean conidium length/width ratio = 3.5:1................0.004 K. novojournalis

10b. Mean conidium length/width ratio = 10:1 ............. 00.0.0. eee K. scutiae

Koorchaloma and Ciliochorella spp. nov. (Argentina) ... 179

Ciliochorella buxifoliae Allegr., Eliades & Aramb., sp. nov. PLATE 2

MycoBank MBs518291

Foliicola, conidiomata stromatica, dissita vel gregaria, origene subcuticularia, in sectione

lenticula 300-500 um lat, 140-150 ym alt., unilocularia, glabra, brunnea, paries 20-35

um cr., e textura angulari compositus. Conidiophora e cellulis strati intimi telae basalis

conidiomatum enascentia, simplicia et basi 1-2 septata vel ad cellulas conidiogenas redacta,

in muco involuta. Cellulae conidiogenae holoblasticae, ageniformes, hyalinae, laeves, 3-3.5

x 4-5 um. Conidia subfusiformia, triseptata, 19-21 x 2.5-2.7 um, appendices ferentia;

cellula basalis obconica, hyalina, laevis 2-3 um long; cellulae medianae duae, cylindraceae,

subhyalinae, aliquantum inaequalis 8 um long, cellula apicalis hyalina, laevis, cassa, in

appendicem apicalem singularem attenuata; appendix basalis singularis, excentrica

simplex attenuata 3-5 um long; ratione conidii long /lat.= 7:1.

Typus: Argentina, Buenos Aires, Magdalena, in foliis mortuis Scutia buxifolia, Allegrucci

& Cazau 48244 (LPS holotypus) February 2005.

EryMoLoey: referring to its leaf litter substrate species, Scutia buxifolia.

Folicolous conidiomata lenticular, stromatic, picnidioid scattered, subcuticular,

conical in sectional view, 300-500 wm wide, 140-150 um deep, unilocular,

glabrous, pale brown, wall 20-35 um thick, textura angularis, cells thin walled,

pale brown to almost colourless with area of dehiscence ultimately breaking

wide open. Conidiophores lining the cavity of the conidioma, unbranched,

1-2 septate at the base or reduced to conidiogenous cells, invested in mucus.

Conidiogenous cells holoblastic, lageniform, hyaline, smooth 3-3.5 x 4-5 um.

Conidia subfusiform, slightly curved 3-septate 19-21 x 2.5-2.7 um bearing

appendages; basal cell obconical with a truncate base, hyaline, smooth, 2-3

uum long, devoid of contents; 2 median cells cylindrical, almost colourless,

equal, 8 um long, apical cell hyaline, smooth devoid of contents and modified

into a branched appendage divided with 27-30 um between both extremes;

basal appendage single, eccentric, unbranched, attenuated, 3-5 um long, mean

conidium length/width ratio 7:1.

CoMMENTs: The genus Ciliochorella Syd. was described in 1935 for the type

species, Ciliochorella mangiferae (Sydow & Mitter 1935; see Sutton 1964 for a

brief history of the genus). Ciliochorella is characterized by having cylindrical,

straight or slightly curved conidia with euseptate pale brown middle cells,

colourless end cells that bear a single, eccentric appendage. Nag Raj (1993)

recognized three species: C. splendida Nag Raj & R.E Castafieda (Nag Raj

1993), C. castaneae Munjal (Munjal, 1966), and C. mangiferae Syd. (Sydow &

Mitter 1935), Although three other Ciliochorella species have been described,

Nag Raj (1993) synonymized C. eucalypti T.S. Viswan. and C. indica Kalani with

C. mangiferae and C. bambusarum Shanor with Placonema bambusacearum

(Sacc. et al.) Petr.

The new species, C. buxifoliae, grows profusely throughout the year on

Scutia buxifolia leaf litter. We placed our species into Ciliochorella because the

180 ... Allegrucci & al.

4um

PLATE 2. Ciliochorella buxifoliae. A-C. Conidiogenous cells and conidia. D. Conidium.

stromatic pycnidioid subcuticular adpressed to lenticular conidioma is never

immersed in the host tissue; it differs from other Cliochorella species in size,

septation, ramification, and form of the conidial appendage.

Ciliochorella buxifoliae differs from the three other species described above

mainly by the longer and wider conidia. It most closely resembles C. mangiferae,

which produces longer conidia (32-43 x 2.5-3.5 um) with a mean conidium

length/width ratio = 12.3:1.

Key to Ciliochorella species

la. Conidiomata not lenticular ....... 0.0. cece een eee C. splendida

lb? Conidiomatatenticular. 3.0 oc G20 a ee eh at ek Fan eb dad ee bate 2

2a. Conidiophores 0-2 septate, branched occasionally reduced to

conidiogenous:cells t's Ned rats slant tthe serena the he orale heats C. castaneae

2b. Conidiophores invariably reduced to conidiogenous cells...............0..0000. 3

3a. Mean conidium length/width ratio = 12.3:1..................0.00. C. mangiferae

3b. Mean conidium length/width ratio = 7:1..............0... 00.0000. C. buxifoliae

Acknowledgements

This research is part of the 11/N527 UNLP Project. This work was performed with the

financial support of CONICET and CIC. Allegrucci is a recipient of a scholarship from

CONICET. Eliades and Arambarri are research scientists from CONICET, and Cabello

is a researchers from CICPBA. The authors wish to thank Dra. Andrea I. Romero and

Dr. Luis E. Pascholati Gusmao for their suggested revisions of the manuscript.

Koorchaloma and Ciliochorella spp. nov. (Argentina) ... 181

Literature cited

Allegrucci N, Arambarri AM, Cazau C, Cabello MN. 2004. Thozetella buxifolia a new hyphomycete

from Argentina. Mycotaxon 90(2): 275-279.

Allegrucci N, Cazau MC, Cabello MN, Arambarri AM. 2005. Andlisis de las Comunidades de

microhongos de la hojarasca de Scutia buxifolia (Rhamnaceae) en el Este de la Provincia de

Buenos Aires (Argentina). Darwiniana. 43(1-4): 1-9.

Allegrucci N, Elfades L, Bucsinszky AM, Cabello MN, Arambarri AM. 2007. Diversidad de

Hyphomycetes en bosques nativos de Celtis tala (Ulmaceae) en la provincia de Buenos Aires,

Argentina. Soc. Argent. Bot. 42(1-2): 79-86.

Allegrucci N, Cabello MN, Arambarri AM. 2009. Diversity of saprotrophic fungi imperfecti from

native forests in Argentina: an up-dated review. Darwiniana 47(1): 108-124.

Arturi M. 1997. Regeneracién de Celtis tala en el noreste de la Provincia de Buenos Aires. Tesis

doctoral, Facultad de Ciencias Naturales y Museo. UNLP. 163 p.

Crous PW, Allegrucci N, Arambarri MA, Cazau MC, Groenewald JZ, Wingfield MJ. 2005.

Dematiocldium celtidis gen. sp. nov. (Nectriaceae, Hypocreales) a new genus from Celtis leaf

litter in Argentina. Mycological Research. 109(7): 833-840. doi:10.1017/S0953756205002911

Eliades LA, Voget CE, Arambarri AM, Cabello MN. 2007. Fungal communities on decaying

saltgrass (Distichlis spicata) in Buenos Aires province (Argentina). Sydowia 59(2): 227-234.

Hino I. 1961. Icones fungorum bambusicolorum Japonicorum. The Fuji Bamboo Garden town,

Kobe, Japan. 335 p.

Kohlmeyer J, Volkmann-Kohlmeyer B. 2001. Fungi on Juncus roemarianus. 16. More new

coelomycetes, including Tetranacriella, gen. nov. Botanica Marina 44: 147-156. doi:10.1515/

BOT.2001.020

Matsushima T. 2003. Matsushima mycological. memoirs. N°10: Published by the author, Kobe,

Japan. 214 p.

Munjal RL. 1966. The genus Ciliochorella in India. Indian Phytopath. 19: 198-200.

Nag Raj TR, 1984. Koorchaloma, Koorchalomella and Kananascus gen. nov. Mycotaxon 19:

167-212.

Nag Raj TR (ed.). 1993. Coelomycetous anamorphs with appendage-bearing conidia. University of

Waterloo, Ontario. 1101p.

Sanchez RO, Ferreer JA. Duymovich OA. Hurtado MA. 1976. Estudio pedoldgico integral de los

Partidos de Magdalena y Brandsen (Provincia de Buenos Aires). 1-123, in: Anales del LEMIT,

serie II, N° 310. Ministerio de Obras Publicas de la provincia de Buenos Aires, Argentina.

Sarma VV, Newell SY, Hyde KD. 2001. Koorchaloma spartinicola sp.nov. A new marine sporodochial

fungus from Spartina alterniflora. Botanica Marina 44: 321-326. doi:10.1515/BOT.2001.041

Subramanian CV. 1953. Koorchaloma, a new genus of the Tuberculariaceae. Journal of the Indian

Botanical Society 32: 123-126.

Sutton BC. 1964. Coelomycetes III. Annellolacinia gen. nov., Aristastoma, Phaeocytostroma,

Seimatosporium, etc. Mycological papers 97: 1-42.

Sydow H, Mitter JH. 1935. Fungi indici, II. Ann. mycol. 33: 46-71.

Treigiené A. 2006. New species of Kananascus and its anamorph from Lithuania. Mycotaxon 96(2):

173-180.

Yanna, Hyde, KD, Goh TK. 1998. Koorchaloma novojournalis sp nov., a new sporodochial fungus

from Hong Kong. Fungal Diversity 1: 193-197.

Yanna, Ho WH, Hyde KD. 2001. Fungal communities on decaying palm fronds in Australia, Brunei,

and Hong Kong. Mycological Research 105(12): 1458-1471. doi:10.1017/S0953756201005214

MYCOTAXON

Volume 115, pp. 183-201 January-March 2011

DOT: 10.5248/115.183

A new taxonomic classification for species in

Gomphus sensu lato

ADMIR J. GIACHINI'! & MICHAEL A. CASTELLANO”

1 Universidade Federal de Santa Catarina, Departamento de Microbiologia, Imunologia e

Parasitologia, Florianopolis, Santa Catarina 88040-970, Brasil

2U.S. Department of Agriculture, Forest Service, Northern Research Station, Forestry Sciences

Laboratory, 3200 Jefferson Way, Corvallis, Oregon 97331, USA

CORRESPONDENCE TO: ‘admir.giachini@ccb.ufsc. br & *mcastellano@fs.fed.us

ABsTRACT — Taxonomy of the Gomphales has been revisited by combining morphology

and molecular data (DNA sequences) to provide a natural classification for the species

of Gomphus sensu lato. Results indicate Gomphus s.l. to be non-monophyletic, leading to

new combinations and the placement of its species into four genera: Gomphus sensu stricto

(3 species), Gloeocantharellus (11 species), Phaeoclavulina (41 species), and Turbinellus

(5 species).

Key worps - Fries, nomenclature, Persoon, systematics

Introduction

Gomphus sensu lato (Gomphaceae, Gomphales, Basidiomycota) is

characterized by fleshy basidiomata that can have funnel- or fan-shaped pilei

with wrinkled, decurrent hymenia. The genus, which was described by Persoon

(1797a), has undergone several taxonomic and nomenclatural modifications

over the past 200 years.

The taxonomy of Gomphus s.1. (Gomphales) has proven difficult because of the

few reliable morphological characters available for classification. Consequently,

species of Gomphus s.]. have been classified under Cantharellus, Chloroneuron,

Chlorophyllum, Cratereilus, Gloeocantharellus, Nevrophyllum, and Turbinellus.

A few species are mycorrhizal (Agerer et al. 1998, Bulakh 1978, Guzman &

Villarreal 1985, Khokhryakov 1956, Kropp & Trappe 1982, Masui 1926, 1927,

Pantidou 1980, Trappe 1960, Valdés-Ramirez 1972). Some are considered rare

*This paper was prepared by a U.S.A. government employee on official time and is therefore in

the public domain and not subject to copyright.

184 ... Giachini & Castellano

and endangered, especially in the Pacific Northwestern USA (USDA/USDI

1994) and certain regions of Europe (Bulakh 1978, Bulakh & Govorova 2000,

Dahlberg & Croneborg 2003, Kluzak 1994, Urbonas et al. 1990). Gomphus

bonarii, G. clavatus, G. floccosus, and G. kauffmanii are listed as threatened in

the 1994 Northwest Forest Plan (USDA/USDI 1994) because of their apparent

close association with old-growth forests. Gomphus clavatus is considered rare

(red-listed) in 17 countries of Europe (Dahlberg & Croneborg 2003).

Nomenclatural history of Gomphus sensu lato

The concept of Gomphus s.]. was established when Persoon (1796) first

mentioned the name Merulius. Subsequently Persoon (1797b) proposed four

new combinations, including M. violaceus (= M. clavatus). Persoon (1797a)

also introduced the name Gomphus at the generic level, but did not assign

species to his newly created genus; still the name was validly published. Later

Persoon (1801) transferred Gomphus to Merulius section Gomphus with two

documented taxa [M. clavatus var. violaceus and M. clavatus var. spadiceus

(= Clavaria truncata Schmidel)] and afterward restored the genus rank to

Gomphus (Persoon 1825) with five species, including G. truncatus (= M.

clavatus). Gray (1821) accepted Persoon’s genus name, which he assigned to

one species, Gomphus clavatus. ‘The genus has frequently been cited in the past

as “Gomphus (Pers.) Gray” or “Gomphus Pers. ex Gray”; but once the starting

date for fungal nomenclature was emended to 1753 (Voss et al. 1983), the

correct citation has been Gomphus Pers.

Fries (1821) accepted Gomphus only at the infrageneric level, as Cantharellus

‘tribus’ Gomphus (not to be confused with the unrelated Agaricus subgen.

Gomphus Fr.) and subsequently (Fries 1825) introduced the genus Gomphora

as a nomenclatural synonym of Gomphus Pers.

Other authors involved with shaping the history of Gomphus s.]. included

Schweinitz (1832), Berkeley (1839), Berkeley & Curtis (1859), Peck (1887), and

Smith & Morse (1947), all of whom assigned gomphoid species to Cantharellus.

Fries (1838) moved Merulius clavatus to Craterellus. Doassans & Patouillard

(1886) described Nevrophyllum to accommodate Gomphus species, and Earle

(1909) proposed Turbinellus to accommodate some species formerly assigned

to Cantharellus.

Singer (1945) described Gloeocantharellus (based on Cantharellus

purpurascens) with the key diagnostic character of gloeocystidia to separate it

from Cantharellus. More importantly, here he also recognized Gomphus at the

generic level, recombining Cantharellus bonarii as G. bonarii.

Corner (1950, 1966, 1970), and Petersen (1967, 1968, 1969, 1971, 1972),

who clarified the natural classification of this group, accepted the classifications

proposed by Donk (1933, 1941, 1949a,b), who also proposed the family

Gomphus sensu lato reclassified ... 185

Gomphaceae (Donk 1961). The Gomphaceae was considered a member of the

Aphyllophorales until Julich (1981) proposed the order Gomphales.

The molecular overview of gomphoid-phalloid phylogeny by Hosaka et al.

(2006) incorporated the data from Giachini (2004) for Gomphus s.L, including

its four generic segregates. We here provide the conclusions from Giachini’s

research, a key to the segregate genera, and a list of accepted names, including

new combinations, and synonyms.

Systematics, taxonomy, and evolutionary biology

Most difficulties in identifying taxa of Gomphus s.1. arise because of the

few reliable morphological characters available for classification. However,

distinctive clusters of species can be consistently separated by morphology.

Most are united by a few consistent features, such as fan-shaped, lilaceous vs.

funnel-shaped, orange-brown pilei, scaly vs. inconspicuously fibrous pileus

surface, presence vs. absence of clamp connections, echinulate vs. verrucose

spores, tropical vs. temperate habitat, etc.

Given the difficulty in identifying species of Gomphus s.1. by morphological

characters, combined morphological and molecular data (DNA sequences)

were used to verify the monophyly of Gomphus and to identify morphological

features to reliably separate taxa within Gomphus.

Materials & methods

Collections examined

In all, 434 collections of Gomphales species were analyzed for distinct macro- and

micro-morphological features, of which 189 were selected for molecular characterization

(for details see Giachini 2004, Giachini et al. 2010).

Molecular characterization

Twenty-nine sequences of Gomphus sl. representing 22 taxa were sampled for

molecular characterization and phylogenetic analysis; DNA extraction, purification,

sequencing, and analyses are according to Giachini (2004) and Giachini et al. (2010).

Results

Reexamination of generic types by morphological and molecular approaches

revealed the inadequacy of some characters used by early workers to differentiate

species within Gomphus s.]. Additionally, genetic data strongly suggest that

Gomphus s.1. is not monophyletic (Giachini 2004, Giachini et al. 2010). Rather, it

originated several times within the order Gomphales (Giachini et al. 2010: figures

1, 2). Because basidioma morphology and overall microscopic characteristics

differentiate among species in many clades within Gomphus s.1., segregation of

species into the genera Gomphus s.s., Gloeocantharellus, Phaeoclavulina (some

species of Gomphus s.l. and all species of Ramaria subgenus Echinoramaria),

186 ... Giachini & Castellano

and Turbinellus is proposed. Detailed description of all species listed here will

be published elsewhere.

Key to genera

la.

1b.

2a.

2b.

3a.

3b.

Basidiomata unipileate or merismatoid (composed of several pilei); pileus

mostly funnel-shaped, surface almost glabrous to fibrillose, appressed-floccose,

squamose scaly or with heavy recurved scales; clamp connections sometimes

present but mostly absent; spores verrucose....... 0.0... cece cece eee eee 2

Basidiomata ramarioid, unipileate or merismatoid; pileus, when present,

fan- to funnel-shaped, surface glabrous; clamp connections always present;

spores echinulate, verrucose, subreticulate or reticulate .................004. 3

Pileus minutely to strongly scaly, orange-yellow to orange-scarlet, blood red,

pale orange, orange, or brown, often changing color on drying; scales generally

darker than pileus surface; hymenium wrinkled................... Turbinellus

Pileus glabrous to tomentose, off-white, pale yellow, pale yellow brown,

yellow-pink, pale to livid orange, orange-pink, pink, pale brown, dark

yellow-orange, dark rusty brown, or pale red; hymenium decurrent,

supported by either true lamellae, bifurcating broad hymenial folds,

or wertinkled folds... oe: oe: sth, aes pees 4 a de gee oles petit a gi Gloeocantharellus

Basidiomata unipileate or merismatoid, terrestrial; pileus fan-shaped to slightly

funnel-shaped, bright violet, pale olivaceous or brown; hymenium wrinkled

to almost poroid, violet, vinaceous brown to milky-coffee colored; spores

VELEUCOSES ES gical tite Ath Le tesl Soak eons stat RIE eats engl tyes ate Pigelah gag Alia Gomphus

Basidiomata ramarioid, unipileate or merismatoid, sometimes lignicolous;

pileus, when present, funnel-shaped or fan-shaped, pileus and branch surfaces

white, brown-green, pale to sordid olivaceous, violet, brown-yellow or red-

cinnamon, gray, brick red, or pale to dark orange-yellow; hymenium smooth

in some species, sublamellate or irregularly wrinkled with decurrent folds in

others, in general yellow to orange-red or brown, pale to sordid olivaceous,

or violet; spores echinulate (mostly with acute spines), verrucose,

subreticulate or reticulate ....... 0... eee Phaeoclavulina

Accepted names and new combinations

New synonymies are prefixed with an asterisk * (based on Giachini et al. 2010)

Gomphus Pers. Tent. Disp. Meth. Fung.: 74 (1797)

[non Gomphus (Fr.) Weinm. 1826].

= Merulius sect. Gomphus Pers., Syn. Meth. Fung.: 498 (1801).

= Cantharellus ‘trib? Gomphus (Pers.) Fr., Syst. Mycol. 1: 322 (1821).

= Gomphora Fr., Syst. Orb. Veg.: 88 (1825).

= Nevrophyllum Pat., in Doassans & Patouillard, Revue Mycol. 8: 26

(1886), nom. illegit. [non Neurophyllum Torr. & A. Gray 1840].

= Cantharellus sect. Gomphus A.H. Sm. & Morse, Mycologia 39: 499 (1947).

Type species: Gomphus clavatus (Pers.) Gray 1821.

Gomphus sensu lato reclassified ... 187

Gomphus brunneus (Heinem.) Corner, Ann. Bot. Mem. 2: 116 (1966).

Basionym: Neurophyllum brunneum Heinem., Bull. Jard. Bot. Etat. Brux. 28: 435 (1958).

= Gomphus clavatus var. parvisporus Corner, Ann. Bot. Mem. 2: 118 (1966).

Gomphus clavatus (Pers.) Gray, Nat. Arr. Brit. Pl. 1: 638 (1821).

Basionym: Merulius clavatus Pers., Observ. Mycol. 1: 21 (1796).

= Cantharellus clavatus (Pers.) Fr., Syst. Mycol. 1: 322 (1821).

= Craterellus clavatus (Pers.) Fr., Epicr. Syst. Mycol.: 533 (1838).

= Thelephora clavata (Pers.) P. Kumm., Fuhr. Pilzk: 46 (1871).

= Nevrophyllum clavatum (Pers.) Pat., in Doassans &

Patouillard, Revue Mycol. 8: 26 (1886).

= Trombetta clavata (Pers.) Kuntze, Revis. Gen. Pl. 2: 873 (1891).

= Clavaria elveloides Wulfen, Miscell. Austriaca Bot. 2: 99 (1781).

= Clavaria truncata Schmidel , Anal. Pl. 3: 237 (1796).

= Gomphus truncatus (Schmidel) Pers., Mycol. Eur. 2: 9 (1825).

= Merulius clavatus var. spadiceus Pers., Syn. Meth. Fung.: 498 (1801).

= Cantharellus brevipes Peck, Rep. N. Y. St. Mus. Nat. Hist. 33: 21 (1883).

= Merulius brevipes (Peck) Kuntze, Revis. Gen. Pl. 2: 862 (1891).

= Craterellus nucleatus Schréd., Centralbl. Gesammte Forstwes. 34: 396 (1908).

*= Cantharellus purpuraceus Iwade, Bull. Tokyo Univ. Forests. 33: 54 (1944).

= Gomphus purpuraceus (Iwade) K. Yokoy., in Imazeki,

Colour. Illustr. Mushr. Japan 2: 98 (1989).

Gomphus crassipes (L.M. Dufour) Maire, in Maire & Werner, Mém. Soc. Sci. Nat.

Maroc 45: 81 (1937).

Basionym: Cantharellus crassipes L.M. Dufour, Rev. Gen. Bot. 1: 358 (1889).

= Merulius crassipes (L.M. Dufour) Kuntze, Revis. Gen. Pl. 3(2): 494 (1898).

= Nevrophyllum crassipes (L.M. Dufour) Maire, Bull. Soc. Mycol. Fr. 30: 214 (1914).

Gloeocantharellus Singer, Lloydia 8: 140 (1945).

= Linderomyces Singer, Farlowia 3: 157 (1947).

Type species: Cantharellus purpurascens Hesler 1944.

Gloeocantharellus corneri (Singer) Corner, Nova Hedwigia 18: 799 (1970).

Basionym: Linderomyces corneri Singer, Vellozia 1: 14 (1961).

Gloeocantharellus dingleyae (Segedin) Giachini, comb. nov.

MycoBank MB512928

BasionymM: Gomphus dingleyae Segedin, New Zealand J. Bot. 22: 536 (1985), as “dingleyi”.

Note: The masculine termination ‘-? is an error to be corrected to ‘-ae’, because the

epithet is a feminine possessive noun honouring Joan Dingley [see McNeill et al. 2006:

Art. 32.7, 60.11 + Rec. 60C.1(a)].

Gloeocantharellus echinosporus Corner, Nova Hedwigia 18: 801 (1970).

Gloeocantharellus lateritius (Petch) Corner, Nova Hedwigia 18: 803 (1970).

BasionyM: Paxillus lateritius Petch, Ann. Roy. Bot. Gard. Peradeniya 6: 202 (1917).

188 ... Giachini & Castellano

= Phyllobolites lateritius (Petch) Singer, Ann. Mycol. 40: 59 (1942).

= Linderomyces lateritius (Petch) Singer, Farlowia 3: 157 (1947).

= Gomphus lateritius (Petch) R.H. Petersen, J. Elisha Mitchell Scient. Soc. 84: 380 (1968).

Gloeocantharellus mamorensis (Singer) Giachini, comb. nov.

MycoBank MB 512929

BasionyM: Gomphus mamorensis Singer, in Singer et

al., Beih. Nova Hedwigia 77: 17 (1983).

Gloeocantharellus novae-zelandiae (Segedin) Giachini, comb. nov.

MycoBank MB512930

Basionym: Gomphus novae-zelandiae Segedin, New Zealand J. Bot. 22: 533 (1985).

Gloeocantharellus okapaensis (Corner) Corner, Nova Hedwigia 18: 803 (1970).

BasionyM: Gomphus okapaensis Corner, Ann. Bot. Mem. 2: 123 (1966).

Gloeocantharellus pallidus (Yasuda) Giachini, comb. nov.

MycoBank MB512931

Basionym: Cantharellus pallidus Yasuda, in Lloyd, Mycol. Notes 47: 661 (1917).

= Gomphus pallidus (Yasuda) Corner, Ann. Bot. Mem. 2: 123 (1966).

Gloeocantharellus persicinus T.H. Li, Chun Y. Deng & L.M. Wu, in Deng & Li,

Mycotaxon 106: 450 (2009).

Gloeocantharellus purpurascens (Hesler) Singer, Lloydia 8: 140 (1945).

Basionym: Cantharellus purpurascens Hesler, in Smith & Hesler, Lloydia 6: 248 (1944).

= Gomphus purpurascens (Hesler) R.H. Petersen, J. Elisha

Mitchell Scient. Soc. 84: 380 (1968).

Gloeocantharellus uitotanus Vasco-Pal. & Franco-Mol., Mycotaxon 91: 90 (2005).

Phaeoclavulina Brinkmann, Jahresber. Westfal. Provinz.-Ver. Wiss.

Kunst 25: 197 (1897).

= Clavaria sect. Phaeoclavulina (Brinkmann) Killerm., in

Engler & Prantl, Nat. Pflanzenfam. 6: 155 (1928).

*= Lachnocladium sect. Dendrocladium Pat., J. Bot. Morot 3: 33 (1889).

= Dendrocladium (Pat.) Lloyd, Mycol. Notes 60: 870 (1919).

= Ramaria sect. Dendrocladium (Pat.) R.H. Petersen, Bibl. Mycol. 79: 44 (1981).

*= Chloroneuron Murrill, Mycologia 3: 25 (1911).

= Chlorophyllum Murrill, North Amer. Flora 9: 172 (1910),

nom. illeg. [non Chlorophyllum Massee 1898].

= Neurophyllum subgen. Chloroneuron (Murrill) R. Heim, Revue Mycol. 19: 51 (1954).

*= Clavaria subsect. Terrestres Killerm., in Engler & Prantl, Nat. Pflanzenfam. 6: 154 (1928).

*= Ramaria subgen. Echinoramaria Corner, Beih. Nova Hedwigia 33: 238 (1970).

*= Ramaria ser. Grandisporae Corner, Beih. Nova Hedwigia 33: 239 (1970).

= Ramaria sect. Grandisporae (Corner) Franchi & M.

Marchetti, Fungi non Delineati 16: 15 (2001).

*= Ramaria ser. Flaccidae Corner, Beih. Nova Hedwigia 33: 239 (1970).

= Ramaria sect. Flaccidae (Corner) R.H. Petersen, Bibl. Mycol. 79: 100 (1981).

Gomphus sensu lato reclassified ...

*= Ramaria ser. Virescentes Corner, Beih. Nova Hedwigia 33: 239 (1970).

*= Gomphus subgen. Phaeoclavulinoides R.H. Petersen, Mycologia 68: 432 (1976).

Type species: Phaeoclavulina macrospora Brinkmann 1897.

Phaeoclavulina abietina (Pers.) Giachini, comb. nov.

MycoBank MB512962

BasionyM: Clavaria abietina Pers., Neues Mag. Bot. 1: 117 (1794)

[sanctioned name; non “Clavaria abietina” sensu Fr. 1821].

= Merisma abietinum (Pers.) Spreng., Syst. Veg. 4: 495 (1827).

= Hydnum abietinum (Pers.) Duby, Bot. Gall 2: 778 (1830).

= Clavariella abietina (Pers.) P. Karst., Revue Mycol. 3(9): 21 (1880).

= Ramaria abietina (Pers.) Quél., Fl. Mycol. France: 467 (1888).

= Clavaria ochraceovirens Jungh., Linnaea 5: 407 (1830).

= Ramaria ochraceovirens (Jungh.) Donk var. ochraceovirens,

Meded. Ned. Mycol. Ver. 22: 112 (1933).

= Clavaria abietina f. persoonii Fr., Hymenomyc. Eur.: 671 (1874).

= Clavaria abietina var. virens Gillet, Tab. Anal.: 183 (1884).

*= Clavaria abietina subsp. cyanescens Romell, in Krok & Almquist, Sv.

FL. Skol., Krypt., 24 ed., (1911) [not seen; fide Corner 1950].

= Clavaria cyanescens (Romell) S. Lundell, in Krok & Almquist, Sv. FI.

Skol., Krypt., 5" ed.: 286 (1932) [not seen; fide Corner 1950].

= Clavaria virescens Gramberg, Pilz- Krauterfreund 5: 57 (1921).

= Ramaria virescens (Gramberg) Hennig, in Michael, Fiihr. Pilzfr. 3: 320 (1927).

*= Ramaria ochrochlora Furrer-Ziogas & Schild, in Schild,

Fung. Rar. Icon. Color. 5: 17 (1971).

*= Ramaria ochraceovirens var. parvispora K.S. Thind, Khurana

& S.C. Kaushal, Kavaka 11: 33 (1984).

Phaeoclavulina africana (R.H. Petersen) Giachini, comb. nov.

MycoBank MB512932

BasionyM: Gomphus africanus R.H. Petersen, Mycologia 68: 429 (1976).

Phaeoclavulina angustata (Lév.) Giachini, comb. nov.

MycoBank MB512933

Basionym: Merisma angustatum Lév., Ann. Sci. Nat., Bot. sér. 3, 5: 158 (1846).

189

= Thelephora angustata (Lév.) Fr., Nova Acta Regiae Soc. Sci. Ups., Ser. 3, 1: 108 (1851).

= Ramaria angustata (Lév.) Corner, Beih. Nova Hedwigia 33: 242 (1970).

Phaeoclavulina apiahyna (Speg.) Giachini, comb. nov.

MycoBank MB512934

BasionyM: Clavaria apiahyna Speg., Bol. Acad. Nac. Cienc. (Cérdoba) 23: 435 (1919).

= Ramaria apiahyana (Speg.) Corner, Ann. Bot. Mem. 1: 555 (1950).

Phaeoclavulina argentea (R.H. Petersen) Giachini, comb. nov.

MycoBank MB512935

BasionyM: Ramaria argentea R.H. Petersen, Bibl. Mycol. 79: 111 (1981).

*= Ramaria incognita R.H. Petersen, Bibl. Mycol. 79: 145 (1981).

*= Ramaria incongrua R.H. Petersen, Bibl. Mycol. 79: 147 (1981).

190 ... Giachini & Castellano

Phaeoclavulina articulotela (R.H. Petersen) Giachini, comb. nov.

MycoBank MB512936

Basionym: Ramaria articulotela R.H. Petersen, Bibl. Mycol. 79: 115 (1981).

Phaeoclavulina camellia (Corner) Giachini, comb. nov.

MycoBank MB512937

BAsIONYM: Ramaria camellia Corner, Darwin. 11: 200 (1957).

Phaeoclavulina campestris (K. Yokoy. & Sagara) Giachini, comb. nov.

MycoBank MB512938

BasionyM: Ramaria zippelii var. campestris K. Yokoy. &

Sagara, Trans. Mycol. Soc. Japan 14: 302 (1973).

= Ramaria campestris (K. Yokoy. & Sagara) R.H. Petersen, Bibl. Mycol. 79: 57 (1981).

Phaeoclavulina campoi (Speg.) Giachini, comb. nov.

MycoBank MB512939

Basionym: Clavaria campoi Speg., Bol. Acad. Nac. Cienc. (Cordoba) 25: 28 (1921).

= Ramaria campoi (Speg.) R.H. Petersen, Bibl. Mycol. 79: 119 (1981).

Phaeoclavulina capucina (Pat.) Giachini, comb. nov.

MycoBank MB512940

BasionyM: Clavaria capucina Pat., Bull. Soc. Mycol. Fr. 33: 50 (1917).

= Ramaria capucina (Pat.) Corner, Ann. Bot. Mem. 1: 565 (1950).

Phaeoclavulina cervicornis (A.L. Sm.) Giachini, comb. nov.

MycoBank MB512941

BastonyM: Clavaria cervicornis A.L. Sm., J. Linn. Soc., Bot. 35: 10 (1901).

= Ramaria cervicornis (A.L. Sm.) Corner, Ann. Bot. Mem. 1: 565 (1950).

Phaeoclavulina clavarioides (Schild) Giachini, comb. nov.

MycoBank MB512942

Basionym: Ramaria clavarioides Schild, Z. Mykol. 64: 60 (1998).

Phaeoclavulina cokeri (R.H. Petersen) Giachini, comb. nov.

MycoBank MB512945

BasionyM: Ramaria cokeri R.H. Petersen, Dist. Hist. Biota S. Appalachians 4: 291 (1976).

*= Clavaria echinospora Berk. & Broome, J. Linn. Soc., Bot. 14: 75 (1873).

= Scytinopogon echinosporus (Berk. & Broome) Corner, Ann. Bot. Mem. 1: 655. (1950).

*= Clavaria fragillima Sacc. & P. Syd., Syll. Fung. 16: 206 (1902).

= Clavaria echinospora Henn., Monsunia 1: 141 (1899), nom.

illegit. [non C. echinospora Berk. & Broome 1873].

= Clavariella fragillima (Sacc. & P. Syd.) Overeem, Bull.

Jard. Bot. Buitenzorg, ser. 3, 5: 275 (1923).

= Ramaria fragillima (Sacc. & Syd.) Corner, Ann. Bot. Mem. 1: 588 (1950).

Phaeoclavulina curta (Fr.) Giachini, comb. nov.

MycoBank MB512946

BasionyM: Clavaria curta Fr., Ofvers. Forh. Kongl. Svenska Vetensk.- Akad. 18: 31 (1861).

= Ramariopsis curta (Fr.) Corner, Ann. Bot. Mem. 1: 639 (1950).

= Ramaria curta (Fr.) Schild, Z. Mykol. 60(1): 125 (1994).

Gomphus sensu lato reclassified ... 191

= Clavaria myceliosa Peck, Bull. Torrey Bot. Club 31(4): 182 (1904).

= Ramaria myceliosa (Peck) Corner var. myceliosa, Ann. Bot. Mem. 1: 607 (1950).

*= Clavaria decurrens var. australis Coker, Clav. U.S.: 177 (1923).

= Ramaria pusilla var. australis (Coker) Corner, Ann. Bot. Mem. 1: 618 (1950).

= Ramaria decurrens var. australis (Coker) R.H. Petersen, Bibl. Mycol. 79: 127 (1981).

= Ramaria pusilla Corner var. pusilla, Ann. Bot. Mem. 1: 617 (1950).

= Clavaria pusilla Peck, Ann. Rep. Reg. Univ. St. N.Y. 25: 83

(1873), nom. illegit. [non C. pusilla Pers. 1797].

= Ramaria myceliosa var. microspora R.H. Petersen, Bibl. Mycol. 79: 157 (1981).

*= Ramaria subdecurrens var. burnhamii R.H. Petersen, Bibl. Mycol. 79: 171 (1981).

Phaeoclavulina cyanocephala (Berk. & M.A. Curtis) Giachini, comb. nov.

MycoBank MB512947

BasionyM: Clavaria cyanocephala Berk. & M.A. Curtis, J. Linn. Soc., Bot. 10: 338 (1868).

= Ramaria cyanocephala (Berk. & M.A. Curtis) Corner, Ann. Bot. Mem. 1: 568 (1950).

= Ramaria grandis f. cyanocephala (Berk. & M.A. Curtis)

R.H. Petersen, Bibl. Mycol. 79: 71 (1981).

*= Clavaria grandis Peck, Bull. Torrey Bot. Club 29(2): 73 (1902).

= Ramaria grandis (Peck) Corner f. grandis, Ann. Bot. Mem. 1: 595 (1950).

= Ramaria zippelii f. grandis (Peck) R.H. Petersen, Taxonomy of

Fungi, (Proc. int. Symp. Madras, 1973) Part 2: 569 (1984).

*= Clavaria spiculospora G.F. Atk., Ann. Mycol. 7: 368 (1909) [cited as

“spiculisperma” (lapsus calami) in Syll. Fung. 21: 426 (1912)].

Phaeoclavulina decolor (Berk. & M.A. Curtis) Giachini, comb. nov.

MycoBank MB512948

BasionyM: Clavaria decolor Berk. & M.A. Curtis, Proc.

Amer. Acad. Arts Sci. 4: 124 (1860).

= Ramaria decolor (Berk. & M.A. Curtis) R.H. Petersen, Persoonia 12(3): 231 (1984).

*= Ramaria zippelii var. cristatospora Corner, Proc. Linn. Soc. London 178: 103 (1967).

= Ramaria cristatospora (Corner) R.H. Petersen, Bibl. Mycol. 79: 64 (1981).

Phaeoclavulina echinovirens (Corner, K.S. Thind & Dev) Giachini, comb. nov.

MycoBank MB512950

BasionyM: Ramaria echinovirens Corner, K.S. Thind &

Dev, Trans. Br. Mycol. Soc. 40: 473 (1957).

Phaeoclavulina eumorpha (P. Karst.) Giachini, comb. nov.

MycoBank MB512949

BasionyM: Clavariella spinulosa subsp. eumorpha P. Karst.,

Bidr. Kannedom Finl. Natur Folk 37: 185 (1882).

= Clavaria spinulosa subsp. eumorpha (P. Karst.) Sacc., Syll. Fung. 6: 701 (1888).

= Clavariella euamorpha (P. Karst.) P. Karst., Bidr. Kannedom

Finl. Natur Folk 48: 388 (1889).

= Ramaria eumorpha (P. Karst.) Corner, Ann. Bot. Mem. 1: 575 (1950).

*= Clavaria patagonica Speg., Bol. Acad. Nac. Cienc. (Cérdoba) 11: 21 (1887).

= Clavulinopsis patagonica (Speg.) Corner, Ann. Bot. Mem. 1: 383 (1950).

= Ramaria patagonica (Speg.) Corner, Darwin. 11: 203 (1957).

192 ... Giachini & Castellano

= Clavaria invalii Cotton & Wakef., Trans. Br. Mycol. Soc. 6: 176 (1919).

= Clavaria flaccida subsp. invalii (Cotton & Wakef.) Konrad &

Maubl., Icon. Select. Fung., fasc. 4: p1.488 (1928).

= Ramaria invalii (Cotton & Wakef.) Donk, Meded. Ned. Mycol. Ver. 22:113 (1933).

= Clavaria flaccida var. invalii (Cotton & Wakef.) J. Favre,

Mater. FI. Crypt. Suisse 10(3): 32 (1948).

*= Clavaria murrillii Coker, Clav. U.S.: 190 (1923).

= Ramaria murrillii (Coker) Corner, Ann. Bot. Mem. 1: 607 (1950).

Phaeoclavulina flaccida (Fr.) Giachini, comb. nov.

MycoBank MB512951

BasionyM: Clavaria flaccida Fr., Syst. Mycol. 1: 471 (1821).

= Clavariella flaccida (Fr.) P. Karst. var. flaccida, Revue Mycol. 3(9): 21 (1881).

= Ramaria flaccida (Fr.) Bourdot var. flaccida, Rev. Sci. Bourb. 11: 235 (1898).

*= “Clavaria abietina” sensu Fr., Syst. Mycol. 1: 469 (1821),

nom. inval. [non Clavaria abietina Pers. 1794].

*= Clavaria muscicola Pers., Observ. Mycol. 2: 60 (1800).

= Pistillaria muscicola (Pers.) Fr., Syst. Mycol. 1: 498 (1821).

= Typhula muscicola (Pers.) Fr., Epicr. Syst. Mycol.: 585 (1838).

= Eocronartium muscicola (Pers.) Fitzp., Phytopathology 8: 197 (1918).

*= Clavaria crispula Fr., Syst. Mycol. 1: 470 (1821).

= Merisma crispulum (Fr.) Spreng. Syst. Veg. 4: 496 (1827).

= Clavariella crispula (Fr.) P. Karst., Revue Mycol. 3(9): 21 (1881).

= Ramaria crispula (Fr.) Quél., Fl. Mycol. France: 464 (1888).

= Ramaria flaccida var. crispula (Fr.) Schild, Hoppea 61: 317 (2000).

*= Clavaria decurrens Pers. Mycol. Eur. 1: 164 (1822).

= Ramaria decurrens (Pers.) R.H. Petersen var. decurrens, Bibl. Mycol. 79: 124 (1981).

*= Clavaria corrugata P. Karst., Not. Sallsk. Fauna Fl. Fenn. Férh. 9: 371 (1868).

= Clavariella corrugata (P. Karst.) P. Karst., Revue Mycol. 3(9): 21 (1881).

= Clavaria abietina f. corrugata (P. Karst.) Killerm., Denkschr.

Bayr. Bot. Ges. Regensburg 15: 113 (1922).

= Ramaria corrugata (P. Karst.) Schild, Schweiz. Z. Pilzk. 53: 130 (1975).

*= Clavariella flaccida var. dendroides P. Karst., Not. Sallsk.

Fauna FI. Fenn. Forh. 9: 372 (1868).

*= Clavaria muscigena P. Karst., Not. Sallsk. Fauna Fl. Fenn. Forh. 9: 373 (1868).

= Clavaria uncialis subsp. muscigena (P. Karst.) Sacc., Syll. Fung. 6: 730 (1888).

= Eocronartium muscigena (P. Karst.) Hohn., Sitzungsber. K. Akad.

Wiss., Math.-Naturwiss. K1., Abt. 1, 118: 1463 (1909).

*= Eocronartium typhuloides G.F. Atk., J. Mycol. 8: 107 (1902).

= Helicobasidium typhuloides (G.F. Atk.) Pat., Bull. Soc. Mycol. Fr. 36: 176 (1920).

*= Clavaria subdecurrens Coker var. subdecurrens, Clav. U.S.: 172 (1923).

= Ramaria subdecurrens (Coker) Corner var. subdecurrens, Ann. Bot. Mem. 1: 626 (1950).

*= Ramaria ligustri Velen., Novit. Mycol.: 162 (1939).

*= Ramaria fuscobrunnea Corner, in Balfour-Browne, Bull. Brit. Mus. Nat. Hist. 1: 200 (1955).

*= Ramaria flaccida var. longiramosa Corner, Beih. Nova Hedwigia 33: 250 (1970).

*= Ramaria perfluopunicea R.H. Petersen, New Zealand DSIR Bull. 236: 100 (1988).

Gomphus sensu lato reclassified ... 193

Phaeoclavulina gigantea (Pat.) Giachini, comb. nov.

MycoBank MB512952

BasionyM: Lachnocladium giganteum Pat., J. Bot. (Morot) 3: 34 (1889).

= Ramaria gigantea (Pat.) R.H. Petersen f. gigantea, Bibl. Mycol. 79: 66 (1981).

= Lachnocladium olivaceum Henn., Hedw. 36: 196 (1897).

= Lachnocladium echinosporum Bres., Ann. Mycol. 9: 551 (1911).

*= Ramaria zippelii var. gracilis Corner, Ann. Bot. Mem. 1: 635, 700 (1950).

*= Ramaria gigantea f. tenuispora R.H. Petersen, New Zealand DSIR Bull. 236: 97 (1988).

Phaeoclavulina glauco-aromatica (R.H. Petersen) Giachini, comb. nov.

MycoBank MB512953

Basionym: Ramaria glauco-aromatica R.H. Petersen, Bibl. Mycol. 79: 141 (1981).

Phaeoclavulina grandis (Corner) Giachini, comb. nov.

MycoBank MB512954

BasionyM: Gomphus grandis Corner, Nova Hedwigia 18: 812 (1970).

Phaeoclavulina griseobrunnea (Singer) Giachini, comb. nov.

MycoBank MB512955

BasionyM: Ramaria griseobrunnea Singer, in Singer et

al., Beih. Nova Hedwigia 77: 19 (1983).

Phaeoclavulina guadelupensis (Pat.) Giachini, comb. nov.

MycoBank MB512956

BasionyM: Stereum guadelupense Pat., Bull. Soc. Mycol. Fr. 15: 201 (1899).

= Gomphus guadelupensis (Pat.) D.A. Reid, Persoonia 2: 134 (1962).

*= Nevrophyllum ochraceum Pat., in Duss, Enum. Champ. Guadeloupe: 38 (1903).

= Cantharellus ochraceus (Pat.) Sacc. & D. Sacc., Syll. Fung. 17: 36 (1905).

= Gomphus ochraceus (Pat.) Singer, Lloydia 8: 140 (1945).

Phaeoclavulina guyanensis (Pat.) Giachini, comb. nov.

MycoBank MB512957

Basionym: Lachnocladium guyanense Pat., J. Bot. (Morot) 3: 35 (1889).

= Ramaria guyanensis (Pat.) Corner, Ann. Bot. Mem. 1: 596 (1950).

= Clavaria guyanensis (Pat.) Rick, Iheringia 5: 132 (1959).

*= Lachnocladium leucoceras Pat., J. Bot. (Morot) 3: 33 (1889).

= Ramaria leucoceras (Pat.) Corner, Ann. Bot. Mem. 1: 600 (1950).

Phaeoclavulina insignis (Pat.) Giachini, comb. nov.

MycoBank MB512958

Basionym: Lachnocladium insigne Pat., J. Bot. (Morot) 3: 34 (1889).

= Ramaria insignis (Pat.) R.H. Petersen, Bibl. Mycol. 79: 77 (1981), as “insigne”.

Phaeoclavulina longicaulis (Peck) Giachini, comb. nov.

MycoBank MB512959

Basionym: Clavaria longicaulis Peck, Bull. Torrey Bot. Club 25: 371 (1898).

= Ramaria longicaulis (Peck) Corner, Ann. Bot. Mem. 1: 600 (1950).

194 ... Giachini & Castellano

Phaeoclavulina macrospora Brinkmann, Jber. Westf. Prov. Ver. Wiss. Kunst 25: 198

(1897).

= Ramaria macrospora (Brinkmann) Corner, Ann. Bot. Mem. 1: 603

(1950), nom. illegit. [non R. macrospora Velen. 1947].

= Phaeoclavulina nigrescens Brinkmann, Jber. Westf. Prov. Ver. Wiss. Kunst 25: 198 (1897).

= Ramaria nigrescens (Brinkmann) Donk var. nigrescens,

Meded. Ned. Mycol. Ver. 22: 104 (1933).

= Clavaria broomei Cotton & Wakef., Trans. Br. Mycol. Soc. 6: 170 (1919).

= Phaeoclavulina broomei (Cotton & Wakef.) Overeem, Bull.

Jard. Bot. Buitenzorg, ser. 3, 5: 277 (1923).

= Ramaria broomei (Cotton & Wakef.) R.H. Petersen, Bibl. Mycol. 79: 53 (1981).

*= Ramaria nigrescens var. americana Corner, Ann. Bot. Mem. 1: 608, 700 (1950).

= Ramaria americana (Corner) R.H. Petersen, Bibl. Mycol. 79: 48 (1981).

Phaeoclavulina mutabilis (Schild & R.H. Petersen) Giachini, comb. nov.

MycoBank MB512960

BasionyM: Ramaria mutabilis Schild & R.H. Petersen,

in Petersen, Bibl. Mycol. 79: 149 (1981).

Phaeoclavulina ochracea (Bres.) Giachini, comb. nov.

MycoBank MB512961

BasionyM: Lachnocladium ochraceum Bres., in Bresadola &

Saccardo, Bull. Soc. Roy. Bot. Belgique 38: 157 (1899).

= Ramaria ochracea (Bres.) Corner var. ochracea, Ann. Bot. Mem. 1: 610 (1950).

*= Clavaria intricatissima Speg., Anales Mus. Nac. Buenos Aires 19: 279 (1909).

= Ramaria intricatissima (Speg.) Corner, Ann. Bot. Mem. 1: 598 (1950).

*= Ramaria luteoflaccida Corner, Ann. Bot. Mem. 1: 601, 699 (1950).

*= Ramaria flaccida var. chilensis Lazo, Mycol. 64: 77 (1972).

*— Ramaria ochracea var. sicco-olivacea R.H. Petersen,

New Zealand DSIR Bull. 236: 98 (1988).

Phaeoclavulina pancaribbea (R.H. Petersen) Giachini, comb. nov.

MycoBank MB512963

BasionyM: Ramaria pancaribbea R.H. Petersen f. pancaribbea, Bibl. Mycol. 79: 88 (1981).

*= Ramaria pancaribbea f. caerulea R.H. Petersen, Bibl. Mycol. 79: 90 (1981).

Phaeoclavulina quercus-ilicis (Schild) Giachini, comb. nov.

MycoBank MB512964

BasionyM: Ramaria quercus-ilicis Schild, Z. Mykol. 64: 53 (1998).

Phaeoclavulina retispora (Corner) Giachini, comb. nov.

MycoBank MB512965

BasionyM: Gomphus retisporus Corner, Ann. Bot. Mem. 2: 124 (1966).

Phaeoclavulina roellinii (Schild) Giachini, comb. nov.

MycoBank MB512966

BastonyM: Ramaria roellinii Schild, Schweiz. Z. Pilzk. 56: 97 (1978).

Phaeoclavulina sikkimia (S.S. Rattan & Khurana) Giachini, comb. nov.

MycoBank MB512967

BasionyM: Ramaria sikkimia S.S. Rattan & Khurana, Bibl. Mycol. 66: 18 (1978).

Gomphus sensu lato reclassified ... 195

Phaeoclavulina subclaviformis (Berk.) Giachini, comb. nov.

MycoBank MB512968

BasionyM: Thelephora subclaviformis Berk., Hooker’s J. Bot. Kew

Gard. Misc. 8: 238 (1856), as “sebclavaeformis”.

Note: ‘The ‘-ae-’ connective is an error, to be replaced with an ‘-i-’ (McNeill et al. 2006:

Art. 60.8).

= Gomphus subclaviformis (Berk.) Corner, Nova Hedwigia

18: 815 (1970), as “subclavaeformis”.

*= Gomphus cavipes Corner, Nova Hedwigia 18: 808 (1970).

Phaeoclavulina tropicalis (R.H. Petersen) Giachini, comb. nov.

MycoBank MB512969

BasionyM: Ramaria tropicalis R.H. Petersen, Bibl. Mycol. 79: 173 (1981).

Phaeoclavulina vinaceipes (Schild) Giachini, comb. nov.

MycoBank MBs512970

Basionym: Ramaria vinaceipes Schild, Z. Mykol. 56(1): 131 (1990).

Phaeoclavulina viridis (Pat.) Giachini, comb. nov.

MycoBank MBs512971

Basionym: Nevrophyllum viride Pat., J. Bot. (Morot) 2: 406 (1888).

= Chlorophyllum viride (Pat.) Murrill, North Amer. Flora 9(3): 172 (1910).

= Chloroneuron viride (Pat.) Murrill, Mycologia 3(1): 25 (1911).

= Gomphus viridis (Pat.) Singer, Lloydia 8: 140 (1945).

*= Cantharellus patouillardii Sacc., Syll. Fung. 9: 65 (1891).

= Merulius patouillardii (Sacc.) Kuntze, Revis. Gen. Pl. 3(2): 494 (1898).

Phaeoclavulina zealandica (R.H. Petersen) Giachini, comb. nov.

MycoBank MB512972

Basionym: Ramaria pancaribbea var. zealandica R.H. Petersen,

New Zealand DSIR Bull. 236: 99 (1988).

Phaeoclavulina zippelii (Lév.) Overeem, Bull. Jard. Bot. Buitenzorg, ser. 3, 5: 276

(1923).

BasionyM: Clavaria zippelii Lév., Ann. Sci. Nat., Bot. sér. 3, 2: 215 (1844).

= Ramaria zippelii (Lév.) Corner f. zippelii, Ann. Bot. Mem. 1: 632 (1950).

*= Merisma guadelupense Lév., Ann. Sci. Nat., Bot. sér. 3, 5: 157 (1846).

= Pterula guadelupensis (Lév.) Sacc., Syll. Fung. 6: 742 (1888).

= Lachnocladium guadelupense (Lév.) Pat., J. Bot. (Morot) 3: 33 (1889).

= Microporus guadelupensis (Lév.) Kuntze, Revis. Gen. Pl. 3(2): 496 (1898).

= Dendrocladium guadelupense (Lév.) Lloyd, Mycol. Writ.

5(Index): 13 (1919), as “guadeloupe”.

= Ramaria guadelupensis (Lév.) Corner, Ann. Bot. Mem. 1: 596 (1950).

= Aphelaria guadelupensis (Lév.) Corner, Beih. Nova Hedwigia 33: 19 (1970).

*= Clavaria nigrescens Fr., Nova Acta Regiae Soc. Sci. Ups., Ser. 3, 1: 116 (1851).

*= Lachnocladium hookeri Berk., Hooker's J. Bot. Kew Gard. Misc. 4: 140 (1852).

= Clavaria thwaitesii Berk. & Broome, J. Linn. Soc., Bot. 14: 75 (1873).

= Clavaria aeruginosa Pat., Bull. Soc. Mycol. Fr. 14: 189 (1898).

= Ramaria zippellii var. aeruginosa (Pat.) R.H. Petersen, Bibl. Mycol. 79: 96. 1981.

196 ... Giachini & Castellano

= Clavaria phaeocladia Pat., Bull. Soc. Mycol. Fr. 14: 189 (1898).

= Lachnocladium albidum Pat., Bull. Soc. Mycol. Fr. 14: 188 (1898).

*= Lachnocladium englerianum Henn., Bot. Jahrb. Syst. 25: 499 (1898).

*= Lachnocladium neglectum Massee, in Wakefield et al.,

Vierteljahrsschr. Naturf. Ges. Ziirich 61: 630 (1916).

Turbinellus Earle, Bull. N. Y. Bot. Gard. 5: 407 (1909).

= Cantharellus sect. Excavatus AH. Sm. & Morse, Mycologia 39: 500 (1947).

= Gomphus sect. Excavatus (A.H. Sm. & Morse) Corner, Ann. Bot. Mem. 2: 113 (1966).

= Gomphus subgen. Excavatus (A.H. Sm. & Morse) R.H. Petersen,

J. Elisha Mitchell Scient. Soc. 84: 381 (1968).

Type species: Cantharellus floccosus Schwein. 1832.

Turbinellus flabellatus (Berk.) Giachini, comb. nov.

MycoBank MB512973

Basionym: Cantharellus flabellatus Berk., J. Linn. Soc., Bot. 16: 50 (1877).

= Merulius flabellatus (Berk.) Kuntze, Revis. Gen. Pl. 3(2): 494 (1898).

= Gomphus flabellatus (Berk.) Corner, Ann. Bot. Mem. 2: 119 (1966).

*= Cantharellus glutinosus Pat., Bull. Soc. Mycol. Fr. 25: 7 (1909).

= Gomphus glutinosus (Pat.) R.H. Petersen, Nova Hedwigia 21: 92 (1972).

Turbinellus floccosus (Schwein.) Earle, Bull. N.Y. Bot. Gard. 5: 407 (1909).

Basionym: Cantharellus floccosus Schwein. f. floccosus,

Trans. Amer. Phil. Soc. 4: 153 (1832).

= Merulius floccosus (Schwein.) Kuntze, Revis. Gen. Pl. 2: 862 (1891).

= Chanterel floccosus (Schwein.) Murrill, N. Amer. Flora 9(3): 168 (1910).

= Gomphus floccosus (Schwein.) Singer f. floccosus, Lloydia 8: 140 (1945).

= Nevrophyllum floccosum (Schwein.) R. Heim, Revue Mycol. 19: 51 (1954).

= Cantharellus canadensis Klotzsch, in Berkeley, Ann. Nat. Hist. 3: 380 (1839).

= Craterellus canadensis (Klotzsch) Sacc., Syll. Fung. 6: 519 (1888).

= Trombetta canadensis (Klotzsch) Kuntze, Revis. Gen. Pl. 2: 873 (1891).

= Gomphus canadensis (Klotzsch) Corner, Ann. Bot. Mem. 2: 116 (1966).

= Cantharellus princeps Berk. & M.A. Curtis, Ann. Mag. Nat. Hist., ser. 3, 4: 293 (1859).

= Merulius princeps (Berk. & M.A. Curtis) Kuntze, Revis. Gen. Pl. 2: 862 (1891).

*= Cantharellus bonarii Morse, Mycologia 22: 219 (1930).

= Gomphus bonarii (Morse) Singer f. bonarii, Lloydia 8: 140 (1945).

*= Cantharellus floccosus f. excavatus A.H. Sm. & Morse, Mycologia 39: 525 (1947).

= Gomphus floccosus f. excavatus (A.H. Sm. & Morse)

Corner, Ann. Bot. Mem. 2: 121 (1966).

*= Cantharellus floccosus f. rainieriensis AH. Sm. & Morse, Mycologia 39: 521 (1947).

= Gomphus floccosus f. rainieriensis (A.H. Sm. & Morse) Corner,

Ann. Bot. Mem. 2: 121 (1966), as “raineriensis”.

= Gomphus floccosus subsp. rainieriensis (A.H. Sm. & Morse)

R.H. Petersen, Nova Hedwigia 21: 48 (1972).

*= Cantharellus floccosus f. wilsonii AH. Sm. & Morse, Mycologia 39: 523 (1947).

= Gomphus floccosus f. wilsonii (A.H. Sm. & Morse)

Corner, Ann. Bot. Mem. 2: 121 (1966).

Gomphus sensu lato reclassified ... 197

= Gomphus bonarii f. wilsonii (A.H. Sm. & Morse) R.H.

Petersen, Nova Hedwigia 21: 37 (1972).

*— Cantharellus wilkinsiae Morse, in Smith & Morse,

Mycologia 39: 528 (1947), as “wilkinsae”.

= Gomphus wilkinsiae (Morse) Corner, Ann. Bot. Mem. 2: 128 (1966), as “wilkinsae”.

= Gomphus bonarii f. wilkinsiae (Morse) R.H. Petersen,

Nova Hedwigia 21: 35 (1972), as “wilkinsae”.

*= Gomphus floccosus f. cystidiophorus R.H. Petersen, J.

Elisha Mitchell Scient. Soc. 84: 376 (1968).

*= Gomphus megasporus Corner, Nova Hedwigia 18: 813 (1970).

*= Gomphus bonarii f. novamexicanus R.H. Petersen, Nova Hedwigia 21: 44 (1972).

*= Gomphus floccosus f. coccineobasalis R.H. Petersen, Nova

Hedwigia 21: 52 (1972), as “coccineo-basalis”.

*= Gomphus floccosus f. olivaceus R.H. Petersen, Nova Hedwigia 21: 54 (1972).

*= Gomphus szechwanensis R.H. Petersen, Nova Hedwigia 21: 102 (1972).

*= Gomphus thiersii R.H. Petersen, Evol. Higher Basidio.: 363 (1971).

Turbinellus fujisanensis (S. Imai) Giachini, comb. nov.

MycoBank MB512974

Basionym: Cantharellus fujisanensis S. Imai, Bot. Mag. Tokyo 55: 519 (1941).

= Nevrophyllum fujisanense (S. Imai) S. Ito, Mycol. Fl.

Japan 2(4): 103 (1955), as “fujisanensis”.

= Gomphus fujisanensis (S. Imai) Parmasto, Ident. URSS Clav.: 28 (1965).

Turbinellus kauffmanii (A.H. Sm.) Giachini, comb. nov.

MycoBank MB512975

BasionymM: Cantharellus kauffmanii A.H. Sm., in Smith

& Morse, Mycologia 39: 516 (1947).

= Gomphus kauffmanii (A.H. Sm.) Corner, Ann. Bot. Mem. 2: 122 (1966).

Turbinellus stereoides (Corner) Giachini, comb. nov.

MycoBank MB512976

BasionyM: Gomphus stereoides Corner, Ann. Bot. Mem. 2: 124 (1966).

*= Gomphus brasiliensis Corner, Nova Hedwigia 18: 807 (1970).

Discussion

Hibbett et al. (1997), Pine et al. (1999), Humpert et al. (2001), Giachini

(2004), and now Giachini et al. (2010) have shown that evolutionarily the

genus Ramaria, long recognized as having morphological features similar to

Gomphus s.1., is closely related to species of that genus. Aside from the overall

evolutionary relationships of Gomphus s.l. and Ramaria, Giachini (2004)

revealed in particular a closer relationship between some species of Gomphus

s.l. and species of Ramaria subgen. Echinoramaria (Giachini et al. 2010: figs.

1-2). Of the genera treated here, Gomphus s.s. and Phaeoclavulina share the

most macro- and microscopic features. Although Phaeoclavulina is mostly

ramarioid, it also includes a few pileate species previously placed in Gomphus s.1.

Both Gomphus s.s. and Phaeoclavulina have uni- and multi-pileate species that

198 ... Giachini & Castellano

present fan- to funnel-shaped, glabrous to subtomentose or floccose-squamose

pilei. Nearly all species have decurrent hymenia with wrinkled hymenial folds,

and all species possess clamp connections.

Gomphus s.s. and Gloeocanthareilus are fairly easily differentiated by

abundance of gleoplerous hyphae and clamp connections: Gomphus s.s. has

ubiquitous clamp connections, whereas these structures are present only

irregularly in Gloeocantharellus. Gloeocantharellus is characterized by abundant

gleoplerous hyphae dispersed among all hyphal tissues, separating it from other

genera in the Gomphaceae.

Turbinellus was proposed by Earle (1909) to accommodate Cantharellus

floccosus. Earle (1909) assigned three species to his genus, all from North

America. Turbinellus species were later transferred to Gomphus (Singer 1945),

then Cantharellus (Smith & Morse 1947), Nevrophyllum (Heim 1954: only

T. floccosus), and finally back to Gomphus (Corner 1966). The taxonomy of its

species has been challenging, primarily to the lack of morphological features

sufficiently reliable to differentiate species, resulting in many nomenclatural

synonyms.

The morphological and genetic sampling of all species, forms, and subspecies

by Giachini (2004), Giachini et al. (2010), and this study support the new

generic circumscriptions reflected here. Many species previously delimited on

morphological grounds have been shown to represent phenotypic variants of

a few well-supported genetic taxa. Genetic data indicate that Gomphus bonarii

and G. floccosus (and all their forms and subspecies) represent phenotypes of

a single species (Giachini et al. 2010). Hence, G. bonarii and G. floccosus (and

all their variants), long thought to be different species but seldom correctly

separated on morphological grounds, are synonymized, with the name

Turbinellus floccosus having priority. Even though Giachini (2004: fig. 3)

presented three clades of bonarii/floccosus species, the overall morphological

similarities (e.g., basidioma morphology, spore size, hyphal arrangement)

combined with the inconsistent arrangement of species/subspecies within and

among each of those clades, imply that those species/subspecies are sufficiently

similar to comprise one single taxon.

The overall conclusions indicate an intricate organization for Gomphus

s.l. and its counterparts. Additional studies, focusing on generic and species

distribution, are undoubtedly necessary.

Acknowledgements

The extensive collecting and laboratory work on the Gomphales was partially supported

by the Forest Mycology Team (US. Forest Service, Pacific Northwest Research Station,

Corvallis, Oregon). The senior author thanks Conselho Nacional de Desenvolvimento

Cientifico e Tecnolégico (CNPq) of the Brazilian Ministry of Education for the doctoral

fellowship. Special thanks to the following herbaria for fungal loans: BPI, BR, CANB,

Gomphus sensu lato reclassified ... 199

CUP, DAOM, DAR, F, FH, GH, H, K, L, LPS, M, MICH, NCU, NY, NYS, OULU, OSA,

OSC, PC, PDD, PERTH, PH, S, SFSU, TENN, TNS, UC, UPS, WTU, and ZT. Dr. Richard

Halse provided unconditional assistance on herbarium loans. Special thanks to Matthew

E. Smith and Matthew J. Trappe for presubmission review and Shaun R. Pennycook and

James M. Trappe for nomenclatural assistance.

Literature cited

Agerer R, Beenken L, Christian J. 1998. Gomphus clavatus (Pers.: Fr.) S. F. Gray + Picea abies (L.)

Karst. In R Agerer et al. (eds), Descriptions of Ectomycorrhizae 3: 25-29.

Berkeley MJ. 1839. Descriptions of exotic fungi in the collection of Sir W. Hooker, from memoirs

and notes of J.F. Klotzsch, with additions and corrections. The Annals of Natural History 3:

375-401.

Berkeley MJ, Curtis MA. 1859. New species of North American fungi. XXXI — Centuries of North

American fungi. The Annals and Magazine of Natural History, series 3, 4: 284-296.

Bulakh EM. 1978. Macromitsety pikhtavo-elovykh lesov. In DF Efremov, TA Komarova, VA

Rosenberg (eds), Biotsenotycheskiye Issledovaniya na Berkhneussuriyskom Statsionare.

Academiya Nauk SSSR Dalnevostochnyi Nauchnyi Tsentr Biologo-Pochvenniy Institut,

Vladivostok. Pp. 73-81.

Bulakh EM, Govorova OK. 2000. Rare and new for Russia Basidiomycetes from Primorsky territory.

Mycology and Phytopathology 34: 21-25.

Corner EJH. 1950. A monograph of Clavaria and allied genera. Annals of Botany Memoir 1:

1-740.

Corner EJH. 1966. A monograph of the cantharelloid fungi. Annals of Botany Memoir 2: 1-255.

Corner EJH. 1970 [“1969”]. Notes on cantharelloid fungi. Nova Hedwigia 18: 783-818.

Dahlberg A, Croneborg H. 2003. 33 threatened fungi in Europe: complementary and revised

information on candidates for listing in appendix I of the Bern convention. http://www.coe.

int/T/E/Cultural_Cooperation/Environment/Nature_and_biological_diversity/Nature_

protection/sc21_34erev_introduction.pdf¢L=E.

Doassans MME, Patouillard NT. 1886. Champignons du Béarn (2° liste). Revue Mycologique 8(29):

25-28. (Reprint from ‘Collected Mycological papers’ chronologically arranged and edited by L.

Vogelenzang, Librarian Rijksherbarium, Leiden, Amsterdan, vols. 1-3, 1978).

Donk MA. 1933. Revision der Niederlandischen Homobasidiomycetae—Aphyllophoraceae, Teil II.

Mededeelingen van de Nederlandsche Mycologische Vereeniging. 22: 1-278.

Donk MA. 1941. Nomina generica conservanda and confusa for Basidiomycetes (Fungi). Bulletin of

the Botanic Gardens Buitenzorg, series 3, 17: 155-197.

Donk MA. 1949a. New and revised nomina generica conservanda proposed for Basidiomycetes

(Fungi). Bulletin of the Botanic Gardens Buitenzorg, series 3, 18: 83-168.

Donk MA. 1949b. Nomenclatural notes on generic names of agarics (Fungi: Agaricales). Bulletin of

the Botanic Gardens Buitenzorg, series 3, 18: 271-402.

Donk MA. 1961. Four new families of Hymenomycetes. Persoonia 1: 405-407.

Earle FS. 1909. The genera of the North American gill fungi. Bulletin of the New York Botanical

Garden 5: 373-462.

Fries EM. 1821. Systema mycologicum, vol. 1. Lund.

Fries EM. 1825. Systema Orbis Vegetabilis. Lund.

Fries EM. 1838. Epicrisis Systema Mycologicum. Uppsala.

Giachini AJ. 2004. Systematics, Phylogeny, and Ecology of Gomphus sensu lato. Ph.D. Dissertation,

Oregon State University. Corvallis.

200 ... Giachini & Castellano

Giachini AJ, Hosaka K, Nouhra ER, Spatafora JW, Trappe JM. 2010. Phylogenetic relationships

of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA and mit-atp6-DNA combined

sequences. Fungal Biology 114: 224-234. doi:10.1016/j.funbio.2010.01.002

Gray SF. 1821. A Natural Arrangement of British plants, vol. 1. London.

Guzman G, Villarreal L. 1985. Estudios sobre los hongos, liquenes y mixomicetos del Cofre de

Perote, Veracruz, I: Introduccion a la mico-flora de la region. Boletin de la Sociedad Mexicana

de Micologia 19: 107-124.

Heim R. 1954. A propos de trois Chanterelles Américaines. Revue Mycologique 19: 47-56.

Hibbett DS, Pine EM, Langer E, Langer G, Donoghue MJ. 1997. Evolution of gilled mushrooms

and puftballs inferred from ribosomal DNA sequences. Proceedings of the National Academy

of Science U.S.A. 94: 12002-12006. doi:10.1073/pnas.94.22.12002

Hosaka K, Bates ST, Beever RE, Castellano MA, Colgan III W, Dominguez LS, Nouhra ER, Geml J,

Giachini AJ, Kenney SR, Simpson NB, Spatafora JW, Trappe JM. 2006. Molecular phylogenetics

of the gomphoid-phalloid fungi with an establishment of the new subclass Phallomycetidae and

two new orders. Mycologia 98(6): 949-959. doi:10.3852/mycologia.98.6.949

Humpert AJ, Muench EL, Giachini AJ, Castellano MA, Spatafora JW. 2001. Molecular

phylogenetics of Ramaria (Gomphales) and related genera:evidence from nuclear large

subunit and mitochondrial small subunit rDNA sequences. Mycologia 93(3): 465-477.

doi: 10.2307/3761733

Jiilich W. 1981. Higher taxa of Basidiomycetes. J. Cramer, Germany.

Khokhryakov MK. 1956. Mycorrhiza. In MV Gorlenko and IV Voronkevich (eds). (Griby—Druziya

I vragi cheloveka) Sovyetskaya Nauka, Moscow. Pp. 178-181.

Kluzak Z. 1994. Gomphus clavatus, a seriously endangered species in the Czech Republic. Zeitschrift

fiir Mykologie 60: 113-116.

Kropp BR, Trappe JM. 1982. Ectomycorrhizal fungi of Tsuga heterophylla. Mycologia 74(3):

479-488. doi:10.2307/3792970

Masui K. 1926. A study of the mycorrhiza of Abies firma, S. et Z., with special reference to its

mycorrhizal fungus, Cantharellus floccosus, Schw. Memoirs of the College of Science, Kyoto

Imperial University. Series B, vol. 2(1), Article 2: 1-84.

Masui K. 1927. A study of the ectotrophic mycorrhizas of woody plants. Memoirs of the College of

Science, Kyoto Imperial University. Series B, vol. 3: 149-279.

McNeill J, Barrie FR, Burdet HM, Demoulin V, Hawksworth DL, Marhold K, Nicolson DH, Prado

J, Silva PC, Skog JE, Wiersema JH, Turland NJ (eds). 2006. International Code of Botanical

Nomenclature (Vienna Code). Adopted by the Seventeenth International Botanical Congress,

Vienna, Austria, July 2005. Regnum Vegetabile 146. 568 p. (http://ibot.sav.sk/icbn/main.htm)

Pantidou ME. 1980. Macrofungi in forests of Abies cephalonica in Greece. Nova Hedwigia 32:

709-723.

Peck CH. 1887. New York species of Cantharellus. Bulletin of the New York State Museum of

Natural History 1(2): 34-43.

Persoon CH. 1796. Observationes mycologicae seu descriptiones tam novorum quam notabilium

fungorum exhibitae, vol. 1. Leipzig (Reprint 1967, New York).

Persoon CH. 1797a. Tentamen dispositionis methodicae fungorum in classes, ordines, genera et

familias. Leipzig.

Persoon CH. 1797b. Commentatio de fungis clavaeformibus sistens specierum hus usque notarum

descriptiones cum differentiis specificis. Leipzig.

Persoon CH. 1801. Synopsis methodica fungorum. Gottingen.

Persoon CH. 1825. Mycologia europeae, seu completa omnium fungorum in variis Europaeae

regionibus detectorum enumeratio, methodo naturali disposita, vol. 2. Erlangen.

Gomphus sensu lato reclassified ... 201

Petersen RH. 1967. Evidence on the interrelationships of the families of clavarioid fungi. Transactions

of the British Mycological Society 50: 641-648. doi:10.1016/S0007-1536(67)80096-2

Petersen RH. 1968. Notes on cantharelloid fungi. 1. Gomphus S. F. Gray and some clues to the origin

of the ramarioid fungi. The Journal of the Elisha Mitchell Scientific Society 84: 373-381.

Petersen RH. 1969. Notes on cantharelloid fungi. II. Some new taxa, and notes on Pseudocraterellus.

Persoonia 5(3): 211-223.

Petersen RH. 1971. The genera Gomphus and Gloeocantharellus in North America. Nova Hedwigia

21: 1-118. 1970.

Petersen RH. 1972 [“1971”]. Interfamilial relationships in the clavarioid and cantharelloid fungi.

In RH Petersen (ed.). Evolution in the higher Basidiomycetes. University of Tennessee Press,

Knoxville. Pp. 345-374.

Pine EM, Hibbett DS, Donoghue MJ. 1999. Phylogenetic relationships of cantharelloid and clavarioid

Homobasidiomycetes based on mitochondrial and nuclear rDNA sequences. Mycologia 91(6):

944-963. doi:10.2307/3761626

Schweinitz LD. 1832. Synopsis fungorum in America boreali media degentium. Article VIII.

Transactions of the American Philosophical Society 4: 141-316. doi:10.2307/1004834

Singer R. 1945. New genera of fungi. Lloydia 8: 139-144.

Smith AH, Morse EE. 1947. The genus Cantharellus in the western United States. Mycologia 39:

497-534. doi:10.2307/3755192

Trappe JM. 1960. Some probable mycorrhizal associations in the Pacific Northwest. II. Northwest

Science 34(4): 113-117.

Urbonas VA, Matyalis AA, Gritsyus AI. 1990. Trends of variability of macromycetes, extinguishing

species and principles of their protection in Lithuania. Mycology and Phytopathology 24:

385-388.

USDA/USDI [U.S.D.A. Forest Service; U.S.D.I. Bureau of Land Management]. 1994. Final

supplemental environmental impact statement on management of habitat for late-successional

and old-growth forest related species within the range of the northern spotted owl (Northwest

Forest Plan). Portland, OR.

Valdés-Ramirez M. 1972. Microflora of a coniferous forest of the Mexican basin. Plant and Soil 36:

31-38. doi:10.1007/BF01373453

Voss EG, Burdet HM, Chaloner WG, Demoulin V, Hiepko P, McNeill J, Meikle RD, Nicolson

DH, Rollins RC, Silva PC, Greuter W. 1983. International Code of Botanical Nomenclature.

Adopted by the Thirteenth International Botanical Congress, Sydney, August 1981. Regnum

Vegatabile 111. 472 p.

MYCOTAXON

Volume 115, pp. 203-213 January-March 2011

DOT: 10.5248/115.203

New records of Uredinales from Fairy Meadows, Pakistan

N.S. AFSHAN”, A.N. KHALID™, A.R. Nrazr? & S.H. IQBAL?

Centre for Undergraduate Studies & *Department of Botany,

University of the Punjab, Quaid-e-Azam Campus, Lahore, 54590, Pakistan

CORRESPONDENCE TO *: !pakrust@gmail.com, *drankhalid@gmailcom, *mushroomniazi@gmail.com

ABSTRACT— Puccinia pygmaea var. angusta and P. urticata var. urticata were collected in

Fairy Meadows and are new records for Pakistan. Similarly the aecidial stages of Uromyces

hedysari-obscuri and U. polygoni-avicularis are an addition to the rust flora of this country.

Puccinia alpina, P. leveillei, and P. ribis are redescribed and illustrated from Fairy Meadows.

Key worps — Bistorta vivipara, Nanga Parbat

Introduction

Fairy Meadows in Northern Pakistan is a floristically rich area, from which

about 70 species of rust fungi have been reported (Afshan et al. 2009). During

several extensive surveys of the region, seven plants infected with rust fungi

were collected. Among these, Puccinia pygmaea var. angusta on Calamagrostis

epigejos and P. urticata var. urticata on Carex flacca are new records for Pakistan.

‘The aecidial stages (1) of Uromyces hedysari-obscuri and U. polygoni-avicularis

are also here described as an addition to the rust flora of Pakistan. Puccinia

alpina, P. leveillei, and P. ribis, which represent new records for Fairy Meadows,

are re-described to illustrate important morphological features using scanning

electron microscopy.

Materials & methods

Freehand sections of infected tissue and spores were mounted in lactophenol and

gently heated to boiling. The preparations were observed under a NIKON YS 100

microscope and photographed with a digipro-Labomed and JSM5910 scanning electron

microscope. Drawings of spores and paraphyses were made using a Camera Lucida

(Ernst Leitz Wetzlar, Germany). Spore dimensions were taken by an ocular micrometer.

At least 25 spores were measured for each spore stage. Images were also obtained of the

rust spores using a scanning electron microscope (SEM). The rusted specimens have

been deposited in the herbarium of the Botany Department at the University of the

Punjab, Lahore (LAH).

204 ... Afshan & al.

Taxonomy

Puccinia pygmaea var. angusta Cummins & H.C. Greene, Mycologia 58: 715

(1966). Fic. 1

SPERMOGONIA and AECIA not found. UREDINIA amphigenous, mostly on adaxial

surface, pale brown to golden brown, 0.09-0.3 x 0.1-0.4 mm. UREDINIOSPORES

ellipsoid to broadly ellipsoid or ovoid, 21-25 x 25-29 um; wall 1.5-2 wm

thick, pale yellow to pale brown, echinulate; germ pores obscure, 4-6(-8),

scattered. PARAPHYSES clavate to capitate, peripheral to intermixed, hyaline to

pale brown, 14-18 um wide, to 80 wm long. TELIA amphigenous, covered by

epidermis, dark brown to blackish brown, loculate, 0.09-0.4 x 0.2-0.6 mm.

TELIOSPORES 1-2 celled, clavate or ellipsoid; wall 1.5-2 um thick, cinnamon

brown to chestnut brown, smooth; 15-23 x 42-58 um (mean 16.6 x 47.5 um);

apex mostly truncate, sometimes rounded to conical, 4-6(-7) um thick; germ

pore obscure; pedicel hyaline to pale brown, 5-7 x 8-15 um, one-celled spores

abundant.

B ;

Fic. 1. Lucida drawings of Puccinia pygmaea var. angusta.

(A) Urediniospores and paraphyses. (B) 1-2 celled teliospores. Scale bar = 10 um.

Uredinales new to Fairy Meadows (Pakistan) ... 205

MATERIAL EXAMINED: On Calamagrostis epigejos (L.) Roth (Poaceae), with II and II

stages, Pakistan, Northern Areas, Fairy Meadows, 3036 m, 12 Aug 2007, N.S.Afshan #G

90. (LAH Herbarium NSA 1083).

COMMENTS: Six varieties of P. pygmaea are recognized based on spore size:

P. pygmaea var. ammophilina (Mains) Cummins & H.C. Greene, P pygmaea var.

angusta, P. pygmaea var. chisosana Cummins, P. pygmaea var. major Cummins

& H.C. Greene, P. pygmaea var. minor Cummins & H.C. Greene, and P. pygmaea

Erikss. var. pygmaea (Cummins 1971).

Ahmad (1956a, b) reported P pygmaea on Agrostis munroana Aitch. &

Hemsl. from Kaghan valley, and Afshan & Khalid (2009) reported P. pygmaea

var. pygmaea on Agrostis gigantea Roth from Bara Gali (NWEP). The variety

P. pygmaea var. angusta is a new record for Pakistan.

K—

Fic. 2. Lucida drawings of Puccinia urticata var. urticata.

(A) Urediniospores. (B) Teliospores. Scale bar = 10 tum.

Puccinia urticata F. Kern, Mycologia 9: 214 (1917) var. urticata Fic. 2

SPERMOGONIA and AECIA unknown. UREDINIA mostly hypophyllous, sometimes

amphigenous, on leaves and culms, intermixed with telia. UREDINIOSPORES

ovoid to obovoid or ellipsoid to broadly ellipsoid, 18-24 x 23-31 tm (mean

22.0 x 27.6 um); wall 1.5-2 um thick, pale brown to cinnamon brown, finely

and sparsely echinulate; germ pores 2-4, equatorial; pedicel hyaline, short.

TELIA mostly hypophyllous, rarely amphigenous, intermixed with uredinia,

dark brown to blackish brown, covered by epidermis, 0.1-0.3 x 0.2-0.5 mm.

TELIOSPORES clavate to broadly clavate or oblong, not or slightly constricted

at septum, 14-24 x (38-)42-71 tum (mean 19.2 x 52.5 um); wall 2-3 um thick,

golden brown to chestnut brown, smooth; apex mostly rounded, 9-15 um

206 ... Afshan & al.

thick; germ pores obscure; pedicel hyaline to pale brown, thin walled, 7-10 um

wide and up to 100 um long.

MATERIAL EXAMINED: On Carex flacca Schreb. (Cyperaceae), with II and III stages,

Pakistan, Northern Areas of Pakistan, Fairy meadows, 3036 m, 12 Aug 2007, N.S.Afshan

#74. (LAH Herbarium NSA 1098).

Puccinia urticata var. urticata is a new record for Pakistan.

Fic. 3. Uromyces hedysari-obscuri. (A) Aecium containing aeciospores (B) SEM photograph of an

aecium. (C) Aeciospores with peridial cells. (D) Aeciospores showing verrucose wall ornamentation.

(E) SEM photograph of teliospores. (F) Teliospores showing verrucose wall ornamentation. Scale

bar for E = 0.1 mm.

Uredinales new to Fairy Meadows (Pakistan) ... 207

Uromyces hedysari-obscuri (DC.) Carestia & Picc., in Orbigny, Erb. critt. Ital., Ser.

2, 9: no. 447 (1871). Fras. 3-4

SPERMOGONIA not known. AEcIA mostly caulicolous, gregarious, in rounded

groups. AECIOsPoRES angular to globose, verrucose, hyaline with a yellowish

tinge, 16-21 x 20-24 um; peridial cells hyaline to pale yellow, angular to

rectangular, verrucose, 20-24 x 23-31 um. TELIA amphigenous, mostly

epiphyllous, scattered or gregarious, small, roundish, early naked, surrounded

by aruptured epidermis, dark brown to blackish brown. TELIosporgs globose,

oblong or ellipsoid; 16-19 x 20-29 um; apex rounded, with light colored papilla,

3-6 um thick; wall 1.5-2.5 um thick, dark brown to chestnut brown, verrucose;

germ pores 2, equatorial; pedicel hyaline, short, deciduous, 6-7 x 14-16 um.

MATERIAL EXAMINED: On Hedysarum falconeri Baker (Fabaceae), with I & III stages,

Pakistan, Northern Areas, Fairy Meadows, 3036 m, 125 Aug 2007. N.S.Afshan #G16.

(LAH Herbarium NSA 1006).

The teliospore stage of Uromyces hedysari-obscuri has been reported on the

same host from Fairy Meadows (Sultan 2005). The aecidial stage (1) of this

fungus, which is described here for the first time from Pakistan, is an addition

to our rust flora.

Fic. 4. Lucida drawings of Uromyces hedysari-obscuri.

(A) Aeciospores showing verrucose wall ornamentation. (B) Peridial cells.

Scale bar for A = 5 um, B & C = 10 um.

208 ... Afshan & al.

Fic. 5. Lucida drawings of Uromyces polygoni-avicularis.

(A) Peridial cells. (B) Aeciospores. (C) Urediniospores showing germ pores.

(D) Teliospores. Scale bar = 10 um.

Uromyces polygoni-avicularis (Pers.) P. Karst., Bidr. Kann. Finl. Nat. Folk 4: 12

(1879), as ‘polygoni aviculariae. Fics. 5-6

AscIA hypophyllous, minute, in circular or irregular shaped groups, orange,

cupulate. AEcIosPoREs globose to ellipsoid, verrucose, hyaline to yellow with

orange granules, 15-22 x 18-24 um; peridial cells rhomboid, hyaline to pale

yellow, striate, verrucose, 17-24 x 23-29 um. UREDINIA amphigenous, scattered

or gregarious, minute, roundish, brown to cinnamon brown, 0.09-0.3 x 0.2-0.8

mm. UREDINIOSPORES globose to subglobose or ellipsoid, 18-24 x 20-29 um;

wall 1.5-3.0 um thick, golden brown to cinnamon brown, verruculose; germ

pores 2-4, equatorial. TELIA amphigenous, small, scattered or gregarious, on

leaves and stem, roundish or oblong, blackish brown, 0.1-0.5 x 0.2-0.8 mm.

TELIOSPORES subglobose, ovate or ellipsoid, 18-24 x 22-31(-35) wm; apex

rounded or truncate, 4-6 tm thick; wall 2-3 wm thick, smooth, golden brown

to chestnut brown; germ pore, apical or sub-apical; pedicel hyaline to pale

yellow, persistent, 8-10 x 90-104 um.

MATERIAL EXAMINED: On Bistorta vivipara (L.) Delarbre (Polygonaceae), with II &

III stages, Pakistan, Northern Areas, Bial camp (Nanga Parbat base camp), 11 Aug

2007. N.S.Afshan #G10. (LAH Herbarium NSA 1008). On Polygonum aviculare L.

Uredinales new to Fairy Meadows (Pakistan) ... 209

Fic. 6. Uromyces polygoni-avicularis. (A) SEM photograph of an aecium. (B) An aeciospore showing

verrucose wall ornamentation. (C) SEM photograph of a uredinial sorus. (D) SEM photograph of a

urediniospore showing verrucose wall ornamentation. (E) SEM photograph of a telium containing

teliospores. (F) Teliospores.

(Polygonaceae), with I & III stages, Pakistan, Northern Areas, Fairy Meadows, 3036 m,

12 Aug 2007. N.S.Afshan #G02. (LAH Herbarium NSA 1007)

The uredinial and telial stages of Uromyces polygoni-avicularis were previously

reported on Polygonum aviculare from Kaghan and Quetta valleys and on

Bistorta vivipara (as P. viviparum L.) from Hazara, Madian, and Swat (Ahmad

et al. 1997). The aecidial stage represents a new record for Pakistan

210 ... Afshan & al.

Fic. 7. A-B. Puccinia alpina. (A) SEM photograph of telium showing teliospores. (B) Teliospores

showing striately verrucose wall ornamentation. C—D: Puccinia leveillei. (C) SEM photograph of a

telium (D) Teliospores showing verrucose wall ornamentation.

Puccinia alpina Fuckel, Jahrb. Nassauischen Vereins Naturk. 27-28: 13 (1873).

Fre. 7A-B, 8A

SPERMOGONIA, AECIA and UREDINIA unknown. TELIA hypophyllous, scattered

or loosely clustered, small roundish, soon naked, pulvinate, dark brown to

blackish brown, 0.08-0.1 x 0.2-0.8 mm. TELrosporss ellipsoid to oblong or

clavate, rounded at both ends or sometimes attenuated downwards, not or

slightly constricted at septum, base roundish or narrowed, 16-26 x (25-)31-50

um; wall 1.5-2 um thick, verrucose, golden brown to chestnut brown; apex

3-5 «um thick, pale in color; germ pore 1 per cell, germ pore of both cells near

septum or sometimes apical cell, with hyaline umbo over each pore; pedicel

hyaline, deciduous, up to 25 um long and 5-6 um wide.

MATERIAL EXAMINED: On Viola biflora L. (Violaceae), with III stage, Pakistan, Northern

Areas, Fairy Meadows, 3036 m, 12 Aug 2007. N.S.Afshan #G 08. (LAH Herbarium NSA

1005).

Ono (1992) previously reported Puccinia alpina on Viola rupestris FW. Schmidt

from Kaghan valley. The above collection is a new record for Fairy Meadows.

Uredinales new to Fairy Meadows (Pakistan) ... 211

Fic. 8. (A) Lucida drawing of teliospores of Puccinia alpina.

(B) Lucida drawing of teliospores of Puccinia leveillei.

Scale bars = 10 um.

Puccinia leveillei Mont., in Gay, Hist. Fis. Polit. Chile 8: 41 (1852). Fic. 7C-D, 8B

= P geranii-sylvatici P. Karst., Enum. Fung. Lapponia: 220 (1866).

SPERMOGONIA, AECIA and UREDINIA unknown. TELIA mostly amphigenous,

0,2-0.4 x 0.2-0.6 mm, dark brown. TELIOsPoREs mostly two-celled, sometimes

three-celled; ellipsoid to clavate, not or slightly constricted at septa, 14-23 x

30-44(-47) um; wall 2-3 wm thick, densely verrucose, brown to chestnut

brown; apex rounded or truncate, 4-5 um thick; germ pore of upper cell mostly

apical, sometimes sub-apical, of lower cell near pedicel; pedicel short, hyaline,

8-9 x 10-15 um.

MATERIAL EXAMINED: On Geranium sibiricum L. (Geraniaceae), with III stage, Pakistan,

Northern Areas, Fairy Meadows, Bial camp (Nanga Parbat base camp) 3036 m, 12 Aug

2007. N.S.Afshan # G13. (LAH Herbarium NSA 1010).

212 ... Afshan & al.

Ahmad 1956a reported P leveillei on Geranium pratense L., G. collinum Stephan

ex Willd., G. rectum Trautv., and G. eglandulosum Dalla Torre from Kaghan,

Kalam, Baltistan, and Barum valleys. This above collection represents a new

record from Fairy Meadows (Bial camp); Geranium sibiricum is a new host

species in Pakistan.

Fic. 9. Lucida drawing of Puccinia ribis.

1-2 celled teliospores showing verrucose wall ornamentation. Scale bar = 10 um.

Puccinia ribis DC., FI. frang., 3e Ed., 2: 221 (1805). Fic. 9

SPERMOGONIA unknown, AECIA and UREDINIA absent. TELIA epiphyllous,

surrounded by a discolored yellow zone, circinate, pulverulent, 0.9-3 x 3-5

mm, chestnut brown. TELIospoREs ovoid or oblong to ellipsoid, rounded

above and below, hardly constricted, 15-24 x 20-35 wm; wall 1.5-2.5 um thick

at sides and 4-5 um thick at apex, verrucose, chestnut brown; germ pores

1 per cell, apical in upper cell with a hyaline papilla, pore of lower cell usually

basal; pedicels hyaline, deciduous, 4-5 x 18-25 um. A few one-celled spores

also observed.

MATERIAL EXAMINED: On Ribes nigrum L. (Grossulariaceae), with III stage, Pakistan,

Northern Areas, Fairy Meadows, 3036 m, 12" Aug 2007. N.S. Afshan # G14. (LAH

Herbarium NSA 1011).

Ahmad 1956a reported P. ribis on Ribes rubrum L. from Swat, Kalam, and

Hazara. Our collection represents a new record from Fairy Meadows.

Acknowledgements

We sincerely thank Dr. Amy Rossman, Systematic Mycology and Microbiology

Laboratory, USDA-ARS, Beltsville, and Omar Paino Perdomo, Dominican Mycological

Society, Santo Domingo, for their valuable suggestions to improve the manuscript and

acting as presubmission reviewers. We are thankful to Dr. Asim Sultan for help in the

field. We are highly obliged to Higher Education Commission (HEC) of Pakistan for

providing financial support.

Uredinales new to Fairy Meadows (Pakistan) ... 213

Literature cited

Afshan NS, Khalid AN. 2009. New records of Puccinia and Pucciniastrum from Pakistan. Mycotaxon

108: 137-146.

Afshan NS, Khalid AN, Iqbal SH, Niazi AR, Sultan A. 2009. Puccinia subepidermalis sp. nov. and

new records of rust fungi from Fairy Meadows, Northern Pakistan. Mycotaxon 110: 173-182.

Ahmad S. 1956a. Uredinales of West Pakistan. Biologia 2: 29-101.

Ahmad S. 1956b. Fungi of Pakistan. Biological Society of Pakistan, Lahore Monograph 1: 1-126.

Ahmad §, Iqbal SH, Khalid AN. 1997. Fungi of Pakistan. Nabiza Printing Press, Karachi, Pakistan.

Cummins GB. 1971. The rust fungi of cereals, grasses and bamboos. Springer Verlag, Berlin-

Heidelberg—New York.

Ono Y. 1992. Uredinales collected in the Kaghan Valley, Pakistan. Cryptogamic Flora of Pakistan

1: 217-240.

Sultan MA. 2005. Taxonomic study of rust flora of Northern Areas of Pakistan. Ph.D. Thesis,

University of the Punjab. Lahore, Pakistan.

MYCOTAXON

Volume 115, pp. 215-226 January-March 2011

DOT: 10.5248/115.215

Observations on Melanoleuca. Type studies - 3

ROBERTO FONTENLA’* & ROBERTO PARA ”

1 Via Monte Marino, 26 - I 60125 Ancona, Italy

? Via Martiri di via Fani, 22 - 1 61024 Mombaroccio (PU), Italy

CORRESPONDENCE TO *: pimpinella@tin.it

AssTRACT — The results of type studies on several taxa of the genus Melanoleuca are reported

and discussed: Melanoleuca substrictipes, M. polioleuca, M. alutaceopallens, M. permixta, M.

wrightii, M. lapataiae, and M. lapataiae var. ochroleuca. For the first two taxa a lectotype and

a neotype are designated respectively.

Key worps — taxonomy, Tricholomatales

Introduction

Type materials of sixteen critical Melanoleuca taxa have already been

discussed in two previous publications (Fontenla & Para 2007, 2008). Fontenla

& Para (2007) reported on M. diverticulata G. Moreno & Bon, M. electropoda

Maire & Malencon, M. kavinae (Pilat & Vesely) Singer, M. meridionalis

G. Moreno & Barrasa, M. metrodii Bon, M. nigrescens (Bres.) Bon, and

M. pseudobrevipes Bon. Fontenla & Para (2008) discussed Melanoleuca decembris

Métrod ex Bon, Tricholoma humile var. bulbosum Peck, M. luteolosperma

(Britzelm.) Singer, Clitocybe nobilis Peck, M. pseudopaedida Bon, M. decembris

var. pseudorasilis Bon, M. subalpina (Britzelm.) Bresinsky & Stangl, M. subdura

(Banning & Peck) Murrill, and M. tucumanensis Singer.

In this paper we hope to shed new light on seven more taxonomically critical

taxa and designate one lectotype and two neotypes to clarify relationships of

the three taxa to their closest allies.

Materials & methods

Microscopical characters were examined using a Leitz Biomed optical microscope

equipped with 100x, 500x and 1000x lenses; a stereomicroscope mod. MbC-10 was

used to make thin sections. The pileipellis was sectioned from radial sections of the

pileus margins, and the stipitipellis was sectioned from longitudinal sections of the

medial third of the stipe. Sections were routinely revived in L4, stained in Phloxine B,

216 ... Fontenla & Para

and tested for amyloidity in Melzer’s. Micrographs were made using a Nikon Coolpix

4500 digital camera. Throughout all text, citations in quotes (“..”) comes from the

original protologues (even if incorrect), except that the en-dash (—) is substituted to

separate data.

The systematic framework adopted follows Bon (1991) with some personal

changes.

Taxonomy

Melanoleuca substrictipes Kubner, Bull. Soc. Linn. Lyon 47(1): 52. 1978. Fic. 1

ORIGINAL DIAGNosIs: Pileus 25-105 mm latus, carnosulus, e convexo expansus, saepe

obtuse umbonatus, jove pluvio albus vel eburneolo albus, sed mox albus, demum saepe

alutaceus vel subisabellinus. Stipes 17-80 mm altus, 4-14 mm crassus, subaequalis,

albus, glaber, apice subtiliter pruinosus, solidus vel farctus. Lamellae confertae, plus

minusve sinuatae vel emarginatae, albidae. Odore spermatico. Sporae 8-10 x 5-6.5 um,

ellipsoideae, modice elongatae, asperulae. Cystidiae fusoideae-subcuspidatae, angustae,

inferne 5-9 um, superne 2-3 um latae, septatae. In pascuis alpinis, frequens. Typus Herb.

Kiihner, n° 66-13.

SPECIMEN STUDIED — “Herbier R. Kthner (G) — Melanoleuca substrictipes R. Kiuhner

— F - Savoie — Parc Nat. de la Vanoise, environs de Pralognan — Entre le Pas de LAne

et le Cirque des Nants — Alt.: 1900 — « K 66-13 » — Leg./Det. : R. Ktthner — 20-07-1966”

lectotypus, hic designatus. [G, Conservatoire et Jardin botaniques de la ville de Genéve,

GENEVA, Switzerland]. Revision date: 26 August 2008.

(MACROCHARACTERS, see Ktihner 1978: 46-49).

MICROCHARACTERS —Basidiospores 7.2-9.6 x 4.8-6.0 tum; av. = 8.60 x 5.55

uum; Q = 1.35-1.75; Qm = 1.55; ellipsoid, with small, dense, isolate and rounded

warts, without a suprahilar plage. Basidia 31-33 x 7-8 um, clavate, 4-spored.

Cheilocystidia 45-55 x 6-8 um, rare, urticiform, with a thin wall, hyaline,

sometimes with incrusted apex. Pleurocystidia not seen. Stipitipellis made up

of long, narrow hyphae, intermixed with shorter ones constricted at septa, with

scattered short, clavate or cylindroid cells, not in clusters; caulocystidia not

seen. Pileipellis a cutis of interwoven hyphae, without emergent elements, with

a thin gelatinized suprapellis. Dermatocystidia and thromboplerous hyphae

absent. Clamp connections absent.

COMMENTS - The authentic material kept in Geneva (G) is subdivided into

two portions. “Pr. 66-13” is composed of fragments of several pilei and stipes

and is difficult to study; “66-13 lot B” consists of basidiomata sections, all in

good state. Each part is accompanied by various barely legible hand-written

notes, interpreted for us by Pierre Arthur Moreau: Envelope 66-13 (Fic. 1)

— “Melanoleuca Pr.66-13 (Pr is for Pralognan, the name of the locality in the

Vanoise National Park), 20 July 1966, 17 carpophores (remarquable qualité !)

Odeur vite aigrelette bolétoide” Envelope 66-13 lot B— “Melanoleuca Pr 66.13,

lot B, 3 exemplaires. 20 July 1966. Sirement pas spermatique en coupe!”

Type studies of Melanoleuca ... 217

Figure 1. Melanoleuca substrictipes. 66-13 envelope (lectotypus).

However, it seems clear that the two parts represent two different collections

made the same day - 20 July 1966 - and that Kthner decided to separate them

due to differences in appearance and odor. In Pr. 66-13, we observed urticoid

(fusoid) cystidia, as reported in the protologue, while in 66-13 “lot B’, we noted

numerous fusoid macrocystidia, very different from those in the Pr. 66-13

basidiomata.

The indication of the “aigrelette boletoide” odor for Pr. 66-13 matches the

protologue description (Kithner 1978: 370), while the “lot B” spermatic odor

(“stirement pas spermatique”) contradicts “souvent distinctement spermatique

apres la coupure” noted in the protologue.

Based on ICBN Arts. 9.9 and 9.12 (McNeill et al. 2006), we here designate

the portion of the original material marked Pr. 66-13 as lectotype of M.

substrictipes, since the protologue is also based on this material and it fits the

protologue very well.

Melanoleuca favrei Bon is a closely related species with longer spores (Qm =

1.71, as confirmed by our type study).

Other similar European species are M. substrictipes var. sarcophylla Kihner

and M. pseudoevenosa Bon ex Bon & G. Moreno, which have ochraceous gills

at maturity and spore ratios of Qm = 1.56 and 1.72, respectively. Comparable

extraeuropean species are M. conspurcata (Berk. & Broome) Pegler and M.

tropicalis Pegler, which our type studies showed to have spore ratios of Qm

= 1.48 and 1.65, respectively. We need more data to confirm whether these

differences are taxonomically significant.

218 ... Fontenla & Para

Melanoleuca alutaceopallens (P. Karst.) Konrad & Maubl., Icon. Select. Fung.

6(10): 324. 1937.

= Tricholoma melaleucum var. alutaceopallens P. Karst.,

Medd. Soc. F. Fl. Fenn. 9: 40. 1882.

= Tricholoma melaleucum subsp. alutaceopallens (P. Karst.) Sacc.., Syll. Fung. 5: 135. 1887.

= Tricholoma alutaceopallens (P. Karst.) P. Karst., Medd.

Soc. E. Fl. Fenn. 16: 85. 1890 (“1889”).

ORIGINAL DIAGNOSIS: Pileus carnosus, mollis, econvexo planus, obsolete umbonatus, laevis,

glaber, alutaceopallens, vix hygrophanus, circ. 7 cm. latus. Stipes farctus, rigidofragilis,

strictus, aequalis, basi incrassatus, primitus squamutloso-fibrillosus, glabrescens, apice

pruinosus, albidus, demum nigrescens, 6-7cm. longus, 4-5 mm. crassus. Lamellae

emarginatae, planae, horizontales, rectae, lineares, sat angustae, admodum confertae,

integerrimae, albae, 4—5 mm. latae. Caro alba, mollis, non hygrophana. In clivis sterilibus

prope Mustiala, m. Sept. 1882.

SPECIMEN STUDIED: “Museum Botanicum Universitatis, Helsinki (H) — Herbarium

Petter Adolf Karsten (1834-1917) #5270 — (Tricholoma) n-sp. — Tricholoma melaleucum

(Pers.) var. - FINLAND. ETELA-HAME (EH/Ta). Tammela. Mustiala — Grid 27° E: — [no

date] — leg. & det. P.A. Karsten — (H6003411)”, neotypus, hic designatus (H). Revision

date: 7 February 2008.

(MACROCHARACTERS, see Karsten 1882: 40).

MICROCHARACTERS — Basidiospores 7.8-10.8 x 4.8-6.2 tum; av. = 8.82 x 5.73

um; Q = 1.25-2.00; Qm = 1.55; subglobose or subcylindrical, with small or

medium, weakly amyloid warts, which are dense, isolate, rounded, rarely, with

well-delimited suprahilar plage. Basidia 23-30 x 7-10 um, clavate, 4-spored.

Cheilocystidia numerous, macrocystidia type, 65-85 x 12-19 um, lageniform

or fusoid in shape, thin-walled, with crystals at apex. Pleurocystidia scarce,

similar to cheilocystidia. Stipitipellis made up of hyphae up to 240 x 20 um,

without emergent elements or caulocystidia. Pileipellis made up by interwoven

hyphae, with conspicuous yellow-tawny intracellular pigment. Dermatocystidia

and thromboplerous hyphae absent. Clamp connections absent.

CoMMENTS - ‘The type collection is composed of three entire basidiomata

in good condition. No collection date is noted on the specimen envelope,

but the locality, which is included, agrees with the original diagnosis (“prope

Mustiala”). Karsten’s envelope bears the herbarium number “5270”, but the

material is filed at H with the number H6003411. As we cannot assume that

Karsten’s original description is based on H6003411, it cannot be selected as

a lectotype. However, given the lack of other material suitable for a lectotype

selection, we think that the above collection can be designated as the neotype

of Tricholoma melaleucum var. alutaceopallens.

This species is difficult to separate from other representatives of the same

subgenus, which seem to differ mainly on macroscopical features that are lost

in drying (pileus colour etc.): e.g, M. melaleuca (Pers.) Murrill, M. cavipes

Métrod ex Bon, M. pallidicutis Bresinsky.

Type studies of Melanoleuca ... 219

Karsten (1890) also described Tricholoma alutaceopallens var. stercorarium,

which has not yet been transferred to Melanoleuca and which differs from the

typical form (var. alutaceopallens) in darker pileus color and growth on dung.

Melanoleuca polioleuca (Fr.) Kihner & Maire, Bull. trimest. Soc. mycol. Fr.

50: 18 (1934).

= Agaricus melaleucus var. polioleucus Fr., Syst. Myc. 1: 115. 1821.

= Agaricus polioleucus (Fr.) Pass., Nuovo Giorn. Bot. Ital. 4: 58. 1872.

= Tricholoma melaleucum var. polioleucum (Fr.) Gillet, Les Hyménomycetes: 128. 1874.

= Tricholoma melaleucum subsp. polioleucum (Fr.) Sacc., Syll. Fung. 5: 134. 1887.

= Tricholoma polioleucum (Fr.) Lapl., Dict. Iconogr. Champ. Sup.: 339. 1894.

= Melanoleuca vulgaris var. polioleuca (Fr.) Konrad &

Maubl., Icon. Select. Fung.6(10): 322. 1937.

= Melanoleuca melaleuca var. polioleuca (Fr.) J. Favre, Ergebn. wiss. Unters.

schweiz. Nat. Parks 6(42): 441. 1960, comb. inval. (basionym lacking).

ORIGINAL DIAGNOsIs: A. melaleucus y. polioleucus, pileo griseo-livido, lamellis sordide

albis, stipite subfarcto brevi, apice albo-pruinato. Constanter utique ab a. diversus nec

elegans; sed e solo locoque diverso ortum puto; plurima enim utrique specei communia.

Stipes 2 unc. longus, 2-3 lin. crassus, equalis, sat firmus. Pileus obtuse umbonatus. Lam.

late. Accedit ad A. oreinum, ut A. melaleuc. ad A. humilem. In regionibus depressis,

campestribus, locis graminosis. (Lund, Alnarp etc) Oct. Nov. (v.v.)

SPECIMEN STUDIED: “Mus. Botan. Stockholm. — Fungi suecici — Tricholoma polioleuca

— Smaland: Femsjé s:n, Femsjé, Hagnen, Grytskedsangen, aker. — 4.8.48 — G. Haglund

et Seth Lundell — (S) reg. nr. F70162”, neotypus, hic designatus (S). Revision date: 1

October 2008.

(MACROCHARACTERS, see Fries 1821: 115).

MICROCHARACTERS - Basidiospores 6.0-8.4 x 3.8-4.8 um; av. = 7.24 x

4.66; Q = 1.30-1.88; Qm = 1.56; with small, dense, amyloid warts, which are

isolate and rounded, more rarely elongated, with well-delimited suprahilar

plage. Basidia 28-33 x 8.5-9.5 um, clavate, 4-spored. Cheilocystidia 50-70 x

12-17 um, frequent, mostly fusiform, thin-walled. Stipitipellis made up of long,

narrow hyphae, with scattered, small clusters of short, clavate cells, intermixed

with caulocystidia, which are similar to cheilocystidia. Pileipellis made up of

a thick ixocutis. Dermatocystidia and thromboplerous hyphae absent. Clamp

connections absent.

CoMMENTSs - ‘The type collection comprises four entire basidiomata in good

condition. These specimens were collected in the same place where Fries

used to collect and its micromorphological features match those proposed by

nearly all authors as characterizing the taxon “polioleucus” (see Métrod 1949,

Singer & Clémencon 1972, Bresinsky & Stang] 1977, Kithner 1978, Enderle &

Krieglsteiner 1987, Bon 1991, Gulden 1992, Moreno et al. 1994, Lonati 1998,

Watling & Turnbull 1998, Boekhout 1999, Grilli & Lanzoni 1999, Fontenla et

al. 2001, Munzmay 2005, Caroti et al. 2006, Vesterholt 2008). Therefore, since

220 ... Fontenla & Para

there is no original material available, this collection is here proposed as the

neotype of Agaricus melaleucus var. polioleucus.

Melanoleuca melaleuca has white flesh, a non-pruinose stipe, and usually

grows in the forests; M. subpulverulenta (Pers.) Singer has lageniform cystidia,

a grey pileus, and grows in the forests; M. heterocystidiosa (Bon & Beller) Bon

has grey pileus and fusiform or lageniform cystidia; M. polioleuca f. langei

Boekhout differs from the typical form only in the relatively short stipe;

M. polioleuca f. pusilla Boekhout & Kuyper is smaller and grows in grassland;

and M. polioleuca var. confusa G. Moreno has pale stipe flesh and grows under

coniferous trees.

Neotypes should be designated for the last two taxa, as their holotypes

are believed to be missing (personal communication by L and AH herbaria

curators).

Melanoleuca permixta Raithelh., Hong. Argentin. 1: 139. 1974. Fic. 2

ORIGINAL DIAGNOSIS: Pileo sordidae pallido, centro fusco, convexo-umbonato, glabro,

4-5 cm lato. Odore grato, sapore miti. Lamellis cremeis, sinuatis(-adnatis), subdistantibus.

Stipite pallido, cavo, 4-5 cm/6-8 mm, carne pallida. Sporis in cumulo candidis, amyloides,

subverrucosis, 7.5—9/4.5-6 my. Cheilocystidiis nullis. Pratis, autumno.

Typus: Veronica/Prov. Buenos Aires nitmero MeA-10472 in herb. mihi conservatur.

SPECIMEN STUDIED: “M. permixta, nr. 104-72”, holotype (Z+ZT). Revision date: 3

September 2008.

(MACROCHARACTERS, see Raithelhuber 1974: 139).

MICROCHARACTERS — Basidiospores 8.2-9.8 x 5.0-6.2 tum; av. = 8.58 x 5.77 um;

Q = 1.35-1.78; Qm = 1.49; with thick, dense, isolate, amyloid warts, rounded

or more rarely elongated in shape, with well-delimited suprahilar plage. Basidia

28-31 x 7-8 um, clavate, 4-spored or 2-spored. Cheilocystidia 37-55 x 7-10

um, frequent, urticoid (fusoid-shaped), thin-walled, often with crystals at the

apex. Pleurocystidia similar to cheilocystidia, frequent, especially in the sinus of

lamellae. Stipitipellis made up of long, narrow hyphae, with numerous clusters

of short, clavate or cylindraceous cells. caulocystidia not seen. Pileipellis made

up of interwoven hyphae, with some ascending but not emergent elements.

Dermatocystidia and thromboplerous hyphae absent. Clamp connections

absent.

ComMMENTSs - ‘The type collection is composed of two-thirds of a basidiome

in good condition. In the protologue Melanoleuca permixta is described as

an acystidiate species, but we found urticoid cystidia in the original material

studied (Fic. 2), which would place this species in subgenus Urticocystis. This

species is close to M. exscissa (Fr.) Singer owing to its colours and microscopic

features, but the lack of further collections does not allow us to evaluate the

variability of such features or to propose synonymy.

Type studies of Melanoleuca ... 221

Ficure 2. Melanoleuca permixta. Cystidia.

Melanoleuca wrightii Raithelh., Metrodiana 2(4): XXVII. 1971. Fic. 3

ORIGINAL DIaGNosis: Pileo pallide griseo, centro suboscuriore, convexo depressove,

gibboso, flexuoso, subviscoso, deinde nitente, 5—6.5 cm lato. Carne albida. Odore subingrato,

sapore miti. Lamellis cremeis vel pallide griseis, basi clarioribus, 6-8 mm latis, adnatis vel

dente decurrentibus, medio distantibus. Stipite cremeo, sursum suboscuriore; subfibrilloso,

farcto, 2-3 cm longo, 5-7 mm lato. Sporis amyloideis, in cumulo albis, 8.5-11/6-6.5 my,

subasperis. Ap. Fraxinum in hortis; autumno.

Typus: Palermo/Buenos Aires. Sub numero MeA-3470 in herb. mihi conseryv.

SPECIMEN STUDIED: “M. wrightii, nr. 3470”, holotype (Z+ZT). Revision date: 3 September

2008.

(MACROCHARACTERS, see Raithelhuber 1971: XXVII).

MICROCHARACTERS — Basidiospores 7.4-9.6 x 4.8-6.2 Lum; av. = 8.68 x 5.68 um;

Q = 1.20-1.80; Qm = 1.53; with thick, dense, isolate, amyloid warts, rounded

or rarely elongated in shape, with well-delimited suprahilar plage. Basidia 33-

38 x 8-9 um, clavate, 4-spored or 2-spored. Cheilocystidia 35-50 x 8-10 um,

numerous, urticoid (typical in shape), thin-walled and with incrustated apex.

Pleurocystidia very rare, similar to cheilocystidia. Stipitipellis with scattered,

large clusters of short, clavate cells, intermixed with frequent urticoid (fusoid-

shape) caulocystidia, 30-45 x 7-8 um. Pileipellis made up of a trichoderm

of ascendant cylindrical hyphae bearing apex-rounded terminal elements.

Dermatocystidia and thromboplerous hyphae absent. Clamp connections

absent.

222 ... Fontenla & Para

Ficure 3. Melanoleuca wrightii. Cystidia.

ComMENTs - The type collection consists of one entire basidiome and one

single pileus without stipe, all in good condition.

In the protologue the author does not record the presence of cystidia, but

the original material exhibits typical cystidia (Fic. 3); accordingly, we place

M. wrightii in subgenus Urticocystis. Like M. permixta, this species is close to

M. exscissa, but the lack of further collections does not allow to estimate the

variability of such features and to propose the synonymy.

Melanoleuca lapataiae Raithelh., Metrodiana 2(4): XXVI. 1971. Fic. 4

ORIGINAL DIAGNosiIs: Pileo lilacino-griseo vel albido cum centro pallide lilacino-griseo,

interdum maculoso, margine clariore, + gibboso, convexo, deinde depresso, glabro, vel

partim nitido vel leviter tomentoso, interdum subsquamuloso; carne albida, sub cuticula

+ lilacina-grisea. — 3-5 cm lato. Odore nullo, sapore miti. Lamellis albidis, nunc adnatis

nunc dente decurrentibus nunc subliberis, saepe basi coniunctis. Stipite albido, interdum

leviter grisaceo, primo farcto, adulto cavo, crustato, superficie leviter fibrilloso, rarior basi

subbulboso, 3-4 cm longo, 4-10 mm lato; carne albida. Sporis amyloideis, in cumulo

albidis vel candidis, asperis, 7-8.5/4.5-5.5 um, ovoideis. Cheilocystidiis fibulisque nullis.

Pascuis, partim cum Nothof. dombeyo.

Typus: Lapataia/Argentina prope Hosteria Alakush. Sub numero MeA-271 in herb.

mihi conserv.

SPECIMEN STUDIED: “M. lapataiae — Nr. 271’, holotype (Z+ZT). Revision date: 19 August

2008.

(Macrocharacters, see Raithelhuber 1971: xxvi-xxvii).

Type studies of Melanoleuca ... 223

Ficure 4. Melanoleuca lapataiae. Cystidia.

MICROCHARACTERS — Basidiospores 8.2-10.8 x 4.8-6 tum; av. = 9.48 x 5.79

um; Q = 1.36-2.05; Qm = 1.64; with small, dense, isolate, rounded amyloid

warts, with poorly developed but obvious suprahilar plage. Basidia 43-52

x 10-12 um, clavate-elongate, 4-spored. Cheilocystidia 43-65 x 7-8 um,

abundant, macrocystidia type, fusoid, many of them bearing a septum, thin-

walled, and with an encrusted apex. Pleurocystidia present but less numerous

than cheilocystidia, even if very similar in size and shape. Stipitipellis made up

of long, narrow hyphae, with frequent cylindrical cells, isolate or in clusters.

caulocystidia not seen. Pileipellis made up of a trichoderm of ascendant hyphae

with rounded and/or strangled terminal elements. Dermatocystidia and

thromboplerous hyphae absent. Clamp connections absent.

CoMMENTS - ‘The type collection includes two entire basidiomata in good

condition. Raithelhuber did not record the presence of cystidia for this species,

either in the protologue (Raithelhuber 1971) or in two subsequent papers

citing this agaric (Raithelhuber 1972, 1987). However, in a later description

(Raithelhuber 1993), he wrote: “Cheilo (and pleuro?) cystidia 40-55/5-7 um,

fusiform, with thin wall.”

These contradictions have so far made it impossible refer M. lapataiae to a

subgenus. Study of the holotype (Z+ZT) allowed us to ascertain that M. lapataiae

exhibits very unusually shaped cystidia (Fic. 4), which make it difficult to assign

to any of the currently accepted cystidial types for Melanoleuca. We have never

seen such cystidia in any of the very numerous collections of Melanoleuca we

have examined. Due to its peculiar size and shape — always fusoid and mostly

224 ... Fontenla & Para

septate — M. lapataiae takes an intermediate position between the subgenera

Urticocystis and Melanoleuca. Only further studies, especially those based on a

molecular approach, will provide further data on its taxonomic treatment.

Melanoleuca lapataiae var. ochroleuca Raithelh., Metrodiana Sonderheft 1: 16.

1972.

ORIGINAL DIAGNOsIs: Differt M. lapataiae pileo albo-ochraceo vel cremeo, umbo +

ochraceo, basi stipiti subaurantio-croceo in adultis et sporis 6.5-7.5 x 3.2-5 my.

Typus: Lapataia, ripo Lago Rocae, sub numero MeA-371 in herb. mihi conserv.

SPECIMEN STUDIED: “M. lapataiae var. ochroleuca, nr. 3-71”, holotype (Z+ZT). Revision

date: 19 August 2008.

(MACROCHARACTERS, see Raithelhuber 1972: 16).

MICROCHARACTERS — Basidiospores 8.4-10.8 x 5.0-6.0 um; av. = 9.21 x

5.67 um; Q = 1.44-1.90; Qm = 1.63; with small to medium, dense, isolate,

rounded, amyloid warts, with poorly developed but obvious suprahilar plage.

Basidia 31-36 x 5-8 um, clavate, 4-spored or 2-spored. Cheilocystidia 40-65

x 8-11 um, not very frequent, macrocystidia type, fusoid, partially septate (in

approximately 50% of cases), sometimes with encrusted apex, thin-walled,

hyaline. Pleurocystidia very rare, similar to cheilocystidia. Stipitipellis made

up of long, narrow hyphae, with frequent cylindrical cells, isolate or in clusters,

caulocystidia not seen. Pileipellis made up of a cutis of interwoven hyphae,

with some scattered, rising but not emerging elements. Dermatocystidia and

thromboplerous hyphae absent. Clamp connections absent.

COMMENTS - The type collection is composed of an almost entire pileus and the

stipe apex, all in good condition. The basidiospore size recorded in the original

diagnosis is wrong, according to a personal communication by J. Raithelhuber,

who states that the correct size is “10-11 x 5-7.5 um? which was confirmed by

our study of the original material.

Melanolecua lapataiae var. ochroleuca showed us the same micromorphology

as that of M. lapataiae var. lapataiae, except for the different pileipellis structure.

We think that it is correct to regard these as two taxa separated by differences

in the pileipellis structure and colors of the pileus and stipe base. The peculiar

cystidial morphology of these varieties prevents placement in any of the

currently named subgenera and suggests erection of a new subgenus; however,

because it was not possible to obtain comparable molecular sequences from

the two specimens due to age, we prefer to wait for collection of fresh material

before suggesting taxonomic changes.

Acknowledgments

We want to express our gratitude to Marco Contu for his encouragement and precious

advice, and to Fabio Taffetani, curator at ANC; Philippe Clerc, curator at G; Anna-Lena

Type studies of Melanoleuca ... 225

Anderberg, curator at S; Tuomo Niemeli, curator at H; Reinhard Berndt, curator at

Z+ZT for providing us with the material requested. Our most sincere thanks are due to

Pierre Arthur Moreau and Fernando Esteve Raventés for their pre-submission reviews.

Edmondo Grilli is thanked for improvements in the English text.

Literature cited

Boekhout T. 1999. Melanoleuca Pat., Cat. Rais. Pl. cell. Tunésie: 22. 1897 (nom. conserv.). Flora

Agaricina Neerlandica 4: 153-165.

Bon M. 1991. Flore mycologique d'Europe 2. Tricholomes et ressemblants. Documents

Mycologiques, Mémoire hors série 2. Amiens.

Bresinsky A, Stangl J. 1977. Beitrage zur Revision M. Britzelmayrs “Hymenomyceten aus Stidbayern”

13. Zeitschrift fiir Pilzkunde 43: 145-173.

Caroti V, Consiglio G, Contu M, Fontenla R, Gottardi M, Para R. 2006. Contributo alla conoscenza

dei Macromiceti del? Emilia-Romagna. XXII. Genere Melanoleuca. Bollettino dell Associazione

Micologica ed Ecologica Romana 22(67): 9-39.

Enderle M, Krieglsteiner GJ. 1987. Uber neue, seltene, kritische makromyceten in der

Bundesrepublik Deutschland (Mitteleuropa) VUI. Mitteilungsblatt der Arbeitsgemeinschaft

Pilzkunde Niederrhein 5(1): 7-29.

Fontenla R, Para R. 2007. Osservazioni sul genere Melanoleuca. Studio dei typi — I. Rivista di

Micologia 50 (3): 221-236.

Fontenla R, Para R. 2008. Osservazioni sul genere Melanoleuca. Studio dei typi — II. Rivista di

Micologia 51 (2): 147-162.

Fontenla R, Gottardi M, Para R. 2001. Osservazioni sul genere Melanolueca. 1° contributo. Rivista

di Micologia 43 (1): 27-41.

Fries EM. 1821. Systema mycologicum vol. 1. Lund.

Grilli E, Lanzoni G. 1999. Specie interessanti dellerbario Lanzoni. Fungi non delineati, pars VII.

Alassio.

Gulden G. 1992. Melanoleuca Pat. Nordic Macromycetes 2: 148-150

Karsten PA. 1882. Symbolae ad mycologiam fennicam. IX. Meddelanden af Societatis pro Fauna et

Flora fennica 9: 39-56.

Karsten PA. 1890 (“1889”). Symbolae ad mycologiam fennicam. Pars XXIX. Meddelanden af

Societas pro Fauna et Flora Fennica 16: 84-106.

Kithner R. 1978. Agaricales de la zone alpine. Genre Melanoleuca Pat. Bulletin de la Société

Linnéenne de Lyon 47(1): 12-52.

Lonati G. 1998. Funghi rari o poco conosciuti. Bollettino dell’Associazione Micologica ed Ecologica

Romana 14: 3-7.

McNeill J, Barrie FR, Burdet HM, Demoulin V, Hawksworth DL, Marhold K, Nicolson DH,

Prado J, Silva PC, Skog JE, Wiersema JH, Turland NJ. 2006. International Code of Botanical

Nomenclature (Vienna Code), adopted by the Seventeenth International Botanical Congress,

Vienna, Austria, July 2005. Regnum Vegetabile 146. 568 p.

Métrod G. 1949 (“1948”). Essai sur le genre Melanoleuca Patouillard emend. Bulletin trimestriel de

la Société mycologique de France 64: 141-165.

Moreno G, Arenal F, Gonzalez V. 1994. Algunos Agaricales de las playas de Espafia peninsular.

Cryptogamie Mycologie 15(4): 239-254.

Munzmay T. 2005. Meine mini Melanoleuca Monographie. Der Tintling 4: 4-13.

Raithelhuber J. 1971. Lateinische Kurzdiagnosen der auf der Dreilandertagung in Neubulach

vorgestellten Pilzarten aus Argentinien. Metrodiana 2(4): XXVI-XXVIL.

226 ... Fontenla & Para

Raithelhuber J. 1972. Neue und wenig bekannte Tricholomataceae Argentiniens. Metrodiana

Sonderheit 1: 1-28.

Raithelhuber J. 1974. Hongos Argentinos I. Hongos de la provincia de Buenos Aires y de la capital

federal. Buenos Aires.

Raithelhuber J. 1987. Flora mycologica argentina Hongos I. Stuttgart.

Raithelhuber J. 1993. Agaric flora of South America (6). Metrodiana 20(4): 151-200.

Singer R, Clémengon H. 1972. Notes on some leucosporous and rhodosporous European agarics.

Nova Hedwigia 23: 305-328.

Vesterholt J. 2008. Munkehat (Melanoleuca) i Danmark. Svampe 57: 18-29.

Watling R, Turnbull E. 1998. British fungus flora vol. 8. Edinburgh.

MYCOTAXON

Volume 115, pp. 227-238 January-March 2011

DOT: 10.5248/115.227

Coprinopsis neophlyctidospora sp. nov.,

a new ammonia fungus from boreal forests in Canada

Jay K. Raut", AKIRA SUZUKI” *, TOSHIMITSU FUKIHARU3,

KIMINORI SHIMIZU4, SUSUMU KAWAMOTO! & CHIHIRO TANAKA$

‘Graduate School of Horticulture, Chiba University, Matsudo City, Chiba, 271-8510, Japan

Faculty of Education, Chiba University, Chiba 263-8522, Japan

3Natural History Museum and Institute, Chiba 260-8682 Japan

‘Medical Mycology Research Center, Chiba University, Chiba 260-8673, Japan

5Graduate School of Agriculture, Kyoto University, Kyoto 606-0026, Japan

*CORRESPONDENCE TO: raut_jk2000@yahoo.com

ABSTRACT — Coprinopsis neophlyctidospora sp. nov. (Basidiomycota, Agaricales), collected

in urea treated soil of boreal forests from Canada is described and illustrated. Its

micromorphological features, phylogenetic analysis, and mating test delineate this taxon as a

new species. In addition, its ecological characters also indicate it is a new ammonia fungus.

Key worps — biogeography, cryptic species, ITS, species-complex, taxonomy

Introduction

‘The ammonia fungi are defined as a chemoecological group of fungi whose

growth can be stimulated by the addition of urea or aqueous ammonia or any

other related nitrogenous materials to forest soils (Sagara 1975). The diversity

and ecology of ammonia fungi have been studied in diverse geographical areas

such as in Japan, Taiwan, New Zealand, Western Australia, UK and western

US (Suzuki et al. 2003). However, ammonia fungi in the boreal region of

North America had not previously been examined. We, therefore, conducted

the first survey of ammonia fungi in boreal forests of Canada. In this study,

we focused on an ammonia fungus in the Coprinopsis phlyctidospora species-

complex. Coprinopsis phlyctidospora had been believed to be a cosmopolitan

species (Fukiharu & Horigome 1996, Suzuki et al. 2003), though we have

revealed that this group represents of cryptic species (Suzuki et al. 2002) in

different areas of the world. In this study, we reveal morphological characters

and phylogenetic relationships based on rDNA nucleotide sequences of a new

228 ... Raut &al.

saprobic Coprinopsis ammonia fungus collected from the urea treated soil of

boreal forests in Canada.

Materials & methods

Isolation and culture

A mixture litter (A,) and soil from the upper A horizon from a lodge pole pine (Pinus

contorta var. latifolia) forest and from an aspen (Populus tremuloides) forest both near

Edmonton, Canada was collected in May 2001. To stimulate fruiting of ammonia fungi,

a large amount of aqueous urea (granular fertilizer; 46% nitrogen, 5-20 mg urea/g dry

soil) was applied in plant pots containing the soil/litter mixture from two different

forests separately and incubated at 23-25°C under a 12 hrs light/12 hrs dark regime

for 30-72 days. Sterile water was applied at 1-3 day intervals to avoid desiccation of the

surface of the mixture. Basidiomata were collected from plant pots and cultured in the

laboratory. All cultures were grown at 25°C under a 12 hrs light/12 hrs dark regime on

MY agar medium [(malt extract 10 g/L (Difco, USA), yeast extract 2g/L (Difco, USA)

and agar 15g/L (Nakalai, Japan)].

Morphology

All descriptions of macro- and microscopic features were obtained from cultivated

basidiomata. Different developmental stages of basidiomata were photographed

and collected to observe the changes in pileus colors and veil features. Anatomical

observations and measurements were made on material mounted in 25% aqueous

ammonia. Microscopic terminology of basidiospores and cystidia followed that

of Vellinga (1988). Color terms and notations used in this description are based on

Kornerup & Wanscher (1978). Herbarium abbreviations are according to Holmgren &

Holmgren (1998). Basidiospore statistics: x, the arithmetic mean of spore length by

spore width (+ standard deviation) ; n, number of spores measured; Q, the quotient

of spore length and spore width; Q_, the mean of Q-values (+ standard deviation). For

scanning electron microscope (SEM) observation of basidiospores samples from spore

prints were rehydrated in 25% aqueous ammonia and fixed in 2.5% osmic acid, coated

with platinum-palladium in an ion sputter-coater (Hitachi E-1030; Hitachi Tokyo,

Japan), and observed under a SEM (Hitachi S-800) operating at 15.0 kV.

Phylogeny

Fungal strains were grown in a MY liquid medium. Mycelia were harvested, squeezed

with a paper towel, frozen and lyophilized. The dried mycelia were then ground with a

spatula and suspended in a TES buffer [50 mM Tris-HCl (pH 7.5), 20mM EDTA, 1%

SDS] and soluble fractions were recovered by centrifugation. The DNA was purified

by a TE buffer [10 mM Tris-HCl (pH 8.0), lmM EDTA] saturated phenol/chloroform/

isoamy] alcohol (Nippon gene) extraction followed by an iso-propyl alcohol precipitation.

After desiccation of the DNA pellet, the DNA was dissolved in 30 ul TE buffer. For

some samples, the genomic DNA was further purified using a NucleoSpin Extract II

(Macherey-Nagel) following the manufacture’s recommendation. Primers ITS1 (5’-

TCCGTAGGTGAACCTGCGG-3) and ITS4 (5'-TCCTCCGCTTATTGTATGC-3’)

were used to amplify the ITS1-5.8S-ITS4 ribosomal DNA region. PCR reactions were

carried out using Ex Taq (TakaraBio) according to the manufacturer’s protocol. PCR

229

Coprinopsis neophlyctidospora sp. nov. (Canada) ...

PI8sred

cO8TZo"d

TO8TZ0d

008TZ0d

66Z120d

86Z1Z0d

68Z1Z0d

S6LTLOd

PoLTZO"d

c6ZTZ0"d

OT9TZO”d

609TZ0d

9T9TZO"d

PI9TLO”d

ST9TZO"d

i a a a a a i a

T@Lvosd

OlProsd

s0rresd

90rrOSd

LOvPoSd

60rroSd

“ON NOISSHOOV

MNVANAD,

cgtat at <

ZOOZ Te IA LANZNg Bouasayay y

juaurtiedxa play ur juaurjeed vain Aq peureyqgo eyeuorpseg ,, quautiadxa ArojeIOQR] UI JUUT]eAT] Barn Aq PauTe}qo ByeULOIpIsEY ,

vyopidsn ‘F)

pypuasd iy

vyouasd sns8oq

(UoneUR[q) vyIpHsL snuig

posnf ‘N “Hsaizuaul ‘Ny

posnf ‘N “ Hsaizuaul ‘Ny

vosnf ‘N Usaizuaus sn8nfoyjon

pnw TC

Dyno 0

oyppidsna “9 vinw D

vyppidsno ‘d “‘vyno sn2san?)

vyopidsng sisdouvjsyD

saplopnuiass q

saplojnuas q

saplopnuias q

saplopnuiaay g

sapiomnusasy srpndog

DYOfyv] “IRA DyLOJUOI Snug

NOILVLASTA

ONILYNIWO(

uede{ ‘o0A4y

uede( 18eATA]

uede( Tiowloy

uede( ‘opreyyoH

ZN ‘PUrys] YON

ZN ‘Purys] YON

ZN PuUrysy YON

ZN PUris] YON

uede( ‘oAYoq,

uede ‘oA¥oq,

uede{ eqryy

uede{ ‘oj 0A4y

NYO elegy ‘ueudry

NV) ®heqy ‘ueudry

NV) ®Heqy ‘ueurdry

NYO ®heqy ‘ueurdry

NYO ®heqy ‘ueudry

NVO ®ieqry 9pefon

Oo OO (Oro

ALITVOOT

x€EZI7d

xSCLIT"

+6091"

xP9T17"

+LVC0E"

+09S67"

pos6cd

90T?d

x6€S07"

VSPCCO

PrSted

pcosed

+968"

reseed

06eed

+668"

x0€7T

“Wd

fo) pe; TEE

OO 0 0

“Wd

BeBe Ge) Jey, Me, ke

OOo Oo GO

iad

“Wd

HAVA

iad

oo OO. Oo Oo

iad

“ON NAWIOddS

YHHONOA

8Se6FOOVA

+6T0€NHO

xxZ00€NH

9TO€NH

sTOeNH

FIOENH

OOO 0

co0e NH

ZI0€NH

O1O€NH

«x8ZP0C0OU

ZOo0

ScO¢NH

¥COCNH

ecOc?NH

ecOcNH

T@O?NH

6007NH

OO 00 0 0

“ON ALV TOS]

DIADJUIUIDAID “)

dnows Lng

y baodsoutysa “>

y @uodsopysdjydoajsny, “2

, vaodsopyadqyd *D

SHONANOS ANVGNEDH

viodsopjadjydoau sisdoursdon

NOXV],

‘sisAjeue stjauasoAyd oy} UI popnpouT suoryaT[o9 sisdoutsdoy 2] LIAVI,

230 ... Raut & al.

products were purified using the NucleoSpin Extract H, and DNA fragments were

directly sequenced using the BigDye Terminator ver3.1 Cycle Sequencing Kit (Applied

Biosystems) according to the provided protocol. The reactions were then cleaned up

using the Centri Sep (Princeton Separations) before analysis by capillary electrophoresis

on a 3130x DNA Analyzer (Applied Biosystems). Sequences were assembled and

edited using the ATSQ software (Genetyx). All nucleotide sequences were deposited in

GenBank/EMBL/DDJB and accession numbers are provided (Table 1). The data set was

aligned using Clustal X ver. 1.81 (Jeannmougin et al. 1998), and the resulting alignment

was manually refined. The alignment was deposited in TreeBASE under accession

number _http://purl.org/phylo/treebase/phylows/study/TB2:S10848. All phylogenetic

analyses were performed with Paup* 4.0b10 (Swofford 2001). Gaps were treated as

missing data. The ITS data set of 730 bp was analysed with maximum parsimony. The

maximum parsimony was performed with a full heuristic search with 100 random

stepwise addition replicates and TBR (tree bisection-reconnection) branch swapping

and equal weighting of all characters. The robustness of inferred MP tree topologies

was tested by the bootstrap value (Felsenstein 1985) with 1000 replicates. Coprinopsis

atramentaria was used as an outgroup. Sequences for C. atramentaria, C. phlyctidospora,

C. “austrophlyctidospora” and C. echinospora were retrieved from GenBank (TaBLE 1).

Mating tests

Mating compatibility of C. neophlyctidospora with C. phlyctidospora and

C. “austrophlyctidospora” was examined. Monokaryotic testers of C. phlyctidospora

NBRC 30478 (Suzuki et al. 2002) and C. “austrophlyctidospora” CHU 3007 (tester

strains were generated by the authors of this paper, unpublished) were used in this study.

Small mycelium-covered agar blocks of dikaryotic C. neophlyctidospora and one of the

monokaryotic testers were placed 5 mm apart in the center of an MY agar plate. After

about two weeks incubation at 25°C in the dark, several pieces of mycelia from the

outer edge of the monokaryotic colony were examined and compatible crossings were

determined by the presence of clamp connections (TABLEs 2, 3). Individual pairings

were performed three times.

Taxonomy

Coprinopsis neophlyctidospora Raut, Fukiharu & A. Suzuki, sp. nov. Fies. 1-3

MycoBank 518507

Pileo primo 5-12 mm lato 3-6 mm alto, usque ad 10-30 mm lato, ovato-campanulato,

demum in margine lacerato revolutoque, radiatim sulcato, candido vel eburneo, deinde

cinerascenti, primo squamis albis radiatim hirsuto-fibrillosis ubique tecto, dein fere glabro;

carne tenuissima, fragilissima, alba, sapore miti, odore nullo; lamellis adnexis vel liberis,

comfertis, angustis (0.5-1.0 mm), albis, deinde atratis, deliquescentibus; stipete 50-80 mm

longo, 1-3 mm crasso, aequali vel sursum leviter attenuato, basi leviter incrassatula, cavo,

candido, fragilissimo, primo squamis albis fibrillosis squarrosis ubique tecto, dein nudo;

basidiosporis in cumulo atratis, sub microscopio rufo-brunneis, 7.8-8.5 um longis x 5.4—

6.0 um anticis x 5.4—5.8 latis, ovoideis vel ellipsoideis, verrcosis, poro germinationis centrali

1.8-2.1 um lato, cum plagiis; basidiis 26.2-36.2 x 7.7-8.5um, tetrasporis; pleurocystidiis

40-65 x 15-30 um, obovatis vel utriculiformibus, hyalinis, tenui-tunicatis; cheilocystidiis

25-35 x 15-25 um, subglobosis vel utriculiformibus, hyalinis, tenui-tunicatis; velo pilei,

Coprinopsis neophlyctidospora sp. nov. (Canada) ... 231

ANY

rN.

Up | N\ Hii

AW aa”

Fic. 1. Macromorphology of the newly described species, Coprinopsis neophlyctidospora.

A. Basidiomata (UAMH 11230); B. Longitudinal section of basidioma (UAMH 11230); and

C-E different developmental stages of basidiomata. Bars, A-B = 5 mm, C-E = 20 mm.

232 ... Raut & al.

Fic. 2. Anatomical details of Coprinopsis neophlyctidospora (drawn from the holotype)

A. Basidiospores B. Basidia C. Pleurocystidia D. Cheilocystidia D. Veil elements.

Bars A = 5 um B—-D = 20 um, E = 30 um.

Coprinopsis neophlyctidospora sp. nov. (Canada) ... 233

ex hyphis multi-septatis, divaricatis, tenui-tunicatis, hyalinis, 28.2-68.2 x 5.8-7.8 um

compositis; fiblis praesentibus.

Type: Canada, Alberta: Nojack (115°35'15”W 53°36'19"N; 828 m) on a large amount of

aqueous urea (granular fertilizer; 46% nitrogen, 5 mg urea/g dry soil) applied soil/litter

mixture collected from pine (Pinus contorta var. latifolia) forest, May 2001, A. Suzuki

[CHU 2009] (HoLoTYPE UAMH 11230).

EryMo.ocy: The Latin neo- refers to the “New World” origin of the species, and -

phlyctidospora reflects its morphological resemblance to Coprinopsis phlyctidospora.

PiLeus 5-12 mm broad, 3-6 mm high in button stage, when young ellipsoid to

ovoid, later convex to plane, 10-30 mm broad when expanded, finally uplifted

with age, radially sulcate; pileipellis color at first grayish orange to pale orange

(5B, 3), soon becoming grayish brown (5D-E, 3), surface when young densely

covered with white, hairy fibrillose scales (Fig.1), soon breaking up in small

radially arranged fibrillose veil, later almost glabrous or veil remaining only

in the center. Context very thin, fragile, white; taste mild; odor indistinct.

LAMELLAE adnexed to free, close (number of lamellae 40-60), with 0-1 lamellulae

(between two lamellae), narrow (0.5-1.0 mm wide), edge slightly pruinose, at

first white, then grayish, finally blackish, deliquescent. STIPE up to 50-80 x

1-3 mm, central, cylindrical, equal or somewhat tapering upward, sometimes

the base clavate, not rooting, fistulose, fragile, surface white, at first with white

fibrillose scales (Fig. 1), soon becoming smooth (Fig. 1). Bastpiosporss black

in mass, dark reddish brown under the light microscope, 7.8-8.5 x 5.4-6.0 um

in face view (x, =7.9+0.6 x 5.8 +0.5 um, Q= 1.2-1.5,Q =14+0.1,n= 40),

5.4-5.8 um diam in side view (x, = 5.6 + 0.4 um, n = 40), ovoid to ellipsoid

with warty ornamentation, a central germ pore 1.8-2.1 (1.8 + 0.1, n = 10) um

wide and vague plage (Figs. 2, 3A). BAsIDIA 26.2-36.2 x 7.7-8.5 «um, 4-spored

(Fig. 3C), PLEUROcysTIDIA 40-65 x 15-30 um, obovoid or clavate to utriform,

thin-walled, colorless (Fig. 3C). CHEILOCYSTIDIA 25-35 x 15-25 um, subglobose

or obovoid to utriform, numerous, thin-walled, colorless (Fig. 3D). ELEMENTS

OF VEIL on the pileal surface composed of thin-walled, diverticulate, colorless

hyphae, 28.2-68.2 x 5.8-7.8 um (Fig. 3E). CLAMP CONNECTIONS present in

vegetative mycelia and in pileal veil elements.

Hapit & Hapitat - Saprobic, growing after application of urea in the soil

collected from lodgepole pine (Pinus contorta var. latifolia Engelm.) and aspen

(Populus tremuloides Michx.) forests in Canada. Fruiting of this fungus in urea-

treated soil indicates that it is an ammonia fungus (Sagara 1975).

DisTRIBUTION — Only known from the type locality in Canada.

ADDITIONAL SPECIMENS EXAMINED: CANADA. ALBERTA: Chipman, (112°45’10°W

53°39 '46"N; 728 m) ina large amount of aqueous urea (granular fertilizer; 46% nitrogen,

20 mg urea/g dry soil) applied soil/litter mixture collected from an aspen (Populus

tremuloides) forest, CBM-FB33899, CBM-FB33901, CBM-FB33894, CBM-FB33896

December 2003, T. Fukiharu, CBM-FB38024 January 2004, T. Fukiharu.

234 ... Raut & al.

Fic. 3. Comparison of scanning electron micrographs (SEM) of basidiospores among:

A. Coprinopsis neophlyctidospora; B. C. “austrophlyctidospora” (Fukiharu et al. 2011); and

C. C. phlyctidospora (Fukiharu et al. 2011). Bars, A-C=2.5 um.

Results & discussion

According to conventional Coprinus Pers. taxonomy, Coprinopsis

neophlyctidospora belongs to Coprinus subsect. Alachuani (Singer 1986) based

on its diverticulate veil elements. In this subsection four species are reported

Coprinopsis neophlyctidospora sp. nov. (Canada) ... 235

to have warty ornamented basidiospores, i.e., Coprinopsis echinospora (Buller)

Redhead &al. (= Coprinus echinosporus), Coprinopsis phlyctidospora (Romagn.)

Redhead & al. (= Coprinus phlyctidosporus), Coprinopsis rugosobispora (J.

Geesink & Imler) Redhead & al. (= Coprinus rugosobisporus) (Orton & Watling

1979, Moser 1983, Uljé & Noordeloos 1997, Uljé 2005), and Coprinopsis

“austrophlyctidospora” nom. prov. (proposed as a new species by Fukiharu

et al. 2011). Macroscopically it is difficult to separate C. neophlyctidospora

from these species, but some microscopic features are distinctive. Coprinopsis

echinospora differs in its amygdaliform basidiospores and two hyphal types

in the pileal veil. Coprinopsis rugosobispora has two-spored basidia and is

also distinguished from C. phlyctidospora and C. ‘austrophlyctidospora”

KACC49358 (C. atramentaria)

CHU2025

CHU2024

CHU2009

CHU2023

CHU2022

CHU2021

CHU3010

CHU3003

CBM FB21061

CHU3017

NBRC30478

CHU3015

CHU3016

E5808

CHU3014

ri CBM FB214562

6 CHU3019

98 CBM FB21733 C. echinospora

CBM FB21725

CBM FB21264

C. neophlyctidospora

C. phiyctidospora

C. austrophiyctidospora

~ 10 changes

Fic. 4. The most parsimonious tree (156 steps) from a heuristic search based on the nuclear rDNA

sequences in ITS region for phylogenetically related Coprinopsis spp. The tree was rooted to the

outgroup, C. atramentaria. The numbers on branches indicate bootstrap support (value >50% only

shown) with 1000 replications. The distance corresponding to 10 base changes per 1000 nucleotide

position is indicated by the bar. Sidebar represents the inferred clades of Coprinopsis species.

236 ... Raut & al.

TABLE 2: Dikaryon-monokaryon mating reactions between the dikaryotic isolates of

Coprinopsis neophlyctidospora from Canada and monokaryotic testers of

C. phlyctidospora (NBRC30478).

Monokaryotic testers of C. phlyctidospora from Japan

Dikaryotic A.B, AB, AB, AB,

Isolates

cHu003 cHu00L cHu008 = cHU007 cHuU010 =cHU009 cHu0l1 cHu012

cHu2009 - - - - - - - -

cHu2021 - - - - - - - -

cHU2022 - - - - - - - -

cHu2023 - - - - - - - -

-, Clamp connections did not form

TABLE 3: Dikaryon-monokaryon mating reactions between the dikaryotic isolates of

Coprinopsis neophlyctidospora from Canada and monokaryotic testers of

C. “austrophlyctidospora” (cHuU3007).

Monokaryotic testers of C. “austrophlyctidospora” from New Zealand

A.B, AB, AB, ALB,

cHU013 cHUO15 cHU021 = cHU022 cHU0I6 ~=cHUO020 cHU018 = cHUO019

Dikaryotic

isolates

cHu2009 - - - - - - - -

cHu2021 - - - - - - - -

cHU2022 - - - - - - - -

cHu2023 - - - - - - - -

-, Clamp connections did not form

TABLE 4: Diagnostic basidiospore features of Coprinopsis neophlyctidospora and its

allies.

BASIDIOSPORE C. neophlyctidospora _C. phlyctidospora C. ‘austrophlyctidospora”

CHARACTER

Size 7.8-8.5 X 8.4-10.6 x 6.5-7.5 x

(um) 5.4-6.0 6.0-7.6 51-65

Surface warts more flattened, warts coarse & cone-like, warts smaller,

(verrucose) plage not distinct plage +/- distinct plage always distinct

in basidiospore size and surface ornamentation. The basidiospore size of

C. neophlyctidospora is smaller than that of C. phlyctidospora (8.4-10.6 x 6.0-

7.6 um; Uljé and Noordeloos 1997, Uljé 2005) while larger and more elongated

than those of C. “austrophlyctidospora” (6.5-7.5 x 5.1-6.5 «um; Fukiharu et al.

2011). The scanning electron micrographs also revealed its distinct broadly

warted basidiospores, showing warts more flattened than those in other species

Coprinopsis neophlyctidospora sp. nov. (Canada) ... 237

(Fic. 2). Furthermore, in the phylogenetic analysis based on ITS nucleotide

sequences C. neophlyctidospora formed a conspicuous and distinct clade among

its allies. The tree topology is strongly supported by high bootstrap values

(Fic. 3), indicating that C. neophlyctidospora is a distinct taxon. Moreover, the

mating test results comparing C. neophlyctidospora with C. phlyctidospora (TABLE

2) and C. “austrophlyctidospora” (TABLE 3) also strongly support biological

separation of these species. In conclusion, we propose C. neophlyctidospora as

anew cryptic species within the C. phlyctidospora species-complex, distributed

in the boreal region of Canada. Further research in unexplored regions is

needed to resolve comprehensive global understanding of the distribution of

these species.

Acknowledgments

The authors are deeply indebted to Prof. Dennis Desjardin (San Francisco State

University, San Francisco, USA) and Dr Peter Buchanan (Landcare Research, Auckland,

New Zealand) for their critical reviews of the manuscript and valuable remarks that

greatly improved it. The constructive nomenclature reviews from Dr. Shaun Pennycook

that further improved it are also greatly acknowledged. This work was financially

supported in part by a Grant-in-Aid for the Scientific Research (Nos. 14560112 and

16570073) from the Japan Society for the Promotion of Science (JSPS). We would

like to express sincere thanks to Prof. R. S. Currah (University of Alberta, Canada)

for his making the experimental sites available and supporting field and laboratory

experiments in Canada. We also express appreciation to Emeritus Research Scientist,

Y. Hiratsuka (Canadian Forest Service, Northern Forestry Center, Edmonton, Canada) and

H. Ono (Land and Forests Division, Alberta Sustainable Resource Development,

Alberta, Canada) for their support and making the field experiment in Canada possible.

We are thankful to the staff of Cold Creek Ranger Station, Alberta, Canada, for their

support and making the experimental sites available and secure.

Literature cited

Felsenstein J. 1985. Confidence limits on phylogenies: an approach using bootstrap. Evolution 39:

783-791.

Fukiharu T, Horigome R. 1996. Ammonia fungi in the Abukuma Mountains and its biogeographical

distribution around Japan (in Japanese). Mem. Natl. Sci. Mus. Tokyo No. 29: 105-112.

Fukiharu T, Bougher NL, Buchanan PK, Suzuki A, Tanaka C, Sagara N. 2011. Coprinopsis

austrophlyctidospora sp. nov., an agaric ammonia fungus from Southern Hemisphere plantations

and natural forests. Mycoscience in press. doi:10.1007/s10267-010-0077-0.

Holmgren PK, Holmgren NH. 1998. Index Herbariorum: A global directory of public herbaria

and associated staff. New York Botanical Garden’s Virtual Herbarium. http://sciweb.nybg.org/

science2/indexHerbariorum.asp

Jeannmougin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ. 1998. Multiple sequence alignment

with Clustal X. Trends Biochem. Sci. 23: 403-405. doi:10.1016/S0968-0004(98)01285-7

Kornerup A, Wanscher JH. 1978. Methuen Handbook of Color, 3"! edn. Sankt Jorgen Tryk Ltd,

Copenhagen.

238 ... Raut & al.

Moser M. 1983. Key to agarics and boleti (Polyporales, Boletales, Agaricales, Russulales), 4% edn. The

Whitefriars Press Ltd., Tonbridge UK.

Orton PD, Watling R.1979. British fungus flora. Agarics and boleti. 2. Coprinaceae Part 1: Coprinus.

Royal Botanic Garden, Edinburgh.

Redhead SA, Vilgalys R, Moncalvo JM, Johnson J, Hopple JS. 200la. Coprinus Pers. and the

disposition of Coprinus species sensu lato Taxon 50: 203-241. doi:10.2307/1224525

Redhead SA, Vilgalys R, Moncalvo JM, Johnson J, Hopple JS. 2001b. Proposal to conserve the

name Psathyrella (Fr.) Quél. with a conserved type and to reject the name Pselliophora P. Karst.

(Basidiomycetes: Psathyrellaceae). Taxon 50: 275-277. doi:10.2307/1224529

Sagara N. 1975. Ammonia fungi: a chemoecological grouping of terrestrial fungi. Contrib. Biol.

Lab. Kyoto Univ. 24: 205-276.

Singer R. 1986. The Agaricales in modern taxonomy, 4% edn. Koeltz Scientific Books, Koenigstein.

Suzuki A, Motoyoshi N, Sagara N. 1982. Effects of ammonia, ammonium salts, urea and potassium

salts on basidiospore germination in Coprinus cinereus and Coprinus phlyctidosporus. Trans.

Mycol. Soc. Japan 23: 217-224.

Suzuki A, Tanaka C, Bougher NL, Tommerup CI, Buchanan PK, Fukiharu T, Tsuchida S, Tsuda M,

Oda T, Fukuda J, Sagara N. 2002. ITS rDNA variation of the Coprinopsis phlyctidospora (Syn.:

Coprinus phlyctidosporus) complex in the Northern and Southern Hemispheres. Mycoscience

43: 229-238. doi:10.1007/s 102670200033

Suzuki A, Fukiharu T, Tanaka C, Ohono T, Buchanan PK. 2003. Saprobic and ectomycorrhizal

ammonia fungi in the Southern Hemisphere. New Zeal. J. Bot. 41: 391-406. doi:10.1080/

0028825X.2003.9512858

Swofford DL. 2002. PAUP*. Phylogenetic analysis using parsimony (*and other methods), Version

A, Sinauer Associates, Sunderland, Massachusetts, USA.

Uljé CB. 2005. Coprinus Pers. Flora Agaricina Neerlandica 6: 22-109.

Uljé CB, Noordeloos ME.1997. Studies in Coprinus IV. Coprinus section Coprinus: subdivision and

revision of subsection Alachuani. Persoonia 16: 265-333.

Vellinga EC.1988. Glossary. Flora Agaricina Neerlandica 1: 54-64.

MYCOTAXON

Volume 115, pp. 239-50 January-March 2011

DOT: 10.5248/115.239

Stachybotrys thaxteri sp. nov. and the

nomenclatural status of three Stachybotrys species

DeE-WEI LI

The Connecticut Agricultural Experiment Station, Valley Laboratory,

153 Cook Hill Road, Windsor, CT 06095

CORRESPONDENCE TO: dewei.li@ct.gov

ABSTRACT — A new species of Stachybotrys, S. thaxteri, is described as producing oblong or

ellipsoid conidia with a median constriction and undulating diagonal striations and colorless

conidiophores up to 360 um long. The nomenclatural status of S. cannae, “S. pallida,” and

“S$. striatispora” is clarified.

Key worps — anamorphic fungi, Periconiella, synonym

Introduction

The genus Stachybotrys was erected by Corda (1837: 21) with S. atra

Corda as type species. Verona & Mazzucchetti (1968), who monographed

Stachybotrys and Memnoniella, accepted 16 species of Stachybotrys and 3

species of Memnoniella. Jong & Davis (1976) published culture studies of 11

species of Stachybotrys and 2 species of Memnoniella. Pinruan et al. (2004)

accepted 55 taxa in Stachybotrys (including seven taxa formerly placed in

Memnoniella). At present, 96 Stachybotrys names have been published (Jiang

& Zhang 2009, Wang et al. 2009, Index Fungorum 2010), of which ca. 44 were

accepted in the 10 edition of Dictionary of Fungi (Kirk et al. 2008). Since that

publication, Stachybotrys variabilis H.R. Wang & T.Y. Zhang (Wang et al. 2009)

and Stachybotrys pallescens Y.L. Jiang & T.Y. Zhang (Jiang & Zhang 2009) have

been added.

During study of exsiccati from the U.S. National Fungus Collections

(BPI), The Farlow Herbarium (FH), Harvard University, and University of

Wisconsin Herbarium, Madison (WIS), one specimen (FH 2633) collected by

R. Thaxter labeled as Stachybotrys sp. was found to represent an undescribed

species, described below as Stachybotrys thaxteri. During the same research,

Stachybotrys cannae (isotype specimen BP1422138) was determined to represent

240 ... Li

not Stachybotrys but Periconiella. The nomenclatural status of S. cannae,

“8. pallida”, and “S. striatispora” is clarified and those species are redescribed.

Materials & methods

Specimens of Stachybotrys on loan from BPI, FH, WIS, and several other herbaria

were studied. Fungal structures including hyphae, conidiophores, conidiogenous cells,

and conidia were tape-lifted from each specimen with transparent tape (2 x 3 mm) and

mounted in lacto-fuchsin (0.1 g acid fuchsin, 100 mL 85% lactic acid). Morphological

characters (e.g., conidiophores, conidiogenous cells, conidia) from each specimen were

observed with a Nomarski differential interference contrast optical system at three

different times (immediately, after one week, after one month) to determine whether

rehydration had any effect on the morphology of the fungal structures. Herbarium

acronyms follow Holmgren & Holmgren (1998). Articles of the International Code of

Botanical Nomenclature are hereafter cited as from the “Vienna Code” (McNeill et al.

2006).

Results

Stachybotrys thaxteri D.W. Li, anam. sp. nov. Figures 1-4

MycoBank MB515398

Coontz olivascens, effusae, velutinae. CONIDIOPHORA macronemata, erecta, simplicia,

septata, solitaria vel interdum fasciculata, determinata, recta vel exigua curvata, laevia vel

verrucosa, hyalina, usque ad 360 um longa et 3.0-5.0 wm crassa. CELLULAE CONIDIOGENAE

phialidicae, determinatae, discretae, laeviae, subclavatae, prope apicem fuscae olivaceae,

(10.5-)11-13(-15.5) x (4.5-)5-6(-6.5) wm, collo conspicuo, praeditae, 4-6 in verticillo

dispositae. Conrpra oblonga, elliptica vel subcylindro-elliptica, primo hyalina et laevia,

deinde atro-olivaceobrunnea, diagnaliter striata, (12.5-)15-17.5(-19) x (6—) 6.5-7.5(-8)

um, biguttata, in massam mucosam nigram congesta. Teleomorphosis ignota.

Type: Trinidad: Maravel Valley, de aroid folii, per Roland Thaxter. Coll. 7-XII-1913, FH

2633 (holotype).

Erymo.oey: the specific epithet honors Roland Thaxter, the longtime curator of the

Farlow Herbarium, Harvard University, who collected the holotype.

COLONIES olivaceous, effuse, and velutinous; Mycelia superficial, partially

immersed. Hyphae septate, branched, light olivaceous, smooth. CONIDIOPHORES

differentiated, determinate, solitary or in groups, erect, straight or flexuous,

simple, 3-7-septate, smooth to verrucose, hyaline, up to 360 um in length, 3.0-5.0

um in width, apices inflated (Fics. 1-2). PHIALIDEs , unilocal, determinate,

discrete, subclavate, smooth, hyaline, dark olivaceous at the tip, (10.5-)11-13

(-15.5) x (4.5-)5-6(-6.5) um (mean = 12.2 + 1.0 x 5.4 + 0.6 um, n = 20), with

or without conspicuous collarettes, in digitate clusters of 4-6 (Fic. 1), CoNIDIA

unicellular, oblong, ellipsoid, occasionally constricted in the middle or slightly

curved, rounded at both ends, light gray and smooth at first, gray to dark

olivaceous when mature, forming delicate undulating diagonal striations with

minute dots in lines on the conidial surface, (12.5-)15-17.5(-19) x (6-)6.5-7.5

Stachybotrys thaxteri sp. nov. (Trinidad) ... 241

Figures 1-4. Stachybotrys thaxteri. 1. Conidiophore, phialides, and conidia. 2. Long

conidiophores, phialides, and conidium. 3. Conidia showing striations. 4. Biguttulate

conidia. Scale bars: 1, 3, 4 = 10 tm, 2 = 40 um.

(-8) um (mean = 16.1 + 1.3 x 7.1+0.4 um, n = 31), ratio of length/width 1.8-2.7

(mean = 2.3), biguttulate, especially when young, aggregated in slimy masses;

the striations becoming thicker and irregular with age (Fics. 3-4, TABLE 1).

eyided ayeouny

xode ye Avis L-SF ® YIM 10 pepunor 71-8

N qoours 0} ssay1opoo X SL-FS aSOOLLI3A Wry aseq prosdiya X61-S BLIYDIIDM *S

PRE aSOONLIaA S9-S

N asornon4qeA snoaseayo —- X Q9Z-OZI Ajasreo snoacealyo yeotspuyAr 0} prosdiyya Xx 61-0 SHDULOSOYJUD *S

aSONLLIaA oF sg-s

N Ajas.re09 uMoIg X OOT aSOMLI3A uMoIg Yep prosdija X €1-Z DIWSAA *S

aSOMLIIAA uUMOIq 0} PR-e asOondaa uMmolq yep prosdija €I-€

N 0} Yjoours aurpedyqns X OL-SF 0} Yoours 0} umodq ated 0} asqoysqns X OC-F SIIQDLADA.*S

o-F aSOMLLI3A 8I-ST

k yyoours ssa]IO[Oo xX 00T> 0} Yoours Wrqyg snqnotde we tym yeao X 87-0 avusosgoayy ‘S

aSOMIIAA o-¢€ Aqjeuo8erp [PPT ye payotysu0s GL-L

k 0} Yjoouss Ssa]IO[O2 Xx Q9E5 aqerdys snoaoealyo prosdyja ‘suotqo X8I-S Majxvyy “S

snoaoearyo 6-8 8-9

k yyoours oy auredygns =X QSZ-OST aSOMLLIOA snoaoealyo Suolgo xX PI-0 sisuajpduvy *S

aSOMLIIAA umogq ajed G8-G'S asOONLaa SPP

k Jo yyoours TO ssay1opoo x OCES Ajasreo3 rg yeotpurpAa x ST-0 avijauiaad ‘S

snoasearo eared S-¢ Ayjeurpnysucy os-s'¢

k QSOOLIIAA 0} ssayropoo x 00@> aqyeLys snoaoealyo yeotpurpAo X OT-€ viodsoupuydona *S

ayepnuess Io ayqeiqea

paueysnor snoaoealjo S-$'7 pespu prosdyya 9-S'¢

hy qjoours 0} UMOI x OOT< 0} asOONLIOA snoaoealyo ATpeorg XTI-L WNADIADYD *S

ey (tar) azig

pa Pe aovadns woo) AZIS aovadns woTOD aqdVHS

2 ees oe eS SSS Sa1Ogds

SHUYOHAOICINO’) VICINOD

‘satoods sfyogdyonyjs IepLUnis pure tagxvyy skajogdyonys Jo stsdouds oatyereduroy *T ATV],

Stachybotrys thaxteri sp. nov. (Trinidad) ... 243

TELEOMORPH: unknown.

DISTRIBUTION AND HABITAT: Known only from Trinidad on aroid leaves.

ADDITIONAL TYPE SPECIMENS OF SIMILAR STACHYBOTRYS SPECIES EXAMINED: Canada.

Ontario: Near Guelph, from peat soil, cedar bog, Nov. 1960, G.L. Barron [DAOM

87664, type of Stachybotrys eucylindrospora]. Czech Republic. PRAGUE, on plaster,

A.CJ. Corda [PRM 155670, holotype of Stachybotrys atra Corda]. Germany. BERLIN.

Unknown locality, on paper, date, collector unknown [Herb. Inst. Syst. Bot. Uppsala,

Sweden. Herb. E. Fries, ex holotype of Stilbospora chartarum Ehrenb. (= Stachbotrys

chartarum) (DAOM 51026)]. New Zealand. Waikato. Mt. Pirongia, No. 3 Track, on

Freycinetia banksii A.Cunn., 19 Nov 1984, E.H.C. McKenzie [PDD 57639, holotype

of Stachybotrys freycinetiae]. Uganda. KampaLa: on dead wood, March 1930, C.G.

Hansford (1138) [K(M) 165379, holotype of Stachybotrys kampalensis Hansf.]; on dead

branches of Theobroma cacao L., May 1936, C.G. Hansford (1138), [K(M) 165384,

holotype of Stachybotrys theobromae Hansf.].

COMMENTS—A comparison of S. thaxteri and similar Stachybotrys species is

given in TABLE 1.

One striking character of S. thaxteri is the long (< 360 um) conidiophore.

Both S. freycinetiae McKenzie and S. xanthosomatis Mercado & J. Mena also

have long conidiophores. The holotype of S. freycinetiae has conidiophores up

to 320 um long, but its conidia are cylindrical and much smaller (10-15 x 4-

4.5 um; McKenzie 1991) than those of S. thaxteri. Stachybotrys xanthosomatis

produces 120-260 um long conidiophores and conidia with extremely variable

lengths (Mercado & Mena 1988) that overlap those of S. thaxteri, but from

which it is distinguished by its narrower, ellipsoid or cylindrical conidia (10-19

x 5-6.5 um). The conidial widths of the two species do not overlap (TABLE I).

Stachybotrys virgata has warted conidiophores up to 100 um long and ellipsoid

conidia that are smaller (12-13 x 5-5.5 um; Krzemieniewska & Badura 1954)

than those of S. thaxteri. Although the type specimens of S. xanthosomatis and

S. virgata were deposited in herbaria in Cuba and Poland and thus unavailable

to the author, the literature descriptions of these two species are detailed enough

for comparison.

Conidia of several other species are similar in size or shape to those of

S. thaxteri. Conidia of S. waitakere Whitton et al. are similar in size (14.5-19

x 8-11.5 um) but differ in ornamentation (verrucose) and shape (ellipsoid to

broadly ellipsoid) and are produced on short (< 75 um) conidiophores (Whitton

et al. 2001). Conidia of S. kampalensis are morphologically similar to those of

S. thaxteri but smaller (10-14 x 6-8 um; Jong & Davis 1976; holotype examined).

The conidia of S. theobromae (20-28 x 15-18 um; Hansford 1943; holotype

examined) and S. variabilis (4-20 x 3-13 um; Wang et al. 2009) overlap those of

S. thaxteri in size. However, the larger ovoid conidium with the apical apiculus

of S. theobromae separates that species from S. thaxteri.

In S. variabilis some conidia are oblong, but smooth to verrucose (not

striate) and the size and shape variability combined with the short (45-70 um)

244 ... Li

conidiophores easily separate this species from S. thaxteri. Although conidia

of S. thaxteri and S. eucylindrospora are both striate, the longitudinal striations

on the smaller (12.8-16 x 3.5-5.5 um) cylindrical conidia of S. eucylindrospora

readily distinguish that species from the larger conidia with diagonally oriented

striations in S. thaxteri (TABLE 1) (Li 2007).

A culture of S. thaxteri was not isolated when the specimen was collected.

Therefore DNA sequencing couldnotbe conducted to determine its phylogenetic

relationship with the species of Stachybotrys that have DNA sequence data in

GenBank.

Nomen Excludendum

Stachybotrys cannae Bat.

Examination of this specimen showed that its conidiogenous cells were

clearly sympodial and cicatrized, rather than phialidic, and that the fungus

had been misdetermined. It is identical with Periconiella portoricensis, which

is redescribed as follows:

Periconiella portoricensis (F. Stevens & Dalbey) M.B. Ellis, Mycol.

Pap. 111: 26 (1967) FIGURES 5-12

= Haplographium portoricense F. Stevens & Dalbey, Mycologia 11(1): 6 (1919).

= Cephalotrichum portoricense (F. Stevens & Dalbey) Toro, Sci. Survey

Porto Rico Virgin Islands, New York Acad. Sci. 8: 224 (1932).

= Stachybotrys cannae Bat., in Batista & Vital, Anais Soc.

Biol. Pernambuco 15(2): 394 (1957).

CoLonligs brown, velutinous, effuse. Mycelium superficial, partially immersed.

Hyphae septate, branched, light brown, smooth. ConrpropHorss differentiated,

solitary or in groups, septate, erect, straight or flexuous, smooth, brown to dark

brown, thick-walled, occasionally branched, up to 430 um in length, 4-6.5 um

in width, with a defined foot cell (Figs. 5-6), CONIDIOGENOUS CELLS clavate or

cylindrical, polyblastic, sympodial, cicatrized, smooth, brown, thick-walled in

basal area, aggregated in groups of 2 - 5 on the apex of the conidiophores or

solitary; solitary ones longer than these in groups; aggregated conidiogenous

cells (14-)17-23(-25) x (4.5-)5-7(-8.5) um (mean = 20.6 + 3 x 6.1 + 0.9

um, n = 20) um, fertile part as wide as the basal part (Fics. 5-8); solitary

conidiogenous cells terminal or intercalary, (19-)23-34(-43.0) x (5-)5.5-7(-

7.5) um (mean = 29.2 + 5.5 x 6.3 + 0.8 um, n= 15) um, fertile part often wider

than the basal part (Figure 9). Conrp1a unicellular, acropleurogenous, single or

in short chains, obovoid, ellipsoid or subcylindrical, brown, smooth or rarely

verruculose, (15-)16-20(-22) x (6-)7.5-10(-13) um (mean = 18.2 + 1.9 x 9.2

+ 1.5 um, n= 31) um, ratio of length/width 1.5-3.2 (mean = 2.0), cicatrized on

basal end, occasionally on both ends (Fics. 10-12). Teleomorph unknown.

TELEOMORPH: unknown.

Stachybotrys thaxteri sp. nov. (Trinidad) ... 245

Ficures 5-12. Periconiella portoricensis. 5-6, 8. Conidiophores, and conidiogenous cells in groups.

7. Conidiophore, conidiogenous cells in a group, and conidium. 9. Solitary conidiogenous cells and

conidia. 10-12. Conidia. Scale bars: 7, 8, 10-12 = 10 um, 5, 6, 9 = 20 um.

DIsTRIBUTION AND HABITAT: Known from Ecuador, Guyana and Puerto Rico

on Canna coccinea Mill. and Canna sp.

SPECIMENS EXAMINED: Puerto Rico. AIBONITE: on Canna coccinea, 16 July 1915, J. A.

Stevenson 8447 [ILL 15999 (= Herbarium of John Stevenson, paratype of Haplographium

portoricense]; EL GIANTE: on Canna sp., 16 July 1915, J.A. Stevenson 8495 [ILL 16000 (=

246 ... Li

Herbarium of John Stevenson), holotype of Haplographium portoricense]; GUAYNABO:

on leaves of Canna sp., September 1917, J.A. Stevenson 6608 [BPI 422138 (= Herbarium

of John Stevenson), isotype of Stachybotrys cannae].

COMMENTS—he genus Periconiella was erected by Saccardo (Saccardo &

Berlese 1885: 727). It is characterized by differentiated conidiophores having

a branched head with polyblastic, sympodial, conspicuously cicatrized

conidiogenous cells (Ellis 1967). Batista & Vital (1957) proposed Stachybotrys

cannae as a new species. However, its possession of polyblastic, sympodial

conidiogenous cells, rather than phialides, indicates that it should be classified

in Periconiella rather than in Stachybotrys. Unlike Stachybotrys, which is defined

as having — without exception — unicellular conidia, the conidia of Periconiella

species are transversely non- to multi-septate (Ellis 1971). Examination of

the Stachybotrys cannae and Periconiella portoricensis type materials led the

author to conclude that these two species are conspecific due to their shared

conidiogenesis, conidial shape and size, as well as habitat and distribution.

Conidia of S. cannae were 16-20 x 7.5-10 um, while those of P. portoricensis are

17-20 x 7-10 um. Since H. portoricense (published in 1919) has priority over

S. cannae (published in 1957), Periconiella portoricensis is the correct name of

S. cannae (Vienna Code Art. 11.4).

Periconiella portoricensis was first described as Haplographium portoricense.

Toro (1932) transferred this species from Haplographium to Cephalotrichum.

However, this transfer was incorrect, because the species of Cephalotrichum

have annellidic (percurrently proliferating) conidiogenesis and synnematous

conidiophores (Kirk et al. 2008). Ellis (1967) proposed a new combination,

transferring H. portoricense to Periconiella. Because the description and

illustrations by Stevens & Dalbey (1919) and Batista & Vital (1957) were

not detailed enough to show clearly diagnostic characters such as conidial

orientation on conidiogenous loci, photographic illustrations and a detailed

description are provided here.

“Acrodesmis portoricensis (F. Stevens & Dalbey) M.B. Ellis ined.” is listed as

an obligate synonym of Periconiella portoricensis in Mycobank. Since “ined.”

refers to an unpublished name, “Acrodesmis portoricensis” is nom. inval.

Nomina Invalida

“Stachybotrys pallida” Orpurt, Studies on the soil microfungi of Wisconsin

prairies. Ph.D. dissertation, University of Wisconsin, pages 95-96 (1954), nom.

inval. (Vienna Code, Art. 30.5 and 36.1).

The valid name for this taxon is:

Stachybotrys elegans (Pidopl.) W. Gams, Compendium of Soil Fungi (London): 746

(1980).

= Hyalobotrys elegans Pidopl., Fungus flora of coarse fodder: 186 (1948).

Stachybotrys thaxteri sp. nov. (Trinidad) ... 247

= Hyalostachybotrys bisbyi Sriniv., J. Indian Bot. Soc. 37: 340 (1958).

= Stachybotrys bisbyi (Sriniv.) G.L. Barron, Mycologia 56: 315 (1964).

= Hyalostachybotrys sacchari Sriniv., J. Indian bot. Soc. 37: 341 (1958).

= Stachybotrys sacchari (Sriniv.) G.L. Barron, Mycologia 56: 315 (1964).

= Stachybotrys aurantia G.L. Barron, Can. J. Bot. 40: 258 (1962).

SPECIMENS EXAMINED: Canada. BRITISH COLUMBIA: Vancouver International Airport,

Straw from interior of cushings shipped from Thailand and seized at the airport, 13

January 1998, G. White, [DAOM 225565 (labeled as S. bisbyi)]. ONTARIO: from soil, J.A.

Traquair, [DAOM 222969]. Ottawa, isolated from serially washed roots of yellow birch,

November 1961, E.A. Peterson, [DAOM 87338 (labeled as S. bisbyi)]. Ottawa, CEF, from

soil, 18 August 1998, D. Overy, [DAOM 226830]. Egypt. from soil, 16 December 1965,

A.H. Moubasher, [IMI 116426 (labeled as S. sacchari)]. India. Gwalior, from soil, 15

September 1976, R.K.S. Chauhan, [IMI 206921]. Kenya. Nairobi, from Isoptera (Insecta),

7 November 1985, M.O. Kotengo [IMI 299091]. Pakistan. from Linum usitatissimum L.,

1965, M. Kamal, [IMI 114745 (labeled as S. sacchari)]. South Africa. from Saccharum

officinarum L., 19 January 1962, J.R. Anderson, [IMI 91211 (labeled as S. sacchari)].

USA. CoLorapo: Fort Collins, isolated from rhizosphere of Agropyron repens (L.) P.

Beauv., 1969, L.W. Durrell, [DAOM 129721 (labeled as S. bisbyi)]. NEw York: Ithaca,

isolated from soil, May 1962, WJ. Jooste, [DAOM 89199 (2 packets) (labeled as S.

bisbyi)]. Wisconsin: Columbia County, Morrisonville, isolated from soil of Mesic

Prairie, on corn meal potato dextrose, 6 August 1952, P.A. Orpurt, [(WIS 55), “holotype”

of “Stachybotrys pallida”).

COMMENTS— Examination of the type specimen of “S. pallida” (WIS 55) revealed

only mycelia, with both conidia and phialides lacking. The nomenclatural status

of “S. pallida” is therefore based on the English description and accompanying

illustrations in Orpurt’s dissertation. “Stachybotrys pallida” (= S. elegans) was

frequently isolated from the soils of the prairie in Wisconsin (Orpurt & Curtis

1957).

“Stachybotrys striatispora” Orpurt, Studies on the soil microfungi of Wisconsin

prairies. Ph.D. dissertation, University of Wisconsin, pages 93-94 (1954), nom.

inval. (Vienna Code, Art. 30.5 and 36.1).

The valid name for this taxon is:

Stachybotrys eucylindrospora D.W. Li, Mycologia 99(2): 333 (2007).

SPECIMENS EXAMINED: Canada. ALBERTA: Waterton National Park, Aspen parkland

picnic area, on Populus log, 4 August, 1980, G.P. White-696, [DAOM 176800a (2

packets)]. BrrrisH CoLumB1a: South Burnaby, Dahlia stems, 9 August 1957, S.J. Hughes,

[DAOM 56386éd (2 packets)]. ONTARIO: near Guelph. From peat soil, cedar bog, Nov.

1960, G.L. Barron, [DAOM 87664, holotype of Stachybotrys eucylindrospora]; Ottawa,

on stems of “Ligustrum officinale Lilach” (invalid pre-Linnaean name), 26 May 1983,

WI. Illman, [DAOM 186941]; St. Lawrence Islands National Park, MacDonald Is. Carya

ovata husks, 23 July 1979, S.J. Hughes, [DAOM 172376g]. QuEBEc: MacDonald College,

from soil, 1 June 1955, O.A. Olsen, [DAOM 70309 (as S. atra)]. United Kingdom:

ENGLAND— YORKSHIRE: Gundale, from Angelica sp., 18 October 1959, W.G. Bramley,

[IMI 79062 (labeled as S. atra)]; Pickering, from Heracleum sp., 3 July 1964, W.G.

Bramley, [IMI 107222]. USA. Wisconsin: Racine County, Mesic Prairie soil (isolated on

248 ... Li

corn meal potato dextrose), 23 August 1952, P.A. Orpurt, [(WIS 56 319-13), “holotype”

of “Stachybotrys striatispora”].

ADDITIONAL SPECIMENS EXAMINED: Israel. BEESHABA, soil, September 1953, S. Borat,

[IMI 76515, (labeled as Stachybotrys atra var. cylindrospora (C.N. Jensen) Rayss & Borut

1958 (= S. chartarum), the specimen on which the new combination was based) ]. USA.

New York, North Cohocton, arable soil, August 1911, C.N. Jensen, [CUP 5925, holotype

of Stachybotrys cylindrospora (= S. chartarum)].

COMMENTsS—According to Orpurt (1954) “S. pallida” was a common species

found throughout the prairie in Wisconsin, while “S. striatispora” (= S.

eucylindrospora) was isolated from only two locations. The former species was

occasionally isolated from indoor environments.

Although “S. striatispora” was proposed much earlier than S. eucylindrospora,

S. eucylindrospora is the valid name for this species due to the nomenclaturally

invalid status of “S. striatispora”. Orpurt (1954) examined a slide prepared by

Dr. Richard Korf from the holotype of Stachybotrys cylindrospora C.N. Jensen

as suggested by Dr. G.R. Bisby. He concluded that S. cylindrospora is a synonym

of S. atra (= S. chartarum). This conclusion is in agreement with the same

conclusion drawn by three other authors (Bisby 1943, Gilman 1945, Li 2007).

Discussion

Examination of the specimens from several major herbaria including 31

types has clarified the circumscriptions of the species presented in this paper.

In the author’s opinion, delineation of several Stachybotrys species, such as S.

lunzinensis Szilvinyi, remains doubtful due to the sketchy descriptions and/or

unavailable illustrations and type specimens. Further studies on these doubtful

species are needed. Without examining type materials of the species in question

or sequencing their DNA (if a culture were available), a nomenclature change

would be preliminary and thus add to the confusion.

Stachybotrys cannae may not be the last species transferred to a different

genus. One challenge is the availability and accessibility of type materials

collected in the 19" and early 20" centuries. A number of types collected at

much later times are missing or were destroyed by natural disaster, such as the

Kobe earthquake in Japan in 1995 (Matsushima pers. comm. 2008).

Acknowledgments

Theauthoris deeply indebtedto Dr. Bryce Kendrickand Dr. Rafael F. Castafieda Ruiz for

reviewing the manuscript. The author also expresses his sincere gratitude to the curators

and directors of following herbaria: The Farlow Herbarium (FH), Harvard University,

US. National Fungus Collections (BPI), University of Wisconsin (WIS), Herbarium of

the University of Illinois (ILL), Cornell University (CUP), The National Mycological

Herbarium, Ottawa, Canada (DAOM), UK (IMI), New Zealand Fungal Herbarium,

Landcare Research, New Zealand (PDD), Czech National Museum Herbarium, Prague,

Czech Republic (PREM), New York Botanic Garden (NY), the ARS Culture Collection

Stachybotrys thaxteri sp. nov. (Trinidad) ... 249

USDA (NRRL), Auburn University (AUA), University of Alberta (UAMH), Herbarium

of Institute of Microbiology, Chinese Academy of Sciences, Beijing, China (HMAS) for

specimen loans and to BPI and FH for providing the access to the mycological libraries

in their institutions for this study. The author is very grateful to Dr. Lorelei L. Norvell

for her editorial review, Dr. Shaun Pennycook for his nomenclature review, Dr. Weidong

Wu for scanning the descriptions of Stachybotrys species from Orpurt’s dissertation, and

support from Jiangsu Natural Science Foundation (BK2008243).

Literature cited

Barron GL. 1961. Studies on species of Helicodendron, Oidiodendron and Stachybotrys from soil.

Can. J. Bot. 39: 1563-1571. doi:10.1139/b61-136

Batista AC, Vital AF. 1957. Novas diagnoses de fungos Dematiacee. Anais da Sociedade de Biologia

de Pernambuco 15: 373-397.

Bisby GR. 1943. Stachybotrys. Trans. Brit. Mycol. Soc. 26: 133-143. doi:10.1016/S0007-

1536(43)80018-8

Corda ACJ. 1837. Icones fungorum hucusque cognitorum, vol. 1. Prague. 32 p.

Ellis MB. 1967. Dematiaceous hyphomycetes VIII, Periconiella, Trichodochium, etc. Mycol. Pap.

111: 1-46.

Ellis MB. 1971. Dematiaceous hyphomycetes. Wallingford, CABI.

Gilman JC. 1945. A manual of soil fungi. lowa State College Press, Ames, Iowa. 392 p.

Hansford CG. 1943. Contributions toward the fungus flora of Uganda. V. Fungi Imperfecti. Proc.

Linn. Soc., Lond. 155: 34-67.

Holmgren PK, Holmgren NH. 1998. Index Herbariorum: A global directory of public herbaria

and associated staff. New York Botanical Garden's Virtual Herbarium. http://sweetgum.nybg.

org/ih/

Index Fungorum. 2010. Index Fungorum. www.indexfungorum.org; accession date 3 August

2010.

Jiang YL, Zhang TY. 2009. Notes on soil dematiaceous hyphomycetes from Sichuan Province,

China. Mycosystema 28(5): 644-647.

Jong SC, Davis EE. 1976. Contribution to the knowledge of Stachybotrys and Memnoniella in

culture. Mycotaxon 3: 409-485.

Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the Fungi, 10 Edition. CABI,

Wallingford, UK.

Krzemieniewska H, Badura L. 1954. Przyczynek do znajomosci mikroorganizméw scidlki i gleby

lasu bukowego (A contribution to the knowledge of the microorganisms from the litter and soil

of beech wood). Acta Societatis Botanicorum Poloniae 23: 727-781.

Li DW. 2007. Stachybotrys eucylindrospora, sp. nov. resulting from a re-examination of Stachybotrys

cylindrospora. Mycologia 99: 332-339. doi:10.3852/mycologia.99.2.332

McKenzie EHC. 1991. Dematiaceous hyphomycetes on Freycinetia (Pandanaceae). 1. Stachybotrys.

Mycotaxon 41: 179-188.

McNeill J, Barrie FR, Burdet HM, Demoulin V, Hawksworth DL, Marhold K, Nicolson DH,

Prado J, Silva PC, Skog JE, Wiersema JH, Turland NJ. 2006. International Code of Botanical

Nomenclature (Vienna Code). Regnum Vegetabile 146. A-R.G. Gantner Verlag KG.

Mercado Sierra A, Mena Portales J. 1988. Nuevos o raros hifomicetes de Cuba. V. Especies de

Stachybotrys. Acta Bot. Cub. 55: 1-8.

Orpurt PA. 1954. Studies on the soil microfungi of Wisconsin prairies. Ph.D. dissertation, University

of Wisconsin. 138 p.

250 ... Li

Orpurt PA, Curtis JT. 1957. Soil microfungi in relation to the prairie continuum in Wisconsin.

Ecology 38(4): 628-637. doi:10.2307/1943129

Pinruan U, McKenzie EHC, Jones EBG., Hyde KD. 2004. Two new species of Stachybotrys, and a

key to the genus. Fungal Diversity 17: 145-157.

Robert V, Stegehuis G, Stalpers J. 2010. The MycoBank engine and related databases. http://www.

mycobank.org (accession date: 24 January 2010).

Saccardo PA, Berlese AN. 1885. Miscellanea mycologica. Series II. Atti R. Ist. Veneto Sci. Lett. Arti,

Ser. 6, 3: 711-742.

Stevens FL, Dalbey NE 1919. New or noteworthy Porto Rican fungi. Mycologia 11: 4-9.

doi: 10.2307/3753206

Verona O, Mazzucchetti G. 1968. I generi Stachybotrys e Memnoniella. Roma: Publicazioni dell’ Ente

Nazionale, per la Cellulosa e per la Carta, Laboratorio Di Cartotecnica Speciale. pp. 1-110.

Wang HE, Kong JH, Wu YM, Zhang TY. 2009. Notes on soil dematiaceous hyphomycetes from the

Qaidam Basin, Qinghai Province, China I. Mycosystema 28(1): 20-24.

Whitton SR, McKenzie EHC, Hyde KD. 2001. Microfungi on the Pandanaceae: Stachybotrys, with

three new species. New Zeal. J. Bot. 39: 489-499. doi:10.1080/0028825X. 2001.9512752

MYCOTAXON

Volume 115, pp. 251-254 January-March 2011

DOT: 10.5248/115.251

Two new species of Phialophora from soil

YuE-MING Wu & TIAN-Yu ZHANG’

Department of Plant Pathology, Shandong Agricultural University, Taian, 271018, China

* CORRESPONDENCE TO: tyzhang1937@yahoo.com.cn

ApsTRACT — Two new species, Phialophora microspora and P. nielamuensis, both from

soil in China are described and illustrated. The type specimens (dried cultures) and living

cultures are deposited in the Herbarium of Shandong Agricultural University Plant Pathology

(HSAUP). Isotypes are kept in the Herbarium of Institute of Microbiology, Academia Sinica

(HMAS).

Key worps — taxonomy, soil fungi, dematiaceous hyphomycetes

Introduction

Since Phialophora Medlar was erected in 1915, 86 epithets have been

proposed in the genus (Anonymous 2010). This genus is characterized by

possession of pigmented or hyaline colonies, weakly pigmented or hyaline,

thin-walled, branched conidiophores or simple phialides (which are discrete,

typically flask-shaped, with a distinct collarette), and one-celled, hyaline or

slightly pigmented conidia. In the course of a survey of soil dematiaceous

hyphomycetes in China, several unusual species of Phialophora were collected.

Two of them are described as new species, P microspora and P. nielamuensis.

Taxonomy

Phialophora microspora Y.M. Wu & TY. Zhang, sp. nov. Fic. 1

MycoBank MB 518896

Coloniae in PDA velutinae, leviter radiatis sulcais, griseo-olivaceae. Hyphae ramosae,

septatae, olivaceae, laeves vel modice scabrae, 2-3 um crassae. Conidiophora micronemata

vel semi-macronemata, mononemata, erecta, ex hyphis oriunda, simplicia, dilute brunnea,

laevia, verrucosa, 30-80 x 4-7 um. Cellulae conidiogenae monophialidicae, terminales

vel laterales, ex hyphis statim et singulatim oriundae, discretae, subcylindricae, gradatim

attenuatae versus apicem, subcollari modice angustatae, dilute brunneae, verrucosae, 20-

30 x 4-7 um, nonnumquam percurrenter proliferantiae; colla conspicua, infundibuliformia

252 ... Wu & Zhang

F ia. 1. Conidia, conidiophores, and conidiogenous cells of Phialophora microspora.

Left: drawings. Right: photomicrographs (Bars = 25 um).

vel ureceolata, paulo-obscura. Conidia unicellularia, globosa vel subglobosa, pallide

olivacea, hyalina, laevia, 2-3 x 1.5-2.5 um, coacervata in mucosa capitula.

Ho.otype: China. Tibet, Nielamu, from a mountain soil, altitude 2600 m, 14 Sept. 2007,

¥.M. Wu, HSAUPII ,,1381, holotype; HMAS 196259, isotype.

EryMo.ocy: The epithet refers to the small conidia of this species.

Colonies on PDA at 25°C for 28 days 3-5 cm diam., velvety, with faint radial

furrows, gray-olivaceous. Mycelium mostly superficial, partly immersed.

Hyphae branched, septate, smooth or sometime roughened, olivaceous, 2-3

um wide. Conidiophores semi-macronematous, mononematous, erect, arising

from the hyphae, simple or occasionally branched, light brown, verrucose,

30-80 x 4-7um. Conidiogenous cells monophialidic, terminal and integrated

or discrete borne directly on the hyphae, subcylindrical, gradually tapering

towards the apex and more or less constricted below the collarette, light brown,

verrucose, 20-30 x 4-7 um, sometimes proliferating percurrently; collarettes

conspicuous, funnel to vase-shaped, slightly darker. Conidia one-celled, globose

or subglobose, hyaline, smooth, 2-3 x 1.5-2.5 um, aggregated in slimy heads.

Phialophora microspora resembles P. richardsiae (Nannf.) Conant (Conant

1937) and P. benthica K.R. Millar (Millar 1990) in conidial colour and shape,

but the conidiogenous cells of these species are smooth, and the conidia of

P. microspora are smaller than those of either P. benthica (2.5-4 x 2-2.5 um) or

P. richardsiae (2.7-3.3 um) diam.

Phialophora spp. nov. (China) ... 253

2 e 9 8 @ .)

59 Oo 6

. (e)

Ss é

A Aro

0 &

is 5

Q. oN °

oN SO

Oghys @ @)

Fa LS i)

}

(e)

.@)

Fic. 2. Conidia, conidiophores, and conidiogenous cells of Phialophora nielamuensis.

Left: drawings. Right: photomicrographs (Bars = 25 um).

Phialophora nielamuensis Y.M. Wu & TY. Zhang, sp. nov. Fic. 2

MycoBank MB 518895

Coloniae in PDA velutinae, leviter radiatis sulcatis, griseo-olivacea. Hyphae ramosae,

septatae, olivaceae vel dilute bruneae, laeves, 1.5-3 um crassae. Conidiophora micronemata

vel semi-macronemata, mononemata, erecta, ex hyphis oriunda, simplicia, dilute brunnea,

laevia, 20-110 x 1.5-3 um. Cellulae conidiogenae monophialidicae, terminales vel

laterales, ex hyphis statim et singulatim oriundae, discretae, subcylindricae, gradatim

attenuatae versus apicem, subcollari modice angustatae, dilute brunneae vel subhyalinae,

laevia, 15-60 x 1.5-3 um, nonnumquam percurrenter proliferantiae; colla conspicua,

infundibuliformia vel ureceolata, paulo-obscura. Conidia unicellularia, pyriformia,

ellipsoidea vel subglobosa, hilo basilari plano, pallide olivacea, laevia, 3.5-5 x 2-2.5 um,

coacervata in mucosa capitula.

Ho.ortype: China. Tibet, Nielamu, from a grassland soil, altitude 2300 m, 14 Sept. 2007,

¥.M. Wu, HSAUPII ,,1354, holotype; HMAS 196258, isotype.

ETYMOLOGY: in reference to the type locality.

Colonies on PDA at 25°C for 28 days 3-5 cm diam., velvety, with faint radial

furrows, gray-olivaceous. Mycelium mostly superficial, partly immersed.

Hyphae branched, septate, smooth, olivaceous to light brown, 1.5-3 um wide.

Conidiophores micronematous to semi-macronematous, mononematous,

erect, arising from the hyphae, sometimes branched light brown, smooth, 20-

110 x 1.5-3 um. Conidiogenous cells monophialidic, integrated and terminal,

or discrete, subcylindrical, gradually tapering towards the apex and more or

less constricted below the collarette, light brown to subhyaline, smooth, 15-60

254 ... Wu & Zhang

x 1.5-3 um, sometimes proliferating percurrently; collarettes conspicuous,

funnel to vase-shaped, slightly darker. Conidia one-celled, pyriform, ellipsoidal

or subglobose, with a flat basal hilum, pale olivaceous, smooth, 3.5-5 x 2-2.5

um, aggregated in slimy heads.

This fungus resembles Phialophora japonica Iwatsu & Udagawa (Iwatsu &

Udagawa 1985) and P. taiwanensis Matsush. (Matsushima 1983) in conidial

morphology. However the former species has smaller conidia (1.5-3.5 x 1.2-2

tum), and the latter has larger (4.5-7 x 2-2.8 um), darker conidia.

Acknowledgments

The authors are grateful for pre-submission comments and suggestions provided by

Dr. Eric McKenzie, Prof. Y.L. Guo, and Dr. Shaun Pennycook. This project was supported

by the National Science Foundation of China (no. 30670014 & 30499340).

Literature cited

Anonymous 2010. Index Fungorum. http://www.indexfungorum.org/Names/Names.asp; accessed.

16 September 2010.

Conant GT. 1937. The occurrence of a human pathogenic fungus as a saprophyte in nature.

Mycologia 29: 597-598. doi: 10.2307/3754512.

Iwatsu T, Udagawa S. 1985. A new species of Phialophora from Japan. Mycotaxon 24: 387-393.

Matsushima T. 1983. Matsushima Mycological Memoirs No. 3.

Millar KR. 1990. A new species of Phialophora from lake sediment. Mycologia 82: 647-650. doi:

10.2307/3760056.

MYCOTAXON

Volume 115, pp. 255-258 January-March 2011

DOT: 10.5248/115.255

Phlebiopsis mussooriensis (Agaricomycetes),

a new corticioid species from India

PRIYANKA, G.S. DHINGRA’ & NAVNEET KAUR

Department of Botany, Punjabi University Patiala 147 002

“CORRESPONDENCE TO: dhingragurpaul@gmail.com

ABSTRACT - A new corticioid species, Phlebiopsis mussooriensis, is described from Mussoorie

in Uttarakhand.

Key worps - Company Garden, Cedrus deodara

While conducting the fungal foray in the Company Garden in Mussoorie of

Uttarakhand, India, Dhingra and Navneet made a collection from a decaying

log of Cedrus deodara. On the basis of macroscopic and microscopic characters

it was compared with species of Phlebiopsis and Phanerochaete (Eriksson et al.

1978 1981, Burdsall 1985, Dhingra 1987, Parmasto et al. 2009). As it could not

be assigned to any of the known taxa in these genera, it is here described as a

new species. With the addition of the new species to the four earlier reported

species, the total number from India has become five, a key to which is also

provided.

Phlebiopsis mussooriensis Priyanka, Dhingra & N. Kaur, sp. nov. Fics 1-5

MycoBank MB 517441

Basidiocarpum resupinatum, adnatum, effusum, ad 560 um crassum; hymenium

tuberculatum; systema hyphale monomiticum; hyphae ad 3.6 um latae, fibulae destitutae;

cystidia 40.0-62.0 x 7.2-10.9 um, subfusiformia vel fusiformia, encrustata; basidia 13.0-

26.7 x 3.3-5.0 um, clavata, 4-sterigmata; basidiosporae 5.0-7.1 x 2.5-3.8 um, ellipsoidae,

tenuitunicatae, inamyloidae, acyanophilae.

Type: India, Uttarakhand: Mussoorie, Company Garden, on a decaying log of Cedrus

deodara (Roxb.) G. Don (Pinaceae), Navneet 3405 (PUN, holotype), September 26,

2004.

EryMo.ocy: The epithet refers to ‘queen of hills? Mussoorie, in Uttarakhand where the

holotype was collected.

256 ... Priyanka, Dhingra & Kaur

Fics 1-4. Phlebiopsis mussooriensis: microscopic structures

1. basidiospores; 2. basidia; 3. cystidia; 4. vertical section through basidiocarp.

Phlebiopsis mussooriensis sp. nov. (India) ... 257

Fic. 5. Phlebiopsis mussooriensis: basidiocarp showing hymenial surface.

Basidiocarp resupinate, adnate, effused, up to 560 um thick in section; hymenial

surface smooth to somewhat tuberculate, grayish yellow, not changing to

purplish on putting a drop of 3% KOH solution, cracks appearing on drying;

margins thinning out to abrupt. Hyphal system monomitic; generative hyphae

up to 3.6 wm wide, branched, septate, without clamps; basal zone up to 290

uum thick, composed of compactly packed hyphae running parallel to the

substratum; subhymenium of irregularly branched, compactly packed vertical

hyphae; hymenium thickening with evenly distributed cystidia. Cystidia

40.0-62.0 x 7.2-10.9 um, numerous, subfusiform to fusiform, thin- to somewhat

thick-walled, especially at the base, naked when young to heavily encrusted

in the upper % portion when mature, immersed or projecting up to 45 um

from the hymenium. Basidia 13.0-26.7 x 3.3-5.0 um, narrowly clavate, apically

widened, thin-walled, 4-sterigmate, without basal clamp; sterigmata up to

5.0 um long. Basidiospores 5.0-7.1 x 2.5-3.8 um, ellipsoid, smooth, thin-

walled, inamyloid, acyanophilous.

REeMARKS—Phlebiopsis mussooriensis resembles members of the genus

Phanerochaete in producing a thickened hymenium with evenly distributed

encrusted cystidia, but the newly described species differs from the same by

a distinctly firm subiculum composed of narrow, thin-walled hyphae (up to

3.5 um wide). On the other hand, it is quite similar to Phlebiopsis himalayensis

258 ... Priyanka, Dhingra & Kaur

Dhingra in producing a smooth to somewhat tuberculate basidiocarp and

thick-walled encrusted cystidia, but the basidiospores of the latter species

are considerably shorter (3.5-4.75 x 2.5-3.0 um) than in the new species. In

addition, basidiocarp of P. himalayensis turns purplish on putting a drop of

3% KOH solution, a reaction that is not observed for P mussooriensis. The new

combination of features supports an independent species.

Consolidated key to the Indian species of Phiebiopsis:

1. Cystidia not massive (generally up to 10 um wide) .......... 00.0... e eee eee eee 2

1. Cystidia massive (more than 10 wm wide) ........ 00. cece eee eee eee 3

2. Hymenial surface turns purplish on putting a drop of 3% KOH solution,

basidiospores 3.5-4.75 X 2.5-3.0 HM... . eee eee eee eee P. himalayensis

2. Hymenial surface not changing color in 3% KOH solution,

basidiospores 5.0-7.1 x 2.5-3.8 MM ..... 0c. eee eee eee P. mussooriensis

3. Basidiospores broadly ellipsoid, 5-6 x 3.5-4.5 um ...........000. P. darjeelingensis

3. Basidiospores oblong-narrowly ellipsoid-sub cylindrical ................0.0.04. 4

4. Subiculum well developed ...... 00... ccc ccc cece ence een ees P. gigantea

4. Subiculum scanty or lacking ........ 00. ccc ee eee ee P. roumeguerei

Acknowledgements

Authors thank Prof. Nils Hallenberg (Gothenburg, Sweden) for valuable suggestions

and peer review; Prof. B. M. Sharma, Department of Plant Pathology, COA, CSKHPAU,

Palampur, H.P., India for peer review; Head, Department of Botany, Punjabi University,

Patiala, for providing research facilities.

Literature cited

Burdsall HH. 1985. A contribution to the taxonomy of the genus Phanerochaete (Corticiaceae,

Aphyllophorales). Mycologia Memoir No. 10. 165 p.

Dhingra GS. 1987. The genus Phlebiopsis in the Eastern Himalayas. Nova Hedwigia 44: 221-227.

Eriksson J, Hjortstam K, Ryvarden L. 1978. The Corticiaceae of North Europe — V. Fungiflora, Oslo

pp. 889-1047.

Eriksson J, Hjortstam K, Ryvarden L. 1981. The Corticiaceae of North Europe — VI. Fungiflora,

Oslo pp. 1051-1276.

Parmasto E, Nilsson H, Larsson KH. 2009. Cortbase: a nomenclatural database of corticioid fungi

(Hymenomycetes). Version 2.1 (Dec. 2009). http://andromeda.botany.gu.se/cortbase.html

MYCOTAXON

Volume 115, pp. 259-262 January-March 2011

DOT: 10.5248/115.259

Pseudocolus fusiformis, an uncommon stinkhorn

new to Turkish mycobiota

ILGAZ AKATA™ & HASAN HUSEYIN DOGAN*

‘Ankara University, Science Faculty, Department of Biology, TR 06100, Ankara Turkey

*Selcuk University, Science Faculty, Department of Biology, TR 42031 Campus/Konya, Turkey

* CORRESPONDENCE TO: fungus@hotmail.com.tr

AsstrActT — Pseudocolus fusiformis is the first representative of the genus to be recorded from

Turkey. The species is characterized by basidiocarps with three apical arms that are distally

fused and inner surfaces covered by a dark greenish mucoid gleba. A short description and

macro- and microphotographs are provided.

Key worps — Basidiomycota, biodiversity, new record, Phallales

Introduction

Pseudocolus Lloyd is asmall and uncommon stinkhorn genus, which includes

P. fusiformis, which is characterized by white to pale orange stem bearing

usually 3-4 apical arms united at the their tips and dark greenish mucoid gleba

covering the inner surface of the arms (Hemmes & Desjardin 2002, Meyers

2004, Phillips 2005). According to current checklists (Solak et al. 2007, Sesli &

Denchev 2010) and latest records (Uzun et al. 2010, Kaya et al. 2010), the genus

has not yet been reported from Turkey. Our recent collection of P. fusiformis,

therefore, constitutes the first report of the species and genus for Turkey.

Materials & methods

The fungi samples were collected from Yomra district of Trabzon province on the east

of Black Sea coast of Turkey. Specimens were photographed, and their morphological

and ecological properties were recorded in their natural habitats. Thereafter the samples

were taken to the laboratory for further investigation. Some reagents (distilled water,

Melzer’s reagent, 5% KOH) were used for microscopic investigation. Microphotographs

of basidiospores were taken under a light microscope (Leica DM 1000). The specimens

were identified based on their macroscopic and microscopic features and aided by

the literature (Sumstine 1916, Blanton 1977, Blanton & Burk 1980, Quadraccia 1983,

Hemmes & Desjardin 2002, Meyers 2004, Phillips 2005). A short description, images,

260 ... Akata & Dogan

habitat, geographical position, locality and collection date of the species are also

provided. All specimens were deposited at the herbarium of Ankara University (ANK).

Taxonomy

Pseudocolus fusiformis (E. Fisch.) Lloyd, Syn. Phalloids: 53 (1909). Fic. 1

= Colus fusiformis E. Fisch., Neue Denkschr. Allg. Schweiz.

Ges. Gesammten Naturwiss. 32(1): 64 (1890).

= Colus javanicus Penz., Ann. Jard. Bot. Buitenzorg 16: 160 (1899).

= Pseudocolus javanicus (Penz.) Lloyd, Mycol. Notes 2: 358 (1907).

= Anthurus javanicus (Penz.) G. Cunn., Proc. Linn. Soc. N.S.W. 56: 186 (1931).

= Pseudocolus rothae E. Fisch. ex Lloyd, Phalloids Australas.: 20 (1907).

“Colus rothae” E. Fisch., Neue Denkschr. Allg. Schweiz. Ges.

Gesammten Naturwiss. 33(1): 23 (1893), nom. inval.

= Colus rothae (Lloyd) Sacc. & Traverso, Syll. Fung. 19: 389 (1910).

= Anthurus rothae (Lloyd) G. Cunn., Proc. R. Soc. N.S.W. 56: 188 (1931).

= Colus schellenbergiae Sumst., Mycologia 8: 183 (1916).

= Pseudocolus schellenbergiae (Sumst.) M.M. Johnson,

Ohio Biol. Survey Bull. 22: 338 (1929).

= Pseudocolus jaczewskii Woronow, Izv. Kavkaz. Muz. 11: 196 (1918).

IMMATURE FRUIT BODY 12-16 mm broad, globose to subglobose, resembling

pear to egg shaped; peridium white to whitish gray or pale gray, thin, smooth,

opening irregularly along three seams; rhizomorphs whitish, filiform, attached

to the base. MATURE FRUIT BODY 40-70 mm height, forming a stalk with tapering

three united arms and a volva, arms 2-4 times length of stipe. Stalk white to

whitish gray or pale gray, 15-30 mm height, 5-20 mm wide, not extending

past volva, thin-walled, hollow, chambered, transversely rugose, flaring toward

the upper end. Arms are three in all samples, bright orange to red orange,

lanceolate, spongy, united at apex, cylindrical to flattened, transversely rugose

and chambered. GLEBA olive-green to dark green and slimy. VoLva white to

whitish gray or grayish, rugose and tough.

BasIpIosPporEs 2.8-3.2 x 4.9-5.6 um, ellipsoid, smooth, hyaline. BAsIDIA

with 6-8 spores.

Eco.oey solitary or scattered, on disturbed soil in deciduous, coniferous,

or mixed forests, gardens; also on old woodchip mulch, thick grass, leaf mulch

and humus.

SPECIMEN EXAMINED: TURKEY—rraszon: Yomra, [kisu Village: in common hazel

(Corylus avellana) garden, in soil, 40°56'30''N - 39°48'55”E, 84 m, 21 August 2009, leg.

Akata and Dogan, Akata 2141.

Discussion

Pseudocolus fusiformis is characterized by its onion shaped fruiting body

when young and 3-4 (occasionally up to 6) arms when mature (Blanton &

Burk 1980). From our measurements taken from 15 fresh specimens, the radius

of the four unopened onion shaped fruiting bodies averaged 12-16 mm. All

Pseudocolus fusiformis new to Turkey ... 261

Figure 1. Pseudocolus fusiformis: a,b. mature fruit body; c. immature fruit body; d. spores.

specimens bore only three arms. Mature fruit bodies measured 40-70 x 12-30

mmm, and the lengths of the arms were 34-57 mm. These results are confirmed

in Blanton & Burk (1980) and Quadraccia (1983).

In the literature, basidiospore sizes for P fusiformis are reported as 1.7-2 x

4.5-5 wm by Burk (1976), 1.8-2 x 3.2-5.5 um by Quadraccia (1983), and 1.5-2

x 3.75-4.5 um by Blanton (1977). The spore sizes in our collection —2.8-3.2 x

4.9-5.6 um — are greater than those given in the relevant literature.

This species appears not to require a specific habitat. Pseudocolus fusiformis

occurs in habitats possessing mulch, wood mulch, or humus, and has been

reported from Africa (La Réunion), Asia, Australia, Europe, North America,

and South America (Blanton & Burk 1980).

Acknowledgements

We would like to thank Mitko Karadalev, Abdullah Kaya, Gabriel Moreno, and

Shaun Pennycook for reviewing this article.

Literature cited

Blanton RL. 1977 (“1976”). Pseudocolus fusiformis, new to North Carolina. Mycologia 68:

1235-1239.

Blanton RL, Burk WR. 1980. Notes on Pseudocolus fusiformis. Mycotaxon 12: 225-234.

Burk WR. 1976. Pseudocolus javanicus in Connecticut and its distribution in the United States.

Mycotaxon 3: 373-376.

Hemmes DE, Desjardin DE. 2002. Mushrooms of Hawaii. Berkeley, CA, Ten Speed Press.

Kaya A, Uzun Y, Keles A, Demirel K. 2010. Three coprinoid macrofungi taxa, new to Turkey. Turk

J Bot 34: 351-354. doi:10.3906/bot-1001-276.

Meyers R. 2004. Pseudocolus fusiformis, the stinky squid. http://www.mushroomexpert.com/

pseudocolus_fusiformis.html (Accessed 25 May 2010).

262 ... Akata & Dogan

Phillips R. 2005. Mushrooms and other fungi of North America. Firefly Books.

Quadraccia L. 1983. Pseudocolus fusiformis (Fisch.) Lloyd in Italy. Micologia Italiana 12(2): 3-8.

Sesli E, Denchev CM. 2008. Checklists of the myxomycetes, larger ascomycetes and larger

basidiomycetes in Turkey. Mycotaxon 106: 65-67; on-line version: 1-133 pp. http://www.

mycotaxon.com/resources/checklists/sesli-v106-checklist.pdf (Accessed March 2010).

Solak MH, Isiloglu M, Kalmus E, All H. (2007). Macrofungi of Turkey Vol. 1. izmir. Universiteliler

Ofset.

Sumstine DR. 1916. A new species of Colus from Pennsylvania. Mycologia 8: 183-184.

Uzun Y, Demirel K, Kaya A, Giicin F. 2010. Two new genus records for Turkish mycota. Mycotaxon

111: 477-480.

MYCOTAXON

Volume 115, pp. 263-270 January-March 2011

DOT: 10.5248/115.263

New lichen records from Turkey — 2:

Aspicilia, Protoparmeliopsis, and Ramalina

AYHAN SENKARDESLER' & ORGUN FuaT CALBA?

Biology Department, Faculty of Science, Ege University, 35100 Izmir, Turkey

CORRESPONDENCE TO: *Ayhan.Senkardesler@ege.edu.tr & “orcuncalba@gmail.com

AsstTract— Lecanora albosparsa is lectotypified, the new combination Protoparmeliopsis

klauskalbii is proposed, and three species of lichen-forming fungi — Aspicilia albosparsa, P.

klauskalbii, and Ramalina carpatica — are reported as new to the lichen biota of Turkey

Key worps— Afyon, Ascomycetes, Batman, Diyarbakir, Elaz1g, Izmir, Sirnak, Usak

Introduction

Examination of last century collections from Turkeyin the herbaria of Vienna

(W, WU) has revealed Aspicilia albosparsa and Protoparmeliopsis klauskalbii as

species new to the Turkish lichen biota. These species and Ramalina carpatica

have also been recently collected by the authors.

Materials & methods

Specimens deposited in W and WU were studied in Vienna, while the type specimens

of Aspicilia albosparsa, deposited in BC, were studied in Barcelona. Fresh materials were

collected from Afyon and Usak provinces in 2009 and 2010 and deposited at the Aegean

University Herbarium (EGE).

The samples were identified using a stereomicroscope, a compound microscope,

and standard spot tests. Measurements were made on dry herbarium material or in

microscopic preparations in tap water. Hand sections were mounted in water or in

lactophenol-cotton-blue (Merck Rf. 13741). To study the ascus structure, Lugol’s solution

was added to sections and squash preparations after pre-treatment with 10% KOH.

The descriptions presented below are based on both original descriptions (Fritze &

Ilse 1870, Sipman 2007, Werner 1958) and our own observations.

For secondary metabolite study, high performance thin-layer chromatography

(HPTLC) was performed in accordance with Arup et al. (1993), using a CAMAG

Nanomat 4 sample applicator and CAMAG Horizontal Development Chamber.

264 ... Senkardesler & Calba

Taxonomy

Aspicilia albosparsa (Werner) S.Y. Kondr., Ukr. bot. Zh. 59: 603 (2002) Fic. 1

= Lecanora albosparsa Werner, Bull. Soc. Bot. France 105: 241 (1958).

Typus: Syrie, roches volcaniques du littoral prés Banias, 27.8.1938, R.G. Werner (BC!-

lectotypus, hic designatus; BC!-isolectotypus).

Key CHARACTERS— Thallus usually sterile, epilithic, crustose (becoming semi-

umbilicate occasionally) and squamulose, with dirty green to ochraceous brown

colours, with dominancy of white pseudocyphellae on the surface; hymenium

rather shallow to medium, up to 125 um, with non-moniliform paraphyses;

conidia rather short (6-9 um); secondary metabolites absent.

DEscRIPTION— ‘Thallus epilithic, crustose, sometimes becoming semi-

umbilicate (only seen in the collection locality from Usak!), areolate-efhigurate,

marginal lobes up to 2 mm long and slightly ascending, flat to slightly convex,

dirty green to ochraceous brown, epruinose; pseudocyphellae dominating

the surface, white, 1 to 8 in each areole, at first punctiform than becoming

elongated and joining into sinuous, branched lines; cortex unistratose,

paraplectenchymatous, constructed of perpendicular and moniliform hyphae,

up to 50 um tall, outer part up to 25 um brown; soredia and isidia absent;

prothallus not visible. Ascomata rare, with a black disc, at first punctiform and

concave, then slightly convex and up to 1 mm in diam.; excipulum hyaline, up

to 30 um broad, I-; hymenium 75-125 um tall, hyaline, I+ blue; epihymenium

Aspicilia-green, N+ green to blue-green; hypothecium distinct, shallow, to 40

um tall, hyaline, without algae, I-. Asci clavate, Aspicilia-type, 75-85 x 19-

25 wm, usually sterile; paraphyses septate, simple or branched, 2.5 um broad,

apical cells swollen, up to 3.8 um; mature ascospores not seen. Conidia straight

or slightly curved, 6-9 x 1.3 um.

SECONDARY METABOLITES— None detected by HPTLC. Spot tests K-, C-,

KC-, Pd-.

DIsTRIBUTION AND ECOLOGY— ‘This xerophytic species, known from Syria and

Turkey (Fic. 2), is perhaps common in the Eastern Mediterranean. It grows on

sun-exposed calcareous rocks up to 1700 m altitude in the eu-mediterranean to

the mediterranean-montane belt.

ADDITIONAL SPECIMENS EXAMINED— AFYON, BETWEEN CAGLAYAN & KEKLICEK

VILLAGES, Ist km, Kirag Mountain, 38°10.26’N, 30°10.48E, 1140 m, 25 June 2009, A.

Senkardesler (EGE 39726); BETWEEN MURATLI & KEKLICEK VILLAGES, Ist km, Kira¢

Mountain, 38°10.10’N, 30°08.67’E, 1490 m, 25 June 2009, A. Senkardesler (EGE 39728);

BETWEEN PAZARAGAG & INLI VILLAGES, 5th km, 38°31.80’N, 30°49.38’E, 1060 m, 25 May

2010, A. Senkardesler (EGE 39728); BATMAN, “in valle Sassun districtus Bitlis, ad rupes

prope vicum Goro” [on rock probably in environs of Sarryayla village], 1700 m, 12 Aug.

1910, H.E von Handel-Mazzetti Nr. 3305 (W 1929-15489); ELAZIG, near GOLDSCHIK

(=G6LcUK) VILLAGE, at subsaline lake with same name (source of western Tigris),

1350 m, 28 July 1910, H.E von Handel-Mazzetti Nr. 2543 (W 1920-00704); SIRNAK,

DsCHESIRET-IBN-OMAR (Cizre), ca. 400 m, 21 Aug. 1910, H.E von Handel-Mazzetti

New lichen records — 2 (Turkey) ... 265

FicureE 1: Aspicilia albosparsa. (a) Lectotype: white, punctiform to jointed pseudocyphellae

dominate the surface of the crustose thalli (BC); (b) Semi-umbilicate form with mainly

punctiform pseudocyphellae (EGE 39729); scale bars = 2 mm.

266 ... Senkardesler & Calba

Nr. 3082 (W 1929-15643, WU 41317); Usax, between ORMANDAMI & UGKUYULAR

VILLAGES, 3rd km, 38°47.28’ N, 29°06.24’ E, 920 m, 22 Apr. 2010, A. Senkardesler (EGE

39730).

REeMARKS— (1) Aspicilia albosparsa, which is not included in any identification

key, is characterized by a usually sterile, epilithic, crustose (occasionally

becoming semi-umbilicate) and areolate-effigurate thallus with dirty green

to ochraceous brown colours, a surface largely covered by conspicuous white

pseudocyphellae, a rather shallow to medium (< 125 um thick) hymenium with

non-moniliform paraphyses, rather short conidia (6-9 um), and the absence of

secondary metabolites.

(2) The species is morphologically similar to A. maculata (H. Magn.)

Oxner, A. sphaerothallina (J. Steiner) Szatala, and A. syriaca (J. Steiner) Szatala.

Aspicilia albosparsa differs from these species by one or more of the following

characters: white pseudocyphellae, shorter conidia (8-12 um in A. maculata,

7-13 wm in A. sphaerothallina, and 8-15 um in A. syriaca) and a shallower

hymenium (100-120 um in A. maculata, 140-190 um in A. sphaerothallina,

and 140-180 um in A. syriaca).

(3) Specimens seen in the Natural History Museum in Vienna (W) and

the University of Vienna Herbarium (WU) in 2007 and 2008 were labeled

“Lecanora (Aspicilia) pseudocyphellata J. Steiner”, a perfect name reflecting

its main key character but one that was never published. In 2009 the author

found a suitable type in the herbarium of Guy Roger Werner (BC), labeled as

Lecanora albosparsa, which was later transferred to Aspicilia in Kondratyuk &

Zelenko (2002).

(4) The localities of the specimens collected by H.F. von Handel-Mazzetti

cause problems, because many village names are no longer in use or unusually

spelt. A map deposited in W provided some information about these localities.

The locality “Goro” lies about 50 km east of Bitlis province; this information

directs the author to the surroundings of Sartyayla village within Batman

province. The locality “Géldschik” corresponds to the present village Gélctik in

Elazig province; the lake indicated in the label is currently called Hazar Lake,

lying just east of Golctik. Dschesiret-ibn-Omar is the former name of Cizre

village in Sirnak province.

Protoparmeliopsis klauskalbii (Sipman) Senkard., comb. nov. Fic. 3

MycoBank MB 518655

= Lecanora klauskalbii Sipman, Biblioth. Lichenol. 96: 270 (2007).

Typus: Greece, W Aegean, Nomos Evvias, Eparchia Karistias, S Evvia, Aetés, alt. ca. 20

m, schist rock outcrops along the coast and in phrygana, 23.09.2005 H. Sipman & Th.

Raus no 54654 [B-holotype].

Key CHARACTERS— Thallus placodioid, brown, without pruina; areoles with

white margins and non-swelling lobes with black lower side; apothecia with

New lichen records — 2 (Turkey) ... 267

Q pens

. By

& ©

oS i

S No GS oe

2% ft

Cam $ ae 0 125 250 500Kilometers

Ficure 2. Distribution of Aspicilia albosparsa (WH) and Protoparmeliopsis klauskalbii (A= Specimens

examined, @= Locality cited in Sipman 2007)

brown discs; lecanoric acid present (in Turkish specimens) (C+ orange to

reddish), usnic and norstictic acids absent (K-, KC-).

DescRIPTION— Provided by Sipman (2007).

SECONDARY METABOLITES— Zeorin, lecanoric acid and unknown fatty acids.

Spot tests K-, C+ orange to reddish, KC+ orange to reddish, Pd-.

DIsTRIBUTION AND EcoLocy— ‘This species, known from the Aegean island

of Evvia (Greece) and three localities in the western and eastern central

highlands of Turkey (Fic. 2), is probably widespread throughout the eastern

Mediterranean.

SPECIMENS EXAMINED— AFYON, between ATAKOY & KUGUKKALECIK VILLAGES,

2nd km, Kumalar Mountains, 38°40.99’ N, 30°32.78 E, 1140 m, 23 June 2009, A.

Senkardesler (EGE 39731); between BUYUKKALECIK & KOCATEPE VILLAGES, 3rd km,

Kumalar Mountains, 38°40.06’ N, 30°28.30’ E, 1700 m, 23 June 2009, A. Senkardesler

(EGE 39732). DIYARBAKIR, near GORO VILLAGE [close to CATAKKOPRU VILLAGE] in

Sassun valley, ca. 700 m, 08 Aug. 1910, H.E von Handel-Mazzetti Nr. 3308 (WU 41350,

labelled as Lecanora riparia, published in Steiner (1921); specimen attached with a note

of Bruce Ryan in 1992 as “Holotype of Lecanora steineri ined?. W 1929-15537, labelled

as Lecanora riparia, published in Steiner (1921); specimen annotated by Bruce Ryan in

1992 as “Isotype of Lecanora steineri ined.’).

RemMaRKs— (1) Protoparmeliopsis klauskalbii, not yet included in any

identification key, differs from Lecanora graeca J. Steiner and L. placentiformis

J. Steiner by the absence of norstictic acid and from other placodioid species

of Lecanora Ach. and Protoparmeliopsis M. Choisy by the absence of usnic

acid and the presence of lecanoric acid. It differs from related species known

from Turkey and adjacent regions by the combination of a brown thallus with

white areole margins, non-swelling lobes, and a black underside. Lecanora

bolcana (Pollini) Poelt, L. dispersoareolata (Schaer.) Lamy, L. garovaglii (K6érb.)

Zahlbr., L. graeca, Protoparmeliopsis achariana (A.L. Sm.) Moberg & R. Sant.,

P. laatokkaensis (Rasanen) Moberg & R. Sant., P macrocyclos (H. Magn.) Moberg

& R. Sant., and PB muralis (Schreb.) M. Choisy are not brown and their areoles

lack white margins; unfortunately, old herbarium material of these 8 species

268 ... Senkardesler & Calba

Ficure 3: Protoparmeliopsis klauskalbii. Thallus margin (W 1929-15537); scale bar = 2 mm.

often becomes brownish, so that TLC/HPTLC analyses become necessary to

differentiate them from P. klauskalbii. Lecanora placentiformis is also brown but

its areolar margins are not white.

(2) The Turkish material seems to deviate by the presence of lecanoric acid,

a substance not reported by Sipman (2007).

(3) Choisy (1929) briefly described the genus Protoparmeliopsis as having

a placodioid and submembranous thallus with hypothecium containing

photobionts [“Thalle submembraneux, lacinié divisé au pourtour, straminé,

apothécies vulgairement pénétrées par les gonidies dans Phypothécium.”]”

and as type species proposed P muralis, which has long (< 25 um), curved

pycnoconidia. Hafellner & Tiirk (2001) and Santesson et al. (2004) have

recently proposed many new combinations, and the genus has been accepted

in numerous local floristic studies. According to Sipman (2007), P. klauskalbii

is closely related to P muralis and fits well in Protoparmeliopsis even in a

narrower concept of the genus. Therefore we do not hesitate to propose this

new combination even in the absence of one generic character—the straw-like

colour (presence of usnic acid). Other transfers to Protoparmeliopsis will be

made in future papers.

(4) Steiner used the name Lecanora riparia (Flot.) J. Steiner for specimens

related to “Lecanora muralis” with a brown colour and whitish margins,

New lichen records — 2 (Turkey) ... 269

conspecific with P. klauskalbii (specimens seen by the authors in W and WU).

However, this name is not applicable because the type specimen is from Central

Europe, where P. klauskalbii does not occur. Bruce Ryan, who reinvestigated

these specimens using TLC and annotated some as “Lecanora steineri B. Ryan

ined.,.” died before he could publish his species. Later, Sipman (2007) realized

that the usnic acid-lacking, brown, white-margined specimens collected in

Greece should be treated as a distinct species, for which he proposed the name

Lecanora klauskalbii.

(5) As mentioned above, recognition of the collection localities of H.E von

Handel-Mazzetti is problematic. The map deposited in W situates “Batman

K6éprt” about 15 km east of Mejafarkin (currently known as Silvan). It is inside

the province of Diyarbakir, close to the border with Batman, a location that

matches the current environs of Catakkoprii.

Ramalina carpatica Korb., in Fritze & Ilse, Verh. Zool.-Bot. Ges. Wien 20: 501

(1870).

TYPE: “Mittelgrat”, Vysoké Tatry, Slovakia, 1863, leg. Hausknecht & Fritze [W? not

seen].

Key CHARACTERS— ‘Thallus epilithic, erect, with distinctly blackened branch

tips, lacking soredia, isidia and pseudocyphellae; apothecia apical, occasionally

blackening like the tips of branches; ascospores kidney-shaped.

DescripTION— Thallus epilithic, shrubby, tufted, erect, up to 9 cm high;

branches usually single, thick, smooth to unevenly pitted, hollow, cylindrical

or rarely flattened at the base, not dorsiventral and not filamentous; soredia,

isidia and pseudocyphellae absent; tips of the branches distinctly blackened;

cortex plectenchymatous of perpendicular hypes, thin, indistinct, overlaying

a strongly developed and cylindrical zone of prosoplectenchymatous tissue

including the photobiont zone; photobiont trebouxioid. Ascomata apothecia,

frequent, apical, partly blackened, shortly stalked, disc pale green or blackened.

Asci elongate-clavate, Bacidia-type, 8-spored. Ascospores 1-septate, kidney-

shaped, colourless, 11-16 x 5-7 um.

SECONDARY METABOLITES— None detected by HPTLC. Spot tests K-, C-, KC-

, Pd-. Earlier studies report evernic, obtusatic and usnic acid for this species

(Culberson 1970). Our material seems to belong to a deficient strain.

DIsTRIBUTION AND ECOLOGY— ‘This species, previously known only from

Poland to Greece in the Carpathian Mountains and the Balkans (Keissler 1959,

Abbott 2009), is reported here for the first time from Turkey. It is a saxicolous

species from wind-exposed cliffs of acidic silicate rocks.

SPECIMEN EXAMINED— Izmir, Bozdag Mountains, between YILANLI & DOKUZLAR

VILLAGES, Ist km, 38°18.22’ N, 28°07.45’ E, 2063 m, 11 May 2009, S. G. Senol, conf. O.

Blum (EGE 39733).

270 ... Senkardesler & Calba

REeMARKS— (1) Ramalina carpatica is easily recognizable at first glance by its

habit on siliceous rocks and its blackening tips and apothecia. The collected

specimens, reaching up to 9 cm tall, are the longest reported for this species.

(2) The identification of this species was confirmed by Prof. Dr Oleg Blum

(Kiev).

Acknowledgements

I thank Dr Laszl6 Lékés (Budapest) and Dr Harrie J.M Sipman (Berlin) for reviewing

this paper. Dr Harrie J.M Sipman (Berlin) is acknowledged for his useful comments

on Protoparmeliopsis klauskalbii, Dr Serdar G. Senol (Izmir) for collecting Ramalina

carpatica and Dr Oleg Blum (Kiev) for the confirmation of R. carpatica. The study in the

Institut Botanic de Barcelona was supported by the Ege University (09 FEN 055), that

in the Herbarium of the Natural History Museum Vienna was financed by the mobility

program of The Scientific and Technological Research Council of Turkey (TUBITAK),

that in the University of Vienna Herbarium was awarded by the Synthesys Project

(http://www.synthesys.info/) which is financed by the European Community Research

Infrastructure Action under the FP6 “Structuring the European Research Area”

Programme, while the specimens from Afyon and Usak provinces were collected in the

framework of the TUBITAK Research Project No 1061628 and by the Ege University

(08 BIL 025).

Literature cited

Abbott BFM. 2009. Checklist of the lichens and lichenicolous fungi of Greece. Biblioth. Lichenol.

103. Berlin/Stuttgart. J. Cramer Verlag.

Arup U, Ekman S, Lindblom L, Mattsson J-E. 1993. High performance thin layer chromatography

(HPTLC), an improved technique for screening lichen substances. Lichenologist 25(1): 61-71.

doi:10.1006/lich.1993.1018

Choisy M. 1929. Genres nouveaux pour la lichénologie dans le groupe des Lecanoracées. Bull. Soc.

Bot. France 67: 521-527.

Culberson CE. 1970. Supplement to “Chemical and Botanical Guide to Lichen Products”. Bryologist

73: 177-377. doi:10.2307/3241261

Fritze R, Ilse H. 1870. Karpaten-Reise. Gemeinschaftlich ausgefiihrt im Juli und August 1868 und

beschrieben. Verh. K.K. Zool.-Bot. Ges. Wien 20: 467-526.

Hafellner J, Turk R. 2001. Die lichenisierten Pilze Osterreichs — eine Checkliste der bisher

nachgewiesenen Arten mit Verbreitungsangaben. Stapfia 76: 1-167.

Kondratyuk SY, Zelenko SD. 2002. New lichens and lichenicolous fungi from Israel and the Near

East. Ukr. Bot. Zhurn. 59: 598-607.

Keissler K. 1959. Usneaceae. 321-480, in Dr. L. Rabenhorst’s Kryptogamen-Flora von Deutschland,

Osterreich und der Schweiz. IX. Band, 5. Abteilung, 4. Teil, Lieferung 3. Leipzig, Akademische

Verlagsgesellschaft Geest & Portig.

Santesson R, MobergR, Nordin A, Tensberg T, Vitikainen O. 2004. Lichen-formingand lichenicolous

fungi of Fennoscandia. Uppsala, Museum of Evolution, Uppsala University, Uppsala.

Sipman HJM. 2007. New lecanoroid lichens from Greece. Bibliotheca Lichenologica 96: 267-277.

Steiner J. 1921. Lichenes aus Mesopotamien und Kurdistan sowie Syrien und Prinkipo. Ann.

Naturhist. Mus. Wien 34: 1-68.

Werner RG. 1958. Notes de lichénologie libano-syrienne. V. Bull. Soc. Bot. France 105(5-6):

238-243.

MYCOTAXON

Volume 115, pp. 271-279 January-March 2011

DOT: 10.5248/115.271

Tropical Trametes lactinea is widely distributed

in the eastern USA

JosEF VLASAK* & Jikf KouT3

‘Biol. Centre of the Academy of Sciences of the Czech Republic &’ University of South Bohemia,

Faculty of Science, Branisovskd 31, CZ-370 05 Ceské Budéjovice, Czech Republic

2University of West Bohemia, Faculty of Education, Department of Biology,

Klatovské 51, CZ-306 19 Pilsen, Czech Republic

* CORRESPONDENCE TO: viasak@umbr.cas.cz

ABsTRACT — Trametes lactinea is reported from the USA for the first time. This large and

conspicuous polypore, known until now only from tropical regions, was collected in many

different localities in eastern USA. ITS region of six collected specimens and four others

from public and private herbaria was sequenced and compared with the sequences in the

GenBank. Important macro- and micro-characteristics that discriminate between T. lactinea

and its similar species T. elegans are pointed out and discussed.

Key worps — Basidiomycota, USA new record, taxonomy, invasive species

Introduction

Since 2001, we have occasionally collected in the eastern USA (from Virginia

to Connecticut) a very large (< 7 cm thick, < 20 cm wide), white to light greyish

Trametes species with a velutinous but not hirsute pileus and large, regular pores

that appear a bit brownish when old. The collections, which were always sterile,

could not be identified using the keys for USA Trametes species. In early spring

2009 when travelling around southern Florida we noted a great abundance of

a very similar, but thinner and fertile, Trametes sp. that was in many localities

the dominant fungus on both hardwoods and pines. In this article we present

evidence that both the early spring/southern and the autumn/northern USA

collections represent the same species, Trametes lactinea, that is, accordingly,

widely distributed in the eastern USA and locally very common, in contrast to

literature data.

Trametes lactinea is a typical Trametes species with a white tough context,

white tomentose pileus, and large pores. Described from Sri Lanka (Berkeley

1843), it was reported as common in the tropics of East Asia and Australia, rare

272 ... Viasdk & Kout

TABLE 1. Trametes lactinea and T. elegans specimens examined.

SPECIMEN

T. lactinea

PRM560783

Damm 8936

Damm 4703

V0108/8-H

V0309/130-J

V0309/186A

V0312/28.2-J

V0410/11-J

V0709/179

V0808/29

0809/50

0904/23

0904/24

0904/27

0904/43 =

PRM915660

0904/79

0904/93

V0904/120

V0904/127

V0409/145 =

PRM915661

V0904/146

V0904/147

V0904/148

V0904/148A

T. elegans

PRM871961

PRM887367

6069-Dammrich

V0212/37-J

V0411/2-Ja&Ro

V0511/2-Kop

LocaLity

Fungi of west Pakistan

15286, coll. S. Ahmad

Mahé, Beau Vallon, Seychelles

Mauritius Island

Valley Forge, PA, USA

Hatfield Apartments, Hatfield, PA, USA

Promised Land St. Park, Pike

County, PA, USA

Tree Tops Park, Miami, FL, USA

Mason Neck St. Park,

Woodbridge, VA, USA

Mason Neck St. Park,

Woodbridge, VA, USA

Swamp Creek, Schwenksville, PA, USA

Yale Univ. arboretum,

New Haven, CN, USA

Royal Palm, Everglades N.P., FL, USA

Royal Palm, Everglades N.P, FL, USA

Long Pine Key, Everglades N.P., FL, USA

East Main Tram, Fakahatchee

Strand Preserve, FL,USA

Collier-Seminole St. Park, FL, USA

Myakka River St. Park,

Sarasota Co., FL, USA

Myakka River

Sarasota Co.,

Myakka River

Sarasota Co.,

Myakka River

Sarasota Co.,

Myakka River

Sarasota Co.,

L, USA

HwHamnmnN aw

Esmeralda pr. Camagtiey,

Mt. California, Cuba

Pico Perillo, Sierra del

Escambray, Cuba Centr.

Ko Samui, Thailand

Gainsville, FL, USA

Cameroon Highlands, Malaysia

Ecuador

SUBSTRATE

Morus alba

Cocos

hardwood

Populus

Carya

beech

Casuarina

Nyssa

hardwood

oak

beech

hardwood

pine

hardwood

pine

ive oak

Eugenia

hardwood

Carya

hardwood

COLLECTED

27.11.1961

10.I1.2008

13.I1.2000

1.VIL.2001

18.IX.2003

22.1X.2003

28.X11.2003

9.X.2004

22.1X.2007

28.VIIL.2008

13.IX.2008

19.IV.2009

21.1V.2009

22.1V.2009

23.1V.2009

24,1V.2009

24. 1V.2009

24, 1V.2009

14.X.1966

51.1967

15.I1.2002

20.X11.2002

27.X1.2004

3.X1.2005

* Numbers indicate sequenced specimens. Bold numbers indicate specimens with ribosomal RNA

ITS region sequence deposited in GenBank: 2 = HM756192, 3= HM756193, 10 = HM756191,

11=HM756196, 12 = HM756194, 13 = HM756195. Sequences 1, 4, 6, 7, 8 are identical with published

sequence AY684178; sequences 5, 9, 10 are also identical.

Trametes lactinea in eastern U.S.A. ... 273

in southern China and Africa, but not occurring in tropical America (Corner

1989, Dai 2009, Dai et al. 2004, Ryvarden 1976, Ryvarden & Johansen 1980).

Since 2000, its occurrence in South America has slowly been acknowledged

(Ryvarden 2000, 2001), but there are no previous records for the USA. We have

compared our USA collections with three standard T. lactinea samples from

public and private herbaria, including ITS region sequencing, and found that

they are identical. We also show that other sequences in the GenBank annotated

as T! lactinea are often derived from another species, Trametes elegans (Spreng.)

Fr., and so we summarize here the most important characteristics that allow to

discriminate these two species. Comments regarding other lenzitoid Trametes

species are also provided.

Materials & methods

Specimens studied

We collected 13 fertile specimens of T. lactinea in early spring 2009 in Florida and

nine other sterile specimens from various states of eastern USA from late summer

through early winter during 2001, 2003, 2004, 2007, and 2008. We also studied one

sample (unfortunately sterile) of T’ lactinea obtained from PRM collection in Prague

and one fertile sample from Frank Dammrich private collection that was reputedly

determined by Prof. Ryvarden. We have also inspected some typical samples of similar

T. elegans (TaBLE 1) and one aberrant sample from the Dammrich collection labeled

as T. menziesii (Berk.) Ryvarden. Pieces of dried basidiocarps mounted in water were

examined microscopically and 20 basidiospores from each specimen were measured.

One drop of 10% KOH was added to study the swelling of skeletal hyphae. Specimens

are deposited in the private herbarium of the first author (http://mykoweb.prf.jcu.cz

/polypores) and PRM (TaBLe 1).

ITS amplification and sequencing

0.25 g of the context tissue from dried specimens was frozen and disintegrated 60 s

with steel ball in mixer mill MM301 RETSCH under liquid nitrogen. DNA was isolated

using CTAB/NaCl extraction buffer as described by Murray & Thompson (1980),

followed by repeated extraction with chloroform and isopropanol precipitation. Crude

DNA was dissolved in 100 ul of sterile water and further purified using Wizard Clean

Up kit PROMEGA. Resulting DNA solution (50 ul) was diluted ten times and 1 ul was

used as template for amplification with ITS1 and ITS4 primers (White et al. 1990) in 25

ul reaction mixture using 55°C annealing temperature. Amplified DNA was purified

using Wizard Clean Up kit PROMEGA and sequenced in the Genomics laboratory of

Biology Centre, Academy of Sciences of the Czech Republic, Ceské Budéjovice, on ABI

3730xl DNA analyzer, using BigDye Terminator 3.1 kit.

ITS sequence analysis

The sequences were aligned by Clustal X and manually pruned. The evolutionary

history was inferred using the Neighbor-Joining method (Saitou & Nei 1987). The

evolutionary distances were computed using the Maximum Composite Likelihood

method (Tamura et al. 2004). All positions containing gaps and missing data were

274 ... Viasdk & Kout

eliminated from the dataset (complete deletion option). There were a total of 454

positions in the final dataset. Phylogenetic analyses were conducted in MEGA4 (Tamura

et al. 2007).

Taxonomy

Ryvarden & Johansen (1980) and Corner (1989) published very good

descriptions of Trametes lactinea; here we compile the most important features

and add some new characteristics based on our own observations of many

fresh USA specimens.

Trametes lactinea (Berk.) Sacc. FIGURE 1

Photos in (http://mykoweb.prf.jcu.cz/polypores)

BASIDIOMES annual to biennial, solitary to more rarely imbricate (when

growing on short stumps), pileate, broadly to narrowly attached, 1-25 cm

broad and wide, and 0.5-2 cm thick (exceptionally up to 7 cm thick at the

base in specimens from the Northern USA), hard corky; pILEus semicircular,

mostly applanate but sometimes rather thick at the base, surface velvety, but

with no hairs visible under 20x lens, becoming warted with age, sometimes

with irregular outgrows especially near the base, azonate or very slightly

concentrically sulcate, sometimes with narrow greyish zones near the margin

or with wide, concentric furrows that mark periods of an intensive growth;

MARGIN obtuse and thick at first, sterile below, later sharpened, with pores

developed to the very edge; porgs at first white, later cream to ochraceous and

darker than the upper surface, at first round, thick-walled, later with wedge-

narrowed edges, in old specimens thin-walled, distinctly angular, but never

labyrinthine, 2-3 per mm; TUBEs concolorous with the context, 6-12 mm long;

CONTEXT 5-20 mm, sometimes up to 60 mm thick, white, corky.

Hyphal system trimitic, GENERATIVE HYPHAE clamped and thin-walled,

1-3 um in diam.; SKELETAL HYPHAE abundant, hyaline, mostly with only

moderately thickened walls, 4-6 um in diam., but sometimes 3-4 um broad

and almost solid. After adding 10% KOH the solid hyphae swell to 10-15 um

in diam. and shrink quickly in vivid movements; in moderately thickened

hyphae the swelled walls only fill the hole but the outer diameter remains

unchanged. BINDING HYPHAE abundant, hyaline, thick-walled, arboriform, 1-5

um in diam.; BAsIDIA clavate, 4-sterigmate, 12-16 x 5-7 wm; CYSTIDIA none;

BASIDIOSPORES oblong-ellipsoid to cylindric, hyaline, negative in Melzer’s

reagent, 5-7 x 2.5-3.2 um, thin-walled.

Differentiation between Trametes lactinea and Trametes elegans

Because Trametes lactinea keys in the American literature as T. elegans

(Gilbertson & Ryvarden 1987), we summarize here the most important

characteristics ofboth species. Spores are clearly diagnostic — they are distinctly

Trametes lactinea in eastern U.S.A... 275

Ficure 1: Trametes elegans PRM 887367 (A): basidiospores. Trametes lactinea (B): a. basidiospores,

b. skeletal hyphae, c, d. binding hyphae.

larger in T: lactinea (usually > 6 um x 3 um) and more curved and smaller (< 6

um x 2.5 um) in T. elegans (Fic. 1). Basidia of T. elegans are also quite small, only

8-13 x 4-6 um. Unfortunately, many collections of both species are completely

sterile. Trametes lactinea does not have hyphal pegs but all 6 studied specimens

of T. elegans had pegs in the tubes that could be best seen on cut tubes under

lens as scattered warts or protuberances on tube sides. Although this feature

has never been mentioned in T° elegans descriptions, we regard it as rather

constant. Pores of T. lactinea change in the course of basidiocarp development

from thick-walled, round, and white to relatively thin-walled, angular, and

brownish, but they are never labyrinthine, whereas in T' elegans they are

mostly lamellate and when poroid, they are a bit elongated or labyrinthine at

least in part of the fruitbody. The KOH reaction is only moderate in T! elegans:

the hyphae swell slightly, without shrinking accompanied by quick hyphal

movements. Unfortunately, the typical swelling reaction of T: lactinea skeletal

hyphae is much weaker or less striking in very old herbarium specimens. The

pileus surface of T. lactinea is quite variable but never glabrous, as it appears in

most specimens of T. elegans (and never hirsute like by T: gibbosa (Pers.) Fr.).

276 ... Viasdk & Kout

1. T. lactinea PRM560783 Pakistan

GQ982888* T. lactinea Thailand

2. T. lactinea Damm8936 Seychelles

5. T. lactinea JV041011J Virginia

GQ982887* T. lactinea Thailand

8. T. lactinea JV090424 Florida

AY684178* T. "elegans" Tennessee

6. T. lactinea JV080829 Pennsylvania

7. T. lactinea JV080950J Connecticut

T.lactinea clade BI 10. T. lactinea JV0904145 Florida

9, T. lactinea JV090443 Florida

4. T. lactinea JV0309186A Pennsylvania

EU661879* T. “elegans” China

Liege GU731566* Lenzites sp.

66'3. T. lactinea Damm 4703

FJ372692* T. "lactinea" Thailand

—-"| FJ372691* T. "lactinea" Thailand

12. T. elegans Damm6069 Thailand

13. T. elegans JV021237J Florida

GU731565* L. elegans

FJ711054* L. elegans

11. T. elegans PRM887367 Cuba

FJ711055* L. elegans

AY684170* T. hirsuta

FJ608587* T. versicolor

GU067734 L betulinus Sweden

GU731576* T. gibbosa

100 ' AY684176* T gibbosa

T. elegans clade

+—_

0.005

Ficure 2: Evolutionary relationships of 28 Trametes species based on ITS region sequence. The

bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary

history of the taxa analyzed. The percentage of replicate trees in which the associated taxa

clustered together in the bootstrap test (1000 replicates) is shown next to the branches. The tree

is drawn to scale, with branch lengths in the same units as those of the evolutionary distances

used to infer the phylogenetic tree. The evolutionary distances are in the units of the number

of base substitutions per site. Accession numbers with * represent sequences retrieved from

GenBank. Other GenBank accession numbers are in TABLE 1.

ITS sequence analysis

Allour collections and one PRM herbarium specimen from Pakistan showed

striking sequence similarities with only one variable site in ITS1. The sequence

is identical with two recently published sequences (GQ982887, GQ982888) of

Trametes lactinea in eastern U.S.A. ... 277

Trametes lactinea from Thailand and also with sequences AY684178 (Tennessee;

TomSovsky et al. 2006) and EU661879 (China, unpublished) that were derived

from putative T. elegans collections (Fic. 2). The GenBank sequence GU731566,

identified as “Lenzites sp” and derived from the CIRM-BRFM 1050 strain and

also somewhat aberrant specimen of EF Dammrich from Mauritius show about

15 transitions/transversions in ITS region, but overall sequence similarity with

T’ lactinea is prevails (see discussion). Other T° elegans/lactinea sequences from

GenBank as well as from our own, E Dammrich, and PRM collections are

distinct and comprise a distinctly separate clade (Fic. 2) that represents the

true T. elegans.

Discussion

The massive fruiting of a previously unrecognized, large polypore, Trametes

lactinea, in southern Florida is very surprising. It is possible that the species has

been misdetermined as T' elegans or T. menziesii and that many collections in

American herbaria are in fact T. lactinea. We have not systematically studied

its ecology, but it is worth mentioning that during September 2010 in our best

localities around Miami, FL, we could not find any basidiocarps except for some

disintegrated remnants. We infer that in the southernmost USA, the species

develops very late in autumn, survives winter, and disintegrates in spring, which

might contribute to its imperceptibility in the past. Nevertheless, the striking

sequence homogeneity of all American collections of T. lactinea also suggests

a relatively recent colonization of the American continent. We have previously

described a similar case of the sudden appearance of the European T. gibbosa in

the northern USA and Canada (Kout & Vlasak 2007); currently, 7: gibbosa is the

dominant polypore in the region, at least in Pennsylvania (Vlasak, unpublished

observations 2010). Notably, T. gibbosa also had been misdetermined as

T. elegans. More extensive studies are needed to confirm that T. lactinea is a

recent invasive species in the USA. Long-term and population studies may also

help explain the unexpected spread of T: lactinea to northern USA that has, to

our knowledge, no parallel in its primary distribution area in Asia.

A somewhat aberrant specimen from Mauritius, Damm 4703, with a small

pileus and slightly labyrinthine or split tubes and initially determined as

T. menziesii, has a sequence that corresponds to most of that from T. lactinea but

contains several mutations that are often identical with GenBank GU731566

derived from a Lenzites sp. collected in French Guiana. These two sequences

cluster together with 66% bootstrap support (Fic. 2). The contributors of

GU731566 note that several other French Guianan Lenzites sp. specimens with

quite variable pore surfaces (poroid with 1-2 mm wide pores, or daedaloid, or

lamellate) but with similar sequences were all sterile (A. Favel, INRA, Marseille,

pers. comm.). Fertile basidiocarps are needed to solve this problem. Trametes

278 ... Viasdk & Kout

menziesii is a similar but variable paleotropical species with no sequence yet

deposited in GenBank. According to Ryvarden & Johansen (1980), it should

have rather narrow spores, only 1-2 um wide. We have seen only one specimen

with older name Polyporus meleagris Berk. in PRM herbarium. It was a very

different fungus and so much damaged that we could not isolate DNA.

The T. elegans clade (Fic. 2) is much more divergent than that of T. lactinea

and the division into two branches is well supported. Again, we have no good

explanation for it at present. Trametes elegans is often regarded a member of

genus Lenzites (L. elegans (Spreng.) Pat.) based on its sometimes lamellate

hymenophore and some pointed ends of binding hyphae protruding into

hymenium, reminiscent of the catahymenium characteristic of L. betulinus

(L.) Fr. (Nufiez & Ryvarden 2001). Nevertheless, our ITS region sequence

phylogram shows no similarity between T° elegans and L. betulina, and so we

find the name T! elegans more appropriate.

Acknowledgements

We are grateful to Josef Vlasdk Jr. for collecting of many interesting polypore

specimens and revising the English language. We also thank Frank Dammrich for

generous loan of his herbarium specimens. Dr. Yu-Cheng Dai and Dr. Stephane Welti

have kindly acted as presubmission reviewers and their help is acknowledged. This

research was supported by CEZ: AV0Z50510513 fund.

Literature cited

Berkeley MJ. 1843. Notices of fungi in the Herbarium of the British Museum. Annals and Magazine

of Natural History 10: 369-384.

Corner EJH. 1989. Ad Polyporaceas VI: The genus Trametes. Beih. Nova Hedwigia 97: 1-197.

Dai YC. 2009. A checklist of polypores in China. Mycosystema 28: 315-327 .

Dai YC, Wei YL, Wang Z. 2004. Wood-inhabiting fungi in southern China 2. Polypores from

Sichuan Province. Annales Botanici Fennici 41: 319-329.

Gilbertson RL, Ryvarden L. 1986, 1987. North American polypores Vol. 1 and 2. Oslo, Fungiflora.

885 p.

Kout J, Vlasdk J. 2007. Trametes gibbosa (Basidiomycetes, Polyporales) in the USA and Canada.

Canadian Journal of Botany 85: 342-346. doi:10.1139/B07-013

Murray MG, Thompson WF. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic

Acids Research 8: 4321-4325. doi:10.1093/nar/8.19.4321

Nujiez M, Ryvarden L. 2001. East Asian polypores 2. Synopsis Fungorum 14: 170-522.

Ryvarden L. 1976. Type studies in the Polyporaceae 7. Species described by M.J. Berkeley from 1836

to 1843. Kew Bulletin 31: 81-103. doi:10.2307/4108997

Ryvarden L. 2000. Studies in neotropical polypores 8. Poroid fungi of Jamaica — a preliminary check

list. Mycotaxon 74: 349-360.

Ryvarden L. 2001. Studies in neotropical polypores 9 - a critical checklist of poroid fungi from

Venezuela. Mycotaxon 78: 393-405.

Ryvarden L, Johansen I. 1980. A preliminary polypore flora of East Africa. Oslo, Fungiflora. 636 p.

Saitou N, Nei M. 1987. The neighbor-joining method: A new method for reconstructing

phylogenetic trees. Molecular Biology and Evolution 4: 406-425.

Trametes lactinea in eastern U.S.A. ... 279

Tamura K, Nei M, Kumar S. 2004. Prospects for inferring very large phylogenies by using the

neighbor-joining method. Proceedings of the National Academy of Sciences (USA) 101:

11030-11035. doi:10.1073/pnas.0404206101

Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis

(MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596-1599. doi:10.1093/

molbev/msm092

TomSovsky M, Kolafik M, PaZoutova S$, Homolka L. 2006. Molecular phylogeny of European

Trametes (Basidiomycetes, Polyporales) species based on LSU and ITS (nrDNA) sequences.

Nova Hedwigia 82: 269-280. doi:10.1127/0029-5035/2006/0082-0269

White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal

RNA genes for phylogenetics. 315-322, in MA Innis et al. (eds.), PCR Protocols: a guide to

methods and applications.). San Diego, Academic Press.

MYCOTAXON

Volume 115, pp. 281-285 January-March 2011

DOT: 10.5248/115.281

A new species of Nephroma (Nephromataceae)

from the Tibetan Plateau

QIonG TIAN?, LI-SONG WaNc?, Hal- YING WANG” & ZUN-TIAN ZHAO™*

‘College of Life Sciences, Shandong Normal University, Jinan, 250014, P. R. China

*Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany,

Chinese Academy of Sciences, Kunming, 650204, P. R. China

CORRESPONDENCE TO *: ! jntiangiong@yahoo.cn, * wanglisong@mail.kib.ac.cn,

'* sinolichen@yahoo.cn, '* ztzhao@sohu.com

ApsTRAcT — A new species, Nephroma flavorhizinatum, is described from the Tibetan

Plateau. This species is characterized by marginal and laminal lobules, an obvious pruina, a

white to golden yellow medulla, a golden yellow rhizinal base, and a unique chemistry.

Key worps — China, lichen, Peltigerales, taxonomy

Introduction

Nephroma Ach. is the only member of the lichen family Nephromataceae

(Peltigerales, Lecanoromycetes, Ascomycota) (Kirk et al. 2008). The genus is

morphologically characterized by a cyanobacterium (Nostoc) or a green alga

(Coccomyxa) photobiont, a coriaceous foliose thallus with cortex on both

surfaces, a kidney-shaped apothecium at lobe apices of the lower surface, an 8-

spored ascus, and often 3-septate pale brown ascospores (James & White 1987,

White & James 1988, Burgaz & Martinez 1999, Brodo et al. 2001, Wetmore &

Nash 2002, Louwhoff 2009). Most Nephroma species contain a variety of lichen

substances, including hopane triterpenoids, phenarctin, usnic acid, perlatolic

acid derivatives, anthraquinones, or other pigments (James & White 1987).

Nephroma is a cosmopolitan genus of 36 species worldwide (Kirk et al.

2008). In the southern temperate zone, Australia, North America, Europe,

Macaronesia, and South Korea, the species of Nephroma were studied

systematically (Wetmore 1980, Tensberg & Holtan-Hartwig 1983, James &

White 1987, White & James 1988, Park 1990, Goward & Goffinet 1993, Burgaz

& Martinez 1999, Brodo et al. 2001). In China, nine Nephroma species were

reported: N. helveticum, N. isidiosum, N. javanicum, N. moeszii, N. parile, N.

resupinatum, N. sinense, N. subparile, and N. tropicum (Wei 1991).

282 ... Tian & al.

During our study of the lichen flora of the Tibetan Plateau, an interesting

species of Nephroma new to science was found.

Materials & methods

The specimens studied were collected from Sichuan, China, and are preserved in

SDNU (Lichen Section of Botanical Herbarium, Shandong Normal University). The

morphological and anatomical characters of the specimens were examined using a

stereo microscope (COIC XTL7045B2) and a microscope (OLYMPUS CX21). Lichen

substances in all specimens cited were identified using the standardized thin layer

chromatography techniques (TLC) with G system (Culberson et al. 1981). Photos of the

thallus were taken under OLYMPUS SZX12 with DP72.

Taxonomy

Nephroma flavorhizinatum Q. Tian & H.-Y. Wang, sp. nov. Fies 1,2

MycoBank MB 519038

Lobus crenatus. Lobulus marginalis et laminalis. Medulla alba ad flava. Rhizina flava ad

basis. Phycobiont Nostoc. Thallus T1, T2 et T4 continens.

TYPE COLLECTION: CHINA. Sichuan province, Litang, alt. 4200 m, on ground, Z. S. Sun,

20080755, 5 Nov. 2008. (Holotype in SDNU).

EXPANDED DESCRIPTION — Thallus foliose, coriaceous, about 4 cm in diameter.

Lobes irregular, usually 2-10 mm wide, often ascending at the margins,

crenulate or with lobules. Upper surface brown, smooth; isidia and soredia

absent; lobules marginal and laminal, usually 0.2-1 mm wide, developing from

isidioid papillae, immediately becoming flat, some of them branched; pruina

white, at the margins of lobes and the dorsal surface of apothecia. Photobiont

Nostoc. Medulla white to golden yellow. Lower surface dark brown, tomentose,

paler and smooth at the margins; rhizines about 3 mm long, brush-like, golden

yellow at the bases, white at the tips. Apothecia common, immersed on lower

surface at tips of lobes, kidney-shaped, usually erect; disc dark brown, 1-4

mm in diameter; dorsal surface often with short tomentum; margins usually

entire, rarely crenulate or with lobules. Asci 8-spored; ascospores pale brown,

3-septate, 15-20 x 3.5-5 um. Pycnidia not seen.

Spots TEsts—Thallus upper surface: K-, C-, KC-, PD-; white medulla: K-,

C-, KC-, PD-; golden yellow medulla: K+ violet, C-, KC-, PD-; rhizinal base:

K+ violet, C-, KC-, PD-; rhizine tip: K-, C-, KC-, PD-.

SECONDARY METABOLITES—7[-acetoxyhopan-22-ol (T1), 15a-acetoxyhopan-

22-ol (T2), hopane-7B,22-diol (T4).

DISTRIBUTION AND SUBSTRATE —Nephroma flavorhizinatum is a terricolous

species, at present known only from the type locality.

ADDITIONAL SPECIMENS EXAMINED —CHINA. Sichuan: Litang. alt. 4200 m, on soil, 5

Nov. 2008, Z.S. SUN 20084011 & 20103317 (SDNU).

Nephroma flavorhizinatum sp. nov. (Tibetan Plateau) ... 283

Fic. 1 Nephroma flavorhizinatum (holotype).

A. Thallus. B. Pruina at the dorsal surface of apothecia. (Scale bars = 2 mm).

COMMENTS— lhe presence of laminal and marginal lobules, a white to golden

yellow medulla, a golden yellow rhizinal base, and the unique chemical

characters distinguish Nephroma flavorhizinatum from all other Nephroma

284 ... Tian & al.

Fic. 2 Nephroma flavorhizinatum (holotype).

A. Crenulate lobe. B. Developing laminal lobules. C. Marginal lobules.

D. Developed laminal lobules. E. Rhizines: golden yellow at the bases, and white at the tips.

FE. 8-spored ascus. G. 3-septate ascospore.

(Scale bars: A, C, D = 0.5 mm; B = 0.1 mm; E = 2 mm; F = 5 um; G = 2 um)

species. Many Nephroma species have laminal lobules (phyllidia or folioles),

but most Nephroma species have no rhizines. N. isidiosum, N. kuehnemannii

and N. microphyilum are rhizinate. However, N. isidiosum and N. kuehnemannii

have no laminal lobules, and the former is isidiate, the latter is lichenized with

green algae. N. microphyilum has laminal lobules, but its ascospores are 5-8-

septate rather than 3-septate, and longer than the new species (70-90 tum vs.

15-20 um). Moreover, the medulla and rhizines of all the three Nephroma

species mentioned above are white rather than golden yellow. N. analogicum,

Nephroma flavorhizinatum sp. nov. (Tibetan Plateau) ... 285

N. chubutense, N. laevigatum, N. tangeriense, and N. venosum all have white to

yellow medulla and lobules. However, these five species are not rhizinate, and

their lichen substances are different from the new species.

Acknowledgements

The project was financially supported by the National Natural Science Foundation of

China (31070010) and Natural Science Foundation of Shandong Province (Y2007D21).

The authors would like to thank Prof. Ana Rosa Burgaz (Madrid University, Spain)

for the assistance in the specimen identification. The authors thank Prof. A. Aptroot

(ABL Herbarium, Soest, The Netherlands) and Prof. Shou-Yu Guo (Key Laboratory of

Systematic Mycology & Lichenology, Institute of Microbiology, Chinese Academy of

Sciences, Beijing, China) for presubmission reviews.

Literature cited

Brodo IM, Sharnoff DS, Sharnoff S. 2001. Lichens of North America. Yale University Press: New

Haven and London. 795 pp.

Burgaz AR, Martinez I. 1999. The genus Nephroma Ach. in the Iberian Peninsula. Cryptogamie,

Mycol. 20: 225-235. doi:10.1016/S0181-1584(00)87030-X

Culberson CE, Culberson WL, Johnson A. 1981. A standardized TLC analysis of B-orcinol

depsidones. The Bryologist 84: 16-29. doi:10.2307/3242974

Goward T, Goffinet B. 1993. Nephroma silvae-veteris, a new lichen (Ascomycotina) from the Pacific

Northwest of North America. The Bryologist 96(2): 242-244. doi:10.2307/3243809

James PW, White FJ. 1987. Studies on the genus Nephroma I. The European and Macaronesian

species. Lichenologist 19: 215-268. doi:10.1017/S0024282987000239

Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the fungi. 10th Edition. CABI

Bioscience: CAB International. 771 pp.

Louwhoff SHJJ. 2009. Nephromataceae. Pp. 423-427, in McCarthy PM (ed.). Flora of Australia, Vol.

57. ABRS, Canberra & CSIRO Publishing, Melbourne.

Wetmore CM. 1980. A new species of Nephroma from North America. The Bryologist 83: 243-247.

doi: 10.2307/3242144

Wei JC. 1991. An enumeration of lichens in China. International Academic Publishers: Beijing.

278 pp.

Wetmore CM, Nash III TH. 2002. Nephroma. Pp. 296-298, in: Nash III TH, Ryan BD, Diederich P,

Gries C, Bungartz F (eds.). Lichen Flora of the Greater Sonoran Desert Region, Vol. 1. Lichens

Unlimited: Arizona State University, Tempe, Arizona. 532 pp.

Park YS. 1990. The macrolichen flora of South Korea. The Bryologist 93: 105-160.

doi: 10.2307/3243619

MYCOTAXON

Volume 115, pp. 287-301 January-March 2011

DOT: 10.5248/115.287

Studies in Erysiphales anamorphs (4):

species on Hydrangeaceae and Papaveraceae

ANKE SCHMIDT! & MARKUS SCHOLLER”

'Holunderweg 2 B, D-23568 Liibeck, Germany

*Staatliches Museum fiir Naturkunde, Erbprinzenstr. 13, D-76133 Karlsruhe, Germany

* CORRESPONDENCE TO: markus.scholler@smnk.de

AssTRACcT — Anamorphic powdery mildews on Hydrangeaceae and Papaveraceaein Germany

are revised. Species are documented in detail including line drawings, photomicrographs, and

identification keys. On Papaveraceae three species are accepted, specifically Erysiphe macleayae

on Chelidonium majus and Macleaya cordata, E. cruciferarum on Eschscholzia californica, and

Oidium sp. (an unknown species previously assigned to E. cruciferarum) on Pseudofumaria

lutea. Species on Hydrangeaceae are Oidium hortensiae on Hydrangea macrophylla and

E. deutziae on Deutzia cf. scabra and Philadelphus cf. coronarius. The fungus on the latter host

plant was previously assigned to O. hortensiae. Erysiphe deutziae, E. macleayae, and Oidium

hortensiae are introduced species.

Key worps — conidial germination, morphology, neomycete

Introduction

In Germany, there are three species of Erysiphales reported on Papaveraceae

(Erysiphe cruciferarum, Erysiphe cf. macleayae, Golovinomyces orontii (Castagne)

Heluta); and two (Erysiphe deutziae, Oidium hortensiae) on Hydrangeaceae

(Braun 1995, Jage et. al. 2010). The following is a revision of anamorphs on

certain host plants of Papaveraceae/Hydrangeaceae (Chelidonium, Deutzia,

Hydrangea, Macleaya, Meconopsis, Philadelphus and Pseudofumaria) for which

the host/pathogen affiliations have been doubtful.

Materials & methods

Both fresh and dried structures were examined in tap water mounts with light

microscopy using Olympus BH 2 and Zeiss Axioskop 2 Plus. Pertinent features were

measured at a magnification of 400x or 1000x and documented by line drawings and

photographs using a Canon Al or Canon Powershot A80. From each specimen up to

25 spores were measured. To induce conidial germination, the method of Schmidt &

Scholler (2002) was applied. Fresh conidia were spread on a microscope slide and placed

288 ... Schmidt & Scholler

in a Petri dish with moist cellulose tissue. The closed Petri dishes were incubated at

room temperature and exposed to daylight through a north-facing window for 24 h.

Specimens were studied from HAL, KR, and private herbaria (Herbarium J. Kruse,

A. Schmidt). Specimens collected by the authors were deposited in KR (some duplicates

in the private herbarium of the first author). Permanent slides were made using Hoyer’s

medium (Cunningham 1972). If possible, fresh material was studied, but for study of

outer cell wall ornamentation of conidia only dried material was used according to

Bélanger et al. (2002).

The species concept and nomenclature follows Braun (1999) and Braun & Takamatsu

(2000). The host plants are named according to the Flora Europaea (Tutin et al.

1964-80).

Taxonomic descriptions

Species on Papaveraceae (incl. Fumariaceae)

Erysiphe macleayae RY. Zheng & G.Q. Chen PLATE 1

SPECIMENS STUDIED — On Macleaya cordata R. Br.: Germany, Brandenburg, Potsdam-

Bornim, Am Raubfang, (MTB 3544/3/3), 8 Nov. 2004, leg. V. Kummer (KR 0021921 and

herbarium A. Schmidt no. KM 203) (host species cf.) (fresh); Sachsen, Gorlitz, Sonnenstr.

17, front garden of Dunger house of Staatliches Museum fiir Naturkunde, 25 Oct. 2005,

leg. et det. H. Boyle as «cf. Erysiphe macleayae R.Y. Zheng & G.Q. Chen» (HAL 2209

F = GLM F070246), with hyperparasite Ampelomyces quisqualis; Brandenburg, Teltow,

Lichterfelde direction, Lenaustr., 18 Sep. 2009, leg. et det. V. Kummer as «cf. Erysiphe

macleayae R.Y. Zheng & G.Q. Chen» (HAL 2133 F) (dry). On Meconopsis cambrica

(L.) Vig.: Germany, Niedersachsen, Hannover, Zoo, Adenauerallee 3, wayside (MTB

3624/2/1), 55 m, 9 Oct. 2009, leg. J. Kruse, det. U. Braun, anamorph + teleomorph with

mature ascomata on stem (mixed infection with Peronospora meconopsidis Mayor, det.

M. Scholler) (herbarium J. Kruse no. E 0293) (dry).

Mycelium conspicuous, dense, either covering the whole surface or around

leaf veins, whitish to slightly brownish, amphigenous, but predominantly

epiphyllous; sterile hyphae hyaline, branched, smooth, 3.5-7 um wide;

hyphal appressoria lobed or nipple-shaped, singly or in pairs; epiphyllous

conidiophores 45-90 um, 5.5-11 um wide, attenuated toward base, lowermost

cell up 8 um, uppermost cell up to 11 um wide, 3-celled, rarely 2- or 4-celled,

foot-cell, longest cell of conidiophores, 25-40 um long, often curved; conidia

formed singly, ellipsoid to cylindrical (-doliiform), 26.5-44.0(-47.5) x (10-)

14.5-18.5(-20) um, length/width ratio 1.8-3, average 2.4 (dry material) or

2.1-3.4, average 2.5 (fresh), wrinkling pattern of outer wall angular, of end wall

fibrillar; germ tubes subapically inserted, non- to two-septate, short to long,

20-115 x 2.5-6.0 um, germ tubes terminating simply or in a club-shaped or

rarely in a lobed appressorium, sometimes branching.

Erysiphe cf. macleayae RY. Zheng & G.Q. Chen on Chelidonium majus PLATE 2

SPECIMENS STUDIED — On Chelidonium majus L.: Germany, Brandenburg, Potsdam,

Lennéstr./Carl-von-Ossietzky-Str., 4 Oct. 2004, leg. V. Kummer (KR 0021909 and

Erysiphales on Hydrangeaceae & Papaveraceae ... 289

PLATE 1. Erysiphe macleayae on Macleaya cf. cordata (KR 0021921 = KM 203). A. Conidiophores

(epiphyllous), B. Appressoria, C. Conidia. Bar = 10 tm; drawings by A. Schmidt.

herbarium A. Schmidt no. KM 202) (fresh); Brandenburg, Potsdam, Maulbeerallee 2,

25 Sep. 2005, leg. V. Kummer (KR 0021933 and herb. A. Schmidt no. KM 212) (fresh);

Thiiringen, Jena, near University, Institut fiir Okologie, near Dornburger StraBe, 18 Oct.

2005, leg. V. Kummer (KR 0021934 and herbarium A. Schmidt no. KM 215); Thiiringen,

Bad Frankenhausen, on town wall between Fritz-Brather-Str. and Franz-Winter-Str., 14

Oct. 2007, leg. A. Schmidt (KR 0002945 and herbarium A. Schmidt no. KM 250) (fresh);

Baden-Wiirttemberg, Karlsruhe, Griinwinkel, Albsiedlung, Silcherstr., slope, 110 m, 13

290 ... Schmidt & Scholler

PLateE 2. Erysiphe cf. macleayae on Chelidonium majus. A. Conidiophores (epiphyllous) (KR 0021909

= KM 202), B. Appressoria (KR 0021934 = KM 215), C. Conidia with oil drops (KR 0004850),

D. Conidia (KR 0021909 = KM 202), E. Germinated conidia after 24 h in moist chamber cultures

(KR 0021909 = KM 202). Bar = 10 um; drawings 2A, B, D, E by A. Schmidt, 2C by M. Scholler.

Erysiphales on Hydrangeaceae & Papaveraceae ... 291

Sep. 2009, leg. M. Scholler (KR 0004850) (fresh). Hungary, Martonvasar, 9 Sep. 2004, leg.

et det. T. Jankovics (2007) as «Oidium sp. » (HAL 1842 F) (dry).

Mycelium not conspicuous, not dense, arachnoid, whitish, amphigenous,

predominantly epiphyllous, often around leaf veins and leaf margins; sterile

hyphae superficial, hyaline, sparingly branched, smooth, 3.5-6 «um wide; hyphal

appressoria rarely formed, lobed or nipple-shaped, single or sometimes in pairs;

epiphyllous conidiophores 60-115 um, 7-10.4 um wide, sometimes slightly

attenuated toward base, with uppermost cell widest, 3-celled, rarely 2-celled,

foot-cell, longest cell of conidiophore, 31-70 um, often curved, uppermost

cell often shortest; conidia formed singly, ellipsoid, partly cylindrical, (28-)

31-40(-46.5) x (11.5-)12.5-17.5(-18.5) um, length/width ratio 2.1-3 (average

2.4), wrinkling pattern of outer wall with angular ridges, partly without ridges;

germ tubes subapically inserted, non- to two-septate, first septum close to

conidium, germ tubes short to long, 15-125 x 3.5-6.0 «um, terminating simply

or in a club-shaped or, if in short germ tubes, then in a lobed appressorium,

sometimes branching.

Erysiphe cruciferarum Opiz ex L. Junell PLATE 3

SPECIMENS STUDIED — On Eschscholzia californica Cham.: Germany, Niedersachsen,

Soltau, Heidepark, wayside (MTB 2925/3), 57 m, 23 Sep. 2009, leg. J. Kruse (herbarium

J. Kruse no. E 0279, mixed infection with Acroconidiella eschscholziae (Harkn.) M.B.

Ellis) (dry).

Mycelium not conspicuous, sparse, whitish, amphigenous, mainly hypophyllous

and caulicolous; sterile hyphae superficial, hyaline, sparingly branched,

ee ay

Pate 3. Erysiphe cruciferarum on Eschscholzia californica (herb. J. Kruse no. E 0279).

Conidiophores (hypophyllous). Bar = 10 um; drawings by M. Scholler.

292 ... Schmidt & Scholler

smooth, 4-10 wm wide; hyphal appressoria lobed; hypophyllous conidiophores

central on mother cell, 55-70(-100) wm, 7.5-9.5 um wide, sometimes slightly

attenuated, 2-3(—4)-celled, foot-cell, longest cell of conidiophore, straight or

rarely slightly curved; conidia formed singly, cylindrical to ellipsoid, 37.5-52.5

x (12.5-)14.5-18.5 um, length/width ratio 2-3.9 (average 2.9), wrinkled wall

surface angular; germ tubes inserted subapically, non- to one-septate, 20-55 x

3.5-5.5 um, terminating simply or in a club-shaped appressorium.

Oidium sp.

SPECIMENS STUDIED — On Pseudofumaria lutea (L.) Borkh. (= Corydalis lutea (L.) DC.):

Germany, Brandenburg, Potsdam-Bornim, Florastr. 4, 2 Oct. 2004, leg. et det. V. Kummer

as «cf. E. werneriy (HAL 2123 F) (dry); Germany, Sachsen-Anhalt, Tangermiinde,

“Roffurth’, Elbtor, shady wall, 8 Oct. 2004, leg. et det. H. Jage as «Oidium» (HAL 2124

F) (dry, scanty material).

Mycelium conspicuous, dense, whitish, amphigenous, predominantly

hypophyllous; sterile hyphae hyaline, branched, smooth, 4-6.5 um wide;

hyphal appressoria lobed or nipple-shaped in pairs; conidiophores 65-130 um

long; epiphyllous 65-75 um, hypophyllous 95-125 um, uniformly 5.5-9 um

wide, not attenuated toward base, (2-)3(-4)-celled, foot-cell, longest cell of

conidiophore, straight or sinuous; conidia formed singly, cylindrical to ellipsoid,

29,5-50.0 x 9-12(-13) um, length/width ratio 2.3-5.3 (average 3.6), wrinkled

outer wall angular; germ tube subapically inserted, non-septate, 20.5 x 3 um,

terminating simply.

Species on Hydrangeaceae

Oidium hortensiae Jorst. PLATE 4

SPECIMENS STUDIED — On Hydrangea macrophylla (Thunb.) Ser: Germany, Berlin,

Lichterfelde, Hortensienstr., balcony, flower-pot, 27 Jun. 1993, leg. M. Scholler (KR

0003726) (fresh); Hamburg-Nienstedten, Cordsstr. 3, Cords nursery, flower-pot, 26 Jun.

2009, leg. A. Schmidt (KR 0024164, herbarium A. Schmidt no. KM 275) (fresh).

Mycelium not conspicuous, not dense, arachnoid, whitish, in small patches

on violet spots, amphigenous; hyphal appressoria numerous, lobed, in pairs,

often in sequences of several pairs (up to 4); epiphyllous and hypophyllous

conidiophores about central on mother cell, 40-130 um long, 7-10 um wide,

mostly 2-3-celled, rarely 4-5-celled, foot-cell 17-45(-50) um long, mostly

straight, sometimes attenuated toward base or curved, 4—5-celled conidiophores

occur on both sides of the leaf, conidiophores longer and slightly narrower

below; conidia formed singly, ellipsoid to cylindrical, partly doliiform or ovoid,

(25-)27-40(-45) x (11.5)-13-22 um, length/width ratio 1.7-3.1 (average

2.2), wrinkling pattern of outer wall with mainly longitudinal, slightly angular

ridges; germ tubes subapically inserted, one-septate, 20-88 x 2-5 um, germ

Erysiphales on Hydrangeaceae & Papaveraceae ... 293

A B

Pate 4. Oidium hortensiae on Hydrangea macrophylla (KR 0024164 = KM 275). A. Conidiophores

(epiphyllous), B. Conidiophores (hypophyllous), C. Appressoria, D. Conidia, E. Germinated

conidia after 24 h in moist chamber cultures. Bar = 10 um; drawings by A. Schmidt.

294 ... Schmidt & Scholler

tubes short to long, rarely terminating simply, mostly in a club-shaped or lobed

appressorium, sometimes branched, often germinating with two or three germ

tubes per conidium.

Erysiphe deutziae (Bunkina) U. Braun & S. Takam. on Deutzia PLATE 5

SPECIMENS STUDIED — On Deutzia cf. scabra Thunb.: Germany, Hamburg-Nienstedten,

Wesselhoeftpark, 27 Jun. 2009, leg. A. Schmidt (KR 0024165, herbarium A. Schmidt

no. KM 276/1) (fresh); Hamburg-Nienstedten, Wesselhoeftpark, 18 Jul. 2009, leg. A.

Schmidt (KR 0024168, herbarium A. Schmidt no. KM 276/2) (fresh).

Mycelium not conspicuous, not dense, whitish, epiphyllous, low rate ofinfection;

hyphal appressoria numerous, lobed, in pairs; epiphyllous conidiophores

55-65 um long, 8-10 um wide, sometimes slightly attenuated toward base, 2-3-

celled, foot-cell 25-35 um long, straight or sometimes curved; conidia formed

singly, mostly ellipsoid, partly ovoid or doliiform, 26.5-36(-40) x (16.5-)

18-20 tm, length/width ratio 1.4—2.2 (average 1.7), fresh conidia with numerous

small conspicuous droplets beside large oil drops, wrinkling pattern of outer

cell wall irregular with interrupted longitudinal and angular ridges; germ tubes

subapically inserted, always one-septate, septum distant from conidium, mostly

about middle of germ tube, germ tubes short to moderately long, 25-125 x

3.0-4.5 um, terminating in a mostly lobed or club-shaped appressorium.

Erysiphe deutziae (Bunkina) U. Braun & S. Takam. on Philadelphus PLATES 6-8

SPECIMENS STUDIED — On Philadelphus cf. coronarius L. (cult.): Germany, Nordrhein-

Westfalen, University campus, 20 Mar. 2003, leg. G. Feige & N. Ale-Agha (published

as Oidium cf. hortensiae, see Ale-Agha et al. 2008), Baden-Wiurttemberg, Karlsruhe-

Griinwinkel, Silcherstr. 25, garden, 20 Aug. 2008, leg. M. Scholler (KR 0025921,

herbarium A. Schmidt no. KM 269/1) (fresh); Baden-Wirttemberg, Karlsruhe-

Griinwinkel, Silcherstr. 25, garden, 26 Aug. 2008, leg. M. Scholler (KR 0025922,

herbarium A. Schmidt no. KM 269/2) (fresh).

Mycelium not conspicuous, not dense, whitish, arachnoid, amphigenous and

on fruits; hyphal appressoria numerous, lobed, mostly in pairs; epiphyllous

conidiophores 50-75 um long, 8.5-12.0 um wide, slightly attenuated toward

base, 2-3-celled, upper cell sometimes slightly swollen, foot-cell 21-31 um,

straight or sometimes slightly curved, hypophyllous conidiophores not different

in length; conidia formed singly, mostly ellipsoid, partly ovoid or doliiform,

24-34.5 x (16.5-)17.5-20(-22) um, length/width ration 1.3-1.9 (average 1.6),

fresh conidia with numerous small conspicuous oil drops beside large oil drops,

wrinkling pattern of outer cell wall with mainly longitudinal ridges; germ tubes

subapically inserted, non- to one-septate, septum distant from conidium, about

middle of germ tube, germ tubes short to long, 20-84 x 3.5-5.5 um, terminating

simply, in a lobed or club-shaped appressorium.

Erysiphales on Hydrangeaceae & Papaveraceae ... 295

PiatE 5. Erysiphe deutziae on Deutzia cf. scabra (KR 0024165 = KM 276/1). A. Conidiophores

(epiphyllous), B. Appressoria, C. Conidia, D. Germinated conidia after 24 h in moist chamber

cultures. Bar = 10 um; drawings by A. Schmidt.

296 ... Schmidt & Scholler

PLATE 6. Erysiphe deutziae on Philadelphus cf. coronarius. A. Conidiophores (epiphyllous)

(KR 0025921 = KM 269/1), B. Appressoria (KR 0025921 = KM 269/1), C. Conidia (KR 0025921 =

KM 269/1), D. Germinated conidia after 24 h in moist chamber cultures (KR 0025922 = KM 269/2).

Bar = 10 um; drawings by A. Schmidt.

Erysiphales on Hydrangeaceae & Papaveraceae ... 297

PLATE 7. Germinating conidia of Erysiphe deutziae on Philadelphus cf. coronarius (KR 0025922 =

KM 269/1). Bar = 10 um; photograph by A. Schmidt.

PLaTE 8. Anamorph of Erysiphe deutziae on fruits of Philadelphus cf. coronarius in a garden in

Karlsruhe. 24 Aug. 2008; photograph by M. Scholler.

298 ... Schmidt & Scholler

Key to anamorphs of powdery mildew species

recorded or expected in Germany

On Papaveraceae (incl. Fumariaceae)

la. Conidia formed in chains; on Papaver rhoeas............. Golovinomyces orontii

Ib.:Gonidia formedisingly.. o2 2. sg pe ie eed pd eae REE Wes ee eee eee eee 2

2a. Mycelium internal and external; conidiophores mostly emerging through stomata;

conidia distinctly dimorphic, primary conidia lanceolate, apically attenuated,

secondary conidia ellipsoid-cylindrical; on Glaucium spp., Papaver spp.

Ses Phan anni LanYoanh Ab tat ta et Rape rah Sana ie Ree, Leveillula taurica

2b. Mycelium external; conidiophores arising from superficial hyphae; conidia +

ellipsoid ae ey ee A ete ee here gt eee boleh nage gt Mead ches tothe tng ee 3

3a. Conidiophore foot-cells usually straight, rarely sinuous; on Eschscholzia californica,

¢Fumaria officinalis, Glaucium flavum, Papaver argemone,

P. dubium, P. nudicaule, P. orientale, P. rhoeas, P. somniferum

Aba dea SI Togas ct eager: Meee PED acdc cee eee Paes ae fors Erysiphe cruciferarum

4a. Mycelium predominantly hypophyllous, average length/width ratio of

conidia about 3.5; on Pseudofurnaria lutea ......0. 0... ccc eee eee Oidium sp.

4b. Mycelium predominantly epiphyllous, average length/width ratio of

conidia below 3.5 (2 to 3); on other hosts. 2.0... 6.0... 5

5a. Conidiophores mostly 60-115 um long, often attenuated toward base;

on Chelidonium majus .. 0.0.0.0. 0c Erysiphe cf. macleayae

5b. Conidiophores shorter, mostly 50-85 «um, often attenuated toward base;

on Macleaya cordata, Meconopsis cambrica ............... Erysiphe macleayae

On Hydrangeaceae

la. Conidia formed in chains; on Hydrangea spp. ............ Golovinomyces orontii

Ib. Gonidia formedssingl ysis i! v5, os peek pete eet pels ke OL Ue ppt ee 2

2a. Conidiophores 2-3-celled, rarely 4—5-celled, conidia without small oil drops,

conidia often germinating with two or three germ tubes per conidium; on

Hydrangea macrophylla... 0... ccc cece nee eens Oidium hortensiae

2b. Conidiophores only 2—-3-celled, conidia with numerous small oil drops, generally

germinating with only one germ tube per conidium; on Deutzia xmagnifica, D.

scabra and Philadelphus coronarius ...........0.0 0.00000 Erysiphe deutziae

Discussion

Species on Papaveraceae

Erysiphe macleayae is an introduced species native of Asia (Braun 1987)

that was previously reported from Germany by Ale-Agha et al. (2008) on

Macleaya cordata. The anamorph of this species is reported here from Germany

on Macleaya (HAL 2133 F, KR 0021921) and Meconopsis .The features of the

anamorph and only ascomata on Meconopsis (herb. J. Kruse no. E 0293) agree

Erysiphales on Hydrangeaceae & Papaveraceae ... 299

with the short description of E. macleayae on Macleaya cordata by Braun (1987).

The specimen HAL 2209 F on Macleaya is heavily infested by the hyperparasite

Ampelomyces quisqualis Ces., which obscures the morphological characters

of the powdery mildew. HAL 2133 F contains many germinated conidia.

Meconopsis cambrica is a new host genus and species for E. macleayae. Erysiphe

cruciferarum has previously been listed on this host (Braun 1987: 204) but the

specimens may belong to E. macleayae. A powdery mildew reported from

Bulgaria on Papaver somniferum L. was identified as E. macleayae (Fakirova

1991) but U. Braun studied this material and determined that it belongs to

E. cruciferarum (Braun 1995).

A powdery mildew on Chelidonium majus was first recorded in Italy by

Ciferri & Camera (1962). This material is not available, so we do not know

whether it is conspecific with the fungus on this host in Central Europe. The

Chelidonium powdery mildew may be related to or even conspecific with

E. macleayae. Minor differences are: number of septa in the conidial germ

tubes, one versus up to two on Chelidonium; and conidiophore foot-cells up to

AO um versus up to 70 um on Chelidonium.

Jage et al. (2010) identified specimens HAL 2123 F and HAL 2124 F on

Pseudofumaria luteaas E. cruciferarum. We re-studied this material and it differs

from the anamorph of E. cruciferarum by: 1) often sinuous foot cells, 2) an

extraordinarily high length/ width ratio - 3.6, and 3) formation of predominantly

hypophyllous mycelium. Braun (1987) reports a “larger than 2” L:w ratio for

E. cruciferarum and in the specimens we studied this averaged between 2.4 and

2.9. Braun (1987) also reported that in E. cruciferarum the mycelium is formed

amphigenously. Therefore, it is doubtful that the Pseudofumaria powdery

mildew is conspecific with E. cruciferarum.

One other species, E. werneri U. Braun, occurs on Papaveraceae (Corydalis s.

str.). The anamorph of this species bears some resemblance to the oidial state on

Pseudofumaria. Based on the protologue, E. werneri forms large conidia (48-63

x 15-23 wm). In a recent description of E. werneri from Korea, Shin (2000)

reported conidia 35-48 x 13-18(-20) tm with single hyphal appressoria and

mainly two-celled conidiophores. This agrees with the German material except

that it is not as wide, 9-12 (-13) um, has hyphal appressoria, and mainly three-

celled conidiophores.

Species on Hydrangeaceae

The anamorph Oidium hortensiae occurs on Hydrangea (Blumer 1967;

Braun 1987, 1995). Described as straight, cylindrical, we determined that the

conidiophores may also be attenuated toward base or curved. In contrast to

Braun (1987, 1995), we did not find conidiophores producing conidia rarely in

short chains. Our germination experiments indicated that germ tubes mostly

produced a club-shaped or lobed terminal appressorium. Simple germ tubes

300 ... Schmidt & Scholler

without any appressoria were rare. In this respect, our observations agree

with those of Blumer (1967) but disagree with Braun (1987) who stated that

the species was “without terminal lobed appressorium” According to Braun

(1995), Hydrangea macrophylla may be infected by another powdery mildew,

Golovinomyces orontii. This species is known from Switzerland and may be

expected in Germany.

A detailed description of the anamorph of the Asian Erysiphe deutziae on

Deutzia spp. in Europe was provided by Bolay et al. (2005). Our observations

agree with their description and provide additional information on the mode

of germination and germ tube morphology. However, Bolay et al. (2005)

described the conidia as 12.5-15 um wide while the German specimens were

(16.5-)17.5-20(-22) um wide. This difference may be because Bolay et al. (2005)

measured dried stained conidia whereas we measured only fresh conidia. In his

monograph, Braun (1987) described them as 14-20 um wide. An important

diagnostic feature of E. deutziae is the formation of numerous small refractive

droplets in the conidia; these are clearly visible in fresh conidia. The smaller

droplets are formed in addition to larger oil drops that are common in most

powdery mildews. Interestingly, in contrast to the large drops, the small drops

are visible even in dried conidia (when rehydrated in water). The anamorph

on Philadeiphus agrees with E. deutziae on Deutzia and we therefore consider

them to belong to the same species. This also applies to HAL 2138 F, which

was previously published as Oidium cf. hortensiae (Ale-Agha et al. 2008). The

typical Oidium hortensiae differs from E. deutziae by several morphological

characters, e.g. by not forming small droplets. Also infection experiments

reported by Blumer (1928, cited after Blumer 1933) support our results. This

study reports that Oidium hortensiae infects various Hydrangea species but not

Deutzia and Philadelphus species.

Acknowledgements

Special thanks are due to Volker Kummer who sent us literature and fresh material

for germination studies, Uwe Braun and Julia Kruse for providing herbarium specimens

and literature and Amy Rossman for critically reading the manuscript. Finally, we thank

U. Braun and Marcin Piatek for functioning as presubmission reviewers.

Literature cited

Ale-Agha N, Boyle H, Braun U, Butin H, Jage H, Kummer V, Shin H-D. 2008. Taxonomy, host range

and distribution of some powdery mildew fungi (Erysiphales). Schlechtendalia 17: 39-54.

Bélanger RR, Bushnell WR, Dik AJ, Carver TLW. 2002. The powdery mildews. The American

Phytopathological Society, St. Paul.

Blumer S. 1928. Uber den Mehltau der Hortensie. Zeitschrift fiir Pflanzenkrankheiten 38: 78-83.

Blumer S. 1933. Die Erysiphaceen Mitteleuropas mit besonderer Beriicksichtigung der Schweiz.

Beitrage zur Kryptogamenflora der Schweiz 7(1): 1-483.

Blumer S. 1967. Echte Mehltaupilze (Erysiphaceae). G. Fischer, Jena.

Erysiphales on Hydrangeaceae & Papaveraceae ... 301

Bolay A, Braun U, Delhay R, Kummer V, Piatek M, Wotczariska A. 2005. Erysiphe deutziae — anew

epidemic spread in Europe. Cryptogamie, Mycologie 26(4): 293-298.

Braun U. 1987. A monograph of the Erysiphales (powdery mildews). Beihefte zur Nova Hedwigia

89: 1-700.

Braun U. 1995. The powdery mildews (Erysiphales) of Europe. G. Fischer, Jena, Stuttgart, New

York.

Braun U. 1999. Some critical notes on the classification and the generic concept of the Erysiphaceae.

Schlechtendalia 3: 48-54.

Braun U, Takamatsu S. 2000. Phylogeny of Erysiphe, Microsphaera, Uncinula (Erysipheae) and

Cystotheca, Podosphaera, Sphaerotheca (Cystotheceae) inferred from rDNA ITS sequences

— some taxonomic consequences. Schlechtendalia 4: 1-33.

Ciferri R, Camera C. 1962. Tentativo di elencazione dei funghi italiani. I. Erisifali. Istituto Botanico

Della Universita Laboratorio Crittogamico Pavia, Quaderno 21: 1-46.

Cunningham JL. 1972. A miracle mounting fluid for permanent whole-mounts of microfungi.

Mycologia 64: 906-911. doi:10.2307/3757946

Fakirova VI. 1991. Fungi Bulgaricae, I Tomus, Ordo Erysiphales. Publishing House of Bulgarian

Academy of Sciences, Sophia.

Jage H, Klenke K Kummer V. 2010. Neufunde und bemerkenswerte Bestatigungen von

phytoparasitischen Kleinpilzen in Deutschland - Erysiphales (Echte Mehltaupilze).

Schlechtendalia 21: 1-140.

Jankovics T. 2007. First report of powdery mildew (Oidium sp.) on greater celandine (Chelidonium

majus). Plant Pathology 56: 353. doi:10.1111/j.1365-3059.2007.01533.x

Schmidt A, Scholler M. 2002. Studies in Erysiphales anamorphs (II): Colutea arborescens, a new

host for Erysiphe palczewskii. Feddes Repertorium 113: 107-111.

Shin H-D. 2000. Erysiphaceae of Korea. Plant Pathogens of Korea 1. National Institute of Agricultural

Science and Technology, Suwon.

Tutin TG, Heywood VH, Burges NA, Valentine DH, Walters SM, Webb DA. 1964-80. Flora

Europaea, 2nd ed. Volumes 1-5. Cambridge University Press, Cambridge.

MYCOTAXON

Volume 115, pp. 303-310 January-March 2011

DOT: 10.5248/115.303

Paecilomyces wawuensis, anew species

isolated from soil in China

Jin HE?, JICHUAN KANG'?", BANGXING LEI & TINGCHI WEN?

? Engineering and Research Center for Southwest Bio-Pharmaceutical Resources

of National Education Ministry of China &

? Key Laboratory of Agricultural Bioengineering at Guizhou

2 Guizhou University, Huaxi, Guiyang 550025, Guizhou Province, PR China

* CORRESPONDENCE TO: bcec.jckang@gzu.edu.cn

ABSTRACT — A new species, Paecilomyces wawuensis, isolated from soil samples of the

Wawu Mountain, Sichuan Province, China, is described and illustrated. It is characterized by

phylogenetic analysis of ITS rDNA and -tubulin gene sequences, white obverse and sandy

beige reverse colonies that grow slowly on Czapek agar, cylindrical phialides with long, thin

necks, and ellipsoidal-ovate, spinulose conidia.

Key worps — taxonomy, fungi, hyphomycete

Introduction

The hyphomycete genus Paecilomyces was introduced by Bainier (1907) to

accommodate Paecilomyces variotii Bainier, a species growing in the air, soil,

and compost and on wood. It was characterized by verticillate conidiophores

with divergent whorls of phialides, which have a cylindrical or inflated base

tapering into a long and distinct neck. The conidia are typically hyaline,

one-celled, smooth-walled, and produced in basipetal chains. The genus was

revised by Brown & Smith (1957) and further modified by Samson (1974), who

accepted 31 species. Some species of Paecilomyces were later found to represent

anamorphs of Byssochlamys Westling, Talaromyces C.R. Benj., Thermoascus

Miehe, Cordyceps Fr., and Torrubiella Boud. (Stolk & Samson 1972, Samson

1974).

In Paecilomyces, most species can be separated from each other with colonies,

conidiogenous cells, conidia, and phialides. Han (2007) accepted only 64 of

the 125 published Paecilomyces species. According to Index Fungorum (www.

indexfungorum.org), over 140 epithets were assigned to Paecilomyces; many of

them, however, are known to be taxonomic synonyms or dubious taxa.

304 ... He & al.

A total of 39 species in Paecilomyces have been reported in China, including

18 entomogenous species and 21 species from soil (Liang et al. 2005a,b, 2006;

Han et al. 2005a,b,c; Li et al. 2006).

Based on the records of Paecilomyces and the distinctive molecular and

morphological characteristics, the fungus isolated from soil samples of the

Wawu Mountain, Sichuan Province, China, is described as a new species of

Paecilomyces.

Materials & methods

Collection and strain isolation

Strain GZU-BCECWS15 was isolated from a soil sample collected from the Wawu

Mountain, Sichuan Province, China, in July, 2008. Two grams of soil were added to a

flask containing 20 ml sterilized water and glass beads. The soil suspension was diluted

to a concentration of 10-'-10° after shaking for about 10 min. A 1 ml soil suspension

(concentration 10°) was mixed with Martin medium in sterilized 9 cm diam Petri dish

and incubated at 25°C for 5 days. The strain was purified by transplanting to Martin’s

slants.

Morphological identification of strain

The strain studied was transplanted onto Czapek agar, potato dextrose agar (PDA),

and Sabouraud agar. After incubating at 25°C for 14 days, morphological identification

of the strain was carried out based on colony characters, conidiogenous structure and

other biological features (Brown & Smith 1957, Samson 1974).

The generic names Paecilomyces and Penicillium are abbreviated as “P.” and “Pen.”

respectively. The holotype GZU-BCECWS15 of PR wawuensis was deposited in the

Engineering and Research Center for Southwest Bio-Pharmaceutical Resources of

National Education Ministry of China, Guizhou University, PR China.

TaBLE 1. ITS rDNA sequences from GenBank used in the phylogenetic analysis

NAME GENBANK No. NaME GENBANK No.

P antarcticus AJ879113 P. gunnii AJ309339

P carneus AY624171 P. marquandii AY624193

P carneus AB103179 P. niphetodes AY624192

P carneus DQ888728 P. penicillatus AY624194

P carneus DQ914684 P viridis AY624197

P. gunnii AJ309343 P. wawuensis GU453921

P. gunnii GY453920 Pen. expansum AF404655

TABLE 2. B-tubulin gene sequences from GenBank used in the phylogenetic analysis

NAME GENBANK No. NAME GENBANK No.

P. carneus AY624209 P. viridis AY624235

P carneus AY624210 P. wawuensis HM480496

P. gunnii HM480497 Pen. expansum AF003248

Paecilomyces wawuensis sp. nov. (China) ... 305

DNA sequencing & phylogenetic analysis

Genomic DNA was extracted from fungal mycelia directly collected from the plates

following the CTAB isolation protocol of Oscar et al. (1999). Template DNA (30-40

ng) was amplified in a 50 ul PCR reaction mixture consisting of 10 mM KCl, 10 mM

(NH,),SO, 20 mM Tris-HCl (pH 8.8), 6 mM MgCl, and 500 uM each of dATP,

dCTP, dGTP, and dTTP, with 60 pmols ITS4 & ITS5 primers (White et al. 1990) for

ITS rDNA or T1&T22 primers (O'Donnell & Cigelnik 1997) for B-tubulin gene, and 2

units TaqDNA polymerase (TianGen, China). The reaction was set up as follows: initial

denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C for 1 min,

annealing at 51°C for 1 min, extension at 72°C for 1 min and final extension at 72°C for

10 min in Gene Amp PCR system 9700 (Gene Amp, U S). The temperature of annealing

for B-tubulin gene (TUB2) was 54°C.

The PCR products were purified by using a UNIQ-10 PCR Purification Kit (Sangon

Biotech, China). The purified PCR products were sequenced using the ABI Prism 377

DNA Sequencer (Perkin-Elmer, Norwalk, Connecticut) with ITS4 or ITS5 and T1 or

T22. The DNA sequences of ITS rDNA and B-tubulin gene of the fungus have been

submitted to GenBank.

Nucleotide sequences of ITS rDNA and f-tubulin gene of the isolate GZU-

BCECWS15 and their allies as well as the outgroups retrieved from GenBank were

assembled using Tex-Edit Plus (Bender, TomBB@aol.com) respectively. The alignment

of the sequence files was conducted using the CLUSTAL W software (Thompson et

al. 1994). Phylogenetic analyses were performed with PAUP version 4.0b10 (Swofford

2004). The most parsimonious trees (MPT) were determined from the data sets using

the heuristic search options with 1000 random sequence input orders with MULPARS

on and TBR branch swapping for the exact solution. The unconstrained topologies of the

equally parsimonious trees were compared using the Kishino- Hasegawa test of PAUP.

The best topology was selected as the most parsimonious tree topology. Parsimony

bootstrap with 1000 replicates in PAUP was applied to the tree to evaluate the stability.

Other measures including tree length, consistency, retention, rescaled consistency and

homoplasy indexes (TL, CI, RI, RC and HI) were also calculated.

Taxonomy

Paecilomyces wawuensis Jin He, J.C. Kang & B.X. Lei, sp. nov. FIG. 1

MycoBank MB 518791

On agaro Czapekii, coloniae 25-26 mm diam in 14 diebus ad 25°C, albae, floccosae,

margine regularis, reversum vinacea. Hyphae hyalinae, septatis, levibus, 1.3-1.5 um crassis.

Conidiophora breva, simplicia, 16-40 x 1.3-2.0 um, phialides singulare vel phialidibus

2 ad 4 terminatis, Phialides12-42 x 1.8-4.0 um, cylindricae, e basi inflata, angustatae

collolongo minus quam 0.4 um. Conidia monocellula, hyalina, verrucosa, ellipsoidea ad

ovata vel subglobosa, 4.3-6.9 x 3.3-5.3 um, facientia divergentes, catenas exsiccates.

Typus: GZU-BCECWS15 et cultara , isolatus ab soli in solo Wawu, Provinice Sichuan,

VII.2008, T.C. Wen; in Guizhou Univ., conservatur.

COLONIES ON CZAPEK AGAR growing slowly, attaining a diameter of 25-26

mm 14 days at 25°C; white, ridged, dense floccose, thick, with orderly margins,

with some irregular radiating furrow and more or less hyaline exudates; reverse

306 ... He & al.

Fic. 1. Photographs of colony and conidiogenous structure of Paecilomyces wawuensis under

scanning electron microscope. A. Colony on Czapek agar after 14 days at 25°C. B. Conidiogenous

structure. C. Ellipsoidal conidia in chains. D. Phialides of the conidiogenous structure.

E. Echinula of a conidium. Scale bars: A =10 mm, B = 5 um, C-D = 2 um, E = 0.5 um.

sandy beige, appearing soluble wine red pigment. Vegetative hyphae septate,

hyaline, smooth-walled, 1.3-1.5 um wide. Conidiophores mononematous erect

or absent, hyaline, smooth-walled, uneven length, 16-40 x 1.3-2.0 um, with

single phialide or whorls of 2 to 4 phialides, or phialides growing from hyphae

directly. Phialides 12-42 x 1.8-4.0 um, consisting of a cylindrical, somewhat

inflated base, tapering into a long and thin neck, somewhat incurved, 6.0-6.7

uum long and less than 0.6 um wide. Conidia one-celled, hyaline, roughened-

walled with spinulose, most ellipsoidal or ovate to subglobose, 4.3-6.9 x

3,3-5.3 wm, forming divergent, dry and basipetal chains. Chlamydospores

present, produced singly or in short chains, thick-walled, roughened, globose

to subglobose, 7.5-8.5 um in diameter.

COLONIES ON PDA at 25°C within 14 days, usually growing more rapidly

than on Czapek agar, 27mm, consisting of a pink mycelium, with some irregular

radiating furrow and more or less hyaline exudates. Reverse saddle brown, with

distinct radiating furrow and present wine red pigment diffusion.

COLONIES ON SABOURAUD AGAR 25 mm at 25°C within 14 days, consisting

of white mycelium, with some irregular radiating furrow. Reverse light brown,

with distinct radiating furrow.

Paecilomyces wawuensis sp. nov. (China) ... 307

P. carneus

GZU -BCECWSI15

P. gunnii

P. marquandii

P. viridis

P. penicillatus

P. niphetodes

P. antarcticus

en, expansum

Fic. 2. The gene tree was constructed using the MP method and based on phylogenetic analysis of

the nucleotide sequences of ITS1-5.8S-ITS2 rDNA. It shows the relationships between GZU-

BCECWS15 and other Paecilomyces species. Bootstraps values (1,000 replicates) are indicated

at the nodes (TL = 577, CI = 0.825, HI = 0.175, RI = 0.710, RC = 0.586).

97 P. carneus

94 P. carneus

100 P. gunnii

GZU -BCECWS15

P. viridis

Pen. expansum

Fic. 3. The gene tree was constructed using the MP method and based on phylogenetic analysis of

the B-tubulin gene sequences. It shows the relationships between GZU-BCECWS15 and other

Paecilomyces species. Bootstraps values (1,000 replicates) are indicated at the nodes (TL = 174,

CI = 0.937, HI = 0.063, RI = 0.645, RC = 0.604).

Phylogenetic analyses

The ITS1-5.8S-ITS2 rDNA of the 2 wawuensis has been sequenced

and compared with that of P carneus (CBS 239.32, GenBank Accession

No.: AY624171) and PB gunnii (GenBank Accession No.: AJ3093390) in an

alignment. In comparison with PB carneus, P wawuensis exhibited 31 transitions/

transversions and 36 deletion and 6 insertion substitutions. Meanwhile

there were 60 positional transitions/transversions and 57 insertion/deletion

substitutions in ITS1-5.8S-ITS2 rDNA between P. gunnii and P. wawuensis.

308 ... He & al.

At the same time, the alignment of B-tubulin gene sequences from

P. gunnii, PB. carneus, and P. wawuensis showed that P. wawuensis had 1 insertion

substitution, 6 deletion substitutions and 12 transitions/transversions both to

P. gunnii and P. carneus.

Both the most parsimonious trees (MPT) inferred from the ITS rDNA

(Fic. 2) and the B-tubulin gene sequences data (Fic. 3) showed that the strain

GZU-BCECWS15 stands parallel to the others, although it is clustered with

P. gunnii and P. carneus in a subclade.

Discussion

In the genus Paecilomyces, rare species have been found to have echinulate

conidia. The previously accepted species with echinulate conidia were

P. carneus Brown & Smith (Samson 1974), P. gunnii Z.Q. Liang (Liang 1985),

and P curticatenatus Z.Q. Liang & Y.F. Han (Han et al. 2007). Liang et al. (2009)

recombined P curticatenatus in a new genus, Taifanglania, characterised by

solitary phialides; this character separates P. curticatenatus from P. wawuensis.

The new species P wawuensis can be separated from P carneus and P. gunnii by

the sandy beige reverse of the colony on Czapek agar and the large ellipsoidal-

ovate conidia (TABLE 3). Paecilomyces wawuensis can be distinguished from

the other species in having a white/ sandy beige colony on Czapek agar and

echinulate conidia.

TABLE 3. A comparison between Paecilomyces wawuensis and its related species

CoLony PHIALIDES CONIDIA CHLAMYDO-

SPECIES [a

OBVERSE REVERSE SEORES

P. carneus white olive cylindrical subglobose to ellipsoidal absent

drab 3-4 x 2-2.5 um

P. gunnii grey brown cylindrical subellipsoidal or subovate present

1.6-4.8 x 1.2-3.5 um

P wawuensis white sandy cylindrical/ ellipsoidal or ovate to subglobose _ present

beige ampulliform 4.3-6.9 x 3.3-5.3 um

Meanwhile the dominant substitutions and transitions/transversions in the

alignments of ITS1-5.8S-ITS2rDNA and B-tubulin gene sequences of P. carneus,

P. gunnii, and PB wawuensis differentiate the new species from the others.

In conclusion, Paecilomyces wawuensis can be distinguished from the other

species in the genus by the following morphological characters: 1) colonies on

Czapek agar grow slowly and the obverse is white while the reverse is sandy

beige; 2) phialides consist of a cylindrical, sometimes inflated base, tapering

into a long, thin, and sometimes incurved neck; and 3) conidia are ellipsoidal

or ovate to subglobose, large and roughened-walled with spinules.

Both phylogenetic trees (Fics. 2, 3) based on ITS rDNA and 6-tubulin gene

sequences show that the strain GZU-BCECWS15 stands parallel to P. carneus

Paecilomyces wawuensis sp. nov. (China) ... 309

and P gunnii in a sub-clade, although all of them possess roughened-walled

conidia with spinules. Both molecular and morphological evidence supports

P. wawuensis (GZU-BCECWS15) as a new species.

Acknowledgements

This work was supported by the grant of National Natural Science Foundation of

China (No. 30660002). We are grateful to Prof. Wen-Ying Zhuang and Prof. Zhu-Liang

Yang for their comments on the manuscript. At the same time, we sincerely appreciate

editorial review and revisions.

Literature cited

Brown AHS, Smith G. 1957. The genus Paecilomyces Bainier and its perfect stage Byssochlamys

Westling. Trans. Brit. Mycol. Sac. 40(1): 17-89. doi:10.1016/S0007-1536(57)80066-7

Bainier G.1907. Mycothéque de lécole de Pharmacie. XI. Paecilomyces, genre nouveau de

Mucedinees. Bull. Trimest. Soc. Mycol. Fr. 23: 26-27

Han YF, Chu HL, Liang ZQ. 2005a. Two new species of the genus Paecilomyces in China. Mycotaxon

92: 311-316.

Han YF, Liang ZQ, Chu HL, Kang JC. 2005b. Paecilomyces parvisporus, a new species and its allies

from Yunnan, China. Mycotaxon 94: 357-363.

Han YF, Liang ZQ, Chu HL. 2005c. Studies on the genus Paecilomyces in China II. Paecilomyces spp.

from Guizhou. Mycotaxon 91: 361-364.

Han YF, Liang ZQ, Chu HL. 2007. A new thermophilic species of Paecilomyces, Paecilomyces

Curticatenatus. Mycosystema 26(1): 13-16.

Li Z, Han YE, Liang ZQ. 2006. A new species Paecilomyces verticillatus sp. nov. from soil in China.

Mycotaxon 95: 133-136.

Liang ZQ. 1985. Isolation and identification of the conidial stage of Cordyceps gunnii. Mycosystema

(3): 162-166.

Liang ZQ, Han YF, Chu HL, Liu AY. 2005a. Studies on the genus Paecilomyces in China I. Fungal

Diversity 20: 83-101.

Liang ZQ, Han YF, Liu AY, Huang JZ. 2005b. Some entomogenous fungi from Wuyishan and

Zhangjiajie nature reserves II. Three new species of the genus Hirsutella. Mycotaxon 94:

349-355,

Liang ZQ, Han YF, Chu HL. 2006. Studies on the genus Paecilomyces in China IV. Two new species

of Paecilomyces with monophialides. Mycotaxon 97: 13-20.

Liang ZQ, Han YE, Chu HL, Fox RTV. 2009. Studies on the genus Paecilomyces in China V.

Taifanglania gen. nov. for some monophialidic species. Fungal Diversity 34: 69-77.

O’DonnellK, Cigelnik E. 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic

lineage of the fungus Fusarium are nonorthologous. Mol. Phylogenet. Evol. 7: 103-116.

Oscar FC, Ana C, Jamshid £1999. DNA extraction and PCR amplification method suitable for

fresh, herbarium-stored, lichenized, and other fungi. Plant Systematics and Evolution 216:

243-249. doi: 10.1007/BF01084401

Samson RA. 1974. Paecilomyces and some allied hyphomycetes. Stud. Mycol. 6: 1-119.

Stolk AC, Samson RA. 1972. Studies on Talaromyces and related genera II. The genus Talaromyces.

Stud. Mycol. 2: 1-65.

Swofford DL. 2004. PAUP*: Phylogenetic analysis using parsimony (*and other methods). Version

4.0 Sinauer Associates, Sunderland, MA.

310 ... He & al.

Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive

multiple sequence alignment through sequence weighting, positions-specific gap penalties and

weight matrix choice. Nucleic Acids Research 22:4673-4680. doi:10.1093/nar/22.22.4673

WhiteTJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal

RNA genes for phylogenetics. 315-322, in: PCR Protocols: A Guide to Methods and

Applications. Academic Press, New York.

MYCOTAXON

Volume 115, pp. 311-322 January-March 2011

DOT: 10.5248/115.311

Mycosphaerella nyssicola revisited:

a species distinct from M. punctiformis

ANDREW M. Minnis", Amy Y. RossMAN! & RICHARD T. OLSEN?

‘Systematic Mycology & Microbiology Laboratory, USDA-ARS &

Floral and Nursery Plants Research Unit, US National Arboretum, USDA-ARS:

Rm. 128, BOIOA, 10300 Baltimore Avenue, Beltsville, MD 20705, USA

* CORRESPONDENCE TO: Drew. Minnis@ars.usda.gov

ABsTRACT —Nyssa trees involved in a breeding program for ornamentals were found

to be affected deleteriously by a leaf spot disease. The causative agent was identified as a

species of Mycosphaerella that had been classified as morphologically indistinguishable from

M. punctiformis. A subsequent taxonomic investigation using morphological data from new

and existing herbarium collections, cultural data, and ITS region rDNA sequences suggested

that this was a distinct species on Nyssa that represents the previously described M. nyssicola.

The species is lectotypified and epitypified to promote nomenclatural and taxonomic

stability.

Key worps — Ascomycota, Asteromella nyssae, Dothideomycetes, lectotype, Phyllosticta

nyssae

Introduction

Nyssa (Cornaceae) is a small genus of trees disjunct between eastern Asia

and eastern North America and Central America (Wen & Stuessy 1993), Four

North American species (N. aquatica L., N. biflora Walter, N. ogeche W. Bartram

ex Marshall, and N. sylvatica Marshall), collectively known as gums or tupelos,

are found in swamps and alluvial soils as well as uplands. The black gum,

N. sylvatica, is the most commonly cultivated species for ornamental and urban

tree use due to its beautiful red fall color. The USDA-ARS National Arboretum

began a Nyssa breeding program in the early 1990’s directed at improving

urban adaptability and transplantability for the nursery industry. Increased use

of Nyssa has been tempered by a disfiguring leaf spot disease that results in

reduced aesthetic appeal and premature defoliation (Dirr 1998). In 2006, the

Arboretum refocused the Nyssa program towards developing resistance to this

organism.

312 ... Minnis, Rossman & Olsen

Recent attempts at identifying the causal organism failed or resulted in

isolation of secondary pathogens (Dirr 1998, Charles Hodges pers. comm.).

It was assumed to be a widely distributed species of Mycosphaerella Johanson

(Dothideomycetes, Ascomycota) that has been classified as morphologically

indistinguishable from and probably conspecific with M. punctiformis (Pers.)

Starback, the type species of the genus (Aptroot 2006). The genus Mycosphaerella

includes a vast diversity of species on multitudinous hosts, and it is successful

in several ecological roles, including most importantly as a plant pathogen

(Verkley et al. 2004, Crous 2009). Species of Mycosphaerella are in general

host specific, but several species have broader host ranges (Crous 2009). A

recent paper serving to stabilize the taxonomic application of M. punctiformis

suggested that this species, in a strict sense, was specific to Quercus (Verkley et

al. 2004).

Knowledge of the identity and host range of the leaf spot fungus from Nyssa

is important in the development of disease control strategies and resistant

cultivars. New isolates were obtained from Nyssa in field plots of the USDA

breeding program and DNA sequence data of the ITS region were generated for

comparison with other Mycosphaerella species. New specimens were compared

with herbarium collections including type specimens, which are designated

herein to promote nomenclatural and taxonomic stability.

Materials & methods

Isolation from fruiting bodies

Overwintered, dead, and fallen leaves were collected in spring. Cultures on cornmeal

dextrose agar (CMD) were obtained variously by growth at room temperature from

ascospores ejected from bits of leaves containing pseudothecia glued to the top lid of

Petri dishes that were incubated with either the top lid oriented upwards or downwards

or ascospores, usually with associated asci, from crushed pseudothecia isolated with a

pipette. Cultures were deposited in the Centraalbureau voor Schimmelcultures (CBS).

Morphological examination

Microscopic observations and measurements of sections and crush mounts of fresh

material were made in water. For viewing of dried material, material was wetted with

95% ethanol and subsequently rehydrated and viewed in 3% KOH. Phloxine solution

(Largent et al. 1977) was also used to aid in microscopic examination. In the descriptions,

an ™ indicates average or mean and Q is the length to width ratio. For phenotypic

observations, cultures were grown on potato dextrose agar (PDA). See Farr & Rossman

(2010) for complete collection data of examined historical herbarium collections. New

collections were deposited in the US National Fungus Collections (BPI).

Fic. 1. Strict consensus of the 600 equally most parsimonious trees resulting from the phylogenetic

analysis. Percent bootstrap support values from the 1000 replicates are indicated above branches.

GenBank accession numbers are shown to the right of the names.

Mycosphaerella nyssicola is not M. punctiformis ... 313

Ramularia clade

100

0.9

100

‘M. fragariae AY 152597

‘M. fragariae AF297325

‘M. fragariae AY152596

‘M. fragariae AY152595

‘M. fragariae AF173312

R. collo-cygni AF173310

R. sp. AJ417496

‘M. rubella AY490767

M. punctiformis AY490759 ex Acer

-M. punctiformis AY490760 ex Tilia

M. punctiformis AY152593 ex Acer

-M. punctiformis AY 152594 ex Quercus

‘M. phacae-frigidae AY490758

‘M. punctiformis AY490762

‘M. punctiformis AY490764

‘M. punctiformis AY490766

‘M. punctiformis AY490765 sensu stricto

-M. punctiformis AY490761

‘M. punctiformis AF222848

‘M. punctiformis AY490763 ex-epitype

-M. nyssicola HQ162263

‘M. nyssicola HQ162266 ex-epitype

‘M. nyssicola HQ162265

‘M. nyssicola HQ162264

‘M. graminicola AY 152602

‘M. graminicola AY 152603

‘M. graminicola AF181692

‘M. graminicola AF 181693

‘Septoria passerinii AF181697

ladosporium bruhnei AY251078 ] Outgroup

sensu lato

314 ... Minnis, Rossman & Olsen

DNA isolation, amplification, sequencing

DNA was isolated from cultures on CMD and the ITS region rDNA was amplified and

sequenced following the methods of Bao et al. (2010). Sequences were also assembled

and edited from chromatographs according to Bao et al. (2010).

Phylogenetic analyses

An initial BLAST search on GenBank indicated that the Nyssa isolates were closely

related to M. punctiformis with 96% maximum identity. The ITS region sequence data

from these isolates were subsequently aligned with that of the taxa included in a prior

taxonomic study of M. punctiformis (Verkley et al. 2004) using Clustal X version 2.0.10

(Larkin et al. 2007). A preliminary analysis employed PAUP* 4.0b10 (Swofford 2002)

using the same settings as Verkley et al. (2004). A reduced dataset was constructed

using the Nyssa isolates and selected members of the Ramularia clade and closely related

species from the Verkley et al. (2004) study with Cladosporium bruhnei Linder as the

outgroup [= “Davidiella tassiana” (De Not.) Crous & U. Braun of Verkley et al. 2004]

and aligned with Clustal X using the default settings (Larkin et al. 2007) with the ingroup

aligned in the first step and the outgroup added in a subsequent second step alignment.

The resulting alignment was visually inspected and the unaligned ends were omitted

from later analyses. GenBank accession numbers of included sequences are indicated in

Fic. 1. A maximum parsimony analysis was performed using the default parameters of

the heuristic search of PAUP* 4.0b10 (Swofford 2002) that included characters 50-560 of

the dataset. A parsimony bootstrap analysis was performed using the default settings of

PAUP* 4.0b10 (Swofford 2002) with 1000 replicates and maxtrees set at 1000.

Results

The preliminary analysis showed the Nyssa isolates were part of the Ramularia

clade (Verkley et al. 2004, Crous et al. 2009), also known as Mycosphaerella

sensu stricto (Crous et al. 2009). Analyses of the reduced ITS region dataset

contained thirty taxa with Cladosporium bruhnei as outgroup and included 501

characters, of which 83 were parsimony informative. The heuristic search of

the maximum parsimony analysis produced 600 equally most parsimonious

trees of length 225. The consistency (CI), homoplasy (HI), retention (RI),

and rescaled consistency (RC) indices were 0.831, 0.169, 0.912, and 0.758,

respectively. A strict consensus tree is presented in Fic. 1. The Ramularia clade

(Mycosphaerella sensu stricto) was recovered with 99% bootstrap support

(BS). The isolates from Nyssa formed a well-supported clade (99% BS).

A larger clade, one lacking significant statistical support but composed of

several moderately supported subclades, was sister to the Nyssa isolate clade.

One of these subclades is M. punctiformis sensu stricto with 65% BS, which

is distinct from the isolates from Nyssa that are determined to represent

M. nyssicola. Isolates of M. punctiformis sensu lato and M. phacae-frigidae

grouped in a clade (75% BS) with M. phacae-frigidae sister to a strongly

supported (100% BS) M. punctiformis sensu lato clade.

Mycosphaerella nyssicola is not M. punctiformis ... 315

Taxonomy

Mycosphaerella nyssicola (Cooke) B.A. Wolf, Mycologia 32: 333. 1940,

as ‘nyssaecola’ Fics. 2-5

= Sphaerella nyssicola Cooke, Hedwigia 17: 40. 1878, as ‘nyssoecola’.

Lectotypus of Sphaerella nyssicola (hic designatus): USA. Florida: Gainesville, on leaves

of Nyssa, leg. Ravenel, Func AMERICANI ExsiccarI no. 96 (BPI 608979). Note: BPI has

more than one of these exsiccatae. This one is mounted on a separate sheet and given a

specific BPI number.

Epitypus of Sphaerella nyssicola (hic designatus): USA. Maryland: Prince George's

Co., Glenn Dale, U.S. Plant Introduction Station, 11601 Old Pond Dr. (38°58'00.49"N

76°48’ 12.78” W), on overwintered, dead, and fallen leaves of Nyssa spp., V.2009, leg. RT

Olsen (BPI 880897, AR 4656 ex-epitype culture deposited at CBS 127665, ITS GenBank

Accession No. HQ162266).

PsEUDOTHECIA developing overwinter on fallen dead leaves; chiefly

hypophyllous; scattered to gregarious, sometimes touching but not confluent;

erumpent; semi-immersed; globose; black; 65-125 um diam. (74-97 um diam.

in lectotype); ostiole apical, 10-23 umdiam. PsEUDOTHECIAL WALL with

2-3 layers of brown textura angularis. PARAPHYsEs absent. Ascr bitunicate,

34-48 x 6.5-8 um, fasciculate, cylindrical, straight to slightly curved, with a

short pedicel, octosporous. AscosporEs 6.4-8.3 x 1.9-3.2 um, Q = 2-3.3 um

("= 7.1 x 2.6 um, Q™ = 2.7 um), fusoid-ellipsoid, tapering towards ends,

tapering more prominently towards lower end, ends obtuse, widest above

septum, with 1 septum, median or slightly supramedian, slightly constricted at

septum, thin-walled, hyaline, uniseriate to biseriate, sometimes oblique within

and among asci. Germination not observed.

In CULTURE: CoLony after 31 days on PDA at approx. 22°C and exposed to

ambient lighting, up to 29 mm diam., low without abundant aerial mycelium,

raised in a mound at center, texture somewhat slimy but not yeast-like, pinkish,

or with a pinkish base covered by a whitish tomentum, paler at margin, reverse

pinkish to rosette, not sporulating, older cultures sometimes developing

fruiting structures more or less globose, black, presumably immature, with

walls textura angularis. MycELIuM with hyphae branching, septate, hyaline or

faintly pigmented at times when viewed in mass, walls smooth, width 1.9-3.2

yum.

SPECIMENS EXAMINED: USA. FLoripa: (BPI 608979, designated lectotype); idem (3

additional exsiccatae duplicates of lectotype without BPI numbers); GEorGIA: Richmond

Co. AuGusTA, PHINIZY SWAMP NATURE Park, on overwintered, dead and fallen leaves

of Nyssa aquatica, 19.1I1.2010, leg. J.E. Gordon (BPI 880908, asci and ascospores not

observed); MARYLAND: Prince George’s Co. GLENN DaLe, U.S. PLANT INTRODUCTION

STATION, 11601 OLD PonD DR., 38°58'00.49”N 76°48 12.78 W, on overwintered, dead

and fallen leaves of Nyssa spp., V.2009, leg. RT Olsen (BPI 880897, designated epitype,

ex-epitype culture deposited at CBS 127665 = AR 4656, ITS GenBank Accession No.

316 ... Minnis, Rossman & Olsen

Fic. 2. Mycosphaerella nyssicola. Upper: leaf discoloration and defoliation at U.S. National

Arboretum research plots, Glenn Dale, MD. Lower: leaf spot symptoms on Nyssa ogeche in fall,

USNA, Washington, DC.

HQ162266; AR 4655 additional culture not preserved, ITS GenBank Accession No.

HQ162265); idem (BPI 880800, culture deposited at CBS 127664 = AR 4629, ITS

GenBank Accession No. HQ162264; AR 4626 additional culture not preserved, ITS

GenBank Accession No. HQ162263); NORTH CAROLINA: (BPI 608981, 876718); WEST

VIRGINIA: (BPI 601980, immature; BPI 608980, immature).

Mycosphaerella nyssicola is not M. punctiformis ... 317

Fic. 3. Mycosphaerella nyssicola. UPPER LEET: leaf spot symptoms on Nyssa sylvatica x N. ogeche

hybrid in USNA research plots, Beltsville, MD. UPPER RIGHT: leaf spot symptoms on N. ogeche

and N. sylvatica growing at USNA research plots, Washington, DC. Lower LEFT: leaf spot

symptoms on N. sinensis growing in the Asian collections at the USNA, Washington, DC.

LOWER RIGHT: overwintering Nyssa leaves at USNA research plot, Glenn Dale, MD.

ANAMORPH (SPERMATIAL STATE): Asteromella nyssae (Cooke) Aa, A revision

of the species described in Phyllosticta: 336. 2002.

= Phyllosticta nyssae Cooke, Grevillea 12: 26. 1883.

Lectotypus of Phyllosticta nyssae (hic designatus): USA. Georgia: Darien, on leaves of

Nyssa capitata, leg. Ravenel, FUNGI AMERICANI ExsiccatI no. 798 (BPI 353790). Note:

BPI has more than one of these exsiccatae. This one is mounted on a separate sheet and

given a specific BPI number.

LEAF spots epiphyllous, but discoloring beneath, irregular, frequently

coalescing, large, pallid with margin purplish or purplish. SPERMOGONIA chiefly

hypophyllous; frequently but not always associated with spots; scattered to

318 ... Minnis, Rossman & Olsen

Fic. 4. Mycosphaerella nyssicola. UPPER ROW: pseudothecia of BPI 608981. MIDDLE ROW AND

LOWER LEFT: asci and ascospores of BPI 608981. LowER RIGHT: ex-epitype culture on PDA

(CBS 127666). Scale bars = 10 um.

gregarious, sometimes touching but not confluent; erumpent; semi-immersed;

pseudopycnidial; globose; black; 61-103 wm diam. (65-103 um diam. in

lectotype); ostiole apical, 16-29 um diam. (16-23 tm diam. in lectotype);

unilocular. SPERMAGONIAL WALLS composed of an outer layer of brown textura

angularis and a hyaline inner layer that produces the spermatogenous cells.

SPERMATOGENOUS CELLS determinate; phialidic; hyaline; walls smooth; discrete

or more typically integrated on spermatiophores; spermatiophores up to three

Mycosphaerella nyssicola is not M. punctiformis ... 319

Fic. 5. Asteromella nyssae (spermatial state of Mycosphaerella nyssicola). UPPER ROW:

spermogonia of BPI 353792. Middle row: conidiogenous cells of BPI 353799. LowER

ROW: spermatia of BPI 353792. Scale bars = 10 um.

septate, occasionally branching at base; loci apical or on short side branches

formed one per cell immediately below septa of spermatiophores. SPERMATIA

3,2-5.8 x 0.6-1.6 um, Q = 2.4-5.3 um ("= 4.1 x 1.2 um, Q™ = 3.4 um)

(3.8-4.5 x 1-1.3 um in lectotype), at times copious and adhering in large

numbers, bacilliform, aseptate, walls smooth, hyaline, eguttulate.

SPECIMENS EXAMINED: USA. GEorGIA: (BPI 353789, duplicate of lectotype; BPI 353790,

designated lectotype); MICHIGAN: (BPI 353793); NorTH CAROLINA: (BPI 353792);

SouTH CAROLINA: (BPI 353796, 353797); TENNESSEE: (BPI 860755); VIRGINIA: (BPI

353788, 353791, 353795, 353799); WEST VIRGINIA: (BPI 353798, 521392, 521393).

320 ... Minnis, Rossman & Olsen

HABITAT & DISTRIBUTION — Based on Farr & Rossman (2010) and examined

specimens, Mycosphaerella nyssicola is known to occur on leaves of Nyssa

aquatica, N. biflora (= N. sylvatica var. biflora), N. ogeche, and N. sylvatica, and

it is widely distributed in the eastern USA (AL, FL, GA, MD, MI, NC, NY, PA,

SC, TN, VA, WV), especially in the southeastern states. Observations of disease

symptoms at the USDA field plot also confirmed as hosts: N. sinensis and two F1

hybrids, N. sylvatica x N. ogeche and N. sylvatica x N. sinensis. It is possible that

the distribution of M. nyssicola is greater than that reported in the literature,

and the fungus may occur throughout the range of Nyssa in the USA.

COMMENTS — Analyses of the DNA sequence data from the ITS region suggest

that isolates from Nyssa are distinct from isolates of M. punctiformis both sensu

stricto and sensu lato as presented by Verkley et al. (2004). Morphological

examination of new collections and historical herbarium collections indicates

that the Nyssa isolates are identical with Mycosphaerella nyssicola. Although M.

nyssicola is more or less indistinguishable from M. punctiformis, as was noted

by Aptroot (2006), DNA evidence and host specificity support M. nyssicola as

a distinct species on Nyssa.

With respect to types, Cooke (1878) described Sphaerella nyssicola as a

new species occurring on Nyssa, and the original material was distributed as

exsiccatae in Ravenel’s FUNGI AMERICANI Exsiccati. Confusingly, the labels

of the exsiccatae cited in the protologue by Cooke (1878) indicate specimens

from Florida on Nyssa, while the protologue lists South Carolina and Nyssa

multiflora (= N. sylvatica) for distribution and host. These exsiccatae are

syntypes (McNeill et al. 2006: Art. 9.4). Aptroot (2006), who listed a specimen

from South Carolina at K as holotype and exsiccata no. 96 at BPI from Florida

as isotype, did not use the phrase ‘hic designatus? which would have caused an

accidental lectotypification of the species (McNeill et al. 2006: Arts. 7.11, 9.8).

However, to assume that a collection housed in the original author’s herbarium

represents the holotype when no holotype has been designated is not the correct

course of action. Additional confusion results from whether original material

exists from Florida, from South Carolina, or from both regions. To resolve the

confusion, we designate one syntype as lectotype (McNeill et al. 2006: Art. 9.2).

‘The original material (as noted by Cooke, 1878) is immature. Despite repeated

attempts, we were unable to find asci or ascospores in any of the four exsiccatae

(including the designated lectotype) housed at BPI.

Similarly, Cooke (1883) described Phyllosticta nyssae as a new species

on Nyssa capitata (= N. ogeche), and the original material was distributed as

exsiccatae in Ravenel’s FUNGI AMERICANI EXSICCATI. Seaver (1922), Wolf

(1940), and Aa & Vanev (2002), all of whom provided morphological data on

this species and cited the exsiccatae, did not designate a type. Hence, we here

also designate one syntype as lectotype.

Mycosphaerella nyssicola is not M. punctiformis ... 32.1

Lastly, because the type material is immature, we epitypify S. nyssicola based

on a recent collection of Mycosphaerella nyssicola from Maryland. The living

culture and DNA data obtained from the epitype aid in the application of the

name (McNeill et al. 2006: Art. 9.7), although we are somewhat reluctant to

epitypify the name based on a specimen that was not collected in the type

locality (.e., either Florida or South Carolina). The epitype is otherwise

identical in all regards to material observed by Wolf (1940) and so maintains

current usage of the name.

Wolf (1940) provided an excellent symptomatological account of this leaf

spot disease and the life history of M. nyssicola. We have nothing to add except

that Koch's postulates have not yet been completed, linkage of the teleomorphic

and spermatial states is circumstantial, and no attempts have been made to

germinate spermatia that would confirm they are not conidial in nature. We

also have not studied fresh material of the spermatial state. As with Wolf (1940),

we found no Ramularia or other conidial state for this fungus. Mycosphaerella

nyssicola is typical of members of the Ramularia clade (also known as section

Mycosphaerella or Mycosphaerella sensu stricto) and it is quite similar to M.

punctiformis (Verkley et al. 2004, Crous 2009, Crous et al. 2009). At this time,

we do not propose anew combination in Ramularia based on the teleomorphic

state as advocated by Crous et al. (2009) for species of Mycosphaerella sensu

stricto, as the latter generic name correctly adheres to ICBN Art. 59.1 (McNeill

et al. 2006).

Acknowledgments

We thank Tunesha Phipps and Sasha Allen of the Systematic Mycology and

Microbiology Laboratory for assistance with DNA sequencing. Judith Gordon of

Augusta State University is warmly acknowledged for sending fungal material. We

extend our gratitude to Uwe Braun of Martin-Luther-Universitat and Charles Hodges of

North Carolina State University for their expert reviews of this manuscript.

Literature cited

Aa HA van der, Vanev S. 2002. A revision of the species described in Phyllosticta. Centraalbureau

voor Schimmelcultures, Utrecht, The Netherlands.

Aptroot A. 2006. Mycosphaerella and its anamorphs: 2. Conspectus of Mycosphaerella. CBS

Biodiversity Ser. 5: 1-231.

Bao X, Carris LM, Huang G, Luo J, Liu Y, Castlebury LA. 2010. Tilletia puccinelliae, a new species

of reticulate-spored bunt fungus infecting Puccinellia distans. Mycologia 102: 613-623.

doi: 10.3852/09-135

Cooke MC. 1878. North American fungi. Hedwigia 17: 37-40.

Cooke MC. 1883. New American fungi. Grevillea 12: 22-33.

Crous PW. 2009. Taxonomy and phylogeny of the genus Mycosphaerella and its anamorphs. Fungal

Diversity 38: 1-24.

Crous PW, Summerell BA, Carnegie AJ, Wingfield MJ, Hunter GC, Burgess TI, Andjic V, Barber

PA, Groenewald JZ. 2009. Unraveling Mycosphaerella: do you believe in genera? Persoonia: 23:

99-118. doi:10.3767/003158509X479487

322 ... Minnis, Rossman & Olsen

Dirr MA. 1998. Manual of Woody Landscape Plants: Their Identification, Ornamental

Characteristics, Culture, Propagation, and Uses. Stipes, Champaign, IL.

Farr DE, Rossman AY. 2010. Fungal databases, Systematic Mycology and Microbiology Laboratory,

ARS, USDA. Retrieved June 14, 2010, from http://nt.ars-grin.gov/fungaldatabases/.

Largent D, Johnson D, Watling R. 1977. How to identify mushrooms to genus III: Microscopic

Features. Mad River Press, Eureka, CA.

Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F,

Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and

Clustal X version 2.0. Bioinformatics 23: 2947-2948. doi:10.1093/bioinformatics/btm404

McNeill J, Barrie FR, Burdet HM, Demoulin V, Hawksworth DL, Marhold K, Nicolson DH, Prado

J, Silva PC, Skog JE, Wiersema JH, Turland NJ (eds.). 2006. International Code of Botanical

Nomenclature (Vienna Code): Adopted by the Seventeenth International Botanical Congress,

Vienna, Austria, July 2005. ARG Gantner, Ruggell, Liechtenstein.

Seaver FJ. 1922. Phyllostictales Phyllostictaceae (pars). N. Amer. Fl. 6: 1-84.

Swofford DL. 2002. PAUP*: Phylogenetic analysis using parsimony (*and other methods). Version

4.0b10. Sinauer Associates, Sunderland, MA.

Verkley GJM, Crous PW, Groenewald JZ (Ewald), Braun U, Aptroot A. 2004. Mycosphaerella

punctiformis revisited: morphology, phylogeny, and epitypification of the type species of the

genus Mycosphaerella (Dothideales, Ascomycota). Mycol. Res. 108: 1271-1282. doi:10.1017/

$0953756204001054

Wen J, Stuessy TF. 1993. The phylogeny and biogeography of Nyssa (Cornaceae). Syst. Bot. 18:

68-79. doi:10.2307/2419789

Wolf FA. 1940. A leafspot fungus on Nyssa. Mycologia 32: 331-335. doi:10.2307/3754315

MYCOTAXON

Volume 115, pp. 323-326 January-March 2011

DOT: 10.5248/115.323

Acaulospora soloidea, a new arbuscular mycorrhizal fungus

from rhizosphere soils of Murraya paniculata

J.D. VAINGANKAR' & B.F. RODRIGUES?

Department of Botany, Goa University, Goa 403 206, India

CORRESPONDENCE TO: ‘vaingankarjyoti@gmail.com ¢& *felinov@gmail.com

ABSTRACT — A new species of Acaulospora from the laterite soils in Goa, India is described

and illustrated. The spores have a unique wall with fibrillose, hairy outgrowths, which appear

like the rays of the sun when mounted in water or PVLG, hence named as A. soloidea.

Key worps — Glomeromycota, spore morphology, taxonomy, species description

Introduction

A survey was conducted on the rhizosphere soils of ornamental flowering

plants of Goa state to collect the arbuscular mycorrhizal fungal diversity and

distribution data. During the survey an interesting taxon was isolated from

Murraya paniculata. The spore wall is covered with numerous fibrillose,

acellular, hairy outgrowths forming a thick cover. When the spores are mounted

in a drop of water or PVLG, these hairs unfold from the spore surface to spread

around the spore like solar rays, giving the spore an appearance of sun, hence

proposed as Acaulospora soloidea sp. nov.

Materials & methods

Spores were isolated from the rhizosphere soils by wet sieving, decanting and sucrose

centrifugation (Sieverding 1991). The spores were mounted in Polyvinyl alcohol lacto-

glycerol (PVLG) and in PVLG mixed with Melzer’s reagent (1:1, v/v). Wall description

and terminology are based on those suggested by Walker (1983) and Walker & Vestberg

(1998). Type material has been deposited in the Goa University Arbuscular Mycorrhizal

Culture Collection. To study more carefully the external morphology of the spores, a

number of them were prepared for Scanning Electron Microscopy (SEM). Before the

preparation of the material for SEM, spores were put under a dissecting microscope to

remove any debris adhering to the spore surface. For SEM studies, clean dry spores were

mounted on an aluminum stub with double-sided transparent tape, coated with gold,

and observed.

324 ... Vaingankar & Rodrigues

Fics 1-6. Acaulospora soloidea. 1. Fresh spores under transmitted light. 2. Dry spore.

3. Spores mounted in PVLG. 4-6. Spores showing wall layers.

Acaulospora soloidea Vaingankar & B.F. Rodrigues, sp. nov. Ficures 1-12

MycosBank MB 518836

Sporae singulae pallide brunneae vel brunneae, globosae vel subglobosae (50-)65-84(-90)

um diam. Tunica sporae e stratis quinque in turmis tribus, in totum 2.0-3.0 um crassa.

Tunica exterium (stratum 1) unitum, hyalinum 0.4-0.6 um crassa, caducus, tenue et

evanescens. Tunica media stratis duobus, stratum exterius (stratum 2) brunneae, 1.2-1.6

um crassa, rigido, cum appendicibus numerosis fibrillosis, pilosae sporae, 3-6 jm cr.

formantibus. Stratum interioris (stratum 3) hyalinum vel pallide brunneae 0.3-0.4um

crassa. Tunica interior stratis duobus (strati 4, 5); quarto hyalinum, 0.1-0.2 um crassa;

quinque hyalinum, 0.1-0.2 um crassa amorpho.

HoLotype: India. Goa: Arambol, from rhizosphere soil of Murraya paniculata (L.)

Jack (Rutaceae), 3 Jan. 2009, Jyoti. (Arbuscular Mycorrhizal Culture Collection, Goa

University: Slide no. OFP-VJ1).

EryMo.ocy: soloidea, from Latin sol (= sun) and —oideus (= resembling), referring to

the sun like appearance of the spore.

Acaulospora soloidea sp. nov. (India) ... 325

100pm*

Fics 7-12. Acaulospora soloidea. 7. Crushed spore showing lipid content. 8. Spore

mounted in PVLG + Melzer’s reagent showing inner wall. 9-10. Spores showing hairy

ornamentation. 11-12. SEM images of spores.

Spores formed singly in the soil, sessile, borne laterally on the subtending hypha

of the sporiferous saccule. The spores are pale brown to brown, globose to

subglobose (50-)65-84(-90) tum diam. Spore wall structure of 5 walls (1-5) in

three groups (A, B, C), exterior, medium and interior, in total 2.0-3.0 um thick

(Fics 4-6, 8). Group A with a single wall (W1). Wall 1 is hyaline, 0.4-0.6 um

thick, sloughing completely, evanescent and thus present only in young spores.

Group B consisting of two walls (W2 and W3). Wall 2 is continuous, brown

1.2-1.6 um thick, rigid, with numerous acellular, fibrillose, hairy outgrowths

forming a pile or thick coat 3-6 um on the spore surface (Fics 3-4). The hairs

are tightly packed together on the spore surface when dry (Fic. 2). The length

of each may vary from 10-15 tm, Wall 3 hyaline to light brown, laminated,

0.3-0.4 wm thick tightly adherent to W2. Group C composed of two hyaline

flexible walls (W4 and W5), which are formed after the differentiation of spore

326 ... Vaingankar & Rodrigues

wall. Wall 4 hyaline, bilayered, very thin 0.1-0.2 um, does not show any reaction

with Melzer’s reagent. Wall 5 is hyaline, thin, 0.1-0.2 um, amorphous and is not

beaded (Fic. 8). Spore contents of hyaline lipid globules (Fic. 7).

Discussion

Gerdemann & Trappe (1974) established the genus Acaulosporaand presented

the first key for the two species, A. laevis and A. elegans. The key differentiated

one species known to produce spores with a smooth surface (A. laevis) from

another with an ornamented surface (A. elegans). Presently 19 Acaulospora

species with smooth spore surfaces (http://www.lrz-muenchen.de/~schuessler/

amphylo/) and 15 Acaulospora species with outer spore wall ornamentation have

been identified (Sieverding et al. 2006). Schenck et al. (1984) presented a key to

the ornamented species of Acaulospora. Differentiating features such as spines,

tubercles, ridges, folds, pits or cracks as for the spore wall ornamentations were

used. The species described here is included in this genus. It presents affinities

with the type species in spore shape and wall layers. It differs from other

Acaulospora species in the morphology of the spore surface, which gives rise to

numerous acellular, fibrillose hairy outgrowths forming a pile or thick coat on

the spore surface, which when extended look like the rays of the sun. On the

basis of its morphological characteristics, the isolate represents a novel species

of the genus Acaulospora, for which the name A. soloidea sp. nov. is proposed.

Acaulospora soloidea can be easily distinguished from all other known species

in the genus.

Acknowledgements

We thank Prof. C. Manoharachary and Prof. D.J. Bagyaraj for their helpful suggestions

and critical review of the manuscript. One of us (JDV) acknowledges, with thanks

Department of Science and Technology, New Delhi, for the fellowship.

Literature cited

Gerdemann JW, Trappe JM. 1974. The Endogonaceae in the Pacific Northwest. Mycologia Memoir

No. 5. 76 p.

Oehl F, Sykorova Z, Redecker D, Wiemken A, Sieverding E. 2006. Acaulospora alpina, a new

arbuscular mycorrhizal fungal species characteristic for high mountainous and alpine regions

of the Swiss Alps. Mycologia, 98(2): 286-294. doi:10.3852/mycologia.98.2.286

Schenck NC, Spain JL, Sieverding E, Howeler RH. 1984. Several new and unreported vesicular-

arbuscular mycorrhizal fungi (Endogonaceae) from Colombia. Mycologia 76: 685-699.

doi: 10.2307/3793226

Sieverding E. 1991. Vesicular-arbuscular mycorrhiza management in tropical ecosystems. GTZ

Eschborn Germany.

Walker C. 1983. Taxonomic concepts in the Endogonaceae: spore wall characteristics in species

descriptions. Mycotaxon 18: 443-455.

Walker C, Vestberg M. 1998. Synonymy amongst the arbuscular mycorrhizal fungi: Glomus

claroideum, G. maculosum, G. mutltisubstensum and G. fistulosum. Annals of Botany 82:

601-624. doi:10.1006/anbo.1998.0714

MYCOTAXON

Volume 115, pp. 327-334 January-March 2011

DOT: 10.5248/115.327

Conidial fungi from the semi-arid Caatinga biome of Brazil.

New species and records for Thozetella

FLAVIA RODRIGUES BARBOSA, SILVANA SANTOS DA SILVA,

PATRICIA OLIVEIRA FIUZA & Luis FERNANDO PASCHOLATI GUSMAO

Departamento de Ciéncias Biolégicas, Laboratério de Micologia, Universidade Estadual de Feira de

Santana, Av. Transnordestina s/n, Novo Horizonte, 44036-900, Feira de Santana, BA, Brazil

CORRESPONDENCE TO: faurb 10@yahoo.com.br, silvanasdasilva@hotmail.

com. br, patyfiuz@yahoo.com.br & lgusmao@uefs.br

ApsTRACT — As a result of an investigation of microfungi in northeastern Brazil, the

hyphomycete Thozetella submersa sp. nov. is described from submerged wood. Its diagnostic

features are the smooth, elliptic-fusiform, obclavate to rarely obovoid to obclavate, slightly

curved, sometimes corniculate at the ends, microawns. T. boonjiensis and T. gigantea are

recorded for the first time for the American continent. A key to all described species is

included. A synopsis of drawings of microawns (most based on original papers) is provided

for all Thozetella species.

Key worps — anamorphic fungi, diversity, taxonomy

Introduction

Thozetella Kuntze presently includes fifteen species (Castaneda et al. 2002,

Paulus et al. 2004, Allegrucci et al. 2004, Jeewon et al. 2009) found in temperate

and warm regions (Nag Raj 1976, Grandi & Gusmao 2002, Piontelli & Giusiano

2004, Barbosa et al. 2007). Among the variety of sterile structures known for

the hyphomycetes, the presence of microawns is unique for the genus (Sutton

& Cole 1983).

Recent phylogenetic and morphological research of five species of Thozetella

from Australia by Paulus (et al. 2004) confirms that Thozetella species are

anamorphs of the ascomycete Chaetosphaeria Tul. & C. Tul. Their key to 14

described species of Thozetella (Paulus et al. 2004) did not include T! buxifolia

Allegr. et al. (Allegrucci et al. 2004). In their synoptic table of Thozetella species,

Paulus et al. (2004), who apparently did not examine the holotype, cited a

median to submedian septum for microawns in T’ canadensis Nag Raj although

this character was not mentioned in the protologue (Nag Raj 1976). In the

present work, almost all characters are based on original species descriptions.

328 ... Barbosa & al.

Recently, T° pinicola S.Y.Q. Yeung et al. was described from leaf litter of Pinus

elliottii Engelm. in Hong Kong. This new taxon was based on morphology and

DNA sequence analyses (Jeewon et al. 2009).

Paulus et al. (2004), Allegrucci et al. (2004), and Jeewon et al. (2009) retain

T. ciliata (R.E Castafieda et al.) Hol.-Jech. & Mercado within Thozetella.

However, we refer this specimen to Venustosynnema ciliatum (R.F. Castaneda et

al.) R.E. Castafieda & W.B. Kendr. In their discussion of V. ciliatum, Castafieda-

Ruiz et al. (2002) note that the absence microawns and presence of dark brown

setae are characters that exclude the species from Thozetella.

Thozetella species have been reported from leaf litter (Grandi 1999, Parungao

et al. 2002, Castafieda-Ruiz et al. 2003, Allegrucci et al. 2004), decaying floral

parts (Agnihothrudu 1958), soil (Agnihothrudu 1962), roots (Waipara et al.

1996), stalks (Nag Raj 1976), and bark (Morris 1956). This constitutes the third

report of the genus from freshwater habitats following those of T. havanensis

R.E Castafieda (from submerged leaf litter) and T’ nivea (Berk.) Kuntze (from

wood) (Sivichai et al. 2002, Delgado-Rodrigues & Mena-Portales 2004).

From Brazil, five Thozetella species have been found: T. cristata Piroz. & Hodges,

T. cubensis R.E. Castafieda & G.R.W. Arnold, T. havanensis (Barbosa et al. 2007, Silva

& Grandi 2008), T) queenslandica B.C. Paulus, Gadek & K.D. Hyde (Cruz & Gusmao

2009), and T. tocklaiensis (Agnihothr.) Piroz. & Hodges (Maia et al. 2002).

Materials & methods

STUDY SITE. Collecting trips were made to the hygrophilous forests called “Serra da

Jibdia” in the semi-arid region in the northeastern of Brazil. This area has been described

previously (Barbosa et al. 2007, Marques et al. 2007)

COLLECTION TECHNIQUES. Submerged leaves and wood debris were collected from

a lotic habitat in an unnamed stream in the “Serra da Jibdia”. Samples were placed in

plastic bags and returned to the laboratory. The plant material was then incubated at

25°C in Petri dish moist chambers and stored in 50 L plastic boxes with 200 ml sterile

water plus 2 ml glycerol. Samples were examined over four weeks for the presence of

conidiomata.

SPECIMEN EXAMINATION. Conidiomata were located with a dissecting microscope

and removed to a glass slide where they were crushed and mounted in polyvinyl alcohol-

glycerol (8.0 g in 100 ml of water, plus 5 ml of glycerol). Measurements were made of

fixed material. Permanent slides were deposited in HUEFS.

Taxonomy

Thozetella submersa ER. Barbosa & Gusmao, sp. nov. Fic. 1-5

MycoBank MB518831

Abomnibus speciebus Thozetellae differt microaristis unicellularibusellipsoidi-fusiformibus,

raro obovatis vel obclavatis, minute curvis, laevibus, utrinque interdum solo corniculatis

praeditis, hyalinis, 16-25um longis, 3-4 um latis at basi, 2-3 um latis at apicem.

Thozetella in Brazil ... 329

Fics. 1-5. Thozetella submersa (from the holotype). 1. Conidioma on the natural substrate.

2. General aspect of a conidioma without the conidial mass. 3. Conidiogenous cells.

4. Conidia. 5. Microawns. (Scale bars: 1 = 100 um; 2 = 50 um; 3-5 = 10 um).

330 ... Barbosa & al.

Hotorypus: Brazil. Bahia: Santa Terezinha, Serra da Jibdia, on submerged wood from

a stream, 25.III.2009, coll. FR Barbosa, HUEFS 141560.

EryMo.ocy: the Latin submersa refers to the submerged habitat.

CoNIDIOMATA sporodochial, superficial, sessile, 200-250 x 105-150 um, moist

and white mass. CONIDIOPHORES macronematous, compact at the base but

more or less free distally, septate, smooth, cylindrical, brown, paling toward

the apex, < 3 um diam. CoNIDIOGENOUS CELLS monophialidic, integrated,

determinate, terminal, cylindrical, light brown, 7.5-10 x 2.5-3 wm, lacking an

apical collarette. MICROAWNS not visible in mass on the natural substratum,

smooth, elliptic-fusiform, rarely obovoid to obclavate, slightly curved,

sometimes corniculate at the ends, hyaline, 16-25 um long, 3-4 um wide at

the base, 2-3 um wide at the apex. CoNIDIA aseptate, smooth-walled, finely

guttulate or eguttulate, lunate, hyaline, 14-15 x 2-2.5 um, provided with a

single filiform setula at each end, 5-7 um long.

Notes: Thozetella submersa can be easily diagnosed by the morphology and

smaller size of the microawns. A synopsis of microawns (Fic. 6) and a key to

the published species are included.

Thozetella boonjiensis B.C. Paulus, Gadek & K.D. Hyde, Mycologia 96: 1076. 2004.

CONIDIOMATA sporodochial. Microawns L-shaped, 0-septate, hyaline, 54-63

x 3-4.5 tum, apex acerose. CONIDIA 10.5-14.3 x 1.5-3 um. SETULAE 5.3-7.5

uum long.

EXAMINED MATERIAL: BRAZIL. Bauia: Santa Terezinha, Serra da Jibéia, on decaying

wood, 01.VIII.2008, coll. Fiuza P.O. (HUEFS 148834).

Notss: Thozetella boonjiensis resembles T. acerosa B.C. Paulus et al., T. gigantea,

and T! tocklaiensis in the L-shaped microawns, which are, however, septate in

T. acerosa. Both microawns and conidia are larger in T: gigantea and smaller

in T. tocklaiensis (Paulus et al. 2004, Piontelli & Giusiano 2004). Thozetella

boonjiensis was previously known only from the type locality (Australia)

(Paulus et al. 2004).

Thozetella gigantea B.C. Paulus, Gadek & K.D. Hyde, Mycologia 96: 1080. 2004.

CONIDIOMATA sporodochial; Microawns L-shaped, 0-septate, hyaline, 81-141 tm

long, 4.5-6 um wide at base. CONIDIA 13-15 x 1.5-2 um. SETULAE 7.5-9 um long.

EXAMINED MATERIAL: BRAZIL. Bauia: Santa Terezinha, Serra da Jibéia, on decaying

leaves, 02.VIII.2007, coll. Silva, $.S. CHUEFS141569).

Notss: T gigantea is characterized by its microawns, which are the largest for

the genus (Paulus et al. 2004). This species has been registered only from type

locality (Australia) (Paulus et al. 2004).

Thozetella in Brazil... 33.1

tL—

4 ed

Fic. 6. Microawns of Thozetella species. A. T. acerosa; B. T. boonjiensis; C. T. buxifolia;

D. T. canadensis; E. T. cristata; F. T. cubensis; G. T. effusa; H. T. falcata; |. T. gigantea; J. T: havanensis;

K. T. nivea; L. T. pinicola; M. T. queenslandica; N. T. radicata; O. T. submersa; P. T. tocklaiensis.

(Scale bars: A-P = 10 um).

332 ... Barbosa & al.

Key to Thozetella species

15.

15a.

Microawns predominantly L-shaped. .......... 0... cece cee eee eee nee 2

Microawns not L-shaped or variously shaped ............... 0.000 c eee eee ee 5

Microawns 0-2 septate. .... 0... cece eee eee T. acerosa

Microawns aseptate ..... 6660 e eee eee 3

Microawns 75 wm or longer ...... 0... eee eee een eee T. gigantea

Microawns shorter than 75 UM. ... 0... cece etn een e een e ee 4

Microawn apex undulating to geniculate ..........0. 0... cee eee eee T. nivea

Microawn apex straight to slightly undulating................... T. boonjiensis

Microawns predominantly sickle-shaped, uncinate, hamate or

otherwise strongly curved ..... 0... cece nee ene n eee nena 6

Microawns predominantly straight, sigmoid or of other shape............... 11

Conidiomata predominantly synnematous............ 0.0... c cece eee ee eee 7

Conidiomata predominantly sporodochial.............. 00.0.0 cece eee eee 10

Synnemata proliferating conidiophores form ridges....................00004 8

Synnemata non-proliferating ..... 0... cece cnet nen ee ene ee 9

Microawns 40-60 x 2.5-3 wm, smooth... 0.0... eee eee eee T. cristata

Microawns 25-30 x 3-3.5 fm, Verrucose.... 6... eee eee eee ee T. buxifolia

Microawns 40-95 x 2.5-5 ym, setulae 5-8 um long.................. T. falcata

Microawns 30-60 x 3-4.5 um, setulae 5 um long.................. T. radicata

Microawns 21-34 x 2-4 um, smooth or apically verrucose..... T. queenslandica

Microawns 40-100 um long, 2.5-4 um wide at base,

0.5-1 um wide at apex, smooth ...... 0... eee eee eee T. cubensis

Conidiomata effuse. 0... 0. ccc cece enn ene e es T. effusa

Conidiomata otherwise .....0 00... es 12

Conidiomata sporodochial 0.0.0.0... 0. cece enn en een ees 13

Conidiomata synnematous . 0.0.0.0... ccc eet e tenn n ees 15

Microawns Verrucose. 6... eee eee ee T. canadensis

Microawns smooths 5 t.°s Baz. ise sete Bogs igi AG eg tee ig. Se, Sls fg tela 14

Microawns elliptic-fusiform, 16-25 x 3-4 wide at the base,

2-3 um wide at the apex 0... cece eee ees T. submersa

Microawns straight or slightly undulating with the apical end acerose,

DEAD DS Ke2 DD) UMM, A a cce o> eg ontra at Nee rete tee een ky Mee ee es le T. pinicola

Microawns variously shaped, bulbous base, acerose apex, straight,

undulate, uncinate or bent,18-38 x 1.5-4 um 0.0.0... 0 eee T. tocklaiensis

Microawns with + uniform width, sigmoid, allantoid, uncinate,

DRARABD Ss WHS Dollies, Mas ved hs & sanghiegtatae Mega yage ts Bi Rees oe Ot ay Reaaepett T. havanensis

Thozetella in Brazil ... 333

Acknowledgements

We especially thank Dr E. Descals (Instituto Mediterraneo de Estudios Avanzados,

CSIC-Universitat de les Illes Balears, Spain) and Dr A.M. Arambarri (Instituto de

Botanica Spegazzini, Argentina) for their contribution to this paper. The authors thank

the CNPq (Conselho Nacional de Desenvolvimento Cientifico e Tecnoldgico) for

financial support and the “Programa de Pdés-graduacdo em Botanica — PPGBot/UEFS”.

Literature cited

Agnihothrudu V. 1958. Notes on fungi from North East India. I. A new genus of Tuberculariaceae.

Mycologia 50: 571-579. doi:10.2307/3756119

Agnihothrudu V. 1962. A comparison of some techniques for the isolation of fungi from tea soils.

Mycopathology 16: 234-242. doi:10.1007/BF02145735

Allegrucci N, Cazau MC, Cabello MN, Arambari AM. 2004. Thozetella buxifolia sp. nov. — a new

hyphomycete from Argentina. Mycotaxon 90(2): 275-279.

Barbosa FR, Gusmao LEP, Barbosa, FF. 2007. Thozetella species (Anamorphic Fungi-Hyphomycetes)

from semi-arid of Bahia State, Brazil. Sitientibus 7(2): 184-187.

Castafieda-Ruiz RE, Iturriaga T, Minter DW, Saikawa M, Vidal G, Velazquez-Noa S. 2003.

Microfungi from Venezuela. A new species of Brachydesmiella, a new combination and new

records. Mycotaxon 85: 211-229.

Castafieda Ruiz RF, Minter DW, Rodriguez Herndndez M. 2002. Venustosynnema ciliatum. IMI

Descriptions of Fungi and Bacteria. No. 1490. 3 pp.

Cruz ACR da & Gusmao LFP. 2009. Fungos conidiais na Caatinga: espécies lignicolas. Acta bot.

bras. 23(4): 1133-1144.

Delgado-Rodrigues G, Mena-Portales J. 2004. Hifomicetos Aero-acuaticos e Ingoldianos de la

reserve de la Biosfera Sierra del Rosario (Cuba). Bol. Soc. Micol. Madrid 28: 105-113.

Grandi RAP. 1999. Hifomicetos decompositores do folhedo de Euterpe edulis Mart. Hoehnea 26(1):

87-101.

Grandi RAP, Gusmao LFP. 2002. Hyphomycetes decompositores do folhedo de Tibouchina pulchra

Cogn. Rev. Brasil. Bot. 25(1): 79-87. doi:10.1590/S0100-84042002000100010

Jeewon R, Yeung SYQ, Hyde KD. 2009. A novel phylogenetic group within Thozetella

(Chaetosphaeriaceae): a new taxon based on morphology and DNA sequence analyses. Can. J.

Microbiol. 55(6): 680-687. doi:10.1139/W08- 148

Maia LC, Yano-Melo AM, Cavalcanti MA. 2002. Diversidade de fungos no Estado de Pernambuco.

Pp. 15-50, in: Tabarelli M, Silva JMC. Diagnéstico da diversidade de Pernambuco, v.1. Editora

Massangana, Recife.

Marques MFO, Barbosa FR, Gusmao LEP, Castafieda-Ruiz RF, Maia LC. 2007. Conidial fungi from

the semi-arid Caatinga biome of Brazil. Cubasina microspora sp. nov. a note on C. albofusca,

and some new records for South America. Mycotaxon 102: 17-23.

Morris EF. 1956. Tropical Fungi Imperfecti. Mycologia 48: 728-737. doi:10.2307/3755382

Nag Raj TR. 1976. Miscellaneous microfungi. I. Can. J. Bot. 54: 1370-1376. doi:10.1139/b76-149

Parungao MM, Fryar SC, Hyde KD. 2002. Diversity of fungi on rainforest litter in North Queensland,

Australia. Biodiversity and Conservation 11: 1185-1194. doi: 10.1023/A:1016089220042

Paulus BC, Gadek P, Hyde KD. 2004. Phylogenetic and morphological assessment of five new species

of Thozetella from an Australian rainforest. Mycologia 96(5): 1074-1087. doi:10.2307/3762090

Piontelli E, Giusiano G. 2004. Notas micoldégicas VIII: acerca de Thozetella tocklaiensis en aciculas

senescentes de Pino (Misiones, Argentina). Boletin Micologico 19: 117-124.

334 ... Barbosa & al.

Waipara NW, Di Menna ME, Cole AL], Skipp RA. 1996. Characterisation of Thozetella tocklaiensis

isolated from the roots of three grass species in Waikato pastures. New Zealand. J. Bot. 34:

517-522. doi:0028-825X/96/3404-0517

Silva P da, Grandi, RAP. 2008. Hyphomycetes sobre o folhedo de Caesalpinia echinata Lam. com

duas novas citagdes para o Brasil. Hoehnea 35(4): 477-488.

Sivichai S, Jones EBG, Hywel-Jones N. 2002. Fungal colonization of wood in a freshwater stream at

Tad Ta Phu, Khao Yai National Park, Thailand. Fungal Diversity 10: 113-129.

Sutton BC, Cole GT. 1983. Thozetella (Hyphomycetes): an exercise in diversity. Trans. Br. mycol.

Soc. 81(1): 97-107. doi:10.1016/S0007-1536(83)80209-5

MYCOTAXON

Volume 115, pp. 335-344 January-March 2011

DOT: 10.5248/115.335

Chrysothrix flavovirens, Lepraria elobata, and Ochrolechia arborea

new to Portugal

SANDRINA AZEVEDO RODRIGUES, TOR T@NSBERG?,

ARSENIO TERRON-ALFONSO? & AMADEU M. V. M. SOARES?

'CESAM ¢& Departamento de Biologia, Universidade de Aveiro, Campus Universitario de

Santiago, 3810-193 Aveiro, Portugal

? Museum of Natural History, University of Bergen, Allégaten 41, P. O. Box 7800,

N-5020 Bergen, Norway

[Departamento de Biodiversidad y Gestion Ambiental, Area Botanica, Facultad de Biologia y

Ciencias Ambientales, Universidad de Leon, Campus Vegazana S/N, 24071, Léon, Spain

*CORRESPONDENCE TO: rodrigues.s@ua.pt

Asstract — Chrysothrix flavovirens, Lepraria elobata, and Ochrolechia arborea are reported

as new to Portugal, based on surveys carried out in pine forests along the Portuguese coast.

Data on the distribution, secondary products and ecology of the species are presented.

Key worps — lichens, epiphytic, sand dunes

Introduction

The epiphytic lichen flora of pine forests in coastal areas in Portugal is

poorly studied and is in need of a thorough survey. Pine forests are a common

biotope along the Portuguese coast and many of them are classified as Natural

Parks or Nature Reserves (Fic. 1A&B: 3, 8, 18-19, 21-22, 24), while others are

national forests or forest perimeters that are owned and/or partially managed

by the Portuguese State (Fic. laws: 1, 7, 9-18, 20, 24). Moreover, many of

them are currently classified as Natura 2000 sites (ICN 2006) by the European

Commission (Fic. 1A&B: 1-3, 8, 10, 12, 18-19, 21-22, 24). The only known

inventory of epiphytic lichen species in pine forests on sand dunes was generated

by Catarino et al. (1985) in the framework of biomonitoring studies.

In the course of our investigations on the epiphytic lichens of these areas —

particularly the well-preserved Dunas de Quiaios (Figueira da Foz) (Fic. 1A&B:

12) — new epiphytic lichen records were reported for the Iberian Peninsula

(Rodrigues et al. 2007) and a new Lecanora species has been published

(Rodrigues et al. 2011). These discoveries point to the importance of coastal

336 ... Rodrigues & al.

pine forests as habitats for lichens, which is an extra incentive to ensure their

future preservation. At Dunas de Quiaios, the tree vegetation, rich in epiphytic

lichens, is a planted Pinus pinaster forest mixed with P. pinea, Acacia longifolia,

A. melanoxylon, and Eucalyptus globulus. Arbutus unedo and Myrica faya are

also appropriate supports for lichens (Almeida 1997, Danielsen 2008, Rodrigues

et al. 2007, 2011).

Theaim of this work is to report three crustose and sorediate epiphytic lichens

growing on P pinaster and P. pinea, new to Portugal: Chrysothrix flavovirens,

Lepraria elobata and Ochrolechia arborea. Data on their distribution along the

Portuguese coast, secondary products, and ecology are also provided.

Materials & methods

Unless otherwise stated, all specimens were collected by the first author (SAR) on

P. pinaster trunks in pine forests on sand dunes along the Portuguese coast (Fic. la&s,

see also EXAMINED SPECIMENS). Samples were deposited in AVE, BG, and LEB herbaria.

Distribution maps are based on UTM grid projection and coordinates of the locations

are given in MGRS. Maps [a] and [B] represent the distribution along the Portuguese

coast of C. flavovirens, and O. arborea respectively. The location where L. elobata was

found [12] appears on both maps. Visited locations (indicated by numbers on each map)

were geo-referenced using GoogleEarth and maps were plotted using ArcGis version

OF,

Samples were analysed morphologically and chemically, with standard identification

methods for lichenized fungi (Nash et al. 2001, Smith et al. 2009) and compared to

authentic material deposited in BG herbarium. Morphology of the thallus was examined

with a Leica MS5 stereomicroscope and anatomical observations of hand cut sections of

apothecia were performed under a Leitz HM-LUX 3 microscope. For that, sections were

mounted in distilled water and K/I and the latter was used for measuring anatomical

characters. Chemical analyses followed standardized TLC methods (White & James

1985; Orange et al. 2001). Data regarding companion species were retrieved at Dunas

de Quiaios (Fic. 1aA&B: 12) during a small biomonitoring campaign, using the method

proposed by Asta et al. (2002), in which 9 sampling units with 10 or 12 trees each were

studied. Only C. flavovirens was detected using this method, and therefore it is the

only species for which such data are provided. Only species present in each 10 x 10 cm

quadrate where C. flavovirens was detected were considered as companion species.

The species

Chrysothrix flavovirens Tonsberg Fic. 1A

This common species is characterized by a vivid yellowish-green and

leprose thallus, which is neither stratified nor lobed. The soralia are discrete

to contiguous, forming an areolate or, more often, a thin to thick, continuous

thallus. In our material, diffractaic and rhizocarpic acids and + unidentified

substances were detected. Fertile material was found at Mata do Camarido

(Caminha) (Fic. 1a: 1). Fertile specimens had scattered and sessile apothecia,

Chrysothrix, Lepraria, & Ochrolechia spp. new to Portugal ... 337

0 25 50 100 Km

Lop

Source: IGEO 2009

Fic. 1. Distribution of Chrysothrix flavovirens [a] and Ochrolechia arborea [B] along the

Portuguese coast; Lepraria elobata [12] appears in both [a] and [B]. Dot numbers correspond to

the localities shown in square brackets within the SPECIMENS EXAMINED sections. Asterisks flag

locations where the species were found on both Pinus pinaster and P. pinea.

which were 0.3-0.6 mm in diam. (n = 30), yellowish brown in colour, mostly

rounded, convex and immarginate, but sometimes surrounded by soredia as

also reported by Laundon (1981). Sections of the apothecia reacted K+ violet in

the centre and intensified yellow at the border of the section. The epihymenium,

hymenium, and hypothecium were constituted by anastomosing paraphysis,

and reacted K/I+ blue. The epihymenium was 2.5-12.5 «zm (n = 15) high, the

hymenium 38-83.5 tm (n = 8) and the hypothecium 1485-265 (n = 8). Asci

were clavate, sometimes slightly curved, 23-40.5 x 8.5-14 um (n = 14). Spores

338 ... Rodrigues & al.

were narrowly ellipsoid, some slightly curved, mostly 3-septate, 9.5-12.5 x

2-4 um (n = 21), although some were found 2-septate and 1-septate, but of

smaller sizes. Detailed descriptions can be found in Laundon (1981), Smith et

al. (2009), and Tansberg (1992).

HABITAT AND DisTRIBUTION — Chrysothrix flavovirens may form large

patches extending over a large part of the pine trunk or appear as small patches

associated with other species. At Dunas de Quiaios (Fic. 1a: 12) it was found

together mostly with C. candelaris (L.) J.R. Laundon, Hypogymnia physodes (L.)

Nyl., and Pyrrhospora quernea (Dicks.) Kérb. but also with Usnea rubicunda

Stirt., U. subscabrosa Nyl. ex Motika, and Flavoparmelia caperata (L.) Hale,

Lecanora strobilina (Spreng.) Kieff., Parmotrema reticulatum (Taylor) M.

Choisy and Trentepohlia sp.

This species was frequently found in well-preserved to open coastal pine

forests on sand dunes and also in localities with scanty pines, growing on

P. pinaster and in some sites also on P pinea (Fic. 1A, see also EXAMINED

SPECIMENS). It was also collected in mountains near the coast at Serra da Boa

Viagem (Figueira da Foz) (Fic. 1a: 13) and Serra de Sintra (Sintra) (Fic. 1a: 18).

Elevations observed ranged from about 2 m at Dunas de Ofir/Fao (Esposende)

(Fic. 1A: 3) to about 260 m at Serra de Sintra. Although C. flavovirens is

widespread throughout the Atlantic and Mediterranean biogeographic

regions of Portugal (ICN 2006), it was not found in surveys at a coastal pine

forest in south-eastern Portugal, Dunas de Vila Real de Santo Anténio (Vila

Real de Santo Antdénio). This species, which is frequent and of which reports

are increasing, is regarded as a preferentially coastal species of acidic bark

(Laundon 1981 [as sorediate thalli of C. chrysophthalma (P. James) P. James &

J.R. Laundon], Kowalewska & Jando 2004, Tonsberg 1992 [as sorediate thalli of

C. chrysophthalma], Smith et al. 2009).

Chrysothrix flavovirens is widely distributed in Europe (Aptroot et al. 2003;

Kowalewska & Jando 2004; Laundon 1981; Llimona & Hadlun 2001; Nimis &

Martellos 2008; Smith et al. 2009; Sachting & Alstrup 2008; Sparrius et al. 2002;

Suija et al. 2009; Tonsberg 1992, 1994) and is also known from North America

(Richardson et al. 2009) and Asia (Kowalewska & Jando 2004). A very similar

species recently described from eastern North America, C. chamaecyparicola

Lendemer, is similar to C. flavovirens except that it lacks diffractaic acid

(Lendemer & Elix 2010).

SPECIMENS EXAMINED (square bracketed numbers refer to localities indicated in Fic.

1a): PORTUGAL. Mrinuo: [1] Caminha. MoLepo, Mata NACIONAL DO CAMARIDO,

29TNG1133, 14 m, 22.3.2009, AVE-L 337, LEB-Lichenes 7810. [2] Viana do Castelo.

CuaFE, PRAIA DA AMOROSA, 29TNGI1510, 17 m, 5.9.2009, AVE-L 380, LEB-Lichenes

7811. [3] Esposende. FAo, Dunas DE OFtR/FAO (PARQUE NATURAL DO LITORAL

Norte), 29TNF1894, 2 m, 15.5.2009, AVE-L 358. Douro LIToRAL: [4] Vila do Conde.

MINDELO, RESERVA ORNITOLOGICA DO MINDELO, 29TNF2275, 24 m, 25.6.2009, AVE-

L 376, LEB-Lichenes 7812; id., on trunk of Pinus pinea AVE-L 364. [5] Matosinhos.

Chrysothrix, Lepraria, & Ochrolechia spp. new to Portugal ... 339

ANGEIRAS, PARQUE DE CAMPISMO DE ANGEIRAS — ina small pine stand on sand dunes

used for camping, 29TNF2368, 23 m, 15.5.2009, AVE-L 366. [6] Vila Nova de Gaia.

VALADARES — in an area with scanty pines, 29TNF2949, 24 m, 15.5.2009, AVE-L 359.

Berra Lirorat: [7] Ovar. CorTEGAGA, DUNAS DE Ovar, 29TNF2932, 8 m, 25.6.2009,

AVE-L 375, LEB-Lichenes 7813. [8] Aveiro. S. JACINTO, DUNAS DE S. JACINTO (RESERVA

NATURAL DAS DuNAS DE S. JACINTO), 29TNF2302, 2 m, 23.4.2009, AVE-L 349, LEB-

Lichenes 7814. [9] flhavo. GAEANHA DO CARMO, Dunas DA GAFANHA, 29TNE2394,

13 m, 9.9.2009, AVE-L 377, LEB-Lichenes 7815. [10] Vagos. GAEANHA DO AREAO,

DuNAS DE VAGos, 29TNE2185, 21 m, 23.3.2009, AVE-L 340. [11] Mira. Serxo, Dunas

DE Mira, 29TNE2280, 24 m, 26.3.2009, AVE-L 341, LEB-Lichenes 7816. Figueira da

Foz. [12] Quraios, DUNAS DE QUIAIOS, 29TNE1654, 49 m, 4.9.2007, AVE-L 383; id.,

29TNE1554, 49 m, 11.1.2007, BG-L 88214, LEB-Lichenes 7817; id., epiphytic on trunk

of PB pinea, 29TNE1353, 45 m, 26.6.2009, AVE-L 373. [13] SeRRA DA Boa VIAGEM,

Marta DO PRAZO DE SANTA MARINHA/SERRA DA Boa VIAGEM — ina pine forest ina

mountainous area, 29TNE1149, 205 m, 26.6.2009, AVE-L 371; id., epiphytic on trunk of

P. pinea, 29TNE1149, 200 m, 26.6.2009, AVE-L 372. [14] Costa DE Lavos, DuNas DA

Lerrosa, 29TNE1137, 21 m, 25.4.2009, AVE-L 356, LEB-Lichenes 7818; id., epiphytic

on trunk of P. pinea, 29TNE1037, 16 m, 25.4.2009, AVE-L 354, LEB-Lichenes 7819. [15]

Lerrosa, Mata Do Urso, 29TNE1132, 28 m, 25.4.2009, AVE-L 352, LEB-Lichenes 7820.

[16] Leiria. PEDROGAo, MATA DO PEDROGAO, 29SNE0416, 24 m, 25.4.2009, AVE-L 344,

LEB-Lichenes 7821. ESTREMADURA: [17] Marinha Grande. S. PEDRO DE MUEL, Mata

DE LEIRIA, 29SNE0004, 49 m, 25.4.2009, AVE-L 351. [18] Sintra. SERRA DE SINTRA,

ULGUEIRA, PER{METRO FLORESTAL DA SERRA DE SINTRA (PARQUE NATURAL DE SINTRA

CascalIs) — in a pine forest in a mountainous area 29SMC5993, 260 m, 27.4.2009,

AVE-L 347. BAIxo ALENTEJO: [19] Alcdcer do Sal. Comporta, PRAIA DA COMPORTA,

29SNC1748, 24 m, 1.6.2009, AVE-L 367. [20] Santiago do Cacém. Retvas Verpes, AREA

FLORESTAL DE SINES, 29SNC2106, 75 m, 3.4.2009, AVE-L 336. ALGARVE: [21] Aljezur.

ROGIL, PRAIA DE VALE DOS HOMENS (PARQUE NATURAL DO SUDOESTE ALENTEJANO

E CosTA VICENTINA), 29SNB1537, 49 m, 30.5.2009, AVE-L 370. [22] Vila do Bispo.

SAGRES, PINHAL DE VALE SANTO (PARQUE NATURAL DO SUDOESTE ALENTEJANO E

Costa VICENTINA) — epiphytic on branch of P. pinaster, 29SNB0300, 74 m, 31.5.2009

AVE-L 369.

Remarks — Recently separated as the sorediate counterpart of C. chrysoph-

thalma (Smith et al. 2009, Tonsberg 1994), C. flavovirens may be confused with

C. candelaris, which also occurs on pine trees in the study areas, but developing

a more yellowish thallus with calycin (Elix & Kantvilas 2007, Laundon 1981).

The chemical constitution of C. flavovirens (Elix & Tensberg 2004, Laundon

1981, Tonsberg 1992) is variable, as Elix & Kantvilas (2007) refer to the presence

of barbatic and conrhizocarpic acids, as well as epanorin, and the absence of

atranorin in samples from the United Kingdom and Sweden.

Lepraria elobata Tonsberg

This species develops a diffuse, leprose, predominantly non-lobed and non-

stratified, bluish-grey thallus, without medulla and with profuse more or less

continuous fine soredia (Saag et al. 2009, Tonsberg 1992). Our sterile material

of L. elobata contained atranorin, zeorin and stictic acid with satellites. Detailed

descriptions are provided by Saag et al. (2009), Smith et al. (2009) and Tansberg

(1992).

340 ... Rodrigues & al.

HABITAT AND DIsTRIBUTION: Only one specimen of L. elobata was found

epiphytic on P. pinaster bark at Dunas de Quiaios (Fic. 1AxB: 12), at an

altitude of about 49 m, where it appears to be uncommon. This species occurs

preferentiality on bark but is also known to grow on soil and siliceous rocks in

shady and wet locations (Kukwa 2006). Regarding bark preferences, L. elobata

seems to prefer deciduous to conifer trees (Saag 2007) and should be expected

to occur in other habitats in Portugal.

Lepraria elobata is known from several European countries (Bayerova

& Kukwa 2004, Boom et al. 1996, Coppins 2002, Czyzewska & Kukwa 2005,

Diederich et al. 2009, Ekman & Tonsberg 2002, Feuerer 2009, LukoSiené

& Naujalis 2009, Nimis & Martellos 2008, Osyczka & Stolarczyk 2005, Paz-

Bermudez et al. 2000, Priigger 2000, Tonsberg 1992) and North America (Saag

et al. 2009, Tonsberg 2004).

SPECIMEN EXAMINED - PORTUGAL. Berra Lirorat: [Fic. 1A&s: 12] Figueira da Foz.

Qutaios, DuNAS DE QUIAIOS, 29TNE1554, 49 m, 11.1.2007, AVE-L 390, BG-L 88184.

Remarks — Lepraria nylanderiana Kiummerl. & Leuckert is the most frequent

Lepraria species at Dunas de Quiaios and is thought to be widespread in pine

forests on sand dunes in the central west coast of Portugal. Both L. elobata

and L. nylanderiana have a leprose, bluish-grey thallus, but L. nylanderiana

has a delimited margin where minute lobes may appear in well-developed

specimens. Also, L. nylanderiana usually has a whitish medulla, medium to

coarse soredia, and thamnolic and roccellic acids and atranorin (Smith et al.

2009). Lepraria elobata is morphologically similar to L. caesiella R.C. Harris

and L. incana (L.) Ach., which are differentiated chemically by the content in

atranorin and zeorin, and divaricatic acid and zeorin, respectively (see Saag et

al. 2009). Neither species has been found so far epiphytic on pine at Dunas de

Quiaios.

Ochrolechia arborea (Kreyer) Almb. Fic. 1B

This species is characterized by a whitish grey, sorediate and thin thallus,

which may be tuberculate in the centre. The soralia are mostly discrete and may

be delimited and orbicular or more or less diffuse, rarely being confluent, but not

covering the whole thallus (Boqueras et al. 1999, Tonsberg 1992). Our material

was sterile and contained gyrophoric and lecanoric acids, lichexanthone (UV+

orange), and + atranorin (Tonsberg 1992).

HABITAT AND DISTRIBUTION — Ochrolechia arborea was found in localities

along the western coast from Minho to Estremadura provinces (Fic. 1B, see

also EXAMINED SPECIMENS) in Portugal’s Atlantic and Mediterranean regions

(ICN 2006). It was also found in mountainous locations at Serra da Boa Viagem

(Figueira da Foz) (Fic. 1p, 13) and Serra de Sintra (Cascais) (Fic. 1p: 24),

Chrysothrix, Lepraria, & Ochrolechia spp. new to Portugal ... 341

having been recorded at altitudes up to 205 m at Serra da Boa Viagem. Most

specimens were found on P pinaster, but some were also found on P. pinea.

Contrary to C. flavovirens, O. arborea is not restricted to maritime habitats

and has been reported from inland countries such as Switzerland (Diederich

& Sheidegger 1996) and Mongolia (Hauck & Javkhlan 2006). It is expected

to occur in inland Portugal on a wide variety of phorophytes as reported in

the literature (Boqueras et al. 1999, Christensen & Svane 2007, Kukwa 2009,

Tonsberg 1992). The species has been noted as typical of shady habitats or soft

barks johansson et al. 2007).

Ochrolechia arborea is currently known from several European countries

(Andrianova et al. 2006, Boqueras et al. 1999, Brodo 1991, Christensen &

Svane 2007, Coppins 2002, Diederich et al. 2009, Dietrich & Scheidegger 1996,

Farkas et al. 2009, Feuerer 2009, Jablonska & Kukwa 2007, Kukwa 2009, Ligka

et al. 2008, Nimis & Martellos 2008, Priigger 2000, Roux et al. 2008, Sechting

& Alstrup 2008, Tibell 1992, Tonsberg 1992). It is also known from North and

South America (Brodo 1991) and Asia (Hauck & Javkhlan 2006, John & Nimis

1998, Koneva 2007).

SPECIMENS EXAMINED (square bracketed numbers refer to localities indicated in Fic.

1s): PORTUGAL. Minuo: [1] Caminha. MoLEDo, Mata NACIONAL DO CAMARIDO,

29TNG1133, 15 m, 17.5.2009, AVE-L 320, LEB-Lichenes 7822. [2] Viana do Castelo.

CHAFE, PRAIA DA AMOROSA, 29TNG1510, 20 m, 17.5.2009 AVE-L 323, LEB-Lichenes

7823. BEIRA LITORAL: [23] Ovar. FURADOURO, 29TNF2823, 9 m, 23.3.2009 AVE-L 310.

[11] Mira. Serxo, DuNAs DE Mira, 29TNE2280, 24 m, 26.3.2009, LEB-Lichenes 7824;

id., on a branch of Pinus pinaster, 29TNE2280, 24 m, 26.3.2009, AVE-L 312. Figueira da

Foz. [12] Quiaios, Dunas DE Quiatos, ona branch of P. pinaster, 29TNE1353, 42 m,

14.4.2006, AVE-L 389; id., epiphytic on trunk of P. pinea, 29TNE1758, 49 m, 26.6.2009,

AVE-L 326, LEB-Lichenes 7825. [13] SERRA DA Boa VIAGEM/ MaTA DO PRAZO DE

SANTA MARINHA/SERRA DA BoA VIAGEM — in a pine forest in a mountainous area,

29TNE1149, 205 m, 26.6.2009, AVE-L 328; id., on trunk of P. pinea, 29TNE1149, 200

m, 26.6.2009, AVE-L 324. [16] Leiria. PEDROGAO, MATA DO PEDROGAO —on a branch

of PB. pinaster, 29SNE0416, 24 m, 25.4.2009, AVE-L 315. ESTREMADURA: [24] Cascais.

SERRA DE SINTRA, PENHA LONGA, PER{METRO FLORESTAL DA PENHA LONGA (PARQUE

NATURAL DE SINTRA CascalIs) — ina pine forest in a mountainous area, on a branch of

P. pinaster, 29SMC6490, 149 m, 27.4.2009, AVE-L 317.

Remarks — In our study area, O. arborea specimens growing on branches

frequently developed roundish and delimited soralia, while those on trunks

often generated confluent soralia. Orsellinic acid, detected in Spanish specimens

(Boqueras etal. 1999), was not found in our material. Ochrolechia microstictoides

Rasanen is another very common species in pine forests on sand dune areas in

the centre of Portugal. This species, which has confluent soralia towards the

centre of the thallus that give it a leprose appearance, contains variolaric and

lichesterinic acids (Tonsberg 1992).

342 ... Rodrigues & al.

Acknowledgments

SAR thanks the staff of the Natural Parks of Litoral-Norte, Sintra-Cascais, and

Sudoeste Alentejano e Costa Vicentina; the Nature Reserves of S. Jacinto and Estudrio

do Sado for permission to collect the lichens and also for valuable information on the

location of pine areas. Isabel Mata of the National Forest Authority is specially thanked

for a guided visit in Serra de Sintra. Carla Quintaneiro, Salomé Menezes (Universidade

de Aveiro, Portugal) and Rui Costa are thanked for helping in some of the field trips.

Ana B. Fernandez-Salegui (Universidad de Leén, Spain) is thanked for her assistance

in the course of this study. José Vingada (Universidade do Minho, Portugal) is thanked

for reviewing the manuscript. The peer-reviewers Palmira Carvalho (Universidade de

Lisboa, Portugal) and Victor Rico (Universidad Complutense, Spain) are gratefully

acknowledged for reviewing and improving the manuscript. The first author was

supported by Fundacao para a Ciéncia e Tecnologia (SFRH/BD/18541/2004). Part of

this work was supported by FCT Project Grant reference PTDC/AMB/76006/2006.

Literature cited

Almeida AC. 1997. Dunas de Quiaios, Gandara e Serra da Boa Viagem: uma abordagem ecolégica

da paisagem. Lisboa, Fundacéo Calouste Gulbenkian - Junta Nacional de Investigacao

Cientifica e Tecnolégica.

Andrianova TV, Dudka IO, Hayova VP, Heluta VP, Isikov VP, Kondratiuk SYa, Krivomaz TI, Kuzub

VV, Minter DW, Minter TJ, Prydiuk MP, Tykhonenko YuYa. 2006. Fungi of Ukraine [http://

www.cybertruffle.org.uk/ukrafung/eng (viewed online on 6 January 2010)].

Aptroot A, Herk CM van, Sparrius LB, Spier JL. 2003. New lichens and lichenicolous fungi from the

Netherlands, with additions to the checklist. Buxbaumiella 63: 32-37.

Asta J, Erhardt W, Ferreti M, Fornasier F, Kirshbaum U, Nimis PL, Purvis OW, Pirintsos S,

Scheidegger C, Haluwyn C van, Wirth V. 2002. Mapping lichen diversity as an indicator

of environmental quality. 273-279, in PL Nimis et al. (eds.), Monitoring with lichens —

Monitoring lichens. Nato Science Series. IV. Earth and Environmental Sciences. Dordrecht,

Kluwer Academic Publishers.

Bayerova $, Kukwa M. 2004. New records of leprarioid lichens in the Czech Republic. Biologia,

Bratislava 59(1): 19-23.

Boom P van den, Diederich P, Sérusiaux E. 1996. Lichens et champignons lichénicoles nouveaux ou

intéressants pour la flore de la Belgique et des régions voisines. VII. Bulletin de la Société des

naturalistes luxembourgeois 97: 81-92.

Boqueras M, Barbero M, Llimona X. 1999. The genus Ochrolechia A. Massal. (Pertusariaceae,

lichens) in Spain and Portugal. Cryptogamie Mycologie 20(4): 303-328. doi:10.1016/S0181-

1584(00)88858-2

Brodo IM. 1991. Studies in the lichen genus Ochrolechia. 2. Corticolous species of North America.

Canadian Journal of Botany 69(4): 733-772. doi:10.1139/b91-099

Catarino F, Sérgio C, Jones MP. 1985. Contribuic¢4o para o estudo da avaliacao do impacte ambiental

da nova central a carvao da EDP na Costa de Lavos. Relatério — 1° ano. Museu Laboratério e

Jardim Botanico — Faculdade de Ciéncias de Lisboa. Lisboa.

Christensen S, Svane S. 2007. Contribution to the knowledge of the lichen flora of Crete (Kriti),

Greece. Willdenowia 37: 587-593. doi:10.3372/wi.37.37218

Coppins BJ. 2002. Checklist of lichens of Great Britain and Ireland. London, British Lichen Society.

[http://www.thebls.org.uk/content/checklist.html (viewed on line on 12 January 2010)].

Czyzewska K, Kukwa M. 2005. Notes on two species of Lepraria from Belarus. Graphis Scripta 17:

20-21.

Chrysothrix, Lepraria, & Ochrolechia spp. new to Portugal ... 343

Danielsen R. 2008. Palaeoecolgical development of the Quiaios-Mira dunes, northern-

central littoral Portugal. Review of Palaeobotany and Palynology 152: 74-99. doi:10.1016/

j.revpalbo.2008.04.005

Diederich P, Ertz D, Stapper N, Sérusiaux E, Broeck D Van den, Boom P van den, Ries C. 2009. The

lichens and lichenicolous fungi of Belgium, Luxembourg and northern France [http://www.

lichenology.info (viewed online on 6 January 2010)].

Dietrich M, Scheidegger C. 1996. The importance of sorediate crustose lichens in the epiphytic

lichen flora of the Swiss plateau and the pre-alps. Lichenologist 28(3): 245-256. doi:10.1017/

$002428299600031X

Ekman S, Tensberg T. 2002. Most species of Lepraria and Leproloma form a monophyletic group

closely related to Stereocaulon. Mycological Research 106(11): 1262-1276. doi:10.1017/

$09537562020067 18

Elix JA, Kantvilas G. 2007. The genus Chrysothrix in Australia. Lichenologist 39(4): 361-369.

doi: 10.1017/S0024282907006998

Elix JA, Tonsberg T. 2004. Notes on the chemistry of some lichens, including four species of

Lepraria. Graphis Scripta 16: 43-45.

Farkas E, Lékés L, Molnar K. 2009. Ochrolechia arborea (lichen-forming fungi) in Hungary.

Mikoldogiai Kozlemények, Clusiana 48(1): 19-24.

Feuerer TE. 2009. Checklists of lichens and lichenicolous fungi [http://www.checklists.de (viewed

on line 16 December 2009)].

Hauck M, Javkhlan S. 2006. Additions to the lichen flora of Mongolia: records from Khentey and

Khangay. Willdenowia 36: 895-912. doi:10.3372/wi.36.36221

ICN. 2006. Plano sectorial da Rede Natura 2000. Lisboa, Instituto da Conservagao da Natureza e

Biodiversidade [http://www.icn.pt/psrn2000/conteudo_plano.htm (viewed on line 5 January

2010)].

IGEO. 2008. Carta administrativa oficial de Portugal (CAOP v. 6.0). Lisboa, Instituto Geografico

Portugués [downloaded from http://www.igeo.pt/produtos/cadastro/caop/ versao6.htm].

Jabtoniska A, Kukwa M. 2007. The lichen genus Ochrolechia in Poland I. O. androgyna s. lat. and

O. arborea. Herzogia 20: 13-27.

Johansson P, Rydin H, Thor G. 2007. Tree age relationships with epiphytic lichen diversity and

lichen life history traits on ash in southern Sweden. Ecoscience 14(1): 81-91. doi:10.2980/1195-

6860(2007) 14[81:TARWEL]2.0.CO;2

John V, Nimis PL. 1998. Lichen flora of Amanos Mountain and the Province of Hatay. Turkish

Journal of Botany 22: 257-267.

Koneva VV. 2007. Lichen flora of the territory between the Ob and the Chulym. Siberian Journal

of Ecology 3: 409-415.

Kowalewska A, Jando K. 2004. Chrysothrix flavovirens in Poland. Graphis Scripta 15: 51-52.

Kukwa M. 2006. The lichen genus Lepraria in Poland. Lichenologist 38(4): 293-305. doi:10.1017/

$0024282906005962

Kukwa M. 2009. The lichen genus Ochrolechia in the Baltic countries. Folia Cryptogamica Estonica

A6: 67-74.

Laundon JR. 1981. The species of Chrysothrix. Lichenologist 13(2): 101-121. doi:10.1017/

$002428298 1000169

Lendemer JC, Elix JA. 2010. Two new species of Chrysothrix from eastern North America. Opuscula

Philolichenum 8: 51-58.

LiSka J, Palice Z, Slavikova $. 2008. Checklist and Red List of lichens of the Czech Republic. Preslia

80: 151-182.

Llimona X, Hladun N. 2001. Checklist of the lichens and lichenicolous fungi of the Iberian

Peninsula and Balearic Islands. Bocconea 14: 5-581.

344 ... Rodrigues & al.

LukoSiené I, Naujalis J. 2009. Rare lichen associations on common oak (Quercus robur) in Lithuania.

Biologia 64(1): 48-52. doi:10.2478/s11756-009-0004-z

Nash III TH, Ryan BD, Gries C, Bungartz F. (eds.) 2001. Lichen flora of the Greater Sonoran Desert

region 1. Tempe, Lichens Unlimited, Arizona State University.

Nimis PL, Martellos S. 2008. ITALIC - The information system on Italian lichens [http://dbiodbs.

univ.trieste.it/ (viewed on line on 6 January 2010)].

Orange A, James PW, White FJ. 2001. Microchemical methods for the identification of lichens.

London, British Lichen Society.

Osyczka P, Stolarczyk P. 2005. Lichens of the genus Lepraria in the Jas. Fragmenta Floristica et

Geobotanica Polonica 12(2): 371-383.

Paz-Bermudez G, Lépez de Silanes ME, Carballal R. 2000. Liquenes saxicolas y terricolas y hongos

liquenicolas interesantes de la costa de Galicia (NW Espafia). Candollea 55: 137-152.

Prigger J. 2000. Lichen biodiversity in Slovenia. Graz, University of Graz [http://members.chello.

at/johannes.pruegger/uni/slovenia/index.html (viewed on line 6 January 2010)].

Richardson DHS, Lucas Z, Anderson F. 2009. The lichen flora of Sable Island, Nova Scotia: its past,

present and likely future status. Bryologist 112(3): 558-571. doi:10.1639/0007-2745-112.3.558

Rodrigues SA, Elix JA, Vingada JV, Terrén Alfonso A, Soares AMVM. 2007. The first records

of Hypotrachyna lividescens and H. pseudosinuosa in the Iberian Peninsula. Cryptogamie

Mycologie 28(2): 155-157.

Rodrigues SA, Terrén-Alfonso A, Elix JA, Peréz-Ortega S, Tonsberg T, Fernandez-Salegui AB,

Soares AMVM. 2011. Lecanora sorediomarginata, a new epiphytic lichen species discovered

along the Portuguese coast. Lichenologist 43(2): 99-111. doi:10.1017/S002428291000071X

Roux C, Coste C, Bricaud O, Bauvet C, Masson D. 2008. Lichens et champignons lichénicoles du

parc national des Cévennes (France) 5 — Vue demsemble et conclusion. Bulletin de la Société

Linnéene de Provence 59: 243-279.

Saag L. 2007. The substrate preferences of epiphytic Lepraria species in old-growth forests in

Estonia. Folia Cryptogamica Estonica 43: 51-56.

Saag L, Saag A, Randlane T. 2009. World survey of the genus Lepraria (Stereocaulaceae, lichenized

Ascomycota). Lichenologist 41(1): 25-60. doi:10.1017/S0024282909007993

Smith CW, Aptroot A, Coppins BJ, Flechter A, Gilbert OL, James PW, Wolseley PA. 2009. The

lichens of Great Britain and Ireland. London, British Lichen Society, Department of Botany,

The Natural History Museum.

Sechting U, Alstrup V. 2008. Danish lichen checklist. Version 2. Copenhagen, Faculty of Science,

University of Copenhagen. [downloaded from http://www.bi.ku.dk/lichens/dkchecklist/

default.asp].

Sparrius LB, Diederich P, Signoret J, Sérusiaux E. 2002. The lichen flora of the Boulonnais (France,

Pas-de-Calais). Belgian Journal of Botany 135(1-2): 50-75.

Suija A, Czarnota P, Himelbrant D, Jiiriado I, Kukwa M, Lohmus P, Motiejimaité J. 2009. New

Estonian records: lichenized and lichenicolous fungi. Folia Cryptogamica Estonica 46: 83-89.

Tibell L. 1992. Crustose lichens as indicators of forest continuity in boreal coniferous forests.

Nordic Journal of Botany 12(4): 427-450. doi:10.1111/j.1756-1051.1992.tb01325.x

Tonsberg T. 1992. The sorediate and isidiate, corticolous, crustose lichens in Norway. Oslo, Natural

History Museum, University of Oslo.

Tonsberg T. 1994. Chrysothrix flavovirens sp. nov. — the sorediate counterpart of C. chrysophthalma.

Graphis Scripta 6: 31-33

Tonsberg T. 2004. Lepraria. 322-329, in TH Nash Het al. (eds), Lichen flora of the Greater Sonoran

Desert region. Volume II. Tempe, Arizona.

White FJ, James PW. 1985. A new guide to microchemical techniques for the identification of lichen

substances. British Lichen Society Bulletin 57 (supplement).

MYCOTAXON

Volume 115, pp. 345-351 January-March 2011

DOT: 10.5248/115.345

Lichenological notes 2: Lichenothelia convexa,

a poorly known rock-inhabiting and lichenicolous fungus

JANA KocouRKOVA! & KERRY KNUDSEN?

‘Department of Ecology, Faculty of Environmental Sciences, Czech University of Life Sciences,

Prague, Kamyckd 129, Praha 6 - Suchdol, CZ-165 21, Czech Republic

*Herbarium, Department of Botany and Plant Sciences, University of California,

Riverside CA, 9252-0124, USA

CORRESPONDENCE TO: ! kocourkovaj@fzp.czu.cz & ?knudsen@ucredu

Asstract — Lichenothelia convexa, a saxicolous and lichenicolous microfungus, is reported

new for the Czech Republic. The poorly known species is provided with a description and is

illustrated.

Key worps — Lichenostigma saxicola, Lichenothelia paradoxa

Introduction

Rock-inhabiting fungi (known as RIF) are common throughout the

world. They are rich in diversity (Ruibal et al. 2009) and often collected by

lichenologists who study saxicolous lichenized fungi. Lichenothelia D. Hawksw.

is a cosmopolitan genus of RIF currently comprising 24 species (Robert et

al. 2005). The genus Lichenothelia was introduced by Hawksworth (1981)

for the Microthelia aterrima group of fungi with apothecioid ascomata with

bitunicate asci, pseudoparaphyses, 1-3 septate to submuriform brown halonate

ascospores, and a black areolate non-lichenized thallus. The generic type is

L. scopularia (Nyl.) D. Hawksw.,a widespread species on acid rock or micaschists

in Europe and North America, which has mainly 3-septate to submuriform

ascospores and an I- hymenium. Hawksworth included a second species in the

genus, L. metzleri (J. Lahm) D. Hawksw., which has a similar thallus, but differs

in having predominately 1-septate ascospores, an amyloid reaction on the outer

layers of the asci (I+ blue), and occurs on calcareous rock and serpentine. It is

also known from Europe and North America (Hawksworth 1981).

Aino Henssen published 18 new species in the genus on calcareous or

non-calcareous rock (Henssen 1987). Five of the species had apothecioid

346 ... Kocourkova & Knudsen

ascomata with pseudoparaphyses. Henssen emended the genus to include taxa

with ascomata with asci developing in cavities within a centrum of spherical

cells, describing 13 more species. Henssen’s species varied from dispersed to

contiguous areoles, becoming lobulate or efhigurate thalli in some species.

Some produced superficial hyphae called stolons, which usually produce new

ascomata. Many taxa produced globose macroconidia, often on stalks, or

meristematic offshoots. The centrums were either amyloid or non-amyloid.

Some taxa were described as facultatively lichenicolous or fungicolous. The

paper excited curiosity among lichenologists, who occasionally collected the

more conspicuous rock-inhabiting fungi. But it proved perplexing. It was

without a key and only a short diagnosis was given for each species. Most

species were not illustrated and the pictures of the thalli, though good for the

time, were over-all dark and too small. A monograph was apparently planned

but was never completed. Authentic specimens of the new species were rare

in herbaria and most types were unavailable for loan as Henssen continued

her studies. Few of the types of Henssen’s species are accessible now, although

Hessen will eventually deposit them in Helsinki (H). Most lichenologists lost

interest and stopped collecting the fungi when they found they could not be

identified.

In the 23 years since Henssen’s paper, only 4 new species have been

described. Lichenothelia antarctica Ovstedal (Ovstedal & Lewis Smith 2001) has

apothecioid ascomata with pseudoparaphyses and large muriform ascospores.

It appears to be endemic to Antarctica. Lichenothelia renobalesiana D. Hawksw.

& V. Atienza (Atienza & Hawksworth 2008) also has apothecioid ascomata

with pseudoparaphyses. It has no thallus and is lichenicolous on Verrucaria

species on limestone in Europe and North America (Kocourkova & Knudsen

2009). Lichenothelia spiratispora Etayo is similar to L. renobalesiana but has

smaller ornamented and halonate 1-septate ascospores and is lichenicolous on

Acarospora sphaerospora H. Magn. (Etayo 2010). Lichenothelia uralensis Zhurb.

(Zhurbenko 2008) from the Russian Federation has a cellular centrum and

dispersed areoles and is known only from the type.

Recent pioneering studies of rock-inhabiting fungi using molecular analysis

are renewing interest among mycologists (Ruibal et al. 2009). Currently several

species of Lichenothelia are being cultured and sequenced. The reconstruction

of their phylogeny is anticipated.

We became interested in saxicolous microfungi while studying lichenicolous

fungi. We recently described Lichenostigma saxicola K. Knudsen & Kocourk.

from southern California (Knudsen & Kocourkovdé 2010), a taxon Henssen

would have described in Lichenothelia. The new species has a non-amyloid

centrum of spherical cells, 1-septate ascospores, dispersed thallus, produces

stolons, and is both saxicolous and lichenicolous. From the Czech Republic

Lichenothelia convexa revisited [Europe] ... 347

we examined two taxa with amyloid centrums with spherical cells, both

facultatively lichenicolous. The more common species was eventually identified

as Lichenothelia convexa. In this paper we publish a revised description of

L. convexa and report it new for the Czech Republic. The other taxon may be

new to science or else represent wider variation in L. convexa but needs further

study and more specimens.

Materials & methods

Specimens of Lichenothelia calcarea Henssen, L. convexa, L. metzleri, L. paradoxa

Henssen, L. renobalesiana, L. scopularia, L. tenuissima Henssen, as well as Lichenostigma

saxicola and several probably undescribed taxa from Australia, Europe, North and

South America were studied from B, FH, IMS, MIC, SBBG, PRM, UCR, UPS, and the

Hb. Mycologicum J. Kocourkova & K. Knudsen. Specimens have been examined using

standard microscopical techniques with an Olympus SZX 7 Stereomicroscope or an

Olympus BX 51 fitted with Nomarski differential interference contrast. Hand-made

sections were studied in water and 10% KOH [K]. Amyloid reactions were tested in

Lugol’s iodine 1% [I] with and without pretreatment with K. Ascospore measurements

were made in water with an accuracy of 0.5 um and given in the form “(minimum-)

mean minus standard deviation-mean—mean plus standard deviation (-maximum)”

and followed by the number of measurements (n); the length/breadth ratio of ascospore

is indicated as 1/b and given in the same way. Over-mature ascospores were few and

excluded.

Macro- and microphotographs were taken with a digital Olympus D72 camera

mounted on an Olympus SZX 7 Stereomicroscope and or an Olympus BX 51 fitted with

Nomarski differential interference contrast.

Taxonomy

Lichenothelia convexa Henssen, Bibl. Lichenol. 25: 259 (1987). PLATE 1

TYPE: GERMANY. Hessen. Kr. Marburg, Wollenberg, on quartzite rock, 1980, Henssen

26750a (MB, holotype)

Vegetative hyphae, 4-5 um in diam., brown, with granular surface, thick-walled,

cells 7-10 um long, branching not observed, immersed in substrate, usually

one per stroma, often absent or hard to observe, I-. Thallus dispersed areolate,

stromata sometimes congregated, infrequently confluent but separated by wide

cracks, superficial on rock and lichens, not connected to other ascomata by

networks of superficial hyphae. Stromata black, irregularly rounded, convex

to somewhat flattened, mostly 100-200 x 90-120(-150) tum, some becoming

as wide as 400 um across, infrequently producing 1 to 3 superficial hyphae,

“stolons” sensu Henssen (1987), black in dissecting microscope, black-brown

with granular surface in light microscope, up to 1 mm long, but often shorter,

one cell wide, cells various size, many 4-6 x 4-6 um, often forming new stroma

at tips of stolon, sometimes 3 stromata appearing linked in row. Stromata in

348 ... Kocourkova & Knudsen

section pseudoparenchymatous, with round to angular cells mostly 4-5 um

in diam., external cells brown with granular surface, internal cells hyaline to

light brown, I-, often sterile. Non-ostiolate, opening in apex by wall decay. Asci

immersed in cavities in the stromata, bitunicate, broadly saccate to clavate,

20-30(-35) x 10-20 um, fragile, mostly 8-spored. Intercellular spaces with an

I+ blue, K/I+ blue gel, sometimes weak, reaction not observed when ascomata

sterile. Ascospores hyaline to light brown when young, becoming darker brown,

ellipsoid to broadly ellipsoid, faintly ornamented, halonate at least when young,

cells not equal in size, 1-4 septate, sometimes becoming submuriform, (10.0-

)10.5-10.8-11.5(-12.0) x (5.0-)6.0-6.1-6.5 wm (n = 20); I/b = (1.5-)1.7-1.8-

1.9(-2.1). A few larger over-mature submuriform ascospores were seen, 14 x

6-6.5 um, but were excluded. (Henssen 1987 gives ascospore measurements

of 11-14 x 5.5-6.5 wm). Macroconidia globose, often absent, 10-15(-20) um.

Meristematic outgrowths also produced from surface of stromata of various

sizes and shapes.

ECOLOGY AND SUBSTRATE - On non-calcareous rocks and on saxicolous

lichens. It is not host specific. In some specimens no damage to the host

was observed. In a specimen from KrkonoSe National Park, Knudsen 12560,

Lichenothelia convexa is clearly pathological on the thallus of a Lecidea

species.

DisTRIBUTION. — Europe (Czech Republic, Germany, Sweden, United

Kingdom), Asia (Turkey), North America in the United States (California,

Colorado, Washington) (Halici et al. 2006; Hawksworth 1992; Henssen 1987).

SPECIMENS EXAMINED. — CZECH REPUBLIC. East BoHEMIA. Krkonoge National

Park, KrkonoSe Mts, map of Czech Republic. 50°43’20”N 15°42’03”E, 1426 m, on granite

outcrop and Lecidea species, 10 Oct. 2010, K. Knudsen 12560 w/ J. Kocourkova (Hb.

Mycologicum Kocourkova & Knudsen). CENTRAL BoueEMIA. Distr. Praha, Pitkovice,

Pitkovické stran, 50°1’26"N 14°34'21”E, 276 m, on shale and Rinodina aspersa, 21

Sept. 2010, J. Kocourkovd 7744 (Hb. Mycologicum Kocourkova & Knudsen), on shale

and Acarospora gallica, Knudsen 12452 (BM, GZU, Hb. Mycologicum Kocourkova &

Knudsen); Nova Ves, Prokopské valley, Hemrovy rocks, 50°2’34.88"N 14°21711.6137E,

265 m, on west-facing slope above road, on diabase and Acarospora fuscata, 7 June, 2010,

J. Kocourkovdé 7404 (Hb. Mycologicum Kocourkova & Knudsen); GERMANY. HEssEn.

Kreis Marburg/Biedenkopf, TK 25: 5117 Buchenau, Wollenberg, Wichtelhauser,

Hohler Stein, 385 m, on quartzite, 13 Aug. 1989, H. T. Lumbsch & E. Mietzsch 6948 (B,

TOPOTYPE); Harz. Selketal, Meiseberg, 3 June 1990, H. T: Lumbsch (B).

Discussion

Lichenothelia convexa is widespread and probably under-collected. We

report it as new for the Czech Republic, where it appears to be infrequent on

non-calcareous rock (although often locally common on diabase and shale)

and is often sterile. Unlike L. scopularia, L. metzleri, or L. paradoxa, all of

which have conspicuous black areolate thalli, the dispersed areolate thallus of

Lichenothelia convexa revisited [Europe] ... 349

Pate 1. A, Lichenothelia convexa on Acarospora fuscata and rock (J. Kocourkovd 7404, scale = 1

mm). B, Section of stroma of L. convexa (scale = 20 um). C, Young 1-septate halonate ascospore

(scale = 10 um). D, Faintly ornamented surface of ascospore (scale = 10 um). E, Spore with 3

septa becoming submuriform (scale = 10 um).

350 ... Kocourkova & Knudsen

L. convexa looks like the dispersed thalli of many rock-inhabiting microfungi

seen on calcareous and non-calcareous rock throughout the world. Rarely does

L. convexa form a more confluent thallus of stromata separated by wide, deep

cracks.

In southern California, Lichenothelia convexa resembles Lichenostigma

saxicola, which is distinguished by thinner usually hyaline or light brown

stolons, 1-septate ascospores, and a non-amyloid centrum and which occurs

at relatively low elevations in desert and coastal xeric habitats (Knudsen &

Kocourkové 2010). Lichenothelia convexa was collected in California at a

mesic low elevation site (Silverwood, San Diego County) and higher elevation

montane sites (Yosemite in the Sierra Nevada Mountains and Mt. Baldy in San

Gabriel Mountains) (Henssen 1987). Lichenostigma saxicola, which has not

been reported yet from Europe, is currently considered endemic to western

North America and may be a predominately desert species.

Henssen (1987) originally described Lichenothelia convexa as having 3-4

septate ascospores, but our observations show the ascospores to be variably 1-4

septate. We also observed a K/I+ blue stain in the apex of the ocular chamber

and lacking an amyloid ring. Further study of fresh material, best for taxonomic

study, is needed, as good asci for staining were insufficient in our specimens.

Sterile stromata are common.

Lichenothelia paradoxa is currently known only from Slovakia on quartzite

but is expected in the Czech Republic. Itresembles L. scopularia, but L. paradoxa

has paraplectenchymatous stromata with asci forming in cavities rather than

apothecioid ascomata with pseudoparaphyses. Otherwise the brown ascospores

with 2 or 3 septa are similar in size to the ascospores of L. convexa.

Acknowledgments

We thank our reviewers, James C. Lendemer (NY) and M. Gékhan Halici (University

of Erciyes, Turkey). We thank the curators of B, FH, IMS, MIC, UPS and SBBG. The

work of Jana Kocourkova was supported financially by the grant “Environmental

aspects of sustainable development of society” 42900/1312/423114 from the Faculty of

Environmental Sciences, Czech University of Life Sciences Prague.

Literature cited

Atienza V, Hawksworth DL. 2008. Lichenothelia renobalesiana sp. nov. (Lichenotheliaceae), for a

lichenicolous ascomycete confused with Polycoccum opulentum (Dacampiaceae). Lichenologist

40(2): 87-96. doi:10.1017/S0024282908007342

Etayo J. 2010. Liquenes y hongos liquenicolas de Aragén. Guineana 16: 1-501.

Halici MG, Kocakaya M. & Aksoy A. 2006. Additional and interesting lichenized and lichenicolous

fungi from Turkey. Mycotaxon 96: 13-19.

Hawksworth DL. 1981. Lichenothelia, a new genus for the Microthelia aterrima group. Lichenologist

13: 141-153. doi:10.1017/S0024282981000182

Lichenothelia convexa revisited [Europe] ... 351

Hawksworth DL. 1992. Lichenothelia D. Hawks. (1981). 359-360, in: Purvis OW, Coppins BJ,

Hawksworth DL, James PW, Morse DM (eds.): The Lichen Flora of Great Britain and Ireland.

British Lichen Society, Natural History Museum Publications, Great Britain.

Henssen A. 1987. Lichenothelia, a genus of microfungi on rocks. Bibliotheca Lichenologica 25:

207-293,

Knudsen K, Kocourkova J. 2010. A new Lichenostigma species (genus incertae sedis) from southern

California. The Bryologist 113(2): 229-234. doi:10.1017/S0024282908007342

Kocourkova J, Knudsen K. 2009. Three lichenicolous fungi new for North America. Evansia 26(3):

148-151. doi:10.1639/0007-2745-113.2.229

@vstedal DO, Lewis Smith RI. 2001. Lichens of Antarctica and South Georgia: A guide to their

identification and ecology. Studies in Polar Research, Cambridge University Press, Cambridge,

England. 411 pp.

Robert V, Stegehuis G, Stalpers J. 2005. The MycoBank engine and related databases. http://www.

mycobank.org

Ruibal C, Gueidan C, Selbmann L, Gorbushina AA, Crous PW, Groenewald JZ, Muggia L, Grube

M, Isola D, Schoch CL, Staley JT, Lutzoni F, de Hoog GS. 2009. Phylogeny of rock-inhabiting

fungi related to Dothideomycetes. Studies in Mycology 64: 123-133.

Zhurbenko MP. 2008. A new species from the genus Lichenothelia (Ascomycota) from the Northern

Ural. Mikologia i Fitopatologia 42(3): 240-243.

MYCOTAXON

Volume 115, pp. 353-363 January-March 2011

DOT: 10.5248/115.353

Mortierellomycotina subphyl. nov.,

based on multi-gene genealogies

K. HOFEMANN?, K. VoictT! & P.M. Kirk?

! Jena Microbial Resource Collection, Institute of Microbiology, University of Jena,

Neugasse 25, 07743 Jena, Germany

?CABI UK Centre, Bakeham Lane, Egham, Surrey TW20 9TY, United Kingdom

“CORRESPONDENCE TO: Hoffmann. Kerstin@ Uni-Jena.de

ABsTRACT — The Mucoromycotina unifies two heterogenous orders of the sporangiferous, soil-

inhabiting fungi. The Mucorales comprise saprobic, occasionally facultatively mycoparasitic,

taxa bearing a columella, whereas the Mortierellales encompass mainly saprobic fungi lacking

a columella. Multi-locus phylogenetic analyses based on eight nuclear genes encoding 18S

and 28S rRNA, actin, alpha and beta tubulin, translation elongation factor lalpha, and RNA

polymerase II subunits 1 and 2 provide strong support for separation of the Mortierellales

from the Mucoromycotina. The existence of a columella is shown to serve as a synapomorphic

morphological trait unique to Mucorales, supporting the taxonomic separation of the

acolumellate Mortierellales from the columellate Mucoromycotina. Furthermore, irregular

hyphal septation and development of subbasally vesiculate sporangiophores bearing single

terminal sporangia strongly correlate with the phylogenetic delimitation of Mortierellales,

supporting a new subphylum, Mortierellomycotina.

Key worps — Zygomycetes, SSU rDNA, LSU rDNA, protein-coding genes, monophyly

Introduction

The type species of Mortierella Coem. 1863, M. polycephala Coem. 1863, was

originally isolated from a parasitic interaction with a mushroom and named in

honour of M. Du Mortier, the president of the Société de Botanique de Belgique

(Coemans 1863). However, the common habit of mortierellalean species is as

soil saprobes, enabling the fungi to grow on excrements, decaying plants, or

(not infrequently) on decaying mushrooms and mucoralean fungi (Fischer

1892). Members of the Mortierellales do occasionally occur as opportunistic

pathogens in animals and humans as well (de Hoog et al. 2009: 79). Because of

the morphological differences to other mucoralean-like fungi, the genus was

classified in a separate family, Mortierellaceae A. Fisch. 1892 (Fischer 1892),

which is the only family within the Mortierellales Caval.-Sm. 1998 (Cavalier-

354 ... Hoffmann, Voigt & Kirk

Smith 1998). In addition to Mortierella, the Mortierellaceae includes a further

five genera, Aquamortierella Embree & Indoh 1967, Dissophora ‘Thaxt. 1914,

Gamsiella (R.K. Benj.) Benny & M. Blackw. 2004, Lobosporangium M. Blackw.

& Benny 2004 (= Echinosporangium Malloch 1967, nom. illegit.), and Modicella

Kanouse 1936. Currently, the Mortierellales are classified within the subphylum

Mucoromycotina Benny 2007 with the Mucorales Fr. 1832 and Endogonales

Moreau ex R.K. Benj. 1979 (Hibbett et al. 2007). This classification, based

upon informal supertrees, abandons the phylum Zygomycota and recognizes

four subphyla of uncertain phylogenetic position: Zoopagomycotina,

Entomophthoromycotina, Kickxellomycotina, and Mucoromycotina.Supermatrix-

based phylogenetic approaches using multiple genes in concatenated analyses

place the Mortierellales basal to the Mucorales (Tanabe et al. 2004, James et al.

2006). In contradiction to this, the Mortierellales has also been shown to be

more closely related to the Dikarya and Glomeromycota (Benny et al. 2001, Liu

et al. 2009, Voigt et al. 2009).

‘This study provides evidence for the missing sister relationship between both

orders. All attempts to constrain the monophyly were statistically insignificant

and rejected under the null hypothesis. Therefore, the possibility of a common

ancestor for both orders is unlikely. Combined Bayesian inference, maximum

likelihood, maximum parsimony and distance phylogenetic analyses imply

clear separation of the Mortierellales and the Mucorales. Both orders appear

as well-separated, monophyletic groups in single and combined analyses.

Two synapomorphic morphological features are identified that reliably

characterize, strongly support, and justify the introduction of anew subphylum,

Mortierellomycotina.

Materials & methods

SEQUENCE AND PHYLOGENETIC ANALYSES. Nucleotide sequences encoding the

nuclear small (18S) and large (28S) ribosomal RNA (rDNA), actin (act), translation

elongation factor 1 alpha (tef), RNA polymerase II largest subunit (rpbl), RNA

polymerase II second largest subunit (rpb2), alpha- (atub) and beta-tubulin (btub) from

twenty-seven fungal species were retrieved from GenBank (www.ncbi.nlm.nih.gov),

aligned and subjected to single and combined phylogenetic analyses using Bayesian

inference, maximum likelihood, maximum parsimony and distance algorithms. In

addition, amino acid sequences were also obtained from the protein-coding genes and

used for validation of the tree topologies. Furthermore, nucleic acid sequences available

from genome projects were screened for genomic regions, which are orthologous

to the phylogenetic marker genes selected in this study. Accession numbers of the

sequences retrieved from GenBank as well as the loci from the genome projects (http://

genome.jgi-psf.org/ and www.broadinstitute.org/) are indicated by the taxon labels in

Fic. 1. Individual alignments of the ribosomal DNA sequences and the protein-coding

sequences were performed using ClustalW implemented in BioEdit version 7.0.9.0 (Hall

1999). Considering the triplet-based coding of the protein sequences, these sequences

Mortierellomycotina subphyl. nov. ... 355

were re-translated into their nucleic acid sequences using RevIrans (Wernersson &

Pedersen 2003, www.cbs.dtu.dk/services/RevTrans/). Ambiguously and divergently

aligned blocks were removed from the alignments prior to phylogenetic analysis, which

was finally conducted in individual and all possible gene combinations of concatenated

analyses. Two phylogenetic trees, which are representative for these analyses, are

shown in Fic. 1. The phylogram presented in Fic. 1A bases on a combined alignment

of the nuclear ribosomal DNA consisting of a total of 2103 characters (1518 and 585

characters for 18S and 28S rDNA, respectively). The phylogram presented in Fic. 1B was

computed based on an aligned supermatrix concatenating a total of 5382 characters of

the protein-coding genes (807; 1515; 1890 and 1170 characters for ACT, RPB1, RPB2 and

BTUB, respectively). For the trees shown in Fic. 1a and 1B, respectively, the combined

nucleotide data sets of the ribosomal DNA and the protein-genes were subjected to

MrBayes v3.1.2 (Huelsenbeck & Ronquist 2001, Ronquist & Huelsenbeck 2003). The

Bayesian inference was initiated from a random starting tree. Two independent runs

with four chains each were conducted for 2,500,000 generations with samples collected

every 2500th generation. After discarding the first 25% of the generated trees (burn-in)

the consensus tree was calculated using the halfcompat option. Posterior probabilities

(in percent) are indicated at the nodes and represent node confidence values. Additional

bootstrap analyses (Felsenstein 1985; 50% majority rule) with 100 and 1000 replicates of

maximum likelihood (RaxML; Stamatakis 2006; Stamatakis et al. 2008) and neighbor-

joining (Saitou & Nei 1987) searches, respectively, were used to calculate clade stability.

The amoeboid protist genus Nuclearia was chosen as outgroup taxon because it appears

to be the closest extant relative to the fungi (Liu et al. 2009). The probability of alternative

phylogenetic tree topologies constraining the phylogenetic relationship of the Mucorales

and Mortierellales unified within a common monophyletic clade was evaluated by

several independent statistical tests, such as (i) the Kishino-Hasegawa test (Kishino &

Hasegawa 1989), (ii) the Templeton test (Templeton 1983) and (iii) the winning-sites

test (Prager & Wilson 1988), based on the evaluation of the number of steps necessary to

find the most parsimonious tree as implemented within PAUP*v4.0b10 (Swofford 1998).

Additionally, the number of trees found after reaching a stationary phase (stationarity)

from the constraint topology in the Bayesian analyses were compared to the number of

trees without particular topological constraints using PAUP*v4.0b10.

IDENTIFICATION OF SEQUENCE SIGNATURES. Exonic nucleotide and protein

sequences of the genes encoding act, RPB1, and TEF were identified as suitable marker

genes for short unique sequence regions that differentiate the Mortierellales from the

Mucorales. The sequence fragments were subjected to BLAST (Altschul et al. 1990, 1997)

at NCBI in order to exclude identical sequence regions within the order Mucorales.

These discriminatory sequences were defined as signature sequences and are displayed

in TABLE 1.

Results & discussion

Phylogenetic tree reconstructions

In 2007, Hibbett et al. proposed a re-classification of the Fungi, which is now

widely accepted, abandoning the phylum Zygomycota which was reported as

356 ... Hoffmann, Voigt & Kirk

Feo al paises cae Saag Taare see whSTee Sap Pee yet ere esas eel? Soe aes se ee eee eee eee ewe S6SP6TOC VIDIIIN4AA “A

840}2 49 TN...

SLOADOOWWODOOWWNL DA LYMODL DOA DWMOOMLODLLMOOUWOOOLLOD IdMdMTIVdLd149aM9 IsH0UV' [] ASVAAWAIOR VNY

eee eee eee eee emote tees eens teen eee eee eee eeneee eee enzee ee eeeeeee ZOCLSTAV VIDHIIDIA

SC HS seen eae eee e eee ees L9@LSTAV vpydartjiod we

SO I es a SOZOELNT vuttssHnutu

PO A ns ea POTIELNA Byopur We

SCE Ho A seen ogee cece ees 6SZLSTAV vsodsopduinjys “We

SfON e REE Ceres Ay Se leah 7 esse yt: Bins SES. 8 reieian € coats xete: Behe oe ence ee 6 48-8 Tee ere SPORES haere ge xO) Bree Se) COTIELNG BUldy “We

Fo Ce ns see ogee ence ees SPTLSIAY ajosiaasunsy “J

POCO ne eo ns on a OOZLSTAY vIDIAvaIpLyNU “ED

DILILYO DDD LSD LL ODO LL DO LOWY OD DOVWOV LL SD OL SD YYOVYOLD SIdAdAdASMdNADAMMA

AOLALYOOOOLOOLLADSA LDA DGD VW OD OOVWOVLLOD OLOOVYOVYOLD elena ayaa Seay ee an eee

A(W/L/S) H4NADAMMA WOLOVA NOILVONOTA NOLLVISNVUL

Di CI te tin A i) ae > cin i a > is Cs TLIZ82(V tyfjom

BG BART OE s ies Roe RCE a: ARR G8 SSAC ENE BOR RCE eT de SRRCE ES Bop aCe ol METAR pe sete E eeeere 88: 88 OLILZST(V VIDIfIDIZ4aA “Ay

POO Co On Saget eee eee 69TL8zlV Mpydariod ‘Ww

SIE oon eC SE gece eee ees 6ETIELNT vuessynunu

SOI on sages ete eyes RETIEL AT vueissynunu

SINE Coe Saget eens LEZOSLOA NYOpUT “E

FG ey see ge eee e eee eee LOTLET(V vsodsopkumpy we

Sn Ct ce cc a settee eee eeeeee SESTIFINY Duidp vyjasansoyy

RAS AO AOS oc eee eee cece ee eee OSTLRT[V afosuansuns weniSuvsodsoqoT

Son CCCI son in CC Seog eee eee ee ees ROLLET[V VIDIADAIpYNU DYaIsUADD

DDD DI LIOWOVWO LL OO LOW LOS LSD OWS LYOL OO LYOVYOLYOL OWL WSLINASADMAWIIMWIA

W(L/S)L(0/S/N)dSa9

AQSEGOMOOVENHOLLAOLOVLADDHSDOOWOOLNSLOALYOYUVOLYSLOOWL wg (1/W) TI (d/o) WIA SOSNHSNOO ‘(.LOV) NILOV

[.€-.¢] SONaNDAS GIOV OIgTOAN [.¢ -.S] JONdNDdAS GIOV ONINV

‘sappsoon Jop1O ayy Jo Jaquiaur Aue ut juasard

JOU oe PUL sapyjjasaty Loy WY} 9Z119]DeIeY ATTeE.0ammboun sasuanbes amnyeusis 3y} [GON Je sayozeas [Sy Tq Aq poylsiaa sy ‘[adu pue

“AL “ure BuIpooua sauas WO] eyep pide WapPnu pue oUTUTe paUsi[e UO paseq poyuapt 10M soduonbeas omnjyeusis “(OTOZ YIeW

I Jo se) puyorkwmoyasaysoyy unAydqns oy} Jo erauas a[qepear [je Jo Yuequay ul sosuanbeas wos paatiap sosuanbas sinyeusis *[ ATAVI,

Mortierellomycotina subphyl. nov. ... 357

paraphyletic in several previous phylogenetic studies (e.g. Gehrig et al. 1996,

Tanabe et al. 2000). The hypothesis of a close relationship between Mortierellales

and Mucorales (classified as Mucoromycotina) was recently rejected by Liu et al.

(2009) and, moreover, the justification for a classification of the Mortierellales

into a separate supra-ordinal taxon distinct from the Mucoromycotina was

proposed by Voigt et al. (2009). In our single and combined phylogenetic

analyses both orders appear as distinct clades (Fic. 1a-B). Although, the

actual relationship between both clades is not resolved, none of the sequence

analyses supported a sister-clade relationship between Mucorales (clade @

and Mortierellales (clade ‘b’). Based on ribosomal DNA data, the Mortierellales

are more closely related to the Glomeromycota and the Dikarya (Ascomycota

+ Basidiomycota), but less related to the Mucorales (Fic. 1A). This relationship

was also shown by Liu et al. (2009), but here the Glomeromycota were not

included, using instead a phylogeny inferred from mitochondrially encoded

sequences. Analyses of the protein-coding sequences show a minimal sister

group relationship between Mucorales and Glomeromycota but fairly unresolved

relationships between all other groups, probably due to a lack of informative

characters and the phylogenetic signal of the marker genes for clade ‘b’ (Fic. 18).

Both phylogenies support the monophyly and also, therefore, the phylogenetic

distinctiveness, of both clades ‘@ and ‘v by bootstrap proportions (BP) of 100%.

Eight-locus phylogenies using RaxML analyses resulted in the coherence of the

Mortierellales supported by a BP of 77% grouping apart from the Mucorales (BP

90%; data not shown).

Rejecting the coherence of a Mortierellales-Mucorales clade

In single-locus analyses none of the eight loci supported the phylogenetic

coherence of the Mortierellales with the Mucorales (TABLE 2). Using 185,

288 rDNA and Brus the individual clades of Mortierellales and Mucorales

are supported by BP values of 100% each. But a coherent node for a unified

Mortierellales-Mucorales clades collapses due to a BP below 50%. Also, no

support of a monophyletic Mortierellales-Mucorales clade occurs if rpb1 and

rpb2 are used, with 92% and 100% BP for a monophyletic Mucorales clade

separated from the Mortierellales, respectively, for each individual gene. Since

there is currently only one mortierellalean nucleotide sequence available for

each of the phylogenetic markers RpB1 and RpB2, this order appears without

statistical support. For act and tef only the Mortierellales are well supported

(100% BP for TEF and 81% BP for act), there is also no statistical support

for a monophyletic origin of both orders. With the exception of arus, from

which no sequences were available for the Mortierellales, single-gene based

bootstrapping of all other loci suggests the incoherence of the Mucoromycotina

as a whole in its current circumscription, supporting the separation of the

Mortierellales from the Mucorales (TABLE 2).

358 ... Hoffmann, Voigt & Kirk

[sszzocda ‘96sr6za * “-] sunsaja saaduopodoyy

L- ‘plpz6oav © -] ossasdap sypydaouds 18

[sozzocda ‘gzsp6zdd * -] vjnosnqun saotuony

[eszzosda ‘rosbozOa ‘eesrroAv ~] ‘ds nisupuaoD

aus/SUOTININSGNS 1°O

[- = Tsgzssav ‘ZlosoEAv] ‘ds piunajonyy

[oszzoeda * ‘.90z9 1a ~] “ds saoduourdy

001

| LL

[Loerlodd ‘LIPLOOaY ‘E90791AV ~] snBuDsauodg saatuojnadney 001

[zgzzocdd ‘c6sh6zOa ‘690z91 AV *] anjasyno wniniUg

[szzzoeda “o6srozda ~ ‘oosrerad] avosnu nsoyrydowojug

[80br10dd ‘O6EPIOAT ‘SPBPPOAV ‘IP8Z8SAV] “ds saodmoliyD

[p8zzoeda ‘s6sh6ZOd “ILOZ9IAV ‘OLIL8ZLV] DIDIPIYLAA DjJasaysOpy

“SOILL8ZLV] DIDILAVAIPHINU DjJaIsSWuyy

[--* ‘ostzszry] appsuaasupy umsuvsodsogoT

[- = ‘eogroAv ‘SsIL8ziv] suagquinzap vsoydossiq

_Telozse WX ‘po06s6 WX ‘9LSzS6 WX ‘or09s6 Wx] Dssns9 psodsoanay

[ssoozt o'Sd Tysouady axqIse ‘ESPOT O'sn[aastMeuED IxqISe

“9

“66E76EIOO NX “LL109 D'1asimeuen IxqIS9] ,.Wadiu snypsiodsy 0OT SL

[880678100 WX ‘Szs8Z8100 WX ‘91 1000dV ‘E1€6€8100 WX] vasauis sisdoutsdod __ [001]

[Z9098LAW ‘79ZO00T PloeOs Dud [ysoussy

“SEI ZEEaV ‘L0601 O° Tasimousg 1xq3s9] 4 SNPDALISO SNJOANALT Or

[90s0100000°zAeueng “zrEooozT PIQYeos D'8d_eysouedy

“ILTZE88100 WX ‘LO00SZ O'S Lysousdy xqIs9] ,.10J091g DIMDIIDT 001

[Zpoo9T O'snidtesimeuan 3xqyse

‘TL spud qaysouedy ‘pe10z O’snjdlasimeuan axgise *] ,, smuvaajsaynyq Saadumordyd

[ezezel DEOU ‘e'PSEL0 DEOU ‘€'S0K00 DEOU ‘€ ZOOPT OEOUl ~SuZyssy sndozyy

[90%06 O'Tesimausn axquse ‘T's 1'Z1 139

“egcoz Oud Qpysoussy axqIs9 “610001 O'S¥ OWYsoUSsy 3xqIS9] ,, SAPIO[9UIIsII LOIN 01

[ozezoeda ‘16sr6zda ‘ssoz91AV ‘] snjDUOLOD snjogoIpIuED) 66

[scoszgdq ‘zosp6zOa ‘El ebL itd -] wnjgnd00 snuojspaog

= al oor

L ‘eserloda ‘.8esstav “] avassouw snuoj DoT

O01

[oszzoeda ‘rosrezda ‘ozerLifa ‘9Eszostv] ‘ds nuodsojjamog

[p6zz0edd ‘eo9p6zOd ‘ozE9ZEAYV *] SadIp.AD.UI SNLUO]D ool

aUsSUOHMNSGAS [°O

[oegezzOd ‘Lepoesdal snurody saoduomuidyd

[s6osrlAv ‘o9seredv] ‘ds piuwajony

[szszssAv ‘peszssAW] Djnosngdp saoduonjy

[zLeczOa ‘ozsse9AV] avosnu vsoyjydowojug

[le99rsAv ‘esc96zdVv] snjpuo.109 snjogoIpiuoD (OOT

[eosployeos ‘-] , snunaajsayng sarduordyg re

[o'¢8nuooiedns ‘9'¢8nuoor0dns] ,. sm2zysav sndozyy DOT LJ

[eproygeos ‘Z[poyyeos] ~saproyaurouts soonpy 96

[socezzOa “pesseoAv] sunsaja saoduojndoyy

[- ‘11o910av] vssaudap sipoydooudg

[ezzezzO ‘0s66za] anjasijno wnigpiUug

. O0T

[608220 ‘seszooav] suSupsauoog sarduojnoénsy 00T

[ool corv ‘ZhsLooa] sninuu saotuosdy oor

[esoorsAv “] ‘ds pisupuaoD OOT

[Zorel lav ‘bZbEl 1A] apusuansupay unjisuvsodsogoT

[861 LS1AV ‘prILSIAV] BDIsDAIpH]NU Vjjaisupy mT

[peLeczOd ‘LIO9TOGV] BIDIPLINIaA DYaLaysOPYy

[e8Izslav ‘€e1slav] suaqunaap vsoydossiq

[- ‘ezozzeda] unjjno20 snuojsp.1ng

[zoxexzda ‘zesseoAv] DuirBo.ia1ay nsodsojjainogy is

[eozezzOa ‘eesseoAv] avassou snuojy

=] oor

[szsezzdq ‘ocozzedal sazippansjur snuojy oor

[sSTI89AV ‘ILZ9POAV] Dssin49 D1odsoanan’ u

[z18szn ‘gesszx] 4asiu snypisuadsy OT

[poosoena ‘STOLS9AW] snmpadiso snjodna}g dor

[zoz1L004 “perployseos] 4oj001g DLDIODT

[ror rosy ‘166z6W] Basauto sisdoutadoy __|L6

Mortierellomycotina subphyl. nov. ... 359

TABLE 2. Bootstrap proportions of the Mucorales and Mortierellales nodes and

the combined Mucorales—Mortierellales clade in single-locus analyses.

NA-sequences 18S 28S ATUB BTUB RPBL RPB2 TEE ACT

Mucorales (Mu.) 100 100 78 100 92 100 Boat

Mortierellales (Mo.) 100 100 ni 100 nd nd 100 81

Mu. + Mo. 0 0 - 0 0 0 0 0

*NA = nucleic acid sequences coding for: 188/28S: small/large subunit nuclear ribosomal DNA; aTUB/BTUB:

alpha-/beta-tubulin; rpB1/2: RNA polymerase I] subunit 1 or 2; TEF: translation elongation factor lalpha;

ACT: actin. ni: not included; nd: not determined because there is only one member of the Mortierellales

included in the analysis.

Statistical tests for a monophyletic relationship between Mortierellales and Mucorales

The Ascomycota, Basidiomycota and Kickxellomycotina are well resolved and

show high clade stability support in both analyses presented in Fic. 1. However,

the relationships among those groups and the other groups are less clear-cut,

showing no significant support values. Statistical tests for an alternative topology

with a monophyletic Mucorales—Mortierellales clade allowed the exclusion of

that hypothesis of a biordinal monophyletic relationship, which justifies their

classification into a common subphylum. All tests rejected the phylogenetic

alliance between Mucorales and Mortiereilales with P<0.0001 under the

assumption of the null hypothesis. In Bayesian inference analyses only 23 trees

out of 2,002 were found after stationarity showing the topological constraint

unifying both orders using the ribosomal DNA data set and no tree was found

based on the combined protein data set. Therefore, it can be concluded that the

probability of a monophyly for the Mucorales—Mortierellales clade is 1.15% for

the ribosomal DNA data set and zero for the protein data set.

Identification of signature sequences

Based on Act, TEFand RPB1, consensus amino and nucleic acid sequences were

identified which represent diagnostic signatures unique for the Mortierellales

(TABLE 1). These are the protein sequence YLM[K/R]IL[M/L]ERGYSF[[N/s/Q]T[s/

T]A with its corresponding nucleic acid 5°-TAC CTS ATG ARG ATY CTS MTG

GAG CGH GGY TAC TCY TTC HMB ACC WCB GcyY-3° for act, VKKVGYNPK[s/T/

A]v[p/A]FV PIs with 5°-GTC AAG AAG GTC GGT TAC AAC CCC AAG DCY GTY SCY

Ficure 1. Bayesian inference analysis displaying the relationship between the orders Mucorales and

Mortierellales. The phylogenetic reconstruction is based on A: a total of 2103 aligned nucleotide

characters from the nuclear small and large subunit ribosomal DNA (1518 and 585 characters of the

18S and 28S rDNA, respectively) and B: a total of 5382 nucleotide characters from aligned protein-

coding genes (807; 1515; 1890 and 1170 characters of AcT, RPB1, RPB2 and BTUB, respectively), each

from 27 taxa. The protistan genus Nuclearia was chosen as outgroup taxon. Posterior probabilities

are indicated as clade stability support values above the branches. Clade ‘a represents the subphylum

Mucoromycotina and clade ‘b’ is represented by the Mortierellomycotina.

360 ... Hoffmann, Voigt & Kirk

TTC GTC ccc ATY TCY-3° for TEF and GWEGFLPTPAILKPKPL with 5°-GGT TGG

GAR GGW TTC CTR CCW ACY CCT GCW ATY CTM AAG CCC AAG CCyY CTS-3° for

RpPB1 (TABLE 1). These signatures based upon sequences currently available in

GenBank (as of 1% of March, 2010).

Identification of micromorphological traits

Typical micromorphological structures are shown in Fic, 2. ‘The

Mucorales develop a columella, a sterile swelling of the sporangiophore apex

protruding into the multi-spored sporangium. Conversely, the Mortierellales

lack this structure, suggesting that the columella is a synapomorphy of the

Mucoromycotina. The vegetative hyphae of the Mucorales are coenocytic, with

septation only rarely occurring below the columella within the sporangiophore.

In contrast, the Mortierellales develop irregularly septate vegetative hyphae and,

in addition, septa also appear among the hyphae lacking generative structures

and sporangiophores. Also, the sporangiophores are typically subulate, being

broad at the base and tapering towards the apex, whereas the sporangiophore

diameters in the Mucorales remain more-or-less constant (Benny et al. 2001).

Rhizoids are more pronounced and occur more frequently in the Mucorales

than among the Mortierellales; giant cells are absent in the Mortierellales.

Taxonomic description

Mortierellomycotina Kerst. Hoffm., K. Voigt & P.M. Kirk, subphylum nov.

INDEX FUNGORUM IF 539369

Mycelium hypharum bifurcate ramosarum anastomosantium compositum. Sporangiophora

basin inflata, apicem attenuata, erecta, non ramosa vel ramosa, ab initio non-septata,

sed irregulariter septata ubi plene creta. Sporangia sphaerica, unispora vel mutltispora;

columella carens. Sporangiosporae globosae usque ad ellipsoideas, vel irregulares, muris

laevibus ornamentatisve. Stylosporae, rhizoides et chlamydosporae interdum praesentes.

Zygosporae muris crassis; zygosporangium laeve; suspensores sine appendicibus.

Typus: Mortierella Coem. 1863

Zygomycota, incertae sedis. Mycelium with anastomosing hyphae, dichotomously

branching, bearing stylospores. Hyphae sporangiferous, sporangiophores

basally inflated and elongating towards the sporangiophore apex, erect,

coenocytic initially, but irregularily septated at maturity. Asexual reproduction

via sporangia and sporangiola. Sporangia sphaerical, multi-spored; columella

absent. Ramifications gracilous, primarily horizontally expanding, erecting

hyphae sometimes terminate with sporangiola. Spores globose to ellipsoid or

irregular, smooth or ornamented. Rhizoids only occasional. Giant cells absent.

Zygospores naked.

EXEMPLAR GENERA: Mortierella, Dissophora, Modicella, Lobosporangium,

Gamsiella, Aquamortierella.

Mortierellomycotina subphy]. nov. ... 361

Ficure 2. Micromorphological characteristics of prominent members of the subphyla

Mucoromycotina and Mortierellomycotina. a) Sporangiophore of Mortierella sp. lacking a columella

(white arrows). b) Tapering sporangiophore with rhizoids of Mortierella sp. Rejuvenating towards

the sporangiophore apex is characteristic for the Mortierellomycotina. c+d) Non-tapering

sporangiophores with rhizoids of Rhizopus/Rhizomucor sp. with sporangia. After spore release a

well-developed columella remains (black arrows).

Acknowledgements

The authorsthank Martin Eckart for assistancein theestablishment ofacomprehensive

sequence database comprising basal fungi and allied taxa. We also express our gratitude

to John David (Royal Horticultural Society, Wisley, UK) for his help with the Latin

diagnosis. Appreciation is extended to Dr. Hsiao-Man Ho (National Taipei University

of Education, Taiwan), Sybren de Hoog (CBS-Knaw Fungal Diversity Centre, Utrecht,

The Netherlands), Gerald L. Benny (University of Florida, Gainesville), and Dr. Shaun

Pennycook for critical review of the manuscript and valuable remarks. This work was

financially supported by the Deutsche Forschungsgemeinschaft (VO772/9-1).

Literature cited

Altschul SE, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool.

Journal of Molecular Biology 215: 403-410. doi:10.1016/S0022-2836(05)80360-2

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped

BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids

Research 25: 3389-3402. doi:10.1093/nar/25.17.3389

362 ... Hoffmann, Voigt & Kirk

Benny GL, Humber RA, Morton JB. 2001. Zygomycota: Zygomycetes. 113-146, in DJ McLaughlin et

al. (eds.), The Mycota Vol. 7A: Systematics and Evolution. Springer Verlag, Berlin, Germany.

Cavalier-Smith T. 1998. A revised six-kingdom system of life. Biological Reviews, Cambridge 73:

203-266. doi:10.1017/S0006323 198005 167

Coemans E. 1863. Quelques hyphomycétes nouveaux. — Ire. — I. Mortierella polycephala et II.

Martensella pectinata. Bulletin de Académie Royale des Sciences, des Lettres et des Beaux-Arts

de Belgique, Sér. 2, 15: 536-544.

de Hoog GS, Guarro J, Gené J, Figueras MJ (eds). 2009. Atlas of clinical fungi, 3rd ed. Centraalbureau

voor Schimmelcultures, Utrecht, The Netherlands.

Fischer A. 1892. Phycomycetes. Dr. L. Rabenhorst’s Kryptogamen-Flora von Deutschland,

Oesterreich und der Schweiz. Zweite Auflage, Band I — Pilze, Abt IV. Eduard Kummer, Leipzig

(Germany). 505 pp.

Felsenstein J. 1985. Confidence limits of phylogenies: An approach using the bootstrap. Evolution

39: 783-791. doi:10.2307/2408678

Gehrig H, SchiiBler A, Kluge M. 1996. Geosiphon pyriforme, a fungus forming endocytobiosis with

the Nostoc (Cyanobacteria), is an ancestral member of the Glomales: Evidence by SSU rDNA

analysis. Journal of Molecular Evolution 43: 71-81. doi:10.1007/BF02352301

Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program

for Windows 95/98/NT. Nucleic Acid Symposium Series 41: 95-98.

Hibbett DS, Binder M, Bischoff JE, Blackwell M, Cannon PF, Eriksson OE, Huhndorf S, James

T, Kirk PM, Licking R, Lumbsch H, Lutzoni F, Matheny PB, McLaughlin DJ, Powell MJ,

Redhead S, Schoch CL, Spatafora JW, Stalpers JA, Vilgalys R, Aime MC, Aptroot A, Bauer

R, Begerow D, Benny GL, Castlebury LA, Crous PW, Dai YC, Gams W, Geiser DM, Griffith

GW, Gueidan C, Hawksworth DL, Hestmark G, Hosaka K, Humber RA, Hyde KD, Ironside

JE, Kéljalg U, Kurtzman CP, Larsson KH, Lichtwardt R, Longcore J, Miadlikowska J, Miller A,

Moncalvo JM, Mozley-Standridge S$, Oberwinkler F, Parmasto E, Reeb V, Rogers JD, Roux C,

Ryvarden L, Sampaio JP, Schiissler A, Sugiyama J, Thorn RG, Tibell L, Untereiner WA, Walker

C, Wang Z, Weir A, Weiss M, White MM, Winka K, Yao YJ, Zhang N. 2007. A higher-level

phylogenetic classification of the Fungi. Mycological Research 111: 509-547. doi:10.1016/

j-mycres.2007.03.004

Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17:

754-755. doi:10.1093/bioinformatics/17.8.754

James TY, Kauff F Schoch CL, Matheny PB, Hofstetter V, Cox C, Celio G, Gueidan C, Fraker E,

Miadlikowska, J, Lumbsch HT, Rauhut A, Reeb V, Arnold EA, Amtoft A, Stajich JE, Hosaka K,

Sung G-H, Johnson D, O’Rourke B, Crockett M, Binder M, Curtis JM, Slot JC, Wang Z, Wilson

AW, Schii®ler A, Longcore JE, O’Donnell K, Mozley-Standridge S, Porter D, Letcher PM,

Powell MJ, Taylor JW, White MM, Griffith GW, Davies DR, Humber RA, Morton J, Sugiyama

J, Rossman AY, Rogers JD, Pfister DH, Hewitt D, Hansen K, Hambleton S, Shoemaker RA,

Kohlmeyer J, Volkmann-Kohlmeyer B, Spotts RA, Serdani M, Crous PW, Hughes KW, Matsuura

K, Langer E, Langer G, Untereiner WA, Lacking R, Badel B, Geiser DM, Aptroot A, Diederich

P, Schmitt I, Schultz M, Yahr R, Hibbett DS, Lutzoni F, McLaughlin D, Spatafora J, Vilgalys R.

2006. Reconstructing the early evolution of the fungi using a six-gene phylogeny. Nature 443:

818-822. doi:10.1038/nature05110

Kishino H, Hasegawa M. 1989. Evaluation of the maximum likelihood estimate of the evolutionary

tree topologies from DNA sequence data, and the branching order in hominoidea. Journal of

Molecular Evolution 29: 170-179. doi:10.1007/BF02100115

Liu Y, Steenkamp ET, Brinkmann H, Forget L, Philippe H, Lang BF. 2009. Phylogenomic analyses

predict sistergroup relationship of Nucleariids and Fungi and paraphyly of Zygomycetes with

significant support. BMC Evolutionary Biology 9: 272. doi:10.1186/1471-2148-9-272

Mortierellomycotina subphyl. nov. ... 363

Prager EM, Wilson AC. 1988. Ancient origin of lactalbumin from isozyme: analysis of DNA and

amino acid sequences. Journal of Molecular Evolution 27: 326-335. doi:10.1007/BF02101195

Ronquist F, Huelsenbeck JP. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed

models. Bioinformatics 19: 1572-1574. doi:10.1093/bioinformatics/btg180

Saitou N, Nei M. 1987. The neighbor-joining method: anew method for reconstructing phylogenetic

trees. Molecular Biology and Evolution 4: 406-425.

Swofford DL. 1998. PAUP*: Phylogenetic Analysis using Parsimony (*and Other Methods). Version

4., Sinauer Associates, Sunderland, MA.

Stamatakis A. 2006. RAxML-VI-HPC: Maximum Likelihood-based phylogenetic analyses

with thousands of taxa and mixed models. Bioinformatics 22(21): 2688-2690. doi:10.1093/

bioinformatics/btl446

Stamatakis A, Hoover P, Rougemont J. 2008. A fast bootstrapping algorithm for the RAxML Web-

Servers. Systematic Biology 57: 758-771. doi:10.1080/10635 150802429642

Tanabe Y, O’Donnell K, Saikawa M, Sugiyama J. 2000. Molecular phylogeny of parasitic Zygomycota

(Dimargaritales, Zoopagales) based on nuclear small subunit ribosomal DNA sequences.

Molecular Phylogenetics and Evolution 16: 253-262. doi:10.1006/mpev.2000.0775

Tanabe Y, Saikawa M, Watanabe MM, Sugiyama J. 2004. Molecular phylogeny of Zygomycota

based on EF-1la and RPB1 sequences: limitations and utility of alternative markers to rDNA.

Molecular Phylogenetics and Evolution 30: 438-449. doi:10.1016/S1055-7903(03)00185-4

Templeton AR. 1983. Phylogenetic inference from restriction endonuclease cleavage site map

with particular reference to the evolution of humans and the apes. Evolution 37: 221-244.

doi:10.2307/2408332

Voigt K, Hoffmann K, Einax E, Eckart M, Papp T, Vagvélgyi C, Olsson L. 2009. Revision of the

family structure of the Mucorales (Zygomycetes) based on multigene-genealogies. 313-332, in

Y Gherbawy et al. (eds.), Current Advances in Molecular Mycology. Nova Science Publishers,

Inc.

Wernersson R, Pedersen AG. 2003. RevTrans — Constructing alignments of coding DNA from

aligned amino acid sequences. Nucleic Acids Research 31: 3537-3539. doi:10.1093/nar/

gkg609

MYCOTAXON

Volume 115, pp. 365-368 January-March 2011

DOT: 10.5248/115.365

Three species excluded from Melanopsamma (Ascomycetes)

You-ZHI WANG

Institute of Microbiology, Chinese Academy of Sciences, Beijing 100101, China

Tibet Institute of Plateau Biology, Lhasa 850008, China

CORRESPONDENCE TO: yzwang@im.ac.cn

AsstTract— Melanopsamma is a unitunicate ascomycete genus. However, examinations of

the holotypes of M. aggregata, M. merrillii, and M. pomiformis var. monosticha has revealed

that all were bitunicate. They are synonyms of Astrosphaeriella africana, Didymosphaeria

dimastospora, and Keissleriella sambucina, respectively.

Key worps— morphology, mycology, taxonomy

Introduction

Melanopsamma Niessl ex Sacc. is a unitunicate ascomycete genus. As

currently recognized, its main characters are superficial ascomata that are

ostiolate, glabrous, and collabent when mature; reddish brown, 2- or 3-layered

peridia; unitunicate, cylindrical, paraphysate, 8-spored asci; and ellipsoidal or

fusiform, hyaline, 1-septate ascospores.

Of the approximately 110 Melanopsamma species names listed in Index

Fungorum (2010), only 41 species are accepted in the genus (Kirk et al. 2008).

To date, nine taxa have been transferred to other genera (Index Fungorum

2010), leaving about 80 names that are either synonyms or probably do not

belong in the genus.

Most of the excluded species are bitunicate ascomycetes. The concept

of bitunicate/unitunicate asci was not introduced until 1951 (Luttrell 1951),

Before 1951 Melanopsamma included bitunicate taxa, which were otherwise

very similar to unitunicate Melanopsamma species. ‘The same situation occurred

also with the unitunicate genus Amphisphaeria (Wang et al. 2004), in which

earlier authors described many bitunicate taxa. There is no world monographic

study on Melanopsamma.

In this paper, we exclude three bitunicate Melanopsamma species from the

genus and reallocate them based on re-examination of their type specimens.

366 ... Wang

Materials & methods

Type specimens were borrowed from BPI, YAM and W. Dried material was

rehydrated in water and fruiting structures were observed using a Zeiss 2000-C dissecting

microscope. Slides of ascospores, asci, and sections of ascomata mounted in water were

examined, photographed, and measured using a Zeiss Axioplan II image microscope.

Taxonomy

Astrosphaeriella africana D. Hawksw., Sydowia 38: 116.1986 [‘1985’]. Fas 1-2.

= Melanopsamma aggregata I. Hino & Katum., Bull. Fac. Agric. Yamaguti Univ. 6: 53.1955.

SPECIMEN EXAMINED: Japan, Sakaedani, Tokuyama, on dead stems of Phyllostachys

bambusoides Siebold & Zucc. (Poaceae), 28 November 1954, I. Hino, YAM 20365,

holotype of Melanopsamma aggregata.

Ascomata immersed, erumpent, arising singly in the substrate, 650-900 um

diam., hemispherical, black, base applanate, with a central papilla (Fic. 1). Asci

bitunicate, 135-160 x 12-17 um, 8-spored, cylindrical. Ascospores 50-57 x

5.5-6.5 um, 2-3-seriate, fusiform, pale yellowish brown, 1-septate, constricted

at the septum, with longitudinal wall striations (Fic. 2).

Didymosphaeria dimastospora Sousa da Camara, Agron. lusit. 13: 123. 1951.

Fics 3-4.

= Melanopsamma merrillii H.S. Yates, Philipp. Journ. Sc. 12: 376. 1917.

SPECIMEN EXAMINED: Philippines, Alabat Island, substrate undetermined, 21 December

1916, E.D. Merrill 10554, BPI 612151, holotype of Melanopsamma merrillii.

Ascomata bitunicate, 400-600 um diam., globose, erumpent (Fic. 3). Ostiole

raised, lateral. Pseudoparaphyses filaments 1-1.5 um wide. Asci 100-135 x

9-12 um. Ascospores ellipsoidal, grey, 17-22 x 6-9 um, often widened at the

septum, 1-septate, cells equal, without ornamentation, but sometimes with

brownish gel at the poles (Fic. 4).

Notes: Didymosphaeria Fuckel was monographed by Aptroot (1995), who

accepted seven species out of 550 named taxa. The excluded taxa belong to

other similar genera, which are bitunicate or unitunicate ascomycetes.

Keissleriella sambucina (Rehm) Hohn., Sitzungsber. Kaiserl. Akad. Wiss.,

Math.-Naturwiss. K1., Abt. 1, 128: 582. 1919. Fics 5-6.

= Melanopsamma pomiformis var. monosticha Keissl., Beih.

Bot. Centrlbl., Abt. IT, 29: 400. 1912.

SPECIMENS EXAMINED: Slovenia, Carniola, on dry branch of Sorbus aria (L.) Crantz

(Rosaceae), July 1908, leg. & det. K.V. Keissler, W 1908/9129, holotype of Melanopsamma

pomiformis var. monosticha. Austria, Ybbsitz, on Cydonia japonica Pers. (Rosaceae),

March 1909, W 1939/0113, [as Melanopsamma amphisphaeria Schulzer & Sacc.]

Ascomata subglobose, semi-immersed to superficial, gregarious to crowded,

black, 300-500 um in diam., 300-450 um in height (Fic. 5). Ostiole papillate

Melanopsamma exclusions ... 367

Ficures 1-6. Fics 1-2: Astrosphaeriella africana (from holotype of Melanopsamma aggregata):

1—habit of ascomata on host surface; 2—ascospores. Fics 3-4. Didymosphaeria dimastospora

(from holotype of Melanopsamma merrillii): 3—habit of ascomata on host surface; 4—intact

ascus, ascospores. Fics 5-6. Keissleriella sambucina (from holotype of Melanopsamma

pomiformis var. monosticha): 5—habit of ascomata on host surface; 6—ascus, ascospores.

368 ... Wang

with short, blackish brown setae, not collabent. Pseudoparaphyses trabeculate.

Asci bitunicate, cylindrical, 8-spored, 110-140 x 11-13 um (Fic. 6). Ascospores

16-20 x 6-8 um, hyaline, ellipsoidal, asymmetrical with upper hemispore

wider and more obtuse than lower, 1-septate, wall smooth, constricted at the

septum (Fig. 6).

Key to the genera

la. Ascomata collabent when mature, asci unitunicate ............. Melanopsamma

1b. Ascomata not collabent, asci bitunicate ......0 0.0 ee ee ce ec eee eee 2

2a. Ascomata gregarious to crowded, ascospores ellipsoidal or fusiform,

L=miultizseptaterg. SPisesannodl cesaeitis tis) cesanee mtarterqxat elas ee ete Keissleriella

2b. Ascomata scattered 26... ccc een enn nes 3

3a. Ascospores 1-seriate, ellipsoidal, 1-septate ..................0.. Didymosphaeria

3b. Ascospores 2-3-seriate, elongate-fusiform, 1-5-septate ........... Astrosphaeriella

Acknowledgments

Drs Eric McKenzie and André Aptroot are deeply thanked for pre-submission

reviews. The author would also like to thank the curator of herbarium BPI, W, YAM,

for loan of specimens. Thanks are extended to Dr Shaun Pennycook for nomenclatural

review. This work was supported by the Funds of the Knowledge Innovation Program of

the Chinese Academy of Sciences (KSCX2-YW-Z-004).

Literature cited

Aptroot A. 1995. A monograph of Didymosphaeria. Studies in Mycology 37: 1-160.

Index Fungorum. 2010. http://www.indexfungorum.org/Names/NA MES. ASP.

Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth and Bisby’s dictionary of the fungi.

Tenth edition. CAB International. UK.

Luttrell ES. 1951. Taxonomy of the Pyrenomycetes. University of Missouri Studies 3: 1-120.

Wang YZ, Aptroot A, Hyde KD. 2004. Revision of the genus Amphisphaeria. Hong Kong, Fungal

Diversity Press. 168 p.

MYCOTAXON

Volume 115, pp. 369-373 January-March 2011

DOT: 10.5248/115.369

Tubakia seoraksanensis, a new species from Korea

Hyg YOUNG YUN’ & Amy Y. RossMAN

Systematic Mycology & Microbiology Laboratory, USDA-ARS,

Rm. 246, BOIOA, 10300 Baltimore Avenue, Beltsville, MD 20705, USA

* CORRESPONDENCE TO: rustfungi@gmail.com

AsstTract — An unknown species of Tubakia was collected recently from Quercus mongolica

on Seoraksan Mountain, GangWon Province, in Korea. This species was characterized with

cultural, ITS region sequence, and morphological data. After comparison with known species

of Tubakia, this species is here described as Tubakia seoraksanensis, sp. nov.

Key worps — Ascomycota, Diaporthales, Dicarpella, forest pathogen, Sordariomycetes

Introduction

‘The anamorphic genus Tubakia B. Sutton (Diaporthales, Ascomycota) causes

leaf spot diseases on Castanea, Quercus, and various other trees and shrubs

primarily in the Fagaceae (Sinclair et al. 2005). Currently, five species are

recognized in Tubakia, namely I! castanopsidis (T. Yokoy. & Tubaki) B. Sutton,

T. dryina (Sacc.) B. Sutton, T: japonica (Sacc.) B. Sutton, T) rubra (T. Yokoy. &

Tubaki) B. Sutton, and T. subglobosa (T. Yokoy. & Tubaki) B. Sutton (Belisario

1991, Limder & Cash 1945, Sutton 1973, Yokoyama & Tubaki 1971). Tubakia

has been associated with the teleomorphic genus Dicarpella Syd. & P. Syd.

with the single species D. dryina Belisario & M.E. Barr connected to T. dryina

(Belisario 1991).

In Korea, three species of Tubakia have been reported: T. japonica on

Castanea crenata Siebold & Zucc., Quercus acutissima Carruth., and Q. aliena

Blume; I) rubra on Q. serrata Murray; and an undescribed Tubakia sp. on

Q. rubra L. (Cho et al. 2004, Lee et al. 1991,). In August 2009, specimens of

Tubakia were collected on leaves of Quercus mongolica Fisch. ex Ledeb.

(Mongolian oak) in Seoraksan Mountain, Gangwon Province, Korea. Quercus

mongolica is a mountain tree that grows on ridgelines in Korea and is resistant

to drought and wind conditions (Lee 1997). We determined that the specimens

represented a previously undescribed species of Tubakia, which we then

370 ... Yun & Rossman

analyzed using cultural, molecular, and morphological methods and compared

with known species. The new species is described below.

Materials & methods

Fungal Isolations

Diseased leaves of Quercus mongolica were collected from nature. Isolates from

fructifications were made from two different areas on the leaves, namely necrotic areas

surrounding veins and leaf spots. Cultures were grown on malt extract agar (MEA,

1.5% malt extract and 2.0% agar) at 25°C in the dark. Specimens were deposited at

the U.S. National Fungus Collections, Beltsville, Maryland, USA (BPI 880798 and BPI

880799) and cultures were deposited in CBS Fungal Biodiversity Centre, Utrecht, The

Netherlands (CBS 127490, CBS 127491, CBS 127492, and CBS 127493).

Morphological examination

Observations of microscopic structures were made from material mounted in

distilled water and measured using a compound light microscope (Axiophot, Zeiss,

Germany). Colors of cultures were described using Munsell soil color charts (Macbeth

2000).

DNA extraction, PCR, sequencing, analysis of sequence data

DNA was isolated from cultures on MYEA (2% malt extract, 0.2% yeast extract, and

1.5% agar) grown for about 10 to 14 days at room temperature. Mycelium was used for

DNA extraction using PrepMan” Ultra reagent following the manufacturer's instructions

(Applied Biosystems, Foster City, CA). The internal transcribed spacer regions 1 and 2

and the 5.8 S rDNA hereafter referred to as ITS were amplified using the primer pair,

ITS-1F and ITS4 (Gardes & Bruns 1993). Amplification of the ITS region was achieved

with initial denaturation at 85°C 2 min; 35 cycles, each consisting of denaturation at

94°C for 1 min 35 sec, annealing at 49°C for 1 min, and extension at 72°C for 1 min;

and final extension at 72°C for 15 min. PCR products were purified using QIAquick

PCR purification kit (Qiagen Inc., Valencia, CA, USA) following the manufacturer’s

instructions. Automated sequencing was performed at the Iowa State University DNA

Sequencing and Synthesis Facility (Ames, IA). Reactions were set up using Applied

Biosytems (Foster City, CA) Prism BigDye Terminator v3.1 cycle sequencing kit with

AmpliTaq DNA polymerase, FS and analyzed on an Applied Biosystems 3730 DNA

analyzer.

Sequences were deposited at GenBank sequence database (HM991734, HM991735,

HM991736, and HM991737). A GenBank Blast search was performed with the resulting

sequence data and a comparison was made to existing Tubakia ITS region sequences. All

sequences of Tubakia species were aligned and compared using the jPHYDIT program

Jeon et al. 2005).

Results: Analysis of sequence data & taxonomy

The ITS sequences from each of the four isolates were identical. The GenBank Blast

search revealed the closest identifiable match as Dicarpella dryina (= Tubakia dryina,

accession no. AY853242, culture CBS 115970) with 94% maximum identity. Additional

Tubakia seoraksanensis sp. nov. (Korea) ... 37 1

comparison with sequences of all other Tubakia species revealed a close relationship

with Tubakia japonica (unpublished data). In the ITS region alignment produced in

PHYDIT, sequences of Tubakia seoraksanensis were 98% similar to T: japonica and

97.8% similar to D. dryina (accession no. AY853242) (unpublished data).

Tubakia seoraksanensis H.Y. Yun, sp. nov. Fic. 1

MycoBank MB 519212

Coloniis in MEA similis Tubakiae japonicae coloratis, sed conidiis minoribus, 13-25 um

x 10-15 ym, differt.

Type: Korea, Gangwon, Seoraksan National Park, Seorak-dong, Sokcho-si, Gangwon-

do, on living leaves of Quercus mongolica, 31.VIII.2009, coll. Hye Young Yun. Holotype,

BPI 880799 (cultures CBS 127490, ITS GenBank HM991734; CBS 127491, ITS GenBank

HM991735); Isotype, BPI 880798 (cultures CBS 127492, ITS GenBank HM991736; CBS

127493, ITS GenBank HM991737).

EryMo.oey: referring to the type locality.

LEAF spots epiphyllous, occasionally amphigenous, 2-10 mm diam., globose

to broadly ellipsoidal on blade, at times necrotic areas ellipsoidal to fusiform,

extending along midrib or veins, pale brown, margin regular or irregular in

shape, dark brown; typically discrete, may become confluent. CoNIDIOMATA

epiphyllous, occasionally amphigenous, frequently but not always associated

with spots, scattered to gregarious, sometimes confluent, especially near veins,

superficial, easily removed from leaf surface, brown to dark brown, scutellate,

each attached to leaf by a central columella, circular or somewhat irregularly

subcircular as viewed from above, more or less plane as viewed from side.

SCUTELLA 90-160 x 90-130 tum, membranous, composed of thick-walled, pale

brown to brown, 4-6 um diam., septate hyphae radiating, typically bifurcating

up to three times from a central disc that consists of a single hyaline cell

towards margin, acute and cornute at margin that is fringed and unattached to

substrate. CONIDIOGENOUS CELLS formed on underside of scutella, radiating

downward and towards margin, 14-22 x 3-5 um, cylindrical or slightly clavate

to fusiform, narrowing to a thin point at neck, pale brown to hyaline. CoNIDIA

13-25 x 10-15 um (Q = 1.15-1.56), acrogenous, blastic, subglobose, broadly

ellipsoid to ellipsoid, hyaline, becoming pale yellowish brown, walls smooth,

thickening in age, with a prominent frill at base. Microconidia unknown.

IN CULTURE: Colony (after 10 days on MEA at 25°C in the dark) 32-44 mm

diam., low velutinous to fuzzy, wrinkled, margin with uneven growth, whitish

to pale yellow (8/1-2), reverse wrinkled, center darker, becoming progressively

paler towards margin, olive brown, light olive brown to yellow (4/3, 5/6, 8/6),

margin white (8/1), without sporulation. Mycelium branching, septate, 3.2-4.8

um diam., hyaline or slightly brownish in mass, some hyphae forming short

coils on side branches.

372 ... Yun & Rossman

Fic. 1. Tubakia seoraksanensis (a—-p, holotype; E-E, CBS 127491). a. Necrotic leaf spot and

conidiomata along leaf midrib of Quercus mongolica. B. Scutellum and conidia by light microscopy

(LM). c. Scutella and conidia by LM. p. Conidia and conidiophores by LM. £. Colony on MEA.

F. Colony reverse on MEA. (Scale bars: a = 2mm, B—c = 50 um, d = 20 um)

HaBITaT & DisTRIBUTION — Known only from Quercus mongolica at the type

locality in Seoraksan National Park, Republic of Korea.

COMMENTS — Tubakia seoraksanensis can be distinguished from all known

species of Tubakia except T. japonica by its larger conidia. In culture on MEA,

the colony color of T. seoraksanensis resembles that of T’ japonica but is readily

distinguished from the other species as illustrated in plate 2 of Yokoyama &

Tubaki (1971).

Conidial size is the primary morphological difference distinguishing

T. japonica and T! seoraksanensis, with T. japonica producing conidia that

are much larger (40-55 x 35-45 um) compared to those of T! seoraksanensis

(13-25 x 10-15 um). Yokoyama & Tubaki (1971) noted that the sizes of scutella,

columellae, and conidia and hosts are useful in differentiating species. As with

Jones & Holcomb (1978), Glawe & Crane (1987), and Taylor (2001), we found

columellar characters untenable due to difficulty in observing these fragile

structures and unreliable historical data.

Isolates of T. seoraksanensis from the different parts of the leaves (e.g., leaf

blades or surrounding veins) produced identical sequences and conidiomatal

morphology. However, necrotic areas surrounding veins tended to extend some

distance along veins, be more irregular in shape, and were associated with a

greater number of epiphyllous and hypophyllous conidiomata. ‘The leaf spots

on the leaf blades tended to be more confined in size, more regularly circular

Tubakia seoraksanensis sp. nov. (Korea) ... 373

in shape, and associated with a smaller number of epiphyllous and especially

hypophyllous conidiomata.

Acknowledgments

We would like to thank several people at Iowa State University including Tom

Harrington and Dave Volkers for kind assistance, Doug McNew for technical support,

and Gary Polking for support at the DNA Sequencing and Synthesis Facility. We would

like to express thanks to our reviewers, Svetoslav Bobev and Luis C. Mejia.

Literature cited

Belisario A. 1991. Dicarpella dryina sp. nov., teleomorph of Tubakia dryina. Mycotaxon 41:

147-155.

Cho WD, Shin HD (eds). 2004. List of plant diseases in Korea, Fourth Edition. Korean Society of

Plant Pathology.

Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity of basidiomycetes: application

to the identification of mycorrhizae and rusts. Mol. Ecol. 2: 113-118. doi:10.1111/j.1365-

294X.1993.tb00005.x

Glawe DA, Crane JL. 1987. Illinois fungi XIII. Tubakia dryina. Mycotaxon. 29: 101-112.

Jeon YS, Chung H, Park S, Hur I, Lee JH, Chun J. 2005. jPHYDIT: a JAVA-based integrated

environment for molecular phylogeny of ribosomal RNA sequences. Bioinformatics 21:

3171-3173. doi:10.1093/bioinformatics/bti463

Jones JP, Holcomb GE. 1978. Conidium ontogeny and cytology of Tubakia dryina from Louisiana

hardwoods. Mycologia 70: 1212-1216. doi:10.2307/3759319

Lee KJ. 1997. Tree physiology. Seoul National University Publishing.

Lee YH, Cho WD, Kim WK, Jin KS, Lee EJ. 1991. Report on host-unrecorded diseases identified

from economical crops in Korea. Res. Rep. Rural Develop. Admin. 33: 15-19.

Limber DP, Cash EK. 1945. Actinopelte dryina. Mycologia 37: 129-137. doi:10.2307/3754856

Macbeth G. 2000. Munsell Soil Color Charts. Gretag Macbeth, New Windsor, NY.

Sinclair WA, Lyon HH, Johnson WT. 2005. Diseases of trees and shrubs, Second edition. Comstock

Publishing, USA.

Sutton BC. 1973. Tubakia nom. nov. Trans. Brit. Mycol. Soc. 60: 164-165. doi:10.1016/S0007-

1536(73)80077-4

Taylor J. 2001. Pycnothyrium ultrastructure in Tubakia dryina. Mycol. Res. 105: 119-121.

doi: 10.1017/S0953756200003099

Yokoyama T, Tubaki K. 1971. Cultural and taxonomical studies on the genus Actinopelte. Inst.

Fermentation, Osaka, Res. Comm. 5: 1-77. doi:10.1007/BF0205 1502

MYCOTAXON

Volume 115, pp. 375-382 January-March 2011

DOT: 10.5248/115.375

Two new species of Hymenochaete (Hymenochaetales) from China

SHUANG-Hu!1 HeE* & Har-JIAo LI

Institute of Microbiology, RO. Box 61, Beijing Forestry University,

Beijing 100083, China

* CORRESPONDENCE TO: heshh1981@yahoo.cn

ABSTRACT — Two new species, Hymenochaete megaspora and Hymenochaete acerosa are

described from Xizang Autonomous Region (Tibet), China. Hymenochaete megaspora

distinguishes from other species by its large basidiospores and heavily encrusted setae; while

Hymenochaete acerosa is unique for its acerose setae, loosely interwoven hyphae and relatively

large basidiospores.

Key worps — Hymenochaetaceae, taxonomy, wood-inhabiting fungi

Introduction

Hymenochaete is one of the important genera in Hymenochaetaceae. ‘This

group of wood-decaying fungi has been studied by several authors in China,

who recorded 39 taxa from the country (Dai et al. 2000, Xu et al. 2003, Zhang

& Dai 2005, Dai & Niemela 2006, Dai 2010, 2011, He 2010). Dai (2010a)

revised the genus in China systematically and illustrated 23 species. However,

in comparison with the total number of known species worldwide (ca. 110), the

genus is still poorly known in China, and many species remain undiscovered.

Xizang Autonomous Region (Tibet) and its adjacent areas are largely

unknown mycologically. Despite reports on polypores in the region by Dai et

al. (2004, 2007a, b) and Yuan & Dai (2008), many species of other groups of

wood-decaying fungi are still unrecorded. Recently, during a survey of wood-

inhabiting fungi in Xizang Autonomous Region approximately 100 specimens

of Hymenochaete were collected. Two species are distinctly different from

known species of the genus. Therefore they are described as new species in this

paper.

Materials & methods

Voucher specimens are deposited in the herbarium of Beijing Forestry University

(BJFC), and the microscopic procedure follows Cui & Dai (2008). In the text the

376 ... He & Li

following abbreviations are used: L = mean spore length (arithmetical average of all

spores), W = mean spore width (arithmetical average of all spores), Q = variation in the

L/W ratios between the specimens studied (quotient of the mean spore length and the

mean spore width of each specimen), n = the number of spores measured from given

number of specimens. In presenting the size range of spores, 5% of the measurements

were excluded from each end of the range, and the measurements were given in

parentheses. IKI stands for Melzer’s reagent, KOH for 5% potassium hydroxide, and

CB is the abbreviation of Cotton Blue. IKI- = inamyloid and nondextrinoid, CB- =

acyanophilous. Special color terms follow Petersen (1996).

Taxonomy

Hymenochaete megaspora $.H. He & Hai J. Li, sp. nov. Fics. 1-2

MycoBank MB 519354

Carpophorum annuum, effusum vel effuso-reflexum, margine leviter elevatum, laxe

adnatum, coriaceum, in sicco durum fragileque, 150-600 um crassum. Superficies pilei

griseo-brunnnea vel atro-grisea, tomentosa, concentrice sulcata et zonata. Hymenophorum

laeve vel tuberculatum, submurinum vel vinaceo-griseum. Cortex, tomentum et stratum

hypharum adsunt; cortex ex hyphis agglutinatis compositus, 10-25 um crassus. Systema

hypharum monomiticum, hyphae generativae sine fibulis, hyalinae vel flavo-brunneae,

tenuiter tunicatae vel crasse tunicatae, interdum septatae, rare ramosae, plus minusve

intertextae, 2-4 um diam; setae in hymeniis stratosis abundae, subulatae, acutae, parte

superiore cum crystallis incrustatae, (80-)90-120(-140) x 8-13(—14) um; cystidia desunt;

hyphidia hyalina, 2-3 um in diam; basidia clavata, 4 sterigmatibus praedita, 25-32 x 5-8

uum; sporae late ellipsoideae, IKI-, CB-, (7-)7.5-10(-11) x 5-7 um.

Type: China. Xizang Autonomous Region, Linzhi County, Lulang, alt 3700 m, on dead

branch of Quercus (Fagaceae), 17.1X.2010 He 328 (Holotype, BJFC).

ETYMOLOGY: megaspora, refers to the large basidiospores.

Fruirsopy: Annual, effused or effused-reflexed with slightly elevated margins,

loosely adnate, easily detached, coriaceous without odour or taste when fresh,

becoming hard and brittle when dry, 150-600 um thick, resupinate part up to

7cm long, reflexed part short and broad, projecting 0.1-0.4 cm. Pileal surface

grayish brown to dark gray, silky, tomentose, concentrically sulcate and zonate;

margin thin, lighter than pileal surface. Hymenophore smooth or tuberculate,

slightly irregularly cracked when old, pale mouse-gray to vinaceous gray;

resupinate margin thinning out, indistinct, silky, slightly fimbriate, lighter than

hymenophore, cinnamon to yellowish brown, up to 0.5 cm.

HYPHAL STRUCTURE: Hyphal system monomitic; generative hyphae without

clamp connections; tissue darkening but otherwise unchanged in KOH.

SUBICULUM: Cortex, tomentum and hyphal layer present. Cortex composed

of strongly agglutinated hyphae, 10-25 um. Setal layer thickening in old

specimens, sometimes a hyphal layer present between rows of setae. Generative

hyphae hyaline to yellowish brown, thin- to distinctly thick-walled with a

Hymenochaete spp. nov. (China) ... 377

Fic. 1. Fruitbody of Hymenochaete megaspora (He 302, paratype).

narrow lumen, occasionally septate, rarely branched, regularly arranged, more

or less interwoven, 2-4 tm in diam.

STRATIFIED HYMENIUM: Hyphae in this layer similar to those in subiculum,

yellowish to yellowish brown, thick-walled, more or less agglutinated,

interwoven, 2-3.5 um in diam. Setae abundant, subulate, dark brown, thick-

walled with a wide or narrow lumen; tip acute, always encrusted with small

crystals; setae projecting up to 80 um above the hymenium, (80-)90-120(-140)

x 8-13(-14) um; cystidia absent; hyphidia present in sterile specimens, hyaline,

slightly conical, 2-3 wm in diam; basidia clavate, with four sterigmata and a

simple septum at base, 25-32 x 5-8 um; basidioles in shape similar to basidia,

but smaller.

Spores: Basidiospores broadly ellipsoid, hyaline, thin-walled, smooth, IKI-,

CB-, (7-)7.5-10(-11) x 5-7 um, L = 8.59 um, W = 5.94 um, Q= 1.40-1.50 (n

= 60/2).

ADDITIONAL SPECIMENS (PARATYPES) EXAMINED: CHINA. X1IzZANG AUTONOMOUS

ReGIon, Linzhi County, Lulang, alt 3700 m, on dead branch of Quercus (Fagaceae),

16.IX.2010 He 302; 18.1X.2010 He 334; Bomi County, on dead branch of Quercus

(Fagaceae), 19.1X.2010 He 351 (Paratypes, BJFC).

RemaRKs: Hymenochaete megaspora is characterized by large and broadly

ellipsoid basidiospores, encrusted setae, and the presence of a cortex. Its

basidiospores are similar to those of H. gigaspora D.A. Reid (6.5-8.5 x 5.2-6.5

378 ... He & Li

—

10 ym

Fic. 2. Microscopic structures of Hymenochaete megaspora (drawn from the holotype).

a: Basidiospores. b: Basidia and basidioles. c: Setae. d: Hyphae from subiculum.

Hymenochaete spp. nov. (China) ... 379

um), but H. gigaspora differs in having smaller setae without encrustation (75-

100 x 5-10 um), and lacking a cortex and tomentum (Léger 1998, Parmasto

2005). Another similar species, H. tabacina (Sowerby) Lév., which also has

encrusted setae and a cortex, can be distinguished by its smaller basidiospores

(4.5-7 x 1.2-2.2 um) and presence of setal hyphae (Parmasto 2001).

Macroscopically, Hymenochaete megaspora is similar to H. rigidula Berk.

& M.A. Curtis, which is another common species on Quercus in Xizang

Autonomous Region. However, H. rigidula has shorter setae (40-60 x 7-12

um) and smaller basidiospores (3.7-5 x 1.5-2.3 um, Parmasto 2001).

Hymenochaete acerosa S.H. He & Hai J. Li, sp. nov. Fics. 3-4

MycoBank MB 519355

Carpophorum annuum, effusum, adnatum, molle, 200-600 um crassum. Hymenophorum

laeve, azonatum, non crevisum, cinnamomeum vel flavo-brunneum. Cortex et tomentum

desunt, stratum hypharum adest. Systema hypharum monomiticum, hyphae generativae

non fibulatae, in subiculo hyalinae vel flavo-brunneae, crasse tunicatae, ad angulum 90°

frequanter ramosae, septatae, laxe intertextae, 2-5 um diam; setae in hymeniis stratosis

numerosae, flavo-brunneae, acerosae, acutae, interdum curvatae vel leviter sigmoideae,

(55-)85-170(-180) x 5-8(-9) um; hyphidia et cystidia desunt; basidia clavata, 4

sterigmatibus praedita, 13-21 x 5-8 um, ad basim uniseptata; sporae ellipsoideae vel late

ellipsoideae, hyalinae, tenuiter tunicatae, laeves, IKI-, CB-, (6.5-)7-8.5(-9) x (4.6-)4.8-6

um.

Type: China. Xizang Autonomous Region, Linzhi County, Lulang, alt 3700 m, on dead

angiosperm branch, 18.[X.2010 He 344 (Holotype, BJFC).

ETYMOLOGY — acerosa, refers to the acerose setae.

Fic. 3. Fruitbody of Hymenochaete acerosa (He 344, holotype).

380 ... He & Li

sa (drawn from the holotype).

s. c: Setae. d: Hyphae from subiculum.

f Hymenochaete acero.

nd basidiol

Hymenochaete spp. nov. (China) ... 381

FruiTBopy: Annual, effused, adnate, detachable, soft, first as small colonies,

later confluent up to 15 cm or more in longest dimension, 200-600 tum thick.

Hymenophore smooth, azonate, cinnamon to yellowish brown, usually

not cracked; margin thinning out, indistinct, byssoid, concolorous with

hymenophore.

HYPHAL STRUCTURE: Hyphal system monomitic; generative hyphae without

clamp connections; tissue darkening but otherwise unchanged in KOH.

SUBICULUM: Cortex and tomentum absent, hyphal layer present. Generative

hyphae hyaline to yellowish brown, thick-walled with a wide lumen, frequently

branched at a right angle, with numerous simple septa, loosely interwoven, 2-5

uum in diam.

STRATIFIED HYMENIUM: Hyphae in this layer similar to those in subiculum,

yellowish to yellowish brown, thick-walled, more or less agglutinated,

interwoven, 2-4 uum in diam. Setae numerous, yellowish brown, acerose with

acute tip, sometimes curved or slightly sigmoid, projecting up to 100 um above

the hymenium, (55-)85-170(-180) x 5-8(—9) tm; cystidia and hyphidia absent;

basidia clavate, with four sterigmata and a simple septum at base, 13-21 x 5-8

tum; basidioles in shape similar to basidia, but smaller.

Spores: Basidiospores ellipsoid or broadly ellipsoid, hyaline, thin-walled,

smooth, IKI-, CB-, (6.5-)7-8.5(-9) x (4.6-)4.8-6 um, L = 7.69 um, W = 5.30

pum, Q= 1.40-1.50 (n = 60/2).

ADDITIONAL SPECIMENS (PARATYPES) EXAMINED: CHINA. X1zZANG AUTONOMOUS

REGION, Linzhi County, Lulang, alt 3700 m, on dead angiosperm branch, 18.IX.2010 He

338; 25.IX.2010 He 399 (Paratypes, BJFC).

Remarks: Hymenochaete acerosa is distinguished by the very long and narrow

(acerose) setae, large basidiospores, and loosely inter wove hyphae. It is similar

to H. depallens Berk. & M.A. Curtis, which also has long setae and loosely

interwove hyphae; however, the new species differs in having narrower setae

(85-170 x 5-8 um vs. 80-150 x 9-13 um), larger basidiospores (7-8.5 x

4.8-6 um vs. 6-7.3 x 3.7-4.2 um), and an uncracked hymenophore (Léger

1998, Parmasto 2005).

Hymenochaete acerosa is superficially similar to H. cinnamomea (Pers.) Bres.,

which differs in having shorter setae (70-120 x 5-9 um), smaller basidiospores

(4.5-6.5 x 1.8-2.8 um), and always stratified hyphal and setal layer (Léger 1998,

Parmasto 2001).

Acknowledgments

The authors would like to express their deep thanks to Prof. Yu-Cheng Dai (Institute

of Applied Ecology, Chinese Academy of Sciences) and Dr. Jun-Feng Liang (Chinese

Academy of Forestry) for serving as pre-submission reviewer; to Prof. Jian-Yun Zhuang

(Institute of Microbiology, Chinese Academy of Sciences) for Latin corrections. This

382 ... He & Li

study was supported by the Beijing Forestry University Young Scientist Fund (No.

BLX2009023); the Fundamental Research Funds for the Central Universities (No.

YX2010-22); the National Natural Science Foundation of China (No. 31000006).

Literature cited

Cui BK, Dai YC. 2008. Wood-rotting fungi in eastern China 2. A new species of Fomitiporia

(Basidiomycota) from Wanmulin Nature Reserve, Fujian Province. Mycotaxon 105: 343-348.

Dai YC. 2010. Hymenochaetaceae (Basidiomycota) in China. Fungal Diversity 45: 131-343.

doi: 10.1007/s13225-010-0066-9

Dai YC. 20111. A revised checklist of corticioid and hydnoid fungi in China for 2010. Mycoscience

52: 69-79. doi:10.1007/s 10267-010-0068-1

Dai YC, Niemela T. 2006. Hymenochaetaceae in China: hydnoid, stereoid and annual poroid genera,

plus additions to Phellinus. Acta Botanica Fennica 179: 1-78.

Dai YC, Zhang XQ, Zhou TX. 2000. Changbai wood-rotting fungi 12. Species of Hymenochaete

(Basidiomycota). Mycotaxon 75: 445-450.

Dai YC, Wei YL, Wang Z. 2004. Wood-inhabiting fungi in southern China 2. Polypores from

Sichuan Province. Annales Botanici Fennici 41: 319-329.

Dai YC, Wei YL, Yuan HS, Huang MY, Penzina T. 2007a. Polypores from Altay and Tian Mts. in

Xinjiang, northwest China. Cryptogamie Mycologie 28: 269-279.

Dai YC, Yu CJ, Wang HC. 2007b. Polypores from eastern Xizang (Tibet), western China. Annales

Botanici Fennici 44: 135-145.

He SH. 2010. Hymenochaete (Hymenochaetales) in Hainan. Mycosystema 29: 835-839.

Léger JC. 1998. Le genre Hymenochaete Léveillé. Bibliotheca Mycologica 171: 1-319.

Parmasto E. 2001. Hymenochaetoid fungi (Basidiomycota) of North America. Mycotaxon 79:

107-176.

Parmasto E. 2005. New data on rare species of Hydnochaete and Hymenochaete (Hymenochaetales).

Mycotaxon 91: 137-163.

Petersen JH. 1996. Farvekort. The Danish Mycological Society’s colour-chart. Foreningen til

Svampekundskabens Fremme, Greve. 6 pp.

Xu SZ, Zhou TX, Wang L, Yao XL, Zhai JW. 2003. A note on the species and new records of

Hymenochaete Lév in Yunnan. Journal of Southwest Forestry College 23: 53-58. (in Chinese).

Yuan HS, Dai YC. 2008. Polypores from northern and central Yunnan Province, Southwestern

China. Sydowia 60: 147-159.

Zhang XQ, Dai YC. 2005. Flora fungorum sinicorum, vol. 29, Hymenochaetaceae. Science Press,

Beijing, 205 pp. (in Chinese).

MYCOTAXON

Volume 115, pp. 383-400 January-March 2011

DOT: 10.5248/115.383

Rare or little known corticioid basidiomycetes

from southern Belarus

EUGENE YURCHENKO ** & HEIKKI KOTIRANTA ?

'V.E. Kuprevich Institute of Experimental Botany, Akademichnaya str. 27,

Minsk, BY-220072, Belarus

2 Finnish Environment Institute, Natural Environment Centre, RO. Box 140,

Helsinki, F-00251, Finland

CORRESPONDENCE TO *: “eugene_yu@tut.by e& *heikki.kotiranta@ymparisto,fi

ApsTRACT — Six non-poroid resupinate homobasidiomycete species, collected within

the borders of Paleskaya Physiographic Province, or Polesia (Belarus), are described and

illustrated: Crustodontia chrysocreas, Hyphoderma cryptocallimon, H. transiens, Oliveonia

citrispora, Trechispora caucasica, T: minuta. According to the known distributional data, these

taxa are rare or exceptionally rare in Belarus and other European countries; they are, except H.

transiens, reported from Belarus for the first time. Distinctive characters and morphological

differences from similar-looking species are discussed.

Key worps — Basidiomycota, Corticiaceae, geography, morphology

Introduction

This paper continues a series on rare corticioid fungi from Belarus. Two

previous publications were devoted to the species found in central (Yurchenko

& Kotiranta 2006) and northern (Yurchenko & Kotiranta 2007) parts of the

country. The species described here were found in southern Belarus and are

rare or very rare in Belarus and most of the other European countries. The

morphology of these species, except Crustodontia chrysocreas, is relatively little

documented, and thus additional descriptions are needed.

Materials & methods

The material was collected from Paleskaya Province, or province No.845 according

to the European decimal physiographic division (see Klitsunova et al. 2002). In

geographical literature this area is better known as Belarusian part of Polesia Lowland or

Belarusian Palesse (Fic. 1). The corresponding author collected most of the specimens

in 2006 and 2007; otherwise the collector’s name is indicated.

384 ... Yurchenko & Kotiranta

124°E

Fic. 1. Study area and collection sites: a, contour of the Republic of Belarus and Paleskaya Province

(province No. 845, according to the European decimal physiographic division); b, collection sites,

northern border of the Province and the borders of Belarus administrative districts (site numbers

are the same as mentioned in SPECIMENS EXAMINED).

The macromorphology was described from dry samples. For micromorphological

measurements and drawings the material was mounted in 3% KOH water solution or

in distilled water to observe crystals; Melzer’s reagent (Mz’s) was used to test amyloidity

or dextrinoidity, and Cotton Blue (CB; 0.1% Cotton Blue in 60% lactic acid) to test

for cyanophily. The studied samples are deposited in the Herbarium of V-F. Kuprevich

Institute of Experimental Botany (MSK-F); duplicates are also deposited in the reference

herbarium of Heikki Kotiranta (H.K.) and one in the University of Oslo Herbarium

(O).

Species descriptions

Crustodontia chrysocreas (Berk. & M.A. Curtis) Hjortstam & Ryvarden Fic. 2

BasIDIOMA totally effused, closely adnate, about 10 x 5 cm, 50-100 um

thick in dry state, ceraceous or subcartilaginous, somewhat fissured in dry

state; hymenophore greyish ochraceous with orange tint, under the lens slightly

pruinose, with the naked eye like grayish bloom, smooth or with minute,

quite scattered, blunt warts. MARGIN concolorous, thinning out. SUBICULUM

rather thin and subhymenium thick; subhymenium with pigmented resinous

inclusions. HyPHAL sYsTEM monomitic, hyphae clamped at all septa. Subicular

hyphae moderately branched, more or less sinuous, even or with swellings,

2.2-4.1 tum wide, hyaline, thin- to slightly thick-walled, smooth. Subhymenial

hyphae densely branched, short-celled, densely packed and forming a

pseudoparenchymatic tissue, 2-3 um wide, with swellings up to 4 um wide,

Unusual corticioids from Belarus... 385

hyaline, thin- or slightly thick-walled, smooth. HyMENIUM consisting of

densely palisade-arranged cells, with brownish resinous excretions in between.

CYSTIDIOLES (leptocystidia) fusoid, blunt, about 20 um long, 2.3-4.3 um wide,

projecting 6-8 um above the hymenium, hyaline, thin-walled, naked or apically

with capitate, pale brownish or yellow encrustations, 2.2-6.7 um in diam.

Basip1a cylindrical or narrowly clavate, 16-21 x 3.8-4.2 tm, hyaline, thin-

walled, with 4 sterigmata 6-6.5 x 0.8 um. BAsIDIosPoREs narrowly ellipsoid,

(3.7-)4.2-4.7(-5.5) x (2-)2.2-2.3 um, mostly slightly thick-walled, hyaline or

subhyaline, with very small apiculus, Mz’s-negative, acyanophilous.

SPECIMEN EXAMINED—BELARUS. Homel’ voblast’: Lel'chytsy district, in vicinity of

Baravoe village (site 5), on decorticated fallen wood of Quercus robur L. in Quercus

forest of Vaccinium myrtillus type, coll. E.P. Komarova 22 VIII 1963 (MSK 10574; H.K.;

O).

Crustodontia chrysocreas is distinguished by its slightly warted hymenial surface,

usually ochraceous hymenium with orange and brownish hues, short-celled,

and tightly packed hyphae in textura intricata, which gives the basidioma a

cartilaginous consistency (Lombard et al. 1975 as ‘Phlebia chrysocrea (Berk. &

M.A. Curtis) Burds? Domariski 1991 as “Ph. chrysocreas’). Our specimen fits

C. chrysocreas in colour, hymenial configuration, basidioma texture,

leptocystidia, basidia, and spore morphology. However, we did not observe

microbinding hyphae or the waxy, yellow substance described by Lombard et

al. (1975) in the substratum under the basidioma. Moreover, no parts of the

fungus turned red in 3% KOH, which is characteristic for American (Lombard

et al. 1975), Hawaiian (Gilbertson & Adaskaveg 1993), and Japanese (Maekawa

1993) material. Microbinding hyphae were not observed in Asian material (Wu

1990 as ‘Amethicium chrysocreas (Berk. & M.A. Curtis) Sheng H. Wu} Maekawa

1993), Abundant yellowish (but not orange brown, as in the American samples)

granular material was found in subhymenium and especially hymenium, but

absent in subiculum. The colour differences and the absence of KOH reaction

is probably due to the long-time storage of the specimen in herbarium.

Remarkably, in his original description of Corticium chrysocreas Berk. & M.A.

Curtis, Berkeley stated, “subiculum bright yellow” (Berkeley 1873: 178), but

Maekawa (1993) described the fungus as pale yellow in section. Our sample has

smaller (although similarly shaped) cystidia compared with those described

by Lombard et al. (1975) and Maekawa (1993). The material described from

Hawaii (Gilbertson & Adaskaveg 1993) had oblong to cylindrical spores and

remarkable hyphal elements with vesicular apices up to 22 um wide, which are

absent in our sample.

‘The species is new for Belarus and the record is the northernmost (51.7°N)

known in the world. It has a pantropical distribution and is exceptionally rare

in Europe, earlier collected in France (Bourdot & Galzin 1928), Poland, and

386 ... Yurchenko & Kotiranta

x GOO CI VOR O%, a

TO ee

iu Nas See

( foiess Sail

50 pm

eld

0869)

5 pm

Fic. 2. Crustodontia chrysocreas (MSK 10574): a, vertical section through basidioma; b, subicular

hyphae close to the substratum; c, portions of hymenium and subhymenium; d, cystidia and

basidioles; e, basidia; f, basidiospores.

Ukraine (Bernicchia & Gorjén 2010). The species has been reported from

southeastern and eastern USA (Lombard et al. 1975 - 10 localities), Costa

Rica (K.-H. Larsson 2010, pers. comm.), Caribbean Islands (Minter et al. 2002

- 18 records), Venezuela (Minter 2010), six countries of equatorial Africa

Unusual corticioids from Belarus ... 387

(Hjortstam et al. 1993, Roberts 2000), Sri Lanka (Lombard et al. 1975), southern

and southeast China (Dai et al. 2004, Dai 2010), Taiwan (Lin & Chen 1990,

Wu 1990), Japan (Maekawa 1993 - 8 localities; Kubayashi & Maekawa 2001),

Hawaii (Gilbertson & Adaskaveg 1993), Brunei (Hjortstam et al. 1998), western

Australia (Hjortstam et al. 2009), New Zealand (Pennycook & Galloway 2004).

We suppose, in accordance with Hjortstam et al. (2009), that the material from

different isolated landmasses is heterogeneous, comprising several species,

which is reflected in differences in descriptions.

Hyphoderma cryptocallimon B. de Vries Fi. 3

BAsIDIOMA effused, closely adnate, subceraceous, several cm long, 0.1-0.2

mm thick, smooth and continuous to porulose, especially towards the margin,

cream- or pale coloured. Marcin diffuse. HyPHAL sysTEM monomitic.

Subicular hyphae clamped, moderately branched, 2-3.7 ttm wide, hyaline, thin-

walled. CysTIpIA scattered, projecting up to 65-100 um above the hymenium,

cylindrical or with some dilatations towards the base and/or to the apex, apically

occasionally subcapitate or with a small resinous cap, non-septate or seldom

with 1-3 adventitious septa, 70-90(-125) x 5.5-9.2 um, hyaline, apically thin-

walled, at the base slightly or distinctly thick-walled (to 1 um). HypHrpia

numerous in some hymenial areas, cylindrical, hyaline, thin-walled, straight

to sinuous, 1.5-2.3 um wide, projecting up to 5-15 um. BAsIDIOLEs often rich

in oil-drops. Basip1a subcylindrical or narrowly clavate, hyaline, thin-walled,

rich of oily inclusions, (30-)45-50 x 7-10.3 um, with (2)4 sterigmata 6.5-9 x

1.3-1.7 um, some sterigmata basally with an oily inclusion, with attenuated

to hair-like tip when mature. BAstpIosporEs narrowly ellipsoid to oblong,

sometimes narrowing to the base, (8.5-)9.5-11(-13.5) x (4.5-)5-5.5(-6.7) um,

hyaline, often with a large, strongly refractive oil drop, thin-walled, smooth,

with rather narrow, distinct apiculus, inamyloid, acyanophilous.

SPECIMEN EXAMINED—BELARUS. Homel’ voblast’: Lel’chytsy district, in vicinity of

Simanichy village (site 3), on fallen decorticated branch of Pinus sylvestris L. in Pinus

forest of Pleurozium type, coll. 9.X1.2007 (MSK 6904; H.K.). The fungus is mixed with

Tubulicrinis subulatus (Bourdot & Galzin) Donk basidioma, and grew over it.

Eriksson & Ryvarden (1975: 543) first diagnosed this taxon under the name

Hyphoderma sp. de Vries 488, based on asingle sample from northwest Germany.

Nakasone & Gilbertson (1982: 603-605) described a new species in the genus

Crustoderma, C. opuntiae Nakasone & Gilb., from Arizona, with the notation

that it is morphologically similar to Hyphoderma sp. de Vries 488. However, we

see several differences between the C. opuntiae and H. cryptocallimon diagnoses

that do not support their synonymy: C. opuntiae has floccose subiculum with

moderately thick-walled hyphae, somewhat flexuose cystidia, narrower basidia

(6-7 wm) of narrowly clavate shape, narrower spores (4-5 um wide), and

388 ... Yurchenko & Kotiranta

0-0 .00

Fic. 3. Hyphoderma cryptocallimon (MSK 6904): a, subicular hyphae; b, cystidia; c, basidioles;

d, basidia; e, basidiospores.

negative oxidase test, indicating a brown rot activity, whereas the members of

the genus Hyphoderma are white rot fungi.

Hyphoderma cryptocallimon is morphologically close to H. obtusiforme

J. Erikss. & A. Strid, differing from it by shorter basidiospores, much longer

and projecting cystidia that are often distally slightly clavate and basally with

thickened or thick walls and sometimes with adventitious septa, and somewhat

Unusual corticioids from Belarus ... 389

larger and slightly more sinuous basidia (25-70 x 7-10 um), usually with many

guttules (Eriksson & Ryvarden 1975, de Vries 1987). Cystidia in H. obtusiforme

are 50-80 um long, thin-walled and not subclavate; besides, they often have

dense protoplasm in the distal part. The spore size in H. cryptocallimon is noted

as 7-12 x 4.5-7 um, whereas spores are 10-14 x 5-7 um in H. obtusiforme

(Eriksson & Ryvarden 1975, de Vries 1987). There is also a presumed ecological

distinction: H. cryptocallimon prefers habitats on poorer sandy soils, which is

seen at least from the finds described by de Vries and from our finding. Some

spores in our material were longer than 12 tm, thus approaching the spore size

of H. obtusiforme. Moreover, our sample has many cylindrical cystidia, only

some of which expanded slightly toward the apex; some cystidia are subcapitate,

uncommon for H. cryptocallimon.

The species is new for Belarus and known from a single locality.

H. cryptocallimon was described on Juniperus communis from northwest

Germany and reported also from southern Sweden and the Netherlands (de

Vries 1987), Italy on Juniperus and Pinus (Bernicchia 2000, Bernicchia et al.

2007a), Zakarpats’ka oblast in Ukraine (Kiiffer et al. 2004), Britain including

Northern Ireland (Kirk & Cooper 2009), and Belgium and Spain (Bernicchia

& Gorjén 2010).

Hyphoderma transiens (Bres.) Parmasto Fic. 4

BAsIDIOMATA totally effused, more or less closely adnate, 5 cm or more in

extent, 50-130 um thick between the teeth, subceraceous, cream-coloured.

HyMENOPHORE odontioid, at basidioma periphery partly smooth or minutely

porulose; teeth tuberculate-flattened at the periphery of the basidioma, in the

center conical or cylindrical, brownish or dark ochraceous, glossy, fragile,

up to 0.4 mm long and 0.2 mm wide, simple or slightly branched, obtuse or

acute, smooth or apically short-setaceous; with age or when dry basidioma

minutely cracked. MARGIN farinaceous, diffuse, in some areas almost mould-

like (short-fibrillose), whitish or cream-coloured, 0.3-0.7 mm wide. HYPHAL

SYSTEM monomitic, hyphae clamped at all septa. Subicular hyphae moderately

branched, more or less loosely interwoven, 2-3.7 um wide, hyaline, thin- to

slightly thick-walled, smooth or sparsely encrusted (in KOH). Tooth trama

with abundant yellowish, coarse crystalline material (in water); apical hyphae

of the teeth often forming clusters, individual hyphae 1.3-3.5 um wide.

Subhymenial hyphae moderately branched, more or less vertically arranged,

2-2.5 um wide, hyaline, thin-walled, richly covered with aggregations of

yellowish coarse crystalline material, not dissolved in KOH. Cystip1a rare

or scattered, more or less embedded, subcylindrical, 40-95 x 7-9(-10) um,

subhyaline, thin-walled, in KOH smooth. Basip1a irregularly clavate, 25-30

(-38) x 5.7-6.7 «um, hyaline, thin-walled, smooth or basally encrusted, with 2-4

sterigmata, initially stout and obtuse, when mature conical or subulate, 6.5-9.5

390 ... Yurchenko & Kotiranta

Fic. 4. Hyphoderma transiens (MSK 3965): a, view of odontioid hymenophore; b, subicular hyphae;

c, cystidia; d, basidia; e, basidiospores.

x 1.5-1.8 um. Basiprosporss cylindrical, adaxially straight or slightly concave,

occasionally gently sigmoid, 8.5-12 x 2.7-4.1 «um, thin-walled, colourless, with

small dispersed oil drops, with short and blunt, sometimes not pronounced

apiculus, Mz’s-negative, acyanophilous.

SPECIMENS EXAMINED—BELARUS. Homel’ voblast: Zhytkavichy district, in the

vicinity of Naida village (site 1), on fallen corticated branch of Corylus avellana L. and

unidentified deciduous tree in Alnus glutinosa forest of Urtica type, coll. A. Golovko

21.VIIL.1967 (MSK 10505a, 10505b); Lelchytsy district, in the vicinity of Baravoe village

(site 5), on fallen decorticated wood of Populus tremula L. in Alnus glutinosa forest of

Sphagnum type, coll. E.P. Komarova 17.VIII.1963 (MSK 3965).

Unusual corticioids from Belarus... 391

Distinctive characters of H. transiens are the odontioid hymenophore, which

smoothens towards the basidioma periphery, crystal-rich aculeal trama, the

presence of scattered, almost immersed subcylindrical cystidia (Maekawa

1994), and relatively narrow basidiospores. The hymenophore colour is usually

pale ochraceous and varies little even between samples from different continents

(Hjortstam & Ramos Bononi 1987, Maekawa 1994). Other authors (Nikolajeva

1961 as “Odontia transiens Bres?, Hjortstam & Ramos Bononi 1987, Maekawa

1993: 12 as ‘H. longosporum (H. Furuk.) N. Maek3 1994: 65) noted longer

basidiospores (< 13-15 um). Nikolajeva (1961) described also cylindrical,

spindle-shaped or slightly capitate apically encrusted (rough) cystidia, which

were not observed by us. The same author described the hymenophore as warted

with warts having penicillate apices, whereas our material is irregularly warted

to irregularly short-aculeate, with barely pronounced or absent penicillate

projections at aculei apices. A morphologically close species is H. roseocremeum

(Bres.) Donk, but it differs by a smooth hymenophore.

Hyphoderma transiens was published for the first time from Belarus from the

northwestern part of the country (Yurchenko 2008). Two other known sites are

in the southern part, but the species has not been recollected there since 1967.

The species is common in the Mediterranean and frequent on Quercus in Italy

(Bernicchia et al. 2007b, 2008) and has been reported from many other warm

regions: southern Brazil (Hjortstam & Ramos Bononi 1987), Azores (Telleria et

al. 2009a,b - common), Madeira (Telleria et al. 2008), Krasnodar krai of Russia,

Georgia, Azerbaijan, northeast Turkey, northern Iran (Ghobad-Nejhad et al.

2009), north-central China (Dai et al. 2004, Dai 2010), Japan (Maekawa 1994).

In the more northern areas there are records from the Carpathians and the

Forest Steppe Zone of Ukraine (Nikolajeva 1961, Zerova et al. 1972 - under the

name ‘Odontia transiensis’), and Middle Volga Region in Russia (Malysheva &

Malysheva 2008). Bernicchia & Gorjén (2010) cite the northernmost localities

as Sweden and Estonia.

Oliveonia citrispora (Hauerslev) P. Roberts Fic. 5

BasIDIOMA totally effused, 1-7 mm long, ca 30 um thick, hypochnoid,

comparatively loosely attached to the substratum, not continuous, porulose-

reticulate, greyish with yellowish or brownish tint. MARGIN rather abrupt

or indistinct. SuBicuLUM poorly developed; subicular hyphae moderately

branched, with small clamps or rarely with simple septa, (1.3-)1.6-2(-2.8) um

wide (some segments inflated to 4 um), thin-walled, smooth, hyaline or with

pale yellowish refractive contents. Subbasidial hyphae moderately branched,

1.8-2(-3) um wide, thin-walled, hyaline or with yellowish contents, with

clamped septa. CysTIDIA none, but broadly fusoid cystidioles scattered,

12-17.5 x 3.2-4.7 um, yellowish. BAsIDIOLEs broadly clavate, narrowly ovoid

392 ... Yurchenko & Kotiranta

~ OO00Gr

Fic. 5. Oliveonia citrispora (MSK 6895): a, subicular hyphae; b, broadly fusoid cystidioles;

c, basidioles and basidia; d, basidiospores.

or subcylindrical, 11-25 x 5.7-7.5(-8.5) um, with subhyaline to brownish

yellow, minutely granular or refractive contents. BAsIDIA ovoid to broadly

clavate, basally clamped (but the clamp not always seen), 10-16.5 x 4.5-7.7

uum, hyaline or pale yellowish, thin-walled (wall thinner basally), with 1-4

Unusual corticioids from Belarus... 393

sterigmata, 2.2-6.5 x 0.8-1.1 um. Basiprospores wide-navicular - citriform,

narrowing towards both ends, (4.3-)6-8.2 x 2.9-4.3 um, thin-walled, smooth,

hyaline to yellowish, with short blunt apiculus, Mz’s-negative, acyanophilous.

SPECIMENS EXAMINED—BELARUS. Homel’ voblast’: Lelchytsy district, Prypyatski

National Park, in the vicinity of Simanitskaya Rudnya village (site 4), on decorticated

wood of strongly decayed Picea abies (L.) H. Karst. stump in Betula-Picea forest of

Vaccinium myrtillus type, coll. 9.X1.2007 (MSK 6895; H.K.); the same locality, on

decaying Picea abies bark in Picea forest of swampy moss type, coll. 21.V.2010 (MSK

7291).

Oliveonia citrispora is distinguished from other members of the genus by bi-

apiculate basidiospores. Our material deviates somewhat compared with

other descriptions of the species. According to Roberts (1999), O. citrispora

has narrower (1.5-2 um) hyphae, subglobose, cuboid or ellipsoid basidia that

are shorter (7.5-11 tm) and often pleural, larger sterigmata (4-10 x 1-1.5

um) and larger basidiospores (6-10 x 3.5-8 wm) with pronounced apiculi.

However, such small differences are common in Rhizoctonia-forming fungi.

Basidiospores in our material are notably narrow, even when compared with

the data by Roberts (1999: Tab. 30) for a sample with the narrowest spores

(up to 6 um). Our samples have a dirty yellowish pigmentation in hymenial

elements and hyphae, giving a yellowish or brownish tinge to the hymenial

surface, whereas basidiomata are greyish-white according to other descriptions

(Hauerslev & Roberts 1997 as ‘Sebacinella citrispora Hauerslev, Roberts 1999).

Spore repetition is often found in this taxon (Hauerslev & Roberts 1997) but

was not detected in the specimens examined here.

The species is new for Belarus and known from a single locality. Itis probably

rare over its entire small range: so far it is known from the Netherlands,

Denmark (Roberts 1999), southern Britain (Kirk & Cooper 2009 - 7 records),

and Sweden (Bernicchia & Gorjén 2010).

Trechispora caucasica (Parmasto) Liberta Fia. 6.

BasIDIOMATA totally effused, ca 5-15 mm long, very thin, closely adnate but

not firmly attached to the substratum, pure white, arachnoid-reticulate, with

scattered loose granules, 0.2-1 mm in diam., containing conidia or hyphae with

abundant coarse crystalline material. MARGIN abrupt or indistinct. HyPHAL

STRANDS present, 70-150 um wide, situated near the basidiomata or radiating

in flabelliform pattern from the margins. HyPHAL sysTEM monomitic, hyphae

clamped. Subicular hyphae moderately branched, 1.3-1.8 um wide, hyaline,

thin-walled, in strands straight, 1-1.5 um wide. Subhymenium rich of fine

crystalline material and also with groups of coarse crystals (separate crystals

2.5-11 um across). Subbasidial hyphae moderately branched, 1.6-2(-3.5) um

wide, hyaline, thin-walled, moderately encrusted or smooth. CysTIDIA none.

Basip1A basally clamped, short clavate to subcylindrical, some with a median

394 ... Yurchenko & Kotiranta

Fic. 6. Trechispora caucasica (MSK 6891): a, subicular hyphae; b, fragments of hymenium; c, basidia

and basidioles; d, basidiospores; e, conidiophores with developing conidia; f, conidia.

constriction, thin-walled, hyaline, 9-11.5(-18) x 4-4.5(-5) wm, with 2-4

sterigmata, 2.5-3.2 x 0.5 um. BAsIpIosPoREs ovoid, somewhat bent, adaxially

concave, 3.3-4(-5.5) x 2.5-2.7 um, relatively evenly covered with spines up to

0.8 um long, thin-walled, hyaline, with middle-sized apiculus, Mz’s-negative,

acyanophylous. ConipiA (blastoconidia) numerous, originating terminally,

sometimes intercalarly, on delicate hyphae, 1-2 um wide, ellipsoid, ovoid,

angular-subglobose or irregular-shaped, 4.2-6.2 x 2.2-4 tum, smooth, or with

one, or a few protuberances, with thickened walls, subhyaline, with one large

drop or several smaller inclusions.

SPECIMEN EXAMINED—BELARUS. Homel’ voblast’: Lelchytsy district, Prypyatski

National Park, in the vicinity of Simanichy village (site 3), on corticated fallen branch of

Pinus sylvestris in Pinus forest of Pleurozium type, coll. 9.X1.2007 (MSK 6891; H.K.).

The presence of hyphal cords, lack of skeletal hyphae, often irregular shape

of conidia, and especially morphology of basidiospores, which are ventrally

Unusual corticioids from Belarus... 395

somewhat concave and bearing comparatively long aculei, are characteristic

for T. caucasica (Parmasto 1965, Larsson 1992). A very similar species is

T. tenuicula (Litsch.) K.H. Larss., which, however, is dimitic, grows mostly

on ferns (whereas 7: caucasica grows on wooden substrata), and spores are

ellipsoid to nearly lacrymiform, densely aculeate, with a small spine-free area

on the ventral side (e.g., Larsson 1992, Kotiranta & Saarenoksa 2000).

Trechispora caucasica is new for Belarus and known from a single locality.

The species was described for the first time from Azerbaijan (Parmasto 1965,

as ‘Cristella caucasica Parmasto’), but today it is known from Britain (Kirk &

Cooper 2009 — 2 records), Norway (Ryvarden et al. 2003 - from 3 localities),

Finland (Kotiranta et al. 2009 - 2 localities), Lithuania (R. IrSénaité 2010),

Sweden, Denmark, France, Austria, Italy, USA (Larsson 1992), Azores (Telleria

et al. 2009b). It is a rare or probably under-reported taxon, as earlier it was not

distinguished from T. farinacea (Pers.) Liberta s. 1. (Liberta 1973, Hjortstam

1987, Domanski 1992). However, Liberta (1973) did not describe blastoconidia

or aleuriospores, typical of I’ caucasica, in T: farinacea s.]. The distinction of

T. caucasica from T. farinacea was made clear after the treatments by Larsson

(1992; 1996).

Trechispora minuta K.H. Larss. Fic. 7

BasIDIOMATA totally effused, closely adnate, very thin (about 15-20 um

thick), discontinuous, farinaceous or pruinose, 3-10 mm in extent, white.

MarcIn diffuse, sometimes with very slender, closely adpressed, fan-shaped

hyphal strands at the periphery. HyPHAL sysTEM dimitic. Generative hyphae

clamped, moderately branched, hyaline, thin-walled, smooth to slightly

encrusted, (0.9-)1.3-2.3 um wide, subbasidial ones 1.6-1.8(-4.2) um wide.

Hyphae in cords with blunt, cystidia-like hyphal ends up to 3.7-4.3 um wide.

Skeletals not present in all parts of basidiomata, but in some areas abundant,

very sparingly branched, rather straight to wavy, hyaline, 0.5-1.1(-1.8) um

wide, with lumen about 0.3 um wide or seemingly without lumen, gradually

turning into narrow generative hyphae with clamps. Skeletals often covered

with numerous, coarse (mostly 3-10 tm across) crystals. HyPHIDIA occasional,

sinuous, 18-32 um long, often swollen at base to about 4 um. BasIpia basally

clamped (clamps often obscured by fine crystalline material), shortly clavate to

oblong and slightly pedunculate, straight or curved, 7.5-9.2 x (3.3-)3.5-4 um,

with 4 subulate sterigmata 3.3(-4) um x 0.5 um. Basiprosporgs ellipsoid or

ovoid, with flat or convex ventral side, minutely echinulate to short aculeate,

3,3-3.8(-4.5) x 1.7-2.1 um excluding the aculei, hyaline, thin- or rather thin-

walled, Mz's-negative, acyanophilous, with minute or indistinct apiculus.

SPECIMEN EXAMINED—BELARUS. Homel’ voblast: Mazyr district, NW outskirts of

town Mazyr (site 2), in ravine bottom, on angiosperm twig in litter in Alnus glutinosa

forest of Rubus idaeus-Oxalis type, coll. 26.X.2006 (MSK 7307; H.K.).

396 ... Yurchenko & Kotiranta

OG selseaoaoaa

Fic. 7. Trechispora minuta (MSK 7307): a, generative hyphae; b, skeletal hyphae and crystals;

c, hyphidia; d, basidioles and basidia; e, basidiospores.

$5 um

The main distinctive characters for T. minuta are the presence of skeletal hyphae,

usually pruinose to farinaceous basidiomata, very short basidia (< 10 x 5 um),

and a subhymenium of intricately branched hyphae in fully mature specimens

Unusual corticioids from Belarus ... 397

(Larsson 1992). Trechispora tenuicula differs in having longer basidia (10-13

um) and the presence of blastoconidia. In contrast to the original description

of I! minuta, our sample has an undeveloped subhymenium and narrower

basidiospores with rather evenly distributed aculei. According to Larsson

(1992, Fig. 28) spores are 2.4-2.7 um wide without aculei and have almost a

smooth area on the ventral side near the apiculus.

The species is new for Belarus and known from a single locality. It is widely

distributed and presumably common, but is evidently neglected or often

misidentified. The species is known from Norway (10 localities), Sweden (7

localities), Finland, France, Austria, Poland (at the eastern border close to

Belarus), Canada, USA (Larsson 1992), and Azores (Telleria et al. 2009b).

Acknowledgments

The authors are grateful to Prof. Nils Hallenberg (Department of Plant and

Environmental Sciences, University of Géteborg, Sweden) and to Dr Wolfgang Damon

(St. Georgen bei Salzburg, Austria) for presubmission review of the manuscript. We

are thankful to Dr Karl-Henrik Larsson (Natural History Museum, University of Oslo,

Norway) for the identification of Crustodontia chrysocreas and giving some data on

its distribution, and to Dr Bernhard de Vries (Hoogeveen, The Netherlands) for the

discussion on Hyphoderma cryptocallimon taxonomy.

Literature cited

Berkeley MJ. 1873. Notices of North American fungi. Grevillea 1(12): 177-180.

Bernicchia A. 2000. Wood-inhabiting aphyllophoraceous fungi on Juniperus spp. in Italy.

Mycotaxon 75: 241-256.

Bernicchia A, Gorjon SP. 2010. Corticiaceae s.]. Fungi Europaei n°12. Ed. Candusso, Italia. 1008

PP-

Bernicchia A, Savino E, Gorjén SP. 2007a. Aphyllophoraceous wood-inhabiting fungi on Pinus

spp. in Italy. <http://www.mycotaxon.com/resources/checklists/bernicchia-v101-checklist1.

pdf>. (Summary of web publication: Mycotaxon 101: 5-8.)

Bernicchia A, Venturella G, Saitta A, Gorjén SP. 2007b. Aphyllophoraceous wood-inhabiting fungi

on Fagus sylvatica in Italy. <http://www.mycotaxon.com/resources/checklists/ bernicchia-

v101-checklist2.pdf>. (Summary of web publication: Mycotaxon 101: 229-232.)

Bernicchia A, Benni A, Venturella G, Gargano ML, Saitta A, Gorjén SP. 2008. Aphyllophoraceous

wood-inhabiting fungi on Quercus spp. in Italy. <http://www. mycotaxon.com/resources/

checklists/bernicchia_v104-checklist.pdf> (Summary of web publication: Mycotaxon 104:

425-428.)

Bourdot H, Galzin A. 1928. Hyménomycétes de France. Hetérobasidiés — Homobasidiés

Gymnocarpes [Contribution a la flore mycologique de la France 1]. Paris: Lechevalier. 764 pp.

Dai YC. 2010. A revised checklist of corticioid and hydnoid fungi in China for 2010. Mycoscience.

Published online 31 Aug 2010. doi:10.1007/s10267-010-0068-1

Dai YC, Wei YL, Zhang XQ. 2004. An annotated checklist of non-poroid Aphyllophorales in China.

Ann. Bot. Fennici 41: 233-247.

Domanski S. 1991. Mala flora grzybéw. T. 1. Basidiomycetes (Podstawczaki). Aphyllophorales

(Bezblaszkowce), Stephanosporales (Stefanosporowce). Czesé 6. Corticiaceae: Kavinia

398 ... Yurchenko & Kotiranta

— Rogersella. Stephanosporaceae: Lindtneria. Paistwowe wydawnictwo naukowe: Warszawa,

Krakéw. 273 pp.

Domaniski S. 1992. Mala flora grzybéw. T. 1. Basidiomycetes (Podstawczaki). Aphyllophorales

(Bezblaszkowce). Czesé 7. Corticiaceae: Sarcodontia — Ypsilonidium, Christiansenia &

Syzygospora. Instytut botaniki im. W. Szafera: Krakow. 258 pp.

Eriksson J, Ryvarden L. 1975. The Corticiaceae of North Europe. Vol. 3: Coronicium — Hyphoderma.

Fungiflora: Oslo. Pp. 287-546.

Ghobad-Nejhad M, Hallenberg N, Parmasto E, Kotiranta H. 2009. A first annotated checklist

of corticioid and polypore basidiomycetes of the Caucasus region. Mycologia Balcanica 6:

123-168.

Gilbertson RL, Adaskaveg JE. 1993. Studies on wood-rotting basidiomycetes of Hawaii. Mycotaxon

A9: 369-397,

Hauerslev K, Roberts P. 1997. Ceratobasidiaceae Julich. 112-115, in: Hansen L, Knudsen H.

(eds), Nordic macromycetes. Vol. 3: Heterobasidioid, aphyllophoroid and gastromycetoid

Basidiomycetes. Nordsvamp: Copenhagen.

Hjortstam K. 1987. A check-list to genera and species of corticioid fungi (Hymenomycetes).

Windahlia 17: 55-85.

Hjortstam K, Ramos Bononi VL. (1987). A contribution to the knowledge of Corticiaceae s.l.

(Aphyllophorales) in Brazil. Mycotaxon 28(1): 1-15.

Hjortstam K, Ryvarden L, Watling R. 1993. Preliminary checklist of non-agaricoid macromycetes

in the Korup National Park, Cameroon and surrounding area. Edinb. J. Bot. 59(1): 105-119.

doi: 10.1017/S0960428600000743

Hjortstam K, Roberts PJ, Spooner BM. 1998. Corticioid fungi from Brunei Darussalam. Kew

Bulletin 53(4): 805-827. doi:10.2307/4118870

Hjortstam K, Roberts PJ, Spooner BM. 2009. Corticioid fungi from the Kimberley Region, Western

Australia. Kew Bulletin 64(2): 353-368. doi: 10.1007/s12225-009-9104-8.

Irgénaité R. 2010. Aa annotated checklist of corticioid fungi of Lithuania. Bothanica Lithuanica

16(2-3): 83-95.

Kirk P, Cooper J. 2009. The checklist of fungi of the British Isles - name search. British Mycological

Society, FRDBI [website]. <http://www.fieldmycology.net/GBCHKLST/ gbchklst.asp>.

Klitsunova NK, Martsynkevich HI, Pirozhnik II, Shchasnaya II, Yakushka VP. 2002. Map 17.

Physiographic division (in European decimal division system). In: Myasnikovich MU,

Shymau UM et al. (eds), National atlas of Belarus: 152. Belkartahrafiya; KPZRHiK: Minsk. [in

Belarusian]

Kotiranta H, Saarenoksa R. 2000. Corticioid fungi (Aphyllophorales, Basidiomycetes) in Finland.

Acta Bot. Fennica 168: 1-55.

Kotiranta H, Saarenoksa R. 2005. Ceratobasidium and Oliveonia (Basidiomycota, Aphyllophorales)

in Finland. Ann. Bot. Fennici 42: 237-245.

Kotiranta H, Saarenoksa R, Kytovuori I. 2009. Aphyllophoroid fungi of Finland: A check-list with

ecology, distribution, and threat categories [Norrlinia 19]. Botanical Museum, Finnish Museum

of Natural History: Helsinki. 223 pp.

Kubayashi T, Maekawa N. 2001. Identification and pathogenicity of the fungus isolated from butt

rot of Japanese cypress, Chamaecyparis obtusa. J. Gen. Plant. Pathol. 67: 262-267. doi:10.1007/

PL00013027

Kifer N, Lovas PS, Senn-Irlet B. 2004. Diversity of wood-inhabiting fungi in natural beech forests

in Transcarpathia (Ukraine): a preliminary survey. Mycologia Balcanica 1: 129-134.

Larsson KH. 1992. The genus Trechispora (Corticiaceae, Basidiomycetes). Dissertation. Géteborg.

Unusual corticioids from Belarus... 399

Larsson KH. 1996. Taxonomy of Trechispora farinacea and proposed synonyms II. Species with a

smooth hymenophore. Nordic J. Bot. 16(1): 73-82. doi:10.1111/j.1756-1051.1996.tb00217.x

Liberta AE. 1973. The genus Trechispora (Basidiomycetes, Corticiaceae). Can. J. Bot. 51(10):

1871-1892. doi:10.1139/b73-240

Lin SH, Chen ZC. 1990. The Corticiaceae and the resupinate Hydnaceae of Taiwan. Taiwania 35(2):

69-111.

Lombard FF, Burdsall HH, Gilbertson RL. 1975. Taxonomy of Corticium chrysocreas and Phlebia

livida. Mycologia 67(3): 495-510. doi:10.2307/3758388

Maekawa N. 1993. Taxonomic study of Japanese Corticiaceae (Aphyllophorales) I. Rept. Tottori

Mycol. Inst. 31: 1-149.

Maekawa N. 1994. Taxonomic study of Japanese Corticiaceae (Aphyllophorales) Il. Rept. Tottori

Mycol. Inst. 32: 1-123.

Malysheva VE, Malysheva EF. 2008. The higher basidiomycetes in forest and grassland communities

of Zhiguli. KMK Scientific Press: Moscow, St. Petersburg. 243 pp.

Minter DW (ed.) 2010. Cybertruffle’s robigalia. Observations of fungi and their associated

organisms [website]. Retrieved at <http://www.cybertruffle.org.uk/robigalia/eng/ index.htm>

11 Nov 2010.

Minter DW, Mena Portales J, Rodriguez-Hernandez M, Iglesias Brito H, Camino Vilaré M,

Mercado Sierra A. (2002). Electronic distribution maps of Caribbean fungi [website, version

1.00]. <http://www.biodiversity.ac.psiweb.com/carimaps>.

Nakasone KK, Gilbertson RL. 1982. Three brown-rot fungi in the Corticiaceae. Mycologia 74(4):

599-606.

Nikolajeva TL. 1961. Familia Hydnaceae. Flora plantarum cryptogamarum URSS. 6: Fungi (2). Typ.

et imp. Acad. Sc. URSS: Moscow, Leningrad. 433 pp. [in Russian]

Parmasto E. 1965. Corticiaceae URSS. I. Descriptiones taxorum novarum. Combinationes novae.

Eesti NSV Tead. Acad. Toim., Biol. 14(2): 220-233.

Pennycook SR, Galloway DJ. 2004. Checklist of New Zealand “fungi”. Fungi of New Zealand 1:

401-488. Fungal Diversity Press: Hong Kong.

Roberts P. 1999. Rhizoctonia-forming fungi: A taxonomic guide. The Herbarium, Royal Botanic

Gardens: Kew. 239 pp.

Roberts P. 2000. Corticioid fungi from Korup National Park, Cameroon. Kew Bulletin 55(4):

803-842. doi:10.2307/4113628

Ryvarden L, Stokland J, Larsson KH. 2003. A critical checklist of corticioid and poroid fungi of

Norway. Synopsis Fungorum 17: 1-109.

Telleria MT, Melo I, Duefias M, Salcedo I, Cardoso J, Rodriguez-Armas JL, Beltrén-Tejera E.

2008. Corticioid fungi (Basidiomycota) from Madeira Island. <http://www.mycotaxon. com/

resources/checklists/telleria-v106-checklist.pdf>. (Summary of web publication: Mycotaxon

106: 419-422.)

Telleria MT; MeloI, Duefias M, Rodriguez-Armas JL, Beltran-Tejera E, Cardoso J, Salcedo I. 2009a.

Diversity and richness of corticioid fungi (Basidiomycota) on Azores Islands: a preliminary

survey. Nova Hedwigia 88(3-4): 285-308. doi:10.1127/0029-5035/2009/ 0088-0285

Telleria MT, Melo I, Duefias M, Salcedo I, Cardoso J, Rodriguez-Armas JL, Beltran-Tejera E. 2009b.

Corticioid fungi (Basidiomycota) from the Azores Islands: Flores and Séo Miguel. <http://

www.mycotaxon.com/resources/checklists/telleria-v109-checklist.pdf>. (Summary of web

publication: Mycotaxon 109: 141-144.)

Vries BWL de. 1987. Some new corticioid taxa. Mycotaxon 28(1): 77-90.

Wu SH. 1990. The Corticiaceae (Basidiomycetes) subfamilies Phlebioideae, Phanerochaetoideae and

Hyphodermoideae in Taiwan. Acta Bot. Fenn. 142: 1-123.

A00 ... Yurchenko & Kotiranta

Yurchenko E. 2008. Corticioid fungi (Basidiomycota) on living wooden plants in Belarus: species

inventory and host colonization strategies. Botanica Lithuanica 14(3): 177-189.

Yurchenko EO, Kotiranta H. 2006. Rare corticioid fungi (Basidiomycetes, Aphyllophorales) from

central Belarus. Mycena 6: 67-88.

Yurchenko EO, Kotiranta H. 2007. Rare corticioid fungi (Basidiomycetes, Aphyllophorales) from

northern Belarus. Mycena 7: 20-47.

Zerova MYa, Radziyevs’ kyi HH, Shevchenko SV. 1972. Fungi of Ukraine identification book. T. 5.

Basidiomycetes. Book 1. Exobasidiales, Aphyllophorales, Cantharellales. Naukova dumka: Kyiv.

240 pp. [in Ukrainian]

MYCOTAXON

Volume 115, pp. 401-406 January-March 2011

DOT: 10.5248/115.401

Conidial morphology changes in four Phyllosticta species

JING JIN

Agronomy and Plant Protection College, Qingdao Agricultural University, Qingdao 266109 China

CORRESPONDENCE TO: caroljin8100@ 163.com

AssTRACT — Production of pycnidia and conidia by Phyllosticta theacearum, Phyllosticta

sp. (ex Euonymus) and Phyllosticta sp. (ex Portulaca) (grown on PDA), and P. cruenta (from

specimens) was studied. On PDA, conidial appendages of Phyllosticta sp. (ex Portulaca)

disappeared completely after 16 days, of P theacearum after 29 days, and of Phyllosticta sp.

(ex Euonymus) after 14 days. In slide preparations mounted in water, appendages of all four

species persisted; the appendages of P. cruenta and Phyllosticta sp. (ex Euonymus) became

2-4 times longer within 30 minutes, while those of Phyllosticta sp. (ex Portulaca) and

P. theacearum remained unchanged.

Key worps — caducous, extend, identification, anamorph, Ascomycota, Phoma

Introduction

Species of the anamorphic ascomycete genus Phyllosticta Pers. have often

been recorded as plant pathogens, saprobes, and endobionts (Liu & Lu 2007,

Okane et al. 2003, Punithalingam 1974). Identification is highly problematic,

as few characters are available to separate different species. Sometimes a

single difference in conidial morphology, such as thickness of the mucoid

layer surrounding the conidium or appendage shape or size, has been used

to distinguish different species (Motohashi et al. 2008a,b, Nag Raj 1993,

Punithalingam & Woodhams 1982, Aa & Vanev 2002, Wulandari et al. 2009).

There have also been frequent confusions between Phyllosticta and Phoma,

which have many morphological similarities. The key distinctions between these

two genera are the mucoid sheath and appendage, reported for Phyllosticta but

not for Phoma. Those two structures are, however, delicate, faint, colourless,

and easily overlooked under the poorly contrasting conditions of bright field

microscopy. In the past, that has made misidentifications between Phyllosticta

and Phoma frequent. With improvements in the quality of microscopes and

the wide availability of phase contrast and differential interference contrast

optics, it is now easier to detect mucoid sheaths and appendages. But there is

402 ... Jin

an additional problem: in some species of Phyllosticta the appendages can be

caducous even in fresh material and cultures (Aa 1973).

The objectives of the present paper are therefore to report preliminary

observations about the time span during which appendages can be observed,

and to record some changes that can occur in appearance of appendages

during that period. As the species used in this study are not well documented,

the opportunity is also taken to provide illustrations and descriptions of

appearances in pure culture.

Materials & methods

Isolates were obtained using standard phytopathological techniques, and for three

species pure cultures were established (P. cruenta failed because of contamination

by bacteria) and incubated at 28°C in the dark. Slants on PDA were preserved at 4°C

in a refrigerator. Fungal identifications were based on specific literature such as the

contributions as Aa (1973), Aa & Vanev (2002) and Nag Raj (1993) among others. All

slides were prepared using sterile technique. Observations of pycnidia and conidia were

made on subcultures derived from original slants. Starting from 5 days after making

the subculture, each Petri dish was examined daily for pycnidia. When pycnidia

were detected, a slide was prepared to check for presence of conidia. The date of first

appearance of conidia was then noted. From first appearance of conidia, slides were

prepared daily to observe appendages. Two key dates were noted: that on which at

least some conidia no longer had appendages, and that on which no conidia remained

with visible appendages. Thereafter observations were discontinued. Squash mounts

of pycnidia were also prepared in water to observe conidial appendages. Each slide

prepared in this way was then examined at three minutes intervals for 30 minutes, and

the condition of appendages noted and photographed using bright field, phase contrast,

and differential interference contrast microscopy. Where no change in appendage

appearance was noted, the slide was then placed on moist filter paper in a Petri dish and

re-observed every 30 minutes up to 3 hours. Material that still showed no change was

then re-observed daily for three days.

SPECIMENS EXAMINED — Phyllosticta cruenta (Fr.) J. Kickx f.: CHINA, Shandong: Kunyu

Mountain, in diseased leaves of Polygonatum odoratum var. pluriflorum (Miq.) Ohwi

(Convallariaceae), 37°17°04.76"N, 121°44’49.24”E, 284 m, 12 July 2007, MHQAU0134.

Phyllosticta theacearum Aa: CHINA, Shandong: Laoshan Mountain, in diseased leaves

of Thea sinensis L. (Theaceae), 36°11700.42”N, 120°40°49.50"E, 79 m, 25 April 2008,

MHQAU0192, JJ 196.

Phyllosticta sp. (Euonymus): CHINA, Shandong: campus of Qingdao Agricultural

University, in diseased leaves of Euonymus japonicus Thunb. (Celastraceae),

36°19°16.50"N, 120°2401.62”E, 9 m, 22 July 2009, MHQAU0248, JJ243.

Phyllosticta sp. (Portulaca): CHINA, Shandong: campus of Qingdao Agricultural

University, as endobiont from stem of Portulaca oleracea L. (Portulacaceae),

36°19 1L.ODN, 120°2358.18"E, 9 m, 19 July 2008, JJ219.

All the specimens and isolates are deposited in Mycology Herbarium, Qingdao

Agricultural University (MHQAU).

Conidia in Phyllosticta ... 403

Results

Appearance of cultures on PDA

Phyllosticta theacearum: mycelium immersed and superficial, initially pale

grey, gradually turning greenish black, dense, floccose, margin undulate with

abundant submerged mycelium (Fic. 1A); reverse black (Fic. 1B).

Phyllosticta sp. (Euonymus): colonies were initially pale yellow, eventually

turning grey with thin submerged mycelium; aerial mycelium scanty, sparse,

thin; margin irregular with sparse submerged mycelium (Fic. 1N); reverse with

a grey centre surrounded by a black ring and a grey perimeter (Fic. 10).

Phyllosticta sp. (Portulaca): mycelium immersed and superficial, white at

first, becoming greyish black; surface covered by a thin mat of whitish aerial

mycelium, dense, flat, fissured, with a clearly-defined edge (Fic. 1R); reverse

greyish black (Fic. 1S).

Production of pycnidia and conidia on PDA

Phyllosticta sp. (Portulaca) produced pycnidia and conidia in 8 days;

Phyllosticta sp. (Euonymus) produced pycnidia and conidia in 7-8 days;

P. theacearum produced pycnidia and conidia in 14 days.

Loss of appendages with time

Appendages of P. theacearum, Phyllosticta sp. (Euonymus), and Phyllosticta

sp. (Portulaca) disappeared with ageing of colonies on PDA. Conidia of

Phyllosticta sp. (Portulaca) with no visible appendages began to be observed 5

days after conidia were first sighted, and by 8 days no appendages could be seen.

Conidia of Phyllosticta sp. (Euonymus) with no visible appendages began to be

observed 3-4 days after conidia were first sighted, and by 6 days no appendages

could be seen. Conidia of P. theacearum with no visible appendages began to be

observed 10 days after conidia were first sighted, and by 15 days no appendages

could be seen.

Changes in appearance of appendages in water

Appendages of Phyllosticta sp. (Portulaca) (Fic. 1T) and P. cruenta (Fic. 1G,

H) were initially about 50% of the length of conidia. Appendages of Phyllosticta

sp. (Euonymus) (Fic. 1P) and P. theacearum (Fic. 1C) were initially between

50% and 100% of the length of conidia. In water mount slides, appendages of

P. cruenta and Phyllosticta sp. (Euonymus) extended, while those of Phyllosticta

sp. (Portulaca) (Fic. 1T) and P. theacearum (Fic. 1D) remained unchanged,

retaining their original length even in water for three days. Appendages of P.

cruenta began to extend after 6 minutes in water (Fic. 11) and became 3-4

times the original length in 18-30 min (Fic. 1J, K, arrows). After that, no

further extension occurred. In P. cruenta, the conidia contained small greenish

guttules (Fic. 1G-H) which, with time immersed in water, fused into two large

drops (Fic. 1J, K). Guttules in the other three species did not fuse. Appendages

404 ... Jin

of Phyllosticta sp. (Euonymus) extended to 2-3 times their original length in

12-30 min (Fic. 1Q, arrow) and no change occurred thereafter.

Discussion

The presence or absence of appendages is routinely used to distinguish

Phyllosticta species (Nag Raj 1983, Punithalingam & Woodhams 1982, Aa

1973, Weidemann et al. 1982). Aa (1973), however, reported that Phyllosticta

appendages may be caducous in freshly collected specimens and even in

pure cultures, being usually visible only on a proportion of the conidia. For

cultures on PDA, the present results confirm that appendages of some species

in Phyllosticta can disappear with time. Prior to the present study, apparently

nothing was known about Phyllosticta appendage longevity on artificial media.

For all three Phyllosticta species studied here on PDA, the longest period of

appendage visibility lasted no longer than one month. Earlier reports of

Phyllosticta species lacking appendages may need to be reviewed in the light

of this result. Longevity of appendages in cultures on other artificial media

commonly used to grow Phyllosticta species also needs to be determined, and it

may be advisable to record the age of cultures used when describing Phyllosticta

appendages.

When mounted in water, appendages of the four species of Phyllosticta

in the present study remained persistent, but responded differently. Those

of P. theacearum and Phyllosticta sp. (Portulaca) kept their original length in

water for several days, while those P. cruenta and Phyllosticta sp. (Euonymus)

extended 2-4 times their original length in a short time (12-30 minutes).

This phenomenon may explain why in earlier reports there is sometimes

considerable divergence in the stated length of conidial appendages in the same

species. Aa (1973), for example, reported that conidia of P. vaccinii were 8-12 x

5-8 um and had appendages usually 4-8 um long and sometimes up to 17 um

long, while Weidemann et al. (1982), studying the same species, reported larger

measurements of spore appendage lengths. ‘They described appendage lengths

as ranging from 3-70 um for conidia 8-13 x 7-9 um in size. In another species

P. elongata, Weidemann et al. (1982) reported appendages varying in length

from 4-120 um. Unfortunately, the time elapsed between preparing the slide

and measuring the appendages was not stated. Earlier reports of appendage

lengths should therefore be treated with caution. At present it is not clear if this

phenomenon of extending appendages is widespread in Phyllosticta, or present

only in some species. Given its potential impact on Phyllosticta identification,

more species could usefully be studied.

The identity of the Phyllosticta spp. on Euonymus japonicus and on Portulaca

oleracea merits discussion. Numerous taxa described as Phyllosticta spp. from

Euonymus belong in other genera or are of dubious application (Aa & Vanev

Conidia in Phyllosticta ... 405

PLaTE 1 Four species of Phyllosticta. Phyllosticta theacearum: (A) upper colony; (B) converse

colony; (C) conidia; (D) conidia after three days in water. Phyllosticta cruenta: (E) symptom on the

leaf of Polygonatum odoratum var. pluriflorum; (F) pycnidia; (G,H) conidia; (I) conidia after 6 min.

in water; (J,K) conidia after 18-30 min. in water. Phyllosticta sp. (on Euonymus): (L,M) pycnidia

on the leaf of Euonymus japonicus; (N) upper colony; (O) converse colony; (P) conidia; (Q)

conidia after 12-30 min. in water. Phyllosticta sp. (on Portulaca): (R) upper colony; (S) converse

colony; (T) conidia. (C,G,J under light field; D,H,I,K,P,Q,T under phase contrast field.) Scale bars:

A,B,E,L,N,O,R,S = 2.5 cm; F = 1 mm; M = 100 wm; C,D,G-K,P,Q,T = 10 um.

2002). Phyllosticta euonymi-japonici L.L. Liu & G.Z. Lu is apparently the

only species of Phyllosticta sensu stricto described from Euonymus; it differs

from the present species in shape and dimension of conidia. The conidia of

P. euonymi-japonici are ellipsoid to ovoid, 10-12.5 x 7.5-10 um, while those of

406 ... Jin

Phyllosticta sp. (Euonymus) are clavate and 15-23 x 6-8 um. It therefore seems

possible that the present species is undescribed. Phyllosticta sp. (Portulaca) may

also represent an undescribed species. There is no named species of Phyllosticta

recorded on Portulaca, but Batista & Vital (1952: 57) reported Phyllosticta sp. on

P. oleracea from Brazil. ‘There is insufficient information to determine whether

the Brazilian fungus is a species of Phyllosticta sensu stricto, or to compare it

with our Portulaca isolate.

Acknowledgments

The author thanks Dr. Katarina Pastirtéd4kova (Nitra, Slovakia) and Dr.

Keiichi Motohashi (Tokyo, Japan) for pre-submission reviewing the manuscript and is

grateful to Dr. David Minter for checking the English translation and valuable comments

on the manuscript. Ms Jun Yang, a student in the Plant Protection Department of

Qingdao Agricultural University in 2009 assisted with some of the experiments. This

project was supported by National Natural Science Foundation of China (30500004).

Literature cited

Aa HA van der. 1973. Studies in Phyllosticta I. Stud. Mycol. 5: 1-110.

Aa HA van der, Vanev S. 2002. A revision of the species described in Phyllosticta. Centraalbureau

voor Schimmelcultures: Utrecht (Netherlands). 510 p.

Batista AC, Vital AF 1952. Monografia das espécies de Phyllosticta em Pernambuco. Bol. Secr.

Agric. Ind. Com. Est. Pernambuco 19: 1-80.

Liu LL, Lu GZ. 2007. Phyllosticta euonymi-japonici sp. nov., an endophytic fungus isolated from

Euonymus japonicus. Mycosystema 26: 171-173.

Motohashi K, Araki I, Nakashima C. 2008a. Four new species of Phyllosticta, one new species

of Pseudocercospora, and one new combination in Passalora from Japan. Mycoscience 49:

138-146. doi:10.1007/s10267-007-0395-z

Motohashi K, Nishikawa J, Akiba M, Nakashima C. 2008b. Studies on the Japanese species belonging

to the genus Phyllosticta (1). Mycoscience 49: 11-18. doi:10.1007/s10267-007-0386-0

Nag Raj TR. 1993. Coelomycetous anamorphs with appendage-bearing conidia. Mycologue

Publications: Waterloo (Canada). 1101 p.

Okane I, Lumyong S, Nakagiri A, Ito T. 2003. Extensive host range of an endophytic fungus

Guignardia endophyllicola (anamorph: Phyllosticta capitalensis). Mycoscience 44: 353-363.

doi:10.1007/s10267-003-0128-x

Punithalingam E. 1974. Studies on Sphaeropsidales in culture II. Mycol. Pap. 136: 1-63.

Punithalingam E, Woodhams JE. 1982. The conidial appendage in Phyllosticta spp. Nova Hedwigia

36: 151-175.

Weidemann GJ, Boone DM, Burdsall Jr HH. 1982. Taxonomy of Phyllosticta vaccinii (coelomycetes)

and a new name for the true anamorph of Botryosphaeria vaccinii (Dothideales, Dothioraceae).

Mycologia 74: 59-65. doi:10.2307/3792629

Wulandari NF, To-anun C, Hyde KD, Duong LM, de Gruyter J; Meffert JP, Groenewald JZ, Crous

PW. 2009. Phyllosticta citriasiana sp. nov., the cause of Citrus tan spot of Citrus maxima in Asia.

Fungal Divers. 34: 23-39.

MYCOTAXON

Volume 115, pp. 407-411 January-March 2011

DOT: 10.5248/115.407

Notes on some Japanese smut fungi. 5.

Anthracoidea blepharicarpae and A. dispalatae, spp. nov.

CVvETOMIR M. DENCHEV’, TEODOR T. DENCHEV',

MuNEO MICHIKAWA? & MAKOTO KAKISHIMA3

'Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Sciences,

2 Gagarin St., 1113 Sofia, Bulgaria

?College of Biological Sciences, University of Tsukuba, Tsukuba, Ibaraki 305-8572, Japan

3Graduate School of Life and Environmental Sciences, University of Tsukuba,

Tsukuba, Ibaraki 305-8572, Japan

* CORRESPONDENCE TO: cmdenchev@yahoo.co.uk

ABsTRACT — Two new smut fungi, Anthracoidea blepharicarpae on Carex blepharicarpa and

A. dispalatae on Carex dispalata, are described and illustrated from Japan.

Key worps — Anthracoideaceae, taxonomy, Ustilaginomycetes

Introduction

During a taxonomic revision of the genus Anthracoidea in Japan, we founda

specimen of a verruculose-spored species with relatively large spores on Carex

blepharicarpa. After comparison with the known species of Anthracoidea on

Carex sect. Mitratae, we consider this fungus new. The host of another Japanese

specimen, originally identified as Anthracoidea caricis on Carex sp., was found

to represent Carex dispalata, which is a member of the sect. Anomalae. Species

of Anthracoidea have been considered by Vanky (1979) to be restricted to host

plants belonging to the same or closely related sections of Carex. As no species

of Anthracoidea has previously been reported on a representative of Carex sect.

Anomalae, we propose a new species for this collection.

Material & methods

Material from the mycological collections the Graduate School of Life and

Environmental Sciences, University of Tsukuba, Tsukuba (TSH), and Faculty of

Agriculture, Hokkaido University, Sapporo (SAPA), was examined under the light (LM)

and scanning electron (SEM) microscopes. For LM observations, spores were mounted

in lactophenol solution on glass slides, gently heated to boiling point, and then cooled.

A08 ... Denchev & al.

Spore measurements are given in the form: min-max (mean + 1 standard deviation).

For SEM, spores were attached to specimen holders by double-sided adhesive tape and

coated with gold with an ion sputter. The surface structure of spores was observed at 10

kV and photographed with a JEOL SM-6390 scanning electron microscope.

Taxonomy

Anthracoidea blepharicarpae Denchevy, T. Denchev & Kakish., sp. nov. Fics 1-2

MycoBank MB 519311

Sort in ovariis in inflorescentia dispersi, sicut corpora ellipsoidea vel basi cuneata, nigra,

3-4 mm longa, in superficie pulverei. Sporaz a fronte visus late ellipticae, irregulares

vel angulares, 18-30 x 14-25 (24.4+2.1 x 20.741.8) um, a latere visus 12.5-15 um,

rufobrunneae vel atro-rufobrunneae; paries inaequaliter incrassatus, 1-3 um crassus,

plerumque 1-3 (-5) gibberis internis, et interdum etiam maculis lucem refringentibus;

superficie verruculosa.

Holotypus in matrice Carex blepharicarpa Franch.: JAPONIA, Hokkaido, Otaru (Ishikari

Prov.), Mt. Tengu, 19. VI. 1932, leg. Otani, Yabe, Takee & Murayama (SAPA, sine num.).

EryMo_oey: the name refers to the host species.

Sor! in ovaries, scattered in the inflorescence, as ellipsoidal or cuneate at base,

black, hard bodies, 3-4 mm long, when young covered by a thin membrane,

later becoming exposed; spore mass of the mature sori powdery on the surface.

Spores flattened, in plane view broadly elliptical, irregular or moderately

angular in outline, sometimes elliptical or oval, in plane view 18-30 x 14-25

(24.442.1 x 20.741.8) um (n = 150), as an exception up to 34 um long, in side

view 12.5-15 um thick, middle to dark reddish brown, wall unevenly thickened,

1-3 um thick, thickest at the angles, with 1-3 (-5) internal swellings, sometimes

with light-refractive spots; verruculose. SPORE GERMINATION unknown.

DisTRIBUTION — On Cyperaceae: Carex — subgen. Carex, sect. Mitratae:

C. blepharicarpa, Asia (Japan - Hokkaido).

COMMENTS — Carex blepharicarpa is an eastern Asian species distributed in

Japan, Korea, Kuril Islands, and Sakhalin Island.

Anthracoidea blepharicarpae differs from the two other members of

Anthracoidea on sedges of sect. Mitratae, A. microsora (Syd.) Kukkonen and

A. caryophylleae Kukkonen, in having larger spores.

The mean values of the spore length of 17 Japanese specimens of A. microsora

as measured by us fell into a range of 18.8-20.7 um. The mean value of the

spore length of these specimens was 19.6+1.7 tum.

The mean values of the spore length of 18 eastern Asian specimens of

A. caryophylleae (14 Japanese, two Korean, and two from the Sakhalin Island)

as measured by us fell into a range of 18.6-21.7 um. The mean value of the

spore length of these specimens was 20.4+1.7 um. Both mean values of the

spore length of A. microsora and A. caryophylleae differed significantly from the

respective mean of 24.4+2.1 um for A. blepharicarpae.

Anthracoidea spp. nov. (Japan) ... 409

Fics 1-2. Spores of Anthracoidea blepharicarpae on Carex blepharicarpain LM and SEM (Holotype).

Fics 3-4. Spores of Anthracoidea dispalatae on Carex dispalata in LM and SEM (Holotype).

Scale bars: 1, 3 = 10 pum; 2, 4=5 wm.

A10 ... Denchev & al.

Anthracoidea caryophylleae is a species originally described from Europe

(Finland, Kukkonen 1963), where it is a common species (especially in Central

and East Europe, and the Balkan Peninsula). The mean values of the spore

length of European specimens were in a range of 16.9-20.5 um (Kukkonen

1963: 18, Nannfeldt 1979, Vanky 1979: 229, Scholz & Scholz 1988, Denchev

2001) (cfr with the above noted range of 18.6-21.7 tm). It seems that the spores

of the European specimens of A. caryophylleae are shorter than those of the

eastern Asian specimens.

Key to the Anthracoidea species on subgen. Carex sect. Mitratae

1 Spores 18-30 (-34) um long, spore mean length more than 22.5 um

EAE ated Hed RSET LSE Nd Neca 8 tee Aen eg A A. blepharicarpae

1* — Spores 15-25 (-27.5) um long, spore mean length less than 22.0 um ......... 2

2 Spores finely verruculose, warts up to 0.3 um high; profile smooth

OLMnearl VSO? lane Sree ay Rants nab eee a eceea te SRA A. caryophylleae

2* — Spores verruculose to verrucose, warts 0.2-0.6 um high,

affecting the spore profile ....... 0... eee ce eee eee A. microsora

Anthracoidea dispalatae Denchev, T. Denchev & Kakish., sp. nov. Fics 3-4

MycoBank MB 519312

Sorr in ovariis in inflorescentia dispersi, sicut corpora subglobosa vel ovoidea, nigra,

1.8-2 mm longa, in superficie pulverei. Sporaz a fronte visus irregulares, interdum

suborbiculares vel late ellipticae, 19-26 x 16.5-23 (22.3+1.5 x 19.3+1.5) um, a latere visus

11.5-14 um, rufobrunneae vel atro-rufobrunneae; paries inaequaliter incrassatus, 1.5-2.5

(-3.3) um crassus, plerumque sine gibberis internis, interdum 1 gibba interna, sine maculis

lucem refringentibus; superficie verruculosa.

Holotypus in matrice Carex dispalata Boott ex A. Gray: JAPONIA, Honshu, Niigata Pref.,

Gosen-shi (Nakakanbara-gun), 2.V1.1912, leg. K. Yoshino (TSH, sine num.).

EryMo.ocy: the name refers to the host species.

Sori in ovaries, scattered in the inflorescence, as subglobose or ovoid, black,

hard bodies, 1.8-2 mm long, when young covered by a thin membrane, later

becoming exposed; spore mass of the mature sori powdery on the surface.

Sporss flattened, in plane view moderately irregular, sometimes suborbicular or

broadly elliptical in outline, in plane view 19-26 x 16.5-23 (22.341.5 x 19.3+1.5)

um (n = 150), in side view 11.5-14 tm thick, middle to dark reddish brown,

wall slightly unevenly thickened, 1.5-2.5 (-3.3) tm thick, without internal

swellings, sometimes with one, without light-refractive spots; verruculose. In

SEM warts often forming small groups or short rows; the wall between the

warts finely and irregularly punctate. SPORE GERMINATION unknown.

DisTRIBUTION — On Cyperaceae: Carex — subgen. Carex, sect. Anomalae:

Carex dispalata, Asia Japan - Honshu).

Anthracoidea spp. nov. (Japan) ... 411

COMMENTS — Based on Egorova (1999), Carex dispalata is a representative

of sect. Anomalae sensu lato, which includes some smaller sections, described

by Japanese authors (e.g., Glaucaeformes Ohwi, Molliculae Ohwi, Confertiflorae

Franch. ex Ohwi, Dispalatae Ohwi, Alliiformes Akiyama). In a recently

published monograph of China (Dai et al. 2010), Carex dispalata is included

in sect. Confertiflorae. Carex dispalata is distributed in the Far East of Russia,

Sakhalin Island, south Kuril Islands, Japan, Korea, and NE and Central China.

Acknowledgements

We gratefully acknowledge Dr Kalman Vanky (Herbarium Ustilaginales Vanky,

Tubingen, Germany) and Dr Roger G. Shivas (Agri-Science Queensland, Australia) for

critically reading the manuscript and serving as pre-submission reviewers; and Director

and Curator of SAPA (Herbarium of Hokkaido University, Sapporo) for loan of the cited

specimen.

Literature cited

Dai LK, Liang SY, Zhang SR, Tang YC, Koyama T, Tucker GC. 2010. Carex L. 285-461, in ZY Wu

et al. (eds), Flora of China, vol. 23 (Acoraceae through Cyperaceae). Science Press, Beijing, and

Missouri Botanical Garden Press, St. Louis.

Denchev CM. 2001. Classis Ustomycetes (Ordines Tilletiales, Ustilaginales et Graphiolales). 1-286,

in V Fakirova (ed.), Fungi Bulgariae, vol. 4. Editio Academica “Prof. Marin Drinov” & Editio

Pensoft, Sofia. (In Bulgarian with an English summary)

Egorova TV. 1999. The sedges (Carex L.) of Russia and adjacent states (within the limits of the

former USSR). St. Petersburg State Chemical-Pharmaceutical Academy, St. Petersburg &

Missouri Botanical Garden Press, St. Louis. 773 pp.

Kukkonen I. 1963. Taxonomic studies on the genus Anthracoidea (Ustilaginales). Annales Botanici

Societatis Zoologicae Botanicae Fennicae “Vanamo” 34(3): 1-122.

Nannfeldt JA. 1979. Anthracoidea (Ustilaginales) on Nordic Cyperaceae-Caricoideae, a concluding

synopsis. Symbolae Botanicae Upsalienses 22(3): 1-41.

Scholz H, Scholz I. 1988. Die Brandpilze Deutschlands (Ustilaginales). Englera 8: 1-691.

Vanky K. 1979. Species concept in Anthracoidea (Ustilaginales) and some new species. Botaniska

Notiser 132: 221-231.

MYCOTAXON

Volume 115, pp. 413-423 January-March 2011

DOT: 10.5248/115.413

Notes on two species of Boletellus (Boletaceae, Boletales)

from China

NiAn-Kali ZENG??? & ZHU L. YANG**

'Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany,

Chinese Academy of Sciences, Kunming 650204, China

2Department of Pharmacy, Hainan Medical University, Haikou 571101, China

3Graduate University of Chinese Academy of Sciences, Beijing 100039, China

CORRESPONDENCE TO *: fungi@mail.kib.ac.cn

AsstTract — Based on studies of the types and additional materials, Boletellus emodensis

and B. obscurecoccineus are described and illustrated in detail. Strobilomyces annamiticus

is lectotypified and synonymized with B. emodensis; specimens from China regarded as

B. ananiceps are confirmed to represent B. emodensis; B. puniceus and Boletus megasporus,

originally described from southwestern China, are conspecific with B. obscurecoccineus.

Key worps — morphology, revision, taxonomy, type studies

Introduction

Species of Boletellus Murrill are widely distributed and highly diverse in

China, and about twenty-five taxa have been reported from the country (Chiu

1948, 1957; Teng 1963; Bi et al. 1982, 1984, 1997; Wen 1985; Zang 1985; Zang

& Yuan 1999; Zang et al. 1999; Li & Song 2003). Recently, some field and

laboratory observations on the species of genus Boletellus from southern and

southwestern China were made, and several herbarial specimens including

the types of two species were re-examined. ‘The field observations and critical

re-examinations indicate that some purported species of the genus are later

synonyms. Thus, our new findings update characteristics and distributions for

B. emodensis and B. obscurecoccineus.

Materials & methods

Basidiomata were collected during the rainy season (April-September) in southern

and southwestern China. Specimens were described and/or photographed in the

field, dried, and then deposited in the Herbarium of Cryptogams, Kunming Institute

of Botany, Chinese Academy of Sciences (HKAS). Additional collections from the

414 ... Zeng & Yang

Farlow Herbarium, Harvard University (FH), and the Fungal Herbarium of Guangdong

Institute of Microbiology (GDGM) were examined. 5% KOH was used as a mounting

medium for microscopic studies. The notations “basidiospores (n/m/p)” indicate that

the measurements were made on n basidiospores from m basidiomata of p collections.

Dimensions of basidiospores including the ornamentation are given using notation of

the form (a) b-c (d); the range b-c contains a minimum of 90% of the measured values,

and extreme values a and d are given in parentheses. Q refers to the length/breadth

ratio of basidiospores; Q_ refers to the average Q of basidiospores + sample standard

deviation. All line drawings of microstructures were made from rehydrated material.

Taxonomy

Boletellus emodensis (Berk.) Singer, Annls mycol. 40: 19, 1942. Figs. 1-11

= Boletus emodensis Berk., Hook. J. Bot. Kew Gard. Misc. 3: 48, 1851.

= Strobilomyces annamiticus Pat., Bull. Soc. Mycol. Fr. 25: 6, 1909.

= Boletellus annamiticus (Pat.) E.-J. Gilbert, Les Bolets: 107, 1931.

[The description below is based on HKAS 59211, HKAS 59213, GDGM 13229, HKAS

59214, HKAS 59212, HKAS 37832, and HKAS 54741.]

MACROCHARACTERS — BASIDIOMATA medium-sized. Piteus 4.5-9 cm in

diameter, convex to applanate; surface dry, purple to dull crimson, usually

fading to pale fawn in age, finely tomentose when young, then cracking into

large squamules; margin at first extended into a false veil and covering the

pores, then splitting radially, appendiculate with false veil remnants; context

0.8-1.1 cm thick in the center of pileus, yellowish, cyanescent strongly and

rapidly when injured. HyMENoOPHORE poroid, yellow, cyanescent strongly

and rapidly when injured, depressed around apex of stipe; pores 0.1-0.2 cm

in diameter, simple, angular. Stipe central, 6-8 x 0.8-1 cm, cylindric, solid,

firm; surface dry, fibrous, concolorous with the pileus, but apex yellowish; base

usually enlarged and villous with white mycelium; context yellow, cyanescent

strongly and rapidly when injured. ANNULUs absent (Fics. 1-5).

MICROCHARACTERS — Basip1A 34-52 x 11-17 uum, clavate, colorless to yellowish

brown in KOH, 4-spored (occasionally 2- or 3-spored) (Fic. 6). BASIDIOSPORES

[260/13/7] (16-)18-23(-25) x (7-)8-10(-12) pm, Q = (1.70-)1.89-2.75(-2.87),

Q.= 2.28 + 0.24, yellowish to yellowish brown in KOH, elongate-subfusoid

to elongate-ellipsoid, with longitudinal or oblique ridges, 7-9 ridges visible

in lateral view; ridges up to 1-1.5 um in height, round in transverse section,

having distinct transverse striations on the ridges (Fics. 7-9). TUBE TRAMA

made up of thin-walled, colourless to yellowish hyphae 5-13 wm in width.

CHEILOCYSTIDIA 48-66 x 11-16 um, subfusiform to fusiform, thin-walled,

colorless or yellowish to yellowish brown in KOH (Fic. 10), PLEUROCYSTIDIA

70-90 x 11-18 um, subfusiform to fusiform, colorless to yellowish brown in

KOH (Fic. 6), PILEIPELLIs an intricate trichoderm composed of interwoven,

Notes on Boletellus (China) ... 415

Fics. 1-2: Basidiomata of Boletellus emodensis (HKAS 59212). 1. Immature basidioma (HKAS

59215). 2. Fruiting habit on tree stump in forest dominated by Fagaceae, Fujian, China.

Bars = 2 cm.

thin-walled, yellowish to yellowish brown hyphae; terminal cells 19-35 x 7-11

um, with round to obtuse apex (Fic. 11). PILEAL TRAMA made up of thin-

walled, colorless to yellowish hyphae 5-15 tm in diameter. CLAMps absent in

all tissues.

HABIT, HABITAT, DISTRIBUTION — Solitary or gregarious on the ground, tree

stumps or rotten wood in forests dominated by Fagaceae; originally described

from India; then reported from southeast Asia (Corner 1972, Horak 1977),

east Asia (Hongo & Izawa 1994, Chen et al. 1997, Mao 2009, An 1998), and

Australia (Young 2004).

SPECIMENS EXAMINED — VIETNAM. Tonkin: Rives du Kam-ly, 1907, det. N.T.

Patouillard, Eberhardt LBA 161 (FH 3720 pro parte, Strobilomyces annamiticus lectotype

designated here); Vallée du Da-Pounian, 1907, det. N.T. Patouillard, Eberhardt LBA

209 (FH 3720 pro parte, Strobilomyces annamiticus). CHINA. Hainan Province: Baisha

County, Yinggeling Mountain, alt. 747 m, 28 July 2009, N.K. Zeng 384 (HKAS 59211);

same location and date, alt. 841 m, N.K. Zeng 379 (HKAS 59215); Qiongzhong County,

Limushan Mountain, alt. 869 m, 4 August 2010, N.K. Zeng 829 (HKAS 59213); Ledong

County, Jianfengling Mountain, 4 October 1987, T-H. Li s. n. (GDGM 13229, as “B.

ananaeceps” in Bi et al. 1997); Guangdong Province: Zhaoging County, Dinghushan

Mountain, alt. 233 m, 9 August 2010, N.K. Zeng 867 (HKAS 59214); Fujian Province:

Zhangping County, Xingiao Town, Chengkou Village, alt. 357 m, 3 September 2009,

N.K. Zeng 674 (HKAS 59212); Yunnan Province: Jingdong County, Qincaitang, 15

September 1999, Q.B. Wang 282 (HKAS 37832); Jiangcheng County, alt. 1400 m, 29 July

2008, L.P. Tang 510 (HKAS 54741).

COMMENTS — Boletellus emodensis is well characterized by its purple to dull

crimson pileus, a yellow context in both pileus and stipe that is strongly and

rapidly cyanescent in both when injured, longitudinally ridged basidiospores

with fine cross-striations on the ridges observable with the light microscope.

Although B. emodensis is quite common throughout east and southeast Asia, it

was not well characterized until the publication by Corner (1972).

416 ... Zeng & Yang

Strobilomyces annamiticus was described based on collections from Vietnam

(Patouillard 1909) and later transferred to Boletellus by Gilbert (1931). One of

us (ZLY) studied the syntypes of S. annamiticus deposited in Farlow Herbarium,

Harvard University (FH 3720), which consist of two collections, both identified

as S. annamiticus by N.T. Patouillard. One collection (Eberhardt LBA 161) is

composed ofa single fruitbody (Fic. 5). The dried cap is about 1 cm in diameter,

convex, dark chocolate brown, covered with dull chocolate brown tomentose

squamules, and the pileal margin is appendiculate. The stipe is 7 x 0.3 cm,

with the base apparently attached to wood. ‘The basidiospores (Fic. 8) are

[20/1/1] (20-)21-24(-26) x (6.5-)7-8.5 um, Q = 2.63-3.29(-3.69), Q, = 2.95

+ 0.30, yellowish to yellowish brown in KOH, elongate-subfusoid to elongate-

ellipsoid, with longitudinal or oblique ridges, 7-9 ridges visible in lateral view,

with ridges up to 1 um in height, having indistinct transverse striations on the

ridges. The other collection (Eberhardt LBA 209) consists of a dried cap which

is 1.5-2 cm in diameter, convex to applanate, dark to blackish. ‘The stipe is 5 x

0,2-0.4cm, on rotten wood. The basidiospores (Fig. 9) are [20/1/1] (15-)16-18 x

(6.5-)7.5-8.5 pm, Q = (1.76-)1.88-2.33(-2.46), Q., = 2.10 + 0.16, yellowish

brown in KOH, elongate-subfusoid to elongate-ellipsoid, with longitudinal or

oblique ridges, 7-9 ridges visible in lateral view, with ridges up to 1 (1.5) um

in height, round in transverse section, having distinct transverse striations on

ridges.

In the protologue of Strobilomyces annamiticus, Patouillard (1909) cited two

localities that correspond exactly with the localities of the collections Eberhardt

LBA 161 and Eberhardt LBA 209. Eberhardt LBA 161 is designated here as

lectotype. Singer (1945) regarded the two Vietnamese collections as immature

basidiomata of B. emodensis, and S. annamiticus was synonymized with

B. emodensis. With our re-examination of the syntypes and field observation

on other collections, the present authors are convinced that the basidiomata

of the two Vietnamese collections are the same as immature basidiomata of

B. emodensis, because the size of basidiospores of B. emodensis may be variable

at different stages of basidioma development. For example, the basidiospores

of one immature basidioma (HKAS 59215) are [20/1/1] 15-18(-19) x 5-7 um,

with Q = (2.14-)2.29-3.17(-3.20) and Q. = 2.73 + 0.28. They are clearly much

shorter and narrower when compared to mature collections. This explains why

the basidiospores from the two Vietnamese collections are slightly narrower

(and Eberhardt LBA 209 slightly shorter) compared with mature Chinese

material and the holotype (20-24 x 8-10 um) (Pegler & Young 1971: 163)

of B. emodensis, and further confirms that S. annamiticus is a synonym of

B. emodensis, as noted by Singer (1945).

Boletellus ananiceps (Berk.) Singer, originally described from Australia, is

allied to B. emodensis. However, B. ananiceps has been noted to differ from

Notes on Boletellus (China) ... 417

Fias. 3-11: Boletellus emodensis (= B. annamiticus) [3 from HKAS 59215; 4 from HKAS 59212;

5, 8 from Eberhardt LBA 161 of FH 3720 (B. annamiticus); 6, 7, 10, 11 from HKAS 59211; 9 from

Eberhardt LBA 209 of FH 3720 (B. annamiticus)]. 3-5. Basidiomata. 6. Basidia and pleurocystidia.

7-9. Basidiospores. 10. Cheilocystidia. 11. Pileipellis. Bars: 3-5 = 2 cm, 6-11 = 20 um.

418 ... Zeng & Yang

B. emodensis by its longitudinally ridged basidiospores that lack cross-striations

on the ridges (Singer 1955, Bougher & Syme 1998, Halling & Fechner 2011).

In China, B. ananiceps was previously reported from Hainan (Bi et al. 1997)

with three cited collections (GDGM 13229, GDGM 16785, GDGM 15741).

Unfortunately, the voucher specimens GDGM 16785 and 15741 were lost

(Ms. Z.D. Xiao, personal communication). Re-examinations of GDGM

13229 showed that that collection is identical to B. emodensis in its purple to

dull crimson pileus and obvious cross-striations on the basidiospore ridges.

Therefore, whether B. ananiceps occurs in China remains to be confirmed.

Boletellus ananas (M.A. Curtis) Murrill, a species originally described from

USA, is also allied with B. emodensis. However, the pileus of the former is pink

or red when fresh and becomes pale fuscous tan when it fades; the stipe is

never red, as in B. emodensis; the squamae in B. ananas are coarse, while in

B. emodensis usually fine. Furthermore, the ridges on the basidiospores are

broader than those of B. emodensis (Halling 2010). In China, B. ananas was

previously reported from the south of China (Chiu 1948, 1957; Teng 1963;

Zang 1985; Bi et al. 1994). Judging from their descriptions, these reports may

represent B. emodensis. Thus, whether B. ananas occurs in China also needs

confirmation.

Boletellus obscurecoccineus (Hohn.) Singer, Farlowia 2:127, 1945. Fics. 12-22

= Boletus obscurecoccineus Hohn., Sber. K. Akad. Wiss. Wien,

Math.-naturw. KL, Abt. 1, 123: 88, 1914.

= Boletus puniceus W.F. Chiu, Mycologia 40(2): 217, 1948.

= Xerocomus puniceus (W.F. Chiu) EL. Tai, Syll. Fung. Sin.: 815, 1979.

= Boletellus puniceus (W.F. Chiu) X.H. Wang & P.G. Liu, Mycotaxon 84: 128, 2002.

= Boletus megasporus M. Zang, Acta Microbiol. Sin. 20(1): 30, 1980, as “magasporus”.

[The description below is based on FH 2993, HKAS 59208, HKAS 59209, and HKAS

59210.]

MACROCHARACTERS — BasIDIOMATA small to medium-sized. PiLeus 1.5-7 cm

in diameter, convex to applanate; surface dry, pink to pale crimson when fresh,

becoming dark purplish red to dark purple when dried, finely tomentose when

young, then minutely cracked; context yellowish, unchanging in color when

injured. HyMENOPHORE poroid, yellow, unchanging in color when injured,

depressed around apex of stipe; pores 0.1- 0.2 cm in diameter, simple, angular.

STIPE central, 3-5 x 0.2-0.8 cm, cylindric, slightly attenuate upwards, solid,

firm, apex yellowish, middle finely tomentose when young, then fracturing

into pale crimson squamules, with base usually enlarged and villous with white

mycelium; context whitish, unchanging in color when injured. ANNULUs absent

(Figs. 12-16).

MICROCHARACTERS — Basipia 42-55 x 8-12 um, clavate, colorless

to yellowish in KOH, 4-spored (sometimes 2- or 3-spored) (Fic. 17).

Notes on Boletellus (China) ... 419

Fics. 12-13: Basidiomata of Boletellus obscurecoccineus (HKAS 59208). 12. Fruiting habit on soil in

forest dominated by Lithocarpus, Hainan, China. 13. Ventral. Bars = 2 cm.

Basiprosporgs [140/7/4] (14-)14.5-18(-20.5) = (5-)6-8(-9.5) um, Q =

(1.81-)2.00-2.77(-3.30), Q. = 2.32 + 0.26, brownish to pale ochraceous in

KOH, elongate-subfusoid to elongate-ellipsoid, with 7-10 faintly longitudinal

ridges in lateral view, not transversely striate on ridges (Fics. 18-19). TUBE

TRAMA made up of thin-walled hyphae 4-9 um in width, colorless to yellowish

in KOH. CHEILocystTipia 32-87 x 11-17 wm, subfusiform to fusiform, thin-

walled, colorless to yellowish in KOH (Fic. 20). PLEUROCysTIDIA similar to

cheilocystidia (Fic. 17). PILEIPELLIs an epithelioid trichoderm made up of

vertically arranged, ellipsoid, occasionally sphaeropedunculate, thin-walled

(sometimes up to 1 um in thickness), yellowish to yellowish brown hyphae;

terminal cells 22-54(-90) x 9-15(-60) um, with round to obtuse apex (Fics.

21-22). PILEAL TRAMA made up of thin-walled, colorless to yellowish hyphae

6-12 um in diameter. CLAMPs absent in all tissues.

HABIT, HABITAT, DISTRIBUTION — Solitary or scattered on the ground in forests

of Lithocarpus (Fagaceae), occasionally on rotten wood; originally described

from Indonesia (Hohnel 1914: 88), and later reported from east Asia (Hongo

1970, Wen 1985, Chen et al. 1997, An 1998, Wang & Liu 2002, Yuan & Sun

2007), southeast Asia (Corner 1972, Horak 1977) and Australia (May & Wood

1997, Bougher & Syme 1998).

SPECIMENS EXAMINED — INDONESIA. Java: Tjibodas, 1908, leg. EX.R. v. Héhnel,

Boletus 1187 (FH 2993, holotype). Cain. Hainan Province: Baisha County, Yinggeling

Mountain, alt. 943 m, 26 July 2009, N.K. Zeng 328 (HKAS 59208); same location and

date, alt. 968 m, N.K. Zeng 335 (HKAS 59209); same location, alt. 824 m, 28 July 2009,

N.K. Zeng 367 (HKAS 59210).

COMMENTS — Boletellus obscurecoccineus is well characterized by its pink to

pale crimson pileus, faintly longitudinally ridged basidiospores combined with

the broad pores, and non-cyanescent context.

One of us (ZYL) studied the holotype of B. obscurecoccineus, which consists

of two and a half basidiomata. The dried cap is about 3-5 cm in diameter, the

420 ... Zeng & Yang

Fias. 14-22: Boletellus obscurecoccineus (14, 17, 20, 22 from HKAS 59210; 15, 18 from HKAS

59208; 16, 19, 21 from FH 2993, holotype).14-16. Basidiomata. 17. Basidia and pleurocystidium.

18-19. Basidiospores. 20. Cheilocystidia. 21-22. Pileipellis. Bars: 14-16 = 2 cm, 17-22 = 20 um.

Notes on Boletellus (China) ... 421

pileal surface is finely tomentose and dark purplish red to dark purple when

dried, the hymenophore is umber-brown, with pores about 1 mm in diameter,

the stipe (4-5 x 0.4-0.6 cm) attenuates slightly upwards, and the surface

is finely tomentose, whitish to ochraceous, much paler than cap (Fic. 16).

Basidia and cystidia would not rehydrate sufficiently for study. Basidiospores

(Fra. 19) are [21/1/1] (15-)16-20.5 x 7.5-8.5(-9.5) um, Q = 2.00-2.38(-2.47),

Q. = 2.20 + 0.13, brownish to pale ochraceous in KOH, elongate-subfusoid

to elongate-ellipsoid, with 7-10 faint longitudinally ridges in lateral view,

without transverse striations on ridges. The pileipellis (Fic. 21) is an epithelioid

trichoderm made up of vertically arranged, moniliform hyphae with ellipsoid,

occasionally sphaeropedunculate, thin-walled elements, often with yellowish-

brownish vacuolar pigment; terminal cells are 25-50(-90) x 10-15(-60) um,

with round to obtuse apex.

Boletus puniceus was originally described from Yunnan, China (Chiu 1948,

1957). Without examining the type of B. puniceus, Corner (1972) suspected

B. puniceus was conspecific with B. obscurecoccineus. Wang & Liu (2002) re-

examined the type of B. puniceus (HMAS3852) and found the basidiospores to

be [74/1/1] 15-18(-19.3) x (6.3-)6.7-8(-9) um, Q = (1.90-)2.05-2.54(-2.64),

Q_ = 2.30 + 0.16, with faint longitudinal ridges, and the species was transferred

to Boletellus, with Boletus megasporus included as a synonym. ‘The present

type studies showed no essential differences among B. obscurecoccineus,

B. megasporus and B. puniceus, suggesting that they are conspecific.

Mao (2000: Fig. 830) published a photo labelled as Aureoboletus [as

“Austreoboletus”| thibetanus (Pat.) Hongo & Nagas. Judging from the features

of the basidiomata in the photo, it may represent B. obscurecoccineus, as

previously noted by Yang et al. (2003).

Acknowledgments

The authors are very grateful to the following: Dr. Roy E. Halling, New York Botanical

Garden, USA, and Prof. Dr. T.H. Li, Guangdong Institute of Microbiology, China, for

serving as reviewers; Prof. Dr. D.H. Pfister, Farlow Herbarium of Harvard University,

USA, for his allowing the second author access to the specimens in the Herbarium and

use his laboratory to examine the collections; Prof. Dr. T.-H. Li, Ms. C.-Y. Deng & Ms.

Z.D. Xiao, Guangdong Institute of Microbiology, for assisting the first author to study

the Boletellus specimens deposited in the institute; Dr. Z.W. Ge, Associate Prof. L.P. Tang

& Mr. M.I. Hosen, Kunming Institute of Botany of CAS, for their suggestions on writing

this manuscript; Mr. J.Q. Li, Hainan Medical University, for his accompanying the first

author to conduct the field investigation and collection. This study was financed by the

Ministry of Science and Technology of China (2008FY110300-03-1).

Literature cited

An YH. 1998. Notes on Korean Strobilomycetaceae (II) — On Boletellus. Korean J. Mycol. 26(2):

211-229,

422 ... Zeng & Yang

Bi ZS, Lu DJ, Zheng GY. 1982. Basidiomycetes from Dinghu Mountain of China II. Some new

species of Boletaceae (1). Acta Bot. Yunnan. 4: 55-64.

Bi ZS, Li TH, Zheng GY, Li C. 1984. Basidiomycetes from Dinghu Mountain of China III. Some

species of Boletaceae (2). Acta Mycol. Sin. 3(4): 199-206.

Bi ZS, Zheng GY, Li TH. 1994. Macrofungus Flora of Guangdong Province. Guangzhou: Guangdong

Science and Technology Press.

Bi ZS, LiTH, Zhang WM, Song B. 1997. A preliminary agaric flora of Hainan Province. Guangzhou:

Guangdong Higher Education Press.

Bougher NL, Syme K. 1998. Fungi of Southern Australia. Western Australia: University of Western

Australia Press.

Chen CM, Huang HW, Yeh KW. 1997. The boletes of Taiwan (VI). Taiwania 42: 154-160.

Chiu WE. 1948. The boletes of Yunnan. Mycologia 40: 199-231. doi:10.2307/3755085

Chiu WE. 1957. Atlas of Yunnan boletes. Beijing: Science Press.

Corner EJF. 1972. Boletus in Malaysia. Singapore: Government Printer.

Gilbert EJ. 1931. Les Bolets. Paris.

Halling RE. 2010. Identification aid: Boletellus sect. Boletellus. Surveys & revisions in Boletineae.

http://www.nybg.org/bsci/res/hall/boletes/ananas_v_emodensis.html

Halling RE, Fechner NA. 2011. Toward a concept for Boletellus ananiceps. Fungimap Newsletter

A2: 3-4,

Héhnel FXR von. 1914. Fragmente zur Mykologie (XVI. Mitteilung, Nr. 813 bis 875). Sber. K.

Akad. Wiss. Wien, Math.-naturw. KL, Abt. 1, 123: 49-155.

Hongo T. 1970. Notulae mycologicae (9). Mem. Fac. Educ. Shiga Univ., Nat. Sci. 20: 49-54.

Hongo T, Izawa M. 1994. Yama-Kei field books No. 10. Tokyo: Yama-Kei.

Horak E. 1977. Boletellus and Porphyrellus in Papua New Guinea. Kew Bull. 31(3): 645-652.

doi:10.2307/4119416

Li TH, Song B. 2003. Bolete species known from China. Guizhou Sci. 21(1-2): 78-86.

Mao XL. 2000. The macrofungi in China. Zhengzhou: Henan Science and Technology Press.

Mao XL. 2009. Macromycetes of China. Beijing: Science Press.

May TW, Wood AE. 1997. Catalogue and bibliography of Australian macrofungi 1. Basidiomycota

p-p. Fungi of Australia volume 2A. Australian Biological Resources Study: Canberra.

Patouillard NT. 1909. Quelques champignons de 'Annam. Bull. Soc. Mycol. France 25: 1-12.

Pegler DN, Young TWK. 1971. Basidiospore morphology in the Agaricales. Beih. Nova Hedwigia

35: 1-210, pls. 1-53.

Singer R. 1945. The Boletineae of Florida with notes on extralimital species. I. The Strobilomycetaceae.

Farlowia 2: 97-141.

Singer R. 1955. Type studies on Basidiomycetes. VIII. Sydowia 9: 367-431.

Teng SC. 1963. Fungi of China. Beijing: Science Press.

Wang XH, Liu PG. 2002. Notes on several boleti from Yunnan, China. Mycotaxon 84: 125-134.

Wen HA. 1985. New species and new records of genus Boletellus from China. Acta Mycol. Sin. 4:

222-226.

Yang ZL, Wang XH, Binder M. 2003. A study of the type and additional materials of Boletus

thibetanus, Mycotaxon 86: 283-290.

Young T. 2004. A field guide to the fungi of Australia. Sydney: University of New South Wales

Press.

Yuan MS, Sun PQ. 2007. Atlas of Chinese mushrooms. Chengdu: Sichuan Science and Technology

Press.

Notes on Boletellus (China) ... 423

Zang M. 1980. Some new species of Basidiomycetes from the Xizang Autonomous Region of China.

Acta Micro. Sin. 20: 29-34.

Zang M. 1985. Notes on the Boletales from eastern Himalayas and adjacent of China. Acta Bot.

Yunnan. 7: 383-401.

Zang M. 2006. Flora Fungorum Sinicorum. Vol. 22. Boletaceae (1). Beijing: Science Press.

Zang M, Yuan MS. 1999. Contribution to the knowledge of new basidiomycoteous taxa from

China. Acta Bot. Yunnan. 21: 37-42.

Zang M, Chen CM, Sittigul C. 1999. Some new and interesting taxa of Boletales from tropical Asia.

Fungal Sci. 18: 19-25.

MYCOTAXON

Volume 115, pp. 425-433 January-March 2011

DOT: 10.5248/115.425

Aspergillus flavus — primary causative agent of aflatoxins

in dried figs

H. IMcGe Oxtay"’, DILEK HEPERKAN?,

EMRAH YELBOGA?* & NEVIN GUL KARAGULER?**

1TUBITAK Marmara Research Center Food Institute, 41470 Kocaeli Turkey

? Faculty of Chemical and Metallurgical Engineering, Department of Food Engineering,

Istanbul Technical University, 34469 Istanbul Turkey

3 Faculty of Science and Letters, Department of Molecular Biology and Genetics,

Istanbul Technical University, 34469 Istanbul Turkey

“ Molecular Biology-Biotechnology & Genetics Research Center (MOBGAM),

Istanbul Technical University, 34469 Istanbul Turkey

* CORRESPONDENCE TO: imgeoktay@yahoo.com

ApsTRAcT — Aspergillus sect. Flavi isolates from Turkish dried figs have been determined

using PCR amplification of the ITS1 and ITS2 rDNA regions. Species were identified

by comparing partial 18S rDNA sequences from 57 different fungal isolates comprising

5 A. parasiticus strains, 1 A. tamarii strain, and 51 A. flavus strains with known ribosomal

sequences using BLAST search. Sequence comparisons between the isolates and reference

cultures showed a 95-99% similarity; morphological and phenotypical character comparisons

of the same strains produced equally close similarities. The sole exception was an aflatoxin

B, and B, producing strain that cannot produce cyclopiazonic acid; this strain, originally

identified as A. flavus, was instead found to represent A. parasiticus.

Key worps — Aspergillus parasiticus, Polymerase Chain Reaction, dried fruit, ITS, CPA

Introduction

The Aspergillus flavus group commonly found in nature is one of the most

widely studied fungal species. Aspergillus flavus, A. parasiticus, A. nomius,

A. pseudotamarii, and A. bombycis produce aflatoxin, a potent carcinogenic

toxin, while A. oryzae, A. sojae, and A. tamarii are non-toxigenic species widely

used in the production of fermentation products throughout Asia (Frisvad et

al. 2007). Although these fungi are commonly used to produce enzymes and

fermentation products, some cause serious problems through contamination

of food and foodstuffs.

Aflatoxins (AFs), naturally occurring secondary metabolites, are potent

hepatotoxic, mutagenic, and carcinogenic toxins causing serious health hazards

426 ... Oktay & al.

in humans and animals. Aflatoxin BiB sta and G, are found predominantly

in food whereas M, and M, aflatoxins are found primarily in animal tissues

and fluids (milk, urine) as the hydroxylated metabolic products of aflatoxins B,

(AFB,) and B, (AFB,) respectively (Richard 2007). Special interest is given to

AFs due to their high occurrence and toxicity. The most toxic aflatoxin known,

AFB,, is cited as a group I carcinogen by the International Agency for Research

on Cancer (IARC 1993). The maximum levels of AFB, and total aflatoxins

allowable in dried fruits as determined by Commission of the European

Communities are 2 and 4ug/kg respectively. Aflatoxigenic fungi occur in such

food commodities as corn, peanuts, cottonseed, nuts, spices, figs, and dried

fruits (Pitt & Hocking 1997), Aflatoxigenic fungi may contaminate foods

throughout several stages (pre-harvest, processing, transportation, storage) of

the food chain (Manonmani et al. 2005). The level of mould infestation and

identification of species are important indicators of raw material quality and

predictors of the potential risk of mycotoxin occurrence (Shapira et al. 1996).

Fungi in foods can be identified using traditional morphological and

phenotypic observations of cultures in different media. However, such methods

are time consuming and laborious and require mycological expertise and

special facilities. Also, because morphological characters can vary over time,

they should be verified by the mycotoxigenic profile of the strains (Samson et

al. 2007). Furthermore, traditional methods do not distinguish toxigenic from

non-toxigenic forms. For these reasons, application of molecular techniques

has become increasingly important in detecting and characterizing potential

contaminants within the food-processing industry. These methods are very

rapid, specific, and sensitive compared to traditional methods.

‘There are two approaches in identifying aflatoxigenic fungi through PCR-

based methodology. The first uses standard PCR to detect aflatoxigenic

fungi in foods. In this technique, the contiguous Internal Transcribed Spacer

(ITS) regions in fungal DNA fungi are amplified, sequenced, and compared

extensively with sequences in GenBank (Hinrikson et al. 2005; Rodrigues et

al. 2007; Gonzalez-Salgado et al. 2008). The second approach is especially

useful for the strains having nearly identical genes, as the PCR reaction

targets six aflatoxin biosynthesis genes, namely; aflatoxin regulatory genes

(AFLR, AFLS), norsolorinic acid reductase (NOR-1 = AFLD), versicolorin A

dehydrogenase (VER-1) sterigmatocystin-o-methyltransferase (OMT-A),

polyketide synthase (pKsA), and ApA-2 in A. flavus and A. parasiticus (Shapira

et al. 1996; Somashekar et al. 2004; Manonmani et al. 2005; Rodrigues et al.

2009). We used the first approach to detect ITS sequences from 57 Aspergillus

sect. Flavi isolates, which had been previously characterized according to their

morphological and phenotypic characters, from Turkish dried figs. This is the

first report of molecular analyses of Aspergillus sect. Flavi strains isolated from

a Turkish agricultural commodity.

Aspergillus flavus in figs (Turkey) ... 427

Materials & methods

Fungal isolates and culture conditions

Fifty-seven strains of A. flavus, A. parasiticus, and A. tamarii, isolated from dried

figs from the west of Turkey (Aegean region), were selected. The isolates had been

previously morphologically and phenotypically identified to species level (Heperkan &

Karbancioglu-Gtiler 2009). All fungal cultures were maintained on slant malt extract

agar (MEA) and stored at 4°C. Incubation was performed at 25°C for 5 days. Cultures

were inoculated with 1 cm diameter mycelial disks cut from the plates and incubated

in 30 ml Erlenmeyer flasks containing 20 ml of Potato Dextrose Broth (PDB) at 25°C

and 150 rpm. Mycelia from 2-day-old cultures were harvested by filtration through

Whatman No.1 paper and kept at -80°C for DNA isolation.

Fungal DNA extraction

Template DNA was extracted from 50-100 mg (wet weight) of fungal mycelia

harvested from freshly growing cultures in PDB under stationary conditions. DNA was

isolated by using ZR fungal / bacterial DNA system (purchased from Zymo Research,

Orange, CA, USA) according to the manufacturer's protocol.

PCR amplification

DNA was amplified by PCR using fungal-specific 188 rDNA primers ITS1 (5’-

TCCGTAGGTGAACCTGCGG-3’) and ITS4 (5’°-TccTCCGCTTATTGATATGC-3’). The PCR

amplification protocol was as follows: 1 cycle of 95°C for 5 min, 30 cycles of a set

including 95°C for 1 min, 55°C for 1 min and 72°C for 1 min 40 s and a final cycle

of 72°C for 10 min. Amplification of fungal DNA was carried out in a total reaction

volume of 50 ul, containing 1 ul of template DNA, 1 pl of each primer, 5 ul of 10 x PCR

buffer, 4 ul of MgCl, (25 mM), 1 pl of dNTPs and 0.5 ul of Taq DNA polymerase. The

PCR reaction was performed using Biometra T Professional Thermocycler (Biometra,

Goettingen, Germany).

DNA sequencing & analysis

Sequencing was carried out using an ABI PRISM 3100-Avant automated sequencer at

the Molecular Biology and Genetics Department, ITU. Both strands of the PCR product

were sequenced with the same primers. The resultant nucleotide sequences were aligned

with MEGA sequence analysis software version 4.0 (Tamura et al. 2007).

Species were identified by comparing the partial 18S rDNA sequences with known

ribosomal sequences using BLAST (Basic Local Alignment Search Tool). Comparisons

of reference strain and isolate sequences were performed using Clustal W alignment

algorithm. Sequence variation and similarity between sampled sequences were

determined with MEGA 4.0 software; sequences were visually confirmed using pairwise

nucleotide alignments.

Results & discussion

ITS regions from 57 Aspergillus sect. Flavi strains were sequenced to identify

the species at the molecular level. ITS regions, located between the 18S and 28S

RNA genes, offer distinct advantages over other molecular regions due to the

existence of approximately 100 copies per genome. Amplification of the ITS

428 ... Oktay & al.

M123 45 678 91011 M 12 13 14 15 16 17 18 19 20 2122 23 M 24 25 26 27 28 29 30 31

beled] Lelel Lelahed «MM laleded lehahed ded bebe Her A ee

were eee wWrer -seeqgeew

M 32 33 34 35 36 37 38 39 40 41 42 M4344 45 46 4748 49 SO 51 525354. M 55 56 S7

Ficure 1. Agarose gel analysis of PCR products from genomic DNA of fungal cultures. Lane M,

DNA molecular size marker (Lambda/HindIID); Lanes 1-7, 9-24, 26-28, 30, 32-35, 37-41, 43-57,

A. flavus; Lanes 8; 25; 31; 36; 42, A. parasiticus; Lane 29, A. tamarii.

M 1234567891011 M 121314 1516 1718 19202122 M 23 2425 26 27 28 2930 31 32

— 600 bp

-———-— “ ——— _——=- t — 600 bp

M 33343536 373839404142 M 43 44 45 46 47 48 49 S50 51 52 53 54 M 55 S6 57

FicurE 2. Agarose gel analysis of PCR amplification products from strains using ITS1-ITS4

primers. Lane M, PhiX174 DNA/BsuRI HAEIII marker; Lanes 1-7, 9-24, 26-28, 30, 32-35, 37-41,

43-57, A. flavus; Lanes 8, 25, 31, 36, 42, A. parasiticus; Lane 29, A. tamarii.

regions from the samples generated PCR products around 600 bp long. FicuREs

1 and 2 show the results of gel electrophoresis for genomic DNA isolation and

PCR amplification, respectively.

A matrix comparing the ITS1 and ITS4 sequence similarities among the four

Aspergillus reference species is depicted in TABLE 1.

Since the strains were previously identified as Aspergillus sect. Flavi using

morphological and phenotypical criteria (Heperkan & Karbancioglu-Gtler

2009), only Aspergillus sect. Flavi species were used for reference. Similarities

between the isolate ITS sequences and the reference strain sequence of the

same Aspergillus species are shown in TABLE 2.

We followed protocols set forth by Gonzalez-Salgado et al. (2008) for

differentiating A. flavus and A. parasiticus species in wheat flour. Although

several PCR-based methods use aflatoxin biosynthetic genes to detect

Aspergillus flavus in figs (Turkey) ... 429

TABLE 1. Matrix of ITS region similarities (%) for Aspergillus reference species

Aspergillus spp.

(isolate codes) / base pairs (bp)

. flavus

oryzae

. parasiticus

. pseudotamarii

A, flavus (ATCC 16883) / 595

A, oryzae (ATCC 4814) / 555

A. parasiticus (NRRL 2999) / 576

A, sojae (IFO 4386) / 576

A. tamarii JCM 2259) / 579

A, pseudotamarii (NRRL 25517) / 598

TABLE 2. Molecular identification of Aspergillus sect. Flavi isolates

ITS1/ITS4 Similarity | Isolate i ITSL/ITS4 : Similarity i Isolate

: sequence : (%) : name : sequence : (%) : name

Nowe: similarities: i Noo similarities 3

(out of 5) (out of 5)

3He3 i i A, tamarii

430 ... Oktay & al.

aflatoxigenic fungi, it has been always a major problem to separate A. flavus

from A. parasiticus, as the latter is always more easily amplified. It is believed

that this might explain the high similarity in the specific primers used to

amplify aflatoxin biosynthesis genes. However, ITS amplification allows us to

differentiate these closely related species with greater sensitivity than single

copy genes. The ITS region, which has been used for phylogenetic analysis

for almost 20 years, offers distinct advantages because it customarily displays

sequence variation between species as well as the minor variations within the

strains of the same species. One disadvantage, however, is that the ITS region

cannot differentiate toxigenic from non-toxigenic species. Potential toxigenicity

of the fungi is better assessed by either monitoring several genes involved in the

toxin biosynthetic pathway or analyzing mycotoxins using HPLC (Urano et al.

1992, Stroka & Anklam 2000), LC-MS (Rundberget & Wilkins 2002), and/or

LC-MS/MS (Spanjer et al. 2008).

Gonzalez-Salgado et al. (2008) were the first to attempt to detect A. flavus

and A. parasiticus using a multicopy region (ITS). We used specific primers to

amplify ITS1 and ITS2 conserved 18S rDNA regions and compared the

results with the reference cultures. Gonzalez-Salgado et al. (2008) initially had

difficulties in differentiating A. flavus from A. oryzae and A. parasiticus from

A. sojae due to the small (1-2 bp) difference separating these species. To

eliminate this problem, we duplicated the amplification of some isolates. The

molecular identifications were tested with 57 different fungal-isolates shown

in TABLE 2. Results compared with the reference cultures showed a 95-99%

similarity.

Henry et al. (2000), Geiser et al. (2007), Sanchez-Hervas et al. (2008), and

Karthikeyan et al. (2009) have all noted the ability of molecular techniques

to differentiate Aspergillus species. For example, Aspergillus sect. Flavi and

Nigri species isolated from cocoa beans were first identified macro- and

microscopically and the identity of the different isolates was confirmed through

5.8S-ITS rDNA sequencing after PCR amplification using the universal

primers ITS4 and ITS5. Aspergillus spp. (including A. flavus and A. tamarii)

and Penicillium spp. thought to represent different species were isolated and

identified by ITS sequencing (Sanchez-Hervas et al. 2008).

Genetic variability among the A. flavus isolates was investigated by PCR

amplification (using ITS1 and ITS4 primers) and sequencing of the ITS1,

ITS2, and 5.88 rRNA regions from A. flavus isolates, yielding products of

approximately 580 base pairs in length. Nucleotide sequences were compared

with A. flavus ITS sequences in the Genbank database. Analysis of the genetic

coefficient matrix derived from the ITS nucleotide sequences from A. flavus

isolates showed that % similarities among the tested A. flavus strains ranged

from a minimum of 12% to a maximum of 99% (Karthikeyan et al. 2009).

Aspergillus flavus in figs (Turkey) ... 431

This molecular approach is also used to identify Aspergillus species from

human exudates in the health sector. For example, A. flavus, A. fumigatus,

and A. terreus — the most frequent causes of invasive mould infections in

immunocompromised patients — have been identified by amplification of

ITS1 and ITS2 conserved regions of 185 and 28S rDNA (Henry et al. 2000).

Clinical application of this approach allowed the earlier diagnosis and selection

of effective antifungal agents for patients with invasive aspergillosis. Most

recently, serial specimens from 26 patients with documented fungal infections

have been investigated by using the PCR-based ITS2 region amplification. The

fungal pathogens identified were different Aspergillus and Candida species,

Rhizopus oryzae and Fusarium oxysporum (Landlinger et al. 2009).

Molecular techniques have also been widely applied in an attempt to

differentiate aflatoxigenic and non-aflatoxigenic strains of Aspergillus species.

Morphological, chemical, and molecular characterizations of 31 Aspergillus sect.

Flavi isolates from Portuguese almonds were used to identify aflatoxigenic and

non-aflatoxigenic strains. Morphological characterization classified 18 isolates

as A. parasiticus and 13 isolates as A. flavus. Aflatoxins and cyclopiazonic acid

(CPA) production of isolates investigated for the chemical characterization

revealed that all A. parasiticus isolates were strong AFB and AFG producers

but did not produce CPA. Furthermore, 8% of A. flavus isolates were found to

produce all 3 mycotoxin groups (i.e., AFB,, AFB,, CPA), while 77% of A. flavus

isolates were classified as atoxigenic. Two genes of the aflatoxin biosynthetic

pathway [AFLD (NoR1), AFLQ (ORD1=ORDA)] were investigated using

molecular techniques. Although the arLD gene did not show any correlation

with aflatoxigenicity, AFLQ did show some correlation. AFLD and AFLQ are not

the only genes to distinguish the toxigenicity of Aspergillus sect. Flavi species.

Three other genes — VER-1, OMT-1, and APA-2 coding for key enzymes and a

regulatory factor in aflatoxin biosynthesis — have been used to detect A. flavus

and A. parasiticus species in grains and foods. Good results have been obtained

only with the DNA of the aflatoxigenic moulds, namely A. parasiticus and

A. flavus (Shapira et al. 1996).

Different food and feed commodities from Mysore City in India have

been examined to isolate aflatoxin-producing fungi and assess aflatoxins in

commodities by targeting the AFLR and omr aflatoxin biosynthesis genes.

Although useful for detecting the A. flavus group, however, this protocol did

not distinguish aflatoxin producers from non-producers (Somashekar et al.

2004). Another Indian study used PCR-based amplification of the aflatoxin

regulatory gene AFLR for rapid detection of aflatoxigenic fungi in groundnuts

and maize (Manonmani et al. 2005).

Our molecular analyses have produced results comparable to those

obtained by the identification of the same strains using morphological and

432 ... Oktay & al.

phenotypical characters by Heperkan & Karbancioglu-Gtiler (2009). We did

detect a difference for one isolate — the aflatoxin B, and B, producer strain

originally identified as A. flavus (isolate 36) was in fact shown by sequence

analyses to represent A. parasiticus (Oktay & Heperkan unpublished data).

The mycotoxigenic character of isolate 36 was re-analyzed with HPLC, which

showed that it produced aflatoxin B, and B, but not CPA, so describing isolate

36 as an aflatoxin B, and B, producer would be more appropriate. Our result

does not agree with related literature and serves as a first indication of an

unusual mycotoxin pattern in A. parasiticus.

In conclusion, the contiguous ITS region is a very useful approach for

verification of morphologically and phenotypically pre-identified Aspergillus

sect. Flavi species.

Acknowledgments

The authors are grateful to Prof. Dr. Vildes M. Scussel (Food Science and Technology

Department, Centre of Agricultural Sciences, Santa Catarina Federal University) and

Assist. Prof. Dr. Fatma Nese Kok (Department of Molecular Biology and Genetics,

Istanbul Technical University) for serving as pre-submission reviewers. The authors also

wish to thank Dr. Shaun Pennycook for nomenclatural review and the Editor-in-Chief

for her excellent contribution to the language.

Literature cited

Frisvad JC, Thrane U, Samson R. 2007. Mycotoxin producers. 135-140, in: Dijksterhuis J, Samson

RA (eds), Food Mycology. CRC press, Taylor and Francis Group. doi: 10.1201/9781420020984.

ch8

Geiser DM, Klich MA, Frisvad JC, Peterson SW, Varga J, Samson RA. 2007. The current status

of species recognition and identification in Aspergillus. Studies in Mycology 59: 1-10. doi:

10.3114/sim.2007.59.01

Gonzalez-Salgado A, Gonzalez-Jaén T, Vazquez C, Patino B. 2008. Highly sensitive PCR-based

detection method specific for Aspergillus flavus in wheat flour. Food Additives and Contaminants

25(6): 758-764. doi: 10.1080/02652030701765715

Henry T, Iwen PC, Hinrichs SH. 2000. Identification of Aspergillus species using Internal transcribed

spacer regions 1 and 2. Journal of Clinical Microbiology 38(4): 1510-1515.

Heperkan D, Karbancioglu-Giiller F. 2009. Determination of Aspergillus section Flavi and their

aflatoxin and cyclopiazonic acid production patterns in naturally dried figs. 77-90, in: M

Appell, DF Kendra, MW Trucksess (eds), Mycotoxin Prevention and Control in Agriculture

[ACS Symposium Series, vol. 1031]. doi: 10.1021/bk-2009-1031.ch006

Hinrikson HP, Hurst SE, de Aguirre L, Morrison CJ. 2005. Molecular methods for the identification

of Aspergillus species. Medical Mycology Supplement 43: 29-37. doi: 10.1080/1369378050006

A722

IARC [International Agency for Research on Cancer]. 1993. Some naturally occurring substances:

food items and constituents, heterocyclic aromatic amines and mycotoxins. Monograph 56.

Lyon International Agency for Research on Cancer. 571 p.

Karthikeyan M, Sandosskumar R, Mathiyazhagan S, Mohankumar M, Valluvaparidasan V, Kumar S,

Velazhahan R. 2009. Genetic variability and aflatoxigenic potential of Aspergillus flavus isolates

Aspergillus flavus in figs (Turkey) ... 433

from maize. Archives of Phytopathology and Plant Protection 42(1): 83-91. doi: 10.1080/

03235400600950961

Landlinger C, Baskova L, Preuner S, Willinger B, Buchta V, Lion T. 2009. Identification of fungal

species by fragmentlength analysis of the internally transcribed spacer 2region. European Journal

of Clinical Microbiology & Infectious Diseases 28: 613-622. doi: 354000602277 18.0020

Manonmani HK, Anand S, Chandrashekar A, Rati ER. 2005. Detection of aflatoxigenic fungi

in selected food commodities by PCR. Process Biochemistry 40: 2859-2864. doi: 10.1016/

j-procbio.2005.01.004

Pitt JI, Hocking AD. 1997. Aspergillus flavus Link. 377-380, in: Fungi and Food Spoilage. 2nd Ed.

Blackie Academic and Professional.

Richard JL. 2007. Some major mycotoxins and their mycotoxicoses-An overview. International

Journal of Food Microbiology 119: 3-10. doi: 10.1016/j.ijfoodmicro.2007.07.019

Rodrigues P, Soares C, Kozakiewicz Z, Paterson RRM, Lima N, Venancio A. 2007. Identification

and characterization of Aspergillus flavus and aflatoxins. 527-534, in: A Méndez-Vilas (ed.),

Communicating Current Research and Educational Topics and Trends in Applied Microbiology.

Formatex Research Center

Rodrigues P, Venancio A, Kozakiewicz Z, Lima N. 2009. A polyphasic approach to the identification

of aflatoxigenic and non-aflatoxigenic strains of Aspergillus section Flavi isolated from

Portuguese almonds. International Journal of Food Microbiology 129: 187-193. doi: 10.1016/

j.ijfoodmicro.2008.11.023

Rundberget T, Wilkins AL. 2002. Determination of Penicillium mycotoxins in foods and feeds

using liquid chromatography-mass spectrometry. Journal of Chromatography A 964: 189-197.

doi: 10.1016/S0021-9673(02)00698-2

Samson RA, Varga J, Witiak SM, Geiser DM. 2007. The species concept in Aspergillus:

recommendations of an international panel. Studies in Mycology 59: 71-73. doi: 10.3114/

sim.2007.59.09

Sanchez-Hervas M, Gil JV, Bisbal F, Ramon D, Martinez-Culebras PV. 2008. Mycobiota and

mycotoxin producing fungi from cocoa beans. International Journal of Food Microbiology 125:

336-340. doi: 10.1016/j.ijfoodmicro.2008.04.021

Shapira R, Paster N, Eyal O, Menasherov M, Mett A, Salomon R. 1996. Detection aflatoxigenic

moulds in grains by PCR. Applied and Environmental Microbiology 62(9): 3270-3273.

Somashekar D, Rati ER, Anand S, Chandrashekar A. 2004. Isolation, enumeration and PCR

characterization of aflatoxigenic fungi from food and feed samples in India. Food Microbiology

21: 809-813. doi: 10.1016/j.fm.2004.01.012

Spanjer MC, Rensen PM, Scholten JM. 2008. LC-MS/MS multi-method for mycotoxins after single

extraction, with validation data for peanut, pistachio, wheat, maize, cornflakes, raisins and figs.

Food Additives and Contaminants 25(4): 472-489. doi: 10.1080/02652030701552964

Stroka J; Anklam E. 2000. Immunoaffinity column cleanup with liquid chromatography using

post-column bromination for determination of aflatoxins in peanut butter, pistachio paste, fig

paste and paprika powder: collaborative study. Journal of AOAC International 83(2): 320-340.

doi: 10.5555/jaoi.2000.83.2.320

Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics Analysis

(MEGA) software version 4.0. Molecular Biology and Evolution 24: 1596-1599. doi: 10.1093/

molbev/msm092

Urano T, Trucksess MW, Matusik J. 1992. Liquid chromatographic determination of cyclopiazonic

acid in corn and peanuts. Journal of AOAC International 75(2): 319-322.

MYCOTAXON

Volume 115, pp. 435-442 January-March 2011

DOT: 10.5248/115.435

A new species and a new record of Pyxine (Physciaceae)

with norstictic acid from Sao Paulo State, Brazil

PaTRiCIA JUNGBLUTH *, MARCELO PINTO MARCELLI * & KLAUS KALB 3

*UNESP Instituto de Biociéncias, Depto de Botanica,

Distrito de Rubido Jr, Caixa Postal 510, Botucatu-SP, CEP 18618-970, Brazil.

*Instituto de Botanica, Niicleo de Pesquisa em Micologia,

Caixa Postal 3005, Séo Paulo/SP, CEP 01031-970, Brazil

3Lichenologisches Institut Neumarkt, Im Tal 12, D-92318 Neumarkt, Germany

“CORRESPONDENCE TO: pjungbluth@yahoo.com

AssTRAcT — In the course of a study of Pyxine species in Sdo Paulo State, Brazil, Pyxine

jolyana was recognized as a new species. It has norstictic acid in the medulla, a rare feature in

South American species. Also, another species with norstictic acid, P. fallax, is recorded for

the first time from the Neotropics. A world key to the Pyxine species that produce norstictic

acid is presented.

Key worps — Pyxine albovirens, P. patellaris, P. retirugella var. capitata, P. retirugella,

lichenized fungi

Introduction

The genus Pyxine differs from other foliose genera in Physciaceae by the

epithecium becoming purple with a solution of potassium hydroxide. It shares

a dark pigmented hypothecium and ascospores of the Dirinaria-type with

Dirinaria, but differs from that genus by the presence of rhizines.

Other important features of the genus are the occurrence of apothecia

with carbonized margins in most species, with a more or less developed and

pigmented internal stipe, the presence of lichexanthone in the upper cortex in

about half of the species and also the frequent pigmentation of the medulla,

generally in the upper layer. These and others characters have been extensively

discussed by Malme (1897), Imshaug (1957), Swinscow & Krog (1975) and

Kalb (1987). About 60 Pyxine species are known worldwide (Kalb 2002); more

than 30 species have been reported from Brazil Jungbluth 2010).

Norstictic acid is present in the medulla of many species. Nevertheless, the

only one with this acid reported for Brazil is P. retirugella Nyl. This species was

436 ... Jungbluth, Marcelli & Kalb

first cited for Brazil by Vainio (1890) followed by Zahlbruckner (1909). Kalb

(1987) had the opportunity to study the material cited by Zahlbruckner (1909)

and discovered it to be P. pungens Zahlbr. The specimens cited by Vainio (1890)

could not be studied and nobody else has mentioned P. retirugella for South

America since Zahlbruckner’s work.

During our studies on the lichenized mycobiota of S40 Paulo State, a new

species with norstictic acid in the medulla was found, which is described below.

Furthermore, P. fallax, another species with norstictic acid, was discovered and

is here reported for the first time for South America.

Material & methods

The specimens studied are from Sao Paulo State, Southeastern Brazil, and were

studied by means of classical lichenological methods. Type specimens were kindly lent

by the curators of H, S and TUR. The nomenclature of the apothecia follows Kalb (1987).

The chemistry of the thalli was determined by traditional color reactions (spot tests) and

thin layer chromatography (TLC) in solvent A and C, following Culberson (1972, 1974),

Huneck & Yoshimura (1996) and Bungartz (2001).

Taxonomy

Pyxine jolyana Jungbluth, Kalb & Marcelli, sp. nov. PLaTE 1

MycoBank 519465

Sicut Pyxine albovirens sed terpenis aliis et acidum norsticticum continenti differt.

Ho.otype: BRAZIL. SAo PauLo State, Municipality of Peruibe, Reserva Ecolégica

Juréia-Itatins, Nucleo Guarauzinho, 24°44'58”"S, 47°02'57”W, 5 m alt., on rock next to

the entrance of the reserve, 26-07-1993, leg. M.P. Marcelli 23690 (SP; isotype in Herb.

Kalb).

EryMo.ocy: The epithet jolyana honours Dr. Carlos Alfredo Joly, the main mentor of

the BIOTA/FAPESP Program of inventory and characterization of the biodiversity of

the Sao Paulo State.

THALLUS orbicular, saxicolous or corticolous, brownish grey, laciniate, 7 cm

diam., closely adnate, 100-150 tm thick. PROXIMAL UPPER SURFACE continuous,

rarely with cracks, smooth to slightly irregular and sometimes with concavities,

dull, plane. DIsTAL UPPER SURFACE continuous, smooth, slightly shiny, plane to

concave, without a darker zone near the tips. UPPER CORTEX 10-20 um thick.

LAcINIAE sublinear, irregularly to rarely dichotomously branched, contiguous

to overlapping laterally, 0.5-1.0 mm wide; apices subtruncate to rounded,

concave, slightly ascendant to adnate; lateral margin smooth to sinuous; axils

acute. PRUINA very rare, farinaceous or forming small patches, subapical.

MACULAE mainly indistinct, sparse, irregularly linear, when marginal more

distinct. PoLysIDIANGIA and IsIDIA absent. SoRALIA frequent, pale yellow,

orbicular to capitate, submarginal; soredia powdery to granular. MEDULLA

cream to pale yellow to salmon above, sulphur yellow below the soralia, lower

Pyxine jolyana sp. nov. (Brazil) ... 437

layer white and very thin, sometimes with K+ reddish to purple pigment

present, 60-80 um thick. ALGAL LAYER continuous, 10-20 um thick. DisTAL

LOWER SURFACE black but paler near the tips, slightly shiny, smooth to rarely

irregular, PROXIMAL LOWER SURFACE black, slightly shiny, smooth to slightly

irregular. LOwER CoRTEX 15-20 um thick. Ru1zINEs of the same colour as the

lower cortex, the apices sometimes becoming paler, mainly simple, numerous,

evenly distributed, to 0.7 mm long. APOTHECIA absent. Pycnipia rare, laminal.

Conipia sublageniform, 3.7-4.0 x ca. 1.0 um.

COLOR TESTS: upper cortex K-, UV+ yellow; pigmented distal upper medulla

K- or K+ yellow turning red, C-, KC-, P+ yellowish orange, sometimes the

color of the medulla just becomes stronger; pigmented proximal upper medulla

K+ yellow turning red, C-, KC-, P+ strong yellow or yellowish orange, with

pigment K+ purple in oldest parts; lower medulla with negative reactions.

TLC: lichexanthone (cortex), norstictic acid, unidentified triterpenes and

pigments (medulla).

DisTRIBUTION— S4o Paulo State, littoral zone, at the municipalities of Peruibe,

Sao Luis do Paraitinga and Ubatuba.

PARATYPES—BRAZIL. SAo PauLo StaTE, Peruibe Municipality, border of the Guarat

River, near to the mouth of the river, 24°22'24"S, 47°00'25"W, 4 m alt., on palm stipe

next to the base of the Faculdade de Ciéncia e Tecnologia Santa Cecilia, windy and

direct sun, 24-07-1988, leg. M.P. Marcelli 4014 (SP); Sao Luis do Paraitinga Municipality,

Parque Estadual da Serra do Mar, Nucleo Santa Virginia, in the beginning of the “Trilha

do Pirapitinga’ footpath, 23°20'17"S, 45°08'45" W, 915 m alt., on a tree at the border of

a shadowy forest, corticolous, 14-I-2007, leg. P. Jungbluth, M.J. Kitaura, L.S. Canéz &

A.A. Spielmann 1637 (SP); Ubatuba Municipality, Parque Estadual da Serra do Mar,

Nucleo Picinguaba, Praia da Fazenda, 23°21'41"S, 44°50'53”W, 1m alt., on twig of

tree at the border of a Restinga forest, near the ocean, 13-I-2007, leg. P. Jungbluth, M.J.

Kitaura, L.S. Canéz & A.A. Spielmann 1566B (SP).

REMARKS — Pyxine jolyana is characterized by the presence of lichexanthone in

the upper cortex, the orbicular to capitate laminal soralia, the yellow to orange

pigments in the upper medulla in distal regions of the thallus and cream to

salmon pigments in proximal regions. Also, some parts result in negative spot

tests, others are K+ yellow turning red (norstictic acid).

It is important to note that in this species the color of the pigmented medulla

is not evenly distributed throughout the thallus, and norstictic acid is not

detected in TLC using just the tips of the laciniae: pieces of proximal parts of

the thallus must be analyzed too, because probably higher concentrations of

this acid are present in the thallus center.

Licking et al. (2008) observed the opposite in several species of the genus

Heterodermia: they noted that norstictic acid was produced only in the lobe tips,

which might lead to misidentifications in chemical tests performed in proximal

parts of the thalli.

438 ... Jungbluth, Marcelli & Kalb

Pyxine jolyana is the only species in the genus with lichexanthone in the

upper cortex and norstictic acid in the medulla. Pyxine fallax and P. retirugella

also have norstictic acid in the medulla, but both can be easily separated from

the present species by the presence of atranorin in the cortex.

Pyxine albovirens (G. Mey.) Aptroot and P. caesiopruinosa (Tuck.) Imshaug

(H!) are morphologically similar to P jolyana but differ in the absence of

norstictic acid.

Crystals on the upper cortex similar to those observed by Kalb (1987)

in South American material of P. caesiopruinosa could also be observed in

P. jolyana.

Pyxine fallax (Zahlbr.) Kalb, Bibliotheca Lichenologica 88: 315 (2004).

= Parmelia fallax Zahlbr., Ann. Mycol. 10: 381. 1912.

Type: Hawaiian Islands, Oahu, Kalimooa Valley, leg. Rock 89 (lectotype: W!).

= Pyxine patellaris Kurok., Bull. Natl. Sci. Mus., Tokyo 12: 689. 1969.

Type: Bonin Islands, between Okumura and Ohgiura, Chichijima Island, along

trail in the forest of Calophyllum inophyllum—Terminalia catappa, alt. 0-100 m, leg.

Hiroshi Inoue 19027 (holotype: TNS).

= Pyxine retirugella var. capitata Zahlbr., in Magnusson &

Zahlbruckner, Ark. f. Bot. 32A(2): 59. 1945.

Type: United States, Hawaii, Kauai, Haena, S. of Hilo. Pandanus forest, 1922, leg.

Skottsberg 1267 (lectotype: S!) (new synonym).

THALLUS orbicular, corticolous, grey to brownish grey, laciniate, 2.0-4.0 cm

diam., adnate. PROXIMAL UPPER SURFACE continuous to cracked, slightly

scrobiculate, slightly shiny, plane. DIsTAL UPPER SURFACE continuous to

cracked, smooth, sometimes with concavities, shiny, slightly convex to convex,

with a darker zone near the tips of a few laciniae. LAcINIAE sublinear, irregularly

branched, contiguous to rarely laterally overlapping, 0.3-1.0 mm wide; apices

rounded, sometimes subtruncate, mainly slightly concave, slightly ascending;

lateral margin crenate to irregular; axils acute. PRUINA often absent or sparse,

farinaceous, subapical. MACULAE distinct, abundant, irregularly linear, rarely

subreticulate, marginal and laminal, starting mainly from the axils, sometimes

developing into fissures. PoLYSIDIANGIA and IsIDIA absent. SORALIA white,

orbicular to capitate, starting as a wart which soon disintegrates apically, but

continuing to expand, elevating the soralia, laminal or submarginal; soredia

farinaceous. MEDULLA white. DISTAL LOWER SURFACE cream to pale brown,

shiny, smooth to papillate. PROXIMAL LOWER SURFACE black, shiny, smooth.

Ruizines black, simple to irregularly branched, frequent, evenly distributed,

up to 0.5mm long. APOTHECIA of obscurascens-type (absent in Brazilian

material), rare, 0.4-1.1 mm wide, disc epruinose, internal stipe distinct, white

(Elix 2009), ascospores 13-17 x 6-8 wm (Kalb 2004, Elix 2009)]. Pycnrp1a few,

laminal. Conipi1a not found [sublageniform, 3.4-3.6 x 0.5 wm (Zahlbruckner

1912, protologue)].

Pyxine jolyana sp. nov. (Brazil) ... 439

PLATE 1. Pyxine jolyana holotype (SP).

a. Part of the holotype.

b. Part of the thallus.

Bars: 5 mm.

440 ... Jungbluth, Marcelli & Kalb

COLOR TESTS: upper cortex K+ yellow, UV-; medulla K+ yellow turning orange,

C-, KC-, P+ orange, UV-; internal stipe K-, P-.

TLC: atranorin (cortex), norstictic acid and unidentified triterpenes

(medulla).

DISTRIBUTION— Australia (Kalb 2004), Hawaiian Islands (Zahlbruckner

1912, Magnusson & Zahlbruckner 1945, as P. retirugella var. capitata), Japan

(Kurokawa 1969, as P. patellaris), Taiwan (Kalb 2004) and South America.

SPECIMEN EXAMINED— BRAZIL. SAo PauLo StaTE, Praia Grande Municipality,

Cidade Ocean District, 24°02’S, 46°30'W, 2 m alt., ca. 1 km after the Iemanja’s statue, 2

km after the Netuno’ statue, in direction of Mongagué Municipality, low Restinga forest,

corticolous, 07-07-1988, leg. M.P. Marcelli 3303 (SP).

REeMARKS— Pyxine fallax is characterized by atranorin in the upper cortex,

orbicular, laminal to sublaminal soralia, white, K+ yellow turning orange, P+

orange (norstictic acid) medulla and obscurascens-type apothecia.

It is notable that in this species the soralia progressively become slightly

elevated through a small base of the upper cortex (almost stalked). The same

was observed in the holotype of P. copelandii Vain. (TUR-Vain.!), which differs

from P. fallax by its longer ascospores (16-22 um; Swinscow & Krog 1975), less

maculate upper cortex and a different terpene array on the TLC plates.

Further similar species with white medulla and norstictic acidare P. retirugella

(H-NYL!), which differs from P fallax by the presence of polysidiangia, and

P. profallax Kalb, which does not produce soredia (Kalb et al. 2009)

Pyxine retirugella var. capitata is found to be a new synonym of P. fallax.

Rogers (1986) proposed it as a synonym of P. retirugella. However the lectotype

of this variety (S!) has orbicular soralia instead of polysidiangia and has the same

triterpene array on TLC plates as P. fallax. Kalb (2004) placed P. retirugella var.

capitata into the synonymy of P. asiatica Vain.; however, P. asiatica does not

have norstictic acid (Kashiwadani 1977, Awasthi 1982, Kalb 2004).

World key to Pyxine with norstictic acid present at least in some parts

of the thallus or apothecia

la. Thallus with isidia, polysidiangia or/and soredia .................0. 0.000000 2

1b. Thallus without vegetative propagules ..... 0... c cece cece eee eens 7

2a. Upper cortex K—, UV+ yellow, with lichexanthone.................... P. jolyana

2b. Upper cortex K+ yellow, UV-, with atranorin 2.0.0... ... 00. cece eee eee 3

3a. Thallus isidiate, without soredia or polysidiangia ............ P. cylindrica Kashiw.

3b. Thallus without isidia, with soredia or polysidiangia .....................000. 4

4a. Maculae and soredia bright red [norstictic acid present only in the

hy potheei vin my. 0.0 bee hn he aantecs aoe ede ats sett moe P. coccifera (Fée) Nyl.

4b. Maculae and soredia absent or with other colors .......... 0.0.0 cece eee ee eee 5

Pyxine jolyana sp. nov. (Brazil) ... 441

5a. Thallus with polysidiangia, without soralia ...................0.04. P. retirugella

5b. Thallus with soralia, without polysidiangia ............ 0.00. e cece eee eee 6

6a. Upper cortex abundantly maculate, ascospores 13-17 um ............... P. fallax

6b. Upper cortex sparsely maculate, ascospores 16-22 um .............. P. copelandii

7a. Medulla white throughout ........... P. convexior (Mill. Arg.) Swinscow & Krog

7b. Medulla at least in part pigmented 2.0.2.0... 0. cece eee eee ees 8

8a. Medulla orange to ochre throughout [norstictic acid present only in the

SPICE GLUT] og cscs sacra read $00 ANE ang ae eT bead bo iE A bas teste eh P. schechingeri Kalb

8b. Medulla pale yellow or cream or orange above, white below.................0.. 9

9a. Internal stipe K+ purple, known only from Africa ............... P. africana Kalb

9b. Internal stipe K—, known only from Asia .................000. P. philippina Vain.

Acknowledgments

The authors wish to thank Dr. Theodore L. Esslinger and Dr. Robert Licking for

the critical revision of the manuscript. We would like to thank the curators of H, S$

and TUR for lending type material to P. Jungbluth and the curators of W and TNS

for the loans to Dr. Kalb. P. Jungbluth is also grateful to FAPESP (Sao Paulo Research

Foundation) for a PhD grant (process 05/53955-1) and for the infrastructure and

logistical support for collecting excursions of the Projeto Tematico Gradiente Funcional

(process 03/12595-7, BIOTA/FAPESP Program) and to IF (Sao Paulo Forest Institut)

for collecting license. M.P. Marcelli thanks CNPq (National Council of Technological

and Scientific Development) for a research grant.

Literature cited

Awasthi DD. 1982. Pyxine in India. Phytomorphology 30(4): 359-379.

Bungartz F. 2001. Analysis of lichen substances. In: http://nhc.asu.edu/lichens/ lichen_info/tlc jsp.

Accessed in 2010, April.

Culberson CE. 1972. Improved conditions and new data for the identification of lichen products by

a standardized thin-layer chromatographic method. Journal of Chromatography (72): 113-125.

doi: 10.1016/0021-9673(72)80013-X

Culberson CF. 1974. Conditions for the use of Merck silica gel 60 F,., plates in the standardized

thin-layer chromatographic technique for lichen products. Journal of Chromatography (97):

107-108. doi:10.1016/S0021-9673(01)97595-8

Elix J. 2009. Pyxine. 517-547, in McCarthy P (ed.), Flora of Australia. Volume 57, Lichens 5. ABRS/

CSIRO Canberra & Melbourne.

Huneck S, Yoshimura I. 1996. Identification of lichen substances. Springer. Berlin. 493 p.

Imshaug HA. 1957. The Lichen Genus Pyxine in North and Middle America. Transactions of the

American Microscopical Society 76(3): 246-269.

Jungbluth P. 2010. Estudos taxonémicos em Physcia (Schreb.) Michx. e Pyxine Fr. PhD thesis.

Instituto de Sao Paulo, Sao Paulo-SP, Brazil. 228 p.

Kalb K, Archer AW, Sutjaritturakan J, Boonpragob K. 2009. New or otherwise interesting lichens V.

Bibliotheca Lichenologica 99: 225-246.

Kalb K. 1987. Brasilianischen Flechten, 1. Die Gattung Pyxine. Bibliotheca Lichenologica 24:

1-89.

442 ... Jungbluth, Marcelli & Kalb

Kalb K. 2002. Pyxine. 437-441, in TH Nash III et al. (eds.), Lichen Flora of the Greater Sonoran

Desert Region. I. Lichens Unlimited, Arizona State University, Tempe, Arizona.

Kalb K. 2004. New or otherwise interesting lichens II. Bibliotheca Lichenologica 88: 301-329.

Kashiwadani H. 1977. On the Japanese species of the genus Pyxine (lichens) (1). Journal of Japonese

Botany 52: 137-144.

Kurokawa S. 1969. Lichens of Chichijima Island of the Bonin Islands collected by Dr. H. Inoue.

Bulletin of the National Science Museum, Tokyo 12: 685-692.

Licking R, del Prado R, Lumbsch HT, Will-Wolf S, Aptroot A, Sipman HJM, Umafia L, Chaves JL.

2008. Phylogenetic patterns of morphological and chemical characters and reproductive mode

in the Heterodermia obscurata group in Costa Rica. Systematics and Biodiversity 6(1): 31-41.

doi: 10.1017/S1477200007002629

Magnusson AH, Zahlbruckner A. 1945. Hawaiian lichens III. The families Usneaceae to Physciaceae.

Index. Arkiv for Botanik 32A(2): 1-89.

Malme B. 1897. Die Flechten der ersten Regnellschen Expedition I. Die Gattung Pyxine (Fr.)

Nylander. Bihang till Svenska Vetenskapsakademiens Handlingar 23(13): 1-52.

Rogers RW. 1986. The genus Pyxine (Physciaceae, lichenized Ascomycetes) in Australia. Australian

Journal of Botany 34: 131-154.

Swinscow TDV, Krog H. 1975. The genus Pyxine in East Africa. Norwegian Journal of Botany 22:

43-68.

Vainio EA. 1890. Etude sur la classification naturelle et la morphologie des Lichens Du Brésil. Pars

prima. Acta Societatis pro Fauna et Flora Fennica 7 (1): I-X XIX, 1-247.

Zahlbruckner A. 1909. Lichenes (Flechten). 85-211, in V Schiffner (ed.), Ergebnisse der botanischen

Expedition der kaiserlichen Akademie der Wissenschaften nach Siidbrasilien, 1901, 2. Band.

Denkschriften der Kaiserlichen Akademie der Wissenschaften 83.

Zahlbruckner A. 1912. Neue Flechten. VI. Annales Mycologici 10: 359-384.

MYCOTAXON

Volume 115, pp. 443-456 January-March 2011

DOI: 10.5248/115.443

Marine fungi from Sarushima Island, Japan,

with a phylogenetic evaluation of the genus Naufragella

MOHAMED A. ABDEL-WAHAB

Department of Botany, Faculty of Science, Sohag University, Sohag 82524, Egypt &

Extremobiosphere Research Center,

Japan Agency for Marine-Earth Science and Technology (AMSTEC),

2-15 Natsushima-cho, Yokosuka, Kanagawa 237-0061, Japan

CORRESPONDENCE TO: bhhoba@yahoo.com

AssTRACT — Twenty-seven fungi (18 ascomycetes, 9 anamorphic fungi) were recorded

from 91 driftwood samples collected from Sarushima Island, Japan. Ceriosporopsis halima,

Corollospora maritima, and Halosphaeria appendiculata occurred most frequently in the fungal

community. Other common fungi include: Remispora maritima, Tirispora sp., Monotosporella

sp. Phoma sp., and Trichocladium achrasporum. Among the 27 fungi collected, 7 are

possibly new to science. Nemania maritima and Panorbis viscosus are new records for Japan.

Phylogenetic analyses of LSU rDNA sequences placed Naufragella delmarensis with Nohea

umiumi ina highly supported clade. Both Naufragella and Nohea have similar morphological

characters that, in combination with the molecular data, support their placement in a

single genus. The new combinations Nohea delmarensis and N. spinibarbata are proposed.

The anamorph-teleomorph connection of Trichocladium achrasporum—Halosphaeriopsis

mediosetigera was supported with molecular data for the first time.

Key worps — ecology, Halosphaeriales, sub-tropics, aquatic fungi

Introduction

Our knowledge of lignicolous marine fungi from coastal areas of Japan is

fragmentary, with only a few studies carried out with wood blocks baits in

oceanic water (Tubaki 1966, 1967, 1969, 1973). These four studies documented

the presence of 25 lignicolous marine fungi, including a new species, Remispora

galerita Tubaki (Tubaki 1967). Sarushima Island, the only natural island in

Tokyo Bay, was a military fort until the Second World War when it was closed

to civilian access. Sarushima Island is now a tourist site and the public has easy

access to the island. As no marine fungi have been reported from this small

island, this study was carried out to document its marine fungal diversity.

444 ... Abdel-Wahab

The genera Nohea and Naufragella are closely similar in their morphology.

Both genera have two types of ascospore appendages: gelatinous and fibrous.

The two genera differ only in the position of the ascospore appendages. Nohea

has gelatinous appendages attached subapically and laterally and two lateral

fascicles of thin hairs. Naufragella has apical gelatinous appendages and a

subapical crown of filaments at each apex below the gelatinous appendages.

Kohlmeyer and Volkmann-Kohlmeyer (1998) opined that the differences

in the positions of the gelatinous appendages (lateral in Nohea vs. apical in

Naufragella) and filaments (on one side in Nohea vs. forming a subapical crown

in Naufragella) are distinctive characters that can be used to separate fungi at

the generic level. Phylogenetic analyses herein were carried out to test whether

the genera Nohea and Naufragella are congeneric. Another closely similar

genus, Remispora, is characterized by its wing-like apical, gelatinous ascospore

appendages that unfold to form long fibrous material in water.

During this study, phylogenetic analyses of LSU rDNA sequences were

carried out to elucidate the relationships among the genera Naufragella, Nohea,

and Remispora as well as among various marine species.

Materials and methods

Collection techniques

Samples of driftwood collected from the intertidal zone of Sarushima Island,

Japan, were placed in clean plastic bags and returned to the laboratory. They were

examined with a dissecting microscope for marine fungi immediately upon return

to the laboratory, placed in sterile humid plastic boxes for incubation, and examined

periodically over 4 months of incubation. Methods used for the preparation of materials

for light microscopy followed those of Jones & Hyde (1988). For each taxon, percent

occurrence was calculated as: (no. of collections) x 100/(no. of samples).

Digital micrographs were obtained with a Nikon Eclipse E800 differential interference

contrast light microscope and “studio viewfinder version 3” (Nikon Corporation, Japan)

digital imaging system. Wood samples bearing fungi were dried at 60 °C for 24 h. To

obtain single-ascospore cultures of the recorded fungi, ascomata were cut open with

a sterile razor blade, and the centrum tissue containing ascospores was removed with

sterile forceps and placed in sterile seawater. Small drops of this ascospore suspension

were placed on GYA (10 g glucose, 1 g yeast extract, 18 g agar in 1 ] seawater) in Petri

dishes and incubated at 25°C in the dark. Germinated ascospores were transferred to

new GYA Petri dishes with sterile forceps and incubated at 25°C in the dark. Dried

fungi and isolated fungal cultures were deposited at the Extremobiosphere Research

Center, Japan Agency for Marine-Earth Science and Technology (JAMSTEC), Japan and

National Institute of Technology and Evaluation, Biological Resource Center (NBRC),

Japan. DNA isolation, PCR reactions, cycling parameters, sequencing, sequence

alignment and phylogenetic analyses were carried out as described by Abdel-Wahab et

al. (2009).

Marine fungi of Sarushima Island (Japan) ... 445

DNA extraction, sequencing, and phylogenetic analysis

DNA was extracted from pure fungal mycelium using the Microbial DNA Extraction

Kit (MOBIO; Mo Bio Laboratories, Carlsbad, CA, USA) according to the manufacturer’s

instructions. Partial LSU ribosomal DNA was amplified using primers LROR and LR7

(Bunyard et al. 1994). PCR reactions, cycling parameters and sequencing were carried

out as described by Abdel-Wahab et al. (2009). Sequences were assembled using

Sequencher 4.2.2 (Gene Codes Corporation). Sequences were aligned with others

retrieved from GenBank using ClustalX (Thompson et al. 1997) and optimized manually.

The positions where one or more species contained a length mutation and ambiguously

aligned regions were not included in the subsequent phylogenetic analysis. Nucleotide

sequence phylogenies were constructed using PAUP* 4.0b10 (Swofford 2002). Maximum

likelihood (ML) analyses (Felsenstein 1981) were performed using heuristic searches with

the random stepwise addition of 100 replicates and tree bisection reconnection (TBR)

rearrangements. The optimal model of nucleotide substitution for the ML analyses was

determined using hierarchical likelihood ratio tests as implemented in Modeltest 3.7

(Posada & Crandall 1998). The model selected as the best fit for LSU rDNA data set was

TrN+I+G. For the bootstrap analyses (Felsenstein 1985), 100 replicates were generated

with 5 random additions and TBR. Maximum parsimony (MP) trees were obtained

by 100 random addition heuristic search replicates using PAUP, and 1000 bootstrap

replicates were performed employing 5 random addition heuristic searches. Posteriori

probability values were obtained by using the MrBayes 3.1.2 (Huelsenbeck & Ronquist

2001, Ronquist & Huelsenbeck 2003) with the GTR+I+G model that was determined

using MrModeltest 2.2 (Nylander 2004). Nodal supports in the Bayesian analyses were

examined by posterior probabilities from five million generations that were run in four

chains with sampling every 100 generations, yielding 50 000 trees, of which the first

12 500 were discarded as “burn in” Five sequences of the LSU rDNA sequences were

generated in this study and were deposited at GenBank and their accession numbers are

shown in Fie. 1.

Results

Twenty-seven fungi (18 ascomycetes and 9 anamorphic fungi) were

identified from 122 fungal collections that were recorded from 91 driftwood

samples collected from Sarushima Island, Japan. Ceriosporopsis halima (17.6

%), Corollospora maritima (43.9 %) and Halosphaeria appendiculata (12.1 %)

occurred most frequently. Other common fungi include: Remispora maritima

(5.5 %), Tirispora sp. (8.8 %), Monotosporella sp. (5.5 %), Phoma sp. (7.7 %) and

Trichocladium achrasporum (5.5 %). Among the 27 fungi recorded during the

present study, 7 fungi (representing 25.9 % of the recorded fungi) are possibly

newto science. Nemania maritima and Panorbis viscosus are reported from Japan

for the first time. Representatives of the Halosphaeriales predominated in the

fungal community, comprising 27 species (59.3 %). Hyphomycetes, represented

by 8 species, comprised the major anamorphic group, and coelomycetes were

represented by one species of Phoma (TABLE 1).

446 ... Abdel-Wahab

TABLE 1. Frequency of occurrence of marine fungi collected from Sarushima Island

FUNGI %

Ascomycota

Botryosphaeria sp.

Ceriosporopsis halima Linder 76

*Ceriosporopsis sp. 1

*Ceriosporopsis sp. 2 (MF 985) 3.3

Corollospora maritima Werderm. 43.9

“Dryosphaera sp.

Halosphaeria appendiculata Linder 2.1

Halosphaeriopsis mediosetigera (Cribb &J.W. Cribb) T.W. Johnson 2.2

Leptosphaeria sp.

Lulworthia grandispora Meyers :

Marinospora calyptrata (MF986) 3.3

*Morakotiella sp. (MF 980) 22

Nemania maritima Y.M. Ju & J.D. Rogers 2.2

Panorbis viscosus (1. Schmidt) J. Campb. et al. 11

Nohea delmarensis (MF982) 11

Remispora maritima (MF988) 55

*Remispora sp. (MF987) it

ctl OA EIN Ry AM Naas hah sh Mien dct Meda ahe die Nariel be A nls

Anamorphic fungi

Cirrenalia macrocephala (Kohlm.) Meyers & R.T. Moore 1.1

Halazoon fuscus (1. Schmidt) Abdel-Wahab et al. 2.2

*Monotosporella sp. (MF984) 5.5

Phoma sp. 77

Trichocladium achrasporum 5.5

Trichocladium melhae E.B.G. Jones et al. 11

Xylomyces sp. dat

Veronaea japonica Arzanlou et al. (MF991) sai

Unknown synnematous fungus 11

*Possibly new fungi

Total numbers: samples = 91; fungal collections = 122; species = 27; ascomycetes = 18;

anamorphic fungi = 9; fungi per sample = 1.3.

Phylogenetic analyses of Halosphaeriales LSU rDNA dataset

The partial LSU rDNA sequences of Marinospora calyptrata, Naufragella

delmarensis, R. maritima, and T. achrasporum were aligned with representatives

of the Halosphaeriales along with representatives of the Microascales and

Xylariales. In total, the dataset included 36 taxa of which 31 belong to

Halosphaeriales, one to Microascales, and four to Xylariales that were used

as outgroup taxa. The dataset consisted of 460 total characters, of which 49

gaps were excluded, 250 characters were constant, 48 variable characters were

parsimony-uninformative, and 113 were parsimony informative characters.

Marine fungi of Sarushima Island (Japan) ... 447

.02

Nimbospora effusa Broom

Phaeonectriella lignicola AY150224

Halosarpheia marina AY227125

Okeanomyces cucullatus AY490787

93/95 Ascosacculus heteroguttulatus AY227122

Aniptodera chesapeakensis U46882

Nais inornata AF539476

Remispora maritima HQ268016

Neptunella longirostris AF539472

Morakotiella salina AY864843

Nohea umiumi U46893

80177 99/100 ' Naufragella delmarensis HQ268017

Natantispora lotica AF396873

Tirispora unicaudata AY150225

Lignincola laevis U46890

Cucullosporella mangrovei AY150219

Antennospora quadricornuta AY090890

Halosarpheia fibrosa AF396872

84/75 Lignincola tropica AF539474

186 Marinospora longissima AF491266

Marinospora calyptrata HQ268015

Halosphaeriales

Ceriosporopsis halima U47844

Magnisphaera spartinae AY150221

Ophiodeira monosemeia U46894

94/100 Ascosalsum cincinnatulum AY150220

Corollospora maritima AF491260

Sagaaromyces abonnis AF539469

Halosphaeriopsis mediosetigera U46887

73/96 |Trichocladium achrasporum HQ268019 (MF41)

Trichocladium achrasporum HQ268018 (MF992)

Haligena elaterophora AY864845

Microascus trigonosporus U47835 | Microascales

Rosellinia corticium DQ840078

78I- wr Fl ‘i

100/100 Daldinia concentrica U47828 Xylariales

90/- Nemania diffusa DQ840076

Xylaria hypoxylon U47841

Fic. 1: Maximum likelihood phylogenetic tree (-In likelihood = 3,008.01) shows relationships

of Marinospora calyptrata, Naufragella delmarensis, Remispora maritima, and Trichocladium

achrasporum and representatives of halosphaeriaceous ascomycetes based on LSU rDNA. The

numbers indicate pp values > 95% (in bold), ML bootstrap and MP bootstrap values > 70%.

Sequences generated during the present study are set in bold font.

The heuristic search generated 24 most parsimonious trees, all 520 steps long,

and with a consistency index of 0.4462, a retention index of 0.6449, and a

rescaled consistency index of 0.2877. Maximum likelihood analysis produced

one tree with an —In likelihood score of 3,008.01 (Fic. 1). Most parsimonious

(MP) and Bayesian analyses produced trees (not shown) similar to the one in

Fre. 1.

AAB8 ... Abdel-Wahab

Taxonomic notes

Naufragella Kohlm. & Volkm.-Kohlm.

Kohlmeyer & Volkmann- Kohlmeyer (1998) established the genus Naufragella

Kohlm. & Volkm.-Kohlm. to accommodate a new fungus, N. delmarensis, and

also transferred Remispora spinibarbata to the new genus. During this study N.

delmarensis was isolated, described, photographed (Fics 2-5), and sequenced.

The genera Naufrageila and Remispora Linder share common morphological

characters. Barghoorn & Linder (1944) established the genus Remispora to

accommodate halosphaeriaceous fungi with exosporic ascospore appendages

that consist of a fibrous component in an amorphous matrix. Fragmentation of

the sheath gives rise to wing-like fibrous polar appendages (Jones & Moss 1978,

Johnson et al. 1984, Jones et al. 2009). Recent phylogenetic analyses revealed

that Remispora is polyphyletic (Jones et al. 2009).

In contrast, Naufragella and Nohea both have two types of appendages:

(a) gelatinous, forming a band or veil at each apex and (b) a crown of delicate

filaments below each apex (Kohlmeyer & Volkmann-Kohlmeyer 1998).

Phylogenetic analyses place the type species of both genera, Nohea umiumi and

Naufr. delmarensis, within a highly supported clade (99/100/100 for ML/MP/

Bayesian pp respectively) that forms a sister group to Morakotiella salina (C.A.

Farrant & E.B.G. Jones) Sakay. and Neptuneila longirostris (Cribb & J.W. Cribb)

K.L. Pang & E.B.G, Jones. I conclude that the genera, Nohea and Naufragella

are congeneric and that, within the Halosphaeriales, ascospore appendage

position is not a reliable character with which to separate fungi at the generic

level, contrary to the opinion of Kohlmeyer & Volkmann-Kohlmeyer (1998).

Naufragella spinibarbata is very similar to Naufr. delmarensis, and the two

species differ only in ascospore dimensions and appendage shape and length.

Naufragella spinibarbata was not available for sequencing and further study

is needed to confirm its phylogenetic relationships but for the time being it

should returned to Nohea.

Based on the morphology and the molecular results presented here, the

following two combinations are proposed:

Nohea spinibarbata (Jorg. Koch) Abdel-Wahab, comb. nov.

MycoBank MB 519505

=Remispora spinibarbata Jorg. Koch, Nordic Journal of Botany 8: 517, 1989.

=Naufragella spinibarbata (Jorg. Koch) Kohlm. & Volkm.-

Kohlm. Systema Ascomycetum 16: 11, 1998.

Nohea delmarensis (Kohlm. & Volkm.-Kohlm.) Abdel-Wahab, comb. nov.

MycoBank MB 519504 FIGS 2-5

= Naufragella delmarensis Kohlm. & Volkm.-Kohlm., Systema Ascomycetum 16: 10, 1998.

Ascomata 230-260 um high, 250-270 um in diam, erumpent to superficial,

ostiolate with short neck, periphysate, coriaceous, hyaline to cream colored,

Marine fungi of Sarushima Island (Japan) ... 449

Fics 2-5: Nohea delmarensis. Differential interference contrast light micrographs.

2. Vertical section through ascoma. 3. Immature ascus. 4-5. Ascospores with elaborate

two types of appendages (Fic. 5, arrowed). Bars: 2 = 50 wm, 3-5 = 5 wm.

solitary or gregarious (Fic. 2). Peridium 12-15 um thick consisting of 4-6 layers

of flattened polygonal cells. Neck 50-90 um high, 40-48 wm in diameter. Asci

58-70 x 18-27 um, 8-spored, thin-walled, clavate, pedunculate, deliquescing at

maturity (Fic. 3). Ascospores 19-21 x 8.5-9 um, one-septate, not constricted at

the septum, ellipsoidal, with tapered ends. Appendages of two types: (1) polar,

A450 ... Abdel-Wahab

gelatinous, forming a cap-like structure at the apex and lying flat against the

lateral wall forming two unequal wings, wings unfurling in water to form long

sticky filaments and (2) sub-polar crown of spines 15-20 tm long (Fics 4-5).

Marinospora calyptrata (Kohlm.) A.R. Caval. Fics 6-10

During the course of this study, the type species of Marinospora, M. calyptrata,

was recorded, described, photographed, isolated and sequenced.

Ascomata 650-850 um high and 900-1150 um wide, deeply immersed with

long neck growing through the substrate to the surface, subglobose to fusiform

or flattened globose. Asci 120-180 x 24-41 um, 8-spored, clavate with beaked

apex, deliquescing at maturity (Fic. 6). Catenophyses present. Ascospores

26-35 x 10-16 um, one-septate, slightly constricted at the septum, ellipsoidal,

hyaline, rough walled (only visible at 1000x). (Fics 7, 9, 10), enclosed ina sheath,

provided with four to five obclavate, tapering appendages. Appendages straight

or curved, one at each ascospore apex and two to three around the mid-septum,

14-26 wm long, 5-8 um wide at base; annulated along appendage length and

bearing a terminal inverted cap (Fics 7-10).

Norte: Marinospora longissima was considered conspecific with M. calyptrata

(Kohlmeyer & Kohlmeyer 1979). However, Jones & Moss (1980) separated the

two species based on the presence of a mucilaginous envelope in M. longissima

and consistently longer apical appendages. Phylogenetic analyses of LSU rDNA

sequences of M. calyptrata and M. longissima confirm that they are distinct

species and this is in agreement with previous study carried by Sakayaroj et al.

(2004).

New morphological features of M. calyptrata observed during this study

include: (1) presence ofaroughened ascospore wall (Fic. 9, arrowed) surrounded

by a mucilaginous layer (Fic. 10, arrowed); (2) ascospore appendages are

annulated along their length (Fic. 7, arrowed). Marinospora calyptrata grouped

consistently with M. longissima and Ceriosporopsis halima, based on molecular

data (Fic. 1).

Remispora maritima Linder Fics 11-16

During the course of this study, the type species of Remispora, R. maritima,

was isolated, photographed, and sequenced.

Ascomata 180-220 um high, 250-310 um in diam, erumpent to superficial,

papillate, ostiolate, coriaceous, hyaline to cream colored (Fic. 11). Peridium

18-24 um thick, consisting of 5-7 layers of flattened polygonal cells (Fic. 12).

Neck 45-70 um high, 60-68 um in diam. Asci 90-120 x 26-48 um, 8-spored,

thin-walled, broadly clavate, pedunculate, deliquescing at maturity (Fic. 13).

Ascospores 25-28 x 10-12 um, one-septate, not constricted at the septum,

ellipsoidal, hyaline, appendaged; at first surrounded by a gelatinous sheath

Marine fungi of Sarushima Island (Japan) ... 451

Fics 6-10: Marinospora calyptrata. 6. Ascus. 7-10. Ascospores with annulations along the

appendages (Fic. 7, arrowed), roughened wall (Fic. 9, arrowed), and gelatinous sheath (Fic. 10,

arrowed). Bars: 6,8 = 10 um, 7,9,10 = 5 um.

that unfolds (Fics 14-15), remaining attached at both ends of the ascospore;

appendages later elongate and forming numerous fiber-like elements embedded

in the gelatinous material (Fic. 16).

Nore: Phylogenetic analyses of ribosomal gene sequences indicate that

Remisporais a polyphyletic genus (Jones et al. 2009). Remispora maritima seems

452 ... Abdel-Wahab

Fics 11-16: Remispora maritima. 11. Section through the ascoma. 12. Section through

part of the ascomata showing peridium structure. 13. Ascus. 14-16. Ascospores.

Bars: 11 = 25 um, 12 = 5 wm, 13-14 = 10 um, 15-16 = 5 um.

to be cosmopolitan in its distribution but occurs more frequently in temperate

regions (Kohlmeyer & Kohlmeyer 1979). In the LSU analyses in this paper,

Remispora maritima was basal to a node containing Aniptodera chesapeakensis,

Ascosacculus heteroguttulatus, Nais inornata, and Okeanomyces cucullatus

(Fic. 1).

Marine fungi of Sarushima Island (Japan) ... 453

Trichocladium achrasporum (Meyers & Moore) Dixon ex Shearer & J.L. Crane

Shearer & Crane (1977) discovered the connection between Halosphaeriopsis

mediosetigera and T. achrasporum through single spore cultural connection.

That anamorph-teleomorph connection is supported at molecular level for the

first time herein. Phylogenetic analyses of LSU rDNA sequences of two isolates

of T. achrasporum that were isolated from Japan (MF992) and Egypt (MF41)

were consistently grouped with the teleomorph H. mediosetigera with high

bootstrap support (73/96/86 for ML/MP/Bayesian pp respectively). Apparently

there are several varieties of T. achrasporum. The type specimen has conidial

dimensions 17-21(-32) x (8-)10-13 (-16) um (Meyers & Moore 1960), while

Kohlmeyer & Volkmann-Kohlmeyer (1991) reported a wider range of conidial

dimensions (-15)20-34(-45) x (8-)10-24 wm. The isolates T. achrasporum

from Egypt and Japan have similar conidial dimensions (14-32 x 8-18 um)

that agree with those of the type specimen.

Goh & Hyde (1999) monographed Trichocladium, accepting 18 species and

describing a number of new species. They referred another 22 Trichocladium

names to other genera, e.g. Bactrodesmium, Hemispora, and Pithomyces. Several

Trichocladium species have been described from aquatic environments (Crane

& Shearer 1978, Kohlmeyer & Volkmann-Kohlmeyer 1995, Hyde & Goh 1998,

1999, Goh & Hyde 1999, Hyde et al. 1999, Jones et al. 2001). Trichocladium

achrasporum differs from the lectotype species, T. asperum Harz, by having

sporodochioid conidiomata (Meyers & Moore 1960). Kohlmeyer & Kohlmeyer

(1979), however, considered that the degree of conidiophore aggregation in

T. achrasporum could not be considered as a sporodochium and so accepted its

relocation in Trichocladium from the genus Culcitalna Meyers & R.T. Moore.

Currently, there are seven marine Trichocladium species (Jones et al. 2009).

Discussion

Ceriosporopsis halima and Corollospora maritima were the most frequently

collected fungi during this study and these results are similar to those of

previous studies that have been carried out in Japan (Tubaki 1966, Nakagiri et

al. 1999). Both fungi are cosmopolitan species that have been recorded from

various continents (Cribb & Cribb 1956, Kohlmeyer & Kohlmeyer 1979, Miller

& Whitney 1981, Lintott & Lintott 1982, Zanial & Jones 1984, Jones 1985,

Shearer & Burgos 1987, Hyde & Jones 1989, Tan & Leong 1992, Abdel-Aziz

2010).

Halosphaeria appendiculata was frequently recorded during the present

study. This species was commonly recorded from San Juan Island (Jones 1985)

and from sea foam samples in Japan (Nakagiri 1989). Although cosmopolitan in

its distribution, H. appendiculata tends to occur more frequently in temperate

water (Kohlmeyer & Kohlmeyer 1979).

454 ... Abdel-Wahab

Acknowledgements

This work was funded by grants from the Japan Society for the Promotion of Science

(SPS) (No. 185701000001 and No. 18-06620). I am very grateful to Dr. Takahiko

Nagahama for his support and guidance during the course of this work and to JSPS

for an award of a postdoctoral fellowship. I would like to thank Prof. Carol Shearer and

Prof. Akira Nakagiri for reviewing the manuscript and for their invaluable comments.

Literature cited

Abdel-Aziz FA. 2010. Marine fungi from two sandy Mediterranean beaches on the Egyptian north

coast. Botanica Marina 53: 283-289. doi:10.1515/BOT.2010.023

Abdel-Wahab MA, Nagahama T, Abdel-Aziz FA. 2009. Two new Corollospora species and one new

anamorph based on morphological and molecular data. Mycoscience 50: 147-155. doi:10.1007/

$10267-008-0466-9

Barghoorn ES, Linder DH. 1944. Marine fungi: their taxonomy and biology. Farlowia 1: 395-467.

Bunyard BA, Nicholson MS, Royse DJ. 1994. A systematic assessment of Morchella using RFLP

analysis of the 28S rRNA gene. Mycologia 86: 762-772. doi:10.2307/3760589

Crane JL, Shearer CA. 1978. Two new species of Trichocladium (Hyphomycetes) from submerged

wood. Mycologia 70: 866-874. doi:10.2307/3759370

Cribb AB, Cribb JW. 1956. Marine fungi from Queensland-II. Papers of the University of

Queensland, Department of Botany 3: 97-107.

Felsenstein J. 1981. Evolutionary trees from DNA sequences: a maximum likelihood approach.

J. Mol. Evol. 17: 368-376. doi:10.1007/BF01734359

Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution

39: 783-791. doi:10.2307/2408678

Goh TK, Hyde KD. 1999. A synopsis of Trichocladium species, based on the literature. Fungal

Diversity 2: 101-118.

Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17:

754-755. doi:10.1093/bioinformatics/17.8.754

Hyde KD, Goh TK. 1998. Fungi on submerged wood in Lake Barrine, north Queensland, Australia.

Mycological Research 102: 739-749. doi:10.1017/S0953756297005868

Hyde KD, Goh TK. 1999. Fungi on submerged wood in River Coln, the Cotswolds, UK. Mycological

Research 103: 1561-1574. doi:10.1017/S0953756299008989

Hyde KD, Jones EBG. 1989. Ecological observations on marine fungi from the Seychelles. Botanical

Journal Linnean Society 100: 237-254. doi:10.1111/j.1095-8339.1989.tb01720.x

Hyde KD, Goh TK, Lu BS, Alias SA. 1999. Eleven new intertidal fungi from Nypa fruticans.

Mycological Research 103: 1409-1422. doi:10.1017/S0953756299008667

Johnson RG, Jones EBG, Moss ST. 1984. Taxonomic studies of the Halosphaeriaceae: Remispora

Linder, Marinospora Cavaliere and Carbosphaerella Schmidt. Botanica Marina 27: 557-566.

doi: 10.15 15/botm.1984.27.12.557

Jones EBG. 1985. Wood-inhabiting marine fungi from San Juan Island, with special reference to

ascospore appendages. Botanical Journal Linnean Society 91: 219-231. doi:10.1111/j.1095-

8339.1985.tb01146.x

Jones EBG, Hyde KD. 1988. Methods for the study of mangrove marine fungi. 9-27, in Agate,

Subramanian and Vannucci (eds.), Mangrove microbiology; role of microorganisms in nutrient

cycling of mangrove soils and water. UNDP/UNESCO, New Delhi.

Marine fungi of Sarushima Island (Japan) ... 455

Jones EBG, Moss ST. 1978. Ascospore appendages of marine ascomycetes: an evaluation of

appendages as taxonomic criteria. Marine Biology 49: 11-26. doi:10.1007/BF00390726

Jones EBG, Moss ST 1980. Further observations on the taxonomy of the Halosphaeriaceae. Botanica

Marina 23: 483-500. doi:10.1515/botm.1980.23.2.73

Jones EBG, Abdel-Wahab MA, Vrijmoed LLP. 2001. Trichocladium melhae sp. nov., a new tropical

marine fungus. Fungal Diversity 7: 49-52.

Jones EBG, Sakayaroj J, Suetrong S, Somrithipol S, Pang, KL. 2009. Classification of marine

Ascomycota, anamorphic taxa and Basidiomycota. Fungal Diversity 35: 1-187.

Kohlmeyer J, Kohlmeyer E. 1979. Marine mycology: The higher fungi. Academic Press, New York.

Kohlmeyer J, Volkmann-Kohlmeyer B. 1991. Illustrated key to the filamentous marine fungi.

Botanica Marina 34: 1-61. doi:10.1515/botm.1991.34.1.1

Kohlmeyer J, Volkmann-Kohlmeyer B. 1995. Fungi on Juncus roemerianus. I. Trichocladium

medullare sp. novo. Mycotaxon 53: 349-353. doi:10.2307/3760772

Kohlmeyer J, Volkmann-Kohlmeyer B. 1998. Naufragella, a new genus in the Halosphaeriaceae.

Systema Ascomycetum 16: 9-16.

Lintott WH, Lintott E.A. 1982. Lignicolous marine fungi from New Zealand. Mauri. Ora. 10:

73-76.

Meyers SP, Moore RT. (1960). Thalassiomycetes I]. New genera and species of Deuteromycetes.

American Journal of Botany 47: 345-349. doi:10.2307/2439220

Miller JD, Whitney NJ. 1981. Fungi from the Bay of Fundy. I. Lignicolous marine fungi. Canadian

Journal of Botany 59: 1128-1133. doi:10.1139/b81-154

Nakagiri, A. 1989. Marine fungi in sea foam from Japanese coast. IFO Research Communications

14: 52-79.

Nakagiri A, Okane I, Ito T. 1999. Geographical and seasonal distribution of arenicolous marine

fungi along the pacific coast of the Bousou Peninsula. IFO Research Communications 19:

22-33,

Nylander JAA. 2004. MrModeltest v2. Program distributed by the author. Evolutionary Biology

Center, Uppsala University, Uppsala.

Posada D, Crandall KA. 1998. MODELTEST: testing the model of DNA substitution. Bioinformatics

14: 817-818. doi:10.1093/bioinformatics/14.9.817

Ronquist F, Huelsenbeck JP. 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed

models. Bioinformatics 19: 1572-1574. doi:10.1093/bioinformatics/btg180

Sakayaroj J, Jones EBG, Chatmala I, Phongpaichit S. 2004. Marine fungi. 107-117, in: Thai fungal

diversity (eds. EBG Jones, M Tanticharoen, KD Hyde). BIOTEC, Thailand

Shearer CA, Burgos J. 1987. Lignicolous marine fungi from Chile. Botanica Marina 30: 455-458.

doi: 10.15 15/botm.1987.30.6.455

Shearer CA, Crane JL. 1977. Fungi of the Chesapeake Bay and its tributaries. VI. Trichocladium

achrasporum, the imperfect state of Halosphaeriopsis mediosetigera, a marine ascomycete.

Mycologia 69: 1218-1223. doi:10.2307/3758950

Swofford DL. 2002. PAUP* 4.0: Phylogenetic analysis using parsimony (*and other methods).

Sinauer, Sunderland, MA.

Tan TK, Leong WE. 1992. Lignicolous fungi of tropical mangrove wood. Mycological Research 96:

413-414. doi:10.1016/S0953-7562(09)81083-6

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The ClustalX windows

interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.

Nucleic Acids Res. 25: 4876-4882. doi:10.1093/nar/25.24.4876

456 ... Abdel-Wahab

Tubaki K. 1966. Marine fungi from Japan. Lignicolous group I. Transactions of the Mycological

Society of Japan 7: 73-87.

Tubaki K. 1967. Studies on the Japanese marine fungi. Lignicolous group II. Publications of the

Seto Marine Biological Laboratory 15: 357-372.

Tubaki K. 1969. Studies on the Japanese marine fungi. Lignicolous group HI. Algicolous group and

a general consideration. Annuals Reports of the Institution of Fermentation, Osaka 4: 12-42.

Tubaki K. 1973. Fungi inhabiting in brackish water. Reports of Tottori Mycological Institute, Japan

10: 523-539,

Zanial A, Jones EBG. 1984. Observations on some lignicolous marine fungi from Kuwait. Nova

Hedwigia 39: 569-575.

MYCOTAXON

Volume 115, pp. 457-468 January-March 2011

DOT: 10.5248/115.457

Paraconiothyrium babiogorense sp. nov., anew endophyte

from fir club moss Huperzia selago (Huperziaceae)

‘TULIA BUDZISZEWSKA*, 7WOJCIECH SZYPULA,

3MATEUSZ WILK & ‘MARTA WRZOSEK

‘Department of Plant Systematics and Geography &

’Department of Plant Ecology and Environmental Protection,

University of Warsaw, Al. Ujazdowskie 4, 00-478 Warsaw, Poland

2Department of Biology and Pharmaceutical Botany, Faculty of Pharmacy,

The Medical University of Warsaw, ul. Banacha 1, 02-097 Warsaw, Poland

CORRESPONDENCE TO *: julia. budziszewska@biol.uw.edu.pl

AssTRACT — Paraconiothyrium is a recently established genus within the order Pleosporales.

Species from this genus are commonly associated with plants but can also be found in soil

samples and be parasitic on fungi. Several isolates of a Paraconiothyrium sp. were obtained

from Huperzia selago in Poland. Strains were characterized based on morphological

characteristics and molecular data (SSU rDNA, ITS1, 5.88 rDNA, ITS2). Based on its unique

morphology and DNA phylogeny, isolates were described as a new species: Paraconiothyrium

babiogorense, which represents the first report of a Paraconiothyrium species from fir club

moss. Comparison of characters with other Paraconiothyrium species is provided as well as a

signature sequence for the new species.

Key worps — Paraphaeosphaeria, Coniothyrium

Introduction

Huperzia selago (= Lycopodium selago L.), fir club moss, is a member of the

Huperziaceae (Rothmaler 1944, 1962). Both gametophytes and sporophytes

of this plant are colonized by endophytic fungi (Higgins et al. 2007, Winther

& Friedman 2008). Recently, some Paraconiothyrium-like, endophytic strains

were isolated from healthy-looking propagules (e.g., bulbils, gemmae) of

Huperzia selago collected in the Babia Géra National Park, Poland.

Paraconiothyrium comprises 9 species to date (Damm et al. 2008). The

genus was established by Verkley (Verkley et al. 2004) to accommodate two

species of Coniothyrium-like anamorphs, Paraconiothyrium minitans (W.A.

Campb.) Verkley and P sporulosum (W. Gams & Domsch) Verkley. The genus

also comprised four newly described species: Paraconiothyrium estuarinum

A58 ... Budziszewska & al.

Verkley & M. da Silva, P brasiliense Verkley, P. cyclothyrioides Verkley, and

P. fungicola Verkley & Wicklow. Damm et al. (2008) later described P. variabile

Riccioni et al. and P africanum Damm et al., and transferred Microdiplodia

hawaiiensis Crous as P. hawaiiense (Cross) Damm et al. as indicated by ITS and

SSU sequence analyses. Paraconiothyrium belongs to the order Pleosporales,

class Dothideomycetes (Verkley et al. 2004, Damm et al. 2008). Based on SSU

and ITS phylogeny, the teleomorph state of Paraconiothyrium belongs probably

to the genus Paraphaeosphaeria s. str. (Camara et al. 2001, Verkley et al. 2004).

Paraconiothyrium is characterized by presence of eustromatic, simple or

complex, rarely pycnidial conidiomata. Conidiogenous cells are discrete or

integrated, phialidic or sometimes percurrent. Conidia are aseptate or one-

septate, thin-walled and generally smooth-walled, hyaline when liberated, later

brown (Verkley et al. 2004).

Most Paraconiothyrium isolates to date have been obtained from woody

plants (Damm et al. 2008). However, P. minitans and P. fungicola can also be

fungicolous (Campbell 1947, Whipps & Gerlagh 1992, Verkley et al. 2004,),

P. sporulosum was found in soil samples (Damm et al. 2008), and P estuarinum

was detected in an estuarine sediment (Verkley et al. 2004). Recently,

P. brasiliense and P. sporulosum were determined as dominant endophytes of

the mistletoe Phoradendron perrottetii (Viscaceae) from Brazil (Abreu et al.

2010). Damm et al. (2008) suggested that Paraconiothyrium was a commonly

occurring fungal genus and that it was more often isolated from warm regions

like South Africa, Italy, Brazil, Papua New Guinea, Hawaii (USA), and Turkey

(Verkley et al. 2004, Crous & Groenewald 2006, Gore & Bucak 2007, Riccioni

et al. 2007).

The aim of the present study was to evaluate the taxonomic position of

Paraconiothyrium-like isolates from H. selago propagules collected from an

alpine site in Babia Géra National Park, using morphological observations and

analysis of ITS and SSU rDNA sequences.

Materials & methods

Isolates

Symptomless Huperzia selago propagules from nine different plant individuals were

collected from one site in Babia Géra National Park (49°34’24”N 19°31’46”E), Beskidy

Mountains, Poland. After transfer to the laboratory, the propagules were cleaned of

remnants of soil and other plant leaves, rinsed in tap water with detergent, and then

surface disinfected according to the protocols of Szyputa et al. (2005). In the first step

propagules were subsequently rinsed for 1 min in the following solutions: 0.01 M

hydrochloric acid (HCl), 5% sodium hypochlorite (NaOCl) and 2.4 mM citric acid.

In the second step 70% ethyl alcohol (C,H,OH) for 1 min, 5% sodium hypochlorite

(NaOCl) for 15 min, and 7% hydrogen peroxide (H,O,) for 10 min were used.

After surface sterilization propagules were plated onto potato-dextrose agar (2%

PDA, Fluka’ Analytical) and synthetic medium with yeast extract (BTL, Lddz, Poland)

Paraconiothyrium babiogorense sp. nov. ... 459

containing 1 g Lt ammonium nitrate (NH,NO,), 1 g L'ammonium sulfate [(NH,),SO,],

4 gL" potassium phosphate dibasic (K,HPO,), 2 g L* potassium phosphate monobasic

(KH,PO,), 1 gL" sodium chloride NaCl, 10 g L' glucose,

1 g L" yeast extract (Difco, USA), and 15 g L'Bacto™ Agar (Becton, Dickinson

and Company, USA). The pH was adjusted to 4.55 prior to sterilization by using 10%

citric acid. The sterilization was carried out in an autoclave at 121° C under increased

pressure of 1 bar for 15 min. The cultures were incubated at room temperature (~17°C)

for 4 weeks. Reference strains of isolated fungi are maintained in herbarium (WA17577,

WA17612-WA17619) and culture collection (CBS128292).

Morphology

‘The strains were studied on 2% Potato Dextrose Agar (PDA, Fluka’ Analytical). Petri

dishes were incubated at room temperature for 2-4 weeks. To enhance sporulation,

autoclaved fir club moss fragments were placed on 2% PDA medium. Growth

characteristics were studied on PDA plates incubated in dark at room temperature.

Sporulating structures were mounted in Lactophenol Mounting Medium (Amann’s fluid;

Stevens 1974) and observed using Nikon Eclipse 600 and Nikon SMZ800 microscopes.

Digital images were recorded with Nikon DX 1200 and Canon EOS 450D. The structures

were measured using Coolview v.1.6.0 software.

DNA extraction & sequencing

Total genomic DNA was extracted from the fresh mycelium grown on PDA plates

using Genomic Mini AX PLANT Kit (DNA-Gdarnsk, Gdynia, Poland). The internal

transcribed spacer region (ITS; ca. 0.5 kb) and fragment of 18S rDNA (SSU rDNA; ca.

1.0 kb) were amplified by PCR. Forward primer ITS1-f and reverse primer ITS4 were

used to amplify the ITS region (Gardens & Bruns 1993). Forward primers 402 (5: Gcr

ACC ACA TCC AAG GAA GGC), 1144 (5°: GCC TGC GGC TTA ATT TGA CTC) and reverse

primers 1308 (5°: cic GTT CGT TAA CGG AAT TAA), R (5°: TGA TCC TTC TGC AGG TTC

ACC) were used to amplify SSU rDNA. PCR protocols followed Korniltowicz-Kowalska

et al. (2006). Forward and reversed sequences were matched using BioEdit Sequence

Alignment Editor v. 7.0.0 (Hall, 1999).

Phylogenetic analysis

Pairwise and global alignments of ITS region and SSU rDNA were performed in

BioEdit Sequence Alignment Editor v. 7.0.0 (Hall, 1999). Phylogenetic trees were

obtained from the data using maximum parsimony (MP), neighbor-joining (NJ)

in PAUP* v. 4.0b10 (Swofford 2002) and Bayesian analysis (BA) in MrBayes v. 3.1.2

(Huelsenbeck & Ronquist 2001). Tree robustness was evaluated by 1000 replicate

bootstrap analysis. The Akaike Information Criterion (AIC) implemented in Modeltest

3.7 (Posada & Crandall 1998) was used to select the model that best fit each dataset.

BLAST searches in GenBank with ITS region sequences were performed using the blastn

algorithm. For phylogenetic analysis Helminthosporium velutinum Link (AF145704) and

Helminthosporium solani Durieu & Mont. (AF163089) for the ITS dataset and Peziza

echinospora P. Karst. (AF006309) for the 18S rDNA dataset were used as outgroups like

in research by Damm et al. (2008). GenBank accession numbers used in these studies

are indicated on the phylogenetic trees.

460 ... Budziszewska & al.

A species specific, signature DNA sequence in the Internal Transcribed Spacer 1

(ITS1) was determined basing on ITS region alignment. The accuracy of characteristic

sequence identification was verified using the BLAST algorithm against the whole

GenBank database.

Results

Morphological observations

Morphological characters are presented in TABLE 1, where they are compared

with other closely related species. They are also presented in the taxonomic

description.

Phylogenetic analysis

The SSU region dataset contained 36 taxa and 933 characters (including

gaps) and 92 characters were parsimony informative. After heuristic search,

three most parsimonious SSU trees (length: 262 steps) were retained and the

strict consensus tree was calculated using bootstrap 50% majority-rule. The ITS

region alignment of 52 taxa contained 522 characters (including gaps), of which

179 characters were parsimony informative. After heuristic search, four most

parsimonious ITS trees (length: 423 steps) were retained, and the strict consensus

tree was calculated using bootstrap 50% majority-rule. The topologies of the

ITS trees using MP and BA were similar (Fics 1 and 2). However, in NJ analysis

P. fungicola was placed in outer position to all other Paraconiothyrium species,

and PB sporulosum, P. minitans, and two Paraphaeosphaeria spp. formed a sister

group separate from the to the remaining Paraphaeosphaeria spp. Although

we did not resolve phylogenetic relationships within the Paraphaeosphaeria/

Paraconiothyrium clade, the main species groups were the same as in Verkley

et al. (2004).

The genetic variability of ITS sequences between different strains of

P. babiogorense was very low (less than 1%). These ITS sequences revealed the

highest similarity to Coniothyrium fuckelii Sacc. (AY904055), Paraconiothyrium

sp. (EU709779), Coniothyrium wernsdorffiae Laubert (AY904058), and

Coniothyrium sp. (GU062312; e-value = 0.0; maximum identity = 95% all).

The SSU sequence of our strain revealed the highest similarity to Bipolaris

sorokiniana (Sacc.) Shoemaker (DQ337383), Paraphaeosphaeria michotii

(Westend.) O.E. Erikss. (AF250817), Paraphaeosphaeria sp. (AB096264), and

Paraconiothyrium sp. (AB303550; e-value = 0.0; maximum identity = 99% all).

The phylogenetic analysis of the SSU dataset confirmed that our isolates

are placed in the Paraconiothyrium/Paraphaeosphaeria clade (Fic. 1) as

defined by Verkley et al. (2004). The phylogenetic tree based on ITS dataset

showed that strains from H. selago are placed on sister branch to two other

Paraconiothyrium sp. from Polish club mosses (Fic. 2). However, without

detailed information on morphology of these two other strains, we decided not

0.66

99 |

1.00]

Paraconiothyrium babiogorense sp. nov.... 461

AY642527 Paraconiothyrium fungicola

~ HM623325 Paraconiothyrium babiogorense

AF250821 Paraphaeosphaeria pilleata

EU295653 Paraconiothyrium variabile

60 > AY642522 Paraconiothyrium estuarinum

| AY642523 Paraconiothyrium brasiliense

EU295651 Paraconiothyrium brasiliense

AY642524 Paraconiothyrium cyclothyrioides

AF250817 Paraphaeosphaeria michotii

AY642526 Paraconiothyrium minitans

98 EU295655 Paraconiothyrium hawaiiense

78 | 1.00 EU295656 Paraconiothyrium hawaiiense

0.99

Paraconiothyrium/Paraphaeosphaeria

EU295654 Paraconiothyrium africanum

AY016345 Letendraea helminthicola

AY016338 Bimuria novae-zelandiae

AF120250 Helminthosporium solani

AF120254 Helminthosporium velutinum

U05201 Pleospora herbarum

U43458 Pleospora herbarum

U04205 Leptosphaeria doliolum

U42481 Cucurbitaria berberidis

U43466 Pleospora betae

Pleosporales

U04238 Leptosphaeria maculans

AF250823 Phaeosphaeriopsis agavensis

U04236 Phaeosphaeria nodorum

AY642513 Coniothyrium palmarum

AF250820 Neophaeosphaeria filamentosa

U42484 Herpotrichia diffusa

U42483 Herpotrichia juniperi

AY016354 Trematosphaeria heterospora

——— AY642528 Roussoella hysterioides

AY016355 Westerdykella cylindrica

U42476 Lasiodiplodia theobromae

0.77 AB041248 Guignardia mangiferae

~ U42474 Dothidea insculpta

: AF006309 Peziza echinospora

Fic. 1. Strict consensus tree obtained from partial SSU nrDNA sequences data of selected

Dothideomycetes species. Numbers above branches indicate bootstrap support values inferred

by maximum parsimony analysis (1000 replicates; length: 277 steps, CI: 0.661, RI: 0.796,

RC: 0.526, HI: 0.339); numbers under branches indicate Bayesian posterior probability values.

Only values higher than 50% are shown.

462 ... Budziszewska & al.

-/100

1.00

-/96

100/99

1.00

Fic. 2. Strict consensus tree obtained from ITS region sequences data of Paraconiothyrium/

Paraphaeosphaeria species. Numbers above branches before slash indicate bootstrap support

values inferred by neighbor-joining analysis (1000 replicates); numbers above branches after

slash indicate bootstrap support values inferred by maximum parsimony analysis (1000

replicates; length: 423 steps, Cl: 0.650, RI: 0.894, RC: 0.581, HI: 0.350); numbers under branches

EF055360 Paraconiothyrium sp.

EF055359 Paraconiothyrium sp.

EU295641 Paraconiothyrium variabile

EU295644 Paraconiothyrium variabile

EU295647 Paraconiothyrium variabile

EU295643 Paraconiothyrium variabile

EU295648 Paraconiothyrium variabile

EU295646 Paraconiothyrium variabile

EU295640 Paraconiothyrium variabile

EU295645 Paraconiothyrium variabile

EU295639 Paraconiothyrium variabile

EU295642 Paraconiothyrium variabile

EU295649 Paraconiothyrium variabile

HQ316927 Paraconiothyrium babiogorense

HQ316928 Paraconiothyrium babiogorense

HQ316929 Paraconiothyrium babiogorense

HQ316930 Paraconiothyrium babiogorense

HQ316931 Paraconiothyrium babiogorense

HQ316932 Paraconiothyrium babiogorense

HQ316933 Paraconiothyrium babiogorense

HQ316934 Paraconiothyrium babiogorense

HM623324 Paraconiothyrium babiogorense

EU709779 Paraconiothyrium sp.

EU935219 Paraconiothyrium sp.

AY642531 Paraconiothyrium brasiliense

EU295637 Paraconiothyrium brasiliense

EU295635 Paraconiothyrium brasiliense

EU295638 Paraconiothyrium brasiliense

EU295636 Paraconiothyrium brasiliense

EU295632 Paraconiothyrium brasiliense

EU295633 Paraconiothyrium brasiliense

EU295634 Paraconiothyrium brasiliense

P. variabile

P. babiogorense

P brasiliense

98/87 AF250817 Paraphaeosphaeria michotii

1.00 AF250821 Paraphaeosphaeria pilleata

100/99 AJ293809 Paraconiothyrium eb | P minitans

1.00 AJ293810 Paraconiothyrium minitans

AJ293814 Paraconiothyrium sporulosum

AJ293815 Paraconiothyrium sporulosum

AY929375 Paraconiothyrium cyclothyrioides

AB096264 Paraphaeosphaeria sp.

AY642530 Paraconiothyrium estuarinum

DQ885896 Paraconiothyrium hawaiiense

DQ885897 Paraconiothyrium hawaiiense

] P. sporulosum

] P hawaiiense

EU295650 Paraconiothyrium africanum

AY642532 Paraconiothyrium fungicola

100/99

0.99

-/99

0.98

100/95

1.00

100/99

1.00

56/62

0.98

65/54

100/90 O81

0.72

59/66

0.98

95/93

1.00

100/96

0.79

98/94

94/85 0.99

0.95

100/99

1.00

51/95

155 0.79

AF439463 Saccharicola taiwanensis

AF439464 Saccharicola taiwanensis

Af439462 Saccharicola taiwanensis

AF455415 Saccharicola bicolor

U04203 Saccharicola bicolor

AF145704 Helminthosporium velutinum

AF 163089 Helminthosporium solani

indicate Bayesian posterior probability values. Only values higher than 50% are shown.

to treat all of them as the same species. Taking into account the phylogenetic

position of strains WA0000017577, WA0000017612-WA0000017619, their

distinct morphological characters, and low ITS sequence similarity to other

Paraconiothyrium representatives (less than 95%), we decided to describe them

as a new, separate species, Paraconiothyrium babiogorense.

Paraconiothyrium babiogorense sp. nov. ... 463

Taxonomy

Paraconiothyrium babiogorense Budziszewska, sp. nov. PLATE 1

MycoBank 519253

Coloniae in PDA ad temp 17°C luteae, reverso brunneae; Conidiomata eustromatica,

complexa, globosa (0.2-)0.3-0.5(-0.9) mm diametro; Cellulae conidiogenae discretae,

phialidicae, ampulliformes, hyalinae vel pallide brunneae, 5-7(-9) x 3-5 jm; Conidia

tempore liberationis hyalina, deinde luteo-fusca, cylindrica vel breviter cylindrica, glabra,

aseptata, interdum uniseptata, guttulata, 1-2(-3) x (7-)8-9(-10) um.

Type: Poland, Babia Gora National Park, Carpathians Mountains (49°34’24”N,

19°31'46"E; WGS84 system) from healthy propagules of H. selago, 10 October 2009,

J. Budziszewska; holotype, WA17577 (dried culture); isotypes, WA17612—-WA17619

(dried cultures); ex-holotype, CBS128292 (lyophylised culture).

SIGNATURE SEQUENCE: 5? CCCCTGGGGGCGTGGGCGTCTCCCGGCGTCCTCTCTCCTG 3”

Erymo.Loey: Named after the place of origin — the Babia Gora National Park, Poland.

Colonies on PDA reach 5 mm after 7 days and 25 mm after 28 days (~17°C,

dark). Colonies are Colonial-Buff to Deep Colonial-Buff and reverse is Honey-

Yellow to Isabella in color (Ridgway 1912). Conidiomata eustromatic, complex,

mostly submerged in the agar, but also superficial on club moss fragments,

globose to subglobose, dark brown to black, ostioles absent, (0.2-)0.3-0.5

(-0.9) mm diam. Conidiophores reduced to conidiogenous cells. Conidiogenous

cell discrete, phialidic, ampulliform, hyaline to pale brown, 3-5 x 5-7(-9)

um. Conidia hyaline when liberated, later pale brown, cylindrical to short-

cylindrical, rounded at both ends, aseptate, sometimes 1-septate, thin and

smooth-walled, with 2-5 oil guttules, 1-2(-3) x (7-)8-9(-10) um.

Host: Huperzia selago (L.) Bernh. ex Schrank & Mart. (Huperziaceae)

DIsTRIBUTION: Southern Poland.

Notss: P babiogorense is most similar to Coniothyrium lycopodinum Sacc.

& Paol., described from Lycopodium annotinum L. However, P. babiogorense

conidia are longer (8-9 um) than those of C. lycopodinum (6 um), and the

two species were isolated from different hosts. The short-cylindrical conidia

with oil guttules of P. babiogorense are also similar to those of P. cyclothyrioides

(Verkley et al. 2004). However, PB babiogorense conidia are larger (1-2 x 8-9

um) and have more (2-5) oil guttules than P. cyclothyrioides. The SSU and ITS

phylogenies also support P. babiogorense as different from P. cyclothyrioides

(Fics. 1 & 2).

Discussion

The signature sequence, low ITS sequence similarity to other Paraconio-

thyrium representatives (95%), distinct morphological characters, and

monophyly support the Huperzia selago isolates as representing a new taxon,

described above as P. babiogorense. The new species fits wellin the concept of the

464 ... Budziszewska & al.

es eer = _ SE-GTXGO-F S0-70 ; ;

CTE G Oe Ca pelle>-T qeotpuréogns oy wo0pypndure eee ‘oneurojsna FOOT “Te 19 Aappied OSE

Patten Ts , S-€ X £-G syatdorp rep 1-0 ; ;

LEEKCIVG mos Pall>T mojrndure 10 ‘asoqop8qns sazoo ‘aqeqided ‘oreurojsna FOO? TP 19 Aap9A mobuns g

we aw 1 2, OV-STXO8-SP cT-€0 r :

gk Gee oy pelleoT qeotpuréogns oy wo0pypndure peed ‘oneurojsna HOOT ‘Te 19 AapHIOA SRAM

= us £9 RSIS SO> 9007 PIeMetIa0Ip, i

selec! fEOe Pelle qeotpuréogns 0} waoyypndure Peete qerprusdd 2 snoln asHatmneit E

5 Shea Pople’ 9-EX BE 90-TO ‘ ;

F-€XG6-G9 yuasqe ‘Aout suLLOgTOp 0} wOFINduTe yeryuas sqerprusdd 8007 ‘Te Je WUE wnuvrnafo J

z 7 c ‘: LEXs-Ge = 90-€0 : {

GAL Se satuTjauros pale? ‘odeys ur ayqeiea eT qerprusdd 800¢ "TP 19 Came] NAPPA

bs ee . S-GEXO-F 7-0 : ;

e-¢ Ko e Mey payee 4aaSGayS ay iments quasqe ianienaca POOT “Te 12 AEPylaA, asuayisp.ig q

P-€XL-P yuasqe paljao- wuoyypndure 0} proac yeryuao ay LbOT Teqdurea suppume q

: i qerprusdd ey

900 > uinsojnaods q

ST-S1X S-GZ yuasqe palja2- asoqgols 0} wuopndure ayeporso qerprusdd PR6I Uesourars

L-G X G-€ S'0-€°0 ‘

6-8 X Z-1 S-Z P? [22-1 Suuitpyduire juasqe swiss Apnys yuasead asuaLosoiqvg q

saTNLLao

(um) azis aod STIa9 # (umn) azis aavHs (Wut) ‘WvId salogas

‘TIE SAONFO OIGINOD TIOILSO “Ad A.L VWOIGINOO AONTATATY

VICINO‘)

‘satsods wintsdyjoiuompsDg WIIIJIP JO sJojereypo yesisoToydiow Jo uostszeduroy t ATaV,

Paraconiothyrium babiogorense sp. nov. ... 465

PLATE 1. Paraconiothyrium babiogorense: a. complex conidiomata immersed in agar medium;

b. conidia; c. longitudinal section of conidiomata; d. conidiomatal wall (arrow indicates

phialidic cell).

genus by the presence of eustromatic, complex conidiomata, discrete, phialidic

conidiogenous cells, and thin-, smooth-walled, hyaline (when liberated) to

brownish spores (Verkley et al. 2004). DNA sequence data from P. babiogorense

also support this species as representing Paraconiothyrium.

Fungal endophytes of Huperzia selago are poorly known. Budziszewska &

Szyputa (2010) identified 13 endophytic speciesin H. selago shoots from different

sites, of which only two were cited by Higgins et al. (2007), who also worked

on this plant. Surprisingly, neither Higgins et al. (2007) nor Budziszewska &

Szyputa (2010) isolated Paraconiothyrium species from fir club moss shoots

when our study isolated P babiogorense from the vegetative reproductive

structures. However, the species could have been overlooked in previous

research, as it is an extremely slow growing fungus that is easily overgrown

by other, faster growing ones. Thus, the presence of a new Paraconiothyrium

species in H. selago shoots should be re-examined.

Although Paraconiothyrium species are relatively common (Damm et al.

2008), this is the first report of one isolated from fir club moss. Interestingly,

Coniothyrium lycopodinum (Saccardo 1892: 267-268), described from leaves of

Lycopodium annotinum from a mountain forest in Siberia, is morphologically

466 ... Budziszewska & al.

similar to our PB babiogorense isolates, at least according to its diagnosis.

Moreover, two Paraconiothyrium sp. isolates, which phylogenetic analysis

indicate are the closest relatives of the isolates from H. selago propagules, were

also isolated from the Polish club mosses Diphasiastrum tristachyum (Pursh)

Holub (EU709779) and Lycopodium clavatum L. (EU935219), suggesting some

degree of host specificity.

As P. babiogorense was isolated from healthy plant tissue, it is not known

whether it could be pathogenic to the host. Interestingly, periodic formation of

the specific vegetative propagules at the shoot apex is a unique feature of some

Huperzia species (Ollgaard 1987, Gola 2008). Moreover, the populations differ

in their strategies of balancing generative and vegetative reproduction with

extensive propagule production in mountain locations in opposition to the

moderate number of propagules produced by lowland plants (Gola 2008). All

P. babiogorense strains were isolated from these vegetative reproductive

structures in alpine H. selago plants, suggesting that it could be vertically

transmitted.

This fact can also explain the low genetic variability in ITS sequences among

P. babiogorense isolates. In fact, although we sampled nine plant ramets, we are

unable to determine how many plant genets there were. Thus, all isolated fungal

strains may actually be vertically transmitted clones of the same individual

and hence should not be treated as different strains. More research on

P. babiogorense and H. selago population structures and genetic variability on

this site are needed to understand the biology of the fungus.

Acknowledgments

The authors thank Dr Gerard J.M. Verkley and Dr Malgorzata Ruszkiewicz-Michalska

for reviewing the manuscript and Dr Pedro W. Crous for his useful comments on the

text. We would also like to thank Babia Géra National Park authorities for permission

to undertake the research in the park. The study was supported by State Committee for

Scientific Research, KBN, through Faculty of Biology, Warsaw University intramural

grant, BW191105, in the year 2010.

Literature cited

Abreu LM, Almeida AR, Salgado M, Pfenning LH. 2010. Fungal endophytes associated with the

mistletoe Phoradendron perrottettii [sic] and its host tree Tapirira guianensis. Mycological

Progress 9(4): 559-566. doi:10.1007/s11557-010-0663-8

Budziszewska J, Szyputa W. 2010. Influence of site conditions on the diversity of endophytic fungi

of clubmoss species Huperzia selago (L.) Bernh. ex Schrank et Mart. Polish Journal of Ecology

58(4): 627-634.

Camara MPS, Palm ME, Berkum P, Stewart EL. 2001. Systematics of Paraphaeosphaeria: a

molecular and morphological approach. Mycological Research 105(1): 41-56. doi:10.1017/

$0953756200003233

Campbell WA. 1947. A new species of Coniothyrium parasitic on sclerotia. Mycologia 39(2):

190-195. doi:10.2307/3755006

Paraconiothyrium babiogorense sp. nov. ... 467

Crous PW, Groenewald JZ. 2006. Microdiplodia hawaiiensis. Fungal Planet, No. 7 (www.

fungalplanet.org/content/descriptions/descriptions_001.htm).

Damm U, Verkley GJM, Crous PW, Fourie PH, Haegi A, Riccioni L. 2008. Novel Paraconiothyrium

species on stone fruit trees and other woody hosts. Persoonia 20: 9-17. doi:10.3767/

003 158508X286842

Gardens M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycetes: application

to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118. doi:10.1111/

j.1365-294X.1993.tb00005.x

Gola EM. 2008. Reproductive strategies of Huperzia. 5-14, in: E Szczesniak, E Gola (eds), Club

mosses, horsetails and ferns in Poland — resources and protection. Polish Botanical Society &

Institute of Plant Biology, University of Wroclaw.

Gore ME, Bucak C. 2007. Geographical and seasonal influences on the distribution of

fungal endophytes in Laurus nobilis. Forest Pathology 37: 281-288. doi:10.1111/j.1439-

0329.2007.00509.x

Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program

for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98.

Higgins LK, Arnold AE, Miadlikowska J, Sarvate SD, Lutzoni F. 2007. Phylogenetic relationships,

host affinity, and geographic structure of boreal and arctic endophytes from three

major plant lineages. Molecular Phylogenetics and Evolution 42: 543-555. doi:10.1016/

j-ympev.2006.07.012

Huelsenbeck JP, Ronquist F. 2001. MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics

17: 754-755. doi:10.1093/bioinformatics/17.8.754

Kornillowicz-Kowalska T, Wrzosek M, Ginalska G, Iglik H, Bancerz R. 2006. Identification and

application of a new fungal strain Bjerkandera adusta R59 in decolorization of daunomycin

wastes. Enzyme and Microbial Technology 38: 583-590. doi:10.1016/j.enzmictec.2005.10.009

Ollgaard B. 1987. A revised classification of the Lycopodiaceae s. lat. Opera Botanica 92: 153-178.

Posada D, Crandall KA. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics

14: 817-818. doi:10.1093/bioinformatics/14.9.817

Riccioni L, Manning M, Valvassori M, Haegi A, Casonato S, Spinelli R. 2007. A new disease: leader

die-back in Actinidia chinensis “Hort16A’ in Italy. Acta Horticulturae 753: 669-676.

Ridgway R. 1912. Color standards and color nomenclature. Eliborn Classics. Washington.

Rothmaler W. 1944. Pteridophyten-Studien I. Feddes Repertorium 54: 55-82. doi:10.1002/

fedr.19440540106

Rothmaler W. 1962. Uber eininge Diphasium-Arten (Lycopodiaceae). Feddes Repertorium 66:

234-236.

Saccardo PA. 1892. Supplementum universale, pars II. Discomyceteae-Hyphomyceteae. Sylloge

Fungorum 10. 964 p.

Sivanesan A. 1984. The bitunicate ascomycetes and their anamorphs. AR Gantner Verlag. Vaduz.

Stevens RB. 1974. Mycology guidebook. University of Washington Press. Seattle.

Swofford DL. 2002. Phylogenetic analysis using parsimony (PAUP). Version 4. Sunderland,

Massachusetts: Sinauer Associates.

Szypula W, Pietrosiuk A, Suchocki P, Olszowska O, Furmanowa M, Kazimierska O. 2005. Somatic

embryogenesis and in vitro culture of Huperzia selago shoots as a potential source of huperzine

A. Plant Science 168: 1443-1452. doi:10.1016/j.plantsci.2004.12.021

Verkley GJM, da Silva M, Wicklow DT, Crous PW. 2004. Paraconiothyrium, a new genus to

accommodate the mycoparasite Coniothyrium minitans, anamorphs of Paraphaeosphaeria, and

four new species. Studies in Mycology 50: 323-335.

468 ... Budziszewska & al.

Whipps JM, Gerlagh M. 1992. Biology of Coniothyrium minitans and its potential for use in disease

biocontrol. Mycological Research 96: 897-907. doi:10.1016/S0953-7562(09)80588-1

Winther JL, Friedman WE. 2008. Arbuscular mycorrhizal associations in Lycopodiaceae. New

Phytologist 177: 790-801. doi:10.1111/j.1469-8137.2007.02276.x

MYCOTAXON

Volume 115, pp. 469-480 January-March 2011

DOT: 10.5248/115.469

Additional species of Graphis from Maharashtra, India

GAYATRI CHITALE, URMILA MAKHIJA & BHARATI SHARMA®

Agharkar Research Institute, G.G. Agarkar Road, Pune - 411004, India

* CORRESPONDENCE TO: bharatiomsharma@gmail.com

ABsTRACT—Our recent investigations of the lichen flora of Maharashtra have brought to

light several new taxa in the family Graphidaceae. Nine species of Graphis with muriform

ascospores are recognized of which two, G. maharashtrana and G. elevativerrucosa, are

described as new to science. One new combination, G. panhalensis is proposed. Two species,

G. galactoderma and G. parilis, are recorded from India for the first time, and G. platycarpa

and G. subducta are reported for the first time from Maharashtra. Graphis sp. 1 is clearly

distinguished from the other species, but is not formally described as new to science as the

material is scanty. A revised key to all species of Graphis from Maharashtra is provided.

KEeyworps—taxonomy, ascomycetes, lichenized fungi

Introduction

The Western Ghats of India form a practically unbroken mountain chain

dominating the western coast of the Indian peninsula for almost 1600 km. They

extend from the mouth of the river Tapti in Gujarat to Kanyakumari, the tip of

South India in Tamil Nadu. The region consists of hills spreading north-south

along the coast traversing the states of Gujarat, Maharashtra, Goa, Karnataka,

Tamil Nadu, and Kerala and enjoys a tropical climate. The Western Ghats,

which are exceptionally biodiverse and occupy a special position in the Indian

subcontinent because of the interesting flora, are one of the richest lichen

sites of India. Thus far, 800 lichen species, including 219 (i.e. 27%) potential

endemics, have been recorded from this region (Singh et al. 2004).

Although a large number of lichens have been recorded from the Western

Ghats of South India, Maharashtra has long been among the least explored

places. During our recent investigations of the lichen flora of Maharashtra,

we recorded several species in the family Graphidaceae, including ten species

of Graphis with transversely septate ascospores and two species of Dyplolabia

(Makhija et al. 2005a), ten species of Hemithecium (Makhija et al. 2005b;

Chitale et al. 2009), three species of Pallidogramme (Chitale et al. 2009), and

eleven species of Diorygma (Sharma & Makhija 2009, Makhija et al. 2009).

470 ... Chitale, Makhija & Sharma

Graphis Adans. (sensu Staiger 2002), a widespread tropical lichen genus with

about 300 species known worldwide (Licking 2009, Lticking et al. 2009), is

characterized by a thallus crustose that is corticolous and epi- or endophloeodal

(rarely saxicolous or foliicolous); a green algal photobiont (Trentepohlia); lirellate

ascomata that are usually elongate, simple or variously branched (rarely short

oryzaeform), and immersed in the thallus or emergent and sessile; a totally

or partially but distinctly carbonized exciple with well developed, convergent,

and entire or crenate-sulcate labia; simple paraphyses that are not thickened

at apices; asci clavate to subcylindrical, (1-)2-4-8-spored, unitunicate, and

ascospores colourless, 3-many trans-septate, or muriform, locules lentiform,

I+ blue violet.

Graphis is represented by 85 species from the Indian subcontinent

(Adawadkar & Makhija 2004, 2006, 2007; Makhija & Adawadkar 2005a,b;

Makhija et al. 2005a, Jagadeesh Ram et al. 2007) and by ten species with trans-

septate ascospores from Maharashtra (Makhija et al. 2005a). In the present paper

we report the occurrence of nine Graphis species with muriform ascospores

from Maharashtra. Two species (G. maharashtrana, G. elevativerrucosa) are

described as new to science. Graphis galactoderma and G. parilis are reported

for the first time from India and G. platycarpa and G. subducta for the first

time from Maharashtra. Graphis panhalensis is proposed as a new combination.

Graphis sp. 1, which is clearly distinct from the other species, is not formally

described as new to science as the material is scanty. A key is provided to all

species of Graphis (both with trans-septate and with muriform ascospores)

now known from Maharashtra,.

Materials & methods

Chemical constituents were identified by thin-layer chromatography using methods

standardized for lichen products (Culberson & Kristinsson 1970, Culberson 1972, White

& James 1985) with the solvent systems benzene-dioxane-acetic acid (180:45:5), hexane-

ethyl ether-formic acid (130:80:20) and toluene-ethyl acetate-formic acid (139:83:8). All

specimens examined are deposited in Ajrekar Mycological Herbarium (AMH).

Taxonomy

Graphis elevativerrucosa Chitale, Makhija & B.O. Sharma, sp. nov. Fic. 8

MycoBank MB 519296

Similis Graphis bilabiata, sed lirellis longioribus, immerses in verrucosus et acid continens

differt.

Holotypus—India. Maharashtra: Sindhudurg District, Amboli, 28.9.1976, PG.

Patwardhan & A.V. Prabhu, 76.1233: AMH.

EryMo.oey: From the Latin elevatus (elevated) and verrucosus (warty): a reference to

highly elevated verruceae.

Graphis in Maharashtra (India) ... 471

Thallus crustose, corticolous, grayish-green to dull brownish-green, distinctly

warty, robust, thick; hypothallus absent. Ascomata lirelline, concolorous with

the thallus, straight to curved, terminally acute, mostly simple, rarely branched

irregularly, 1-9 mm long and 0.1-0.2 mm broad, immersed in verrucae of the

thallus, raised; exciple, convergent, non-striate, present at the base, apically

carbonized, covered with the thalline margin up to the top; hymenium hyaline,

not inspersed, 84-147 um tall, KI-; asci 2-4-spored. Ascospores hyaline,

muriform, ellipsoidal, oblong, 76-109 x 25-29 um, I+ violet.

CHEMISTRY— Constictic, stictic (major), and hypostictic (minor) acids

present.

ADDITIONAL SPECIMENS EXAMINED—INDIA. Manarasutra: Sindhudurg District,

Amboli, RG. Patwardhan & A.V. Prabhu, 76.1258, 76.1259; U.V. Makhija & A.V. Prabhu,

76.1236: AMH

REMARKS— Graphis elevativerrucosa is well characterized by the thick, highly

elevated, conspicuous warts of the thallus, apically carbonized exciple without

striae; 2-4-spored asci, muriform ascospores of 76-109 x 25-29 um and by the

presence of constictic, hypostictic and stictic acids in its thallus.

Graphis elevativerrucosa shares most of the morphological characters with

G. bilabiata Nyl., a species from Ceylon, but the latter has extremely short,

sessile lirellae with a thick lateral thalline margin.

Graphis streblocarpa (Bél.) NyL, a species with immersed to emergent lirellae,

large muriform ascospores, and a smooth to subtuberculate thallus, however,

differs from the present species in prominently immersed ascomata in the

thalline verrucae, 1-2-spored asci, and narrow (15-30 um diam) ascospores.

The new species has been collected in semi-evergreen forest in open places

on the roadsides.

Graphis galactoderma (Zahlbr.) Licking, Lichenologist 41: 436 (2009). Fic. 1

SPECIMENS EXAMINED—INDIA. Manarasutra: Kolhapur District, Panhala, PG.

Patwardhan e& A.V. Prabhu, 74.1083, 74.1094, 74.1113, 74.1121; BG. Patwardhan & C.R.

Kulkarni, 74.1144: AMH

Thallus crustose, corticolous, epiphloeodal, uniform, continuous, pale yellow

to white in colour, smooth to cracked, surrounded by thin, black hypothallus.

Ascomata lirelline, up to 6 mm long and up to 0.2 mm broad, simple to branched

or forked at apices, crowded, emergent to prominent, curved, wavy, flexuous,

blackish, terminally acute or obtuse; lateral thalline margin not bulging, studded

with crystals; exciple 1-4-striate, apically carbonized; hymenium hyaline, not

inspersed, 84-100 pm tall, KI-; asci 8-spored. Ascospores hyaline, muriform,

fusiform-oblong, 34-42 x 16-21 um, I+ violet.

CHEMISTRY—Constictic, stictic (major) and norstictic acid (minor)

present.

472 ... Chitale, Makhija & Sharma

REMARKS— Graphis galactoderma has been collected at ca. 750 m from moist

open forests that get heavy rains during the monsoon. ‘This species, earlier

known from the eastern palaeotropics, is a first report from India.

Graphis insulana (Mill. Arg.) Licking & Sipman, Fieldiana Botany 46(1):

84 (2008). Fic. 2

= Graphina insulana Mill. Arg., Engler Bot. Jahr. 4: 56 (1883).

SPECIMENS EXAMINED—INDIA. MAHARASHTRA: Ratnagiri District, Nerur, A.V.

Prabhu, 75.486, 75.487; Dabhole ghat, A.V. Prabhu e& M. B. Nagarkar, 74.2068: AMH

Thallus crustose, corticolous, whitish-gray to light greenish-gray, smooth,

cracked with the age, delimited by a black hypothalloidal region at the periphery.

Ascomata lirelline, mostly immersed, to rarely slightly emergent, straight to

curved, terminally acute, mostly simple, rarely irregularly branched, up to 11

mm long and up to 0.25 mm broad; exciple convergent, non-striate, laterally

to sometimes completely carbonized, present at the base; hymenium hyaline,

inspersed, 134-168 pm tall, KI-; asci 1-spored. Ascospores hyaline, muriform,

oblong, with more or less rounded ends, 67-118 x 17-29 um, I-.

CHEMISTRY —Norstictic acid present.

REMARKS—Graphis insulana, a widely distributed species in the tropical regions

of the world, was earlier described from Maharashtra as Graphina nylanderi

Patw. & C.R. Kulk. (Patwardhan & Kulkarnil979). It has also been reported

from Karnataka in India.

Graphis maharashtrana Chitale, Makhija & B.O. Sharma, sp. nov. Fic. 3

MycoBank MB 519287

Similis Graphis panhalensis, sed excipulo lateralis nigro, ascosporis minoribus, et acida

consticticum, hyposalazinicum et sticticum continens differt.

Holotypus—India. Maharashtra: Sindhudurg District, on the way to Ajra from Amboli,

10.10.2000, U.V. Makhija & B.A. Adawadkar, 00.168: AMH.

ETYMOLOGY: From the state name Maharashtra.

Thallus crustose, corticolous, endophloeodal, continuous, smooth to cracked,

grayish-white to dirty white, surrounded by a thin black hypothallus. Ascomata

lirelline, short, up to 3 mm longand 0.1mm broad, simple to branched, immersed

to semi-emergent, irregularly curved, flexuous, scattered, concolorous with

the thallus to black, terminally round to acute; exciple 4—5-striate, laterally

carbonized, present at the base, convergent, covered by a thick thalline margin

up to the top; studded with crystals; hymenium hyaline, not inspersed, 34-46

Figure 1-6. Habit: 1. Graphis galactoderma (74.1121: AMH); 2. G. insulana (75.486:AMH);

3. G. maharashtrana (Holotype); 4. G. panhalensis (Holotype); 5. G. parilis (74.1826:AMH);

6. G. platycarpa (74.1826: AMH). Bar =1mm

473

Graphis in Maharashtra (India) ...

474 ... Chitale, Makhija & Sharma

pum tall, KI-; asci 8-spored. Ascospores hyaline, muriform, fusiform-oblong,

without gelatinous sheath, 25-42 x 13-17 um, I+ violet.

CHEMISTRY—Constictic, stictic acids present.

ADDITIONAL SPECIMENS EXAMINED—INDIA. ManarasHTRa: Kolhapur District,

Panhala, 2G. Patwardhan & A.V. Prabhu, 74.1063b, 74.1076; 74.1078, 74.1091; PG.

Patwardhan & C.R. Kulkarni, 74.1095, 74.1101, 74.1129. Nasik District, Anjaneri,

B.C. Behera & G.S. Chitale, 02.232; Saptashringi, B.C. Behera & G.S. Chitale, 02.185.

Pune District, Bhimashankar, B.A. Adawadkar, 97.19; Lonavala, B.C. Behera & B.A.

Adawadkar, 00.87; Khandala, B.C. Behera & V.A. Mantri, 00.88; Lonavala, Walvan Dam,

B.C. Behera, 02.122, 02.123; Malshej Ghat, Neemgiri, UV. Makhija & A.V. Bhosale,

02.14B; Purandar fort, UV. Makhija & A.V. Bhosale, 02.55: AMH

REMARKS— Graphis maharashtrana belongs in a small group (Group 16,

Licking et al. 2009) of taxa with striate, laterally carbonized exciples, clear

hymenium, and muriform ascospores. All species but one within this group

lack lichen secondary metabolites. The exception, G. neoelongata Licking,

differs from the new species in having stictic and norstictic acids and very long

and radiately branched lirellae.

The species can easily be differentiated from the morphologically similar

G. panhalensis in having a laterally carbonized exciple, smaller ascospores of

25-42 x 13-17 wm and constictic and stictic acids. Graphis panhalensis has

apically carbonized exciple and larger ascospores of 45-65 x 12-16 um; it

contains has only stictic acid.

Graphis maharashtrana has been collected from the bark of Mangifera indica

in the dry deciduous forests.

Graphis panhalensis (Patw. & C.R. Kulk.) Chitale, Makhija & B.O. Sharma,

comb. nov. Fic. 4

MycoBank MB 519294

= Graphina panhalensis Patw. & C.R. Kulk., Norw. J. Bot. 26: 47 (1979).

Thallus pale glaucous green, smooth to indistinctly warty; ascomata emergent,

black, simple, curved or flexuous, 0.5-2 mm long, ends subacute; exciple 4-5-

striate, carbonized only at the apices; hymenium not inspersed; asci 8-spored;

ascospores hyaline, muriform, ellipsoid, 45-65 x 12-16 um.

CHEMISTRY—Stictic acid present.

SPECIMEN EXAMINED—INDIA. MAHARASHTRA: Panhala, 13.10.1974, 2G. Patwardhan

& C.R. Kulkarni, 74.1075: AMH (holotype)

REMARKS—Graphis panhalensis, established as Graphina panhalensis by

Patwardhan & Kulkarni (1979) from Maharashtra, is now placed in Graphis

in the new system of Staiger (2002) based on its convergent, well developed

exciple with distinct carbonized areas and colourless ascospores. This species is

known only from its type.

Graphis in Maharashtra (India) ... 475

Graphis parilis Kremph., Flora 59: 422 (1876). Fic. 5

SPECIMENS EXAMINED—INDIA. MAHARASHTRA: Satara District, Mahabaleshwar,

Arther Seat, M.B. Nagarkar & A.V. Prabhu, 74.1765, 74.1769; Lodwick point, M.B.

Nagarkar & A.V. Prabhu, 74.1826, 74.1839, 74.1849, 74.1910, 74.1911; A.V. Prabhu &

M.B. Nagarkar, 74.1823, 74.1824, 74.1825, 74.1827, 74.1835, 74.1872, 74.1927, 74.2952;

Kolhapur District, Panhala, 13.10.1974, BG. Patwardhan e& A.V. Prabhu, 74.1132; Pune

District, Malshej ghat, UV. Makhija & A.V. Bhosale, 02.17: AMH

Thallus crustose, corticolous, epiphloeodal, continuous, smooth to cracked,

or warty, greenish-yellow, surrounded by a thin, black hypothallus. Ascomata

lirelline, up to 10 mm long and 0.2-0.5 mm broad, branched, curved, totally

immersed to semi-emergent, or emergent, flexuous, concolorous with the

thallus, terminally acute; exciple yellowish-brown, present at the base, apically

carbonized, and convergent, 3-8-striate, covered by a thick thalline margin up

to the top, studded with crystals; hymenium hyaline, not inspersed, 84-126(-

136) wm tall, KI-; asci 2-8-spored. Ascospores hyaline, muriform, oblong,

46-76 x 13-17 um, I+ violet.

CHEMISTRY—Stictic acid present.

REMARKS—Graphis parilis, a species earlier reported from Brazil, Canada,

Florida, and Mexico, is here reported from India for the first time.

Graphis platycarpa Eschw., Fl. Brasil. 1:74 (1833). Fic. 6

SPECIMENS EXAMINED—INDIA. MAHARASHTRA: Satara District, Mahabaleshwar,

Arther Seat, M.B. Nagarkar e& A.V. Prabhu 74.1759, 74.1763; Lodwick Point, M.B.

Nagarkar & A.V. Prabhu; A.V. Prabhu & M.B. Nagarkar, 74.1864, 74.1902, 74.1839,

74.1910, 74.1911: AMH

‘Thallus crustose, corticolous, greenish-gray, epiphloeodal, continuous, smooth

to cracked, uneven, rough, surrounded by a thin, black hypothallus. Ascomata

lirelline, 1-3.2 mm long and 0.1-0.25 mm broad, simple to rarely with short

branches, semi-emergent, scattered, concolorous with the thallus, terminally

acute; exciple present at the base, 1-5-striate, carbonized only at tips, converging

at the apical portion, covered by a thick thalline margin up to the top, studded

with crystals; hymenium hyaline, clear, 100-136 um tall, KI-; hypothecium

hyaline to yellowish, 16-20 um thick; asci 8-spored. Ascospores hyaline,

muriform, fusiform-oblong, without gelatinous sheath, 7-14-transverse septa,

lumina lenticular, 59-71 x 13-17 um, I+ violet.

CHEMISTRY— No lichen substances present.

REMARKS— Graphis platycarpa was found in semi-evergreen forest in shady

places. The most similar species, G. glaucorufa Vain., differs from G. platycarpa

by its 1-spored asci.

Graphis platycarpa was earlier known from Manipur, India, and is reported

for the first time from Maharashtra.

476 ... Chitale, Makhija & Sharma

Ficure 7-9. Habit. 7. Graphis subducta (04.89:AMH)); 8. G. elevativerrucosa (Holotype); 9. Graphis

sp. 1. Bar = 1 mm

Graphis subducta Vain., Ann. Acad. Sci. Fenn., ser. A, 15(6): 203 (1921). Fic. 7

SPECIMENS EXAMINED—INDIA. Manarasutra: Kolhapur District, Panhala, PG.

Patwardhan e& A.V. Prabhu, 74.1085, G.S. Chitale, 02.282. Ratnagiri District, Chiplun,

G.S. Chitale, 04.89: AMH

Thallus crustose, corticolous, grayish, flaking, finely cracked, smooth to rough;

hypothallus black. Ascomata lirelline, simple to rarely branched, triradiate,

curved, emergent, up to 1.5 mm long, 0.2-0.5 mm broad; thalline margin

raised, concolorous with the thallus; exciple convergent, 3-4-striate, apically

carbonized; hymenium hyaline, not inspersed, 75-90 «um tall, KI+ blue-violet;

asci 8-spored. Ascospores hyaline, muriform, small, ellipsoidal, 24-33 x 9-12

uum, I+ blue-violet.

CHEMISTRY— Constictic and stictic acids present.

REMARKS— Graphis subducta, a species previously known from the

Philippines and in India from Nagaland, is here reported for the first time from

Maharashtra.

Graphis sp. 1 Fic. 9

SPECIMEN EXAMINED—INDIA. MAHARASHTRA: Satara District, Mahabaleshwar,

Lodwick point, M.B. Nagarkar & A.V. Prabhu, 74.1876, 74.1909: AMH

Thallus crustose, corticolous, epiphloeodal, continuous, smooth to cracked,

uneven, slightly rough, greenish-yellow, surrounded by thin, black hypothallus.

Ascomata lirelline, 1.5-7 mm long and 0.1-0.6 mm broad, simple to sparsely

branched, semi-emergent, irregularly curved, flexuous, intricate, concolorous

with the thallus, terminally acute; exciple 1-5-striate, yellowish-brown,

Graphis in Maharashtra (India) ... 477

carbonized at apices, convergent, covered by a thick brown to blackish thalline

margin up to the top, studded with crystals; hymenium hyaline, not inspersed,

126-176 um tall, KI-; asci 8-spored. Ascospores hyaline, muriform, elliptical-

oblong, 63-101 x 17-21 um, I+ violet.

CHEMISTRY —Stictic acid present.

RemMARKs—lhe present species is distinct in having unusual combination of

large ascospores and chemistry. It is similar to Graphis parilis in respect of

morphological characters and chemistry. However, G. parilis has much smaller

ascospores of 46-76 x 13-17 um. Since our material is rather scanty, we do not

propose a new species.

Key to the species of Graphis from Maharashtra

la. AscOspores trans-septate: 2... 3. tiue qa hoes oa htbaeabal dae ohudweee abs das 2

lb. Ascospores muriform ....... 0... c cece cette een een nnn een ees 11

2a. Proper exciple partially carbonized ....... 0.0... cece ee ee eee 3

2b. Proper exciple completely carbonized including at the base ................. 10

3a. Proper exciple apically carbonized ........ 0... ec cece een eens 4

3b. Proper exciple laterally carbonized down to the base ..................00 000. 5

4a. Thallus verruculose; ascomata black, 0.5-4 mm long; exciple present below,

3-4 striate; ascospores 21-39 x 4-7 um; stictic acid present... G. vittata Mill. Arg.

4b. Ascomata concolorous with the thallus, 0.5-6 mm long, more or less

effuse; exciple entire to 2-4 striate, indistinctly present at the base;

ascospores 21-49 x 4-6 tm; constictic, connorstictic, and norstictic

acids present ................ G. exalbata Nyl. (= G. nerurensis Makhija et al.)

5a. Exciple striate [Ascomata 0.1-7 mm long, black; exciple 2-13-striate,

partially to completely carbonized; ascospores oblong, 12-24-trans-septate,

with one end acute, 25-109 x 4-8 tm; no lichen substances present. ]

Ba aiken tM Beaten Rt agg ht BY Aeca Ball Mia oe Pat G. polystriata Makhija et al.

SD: EXCIplEMOt, State: 6. eset wce tociats epee on als setts Noha teal eghcnad deaual 6 Beans bret 6

6a. Norstictic acid absent [Ascomata 1-8 mm long, black; exciple present

at base, ascospores 5—-8-trans-septate, 20-38 x 5-8 ym; constictic and

stictic acids present .... 0... cece eee eee nee G. modesta Zahlbr.

6b; Norsti¢tic-acid present Sing eens ee eres bleeay edo dea Ok ea Zz

7a. Ascospores less than 50 um long 1.2.6... eect en eee n eens 8

7b. Ascospores more than 50 um long 2.0.0.0... cece cece ence een nena 9

8a. Thallus smooth to minutely warty; ascomata 1-4 mm long, black; exciple

present at base; ascospores 9-11-trans-septate, (20-)30-40 x 6-8 tm;

constictic, norstictic and stictic acids present

P erentaes Set MAR es teleosts salt Baad tp hites whe G. ajarekarii Patw. & C.R. Kulkarni

8b. Thallus smooth to plicate; ascomata 1-2.5 mm long, black; exciple present below;

ascospores 3-10-trans-septate, 17-42 x 5-9 um; constictic and norstictic

ACO Sgn cA MAR ore Sart URSA tl Bove Dash A lnc Su Rete ERS G. librata C. Knight

478 ... Chitale, Makhija & Sharma

9a. Thallus brownish to greenish-grey; ascomata 0.5-6 mm long, concolorous

with the thallus; exciple may or may not be present at the base;

ascospores 8-16-trans-septate, 25-60 x 5-11 um; norstictic acid present

hngshiodaredetcha todos viotasctonty riche seeded e-tietel ecu it G. pyrrhocheiloides (Vain.) Zahlbr.

9b. Thallus whitish; ascomata 1-8 mm long, black; exciple present at base;

ascospores 8-11-trans-septate, 25-50 x 7-10 um; norstictic and

stictic acids present .......... G. cincta (Pers.) Aptroot (= G. guimarana Vain.)

10a. Thallus off white; ascomata 1-5 mm long, black; exciple present at base,

multistriate; ascospores 6-9(-12)-trans-septate, 21-35 x 4-8 um;

no lichen substances present ......... 0.00. cece ee eee eee G. duplicata Ach.

10b. Thallus olivaceous buff to citrine green; ascomata 0.5-3 mm long, black;

exciple present at base, 3-4-striate; ascospores 7—10-trans-septate,

30-45 x 6-10 um; no lichen substances present

US Ae as ees eee Ree G. aurita Eschw. (= G. persulcata Stirt.)

lla. Exciple laterally carbonized 2.0... 0... ccc cece een een ees 12

11b. Exciple apically carbonized ..... 0... cece cette nen een e es 13

12a. Ascomata immersed, to slightly emergent, 0.1-11 mm long; exciple sometimes

completely carbonized, without striae; asci 1-spored; ascospores 67-118 x 17-29

um; norstictic acid present 0.0.0.0... cece eee eee eens G. insulana

12b. Ascomata grayish-white to dirty white to blackish, 0.1-3 mm long, immersed to

semi-emergent; exciple 4—5-striate; ascospores 25-42 x 13-17 um; constictic,

stictic and hyposalazinic acids present .................... G. maharashtrana

13a. Exciple not striate. [Ascomata emergent, 1-8 mm long; asci 2-4-spored,;

ascospores 76-109 x 25-29 um; constictic, hypostictic (trace) and stictic acids

present]. pi oRe saat pais aah g Rese odie cue gp Berges G. elevativerrucosa

MSDE EXCIp Oeste ate- kas. ct tcannctnat natin he chop hetustin aie Pale tegt facta ieat Laat ac ned Suey 14

14a. Ascospores less than 50 um long ......... 0... eee eect e ene es 15

14b. Ascospores more than 50 um long ....... 0... ec ee e ee ne ee 16

15a. Ascomata up to 6 mm long. Thallus pale yellow to white; ascomata 1-6 mm

long, simple to branched, semi-emergent to emergent; exciple, 1-4-striate;

ascospores 34-42 x 16-21 um; constictic, norstictic (trace) and stictic acids

PICSCNt ss he ahaa toh dt oad Pa aN Rd bod Re eae cb tids Jub a bade e 4 G. galactoderma

15b. Ascomata simple to rarely branched, tri-radiate, curved, emergent, 1-1.5 mm

long; exciple 3-4-striate; ascospores 24-33 x 9-12 um; constictic and stictic

AGIAS: PLESEMU ewe rkhes or re yet Tate reage eeloca cei a! PURER Clan G. subducta

16a. Lichen substances absent. [Ascomata 1-3 mm long, simple, or rarely with

short branches, semi-emergent; exciple 1-5 striate; ascospores 59-71 x

PSE WIN] fasts kts ie ack BA Pigness eagnats SERENE hese, ASEM cea, G. platycarpa

16b. Lichen substances present ......... 0. cece cece cnet n ene nen e eens 17

17a. Ascospores up to 100 um long. [Ascomata 1.5-7 mm long, simple to sparsely

branched, semi-emergent; exciple 1-5-striate; ascospores 63-101 x

17-21 um; stictic acid present] ...... 0... eee eee Graphis sp. 1

17b. Ascospores less than 100 um long ....... 0. cece cnet eens 18

Graphis in Maharashtra (India) ... 479

18a. Ascomata concolorous with the thallus, 1-10 mm long, branched, totally

immersed, semi-emergent, or emergent; exciple yellowish-brown, 3-8-striate;

ascospores 46-76 x 13-17 um; stictic acid present.................. G. parilis

18b. Ascomata black, short, 0.5-2.0 mm long, emergent; exciple 4—5-striate;

ascospores 45-65 x 12-16 um; stictic acid present.............. G. panhalensis

Acknowledgments

We are grateful to the Ministry of Environment and forests and the Department of

Science and Technology, Government of India, New Delhi for the financial support. We

also thank Miss Pradnya Khadilkar for preparing illustrations.

Literature cited

Adawadkar B, Makhija U. 2004. A new isidiate species of Graphis from India. Lichenologist 36:

361-363. doi:10.1017/S00242829040 14409

Adawadkar B, Makhija U. 2006. New species and new records of Graphis from India: trans-septate

species with completely carbonized exciples and norstictic acid. Mycotaxon 96: 51-60.

Adawadkar B, Makhija U. 2007. New species and new records of Graphis from India with partially

carbonized exciples and trans-septate ascospores. Mycotaxon 99: 303-326.

Chitale G, Makhija U, Sharma BO. 2009. New combinations and new species in the lichen genera

Hemithecium and Pallidogramme. Mycotaxon 108: 83-92. doi:10.5248/108.83

Culberson CF. 1972. Improved conditions and new data for the identification of lichen products by

a standardized thin-layer chromatographic method. Journal of Chromatography 72: 113-125.

doi: 10.1016/0021-9673(72)80013-X

Culberson CF, Kristinsson H. 1970. A standardized method for the identification of lichen products.

Journal of Chromatography 46: 85-93. doi:10.1016/S0021-9673(00)83967-9

Jagdeesh Ram TAM, Sinha GP, Singh KP. 2007. A new species of Graphis (Graphidaceae) from

India. Lichenologist 39: 231-233. doi:10.1017/S0024282907006482

Liicking R. 2009. The taxonomy of the genus Graphis sensu Staiger (Ascomycota: Ostropales:

Graphidaceae). Lichenologist 41: 319-362. doi:10.1017/S0024282909008524

Liicking R, Archer AW, Aptroot A. 2009. A world wide key to the genus Graphis (Ostropales:

Graphidaceae). Lichenologist 41: 363-452. doi:10.1017/S0024282909008305

Makhija U, Adawadkar B. 2005a. Some additions to the Graphidaceae in the Andaman Islands,

India. Mycotaxon 91: 347-352.

Makhija U, Adawadkar B. 2005b. Some new species of Graphis (Lichenized Ascomycota) from the

Andaman and Nicobar Islands of India. Mycotaxon 91: 369-379.

Makhija U, Dube A, Adawadkar B, Chitale G. 2005a. Some species of lichen genera Dyplolabia and

Graphis from Maharashtra. Geophytology 36(1-2): 61-68.

Makhija U, Dube A, Adawadkar B, Chitale G. 2005b. Five trans-septate species of Hemithecium

from India. Mycotaxon 93: 365-372.

Makhija U, Chitale G, Sharma BO. 2009. New species and new records of Diorygma (Graphidaceae)

from India: species with convergent exciples. Mycotaxon 109: 379-392. doi:10.5248/109.379

Patwardhan PG, Kulkarni CR. 1979. Some new taxa of the family Graphidaceae from western ghats,

southwestern India. Norwegian Journal of Botany 26: 45-52.

Sharma BO, Makhija U. 2009. New species and new reports of Diorygma (lichenized Ascomycotina,

Graphidaceae) from India. Mycotaxon 109: 209-217. doi:10.5248/109.209

Singh KP, Sinha GP, Bujarbarua P. 2004. Endemic lichens of India. Geophytology 33: 1-16.

480 ... Chitale, Makhija & Sharma

Staiger B. 2002. Die Flechtenfamilie Graphidaceae: Studien in Richtung einer natiirlicheren

Gliederung. Bibliotheca Lichenologica 85: 1-526.

White FJ, James PW. 1985. A new guide to microchemical techniques for the identification of lichen

substances. Bulletein British Lichen Society. 57(Suppl.): 1-41.

MYCOTAXON

Volume 115, pp. 481-484 January-March 2011

DOT: 10.5248/115.481

Septobasidium sichuanense sp. nov. (Septobasidiaceae) from China

SUZHEN CHEN” & LIN Guo”

‘Ocean University of China, Qingdao 266003, China

?Key Laboratory of Systematic Mycology and Lichenology Institute of Microbiology,

Chinese Academy of Sciences, Beijing 100101, China

* CORRESPONDENCE TO: Chensz2009@gmail.com e& *guol@im.ac.cn

ABsTRACT — A new species, Septobasidium sichuanense, is described. It was collected from

Sichuan Province, China.

Key worps — Pucciniomycetes, Septobasidiales, tawonomy

A species of Septobasidium, recently collected from Sichuan Province, is

described here as new:

Septobasidium sichuanense S.Z. Chen & L. Guo, sp. nov. Figs. 1-7

MycoBank MB 519472

Basidiomata resupinata, 0.4-6.5 cm longa, 0.3-4 cm lata, alba vel cinnamomeo-brunnea,

margine determinata, superficie laevia, in sectione 240-1300 um crassa. Subiculum

brunneum, 15-40 um crassum. Columnae brunneae, primum 30-60 um altae, deinde

120-290 um altae, 15-250 um latae. Strata hyphararum 40-620 um alta. Interdum

hyphae repullulantes, super hymenium stratum hypharum secundum 410-650 um altum

formantes. Hymenium 45-90 um crassum. Basidia cylindrica vel clavata, recta vel curvata,

2-cellularia, 17-27 x 6-7.5 um, hyalina vel brunneola. Sine probasidio. Basidiosporae non

visae. Haustoria ex cellulis globularibus et hyphis irregulariter spiralibus constantia.

Type: On Punica granatum L. (Punicaceae): China, Sichuan, Mianning, alt. 1873

m, 17.1X.2010, Y.R Zhu & L. Guo 368, HMAS 242046 (holotype), associated with

Lepidosaphes sp. (Diaspididae).

Basidiomata on trunks and branches, resupinate, 0.4-6.5 cm long, 0.3-4

cm wide, patches frequently confluent, white or cinnamon-brown; margin

determinate, surface smooth. In section 240-1300 um thick. Subiculum brown,

15-40 um thick. Pillars brown, 30-60 um high in the young stage and 120-290

um high in the older stage, 15-250 um wide. Hyphal layer 40-620 um high.

Hymenial layer 45-90 um thick, sometimes from hymenial layer the fungal

hyphae renew growth to form a second layer, 410-650 um high. Basidia arising

A482 ... Chen & Guo

poe =

10 um

Fic. 1. Basidia of Septobasidium sichuanense (HMAS 242046, holotype).

directly from the hyphae without a probasidial cell, cylindrical or clavate,

often constricted at the septum, straight or curved, 2-celled, 17-27 x 6-7.5

um, hyaline or brownish. Basidiospores not seen. Haustoria consisting of both

globose cells and irregularly coiled hyphae, hyaline.

ADDITIONAL SPECIMEN EXAMINED: On Cotoneaster franchetii Bois (Rosaceae): China,

Sichuan, Yanyuan, Mianya, alt. 3164 m, 13.IX.2010, YF Zhu & L. Guo 322, HMAS

250986.

Septobasidium sichuanense sp. nov. (China) ... 483

——

i 10 um ae

Fics. 2-7. Septobasidium sichuanense (HMAS 242046, holotype).

2. Basidiomata on trunk. 3-4. Sections of basidiomata. 5-6. Basidia (arrows). 7. Haustoria.

A84 ... Chen & Guo

Remarks: Morphologically, Septobasidium sichuanense is similar to

S. patouillardii Burt in having 2-celled basidium but differs in forming rather

regular patches of basidiomata with a smooth surface and not cracked in

the older parts, lacks a purplish tint, and has thick pillars. Septobasidium

patouillardii forms irregular patches with cracks in the older surfaces, is velvety

with a purplish tint, and has slender pillars, 20-54 tm wide and in section is

300-460 um thick.

To date, 29 species of Septobasidium have been reported in China (Sawada

1933, Couch 1938, Teng 1963, Tai 1979, Kirschner & Chen 2007, Lu & Guo

2009a,b,c, 2010a,b,c, Lu et al. 2010), including the new species reported in this

paper.

Acknowledgements

The authors would like to express their deep thanks to Drs Eric H.C. McKenzie

(Auckland, New Zealand) and Shuanghui He (Beijing Forestry University) for serving

as pre-submission reviewers, to Dr. Shaun Pennycook (Auckland, New Zealand) for

nomenclatural review, to Prof. Jianyun Zhuang (Institute of Microbiology, Chinese

Academy of Sciences) for Latin corrections, to Mr Ziyu Cao (Institute of Botany, Chinese

Academy of Sciences) for identifying the host plants, to Prof. Sanan Wu (Beijing Forestry

University) for identifying the scale insect, and to Mrs Xiangfei Zhu for inking in the

line drawing. This study was supported by the National Natural Science Foundation of

China (No. 30499340 and No. 30870016).

Literature cited

Couch JN. 1938. The Genus Septobasidium. Univ. of North Carolina Press, Chapel Hill. 480 p.

Kirschner R, Chen CJ. 2007. New reports of two hypophyllous Septobasidium species from Taiwan.

Fung. Sci. 22: 39-46.

Lu CX, Guo L. 2009a. Septobasidium maesae sp. nov. (Septobasidiaceae) from China. Mycotaxon

109: 103-106. doi:10.5248/109.103

Lu CX, Guo L. 2009b. Two new species of Septobasidium (Septobasidiaceae) from China. Mycotaxon

109: 477-482. doi:10.5248/109.477

Lu CX, Guo L. 2009c. Septobasidium annulatum sp. nov. (Septobasidiaceae) and Septobasidium

kameii new to China. Mycotaxon 110: 239-245. doi:10.5248/110.239

Lu CX, Guo L. 2010a. Three new species of Septobasidium (Septobasidiaceae) from Gaoligong

Mountains in China. Mycotaxon 112: 143-151. doi:10.5248/112.143

Lu CX, Guo L. 2010b. Two new species of Septobasidium (Septobasidiaceae) and S. pallidum new to

China. Mycotaxon 113: 87-93. doi: 10.5248/113.87

Lu CX, Guo L. 2010c. Two new species of Septobasidium (Septobasidiaceae) from Hainan province

in China. Mycotaxon 114: 217-223. doi: 10.5248/114.217

Lu CX, Guo L, Wei JG, Li JB. 2010. Two new species of Septobasidium (Septobasidiaceae) from

southern China. Mycotaxon 111: 269-274. doi:10.5248/111.269

Sawada K. 1933. Descriptive catalogue of the Formosan fungi. Part VI. Rep. Dept. Agric. Govt. Res.

Inst. Formosa 61: 1-99.

Tai FL. 1979. Sylloge Fungorum Sinicorum. Science Press, Beijing. 1527 p.

Teng SC. 1963. Fungi of China. Science Press, Beijing. 808 p.

MYCOTAXON

Volume 115, pp. 485-494 January-March 2011

DOT: 10.5248/115.485

Hypogymnia irregularis (Ascomycota: Parmeliaceae)—

a new species from Asia

Bruce McCungE

Department of Botany and Plant Pathology, Oregon State University,

Corvallis, OR 97331-2902 U.S.A.

CORRESPONDENCE TO: Bruce.McCune@science.oregonstate.edu

ABsTRACT — Hypogymnia irregularis is newly described from southwest China, Nepal, Japan,

and Taiwan. Similar in growth form to H. vittata, H. irregularis differs in always lacking soredia

and having staggered, lateral, or almost randomly located perforations in the lower surface. In

contrast, H. vittata usually produces soredia and has perforations more centered in the lower

surface and axils. Hypogymnia vittata is known from Asia, North America, Central America,

and Europe, while H. irregularis is endemic to Asia. Hypogymnia irregularis is postulated as

being the fertile species that is the closest living relative to the sorediate H. vittata. Another

Asian species, H. stricta, can be similar in appearance to H. irregularis and H. vittata, but can

be differentiated both morphologically and chemically from those two.

Key worps — Lecanorales, lichenized ascomycetes, lichenized fungi, Yunnan Province

Introduction

Since the last checklist of lichens in China (Wei 1991), numerous species

of Hypogymnia from Asia have been described or revised (Chen 1994, Elix &

Jenkins 1989, McCune et al. 2002, McCune & Obermayer 2001, Sinha & Elix

2003, Tchabanenko & McCune 2001, Wei & Bi 1998, Wei & Wei 2005, Wei

et al. 2010). But still this center of diversity for Hypogymnia, particularly in

southwestern China, holds additional undescribed species. This paper describes

a species that can be one of the dominant lichens in the high-mountain Abies

forests of southwest China and also occurs in Nepal, Taiwan, and Japan. The

species has not previously been described because of its similarity to esorediate

H. vittata and the recently resurrected H. stricta (Hillmann) K. Yoshida (Yoshida

& Kashiwadani 2001). The new species was, however, keyed in McCune (2009)

as “H. sp. undescribed, close to H. vittata”

Methods

Standard microscopy and chemical spot test methods were applied to over 600

specimens of H. vittata and closely related species, from throughout its range, including

A86 ... McCune

417 specimens of H. vittata s. str. and 149 specimens of the new species described here.

A total of 86 specimens belonging to the new species, 20 of H. stricta, and 92 of H. vittata

s. str. were subjected to thin-layer chromatography (TLC), using standard methods of

Culberson et al. (1981). Fragments of specimens were extracted in acetone at room

temperature, spotted on aluminum-backed silica gel plates (Merck 5554/7 Silica gel 60

F,,,), run in solvent systems A and C of Culberson et al. (1981), lightly brushed with 10%

H,so,, and charred in an oven at 100°C.

Taxonomy

Hypogymnia irregularis McCune, sp. nov. FIGURES 1, 2A-D

MycoBank MB 519394

Ab Hypogymnia vittata differt sorediis absentibus, ascosporis 5-6 x 4-5 um; foraminibus

infernis irregularibus.

TYPE: China: Yunnan Province, Jiaoxi Mountain, north of Kunming, 26.100°N 102.867°E,

3700 m, Abies georgei var. smithii-Rhododendron forest on slopes near hotel, on bark of

Abies, Sept. 2000, McCune 25576 (holotype: KUN; isotypes: H, HMAS-L, OSC, UPS, US)

ETYMOLOGY: irregularis, referring to the irregular arrangement of perforations through

the lower surface.

THALLUS appressed to pendulous, to 10(-30) cm long, branching variable,

including both isotomic and anisotomic portions, lateral budding often present;

texture cartilaginous rather than papery; upper surface white to pale greenish

gray, sometimes with dark mottles, sometimes with black borders, smooth to

weakly rugose, epruinose; lobes 0.5-3(-4) mm wide separate to imbricate,

often arcuate-recurved, width even to slightly expanding distally and near the

nodes, sometimes + pinched at the nodes; lobe width:height ratio 0.5:1 to 2:1;

perforations present on many lobe tips, axils, and lower surfaces, the holes not

rimmed; medulla hollow, both the ceiling and floor of the cavity soon darkening

to brown or dark brown; soredia and isidia lacking; lateral budding or lobules

occasional.

APOTHECIA common, substipitate to stipitate, to 9 mm broad, the receptacle

urn or funnel shaped; stipe hollow; disk brown; spores small, subglobose, 5-6 x

4-5 um; pycnidia common, brown to black; spermatia weakly bifusiform, 5-6

x 0.5-0.7 um; photobiont chlorococcoid.

CHEMISTRY — By TLC the thallus contains atranorin and physodic acid,

usually with 3-hydroxyphysodic and/or vittatolic acids (all four substances

present in the holotype); cortex K+ yellow; medulla K- or K+ slow reddish

brown, KC+ orange-red, P-. Of 86 specimens with TLC results, all had

both atranorin and physodic acid, 70% had 3-hydroxyphysodic acid, and

91% had vittatolic acid. No attempt was made to distinguish atranorin from

chloroatranorin.

SUBSTRATE — On bark and wood of both conifers (especially Abies, Picea,

Sabina, Pinus, and Tsuga, in order of decreasing frequency) and hardwoods

Hypogymnia irregularis sp. nov. (Asia) ... 487

BE Bs

Fic. 1. Hypogymnia irregularis habit and perforations. Arrows indicate examples of dorsal (D),

lateral (L), and ventral (V) perforations (McCune 25576, holotype). Dorsal perforations are

infrequent, lateral perforations occasional, and ventral perforations common. Scale bar 1 mm.

(especially Rhododendron, Quercus, Sorbus, and dwarf bamboo).

DisTRIBUTION — Very common and often locally abundant in southwest

China, especially Yunnan and Sichuan Provinces; infrequent disjuncts in India,

A88 ... McCune

Nepal, and Taiwan. In southwest China, where the species is most abundant, it

occurs primarily between 3000 and 4400 m in elevation, in Abies-Rhododendron

forests above the zone of hardwood dominance.

BRIEF CHARACTERIZATION — Lobes free, short or long, often arcuate-tipped;

long, slender, adventitious lobes often abundant; lobes 0.5-4 mm broad and

internodes often 1-2 cm long; lobes somewhat pinched and swollen or smooth

in profile; ceiling of cavity grayish brown to black; floor brownish black; similar

to H. vittata but no soredia and perforations on lower surface irregularly

arranged or staggered and partly lateral.

SELECTED SPECIMENS EXAMINED — CHINA. SICHUAN PROVINCE: Er Mei Mt., 29.5°N

103.33°E, 2100 m, Tao De Din 1415 (kun); from Ping Wu Co to Jui Zhai Guo, 29.53°N

104°E, 3100 m, Wang Li-song 86-25 1 la (KUN); XINXING Co.: Gongga Mt, Yen Zi Village,

29.67°N 102°E, 3350 m, Xuan Yu 1378 (kuN); KanGpING Co. (as Sikang: Kangting

(Tachienlu), montes orientalis), Harry Smith, s.n. (UPS); LupInG Co.: Gongga Mt, Yen

Zi Village, 29.67°N 102°E, 3250 m, Xuan Yu 1377 (kun); Gongga Mt., Hai Luo Gou,

29.833°N 102.33°E, 2450-3000 m, Wang Li-song 96-16111, 96-17030, 96-16295b, 96-

16213 (kuN); Gongga Mt, 29.42°N 101.83°E, 3000 m, Wang Li-song 96-17242 (KUN);

Mr Yi Co., Ma Long Village, Bei Puo Mt., 26.83°N 102°E, 3100-3600 m, Wang Li-song

83-775 , 83-798, 83-829 (KUN); MuLi Co., E slopes of Ning Lang Mt., 27.83333°N

101.1667°E, 3900 m, Yuan Yu 1845 (kun); Ning-lang village, 27.23°N 100.87°E, 3900

m, Xuan Yu 4268b (kun); from Yi Qu to Wo Ya, 27.83°N 101°E, 2700-3500 m, Wang

Li-song 83-2364, 83-2365 (KUN); W slope of Ning Lang Mt., 27.83°N 101.17°E, 4000 m,

Xuan Yu 1798 (kun); Ya Zhuei forest sta., Jiang Du, 27.83°N 101.33°E, 3450 m, Wang

Li-song 83-1580 (KUN); Yi Qu, 27.83°N 101°E, 3200-3700 m, Wang Li-song 83-2341, 83-

2400 (xuN); NANPING Co., Jiu Zhai Gou, 33°N 103.83°E, 2050-3200 m, Wang Li-song

86-2725,86-2627, 86-2660 (KUN); WENCHUAN Co.: Wo Long Nature Preserve, 30.9°N

103.1°E, 3200 m, Wang Li-song 96-17683 (KUN); YANYUAN Co., Beiling Village, Si Da

Unit, 27.5°N 101.5°E, 3500-3800 m, Wang Li-song 83-1435, 83-1464 (kuN); Daling

Village, Huo Lu Mt., 27.5°N 101.5°E, 3500-4150 m, Wang Li-song 83-1149, 83-1175a,

83-1196, 83-1211, 83-1258, 83-1398 (KUN); XIZANG (TIBET): CHayu Co.: Cawarong,

Song Ta Xue Mt, 28.67°N 97.83°E, 3500 m, Wang Li-song 82-801, 82-805 (kuN); Gyala

Peri N, W above Gyala Peri-N Glacier, 29.9°N 94.87°E, 3820 m, Miehe, G. & S. 94-

215-42/10 (Gzu). YUNNAN PROVINCE: CAOJIAN Co., Zi ben Mt, 25.737°N 99.058°E,

Wang Li-song 00-18901, 00- 18910, 00-18913 (KUN); DALI Co.: Xiao Lin Feng, 25.717°N

100.13°E, Wang H.-c. 4825b (kun); Long-quan-feng Mt., 25.2°N 100.95°E, Wang Han-

che 4364 (kun); top of Long Quan Feng Mt., 25.717°N 100.133°E, Wang H.-C. 1067, 4360

(kun); Yu Jiu Feng, 25.63°N 100.1°E, 3000 m, Sauer 30.154b (kun); trail to Mt. Cang,

25.685°N 100.102°E, 3500 m, McCune 26772, 26775, 26779, 26780, 26787, 26803, 26806,

26795, 26797 (osc); DEQIN Co.: Bei Ma Xue Shan, Ya Kou, 28.383°N 99°E, 4300 m,

Wang Li-song 93-13489 (kuN); Meilishi village, Suola Ya-Kou, 28.63667°N 98.61333°E,

4000-4750 m, Wang Li-song 00-19742, 00-19766 (KUN); Mei Li Xue Mt, Xio-Nang

Village, 28.4°N 98.75°E, 3400 m, Wang Li-song 94-1504] (kuN); FU Gone Co.: Lu Ma

Den Village, Qu Lu Di unit, 27.033°N 98.883°E, 3500 m, Wang Li-song 82-448 (KUN);

Gone SHAN Co., Binzhong Luo to Tong Da Ya Kou, 93.683°N 28.092°E, 3800 m, Wang

Li-song 99-185 10 (KUN); Qinatong, Songtaxue Mt., 28.1883°N 98.5317°E, 3200 m, Wang

Li-song 00-196 13, 00-19615, 00-19619, 00-19628 (KUN); Yen Niu Gu, 27.801°N 98.825°E,

2950 m, Wang Li-song 00-19364, 00-19377 (kuN); Binzhong Luo village, 27.96667°N

Hypogymnia irregularis sp. nov. (Asia) ... 489

McCune 25537

eat. 00008

60000

Wang 96-16213

Follman 509

Fic. 2. Hypogymnia irregularis. A. Apothecia (McCune 25576; scale bar 1 mm.); B. Young

apothecia (McCune 25576); C. Ascospores (Wang 96- 16213; McCune 25576). D, E. Comparison

of position of perforations in the lower surface of Hypogymnia irregularis (D) and H. vittata (E).

Collection numbers are indicated below photos.

490 ... McCune

98.51667°E, 3600 m, Wang Li-song 82-741 (KUN); JIANCHUAN Co.: ridge on trail to

Laojun Shan, 26.6317°N 99.7183°E, 3980 m, McCune 26728, 26729 (osc); San Jiang

Bin Liu area, 26.6625°N 99.7217°E, 3110 m, McCune 26703 (osc); trailhead to Laojun

Shan, 26.6322°N 99.7253°E, 3700-3800 m, McCune 26707, 26715 (osc), Wetmore 88456

(min); LytanG Co.: Jiushijiulongtiam Lake, Maan Mt., 26.6517°N 99.775°E, 3500 m,

Wang Li-song 00-20085, 00-20094, 00-20101, 00-20223 (KUN); Jiutte Villate, Laojun Mt.,

26.65°N 99.77°E, 4000 m, Wang Li-song 99-18732 (kuN); Laojun Mt., Jiushijiulong Lake,

26.6317°N 99.7283°E, 3800-4100 m, Wang Li-song 00-19820, 00-20252, 00-20257, 00-

20278, 00-20288, 00-20289, 00-20319, 00-20324 (kuN); Li-di-ping, 26.85°N 100.267°E,

3200 m, Xi Jian-xun 0165, 0169a (KUN); Yu Long Xue Mt., 27.083°N 100.167°E, Li Xin-

jiang 1494 (kun); Lijiang area (“Likiang”), |, E Rock 115b (US); eastern slopes Likiang

Snow Range, Rock,.F. 11779 (US); Luquan Co., Jiaoxi Mt., 26.083°N 102.133°E, 3700-—

4300 m, Wang Li-song 92-12856, 92-12857, 92-12869, 92-12879, 92-12949, 92-12950,

96-16725, 96-17060, 96-17066 Fan Rei Zhen 3220 (KuN); Jiaoxi Mt., N of Kunming,

26.100°N 102.867°E, 3500-3750 m, McCune 25517, 25518, 25528, 25537a, 25537),

25588, 25600, 25606, 25631, 25653 (osc); WEI X1 Co.: Li-di-ping Village, 27.167°N

99.417°E, 3200 m, Wang Li-song 82-7 (kuN); Ye Zhi Village, Ba-ding, 27.8°N 99.03°E,

3500 m, Wang Li-song 82-264a, Zhang D.-C. 82-83 (KUN); YUNLONG Co.: Zi Ben Shan,

top of ridge, 25.733°N 99.067°E, 3200 m, McCune, 26822 (osc); Xiao Zhongdian, Ji

Sha, 27.417°N 99.733°E, Den Kun-Mei 81-1679 (KUN); Daxue Mt., 28.503°N 99.817°E,

3800 m, Wang Li-song 00-19824 (KUN); Daxue Mt., Ya Kou, 28.667°N 99.834°E, 4270

m, Wang Li-song 93-2751 (KUN); Daxue Mt., 28.567°N 99.817°E, 4400 m, Wang Li-song

01-20740, 01-20796, 01-20800 (KUN); Daxue Mt., 28.579°N 99.821°E, 3350 m, Watson,

M. F. 18 (z); Na Pa, Hai Hou Mt., 27.833°N 99.717°E, 3860 m, Wang Li-song 93-13742

(kun); Tianchi (alpine lake), 27.833°N 99.717°E, 3700 m, Wang Li-song 94-14929 (kun);

Tianchi Lake, 27.617°N 99.633°E, 3900 m, Wang Li-song 01-20888 (KUN); Wengshuei

Village, Daxue Mt., 28.575°N 99.83417°E, 4000 m, Wang Li-song 00-20026, 00-20032

(kun); Xiozhongdian, Tianchi, 27.833°N 99.717°E, Wang Li-song 93- 13683d, f, g (KUN).

JAPAN. Honsuuv: Prov. Shinano, betw. Shibunoyu Hot Spring & Kuroyuridaira, 2400

m, Kashiwadani, Lich. Rar. Crit. Exs. 478 (BM, S, US, WIS); Prov. Kai, lower slopes

on N side of Mt Fuji, near Okuniwa, between 4-gome and 5-gome, 2250 m, McCune

26062, 26069 (OSC). NEPAL. Rolwaling Himal: Mt. Numbur, 3400 m, Yoda 130 (TNs);

S of Kyangen Gompa, Birch wood, 28.2037°N 85.558°E, 3852 m, Sharma et al. L10 (&).

TAIWAN: TaicHunc Co., Between Ssu-yuan & To-chia-tun Mt., Nanhuta Mt., 2700 m,

Kashiwadani 36156 (TNs); Nanhuta Mt., 3000 m, Tateishi s.n., 12 Sep 1984 (TNs); Nantou

Co., Mt. Yu Shan, Tartaka Saddle to Paiyun Hostel, 3000 m, Lai 10325 (US); Toroko NP,

Hehuan Mt, 3200 m, Mikulin T5 (OSC), 2756 m, Mikulin T72 (OSC).

Hypogymnia vittata (Ach.) Parrique FIGURE 2E

SPECIMENS ILLUSTRATED OR MENTIONED — AUSTRIA. Karnten: Gurktaler Alpen,

Severgraben, E von Gnesau, ca. 800 m, 46°48’N 14°4’W, on Alnus incana, 27 Oct 1998,

Zeiner 151 (Gzu, fertile); E Tyrol, southern foothills of Hochvenediger Mts., Follman,

Lich. exs. sel. 509 (osc). CHINA. YUNNAN PROVINCE: Jiaoxi Mt., north of Kunming,

26.100°N 102.867°E, 3700 m, McCune 25623 (osc); Jianchuan Co., San Jiang Bin Liu

area, road to Lao Juen Shan, 3110 m, McCune 26705 (osc). FINLAND. Uusimaa: Espoo,

Nuuksio (Nouks), Hankalahti (Hanklaks), Ahvenlampi, rock face (kallioseinalla), 21

Oct 1934 K. Linkola (u, fertile). Pohjois-Savo (Savonia borealis): Kuopio, Enonlahti,

Enonmaki, rock face (kallion kyless4), 14 Jul 1909 K. Linkola (u, fertile). MEXICO.

Estado de Oaxaca: mountain tops ca. 6 km NW of Ixtlan de Juarez, 2865 m, Esslinger

18225C (NDA).

Hypogymnia irregularis sp. nov. (Asia) ... 491

Discussion

Hypogymnia irregularis often shows an extreme range in lobe width and

length, all in the same thallus (Fig. 1), but it is generally more robust than

H. vittata, with lobes commonly >2 mm wide and internodes >9 mm long.

The arrangement of the perforations in H. irregularis can vary even within a

single specimen from a staggered arrangement of semi-lateral holes to a linear

arrangement of holes centered on the lobes, or even lateral or dorsal holes (Figs

1, 2D).

Both Hypogymnia irregularis and H. stricta (Yoshida & Kashiwadani 2001,

lectotype: TNS!) appear similar to esorediate individuals of the normally

sorediate H. vittata (type: BM! as Parmelia physodes var. vittata Ach.).

Differences among these species are discussed below.

Hypogymnia stricta is currently known from China, Japan, and Taiwan.

In H. stricta the ceiling of the lobe cavity is light brown to white (rarely dark

brown), the upper cortex has faint to prominent transverse cracks, and the

thallus contains 2’-O-methylphysodic acid (see below). In contrast, both

H. irregularis and H. vittata have consistently dark ceilings, except for a whitish

ceiling very near the lobe tips. The perforations of H. stricta are similar to

H. vittata, being rather large and + centered along the midline of the lower

surface of the lobes, both of those differing from the irregularly placed holes in

H. irregularis (Fig. 2D).

The ascospores of H. stricta average 5.5-7.0 x 4.5-5.0 um, slightly longer

than those of H. irregularis which are mostly 5.0-6.0 x 4.0-5.0 tum. The spore

sizes of H. irregularis broadly overlap with H. vittata. Fertile specimens of H.

vittata are rare. Two specimens from Finland had ascospores (4.8-)5.0-6.0

(-6.5) x 4.8-5.2(-5.4) um, similar to Bitter (1901): 4.5-5.8 x 4.5-5.0 um. A

fertile specimen from Austria was barren of ascospores.

Separation of esorediate H. vittata from H. irregularis must rely on the

pattern of the perforations in the lower surface and the presence and abundance

of pycnidia. Although H. vittata typically has large, sparse perforations that are

nearly centered in the lower surface or axils (Fig. 2E), H. irregularis has more

frequent and smaller perforations that are often lateral, irregular in placement

or sometimes staggered from side-to-side (Figs 1, 2D). This character is not,

however, perfect. Even on a single individual of H. irregularis, one can observe

some lobes with centered perforations and others with staggered perforations.

And some specimens of H. irregularis have mainly centered perforations.

Conversely, H. vittata sometimes forms perforations that deviate somewhat

from the midline.

Almost always H. vittata has no pycnidia or only a few, widely scattered

pycnidia, while H. irregularis usually has dense swarms of pycnidia on many

lobes.

492 ... McCune

Because H. irregularis is restricted to Asia, it is not necessary to separate

H. vittata from H. irregularis in most of the World. Hypogymnia vittata is

known from Europe, North America, Central America (Mexico), and Asia

south to New Guinea.

Some specimens from Japan are problematic. There it is common to find

specimens close to H. vittata but without soredia and without the irregular

perforations of H. irregularis. Perforations in the lower surface tend to be large

and centrally aligned. In contrast to usual H. vittata, the esorediate Japanese

material often has dense swarms of pycnidia, suggesting a closer affinity with

H. irregularis. The ultimate disposition of this material requires further study;

for now, it is placed in H. irregularis.

Hypogymnia — stricta typically contains atranorin, physodic, 3-

hydroxyphysodic, and 2’-O-methylphysodic acids (20 specimens with TLC

data). Thus it has a medulla K+ slow reddish brown, KC+ orange red, and

P_. Hypogymnia irregularis can have the same spot tests, or it can be K- when

lacking 3-hydroxyphysodic acid. However, 2’-O-methylphysodic acids was not

found in H. irregularis by TLC, while this substance appears to be constant in

H. stricta.

Hypogymnia vittata is essentially the same as H. irregularis in frequency of

substances by TLC. Of 92 specimens of H. vittata with TLC data (worldwide),

all had both atranorin and physodic acid, 85% had 3-hydroxyphysodic acid (vs.

70% in H. irregularis) and 84% had vittatolic acid (vs. 91% in H. irregularis).

Both species often show an unknown spot just under vittatolic acid in solvent C,

and both commonly have long-wave UV+ unknowns in Culberson’s Rf classes

A5 and C6. Both species show pronounced quantitative variation in vittatolic

acid, ranging from a trace (or not detected) to an obvious major substance.

The Hypogymnia vittata complex (TABLE 1) should prove a fascinating

subject for molecular systematics. All species in this group have large ventral

perforations that lack a raised differentiated rim, predominantly dark lobe

interiors, narrow perpendicular adventitious branches, and a P- medulla

(lacking physodalic and protocetraric acids). The common H. physodes,

while similar to H. vittata in the soralia lining splayed open lobe tips, differs

in the absence of perforations (other than those associated with soredia), the

absence of narrow adventitious branches, and the P+ orange-red medulla from

physodalic acid.

All species in the H. vittata group are Asian, except for H. vittata, which

has spread to other continents. Like other species pairs in Hypogymnia

(H. lophyrea (Ach.) Krog and H. hultenii (Degel.) Krog; H. krogiae Ohlsson and

H. incurvoides Rass.; Miadlikowska et al. 2011), this can be considered another

case of the fertile species having a narrower distribution than the sorediate

counterpart.

Hypogymnia irregularis sp. nov. (Asia) ... 493

TABLE 1. Summary of characters of Hypogymnia vittata and related species.

Hypogymnia ASEXUAL APOTHECIA CEILING OF VITTATOLIC = -2’-O-METHYL-

species REPRODUCTION LOBE CAVITY ACID PHYSODIC

ACID

irregularis none common dark usually no

pectinatula none not seen dark no? no?

pseudobitteriana laminal soredia, rare dark seldom no

schizidia

stricta none common pale no usually

vittata labriform soredia _ rare dark usually no

zeylanica isidia bursting rare dark no no

into soredia

All have narrow perpendicular adventitious branches, are P- (lacking physodalic and protocetraric acids),

have non-rimmed perforations in the lower surface. Only a small number of H. pectinatula have been

tested by TLC, so chemical substances are uncertain.

In addition to the species discussed above, other apparently close relatives of

H. vittata have a diversity of reproductive modes (Table 1): H. pseudobitteriana

(D.D. Awasthi) D.D. Awasthi (widespread in eastern and southern Asia) has

laminal schizidia and soredia, H. zeylanica (R. Sant.) D.D. Awasthi & Kr.P.

Singh (Sri Lanka) has isidia and pustular soredia; and H. pectinatula (Zahlbr.)

Elix (Papua New Guinea, Java, Philippines, and North Borneo) has a frondose

growth form with abundant lateral budding but no other asexual propagules.

All of these share with H. vittata a perforate lower surface, dark ceilings

and floors of the lobe cavity, absence of 2’-O-methylphysodic, physodalic,

and protocetraric acids (medulla P-), and a tendency to produce slender

perpendicular adventitious branches. From this group I exclude those species

with a raised, differentiated rim around the perforations (McCune et al. 2002),

such as the superficially similar H. diffractaica McCune. Last, H. subduplicata

(Rass.) Rass., a sorediate species described from Far East Russia, is very

similar to H. vittata. The chemistry of the type needs to be determined and the

morphology compared with H. vittata.

Acknowledgments

We thank curators of Asu, BM, CANL, COLO, DUKE, E, GZU, H, HMAS-L, KUN, MIN, MSC,

NY, OSC, PC, S, TNS, UBC, UPS, US, and wis who kindly cooperated with loans and visits; and

to Ted Esslinger and André Aptroot for sharing personal collections. I greatly appreciate

Wang Li Song sharing his voluminous collections and cheerful hospitality during two

extended visits, Hiroyuki Kashiwadani, Kozo Yoshida, and Svetlana Tchabanenko for

sharing their collections and knowledge of Hypogymnia, and Olivia Lee for translating

label data and assisting with data entry. Elisa Alphandary, Lalita Calabria, Erin Martin,

and Christina Wesseler assisted with TLC. Thanks to Walter Obermayer and Arve

Elvebakk for reviewing the manuscript and to Teuvo Ahti for helpful suggestions.

A494 ... McCune

Literature cited

Bitter G. 1901. Zur Morphologie und Systematik von Parmelia, Untergattung Hypogymnia.

Hedwigia 40: 171-274.

Chen JB. 1994. Two new species of Hypogymnia (Nyl.)Nyl. (Hypogymniaceae, Ascomycotina). Acta

Mycologica Sinica 13: 107-110.

Culberson CK, Culberson WL, Johnson A. 1981. A standardized TLC analysis of B-orcinol

depsidones. Bryologist 84: 16-29. doi:10.2307/3242974

Elix JA, Jenkins GA. 1989. New species and new records of Hypogymnia (lichenized Ascomycotina).

Mycotaxon 35: 469-476.

McCune B. 2009. Hypogymnia (Parmeliaceae) species new to Japan and Taiwan. Bryologist 112:

823-826. doi:10.1639/0007-2745-112.4.823

McCune B, Obermayer W. 2001. Typification of Hypogymnia hypotrypa and H. sinica. Mycotaxon

79: 23-27.

McCune B, Martin E, Wang LS. 2002. Five new species of Hypogymnia with rimmed holes, from

the Chinese Himalayas. Bryologist 106: 226-234. doi:10.1639/0007-2745(2003) 106[0226:

FNSOHW]2.0.CO;2

Miadlikowska J, Schoch C, Kageyama S, Molnar K, Lutzoni F McCune B. 2011. Hypogymnia

phylogeny, including Cavernularia, reveals biogeographic structure with broader distribution

for asexually reproducing (sorediate) species. Bryologist (in press).

Sinha GP, Elix JA. 2003. A new species of Hypogymnia and a new record in the lichen family

Parmeliaceae (Ascomycota) from Sikkim, India. Mycotaxon 87: 81-84.

Tchabanenko S$, McCune B. 2001. Hypogymnia arcuata and H. sachalinensis, two new

lichens from east Asia. Bryologist 104: 146-150. doi:10.1639/0007-2745(2001) 104[0146:

HAAHST]2.0.CO;2

Wei JC. 1991. An enumeration of lichens in China. International Academic Publishers, Beijing.

Wei JC, Bi WE. 1998. Chemical revision of Hypogymnia hengduanensis. Bryologist 101: 556-557.

Wei XL, Wei JC. 2005. Two new species of Hypogymnia (Lecanorales, Ascomycota) with pruinose

lobe tips from China. Mycotaxon 94: 155-158.

Wei XL, McCune B, Wang LS, Wei JC. 2010. Hypogymnia magnifica (Parmeliaceae), a new lichen

from southwest China. Bryologist 113: 120-123. doi:10.1639/0007-2745-113.1.120

Yoshida K, Kashiwadani H. 2001. Typification of taxa of Hypogymnia (Parmeliaceae) described

from Japan and Sakhalin. Bulletin of the National Science Museum, Tokyo, Series B 27(2,3):

35-46.

MYCOTAXON

Volume 115, pp. 495-500 January-March 2011

DOT: 10.5248/115.495

Marasmius galbinus, a new species from China

Cuun- YING DENG*? & Tar-Hur Lr

‘School of Bioscience and Biotechnology, South China University of Technology,

Guangzhou, 510641, China

’Guangdong Provincial Key Laboratory of Microbial Culture Collection and Application,

Guangdong Institute of Microbiology, Guangzhou 510070, China

CORRESPONDENCE TO: mycolab@263.net

Asstract — Marasmius galbinus of section Globulares is described and illustrated as a new

species. The type is preserved in the Herbarium of Microbiology Institute of Guangdong

Province (GDGM).

Key worps —diversity, Marasmiaceae, taxonomy

Introduction

Members of Marasmius sect. Globulares possess a hymeniform pileipellis of

smooth (Globulares-type) cells (Wilson & Desjardin 2005). There are about 100

species and varieties in this section worldwide (Singer 1976, 1986; Tan et al.

2009; Wannathes et al. 2009; Antonin et al. 2010).

Until now, no monograph of Marasmius has been published from China,

and only 17 members of section Globulares have been reported from China

(Dai 1979; Bi et al. 1985, 1987, 1994; Li et al. 1994; Zhang 1995; Mao 1998;

Deng & Li 2008). During a survey on the Chebaling Biosphere Reserve in

Shixing County of Guangdong Province, a species was collected, belonging to

section Globulares with a unique combination of features and herein proposed

as a new species.

Materials & methods

Specimens were annotated and photographed in the field, dried in an electric drier,

and then preserved in herbarium. Color terms and notations follow those of Kornerup &

Wanscher (1978). Fungal tissues were mounted in 5% KOH for microscopic examination.

The terms used to describe lamellae spacing refer to the number of lamellae reaching

from the stipe to the pileus margin and do not include the lamellulae, whose spacing

is indicated by the number of series present. Spore statistics include: x, , the arithmetic

496 ... Deng & Li

mean of the spore length by spore width (+ standard deviation) for n spores measured

in a single specimen; Q, the quotient of spore length by spore width in any one spore,

indicated as a range of variation in n spores measured; Q_, the mean of Q-values in

a single specimen; n, the number of spores measured per specimen; s, the number of

specimens involved. Specimens are deposited in Herbarium of Guangdong Institute of

Microbiology (GDGM). Authors of fungal names are cited according to the International

Plant Names Index Authors website (http://www. ipni.org/ipni/authorsearchpage.do).

Genomic DNA was isolated from dried specimens and the ITS1-5.8S-ITS2 segment

from the ribosomal DNA (rDNA) was amplified with primer sets ITS1 (5’-Trcc GTA GGT

GAA CCT GCG G -3’) and ITS4 (5’-Tcc TCC GCT TAT TGA TAT GC -3’) by polymerase chain

reaction (PCR) techniques (White et al. 1990). Amplified products were examined with

agarose gel electrophoresis using a 2kb DNA marker. The amplified PCR products were

directly sequenced and deposited in GenBank.

Taxonomy

Marasmius galbinus T.H. Li & Chun Y. Deng, sp. nov. Fic. 1-2

MycoBank MB 519192

Pileus 8-15 mm latus, campanulatus, late conicus, striatus, hygrophanus, albido-luteolus.

Lamellae adnexae vel subliberae, distantibus. Stipes 15-30 x 0.5-1 mm, aequalis vel

subbulbosus ad basim, non-insititius, apicem albidus vel luteolus, ad basim albo-

strigosus. Basidiosporae 14-16 x 4-5 um, anguste clavatae vel sublacrymoideae, hyalinae,

inamyloideis. Cheilocystidia 29-33 x 6-9 um, clavata vel vesiculosa. Pleurocystidia

nulla. Pileipellis hymeniformis (typi Globularis) ex cellulis clavato-vesiculosis, hyalinis,

membrana tenuitunicata instructa. Trama pilei et lamellarum dextrinoidea. Caulocystidia

10-50 x 4-10 um, cylindraceis, clavatis vel subfusiformibus. Trama pilei et lamellarum

dextrinoidea.

Type: CHINA, GUANGDONG, Chebaling National Nature Reserve. 26 May 2010, Li YJ.,

Huang H. & Deng C.Y. (Holotype, GDGM 27251).

EryMo.ocy: galbinus = greenish yellow; referring to the basidiome color.

PiLeus 8-15 mm wide, obtusely conical when young, convex to campanulate in

age, rugulose at the disc, sulcate to plicate at margin, glabrous, hygrophanous,

disc and striae white to greenish white (3A2), elsewhere yellowish white (2A2,

2B3). ConTEXT yellowish white, thin. LAMELLAE subfree to adnexed, distant

(14-16) with 0-3 series of lamellulae, broad (1-2 mm), yellowish white, non-

marginate, not intervenose. STIPE 15-30 x 0.5-1 mm, central, cylindrical with

or without a sub-bulbous base, hollow, glabrous, non-insititious, apex hyaline

to white, base pale yellow (4A3) to light yellow (4A4, 4A5). Odor and taste not

distinctive.

Basipiospores 14-16 x 4-5 um [x, = 15.68 + 0.7 x 4.6 + 0.5 um, Q =

3.2-3.4, Q. = 3.38 + 0.1, n = 25 spores, s = 1 specimen], clavate to fusoid,

often curved in profile, smooth, hyaline, inamyloid, thin-walled. Basip1a

30-35 x 6-8 um, clavate, 2- or 4-spored. BAsIDIOLEs clavate to cylindrical.

Marasmius galbinus sp. nov. (China) ... 497

Cc e

Fics 1-2: Marasmius galbinus (holotype, GDGM 27251).

1. Basidiomes; 2. a. Basidiospores, b. Pileipellis, c. Cheilocystidia, d. Basidia, e. Caulocystidia.

Bars: 1 = 1 cm; 2 = 10 um.

498 ... Deng & Li

CHEILOCYSTIDIA abundant, lamellar-edge sterile, 29-33 x 6-9 um, irregularly

clavate to ventricose, hyaline, inamyloid, thin-walled. PLEUROCYSTIDIA absent.

PILEIPELLIs a hymeniform layer of Globulares-type cells, 12-21 x 9-12 um,

broadly clavate to pyriform, hyaline, inamyloid, thin to thick-walled, non-

gelatinous. LAMELLAR TRAMA regular; hyphae 2.5-10 um diam., cylindrical,

hyaline, dextrinoid, thin-walled, non-gelatinous. STIPITIPELLIs hyphae 4-10

um diam., parallel, cylindrical, smooth, dextrinoid, thin- to thick-walled,

non-gelatinous. STIPE TRAMA hyphae 3-6 um diam., parallel, cylindrical,

hyaline, smooth, dextrinoid to weakly dextrinoid, thin-walled, non-gelatinous.

CAULOCYSTIDIA 10-50 x 4-10 um, versiform, ranging from irregular cylindrical

to fusoid, clavate or irregular in outline, hyaline, inamyloid, thin- to thick-

walled. Clamp connections present in all tissues.

ECOLOGY AND DISTRIBUTION—Scattered on dicotyledonous leaves or debris in

broad-leaved forest in May; China (Guangdong).

CoMMENTS— The main features of Marasmius galbinus include: ahygrophanous,

striate pileus with (greenish) white disc and striae; distant to subdistant yellowish

white lamellae; large basidiospores with means 15.6 x 4.0 um; the presence of

cheilocystidia and caulocystidia; and the absence of pleurocystidia.

Marasmius galbinus is similar in color to three other yellowish green species,

Asian M. grandiviridis Wannathes et al, American M. rhyssophyllus Mont. ex

Berk. & M.A. Curtis, and African M. staudtii Henn. Marasmius grandiviridis

differs in forming a larger (37-88 mm diam.), plicate pileus and larger

basidiospores (26-30 x 4-5 um) (Wannathes et al. 2009b); M. rhyssophyllus

differs in forming narrow, closely interveined lamellae and smaller basidiospores

(5-6.5 x 3.5-4.5 um) (Pegler 1983); and M. staudtii differs in forming a sulcate

pileus and longer basidiospores (23-26 tum) (Singer 1964).

Macroscopically, the new species resembles the African species M. albido-

cremeus Antonin and South Pacific species M. musisporus Desjardin & E.

Horak. Marasmius albidocremeus is distinct by a whitish or pale cream pileus,

a long and slender stipe (50-90 x 0.5-1.25 mm), larger basidiospores (16.5-23

x 3.5-5.0 um) and well-developed pleurocystidia (Antonin 2003), while M.

musisporus differs by very large basidiospores (30-40 um long) and the absence

of caulocystidia (Desjardin & Horak 1997)

The rDNA-ITS (ITS1-5.8S-ITS2 segment) sequence with 657 bps of the

new species (HQ709445) differs from all other known Marasmius sequences.

Through a Blast search against the GenBank DNA database, only 160 bps

of 5.88 of the sequence can be compared with 998 max scores and 95%

maximal percent identities to those of M. laticlavatus (EU643511, EU643512),

and with 929 max scores and 92% maximal percent identities to those of

M. purpureostriatus (EU935539). The remaining parts (ITS1 and ITS2,

Marasmius galbinus sp. nov. (China) ... 499

occupying about 75.6% of the whole segment) of the sequence are so different

that they are not comparable with the known sequences. Therefore, M. galbinus

is considered distinct.

Acknowledgments

The authors thank Dr. Vladimir Antonin of Brno, Czech Republic and Dennis E.

Desjardin of San Francisco State University, San Francisco, USA for reviewing the

manuscript. This study was supported by the National Natural Science Foundation of

China (No. 30770004, 30870019, 30970023).

Literature cited

Antonin V. 2003. New species of marasmioid genera (Basidiomycetes, Tricholomataceae) from

tropical Africa I. Sect. Epiphilli, Fusicystides, Globulares, Hygrometrici and Neosessiles.

Mycotaxon 85: 109-130.

Antonin V, Ryoo R, Shin HD. 2010. Marasmioid and gymnopoid fungi of the Republic of Korea. 2.

Marasmius sect. Globulares. Persoonia 24: 49-51. doi:10.3767/003158510X496107

Bi ZS, Li TH. 1987. Notes on species of Marasmius from North Guangdong province of China.

Guihaia 7(3): 225-228.

Bi ZS, Zheng GY, Liang JQ, Li C, Li TH. 1985. Taxonomic studies on Marasmius from Dinghu

Mountain of China. Acta Mycologica Sinica 4(1): 41-50. (in Chinese)

Bi ZS, Zheng GY, Li TH. 1994. Macrofungus flora of Guangdong Province. Guangdong Science and

Technology Press, Guangzhou. 879 p. (in Chinese)

Deng CY, Li TH. 2008. Marasmius nigrodiscus, a newly recorded species to China. Mycosystema

27(5): 768-770. (in Chinese)

Desjardin DE, Horak E. 1997. Marasmius and Gloiocephala in the South Pacific Region: Papua New

Guinea, New Caledonia and New Zealand Taxa. Part 1: Papua New Guinea and New Caledonia

Taxa. Part 2: New Zealand Taxa. Bibliotheca Mycologica 168. 152 p.

Kornerup A, Wanscher JH. 1978. Methuen handbook of colour. 3" ed. London: Methuen. 252 p.

Li TH, Bi ZS, Zheng GY, Zhang WM. 1994. Species of Marasmius from Guangdong and Hainan

province. Acta Mycologica Sinica. 13(4): 249-254. (in Chinese)

Mao XL. 1998. Economic fungi of China. Science Press, Beijing. 762 p. (in Chinese)

Pegler DN. 1983. Agaric flora of the Lesser Antilles. Kew Bulletin Additional Series 9. 668 p.

Singer R. 1964. Marasmius. Flore Iconographique des Champignons du Congo, Fasc. 14: 253-278.

Singer R. 1976. Marasmieae (Basidiomycetes — Tricholomataceae). Flora Neotropica 17: 1-348.

Singer R. 1986. The Agaricales in modern taxonomy. 4" Ed. Koenigstein, Koeltz Scientific Books.

981 p.

Tai FL. 1979. Sylloge Fungorum Sinicorum. Science Press, Beijing, China. 1527 p. (in Chinese)

Tan YS, Desjardin DE, Perry BA, Vikineswary S, Noorlidah A. 2009. Marasmius sensu stricto in

Peninsular Malaysia. Fungal Diversity 37: 9-100.

Wannathes N, Desjardin DE, Hyde KD, Perry BA, Lumyong S. 2009a. A monograph of Marasmius

(Basidiomycota) from Northern Thailand based on morphological and molecular (ITS

sequences) data. Fungal Diversity 37: 209-306.

Wannathes N, Desjardin DE, Lumyong S. 2009b. Four new species of Marasmius section Globulares

from Northern Thailand. Fungal Diversity 36: 155-163.

Wilson AW, Desjardin DE. 2005. Phylogenetic relationships in the gymnopoid and marasmioid fungi

(Basidiomycetes, euagaric clade). Mycologia 97(3): 667-679. doi:10.3852/mycologia.97.3.667

500 ... Deng & Li

White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal

RNA genes for phylogenetics. In: MA Innis, DH Gelfand, JJ Sninsky, TJ White (editors), PCR

Protocols: A guide to Methods and Applications, Academic Press Inc., San Diego: 315-322.

Zhang ST, Mao XL. 1995. Hong Kong mushrooms. Hong Kong: The Chinese University Press, 470

p- (in Chinese)

MYCOTAXON

Volume 115, pp. 501-504 January-March 2011

DOT: 10.5248/115.501

A new Puccinia on Thymelaea from Turkey

SEVDA KIRBAG &*, M. CATHERINE AIME ?& MuRAT KuRSAT ?

‘Department of Biology, Faculty of Science, Firat University, TR 23119, Elazig, Turkey

"Louisiana State University Agricultural Center, Department of Plant Pathology

& Crop Physiology, Baton Rouge, LA 70803 USA

’Department of Biology, Faculty of Science & Arts, Bitlis Eren University,

TR 13000, Bitlis, Turkey

* CORRESPONDENCE TO: skirbag@firat.edu.tr

AssTRAcT — ‘The rust fungus Puccinia salihae sp. nov. is described from Ihymelaea aucheri

in East Anatolia, Turkey, producing aecia, uredinia, and telia. This is the first report of a rust

disease infecting a species of Thymelaea.

Key worps — phytopathogens, Pucciniales, Thymelaeaceae, Uredinales

Introduction

Although many studies on the flora of Turkey have been carried out, the

mycobiota is comparatively less studied (Gobelez 1963; Kirbag 2003, 2004;

Huseyin & Kirbag 2003; Hiiseyin 2004; Bahcecioglu et al. 2009). During surveys

of the parasitic fungi on herbaceous plants in the Elazig province of Turkey a

species of Puccinia Pers. was observed on ‘Thymelaea aucheri, a perennial herb.

The disease was observed on host leaves, fruit, and stems. Disease incidence

was rare, detected only once during three years’ observation. Very few rusts

have been recorded from Thymelaeaceae and none from Thymelaea Mill. (Farr

& Rossman 2010).

Materials & methods

The material for this study was collected from the Elazig-Baskil Province in Turkey

in 2007, from square B7 at an altitude of 1800 m. The typical climate of the region is

Mediterranean, characterized by hot and dry summers and extremely cold and snowy

winters. Field collected specimens were preserved by drying in a plant press according

to established herbarium techniques. The host plant was identified using the flora of

Turkey (Davis 1985). Holotype material is housed at the Firat University Herbarium

(FUH) in Elazig, Turkey; isotype material is housed at the US National Fungus

502 ... Kirbag, Aime & Kursat

Collections, Beltsville, MD USA (BPI). DNA extraction, polymerase chain reaction,

and cycle sequencing of the nuclear ribosomal large subunit (LSU) were performed as

previously described in Aime (2006). A DNA sequence of the LSU has been deposited

in GENBANK, accession number HQ412645.

Results

A 981 bp sequence of the 5’-end of the LSU was obtained. Blast analyses

(Altschul et al. 1997) indicated placement within the Pucciniaceae, with

closest similarities to other members of Puccinia, including P. windsoriae (98%

similarity), P. andropogonis (98%), and P. emaculata (97%).

Taxonomy

Puccinia salihae Kirba’ & Aime sp. nov. Fic 1

MycosBank MB 519019

Aecia in fructus, folia, caulicola, 1 mm longa, 0.2 mm lata, meliaurantiata, cellulae

peridii, sphaeroideae, elipsoideae 20-22.5 x 17.5-20 um, parietibus 6 um. Aeciosporae

sphaeroideae, ovoidaeae, 20-22 x 18-20 um, membrana 1-1.5 um. Uredinia foliacolae,

caulicolae, rarius fructicolae, 1-2 mm longa, 0.1-0.5 mm lata, pulvinata, flaventa.

Urediniasporae globosae 30-35 x 25-27.5 um, membrana 1.5 um crassa, echinulataeae,

poris germinationis 4 dispersis. Telia foliicolae, caulicolae, rarius fructicolae 1-2 mm

longa, 0.1-0.5 lata, black, fuliginea, pulvinata, pulveraceae. Teliosporae elipticae-ovoideae

45-51 x 30-32 um, membrane 1-1.5 um, crassa in apice 4 um, poro superiore apical, poro

inferiore prope septum, crassa caducous stipite, hyaline, 10-25x 5-7.5 um.

TyPE: TURKEY, ELAZIG-BASKIL, Hasan mountain, slope of Hacimustafa village, alt 1800

m on Thymelaea aucheri (Thymelaeaceae), 14 Jul 2007, leg: S. Karbag & M. Kursat

(no:2000) (Holotype FUH 1272). Isotype in BPI (BPI 881123).

ETyMoLoGy: Saliha, in honor of the mother of the first author.

Aecia (Fic 1c) on fruits, leaves and stems, 1 mm long, 0.2 mm wide, whitish

to honey-orange in color, pinnately arranged. Peridial cells (Fic le) honey

colored, irregularly shaped, in cross section spherical to ellipsoid, 20-22.5 x

17.5-20 um, outer wall 1-1.5 um thick, inner wall 4-5 um thick. Aeciospores

spherical to ovoid, 20-22 x 18-20 um, spore wall 1-1.5 um thick. Uredinia

on leaves, stems, rarely on fruits, 1-2 mm long, 0.1-0.5 mm wide, yellowish,

at first covered by epidermis, later rupturing. Urediniospores globoid 30-35

x 25-27.5 um, wall 1.5 um thick, echinulate, germ pores 4, scattered. Telia

(Fic 1d) on leaves, stems rarely on fruits, 1-2 mm long, 0.1-05 mm wide, black,

powdery. Teliospores (Fic 1f) ellipsoid-ovoid 45-51 x 30-32 um, spore wall

brown-chestnut, 1-1.5 um thick, apex slightly thickened up to 4 um, upper pore

apical, lower pore near septum, pedicel hyaline, 10-25 x 5-7.5 um.

ECOLOGY, RANGE & DISTRIBUTION: Known only from Thymelaea aucheri at

the type location. Worldwide, the host plant has been recorded from Turkey,

Syria, Lebanon, and western Iran (Davis 1985).

Puccinia salihae sp. nov. (Turkey) ... 503

Figure 1. Puccinia salihae on Thymelaea aucheri (holotype): a—b. infected host plant; c. aecia;

d. telia; e. peridial cells; f. teliospores.

Discussion

Thymelaeaceae is represented by three genera (Diarthron, Daphne,

Thymelaea) in Turkey (Davis 1985). A single species of rust, Uredo daphnicola

Dietel, has been reported on Thymelaeaceae from Turkey on Daphne oleoides

Schreb. (Kabaktepe & Bahcecioglu 2005). Uredo daphnicola is considered

504 ... Kirbag, Aime & Kursat

synonymous with Melampsora daphnicola (Dietel) Jorst. (Kuprevich &

Transhel 1957), a fungus that is readily distinguished from Puccinia salihae by

its colorless urediniospores and paraphysate uredinia.

Worldwide, there are few rusts recorded from Thymelaeaceae and none

from a species of Thymelaea (Farr & Rossman 2010). Only one other species of

Puccinia, P. gnidiae Doidge on Gnidia microcephala Meisn. from South Africa,

is known to infect a member of the family (Farr & Rossman 2010). In addition

to host genus, P. salihae differs from P. gnidiae primarily by the much larger

urediniospores (30-35 x 25-27.5 um in P. salihae vs. 25-30 x 22.5-25 um in

P. gnidiae) and teliospores (45-51 x 30-32 um in P salihae vs. 30-40 x 25-30

um in PB gnidiae) (Doidge 1939).

Acknowledgments

MCA acknowledges Cindy Park for excellent technical support at the USDA. Elsad

Hiiseyin and Zeliha Bahcecioglu are thanked for helpful corrections and suggestions on

the manuscript.

References

Aime MC. 2006. Toward resolving family-level relationships in rust fungi (Uredinales). Mycoscience

47: 112-122. doi:10.1007/s10267-006-0281-0

Altschul SE, Madden TO, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped

BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids

Research 25: 3389-3402. doi:10.1093/nar/25.17.3389

Bahcecioglu Z, Berndt R, Kabaktepe S. 2009. Puccinia ardahanensis sp. nov., a new rust fungus

from Turkey. Sydowia 61: 209-213.

Davis PH, 1985. Flora of Turkey and the East Aegean Islands, Vol 7, Edinburgh Univ. Press.

Edinburgh. doi:10.2307/1219187

Doidge EM. 1939. South African rust fungi, II. Bothalia 3: 487-512.

Farr DF, Rossman AY. 2010. Fungal databases, systematic mycology and microbiology laboratory,

ARS, USDA. Retrieved September 3, 2010, from http://nt.ars-grin.gov/ fungaldatabases/

Gobelez M. 1963. La mycoflore de Turquie. I. Mycopathologia et Mycologia Applicata 19 (4):

296-314.

Hiiseyin E. 2004. Kuehneola uredinis (Uredinales) on Species of Rubus in Turkey. Mycotaxon 90

(1): 149-151.

Hiiseyin E, Karbag S. 2003. A new Puccinia on endemic Phryna. Pakistan Journal of Botany 35 (4):

477-478.

Kabaktepe S, Bahcecioglu Z. 2005. Seven rust species recorded as new to Turkey. Mycotaxon 91:

393-396.

Karbag S. 2003. New records of microfungi for Turkey. Plant Disease Research 18 (1): 94-95.

Karbag S. 2004. New records of microfungi from Turkey. Pakistan Journal of Botany 36 (2):

445-448,

Kuprevich VF, Transhel’ V G. 1957. Cryptogamic plants of the USSR. Vol IV. Rust Fungi: Family

Melampsoraceae. Translated from Russian (1970): Israel Program for Scientific Translations,

Jerusalem. 518 pp.

MYCOTAXON

Volume 115, pp. 505-506 January-March 2011

DOT: 10.5248/115.505

Pucciniastrum enkianthi nom. nov.,

a replacement name for P. hakkodaense

YING- MEI LIANG! & MAKOTO KAKISHIMA”

‘College of Environmental Science and Engineering, Beijing Forestry University,

No.35, Tsinghua Eastern Road, Haidan District, Beijing 100083, China

?Graduate School of Life and Environmental Sciences, University of Tsukuba,

Tsukuba, Ibaraki 305-8572, Japan

* CORRESPONDENCE TO: kaki@sakura.cc.tsukuba.ac.jp

ABSTRACT — Pucciniastrum hakkodaense (a rust pathogen of Enkianthus) is an illegitimate

later homonym of P. hakkodense (a rust pathogen of Leucothoe). Hence, the replacement

name Pucciniastrum enkianthi is proposed.

Key worps —Naohidemyces, nomen novum, nomenclature, Thekopsora

Pucciniastrum enkianthi Y.M. Liang & Kakish., nom. nov.

MycoBank MB519279

= Pucciniastrum hakkodaense Y.M. Liang & Kakish., Mycotaxon 92: 372. 2005,

nom. illegit. (non PB. hakkodense (S. Ito & Hirats. f.) Jorst. 1958).

EryMo.oey: referring to the host genus Enkianthus.

Pucciniastrum hakkodaense Y.M. Liang & Kakish. was described as a new

species based on specimens on Enkianthus campanulatus (Migq.) G. Nicholson

(Ericaceae) collected in Japan (Liang et al. 2005). However, following ICBN

Art. 53.3 (McNeill et al. 2006), this name must be regarded as an illegitimate

later homonym of Pucciniastrum hakkodense (S. Ito & Hirats. f.) Jorst. 1958

(= Thekopsora hakkodensis S. Ito & Hirats. f. 1927).

Thekopsora hakkodensis was described based on a specimen on Leucothoe

grayana Maxim. (Ericaceae) from Japan (Hiratsuka 1927, 1936). Although

Jorstad (1958) transferred the name to Pucciniastrum, Hiratsuka (1958)

and Hiratsuka et al. (1992) continued to treat this species under its original

name, T: hakkodensis. Subsequently, Sato et al. (1993) established a new genus

Naohidemyces and treated T. hakkodensis as a synonym of the type species,

“Naohidemyces vaccinii” S. Sato et al. (an invalidly published combination

506 ... Liang & Kakishima

based on the illegitimate teleomorph name Melampsora vaccinii G. Winter

1881, non (Alb. & Schwein.) G. Winter 1880). The correct name for this taxon

is Naohidemyces vacciniorum (J. Schrot.) Spooner (Spooner & Butterfill 1999)

based on the earliest legitimate teleomorph name, Melampsora vacciniorum

J. Schrot. 1887.

Pucciniastrum enkianthi (= P. hakkodaense) is morphologically quite

different from Naohidemyces vacciniorum (= P. hakkodense, T. hakkodensis).

Pucciniastrum enkianthi produces its telia underneath the epidermis of the host

whereas N. vacciniorum produces teliospores within epidermal cells of the host.

In addition, their uredinial/telial hosts are not closely related though they are

in the same family, Ericaceae: P enkianthi on Enkianthus;, and N. vacciniorum

on Hugeria, Leucothoe, Oxycoccus, and Vaccinium (Sato et al. 1993, Liang et al.

2005).

Acknowledgements

We gratefully acknowledge Dr Shaun Pennycook (Landcare Research, Auckland, New

Zealand), Dr Paul M. Kirk (CABI-UK, Egham, UK), and Dr. C. M. Denchev (Institute of

Biodiversity and Ecosystem Research, Bulgarian Academy of Sciences, Sofia, Bulgaria)

for their kind suggestions and critically reading the manuscript.

Literature cited

Hiratsuka N. 1927. Studies on the Melampsoraceae of Japan. Jour. Facul. Agric. Hokkaido Imp.

Univ. 21: 1-41.

Hiratsuka N. 1936. A monograph of the Pucciniastreae. Mem. Tottori Agric. Coll. 4: 1-374.

Hiratsuka N. 1958. Revision of taxonomy of the Pucciniastreae. Mem. Fac. Agric. Tokyo Univ.

Educ. 5: 1-167.

Hiratsuka N, Sato S, Katsuya K, Kakishima M, Hiratsuka Y, Kaneko S, Ono Y, Sato T, Harada Y,

Hiratsuka T, Nakayama K. 1992. Rust flora of Japan. Tsukuba Tsupankai, Tsukuba.

Jorstad I. 1958. Nomenclature notes, chiefly on Uredinales. Nytt Mag. Bot. 6: 135-140.

Liang Y-M, Tian C-M, Hiratsuka K, Kakishima M. 2005. A new species of Pucciniastrum on

Enkianthus campanulatus from Japan. Mycotaxon 92: 371-376.

McNeill J, Barrie FR, Burdet HM, Demoulin V, Hawksworth DL, Marhold K, Nicolson DH,

Prado J, Silva PC, Skog JE, Wiersema J, Turland NJ. 2006. International Code of Botanical

Nomenclature (Vienna Code). Adopted by the Seventeenth International Botanical Congress,

Vienna, Austria, July 2005. Regnum Vegetabile 146. 568 p.

Sato S, Katsuya K, Hiratsuka Y. 1993. Morphology, taxonomy and nomenclature of Tsuga-Ericaceae

rusts. Trans. Mycol. Soc. Japan 34: 47-62.

Spooner BM, Butterfill G. 1999. Additions to the Uredinales and Ustilaginales of the Azores. Vieraea

27: 173-182.

MYCOTAXON

Volume 115, pp. 507-520 January-March 2011

DOT: 10.5248/115.507

Morphological studies in Dothideomycetes:

Elsinoe (Elsinoaceae), Butleria, and three excluded genera

YANMEI Li’, Halx1A Wu?, HANG CHEN! & KEVIN D. HypDE??*

! International Fungal Research and Development Centre, Key Laboratory of Resource Insect

Cultivation & Utilization State Forestry Administration, The Research Institute of Resource Insects,

Chinese Academy of Forestry, Kunming 650224, PR China

? Visiting Professor, Botany and Microbiology Department, College of Science, King Saud University,

Riyadh 11442, Saudi Arabia

3 School of Science, Mae Fah Luang University Tasud, Muang, Chiang Rai 57100, Thailand

* CORRESPONDENCE TO: kdhyde3@gmail.com

AssTRACT — ‘The types of the genera Beelia, Butleria, Elsinoe, Hyalotheles, and Saccardinula

were examined to revise their familial position. The family Elsinoaceae (type: Elsinoe

canavaliae) is described and its separation from Myriangiaceae is supported. Butleria

inaghatahani has characters similar to Elsinoaceae where it should remain. Beelia suttoniae

appears to be a superficial biotroph on the surface of leaves and thus Beelia should be placed

in Chaetothyriaceae and is most similar to Ainsworthia (= Phaeosaccardinula). Apart from

the oblong to ovoid sessile asci in Hyalotheles dimerosperma, its placement in Elsinoaceae

seems unwarranted, and Hyalotheles should be placed in Dothideomycetes incertae sedis.

Saccardinula guaranitica may be better placed in Microthyriaceae or Brefeldiellaceae, because

its ascomata greatly resemble thyrothecia found in Microthyriaceae and have similarities with

Brefeldiella. Molecular sequence data from fresh collections is required to solve the problem

of familial placement.

Key worps — Ascomycota, morphology, taxonomy

Introduction

We are conducting studies on the Dothideomycetes in order to provide a

natural classification (Zhang et al. 2008, 2009; Wu et al. 2010). As part of this

research, we are restudying the type species of genera placed in the Elsinoaceae,

a poorly known but relatively important family within the Dothideomycetes

(Lumbsch & Huhndorf 2007). The Elsinoaceae presently comprise 10 genera

including Beelia, Butleria, Elsinoe, Hemimyriangium, Hyalotheles, Micularia,

Molleriella, Saccardinula, Stephanotheca, and Xenodium (Lumbsch & Huhndorf

2007). The family is characterized by immersed or erumpent ascomata,

508 ... Li & al.

composed of pale gelatinous thin-walled hyphal or pseudoparenchymatous

cells. Asci are arranged in individual locules, in a single layer or are irregularly

scattered, and are saccate to globose, bitunicate and fissitunicate. Ascospores

are hyaline to brown, septate, or sometimes muriform (Kirk et al. 2001,

2008). The known anamorphs in Elsinoaceae are acervular coelomycetes with

polyphialidic conidiogenous cells (e.g. Sphaceloma anamorphs of Elsinoe)

(Sivanesan 1984), We have thus far examined several taxa within Elsinoaceae

and in this paper report on the type species of Elsinoe and four poorly known

genera: Elsinoe canavaliae (Raciborski 1900), Beelia suttoniae (Stevens 1925),

Butleria inaghatahani (Saccardo 1914), Hyalotheles dimerosperma (Spegazzini

1908), and Saccardinula guaranitica (Spegazzini 1885). Full descriptions of

these taxa and suggestion for their taxonomic placement are provided.

Materials & methods

Type specimens of Elsinoe canavaliae, Beelia suttoniae, Butleria inaghatahani,

Hyalotheles dimerosperma, Saccardinula guaranitica were obtained from ZT & K,

BISH, PAD, LPS and LPS, respectively. Ascomata were rehydrated in 3% KOH prior

to examination and sectioning. Specimens were examined under a stereo microscope

(Leica MZ16A) and fine forceps were used to remove one or two ascomata, which

were mounted in water, Melzer’s, Congo red, or cotton blue reagents. Observations and

photographs were made under the light microscopes (Nikon E800 and Leica DM3000).

Differential interference contrast microscopy was used for some hyaline structures.

Hand sections were cut with a sharp razor blade and thin (8 tm) sections were cut

using a Leica CM1100 freezing microtome. The sections were transferred to a drop of

water or a drop of cotton blue for examination and photography.

Taxonomy

Elsinoaceae Hohn. ex Sacc. & Trotter, Syll. fung. 22: 584 (1913).

Parasitic on leaves causing scabs and anthracnose. Ascomata immersed to

erumpent, round or elongate, usually crustose, composed of pale gelatinous

thin-walled hyphal or pseudoparenchymatous cells, opening by unordered

breakdown of the surface layers. Specialized interascal tissue absent. Asci

arranged in individual locules, in a single layer or irregularly arranged, saccate

to globose, bitunicate, fissitunicate. Ascospores hyaline to brown, septate,

sometimes muriform. Anamorph acervular where known.

Elsinoaceae was validated by Saccardo & Trotter (1913) based on the invalid

non-Latin name “Elsinoéen” published by Hohnel (1909: 373). Héhnel (1909)

regarded Elsinoaceae as a separate family at the same level with Myriangiaceae

among “die Protodiscineen” or “die Plectascineen” Von Arx & Miiller (1975)

extended the family concept and placed Elsinoe with another 15 genera in

Myriangiaceae. Luttrell (1973) used this concept to unite seven additional genera

with Elsinoe in Myriangiaceae. Barr (1979) and Eriksson (1981) maintained

Morphological studies in Dothideomycetes ... 509

the Elsinoaceae as separate from Myriangiaceae, mainly based on habit and

developmental studies. Lumbsch & Huhndorf (2007) placed Elsinoaceae in the

order Myriangiales and this is supported in the studies of Schoch et al. (2006,

2009) and Boehm et al. (2009). Further molecular study is needed to establish

whether Elsinoaceae and Myriangiaceae are distinct families, although the

evidence points towards this (Schoch et al. 2009).

Type GENus: Elsinoe Racib., Paras. Alg. Pilz. Java’s (Jakarta) 1: 14 (1900).

Ascomata parasitic, usually forming scabs or anthracnose on leaves.

Ascomata pulvinate, white or occasionally brown, in section with numerous

locules distributed inside the ascostromata, with numerous asci inside each

locule. Paraphyses absent. Asci 8-spored, bitunicate, globose to subglobose,

without a pedicel. Ascospores hyaline, transseptate or muriform.

ANAMORPH: Sphaceloma spp. Acervuli pseudoparenchymatous from which

hyaline to pale-brown phialidic conidiophores and/or conidiogenous cells

originate. Conidia hyaline, unicellular, ellipsoidal, biguttulate.

Type species: Elsinoe canavaliae Racib., Paras. Alg. Pilze Java's 1: 14 (1900),

as “cavavalliae”. Fic. 1

Ascomata parasitic on leaves, forming scabs on lower surface (Fic. 1A).

Ascomata pulvinate, white or occasionally brown, 1.8-3.3 mm in diam.,

gregarious, immersed or erumpent, irregularly shaped, spreading around the

host veins (Fic. 1B-c), in section with numerous locules distributed inside

the ascostromata, with numerous asci inside each locule, with lower part

of ascomata fusing with the hyaline host cells (Fic. 1p-). Paraphyses not

seen, probably absent. Asci 19-23 x 16-20 tm (mean = 21 x 18 um, n = 10),

8-spored, bitunicate, globose to subglobose, without a pedicel, with a wide but

indistinct ocular chamber (Fic. 1F-H). Ascospores 14-18 x 6-9 um (mean = 15

x 7 tun, n = 10), irregularly arranged, hyaline, ellipsoidal-fusiform, 3-4 septate,

constricted at the central septum, upper part wider with slightly acute ends,

lower part narrow with rounded ends, guttulate (Fic. 11-)).

ANAMoRPE: Sphaceloma.

SPECIMEN EXAMINED: INDONESIA, Java, on leaves of Canavalia gladiata (Savi) DC.

(Fabaceae) leg. Raciborski (ZT Myc 1489, lectotype; K 164015, syntype).

Elsinoe was established by Raciborski (1900) with descriptions of three species

(E. canavaliae, E. antidesmae Racib., E. menispermacearum Racib.). Von Arx

& Miiller (1975) placed Elsinoe in Myriangiaceae based on its immersed or

erumpent, pulvinate or irregular ascomata and being parasitic on the leaves

of higher plants causing scabs. Later, the genus was removed to the family

Elsinoaceae (Barr 1979, Lumbsch & Huhndorf 2007). The more than 141 species

recorded for Elsinoe (www.indexfungorum.org 2010) are generally parasites on

leaves, stems, scale insects or other fungi.

510 ... Li &al.

Fic. 1. Elsinoe canavaliae (lectotype) a. Appearance of ascomata on the host surface of leaves.

B-c. Appearance of ascomata on the leaves showing the irregular shape of scabs. D-E. Vertical

section through ascomata in cotton blue showing the ascomata with numerous asci inside each

locule. F-H. Sessile asci in cotton blue. I-J. Ascospores in cotton blue.

Scale bars: B- c = 5 mm, D- E = 100 um, F-j = 10 um.

This is an important plant pathogenic genus causing scab and anthracnose

of Citrus, Malus, Rubus, Vitis spp. and other hosts and descriptions and disease

symptoms can be found on the worldwide web. It is important however, to

characterize the type of the genus, which is less well known. Elsinoe fawcettii

Bitanc. & Jenkins and E. australis Bitanc. & Jenkins cause scab diseases of

Citrus species (Hanlin 1989; Timmer et al. 1996), and there are many other

important pathogens in this genus. Examples include Elsinoe veneta (Burkh.)

Morphological studies in Dothideomycetes ...511

Jenkins, which causes cane spot of raspberry (Munro 1988); E. dracophylli PR.

Johnston & Beever, which causes spots on Dracophyllum Johnson and Beever

1994); and E. mangiferae Bitanc. & Jenkins (Bitancourt & Jenkins 1946), which

causes mango scab. Elsinoe takoropuku G.S. Ridl. & Ramsfield is a recently

introduced species (Ridley & Ramsfield 2006), but it differs quite markedly

from E. canavaliae as it does not cause scabs on leaves, but forms ascostromata

on twigs with locules each containing single asci. The asci are thought to be

more like the Elsinoe type, although the fungus shares many characters with

Myriangiaceae, illustrating a clear need for molecular studies on this group.

There have been a few molecular studies incorporating strains of Elsinoe.

Schoch et al. (2006, 2009) and Boehm et al. (2009) showed the species to cluster

in the Myriangiales and form a distinct subclade — the Elsinoaceae. However,

since only four Elsinoe specimens and one Myriangium specimen were used

in Schoch et al. (2006) and no Elsinoe specimens were used in Schoch et al.

(2009), the molecular data does not conclusively resolve two separate families

(Elsinoaceae and Myriangiaceae). Swart et al. (2001) analyzed ITS sequence

data of six Elsinoe species — E. banksiae, E. leucospermi, E. proteae, Elsinoe sp.

(from Citrus), Elsinoe sp. (from Banksia), Sphaceloma protearum — in their

research on the taxonomy of species associated with scab disease of Proteaceae;

their molecular analyses supported five species, of which four were described

in that paper. A molecular study of many more Elsinoe species is needed.

Beelia FE Stevens & R.W. Ryan, in Stevens, Bulletin of the Bernice P. Bishop Museum

19: 71 (1925).

Forming colonies on the surface of the leaves. Ascomata black, superficial,

ostiolate, aparaphysate, borne on free, brown, septate, branching mycelium.

Asci bitunicate, broadly ellipsoidal, obovate to saccate, pedicellate. Ascospores

cylindrical, hyaline to straw-coloured, 6-celled.

ANAMorRPHs unknown.

Type species: Beelia suttoniae F. Stevens & R.W. Ryan, in Stevens, Bulletin of the

Bernice P. Bishop Museum 19: 71 (1925). Fic. 2

Ascomata on the upper surface of leaves, scattered beneath and between

darkened mycelial strands (Fic. 2A-B). Ascomata 190-210 tum wide x 115-133

uum high, superficial, globose to subglobose, black, with a flattened base which

is easily removed from the substrate containing numerous asci (Fic. 2c-p).

Peridium 25-30 um wide, up to 39 um wide at the apex, 20 um wide at the base;

comprising two cell types; outer cells brown, thick-walled, textura globulosa,

inner cells thin-walled, lighter, textura angularis (Fic. 2p-E). Paraphyses not

seen, probably absent. Asci 70-89 x 45-55 um (mean = 84.3 x 51.2 um, n = 20),

8-spored, bitunicate, broadly ellipsoidal, obovate to saccate, thick-walled, with

small pointed pedicle, and with ocular chamber up to 24.4 um wide x 14.9 um

512... Li &al.

Fic. 2. Beelia suttoniae (syntype): a. Appearance of ascomata on host leaf scattered beneath and

between darkened mycelium. B. Squash of ascoma in water. c-E. Vertical section through ascoma

showing outer and inner cell types. F-c. Asci. Note the bitunicate appearance and ocular structure

in the extended apex. H-1. Hyaline ascospores with 5-septa. Note the central septum is strongly

constricted and upper part wider.

Scale bars: A— B = 100 pum. c-E = 50 um, F = 25 pm. G = 50 um. H-1 =10 pum.

high (Fic. 2F-G). Ascospores 38-45 x 13-18 um (mean = 42.8 x 14.6 um, n =

20), irregularly arranged, cylindrical, hyaline, 5-septate, strongly constricted at

each septum, central septum very strongly constricted and upper part wider,

smooth-walled, with narrow mucilage sheath (Fic. 2 H-1).

ANAMORPH unknown.

Morphological studies in Dothideomycetes ... 513

SPECIMEN EXAMINED: USA, Hawall, on leaves of Suttonia lanaiensis Mez (Myrsinaceae),

circa 1925, Lanai, no. 421, leg. Munro (BISH 499845, syntype).

Beelia was introduced by Stevens & Ryan (Stevens 1925) and remained

monotypic until B. philippinensis Bat. & C.A.A (Batista & Costa 1959) and B.

plumeria Bat. & Cavalc. (Batista et al. 1967) were added. Stevens (1925) placed

Beelia in the family Microthyriaceae, where it was accepted by Petrak (1953).

Von Arx & Miller (1975) transferred Beelia to the Myriangiaceae based on

its dimidiate ascomata and long (> 30 um) brown ascospores. Hawksworth et

al. (1995) later transferred the genus to the Elsinoaceae, a placement accepted

by Kirk et al. (2001) and Lumbsch & Huhndorf (2007). The taxon appears

to be a superficial biotroph on leaf surfaces, a character shared by genera in

Chaetothyriaceae. As Beelia seems most similar to Ainsworthia (Batista & Ciferri

1962; = Phaeosaccardinula Henn., fide von Arx & Miller 1975) in that family,

we suggest that the genus may belong in Chaetothyriaceae. New collections and

molecular analyses are needed to clarify the familial placement.

Butleria Sacc., Annls mycol. 12(3): 302 (1914).

Forming leaf spots. Ascomata gregarious, superficial, black, subglobose,

with numerous locules distributed at different levels inside the ascomata, with

only one globose to oblong asci inside each locule. Asci 8-spored, bitunicate,

sessile. Ascospores oblong to ovoid, brown, two-celled.

ANAMORPHs unknown.

Type species: Butleria inaghatahani Sacc., Annis mycol. 12(3): 302 (1914). Fie. 3

Forming light, somewhat zonate target spots on leaves (Fic. 3a,c) with

minutely stromatic ascomata forming on the upper surface. Ascomata 81-130

x 60-88 um (mean = 114.4 x 75.2 wm, n = 15), gregarious, superficial, ovoid,

subglobose to globose, black, with numerous locules distributed at different

levels inside the ascomata, with only one globose to oblong asci inside each

locule (Fic. 3B, p-F). Paraphyses not seen. Asci 19-25 x 16-23 um (mean =

22.7 x 19.2 um, n = 15), 8-spored, bitunicate, globose to oblong, sessile, with

small ocular chamber up to 11.8 um wide x 2.9 um high (Fic. 3G-1). Ascospores

8-13 x 4-6 um (mean = 12.1 x 4.8 wm, n = 15), irregularly arranged in rows of 3

or 4, oblong to ovoid, brown, 2-celled, constricted at the central septum, upper

cell slightly larger than lower cell, spinulose (Fic. 3J-k).

ANAMORPH: unknown.

SPECIMEN EXAMINED: BANGLADESH, Comillae District, Krishnapone, associated

with target spots on leaves of Vangueria sp. (Rubiaceae), causing, 8 December 1913, leg.

Inaghataban (PAD 1677, holotype).

Butleriais a monotypic genus established by Saccardo (1914) for B. inaghatahani.

Von Arx & Miiller (1975) referred this genus to Myriangiaceae based on its

small bright ascomata and 2-celled ascospores. Currently, Butleria is placed in

the family Elsinoaceae (Barr 1979; Lumbsch & Huhndorf 2007; Kirk et al. 2001,

514... Li &al.

Boablinie rage bed Sey

Morphological studies in Dothideomycetes ...515

2008). This taxon does appear to be a candidate for Elsinoaceae as it is a parasite

on leaves and has single asci locules scattered throughout a somewhat reduced

but pulvinate ascomata. The ascospores are, however, distinct in being brown.

Here also additional collections and molecular analyses are needed to clarify

family relationships.

Hyalotheles Speg., Revta Mus. La Plata 15(2): 11 (1908).

Forming black spots on the upper surface of leaves. Individual ascomata

scattered, superficial, globose, black. Paraphyses not seen. Asci 8-spored,

bitunicate, oblong to obovoid, without a pedicel. Ascospores irregularly

arranged in 2---3 rows, globose, hyaline, 1-celled, minutely guttulate.

ANAMOoRPH: unknown.

Type species: Hyalotheles dimerosperma Speg., Revta Mus. La Plata 15(2): 11

(1908). Fic. 4

Forming black spots on the upper surface of leaves (Fic. 4a,c).

Individual ascomata scattered, superficial, globose, black, composed of

the hyaline pseudoparenchymatous cells at the edge and brown to dark

pseudoparenchymatous cells at the center (Fic. 48,D-E). Ascomata in section

50-62 x 54-60 um (mean = 56 x 55 um, n = 10) (Fic. 4E-F). Peridium dark to

brown, up to 4-5 um wide (Fic. 4£-F). Paraphyses not seen. Asci 23-28 x 15-

18 um (mean = 26 x 16 um, n = 10), 8-spored, bitunicate, oblong to obovoid,

without a pedicel (Fic. 4c-H). Ascospores 5-7 x 5-7 um (mean = 5.5 x 6. fm,

n = 8), irregularly arranged in 2-3 rows, globose, hyaline, 1-celled, minutely

guttulate (Fic. 41).

ANAMOoRPH: unknown.

SPECIMEN EXAMINED: BRAZIL, Sao PAuLo, Casa do Isolamento, on leaves of Rubus

urticifolius Poir. (Rosaceae), collector unknown (LPS 408, holotype).

Hyalotheles is a monotypic genus introduced by Spegazzini (1908) for H.

dimerosperma. The genus is characterized by ascomata developing on glandular

hairs of the host and spherical ascospores (von Arx & Miiller 1975). Von Arx

& Muller (1975) placed Hyalotheles in the family Myriangiaceae, but later

Barr (1979) transferred the genus to the family “Saccardinulaceae” [an invalid

name]. Lumbsch & Huhndorf (2007) now recognize Hyalotheles in the family

Elsinoaceae. Apart from the oblong to ovoid sessile asci, however, placement

in Elsinoaceae seems unwarranted, and Hyalotheles is better referred to

Dothideomycetes incertae sedis. Additional collections and molecular analyses

are needed to clarify family relationships.

Fi. 3 (left). Butleria inaghatahani (holotype): a, c. Appearance of ascomata in leaf spot. B. Drawing

from herbarium specimen. pD, F. Vertical section through ascomata showing the part connected

to the leaf. E. Vertical section through ascomata (in cotton blue reagent). G-I. Saccate asci.

J-K. Ascospores. Scale bars: c = 1 mm, D-E = 100 tum, F = 50 um, G—-K = 10 um.

516 ... Li &al.

5 ‘Cae

Nyt Pabes by. (pd: eed p,

7 fae |

f ie tal * ) Vue

Fic. 4. Hyalotheles dimerosperma (holotype). a, c. Appearance of ascomata on host surface

of leaf. B. Appearance of the drawing picture from the specimen. p. Ascomata in lactic acid

showing the structure of dark to brown pseudoparenchymatous cells at the center and hyaline

pseudoparenchymatous cells at the edge. E—-F. Vertical section through ascoma in cotton blue.

G-H. Asci in cotton blue. I. Ascospores in cotton blue.

Scale bars: c = 1 mm, D = 100 um, E = 50 pm, F = 100 um, G—H = 10 um.

Morphological studies in Dothideomycetes ...517

Saccardinula Speg., Anal. Soc. cient. argent. 19(6): 257 (1885).

Thalli forming raised black spots on the lower leaf surface. Individual

ascomata gregarious, superficial, very easily removed from host surface, ovoid

to globose, black, with the two different regions; the central region comprising

dark brown radiating cells with the ascomata and the marginal parts comprising

lighter brown radiating cells. Ascomata subglobose, fusing with one or more

ascomata, with a single locule distributed inside each ascoma, with single asci

inside each locule. Paraphyses not seen. Asci 8-spored, bitunicate, globose to

oblong, without pedicel. Ascospores ellipsoid-fusiform, with a few transsepta

and occasional longitudinal septa.

ANAMORPH: unknown.

Typs species: Saccardinula guaranitica Speg., Anal. Soc. cient. argent.

19(6): 258 (1885). Fic. 5

Thalli forming raised 400 um black spots on the lower leaf surface (Fic.

5a-C). Individual thalli gregarious, superficial, very easily removed from host

surface, ovoid to globose, black, with the two different regions; the central

region comprising dark brown radiating cells with the ascomata and the

marginal parts comprising lighter brown radiating cells to 3-7 um in diam.

(Fic. 5B,D-E). Ascomata in section 81-130 um x 60-88 pum, subglobose, fusing

with one or more ascomata, with a single locule distributed inside each ascoma,

with single asci inside each locule (Fic. 5F). Paraphyses not seen. Asci 19-25 x

16-23 um (mean = 22 x 20 um, n = 10), 8-spored, bitunicate, globose to oblong,

without pedicel (Fic. 5c-H). Ascospores 8-13 x 4-6 um (mean = 10 x 5 um, n

= 10), irregularly arranged, ellipsoid-fusiform, 2-3 septate, constricted at the

central septum, one end broadly rounded and slightly pointed at the other end,

hyaline, occasionally with longitudinal septa, guttulate (Fic. 51-J).

ANAMoRPH: unknown.

SPECIMEN EXAMINED: BRAZIL, Borga, Villa Rice, on leaves of Ilex sp., (Aquifoliaceae),

January 1882, leg. B. Balanse (LPS 1469, holotype).

Saccardinula was erected by Spegazzini (1885) for S. guaranitica. Luttrell (1973)

placed this genus in the “Saccardinulaceae” based on its ascostromata grouped

in a radiate, superficial, cellular membrane. Von Arx & Miller (1975) removed

this genus to Myriangiaceae based on its small ascomata, which are pustulate

at the centre, and short (< 20 um) hyaline ascospores, but Barr (1979) retained

the genus in the “Saccardinulaceae.” Lumbsch & Huhndorf (2007) placed

Saccardinula in the family Elsinoaceae.

Re-examination of S. guaranitica shows that the ascomata greatly resemble

the thyrothecia found in Microthyriaceae (Wu et al. 2010), although Brefeldiella

Speg. (Brefeldiellaceae), which occurs on leaves and has ascomata comprising a

wide area of radiating cells anda darker central raised areain which the asci form,

may be more similar (Reynolds & Gilbert 2005). Elsinoaceae is characterized by

Morphological studies in Dothideomycetes ... 519

round or elongate ascomata composed of pale gelatinous thin-walled hyphal

or pseudoparenchymatous cells and which open by unordered breakdown of

the surface layers (Kirk et al. 2001). Therefore, Saccardinula might better be

placed in either Microthyriaceae or Brefeldiellaceae, or “Saccardinulaceae” could

be validated to accommodate it (Eriksson 1981). Ultimately only molecular

sequence data will solve the problem of familial placement.

Acknowledgments

The Research Institute of Resource Insects, Chinese Academy of Forestry provided

financial support to Yanmei Li PhD’s study. Funds for research were provided by

the Grant for Essential Scientific Research of National Non-profit Institute (no.

CAFYBB2007002). The curators of the following herbaria are thanked for providing

material on loan for this study: ZT, K, BISH, PAD and LPS. We also thank Professor

Xiaoming Chen for financial support. K.D. Hyde acknowledges a research grant from

the Biodiversity Research and Training Program (BRT R253012) and The Thailand

Research Fund (BRG 5280002).

Literature cited

Arx JA von & Miiller E. 1975. A re-evaluation of the bitunicate ascomycetes with keys to families

and genera. Studies in Mycology 9: 1-159.

Barr ME. 1979. A classification of Loculoascomycetes. Mycologia 71: 935-957. doi: 10.2307/37592

Barr ME. 1983. Prodromus to class Loculoascomycetes.

Batista AC, Cifferi R. 1962. The Chaetothyriales. Beihefte zur Sydowia 3: 1-129.

Batista AC, Costa CA. 1959. Estudo analitico e iconografico de espécies de Microthyrium Desm.

Anais da Sociedade de Biologia de Pernambuco 16: 69-78.

Batista AC, Cavalcante W de A, Peres GP. 1967. Novas espécies de Microthyriaceae. Atas Instituto

de Micologia. Universidade do Recife 5: 213-214.

Bitancourt AA, Jenkins AE. 1946. A verrugose da mangueira. Arquivos do Instituto Biolégico, Sao

Paulo 17(13): 205-228.

Boehm EWA, Mugambi GK, Miller AN, Huhndorf SM, Marincowitz S, Spatafora JW, Schoch CL.

2009. A molecular phylogenetic reappraisal of the Hysteriaceae, Mytilinidiaceae and Gloniaceae

(Pleosporomycetidae, Dothideomycetes) with keys to world species Studies in Mycology 64: 49-

83. doi: 10.3114/sim.2009.64.03

Eriksson O. 1981. The families of bitunicate ascomycetes. Opera Botanica 60: 1-220.

Hanlin RT. 1989. Illustrated Genera of Ascomycetes. APS Press. the American Phytopathological

Society St. Paul. Minnesota.

Hawksworth DL, Kirk PM, Sutton BC, Pegler DN. 1995. Ainsworth & Bisby’s dictionary of the

fungi. 8% edn. CAB International. International Mycological Institute.

Héhnel FXR von. 1909. Fragmente zur Mykologie (VI. Mitteilung, Nr. 182 bis 288). Sitzungser. K.

Akad. Wiss. Math.-Naturwiss. K1. Abt. 1.118: 275-452.

Fic. 5 (left). Saccardinula guaranitica (holotype) a, c. Appearance of ascomata on the host surface

of leaf. 8. Drawing from herbarium specimen. D-E. Ascomata in lactic acid showing the two

different regions; the central region comprising dark brown radiating cells and the marginal parts

comprising lighter brown radiating cells. & Vertical section through ascoma. G-H. Asci in cotton

blue reagent. 1-J. Ascospores in cotton blue reagent.

Scale bars: c = 1mm, D = 100 um, E = 50 um, F = 100 um, G-J = 10 pm.

520 ... Li &al.

Johnston PR, Beever RE. 1994. Elsinoé dracophylli sp. nov. New Zealand Journal of Botany 32:

919+520.

Kirk PM, Cannon PF, David JC, Stalpers JA. 2001. Ainsworth & Bisby’s dictionary of the fungi. 9®

edn. CAB International, Wallingford, UK.

Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi.

10® edn. CAB International, Wallingford, UK.

Lumbsch HT, Huhndorf. SM. 2007. Outline of Ascomycota -2007. Myconet 13: 1-58.

Luttrell ES. 1973. Chapter 7. Loculoascomycetes. In: The Fungi, an advanced treatise, Vol. 4A. (eds.

C Ainsworth, FK Sparrow, AS Sussman). Academic Press, New York and London: 135-291.

Munro JM. 1988. Cane spot (Elsinoe veneta) in red raspberry: infection periods and fungicidal

control. Plant Pathology 37: 390-396.

Petrak F. 1953. Die Gattung Beelia Stev. et Ryan. Sydowia 7: 321-324.

Raciborski M. 1900. Parasitische. Algen und Pilze Java's. I. Theil. Staatsdruckerei. Batavia 39p.

Reynolds DR, Gilbert GS. 2005. Epfoliar fungi from Queensland, Australia. Australian Systematic

Botany 18: 265-289. doi: 10.1071/SB04030

Ridley GS, Ramsfield TD. 2006 [“2005”]. Elsinoe takoropuku sp.nov. infects twigs of Pittosporum

tenuifolium in New Zealand. Mycologia 97: 1362-1364. doi: 10.38520/mycologia.97.6.1362

PMid:16722226

Saccardo PA, Trotter A. 1913. Supplementum Universale Pars IX. Sylloge Fungorum 22: 1--1612.

Schoch CL, Shoemaker RA, Seifert KA, Hambleton S, Spatafora JW, Crous PW. 2006. A multigene

phylogeny of the Dothideomycetes using four nuclear loci. Mycologia 98: 1041-1052.

Schoch CL, Crous PW, Groenewald JZ, Boehm EWA, Burgess TI, de Gruyter J, de Hoog GS, Dixon

LJ, Grube M, Gueidan C, Harada Y, Hatakeyama S, Hirayama K, Hosoya T, Huhndorf SM,

Hyde KD, Jones EBG, Kohlmeyer J, Kruys A, Li YM, Licking R, Lumbsch HT, Marvanova L,

Mbatchou JS, Mc Vay AH, Miller AN, Mugambi GK, Muggia L, Nelsen MP, Nelson P, Owensby

CA, Phillips AJL, Phongpaichit S, Pointing SB, Pujade-Renaud V, Raja HA, Rivas Plata E,

Robbertse B, Ruibal C, Sakayaroj J, Sano T, Selbmann L, Shearer CA, Shirouzu T, Slippers

B, Suetrong S, Tanaka K, Volkmamm-Kohlmeyer B, Wingfield MJ, Wood AR, Woudenberg

JHC, Yonezawa H, Zhang Y, Spatafora JW. 2009. A class—-wide phylogenetic assessment of

Dothideomycetes. Studies in Mycology 64: 1-15. doi: 10.3114/sim.2009.64.01

Sivanesan A. 1984. The bitunicate Ascomycetes and their anamorphs.

Spegazzini CL. 1885. Fungi guaranitici. Pugillus I. Anales de la Sociedad cientifica argentina 19(6):

241-265.

Spegazzini CL. 1908. Fungi aliquo paulistani. Revista del Museo de la Plata 15(2): 7-48.

Stevens FL. 1925. Hawaiian fungi. Bulletin of the Bernice P. Bishop Museum 19: 1-189.

Swart L, Crous PW, Kang JC, Mchau GRA. Pascoe I, Palm ME. 2001. Differentiation of species of

Elsinoe associated with scab disease of Proteaceae based on morphology, symptomatology, and

ITS sequence phylogeny. Mycologia 93: 366-379. doi:10.2307/3761658

Timmer LW, Priest M, Broadbent P, Tan M.-K. 1996. Morphological and pathological

characterization of species of Elsinoé causing scab diseases of Citrus. Phytopathology 86:

1032-1038. doi:10.1094/Phyto-86-1032

Wu HX, Li YM, Chen H, Hyde KD. 2010. Studies on Microthyriaceae: some excluded genera.

Mycotaxon 113 :147-156. doi: 10.5248/113.147

Zhang Y, Fournier J, Pointing SB, Hyde KD. 2008. Are Melanomma pulvis—-pyrius and

Trematosphaeria pertusa congeneric? Fungal Diversity 33: 47-60.

Zhang Y, Wang HK, Fournier J, Crous PW, Jeewon R, Pointing SB, Hyde KD. 2009. Towards a

phylogenetic clarification of Lophiostoma/Massarina and morphologically similar genera in the

Pleosporales. Fungal Diversity 38: 225-251.

MYCOTAXON

Volume 115, pp. 521-533 January-March 2011

DOT: 10.5248/111.521

BOOK REVIEWS AND NOTICES

ELsE C. VELLINGA, Book Review Editor*

861 Keeler Avenue, Berkeley CA 94708 U.S.A.

CORRESPONDENCE TO: bookreviews@mycotaxon.com

INTRODUCTION

Lichens, the genus Amanita, stereoid fungi, rust fungi, and a checklist for the

fungi in Japan are the focus for the book reviews presented here, just an average

anthology of today’s systematic literature. The need to inventory, classify and

describe is as great as ever, or even more pressing in light of the changes in

the environment that take place, and the books reviewed here fill, in their own

small ways, the existing knowledge hole.

This contribution concludes with a list of newly published books to be

included in upcoming BooK REVIEWS AND NOTICES.

ASCOMYCETES

Hypotrachyna (Parmeliaceae, lichenized fungi). By H.J. Sipman, J.A. Elix &

T.H Nash III. 2009. New York Botanical Garden Press, Bronx, New York, NY 10458-

5126, USA; <www.nybgpress.org>. Pp. 179, figs 83, tables 2. [FLORA NEOTROPICA

MonoGraPH 104] ISBN 978-0-89327-502-0. Price: US $ 48.

Works such as this form the backbone of biodiversity inventory and

conservation work. They are of particular importance where they are the

culmination of extensive study and field experience and deal with groups

for which there was previously no contemporary synthetic works in the

region concerned. The tropical American species of this genus of parmelioid

lichens had previously been studied by Hale (1975), who accepted 74 species.

However, from the work of Sipman and a growing band of lichenologists in the

region, it had become clear that there were numerous additional species to be

* Books for consideration for coverage in this column should be mailed to the Book Review Editor

at the address above. All unsigned entries are by the Book Review Editor.

522 ... Vellinga, BOOK REVIEW EDITOR

accommodated. This new monograph almost doubles the number of known

species to 140, of which 37 are new to science, at the same time relegating many

names to synonymy. Hypotrachyna is primarily a tropical genus, although a few

species are known in temperate regions where they tend to occur in somewhat

high-rainfall regions. The neotropics in particular are their centre of diversity,

and 85 of the species treated here are only known from that region.

‘The monograph follows the traditional pattern of an historical overview, a

discussion of morphological and anatomical characters, a rather full account

of the 109 lichen products detected, notes on ecology and biogeography, and a

key. The species are arranged alphabetically with full bibliographical and type

citations (almost all types having been studied by at least one of the authors) for

accepted names and synonyms, descriptions, references to illustrations, details

of chemical characters, a summary of the distribution, details of specimens

or selected specimens examined, and notes concentrating on separation from

other species. Distribution maps are provided in many cases, but the halftone

photographs are mainly of the types of newly described species or lectotypes.

Photographs of more species, especially if they could have been in colour,

would have been a valuable addition to facilitate the use of the monograph

by non-specialists who lack immediate access to the works containing the

listed illustrations. I was pleased to see that the Latin diagnoses were generally

restricted to 2-3 lines but sad that data on the new names had not been deposited

in MycoBank, and consequently reference numbers not included. For me, and

I suspect many potential users, the key, in addition to being presented in the

space-wasting indented and dated format used in other volumes of the series,

places too much emphasis on chemical characters. Is it reasonable to expect

users to have a UV-lamp and potassium hydroxide to hand to get beyond the

second couplet? There is still perhaps too much emphasis on chemical products

in the formulation of species concepts here, and I was disappointed to see the

“fertile species”/"asexual counterparts” concept perpetuated — in all such

supposed cases in macrolichens so far studied in detail by molecular methods

the relationships have proved to be unsound (Crespo & Pérez-Ortega 2009).

Following Hale, conidial characters are not considered taxonomically valuable

and seem not to have been studied in most species, but I was pleased to see

ascospore size differences featured in a few of the species separations — as with

conidia, ascospore characters are much-neglected in macrolichen systematics.

No molecular studies were undertaken in the course of this revision,

and it would have been of interest to know to what extent the more widely

distributed species, such as Hypotrachyna revoluta, are really intercontinental

as opposed to further instances of cryptic speciation as is proven frequent in

other “widespread” parmelioid lichens (Crespo & Lumbsch 2010). I suspect

MycotTaxon 115 Book Reviews ... 523

modifications of species concepts may become necessary in the future in

some cases, but that will be a task for the next generation of researchers who

can proceed from the base now created. Overall, however, this is a scholarly

landmark work on the genus, and one that has been painstakingly compiled

over many years by three of today’s most experienced lichenologists. It can be

unhesitatingly commended as an authoritative account of the current state of

knowledge of this important lichenized genus.

Crespo A, Lumbsch HT. 2010. Cryptic species in lichen-forming fungi. IMA Fungus

1: 167-170.

Crespo A, Pérez-Ortega S. 2009. Cryptic species and species pairs in lichens: a

discussion on the relationship between molecular phylogenies and morphological

characters. Anales del Jardin Botanico de Madrid 66 (S1): 71-81.

Hale ME. 1975. A revision of the lichen genus Hypotrachyna (Parmeliaceae) in

tropical America. Smithsonian Contributions to Botany 25: 1-73.

Davip L HAawKsworTH

Departamento de Biologia Vegetal H, Facultad de Farmacia, Universidad Complutense

de Madrid, Plaza Ramon y Cajal, Ciudad Universitaria, E-20840 Madrid, Spain

davidh@farm.ucm.es

The lichen genus Rinodina (Ach.) Gray (Lecanoromycetidae, Physciaceae) in

North America, north of Mexico. By J.W. Sheard. 2010. National Research

Council of Canada, Ottawa, Ontario ON K1A OR6, Canada <pubs@nrcresearchpress.

com>. Pp. viii + 246, figs 182, tables 6. [MONOGRAPH PUBLISHING PROGRAM.] ISBN

978-0-660-19941-2. Price: US $ 89.95.

John Sheard has made the genus Rinodina the primary focus of his systematic

research since he completed his PhD on the British and European species in

1966; after he moved to the University of Saskatchewan in 1968 his attention was

immediately drawn to the North American species — on which he proceeded

to make contributions from time to time while accumulating information for

this work. Early retirement and appointment as an Emeritus Professor of the

University in 2000 has enabled him to bring this major work to fruition. Since

the work of Malme in 1902, ascospore structural differences have become the

fundamental criterion in the classification of the genus. The two developmental

ascospore types (Dirinaria-type, Physcia-type) yield no fewer than 13(-

14) spore types amongst the North American species. Various molecular

studies during the last decade have shown that the genus is paraphyletic (e.g.

Kaschik 2006) with foliose genera of the Physciaceae (e.g. Anaptychia, Physcia,

Physconia) nested within it. While not addressing this issue, Sheard does

reflect on the ancient origins of different groups within the genus in relation to

continental movements, suggesting that a calcicolous group well represented in

Colorado could date back to the Middle Triassic (240-230 Myr). Several other

524 ... Vellinga, BOOK REVIEW EDITOR

biogeographical hypotheses are also put forward for future testing, among

them molecular, and there are detailed discussions of regional diversity and

“floristic” elements that can be recognized within North America.

The introductory chapters include information on the 61 characters assessed

for each specimen studied in detail and recorded in a spreadsheet — a method

rarely used these days but routine during numerical (phenetic) analyses in the

1960s and 1970s. Especially important is the discussion of spore types, and the

illustrations make clear how important it is to observe developing as well as

mature (but not over-mature) ascospores when considering to which category

they should be assigned; here clearing in Melzer’s reagent is recommended for

material less than 2-3 years old. The numerous half-tone photographs in this

section and in the species accounts make these characters much clearer than

line drawings alone, as used in some other regional accounts of the genus. The

chemical products detected are summarized, but these are much less diverse

than in many other lichenized genera. The key is strictly dichotomous, but in

three categories arranged by substratum. In general this will work well, but as

Sheard notes substrate-switches can occur so some caution in their use would

be prudent. Spore types unavoidably feature strongly in the keys. Otherwise

the characters seem clear, although I would have preferred to see maximal and

minimal spore lengths rather than averages used in several couplets.

Species treatments are particularly detailed, especially with respect to

descriptions of anatomical features, and there are the expected notes on ecology,

distribution, and characterization. Lists of specimens examined and also in

many cases distribution maps are provided, the latter with records split into pre-

and post-1960 categories. In all, 96 species are recognized in North America,

of which five are newly described and ten had not previously been reported.

Of these, 36 are evidently endemic. At the same time, no fewer than 30 species,

including 13 first described from North America, are placed into synonymy.

In all cases detailed bibliographic and typification details are presented. Notes

are provided on some excluded species, including the lichenicolous “Rinodina”

insularis, which has Bacidia-type (not Lecanora-type) asci and which Sheard

considers to be best treated as “an aberrant Buellia” for the present. In fact, this

species has now been included in Endohyalina by Giralt et al. (2010), a work

which evidently came out while Sheard’s monograph was in press.

This meticulously produced monograph is a great tribute to Sheard’s almost

lifelong dedication to the genus and to his powers of critical observation. It

should be looked at by others contemplating monographs of crustose lichens

as a standard to aspire to. This revision is sure to remain the pivotal work on

species concepts in the genus for many years to come, even if the genus itself

is eventually divided as a consequence of more intensive molecular work and a

re-examination of generic concepts in the family. The work also has value as a

MycorTaxon 115 Book Reviews ... 525

complement to the several regional revisions of the genus produced in recent

decades (e.g. Mayrhofer & Poelt 1979, Mayrhofer 1984, Giralt 2001, Mayrhofer

& Moberg 2002, Kaschik 2006) and so merits use worldwide to. This is a job

extremely well done in the best taxonomic tradition!

Giralt M. 2001. The lichen genera Rinodina and Rinodinella (lichenized ascomycetes,

Physciaceae) in the Iberian Peninsula. Bibliotheca Lichenologica 79: 1-160.

Giralt M, van den Boom PPG, ElixJA. 2010. Endohyalina, the genus in the Physciaceae

to accommodate the species of the Rinodina ericina-group. Mycological Progress

9: 37-48.

Kaschik M. 2006. Taxonomic studies on saxicolous species of the genus Rinodina

(lichenized ascomycetes, Physciaceae) in the Southern Hemisphere with emphasis

in Australia and New Zealand. Bibliotheca Lichenologica 93: 1-162.

Mayrhofer H. 1984. Die saxicolen Arten der Flechtengattung Rinodina und

Rinodinella in der alten Welt. Journal of the Hattori Botanical Laboratory 55:

327-493.

Mayrhofer H, Moberg R. 2002. Rinodina. Nordic Lichen Flora 2: 41-69.

Mayrhofer H, Poelt J. 1979. Die saxicolen Arten der Flechtengattung Rinodina in

Europa. Bibliotheca Lichenologica 12: 1-186.

Davip L HAWKsworTH

Departamento de Biologia Vegetal H, Facultad de Farmacia, Universidad Complutense

de Madrid, Plaza Ramon y Cajal, Ciudad Universitaria, E-20840 Madrid, Spain

davidh@farm.ucm.es

BASIDIOMYCETES

Quelques espéces nouvelles ou mal délimitées d’ Amanita de la sous-section

Vaginatinae. 1° complément a Amaniteae, Fungi Europaei 9. By P. Neville

+ &S. Poumarat. 2009. Fungi non delineati LI-LII. Edizioni Candusso, Via Ottone

Primo 90, 17021 Alassio SV, Italy. <maxcandusso@libero.it>. Price € 26.00.

During the final illness of the late Professor Pierre Neville and after his death,

several friends and associates generously expended time and effort in the

production of this book. It represents their personal tribute to him, his life,

and his work. It also comprises the extant fragments of the work of Neville and

Poumarat on Amanita subsection Vaginatinae, which I understand to be section

Vaginatae in the sense of Corner and Bas (1962) as revised by Yang (1997). A

publication covering European taxa of Amanita [section Amanita] subsection

Amanitella and subsection Vaginatinae was proposed to follow the extensive

volume on the Amanitaceae [p.p.] of Europe written by Neville and Poumarat

(2004; reviewed in MycoTaxon 92: 474-484). Understandably, the present

volume has a much more restricted scope. It is significant that “Europe” is not

mentioned in the title of the present work. The materials on which the reported

results are based are almost exclusively from France, Italy, and Spain. I found

one collection each from Finland and Switzerland listed as revised material.

526 ... Vellinga, BOOK REVIEW EDITOR

For a book discussing taxa that first appeared in the works of Schaeffer and

Secretan, it is a shortcoming that no German, not to say Bavarian, material was

revised and that only one specimen from Switzerland was studied. As was the

case with the 2004 volume, the conspicuous lack of material from northern

and eastern Europe may raise questions about the accuracy of some species

concepts employed in this work as well as for some claims of novelty.

This work is divided into three parts of which the first two (“Introduction”

and “Matériel et méthodes”) are quite brief and refer the reader to the 2004

volume. The remainder of the work is dedicated to “Présentation des espéces,”

which is divided into four parts: (A.) “Amanita pini” (a slight modification

of the protolog of this taxon), (B.) “Espéces nouvelles” (C.) “Quelques

Vaginatinae déja décrites, liées a un hdte précis,” and (D.) “Les Amanites

cocardées européennes.” There are 26 line drawings of anatomical elements,

and thirty-six photographic plates in color were included at the end of the

book. Overly dark photographs and photographs that are off color were not

adjusted prior to publication. The book lacks an index, but does list the taxa

that are treated at greatest length in the table of contents. The authors do not

follow conventions for presenting their lists of material examined in a manner

organized by countries and by administrative subdivisions of those countries;

as a consequence, their information on material examined is very difficult to

read. The present work contains nine new names and one new combination

in Amanita. Six previously named taxa are treated with some detail. Three

names have lectotypes designated, and one name has a neotype designated.

The new taxa are proposed to be added to the 50 or so that the authors estimate

have been previously treated in Europe, based on certain keys authored by M.

Contu. These keys contain a significant number of infraspecific taxa and several

synonyms; hence, the species count in them is closer to 30.

The new species proposed herein (each listed with the country or countries

from which material examined was collected) are A. betulae (France), A.

coryli (France and Spain), A. fulvoides (France, Italy, and Spain), A. schaefferi

(a single locality in France), and A. subfuliginosa (a single Italian locality).

Amanita avellanea is the new combination at species rank. The authors’ A.

ochraceomaculata (which is extremely close to, if not identical with, A. fulva

as it is widely understood in northern Europe) is presented again without

comparison to any truly similar taxa. Among other previously described taxa

treated in part C are A. pachyvolvata and A. simulans. Amanita umbrinolutea

and A. battarrae are treated in part D.

The authors unfortunately follow the approach of the 2004 volume and

abandon both the use of logic and the treatment of complex and informative

morphological characters such as the detailed anatomy of the lamellae. In fact,

I was unable to find a species treatment in the book that mentions bilateral

MycotTaxon 115 Book Reviews ... 527

divergent lamella trama. Demonstrations of novelty are inadequate and

consider only European taxa that bear some macroscopic similarity with

a given proposed taxon. The authors take little advantage of, and make little

comparison to, extant expert literature. In one case, a modern revision of a

taxon that they treat at length (A. umbrinolutea) is included in their bibliography

but cited briefly with regard to a nomenclatural point and is ignored entirely

with regard to its taxonomic content — even though the authors’ description

differs significantly from that of the prior work. When a prior work treats more

characters than do the authors, the authors select from the prior work only the

information that may be placed in one-to-one comparison with components

of their own description and omit mention of the rest. From the work of Bas

in section Vaginatae they cite only his paper on species concepts (Bas 1977).

Sixteen years of relevant publications by Yang and his co-authors are ignored

entirely. In some critical cases, the authors make unjustified assumptions about

the meaning of the work of other amanitologists such as those just cited. For

example, the authors assume that because they have noted that the cells of the

subhymenium in many species of Amanita inflate to one degree or another as

the hymenium matures, that the researchers who describe the subhymenium

and characters of the subhymenium in the development of Amanita taxonomy

must be unaware of this fact and, hence, have been producing ill-informed,

wrong descriptions. As a consequence of the above-cited issues (among other

problems) the descriptions in the reviewed work are very difficult, if not

impossible, to compare with the descriptions that comprise the main body of

morphological study of the Amanitaceae over the last half century.

Spore data in this work cannot be understood by other workers [unless they

were to have access to the original complete sets of raw spore measurement data]

because, despite including the table from (Bas 1969) relating length/breadth

ratio (Q) ranges to qualitative terms for spore shape, the authors almost always

provide ranges for Q that include values less than 1.0. Hence, their average Q

values are meaningless.

Thorough type revisions will be necessary in order to give meaning to every

name proposed in this work. All type collections are retained in personal

herbaria, as was often the practice in the case of taxa treated in Neville and

Poumarat (2004). I have inquired of Prof. Poumarat concerning the location

of materials revised for the present work as well as the 2004 volume. He kindly

informed me that all the materials of Neville’s herbarium have now been

transferred to Prof. Poumarat’s herbarium, and he is considering where to

deposit them in the future. Great effort has been expended on assembling and

determining the material in the combined herbaria of Neville and Poumarat;

it will be important that the material be well preserved and to know where the

exsiccata can be found.

528 ... Vellinga, BOOK REVIEW EDITOR

The authors’ reasoning in attempting to replace the use of anatomy with

supposed single-tree-genus associations in the diagnoses of their species

is circular. It only means that someone other than the authors must do the

anatomical revision to support the species and create a sufficiently detailed

species concept so that hypotheses concerning plant association, for example,

can become meaningful.

Poor methodology and lack of anatomical character data lead to difficult

situations of which there is a prime example in this book. “Species A’ is defined

by a limited set of anatomical details and the fact that “species A” is associated

with a certain tree genus or genera, let’s call the associates collectively “T” It

happens that many examples of “species A’ have been collected over a number

of years around a single specimen belonging to the T group. It is assumed

that all the specimens (being macroscopically similar and, apparently, sharing

the limited set of microscopic characters used) are all one species. Moreover,

it is assumed without justification that all the basidiomes are produced by a

single mycelium. One set of the few available anatomical characters (spore

size and shape) varies considerably from one collection to another of “species

A? A chart is offered showing a distribution of the average length/width ratio

(the quantitative rendering of “shape”) that is far from a normal distribution

and strongly suggests to me the presence of more than one taxon in the set

of collections. Because the anatomical information has been intentionally

limited in favor of ecological association information and because of the cited

unjustified assumptions related to ecological association, the possibility that

multiple species may be involved is not considered.

This book is nomenclaturally significant. It also brings to light opinion and

information from some southern European publications that are not easily

accessible elsewhere. It should be in libraries for the use of those interested in

revising the taxa discussed and proposed in it.

Bas C. 1969. Morphology and subdivision of Amanita and a monograph of its section

Lepidella. Persoonia 5: 285-579.

Bas C. 1977 [“1976”]. Species concept in Amanita section Vaginatae in H. Clémengon

(ed). The species concept in Hymenomycetes. Bibliotheca Mycologica 61: 79-

103.

Corner EJH, Bas C. 1962. The genus Amanita in Singapore and Malaya. Persoonia

2: 241-304.

Neville P, Poumarat S. 2004. Amaniteae. 1. Fungi Europaei 9. Edizione Candusso.

Yang ZL. 1997. Die Amanita-Arten von Siidwestchina. Bibliotheca Mycologica 170: i-ii,

1-240.

RopuaM E. TuLLoss

P.O. Box 57, Roosevelt, NJ 08555-0057, USA

MycoTaxon 115 Book Reviews ... 529

Stereoid fungi of America. By L. Ryvarden, 2010. Synopsis Fungorum, P.O.Box

95, Blindern, 0314 Oslo, Norway. <leifryvarden@bio.uio.no>. Pp. 202, figs 65.

[SyNopsis FUNGORUM vol. 28] Price: NOK 280.

Stereum s.l. By A.L. Welden, 2010. New York Botanical Garden Press, Bronx, New

York, NY 10458-5126, USA; <www.nybgpress.org>. Pp. 79, figs. [FLORA NEOTROPICA

MonoGraPH 106] ISBN 0893275042. Price: $ 38.00.

In the previous installment of this journal’s BookREvVIEWs (MycoTAXon 114:

490), David Hawksworth, in noting the paucity of identification keys in a recent

collection of systematic revisions of Dothideomycetes, stated: “Mycologists with

access to superbly equipped and resourced molecular laboratories, supported

by skilled technicians, should not forget that they represent a privileged section

of the potential user-community of systematic works.” If strictly phylogenetic

studies lacking morphological information (noting that not all of the chapters

in the aforementioned collection fit this description) represent one end of a

“utility vs. phylogenetic purity” spectrum, the other must consist of studies that

eschew monophyly entirely to facilitate identification of superficially similar

taxa. Two recent treatments of stereoid fungi of the Americas inhabit the latter

niche.

In thinking of the stereoid fungi (Stereum s.1.), one may be reminded of

former U.S. Supreme Court Justice Potter Stewart’s famous statement about

pornography: “I know it when I see it”” Beyond this initial recognition, however,

the task of identification is considerably more complicated. The characters

uniting the stereoid fungi are quite general ones — effused-reflexed or pileate

basidiomata with a smooth or nearly smooth hymenophore and hyaline,

usually smooth, basidiospores — and further examination reveals a significant

amount of anatomical and micromorphological diversity. Given the dearth of

accessible sources for identification of stereoid fungi, a central starting point for

taxonomic navigation seems justified. The two volumes reviewed here provide

such resources, and in so doing take a decidedly non-phylogenetic approach: a

total of 37 genera representing 18 families and 6 orders (according to current

INDEX FUNGORUM taxonomy) are covered.

The volume by Arthur L. Welden (Tulane University, emeritus), the 106" in

the Flora Neotropica series of monographs, covers 13 stereoid genera having

species in the Neotropics. The author provides a detailed methods section

(including formulae for all macrochemical reagents employed in the study),

a discussion of the phylogenetic affinity of each genus, a synoptic definition

of Stereum s.l. (the author employs this definition with some skepticism, but

it is nonetheless welcome to the reader in defining the limits of the entity to

be discussed), a key to genera, keys to Neotropical species of Coralloderma,

Stereopsis, Cotylidia, Hydnopolyporus, Cymatoderma, Podoscypha, Cystostereum,

530 ... Vellinga, BOOK REVIEW EDITOR

Stereum, and Lopharia s.1., and descriptions of species. The volume is illustrated

by 13 line drawings and 6 distribution maps; the former generally include

macroscopic habit as well as micromorphological sketches. The section on

phylogenetic affinities includes an extended discussion of Cymatoderma and

Podoscypha (together accounting for just over half of the known Neotropical

Stereum s.1.), including detailed discussions of major characters and a

tabular species-level comparison of character state distributions. Taxonomic

novelties presented in this volume include 7 new combinations and one status

reassignment. This handsome and carefully prepared volume reflects a very

high level of scholarship, clearly drawn from both extensive fieldwork and a

thorough knowledge of the literature regarding stereoid fungi.

The volume by Leif Ryvarden (University of Oslo) is intended to be a

compilation of available information to aid in the identification of stereoid fungi

— especially in the Neotropics — rather than a monographic study, though

one new species and 2 new combinations are proposed. Thirty-six genera are

included. The larger number of genera compared to the Welden volume is a

function of broader geographic and taxonomic coverage (temperate as well as

tropical America, and taxa with ornamented and smooth spores, are included);

in other cases it is due to differences in delimitation of genera — for example,

Hjortstamiaand Porostereumare retained withinamore heterogeneous Lopharia,

Aleurocystis magnispora is treated in Stereum, and Cyphellostereum pusiolum is

treated within Cotylidia by Welden. ‘The text provides summary information for

each genus (original citation, brief descriptive synopsis, type species data, and

remarks) and descriptions of each of the treated species, and is accompanied

bya key to genera (albeit incomplete; see below), 22 keys to species, and 75 line

drawings of micromorphological features and in some cases basidiome habit.

Some of the illustrations are provided by the author; others are reprinted from

Corticiaceae of North Europe. There are several typographic errors, including

a misspelling of Licrostroma in the table of contents, discrepancy between

the number of included genera on the back cover (35) vs. table of contents

(36), and reprinted figures that retain internal references to additional figures

from the original text. The first printing lacked the second part (Key B) of the

key to genera, but this problem was corrected in later printings. Despite a few

such errors, this is an excellent volume that compiles an impressive amount of

information, and the identification tools and remarks presented here will prove

valuable to not only those mycologists working in the Americas but on stereoid

fungi in other parts of the world as well.

Both Welden and Ryvarden have opted to present polyphyletic assemblages

of taxa in hopes of providing mycologists in tropical America as well as

students and non-specialists with a central starting point from which to

identify a wide variety of these superficially similar fungi. While this approach

MycoTaxon 115 Book Reviews ... 531

is completely justified given the need for accessible, comprehensive, and up-to-

date taxonomic literature, its ability to provide a catalyst for further, detailed

scientific study of particular monophyletic subgroups is diminished by the lack

of a clear phylogenetic context. Welden’s discussion on “The interrelationships

of the genera of Stereum sl” bridges this gap to a large degree, but the

interested researcher will need to consult a wider variety of sources in order

to understand the broader evolutionary picture for these organisms. Assuming

that mycologists with access to molecular laboratory facilities also have access

to suitable electronic reference materials, and given the greater ability for

electronic databases such as INDEx FUNGORUM and MycoBANK to keep up

with rapidly changing systematic classifications compared to print sources, the

approach taken by both authors seems to be the right one. Both of the volumes

reviewed here will be valuable references for workers with an interest in further

sorting out taxonomic issues within the stereoid fungi and/or identifying

stereoid fungi in the Americas.

Topp W. OsMUNDSON

Berkeley Natural History Museums and

Department of Environmental Science, Policy, & Management,

University of California, Berkeley, CA, USA

toddo@berkeley.edu

Ferrugens: Diversidade de Uredinales do Parque Nacional do Itatiaia, Brasil.

By M. Salazar Yepes & A. Alves de Carvalho Junior. 2010. Technical Books

Eidtora, Rua Gongalves Dias, 89, 2° andar, Sala 208, Centro Rio de Janeiro RJ CEP

20.050-030, Brazil. <www.tbeditora.com.br>. Pp. 201, figs 36. ISBN: 978-85-61368-

18-0. Price: R$ 70.00.

The Parque Nacional do Itatiaia is the oldest national park in Brazil, and part

of the Atlantic forest, well known for its high biodiversity. It is in the provinces

of Rio de Janeiro and Minas Gerais, and covers the higher altitudes (above 500

m asl). This is the area where the two authors have inventoried the rust fungi.

Almost one third ofall the species known for Brazil so far (Hennen et al. 2005) is

present in the park, 171 species in total. The book starts with short introductions

to the park and its vegetation and to rust fungi, followed by the main part with

the descriptions of the species organized by host plant, Pteridophyta first, then

the Magnoliaphyta with all their families. Colour photos of infected plants

and microscope photos of spores and other important features illustrate the

fungi. As expected, the genus Puccinia is the most species rich with 81 species

(this excludes Uromyces with 26 species). The Asteraceae are the plant family

with the highest number of rust fungi. The book continues with a glossary, a

bibliography, an index to the rust species, and per plant species a list of rust

taxa. The different chapters are clearly colour coded on the pages, making it

very easy to find the different subjects.

532 ... Vellinga, BOOK REVIEW EDITOR

‘This is the first book of this kind that I have ever seen with colour illustrations

throughout. It is a well-executed, important contribution to the knowledge of

those fascinating plant pathogenic fungi. | would have loved to see more, and

bigger pictures of the infected plants, and family names as page headers, but

these are just two minor comments. Even though it is written in Portuguese,

the text and descriptions are quite accessible and understandable. All in all a

very nice, well-executed contribution to our knowledge of an important fungal

group.

Hennen JF, Figueiredo MB, de Carvalho AA Jr, Hennen PG, 2005. Catalogue of the

species of plant rust fungi (Uredinales) of Brazil. 490 pp. <www.jbrj.gov.br/>

CHECKLIST

List of fungi recorded in Japan. By Ken Katumoto. 2010. The Kanto Branch of the

Mycological Society of Japan. (Contact: Toru Okuda <torula@lab.tamagawa.ac.jp>.)

North American distributor: Mycotaxon Ltd., P.O. Box 264, Ithaca, NY 14851-0264,

USA. <info@mycotaxon.com>. Pp. xv + 1177. Softcover ed. ISBN 978-4-87974-624-

5. Price (US) $130, postpaid. Hardcover ed. ISBN 978-4-87974-625-2. Price (US)

$220, postpaid. Canada and Mexico delivery add US$25 for postage.

Access to this monumental work is essential for any taxonomist who works with

collections from Japan. Itis indisputably the most comprehensive floristic listing

that I have ever encountered. 1067 pages are, throughout, in small typeface,

alphabetically listing all species by alphabetically ordered generic name, with

the most current familial placement shown for each taxon. The correct names

and authors are all provided with their places of publication in Roman typeface.

Locations of holotypes and isotypes are noted carefully. Anamorphs where

known are clearly identified, allowing quick cross-referencing. Teleomorphs

are similarly cross- referenced to their anamorph names. Nomina rejicienda

under the International Code of Botanical Nomenclature are clearly marked as

such. Even more important, all misapplications are shown as “sensu” a Japanese

author or authors, and crossed referenced to those names. Allin all, a goldmine

of information.

The volume weighs in at almost 4 1/2 pounds in paperback and over

5 pounds in hardcover, and may to some of us be worth its weight in gold.

Though few individuals will be willing to pay the price for a personal copy, the

serious taxonomists among us should do all they can to get their library to buy

a copy. Borrowing a copy on interlibrary loan is scarcely the solution when time

and time again you'll want to consult this.

With all its excellent features, this book has some drawbacks for the non-

Japanese reader. Host names are given by Japanese common name only, and

these in kanji. Common names in kanji are also applied to most accepted

MycoTaxon 115 Book Reviews ... 533

species for Japan. For non-kanji readers, the two indices to Japanese names

of fungi and Japanese names of hosts will prove useless. And, to my mind, the

most serious fault for the non-kanji reader is that later references to each species

are provided, but only non-Japanese journals have these references in Roman

typeface. All Japanese journal names, except for original publication of a name,

are strangely rendered only in kanji. One sees three, four, five or more kanji

characters followed by, for example, 26:65, 1975., leaving the non-Japanese

reader wondering which journal that is. I’m sure our Japanese colleagues will

be frequently emailed to translate such journal titles into Roman characters. |

have suggested to the publishers that they could add a helpful slip-in sheet with

the translations of the names of Japanese journals into Roman typeface.

RICHARD P. Kore

Plant Pathology Herbariumm, Cornell University, Ithaca, NY 14853, USA

Book ANNOUNCEMENTS

Atlas des Cortinaires Vol. 19. By A. Bidaud, P. Moénne-Loccoz, P. Reumaux et X.

Carteret. 2010. Sarl Editions FMDS, 2436 route de Brailles, 38510 Vézeronce-Curtin,

France. <esperance.bidaud@wanadoo.fr>. Loose leafed in folder. Pp. 131, pl. 64.

Price around € 148.00.

Flora Slovenska Volume 10:2: Mycota (Huby), Ascomycota (Vreckatem huby).

Taphrinales: Protomycetaceae, Taphrinaceae. 2010. Edicia Flora Slovenska, Slovakia.

<www.elegenda.sk>. Pp. 184, pl. 6, figs. ISBN: 978-80-224-1096-0. Price € 11.00.

MYCOTAXON

Volume 115, pp. 534-536 January-March 2011

DOI: 10.5248/111.534

Regional annotated mycobiotas new to www.mycotaxon.com

Mycortaxon is pleased to announce the addition of six new species distribution lists to our

“web-list” page at www.mycotaxon.com//resources/weblists.html, where over 70 checklist

PDFs are available for free download. The content and design of each list is the sole

responsibility of its authors and their three (or more) expert reviewers, after which those

meeting MycorTaxon’s scientific and nomenclatural criteria are accepted for posting. The

authors, titles, and abstracts of our most recently accepted web-lists are provided below.

CENTRAL AMERICA

Nicaragua

Delgado, Gregorio. Nicaraguan fungi: a checklist of hyphomycetes. 31 pp.

ApsTract— A checklist of hyphomycetes (anamorphic fungi) known from

Nicaragua is presented. A total of 194 taxa belonging to 70 genera are listed, including

25 determined only to generic level, 156 to specific level and 13 infraspecific taxa.

They were compiled from scattered records in the literature, the online databases of

the world’s major culture collections and fungal herbaria, and sporadic collections of

plant debris samples carried out in the departments of Managua and Leén in 2008.

14 saprobic genera, 19 species and one forma are recorded for the first time from

Nicaragua. A host and substrate index is also provided, including 99 host plants

belonging to 30 families and 16 host insects belonging to 4 orders. A brief approach

to the history of mycology in the country is presented.

Panama

Piepenbring, Meike, José Camarena, Dario Cruz, Ana Karina Gémez, Yuriza

Guerrero, Tina Antje Hofmann, Roland Kirschner, Mavis de Matas, Loraine

Perez, Délfida Rodriguez, José Ureta, Ivette Vargas & Carl Williams. New

records of fungi pathogenic on cultivated plants in Panama. 11 pp.

ApsTRACT— Knowledge about the geographical distribution of species of

plant pathogenic fungi is fundamental for epidemiology, decision making and

recommendations for their control. For many tropical countries like Panama,

however, checklists are still very incomplete. In the present publication, 20 species of

pathogenic fungi on cultivated plants are cited, with 13 of them and one hyperparasitic

fungus reported for the first time for Panama, mainly in the province of Chiriqui

in the western part of the country. Among these are several rarely reported species:

WEBLISTS NEW TO Mycotaxon ... 535

Asterinella puiggarii on Psidium guajava; Entyloma doebbeleri on Dahlia sp., which is

reported for the first time outside Costa Rica; Mycosphaerella agapanthi-umbellati on

Agapanthus sp., which is recorded for the first time for America; Passalora vanderystii

on Phaseolus vulgaris; and Ustilago affinis on Stenotaphrum secundatum.

SOUTH AMERICA

Brazil

Gumboski, Emerson Luiz & Sionara Eliasaro. Checklist of lichenized fungi of

Santa Catarina State (Brazil). 45 pp.

ABSTRACT— Based on the evaluation of available literature, a list of 355 lichenized

fungi species recorded from Santa Catarina State, Brazil is presented. These species

are distributed among 109 genera and 45 families. Parmeliaceae and Cladoniaceae are

the most diverse families with 69 and 41 species, respectively.

EUROPE

Greece

Polemis, Elias, Dimitris M. Dimou, Leonidas Pountzas, Dimitris Tzanoudakis &

Georgios I. Zervakis. Mycodiversity studies in selected ecosystems of

Greece: 5. Basidiomycetes associated with woods dominated by Castanea

sativa (Nafpactia Mts., central Greece). 16 pp.

ABSTRACT— Very scarce literature data are available on the macrofungi associated

with sweet chestnut trees (Castanea sativa, Fagaceae). We report here the results of

an inventory of basidiomycetes, which was undertaken in the region of Nafpactia

Mts., central Greece. The investigated area, with woods dominated by C. sativa, was

examined for the first time in respect to its mycodiversity. One hundred and four

species belonging in 54 genera were recorded. Fifteen species (Conocybe pseudocrispa,

Entoloma nitens, Lactarius glaucescens, Lichenomphalia velutina, Parasola schroeteri,

Pholiotina coprophila, Russula alutacea, R. azurea, R. pseudoaeruginea, R. pungens, R.

vitellina, Sarcodon glaucopus, Tomentella badia, T. fibrosa and Tubulicrinis sororius)

are reported for the first time from Greece. In addition, 33 species constitute new

habitats/hosts/substrates records.

Italy

Rizzi, Guido, Guido Incerti, Fabrizio Ginaldi, Danijela Kodnik, Serena Viglione

& Paolo Giordani. A contribution to the lichen flora of Sardinia. 27 pages.

AsstTracT— A contribution to the epilithic and epiphytic lichen flora of Sardinia

is presented. Seventy localities from both coastal and mountain areas of western

Sardinia have been investigated during four surveys from 2006 to 2008. In all, 390

taxa have been recorded. Three taxa are new to Italy (Allarthonia hypobela, Bacidia

biatorina, Catillaria subviridis); 25 taxa are new to Sardinia. Pannaria rubiginosa

and Melaspilea ochrothalamia were re-collected after one century. Distribution and

substrata are presented.

536 ... Mycotaxon 115

Mip-EAst

Turkey

Tufan-Cetin, Ozge & Hiiseyin Stimbiil. Lichens of the Képriilti Canyon National

Park in Turkey. 25 pp.

AssTRACT— ‘This is the first comprehensive survey on lichens of the Kopriilii Canyon

National Park. Totally 1266 lichen samples were collected during the field studies

between June 2006 and August 2008 in K6priilii Canyon National Park. 217 lichen

taxa which belong to 8 orders, 28 families and 76 genera were determined from the

research area. Of the determined lichens 203 taxa were recorded for the first time

in the national park. In addition 67 taxa are new records for Antalya and 7 taxa for

Turkey.

MYCOTAXON

Volume 115, pp. 537-539 January-March 2011

DOT: 10.5248/111.537

NOMENCLATURAL NOVELTIES AND TYPIFICATIONS

PROPOSED IN MYCOTAXON 115

Acaulospora soloidea Vaingankar & B.F. Rodrigues, p. 324

Anthracoidea blepharicarpae Denchev, T. Denchev & Kakish., p. 408

Anthracoidea dispalatae Denchev, T. Denchev & Kakish., p. 410

Aspicilia albosparsa (Werner) S.Y. Kondr. 2002 (lectotypified), p. 264

Aspicilia subfarinosa (J. Steiner) Senkard. & Sohrabi, p. 101

Asteromella nyssae (Cooke) Aa 2002 (lectotypified), p. 317

Calocera bambusicola Sheng H. Wu, p. 165

Chaetomium siamense Pornsuriya & Soytong, p. 21

Ciliochorella buxifoliae Alleg., Eliades & Aramb., p. 179

Coprinopsis neophlyctidospora Raut, Fukiharu & A. Suzuki, p. 230

Crepidotus flavus Capelari, p. 146

Crepidotus longicystidiatus Capelari, p. 150

Gloeocantharellus dingleyae (Segedin) Giachini, p. 187

Gloeocantharellus mamorensis (Singer) Giachini, p. 188

Gloeocantharellus novae-zelandiae (Segedin) Giachini, p. 188

Gloeocantharellus pallidus (Yasuda) Giachini, p. 188

Graphis elevativerrucosa Chitale, Makhija & B.O. Sharma, p. 470

Graphis maharashtrana Chitale, Makhija & B.O. Sharma, p. 472

Graphis panhalensis (Patw. & C.R. Kulk.) Chitale, Makhija & B.O. Sharma, p. 474

Hymenochaete acerosa S.H. He & Hai J. Li, p. 379

Hymenochaete megaspora S.H. He & Hai J. Li, p. 376

Hyphodiscus stereicola Raitv., Partel & K. Példmaa, p. 12

Hypogymnia irregularis McCune, p. 486

Koorchaloma scutiae Alleg., Eliades & Aramb., p. 176

Lecanora farinosa f. subopegraphoides Werner 1956 (lectotypified), p. 101

Lecanora subfarinosa J. Steiner 1921 (lectotypified), p. 101

Lyophyllum fuscobrunneum Dahncke, Contu & Vizzini, p. 66

Lyophyllum impudicum Dahncke, Contu & Vizzini, p. 68

538 ... MYCOTAXON 115

Marasmius galbinus T.H. Li & Chun Y. Deng, p. 496

Mortierellomycotina Kerst. Hoffm., K. Voigt & P.M. Kirk, p. 360

Mycosphaerella nyssicola (Cooke) EA. Wolf 1940 (lectotypified, epitypified), p. 315

Nephroma flavorhizinatum Q. Tian & H.Y. Wang, p. 282

Nohea delmarensis (Kohlm. & Volkm.-Kohlm.) Abdel-Wahab, p. 448

Nohea spinibarbata (J. Koch) Abdel-Wahab, p. 448

Ophiocordyceps laojunshanensis J.Y. Chen, Y.Q. Cao & D.R. Yang, p. 2

Paecilomyces wawuensis Jin He, J.C. Kang & B.X. Lei, p. 305

Paraconiothyrium babiogorense Budziszewska, p. 463

Parmotrema conidioarcuatum Marcelli, Benatti & Elix, p. 74

Parmotrema pycnidiocarpum Benatti, Marcelli & Elix, p. 77

Phaeoclavulina abietina (Pers.) Giachini, p. 189

Phaeoclavulina africana (R.H. Petersen) Giachini, p. 189

Phaeoclavulina angustata (Lév.) Giachini, p. 189

Phaeoclavulina apiahyna (Speg.) Giachini, p. 189

Phaeoclavulina argentea (R.H. Petersen) Giachini, p. 189

Phaeoclavulina articulotela (R.H. Petersen) Giachini, p. 190

Phaeoclavulina camellia (Corner) Giachini, p. 190

Phaeoclavulina campestris (K. Yokoy. & Sagara) Giachini, p. 190

Phaeoclavulina campoi (Speg.) Giachini, p. 190

Phaeoclavulina capucina (Pat.) Giachini, p. 190

Phaeoclavulina cervicornis (A.L. Sm.) Giachini, p. 190

Phaeoclavulina clavarioides (Schild) Giachini, p. 190

Phaeoclavulina cokeri (R.H. Petersen) Giachini, p. 190

Phaeoclavulina curta (Fr.) Giachini, p. 190

Phaeoclavulina cyanocephala (Berk. & M.A. Curtis) Giachini, p. 191

Phaeoclavulina decolor (Berk. & M.A. Curtis) Giachini, p. 191

Phaeoclavulina echinovirens (Corner, K.S. Thind & Dev) Giachini, p. 191

Phaeoclavulina eumorpha (P. Karst.) Giachini, p. 191

Phaeoclavulina flaccida (Fr.) Giachini, p. 192

Phaeoclavulina gigantea (Pat.) Giachini, p 193

Phaeoclavulina glauco-aromatica (R.H. Petersen) Giachini, p. 193

Phaeoclavulina grandis (Corner) Giachini, p. 193

Phaeoclavulina griseobrunnea (Singer) Giachini, p. 193

Phaeoclavulina guadelupensis (Pat.) Giachini, p. 193

Phaeoclavulina guyanensis (Pat.) Giachini, p. 193

Phaeoclavulina insignis (Pat.) Giachini, p. 193

Phaeoclavulina longicaulis (Peck) Giachini, p. 193

NOMENCLATURAL NOVELTIES & TYPIFICATIONS ...

Phaeoclavulina mutabilis (Schild & R.H. Petersen) Giachini, p. 194

Phaeoclavulina ochracea (Bres.) Giachini, p. 194

Phaeoclavulina pancaribbea (R.H. Petersen) Giachini, p.194

Phaeoclavulina quercus-ilicis (Schild) Giachini, p. 194

Phaeoclavulina retispora (Corner) Giachini, p. 194

Phaeoclavulina roellinii (Schild) Giachini, p. 194

Phaeoclavulina sikkimia (S.S. Rattan & Khurana) Giachini, p. 194

Phaeoclavulina subclaviformis (Berk.) Giachini, p. 195

Phaeoclavulina tropicalis (R.H. Petersen) Giachini, p. 195

Phaeoclavulina vinaceipes (Schild) Giachini, p. 195

Phaeoclavulina viridis (Pat.) Giachini, p. 195

Phaeoclavulina zealandica (R.H. Petersen) Giachini, p. 195

Phialophora microspora Y.M. Wu & TY. Zhang, p. 251

Phialophora nielamuensis Y.M. Wu & T-Y. Zhang, p. 253

Phlebiopsis mussooriensis Priyanka, Dhingra & N. Kaur, p. 255

Phyllactinia sebastianiae M.G. Cabrera & Vobis, p. 55

Phyllopsora catervisorediata G.K. Mishra, Upreti & Nayaka, p. 33

Phyllopsora corallina var. subglaucella G.K. Mishra, Upreti & Nayaka, p. 36

Phyllopsora himalayensis G.K. Mishra, Upreti & Nayaka, p. 38

Pilidiella crousii Rajeshkumar, S.K. Singh & Hepat, p. 158

Pilidiella macrospora (Aa) Crous & Van Niekerk, p. 161

Protoparmeliopsis klauskalbii (Sipman) Senkard., p. 288

Puccinia salihae Kirba& & Aime, p. 502

Pucciniastrum enkianthi Y.M. Liang & Kakish., p. 505

= Pucciniastrum hakkodaense Y.M. Liang & Kakish. 2005

non P hakkodense (S. Ito & Hirats. f.) Jorst. 1958

Pyxine jolyana Marcelli, Jungbluth & Kalb, p. 436

Septobasidium sichuanense S.Z. Chen & L. Guo, p. 481

Stachybotrys subreniformis Q.R. Li & Y.L. Jiang, p. 171

Stachybotrys thaxteri D.W. Li, p. 240

Strobilomyces annamiticus Pat. 1909 (lectotypified), p. 415

Tubakia seoraksanensis H.Y. Yun, p 371

Thozetella submersa E.R. Barbosa & Gusmao, p. 328

Turbinellus flabellatus (Berk.) Giachini, p. 196

Turbinellus fujisanensis (S. Imai) Giachini, p. 197

Turbinellus kauffmanii (A.H. Sm.) Giachini, p. 197

Turbinellus stereoides (Corner) Giachini, p.197

539