IV ... MYCOTAXON 122

MYCOTAXON

VOLUME ONE HUNDRED TWENTY-TWO — TABLE OF CONTENTS

COVER SECTION

TEAL ep Resse ep Recah cae Wade yg de ERe tn age MR ee BOP ales 'y ota po Wet tbe viii

Ee VTOMVCT Stara rrtloy anes onc tor BMD ted Here ewe enEM eS PRD, ey 0 TED beg pm, BCE Telerik oly ete ix

SUDHTISSION-PTOCCUATCS. ori 0 bey cts Bb bes lem lec neay Sie fea e ame ee x

bay Oye SAAC od Oe LLC) pag RY ARG AP CIRO AO AIS ea Aan TAN I TR a xi

RESEARCH ARTICLES

Hypoxylon from China - 2: H. dengii sp. nov. and H. crocopeplum

new to China Hai-xia Ma, Larissa Vasilyeva & Yu Li

Corticioid basidiomycetes on the bark of living trees

from Porto Alegre, Brazil

César Luiz M. Rodriguest & Rosa T. Guerrerot

Hymenoscyphus pseudoalbidus, the correct name for Lambertella albida

reported from Japan Yan-Jie Zhao, Tsuyoshi Hosoya, Hans-Otto Baral,

Kentaro Hosaka & Makoto Kakishima

New records of Scleroderma (Sclerodermataceae, Agaricomycetes)

from Pakistan N. Yousaf, A.N. Khalid & A.R. Niazi

Aphyllophoroid fungi from Sonora, México 2. New records from

Sierra of Alamos-Rio Cuchujaqui Biosphere Reserve Ricardo Valenzuela,

Tania Raymundo, Cony Decock & Martin Esqueda

Passalora acrocomiae sp. nov. and Exosporium acrocomiae from

the palm Acrocomia aculeata in Puerto Rico Eduardo Guatimosim,

Henrique Jorge Pinto & Robert Weingart Barreto

A new Stigmella species associated with Lycium leaf spots

in northwestern China Yan Wang, Xiu-Rong Chen & Cheng-De Yang

Tuber sinoaestivum sp. nov, an edible truffle from southwestern China

Jie-Ping Zhang, Pei-Gui Liu & Juan Chen

Two new Ellisembia species from Hainan and Yunnan, China

Shou-Cai Ren, Jian Ma & Xiu-Guo Zhang

Lichenized and lichenicolous fungi new to Babia Gora National Park

(Poland, Western Carpathians) Pawel Czarnota & Michal Wegrzyn

Resupinate polypores from mixed ombrophilous forests in southern Brazil

Mauro C. Westphalen & Rosa Mara Borges da Silveira 111

Coltricia australica sp. nov. (Hymenochaetales, Basidiomycota)

from Australia Li-Wei Zhou & Leho Tedersoo 123

OCTOBER-—DECEMBER 2012... V

Four new rust taxa on Asteraceae from Central Alborz,

northern Iran Faezeh Aliabadi & Mehrdad Abbasi 129

Microfungi from Portugal: Minimelanolocus manifestus sp. nov.

and Vermiculariopsiella pediculata comb. nov.

Margarita Hernandez-Restrepo, Rafael FE Castafieda-Ruiz,

Josepa Gené, Josep Guarro, David W. Minter & Marc Stadler 135

Geastrum species of the La Rioja province, Argentina Francisco Kuhar,

Valeria Castiglia & Leandro Papinutti 145

Myxomycetes from China 16: Arcyodes incarnata and Licea retiformis

newly recorded for China Bo Zhang & Yu Li 157

Tuber microverrucosum and T. huizeanum — two new species with

reticulate ascospores from China Li Fan, Cheng-Lin Hou & Yu Li 161

Three new species of Humicola from the Qinghai-Tibet Plateau Area,

China Yue-Ming Wu & Tian-Yu Zhang 171

A new species of Calonectria causing leaf disease of water lily in China

Jun-Jie Xu, Shao-Yuan Qin, Yuan-Yuan Hao, Jun Ren,

Ping Tan, Ali H. Bahkali, Kevin D. Hyde & Yong Wang 177

Two species of Agaricus sect. Xanthodermatei from Thailand

Rui-Lin Zhao, Dennis E. Desjardin, Philippe Callac,

Luis A. Parra, Jacques Guinberteau, Kasem Soytong,

Samantha Karunarathna, Ying Zhang & Kevin D. Hyde 187

Hymenochaete in China. 4. H. parmastoi sp. nov. and H. ustulata

new to China Shuang-Hui He & Hai-Jiao Li 197

Phylogenetic systematics of the Gigasporales

Gladstone Alves da Silva, Leonor Costa Maia & Fritz Oehl 207

Pleurotus eryngii var. elaeoselini, first record from Romania

Vasilica Claudiu Chinan & Giuseppe Venturella 221

A new species of Hypoderma with periphysoids

Chun-Tao Zheng, Feng Zhou, Ke Li& Ying-Ren Lin 225

Yeast species from soil and fallen leaves new for the mycobiota of Israel

Dmytro M. Gotman, Solomon P. Wasser & Eviatar Nevo 231

A new record of the desert truffle Picoa lefebvrei in Saudi Arabia

Abdulhakim Bawadekji, Maria Letizia Gargano,

Alessandro Saitta & Giuseppe Venturella 243

Coccomyces hubeiensis, a new fungus of Rhytismatales from China

Meng-Shi Yang, Ying-Ren Lin, Lan Zhang & Xiao- Yan Wang 249

A microfungus from Costa Rica: Ticosynnema gen. nov.

Rafael F. Castafieda-Ruiz, Maria M. Granados, Melissa Mardones,

Marc Stadler, David W. Minter, Margarita Hernandez-Restrepo,

Josepa Gené & Josep Guarro 255

VI ... MYCOTAXON 122

First record of Amanita dunensis in Italy

Lorenzo Pecoraro & Dario Lunghini 261

A new species of Scopinella from Pampas grass in Argentina

Romina M. Sanchez, Lucrecia Giordano,

Freda E. Anderson & M. Virginia Bianchinotti 265

Development and morphology of Lysurus cruciatus

(Phallomycetidae, Phallaceae) - an addition to the Indian mycobiota

S. Abrar, S. Swapna & M. Krishnappa 271

New Anthracoidea, Tilletia, and Ustilago records for Turkey

Sanli Kabaktepe & Zeliha Bahcecioglu 283

A new species of Coccomyces (Rhytismatales, Ascomycota)

on Ilex elmerrilliana Shi-Juan Wang, Yan-Ping Tang,

Ke Li & Ying-Ren Lin 287

New Asian records and morphological variation in Fibrodontia brevidens

(Basidiomycota) Eugene Yurchenko & Sheng-Hua Wu 293

Caloplaca gyrophorica (lichenized Ascomycota), a new saxicolous

lichen species from India

Yogesh Joshi, T.A.M. Jagadeesh Ram & G.P. Sinha 303

Seven dark-fruiting lichens of Caloplaca from China

Guo-Li Zhou, Zun-Tian Zhao, Lei Lu,

De-Bao Tong, Min-Min Ma & Hai-Ying Wang 307

Boletus atlanticus sp. nov., a new species of section Luridi from

coastal dunes of NW Spain

Jaime B. Blanco-Dios & Guilhermina Marques 325

An efficient protocol for DNA extraction from Meliolales and

the description of Meliola centellae sp. nov. Danilo B. Pinho,

Andre |. Firmino, Walnir G. Ferreira Jr. & Olinto 1. Pereira 333

Tuber sinosphaerosporum sp. nov. from China

Li Fan, Jin-Zhong Cao & Yu Li 347

Terriera angularis sp. nov. on Illicium simonsii from China

Feng Zhou, Xiao-Yan Wang, Lan Zhang & Ying-Ren Lin 355

A new species of Mycena sect. Sacchariferae from the Iberian

cushion-shaped Genisteae Juan Carlos Zamora & Santiago Catala 361

Myxomycete history and taxonomy:

highlights from the past, present, and future Harold W. Keller 367

Synonymy of Suillus imitatus, the imitator of two species

within the S. caerulescens/ponderosus complex

Nhu H. Nguyen, Jennifer F. Kerekes,

Else C. Vellinga & Thomas D. Bruns 388

OCTOBER-DECEMBER 2012... VII

Phylogenetic relationships and the newly discovered sexual state of

Talaromyces flavovirens, comb. nov.

Cobus M. Visagie, Xavier Llimona, Jordi Vila,

Gerry Louis-Seize & Keith A. Seifert 399

Two interesting cantharelloids from Nan and Kanchanaburi Provinces,

Thailand Sunadda Yomyart, Roy Watling, Cherdchai Phosri,

Jittra Piapukiew & Prakitsin Sihanonth 413

Lichens newly recorded from the South Korean coast

Lu-Lu Zhang, Xin-Yu Wang, Zun-Tian Zhao & Jae-Seoun Hur 421

Polyporus submelanopus sp. nov. (Polyporales, Basidiomycota)

from Northwest China Hui-Jun Xue & Li-Wei Zhou 433

A new species of Clitopilus from southwestern China

Wang-Qiu Deng, Tai-Hui Li & Ya-Heng Shen 443

Arthrinium rasikravindrii sp. nov. from Norway

Shiv M. Singh, Lal S. Yadav, Paras N. Singh,

Rahul Hepat, Rahul Sharma & Sanjay K. Singh 449

New records of Ochrolechia and Placopsis from the

Hengduan Mountains, China Tong-li Gao & Qiang Ren 461

Nomenclatural notes on lichen genera Leucodecton and Myriotrema

(Graphidaceae) in India Santosh Joshi, Dalip K. Upreti & Biju Haridas 467

Three non-hairy species of Leptogium from China

Hua-Jie Liu, Jing Cao, Shuai Guan & Qing-Feng Wu 483

MYCOBIOTAS ONLINE

Checklist of the Argentine Agaricales 5. Agaricaceae

N. Niveiro & E. Alberté 491

NOMENCLATURE

Nomenclatural novelties proposed in volume 122 493

PUBLICATION DATE FOR VOLUME ONE HUNDRED TWENTY-ONE

MYCOTAXON for JuLY-SEPTEMBER, VOLUME 121 (I-x1I + 1-502)

was issued on January 8, 2013

vul ... MYCOTAXON 122

ERRATA FROM PREVIOUS VOLUMES

VOLUME 121

p. V, line 19

p. vu, line 15

p-3, table footnotes

p.5, footnote line 2

p.7, Fic. 1 legend, line 3

p.10, line 2"¢ from bottom

p.17, line 26

p.199, line 3

p.233, lines 21 & 33

p-238, line 4

p-268, line 6

p. 394, line 16

p-409, line 9

: Ling-ming He,

: nephrosteranic

FOR: hymenodermioid

For: Alnus incana

: LING-MING HE,

: Henkel et al. 2011

FOR: (Smith et al. 2011)).

FOR: Leucoagaricus cretaceus

FOR: recognized seven genera

FOR: columbiana

READ:

Ling-min He,

nephrosterinic

basidiomata

hymenodermoid

section).

Alnus incana

IB19980446

LING-MIN HE,

Henkel et al. 2012

(Smith et al. 2011).

Leucocoprinus cretaceus

recognized eight genera

colombiana

OCTOBER-DECEMBER 2012... IX

REVIEWERS — VOLUME ONE HUNDRED TWENTY-TWO

The Editors express their appreciation to the following individuals who have,

prior to acceptance for publication, reviewed one or more of the papers

prepared for this volume.

Vagn Alstrup

Vladimir Antonin

André Aptroot

Arne Aronsen

Boris Assyov

Juliano M. Baltazar

Timothy J. Baroni

Scott T. Bates

Peter Buchanan

Gregory Bonito

Dimitar Bojantchev

Uwe Braun

Mehmet Candan

Rafael F. Castafieda Ruiz

Vagner Gularte Cortez

Bao-Kai Cui

Cvetomir M. Denchev

Maria Martha Dios

Pradeep K. Divakar

Uno H. Eliasson

Sydney Everhart

Genevieve M. Gates

Zai-Wei Ge

Sergio P. Gorjon

Ying-Lan Guo

Shou- Yu Guo

Anna Guttova

Laura Guzman-Davalos

Ian Robert Hall

Shuang-Hui He

Antonio Hernandez-

Gutiérrez

Ottmar Holdenrieder

Virupakshagouda

Hosagoudar

Kentaro Hosaka

Jae-Seoun Hur

Bryce Kendrick

Sergey Kondratyuk

Martin Kukwa

Deepika Kumari

Richard P. Korf

De-Wei Li

Taihui Li

Xiao- Yong Liu

Laszlo Lék6s

Clarice Loguercio-Leite

Guozhong Lit

Maria P. Martin

Eric H.C. McKenzie

David W. Minter

Gabriel Moreno

Maria Alice Neves

Lorelei L. Norvell

Silvano Onofri

Beatriz Ortiz-Santana

Shaun R. Pennycook

Stephen W. Peterson

Orlando F. Popoff

Relf L. Price

Mario Rajchenberg

Eimy Rivas Plata

Giovanni Robich

Amy Y. Rossman

Rob Samson

Conrad Schoch

Dartanha J. Soares

Viacheslav Spirin

Larissa Trierveiler-Pereira

Andriy Sibirny

Ewald Sieverding

Kotzue Sotome

Alberto M. Stchigel

Giuseppe Venturella

Annemieke Verbeken

Paul A. Volz

John Walker

Xiang-Hua Wang

Felipe Wartchow

A.J.S. Whalley

Zhu-Liang Yang

Ming Ye

Bayram Yildiz

Hai-Sheng Yuan

Alessandra Zambonelli

Georgios I. Zervakis

Xiu-Guo Zhang

Zun-Tian Zhao

x ... MYCOTAXON 122

FOUR EASY STEPS TO SUCCESSFUL MYCOTAXON PUBLICATION IN 2013

Prospective Mycoraxon authors should download instructions PDF, review and

submission forms, and other helpful templates by clicking the ‘file download page’ link

on our INSTRUCTIONS TO AUTHORS page before preparing their manuscript. Below is a

summary of our “4-step’ publication process.

1—PEER REVIEW: Email formatted text and illustration files with a2013 MycoTaxon

Reviewer Comments Form to 2-3 experts for peer review. Authors should (i) ask

peer reviewers to return revisions and comment forms to BOTH authors and Editor-

in-Chief <editor@mycotaxon.com> and (ii) revise the files according to reviewer

suggestions before sending text files to the Nomenclature Editor for nomenclatural

review.

2—NOMENCLATURAL REVIEW: Email text files (wiTH tables & captions but No

artwork) to the Nomenclature Editor <PennycookS@LandcareResearch.co.nz>

for accession and pre-submission review. The Email message MUST include

‘Mycotaxon’ on the subject line AND all peer reviewer names+Email addresses in

the message. The Nomenclature Editor will assign accession numbers and return

annotated files with a list of needed corrections to the authors and Editor-in-Chief.

3—FINAL SUBMISSION: After again consulting experts and revising manuscripts as

needed, send the (i) completed 2013 MycoTaxon submission form; (ii) separate

text files for main text, tables, and legends; and (iii) art files to the Editor-in-Chief

<editor@mycotaxon.com>. Only text and image files prepared for immediate

publication should be sent at this time. The Editor-in-Chief usually acknowledges

manuscripts and thanks expert reviewers within two weeks, but please wait at

least 14 days before sending a follow-up query (without attachments); this helps

us keep Email traffic to a minimum during Mycotaxon publication deadlines or

temporary closures of the editorial office.

4—FINAL EDITORIAL REVIEW & PRESS PREPARATION: Files not ready for publication

will be rejected or returned to authors for further revision; the Editor-in-Chief gives

tentatvely approved manuscripts a final grammatical and scientific review before

converting all files into publishable format. The PDF proof, bibliographic citation,

and nomenclatural entries are sent to all coauthors for final inspection prior to

publication. After PDF conversion, the Editor-in-Chief corrects only processing or

editorial errors prior to publication, but corrections of author errors are listed in

the Errata of a subsequent volume for no charge. If authors have selected the open

access option, they are asked to arrange payment of page charges with the Business

Manager <subscriptions@mycotaxon.com> at this time.

MyYcoTAXxON LTD— www.mycotaxon.com

The Mycotaxon Webmaster <mycotaxon@gmail.com> posts general and

subscription information, important announcements, and author forms and templates

on the official MycoTaxon site, which also hosts the regional mycobiota webpage for

free download of distributional annotated species lists.

MYCOTAXON ONLINE— www.ingentaconnect.com/content/mtax/mt

Mycotaxon publishes four 500-page volumes a year. Both open access and

subscription articles are offered.

OCTOBER-DECEMBER 2012... XI

FROM THE EDITOR-IN-CHIEF

MycoTaxon 122 — Closing our ‘book’ on 2012, the October-December

volume proposes one new genus (Ticosynnema) from Costa Rica and names

species new to science representing Agaricus from Thailand; Arthrinium from

Norway; Boletus, Minimelanolocus, and Mycena from Portugal and Spain,

Calonectria, Clitopilus, Coccomyces, Ellisembia, Humicola, Hymenochaete,

Hypoderma, Hypoxylon, Polyporus, Stigmella, Terriera, and Tuber from China;

Caloplaca from India; Coltricia from Australia; Dendrothele and Meliola from

Brazil; Minimelanolocus from Portugal; Passalora from Puerto Rico; Puccinia

from Iran; and Scopinella from Argentina.

In addition to range extensions of previously named taxa, we also offer

regional monographs (most with keys) on Corticiaceae on living bark

(posthumously published by Rodrigues and Guerrero) and resupinate

polypores in Brazil, Geastrum in Argentina, Leptogium in China, Leucodecton

and Myriotrema in India, and Scleroderma in Pakistan.

One papers multigene phylogenies support a recent morphologically

based reclassification of the Gigasporales. Another explores phylogeny and a

newly discovered sexual state for Talaromyces flavovirens comb. nov. while a

third examines development in Lysurus from egg to fully hatched and a fourth

provides a fascinating review of myxomycetes from fossil to Eppendorf tube.

A special thanks to four UC Berkeley authors who have solved a mystery

that has puzzled this editor for over 30 years: how does one differentiate two

Suillus imitatus varieties, Suillus caerulescens, and S. ponderosus in the field?

Placing the two varieties into synonymy with an explanation of how one might

separate S. caerulescens from S. ponderosus without recourse to DNA work is a

restful and much appreciated outcome indeed!

MyYcoTAXON 123 — Weare pleased to report that the first 2013 volume should

be only slightly delayed. Revisions of final submissions for the next volume will

begin in a few days, and we hope — somewhat optimistically — to publish the

January-March volume in April.

Warm regards,

Lorelei Norvell (Editor-in-Chief)

26 February 2013

MYCOTAXON

http://dx.doi.org/10.5248/122.1

Volume 122, pp. 1-5 October-December 2012

Hypoxylon from China - 2: H. dengii sp. nov.

and H. crocopeplum new to China

Hali-x1A MA’”’, LARISSA VASILYEVA? & Yu LI**

' Institute of Tropical Bioscience and Biotechnology,

Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, China

? Institute of Mycology, Jilin Agricultural University, Changchun 130118, China

> Institute of Biology & Soil Science, Far East Branch of the Russian Academy of Sciences,

Vladivostok 690022, Russia

* CORRESPONDENCE TO: yuli966@126.com

ABSTRACT—Hypoxylon dengii (Xylariales, Xylariaceae) is described from China as a new

species, and H. crocopeplum is reported for the first time from the Chinese Mainland. The

morphological descriptions and photographs of stromata and microstructures are provided

based on the Chinese collections.

KEY worDs—Ascomycota, pyrenomycetous fungi, taxonomy

Introduction

The members of the genus Hypoxylon are important components of forest

ecosystems, where they grow on wood and decompose woody structures

(Merrill et al. 1964, Rajagopalan 1966, Rogers 1979, Sutherland & Crawford

1981, Whalley 1985, Chapela & Boddy 1988, Wei et al. 1992). Publications

dealing with descriptions and illustrations of Hypoxylon species from China are

scanty (Teng 1963, Tai 1979, Abe & Liu 1995). A further study of this genus has

yielded one species new to science and another new to the Chinese Mainland.

Illustrated descriptions of these two species are provided in this paper.

Materials & methods

The studied specimens are deposited at the Herbarium of Mycology of Jilin

Agricultural University (HMJAU). Microscopic features and measurements were made

from slide preparations mounted in water, 10% KOH, and Melzer’s iodine reagent. The

photographs of asci, ascal apical ring, and ascospores were taken by using a VHX-600E

microscope of the Keyence Corporation. The photographs of stromatal surface were

taken with a ZSA30w microscope and S70 Canon camera. External stromatal colors

were recorded and coded according to Rayner (1970). The methods of collecting,

preservation, and identification of the examined specimens follow Ju & Rogers (1996).

2... Ma, Vasilyeva & Li

Pi. 1 Hypoxylon dengii: a. Stromata; b. Stromatal surface; c. Ascospores;

d. Asci. Scale bars: a = 0.5 mm, b = 0.2 mm, c = 15 um, d = 20 um.

Taxonomy

Hypoxylon dengii H.X. Ma, Lar.N. Vassiljeva & Yu Li, sp. nov. PL..1,

MycoBank MB 563782

Differs from Hypoxylon jecorinum by its larger ascospores and straight germ slit and

from H. crocopeplum by its usually indehiscent perispore, smaller ascospores, and

straight germ slit.

Type: China, Guangdong Province, Chebaling Nature Reserve, on the bark of a fallen

branch, 26 June 2010, He S.-H. (Holotype, HMJAU 22432).

Erymo ocy: The species is named in honor of Prof. Shu-Qun Deng, the first Chinese

mycologist, who reported Hypoxylon from China.

STROMATA effused-pulvinate, plane, with conspicuous perithecial mounds,

0.5-1 mm thick; surface yellow brown to rust, orange granules immediately

beneath surface and between perithecia, with KOH-extractable pigments

orange to scarlet; the tissue below the perithecial layer black, inconspicuous.

Perithecia ovoid to short tubular, 0.1-0.3 x 0.2-0.6 mm; ostioles lower than the

stromatal surface. Asci 65-80 x 5.5-7 um long in the spore-bearing portions,

the stipes 28.5-58.5 um long, with apical ring bluing in Melzer’s iodine reagent,

discoid, 0.5-1 um high x 1-1.5 um broad. Ascospores brown to dark brown,

unicellular, ellipsoid-inequilateral, with narrowly to broadly rounded ends,

(10-)10.5-11.5(-12.5) x 5-6.5 um, with straight germ slit slightly less than

spore length; perispore infrequently dehiscent in 10% KOH.

ADDITIONAL SPECIMEN EXAMINED: CHINA, YUNNAN PROVINCE, Kunming, on the

bark of a fallen branch, 2 September 2010, Ma H.-X. (HMJAU 22624).

Hypoxylon dengii sp. nov. (China) ... 3

ComMENTs — Hypoxylon dengii differs from H. jecorinum Berk. & Ravenel,

which has smaller ascospores (8-9.5 x 4-5 um) and a straight or slightly

sigmoid germ slit Ju & Rogers 1996).

Another similar species, H. crocopeplum, is distinguished by the dehiscence

of almost every ascospore in 10% KOH, a larger ascospore size (see below), and

a straight or slightly sigmoid germ slit.

In stromatal morphology and KOH-extractable pigments, H. dengii is also

resembles H. subcrocopeplum Y.M. Ju & J.D. Rogers, which has longer narrower

spores (11-15 x 4.5-5.5 um) and an indehiscent perispore (Ju & Rogers

1996).

Hypoxylon crocopeplum Berk. & M.A. Curtis, Grevillea 4: 49. 1875. Pi. 2

STROMATA effused-pulvinate, plane, with conspicuous perithecial mounds,

0.4-2.5 cm long x 0.2-1.5 cm broad x 0.5-1 mm thick; surface yellow brown to

rust, orange-red granules immediately beneath surface and between perithecia,

with orange KOH-extractable pigments; the tissue below the perithecial layer

black, inconspicuous. Perithecia ovoid, 0.1-0.3 x 0.2-0.5 mm; ostioles lower

than the stromatal surface. Asci 77-95 x 8-10 um long in the spore-bearing

parts, the stipes 55-70 um long, with apical ring bluing in Melzer’s iodine

reagent, discoid, 0.5-0.8 um high x 0.8-1.5 um broad. Ascospores brown to

dark brown, unicellular, ellipsoid-inequilateral, with broadly rounded ends,

(11.5-)12-14(-14.5) x 6-7.5 um, with straight or sigmoid germ slit spore-

length; perispore dehiscent in 10% KOH.

BAY Coa\\Y f

RSA ay WE c d

‘ \

ye x

+ Note

SS 5 ~

=~ Lee

- = as!

— Ra ~

Pi. 2 Hypoxylon crocopeplum: a. Stromata; b. Stromatal surface; c. Asci;

d. Ascospores. Scale bars: a= 4mm, b = 1 mm, c = 15 um, d= 10 um.

4 ... Ma, Vasilyeva & Li

SPECIMENS EXAMINED: CHINA, GUANGZHOU PROVINCE, Chebaling Nature Reserve,

on the bark of a fallen branch, 26 June 2010, Ma H.-X. (HMJAU 20215); YUNNAN

PROVINCE, Mengla County, on the bark of a fallen branch, 14 August 1994, Liu P.-G.

(HKAS 28660).

ComMENTs — Hypoxylon crocopeplum is widely distributed in the tropics and

subtropics and has been reported in many areas including Africa, Australia,

Brazil, India, Mexico, U.S.A, Thailand, and Taiwan. Our collections match the

eastern North American type in thin stromata with inconspicuous black basal

tissue and conspicuous perithecial mounds. Miller (1961) and Ju & Rogers

(1996) considered some H. crocopeplum specimens to have thicker stromata

with tubular to long tubular perithecia and a conspicuous black basal tissue

beneath the perithecial layer, while Hsieh et al. (2005) felt that such specimens

represented H. polyporoideum Berk. ex Cooke.

Hypoxylon crocopeplum somewhat resembles H. cinnabarinum (Henn.) Y.M.

Ju & J.D. Rogers in stromatal morphology and H. subcrocopeplum in stromatal

morphology and KOH-extractable pigments. However, H. cinnabarinum has

nearly equilateral ascospores and a perispore that is usually indehiscent in 10%

KOH (Ju & Rogers 1996), and H. subcrocopeplum ascospores are indehiscent.

Hypoxylon crocopeplum is also somewhat similar to H. jecorinum, which has

smaller ascospores 8-9.5(-11) x 4-5 um.

Acknowledgments

We greatly appreciate Dr. A.J. Whalley of Liverpool John Moores University and Dr.

Shuang-hui He of Institute of Microbiology, Beijing Forestry University for reviewing

presubmitted manuscript and giving helpful comments and suggestions. This study was

supported by the National Natural Science Foundation of China (grant no. 30770005)

and the Start-up Costs for Doctors in Institute of Tropical Bioscience and Biotechnology,

Chinese Academy of Tropical Agricultural Sciences. We are also grateful to Institute

of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural

Sciences for funding in the project entitled “The Project of the Basic Scientific Research

by the Central Public Welfare Institutes” We thank Dr. Pei-gui Liu (Kunming Institute

of Botany, Chinese Academy of Sciences) who collected the fungus. We also thank

Dr. Hua Peng and Dr. Li-song Wang (Kunming Institute of Botany, Chinese Academy of

Sciences), for loan of specimen.

Literature cited

Abe Y, Liu Z. 1995. An annotated list of xylariaceous and diatrypaceous fungi collected from Mt.

Fengyangshan and Mt. Baishanzu, Zhejiang Prov. in East China. Bull Nat Sci Mus Tokyo, Ser.

B. 21: 75-86.

Chapela IH., Boddy L. 1988. Fungal colonization of attached beech branches II. Spatial and

temporal organization of communities arising from latent invaders in bark and functional

sapwood, under different moisture regimes. New Phytologist 110: 47-57.

http://dx.doi.org/10.1111/j.1469-8137.1988.tb00236.x

Hypoxylon dengii sp. nov. (China) ... 5

Hsieh HM, Ju YM, Rogers JD. 2005. Molecular phylogeny of Hypoxylon and related genera.

Mycologia 97(4): 844-865. http://dx.doi.org/10.3852/mycologia.97.4.844

Ju YM, Rogers JD. 1996. A revision of the genus Hypoxylon. American Phytopathological Society

Press, St. Paul, Minnesota. 365 p.

Merrill W, French DW, Wood FA. 1964. Decay of wood by species of the Xylariaceae. Phytopathology

54: 56-58.

Miller JH. 1961. A monograph of the World Species of Hypoxylon. University of Georgia Press:

Athens, USA. 158 p.

Rajagopalan C. 1966. Studies on four species of wood rotting fungi. Transactions of the Kansas

Academy of Sciences 68: 541-552. http://dx.doi.org/10.2307/3627468

Rayner RW. 1970. A mycological color chart. Kew: Commonwealth Mycological Institute, 34 p. +

2 charts.

Rogers JD. 1979. The Xylariaceae: systematic, biological and evolutionary aspects. Mycologia

71: 1-42. http://dx.doi.org/10.2307/3759218

Sutherland JB, Crawford DL. 1981. Lignin and glucan degradation by species of Xylariaceae.

Transactions of the British Mycological Society 76: 335-337.

http://dx.doi.org/10.1016/s0007-1536(81)80159-3

Tai FL. 1979. Sylloge fungorum Sinicorum. Science Press, Peking. 1527 p.

Teng SQ. 1963. Fungi of China. Science Press, Peking. 808 p.

Wei DL, Chang SC, Wei YH, Lin YW, Chuang CL, Jong SC. 1992. Production of cellulolytic enzymes

from the Xylaria and Hypoxylon species of Xylariaceae. World Journal of Microbiology and

Biotechnology 8: 141-146. http://dx.doi.org/10.1007/BF01195834

Whalley AJS. 1985. The Xylariaceae: some ecological considerations. Sydowia 38: 369-382.

MYCOTAXON

http://dx.doi.org/10.5248/122.7

Volume 122, pp. 7-23 October-December 2012

Corticioid basidiomycetes on the bark of living trees

from Porto Alegre, Brazil '

CESAR Lu1z M. RODRIGUEST & ROSA T. GUERREROTT

Programa de Pés-Graduacdo em Botanica, Departamento de Botanica,

Universidade Federal do Rio Grande do Sul, Porto Alegre, RS, Brazil

* CORRESPONDENCE TO Vagner G. Cortez (cortezvg@yahoo.com.br),

Juliano M. Baltazar (baltazarjmb@gmail.com)

AxsstRact —'The species of Corticiaceae s.l. growing on the bark of living trees in the

Metropolitan Region of Porto Alegre, Rio Grande do Sul State, Brazil, were studied. Dendrothele

syspora is described as a new species, based on morphology and development of spores,

and the new combination Dendrodontia bispora is proposed. Five species of Dendrothele

and one of Xenosperma represent new records for Brazil. Descriptions, illustrations, and an

identification key are included.

Key worps — Aphyllophorales, new taxa, systematics, wood decay fungi

Introduction

Corticiaceae s.l. includes lignicolous fungi with many species producing

basidiomata that develop on dead branches or woody material lying on the

ground. However, it also includes species that develop on bark of living trees.

Corticioid species were first reported from Rio Grande do Sul State (Brazil) by

Rick (1959). Some of his materials were reviewed by Hjortstam & Ryvarden

(1982) and Rajchenberg (1987). Since then, only Maluf & Guerrero (1993),

Nietiedt & Guerrero (2000), and Sobestiansky (2005) have contributed

significantly to this mycota.

In this work we present and discuss species belonging to genera that occupy a

specialized habitat, i.e., the exposed bark of living trees: Dendrodontia Hjortstam

& Ryvarden, Dendrothele Hohn. & Litsch., and Xenosperma Oberw.

"From the PhD thesis by Rodrigues, who had almost completed this paper with Guerrero shortly

before his untimely death. t Deceased, 18 December 2008. ++Deceased 28 February 2012

*The paper presented here was prepared for publication by Vagner G. Cortez and Juliano M.

Baltazar.

8 ... Rodriguest & Guerrerot

Materials & methods

The species treated are part of a survey of Corticiaceae s.l. carried out in four hills

located within 60 km of one another. Except for Dendrodontia bispora, which was

collected in an urban park, all collections were gathered in native forests surrounding

Porto Alegre municipality (Rio Grande do Sul State, Brazil) during 2001-04. The

vegetation in the sampled areas consists of seasonal semi-deciduous forests with

10-20 m tall hygrophilous to mesophilous communities. Specimens, analyzed macro-

and microscopically following usual techniques, are deposited in the herbarium ICN

(Universidade do Rio Grande do Sul, Departamento de Botanica).

Taxonomy

Key to species of Corticiaceae s.|. on bark of living trees in the

Metropolitan Region of Porto Alegre, Rio Grande do Sul, Brazil

ately bial Sy Sten CUA ith 5 hn Reh Rae ie aR ao as Dendrodontia bispora

Ibsblyphal systemaMOnoniitic yf bosc-g dh octon dyes keg dr eaeteg dye zcheg Frese tr scbwdibnpboo dpe’ 2

Dai Veudia 1 EOSeUty . ots o 5 5 ole x p vkalbs cates y Setalicete Salalah Setting Selanne alates «lel lea 3

ZI Y SUV Aca SENN NREL RAPT al EN aia ole ok AAG sk AAR od CO ad SIM heer cach heect 4

SA OMMECIA CAM ALE 8 84 Ose R dhe Ee FARO! ABE! LS te Dendrothele capitulata

SU, Cystidia tUSHOLiN’s yg dit eddie eg dpe dd peered pacrdd Herd S hart Dendrothele alliacea

4a. Basidiospores asteriform, with 3 or more projections .................. 000 aes 5

AbSBaAsidto spOves-AULSCEN Te, ect ce aela ey Ree Bea ee hha Rc hor oR Raa he sO 6

5a. Dendrohyphidia present, hyphae 1.5-2 um diam. ....... Dendrothele asterospora

5b. Dendrohyphidia lacking, hyphae 2.0-3 um diam. ......... Xenosperma murrillii

6a. Basidiospores lageniforny 22 oe Fees nse tv mnie ee nate mene & Dendrothele syspora

6b. Basidiospores spherical or subspherical .......... 0... eee ee eee eee eee E

7a. Surface of basidiomata with projections ................ Dendrothele griseocana

7b: Suriace-of basidiomata: smooth «1... . 26.0 4s ta.sy eats sey bess oS aoe on ae PRG 8

84. Basidiospores >15: wim CaM soc. ss wee oe ease ots ced ots od ote Dendrothele mangiferae

Sb, Basidiospores:<15 yun darth, wi... oo. scieee + steeein + wtoee le «was Dendrothele incrustans

Descriptions

Dendrodontia bispora (Burds. & Nakasone) Guerrero & C.L.M. Rodrigues,

comb. nov. PLATE 1

MycoBank MB 564698

= Dendrothele bispora Burds. & Nakasone, Mycotaxon 17: 253, 1983.

= Brunneocorticium bisporum (Burds. & Nakasone) Nakasone, Botany 87: 879, 2009.

= Brunneocorticium pyriforme Sheng H. Wu, Mycologia 99: 306, 2007.

BASIDIOMATA effuse, forming confluent patches 4 x 1 cm, 50-100 um thick,

closely adnate; HYMENIAL SURFACE smooth; MARGIN abrupt, pubescent,

sometimes with a dark brown line along the edge.

Dendrothele syspora sp. nov. (Brazil) ... 9

}

$1)

Opps

PLATE 1. Dendrodontia bispora.

A: generative hypha. B: skeletal hyphae. C: dendrohyphidia. D: young basidium.

E: mature basidia. F: basidiospores. Scale bar: 10 um.

HYPHAL SYSTEM dimitic; GENERATIVE HYPHAE thin-walled, 3-4 um in diam.,

finely encrusted, clamped; SKELETAL HYPHAE thick-walled, slightly brownish,

sometimes flexuous and branched. Cystip1a lacking; DENDROHYPHIDIA

branched, tortuous, 2-3 um in diam. Basrp1a clavate, 25-40 x 7-10 um, thin-

walled, clamped at base, with 2 sterigmata, 8-10 x 2-3 um; BASIDIOSPORES

ellipsoid to ovoid, smooth, thin-walled, sometimes with droplets, 13-16.5 x

6-8 um.

10 ... Rodriguest & Guerrerot

DISTRIBUTION — China, Guadeloupe, Mauritius, Réunion, Taiwan, USA

(Nakasone et al. 2009), and southern Brazil.

SPECIMENS EXAMINED — BRAZIL. R10 GRANDE DO SUL: Porto Alegre, Parque

Farroupilha, on Britoa guazumifolia (Myrtaceae), 03.XII.1992, leg. R.T. Guerrero (ICN

97664); 12.X.2001, leg. R.T. Guerrero (ICN 102781); 31.11.2004, leg. R.T. Guerrero

(ICN 102780).

REMARKS — Dendrodontia was described based on a dimitic hyphal system with

branched brownish skeletal hyphae and the presence of hyaline dendrohyphidia

as main features (Hjortstam & Ryvarden 1980). Burdsall & Nakasone (1983)

described Dendrothele bispora with a dimitic hyphal system, emphasizing its

brownish skeletal hyphae as unique in the genus.

In their study of Dendrothele, Boidin et al. (1996) suggested excluding

D. bispora from the genus based on its dimitic hyphal system and suggested

its placement in Dendrodontia. Recently, Nakasone et al. (2009) transferred

this species to Brunneocorticium Sheng H. Wu within the euagarics clade,

reducing B. pyriforme to synonymy. Larsson (2007) and Wu et al. (2007) placed

Dendrodontia in the polyporoid clade, but Wu et al. (2007) included only one

unidentified specimen of Dendrodontia in their analyses.

Considering that Dendrothele bispora does not agree in important features

with the concept of Dendrothele and that sequences of more specimens of

Dendrodontia spp. (particularly of the type species D. bicolor (P.H.B. Talbot)

Hjortstam & Ryvarden) are needed to assess the phylogenetic relationships

of that genus, we prefer to transfer the species to Dendrodontia based on

morphological evidence.

Dendrothele alliacea (Quél.) RA. Lemke, Persoonia 3: 366, 1965. PLATE 2

BASIDIOMATA resupinate, white to ochraceous, smooth, pruinose under the

lens, 120-150 um thick, in rounded patches less than 1 cm in diam., sometimes

confluent.

HYPHAL SYSTEM monomitic; GENERATIVE HYPHAE irregular, 1-3 um in

diam., straight, clamps somewhat difficult to see. LEPTOCYSTIDIA numerous,

fusiform 20-32 x 8-12 um, slightly thick-walled ca. 1 um thick, sometimes

bearing an apical filamentous appendix; DENDROHYPHIDIA slender 1-2 um

wide bearing short branches and covered by crystals. BAsip1A clavate, 37-42 x

6-7 um, tapering towards the base, clamps hardly visible, with four sterigmata,

4.5-7 um; BASIDIOSPORES ellipsoid, smooth, somewhat thick-walled, 9-13 x

5-7 um, sometimes with granular content, with distinct apiculus, IKI-.

DISTRIBUTION — Canada, South Africa, USA (Lemke 1964), Europe

(Bernicchia & Gorjon 2010), Russia (Ghobad-Nejhad 2011), Uruguay

(Hjortstam & Ryvarden 2007), and southern Brazil.

Dendrothele syspora sp. nov. (Brazil) ... 11

PLATE 2. Dendrothele alliacea.

A: generative hyphae. B: dendrohyphidia. C: leptocystidia. D: mature and immature basidia.

E: basidiospores. Scale bar: 10 um.

SPECIMENS EXAMINED — BRAZIL. R10 GRANDE DO SUL STATE: Guaiba, Morro Sao

Maximiano, 09.XII.2003, leg. C. Rodrigues 989 (ICN); Sapucaia do Sul, Morro Sapucaia,

18.X1I.2003, leg. C. Rodrigues 1018 (ICN).

REMARKS — Numerous fusiform leptocystidia are noticeable in this species.

They are also found in D. acerina (Pers.) P.A. Lemke, from which D. alliacea

differs by its ellipsoid spores. Our specimens have basidiospores that are a

bit smaller than those mentioned by Boidin et al. (1996) but similar to the

dimensions reported by Eriksson & Ryvarden (1975).

12 ... Rodriguest & Guerrerot

PLaTE 3. Dendrothele asterospora.

A: hyphae. B: young basidia. C: mature basidia. D: basidiospores. Scale bar: 10 um.

Dendrothele asterospora Boidin & Langq., Bull. Soc. Mycol. Fr. 112: 94, 1996.PLATE 3

BASIDIOMATA white to cream, in rounded patches ca. 0.5 cm wide, 40-50

um in vertical section, covered by crystals.

HyPHAL SYSTEM monomitic; GENERATIVE HYPHAE slender, tortuous,

1.5-2 um wide, clamps difficult to see. Cystrp1a lacking; DENDROHYPHIDIA

shortly branched. Basrp1a cylindric to urniform, 17-21 x 7-8 um, frequently

bearing a projection that extends as a hypha, with four sterigmata 6-7 um long;

BASIDIOSPORES asteriform with 5 tips, 10-16 um between the opposite tips,

thin-walled, IKI-.

DISTRIBUTION — Central African Republic, Réunion (Boidin et al. 1996, the

latter sub aff.), and southern Brazil.

SPECIMEN EXAMINED — BRAZIL: R10 GRANDE DO SUL STATE: Sapucaia do Sul, morro

Sapucaia, on Cabralea canjerana (Meliaceae), 17.1V.2003, leg. C. Rodrigues 755 (ICN).

Dendrothele syspora sp. nov. (Brazil) ... 13

REMARKS — ‘This species is similar to species of Xenosperma because of the

basidia with lateral projections that resemble pleurobasidia, and pluriapiculate

basidiospores, but the presence of dendrohyphidia, chalky consistency and

habit points towards its placement in Dendrothele. ‘This is the first report of

D. asterospora since its original description.

PiatE 4. Dendrothele capitulata.

A: hyphae. B: cystidia. C: basidia. D: basidiospores. Scale bar: 10 um.

Dendrothele capitulata Boidin & Langq., Bull. Soc. Mycol. Fr. 112: 99, 1996. PLATE 4

BASIDIOMATA white to pale salmon, in patches, isolated or confluent, with a

calcareous consistency, fragile and friable, often covered by cristals.

HYPHAL SYSTEM monomitic; GENERATIVE HYPHAE 2-3 um _ wide,

without clamps. Cystip1a lacking; DENDROHYPHIDIA irregularly branched;

LEPTOCYSTIDIA capitate, numerous, stem 3-4 um in diam. and spherical apex

7-9 um in diam. Basip1A utriform, 40-50 x 8-10 um, with four sterigmata,

14 ... Rodriguest & Guerrerot

7 um long; BASIDIOSPORES spherical, some subspherical, 8-12.5 um in diam.,

thick-walled, smooth, with a distinct apiculus, IKI-.

DISTRIBUTION — Guadeloupe and southern Brazil.

SPECIMENS EXAMINED — BRAZIL: R10 GRANDE DO SUL STATE: Guaiba, Morro Sao

Maximiano, on Luehea divaricata (Malvaceae), 30.1.2003, leg. C. Rodrigues 687 (ICN);

13.V.2003, leg. C. Rodrigues 783 (ICN).

REMARKS — This species is easily recognized by its large capitate cystidia and

spherical spores as described and illustrated by Boidin et al. (1996). This is the

second record since its original description.

Dendrothele griseocana (Bres.) Bourdot & Galzin, Bull. Soc. Mycol. Fr. 28: 354,

1913 [“1912”]. PLATE 5

BASIDIOMATA white to ochraceous, effuse, sterile papillae visible under the

lens, 40-60 um long and distant 100 um from each other.

ee a

ei fr

PLaTE 5. Dendrothele griseocana.

A: dendrohyphidia. B: basidia. C: basidiospores. Scale bar: 10 um.

Dendrothele syspora sp. nov. (Brazil) ... 15

HyYPHAL SYSTEM monomitic; GENERATIVE HYPHAE hardly observed, tortuous,

thin-walled, clamps difficult to see. Cystip1a lacking; DENDROHYPHIDIA

numerous, richly branched, covered by crystalline matter. Basip1A clavate

when young, 25-30 x 6-7 um with a medial constriction at maturity, with

2 sterigmata; BASIDIOSPORES ellipsoid to subspherical, smooth, slightly thick-

walled, 8.5-10 x 7-9 um, IKI-.

DISTRIBUTION — Canada, USA (Nakasone 2006), Europe (see Bernicchia

& Gorjon 2011), Mexico, Uruguay (Hjortstam & Ryvarden 2007), Russia

(Ghobad-Nejhad 2011), and southern Brazil.

SPECIMEN EXAMINED — BRAZIL. R10 GRANDE DO SUL: Guaiba, Morro Sao Maximiano,

09.XII.2003, leg. C. Rodrigues 1003 (ICN).

REMARKS — Dendrothele griseocana was traditionally considered to be a

variable species. However, Nakasone (2006) resolved this species complex

and characterized D. griseocana mainly by the presence of hyphal pegs, simple

septa, and basidia with 2 sterigmata, segregated from D. americana Nakasone

and D. tanzaniana Nakasone by their clamped generative hyphae and basidia

with 4 sterigmata.

Dendrothele griseocana was first reported for Rio Grande do Sul State by

Rick (1959).

Dendrothele incrustans (P.A. Lemke) P.A. Lemke, Persoonia 3: 366, 1965. PLATE 6

BASIDIOMATA white, formed by confluent patches 2-5 mm wide each,

50-100 um thick; adherent, with an indistinct margin.

HYPHAL SYSTEM monomitic; SUBICULUM densely crystalline; GENERATIVE

HYPHAE clamped, irregular and thin-walled, 1-2 um in diam. Cystipia lacking;

DENDROHYPHIDIA 1-3 um wide. Basip1A clavate to suburniform, slightly

swollen at the bases, 35-45 x 11-13 um, with four sterigmata 11-13 um long;

BASIDIOSPORES spherical, sometimes with guttulae, 9-12 um in diam., apiculus

often conspicuous, IKI-.

DISTRIBUTION — Argentina, Guadeloupe, (Hjortstam & Ryvarden 2007),

Canada, USA (Lemke 1964), Russia (Ghobad-Nejhad 2011), and southern

Brazil.

SPECIMENS EXAMINED — BRAZIL. R10 GRANDE DO SUL STATE: GUAIBA,

Morro SAO MAXIMIANO, ON MATAYBA ELAEAGNOIDES (SAPINDACEAE),

18.]II.2003, LEG. C. RODRIGUES 607 (ICN); 15.[X.2003, LEG. C.

RODRIGUES 882; 15.1X.2003, LEG. C. RODRIGUES 894 (ICN).

REMARKS — ‘The diagnostic features of D. incrustans are the lack of cystidia

and the large spherical basidiospores with prominent apiculi. Our specimens

have basidiospores slightly larger than the 8-11 um reported by Gilbertson &

Blackwell (1987) and basidia larger than 25-30 x 8-11 um as cited by Lemke

(1964).

16 ... Rodriguest & Guerrerot

PLATE 6. Dendrothele incrustans.

A: hypha. B: dendrohyphidium. C: basidia. D: basidiospores. Scale bar: 10 um.

Dendrothele mangiferae Boidin & Duhem, Bull. Soc. Mycol. Fr. 112: 106, 1996.

PLATE 7

BASIDIOMATA white, occurring in irregular, rounded, small patches ca. 1 cm,

80-170 um thick.

HYPHAL SYSTEM monomitic; GENERATIVE HYPHAE 2-3 um in diam.,

irregularly arranged, clamped. DENDROHYPHIDIA thin, 1-2 um wide, poorly

branched, tips resembling a cauliflower. Basip1a subcylindrical, containing

oil droplets, 110-130 x 18 um, with 45 um long sterigmata, 25-30 x 5-6 um,

immature basidia multilayered by repetition; BAstpIosPpoREs spherical to

subspherical 18-25 x 17-23 um, sometimes with oil droplets and a distinctive

apiculus, smooth in KOH and finely spiny in Melzer’s solution, IKI-.

Dendrothele syspora sp. nov. (Brazil) ... 17

PLatE 7. Dendrothele mangiferae.

A: hyphae. B: dendrohyphidia. C: young repetitive basidium. D: mature basidia.

E: basidiospores. Scale bars: 10 um.

DISTRIBUTION — Costa Rica (Gorjén 2012), Mauritius, Réunion (Boidin et

al. 1996), and Southern Brazil.

SPECIMEN EXAMINED — BRAZIL. R10 GRANDE DO SUL STATE: Guaiba, Morro Sao

Maximiano, on Cedrela fissilis (Meliaceae), 13.V.2003, leg. C. Rodrigues 791 (ICN).

REMARKS — Dendrothele mangiferae has the largest basidia and basidiospores

among the Dendrothele species discussed here. These features, which agree with

the description by Boidin et al. (1996), make it easy to identify. Since its original

description, D. mangiferae has been reported only from Costa Rica and now

from southern Brazil.

18 ... Rodriguest & Guerrerot

Dendrothele syspora C.L.M. Rodrigues & Guerrero, sp. nov. PLATE 8

MycoBank MB 564699

Speciei Dendrothele magninavicularis differt hyphae sine fibulae; dendrohyphida

cum projecturis spinulosis; 2 sterigmatigmatis bisporatis; sporae primo conjugatis, in

maturitatem secedentibunt.

TYPE: Brazil. Rio Grande do Sul State: Viamao, Parque Estadual de Itapua, Morro

da Grota, on Allophylus edulis (A. St.-Hil.) Niederl. (Sapindaceae), 27.X.2003, leg.

C. Rodrigues 924 (Holotype, ICN).

EryMo_osey: sy = pref. Gr., together, with, joined; spora = L., spore.

BASIDIOMATA in patches irregularly rounded, 3-7 mm wide, sometimes

confluent, white to pale ochraceous, 100-150 um in vertical section, texture

chalky, cracking; MARGIN indistinct, often thinning out, pruinose.

HYPHAL SYSTEM: monomitic; GENERATIVE HYPHAE 2-3 um in diam.,

simple-septate. Cystrp1a lacking; DENDROHYPHIDIA with the last branches

short and with spiny projections, 1.5-3 um in diam. Basrp1a: irregularly

cylindrical, 34-54 x 9-12 um, enlarged at the basis, slightly sinuous, somewhat

pinched at the middle, smooth, thin-walled, with 2 sterigmata 12-12 x 3-4

lum; BASIDIOSPORES navicular to lageniform, 17-24 x 7-8 um, with a median

constriction (4 x 5 um wide), straight or curved, rarely with 1 or 2 drops, often

none, smooth, thin-walled, apiculus in the broadest tip, IKI-.

DISTRIBUTION — Known from three localities in Rio Grande do Sul,

southern Brazil.

ADDITIONAL SPECIMENS EXAMINED — BRAZIL. R10 GRANDE DO SUL STATE: Guaiba,

Morro Sao Maximiano, on Ocotea puberula (Lauraceae), 09.XII.2003, leg. C. Rodrigues

998 (ICN); Sapucaia do Sul, Morro Sapucaia, 18.X1.2003, leg. C. Rodrigues 1015 (ICN);

leg. C. Rodrigues 1025 (ICN); leg. C. Rodrigues 1031 (ICN); Viamao, Parque Estadual

de Itapua, Morro da Grota, on Allophylus edulis, 11.V1.2004, leg. C. Rodrigues 1081

(ICN); leg. C. Rodrigues 1098 (ICN).

REMARKS — ‘This species presents the habit and substrate typical for

Dendrothele species. The spores are larger than any other known species with

median constriction in the genus (Nakasone & Burdsall 2011, Gorjén et al.

2011). Sterigmata and basidiospores, however, are rarely observed during their

development. At first, sterigmata are born separately, but as they elongate, the

tips grow toward each other and produce basidiospores that remain aligned

together along their length. The spores are released together and remain joined

for a short time before becoming separated. Basidiospore germination has not

been observed.

Dendrothele syspora seems to belong to a recently described group of species

with navicular basidiospores, including D. cymbiformis Nakasone & Burds.,

D. magninavicularis Nakasone & Burds., and D. navicularis Nakasone & Burds.

from New Zealand (Nakasone & Burdsall 2011) and D. latinavicularis Gorjon

from the Patagonian Andes forests of Argentina (Gorjon et al. 2011). Dendrothele

Dendrothele syspora sp. nov. (Brazil) ... 19

{ Me)

Pate 8. Dendrothele syspora.

A: hyphae. B: dendrohyphidia. C: basidia in different stages of development. D: basidiospores.

Scale bar: 10 um.

latinavicularis differs from D. syspora by the shorter and wider basidiospores,

which thus appear broadly navicular. Both D. cymbiformis and D. navicularis

have smaller basidiospores, while D. magninavicularis basidiospores are almost

the same size as those in D. syspora. Dendrohyphidia differ in these species:

they are hyphoid in D, cymbiformis and D. navicularis but have short branches

and spiny projections in D. magninavicularis and D. syspora. Dendrothele

syspora is unique in this group by having simple septate generative hyphae and

2-sterigmate basidia.

20 ... Rodriguest & Guerrerot

Species of this group were found on different hosts: D. latinavicularis was

always found in bark of living Saxegothaea conspicua Lindl., an endemic

southern South American conifer (Gorjén et al. 2011); D. cymbiformis

was reported from bark of living Dracophyllum scoparium Hook. f. and

D. magninavicularis from bark of living Melicytus ramiflorus J.R. Forst. &

G. Forst. [subsp. ramiflorus], both New Zealand endemic angiosperms. On the

other hand, both D. navicularis and D. syspora were found in bark of several

different living angiosperms native to their respective geographic regions.

0A di

os oo

PLATE 9. Xenosperma murrillii.

A: hypha. B: basidia. C: basidiospores. Scale bar: 10 um.

Xenosperma murrillii Gilb. & M. Blackw., Mycotaxon 28: 400, 1987. PLATE 9

BASIDIOMATA in patches 0.3-1.0 mm wide, sometimes confluent, white

to ochraceous, 70-150 um thick, fragile, cracking, texture chalky; MARGIN

determinate, abrupt.

Dendrothele syspora sp. nov. (Brazil) ... 21

HYPHAL SYSTEM monomitic; GENERATIVE HYPHAE clamped, 2-3 um in

diam., thin-walled. Cystip1a and DENDROHYPHIDIA lacking. Basrp1a pleural,

30-40 x 9-10 um, with a medium constriction, 4-sterigmate; BASIDIOSPORES

asteriform, 17-18(-21) x 14-18 um, with 5 projections of which one is larger

than the others and curved, 1-3-gutulate.

DISTRIBUTION — USA (Gilbertson & Blackwell 1987) and southern Brazil.

SPECIMENS EXAMINED — BRAZIL. R10 GRANDE DO SUL STATE: Guaiba, Morro Sao

Maximiano, on Enterolobium contortisiliquum (Mimosaceae), 15.VIUI.2001, leg. C.

Rodrigues 445 (ICN); 03.1X.2002, leg. C. Rodrigues 657 (ICN); Ipse, 13.V.2003, leg. C.

Rodrigues 802 (ICN); Porto Alegre, Parque Farroupilha, VI.1994, leg. R. T. Guerrero

(ICN 102261); on Bauhinia forficata (Caesalpiniaceae), VIII.1994, leg. R. T. Guerrero

(ICN 102318); Salvador do Sul, on branch of unidentified angiosperm, 07.III.1982,

leg. R. T. Guerrero (ICN 56138); Sapucaia do Sul, Morro Sapucaia, 17.IV.2003, leg. C.

Rodrigues 746 (ICN); on Allophylus edulis, 12.V1I.2003, leg. C. Rodrigues 857 (ICN);

Viamao, Parque Estadual de Itapua, 20.X.1984, leg. R. T. Guerrero (ICN 56150).

REMARKS — Xenosperma murrillii differs from X. ludibundum (D.P. Rogers

& Liberta) Oberw. ex Julich, which has 2-sterigmate basidia and smaller

basidiospores (Oberwinkler 1965). Xenosperma pravum Boidin & Gilles differs

by having 6-sterigmate basidia (Boidin & Gilles 1989).

Discussion

Although Dendrothele species are frequently reported from temperate

regions (Lemke 1964, Eriksson & Ryvarden 1975, Greslebin & Rajchenberg

1998) where Corticiaceae s.l. has been intensively studied, they also occur

in tropical and subtropical regions where their diversity is poorly known.

Boidin et al. (1996) described D. asterospora, D. capitulata, and D. mangiferae

for Mauritius, Réunion, Guadeloupe, and the Central African Republic. The

materials treated in this study were collected in similar climatic regions.

Other species reported here are cited both for temperate and tropical/

subtropical regions. While the broad northern temperate distribution of many

wood-decaying species is well established (Gilbertson 1980), more studies are

needed to determine their distribution in the tropics.

Another interesting aspect of this study is the discovery of several rarely

reported species occurring on substrates different from those previously cited.

This includes X. murrillii, known only from the bark of Juniperus virginiana L.

in the type locality. Investigation of fungi on fast-drying juniper bark, revealed

that some species also grew on hardwood trees (Gilbertson & Blackwell 1987).

Perhaps, host distributions are more variable in other regions where these

fungi occur. The distinctive fast-drying habitat in which these fungi occur will

facilitate their collection and improve their knowledge regarding distribution

and host range.

22 ... Rodriguest & Guerrerot

Acknowledgments

The authors thank the pre-submission reviewers, Dr. Mario Rajchenberg (Centro

Forestal CIEFAP, Argentina) and Dr. Sergio Pérez Gorjén (Spain). We also thank Nhu

H. Nguyen for correcting the Latin diagnosis. The ‘Coordenacao de Aperfeigoamento de

Pessoal de Nivel Superior” (CAPES) provided financial support.

Literature cited

Bernicchia A, Gorjon SP. 2010. Corticiaceae s.l. Fungi Europaei vol. 12. Edizioni Candusso, Italia.

Boidin J, Gilles G. 1989. Basidiomycetes Aphyllophorales de lle de la Réunion XV. Famille des

Xenasmataceae Oberw. Bull. Soc. Mycol. Fr. 105: 151-162.

Boidin J, Lanquetin, P, Duhem B. 1996. Contribution a la connaissance du genre Dendrothele

(Basidiomycotina, Aphyllophorales). Bull. Soc. Mycol. Fr. 112: 87-126.

Burdsall Jr HH, Nakasone KK. 1983. Species of effused Aphyllophorales (Basidiomycotina) from the

southeastern United States. Mycotaxon 17: 253-268.

Eriksson J, Ryvarden L. 1975. The Corticiaceae of North Europe. Vol. 3. Oslo, Fungiflora.

Ghobad-Nejhad M. 2011. Updated checklist of corticioid and poroid basidiomycetes of the Caucasus

region. Mycotaxon 117: 508 (abstract) + 70 pp. (accessioned 05/03/12) at

http://www.myco-lich.com/mycology-of-iran/basidiomycota/caucasus-region/checklists

Gilbertson RL. 1980. Wood-rotting fungi of North America. Mycologia 72: 1-49.

http://dx.doi.org/10.2307/3759417

Gilbertson RL, Blackwell M. 1987. Notes on wood-rotting fungi on junipers in the Gulf Coast

region. II. Mycotaxon 28: 369-402.

Gorjon SP. 2012. First record of Dendrothele mangiferae (Agaricales, Basidiomycota) from the

Neotropics. Mycotaxon 119: 137-140. http://dx.doi.org/10.5248/119.137

Gorj6én SP, Greslebin A, Rajchenberg M. 2011. Dendrothele latenavicularis sp. nov. (Agaricales,

Basidiomycota) from the Patagonian Andes. Mycotaxon 117: 101-108.

http://dx.doi.org/10.5248/117.101

Greslebin A, Rajchenberg M. 1998. Corticioid Aphyllophorales (Basidiomycota) from the Patagonian

Andes Forests of Argentina 3. The genus Dendrothele. Mycotaxon 67: 469-486.

Hjortstam K, Ryvarden L. 1980. Studies in tropical Corticiaceae (Basidiomycetes) I. Mycotaxon 10:

269-287.

Hjortstam K, Ryvarden L. 1982. Studies in tropical Corticiaceae (Basidiomycetes) IV. Type studies

of taxa described by J. Rick. Mycotaxon 15: 261-276.

Hjortstam K, Ryvarden L. 2007. Checklist of corticioid fungi (Basidiomycotina) from the tropics,

subtropics, and the southern hemisphere. Syn Fungorum 22: 27-146.

Larsson K-H. 2007. Re-thinking the classification of corticioid fungi. Mycol Res 111: 1040-1063.

http://dx.doi.org/10.1016/j.mycres.2007.08.001

Lemke PA. 1964. The genus Aleurodiscus (sensu lato) in North America. Can. J. Bot. 42: 723-766.

http://dx.doi.org/10.1139/b64-066

Maluf RW, Guerrero RT. 1993. Estudo biossistematico de espécies da familia Peniophoraceae

(Basidiomycetes) no Rio Grande do Sul. Insula (22): 39-82.

Nakasone KK, Burdsall Jr HH. 2011. The genus Dendrothele (Agaricales, Basidiomycota) in New

Zealand. New Zealand J. Bot. 49: 107-131. http://dx.doi.org/10.1080/0028825X.2010.512636

Nakasone KK, Hibbett DS, Goranova G. 2009. Neocampanella, a new corticioid fungal genus, and a

note on Dendrothele bispora. Botany 87: 875-882. http://dx.doi.org/10.1139/B09-046

Nietiedt SA, Guerrero RT. 2000. Familia Corticiaceae (s.l.) - Novas citacoes para o Brasil. Iheringia,

Bot. 54: 45-56.

Dendrothele syspora sp. nov. (Brazil) ... 23

Oberwinkler F. 1965. Primitive Basidiomyceten: revision einiger Formenkreise von Basidienpilzen

mit plastischer Basidie. Sydowia 19: 1-93.

Rajchenberg M. 1987. Type studies of Polyporaceae (Aphyllophorales) described by J. Rick. Nordic

J. Bot. 7: 553-568. http://dx.doi.org/10.1111/j.1756-1051.1987.tb02023.x

Rick J. 1959. Basidiomycetes Eubasidii in Rio Grande do Sul - Brasilia 3. Thelephoraceae. Iheringia,

Bot. 4: 61-124.

Sobestiansky, G. 2005. Contribution to a macromycete survey of the states of Rio Grande do Sul

and Santa Catarina in Brazil. Braz. Arch. Biol. Technol. 48(3): 437-457.

Wu SH, Wang DM, Tschen E. 2007. Brunneocorticium pyriforme, a new corticioid fungal genus and

species belonging to the euagarics clade. Mycologia 99: 302-309.

http://dx.doi.org/10.3852/mycologia.99.2.302

MY COTAXON

http://dx.doi.org/10.5248/122.25

Volume 122, pp. 25-41 October-December 2012

Hymenoscyphus pseudoalbidus, the correct name for

Lambertella albida reported from Japan

YAN-JIE ZHAO'™, TSUYOSHI Hosoya’, HANS-OTTO BARAL’,

KENTARO HOSAKA’? & MAKOTO KAKISHIMA'

' Faculty of Life and Environmental Science, Tsukuba University,

1-1-1 Tennodai, Tsukuba, Ibaraki 305-0821, Japan

? Department of Botany, National Museum of Nature and Science,

4-1-1 Amakubo, Tsukuba, Ibaraki 305-0005, Japan

> Blaihofstr. 42, D-72074 Tiibingen, Germany

* CORRESPONDENCE TO: zhaoyanjiel 1@gmail.com

Asstract — Recent molecular analyses separate Hymenoscyphus pseudoalbidus (causal

agent of ash dieback in Europe) from the morphologically scarcely distinguishable H. albidus.

Hymenoscyphus albidus was reported (as “Lambertella albida”) on petioles of Fraxinus

mandshurica in Japan. Phylogenetic analysis in the present study shows Japanese “L. albida”

to be conspecific with H. pseudoalbidus but with a higher genetic variability compared

to European isolates. The presence of croziers at the ascus base was found to be a clear

distinguishing character of H. pseudoalbidus. Our phylogenetic analysis of the combined ITS

and LSU-D1/D2 dataset supports Hymenoscyphus as more appropriate than Lambertella for

H. pseudoalbidus. As the Hymenoscyphus clade includes members with two major characters

(presence of substratal stroma and brown ascospores) currently used to circumscribe

Lambertella, the generic delimitation of Lambertella requires redefinition.

Key worps — Chalara fraxinea, Helotiaceae, Rutstroemiaceae

Introduction

Ash dieback, an emerging infectious disease of common ash (Fraxinus

excelsior), has reached epidemic levels in Central Europe during the last two

decades (Bakys et al. 2009; Kowalski 2006). Since the first disease report

around 1992 in Poland, ash dieback has spread into 22 European countries

(Timmermann et al. 2011). The causal agent, Chalara fraxinea T. Kowalski

was first described in Poland (Kowalski 2006). Later, its teleomorph was

found and tentatively identified as Hymenoscyphus albidus (Gillet) W. Phillips

(Kowalski & Holdenrieder 2009). Further research revealed that H. albidus was

a complex of two species, and the ash dieback pathogen was described as a new

26 ... Zhao & al.

taxon Hymenoscyphus pseudoalbidus Queloz et al., separated from H. albidus

based on differences in ITS rDNA, calmodulin gene (CAL), and translation

elongation factor 1-a gene (EF1-a), as well as substantial differences in inter-

simple sequence repeat anchored PCR (ISSR-PCR) fingerprinting (Queloz et

al. 2011). The genetic distinction between H. albidus and H. pseudoalbidus was

later confirmed by population genetic studies (Bengtsson et al. 2012, Gross

et al. 2011, Husson et al. 2011). Queloz et al. (2011) indicated that the two

species are indistinguishable in apothecial morphology except for a tendency

toward slightly longer ascospores in H. pseudoalbidus. In fact, measurements

in the two species overlapped, making it virtually impossible to distinguish

H. pseudoalbidus from H. albidus based on ascospore size (Queloz et al. 2011).

However, recent morphological studies of European materials revealed a

sharp difference in the ascus base that permits unequivocal distinction between

H. albidus and H. pseudoalbidus (Baral & Bemmann, in prep.). The importance

of ascal croziers in helotialean fungi was discovered by White (1942, 1943,

1944). Although many later workers neglected this discovery, a number of

studies have confirmed that the presence or absence of ascal croziers is a stable

characteristic that clearly distinguishes between closely allied species (e.g.,

Baral 1984; Huhtinen 1989).

Carpenter (1981) transferred Hymenoscyphus albidus to Lanzia based on the

presence of a conspicuous substratal stroma. The transfer to Lambertella (Korf

1982) was based on the presence of some brown spores in the studied specimen

(R.P. Korf, pers. comm.), and this recombination was confirmed when Japanese

material was studied by Hosoya et al. (1993), who likewise found the ascospores

to become brown prior to germination. Although these two characters were

also recognized in the teleomorph classification of Chalara fraxinea, Kowalski

& Holdenrieder (2009), who followed European usage to classify the species in

Hymenoscyphus, did not place the species in Lambertella.

Lambertella albida (Gillet) Korf was reported as a new record for Japan by

Hosoya et al. (1993) from petioles of Fraxinus mandshurica, a common ash in

northeastern Asia. The asexual reproductive structure was also obtained in pure

culture of Japanese material, but the authors regarded it as having a spermatial

function. Since conidiophores have never been reported for H. albidus, and

H. pseudoalbidus was considered morphologically indistinguishable from H.

albidus, the taxonomic status of “L. albida” as reported from Japan needs to be

reconsidered.

The aims of the present research were: 1) to clarify whether Japanese

“L. albida” belongs to H. albidus or H. pseudoalbidus based on molecular

phylogeny; 2) to examine if the presence of croziers is appropriate to separate

the two species; 3) to clarify whether Hymenoscyphus or Lambertella is more

appropriate for Japanese specimens currently known as “L. albida”.

Hymenoscyphus pseudoalbidus in Japan ... 27

Materials & methods

Specimens and strains

Thirty-one specimens were analyzed, which include nine “L. albida” specimens from

Japan, sixteen further specimens classified as Lambertella spp., four specimens classified

as Hymenoscyphus spp., and two Lachnum species as outgroup (TABLE 1). Japanese

isolates were obtained from single spores, using a Skerman’s micromanipulator (Skerman

1968). Three L. albida” isolates of (FC-1445, FC-2793, FC-2799) were maintained on

potato dextrose agar (PDA, Nissui, Tokyo, Japan) slants and deposited in Biological

Resource Center, National Institute of Technology and Evaluation (NITE-BRC, Japan).

Observation of ascal base and anamorph

The bases of asci were examined for the presence of croziers or simple septa in

Japanese specimens previously identified as “L. albida”. Apothecial fragments were

mounted in either water + 1% phloxine B solution or 5-10% KOH + Congo Red and

strongly squashed.

In order to observe the anamorph, isolates were incubated on malt extract agar

(MEA, 20 g malt extract, 20 g agar, 1000 ml distilled water) at room temperature up to

1 month.

DNA extraction, PCR amplification and sequencing

Isolates were cultivated in 2 ml of 2% malt extract broth (20 g malt extract, 1000

ml distilled water) for 2 weeks to obtain mycelium. Genomic DNA of isolates was

obtained from about 50 mg of frozen mycelia using a DNeasy Plant Mini Kit (Qiagen,

Mississauga, ON, Canada) following the manufacturer's instruction. Genomic DNA

from apothecia was extracted using the modified Cetyltrimethylammonium bromide

(CTAB) extraction following glass milk purification methods as summarized by Hosaka

(2009) and Hosaka & Castellano (2008). Briefly, samples were ground in liquid nitrogen

using mortar and pestle, incubated in CTAB buffer (2% CTAB, 100 mM Tris pH 8.0,

20 mM EDTA, 1.4 M NaCl) at 65°C for 1 hour, and proteins were removed using the

mixture of chloroform: isoamylalcohol (24: 1). The materials were further purified

using 6M sodium iodine buffer (1M Tris pH 6.8, 2M Na,SO,) with glass milk, washed

with ethanol/buffer solution (10 mM Tris pH 7.4, lmM EDTA, 100 mM NaCl, 50%

EtOH), and finally eluted in 100 ul Tris-EDTA buffer (TE, 10 mM Tris-HCl pH 8.0,

1 mM EDTA).

The internal transcribed spacer regions (ITS-5.8S), the LSU-D1/D2 region of the

large subunit rDNA gene (28S rDNA), the calmodulin gene (CAL) and translation

elongation factor 1- a (EF1-a) were sequenced using primer pairs ITS1F and ITS4 or

ITS1 and ITS4 (White et al. 1990), NL1 and NL4 (O'Donnell 1993), Cal-228F and Cal-

737R (Carbone & Kohn 1999), EF1-728F and EFla_R (Carbone & Kohn 1999, Griinig et

al. 2007), respectively. PCR reactions were performed using 10 ul reaction volumes each

containing: 0.5 ul genomic DNA, 0.25 ul of each primer (10 uM), 0.05 wl (0.25 unit) of

ExTaq DNA polymerase (TaKaRa, Tokyo, Japan), 5.0 ul deoxynucleotide triphosphate

(dNTP) mixture containing 2.5 mM each dNTP and ExTaq buffer containing 2 mM

Mg”** (adding 3.95 ul distilled water to get 10 pl reaction volumes). Amplifications were

performed for ITS-5.8S and D1/D2 region with preliminary denaturation at 94°C for

28 ... Zhao & al.

3 min, 35 amplification cycles (94°C for 1 min, 52°C for 30 s and 72°C for 1 min),

followed by a final extension at 72°C for 7 min. For both CAL and EF1-c regions, the

annealing temperature was set at 54°C for 30s. PCR products were electrophoresed in

1% agarose gels stained with ethidium bromide and visualized under UV light. PCR

products were then purified using an ExoSAP-IT purification kit (USB, Cleveland, OH,

USA) following the manufacturer's instruction.

Sequencing was carried out using the Big Dye Terminator Cycle Sequencing Kit on

the DNA auto sequencer 3130x (Applied Biosystems Inc., Norwalk, CT, USA), following

the manufacturer’s instructions. Sequences were assembled and edited by SeqMan

(Lasergen v6 DNAstar), and congruent sequences obtained from both strands were

saved. A total of 92 sequences generated from this study were deposited in GenBank

(TABLE 1).

Phylogenetic analyses

The obtained DNA sequences were aligned by Clustal W using the default parameters

(Thompson et al. 1994) and edited manually when necessary using BioEdit ver. 7.0.5.2

(Hall 1999). Ambiguous regions having gaps were excluded from the analyses by

checking the alignment in BioEdit. Each of the three datasets (ITS-5.88, CAL and EF1-

a) including all sequences of European H. albidus and H. pseudoalbidus used in the

analyses of Queloz et al. (2011) and Japanese “L. albida” species were analyzed, rooted

with other Hymenoscyphus species as used in the analyses of Queloz et al. (2011) (H.

scutula, H. fructigenus, H. caudatus, H. serotinus for ITS-5.8S; H. fructigenus for CAL

and EF1-c ). 103 sequences downloaded from GenBank shown in Fic. 1-3 were used. A

combined sequence data set (ITS-5.8S and D1/D2 region) was also analyzed, including

seven “L. albida”, 24 Lambertella species, nine Hymenoscyphus species, and rooted with

Lachnum abnorme and Lachnum virgineum.

Maximum parsimony (MP) and maximum likelihood (ML) methods were used

to analyze all four datasets. The combination of these two methods was suggested as

a supportive way when constructing a phylogenetic tree (Kolaczkowski & Thornton

2004). The MP analyses were performed using PAUP version 4.0b10 (Swofford 2002).

Heuristic searches were conducted with tree bisection-reconnection branch swapping

algorithm (TBR), random sequence additions, and with Multrees option on. Bootstrap

values (BP) of the most parsimonious trees were obtained from 1000 replications.

The ML analyses were conducted using GARLI version 0.951 (Zwickl 2006). The

analyses were conducted using the GIR+G+I model (six general time reversible

substitution rates, assuming gamma rate heterogeneity and a proportion of invariable

sites), with model parameters estimated over the duration of specified runs. The tree

topology with the highest likelihood was inferred from 10 independent runs from random

starting trees. The “stopgen” parameters were set to 50,000,000 and other parameters

were set to default values. Bootstrap analyses were done using 1000 replications with the

same parameters as the initial tree search. The data matrix and trees have been deposited

in TreeBASE (http://purl.org/phylo/treebase/phylows/study /TB2:S12500).

Genetic variation analysis

DnaSP Version 4.0 software (Librado & Rozas 2009) was used to investigate the

genetic diversity among the European and Japanese populations of H. pseudoalbidus.

ee — — gZcSoLav gecsoLav ‘JoIg oueseN ‘TYs-epor) 61O00b-4-SNL TCLT-OA

. TURIO “A

‘ds : 2g edosoH] (sdiyftyd ‘M)

6 == eee remem omen Georeen —auienn oop pungues

S j ‘Jolg euuUNy ‘eurnsyesy TT T-d-SNL OOT-Od : ;

ee umouyuy, Bee CET ore ruin guineas eae is aeeanein aa ene ra siey ‘qd (yosieg)

¢ = = SLz7SoLav SezSoLav ; €8SQ1-d-SNL LETT-OA WNIUIBALA WNUYIVDT

a un8-Tureyeresiysy “Ok:

3 Pere rere rere r errr ere Perera rere rere rere rere rererererere rere rr rer reer ecer rere reer rarer ere re rere rererererererrrerrrrrrrrirsry Oo IWOISUILLIDY Fede reer eee reneseaeneseeses Ge a ee eee Baie MKS | Ae ea eRe Gia eg) Vag fee yuoun¢y wanes

aS — — blLe7SoLav vecSsoLav snxvjojoyday J ereMerey 6099T-4-SNL QIT?-0d 2» sauTeHY *H’[ (UO)

xs ‘UNS-TUIeyeIesIysy :

ag pe ae a rent ele Stn Mie DR on, are ae, un He en trie eben ee ee Ae Ge AAA A Races mee Adee etl, Met ickarece rahe Merb acts enn eM aoe nate hs gaaiecaes AN dda held Oo

ec Somerert sores A en Neat ee eM CEE TE GR st FED] MOTT 5. OEE AS EOD) OEOOE SN EGON es axuge eds Saud Osoueuny..

3 — — zZ7SoLav z€zSoLav UI9}$ SSBIDy ‘Jaig ouesey ‘TYys-epac L€00v-d-SNL LeLt-oa 1 ‘ds Bes Gtetnaionia

4 eee rere errr ere rere ee ee ree rere ere ee rere eerreeerrer ere rere reer rere rere ere rere reer ee ere ee eee eerie ee reer ere ree eer errr errr eee erreec cere sere ter eee Peer er eee rrret eS Teer IT Teeter eT T ee eee eee er Ea TTTETTITe Teer rete reer ee eeee rete rere eee eee eee eee ve Srrerrrerere rere rercirrr tries S$ r wdc (S13 Finaee

= — — tLcSoLav TEcTSoLav = VN Bore wnsvgsay

Be Sct ee meee oe ea pera sr SU SOU DIET x

2 =) = LozSoLav of 7S oLav — — WN b6FT-Od

- — — 69cSoLav 6zzSoLav — — VN €6VT-Od

= ih aa gotSoLav gzzSoLav —_— - VN Z6VT-Od ulys ‘dH 28 Ue Di

x = oe Q9eSOLEY LETS OLEY nn ee en ee ey ce WN. vevcnsntenen EORTOH,_, SPUOM NAS styfosoUsuNET

— — oLzSoLav ttSoLav Pqort4 OY O@TT-d-SNL €60T-O04 APTN). Sea reef

2 OSyuUIL) JO Fea] ‘TYSeUI-OY-EpeMO], 2 snyddosouamAyy

setuseeeuannntensennanntnsnnnuase sesetsnnensnne erecyeere es ee a rags ee eas ee sees wean pe praise nara seine

LizSoLav ttzSoLav bozSoLav — bzzSoLav ‘Jorg oursey “errepesng L1g/T-d-SNL WN

gtzSoLav o1zSoLav €9zSoLav— ss ExzSoLav ‘Jold OurseN ‘eirepesng vLoob-d-SNL VN

€1zSoLav LotSoLav ogzSolav — oztSoZav ‘Je1d OplepfoH ‘esowyD TS00F-d-SNL 664c-0a

zIcSoLav gozSoLav 6SzSoLav 61zSoLaVv ‘fold OprexpjoH ‘Weqny €voor-d-SNL £627-Od

GtzSoLav 6ozSoLav = gSzSoZav—s gu. tSoZav ‘Jord oursey ‘errepesng TQLTI-d-SNL SvVT-Od

bpizsoLav gozsoLav 9zSolav — tzzSoZav ‘Jold OurseN ‘errepesng €OSTI-d-SNL VN

— — — — ‘Jolg oueseN ‘Tys-epa- 7907 S-4-SNL VN

- —s = _ sid OPPePIOH 0907 S-d-SN.L

TYS-TeUloyeUo], VN

vounyspuvut (.YPIQY vyjaj4aquivT,,

= — i ‘JoIg OprexpyoH ‘eqnyz TQOTS-4-SNL se) snpiqwwopnasd

ixPedd snyddasouamA yy

zQOTSOLAV TTTSOLAV 0 3]019q VN

D- Td TvO cata SL ALVULSANS KLITVOO'T] NaWIOddS ‘pc caeban Saloadds

"ON NOISSHOOV ANVGNAL) quod

‘Apnys yuaseid oy} ul pasn ssouonbeas pur ‘sainynd sind ‘suawdeds | aATAVI,

30 ... Zhao & al.

LSz7SoLav

9SzSoLav

‘Juasaid Jou sayeTOST UsYM UOTIeI}X9 WNC JOF pasn aiam erayjody ‘ajqeytear jou :WN ,

Meter cee

2g SuURNYZ “AM

— = L6zS OLAV gtoOov-4-SNL VN (NO *H'S) sisuauvuund

— — 96cSoLav ds snuig Jo yueig $€00v-4-SNL VN VIJ2JAaqQuiv T

Te a ei aeteeniad SMUT TOE ha, feel ee REN Ee DOs TOGA IRNIE Bic ce RNa Ra Rata RNC lh cid a

— = v6cSoLav pagaol Z700v-d-SNL VN L ds vyjaqsaquu T

VIIJaULDD JO Je]

voiuodvl

DqnIny Jo JeaT

‘Jolg ojoureuINy

‘TYs-TYNyALY]

obzSoLav

LyzSoLav

Sv7SoLav

br7SoLav

€vz7SoLav

thzSoLav

tvzSoLav

obzSoLav

vaiuodvl

DIS] JO BONA

‘Jog emeseury

‘TYys-eIeMePO

odo], “ny-epodryD

oAVOL, “My-epodryD

— — 6gzSoZLav

a a ggzSoLav

= = SgcSoLav

<2 i 9gzSoLav

— — LgzSoLav

bgzsoLav

— — €gzSoLav

— — 7QtTSOLAV

— — TgzSoLav

— — ogzSoLav

— — 6Lz7SOLav

0-TSH TVO cd-Td

"ON NOISSHOOV INVGNAL)

6¢z7SoZLav

SLI

snatuodvl

SNJOTVIY JO JeIT

ALVULSANS

oAYO], ‘ny-oAUNG

KLITVOOT

€€QZLT-d-SNL O€CI-Od z ‘ds vyajsaquy yt

VN V689 -OUAN

LSTTE-A-SNL O6TT-Od

QTOO€-d-SNL S861-Od

¥669¢-A-SNL SbQz7-Od

VN O6hT-Oa4 1 ‘ds vyajsaquvT

VN 6ghT-Od

VN 88hT-Od

VN Lgvt-oa

VN £906 -OUdN

ZOVOE-A-SNL 6g€7t-Od WHOH S2M

-1UL09 DIJAJAIQUIDT

aan.LIno

NHWI0adS SHIOddS

aund

ponunuor) [ ATaVy,

Hymenoscyphus pseudoalbidus in Japan ... 31

The alignments of the ITS region, and the portion of CAL and EF1l-a regions were

separately compared without deletions, and the genetic diversity parameter Pi was

calculated.

Results

Taxonomic reconsideration of Japanese “Lambertella albida” based on three loci

The aligned ITS-5.8S rDNA dataset comprised 454 bp, and 11 ambiguously

aligned sites (site nos. 100-102, 336-343) were excluded from the analyses. Three

most parsimonious trees were obtained [tree length (TL): 67 steps, consistency

index (CI): 0.8060, retention index (RI): 0.9615, rescaled consistency index

(RC): 0.7750]; one is shown in Fic. 1. The ML analysis yielded an optimal tree

with the best likelihood (log likelihood = -1051.7137), topologically congruent

with this MP tree, which highly supported monophyly of the ingroup. In the

ingroup, two major clades were supported with high BP (BP >80%) confirming

Queloz et al. (2011); Japanese materials were included in the strongly supported

(92/90% ML BP/MP BP) clade with European H. pseudoalbidus.

The aligned CAL dataset comprised 460 bp, and 18 ambiguously aligned

sites (site nos. 38-42, 72-74, 82, 176-177, 201, 216-217, 247-250) were

excluded from the analyses. One of the 10 MP trees obtained (TL: 28 steps, CI:

0.9286, RI: 0.9888, RC: 0.9182) is shown in Fic. 2. The ML tree (log likelihood

= -1110.7132) showed the same topology with one MP tree. Here also two

major clades were highly supported and Japanese materials were included in

the European H. pseudoalbidus clade with high support.

The aligned EF1-a dataset comprised 553 bp with 31 ambiguously aligned

sites (site nos. 35-36, 86-87, 121-127, 221-228, 233-239, 453-456) excluded

from further analysis. Only one parsimonious tree (Fic. 3) was obtained

(TL: 28 steps, CI: 0.8929, RI: 0.9779, RC: 0.8732). The ML tree (log likelihood =

-1145.5894) did not show any topological conflict with the MP tree. Also, two

major clades were obtained, one consisting of European H. albidus with high

support and the other (including Japanese “L. albida” and H. pseudoalbidus)

that was moderately supported (61/-%). In the latter clade, five out of six

Japanese “L. albida” materials grouped with European H. pseudoalbidus with

high support (97/97%).

Morphology of Japanese “Lambertella albida”

The presence of croziers at the base of asci was observed in all nine Japanese

“L. albida” specimens (Fic. 4). White (1944) observed the absence of croziers in

the type of H. albidus; Baral (Baral & Bemmann,in prep.) observed the presence

of croziers in the type of H. pseudoalbidus, and he and Bemmann examined

numerous European materials (including some specimens treated by Queloz et

al. 2011) morphologically. The presence of basal croziers was found to be a clear

distinguishing character between the two taxa (Baral & Bemmann,jin prep.).

32 ... Zhao & al.

IGU586922 Hymenoscyptus pseudodbidus

IGU536923 H ymenoscyphus pseudodlbidus

IGU536924 H ymenoscyphus pseudodbidus

IGU586925 Hymenoscyphus pseudoalbidus

FJ597975 Hymenoscyphus pseudoalbidus

AB705221 “Lambertella albida” TNS-F-12503

'4B505220 “Lambertella albida” FC-2799

GU586921 Hymenoscyphus pseudoalbidus

AB705219“Lambertella albida” FC-2793

AB705222 “Lambertella albida” TNS-F-52061

|AB705223 “Lambertella albida” TNS-F-40074

AB705218 “Lambertella albida” FC-1445

AB705224“Lambertella albida” TNS-F-17817

GU586901 Hymenoscyphus pseudoalbidus

IGU586902 H ymenoscyphus pseudoalbidus

IGU586903 H ymenoscyphus pseudoalbidus

IGU536904 H ymenoscyphus pseudoalbidus

(GU586905 H ymenoscyphus pseudoalbidus

IGU586906 Hymenoscyphus pseudoalbidus

100/99 |

Fic. 1. One of three most parsimonious trees based on ITS rDNA sequences from Japanese

“Lambertella albida” and European Hymenoscyphus albidus and H. pseudoalbidus. Numbers

above the branches are maximum parsimony (MP) bootstrap values (BP) followed by maximum

likelihood (ML) BP >50% in 1000 replications. Tree length: 67 steps; consistency index: 0.8060;

retention index: 0.9615; rescaled consistency index: 0.7750. EU: European materials; JP: Japanese

materials

GU586963 Hymenoscyphus pseudoalbidus

GU586968 Hymenoscyphus pseudoalbidus

GU586967 Hy menoscy phus pseudoalbidus

GU586964 Hymenoscy phus pseudoalbidus

GU586970 Hymenoscy phus pseudoalbidus

62/65 | Gus36962 Hymenoscyphus pseudoalbidus

GU586969 Hy menoscy phus pseudoalbidus

GU586965 Hy menoscy phus pseudoalbidus

GU586966 Hy menoscy phus pseudoalbidus

AB705209“Lambertella albida” FC-1445

97/97

88/92

AB705213“Lambertella albida” FC-2799

GU586959 Hymenoscyphus albidus

GU586960 Hy menoscy phus albidus

GU586958 Hymenoscy phus albidus

GU586957 Hy menoscyphus albidus

98/98 | GUS86955 Hymenoscyphus albidus

GU586956 Hymenoscy phus albidus

GU586953 Hymenoscyphus albidus

GU586954 Hy menoscy phus albidus

GU586961 Hymenoscy phus albidus

GU586971 Hymenoscyphus fiuctigenus

GU586963 Hymenoscy phus pseudoalbidus

GU586968 Hy menoscy phus pseudoalbidus

GU586967 Hymenoscyphus pseudoalbidus

GU586964 Hy menoscy phus pseudoalbidus

GU586970 Hy menoscy phus pseudoalbidus

62/65 | Gu536962 Hymenoscyphus pseudoalbidus

GU586969 Hymenoscy phus pseudoalbidus

GU586965 Hymenoscy phus pseudoalbidus

GU586966 Hy menoscy phus pseudoalbidus

AB705209*“Lambertella albida” FC-1445

88/92

AB705213“Lambertella albida” FC-2799

GU586959 Hymenoscyphus albidus

GU586960 Hymenoscy phus albidus

GU586958 Hy menoscy phus albidus

GU586957 Hymenoscyphus albidus

98/981 GU586955 Hymenoscyphus albidus

GU586956 Hy menoscy phus albidus

GU586953 Hymenoscyphus albidus

GU586954 Hymenoscyphus albidus

GU586961 Hymenoscyphus albidus

GU586971 Hymenoscyphus fructigenus

100/99 | 4B705216“Lambertella albida” TNS-F-40074

AB705212“Lambertella albida” FC-2793

AB705214"Lambertella albida” TNS-F-12503

AB705217"Lambertella albida” TNS-F-17817

Hymenoscyphus pseudoalbidus in Japan ... 33

Fic. 2. One of ten most parsimonious

trees based on CAL gene sequence

data of Japanese “Lambertella albida”

with European Hymenoscyphus

albidus and H. __ pseudoalbidus.

Numbers above the branches are

bootstrap values (BP) in maximum

parsimony analysis (MP) followed

by BS from maximum likelihood

(ML) >50% in 1000 replications. Tree

length: 28 steps; consistency index:

0.9286; retention index: 0.9888;

rescaled consistency index: 0.9182.

EU: European materials; JP: Japanese

materials

100/99 | AB705216“Lambertella albida” TNS-F-40074

AB705212“Lambertella albida” FC-2793

AB705214“Lambertella albida” TNS-F-12503

AB705217“Lambertella albida” TNS-F-17817

Fic. 3. Maximum parsimony tree

Jp based on EF1-a gene sequences from

Japanese “Lambertella albida” and

European Hymenoscyphus albidus and

H. pseudoalbidus. Numbers above the

branches are maximum parsimony

(MP) bootstrap values (BP) followed

by maximum likelihood (ML) BP

>50% in 1000 replications. Tree

length: 28 steps; consistency index:

0.8929; retention index: 0.9779;

rescaled consistency index: 0.8732. “-

”: BP <50%; EU: European materials;

JP: Japanese materials

34 ... Zhao & al.

Fic. 4. Representative photos of croziers at the base of asci observed in Japanese materials of

Hymenoscyphus pseudoalbidus. Mounted in 1% phloxine B solution (A. TNS-F-12503; B. TNS-F-

52061). Scale = 20 um

The conidia and conidiophores of Chalara fraxinea were obtained on MEA,

but conidia did not germinate in any of the isolates during the prolonged

incubation up to one month at room temperature.

Results from the above molecular, morphological, and cultural analyses

all indicate that Japanese “L. albida” materials should be re-identified as

H. pseudoalbidus.

Comparison of genetic variation between Japanese and European materials

Japanese H. pseudoalbidus showed a higher genetic variation compared with

European H. pseudoalbidus and H. albidus in all the three genes, whereas no

genetic difference was observed within European H. pseudoalbidus for CAL

and EF1-a genes, and within European H. albidus for CAL gene. (TABLE 2).

Comparison of nucleotide characters between Japanese and European materials

Nucleotide differences in the EFl-a, CAL and ITS genes were found between

European H. pseudoalbidus and H. albidus (Queloz et al. l.c.). Although most

nucleotides from Japanese H. pseudoalbidus populations matched those from

European H. pseudoalbidus populations, some positions deviated. Unexpectedly,

these deviating positions consistently showed the same nucleotides as H. albidus.

EFl-a gene nucleotides were most diverse among Japanese H. pseudoalbidus

materials (TABLE 3). When comparing the 22 positions in which European

H. pseudoalbidus differed from H. albidus, Japanese material showed

concordance with H. pseudoalbidus in 7 positions, while the remaining 15

positions showed variation within Japanese materials. Thereby, each position

that differed from European H. pseudoalbidus showed the nucleotide that

characterized H. albidus. This phenomenon occurred mainly in positions

included in the definition (protologue) of H. pseudoalbidus (Queloz et al. 2011),

but also in 4 additional positions (232-235 in TABLE 3) that were not included

Hymenoscyphus pseudoalbidus in Japan ...

‘snpiqv ‘H 7WH ‘snpiqjvopnasd "H :qH ‘esouede{ :g{ sueadoimg :q¥q Suonruyep jo NE :N <(enso]o}01d) snpiqvopnasd ‘Y Jo UOTTUYEp ay} Ul pepnpuT suOTIsog =X ,

dvd : avo L L 3) 5 5) dvd Vv 5) re) Vv L a @ Vv D 5) f3) Vv fe) t3) VH na

dvd : avo L L Vv 3) a advo Vv a fe) 3) L e) re) Vv 2) L fe) a) L 6627-04

iT Vv 3) L Vv Vv ) 5 2) iL A 5 a) Vv a) f) 2) L e) a ZIgZt-d-SNL :

a Vv 9 it Vv Vv 3) i) 9 iL L i) fe) Vv 9 D 9 L > 4a ‘COSTI-d-SNL : aH

L Vv 9 9 3) Vv i) i) 9 1 L D fe) Vv i 9 3 a S- iia "6 Le-0d fal

L Vv a) a) 3) Vv 3) 3) a) L L ) 9 > . f) it 2 ie $LOOF EL SNL |

12 ae Beans on crn i fons Beatty lll ee ie a nl on @ aa

L : V¥ Geom vo: vy am Peo: «6LlUflUL Oe vo: lL Oo: «6 Oe 6LlfV: dH na

SE : vet 3 €€% : TET : ESH : ODT : Tht : QET + OFT : ETT : STC : TIt : 661 : THT : GBT +: OBVT : QghT : EhT : Let : 68 : Lo : OF : NOLLISOg

N N : N i N f A G KR EF AR FG KR EAR |G KR ER GF KR ER EP RG KR ER GF KR PE KR EF KR ERG REAR: NOLLINIAIQ

‘snpiqy ‘H ueodoing pue

‘( Dplgy vpyjaj4aquvT,,) snpiqjpopnasd ‘fF asouede ‘snpiqvopnasd ‘YH ueadoing ul suostzedurod sproapnu ous 10-1 Jq “¢ ATAVI,

(Z=U) TZ000°0 (9=U) 881700 (6=") 00000°0 0-TAT

eA iie ION Ea Sas yh a RO OO A OR aat

(Sz=U) 96000°0 (Z=") Z8700°0 (S¢=U) F€000°0 SLI

VH ueadoing dH asouede( dH ueadoing

DOT

(td) Avszoarp apyosponN

‘snpiqv ‘H ueadoing pue

‘(_ vplgy vyjajsaquvT,,) snpiqjpopnasd ‘FY asouede{ ‘snpiqyvopnasd ‘YH uesdoing jo sutesjs usamyaq (1g) AJSIOATP 9PIJOITONN "7 ATAV,

36 ... Zhao & al.

in the protologue. One strain (FC-2799) shared 14 nucleotides with H. albidus

and 8 with H. pseudoalbidus, suggesting it is intermediate between these two

species (Fic. 3, TABLE 3).

However, strain FC-2799 and four other Japanese materials concurred with

H. pseudoalbidus in all 21 CAL gene positions where the European H. pseudo-

albidus differed from H. albidus. Within these positions, some Japanese

specimens showed variation at position 244 (specimens: TNS-F-40043, TNS-

F-12503) and position 266 (specimen: TNS-F-12503) where they shared,

instead, nucleotides with H. albidus. Further CAL region variation was noted

at positions where European H. albidus and H. pseudoalbidus do not differ.

In the ITS rDNA, Japanese materials concurred with European H. pseudo-

albidus except for two positions (site nos. 83, 124) at which all Japanese materials

showed the character of H. albidus.

Generic taxonomy of Hymenoscyphus pseudoalbidus

The combined ITS-5.8S and D1/D2 dataset comprised 1183 bp (582 bp for

ITS-5.8S rDNA, 601 bp for D1/D2), and 15 ambiguously aligned ITS sites (site

nos. 80-81, 107-113, 127, 140-141, 206, 581-582) and 17 ambiguously aligned

D1/D2 sites (site nos. 583-596, 781-782, 850) were excluded from the analysis.

One of the 16406 equally parsimonious trees obtained (TL: 67 steps, CI: 0.8060,

RI: 0.9615, RC: 0.7750) is shown in Fic. 5. The ML tree (log likelihood = -

6682.1630) did not show any topological conflict with the MP trees. In the MP

consensus tree and the best ML tree, two major clades were generated, one

strongly supported (100/100%) and the other moderately supported (77/80%).

The more strongly supported clade was composed solely of Lambertella

species, including the type species L. corni-maris. The other clade included the

Hymenoscyphus species and L. yunnanensis; H. pseudoalbidus grouped here

with H. fructigenus (type species of Hymenoscyphus) with 99% BP support.

This phylogenetic analysis shows H. pseudoalbidus as more distantly related to

the Lambertella core group (including the type) and more closely related to the

Hymenoscyphus core group (including the type).

Discussion

Based on the rapid expansion and high intensity of ash dieback in Europe,

H. pseudoalbidus was considered as an invasive alien organism (Husson et al.

2011; Queloz et al. 2011; Timmermann et al. 2011). However, until now its

Fic. 5. One of 16406 most parsimonious trees inferred from combined dataset of ITS and D1-

D2 sequences showing the relationship of Japanese Hymenoscyphus pseudoalbidus with other

Hymenoscyphus* and Lambertella species. Numbers above the branches are maximum parsimony

(MP) bootstrap values (BP) followed by maximum likelihood (ML) BP >50% in 1000 replications.

Tree length: 67 steps; consistency index: 0.8060; retention index: 0.9615; rescaled consistency

index: 0.7750. “-”: BP <50%.

Hymenoscyphus pseudoalbidus in Japan ...

FC-1488 Lambertella corni-maris

FC-1489 Lamb ertella corni-maris

FC-1487Lambertella corni-maris

FC-1490 Lamb ertella corni-maris

95/ FC-2674 Lambertella corm-maris

, FC-2389 Lamertella comi-maris

100/100

FC-1230Lambertella sp.2

100/100 FC-2726 Lamb ertella sp.3

TNS-F-40038Lambertella sp.5

TNS-F-40036Lambertella sp.4

FC-1985Lambertella sp. 1

100/100 |Fc.2645Lambertella sp.1

FC-1190Lambertella sp. 1

58/51

94/99

100/100 FC-2675 Lamb ertella sp. 1

100/100 TNS-F-40026Lambertella sp.6

TNS-F-40027Lambertella sp.7

89/- TNS-F-40031Lambertella sp.8

FC-2718Lambertella advenula

100/- FC-2722Lambertella advenula

FC-1007Lambertella advenula

FC-2727Hymenoscyphus sp.1

98/-

FC-1093Hymenoscyphus ginkgonis

100/100 FC-1494Hymenoscyphus ginkgonis

FC-1491 Hymenoscyphus ginkgonis

77/80 | 83/- FC-1493Hymenoscyphus ginkgonis

| FC-1492Hymenoscyphus ginkgonis

991100) TNS-F-40028Lambertella yunnanensis

90/-'TNS-F-40035Lambertella yunnanensis

FC-2725 Hymenoscyphus sp.2

95/97 98/91 FC-2375Hymenoscyphus fructigenus

FC-2676 “Hymenoscyphus herb arum”

FC-2793Hymenoscyphus pseudoalbidus

99/99 TN-S-F-12503Hymenoscyphus pseudoalbidus

100/100] |FC-2799 Hymenoscyphus pseudoalbidus

FC-1445 Hymenoscyphus pseudo abidus

TNS-F-52061 Hymenoscyphus pseudo albidus

TNS-F-40074 Hymenoscyphus pseudo albidus

TN-S-F-17817 Hymenoscyphus pseudoalbidus

FC-2137Lachnum virgineum

FC-2118Lachnum abnorme

38 ... Zhao & al.

origin has remained uncertain. Field inoculations showed that Fraxinus ornus,

closely related to many Asian ash species, is less susceptible to infection than

the European common ash, F. excelsior (Krautler & Kirisits 2011), leading

Queloz et al. (2011) to suggest a possible Asian origin for the ash dieback

pathogen. In addition, E mandshurica, a northeastern Asian ash ornamental

introduced in Europe, was only slightly affected by ash dieback in southeastern

Estonia (Drenkhan & Hanso 2010). It must be mentioned, however, that

F. mandshurica is not closely related to FE ornus but is, instead, close to

FE. excelsior (Wallander 2008). Pathogenicity of H. pseudoalbidus to indigenous

ash has not been reported in Japan.

To clarify the origin of the pathogen, population genetic studies based

on polymorphic microsatellite markers, have shown that H. pseudoalbidus

possesses low genetic variation among and within populations (Bengtsson et

al. 2012, Gross et al. 2011). The genetic homogeneity of European H. pseudo-

albidus can be explained by the founder effect (characteristic of invasive

populations established by a small number of individuals). In the present study,

Japanese H. pseudoalbidus showed a higher genetic variation than European

populations, and Japanese populations were more basal in the phylogenetic

analyses. Together with a very low susceptibility of local Fraxinus, this does not

contradict an Asian origin for H. pseudoalbidus. In order to unravel the origin

of H. pseudoalbidus, however, further genetic comparisons of populations from

other Asian regions are needed.

Comparison of the ITS, CAL and EF1l-a gene nucleotides has shown the

European H. pseudoalbidus and H. albidus to be extremely stable and with clear

differences in various positions. Although Japanese H. pseudoalbidus shared

most characters with the European H. pseudoalbidus, some nucleotide positions

varied. Especially in the EFl-a gene, strain FC-2799 appeared intermediate

between H. pseudoalbidus and H. albidus. Records of H. albidus in Japan are

unknown up to now, and the reason for the intermediate nucleotide patterns

needs further study. Possibly the mixed nucleotide positions in Japanese

materials suggests a common ancestor of H. albidus and H. pseudoalbidus from

eastern Asia.

Hosoya et al. (1993) was the first to report the presence of an anamorphic

structure in H. pseudoalbidus, based on Japanese material. At the time, the

authors regarded the structure as spermatia due to its minute size and the fact

that conidial germination was not observed. In the present study, the absence of

conidial germination was again noted (on MEA). This suggests that the asexual

state of H. pseudoalbidus does not contribute to its long-range dispersal and

that pathogen dispersal is limited to ascospores, as previously suggested (e.g.

Gross et al. 2011, Timmermann et al. 2011, Gross et al. 2012).

Hymenoscyphus pseudoalbidus in Japan ... 39

Lambertella was chiefly characterized by the presence of a substratal stroma

and ascospores that may become brown at various stages of spore development

(Dumont 1971, Korf & Zhuang 1985). Our current phylogenetic analysis (Fic.

5) places Lambertella species in both of the two major clades, suggesting that

the genus is not monophyletic. The molecular phylogeny of Holst-Jensen et

al. (1997) also suggested polyphyly in Lambertella. Korf (1982) transferred

Hymenoscyphus albidus to Lambertella because it has the major morphological

characters of Lambertella (Hosoya etal. 1993). Both substratal stroma and brown

ascospores were observed in H. pseudoalbidus by Kowalski & Holdenrieder

(2009), but the authors retained this fungus in Hymenoscyphus.

Our phylogenetic analyses situate H. pseudoalbidus in the Hymenoscyphus

group, suggesting that Hymenoscyphus is the more appropriate genus to

accommodate this fungus at present. This is in concordance with morphological

characteristics, such as the Hymenoscyphus-type of ascus apical ring and the

heteropolar scutuloid ascospores in H. pseudoalbidus (Baral & Bemmann, in

prep.). The Hymenoscyphus clade also contains H. ginkgonis, another species

with a substratal stroma and ascospores becoming brown when germinated

(although these characters were not mentioned by Han & Shin, 2008). In

conclusion, the two major characters (presence of substratal stroma and brown

ascospores) currently used to circumscribe the genus Lambertella seem to have

resulted from convergent evolution, and the generic delimitation of Lambertella

needs to be reconsidered.

Acknowledgments

The authors would like to express their thanks to Prof. R.P. Korf (Cornell University,

US.A.) and Prof. O. Holdenrieder (Institute of Integrative Biology, Switzerland) for

serving as pre-submission reviewers and for their valuable suggestions. This project is

supported by the integrated research on biodiversity of interspecies relationships in the

National Museum of Nature and Science, and Grant-in-Aid for Scientific Research (C)

22570102.

Literature cited

Bakys R, Vasaitis R, Barklund P, Thomsen IM, Stenlid J. 2009. Occurrence and pathogenicity of

fungi in necrotic and non-symptomatic shoots of declining common ash (Fraxinus excelsior) in

Sweden. Eur. J. Forest Res.128: 51-60. http://dx.doi.org/10.1007/s10342-008-0238-2

Baral HO. 1984. Taxonomische und okologische Studien tiber die Koniferen bewohnenden

europaischen Arten der Gattung Lachnellula Karsten. Beitrage Kenntnis Pilze Mitteleuropas

1: 143-156.

Baral HO, Bemmann M (in prep.). A light-microscopical study of Hymenoscyphus albidus, H.

pseudoalbidus and related stroma-forming species, including the non-foliicolous H. serotinus.

Bengtsson SBK, Vasaitis R, Kirisits T, Solheim H, Stenlid J. 2012. Population structure of

Hymenoscyphus pseudoalbidus and its genetic relationship to Hymenoscyphus albidus. Fungal

Ecol. 5: 147-153. http://dx.doi.org/10.1016/j.funeco.2011.10.004

AO ... Zhao & al.

Carbone I, Kohn LM. 1999. A method for designing primer sets for speciation studies in filamentous

ascomycetes. Mycologia 91: 553-556. http://dx.doi.org/10.2307/3761358

Carpenter SE. 1981. Monograph of Crocicreas (Ascomycetes, Helotiales, Leotiaceae). Mem. New

York Bot. Gdn. 33: 1-290.

Drenkhan R, Hanso M. 2010. New host species for Chalara fraxinea. New Disease Reports 22: 16.

http://dx.doi.org/10.5197/j.2044-0588.2010.022.016

Dumont KP. 1971. Sclerotiniaceae Il. Lambertella. Mem. N. Y. Bot. Gdn. 22: 1-178.

Gross A, Griinig CR, Queloz V, Holdenrieder O. 2011. A molecular toolkit for population genetic

investigations of the ash dieback pathogen Hymenoscyphus pseudoalbidus. For. Path. 42:

252-264. http://dx.doi.org/10.1111/j.1439-0329.2011.00751.x

Gross A, Zaffarano PL, Duo A, Griinig CR. 2012. Reproductive mode and life cycle of the

ash dieback pathogen Hymenoscyphus pseudoalbidus. Fungal Genet. Biol. 49: 977-986.

http://dx.doi.org/10.1016/j.fgb.2012.08.008

Griinig CR, Brunner PC, Duo A, Sieber TN. 2007. Suitability of methods for species recognition

in the Phialocephala fortinii-Acephala applanata species complex using DNA analysis. Fungal

Genet. Biol. 44: 773-788. http://dx.doi.org/10.1016/j.fgb.2006.12.008

Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program

for Windows 95/98/NTT. Nucleic Acids Symposium Series 41:95-98.

Han JG, Shin HD. 2008. Hymenoscyphus ginkgonis sp. nov. growing on leaves of Ginkgo biloba.

Mycotaxon 103: 189-195.

Holst-Jensen A, Kohn ML, Schumacher T. 1997. Nuclear rDNA Phylogeny of the Sclerotiniaceae.

Mycologia 86: 885-899. http://dx.doi.org/10.2307/3761109

Hosaka K. 2009. Phylogeography of the genus Pisolithus revisited with some additional taxa from

New Caledonia and Japan. Bull. Natn. Mus. Nat. Sci., Ser. B 35: 151-167.

Hosaka K, Castellano MA. 2008. Molecular phylogenetics of Geastrales with special emphasis on

the position of Sclerogaster. Bull. Natn. Mus. Nat. Sci., Ser. B 34: 161-173.

Hosoya T, Otani Y, Furuya K. 1993. Materials for the fungus flora of Japan (46). Trans. Mycol. Soc.

Japan 34: 429-432.

Huhtinen S. 1989. A monograph of Hyaloscypha and allied genera. Karstenia 29: 45-252.

Husson C, Scala B, Caél O, Frey P, Feau N, Ioos R, Margais B. 2011. Chalara fraxinea is an invasive

pathogen in France. Eur. J. Plant Pathol. 130: 311-324.

http://dx.doi.org/10.1007/s10658-011-9755-9

Kolaczkowski B, Thornton JW. 2004. Performance of maximum parsimony and likelihood

phylogenetics when evolution is heterogeneous. Nature 431: 980-984.

http://dx.doi.org/10.1038/nature02917

Korf RP. 1982. New combination and a new name for discomycetes illustrated by Boudier in the

Icones Mycologicae. Mycotaxon 14: 1-2.

Korf RP, Zhuang WY. 1985. A synoptic key to the species of Lambertella (Sclerotiniaceae), with

comments on a version prepared for TAXADAT, Anderegg’s computer program. Mycotaxon

24: 361-386.

Kowalski T. 2006. Chalara fraxinea sp. nov. associated with dieback of ash (Fraxinus excelsior) in

Poland. Forest Pathol. 36: 264-270. http://dx.doi.org/10.1111/j.1439-0329.2006.00453.x

Kowalski T, Holdenrieder O. 2009. The teleomorph of Chalara fraxinea, the causal agent of ash

dieback. Forest Pathol. 39: 304-308. http://dx.doi.org/10.1111/j.1439-0329.2008.00589.x

Krautler K, Kirisits T. 2011. The ash dieback pathogen Hymenoscyphus pseudoalbidus is associated

with leaf symptoms on ash species (Fraxinus spp.). IUFRO 2011 WP 7.02.02 Global Change

and Forest Diseases: New Threats, New Strategies: p.102.

Hymenoscyphus pseudoalbidus in Japan ... 41

Librado P, Rozas J. 2009. DnaSP v5: A software for comprehensive analysis of DNA polymorphism

data. Bioinformatics 25: 1451-1452. http://dx.doi.org/10.1093/bioinformatics/btp187

O’Donnell K. 1993. Fusarium and its near relatives. 225-233, in: DR Reynolds, JW Taylor (eds).

The fungal holomorph: mitotic, meiotic and pleomorphic speciation in fungal systematics.

CAB International, Wallingford.

Queloz V, Griinig CR, Berndt R, Kowalski T, Sieber TN, Holdenrieder O. 2011. Cryptic speciation

in Hymenoscyphus albidus. For. Path. 41: 133-142.

http://dx.doi.org/10.1111/j.1439-0329.2010.00645.x

Skerman VBD. 1968. A new type of micromanipulator and microforge. J. Gen. Microbiol. 54:

287-297.

Swofford DL. 2002. PAUP*: phylogenetic analysis using parsimony and other methods (*PAUP

version 4.0 beta 10). Sinauer, Sunderland.

Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive

multiple sequence alignment through sequence weighting, position specific gap penalties and

weight matrix choice. Nucleic Acids Res. 22: 4673-4680.

http://dx.doi.org/10.1093/nar/22.22.4673

Timmermann V, Borja I, Hietala AM, Kirisits T, Solheim H. 2011. Ash dieback: pathogen spread

and diurnal patterns of ascospore dispersal, with special emphasis on Norway. OEPP/EPPO

Bulletin 41: 14-20.

Wallander E. 2008. Systematics of Fraxinus (Oleaceae) and evolution of dioecy. Plant Syst. Evol.

273: 25-49.

White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal

RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: A guide to

methods and applications. Academic Press, Inc.: New York.

White WL. 1942. Studies in the genus Helotium, I - A review of the species described by Peck.

Mycologia 34: 154-179.

White WL. 1943. Studies in the genus Helotium, III - history and diagnosis of certain European and

North American foliicolous species. Farlowia 1: 135-170.

White WL. 1944. Studies in the genus Helotium, IV - some miscellaneous species. Farlowia 1:

599-617.

Zwickl DJ. 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological

sequence datasets under the maximum likelihood criterion. Ph.D. dissertation, The University

of Texas at Austin.

MY COTAXON

http://dx.doi.org/10.5248/122.43

Volume 122, pp. 43-50 October-December 2012

New records of Scleroderma species

(Sclerodermataceae, Agaricomycetes) from Pakistan

N. YousAr*, A.N. KHALID & A.R. NIAZI

Department of Botany, University of the Punjab, Quaid-e-Azam Campus, Lahore, 54590, Pakistan

* CORRESPONDENCE TO: nousheenyousaf@gmail.com

ABSTRACT — During a survey of gasteroid basidiomycetes from Pakistan, three Scleroderma

species (S. areolatum, S. chevalieri, S. dictyosporum) have been identified that represent new

records from Pakistan. A key to the known Scleroderma species from Pakistan is presented.

Key worps — Boletales, earth balls, fungal taxonomy, Khyber Pakhtun Khwa, Nathia gali,

Neelum valley

Introduction

Scleroderma Pers. is an extensively studied genus (Guzman 1970, Sims et

al. 1997, Kasuya et al. 2002, Baseia & Galvao 2002, Yoshimi 2000, 2002). This

genus comprises 30 species worldwide, most of which occur in North America

(Guzman 1970, Kirk et al. 2008). Scleroderma species are thick-skinned earth

balls that are separated primarily based on basidiospore characters (Sims et al.

1995). These gasteroid basidiomycetes form ectomycorrhizal associations with

various trees and have a definite opening from which they eject their spores

(Marshall 1904, Jeffries 1999).

Five Scleroderma species have been recorded previously from Pakistan

(Ahmad et al. 1997). Continuing the survey of gasteroid basidiomycetes from

Pakistan (Khalid & Iqbal 1996, 2004, Sultan et al. 2001, Razzaq & Shahzad 2004,

2007, Iqbal et al. 2006, Sultana et al. 2007, Moreno et al. 2009), we collected

and identified three more Scleroderma species, which we describe here as an

addition to the gasteroid mycota of Pakistan.

Materials & methods

Slides were prepared by mounting a smear of spores in a drop of 5% KOH, lacto-

phenol and trypan blue. Spore ornamentation was observed under oil immersion (100x)

objective. Spore size was determined by measuring the diameter of at least forty spores

A4 ... Yousaf, Khalid & Niazi

including the ornamentation and then calculating the mean. Only mature spores were

selected for the measurements. Peridium thicknesses, glebal color, surface ornamentation

of basidiomata were also observed using 10x hand lens. Drawings were made with the

help of camera lucida and measurements were taken using ocular micrometer.

Taxonomy

Scleroderma areolatum Ehrenb., Sylv. mycol. berol. 15: 27 (1818) Fig. 1

BASIDIOMATA epigeous, <30 mm broad, 25 mm high, subglobose, attached

to the substratum by a thick mycelial base, forming a pseudostipe; pseudostipe

Fic. 1: Scleroderma areolatum. A. Basidiomata. B. Basidiospore. C. Exoperidial hyphae. D. Meso-

peridial hyphae. E. Endoperidial hyphae. E Tramal hyphae. Scale bars: A = 0.5 cm; B = 3.5 um;

C = 28 um; D, F= 14 um; E= 18 um.

Scleroderma spp. new to Pakistan ... 45

tough, often two basidiomata arise from the same tuft of mycelium.

RHIZOMORPHS white, thick, growing individually or in small groups. PERIDIUM

thin, <lmm thick, pale yellow to brown; basal portion smooth, without scales,

off white to pale yellow, upper part with brown spots like scales, dehiscence by

tearing away the apical portion. GLEBA powdery, dark purplish.

Basip1ospores brown, globose, echinulate, never reticulate, 12-18 um

in diam., echines <2.5 um long. TRAMAL HypuHaeE rarely septate, branched,

hyaline, with few amorphous material encrusted, <5.5 um wide, wall thickness

<1 um. ExoperiIpIuM composed of aseptate, branched hyphae, <7 um wide,

wall thickness <2.5 um. MESOPERIDIUM composed of aseptate, branched

hyphae, wall encrusted, <7 um wide, wall thickness 2.6 um. ENDOPERIDIUM

composed of septate, branched hyphae, <6.6 um wide, wall thickness <2.8 um.

SPECIMEN EXAMINED: PAKISTAN: KHYBER PAKHTUN Kuwa, Khanspur, Ayubia, ca.

2575 maz.s.L, solitary on ground, in Himalayan moist temperate forest, 12 Aug. 2007, N.

Yousaf NYG04 (LAH 120807).

ComMENTs: The ectomycorrhizal S. areolatum is a poisonous species (Yamada

& Katsuya 1995, Mason et al. 2000, Chen et al. 2006a,b) that is characterized

by non-reticulate, densely echinulate basidiospores, a distinctive diagnostic

feature, as other Scleroderma spp. examined have reticulate and sub-reticulate

basidiospores. Scleroderma areolatum is widely distributed in Asia, Australia,

Europe, North America, and South America (Lu et al. 1999, Giachini et al.

2000, Kasuya et al. 2002, Barroetavenia et al. 2005, Chen et al. 2006b).

Scleroderma chevalieri Guzman, Ciencia Méx. 25: 202 (1967) Fig. 2

BASIDIOMA epigeous, 45 mm broad, 40 mm high, subglobose, attached to

the substratum via a tuft of mycelium, latter some time aggregated to form

pseudostipe. RHIZOMORPHS white, thick. PERIDIUM <1 mm thick, hard, rough,

covered with patches of scales, mature specimen cracked at the upper portion,

dehiscence by the irregular splitting of the peridium. GLEBA pulverulent, pale

yellow, brown to olivaceous.

BasIp1ospores brown, globose, echinulate, partially reticulate or sub

reticulate, 11-17 um in diam., echines <3 um long. TRAMAL HyPHAE aseptate,

branched, hyaline, with clamp connections, <5.3 um wide, wall thickness <1.3

um. EXOPERIDIUM composed of septate, unbranched hyphae; <8.8 um wide,

wall thickness <2.0 um. MESOPERIDIUM composed of aseptate, unbranched

hyphae, clamp connections rarely present; <9.5 um wide, wall thickness <2.4

uum. ENDOPERIDIUM composed of aseptate, unbranched hyphae, <9.5 um wide,

wall thickness 2.5 um.

SPECIMEN EXAMINED: PAKISTAN: KHYBER PAKHTUN Kuwa, Nathia Gali, ca. 2501 m

a.s.l., in groups, on ground, under Abies pindrow in Himalayan moist temperate forest,

25 Aug. 2006, N. Yousaf NYGO3 (LAH 250806).

46 ... Yousaf, Khalid & Niazi

Fic. 2: Scleroderma chevalieri. A. Basidiome (weathered). B. Basidiospores. C. Exoperidial hyphae.

D. Mesoperidial hyphae. E. Tramal hyphae. F. Endoperidial hyphae. Scale bars: A = 0.8 cm; B = 3.5

um; C = 16 um; D = 18 um; E = 10 um; F = 24 um.

Comments: Like other members of Scleroderma, S. chevalieri has a hard,

tough peridium and is characterized by a subglobose basidioma with short

pseudostipe. It has large ornamented basidiospores with a sub-reticulum and

peridium <1 mm thick. Scleroderma sinnamariense Mont. and S. stellatum Berk.,

also have a similar peridial thickness and partially reticulate spores. However,

S. sinnamariense has a colored peridium with lemon yellow to black scales and

smaller spores, and S. stellatum has a star-shaped opening and smaller spores

(Sims et al. 1995).

Scleroderma spp. new to Pakistan ... 47

Fic. 3: Scleroderma dictyosporum. A. Basidiome. B. Basidiospores. C. Exoperidial and mesoperidial

hyphae. D. Endoperidial hyphae. Scale bars: A = 0.6 cm; B = 3.5 um; C = 28 um; D = 10 um.

Scleroderma dictyosporum Pat., Bull. Soc. Mycol. Fr. 12: 135 (1896) Fic. 3

BASIDIOMATA epigeous, <30 mm broad and 30 mm high, globose to sub-

globose, dull brown, with well-developed mycelial base often produced into

a pseudostipe; several fruit bodies arising from a single stalk. PERIpDIUM <1

mm thick, tough, relatively smooth, elastic, brittle in dried specimen cuticle

A8 ... Yousaf, Khalid & Niazi

breaking into scales; scales black, thin, denser on top, spot-like; dehiscence by

an irregular rupturing of an apical part. GLEBA firm, compact, powdery with

age, grayish to sepia, lighter towards the center.

Basipiospores brown, globose, echinulate-reticulate, 12-15 tm in diam.,

echines <4 um long, young spores without reticulum, nurse cells prominent

in the mount. TRAMAL hyphae hyaline, thin-walled, with clamp connections.

EXOPERIDIUM composed of fascicles of erect hyphae, dark orange to brown,

<6.5 um, thick-walled, encrusted. MEsopERIDIUM with globose elements,

hyaline (yellowish in mass), <6 um in diam., thin-walled, mixed with long

hyaline hyphae. ENDOPERIDIUM composed of septate, branched, hyaline

hyphae, surrounding the gleba, hyphae <6 um wide, thin-walled.

SPECIMEN EXAMINED: PAKISTAN: KHYBER PAKHTUN Kuwa, Naran (Kaghan valley),

ca. 3350 ma.s.l., solitary on sandy soil, 23 Sep. 2009, N. Yousaf NYGO1 (LAH 230909).

ComMENTs: Scleroderma dictyosporum is an ectomycorrhizal species (Mukerji

et al. 2000, Rai et al. 2009) and is distinguished by its globose basidioma

with shorter pseudostipe, thin peridium (<lmm), echinulate-reticulate

basidiospores (12.5-15.0 um) with echines <4 um. This species is close to

S. fuscum (Corda) E. Fisch., but the latter has smooth peridium, absence of

stipe and larger basidiospores (<17 um).

Key to Scleroderma species from Pakistan

Le Basicdiosporeswetic ulate +0. vasa vaste none Noaute vonte lend tne Bmiah dig oa ea we p

1b. Basidiospores echinulate or verrucose, never reticulate ..................-2000- 5

2a. Basidiospores partially, to subreticullate oon. fiF va ceiet 8 eine Benes Yt ane eee et ale 3

2beBasidiospores‘completely reticulation #ut.s9 Fut et.. une thee tae Oe eat at a 4

3a. Basidiospores 11-17 «sm in diam., echines <3.0 umlong............. S. chevalieri

3b. Basidiospores 5-8 ttm in diam., echines <lum long............. S. sinnamariense

4a. Basidiospores 12-15 um in diam., echines <4 um long............ S. dictyosporum

4b. Basidiospores 11-16 um in diam., echines <1 um long................. S. bovista

5a. Basidiospores. 8=13 wi, . ya. os tas ¢ steno ities steals sine (Mlgale oa Gale e¥ gos Ee 6

Dbe basidiospores larger, OTS ui FG yi Bec sa. Page let Setgd load Page loa Mugs ieadtrede baba ade baka kh 7

6a. Basidiospores 8-13 tm, echines >1 um long...................00. S. verrucosum

6b. Basidiospores 8.5-12 um, echines <1 um long.................. 0. eee eee S. cepa

7a. Basidiospores 12-18 tm, echines >2.5 um long..................06. S. areolatum

7b. Basidiospores 10-14 um, echines <1.5 um long...................004 S. flavidum

Acknowledgements

The authors are thankful to Dr. Taiga Kasuya (Laboratory of Plant Parasitic Mycology,

University of Tsukuba, Japan) for helping in the verification of Scleroderma areolatum.

We are also grateful to Prof. G. Moreno of the Dpt. Biologia Vegetal (Botanica), Fac.

Scleroderma spp. new to Pakistan ... 49

Biologia, Univ. Alcala Henares, Madrid, Spain and Ms. Larissa Trierveiler Pereira

in the Department of Botany, Biosciences Institute, UFRGS, Brazil for suggestions

of improvements of earlier versions of the manuscript and acting as pre submission

reviewers. This work was financially supported by Higher Education Commission

(HEC), Pakistan under the “Indigenous Ph.D. Fellowship Scheme 5000 Batch VI”.

Literature cited

Ahmad §S, Iqbal SH, Khalid AN. 1997. Fungi of Pakistan. Sultan Ahmad Mycological Society of

Pakistan, Lahore.

Barroetavenia C, Rajchenberg M, Cazares E. 2005. Mycorrhizal fungi in Pinus ponderosa introduced

in Central Patagonia (Argentina). Nova Hedwigia 80(3-4): 453-464.

Baseia IG, Galvao TCO. 2002. Some interesting gasteromycetes (Basidiomycota) in dry areas from

North Eastern Brazil. Acta Botanica Brasilica 16(1): 1-8.

http://dx.doi.org/10.1590/S0102-33062002000100002

Chen YL, Dell B, Malajczuk N. 2006a. Effect of Scleroderma spore density and age on mycorrhiza

formation and growth of containerized Eucalyptus globulus and E. urophylla seedlings. New

Forests 31(3): 453-467. http://dx.doi.org/10.1007/s11056-005-0880- 1

Chen YL, Kang LH, Malajczuk N. Dell B. 2006b. Selecting ectomycorrhizal fungi for inoculating

plantations in south China: effect of Scleroderma on colonization and growth of exotic

Eucalyptus globulus, E. urophylla, Pinus elliottii, and P. radiata. Mycorrhiza 16(4): 251-259.

http://dx.doi.org/10.1007/s00572-006-0039-8

Giachini AJ, Oliveira VL, Castellano MA, Trappe JM. 2000. Ectomycorrhizal fungi in Eucalyptus

and Pinus plantations in Southern Brazil. Mycologia 92(6): 1166-1177.

http://dx.doi.org/10.2307/3761484

Guzman G. 1970. Monografia del género Scleroderma Pers. emend. Fr. Darwiniana 16: 233-407.

Iqbal SH, Kasuya T, Khalid AN, Niazi AR. 2006. Lysurus pakistanicus, a new species of Phallales

from Pakistan. Mycotaxon 98: 163-168.

Jeffries P. 1999. Scleroderma. 187-200, in: JWG Cairney, SW Chambers (eds). Ectomycorrhizal

fungi: Key genera in profile. Springer, Berlin.

Kasuya T, Guzman G, Ramirez-Guillén F, Kato T. 2002. Scleroderma laeve (Gasteromycetes,

Sclerodermatales), new to Japan. Mycoscience 43(6): 475-476.

Khalid AN, Iqbal SH.1996. New gasteromycetes from Pakistan. Sultania 1: 97-102.

Khalid AN, Iqbal SH. 2004. Calvatia ahmadii sp. nov., from Pakistan. Pakistan Journal of Botany

36: 669-671.

Kirk PM, Cannon PF, Minter DW, Staplers JA. 2008. Ainsworth and Bisby’s dictionary of the fungi.

Wallingford: CAB International.

Lu X, Malajczuk N, Brundrett M, Dell B. 1999. Fruiting of putative ectomycorrhizal fungi under

blue gum (Eucalyptus globulus) plantations of different ages in Western Australia. Mycorrhiza

8(5): 255-261. http://dx.doi.org/10.1007/s005720050242

Marshall NL. 1904. The mushroom book. Doubleday, Page & Company.

Mason PA, Ingleby K, Munro RC, Wilson J, Ibrahim K. 2000. The effect of reduced phosphorus

concentration on mycorrhizal development and growth of Eucalyptus globulus Labill. seedlings

inoculated with 10 different fungi. Forest Ecology and Management 128: 249-258.

Moreno G, Khalid AN, Alvarado P. 2009. A new species of Phallus from Pakistan. Mycotaxon 108:

457-462. http://dx.doi.org/10.5248/108.457

Mukerji KG, Chamola BP, Singh J (eds). 2000. Mycorrhizal biology. Springer, Science. 336 p.

50 ... Yousaf, Khalid & Niazi

Rai M, Bridge PD (eds). 2009. Applied mycology. CABI. 318 p.

Razzaq A, Shahzad S. 2004. Pisolithus tinctorius, a new record from Pakistan. Pakistan Journal of

Botany 36(2): 449-451.

Razzaq A, Shahzad S. 2007. Geastrum sessile and G. vulgatum, new records from Pakistan. Pakistan

Journal of Botany 39(6): 2193-2194.

Sims KP, Watling R, Jeffries P. 1995. A revised key to the genus Scleroderma. Mycotaxon 56:

403-420.

Sims K, Watling R, Cruz R de la, Jeffries P. 1997. Ectomycorrhizal fungi of the Philippines:

a preliminary survey and notes on the geographic biodiversity of the Sclerodermatales.

Biodiversity and Conservation 6: 45-58. http://dx.doi.org/10.1023/A:1018371515051

Sultan A, Nazir K, Ayub N. 2001. Some common species of fleshy macromycetes (Discomycetes,

Gasteromycetes and Agaricales) from Margalla hills national park and adjacent areas. Pakistan

Journal of Botany 33(special Issue): 709-721.

Sultana K, Gul M, Firdous SS, Asghar R. 2007. Hymenomycetes from Multan District. Pakistan

Journal of Botany 39(2): 651-657.

Yamada A, Katsuya K. 1995. Mycorrhizal association ofisolates from sporocarpsand ectomycorrhizas

with Pinus densiflora seedlings. Mycoscience 36(3): 315-323.

http://dx.doi.org/10.1007/BF02268607

Yoshimi S. 2000. Gasteromycetes (Basidiomycota) in the Fukiage Gardens of the Imperial Palace,

Tokyo (in Japanese with English summary). Memoirs of the National Science Museum Tokyo

34: 321-326.

Yoshimi S. 2002. Taxonomic study of the Japanese taxa of Scleroderma Pers. (in Japanese with

English summary). Nippon Kin Gakkai Kaiho 43(1): 3-18.

MYCOTAXON

http://dx.doi.org/10.5248/122.51

Volume 122, pp. 51-59 October-December 2012

Aphyllophoroid fungi from Sonora, México 2. New records from

Sierra de Alamos-Rio Cuchujaqui Biosphere Reserve

RICARDO VALENZUELA’, TANIA RAYMUNDO’,

Cony DECOCK? & MARTIN ESQUEDA?*

‘Laboratorio de Micologia, Departamento de Botanica, Escuela Nacional de Ciencias Bioldgicas,

I.P.N. Apartado Postal 256, Centro Operativo Naranjo, Col. Santa Maria,

México, D.E 02600, México

*Mycothéque de l'Université catholique de Louvain (MUCL, BCCM"),

Earth and Life Institute-Mycology, Université catholique de Louvain,

Croix du Sud 3, 1348 Louvain-la-Neuve, Belgium

°Centro de Investigacién en Alimentacion y Desarrollo,

A.C. Apartado Postal 1735, Hermosillo, Sonora 83000, México

* CORRESPONDENCE TO: esqueda@ciad.mx

ABSTRACT — Gyrodontium sacchari, Leiotrametes menziesii, Phellinus glaucescens, and

P. shaferi are described as new records from México. The specimens were collected on dead or

living wood in tropical deciduous forest in the Sierra de Alamos-Rio Cuchujaqui Biosphere

Reserve located in Sonora State, México.

Key worps — Trametes, taxonomy, chorology

Introduction

The Sierra de Alamos—Rio Cuchujaqui Biosphere Reserve has an extension

of 92,899 ha and is located in south of State of Sonora, México. It presents an

extraordinary biological richness, with approximately 1100 species of plants

distributed in xerophilous scrub, tropical deciduous forest and oak-pine forest

(CONANP 2007). The aphyllophoroid fungi are heterogeneous groups of several

taxa of macrofungi that are very abundant in this region, mainly on live and

dead wood. In this study four species are described for the first time for México:

Gyrodontium sacchari (Coniophoraceae, Boletales), Phellinus glaucescens and

P. shaferi (Hymenochaetaceae, Hymenochaetales), and Leiotrametes menziesii

(Polyporaceae, Polyporales).

Materials & methods

The examined specimens were collected from Sonora State in September 2006 and

are deposited in ENCB Herbarium with duplicate in CESUES. Herbarium ENCB is

52 ... Valenzuela & al.

abbreviated according to Thiers (2012). Morphological examinations followed protocols

outlined by Ryvarden (1991) and Cifuentes et al. (1986). Keys in parentheses after

colors in basidioma descriptions follow the Methuen Handbook of Colour (Kornerup

& Wanscher 1978). Measurements of anatomical characters were taken from rehydrated

tissues in 5% aqueous KOH and amyloid reactions were taken with Melzer’s reagent.

Longitudes and latitudes were obtained with GPS etrex (garmin). Line drawings were

made to scale using a camera lucida attached to a light microscope. The macro-photos

were taken with a Nikon Coolpix 4300.

Taxonomy

Gyrodontium sacchari (Spreng.) Hjortstam, Mycotaxon 54: 186, 1995. FIGS 1-5

BASIDIOMES annual, 40-50 mm broad and up to 100 mm long, resupinate to

effuse-reflexed, subpileate to pileate, fleshy to spongy, easily separable from the

substratum. PILEUS poorly to well development, conchate in some parts, soft to

spongy, white. MARGIN obtuse and thick in pileus, acute at effused parts, sterile,

membranaceus, spongy to cottony, white, width, up to 12 mm. HYMENOPHORE

tuberculate appearance in young parts, aculeate to distinctly hydnoid in mature

parts; aculei mainly flattened, some cylindrical, up to 5 mm long, yellow

(2-3A8), sulphur yellow (1A5), olive yellow (2-3D8) to olive green (3D7),

reddish-brown (8E8) when the spores covering the surface. CONTEXT or

subiculum up to 5 mm thick, soft to spongy, cottony, white.

HYPHAL SYSTEM monomitic; GENERATIVE HYPHAE simple septate, hyaline

to yellowish in KOH, inamyloid, simple to branched, mainly thin-walled,

some thick-walled, 2.4-8 um diam. HYMENOPHORAL TRAMA with parallel to

subparallel hyphae, hyaline to yellowish in KOH, simple to slightly branched,

thin-walled, 2.4-4.8 um diam. CONTEXTUAL HYPHAE slightly interwoven,

hyaline in KOH, simple to branched, thin to thick-walled, 4-8 um diam. CLAMP

CONNECTIONS absent. CYSTIDIA absent. BASIDIA 10.8-15 X 4-6.4 um, clavate,

hyaline in KOH, tetra-spored, sterigmata up to 3 um long. BASIDIOSPORES

4-5.6 x 2.4-3.2 um, ellipsoid to elongate, yellowish brown in KOH, inamyloid

to weak dextrinoid, thick-walled, smooth.

ECOLOGY & DISTRIBUTION— Gyrodontium sacchari grows on live legume

wood in tropical deciduous forests, causing a brown rot. Carlier et al. (2004)

mentioned that this pantropical species has been recorded on all continents. It

is known from Ethiopia, Tanzania, and Zimbabwe in Africa (Hjortstam 1987,

Carlier et al. 2004), Thailand (Carlier et al. 2004) in Asia, from Guadeloupe,

Brazil (Hjortstam 1995) and French Guyana (Carlier et al. 2004) in South

America. In México it was found in the municipality of Alamos, Sonora State.

REPRESENTATIVE SPECIMEN EXAMINED — MEXICO. Sonora: municipality of Alamos,

Palo Injerto (27°02'50.9"N 108°43'57.9"W) elev. 425 m, 13.1X.2006, R. Valenzuela 13068

(ENCB, CESUES).

Aphyllophoroid fungi new for Mexico ... 53

Fics 1-10: Gyrodontium sacchari: 1. Basidiospores. 2. Basidia. 3. Hyphae of hymenophoral trama.

4-5. Basidiomes. Leiotrametes menziesii: 6. Basidiospores. 7. Basidia. 8. Hyphae of hymenophoral

trama. 9-10. Basidiomes.

54 ... Valenzuela & al.

CoMMENTS— Gyrodontium sacchariis characterized by a resupinate to an effuse-

reflexed basidiome, yellow to olive green hydnoid hymenophore, monomitic

hyphal system with simple septate generative hyphae, and small thick-walled

smooth yellowish brown basidiospores. The monotypic Gyrodontium can be

confused with Serpula species, but the meruloid hymenophore and clamped

generative hyphae easily separate both genera (Hjortstam 1987). Phylogenetic

analysis indicates that Gyrodontium and Coniophora share clampless generative

hyphae and are related, but Coniophora has a smooth hymenophore and forms

exclusively resupinate basidiomes (Carlier et al. 2004).

Leiotrametes menziesii (Berk.) Welti & Courtec., Fungal Diversity 55: 60, 2012

FIGs 6-10

BASIDIOMES annual, 60-120 x 30-70 x 10-30 mm, pileate-sessile, imbricate,

connate, corky in consistency. pILEUS dimidiate to broadly attached, conchate,

semicircular, velutinous to glabrous, azonate or with narrow zones to the

margin, whitish, pale yellow (4A2, 4A3) to ochraceous yellow (5C7) with

brownish grey (5D7) in young specimens, ochraceous yellow (5C7), orange

grey (5B2), grayish orange (5B3), brown (6E4) with spots grayish brown (6E3),

brownish gray (6E2) to gray (6E1) in mature specimens. MARGIN sterile, thin,

acute, lobed in some specimens, recurved, whitish to brown (6E8) or dark

brown (7F4); pale gray (5D1) to black in dry specimens. HYMENOPHORE poroid,

white to cream color (4A3), with tones straw yellow (4A4) in some parts, gray

(5D1) or pale brown (6D3) in others; porEs rounded to irregular in shape, 5-7

per mm, with the dissepiments entire to slightly lacerated; TUBES up to 10 mm

deep, concolorous with the pores. CONTEXT up to 20 mm thick, homogeneous,

dense, zonate, white to pale yellow (4A2, 4A3).

HYPHAL SYSTEM trimitic, GENERATIVE HYPHAE with clamp connections,

hyaline in KOH, inamyloid, simple to branched, thin-walled, 2.4-3.2 um in

diam.; SKELETAL HYPHAE hyaline in KOH, inamyloid, unbranched, thick-

walled to solid, 3.2-6.4 um in diam., some swollen up to 10 um broad;

BINDING HYPHAE hyaline in KOH, inamyloid, thin-walled to thick-walled, very

branched, 2.4-4 um diam. HYMENOPHORAL TRAMA with interwoven hyphae,

generative hyphae hyaline, thin-walled, simple to slightly branched, 2.4-3.2

um wide; skeletal hyphae yellowish hyaline, unbranched, thick-walled, 3.2-5.6

um broad; binding hyphae hyaline in KOH, inamyloid, thin-walled to thick-

walled, very branched, 2.4—4 um diam. CONTEXTUAL HYPHAE Very interwoven,

generative hyphae hyaline, simple to branched, thin-walled, 2.4-3.2 um wide;

skeletal hyphae hyaline, unbranched, thick-walled to solid, 3.2-6.4 um in

broad; binding hyphae hyaline in KOH, inamyloid, thin-walled to thick-walled,

very branched, 2.4—4 um diam. STERILE CELLS absent. BASIDIA 12-16 x 4.8-6.4

um, clavate, tetra-spored, hyaline in KOH, with sterigmata up to 4 um long.

Aphyllophoroid fungi new for Mexico ... 55

BASIDIOSPORES 4.4-6.4 x 1.5-2.4 um, cylindrical, hyaline in KOH, inamyloid,

thin-walled, smooth.

ECOLOGY & DISTRIBUTION— Leiotrametes menziesii grows on dead legume

wood in tropical deciduous forests and causes a white rot. Ryvarden & Johansen

(1980) regard this species, widely distributed in Africa, Asia, Australia, and

Pacific Islands, as paleotropical. It has been cited (as Trametes menziesii) from

Malaysia (Corner 1989), Papua New Guinea (Quanten 1997), and (in South

America) Costa Rica (Carranza & Ruiz-Boyer 2005), Guyana (Aime et al.

2003), and Martinique (Welti et al. 2012). The most northernmost report of

L. menziesii is from two sites in Sonora state, México.

REPRESENTATIVE SPECIMEN EXAMINED — MEXICO. SONORA: municipality

of Alamos, El Aguaje (26°56'45.9"N 108°45'48.9"W) elev. 450 m, 14.1X.2006, R.

Valenzuela 13106 (ENCB, CESUES); El Platanar, (26°59'26.7"N 108°40'40.4"W) elev.

635 m, 14.1X.2006, R. Valenzuela 13137 (ENCB, CESUES).

CoMMENTS— Leiotrametes menziesii is very variable in basidiome size, shape,

and color, but it can be distinguished by the numerous gray tones (mainly

towards the base) in mature specimens and spore size. Quanten (1997)

mentioned the size differences for basidiospores cited by Cunningham (1965),

Ryvarden & Johansen (1980), and Corner (1989), and the Mexican specimens

are very close to or within the range given by these authors. The morphological

features of Mexican specimens agree with those given by Ryvarden & Johansen

(1980) and Quanten (1997).

Phellinus glaucescens (Petch) Ryvarden, Norw. Jour. Bot. 19: 234, 1972. Figs 11-15

BASIDIOMESs perennial, 80-100 x 45-60 x 5-8 mm, resupinate, becoming

widely effused, adnate, corky. MARGIN sterile, up to 1 mm wide, dark brown

(6F5) to black with age, matted, fimbriate. HYMENOPHORE poroid, cracked with

age, PORES circular to angular, 6-8(-9) per mm, grayish brown (7D3-4) (8D3),

light brown (6D8), golden brown (5D7), yellowish brown (5E7), cocoa brown

(6E6), umber (6F6) to dark brown (6F7), iridescent, light brown (6D5) when

moved, edges thin and entire; TUBES up to 7 mm deep, indistinctly stratified,

tough to woody, yellowish brown (5E7), cocoa brown (6E6) to reddish brown

(8E8). CONTEXT or subiculum up to 1 mm thick, yellowish brown (5E8) to

reddish brown (8E8), fibrous, tough, azonate.

HYPHAL SYSTEM dimitic, GENERATIVE HYPHAE simple septate, hyaline to

pale yellow in KOH, simple to slightly branched, thin-walled, 1.6-3.2 um in

diam; SKELETAL HYPHAE yellowish brown to reddish brown, unbranched or

with rare branched, thick-walled, 3.2-5.6 um in diam. HYMENOPHORAL TRAMA

with parallel to subparallel hyphae, generative hyphae hyaline to pale yellow

in KOH, thin-walled to thick-walled, simple to slightly branched, 2.4-4 um

wide; skeletal hyphae yellowish brown to reddish brown in KOH, unbranched,

56 ... Valenzuela & al.

thick-walled, 3.2-5 um in diam. CONTEXTUAL TRAMA with slightly interwoven

hyphae, generative hyphae hyaline in KOH, simple to scarcely branched, thick-

walled, 1.6-2.4 um wide; skeletal hyphae pale yellow in KOH, unbranched, thick-

walled, 2.4-3.2 um in diam. HYMENIAL SETAE 14-20 X 4.8-6.4 um, ventricose to

ventricose-rostrate, reddish brown to dark brown, thick-walled. Basip1A 10-14

x 5.6-6.4 um, clavate, tetra-spored, hyaline in KOH. Basip1ospores 4-4.8 x

3.2-4.0 um, broadly ellipsoid to subglobose, pale yellow to yellowish brown in

KOH, inamyloid, slightly thick-walled, smooth.

ECOLOGY & DISTRIBUTION— Solitary, growing on dead angiosperm wood

in tropical deciduous forests. This species is also known from Africa and Asia

(Ryvarden & Johansen 1980, Larsen & Lombard 1988, Larsen & Cobb-Poulle,

1990). The first record from the Americas is in México, where P. glaucescens was

found in the State of Sonora.

REPRESENTATIVE SPECIMEN EXAMINED — MEXICO. SONORA: municipality of

Alamos, El Sabinito (27°00'5.5”N 108°48'14.2" W) elev. 377 m, 16.1X.2006, R. Valenzuela

13173, 13175 (ENCB, CESUES).

CoMMENTS— Within Phellinus, P. glaucescens belongs to the resupinate species

complex, from which it is separated by the combination of basidiome color,

small pores, the presence of hymenial setae, and spore size, shape, and color. A

similar species that has been cited from the area, Inonotus tropicalis (M.J. Larsen

& Lombard) T. Wagner & M. Fisch. (Raymundo et al. 2009), has a resupinate

basidiome, small pores, and similar basidiospores but is distinguished by its

annual to biennial fruiting pattern, fasciculate or clustered hymenial setae, and

a monomitic to pseudodimitic hyphal system.

Phellinus shaferi (Murrill) Ryvarden, Norw. Jour. Bot. 19: 235, 1972. Fics 16-20

BASIDIOMES perennial, 90-140 x 40-70 x 4-7 mm, resupinate, widely

effused, adnate, tough to woody. MARGIN sterile, up to 1 mm wide, brownish

yellow (5C7), golden brown (5D7) to light brown (6D8), dark brown (6F5)

to black with age, matted, fimbriate. HYMENOPHORE poroid, cracked with

age, PORES circular to angular, 5-6 per mm, yellowish brown (5E7) to reddish

brown (8E8), dark brown (6F7) with age, edges thin and entire; TUBES up to

3 mm deep, tough to woody, yellowish brown (5E7) to reddish brown (8E8).

CONTEXT or subiculum up to 1 mm thick, yellowish brown (5E8) to reddish

brown (8E8), fibrous, tough, azonate.

HYPHAL SYSTEM dimitic, GENERATIVE HYPHAE simple septate, hyaline to

pale yellow in KOH, simple to slightly branched, thin-walled, 2.4-3.2 um in

diam; SKELETAL HYPHAE golden brown to reddish brown, unbranched, thick-

walled, 2.4-5.0 um in diam. HYMENOPHORAL TRAMA with slightly interwoven

hyphae, generative hyphae hyaline to pale yellow in KOH, thin-walled, simple

to slightly branched, 2.4-3.2 um wide; skeletal hyphae golden brown to reddish

Aphyllophoroid fungi new for Mexico ... 57

Fics 11-20: Phellinus glaucescens: 11. Basidiospores. 12. Hymenial setae. 13. Hyphae of

hymenophoral trama. 14-15. Basidiomes. Phellinus shaferi: 16. Basidiospores. 17. Cystidioles. 18.

Hymenial setae. 19. Hyphae of hymenophoral trama. 20. Resupinate basidiome.

58 ... Valenzuela & al.

brown in KOH, unbranched, thick-walled, 3.2-5 um in diam. CONTEXTUAL

TRAMA with slightly interwoven hyphae, generative hyphae hyaline to pale

yellow in KOH, simple to scarcely branched, thick-walled, 1.6-2.4 um wide;

skeletal hyphae yellowish brown in KOH, unbranched, thick-walled, 2.4-4.0

um in diam. HYMENIAL SETAE 16-22.4 X 5.6-9.6 um, ventricose to ventricose-

rostrate, reddish brown to dark brown, thick-walled. CySTIDIOLES 24-26 x

7.2-8.8 um, subulate to ventricose-rostrate, hyaline in KOH. BAsip1a not

observed. BASIDIOSPORES 4-4.8 x 3.2-4.0 um, subglobose, pale yellow to rusty

brown in KOH, inamyloid, thin-walled, smooth.

ECOLOGY & DISTRIBUTION — Solitary, growing on dead angiosperm wood

in tropical deciduous forests. Previously known from Montserrat in the West

Indies, Panama, and Venezuela (Ryvarden 2004), in México P. shaferi was found

in Sonora State.

REPRESENTATIVE SPECIMEN EXAMINED — MEXICO. SONORA: municipality of

Alamos, El Aguaje (26°56'45"N 108°45'48”W) elev. 462 m, 14.IX.2006, R. Valenzuela

13099 (ENCB, CESUES).

ComMMENTS— Phellinus shaferi is characterized by its resupinate basidiomes,

pore size and shape, and basidiospore size and color. It is separated from

P. glaucescens by small pores (6-8 per mm). We follow Ryvarden (2004) in

placing this taxon in Phellinus, until molecular studies confirm whether it

would be better retained in Fuscoporella.

Acknowledgments

We wish to express our gratitude to Dr. Gabriel Moreno and Dr. Clarice Loguercio-

Leite for reviewing the manuscript and their useful comments. We also express our

gratitude to SEMARNAT- CONACYT (Grant 2002-C01-0409) for their financial

support. Valenzuela and Decock acknowledge the financial support from CONACyT

(México) and FNRS (Belgium), in the framework of the bilateral cooperation agreement

that allowed fieldwork in México, and a research visit of R. Valenzuela and T. Raymundo

at MUCL in 2011. R. Valenzuela and T. Raymundo thank COFAA and IPN for the

financial support for their research in the project SIP-20121207 and UNAM (PAPPIT)

for financial support in the project IN- 207311. Cony Decock gratefully acknowledges

the financial support received from the Belgian State-Belgian Federal Science Policy

(contract BCCMC3/10/003). Silvia Bautista Hernandez from the ENCB (IPN), kindly

prepared the final version of drawing lines. Aldo Gutierrez (CIAD) kindly prepared the

final version of the pictures and text.

Literature cited

Aime MC, Henkel TW, Ryvarden L. 2003. Studies in neotropical polypores 15: new and interesting

species from Guyana. Mycologia 95: 614-619. http://dx.doi.org/10.2307/3761937

Carlier FX, Bitew A, Castillo G, Decock C. 2004. Some Coniophoraceae (Basidiomycetes, Boletales)

from Ethiopian highlands: Coniophora bimacrospora, sp. nov. and a note on the phylogenetic

relationships of Serpula similis and Gyrodontium. Cryptogamie Mycologie 25(3): 261-275.

Aphyllophoroid fungi new for Mexico ... 59

Carranza J, Ruiz-Boyer A. 2005. Checklist of polypores of Costa Rica. Revista Mexicana de

Micologia 20: 45-52.

Cifuentes J, Villegas M, Pérez-Ramirez L. 1986. Hongos. In: Lot A, Chiang F (compiladores).

Manual de Herbario. Consejo Nacional de la Flora de México, A.C., México, D.E

CONANP [Comisién Nacional de Areas Naturales Protegidas]. 2007. Reserva de Biosfera Sierra de

Alamos — Rio Cuchujaqui. http://conanp.gob.mx [accessed March 2012].

Corner EJH. 1989. Ad Polyporaceas VI. The genus Trametes. Beihefte zur Nova Hedwigia 97:

1-197.

Cunningham GH. 1965. Polyporaceae of New Zealand. N. Zealand Dept. Sci. Industr. Res. Bull.

164: 1-304.

Hjortstam K. 1987. Studies in tropical Corticiaceae (Basidiomycetes) VII. Specimens from East

Africa collected by L. Ryvarden. I. Mycotaxon 28: 19-37.

Hjortstam K. 1995. Two new genera and some new combinations of corticioid fungi (Basidiomycotina,

Aphyllophorales) from tropical and subtropical areas. Mycotaxon 54: 183-193.

Kornerup A, Wanscher JH. 1978. Methuen handbook of colour. 3" ed. Eyre Methuen, London.

Larsen MJ, Cobb-Poulle LA. 1990. Phellinus (Hymenochaetaceae). A survey of the world taxa.

Synopsis Fungorum 3: 1-206.

Larsen MJ, Lombard FF. 1988. Studies in the genus Phellinus I. The identity of Phellinus rickii with

notes on its facultative synonyms. Mycologia 80: 72-76. http://dx.doi.org/10.2307/3807495

Quanten E. 1997. The polypores (Polyporaceae s.1.) of Papua New Guinea. Opera Botanica Belgica

11. National Botanic Garden of Belgium, Meise. 352 p.

Ryvarden L. 1991. Genera of polypores. Nomenclature and taxonomy. Synopsis Fungorum 5:

1-363.

Ryvarden L. 2004. Neotropical polypores. Introduction, Ganodermataceae & Hymenochaetaceae.

Synopsis Fungorum 19: 1-229.

Ryvarden L, Johansen I. 1980. A preliminary polypore flora of East Africa. Fungiflora, Oslo. 636 p.

Thiers, B. 2012 [continuously updated]. Index Herbariorum: a global directory of public herbaria

and associated staff. New York Botanical Garden's Virtual Herbarium. [accessed February 2012:

http://sweetgum.nybg.org/ih/ ].

Welti S, Moreau PA, Favel A, Courtecuisse R, Haon M, Navarro D, Taussac S, Lesage-Meessen L.

2012. Molecular phylogeny of Trametes and related genera, and description of a new genus

Leiotrametes. Fungal Diversity 55: 47-64. http://dx.doi.org/10.1007/s13225-011-0149-2

MYCOTAXON

http://dx.doi.org/10.5248/122.61

Volume 122, pp. 61-67 October-December 2012

Passalora acrocomiae sp. nov. and Exosporium acrocomiae

from the palm Acrocomia aculeata in Puerto Rico

EDUARDO GUATIMOSIM, HENRIQUE JORGE PINTO

& ROBERT WEINGART BARRETO*

Departamento de Fitopatologia, Universidade Federal de Vicosa

Vicosa, Minas Gerais, 36570-000, Brazil

*CORRESPONDENCE TO: rbarreto@ufv.br

ABSTRACT — Collections determined by J.A. Stevenson as Cercospora acrocomiae |= Exosporium

acrocomiae] from leaf spots of Acrocomia media [= A. aculeata] in Puerto Rico were re-

examined. Two different fungi were identified: a previously unnoticed authentic cercosporoid

taxon that we describe herein as Passalora acrocomiae and Exosporium acrocomiae, which we

illustrate here for the first time and for which we designate a lectotype to substitute for the

missing holotype.

Key worps —Arecaceae, phytopathogens, reappraisal, taxonomic novelties

Introduction

Acrocomia aculeata (Jacq.) Lodd. ex Mart. (Arecaceae) is a thorny medium

sized neotropical palm (Scariot & Lleras 1995). We present a reappraisal of

the available specimens of a fungus collected on A. media [= A. aculeata] in

Puerto Rico at the beginning of the 20" century. This dematiaceous fungus

has been placed in two disparate genera, Cercospora and Exosporium. Firstly

a description was given by Stevenson (1917) of the fungus as Cercospora

acrocomiae. Chupp (1954) later described the same fungus, annotating it

as “plainly an Exosporium,? Accepting Chupp’s opinion, Stevenson (1975)

recombined the taxon as Exosporium acrocomiae. The original Stevenson and

Chupp descriptions are very similar and fit best into the present concept of

Exosporium. A re-examination of the original material was undertaken to

confirm its placement in that genus.

Materials & methods

All relevant specimens were obtained as loans from BPI and CUP herbaria. Samples

were examined under a dissecting microscope and freehand sections of fungal structures

62 ... Guatimosim, Pinto & Barreto

or fungal structures scraped from colonized plant surfaces were mounted in lactic

acid or lacto-fuchsin. Observations of fungal structures and measurements, as well as

preparation of line drawings and photographs, were performed with an Olympus BX 51

light microscope fitted with a drawing tube and an Olympus E330 digital camera. Plates

were organized with CorelDraw X5. Wherever possible, 30 measurements of structures

from each fungus were made.

Taxonomy

Exosporium acrocomiae (J.A. Stev.) Chupp ex J.A. Stev.,

Contrib. Reed Herb. 23: 516, 1975. PLATE 1

MycoBank MB477989

= Cercospora acrocomiae J.A. Stev., Ann. Rep. Insular

Exp. Stat. Porto Rico 1916-17: 89, 1917.

ORIGINAL DESCRIPTION (Stevenson 1917: 89-90): “Primary spots amphigenous, few,

1-8 per pinnz: but areas between finally dying so as to make large continuous areas:

regular, oval, with definite margins neither raised nor sunken, .8-1.5, rarely 2 cm. long

by 3-6 mm. broad, rarely wider, at first red brown, then tricoloured, a central oval gray

area (.5-3 mm. x 2-6 mm.), enclosed by a dark-brown band, 2-3 mm. wide, with an

outer more or less irregular red-brown area, often no completely encircling the central

portions. Conidal [sic] fascicles hypophyllous, numerous, confined to the central gray

area, often in two distinct lines; conidiophores many to each fascicle, brown to olive

brown, 1-2 septate, erect to reclining, concolorous with the conidia, 32-70 x 5-8 mu.

Conidia 3-9 septate, long clavate, sometimes slightly curved, apical cell rounded, brown,

often constricted at the septze, 55-120 x 8-12 mu.”

SUPPLEMENTARY DESCRIPTION (Chupp 1954: 428): “Pinnae of older leaves are affected,

so that part or the whole leaf may finally be killed, single spots 8-20 x 3-6 mm., or

coalescing into large irregular areas, often with a central oval gray area enclosed by a dark

brown band, with an outer irregular reddish brown area; fruiting chiefly hypophyllous;

stromata dark to black, 40-100y in diameter; fascicles very dense; conidiophores dark

fuligeneous brown, septate, not geniculate, straight, curved, or tortuous, sometimes

wider near the tip or irregular in width, not branched, spore scars absent or indistinct,

4-8 x 30-70; conidia dark fuligeneous brown, straight to slightly curved, clavato-

cylindric to slightly attenuated toward the tip, obtuse ends, septa distinct, 3-9 in number,

5-10 (812) x 30-120 p?

Type: PUERTO RICO, Rio Piedras, on leaves of Acrocomia media |= A. aculeata], July

1917, J.A. Stevenson 6604 (Holotype, not located, presumed lost); 14 Feb. 1912, J.R.

Johnston [Stevenson 4206, 4206A] (Paratype = Lectotype designated here, BPI 432400;

isolectotypes, BPI 432402, CUP 039018).

Lesions on leaves subcircular to elliptic, with pale brown edges and paler

centre, 1.2-2.0 x 0.3-0.60 cm. Internal mycelium indistinct. External mycelium

absent. Stroma sub-epidermal, subglobose, erumpent, composed of dark brown

textura angularis, smooth. Conidiophores hypogenous, in dense fascicles

(of up to 20 conidiophores per fascicle), sub-cylindrical, straight to slightly

PLaTE 1. Exosporium acrocomiae. A: Leaf spot symptoms on leaves; B—C: Hypogenous caespituli;

D: Conidia and conidiophores; E-I: Conidia; J-K: Detail of conidiogenous loci. Bars: 20 um.

Exosporium & Passalora on Acrocomia aculeata ...

WlEs>

CEL

64 ... Guatimosim, Pinto & Barreto

curved, occasionally geniculate at the apex, 40-70 x 4-5 um, 3-5 (mainly 3)-

septate, unbranched, thick-walled, pale brown to olivaceous-brown, smooth.

Conidiogenous cells terminal, integrated, sub-cylindrical, 10-32 x 5-7 um,

pale brown, smooth. Conidiogenous loci almost inconspicuous, one per cell,

1.0-2.0 um diam, thickened, not darkened. Conidia solitary, cylindrical,

30-100 x 5-10 um, truncate at the base, apex rounded, 3-9-distoseptate, 2-3

um diam at base, guttulate, pale brown to olivaceous-brown, smooth.

ADDITIONAL MATERIAL EXAMINED: PUERTO RICO, Rio Piedras, on Acrocomia media,

29 Jan. 1917, J.A. Stevenson 6175 (BPI 432399); 15 Jul. 1914, J.A. Stevenson No. 2090

(BPI 432397, 432398, 432401).

Passalora acrocomiae Guatimosim & R.W. Barreto, sp. nov. PLATE 2

MycoBank MB801218

Differs from Passalora eitenii by its denser cespituli, stromata of textura intricata, smaller

conidiophores, and absence of percurrently proliferating conidiogenous cells.

Type: Puerto Rico, Rio Piedras, on leaves of Acrocomia media [= A. aculeata], 15 Jul.

1914, J.A. Stevenson No. 2090 (Holotype, BPI 432397; isotypes, BPI 432398, 432401).

ErymMo_oey: from the host genus.

Lesions on leaves subcircular to elliptic, with pale brown edges and paler centre,

0.90-2.30 x 0.3-0.60 cm. Internal mycelium branched, 2.5 um diam., septate,

subhyaline. External mycelium absent. Stroma sub-epidermal, erumpent,

subglobose, 100-157 x 87-113 tm, composed of dense textura intricata,

pale brown, smooth. Conidiophores hypogenous, in dense fascicles (up to 20

conidiophores per fascicle), confined to the central gray area, often in two parallel

distinct lines, sub-cylindrical, straight to slightly curved, 90-105 x 5-7 um,

1-3-septate, unbranched, eguttulate, pale brown, smooth but with a distinctly

roughened apex. Conidiogenous cells terminal, integrated, sub-cylindrical,

37-55 x 6-8 um, pale brown, roughened. Conidiogenous loci conspicuous,

one per cell, discoid, 1.5-4 um diam. Conidia solitary, subcylindrical to slightly

clavate, obconically truncate at the base, apex rounded, 35-68 x 8-13 um,

1-3-septate, diam 2-4 um at base, hila somewhat thickened and darkened-

refractive, guttulate, pale brown to olivaceous-brown, mostly smooth but with

a distinctly roughened apex.

Discussion

Based on examination of the holotype (Stevenson 6604) and other original

collections, Chupp (1954) indicated that Stevenson’s Cercospora acrocomiae

was “plainly an Exosporium,” but did not publish a valid new combination.

Stevenson (1975) accepted Chupp’s opinion, and published the valid combination

Exosporium acrocomiae. The genus Exosporium Link (type species, E. tiliae

Link) is characterized by having typically darkened, thickened and prominent

conidiogenous loci (scars) and conidial hila. After careful examination of the

Exosporium & Passalora on Acrocomia aculeata ... 65

PLATE 2. Passalora acrocomiae. A-B: Hypogenous caespituli; C-D: Conidia and conidiophores.

Bars: 20 um; E: Detail of the upper part of a conidiophore (note distinctly roughened apex).

Bar: 5 um.

original collections of C. acrocomiae (all from the same locality, including

paratypes collected in 1912 and 1914 and an additional collection in 1917), we

concluded that, in fact, two different fungi are present associated with the leaf

spots on A. aculeata in Puerto Rico.

One is ubiquitous and is recognized as the fungus described by both authors,

although neither Stevenson nor Chupp published illustrations of their fungus.

66 ... Guatimosim, Pinto & Barreto

Although this fungus does not have the prominent, dark and thickened scars of

many other Exosporium species, it still is adequately placed in Exosporium.

The second fungus associated with the A. aculeata leaf spots represents a

novel species unnoticed by Stevenson and Chupp. This fungus is present only

in three herbarium specimens from one Stevenson paratype collection, where

it is much less common than E. acrocomiae. This new taxon bears the typical

features of cercosporoid fungi now placed, under the current concept for this

group, in Passalora (Crous & Braun 2003). Hence, the source of the confusion

that emerged during the present study was the combined occurrence of two

fungi on the same kind of lesions on one paratype collection of C. acrocomiae.

An additional complication is that, to the best of our knowledge, the

holotype of E. acrocomiae is now lost; a search in all potential deposit sites for

the holotype (BPI, CUP, ILL, ILS, UPRRP) failed to uncover this critical type

specimen. Therefore, we chose one of the two paratypes (Stevenson 4206 = BPI

432400) as lectotype for E. acrocomiae.

It is interesting that a similar leaf spot was collected in Brazil during an

ongoing study of the mycobiota of A. aculeata involving a third hyphomycete

— also belonging to Passalora but clearly distinct from P acrocomiae (pers.

obs.). Probably this palm species reacts to attack by different pathogenic fungi

by forming similar leaf spots.

Two Exosporium species have already been described on members of the

Arecaceae: Exosporium pulchellum Sacc. on Areca catechu L.and Orania palindan

(Blanco) Merr., both in the Philippines (Trotter 1931: 994-995; Teodoro 1937);

E. stilbaceum (Moreau) M.B. Ellis on Elaeis guineensis Jacq. in Africa and Asia;

and Elaeis sp. in Africa (Ellis 1971; Turner 1971; Pirozynski 1972; Liu 1977).

These two species have much longer conidiophores (<220 um long) and thicker

scars. Additionally E. stilbaceum forms conidia in chains and conidiophores

arranged in synnemata (Ellis 1971).

There is only one Passalora described on the Arecaceae: P. eitenii R.B.

Medeiros & Dianese on the Brazilian native palm Syagrus comosa (Matt.)

Mart. Passalora eitenii differs morphologically P acrocomiae by its sparser

caespituli, stromata of textura angularis, larger conidiophores, and percurrently

proliferating conidiogenous cells (Medeiros & Dianese 1994).

The search for a clarification of the status of Exosporium on A. aculeata

resulted in confirming its identity in this genus and the unexpected discovery

of an overlooked species of Passalora.

Acknowledgments

The authors wish to acknowledge Fundacao de Amparo a Pesquisa do Estado de

Minas Gerais (FAPEMIG) and Coordenacao de Aperfeigcoamento de Pessoal de Nivel

Superior (CAPES) for financial support, A. Rossman and A. Minnis (USDA) for helping

with the literature and herbarium search, U. Braun (Martin-Luther-Universitat, Halle)

Exosporium & Passalora on Acrocomia aculeata ... 67

and A. Hernandez-Gutiérrez (Universidade Federal do Para, Belem) for presubmission

reviews of the manuscript, and BPI for the loan of specimens.

Literature cited

Chupp C. 1954. A monograph of the fungus genus Cercospora. Published by the author, Ithaca.

Crous PW, Braun U. 2003. Mycosphaerella and its anamorphs: 1. Names published in Cercospora

and Passalora. Centraalbureau voor Schimmelcultures, Utrecht.

Ellis MB. 1971. Dematiaceous hyphomycetes. Commonwealth Mycological Institute, Kew.

Liu PSW. 1977. A supplement to a host list of plant diseases in Sabah, Malaysia. Phytopathol. Pap.

21: 1-49.

Medeiros RB, Dianese JC. 1994. Passalora eitenii sp. nov. on Syagrus comosa in Brazil and a key to

Passalora species. Mycotaxon 51: 509-513.

Pirozynski KA. 1972. Microfungi of Tanzania. I. Miscellaneous fungi on oil palm. Mycol. Pap. 129:

Tse

Scariot A, Lleras E. 1995. Flowering and fruiting phenologies of the palm Acrocomia aculeata:

patterns and consequences. Biotropica 27: 168-173. http://dx.doi.org/10.2307/2388992

Stevenson JA. 1917. Report of the Department of Pathology and Botany. Annual Report of the

Insular Experiment Station of Porto Rico 1916-17: 37-98.

Stevenson JA. 1975. The fungi of Puerto Rico and the American Virgin Islands. Contribution of

Reed Herbarium No. 23. Baltimore.

Teodoro NG. 1937. An enumeration of Philippine Fungi. Technical Bulletin of the Department of

Agriculture Commonwealth. Manila 4: 1-585.

Trotter A. 1931. Supplementum universale, pars X. Sylloge Fungorum, vol. 25. Patavia. 1093 p.

Turner PD. 1971. Microorganisms associated with oil palm (Elaeis guineensis Jacq.). Phytopathol.

Pap. 14: 1-58.

MYCOTAXON

http://dx.doi.org/10.5248/122.69

Volume 122, pp. 69-72 October-December 2012

A new Stigmella species associated with Lycium leaf spots

in northwestern China

YAN WANG *”, XIU-RONG CHEN ** & CHENG-DE YANG

‘College of Pratacultural Science, Gansu Agricultural University;

Key Laboratory of Grassland Ecosystem (Gansu Agricultural University),

Ministry of Education; Sino-U.S. Center for Grazingland Ecosystem Sustainability,

Lanzhou 730070, China

*Gansu College of Traditional Chinese Medicine, Lanzhou 730000, China

*CORRESPONDENCE TO: chenxiurong@gsau.edu.cn

ABSTRACT — A new anamorphic species Stigmella lycii on Lycium chinense is described and

illustrated from Chinese material and compared with all known species of this genus. ‘This is

the first report of Stigmella species in China.

KEY worps — coelomycete, taxonomy

Introduction

While investigating medical plant diseases in Gansu province, China, during

2004 and 2011, a species of Stigmella Lév. was discovered that caused large,

circular, necrotic leaf spots on Lycium chinense Mill. in Jingtai county. Severe

infections caused by this pathogenic fungus usually resulted in premature leaf

and fruit fall. Based on careful morphological examination, we determined that

this pathogen represented a new species of Stigmella.

Materials & methods

The fungal specimens were cut by hand with a razor blade to make thin sections

of conidiomata for microscopical observation. The sections were mounted in water

and lactophenol cotton blue on slides. Morphological characteristics of pycnidia,

conidiogenous cells and conidia were carefully examined using light microscopy. For

scanning electron microscope (SEM) examinations, shortly after collection 5 mm

squares of fresh leaf tissue containing conidiomata were fixed overnight at 4°C in

2.5% glutaraldehyde in 0.1M phosphate buffer (pH 7.2), washed with glutaraldehyde

buffer, dehydrated in a 50-70-80-90-100% ethanol series for 15 min each, dehydrated

in acetone, critical point dried, sputter-coated with gold, and examined in a JSM-6380

operating at 30 kV. The examined specimens were deposited in the Herbarium of Gansu

Agriculture University (HGAU).

70 ... Wang, Chen & Yang

aor

| Ae PAS ae 2

PLATE 1. Stigmella lycii. A. Leaf lesion. Arrow indicating a single stroma. B-C. Section through a

pycnidium with a layer of conidiogenous cells bearing conidia (B, by light microscopy; C, by SEM).

D-F. Muriform conidia, by light microscopy. G-H. Muriform conidia, by SEM. Bars: A = 400 um;

B = 50 um; C-F = 8 um.

Taxonomy

Stigmella lycii X.R. Chen & Yan Wang, sp. nov. PLATE 1.

MycoBank MB 800236

Differt ab omnibus speciebus Stigmellae pycnidiis distincte majoribus et conidiis quoque

majoribus.

Type: China, Gansu province, Jingtai county, Damiao village, on leaves of Lycium

chinense Mill. (Solanaceae), 22 October 2011, X.R. Chen & Y. Wang (Holotype, HGAU,

Herbarium of Gansu Agriculture University).

ErymMo.oey: Epithet derived from the host genus.

Early lesions on leaves visible as small, round, pale brown leaf spots, gradually

becoming larger necrotic blotches, somewhat zonate, with distinct margins, 2-8

mm diam. Lower leaves falling prematurely due to severe infections. Mycelium

entirely immersed in the leaf tissue, septate, branched, hyaline to pale brown.

Conidiomata pycnidial, immersed, erumpent at maturity, subglobose, blackish,

161-172 um diam, with thin walls up to 10 um diam, composed of one to three

layers of small, pale brown to dark brown cells and an inner textura prismatica

with thin-walled paler cells. Ostiole indefinite. Conidiogenous cells holoblastic,

determinate, discrete, doliiform to ampulliform, hyaline, smooth, formed from

the inner cells of the pycnidial wall. Conidia hyaline when young, at maturity

pale olive-brown and muriform, oval, ellipsoid, pyriform, irregular and

mulberry-shape, 19.9-52.8 x 12.8-32.9 um, composed of 12-35 cells. Conidial

cells small, irregular, subglobose, pale yellowish, 2.6-11.5 x 2.6-11.0 um.

Discussion

The coelomycetous genus Stigmella has an intricate history. Its type species,

S. dryina Lév. (Demidow 1842), was placed in the ‘Phyllostictei’ by Fuckel

Stigmella lycii sp. nov. (China) ... 71

(1870), along with representatives of Coniothyrium Corda, Phoma Sacc.,

Darluca Castagne, and other genera. Saccardo (1878) assigned ‘Stigmella dryina

(Corda) Lév (an incorrect author citation) to hyphomycetes, a practice followed

by subsequent authors. Bubak (1914) was the first to recognize the pycnidial

structure of S. dryina. Hughes (1952), who conducted the first modern revision

of Stigmella based on its type species, concluded from original descriptions that

most species attributed to this genus were hyphomycetes and not congeneric

with S. dryina. Sutton (1980) published a later description of the genus.

The two other species accepted in Stigmella are S. effigurata (Schwein.)

S. Hughes (= S. dryina; = S. dryophylla (Corda) Lindau; see Hughes 1958) and

the Indian S. tirumalensis Bagyan. et al. (Bagyanarayana et al. 1992). Based on

conidioma structure, conidiogenesis, and conidial morphology, the recently

collected Chinese fungus can clearly be allocated to Stigmella where it represents

a third species, S. lycii, that is easily distinguished from the other species by

much larger pycnidia and conidia with a distinctive cellular composition

(TABLE 1).

TABLE 1. Comparison of Stigmella effigurate, S. tirumalensis, and S. lycii

S. effigurata S. tirumalensis S. lycii

PYCNIDIA <100 um 40-100 um, 172-162 um

rarely $200 um

CONIDIA 12-20 x 7-10 um; 10-14 (-21) x 6-9 20-53 x 13-33 um,

6 transverse + variable um; <4 transverse comprising 12-35 small cells

longitudinal septa & 0-3 longitudinal (2.6-11.5 x 2.6-11 pm)

septa

Host/ Leaves of Quercus spp., Leaves of Leaves of

DISTRIBUTION Atriplex suberecta, Cassine glauca] Lycium chinense |

Chenopodium sp., India China

Eugenia sp., Senecio

mesogrammoides,

Stephania abyssinica |

Africa, Asia, Europe

Acknowledgements

The authors are grateful to Uwe Braun (Martin-Luther-University, Halle (Saale),

Germany) and Guo-Zhong Lu (Dalian Nationalities University, China) for critical

comments, corrections, and pre-submission reviews and appreciate the preliminary

species evaluation by Yong-Liang Wei (Gansu Agricultural University, China). This

study has been supported by the Gansu Herbal Medicine Industry Research Foundation,

project GYC11-01.

Literature cited

Bagyanarayana G, Braun U, Jagadeeswar P. 1992. Three new phytoparasitic fungi from India.

Mycotaxon 45: 105-108.

72... Wang, Chen & Yang

Bubak F. 1914. Ein Beitrag zur Pilzflora von Tirol und Istrien. Annales Mycologici 12: 215-219.

Demidow AN. 1842. Voyage dans la Russie Meridionale et al Crimeé, par Hongarie et al Moldavie.

Vol. 2. Paris.

Fuckel L. 1870. Symbolae mycologicae. Beitrag zur Kenntnis der rheinischen Pilze. Jahrbticher des

Nassauischen Vereins fiir Naturkunde 23-24: 1-459.

Hughes SJ. 1952. Studies on micro-fungi. XIV. Stigmella, Stigmina, Camptomeris, Polythrincium

and Fusicladiella. Mycological Papers 49: 1-25.

Hughes SJ. 1958. Revisiones hyphomycetum aliquot cum appendice de nominibus rejiciendis.

Canadian Journal of Botany 36(6): 727-836. http://dx.doi.org/10.1139/b58-067

Saccardo PA. 1878. Fungi veneti novi vel critici vel mycologicae Venetae addendi, Series VIII.

Michelia 1(2): 239-275.

Sutton BC. 1980. The Coelomycetes. Commonwealth Mycological Institute, Kew.

MY COTAXON

http://dx.doi.org/10.5248/122.73

Volume 122, pp. 73-82 October-December 2012

Tuber sinoaestivum sp. nov.,

an edible truffle from southwestern China

JiE-PING ZHANG*?, PEI-Gul Liu” & JUAN CHEN”?

' Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany,

Chinese Academy of Sciences, Kunming 650201, Yunnan, China

? Graduate University of Chinese Academy of Sciences, Beijing 100049, China

> Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences &

Peking Union Medical College, Beijing 100194, P. R. China

* CORRESPONDENCE TO: pgliu@mail.kib.ac.cn

ABSTRACT — Anew Tuber species, T. sinoaestivum, is described from southwestern China based on

morphological and molecular analyses. The new species, which was found fruiting in association

with Pinus armandii, has been previously misidentified as T. aestivum (=T: uncinatum). Although

morphologically quite similar, T. sinoaestivum differs from the European species by more

globose ascospores ornamented with a shallower reticulum. ITS sequence analyses show

only 92% similarity between the two species, further supporting the taxonomic separation of

T: sinoaestivum from T: aestivum.

Key worps —black truffles, Pezizales, phylogeny, taxonomy

Introduction

Chinese black truffles have attracted much scientific and commercial

interest since their export to Europe in the beginning of 1990s. Four black

truffle taxa have previously been reported from China: Tuber indicum complex,

T: formosanum, T. pseudohimalayense, and T: aestivum (Chen et al. 2005; Chen

& Liu 2011; Hu 1992; Manjon et al. 2009; Song et al. 2005; Wang et al. 1998,

2006; Zhang et al. 2005). The high morphological similarity between Chinese

and European black truffles has prompted intensive investigations on species

recognition and phylogenies (Bonito et al. 2010; Douet et al. 2004; Jeandroz et

al. 2008; Paolocci et al. 1997; Roux et al. 1999). Previous studies indicate that a

number of major Tuber clades are distributed across both China and Europe,

yet species within the two regions appear to be distinct from each other.

T. aestivum Vittad. (= T: uncinatum Chatin), a renowned culinary species

in Europe, is widely distributed across Nordic and Mediterranean regions

(Jeandroz et al. 2008). This species was reported as a new Chinese record

74 ... Zhang, Liu & Chen

based on ascomata sold at mushroom markets in Huidong, Sichuan (Chen

et al. 2005; Song et al. 2005). Both identifications relied on morphological

comparison with European collections, and spore size and ornamentation

differences were regarded as mere intraspecific variations. In their worldwide

phylogeny of Tuber, Jeandroz et al. (2008) did not include Asian T: aestivum

material, leaving open the true identity of the Chinese collections. In recent

years, more T. aestivum-like ascomata have been found in southwestern China.

Morphological and ITS-rDNA and £-tubulin sequence comparisons of these

Chinese truffles with European collections indicate that the Chinese material

differs from T: aestivum and should be described as a new species.

Materials & methods

Morphological examination

Macroscopic characters are based on fresh and dried specimens. Descriptions and

spore parameters follow Yang & Zhang (2003). Slides were made with a razor blade from

dried ascomata and mounted in 5% KOH. Micro-morphological features were examined

under a Nikon E400 microscope (10 x 100). At least 100 spores were measured from each

ascoma and included asci containing different numbers of spores. For scanning electron

microscopy (SEM), ascospores were scraped from dried ascoma gleba and mounted

in distilled water on a cover glass. After air drying the cover glasses were directly

attached to a SEM stub with double-sided tape and then coated with gold-palladium.

The treated materials were examined and photographed with an AMRAY 1000B SEM.

All specimens cited are deposited in the Herbarium of Cryptogams, Kunming Institute

of Botany, Chinese Academy of Science (KUN-HKAS).

Molecular methods

Six truffle collections from China and seventeen from Europe were selected for

phylogenetic analysis (TABLE 1). Total DNA was extracted from gleba dried with silica-

gel using a modified CTAB procedure of Doyle & Doyle (1987). The ITS5 (forward)

and ITS4 (reverse) primers were used to amplify the internal transcribed spacer regions

(ITS-rDNA) of the nuclear ribosomal DNA (White et al. 1990) and Bt2a (forward) and

Btspect (reverse) primers were used for the 6-tubulin gene (Glass et al. 1995; Paolocci et

al. 2004). The amplifications used 2 ul DNA template solutions in final volume of 25 ul. The

final solution contained 10 mM Tris-HCl (pH 9.0), 50 mM KCI, 2 mM MgCL, 200 uM of

each dNTP, 0.2 uM of each primer and 3 U Taq Polymerase (Takara Biotechnology, Dalian

Co. Ltd., China). The cycling parameters were an initial denaturation at 95 °C for 5 min,

followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 52 °C (for ITS and 49

°C for B-tubulin) for 90 s and extension at 72 °C for 2 min, then a final extension at 72 °C

for 10 min. PCR products were visualized through gel electrophoresis on a 1% agarose

gel and purified with Watson's purification kit. Sequencing was performed with ABI

Prism BigDye terminator cycle sequencing kit v3.1 on an ABI PRISM 3730 automatic

sequencer. DNA sequences were edited and aligned with BioEdit Version 5.0.9 (Hall

1999) and Clustal X with manual adjustment where necessary. Maximum parsimony

(MP) analysis was conducted with PAUP* 4.0b4a (Swofford, 2002) using heuristic

Tuber sinoaestivum sp. nov (China) ... 75

TABLE 1 Tuber sequences used in phylogeny.

(Bold font = sequences newly generated in this study.)

VOUCHER GENBANK IDENTIFICATION GENBANK LOCALITY

LABEL #ITS # 6-tubulin

—— T. malenconii T. malenconii FM205597 —— Spain

—— T. malenconii T. malenconii FM205596 —— Spain

E2 T. aestivum T. aestivum AF516781 AF516801 Italy

E61 T. aestivum T. aestivum AF516783 AF516812 Italy

E60 T. aestivum T. aestivum AF516789 AF516804 Italy

E5 T. uncinatum T. aestivum AF516791 AF516809 Italy

E24 T. uncinatum T. aestivum AF516792 AF516807 Italy

E17 T. uncinatum T. aestivum AY226042 AY 206632 Italy

HKAS44347 T. aestivum T. sinoaestivum GU979038 GU979152 China

HKAS44322 T. aestivum T. sinoaestivum GQ217542 GU979150 China

HKAS70291 T. aestivum T. aestivum JQ348410 JQ348402 Sweden

HKAS70292 T. aestivum T. aestivum JQ348411 JQ348401 Sweden

HKAS70296 T. aestivum T. aestivum JQ348412 JQ348404 France

HKAS70297 T. aestivum T. aestivum JQ348413 JQ348403 France

HKAS59111 T. sinoaestivum T. sinoaestivum JN896352 JQ348409 China

HKAS59100 T. sinoaestivum T. sinoaestivum JN896356 JQ348408 China

HKAS59101 T. sinoaestivum T. sinoaestivum JN896357 JQ348406 China

HKAS59102 T. sinoaestivum T. sinoaestivum JN896358 JQ348407 China

HKAS70294 T. mesentericum T. mesentericum JQ348414 JQ348405 France

M13 T. mesentericum T. mesentericum AF516793 AY170363 ——

Mi T. mesentericum T. mesentericum AF516794 AY 170364 ——

G02 T. magnatum T. magnatum AJ586251 AJ586430 Croatia

B6 T. magnatum T. magnatum AJ586271 AJ586428 Italy

search with multi-trees setting on and tree bisection reconnection (TBR) branch

swapping with 1000 search replicates, each replicate with random sequence addition.

No ambiguous characters were excluded from the analyses. Gaps were treated as missing

data. Character states were treated as equally weighted and unordered. Tuber magnatum

was selected as outgroup based on previous analyses, and T! sinoaestivum, T: aestivum,

T: mesentericum, and T: malenconii comprised the ingroup taxa.

Results

Taxonomy

Tuber sinoaestivum J.P. Zhang & P.G. Liu, sp. nov. Figs 1-5

MycoBank MB 563565

Differs from Tuber aestivum by its more globose spores with thicker walls and shallower

ornamentation mesh.

Type: China, Sichuan Province, Huidong County, Gaji mountain, 26°29'N 102°31’E, alt.

2280 m, in Pinus armandii Franch. forest, 25 Nov. 2009, JP Zhang 153 (holotype KUN-

HKAS 59105).

76 ... Zhang, Liu & Chen

Fics 1-5. Tuber sinoaestivum. 1: Fresh ascomata; 2: Pseudoparenchymatous tissue of outer layer

of peridium; 3: Intricately interwoven hyphae of inner layer of peridium; 4: Ascospores; 5: SEM of

ascospore, showing the reticulate ornamentation.

ETyMOLoGy: sinoaestivum (Lat.) referring to its Chinese origin and its relationship to

European T. aestivum.

Ascomarta subglobose, 1.5-3(-6) cm in diam., blackish to black, conspicuously

covered with low, polygonal warts; warts 3-6-sided, 2-4 mm transverse, about

2 mm high, apex pointed. PERIDruM 100-620 um thick, consisting of two

Tuber sinoaestivum sp. nov (China) ... 77

layers; the outer layer 50-300 um thick, pseudoparenchymatous, composed

of subglobose or subangular cells; cells dark to yellowish brown, 7-15 x 6-12

um, thick-walled; the inner layer 50-350 um thick, pale yellow or hyaline,

interwoven hyphae 2-5 um diam., forming an intricate texture. Gleba whitish

at first when young, then becoming yellowish or brown gradually, marbled with

numerous, narrow, white branching veins. Asci (51-)55-88(-124) x (33-)40-

72(-75) um (excluding stalk), subglobose, ellipsoid or variable in shape, sessile

or with a short stalk, the stalk (6—)10-25(-50) x 5-15(-16) um, 1-6(—7)-spored.

Ascospores globose, subglobose, (17—)20-41(-47) x (15-)17-30(-35) um

[Q =1.04-1.50(-1.57), Q =1.15 + 0.09], spore walls 2-4 um thick, yellowish-

brown at maturity, ornamented with a more or less irregular reticulum 2-5 um

deep; meshes variable, usually (7-)8-21(-22) x (4-)5-19(-20) um, commonly

1-3 meshes in the transverse diam. and 2-4 meshes in the longitudinal direction.

Odor unique with pleasant fragrance, taste a bit sweet for its mild aroma.

HABIT AND HABITAT: hypogenous, symbiotic with P armandii, maturing

from October to December or later.

DISTRIBUTION: known only from southwestern China.

ADDITIONAL SPECIMENS EXAMINED: Tuber sinoaestivum - CHINA: SICHUAN

PROVINCE, HurponG County, Daqiao mountain, 26°29'N 102°31’E, alt. 2250 m, 26

Nov. 2009, JP Zhang 158 (KUN-HKAS 59108); JP Zhang 156 (KUN-HKAS 59110);

19 Oct 2003, J Chen 129 (KUN-HKAS 44322). Gaji market, 23 Oct 2003, J Chen 141

(KUN-HKAS 44347). Gaji mountain, 26°29’N 102°31’E, alt. 2280 m, 25 Nov. 2009, JP

Zhang 143 (KUN-HKAS 59095); JP Zhang 152 (KUN-HKAS 59104). Haiba mountain,

26°29'N 102°31'E, alt. 2300 m, 23 Nov. 2009, JP Zhang 140 (KUN-HKAS 59100); JP

Zhang 141 (KUN-HKAS 59099); JP Zhang 144 (KUN-HKAS 59096); JP Zhang 149

(KUN-HKAS 59098). Yezu mountain, 26°29'N 102°31’E, alt. 2300 m, 27 Oct. 2009, JP

Zhang 65 (KUN-HKAS 59101); JP Zhang 66 (KUN-HKAS 59102).

Tuber aestivum - ENGLAND: Hedben Bridge forest, 6 Aug. 2010, PG Liu (KUN-

HKAS 70301, 70302). FRANCE: 2006, Y Wang (KUN-HKAS 70293, 70294, 70295);

Lacoste, 46090 Le Montat, P Sourzat (KUN-HKAS 70296); La Devéze, 46090 Cours,

P Sourzat (KUN-HKAS 70297). ITALY: Valle Fiorano (Modena), 10 Dec. 1984, A

Zambonelli (KUN-HKAS 70298, 70299, 70300). SWEDEN: IsLAND OF GOTLAND,

middle part of island, 8 Nov. 2003, C Wedén (KUN-HKAS 70290, 70291, 70292).

Phylogeny

Twenty-three samples were used for phylogenetic analysis. The homogeneity

test for the conjoint analysis of ITS-rDNA and 6-tubulin did not detect

conflict between the ITS-rDNA and £-tubulin analyses, which allowed for a

concatenated alignment and analysis. The alignment includes 1107 characters,

of which 951 are constant, 149 are parsimony informative, and 7 are parsimony

uninformative. Parsimony analysis generated one MP tree, with tree length =

360, CI = 0.928, RI = 0.968, RC = 0.898, and HI = 0.072.

In the concatenated analysis, the twenty-three samples grouped into three

well-supported clades (Fic. 6): Clade I included all the Chinese materials

78 ... Zhang, Liu & Chen

100 Tuber malenconii

T. malenconii

HKAS44322

HKAS44347

100 HKAS59100 Clade I

HKAS59101 T. sinoaestivum

HKAS59102

100

HKASS9111

HKAS70291

at 95 | HKAS70292

E24

96 ES

HKAS70296

Clade 1

Eee T. aestivum/uncinatum

81 100 64

E61

E17

E60

HKAS70294

100

nt Clade LI

M13 T. mesentericum

B6 T: magnatum

GO2 T. magnatum

—— 10 changes

Fic. 6. Phylogenetic relationships of Tuber sinoaestivum and T: aestivum inferred from maximum

parsimony (MP) analysis of ITS and $-tubulin sequences. MP Bootstrap values greater than 70%

are indicated at nodes.

analyzed (T. sinoaestivum), Clade I] included T: aestivum/uncinatum from

Europe, and Clade II was represented by three T: mesentericum samples. Clade

I formed a sister clade with Clade II. The same tree topology was obtained from

the single gene ITS-rDNA and 6-tubulin analyses but with different bootstrap

values: the ITS-rDNA analysis shows 99% and 100% bootstrap support for the

T. aestivum/uncinatum and T. sinoaestivum clades respectively, whereas the

6-tubulin analysis indicates only 61% and 69% support. All analyses suggest

a close relationship between T. sinoaestivum and T. aestivum/uncinatum,

T. mesentericum, and T: malenconii but support a clear separation between the

Chinese and the three European species.

Tuber sinoaestivum sp. nov (China) ... 79

Discussion

In the molecular phylogenetic tree, European T. aestivum collections (and

others annotated as T’ uncinatum) grouped together into clade II with 99%

bootstrap support. The taxonomic relationship between T! aestivum and

T. uncinatum has been subject to debate, with some regarding them as two

species (Chevalier et al. 1994; Mello et al. 2002; Riousset et al. 2001) and others

treating T’ uncinatum asa morphological variation of T: aestivum (Sin et al. 1995;

Trappe 1979), or perhaps two extremes of a morphological species-complex

(Gandeboeuf et al. 1994; Pacioni et al. 1993; Urbaneli et al. 1998). Based on

current research and our studies, we accept T. aestivum and T: uncinatum as a

single widespread species with highly variable morphological and ecological

characters. In addition, the phylogenetic trees suggest that “genetic variation”

is not great. A previous multi-gene (ITS-rDNA, B-tubulin, EFl-a) analysis

of sixty T: aestivum or T. uncinatum samples from Italy and other European

countries has also supported T: uncinatum and T: aestivum as a single species

(Paolocci 2004). A subsequent study by Wedén (2004) has drawn the same

conclusion.

Tuber aestivum was initially reported from China as a new record because of

its morphological resemblance to the European T’ aestivum (Chen et al. 2005;

Song et al. 2005). The Chinese collections that we studied are morphologically

similar to the European T! aestivum in that both have black ascomata with

conspicuous polygonal warts and reticulate spores. Such morphological

similarity is mirrored in our ITS-rDNA and 6-tubulin sequence analysis

rooted by T: magnatum (Bonito et al. 2010; Jeandroz et al. 2008). However,

after observing several European T. aestivum collections, we found that despite

their almost identical macrocharacters, the two species are easily distinguished

by spore shape. Tuber sinoaestivum spores are more globose (Fic. 7) as shown

by the parameters in T. sinoaestivum [Q = (1.00-)1.04-1.40(-1.43), Q=1.15 +

0.11] in contrast to those in T: aestivum [Q = (1.03-)1.10-1.50(-1.65), Q =1.29

+ 0.13]. Furthermore, T. sinoaestivum spores have much thicker (2-4 um) walls

and shallower (<5 um) meshes compared with the thinner walls (normally

<2 um thick) and higher (4-8 um) meshes in T: aestivum. Chen et al. (2005)

and Song et al. (2005) also noticed these differences but failed to use them

for specific discrimination. European mycologists also noted the more globose

spores in the Chinese T. sinoaestivum, but regarded it as a separate taxon

(Zambonelli et al. 2012). Although T’ aestivum is regarded as a widespread

species with high morphological variation, the differences in T! sinoaestivum

exceed the variation accepted for T: aestivum.

Until now, T. sinoaestivum has been found only from very limited localities

in southwestern China. In the local Sichuan markets, it is often found mixed

with collections representing the T. indicum complex. Zambonelli et al. (2012)

80 ... Zhang, Liu & Chen

25 30

Length

¢ Tuber aestivum ® T. sinoaestivum

Fic. 7. Ascospore dimensions of Tuber aestivum and T. sinoaestivum; each point represents the

mean values for 30 ascospores from a single ascocarp.

reported T. sinoaestivum (as “T: aestivum s.l”) as being sold in an Italian

market. The very small number cited suggests that it could be mixed with

fruiting bodies of T. indicum complex, a truffle intensively commercialized

internationally. Potential introduction into T: sinoaestivum ecosystems cannot

be excluded, as has occurred with T: indicum (Bonito et al. 2010; Murat et al.

2008), and precautions should be taken to avoid unwanted species invasions.

Nevertheless, the culinary traits of T. sinoaestivum can still be commercially

valuable. Accordingly, we suggest that when this truffle is traded, it should be

classified and explicitly labeled T. sinoaestivum to emphasize its geographical

origin and thus avoid confusion with T: aestivum and T. indicum complex. This

will be significant for both the sustainable development and conservation of

truffle biodiversity.

Acknowledgements

We are grateful for the two peer reviewers, Dr. Gregory Bonito and Dr. Kentaro

Hosaka, who critically reviewed the manuscript and provided invaluable suggestions.

We thank Dr. Yun Wang (New Zealand Institute for Plant & Food Research Limited,

New Zealand) and Dr. Christina Wedén (Department of Medicinal Chemistry, Uppsala

University, Sweden) for providing samples, literature, and comments. Dr. X.H. Wang

and Dr. FQ. Yu (Kunming Institute of Botany, Chinese Academy of Sciences, China)

helped to improve the manuscript. Prof. Alessandra Zambonelli (Department of Food

Protection and Valorization, Faculty of Agriculture, University of Bologna, Italy) and

Pierre Sourzat (Lycée professionnel agricole de Cahors-Le Montat, France) generously

loaned European samples of T: aestivum. This study was financed by the National

Tuber sinoaestivum sp. nov (China) ... 81

Science Foundation of China (No.30470011, 30770007, 30800005), International

Cooperation Yunnan Program of Innovation to Strengthen Provinces by Science &

Technology (No. 2009AC013), the Joint Founds of the National Science Foundation

of China and Yunnan Province Government (No.U0836604), and Key Laboratory of

Biodiversity and Biogeography, Kunming Institute of Botany, Chinese Academy of

Sciences (No.0806361121), as well as the Knowledge Innovation Program of the Chinese

Academy of Sciences (No.KSCX2-YW-G-025).

Literature cited

Bonito GM, Gryganskyi AP, Trappe JM, Vilgalys R. 2010. A global meta-analysis of Tuber ITS

rDNA sequences: species diversity, host associations and long-distance dispersal. Mol. Ecol.

19(22): 4994-5008. http://dx.doi.org/10.1111/j.1365-294X.2010.04855.x

Bonito GM, Trappe JM, Donovan S, Vilgalys R. 2010. The Asian black truffle Tuber indicum can

form ectomycorrhizas with North American host plants and complete its life cycle in non-

native soils. Fungal Ecol. 4: 83-93. http://dx.doi.org/10.1016/j.funeco.2010.08.003

Chen J, Liu PG. 2011. Delimitation of Tuber pseudohimalayense and T. pseudoexcavatum based on

morphological and molecular data. Cryptogamie Mycol. 32(1): 83-93.

Chen J, Liu PG, Wang Y. 2005. Notes on Tuber aestivum (Tuberaceae, Ascomycota). Acta Botanica

Yunnanica 27(4): 385-389.

Douet JP, Castroviejo M, Mabru D, Chevalier G, Dupré C, Bergougnoux F, Ricard JM, Médina B.

2004. Rapid molecular typing of Tuber melanosporum, T. brumale and T. indicum from tree

seedlings and canned truffles. Anal. Bioanal. Chem. 379: 668-673.

http://dx.doi.org/10.1007/s00216-004-2643-9

Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure from small quantities of fresh leaf

tissues. Phytochem. Bull. 19: 11-15.

Glass NL, Donaldson GC. 1995. Development of primer sets designed for use with the PCR

to amplify conserved genes from filamentous ascomycetes. Appl. Environ. Microb. 61:

1323-1330.

Guevara G, Bonito G, Cazares E, Rodriguez JA, Vilgalys R. 2008. Tuber regimontanum, new species

of truffle from Mexico. Rev. Mex. Micol. 26: 17-20.

Hu HT. 1992. Tuber formosanum sp. nov. and its mycorrhizal associations. Journal of the

Experimental Forest of National Taiwan University 6: 79-86.

Jeandroz S, Murat C, Wang YJ, Bonfante P, Le Tacon F. 2008. Molecular phylogeny and

historical biogeography of the genus Tuber, the ‘true truffles. J. Biogeogr. 35(5): 815-829.

http://dx.doi.org/10.1111/j.1365-2699.2007.01851.x

Kers LE. 2003. Tryfflarna Tuber aestivum och T. mesentericum i Sverige. Sven. Bot. Tidskr. 97:

157-175.

ManjonJL, Garcia- Montero LG, Alvarado P, Moreno G, Di Massimo G. 2009. Tuber pseudoexcavatum

versus T. pseudohimalayense - new data on the molecular taxonomy and mycorrhizae of Chinese

truffles. Mycotaxon 110: 399-412. http://dx.doi.org/10.5248/110.399

Murat C, Zampieri E, Vizzini A , Bonfante P. 2008. Is the Perigord black truffle threatened

by an invasive species? We dreaded it and it has happened! New Phytol. 178: 699-702.

http://dx.doi.org/10.1111/j.1469-8137.2008.02449.x

Pacioni G, Pomponi G. 1991. Genotypic patterns of some Italian populations of the Tuber aestivum

- T. mesentericum complex. Mycotaxon 42: 171-179.

Paolocci F, Rubini A, Granetti B, Arcioni S. 1997. Typing Tuber melanosporum and Chinese

black truffle species by molecular markers. FEMS Micobiol. Lett. 153: 255-260.

http://dx.doi.org/10.1016/S0378-1097(97)00226-7

82 ... Zhang, Liu & Chen

Paolocci F, Rubini A, Riccioni C, Topini K Arcioni S. 2004. Tuber aestivum and Tuber uncinatum:

two morphotypes or two species? FEMS Micobiol. Lett. 235: 109-115.

http://dx.doi.org/10.1016/j.femsle.2004.04.029

Pegler DN, Spooner BM, Young TWK. 1993. British truffles. A revision of British hypogeous fungi.

Royal Botanic Garden, Kew.

Roux C, Séjalon-Delmas N, Martins M, Parguey-Leduc, Dargent R, Bécard G. 1999. Phylogenetic

relationships between European and Chinese truffles based on parsimony and distance analysis

of ITS sequences. FEMS Micobiol. Lett. 180: 147-155.

http://dx.doi.org/10.1016/S0378-1097(99)00474-7

Sin KS, Park JS, Yoshimi S. 1995. Note on Tuber aestivum subsp. uncinatum (newly recorded in

Korea). Korean J. Mycol. 23: 10-13.

Song MS, Cao JZ, Yao YJ. 2005. Occurrence of Tuber aestivum in China. Mycotaxon 91: 75-80.

Swofford DL. 2002. PAUP*: phylogenetic analysis using parsimony (*and other methods), 4.0b4a.

Sunderland, Massachusetts: Sinauer Associates.

Trappe JM, Castellano MA. 1991. Keys to the genera of truffles (Ascomycetes). MclIlvainea 10:

47-65.

Wang Y, Moreno G, Riousset LJ, Manjon JL, Riousset G, Fourre G, Di Massimo G, Garcia- Montero

LG, Diez J. 1998. Tuber pseudoexcavatum sp. nov., a new species from China commercialized

in Spain, France and Italy with additional comments on Chinese truffles. Cryptogamie Mycol.

£9: IN3—120;,

Wang YJ, Tan ZM, Zhang DC, Murat C, Jeandroz S, Le Tacon F. 2006. Phylogenetic and populational

study of the Tuber indicum complex. Mycol. Res. 110: 1034-1045.

http://dx.doi.org/10.1016/j.mycres.2006.06.013

White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal

RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR Protocols: a guide to

methods and applications. New York: Academic Press.

Yang ZL, Zhang LE. 2003. Type studies on Clitocybe macrospora and Xerula furfuracea var. bispora.

Mycotaxon 88: 447-454.

Zambonelli A, Iotti M, Piattoni F. 2012. Chinese Tuber aestivum sensu lato in Europe.The open

Mycology Journal. 6: 22-26.

Zhang LF, Yang ZL, Song DS. 2005. A phylogenetic study of commercial Chinese truffles and their

allies: taxonomic implications. FEMS Micobiol. Lett. 245: 85-92.

http://dx.doi.org/10.1016/j.femsle.2005.02.028

MY COTAXON

http://dx.doi.org/10.5248/122.83

Volume 122, pp. 83-87 October-December 2012

Two new Ellisembia species from Hainan and Yunnan, China

SHOU-CAI REN”, JIAN MA’? & XIU-GUO ZHANG"

‘Department of Plant Pathology, Shandong Agricultural University, Taian, 271018, China

*Zaozhuang Vocational College, Zaozhuang, 277800, China

*CORRESPONDENCE TO: zhxg@sdau.edu.cn, sdau613@163.com

Asstract — Ellisembia heritierae sp. nov. on Heritiera littoralis and E. pistaciae sp. nov. on

Pistacia chinensis are described and illustrated from specimens collected in tropical forests in

Hainan and Yunnan Provinces, China. They are compared with closely related taxa.

KEY worpDs —anamorphic fungi, systematics, taxonomy

Introduction

Subramanian (1992) established Ellisembia Subram. typified by E. coronata

(Fuckel) Subram. to accommodate those taxa previously described in

Sporidesmium that have distoseptate conidia borne terminally on determinate

or percurrently extending conidiogenous cells. The genus Imicles Shoemaker &

Hambl. was later merged into Ellisembia by Wu & Zhuang (2005). More than

40 Ellisembia species have been described, mostly from rotten wood and dead

branches of various plants (Subramanian 1992, McKenzie 1995, 2010, Goh &

Hyde 1999, Mena-Portales et al. 2000, Zhou et al. 2001, Wu & Zhuang 2005,

Heuchert & Braun 2006, Ma et al. 2008, 2011b).

The lignicolous mycota is very rich in tropical and subtropical forests of

Hainan and Yunnan Provinces (Dai & Cui 2006, Dai & Li 2010, Ma et al. 2010,

2011a, Cui et al. 2011, Zhang et al. 2011). During ongoing surveys of tropical

forest microfungi in the two regions, two new Ellisembia species were found.

The type specimens are deposited in the Herbarium of the Department of

Plant Pathology, Shandong Agricultural University (HSAUP) with isotypes in

the Mycological Herbarium, Institute of Microbiology, Chinese Academy of

Sciences (HMAS).

Ellisembia heritierae S.C. Ren & X.G. Zhang, sp. nov. FIG. 1

MycoBank MB 800477

Differs from Ellisembia ellipsoidea in its wider conidia with fewer distosepta and non-

extending conidiogenous cells.

84 ... Ren, Ma & Zhang

Fic. 1. Ellisembia heritierae. Conidiophores, conidiogenous cells and conidia.

Type: China. Hainan Province: tropical forest of Xishuangbanna, on decaying branches

of Heritiera littoralis Aiton (Sterculiaceae), 30 October 2011, Sh.C. Ren (Holotype

HSAUP H0062; isotype HMAS 243417).

EryMoLoey: in reference to the host genus, Heritiera.

COLONIES on natural substrate effuse, dark brown to black, hairy. Mycelium

partly superficial, partly immersed in the substratum, composed of branched,

septate, pale brown, smooth-walled hyphae, 1.5-3 um wide. CONIDIOPHORES

distinct, single or in groups, erect, unbranched, straight or flexuous, cylindrical,

brown, smooth, 4—7-septate, 80-110 um long, 5-6.5 um wide. CONIDIOGENOUS

CELLS monoblastic, integrated, terminal, cylindrical, brown, smooth,

determinate. Conidial secession schizolytic. Conrp1a holoblastic, solitary,

acrogenous, ellipsoidal, rounded at the apex, truncate at the base, smooth-

Ellisembia heritierae & E. pistaciae spp. nov. (China) ... 85

walled, brown to pale brown, 4-distoseptate, 35-40 um long, 12-14.5 um wide

in the broadest part, 2.5-3.5 um wide at the truncate base.

Comments - Ellisembia heritierae resembles E. ellipsoidea W.P. Wu in

producing ellipsoidal conidia, but can be differentiated from E. ellipsoidea

(conidia 40-45 x 10-11 um, 7-8-distoseptate) by its wider conidia with

fewer distosepta. In addition, conidiogenous cells of E. ellipsoidea have up to 3

lageniform to ampulliform percurrent extensions, while those of E. heritierae

have no extensions.

Fic. 2. Ellisembia pistaciae. Conidiophores, conidiogenous cells and conidia.

Ellisembia pistaciae S.C. Ren & X.G. Zhang, sp. nov. FIG. 2

MycoBank MB 800478

Differs from previously described Ellisembia species in its flask-shaped conidia with a

subhyaline multiseptate rostrum.

86 ... Ren, Ma & Zhang

Type: China. Hainan Province: tropical forest of Bawangling, on decaying branches

of Pistacia chinensis Bunge (Anacardiaceae), 30 October 2011, Sh.C. Ren (Holotype

HSAUP H8620; isotype HMAS 243418).

EryMoLoey: in reference to the host genus, Pistacia.

COLONIES on natural substrate effuse, brown, hairy. Mycelium partly superficial,

partly immersed in the substratum, composed of branched, septate, pale

brown, smooth-walled hyphae, 2-4 um wide. CoNIDIOPHORES distinct, single

or in groups, erect, unbranched, straight or flexuous, cylindrical, brown to dark

brown, smooth, 3-8-septate, 70-125 um long, 4.5-6 um wide. CONIDIOGENOUS

CELLS monoblastic, integrated, terminal, cylindrical, brown, smooth,

determinate. Conidial secession schizolytic. Conrp1a holoblastic, solitary,

acrogenous, flask-shaped, rostrate, smooth-walled, brown, rostrum pale brown

to subhyaline, 8-10-distoseptate, 50-65 um long (rostrum included), 13-14.5

um wide in the broadest part, 3.5-4 um wide at the truncate base, rostrum

25-40 um long, 6-8 um wide.

Comments - Ellisembia pistaciae is unique in having determinate conidiogenous

cells and flask-shaped conidia with a multiseptate, pale coloured rostrum

measuring 25-40 x 6-8 um.

Acknowledgments

The authors express gratitude to Dr Bryce Kendrick and Dr Eric H.C. McKenzie for

serving as pre-submission reviewers and for their valuable comments and suggestions.

This project was supported by the National Natural Science Foundation of China (Nos.

31093440, 30499340, 30770015) and the Ministry of Science and Technology of the

People’s Republic of China (Nos. 2006FY120100, 2006FY110500-5).

Literature cited

Cui BK, Du P, Dai YC. 2011. Three new species of Inonotus (Basidiomycota, Hymenochaetaceae)

from China. Mycol. Prog. 10: 107-114. http://dx.doi.org/10.1007/s11557-010-0681-6

Dai YC, Cui BK. 2006. Two new species of Wrightoporia (Basidiomycota, Aphyllophorales) from

southern China. Mycotaxon 96: 199-206.

Dai YC, Li HJ. 2010. Notes on Hydnochaete (Hymenochaetales) with a seta-less new species

discovered in China. Mycotaxon 111: 481-487. http://dx.doi.org/10.5248/111.481

Goh TK, Hyde KD. 1999. Fungi on submerged wood and bamboo in the Plover Cove Reservoir,

Hong Kong. Fungal Divers. 3: 57-85.

Heuchert B, Braun U. 2006. On some dematiaceous lichenicolous hyphomycetes. Herzogia 19:

11-21.

Ma J, Zhang K, Zhang XG. 2008. Two new Ellisembia species from Hainan, China. Mycotaxon 104:

141-145.

Ma LG, Ma J, Zhang YD, Zhang XG. 2010. A new species of Spadicoides from Yunnan, China.

Mycotaxon 113: 255-258. http://dx.doi.org/10.5248/113.255

Ma LG, Ma J, Zhang YD, Zhang XG. 2011a. Taxonomic studies of Endophragmiella from southern

China. Mycotaxon 113: 255-258. http://dx.doi.org/10.5248/117.279

Ellisembia heritierae & E. pistaciae spp. nov. (China) ... 87

Ma J, Ma LG, Zhang YD, Zhang XG. 2011b. Three new hyphomycetes from southern China.

Mycotaxon 117: 247-253. http://dx.doi.org/10.5248/117.247

McKenzie EHC. 1995. Dematiaceous hyphomycetes on Pandanaceae. 5. Sporidesmium sensu lato.

Mycotaxon 56: 9-29.

McKenzie EHC. 2010. Three new phragmosporous hyphomycetes on Ripogonum from an

‘ecological island’ in New Zealand. Mycotaxon 111: 183-196.

Mena-Portales J, Delgado-Rodriguez G, Heredia-Abarca G. 2000. Nuevas combinaciones para

especies de Sporidesmium sens. lat. Bol. Soc. Micol. Madrid 25: 265-269.

Subramanian CV. 1992. A reassessment of Sporidesmium (hyphomycetes) and some related taxa.

Proc. Indian Nat. Sci. Acad. B 58: 179-190.

Wu WP, Zhuang WY. 2005. Sporidesmium, Endophragmiella and related genera from China. Fungal

Divers. Res. Ser. 15: 1-351.

Zhang YD, Ma J, Wang Y, Ma LG, Castafieda-Ruiz RE, Zhang XG. 2011. New species and record of

Pseudoacrodictys from southern China. Mycol. Prog. 10: 261-265.

http://dx.doi.org/10.1007/s11557-010-0696-z

Zhou DQ, Hyde KD, Wu XL. 2001. New records of Ellisembia, Penzigomyces, Sporidesmium and

Repetophragma species on bamboo from China. Acta Botanica Yunnanica 23(1): 45-51.

MY COTAXON

http://dx.doi.org/10.5248/122.89

Volume 122, pp. 89-110 October-December 2012

Lichenized and lichenicolous fungi new to

Babia Gora National Park (Poland, Western Carpathians)

PAWEL CZARNOTA’ & MICHAEL WEGRZYN’

"Department of Agroecology and Landscape Architecture, Faculty of Biology and Agriculture,

University of Rzeszéw, Cwikliniskiej 2, 35-601 Rzeszéw, Poland

*Zdzislaw Czeppe Department of Polar Research and Documentation, Institute of Botany,

Jagiellonian University, Kopernika 27, PL-31-501 Krakow, Poland

CORRESPONDENCE TO *: pawczarnota@poczta.onet.pl

ABSTRACT — 46 lichenized fungi and 1 lichenicolous fungus new to the Babia Gora Massif, a

Polish and Slovak transborder mountain range, the highest in the flysch Western Carpathians,

are presented here. Taxonomic and ecological remarks, as well as the distribution of some

noteworthy taxa in other Carpathian ranges, are included. Helocarpon crassipes is reported

in detail for the first time from the Western Beskidy Mts and Leptogium intermedium is

rediscovered in the Polish Carpathians.

Key worps — lichen diversity, lichen biota, lichens, Biosphere Reserve

Introduction

The Babia Gora Massif, the highest mountain range (1725 m a.s.l.) of the

Western Beskidy Mts (part of the Western Carpathians), is located on the

Polish-Slovak border. The main part of this transborder range belongs to Poland

and is covered by the Biosphere Reserve of UNESCO MAB. Since the whole

Babia Gora Massif has a unique and valuable natural character, an extension

of the Reserve into Slovakia part is planned. The Protected Landscape Area

‘Horna Orava has covered the Slovak portion of the Massif since 1979, while

the Polish side is almost entirely included within the Babia Gora National Park

since 1954. Different nature conservation methods on both sides of the massif

are nonetheless linked by compatible protection regimes.

The natural environment of the Carpathians was extensively exploited

throughout the whole of the 18th and early 19th centuries, with mass

deforestation and replacement by spruce monocultures on the degraded areas

contributing to an impoverished epiphytic lichen biota. Moreover, excessive

grazing of large cattle herds in the alpine and subalpine zones caused the

destruction of terrestrial lichens, important components of alpine grasslands.

90 ... Czarnota & Wegrzyn

The diversity of plant communities, forming vegetation zones from the lower

forest zone to the alpine zone in the Babia Gora Massif, and especially relics of

ancient upper spruce montane forests, continues to have a direct impact on the

unique character of the lichen biota of the massif, which includes 350 species of

both lichenized and lichenicolous fungi (Bielczyk 2004; Czarnota 2007; Kukwa

et al. 2010).

The first reports on lichens of the Babia Gora Massif are by Stein (1872,

1873), whose data are repeatedly cited in the summary studies by Rehman

(1879) and Boberski (1886). These contain information on some macrolichens

(e.g. Usnea longissima, Sticta sylvatica) no longer recorded in this area, despite

intensive lichenological studies were made by Suza (1951), Tobolewski (1966)

and Nowak (1998). Other minor works referring mainly to the ‘Atlas of the

geographical distribution of lichens in Poland’ and detailed history of all studies

on lichens in the Babia Gora Massif are provided by Bielczyk (2004). In the

first decade of this century, the area of Babia Gora NP has once more become

a site of lichenological interest, with new reports of lichens from this region

(Wegrzyn 2002; 2004). Except for the contributions by Lisicka (1980) on two

Umbilicaria species and Guttova (2001) on Microcalicium disseminatum, there

are no additional published data from the Slovak side of Babia Géra Massif.

The known lichen diversity of the neighbouring lower flysch ranges of

Western Beskidy Mts (Kiszka 1967; Nowak 1998; Czarnota 2010) suggests

that the biodiversity is probably much greater in the Babia Géra Massif than

published; indeed, our current lichenological results significantly extend the

list by 47 taxa. However, we did not make a detailed exploration of all available

lichen habitats in 2007-10 but focused on lichens occupying standing and

fallen spruce ‘dead wood’ (including wind-throws) within the strictly protected

area and investigated lichen diversity within 520 permanent plots regularly

distributed throughout the park, including the highest alpine zone.

Materials & methods

All collections except one were made in Babia Gora National Park. Lichens were

identified by standard microscopy, with Lepraria, Cladonia and some sterile sorediate

species checked through thin-layer chromatography (TLC) in solvent C according

to Orange et al. (2001). Apothecial hand-made sections were mounted in water and

anatomical structures were measured in KOH. Spot test reactions of apothecial

pigments were studied in KOH and NaClO, and ascus types as well as medulla in IKI.

Nomenclature follows MycoBank Fungal Databases (http://www.mycobank.org).

Examined materials and selected habitat notes are given for all taxa, while

distributional, ecological and taxonomic notes are included for more noteworthy and

rare species. The P. Czarnota collections are deposited in the Gorce National Park (GPN)

herbarium while M. Wegrzyn collections are in the Jagiellonian University herbarium

in Krakow (KRA).

Abbreviations: fs no. = forest section number; * = lichenicolous fungus.

Lichenized and lichenicolous fungi (Poland) ... 91

The species

Absconditella delutula (Nyl.) Coppins & H. Kilias

SPECIMENS EXAMINED: POLAND. MALOPOLSKA PROVINCE, SE slope of Kepa hill,

fs no. 25c [49°34'29.4"N 19°33'41.3"E], alt. 1360 m, 26.8.2009, leg. P. Czarnota 6339

(GPN); E slope of Sokolica hill, fs no. 17b [49°35'15.1"N 19°34'26.2"E], alt. 1140 m,

9.6.2009, leg. P. Czarnota 6046 (GPN); NE slope of Sokolica hill fs no. 5b close to 'Dolny

Plaj tourist track [49°35'26.8"N 19°34'14.9"E], alt. 1040 m, 10.6.2009, leg. P. Czarnota

5991 (GPN); 'Gorny Plaj’ tourist track, near Mokry Staw lake, fs no. 18b [49°35'25.18"N

19°33'57.2"E], alt. 1040 m, 10.11.2010, leg. M. Wegrzyn 4153 (KRA).

ECOLOGY & DISTRIBUTION: Based on both the present study and previous investigations

in other Polish ranges (Czarnota unpubl.), A. delutula seems not infrequent on sandstone

pebbles over root systems of recent conifer wind-throws in montane forests. Sometimes

it occurs on decaying wood (Pisut et al. 2007; Malicek et al. 2010).

This ephemeral species has been found several times in Poland (Czarnota &

Kukwa 2008a). The new sites extend its range in the Western Carpathians where it has

previously been reported from both Polish (Gorce, Beskid Wyspowy Mts) and Czech

(Moravskoslezké Beskydy) areas (Czarnota & Kukwa 2008a; Malicek et al. 2010).

Anisomeridium polypori (Ellis & Everh.) M.E. Barr

SPECIMEN EXAMINED: POLAND, MALOPOLSKA PROVINCE, N of Markowe Szczawiny

shelter house, fs no. 74b [49°35'48.7"N / 19°31'12.6"E], alt. 880 m, on decaying bark

of roots of fallen Picea abies within Carpathian beech forest, 2.7.2009, leg. P. Czarnota

6120 (GPN).

Biatora chrysantha (Zahlbr.) Printzen

SPECIMENS EXAMINED: POLAND. MALOPOLSKA PROVINCE, N slope of massif, near

Rybny Potok stream, fs no. 59a [49°36'53.2"N / 19°32'15.3"E], alt. 750 m, on Alnus

glutinosa bark, 4.8.2010, leg. M. Wegrzyn 4214 (KRA); NE slope of Sokolica, fs no. 17b

[49°35'15.0"N / 19°34'17.09"E], alt. 1200 m, on Sorbus aucuparia bark, 9.6.2009, leg. M.

Wegrzyn 3169 (KRA).

ECOLOGY & DISTRIBUTION: B. chrysantha prefers old, natural forests, where it is found at

the base of older trees and on over-growing bryophytes in high precipitation sites.

This species has been found in Poland several times in the Carpathians (Faltynowicz

2003) and Western Pomerania (Kukwa & Szymczyk 2006). Close to Babia Gora Massif

it was reported only from Wielka Racza Mt. (Nowak 1998). In Europe its distribution

is defined as suboceanic, since it is widely distributed in Scandinavia, Finland and the

British Isles (Printzen & Palice 1999), but it is also recorded in the central, mountainous

part of Europe (e.g. Coppins et al. 1998, 2005; Kiszka & Koscielniak 1998; Printzen &

Palice 1999; Pisut et al. 2007).

Biatora helvola Korb. ex Hellb.

SPECIMEN EXAMINED: E slope of Sokolica hill, fs no. 25a [49°35'08.8"N / 19°34'05.9"E],

alt. 1280 m, on Sorbus aucuparia bark within upper montane spruce forest, 9.6.2009, leg.

P. Czarnota 6026 (GPN).

Biatora veteranorum Coppins & Sérus. PLATE 1A

= Catillaria alba Coppins & Vézda

This species is almost exclusively cited in the literature as Catillaria alba

(Palice 1999; Fletcher & Coppins 2009), since it has only recently been

92 ... Czarnota & Wegrzyn

transferred to Biatora (as B. veteranorum nom. nov., non B. alba Hepp) on

the basis of its phylogenetic affinity to several other Biatora taxa (Sérusiaux et

al. 2010). Vézda (1993) originally noted in the protologue that as this species

does not belong to the genus Catillaria sensu stricto, the name Catillaria alba

should be treated rather tentatively. Indeed, the 1-septate, ellipsoid ascospores,

ascus tholus with a darker tube and non-amyloid conical ocular chamber,

unpigmented apical caps of paraphyses, small bacilliform conidia, and the

usual presence of short-stalked pycnidia suggest that the species may belong

to another genus within, for example, Pilocarpaceae (Sérusiaux et al. 2010).

Such pycnidia are almost unknown in Biatora except for B. ligni-mollis T. Sprib.

& Printzen, which forms rather sessile, globose, and never white pruinose

pycnidia, whereas in B. veteranorum they are distinctly stalked, elongated, and

almost white from distinct pruina. The ‘core’ pycnidial wall in B. veteranorum

is white to pale beige, contrasting with the orange or slightly brown pycnidial

pigmentation in B. ligni-mollis. Such pycnidial characters of major diagnostic

importance for B. veteranorum, which is often found in only in the asexual

stage. Stalked, pale pycnidia are also present in several Micarea species, e.g.,

M. doliiformis (Coppins & P. James) Coppins & Sérus., M. hedlundii Coppins,

M. pycnidiophora Coppins & P. James, M. stipitata Coppins & P. James, and

M. tomentosa Czarnota & Coppins (Coppins 1983; Czarnota 2007; Sérusiaux

et al. 2010), but there they are at most whitish tomentose and never pruinose.

Moreover, all these species differ from B. veteranorum in their external thallus.

All B. veteranorum specimens from the Babia Gora Massif have abundant

apothecia, which are also white pruinose due to minute crystals confined to

the epithecium.

SPECIMENS EXAMINED: POLAND. MALOPOLSKA PROVINCE, N slope of Diablak Mt.,

fs no. 23a [49°34'55"N / 19°31'10.7"E], alt. 1270 m, 7.8.2009, leg. P. Czarnota 6265

(GPN); N slope of Sokolica hill, fs no. 7a [49°35'21.0"N / 19°33'12.9"E], alt. 1060 m,

21.7.2009, leg. P. Czarnota 6225 (GPN); N slope of Diablak Mt., fs no. 10g [49°34'57.3"N

/ 19°31'51.6"E], alt. 1180 m, 3.7.2009, leg. P. Czarnota 6172 (GPN). POLAND.

PODKARPACKIE PROVINCE, Bieszczady Mts, Bieszczadzki National Park, Sianki forest

district, fs no. 781, on wood of a decaying Abies alba stump, mixed forest dominated by

Picea abies, 19.6.2002, leg. P. Czarnota 2872 (GPN).

ECOLOGY & DISTRIBUTION: B. veteranorum prefers slightly decayed wood of decorticated

higher conifer snags within dense mixed and spruce montane forests, especially in lower

zones, where it usually occupies shady niches.

This species has previously only been reported from Poland twice, both from the

Polish Western Carpathians (Czarnota 2003, 2010; as Catillaria alba). The new records

PiaTE. 1. Habits of several noteworthy species. A - Biatora veteranorum [|Czarnota 6225 (GPN)];

B - Elixia flexella |Czarnota 6266 (GPN)]; C - Lecanora sarcopidoides [Czarnota 4199 (GPN)];

D - Lecanora subintricata [Czarnota 6062 (GPN); E - Leptogium intermedium |Wegrzyn 4151

(KRA)]; F - cross section of thallus of Leptogium intermedium [Wegrzyn 4151 (KRA)]; G - Lecidea

leprarioides [Czarnota 6177 (GPN)]; H - Trapeliopsis glaucolepidea [Czarnota 6012 (GPN)].

Lichenized and lichenicolous fungi (Poland) ... 93

ane

r SOE) WN ANG

} a Mh: fe

94 ... Czarnota & Wegrzyn

from Babia Gora Massif and Bieszczady Mts in Eastern Carpathians extend its range to

the entire Polish part of this mountain range. B. veteranorum was also recorded in the

Ukrainian Carpathians (Kondratyuk & Coppins 2000).

Calicium glaucellum Ach.

SPECIMENS EXAMINED: POLAND. MALOPOLSKA PROVINCE, N slope of Sokolica hill

fs no. 7a [49°35'21.0"N / 19°33'12.9"E], alt. 1060 m, 21.7.2009, leg. P. Czarnota 6226

(GPN); ibid., [49°35'25.9"N / 19°33'12.2"E], alt. 1055 m, 21.7.2009, leg. P. Czarnota 6235

(GPN)); ibid., fs no. 24a, below Brona Pass [49°35'07.3"N / 19°30'41.4"E], alt. 1250 m,

21.8.2009, leg. P. Czarnota 6311 (GPN); S slope of Kepa hill, fs no. 26h [49°34'07.8"N /

19°33'12.8"E], alt. 1290 m, 17.7.2009, leg. P. Czarnota 6078 (GPN); N slope of Diablak

Mt., fs no. 10g [49°34'58.2"N / 19°31'45.7”E], alt. 1180 m, 3.7.2009, leg. P. Czarnota

6140 (GPN); N slope of Babia Gora Massif, Czatoza Forest, fs no. 16a [49°35'42.0"N /

19°28'49.7"E], alt. 1200 m, 23.6.2009, leg. M. Wegrzyn 3792 (KRA).

ECOLOGY & DISTRIBUTION: Similar to several other Calicium species, C. glaucellum is

found on decaying wood of decorticated conifer trunks within different montane forests

up to the timber line.

Although Tobolewski (1966) focused on species of the former Caliciaceae during

his explorations of Babia Gora, he did not report this currently quite common epixylic

lichenized fungus. However, in the Tobolewski key to Calicium (Nowak & Tobolewski

1975), it was likely to be confused with C. abietinum Pers.

Candelariella aurella (Hoftm.) Zahlbr.

SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, S slope of Diablak Mt.,

above the Rajsztag road, fs no. 99h [49°33'45.1"N / 19°43'46.8"E], alt. 905 m, on concrete

of old building ruins, 11.6.2008, leg. M. Wegrzyn 4106 (KRA).

Chaenothecopsis nigra Tibell

SPECIMENS EXAMINED: POLAND. MAELOPOLSKA PROVINCE, N slope of Diablak Mt.,

fs no. 10g [49°34'56.3"N / 19°31'55.2”E], alt. 1170 m, 3.7.2009, leg. P. Czarnota 6133 &

6134 (GPN)); ibid., [49°34'58.0"N / 19°31'52.1"E], alt. 1170 m, 3.7.2009, leg. P. Czarnota

6161 (GPN); below Brona Pass, fs no. 24a, [49°35'10.1"N / 19°30'47.1”E], alt. 1240 m,

14.7.2009, leg. P. Czarnota 6188 (GPN).

ECOLOGY & DISTRIBUTION: Most specimens were collected on free-living algae

Stichococcus in association with Chaenotheca stemonea on bark of dead spruces at trunk

bases, but it was also found on Stichococcus over soil in root-system underhangs of fallen

Picea abies; all collections were within upper montane spruce forest.

This species is often included in lists of lichenicolous fungi (e.g. Bielczyk 2003), but it

is also sometimes lichenized (Giavarini & Coppins 2009) as in this case. From Poland C.

nigra has been reported only twice (Faltynowicz 2003), including a record from Western

Beskidy Mts (Bielczyk 2003) lacking details.

Cladonia cenotea (Ach.) Schaer.

SPECIMENS EXAMINED: POLAND. MAELOPOLSKA PROVINCE, S slope of Kepa hill, fs no.

26h [49°34'09.3"N / 19°33'03.2"E], alt. 1365 m, 17.7.2009, leg. P. Czarnota 6085 (GPN);

N slope of the massif below Brona pass, fs no. 24a [49°35'01.0"N / 19°30'33.5"E], alt.

1330 m, 3.7.2010, leg. M. Wegrzyn 4005 (KRA).

ECOLOGY & DISTRIBUTION: Common in the Polish Carpathians (Faltynowicz 2003;

Bielczyk 2003), this species is found on decaying wood of roots, soil, and plant debris in

upper montane spruce forests.

Lichenized and lichenicolous fungi (Poland) ... 95

Cladonia gracilis (L.) Willd.

SPECIMENS EXAMINED: POLAND. MALOPOLSKA PROVINCE, S slope of Gowniak hill,

Wolarnia, fs no. 28f [49°34'14.3"N / 19°32'13.0"E], alt. 1575 m, on soil, 10.7.2010, leg. M.

Wegrzyn 4171 (KRA); close to Gowniak hill, fs no. 21f [49°34'32.18"N / 19°32'27.24"E],

alt. 1620 m, on soil, 27.8.2009, leg. M. Wegrzyn 3286 (KRA).

ECOLOGY & DISTRIBUTION: This very common species in lowland Scots pine forests is

also recorded in subalpine and alpine zones of mountain regions in Europe.

In the Tatra Mts alpine meadows are dominated by C. gracilis and C. amaurocraea

(Florke) Schaer. is rare (Osyczka & Wegrzyn 2005), but the situation is reversed in the

Babia Gora Massif (Wegrzyn unpubl.). Because C. amaurocraea and C. macroceras

(Delise) Ahti are morphologically very similar to C. gracilis in this region, species

determination requires more attention, including investigation of their secondary

metabolites (Osyczka & Wegrzyn 2005).

Cladonia grayi G. Merr. ex Sandst.

SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, S of Sokolica hill, fs no. 25c

[49°34'58.3"N / 19°33'48.3"E], alt. 1290 m, on humus over root system of fallen Picea

abies within upper montane spruce forest, 1.7.2009, leg. P. Czarnota 6114 (GPN).

Cladonia norvegica Tonsberg & Holien

SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, E slope of Sokolica hill, fs

no. 25a [49°35'07.9"N / 19°34'06.4”E], alt. 1290 m, on roots of fallen Picea abies within

upper montane spruce forest, 9.6.2009, leg. P. Czarnota 6011 (GPN).

DISTRIBUTION: The species is rare in Poland. Osyczka (2011) confirms its presence in

the Tatra Mts, the Pieniny Mts, and the region of the Puszcza (Primeval) Augustowska

and Puszcza Knyszynska forests in northeast Poland.

Cladonia ochrochlora Flérke

The encountered specimen consists of several subulate and scyphose podetia.

Generally, C. ochrochlora is characterized by areolate cortication with cortex

especially well developed basally but sometimes extending upwards to near the

apices or even inside narrow scyphi. The surface without cortex is covered by

farinose to granular soredia (e.g. Ahti 2000; James 2009). This description can

be applied to the specimen examined; however, some of the gathered podetia

are almost totally areolate-corticate, partly richly squamulose, and produce

only scattered granulose soredia. The specimen was fertile, with most of the

podetia terminating in pale brown contiguous apothecia.

SPECIMEN EXAMINED: POLAND. MAEOPOLSKA PROVINCE, N foot of Diablak Mt.,

Stonow, fs no. 50b [49°36'21.1"N / 19°33'3.8"E], alt. 770 m, on decaying wood, 21.5.2010,

leg. M. Wegrzyn 4008 (KRA).

ECOLOGY & DISTRIBUTION: This species has previously been rather frequently reported

from the Polish Carpathians (see Bielczyk 2003), but not from the Babia Gora Massif.

The specimen was overgrowing decayed spruce wood.

Diploschistes muscorum (Scop.) R. Sant.

SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, the main ridge of massif,

close to Géwniak hill, fs no. 21f [49°34'27.84"N / 19°32'12.99"E], alt. 1680 m, on base-

rich soil between calcareous sandstones, 27.8.2009, leg. M. Wegrzyn 4215 (KRA).

96 ... Czarnota & Wegrzyn

Elixia flexella (Ach.) Lumbsch PLATE 1B

SPECIMENS EXAMINED: POLAND. MAELOPOLSKA PROVINCE, N slope of Diablak Mt.,

close to Suchy Stawek, fs no. 23a [49°34'55"N / 19°31'10.7"E], alt. 1270 m, leg. P. Czarnota

6266 (GPN); SE slope of Kepa hill, fs no. 25c [49°34'20.9"N / 19°33'52.9"E], alt. 1200

m, 17.7.2009, leg. P. Czarnota 6063 (GPN); below Brona Pass, fs no. 24a [49°35'09.3"N /

19°30'51.6"E], 1235 m, 14.7.2009, leg. P. Czarnota 6195 (GPN); N slope of Diablak Mt.,

fs no. 10g [49°34'58.2"N / 19°31'45.7"E], alt. 1180 m, 3.7.2009, leg. P. Czarnota 6141

(GPN).

ECOLOGY & DISTRIBUTION: Quite common on decaying wood of decorticated Picea

abies trunks and fallen spruce roots within the upper montane spruce forest, E flexella is

known elsewhere in the Polish Western Carpathians (Bielczyk 2003).

*Endococcus propinquus (Kérb.) D. Hawksw.

SPECIMENS EXAMINED (both on sterile epilithic lichens): POLAND. MALoPoLska

PROVINCE, SE slope of Kepa hill, fs no. 25c [49°34'21.8"N / 19°33'52.0"E], alt. 1210 m,

17.7.2009, leg. P. Czarnota 6072 (GPN); N slope of Sokolica hill, fs no. 18b [49°35'26.5"N

/ 19°34'02.4"E], alt. 1050 m, 10.6.2009, leg. P. Czarnota 6049 (GPN).

ECOLOGY & DISTRIBUTION: This lichenicolous fungus is probably common in the

Babia Gora Massif; it grows on various epilithic lichens over sandstone rocks above the

timberline but is also found within montane forests.

Fuscidea pusilla Tonsberg

Since Tonsberg (1992) described this species from Scandinavia, its

distribution has markedly increased in Europe, despite its being found only in

a sterile, usually overlooked or hardly distinguishable, form. The presence of

divaricatic acid as the major diagnostic secondary substance appears sufficient

for distinguishing E pusilla from several other morphologically similar species:

Ropalospora viridis (Tonsberg) Tonsberg, Mycoblastus fucatus (Stirt.) Zahlbr.,

Fuscidea arboricola Coppins & Tonsberg, and Buellia griseovirens (Turner

& Borrer ex Sm.) Almb. Ropalospora viridis, also sterile (except a few fertile

reports; Tonsberg 1992), differs almost only in the presence of perlatolic acid

and thus is not UV+ bluish-white (contrasting with E pusilla, which contains

divaricatic acid). The other three species, which also contain substances other

than divaricatic acid, are easily detected in simple spot tests such as: P+ ginger

from fumarprotocetraric acid (M. fucatus and F. arboricola) and K+ yellow

turning to brownish-red and P+ yellow to yellow-orange due to norstictic acid

and substances of stictic acid complex in B. griseovirens. (Sometimes this K+

reaction is almost invisible, as the norstictic acid concentration is below the

detection limit, but then characteristic norstictic acid crystals can be observed

in the slide preparation.) Lendemer (2011) provides excellent morphological

and chemical comparisons of F. pusilla and R. viridis supported by colour

figures.

SPECIMENS EXAMINED (selected): POLAND. MALopoLsKA PROVINCE, N slope of

Diablak Mt., fs no. 22a [49°34'51.3"N / 19°31'41.6"E], alt. 1220 m, 7.8.2009, leg. P.

Lichenized and lichenicolous fungi (Poland) ... 97

Czarnota 6273 (GPN)); E slope of Sokolica hill, fs no. 25a [49°35'07.9"N / 19°34'06.4"E],

alt. 1290 m, 9.6.2009, leg. P. Czarnota 6010 (GPN); N slope of Diablak Mt., fs no. 10g

[49°34'56.3"N / 19°31'55.2"E], alt. 1170 m, 3.7.2009, leg. P. Czarnota 6165 (GPN); E

slope of Sokolica hill, fs no. 25a [49°35'08.2"N / 19°34'07.4"E], alt. 1280 m, 9.6.2009, leg.

P. Czarnota 6201 (GPN); S slope of Kepa hill, fs no. 26h [49°34'07.8"N / 19°33'02.5"E],

alt. 1365 m, 17.7.2009, leg. P. Czarnota 6214 (GPN); S of Sokolica hill, fs no. 25c

[49°35'01"N / 19°33'47.6"E], alt. 1285 m, 1.7.2009, leg. P. Czarnota 6104 (GPN).

ECOLOGY & DISTRIBUTION: Fuscidia pusilla has rarely been reported (normally as an

epiphyte of deciduous trees) from the Polish and Ukrainian Carpathians (Bielczyk 2003;

Koscielniak & Kiszka 2003; Kondratyuk & Coppins 2000), but in the Babia Géra Massif

it is found as a common lichenized fungus on wood of dead decorticated spruces, snags

and wind-throws.

The species has not been reported from the British Isles (Gilbert et al. 2009), whereas

another divaricatic acid-producing sorediate Fuscidia, F. lightfootii (Sm.) Coppins & P.

James, is well known there. An assumption that both species may represent the same

taxon and that F. pusilla is only a morph of F. lightfootii (Gilbert et al. 2009) has no

molecular support. A mtSSU rDNA phylogeny of Fuscideaceae shows that the two

species are not closely related (Bylin et al. 2007).

Helocarpon crassipes Th. Fr.

= Micarea crassipes (‘Th. Fr.) Coppins

Although molecular evidence suggests that H. crassipes is better treated

in the separate genus Helocarpon Th. Fr. (Andersen & Ekman 2005), it is still

sometimes placed in Micarea Fr. (Coppins 2009). Indeed, the ‘micareoid’

photobiont, sparingly branched and anastomosed paraphyses, ascus structure,

and mixture of Cinereorufa-green, Melaena-red, and Melaenida-red apothecial

pigments (Meyer & Printzen 2000) are phenotypic features found in some

representatives of Micarea s. lat. (Coppins 1983). Micarea assimilata (Nyl.)

Coppins in particular resembles H. crassipes in apothecial pigmentation,

lack of secondary substances, and ecology. Both species are terricolous and

have an arctic-alpine distribution (Coppins 1983), but they differ at least in

the thallus and apothecial structure. Micarea assimilata forms thick, slightly

convex areoles intermixed with cephalodia of its additional photobiont, Nostoc,

while the H. crassipes thallus is composed of small, + globose, often coralloid

areoles, with only a chlorococcoid photobiont. Young H. crassipes apothecia

are marginate and constricted below hypothecium forming the distinct stalked

base in contrast to the M. assimilata apothecia, which are never marginate

and shortly stalked. Sterile forms of H. crassipes markedly resemble thalli of

M. leprosula and M. submilliaria (Nyl.) Coppins and can grow together in alpine

regions. However, both these species produce easily detected metabolites,

namely gyrophoric acid and argopsin in M. leprosula (C+ red, Pd+ ginger)

and alectorialic acid in M. submilliaria (Pd+ yellow), and their thallus areoles

are very fragile. Furthermore, both species differ from H. crassipes in their

apothecial characters and spore septation (for more details see Czarnota 2007).

Although Micarea appears not to be monophyletic (Andersen & Ekman 2005)

98 ... Czarnota & Wegrzyn

and phenetically not congeneric with Helocarpon, H. crassipes may represent

Micarea in its classical sense by Coppins (1983), as many other representatives

are morphologically distantly related to the ‘core’ Micarea prasina group.

However, in the mtSSU sequence-based phylogenetic tree of Lecanorales,

H. crassipes nests outside the former Micareaceae. We therefore prefer to retain

the species in the separate genus Helocarpon.

SPECIMEN EXAMINED: POLAND. MAEOPOLSKA PROVINCE, Gowniak hill, by tourist

track [49°34'34"N / 19°32'39"E], alt. 1608 m, on soil and decaying bryophytes,

11.11.2005, leg. P. Czarnota 4600 (GPN).

ECOLOGY & DISTRIBUTION: ‘This terricolous species occurs frequently in the alpine

zone of the Tatra Mts (Bielczyk 2003; Czarnota unpubl.). Its presence in the Babia Gora

Massif was noted by Czarnota (2007), but without locality details. Formerly Helocarpon

crassipes was often recognized as Lecidea assimilata, under which name it is filed in some

Polish herbaria (see Czarnota 2007).

Lecanora chlarotera Nyl.

SPECIMENS EXAMINED (selected; each on a different deciduous tree): POLAND.

MALOPOLSKA PROVINCE, S slope of Diablak Mt., near the Pl-Sk boundary

[49°33'23.47"N / 19°31'47.59"E], alt. 1200 m, 14.5.2008, leg. M. Wegrzyn 3844 (KRA);

Zawoja Markowa, fs no. 72a [49°36'14.2"N / 19°31'13.0"E], alt. 740 m, 11.7.2010,

leg. M. Wegrzyn 4159 (KRA); N slope of massif, W of Sulowa Cyrhla glad, fs no. 71a

[49°35'49.4"N / 19°31'36.9"E], alt. 870 m, 5.8.2010, leg. M. Wegrzyn 4160 (KRA).

Lecanora expallens Ach.

SPECIMENS EXAMINED (selected): POLAND. MALopoLskKa PROVINCE, N slope of

Diablak Mt., fs no. 23a, close to Suchy Stawek [49°34'55"N / 19°31'10.7"E], alt. 1270 m,

7.8.2009, leg. P. Czarnota 6268 (GPN); N slope of Sokolica hill, fs no. 7a [49°35'25.6"N /

19°33'06.9"E], alt. 1055 m, 25.8.2009, leg. P. Czarnota 6328 (GPN); S slope of Kepa hill,

fs no. 26h [49°34'09.3"N / 19°33'09.2"E], alt. 1315 m, 17.7.2009, leg. P. Czarnota 6060

(GPN); ibid., [49°34'07.8"N / 19°33'12.8"E], alt. 1290 m, 17.7.2009, leg. P. Czarnota 6080

(GPN).

ECOLOGY & DISTRIBUTION: This usually sterile species is frequently reported from the

Polish Carpathians (Bielczyk 2003) primarily as an epiphyte on deciduous trees. In

Babia Gora Massif as in other higher ranges of the Western Carpathians, however, it

frequently grows also on hard wood of decorticated dead spruces within upper montane

forests (Czarnota unpubl.).

Lecanora saligna (Schrad.) Zahlbr. var. saligna

SPECIMENS EXAMINED (on decaying wood, bark of snags and roots of fallen spruces):

POLAND. Matopo ska PROVINCE, N of Markowe Szczawiny shelter house, fs no.

74b [49°35'48.7"N / 19°31'12.6"E], alt. 880 m, 2.7.2009, leg. P. Czarnota 6121 (GPN);

below Brona Pass, fs no. 24a, [49°35'44.0"N / 19°31'10.3”E], alt. 940 m, 2.7.2009, leg. P.

Czarnota 6131 (GPN); SE slope of Kepa hill near the Chodnik Parkowy trail, fs no. 27f

[49°34'04.2"N / 19°33'02.1"E], alt. 1350 m, 28.5.2009, leg. M. Wegrzyn 3235 (KRA).

Lecanora sarcopidoides (A. Massal.) Hedl. PLATE 1C

SPECIMEN EXAMINED: POLAND. MAEOPOLSKA PROVINCE, below Brona Pass, fs no.

24a [49°35'10.8”"N / 19°30'45.7”E], alt. 1240 m, 14.7.2009, leg. P. Czarnota 6194 (GPN).

Lichenized and lichenicolous fungi (Poland) ... 99

Lecanora subintricata (Ny1.) Th. Fr. PLATE 1D

This species usually develops an endoxylic thallus (Edwards et al. 2009), but

occasionally a form with a thick, warted, slightly yellowish thallus is encountered

as elsewhere in the Polish Carpathians (Czarnota 2010). It differs from other

morphologically similar Lecanora species (e.g. L. sarcopidoides, L. saligna,

endoxylic forms of L. conizaeoides Nyl. ex Cromb., L. albellula (Nyl.) Th. Fr.) in

its chemistry (presence of only usnic acid) and smaller ascospores. Apothecia of

L. subintricata are variously shaped and pigmented, and the presence of a more

or less developed amphithecium depends on their ontogeny and ecological

conditions. They are mostly concave, olive-grey and slightly yellowish-green

at least in the margin, but sometimes apothecia of L. subintricata in similar

circumstances are olive-brown to brown and often convex and immarginate,

resembling those found in L. saligna var. saligna or some forms of L. phaeostigma

(Korb.) Almb. Some apothecia can also be slightly pruinose, as in L. sarcopidoides,

which, however, has larger ascospores and pseudoplacodiolic acid as the major

substance. Lecanora conizaeoides is easily distinguished by P+ ginger reaction

(fumarprotocetraric acid) in its apothecial margin. The presence of brialmontin

1 as an additional minor secondary compound (Edwards et al. 2009) was not

detected in the tested Polish L. subintricata specimens.

SPECIMENS EXAMINED (selected): POLAND. MALOpPOLsKA PROVINCE, N slope of

Sokolica, fs no. 18c [49°35'15.3"N / 19°33'49.7"E], alt. 120 m, 26.8.2009, leg. P. Czarnota

6335 (GPN); below Brona Pass, fs no. 24a, [49°35'06.6"N / 19°30'43.4”E], alt. 1260 m,

21.8.2009, leg. P. Czarnota 6284 (GPN); SE slope of Kepa hill, fs no. 25c [49°34'21.7"N /

19°33'51.9"E], alt. 1210 m, 17.7.2009, leg. P. Czarnota 6081 (GPN); S slope of Kepa hill,

fs no. 26h [49°34'07.7"N / 19°33'01.9"E], alt. 1365 m, 17.7.2009, leg. P. Czarnota 6067

(GPN).

ECOLOGY & DISTRIBUTION: First modern records of L. subintricata for Poland were

recently confirmed in the Gorce Mts (Czarnota 2010). Both there and in the Babia Gora

Massif, L. subintricata is very common, mostly occupying decayed decorticated spruce

wood, especially frequent in the upper spruce forests much destroyed by the activity

of the bark beetle Ips typographus. In the Polish Western Carpathians, L. subintricata

prefers hard wood exposed to the light and with L. expallens, L. phaeostigma, non-

lichenized Mycocalicium subtile (Pers.) Szatala, and Strangospora moriformis appears to

be one of the first common colonizers of this substrate.

Lecidea leprarioides Tonsberg PLATE 1G

This species, which recently was reported from Gorce Mts as new for Poland

(Czarnota 2010), was collected previously in other Carpathian regions as Lecidea

turgidula Fr. or L. turgidula var. pulveracea ‘th. Fr. (Czarnota unpubl.). Indeed,

L. leprarioides and L. turgidula often have almost identical apothecia, especially

when the thallus of L. leprarioides is less developed and the L. turgidula apothecia

are whitish to bluish pruinose. In such cases secondary compound analyses help

differentiate the usually inconspicuously endosubstratal L. turgidula (which

produces placodiolic acid) and distinctly sorediate L. leprarioides (which

100 ... Czarnota & Wegrzyn

contains pseudoplacodiolic acid, rarely present in other lichens; Tonsberg 1992).

Similar sorediate thalli, often found in similar habitats in the Carpathians, may

also form in L. nylanderi (Anzi) Th. Fr. and diminutive examples of Ochrolechia

microstictoides Rasanen. However, both species are usually sterile, in contrast to

the usually fertile L. leprarioides, which is easily distinguished by its immarginate,

convex, bluish-grey apothecia immersed within sorediate patches. All species

differ markedly in their chemistry: L. nylanderi contains divaricatic acid and

O. microstictoides variolaric and lichesterinic acids. Furthermore, their soredia are

thicker and more granular, and thus their thalli are less farinose than the thallus

of L. leprarioides. Another similar, usually sterile, sorediate epiphyte growing

on acidic bark, which also sometimes serves as substrate for L. leprarioides, is

Cliostomum leprosum (Rasanen) Holien & Tonsberg. ‘This species is, however,

rare (reported mainly from N Europe; Golubkov & Kukwa 2006) and its major

compounds are atranorin and caperatic acid (Tonsberg 1992). For an excellent

description of L. leprarioides and similarities to other morphologically related

taxa, see also Tonsberg (1992) and Aptroot et al. (2009).

SPECIMENS EXAMINED (selected): POLAND. MALopoLskKA PROVINCE, N slope of

Sokolica hill, fs no. 18c [49°35'13.7"N / 19°33'48.3"E], alt. 1200 m, 26.8.2009, leg. P.

Czarnota 6302 (GPN); N slope of Diablak Mt., fs no. 21b [49°35'04.6"N / 19°32'15.3"E],

alt. 1160 m, 3.7.2009, leg. P. Czarnota 6156 (GPN); below Brona Pass, fs no. 24a

[49°35'10.2"N / 19°30'50.4"E], alt. 1230 m, 14.7.2009, leg. P. Czarnota 6177 (GPN);

SE slope of Sokolica hill near the Chodnik Parkowy trail, fs no. 25c [49°34'44.0"N /

19°33'51.5"E], alt. 1380 m, 24.5.2009, leg. M. Wegrzyn 3823 (KRA); ibid., [49°34'51.7"N

/ 19°34'06.5"E], alt. 1300 m, 24.5.2009, leg. M. Wegrzyn 4152 (KRA).

ECOLOGY & DISTRIBUTION: Lecidea leprarioides is a common lichenized fungus usually

found on decayed wood of conifer snags, but sometimes it also grows directly on bark

of spruces, more particularly within destroyed parts of upper montane spruce forests,

similar to Lecanora subintricata.

Lepraria eburnea J.R. Laundon

SPECIMENS EXAMINED (selected): POLAND. MALOPOLsKA PROVINCE, N slope

of Sokolica hill, fs no. 18c [49°35'13.7"N / 19°33'48.5"E], alt. 1200 m, 26.8.2009, leg.

P. Czarnota 6349 (GPN)); ibid., fs no. 6d [49°35'34.6"N / 19°33'34.5"E], alt. 990 m,

25.8.2009, leg. P. Czarnota 6319 (GPN); E slope of Kepa hill, fs no. 25c [49°34'21.8"N /

19°33'52.0"E], alt. 1210 m, 17.7.2009, leg. P. Czarnota 6073 (GPN).

ECOLOGY & DISTRIBUTION: On tree bark, decaying wood, and sandstone rocks in the

lower and upper zones of Babia Gora Massif.

Lepraria jackii Tonsberg

This species is differentiated from other Lepraria species by an almost mealy

thallus that is shared only by L. toensbergiana, from which it differs only

chemically (Bayerova et al. 2005).

SPECIMENS EXAMINED (selected): POLAND. MALOPOLSKA PROVINCE, N slope of

Diablak Mt., fs no. 22a [49°34'51.3"N / 19°31'41.6"E], alt. 1220 m, 7.8.2009, leg. P.

Czarnota 6272 (GPN)); E slope of Sokolica hill, fs no. 25a [49°35'08.8"N / 19°34'05.9"E],

Lichenized and lichenicolous fungi (Poland) ... 101

alt. 1280 m, 9.6.2009, leg. P. Czarnota 6053 (GPN); ibid., fs no. 18c [49°35'7.4"N /

19°33'52.5"E], alt. 1350 m, 6.6.2009, leg. M. Wegrzyn 3261 (KRA); SE slope of Kepa

hill, fs no. 25c [49°34'20.9"N / 19°33'52.9"E], alt. 1200 m, 17.7.2009, leg. P. Czarnota

6064 (GPN); N slope of massif, below Dolny Plaj forest road, fs no. 57g [49°35'39.3"N /

19°32'51.6"E], alt. 900 m, 8.5.2010, leg. M. Wegrzyn 4146 (KRA).

ECOLOGY & DISTRIBUTION: This anamorphic lichenized fungus seems to be the most

common Lepraria in the Western Carpathians. In addition to the Babia Gora Massif,

many sites occur in the Gorce Mts (Czarnota & Kukwa 2001), Beskid Sadecki Mts

(Kukwa & Sliwa 2005), and Tatra Mts (Kukwa 2004) where it usually grows on conifer

bark, decaying stumps and snags, and roots of fallen trees.

Lepraria rigidula (B. de Lesd.) Tonsberg

SPECIMEN EXAMINED: POLAND. MAELOPOLSKA PROVINCE, N slope Diablak Mt.,

Sulowa Cyrhla glade [49°36'04.9"N / 19°32'14.4"E], alt. 840 m, on bark of Salix sp.,

3.5.2010, leg. M. Wegrzyn 4156 (KRA).

ECOLOGY & DISTRIBUTION: Although rather common in Poland (Kukwa 2006), L.

rigidula has been thus far recorded only from one locality in the Babia Gora Massif.

It may be more frequent here, especially on the bark of solitary or roadside deciduous

trees at foot of the massif or in old orchards, as data suggest from other West Carpathian

ranges (e.g. Kukwa & Sliwa 2005).

Leptogium intermedium (Arnold) Arnold PLATE 18, F

This cyanolichen from the study area has a small thallus composed of

numerous spreading squamules up to 3 mm in width, but most do not exceed

1.5 mm. Vertical sections of the thallus are distinctly heteromerous, consisting

of dense single-layered zones of large (5-10 tum) cells in the upper and lower

cortex surrounding loosely interwoven fungal hyphae in the medulla. Individual

lobe margins are sometimes deeply cut. Their upper surface is unwrinkled and

brownish-grey when dry. Concave apothecia are very numerous, <1.5 mm

diam.; thalline margin distinct, beige, paler than the brownish disc.

L. intermedium mostly resembles diminutive specimens of L. gelatinosum

(With.) J.R. Laundon, which, however, has larger lobes distinctly wrinkled at

the upper surface and more brownish apothecial discs (Jorgensen 1994).

The material presented above differs slightly from the species description

by Jorgensen (1994) and Gilbert & Jorgensen (2009) in the size of squamules

and apothecia, which are larger here. Furthermore, in the Polish specimen the

upper thallus surface is rather smooth, in contrast to the weakly wrinkled lobes

given as a diagnostic feature for L. intermedium.

SPECIMEN EXAMINED: POLAND. MAELOPOLSKA PROVINCE, N slope of massif, Czatoza

Forest, fs no. 16a [49°35'44.7"N / 19°28'57.2"E], alt. 900 m, on the base of a mossy

old beech within ancient Carpathian beech forest, 29.10.2008, leg. M. Wegrzyn 4151

(KRA).

ECOLOGY & DISTRIBUTION: This species is widespread in Europe (Jorgensen 1994;

Gilbert & Jorgensen 2009) but has been reported only twice in Poland from the Gorce

Mts in the Carpathians (Czarnota 1997) and the Gory Kaczawskie Mts in the Sudetes

102 ... Czarnota & Wegrzyn

(Kossowska 2008), where it was found on a clayey soil overlying calcareous sandstone

and on mossy rocks in deeply shaded places (Czarnota 1997; Kossowska 2008). In the

Babia Gora Massif, L. intermedium occurs on the base of a mossy old beech in the

best conserved fragment of an ancient Carpathian beech forest in this massif. Such a

substrate is rarely reported elsewhere.

Although L. intermedium was discovered in the Polish Carpathians no more than 20

years ago (Czarnota 1997), reports from the Gorce Mts should be regarded as historical.

The 1997 flood completely destroyed all known L. intermedium sites in localities

that region. Its new Babia Gora Massif locality may be the only site left in the Polish

Carpathians.

Micarea byssacea (Th. Fr.) Czarnota, Guz.-Krzemin. & Coppins

SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, N slope of Sokolica hill, fs

no. 18b [49°35'21.5"N / 19°33'39.1"E], alt. 1120 m, on decaying wood of decorticated

Picea abies within a montane spruce-fir forest, 10.6.2009, leg. P. Czarnota 6005 (GPN).

ECOLOGY & DISTRIBUTION: Recently segregated from the Micarea micrococca complex,

this species is characterized in detail by Czarnota & Guzow-Krzeminska (2010). It is

poorly known under the name M. byssacea, but is probably a more common epixylic

or epiphytic lichenized fungus in lowland forests; in the Western Carpathians it is

widespread, but uncommon (Czarnota unpubl.).

Micarea leprosula (Th. Fr.) Coppins & A. Fletcher

SPECIMEN EXAMINED: POLAND. MAEOPOLSKA PROVINCE, Gowniak hill, by tourist

track [49°34'34"N / 19°32'39"E], alt. 1608 m, on soil, decaying bryophytes, plant debris

and terricolous lichens in alpine zone, 11.11.2005, leg. P. Czarnota 4598 (GPN).

ECOLOGY & DISTRIBUTION: This terricolous alpine species was reported several times from

the Polish Western Beskidy Mts, but its large population is located in the neighbouring

Tatra Mts (Czarnota 2007). For taxonomic notes see also under Helocarpon crassipes.

Micarea lithinella (Nyl.) Hedl.

SPECIMENS EXAMINED (selected; all on sandstone shaded pebbles): POLAND.

MALOPOLSKA PROVINCE, SE slope of Kepa hill, fs no. 25¢ [49°34'29.6"N / 19°33'40.4"E],

alt. 1360 m, 26.8.2009, leg. P. Czarnota 6351 (GPN); SE slope of Sokolica, fs no. 25c

[49°34'51.7"N / 19°34'06.5"E], alt. 1300 m, 24.5.2009, leg. M. Wegrzyn 3170 (KRA); N

slope of Sokolica hill, fs no. 18¢ [49°35'16.0"N / 19°33'54.0"E], alt. 1200 m, 6.6.2009,

leg. M. Wegrzyn 4155 (KRA); N slope Diablak Mt., W of Sulowa Cyrhla, fs no. 70c

[49°35'56.7"N / 19°31'35.4"E], alt. 830 m, 5.8.2010, leg. M. Wegrzyn 4158 (KRA).

ECOLOGY & DISTRIBUTION: ‘This epilithic species is a common early colonizer of

sandstone pebbles over root systems of wind-throws within montane forests, as indicated

recent studies in other ranges of the Western Carpathians (Czarnota unpubl.).

Micarea nowakii Czarnota & Coppins

SPECIMENS EXAMINED: POLAND. MALOPOLSKA PROVINCE, below Brona Pass, fs no.

24a [49°35'09.6"N / 19°30'49.1"E], alt. 1235 m, 14.7.2009, leg. P. Czarnota 6212 (GPN);

N slope of Sokolica, fs no. 18¢ [49°35'15.0"N / 19°33'49.7"E], alt. 1200 m, 26.8.2009,

leg. P. Czarnota 6307 (GPN); E slope of Sokolica hill, fs no. 25a [49°35'08.8"N /

19°34'05.9"E], alt. 1280 m, 9.6.2009, leg. P. Czarnota 6023 (GPN); S slope of Kepa hill,

fs no. 26h [49°34'09.3"N / 19°33'03.2"E], alt. 1365 m, 17.7.2009, leg. P. Czarnota 6086

(GPN).

Lichenized and lichenicolous fungi (Poland) ... 103

ECOLOGY & DISTRIBUTION: This recently described species (Czarnota 2007), a member

of the Micarea prasina group (Czarnota & Guzow-Krzeminska 2010), appears to be an

early colonizer of decorticated logs of spruce wind-throws in the upper montane zone of

Babia Gora Massif. It prefers well-lit places, especially forest areas destroyed by the bark

beetle Ips typographus. The present data extend the range of M. nowakii to other parts

of Western Carpathians, being additional to its first discoveries in the Gorce Mts and

Beskid Maly Mts (Czarnota 2007).

A realistic world distribution of M. nowakii is as yet unknown due to its phenetic

similarity to M. denigrata, M. misella, and dark coloured morphotypes of M. prasina.

It differs from M. denigrata by its usually simple and shorter ascospores and lack of

gyrophoric acid, from M. misella by its wider conidia (similar to M. denigrata) and the

presence of micareic acid, and from M. prasina by its usually numerous black, barrel-like

and aggregated pycnidia, and lack of thallus composed of goniocysts. M. nowakii is also

reported from Sweden (Svensson & Westberg 2010).

Peltigera leucophlebia (Nyl.) Gyeln.

SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, N slope of Diablak hill, fs

no. 22m [49°34'23.2"N / 19°31'32.0"E], alt. 1620 m, on plant debris in Salix silesiaca

community, 7.8.2009, leg. M. Wegrzyn 3198 (KRA).

ECOLOGY & DISTRIBUTION: This arctic-boreal-alpine species is widespread in the

northern hemisphere but is very rare in the Western Carpathians, except in the

subalpine and alpine zones of the Tatra Mts (Lisické 2005). From other Polish parts

of the Western Carpathians, it has only been reported on three occasions growing in

lower forested mountain zones (Bielczyk 2003). In the Babia Gora Massif, P. leucophlebia

occurs above timberline, where terricolous and mossy habitats are much more suitable

for the species.

Physcia caesia (Hoffm.) Hampe ex Fiirnr.

SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, NW slope of Mala Babia

Gora hill, Czarna Cyrhel glade [49°35'50.0"N / 19°29'8.8"E], alt. 880 m, on concrete,

23.6.2009, leg. M. Wegrzyn 4253 (KRA).

Physcia tenella (Scop.) DC.

SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, N slope of Diablak Mt.,

Sulowa Cyrhla glade [49°36'04.9"N / 19°32'14.4"E], alt. 840 m, on bark of Salix sp.,

3.5.2010, leg. M. Wegrzyn 4162 (KRA).

Physconia grisea (Lam.) Poelt

SPECIMEN EXAMINED: POLAND. MAEOPOLSKA PROVINCE, N foot of Diablak

Mt., Zawoja Markowa, fs no. 72d [49°36'29.8"N / 19°31'03.5"E], alt. 740 m, on bark of

roadside Fraxinus excelsior, 14.5.2010, leg. M. Wegrzyn 4219 (KRA).

Placynthiella oligotropha (J.R. Laundon) Coppins & P. James

SPECIMENS EXAMINED: POLAND. MAELOPOLSKA PROVINCE, below Brona Pass,

fs no. 24a [49°35'10.8"N / 19°30'50.5”E], alt. 1230 m, 14.7.2009, leg. P. Czarnota 6173

(GPN); ibid., [49°35'10.1"N / 19°30'47.1”E], alt. 1240 m, 14.7.2009, leg. P. Czarnota

6202 (GPN); N foot of Diablak Mt., Zawoja Markowa, fs no. 77a [49°36'13.8"N /

19°30'22.5"E], alt. 815 m, 6.8.2010, leg. M. Wegrzyn 4217 (KRA).

ECOLOGY & DISTRIBUTION: In the Babia Gora Massif this terricolous species prefers

well-lit soil over root systems of wind-throws, similar to those in other ranges of Western

104 ... Czarnota & Wegrzyn

Carpathians (Czarnota unpubl.). In these habitats it is a frequent member of a pioneer

lichen biota.

Porina chlorotica (Ach.) Mill. Arg.

SPECIMEN EXAMINED: POLAND. MALOPOLSKA PROVINCE, N of Markowe Szczawiny

shelter house, fs no. 73b [49°35'49.3"N / 19°31'13.1”E], alt. 880 m, on sandstone pebble

under root system of fallen Picea abies within Carpathian beech forest, 2.7.2009, leg. P.

Czarnota 6125 (GPN).

Porpidia soredizodes (Lamy) J.R. Laundon

SPECIMENS EXAMINED: POLAND. MAELOPOLSKA PROVINCE, N slope of Diablak Mt.,

fs no. 22a [49°34'54"N / 19°31'39.9"E], alt. 1220 m, 7.8.2009, leg. P. Czarnota 6250

(GPN); ibid., [49°34'36.6"N / 19°31'23.00"E], alt. 1370 m, 21.6.2009, leg. M. Wegrzyn

3323 (KRA); ibid., fs no. 10g [49°34'56.7"'N / 19°31'54.8"E], alt. 1170 m, 3.7.2009, leg. P.

Czarnota 6145 (GPN).

ECOLOGY & DISTRIBUTION: This saxicolous species is frequent in the Polish Western

Carpathians on various acidic rocks (Jablofska 2010). However, since it resembles

Porpidia tuberculosa (Sm.) Hertel & Knoph, also abundant there, correct determination

of both species requires analyses of their secondary compounds. In the Babia Gora

Massif, P. soredizodes has been found on sandstone rocks in forested zones.

Psilolechia clavulifera (Nyl.) Coppins

SPECIMENS EXAMINED (selected): POLAND. MALopoLskKA PROVINCE, N slope of

Diablak Mt., fs no. 22a [49°34'46.4"N / 19°31'34.3”E], alt. 1300 m, 7.8.2009, leg. P.

Czarnota 6275 (GPN); N slope of Sokolica hill, fs no. 7a [49°35'27.1"N / 19°33'28.5"E],

alt. 1090 m, 21.7.2009, leg. P. Czarnota 6248 (GPN)); E slope of Sokolica hill, fs no. 25a

[49°35'09.5"N / 19°34'05.8"E], alt. 1280 m, 9.6.2009, leg. P. Czarnota 6029 (GPN); SE

of Sokolica hill, fs no. 25c [49°34'21.4"N / 19°33'52.4"E], alt. 1210 m, 17.7.2009, leg. P.

Czarnota 6216 (GPN)); ibid., [49°34'51.7"N / 19°34'06.5"E], alt. 1300 m, 24.5.2009, leg.

M. Wegrzyn 3183 (KRA).

ECOLOGY & DISTRIBUTION: Recently Czarnota & Kukwa (2008b) presented a modern

distribution of P. clavulifera in Poland that shows the best habitats as being roots, soil,

and acidic rocks under root systems of wind-throws. The same is also observed in the

Babia Gora Massif, confirming the species as an early colonizer of such habitats.

Pycnora praestabilis (Nyl.) Hafellner

In Central Europe, P. praestabilis is reported as a separate species resembling

the Scandinavian P. xanthococca; however the phenetic characters are not so

distinct. In the Western Carpathians, P. praestabilis very frequently grows

in association with P. sorophora, which is sorediate and usually sterile but

chemically similar. Some morphs of both species seem to be transient and the

small conidial size differences regarded as diagnostic (Timdal 1984) are not

necessarily convincing in identification. Moreover, pycnidia are not always

present in P sorophora; thus, separation of the species will probably rely on

future molecular evidence. Here, P praestabilis is recognized only as a fertile,

non-sorediate Pycnora morphotype.

Lichenized and lichenicolous fungi (Poland) ... 105

SPECIMENS EXAMINED (selected): POLAND. MALOpPOLsKA PROVINCE, N slope of

Diablak Mt., fs no. 22a [49°34'44.5"N / 19°31'32.2"E], alt. 1335 m, 7.8.2009, leg. P.

Czarnota 6256 (GPN); below Brona Pass, fs no. 24a [49°35'10.1"N / 19°30'47.2"E],

alt. 1240 m, 14.7.2009, leg. P. Czarnota 6178 (GPN); S of Sokolica hill, fs no. 25c

[49°34'58.2"N / 19°33'48.6”E], alt. 1285 m, 1.7.2009, leg. P. Czarnota 6110 (GPN); SE

slope of Géwniak hill, fs no. 27f [49°34'4.2"N / 19°33'02.1"E], alt. 1350 m, 28.5.2009,

leg. M. Wegrzyn 3362 (KRA).

ECOLOGY & DISTRIBUTION: In the Babia Géra Massif, P. praestabilis frequently occurs

on wood of decorticated Picea abies trunks, but mostly within well-lit upper montane

spruce forest destroyed by the activity of the bark beetle Ips typographus.

Pycnora sorophora (Vain.) Hafellner

SPECIMENS EXAMINED (selected): POLAND. MALopo ska PROVINCE, N slope of

Diablak Mt., fs no. 23a [49°34'44.6"N / 19°31'17.6"E], alt. 1330 m, 7.8.2009, leg. P.

Czarnota 6269 (GPN); N slope of Sokolica hill, fs no. 7a [49°35'22.6"N / 19°33'07.5"E],

alt. 1080 m, 25.8.2009, leg. P. Czarnota 6331 (GPN); below Brona Pass, fs no. 24a

[49°35'10.1"N / 19°30'47.2"E], alt. 1240 m, 14.7.2009, leg. P. Czarnota 6179 (GPN); S

of Sokolica hill, fs no. 25c [49°34'58.2"N / 19°33'48.6"E], alt. 1285 m, 1.7.2009, leg. P.

Czarnota 6111 (GPN); SE slope of Kepa hill, fs no. 25g [49°34'32.9"N / 19°33'30.1"E],

alt. 1440 m, 18.9.2010, leg. M. Wegrzyn 4212 (KRA).

ECOLOGY & DISTRIBUTION: In the Babia Gora Massif, P. sorophora is more frequent than

P. praestabilis, occupying similar woody habitats, as well as the bark of Norway spruces,

but is not strictly confined to upper montane stands (see above).

Strangospora moriformis (Ach.) Stein

SPECIMENS EXAMINED (selected): POLAND. MALOPOLSKA PROVINCE, E slope of

Sokolica hill, fs no. 25a [49°35'02.8"N / 19°34'05.6”E], alt. 1220 m, 1.7.2009, leg. P.

Czarnota 6112 (GPN)); ibid., [49°35'09.6"N / 19°34'08.6"E], alt. 1265 m, 9.6.2009, leg.

P. Czarnota 5989 (GPN); below Brona Pass, fs no. 24a [49°35'10.5"N / 19°30'47.4"E],

alt. 1240 m, 14.7.2009, leg. P. Czarnota 6191 (GPN); N slope of Diablak Mt., fs no. 22a

[49°34'48.2"N / 19°31'34.1”E], alt. 1270 m, 7.8.2009, leg. P. Czarnota 6260 (GPN); E of

Markowe Szczawiny shelter house, fs no. 10d [49°35'26.0"N / 19°29'44.5"E], alt. 1105 m,

4.9.2010, leg. M. Wegrzyn 4154 (KRA).

ECOLOGY & DISTRIBUTION: Strangospora moriformis was formerly rarely reported from

Western Carpathians, including the Tatra Mts (Bielczyk 2003, Lisicka 2005), but recent

investigations show that this species is common in dead (destroyed by the bark beetle)

parts of upper montane spruce forests throughout the Polish Western Beskidy Mts

(Czarnota unpubl.). It is an early colonizer of such natural woody substrates associated,

for example, with Mycocalicium subtile, Lecanora subintricata, and Lecidea turgidula. It

is interesting that this species has not been found in similar habitats in the Polish Tatra

Mts, despite recent intensive field explorations.

Trapelia corticola Coppins & P. James

SPECIMENS EXAMINED (selected): POLAND. MALOPOLSKA PROVINCE, N slope of

Sokolica hill, fs no. 18b [49°35'21.5"N / 19°33'39.1”E], alt. 1120 m, 10.6.2009, leg. P.

Czarnota 6006 (GPN); N of Markowe Szczawiny shelter house, fs no. 74b [49°35'48"N

/ 19°31'12.4"E], alt. 890 m, 2.7.2009, leg. P. Czarnota 6129 (GPN); SE slope of Sokolica

hill, fs no. 25c, [49°34'51.7"N / 19°34'06.5"E], alt. 1300 m, 24.5.2009, leg. M. Wegrzyn

3171 (KRA).

106 ... Czarnota & Wegrzyn

ECOLOGY & DISTRIBUTION: A modern distribution of this sterile, sorediate species in

Poland is presented by Czarnota & Kukwa (2009); based on this and recent field data,

T. corticola seems to be common throughout the Western Carpathians (Czarnota

unpubl.) but is usually found in ancient or natural forest communities with abundant

standing or fallen ‘dead wood.

Trapelia obtegens (Th. Fr.) Hertel

SPECIMENS EXAMINED: POLAND. MALOPOLSKA PROVINCE, S of Sokolica hill, fs no.

25c [49°35'01.9"N / 19°33'55.8"E], alt. 1260 m, 1.7.2009, leg. P. Czarnota 6089 (GPN);

ibid., [49°34'51.7"N / 19°34'06.5"E], alt. 1300 m, 24.5.2009, leg. M. Wegrzyn 3178

(KRA); SE slope of Kepa hill, fs no. 25c, [49°34'48.0"N / 19°34'06.8"E], alt. 1290 m,

16.9.2009, leg. P. Czarnota 6352 (GPN).

ECOLOGY & DISTRIBUTION: This epilithic early colonizer is usually found on acidic rocks

in well-lit places. In forested parts of the Western Carpathians, including the Babia Gora

Massif, T: obtegens is mostly confined to small sandstone pebbles lying on root systems

of wind-throws.

Trapeliopsis glaucolepidea (Nyl.) Gotth. Schneid. PLATE 1H

This species is recognized under two different morphotypes: (1) as T. glauco-

lepidea forming more or less distinct squamules with lip-shaped soralia and (2)

as T. percrenata (Nyl.) Gotth. Schneid. producing punctiform soralia at a very

early thallus developmental stage and thus never distinctly squamulose. Recent

ITS analyses (Palice & Printzen 2004) support previous assumptions that

both morphotypes could be conspecific (Palice 1999). In tropical populations

T. glaucolepidea was found to be usually squamulose and often fertile but in

Europe both phenetic forms are found and are almost exclusively sterile (Palice

& Printzen 2004). It is interesting that European squamulose forms occur in

regions with high precipitation (western Europe and mountains in the Central

Europe) growing on a strongly decayed wood or humus, while the “T: percrenata’

morphotypes occur on somewhat harder wood or are sometimes epiphytic and

much more widespread in European lowlands.

The small, almost only sorediate stage of the species mostly resembles

Trapelia corticola, another lichen found in similar habitats throughout Europe.

The two morphologically similar species are composed of separate, punctiform,

bright green to whitish-green soralia but differ in their chemistry. Trapelia

corticola produces gyrophoric acid, which can be detected in the simple spot

test reaction C+ red, while Trapeliopsis glaucolepidea soralia are C-. There are

also ‘soraliate’ epixylic Micarea prasina forms that may resemble the punctiform

T. glaucolepidea morphotypes (Czarnota unpubl.). In such cases, both species

can be also identified based on their chemistry, although the micareic acid

present in M. prasina is only detected by chromatography. The squamulose

forms of T: glaucolepidea are very similar to the young thalli of many Cladonia

taxa that often grow together in the same place. Here the presence of lip-shape

soralia diagnoses T: glaucolepidea.

Lichenized and lichenicolous fungi (Poland) ... 107

SPECIMENS EXAMINED: POLAND. MAELOPOLSKA PROVINCE, N slope of Diablak Mt.,

fs no. 23b [49°34'57.6"N / 19°31'13.2"E], alt. 1265 m, 7.8.2009, leg. P. Czarnota 6278

(GPN); E slope of Sokolica hill, fs no. 25a [49°35'07.9"N / 19°34'06.4”E], alt. 1290 m,

9.6.2009, leg. P. Czarnota 6012 (GPN).

ECOLOGY & DISTRIBUTION: On the Polish side of the Carpathians, T: glaucolepidea

has been reported only four times from the neighbouring Gorce Mts and Tatra Mts

(Czarnota & Kukwa 2004; Czarnota 2010), but it is a widespread species, known also

from the Slovak and Ukrainian Carpathians (Palice & Printzen 2004; Palice et al. 2006;

Vondrak et al. 2010). In the Babia Gora Massif, it is found on humus and strongly

decayed wood over root systems of up-ended spruces in natural upper montane spruce

stands. Only the squamulose morphotype has been observed there and in the Tatra Mts,

whereas the ‘T. percrenata’ form dominates in the Gorce Mts. In the first two ranges

T. glaucolepidea has been recorded above 1200 m a.s.l., while in Gorce Mts its localities

do not exceed 1020 m.

Trapeliopsis pseudogranulosa Coppins & P. James

SPECIMENS EXAMINED (selected): POLAND. MALOpPOLSKA PROVINCE, N slope of

Sokolica hill, fs no. 6d [49°35'27.7"N / 19°33'42.5"E], alt. 1060 m, 25.8.2009, leg. P.

Czarnota 6294 (GPN); ibid., fs no. 7a [49°35'24.3"N / 19°33'12.7"E], alt. 1060 m,

21.7.2009, leg. P. Czarnota 6228 (GPN); N of Markowe Szczawiny shelter house, fs no.

73b [49°35'49.3"N / 19°31'13.1"E], alt. 880 m, 2.7.2009, leg. P. Czarnota 6127 (GPN).

ECOLOGY & DISTRIBUTION: A common species throughout the Carpathians, being

mostly found in the Babia Gora Massif on decaying wood of wind-throws in shady and

moist forests.

Acknowledgements

We would like to thank Jézef Omylak (Director of the Babia Gora National Park)

for permission to research lichen biota in the National Park area and Tomasz Lamorski

for help in conducting fieldwork and invaluable advice. We are also grateful to Dr

Piotr Osyczka (Krakéw) for his assistance in determining some Cladonia and Lepraria

species by TLC, to Natalia Gucwa for tireless assistance in the field and the herbarium,

and to Prof. Mark Seaward (Bradford, UK) for linguistic corrections and valuable

improvements. We are greatly indebted also to Dr Anna Guttova (Slovakia, Bratislava)

and Dr Vagn Alstrup (Denmark, Copenhagen) for valuable criticism of the manuscript.

This research was supported by the Polish Ministry of Science and Higher Education,

grants No. N N305 306835 (P. Czarnota) and N N305 2779 33 (M. Wegrzyn).

Literature cited

Ahti T. 2000. Cladoniaceae. Flora Neotropica Monograph 78: 1-362.

Andersen HL, Ekman S. 2005. Disintegration of the Micareaceae (lichenized Ascomycota): a

molecular phylogeny based on mitochondrial rDNA sequences. Mycological Research 109(1):

21-30. http://dx.doi.org/10.1017/S0953756204001625

Aptroot A, Gilbert OL, Hawksworth DL, Coppins BJ. 2009. Lecidea Ach. (1803). 502-519, in: CW

Smith et al. (eds), The Lichens of Great Britain and Ireland. British Lichen Society, London..

Bayerova $, Kukwa M, Fehrer J. 2005. A new species of Lepraria (lichenized ascomycetes) from

Europe. Bryologist 108: 131-138.

http://dx.doi.org/10.1639/0007-2745(2005)108[131:ANSOLL]2.0.CO;2

Bielczyk U. 2003. The lichens and allied fungi of the Polish Western Carpathians. 23-232, in: U

Bielczyk (ed.), The lichens and allied fungi of the Polish Carpathians — an annotated checklist,

108 ... Czarnota & Wegrzyn

Biodiversity of the Polish Carpathians. W. Szafer Institute of Botany, Polish Academy of

Sciences, Krakow.

Bielczyk U. 2004. Rdoznorodnosé gatunkowa porost6w Babiogérskiego Parku Narodowego.

285-314, in: BW Woloszyn et al. (eds), Babiogorski Park Narodowy. Monografia przyrodnicza,

Wydawnictwo i Drukarnia Towarzystwa Slowakow w Polsce, Krakéw.

Boberski W. 1886. Systematische Ubersicht der Flechten Galiziens. Verh. Zool.-Bot. Ges. Wien 36:

243-286.

Bylin A, Arnerup J, Hogberg N, Thor G. 2007. A phylogenetic study of Fuscideaceae using mtSSU

rDNA. Bibliotheca Lichenologica 96: 49-60.

Coppins BJ. 1983. A taxonomic study of the lichen genus Micarea in Europe. Bull. Brit. Mus. Nat.

Hist. 11: 17-214.

Coppins BJ. 2009. Micarea Fr. (1825). 583-686, in: CW Smith et al. (eds), The Lichens of Great

Britain and Ireland. British Lichen Society, London..

Coppins BJ, Kondratyuk S, Khodosovtsev A, Zelenko S, Coppins A, Wolseley P, Virchenko V. 1998.

Diversity of lichens and bryophytes in Regional Landscape Park ‘Stuzhytsia (Ukrainian part

of the international biosphere reserve ‘Eastern Carpathians’). 139-161, in: S Kondratyuk, BJ

Coppins (eds), Lobarion lichens as indicators of the primeval forests of the Eastern Carpathians,

Darwin International Workshop, 25-30 May 1998, Kostrino. Phytosociocentre, Kiev.

Coppins BJ, Kondratyuk SYa, Khodosovtsev AYe, Zelenko SD, Wolseley PA. 2005. Contribution to

lichen flora of Ukrainian Carpathians. Chornomors’ki Bot. J. 1: 5-23.

Czarnota P. 1997. Micarea synotheoides, M. hedlundi (Micareaceae) and Leptogium intermedium

(Collemataceae), three lichens new to Poland. Fragm. Flor. Geobot. 42(2): 489-494.

Czarnota P. 2003. Notes on some new and noteworthy lichens from southern Poland. Graphis

Scripta 14: 18-26.

Czarnota P. 2007. The lichen genus Micarea (Lecanorales, Ascomycota) in Poland. Polish Bot. Stud.

232 T1199,

Czarnota P. 2010. Krytyczna lista porostéw i grzybéw naporostowych Gorcow. Ochrona Beskidéw

Zachodnich 3: 55-78.

Czarnota P, Guzow-Krzeminska B. 2010. A phylogenetic study of the Micarea prasina-group

shows that Micarea micrococca includes three distinct lineages. Lichenologist 42: 7-20.

http://dx.doi.org/10.1017/S0024282909990211

Czarnota P, Kukwa M. 2001. Lichens of the genera Lepraria and Leproloma from the Gorce Mts

(Western Carpathians, Poland) and note on lichenicolous fungus Paranectria oropensis found

on Leproloma membranaceum. Polish Bot. J. 46: 199-206.

Czarnota P, Kukwa M. 2004. Some sorediate lichens and lichenicolous fungi new to Poland. Graphis

Scripta 15: 24-32.

Czarnota P, Kukwa M. 2008a. Contribution to the knowledge of some poorly known lichens in

Poland. I. The genus Absconditella. Folia Cryptog. Estonica 44: 1-7.

Czarnota P, Kukwa M. 2008b. Contribution to the knowledge of some poorly known lichens in

Poland. II. The genus Psilolechia. Folia Cryptog. Estonica 44: 9-15.

Czarnota P, Kukwa M. 2009. Contribution to the knowledge of some poorly known lichens in

Poland. III. Trapelia corticola and the genus Vezdaea. Folia Cryptog. Estonica 46: 25-31.

Edwards B, Aptroot A, Hawksworth DL, James PW. 2009. Lecanora Ach. in Luyken (1809).

465-502, in: CW Smith et al. (eds), The Lichens of Great Britain and Ireland. British Lichen

Society, London.

Faltynowicz W. 2003. The lichens, lichenicolous and allied fungi of Poland. An annotated checklist.

Biodiversity of Poland 6. W. Szafer Institute of Botany, Polish Academy of Sciences, Krakow.

435 p.

Fletcher A, Coppins BJ. 2009. Catillaria A. Massal. (1852). 282-288, in: CW Smith et al. (eds), The

Lichens of Great Britain and Ireland. British Lichen Society, London.

Giavarini V, Coppins BJ. 2009. Chaenothecopsis Vain. (1927). 303-307, in: CW Smith et al. (eds),

The Lichens of Great Britain and Ireland. British Lichen Society, London.

Lichenized and lichenicolous fungi (Poland) ... 109

Gilbert OL, Jorgensen PM. 2009. Leptogium (Ach.) Gray (1821).541-551, in: CW Smith et al. (eds),

The Lichens of Great Britain and Ireland. British Lichen Society, London.

Gilbert OL, Purvis OW, Skjoldahl LH, Tonsberg T. 2009. Fuscidea V. Wirth & Vézda (1972).

407-411, in: CW Smith et al. (eds), The Lichens of Great Britain and Ireland. British Lichen

Society, London.

Golubkov VV, Kukwa M. 2006. A contribution to the lichen biota of Belarus. Acta Mycol. 41:

155-164.

Guttova A. 2001 Zaujimavejsie floristické nalezy. Bull. Slov. Bot. Spoloén. 23: 1-208.

Jabtonska A. 2010. The lichen genus Porpidia in Poland III. Herzogia 23: 217-228.

James PW. 2009. Cladonia P. Browne (1756). 309-338, in: CW Smith et al. (eds), The Lichens of

Great Britain and Ireland. British Lichen Society, London.

Jorgensen PM. 1994. Further notes on European taxa of the lichen genus Leptogium, with emphasis

on the small species. Lichenologist 26: 1-29.

Kiszka J. 1967. Porosty Beskidu Slaskiego. Rocznik Naukowo-Dydaktyczny WSP w Krakowie,

Prace z botaniki 28: 5-91.

Kiszka J, KoScielniak R. 1998. The flora of lichens in the Polish Eastern Carpathians. 82-101,

in: S Kondratyuk, BJ Coppins (eds), Lobarion lichens as indicators of the primeval forests

of the Eastern Carpathians, Darwin International Workshop, 25-30 May 1998, Kostrino.

Phytosociocentre, Kiev.

Kondratyuk SYa, Coppins BJ. 2000. Basement for the lichen monitoring in Uzhansky National

Nature Park, Ukrainian Part of the Biosphere Reserve “Eastern Carpathians. Roczniki

Bieszczadzkie 8: 149-192.

Koscielniak R, Kiszka J. 2003. The lichens and allied fungi of the Polish Eastern Carpathians.

233-294, in: U Bielczyk (ed.), The lichens and allied fungi of the Polish Carpathians - an

annotated checklist, Biodiversity of the Polish Carpathians. W. Szafer Institute of Botany, Polish

Academy of Sciences, Krakow.

Kossowska M. 2008. Lichens growing on calcareous rocks in the Polish part of the Sudety

Mountains. Acta Bot. Siles. Monogr. 3: 1-110.

Kukwa M. 2004. Porosty z rodzaju Lepraria w Tatrzanskim Parku Narodowym. Parki nar. Rez.

Przyr, 2323~12,,

Kukwa M. 2006. The lichen genus Lepraria in Poland. Lichenologist 38: 293-305.

http://dx.doi.org/10.1017/S0024282906005962

Kukwa M, Sliwa L. 2005. The genus Lepraria (lichenized Ascomycota) in the Beskid Sadecki Mts

(West Carpathians, S Poland). Polish Bot. J. 50: 163-184.

Kukwa M, Szymezyk R. 2006. Stanowiska porostu Mycobilimbia epixanthoides (Ascomycota

lichenisati) na pétnocy Polski. Fragm. Flor. Geobot. Ser. Polonica 13: 429-432.

Kukwa M, Czarnota P, Perz P. 2010. New or interesting records of lichenicolous fungi from Poland

VIII. Herzogia 23: 111-119.

Lendemer J.C. 2011. A review of the morphologically similar species Fuscidea pusilla and

Ropalospora viridis in eastern North America. Opuscula Philolichenum 9: 11-20.

Lisicka E. 1980. Flechtenfamiie Umbilicariaceae Fée in der Tschechoslowakei. Biol. Prace Slov.

Akad. Vied 26: 1-151.

Lisicka E. 2005. The lichens of the Tatry Mountains. VEDA, Slovak Academy of Sciences, Bratislava.

439 p.

Malicek J, Palice Z, Kocourkova J, Miller A. 2010. Contribution to the lichen flora of the Beskydy

Protected Lanscape Area. Bryonora 46: 56-66.

Meyer B, Printzen C. 2000. Proposal for a standardized nomenclature and characterization of

insoluble lichen pigments. Lichenologist 32: 571-583.

http://dx.doi.org/10.1006/lich.2000.0294

Nowak J. 1998. Porosty Beskidéw Wyspowego i Zywieckiego, Pasma Jalowca i Masywu Babiej

Gory. Monogr. Bot. 83: 55-131.

Nowak J, Tobolewski Z. 1975. Porosty polskie. PWN, Warszawa-Krakow. 1177 p.

110 ... Czarnota & Wegrzyn

Orange A, James PW, White FJ. 2001. Microchemical Methods for the Identification of Lichens.

British Lichen Society, London. 101 p.

Osyczka P. 2011. The genus Cladonia, group Cocciferae, in Poland. Herzogia 24: 209-227.

Osyczka P, Wegrzyn M. 2005. Arktyczno-alpejski gatunek porostu Cladonia amaurocraea w Tatrach

[An arctic-alpine lichen species Cladonia amaurocraea in the Tatra Mts.]. Fragm. Flor. Geobot.

Ser. Polonica 12: 157-163.

Palice Z. 1999. New and noteworthy records of lichens in the Czech Republic. Preslia 71:

289-336.

Palice Z, Printzen C. 2004. Genetic variability in tropical and temperate populations of Trapeliopsis

glaucolepidea: Evidence against long-range dispersal in a lichen with disjunct distribution.

Mycotaxon 90: 43-54.

Palice Z, Guttova A, Halda JP. 2006. Lichens new for Slovakia collected in the National Park

Muranska planina (W Carpathians). 179-192, in: A Lackovicova et al. (eds.), Central European

lichens — diversity and threat. Mycotaxon Ltd., Ithaca.

Pisut I, Lackovi¢ova A, Guttova A, Palice Z. 2007. New lichen records from Bukovské vrchy Mts

(NE Slovakia). Acta Mycol. 42: 267-280.

Printzen C, Palice Z. 1999. The distribution, ecology and conservational status of the lichen genus

Biatora in central Europe. Lichenologist 31: 319-333.

Rehman A. 1879. Systematyczny przeglad porostéw znalezionych dotad w Galicji Zachodniej

opracowany na podstawie wiasnych i cudzych spostrzezen. Spraw. Komisji Fizjogr. PAU 13:

3-66.

Sérusiaux E, Brand AM, Motiejunaite J, Orange A, Coppins BJ. 2010. Lecidea dolliformis belongs

to Micarea, Catillaria alba to Biatora, and Biatora ligni-mollis occurs in Western Europe.

Bryologist 113: 333-344. http://dx.doi.org/10.1639/0007-2745-113.2.333

Stein B. 1872. Flechten der Babia Gora. Verhandl. des bot. Vereins f. Brand. 14: 94-97.

Stein B. 1873. Uber zwei in diesem Jahre von ihm botanische Excursionennach der Babia Gora.

Jahresber. Schles. Ges. Vaterl. Cult. 50: 119-123.

Suza J. 1951. Ligejniky Babia Gory a vrchovi8t v prilehlé Oravské panvi (slovenské Casti). Lichens

de Babia Gora et des tourbiéres du bassin voisin de Orava (Slovaquie). Sbornik Klubu

prirodovédeckého v Brné 29: 147-156.

Svensson M, Westberg M. 2010. Additions to the lichen flora of Fennoscandia. Graphis Scripta 22:

55-37?

Timdal E. 1984. The genus Hypocenomyce (Lecanorales, Lecideaceae), with special emphasis on the

Norwegian and Swedish species. Nordic J. Bot. 4: 83-10.

http://dx.doi.org/10.1111/j.1756-1051.1984.tb01979.x

Tobolewski Z. 1966. Rodzina Caliciaceae (Lichenes) w Polsce. Poznanskie Towarzystwo Przyjacidt

Nauk, Wydzial Matematyczno-Przyrodniczy. Prace Komisji Biologicznej 24 (5): 1-106.

Tonsberg T. 1992. The sorediate and isidiate, corticolous, crustose lichens in Norway. Sommerfeltia

14: 1-331.

Vondrak J, Palice Z, Khodosovtsev A, Postoyalkin S. 2010. Additions to the diversity of rare or

overlooked lichens and lichenicolous fungi in Ukrainian Carpathians. Chornomors’ki Bot. J.

6: 6-34.

Vézda A. 1993. Lichenes Rariores Exsiccati. Fasc. 6. Brno.

Wegrzyn M. 2002. Nowe stanowiska Fellhanera subtilis na potudniu Polski. Fragm. Flor. Geobot.

Ser. Polonica. 9: 388-389.

Wegrzyn M. 2004. Porosty epifityczne, epiksyliczne i epigeiczne pietra kosodrzewiny na Babiej

Gorze. Fragm. Flor. Geobot. Ser. Polonica 11: 355-363.

MY COTAXON

http://dx.doi.org/10.5248/122.111

Volume 122, pp. 111-122 October-December 2012

Resupinate polypores from mixed ombrophilous forests

in southern Brazil

Mauro C. WESTPHALEN* & ROSA MARA BORGES DA SILVEIRA

Universidade Federal do Rio Grande do Sul, Departamento de Botanica

Av. Bento Goncalves, 9500, 91501-970, Porto Alegre, RS, Brazil

* CORRESPONDENCE TO: maurowestphalen@yahoo.com.br

ABSTRACT — During a survey of polypore fungi in the municipality of Sao Francisco de Paula,

Rio Grande do Sul State, Brazil, 24 resupinate species were identified. Trechispora mollusca,

Antrodia variiformis, Diplomitoporus venezuelicus, and Flaviporus subundatus, rare species in

Brazil, are fully described, discussed and illustrated. Comments are also given on Fomitiporia

maxonii, recorded for the first time from Rio Grande do Sul State. An identification key and

a checklist of the species are presented.

Key worps — Polyporaceae, fungal diversity, neotropics

Introduction

Polypore fungi are characterized by a tubular hymenophore and being

predominantly xylophilous, but they can also grow on soil or plant litter and

therefore are extremely important in nutrient and energy cycling (Webster &

Weber 2007). Wood-decay fungi can be divided into two large groups —white

rot fungi that decompose cellulose, hemicellulose, and lignin and brown rot

fungi that decompose only cellulose and hemicellulose. Wood decay fungi may

cause damage when they attack wood, reducing its commercial value, and when

they parasitise species of economic interest, causing a slump in productivity

(Wright & Alberté 2006).

In polypores, both macro and microscopic characters are highly variable.

Macroscopically, basidiomes can be resupinate or pileate, but transitions

between these forms can also be observed (Ryvarden 1991). Although macro-

and microscopic characters are very important in the characterization of taxa,

polypores do not forma monophyletic group, and several cases of morphological

convergence exist (Hibbett & Binder 2002).

Since Rick’s pioneer study of macroscopic fungi, including polypores,

in the state of Rio Grande do Sul (Fidalgo 1962, Rick 1960), several other

112 ... Westphalen & Silveira

taxonomic studies have been undertaken in the State on that group (Silveira &

Guerrero 1991, Groposo & Loguercio-Leite 2002, Coelho et al. 2006, Reck &

Silveira 2008). Silveira et al. (2008) surveyed the pileate polypores from the Sao

Francisco de Paula National Forest. Our survey of resupinate polypore species

of Sao Francisco de Paula continues this study, while expanding knowledge of

fungi in the region.

Materials & methods

Most examined specimens were collected from April 2009 to October 2010 in the

mixed ombrophilous forest of the municipality of Sao Francisco de Paula, in northeastern

Rio Grande do Sul State, southern Brazil. Specimens previously collected in the region

were also included in this study. The mixed ombrophilous forest is characterized by

subtropical vegetation with the presence of the coniferous tree Araucaria angustifolia

(Bertol.) Kuntze. The municipality of Sao Francisco de Paula is located about 900m

above sea level and has an area of 3274 km”. The climate in the region is of the Cfb type,

according to Képpen Classification, with rainfall high in all months (average of 2252

mm) and average annual temperature of 14.5 °C (Mota 1951, Backes 1999).

The basidiomes collected were analyzed macroscopically and later dried at room

temperature. For microscopy analysis, freehand sections of the basidiomes were

mounted on microscope slides with 3% KOH solution and 1% phloxine solution.

Amyloid or dextrinoid reactions were observed in Melzer’s reagent. Drawings of the

microstructures were made with the aid ofa drawing tube. All specimens were deposited

at ICN herbarium (Universidade Federal do Rio Grande do Sul, Brazil).

Taxonomy

Key to species of resupinate polypores recorded in Sao Francisco de Paula

Lay TAs) Wal sey Stetiner i OFTEN ed oma Fe tens 2b tema Ae Miwa Ra tl ewn i tau et ook Ra aun esta ny 2.

LB Five all Syste rich Ce Tele et fae pce tt eat ge iota tle deg yee gt W ge tg Pee 7

2a. Generative hyphae with clamps $s... 2.0 fnew ch oc oe ch hw chs ae ely ew eg ae 3

2b-Genetative hyphaesimple septate mes samed aah Ailes Ailes det dhlcrrele fe ol het te 4

3a. Encrusted cystidia present in the hymenium ................ Trechispora regularis

DBDs Cy Stila ASEM Utes: xnsys hearts, Becwaces eawa-apl Hawn ce came Ae atau ee cheese Trechispora mollusca

4a. Basidiomes white to cream, very fragile, basidiospores cylindrical ... Ceriporia viridans

4b. Basidiomes isabelline to pinkish, tough, basidiospores globose to subglobose ....5

5a. Cystidia absent in the trama and hymenium, only with encrusted hyphal ends

PLESelit WAS CIssepiMMeN iss ds gow ss gnc era eens Bane Rigidoporus crocatus

Sb.-Gystidia present in the trama-or hymenium oi. oe. es ee on ee ae oe 6

6a. Pore surface pale orange-pink to vivid pink, becoming smoke gray to dark brown

after drying, cystidia usually present in the trama and hymenium, basidiospores

SUE SO DOS sey ak aha ach carn acl eh ted ach Sat ale fed de ca a Sed bd Rigidoporus vinctus

6b. Pore surface cream to isabelline, becoming only slightly darker after drying,

cystidia restricted to the trama, basidiospores globose ..... Rigidoporus undatus

Resupinate polypores in southern Brazil ... 113

7a. Generative hyphae with simple'septa: + s.a5...6..<55Gu chee seen thee ow 8

7b. -Genetative: hyphae swith Clans? teehee eae eh ob ga ew age cee Hanae Rd gel 12

8a. Basidiomes pinkish, not becoming black in KOH, basidiospores very small

CBSO DAG EI) oon PN es He ca sipt tere AUD oral Weve Set eva: Flaviporus subundatus

8b. Basidiomes in shades of brown, becoming black in KOH, basidiospores larger . . . .9

9a. Basidiospores non-dextrinoid, ellipsoid, rusty brown ...... Fulvifomes umbrinellus

9b. Basidiospores dextrinoid, globose, hyaline to pale yellow ...................2. 10

OARS et aerlaC KM ak ok Shik tothe Se edad dete pia Fomitiporia maxonii

LGD: Seles UCSC Sas f0 , Fne a hae Marsa Say RecA he 8 aM Rl oO ee eG A gt 11

lla. Pores 7-10/mm, basidiospores 3.5-5.0 um in diam., setae 11-27 um

LOTS say Sarg hite cetera tense oh oy eae mers rae meen Phellinus bambusarum

11b. Pores 2-5/mm, basidiospores 4.5-7 um in diam., setae 12-40 um

HOT res FS Bese. aster ee: Seats aah, te ayes ea a nace ge Fomitiporia sanctichampagnatii

12a. Basidiospores ornamented, 10-15 um long ........... Pachykytospora papyracea

12b. Basidiospores smooth, less than 10 um long ........... eee eee ee eee 13

13a. Basidiomes perennial, basidiospores dextrinoid, truncate and

fini Kempe hr tle eri ei Ra Rides Paki hs Perenniporia medulla-panis

13b. Basidiomes annual, basidiospores non-dextrinoid, different shaped and

gAEY CE es NecU Lats EO Ry oe ORs oy UM rc REN ct a ee i ct Uy Coe ey Sc 14

PAde GUSETADTCSELIE cual t cee dn uae da. ncoeae ond o ebans tela cth lanl ood ahd sk amas ett ahdss aes 15

LAs eV Stie Asa SCTE Mes alates Mpeeeastin Bernenres Batwabiy Aetaaely Belwet fe Micaela enna apnatd oth ENN waite 17

15a. Pore surface yellowish becoming red when bruised, cystidia finely encrusted

Peres, COT oe i ee. ee oe ee ee ee 2 Junghuhnia carneola

16a. Pore surface cinnamon to brick-red, basidiospores narrowly ellipsoid to

SUDO YMC EICAL Stes we Ne Mee al iia Smelly seve mPOMie oe nle Bek Junghuhnia meridionalis

16b. Pore surface cream to pale orange-pink, basidiospores broadly ellipsoid to

ras) (6 Mie Bch i cee TO ea OU Ce ce Wa ake ae i ete Junghuhnia nitida

17a. Pore surface lilac grey, vegetative hyphae dextrinoid, basidiomes

reddetiing the substrate. .c.. 2. bones Pete ee Tinctoporellus epimiltinus

17b. Pore surface white to beige, vegetative hyphae nondextrinoid,

basidiomes not reddening the. substrate. scum ays pica chet 5 ten di peben dh pcben hrs fed ght fad 18

18a. Vegetative hyphae weakly amyloid and dissolving in KOH Cinereomyces lindbladii

18b. Vegetative hyphae negative in Melzer’s reagent and not dissolving in KOH ..... 19

19a. Scattered hyphae with an apical cap of crystals, spores 0.5-1 um wide,

IPRA CMDR gs eR ot Bay Be Re ee BR te ep ght Moy oi J Meee Mon eee a at eo he Sidera lenis

19b. No hyphae with encrusted cap, spores wider, ellipsoid to cylindrical .......... 20

20a. Pores 6-9/mm, basidiospores 1-2 um wide ......... Diplomitoporus venezuelicus

20b. Pores 1-5/mm, basidiospores more than 2 um wide ................-22 000s 21

114... Westphalen & Silveira

21a. Causing a white rot, basidiospores ellipsoid, capitate cystidioles present

Erste VANE TOT FA ree Roe co eM thay thes SAV ut oatd 9 MoE Leite ste PoutNon cp tatties based 22

21b. Causing a brown rot, basidiospores cylindrical, capitate cystidioles absent ..... 23

22a. Pores mostly irregular, 1-3/mm, basidiospores 5-6.5 x 3-4 um

Ohi d PE EO one Pepe Lee LORE Tee hee Pen: Schizopora paradoxa

22b. Pores regular, 3-5/mm, basidiospores 3.5-5 x 2.5-3.5 um ... Schizopora flavipora

23a. Pores mostly round to angular, sometimes slightly split and elongated,

basidiospores 8-12 X 3.5-5 UM 1... eee eee eee cee eee ee Antrodia albida

23b. Pore surface mostly irpicoid to daedaleoid, pores strongly split,

basidiospores 6.5-10 x 2-4. uM .... eee eee eee eee Antrodia variiformis

Antrodia albida (Fr.) Donk, Persoonia 4(3): 339, 1966

SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sado Francisco de Paula,

FLONA, 18.V.2009, leg. M.C. Westphalen 183/09 (ICN 154265); 25.1X.2009, leg. M.C.

Westphalen 258/09 (ICN 154353); CPCN Prdé-Mata, 29.V.2009, leg. M.C. Westphalen

204/09 (ICN 154266), leg. M.C. Westphalen 213/09 (ICN 154267), leg. M.C. Westphalen

214/09 (ICN 154268).

Antrodia variiformis (Peck) Donk, Persoonia 4(3): 340, 1966 Fics 1-3, PLATE 1

BASIDIOMES annual, resupinate, adnate, effused, separable, <1.5 mm thick,

corky and brittle; margin sharp, cream colored, narrow, <1 mm wide; pore

surface at first beige, drying cork colored, pale cinnamon or light brown, pores

irregular, distinctly split and sinuous, irpicoid to daedaloid, 1-3 per mm; tubes

cream to pale brown, <1 mm deep; subiculum cream to beige, often forming

a darker cinnamon to brownish zone in the regions where in contact with the

substrate, <0.5 mm thick.

HYPHAL SYSTEM dimitic; generative hyphae with clamps, thin-walled,

hyaline, 2-4 um wide; skeletal hyphae dominant, thick-walled to almost solid,

hyaline to yellowish, straight, unbranched to dichotomously branched, 3-6 um

wide, IKI-; cystidia absent, scattered fusoid cystidioles present. Basidia clavate,

Fic. 1-3. Antrodia variiformis .

1. Basidiospores. 2. Generative hyphae. 3. Skeletal hyphae.

Resupinate polypores in southern Brazil... 115

‘

PLATE 1. Basidiome of Antrodia variiformis. Scale bar = 1 cm

4-sterigmate. Basidiospores cylindrical, hyaline, smooth, thin-walled, (6-)6.5-

10 x (2-)2.5-4 um.

SUBSTRATA: Fallen logs of an undetermined angiosperm.

DISTRIBUTION: Previously recorded from North America, Europe and

Africa. This is the first record of the species from South America.

SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, Hotel

Veraneio Hampel, 26.V.2008, leg. M.A. Reck s.n. (ICN 154706). CANADA. QUEBEC,

Gaspé county, Kelly's Camp, VHI.1936, leg. C.G. Riley s.n. (S F6828)

REMARKS: Antrodia variiformis is characterized by the irregular irpicoid to

daedaleoid hymenophore with large pores and the beige to cork-colored pore

surface. Antrodia albida is a similar species differentiated by the white to cream

basidiomes when fresh with more regular pores. The specimen of A. variiformis

collected in Rio Grande do Sul State has a fully resupinate basidiome, but the

species can be effused-reflexed or, more rarely, sessile (Gilbertson & Ryvarden

1986). The specimen examined from S herbarium is very similar to ours,

but it has lifted margins forming, in some regions, small brown pilei. The

spore size, mainly the length, of the Brazilian collection also differs from the

descriptions given by other authors. Gilbertson & Ryvarden (1986) described

the basidiospores of A. variiformis as 8-12 x 3-4.5 um, Ryvarden & Johansen

(1980) measured them 8-10(-11) x 2.5-4 um, while according to Niemela

116 ... Westphalen & Silveira

(1985) they are 8-9 x 2.8-3 um. In the S herbarium specimen the basidiospores

were also slightly shorter, 7-8.5 x 2.5-3.5 um. We believe that this variation

in the spore size is normal within the species, especially when comparing

collections from different regions of the world. As all the other characteristics

of the collected specimen are the same as those of A. variiformis, we identified

it as such.

Ceriporia viridans (Berk. & Broome) Donk, Meddn Bot. Mus. Herb. Rijhs Universit.

Utrecht. 9: 171, 1933

SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, CPCN

Pré-Mata, leg. M.C. Westphalen 345/11, 07.V.2011 (ICN 170625).

Cinereomyces lindbladii (Berk.) Jiilich, Biblioth. Mycol. 85: 400, 1982

SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, FLONA,

18.V.2009, leg. M.A. Reck 073/09 (ICN 154359); 22.V1.2009, leg. M.C. Westphalen

244/09 (ICN 154275); 25.1X.2009, leg. M.C. Westphalen 254/09 (ICN 154360), leg. M.C.

Westphalen 257/09 (ICN 154361).

Diplomitoporus venezuelicus Ryvarden & Iturr., Mycol. 95(6): 1069, 2003 Fics 4-7

BASIDIOMES annual, resupinate, adnate, forming more or less confluent

patches on the substrate, <1.5 mm thick, soft and somewhat watery when fresh

becoming rigid upon drying; marginal sterile zone white to cream, very narrow,

a &

oe kit

oO oe

(ome |

(MS

Q s

eee

: ————

a —

Fic. 4-7. Diplomitoporus venezuelicus.

4, Basidiospores. 5. Hyphal pegs. 6. Generative hyphae. 7. Skeletal hyphae.

Resupinate polypores in southern Brazil ... 117

<0.15 mm wide; pore surface white to cream drying beige to straw-colored,

pores regular, round to angular, 6—9 per mm, tubes concolorous with the pore

surface, <1.5 mm deep; subiculum white to cream, very thin, <0.35 mm thick.

HYPHAL SYSTEM dimitic; generative hyphae with clamps, hyaline and thin-

walled, 2—3 um in diam.; skeletal hyphae dominating, hyaline and thick-walled,

mostly unbranched, 2—4 um in diam.; hyphal pegs scattered in the hymenium,

difficult to observe. Basidia clavate, 4-sterigmate; basidiospores cylindrical,

hyaline, thin-walled, smooth, (3.5—)4—4.5 x1-1.5(-—2) um.

SUBSTRATA: Fallen logs of an undetermined angiosperm.

DISTRIBUTION: Known from Venezuela, Colombia and Brazil.

SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, CPCN

Pré-Mata, leg. M.C. Westphalen 347/11, 07.V.2011 (ICN 170624). COLOMBIA. Dpt.

MAGDALENHA, Sierra Nevada de Santa Marta, Reserva Forestal San Lorenzo, leg. L.

Ryvarden 16195, 17-19.V1.1978 (O 918147).

REMARKS: Diplomitoporus venezuelicus is characterized by the white to cream

resupinate basidiomes with small pores and the small cylindrical basidiospores.

The specimen examined has a few hyphal pegs, although these are sometimes

difficult to observe. ‘This is the first report of hyphal pegs for this species.

Flaviporus subundatus (Murrill) Ginns, Canad. J. Bot. 58(14): 1587, 1980 Fics 8-10

BASIDIOMES annual to perennial, resupinate, adnate, <3 mm thick, tough

when fresh, very hard and resinous when dried, usually cracking into pieces;

margin very narrow to absent; pore surface flesh-colored to pinkish, pores

regular, circular to angular, 8-10 per mm; tubes concolorous with the pore

surface, $2.5 mm thick; subiculum very thin to absent, ochraceous to brownish,

<0.5 mm thick.

HYPHAL SYSTEM dimitic, hyphae strongly agglutinated; generative hyphae

with simple septa, hyaline, thin to thick-walled, 2.5-5 um in diam.; skeletal

hyphae dominating, hyaline, thick-walled, unbranched, <5.5 um_ thick.

a ol an

el == NK

08 LP EF”

Fic. 8-10. Flaviporus subundatus.

8. Basidiospores. 9. Generative hyphae. 10. Skeletal hyphae

5 yum

118 ... Westphalen & Silveira

Cystidia present, embedded in the trama and very difficult to separate, usually

seen only as large club-like crystalline structures. Basidia clavate, 4-sterigmate;

basidiospores very small, subglobose to broadly ellipsoid, hyaline, thin-walled,

smooth, 2.5-3 x 2-2.5 um.

SuBSTRATA: Fallen logs of an undetermined angiosperm.

DISTRIBUTION: Pantropical.

SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, Hotel

Veraneio Hampel, leg. M.C. Westphalen 312/10, 27.I1I.2010 (ICN 154701). CUBA.

GUANTANAMO, Baracoa, El Yunque Mountain, leg. L.M. Underwood & ES. Earle 1168,

III/1903 (BPI US0243504, isotype of Poria subundata).

REMARKS: Flaviporus subundatus can be easily identified by the resinous-hard

resupinate basidiomes, pinkish color, very small pores and basidiospores,

generative hyphae with simple-septa, and incrusted cystidia embedded in

the trama. Ryvarden (2007) recently transferred this species from Flaviporus

Murrill to Junghuhnia Corda. However, both genera (sensu typorum) are

characterized by the presence of clamp-connections in the generative hyphae.

The basidiome color and absence of clamp-connections in F subundatus are

features that come close to those of Rigidoporus, but the latter usually has a

monomitic hyphal system and larger basidiospores. We consider that neither

Flaviporus nor Junghuhnia are appropriate to accommodate this species and

that further study involving molecular data is necessary to resolve its generic

placement.

Fomitiporia maxonii Murrill, N. Amer. Fl. 9(1): 11, 1907

SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula,

FLONA, 24.IV.2009, leg. M.C. Westphalen 161/09 (ICN 154308); CPCN Pré-Mata,

26.1X.2009, leg. M.C. Westphalen 270/09 (ICN 154374), leg. M.C. Westphalen 272/09

(ICN 154375).

REMARKS: Fomitiporia maxonii is very similar to F. punctata (P. Karst.) Murrill

[= Phellinus punctatus (P. Karst.) Pilat], differing only by basidiospore size

(FE. maxonii, 5-6.5 x 4.5-6 um; F. punctata, 6.5-8.5 x 5.5-7 um). Ryvarden (1985)

considered them to be synonymous. However, more recently, phylogenetic

studies by Decock et al. (2007) show that they represent two different taxa and

that EF maxonii is widely distributed in the neotropics, including Brazil. Even

though this is the first confirmed record of the species from Rio Grande do

Sul, it is probable that many collections from the State identified as Phellinus

punctatus actually represent F maxonii.

Fomitiporia sanctichampagnatii G. Coelho, R.M. Silveira & Rajchenb., Fung.

Diversity 36: 3, 2009

SPECIMENS EXAMINED: BRAZIL. RIO GRANDE DO SUL, Sao Francisco de Paula, CPCN

Pré-Mata, 06.V1.2006, leg. G. Coelho 493-1 (ICN 139201), leg. G. Coelho 493-2 (ICN

139202), leg. G. Coelho 493-3 (ICN 139203).

Resupinate polypores in southern Brazil ... 119

Fulvifomes umbrinellus (Bres.) Y.C. Dai, Fung. Diversity 45: 203, 2010

SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, FLONA,

26-II-2010, leg. M.C. Westphalen 305/10 (ICN 154665); CPCN Pro-Mata, 26.1X.2009,

leg. M.C. Westphalen 266/09 (ICN 154373).

Junghuhnia carneola (Bres.) Rajchenb., Revista Invest. Agropec. 19: 45, 1984

SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO SUL: Sao Francisco de Paula, CPCN

Pro-Mata, 14.XI.2009, leg. M.C. Westphalen 289/09 (ICN 154468).

Junghuhnia meridionalis (Rajchenb.) Rajchenb., Austral. Syst. Bot. 16(4): 477, 2003

SPECIMEN EXAMINED: BRAZIL. RIO GRANDE DO SUL, Sado Francisco de Paula,

FLONA, 22.V1.2009, leg. M.C. Westphalen 238/09 (ICN 154290); 26-III-2010, leg. M.C.

Westphalen 295/10, (ICN 154659); leg. M.C. Westphalen 303/10 (ICN 154660).

Junghuhnia nitida (Pers.) Ryvarden, Persoonia 7(1): 18, 1972

SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, CPCN

Pro-Mata, 30.V.2009, leg. M.C. Westphalen 222/09 (ICN 154296); FLONA, 22.VI.2009,

leg. M.C. Westphalen 236/09 (ICN 154294), leg. M.C. Westphalen 241/09 (ICN

154295).

Pachykytospora papyracea (Cooke) Ryvarden, Norweg. J. Bot. 19: 233, 1972

SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sado Francisco de Paula, CPCN

Pré-Mata, 29.V.2009, leg. M.C. Westphalen 219/09 (ICN 154302); 26.IX.2009, leg. M.C.

Westphalen 265/09 (ICN 154369); 26-III-2010, leg. M.C. Westphalen 302/10 (ICN

154663).

Perenniporia medulla-panis (Jacq.) Donk, Persoonia 5(1): 76, 1967

SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, CPCN

Pré-Mata, 30.V.2009, leg. M.C. Westphalen 224/09 (ICN 154303).

Phellinus bambusarum (Rick) M.J. Larsen, Synopsis Fung. 3: 40, 1990

SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, FLONA,

24.1V.2009, leg. M.C. Westphalen 179/09 (ICN 154305); CPCN Pré-Mata, 29.V.2009,

leg. M.C. Westphalen 217/09 (ICN 154306); 26.[X.2009, leg. M.C. Westphalen 264/09

(ICN 154372).

Rigidoporus crocatus (Pat.) Ryvarden, Occas. Pap. Farlow Herb. Cryptog. Bot. 18:

13, 1983

SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, CPCN

Pré-Mata, 29.V.2009, leg. M.C. Westphalen 218/09 (ICN 154320); 07.X.2010, leg. M.C.

Westphalen 338/10 (ICN 154703); FLONA, 22.V1.2009, leg. M.C. Westphalen 231/09

(ICN 154316), leg. M.C. Westphalen 248/09 (ICN 154317), leg. M.C. Westphalen 253/09

(ICN 154319).

Rigidoporus undatus (Pers.) Donk, Persoonia 5(1): 115, 1967

SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, FLONA,

24.1V.2009, leg. M.C. Westphalen 148/09 (ICN 154297); CPCN Pr6-Mata, 26.VI.2010,

leg. M.C. Westphalen 335/10 (ICN 154695).

120 ... Westphalen & Silveira

Rigidoporus vinctus (Berk.) Ryvarden, Norweg. J. Bot. 19: 143, 1972

SPECIMEN EXAMINED: BRAZIL. RIO GRANDE DO SUL, Sao Francisco de Paula, FLONA,

24.1V.2009, leg. M.C. Westphalen 153/09 (ICN 154315).

Schizopora flavipora (Berk. & M.A. Curtis) Ryvarden, Mycotaxon 23: 186, 1985

SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, FLONA,

24.1V.2009, leg. M.C. Westphalen 151/09 (ICN 154280); 18.V.2009, leg. M.C. Westphalen

187/09 (ICN 154281); 25.1X.2009, leg. M.C. Westphalen 259/09 (ICN 154380); CPCN

Pré-Mata, 26.1X.2009, leg. M.C. Westphalen 269/09 (ICN 154381); 26.VI.2010, leg.

M.C. Westphalen 337/10 (ICN 154691).

Schizopora paradoxa (Schrad.) Donk, Persoonia 5(1): 104, 1967

SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, FLONA,

18.V.2009, leg. M.C. Westphalen 184/09 (ICN 154282); CPCN Pr6-Mata, 29.V.2009, leg.

M.C. Westphalen 208/09 (ICN 154283); 30.V.2009 leg. M.C. Westphalen 228/09 (ICN

154284); 26.1X.2009, leg. M.C. Westphalen 274/09 (ICN 154382).

Sidera lenis (P. Karst.) Miettinen, Mycol. Progr. 10(2): 136, 2011

SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sado Francisco de Paula,

FLONA, 18.V.2009, leg. M.C. Westphalen 182/09 (ICN 154321), leg. M.C. Westphalen

188/09 (ICN 154322); 22.V1.2009, leg. M.C. Westphalen 234/09 (ICN 154323), leg. M.C.

Westphalen 245/09 (ICN 154324); CPCN Pr6é-Mata, 29.V.2009, leg. M.C. Westphalen

220/09 (ICN 154325); 26.IX.2009, leg. M.C. Westphalen 268/09 (ICN 154383).

Tinctoporellus epimiltinus (Berk. & Broome) Ryvarden, Trans. Brit. Mycol. Soc. 73:

193.1979

SPECIMEN EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, Hotel

Veraneio Hampel, 27.III.2010, leg. M.C. Westphalen 317/10 (ICN 154671).

Trechispora mollusca (Pers.) Liberta, Canad. J. Bot. 51(10): 1878, 1974 Fras 11-12

BASIDIOMES annual, resupinate, adnate, <1 mm thick, very soft and fragile,

separable from the substrata; marginal sterile zone white, cottony, arachnoid or

fimbriate, sometimes slightly rhizomorphic, narrow to wide; pore surface white

when fresh, drying cream, pores irregular, circular to angular, sinuous, split

in some parts, 2-6 per mm; tubes concolorous with the pore surface, fragile,

<1 mm thick; subiculum white to light cream, very thin, soft and fibrous,

continuous with the trama.

HyYPHAL SYSTEM monomitic; generative hyphae with clamps, thin-walled,

branched, often ampullate at the septa, sometimes incrusted with small

granules, 2-6 um in diam., IKI-; cystidia and other sterile elements absent.

Basidia clavate to cylindrical, 4-sterigmate; basidiospores ovoid to ellipsoid,

hyaline, thin-walled, echinulate, 3.5-4.5 x 2.5-3.5 um.

SuBsTRATA: Fallen logs of an unknown angiosperm.

DISTRIBUTION: Circumglobal.

SPECIMENS EXAMINED: BRAZIL. R10 GRANDE DO SUL, Sao Francisco de Paula, CPCN

Pré-Mata, 26.1X.2009, leg. M.C. Westphalen 276/09 (ICN 154386), leg. M.C. Westphalen

277/09 (ICN 154387).

Resupinate polypores in southern Brazil ... 121

i hy ES

arenes

ora esa foe

Fic. 11-12. Trechispora mollusca.

11. Basidiospores. 12. Generative hyphae.

REMARKS: Trechispora mollusca is characterized by very fragile basidiomes with

cottony margins and sinuous pores. Microscopically it has a monomitic hyphal

system and ornamented spores. It is very similar to T’ regularis, differing only

in the absence of cystidia in the hymenium. Trechispora mollusca was recently

recorded as new to Brazil by Drechsler-Santos et al. (2008), but their Brazilian

specimen deposited in FLOR herbarium has effused-reflexed basidiomes

and a flexible consistency. After microscopic examination, we identified it as

Junghuhnia undigera (Berk. & M.A. Curtis) Ryvarden. Therefore, we consider

the ICN material cited above as the first record of T: mollusca from Rio Grande

do Sul State and Brazil.

Trechispora regularis (Murrill) Liberta, Canad. J. Bot. 51(10): 1878, 1974

SPECIMEN EXAMINED: BRAZIL. RIO GRANDE DO SUL, Sao Francisco de Paula, FLONA,

22.V1.2009, leg. M.C. Westphalen 246/09 (ICN 154329).

Acknowledgements

CAPES (Brazil) is acknowledged for financial support. We also wish to thank

MSc. Marisa de Campos Santana for assistance with the line drawings and Dr. Maria

Alice Neves (Universidade Federal de Santa Catarina, Brazil) and Dr. Peter Buchanan

(Landcare Research, New Zealand) for the critical review.

Literature cited

Backes A. 1999. Condicionamento climatico e distribuicéo geografica de Araucaria angustifolia

(Bertol.) Kuntze no Brasil - II. Pesquisas - Botanica 49: 31-51.

Coelho G, Silveira RMB, Rajchenberg M. 2006. A new Gloeoporus species growing on bamboo

from southern Brazil. Mycologia 98: 821-827. http://dx.doi.org/10.3852/mycologia.98.5.821

122 ... Westphalen & Silveira

Decock C, Figueroa SH, Robledo G, Castillo G. 2007. Fomitiporia punctata (Basidiomycota,

Hymenochaetales) and its presumed taxonomic synonyms in America: taxonomy and

phylogeny of some species from tropical/subtropical areas. Mycologia 99(5): 733-752.

http://dx.doi.org/10.3852/mycologia.99.5.733

Drechsler-Santos ER, Groposo C, Loguercio-Leite C. 2008. New records of lignocellulolytic fungi

(Basidiomycetes) from the Atlantic Rain Forest in State of Santa Catarina, Brazil. Hoehnea

35(1): 57-61.

Fidalgo O. 1962. Rick, o pai da micologia brasileira. Rickia 1: 1-11.

Gilbertson RL, Ryvarden L. 1986. North American polypores, vol. 1, Abortiporus - Lindtneria.

Fungiflora, Oslo.

Groposo C, Loguercio-Leite C. 2002. Fungos polipordides (Basidiomycetes) da Reserva Biolédgica

Tancredo Neves, Cachoeirinha, Rio Grande do Sul, Brasil. Iheringia, Série Botanica 57: 39-59

Hibbett SD, Binder M. 2002. Evolution of complex fruiting-body morphologies in

homobasidiomycetes. Proceedings of Royal Society of London 269: 1963-1969.

Mota FS. 1951. Estudos do clima do Estado do Rio Grande do Sul, segundo o sistema de W. Koppen.

Revista Brasileira de Geografia 13(2): 275-284.

Niemela T. 1985. Mycoflora of Poste-de-la-Baleine, Northern Quebec. Polypores and the

Hymenochaetales. Naturaliste Canadien 112: 445-472.

Reck MA, Silveira RMB. 2008. Ordem Polyporales (Basidiomycota) no Parque Estadual de Itapua,

Viamao, Rio Grande do Sul. Revista Brasileira de Biociéncias 6(3): 301-314.

Rick J. 1960. Basidiomycetes eubasidii in Rio Grande do Sul, Brasilia. Iheringia 7: 193-296.

Ryvarden L. 1985. Type studies in the Polyporaceae 17. Species described by W.A. Murrill.

Mycotaxon 23: 169-198.

Ryvarden L. 1991. Genera of polypores: Nomenclature and taxonomy. Synopsis Fungorum 5:

1-363.

Ryvarden L. 2007. Studies in Neotropical Polypores 23. New and interesting wood-inhabiting fungi

from Belize. Synopsis Fungorum 23: 32-50

Ryvarden L, Johansen I. 1980. A preliminary polypore flora of East Africa. Fungiflora, Oslo.

Silveira RMB, Guerrero RT. 1991. Aphyllophorales polipordides (Basidiomycetes) do Parque

Nacional de Aparados da Serra, RS. Boletim do Instituto de Biociéncias 48: 1-147.

Silveira RMB, Reck, MA, Graf LV, Nogueira De Sa FE. 2008. Polypores from a Brazilian pine forest in

Southern Brazil: pileate species. Hoehnea 35: 619-630.

Webster J, Weber WS. 2007. Introduction to Fungi. 5 ed. Cambridge University Press, New York.

Wright J, Alberté E. 2006. Hongos de la regién Pampeana, II: Hongos sin laminillas. L.O.L.A.,

Buenos Aires.

MY COTAXON

http://dx.doi.org/10.5248/122.123

Volume 122, pp. 123-128 October-December 2012

Coltricia australica sp. nov.

(Hymenochaetales, Basidiomycota) from Australia

L1I-WEI ZHOU! & LEHO TEDERSOO”

'State Key Laboratory of Forest and Soil Ecology, Institute of Applied Ecology,

Chinese Academy of Sciences, Shenyang 110164, P. R. China

?Institue of Ecology and Earth Sciences and Natural History Museum, University of Tartu,

14A Ravila, 50411 Tartu, Estonia

“ CORRESPONDENCE TO: liwei_zhou1982@163.com

ABSTRACT — Coltricia australica sp. nov. is described and illustrated from Tasmania, Australia.

It is characterized by its annual and centrally stipitate basidiocarps with concentrically zonate

and glabrous pilei when dry, angular pores of 3-4 per mm, and ellipsoid, thin- to thick-

walled, smooth, pale yellowish, and cyanophilous basidiospores. This species is terrestrial in

angiosperm forests.

Key worps — Hymenochaetaceae, polypore, taxonomy

Introduction

Coltricia Gray, typified by C. connata Gray [= C. perennis (L.) Murrill], is a

cosmopolitan genus of Hymenochaetales and has been well studied in Africa

(Ryvarden & Johansen 1980), Asia (NUfez & Ryvarden 2000, Dai & Cui 2005,

Dai et al. 2010, Dai 2010, 2012, Dai & Li 2012, Baltazar & Silveira 2012),

Europe (Ryvarden & Gilbertson 1993), Neotropics (Ryvarden 2004, Baltazar et

al. 2010), and North America (Gilbertson & Ryvarden 1986). Coltricia differs

from other genera in Hymenochaetales by the combination of annual stipitate

and fragile (when dry) basidiocarps, a monomitic hyphal system, and colored

slightly to distinctly thick-walled smooth basidiospores (Dai 2010).

Coltriciella Murrill, the most morphologically similar genus to Coltricia,

differs by its ornamented basidiospores (Dai 2010). Recent molecular data

confirmed that the two genera are closely related in a strongly supported clade,

but the monophyly of both genera remains unresolved (Wagner & Fischer

2002, Larsson et al. 2006).

Most species of Coltricia and Coltriciella are terrestrial or associate with

strongly decayed wood. Despite the woody fruitbody texture and phylogenetic

124 ... Zhou & Tedersoo

placement within the Hymenochaetales comprising mostly white-rot agents of

wood, several species of the two genera have been reported to be ectomycorrhizal

(EcM) symbionts of different trees based on both morphological and molecular

evidence (Thoen & Ba 1989, Tedersoo et al. 2007, 2010).

The stipitate and terrestrial species of Phylloporia Murrill, in particular

P. minutispora Ipulet & Ryvarden, P. spathulata (Hook.) Ryvarden, and P. verae-

crucis (Berk. ex Sacc.) Ryvarden, are frequently misidentified as Coltricia and

Coltriciella in the field, but Phylloporia spp. have smaller basidiospores (<4.5

um long and <3.5 um wide, Zhou & Dai 2012). However, a reliable delimitation

between Phylloporia and Coltricia is still unknown; for example, Coltricia

stuckertiana (Speg.) Rajchenb. & J.E. Wright with typical Coltricia characters

clusters within the Phylloporia clade (Valenzuela et al. 2011).

During a field trip in Australia, a specimen of Coltricia was collected and

originally labeled as “C. cf. cinnamomea”. Molecular evidence (Tedersoo et al.

2007) and careful microscopic examination revealed it to differ from described

species and to represent a new Coltricia species. Description and drawings of

the microscopic structures of this new species are provided.

Materials & methods

The studied specimen was deposited at the herbaria of University of Tartu (TU)

and Beijing Forestry University (BJFC). The microscopic procedure follows Dai (2010).

A Nikon Eclipse 80i microscope at magnification up to x1000 was used to study the

sections prepared in IKI (Melzer’s reagent), KOH (5% potassium hydroxide) and CB

(Cotton Blue) solutions. When presenting the variation in the size of the spores, 5% of

measurements were excluded from each end of the range and are given in parentheses.

The following abbreviations are used: IKI- = negative in Melzer’s reagent, CB+ =

cyanophilous, L = mean spore length (arithmetic average of all spores), W = mean spore

width (arithmetic average of all spores), Q = variation in the L/W ratios between the

specimens and n = number of spores measured from the given number of specimens.

Line drawings were made with the aid of a light tube. Special color terms follow Petersen

(1996).

Taxonomy

Coltricia australica L.W. Zhou, Tedersoo & Y.C. Dai, sp. nov. FIGURE 1

MycoBank MB 800364

Differs from Coltricia cinnamomea in its slightly smaller basidiospores and narrower

contextual hyphae.

Type: Australia. Tasmania, Southwest Conservation Area, Warra Long-Term Ecological

Research site, ground in mixed forest of Eucalyptus and Nothofagus, 8.V1II.2006

(holotype, TU 103694; isotype, BJFC; European Nucleotide Archive accession number,

AM412243 for nLSU).

EryMo_oey: australica (Lat.): refers to the country of Australia.

Coltricia australica sp. nov. (Australia) ... 125

==) —————

t . ) }

2 d

10 um —

10 ym

FiGurRE 1. Coltricia australica (holotype).

a: Basidiospores. b: Basidia and basidioles. c: Hyphae from trama. d: Hyphae from context.

BASIDIOCARPS annual, centrally stipitate, gregarious. PILEUS more or less

circular, infundibuliform, up to 3 cm in diam., 3 mm thick at centre. PILEAL

SURFACE cinnamon to greyish brown, concentrically zonate, when dry with

radial wrinkled ridges, glabrous; margin thin, acute, curving down when dry.

PoRE SURFACE reddish brown to greyish brown; pores angular, 3-4 per mm;

dissepiments thin, entire. CONTEXT dark brown, coriaceous, up to 1 mm thick.

TuBEs yellowish brown, paler than the context, fragile when dry, up to 2 mm

long. St1PE yellowish brown, matted, up to 3 cm long and 2 mm in diam.

HyPHAL SYSTEM monomitic; GENERATIVE HYPHAE simple septate; tissue

becoming reddish brown in KOH but otherwise unchanged. CONTEXTUAL

126 ... Zhou & Tedersoo

HYPHAE pale yellowish to golden brown, thick-walled with a wide lumen,

regularly branched and septate, straight, regularly arranged, 3.5-6.5 um in

diam.; hyphae in the stipe similar to those in context. TRAMAL HYPHAE pale

yellowish to golden brown, thick-walled with a wide lumen, occasionally

branched, regularly septate, straight, subparallel along tubes, 2.9-5.5 um

in diam. Basip1a clavate, with four sterigmata and a simple septum at the

base, 14-21 x 6-7.8 um; basidioles in shape similar to basidia, but slightly

smaller. Bastp1ospores broadly ellipsoid to ellipsoid, pale yellowish, thin- to

thick-walled, smooth, IKI-, CB+, (5.5-)6-7.3(-7.4) x (4-)4.1-5.2(-5.3) um,

L = 6.54 um, W = 4.77 um, Q = 1.37 (n = 30/1).

REMARKS: The holotype specimen of C. australica 'TU103694 was subjected

to sequence analysis of both nuclear large subunit ribosomal DNA (nLSU)

and internal transcribed spacer (ITS) regions as described in Tedersoo et al.

(2007). The ITS fragment was probably too long to yield a PCR product, but a

1009-nucleotide nLSU sequence was easily obtained. nLSU-based phylograms

suggested that this specimen is closely related to a Coltricia specimen [MEL

(Melbourne Royal Botanical Gardens Herbarium) 2059672, AM412244] also

from Australia (Tedersoo et al. 2007) but unavailable for examination. Other

Coltricia and Coltriciella species were phylogenetically well segregated from the

two Australian specimens.

Coltricia australica macroscopically resembles C. cinnamomea (Jacq.)

Murrill, C. perennis, C. pyrophila (Wakef.) Ryvarden, C. subperennis Y.C. Dai

[nom. illegit.], and C. weii Y.C. Dai by sharing a central stipe, similar pores

(3-4 per mm), and ellipsoid basidiospores (Dai 2010).

Coltricia cinnamomea is distinguished by slightly larger basidiospores

(TABLE 1) and wider contextual hyphae (6-10 um in diam., Dai 2010).

Coltricia perennis has longer basidiospores (TABLE 1) and wider contextual

hyphae (6-9 um in diam., Dai 2010) than C. australica. In the field, it is easy to

differentiate the two species: C. perennis grows on gymnosperm forest floors

(Gilbertson & Ryvarden 1986, Ryvarden & Gilbertson 1993, Baltazar et al.

2010, Dai 2010), while C. australica inhabits angiosperm forests.

Coltricia pyrophila differs from C. australica in its smaller basidiospores

(TABLE 1) and loosely interwoven tramal hyphae (Dai 2010).

Coltricia subperennis is distinguished from C. australica by its larger

basidiospores (TABLE 1) and narrower tramal hyphae (3-4 um in diam., Dai

2010).

When dry, Coltricia weii has dark reddish to umber pileal surface and umber

pore surface (Dai 2010), which are paler than those in C. australica. In addition,

the basidiospores are weakly cyanophilous in C. weii (Dai 2010) but strongly

cyanophilous in C. australica.

Coltricia australica sp. nov. (Australia) ... 127

TABLE 1. Comparison of basidiospore sizes of six similar Coltricia species

based on Dai (2010) and specimen examined in the present study.

SPECIES BASIDIOSPORES [L x W]

C. australica 6.54 x 4.77 um, Q = 1.37

C. cinnamomea 7.18 x 5.25 um, Q = 1.34-1.39

C. perennis 7.41 x 4.70 um, Q = 1.49-1.67

C. pyrophila 5.20 x 3.82 um, Q = 1.36

C. subperennis 8.25 x 5.70 um, Q = 1.42-1.47

C. weii 6.36 x 4.98 um, Q = 1.22-1.35

Acknowledgements

We express our gratitude to MSc. Juliano M. Baltazar (Universidade Federal do Rio

Grande do Sul, Brazil) and Dr. Shuang-Hui He (Beijing Forestry University, China) who

reviewed the manuscript. MSc. Chang-Lin Zhao (Beijing Forestry University, China) is

thanked for help in drawings. The research was financed by the National Natural Science

Foundation of China (Project Nos. 30910103907 and 31200015). L.T. acknowledges

financial support from the Estonian Science Foundation (grant 9286).

Literature cited

Baltazar JM, Ryvarden L, Gibertoni TB. 2010. The genus Coltricia in Brazil: new records and two

new species. Mycologia 102: 1253-1262. http://dx.doi.org/10.3852/09-227

Baltazar JM, Silveira RMB. 2012. A new name for a Coltricia (Basidiomycota) from India. Mycotaxon

119: 385-389. http://dx.doi.org/10.5248/119.385

Dai YC. 2010. Hymenochaetaceae (Basidiomycota) in China. Fungal Divers. 45: 131-343.

http://dx.doi.org/10.1007/s13225-010-0066-9

Dai YC. 2012. Polypore diversity in China with an annotated checklist of Chinese polypores.

Mycoscience 53: 49-80. http://dx.doi.org/10.1007/s10267-011-0134-3

Dai YC, Cui BK. 2005. Two new species of Hymenochaetaceae from eastern China. Mycotaxon 94:

341-347,

Dai YC, Li HJ. 2012. Type studies on Coltricia and Coltriciella described by E. J. H. Corner from

Southeast Asia. Mycoscience 53: 337-346. http://dx.doi.org/10.1007/s10267-011-0174-8

Dai YC, Yuan HS, Cui BK. 2010. Coltricia (Basidiomycota, Hymenochaetales) in China. Sydowia

625 Lia21¢

Gilbertson RL, Ryvarden L. 1986. North American polypores 1. Fungifora, Oslo. 433 p.

Larsson K-H, Parmasto E, Fischer M, Langer E, Nakasone KK, Redhead SA. 2006. Hymenochaetales:

a molecular phylogeny for the hymenochaetoid clade. Mycologia 98: 926-936.

http://dx.doi.org/10.3852/mycologia.98.6.926

Nujiez M, Ryvarden L. 2000. East Asian polypores 1. Ganodermataceae and Hymenochaetaceae.

Syn. Fungorum 13: 1-168.

Petersen JH. 1996. Farvekort. The Danish Mycological Society's colour-chart. Foreningen til

Svampekundskabens Fremme, Greve. 6 p.

Ryvarden L. 2004. Neotropical polypores 1. Syn. Fungorum 19: 1-229.

Ryvarden L, Gilbertson RL. 1993. European polypores 1. Syn. Fungorum 6: 1-387.

128 ... Zhou & Tedersoo

Ryvarden L, Johansen I. 1980. A preliminary polypore flora of East Africa. Fungiflora, Oslo. 636 p.

Tedersoo L, Suvi T, Beaver K, Saar I. 2007. Ectomycorrhizas of Coltricia and Coltriciella

(Hymenochaetales, Basidiomycota) on Caesalpiniaceae, Dipterocarpaceae and Myrtaceae in

Seychelles. Mycol. Prog. 6: 101-107. http://dx.doi.org/10.1007/s11557-007-0530-4

Tedersoo L, May TW, Smith ME. 2010. Ectomycorrhizal lifestyle in fungi: global diversity,

distribution, and evolution of phylogenetic lineages. Mycorrhiza 20: 217-263.

http://dx.doi.org.10.1007/s00572-009-0274-x

Thoen D, Ba AM. 1989. Ectomycorrhizas and putative ectomycorrhizal fungi of Afzelia africana

Sm. and Uapaca guineensis Mill. Arg. in southern Senegal. New Phytol. 113: 549-559.

Valenzuela R, Raymundo T, Cifuentes J, Castillo G, Amalfi M, Decock C. 2011. Two undescribed

species of Phylloporia from Mexico based on morphological and phylogenetic evidence. Mycol.

Prog. 10: 341-349. http://dx.doi-org.10.1007/s11557-010-0707-0

Wagner T, Fischer M. 2002. Proceedings towards a natural classification of the worldwide taxa

Phellinus s.l. and Inonotus s.l., and phylogenetic relationships of allied genera. Mycologia 94:

998-1016. http://dx.doi.org/10.2307/3761866

Zhou LW, Dai YC. 2012. Phylogeny and taxonomy of Phylloporia (Hymenochaetales): new species

and a worldwide key to the genus. Mycologia 104: 211-222. http://dx.doi.org/10.3852/11-093

MY COTAXON

http://dx.doi.org/10.5248/122.129

Volume 122, pp. 129-134 October-December 2012

Four new rust taxa on Asteraceae from Central Alborz,

northern Iran

FAEZEH ALIABADI & MEHRDAD ABBASI

Iranian Research Institute of Plant Protection, Department of Botany

Yaman street, Tehran, 19395-1454, Iran

* CORRESPONDENCE TO: f_aliabadi@hotmail.com

ABSTRACT — During the study of the rust mycobiota of Central Alborz, four new taxa (two

species and two varieties) were found: Puccinia artemisiae-chamaemelifoliae on Artemisia

chamaemelifolia, P. crepidis-asadbarensis on Crepis asadbarensis, P. jaceae var. elbursensis on

Centaurea behen, and P. punctiformis var. karajensis on Cirsium arvense.

Key Worps — Fungi, Pucciniales, taxonomy, mycology

Introduction

The Central Alborz, located in the middle Alborz chain, is situated at

35°00'-36°30'N 50°20'-53°10'E and contains several peaks above 3000 m

(Gitasshenasi 2004). Due to its varied topography and climate, this area has a

remarkable diversity of vegetation (Klein 1994). The rust mycobiota of Central

Alborz has not yet been intensively studied. The Asteraceae harbor a wide range

of rust fungi, especially species of the genus Puccinia. In Iran, so far 66 Puccinia

spp. have been reported on hosts of 44 asteraceous genera. During the course

of studies on the rust mycobiota of Central Alborz, several Puccinia spp. on

asteraceous plants have been identified. Four of them proved to be new and are

described in this paper.

Materials & methods

Several rust-infected plant specimens were collected from different parts of the

Central Alborz region in northern Iran. All specimens were studied macroscopically

and microscopically. Color, shape and structure of sori of all infected specimens were

carefully examined by an Olympus stereomicroscope. Glycerine-Lactic acid was used

in preparing microscopic slides. All preparations were studied by an Olympus BH2

Nomarski Differential Interference Contrast Microscope (DIC) at magnifications of x

400 and x 1000. 50 spores per specimen were randomly selected and measured. All

130 ... Aliabadi & Abbasi

specimens are deposited in the Fungal Reference Collection of the Ministry of Jihad-e

Agriculture (IRAN) located at Iranian Research Institute of Plant Protection, Tehran.

Taxonomy

PLaTE 1. Puccinia artemisiae-chamaemelifoliae on Artemisia chamaemelifolia: A. urediniospores;

B. teliospores. Scale bars = 20 um.

Puccinia artemisiae-chamaemelifoliae Aliabadi & M. Abbasi, sp.nov. = PLATE 1

MyYcoBANK MB 564231

Differs from Puccinia absinthii s. lat. by its smaller teliospores with a smaller length/

width ratio.

Type: On Artemisia chamaemelifolia Vill.: Iran, Tehran Prov., Central Alborz, Haraz

road, Hareh village, 3 km after village, alt. 2000-2200 m, II+III, 5 August 1993, leg.

J.Fatehi, M.Abbasi & Z.Ghanbari (holotype, IRAN 14660 F).

EryMo ocy: referring to the host species.

SPERMOGONIA and AECIA not observed. UREDINIA epiphyllous and caulicolous,

yellowish brown, round to oval-oblong, semi-compact; urediniospores

27.5-32.5(-37.5) x (20-)22.5-25(-27.5) um, globoid to ovoid, wall yellowish

brown, 1.5-2.5 um thick, echinulate, with 3(-4) equatorial germ pores covered

with hyaline papillae. TEL1a mostly epiphyllous and caulicolous, blackish

brown, round to oblong, semi-compact; teliospores (37.5-)40-47.5(-50) x

(22.5-)25-30 um, ellipsoid, broadly obovoid, clavate or oblong, wall 2.5-5

um thick at the sides and sometimes up to 7.5 um apically, chestnut-brown,

finely and densely verrucose, verrucae more visible on the upper cell of the

spore and becoming smaller towards the hilum, germ pore of the upper cell

approximately apical and of the lower cell below the septum, pedicel hyaline,

persistent, up to 90 um long.

CoMMENTS — Based on Braun’s revision (Braun 1981), the rust on A. chamae-

melifolia is close to P. absinthii s. lat. but differs from it in having smaller

Puccinia spp. nov. (Iran) ... 131

teliospores and a smaller teliospore length/width ratio. Puccinia artemisiae-

chamaemelifoliae teliospores have a mean length of 43.5 um and a mean width of

27.5 um, giving a mean length/width ratio of 1.6. However the mean teliospore

length for P absinthii is greater than 45 um and its teliospore L/W ratio is

1.7-2.1 (Braun 1981). The only Puccinia species reported on A. chamaemelifolia

is P chamaemelifoliae published by Viennot-Bourgin (1958); according to the

original description, only the uredinial state was present, with urediniospores

21-29 x 19-23 um, i.e., smaller than those of P artemisiae-chamaemelifoliae.

: ee

oe _

\ael

PLATE 2. Puccinia crepidis-asadbarensis on Crepis asadbarensis: A. aeciospores; B. urediniospores;

C. teliospores. Puccinia jaceae var. elbursensis on Centaurea behen: D. urediniospores. Scale bars:

A-B, D=10 um, C=20 um.

Puccinia crepidis-asadbarensis Aliabadi & M. Abbasi, sp. nov. PLATE 2A-C

MycoBank MB 564233

Differs from Puccinia crepidis-pygmaeae by its larger urediniospores and teliospores.

Type: On Crepis asadbarensis Bornm. ex Rech.f.: Iran, Tehran Prov., Central Alborz

between Shemshak to Dizin, alt. 2800 m, I+II+III, 11 July 1994, leg. M.Abbasi (holotype,

IRAN 14662 F).

EryMo_oey: referring to the host species.

SPERMOGONIA unknown. AEcIA localized, in clusters; aeciospores 17.5-20

(-22.5) x 12.5-17.5 um, mostly polygonal, wall hyaline, 1-1.5 um thick, finely

verrucose. UREDINIA amphigenous, round, pulverulent, brown, rupturing the

epidermis; urediniospores (20-)22.5-30(-32.5) x (17.5-)20-25(-27.5) um,

132 ... Aliabadi & Abbasi

globoid, ellipsoid or obovoid, wall echinulate, 1.5-2.5 um thick, somewhat

thicker at germ pores, germ pores 2(-3), equatorial. TELIA amphigenous,

round, pulverulent, black, rupturing the epidermis; teliospores (30—)32.5-40

(-42.5) x 22.5-27.5 um, broadly ellipsoid or oblong, rounded at both ends, wall

finely verrucose, 2.5 um thick, germ pore of the upper cell apical or subapical,

rarely close to the septum, and that of the lower cell close to the septum or

equatorial.

ADDITIONAL SPECIMENS EXAMINED: On Crepis asadbarensis: IRAN, TEHRAN PROv.,

Central Alborz, Firoozkuh, Gaduk towards Doab, 20 km of Doab, Zagh-Bolagh

Mountains, alt. 2300-2600 m, I+III, 30 June 1991, leg. FTermeh & M.Mousavi (IRAN

14661 F); Shahrestanak, near Gilkola spring, alt. 2500 m, I+II+III, 12 August 1993, leg.

M.Abbasi, J.Fatehi & O.Foitzik (IRAN 11174 F).

COMMENTS — On the basis of the identification key published by Braun

(1981), P. crepidis-asadbarensis is close to P. crepidis-pygmaeae but differs in

having larger urediniospores (mostly >25 um in diam.) and teliospores (32-40

um long). Puccinia crepidis-pygmaeae urediniospores are mostly 20-25 um

long and teliospores 24-31 x 19-24 um (Braun 1981). The host plant, Crepis

asadbarensis, endemic to the Alborz area, belongs to section Berinia (Rechinger

et al. 1977); no rust has previously been reported on plant species from this

section in Iran.

Puccinia jaceae var. elbursensis Aliabadi & M. Abbasi, var. nov. PLATE 2D

MycoBank MB 564234

Differs from Puccinia jaceae var jaceae by its urediniospores with larger smooth patches

around the germ pores.

Type: On Centaurea behen L.: Iran, Tehran Prov., around Karaj, Gholgholak Spring,

II+III, 22 May 1998, leg. M.Abbasi (holotype, IRAN 14667 F).

EryMoLoey: referring to the mountain range near the type locality.

SPERMOGONIA and AECIA not seen. UREDINIA amphigenous, round, pulverulent,

cinnamon-brown, surrounded by the ruptured epidermis; urediniospores

25-32(-37.5) x 20-27.5 um, mostly ellipsoid or globoid, wall echinulate,

1.5-2.5 um thick, yellowish brown, germ pores 2(-3), supraequatorial, with

smooth patches around the germ pores, up to 18 um diam. TELIA amphigenous,

round, scattered, sometimes with a central sorus surrounded by an encircling

group of sori (arranged in concentric circles), pulverulent, blackish brown;

teliospores (35-)37.5-45(-52.5) x 22.5-27.5 um, broadly ellipsoid, wall 2-3

um thick, slightly thicker at pores, verrucose, sometimes verrucae arranged in

more or less evident longitudinal rows, germ pore of the upper cell subapical

and that of the lower cell approximately equatorial, germ pores covered by

minute, verrucose papillae.

ADDITIONAL SPECIMENS EXAMINED — On Centaurea behen: IRAN, TEHRAN PRov., 25

km of NE of Tehran, Latian dam, II+III, August 1968, leg. M.Iranshahr (IRAN 14666 F);

Puccinia spp. nov. (Iran) ... 133

Karaj-Chalus road, Kondor village, in an orchard, alt. 1800 m, II+IH, 17 June 1997, leg.

M.Abbasi et al. (IRAN 14668 F).

COMMENTS — To judge from Braun (1981), P. jaceae is delimited from P. hieracii

by teliospores with a mean width >25 um and urediniospores with smooth

patch <10 um. This rust species is restricted to Centaurea spp. (Braun 1981).

Interestingly, all three rust samples on C. behen we studied had teliospores with

a mean width >25 um (similar to P jaceae) but urediniospores with smooth

patches >10 um (different from P jaceae), leading us to describe the new variety,

P. jaceae var. elbursensis.

Re-examination of the P jaceae specimen on Centaurea macrocephala

Puschk. ex Willd. (IRAN 13722 F) reported by Donyadoost-Chalan et al. (2009)

showed urediniospores with smooth patches <10 um, identifying it as P. jaceae

var. jaceae in agreement with Braun (1981).

PLaTE 3. Puccinia punctiformis var. karajensis on Cirsium arvense: A. urediniospores; B. cross-

section of uredinium. Scale bars = 20 um.

Puccinia punctiformis var. karajensis Aliabadi & M. Abbasi, var. nov. PLATE 3

MycoBank MB 564235

Differs from Puccinia punctiformis var. punctiformis by its dimorphic urediniospores.

Type: On Cirsium arvense (L.) Scop.: Iran, Tehran Prov., Karaj-Chalus road, 2 km S

of Asara, around the river, alt.1750 m, O+II+III, 30 June 1999, leg. M.Abbasi et al.

(holotype, IRAN 14659 F).

EryMo_oey: referring to the general type locality.

SPERMOGONIA crowded, amphigenous, in large clusters, honey-colored.

UREDINIOID AECIA mostly hypophyllous and on the stems, systemic, scattered

over the whole surface of the leaf, round to oblong, pulverulent, reddish brown;

urediniospores of two types, normal urediniospores 23-31 x 23-27 um, wall

echinulate, 1.5-2 um thick, mostly globoid or broadly ellipsoid, with (2-)3

equatorial germ pores; large urediniospores 33-37(-44) x 32-37(-44) um,

globoid, with 5-8(-10) scattered germ pores. TELIA chiefly hypophyllous, rarely

epiphyllous and on stems, round to oblong, pulverulent, sometimes covered

134 ... Aliabadi & Abbasi

by the plant epidermis, black or brownish black; teliospores 34-40 x 21-26

uum, mostly ellipsoid to broadly ellipsoid or obovoid, rounded at both ends or

slightly narrowed basally, wall 1.5-2.5 um thick, chestnut-brown, scattered

and finely verrucose, germ pore apical in upper cell, in lower cell close to the

pedicel, pedicels short.

ComMENTS — Puccinia punctiformis var. karajensis differs from P. punctiformis

var. punctiformis in having dimorphic urediniospores with a second type of

unusually large spores with 5-8 scattered germ pores. We observed cross-

sections of uredinia with larger spores sitting on pedicels surrounded by normal

urediniospores. Study of 12 Iranian P. punctiformis herbarium specimens from

5 different provinces (IRAN 12389, 9560, 11625, 11776, 4011, 8371, 4010, 6851,

1866, 13752, 15114, 15115 F) and specimens from Turkey (IRAN 6847 F) and

Finland (IRAN 4482 F) showed no dimorphic urediniospores.

Acknowledgments

We acknowledge the help of Bahereh Javadi, Research Scientist at the Iranian

Research Institute of Plant Protection for identifying host plants. We also appreciate

the comments of expert referees, Dr. John Walker (Australia) and Prof. Cvetomir M.

Denchev (Bulgaria).

Literature cited

Braun U. 1981. Vorarbeiten zu einer Rostpilzflora der DDR. Feddes Reportorium 92: 95-123.

http://dx.doi.org/10.1002/fedr.49 10920105

Donyadoost-Chalan M, Abbasi M, Rezaee S. 2009. The rust mycobiota of Arasbaran Protected

area, NW of Iran. Rostaniha 10: 178-192.

Gitashenasi. 2004. General map of Central Albourz. Scale 1:200000. Gitashenasi Geographical &

Cartographic Institute.

Klein JC. 1994. La végétation altitudinale de lAlborz Central (Iran): entre les régions

iranotouranienne et euro-sibérienne. Institut Francais de Recherche en Iran, Téhéran.

Rechinger KH, Lack HW, Van Soest JL. 1977. Compositae I1-Lactuceae. Flora Iranica, No. 122.

Akademische Druck- und Verlagsanstalt, Graz, Austria.

Viennot-Bourgin G. 1958. Contribution a la connaissance des champignons parasites de I’ Iran.

Annal. Epiphyt. 2: 97-210.

MY COTAXON

http://dx.doi.org/10.5248/122.135

Volume 122, pp. 135-143 October-December 2012

Microfungi from Portugal: Minimelanolocus manifestus sp. nov.

and Vermiculariopsiella pediculata comb. nov.

MARGARITA HERNANDEZ-RESTREPO’ , RAFAEL FE, CASTANEDA- RUIZ’,

JOSEPA GENE’ , JOSEP GUARRO’, DAvID W. MINTER? & MARC STADLER‘

'Unitat de Micologia, Facultat de Medicina Ciéncies de la Salut, Universitat Rovira i Virgili, 43201

Reus, Tarragona, Spain

?Instituto de Investigaciones Fundamentales en Agricultura Tropical ‘Alejandro de Humboldt’

(INIFAT), Académico Titular de la Academia de Ciencias de Cuba,

Calle 1 Esq. 2, Santiago de Las Vegas, C. Habana, Cuba, C.P.

°CABI, Bakeham Lane, Egham, Surrey, TW20 9TY, United Kingdom

‘Department of Microbial Drugs, Helmholtz-Center for infection Research,

Inhoffenstrasse 8,38124 Braunschweig, Germany

*CORRESPONDENCE TO: josepa.gene@urv.cat

ABSTRACT —Two microfungi from a forest in Portugal are described and illustrated. The new

species Minimelanolocus manifestus is distinguished by polyblastic, integrated, sympodial

conidiogenous cells, and solitary, cymbiform, (2—)3-septate, smooth conidia with pale brown

middle cells and subhyaline end cells. A new combination Vermiculariopsiella pediculata is

proposed for Gyrothrix pediculata.

KEY worDs — anamorphic fungi, systematics, leaf litter

During the Iberian mycobiota study's twenty-fifth mycological foray, held

in “Lagoas de Bertiandos” (Ponte de Lima, Minho province) Portugal, two

interesting and unusual anamorphic fungi were collected. Individual samples

of plant material were placed in paper and plastic bags, taken to the laboratory,

and treated according to Castafieda-Ruiz (2005). Mounts were prepared in

polyvinyl alcohol-glycerol (8 g in 100 ml of water, plus 5 ml of glycerol) and

measurements made at a magnification of x1000. Photomicrographs were

obtained with a Zeiss AXIO imager M1 microscope (Gottingen, Germany). The

fungus was isolated into pure culture by transferring single conidia observed

under a stereo microscope onto potato-carrot agar (PCA) in Petri dishes, then

incubated at 25°C under daylight, 12 h alternating cycles of light/dark. Colour

notations in parentheses are from Kornerup & Wanscher (1978). The species

are described below.

136 ... Hernandez-Restrepo & al.

Fic 1. Minimelanolocus manifestus (ex holotype HAL 2450 F). a. Conidia. b. Conidiophore,

conidiogenous cell and conidium. c. Conidiogenous cells. d. Conidiogenous cells and conidia.

Scale bars = 10 um.

Minimelanolocus manifestus sp. nov. (Portugal) ... 137

Taxonomy

Minimelanolocus manifestus Hern.-Rest., R.F. Castafieda, Gené & Guarro, anam.

sp. nov. Figs 1, 2

MycoBank MB800026

Differs from Minimelanolocus spp. by conidia cymbiform to subfusiform, (2-)3-septate,

with central cells pale brown and end cells subhyaline.

TYPE: Portugal, Minho province, “Lagoas de Bertiandos’, 41°46’N 8°38'W, FMR 12182,

on rotten leaf of unidentified plant, 9 November 2011, R.E Castafieda, M. Hernandez-

Restrepo, J. Gené & J. Mariné-Gené (Holotype: HAL 2450 F).

ErymMo_oey: Latin, manifestus, meaning evident, clear manifest.

CoLonies on the natural substratum, effuse, hairy, brown to dark brown.

Mycelium superficial and immersed. Hyphae septate, branched, 2-4 um

diam., smooth, pale brown to brown. CONIDIOPHORES macronematous,

Fic 2. Minimelanolocus manifestus (ex holotype HAL 2450 F).

Conidiogenous cells and conidia. Scale bar = 10 um.

138 ... Hernandez-Restrepo & al.

mononematous, erect, straight, sometimes slightly sinuate towards the apex,

simple, 4-8-septate, smooth, 130-200 x 4-5 um, brown at the base, elsewhere

pale brown. CONIDIOGENOUS CELLS polyblastic, terminal, pale brown, 20-70

x 4-5 um, integrated, indeterminate, with several sympodial proliferations

bearing inconspicuous scars. Conidial secession schizolytic. Conrp1a solitary,

smooth, dry, acropleurogenous, cymbiform to subfusiform, fimbrillate at the

base, obtuse at the apex, (2—)3-septate, (21-)25-29 x 5-6 um, with central cells

pale brown and end cells subhyaline. Teleomorph unknown.

NoTE: Castaneda et al. (2001) established the genus Minimelanolocus with M.

navicularis (R.F. Castafieda) R.F. Castafieda as type species to accommodate

one new species and eleven combinations derived from Pseudospiropes M.B.

Ellis, Helminthosporium Link, and Belemnospora P.M. Kirk. Subsequently, the

following nine additional species were described: M. camelliae H.B. Fu & X.G.

Zhang, M. chimonanthi Y.D. Zhang & X.G. Zhang, M. endospermi Jian Ma &

X.G. Zhang, M. linderae Jian Ma & X.G. Zhang, M. machili K. Zhang & X.G.

Zhang, M. magnoliae K. Zhang & X.G. Zhang, M. mori Jian Ma & X.G. Zhang,

M. olivaceus R.F. Castafieda & Guarro, and M. pterocarpi Jian Ma & X.G. Zhang

(Castaneda et al. 2003, Ma et al. 2008, 2011, Zhang et al. 2009, 2010). Among

the known species, M. manifestus most closely resembles M. linderae and M.

navicularis, but M. linderae has ellipsoidal or cylindrical conidia, 26-35 x

7-9 um, which are mostly 4-septate and rarely 3-septate, while M. navicularis

possesses navicular to sub-rhombic conidia, 20-25 x 6-8 um, which are

(2—)3(-5)-septate, with brown to dark brown central cells and subhyaline end

cells. All three species can be easily differentiated.

Vermiculariopsiella pediculata (J.L. Cunn.) Hern.-Rest., R.F. Castafieda, Gené &

Guarro, comb. nov. Figs 3-5

MycoBank MB800053

= Gyrothrix pediculata J.L. Cunn., Mycologia 66(1): 123 (1974).

Anamorphic fungus. CoLonizs on the natural substratum effuse, blister-

shaped to sporodochial, hairy, whitish, amphigenous. Mycelium superficial

and immersed. Hyphae septate, frequently anastomosing, 1-3 um diam. SETAE

erect, cylindrical, 110-220 x 4-6 um, but wider, 5-9 um diam at the base, with

alternate, irregular to imperfect dichotomous branches, the branches being

attenuate, coiled to whip-like, curved, septate, smooth, brown below, and pale

brown at the apex. CONIDIOPHORES comprised solely of conidiogenous cells.

CONIDIOGENOUS CELLS monophialidic, discrete, ampulliform to subulate,

sometimes very close packed forming a cespitose layer, pale brown at the base,

subhyaline at the apex, 14-15 x 3-4 um, with a distinct, narrow, refractive

collarette. ConrpIA asymmetrical, sub-fusiform to navicular or sub-oblong,

attenuate, somewhat apiculate, curved at the apex, tumid, somewhat irregular,

Minimelanolocus manifestus sp. nov. (Portugal) ... 139

Fic 3. Vermiculariopsiella pediculata (ex nature HAL 2447 F). a. Conidia. b, c. Conidiogenous cells.

d-f. Setae. Scale bars = 10 um.

eccentrically and inconspicuously fimbrillate at the base, unicellular, hyaline,

smooth, 5-9 x 2 um, produced seriately and obliquely from the conidiogenous

loci, forming a white cirrhus or pseudochains in snow-like masses.

SPECIMEN EXAMINED: PORTUGAL, MINHO PROVINCE, “Lagoas de Bertiandos’,

41°46'N 8°38'W, FMR 12187, on rotten leaf of unidentified plant, 9 November 2011, R.F.

Castafieda, M. Hernandez-Restrepo, J. Gené & J. Mariné-Gené (HAL 2447 F).

CoLonigs on PCA, attaining 21-30 mm after 7 days at 25°C, floccose, raw

umber (5F8) with yellowish white (4A2) and numerous white pustules

somewhat pulvinate formed by conidial cirrhus. SETAE similar to those on

the natural substratum, 100-149 x 4-6 um. Hyphae septate, subhyaline to

very pale brown, 1-2 um diam, smooth. ConipiopHoREs comprised solely

of conidiogenous cells. CONIDIOGENOUS CELLS monophialidic, subulate to

ampulliform, slightly sinuate or curved, very pale brown at the base, hyaline

140 ... Hernandez-Restrepo & al.

Fic 4. Vermiculariopsiella pediculata (ex culture HAL 2451 F). a. Colonies on PCA (obverse and

reverse, respectively) at 25°C after 7 days. b, c. Conidia. d. Conidiogenous cells. Scale bars = 10

yum.

towards the apex, 19-28 x 3-4 um. Conip1A asymmetrical obclavate to long

obovoid, oblong or irregular, obtuse, slightly curved or subuncinate at the apex,

inflated, tumid, eccentrically fimbrillate at the base, hyaline, 19-28 x 3-4 um,

smooth-walled, produced axially at the conidiogenous cell apex in a long white

cirrhus or pseudocatenate.

CULTURES DEPOSITED: (ex HAL 2447 F) HAL 2451 E CBS 132484, FMR 12187.

Note: Nakagiri & Ito (1991) illustrated the conidiogenous cells and conidium

ontogeny from Gyrothrix circinata (Berk. & M.A. Curtis) S. Hughes and

regarded conidial production as “phialides type”; the authors interpreted the

whorled arrangement of conidia at the conidiogenous cell apex as resulting

Minimelanolocus manifestus sp. nov. (Portugal) ... 141

Fic 5. Vermiculariopsiella pediculata (ex culture on PCA, HAL 2451 F).

Conidia and conidiogenous cells. Scale bar = 10 um.

from mucilaginous material produced by and accumulated at the tip of each

conidiogenous cell. Crous et al. (1996), working with Gyrothrix verticiclada

(Goid.) S. Hughes & Piroz., illustrated inconspicuous annellations at the

conidiogenous cell apices produced after enteroblastic percurrent proliferations.

The aggregated conidia forming a whitish, more or less uniform layer at the

base of each seta is clearly the result of a conidial ontogeny with successive

enteroblastic percurrent or sympodial proliferations occurring near the apex

142 ... Hernandez-Restrepo & al.

of each conidiogenous cell, but the number of conidia produced by this way is

apparently limited and can be differentiated from the conidia produced from a

“phialide” as described by Kirk et al. (2008).

Wu et al. (1997) suggested that conidiogenous cells in Ceratocladium,

Circinotrichum, and Gyrothrix are not typical “phialides” Cunningham (1974)

described and illustrated the conidiogenous events on Gyrothrix pediculata

from cultures on corn meal agar. This pattern of ontogeny was classified as

conidial development type 18 (conidium ontogeny holoblastic, delimitation

by 1 septum, schizolytic secession, maturation by diffuse wall-building,

percurrent and sympodial enteroblastic conidiogenous cell proliferation below

the previous locus and delimiting septum, the second and subsequent conidia

formed from proliferations, but with no observed reduction in length of the

conidiogenous cells). Setose conidiomata with branched setae and similar

conidial ontogeny can be found in Vermiculariopsiella Bender [V. cornuta

(V. Rao & de Hoog) Nawawi, Kuthub. & B. Sutton, V. cubensis (R.F. Castaneda)

Nawawi, Kuthub. & B. Sutton, V. microsperma (Hohn.) R.F. Castafieda & W.B.

Kendr., and V. ramosa (B. Sutton) Nawawi, Kuthub. & B. Sutton]. As “phialides”

were described for the conidiogenous cells in Vermiculariopsiella by Morgan-

Jones et al. (1972), Nawawi et al. (1990) and Keshavaprasad et al. (2003), the

transfer of G. pediculata to Vermiculariopsiella is clearly supported and agrees

with the generic concept.

Acknowledgments

The authors express their sincere gratitude to Dr Xiu-Guo Zhang and Dr De-Wei Li

for their critical review of the manuscript. This study was supported by the Ministry of

Science and Innovation of Spain, grant CGL 2011-27185. We thank the Cuban Ministry

of Agriculture and Dr Adolfo Rodriguez Nodals (INIFAT) for facilities. We thank M.

Caraballo and B. Ramos for technical assistance. We thank Drs U. Braun, De-Wei Li, V.

Melnik, P.W. Crous, R. Singh, and M.A. D’Souza for their generous and valued assistance

with literature not otherwise available. We also acknowledge the facilities provided by

Dr P.M. Kirk and Drs V. Robert and G. Stegehuis through the Index Fungorum and

Mycobank websites. Dr Lorelei L. Norvell’s editorial review and Dr Shaun Pennycook’s

nomenclature review are greatly appreciated.

Literature cited

Castafieda-Ruiz RF. 2005. Metodologia en el estudio de los hongos anamorfos. 182-183, in: Anais

do V Congresso Latino Americano de Micologia. Brasilia.

Castafieda-Ruiz RE, Heredia G, Reyes M, Arias RM, Decock C. 2001. A revision of the genus

Pseudospiropes and some new taxa. Cryptog. Mycol. 22: 3-18.

http://dx.doi.org/10.1016/S0181-1584(01)01057-0

Crous PW, Seifert KA, Castafieda-Ruiz RE.1996. Microfungi associated with Podocarpus leaf litter

in South Africa. S. Afr. J. Bot. 62: 89-98.

Cunningham JL. 1974. A new Gyrothrix in culture and key to species. Mycologia 66: 122-129.

http://dx.doi.org/10.2307/3758461

Minimelanolocus manifestus sp. nov. (Portugal) ... 143

Keshavaprasad TS, D’Souza M, Bhat DJ. 2003. Vermiculariopsiella Bender: Present status of species

diversity. 503-511, in: Frontiers of fungal diversity in India. International book distributing

Co., Lucknow, India.

Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the fungi. 10° ed. CAB

International, Wallingford, UK.

Kornerup A, Wanscher JH. 1978. Methuen handbook of colour 3" ed. E. Methuen, London.

Ma J, Zhang K, Zhang XG. 2008. Two new species of the genus Minimelanolocus in China.

Mycotaxon 104: 147-151.

Ma J, Ma L-G, Zhang Y-D, Castafieda-Ruiz RF, Zhang XG. 2011a. Pseudospiropes linderae sp. nov.

and notes on Minimelanolocus (both anamorphic Strossmayeria) new to China. Nova Hedwigia

93: 465-473. http://dx.doi.org/10.1127/0029-5035/2011/0093-0465

Ma J, Zhang Y-D, Ma L-G, Zhang XG. 2011b. Two new Minimelanolocus species from southern

China. Mycotaxon 117: 131-135. http://dx.doi.org/10.5248/117.131

Morgan-Jones G, Nag Raj TR, Kendrick B. 1972. Icones generum coelomycetum V. Univ. Waterloo

Biol. Ser. 7: 1-52.

Nawawi A, Kuthubutheen AJ, Sutton BC. 1990. New species and combinations in Vermiculariopsiella

(hyphomycetes). Mycotaxon 37: 173-182.

Wu W, Sutton BC, Gange AC. 1997. Description of Avesicladiella gen. nov. (hyphomycetes) for two

undescribed leaf litter microfungi. Mycoscience 38: 11-15. http://dx.doi.org/10.5248/109.95

Zhang K, Fu HB, Zhang XG. 2009. Taxonomic studies of Minimelanolocus from Yunnan, China.

Mycotaxon 109: 95-101. http://dx.doi.org/10.5248/109.95

Zhang Y-D, Ma J, Ma L-G, Zhang XG. 2010. A new species of Minimelanolocus from Fujian, China.

Mycotaxon 114: 373-376. http://dx.doi.org/10.5248/114.373

MY COTAXON

http://dx.doi.org/10.5248/122.145

Volume 122, pp. 145-156 October-December 2012

Geastrum species of the La Rioja province, Argentina

FRANCISCO KUHAR*, VALERIA CASTIGLIA & LEANDRO PAPINUTTI

Laboratorio de Micologia Experimental, DBBE, Facultad de Ciencias Exactas y Naturales,

Ciudad Universitaria, (C1428EHA) Ciudad de Buenos Aires, Argentina.

* CORRESPONDENCE TO: fkuhar@yahoo.com.ar

ABSTRACT—A survey of Geastrum species from arid lands in the La Rioja province

(northwestern Argentina) recovered fourteen species previously unreported from the

province: G. arenarium, G. campestre var. famatinum, G. corollinum, G. fimbriatum, G.

floriforme, G. glaucescens, G. hieronymi, G. aff. lloydianum, G. pampeanum, G. pampeanum vat.

pallidum, G. parvistriatum, G. rufescens, G. saccatum, and G. schmidelii. Of these, new records

are G. corollinum for Argentina, G. arenarium for South America, and G. parvistriatum for

the Americas, and G. campestre var. famatinum is proposed as a new variety. Each taxon

is described, and photographs of basidiomes and SEM micrographs illustrating spores are

provided for selected taxa.

Key worps— Geastrales, mycobiota, Phallomycetidae, taxonomy

Introduction

The genus Geastrum (earthstars) is characterized by subspherical to

spherical basidiomes having a central axis (columella) surrounded by a mass

of fertile tissue (gleba) contained within an inner (endoperidium) and outer

(exoperidium) layer. Spores are liberated through a single apical pore (in the

endoperidium) surrounded by a highly variable structure called the peristome.

At maturity, the exoperidium splits into a variable number of rays, which give

Geastrum basidiomes their characteristic star-shape. These exoperidial rays

serve to protect the endoperidial body and facilitate spore dispersal. With their

unique morphology, Geastrum species represent the evolution of one of the

more specialized basidiome forms found among the gasteroid fungi.

The present paper focuses on Geastrum species that were collected during

survey of gasteroid fungi of the La Rioja province of northwestern Argentina.

La Rioja belongs to the Monte biogeographical province, which is defined

as a xeric biome (80-200 mm annual rainfall) based on its vegetation and

146 ... Kuhar, Castiglia & Papinutti

physiognomy (Roig 1998; Roig-Jufent 2001). The predominant vegetation

is a shrub steppe, which is a characteristic endemic flora mainly represented

by vascular plant species in the Zygophyllaceae (e.g., Larrea, Bulnesia, and

Plectrocarpa). Each Geastrum taxon recovered in the survey is described and

discussed, and selected taxa are illustrated.

Materials & methods

This work is based on specimens collected by L. Papinutti and G. Rolén and deposited

in the University of Buenos Aires Herbarium (BAFC). Capillitial threads and spores

were observed under light (mounted in KOH 3% w/v) or scanning electron (Zeiss DSM

982 Gemini) microscopy. At least 20 measurements were made to estimate the size

of microscopic and macroscopic elements. Macroscopic measures were made on dry

basidiomes. All spore measurements citing the diameter include the ornamentation.

Colors were described in well-preserved dry specimens and indicated following Maerz

& Paul (1930). Bates (2004), Dominguez de Toledo (1989), Sunhede (1989), Soto &

Wright (2000), Ponce de Leon (1968), Calonge (1998) and Zamora & Calonge (2007)

were used as standard references in the determination of collections.

Taxonomy

Geastrum arenarium Lloyd, Geastrae: 28 (1902, as“ Geaster arenarius”). Fics lc, 2a

Mature basidiomes 20-30 mm wide; exoperidium arched, splitting

in 10-12 subequal arching, revolute, hygroscopic rays; mycelial layer

encrusting fine particles of debris and sand; fibrous layer creamy white (2A1);

pseudoparenchymatous layer whitish to pallid brown (14C7) when immature,

rimulose in age; endoperidial body 5-12 mm wide almost sessile, globose,

slightly pruinose, pallid brown (14C7); apophysis reduced; peristome fibrillose,

conical, delimited, darker, concolorous, or lighter than the surrounding

endoperidium; gleba brown (7H10), cottony.

Spores globose, 2.5-3.7 um wide, verrucose, with a short apiculus that is

difficult to discern due to the dense covering of mammiform verrucae.

SPECIMEN EXAMINED—ARGENTINA. La_ Rioja: Miranda, 28°28'33.68"S

67°42'27.55"W, gregarious on abundant leaf litter under Prosopis sp. (Mimosaceae),

27.111.2008, leg. L. Papinutti & G. Rolén (BAFC 51925).

ComMENTs—Although most basidiomes exhibited hygroscopic rays, sub-

hygroscopic rays were also observed. A very short stalk was observed in some

dry specimens similar to North American material described by Bates (2004;

referred to by the author as “+ sessile”), while other specimens were entirely

sessile. Geastrum arenarium may be confused with other hygroscopic species,

G. corollinum and G. floriforme, from La Rioja. However, these taxa have larger

spores than G. arenarium and a mycelial layer not strongly encrusted with sand

and debris. This is the first record of this species for Latin America.

Geastrum in Argentina ... 147

aX A

FIGURE. 1: a. G. corollinum. b. G. floriforme. c. G. arenarium. d. G. parvistriatum. e. G. saccatum. f.

G. hieronymi. g. G. campestre var. famatinum. h. G. glaucescens. Scale bars = 1 cm.

148 ... Kuhar, Castiglia & Papinutti

fo Bs

ye his a é

y DENS See BR “

FiGurRE. 2: SEM micrographs of spores. a. G. arenarium. b. G. hieronymi. c. G. glaucescens.

d. G. parvistriatum. e. G. aff. lloydianum. f. G. pampeanum var. pampeanum. Scale bars: a, c-f = 4

um; b = 2 um.

Figure. 3: SEM micrographs of G. campestre var. famatinum spores.

Scale bars: a= 1 um; b = 5 um.

Geastrum in Argentina... 149

Geastrum campestre var. famatinum Kuhar & Papinutti, var. nov. Fics 1g, 3

MycoBank MB 563048

Differt a typo Geastri campestris magnitudine sporarum valde minore.

Type: Argentina. La Rioja: Famatina Department, Pituil, 28°34'47.94"S 67°27'59.42"W

under Prosopis sp., 27.11.2008, leg. L. Papinutti & G. Rolén, (holotype,, BAFC 51926).

ErymMo_oey: from the name of the geographic department of the type locality.

Expanded basidiomes 20-35 mm wide; exoperidium arched, splitting in 9-12

subequal rays, revolute and curving under the endoperidial body, weakly

hygroscopic; mycelial layer encrusted with abundant debris, peeling off toward

the ray tips with age but persisting in the rest of the endoperidium; fibrous

layer light colored (12G7) and smooth; pseudoparenchymatous layer dirty

dark brown (8E8), peeling off of the fibrous layer in an irregular manner;

endoperidial body 10-18 mm wide globose with a very short stalk, verrucose

and slightly pruinose, grey (14A3), laterally compressed in some specimens;

apophysis visible; peristome definite, plicate, conic, concolorous with the

surrounding endoperidium; gleba dark brown (8A11), cottony.

Spores globose, 3.5-4.2 um wide, verrucose.

ComMENTS— This collection agrees very precisely with published descriptions

of G. campestre, but the spores are much smaller than those measured by

Sunhede (1989; 6.5-8 um), Ponce de Leén (1968; 5-6 um) and Bates (2004;

6.4-8 um). Dominguez de Toledo (1989), in her prospection of Cérdoba and

La Pampa provinces (Argentina), reported some collections of G. campestre

having, on average, half the spore size than is typical for this species. Soto

& Wright (2000), who described very similar basidiomes, treated them as

G. ambiguum due to the smaller spore size. Sunhede (1989), who carefully

studied type material of G. ambiguum deposited at Kew, concluded that it

is a synonym of G. campestre. Another similar species is G. smithii, which

differs from G. campestre in having spores more densely covered with shorter

verrucae, a rimose pseudoparenchymatous layer, and a peristome surrounded

by a depressed area. The granulose endoperidium is a striking characteristic

that clearly differentiates G. campestre from other similar species. Since the

La Rioja collection fits the macromorphological description of G. campestre

reported in Sunhede (1989) but with considerably smaller spores, we propose

this as a new variety.

Geastrum corollinum (Batsch) Hollds, Gasteromyc. Ungarns: 62 (1904, as “Geaster

corollinus”). Rig: Ta

Basidiomes small to very small 6-19 mm wide; exoperidium saccate to slightly

arched, very hard in old specimens, splitting into 8-11 strongly hygroscopic

rays that cover the endoperidial body; mycelial layer encrusting debris but soon

peeling off; fibrous layer whitish grey (5A8); pseudoparenchymatous layer very

150 ... Kuhar, Castiglia & Papinutti

persistent, turning brown to dark brown (8L6) in old specimens; endoperidial

body sessile, globose, greyish beige (12B4); peristome fibrillose, delimited;

mature gleba brown (7A11).

Spores globose, 4.0-5.0 um wide, verrucose, with some verrucae coalescing

at their apices; apiculus distinct.

SPECIMENS EXAMINED—ARGENTINA. La Rroja: Santa Cruz, 28°28'35.11"S

67°41'54.45"W, gregarious on abundant leaf litter under Prosopis sp., 27.III.2008, leg. L.

Papinutti & G. Rolon (BAFC 51927); 28°28'42.14"S 67°42'32.31" W, among litter under

Prosopis sp., 27.11.2008, leg. L. Papinutti & G. Rolon (BAFC 51928); 28°28'42.15"S

67°42'49.79"W, on abundant leafy litter under Prosopis sp. near a dry river, 28.11.2008,

leg. L. Papinutti & G. Rolon (BAFC 51929).

ComMENTS— Although fruit body size is homogeneous within each of our

collections, the variation among different collections is high. Sunhede (1989)

clearly illustrates the variability of this character. Geastrum corollinum and

G. glaucescens are the most frequent species found in our survey of this province.

This is the first report of G. corollinum for Argentina.

Geastrum fimbriatum Fr., Syst. Mycol. 3(1): 16 (1829, as “Geaster fimbriatus”).

Basidiomessmallto medium sized 20-25 mm wide; exoperidium often saccate,

splitting from about the middle in 6-10 non-hygroscopic to sub-hygroscopic

rays with light margins; mycelial layer encrusting debris but peeling off in some

specimens; fibrous layer light beige (4C7) on both sides in fresh specimens,

becoming denuded and whitish in older ones; pseudoparenchymatous layer

becoming brownish in age (7A11); endoperidial body 9-11 mm wide greyish

brown (8C11), sessile, globose to depressed globose; peristome fibrillose, not

delimited, sometimes slightly protruding; gleba brown (8L6).

Spores globose, 3.5-4.0 um wide, verrucose with <0.4 um long columnar

verrucae; capillitial hyphae thick walled.

SPECIMEN EXAMINED—ARGENTINA. La_ Rioja: Guanchin, 29°09'40.98"S

67°39'40.37"W, gregarious, on finely particulated debris of diverse plant species,

27.111.2008, leg. L. Papinutti & G. Rolén (BAFC 51930).

COMMENTS—Geastrum fimbriatum, one of the most widely distributed species

in the genus, has been cited in Europe (Sunhede 1989; Calonge 1998), North

America (Bates 2004), and Latin America (Leite et al. 2007; Pereira et al. 2009;

Calonge et al. 2005), including Argentinas Buenos Aires province (Soto &

Wright 2000). This is the first record for La Rioja province.

Geastrum floriforme Vittad., Monog. Lycoperd.: 23 (1842, as “Geaster floriformis”).

Fic. 1b

Basidiomes small to very small, 5-10 mm wide, hypogeous prior to

opening; exoperidium saccate to slightly arched when fresh, very hard when

dry, splitting in about 6-11 strongly hygroscopic rays, these covering the

Geastrum in Argentina... 151

endoperidial body in the dry state; mycelial layer encrusting debris but peeling

off early in the development of the basidiome; fibrous layer greyish (4A1);

pseudoparenchymatous layer very persistent, turning brown (8L6) to dark

brown in old specimens; endoperidial body 3-6 mm wide, sessile light brown

(14E7); peristome fibrillose not delimited; apophysis absent; gleba brown

(7A11).

Spores globose, 5.0-5.5 um wide, verrucose with short irregularly shaped

verrucae; apiculus distinct.

SPECIMEN EXAMINED— ARGENTINA. La Rioja: Santa Cruz, 29°20'45.54"S

67°42'22.16"W, on Larrea divaricata and Baccharis sp. leaf litter, 27.11.2008, leg. L.

Papinutti & G. Rol6n (BAFC 51931).

ComMMENTS—In Argentina G. floriforme was documented from Cordoba and

Catamarca provinces (Dominguez de Toledo, 1989) and Buenos Aires province

(Soto & Wright 2000). This is a first record for La Rioja.

Geastrum glaucescens Speg., An. Mus. Nac. Bs. As. 23: 14

(1912, as “Geaster’). Fics 1h, 2c

Mature basidiomes 11-24 mm wide; exoperidium weakly arched, splitting in

9-10 subequal involute sub-hygroscopic rays; mycelial layer encrusted with fine

debris, fibrous layer whitish; pseudoparenchymatous layer greyish beige in age

(5A8), breaking tangentially at the base of the rays; pseudoparenchymatous layer

and endoperidial body covered with abundant persistent white mesoperidial

matter; endoperidial body 5-10 mm wide, stalked, globose, surface slightly

pruinose, concolorous with the inner exoperidial surface (7A10 to 6A7); stalk

white, 1 mm long; apophysis absent; peristome plicate, conical, delimited,

concolorous to dark brown at the very tip; gleba brown (7H12), cottony.

Spores globose, 3.5-4.5 um wide, with a short apiculus that is difficult to

discern due to the covering of short mammiform verrucae.

SPECIMENS EXAMINED— ARGENTINA. La Roja: Santa Cruz, 29°20'45.54"S

67°42'22.16"W, solitary, on leaf litter of Larrea divaricata and Baccharis sp., 27.I11.2008,

leg. L. Papinutti & G. Rolon (BAFC 51932); Chilecito, 29°09'11.20"S 67°29'34.18"W,

abundant, gregarious, on leaf and particulated debris under Prosopis sp., 15.IV.2009,

leg. L. Papinutti & G. Rolén (BAFC 51933); Chamical, 30°20'18.74"S 66°20'23.79"W,

on leaf litter of L. divaricata, 2.IV.2007, leg. L. Papinutti & G. Rol6n (BAFC 51934);

30°22'21.10"S 66°17'03.90"W, on leaf litter of Prosopis sp., 2.IV.2007, leg. L. Papinutti &

G. Rolén (BAFC 51935).

ComMENTS— As Soto & Wright (2000) stated, G. glaucescens resembles small

basidiomes of G. striatum; however, that species lacks the ring-like apophysis

and has larger distinctly ornamented spores. Another similar species found in

La Rioja is G. parvistriatum, which can be distinguished by larger basidiome

size, larger spores with a less densely distributed ornamentation, and a

subglobose, flattened, or ovoid endoperidial body. The G. parvistriatum stipe is

152 ... Kuhar, Castiglia & Papinutti

much longer and darker than in G. glaucescens. Geastrum minimum also shows

similarities but differs from G. glaucescens in its a strongly arched exoperidium,

fibrillose peristome, less pruinose endoperidial surface, conspicuous apophysis,

and larger spore size. This is the first record of G. glaucescens from La Rioja,

although Spegazzini’s type collection was collected in Buenos Aires province.

Geastrum hieronymi Henn., Hedwigia 36: 211 (1897, as “Geaster”). Fics 1f, 2b

Basidiomes medium sized 30-70 mm wide when fully open; exoperidium

splitting from the middle (or deeper in some specimens) into mostly 6-8

acute rays, sometimes revolute, but not hygroscopic; mycelial layer persistent,

brown, encrusting debris; fibrous layer light beige (11B3) when denuded;

pseudoparenchymatous layer dark brown when dry (8H7); endoperidial

body 20-30 mm wide, dirty bronze grey (15C8), subglobose, with a short

stalk, asperate; apophysis prominent; peristome not delimited, fibrillose; gleba

bordeaux (8L12).

Spores globose, 3.5-4.5 um wide, verruculose.

SPECIMEN EXAMINED— ARGENTINA. La Rioja: Miranda, 29°20'51"S 67°42'22.16" W,

on abundant leaf litter and twigs of Prosopis sp., 27.11.2008, leg. L. Papinutti & G. Rol6n

(BAFC 51936).

ComMENTS— This is the first report of G. hieronymi from La Rioja.

Geastrum aff. lloydianum Rick, Brotéria 5: 27 (1906, as “Geaster lloydianus”). Fic. 2e

Basidiomes 35-40 mm wide; exoperidium splitting into 7-9 acute subequal

rays, not hygroscopic; mycelial layer encrusted with sand; fibrous layer

ochraceous (14G8); pseudoparenchymatous layer umber (8H12), cracking and

seceding in places; endoperidial body 15-20 mm wide, subpedicellate or almost

sessile, light beige (5A9), depressed globose, distinctly pitted and roughened

but not truly warted or tomentose; apophysis absent; peristome sulcate, conical,

acute, concolorous or darker than the endoperidium; gleba umber (7H11).

Spores globose, 3.0-4.0 um wide, dark brown, finely verruculose.

SPECIMEN EXAMINED— ARGENTINA. La_ Rioja: Safiogasta, 29°18'43.88"S

67°35'37.95"W, on soil with scarce organic matter, 25.III.2008, leg. L. Papinutti & G.

Rolén (BAFC 51937).

COMMENTS— Our spores agree in size with the cited descriptions, but differ in

the type of ornamentation illustrated for this species by Coker & Couch (1928),

which showed sparse minute verrucae. We regard this collection as Geastrum

aff. lloydianum, but SEM images of the spores from the type material are needed

to clarify this determination. Another key character for this species is the dark

endoperidial body (Ponce de Leon 1968); but a recent report of G. lloydianum

with a yellowish brown endoperidial surface (Trierveiler-Pereira et al. 2011)

suggests that this character can be highly variable.

Geastrum in Argentina... 153

Geastrum pampeanum Speg., Anal. Mus. Nac. Bs. As. 6: 192 (1899,

as “Geaster pampeanus”) var. pampeanum. Fic. 2f

Basidiome 25 mm wide, saccate; exoperidium membranaceous, delicate,

splitting in 5 rays, these helicoidally twisted at tips in the dry state and partially

covering the endoperidial body; mycelial layer sand colored, not encrusted with

debris; fibrous layer light beige (12C5); pseudoparenchymatous layer dark hazel

brown (8H12); endoperidial body 16 mm wide, sessile, hazel brown at maturity

(14B7); peristome fibrillose, delimited, concolorous with the surrounding

endoperidial body; apophysis absent; gleba dark brown (8L11).

Spores globose, 4.5-5.5 um wide, verrucose with regular long (<1 um)

columnar verrucae.

SPECIMEN EXAMINED— ARGENTINA. La_ Ruoja: Chilecito, 29°09'11.20"S

67°29'34.18" W, solitary, on leaf and particulate debris under Prosopis sp., 20.11.2006, leg.

L. Papinutti (BAFC 51939).

ComMENTS— ‘his is the first record of this variety from La Rioja province.

Geastrum pampeanum var. pallidum Speg., Anal. Mus. Nac. Bs. As. 6: 192 (1899,

as “Geaster pampeanus var. pallida”).

Mature basidiomes 12-29 mm wide, saccate; exoperidium non-hygroscopic

splitting into about 5-10 rays; mycelial layer, slightly encrusted with fine

debris; fibrous layer creamy white (2A1); pseudoparenchymatous layer dark

beige (8E12); endoperidial body 6-10 mm wide, sessile, brown at maturity

(7C10); peristome fibrillose, delimited, slightly conic but depressed in dry state,

concolorous with the surrounding endoperidial body; apophysis absent; gleba

dark beige (8C11).

Spores globose, 3.2-4.5 um wide, verrucose with conical to columnar

verrucae.

SPECIMEN EXAMINED— ARGENTINA. La_ Rioja: Chilecito, 29°09'11.20"S

67°29'34.18" W, gregarious, on leaf and particulate debris under Prosopis sp., 20.11.2006,

leg. L. Papinutti (BAFC 51938).

ComMENTS— This is the first record of this variety from La Rioja province.

Geastrum parvistriatum J.C. Zamora & Calonge, Bol. Soc. Micol.

Madrid 31: 140 (2007). Figs 1d, 2d

Mature basidiomes 20-40 mm wide; exoperidium non-hygroscopic, arched,

splitting into 8-11 subequal, acute rays; mycelial layer encrusted with abundant

debris; fibrous layer sand colored (12D6); pseudoparenchymatous layer brown

(7C9), smooth, peeling off to expose the fibrous layer; endoperidial body

8-15 mm wide, stalked, grey to lead (7C7), smooth and always pruinose; stalk

1.5-2.5 mm high, dark brown; apophysis visible in some basidiomes; peristome

conical, plicate-sulcate, well delimited and darker than the endoperidium;

gleba brown (8C10).

154 ... Kuhar, Castiglia & Papinutti

Spores globose, 4.3-5.7 um wide, verrucose with long verrucae that are

frequently coalescent at their apices.

SPECIMEN EXAMINED— ARGENTINA. La Rioja: Santa Cruz, 28°28'35.11"S

67°41'54.45"W, on abundant Prosopis sp. leaf litter, 27.1II.2008, leg. L. Papinutti & G.

Rolén (BAFC 51940).

CoMMENTS—There are no differences between the accurate description of

Zamora & Calonge (2007) and our material. Our collections were also made

on sandy soil, as were the Spanish type material. This is the first report of

G. parvistriatum from the Americas, although G. striatum (and perhaps

G. schmidelii) specimens there should be re-evaluated in light of Zamora &

Calonge (2007).

Geastrum rufescens Pers., Syn. Meth. Fung.: 134 (1801).

Basidiome medium sized, 25 mm wide; exoperidium non-hygroscopic,

arched to saccate, splitting from the middle into 8 rays with light margins;

mycelial layer encrusted with abundant debris; fibrous layer whitish to pale beige

(13D5) only visible in the denuded margins of the rays; pseudoparenchymatous

layer becoming brownish in age (1419); endoperidial body 10 mm wide, globose

to depressed globose, light brown (14E6) when dry; stalked, apophysis present,

peristome fibrillose, not delimited, neither protruding nor thickened; gleba

dark brown (8L6).

Spores globose, 3.5-5.0(-6.0) um wide, verrucose with long columnar

verrucae; capillitial hyphae thick walled.

SPECIMEN EXAMINED— ARGENTINA. La_ Rtoja: Chilecito, 29°09'11.20"S

67°29'34.18"W, on abundant Prosopis sp. leaf litter under Ephedra triandra, 21.11.2006,

leg. L. Papinutti & G. Rolén (BAFC 51941).

ComMENTS—Although our collection contains just one specimen, the perfectly

preserved basidiome exactly fits the descriptions cited above. Soto & Wright

(2000) have already reported G. rufescens from Buenos Aires province, and this

is the first report of the species from La Rioja.

Geastrum saccatum Fr., Syst. Mycol. 3(1): 16. (1828, as “Geaster saccatus”). Fic. le

Basidiomes typically small though some are medium sized, 19-31 mm wide;

exoperidium splitting to about the middle into 6-8(-12) rays of variable shape,

often recurved under the whole basidiome; mycelial layer whitish when not

covered with debris; fibrous layer beige (14K9); pseudoparenchymatous layer

at first white to grey, but soon turning beige to almost dark brown (8H10),

relatively thick, papery, sometimes with longitudinal cracks in older specimens,

peeling off at the margins with age; endoperidial body (3.5-)5-20(-24) mm

wide, globose to depressed globose, sessile or subsessile, pale grey to light beige

(14A5) smooth; apophysis lacking; peristome finely fibrillose, mammiform

Geastrum in Argentina... 155

to almost flat, delimited, concolorous or darker than the endoperidium and

sometimes surrounded by a light colored zone; gleba brown (8H9).

Spores globose, 4.5-6.0 um wide, ornamented with short columnar verrucae

(some apically coalescent).

SPECIMENS EXAMINED— ARGENTINA. La_ Rioja: Miranda, 29°20'45.54"S

67°42'22.16" W, on Prosopis sp. leaf litter, 27.11.2008, leg. L. Papinutti & G. Rol6n (BAFC

51942, 51944); Safiogasta, 29°18'43.88"S 67°35'37.95"W, on finely particulated debris,

27.111.2008, leg. L. Papinutti & G. Rolén (BAFC 51943).

ComMENTS— Although collected in the same locality, the endoperidium color

differs in G. saccatum BAFC 51944 and BAFC 51942. Nevertheless, Sunhede

(1989) described this character as highly variable in this species. This is the first

record of G. saccatum from La Rioja province.

Geastrum schmidelii Vittad., Monog. Lycoperd.: 13. (1842, as “Geaster”).

Expanded basidiomes 18-28 mm wide; exoperidium arched, splitting in

10-12 slightly hygroscopic subequal revolute rays; mycelial layer encrusting

debris, peeling off in aged specimens; fibrous layer light colored (13B4);

pseudoparenchymatous layer brown (7A9), peeling off irregularly; endoperidial

body stalked, globose, papery to finely pruinose, grey to brown (7C9), stalk up

to 2.5 mm, often laterally compressed; apophysis reduced; peristome delimited,

plicate, conic, darker than the surrounding endoperidium; gleba cottony,

brown (8L7).

Spores globose, 4.5-7.0 um wide, verrucose.

SPECIMEN EXAMINED— ARGENTINA. La_ Rioja: Safiogasta, 29°18'51.43"S

67°35'37.36" W, on abundant leaf litter of diverse herbaceous plant species, 27.III.2008,

leg. L. Papinutti & G. Rolén (BAFC 51945).

ComMENTS—Although the collected material (BAFC 51945) matches the

description of Sunhede (1989), some expanded basidiomes exceed the upper

limit indicated in his work and in Bates (2004). This is the first record of

G. schmidelii for La Rioja province.

Acknowledgments

We wish to express our gratitude to Dra. Maria M. Dios and Dr. Scott T. Bates for

reviewing the manuscript and offering useful comments. We thank Guillermo Rolén

for the technical assistance with the figures. This study was supported by a grant from

Consejo Nacional de Investigaciones Cientificas y Técnicas (CONICET) and Universidad

de Buenos Aires, Argentina.

Literature cited

Bates ST. 2004. Arizona members of the Geastraceae and Lycoperdaceae (Basidiomycota, Fungi).

Masters thesis. Arizona State University, Tempe.

Calonge FD. 1998. Gasteromycetes, I. Lycoperdales, Nidulariales, Phallales, Sclerodermatales,

Tulostomatales. Flora Mycologica Iberica. Ed. J. Cramer. 271 p.

156 ... Kuhar, Castiglia & Papinutti

Calonge FD, Mata M, Carranza J. 2005. Contribucidn al catalogo de los Gasteromycetes

(Basidiomycotina, Fungi) de Costa Rica. Anales del Jardin Botanico de Madrid 62: 23-45.

http://dx.doi.org/10.3989/ajbm.2005.v62.i1.26

Coker WC, Couch JN. 1928. The Gasteromycetes of the Eastern United States and Canada. Chapel

Hill, The University of North Carolina Press.

Dominguez de Toledo LS. 1989 Contribucién al conocimiento de Gasteromycetes del centro de

Argentina. Doctoral Dissertation. Universidad Nacional de Cérdoba, Cordoba.

Leite AG, Calonge FD, Baseia IG. 2007. Additional studies on Geastrum from northeastern Brazil.

Mycotaxon 101: 103-111.

Maerz A, Paul MR. 1930. Dictionary of color, 1st edition. McGraw Hill Co, New York.

Ponce de Leon P. 1968. A revision of the family Geastraceae. Fieldiana Bot 31: 302-349.

Roig A. 1998. Vegetacion de la Patagonia. Coleccién Cientifica INTA 8: 48-166.

Roig-Jufent S, Flores G, Claver $, Debandi G, Marvaldi A. 2001. Monte Desert (Argentina):

insect biodiversity and natural areas. Journal of Arid Environments 47: 77-94.

http://dx.doi.org/10.1006/jare.2000.0688

Soto M, Wright JE. 2000. Taxonomia del género Geastrum (Basidiomycetes, Lycoperdales) en la

provincia de Buenos Aires, Argentina. Boletin de la Sociedad Argentina de Botanica 34:

185-202.

Sunhede S. 1989. Geastraceae (Basidiomycotina) morphology, ecology, and systematics with

emphasis on the North European species. Synopsis Fungorum 1: 1-534.

Trierveiler-Pereira L, Silva AC, Baseia IG. 2009. Notes on gasteroid fungi of the Brazilian Amazon

rainforest. Mycotaxon 110: 73-80. http://dx.doi.org/10.5248/110.73

Trierveiler-Pereira L, Calonge FD, Baseia I. 2011. New distributional data on Geastrum (Geastraceae,

Basidiomycota) from Brazil. Acta Botanica Brasilica 25: 577-585.

http://dx.doi.org/10.1590/S0102-33062011000300010

Zamora, J.C.; Calonge, ED. (2007). Geastrum parvistriatum, una nueva especie encontrada en

Espana. Bol. Soc. Micol. Madrid 31: 139-149.

MY COTAXON

http://dx.doi.org/10.5248/122.157

Volume 122, pp. 157-160 October-December 2012

Myxomycetes from China 16:

Arcyodes incarnata and Licea retiformis,

newly recorded for China

Bo ZHANG? & Yu L1'*

‘Engineering Research Center of Chinese Ministry of Education for Edible and Medicinal Fungi,

Jilin Agricultural University, 2888 Xincheng Street, Changchun City, P. R. China

* CORRESPONDENCE TO: yuli966@126.com

ABSTRACT — Two new records for China, Arcyodes incarnata and Licea retiformis, are

reported in this paper. Materials collected from Yunnan and Fujian province are described

and illustrated by scanning electron micrographs. Those specimens are deposited in the

Herbarium of Mycological Institute of Jilin Agricultural University (HMJAU), Changchun,

China.

KEY worDs —taxonomy, slime molds, SEM

Introduction

Our examination of previous myxomycete collections has revealed two

new records for China. One is in Arcyodes, which is currently accepted as a

monotypic genus. The other is in Licea, which now comprises about 71 species

(Kirk et al. 2008, Lado 2001, 2012-14), of which 13 are reported for mainland

China (Chou 1937; Li & Li 1989, 1994; Li 2005) and 11 for Taiwan (Liu et al.

2002).

Materials & methods

Fruiting bodies and microscopic structures were examined using light and scanning

electron microscopes (Martin & Alexopoulos 1969; Lietal. 1993, Li& Li1995). Permanent

slides were mounted in Hoyer’s reagent (Martin & Alexopoulos 1969). Colored slides

were prepared according to Robbrecht (1974) by spreading the capillitium in a drop of

94% alcohol, determining color after one minute, and then mounting in Hoyer’s reagent.

Color terms are given according to the Flora of British Fungi (1969). The specimens are

deposited in the Herbarium of the Mycological Institute, Jilin Agricultural University

(HMJAU).

158 ... Zhang & Li

Taxonomy

PLaTE 1. Arcyodes incarnata: A, fruiting bodies. B, inner surface of peridium. C, D, part of the

capillitium and spores. E, spore. Scale bars: A = 1 mm; B, E= 2um; C = 5 um; D = 10 um.

Arcyodes incarnata (Alb. & Schwein.) O.F. Cook, Science, N.Y. 15: 651, 1902. Pr. 1

SPOROCARPS aggregated, sessile, crowded and heaped, 0.5-0.7 mm in diam.,

fawn, fading to dull ochraceous. HyPOTHALLUS inconspicuous. PERIDIUM

single, membranous, somewhat opalescent, persistent, irregularly dehiscent

above, yellow to colourless by transmitted light, inner surface with many

prominent warts, low irregular ridges, sometime forming a net with small

protuberances. COLUMELLA absent. CAPILLITIUM tubular, elastic, branched

and anastomosed, pale yellow by transmitted light, mostly 4 um in diam., with

numerous inflations, decorated with many cogs and irregular edges, sometimes

with a faint reticulation. Spores free, pale pink in mass, yellowish pale to

colourless by transmitted light, 7-9.5 um in diam., globose to subglobose,

densely warted, with scattered groups of more prominent warts.

SPECIMEN EXAMINED: CHINA, Yunnan Province, Puer, on the bark surface of a dead

log, 28 August 2011, Zhang Bo1101 (HMJAU10301).

COMMENTS: Arcyodes incarnata, which has been recorded from North America,

Europe, and Africa (Martin & Alexopoulos 1969, Lado 1994), is apparently rare

in Asia. The Yunnan specimen has slightly larger spores than the type specimen

Two myxomycetes new to China... 159

(6-8 um in diam.). However, the Yunnan and type specimen are similar in

habitat on dead logs, a pale pink spore mass, faintly reticulate capillitium, and

pale copper-colored sporocarps.

Acc.V Spot Magn ~ Det) WWDxFkp ¢ Acc:V . Maan Det WD» Exp

a20.0 kV 3.0 “4660x . SE TY 3 a y 2 20.0 kV 3

0G NESE, 11:3"1

PLATE 2. Licea retiformis: A, B, fruiting bodies. C, part of peridium. D, spore. Scale bar: A = 1 mm.

Licea retiformis Nawawi, Trans. Br. mycol. Soc. 60(1): 153, 1973. Pu2

FRUCTIFICATIONS plasmodiocarps, gregarious, reticulation 0.6-3 mm in

extension, pale yellowish brown, fading to pale brown. PLASMODIOCARPS

90-100 um in diameter, appearing smooth on the surface. HYPOTHALLUS

inconspicuous. PERIDIUM single, membranous, firm, translucent. DEHISCENCE

by longitudinal slit, decorated with loose small mesh. COLUMELLA absent.

CAPILLITIUM absent. Spores free, pale ochraceous in mass, yellowish pale

to colourless by transmitted light, subglobose to ovate, 9-11 x 8.5-12.5 um,

densely warted.

SPECIMENS EXAMINED: CHINA, Fujian Province, Fuzhou, on the bark surface of a dead

log, 9 July 2010, Li Ming0031 (HMJAU10302); Li Ming0042 (HMJAU10303).

ComMENTs: This is the only Licea species with reticulate plasmodiocarps. Licea

retiformis, which has been reported from Japan (Yamamoto 1998), Malaysia

(Nawawi 1973), and Taiwan (Liu el at. 2002), is here newly recorded from

mainland China. The two Fujian specimens have slightly shorter spores than

the type specimen (9.3-13.5x8.5-12.5 um, Nawawi 1973).

160 ... Zhang & Li

Acknowledgments

We thank Professors. Guozhong Lii and A.J.S. Whalley for their valuable revisions

and kind help. This study was supported by funds from the Ministry of Agriculture of

China.

Literature cited

Chou ZH. 1937. Notes on myxomycetes from China. Bull. Fan. Men. Inst. Biol. 7: 257-278.

Cook OF. 1902. Types and synonyms. Science 15: 646-656.

http://dx.doi.org/10.1126/science.15.382.646

Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi.

10th ed. CAB International, Wallingford. 771 p.

Lado C. 1994. A checklist of myxomycetes of the Mediterranean countries. Mycotaxon 52(1):

117-185.

Lado C. 2001. Nomenmyx: a nomenclatural taxa base of myxomycetes. Cuadernos de Trabajo de

Flora Micoldgica Ibérica 16. 224 p.

Lado C. 2012-14. An online nomenclatural information system of Eumycetozoa.

http://www.nomen.eumycetozoa.com

Li Y. 2005. Liceales in China. Chinese Science Press. 126 p.

Li Y, Li HZ. 1989. Myxomycetes from China I: A checklist of myxomycetes from China. Mycotaxon

35(2): 429-436.

Li Y, Li HZ. 1994. Myxomycetes from China XII: A new species of Licea. Mycosystema 7:

133-135.

Li Y, Li HZ. 1995. Myxomycetes from China III: Description of a new species, Cribraria media, and

discussion of the relationship between Creibraria and Dictydium. Mycotaxon 53: 69-80.

Li Y, Chen SL, Li HZ. 1993. Myxomycetes from China X: Additions and notes to Trichiaceae from

China. Mycosystema 6: 107-112.

Liu CH, Chen YF, Chang JH, Yang FH. 2002. Myxomycetes of Taiwan. Three new records. Taiwania

47(3): 179-185.

Martin GM, Alexopoulos CJ. 1969. The myxomycetes. University of Iowa Press. Iowa. 561 p.

http://dx.doi.org/10.2307/1218569

Nawawi A. 1973. New species of Licea from Malaysia. Tans. Br. Myc. Soc. 60: 153-155.

http://dx.doi.org/10.1016/S0007-1536(73)80072-5

Robbrecht E. 1974. The genus Arcyria Wiggers in Belgium. Bull. Jard. Bot. Nat. Belg. 44: 303-353.

http://dx.doi.org/10.2307/3667676

Royal Botanic Garden, Edinburgh. 1969. Flora of British Fungi: colour identification chart.

Edinburgh, H.M. Stationery Office. 6 p.

Yamamota Y. 1998. The Myxomycetes biota of Japan. Toyo Shorin Publishing Co., Ltd., Tokyo,

Japan. 700 p.

MYCOTAXON

http://dx.doi.org/10.5248/122.161

Volume 122, pp. 161-169 October-December 2012

Tuber microverrucosum and T. huizeanum —

two new species from China with reticulate ascospores

Li FAN’, CHENG-LIN Hou & Yu Lr?

" College of Life Science, Capital Normal University,

Xisanhuanbeilu 105, Haidian, Beijing 100048, China

? Institute of Mycology, Jilin Agricultural University, Changchun 130118, China

*CORRESPONDENCE TO: fanli@mail.cnu.edu.cn

ABSTRACT — Two new species of Tuber are described and illustrated. Tuber microverrucosum

is recognized by its brown verrucose ascomata, blackish gleba, and broadly ellipsoid to

subglobose ascospores with a large-meshed regular reticulum. Tuber huizeanum is diagnosed

by its brown glabrous ascomata, brown gleba, and broadly ellipsoid ascospores with a regular

reticulum. Molecular phylogenetic analysis supports the erection of the two new species.

Key worps — Ascomycota, truffle, taxonomy

Introduction

Truffles are abundant in some regions of China (Garcia-Montero et al. 2010,

Wang & Liu 2011, Chen et al. 2011a,b) from which more than 20 species have

been described during the 25 years since Liu described Tuber taiyuanense

B. Liu in 1985 (Liu 1985; Wang 1988; Wang & Li 1991; Wang et al. 1998; Wang

& He 2002; Tao et al. 1989; Chen et al. 2005; Chen & Liu 2007). Of these more

than half are considered valid species (Cao 2010). That there are likely more

new species awaiting discovery in China is confirmed by our ongoing research

(Fan et al. 2011, 2012a,b). We describe and illustrate here two additional new

species from Yunnan.

Materials & methods

Morphological studies

Truffles were collected from Huize County and a mushroom market in Kunming,

Yunnan Province. Macroscopic characters were described from fresh specimens.

Microscopic characters were described from razor-blade sections of fresh specimens

162 ... Fan, Hou & Li

TABLE 1. Tuber specimens used in molecular studies

VOUCHER CounTRY OF REFERENCE ITS

SPECIES NAME

SPECIMEN ORIGIN

T. borchii Vittad. GB62 Italy Bonito et al. 2010 HM485342

GB45 Italy Bonito et al. 2010 HM485344

T. canaliculatum Gilkey JT23942 USA From GenBank GQ221456

(unpublished)

OSC59072 USA Bonito et al. 2010 HM485347

T. foetidum Vittad. ZB-2489 Hungary Halasz et al. 2005 AJ557544

ZB3454 Finland Orczan et al. 2010 FN568055

T. gardneri Gilkey TK1779 USA From GenBank AY558808

(unpublished)

T. huizeanum BJTC FAN144 China This paper JN870100

BJTC FAN186 China This paper JQ910651

T. linsdalei Gilkey L63 USA Bonito et al. 2010 HM485370

T. liui AS. Xu HKAS 48269 China Chen & Liu 2007 DQ898182

T. maculatum Vittad. FHS-390 Serbia Marjanovic et al. FM205649

2010

K(M) 17936 — Brock et al. 2009 EU784428

T. microverrucosum BJTC FAN142 China This paper JN870099

T. puberulum TL11885 Denmark Tedersoo et al. 2006 AJ969626

Berk. & Broome

BI-32 Hungary Halasz et al. 2005 AJ557537

T. separans Gilkey ZB-32 Hungary Halasz et al. 2005 HM485388

JT32463 Mexico From GenBank GQ221448

(unpublished)

T. scruposum R. Hesse CMI-UNIBO Armenia From GenBank DQ011846

2192 (unpublished)

CMI-UNIBO Armenia From GenBank DQ011845

2201 (unpublished)

T. zhongdianense X.Y. HKAS 45388B China Chen & Liu 2007 DQ898186

He et al.

Wang0299 China Chen & Liu 2007 DQ898187

T. melanosporum Vittad. A59 France From GenBank AF106878

(unpublished)

— — Roux et al. 1999 AF132501

mounted in 3% KOH, Melzer’s reagent, or 0.1% (w/v) cotton blue in lactic acid. The

specimens are deposited in BJTC (Biology Department Herbarium, Capital Normal

University). For scanning electron microscopy (SEM), spores were scraped from the

dried gleba, placed onto doubled-sided tape, mounted directly on an SEM stub, coated

with gold-palladium, and then examined and photographed with a HITACHI S-4800

SEM.

Tuber spp. nov. (China) ... 163

Molecular methods

Herbarium samples were crushed by shaking for 3 min at 30 Hz (Mixer Mill MM

301, Retsch, Haan, Germany) ina 1.5 ml tube together with one 3 mm diameter tungsten

carbide ball. Total genomic DNA was then extracted using the PeqLabE.Z.N.A._ Fungal

DNA kit following the manufacturer's protocol. The ITS region was amplified with

PCR using the primers ITS1/ITS4 (White et al. 1990). PCR was performed in 50 ul

reactions containing DNA template 2 ul, primer (10UM) 2 ul each, 2 x Master Mix

(Tiangen Biotech (Beijing) Co. Ltd.) 25 ul. PCR reactions were run as follows: an initial

denaturation at 95°C for 3 min, followed by 30 cycles at 95°C for 2 min, 55°C for 25 s,

72°C for 2 min, and a final extension at 72°C for 10 min. The PCR products were sent

to Invitrogen Biotechnology Co. Ltd. (Beijing, China) for purifying, sequencing, and

editing. The other sequence data of ITS rDNA included in this study were downloaded

from GenBank. GenBank numbers are shown in TABLE 1.

Phylogenetic analyses

DNA sequences were aligned with Clustal X (Thompson et al. 1997) and manually

adjusted with Se-Al v.2.03a (Rambaut 2000). The aligned dataset was analyzed with

maximum parsimony (MP) using PAUP*4.0b10 (Swofford 2002). MP analysis was

conducted using heuristic searches with 1000 replicates of random-addition sequence,

tree bisection reconnection (TBR) branch swapping algorithm. All characters were

equally weighted and unordered. Gaps were treated as missing data to minimize

homology assumptions. A bootstrap (BS) analysis was performed with 1000 replicates,

each with 10 random taxon addition sequences. TBR branch swapping was employed.

The Bayesian analysis was performed with MrBayes 3.1.2 (Huelsenbeck et al. 2001;

Ronquist & Huelsenbeck 2003) with two sets of four chains (one cold and three heated)

and the stoprule option in effect, halting the analyses at an average standard deviation

of split frequencies of 0.01. The sample frequency was set to 100, and the first 25% trees

were removed as burn-in. Bayesian posterior probabilities (PP) were obtained from the

50% majority rule consensus of the remaining trees. Two sequences derived from Tuber

melanosporum (AF132501, AF106878) were used as outgroups.

Results

Molecular phylogenetics

343 of 634 characters were found to be parsimony-informative. Maximum

parsimony analysis produced one most parsimonious tree (FiG.1) with a length

(TL) of 907 steps, consistency index (CI) of 0.7310, retention index (RI) of

0.8501, and rescaled consistency index (RCI) of 0.6214 (for all sites).

ITS sequence-based phylogenies (Fic. 1) group the new Tuber

microverrucosum in a clade with T! foetidum with moderate support (BS = 74,

PP = 0.99). The two T. huizeanum sequences grouped in a clade with strong

support (BS = 99, PP = 1.00) and were sister (but with very low support) to

T. zhongdianense.

164 ... Fan, Hou & Li

+00 Tuber puberulum AJ969626

400 Tuber puberulum AJ557537

a8 1 |, Tuber borchii HM485344

1S) 4 8871 Tuber borchii HM485342

Tuber separans HM485388

ee Tuber separans GQ221448

7-| 99) Tuber huizeanum JQ910651

Tuber huizeanum JN870100

89 | 400 Tuber zhongdianense DQ898187

0.95-¥! 4%

gel Tuber zhongdianense DQ898186

Wee Tuber liui DQ898182

400 Tuber latisporum DQ898185

99 1! Tuber latisporum DQ898183

oN Tuber foetidum AJ557544

ooas| | Tuber foetidum FN568055

Tuber microverrucosum JQ870099

99 EN Tuber maculatum FM205649

Tuber maculatum EU784428

Tuber gardneri AY558808

aS +00 Tuber scruposum DQ011846

99 1 | Tuber scruposum DQ011845

Tuber linsdalei HM485370

400 Tuber canaliculatum HM485347

1 | Tuber canaliculatum GQ221456

Tuber melanosporum AF132501

Hated melanosporum AF 106878

Fic. 1. Phylogeny derived from maximum parsimony analysis of the ITS rDNA sequences of some

Tuber species with reticulate ornamentations on the ascospore surface, using T: melanosporum as

outgroups. Bootstrap values of more than 70% (BP = 70) from 1000 replications are shown above

the respective branches. Bayesian posterior probabilities (PP) were estimated and clades with PP >

0.95 (95%) are marked under the branches.

Tuber spp. nov. (China) ... 165

Taxonomy

Tuber microverrucosum L. Fan & C.L. Hou, sp. nov. Fig. 2 a-d

MycoBank MB 563657

Differs from other Tuber species with reticulate ascospores by its brown verrucose

ascomata, blackish gleba, and broadly ellipsoid ascospores.

Type: China. Yunnan Province, Kunming, from the Kunming mushroom market. 20

Jan. 2011, Jin-Zhong Cao 105 (Holotype, BJTC FAN142).

ETYMOLOGY: microverrucosum (Lat.), referring to the minute verrucose surface of the

ascomata.

AscomMa globose or irregular subglobose, 2.2 cm in diam., light brown to brown

when fresh, the surface glabrous and distinctly minute verrucose, the places

without verrucose show gray-brown or pale gray. Odor slight when young

and middle pungent after maturity. PERrpIuM 250-400 um thick including

the verrucose, two layers; outer layer pseudoparenchymatous, composed

of subglobose and angular cells (7.5-)10-20(-25) um in diam, with slightly

thickened walls, yellowish-brown towards the surface; inner layer texture

intricate, the hyphae hyaline and thin walled, 5-7.5 um in diam. GLEBA white

at first, then brown to dark brown and blackish at maturity, marbled with larger

and rare pale white veins which originate from all of the peridium. Ascr ovate

or subglobose, sessile, 75-100 x 50-75 um, (1-)2-4(-6)-spored. ASCOSPORES

broadly ellipsoid to subglobose, a few globose, at first hyaline, becoming brown

to dark brown at maturity, thick-walled 2.5-3 um, surface ornamented with

regular reticulum, 4-6(-7.5) um high, 25-32.5 x 20-27.5 um, Q = 1.10-1.25,

in 2-6-spored asci, and 37.5-42.5 x 27.5-32.5 um, Q = 1.30-1.36, in 1-spored

asci, excluding the ornamentation, the meshes large and variable in size, usually

3-4 meshes across the width.

ComMENTs — Tuber microverrucosum is distinguished by its brown ascomata

with minutely distinct verrucose surface, blackish gleba, and broad ellipsoid to

subglobose ascospores covered with regular deep reticulum.

Two European species, Tuber foetidum and T: scruposum, are similar to the

new species. Tuber foetidum differs in having a smooth or indistinctly verrucose

peridium, a pale brown gleba and yellow-brown ascospores (Pegler 1993),

whereas T. scruposum has a distinct verrucose peridium, and narrow elliptical

ascospores (Lange 1956).

Several North American species that also have verrucose ascomata and

reticulate ascospores include T: canaliculatum, T. linsdalei, T: longisporum

Gilkey, and T’ gardneri. Tuber canaliculatum differs in large (>50 um long)

ascospores (Gilkey 1954), while T: linsdalei has subglobose ascospores and a

reticulum with numerous small meshes (“alveoli small and numerous’; Gilkey

166 ... Fan, Hou & Li

1954). Long ellipsoid ascospores distinguish Tuber longisporum and T. gardneri

from T: microverrucosum.

ITS sequence analyses (Fic. 1) support erection of T: microverrucosum. Tuber

microverrucosum and T. foetidum grouped in the same clade with moderate

support value (BS = 74, PP = 0.99), indicating that they are closely related but

morphologically quite distinct.

Tuber huizeanum L. Fan & Yu Li, sp. nov. FIG. 2 e-i

MycoBank MB 563658

Differs from other Tuber species by its brown glabrous ascomata, brown colored gleba,

and very broadly ellipsoid ascospores with a regular reticulum.

Type: China. Yunnan Province, Huize County, in soil under conifers, 28 Dec. 2011, Jin-

Zhong Cao 513 (Holotype, BJTC FAN186).

EryMo_oey: huizeanum (Lat.), referring to the type locality of the new species.

ASCOMATA 1.5-2.0 cm, subglobose, solid, surface smooth, glabrous, sometimes

with a few furrows, white to yellow-white at first, light brown to brown at

maturity. Odor slight, not pungent. PERrpIum 350-400 um thick, two layers;

outer layer 100-150 um, pseudoparenchymatous, composed of subangular

or subglobose cells mostly 10-25(55) um, with slightly thickened and light

yellowish walls, hypha-like hairs absent from the outermost cells; inner layer

composed of intricately interwoven hyphae, hyaline, thin-walls, branch, septate,

2.5-5 um, intermixed with a few of hyphae up to 10 um in diam. GLEBA brown

at maturity, marbled with large and rare, branch white veins coming from

the peridium. Asc1 subglobose, ellipsoid or irregular, hyaline, slightly thick-

walled, 80-115 x 75-100 um, sessile, 1-4-spored. Ascospores subglobose to

very broad ellipsoid, a few of globose, light brown to yellow-brown at maturity,

27.5-42.5 x 25-40 um, Q = 1.06-1.15, in 2-4-spored asci, and 50-55 x 42.5-45

um, Q = 1.10-1.25, in 1-spored asci, excluding ornamentation; ornamentation

regularly alveolate reticulum, 3-5 um high, the meshes generally 4-8(10) across

the spore width.

ADDITIONAL MATERIAL EXAMINED: CHINA. YUNNAN PROVINCE, Kunming, from the

Kunming mushroom market. 20 Jan. 2011, Jin-Zhong Cao 107 (BJTC FAN144).

ComMENTS — Three species from China are similar to the new species. Tuber

zhongdianense has similarly colored ascomata and shaped ascospores as

T. huizeanum. However, T. zhongdianense ascomata are obviously puberulent

with two types of hairs and the ascospore reticulum is only 2.5 um high (He

et al. 2004). These two characters clearly distinguish the two species. Tuber

liui differs by its large (38-71 x 27-40 um) and ellipsoid to long ellipsoid

ascospores (Xu 1999) and a peridium with hypha-like hairs. Tuber latisporum

is differentiated by its white ascomata, blackish gleba, red brown ascospores,

and a peridium covered with hypha-like hairs.

Tuber spp. nov. (China) ... 167

Fic. 2. Tuber microverrucosum (BJTC FAN142, holotype): a. Ascoma; b-c. Asci and ascospores

observed under light microscope; d. Ascospore observed under SEM. Tuber huizeanum (BJTC

FAN186, holotype): e-f. Ascoma; g-h. Asci and ascospores observed under light microscope;

i. Ascospore observed under SEM.

168 ... Fan, Hou & Li

The similar European T’ puberulum can be separated by its ascomata with

abundant surface hairs and globose ascospores. Tuber borchii has similar

ascospores but differs by its dark chocolate brown mature gleba and puberulent

peridium. The North American T! separans is distinguished by its inconspicuous

glebal veins (Gilkey 1954).

Phylogenetic analyses (Fic. 1) support the erection of T’ huizeanum. The

morphologically similar T! huizeanum and T. zhongdianense form a sister

relationship in the phylogeny but with low support (Fic. 1).

Acknowledgments

We are grateful to Prof. Zhu-Liang Yang (Kunming Institute of Botany of the Chinese

Academy of Sciences) and Dr. Ian R. Hall (Truffles and Mushrooms (Consulting) Ltd,

New Zealand) for reviewing the pre-submitted manuscript. The study was supported by

the National Natural Science Foundation of China (Nos. 30770005 and 30870008), and

the Beijing Natural Science Foundation (No. 5122003).

Literature cited

Bonito GM, Gryganskyi AP, Trappe JM, Vilgalys R. 2010. A global meta-analysis of Tuber ITS

rDNA sequences: species diversity, host associations and long-distance dispersal. Molecular

Ecology 19: 4994-5008. http://dx.doi.org/10.1111/j. 1365-294X

Brock PM, Doring H, Bidartondo MI. 2009. How to know unknown fungi: the role of a herbarium.

New Phytol. 181: 719-724. http://dx.doi.org/10.1111/j.1469-8137.2008.02703.x

Cao JZ. 2010. The genus Tuber in China [Dissertation]. Changchun: Jinlin Agricultural University.

86 p.

Chen J, Liu PG. 2007. Tuber latisporum sp. nov. and related taxa, based on morphology and DNA

sequence data. Mycologia 99: 475-481. http://dx.doi.org/10.3852/mycologia.99.3.475

Chen J, Liu PG, Wang Y. 2005. Tuber umbilicatum, a new species from China, with a key to the

spinose-reticulate spored Tuber species. Mycotaxon 94: 1-6.

Chen J, Guo SX, Liu PG. 2011a. Species recognition and cryptic species in the Tuber indicum

complex. PLoS ONE 6(1): e14625. http://dx.doi.org/10.1371/journal.pone.0014625

Chen J, Deng XJ, Chen JY, Qiao P, Zhang JP, Wan S, Wang R, Liu PG. 2011b. A checklist of the

genus Tuber (Pezizales, Ascomycota) in China. Journal of Fungal Research 9: 243-254.

Fan L, Cao JZ, Liu YY, Li Y. 2011. Two new species of the genus Tuber from China. Mycotaxon 116:

349-354. http://dx.doi.org/10.5248/116.349

Fan L, Hou CL, Cao JZ. 2012a [“2011”]. Tuber sinoalbidum and T. polyspermum — new species

from China. Mycotaxon 118: 403-410. http://dx.doi.org/10.5248/118.403

Fan L, Cao JZ, Zheng ZH, Li Y. 2012b. Tuber in China: T: microspermum and T. microspiculatum

spp. nov. Mycotaxon 119: 391-395. http://dx.doi.org/10.5248/119.xxx

Garcia-Montero LG, D1‘az P, Di Massimo G, Garcia-Abril A. 2010. A review of research on Chinese

Tuber species. Mycological Progress 9: 315-335. http://dx.doi.org/10.1007/s11557-009-0647-8

Gilkey HM. 1954. Taxonomic notes on Tuberales. Mycologia 46: 783-793.

Halasz K, Bratek Z, Szego D, Rudnoy S, Racz I, Lasztity D, Trappe JM. 2005. Tests of species

concepts of the small, white, European group of Tuber spp. based on morphology and

rDNA ITS sequences with special reference to Tuber rapaeodorum. Mycol. Prog. 4: 281-290.

http://dx.doi.org/10.1007/s11557-006-0132-6

He XY, Li HM, Wang Y. 2004. Tuber zhongdianense sp.nov. from China. Mycotaxon 90:213-216.

Tuber spp. nov. (China) ... 169

Huelsenbeck JP, Ronquist F, Nielsen R. Bollback JP. 2001. Bayesian inference of phylogeny and its

impact on evolutionary biology. Science 294: 2310-2314.

http://dx.doi.org/10.1126/science.1065889

Lange M. 1956. Danish hypogeous fungi. Dansk Bot. Arkiv. 16: 1-48.

Liu B. 1985. New species and new records of hypogeous fungi from China (I). Acta Mycologica

Sinica 4(2): 84-89.

Marjanovié Z, Grebenc T, Markovic M, Glisi¢é A, Milenkovié M. 2010. Ecological specificity and

molecular diversity of truffles (genus Tuber) originating from mid-west of the Balkan Peninsula.

Sydowia 62: 67-87.

Orczan KA, Turunen O, Merenyi Z, Rudnoy S, Bratek Z, Shamekh S. 2010. Tuber foetidum found

in Finland. Mycotaxon 114: 127-133. http://dx.doi.org/10.5248/114.127

Pegler DN, Spooner BM, Young IWK. 1993. British truffles: a revision of British hypogeous fungi.

UK: Royal Botanic Gardens, Kew, p1-216.

Rambaut A. 2000. Estimating the rate of molecular evolution: incorporating non-contemporaneous

sequences into maximum likelihood phylogenies. Bioinformatics 16: 395-399. http://dx.doi.

org/10.1093/bioinformatics/16.4.395

Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed

models, Bioinformatics 19:1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180

Roux C, Sejalon-Delmas N, Martins M, Parguey-Leduc A, Dargent R. Becard G. 1999. Phylogenetic

relationships between European and Chinese truffles based on parsimony and distance analysis

of ITS sequences. FEMS Microbiol. Lett. 180: 147-55.

http://dx.doi.org/10.1111/j.1574-6968.1999.tb08789.x

Swofford DL. 2002. PAUP”, phylogenetic analysis using parsimony. (*and other methods), version

4. Sunderland, MA, USA, Sinauer Associates.

Tao K, Liu B, Zhang DC. 1989. A new species of the genus Tuber from China. Journal of Shanxi

University (Nat. Sci. Ed.) 12: 215-218.

Tedersoo L, Hansen K, Perry BA, Kjoller R. 2006. Molecular and morphological diversity of

pezizalean ectomycorrhiza. New Phytol. 170: 581-596.

http://dx.doi.org/10.1111/j.1469-8137.2006.01678.x

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTALX windows

interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.

Nucleic Acids Res. 24: 4876-4882. http://dx.doi.org/10.1093/nar/25.24.4876

Wang Y. 1988. First report of study on Tuber species from China. Atti del II Congresso Internazionale

sul Tartufo, Spoleto, Nov. 24-27: 45-50.

Wang Y, He XY. 2002. Tuber huidongense sp. nov. from China. Mycotaxon 83: 191-194.

Wang Y, Li ZP. 1991. A new species of Tuber from China. Acta Mycologica Sinica 10: 263-265.

Wang Y, Liu PG. 2011. Verification of Chinese names of truffles and their conservation in natural

habitats. Plant Diversity and Resources 33: 625 -642.

Wang Y, Moreno G, Riousset LJ, Manjon JL, Riousset G, Fourre G, Di Massimo G, Garcia- Montero

LG, Diez J. 1998. Tuber pseudoexcavatum sp. nov. A new species from China commercialised

in Spain, France and Italy with additional comments on Chinese truffles. Cryptogamie Mycol.

19-113—-120.

White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal

RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR Protocols: a Guide to

Methods and Applications. Academic Press, San Diego.

Xu AS. 1999. A taxonomic study of the genus Tuber in Xizang. Mycosystema 18: 361-365.

Zhang LF, Yang ZL, Song DS. 2005. A phylogenetic study of commercial Chinese truffles and their

allies: taxonomic implications. FEMS Microbiol. Lett. 245: 85-92.

http://dx.doi.org/10.1016/j.femsle.2005.02.028

MY COTAXON

http://dx.doi.org/10.5248/122.171

Volume 122, pp. 171-175 October-December 2012

Three new species of Humicola

from the Qinghai-Tibet Plateau Area, China

YUE-MING Wu & TIAN-YU ZHANG

Department of Plant Pathology, Shandong Agricultural University, Taian, 271018, China

Key Laboratory of Agricultural Microbiology, Shandong Province, Taian, 271018, China

*CORRESPONDENCE TO: tyzhang1937@yahoo.com.cn

ABSTRACT — Three new species from soil in China, Humicola chlamydospora, H. tuberculata,

and H. verruculosa, are described and illustrated. The type specimens (dried cultures) and

living cultures are deposited in the Herbarium of Shandong Agricultural University, Plant

Pathology (HSAUP). Isotypes are kept in the Herbarium of Institute of Microbiology,

Academia Sinica (HMAS).

KEY worps — dematiaceous hyphomycetes, soil fungi, taxonomy

Introduction

During a survey of dematiaceous soil hyphomycetes in China, several unusual

species of Humicola were collected, of which three are described and illustrated

here as new. Humicola, a genus established by Traaen (1914), is characterized

by possession of micronematous or semi-macronematous conidiophores that

are cylindric or slightly inflated. The conidiogenous cells swell apically to

form globose to ovoid aleuriospores. Of the 66 taxa listed by Index Fungorum

(2012), many are infraspecific, and Seifert et al. (2011) estimate that the genus

may contain only 20 valid species.

Cultures were examined after 7 days growth on potato dextrose agar (PDA)

(De Bertoldi 1976).

Humicola chlamydospora Y.M. Wu & T.Y. Zhang, sp. nov. FIG. 1

MycoBank MB 563897

Differs from Humicola alopallonella by its multinucleate conidia and from H. nivea by

its smaller and smooth conidia.

Type: China, Tibet: Xigaze, from mountain soil, altitude 2300 m, 14 Sept. 2007, Y.M. Wu

(Holotype HSAUP II 1337; isotype HMAS 196265).

Erymo oey: The epithet refers to the chlamydospores of this species.

172 ... Wu & Zhang

Fic. 1. Humicola chlamydospora (ex holotype).

Conidia, conidiophores, conidiogenous cells and intercalary chlamydospores. Scale bars = 25 um.

CoLonligs on PDA at 26°C for 7 days 5-7 cm diam., effuse, velvety, brown to

dark brown. Mycelium superficial or immersed; hyphae branched, septate,

smooth, subhyaline to light brown, 3-4 um wide. ConrDIOPHORES subhyaline

to light brown, mononematous, micronematous, septate, smooth, 5-7 um wide.

Conipia solitary, globose, smooth, golden yellow, thick-walled, (16—)18(-20)

um diam., containing 8-10 oil droplets. Chlamydospores globose, intercalary.

Phialospores not seen.

ComMENTs — Morphologically, H. chlamydospora resembles H. alopallonella

Meyers & R.T. Moore (Meyers & Moore 1960) and H. nivea De Bert. (De

Bertoldi 1976). The new species differs from H. alopallonella in having many

oil droplets in the conidia and from H. nivea, which has rough walled, smaller

conidia (8.9-9.4 um diam.).

Humicola spp. nov. (Qinhai-Tibet Plateau ... 173

a Sn)

Fe |

AER X

<U.6. GE

NGAYS 5,

by SAE?

Ninn eg

Fic. 2. Humicola tuberculata (ex holotype).

Conidia, conidiophores and conidiogenous cells. Scale bars = 25 um.

Humicola tuberculata Y.M. Wu & T.Y. Zhang, sp. nov. FIG. 2

MycoBank MB 563888

Differs from Humicola nivea and H. rugosa by its tuberculate conidia with only a single

nucleus.

Tye: China, Tibet: Shannan, from grassland soil, altitude 3500 m, 9 June 2007, Y.M. Wu

(Holotype HSAUP II 0509; isotype HMAS 196266).

Erymo.ocy: The epithet refers to the tuberculate conidia of this species.

Co.tontgs on PDA at 26°C for 7 days 4-5 cm diam., effuse, velvety, greyish

brown to dark brown. Mycelium superficial or immersed; hyphae branched,

septate, smooth, subhyaline to light brown, 1-2 um wide. CONIDIOPHORES

subhyaline, mononematous, micronematous, septate, smooth, 1-2 um wide.

Conlipli< solitary, globose, tuberculate, golden-yellow, thin-walled, (6-)8(-9)

um diam. Phialospores not seen.

ComMENTS — Humicola tuberculata resembles H. nivea and H. rugosa De Bert.

(De Bertoldi 1976) in conidial size but differs from these two species in its

tuberculate conidia lacking oil droplets.

174 ... Wu & Zhang

Fic. 3. Humicola verruculosa (ex holotype).

Conidia, conidiophores and conidiogenous cells. Scale bars = 25 um.

Humicola verruculosa Y.M. Wu & T.Y. Zhang, sp. nov. FIG. 3

MycoBank MB 563893

Differs from Humicola dimorphospora and H. piriformis by its larger, ellipsoidal and

verrucose conidia.

Type: China, Tibet: Xigaze, from a mountain soil, altitude 2300 m, 14 Sept. 2007, Y.M.

Wu (Holotype HSAUP II 1332; isotype HMAS 196264).

Erymo.oey: The epithet refers to the verruculose conidia.

CoLonigs on PDA at 26°C for 7 days 4-5 cm diam., effuse, velvety, brown to

dark brown. Mycelium superficial or immersed: hyphae branched, septate,

smooth, subhyaline to light brown, 3-5 um wide. ConrpiopHorgs reduced

to conidiogenous cells on side of hyphae, mononematous, micronematous,

subhyaline to light brown, smooth, 4-7 um wide. Conrp1a solitary, ellipsoidal

or ovoid, with a scar at the base, produced singly on the sides of hyphae or

on short lateral conidiophores, verruculose, pale yellowish brown to yellowish

brown, 8-12 x 5-8 um. Chlamydospores globose, intercalary. Phialospores not

seen.

Humicola spp. nov. (Qinhai-Tibet Plateau ... 175

ComMENTs — Morphologically, H. verruculosa is similar to H. dimorphospora

Roxon & S.C. Jong (Roxon & Jong 1974) and H. piriformis De Bert. (De Bertoldi

1976), but its conidia are larger than those of H. dimorphospora (3-5 um

diam.) and H. piriformis (7-7.2 x 7.1-7.5 um). Our new species is additionally

distinguished from those two species by its ellipsoidal conidia with verrucose

conidial wall.

Acknowledgments

The authors are grateful for pre-submission comments and suggestions provided

by Dr Eric McKenzie and Prof. Y.L. Guo. This project was supported by the National

Science Foundation of China (no. 30970011 & 30499340).

Literature cited

De Bertoldi M. 1976. New species of Humicola: an approach to genetic and biochemical

classification. Can. J. Bot. 54: 2755-2768.

Index Fungorum. 2012. http://www.indexfungorum.org/Names/Names.asp; accessed 22 Mar.

2012.

Meyers SP, Moore RT. 1960. Thalassiomycetes II. New genera and species of deuteromycetes. Amer.

J. Bot. 47: 345-349.

Roxon JE, Jong SC. 1974. A new pleomorphic species of Humicola from Saskatchewan soil. Can.

J. Bot. 52: 517-520.

Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes. CBS

Biodiversity Series. CBS-KNAW Fungal Biodiversity Centre, Utrecht, Netherlands. 997 p.

Traaen EA. 1914. Untersuchungen tiber die Bodenpilze aus Norwegen. Nyt. Mag. Naturvid. 32:

20-121. http://dx.doi.org/10.1016/S0007-1536(61)80031-4

MY COTAXON

http://dx.doi.org/10.5248/122.177

Volume 122, pp. 177-185 October-December 2012

A new species of Calonectria causing leaf disease

of water lily in China

JUN-JIE Xu', SHAO- YUAN QIN’, YUAN-YUAN HAO, JUN REN?, PING TAN’,

Att H. BAHKALI‘, KEVIN D. HypDE>4+ & YONG WANG”?

‘College of Life Sciences, Linyi University, Linyi, 276005, China

*Department of Plant Pathology, College of Agriculture, Guizhou University,

Guiyang 550025, China

°Kenli County Agricultural Technology Extension and Service Center, Dongying, 257500, China

‘King Saud University, College of Science, Botany and Microbiology Department,

PO. Box 2455, Riyadh 1145, Saudi Arabia

“Institute of Excellence in Fungal Research, School of Science, Mae Fah Luang University, Chiang

Rai, Thailand

*CORRESPONDENCE TO: yongwangbis@yahoo.cn

AsBsTRACT — A species of Calonectria, isolated from a leaf spot of water lily (Nymphaea

tetragona) in Guiyang, Guizhou Province, China was shown to be pathogenic by applying

Koch’s postulates. Identification based on morphological characters and a comparison of

sequences from beta-tubulin and translation elongation factor 1 alpha (TEF1) genes supported

its status as a new species. Calonectria nymphaeae sp. nov. is introduced and compared with

similar taxa.

Key worps — ITS sequences, taxonomy, hyphomycetes

Introduction

During a survey of hyphomycetes in Guizhou Province, China, various taxa

were isolated from different plant hosts. Two strains isolated from a leaf spot

of water lily had branched conidiophores and a stipe extension terminating

in characteristic vesicles, producing cylindrical, 1-multi-septate conidia;

these morphological characteristics are typical of Cylindrocladium Morgan

(anamorphic Calonectria De Not.) (Crous & Wingfield 1994, Crous 2002).

In culture the strain also produced a Calonectria teleomorph. Recent studies

have largely improved our understanding of the phylogeny and systematics

among Calonectria and allied genera (Lombard et al. 2010a,b,c, Doveri et al.

2010). Lombard et al. (2010c) provided dichotomous and synoptic keys to all

Calonectria species currently recognized.

178 ... Xu & al.

The Calonectria species isolated from Nymphaea tetragona is described

as a new species, C. nymphaeae. It is illustrated with light micrographs and

its uniqueness is confirmed in a phylogram generated from beta-tubulin

and translation elongation factor 1 alpha (TEF1) sequence data, which are

the regions that provide most valuable insights into relationship between all

Calonectria species (Schoch et al. 2000, 2001, Crous 2002, Henricot & Culham

2002). Koch's postulates also confirmed that this new taxon was the causal agent

of leaf disease of water lily.

Materials & methods

Morphological and cultural studies

Diseased leaves of Nymphaea tetragona growing in a pond in Huaxi, Guiyang

city, Guizhou Province, China were collected in clean plastic bags and returned to

the laboratory. Small tissue pieces (each approximately 5 x 5 mm) were cut from the

boundary between healthy and infected parts of leaves, which were previously surface

disinfected with 0.5% NaOCl. The pieces were plated onto malt extract agar (2% w/v;

MEA; Biolab, Midrand, South Africa) and incubated at 25°C for 7 days under continuous

near-UV light. Mycelia grew from the infected samples and were transferred to fresh

MEA plates. Cultural characteristics and morphology were determined on MEA, and

carnation leaf agar (CLA) [1% water agar (10 g/L) with autoclaved carnation leaves

placed onto the medium] (Gams et al. 1998) and incubated for 7 days at 25°C under

continuous near-UV light, to promote sporulation. A water solution of 60% (v/v) lactic

acid without a color dye was used as the mounting medium. Slides were examined under

oil immersion with a UB200i microscope (Chongqing UOP Photoelectric Technology,

China) at 1000x magnification. Dried cultures of this species were deposited in the Plant

Pathology Herbarium of Guizhou University (HGUP). Living cultures were deposited

in HGUP and Centraalbureau voor Schimmelcultures (CBS).

DNA sequencing and alignment

DNA was extracted from mycelium using CTAB method. Three loci including

fragments of the ITS, B-tubulin (BT), and translation elongation factor 1 alpha (TEF1)

gene regions were sequenced. Primers used to sequence these regions were ITS1

and ITS4 (White et al. 1990) for ITS region, Tl (O'Donnell & Cigelnik 1997) and

CYLTUBIR (Crous et al. 2004) for the BT region, and EF1-728F (Carbone & Kohn

1999) and EF2 (O’Donnell et al. 1998) for the TEF1 region. Reaction mixtures contained

5 uL of 10 x ThermoPol reaction buffer [200 mM Tris-HCl, pH 8.3, 100 mM KCl, 100

mM (NH,),SO,, 20 mM MgSO, and 1% Triton X-100], 5 uL of 10 mM MgSO,, 20 ng

template genomic DNA, 4 pM of each primer, 4 uL of 2.5 mM dNTPs, 2.5 U of AmpliTaq

polymerase, and total volume was adjusted to 50 uL with deionized water. The PCR

amplified DNA fragments were fractionated in 1% agarose gels in 0.5 x TBE buffer, and

DNA was visualized by ethidium bromide staining and UV illumination. Sequencing

was performed with an ABI PRISM 3730 DNA autosequencer using either dRhodamine

terminator or Big Dye Terminator chemistry (Applied Biosystems, 850 Lincoln Centre

Drive, Foster City, California). The DNA sequences of isolates HGUP100003 and

Calonectria nymphaeae sp. nov. (China) ... 179

HGUP100004 in ITS, BT and TEF1 regions generated in this study were submitted to

GenBank (JF499828, JN984864, JN984866, JN984865, JX546573 and JX546579). The

ITS sequences comparison with published sequences was performed using a BLAST

search.

Phylogenetic analyses

The combined BT and TeEF1 DNA sequence of HGUP100003 was primarily aligned

with the ClustalX (Thompson et al. 1997). Alignments files are available in TreeBASE

(www.treebase.org/treebase-web/home.html) with study ID 12047. We built up the

phylogenetic tree based on combined BT and TEF1 gene regions using the MP (Maximum

Parsimony) by PAUP* 4.0b10 (Swofford 2002) and Bayesian methods by MrBayes v3.1.1

(Ronquist & Huelsenbeck 2003). A partition homogeneity test (Farris et al. 1994) was

applied to evaluate the feasibility of combining the datasets. In the MP analyses, trees

were inferred using a heuristic search option with tree bisection reconnection (TBR)

branch swapping and 1000 random sequence additions replicates, maxtrees were 100,

branches of zero length were collapsed and all parsimonious trees were saved. Measures

calculated for parsimony included tree length (TL), consistency index (CI), retention

index (RI) and rescaled consistence index (RC). Bootstrap analyses (Hillis & Bull 1993)

were based on 1000 replications.

The model of evolution in Bayesian analysis was TPM2uf+G estimated by jModelTest

0.0.1 (Posada 2008). A Markov Chain Monte Carlo (MCMC) algorithm was used to

generate phylogenetic trees with Bayesian probabilities using MrBayes v3.1.1 for the

BT and TEF1 sequence datasets. Two independent runs of four MCMC chains were run

simultaneously from random trees for 1,010,000 generations and sampled every 100

generations for the combined analysis of the gene partitions. Both runs converged on

the same likelihood score and tree topology, and the first 2500 trees were discarded as

the burn-in phase of each analysis. Posterior probabilities were determined from the

remaining 7600 trees.

Pathogenicity test

Pathogenicity of this fungus was determined by inoculating healthy leaves of

N. tetragona with 5 mm diameter mycelial plugs, cut from the margins of 10-day-

old actively growing cultures; the control was treatment with sterile agar plugs. Both

inoculated and control plants were kept in a moist chamber at 25°C for 4 days, and

observed for symptom development. Infected leaves were collected and the fungus was

reisolated in MEA medium and compared with the original isolate.

Results

Phylogenetic analysis

Our initial BLAST searches identified DNA sequences of isolates

HGUP100003 and HGUP100004 to be most closely related to those of

Calonectria eucalypti. The alignment sequences indicated the ITS sequence

of this fungus was 99.6% identical (only two base pairs difference) to four

sequences (GQ280631, GQ280632, GQ280633, GQ280634) of C. eucalypti with

499-bp characters. Sequence GQ280633 originated from the C. eucalypti ex-

180 ... Xu & al.

C. colombiensis CBS 112221

C. chinensis CBS 112744

C. crousiana CMW 27249

C. multiseptata CBS 112682

77 99 C. pseudoreteaudii CBS 123694

100 C. reteaudii CBS 112144

92 C. terrae-reginae CBS 112151

C. queensiandica CBS 112146

C. pteridis CBS 111793

C. eucadoriae CBS 111394

97 C. brachiatica CBS 123700

C. brassicae CBS 111869

C. spathulata CBS 112689

C. colombiana CBS 115638

lll a C. pauciramosa CMW 30823

87 C. zuluensis CMW 9188

C. polizzii CMW 7804

C. cerciana CBS 123639

C. morganii CBS 110666

75 C. insulare CBS 114558

Cc. macroconidialis CBS 114880___

7 €Mw27209

cMmw27213 C. pseudocolhounii

cMmw27214

HGUP100003

i HGUP100004

| cMw27254

C. pseudocolhounii

C. nymphaeae sp. nov

C. nymphaeae sp. nov 82

C. fujianensis

Mw?27257 C. fujianensis

CMWw27263

cMw14890

aan re ~cwwia4aa

cBS29379 i

C. cothounii

C. eucalypti

81 CBS114704

Fic. 1 One parsimonious tree based on combined sequences of BT (beta-tubulin) and tefl

(translation elongation factor 1 alpha) for Calonectria nymphaeae and 24 other Calonectria species

downloaded from GenBank. C. colombiensis (CBS 112221) and C. chinensis (CBS 112744) serve

as outgroups. The detailed phylogenetic relationships between C. nymphaeae, C. fujianensis,

C. eucalypti, and C. pseudocolhounii are shown in the amplified part of the bottom right corner.

Bootstrap values = 50% are shown above or below branches. Thickened branches indicate Bayesian

PPS 95%.

type strain (CMW 18444); therefore we originally identified our two isolates as

C. eucalypti.

However, C. eucalypti is a species complex and our Calonectria isolates were

revealed as a cryptic species following comparisons of sequences of BT and

TEF1 gene regions. Partition homogeneity tests for combinations of the two

gene regions used, yielded a P-value of 0.001. Based on the tree topologies and a

P-value of 0.001 (Cunningham 1997, Dettman et al. 2003), the two gene regions

were combined. The aligned sequence data matrix contained 27 taxa, including

2 outgroups and 1024 characters. Among them, BT has 515 characters, and

TEF1 has 509 characters. Of these, 294 were parsimony informative. Ten most

parsimonious trees were obtained, one to represent the topology of the strict

consensus tree selected for presentation (Fic. 1). The tree was described as

follows: Tree Length (TL) = 833, CI = 0.6423, RI = 0.8012, HI = 0.3577, and

RC = 0.5146. In this parsimonious tree, 25 species of Calonectria resided in a

strongly supported large monophyletic clade with a bootstrap value of 100%.

Calonectria nymphaeae sp. nov. (China) ... 181

Among them, two isolates of C. nymphaeae clustered together with a 86%

supported value. Calonectria nymphaeae, C. pseudocolhounii, C. eucalypti,

C. colhounii, and C. fujianensis are related species supported by a high bootstrap

value (100%). However, only C. fujianensis showed a closer relationship with

C. nymphaeae with a moderate bootstrap value (62%), and C. nymphaeae and

C. eucalypti are distant.

The topology in Bayesian analysis was nearly identical to that of the MP

analyses. The Bayesian trees are therefore not shown, but the statistically

supported clades (posterior probabilities = 0.95) are marked with a thickened

line in the parsimony tree (Fie. 1).

Taxonomy

Calonectria nymphaeae Yong Wang bis, S.Y. Qin, P. Tan & K.D. Hyde, sp. nov.

MycoBank MB 800112 Fic. 2

Differs from Calonectria pseudocolhounii and C. fujianensis by its slightly larger

macroconidia and its longer, narrower ascospores.

Type: China, Guizhou Province, Guiyang, Huaxi, Huaxi Garden, in a pond, from the

diseased leaves of Nymphaea tetragona Georgi (Nymphaeaceae), dried sporulating

MEA medium cultures, July 2010, S.Y. Qin (Holotype, HGUPd100003; isotype, CBS;

ex-type living cultures—HGUP 100003, CBS 131802; GenBank—JF499828, JN984864,

JX546573).

EryMo_oey: in reference to the host from which the fungus was isolated.

Ascomata solitary or in groups, orange to red, becoming red-brown with

age, perithecial; in section, apex and body yellow to orange, base red-brown,

subglobose to ovoid, 360-450 um high, 320-380 um diam. Peridium rough,

consisting of 2 thick-walled layers; outer layer of textura globulosa, 30-60 um

wide; becoming more compressed towards inner layer of textura angularis,

13-16 um wide; becoming thin-walled and hyaline towards the center, outer

cells 28-35 x 10-18 um; inner cells 10-13 x 5-7 um, ascomata base up to

90-100 um wide, consisting of dark red, angular cells, merging with an erumpent

stroma, cells of the outer wall layer continuing into the pseudoparenchymatous

cells of the erumpent stroma. Asci 4-spored, clavate, 100-145 x 12-16 um,

tapering to a long thin stalk. Ascospores aggregated in the upper third of the

ascus, hyaline, guttulate, fusoid with rounded ends, straight to slightly curved,

2-3-septate, not or slightly constricted at the septa, 51-71 x 5.5-6.5 um (av.

= 66 x 6.0 um). Cultures homothallic. Conidiophores with a stipe bearing a

penicillate suite of fertile branches, stipe extensions, and terminal vesicles. Stipe

septate, hyaline, smooth, 250-300 x 3-4.5 um; stipe extensions septate, straight

to flexuous, 120-240 um long, 3-5 um wide at the apical septum, terminating

in a clavate vesicle, 3-5 um diam. Conidiogenous apparatus 50-100 um long,

and 30-70 um wide; primary branches aseptate or 1-septate, 18-28 x 4-5

182 ... Xu & al.

Fic. 2 Calonectria nymphaeae: A-B. cultures on MEA; C. macroconidiophore; D. fertile branches;

E. clavate vesicle; F. macroconidium; G-H. macroconidia stained by cotton blue; I. perithecium; J.

asci; K. ascospore. Scale bars: C-E = 50 um; F-H = 20 um; J-I = 100 um; K = 15 um.

Calonectria nymphaeae sp. nov. (China) ... 183

Fic. 3 A: Naturally occurring symptoms on Nymphaea tetragona caused by Calonectria nymphaeae;

B: Symptoms on N. tetragona leaves by inoculation.

um; secondary branches aseptate, 9-15 x 3-4 um; tertiary branches aseptate,

6-12 x 2.5-3.5 um, each terminal branch producing 2-4 phialides; phialides

doliiform to reniform, hyaline, aseptate, 9-12 x 2.5-3 um; apex with minute

periclinal thickening and inconspicuous collarette. Macroconidia cylindrical,

rounded at both ends, straight, 55-63 x 5.3-6.3 um (av. = 61 x 5.9 um), 3-4-

septate, lacking a visible abscission scar, held in parallel cylindrical clusters by

colourless slime.

ADDITIONAL SPECIMEN EXAMINED: CHINA, GUIZHOU PROVINCE, Guiyang, Huaxi,

in a pond, from diseased leaves of Nymphaea tetragona, August 2011, Y. Wang,

(HGUP100004; GenBank—JF984866, JN984865, JX546579).

ComMENTs: Calonectria nymphaeae is similar to species in the C. colhounii

complex (Chen et al. 2011) that all have yellow ascomata, (1-)3-septate

ascospores, and clavate vesicles in the anamorph state. Calonectria nymphaeae

is morphologically most similar to C. pseudocolhounii S.E. Chen et al. and

C. fujianensis S.E. Chen et al. However, the macroconidia of C. nymphaeae

are slightly larger than those of C. pseudocolhounii (av. 60 x 4.5 um) and

C. fujianensis (av. 52.5 x 4.5 um). The ascospores of C. nymphaeae are longer but

narrower than those of C. pseudocolhounii (av. 56 x 6.5 um) and C. fujianensis

(av. 55.5 x 6.8 um). In addition, C. pseudocolhounii and C. fujianensis were

isolated from terrestrial hosts (Eucalyptus dunnii and E. grandis), while

C. nymphaeae was isolated from a hydrophyte.

Pathogenicity test

Following mycelial inoculation, N. tetragona leaves exhibited dark brown

to black necrotic spots (Fic. 3B) after 4 days, which were very similar to those

of natural infection (Fic. 3A). C. nymphaeae was successfully reisolated from

the artificially inoculated leaves of N. tetragona, thus establishing proof of

pathogenicity. Controls remained healthy and the leaves did not yield any

microorganisms at 4 days.

184 ... Xu & al.

Discussion

The phylogenetic results indicate that ITS sequence data poorly resolves

closely related species of Calonectria, while BT and TEF1 sequence data are more

effective DNA markers for phylogenetic analyses. In our study, morphological

comparison indicated that C. nymphaeae possessed some unique characters that

differ from related species. The phylogenetic analyses based on BT and TEF1

regions confirmed that the two C. nymphaeae isolates clustered together as an

independent branch with creditable bootstrap (86%) and posterior probabilities

values (1.00) (Fic. 1). The clade including C. nymphaeae, C. pseudocolhounii,

C. eucalypti, C. colhounii, and C. fujianensis was supported by high statistical

values (BP 100%, PP 1.00), which is consistent with morphological comparison.

By combining morphology and phylogeny we conclude that C. nymphaeae is a

novel species. Koch's postulates showed the taxon to be the causal agent of the

leaf spot disease of N. tetragona. According to Peerally (1991), Cylindrocladium

hawksworthii Peerally (anamorphic Calonectria hawksworthii L. Lombard

et al.) was the pathogen of a common foliage disease on Nymphaea lotus in

Mauritius. However, C. nymphaeae produces conidia with 3-4 septa, but those

of Cylindrocladium hawksworthii have only 1 septum. The phylogenetic analyses

also proved these two pathogens were not the same species.

Acknowledgments

The authors are grateful for pre-submission comments and suggestions provided

by Drs. E.H.C. McKenzie, J.Z. Zhang and Conrad Schoch. This project was supported

by the Doctors’ Funding of Guizhou University (no. 2010014) the National Science

Foundations of China (no. 31060005 and 31040005). The Global Research Network for

Fungal Biology and King Saud University are also thanked for support.

Literature cited

Carbone I, Kohn LM. 1999. A method for designing primer sets for speciation studies in filamentous

ascomycetes. Mycologia 91: 553-556. http://dx.doi.org/10.2307/3761358

Chen SF, Lombard L, Roux J, Xie YJ, Wingfield, MJ, Zhou XD. 2011. Novel species of Calonectria

associated with Eucalyptus leaf blight in Southeast China. Persoonia 26: 1-12.

http://dx.doi.org/10.3767/003158511X555236

Crous PW. 2002. Taxonomy and pathology of Cylindrocladium (Calonectria) and allied genera. APS

Press, St. Paul, Minnesota, U.S.A.

Crous PW, Wingfield MJ. 1994. A monograph of Cylindrocladium, including anamorphs of

Calonectria. Mycotaxon 51: 341-435.

Crous PW, Groenewald JZ, Risede J-M, Simoneau P, Hywel-Jones NL. 2004. Calonectria species

and their Cylindrocladium anamorphs: species with sphaeropedunculate vesicles. Studies in

Mycology 50: 415-430.

Cunningham CW. 1997. Can three incongruence tests predict when data should be combined?

Molecular Biology and Evolution 14: 733-740.

http://dx.doi.org/10.1093/oxfordjournals.molbev.a025813

Calonectria nymphaeae sp. nov. (China) ... 185

Dettman JR, Jacobson DJ, Taylor JW. 2003. A multilocus genealogical approach to phylogenetic

species recognition in the model eukaryote Neurospora. Evolution 57: 2703-2720.

http://dx.doi.org/10.1554/03-073

Doveri F, Pecchia S, Sarrocco S, Minnocci A, Vannacci G. 2010. Rodentomyces, a new hypocrealean

genus from Italy. Fungal Diversity 42: 57-69. http://dx.doi.org/10.1007/s13225-010-0028-2

Farris JS, Kallersjo M, Kluge AG, Bult C. 1994. Testing significance of incongruence. Cladistics 10:

315-320. http://dx.doi.org/10.1111/j.1096-0031.1994.tb00181.x

Gams W, Hoekstra ES, Aptroot A (eds). 1998. CBS Course of mycology. 4° ed. CBS, Baarn,

Netherlands.

Henricot B, Culham A. 2002. Cylindrocladium buxicola, a new species affecting Buxus spp., and its

phylogenetic status. Mycologia 94: 980-997. http://dx.doi.org/10.2307/3761865

Hillis DM, Bull JJ. 1993. An empirical test of bootstrapping as a method for assessing confidence in

phylogenetic analysis. Systematic Biology 42: 182-192.

http://dx.doi.org/10.1093/sysbio/42.2.182

Lombard L, Crous PW, Wingfield BD, Wingfield MJ. 2010a. Species concepts in Calonectria

(Cylindrocladium). Studies in Mycology 66: 1-14. http://dx.doi.org/10.3114/sim.2010.66.01

Lombard L, Crous PW, Wingfield BD, Wingfield MJ. 2010b. Multigene phylogeny and mating tests

reveal three cryptic species related to Calonectria pauciramosa. Studies in Mycology 66: 15-30.

http://dx.doi.org/10.3114/sim.2010.66.02

Lombard L, Crous PW, Wingfield BD, Wingfield MJ. 2010c. Phylogeny and systematics of the genus

Calonectria. Studies in Mycology 66: 31-69. http://dx.doi.org/10.3114/sim.2010.66.03

O’Donnell K, Cigelnik E. 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic

lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics and Evolution 7:

103-116. http://dx.doi.org/10.1006/mpev.1996.0376

O’Donnell K, Kistler HC, Cigelink E, Ploetz RC. 1998. Multiple evolutionary origins of the fungus

causing Panama disease of banana: concordant evidence from nuclear and mitochondrial

gene genealogies. Proceedings of the National Academy of Science USA 95: 2044-2049.

http://dx.doi.org/10.1073/pnas.95.5.2044

Peerally A. 1991. Cylindrocladium hawksworthii sp. nov., pathogenic on water-lily in Mauritius.

Mycotaxon 40: 367-376.

Posada D. 2008. jModelTest: phylogenetic model averaging. Molecular Biology and Evolution 25:

1253-1256. http://dx.doi.org/10.1093/molbev/msn083

Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed

models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180

Schoch CL, Crous PW, Wingfield MJ, Wingfield BD. 2000. Phylogeny of Calonectria and selected

hypocrealean genera with cylindrical macroconidia. Studies in Mycology 45: 45-62.

Schoch CL, Crous PW, Wingfield BD, Wingfield MJ. 2001. Phylogeny of Calonectria based

on comparisons of $-tubulin DNA sequences. Mycological Research 105: 1045-1052.

http://dx.doi.org/10.1016/S0953-7562(08)61966-8

Swofford DL. 2002. PAUP*: Phylogenetic analysis using parsimony (*and other methods), version

4.0b10. Sunderland, Massachusetts: Sinauer Associates.

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The Clustal X windows

interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.

Nucleic Acids Research 24: 4876-4882. http://dx.doi.org/10.1093/nar/25.24.4876

White TJ, Bruns T, Lee S, Taylor J, 1990. Amplification and direct sequencing of fungal ribosomal

RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols: a guide to

methods and applications. New York: Academic Press, U.S.A.

MYCOTAXON

http://dx.doi.org/10.5248/122.187

Volume 122, pp. 187-195 October-December 2012

Two species of Agaricus sect. Xanthodermatei from Thailand

Rut-LiIn ZHAO’, DENNIS E. DESJARDIN?, PHILIPPE CALLAC3, Luts A. PARRA‘,

JACQUES GUINBERTEAU?, KASEM SOYTONG*®, SAMANTHA KARUNARATHNA‘,

YING ZHANG?! & KEVIN D. HypDE®”®

'Key Laboratory of Forest Disaster Warning and Control in Yunnan Province, College of Forestry,

Southwest Forestry University, Kunming, Yunnan Province 650224, PR China

?Department of Biology, San Francisco State University, San Francisco, California, 94132, USA

7INRA, UR1264, Mycologie et Sécurité des Aliments, 33883 Villenave d’Ornon, France

‘Avda. Padre Claret 7, 5° G, 09400 Aranda de Duero, Burgos, Spain

°Faculty of Agricultural Technology, King Mongkut’s Institute of Technology Ladkrabang (KMITL),

Ladkrabang, Bangkok 10520, Thailand

°Institute of Excellence in Fungal Research, School of Science, Mae Fah Luang University,

Chiang Rai, Thailand

7International Fungal Resource and Development Centre,

The Research Institute of Resources Insects Chinese Academy of Forestry,

Bailongsi, Kunming, Yunnan Province 650224, PR China.

’King Saud University, College of Science, Botany and Microbiology Department,

Riyadh 1145, Saudi Arabia

* CORRESPONDENCE TO: Zhaoruilin@gmail.com

ABSTRACT —Agaricus murinocephalus is described and illustrated as a new species. This

taxon, presently known only from Thailand, is characterized by a context that generally does

not discolor on exposure, the lack of a phenolic odor, a cap covered by very fine, appressed,

dark grey squamules outside the grey disc on a whitish background, and a broken collar-like

annulus. Agaricus endoxanthus, previously reported from South America, Europe, and Asia,

is recorded for the first time in Thailand. Morphological and published molecular analyses

place both taxa in A. sect. Xanthodermatei based on.

Key worps —Basidiomycota, Agaricaceae, new species, taxonomy, tropics

Introduction

Agaricus is a genus that comprises many edible species but also includes a

small number of species that are toxic if eaten. These toxic taxa do not generally

cause death but may cause gastrointestinal upsets. Most toxic species are

members of A. sect. Xanthodermatei (Parra 2008).

188 ... Zhao & al.

Agaricus sect. Xanthodermatei was established by Singer (1948) with

the type species A. xanthodermus Genev. Recent molecular phylogenetic

analyses of samples from Europe and North America showed the section to

be monophyletic (Callac & Guinberteau 2005, Challen et al. 2003, Gem et al.

2004, Kerrigan et al. 2005). Inclusion of tropical species in molecular analysis

by Zhao et al. (2011) also confirmed monophyly of the group. Agaricus sect.

Xanthodermatei is characterized mainly by its chemical reactions as all section

members have a negative Schaffer reaction and bright yellow positive KOH

reaction (Parra 2008). Other important features shared by many taxa in sect.

Xanthodermatei are a transient yellowing discoloration in the pileus surface

and stipe base when bruised or cut, phenolic or iodine-like odors, and toxic

compounds that can cause gastrointestinal disorders in humans. Surprisingly

A. biannulatus Mua et al., a recently published new species in this section has

neither yellow context discoloration nor a phenolic or iodine-like odor (Parra

et al. 2011). Sect. Arvenses and sect. Minores (also with yellow staining species)

can be distinguished from sect. Xanthodermatei by their more persistent color

change, positive Schaffer reaction, anise seed or almond-like odors, and lack

toxic compounds causing gastrointestinal upset when ingested (Parra 2008).

As part of our ongoing studies of macrofungi in northern Thailand (Van de

Putte et al. 2010), including Agaricus (Zhao et al. 2011) and its relatives (Zhao

et al. 2010), we describe here two A. sect. Xanthodermatei species from the

region: one a newly proposed species and the other a first record for Thailand.

Materials & methods

Collections were made in forests and grassy areas in northern Thailand between

2004 and 2010. Specimens were photographed in situ and gathered and wrapped in

aluminum foil or kept separately in a box in order to avoid mixing or crushing, and

returned to the laboratory for treatment. Odor and color change upon bruising were

recorded when collecting. Descriptions of other macrocharacters, chemical tests, and

further photography of fresh samples were carried out as soon as possible after return

from the field, generally following Largent (1986). Color terminology follows Kornerup

& Wanscher (1978). Specimens were dried overnight in a food drier, sealed in plastic

bags, and deposited in the BIOTEC Bangkok Herbarium (BBH), with duplicates in the

H.D. Thiers Herbarium at San Francisco State University (SFSU). Herbarium acronyms

follow Thiers (http://sweetgum.nybg.org/ih continuously updated).

Micromorphological features were documented from examination of dried

specimens according to Largent (1986). Particular attention was given to the anatomy

of the pileipellis, stipitipellis and partial veil, and features of the hymenophoral trama,

basidiospores, basidia and cystidia. Measurements of anatomical features (spores,

basidia and cheilocystidia) are presented based on at least 20 measurements, and include

x, the mean of length by width + SD, Q, the quotient of basidiospore length and width,

and Qm, the mean of Q-values + SD. The phylogenetic relationships of the two species

included herein are published in Zhao et al. (2011).

Agaricus murinocephalus sp. nov. (Thailand) ... 189

PLATE 1. Agaricus murinocephalus (Holotype BBH 19560): A. Longitudinal section of

basidiocarp; B. Basidiospores, basidia and cheilocystidia; C. Pileipellis hyphae; D. Annulus

hyphae. Scale bars: A = 10 mm; B-D = 10 um.

Taxonomy

Agaricus murinocephalus R.L. Zhao, Desjardin & K.D. Hyde, sp.nov. PL. 1, 3A-E

MycoBank MB564460

Differs from other species of Agaricus sect. Xanthodermatei by its lack of (or very slight)

yellow context discoloration on exposure, lack of phenolic or iodine-like odor, pileus disc

with very fine grey squamules on a white background, and broken collar-like annulus.

190 ... Zhao & al.

Type: Thailand. Chiang Mai Prov., Mae Taeng, Ban Mae Sae village, on Hwy 1095

near 50 km marker, 19°14.599'N 98°39.456’E, altitude 962 m, 10 June 2006, coll. Todd

Osmundson ZRL3044 (Holotype, BBH 19560; isotype SFSU; GenBank, JF691555).

EryMo_oey: from murinus = mouse-grey, and cephalus = headed; referring to the grey-

colored pileus.

PILEus 30 mm diam. when young, then expanding to 50-55 mm diam., convex

with distinct broad umbo; margin deflexed, splitting with age, never uplifted;

surface dry, covered with fibrils or very finely squamulose; disc generally

greyish brown (5F5) to black or sometimes with greenish tones; ornamentation

disrupted towards the whitish margin and appearing minutely pulverulent on

a whitish background. CONTEXT 3 mm thick at disc, white. LAMELLAE free,

crowded, with 4 series of lamellulae, 5-6 mm broad, ventricose, at first white,

then light orange grey (6B2), later greyish brown (8D3), finally dull brown

to dark brown. St1pE 40-70 x 4-5 (apex) x 5-10 (base) mm, cylindrical to

subclavate above a bulbous base, hollow; surface smooth, silky, white. ANNULUS

2 mm broad, collar-like, broken, ephemeral, white. ODor pleasant. Surfaces

of stipe and pileus staining reddish-brown on touching; context lacking color

change or very slightly discoloring yellow at the base of stipe on cutting.

MACROCHEMICAL REACTIONS KOH reaction bright yellow; Schaffer reaction

negative.

BASIDIOSPORES 5.5-7 X 3-4 um, [x = 6 + 0.4 x 3.5 + 0.3 um, Q = 1.4-2.0,

Q. = 1.75 + 0.35, n = 20], elongate-ellipsoid, without germ pore, smooth,

brown. Basip1A 12-19 x 6-8 um, hyaline, smooth, 4-spored. CHEILOCYSTIDIA

scattered, 9-24 x 8-13 um, pyriform to broadly clavate, hyaline, smooth.

PLEUROCYSTIDIA absent. PILEIPELLIS a cutis formed from hyphae 5-10 um

diam., some constricted at septa, cylindrical, walls hyaline, containing brown

vacuolar pigment. ANNULUS composed of hyphae of 4-7 um diam. that are

smooth, hyaline and branched.

Hasir solitary or scattered in small groups in open areas of forest.

ADDITIONAL MATERIAL EXAMINED: THAILAND, CHIANG Rat PRov., Mae Sai, Doi

Tung, 3 August 2006, coll.: Rui-lin Zhao ZRL3092 (BBH 19608, SFSU).

Agaricus endoxanthus Berk. & Broome, J. Linn. Soc. Bot. 11: 548. 1871. PL. 2, 3F-H

PILEus 65 mm diam., convex to plano-convex; disc with a broad, flattened

or slightly depressed umbo; pileus margin exceeding the lamellae as a white

edge; surface dry, covered by brownish-grey (8E2) to grey (8E5) fibrils,

radially fissured exposing the underlying white context that turns pink in wet

conditions; at disc fibrils darker and aggregated into small, scattered fibrillose

squamules. CONTEXT firm, white. LAMELLAE free, crowded, with 10 or more

series of lamellulae, up to 4 mm broad, straight or ventricose, greyish red to

dull red (8C3) when young, brown to dark brown (8F4) with age; edges paler

than the sides. Stipe 60 x 4-12 mm, cylindrical below, with a slightly tapered

Agaricus murinocephalus sp. nov. (Thailand) ... 191

PLATE 2. Agaricus endoxanthus (BBH 19611): A. Cheilocystidia; B. Basidiospores and

basidia; C. Pileipellis hyphae. Scale bars: A-B = 10 um; C = 25 um.

apex: base slightly swallowed with white rhizomorphs, hollow; surface both

above and below the annulus glabrous, brownish grey (8E2). ANNULUS superior,

persistent, pendent, single, up to 11 mm broad; lower surface slightly floccose;

edge entire, white, and sometimes with brown granules. Opor indistinct, not

phenolic or almond-like. Base of stipe and centre of disc strongly staining

yellow on cutting, without color change on touching.

MACROCHEMICAL REACTIONS KOH reaction yellow; Schaffer reaction

negative.

Spores 5-6 x 3-4 um [x=5.4 + 0.6 x 3.5 +0.5 um, Q=1.25-2,Q_=1.55+0.45,

n= 20], ellipsoid with attenuate apex in most cases, without germ pore, smooth,

brown. Basip1A 12-17 x 5-7 um, clavate, 4-spored. CHEILOCYSTIDIA (9-)11-

17 x 8-12 um, rarely seen in old specimens, mostly pyriform, some turbinate

192 ... Zhao & al.

or subsphaerical, hyaline, smooth. PLEUROCysTIDIA absent. PILEIPELLIS a

cutis, composed of cells variable in size and shape, many 25-44 x 17-25 um,

others 17-25 x 5-7.5 um, distinctly constricted at the septa, with dark brown

vacuolar pigments. ANNULUS composed of hyphae of 5-7.5 um diam., which

are hyaline, smooth and curved. STIPITIPELLIS with hyphae similar to those of

the pileipellis, but slightly smaller.

Hasit solitary in soil, in open areas of forest.

MATERIAL EXAMINED: THAILAND, CHIANG Mal Prov., Mae Taeng Dist., Ban Pha

Deng Village, 19°17.123'N 98°44.009’E, elev. 900 m., 13 August 2006, coll.: Rui-lin Zhao

ZRL3095 (BBH 19611, SFSU; see also Zhao et al. 2011).

Discussion

Although some morphological characters of A. murinocephalus, such as

the slightly reddish-brown discoloration on bruising of the pileus and the

lack of typical phenolic odor are not typical for A. sect. Xanthodermatei, the

molecular phylogenetic position (Zhao et al. 2011), negative Schaffer reaction,

positive KOH reaction, and pileipellis hyphae with vacuolar pigments support

this new species in this section. Furthermore, the previous molecular work

separates this new species from A. endoxanthus, A. microvolvatulus Heinem.,

A. xanthodermulus Callac & Guinb., A. xanthodermus, and A. xanthosarcus

Heinem. & Gooss.-Font. Specimen NTF61 (see sp. 39 in the Zhao et al. 2011

phylotree) represents another possible species sister to A. murinocephalus

that our molecular analyses show as a different new species. A complete

morphological and molecular characterization of specimen NTF61 will be

presented in another paper.

The context in A. murinocephalus either does not stain yellow or discolors

only slightly on exposure. Most sect. Xanthodermatei species stain distinctly

yellow after being cut, especially at the stipe base of the stipe, e.g. A. bulbillosus

Heinem. & Gooss.-Font., A. endoxanthus, A. iodosmus Heinem., A. moelleri

Wasser, A. menieri Bon, A. pseudopratensis (Bohus) Wasser, A. xanthodermus,

A. xanthosarcus (Cappelli 1984, Heinemann 1956a, 1978; Kerrigan 1986, Nauta

2001). In some species, such as A. phaeolepidotus (RH. Moller) RH. Moller,

A. californicus Peck, or A. hondensis Murrill, a weak yellow or rubescent

discoloration occurs on cutting, however all taxa have a phenolic odor and lacka

dark greyish pileus (Cappelli 1984, Kerrigan 1986, Nauta 2001) that characterize

A. murinocephalus. Agaricus biannulatus, a recently published species (Parra et

al. 2011) in this section also lacks a yellow context discoloration and phenolic

or iodine-like odor, but differs from A. murinocephalus in a two-layered

annulus consisting of two distinct separate limbs. Agaricus volvatulus Heinem.

& Gooss.-Font. and A. placomyces Peck are morphologically similar to our new

species in that both have blackish pilei and a bulbous stipe. Agaricus volvatulus,

however, has a distinct phenolic odor and its pileus is darkly pigmented overall,

Agaricus murinocephalus sp. nov. (Thailand) ... 193

PLATE 3. Agaricus murinocephalus: A-C. Holotype BBH 19560; D-E. BBH 19608. Agaricus

endoxanthus (BBH 19611): E Basidiomata; G. Cheilocystidia; H. Pileipellis hyphae.

194 ... Zhao & al.

while A. placomyces has an elastic annulus that may remain attached to the

pileus margin even after pileus expansion (Heinemann 1978, 1980; Kerrigan

et al. 2005).

Agaricus endoxanthus is another species with dark appressed squamules

on the pileus, a large membranous-floccose annulus, small spores and

cheilocystidia, and vacuolar pigments in the pileipellis hyphae (Pegler 1977,

1986; Heinemann 1980). An ITS1+2 sequence of material from Thailand

(sample ZRL3095, GenBank JF691554; Zhao et al. 2011) is nearly identical

to that of A. endoxanthus (GenBank DQ182511) reported in Kerrigan et al.

(2005). The fact that only two heteromorphisms separate the two sequences

helped us select the appropriate epithet for the Thai material.

Agaricus endoxanthus is similar to A. pseudoniger Heinem. & Gooss.-Font.

from Congo and Agaricus rotalis K.R. Peterson et al. from Hawaii (Peterson et

al. 2000). Agaricus pseudoniger differs in having a brownish-black pileus and

larger cheilocystidia (18-30 x 9.5-18.5 um; Heinemann 1980, 1956b). Agaricus

rotalis is morphologically nearly indistinguishable from A. endoxanthus (cf.

comparison in Kerrigan et al. 2005), but they differ by three heteromorphisms

in their ITS1+2 sequences.

Acknowledgments

We thank the National Natural Science Foundation of China (Project ID: 31000013

to Ruilin Zhao), Key Laboratory of Forest Disaster Warning and Control in Yunnan

Province (Project ID: ZK09A107), the Bio-Asie project “Inventory and taxonomy of

Agaricus species in Thailand, Laos, Malaysia and Yunnan (China); domestication and

evaluation of species of nutritional or medicinal interest’, and BRN grant (BRN049/2553)

is acknowledged for support to study the taxonomy of potentially edible mushrooms in

Thailand. We thank the USA National Science Foundation (PEET-grant DEB-0118776 to

Desjardin) for partial support of Zhao and Desjardin. The Global Research Network for

Fungal Biology and King Saud University are also thanked for support. Drs. Annemieke

Verbeken, Xianghua Wang, and Zai-Wei Ge are thanked for helping us in preparing the

final submission.

Literature cited

Callac P, Guinberteau J. 2005. Morphological and molecular characterization of two novel species

of Agaricus section Xanthodermatei. Mycologia 97: 416-424.

http://dx.doi.org/10.3852/mycologia.97.2.416

Cappelli A. 1984. Agaricus L.: Fr. (Psalliota Fr.). Libreria editrice Biella Giovanna, Saronno.

Challen MP, Kerrigan RW, Callac P. 2003. A phylogenetic reconstruction and emendation of

Agaricus section Duploannulatae. Mycologia 95(1): 61-73. http://dx.doi.org/10.2307/3761962

Geml J, Geiser DM, Royse DJ. 2004. Molecular evolution of Agaricus species based on ITS and LSU

rDNA sequences. Mycol. Prog. 3(2): 157-176. http://dx.doi.org/10.1007/s11557-006-0086-8

Heinemann P. 1956a. Champignons récoltés au Congo belge par Mme M. Goossens-Fontana, II.

Agaricus Fr. s.s. Bull Jard Bot Brux 26: 1-127.

Agaricus murinocephalus sp. nov. (Thailand) ... 195

Heinemann P. 1956b. Sur divers facteurs agissant sur la formation des primordiums de Agaricus

edulis en culture pure, VIlle Congrés de Bot., C R des séances et rapports et rapports et comm.

déposées lors du Congres. dans les sect. 18, 19 et 20: 48-50.

Heinemann P. 1978. Essai d'une clé de determination des genres Agaricus et Micropsalliota. Sydowia

30: 6-37.

Heinemann P. 1980. Les genres Agaricus et Micropsalliota en Malaisie et en Indonésie. Bull Jard Bot

Nat Belg 50: 3-68.

Kerrigan RW. 1986. Agaricales of California. Vol. 6. Agaricaceae. Mad River Press, Eureka.

California.

Kerrigan RW, Callac P, Guinberteau J, Challen MP, Parra LA. 2005. Agaricus section Xanthodermatei:

a phylogenetic reconstruction with commentary on taxa. Mycologia 97: 1292-1315.

http://dx.doi.org/10.3852/mycologia.97.6.1292

Kornerup A, Wanscher JH. 1978. Methuen handbook of color. Third Edition. Eyre Methuen,

London.

Largent DL. 1986. How to identify mushrooms to genus, vols 1-5. Mad River Press, Eureka,

California.

Nauta MM. 2001. Agaricus L. and Allopsalliota Naunta et Bas. 23-62, in: ME Noordeloos et al. (eds).

Flora Agaricina Neerlandica, Vol. 5, Family Agaricaceae. Lisse, A.A. Balkema Publishers.

Parra LA. 2008. Agaricus L. Allopsalliota Nauta & Bas, Edizioni Candusso, Alassio.

Parra LA, Mua A, Cappelli A, Callac P. 2011. Agaricus biannulatus sp. nov., a new species of the

section Xanthodermatei collected in Sardinia and Sicily. Micol. Veget. Medit. 26 (1): 3-20.

Pegler DN. 1977. A preliminary agaric flora of east Africa. Kew Bull 6: 1-615.

Pegler DN. 1986. Agaric flora of Sri Lanka. Kew Bull 12: 1-519.

Peterson KR, Desjardin DE, Hemmes DE. 2000. Agaricales of the Hawaiian Islands.6. Agaricaceae

I. Agariceae: Agaricus and Melanophyllum. Sydowia 52(2): 204-257.

Singer R. 1948. Diagnoses Fungorum Novorum Agaricalium. Sydowia 2: 26-42.

Van de Putte K, Nuytinck J, Stubbe D, Le HT, Verbeken A. 2010. Lactarius volemus sensu lato

(Russulales) from northern Thailand: morphological and phylogenetic species concepts

explored, Fungal Divers. 45: 99-130. http://dx.doi.org/10.1007/s13225-010-0070-0

Zhao RL, Desjardin DE, Soytong K, Perry BA, Hyde KD. 2010. A monograph of Micropsalliota

in Northern Thailand based on morphological and molecular data. Fungal Divers. 45: 33-79.

http://dx.doi.org/10.1007/s13225-010-0050-4

Zhao RL, Karunarathna S, Raspé O, Parra LA, Guinberteau J, Moinard M, Kesel AD, Barroso G,

Courtecuisse R, Hyde KD, Guelly AK, Desjardin DE, Callac P. 2011. Major clades in tropical

Agaricus. Fungal Divers. 51: 279-296. http://dx.doi.org/10.1007/s13225-011-01360-7

MY COTAXON

http://dx.doi.org/10.5248/122.197

Volume 122, pp. 197-205 October-December 2012

Hymenochaete in China. 4.

H. parmastoi sp. nov. and H. ustulata new to China

SHUANG-HuI HE” & HaI-Jiao LI

Institute of Microbiology, P.O. Box 61, Beijing Forestry University, Beijing 100083, China

* CORRESPONDENCE TO: heshh1981@yahoo.cn

ABSTRACT — Hymenochaete parmastoi is described as new to science. It is similar to H. minor

and H. rhabarbarina, but morphological and molecular (ITS rDNA sequences) evidence

show that they are distinct from each other. Hymenochaete ustulata, which was collected

from Guangdong Province, southern China, is newly recorded in China. It is characterized

by anatomical structure (in sect. Paragymnochaete and with abundant crystals). Illustrated

descriptions of these two species are provided.

Key worps — Hymenochaetaceae, phylogeny, taxonomy, wood-inhabiting fungi

Introduction

The poroid wood-inhabiting fungi in China have been intensively studied

during the last decade (Yuan & Dai 2008a,b; Dai 2010, 2011, 2012; Cui et al.

2011; Dai & Cui 2011; Zhou & Dai 2012), but the corticioid fungi are still

poorly studied. As a contribution to the studies of the corticioid fungi in China,

a project dealing with the taxonomy and phylogeny of the genus Hymenochaete

Lév. (Léveillé 1846) is in progress and several intensive surveys in south and

southwest China have been carried out since 2010. Among the 1000 specimens

collected, several new species and Chinese new records have been found (He &

Li 2011a,b, 2012a,b, He & Dai 2012).

More recently, careful morphological study and molecular analysis of some

Hymenochaete specimens from several provinces and autonomous regions

in temperate and subtropical areas of China indicate that they represent an

undescribed species, which we describe here as H. parmastoi.

One additional specimen collected from Guangdong Province is identified

as H. ustulata, a rare species new to Chinese fungal flora. This is the first

report outside its type locality. Illustrated descriptions of these two species are

provided in this paper.

198 ... He & Li

Materials & methods

MorRPHOLOGICAL STUDIES: Voucher specimens are deposited in the herbarium of

Beijing Forestry University (BJFC), and the microscopic procedure follows Dai (2010).

In presenting the size range of spores and setae, 5% of the measurements were excluded

from each end of the range, and the measurements were given in parentheses. In the

text the following abbreviations are used: L = mean spore length (arithmetical average

of all spores), W = mean spore width (arithmetical average of all spores), Q = variation

in the L/W ratios between the specimens studied (quotient of the mean spore length

and the mean spore width of each specimen), n = the number of spores measured from

given number of specimens. IKI stands for Melzer’s reagent, KOH for 5% potassium

hydroxide, and CB is the abbreviation of Cotton Blue in lactic acid. IKI- = inamyloid

and nondextrinoid, CB- = acyanophilous. Special color terms follow Petersen (1996).

DNA EXTRACTION AND SEQUENCING: The F-130 Phire® Plant Direct PCR Kit (Finnzymes,

Finland) was employed for DNA extraction and PCR amplification from herbarium

specimens according to the manufacturer's instructions. Approximately 700 base pairs

of the ITS rDNA were amplified with primers ITS5 (GGA AGT AAA AGT CGT AAC AAG

G) and ITS4 (tcc Tcc GcT TAT TGA TAT GC; White et al. 1990), using the following

procedure: initial denaturation at 98°C for 5 min, followed by 39 cycles of 98°C for 5 s,

58°C for 5 s and 72°C for 5 s, and a final extension of 72°C for 10 min. DNA sequencing

was performed at Beijing Genomics Institute, and all new sequences were deposited in

GenBank (http://www.ncbi.nlm.nih.gov).

PHYLOGENETIC ANALYSIS: The phylogeny was inferred from the ITS sequences of 51

Hymenochaete species. Pseudochaete corrugata (Fr.) $.H. He & Y.C. Dai and P. tabacina

(Sowerby) T. Wagner & M. Fisch. were selected as outgroups. The sequences were aligned

using the ClustalX 1.83 (Chenna et al. 2003). Alignments were optimized manually in

BioEdit 7.0.5.3 (Hall 1999). Maximum parsimony analysis were performed using PAUP*

4.0b10 (Swofford 2002). Gaps in the alignments were treated as missing data. Trees

were generated using 100 replicates of random stepwise addition of sequence and tree-

bisection reconnection (TBR) branch-swapping algorithm, with all characters given

equal weight. Branch supports for all parsimony analysis were estimated by performing

1000 bootstrap replicates (Felsenstein 1985) with a heuristic search of 10 random-

addition replicates for each bootstrap replicate. The tree length (TL), consistency

indices (CI), retention indices (RI), rescaled consistency indices (RC) and homoplasy

index (HI) were calculated for each tree generated. Trees were figured in Treeview 1.6.6

(Page 1996).

Taxonomy

Hymenochaete parmastoi S.H. He & Hai J. Li, sp. nov. Fics 1-2

MycoBank MB 800487

Differs from other Hymenochaete species by its yellowish brown basidiocarps, encrusted

setae, and ellipsoid to ovoid basidiospores.

Type: China. Xizang Autonomous Region, Bomi County, on fallen angiosperm trunk,

20.IX.2010, He 367 (holotype, BJFC; GenBank, JQ780061).

Hymenochaete parmastoi sp. nov. (China) ... 199

Fic. 1. Basidiocarps of Hymenochaete parmastoi (holotype).

Erymo_oey: honoring Erast Parmasto, 1928-2012, eminent Estonian mycologist and

author of many significant papers on Hymenochaete.

FruITBoby: Basidiocarps annual, effused, closely adnate, coriaceous, first as

small round or irregular colonies, later confluent up to 15 cm or more in longest

dimension, 50-250 um thick in section. Hymenophore smooth, cinnamon

to clay-buff, not cracked or with numerous deep crevices with age; margin

thinning out, distinct, whitish to yellowish when juvenile, becoming indistinct,

concolorous with hymenophore surface when mature.

HyPHAL STRUCTURE: Hyphal system monomitic; generative hyphae without

clamp connections; tissue darkening but otherwise unchanged in KOH.

SUBICULUM: Tomentum and cortex absent. Hyphal layer locally present,

thin. Generative hyphae hyaline to yellowish brown, thin- to thick-walled with

a wide lumen, septate, usually branched at a right angle, loosely to densely

interwoven, 2-4 um in diam.

STRATIFIED HYMENIUM: Hyphae in this layer similar to those in subiculum,

yellowish brown, thick-walled, more or less agglutinated, interwoven, 2-3

um in diam. Setal layer composed of 1-3 rows of overlapping setae. Setae

not numerous, scattered, subulate, reddish brown, with acute tips, projecting

up to 30 um above the hymenium, (30-)40-75(-95) x (5-)6-10 um, usually

enmeshed in thick hyphal sheath, this usually slightly or heavily encrusted with

yellowish or brownish amorphous matters in the tip part. Cystidia and hyphidia

absent, but hyphal ends sometimes present in the hymenium, some encrusted

200 ... He & Li

“10pm

Fic. 2. Microscopic structures of Hymenochaete parmastoi (drawn from the holotype).

a: Basidiospores. b: Basidia and basidioles. c: Setae.

with amorphous matters. Basidia clavate, with four sterigmata and a simple

septum at base, walls thickening at basal part, 15-20 x 3-4.8 um; basidioles in

shape similar to basidia, but slightly smaller.

Spores: Basidiospores ellipsoid to ovoid, hyaline, thin-walled, smooth, IKI-

, CB-, (3.8-)4-5.5(-6) x (2.5-)2.6-3.2(-3.5) um, L = 4.84 um, W = 2.94 um,

Q = 1.55-1.76 (n = 210/7).

ADDITIONAL SPECIMENS EXAMINED: CHINA. ANHUI PRov., Huangshan County,

Yellow Mountain National Park, on fallen twig of Rhododendron, 20.X.2010, He 431

(BJFC); GUANGxI AUTONOMOUS REGION, Xing’an County, Maoershan Nat. Res., on

fallen angiosperm twig, 19.VIII.2011, He 867 (BJFC; GenBank, JQ780063); GuIzHoU

Prov., Leishan County, Leigongshan Nat. Res., on fallen angiosperm twig, 24.VIHI.2010,

He 266 (BJFC), He 277 (BJFC; GenBank, JQ780064); X1IZANG AUTONOMOUS REGION,

Linzhi County, Lulang, on fallen angiosperm twig, 24.1X.2010, He 388 (BJFC; GenBank,

JQ780062), He 391 (BJFC); Gadinggou, on fallen angiosperm twig, 25.IX.2010, He 402

(BJFC); YUNNAN Prov., Zhanyi County, Zhujiangyuan Forest Park, on dead angiosperm

tree, 11.V1I.2011, He 725 (BJFC); Chuxiong, Zixishan Forest Park, on fallen angiosperm

trunk, 11.VI.2011, He 741 (BJFC).

Hymenochaete ustulata G.A. Escobar ex J.C. Léger,

Cryptog. Mycol. 11: 309, 1990 Fics 3-4

FRuITBoby: Basidiocarps annual, effused, closely adnate, coriaceous, first as

small colonies, later confluent up to 5 cm or more in longest dimension, 100-150

Hymenochaete parmastoi sp. nov. (China) ... 201

Fic. 3. Basidiocarps of Hymenochaete ustulata (He 104).

um thick in section. Hymenophore smooth or with scattered small tubercles,

vinaceous brown to reddish brown when fresh, becoming pale mouse-gray to

vinaceous gray after dry, usually not cracked; margin thinning out, indistinct,

paler or concolorous with hymenophore surface.

HyPHAL STRUCTURE: Hyphal system monomitic; generative hyphae without

clamp connections; tissue darkening but otherwise unchanged in KOH.

SuBICULUM: Tomentum and hyphal layer absent. Cortex well developed,

composed of strongly agglutinated hyphae, 20-70 um thick.

STRATIFIED HYMENIUM: Generative hyphae yellowish brown, thick-walled,

agglutinated, 2-3.5 um in diam. Setal layer thickening, composed of several

rows of overlapping setae. Agglomerates of crystals frequently present in

the setal layer and subhymenium, 10-30(-50) um in diam. Setae numerous,

subulate, reddish brown, with acute tips, some enmeshed with a thin hyphal

sheath, projecting up to 40 um above the hymenium, (30-)45-70(-75) x 5-9

um. Cystidia and hyphidia absent. Basidia clavate, with four sterigmata and a

simple septum at base, walls thickening at basal part, 15-18 x 3-4 um; basidioles

in shape similar to basidia, but smaller.

Spores: Basidiospores ellipsoid, hyaline, thin-walled, smooth, IKI-, CB-,

4-5 x 2.2-2.8 um, L = 4.42 um, W = 2.49 um, Q = 1.78 (n = 30/1).

SPECIMEN EXAMINED: CHINA. GUANGDONG PRov., Shixing County, Chebaling Nat.

Res., on rotten angiosperm trunk, 24.VI.2010, He 104 (BJFC; GenBank, JQ780066).

202 ... He & Li

ee ae

CS aay EE

Si Cen

Gy: “Gps Gw

Ah Sey ee ont

10 um

10 ym

Fic. 4. Microscopic structures of Hymenochaete ustulata (drawn from He 104).

a: Basidiospores. b: Basidia and basidioles. c: Setae.

Phylogenetic results

Seven ITS sequences were newly obtained in this study (GenBank accession

numbers JQ780061-JQ780067). The alignment of the ITS sequences of 53

taxa resulted in 786 sites with 398 parsimony informative characters. One

strict consensus tree was yielded from the analysis with TL = 2056, CI = 0.428,

RI = 0.645, RC = 0.276 and HI = 0.572 (Fic. 5). The strict consensus tree placed

Hymenochaete taxa well apart from the outgroups, with H. parmastoi strongly

supported (bootstrap value = 100%) as a separate lineage and confirming

H. parmastoi as phylogenetically distinct from any sampled species. The tree

also showed H. parmastoi closely related to H. minor S.H. He & Y.C. Dai and

H. ustulata closely related to H. rhabarbarina (Berk.) Cooke.

Discussion

Hymenochaete parmastoi is characterized by yellowish brown basidiocarps,

encrusted setae, and ellipsoid to ovoid basidiospores. In both morphological

and phylogenetic aspects, H. parmastoi seems very close to H. minor (with a

100% bootstrap value), which also has setae encrusted with amorphous matter.

However, H. minor differs from H. parmastoi by its shorter setae (25-50 um)

and smaller basidiospores (3-4.5 x 1.7-2 um; He & Dai 2012). Moreover,

H. parmastoi grows mostly in temperate areas, while H. minor seems to be a

tropical species.

Hymenochaete parmastoi sp. nov. (China) ... 203

H. parmastoi He277 JQ780064*

100] 77, parmastoi He867 JQ780063*

100| | 4. parvnastoi He388 JQ780062*

H. parmastoi He367 JQ780061*

62] 140) K minor He933 JQ279555

H. minor He941 JQ279557

H. megaspora He302 JQ279553

1007 4. rhododendricola He392 JQ279576

H. rhododendricola He389 JQ279577

72y— H. ochromarginata Hed? JQ279579

100) 4. rubiginosa He1049 JQ716407

H. tasmanica He449 JQ279582

55- H. paucisetigera Cur?845 JQ279560

100\- 77 asetosa Dail0756 JQ279559

H. odontoides Dail1635 JQ279563

H. fuiva He640 JQ279565

H. yunnanensis He709 JQ279571

96 H, anomaia JQ279566 He592

H. luteobadia He8 JQ279569

H. separabilis He460 JQ279572

81 H. rhabarbarina He280 JQ279574

H. ustulata Hel04 JQ780066*

H. ulmicola He864 JQ780065*

98r H. adusta He207 JQ279523

H. subjerruginea Cui 8122 JQ279521

H. xerantica Cui 9209 JQ279519

H. berteroi He133 JQ279524

H. rheicolor He503 JQ279530

og | WOO H. attenuata He28 JQ279526

H. villosa He537 JQ279528

61 64-- H. setipora Cui6301 JQ279515

961'— 7 porioides Cui7609 JQ279517

H. cyclolameliata Cur?39 JQ279513 3

H. nanospora He475 JQ279531

H. acerosa He338 JQ279543

H, fuliginosa He785 JQ279545

64 H. cinnamomea He755 JQ279548

H. minuscula He253 JQ279546

H. epichiora He525 JQ279549

H. unicolor He468a JQ279551

97 H. huangshanensis He432 JQ279533

H., longispora He101 JQ279536

H. senatoumbrina He349 JQ279540

H. tenuis He779 JQ279538

H. muroiana Hel72 JQ279541

100 1007 H. floridea He536 JQ279597

100 H. sphaericola He303 JQ279599

H. cruenta He766 JQ279595

95 H. legeri He1028 JQ?780067*

H. spathulata He685 JQ279591

52 100 H. innexa He555 JQ279584

H. tropica He661 JQ279588

72 100_+ H. duportii CBS939.96 DQ404386

zc H. hydnoides He245 JQ279590

H. sphaerospora He691 JQ279593

H. murina He569 JQ716406

Pseudochaete corrugata He761 JQ279606

10 Pseudochaete tabacina He390 JQ279610

Fic. 5. Strict consensus tree obtained from Maximum Parsimony analysis of ITS sequences of

Hymenochaete. Pseudochaete corrugata and P. tabacina were used as outgroups. Newly generated

sequences are those with *. Parsimony bootstrap values (>50%) are shown.

204 ... He & Li

Two other species, H. rhabarbarina and H. rhododendricola S.H. He & Hai J.

Li, also have setae encrusted with amorphous matter. However, H. rhabarbarina

differs from H. parmastoi by its well-developed hyphal layer, encrusted hyphae,

and longer setae (60-100 um; Parmasto 2001), while H. rhododendricola has

longer setae (80-130 um) and larger basidiospores (6-7 x 4-5 um; He & Li

2011a) than H. parmastoi. These two morphologically close allies are distantly

related to the H. parmastoi clade in the phylogram.

Hymenochaete ustulata was previously reported only in Brazil. The species

is diagnosed by its anatomical structure, which contains a well-developed

cortex without a hyphal layer (sect. Paragymnochaete) and an abundance of

crystal agglomerates. The similar H. separata G. Cunn. can be separated by its

smaller setae (35-45 x 6-7 um) and larger basidiospores (5-6.5 x 3-3.5 um;

Escobar 1978; Parmasto & Gilbertson 2005). Hymenochaete dissimilis G. Cunn.

shares similar setae, basidiospores, and agglomerated crystals but differs from

H. ustulata in its thicker basidiocarps (<750 um) and lack of cortex (Cunningham

1957; Léger 1998).

He & Dai (2012) conducted a taxonomic and phylogenetic study of

Hymenochaete and allied genera in China in which they combined five species

of Hydnochaete Bres. and Cyclomyces Kunze ex Fr. in Hymenochaete and

transferred five species of Hymenochaete were transferred to Pseudochaete

T. Wagner & M. Fisch. (nom. illegit., non Pseudochaete West & G.S. West

[Chlorophyta]). Including the two species reported in this paper, a total of 55

Hymenochaete species have been recorded in China (He & Dai 2012; He & Li

2012b).

Acknowledgments

The authors would like to express their deep thanks to Drs. Hai-Sheng Yuan (Institute

of Applied Ecology, Chinese Academy of Sciences) and Xiao-Yong Liu (Institute of

Microbiology, Chinese Academy of Sciences) for serving as pre-submission reviewers

and to Prof. Yu-Cheng Dai (Institute of Applied Ecology, Chinese Academy of Sciences)

for improving the manuscript. This study was supported by the National Natural Science

Foundation of China (No. 31000006).

Literature cited

Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson JD. 2003. Multiple

sequence alignment with the Clustal series of programs. Nucleic Acids Res 31: 3497-3500.

http://dx.doi.org/10.1093/nar/gkg500

Cui BK, Du P, Dai YC. 2011. Three new species of Inonotus (Basidiomycota, Hymenochaetaceae)

from China. Mycol Prog 10: 107-114. http://dx.doi.org/10.1007/s11557-010-0681-6

Cunningham GH. 1957. Thelephoraceae of New Zealand XIV - The genus Hymenochaete. Trans

Roy Soc New Zealand 85: 1-51.

Dai YC. 2010. Hymenochaetaceae (Basidiomycota) in China. Fungal Divers 45: 131-343.

http://dx.doi.org/10.1007/s13225-010-0066-9

Hymenochaete parmastoi sp. nov. (China) ... 205

Dai YC. 2011. A revised checklist of corticioid and hydnoid fungi in China for 2010. Mycoscience

52: 69-79. http://dx.doi.org/10.1007/s10267-010-0068-1

Dai YC. 2012. Polypore diversity in China with an annotated checklist of Chinese polypores.

Mycoscience 53: 49-80. http://dx.doi.org/10.1007/s10267-011-0134-3

Dai YC, Cui BK. 2011. Fomitiporia ellipsoidea has the largest fruiting body among the fungi. Fungal

Biol 115: 813-814. http://dx.doi.org/10.1016/j.funbio.2011.06.008

Escobar GA. 1978. Contribution towards a monograph of the neotropical species of Hymenochaete.

Ph. D. dissertation, University of Washington. University Microfilms, Ann Arbor. 227 p.

Felsenstein J. 1985. Confidence intervals on phylogenetics: an approach using bootstrap. Evolution

39: 783-791. http://dx.doi.org/10.2307/2408678

Hall TA. 1999. Bioedit: a user-friendly biological sequence alignment editor and analysis program

for Windows 95/98/NT. Nucleic Acids Symp Ser 41: 95-98.

He SH, Dai YC. 2012. Taxonomy and phylogeny of Hymenochaete and allied genera of

Hymenochaetaceae (Basidiomycota) in China. Fungal Divers 56: 77-93.

http://dx.doi.org/10.1007/s13225-012-0174-9

He SH, Li HJ. 2011a. Hymenochaete rhododendricola and H. quercicola spp. nov. (Basidiomycota,

Hymenochaetales) from Tibet, southwestern China. Nord J Bot 29: 484-487.

http://dx.doi.org/10.1111/j.1756-1051.2011.01217.x

He SH, Li HJ. 2011b. Two new species of Hymenochaete (Hymenochaetales) from China. Mycotaxon

115: 375-382. http://dx.doi.org/10.5248/115.375

He SH, Li HJ. 2012a [“2011”]. Hymenochaete in China. 2. A new species and three new records

from Yunnan Province. Mycotaxon 118: 411-422. http://dx.doi.org/10.5248/118.411

He SH, Li HJ. 2012b. Hymenochaete in China 3. Three species new to China from Guangxi

Autonomous Region and Jilin Province. Mycosystema 31: (in press)

Léger JC. 1998. Le genre Hymenochaete Léveillé. Biblioth Mycol 171: 1-319.

Léveillé JH. 1846. Descriptions de champignons de l’herbier du Muséum de Paris. Ann Sci Nat Bot,

de ser, 58111167.

Page RMD. 1996. TreeView: an application to display phylogenetic trees on personal computers.

Comput Appl Biosci 12: 357-358.

Parmasto E. 2001. Hymenochaetoid fungi (Basidiomycota) of North America. Mycotaxon 79:

107-176.

Parmasto E, Gilbertson RL. 2005. The genus Hymenochaete (Basidiomycota, Hymenomycetes) in the

Hawaiian Islands. Mycotaxon 94: 189-214.

Petersen JH. 1996. Farvekort. The Danish Mycological Society's colour-chart. Foreningen til

Svampekundskabens Fremme, Greve. 6 p.

Swofford DL. 2002. PAUP*: Phylogenetic analysis using parsimony (*and other methods). Version

4.0b10. Sinauer Associates, Sunderland, Massachusetts.

White TJ, Bruns TD, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal

RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR protocols, a guide to

methods and applications. Academic, San Diego.

Yuan HS, Dai YC. 2008a. Two new species of Junghuhnia (Basidiomycota, Polyporales), and a key to

the species of China. Nordic J Bot 26: 96-100.

http://dx.doi.org/10.1111/j.1756-1051.2008.00169.x

Yuan HS, Dai YC. 2008b. Polypores from northern and central Yunnan Province, Southwestern

China. Sydowia 60: 147-159.

Zhou LW, Dai YC. 2012. Phylogeny and taxonomy of Phylloporia (Hymenochaetales): new species

and a worldwide key to the genus. Mycologia 104: 211-222. http://dx.doi.org/10.3852/11-093

MY COTAXON

http://dx.doi.org/10.5248/122.207

Volume 122, pp. 207-220 October-December 2012

Phylogenetic systematics of the Gigasporales

GLADSTONE ALVES DA SILVA’, LEONOR CosTA MAIA! & FRITZ OEHL?

"Departamento de Micologia, CCB, Universidade Federal de Pernambuco,

Av. Prof. Nelson Chaves s/n, Cidade Universitaria, 50670-420, Recife, PE, Brazil

Federal Research Institute Agroscope Reckenholz-Tanikon ART, Organic Farming Systems,

Reckenholzstrasse 191, CH-8046 Ziirich, Switzerland

“CORRESPONDENCE TO: gladstonesilva@yahoo.com

AsstRract — ‘The classification, phylogeny, and evolutionary pathways of the Gigasporales

are re-evaluated based on concomitant morphological and molecular phylogenetic analyses.

Only Cetraspora was not supported in the morphology-based tree, while Quatunica formed

a monophyletic group with its sister genus Dentiscutata. Only a few taxa were not completely

supported in the SSU rDNA phylogenetic analyses, namely Dentiscutata and Fuscutata

(Dentiscutataceae) and Racocetra and Cetraspora (Racocetraceae). However, all trees generated

by the LSU, SSU (rDNA), and $-tubulin genes supported the existence of the families with

strong support for all genera represented in the LSU rDNA and 6-tubulin analyses. In

conclusion, the current classification of the Gigasporales has a strong morphological and

molecular congruency.

Key worps — Glomeromycetes, gigasporoid, scutellosporoid

Introduction

The arbuscular mycorrhizal (AM) fungi form a symbiotic association

with plants, being the most important mutualism between plants and fungi

in the nature. These fungi are grouped in the phylum Glomeromycota, in

which the order Gigasporales (Oehl et al. 2011a) with 54 currently described

species (TABLE 1) forms a clade of outstanding interest and particularity for

taxonomic, phylogenetic, and ecological reasons. Fungi in this order were

grouped according to their spore formation mode on sporogenous cells and

phylogenetic analyses of the rDNA and 6-tubulin genes (Oehl et al. 2011a).

Besides, members of Gigasporales do not form vesicles in the colonized roots

but rather form auxiliary cells in mycorrhizospheric soils. Recently, Dotzler et

al. (2006) reported ~400 million year-old fossil scutellosporoid spores with very

structures similar to those in Gigasporales (bulbous bases, germinal walls, and

208 ... Silva, Maia & Oehl

TABLE 1. Species in Gigasporales”*

Dentiscutataceae F.A. Souza et al.

Dentiscutata biornata (Spain et al.) Sieverd. et al.

D. cerradensis (Spain & J. Miranda) Sieverd. et al.

D. colliculosa B.T. Goto & Oehl

D. hawaiiensis (Koske & Gemma) Sieverd. et al.

D. heterogama (T.H. Nicolson & Gerd.) Sieverd.

et al.

D. nigerita Khade

D. nigra (J.F. Redhead) Sieverd. et al.

D. reticulata (Koske et al.) Sieverd. et al.

D. scutata (C. Walker & Dieder.) Sieverd. et al.

Fuscutata aurea Oehl et al.

EF heterogama Oehl et al.

FE. rubra (Stiirmer & J.B. Morton) Oehl et al.

EF, savannicola (R.A. Herrera & Ferrer) Oehl et al.

E trirubiginopa (X.L. Pan & G. Yun Zhang) Oehl

et al.

Quatunica erythropus (Koske & C. Walker) EA.

Souza et al.

Gigasporaceae J.B. Morton & Benny

Gigaspora albida N.C. Schenck & G.S. Sm.

G. alboaurantiaca W.N. Chou

G. candida Bhattacharjee et al.

G. decipiens I.R. Hall & L.K Abbott

G. gigantea (T.H. Nicolson & Gerd.) Gerd. &

Trappe

G. margarita W.N. Becker & IR. Hall

G. ramisporophora Spain et al.

G. rosea T.H. Nicolson & N.C. Schenck

Intraornatosporaceae B.T. Goto & Oehl

Intraornatospora intraornata (B.T. Goto & Oehl)

B.T. Goto et al.

C. pellucida (T.H. Nicolson & N.C. Schenck) Oehl

et al.

C. striata (Cuenca & R.A. Herrera) Oehl et al.

Racocetra alborosea (Ferrer & R.A. Herrera) Oehl

et al.

R. beninensis Oehl et al.

R. castanea (C.Walker) Oehl et al.

R. coralloidea (Trappe et al.) Oehl et al.

R. fulgida (Koske & C. Walker) Oehl et al.

R. gregaria (N.C. Schenck & T.H. Nicolson) Oehl

et al.

R. minuta (Ferrer & R.A. Herrera) Oehl et al.

R. persica (Koske & C. Walker) Oehl et al.

R. tropicana Oehl et al.

R. undulata T.C. Lin & C.H. Yen

R. verrucosa (Koske & C. Walker) Oehl et al.

R. weresubiae (Koske & C. Walker) Oehl et al.

Scutellosporaceae Sieverd. et al.

Orbispora pernambucana (Oehl et al.) Oehl et al.

O. projecturata (Kramad. & C. Walker) Oehl et al.

Scutellospora arenicola Koske & Halvorson

S. aurigloba (I.R. Hall) C. Walker & EE. Sanders

S. calospora (T.H. Nicolson & Gerd.) C. Walker &

EE. Sanders

S. crenulata R.A. Herrera et al.

S. dipapillosa (C. Walker & Koske) C. Walker &

EE. Sanders

S. dipurpurescens J.B. Morton & Koske

S. spinosissima C. Walker & Cuenca

S. tricalypta (R.A. Herrera & Ferrer) C. Walker &

EE. Sanders

*The nomenclature and its authorities are based on

Goto et al. (2009, 2010, 2011, 2012), Khade (2010),

Lin & Yen (2011), Mello et al. (2012), Oehl et al.

(2008, 2010, 2011b,d), Silva et al. (2008), and Tchabi

et al. (2009).

Placement of S. spinossisima is tentative because its

germ shield morphology and phylogeny are not yet

sufficiently resolved and need re-analysis.

Paradentiscutata bahiana Oehl et al.

P. maritima B.T. Goto et al.

Racocetraceae Oeh| et al.

Cetraspora armeniaca (Btaszk.) Oehl et al.

C. gilmorei (Trappe & Gerd.) Oehl et al.

C. helvetica Oehl et al.

C. nodosa (Blaszk.) Oehl et al.

germination shields). This discovery indicates diversification of Gigasporales

earlier than suggested by other researchers (Phipps & Taylor 1996, Redecker

et al. 2000).

Until 2008 little attention was given to Gigasporales classification, although

some problems regarding the monophyly and position of Gigaspora and

Scutellospora had been discussed earlier (Kramadibrata et al. 2000, Souza et al.

2005, Silva et al. 2006). Studying the morphological phylogeny of AM fungi,

Morton (1990) reported Gigaspora as basal to the former Scutellospora, and

his results were supported by ontogenetic studies (Bentivenga & Morton 1995,

Morton 1995, Franke & Morton 1994) and fatty acid profiles (Bentivenga &

Phylogeny of the Gigasporales ... 209

Morton 1996). On the other hand, molecular phylogenetic analyses increasingly

demonstrated that Gigaspora might be monophyletic with Scutellospora basal

and polyphyletic (Simon et al. 1993, Souza et al. 2005, Redecker & Raab 2006).

Based on concomitant morphological and molecular phylogenetic analyses,

Oehletal. (2008) confirmedthe former Scutellosporaas polyphyleticand proposed

four families (Dentiscutataceae, Gigasporaceae, Racocetraceae, Scutellosporaceae)

and seven genera (Cetraspora, Dentiscutata, Fuscutata, Gigaspora, Quatunica,

Racocetra, Scutellospora) within the sporogenous cell forming AM fungi, ice.

the Gigasporales. Countering this revision of Scutellospora, Morton & Msiska

(2010) reported that such segregation destabilized the taxonomy of the group,

proposing that beside the former Gigaspora and Scutellospora, only one genus

(Racocetra) described by Oehl et al. (2008) was valid. However, Kriiger et al.

(2012) provided support for some more genera described by these authors, and

a several recent studies with a broader database (e.g. Goto et al. 2010, 2011,

2012, Oehl et al. 2010, 2011b) sustain the revision by Oehl et al. (2008).

Currently, Gigasporales comprises five families (Dentiscutataceae,

Gigasporaceae, Intraornatosporaceae, Racocetraceae, Scutellosporaceae) and

ten genera (Cetraspora, Dentiscutata, Fuscutata, Gigaspora, Intraornatospora,

Orbispora, Paradentiscutata, Quatunica, Racocetra, Scutellospora) (Oehl et

al. 2008, 2011b, Goto et al. 2012). We wish here to evaluate the classification,

phylogeny, and evolutionary pathways in Gigasporales.

Materials & methods

Morphological phylogenetic analyses

As in Morton & Msiska (2010), we selected just 27 species from Gigasporales and 23

characters to construct a matrix for the morphological phylogenetic analysis. In general,

characters and the plesiomorphic and apomorphic character states were defined and

coded as in Morton & Msiska (2010). We did not include the Intraornatosporaceae

or Intraornatospora, Orbispora, and Paradentiscutata in our morphological analysis,

because these taxa were described after the Morton & Msiska (2010) study.

The phylogenetic analysis and tree construction were performed using Phylogenetic

Analysis Using Parsimony (PAUP 4.0b10) (Swofford 2003). The matrix-generated data

were calculated by maximum parsimony (MP). Acaulospora mellea and A. laevis served

as outgroups.

Evolutionary phylogenetic terms used in this study (from Wiley et al. 1991)

include (1) homoplastic = a character shared by two taxa that does not meet the

criteria of homology (i.e., the character does not derive from a common ancestor), (2)

plesiomorphic = ancestral character state and apomorphic = derived character state, (3)

synapomorphy = a derived character state shared by a group of species with evidence

of a common ancestor, (4) symplesiomorphy = an ancestral character state shared by a

group of species but useless for phylogenetic analyses since clearly representing common

ancestry for all the fungi being analyzed.

210 ... Silva, Maia & Oehl

Molecular phylogenetic analyses

Partial sequences of rRNA (SSU and LSU) and 6-tubulin genes were analyzed

independently to reconstruct the phylogeny of the Gigasporales. Only B-tubulin exon

regions were analyzed, with introns excluded.

Sequences (all obtained from the National Center for Biotechnology Information-

NCBI) were aligned with ClustalX (Larkin et al. 2007) and edited with BioEdit (Hall

1999) to obtain a final alignment.

Prior to phylogenetic analysis, the nucleotide substitution model was estimated using

Topali 2.5 (Milne et al. 2004). Bayesian (two runs over 1 x 10° generations with a burnin

value of 2500) and maximum likelihood (1000 bootstrap) analyses were executed,

respectively, in MrBayes 3.1.2 (Ronquist & Huelsenbeck 2003) and PhyML (Guindon

& Gascuel 2003), launched from Topali 2.5. Neighbor-joining (established with the

same model used to construct the Bayesian tree) and maximum parsimony analysis

were performed using PAUP*4b10 (Swofford 2003) with 1000 bootstrap replications.

Pacispora scintillans sequences were used as outgroup for the SSU and LSU rRNA

analyses, and Acaulospora mellea was outgroup for $-tubulin analysis.

Results

Molecular phylogenetic analysis

All LSU, SSU (rDNA), and B-tubulin gene trees support the families described

in the Gigasporales (Fics 1-3). The LSU rDNA sequence-based phylogenies

support all ten genera (Fic. 1), and the B-tubulin tree supports all genera with

species included in the analysis (Fic. 2). Only the SSU rDNA phylogenetic

tree did not fully support a few taxa in the Dentiscutataceae and Racocetraceae

(Fic. 3) with no separation shown between Dentiscutata and Fuscutata or

Racocetra and Cetraspora.

Morphological phylogenetic analyses

The morphology-based phylogeny supported Gigasporaceae and

Dentiscutataceae (F1Gc.4). However, Scutellosporaceae and Racocetraceae grouped

together in a monophyletic clade. Our morphological analyses, which included

only the same data and taxa used by Morton & Msiska (2010), did excluded

taxa described since 2010: Orbispora, Intraornatospora, Paradentiscutata,

and Intraornatosporaceae. Of all genera considered, only Cetraspora was

not supported. Fuscutata, Gigaspora, Racocetra, and Scutellospora were

monophyletic, and Quatunica formed a monophyletic group with Dentiscutata

(Fic. 4).

Discussion

All LSU, SSU (rDNA) and £-tubulin phylotrees supported the existence

of the gigasporalean families with strong support for all genera shown by the

LSU rDNA and 6-tubulin analyses. As the LSU region is believed to give the

best resolution for Gigasporales (Souza et al. 2005, Oehl et al. 2008, 2011b),

Pacispora scintillans FM876832

P. scintillans FM876831

0.99

0.1

Phylogeny of the Gigasporales ...211

Scutellospora calospora FJ461864

S. calospora FJ461865

S. dipurpurescens FJ461868

S. calospora EU346867

S. calospora EU252109

100, Orbispora pernambucana JQ340917

100| O. pernambucana JQ340918

100} O. pernambucana JF965445

1.00) ©. pernambucana JF965446

O. pernambucana HQ871519

Racocetra fulgida FJ461870

R. gregaria AJ510232

R. coralloidea FJ461866

R. persica FJ461880

R. alborosea JN689226

R. tropicana GU385898

R. castanea Y12076

R. verrucosa AY900507

R. verrucosa AY900508

Cetraspora nodosa FM876833

| C. nodosa FM876836

C. helvetica HM565946

C. helvetica HM565945

C. helvetica HM565944

C. pellucida AY639323

C. pellucida AY639261

C. gilmorei FN547608

C. gilmorei FN547606

C. gilmorei FN547603

C. gilmorei FN547618

Dentiscutata nigra AY900496

D. nigra AY900497

D. nigra AY900495

D. nigra AY900494

Quatunica erythropus AM040357

Q. erythropus AM040353

Q. erythropus AM040355

Q. erythropus AM040351

Q. erythropus AM040352

Fuscutata aurea JN971067

F. aurea JN971068

F. aurea JN971066

F. heterogama FJ461875

F. heterogama FJ461873

F. heterogama FJ461876

F. heterogama FJ461872

G. roseaY 12075

G. rosea AM040350

G. albida FJ461861

G. margarita AF396782

G. margarita AF396783

G. decipiens FJ461862

G. gigantea AY900506

G gigantea AY900504

Intraornatospora intraornata JN971072

|. intraornata JN971074

|. intraornata JN971073

I. intraornata JN971075

Paradentiscutata bahiana JN971069

92 P. bahiana JN971071

98 P. bahiana JN971070

99 P. maritima JN971081

00), P. maritima JN971078

P. maritima JN971077

P. maritima JN971079

P. maritima JN971080

P. maritima Jn971076

Fic. 1. Phylogenetic reconstruction of the Gigasporales obtained from partial LSU rDNA sequences.

The NJ, ML, and Bayesian analyses were performed with GTR+G nucleotide substitution model.

Sequences are labeled with database accession numbers. Support values are (from up to down)

from neighbor-joining (NJ), maximum parsimony (MP

), maximum likelihood (ML), and Bayesian

analyses. Only topologies with 250% bootstrap values are shown. (Consistency Index = 0.55;

Retention Index = 0.84).

212 ... Silva, Maia & Oehl

A. foveata FJ174304

A. mellea FJ174303

400 S. dipurpurescens FJ807705

100

0.99L_ S. calospora FJ174268

C. pellucida FJ174269

we R. castanea AJ717326

aon 1.00 R. fulgida FJ174273

100 abel

1.00 Pe

rs R. verrucosa FJ174270

0.53

84 R. gregaria FJ174271

1.00) — R. persica FJ174272

54 R. coralloidea FJ807707

G. margarita FJ174278

G. decipiens FJ174277

4.00] ; G gigantea FJ174276

G. albida FJ174275

57 G. rosea FJ174274

Q. erythropa FJ807706

83 F, heterogama FJ174320

-- F. heterogama FJ174317

F. heterogama FJ174325

F. heterogama FJ174315

0.01

Fic. 2. Phylogenetic reconstruction of the Gigasporales obtained from partial B-tubulin sequences.

The NJ, ML, and Bayesian analyses were performed with GTR+G+I nucleotide substitution model.

Sequences are labeled with database accession numbers. Support values are (from up to down)

from neighbor-joining (NJ), maximum parsimony (MP), maximum likelihood (ML), and Bayesian

analyses. Only topologies with 250% bootstrap values are shown. (Consistency Index = 0.63;

Retention Index = 0.68).

Phylogeny of the Gigasporales ... 213

Pacispora scintillans AJ619951

P. scintillans AS619940

Orbispora projecturata AJ242729

rir F Scutellospora aurigloba AJ276092

- 5. Scutellospora spinosissima AJ306437

_ S. calospora AJ306445

S. calospora AJ306443

Gigaspora decipiens U96146

aoe G. margarita AM181143

‘00 m G gigantea EF014362

1:89 G. gigantea Z14010

G. albida Z14009

G. albida AJ852599

a G. rosea X58726

30 Dentiscutata colliculosa GQ376067

0.99} 44 .

99 D. reticulata AJ871272

5 x D. reticulata AJ871273

D. cerradensis AB041344

D. cerradensis AB041345

96] - Fuscutata heterogama AJ852609

4.00 ~ © heterogama AY635832

Racocetra weresubiae AJ306444

=~ R. fulgida AS306435

4.00 R. castanea AF038590

R. gregaria AJ871275

R. gregaria AJ871274

R. alborosea JQ080259

R. tropicana GU385897

ggr— Cetraspora gilmorei AJ276094

81 C. pellucida 214012

1.00

C. nodosa AJ306436

0.01

Fic. 3. Phylogenetic reconstruction of the Gigasporales obtained from partial SSU rDNA sequences.

The NJ, ML, and Bayesian analyses were performed with GTR+G+I nucleotide substitution model.

Sequences are labeled with database accession numbers. Support values are (from up to down)

from neighbor-joining (NJ), maximum parsimony (MP), maximum likelihood (ML), and Bayesian

analyses. Only topologies with 250% bootstrap values are shown. (Consistency Index = 0.68;

Retention Index = 0.74).

214 ... Silva, Maia & Oehl

we conclude that the current classification by Oehl et al. (2011c) and Goto et

al. (2012) has a strong morphological and molecular congruency and support.

The SSU rDNA phylogenetic analysis did not completely support only a few

taxa — Dentiscutata and Fuscutata (Dentiscutataceae) and Racocetra and

Cetraspora (Racocetraceae), which confirms the analyses of Oehl et al. (2008)

using a similar database. In the morphology-based tree, only Cetraspora was

not supported while Quatunica formed a monophyletic group with its sister

genus Dentiscutata. We argue that this might correspond to the fact that

Cetraspora lacks any unique morphological character and shares (for example)

the number of spore walls with several other genera as well as the germination

shield color and structure with related genera. Thus far, Quatunica has only one

important character (spore wall numbers) that separates it morphologically

from Dentiscutata species. The fact that Quatunica is monospecific gives it a

low analytical weight.

Of the 23 morphological characters analyzed by Morton & Msiska (2010),

we regard eight (1, 2, 3, 4, 6, 8, 11, 12) as synapomorphies that are identical for

all gigasporalean species, thereby leaving just 15 characters to divide clades in

the order. Among these, Morton & Msiska (2010) report variation in character

21 (germination shield color) between isolates from the same species, which

could prevent using this character in phylogenetic analyses, due to its instability.

However, we argue that these authors might have included immature spores

with germination shields that were not completely differentiated or very old

spores in their observations. They might also have considered similar spores

from more than one species that represent different phylogenetic clades (e.g.

Cetraspora pellucida, Fuscutata savannicola, and Dentiscutata scutata). We also

believe that although species show a typical germination shield pattern, natural

exceptions may occur in some individuals, due to several reasons such as a

malformation.

Morton & Msiska’s (2010) characters 9 (spore size), 10 (spore color), and 13

(outer layer surface of the gigasporoid spore wall) do not pass a homology test,

because there is no congruence with other characters among the taxa (de Pinna

1991). Moreover, characters 9 and 10 are quantitative, and the most obvious

character filter for cladistic analysis rejects continuous or quantitative attributes.

Bentivenga et al. (1997) reported significant variation in the average of spore

size and color in a single Glomus clarum isolate after generations of selection

pressure for some phenotypic characters. Bever & Morton (1999) also observed

average variation in Cetraspora pellucida spore size and shape in five single-spore

cultures from a single isolate population. None of these characters contributed

significantly to synapomorphies within the Gigasporales, being homoplastic

with a consistency index (CI) below 0.4. Character 14 was synapomorphic for

the genus Dentiscutata, although the CI was also below 0.4.

Phylogeny of the Gigasporales ... 215

Acaulospora mellea

A. laevis

Cetraspora nodosa

: Scutellospora spinosissima

Foad - S. calospora

12 3 4 6 8 1112141617 20 22 22:25 Se aungiona

Orbispora projecturata

C. armeniaca

23 [C. pellucida

Fuscutata heterogama

Character state 3

@ =0 Pree F. rubra

mw =1

A =2 5 21 Dentiscutata cerradensis

@ =3

@=4 D. scutata

D. biornata

9 17 22 23 9 14

D. nigra

10 10 5

D. reticulata

1014 | 9

Quatunica erythropus

13 16 17 18 20

Gigaspora albida

G rosea

7 1519 G gigantea

9 G. decipiens

Wig margarita

Racocetra fulgida

14-8 R. castanea

R. weresubiae

16 20

R. verrucosa

R. persica

10 R. coralloidea

10 5 R. gregaria

Fic. 4. Phylogenetic reconstruction of the Gigasporales based on 23 morphological characters.

(Tree length = 63 steps; Consistency Index = 0.49; Retention Index = 0.77).

Some characters (7 and 19) that serve to separate Gigaspora from other

gigasporalean taxa do not help solve the polyphyletic former Scutellospora

groups. Thus, of 23 characters used by Morton & Msiska (2010), just ten are

phylogenetically helpful in separating monophyletic groups. Most of these

characters are related to germination shield, hyphal color, and germinal wall

characteristics.

Despite the Morton & Msiska (2010) criticism of the LSU-SSU

interdependence, they used two interdependent morphological characters

216 ... Silva, Maia & Oehl

(16—number of germinal walls and 20—germination shield position) to group

Racocetra taxa. In addition, this genus is grouped by the more ancestral character

state (as coded by the authors) that clearly represents a symplesiomorphy, which

does not provide evidence of common ancestry (Wiley et al. 1991). We conclude

that Morton & Msiska (2010) erred when coding these character states.

Evolutionary line in the Gigasporales

Ontogenetic data (Franke & Morton 1994; Morton 1995; Bentivenga &

Morton 1995, 1996) led readers to believe that Gigaspora might be basal to

the former Scutellospora. However, several molecular studies (Oehl| et al. 2008,

2010, 2011b, Goto et al. 2010; 2012) demonstrated that the former Scutellospora

evolved first in the Gigasporales. The report of 400 million year-old fossil

specimens with germination shields by Dotzler et al. (2006) suggested that the

presence of germination shield is ancestral in Gigasporales. The low number

of gigasporoid species related to scutellosporoid (sensu lato) species also

suggests that Gigaspora diverged after other members. Finally, we understand

the capacity of repeated germination of Gigaspora species (Maia & Kimbrough

1993) from <1000 germ warts randomly distributed on the spore wall inner

surface as a evolutionary progression compared with single germination events

from 1-24 germ tube initiations found on the germination shield periphery of

scutellosporoid (sensu lato) species.

The molecular phylogenetic trees suggest that spore wall loss has occurred

three times during the evolutionary history of Gigasporales [Scutellospora,

Cetraspora (3) > Racocetra, Intraornatospora (2) > Gigaspora (1)], while at

least once an additional wall was acquired [Dentiscutata (3) > Quatunica (A)].

However, even the germinal wall was lost in Gigaspora leaving only the innermost

warty germination layer, and germination in this genus is related to this specific

layer. Intraornatospora with one germinal wall with a rudimentary appearing

germination shield (Goto et al. 2012) is close phylogenetically to Gigasporaceae.

This genus forms a particular ornamentation on the inner surface of the outer

spore wall (Goto et al. 2009) in the form of tubercular projections resembling

the germ warts in Gigaspora. Since Intraornatospora germination has not yet

been observed, it is not possible to infer whether germination occurs from the

germination shield or tuberculate projections.

The increasing complexity of the germination shield structure can be observed

in the gigasporalean evolutionary line. Clearly, the simple shield states (germ

orbs = mono-lobed, germ violins = bi-lobed) are ancestral. The presence of

color in the germination shield is a derivative state (shared by Dentiscutataceae

species and the related Paradentiscutata), whereas this structure is clearly

hyaline in the basal branch (Orbispora, Scutellospora).

Phylogeny of the Gigasporales ... 217

Final considerations

The classification proposed by Morton & Msiska (2010) was based solely

on morphological data that were not correctly interpreted. The authors did not

consider their own molecular phylogenetic data, which supported almost all

families and genera proposed by Oehl et al. (2008). Moreover, the Gigasporales

classification suggested by Morton & Msiska (2010) does not reflect natural

groups and leaves Scutellospora polyphyletic. Thus, we do not accept the

analysis and assumptions by Morton & Msiska (2010), who misinterpreted

some morphological characters, leading to misanalysis in the morphological

phylogeny of the Gigasporales.

The low number of informative morphological characters in Gigasporales

(until now) have not permitted a reliable morphology-based phylogeny. While

we work to find more informative phylogenetic characters and reconstruct

a reliable evolutionary history for Gigasporales, we should investigate the

gigasporalean phylogeny using molecular tools.

Our current phylogenetic analyses demonstrate that all families and almost

all genera proposed by Oehl et al. (2008) are monophyletic. Molecularly, generic

relationships in the Dentiscutataceae are not yet completely understood but will

be clarified once sequences of more species from this family are available. We

believe that the classification by Oehl et al. (2008; 2011b) with implementation

of Goto et al. (2012) is reliable and indicate the need for clarification of generic

relationships in the Dentiscutataceae.

Acknowledgments

The authors acknowledge, in special, the valuable comments and revisions of Felipe

Wartchow and Ewald Sieverding on the manuscript and appreciate the corrections by

Shaun Pennycook, Nomenclatural Editor, and suggestions by Lorelei L. Norvell, Editor-

in-Chief. This work was supported by: Conselho Nacional de Desenvolvimento Cientifico

e Tecnoldgico (CNPq) that provided research grants to Leonor C. Maia (INCT-Herbario

Virtual da Flora e dos Fungos/Sisbiota/Protax) and FACEPE (Fundacgao de Amparo a

Ciéncia e Tecnologia do Estado de Pernambuco) which provided financial support to

G.A. Silva and a grant to FE Oehl as ‘visiting professor’

Literature cited

Bentivenga SP, Morton JB. 1995. A monograph of the genus Gigaspora, incorporating

developmental patterns of morphological characters. Mycologia 87: 719-731.

http://dx.doi.org/10.2307/3760818

Bentivenga SP, Morton JB. 1996. Congruence of fatty acid methyl ester profiles and morphological

characters of arbuscular mycorrhizal fungi in Gigasporaceae. Proceedings of the National

Academy of Sciences, USA 93: 5659-5662. http://dx.doi.org/10.1073/pnas.93.11.5659

Bentivenga SP, Bever JD, Morton JB. 1997. Genetic variation of morphological characters within a

single isolate of the endomycorrhizal fungus Glomus clarum (Glomaceae). American Journal of

Botany 84: 1211-1216. http://dx.doi.org/10.2307/2446044

218 ... Silva, Maia & Oehl

Bever, JD, Morton JB. 1999. Heritable variation and mechanisms of inheritance of spore shape

within a population of Scutellospora pellucid, an arbuscular mycorrhizal fungus. American

Journal of Botany 86: 1209-1216. http://dx.doi.org/10.2307/2656768

de Pinna MCC. 1991. Concepts and tests of homology in the cladistic paradigm. Cladistics 7:

367-394. http://dx.doi.org/10.1111/j.1096-0031.1991.tb00045.x

Dotzler N, Krings M, Taylor TN, Agerer R. 2006. Germination shields in Scutellospora

(Glomeromycota: Diversisporales, Gigasporaceae) from the 400 million-year-old Rhynie chert.

Mycological Progress 5: 178-184. http://dx.doi.org/10.1007/s11557-006-0511-z

Franke M, Morton JB. 1994. Ontogenetic comparisons of arbuscular mycorrhizal fungi

Scutellospora heterogama and Scutellospora pellucida: revision of taxonomic character concepts,

species descriptions, and phylogenetic hypotheses. Canadian Journal of Botany 72: 122-134.

http://dx.doi.org/10.1139/b94-017

Goto BT, Maia LC, Silva GA, Oehl F. 2009. Racocetra intraornata, a new species in

the Glomeromycetes with a unique spore wall structure. Mycotaxon 109: 483-491.

http://dx.doi.org/10.5248/109.483

Goto BT, Silva GA, Maia LC, Oehl E 2010. Dentiscutata colliculosa, a new species in the

Glomeromycetes from Northeastern Brazil with colliculate spore ornamentation. Nova Hedwigia

90: 383-393. http://dx.doi.org/10.1127/0029-5035/2010/0090-0383.

Goto BT, Silva GA, Maia LC, Souza RG, Coyne D, Tchabi A, Lawouin L, Hountondji F, Oehl F. 2011.

Racocetra tropicana, a new species in the Glomeromycetes from tropical areas. Nova Hedwigia

92: 69-82. http://dx.doi.org/10.1127/0029-5035/2011/0092-0069

Goto BT, Silva GA, Assis DMA, Silva DKA, Souza RG, Ferreira ACA, Jobim K, Mello CMA, Vieira

HEE, Maia LC, Oehl F. 2012. Intraornatosporaceae, (Gigasporales), a new family with two new

genera and two new species. Mycotaxon: 119: 117-132. http://dx.doi.org/10.5248/119.117

Guindon S, Gascuel O. 2003. A simple, fast, and accurate algorithm to estimate large phylogenies

by maximum likelihood. Systematic Biol. 52: 696-704. http://dx.doi.org/10.1080/1063515039

0235520.

Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program

for Windows 95/98/NTT. Nucl. Acids Symp. Ser. 41: 95-98.

Khade SW. 2010. Dentiscutata nigerita - a new species of arbuscular mycorrhizal fungi from India.

Mycosphere 1: 241-247.

Kramadibrata K, Walker C, Schwarzott D, SchiiBler A. 2000. A new species of Scutellospora with a

coiled germination shield. Annals of Botany 86: 21-27.

http://dx.doi.org/10.1006/anbo.2000.1146

Kriiger M, Kriiger C, Walker C, Stockinger H, Schiifler A. 2012. Phylogenetic reference data for

systematics and phylotaxonomy of arbuscular mycorrhizal fungi from phylum to species level.

New Phytologist 193: 970-984. http://dx.doi.org/10.1111/j.1469-8137.2011.03962.x

Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F,

Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and

Clustal X version 2.0. Bioinformatics 23: 2947-2948.

http://dx.doi.org/10.1093/bioinformatics/btm404

Lin T-C, Yen C-H. 2011. Racocetra undulata, a new species in the Glomeromycetes from Taiwan.

Mycotaxon 116: 401-406. http://dx.doi.org/10.5248/116.401

Maia LC, Kimbrough JW. 1993. Ultrastructural studies of the spore wall of Gigaspora albida

(Glomales). Mycologia 85: 883-889. http://dx.doi.org/10.2307/3760669

Mello CMA, Silva GA, Vieira HEE, Silva IR, Maia LC, Oehl F. 2012. Fuscutata aurea, a new species in

the Glomeromycetes from cassava and maize fields in the Atlantic rain forest zone of Northeastern

Brazil. Nova Hedwigia 95: 267-275. http://dx.doi.org/10.1127/0029-5035/2012/0037

Phylogeny of the Gigasporales ... 219

Milne I, Wright F, Rowe G, Marshal DF, Husmeier D, McGuire G. 2004. TOPALi: Software for

Automatic Identification of Recombinant Sequences within DNA Multiple Alignments.

Bioinformatics 20: 1806-1807. http://dx.doi.org/10.1093/bioinformatics/bth155

Morton JB. 1990. Evolutionary relationships among arbuscular mycorrhizal fungi in the

Endogonaceae. Mycologia 82: 192-207. http://dx.doi.org/10.2307/3759848

Morton JB. 1995. Taxonomic and phylogenetic divergence among five Scutellospora species

(Glomales, Zygomycetes) based on comparative developmental sequences. Mycologia 87:

127-137. http://dx.doi.org/10.2307/3760955

Morton JB, Msiska Z. 2010. Phylogenies from genetic and morphological characters do not support

a revision of Gigasporaceae (Glomeromycota) into four families and five genera. Mycorrhiza 20:

483-496. http://dx.doi.org/10.1007/s00572-010-0303-9

Oehl F, de Souza FA, Sieverding E. 2008. Revision of Scutellospora and description of five new genera

and three new families in the arbuscular mycorrhiza-forming Glomeromycetes. Mycotaxon 106:

311-360.

Oehl F, Jansa J, Souza FA de, Silva GA. 2010. Cetraspora helvetica, a new ornamented

species in the Glomeromycetes from Swiss agricultural fields. Mycotaxon 114: 71-84.

http://dx.doi.org/10.5248/114.71

Oehl F, Silva GA, Goto BT, Maia LC, Sieverding E. 2011a. Glomeromycota: two new classes and a

new order. Mycotaxon 116: 365-379. http://dx.doi.org/10.5248/116.365

Oehl FE, Silva DKA, Maia LC, Ferreira NM, da Silva GA. 2011b. Orbispora gen. nov.,

ancestral in the Scutellosporaceae of the Glomeromycetes. Mycotaxon 116: 161-169.

http://dx.doi.org/10.5248/116.161

Oehl F, Sieverding E, Palenzuela J, Ineichen K, Silva GA. 2011c. Advances in Glomeromycota

taxonomy and classification. IMA Fungus 2: 191-199.

http://dx.doi.org/10.5598/imafungus.2011.02.02.10

Oehl F£, Silva GA, Goto BT, Sieverding, E. 2011d. New recombinations in Glomeromycota.

Mycotaxon 117: 429-434. http://dx.doi.org/10.5248/117.429

Phipps J, Taylor TN. 1996. Mixed arbuscular mycorrhizae from the Triassic of Antarctica. Mycologia

88: 707-714. http://dx.doi.org/10.2307/3760964

Redecker D, Kodner R, Graham LE. 2000. Glomalean fungi from the Ordovician. Science 289:

1920-1921. http://dx.doi.org/10.1126/science.289.5486.1920

Redecker D, Raab P. 2006. Phylogeny of the Glomeromycota (arbuscular mycorrhizal fungi): recent

developments and new gene markers. Mycologia 98: 885-895.

http://dx.doi.org/10.3852/mycologia.98.6.885

Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed

models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180

Silva DK da, Freitas NO, Maia LC, Oehl F. 2008. Scutellospora pernambucana, a new fungal species

in the Glomeromycetes with a characteristic germination orb. Mycotaxon 106: 361-370.

Silva GA da, Lumini E, Maia LC, Bonfante P, Bianciotto V. 2006. Phylogenetic analysis of

Glomeromycota by partial LSU rDNA sequences. Mycorrhiza 16: 183-189.

http://dx.doi.org/10.1007/s00572-005-0030-9

Simon L, Bousquet J, Levesque RC, Lalonde M. 1993. Origin and diversification of endomycorrhizal

fungi and coincidence with vascular land plants. Nature 363: 67-69.

http://dx.doi.org/10.1038/363067a0

Souza FA, Declerck S, Smit E, Kowalchuk GA. 2005. Morphological, ontogenetic and molecular

characterization of Scutellospora reticulata (Glomeromycota). Mycol. Res. 109: 697-706.

http://dx.doi.org/10.1017/S0953756205002546

220 ... Silva, Maia & Oehl

Swofford DL. 2003. PAUP”. Phylogenetic Analysis Using Parsimony (* and other methods), Version

4, Sinauer Associates, Sunderland, Massachusetts.

Tchabi A, Hountondji FE, Lawouin L, Coyne D, Oehl F. 2009. Racocetra beninensis from sub-Saharan

savannas: a new species in the Glomeromycetes with ornamented spores. Mycotaxon 110: 199-

209. http://dx.doi.org/10.5248/110.199

Wiley EO, Siegel-Causey D, Brooks DR, Funk VA. 1991. The compleat cladist: a primer of

phylogenetic procedures. University of Kansas Press, Lawrence, Kansas.

MY COTAXON

http://dx.doi.org/10.5248/122.221

Volume 122, pp. 221-224 October-December 2012

Pleurotus eryngii var. elaeoselini, first record from Romania

VASILICA CLAUDIU CHINAN”™ & GIUSEPPE VENTURELLA?

'Faculty of Biology, Alexandru Ioan Cuza University

Bd. Carol I, No. 20A, 700505, Iasi, Romania

*Dipartimento di Biologia Vegetale e Biodiversita, Universita di Palermo,

Via Archirafi 38, I-90123 Palermo, Italy

* CORRESPONDENCE TO: vasilechinan@yahoo.com

ABSTRACT — Pleurotus eryngii var. elaeoselini, on Laserpitium latifolium roots, is reported in

Romania for the first time. A description and illustrations of this variety are provided.

KEY worpDs — taxonomy, Pleurotaceae, Apiaceae

Introduction

Pleurotus eryngii var. elaeoselini was described by Venturella et al. (2000) from

Sicily (Italy), growing on Elaeoselinum asclepium (L.) Bertol. subsp. asclepium.

Subsequently, Venturella (2002) reported the variety from Spain, associated

with other plants in Apiaceae: Thapsia villosa L. and Elaeoselinum gummiferum

(Desf.) Tutin. Unpublished data from one co-author (G. Venturella) widen the

distribution (i.e. France, Switzerland, Malta, Slovenia and Ukraine) of this taxon

(Frc. 1). In Romania, data on the P eryngii species complex are scarce, and only

P. eryngii (DC.) Quél. on Eryngium spp. roots has been reported (Salageanu &

Salageanu 1985). Identification of P eryngii var. elaeoselini in Romania, collected

on Laserpitium latifolium roots, adds new data to the existing knowledge of this

fungus. Laserpitium latifolium is also known as a host for P. eryngii var. eryngii

(Zervakis & Balis 1996). Zervakis et al. (2001), discussing the occurrence of

Pleurotus nebrodensis (Inzenga) Quél. on L. latifolium, stated that P. nebrodensis

should be associated only with Cachrys ferulacea (L.) Calest.

Materials & methods

The P. eryngii var. elaeoselini basidiomata, collected during 2006-11 in the Stanisoarei

Mountains (Eastern Carpathians), Romania, were described and photographed in the

habitat. The material was preserved by drying and deposited in the Herbarium of the

Alexandru Ioan Cuza University of Iasi (I). Duplicates of I-137264 and I-137266 are kept

222 ... Chinan & Venturella

FiGurReE 1. Distribution of Pleurotus eryngii var. elaeoselini in Europe.

ES (Spain), FR (France), CH (Switzerland), IT (Italy), MT (Malta),

SI (Slovenia), RO (Romania), UA (Ukraine).

in Herbarium Mediterraneum Panormitanum (PAL). For microscopical examination,

sections were mounted in 5% KOH and Congo red solution. The species was monitored

during annual field trips in 2007-11.

Taxonomy

Pleurotus eryngii var. elaeoselini Venturella, Zervakis & La Rocca,

Mycotaxon 76: 420 (2000) Fic. 2

Basip1oMaTA fleshy, 40-110 mm high. Pireus 40-120 mm in diameter,

hemispherical to convex when young, low convex to depressed when mature;

whitish, white-cream tolightbeige, with alutaceous tones; smooth, often lacerated

in small appressed areolae; margin deeply involute in young basidiomata, then

straight, sometimes lobate. LAMELLAE deeply decurrent, arcuate, up to 10 mm

broad, in young basidiomata with evident anastomoses on the stipe, whitish

to light cream, sometimes grayish-white in young basidiomata, edge entire,

concolorous. SPORE DEPOSIT white.

STIPE 25-85 x 6-20 mm, central to eccentric, concolorous with the pileus,

filled and firm, irregularly cylindrical, straight to slightly curved, base attenuate

Pleurotus eryngii var. elaeoselini, new to Romania... 223

FIGURE 2. Pleurotus eryngii var. elaeoselini basidiomata in habitat

(Photo: V.C. Chinan).

and sometimes radicating, lightly pruinose in the young basidiomata, then

smooth, glabrous. CONTEXT compact, fibrous, white in pileus and stipe, odor

and taste fungoid.

BasIpIA 4-spored, 34-48 x 8-10 um, sterigmata 4-5 um. BASIDIOSPORES

8-12(-13) x 4-5.5 um, cylindrical-ellipsoid, apiculate, smooth, hyaline;

cheilocystidia 40-60 x 8-12 um, club-shaped.

HABITAT/SUBSTRATE/PHENOLOGY. Mountain meadow (alt. 620-750 m),

calcareous soil, on Laserpitium latifolium roots, single or in groups, autumn

(September-October).

SPECIMENS EXAMINED: ROMANIA, EASTERN CARPATHIANS: Stanisoarei Mountains,

Neamt County, near Potoci village, mountain meadow, GPS: 46°56'14.55"N

26°07'43.86"E, alt. 620-750 m, on Laserpitium latifolium L. roots (Apiaceae), 6 Oct.

2006, 10 Oct. 2007, 19 Oct. 2008, 17 Sept. 2010, 13 Oct. 2011, coll. V. Chinan (I 137262;

I 137263; I 137264, PAL 001/ROM; I 137265; I 137266, PAL 002/ROM).

Discussion

Pleurotus eryngii var. elaeoselini is a rare taxon in Europe. In Romania it

was found on L. latifolium roots in a meadow in the Stanisoarei Mountains

(Eastern Carpathians). This is the first record of this variety for Romania and

the Carpathian Mountains. Annual field trips, carried out between 2007 and

2011, confirmed its presence in the same place every year from September

to October. Although it was first found in Italy only on E. asclepium subsp.

asclepium (Venturella et al. 2000), data from Spain (Venturella 2002) show that

224 ... Chinan & Venturella

this variety is linked to more than one species in the Apiaceae. The Romanian

collections of P. eryngii var. elaeoselini on L. latifolium confirm this conclusion.

Zervakis et al. (2001) previously discussed the presence of Pleurotus on

Laserpitium spp., noting that Pleurotus strains growing on Laserpitium spp. in

central Europe and northern Italy show identical microscopic characteristics

with P. eryngii var. elaeoselini and that these differ from P. nebrodensis.

The macroscopic and microscopic attributes of the Romanian specimens fit

the description by Venturella et al. (2000). Confusion with P nebrodensis is

excluded, as its host plant, C. ferulacea, is not known in Romania.

The Romanian population of P. eryngii var. elaeoselini apparently fruits only

in autumn, during September and October. In Italy, it is reported fruiting in

both autumn and spring (Venturella et al. 2000), while in Spain the variety has

been found only in spring (Venturella 2002).

Acknowledgements

The authors wish to thank Vladimir Antonin (Czech Republic), Georgios I. Zervakis

(Greece), and Shaun Pennycook (New Zealand) for critically reviewing the manuscript.

Literature cited

Salageanu G, Salageanu A. 1985. Determinator pentru recunoasterea ciupercilor comestibile,

necomestibile si otravitoare din Romania. Edit. Ceres, Bucuresti.

Venturella G. 2002. On the real identity of Pleurotus nebrodensis in Spain. Mycotaxon 84:

445-446.

Venturella G, Zervakis G, La Rocca S. 2000. Pleurotus eryngii var. elaeoselini var. nov. from Sicily.

Mycotaxon 76: 419-427.

Zervakis G, Balis C. 1996. A pluralistic approach on the study of Pleurotus species, with emphasis

on compatibility and physiology of the European morphotaxa. Mycol. Res. 100(6): 717-731.

http://dx.doi.org/10.1016/S0953-7562(96)80205-X

Zervakis GI, Venturella G, Papadopoulou K. 2001. Genetic polymorphism and taxonomic

infrastructure of the Pleurotus eryngii species-complex as determined by RAPD analysis,

isozyme profiles and ecomorphological characters. Microbiology 147: 3183-3194.

MY COTAXON

http://dx.doi.org/10.5248/122.225

Volume 122, pp. 225-230 October-December 2012

A new species of Hypoderma with periphysoids

CHUN-TAO ZHENG’, FENG ZHOU’, KE LP? & YING-REN LIN”

"School of Life Science & ? School of Forestry & Landscape Architecture,

Anhui Agricultural University, West Changjiang Road 130, Hefei, Anhui 230036, China

*CORRESPONDENCE TO: yingrenlin@yahoo.com

ABSTRACT — Hypoderma mirabile, a new species found on fallen leaves of Litsea elongata in

China, is described and illustrated. This taxon is distinctive within the genus by the presence

of periphysoids, unbranched curved paraphyses, and a unique covering stroma.

Key worps — foliicolous fungi, morphological characteristics, taxonomy

Introduction

Hypoderma De Not. is one of the earliest described genera of Rhytismatales.

It was established by De Notaris (1847) and proposed as conserved name by

Cannon & Minter (1983). Héhnel designated Hypoderma rubi (Pers.) DC. as

the lectotype species of the genus in 1917, and this viewpoint was subsequently

accepted (Darker 1967; Cannon & Minter 1986; Korf 1988). Johnston (1990)

emphasised the significance of the developmental and structural characters

of the ascomatal sterile tissues rather than the ascospore shape to revise and

expand the concept of Hypoderma. This genus is characterized by the presence

of a preformed dehiscence mechanism, subcuticular ascomata, paraphyses that

are never swollen, and ascospores that vary in shape.

Hypoderma is the third-largest genus in the Rhytismataceae (Rhytismatales,

Leotiomycetes, Ascomycota), and of the 54 species known worldwide, many are

widely distributed in the temperate and tropical zones (Kirk et al. 2008). The

study of Hypoderma in China began in 1924 with the description of a new taxon,

Hypoderma strobicola f. cunninghamiae Keissl., subsequently raised to species

rank in 1947 as H. handelii Petr. (Keissler 1924; Petrak 1947). Afterwards, 13

additional species have been reported from China (Teng 1963; Tai 1979; Lin

& Hou 1994; Lin et al. 2004; Liang et al. 2005; Hou et al. 2005, 2007; Hou &

Piepenbring 2006; Wang et al. 2007).

226 ... Zheng & al.

Up to now, 5 species representing Lophodermium and Coccomyces in

Rhytismatales have been recorded on Litsea, but no Hypoderma species has yet

been reported on this plant genus (Farr & Rossman 2012).

Materials & methods

Macroscopic appearance was described under the dissecting microscope at 10-50x

magnification. After rehydration of reference material in water for ca 10 min, 8-15 um

thick sections of mature fruitbodies were cut using a freezing microtome (YD-202, Yidi

Medical Appliance Factory, Jinhua, Zhejiang, China). Sections were mounted in lactic

acid or cotton blue with pretreatment in water for the observations of ascomatal and

conidiomatal outlines in vertical section. The colours of various structures were observed

in water. Gelatinous sheaths surrounding ascospores and paraphyses were examined in

water or 0.1% (w/v) cotton blue in lactic acid. Measurements were made from more

than 30 asci, ascospores, and paraphyses for each specimen using material mounted in

5% KOH or Melzer’s reagent. Line and point integrated illustrations of external shape

and internal structures of fruitbodies were drawn using a microscopic painting device

(Panasoianic XSJ-2, Japan).

The type specimen is deposited in the Forest Fungi Dried Reference Collection of

Anhui Agricultural University, China (AAUF).

Taxonomy

Hypoderma mirabile Y.R. Lin & C.T. Zheng, sp. nov. FIGs 1-5

MycoBank MB 800352

Differs from Hypoderma rubi and H. cordylines by the presence of periphysoids, smaller

asci and ascospores, unbranched, curved paraphyses, and a distinct covering stroma.

Type: China, Anhui, Tiantangzhai, Xibianwa, alt. 950 m, on fallen leaves of Litsea

elongata (Wall. ex Nees) Benth. & Hook. f. (Lauraceae), 7 June 2007, J.J. Han & Y.R. Lin

2197 (Holotype, AAUF 68305).

ErymMo.oey: mirabile (Latin = fantastic), referring to the morphological peculiarity of

this fungus which has unique periphysoids.

Cotoniegs on both sides of leaves, forming distinct irregular, yellow-brown

paler areas, 7-12 mm diam.

ZONE LINES somewhat frequent, dark brown, thin, surrounding or partly

surrounding the pale areas, not always conspicuous.

ConipiomaTaA on both sides of leaves, scattered, occasionally coalescent.

In surface view, conidiomata 150-250 um diam., rounded or subrounded,

somewhat raising the substratum surface, dark brown to black, but lighter

coloured in immature conidiomata, with a surrounded black perimeter line,

discharging spores through an inconspicuous central ostiole. In vertical

section, conidiomata subcuticular. UPPER WALL poorly developed, composed

of textura epidermoidea with tiny, thin-walled cells. BASAL WALL 3-7 um

thick, comprised of textura globulosa-angularis. SUBCONIDIOGENOUS LAYER

Hypoderma mirabile sp nov, (China) ... 227

eee

Fics 1-5. Hypoderma mirabile on Litsea elongata. 1. Fruitbodies and a zoneline observed under a

dissecting microscope. 2. Conidioma in vertical section. 3. Portion of ascoma in median vertical

section. 4. Ascoma in median vertical section. 5. Paraphyses, asci, and ascospores.

228 ... Zheng & al.

ca 6 um thick, consisting of 3—4(-5) layers of hyaline, thin-walled angular

cells. CONIDIOGENOUS CELLS 8-14 x 2-3.5 um, cylindrical, tapering towards

the apex, proliferating sympodially or occasionally proliferating percurrently.

Conip1a 4-6 x 1-1.5 um, cylindrical, hyaline, unicellular.

AscoMarta in similar positions to conidiomata on the substratum, scattered

over the pale areas. In surface view, ascomata 1000-1700 x 500-650 um, elliptical

to elongated-elliptical, straight or somewhat curved, ends rounded or obtuse,

black, slightly raising the substratum surface, opening by a single longitudinal

split 3/4—4/5 the length of the ascoma. Lips moderately developed. In median

vertical section, ascomata subcuticular. COVERING STROMA 20-30 um thick

near the opening, increasing to 50-55 um thick not far away from the base,

composed of dark brown textura angularis-epidermoidea with thick-walled

cells 5-8 um diam., connecting to the basal stroma. Lips with a layer of cells

7-14 x 3-4 um, cylindrical, thin-walled, hyaline, 0-1(-2)-septate. Periphysoids

lined on the inner face of the covering stroma, 15-18 x 2-3 um, cylindrical,

straight or curved, frequently swelling at the top, hyaline, 0-2-septate. BASAL

STROMA 5-8 um thick, dark brown, consisting of 1-2 layers of angular, thick-

walled cells. SUBHYMENIUM moderately developed, 10-22 um thick, comprised

of hyaline textura porrecta with a region of colourless, gluey textura angularis

with thin-walled cells 11-14 um diam. at the edge of the ascoma. PARAPHYSES

125-140 x 1-1.5 um, filiform, aseptate, unbranched, often curved but not

swollen at the apex, covered with a 0.5-1 um thick gelatinous coating. Asc

ripening sequentially, 80-120 x 8.5-12 um, cylindrical-clavate, long-stalked,

thin-walled, apex rounded, without circumapical thickening, J-, 8-spored.

Ascosporss biseriate or irregularly arranged, confined to upper half of the

ascus, 12-19 x 2.2-3 um, cylindrical to cylindrical-clavate or clavate, hyaline,

aseptate, with a gelatinous sheath ca 1 um thick.

HOST SPECIES, HABITAT AND DISTRIBUTION: Producing conidiomata and

ascomata on fallen leaves of Litsea elongata. Known only from the type locality,

Anhui Province, China.

ComMENTS — ‘The periphysoidal layer is a structure similar to the lip cells

present in some other species of Rhytismatales. This structure supposedly

helps the covering stroma open when wet and close upon drying (Sherwood

1980). Except for a few Coccomyces and Lophodermium species (Johnston

1986; Sherwood 1980; Spooner 1990, 1991; Lin 1998; Lin et al. 2002), most

rhytismatalean taxa, especially Hypoderma species, lack periphysoids. We

recognize H. mirabile as a new species mainly due to its obvious periphysoidal

layer.

Hypoderma rubi, which produces macroscopically similar ascomata,

conidiomata, and zone lines and similarly shaped asci and ascospores, differs

from H. mirabile in its covering stroma without periphysoids and sharply

Hypoderma mirabile sp nov, (China) ... 229

narrowing from the edge of the opening, septate branched paraphyses, asci

(87-130 x 12-14.5 um), and ascospores [(16—)20-24(-30) x 2.5-3.5 um]

lacking an obvious gelatinous sheath (Cannon & Minter 1986).

The similar H. cordylines P.R. Johnst. is distinguished from H. mirabile by its

covering stroma composed of angular cells that thins gradually or more or less

abruptly toward the outside ascomal edge, well-developed lips, loosely circinate

paraphyses tips, larger asci (90-140 x 11-16 um) slightly thickened at the apex,

uniform elliptic ascospores, the absence of an upper wall in the conidiomata,

and much longer conidia (5-9 um) (Johnston 1990).

From our observations, it seems likely that this new species is a weak parasite

or a saprobe.

Acknowledgments

The authors thank the National Natural Science Foundation of China (No. 30870014,

31270065) and the Specialized Research Fund for the Doctoral Program of Higher

Education of China (No. 20070364002) for financial support. Thanks are also given to

Dr D.W. Minter and Dr M. Ye for critically revising our manuscript.

Literature cited

Cannon PF, Minter DW. 1983. The nomenclacural history and typification of Hypoderma and

Lophodermium. Taxon 32: 572-583. http://dx.doi.org/10.2307/1221727

Cannon PF, Minter DW. 1986. The Rhytismataceae of the India subcontinent. Mycol. Pap. 155:

1-123.

Darker GD. 1967. A revision of the genera of the Hypodermataceae. Can. J. Bot. 45: 1399-1444.

http://dx.doi.org/10.1139/b67-145

De Notaris G. 1847. Prime linee di una nuova disposizione de Pirenomiceti Isterini. Giorn. Bot.

Ital. 2(2-8): 5-52.

Farr DF, Rossman AY. 2012. Fungal Databases, Systematic Mycology and Microbiology Laboratory.

ARS, USDA [http://nt.ars-grin.gov/fungaldatabases/fungushost/FungusHost.cfm (viewed

online on 5 April, 2012)].

Hou CL, Piepenbring M. 2006. Five new species of Hypoderma (Rhytismatales, Ascomycota)

with a key to Hypoderma species known from China. Nova Hedwigia 82: 91-104.

http://dx.doi.org/10.1127/0029-5035/2006/0082-0091

Hou CL, Liu L, Piepenbring M. 2007. A new species of Hypoderma and description of H.rubi

(Ascomycota) from China. Nova Hedwigia 84: 487-493.

http://dx.doi.org/10.1127/0029-5035/2007/0084-0487

Hou CL, Lin YR, Piepenbring M. 2005. Species of Rhytismataceae on needles of Juniperus spp. from

China. Can. J. Bot. 83: 37-46. http://dx.doi.org/10.1139/b04-149

Johnston PR. 1986. Rhytismataceae in New Zealand 1. Some foliicolous species of Coccomyces de

Notaris and Propolis (Fries) Corda. New Zealand J. Bot. 24: 89-124.

http://dx.doi.org/10.1080/0028825X.1986.10409723

Johnston PR. 1990. Rhytismataceae in New Zealand 3. The genus Hypoderma. New Zealand J. Bot.

28: 159-183. http://dx.doi.org/10.1080/0028825X.1990.10412355

Keissler K. 1924. Fungi novi Sinenses a Dr. H. Handel-Mazzetti lect II.. Anzeig. Akad. Wiss. Wein,

Math. Nat. Kl. 61: 10-13.

230 ... Zheng & al.

Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi,

10th ed. CAB International. Wallingford. 771 p.

Korf RP. 1988. Report (N. S. 1) of the Committee for fungi and lichens on proposals to conserve

and/or reject names. Taxon 37: 450-463. http://dx.doi.org/10.2307/1222170

Liang YM, Tian CM, Cao ZM, Yang JX, Kakishima M. 2005. Hypoderma qinlingense sp. nov. on

Sabina squamata from China. Mycotaxon 93: 309-313.

Lin YR. 1998. Studies on Coccomyces de Notaris and Neococcomyces gen. nov. in China.

[Ph.D.thesis; in Chinese]. Northeast Forestry University. Harbin. 95 p.

Lin YR, Hou CL. 1994. A new combination of genus Ploioderma on cones and needles of

Cunninghamia lanceolata [in Chinese]. Acta Mycologica Sinica. 13: 178-180.

Lin YR, Hou CL, Xu ZS, Li K. 2002. Two new species of Lophodermium (Rhytismatales, Discomycetes)

[in Chinese]. 147-150, in: Anhui Plant Pathology Society et al. (eds.), Tactics and future of

integrated pest management. Chinese Agricultural Science Press. Beijing.

Lin YR, Wang SJ, He YE, Ye GB. 2004. Two new taxa of Hypoderma [in Chinese]. Mycosystema

25: 1113,

Petrak EF. 1947. Kritische Studien tiber chinesische Pilze. Sydowia 1: 332-377.

Sherwood MA. 1980. Taxonomic studies in the Phacidiales: The genus Coccomyces (Rhytismataceae).

Occ. Pap. Farlow Herb. Crypt. Bot. 15: 1-120.

Spooner BM. 1990. Coccomyces and Propolis (Rhytismatales) from Mt Kinabalu, Borneo. Kew

Bulletin 45: 451-484. http://dx.doi.org/10.2307/4110513

Spooner BM. 1991. Lophodermium and Hypoderma (Rhytismatales) from Mt Kinabalu, Sabah. Kew

Bulletin 46: 73-100. http://dx.doi.org/10.2307/4110745

Tai FL. 1979. Sylloge Fungorum Sinicorum [in Chinese]. Science Press. Beijing. 1527 p.

Teng SC. 1963. Fungi of China [in Chinese]. Science Press. Beijing. 808 p.

Wang SJ, Liu HY, Chen L, Liu YB, Lin YR. 2007. Two new species of Rhytismataceae [in Chinese].

Mycosystema 26: 161-164.

MY COTAXON

http://dx.doi.org/10.5248/122.231

Volume 122, pp. 231-241 October-December 2012

Yeast species from soil and fallen leaves

new for the mycobiota of Israel

Dmytro M. GOTMAN’, SOLOMON P. WASSER”? & EVIATAR NEVO!

"Institute of Evolution and Department of Evolutionary and Environmental Biology,

Faculty of Natural Sciences, University of Haifa, Mount Carmel, Haifa 31905, Israel

°M. G. Kholodny Institute of Botany of the National Academy of Science of Ukraine,

2 Tereshchenkivska St., Kyiv 01601, Ukraine

* CORRESPONDENCE TO: gotmandm@gmail.com

ABSTRACT — We investigated the species diversity of yeasts from soil and fallen leaves of

Israel based on sequencing of the D1/D2 domain of 26S rDNA. Seven new yeast records

found for Israel were Apiotrichum nothofagi, Cryptococcus carnescens, C. phenolicus,

C. terreus, Komagataella pastoris, Rhodosporidium lusitaniae, and Schwanniomyces

occidentalis.

Key worps — Ascomycota, Basidiomycota, Middle East, molecular methods

Introduction

The biodiversity of yeasts in Israel has not been studied well. There has not

been any critical research regarding the biodiversity of this group of fungi.

One thorough investigation was done at the “Evolution Canyon” microsite

in Mount Carmel by Nagornaya et al. (2003). Some selective studies were

dedicated to the biodiversity of yeasts in hypersaline water habitats (Butinar et

al. 2005). Yarrowia lipolytica was found together with Rhodotorula glutinis on

salt-excreting leaves of Atriplex halimus plants in the central Negev Highlands

of Israel (Zvyagilskaya et al. 2001). Many yeast species were collected in

vineyards in the Coastal Plain of Israel (Zahavi et al. 2002), and Metschnikowia

fructicola was first described from grape surfaces in Israel (Kurtzman & Droby

2001). Metschnikowia reukaufii was isolated from pollen of Asclepias syriaca

(Eisikowitch et al. 1990). Clavispora lusitaniae was first described from citrus

essence in Israel (Rodrigues de Miranda 1979). Several yeast species have been

recorded on mites, in citrus products and organic acid media, on Zea mays, and

on grapefruit (Smith 1986, Steiman et al. 1997, Schena et al. 2000, Boekhout et

al. 2003, Savchenko et al. 2010, Kurtzman et al. 2011).

232 ...Gotman, Wasser & Nevo

Forty-two yeast species are reported in the literature from Israel: 24

ascomycetes (in 15 genera and eight families) and 18 basidiomycetes (in nine

genera and eight orders).

We investigated yeast species diversity of soil and fallen leaves based on

sequencing of the D1/D2 domain of 26S ribosomal DNA in order to achieve

better insight into the biodiversity of yeast species in Israel.

Materials & methods

Collection site

Soil and fallen leaves samples were collected in En Ziwan, 33°11'09"N 35°79'10"E,

Golan Heights; Carmel National Park, 32°75'00"N 35°02'70"E, Carmel Mount; and

Kefar Kisch, 32°65'32"N 35°45'06"E, Lower Galilee.

Isolation techniques

To isolate the yeasts from soil and fallen leaves, 10 g of each sample was diluted in 100

ml of sterile double-distilled water and placed on the orbital shaker for one hour at 150

rpm at room temperature. After shaking, each sample was diluted decimally; 0.15 ml of

each dilution was spread on acidified yeast-malt (YM) agar (1% glucose, 0.5% peptone,

0.3% yeast extract, 0.3% malt extract, and 2% agar) pH 3.7-3.8, or YM agar containing

chloramphenicol (0.01%) and sodium propionate (0.2%) for suppression of bacterial and

mold growth. The plates were incubated at 25°C for 3-7 days. Representative colonies

of each morphology type were picked and streaked onto new YM agar plates. The purity

of yeast cultures was ascertained using light microscopy. Color names follow Rayner

(1969). The yeast cultures were stored at 4°C in YM agar plates. They are available from

culture collection of the Institute of Evolution, University of Haifa (HAI, Haifa, Israel).

For long-term preservation they were frozen at -80°C in 25% glycerol YM medium.

Molecular-biological methods

Yeasts were identified taxonomically using molecular-biological methods. DNA

was extracted according to Hoffman & Winston (1987) with Gottschling (http://labs.

fherc.org/gottschling/Yeast%20Protocols/qgprep.html) and Dunham (http://dunham.

gs.washington.edu/MDyeastDNAprep.htm) modifications. DNA concentration

was measured using the NanoDrop®ND-1000 spectrophotometer (NanoDrop

Technologies, Montchanin, Delaware, U.S.A.). The concentration of DNA was adjusted

to 10 ng/ul for further applications. Diluted DNA (10ng/ul) was used as a PCR template.

The D1/D2 domain of the large subunit (26S) of ribosomal DNA (rDNA) was amplified

on GeneAmp® PCR System 9700 (Applied Biosystems, USA) using primers NL1 (5'-

GCATATCAATAAGCGGAGGAAAAG) and NL4 (5’-GGTCCGTGTTTCAAGACGG) (O’Donnell

1993), and ABgene® Thermo Scientific 2X ReddyMix PCR Master Mix w/1.5 mM

MgCl (Applied Biosystems, California, USA). PCR cycling conditions included initial

denaturation (95°C for 5 min), 5 extension cycles (94°C for 45 s, primer annealing at

55°C for 45 s, primer extension at 72°C for 1 min), 29 denaturation cycles (95°C for

30 s, primer annealing at 60°C for 30 s, primer extension at 72°C for 1 min), and a

final elongation step at 72°C for 10 min. PCR products were visualized in 1.5% agarose

gel, stained with GelRedTM Nucleic Acid Gel Stain, 10,000x in water (Biotium, Inc.,

Yeasts new to Israel ... 233

Hayward, California), and viewed under UV. PCR products were cleaned using an

ExoSAP-IT (USB Corp.) following the manufacturer's instructions.

The PCR products were sent to the Technion (Israel Institute of Technology, The

Bruce Rappaport Faculty of Medicine) Medicine Lab for sequencing, which was

performed on 3130xl Genetic Analyzer (Applied Biosystems, USA) using the PCR

primers and Big Dye® Terminator v 1.1 Cycle (Applied Biosystems, USA). We identified

the yeast species in a BLAST search. BLASTN 2.2.26+ program was to align sequences

and compare them with type strains, percentage of query coverage, and max identity

(Zhang et al. 2000). All sequences were registered in GenBank.

Results

Analysis of the 26S rDNA D1/D2 sequences revealed seven yeast species

not previously reported for Israel, of which two are ascomycetes (K. pastoris,

S. occidentalis) and five are basidiomycetes (A. nothofagi, C. carnescens, C. phenolicus,

C. terreus, R. lusitaniae).

Apiotrichum nothofagi C. Ramirez & A.E. Gonzalez, Mycopathologia

88(2-3): 76 (1984) [as “Apiotricum” ]. FIG?

Type: Chile, Futrono, in evergreen rainy Valdivian forest, from decayed wood of

Nothofagus obliqua, 1980, A. Gonzalez (IJFM 6018).

= Rhodotorula nothofagi C. Ramirez & A.E. Gonzalez, Mycopathologia 91(3):

171 (1985), nom. illegit. [superfluous sp. nov., based on same type].

= Rhodotorula nothofagi (C. Ramirez & A.E. Gonzalez) Roeijmans, Eijk & Yarrow,

Mycotaxon 35(2): 406 (1989), nom. illegit. [superfluous, later homonym].

CELLS after 3 days growth on YM agar at 25°C subglobose to ellipsoid, 3-4

x 6-11 um, occurring mostly singly or in pairs. Budding predominantly polar.

CoLonlies white and smooth.

SPECIMENS EXAMINED — ISRAEL. CARMEL Mownrt, Haifa, Carmel National Park,

32°75'18"N 35°02'69"E, 18.XII.2010, from fallen needles of Pinus halepensis, leg. D.M.

Gotman (HAI-Y-35; GenBank JQ581048); LowER GALILEE, Kefar Kish, 32°65'32”N

35°45'06"E, 22.XII.2010, from fallen leaves of Ceratonia siliqua, leg. D.M. Gotman

(HAI-Y-81; GenBank JQ581049).

ComMENTSs - Apiotrichum nothofagi belongs to the Curvibasidium clade of

Microbotryomycetes. A single strain IJFM 6018 (CBS 8166) was isolated in

1980 from decayed wood of Nothofagus obliqua. In 1984, Ramirez & Gonzalez

described a new taxon, Apiotrichum nothofagi, citing JFM 6018 as type culture.

The following year, they published Rhodotorula nothofagi as a new species,

also citing IJFM 6018 as type culture, rendering R. nothofagi a superfluous

and illegitimate name (ICBM [Vienna Code] Art. 52.1). Apparently unaware

that R. nothofagii had already been validly published by Ramirez & Gonzalez,

Roeijmans et al. (1989) recombined A. nothofagi as Rhodotorula nothofagi, a

comb. nov. that is also a superfluous and illegitimate later homonym. We cite

this taxon here under its only legitimate name, Apiotrichum nothofagi, but it

234 ...Gotman, Wasser & Nevo

requires a nom. nov. in Rhodotorula, since both existing Rhodotorula names

are illegitimate.

DISTRIBUTION - Europe, North America, South America (Gadanho et al. 2003,

Maksimova & Chernov 2004, Villa-Carvajal et al. 2004, Langdon et al. 2005, Rodrigues

et al. 2009, Golubev & Tomashevskaya 2010).

Cryptococcus carnescens (Verona & Luchetti) M. Takash. et al., Int. J. Syst. Evol.

Microbiol. 53(4): 1192 (2003) FIG. 2

CELLS after 3 days growth on YM agar at 25°C single, ellipsoidal or

subglobose, 3-7 um; budding monopolar. CoLontzs [D]-colored, smooth.

SPECIMEN EXAMINED — ISRAEL. GOLAN HEIGHTS, En Zivan, 33°11'09"N 35"79'10"E,

11.1.2011, from fallen leaves of Quercus boissieri, leg. D.M. Gotman (HAI-Y-183;

GenBank JQ317682).

COMMENTS - Cryptococcus carnescens belongs to the Tremellales

(Tremellomycetes).

DISTRIBUTION — Europe, Asia, Antarctica (Gadanho et al. 2003, Wuczkowski et al. 2005,

Butinar et al. 2007, Connell et al. 2008, Golubev & Tomashevskaya 2010, Li et al. 2010,

Loque et al. 2010, Kurtzman et al. 2011, Baleiras-Couto et al. 2012).

Cryptococcus phenolicus A. Fonseca et al., Can. J. Microbiol. 46(1): 24 (2000) Fie. 3

CELLS after 3 days growth on YM agar at 25°C single, globose, 4-8 um in

diam; budding monopolar. Cotonizs [B]-colored with glossy and smooth

surfaces.

SPECIMEN EXAMINED — ISRAEL. GOLAN HEIGHTS, En Zivan, 33°11'16"N 35"79'10"E,

11.1.2011, from grassland soil, leg. D.M. Gotman (HAI-Y-158; GenBank JQ581045).

ComMEntTs - This species belongs to the Filobasidiales lineage. Based on its

ability to degrade phenol, C. phenolicus may be used to assimilate different

aromatic compounds (Fonseca et al. 2000).

DISTRIBUTION — Europe, Asia, South America, Africa (Hong et al. 2002, Cornelissen et

al. 2003, Zachow et al. 2009, Vreulink et al. 2010, Mestre et al. 2011).

Cryptococcus terreus Di Menna, J. Gen. Microbiol. 11: 195 (1954) FIG. 4

CELLS after 3 days growth on YM agar at 25°C single, mainly globose, 5-11

um in diam; budding monopolar. Cotontgs [C/E]-colored, with glossy smooth

surfaces.

SPECIMEN EXAMINED — ISRAEL. GOLAN HEIGHurTs, En Zivan, 33°11'16"N 35"79'10"E,

11.1.2011, from grassland soil, leg. D.M. Gotman (HAI-Y-162; GenBank JQ581046).

Comments - This species is also in the Filobasidiales lineage with C. phenolicus

and was isolated from the same habitat. Apparently, C. terreus is a soil inhabitant.

As with C. phenolicus, C. terreus can assimilate phenol and phenol-related

compounds (Bergauer et al. 2005). Cryptococcus terreus, C. fuscescens, and

C. phenolicus are the main cryptococcal soil inhabitants (Kurtzman et al. 2011).

Yeasts new to Israel ... 235

Fics 1-4. Yeast cells after two days of growing on YM medium, dark field light microscopy.

1. A. nothofagi; 2. C. carnescens; 3. C. phenolicus; 4. C. terreus.

Scale bar = 10 um.

DISTRIBUTION — Europe, Asia, North America, South America, Oceania (Ba et al. 2000;

Slavikova &Vadkertiova 2000; Hong et al. 2002, 2006; Maksimova & Chernov 2004;

Mankowski & Morrell 2004; Bergauer et al. 2005; Langdon et al. 2005; Borelli et al. 2006;

Lynch & Thorn 2006; Vishniac 2006; Rodrigues et al. 2009; Singh et al. 2009; Wang et al.

2009; Golubev & Tomashevskaya 2010; Mestre et al. 2011).

Komagataella pastoris (Guillierm.) Y. Yamada et al., Biosc., Biotechn.,

Biochem. 59(3): 444 (1995) Fic. 5

CELLS after 3 days growth on YM agar at 25°C spherical to ovoid, 2-6 um,

occurring singly or in pairs; budding polar. COLONIEs white, mucoid.

SPECIMEN EXAMINED — ISRAEL. CARMEL Mount, Haifa, Carmel National Park,

32°75'03"N 35°02'77"E, 18.X11.2010, from soil under Quercus calliprinos, leg. D.M.

Gotman (HAI-Y-67; GenBank JQ581044).

236 ...Gotman, Wasser & Nevo

Fics 5-7. Yeast cells after two days of growing on YM medium, dark field light microscopy.

5. K. pastoris; 6. R. lusitaniae; 7. S. occidentalis.

Scale bar = 10 um.

ComMENnts - K. pastoris represents Phaffomycetaceae in the Saccharomycetales.

The major habitats of K. pastoris are tree exudates and decomposing wood.

Phylogenetically, it is very close to K. phaffii and K. pseudopastoris, having no

differences in fermentation and growth, but only in D1/D2 LSU rRNA gene

sequences (Kurtzman 2005). They also were isolated from tree exudates and

rotted wood. K. pastoris has a strong biotechnological potential as a recombinant

protein production system (Heyland et al. 2010).

DISTRIBUTION — Europe, North America, South America, Africa (Phaff & Knapp 1956;

Faparusi 1981; Lachance et al. 1982, 1995; Spencer et al. 1995; Dlauchy et al. 2003).

Yeasts new to Israel ... 237

Rhodosporidium lusitaniae A. Fonseca & J.P. Samp., Syst. Appl. Microbiol.

15(1): 48 (1992) FIG. 6

CE.LSafter 3 days growth on YM agar at 25°C single, cylindrical to bacilliform,

3-4 x 9-11 um; budding polar. CoLontzs apricot colored, smooth.

SPECIMEN EXAMINED — ISRAEL. CARMEL Mownrt, Haifa, Carmel National Park,

32°75'00"N 35°02'70"E, 18.X1I.2010, from fallen leaves of Quercus calliprinos, leg. D.M.

Gotman (HAI-Y-58; GenBank JQ581047).

ComMENTS - Rhodosporidium lusitaniae is classified in Sporidiobolales

(Microbotryomycetes).

DISTRIBUTION — Europe (Bergauer et al. 2005), where it is restricted to Austria, Israel,

and Portugal.

Schwanniomyces occidentalis Klécker, Meddn Carlsberg Lab. 7: 276 (1909) Fic. 7

CELLS after several days growth on YM agar at 25°C globose to ovoid, 5-11

um in diam., singly or in pairs and small chains; budding polar. COLONIES

white, smooth.

SPECIMEN EXAMINED — ISRAEL. LOWER GALILEE, Kefar Kish, 32°65'45"N 35°44'44"E,

22.XII.2010, from soil, leg. D.M. Gotman (HAI-Y-90; GenBank JQ581050).

Comments - Almost all known strains of this species in the Debaryomycetaceae

(Saccharomycetales) have been isolated from soil. Schwanniomyces occidentalis,

which is regarded as an important “non-conventional” yeast with potential

biotechnological value, has a good capacity for starch degradation. Several

genetic models were developed for the production of heterologous proteins

from S. occidentalis (Spencer et al. 2002).

DISTRIBUTION — Europe, Asia, North America (Capriotti 1957, Phaff et al. 1960, Urano

et al. 2002, Slavikova &Vadkertiova 2003, Boby et al. 2008).

Discussion

Our research has revealed seven yeast species new for Israeli mycobiota.

Four were found in soil (C. phenolicus, C. terreus, K. pastoris, S. occidentalis),

one on fallen leaves of Quercus boissieri (C. carnescens), and one on fallen

leaves of Quercus calliprinos (R. lusitaniae). Apiotrichum nothofagi was isolated

both from fallen leaves of Ceratonia siliqua and from fallen needles of Pinus

halepensis. Five species are new for the Middle East. Only C. terreus and

S. occidentalis were previously recorded in Egypt (Youssef & Eldin 1998, El-

Assal et al. 2011).

Worldwide, Cryptococcus terreus and Schwanniomyces occidentalis have been

isolated from various soil types and have wide geographical distribution. The

cosmopolitan C. carnescens has been found on different substrates all over the

world. Besides soil, C. carnescens has been isolated from grape surface, seawater,

marine microalgae, leaves, needle litter, and even from such extreme habitats as

238 ...Gotman, Wasser & Nevo

glacial ice. Soil and leaf litter are the main habitats for Rhodosporidium lusitaniae,

which may possibly inhabit the entire Mediterranean region in addition to

Israel and Portugal; its connection with Mediterranean forest ecosystems can

be traced. Komagataella pastoris, associated with tree exudates in deciduous

forests, has been recorded in different parts of the world. In Israel it was found

in soil (under oak), an unusual habitat for the species; yeast cells may possibly

have entered the soil from decayed oak wood. ‘The habitat of A. nothofagi is not

so clear, as the species has been recorded only a few times, mainly associated

with forest litter and decayed wood. This species has also been isolated from

seawater and blueberry fruit.

Acknowledgments

We are grateful to Dr. Andriy Sibirny (Lviv, Ukraine), Dr. Paul Volz (Jacksonville, FL,

USA) for critically reviewing of the manuscript, and to Dr. Kyria Boundy-Mills (Davis,

USA) for useful comments to the paper. We would like to express our deep thanks to Dr.

Shaun Pennycook (Auckland, New Zealand) for the nomenclature review of the article.

Literature cited

Ba AS, Phillips SA, Anderson JT. 2000. Yeasts in mound soil of the red imported fire ant. Mycol.

Res. 104: 969-973. http://dx.doi.org/10.1017/S0953756299002385

Baleiras-Couto MM, Gomes AS, Casal M, Duarte FL. 2012. Survey of yeast diversity during wine

bottling processes using restriction analysis of 26S ribosomal DNA (rDNA). Aust. J. Grape

Wine Res. 18: 39-42. http://dx.doi.org/10.1111/j.1755-0238.2011.00167.x

Bergauer P, Fonteyne P-A, Nolard N, Schinner F, Margesin R. 2005. Biodegradation of phenol and

phenol-related compounds by psychrophilic and cold-tolerant alpine yeasts. Chemosphere 59:

909-918. http://dx.doi.org/10.1016/j.chemosphere.2004.11.011

Boby VU, Balakrishna AN, Bagyaraj DJ. 2008. Interaction between Glomus mosseae and soil yeasts

on growth and nutrition of cowpea. Microbiol. Res. 163: 693-700.

http://dx.doi.org/10.1016/j.micres.2006.10.004

Boekhout T, Theelen B, Houbraken J, Robert V, Scorzetti G, Gafni A, Gerson U, Sztejnberg A. 2003.

Novel anamorphic mite-associated fungi belonging to the Ustilaginomycetes: Meira geulakonigii

gen. nov., sp. nov., Meira argovae sp. nov. and Acaromyces ingoldii gen. nov., sp. nov. Int. J. Syst.

Evol. Microbiol. 53: 1655-1664. http://dx.doi.org/10.1099/ijs.0.02434-0

Borelli BM, Ferreira EG, Lacerda ICA, Franco GR, Rosa CA. 2006. Yeast populations associated

with the artisanal cheese produced in the region of Serra da Canastra, Brazil. World J. Microbiol.

Biotechnol. 22: 1115-1119. http://dx.doi.org/10.1007/s11274-006-9151-3

Butinar L, Santos S, Spencer-Martins I, Oren A, Gunde-Cimerman N. 2005. Yeast diversity in

hypersaline habitats. FEMS Microbiol. Lett. 244: 229-234.

http://dx.doi.org/10.1016/j.femsle.2005.01.043

Butinar L, Spencer-Martins I, Gunde-Cimerman N. 2007. Yeasts in high Arctic glaciers: the

discovery of a new habitat for eukaryotic microorganisms. Antonie van Leeuwenhoek 97:

277-289. http://dx.doi.org/10.1007/s10482-006-9117-3

Capriotti A. 1957. New Blastomycetes isolated from soils of Spain I: Schwanniomyces castellii nov.

spec. Arch.Mikrobiol. 26: 434-438. http://dx.doi.org/10.1007/BF00407592

Connell L, Redman R, Craig S, Scorzetti G, Iszard M, Rodriguez R. 2008. Diversity of

soil yeasts isolated from South Victoria Land, Antarctica. Microb. Ecol. 56: 448-459.

http://dx.doi.org/10.1007/s00248-008-9363-1

Yeasts new to Israel ... 239

Cornelissen $, Botha A, Conradie WJ, Wolfaardt GM. 2003. Shifts in community composition

provide a mechanism for maintenance of activity of soil yeasts in the presence of elevated

copper levels. Can. J. Microbiol. 49: 425-432. http://dx.doi.org/10.1139/w03-057

Dlauchy D, Tornai-Lehoczki J, Fulop L, Péter G. 2003. Pichia (Komagataella) pseudopastoris sp.

nov., a new yeast species from Hungary. Antonie van Leeuwenhoek 83: 327-332.

http://dx.doi.org/10.1023/A:10233 18829389

Eisikowitch D, Kevan PG, Lachance MA. 1990. The nectar-inhabiting yeasts and their effect on

pollen germination in common milkweed, Asclepias syriaca L. Isr. J. Bot. 39: 217-225.

El-Assal SED, Abd-alla SM, Abou Seada MN. 2011. Molecular and biochemical studies of some

yeast strains. Afr. J. Biotechnol. 10: 1309-1319.

Faparusi SI. 1981. Sugars identified in raphia palm wine. Food Chem. 2: 81-86.

http://dx.doi.org/10.1016/0308-8146(81)90052-2

Fonseca A, Scorzetti G, Fell JW. 2000. Diversity in the yeast Cryptococcus albidus and related species

as revealed by ribosomal DNA sequence analysis. Can. J. Microbiol. 46: 7-27.

http://dx.doi.org/10.1139/cjm-46-1-7

Gadanho M, Almeida JMGCE, Sampaio JP. 2003. Assessment of yeast diversity in a marine

environment in the south of Portugal by microsatellite-primed PCR. Antonie van Leeuwenhoek

84: 217-227. http://dx.doi.org/10.1023/A:1026038213195

Golubev WI, Tomashevskaya MA. 2010. Yeast fungi in Picea abies (L.) Karst. needle litter.

Microbiology 79: 385-389. http://dx.doi.org/10.1134/S002626171003015X

Heyland J, Fu J, Blank LM, Schmid A. 2010. Quantitative physiology of Pichia pastoris during

glucose-limited high-cell density fed-batch cultivation for recombinant protein production.

Biotechnol. Bioeng. 107: 357-368. http://dx.doi.org/10.1002/bit.22836

Hoffman C, Winston F. 1987. A ten-minute DNA preparation from yeast efficiently releases

autonomous plasmids for transformation of Escherichia coli. Gene 57: 267-272.

http://dx.doi.org/10.1016/0378-1119(87)90131-4

Hong SG, Lee KH, Bae KS. 2002. Diversity of yeasts associated with natural environments in Korea.

J. Microbiol. 40: 55-62.

Hong SG, Lee KH, Kwak J, Bae KS. 2006. Diversity of yeasts associated with Panax ginseng.

J. Microbiol. 44: 674-679.

Kurtzman CP. 2005. Description of Komagataella phaffii sp. nov. and the transfer of Pichia

pseudopastoris to the methylotrophic yeast genus Komagataella. Int. J. Syst. Evol. Microbiol. 55:

973-976. http://dx.doi.org/10.1099/ijs.0.63491-0

Kurtzman CP, Droby S. 2001. Metschnikowia fructicola, a new ascosporic yeast with potential for

biocontrol of postharvest fruit rots. System. Appl. Microbiol. 24: 395-399.

http://dx.doi.org/10.1078/0723-2020-00045.

Kurtzman CP, Fell JW, Boekhout T. 2011. The yeasts - a taxonomic study. 5th edn. Elsevier

Science.

Lachance MA, Mencalf BJ, Starmer WT. 1982. Yeast from exudates of Quercus, Ulmus, Populus,

and Pseudotsuga: new isolations and elucidation of some factors affecting ecological specifity.

Microb. Ecol. 8: 191-198. http://dx.doi.org/10.1007/BF02010452

Lachance MA, Gilbert DG, Starmer WT. 1995. Yeast communities associated with Drosophila

species and related flies in an eastern oak-pine forest: a comparison with western communities.

J. Ind. Microbiol. 14: 484-494. http://dx.doi.org/10.1007/BF01573963

Langdon D, Hildebrand PD, Traquair JA. 2005. Yeasts of lowbush blueberry: potential biocontrol

agents for blueberry diseases. Can. J. Plant Pathol. 27: 471.

Li S-H, Cheng C, Li Z, Chen J-Y, Yan B, Han B-Z, Reeves M. 2010. Yeast species associated with

wine grapes in China. Int. J. Food Microbiol. 138: 85-90.

http://dx.doi.org/10.1016/j.ijfoodmicro.2010.01.009

240 ... Gotman, Wasser & Nevo

Loque CP, Medeiros AO, Pellizzari FM, Oliveira EC, Rosa CA, Rosa LH. 2010. Fungal

community associated with marine macroalgae from Antarctica. Polar Biol. 33: 641-648.

http://dx.doi.org/10.1007/s00300-009-0740-0

Lynch MDJ, Thorn RG. 2006. Diversity of basidiomycetes in Michigan agricultural soils. Appl.

Environ. Microbiol. 72: 7050-7056. http://dx.doi.org/10.1128/AEM.00826-06

Maksimova IA, Chernov IY. 2004. Community structure of yeast fungi in forest biogeocenoses.

Microbiology 73: 474-481. http://dx.doi.org/10.1023/B:MICI.0000036994.21650.3a

Mankowski ME, Morrell JJ. 2004. Yeasts associated with the infrabuccal pocket and colonies of the

carpenter ant Camponotus vicinus. Mycologia 96: 226-231. http://dx.doi.org/10.2307/3762058

Mestre MC, Rosa CA, Safar SVB, Libkind D, Fontenla SB. 2011.Yeast communities associated

with the bulk-soil, rhizosphere and ectomycorrhizosphere of a Nothofagus pumilio

forest in northwestern Patagonia, Argentina. FEMS Microbiol. Ecol. 78: 531-541.

http://dx.doi.org/10.1111/j.1574-6941.2011.01183.x

Nagornaya S, Babich T, Podgorsky V, Beharav A, Nevo E, Wasser S. 2003. Yeast interslope divergence

in soils and plants of “Evolution Canyon’, Lower Nahal Oren, Mount Carmel, Israel. Isr. J. Plant

Sci. 51: 55-57. http://dx.doi.org/10.1560/RMNC-XLYU-456X-V6E5

O'Donnell K. 1993. Fusarium and its near relatives. 225-233, in: DR Reynolds, JW Taylor (eds).

The Fungal Holomorph: mitotic, meiotic and pleomorphic speciation in fungal systematics.

CAB International, Wallingford, UK.

Phaff HJ, Knapp EP. 1956. The taxonomy of yeasts found in exudates of certain trees and other

natural breeding sites of some species of Drosophila. Antonie van Leeuwenhoek 22: 117-130.

http://dx.doi.org/10.1007/BF02538319

Phaff HJ, Miller MW, Cooke WB. 1960. A new species of Schwanniomyces: Schwanniomyces alluvius.

Antonie van Leeuwenhoek 26: 182-188. http://dx.doi.org/10.1007/BF02539003

Rayner R. 1969. Flora of British fungi: colour identification chart. Edinburg, Her Majesty's

stationery office.

Rodrigues A, Cable RN, Mueller UG, Bacci M, Pagnocca FC. 2009. Antagonistic interactions

between garden yeasts and microfungal garden pathogens of leaf-cutting ants. Antonie Van

Leeuwenhoek 96: 331-342. http://dx.doi.org/10.1007/s10482-009-9350-7

Rodrigues de Miranda L. 1979. Clavispora, a new yeast genus of the Saccharomycetales. Antonie van

Leeuwenhoek 45: 479-483. http://dx.doi.org/10.1007/BF00443285

Savchenko KG, Heluta VP, Wasser SP, Nevo E. 2010. Smut fungi of Israel: a preliminary check-list.

Mycologia Balcanica 7: 111-116.

Schena L, Ippolito A, Zahavi T, Cohen L, Droby S. 2000. Molecular approaches to assist the

screening and monitoring of postharvest biocontrol yeasts. Eur. J. Plant Pathol. 106: 681-691.

http://dx.doi.org/10.1023/A:10087 16018490

Singh V, Praveen V, Banga J, Tripathi CKM. 2009. Antimicrobial activities of microbial strains

isolated from soil of stressed ecological niches of Eastern Uttar Pradesh, India. Indian J. Exp.

Biol. 47: 298-303.

Slavikova E, Vadkertiova R. 2000. The occurrence of yeasts in the forest soils. J. Basic Microbiol. 40:

207-212. http://dx.doi.org/10.1002/1521-4028(200007)40:3<207::AID-JOBM207>3.0.CO;2-H

Slavikova E, Vadkertiova R. 2003. The diversity of yeasts in the agricultural soil. J. Basic Microbiol.

43: 430-436. http://dx.doi.org/10.1002/jobm.200310277

Smith M. 1986. Zygoascus hellenicus gen. nov., sp. nov., the teleomorph of Candida hellenica

(= C. inositophila = C. steatolytica). Antonie van Leeuwenhoek 52: 25-37.

http://dx.doi.org/10.1007/BF00402684

Yeasts new to Israel ... 241

Spencer DM, Spencer JFT, Fengler E, Defigueroa LI. 1995. Yeast associated with algarrobo trees

(Prosopis spp.) in northwest Argentina: preliminary report. J. Ind. Microbiol. 14: 472-474.

http://dx.doi.org/10.1007/BF01573960

Spencer JFT, Ragout de Spencer AL, Laluce C. 2002. Non-conventional yeasts. Appl. Microbiol.

Biotechnol. 58: 147-156. http://dx.doi.org/10.1007/s00253-001-0834-2

Steiman R, Guiraud P, Sage L, Seigle-Murandi F. 1997. Soil mycoflora from the Dead Sea Oases of

Ein Gedi and Einot Zuqim (Israel). Antonie Van Leeuwenhoek 72: 261-270.

http://dx.doi.org/10.1023/A:1000441705073

Urano N, Ueno R, Kimura S. 2002. Isolation of aquatic yeasts and their bioremedial application in

fisheries. Fish. Sci. 68: 639-640.

Villa-Carvajal M, Coque JJR, Alvarez-Rodriguez ML, Uruburu F, Belloch C. 2004. Polyphasic

identification of yeasts isolated from bark of cork oak during the manufacturing process of cork

stoppers. FEMS Yeast Res. 4: 745-750. http://dx.doi.org/10.1016/j.femsyr.2004.01.007

Vishniac HS. 2006. A multivariate analysis of soil yeasts isolated from a latitudinal gradient. Microb.

Ecol. 52: 90-103. http://dx.doi.org/10.1007/s00248-006-9066-4

Vreulink JM, Stone W, Botha A. 2010. Effects of small increases in copper levels on culturable

basidiomycetous yeasts in low-nutrient soils. J. Appl. Microbiol. 109: 1411-1421.

http://dx.doi.org/10.1111/j.1365-2672.2010.04770.x

Wang GH, Xu YX, Jin J, Liu JD, Zhang QY, Liu XB. 2009. Effect of soil type and soybean genotype

on fungal community in soybean rhizosphere during reproductive growth stages. Plant Soil

317: 135-144. http://dx.doi.org/10.1007/s11104-008-9794-y

Wuczkowski M, Metzger E, Sterflinger K, Prillinger H. 2005. Diversity of yeasts isolated from litter

and soil of different natural forest sites in Austria. Die BodenKultur 56: 201-208.

Youssef YA, Eldin AK. 1998. Airborne spores of opportunistic fungi in the atmosphere of Cairo,

Egypt. Grana 27: 89-92. http://dx.doi.org/10.1080/00173138809427737

Zachow C, Berg C, Mueller H, Meincke R, Komon-Zelazowska M, Druzhinina IS, Kubicek CP,

Berg G. 2009. Fungal diversity in the rhizosphere of endemic plant species of Tenerife (Canary

Islands): relationship to vegetation zones and environmental factors. ISME J. 3: 79-92.

http://dx.doi.org/10.1038/ismej.2008.87

Zahavi T, Droby S, Cohen L, Weiss B, Ben-Arie R. 2002. Characterization of the yeast flora on the

surface of grape berries in Israel. Vitis 41: 203-208.

Zhang Z, Schwartz S, Wagner L, Miller W. 2000. A greedy algorithm for aligning DNA sequences.

J. Comput. Biol. 7: 203-214. http://dx.doi.org/10.1089/10665270050081478

Zvyagilskaya R, Andreishcheva E, Soares M, Khozin I, Berhe A, Persson B. 2001. Isolation and

characterization of a novel leaf-inhabiting osmo-, salt-, and alkali-tolerant Yarrowia lipolytica

yeast strain. J. Basic Microbiol. 41: 289-303.

http://dx.doi.org/10.1002/1521-4028(200110)41:5<289::AID-JOBM289>3.0.CO;2-S

MY COTAXON

http://dx.doi.org/10.5248/122.243

Volume 122, pp. 243-247 October-December 2012

A new record of the desert truffle Picoa lefebvrei in Saudi Arabia

ABDULHAKIM BAWADEKJI’, MARIA LETIZIA GARGANO?’,

ALESSANDRO SAITTA? & GIUSEPPE VENTURELLA”*

‘Northern Borders University, Faculty of Science,

Arar, P.O. Box 1631, Kingdom of Saudi Arabia

?Dipartimento di Biologia Ambientale e Biodiversita,

Via Archirafi 38, I-90123 Palermo, Italy

*CORRESPONDENCE TO: giuseppe.venturella@unipa. it

ABsTRACT — A new record of Picoa lefebvrei from Saudi Arabia is reported accompanied by

notes on its taxonomy, ecology, and distribution.

Key worps — truffle, drip irrigation, Arar

Introduction

Hypogeous mushrooms named desert truffles are commercialized in Saudi

Arabia under the local name of faqaa [including khalasi, which belongs to

Terfezia (Tul. & C. Tul.) Tul. & C. Tul., and zubaidi, which is used for species

of Tirmania Chatin]. Local populations appreciate desert truffles for their

nutritional and sensory qualities (Bokhary & Parvez 1988). Picoa lefebvrei or

bird truffle (known locally as hober) was first reported by Bokhary & Parvez

(1988; as Phaeangium lefebvrei Pat.) from Harrat al Harra in Al Jouf Province

(northern Saudi Arabia). During winter and spring field excursions in the

eastern sector of Northern Borders Province, the senior author (A. Bawadekji)

discovered a new locality in Saudi Arabia for P. lefebvrei.

Materials & methods

The investigation was carried out from November to March during 2010-12. The

habitat was recorded and the collected samples were identified by examining the peridium

and gleba. Ascospores were examined in water under a Leica DMLB microscope.

Nomenclature follows MycoBank (http://www.mycobank.org). The collection is

deposited in the newly established Herbarium of the Department of Biological Sciences,

Northern Borders University, Kingdom of Saudi Arabia (here cited as KSA); a duplicate

is stored in the Herbarium Mediterraneum Panormitanum in Palermo (PAL).

244 ... Bawadekji & al.

——

Fic. 1: Picoa lefebvrei.

a. Habitat of growth. b. A typical outgrowth of the soil. c. Ascomata. d. Detail of peridium.

Picoa lefebvrei in Saudi Arabia ... 245

Fic. 1: Picoa lefebvrei.

a. Ascus and ascospores. b. Peridial hyphae.

Species description

Picoa lefebvrei (Pat.) Maire, Ann. Mycol. 4: 332. 1906. FIGS 1, 2

Ascomata irregularly globose, surface shining when ripe, hypogeous and

semi-hypogeous, growing in groups, 0.5-8 cm diameter, brown-ochre, covered

by numerous and small irregular warts, 1-2 mm wide, ca. 1 mm tall, sparse.

Peridium 0.5 mm thick, pseudoparenchymatic, with angular-subglobose

elements bearing septate hairs, ochre-brown to brown, filled with fine granules,

246 ... Bawadekji & al.

thick-walled, 100-120 x 8-10 um. Cylindrical hyaline hyphae are present under

the subglobose cells layer. Odour Terfezia-like, not as strong at the beginning

of fruiting season (November to mid-January), becoming more intense as

the air and soil temperatures increase. Gleba firm, whitish, veins more or less

evident. Asci ellipsoidal, with 6-8 spores, 50-110 x 50-75 um, encompassed

in the trama, with a long peduncle, then subglobose and shortly pedunculate.

Ascospores disorderly arranged in the ascus (Fic. 2), subglobose to broadly

ellipsoidal, 25-30 x 20-25 um, hyaline with a big guttule when unripe, then pale

olive and covered by tiny, rounded, cyanophilous warts.

SPECIMENS EXAMINED: SAUDI ARABIA. NORTHERN BORDERS PROVINCE, Muayala

Natural Reserve, 15 km south of Arar, 30°54'24"N 40°59'56"E, 552 m, on pastures, on

calcareous and sandy soils with neutral pH reaction and low levels of organic matter, 10

Jan 2010 (provisional number KSA 001), 20 Dec 2011 (provisional number KSA 002),

13 Jan 2012 (PAL 001/KSA), coll. A. Bawadekji.

Ecology

Picoa lefebvrei fruits from January to April in North Africa and Middle

East during years of adequate rainfall (Alsheikh & Trappe 1983). In Kuwait

the species is confined to gypsiferous and calcareous gravelly deserts, where it

is dug out and eaten by several species of migrating birds (Alsheikh & Trappe

1983).

Bokhary & Parvez (1988) regarded some ecological factors as favorable for

production of desert truffles. In particular they considered rainfall as important

for fructification of Terfezia and Picoa species. Morte et al. (2009), who stressed

the importance of irrigation in cultivating desert truffles, pointed out that

irrigation should be applied first at the end of the summer during dry years

when rainfall is less than 150 mm and next at the beginning of the fruiting

season in very dry years. It is interesting to note that the collection sites for

P. lefebvrei in Muayala Natural Reserve experience drip irrigation of ca. 150

mm of water per year, while the mean annual rainfall value for this locality is

only 40 mm.

Discussion

Picoa lefebvrei was originally placed in the genus Phaeangium Pat. because of

spore ornamentation and tomentose peridium not present in other Picoa species

(Alsheikh & Trappe 1983). Ammarellou et al. (2011) through phylogenetic ITS

and 28s rDNA sequence analyses demonstrated that P. lefebvrei belongs to

the Geopora-Tricharina clade of the Pyronemataceae (Pezizales, Ascomycota),

placing Phaeangium lefebvrei in Picoa Vittad. based on its close morphological

and genetic relationship with the type species, Picoa juniperis Vittad. Our

macro- and micro-morphological observations of P. lefebvrei are in accord

with Ammarellou et al. (2011) and confirm its placement in Picoa.

Picoa lefebvrei in Saudi Arabia ... 247

The new collection locality for P. lefebvrei is 15 km south of the city of Arar,

in Northern Borders Province. Because the locality reported by Bokhary &

Parvez (1988) is 400 km away in Al Jouf Province, our new finding constitutes

a significant extension to the distribution of P. lefebvrei in Saudi Arabia.

Furthermore, the ecological features of the investigated area help identify a

correct and sustainable management protocol for establishing good practices

for commercial cultivation of P. lefebvrei for trade and to halt desertification

processes.

Acknowledgements

The authors wish to thank Profs. Alessandra Zambonelli (Bologna, Italy) and

Georgios I. Zervakis (Athens, Greece) for critically reviewing the manuscript and for

their help with linguistic revision. We also wish to thank Eng. Saleh Hussein Sughaier

and Eng. Saleh Eid Al-Naiem from the Directorate General for Agriculture at Northern

Borders Province (Arar, Kingdom of Saudi Arabia) for their valuable help in installing

the drip irrigation system at Muayala Natural Reserve.

Literature cited

Alsheikh AM, Trappe JM. 1983. Taxonomy of Phaeangium lefebvrei, a desert truffle eaten by birds.

Canadian Journal of Botany 61(7): 1919-1925. http://dx.doi.org/10.1139/b83-204

Ammarellou A, Smith ME, Tajick MA, Trappe JM. 2011. The phylogenetic placement of Picoa, with

a first report on Picoa lefebvrei (Pat.) Maire (= Phaeangium lefebvrei) from Iran. International

Journal of Environmental Research 5(2): 509-514.

Bokhary HA, Parvez S. 1988. Desert truffles “Al-Kamah” of the Kingdom of Saudi Arabia. 2.

Additional contributions. Arab Gulf Journal of Scientific Research, B. Agricultural and

Biological Sciences 86(1): 103-112.

Morte A, Zamora M, Gutiérrez A, Honrubia M. 2009. Desert truffle cultivation in semiarid

Mediterranean areas. 221-233, in: C Azcén-Aguilar et al. (eds). Mycorrhizas. Functional

processes and ecological impact. Springer-Verlag, Berlin, Heidelberg.

http://dx.doi.org/10.1007/978-3-540-87978-7_15

MYCOTAXON

http://dx.doi.org/10.5248/122.249

Volume 122, pp. 249-253 October-December 2012

Coccomyces hubeiensis,

a new fungus of Rhytismatales from China

MENG-SHI YANG’, YING-REN LIN?’, LAN ZHANG! & XIAO- YAN WANG!

' School of Life Science &? School of Forestry & Landscape Architecture,

Anhui Agricultural University, West Changjiang Road 130, Hefei, Anhui 230036, China

*CORRESPONDENCE TO: yingrenlin@yahoo.com

ABSTRACT —A new fungus found on fallen leaves of Rhododendron erubescens from the

Shennongjia forestry region of Hubei Province, China, is described as Coccomyces hubeiensis.

This species differs from C. dentatus by its asci with subtruncate-conical apices, paraphyses

branched near the top, infrequent zone lines, and the absence of conidiomata. The type

specimen is deposited in the Reference Collection of Forest Fungi of Anhui Agricultural

University, China (AAUF).

Key worps —Rhytismataceae, morphology, Ericaceae

Introduction

Coccomyces De Not., established by de Notaris in 1847, is now placed in the

Rhytismatales (Leotiomycetes, Ascomycota) (Kirk et al. 2008). Coccomyces taxa

are characterized by polygonal or more or less circular ascomata that open by

several radiate or irregular splits, cylindrical to clavate asci, and filiform, long-

fusiform, or clavate ascospores, often with gelatinous sheaths (Sherwood 1980;

Cannon & Minter 1986; Johnston 1986, 2000; Spooner 1990; Lin et al. 1994; Jia

et al. 2012). External shape, size, and ascomal openings, ascal shape and size,

and the shape of paraphyses at the apex are regarded as the most important

taxonomic characters (Johnston 1986; Lin 1998).

Twenty-five Coccomyces species have been reported in China (Korf &

Zhuang 1985; Lin 1998; Hou et al. 2006, 2007; Jia et al. 2012; Zheng et al. 2012)

since Teng (1934) first recorded C. dentatus on Quercus and Castanea and

C. delta on Lauraceae. Recently, a new Coccomyces species was found on fallen

leaves of Rhododendron erubescens in the Shennongijia forestry region, Hubei

Province.

Materials & methods

Mature ascomata with macroscopic characteristics of Rhytismataceae were selected

from the collected specimens. We observed external shape, size, color, the opening

250 ... Yang & al.

mechanisms of ascomata, and zone line characteristics using a stereoscope with 10-50x

magnification.

The fruitbodies were rehydrated in water for 10 min, and 10-15 um thick sections

of the ascomata were cut using a freezing microtome. Microscopic examinations were

mounted in water, 5% KOH, Melzer’s reagent, or 0.1% (w/v) cotton blue in lactic acid.

For observing the outlines of ascomata in vertical section, sections were mounted in

lactic acid or cotton blue with pretreatment in water. The gelatinous matrix surrounding

ascospores and paraphyses was observed in water or cotton blue in lactic acid. The

color of internal structures was observed in water. Measurements and drawings of asci,

ascospores, and paraphyses were made using material mounted in 5% KOH or Melzer’s

reagent and from 30 ascospores, asci, and paraphyses for each specimen. Illustrations

of external shapes and internal structures of the ascomata were prepared using the

Panasoianic XSJ-2 microscope drawing device.

Taxonomy

Coccomyces hubeiensis Y.R. Lin & M.S. Yang, sp. nov. FIGS 1-5

MycoBank MB800351

Differs from Coccomyces dentatus by its branched paraphyses and asci with subtruncate-

conical apices and from C. cyclobalanopsis by its lack of excipulum and periphysoids.

Type: China, Hubei, Shennongjia forestry region, Xiaolongtan, alt. 1300m, on fallen

leaves of Rhododendron erubescens Hutch. (Ericaceae), 9 July 2010, Y.R. Lin, J.L. Chen &

Q. Zheng 2385 (AAUF 68493).

ErymMo.oey: hubeiensis, referring to the province where the specimen was collected.

ZONE LINES black-brown, infrequent, surrounding the bleached spots.

CONIDIOMATA not observed.

Ascomarta on both sides of the fallen leaves, but predominantly on the upper

side, sparsely scattered in light grey-white, subcircular or irregular bleached areas

15-25 mm diam. without obvious edges. In surface view, ascomata triangular

to pentagonal, 570-950 um diam., shining black, moderately raising above the

surface of leaf but flat or slightly hollow in the centre portion, with an obvious

preformed dehiscence mechanism, opening by 3-5 radial splits which extend

nearly to the edge of ascoma to expose the light yellow-brown hymenium.

Lips absent. In median vertical section, ascomata intraepidermal. COVERING

STROMA 30-35 um thick near the opening, composed of black-brown textura

epidermoidea or angularis with thick-walled cells 4-7 um diam., aliform cells

mainly existing near the inner layer of the covering stroma, becoming thinner

towards the edge gradually and extending to the basal stroma. ExcipuULUM

absent. BASAL STROMA 10-18 um thick, consisting of textura angularis with 2-3

rows of black-brown, thick-walled cells 4-6 um diam. Colorless, thin-walled,

large angular cells 6-12 um diam. exist between the covering stroma and basal

stroma. INTERNAL MATRIX STROMA poorly developed, comprised of hyaline,

gelatinised textura intricata. SUBHYMENIUM 15-20 um thick, composed of

pied

Coccomyces hubeiensis sp. nov. (China) ...

df Or) oe:

BES

| ;

As) My SHB

LAK on

ay ’S ye

50um

Fics 1-5. Coccomyces hubeiensis on Rhododendron erubescens. 1. Habit on a leaf. 2. Detail of

ascomata and a zone line. 3. Ascoma in median vertical section. 4. Portion of ascoma in median

asci and ascospores.

vertical section. 5. Paraphyses,

252 ... Yang & al.

colorless textura porrecta-intricata. PARAPHYSES filiform, 90-150 x 1.5-2 um,

septate, the tips gradually swollen to 2.5-3 um, rarely curved or branched, and

sometimes forming epithecium above the asci, enveloped in mucus 0.8—1.2 um

thick. Asci ripening sequentially, cylindric-clavate, 80-120 x 7.5-10 um, apex

subtruncate-conical, without circumapical thickening, thin-walled, somewhat

long-stalked, J-, 8-spored. AscosporEs arranged in a fascicle, filiform, 65-102

x 1.5-1.8 um, hyaline, aseptate, gradually tapered to the round distal end, with

a gelatinous sheath ca 1 um thick.

HOsT SPECIES & DISTRIBUTION: producing ascomata on fallen leaves of

Rhododendron erubescens; known only from the type locality, Hubei, China.

COMMENTS—Coccomyces dentatus is closely related to C. hubeiensis in the

shape of asci and in the absence of lips, periphysoids, and excipulum, but differs

in ascomata that are quadrate to hexagonal, black zone lines, the presence of

abundant conidiomata, and paraphyses that are apically unbranched and do not

form an epithecium (Sherwood 1980). Coccomyces coronatus is distinguished

from the new species by its orbicular or polygonal ascomata, short-stalked larger

asci (100-130 x 11-13 um), and shorter and wider ascospores (60-80 x 2—2.5

um) (Sherwood 1980). Coccomyces hubeiensis resembles C. cyclobalanopsis in

the shape and size of ascomata, paraphyses, and ascospores as well as in the

color of the exposed hymenium. However, C. cyclobalanopsis differs in having

small abundant bleached spots, a covering and basal stroma consisting of a

textura globulosa, and an extremely well-developed excipulum arising from the

inner layer of the covering stroma (Lin et al. 2000).

Acknowledgments

The authors are grateful to the National Natural Science Foundation of China (No.

31270065), and the Specialized Research Fund for the Doctoral Program of Higher

Education of China (No. 20070364002) for financial support. We would like to express

our deep thanks to Dr. D.W. Minter and Dr. M. Ye for reviewing the manuscript

and providing valuable suggestions and to J.L. Chen and Q. Zheng for the field

investigations.

Literature cited

Cannon PF, Minter DW. 1986. The Rhytismataceae of Indian subcontinent. Mycol. Pap. 155:

1-123.

Hou CL, Piepenbring M. 2007. Two new species of Rhytismataceae on twigs of conifers from

Yunnan Province, China. Mycotaxon 102: 165-170.

Hou CL, Kirschner R, Chen CJ. 2006. A new species and new records of Rhytismatales from Taiwan.

Mycotaxon 95: 71-79.

Jia GJ, Lin YR, Hou CL. 2012 [“2011”]. A new species of Coccomyces (Rhytismatales, Ascomycota)

from Mt. Huangshan, China. Mycotaxon 118: 231-235. http://dx.doi.org/10.5248/118.231

Johnston PR. 1986. Rhytismataceae in New Zealand 1. Some foliicolous species of Coccomyces de

Notaris and Propolis (Fries) Corda. New Zealand J. Bot. 24: 89-124.

Coccomyces hubeiensis sp. nov. (China) ... 253

Johnston PR. 2000. Rhytismatales of Australia: the genus Coccomyces. Aust. Syst. Bot. 13: 199-243.

http://dx.doi.org/10.1071/SB98034

Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi,

10th ed. CAB International. Wallingford. 771 p.

Korf RP, Zhuang WY. 1985. Some new species and new records of Discomycetes in China.

Mycotaxon 22: 483-514.

Lin YR. 1998. Studies on Coccomyces de Notaris and Neococcomyces gen. nov. in China.

[Ph.D. thesis; in Chinese]. Northeast Forestry University. Harbin. 98 p.

Lin YR, Liu HY, Tang YP, Hu BE. 1994. Two new species of the genus Coccomyces from China

[in Chinese]. Acta Mycol. Sin. 13: 8-12.

Lin YR, Li ZZ, Huang CC, Xiang CT. 2000. Studies on the genus Coccomyces from China II

[in Chinese]. Mycosystema 19: 297-301.

Sherwood MA. 1980. Taxonomic studies in the Phacidiales: The genus Coccomyces (Rhytismataceae).

Occ. Pap. Farlow Herb. Crypt. Bot. 15: 1-120.

Spooner BM. 1990. Coccomyces and Propolis (Rhytismatales) from Mt Kinabalu, Borneo. Kew

Bulletin 45: 451-484. http://dx.doi.org/10.2307/4110513

Teng SC. 1934. Notes on Discomycetes from China. Sinensia 5: 431-465.

Zheng Q, Lin YR, Yu SM, Chen L. 2012 [“2011”]. Species of Rhytismataceae on Lithocarpus spp.

from Mt Huangshan, China. Mycotaxon 118: 311-323. http://dx.doi.org/10.5248/118.311

MY COTAXON

http://dx.doi.org/10.5248/122.255

Volume 122, pp. 255-259 October-December 2012

A microfungus from Costa Rica: Ticosynnema gen. nov.

RAFAEL FE. CASTANEDA-RuI1z', MARIA M. GRANADOS?’,

MELISSA MARDONES?, MARC STADLER‘, DAVID W. MINTER>,

MARGARITA HERNANDEZ-RESTREPO’, JOSEPA GENE® & JOSEP GUARRO®

"Instituto de Investigaciones Fundamentales en Agricultura Tropical ‘Alejandro de Humboldt’

(INIFAT), Académico Titular de la “Academia de Ciencias de Cuba”,

Calle 1 Esq. 2, Santiago de Las Vegas, C. Habana, Cuba, C.P.17200

?Centro de Investigaciones en Proteccién de Cultivos (CIPROC), Universidad de Costa Rica

°Escuela de Biologia, Universidad de Costa Rica

‘Department of Microbial Drugs, Helmholtz-Center for infection Research,

Inhoffenstrasse 8,38124 Braunschweig, Germany

*Bakeham Lane, Egham, Surrey, TW20 9TY, United Kingdom

°Unitat de Micologia, Facultat de Medicina Ciéncies de la Salut, Universitat Rovira i Virgili,

43201 Reus, Spain

*CORRESPONDENCE TO: marc.stadler@t-online.de

ABSTRACT — Ticosynnema carranzae gen. & sp. nov., a new microfungus collected on the

twig of an unidentified plant, is described and illustrated. It is distinguished by synnematous

determinate conidiomata, monoblastic integrated determinate conidiogenous cells, and solitary,

3-4-septate, oblong, cylindrical to vermiform, brown conidia that secede rhexolytically.

KEY worpDs — anamorphic fungi, systematics, leaf litter

During an ascomycete-basidiomycete workshop field course at the VII Latin-

American Mycological Congress, more than 100 samples of dead plant material

colonized by anamorphic fungi were collected in a dry forest at the wildlife

station in Santa Rosa National Park, Guanacaste, Costa Rica. Among these

samples a conspicuous synnematous fungus was collected, which is herein

described and illustrated.

Taxonomy

Ticosynnema R.F. Castafieda, Granados & Mardones, anam. gen. nov.

MycoBank MB800232

Differs from Leuliisinea by brown to black conidiomata and determinate conidiogenous

cells, from Endophragmiella by synnematous conidiomata and determinate

256 ... Castafieda-Ruiz & al.

conidiogenous cells, and from Kramasamuha by synnematous conidiomata and

unbranched filaments.

TYPE SPECIES: Ticosynnema carranzae R.F. Castafieda et al.

EryMo.oey: Tico-, is an indigenous word for Costa Rica, -synnema, referring to the

type of conidioma of this anamorphic fungus.

Anamorphic fungi. CONIDIOMATA on the natural substratum synnematous,

scattered, determinate, dark brown to black. Mycelium superficial and

immersed. CONIDIOPHORES macronematous, mononematous, erect, septate,

loosely packed or compact, brown to dark brown. CONIDIOGENOUS CELLS

monoblastic, integrated, determinate, terminal. Conidial secession rhexolytic.

Conip1a solitary, acrogenous, cylindrical, vermiform to oblong, with a

conspicuous basal frill produced by the rhexolytic fracture of the wall of the

conidiogenous cells, septate, foveate, smooth or verruculose, pale brown to

brown. Teleomorph unknown.

Note: Ticosynnema superficially resembles Leuliisinea Matsush., but has

percurrent proliferating, annellate conidiogenous cells and hyaline conidiomata.

In fact, the two genera are similar only with respect to rhexolytic conidial

secession (Matsushima 1985, Seifert et al. 2011). Endophragmiella B. Sutton

and Kramasamuha Subram. & Vittal (Seifert et al. 2011) also produce conidia

by rhexolytic fracture of the monoblastic conidiogenous cells, but both lack

synnematous conidiomata. Endophragmiella has percurrent conidiogenous

cell proliferations while such proliferations are absent in Ticosynnema and

Kramasamuha. In addition, short sympodial or verticillate branches are present

in Kramasamuha (Subramanian & Vittal 1973, Seifert et al. 2011).

Ticosynnema carranzae R.F. Castafieda, Granados & Mardones,

anam. sp. nov. Fies 1,2

MycoBank MB800231

Differs from Leuliisinea bambusicola by having brown to black conidiomata and

determinate conidiogenous cells, from LEndophragmiella spp. by synnematous

conidiomata and determinate conidiogenous cells, and from Kramasamuha sibika by

synnematous conidiomata and unbranched filaments.

Type: Costa Rica, Guanacaste, Santa Rosa National Park, wildlife station, 10°52 N 85°35

W, on living twig of unidentified plant, 15 July 2011, coll. Dr. Aida Vasco Palacios,

C11/51 (Holotype, HAL 2454 F).

ETyMoLocy: Latin, carranzae, named in honor of Dr. Julieta Carranza, a Costa

Rican mycologist, for her contribution to Latin-American mycological progress and

development.

ConipioMarTa on the natural substratum synnematous, determinate, scattered,

erect, dark brown to black, 250-600 um tall, 40-70 um wide. STtipE composed

of parallel hyphal filaments (conidiophores), multi-septate, straight, cylindrical,

closely packed at the base and loosely towards the apex, black or dark brown

Ticosynnema carranzae gen. & sp. nov. (Costa Rica) ... 257

Fic. 1. Ticosynnema carranzae (ex holotype HAL 2454 F): a. Conidiomata. b. Conidiogenous cells.

c. Attached conidium. d-e. Conidia. Bars = 20 um (a) and 10 um (b-e).

258 ... Castafieda-Ruiz & al.

Fic. 2. Drawing of Ticosynnema carranzae (ex holotype HAL 2454 F):

a. Conidia. b. Conidiogenous cells. Bars = 10 um.

below, brown or pale brown above, smooth, 5-8 um diam. Mycelium partly

immersed and partly superficial. Hyphae septate, branched, smooth, pale brown,

2-4 um diam. CONIDIOGENOUS CELLS monoblastic, terminal, determinate,

integrated, brown to pale brown, 17-25 x 4-5 um. Conidial secession rhexolytic.

Conip1a solitary, acrogenous, oblong, cylindrical, vermiform, 3-4-septate,

foveate to verruculose, 35-45 x 11-12 um, brown to dark brown, dry, with end

cells usually markedly different; basal cell hemispherical, slightly narrower at

the first septum, with an evident pale brown frill 1.5-2.5 um long; apical cell

somewhat obtuse. Teleomorph unknown.

Ticosynnema carranzae gen. & sp. nov. (Costa Rica) ... 259

Acknowledgments

The authors express their sincere gratitude to Dr. Xiu-Guo Zhang and Dr. De-Wei

Li for their critical review of the manuscript. We also thank Dr. Aida Vasco Palacios

for provide the specimens collected in Costa Rica. We thank Prof. Dr. Uwe Braun for

facilities through HAL accession numbers. The authors are deeply indebted to the

Universidad de Costa Rica and the Cuban Ministry of Agriculture for facilities. We also

thank Mirtha Caraballo and Beatriz Ramos for technical assistance. We acknowledge

the facilities provided by Dr. P.M. Kirk and Drs. V. Robert and G. Stegehuis through the

IndexFungorum and Mycobank websites. Dr. Lorelei L. Norvell’s editorial review and

Dr. Shaun Pennycook’s nomenclature review are greatly appreciated.

Literature cited

Castafieda-Ruiz RF. 2005. Metodologia en el estudio de los hongos anamorfos. 182-183, in: Anais

do V Congresso Latino Americano de Micologia. Brasilia.

Matsushima T. 1985. Matsushima Mycological Memoirs 4. Kobe published by the author, 68 p.

Seifert K, Morgan-Jones G, Gams W, Kendrick B. 2011. The genera of hyphomycetes.

CBS Biodiversity Series 9: 1-997.

Subramanian CV, Vittal BPR. 1973. Three new hyphomycetes from litter. Can. J. Bot. 51: 1127-

1132. http://dx.doi.org/10.1139/b73-142

MY COTAXON

http://dx.doi.org/10.5248/122.261

Volume 122, pp. 261-263 October-December 2012

First record of Amanita dunensis in Italy

LORENZO PECORARO! & DARIO LUNGHINI ”

"Institute of Agricultural and Environmental Sciences, Estonian University of Life Sciences,

Riia St. 181, 51014 Tartu, Estonia

*Dipartimento di Biologia Ambientale, Universita di Roma “La Sapienza”

Ple Aldo Moro 5, 00185 Roma, Italy

* CORRESPONDENCE TO: lorenzo.pecoraro@gmail.com

ABSTRACT — Amanita dunensis is recorded for the first time in Italy. It was collected in the

sandy dunes of Macchiagrande Natural Reserve near Rome (Central Italy). This finding

extends the geographic distribution of the species, previously recorded only in France and

Spain.

KeY worpbs — in situ conservation, rare Amanita species, Latium littoral

Introduction

During mycological research aimed at improving knowledge of the fungal

biodiversity in Macchiagrande Natural Reserve (Pecoraro & Lunghini 2003,

Pecoraro et al. 2003), observations were carried out from November 1996 to

January 2001 in different ecosystems included in this area.

The main object of our study was the sand dunes, one of the most interesting

natural components in the research area. These dunes, which are the inner

core of the coastal dune system, lie in the junction between the evergreen

mediterranean maquis shrubs and sand dune environment. Their vegetation

is typical of Mediterranean bush, but due to the relative abiotic parameters,

species here exhibit a xeromorphic habit (e.g., Quercus ilex L., Pistacia lentiscus

L., Arbutus unedo L., Cistus incanus L., C. salviifolius L., Phillyrea latifolia L..,

P. angustifolia L., Smilax aspera L., Juniperus phoenicea L., J. oxycedrus L.). On

the other hand, truly sandy and open areas of the dune system are distinguished

by psammophilous vegetation with Pancratium maritimum L., Ammophila

littoralis (P. Beauv.) Rothm., and Eryngium maritimum L.

In this ecosystem in November 1999 we collected Amanita dunensis, a

species remarkable due to its rarity and limited geographical distribution.

262 ... Pecoraro & Lunghini

Materials & methods

The species was identified based on macro- and microscopic observations on fresh

basidiomata, following the descriptions of Heim (1963) and Bon & Andary (1983).

Notes on morphological characters and ecological conditions were recorded in the field,

and samples were taken to the laboratory for microscopic examination. The specimens

are deposited in the Herbarium D.L. of Rome (ROHB).

Results and discussion

Amanita dunensis R. Heim ex Bon & Andary, Doc. Mycol. 13(50): 13. 1983.

“Amanita phalloides f. dunensis” R. Heim, Rev. Mycol. (Paris) 28: 9. 1963, nom. inval.

Pileus 70 mm diam., applanate, not very fleshy, margin finely striate,

overall color light grey with slight green tinge. Lamellae white, rather serrate,

subadnate; lamellulae present. Stipe 140 x 20-25 mm, slender, subcylindrical,

not bulbous, covered with sand over 2/3, whitish. Annulus present but very

degraded when collected. Volva saccate, tough and resilient, whitish. Flesh

whitish, with cadaverous odour, with application of sulfovanillin turning first

intense violet-red, then brown.

Basidiospores 9-11.5(12) x 6.5-8 um, amyloid, ellipsoid to elongate-

ellipsoid. Basidia 50-60 x 10-12 um, clavate, 2- or 4-spored, without clamp

connections. Subhymenial trama subcellular.

SPECIMENS EXAMINED: ITALY. Latium, Macchiagrande Natural Reserve, Fiumicino

(Rome), 04/11/1999, leg. L. Pecoraro & D. Lunghini (ROHB D.L. 796).

Heim (1963) first described Amanita dunensis from France (Vendée) as

A. phalloides f. dunensis (nom. inval., lacking a Latin description and type);

subsequently the taxon name was validated at the rank of species by Bon &

Andary (1983). This rare Amanita species has been reported in Spain by Castro

(1998).

We collected A. dunensis in November 1999 for the first time in Italy, within

the Macchiagrande Natural Reserve along the Latium littoral toward northern

Rome.

A rare species with sabulicolous habit, A. dunensis is characterized by a

slender aspect, non-bulbous stipe, very well-developed saccate volva, subcellular

subhymenial trama, and ellipsoid to elongate-ellipsoid spores (Heim 1963, Bon

& Andary 1983). It is the only known Amanita species with both a striate cap

margin and amyloid spores. Traditionally, a striate margin in Amanita has been

associated with inamyloid spores (Garcin 1984).

Amanita dunensis differs morphologically from A. phalloides (Fr.) Link in the

more ellipsoid spores and distinctly striate cap margin and from A. phalloides

var. larroquei F. Massart & Beauvais (Massart 1984, Neville & Poumarat 2004)

by a different stipe : pileus ratio, absence of marginal pileus striations, the

obvious bulbous stipe, and the pine-wood habitat.

Amanita dunensis in Italy ... 263

The finding of A. dunensis in Italy extends its geographic distribution and

emphasizes the ecological importance of the Macchiagrande Natural Reserve

as an important center for conservation of rare fungal species.

Acknowledgments

We would like to thank Dr. Marco Contu, who confirmed the species identification

and Prof. Giuseppe Venturella and Prof. Silvano Onofri for reviewing this article.

L. Pecoraro is funded by the Estonian Science Foundation and the European Social

Fund (Mobilitas Postdoctoral Research Grant MJD135).

Literature cited

Bon M, Andary C. 1983. Amanita dunensis Heim ex Bon et Andary sp. nov. Doc. Mycol. 13(50):

13-14.

Castro ML. 1998. Annotated check list of the Amanitaceae (Agaricales, Basidiomycotina) of the

Iberian Peninsula and Balearic Islands. Mycotaxon 67: 227-245.

Garcin R. 1984. Les Amanites Européennes. FMDS, Frangy.

Heim R. 1963. Sur trois Amanites de la Flore Frangaise. Rev. de Mycol. 28: 3-10.

Massart F. 1984. Approche du genre Amanita. Observations effectuées en Gironde de 1959 a 1982.

Soc. Linn. Bordeaux, Bordeaux. 138 p.

Neville P, Poumarat S. 2004. Amaniteae. Amanita, Limacella & Torrendia. Fungi Europaei 9.

1119 p.

Pecoraro L, Lunghini D. 2003. Indagini micologiche nella Riserva Naturale di Macchiagrande:

aspetti micofloristici ed ecologici. Micol. e Veget. Medit. 18(1): 21-42.

Pecoraro L, Perrone L, Lunghini D. 2003. Alcuni funghi fimicoli 0 graminicoli del litorale laziale.

Boll. AMER 59-60(2): 55-65.

MY COTAXON

http://dx.doi.org/10.5248/122.265

Volume 122, pp. 265-270 October-December 2012

A new species of Scopinella from pampas grass in Argentina

ROMINA M. SANCHEZ, LUCRECIA GIORDANO,

FREDA E. ANDERSON & M. VIRGINIA BIANCHINOTTI*

Centro de Recursos Naturales Renovables de la Zona Semiarida,

Universidad Nacional del Sur Camino,

La Carrindanga Km 7, B8000FWB, Bahia Blanca, Argentina

* CORRESPONDENCE TO: vbianchi@uns.edu.ar

ABSTRACT — A previously undescribed species of the genus Scopinella was found during

a survey of the fungi associated with Cortaderia selloana (Poaceae) in Argentina. The

ascospores are strongly asymmetrical and have the shape of a truncated pyramid with a

convex quadrangular base. This peculiar ascospore shape sets this species, described here as

new, apart from the others of the genus. This is the second record of Scopinella from South

America.

KEY woRDS — ascomycete, grasses, saprophytic fungi

Introduction

Cortaderia selloana (pampas grass) is a perennial tussock-forming grass

species native to Argentina, Brazil, Chile, Paraguay, and Uruguay (Astegiano

et al. 1995). Its huge tussocks are very conspicuous and become attractive

when they flower to produce showy feathery inflorescences. Pampas has been

introduced in many regions of the world as a garden plant, dryland forage, soil

amendment, and windbreaks. In some of these regions, it has become invasive

(Pausas et al. 2006). The grass has become a particularly serious weed in New

Zealand, where the feasibility of subjecting it to biological control is being

explored (Bellgard et al. 2010).

Most records of fungal species associated with C. selloana are the result of

studies performed in the countries where it has been introduced (Bellgard et al.

2010, Farr & Rossman 2012, McKenzie et al. 2007, Medd et al. 2003). Studies

are now being conducted in Argentina to learn about the associated mycobiota

present in its native distribution area.

During a survey of the fungi associated with C. selloana leaves in Buenos

Aires province, a new species of Scopinella Lév. was discovered.

266 ... Sanchez & al.

The genus Scopinella is characterized by ascomata with long necks and

globose bodies, evanescent asci, and cuboid-ellipsoidal ascospores with two

prominent longitudinal germ slits (Cannon & Hawksworth 1982, Stchigel et al.

2006). Scopinella is a small genus comprising seven species that grow on either

fungi or plant substrates. It belongs to Hypocreales, where at present it cannot

be assigned to any family (Lumbsch & Huhndorf 2010).

The shape of the ascospores of the specimen found on C. selloana distinguishes

it from the other Scopinella species, so we describe it here as new.

Materials & methods

Partially senescent leaves of Cortaderia selloana were carefully inspected under a

Wild M5A stereomicroscope. Sections bearing fruiting bodies were hand-made with a

razor blade and mounted in either distilled water alone or with the addition of phloxine.

Measurements were made in water. A Leica DM2000 dissecting microscope with a Leica

EC3 camera was used to capture micromorphological images. For scanning electron

microscopy intact ascomata were dehydrated in a 10-95% graded acetone series for

fifteen minutes in each step, followed by three changes in absolute acetone. After critical

point drying, the specimens were mounted on aluminum stubs, sputter coated with

gold-palladium, and viewed with a LEO EVO 40 Scanning Electron Microscope (SEM).

Recently collected leaves with the fungus were pressed and preserved in “Bahia Blanca

Biologia” Herbarium (BBB). The herbarium acronym follows Thiers (2012).

Scopinella pyramidospora R.M. Sanchez, L. Giord., F. Anderson & Bianchin.,

sp. nov. PLATE 1

MycoBank MB800633

Diacnosis: Differs from all other Scopinella species by its strongly asymmetrical,

pyramidal ascospores.

Type: Argentina, Buenos Aires Province, Provincial Route No. 205, Km 308, (36°06'43"S

60°58'22"W): on senescent leaves of Cortaderia selloana (Schult. & Schult. f.) Asch. &

Graebn. (Poaceae), 4.VII.2011, coll. FE Anderson (HOLOTYPE, BBB [MVB 1501]).

EtyMo.oey: from the Greek Trvpapidoc = pyramidal and OTLOpOsG: spore.

AscoMarta solitary to gregarious, superficial, settled on a dense mass of brown

hyphae, globose to subglobose, with long necks, brown to black when dry, brown

to paler brown at base when mounted in water, 106-150 um high, 106-225 um

wide, peridial cells forming textura intricata. NEcKs cylindrical, 206-313 um

long, 31-75 um wide at base, ostiolum 19-38 um wide, cells of neck disposed in

textura porrecta. PARAPHYSES moniliform, ramified, septate, hyaline, 4-7 um

wide. AScI 8-spored, unitunicate, clavate to globose, short-stipitate, evanescent,

13-28 x 10-16 um. Ascosporss 1-celled, strongly asymmetrical, resembling

a truncated pyramid with quadrangular, somewhat convex, base, rounded

vertices, smooth-walled at optical level, verruculose under SEM (>7,000x)

with a dark brown median band, paler at ends, germ slits occasionally present,

7.5-9.5 x 5.5-8.5 um (x = 8.4 x 6.7, n = 60). ANAMORPH not known.

Scopinella pyramidospora sp. nov. (Argentina) ... 267

” nig F ,” = }

: a XS 4 8

Pate 1: Scopinella pyramidospora: 1. Ascomata on the substrate (arrows). 2. Close-up of an ascoma.

3. Apex of the ascomata neck (SEM, 4500x). 4. Eight-spored ascus. 5. Asymmetrical ascospores in

various views. 6-7. Ascospore germ slits (arrows). 8. Ascospores (SEM, 7000x). 9. Lateral view of a

pyramidal ascospore (SEM, 10000x). 10. Detail of ascospore wall (SEM, 20000x). Bars: 1 = 200 um;

2 = 50 um; 3 = 10 um; 4, 6-7 = 5 um; 5 = 7 um; 8 = 4 um; 9 = 3 um; 10 = 2 um.

DISTRIBUTION— Argentina, known only from the type collection.

CoMMENTS— Scopinella pyramidospora differs from all other species of the

genus in having strongly asymmetrical, pyramidal ascospores. Ascospore

268 ... Sanchez & al.

asymmetry is best visualized by moving the microslide in three dimensions

when mounted in water. Germ slits were seen only once under optical

microscopy. This suggests that they are not as conspicuous and/or common

as in the other species of the genus. Although the spore size falls in the range

of S. caulincola (Fuckel) Malloch, ascospores of the latter are strongly flattened

bilaterally and almost rectangular in surface view (as shown in von Arx &

Miiller 1954). The ascomata of S. caulincola have much longer necks, up to

2 mm long, with subhyaline short bristles at the apex (fide von Arx & Miller

1954). Ascomatal necks of S. pyramidospora are glabrous.

Discussion

Scopinella was erected by Léveillé (1847) to accommodate the single species

S. barbata (Pers.) Lév. Saccardo (1891) added a second species, S. pleiospora (J.

Schrét.) Sacc., originally described as Melanospora pleiospora. The genus was

then ignored for almost a century until Hawksworth (1975) reestablished it by

recognizing the synonymy between S. barbata and Chaetoceratostoma hispidum

Turconi & Maffei. Hawksworth (1975) considered Scopinella to be monospecific

and did not include Saccardos S. pleiospora. Malloch (1976a,b) added three

species to the genus (S. caulincola, S. solani, S. sphaerophila) and provided a key

to differentiate these additions and the original S. barbata. Two more species

were added, S. gallicola by Tsuneda & Hiratsuka (1981) and S. musciformis by

Stchigel et al. (2006). No reference was made to Scopinella pleiospora in any of

these studies. We failed to access type or authenticated material and presume

the type material of S. pleiospora has been lost.

Scopinella species fall into two ecological groups. One comprises species

growing on other fungi (S. gallicola and S. sphaerophila), and the other

saprobic species, usually growing on plant substrates (S. barbata, S. caulincola,

S. musciformis, S. pyramidospora, and S. solani). Scopinella pleiospora was

described growing on rabbit dung. Scopinella pyramidospora and S. solani are

the only two species of the genus known to occur on grasses. Scopinella solani

was found growing on dead leaves of Poa nevadensis in North America (Malloch

1976a) and on overwintered inflorescences of Brachypodium pinnatum, Dactylis

glomerata, and Elytrigia repens in Slovakia (Pastircak & Pastir¢akova 2007).

Scopinella solani differs from S. pyramidospora in having longer ascomatal

necks (300-500 um), narrower asci (7-11.5 um), and symmetrical and smaller

ascospores (4.5-6.5 x 3.8-5.8 Lm).

Scopinella species are difficult to cultivate, and the species from Cortaderia

selloana was no exception. All attempts to isolate it on artificial media failed.

Because of this, and the fact that the available material is at present very scarce,

it was decided against performing any molecular work. To our knowledge the

only species that have been cultivated are S. gallicola (Tsuneda & Hiratsuka

Scopinella pyramidospora sp. nov. (Argentina) ... 269

1981) and S. solani (Zhang & Blackwell 2002). Tsuneda & Hiratsuka (1982)

found that for S. gallicola both growth and fructification were stimulated in

dual culture with other fungi.

Phylogenetic studies have been performed on S. solani, the only species that

has been sequenced. Zhang & Blackwell (2002) set S. solani in a distinct clade

in Hypocreales apart from Melanospora in contrast with what was previously

accepted (Hawksworth 1975).

Scopinella was reported in Argentina and South America for the first time

with the finding of S. solani on bark of Geoffroea decorticans (Bianchinotti

1998). This is the second record of the genus from this region.

Acknowledgments

This work was funded by “National Biocontrol Collective’ and “Future Forests

Research,’ New Zealand. Lucrecia Giordano is a fellow at CIC. MVB is a researcher at

CONICET. Amy Rossman and Alberto Stchigel are thanked for acting as pre-submission

reviewers and for their helpful comments.

Literature cited

Arx JA von, Miller E. 1954. Die Gattungen der amerosporen Pyrenomyceten. Beitr. Krypttfl.

Schweiz 11 (1): 1-434.

Astegiano ME, Anton AM, Connor HE. 1995. Sinopsis del género Cortaderia (Poaceae) en

Argentina. Darwiniana 33: 43-51.

Bellgard SE, Winks CJ, Than DJ, Aliaga CC. 2010. Natural enemies of the South American pampas

grasses Cortaderia spp. in New Zealand. 215-218, in SM Zydenbos (ed.), Proceedings of the

17th Australasian Weeds Conference. New Zealand Plant Protection Society.

Bianchinotti MV. 1998. Contribucién al conocimiento de la micobiota argentina. Micromicetes

sobre Geoffroea decorticans (Leguminosae). III. Bol. Soc. Argent. Bot. 33: 149-155.

Cannon PF, Hawksworth DL. 1982. A re-evaluation of Melanospora Corda and similar

pyrenomycetes, with a revision of the British species. Bot. J. Linn. Soc. 84: 115-160.

http://dx.doi.org/10.1111/j.1095-8339.1982.tb00363.x

Farr DF, Rossman AY. 2012. Fungal databases. Systematic Mycology and Microbiology Laboratory,

ARS, USDA. http://nt.ars-grin.gov./fungaldatabases/ [accessed: 16 April 2012].

Hawksworth DL. 1975. Chaetoceratostoma Turc. & Maffei, a genus to be rejected. Trans. Brit.

Mycol. Soc. 64: 447-453. http://dx.doi.org/10.1016/S0007-1536(75)80143-4

Léveillé DM. 1847. Mycologie, Mycétologie. 454-496, in: C Orbigny. Dictionnaire Universel

Histoire Naturelle 8.

Lumbsch HT, Huhndorf SM. 2010. Part one. Outline of Ascomycota—2009. Myconet 14: 1-42.

Malloch D. 1976a. Scopinella solani. Fungi Canadenses 82.

Malloch D. 1976b. Scopinella sphaerophila. Fungi Canadenses 83.

McKenzie EHC, Thongkantha S, Lumyong S. 2007. Zygosporium bioblitzi sp. nov. on dead leaves of

Cortaderia and Dracaena. N.Z. J. Bot. 45: 433-435.

http://dx.doi.org/10.1080/00288250709509724

Medd RW, Murray GM, Pickering DI. 2003. Review of the epidemiology and economic importance

of Pyrenophora semeniperda. Australas. Plant Pathol. 32: 539-550.

http://dx.doi.org/10.1071/AP03059

270 ... Sanchez & al.

Pastircak M, Pastircakova K. 2007. Scopinella solani on graminicolous hosts in Slovakia and the

Czech Republic. Mycotaxon 102: 383-387.

Pausas JG, Lloret F, Vila M. 2006. Simulating the effects of different disturbance regimes on

Cortaderia selloana invasion. Biol. Conservation 128: 128-135.

http://dx.doi.org/10.1016/j.biocon.2005.09.022

Saccardo PA. 1891. Supplementum universale, pars I. Sylloge Fungorum 9. 1141 p.

Stchigel AM, Umania L, Guarro J, Mata M. 2006. Two new ascomycetes from rainforest litter in

Costa Rica. Mycologia 98: 815-820. http://dx.doi.org/10.3852/mycologia.98.5.815

Thiers B. 2012 [continuously updated]. Index Herbariorum: a global directory of public herbaria

and associated staff. New York Botanical Garden's Virtual Herbarium. http://sweetgum.nybg.

org/ih/ [accessed: February 2012].

Tsuneda A, Hiratsuka Y. 1981. Scopinella gallicola, a new species from rust galls of Endocronartium

harknessii on Pinus contorta. Canad. J. Bot. 59: 1192-1195. http://dx.doi.org/10.1139/b81-163

Tsuneda A, Hiratsuka Y. 1982. Commensal relationship between Scopinella gallicola and

Cladosporium sp. Rept. Tottori Mycol. Inst. (Japan) 20: 63-69.

Zhang N, Blackwell M. 2002. Molecular phylogeny of Melanospora and similar pyrenomycetous

fungi. Mycol. Res. 106: 148-155.

MY COTAXON

http://dx.doi.org/10.5248/122.271

Volume 122, pp. 271-282 October-December 2012

Development and morphology of Lysurus cruciatus —

an addition to the Indian mycobiota

S. ABRAR, S. SWAPNA & M. KRISHNAPPA*

Department of Post Graduate Studies and Research in Applied Botany, Kuvempu University,

Shankaraghatta-577451, Karnataka, India

* CORRESPONDENCE TO: krishnappam1007@gmail.com

ABSTRACT — Lysurus cruciatus (Phallomycetidae, Phallaceae) produces a basidiome with a

long receptacle terminating in conical arms that branch initially and interconnect at their tips

to support gleba on lateral surfaces. Its development from primordia to mature basidiome

has been microscopically examined. Fructification begins as a small protuberance that

differentiates into a series of layers and with gelatinization develops into an egg. The matured

fruitbody stands up with an expanded receptacle. Lysurus cruciatus is a new record for the

India mycobiota.

Key worps — hymenium, intermediate tissue, medulla, ontogeny, peridial tissues

Introduction

Although morphology and taxonomy of phalloids have been frequently

studied throughout the last century, their developmental characters have

rarely been examined (e.g., Burt 1896, Fischer 1910a, Atkinson 1911, Petch

1911, Cleland & Cheel 1917, White 1944, Flegler & Hooper 1980, Saenz et al.

1983, Zang & Peterson 1989, Abrar et al. 2007). In India, studies on Phallaceae

associated with basidioma development are very scanty as previous reports

were mainly focused on documentation (Narasimhan 1932, Ahmed 1939, Apte

2005), and there are no reports of Lysurus from India (Jamaluddin et al. 2004).

The tropical genus Lysurus is saprobic (Schaffer 1975, Lodge & Cantrell

1995) and morphologically characterized by short columnar arms (Teng 1996)

attached to the apical margin of a cylindrical receptacle (Fischer 1886) that

emerges from a ruptured peridium (Zang & Peterson 1989). The gleba, which

is located on the lateral surfaces of receptacle arms (Miller et al. 1991, Beltran-

Tejera et al. 1998, Cortez et al. 2011), emits a fetid odor (Burk et al. 1982).

Lysurus cruciatus is commonly known as lizard’s claw stinkhorn in U.S.A.

(Arora 1986).

272 ... Abrar, Swapna & Krishnappa

KARNATAKA

75°O'O"E 75°30'O"E

SHIMOGA DISTRICT t

co)

ise)

14°0'O"N

13°30'0"N

@ HANIYA (Sampling site)

75°O'O"E 75°30'0"E |

Fic. 1. Lysurus cruciatus sampling location in Haniya, Shimoga district, India.

Lysurus cruciatus in India ... 273

In this report of a new record of L. cruciatus from the Indian subcontinent,

we focus on the developmental stages of the fruitbody.

Materials & methods

Primordia and sequentially matured basidioma of L. cruciatus were collected from

a site in the Western Ghats, Karnataka (Fic. 1). Macroscopic characters were described

from observations of fresh material; color notations are from Kornerup & Wanscher

(1981). The primordia from different stages were fixed in Pfeiffer’s solution containing

absolute methanol and 40% formalin (w/v) in equal proportions. All measurements

were made in 3% KOH. Free hand sections of primordial stained with 1% lactophenol

cotton blue and 1% phloxine were mounted on glass slides and examined under the

stereo and optical microscopes. Cited collections are deposited in the Applied Botany

Herbarium, Kuvempu University, Shankaraghatta, Shimoga District, Karnataka, India

(KUABSAK).

Taxonomic description

Lysurus cruciatus (Lepr. & Mont.) Henn., Beibl. Hedwigia 41: 172, 1902 Fics. 2, 34

MycoBANnk 100531

IMMATURE FRuiT BoptEs (‘eggs’) 45-60 mm in diam., spherical to obovoid,

white (1A1) always arising from white (1Al) mycelium cord buried under

the soil. RECEPTACLE consisting of a stipe and apical branches or arms. STIPE

85-100 x 20-25 mm, cylindrical, narrowly obconical, hollow, 3-4 mm thick,

longitudinally grooved and transversely ribbed, white (1A1), composed

of a pseudoparenchyma with cells of 19.2-30.5 x 17-31.6 um, globose to

subglobose. RECEPTACLE ARMS 25-40 x 6-8 mm (lengths variable within the

same sporome), 4-6 (usually 5), conical, constricted at the top, hollow, a deep

marked groove running along the whole abaxial surface of arms, transversely

wrinkled in outer surface, initially fused at their tips, then free tending to curve

slightly away from the axis of the receptacle, outer concave surface smooth,

white, inner convex surface transversely rugulose, with pseudoparenchyma

cells of 16.5-25.6 um diam., globose to subglobose. GLEBA in the inner convex

surface of the arms, brown to grayish brown (6E2-6E3), gradually deliquescing,

unpleasant stinkhorn odor. Votva 35-40 x 20-25 mm, saccate, thick, white

(1A1), with aerolations, composed of scattered hyphae 2.4-3.6 um wide, stipe

and volva separated by a clear jelly. MycELIAL corps proliferating from the

base, several white. BasipiosporEs 4-4.5 x 1.5-2 um, elliptic to oblong, thin-

walled, smooth, hyaline.

ECOLOGY & DISTRIBUTION: Gregarious growing in areca nut plantations in

the tropical zone. Fruiting from July to October with a peak in August. Also

known from America, Asia, Australia, Africa. Introduced in Europe.

SPECIMENS EXAMINED — INDIA, KARNATAKA, Western Ghats, Shimoga district, Haniya,

4 km from Hosanagar taluk, 13°52'58"N 75°03'27’E, alt. 742 m, S. Abrar, S. Swapna, &

274 ... Abrar, Swapna & Krishnappa

M. Krishnappa, 28.VII.2007 (KUABSAK-MSH10); 21.VII.2008 (KUABSAK-MSH30);

08.X.2009 (KUABSAK-MSH102).

Developmental stages FIGS. 3B-F, 4

EGG PHASE: Initially small (0.5 mm diam.) white (1A1) swellings form at

the end of mycelial strands. The 1-2 mm diam. primordia or young sporoma

(YS) differentiate into a central medulla (M) and peripheral cortex (C). As

differentiation continues, primary volva-gel (VG) forms from the medulla while

the cortical cells fold inward (IF) four to six times. These infoldings differentiate

and enlarge into lobes (L). The enlarging lobes gradually compress cortical cells

to form a layer of intermediate tissue (IT) 2-4 mm in diam. The infoldings or

clefts (CF) increase at the junction of intermediate tissue and medulla with the

differentiation of peridial plates (PP) (4-5 mm in diam.). The external medullary

region differentiates into palisade tissue (PT), comprising the primordium of

the gleba (G) and develops sequentially to form enlarged clefts (ECF) (5-6 mm

diam). Intermediate tissue continuously thickens along the clefts to initiate

formation of receptacle arms (IRA) while the medullary tissue thickens to form

the initials of the receptacle (IR) (6-8 mm diam.). The gleba enlarges (EG)

(8-10 mm diam.) with the complete transformation of palisade tissue. The

gleba primordium further differentiates hyphae that form the evenly arranged

probasidial tips and later matures to form hymenium and trama layers. The

continuous glebal development along distorted peridial plates breaks the volva-

gel, which corresponds to receptacle arms (RA) (10-20 mm in diam.). The gleba

gelatinization (GG) and the development of pseudoparenchymatous tissue of

receptacle (R) (20-40 mm diam.) increases the size of the egg. The gleba is then

reduced (RG) as grooves (GR) form outside each receptacle arm (40-45 mm

diam.). Maturation proceeds with further differentiation of pseudoparenchyma

in the receptacle wall and receptacle arms and with the continuous production

of basidiospores from the pseudohymenial layer.

During development, the primordial cortex gives rise to the outer skin

(peridium), peridial plates, and receptacle, while the volva-gel and gleba derive

from the medulla. Before rupture, the mature egg differentiates into outer skin

and inner volva-gel that encloses the gleba, receptacle, and receptacle arms.

Complete development and differentiation of the various egg parts up through

basidiospore formation occurs in 6-13 days.

After final internal development (basidiospore production), eggs become

epigeous from an initial hypogeous state. Before rupture, the pre-differentiated

Fic. 2. Lysurus cruciatus (KUABSAK-MSH 30). A, Mature receptacle. B, Receptacle with transverse

and longitudinal grooves. C, Pseudoparenchymatous tissue of receptacle. D, A groove underneath

arm. E, Arms united at their tips. EF Pseudoparenchymatous tissue of an arm. G, An arm with

external longitudinal furrow. Scale bars: a, E= 1cm; B, D = 5mm; C = 30m; F = 20 um; G = 3mm.

Lysurus cruciatus in India ... 275

276 ... Abrar, Swapna & Krishnappa

sporome within the egg is surrounded by a pale grayish gelatinous mucilage.

A crack occurs, tearing at the apical portion (corresponding to the tip of the

arms) of the egg.

RECEPTACLE PHASE: ‘The receptacle elongates through the crack due to

osmosis and cell elongation. The receptacle expands freely in 2-4 seconds with

the autolysis of the gleba upon the receptacle arms (closely compressed together

in the egg stage). The peridium is retained as a volva with mycelial strands at

the base. The arms are set free with the moistening of the gleba, after which the

gleba deliquesces and becomes fetid (Fulton 1889). Insects especially associated

with carrion are attracted towards the sticky gleba. The mature phalloid

basidiome, which lasts for 20-34 hrs, then autodigests and disintegrates. Under

favorable environmental conditions, the dispersed basidiospores germinate to

form mycelium. Development proceeds with the formation of eggs and the life

cycle continues.

Discussion

Although Corda (1842) placed the genus Lysurus in a new family, Lysuraceae

(as “Lysuroideae”), which he separated from Clathraceae, many 20" century

mycologists treated Lysuraceae under Clathraceae (Cunningham 1944, Dring

1980, Zeller 1949). Fungal classification resulting from the Assembling the

Fungal Tree of Life (AFTOL) project revealed Phallaceae and Clathraceae as

separate families with Lysuraceae more closely related to Phallaceae than to

Clathraceae (Hosaka et al. 2006). Lysuraceae fruitbodies resemble Clathraceae

in having sutures dividing the gelatinous layer but differ in the long receptacles

that are stipitate, longer than the arms arising from the receptacles, and with a

gleba always tending to migrate to the exterior part of the arms (cf. the gleba

in Clathraceae being attached only to the interior face of the arms). Currently,

Lysurus is placed under Phallaceae, order Phallales, subclass Phallomycetidae.

The phylogenetic position of Phallales indicates that that stinkhorns are derived

from truffle-like fruitbodies (Hosaka et al. 2006, Hibbett et al. 2007).

In Aseroe arachnoidea E. Fisch., the peridial plates are produced radially

from gleba (Fischer 1910b) whereas in Protubera sp., Phallus impudicus L.,

and Ithyphallus tenuis E. Fisch., the plates develop from the columella (Fischer

1887, Gadumann & Dodge 1928). In Mutinus bambusinus (Zoll.) E. Fisch., the

plates develop from the apical part of the undeveloped cap (Fischer 1886) and

in Clathrus delicatus Berk. & Broome the junction of the cortical tissue and

clefts give rise to the peridial suture (Swapna et al. 2010). In Lysurus cruciatus,

it develops from the junction of the intermediate tissue and medulla.

Fic. 3. Lysurus cruciatus. A, Basidiospores. B, Epigeous egg. C, D, Crack occurring at the apical

portion of the egg. E, Expanded receptacle from egg. F, Insects feeding on gleba. Scale bars: a = 5m;

B, C= 1cm; D-F = 2 cm.

27h.

Lysurus cruciatus in India...

278 ... Abrar, Swapna & Krishnappa

In A. arachnoidea, jelly begins to form as the stalk primordium develops

(Fischer 1910b), while in Protubera sp., Mutinus caninus (Huds.) Fr., and

I. tenuis jelly formation begins during formation of the young fruiting body

(Gaumann & Dodge 1928; Fischer 1886). In L. cruciatus and C. delicatus, the

jelly is formed by the differentiation of medulla (Swapna et al. 2010).

In Simblum sphaerocephalum Schltdl. thick strands of tissue form the central

branches that run radially outwards from the center and fuse into volva-

jelly at the middle of one of the receptacle meshes (Conard 1913). In Aseroe

arachnoidea the branches are borne from the central strand (Fischer 1910b)

but in Protubera sp., are initiated from the columella. In M. caninus, the cap

forms from a central intertwined portion whereas in Phallus impudicus, the cap

develops from intermediate tissue (Gdumann & Dodge 1928). In I. tenuis the

stalk develops before forming a cap at its apex (Fischer 1886). In C. delicatus,

the branches arise from the hyphal knots (Swapna et al. 2010) whereas in

L. cruciatus the intermediate tissue constantly thickens to form receptacle

arms.

The glebal chambers of Aseroe rubra Labill. develop by formation of

pseudoparenchyma cells, after which trama plates are fused together and the

spore mass develops horizontally around the mouth of the attached stalk

(Fischer 1910b). In M. caninus the gleba develops during formation of the

primordial plates followed by the trama and hymenium (Gaumann & Dodge

1928). In I. tenuis the apex of the head wrinkles to form trama wherein it

extends as a dense palisade layer and bulges to form the hymenium. Later the

trama assumes a gelatinous texture and sporulation initiates (Fischer 1886). In

C. delicatus the palisade tissue transforms into gelatinized columella and the

trama adheres tightly in developing receptacle, before the basidiospores form

(Swapna et al. 2010). In L. cruciatus the external medullary region differentiates

into palisade tissue constituting the glebal primordium. The gleba enlarges with

differentiation of the probasidial tips and matures to form pseudohymenium,

trama, and basidiospores.

According to Mycobank, six Lysurus species are currently accepted.

Lysurus cruciatus and L. gardneri Berk. both produce white to pale cream

columnar receptacle, which distinguish them from Lysurus mokusin (L.) Fr.,

characterized by well marked white to reddish angular fluted receptacle. In

L. mokusin, the receptacle arms lie directly on the glebal columella in contrast to

the arms separated with deep grooves in L. cruciatus. Lysurus periphragmoides

(Klotzsch) Dring is unique having subglobose to ovoid clathrate network of

arms with mostly pentagonal to hexagonal meshes that are at first yellow and

then orange red (Dring 1980). Lysurus pakistanicus S.H. Iqbal et al. resembles

L. periphragmoides in its white to yellowish hollow, narrowly obconical receptacle

but differs from the latter by an irregularly oblong or globose apex formed by

Lysurus cruciatus in India ... 279

ROSA ortaans ;

wea oo

BSA RAT, date

Pea TSTe

Sey

War

Fics. 4. Sporoma development of Lysurus cruciatus (KUABSAK-MCH 30). A, Primordium. B, Different-

ation of medulla and cortex. C, Differentiation of volva-gel. D, Cortical cells forming infoldings.

E, Formation of lobes. F Formation of intermediate tissue and peridial plates. G, Formation of

palisade tissue. H, Initiation of receptacle and receptacle arms. I, Development and gelatinization

of gleba. J, Formation of grooves and reduction of gleba. ABBREVIATIONS: C = Cortex, CF = Cleft,

ECF = Enlarged cleft, EG = Enlarged gleba, G = Gleba, GG = Gelatinization of gleba, GR = Groove,

IF = Infolding, IR = Initiation of receptacle, IRA = Initial of receptacle arm, IT = Intermediate tissue,

L = Lobe, M = Medulla, PP = Peridial plate, PT = Palisade tissue, R = Receptacle, RA = Receptacle

arm, RG = Reduction of glebal mass, VG = Volva-gel, YS = Young sporoma.

280 ... Abrar, Swapna & Krishnappa

a clathrate network of anastomosing arms, irregular to cylindrical with up to

10 meshes that is rosy to orange pink at maturity; in L. pakistanicus the gleba

fills the entire interior of the arms and extends outwards in the meshes (Iqbal et

al. 2006). Lysurus corallocephalus Welw. & Curr. is entirely different, with erect

appendages that are usually dark or flushed pink above and white to buff or

yellowish below and which have simple or forked with slender intersections.

Lysurus cruciatus differs from the other known Lysurus species by the

uniquely transversely rugulose glebiferous surface. The glebiferous region is

villose and lamellate in L. gardneri, slightly keeled on both outer and inner

surfaces in L. pakistanicus and L. periphragmoides, and corrugated on the sides

and flat on the inner surface L. periphragmoides is (Dring 1980, Iqbal et al. 2006).

The gleba is on the lateral surface of the arms in L. mokusin and distributed on

the exterior of polygonal meshes in L. corallocephalus (Dring 1980).

In L. gardneri the stalk divides at the apex and does not bear any glebiferous

layer for 2-4 mm from the base of the arm. Each arm is well marked and

borne on its own stalk with a narrow zone, with the sterile base appearing as

a furrow down the outer face (Petch 1911). The diameter of the arms at 3 mm

above the stalk region increases to 6 mm in the glebiferous region. The gleba of

L. cruciatus runs along the groove in the intersection without any sterile base.

The diameter of the arms is almost the same through its length. The glebal

content is comparatively less in L. cruciatus compared to L. gardneri, which

is more concentrated in the center of the arms with a bulging appearance and

reduced towards the tips.

Acknowledgment

We are grateful to the University Grant Commission (UGC), New Delhi for funding

the project. We also thank Mr. K.N. Shankar Narayan Bhat and Mr. K.S. Vinayaka, from

Haniya in Hosanagar Taluk (Karnataka) for their help during the field studies. We thank

Drs. Vagner G. Cortez (Universidade Federal do Parana, Brazil) and Laura Guzman-

Davalos (Departamento de Botanica y Zoologia, Universidad de Guadalajara, México)

for critical review of the manuscript.

Literature cited

Abrar S, Swapna S, Krishnappa M. 2007. Dictyophora cinnabarina. Current Science 92:

1219-1220.

Ahmed S. 1939. Higher fungi of Punjab plains. Journal of Indian Botanical Society 11: 248-254.

Apte D. 2005. First record of Clathrus delicatus Berkeley & Broome (1873) from Sanjay Gandhi

National Park. Journal of Bombay Natural History Society 102: 135-136.

Arora D. 1986. Mushrooms demystified: a comprehensive guide to fleshy fungi. Ten Speed Press,

California. 959 p.

Atkinson GE. 1911. The origin and taxonomic value of the veil in Dictyophora and Ithyphallus.

Botanical Gazette 50: 1-20 + 7 pl.

Beltran-Tejera E, Bafares-Baudet A, Rodriguez-Armas JI. 1998. Gasteromycetes of the Canary

Islands: some noteworthy new records. Mycotaxon 68: 439-453.

Lysurus cruciatus in India ... 281

Burk WR, Flegler SL, Hiss WM. 1982. Ultrastructure studies of Clathraceae and Phallaceae

(Gasteromycetes) spores. Mycologia 74: 166-168. http://dx.doi.org/10.2307/3792646

Burt EA. 1896. The development of Mutinus caninus (Huds.) Fr. Annals of Botany 10(39):

343-372.

Cleland JB, Cheel E. 1917. Notes on the early stage of the development of Lysurus gardneri (Lysurus

australiensis). Journal of Royal Society New South Whales 51: 364-365.

Conard HS. 1913. Structure of Simblum sphaerocephalum. Mycologia 5: 264-273.

http://dx.doi.org/10.2307/3753269

Corda ACJ. 1842. Icones fungorum hucusque cognitorum.Vol. 5. 92 p

Cortez VG, Baseia IG, Silveira RMB. 2011. Gasteroid mycobiota of Rio Grande do Sul State,

Brazil: Lysuraceae (Basidiomycota). Acta Scientiarum. Biological Sciences 33: 87-92.

http://dx.doi.org/10.4025/actascibiolsci.v33il.6726.

Cunningham GH. 1944. The Gasteromycetes of Australia and New Zealand. Dunedin, New Zealand.

236 pp + 36 pl.

Dring DM. 1980. Contributions towards a rational arrangement of the Clathraceae. Kew Bulletin

35: 1-96. http://dx.doi.org/10.2307/4117008

Fischer E. 1886. Versuch einer systematischen Ubersicht tiber die bisher bekannten Phalloideen.

Jahrbuch des K6niglichen Botanischen Gartens und des Botanischen Museums zu Berlin 4:

197.

Fischer E. 1910a. Beitrage zur Morphologie und Systematic der Phalloideen. Annales Mycologici

8: 314-322.

Fischer E. 1910b. Die fruchtkérper-entwicklung von Aseroé. 595-614, in: Treube MM (eds),

Annales du Jardin botanique de Buitenzorg, supp. 3(2) & 4. EJ Brill, Leide.

Flegler SL, Hooper GR. 1980. Ultrastructure and development of Mutinus caninus and the occurrence

of eight spored basidium. Mycologia 72: 1001-1014. http://dx.doi.org/10.2307/3759739

Fulton TW. 1889. The dispersion of the spores of fungi by the agency of insects with special

reference to the phalloidei. Annals of Botany 3: 207-239.

Gaumann EA, Dodge CW. 1928. The comparative morphology of fungi. Mc Graw Hill, New York.

701 pp.

Hibbett DS, Binder M, Bischoff JE, Blackwell M, Cannon PF, Eriksson OE, Huhndorf S, James T,

Kirk PM, Licking R, Lumbsch HT, Lutzoni FE, Matheny PB, Mclaughlin DJ, Powell MJ, Redhead

S, Schoch CL, Spatafora JW, Stalpers JA, Vilgalys R, Aime MC, Aptroot A, Bauer R, Begerow

D, Benny GL, Castlebury LA, Crous PW, Dai YC, Gams W, Geiser DM, Griffith GW, Gueidan

C, Hawksworth DL, Hestmark G, Hosaka K, Humber RA, Hyde KD, Ironside JE, Koljalg U,

Kurtzman CP, Larsson KH, Lichtwardt R, Longcore J, Miadlikowska J, Miller A, Moncalvo

JM, Mozley-Standridge S$, Oberwinkler FE, Parmasto E, Reeb V, Rogers JD, Roux C, Ryvarden

L, Sampaio JP, Schiissler A, Sugiyama J, Thorn RG, Tibell L, Untereiner WA, Walker C, Wang

Z, Weir A, Weiss M, White MM, Winka K, Yao YJ, Zhang N. 2007. A higher-level phylogenetic

classification of the Fungi. Mycological Research 111: 509-547.

http://dx.doi.org/10.1016/j.mycres.2007.03.004

Hosaka K, Bates ST, Beever RE, Castellano MA, Colgan III W, Dominguez LS, Nouhra ER, Gem J,

Giachini AJ, Kenney SR, Simpson NB, Spatafora JW, Trappe JM. 2006. Molecular phylogenetics

of the gomphoid-phalloid fungi with an establishment of the new subclass Phallomycetidae and

two new orders. Mycologia 98: 949-959. http://dx.doi.org/10.3852/mycologia.98.6.949

Iqbal SH, Kasuya T, Khalid N, Niazi AR. 2006. Lysurus pakistanicus, a new species of Phallales from

Pakistan. Mycotaxon 98: 163-168.

Jamaluddin, Goswami MG, Ojha BM. 2004. Fungi of India (1989-2001). Scientific publishers,

Jodhpur. 326 pp.

282 ... Abrar, Swapna & Krishnappa

Kornerup A, Wanscher JH. 1981. Methuen handbook of colour, 3rd ed. Eyre Methuen, London.

252:pp.-

Lodge DJ, Cantrell S. 1995. Fungal communities in wet tropical forests: variation in time and space.

Canadian Journal of Botany 73: 1391-1398. http://dx.doi.org/10.1139/b95-402

Miller OK, Ovrebo CL, Burk WR. 1991. Neolysurus: a new genus in the Clathraceae. Mycological

Research 95: 1230-1234. http://dx.doi.org/10.1016/S0953-7562(09)80016-6

Narasimhan MJ. 1932. The Phalloideae of Mysore. Journal of Indian Botanical Society 11:

248-254.

Petch T. 1911. Further notes on Colus gardneri (Berk.) Fischer. Transactions of the British

Mycological Society 6: 121-132. http://dx.doi.org/10.1016/S0007-1536(17)80020-6

Saenz JA, Carranza J, Gomez VS. 1983. Estudio comparativo al microscopio de luz y al microscopio

electrénico de barrido de Laternea triscapa, Laternea pusilla y Ligiella rodrigueziana. Revista de

Biologia Tropical 31: 327-331.

Schaffer RL. 1975. The major groups of Basidiomycetes. Mycologia 67:1-18.

http://dx.doi.org/10.2307/3758222

Swapna S, Abrar S, Manoharachary C, Krishnappa M. 2010. Development and morphology

of Clathrus delicatus (Phallomycetidae, Phallaceae) from India, Mycotaxon 114: 319-328.

http://dx.doi.org/10.5248/114.319

Teng SC. 1996. Fungi of China. Mycotaxon, New York. 586 p.

White NH. 1944. The development of Lysurus sulcatus (Cooke & Massee). Transaction of the British

Mycological Society 27: 29-35. http://dx.doi.org/10.1016/S0007-1536(44)80005-5

Zang M, Peterson RH. 1989. Endophallus, a new genus in the Phallaceae from China. Mycologia 81:

486-489. http://dx.doi.org/10.2307/3760091

Zeller SM. 1949. Keys to the orders, families and genera of the Gasteromycetes. Mycologia 41:

36-58. http://dx.doi.org/10.2307/3755271

MY COTAXON

http://dx.doi.org/10.5248/122.283

Volume 122, pp. 283-285 October-December 2012

New Anthracoidea, Tilletia, and Ustilago records for Turkey

SANLI KABAKTEPE & ZELIHA BAHCECIOGLU

Department of Biology, Faculty of Science and Art, Inonu University,

TR 44280, Malatya, Turkey

*CORRESPONDENCE TO: Zeliha. bahcecioglu@inonu.edu.tr

ABSTRACT — Three smut taxa, Anthracoidea angulata on Carex hirta, Tilletia lolii on Lolium

perenne, and Ustilago serpens on Elymus elongatus, are reported for the first time from Turkey.

The morphological and microscopical features of these fungi are described based on the

collected materials.

Key worps — Anatolia, Ardahan, Kars, Ustilaginales

Introduction

The smut fungi (Ustilaginales) are parasites of cereals and other cultivated

and natural plants, comprising more than 1400 species in approximately 70

genera (Vanky 1994).

In the last decade, reports of new records of smut fungi have greatly increased

in Turkey, and 55 smut species in 9 genera have been determined for the country

(Bahcecioglu & Yildiz 2005; Bahcecioglu et al. 2006; Bremer et. al. 1952; Kirbag

2003; Kabaktepe & Bahcecioglu 2006; Petrak 1953; Sahin & Tamer 1998; Sert

et. al. 2004; Sert 2009). Further smut research is required, as this number is far

less than the total number of potential host plants in Turkey.

This paper presents smut species collected from Kars and Ardahan provinces

in northeast Turkey.

Materials & methods

Specimens were collected during the field studies in 2006-09 from Kars and Ardahan

Provinces in Turkey. The host specimens were prepared according to established

herbarium techniques. Spores were scraped from dried host specimens and mounted in

lactophenol. The preparations were examined with an Olympus CX31 light microscope

and micrographs taken with a Olympus E-330 camera. Analysis LS Starter software was

used to measure at least 30 spores for each spore state. Host names follow Davis (1965-85)

284 ... Kabaktepe & Bahcecioglu

and Davis et al. (1988). Specimens are deposited in the Inonu University Herbarium

(INU), Turkey. The smut species were identified using relevant literature (Mordue &

Ainsworth 1984; Vanky 1994) concerning smut fungi in Europe.

Taxonomy

Anthracoidea angulata (Syd.) Boidol & Poelt, Ber. bayer. bot. Ges. 36: 23 (1963)

Sori in inflorescence. Spores, angular dark brown, 12-20 x 15-28 um wall

irregularly thickened, 1.5-5 um, verruculose.

A new smut species for Turkey, A. angulata is also known on Carex hirta

from Europe and on C. melanostachya Willd. from Asia.

SPECIMENS EXAMINED — On Carex hirta L. (Cyperaceae). TURKEY: Kars, 10 km

from Sarikamis to Horosan, 2010 m, 22.09.2006, Sanli Kabaktepe 4653 (INU 8549);

ARDAHAN, Yalnizcam mountains, Bilbilan plateau, 2400 m, 18.07.2007, Sanli Kabaktepe

5422 (INU 8550).

Tilletia lolii Auersw. ex G. Winter, Rabenh. Krypt.-Fl. Ed. 2, 1(1): 109 (1881)

Sori in ovaries, covered by epidermis. Spores, globose to subglobose, 16-24

um, light brown, wall reticulate, reticulations 2-5 um wide 1.5-4 um deep.

Sterile cells, few, globose, subglobose, 10-20 um, hyaline, wall 1-2 um.

New for Turkey, T. lolii is also known from Asia, Europe, and New Zealand.

SPECIMENS EXAMINED - On Lolium perenne L. (Poaceae). TURKEY: ARDAHAN, Posof,

2-4 km east of Kursuncavus village, 1720 m, 28.08.2008, Sanli Kabaktepe 6544 (INU

8552).

Ustilago serpens (P. Karst.) B. Lindeb., Symb. bot. upsal. 16(2): 133 (1959)

Sori in leaves, covered with epidermis. Spores globose, ellipsoidal 11-20 um,

dark brown, wall 0.5-1 um, verruculose.

New for Turkey, U. serpens is also known from Europe, Asia, North America,

and New Zealand.

SPECIMEN EXAMINED - On Elymus elongatus (Host) Runemark (Poaceae). TURKEY:

Kars, 13 km from Kagizman to Kars, 1350 m, 11.06.2007, Sanli Kabaktepe 4918 (INU

8551).

Acknowledgments

We are indebted to TUBITAK (Project no. TBAG-106T260) for financial support.

We also thank Dr. Bayram Yildiz and Dr. Mehmet Candan for presubmission expert

reviews

Literature cited

Bahcecioglu Z, Yildiz B. 2005. A study on the microfungi of Sivas Province. Turkish J. Bot. 29:

23-44.

Bahcecioglu Z, Kabaktepe S, Yildiz B. 2006. Microfungi isolated from plants in Kahramanmaras

Province, Turkey. Turkish J. Bot. 30: 419-434.

Anthracoidea, Tilletia, and Ustilago spp. new to Turkey ... 285

Bremer H, Karel G, Biyikoglu K, Goksel N, Petrak, F. 1952. Beitrage zur Kenntnis der parasitischen

Pilze der Turkei V. Revue de la Faculte des Sciences de I Universite d Istanbul, Seri B. 17(2):

161-181.

Davis PH. 1965-85. Flora of Turkey and East Aegean Islands, Vols 1-9. Edinburgh University

Press, Edinburgh.

Davis PH, Mill RR, Tan K. (eds). 1988. Flora of Turkey and the East Aegean Islands, Vol.

10(supplement). Edinburgh University Press, Edinburgh.

Kabaktepe S, Bahcecioglu Z. 2006. Microfungi identified from the flora of Ordu Province in Turkey.

Turkish J. Bot. 30: 251-265.

Kirbag S. 2003. Two new records for the mycoflora of Turkey. Turkish J. Bot. 27(2): 153-154.

Mordue JEM, Ainsworth GC. 1984. Ustilaginales of the British Isles. London, Commonwealth

Mycological Institute.

Petrak E 1953. Neue Beitrage zur Pilzflora der Tiirkei. Sydowia 7: 14—15.

Sahin N, Tamer AU. 1998. Smut species determined in Turkey. J. Turk. Phytopath. 27(2-3): 151-

156.

Sert HB. 2009. Additions to rust and smut fungi of Turkey. Phytoparasitica 37: 189-192. http://

dx.doi.org/10.1007/s12600-009-0023-x

Sert HB, Sumbul H, Isiloglu M. 2004. Phytopathogenic fungi new for Southern Anatolia, Turkey.

Phytoparasitica 32(4): 402-408.

Vanky 1994. European smut fungi. New York, NY USA, Gustav Fischer.

MY COTAXON

http://dx.doi.org/10.5248/122.287

Volume 122, pp. 287-291 October-December 2012

A new species of Coccomyces (Rhytismatales, Ascomycota)

on Ilex elmerrilliana

SHI-JUAN WANG, YAN-PING TANG, KE LI & YING-REN LIN"

School of Forestry & Landscape Architecture, Anhui Agricultural University,

West Changjiang Road 130, Hefei, Anhui 230036, China

*CORRESPONDENCE TO: yingrenlin@yahoo.com

ABSTRACT —Coccomyces ilicis sp. nov. is described, illustrated, and compared with similar

taxa. This fungus was collected from fallen leaves of Ilex elmerrilliana in Mt Huangshan of

Anhui Province, China. It differs from the closest relatives, C. noosanus and C. limitatus, by

its much wider asci and the absence of an excipulum and epithecium. The type specimen

is deposited in the Reference Collection of Forest Fungi of Anhui Agricultural University,

China (AAUF).

Key worps — Rhytismataceae, taxonomy, Aquifoliaceae

Introduction

Coccomyces De Not. is a large genus of Rhytismataceae, for which 116

species were recorded by Kirk et al. (2008) plus a few recently added. Thus far

25 Coccomyces species have been reported for China (Jia et al. 2012; Zheng et

al. 2012). Teng (1934) published the first records for China, C. dentatus (J.C.

Schmidt) Sacc. and C. delta (Kunze) Sacc. Most subsequent Chinese reports

have been made by Lin and Hou (Lin et al. 1994, 1999, 2000a, b, c, 2001; Hou

et al. 2006; Hou & Piepenbring 2007; Jia et al. 2012; Zheng et al. 2012). In this

paper, we describe another new Coccomyces species from China on fallen leaves

of Ilex elmerrilliana.

Materials & methods

Mature fruit bodies were selected from collected specimens. Macroscopic appearance

was described from dried reference collection material under a dissecting microscope at

10-50x magnification. After rehydration in water, fruitbodies were cut using a freezing

microtome into 8-15 um thick vertical sections, which were mounted in lactic acid or

cotton blue for observing the outlines of ascomata and conidiomata. Gelatinous sheaths

surrounding ascospores and paraphyses were examined in water or 0.1% (w/v) cotton

288 ... Wang & al.

blue in lactic acid. The colours of diversified structures and ascospore contents were

observed in water. Measurements and drawings were made using materials mounted in

5% KOH and from ca 30 asci, ascospores, and paraphyses for each specimen.

Taxonomy

Coccomyces ilicis S.J. Wang & Y.R. Lin, sp. nov. FIGs 1-6

MycoBank MB 800353

Differs from C. noosanus and C. limitatus by the absence of an excipulum and epithecium,

and by having much wider asci.

Type: China, Anhui, Mt Huangshang, Zuishi, alt. ca 700 m, on leaves of Ilex elmerrilliana

S.Y. Hu (Aquifoliaceae), 11 September 2004, S.J. Wang & Y.R. Lin 1878 (Holotype, AAUF

67986).

Erymo.ocy: The specific epithet refers to the host genus.

Cotonigs on both sides of leaves, forming irregular, yellowish-white paler

spots.

ZONE LINES frequent, grey-brown or black, thin, entirely or partly surrounding

the paler spots.

ConipioMara in similar positions to ascomataon the substratum, scattered or

crowded, sometimes coalescent, mostly on both sides of the zone lines. In surface

view, conidiomata disparate in dimensions, 45-180 um diam., rotund, black-

brown in the centre and the perimeter line of the conidioma, yellowish-brown

to grey-black elsewhere, somewhat raising the leaf surface, discharging spores

through 1 to 2 apical ostioles. In vertical section, conidiomata intraepidermal,

double lens-shaped. UPPER WALL 6-9 um thick, yellowish-brown but dark

brown near the ostiole(s), consisting of disparately sized angular cells. BAsAL

WALL extremely well developed, 12-22 um thick, black-brown, consisting of

3-4 layers of thick-walled angular cells ca 3 um diam. SUBCONIDIOGENOUS

LAYER 5—10(-22) um thick, composed of nearly colourless, thin-walled angular

cells. CONIDIOGENOUS CELLS 10-15 x 2-3 um, cylindrical, slightly tapering

towards the apex, holoblastic sympodially proliferating. Conip1a 3-5 x 1-1.5

um, cylindrical or subclavate, hyaline, aseptate.

AscoMaTa developing on both sides of leaves, scattered, rarely 2 to 3

coalescent, in irregular, yellowish-white bleached spots. In surface view,

ascomata 600-1250 um diam., triangular or quadrangular, black-brown to

black, shiny, edge defined, moderately raising the substrate surface, with an

obvious performed dehiscence mechanism, opening by 3-4 radial splits nearly

extend to the edge of ascoma, to expose waxy-yellow hymenium. Lips absent.

In median vertical section, ascomata intraepidermal. COVERING STROMA 25-35

um thick near the opening, slightly thinner towards the edge, connecting to the

basal stroma, comprised of textura angularis-globulosa with dark brown, thick-

walled cells 4-6 um diam. Few periphysoids near opening slit. BasAL STROMA

Coccomyces ilicis sp. nov. (China) ... 289

PLTACLILLLT AIPA AAA

Poon Anos gc tf0 {\ PP INIA 14

GANyeoagy

§ (( typ pf

Fics 1-6. Coccomyces ilicis on Ilex elmerrilliana. 1. A leaf bearing fruitbodies. 2. Conidiomata and

ascomata observed under a dissecting microscope. 3. Ascoma in median vertical section. 4. Portion

of ascoma in median vertical section. 5. Paraphyses, asci and ascospores. 6. Conidioma in vertical

section.

290 ... Wang & al.

20-25 um thick, composed of textura angularis-globulosa with 2—3(-4) layers

of black-brown, thick-walled cells 5-8 um diam. INTERNAL MATRIX STROMA

14-25 um thick, consisting of hyaline, gluey textura intricata. ExcIiPULUM

absent. SUBHYMENIUM 15-22 um thick, comprised of hyaline textura angularis

and porrecta. PARAPHYSES 130-160 x 1-1.2 um, filiform, septate, not branched,

increasing to 3.5—5 um at clavate, fusoid or calabash-like apex, covered with

a ca 0.5 um thick gelatinous matrix but not forming an epithecium. AscI

ripening sequentially, 95-130 x 5-7 um, clavate, apex rounded or subacute,

short-stalked, thin-walled, J-, 8-spored. Ascospores arranged fasciculately,

tapering towards the base, 65-95 x 1-1.2 um, filiform, hyaline, aseptate,

covered by a gelatinous sheath ca 0.5 um thick.

ECOLOGY & DISTRIBUTION: Producing conidiomata and ascomata on fallen

leaves of Ilex elmerrilliana. Known only from the type locality, Anhui, China.

COMMENTS —Coccomyces is widely distributed globally and associated

with a wide spectrum of plants in 61 families, particularly Ericaceae, Fagaceae,

and Lauraceae (Sherwood 1980). Of 24 species of Rhytismatales reported to

associate with Aquifoliaceae, only two belong in Coccomyces: C. yerbae Speg.

and C. radiatus Sherwood (Farr & Rossman 2012). They, however, differ

morphologically from C. ilicis (Sherwood 1980; Johnston 1994).

Coccomyces noosanus P.R. Johnst. resembles C. ilicis macroscopically and

microscopically but differs in having a well-developed, compact periphysoid

layer, much narrower asci (4.5-5.5 um), wider ascospores (1.5 um), and the

presence of an excipulum and epithecium (Johnston 2000). Coccomyces limitatus

(Berk. & M.A. Curtis) Sacc. is also close to C. ilicis, but has smaller ascomata

(500-1000 um diam.), a paraphysis-like excipulum, an obvious epithecium,

and narrower asci (4.5-5.5 um) (Johnston 2000; Lin et al. 2000c).

Acknowledgments

The authors are grateful to Dr D.W. Minter and Dr M. Ye for serving as pre-

submission reviewers, and to Dr Y.H. He for identifying the associated plant. This study

was supported by the National Natural Science Foundation of China (No. 30870014,

31270065).

Literature cited

Farr DF, Rossman AY. 2012. Fungal Databases, Systematic Mycology and Microbiology Laboratory.

ARS, USDA; viewed online on 25 April 2012 at

http://nt.ars-grin.gov/fungaldatabases/fungushost/new_frameFungusHostReport.cfm.

Hou CL, Piepenbring M. 2007. Two new species of Rhytismataceae on twigs of conifers from

Yunnan Province, China. Mycotaxon 102: 165-170.

Hou CL, Kirschner R, Chen CJ. 2006. A new species and new records of Rhytismatales from Taiwan.

Mycotaxon 95: 71-79.

Jia GJ, Lin YR, Cheng LH. 2012 [“2011”]. A new species of Coccomyces (Rhytismatales, Ascomycota)

from Mt Huangshan, China. Mycotaxon 118: 231-235. http://dx.dio.org/10.5248/118.231

Coccomyces ilicis sp. nov. (China) ... 291

Johnston PR. 1994, Ascospore sheaths of some Coccomyces, Hypoderma and Lophodermium species

(Rhytismataceae). Mycotaxon 52: 221-239.

Johnston PR. 2000. Rhytismatales of Australia: the Genus Coccomyces. Australian Systematic

Botany 13: 199-243,

Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s Dictionary of the Fungi

10" edn, CAB International. Wallingford. 771 p.

Lin YR, Liu HY, Tang YP, Hu BE. 1994. Two new species of the genus Coccomyces from China (in

Chinese). Acta Mycol. Sin. 13: 8-12.

Lin YR, Li ZZ, Chen Y, Li Z, Wu WJ. 1999. A new species of Rhytismatales, Coccomyces occultus sp.

nov. (in Chinese). Journal of Anhui Agricultural University 26: 37-39.

Lin YR, Li ZZ, Liu HY, Xiang CT. 2000a. Studies on the genus Coccomyces from China I (in

Chinese). Mycosystema 19: 157-160.

Lin YR, Li ZZ, Huang CC, Xiang CT. 2000b. Studies on the genus Coccomyces from China II (in

Chinese). Mycosystema 19: 297-301.

Lin YR, Li ZZ, Xie YS, Liang SW. 2000c. Studies on the genus Coccomyces from China III (in

Chinese). Mycosystema 19: 449-453.

Lin YR, Li ZZ, Xu ZS, Wang JR, Yu SM. 2001. Studies on the genus Coccomyces from China IV (in

Chinese). Mycosystema 20: 1-7.

Sherwood MA. 1980. Taxonomic studies in the Phacidiales: The genus Coccomyces (Rhytismataceae).

Occas. Pap. Farlow Herb. Cryptog. Bot. 15: 1-120.

Teng SC. 1934. Notes on Discomycetes from China, Sinensia 5: 431-465.

Zheng Q, Lin YR, Yu SM, Chen L. 2012 [“2011”]. Species of Rhytismataceae on Lithocarpus spp.

from Mt Huangshan, China. Mycotaxon 118: 311-323. http://dx.doi.org/10.5248/118.311

MY COTAXON

http://dx.doi.org/10.5248/122.293

Volume 122, pp. 293-301 October-December 2012

New Asian records and morphological variation in

Fibrodontia brevidens (Basidiomycota)

EUGENE YURCHENKO”! & SHENG-HUA Wu?

‘Department of Biotechnology, Paleski State University,

Pushkin str. 4, BY-225710, Pinsk, Belarus

*Department of Botany, National Museum of Natural Science,

Taichung, Taiwan 404, Republic of China

* CORRESPONDENCE TO: eugene_yu@tut.by

Asstract — Fibrodontia brevidens (Trechisporales) is reported for the first time from

Taiwan, mainland China, and Vietnam. Asian specimens are compared morphologically with

collections from Venezuela. Morphological variation in the species is discussed. Most variable

features within the specimens are encrustation of projecting skeletal-like hyphae (from totally

naked to richly encrusted) and spore size. Nevertheless, the single morphospecies concept

of E brevidens is retained. Basidioma photographs, microscopical drawings, and scanning

electron microscopic photographs of crystalline deposits on skeletal-like hyphae of this

species are provided.

KEY worps — corticioid, Hyphodontia, SEM, taxonomy

Introduction

Fibrodontia brevidens (Pat.) Hjortstam & Ryvarden (Hydnodontaceae,

Trechisporales) is a presumably not rare but little collected pantropical corticioid

fungus. It has been reported previously from Africa (Rwanda; Ryvarden 1978),

Sunda Archipelago (Brunei; Hjortstam et al. 1998), Caribbean Archipelago

(Guadeloupe; Nakasone 2003), and South America (Ecuador - Langer 1994;

Venezuela - Hjortstam et al. 2005; Brazil - Hjortstam & Ryvarden 2007, S.P.

Gorjon, pers. comm.; Uruguay - Martinez & Nakasone 2010). Although there

have been numerous studies on the corticioid fungi of mainland China and

Taiwan summarized in two recent checklists (Wu 2010, Dai 2011), E brevidens

has not been reported earlier for either country.

Morphological descriptions of FE brevidens were published by Ryvarden

(1978; as Hyphodontia africana Ryvarden), Langer (1994; as Hyphodontia

brevidens (Pat.) Ryvarden), and Nakasone (2003; type of Acia sericea Pat.).

294 ... Yurchenko & Wu

The most prominent feature of this species (and the genus in general) are the

numerous long parallel moderately flexuous thick-walled hyphae (usually

yellowish in mass) that constitute the core of hymenophoral aculei and project

at their apices. They have been referred to variously as thick-walled hyphae

(Ryvarden 1978), skeletal hyphae (Eriksson et al. 1981, Jung 1987), tubular

tramacystidia (Langer 1994), tramal cystidia or pseudocystidia (Nakasone

2003), or pseudoskeletal hyphae (Bernicchia & Gorjén 2010). Similarly, the

Fibrodontia hyphal system has been described as semi-dimitic (Ryvarden 1978),

dimitic (Eriksson et al. 1981), or pseudodimitic (Langer 1994, Bernicchia &

Gorjén 2010). An argument for dimiticism is the presence of skeletal hyphae

in sterile hyphal textures of the type species, F gossypina Parmasto (Eriksson

et al. 1981, Fig. 542). We use the term “skeletal-like hyphae” to refer to these

structures in the present paper.

Materials & methods

The reference specimens, collected during 1991-2000 in Asia and South America,

are stored in TNM, O, and MSK herbaria (acronyms according to Index Herbariorum,

http://sweetgum.nybg.org/ih/). Microscopic structures were measured in material

mounted in 3% KOH water solution, and the spore quotient (spore length/width ratio)

excludes the apiculus. Encrustations were studied in Melzer’s reagent and/or distilled

water. The hymenial surface was photographed with Nikon Coolpix P6000 digital

camera, while encrusting crystals were photographed with a Hitachi SU 1510 scanning

electron microscope.

Results & discussion

Critical study of the collections storedin TNM confirms Fibrodontia brevidens

as a new record for Taiwan, mainland China, and Vietnam. Taiwanese records

are based on two localities, one in central Taiwan and the other on Orchid

Island in the Philippine Sea near the southeast Taiwan coast. Two mainland

China records represent one site in central Sichuan Province and a second in

the extreme south of Yunnan Province. The Vietnamese localities lie in the

northern part of the country in the mountains around Ha Noi. ‘The habitats

correspond to tropical (from near sea level) and warm subtropical vegetation

(up to 1600 maz.s.l.).

Langer (1994) regarded the crystals on skeletal-like hyphae as a common

feature in Fibrodontia. However, only one (TNM F8714 from Orchid

Island) of eight Asian specimens examined had skeletal-like hyphae richly

encrusted by characteristic flattened crystals and visible in KOH. To resolve

the taxonomic position of specimens with naked hyphae, we compared their

general morphology with F. brevidens specimens from Venezuela collected by

L. Ryvarden.

Fibrodontia brevidens in Asia... 295

- =— - =

e483, Ae

eh inn rc

é &* po ee:

Fe ee da -&

~~ * _s

Fic. 1. Fibrodontia brevidens. Details of basidiomata: a, TNM F8714 (Orchid Island, Taiwan);

b, TNM F24714 (central Taiwan); c, TNM F9008 (Vietnam). Scale bars = 1 mm.

Hymenophore color has been said to vary in FE brevidens from white or

cream (Langer 1994) to ochraceous (Hjortstam et al. 1998) and greyish orange

(Nakasone 2003). However, the Asian and South American specimens we

examined were yellowish with olive tinges and not especially variable in color.

The hymenophore consists of 50-150 um tall aculei, which also were not too

variable in density and shape (Fie. 1).

The encrustations on skeletal-like hyphae in Asian specimen TNM F8714

resemble those in both Venezuelan specimens (O 37539, O 40434; Fia. 2e,

f, h, i). The other Asian specimens have totally naked to unclearly or poorly

encrusted skeletal-like hyphae where the crystals were not tablet-shaped and

296 ... Yurchenko & Wu

Fic. 2. Fibrodontia brevidens. Microscopical elements (TNM F24714): a, vertical section through

basidioma; b, vertical section through an aculeus (in KOH solution); c, part of aculeal core (in

water). TNM F4188: d, upper parts of skeletal-like hyphae (in water). TNM F8714, skeletal-like

hyphae: e, f, in lower part; g, naked one; h, collected in emerging cluster. O 37529: i, skeletal-like

hyphae. Scale bars: a = 0.2 mm; b-i = 10 um.

Fibrodontia brevidens in Asia ... 297

often only observed in Melzer’s reagent or water preparations (Fic. 2b-d).

The “encrusted” specimens varied from seldom completely naked (Fic. 2g) to

richly encrusted skeletal-like hyphae. Such variability within a single specimen

is also inferred from the published descriptions and illustrations of E brevidens

(Ryvarden 1978, Langer 1994 - specimen Rammeloo 3929) and F. gossypina

(Eriksson et al. 1981). Nakasone (2003) provided no data on encrustations

on tramacystidia in Hyphodontia brevidens. We thus attribute the degree of

encrustation to intraspecific variation, partly explained by the developmental

stage of each cluster of skeletal-like hyphae.

The shape of the crystals on skeletal-like hyphae in Fibrodontia is

characterized as tablet-like and partly cuff-like (Langer 1994). However, as

their shape is poorly interpreted using light microscopy alone, we compared

the two E brevidens skeletal-like hyphal morphotypes (clearly encrusted vs.

naked) under the scanning electron microscope. Our SEMs demonstrated

that the number and shape of crystals depend on the age of sample examined.

The “encrusted” morphotype produced younger aculei with subacicular

loosely attached tablet-shaped crystals (Fic. 3a) and older aculei encrusted

by numerous tablet-shaped, slate-shaped, and small-sized prismatic crystals

(Fic. 3b,c); here no circularly girdling crystals were observed. In the ‘naked’

E. brevidens morphotype, we observed absolutely no encrustations in younger

basidioma patches (Fic. 3d), while older aculei contained some skeletal-like

hyphae very slightly roughened from scarce minute crystals (Fic. 3e); scattered

and loosely attached semi-tablet-shaped crystals were also detected (Fic. 3f).

Published descriptions and our examinations indicate a notable spore size

variation within E brevidens. A Venezuelan specimen (O 37539) produced the

smallest spores (3.5-4 x 2.5-3.5 um), and a specimen from Sichuan (TNM

F12152; Fic. 5) produced the largest (4.5-5.2 x (3-)3.5-4 um). Previously

published spore sizes vary from 3.5-4 um in diam (Ryvarden 1978) to 4.5-5(-

5.5) x 3.5-4.5 um (Nakasone 2003).

The large-spored samples from Sichuan and central Taiwan were also

distinguished by narrower, more flexuous, loosely arranged skeletal-like hyphae.

A large-spored (3.7-4.5(-5) x 3.2-3.5 um) sample from Taiwan (TNM F24714)

had capitate hyphal ends in the subiculum similar to those in Hyphodontia

(Xylodon) species, a character not previously noted for Fibrodontia (Fic. 4b).

Between collections, spore shape (predominantly broadly ellipsoid and ovoid in

F. brevidens) was less variable than spore size. Spore quotients within a studied

specimen varied from 1 to 1.4; TNM F8714 contained some dorsoventrally

flattened spores (ellipsoid in lateral view), with a length : width ratio of 1.6.

Basidial morphology in Fibrodontia brevidens differs from that in

Hyphodontia s. 1., which we consider an additional argument for placing

Fibrodontia in the trechisporoid clade. Basidia in F brevidens are initially

298 ... Yurchenko & Wu

Fic. 3. Scanning electron microscopic images of projecting skeletal-like hyphae and their

encrustations in Fibrodontia brevidens. TNM F8714: from younger (a) and older (b, c) basidioma

patches. TNM F24714: from younger (d) and older (e, f) basidioma patches. The main crystal

shapes are marked: m - minute, powder-like; p — prismatic, sa - semi-acicular; s - slate-like;

sc — semi-cuff-shaped; st - semi-tablet-shaped; t - tablet-shaped. Scale bars = 10 um.

Fibrodontia brevidens in Asia ... 299

Fic. 4. Fibrodontia brevidens. Microscopical elements (TNM F24714): a, subicular hyphae;

b, capitate hyphal ends from subiculum; c, basidioles and subhymenial hyphae; d, basidia.

Scale bar = 10 um.

300 ... Yurchenko & Wu

Fic. 5. Fibrodontia brevidens. Basidiospore variation: a, TNM F8714 (Taiwan, Orchid Island); b,

TNM F4188 (China, Yunnan); c, O 37539 (Venezuela); d, TNM F24714 (central Taiwan); e, TNM

F12152 (China, Sichuan). Scale bar = 5 um.

ovoid, becoming urniform and basally swollen, then more or less utriform with

somewhat wavy divaricate sterigmata, and ultimately shrinking and distorted

(Fic. 4d).

Except for the encrustations on skeletal-like hyphae and smaller spores

(Fic. 5c), we found no significant differences between South American and

Asian specimens. From our own observations on variation in FE brevidens as

well as morphological data by other authors, we regard all studied material as

one morphospecies.

SPECIMENS EXAMINED — CHINA: SICHUAN, Chingchenghoushan (Qing Cheng Hou

Shan), Feichuankou, 900 m a.s.l., on naked dead wood, S.H. Wu & S.C. Wu, 13.X.2000,

Wu 0010-113 (TINM-F 12152); YUNNAN, Shishuangbanna (Xishuangbanna), Nabanho,

600 m a.s.l., on bamboo stem, coll. S.H. Wu & J.Y. Tseng, 16.VIII.1995, Wu 9508-282

(TNM F4188); on bamboo stem, coll. S.-H. Wu & J.Y. Tseng, 16. VHI.1995, Wu 9508-297

(TNM F4203). TAIWAN: Nantou County, Luku Hsiang, Sunlinksea, 1600 m a.s.L.,

on decorticated branch of angiosperm species, coll. $.H. Wu, 11.X.1991, Wu 911011-

16 (TNM F24714; dup. in MSK); TarrunG County, Orchid Island, Yunghsing Farm,

on dead branch of angiosperm species, coll. SH. Wu & J.Y. Tseng, 30.IV.1997, Wu

9704-179 (ITINM F8714). VENEZUELA: Estapo MIRANDA, Sartenejas, Univ. Simon

Bolivar, on dead, partly corticated hardwood, coll. L. Ryvarden, 10.V1.1995 (O 37539);

EstaDO AMAZONAS, Yutajé, on dead naked angiosperm wood, coll. L. Ryvarden, 12-

19.V1.1997 (O 40434). VIETNAM: Ha Not, Tam Dao National Park, 1050 m a.s.l., on

bamboo trunk, coll. SH. Wu & S.Z. Chen, 1.VII.1998, Wu 9807-15 (TINM F9007); on

dead bamboo stem, coll. S.H. Wu & S.Z. Chen, 1.VII.1998, Wu 9807-16 (TNM F9008);

Ha Tay PROVINCE, Ba Vi National Park, 650 m a.s.1., on bamboo stem, coll. S.-H. Wu &

S.Z. Chen, 4.VII.1998, Wu 9807-96 (TNM F9081).

Fibrodontia brevidens in Asia... 301

Acknowledgements

The authors are grateful to Dr S.P. Gorjén (Centro de Investigacién y Extensién

Forestal Andino Patagénico, Esquel, Argentina) and Dr V. Spirin (Botanical Museum,

University of Helsinki, Finland) for presubmission review of the manuscript. We

acknowledge the curator of University of Oslo Mycological Herbarium, Dr K.-H. Larsson,

for kindly providing us a loan of Fibrodontia brevidens, collected in Venezuela. The

authors thank Ms. S.Z. Chen (TNM), for the help in managing the reference collections,

and Ms. S.K. Hu (Department of Geology, National Museum of Natural Science) for

SEM assistance. The research was supported financially from National Science Council

of ROC (Taiwan) (grant NSC 100-2811-B-178-001) and by National Museum of Natural

Science, ROC (Taiwan).

Literature cited

Bernicchia A, Gorjén SP. 2010. Corticiaceae s. |. (Fungi Europaei). Edizioni Candusso. 1008 p.

Dai YC. 2011. A revised checklist of corticioid and hydnoid fungi in China for 2010. Mycoscience

52: 69-79. http://dx.doi.org/10.1007/s10267-010-0068-1

Eriksson J, Hjortstam K, Ryvarden L. 1981. The Corticiaceae of North Europe. Vol. 6: Phlebia -

Sarcodontia. Fungiflora, Oslo. Pp. 1049-1276.

Hjortstam K, Ryvarden L. 2007. Checklist of corticioid fungi (Basidiomycotina) from the tropics,

subtropics, and the southern hemisphere. Synopsis Fungorum 22: 27-146.

Hjortstam K, Roberts PJ, Spooner BM. 1998. Corticioid fungi from Brunei Darussalam. Kew Bull.

53(4): 805-827. http://dx.doi.org/10.2307/4118870

Hjortstam K, Ryvarden L, Iturriaga T. 2005. Studies in corticioid fungi from Venezuela II

(Basidiomycotina, Aphyllophorales). Synopsis Fungorum 20: 42-78.

Jung HS. 1987. Wood-rotting Aphyllophorales of the southern Appalachian spruce-fir forest. Bibl.

Mycol. 119: 1-260.

Langer E. 1994. Die Gattung Hyphodontia John Eriksson. Bibl. Mycol. 154: 1-298.

Martinez S, Nakasone KK. 2010. New records and checklist of corticioid Basidiomycota from

Uruguay. Mycotaxon 114: 481-484.

Nakasone KK. 2003. Type studies of resupinate hydnaceous Hymenomycetes described by

Patouillard. Cryptogamie, Mycol. 24(2): 131-145.

Ryvarden L. 1978. Studies in the Aphyllophorales of Africa 6. Some species from eastern Central

Africa. Bull. Jard. Bot. Nat. Belg. 48(1/2): 79-117. http://dx.doi.org/10.2307/3667919

Wu SH. 2010. Survey of corticioid fungi in Taiwan, to 2010. Fung. Sci. 25(1): 49-60.

MY COTAXON

http://dx.doi.org/10.5248/122.303

Volume 122, pp. 303-306 October-December 2012

Caloplaca gyrophorica (lichenized Ascomycota),

a new saxicolous lichen species from India

YOGESH JosHt, T.A.M. JAGADEESH RAM? & G.P. SINHA*”

"Department of Botany, Kumaun University, S. S. J. Campus,

Almora 263601, Uttarakhand, India

Botanical Survey of India, Andaman & Nicobar Regional Centre, Port Blair 744102, India

Botanical Survey of India, Central Regional Centre, Allahabad 211002, Uttar Pradesh, India

CORRESPONDENCE TO *: 'dryogeshcalo@gmail.com, *tamjagadeesh@yahoo.co.in ,

*3 drgpsinha@yahoo.co.in

ABSTRACT — A gyrophoric acid-containing Caloplaca species is reported from India for the

first time. Caloplaca gyrophorica was found growing over rocks in temperate regions of Neora

Valley National Park, Darjeeling, India. It is compared with the other three known gyrophoric

acid-containing Caloplaca species and with the morphologically similar C. hueana.

Key worps — depside, parietin, taxonomy, Teloschistaceae

Introduction

Gyrophoric acid, an orcinol para-depside, is reported from a number of

lichens, but its presence in Caloplaca ‘Th. Fr. is so far confined to only three

species: C. bogilana Y. Joshi & Hur, C. subflavorubescens Y. Joshi & Hur, and

C. brownlieae S.Y. Kondr. et al. (Joshi et al. 2010; Lumbsch et al. 2011). While

investigating a specimen from Neora Valley National Park in the Eastern

Himalaya, the authors found gyrophoric acid along with parietin as major

compound. This is the first time that gyrophoric acid has been reported from

an Indian Caloplaca species. When compared with other known gyrophoric

acid-containing Caloplaca species, the specimen was found to differ entirely

from those and hence described as new to science.

Materials & methods

Studied specimens are deposited at BSA and LWG. Description and photographs

of external morphology are based on air-dried material observed under a dissecting

stereomicroscope (Nikon SMZ645). Sections were made with a razor blade under the

stereomicroscope and mounted in lactophenol cotton blue. Anatomical descriptions

304 ... Joshi, Jagadeesh Ram & Sinha

are based on these preparations under a compound microscope (Nikon Eclipse E200).

Ascospores were measured at 400x in water mounts; only free ascospores lying outside

the asci were measured. A K+ purple reaction indicates the absence of the parietin

complex, and a K+ red reaction indicates its presence. Secondary metabolites were

identified by TLC as described by White & James (1985) and Orange et al. (2001) using

solvent systems C and D. Mycological terms follow Kirk et al. (2008).

Taxonomy

Caloplaca gyrophorica Jagadeesh, Y. Joshi & G.P. Sinha, sp. nov. Fic. 1

MycoBank MB 800479

Similis C. hueana sed differt in non-inspersum hymenium, grandior sporae et C+ rubescens

thallus (acidum gyrophoricum).

Type: India. West Bengal: Darjeeling district, Kalimpong subdivison, Neora Valley

National Park, Aloobari, 27°07'33.1"N 88°42'55.2"E, alt. 2479 m, on exposed siliceous

rocks, 17 May 2008, T.A.M. Jagadeesh Ram 4356 (holotype, BSA; isotype, LWG).

EryMoLoGcy — ‘The specific epithet refers to the presence of gyrophoric acid in the

species.

THALLUS crustose, saxicolous, areolate to subsquamulose; areoles confluent

to scattered, yellowish brown to grayish brown, yellowish gray (when wet), +

rounded to ellipsoid or irregular, 0.2-0.5 mm wide; cortex thin, 7.5 um thick,

paraplectenchymatous, necral layer absent; algal layer continuous; medulla

hyaline, of densely interwoven hyphae, with crystals. HyPOTHALLUS brownish

black, scattered throughout and between the areoles.

APOTHECIA numerous, scattered to + aggregated, rounded to somewhat

angular, sessile to adnate, distinctly constricted at base, 0.3-0.5(-0.8) mm

diam., lecanorine; disc brownish orange, yellowish orange (when wet), plane

to convex, epruinose; margin concolorous to thallus, thin, smooth, uneven

by age, slightly emergent from the disc. EPIHYMENIUM yellowish brown,

10-15.5(-25) um thick, K+ red. Hymentum hyaline, not inspersed, (49-)

52.5-60(-75) um high, I+ blue. HypoTHecium hyaline, (30-)75-87.5(-100)

um thick, paraplectenchymatous. THALLINE EXCIPULUM up to 90 um thick,

with algae, without crystals. PROPER EXCIPULUM hyaline, thin. PARAPHYSES

branched and anastomosing, 1-1.5 um wide, tips not swollen. Asct clavate, 8-

spored, 48-58 x 13-15 um. Ascosporss biseriate, hyaline, ellipsoid, polarilocular,

(10-)11.5-14(-16) x 7-10 um, isthmus 2.5-3.75 um. PYCNIDIA not seen.

CHEMISTRY — Spot test reactions: thallus K-, C+ red, KC+ red, P-.

Epihymenium K+ red, C-. TLC: gyrophoric acid and parietin.

ECOLOGY & DISTRIBUTION — Found growing over exposed siliceous rocks

at ca 2400 m in Neora Valley National Park, Eastern Himalaya. Temperatures

range from subzero to 20°C. The hilly slopes are covered by bushy secondary

vegetation with some parts cultivated prior to the 1992 park establishment.

Caloplaca gyrophorica sp. nov. (India) ... 305

FiGuRE 1: Caloplaca gyrophorica. Habit. Scale bar = 5 mm.

REMARKS — Caloplaca gyrophorica is characterized by an areolate to

subsquamulose grayish brown thallus, brownish orange lecanorine apothecia

with concolorous margins, and gyrophoric acid and parietin as major chemical

constituents.

Morphologically the new species is most likely to be confused with the

saxicolous Caloplaca hueana B. de Lesd., which differs in its inspersed

hymenium, much smaller spores (8.5-11(-12) x 5.1-8.5 um; Wetmore 1996),

tropical distribution, and lack of gyrophoric acid.

The saxicolous species C. bogilana, differs from C. hueana in a grayish

areolate thallus, simple to furcate paraphyses with swollen tips, numerous

pycnidia, a maritime distribution, and atranorin and lecanoric acid present

in most collections (Joshi et al. 2010). Caloplaca subflavorubescens differs in

a strictly corticolous habit, a squamulose to subfruticose yellowish green to

grayish green thallus, septate paraphyses, and the presence of 7-chloroemodin,

emodin, fragilin, and atranorin; moreover, gyrophoric acid is present only

rarely and absent from the common C. subflavorubescens chemotype (Joshi et

al. 2010). The saxicolous C. brownlieae differs from C. hueana in having pinkish

orange or cinnabarine areoles and immersed to slightly erumpent apothecia

and containing ovoic acid, lecanoric acid, xanthorin, and erythroglaucin

(Lumbsch et al. 2011).

306 ... Joshi, Jagadeesh Ram & Sinha

Acknowledgments

This work was supported by a grant from the Ministry of Environment & Forests,

New Delhi under AICOPTAX scheme. The authors (TAMJR and GPS) are thankful

to Director Botanical Survey of India, Kolkata for facilities. One of the authors (YJ)

is thankful to Head, Dept. of Botany, S.S.J. Campus, Almora for providing laboratory

facilities to work. The authors are thankful to Drs Laszlé L6k6s and Jae-Seoun Hur for

reviewing the manuscript and providing valuable comments.

Literature cited

Joshi Y, Wang XY, Yamamoto Y, Koh YJ, Hur J-S. 2010. A first modern contribution to Caloplaca

biodiversity in South Korea: two new species and some new country records. Lichenologist

42(6): 715-722. http://dx.doi.org/10.1017/S00242829 10000368

Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth & Bisby’s dictionary of the fungi.

10" ed. Wallingford, Oxon., CAB International.

Lumbsch HT, et al. 2011. One hundred new species of lichenized fungi: a signature of undiscovered

global diversity. Phytotaxa 18: 1-127.

Orange A, James PW, White FJ. 2001. Microchemical methods for the identification of lichens.

British Lichen Society, London.

Wetmore CM. 1996. The Caloplaca sideritis group in North and Central America. Bryologist 99:

292-314. http://dx.doi.org/10.2307/3244301

White FJ, James PW. 1985. A revised guide to microchemical techniques for the identification of

lichen substances. British Lichen Society Bulletin 57(supplement): 1-41.

MY COTAXON

http://dx.doi.org/10.5248/122.307

Volume 122, pp. 307-324 October-December 2012

Seven dark fruiting lichens of Caloplaca from China

Guo-Li ZHOU", ZUN- TIAN ZHAO”, LEI LU?, DE-BAo TONG’,

MIn-MIN Ma’ & HaI-YING WANG"*

‘College of Life Sciences, Shandong Normal University, Jinan, 250014, P. R. China

Shandong Provincial Key Laboratory of Microbial Engineering, School of Food and Bioengineering,

Shandong Polytechnic University, Jinan, 250353, P. R. China

*These authors contributed equally.

*CORRESPONDENCE TO: lichenwhy@yahoo.com.cn

ABSTRACT —Detailed taxonomic descriptions with photos are presented for seven dark

fruiting Caloplaca species found in China. Caloplaca albovariegata, C. atrosanguinea, and

C. diphyodes are apparently new to Asia, C. bogilana, and C. variabilis are new to China, and

C. conversa and C. pulicarioides are new to northern China.

Key worps —Ascomycota, Teloschistales, Teloschistaceae

Introduction

The large cosmopolitan genus Caloplaca (Teloschistaceae, Teloschistales,

Lecanoromycetes, Ascomycota) was established by Theodor Fries in 1860 (Kirk

et al. 2008). Caloplaca is characterized by a totally immersed to subfruticose

crustose thallus, typically teloschistacean ascus, polarilocular ascospores, and

various anthraquinones or no substances (Poelt & Pelleter 1984, Sochting &

Olecha 1995). The genus reportedly comprises more than 500 species worldwide

(Kirk et al. 2008), but only 59 species are known in China (Abbas et al. 1996,

Aptroot & Seaward 1999, Arocena et al. 2003, Wei 1991, Xahidin et al. 2010,

Zhao & Sun 2002).

During our study of Lecanora Ach. in China, six Caloplaca species with

black apothecial discs and one with a red-brown apothecial disc were found.

Of these, five species are new to China. Descriptions with photos of important

characters of these species are provided here.

Materials & methods

The specimens studied are preserved in SDNU (Lichen Section of Botanical

Herbarium, Shandong Normal University). Morphological and anatomical characters

308 ... Zhou & al.

were examined under a COIC XTL7045B2 stereomicroscope and OLtympus CX41

polarizing microscope. Lichen substances were identified using the standardized thin

layer chromatography techniques (TLC) with solvent system C (Orange et al. 2010).

Photos were taken under OLtympus SZX16 and BX61 with DP72.

Terms applied to Caloplaca apothecial structures of are shown below in Fie. 1.

Pe ee ee

+ » ° | a.

é f ; a

Y . \

- yy d *\) f bh Hee

*. . fs, Pwr vy

- ee ‘cs Dh elses eeeee i ©

a . ., sah

he }

ep oe

ae, ~ s

Oats e

Weg ae

a ‘s eS a ee.

Ven oe

toe ;

F ree

a he

‘ “a5

> \o =

« ee mY oe cae |

Figure 1. Terms applied to apothecial structures in Caloplaca: At = amphithecium;

Ex = inner exciple; Eh = epihymenium; Hy = hymenium; Sh = subhymenium.

Bar = 20um.

Taxonomic descriptions

Caloplaca albovariegata (B. de Lesd.) Wetmore, Mycologia 86: 816

(1995 [“1994”]) FIGS 2;:3

MorpuHo.oey — Thallus saxicolous, crustose, greenish gray to blackish gray,

stipitate areolate); cortex with crystals in some places; medulla with obvious

crystals; algal layer clustered; prothallus not seen. Apothecia lecanorine,

sessile; disc black, epruinose; inner exciple black at the top; amphithecium

with very thick algal layer and obvious crystals; epihymenium brown, without

crystals; hymenium and subhymenium hyaline. Ascus 8-spored; ascospores

polarilocular, ellipsoid, 15-20 x 7.5-10 um, isthmus 2-4.5 um; paraphyses

simple, with 1-2 somewhat swollen apical cells. Pycnidia not observed.

CHEMISTRY — Epihymenium K+ light purple, C-; amphithecial cortex and

top of inner exciple K+ purple, C+ purple. Thallus and medulla K-, C-, KC-,

P-. Secondary metabolites: no lichen substances detected by TLC.

Caloplaca spp. new to China ... 309

¥ =

4N,

‘

* = AS ol

~~ * 4 , ' :

Pai Rg

FiGuRE 2. Caloplaca albovariegata (Wang 20124075, SDNU). A: Thallus; B: Apothecium; C: Thallus

section showing clustered algal layer and crystals in cortex and medulla. Scale bars: A = 2 mm;

B = 500 um; C = 50 um.

DISTRIBUTION — Caloplaca albovariegata has been reported from western

North America (Wetmore 1995, 2007). New to China and Asia.

SPECIMEN EXAMINED: CHINA. SHANXI, NINGwu country, Mt. Luya, alt. 2500 m, on

rock, 26 Aug. 2011, H.Y. Wang 20124075 (SDNU).

ComMENts — Caloplaca peliophylla resembles C. albovariegata in the stipitate

areolate thallus but differs in the shiny olive brown thallus and lighter brown

apothecial discs. The similar C. atroalba, C. diphyodes, C. ursina, and C. variabilis

310... Zhou & al.

Tay heey W)

t = ; ee

PT ins

yt F

Dias!

FiGurE 3. Caloplaca albovariegata (Wang 20124075, SDNU). A: Apothecium section; B: Amphi-

thecium with obvious crystals; C: K+ reaction in epihymenium, amphithecial cortex, and top of

inner exciple; D: C+ reaction in amphithecial cortex and top of inner exciple; E: 8-spored ascus;

F: Polarilocular ascospores; G: Simple paraphyses with 1-2 somewhat swollen apices. Scale bars:

A-F = 20 um; G = 10 um.

differ by having non-stipitate or only partly stipitate areolate thalli. See further

discussion under C. variabilis.

Caloplaca atrosanguinea (G. Merr.) I.M. Lamb, Natl. Mus. Canada Bull. 132: 305

(1954) Fics 4,5

MorpHo.tocy — ‘Thallus corticolous, crustose, light grey; cortex with

indistinct crystals; medulla with obvious crystals; algal layer even; prothallus not

Caloplaca spp. new to China... 311

PF ew,

FicurE 4. Caloplaca atrosanguinea (Zhao 20116843A, SDNU). A: Thallus; B: Even algal layer

and crystals in cortex and medulla; C: Apothecium section; D: Crystals in amphithecium

and epihymenium; E: C+ reaction in epihymenium and top of inner exciple; F: K+ reaction in

epihymenium, amphithecial cortex, and top of inner exciple. Scale bars: A = 250 um; B = 50 um;

C-F = 20 um.

seen. Apothecia lecanorine, sessile; disc black or somewhat brown, epruinose;

inner exciple black at the top; amphithecium with crystals; epihymenium dark

black, with crystals; hymenium and subhymenium hyaline. Ascus 8-spored;

ascospores polarilocular, ellipsoid, 10-12.5 x 6.2-7.5 um, isthmus 2-3 um;

paraphyses simple to branched at the top, with 2-3 swollen apical cells. Pycnidia

present, ostiole black; conidia bacilliform, 3.5-6.3 x 0.8—1 um.

312 Fhou-seal:

FigurRE 5. Caloplaca atrosanguinea (Zhao 20116843A, SDNU). A: 8-spored ascus; B: Simple to

branched paraphyses with 2-3 swollen apical cells; C: Polarilocular ascospores; D: Bacilliform

conidia. Scale bars = 10 um.

CHEMISTRY — Epihymenium K+ reddish then purple, C+ reddish purple

(Fic. 4E); top of inner exciple K+ reddish then purple, C+ reddish purple;

amphithecial cortex K+ light purple, C-. Thallus and medulla K-, C-, KC-, P-.

Secondary metabolites: no lichen substances detected by TLC.

DISTRIBUTION — Caloplaca atrosanguinea has been reported from North

America (McCune 1984, Wetmore 1995, 2007). New to China and Asia.

SPECIMEN EXAMINED: CHINA. XINJIANG, URuMai CounTY, Nanshan-Bayi Forest farm,

alt. 1775 m, on bark, 26 Jun. 2005, J.Z. Zhao 20116843A (SDNU).

ComMENTs — Caloplaca parvula resembles C. atrosanguinea in corticolous

habitat and dark colored epihymenium but is distinguished by K- epihymenium

and tissues and ascospores with a very narrow (1-1.5 um) isthmus (McCune

1984). Caloplaca floridana and C. pollinii resemble C. atrosanguinea in

corticolous habitat and the K+ purple epihymenium. However, C. floridana

has an epihymenium without crystals and ascospores with a wider isthmus

(5.5-7 um; Wetmore 1995), and C. pollinii has a patchily yellow-brown

hymenium and four lichen substances (parietin, emodin, fallacinol, fallacinal).

Caloplaca spp. new to China... 313

Caloplaca bogilana Y. Joshi & Hur, The Lichenologist 42: 716 (2010) Fics 6, 7

MorpuHo.oecy — thallus saxicolous, crustose, areolate, grayish-white, glossy,

thick; cortex and medulla with obvious crystals; algal layer even; prothallus

not seen. Apothecia lecanorine, sessile; disc brown to black, epruinose; top

of inner exciple concolorous with disc; amphithecium with obvious crystals;

epihymenium orange-brown, with concolorous crystals; hymenium and

subhymenium hyaline. Ascus 8-spored; ascospores polarilocular, ellipsoid, 10-

FiGurRE 6. Caloplaca bogilana (Cheng 20120490B, SDNU). A: Thallus; B: Even algal layer and

crystals in cortex and medulla; C: Apothecium section; D: Obvious crystals in amphithecium

and orange-brown crystals in epihymenium; E: C+ reaction in epihymenium; F: K+ reaction in

epihymenium. Scale bars: A = 500 um; B = 50 um; C-F =20 um.

314... Zhou &al.

aloes lel Teele a

314 i

mee

cm1

nit

254 nm 365nm = sunlight 365nm

before acid after acid and heating

FiGurE 7 Caloplaca bogilana (Cheng 20120490B, SDNU). A: 8-spored ascus; B: Polarilocular

ascospores; C: Long ellipsoid conidia; D: Simple to branched paraphyses; E: TLC result. Scale bars

= 10 um.

12.5 x 4.0-6.3 um, isthmus 3.5-5.0 um; paraphyses simple to branched at the top.

Pycnidia numerous, ostiole black; conidia long ellipsoid, 3.0—4.5 x 1.1-1.6 um.

CHEMISTRY — Epihymenium K+ red, C+ red; amphithecium and top of

inner exciple K-, C-. Thallus and medulla K+ yellow, C+ red, KC+ red, P-.

Secondary metabolites: atranorin, gyrophoric and lecanoric acids, + parietin.

DISTRIBUTION — Caloplaca bogilana has been reported previously only

from coastal areas of Bogil Island in South Korea (Joshi 2010), while we found

it from both coastal and inland areas in China.

Caloplaca spp. new to China... 315

SPECIMENS EXAMINED: CHINA. LIAONING, BerPIAo city, Mt. Dahei, alt. 1300 m, on

rock, 14 Aug. 2011, Y.L. Cheng 2012490B (SDNU), 20120489B (SDNU); SHANDONG,

YANTAI CITY, Mt. Kunyu, alt. 400 m, on rock, 12 Jun. 2010, Y.L. Cheng 20128005

(SDNU).

ComMENTS — Caloplaca subleptozona resembles C. bogilana in having an

areolate thallus and atranorin but differs in its biatorine apothecia with pruinose

discs and UV+ thallus.

Caloplaca conversa (Kremp.) Jatta, Syll. Lich. Ital.: 254 (1900) Fics 8, 9

MorpHo.oey — Thallus saxicolous, crustose, ivory-white to grayish-white,

areolate, pruinose; cortex and medulla with obvious crystals; algal layer even;

FiGurE8. Caloplaca conversa (Wang 20122965, SDNU). A: Thallus; B: Pruina and apothecia in

thallus, showing; C: Even algal layer and crystals in cortex and medulla. Scale bars: A = 2 mm;

B = 400 um; C = 100um.

316... Zhou &al.

FiGuRE 9. Caloplaca conversa (Wang 20122965, SDNU). A: Apothecium section; B: Crystals in

amphithecium; C: K+ reaction in epihymenium, amphithecial cortex, and top of inner exciple;

D: C+ reaction in epihymenium, amphithecial cortex, and top of inner exciple; E: Simple paraphyses

with 4--6 swollen apical cells; F: 8-spored ascus; G: Polarilocular ascospores; H: Pyriform conidia.

Scale bars: A, B = 50 um; C, D = 20 um; E-H = 10 um.

prothallus not seen. Apothecia lecanorine, immersed or adnate; disc black,

epruinose; inner exciple black at the top; amphithecium with obvious crystals;

epihymenium brown, without crystals; hymenium and subhymenium hyaline.

Ascus 8-spored; ascospores polarilocular, ellipsoid, 10-15 x 4-6.5 um, isthmus

2-4.5 um (Fics 9F, G); paraphyses simple, with 4-6 swollen apical cells. Pycnidia

present, ostiole black; conidia pyriform, 3-4 x 2-2.5 um.

Caloplaca spp. new to China... 317

CHEMISTRY — Epihymenium, top of inner exciple, and amphithecial cortex

K+ weakly purple, C+ purple. Thallus and medulla K-, C-, KC-, P-. Secondary

metabolites: no lichen substances detected by TLC.

DISTRIBUTION — Caloplaca conversa has been reported from Europe, North

America, and Hong Kong, China (Aptroot & Seaward 1999, Breuss 1988,

Wetmore 1995, 2007). New to northern China.

SPECIMENS EXAMINED: CHINA. INNER MONGOLIA, Ba Yan Hot, Mt. Helan, alt. 1500

m, on rock, 19 Aug. 2011, H.Y. Wang 20122965 (SDNU), 20122520 (SDNU); 19 Aug.

2011, P.M. Wang 20123717 (SDNU), 20123333 (SDNU); alt. 1800 m, on rock, 19 Aug.

2011, H.Y. Wang 20123141B (SDNU); alt. 2000 m, on rock, 19 Aug. 2011, D.B. Tong

20123046 (SDNU); Wulate Hougi, Mt. Helan, alt. 1600 m, on rock, 16 Aug. 2011, D.B.

Tong 20123522 (SDNU), 20122837 (SDNU), 20122460 (SDNU), 20123568 (SDNU),

20123471 (SDNU); 17 Aug. 2011, P.M. Wang 20123635 (SDNU), 20123618 (SDNU),

20123902B (SDNU), 20123109 (SDNU); 17 Aug. 2011, X.R. Kou 20123673 (SDNU); alt.

1700 m, on rock, 17 Aug. 2011, X. R. Kou 20123898 (SDNU), 20123676 (SDNU); Wulate

Hougi, Mt. Hebashige, alt. 1600 m, on rock, 16 Aug. 2011, H.Y. Wang 20123003 (SDNU),

20123017 (SDNU), 20122966 (SDNU), 20123977 (SDNU), 20123518A (SDNU).

ComMENTs — Caloplaca alociza and C. chalybaea resemble C. conversa in

black sunken apothecia. However, C. alociza has + immersed thallus and larger

ascospores (15-18 x 7-8 um) (Wilk & Flakus 2006), while C. chalybaea has a

black-brown to lead-grey thallus with conspicuous black prothallus and mature

apothecia with blue pruina. The also similar C. conciliascens differs in having an

indistinct thallus, lecideine apothecia with brownish red discs, and a blackish

green top of inner exciple.

Caloplaca diphyodes (Nyl.) Jatta, Syll. Lich. Ital.: 259 (1900) Fics 10, 11

MorpHo.ocy — ‘thallus saxicolous, crustose, off-white, areolate; cortex

with somewhat crystals; medulla with obvious crystals; algal layer even;

prothallus not seen. Apothecia lecanorine, sessile; disc black, epruinose; inner

exciple black at the top; amphithecium with obvious crystals; epihymenium

dark brown, without crystals; hymenium and subhymenium hyaline. Ascus

8-spored; ascospores polarilocular, ellipsoid, 12.5-15 x 6-8 um, isthmus 3-4

um; paraphyses simple, with 3-6 swollen apical cells. Pycnidia present, usually

on marginal areoles, ostiole black, margin white; conidia filiform, 15—17.5x

0.6—0.7 um.

CHEMISTRY — Epihymenium, top of inner exciple, and amphithecial cortex

K+ purple, C+ weakly purple. Thallus and medulla K-, C-, KC-, P-. Secondary

metabolites: no lichen substances detected by TLC.

DISTRIBUTION — Caloplaca diphyodes has been reported from Europe

(Coste 2005, Magnusson 1937). New to China and Asia.

SPECIMENS EXAMINED: CHINA. INNER MONGOLIA, Ba Yan Hot, Mt. Helan, alt. 1300m,

on rock, 19 Aug. 2011, H.Y. Wang 20122508 (SDNU), 20122519 (SDNU), 20122615

318 ... Zhou & al.

Figure 10. Caloplaca diphyodes (Wang 20122508, SDNU). A: Thallus; B: Even algal layer and

crystals in cortex and medulla; C: Apothecium section; D: Crystals in amphithecium; E: K+ reaction

in epihymenium, amphithecial cortex, and top of inner exciple; F: C+ reaction in epihymenium,

amphithecial cortex, and top of inner exciple. Scale bars: A = 2 mm; B-F = 20 um.

(SDNU), 20122664A (SDNU), 20123015A (SDNU), 20123253 (SDNU); 19 Aug. 2011,

P.M. Wang 20123824A (SDNU); 19 Aug. 2011, X.R. Kou 20123879 (SDNU); 19 Aug.

2011, D.B. Tong 20122781A (SDNU).

ComMMENTS — Caloplaca atroalba and C. ursina resemble C. diphyodes in

a nonstipitate areolate thallus and entirely raised black epruinose apothecia.

However, C. atroalba has ascospores with a narrower isthmus (1.5-3 um;

Wetmore 1995), paraphyses with slightly swollen apical cells, and a weakly K+

Caloplaca spp. new to China... 319

FiGurE 11. Caloplaca diphyodes (Wang 20122508, SDNU). A: 8-spored ascus; B: Polarilocular

ascospores; C: Simple paraphyses with 3-6 swollen apical cells; D: Filiform conidia. Scale bars =

10 um.

purple epihymenium while C. ursina has a K- epihymenium and amphithecial

cortex.

Caloplaca pulicarioides Aptroot, Trop. Bryol. 17: 69 (1999) Fig. 12

MorpHo.ocy — ‘Thallus corticolous, crustose, white to greenish white,

areolate; cortex with indistinct crystal; medulla with obvious crystals; algal

layer even; prothallus not seen. Apothecia lecanorine, adnate to immersed; disc

brown to red-brown, epruinose; top of inner exciple concolorous with disc;

amphithecium with obvious crystals; epihymenium brown, without crystals;

hymenium and subhymenium hyaline. Ascus 8-spored; ascospores polarilocular,

ellipsoid, 7.5-10 x 4-5 um, isthmus 1.5-2.5 um; paraphyses simple to branched

at the top, without swollen cells. Pycnidia present, numerous, ostiole brown to

red-brown; conidia bacilliform, 2.5—-3.5 x 0.8-1.2 um.

CHEMISTRY — Epihymenium, top of inner exciple, and amphithecium

K-, C-. Thallus and medulla K-, C-, KC-, P-. Secondary metabolites: two

unknown substances (S-1, S-2) detected by TLC.

DISTRIBUTION — Caloplaca pulicarioides has been reported from Africa and

Hong Kong, China (Aptroot & Seaward 1999, Seaward & Aptroot 2003). New

to northern China.

SPECIMENS EXAMINED: CHINA. SHANDONG, RONGCHENG COUNTY, Mt. Chengshan,

alt. 50 m, on bark, 20 Jul. 2011, L. Li 20116198 (SDNU), 20127916 (SDNU), 20116529

(SDNU), 20116525A (SDNU), 20116544A (SDNU), 20116630A (SDNU); 20 Jul. 2011,

H.Y. Wang 20116103A (SDNU), 20116537A (SDNU), 20116538B (SDNU), 20116534A

(SDNU), 20116533 (SDNU), 20116532 (SDNU), 20116199 (SDNU), 20116535

(SDNU); Yantai city, Mt. Kunyu, alt. 300 m, on bark, 9 Jun. 2010, Y.L. Cheng 20127923

(SDNU).

ComMMENTS — Caloplaca pulicarioides superficially resembles species of the

Lecanora pulicaris-group, but its polarilocular ascospores place it in Caloplaca.

320 ... Zhou & al.

254 nm 365nm sunlight 365nm

before acid after acid and heating

Ficure 12. Caloplaca pulicarioides (Li 20116198, SDNU). A: Thallus; B: Even algal layer and crystals

in cortex and medulla; C: Apothecium section; D: Crystals in amphithecium; E: 8-spored ascus;

F: Polarilocular ascospores; G: Simple to branched paraphyses without swollen cells; H: Bacilliform

conidia; I: TLC result (S-3 = Atranorin; S-4 = Norstictic acid). Scale bars: A = 500 um; B = 50 um;

C, D = 20 um; E-H = 10 pm.

Caloplaca spp. new to China... 321

The morphologically similar C. homologa and C. trilocularis differ in their

consistently 3-loculate ascospores.

Caloplaca variabilis (Pers.) Mill. Arg., Mém. Soc. Phys. Hist. nat. Genéve 16(2): 387

(1862) Fics 13, 14

MorpHo.oey — Thallus saxicolous, crustose, gray to blackish gray, partly

stipitate areolate; cortex with crystals in some places; medulla with crystals;

algal layer clustered; prothallus not seen. Apothecia lecanorine, sessile, round

FiGurRE 13. Caloplaca variabilis (Wang 20124114, SDNU). A: Thallus; B: Apothecial margin with

thick pruina; C: Clustered algal layer and crystals in cortex and medulla. Scale bars: A = 2 mm;

B = 250 um; C = 50 um.

322%. Zhourecal.

mm Cpa» ane

FicurE 14. Caloplaca variabilis (Wang 20124114, SDNU). A: Apothecium section; B: Crystals

in amphithecium; C: K+ reaction of epihymenium and top of inner exciple; D: C+ reaction of

epihymenium and top of inner exciple; E: 8-spored ascus; F: Polarilocular ascospores; G: Simple

to branched paraphyses with 2-4 somewhat swollen apical cells; H: Pyriform conidia. Scale bars:

A-D = 50 um; E-H = 10 um.

to angular; disc black, sometimes pruinose; top of inner exciple concolorous

with disc; amphithecium with thick pruina, thick algal layer, and crystals;

epihymenium dark brown, without crystals; hymenium and subhymenium

hyaline. Ascus 8-spored; ascospores polarilocular, ellipsoid, 15-20 x 7.5-10

um, isthmus 2-3 um; paraphyses simple to branched at the top, with 2-4

somewhat swollen apical cells. Pycnidia present, numerous, ostiole black;

conidia pyriform, 3—4x 1.5—2 um.

Caloplaca spp. new to China ... 323

CHEMISTRY — Epihymenium and top of inner exciple K+ weakly purple, C+

weakly purple; amphithecium K-, C-. Thallus and medulla K-, C-, KC-, P-.

Secondary metabolites: no lichen substances detected by TLC.

DISTRIBUTION — Caloplaca variabilis has been reported from Asia, Europe,

and North America (Fryday 2004, Wetmore 1995, 2007, Yazici et al. 2008). New

to China.

SPECIMEN EXAMINED: CHINA. SHANXI, NINGWU counrTy, Mt. Luya, alt. 2500 m, on

rock, 26 Aug. 2011, H.Y. Wang 20124114 (SDNU).

CoMMENTS — Caloplaca atroalba, C. diphyodes, and C. ursina resemble

C. variabilis but differ in their nonstipitate areolate thalli and non-pruinose

apothecia. Caloplaca atroalba and C. diphyodes have even algal layers, and

C. atroalba is further distinguished by ascospores with a poorly formed isthmus.

Caloplaca ursina has a K- epihymenium and thallus cortex.

Acknowledgements

This present study was supported by the National Natural Science Foundation

of China (31070010), and the Natural Science Foundation of Shandong Province

(ZR2010CQ038). We are grateful to Dr. A. Aptroot (ABL Herbarium, Soest, the

Netherlands) and Dr. Shou-Yu Guo (State Key Laboratory of Mycology, Institute of

Microbiology, Chinese Academy of Sciences, Beijing, China) for presubmission reviews.

We especially thank Dr. A. Aptroot for assistance in specimen identification.

Literature cited

Abbas A, Wu J, Jiang Y. 1996. Five lichen species new to China. Acta Mycologica Sinica 15(3):

232-233.

Aptroot A, Seaward MRD. 1999. Annotated checklist of Hongkong lichens. Tropical Bryology 17:

57-101.

Arocena JM, Zhu LP, Hall K. 2003. Mineral accumulations induced by biological activity on granitic

rocks in Qinghai Plateau, china. Earth Surface Processes and Landforms 28(13): 1429-1437.

http://dx.doi.org/10.1002/esp.591

Coste C. 2005. Lichens et communautés lichéniques hydrophiles et subhydrophiles saxicoles-

calcifuges du département du Tarn (France). Bulletin de la Société Botanique du Centre Ouest

36: 577-596.

Breuss O. 1988. Neue und bemerkenswerte Flechtenfunde aus Tenerife (Kanarische Inseln). Linzer

Biologische Beitrage 20(2): 829-845.

Fryday AM. 2004. A new species of Fuscopannaria with a green photobiont, and other taxonomic

innovations and new records of lichenized-fungi from Alaska. Bryologist 107(2): 173-179.

http://dx.doi.org/10.1639/0007-2745(2004)107[0173:ANSOFW]2.0.CO;2

Joshi Y, Wang XY, Yamamoto Y, Koh YJ, Hur JS. 2010. A first modern contribution to Caloplaca

biodiversity in South Korea: two new species and some new country records. Lichenologist

42(6): 715-722. http://dx.doi.org/10.1017/S00242829 10000368

Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the fungi, 10th edition. Cromwell

Press, Townbridge, UK.

Magnusson AH. 1937. New or interesting Swedish lichens IX (no. 76-88). Botaniska Notiser. 1937:

124-140.

324 ... Zhou & al.

McCune B. 1984. Lichens with oceanic affinities in the Bitterroot Mountains of Montana and Idaho.

Bryologist 87: 44-50. http://dx.doi.org/10.2307/3242881

Orange A, James PW, White FJ. 2010. Microchemical Methods for the Identification of Lichens.

2nd edition. London: British Lichen Society.

Poelt J, Pelleter U. 1984. Zwergstrauchige Arten der Flechtengattung Caloplaca. Plant Systematics

and Evolution 148: 51-88. http://dx.doi.org/10.1007/BF00984570

Seaward MRD, Aptroot A. 2003. Lichens of Silhouette Island (Seychelles). Bibliotheca Lichenologica

86: 423-439,

Sechting U, Olecha M. 1995. The lichen genus Caloplaca in polar regions. Lichenologist 27:

463-471. http://dx.doi.org/10.1016/S0024-2829(95)80006-9

Wei JC 1991. An enumeration of lichens in China. International Academic Publishers, Beijing.

313 p.

Wetmore CM. 1995 [“*1994”]. The lichen genus Caloplaca in North and Central America with

brown or black apothecia. Mycologia 86(6): 813-838. http://dx.doi.org/10.2307/3760596

Wetmore CM. 2007. Caloplaca. 179-220, in: TH Nash III et al. (eds). Lichen Flora of the Greater

Sonoran Desert Region. Vol. III. Lichens Unlimited, Arizona State University, Tempe.

Wilk K, Flakus A. 2006. Four species of Caloplaca (Teloschistaceae, lichenized Asocmycota) new to

Poland. Mycotaxon 96: 61-71.

Xahidin H, Abbas A, Wei J. 2010. Caloplaca tianshanensis (lichen-forming Ascomycota), a new

species of subgenus Pyrenodesmia from China. Mycotaxon 114: 1-6.

http://dx.doi.org/10.5248/114.1

Yazic1 K, Aptroot A, Etayo J, Aslan A, Guttova A. 2008. Lichens from the Batman, Mardin,

Osmaniye, and Sivas regions of Turkey. Mycotaxon 103: 141-144.

Zhao ZT, Sun LY. 2002. Three new records of the lichen genus Caloplaca from China. Mycosystema

21(1): 135-136.

MY COTAXON

http://dx.doi.org/10.5248/122.325

Volume 122, pp. 325-332 October-December 2012

Boletus atlanticus sp. nov., a new species of section Luridi

from coastal dunes of NW Spain

JAIME B. BLANCO-DIOS' & GUILHERMINA MARQUES?

‘Centro de Formacion e Experimentacion Agroforestal de Lourizan,

Conselleria de Medio Rural, Xunta de Galicia, P.O. Box 127, 36080 Pontevedra, Spain

? CITAB- Universidade de Trds-os-Montes e Alto Douro, Departamento de Agronomia,

5000-801 Vila Real, Portugal

CORRESPONDENCE TO: 'jbblancodios@gmail.com, *gmarques@utad. pt

ABSTRACT—Boletus atlanticus, found in coastal sand dunes in Galicia (NW of Spain) under

Cistus salviifolius and maritime pines (Pinus pinaster), is described as a new species from

section Luridi based on morphology. Morphological description, drawings of microscopic

characters, and color pictures of the basidiomata are presented. A discussion about other

close taxa of section Luridi is also outlined.

Key worps— Basidiomycota, Boletales, taxonomy, Iberian Peninsula, Europe

Introduction

Mycological studies carried out in recent decades in the dunes ecosystems

of Galicia (NW of Spain, Iberian Peninsula) along the Atlantic coast in sand-

dominated areas with natural coastal vegetation and forested mainly with

maritime pine (Pinus pinaster Aiton) have revealed several new species to

science, including Gyroporus ammophilus (Castro & Freire 1989, 1995),

Agaricus freirei (Blanco-Dios 2001), and Leucocoprinus castroi (Blanco-Dios

2003). Recently, in tertiary or gray dunes with vegetation dominated by Cistus

salviifolius L. (Cistaceae) and a few maritime pines, several specimens of a

Boletus species were collected. We determined from a detailed morphological

study that the specimens belong in sect. Luridi Fr. based on their orange pores

and variable blueing of the exposed yellow flesh.

After extensively reviewing the European and extra-European species

of section Luridi, we concluded that this taxon does not correspond to

any previously described species and describe it as a new species: Boletus

atlanticus.

326 ... Blanco-Dios & Marques

Materials & methods

The specimens were collected, documented and preserved using standard methods.

Morphological descriptions are based on fresh material and analysis of photographs of

fresh specimens. Microscopic observations were recorded both from fresh material and

dried specimens rehydrated in 3% KOH. We used a solution of 1% Congo Red in water

to observe cystidia (pleuro-, cheilo-, and caulocystidia) and Melzer’s reagent to examine

basidiospores, pileipellis and stipitipellis. Spore size is presented as (Min)(mean - SD)-

(mean + SD)(Max), where Min = the lowest value measured, Max = the highest value,

followed by the mean spore lengths and widths (Xm); Q = spore length : width ratios;

and the mean volume (Vm) was determined using the formula Vm = 41/3 a’b, where a is

the radius of the minor axis and b the radius of the major axis (Breitenbach & Kranzlin

1991).

The maximum and minimum values and the length/width ratio (Q) of the pileipellis

terminal cells were determined by sampling between the centre and the margin

(Ladurner & Simonini 2003) in the superior layer of young sporocarps, as recommended

by Singer (1965) and Mufioz (2005). Microscopical structures were documented by

color microphotographs and line drawings on a light microscope equipped with a

digital camera and a drawing tube device. The collected material has been deposited in

the mycological herbarium LOU-Fungi (Centro de Investigacién Forestal de Lourizan,

Pontevedra, Spain).

Taxonomy

Boletus atlanticus Blanco-Dios & G. Marques, sp. nov. PLATE 1, FIG. 1

MycosBank MB 803460

Boletus luridus similis sed differt pileo ab rosaceo ad aurantiaco vel flavo et margo cremeo,

pori primum aurantiaco et ochraceo, denique aurantiaco-ferrugineo, stipes ut cuticula

flava, nisi in inferiore tertio, purpureo-rubro, sporis leviter plus grandis, caulocystidiis

multiformis.

Type: Spain, A Corufia, Santa Uxia de Ribeira, Aguifio, near of Penisqueira beach,

29TMH9708, 10 m, in tertiary or gray dunes, under Cistus salviifolius and Pinus pinaster,

29.X.2005, leg. F. Romano, J. Sampedro, A. Sampedro & J.B. Blanco-Dios (Holotype,

LOU-Fungi 19418).

Erymo oy: the species epithet refers to the Atlantic Ocean coast of NW Spain where

the specimens were found.

PiLEus 65-155 mm broad, hemispheric to convex in age, smooth, glabrous,

slightly viscid in wet weather; more intensely coloured when young, ranging

from pink to orange on the disc, fading with age, becoming light brown on

the disc and with various shades of pink, orange and yellow toward the cream

colored margin, margin undulate and slightly projecting. When bruised, pileus

surface changes to deep blue, greyish blue or greenish and, finally, to black

blue. HYMENOPHORE tubulose, tubes 8-15 mm long, adnate, yellow, changing

to blue slowly when bruised or exposed. Pores small, compressed, oval (more

abundant, 0.4-0.7 mm per pore) or triangular (less numerous and larger,

Boletus atlanticus sp. nov. (Spain) ... 327

Pate. 1. Boletus atlanticus (holotype). Habit.

Photo by Jaime B. Blanco-Dios.

1.2-1.4 mm per pore), pale orange to yellow ochre when young, becoming

orange to rust at maturity, staining intense greenish gray when handled. STIPE

60-130 x 15-55 mm, usually shorter than the diameter of the pileus, attenuate,

napiform or fusiform, bright yellow except in the basal third that is reddish to

purple, with a long and irregular orange reticulum, except in the upper portion

of the stipe (1-2 cm long) where the reticulum is yellow and very fine. Stipe

surface changes to blue or grayish blue when bruised. ConTExtT firm, soft at

maturity, yellow, changing to blue, grayish blue or greenish blue when exposed,

except in the lower part where garnet and purple colours dominate. SMELL

agreeable, more intense in the pileus, generally not distinctive or, sometimes,

with garlic smell. TasTE agreeable with unctuous texture. Edibility unknown.

CHEMICAL REACTIONS: Melzer’s reagent: positive in the flesh (deep blue); formol

(35%): grayish-blue in the pileus, pores and stipe, almost not visible in the flesh;

FeSO4 (10%): gray to greenish in the pileus, stipe and flesh, predominantly gray

in the pores. SPORE PRINT deep olive-brown.

BASIDIOSPORES (10.5-)11.5-14(-15.5) x (4.5-)5.2-6.7(-7.3) um, Xm =

12.7 x 6 um, Q = 1.6-2.6(-3), Vm = 240 um’, (n = 100), ellipsoid to fusoid,

smooth, guttulate, thick-walled, ochre gray in 3% KOH, dextrinoid in Melzer’s.

BASIDIA 20.5-35 x 5.5-14.5 um, 4-spored, rarely 2-spored, sterigmata 2.5-3.5

328 ... Blanco-Dios & Marques

L>O

cee YE

A I

;

a a ae

Fic. 1. Boletus atlanticus (holotype).

a. basidiospores; b. basidia; c. cheilocystidia; d. caulocystidia; e. pileipellis. Scale bars = 10 um.

Boletus atlanticus sp. nov. (Spain) ... 329

um long, clavate, numerous basidioles. CHEILOCYSTIDIA AND PLEUROCYSTIDIA

18-37 x 6.5-13 um, smooth and thin-walled, clavate or sphaeropedunculate,

ochre, brown, orange to gray in 3% KOH. PILEIPELLis a trichoderm consisting

of interwoven hyphae 2.5-7 um broad, long, subcylindric, septate, thin-walled,

with brown or gray-brown intracellular pigment in 3% KOH and ochre or

ochre-gray in Melzer’s; terminal cells 33.5-73 x 4-7.5 um, Q = 5.3-12.7, long,

subcylindric to subfusiform with a rounded or acuminate apex. STIPITIPELLIS

consisting of interwoven hyphae 1.5-6.5 um wide, ochre, brown to gray in 3%

KOH and in Melzer’s. CAULOBASIDIA 24.5-55.5 x 6.5-17 um, 4-spored, rarely

2-spored, sterigmata 3-6 um long, clavate. CAULOCYSTIDIA 28.5-52.5 x 10-21

um, smooth and thin-walled, versiform: clavate, fusiform-capitate, lageniform,

sphaeropedunculate, pyriform-mucronate or urceolate, ochre, brown, orange

to gray in 3% KOH. Basa HYPHAE of stipe with a strong positive reaction

amyloid. No CLAMP CONNECTIONS observed.

ECOLOGY AND DISTRIBUTION- On coastal sand dunes under Cistus salviifolius

and maritime pines (Pinus pinaster). Known only froma single locality in Spain.

October-November.

ADDITIONAL COLLECTIONS EXAMINED: SPAIN: A CORUNA: SANTA UxiA DE RIBEIRA,

Aguifio, near of Penisqueira beach, 29TMH9708, 10 m, in tertiary or gray dunes,

under Cistus salviifolius and Pinus pinaster, 28.X.2005, leg. EF Romano, J. Sampedro

& A. Sampedro (LOU-Fungi 19417); 5.X1.2005, leg. J.B. Blanco-Dios, E.M. Boullosa,

I.M. Blanco-Boullosa & M.E Blanco-Boullosa (LOU-Fungi 19419); 11.X1.2008, leg. J.B.

Blanco-Dios (LOU-Fungi 19434).

COMMENTS. Possession of orange pores and flesh changing to blue with variable

intensity when sectioned places Boletus atlanticus in section Luridi (Mufioz

2005). This new species is morphologically characterized by a combination of

(1) pileus color variably pink, orange, salmon, and yellow with a cream margin,

(2) ovoid or triangular pores, (3) bright yellow stipe with the basal third reddish

to purple and covered by an orange reticulum from apex to base except at the

top of the upper yellow portion, (4) stipe context varying from garnet to purple

in the basal third to half or basal third, (5) the pileus, stipe, and flesh staining

gray to green (gray in the pores) with FeSO, (6) habitat in coastal dunes under

Cistus salviifolius and Pinus pinaster, (7) spore Q = 1.6-2.6(-3) and Vm = 240

um’, and (8) versiform caulocystidia.

Among the morphologically similar species in sect. Luridi with a similarly

colored pileus, orange or red pores, stipe with or without reticulum, and context

bluing quickly and intensely when bruised or exposed, the closest European

taxa are B. comptus Simonini, B. luridus Schaeff. s.1., B. luteocupreus Bertéa &

Estadeés, and B. rhodopurpureus Smotl. f. rhodopurpureus.

Boletus comptus differs from B. atlanticus in pileus color (variably gray,

brown, pink, red, orange, and yellow), reticulum absent or limited to the stipe

apex (and then variably yellow, orange, red, and brown), the basal stipe punctate

330 ... Blanco-Dios & Marques

with reddish brown spots, red mature pores, exposed flesh reddening (and then

only on the stipe) or not changing color, and habitat in Quercus spp. forests.

Microscopically, the basidiospores of B. comptus are smaller ((9.5-)10.5-13.1

(-14.8) x (4.3-)4.8-5.9(-6.5) um) and the caulocystidia are predominantly

pyriform or clavate (Simonini 1992, Mufoz 2005, Péric & Péric 2006).

Boletus atlanticus should also be compared with B. luridus s.1., widespread

in Europe and also reported for Africa, Asia and North America (Smith &

Thiers 1971, Thiers 1975, Both 1993, Zang 1999, Bessette et al. 2000, Binder &

Hibbett 2004, Mufioz 2005), which differs in pileus color (predominantly ochre

and brown in var. luridus; red in var. rubriceps (Maire) Dermek; and orange or

ochre-orange in var. queletiformis J. Blum), red pores, a red reticulum restricted

to 2/3 of the stipe, and orange-red flesh that is red-purple only at the stipe

base and fades to yellow-olive after exposure. Boletus luridus, a typical species

from broad-leaved forests in calcareous soils, also differs microscopically in its

slightly smaller spores [(12-)12.3-13.9(-14.2) x 5-5.9(-6.4) um], caulocystidia

that are fusiform, utriform, or lageniform, and a pileipellis composed of short

end cells (Mufioz 2005).

Boletus luteocupreus has a chrome-yellow pileus (sometimes with pinkish

tones) becoming ochre-orange with age, a delayed (a few hours) red-coppery or

brown-coppery staining reaction, variably reddish pores, a yellow-orange stipe

that is red or red-carmine toward the base and almost completely covered with

a blood-red reticulum, an association with deciduous forests in acidic soils,

smaller spores [(10.4-)10.9-12.3(-12.9) x 4.5-5.3(-5.9) um], and fusiform or

lageniform caulocystidia (Mufioz 2005).

Boletus rhodopurpureus f. rhodopurpureus, known also in Asia (Zang 1999;

Binder & Hibbett 2004), is distinguished by a pink, purple to red vinaceous

pileus, sporocarps with red pores when young and red-orange in age (except at

the yellow-orange margin), a yellow or yellow-orange stipe that is red-orange

toward the base with garnet or red purple context only at the base and with a red

fine reticulum limited to the apex, and a habit in broad-leaved forests (mainly

Quercus spp.) in acidic soils. It is differentiated microscopically by smaller

spores (11.8-13.6(-14.2) x (4.8-)5.1-5.7(-6) um), and fusiform caulocystidia

(Mufioz 2005).

Among extra-European taxa, B. atlanticus is morphologically similar to B.

floridanus (Singer) Murrill and B. sinicus W.F. Chiu.

Boletus floridanus, reported from North and Central America (from North

Carolina and Tennessee, south to Florida, Texas, Mexico, and Belize), is

characterized by a grayish-red, intense red to vinaceous pileus, yellow tubes

with red pores, a red markedly reticulated stipe, pale to bright yellow context,

a habit in broad-leaved (especially oak) forests, and longer narrower spores

(12.8-18 x 4-5.6 um) (Both 1993; Bessette et al. 2000, 2007; Ortiz et al. 2007).

Boletus atlanticus sp. nov. (Spain) ... 331

Boletus sinicus, described from Yunnan (China), has a fibrillose scaly garnet

brown pileus, deep red pores, a concolorous (or apically yellow) stipe reticulated

with prominent red veins, white or yellowish flesh, and smaller spores (7.5-11

x 4.5-5.5 um) (Chiu 1948, 1957; Wang et al. 2004).

Acknowledgements

We would like to thank the Sampedro Romano family (Fina, José, and Alfonso)

(Aguifio, Spain) for sending us the first specimens. The authors are grateful to Drs

Ernst E. Both (deceased) and Xiang-Hua Wang for kindly sending relevant literature.

Drs. Beatriz Ortiz-Santana and Timothy J. Baroni are thanked for critically reviewing

an earlier draft of this paper. Amancio Castro is gratefully acknowledged for technical

assistance. Finally we express the most sincere thanks to the direction and members of

the Centro de Investigacion Forestal de Lourizan (Conselleria de Medio Rural, Xunta de

Galicia) for conserving the herbarium LOU-Fungi.

Literature cited

Bessette AE, Roody WC, Bessette AR. 2000. North American boletes. A color guide to the fleshy

pored mushrooms. Syracuse University Press, New York, USA. 400 pp.

Bessette AE, Roody WC, Bessette AR, Dunaway DL. 2007. Mushrooms of the southeastern United

States. Syracuse University Press, New York, USA. 373 pp.

Binder M, Hibbett D. 2004 Toward a global phylogeny of the Boletales.

www.clarku.edu/faculty/dhibbett/boletales_stuff/Boletales_Target_list_2004.doc

Blanco-Dios JB. 2001. Agaricales des dunes de Galice (Nord-Ouest de Espagne) I: Agaricus freirei,

sp. nov. Doc. Mycol. 31 (121): 27-34.

Blanco-Dios JB. 2003. Estudios sobre el género Leucocoprinus Pat. en la Peninsula Ibérica (II).

Leucocoprinus castroi, sp. nov. Revista Catalana de Micologia, 25: 41-47.

Both EE. 1993. The boletes of North America. A compendium. Buffalo Museum of Science. Buffalo,

New York. 436 pp.

Breitenbach J, Kranzlin F. 1991. Champignons de Suisse. Tome 3. 364 pp.

Castro ML, Freire L. 1989. Gyroporus castaneus (Bull: Fr.) Quél. var. ammophilus Castro et Freire,

var. nov. Anales Jard. Bot. Madrid 45(2): 549.

Castro ML, Freire L. 1995. Gyroporus ammophilus, a new poisonous bolete from the Iberian

Peninsula. Persoonia 16(1): 123-126.

Chiu WE. 1948. The boletes of Yunnan. Mycologia 40: 199-231.

Chiu WE. 1957. Atlas of the Yunnan boletes. Beijing: Science Press. 154 pp.

Ladurner H, Simonini G. 2003. Xerocomus s.l. Fungi Europaei 8. 527 pp.

Mufioz JA. 2005. Boletus s.l. (excl. Xerocomus): Strobilomycetaceae, Gyroporaceae, Gyrodontaceae,

Suillaceae, Boletaceae. Fungi Europaei 2 [2nd edition]. 952 pp.

Ortiz-Santana B, Lodge DJ, Baroni TJ, Both EE. 2007. Boletes from Belize and the Dominican

Republic. Fungal Diversity 27: 247-416.

Péric B, Péric O. 2006. Boletus comptus Simonini, primo ritrovamento nel Montenegro e ulteriore

delimitazione della variabilita cromatica. Rivista di Micologia 49(3): 235-242.

Simonini G. 1992. Boletus comptus sp. nov. Rivista di Micologia. 35(3): 195-208.

Singer R. 1965. Die Rohrlinge, Teil I. Die Boletaceae. Die Pilze Mitteleuropas, Band V. 131 pp +

21 pl.

332 ... Blanco-Dios & Marques

Smith AH, Thiers HD. 1971. The boletes of Michigan. University of Michigan Press, Ann Arbor.

428 pp.

Thiers HD. 1975. California mushrooms. A field guide to the boletes. Hafner Press, New York. 261

PPp-

Wang X, Liu P, Yu F. 2004. Color atlas of wild commercial mushrooms in Yunnan. Yunnan Science

and Technology Press. 136 pp.

Zang M. 1999. An annotated check-list of the genus Boletus an its sections from China. Fungal

Science 14(3,4): 79-87.

MY COTAXON

http://dx.doi.org/10.5248/122.333

Volume 122, pp. 333-345 October-December 2012

An efficient protocol for DNA extraction from Meliolales

and the description of Meliola centellae sp. nov.

DANILO B. PINHO’, ANDRE L. FIRMINO’,

WALNIR G. FERREIRA-JUNIOR? & OLINTO L. PEREIRA”

‘Departamento de Fitopatologia, Universidade Federal de Vicosa &

?Departamento de Botanica, Universidade Federal de Vicosa,

Vigosa CEP 36570-000 Minas Gerais Brazil

* CORRESPONDENCE TO: oliparini@ufv.br

ABSTRACT — ‘The first black mildew fungus associated with Apiaceae is collected from

the state of Minas Gerais, Brazil. The new species is described, illustrated, and compared

morphologically with species reported on hosts belonging to the related Araliaceae.

Additionally, two efficient methods for extracting DNA from biotrophic fungi are described.

Phylogenetic 28S rDNA sequence analyses confirm Meliolales as a distinct order within

Sordariomycetes.

Key worps — Ascomycetes, medicinal plant, Meliolaceae, tropical fungi, phylogeny

Introduction

Centella asiatica is a native plant of tropical Asia and commonly grows in

humid areas in many tropical regions. This plant was introduced in Brazil

and grows as a weed in the lawns of gardens in the southern and southeastern

regions (Kissmann & Groth 1999). Brazilian researchers have paid relatively

little attention to fungi associated with C. asiatica. Among the 20 fungal

species described on this host worldwide, only three are reported from

Brazil: Capnodium brasiliense Puttemans, Septoria asiaticae Speg., and Vitalia

setofasciculata Bat. et al. (Farr & Rossman 2012, Mendes & Urben 2012).

During recent surveys of black mildew fungi in Brazil, several species

were recorded on representatives of Anacardiaceae, Asteraceae, Bignoniaceae,

Burseraceae, Euphorbiaceae, Fabaceae (Caesalpinioideae and Papilionoideae),

Piperaceae, and Sapindaceae (Pinho et al. 2009, 2012; Macedo et al. 2010; Silva

et al. 2012). The present work includes the description of a new species collected

on C. asiatica.

334 ... Pinho &al.

Black mildew fungi infect plant species from numerous botanical families and

are widely distributed in the tropics and subtropics (Hansford 1961, Hosagoudar

1996). As these fungi are strictly obligate biotrophs and must interact with

living plant cells for growth and reproduction, they are usually host specific

or have a very narrow host range (Hansford 1961; Hosagoudar 1996). Thus,

attempts to grow species of Meliolales in pure culture have not been successful,

making their DNA extraction challenging (Hansford 1961, Hosagoudar

1996, Vitoria et al. 2010). The development of an efficient protocol for DNA

extraction from this fungal group would allow the taxonomic value of different

morphological characters to be determined and might reveal discriminatory

differences previously overlooked (Saenz & Taylor 1999, Lumbsch & Huhndorf

2007, Rodriguez & Piepenbring 2007, Vitoria et al. 2010).

In the present paper we provide a detailed account of the black mildew

fungus found on C. asiatica and describe it as a new Meliola species based on

its morphology and purported host specificity. In addition, we present two

efficient DNA extraction methods from biotrophic fungi and the phylogenetic

relationship of Meliolales based on 28S rDNA nucleotide sequences.

Materials & methods

Morphology

Centella asiatica plants were found covered with black colonies on both sides of the

leaves during September 2009 in the “Mata da Dendrologia’, a fragment of secondary

tropical seasonal semi-deciduous montane forest, a component of the Brazilian Atlantic

forest in the campus of the Universidade Federal de Vicosa, Vicosa, Minas Gerais, Brazil.

Symptomatic leaves were collected, photographed, and dried in a plant press. Fresh

samples examined under an Olympus SZ40 stereomicroscope were promptly recognized

as a meliolaceous fungus. Representative structures were either scraped with a scalpel or

removed with an adhesive tape and mounted in lactophenol. Slides containing the fungal

structures were examined and photographed under an Olympus BX 51 light microscope

equipped with an Olympus e-volt 330 digital camera. Illustrations were prepared with

a drawing tube and finalized with the method described by Barber & Keane (2007). For

scanning electron microscopy, air-dried material was directly mounted and coated by a

thin layer of gold in a sputter coater (Balzers® model FDU 010) for 2 min. Photographs

were made with a Carl-Zeiss Model LEO VP 1430 scanning electron microscope (SEM).

Biometric data was based on 30 measurements of structures. A representative specimen

was deposited in the local herbarium at the Universidade Federal de Vicosa (Herbarium

VIC).

DNA extraction

To obtain a representative fungal DNA, ca. 50 fertile perithecia of Asteridiella obesa

(Speg.) Hansf., Irenopsis heveae Hansf., Meliola centellae, and M. vernaliae D.B.Pinho &

O.L.Pereira were examined under a stereomicroscope to check for possible contamination

by other fungi. They were removed with the aid of a fine glass needle and placed into

Meliola centellae sp. nov. (Brazil) ... 335

a microcentrifuge tube (1.5 ml) containing 5 ul of double distilled water and stored at

-20°C for later use. Total genomic DNA was extracted by using Wizard’ Genomic DNA

Purification Kit (Promega Corporation, WI, U.S.A.) with some adjustments as follows:

Fungal samples were processed by freezing the sample with liquid nitrogen and

grinding it into a fine powder using a microcentrifuge tube pestle. The crushing continued

after adding 100 ul Nuclei Lysis Solution + 100 mg polyvinylpyrrolidone. After 500 ul

of the same solution was added, the sample mixture was vortexed at high speed for 3-5

seconds to wet the tissue. The samples were incubated at 65°C for 15 minutes. After the

solution was cooled at -20°C for 5 min, 200 ul Protein Precipitation Solution was added,

mixed in a vortex at high speed for 20 seconds, and centrifuged for 10 min at 14000 rpm.

The supernatant (about 600 ul) containing the DNA was transferred to a clean 1.5 mL

microcentrifuge tube containing 600 ul of cold isopropanol. The solution was mixed by

inversion until thread-like DNA strands formed a visible mass and then stored at -20°C

for 24 hours. The next day the solution was centrifuged at 14000 rpm for 5 min, and the

supernatant was discarded. 600 ul cold ethanol was added to the pellet and centrifuged

at 14000 rpm for 5 min. This ethanol step was repeated again to wash the DNA. After

the ethanol was removed, the tube was put upside down over clean towel paper and the

pellet was air dried for 30 min. As a final step, the pellet was re-suspended in 20 ul DNA

Rehydration Solution and 3 ul RNase Solution was added and mixed by inverting the

tube, which was incubated at 37°C for 1 hour. The sample was then stored at —-20°C for

later use.

Direct amplification

For direct amplification of the 28S rDNA, ca. 20 clean (free of mycoparasites) fertile

perithecia were removed using a fine glass needle and placed into a 0.2 ml microcentrifuge

tube containing 3 ul double distilled water (Jaklitsch & Voglmayr 2012). After soaking in

the water, the samples were squashed with a sterile forceps to release their contents and

mixed in a vortex at high speed for 1 min. We also tested the protocol from Vitoria et

al. (2010), replacing 3 yl double distilled water by 3 yl Cell Lysis Buffer (0.05M NaOH,

0.25% [w/v] SDS). The samples were frozen for 15 min at -20°C and thawed in a water

bath at 80°C for 15 min, modifying the protocol in Griffin et al. (2002). This process

was repeated three times using crushed dry ice and thawing in a water bath. When the

solution cooled, the ingredients for PCR reactions were added.

PCR amplification and DNA sequencing

For each 25 ul PCR reaction we used 12.5 ul Dream Taq TM PCR Master Mix 2X

(MBI Fermentas, Vilnius, Lithuania), 1 ul each of 10 uM forward and reverse primers

(Invitrogen, Carlsbad, EUA), 1 ul dimethyl sulfoxide (DMSO, Sigma-Aldrich, St. Louis,

MO, U.S.A.), 5 wl 100x (10 mg/mL) Bovine Serum Albumin (BSA, Sigma-Aldrich,

St. Louis, MO, U.S.A.), 2 ul genomic DNA, and nuclease-free water to bring the total

volume to 25 ul.

Theprimers LROR(5’-ACCCGCTGAACTTAAGC-3 )andLR5(5’-TCCTGAGGGAAACTTCG-

3’) and ITS1 (5’°-TCCGTAGGTGAACCTGCGG-3’) and ITS4 (5’°-TCCTCCGCTTATTGATATGC-

3’) were used to amplify the partial 28S rDNA and ITS, respectively (Vilgalys & Hester

1990, White et al. 1990). Amplifications began with an initial denaturation at 95°C for

5 min, followed by 40 cycles of denaturation at 94°C for 1 min, annealing at 53°C for

336 ... Pinho &al.

TABLE 1. Genbank accession numbers of 28S rDNA sequences derived from strains

used in the phylogenetic analysis.

SPECIES VOUCHER 28S RDNA

Aphysiostroma stercorarium ATCC 62321 AF543792

Apiospora bambusae ICMP 6889 DQ368630

A. setosa ICMP 4207 DQ368631

Appendiculella lozanellae MP3432 DQ508302

Asteridiella sp. 1 PPMP 796 EF094839

Asteridiella obesa VIC31239 JX096809

Balansia henningsiana AEG 96-27A AY545727

Camarops petersii JM1655 AY3 46265

C. tubulina SMH4614 AY 346266

C. ustulinoides SMH1988 AY346267

Ceratocystiopsis manitobensis CW13792 DQ294358

C. minima CMW162 DQ294361

Ceratocystis fimbriata CBS 374.83 AF221009

Chaetosphaeria ovoidea SMH 2605 AFO64641

Claviceps paspali CBS 110.22 U47826

Coniochaeta leucoplaca JONG 54 FJ167399

C. ostrea AFTOL-ID 915 DQ470959

C. velutina UAMH 10912 EU999180

Coniochaetidium savoryi TRTC 51980 AY346276

Cornipulvina ellipsoides — DQ231441

Cryphonectria parasitica CMW 13749 AF277132

Diaporthe phaseolorum CBS 435.87 U47830

Diatrype disciformis CBS 197.49 U47829

Discostroma botan HHUEF 4642 DQ368629

Endomeliola dingleyae PDD 98304 GU138866

Faurelina elongata CBS 126.78 DQ368625

Gelasinospora tetrasperma ATCC 96230 AY346281

Gnomonia ribicola CBS 115443 DQ368626

Grosmannia grandifoliae CMW703 DQ294399

G. penicillata CMW470 DQ294385

Halosarpheia fibrosa JK5132C U46886

Halosphaeria appendiculata CBS 197.60 U46885

Hypocrea pallida GJS89-83 U00740

H. schweinitzii CBS 243.63 U47833

Hypomyces polyporinus CBS 168.89 AF543793

Irenopsis sp. VIC31752 JX096807

Melanochaeta hemipsila SMH 2125 AY346292

Meliola centellae VIC31244 JQ734545

M. variaseta DRJ 54 EFO94840

M. vernaliae VIC31240 JX096808

Nectria cinnabarina IAM 14568 AF193237

Neurospora crassa CBS 709.71 AY681158

Ophiostoma lunatum CMW10564 DQ294355

O. nigrocarpum CMW651 DQ294356

O. piliferum CBS129.32 AY281094

Meliola centellae sp. nov. (Brazil) ... 337

TABLE 1, concluded

SPECIES VOUCHER 28S RDNA

O. ulmi CBS 298.87 DQ368627

Plagiostoma euphorbiae CBS 340.78 AF277131

Poroconiochaeta discoidea SANK 12878 AY346297

Pyxidiophora arvernensis AFTOL-ID 2197 FJ176894

Seiridium cardinale ATCC52521 AF382377

Sordaria fimicola CBS 723.96 AF132330

S. macrospora ATCC 36709 AY346301

Valetoniellopsis laxa CBS 191.97 AY015635

Valsa ceratosperma AR3426 AF408387

Valsonectria pulchella SMH1193 AY 346304

Xylaria acuta AFTOL-ID 63 AY544676

X. hypoxylon CBS 499.80 U47841

45s, extension at 72°C for 2 min and a final extension of 7 min at 72°C. PCR products

were analyzed on 2% agarose electrophoresis gels stained with GelRed™ (Biotium Inc.,

Hayward, CA, U.S.A.) in a 1x TAE buffer and visualized under UV light to check for

amplification size and purity. PCR products were purified and sequenced by Macrogen

Inc., South Korea (http://www.macrogen.com). The nucleotide sequences were edited

with the DNA Dragon software (Hepperle 2011). All sequences were checked manually

and nucleotides with ambiguous positions were clarified using primer sequences in both

directions. Obtained sequences were deposited in GenBank (www.ncbi.nlm.nih.gov).

Phylogenetic analysis

For phylogenetic analysis, 28S rDNA sequences from additional species were

retrieved from GenBank (TABLE 1). Consensus regions were compared against GenBank’s

database using Mega BLAST program. The closest hit sequences and representatives of

selected Sordariomycetes (Boliniales, Chaetosphaeriales, Coniochaetales, Diaporthales,

Hypocreales, Meliolales, Microascales, Ophiostomatales, Sordariales, and Xylariales)

were obtained from Genbank (www.ncbi.nlm.gov) to help clarify the phylogenetic

relationship of Meliolales within the class. All sequences were downloaded in FASTA

format and aligned using the multiple sequence alignment program MUSCLE (Edgar

2004) built in MEGA v. 5 software (Tamura et al. 2011). Alignments were checked and

necessary manual adjustments were made. All ambiguously aligned regions within

dataset were excluded from the analysis. Gaps (insertions/deletions) were treated as

missing data. The resulting alignment was deposited in TreeBASE (http://www.treebase.

org/) (accession number $12768).

Bayesian inference (BI) analysis employing a Markov Chain Monte Carlo method

(MCMC) was performed. Before launching BI, the best nucleotide substitution models

were determined with MrMopELTEstT 2.3 (Posada & Buckley 2004). After calculation of

likelihood scores, models were selected according to the Akaike Information Criterion

(AIC). The general time-reversible evolution model (Rodriguez et al. 1990) was used,

including estimation of invariable sites and assuming a discrete gamma distribution

with six rate categories (GTR+1+G). The alignment was phylogenetically analyzed on

CIPRES webportal (Miller et al. 2010) using MrBayes v.3.1.1 (Ronquist & Huelsenbeck

338 ... Pinho & al.

Coniochaetidium savoryi

oo Poroconiochaeta discoidea ‘

Coniochaeta velutina Coniochaetales

Coniochaeta leucoplaca

Coniochaeta ostrea

Ophiostoma piliferum

am ophiostoma ulmi

83! L Ophiostoma lunatum

999] '— Ophiostoma nigrocarpum :

Ceratocystiopsis manitobensis Ophi ostomatales

Ceratocystiopsis minima

Grosmannia penicillata

oe ~ Grosmannia grandifoliae

: Chaetosphaeria ovoidea Chaetosphaerial

Melanochaeta hemipsila aelospnaeriales

Sordaria fimicola

Sordaria macrospora ‘

Neurospora crassa Sordariales

Gelasinospora tetrasperma

Camarops petersii

Camarops tubulina | Boliniales

0,99)

Camarops ustuliniodes

9g-— Cornipulvina ellipsoides

0,95 Asteridiella sp.1

9.5] Endomeliola dingleyae

nae Arent lozanellae Meliolales

,; Meliola variaseta

0,99 |______________ Mgliofa centellae

|________ Asteridiella obesa

Irenopsis sp.

Diaporthe phaseolorum

eG romonia ribicola j

Valsa ceratosperma Diaporthales

Plagiostoma euphorbiae

ee Cryphonectria parasitica

Diatrype disciformis

Seiridium cardinale

Discostroma botan A

Xylaria hypoxylon xy lariales

Xylaria acuta

Apiospora bambusae

079 Apiospora setosa

| Valsonectria pulchella

Balansia henningsiana

-—— Claviceps paspali

Nectria cinnabarina

Valetoniellopsis laxa Hypocreales

Hypocrea schweinitzii

Aphysiostroma stercorarium

Hypocrea pallida

Hypomyces polyporinus

ee Halosphaeria appendiculata

a Halosarpheia fibrosa '

a2 mes Ceratocystis fimbriata Microascales

Faurelina elongata

Pyxidiophora arvernensis

0,82

Fic. 1. Phylogenetic tree inferred from Bayesian Analysis of 28S rDNA Sordariomycetes sequences.

Bayesian posterior probability of >70% are indicated above the nodes and bold lines indicate

posterior probabilities of 1.00. The species in study are in bold. The tree is rooted with Pyxidiophora

arvernensis,

2003). Four MCMC chains were run simultaneously, starting from random trees for

10,000,000 generations. Trees were sampled every 1000" generation for a total of 10,000

trees. The first 2500 trees were discarded as the burn-in phase of each analysis. Posterior

probabilities (Rannala & Yang 1996) were determined from a majority-rule consensus

tree generated with the remaining 7500 trees. Convergence of the log likelihoods was

analyzed with TRACER v. 1.4.1 (Rambaut & Drummond 2003); no lack of convergence

was detected. Trees were visualized in FigTree (Rambaut 2009) and exported to graphics

programs. Pyxidiophora arvernensis (Breton & Faurel) N. Lundq. was used as outgroup

in these analyses.

Meliola centellae sp. nov. (Brazil) ... 339

Results

Meliola centellae Pinho & O.L. Pereira, sp. nov. Fics 2-3

MycosBank MB519037

Differs from Meliola pectinata by its smaller ascospores and longer mycelial setae.

Type: Brazil, Minas Gerais, Mata da Dendrologia, on living leaves of Centella asiatica

(L.) Urb. (Apiaceae), 16 September 2009, D.B. Pinho (Holotype, VIC 31244).

Erymo.oey: The epithet refers to the host genus, Centella.

BEELI FORMULA 3112.3232. Colonies black, minute, amphigenous, mostly

epiphyllous, initially scattered but becoming confluent with age, dense, 1-3 mm

diameter. Hyphae dark brown, septate, straight to sub-straight, branching usually

opposite at acute angles, bearing appressoria and conidiogenous cells. Hyphal

cells 11-21 x 5-9 um. Appressoria opposite or alternate, antrorse, straight to

curved; stalk cells dark brown, cylindrical to cuneate, 2.5-5 x 5-7.5 um, head

Fic 2. Meliola centellae on Centella asiatica. A. General view of abaxial (left) and adaxial (right)

colonies on leaf surface. B. Perithecium. C. Mycelial setae. D. Appressoria. E. Mixed appressoria

and phialides. EF Ascospores. Bars: B, C = 50 um; D-F = 25 um.

340 ... Pinho &al.

cells dark brown, globose to ovate, slightly attenuated at the apex, rounded,

entire, 7.5-12.5 x 5-10 um. Phialides light brown, mixed with appressoria,

opposite, ampulliform, 12.5-25 x 6-9 um. Mycelial setae dark brown, simple,

straight, apex acute, 5-12 septate, 218-430 x 7.5-10 um. Perithecia brown,

globose, scattered, black, 152-247 um diameter. Asci evanescent. Ascospores

hyaline inside the ascus, becoming grey or brown with age, dark brown or grey

at maturity, cylindrical to ellipsoid, rounded at the tips, 4-septate, constricted

at the septa, 32-39.5 x 9.5-12.5 um.

MOLECULAR ANALYSES: The PCR-amplified fragments were obtained by

direct amplification and extraction with Wizard Genomic DNA Purification.

Both protocols were found suitable for DNA extraction of meliolaceous fungi.

On the other hand, the protocol from Vitoria et al. (2010) was not appropriate

for Meliola spp. The amplification of the partial 28S rDNA revealed sequences

of ca. 700 bp. Although the ITS sequences were not used in phylogenetic

analysis, they were lodged in GenBank (Accession No. KC252606-KC252608)

for future studies and identification purposes. The manually adjusted alignment

contained 57 strains (including the new species described here). Of the 467

characters used in the phylogenetic analysis, 209 were parsimony-informative,

252 were variable, and 207 were conserved. The Bayesian Inference tree

confirms Meliolales as a distinct order within Sordariomycetes.

Discussion

Centella asiatica belongs to Apiaceae subfam. Mackinlayoideae, which is

somewhat intermediate between Apiaceae sensu lato and Araliaceae (Plunkett

et al. 2004, Oskolski & Wyk 2010). Because no other black mildew fungus has

been reported on hosts in the Apiaceae, we compared the C. asiatica fungus

with Meliola spp. occurring on taxa in Araliaceae.

Of the 19 species and four infraspecific taxa of Meliola known on Araliaceae

(Hansford 1961, Hosagoudar et al. 1995, Hosagoudar 1996, Hosagoudar &

Archana 2009), none matched M. centellae. Six taxa (M. acanthopanacis W.

Yamam., M. araliicola W. Yamam., M. didymopanacis var. stevensii Hansf., M.

schefflerae Hansf., M. payakii Hosag., and M. pectinata Hohn.) have straight

simple mycelial setae (like M. centellae) but differ in several other traits

(Hansford 1961, Hosagoudar 1996). Meliola pectinata matches the first four

characters of the M. centellae Beeli formula but has larger ascospores and

shorter mycelial setae. Meliola acanthopanacis, M. araliicola, M. didymopanacis

Fic 3. Meliola centellae on Centella asiatica. A. SEM photographs of the perithecia and mycelial

setae (B). C. Ascospores. D. Asci with two immature ascospores. E, F. Superficial hyphae with

two-celled oppositely and alternately positioned lateral appressoria. G. Mycelial setae. H. Detail of

mycelial setae with acute apex. I. Superficial hyphae with phialides and appressoria. Bars: A= 100

um; B= 20 um; C-I = 30 um.

Meliola centellae sp. nov. (Brazil) ... 341

342 ... Pinho &al.

var. stevensii, and M. payakii also have larger ascospores than M. centellae.

Meliola centellae is also very similar to M. schefflerae but also produces larger

ascospores (45—51 x 17-19 um; Hansford 1961, Hosagoudar 1996). In addition,

the similar M. heteroseta Hohn. and M. dichotoma var. kusanoi (Henn.) Hansf.

are distinguished from the new species by larger ascospores and dichotomously

branched mycelial setae (Hansford 1961). We therefore propose Meliola

centellae for the first Meliola species (and the first Meliolaceae) recorded on a

member of the Apiaceae.

Although mycologists in several laboratories tried to isolate DNA from

meliolalean fungi, only a few attempts have been successful (Rodriguez &

Piepenbring 2007). The Meliolales are a non-culturable group frequently

contaminated by numerous other fungi. It is thought that the dark pigment

of their thick cell walls might also interfere with DNA isolation (Rodriguez &

Piepenbring 2007). Although the Vitoria et al. (2010) method has been reported

as suitable for extracting DNA from ascomata, we found it inappropriate for

Meliola spp. Here we successfully extracted DNA from Meliolales through direct

amplification and extraction with Wizard Genomic DNA Purification kit.

Successful direct amplification of fungal DNA have been published previously

for Xylariales and Meliolales (Saenz & Taylor 1999, Rodriguez & Piepenbring

2007, Jaklitsch & Voglmayr 2012), but adding the freezing/thawing steps

probably improved the process. This is commonly used for most species that

possess rigid cell walls and resist lysis techniques by compromising the integrity

of the cell wall (Griffin et al. 2002). The extraction with Wizard Genomic DNA

Purification kit is described herein as the first successful protocol for isolating

and purifying DNA from Meliolales. This procedure allows amplification of

multiple gene regions.

Of the several papers revising the systematics of the Sordariomycetes

(Spatafora et al. 2006, Zhang et al. 2006, Lumbsch & Huhndorf 2007, Tang et

al. 2007, Schoch et al. 2009), only Saenz & Taylor (1999) included members of

the Meliolales. Their phylogeny grouped Meliolales in a distinct clade close to

Sordariales and thus showed that phylogenetic analysis of molecular characters

confirmed previous morphologically based classifications placing Meliolales in

the Sordariomycetes. The most widely used gene sequences for phylogenetic

studies have been 28S rDNA genes because of their easy amplification due their

high copy number and the availability of numerous universal primers (Miller

& Huhndorf 2005, Tang et al. 2007). The present paper confirms that Meliolales

comprises a monophyletic order within Sordariomycetes (Fic. 1). Although the

presence of dark perithecia and inamyloid asci indicate that Meliolales belong

to the subclass Sordariomycetidae (Zhang et al. 2006), the phylogenetic position

of the order is still uncertain because the phylogeny inferred from the 28S

rDNA datasets are the least supported (Tang et al. 2007). Miller & Huhndorf

Meliola centellae sp. nov. (Brazil) ... 343

(2005) propose that increased taxon sampling will improve resolution in many

clades and that phylogenetic support will increase through the incorporation

of additional genes. This clearly indicates the need for extensive taxon sampling

and further investigation of DNA sequences in order to better clarify the

phylogeny of the Meliolales.

Acknowledgments

The authors wish to thank Drs. Dartanha José Soares (Empresa Brasileira de Pesquisa

Agropecuaria, EMBRAPA Algodao, Campina Grande, Brazil) and Virupakshagouda

B. Hosagoudar (Tropical Botanic Garden and Research Institute, Palode 695562,

Tiruvananthaparum, Kerala, India) for reviewing the manuscript and CNPq (Conselho

Nacional de Desenvolvimento Cientifico e Tecnoldgico) for financial support.

Literature cited

Barber PA, Keane PJ. 2007. A novel method of illustrating microfungi. Fungal Diversity 27: 1-10.

Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput.

Nucleic Acids Research 32: 1792-1797. http://dx.doi.org/10.1093/nar/gkh340

Farr DF, Rossman AY. 2012. Fungal Databases, Systematic Mycology and Microbiology Laboratory,

ARS, USDA. Available at: http://nt.ars-grin.gov/fungaldatabases/ [Verified 10 February 2012].

Griffin, DW, Kellogg CA, Peak KK, Shinn EA. 2002. A rapid and efficient assay for extracting DNA

from fungi. Letters in Applied Microbiology: 34: 210-214.

http://dx.doi.org/10.1046/j.1472-765x.2002.01071.x

Hansford CG. 1961. The Meliolineae. A Monograph. Beiheth. Sydowia 2: 1-806.

Hepperle D. 2011. DNA Dragon 1.4.1 - DNA Sequence Contig Assembler Software. Available at:

http://www.dna-dragon.com/ [Verified 15 November 2011].

Hosagoudar VB. 1996. Meliolales of India. Botanical Survey of India, Calcutta. 363 p.

Hosagoudar VB, Archana GR. 2009. Host range of meliolaceous fungi in India. Journal of

Threatened Taxa 1: 269-282.

Hosagoudar VB, Sarbhoy AK, Agarwal DK, Khan MK. 1995. Meliolaceae exsiccatae in herbarium

cryptogamae Indiae orientalis. Mycotaxon 56: 347-386.

Jaklitsch WM, Voglmayr H. 2012. Phylogenetic relationships of five genera of Xylariales and

Rosasphaeria gen. nov (Hypocreales). Fungal Diversity 52: 75-98.

http://dx.doi.org/10.1007/s13225-011-0104-2

Kissmann KG, Groth D. 1999. Plantas infestantes e nocivas. 2 ed. Sao Paulo, SP, Basf. 978 p.

Lumbsch HT, HuhndorfSM. 2007. Whatever happened to the Pyrenomycetes and Loculoascomycetes?

Mycological Research 111: 1064—1074. http://dx.doi.org/10.1016/j.mycres.2007.04.004

Macedo DM, Pinho DB, Barreto RW, Cuda JP, Pereira OL. 2010. Black mildew fungi (Meliolaceae)

associated with Schinus terebinthifolius (Brazilian pepper tree) in Brazil. Mycotaxon 114:

429-437. http://dx.doi.org/10.5248/114.429

Mendes MAS, Urben AF. 2012. Fungos relatados em plantas no Brasil, Laboratorio de

Quarentena Vegetal. Brasilia, DF: Embrapa Recursos Genéticos e Biotecnologia. Available at:

http://pragawall.cenargen.embrapa.br/aiqweb/michtml/fgbanco01.asp [Verified 10 Febr. 2012].

Miller NA, Huhndorf SM. 2005. Multi-gene phylogenies indicate ascomal wall morphology

is a better predictor of phylogenetic relationships than ascospore morphology in the

Sordariales (Ascomycota, Fungi). Molecular Phylogenetics and Evolution 35: 60-75.

http://dx.doi.org/10.1016/j.ympev.2005.01.007

344 ... Pinho &al.

Miller MA, Pfeiffer W, Schwartz T. 2010. Creating the CIPRES Science Gateway for inference

of large phylogenetic trees. 1-8, in: Proceedings of the Gateway Computing Environments

Workshop (GCE), 14 Nov. 2010, New Orleans, LA.

Oskolski AA, Van Wyk BE. 2010. Wood and bark anatomy of Centella: scalariform perforation

plates support an affinity with the subfamily Mackinlayoideae (Apiaceae). Plant Systematics and

Evolution 289: 127-135. http://dx.doi.org/10.1007/s00606-010-0338-6

Pinho DB, Pereira OL, Nicoli A, Honorato-Junior J, Braganga CAD. 2009. Black mildew disease on

the neotropical medicinal shrub Pothomorphe umbellata in Brazil, caused by Irenopsis tortuosa

var. potomorphes. Australasian Plant Disease Notes 4: 84-86.

Pinho DB, Pereira OL, Firmino AL, Silva M, Ferreira-Junior WG, Barreto RW. 2012. New

Meliolaceae from the Brazilian Atlantic Forest 1. Species on hosts in the families Asteraceae,

Burseraceae, Euphorbiaceae, Fabaceae and Sapindaceae. Mycologia 104: 121-137.

http://dx.doi.org/10.3852/10-260

Plunkett GM, Chandler GT, Lowry PP, Pinney SM, Sprenkle TS. 2004. Recent advances in

understanding Apiales and a revised classification. South African Journal of Botany 70:

371-381.

Posada D, Buckley TR. 2004. Model selection and model averaging in phylogenetics: advantages of

Akaike information criterion and Bayesian approaches over likelihood ratio tests. Systematic

Biology 53: 793-808. http://dx.doi.org/10.1080/10635150490522304

Rambaut A. 2009. FigTree 1.2.2. Available at: http://tree.bio.ed.ac.uk/software/figtree/ [Verified 15

January 2012]

Rambaut A, Drummond A. 2003. Tracer MCMC trace analysis tool. Oxford, UK: University of

Oxford. Available at: http://tree.bio.ed.ac.uk/software/tracer/ [Verified 15 January 2012]

Rannala B, Yang Z. 1996. Probability distribution of molecular evolutionary trees: a new method of

phylogenetic inference. Journal of Molecular Evolution 43: 304-311.

http://dx.doi.org/10.1007/BF02338839

Rodriguez D, Piepenbring M. 2007. Two new species of Appendiculella (Meliolaceae) from Panama.

Mycologia 99: 544-552. http://dx.doi.org/10.3852/mycologia.99.4.544

Rodriguez F, Oliver JF, Marin A, Medina JR. 1990. The general stochastic model of nucleotide

substitutions. Journal of Theoretical Biology 142: 485-501.

http://dx.doi.org/10.1016/S0022-5193(05)80104-3

Ronquist F, Heulsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed

models. Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180

Saenz GS, Taylor JW. 1999. Phylogenetic relationships of Meliola and Meliolina inferred

from nuclear small subunit rRNA sequences. Mycological Research 103: 1049-1056.

http://dx.doi.org/10.1017/S0953756298008211

Schoch CL, Sung G-H, Lopez-Giraldez F, Townsend JP, Miadlikowska J, Hofstetter V, Robbertse B,

Matheny B, Kauff K Wang Z, Gueidan C, Andrie RM, Trippe K, Ciufetti LM, Wynns A, Fraker

E, Hodkinson BP, Bonito G, Groenewald JZ, Arzanlou M, Hoog GS, Crous PW, Hewitt D,

Pfister D, Peterson K, Gryzenhout M, Wingfield MJ, Aptroot A, Suh S-O, Blackwell M, Hillis

DM, Griffith GW, Castlebury LA, Rossman A, Lumbsch HT, Licking R, Biidel B, Rauhut A,

Diederich P, Ertz D, Geiser DM, Hosaka K, Inderbitzin P, Kohlmeyer J, Volkmann-Kohlmeyer

B, Mostert L, O’Donnell K, Sipman H, Rogers JD, Shoemaker R, Sugiyama J, Summerbell RC,

Untereiner W, Johnston PR, Stenroos S, Zuccaro A, Dyer PS, Crittenden PD, Cole MS, Hansen

K, Trappe JM, Yahr R, Lutzoni F, Spatafora JW. 2009. Ascomycota Tree of Life: A phylum-wide

phylogeny clarifies the origin and evolution of fundamental reproductive and ecological traits.

Systematic Biology 58: 224-239. http://dx.doi.org/10.1093/sysbio/syp020

Meliola centellae sp. nov. (Brazil) ... 345

Silva M, Barreto RW, Pereira OL. 2012. Fungal pathogens of ‘cat’s claws’ from Brazil for biocontrol

of Macfadyena unguis-cati. Mycotaxon 119: 181—195. http://dx.doi.org/10.5248/119.181

Spatafora JW, Sung GH, Johnson D, Hesse C, O'Rourke B, Serdani M, Spotts R, Lutzoni F,

Hofstetter V, Miadlikowska J, Reeb V, Gueidan C, Fraker E, Lumbsch T, Lucking R, Schmitt I,

Hosaka K, Aptroot A, Roux C, Miller AN, Geiser DM, Hafellner J, Hestmark G, Arnold AE,

Budel B, Rauhut A, Hewitt D, Untereiner WA, Cole MS, Scheidegger C, Schultz M, Sipman

H, Schoch CL. 2006. A five-gene phylogeny of Pezizomycotina. Mycologia 98: 1018-1028.

http://dx.doi.org/10.3852/mycologia.98.6.1018

Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGAS5: Molecular

evolutionary genetics analysis using Maximum Likelihood, Evolutionary Distance,

and Maximum Parsimony Methods. Molecular Biology and Evolution 28: 2731-2739.

http://dx.doi.org/10.1093/molbev/msr121

Tang, AMC, Jeewon R, Hyde KD. 2007. Phylogenetic utility of protein (RPB2, beta-tubulin) and

ribosomal (LSU, SSU) gene sequences in the systematics of Sordariomycetes (Ascomycota,

Fungi). Antonie Van Leeuwenhoek 91: 327-349. http://dx.doi.org/10.1007/s10482-006-9120-8

Vilgalys R, Hester M. 1990. Rapid genetic identification and mapping of enzymatically amplified

ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4239-4246.

Vitoria NS, Bezerra JL, Gramacho KP. 2010. A simplified DNA extraction method for PCR analysis

of Camarotella spp. Brazilian Archives of Biology and Technology 53: 249-252.

White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal

RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ. (Eds.) PCR

Protocols: A guide to methods and applications. San Diego, California, USA. Academic Press.

pp. 315-322.

Zhang N, Castlebury LA, Miller AN, Huhndorf SM., Schoch CL, Seifert KA., Rossman AY,

Rogers JD, Kohlmeyer J, Volkmann-Kohlmeyer B, Sung GH. 2006. An overview of the

systematics of the Sordariomycetes based on a four-gene phylogeny. Mycologia 98: 1076-1087.

http://dx.doi.org/10.3852/mycologia.98.6.1076

MY COTAXON

http://dx.doi.org/10.5248/122.347

Volume 122, pp. 347-353 October-December 2012

Tuber sinosphaerosporum sp. nov. from China

Li FAN”, JIN-ZHONG CAO? & Yu Lr?’

" College of Life Science, Capital Normal University,

Xisanhuanbeilu 105, Haidian, Beijing 100048, China

? Institute of Mycology, Jilin Agricultural University, Changchun 130118, China

* CORRESPONDENCE TO: fanli@mail.cnu.edu.cn

ABsTRACT — A new white truffle species from China is described and illustrated. Tuber

sinosphaerosporum is characterized by its white ascomata and globose ascospores ornamented

with large reticulum meshes. The new species, supported by ITS sequence analysis, offers

commercial value due to its moderate to relatively large size and possibly high yield in

China.

KEY worDs —Ascomycota, taxonomy

Introduction

The number of Tuber species in China has increased considerably over the

last thirty years (Liu 1985, Wang 1988, Wang & Li 1991, Wang et al. 1998, Wang

& He 2002, Tao et al. 1989, Hu 1992, Xu 1999, He et al. 2004, Hu & Wang 2005,

Chen et al. 2005, Chen & Liu 2007, Cao 2010, Fan et al. 2011, 2012a,b), and

new species are still being found. In December 2010, about a kilo of fresh white

truffles growing under Corylus sp. was collected from Baoshan City of Yunnan

Province; they had a strong but pleasant aroma of garlic, typical of white truffles.

Subsequently, another white truffle was collected from Chenggong County

near Kunming City of Yunnan that was morphologically similar to the Baoshan

specimens but grew under conifers. Detailed morphological observation and

molecular research confirm that the collections from both locations represent

a single undescribed species.

Materials & methods

Morphological studies

Truffles were collected from Baoshan City and Chenggong County, Yunnan Province.

Macroscopic characters were described from fresh specimens. Microscopic characters

were described from razor-blade sections of fresh specimens mounted in 3% KOH,

348 ... Fan, Cao & Li

TABLE 1 Tuber specimens and sequence numbers used in molecular studies.

SPECIES NAME VOUCHER ORIGIN ITS REFERENCE

T. borchii Vittad. GB62 Italy HM485342 Bonito et al. 2010

GB39 Unknown HM485343 Bonito et al. 2010

GB45 Italy HM485344 Bonito et al. 2010

T. borchii var. HKAS 520005 China GQ 217541 GenBank

sphaerospermum

Malengon

T. californicum Harkn. L4AB7 Unknown EF411102 Morris et al. 2008

JT22590 USA HM485351 Bonito et al. 2010

JT28058 USA HM485346 Bonito et al. 2010

T. latisporum HKAS 30838B China DQ898185 Chen & Liu 2007

Juan Chen & PG. Liu

HKAS42380 China DQ898184 Chen & Liu 2007

HKAS44315 China DQ898183 Chen & Liu 2007

T. melanosporum Vittad. A59 France AF106878 From GenBank

TM13 France AF132501 Roux et al. 1999

T. oligospermum (Tul. & MA: FUNGI: 41010A Spain FM205506 GenBank

C. Tul.) Trappe

MA: FUNGI: 41010B Spain FM205507 GenBank

MA: FUNGI: 28388B Spain FM205508 GenBank

MA: FUNGI: 28389 Spain FM205509 GenBank

T. puberulum TL11885 Denmark AJ969626 Tedersoo et al. 2006

Berk. & Broome

TL3857 Denmark AJ969625 Tedersoo et al. 2006

BI-32 Hungary AJ557537 Halasz et al. 2005

T. sinosphaerosporum BJTC FAN135 China JX092086 This study

(HOLOTYPE)

BJTC FAN136 China JX092087 This study

T. sphaerosporum Gilkey JT12487 USA FJ809853 Bonito et al. 2010

JT19772 USA FJ809854 Bonito et al. 2010

JT12487 USA GQ221449 From GenBank

OSC75864 USA HM485390 From GenBank

Melzer’s reagent, or 0.1% (w/v) cotton blue in lactic acid. The specimens are deposited

in BJTC (Biology Department Herbarium, Capital Normal University). For scanning

electron microscopy (SEM), spores were scraped from the dried gleba, placed on to

doubled-sided tape, mounted directly on an SEM stub, coated with gold—palladium, and

then examined and photographed with a HITACHI S-4800 SEM.

Molecular methods

Herbarium samples were crushed by shaking for 3 min at 30 Hz (Mixer Mill MM

301, Retsch, Haan, Germany) ina 1.5 ml tube together with one 3 mm diameter tungsten

carbide ball. Total genomic DNA was then extracted using the PeqLabE.Z.N.A._ Fungal

DNA kit following the manufacturer's protocol. The ITS region was amplified with

PCR using the primers ITS1/ITS4 (White et al. 1990). PCR was performed in 50 ul

reactions containing DNA template 2 ul, primer (10UM) 2 ul each, 2 x Master Mix

(Tiangen Biotech (Beijing) Co. Ltd.) 25 ul. PCR reactions were run as follows: an initial

Tuber sinosphaerosporum sp. nov. (China) ... 349

Tuber sphaerosporum FJ809853

100 0.85 Tuber sphaerosporum GQ221449

1.00 77 Tuber sphaerosporum FJ809854

0.89 Tuber sphaerosporum HM485390

nee Tuber californicum HM485351

a Tuber californicum HM485346

0.79 Tuber californicum EF411102

91 Tuber latisporum DQ898184

100|9-99 Tuber latisporum DQ898185

190 Tuber latisporum DQ898183

0.83 100 Tuber oligospermum FM205506

100) 1.00 Tuber oligospermum FM205507

oer 1.00) 400) Tuber oligospermum FM205508

1.00 Tuber oligospermum FM205509

Tuber borchii var sphaerospermum GQ217541

is 100 Tuber sinosphaerosporum JX092086

1.00 Tuber sinosphaerosporum JX092087

Tuber puberulum AJ969625

100 Tuber puberulum AJ969626

ot 1,08 Tuber puberulum AJ557537

7.00 Tuber borchii HM485342

100 Tuber borchii HM485343

Tuber borchii HM485344

Tuber melanosporum AF 132501

Tuber melanosporum AF106878

Fic. 1. Phylogeny derived from maximum parsimony ITS rDNA sequence analysis of some Tuber

species with reticulate ascospore ornamentation using T: melanosporum as outgroup. Bootstrap

values of >70% from 1000 replications are shown above the respective branches. Clades with

Bayesian posterior probabilities (PP) estimated >0.70 (70%) are marked under the branches.

denaturation at 95°C for 3 min, followed by 30 cycles at 95°C for 2 min, 55°C for 25 s,

72°C for 2 min, and a final extension at 72°C for 10 min. The PCR products were sent

to Invitrogen Biotechnology Co. Ltd. (Beijing, China) for purifying, sequencing, and

editing. The other sequence data of ITS rDNA included in this study were downloaded

from GenBank. GenBank numbers are shown in TABLE 1.

Phylogenetic analyses

DNA sequences were aligned with Clustal X (Thompson et al. 1997). The alignment

was manually adjusted with Se-Al v.2.03a (Rambaut 2000). The aligned dataset was

analyzed with maximum parsimony (MP) using PAUP*4.0b10 (Swofford 2002).

Maximum parsimony analysis was conducted using heuristic searches with 1000

replicates of random-addition sequence, tree bisection reconnection (TBR) branch

swapping algorithm. All characters were equally weighted and unordered. Gaps were

treated as missing data to minimize homology assumptions. A bootstrap (BS) analysis

was performed with 1000 replicates, each with 10 random taxon addition sequences.

TBR branch swapping was employed. The Bayesian analysis was performed with

MrBayes 3.1.2 (Huelsenbeck et al. 2001; Ronquist and Huelsenbeck 2003) with two sets

of four chains (one cold and three heated) and the stoprule option in effect, halting

the analyses at an average standard deviation of split frequencies of 0.01. The sample

frequency was set to 100, and the first 25% trees were removed as burn-in. Bayesian

posterior probabilities (PP) were obtained from the 50% majority rule consensus of

the remaining trees. Two sequences derived from Tuber melanosporum were used as

outgroup.

350 ... Fan, Cao & Li

Results

Molecular phylogenetics

279 of 612 characters were found to be parsimony-informative. Maximum

parsimony analysis resulted in one most parsimonious tree (Fic.1) with a

length (TL) of 510 steps, consistency index (CI) of 0.7804, retention index (RI)

of 0.8948 and rescaled consistency index (RCI) of 0.6983 (for all sites).

The ITS sequence phylogeny (Fic. 1) revealed that sequences from the two

Yunnan collections (Tuber sinosphaerosporum) were the same and grouped in

a clade with strong support (BS = 100, PP = 1.00). They appear to form a sister

relationship with T. borchii and T. oligospermum but with very low support.

Taxonomy

Tuber sinosphaerosporum L. Fan, J.Z. Cao & Yu Li, sp. nov. FIG. 2

MycoBank MB800677

Differs from other Tuber species in its fresh white ascomata and regular globose

ascospores covered by a reticulate ornamentation that is 2-4 meshes across the spore

width.

Type: China. Yunnan Province, Baoshan City, under the soil near Corylus sp. 11 Dec.

2010, De-fu Liu (Holotype, BJTC FAN135; GenBank, JX092086))

ETYMOLOGY: sinosphaerosporum (Lat.), referring to a Chinese species resembling the

American Tuber sphaerosporum.

AscoMaATa irregularly globose or lobed, often convolute and with several

deep furrows, 1.5-5.5 cm in diam., white or whitish-cream or pale yellow

white when fresh, yellow whitish or light yellow brown after dried, the surface

poorly puberulent at least at furrows. Odor faint when young, but of strong

garlic when mature. PERIDIUM 250-300 um thick, with two layers: outer layer

100-150 um thick, pseudoparenchymatous, composed of subglobose and

angular cells 7.5-17.5 um in diam., with slightly thickened walls, yellowish-

brown towards the surface; inner layer 150-200 um thick, texture intricate, the

hyphae thin-walled, hyaline, 2.5-5 um in diam. Hairs hypha-like, arising from

the superficial cells in places, 10-40 x 2.5-5(-7.5) um, hyaline or yellowish,

usually thin-walled, 1-2 septate, cylindric and obtuse at the apex. GLEBA white

at first, becoming yellow-brown to brown at maturity, marbled with large

and rare, branched, white veins originating from various points of the inner

peridium. Asci globose, subglobose or broadly ellipsoid, sessile, 75-125 x

62.5-85 ym, 1-4-spored. Ascospores regularly globose, hyaline at first,

becoming yellow brown to brown at maturity, ornamentation regular reticulum,

20-42.5 um in 2-4-spored asci and 40-45 um in 1-spored asci in diam.

excluding the ornamentation, the meshes large and variable in size, 5.0—7.5 um

high, usually 2-4 meshes across the spore width.

Tuber sinosphaerosporum sp. nov. (China) ... 35.1

pe PANG #2 es 7GA

) PE :/ £ oC

ta? '‘2C.

ny et CHAM ‘iy

Fic. 2. Tuber sinosphaerosporum (BJTC FAN135, holotype). a. Soil adhering to the ascomal

surface makes them appear brown; b-c. Asci and ascospores observed under light microscope;

d. Ascospore observed under SEM.

ADDITIONAL SPECIMENS EXAMINED: CHINA, YUNNAN PROVINCE, CHENGGONG

County, under soil of conifers, 18 Dec. 2010, Jin-zhong Cao (BJTC FAN136; GenBank,

JX092087).

ComMENTS — Tuber sinosphaerosporum is similar to American T: sphaerosporum

in the appearance of ascospores, but the American species differs in its

glabrous brown ascomata and dark gleba (Gilkey 1939, 1954). The peridium of

T. sphaerosporum is composed of “variable cells, the large and small intermixed,

somewhat pseudoparenchymatous or often prosenchymatous” (Gilkey 1954),

whereas T: sinosphaerosporum has typical pseudoparenchymatous peridium.

The molecular study (Fic. 1) also demonstrated a considerable separation.

The other Tuber species with regular globose ascospores, such as T: californicum

from North America, Tuber borchii var. sphaerospermum from Europe, and

T. oligospermum from Europe and North Africa, are distinguished from

T. sinosphaerosporum by their reticulum meshes numbering 5-7 across the

ascospore width (Gilkey 1939, 1954, Riousset et al. 2001). Phylogenetic

analyses (Fic. 1) support T: sinosphaerosporum as a distinct species. The

352 ... Fan, Cao & Li

T. sinosphaerosporum sequences form a sister relationship with T: borchii and

T. oligospermum, but the very low support value indicates they are closely

related but distinct.

Tuber sinosphaerosporum could be a potential commercial species in the

international white truffle market because of its significant larger ascocarp size

(medium to relatively large) and strong but pleasant aroma. According to the

local people, T: sinosphaerosporum could be expected to have a high cropping

yield in Yunnan Province.

Acknowledgments

We are grateful to Prof. Anthony Whalley and Prof. Tai-Hui Li for reviewing the

pre-submitted manuscript. The study was supported by the National Natural Science

Foundation of China (No. 30770005, 30870008), the Beijing Natural Science Foundation

(No. 5122003).

Literature cited

Bonito GM, Gryganskyi AP, Trappe JM, Vilgalys R. 2010. A global meta-analysis of Tuber ITS

rDNA sequences: species diversity, host associations and long-distance dispersal. Molecular

Ecology 19: 4994-5008. http://dx.doi.org/10.1111/j. 1365-294X

Cao JZ. 2010. The genus Tuber in China [Dissertation]. Changchun: Jinlin Agricultural University.

86 p.

Chen J, Liu PG. 2007. Tuber latisporum sp. nov. and related taxa, based on morphology and DNA

sequence data. Mycologia 99: 475-481. http://dx.doi.org/10.3852/mycologia.99.3.475

Chen J, Liu PG, Wang Y. 2005. Tuber umbilicatum, a new species from China, with a key to the

spinose-reticulate spored Tuber species. Mycotaxon 94: 1-6.

Fan L, Cao JZ, Liu YY, Li Y. 2011. Two new species of the genus Tuber from China. Mycotaxon 116:

349-354. http://dx.doi.org/10.5248/116.349

Fan L, Hou CL, Cao JZ. 2012a [“2011”]. Tuber sinoalbidum and T. polyspermum — new species

from China. Mycotaxon 118: 403-410. http://dx.doi.org/10.5248/118.403

Fan L, Cao JZ, Zheng ZH, Li Y. 2012b. Tuber in China: T: microspermum and T: microspiculatum

spp. nov. Mycotaxon 119: 391-395. http://dx.doi.org/10.5248/119.391

Gilkey HM. 1939. Tuberales of North America. Oregon State Mon.1: 1-63.

Gilkey HM. 1954. Taxonomic notes on Tuberales. Mycologia 46: 783-793.

Halasz K, Bratek Z, Szego D, Rudnoy S, Racz I, Lasztity D, Trappe JM. 2005. Tests of species

concepts of the small, white, European group of Tuber spp. based on morphology and

rDNA ITS sequences with special reference to Tuber rapaeodorum. Mycol. Prog. 4: 281-290.

http://dx.doi.org/10.1007/s11557-006-0132-6

He XY, Li HM, Wang Y. 2004. Tuber zhongdianense sp.nov. from China. Mycotaxon 90: 213-216.

Hu HT. 1992. Tuber formosanum sp. nov. and its mycorrhizal associations. Quart. J. Exp. Forest.

Nat. Taiwan Univ. 6: 79-86.

Hu HT, Wang Y. 2005. Tuber furfuraceum sp. nov. from Taiwan. Mycotaxon 93: 155-157.

Liu B. 1985. New species and new records of hypogeous fungi from China (I). Acta Mycologica

Sinica 4(2): 84-89.

Morris MH, Smith ME, Rizzo DM, Rejmanek M, Bledsoe CS. 2008. Contrasting ectomycorrhizal

fungal communities on the roots of co-occurring oaks (Quercus spp.) in a California woodland.

New Phytol. 178: 167-176. http://dx.doi.org/10.1111/j.1469-8137.2007.02348.x

Tuber sinosphaerosporum sp. nov. (China) ... 353

Rambaut A. 2000. Estimating the rate of molecular evolution: incorporating non-contempor-

aneous sequences into maximum likelihood phylogenies. Bioinformatics 16: 395-399.

http://dx.doi.org/10.1093/bioinformatics/16.4.395

Riousset L, Riousset G, Chevalier G, Bardet MC. 2001. Truffes d’Europe et de Chine. Institut

National de la Recherche Agronomique, Paris. 181 p.

Ronquist F, Huelsenbeck JP. 2003. MrBayes 3: Bayesian phylogenetic inference under mixed

models, Bioinformatics 19: 1572-1574. http://dx.doi.org/10.1093/bioinformatics/btg180

Roux C, Sejalon-Delmas N, Martins M, Parguey-Leduc A, Dargent R, Becard G. 1999. Phylogenetic

relationships between European and Chinese truffles based on parsimony and distance analysis

of ITS sequences. FEMS Microbiol. Lett. 180: 147-155.

http://dx.doi.org/10.1111/j.1574-6968.1999.tb08789.x

Swofford DL. 2002. PAUP*, phylogenetic analysis using parsimony (*and other methods), version

4. Sunderland, MA, USA, Sinauer Associates.

Tao K, Liu B, Zhang DC. 1989. A new species of the genus Tuber from China. Journal of Shanxi

University (Nat. Sci. Ed.) 12: 215-218.

Tedersoo L, Hansen K, Perry BA, Kjoller R. 2006. Molecular and morphological diversity of

pezizalean ectomycorrhiza. New Phytol. 170: 581-596.

http://dx.doi.org/10.1111/j.1469-8137.2006.01678.x

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTALX windows

interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.

Nucleic Acids Res. 24: 4876-4882. http://dx.doi.org/10.1093/nar/25.24.4876

Wang Y. 1990. First report of study on Tuber species from China. Atti del II Congresso Internazionale

sul Tartufo, Spoleto, Nov. 24-27, 1988: 45-50.

Wang Y, He XY. 2002. Tuber huidongense sp. nov. from China. Mycotaxon 83: 191-194.

Wang Y, Li ZP. 1991. A new species of Tuber from China. Acta Mycologica Sinica 10: 263-265.

(in Chinese).

Wang Y, Moreno G, Riousset LJ, Manjon JL, Riousset G, Fourre G, Di Massimo G, Garcia-Montero

LG, Diez J. 1998. Tuber pseudoexcavatum sp. nov. A new species from China commercialised

in Spain, France and Italy with additional comments on Chinese truffles. Cryptogamie Mycol.

19: 113-120.

Xu AS. 1999. A taxonomic study of the genus Tuber in Xizang. Mycosystema 18: 361-365.

MY COTAXON

http://dx.doi.org/10.5248/122.355

Volume 122, pp. 355-359 October-December 2012

Terriera angularis sp. nov. on IIlicium simonsii from China

FENG ZHOU!, XIAO-YAN WANG!, LAN ZHANG! & YING-REN LIN”

' School of Life Science & ? School of Forestry & Landscape Architecture,

Anhui Agricultural University, West Changjiang Road 130, Hefei, Anhui 230036, China

*CORRESPONDENCE TO: yingrenlin@yahoo.com

ABSTRACT — Terriera angularis, a new species of Terriera that develops on leaves of

Illicium simonsii, was collected from Shennongjia forestry region of Hubei Province, China.

Description, illustration, and comments are given for this fungus. The type collection is

deposited in the Reference Collection of Forest Fungi of Anhui Agricultural University,

China (AAUF).

Key worps — Rhytismatales, morphological character, taxonomy

Introduction

Eriksson (1970) erected the segregate monotypic genus Terriera B. Erikss.

for the type species T. cladophila (Lév.) B. Erikss. (syn. Hysterium cladophilum

Lév.), which develops on twigs of Vaccinium myrtillus L. Johnston (2001), who

monographed the monocotyledon-inhabiting Lophodermium species, divided

Lophodermium into five groups, equating group B with Terriera because its

morphology was closer to T: cladophila than to the type species of Lophodermium.

Of the 24 species included in Terriera (MycoBank, www.mycobank.org/), seven

have been reported from China: T: camelliae, T: coacervata, T: huangshanensis,

T. illiciicola, T: petrakii, T. rotundata, and T: simplex (Chen et al. 2012, Gao et al.

2012, Song et al. 2012, Yang et al. 2011, Zheng et al. 2012).

Recently, during investigations of the Rhytismatales from Shennongijia

forestry region of Hubei Province, China, a new Terriera species was

discovered.

Materials & methods

Mature and immature ascomata were selected from the collected specimen.

Macroscopic features were observed under a hand lens and stereoscope. Reference

collection material was rehydrated in water for 15 min, and 10-15 um thick fruitbody

sections were cut bya freezing microtome (YD-1508-IH, China). For observing ascomatal

356 ... Zhou & al.

outlines in vertical section, sections were mounted in lactic acid or cotton blue with

pretreatment in water. The colors of the various structures and ascospore contents were

observed in water. Gelatinous sheaths surrounding ascospores and paraphyses were

examined in water or 0.1% (w/v) cotton blue in lactic acid. Measurements were made

from material mounted in 5% KOH or Melzer’s reagent and from 30 asci, ascospores,

and paraphyses for each specimen. Line and point integrated illustrations of external

shapes and internal structures of fruit bodies were drawn using a microscopic drawing

tube (Panasoianic XSJ-2, Japan).

Taxonomy

Terriera angularis Y.R. Lin, F. Zhou & Xiao Y. Wang, sp. nov. FIGS 1-5

MycoBanxk MB800350

Differs from Terriera minor by its triangular to quadrangular, rarely elliptical, mature

ascomata, and its narrower ascospores not quite tapering to both ends.

Type: China, Hubei, Shennongjia forestry region, Guanmenshan, alt. ca 1300 m, on

leaves of Illicium simonsii Maxim. (Schisandraceae), 9 July 2010, G.J. Jia & Y.R. Lin 2511

(Holotype, AAUF 68619).

EryMo_oey: angularis (Latin) = angular, referring to the external shape of the ascomata.

Co.toniEs only hypophyllous, forming irregular, large bleached spots each with

an obvious edge.

ZONE LINES absent.

CONIDIOMATA not observed.

Ascomata hypophyllous, clustered, sometimes confluent in groups of two

or three. In surface view, ascomata triangular to quadrangular, rarely elliptical,

diameter or length 350-720 um, the edge defined, grey-black to black except

sometimes for a paler region at ends, with conspicuously black perimeter

line, shiny, moderately raised above the surface of the substratum, opening by

3-4 radial splits or a longitudinal split. Young ascomata almost concolorous

with substratum surface, with dark brown perimeter line, usually rotund or

elliptical, preformed opening mechanism often appearing as a longitudinally

hollow zone. In median vertical section, ascomata subepidermal with

epidermal cells becoming filled with fungal tissue as ascoma develops. Lips not

observed. COVERING STROMA 22-30 um thick, connecting to the basal stroma,

consisting of dark brown textura angularis with thick-walled cells 3-6 um

diam. A short, ca 12 um thick extension, comprised of strongly black and brittle

tissue with no obvious cellular structure, adjacent to the top of the covering

stroma. EXCIPULUM very poorly developed, arising from the inner layer of the

covering stroma. BASAL STROMA Slightly concave, 10-22 um thick, dark brown,

composed of 2—4 rows of 3.5—7 um diam., angular, thick-walled cells. Colorless

to light grey-brown textura prismatica 35-45 um thick existing between the

covering and basal stromata. SUBHYMENIUM 12-20 um thick, consisting of

Terriera angularis sp. nov. (China) ... 357

Fics 1-5. Terriera angularis on Illicium simonsii. 1. Habit on leaf. 2. Detail of ascomata, immature

ascomata (top left). 3. Portion of ascoma in median vertical section. 4. Ascoma in median vertical

section. 5. Paraphyses, asci and ascospores.

358 ... Zhou & al.

textura angularis-porrecta. PARAPHYSES filiform, 1.8-2 tm wide, aseptate,

gradually or suddenly swollen to 4 um or branching once at the apex, covered

with a ca 1 um thick mucous coating. Asci maturing sequentially, cylindrical,

the apex round or slightly acute, 105-130 x 5.5-6.5 um, thin-walled, J-,

8-spored, with spores arranged in a fascicle. Ascospores filiform, 70-90 x

1-1.2 um, hyaline, aseptate, not quite tapering to the round base, enveloped in

a 0.8-1 um thick gelatinous sheath.

ECOLOGY & DISTRIBUTION: Ascomata on fallen leaves of Illicium simonsii.

Known only from the type locality, Hubei, China.

CoMMENTS— Terriera angularis is very similar to T: minor (Tehon) P.R. Johnst.

in the way ascomata are embedded and in ascal shape and size. However,

T: minor produces oblong to oblong-elliptic ascomata with a black flattened area

lining both sides of the single longitudinal slit-like opening, wider ascospores

(1.5-2 um) tapering slightly to both ends, paraphyses branching 2-3 times in

upper 30-40 um, and a faint to well-developed paler zone along the future line

of the immature ascoma opening (Johnston 1988, 1989a, b).

Terriera cladophila is easily distinguished from the new species by its

subcuticular circular to elliptical ascomata, subhymenium consisting of textura

angularis and textura intricata, wider asci (6-9 um), and brown diffuse zone

lines (Minter 1996).

Acknowledgments

We are grateful to Dr D.W. Minter and Dr M. Ye for invaluable suggestions and

critically reviewing the manuscript, to Mr GJ. Jia for the field investigations. This study

was supported by the National Natural Science Foundation of China (No. 31270065,

31170019), and the Specialized Research Fund for the Doctoral Program of Higher

Education of China (No. 20070364002).

Literature cited

Chen JL, Lin YR, Hou CL, Wang SJ. 2012 [“2011”]. Species of Rhytismataceae on Camellia spp.

from the Chinese mainland. Mycotaxon 118: 219-230. http://dx.doi.org/10.5248/118.219

Eriksson B. 1970. On Ascomycetes on Diapensales and Ericales in Fennoscandia. 1. Discomycetes.

Symb. Bot. Upsal. 19(4): 1-71.

Gao XM, Zheng CT, Lin YR. 2012. Terriera simplex, a new species of Rhytismatales from China.

Mycotaxon 120: 209-213.

Johnston PR. 1988. An undescribed pattern of ascocarp development in some non-coniferous

Lophodermium species. Mycotaxon 31: 383-394.

Johnston PR. 1989a. Lophodermium (Rhytismataceae) on Clusia. Sydowia 41: 170-179.

Johnston PR. 1989b. Rhytismataceae in New Zealand 2. The genus Lophodermium on indigenous

plants. New Zealand J. Bot. 27: 243-274.

Johnston PR. 2001. Monograph of the monocotyledon-inhabiting species of Lophodermium.

Mycol. Pap. 176: 1-239.

Terriera angularis sp. nov. (China) ... 359

Minter DW. 1996. Terriera cladophila. IMI Descr. Fungi & Bact. no. 1296.

Song JF, Liu L, Li YY, Hou, CL. 2012. Two new species of Terriera from Yunnan Province, China.

Mycotaxon 119: 329-335. http://dx.doi.org/10.5248/119.329

Yang ZZ, Lin YR, Hou CL. 2011. A new species of Terriera (Rhytismatales, Ascomycota) from

China. Mycotaxon 117: 367-371. http://dx.doi.org/10.5248/117.367

Zheng Q, Lin YR, Yu SM, Chen L. 2012 [“2011”]. Species of Rhytismataceae on Lithocarpus spp.

from Mt Huangshan, China. Mycotaxon 118: 311-323. http://dx.doi.org/10.5248/118.311

MYCOTAXON

http://dx.doi.org/10.5248/122.361

Volume 122, pp. 361-368 October-December 2012

A new species of Mycena sect. Sacchariferae

from the Iberian cushion-shaped Genisteae

JUAN CARLOS ZAMORA? & SANTIAGO CATALA”?

‘Real Jardin Botanico, CSIC, Pza. de Murillo 2. E-28014, Madrid, Spain

?Instituto Agroforestal Mediterraneo, Universidad Politécnica de Valencia,

Camino de Vera s/n. E-46022, Valencia, Spain

*Institut Cavanilles de Biodiversitat i Biologia Evolutiva, Universitat de Valencia,

C/ Catedratico Beltran 2, E-46980, Paterna (Valencia), Spain

* CORRESPONDENCE TO: jczamora@rjb.csic.es

ABSTRACT— Mycena acanthophila, collected from several localities in Spain, is described

as a new species. It specialises by growing on dead branches of two spiny, cushion-shaped

species of Leguminosae. A complete description, drawings, and microphotographs showing

the morphological characters are accompanied by comparisons with morphologically related

taxa.

Key worps— acanthocysts, Echinospartum, Erinacea, nomenclature, taxonomy

Introduction

Mycena sect. Sacchariferae was first published as a nomen nudum by Kithner

(1938) and later validated by Singer (1962). This section is characterised by

the presence of acanthocysts in the pileipellis, which form a subhymeniform

layer on primordials and remain as terminal hyphal cells of the hyphae

when the pileipellis becomes a cutis with age. Desjardin (1995) subdivided

sect. Sacchariferae into three provisional stirps, Amparoina, Adscendens, and

Alphitophora), based on the presence or absence of cherocytes, caulocystidial

morphology, and the presence or absence of a basal disc.

Maas Geesteranus & de Meijer (1998) added another stirps named Fuscinea,

close to Alphitophora but with brownish contents in the acanthocysts of the

pileipellis.

According to Robich (2003), only seven species of sect. Sacchariferae have

been found in Europe: M. adscendens Maas Geest., M. alphitophora (Berk.)

Sacc., M. cecidiophila A.P. Berg et al., M. corynephora Maas Geest., M. nucicola

Huijsman, M. occulta Harmaja, and M. querciramuli Robich. Here, we describe

an apparently common new species from the Iberian Peninsula with a very

362 ... Zamora & Catala

specific habitat: dead branches of Echinospartum and Erinacea, two spiny

cushion-shaped genera in tribe Genisteae.

Materials & methods

Specimens were collected in the field and photographed when fresh with a Canon

EOS 50D. The macromorphological study was based on both fresh specimens and

photographs. The micromorphological study was performed mostly on air-dried

basidiomata, rehydrated with commercial ammonia or 3% KOH, and stained with

Congo Red. Melzer’s reagent was used for testing amyloid and dextrinoid reactions.

Measurements were all taken in ammonia solution with a Jeulin light microscope, under

a 100x immersion oil objective and 10x oculars. The hilar appendix was excluded for

basidiospore measurements, as well as excrescences for the other elements. The range

of dimensions outside the parentheses is provided after manually rejecting 5% of the

highest and lowest values, while the extremes are provided between parentheses. The Q

coefficient is calculated as length/breadth. Drawings were done by direct observation.

Dehydrated samples with absolute ethanol were dried by the critical point technique for

the scanning electron microscopy (SEM) study, which was done with a Hitachi S-4100

microscope. GPS data are according to the World Geodetic System datum, WGS84.

Studied specimens are deposited in the herbaria AH (Universidad de Alcala, Alcala de

Henares, Madrid), and VAL (Faculty of Biological Sciences, Universitat de Valencia,

Valencia), which acronyms follow Thiers (2012). Terminology follows that of Desjardin

(1995).

Mycena acanthophila J.C. Zamora & Catala, sp. nov. PLATES 1-3

MycoBank MB 564491

Differs from other species in Mycena sect. Sacchariferae by its yellowish basidiomata,

pliciform lamellae, and clamped hyphae.

Type: Spain, Aragon, Huesca, Jaca, San Juan de la Pefia, 42°30'18"N 0°38'13"W, alt.

1125 m, on Echinospartum horridum branches, 11-X-2010, J. Hernanz, J.C. Zamora & S.

Catala (holotypus, AH 40678; isotypus, VAL_MYCO 939).

Erymo oey: From the Greek axavOo<, spine, and giAog, friend, due to the habitat and

association with Echinospartum and Erinacea.

MACROCHARACTERS— PILEvus broadly conical to hemispherical at first, soon

broadly convex and with or without an umbo, finally plane or with the margin

slightly recurved in over-mature basidiomata; 0.4-1.7 mm diam.; granulose;

bright yellow in young basidiomata, pale yellow with a more coloured disc when

mature. STIPE central, filiform, cylindrical to slightly bulbous but never with a

basal disc; 0.5-4 x 0.08-0.16 mm; dry, with a granulose surface; bright yellow

when young, paler when mature. LAMELLAE often present in medium-sized

to large basidiomata, adnate to more or less decurrent, 0-6, pliciform, never

reaching the margin, pale yellowish to almost white; lamellar edge concolorous

with faces, smallest basidiomata often with a smooth hymenophore; lamellulae

absent in all cases. SMELL absent. TasTE not recorded.

Mycena acanthophila sp. nov. (Spain) ... 363

# ADA ee

PLaTE 1—Mycena acanthophila macroscopic features. A, some basidiomata of the holotype

collection. B, basidioma showing well-developed lamellae. C, detail of the granulose pileus

surface, due to the presence of acanthocysts. D, basidioma with almost smooth hymenophore.

(Photographers, A: S. Catala; B, C & D: J. Hernanz)

MICROCHARACTERS— BASIDIOSPORES subglobose to broadly ellipsoid,

rarely globose or ellipsoid, often subamygdaliform to citriform (both ends

slightly pointed), (7.5-)8-10 x (6-)6.5-8 um, Q= 1.06-1.35(-1.42), amyloid;

hilar appendix about 0.5 um long. Basip1a 4-spored (rarely a few 2-spored),

mostly 22-31 x 9.5-11.5 um, but sometimes a low percentage of basidia

with a root-like base, then up to 40 um long; sterigmata 3.5-5 um long.

CHEILOCYSTIDIA present in basidiomata with more or less developed lamellae,

claviform, 13.5-22 x 8.5-12 um, covered with 1-3 um long excrescences in the

upper half. PLEUROCYSTIDIA not seen. LAMELLAR TRAMA hyphae 2-6 um wide.

PILEIPELLIS composed of 5-8.5 um wide hyphae and inflated cells <11 um wide

with excrescences on the upper side; acanthocysts protruding among hyphae,

broadly clavate to sphaeropedunculate, 12-25 x 8-15 um, covered with 1-3.5

(-4.5) um long excrescences. PILEITRAMA hyphae 2.5-8 um wide (broader

near the margin). CAuLocystTip1A claviform, short- to long-stalked, 12-40 x

6.5-12.5 um, densely covered with 1-3.5(-5) um long excrescences; sometimes

up to 120 um long, thin- to somewhat thick-walled, smooth hairs appearing

at the base, inconstant. STIPITIPELLIS hyphae 1.5-5 um, densely covered with

364 ... Zamora & Catala

1-3 um long excrescences. STIPITITRAMA hyphae 2.5-10 um wide. Pileus and

lamellar context more or less dextrinoid, stipe context strongly dextrinoid.

CLAMP CONNECTIONS present in most structures, but often inconspicuous, best

seen in subhymenium.

ECOLOGY & DISTRIBUTION— The ecology and distribution of M. acanthophila

are linked with those of its Echinospartum and Erinacea hosts. Cushion-shaped

communities of Echinospartum horridum (Vahl) Rothm. and Erinacea anthyllis

Link dominate high level mountains on calcareous soils and are subject to some

drought. Echinospartum horridum is an endemic species from northern Iberian

Peninsula to southern France, while Erinacea anthyllis is widely distributed in

the Iberian Peninsula, southern France, and northern Africa (Talavera 1999).

Both hosts are able to grow under hard conditions, like strong winds, drought,

poorly developed soils, and cold (Bonet et al. 2009).

Despite these stressful conditions, the microclimate created inside the

cushion is suitable for basidiomata development, where a few fungal species

can fruit. From an ecological standpoint, the new species can be considered

highly specialised. We observed that M. acanthophila grows only inside

cushions, and we never found it on the most exposed dead branches. What

is more, basidiomata quickly dry up when extracted from the cushion when

humidity is not extremely high. The species is very common in its habitat, so

future records are to be expected in any place where the hosts are present and

may even associate with other species of spiny pulvinular Genisteae.

ADDITIONAL SPECIMENS EXAMINED— SPAIN. ARAGON: Huesca, Arguis, monte

Peirdé, 42°20'N 1°42’W, alt. 1500 m, on Echinospartum horridum branches, 16-X-

2010, J. Hernanz (AH 40679); Huesca, Caldearenas, puerto de Monrepés, 42°20'36"N

0°23'38"W, alt. 1280 m, on E. horridum branches, 12-X-2010, J.C. Zamora, J.C. Campos

& S. Catala (AH 40680); Castiello de Jaca, pista de las Blancas, 42°39'03"N 0°34'25"W,

alt. 1145 m, on E. horridum branches, 11-X-2010, J. Hernanz, J.C. Zamora & S. Catala

(AH 40681); Fanlo, 42°35'28"N 0°01'17"W, alt. 1380 m, on E. horridum branches, 12-

XII-2010, J. Hernanz (AH 40682); Jaca, Pefia de Oroel, 42°31'N 0°31'W, alt. 1670 m,

on E. horridum branches, 14-X-2010, J. Hernanz (AH 40683); Jaca, carretera de Navasa

a Oroel, 42°31'16"N 0°28'55"W alt. 1060 m, on E. horridum branches, 11-X-2010, J.

Hernanz, J.C. Zamora & S. Catala (AH 40684); Jaca, San Juan de la Pefia, 42°30'25”"N

0°39'01"W, alt. 1250 m, on E. horridum branches, 10-X-2010, J.C. Zamora, S. Catala,

J. Hernanz & P.P. Daniéls (AH 40685); 13-XII-2010, J. Hernanz, AH 40686; 42°30'N

0°40'W, alt. 1260 m, on E. horridum branches, 12-X-2010, J. Hernanz (AH 40687);

42°30'40"N 0°39'47"W, alt. 1275 m, on E. horridum branches, 11-XII-2010, J. Hernanz

(AH 40688); 42°30'41.5"N 0°39'51.2"W, alt. 1270 m, 28-XII-2010, J. Hernanz (AH

40689); 42°30'18"N 0°41'04"W, alt. 1330 m, on E. horridum branches, 13-XII-2010,

J. Hernanz (AH 40690); Santa Cruz de la Serdés, San Juan de la Pefia, 42°30'54"N

0°41'10"W, alt. 1118 m, on E. horridum branches, 13-XII-2010, J. Hernanz (AH 40691);

Torla, puerto de Cotefablo, 42°36'56"N 0°12'07"W, alt. 1510 m, on E. horridum branches,

12-XIJ-2010, J. Hernanz (AH 40692); Villanua, fuente del Paco, 42°04'13"N 0°03'13"W,

alt. 1190 m, on E. horridum branches, 10-X-2010, J.C. Zamora & S. Catala (AH 40693);

Yebra de Basa, Santa Orosia, 42°30'N 0°15'W, alt. 1530 m, on E. horridum branches, 15-

Mycena acanthophila sp. nov. (Spain) ... 365

PLaTE 2— Mycena acanthophila microscopic features. A, hyphae of the pileipellis and protruding

acanthocysts. B, morphological variation of some detached acanthocysts. C, basidiospores.

D, cheilocystidia. E, basidia, including one with a root-like base. F, caulocystidia at the middle part

of the stipe. G, caulocystidia at the stipe base, with inconstant smooth hairs. Scale bar = 10 um.

366 ... Zamora & Catala

X-2010, J. Hernanz (AH 40694); Yésero, puerto de Cotefablo, 42°36'57"N 0°12'34"W,

alt. 1420 m, on E. horridum branches, 12-XII-2010, J. Hernanz (AH 40695). CASTILLA

LA MANCHA: GUADALAJARA, embalse de Alcorlo, 41°00'36.5"N 3°01'19.8"W, alt. 940

m, on Erinacea anthyllis branches, 28-XI-2010, J.C. Campos & J. Hernanz (AH 40696);

Somolinos, Sierra de la Pela, 41°15'20.3"N 3°01'19.8"W, alt. 1300 m, on E. anthyllis

branches, 8-I-2011, J. Hernanz (AH 40697). COMUNIDAD VALENCIANA: CASTELLON,

El Toro, Sierra de el Toro, 39°54'44.87"N 0°48'39.50"W, alt. 1464 m, on E. anthyllis

branches, 15-X-2010, G. Salva & S. Catala (VAL_MYCO 940). NAVARRA: Lumbier,

subida Leyre-Arangoiti, 42°38'40.9"N 1°11'48.9"W, alt. 1340 m, on E. anthyllis branches,

31-XII-2010, J. Hernanz (AH 40698).

CoMMENTS— Mycena acanthophila is placed in sect. Sacchariferae, stirps

Alphitophora based on the pileipellis with acanthocysts, absence of cherocytes,

presence of caulocystidia that are densely covered by small warts or spinules,

and a stipe without a basal disc (Desjardin 1995). It is well characterised

macroscopically by its tiny size, yellowish colouration, comparatively short

stipe, and reduced (sometimes absent) lamellae; the often subamygdaliform to

citriform basidiospores are also quite unusual.

Two species in sect. Sacchariferae with a reduced hymenophore,

M. echinocephala (G.F. Atk.) Desjardin and M. cylindrospora A.H. Sm., also

belong to stirps Alphitophora. Mycena echinocephala, known only from the

holotype, differs by the smooth caulocystidia terminated by a spinulose cell [but

Desjardin (1993) observed only an amorphous apex when studying the type],

unclamped hyphae, different basidiospores, and white basidiomata. Mycena

cylindrospora can be distinguished by unclamped hyphae, absence of hymenial

cystidia, different basidiospores, smooth hymenophore, infundibuliform pilei at

maturity, and white basidiomata. Both species grow on Rhododendron leaves.

Very few taxa in this section have been described with a yellowish

colouration. Perhaps the most similar, Mycena chloroxantha Singer, is easily

distinguished by the presence of cherocytes in the pileipellis (which places it

in stirps Amparoina), well-developed close lamellae, ellipsoid basidiospores,

very long caulocystidia, and absence of clamp connections. What is more, var.

chloroxantha exhibits a well-developed, costate basal disc, which is absent in

var. appalachienensis Desjardin (Desjardin 1995).

More recently described species in stirps Alphitophora — M. dissimilis,

M. pistacea, M. hylophila, and M. umbratilis (Maas Geesteranus & de Meijer

1997, 1998) — all differ in well-developed lamellae, non-yellow basidiomata,

and different anatomical features, particularly basidiospores. In addition,

M. dissimilis and M. pistacea lack clamp connections.

Finally, the only two previously known European species of stirps

Alphitophora, M. alphitophora and M. corynephora, are readily distinguished

by larger white to greyish white basidiomata, well-developed lamellae,

basidiospore shape and size (mostly pip-shaped to ellipsoid in M. alphitophora

and subglobose in M. corynephora), and much longer caulocystidia that confer

Mycena acanthophila sp. nov. (Spain) ... 367

PLaTE 3— Mycena acanthophila SEM photographs. A: pileus margin showing the pileipellis with

acanthocysts. B, 4-sterigmate basidia. C, cheilocystidium. D, caulocystidium. E, attachment of stipe

with the substratum. F, detail of the stipe base. Scale bars: A = 20 um; B, C = 3 um; D = 4 um;

E=50 um; F = 10 um.

a puberulous to hirsute appearance to the stipe surface (Desjardin 1995, Robich

2003).

Acknowledgments

The authors are grateful to all the collectors, especially J. Hernanz for providing

most of the studied material and macrophotographs. We are indebted to A. Aronsen

368 ... Zamora & Catala

(Norway) and G. Robich (Italy) for their invaluable reviews of the manuscript. We also

thank Helen Warburton for kindly checking the English wording, and David Lazaro and

Eva Barreno for their assistance and financial support with the SEM.

Literature cited

Bonet FJ, Zamora R, Gastén A, Molina C, Bariego P. 2009. Matorrales pulvinulares ordfilos

europeos meridionales. In: VV.AA., Bases ecoldgicas preliminares para la conservacion de los

tipos de habitat de interés comunitario en Espafia. Madrid: Ministerio de Medio Ambiente, y

Medio Rural y Marino. 122 pp.

Desjardin DE. 1993. Notes on Mycena cylindrospora and Eomycenella echinocephala. Mycologia

85(3): 509-513. http://dx.doi.org/10.2307/3760711

Desjardin DE. 1995. A preliminary accounting of the worldwide members of Mycena sect.

Sacchariferae. Bibliotheca Mycologica 159: 1-89.

Kihner R. 1938. Le genre Mycena. (Fries). Etude cytologique et systématique des espéces d’Europe

et d’Amérique du Nord. Encyclopéde Mycologique 10: 1-710.

Maas Geesteranus RA, de Meijer AAR. 1997. Mycenae paranaenses. Kon. Ned. Akad. Wet. Verh.,

Afd. Nat., Tweede Reeks 97: 1-164.

Maas Geesteranus RA, de Meijer AAR. 1998. Further Mycenas from the state of Parana, Brazil.

Persoonia 17(1): 29-46.

Robich G. 2003. Mycena d’Europa. Associazione Micologica Bresadola, Trento.

Singer R. 1962. Diagnoses Fungorum novorum Agaricalium II. Sydowia 15: 45-83.

Talavera S. 1999. Cytiseae. In: S Talavera et al. (eds.) Flora iberica 7(1). Real Jardin Botanico, CSIC,

Madrid.

Thiers B. 2012 [continuously updated]. Index Herbariorum: A global directory of public herbaria

and associated staff. New York Botanical Garden's Virtual Herbarium.

http://sweetgum.nybg.org/ih/

MY COTAXON

http://dx.doi.org/10.5248/122.369

Volume 122, pp. 369-387 October-December 2012

Myxomycete history and taxonomy:

highlights from the past, present, and future

HAROLD W. KELLER*

Botanical Research Institute of Texas, 1700 University Drive, Fort Worth, Texas 76107-3400

University of Central Missouri, Department of Biology and Earth Science,

Warrensburg, Missouri 64093, U.S.A.

*CORRESPONDENCE TO: haroldkeller@hotmail.com

ABSTRACT—'The past myxomycete legacy covers fruiting bodies preserved in fossil amber

more than 35 million years ago and early contributions by Linnaeus, de Bary, and the

Listers at the British Museum of Natural History (BM), among whom the Listers introduced

monographs, striking watercolors, and more narrow species concepts. Macbride and Martin

(University of Iowa) published illustrated myxomycete monographs with broader species

concepts. The transfer of the ~9500 specimen Iowa myxomycete collection to the United

States National Fungus Collections (BPI) is outlined and ~234 type specimens are listed.

Also covered is Lados recent NoMENMyx and the online resource nomen.eumycetozoa.com,

which offers ~900 names for accepted myxomycete species. The current status of the BM and

BPI myxomycete collections is noted, and Didymium saturnus provides an example of data

associated with myxomycete specimens in the American Type Culture Collection. Problematic

taxa are recommended for DNA sequencing to help clarify phylogenetic relationships.

Key worps—fossils, herbarium, Marie L. Farr, plasmodial slime molds, systematics

The legacy of the past

MyYXOMYCETES PRESERVED IN AMBER— Myxomycetes have a fossil past

that dates back to stalked sporangia of Stemonitis splendens Rostaf. that are

well preserved in Baltic amber from the Tertiary Period and Eocene Epoch

approximately 35 to 40 million years ago (Domke 1952; Keller & Everhart 2008).

Fossilized stalked sporangia of Arcyria sulcata Dorfelt & A.R. Schmidt were also

found in Baltic amber from the Eocene (Dorfelt et al. 2003; Dorfelt & Schmidt

2006; Keller & Everhart 2008). The general habit of these myxomycetes are so

similar to present-day species that it is apparent that morphology has changed

little in 40 million years. Given the advanced fruiting body development

observed in these fossils, we can assume myxomycetes have been around much

longer than 40 million years.

370 ... Keller

One can imagine the dominant coniferous forests of Pinus succinifera

(Goépp.) Conw. that thrived in a warmer subtropical climate and profusely

produced resin that accumulated in cracks inside the tree, under the bark, or

in wounds around the tree base. This resin eventually flowed and dripped on

decaying vegetation, trapping myxomycete fruiting bodies along with a variety

of arthropods and plants. The accumulation of Baltic resin (succinite) resulted

from millions of years of deposition. As rivers flowed through these forests, this

resinous material was carried to form today’s deltaic deposits along the Baltic

seacoasts at present-day Estonia, Latvia, and Lithuania. However, the Baltic

amber region also includes adjacent areas in Denmark, England, the Frisian

Islands, Germany, Norway, Poland, Russia (in an area called Samland, in the

Kaliningrad Oblast), and Sweden.

Fossil records of fragile myxomycete structures are rare due to the transitory

life cycle stages that appear briefly on surface substrata and weather away

in a relatively short time. Nevertheless, the excellent state of preservation in

myxomycete sporangia representing the Stemonitales and Trichiales suggests

that their geological past might extend to the Paleocene some 65 million years

ago when a warmer tropical climate still prevailed.

The 90-94 million year-old New Jersey Cretaceous amber deposits contain

the mushroom pileus and stalk of Archaeomarasmius leggetti Hibbett et al.

that resembles present-day Marasmius and Marasmiellus mushrooms that

are marcescent, persisting and reviving under moist conditions, instead

of putrescent, like many fleshy macrofungi (Hibbett et al. 1995; Hibbett et

al. 1997; Hibbett et al. 2003). This geological time period has the same tree

species and climatic conditions that should also support myxomycete fossils.

Discovery of the more ephemeral myxomycete sporangia is remote, and

calcareous members of the Physarales, the largest and presumably the most

morphologically advanced myxomycetes, never have been recorded in the fossil

record. However, wherever they are found, amber deposits should be screened

by a competent taxonomist for myxomycete fossils to avoid misidentification

of confusing and similar looking calicioid lichens (Keller & Everhart 2008). The

geological and historical recorded past should be included as part of any review

about the myxomycetes.

EARLY STUDENTS OF THE MyxomycetTes— ‘The first literature on myxomycetes

dates back to 1654 with Pankow’s (sometimes spelled Panckow) figure and

illustration of the species now known as Lycogala epidendrum (L.) Fr. Although

Linnaeus SPECIES PLANTARUM, published in 1753, is the nomenclatural

starting point for the Myxomycetes, his treatment of them was best summed up

by Martin & Alexopoulos (1969: 18): “Linnaeus, to be sure, knew little about the

fungi or slime molds, and cared less.” Carl Linnaeus (1701-78), who considered

Myxomycete history and taxonomy... 371

the myxomycetes to be gasteromycetous fungi (puffballs), was undoubtedly

influenced by the appearance of Lycogala as a miniature puffball. Martin (1966)

provides a more detailed account and review of these early students of the

myxomycetes.

The 1800s were marked by a better understanding of the myxomycete life

cycle by Heinrich Anton de Bary (1831-88) and the taxonomic advances by

his student Jozef Thomasz Rostafinsky (1850-1928). Earlier myxomycete

taxonomists had relied primarily on the striking variation of macroscopic

characteristics, whereas Rostafinsky (1874, 1875, 1876) ushered in use of

microscopic characters that would largely influence later description and

classification of the Myxomycetes. De Bary has been called the founding father

of plant pathology and mycology, which also embraces myxomycology. He was

the first to demonstrate myxomycete spore germination and the subsequent

stages of myxamoebae, swarm cells, plasmodia, and fruitbody development. De

Bary’s observations provided the microscopic evidence that led to removal of

the Myxomycetes from the fungal Gasteromycetes and the coinage of the name

Mycetozoa (Martin 1958; Everhart & Keller 2008).

ARTHUR AND GULIELMA LISTER, MYXOMYCETES, AND THE BRITISH MUSEUM

(NATURAL HISTORY, NOW THE NATURAL History MuseuM)— ‘The lives of the

Listers (father Arthur, 1830-1908 and daughter Gulielma, 1860-1949) spanned

119 years. In the main, their world monographs [1894, 1911 (second edition),

1925 (third edition)] follow Rostafinsky’s classification. The Lister publications

stand as a landmark in myxomycete taxonomy, influencing many regional

treatises that appeared over the following 50 years. More attention is given to

the range of environmental conditions and the remarkable extent to which

these factors may influence the appearance and structures of the developing

fruiting body. Even so, they recognized 274 species, 101 varieties, and one form

for a total of 376 taxa. The more than 60-year influence of the Listers as world

authorities on myxomycete taxonomy, especially throughout Europe, resulted

in a more frequent use of variety to designate differences in habit, color, and

structural microscopic changes in fruiting body morphology. The 128 color

and 94 black-and-white plates by Gulielma Lister in the 1925 edition are

without equal and stand as a lasting tribute to her artistic skill. Because many

species in 53 genera are illustrated in color, they can be easily ‘picture-keyed’

and correctly identified. The Listers’ valuable type myxomycete specimens are

deposited in the collections at The Natural History Museum (BM) formerly the

British Museum (Natural History), London, United Kingdom.

MACBRIDE, MARTIN, MYXOMYCETES, AND THE UNIVERSITY OF IowA— The

1900s highlighted the active research of Thomas Huston Macbride (1848-1934)

and George Willard Martin (1886-1971), who served on the faculty at the

372 ... Keller

University of Iowa (U.S.A.). Their lifetime professional careers spanned almost

100 years (1878-1971) in the Department of Botany at the university. Their

field collections, laboratory research, and publications were based largely

on specimens housed in the University of lowa Myxomycete Collection that

also included collections of Bethel, Bilgram, Ellis, Farlow, Gilbert, Hagelstein,

Harvey, Morgan, Plunkett, Rex, Shimek, and Wingate from America and

of Brandza, Japp, Meylan, and Sydow from Europe. Collections were also

contributed by O.F Cook (Liberia) and the Listers (who corresponded and

exchanged specimens with Macbride).

The world monograph, “The Myxomycetes” by Macbride and Martin was

published in 1934 shortly after Macbride’s death. The preface by Macbride

reads:

To assist in meeting such inquiry and interest is the purpose of this book. For

this edition it has been to the writer’s great pleasure and advantage to have

the assistance of his colleague, Dr. G. W. Martin: the introduction and general

editing of the text is his. By enlarging our field of inquiry, the number of species

presented has been greatly enlarged. New plates were needed, — all our plates are

new! To the young botanists of our continent and to our contributors around

the world, the present volume is especially devoted. May they fare well! T.H.M.

The monograph includes 21 plates and 568 figures, all in black and white. Gladys

Baker prepared the habit sketches and a number of her diagrams were made

from paraffin sections. Spores, capillitia, and other microscopic structures were

drawn by Martin in pencil aided by a camera lucida and using an apochromatic

oil immersion lens at a uniform magnification of 1200x to facilitate comparison

of these critical characters.

Comparison of the final monographs by Macbride & Martin (1934) with

the Listers (Lister 1925) show a trend away from subspecific taxa. Indeed, the

Martin introduction emphasizes this trend:

Decision as to the limits of species and genera must necessarily be a matter

of personal judgment, and this is perhaps more apparent in the slime molds,

because of their obvious responsiveness to environmental conditions while the

fructifications are forming, than in most other groups. We have felt justified

in applying a distinctive specific name to any form which shows reasonable

constancy under varying conditions, even though occasional intermediate

forms may appear. The multiplication of varieties has nearly if not quite reached

the saturation point. Many of the varieties listed in the literature are obviously

merely growth forms; some are doubtless autonomous species. If the latter,

they will eventually be recognized as such; if the former, it would seem better

to modify the diagnosis of the species to accommodate them, rather than to

multiply names.

The 1934 book recognized a total of 59 genera, 366 species, and 40 varieties.

Subjective interpretation was used in some cases to tabulate a variety designation

Myxomycete history and taxonomy ... 373

Fic. 1. Thomas Huston Macbride (1848-1934)

(Courtesy THE SCIENTIFIC MONTHLY)

because it is not clear whether Macbride merely mentioned the variety name in

passing or actually recognized the variety as distinct. In any case the number of

varieties is greatly reduced from previous myxomycete authors.

Macbride (Fic. 1), who was heralded as a passionate conservationist and

served as the first president of the Iowa Park and Forestry Association, also

established the Iowa Lakeside Laboratory at Lake Okoboji in 1909 (Martin

1935). Among the many other honors too numerous to mention are the

facts that Macbride served as the tenth president of The University of lowa

(1914-1916) and that the building housing the University of lowa Museum of

Natural History now bears the name of Macbride Hall, dedicated in his honor

shortly after his death in 1934 (Martin 1935).

Progress in the present

MARTIN, ALEXOPOULOS, AND THE UNIVERSITY OF IOWA MyYXOMYCETE

COLLECTION— ‘The tradition of myxomycology at the University of Iowa

has involved three outstanding myxomycologists, Macbride, Martin, and

Alexopoulos. The world monograph “The Myxomycetes” by Martin &

Alexopoulos (1969) was another milestone in myxomycete nomenclature and

taxonomy. These two myxomycologists worked as a team when Martin was

374 ... Keller

in retirement and Constantine John Alexopoulos (1907-86) was Chairman of

the Department of Botany at the University of Iowa and later served on the

faculty at the University of Texas. This book is based on the Macbride—Martin

Collection at the University of Iowa that also includes additional numerous

collections of C. J. Alexopoulos, Travis E. Brooks, William Bridge Cook, and

Donald T. Kowalski.

Perusal and tabulation ofall species descriptions yields 53 genera, 425 species,

and 2 varieties. The trend here again is away from sub-specific designations, as

emphasized by the following:

One fact should be stressed. The plasmodium may develop its characteristic

fruiting stage in less than 24 hours. If this occurs under conditions which cause

unduly rapid drying or if repeated rains check the process, great variation may

be induced. Under such influences, species which ordinarily have stalks may be

sessile or nearly so, or the stalks may be inordinately long; sporangiate species

may form plasmodiocarps; aethalioid forms may approach the sporangiate

type; the characteristics and disposition of limy secretions may be altered; spore

maturation may be checked, resulting in spore-like bodies which are much

larger than fully matured spores. Cold weather, and particularly frosts, may

induce similar alterations. Such variations are in large part responsible for the

extensive synonymy found in the group. Great caution is indicated in describing

as new specimens that are the result of such environmental responses. They

are not “abnormal”; they are natural responses of the organisms involved to

particular stimuli and must be so regarded. Giving them taxonomic status as

named varieties serves only to complicate the nomenclature and to extend the

meaning of the category variety beyond its legitimate significance. (Martin &

Alexopoulos 1969: 3)

This rather long quotation captures the essence of Martin’s lifelong approach

to the taxonomy of the Myxomycetes. This trend in America toward taxonomic

conservatism, broader species concepts, and recognition of fewer species was

categorized as “species lumping” and those in Europe who had narrow species

concepts and described many new species, often based on single collections

and limited specimens, were categorized as “species splitters” (Bisby 1953).

All41 plates and 367 figures show individual images of habits and microscopic

characters of crystals, capillitium, and spores that represent a composite set of

morphological features. Spores, magnified at 1000x, lack the detail of today’s

scanning electron microscopic images. Spore ornamentation and other spore

characters used in keys relied on high dry power (430x), not the oil immersion

lens. This is not apparent in the book text but is what I observed when I was

a graduate student during the monograph’s preparation. All color illustrations

were made by Ruth McVaugh Allen using colored pencils.

The moist chamber culture technique that was introduced at the University of

Iowa Mycology Laboratory by Gilbert & Martin (1933) has led to the discovery

Myxomycete history and taxonomy... 375

Fic. 2. George Willard Martin (1886 -1971)

(Frederick W. Kent, Iowa City, photographer)

376 ... Keller

of many new tiny myxomycetes found on the bark of living trees. Echinostelium

de Bary, represented by only a single species, E. minutum de Bary, in 1874,

increased to five species in 1969 (Martin & Alexopoulos 1969). Macbrideola,

a genus named after T.H. Macbride by Gilbert (1934), described two new tiny

species, M. scintillans H.C. Gilbert and M. decapillata H.C. Gilbert, obtained

from the bark of living trees through moist chamber culture. Thirty-five years

later Macbrideola was represented by five species (Martin & Alexopoulos

1969).

The chronicle of Martin's life by Lentz & Benjamin (1971) and Wells & Lentz

(1973) was augmented by a personal account by Keller (1996). As a United States

Army Lieutenant during World War I, Martin was slightly wounded by artillery

fire while gathering intelligence on the battlefield during shelling and assaults

by the Americans and Germans. During World War I he served as Chief of

the Biological Laboratory at the Army Quartermaster Depot in Jeffersonville,

Indiana. The Botanical Society of America recognized his extraordinary

research and service and he was part of the first group to receive the Certificate

of Merit. He served as Director of the Lakeside Laboratory in Iowa from 1928 to

1934. A charter member of the Mycological Society of America, Martin became

its first Vice President in 1933 and President in 1944 and also served as Editor-

in-Chief of MycoLocia from 1950 to 1957. His experience teaching English

courses at Rutgers University and his command of narrative text undoubtedly

contributed to his 37-year tenure as the editor of the University of Iowa Studies

in Natural History from 1934 until his death. The picture of Professor Martin

(Fic. 2) was taken about the time of his retirement as head of the Department

of Botany in 1955.

He was selected by the North American Flora project as author of The

Myxomycetes published by the New York Botanical Garden (Martin 1949). The

subsequent world monograph, (Martin & Alexopoulos 1969) is still considered

the most authoritative work on the subject. This book along with his lifelong

research on myxomycetes were cited as the basis for the Henry Allan Gleason

Award given in 1970 to Professor Martin by the New York Botanical Garden for

an outstanding recent publication in the fields of plant taxonomy, plant ecology,

or plant geography.

During the course of his career he published more than 140 separate

titles that included journal papers and books and spanning different groups

from dinoflagellates to fungi. The broad spectrum of fungi treated included

pathogenic imperfects, water molds, ascomycetes, the Agaricales, the resupinates

of the Homobasidiomycetidae, bird’s nest fungi, soil fungi, and tropical fungi

from his trips to Colombia, Galapagos Islands, and Panama. Many collections

were made of jelly fungi (Tremellales) and true slime molds (Myxomycetes)

while serving as a world authority for these two groups. Most of his papers

Myxomycete history and taxonomy ... 377

were single-authored and his practice of not attaching his name as a coauthor

to student-authored papers was followed until his death. Professor Martin was

a research mentor for approximately 47 doctoral students (Wells & Lentz 1973),

who represented a living testament to his impact on fungi, myxomycetes, and

all who knew him professionally.

At the time of Professor Martin’s death in 1971, the Macbride—Martin

Myxomycete Collection at the University of lowa numbered approximately

9500 specimens. In a letter dated March 22, 1977 I was informed by Dr. Robert

L. Hulbary, Professor and Chairman of the Department of Botany, that the

decision not to fill the faculty position held by Professor Martin had resulted in

the transfer of the Macbride-Martin Collection of Myxomycetes, January, 1977

to the United States National Fungus Collections (BPI) located at Beltsville,

Maryland.

The summer of 1972, I was asked to curate the entire myxomycete collection

and compile a list of type specimens. Type specimens were kept in a separate

herbarium case that included specimens in boxes as well as microscope slides

carefully wrapped in tissue paper inside boxes and all were labeled as types.

A list of approximately 235 types (specimens and microscope slides) was

prepared from the names taken from the box labels and arranged alphabetically

by genus and species. In the following list, authors’ names have been corrected

and presented as standard abbreviations, where necessary. The following types

are now held in BPI:

Amaurochaete comata G. Lister & M. Brandza, A. ferruginea T. Macbr. & G.W. Martin, A.

minor Sacc. & Ellis, A. trechispora T. Macbr. & G.W. Martin; Arcyria annulifera Torrend

(slide only), A. corymbosa M.L. Farr & G.W. Martin, A. magna Rex; Badhamia armillata

Nann.-Bremek., B. cinerascens G.W. Martin, B. dearnessii Hagelst., B. gracilis (T. Macbr.)

T. Macbr., B. iowensis T. Macbr., B. viridescens Meyl.; Calonema aureum Morgan, C.

luteolum Kowalski; Ceratiomyxa morchella A.L. Welden; Clastoderma pachypus Nann.-

Bremek. (slide only); Comatricha acanthodes Alexop. (slide only), C. aggregata MLL.

Farr, C. amoena Nann.-Bremek., C. brachypus (Meyl.) Meyl., C. caespitosa Sturgis,

C. extendens Hagelst., C. longipila Nann.-Bremek., C. martinii Alexop. & Beneke, C.

mirabilis R.K. Benj. & Poitras, C. nodulifera Wollman & Alexop., C. peritricha Nann.-

Bremek., C. reticulata H.C. Gilbert, C. rispaudii Hagelst., C. shimekiana T. Macbr.,

C. subcaespitosa Peck, C. suksdorfii Ellis & Everh., C. synsporos Alexop.; Diachea

silvipluvialis M.L. Farr, D. thomasii Rex; Diacheopsis depressa K.S. Thind & T.N. Lakh.;

Dianema aggregatum Kowalski, D. andersonii Morgan, D. harveyi Rex, D. nivale (Meyl1.)

G. Lister; Dictydium rutilum G. Lister; Diderma antarcticum (Speg.) Sturgis (slide

only), D. brooksii Kowalski, D. cinereum Morgan, D. corrugatum 'T.E. Brooks & H.W.

Keller, D. darjeelingense K.W. Thind & H.S. Sehgal, D. indicum K.S. Thind & HLS. Sehgal,

D. mussooriense K.S. Thind & Manocha, D. nigrum Kowalski, D. platycarpum Nann.-

Bremek., D. roanense (Rex) T. Macbr., D. rugosum (Rex) T. Macbr., D. subcaeruleum

Kowalski, D. subdictyospermum (Rostaf.) G. Lister, D. subincarnatum Kowalski;

Didymium aurantipes T.E. Brooks & Kowalski, D. discoideum K.S. Thind & H.S. Sehgal,

D. floccosum G.W. Martin, K.S. Thind & Rehill, D. fulvum Sturgis, D. labyrinthiforme

378 ... Keller

G.W. Martin, Lodhi & N.A. Khan, D. leoninum Berk. & Broome, D. nivicola Meyl.,

D. orthonemata H.W. Keller & T.E. Brooks, D. ovoideum Nann.-Bremek., D. parietale G.W.

Martin & T.E. Brooks, D. rugulosporum Kowalski, D. saturnus H.W. Keller, D. synsporon

T.E. Brooks & H.W. Keller, D. verrucosporum A.L. Welden; Echinostelium cribrarioides

Alexop., E. elachiston Alexop.; Enerthenema melanospermum T. Macbr. & G.W. Martin,

E. syncarpon Sturgis; Hemitrichia karstenii (Rostaf.) Lister, H. montana (Morgan)

T. Macbr., H. obrussea Meyl., H. paragoga M.L. Farr; Lamproderma biasperosporum

Kowalski, L. cristatum Meyl., L. fusiforme Kowalski, L. gulielmae Meyl., L. pulchellum

Meyl., L. robustum Ellis & Everh., L. splendens Meyl., L. tuberculospora M.L. Farr,

L. verrucosum G.W. Martin, K.S. Thind & Sohi; Leocarpus fulvus T. Macbr.; Lepidoderma

crustaceum Kowalksi; Licea applanata Kowalski, L. biforis Morgan, L. denudescens Keller

& Brooks (paratype: TEB2502, as L colloderma ined.). L. erecta K.S. Thind & Dhillon,

L. fimicola Dearn. & Bisby, L. pedicellata (H.C. Gilbert) H.C. Gilbert, L. perexigua T.E.

Brooks & H.W. Keller, L. pseudoconica T.E. Brooks & H.W. Keller, L. pumila G.W. Martin

& R.M. Allen, L. punctiformis G.W. Martin, L. scyphoides T.E. Brooks & H.W. Keller,

L. synsporos Nann.-Bremek. (slide only), L. tuberculata G.W. Martin; Lycogala exiguum

Morgan; Macbrideola decapillata H.C. Gilbert, M. scintillans H.C. Gilbert; Metatrichia

horrida Ing; Oligonema aeneum P. Karst., O. fulvum Morgan; Orthotricha microcephala

Wingate; Paradiacheopsis cribrata Nann.-Bremek. (slide only); Perichaena brevifila

T.E. Brooks & H.W. Keller, P quadrata T. Macbr., P. syncarpon T.E. Brooks; Physarina

echinospora K.S. Thind & Manocha; Physarum auripigmentum G.W. Martin, P. bethelii

G. Lister, P confertum T. Macbr., P. dictyosporum G.W. Martin, P. galbeum Wingate,

P. limonium Nann.-Bremek., P- maculatum T. Macbr., P. mennegae Nann.-Bremek.,

P. metallicum Berk., P. mortonii T. Macbr., P. nicaraguense T. Macbr., P. nudum T. Macbr.,

P. oblatum T. Macbr., P pulcherrimum Berk. & Ravenel, P. retisporum G.W. Martin,

KS. Thind & Rehill, PB rubronodum G.W. Martin, P. serpula Morgan, P. spinulosum

K.S. Thind & H.S. Sehgal, P. tessellatum G.W. Martin & MLL. Farr, P. tropicale T. Macbr.,

P. variabile Rex, P. variegatum K.S. Thind & Dhillon; Schenella microspora G.W. Martin,

S. simplex T. Macbr.; Stemonitis carolinensis T. Macbr., S. herbatica Peck, S. inconspicua

Nann.-Bremek., S. morganii Peck, S. mussooriensis G.W. Martin, K.S. Thind & Sohi,

S. nigrescens Rex, S. smithii T. Macbr., S. uvifera T. Macbr., S. virginiensis Rex, S. webberi

Rex; Trichia andersonii Rex, T. cascadensis H.C. Gilbert, T. crateriformis G.W. Martin,

T. erecta Rex, T: mirabilis Nann.-Bremek., T. reniformis Peck; Tubifera papillata G.W.

Martin, K.S. Thind & Sohi; Wilczekia evelinae Meyl.

Marie L. FARR AND THE UNITED STATES NATIONAL FUNGUS COLLECTIONS—

Farr received her doctorate from the University of Iowa in 1957 under the

direction of Professors G.W. Martin and C.J. Alexopoulos. Thereafter, she

spent her professional career at BPI (1958-89), during that time accumulating

myxomycete collections from South American countries and the Caribbean

Islands between the Tropics of Cancer and Capricorn, a geographic area

designated as the Neotropics (Farr 1976). This led to the publication of No.

16 of the Flora Neotropica Monographic Series, a volume devoted to the

Myxomycetes. The approximately 280 myxomycete species recorded in Flora

Neotropica 16 also includes myxomycetes from Florida state (U.S.A.). This

myxomycete monograph includes not only the standard dichotomous keys but

also offers the first available synoptic keys for the identification of myxomycete

species.

Myxomycete history and taxonomy ... 379

It is especially appropriate here to recognize Farr’s publications, travels, and

collections in the Caribbean Islands and Brazil. She collected myxomycetes

during 16 months (1954-55) on the Caribbean island of Jamaica, after which

she published an artificial identification key to 26 genera of Jamaican slime-

moulds and separate keys to 104 species and 4 varieties (Farr 1957). Recife and

the Institute of Mycology at the University of Recife in Brazil was the location

of the IMUR herbarium where Farr studied myxomycetes and published a list

of 21 genera and 67 species during a stay of several months (Farr 1960). She

followed this with an illustrated key to the myxomycetes of South America

published in English (Farr 1968) that was the principal South American

resource for myxomycete identification. She also participated in the Bredin-

Archbold-Smithsonian Biological Survey of Dominica in 1966 that resulted

in 500 myxomycete specimens collected in the field (63 from moist chamber

cultures), representing 96 myxomycete taxa (Farr 1969).

The first field guide to myxomycetes was written by Farr as part of the How

to Know Pictured Key Nature Series launched by Harry E. Jaques in 1937 at

Iowa Wesleyan University (Farr 1981). This spiral-bound paperback, even

though out of print, is still an excellent source for beginners to identify the

more common myxomycete species with dichotomous keys.

Farr updated the Martin & Alexopoulos 1969 monograph in 1983 to provide

more current references and information in the introductory topical sections, to

reclassify some subclasses, families, and genera, and to add keys and discuss 47

genera under a new title, THE GENERA OF MyxomyYceTEs (Martin et al. 1983).

The 41 plates and 367 figures are the same as those published in the previous

world monograph (Martin & Alexopoulos 1969).

Many collections from Dr. D.H. Mitchel and $.W. Chapman, mostly from

higher elevations in Colorado, were deposited at the Denver Botanic Garden and

BPI in cooperation with Farr (Mitchel et al. 1980). A lifetime of contributions

by Dr. Farr to myxomycete taxonomy merits special recognition.

CaRLos LADO AND NOMENMyx— In 2001, Lado published NomMENmyx,

which involved the monumental task of searching the literature for names of

myxomycete species. Of the 4000 names applied to various myxomycete taxa

he uncovered, 900 are current names for accepted species. These names are now

in a database that can be updated over time with the addition of new names

and which has been developed into the online resource nomen.eumycetoza.

com. Another welcome future addition will be information on types assigned

to each myxomycete taxon, the herbarium where the type was deposited, and

the transcription of the original description, its geographical distribution, its

substratum, and synoptic keys.

Lado (2001) recognized 57 generaand approximately 900 species. Comparison

of subspecific taxa was not included but the number of genera closely parallels

380 ... Keller

that of Nannenga-Bremekamp (1991). As NoMENmy*x is strictly a compilation

of names that did not involve examination of type specimens, some taxa listed

may not represent legitimate myxomycete species; thus rigorous type studies

will help refine myxomycete taxonomy. Fortunately some generic names more

familiar to students of myxomycetes have been conserved in their more recent

usage, including Amaurochaete conserved against Lachnobolus, Ceratiomyxa

conserved against Famintzinia, Hemitrichia conserved against Hyporhamma,

Reticularia conserved over Enteridium, and Tubifera conserved over Tubulifera.

All taxonomists are urged to peruse all previous myxomycete names to avoid

publishing duplicate names for species new to science.

The promise of the future

MyYXOMYCETES AND HERBARIA— Preservation of myxomycete collections

in the past usually involved exposure to para-dichlorobenzene (PDB) and/

or naphthalene (organic chemical compounds present in mothballs) used to

protect against insects, mites, and fungal contaminants. The Macbride-Martin

Collection at the University of lowa was treated with mothballs for many years

before concerns that PDB was a potential carcinogen. Furthermore, Gray &

Alexopoulos (1968: 228), recommend PDB for use “...in the herbarium case

or drawer in which the specimens are stored.’ This was standard practice for

many herbaria of the mid-twentieth century. However, combination of age

and treatment with organic agents appears to fragment DNA in older type

myxomycete specimens, which impedes DNA amplification for taxonomic

molecular studies.

Schenella simplex T. Macbr. was considered a myxomycete for more than 100

years until light microscopy, scanning electron microscopy, and DNA analysis

revealed it to be a fungal gasteromycete (Estrada-Torres et al. 2005). The

holotype specimen (BPI 839197) was included in a morphological comparison

with specimens recently collected in Mexico. DNA extraction was successful for

one Mexican specimen, and its nuclear profile most closely matched the fungus

Geastrum saccatum Fr. whose sequence differed greatly from true myxomycete

sequences. Attempts to extract and analyze DNA from the holotype specimen

(BPI 839197) using the same molecular techniques were unsuccessful, as the

DNA had fragmented and deteriorated over time, either due to age or external

treatment with PDB or both (Dennis Miller pers. comm.).

Odell & Perkins (1976) observed that PDB adversely affects life cycle stages

of Didymium squamulosum (Alb. & Schwein.) Fr. by placing PDB crystals on

Petri dish lids, inverting the culture dish, and noting that myxamoebae died in

18 hours leaving ghost-like remnants on the agar surface. Similar treatment of

plasmodia stopped protoplasmic streaming within 40 seconds and caused death

after 20 minutes. Additional experiments showed that spores from sporangia

Myxomycete history and taxonomy... 381

of Comatricha nigra (J.F. Gmel.) J. Schrot., Trichia varia (J.F. Gmel.) Pers., and

T. favoginea (Batsch) Pers. collected on decaying wood showed a consistent

reduction in the percentage of germinated spores when exposed to vapor from

PDB crystals. Furthermore, after exposure to PDB, spores were abnormally

wrinkled and distorted in shape. These experiments also showed that the

percentage of spore germination decreased markedly after only three months.

Odell & Perkins (1976) concluded that PDB should not be used in herbarium

cases where myxomycete fruiting bodies are stored. Thus, more recently,

herbarium managers have had discussions about using type specimens for

possible molecular analysis. There is special concern that tiny fruiting bodies

of many myxomycete species should not be subjected to destructive techniques

used for DNA analysis.

More recent policy changes at BPI will require proof of experience and

protocols before granting permission for specimens to be destructively sampled

(Amy Rossman, pers. comm.). One possible option is to select an epitype from

more recently collected specimens similar to the Schenella collections from

Mexico (Estrada-Torres et al. 2005). Future molecular techniques may also be

developed that can overcome the barriers of age caused by fragmented DNA.

If at all possible, myxomycete type specimens should be deposited in

national herbaria that can provide long-term curation and make specimens

available to the scientific community. The Natural History Museum (BM) still

has a standing policy that specimens, including types, are generally not sent

on loan; however, applications to request “invasive sampling” if approved can

result in the loan of a small fragment of a fruiting body for SEM observation or

DNA extraction. There is justifiable concern that myxomycete fruiting bodies

are too small, brittle, and subject to possible damage when sent by mail.

THE LISTER MYXOMYCETE COLLECTION AT BM— The majority of the Lister

Myxomycete Collection is housed at BM but a substantial number of specimens

are also deposited at the Herbarium, Royal Botanic Garden, Kew (K). Plans are

in place to make more information on myxomycete specimens at both BM and

K more easily accessible to users. The future of the Lister specimens currently

involves the British Mycological Society (BMS) because it is the owner (including

copyrights) of the notebooks with the originals of the plates for the monograph

and many more unpublished sketches and partly colored illustrations. These

notebooks are kept at BM but are administered independently by the library

team and not by the Botany Department, which owns and curates only the

specimens and microscopic slides. Label information and macro-images of the

types will become available on the Internet within the next two years (Holger

Thiis, pers. comm.). Consultation with appropriate curators is encouraged to

coordinate access to the Lister illustrations and specimens.

382 ... Keller

THE UNITED STATES NATIONAL FUNGUS COLLECTIONS (USNFC)— The USNFC

has a herbarium, a library and extensive databases and web resources that serve

as a national and international resource. It is managed under the Systematic

Mycology and Microbiology Laboratory (SMML), a federal laboratory of the

US Department of Agriculture. There is a good overview of the resources with

links to each at http://nt.ars-grin.gov/sbmlweb/fungi/index.cfm. The direct link

to the database search pages is found at http://nt.ars-grin.gov/fungaldatabases.

The USNFC herbarium, referred to as BPI (BPI = Bureau of Plant

Industry), houses more than one million specimens. About 760,000 herbarium

specimens have already been entered into the specimen database, including the

Uredinales (rusts, 186,925), Agaricales sensu lato (45,637 specimens; 718 types),

Ustilaginales (smuts, 31,175), Polyporales (polypores, 91,976), Deuteromycetes

(imperfect fungi, 127,298), Ascomycetes (172,723), and C.G. Lloyd collections

(57,086, including myxomycetes) and thus covering most fungi important to

agriculture.

BPI is constantly growing and the database is updated accordingly. The

BPI Myxomycete Collection, now numbering between 50,000 and 60,000,

ranks as the largest in the world. These specimens have been bar-coded (with

12,532 records indexed) and are available on-line at http://nt.ars-grin.gov/

fungaldatabases/specimens/specimens.cfm.

The Myxomycete Collection of C.J. Alexopoulos at the University of Texas

was transferred to BPI and contains specimens from the state of Texas, U.S.A.,

Costa Rica, and Greece, along with the D.R. Reynolds collections from the

southeastern Asian countries of Thailand, Burma, and the Philippines. The

entire Brooks Myxomycete Collection was also transferred to BPI. Many other

collectors have deposited myxomycete collections at BPI, but in far fewer

numbers.

THE AMERICAN TYPE CULTURE COLLECTION— ‘The importance of spore-

to-spore culture of myxomycetes and the deposit of living cultures with the

United States American Type Culture Collection (ATCC) provides future

source materials for scientific experimentation, genetic discovery, and species

validation. Good myxomycete taxonomic practice should include the spore-

to-spore cultivation of proposed new taxa (See also “Importance of Spore-to-

Spore Cultivation and Living Cultures - A Biological Standard,” Keller 1996).

The mission of ATCC (wwwatcc.org), a private nonprofit biological

resource center and research organization, is to acquire, authenticate, preserve,

develop, standardize, and distribute biological materials and information

for the advancement and application of scientific knowledge. The ATCC

Myxomycete Collection (excluding <50 protostelid and >400 dictyostelid

strains) is represented by 36 species and slightly less than 200 strains, including

the following:

Myxomycete history and taxonomy... 383

Arcyria elaterensis Mulleavy, Badhamia gracilis (T. Macbr.) T. Macbr., Clastoderma

debaryanum A. Blytt, Comatricha laxa Rostaf., Cribraria violacea Rex, Diachea

leucopodia (Bull.) Rostaf., Didymium difforme (Pers.) Gray, D. iridis (Ditmar) Fr.,

D. nigripes (Link) Fr., D. squamulosum (Alb. & Schwein.) Fr., Echinostelium arboreum

H.W. Keller & T.E. Brooks, E. coelocephalum 'T.E. Brooks & H.W. Keller, E. minutum

de Bary, Metatrichia vesparium (Batsch) G.W. Martin & Alexop., Physarum cinereum

(Batsch) Pers., P. compressum Alb. & Schwein., P didermoides (Pers.) Rostaf.,

P. flavicomum Berk., P. melleum (Berk. & Broome) Massee, P. polycephalum Schwein.,

P. pusillum (Berk. & M.A. Curtis) G. Lister, P rigidum (G. Lister) G. Lister, P roseum

Berk. & Broome, Stemonitis flavogenita E. Jahn, Willkommlangea reticulata (Alb. &

Schwein.) Kuntze

Each accessioned strain is assigned an ATCC number with associated

information about the live culture and the origin of the collection. Didymium

saturnus H.W. Keller is presented as an example (Keller 1970):

ATCC Number, Order this item, 64178", Organism, Didymium saturnus H.W. Keller,

Designations, HWK 132, Isolation, Oat straw, lowa, Depositors, H.W. Keller, Biosafety

Level, 1, Shipped, frozen, Growth Conditions, ATCC medium: Corn meal agar, half-

strength, Temperature: 24.0°C, Duration: grown with Escherichia coli ATCC 23437,

Permit/Forms, In addition to the MTA mentioned above, other ATCC and/or regulatory

permits may be required for the transfer of this ATCC material. Anyone purchasing

ATCC material is ultimately responsible for obtaining the permits. Please click here for

information regarding the specific requirements for shipment to your location, Type

Strain, yes, References, 13457: Keller HW. Didymium saturnus, a new myxomycete

occurring on straw stacks. Mycologia 62: 1061-1066, 1970. Three other collections

are also available as live, two-membered cultures deposited by HWK as ATCC 64199

Badhamia rhytidosperma H.W. Keller & Schokn. (Keller & Schoknecht 1989c); ATCC

64200 Didymium annulisporum H.W. Keller & Schokn. (Keller & Schoknecht 1989a);

ATCC 64201 Badhamia spinispora (Eliasson & N. Lundq.) H.W. Keller & Schokn. (Keller

& Schoknecht 1989b). Hardcopy books are no longer available thus relevant information

can be accessed online or by telephone. Deposit of myxomycete live cultures still is

possible and relevant information can be found at the ATCC website. Specific criteria can

be viewed online but consideration should be given as follows: “The expected demand or

need for all potential deposits is reviewed and prioritized with input from the scientific

community and is now a key factor in our acquisition protocol.”

DNA SEQUENCING OF PROBLEMATIC MYXOMYCETE TAXA— Future directions

using DNA sequencing techniques will surely unlock many phylogenetic

mysteries among the five myxomycete orders (Echinosteliales, Liceales, Trichiales,

Stemonitales, Physarales) plus a number of genera difficult to classify. Some of

these perplexing myxomycete taxa are monotypic (monospecific) genera with

a distinctive suite of characters. Several examples will serve to pinpoint the

taxonomic problems and to suggest a priority list of taxa that should receive a

higher priority for DNA sequencing.

Minakatella longifila G. Lister is a monotypic genus that has resided in the

Trichiales since described in 1921 within Arcyriaceae, a family with tubular

(hollow) capillitial threads; the Listers (1925) considered Minakatella close to

384 ... Keller

Perichaena. Martin and Alexopoulos (1969) included the genus in Dianemaceae

(Dianemataceae), emphasizing the apparent solid character of the capillitial

threads. After ultrastructural evidence showed clearly that the capillitial

threads of Minakatella were hollow, it was therefore transferred to the family

Trichiaceae (Keller et al. 1973).

Nannenga-Bremekamp (1982) used polarized light and the birefringent

property of spores and capillitium that triggered taxonomic changes for

Minakatella. The lack of birefringence of the capillitial threads led to removal of

Minakatella from Trichiales and establishment of a new family, Minakatellaceae,

in the Liceales. Birefringence of the capillitium using the Nannenga-Bremekamp

data is not constant (present and absent) within Trichiales, however, as

demonstrated by Arcyria and Perichaena capillitial threads with little or no

birefringence and Trichia and Hemitrichia with the highest measured levels

of birefringence, all genera are still retained in the Trichiales. Ing (1999: 365)

does not follow Nannenga-Bremekamp’s taxonomy, although he recognized

her taxonomic rank of the Minakatellaceae in the Trichiales. This is an extreme

example of the application of “tyranny of a character” or “taxonomic tinkering”

that has led to taxonomic confusion, proliferation of families, and the need for

DNA analysis to help solve the final disposition of questionable taxa.

More taxa that should be considered a higher priority for DNA analysis

because of uncertain taxonomic position are: Kelleromyxa fimicola (Dearn.

& Bisby) Eliasson, Listerella paradoxa E. Jahn, Protophysarum phloiogenum

M. Blackw. & Alexop., and Trabrooksia applanata H.W. Keller. These taxa

are rare and seldom collected, for example, the occurrence of fruiting bodies

of K. fimicola on herbivorous dung, L. paradoxa on Cladonia lichens, and

T. applanata on the bark of living trees (especially Juniperus virginiana L.). This

requires due diligence to find specimens in specific habitats capable of yielding

positive results for DNA analysis. More taxa that would help clarify generic

positions include Barbeyella minutissima Meyl., Calomyxa metallica (Berk.)

Nieuwl., Cornuvia serpula (Wigand) Rostaf., Badhamiopsis ainoae (Yamash.)

T.E. Brooks & H.W. Keller, Erionema aureum Penz., Leocarpus fragilis (Dicks.)

Rostaf., and Physarella oblonga (Berk. & M.A. Curtis) Morgan. These and

other taxa would provide valuable information for species currently granted

an uncertain taxonomic status. The future of myxomycete biosystematics will

depend more and more on DNA analysis, and I hope this will come sooner

rather than later.

Acknowledgments

Portions of this paper were presented as an invited address at the Seventh

International Congress on the Systematics and Ecology of Myxomycetes held at

Recife, Brazil, in September 2011 and appeared in the Abstract Volume distributed to

participants. I wish to express my sincere appreciation to Professor Dr. Laise de Holanda

Myxomycete history and taxonomy... 385

Cavalcanti, Universidade Federal de Pernambuco, Chair of ICSEM7 for the invitation

to present a tree canopy biodiversity graduate credit course, a myxomycete workshop,

organize and present round table discussions, and the opportunity for discourse with

myxomycologists from throughout the world. This paper is dedicated to my research

mentor and doctoral thesis advisor, Professor George W. Martin, who instilled in me

the desire to learn more about the taxonomy of the myxomycetes through his scholarly

example. My thanks go to Holger Thiis, (Curator of Lichens and Myxomycetes, Botany

Department, The Natural History Museum, Great Britain) for current information on the

Lister Collection and policy matters at BM. Amy Rossman, Director of BPI, and Shannon

Dominick, Scientific Collections Coordinator (Herbarium BPI, Systematic Mycology &

Microbiology Laboratory), contributed current information about collections. Anita N.

Phillips, Lead Microbiology Specialist, provided invaluable assistance concerning the

ATCC and is the contact person for the Eumycetozoan Special Collection (ESC). The

ESC houses all myxomycetes, protostelids, and dictyostelids within the Mycology and

Protistology Collections. Figure 1 photographic image of Thomas H. Macbride was

taken from The Scientific Monthly and George W. Martin Figure 2 was taken from a

print made by Frederick W. Kent Photography, Iowa City, Iowa. I want to thank my

former students and reviewers who suggested improvements in content, organization,

and sentence syntax.

Literature cited

Bisby GR. 1953. An introduction to the taxonomy and nomenclature of fungi. 2" edition.

Commonwealth Mycological Institute, Kew, Surrey, United Kingdom.

Domke W. 1952. Der erste sichere Fund eines Myxomyceten im Baltischen Bernstein (Stemonitis

splendens Rost. fa. Succini fa. nov. foss.). Mitteilungen aus dem Geologischen Staatsinstitut in

Hamburg. 21: 154-161.

Dorfelt H, Schmidt AR. 2006. An archaic slime mould in Baltic amber. Paleontology. 49:

1013-1017. http://dx.doi.org/10.1111/j.1475-4983.2006.00582.x

Dorfelt H, Schmidt AR, Ullmann P, Wunderlich J. 2003. The oldest fossil myxogastroid slime

mould. Mycological Research 107: 123-126. http://dx.doi.org/10.1017/S0953756202007025

Estrada-Torres A, Gaither TW, Miller DL, Lado C, Keller HW. 2005. The myxomycete genus

Schenella: morphological and DNA sequence evidence for synonymy with the gasteromycete

genus Pyrenogaster. Mycologia 97: 139-149. http://dx.doi.org/10.3852/mycologia.97.1.139

Everhart SE, Keller HW. 2008. Life history strategies of corticolous myxomycetes: the life cycle,

fruiting bodies, plasmodial types, and taxonomic orders. Fungal Diversity 29: 1-16.

Farr ML. 1957. A checklist of Jamaican slime-moulds (Myxomycetes). Bulletin of the Institute of

Jamaica, Science Series, 7: 1-67.

Farr ML. 1960. The myxomycetes of the IMUR herbarium, with special reference to Brazilian

species. Instituto de Micologia, Recife Publication 184. Recife, Brazil.

Farr ML. 1968. An illustrated key to the myxomycetes of South America, with special reference to

Brazil. Rickia 3: 43-88.

Farr ML. 1969. Myxomycetes from Dominica. Contributions from the United States National

Herbarium 37(6): 399-440.

Farr ML. 1976. Flora Neotropica, Monograph 16, Myxomycetes. New York Botanical Garden, NY.

Farr ML. 1981. How to know the true slime molds. The Pictured Key Nature Series, Wm. C. Brown

Company Publishers, Dubuque, Iowa.

386 ... Keller

Gilbert HC. 1934. Three new species of Myxomycetes. University of Iowa Studies in Natural History.

Contributions from the Botanical Laboratories. 16: 153-159.

Gilbert HC, Martin GW. 1933. Myxomycetes found on the bark of living trees. University of Iowa

Studies in Natural History, Papers on Iowa fungi IV. 15(3): 3-8.

Gray WD, Alexopoulos CJ. 1968. Biology of the Myxomycetes. The Ronald Press Company. New

York.

Hibbett DS, Grimaldi D, Donoghue MJ. 1995. Cretaceous mushrooms in amber. Nature 377: 487.

http://dx.doi.org/10.1038/377487a0

Hibbett DS, Grimaldi D, Donoghue MJ. 1997. Fossil mushrooms from Miocene and Cretaceous

ambers and the evolution of homobasidiomycetes. American Journal of Botany 84: 981-991.

http://dx.doi.org/10.2307/2446289

Hibbett DS, Grimaldi D, Donoghue MJ. 2003. Another fossil agaric from Dominican amber.

Mycologia 95: 685-687. http://dx.doi.org/10.2307/3761943

Ing B. 1999. The Myxomycetes of Britain and Ireland, an identification handbook. The Richmond

Publishing Co. Ltd. England.

Keller HW. 1970. Didymium saturnus, a new myxomycete occurring on straw stacks. Mycologia 62:

1061-1066. http://dx.doi.org/10.2307/3757619

Keller HW. 1996. Biosystematics of Myxomycetes: a futuristic view. Plenary Address. 23-37, in:

Second International Congress on the Systematics and Ecology of Myxomycetes (ICSEM2).

Real Jardin Botanico, CSIC. Madrid, Spain.

Keller HW, Everhart SE. 2008. Myxomycete species concepts, monotypic genera, the fossil record,

and additional examples of good taxonomic practice. Revista Mexicana de Micologica 27:

9-19.

Keller HW, Schoknecht JD. 1989a. Life cycle of a new annulate-spored species of Didymium.

Mycologia 81: 248-265. http://dx.doi.org/10.2307/3759707

Keller HW, Schoknecht JD. 1989b. Spore-to-spore culture of Physarum spinisporum and its transfer

to Badhamia. Mycologia 81: 631-636. http://dx.doi.org/10.2307/3760139

Keller HW, Schoknecht JD. 1989c. Spore-to-spore cultivation of a new wrinkled-reticulate-spored

Badhamia. Mycologia 81: 783-789. http://dx.doi.org/10.2307/3759883

Keller HW, Aldrich HC, Brooks TE. 1973. Corticolous myxomycetes II: notes on Minakatella

longifila with ultrastructural evidence for its transfer to the Trichiaceae. Mycologia 65:

768-778. http://dx.doi.org/10.2307/3758516

Lado C. 2001. NomeNnmyx. a nomenclatural taxabase of myxomycetes. Cuadernos de Trabajo de

Flora Micoldgica Ibérica 16: 1-221.

Lentz PL, Benjamin CR. 1971. George Willard Martin. Mycopathologia et Mycologia Applicata

45: 7-15.

Lister A. 1894. A monograph of the Mycetozoa: a descriptive catalogue of the species in the

Herbarium of the British Museum, 78 plates, each two separate units designated A and B and

with 51 woodcuts. First Edition, Printed by order of the trustees, British Museum of Natural

History, Cromwell Road S.W., London.

Lister A. 1911. A monograph of the Mycetozoa: a descriptive catalogue of the species in the

Herbarium of the British Museum, 200 plates, two to a page, numbered separately, and with 56

woodcuts. Second Edition revised by Gulielma Lister, Printed by order of the trustees, British

Museum of Natural History, Cromwell Road S.W., London.

Lister A. 1925. A monograph of the Mycetozoa: a descriptive catalogue of the species in the

Herbarium of the British Museum, Introduction xiii-xxxii, 223 plates, two to a page, numbered

separately, and with 56 woodcuts. Third Edition revised by Gulielma Lister, Printed by order of

the trustees, British Museum of Natural History, Cromwell Road S.W., London.

Myxomycete history and taxonomy ... 387

Macbride TH, Martin GW. 1934. The Myxomycetes: a descriptive list of the known species with

special reference to those occurring in North America. 21 plates. Habit sketches by Gladys

Baker. The Macmillan Company, New York, New York..

Martin GW. 1935. Thomas Huston Macbride, an appreciation. The Scientific Monthly 40:

284-286.

Martin GW. 1949. Fungi: Myxomycetes, Ceratiomyxales, Liceales, Trichiales, Stemonitales, Physarales.

North American Flora 1(1): 1-190.

Martin GW. 1958. The contribution of de Bary to our knowledge of Myxomycetes. The Iowa

Academy of Science 65: 122-127.

Martin GW. 1966. The genera of Myxomycetes. University of lowa Studies in Natural History 20(8):

132.

Martin GW, Alexopoulos CJ. 1969. The Myxomycetes. Color illustrations by Ruth McVaugh Allen.

41 plates and 367 figures. Iowa City: University of Iowa Press.

Martin GW, Alexopoulos CF, Farr ML. 1983. The genera of Myxomycetes. Iowa City: University of

Iowa Press.

Mitchel DH, Chapman SW, Farr ML. 1980. Notes on Colorado fungi IV: Myxomycetes. Mycotaxon

10(2): 299-349.

Nannenga-Bremekamp NE. 1982. Notes on myxomycetes. XXI, the use of polarized light as an aid

in the taxonomy of the Trichiales. Proceedings of the Koninklijke Nederlandse Akademie van

Wetenschappen, Series C, 85: 541-562.

Nannenga-Bremekamp NE. 1991. A guide to temperate myxomycetes. An English translation by A.

Feest and Y. Burggraaf of De Nederlandse Myxomyceten. Biopress Limited, Bristol, England.

Odell DE, Perkins ME. 1976. The effect of para-dichlorobenzene on myxomycetes. Bulletin of the

British Mycological Society 10: 86-87.

Pankow T. 1654. Herbarium portatile oder Behendes Krauter-und Gewachs-Buch. Berlin.

Rostafinsky JT. 1874. Sluzowce (Mycetozoa) Monografia. Towar. Nauk Scist. 5(4): 1-215.

Rostafinsky JT. 1875. Sluzowce (Mycetozoa) Monografia. Towar. Nauk Scist. 6(1): 217-432.

Rostafinsky JT. 1876. Sluzowce (Mycetozoa) Monografia. Dodatek (Appendix). Towar. Nauk Scist.

8: 1-43. 1876.

Wells K, Lentz PL. 1973. George Willard Martin. Mycologia 65: 985-998.

MY COTAXON

http://dx.doi.org/10.5248/122.389

Volume 122, pp. 389-398 October-December 2012

Synonymy of Suillus imitatus, the imitator of two species

within the S. caerulescens/ponderosus complex

Nuvu H. NGUYEN, JENNIFER FE. KEREKES,

Ese C. VELLINGA & THOMAS D. BRUNS

Department of Plant and Microbial Biology, University of California, Berkeley

111 Koshland Hall #3102, Berkeley CA, 94720-3102, U.S.A.

“CORRESPONDENCE TO: xerantheum@berkeley.edu

AsBstTRAcT—Identification of three species of Suillus, S. caerulescens, S. ponderosus, and

S. imitatus, has always been difficult because of overlapping and non-discrete morphological

characters. To solidify the identification of these taxa, we compared the nucleotide sequences

from the internal transcribed spacer region (ITS) of the type specimens of S. caerulescens,

S. ponderosus, S. imitatus var. imitatus, and S. imitatus var. viridescens with field collected

specimens which we identified as S. caerulescens, S. ponderosus, and S. imitatus in northern

California. Based on ITS sequence identity and phylogenetic inference, specimens of

S. caerulescens and S. ponderosus formed well-supported clades with the holotype of the

respective species. However, S. imitatus var. imitatus fits within the S. caerulescens clade

and S. imitatus var. viridescens fits within the S. ponderosus clade. Therefore, we synonymize

S. imitatus var. imitatus with S. caerulescens and S. imitatus var. viridescens with S. ponderosus,

and show that the species can indeed be recognized morphologically based on annulus

characteristics.

Key worps—bolete, phylogenetics

Introduction

Suillus Gray is a large ectomycorrhizal genus in the Boletales with about 170

known species (Index Fungorum and Mycobank); about half of those species

are found in North America (Bessette et al. 2000) and about 40 species in the

western United States (Smith 1979). The four taxa in this study, S. caerulescens,

S. ponderosus, S. imitatus var. imitatus, and S. imitatus var. viridescens (all within

section Boletinus), are restricted to the North American west coast. Smith &

Thiers (1964) described S. caerulescens, S. ponderosus, and S. imitatus as three

distinct species based mainly on texture of the annulus/annulus remnant and

pileus color. Later, Smith & Trappe (1972) described S. imitatus var. viridescens

from western Oregon based on the strong greening reactions of cut tissue in the

390 ... Nguyen & al.

TABLE 1. Morphological comparisons of four Suillus taxa. *

S. caerulescens

S. ponderosus

S. imitatus

var. imitatus

S. imitatus

var. viridescens

HOLOTYPE MICH12297 MICH12305 MICH12300 MICH12301

(Smith 48733) (Smith 20204) (Smith 48732) (Smith 78754)

PILEUS SIZE 6-14 cm 9-25 cm 4-12 cm 4-12(-15) cm

PILEUS COLOR Vinaceous, Deep vinaceous Orange cinnamon to Reddish orange,

ochraceous tawny brown to dingy cinnamon ferruginous, dull

to ochraceous testaceous to cinnamon

buff rufous to cream-

buff

alysis eee Serge ae sag VP oe mee ae aa ate

si SLE dit aed emer ie le hu

STIPE SIZE 2.5-8 x 9-14 x 3.5-6 x 3-9 x

mat 2 ay My cn Oe OO IMR Cr” RS I SS Rl

STIPE STAINING Base slowly blue Surface blue Base surface Surface blue

when cut to greenish (1/2-1/3) quickly and/or green in

blue when cut moist (not dry)

AEE) Re ects Ds ok ies Boe andes Ma Sadist mela etter Ae nce te tok Ae SC ater hed

ANNULUS Band-like, Membranous, Band-like, dingy Wide band with

fibrillose, reddish- pallid, staining buff-orange slimy

pallid to white, cinnamon, brownish, felty- edge, fragmentary

not gelatinous gelatinous tomentose (edges in age

with some gluten)

SPORES 8-ll x 8-10(-12) x 7-9 x 8-11 x

p etEPOLE DN, | L: Rs ae ae ee! ae att ee aa Fre ethereal oe tins tht

SPORES 7.6-10.2 x 6-8.4 x 7-10 x 7-11 x

(as measured) 4-4.4 um 4-4,2 um 4-4.5 um 4-4.4 um

* Adapted from Smith (1979), Smith & Thiers (1964), and Smith & Trappe 1972. Spore dimensions

are reported based on the literature and as measured in this study.

stipe and the strong green colored specimens in the field. TABLE 1 provides an

overview of the morphological characteristics of these four taxa.

The four taxa are recognized in monographs and western guidebooks (e.g.

Arora 1986, Bessette et al. 2000, Smith & Thiers 1964, Thiers 1967, 1975).

Suillus caerulescens and S. ponderosus are very common mycorrhizal associates

of Douglas-fir (Pseudotsuga menziesii (Mirb.) Franco), while S. imitatus was

described as a spruce associate (Smith & Thiers 1964) and is listed in modern

field guides as occurring in mixed conifer forests in the Pacific Northwest

(Bessette et al. 2000). In many years, fruit bodies belonging to the caerulescens/

ponderosus complex can be found in great abundance in coastal California

forests. As a result, it is not unusual to come across these taxa and to be faced

with the challenge of identifying them correctly. In the field, we rely heavily on

annulus characters to differentiate between species (Fic. 1), but this is a short-

lived, developmental character that can be altered or at least obscured by age

Suillus imitatus & the S. caerulescens-ponderosus complex ... 391

FiGure 1. Suillus caerulescens (A) and S. ponderosus (B):

Comparison of veil and other morphological characters.

and weather. Prof. Harry Thiers used to joke that in dry weather all specimens

had a dry annulus and were called S. caerulescens and in wet weather the annuli

were more gelatinous and the species was called S. ponderosus.

In contrast, the name S. imitatus is rarely applied to California material,

except to those collections that have a greenish tint and are referred to as

S. imitatus var. viridescens (Arora 1986). ‘The original description of S. imitatus

var. imitatus compared it primarily with S. lakei (Murrill) A.H. Sm. &

Thiers, but field guides usually compare it with S. caerulescens from which it

is distinguished with difficulty, by its supposedly slightly shorter spores and

slightly more orangish pileus (Thiers 1975, Arora 1986, Bessette et al. 2000).

Suillus lakei, another Douglas-fir associate closely related to the caerulescens/

ponderosus complex (Kretzer et al. 1996), is easily distinguished by its reddish,

fibrillose pileus. To help sort out the species present in our area, we combined

existing GenBank ITS sequences with newly acquired ITS sequences from the

holotypes and multiple collections of caerulescens/ponderosus complex.

Materials & methods

Our field collections were obtained from northern California (TABLE 2). We obtained

distribution information from our field-collected specimens, those deposited in the

University and Jepson Herbarium at the University of California, Berkeley (UC), photos

deposited in the online database Mushroom Observer that have clear identification, and

available checklists for Arizona (Bates 2006), Montana (C. Cripps pers. comm.), and the

Intermountain Region (Piep 2003). These sources combined to provided an acceptable

account for the overall natural distribution of the species studied here.

We extracted DNA from freshly collected specimens (UC 1861375-UC 1861389)

using a modified Sigma Extract-N-Amp kit (Sigma Aldrich, St. Louis, MO). For

392 ... Nguyen & al.

TABLE 2. Specimens sequenced in this study.

SPECIES COLLECTION COLLECTION HERBARIUM GENBANK

? DATE : LOCATION* # i #

S. caerulescens 3 Dec. 2006 CA: San Francisco Bay area UC 1861383 JQ958308

3 Dec. 2006 CA: San Francisco Bay area UC 1861384 JQ958309

3 Dec. 2006 CA: San Francisco Bay area UC 1861385 JQ958310

: 3Dec.2006 : CA: Marin Co., Mill Valley,

Natt Seley WE ee Mt Tamalpais te ite! Me hee

: 3Dec.2006 : CA: Marin Co., Mill Valley,

ed Ae ated me neat ee ni ie MeN ELON Lee ee eae | naa Me

: 3Dec.2006 : CA: Marin Co., Mill Valley,

eres gi dete deel whet ar eM aloe eae Ltn SISE og se ln aah ee a aM

: 3Dec.2006 = CA: Marin Co., Mill Valley,

: i Mt. Tamalpais UC 1861389 JQ958314

: 19 Nov. 2006 i CA: Mendocino Co., JDSF,

: ? Co. Rd 409 & Little Lake Rd., i UC 1861378 : JQ958315

39.3256 N 123.7372 W i :

S. ponderosus 19 Nov. 2006 CA: Mendocino Co., JDSE,

: : Co. Rd 409 & Little Lake Rd., i UC 1861375 : JQ958320

39.3256 N 123.7372 W : 2

19 Nov. 2006: CA: Mendocino Co., JDSK,

: : Co. Rd 409 & Little Lake Rd., UC 1861376 i JQ958321

39.3256 N 123.7372 W : :

: 19 Nov. 2006 CA: Mendocino Co., JDSE,

: : Co. Rd 409 & Little Lake Rd., i UC 1861377 : JQ958322

39.3256 N 123.7372 W i :

: 19 Nov. 2006 i CA: Mendocino Co., JDSF,

: ? Co. Rd 409 & Little Lake Rd., i UC 1861379 : JQ958323

39.3256 N 123.7372 W i :

: 19 Nov. 2006 : CA: Mendocino Co., JDSF,

: Co. Rd 409 & Little Lake Rd., | UC 1861380 : JQ958324

39,3256 N 123.7372 W

19 Nov. 2006 CA: Mendocino Co., JDSE,

: : Co. Rd 409 & Little Lake Rd., UC 1861381 i JQ958325

39.3256 N 123.7372 W : :

19 Nov. 2006 CA: Mendocino Co., JDSE,

: : Co. Rd 409 & Little Lake Rd., i UC 1861382 : JQ958326

39.3256 N 123.7372 W i :

S. caerulescens, : 9 Oct.1954 : WA: Pierce Co,

re. holotype 6. Oitete eden By aiSpenaway Pay, Se ee ees

S. imitatus var. 9 Oct. 1954 mie abet

Mt. Rainier National Park, ! MICH 12300 : JQ958317

Power House Woods : :

S. imitatus var. : 2Oct.1970 : OR: Lincoln Co., near Otis, i :

viridescens, holotype Van Duzer Corridor CHAZ SOT ag 0339810

S. ponderosus, : 24 Oct. 1944 } OR: Clackamas Co., i :

holotype i : Rhododendron palaces : a

imitatus, holotype

*Location abbreviations: JDSF = Jackson Demonstration State Forest.

‘Herbarium codes: UC = University and Jepson Herbaria, University of California, Berkeley;

MICH = University of Michigan Herbarium.

Suillus imitatus & the S. caerulescens-ponderosus complex ... 393

Suillus imitatus var. imitatus HOLOTYPE MICH12300, JQ958317

Suillus caerulescens HOLOTYPE MICH12297, JQ958316

Suillus caerulescens UC1861378, JQ958315

Suillus caerulescens UC1861384, JQ958309

Suillus caerulescens UBC F16304, EU486453

Suillus caerulescens UC 1861385, JQ958310

Suillus caerulescens UC 1861383, JQ95830

Suillus caerulescens UC 1861388, Q958313

Suillus caerulescens TDB-1028, L54096

Suillus caerulescens UC 1861386, JQ95831 1

Suillus caerulescens UC1861389, JQ958314

Suillus caerulescens UC1861387, JQ958312

Uncultured Suillus BJPO864T, JF792515

Uncultured ectomycorrhiza UBCOCS235, EF218818

Uncultured Suillus BUP1648T, JF792516

Suillus lakei clone Simb156s19A, EU557325

Suillus lakei isolate 140.2, DQ365643

Suillus lakei HDT-44112, L54086

Suillus lakei OUC97024, DQ367917

Uncultured Suillus UBCOFE582B, GU452528

Uncultured Suillus 1_117P3, JQ393127

Suillus amabilis N-5387, AF166499

Suillus ponderosus UC 1861375, JQ958320

Suillus imitatus var. viridescens HOLOTYPE 12301, JQ958319

Suillus ponderosus HOLOTYPE MICH12305, JQ958318

Suillus ponderosus UC1861379, JQ95832

Suillus ponderosus UC1861377, JQ958322

Suillus ponderosus UC1861380, JQ958324

Suillus ponderosus UC1861376, JQ958321

Suillus ponderosus UC1861382, JQ958326

Suillus ponderosus UC 1861381, JQ958325

Suillus spectabilis TDB-641, L5410

96/100

100/100

0.0080

Figure. 2. ITS-sequence based maximum likelihood tree of the Suillus species in this study.

Maximum likelihood followed by maximum parsimony bootstraps provide statistical support for

branches with >50% support. Each sequence contains the isolate/specimen number followed by a

GenBank accession number. Suillus spectabilis served as the outgroup.

specimens that had been stored in a herbarium, it was necessary to obtain high quality

DNA so we used a standard CTAB buffer lysis followed by chloroform extraction

and ethanol precipitation. DNA was extracted from the following herbarium type

specimens: MICH 12305, MICH 12297, MICH 12300 and MICH 12301. Herbarium

abbreviations are according to Thiers (2012; continuously updated). For field/recently

collected specimens, we used the standard fungal specific primers ITSIF (Gardes &

Bruns 1993) and ITS4 (White et al. 1990). For herbarium specimens with degraded

DNA we amplified the ITS gene in two segments when necessary. We used standard ITS

and Suillus ITS specific primers (ITS-2S and ITS-3S) in various combinations: ITS1F

and ITS2S or ITS2 and ITS3S or ITS3 and ITS4 (Bruns et al. 2010). Sequences were

produced using the standard BigDye Terminator v3.1 Kit and ran on an ABI Prism 3700

Genetic Analyzer (Life Technologies).

394 ... Nguyen & al.

We examined each automated sequence and manually interpreted and corrected

ambiguous bases using Sequencher (Gene Codes Corporation). These sequences were

deposited in GenBank under accession numbers (JQ958308-JQ958326). Using BLAST

we gathered from GenBank all sequences similar to the species mentioned as of April

24, 2012: S. lakei (GenBank L54086, DQ365643, DQ367917, EF218818, AF166499,

GU452528, JF792516, EU557325, JQ393127, JF792515), S. caerulescens (GenBank

154096, EU486453), and S. spectabilis (Peck) Kuntze (GenBank L54104) was used as

an outgroup species. We aligned the sequences manually and analyzed the alignment

using the maximum likelihood model GT[RGAMMA in RAxML (Stamatakis 2006).

Maximum likelihood bootstrap was performed using the RAxML online BlackBox

interface (Stamatakis et al. 2008). Maximum parsimony bootstrap was performed

using PAUP v.4.0b6 with 1000 replicates (Swofford 2001). Corrected distances between

sequences were found using the Kimura 2-parameter in PAUP (Swofford 2001).

Results & discussion

We obtained full length ITS coverage for three of the four type specimens

along with the 15 specimens that we collected for this study. We were able

to obtain only the ITS1 and ITS2 regions of the S. caerulescens holotype

MICH12297. We combined the sequences generated with GenBank sequences

of S. lakei, and the outgroup sequence from S. spectabilis. The matrix contained

32 taxa, 613 characters, and 30 parsimony informative characters. The resulting

maximum likelihood tree is shown in Fic. 2.

To our surprise specimens that we had determined as S. caerulescens and

S. ponderosus based on annulus differences (Fic. 1) separated into two clades

with good statistical support (Fic. 2). Despite the morphological similarities

between these two species, S. caerulescens is sister not to S. ponderosus, but to

S. lakei. Together these three species form a clade with moderately high support

(85%) based on an analysis of 40 Suillus taxa (data not shown). From these

results, we conclude that annular characters, when present, are a reliable way to

separate S. caerulescens from S. ponderosus (TABLE 1, Fi. 2).

In contrast, S. imitatus sequences did not fall within their own clade but fit

within the clades for the two other species: Suillus imitatus var. imitatus within

the S. caerulescens clade, and S. imitatus var. viridescens within the S. ponderosus

clade. At least so far, morphologically defined Suillus species separate fairly well

by ITS, but we know from other taxa that not all species may be distinguished

by differences within the ITS region (Manian et al. 2001, Bruns et al. 2010).

This prompts the question of whether there are morphological reasons to

suspect that one or both S. imitatus varieties might be distinct at the species

level. Interestingly, in the discussion that followed separation of the S. imitatus

varieties, Smith & Thiers (1964) and Smith & Trappe (1972) initially thought

that S. imitatus var. imitatus might represent S. caerulescens and S. imitatus

var. viridescens might be S. ponderosus. They decided instead to recognize two

Suillus imitatus & the S. caerulescens-ponderosus complex ... 395

taxa separated by pileus color and spore size differences. The shorter spores for

S. imitatus var. imitatus reported by Smith & Thiers (1964) and cited in many

later references were given as 7-9 x 4—4.5 um. Although this overlaps the lower

end of the spore range given for S. caerulescens (8-11 x 3-5 um), it could indicate

a subtle distinction. However, we re-measured the spores of the type collection

as 7-10 x 4-4.5 um, which now puts the var. imitatus spores within the center

of the range for S. caerulescens, S. ponderosus, and S. imitatus var. viridescens.

The orangish pileus color of S. imitatus var. imitatus certainly overlaps the

highly plastic pileus colors seen in S. caerulescens and S. ponderosus, and the

greenish tint of S. imitatus var. viridescens could easily be environmentally

induced, much as the aqua colors seen in the stipe of Leccinum species (den

Bakker & Noordeloos 2005). For these reasons we see no compelling argument

to maintain either variety of S. imitatus as a separate taxon and so synonymize

var. imitatus with S. caerulescens and var. virescens with S. ponderosus.

Suillus lithocarpi-sequoiae was described by Singer (1960) from Muir Woods,

Marin County, California. The descriptions for this species fit well within our

current concept of S. ponderosus. The type specimen (Singer N 1531) was

deposited in Fundacion Miguel Lillo, Argentina (LIL). Unfortunately, the type

specimen could not be located and is assumed lost. Singer placed (1962) and

maintained (1975, 1986) this species in Pulveroboletus, even though Smith &

Thiers (1964) and Thiers (1975) thought it better placed in Suillus. The species

was never encountered again at the type locality, despite repeated search efforts

(Thiers 1975). For these reasons we consider the name S. lithocarpi-sequoiae

doubtful.

Below is an updated taxonomy, and emended diagnoses for S. caerulescens

and S. ponderosus.

Taxonomy

Suillus caerulescens A.H. Sm. & Thiers, Contr. Monogr. N. Amer. Suillus: 36, 1964.

FIGURE 1A

Ho.Lotype: MICH12297 (A.H. Smith 48733); GENBANK nrITS JQ958316.

= Suillus imitatus A.H. Sm. & Thiers var. imitatus, Contr. Monogr. N. Amer. Suillus: 40, 1964.

HoLotypPe: MICH 12300 (A.H. Smith 48732); GENBANK nrITS JQ958317

These two names were validly published at the same time and therefore have

equal priority. However, we have chosen to retain the name S. caerulescens over

S. imitatus because of its broader use in many research articles, guidebooks,

and Internet web pages.

CHARACTERISTICS—Annulus band-like, fibrillose to felty-tomentose, white to

dingy pallid, staining brownish, not gelatinous to slightly gelatinous with some

gluten along the edges.

396 ... Nguyen & al.

Suillus ponderosus A.H. Sm. & Thiers, Contr. Monogr. N. Amer. Suillus: 38, 1964.

FIGuRE 1B

Ho.otype: MICH12305 (A.H. Smith 20204); GENBANK nrITS JQ958318

= Suillus imitatus var. viridescens A.H. Sm. & Trappe, Mycologia 64: 1151, 1972.

Ho.Lotype: MICH12301 (A.H. Smith 78754); GENBANK nrITS JQ958319

CHARACTERISTICS—Annulus membranous and band-like, buff-orange to

reddish-cinnamon, gelatinous to highly gelatinous and slimy along the edge.

ComMMENTS— Both species seem to occur within the host range of Douglas

fir (P. menziesii). Suillus caerulescens occurs from coastal northern California

north to British Columbia (Canada) and Montana, and in Arizona. It has also

been found in the northern Sierra Nevada at lower elevations where P menziesii

occurs (E.C. Vellinga pers. obs.). There is one report of its occurrence in

northern San Diego County, CA, on Palomar Mountain (Mushroom Observer

2012: 61662). However, Pseudotsuga macrocarpa (Vasey) Mayr rather than

P. menziesii occurs there. Unfortunately this material was not available for study.

Suillus ponderosus occurs in coastal areas from northern California (north of

Monterey Bay) to northern Oregon, but it is unclear whether it occurs in the

Sierra Nevada. Suillus lakei, sister to S. caerulescens, occurs in coastal northern

California, north into Montana, British Columbia, and Alberta (Canada) and

in patchy areas of the Rocky Mountains in Colorado, Utah, New Mexico and

Arizona (Mushroom Observer, Piep 2003, Bates 2006). This wide distributional

range may explain the ITS variations seen in Fic. 2.

To understand ITS genetic variability within and among the three species in

this study, we determined the intraspecific and interspecific percent sequence

similarity based on the corrected Kimura 2-parameter. Together with the type

specimens, all sequences within each of the three clades show high intraspecific

similarity: S. caerulescens (99.8-100%), S. ponderosus (99.5-100%), S. lakei

(98.4-100%). However, the interspecific similarity can be as high as 98.8%

among species: S. caerulescens (93.8-98.8%), S. ponderosus (93.8-96.8%), S.

lakei (94.3-98.8%). This is another case in which strict ITS similarity [the 97%

sequence similarity that serves as a proxy for operational taxonomic unit (OTU)

separation in ecological studies] does not necessarily correctly differentiate

species. Further study is necessary to determine the ITS genetic variability for

the whole genus Suillus. However, based just on what we already observed here,

caution is needed when using the broad implementation of the 97% unilateral

separation for all taxa (reflected in Hibbett et al. 2011, and references therein).

We strongly recommend that a phylogenetic framework be used for species

delimitation in studies using DNA sequences.

Suillus imitatus & the S. caerulescens-ponderosus complex ... 397

Acknowledgements

We thank the Herbarium at the University of Michigan for providing loans of type

specimens and the two reviewers, Boris Assyov and Dimitar Bojantchey, for their useful

comments to improve the manuscript. Support for this research was provided by the

NSF-GRFP to NHN and a Sonoma County Mycological Association (SOMA) Graduate

Scholarship to JFK.

Literature cited

Arora D. 1986. Mushrooms demystified. 2"* Ed. Ten Speed Press, Hong Kong.

Bakker HC den, Noordeloos ME. 2005. A revision of European species of Leccinum Gray and notes

on extralimital species. Persoonia 18: 511-587.

Bates ST. 2006. A preliminary checklist of Arizona macrofungi. Canotia 2: 47-78.

Bessette A, Roody WC, Bessette AR. 2000. North American boletes: a color guide to the fleshy

pored mushrooms. Syracuse University Press, Syracuse.

Bruns TD, Grubisha LC, Trappe JM, Kerekes JF, Vellinga EC. 2010. Suillus quiescens, a new species

commonly found in the spore bank in California and Oregon. Mycologia 102: 438-446.

http://dx.doi.org/10.3852/09-149

Gardes M, Bruns TD. 1993. ITS Primers with enhanced specificity for Basidiomycetes — application

to the identification of mycorrhizae and rusts. Mol. Ecol. 2: 113-118.

http://dx.doi.org/10.1111/j.1365-294X.1993.tb00005.x

Hibbett DS, Ohman A, Glotzer D, Nuhn M, Kirk P, Nilsson RH. 2011. Progress in molecular and

morphological taxon discovery in Fungi and options for formal classification of environmental

sequences. Fungal Biol. Rev. 25: 38-47. http://dx.doi.org/10.1016/j.fbr.2011.01.001

Kretzer A, Li Y, Szaro TM, Bruns TD. 1996. Internal transcribed spacer sequences from 38

recognized species of Suillus sensu lato: phylogenetic and taxonomic implications. Mycologia

88: 776-785.

Manian S, Sreenivasaprasad S, Bending GD, Mills PR. 2001. Genetic diversity and interrelationships

among common European Suillus species based on ribosomal DNA sequences. FEMS

Microbiol. Letters 204: 117-121.

Mushroom Observer. 2012. http://mushroomobserver.org.

Piep MB. 2003. Macrofungi checklist for the Intermountain region.

http://herbarium.usu.edu/resources_checklists_fungal.htm

Singer R. 1960 ['1959’]. New and interesting species of Basidiomycetes VII. Mycologia 51:

578-594.

Singer R. 1962. The Agaricales in modern taxonomy. 2" Ed. J. Cramer, Weinheim

Singer R. 1975. The Agaricales in modern taxonomy. 3" Ed. J. Cramer, Vaduz

Singer R. 1986. The Agaricales in modern taxonomy. 4" Ed. Koeltz Scientific Books, Koenigstein

Smith AH. 1979. The genus Suillus in the western United States. Mycotaxon 9: 285-296.

Smith AH, Thiers HD. 1964. A contribution toward a monograph of the genus Suillus. Ann Arbor,

Publ. by author.

Smith AH, Trappe JM. 1972. The higher Fungi of Oregon’s Cascade Head Experimental Forest and

vicinity: I. The genus Phaeocollybia (Agaricales) and notes and descriptions of other species in

the Agaricales. Mycologia 64: 1138-1153.

Stamatakis A. 2006. RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with

thousands of taxa and mixed models. Bioinformatics 22: 2688-2690.

http://dx.doi.org/10.1093/bioinformatics/btl446

398 ... Nguyen & al.

Stamatakis A, Hoover P, Rougemont J. 2008. A rapid bootstrap algorithm for the RAxML Web-

Servers, Systems Biology 75: 758-771. http://dx.doi.org/10.1080/10635150802429642

Swofford DL. 2001. PAUP*. Phylogenetic Analysis Using Parsimony (* and other methods), version

4.Sinauer Associates Inc, Sunderland.

Thiers HD. 1967. California boletes III. The genus Suillus. Madrofo 19: 148-160.

Thiers HD. 1975. California mushrooms — a field guide to the boletes. Hafner Press, New York.

Thiers B. 2012 [continuously updated]. Index Herbariorum: A global directory of public herbaria

and associated staff. New York Botanical Garden's Virtual Herbarium.

http://sweetgum.nybg.org/ih/ [accessed 15 May 2012]

White T, Bruns TD, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal

RNA genes for phylogenetics. 315-322, in MA Innis et al. (eds.), PCR protocols - a guide to

methods and applications. San Diego, Academic Press.

MY COTAXON

http://dx.doi.org/10.5248/122.399

Volume 122, pp. 399-411 October-December 2012

Phylogenetic relationships and the newly discovered sexual state

of Talaromyces flavovirens, comb. nov.

Cosus M. VISAGIE”?, XAVIER LLIMONA}, JORDI VILA3,

GERRY LOUIS-SEIZE' & KEITH A. SEIFERT?

"Biodiversity (Mycology), Eastern Cereal and Oilseed Research Centre

Ottawa, Ontario, KIA 0C6, Canada

*Department of Microbiology, University of Stellenbosch

Stellenbosch, 7600, South Africa

*Departament de Biologia Vegetal (Botanica), Universitat de Barcelona

Diagonal 643, E-08028 Barcelona, Spain

* CORRESPONDENCE TO: cobusvisagie9@gmail.com

ABSTRACT — Typical Talaromyces ascomata were observed on dry Quercus suber leaf litter

amongst the characteristic synnemata of Penicillium aureocephalum, and they appear to

represent the sexual state of the latter species. The species is a synonym of the older Lasioderma

flavovirens, and we propose the new combination Talaromyces flavovirens. Lectotype and

epitype specimens are designated for this name. The defining characters of the asexual state

include yellow, short-stalked, mycetozoan-like synnemata with an unusual, almost closed

terminal head of penicillate conidiophores intermixed with sinuous hyphae, and dark green

conidia. Ascomata could not be induced in culture, but PCR amplifications of mating-type

genes indicate the species is heterothallic. In nature, ascocarp initials appear to be antheridia

coiled around clavate ascogonia, similar to those of T. flavus, and the thick-walled, spiny

ascospores are also similar to those of T: flavus. ITS barcodes and B-tubulin sequences place T:

flavovirens ina clade with T! apiculatus, T: flavus, T: funiculosus, T. galapagensis, T: pinophilus,

T. macrosporus, and seven other species.

KEYworRps — anamorph-teleomorph connections, DNA _ barcoding, hyphomycetes,

Trichocomaceae.

Introduction

Penicillium aureocephalum was described as a new species of synnematous

hyphomycete from Catalonia, Spain (Muntafiola-Cvetkovi¢ et al. 2001). It

typically occurs on Quercus suber and Cistus salviifolius leaf litter, producing

synnemata that resemble stalked mycetozoan sporangia. Although difficult

to observe without micro-dissection, the synnemata have symmetrical

400 ... Visagie & al.

conidiophores typical of Talaromyces (formerly referred to as Penicillium subg.

Biverticillium), with long, thin acerose phialides and a phialide:metulae length

ratio of about 1:1 (Pitt 1979). In culture on malt extract agar, P aureocephalum

typically produces hirsute yellow structures that resemble ascomata of

Talaromyces, but they do not mature, even after months of incubation

(Muntanola-Cvetkovi¢ et al. 2001).

A subsequent study of the distribution of P. aureocephalum in Spain yielded

abundant collections on Quercus leaves (Llimona et al. 2006). On some

specimens, ascocarps resembling those of Talaromyces, with prolate spiny

ascospores, were observed among the synnemata. Subsequent isolations from

these asciresultedin the production ofsynnemata cultivation of P aureocephalum

in the pure cultures. This, the habitat specificity and the sometimes intertwined

biverticillate conidiophores and asci led to our conclusion that the ascomata

represent the sexual stage of P. aureocephalum.

Montagne (1845) described the monotypic genus Lasioderma, with its type

species L. flavovirens collected on Quercus suber leaf litter from Algeria. The

original description reads, “Peridium e turbinato obpyriforme e floccis septatis

ramosis laxe intricatis contextum, subpersistens. Spore minute, numerosisime,

contiguze, olivaceze in centro evanescente peridii conglutinate.” The species

diagnosis adds only a few details, “stipite rufo statim in capitulum globosum

luteum dilatato,” then refers to an ‘ic. ined’ The color illustration was published

the following year in Flore d'Algérie Durieu (1846). The corresponding Flore

dAlgérie text (Durieu 1848) presented an essentially identical diagnosis,

additional details of a location near la Calle, Algeria (ie. on the Mediterranean

coast), details of an earlier Spanish collection made in 1824 by Durieu (selected

as lectotype below), an earlier unpublished manuscript name (“Cephalotrichum

flavovirens Durieu,’ not to be confused with the validly published name

Cephalotrichum flavovirens (Alb. & Schw.) Nees), and clarification of how

Lasioderma differed from Trichoderma.

The original and expanded descriptions (Montagne 1845, Durieu 1848), color

plate (Durieu 1846; reproduced in MycoBank MB120473), specific habitat, and

geographical location are all suggestive of P aureocephalum. Its specific habitat

and the striking morphological similarities between the Durieu (1846) sketch

and P. aureocephalum synnemata led us to believe that they might be the same

fungus. The suspicion was confirmed by our examination of authentic material

in PC, from which we selected the lectotype below.

Seifert et al. (2012) reviewed the historical literature on Lasioderma, tracing

its fate through Saccardo’s (1886) and Lindau’s (1900) hyphomycete compilations

until it was deflected into the Basidiomycetes by Héhnel (1910) and then largely

forgotten. We rediscovered the name because of its inclusion in the host index

by Oudemans (1920). Because Lasioderma is an older name than Talaromyces,

Teleomorph of Talaromyces flavovirens comb. nov. ... 401

and Lasioderma is also the current name of a genus of beetles, Seifert et al.

(2012) proposed the conservation of Talaromyces over Lasioderma. However,

L. flavovirens remains a valid species name, predating P aureocephalum by

more than 150 years. The recent move to single name nomenclature has placed

Penicillium subg. Biverticillium in synonymy with Talaromyces (Houbraken

& Samson 2011). Therefore, in this paper we introduce the new combination

Talaromyces flavovirens and report our efforts to document the connection of

the newly recognized sexual stage and its better-known synnematous stage. To

supplement the recent phylogenetic analysis of Talaromyces by Samson et al.

(2011), we also present the results of ITS and B-tubulin sequencing of multiple

strains of this fungus, demonstrating its coherence as a phylogenetic species

and confirming its relationships with other asexual Talaromyces species.

Materials & methods

Cultures

Quercus suber leaf litter with visible colonies of T. flavovirens was collected in

Catalonia, Spain by XL and his collaborators. Cultures were isolated from conidial

masses from these specimens by KAS. Dried specimens are deposited in the Canadian

National Mycological Herbarium (DAOM) and the cultures in the Canadian Collection

of Fungal Cultures (CCFC) under accession numbers DAOM 236381-DAOM 236383.

Morphology

The fungus was characterized from its natural habitat (Q. suber leaves) and by using

standardized cultivation techniques on Czapek Yeast Autolysate agar (CYA), Difco Malt

Extract agar (MEA; Pitt 1979, Okuda et al. 2000) and Yeast Extract Sucrose agar (YES,

Frisvad & Samson 2004). Spore suspensions were prepared in semi-solid 0.2% agar with

0.05% Tween80 and inoculated onto 9 cm Petri dishes in three-point pattern using a

micropipette. All plates were incubated in the dark for 7 days at 25°C, with additional

CYA plates incubated at 5 and 37°C. Color names and alphanumeric codes used in the

species description refer to Kornerup & Wanscher (1966). Microscopic characters were

photographed using an Olympus BX50 compound microscope, or an Olympus SZX12

dissecting microscope, with an Evolution MP digital microscope camera operated by

ImagePro 6.0. Composite habit photographs were produced using CombineZM (Hadley

2006). Conidiophore morphology was examined from both synnemata on the Quercus

leaves and cultures grown on MEA.

Phylogeny

DNA was extracted using the UltraClean™ Microbial DNA Isolation Kit (MoBio

Laboratories Inc.). ITS barcodes (Schoch et al. 2012) and partial $-tubulin genes were

amplified using Illustra pureTaq Ready-To-Go™ PCR Beads (GE Healthcare) with

primers ITS1 and ITS4 (White et al. 1990), and Bt2a and Bt2b (Glass & Donaldson

1995). The PCR profile had an initial denaturing step of 95°C for 3 min followed by 35

cycles of 95°C for 1 min, annealing at 56°C for 45 sec and elongation at 72°C for 1 min,

followed by a final elongation step at 72°C for 7 min. PCR products were sequenced

using the same primers, with the Big Dye Terminator Cycle Premix Kit and products

402 ... Visagie & al.

run on an ABI PRISM™ 310 DNA automated sequencer (Applied Biosystems). Contigs

were assembled and edited in CodonCode Aligner v3.7.1.1 (Codon Code Corporation).

GenBank accession numbers are included on Fic. 1.

The ITS sequences of the T: flavovirens strains were compared to a database of

Talaromyces spp. compiled from Samson et al. (2011). Reference strains of closely

related and other synnema-producing species were included in a more focussed analysis

of the B-tubulin gene region. Both data sets were aligned using MAFFT v6.850b (Katoh

et al. 2009) using the L-INS-i option. Sequence analysis was done in PAUP*v4.0b10

(Swofford 2002). The BioNJ method was chosen for calculating a single tree for each

data set (Gascuel 1997), with Trichocoma paradoxa chosen as suitable outgroup for

the ITS analysis and a clade of synnema-producing species for the §-tubulin analysis.

Bootstrap support was calculated using a 1000 replicates.

Teleomorph-anamorph connection and mating experiments

Various approaches were used to prove the connection between the sexual and

asexual structures on the newly collected specimens. Cultures were isolated from

conidial masses from Quercus suber leaves, and ascospore isolates were also attempted.

Anticipating that ascospores might be more heat resistant than conidia, we prepared

spore suspensions prepared from both ascomata and synnemata in a semi-solid

agar solution (Pitt 1979). Individual suspensions were exposed to temperatures at 5°

increments from 50-70°C, for either 15 or 30 min. Unheated suspensions were used

as a positive control. After heating, spore suspensions were plated out onto MEA and

incubated for 7 days at 25°C, after which plates were inspected for growth.

All cultures were grown on CYA, MEA and Oatmeal agar (OA), and on 2% water

agar with twigs or leaves of Q. macrocarpa in 9 cm Polystyrene Petri dishes sealed with

Parafilm. Further, the strains DAOM 236381-236383 and IBT 27044 were crossed in all

possible combinations on OA, and on 2% water agar with Q. macrocarpa leaves. After

several months of incubation at RT under ambient light, the Parafilm was removed to

allow the agar to dry out (Lopez-Villavicencio et al. 2010), in an attempt to mimic the

species’ arid natural habitat.

Mating-type genes were amplified from all strains using the primers MAT1-1b and

MAT1-2b with a touchdown PCR (Lopez- Villavicencio et al. 2010). The PCR profile had

an initial denaturing step at 95°C for 5 min, followed by 30 cycles of denaturing at 95°C

for 30 sec, annealing starting at 60°C (decreased -0.5°C for every cycle until 50°C) for 30

sec, elongation at 72°C for 1 min, followed by a final elongation step at 72°C for 7 min

(Lopez-Villavicencio et al. 2010). To confirm the presence or absence of the MAT1 and

MAT2 genes, products were run on a 1% agarose gel. In addition, representative strains

containing the putative MAT genes were sequenced to confirm results, using the same

sequencing protocol described above. MAT1 and MAT2 sequences were deposited in

GenBank with accession numbers JX091392-JX091394.

FiGuRE 1. Phylogenetic trees showing the relationships of Talaromyces flavovirens within —

Talaromyces. Trichocoma paradoxa was chosen as outgroup in the ITS phylogeny (left). For the

B-tubulin phylogeny (right), only close relatives were included in the data set. The phylogeny was

rooted to other synnema-producing Talaromyces species. Numbers above thick branches represent

bootstrap values above 80%. (7 = ex-type strain; * = synnemata producer).

Clade 1

—

Teleomorph of Talaromyces flavovirens comb. nov. ... 403

JX013912 T. flavovirens DAOM236381* —~

JX013913 T. flavovirens DAOM236382*

= JX013914 T. flavovirens DAOM236383*

JX013915 T. flavovirens DAOM236384*

JX013916 T. flavovirens' IBT27044*

JN899389 T. aculeatus' CBS100105

~~ GQ337428 T. pinophilus NRRL58691

||- JN899382 T. pinophilus'’ CBS631.66

— JN899358 T. galapagensis' CBS751.74

- JN899375 T. apiculatus' CBS312.59

-— JN899312 T. ruber CBS196.88

‘— JN899367 T. verruculosus' CBS388.48

-- JN899360 T. flavus’ CBS310.38

~ JN899385 T. siamensis CBS475.88

- JN899332 T. intermedius’ CBS152.65

-- JN899314 T. viridulus' CBS252.87

JN899319 T. calidicanius' CBS112002*

F JN899317 T. primulinus' CBS321.48

JN899341 T. diversus' CBS320.48

-— AB176617 T. euchlorocarpius' CBMFA0942

‘— JN899362 T. panamensis' CBS128.89*

‘— JN899344 T. marneffe” CBS388.87

JX091373 T. flavovirens DAOM236381*

JX091374 T. flavovirens DAOM236382*

a2! JX091375 T. flavovirens DAOM236384*

JX091376 T. flavovirens" IBT27044*

JX091377 T. flavovirens DAOM236383*

\___. JX091379 T. siamensis' CBS475.88

JX091378 T. apiculatus' CBS312.59

JX091388 T. galapagensis' CBS751.74

JX091380 P. liani’ CBS225.66

JX091381 T. pinophilus’ CBS631.66

-~——— JX091382 T. macrosporus' CBS317.63

JX091383 T. funiculosus\" CBS272.86

-— HQ156944 T. calidicanius' CBS112002*

L—. JX091384 T. duclauxii CBS322.48

EU021663 T. flavus' NRRL2098

JX091389 T. marneffei' CBS388.87

JX091385 T. viridulus' CBS252.87

|______. JX091387 T. intermedius’ CBS152.65

HQ149327 T. panamensis' CBS128.89*

JX091390 T. coalescens” CBS103.83*

PS roses T. cecidicola KAS504*

98 FJ753290 T. ramulosus' DAOM241660

GU385736 T. chloroloma’ DAOM241016*

>———. JX091391 T. dendriticus' CBS660.80*

‘____ HQ156950 T. pseudostromaticus' CBS470.70*

HQ156947 T. palmae’ CBS442.88*

—— 0.01 substitutions/site

Synnemata producing clade

— JN899372 T. purpurogenus' CBS286.36 yw

Seay"

JN899377 T. funiculosus' CBS272.86 og

aie JN899339 T. dendriticus' CBS660.80*

“— JN899371 T. pseudostromaticus' CBS470.70*

JN899366 T. coalescens' CBS103.83*

AY787844 T. cecidicola’ DAOM233329*

FJ160273 T. chloroloma’ DAOM241016*

EU795706 T. ramulosus' DAOM241660*

oe T. purpureus' CBS475.71

FJ160266 T. ptychoconidium' DAOM241017

JN899322 P. mirabile’ CBS624.72

JN899381 P. purpurogenum var. rubrisclerotium™ CBS270.35

JN899346 T. minioluteus' CBS642.68

JN899350 T. udagawae™ CBS579.72

5 aia JN899383 T. erythromellis' CBS644.80

FJ160264 T. solicola’ DAOM241015

JN899345 T. allahabadensis' CBS453.93

-- JN899379 T. loliensis' CBS643.80

\— JN899318 T. islandicus' CBS338.48

JN899365 T. brunneus’ CBS227.60

JN899324 T. radicus' CBS100489

JN899352 T. wortmannii’ CBS391.48

JN899343 T. variabilis' CBS385.48

AB176638 T. sublevisporus' CBMFA0939

JN899361 T. tardifaciens'’ CBS250.94

jl JN899353 T. rotundus' CBS369.48

‘—— JN899340 T. phialosporus' CBS233.60

‘—— JN899374 T. rugulosus' CBS371.48

JN899370 T. piceus' CBS361.48

JN899396 T. palmae’ CBS442.88*

JN899398 Trichocoma paradoxa CBS788 83

— 0.005 substitutions/site

404 ... Visagie & al.

Results

Isolations from both synnemata and ascomata yielded conidiomata of the

asexual state. Because of their small sizes, we could not confidently separate

ascospores from conidia under the dissecting microscope, but all attempted

ascospore isolations yielded the same synnemata that occurred in conidium-

derived isolates. The resulting colonies are described below in the Taxonomy

section.

Amplification of ITS barcodes resulted in amplicons about 600 bp long.

The aligned data set of Talaromyces species was 471 bp long. Talaromyces

flavovirens was resolved as a subclade of cladel, as described by Samson et al.

(2011). Bootstrap supports were low for branches within this clade. Because

B-tubulin is very difficult to align across the whole genus, we restricted our

analysis of this gene to close relatives identified by the ITS analysis, and we

included other synnema-producing species as out groups. §-tubulin amplicons

were about 500 bp long, but the confidently aligned portion of the data set was

only 391 bp long. Branch lengths were longer than for the ITS phylogeny, but

bootstrap support was still low. ITS and 6-tubulin analyses resulted in different

tree topologies. Although the sister group relationships differed between the

two phylogenies, both analyses portrayed T: flavovirens as a phylogenetically

distinct and coherent species.

No ascomata were observed in uncrossed or crossed cultures of T. flavovirens.

All strains produced the characteristic yellow, hirsute structures described by

Muntanola-Cvetkovic¢ et al. (2001), but no ascocarp initials or ascospores were

observed. Amplification and sequencing of the MAT genes showed that T:

flavovirens is heterothallic, with DAOM 236382 having the MAT1 gene and

other strains possessing the MAT2 gene.

The temperature gradient experiment did not reveal any difference in heat

tolerance between ascospores and conidia, and thus was unhelpful in confirming

the relationship of the two morphs. In both kinds of spore suspensions, positive

controls grew within 7 days. Both ascospores and conidia were killed at 65°C

with a 15 min exposure.

Taxonomy

Talaromyces flavovirens (Durieu & Mont.) Visagie, Llimona & Seifert, comb. nov.

MycoBank MB800438 PLATES 1, 2

= Lasioderma flavovirens Durieu & Mont., Annls Sci. Nat., Bot., 3e sér., 4: 364. 1845.

TyPeE: Spain, Madrid, Parque del Retiro, on dead leaves of Quercus ilex, Nov. 1824, M.C.

Durieu de Maisonneuve (lectotype designated here, PC 0088796); Spain, Catalonia,

Gerona, Selva de Mar, 5.XII.1999, X. Llimona (epitype designated here, BCC 473 =

BCN 473 ; ex-epitype culture IBT 27044 = CBS 102801).

= Penicillium aureocephalum Munt.-Cvetk., Hoyo & Gémez-Bolea, Fungal Diversity 7: 73.

2001.

Teleomorph of Talaromyces flavovirens comb. nov. ... 405

PLATE 1. Talaromyces flavovirens as it occurs in nature. a,b. Quercus suber leaves containing the

characteristic yellow synnemata and orange gymnothecia of T: flavovirens. c,d. Gymnothecia on

Quercus suber. e,f. Heavy walled spinose ascospores. g,h. Synnemata produced on Quercus suber.

i. Conidiophores in synnema with typical capitulum. j. Ellipsoidal heavy walled conidia produced.

Scale bars: d = 100 um; e,f,j = 10 um; h = 1000 um; i = 50 um.

406 ... Visagie & al.

Type: SPAIN, Catalonia, Gerona, Selva de Mar, 5.XII.1999, X. Llimona (holotype of

Penicillium aureocephalum, BCC 473 = BCN 473; ex-type culture IBT 27044 = CBS

102801)

IN NATURE — ASCOMATA deep golden yellow, often with a reddish pigment,

globose to subglobose, 150-380 um diam, soft, covered by a loose network of

hyphae, with a synnema-like stalk connecting ascomata to leaves, 50-100 x

15-50 um. Presumed ascocarp initials badly deteriorated, but similar in shape

to those of Talaromyces flavus and T. macrosporus as illustrated by Stolk &

Samson (1972), with antheridia coiled around clavate ascogonia. ASCOSPORES

abundantly produced, prolate, spiny, with a thick wall that appears double-

layered, yellow, (4—)4.5-6(-7) x 3-4, (mean + stdev = 5.1 + 0.43 x 3.5 + 0.2)

um, mean width/length ratio = 0.69 + 0.06, n = 95. SYNNEMATA similar in

appearance to stipitate myxostelid sporangia, with a yellow stalk 400-750 um

high, 100-250 um wide at the base, and a terminal head 250-300 um diam

comprised of conidiophores and conidia, covered with a bright yellow layer of

interwoven sterile hyphae, adding an additional 90-160 um. CONIDIOPHORES

mostly biverticillate, with very few subterminal branches occurring, dimensions

and other features similar to those described below for cultures, but with

metulae consistently diverging at broader angles, perhaps a consequence of the

presumably older age of the synnemata on the observed specimens.

IN CULTURE — On CYA at 25°C after 7 pays — Colonies 11-13 mm, low,

planar; texture velutinous; mycelia white; conidiogenesis moderate, conidia

dark green (29F6-29F7) in mass; exudate absent, soluble pigment absent;

margins narrow (1-2 mm), subsurface, entire; reverse Greyish Green (30D5)

under inoculum, Greyish Green (30B3) elsewhere, fading into a Greenish

White (30A2) margin. After prolonged incubation, colonies develop a brick

red reverse. On MEA at 25°C after 7 pays — Colonies 28-31 mm, low, zonate;

texture velutinous, appearing almost granular; sometimes dominated by

sterile Sulphur Yellow (1A5) mycelia that mask conidial areas; conidiogenesis

moderately dense to dense, conidia Dark Green (29F8) in mass; exudate absent,

soluble pigment absent; margins wide, 4-6 mm, subsurface, entire; reverse

Light Yellow to Reddish Yellow (4A5-4A6) at colony centres, fading to Pale

Yellow (2A3-2A4) near margins when aerial mycelia are present, or in colonies

lacking aerial mycelium with zonate rings of Greyish Green (30E5) and Greyish

Yellow (1B4). After prolonged incubation, colonies produce synnemata similar

in appearance to those seen in nature, differing by having shorter stipes; often

so densely packed that individual synnemata cannot be distinguished, and

conidial heads then seeming confluent. After prolonged incubation, yellow

hirsute structures produced, which resemble sterile ascomata. On YES at

25°C after 7 pays — Colonies 18-21 mm, low, planar; mycelia white; texture

velutinous, with poorly developed funicles; conidiogenesis dense, conidia in

Teleomorph of Talaromyces flavovirens comb. nov. ... 407

BES

PLATE 2. Talaromyces flavovirens as it occurs in culture. a. Colonies grown for 7 days at 25 °C on CYA,

MEA and YES from left to right (top row = obverse, bottom row = reverse). b. Colony texture on MEA

after 7 days. c. Colony texture on MEA after prolonged incubation showing synnemata produced being

covered by the sterile yellow capitulum. d. Colonies on CYA after prolonged incubation, becoming

brick red. e. Synnemata produced on MEA after prolonged incubation. f-j. Typical conidiophores.

k. Ellipsoidal heavy walled conidia. Scale bars: e = 50 um; j (applies to f-k) = 10 um.

408 ... Visagie & al.

mass Greyish Turquoise (24E4—24E6); exudate absent, soluble pigment absent;

margins narrow (3 mm), low, entire; reverse Dark Brown (6F8) at colony centre,

fading to Light Brown (6D8) nearing the Greyish Green (30D5) margin, in

some strains brown shades lacking, then similarly colored to MEA. On CYA at

5°C after 7 pays — no growth. On CYA at 37°C after 7 pays — no growth.

Synnemata as described above for the natural substrate. Conidiophores

closely packed together, mostly biverticillate although terverticillate branching

is not uncommon, smooth walled, 95-325 x 2-3 um; 2-3 basal branches

sometimes present, branches varying greatly in length, 10-35 x 2-3 um;

metulae 4-6 per stipe or branch, cylindrical, forming angles of 25-70°, 9-15

x 2-3 um. Phialides acerose, in nature with a greenish pigment, in culture

pigmentation less obvious, 5-8 per metula, 8-10.5(-11.5) x 2-3 um. Conidia

prolate, rough-walled, connective scars often visible, 2.5-3.5 x 2-2.5 (mean +

stdev = 2.98 + 0.16 x 2.3 + 0.13) um, mean width/length = 0.75 + 0.05, n = 71,

with ‘giant’ conidia sometimes present, up to 4.5-5.5 x 3.5-4 um.

Hasirat: Leaves of Quercus suber, Q. ilex, and Cistus salviifolius.

DISTRIBUTION: Spain, Algeria.

ADDITIONAL SPECIMENS EXAMINED: SPAIN, CATALONIA, Port de la Selva, Girona,

Font Clareta, on leaves of Quercus suber, 3.1.2006, X. Llimona (DAOM 236381, BCN

14.000); Selva de Mar, Girona, 3.1.2006, X. Llimona (DAOM 236382, BCN 14.003); same

location, 31.XII.2006, X. Llimona (DAOM 242312); Barraca den Rabert, Pau, Girona,

31.XII.2005, X. Llimona (DAOM 236383, BCN 14.006); VALENCIA, Xovar, Alt Palacia,

on leaves of Q. suber, 29.X1.2005, X. Llimona, J. Vila, F. Teiedor (DAOM 236384, BCN

14.009). EXTREMADURA, Finca Las Cansinas, Monfragiie, Cacera, on leaves of Q. suber,

14.X1.1986, R. Galano no. 507 (DAOM 242311).

Discussion

Talaromyces flavovirens is distinguished from other synnematous Talaromyces

species (T! calidicanius, T. chloroloma, T. cecidicola, T. coalescens, T. dendriticus,

T. palmae, T. panamensis, T. pseudostromaticus, and T. ramulosus) by the

characteristic yellow, short stalked, mycetozoa-like synnemata produced both

in nature and in culture. The yellow color is caused by an almost peridium-like

hyphal covering of the conidial head, which is much denser than the aerial

mycelium that sometimes covers conidiophores of other Talaromyces species.

Ascomata have so far only been observed in nature, with ascocarps eventually

producing thick walled, spiny ascospores. The ecology of T: flavovirens, as

described by Llimona et al. (2006), is rather specific. The species occurs on

dead leaves of Quercus suber, rarely Q. ilex, and Cistus salviifolius, which have

not fallen from trees by normal senescence, but rather by physical events such

as wildfires, hail or breaking of branches. These leaves are thus killed with

their full complement of nutrients, apparently favouring the growth of this

fungus. The currently known distribution suggests that this is a moderately

thermotolerant, Mediterranean species.

Teleomorph of Talaromyces flavovirens comb. nov. ... 409

The 1824 specimen from Madrid collected by M.C. Durieu de Maisonneuve

(PC 0088796) on leaves of Quercus ilex probably represents the Spanish

material mentioned by Durieu (1848) and is designated as lectotype of

L. flavovirens above. The Algerian specimens from la Calle reported by Durieu

(1848) were also examined (PC088798, PC0088795), but lack ascomata. It is

possible to infer that Montagne (1845) based the description in the protologue

on both Algerian and Spanish material, because in the Flore dAlgérie (1848,

p. 398), an 1824 collection by Durieu from Madrid is mentioned. Observations

of the lectotype by XL demonstrated the occurrence of both ascospores and

conidia on this specimen, making it a suitable lectotype for this pleiomorphic

species. The alternative, lectotypification using the 1846 illustration, would be

less desirable given the lack of conclusive evidence of ascomata. We designated

the holotype of P aureocephalum as the epitype of T! flavovirens to stabilize the

synonymy of these two names.

We were unable to prove unequivocally the genetic connection between the

putative asexual and sexual states of T. flavovirens but feel that the evidence

is convincing. Ascomata were never observed in our single spore derived

strains or crossed cultures, although structures that could be interpreted as

unfertilized ascomata were sometimes produced. Amplification and sequencing

of the mating type genes confirmed that T’ flavovirens is heterothallic, with

individual isolates containing either the MAT1 or MAT2 genes, never both.

A recent paper reported the development of a sexual stage for T. pinophilus

(Lépez-Villavicencio et al. 2010), a close relative of T: flavovirens, induced only

after media dried out. The similarity with the arid habitat of T. flavovirens is

interesting, but in our experiments slow drying of the colonies did not induce

maturation of the putative ascoma initials.

Comparatively large, prolate ascospores with thick spiny walls were observed,

a character also typical for T: flavus and T: macrosporus. Ascospore sizes were

thought to be useful for distinguishing T’ flavus (3-5 x 2.2-3.5 um) and

T. macrosporus (5-6.5 x 3.5-5.2 um) (Stolk & Samson 1972), but T. flavovirens

with its broader size range (4-7 x 3-4 um) complicates this distinction. Based

on ascospores alone, T: flavovirens is difficult to distinguish from T. flavus

and T. macrosporus, but the distinctiveness of its synnematous morph makes

identification simple.

Based on morphological similarities between the sexual states of T: flavovirens,

T. macrosporus, and T: flavus, they were expected to be close relatives in the

phylogenetic analyses. Talaromyces flavovirens is resolved in clade 1 of Samson

et al. (2011), which has little variation in the ITS barcodes. This results in a

weak phylogenetic signal, confirming only that T flavovirens itself forms a

coherent clade with bootstrap support. The B-tubulin gene has more sequence

variation than the ITS and thus provides better species resolution. In the

410 ... Visagie & al.

6-tubulin phylogeny, T. flavovirens was resolved as a close relative of

T. apiculatus’, T. galapagensis, T: siamensis*, and two small clades containing

Penicillium liani, Talaromyces funiculosus’, T. macrosporus, and T. pinophilus’.

Amongst these close relatives, are species that lack a known sexual state, marked

with *. Based on asexual structures, these species are easily distinguished

from T. flavovirens. Concerning the sexually competent species in this clade,

T. flavus and T: macrosporus are discussed in the previous paragraph. Otherwise,

T. galapagensis has the most similar ascomata but it produces ascoma initials

that are thin hyphae (Samson & Mahoney 1977). Its ascospores, although

similarly ornamented, are much bigger (7-10 x 5.5-8 um) than those of

T. flavovirens. Other species that produce synnemata are resolved as distant

relatives to T: flavovirens. Interestingly though, a clade of synnemata producers

occurs in the B-tubulin analysis (Fic. 1). This clade occurs in analyses of other

genes as well, and some kind of fungus-insect relationship was hypothesized

for some of these species (Seifert et al. 2004, Visagie et al. 2009). This idea is

being investigated more carefully in our continuing studies of these species.

Acknowledgements

This study was part of an overseas visit by the first author, made possible by funding

from the South African Biosystematics Initiative, NRF. The fieldwork by X. Llimona in

Catalonia was funded by the Institut d’Estudia Catalans (PT2008-S0206). We are grateful

to the curators of PC and DAOM for allowing us to examine specimens in their care,

JC Frisvad for providing us with the ex-type culture of P aureocephalum, RA Samson

and JAMP Houbraken for providing ex-type B-tubulin sequences, and K Jacobs for her

support of the senior author's participation in this project. The authors are grateful for

reviews by SW Peterson and RA Samson.

Literature cited

Durieu de Maisonneuve MC. 1846. Lasioderma flavo-virens DR. et Montg. Exploration scientifique

de lAlgérie, Botanique 1(4): t.20 f.4.

Durieu de Maisonneuve MC. 1848. Exploration scientifique de lAlgérie, Botanique 1(10):

361-400.

Gascuel O, 1997 BIONJ: An improved version of the NJ algorithm based on a simple model of

sequence data. Molecular Biology and Evolution 14: 685-695.

http://dx.doi.org/10.1093/oxfordjournals.molbev.a025808

Glass NL, Donaldson GC. 1995. Development of primer sets designed for use with the PCR

to amplify conserved genes from filamentous Ascomycetes. Applied and Environmental

Microbiology 61:1323-1330.

Hadley A. 2006. CombineZ, version 5. Published by the author. www.hadleyweb.pwp

Hohnel F von. 1910. Fragmente zur Mykologie (X. Mitteilung, Nr. 468 bis 526). Sitzungsberichte

der Kaiserlichen Akademie der Wissenschaften Math.-naturw. Klasse Abt. I. 119: 393-394.

Houbraken J, Samson RA. 2011. Phylogeny of Penicillium and the segregation of Trichocomaceae

into three families. Studies in Mycology 70: 1-51.

Katoh K, Asimenos G, Toh H. 2009. Multiple alignment of DNA sequences with MAFFT. Methods

Mol Biol 537: 39-64. http://dx.doi.org/10.1007/978-1-59745-251-9_3

Teleomorph of Talaromyces flavovirens comb. nov.... 411

Kornerup A, Wanscher JH. 1966. Methuen handbook of color. Denmark, Sankt Jorgen Tryk.

Lindau G. 1900. Hyphomycetes. In: A Engler, K Prantl (eds). Die natirlichen Pflanzenfamilien

1(1**): 415-517, 558-559.

Llimona X, Vila J, Garcia-Porta TM, Tejedor F. 2006. Penicillium aureocephalum Munt.-Cvetk.,

Hoyo et Gémez-Bolea, un interessant Ascomicet anamorfic amb aspecte de mixomicet.

Distribucid, ecologia i fenologia. Revista Catalana de Micologia 28: 47-56.

L6épez-Villavicencio M, Aguileta G, Giraud T, Vienne DMD, Lacoste S$, Couloux A, Dupont J, 2010

Sex in Penicillium: Combined phylogenetic and experimental approaches. Fungal Genetics and

Biology 47: 693-706. http://dx.doi.org/10.1016/j.fgb.2010.05.002

Montagne JPFC. 1845. Cinqui¢me Centurie de plantes cellulaires exotiques nouvelles. Décades VII

a X. Annales des Sciences Naturelles, Botanique, 3e Sér., 4: 346-367.

Muntanola-Cvetkovic M, Hoyo P, Gémez-Bolea A. 2001. Penicillium aureocephalum anam. sp. nov.

Fungal Diversity 7: 71-79.

Okuda T, Klich MA, Seifert KA, Ando K. 2000. Media and incubation effects on morphological

characteristics of Penicillium and Aspergillus. 83-99, in: RA Samson, JI Pitt (eds). Integration

of modern taxonomic methods for Penicillium and Aspergillus classification. Amsterdam,

Harwood academic publishers.

Oudemans CAJA. 1920. Enumeratio systematica fungorum in omnium herbarum Europaearum

organis diversis hucusque observatorum mentione facta fontium litterariorum diagnoses

eorum figurasque proferentium. Vol. 2. Nijhof, The Hague.

Pitt JI. 1979. The genus Penicillium and its teleomorphic states Eupenicillium and Talaromyces.

London, Academic Press Inc.

Saccardo PA. 1886. Sylloge Hyphomycetum. Sylloge Fungorum 4. 807 p.

Samson RA, Mahoney P. 1977. Talaromyces galapagensis sp.nov. Transactions of the British

Mycological Society 69: 158-160.

Samson RA, Yilmaz N, Houbraken J, Spierenburg H, Seifert KA, Peterson SW, Varga J,

Frisvad JC. 2011. Phylogeny and nomenclature of the genus Talaromyces and taxa

accommodated in Penicillium subgenus Biverticillium. Studies in Mycology 70: 159-183.

http://dx.doi.org/10.3114/sim.2011.70.04

Schoch CL, Seifert KA, HuhndorfS, Robert V, Spouge JL, Levesque CA, Chen W, Fungal Barcoding

Consortium. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal

DNA barcode marker for Fungi. PNAS 109: 6241-6246.

http://dx.doi.org/10.1073/pnas.1117018109

Seifert KA, Hoekstra ES, Frisvad JC, Louis-Seize G. 2004. Penicillium cecidicola, a new species on

cynipid insect galls on Quercus pacifica in the western United States. Studies in Mycology 50:

or 523.

Seifert KA, Frisvad JC, Houbraken J, Llimona X, Peterson SW, Samson RA, Visagie CM. 2012.

(2051) Proposal to conserve the name Talaromyces over Lasioderma (Ascomycota). Taxon

61(2): 461-462.

Stolk AC, Samson RA. 1972. The genus Talaromyces: studies on Talaromyces and related genera II.

Studies in Mycology 2: 1-65.

Swofford, D. L. 2002. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods).

Version 4. Sinauer Associates, Sunderland, Massachusetts.

Visagie CM, Roets F, Jacobs K. 2009. A new species of Penicillium, P. ramulosum sp. nov., from the

natural environment. Mycologia 101: 888-895. http://dx.doi.org/10.3852/08-149

White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal

RNA genes for phylogenetics. 315-322, in: MA Innis et al. (eds). PCR Protocols: a guide to

methods and applications. San Diego, Academic Press.

MYCOTAXON

http://dx.doi.org/10.5248/122.413

Volume 122, pp. 413-420 October-December 2012

Two interesting cantharelloids

from Nan and Kanchanaburi Provinces, Thailand

SUNADDA YOMYART’, ROY WATLING’, CHERDCHAI PHOSRI’,

JITTRA PIAPUKIEW* & PRAKITSIN SIHANONTH>**

"The Institute for the Promotion of Teaching Science and Technology,

924 Sukhumvit Road, Klong Toei, Bangkok, Thailand

*Caledonian Mycological Enterprises,

Crelah 26 Blinkbonny Ave, Edinburgh EH4 3 HU, Scotland, UK

*Department of Biology, Faculty of Science and Technology,

Pibulsongkram Rajabhat University, Phitsanulok, Thailand

‘Department of Botany & °Department of Microbiology, Faculty of Science,

Chulalongkorn University, Bangkok, Thailand

* CORRESPONDENCE TO: sprakits@chula.ac.th

ABSTRACT —Two cantharelloid fungi are recorded and described from Nan and

Kanchanaburi Provinces, Thailand. Cantharellus atratus, a new record for Thailand, is

recombined in Craterellus based on molecular studies. Although previously known from

Peninsular Malaysia, Pterygellus polymorphus var. minor represents a new record for

Thailand.

KEY worps — ectomycorrhizal fungi, ecology, dipterocarps, taxonomy

Introduction

Nan Province is situated in northern Thailand where dipterocarp forests

predominate. Several excursions over a two-year period were made to compare

macromycetes of a woodland in Veingsa District with a study area in Sisawat

District, Kanchanaburi Province, in western Thailand. Two cantharelloids

collected during this work are described herein.

Materials & methods

Collections

The Nan locality consisted of seasonal dipterocarp forest dominated by Shorea

obtusa Wall. and S. siamensis Mig. accompanied by Dipterocarpus tuberculatus Roxb.,

D. obtusifolius Teijsm. ex Mig. and a major understorey of diverse graminoids. The forest

overstorey in Kanchanaburi Province is dominated by S. siamensis and D. tuberculatus and

414 ... Yomyart & al.

an understorey primarily composed of Cycas siamensis Miq. and diverse graminoids. The

collected specimens were dried in silica gel and deposited in Bangkok, Chulalongkorn

University, Microbiology Department (BCUM ND1)

DNA analysis

Genomic DNA extracted from fresh basidiomes with cetyltrimethylammonium

bromide (CTAB) as described in Zhou et al. (1999). DNA was amplified in a 50 ul reaction

mixture that contained 1 yl of DNA template, 1x buffer [16 mM (NH,),SO,, 67 mMTris-

HCI (pH 8.8 at 25°C), 0.01% Tween-20], 2.0 mM MgCl, 250 uM dNTPs (Bioline Ltd,

London, UK), 20 pmol ITS1F (Gardes & Bruns 1993) and ITS4 (White et al. 1990), and 2.5

U BIOTAQ polymerase (Bioline Ltd, London, UK). The PCR cycle comprised an initial

denaturation step at 94°C for 5 min followed by 38 cycles of 94°C for 1 min, 51°C for

1 min and 72°C for 1 min, anda final extension at 72°C for 5 min ona TP600TaKaRa PCR

Thermal Cycler Dice™ (Takara Bio Inc., Japan). The PCR product was sub-cloned with

Takara Cloning Kits (Takara Bio Inc., Japan) following the manufacturer's instructions.

Plasmid DNA was extracted from transformed cells suspended in 50 ul sterile water in

a 1.5 ml tube that was incubated in boiling water for 5 min. The supernatant was PCR

amplified with primers ITS1 and ITS4. After confirming fragment insertion on agarose

gels, the inserts were sequenced using Thermo Sequenase Pre-mixed Cycle Sequencing

Kits (Amersham International plc. Buckinghamshire, England) using primers Texas

Red M13F and T7 following the manufacturer’s instructions. The sequences obtained,

including the complete ITS regions, were registered in DDBJ. A blast homology search

was conducted in DDBJ/EMBL/GenBank database using Blastn. Phylogenetic analysis

was performed with Neighbor-Joining method using PAUP 4.08b (Swofford 1999).

SEM observation

Fresh specimens were prepared for the scanning electron microscope by fixation in

2.5% glutaraldehyde 0.1 M phosphate buffer at pH 7.2 for 2 hr at 5°C. Specimens were

then rinsed twice in phosphate buffer for 10 min and once in distilled water for 10 min.

The specimens were dehydrated in a 30, 50, 70 and 95% ethanol series for 10 min each

followed by three changes of absolute ethanol for 10 min each. Specimens were dried in

a critical point dryer (Balzers model CPD 020). The dried samples were fixed to brass

stubs with double sided sticky tape and then coated with gold in a sputter coater (Balzer

model SCD 040). Specimens were observed under SEM (JEOL model JSM 5410LV)

with an accelerating voltage of 15 kV. Photographs were recorded by computer.

Taxonomy

Craterellus atratus (Corner) Yomyart, Watling, Phosri, Piapukiew & Sihan.,

comb. nov. FIG. 1

MycoBank No. MB 563344

= Cantharellus atratus Corner, Ann. Bot. Mem. 2: 62, 1966.

PitEus 8-9 mm dark fuliginous black, not perforated but depressed at

centre, appearing fibrillose-zoned when fresh, centrally stipitate (although

limb broader on one side), margin wavy slightly fimbriate. StipE 7-9 x 0.75-1

mm greyish buff throughout, darker downwards to slightly swollen at base

Craterellus atratus comb. nov. (Thailand) ... 415

> Y

Je Bhar S

a.)

x :

> 1 D *

MSkU #1ga@,908 lpm 2669 fo

Fic. 1. Craterellus atratus. A: Pair of basidiomes. B: Distribution of basidiomes in study area.

C: Scanning electron micrograph showing variable number of basidiospores on hymenium.

D: High magnification scanning electron micrograph, showing ellipsoid basidiospore shape with

smooth wall. Scale bars: A, B = 1 cm; C = 10 um; D = 1 um.

416 ... Yomyart & al.

Pterygellus polymorphus var. minor (AB445116)

100

Pseudocratereilus sinuosus (GU590932)

100

Uncultured Cantharetlus (FR852287)

Cantharellus atratus (AB445115)

Craterellus lutescens (AY082606)

Craterelius fallax (GU590925)

100

100 Craterelius fallax (GU590927)

100

Craterellus cornucopioides (UDB000053)

Craterellus tubaeformis (UDB001527)

100

Craterellus tubaeformis (UDB002389)

ae Cantharelius appalachiensis (HQ386220)

93 Cantharellus cibarius (DQ200926)

hay 400 Cantharellus cibarius (HQ270128)

Cantharellus lateritius (HQ270121)

100

Cantharellus sp. (HM776721)

Canthareflus minor (HQ270119)

Clavutina cinerea (UDB001532)

Clavulina rugosa (UDB001533)

—— 0.05 substitutions/site

Craterellus atratus comb. nov. (Thailand) ... 417

embedded in sandy, surface passing irregularly into a pale grey, smooth to very

faintly wrinkled hymenium which commences uniformly dark greyish buff but

then becomes darker. FLESH concolorous.

BASIDIOSPORES 9 x 6-7 um, ellipsoid, smooth, thin-walled with minute

guttules, inamyloid. Basip1A 4-6-spored. CysTip1A absent. CLAMp-

CONNECTIONS rare.

SPECIMEN EXAMINED: THAILAND, NAN PROVINCE, VEINGSA DistTRICT, locality, on

bare ground in dipterocarp forest, 29 July 2006, coll. Sihanonth (BCMU ND1, GenBank

AB445115).

Corner (1966), who described this species from the type collection from Rio

de Janeiro, Brazil, also recorded it from Pernambuco, Brazil, and Brunei. Our

material agrees with the pickled collection held in Edinburgh as a collection

sent by Singer from Pernambuco, Brazil. Singer misidentified the Pernambuco

collection as the Venezuelan Craterellus orinocensis Pat. & Gaillard, a much

larger fungus reaching 8 cm high and 2-3 cm wide, allied with Cr. cornucopioides

(L.) Pers. (Patouillard & Gaillard 1888) and possibly, as Heinemann (1958)

suggests, a variety of Cr cornucopioides. Singer's Pernambuco material is a

rather small (pileus 2 cm diam) cantharelloid fungus and resembles a minute,

smooth version of the widespread temperate Cr. tubaeformis (Fr.) Queél.

(= C. infundibuliformis (Scop.) Fr.). Unlike Cr. tubaeformis, Cr. atratus shows

no hint of yellow in the stipe. Corner (1966) originally included C. atratus

in Cantharellus subg. Phaeocantharellus, but Donk (1969) indicated that the

name Cantharellus sect. Leptocantharellus Peck has priority for this group.

Subsequent molecular studies (Feibelman et al. 1997, Dahlman et al. 2000)

have shown that core species in this group are more closely allied to Craterellus

than to the Cantharellus cibarius consortium and should therefore be accepted

in Craterellus (Fic. 2), and we therefore propose the new combination,

Cr. atratus.

Pterygellus polymorphus var. minor Corner, Ann. Bot. Mem. 2: 170, 1966. Fic. 3

PiLEus 0.5-3 cm plane or plano-convex & simple at first then almost

multipileate from deep incisions, rich, clear chrome-yellow but more

ochraceous yellow towards centre in older specimens, deeply depressed,

minutely scurfy roughened especially towards margin, smoother inwards and

minutely fibrillose; margin uniform when young then soon wavy and flanged,

becoming even more so with age and almost dichotomously lobed, irregularly

Fic. 2. A neighbor-joining tree showing placement of Craterellus atratus (AB445115) and

Pterygellus polymorphus var. minor (AB445116). Clavulina cinerea and Clavulina rugosa were

used as outgroups. Numerical values on branched are the bootstrap values as percentage bootstrap

replication from a 1000 replicate analysis. The scale bar indicates 0.05 of the genetic distance

between samples.

418 ... Yomyart & al.

' a - vt ; , F

Peek 83.569. pea un

Fic. 3. Pterygellus polymorphus var. minor. A: cluster of basidiomes in study area. B: Scanning

electron micrograph showing four basidiospores attached to basidia. C: High magnification

scanning electron micrograph of basidiospores, showing smooth wall and ellipsoid shape. Scale

bars: A = 1 cm; B = 10 um; C = 5um.

incised, wavy and toothed with fimbriate extensions. STIPE rich carrot colour

to chrome yellow, darkening downwards, quite short compared with extension

of hymenial surface. HYMENIUM smooth, lacking even minute wrinkles except

at pileus margin, whitish or ivory as if frosted, quite deep and irregular and

fimbriate, yellow towards basal regions. FLEsH thin, pale yellow with a possible

faint pinkish cast.

Craterellus atratus comb. nov. (Thailand) ... 419

BASIDIOSPORES 8-9 x 6-7 um ellipsoid to broadly ellipsoid, smooth, hyaline,

thin-walled, non-amyloid. Basip1a 4-spored. CystTip1a absent. CLAMP-

CONNECTIONS absent.

SPECIMEN EXAMINED: THAILAND, KANCHANBURI PROVINCE, SISAWAT DISTRICT,

locality, on soil troops in dipterocarp forest, 20 October 2007, coll. Sihanonth (BCMU

KD1, GenBank AB445116).

Although agreeing in all microscopic characters with P polymorphus Corner var.

polymorphus, the small size of the basidiomes in the Kanchanaburi collections

places them in P polymorphus var. minor, a small fungus described from the

Reservoir Jungle, Singapore, and differing from the type variety in its smaller

size, being only slightly over 10 mm maximum. Corner (1966) described

the typical variety as growing on soil in woodland in Pahang and Kedah,

Malaysia. Our material agrees with both figures and coloured illustrations of

P. polymorphus var. minor as well as with an excellent colour photograph in The

Mycologist, portraying material collected in New Guinea (Verbeken & Walleyn

1999). Superficially the fungus approaches Craterellus aureus Berk. & M.A.

Curtis in outward appearance, except that but the pileus is not perforate.

Our material also resembles Pseudocraterellus luteus (Pat.) D.A. Reid,

a similar species that Corner (1966) suggested might be compared with

P. polymorphus. Indeed, all our collections are very close to Ps. luteus except for

the prominent fimbriate pileus margin present in our material. The basidiome

colour also differs, being more yellowish than orange when fresh before finally

fading to brownish in Ps. luteus whilst P polymorphus is an intense yellow-

orange (especially in the stipe) when young before fading to an ochraceous

yellow. Pterygellus is a stereoid-like fungus and differs from Pseudocraterellus

in the lack of secondary septation and in the thickened hyphal walls. Pterygellus

polymorphus sequence analysis places the fungus on a branch close to

Pseudocraterellus sinuosus (Fr.) Corner, as indicated in Fie. 2.

Acknowledgements

We wish to thank Professor Anthony J.S. Whalley and Dr. Maria P. Martin on their

valuable critical comments on the manuscript. This work was financially supported

by the Thailand Research Fund through the Royal Golden Jubilee Ph.D. program to

S. Yomyart and P. Sihanonth under research project no. 2.B.CU/47/N.1 and a part of

Graduate School Chulalongkorn University Thesis Grant.

Literature cited

Corner EJH. 1966. A monograph of the cantharelloid fungi. Annales of Botany Memoirs 2:

L=259.

Dahlman M, Danell E, Spatafora JW. 2000. Molecular systematics of Craterellus: cladistic analysis

of nuclear LSU rDNA sequence data. Mycol. Res. 104: 388-394.

http://dx.doi.org./10.1017/S0953756299001380

Donk MA. 1969. Notes on Cantharellus sect. Leptocantharellus. Persoonia 5: 265-284.

420 ... Yomyart & al.

Feibelman TP, Doudrick RL, Cibula WG, Bennett JW. 1997. Phylogenetic relationships within the

Cantharellaceae inferred from sequence analysis of the nuclear large subunit rDNA. Mycol. Res.

101(12): 1423-1430. http://dx.doi.org./10.1017/S0953756297004115

Gardes M, Bruns TD. 1993. ITS primers with enhanced specificity for basidiomycete applications

to the identification of mycorrhizae and rusts. Mol. Ecol. 1: 113-118.

http://dx.doi.org./10.1111/j.1365-294X.1993.tb00005.x

Heinemann P. 1958. Champignons recoltres au Congo Belge par Madame M. Goossens-Fontana.

III. Cantharellineae. Bull. Jardin Bot.de LEtat, Bruxelles 28(4): 385-438.

Patouillard N, Galliard MA. (1888) Champignons de Vénézuéla et principalement de la région du

Haut-Orénoque récoltés par. M.A.Galliard Bulletin Sociéte de Mycologique de France 4: 7-46

Reid DA. 1962. Notes on fungi which have been referred to the Thelephoraceae sensu lat. Persoonia

2 (2): 109-169. A monograph of stipitate stereoid fungi. Nova Hedwigia Beihefte 18: 1-382.

Swofford DL. 1999, PAUP*. Phylogenetic analysis using parsimony (and other methods), version

4.08b8. Sinauer Associates, Sunderland, MA, USA.

Verbeken A, Walleyn R. 1999. Is Pterygellus mycorrhizal with a euphorbia? Mycologist 13: 37.

White TJ, Bruns T, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal rna

genes for phylogenetics. 315-322, in: MA Innes et al. (eds). PCR protocols. A guide to methods

and applications. San Diego, California: Academic Press, Inc.

Zhou Z, Miwa M, Hogetsu T. 1999. Analysis of genetic structure of a Suillus grevillei population in

a Larix kaempferi stand by polymorphism of inter-simple sequence repeat (ISSR). New Phytol.

144: 55-63.

MYCOTAXON

http://dx.doi.org/10.5248/122.421

Volume 122, pp. 421-432 October-December 2012

Lichens newly recorded from the South Korean coast

Lu-Lu ZHANG", XIN-YU WANG” ?*, ZUN-TIAN ZHAO? & JAE-SEOUN Hur”

" College of Life Sciences, Shandong Normal University Jinan, 250014, P. R. China

? Korean Lichen Research Institute, Sunchon National University, Sunchon, 540-742, Korea

°Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany,

Chinese Academy of Sciences, Yunnan 650204, China

* These authors contributed equally to this work

CORRESPONDENCE TO *: 'ztzhao@sohu.com, *jshurl@sunchon.ac.kr

ABSTRACT — Twelve new records of lichen species are reported from the southwestern coast

of South Korea. Among them, ten are crustose lichens and two are macrolichens. Caloplaca

yuchiorum and Lecidea varians are reported for the first time from Asia. The coastal rocky

area offers great potential for the discovery of new or previously unrecorded crustose lichens

in the country.

Key worps — biodiversity, taxonomy, maritime, saxicolous, lichenized fungi

Introduction

The southwestern coast of South Korea where we conducted most of our

research is mainly composed of rocks surrounded by thousands of small rocky

islands (PL. 1). In contrast to macrolichens, which have been studied thoroughly

(Park 1990), crustose lichens are poorly studied in South Korea. Because the

rocky coast area harbors a rich diversity of crustose lichens (Joshi et al. 2009,

2011), we focused the study in this area and found many species that have not

been reported previously for the country.

Most of the new records reported in this study were growing on coastal

rocks, while only a few of them were on bark. Due to the difficulty of collecting

lichens on rock, saxicolous lichens are still poorly studied, compared with the

terricolous or corticolous ones. In addition, no expert has studied such crustose

genera as Acarospora A. Massal., Ochrolechia A. Massal., or Pertusaria DC. in

the region, so that future new discoveries might be found within the crustose

lichen groups, especially those occurring in the coastal rocky region.

Materials & methods

Specimens were collected from the western and southwestern coast of South Korea

in 2011. Samples were hand-sectioned under Nikon SMZ645 dissecting microscope

422 ... Zhang & al

125° 130°E

PLATE 1. Collection sites for lichens newly recorded from South Korea.

and observed under Nikon E200 microscope using standard microscopical techniques.

Lichen substances were identified using standardized thin layer chromatography

techniques (TLC) with C system (Orange et al. 2010). The specimens are lodged at

herbarium of Lichen & Allied Bioresource Center, Korean Lichen Research Institute

(KoLRI), Sunchon National University, Korea.

New lichen records for South Korea... 423

The new records

Acarospora veronensis A. Massal., Ric. auton. lich. crost.: 29 (1852). Piz2A

Thallus medium brown to dark brown, of dispersed areoles, thinly scattered

in lines following cracks, or in places as contiguous groups; areoles 0.2-1.0 mm

wide, rounded or angular by compression, occasionally slightly lobulate, flat or

slightly convex, matt or shiny. Medulla white; lower surface corticated, white to

light brown. Apothecia numerous, deeply immersed, round to angular, 0.2-0.4

mm in diam., 1-3 per areole, sometimes confluent, sessile, concave, crater-

like, of same color as thallus or reddish brown; epihymenium yellowish brown;

hymenium hyaline 60-100 um high; subhymenium and hypothecium hyaline;

Asci cylindrical, more than 100 spores per ascus; Ascospores hyaline, simple,

narrowly to broadly ellipsoid, 3-6 x 1.5-2 um.

SPOT TESTS — thallus: K-, C-, KC-, P-.

SECONDARY METABOLITES — none detected.

SPECIMEN EXAMINED — SOUTH KOREA. GYEONGNAM: NAMHAE COUNTY, seaside,

34°43.515'N 127°53.678’E, alt. 16 m, on rock, 28 Apr. 2011, Hur 110244 (KoLRI).

COMMENTS — Acarospora veronensis is similar to A. impressula, which has

more punctiform, less concave apothecia.

Reported from Europe, North & Central America, and Asia (Smith et al.

2009), A. veronensis is new to South Korea.

Bacidia egenula (Nyl.) Arnold, Flora 53: 472 (1870). PL. 2B

Thallus gray-green to yellowish green, crustose, thin to thick. Apothecia flat

or slightly convex, 0.2-0.6(-0.8) mm in diam.; disc bluish gray to dull black,

epruinose; exciple olive-green at the outer edge, hyaline interior; epihymenium

olive-green to blue-green, K-, N+ reddish; hymenium hyaline, colorless, 35-50

um tall; hypothecium brown to reddish brown in upper part, colorless below.

Ascospores hyaline, 3- to 7-septate or indistinctly septate acicular, clavate or

long-bacilliform, straight or slightly curved, 25-40 x 1.5-2.5 um.

SPOT TESTS — thallus: K-, C-, KC-, P-.

SECONDARY METABOLITES — none detected.

SPECIMEN EXAMINED — SOUTH KOREA. GYEONGNAM: NAMHAE COUNTY, Changseun

Island, 34°51.856'N 127°57.715'E, alt. 4 m, on rock, 29 Apr. 2011, Hur 110289 (KoLRI).

ComMENTsS — Bacidia egenula is similar to B. arnoldiana and B. viridescens

but B. arnoldiana can be distinguished by 1-3-septate spores and a colourless

epihymenium and B. viridescens differs by its colourless hypothecium and

larger thallus granules (80-120 um diam).

Reported from Europe, North America, and Asia (Smith et al. 2009),

B. egenula is new to South Korea.

424 ... Zhang & al

Buellia prospersa (Nyl.) Riddle, Brooklyn Bot. Gard. Mem. 1: 114 (1918). Pi,2c

Thallus crustose, epilithic, thin to moderately thin, continuous, surface

smooth and rimose, slightly roughened, yellowish gray to light gray, epruinose,

without soredia or isidia, prothallus absent; medulla white. Apothecia lecideine,

0.5-1.0 mm in diameter, sessile, disc black and plane, epruinose, with black

and smooth margin; exciple narrow, inner hyphae hyaline, with darkened outer

part; epihymenium brown, hymenium hyaline, paraphyses simple or branched.

Asci clavate, Bacidia-type, 8-spored, ascospores brown, ellipsoid with obtuse

ends, l1-septate, 10-15 x 6-8 um. Pycnidia not seen.

SPOT TESTS — thallus: K-, C-, KC-, P-.

SECONDARY METABOLITES — no compounds or with norstictic acid,

connorstictic acid and several xanthones (UV+ orange).

SPECIMENS EXAMINED — SOUTH KOREA. JEONNAM: WANDO couNTY, Cheongsan

Island, 34°09.187'N 126°52.821’E, alt. 2 m, 23 Jun. 2011, Hur 110711 (KoLRI); SHINAN

COUNTY, Palgseun Island, 34°47.790'N 126°10.173’E, alt. 1 m, on rock, 2 Jun. 2011, Hur

110389 (KoLRI); Heuksan Island, 34°40.901'N 125°26.671’E, alt. 3 m, 21 Jun. 2011, Hur

110530 (KoLRI).

ComMENTsS — Buellia prospersa is easily separated from other Korean Buellia

species by its yellowish surface (UV+ orange) and growth only on the coastal

siliceous rocks.

Cosmopolitan but restricted to coastal areas (Nash et al. 2007), B. prospersa

is new to South Korea.

Caloplaca yuchiorum Lendemer & C.A. Morse, J. Torrey Bot. Soc. 137: 328 (2010).

PL, 2D

Thallus gray-white, rimose-areolate, areoles plane, smooth, upper surface

postulate, and pustules broken and forming soredia; prothallus black. Apothecia

immersed to subimmersed, up to 0.7 mm, with only proper margin or with

additional thalloid margin, proper margin black when prominent; disc dark

brown to black, flat; exciple with or without algae; epihymenium light brown

with blue-green, K+ light violet, N+ violet; hymenium 65-85 um, with oil

droplets; hypothecium hyaline, with oil droplets. Ascospores hyaline, 2 locules,

ellipsoid, (9-)11-18 x (4-)4.5-7 um, isthmus at least 1/3 of spore length.

Pycnidia present, immersed, conidia bacilliform, 3.5-4.5 x 1-1.2 um.

SPOT TESTS — cortex: K+ yellow, C-, N-; medulla: K-, C-, N-.

SECONDARY METABOLITES — atranorin (thallus), anthraquinone pigment

(epihymenium).

SPECIMENS EXAMINED — SOUTH KOREA. GYEONGNAM: NAMHAE COUNTY, Changseun

Island, 34°51.891'N 127°57.705'E, alt. 2 m, on rock, 29 Apr. 2011, Hur 110280 (KoLRI);

TONGYEONG CITY, Salyang Island, 34°50.590'N 128°12.137’E, alt. 28 m, on rock, 20 Apr.

2011, Hur 110028 (KoLRI). JEONAM: JINDO COUNTY, seaside, 34°32.910'N 126°18.697'E,

alt. 3 m, on rock, 3 Jun. 2011, Hur 110462 (KoLRI).

New lichen records for South Korea... 425

PLATE 2. Habit of newly recorded lichens. A. Acarospora veronensis, Hur 110244; B. Bacidia

egenula, Hur 110289; C. Buellia prospersa, Hur 110598; D. Caloplaca yuchiorum, Hur 110284;

E. Lecanora melacarpella, Hur 110352; F. Lecanora pseudistera, Hur 110466. Scale bars: B = 1 mm;

A, C-F =5 mm.

ComMENTS — Caloplaca yuchiorum is very similar to C. diplacia, which differs

in having a sorediate thallus with a pale prothallus, smaller apothecia (0.3-1.0

mm wide), and an epihymenium with an anthraquinone pigment that reacts

K + magenta.

Reported from North America (Lendemer & Morse 2010), C. yuchiorum is

new to South Korea and Asia.

426 ... Zhang & al

Lecanora melacarpella Mill. Arg., Bull. Herb. Boissier 3: 633 (1895) PL. 2E

Thallus whitish to grayish white, crustose, uniform, continuous or dispersed

verrucose to verruculose, epruinose; margins indefinite or definite, sometimes

with a whitish prothallus. Apothecia sessile, constricted at base, 0.6-1.5 mm

diam.; discs brown to dark brown, epruinose; margins smooth to verruculose

or verrucose, prominent. Amphithecium with small K-soluble and large

crystals; parathecium hyaline with small K-soluble crystals; epithecium without

crystals, with a 2 um high hyaline layer above; hymenium hyaline, 65-85 um

tall; hypothecium hyaline, inspersed with oil droplets. Ascospores ellipsoid,

(9-)10.5-13.5 (-15.5) x (5.5-) 7.5-8.5 um.

SPOT TESTS — thallus: K+ yellow, C-, KC-, Pd+ light orange.

SECONDARY METABOLITES — atranorin, zeorin, unidentified triterpenoid

(minor).

SPECIMENS EXAMINED — SOUTH KOREA. GYEONGNAM: NAMHAE COUNTY, Mt.

Mangeun, 34°51.076'N 127°49.605’E, alt. 165 m, 29 Apr. 2011, Hur 110144 (KoLRI).

JEONAM: JINDO COUNTY, Jeob-do Island, 34°23.091'N 126°18.250’E, alt. 2 m, 3 Jun. 2011,

Hur 110516 (KoLRI); SHINAN CounTY, Palgeum Island, 35°47.734'N 126°10.219’E, alt. 2

m, 2 Jun. 2011, Hur 110352 (KoLRI).

COMMENTS — Lecanora melacarpella is similar to L. gangaleoides, which is

diagnosed by gangaleoidin and a thicker, verrucose thallus.

Reported from Australasia and India (Lumbsch & Elix 2004, Galloway

2007), L. melacarpella is new to South Korea.

Lecanora pseudistera Nyl., Flora 55: 354 (1872). PL. 2F

Thallus yellowish gray or whitish gray, crustose to subsquamulose, surface

smooth and epruinose, without soredia, verrucose-areolate or dispersed-

areoles. Apothecia 0.4-1.5(-2.0) mm in diam., red-brown to brown, plane,

epruinose, subimmersed to sessile; margins concolorous with thallus, thin

or thick, persistent, entire or flexuose, even and entire; amphithecium with

large crystals insoluble in K; epithecium without crystals, red-brown to

orange-brown; hymenium hyaline, c. 60 um high, paraphyses with a clear cap;

subhymenium hyaline, c. 20 um. Ascospores, hyaline, simple, ellipsoid, 9-15 x

5-7 um. Pycnidia not seen.

SPOT TESTS — thallus: K+ yellow, C-, KC-, P+ light orange.

SECONDARY METABOLITES — atranorin, 2’-O-methylperlatolic acid.

SPECIMEN EXAMINED — SOUTH KOREA. JEONAM: JINDO COUNTY, Seaside, 34°32.910'N

126°18.697’E, alt. 3 m, on rock, 2 Jun. 2011, Hur 110461, 110466 (KoLRI).

ComMENTS — Lecanora pseudistera is very similar to L. campestris, which has

small crystals in the amphithecium and lacks 2’-O-methylperlatolic acid.

Reported from Europe, the Americas, Asia, South Africa, and Australasia

(Lumbsch & Elix 2004), L. pseudistera is new to South Korea.

New lichen records for South Korea ... 427

Lecanora strobilina (Spreng.) Kieff., Bull. Soc. Hist. Nat. Metz 19: 72 (1895). PL. 3a

Thallus greenish gray to yellowish gray, crustose, without soredia, poorly

developed or granular-warted with areoles or rimose; areoles convex, 0.1

— 0.2 mm in diameter; Apothecia rounded or slightly irregular in outline,

rarely single, mostly densely crowded, 0.30-0.40 mm in diam.; disc yellowish

ochre to orange-brown, flat to moderately or rarely strongly convex, dull,

finely white pruinose; margin white, pale gray or more rarely of same color

as the thallus. Amphithecium present, with an algal layer filled with small

granules; epihymenium orange-brown; hymenium hyaline, (35-)40-50 um

tall; subhymenium hyaline. Ascospores hyaline, simple, narrowly ellipsoid,

(8.5-)10.6-12.4(-16.5) x (3—)3.3-3.8(-4.5) um.

SPOT TESTS — thallus: K-, C-, KC-, P-.

SECONDARY METABOLITES — usnic acid, decarboxysquamatic acid, +

zeorin.

SPECIMEN EXAMINED — SOUTH KOREA. JEONAM: JINDO COUNTY, Jeob-do Island,

34°23.091'N 126°18.250'E, alt. 2 m, on the Pinus bark from the coastal region, 3 Jun.

2011, Hur 110513 (KoLRI); Hachodo Island, 34°16.592'N 126°04.215’E, alt. 22 m, on the

Pinus bark from the coastal region, 23 Aug. 2011, Hur 110854 (KoLRI); SHINAN COUNTY,

Bogil Island, 34°09.275'N 126°34.740’E, alt. 3 m, on the Pinus bark from the coastal

region, 23 Jun. 2011, Hur 110635 (KoLRI); Palgeum Island, 35°47.790'N 126°10.173’E,

alt. 1 m, on the Pinus bark from the coastal region, 2 Jun. 2011, Hur 110392 (KoLRI).

Comments — Lecanora strobilina is very similar to L. confusa but distinguished

by absence of xanthones and lower hymenium (not exceeding 70 um).

Reported from Europe, Macaronesia, North America, Asia, and Africa

(Smith et al. 2009), L. strobilina is new to South Korea.

Lecidea varians Ach., Syn. Meth. Lich.: 38 (1814). PL. 3B

Thallus grayish green to yellowish green, thin, without soredia, mostly

continuous, sometimes warted-aerolate, rimose or rarely endosubstratal thallus.

Apothecia small and rounded, 0.15-0.4 mm in diam., often in groups of 3-5,

sessile; disc brown to reddish brown, with or without white pruina, plane to

weakly convex; margin weakly prominent and soon excluded or lacking from

the beginning; exciple brown at the outer edge, hyaline interior; epihymenium

brown; hymenium hyaline, 50-70 um high, subhymenium and hypothecium

hyaline. Asci Lecanora-type, ascospores hyaline, simple, ellipsoid to broadly

ellipsoid, 8-13 x (4-)5-7 um.

SPOT TESTS — thallus: K+ yellow, C-, P-, UV+ orange.

SECONDARY METABOLITES — atranorin, xanthones.

SPECIMEN EXAMINED — SOUTH KOREA. GYEONGNAM: TONGYEONG CITY, Salyang

Island, 34°51.045'N 128°12.364’E, alt. 45 m, on the Prunus bark from the coastal region,

20 Apr. 2011, Hur 110035 (KoLRI).

428 ... Zhang & al

Comments — Although L. varians does not belong to Lecidea s. str., we retain

it here because its generic position is still unclear.

Reported from North America and Europe (Nash et al. 2004), L. varians is

new to South Korea and Asia.

Ochrolechia tartarea (L.) A. Massal., Ric. auton. lich. crost.: 30 (1852). PL..3¢

Thallus pale to dark gray, often very thick, to 3 mm or more, surface soft,

powdery-tartareous, often with numerous irregular warts forming an uneven

corrugate crust, sometimes with a paler zoned margin and a pale prothallus.

Apothecia usually frequent, immersed and closed at first, becoming rounded

or irregular, scattered or crowded, sessile; thalline exciple thick, wavy; disc to

5 mm diam., pale brown to dull orange-pink, concave to flat, the surface often

scabrose-roughened; epihymenium granular, the granules dissolving in K;

hymenium 200-300 um; hypothecium light yellow. Ascospores (30-) 40-70 x

20-40 um, broadly ellipsoid.

SPOT TESTS — cortex and medulla: K-, C+ pink, KC+ red, Pd-; apothecial

disc C+ red.

SECONDARY METABOLITES — gyrophoric acid, lecanoric acid.

SPECIMENS EXAMINED — SOUTH KOREA. GYEONGNAM: NAMHAE COUNTY, Mt.

Daebang, 34°51.006'N 127°59.427'E, alt. 87 m, on rock, 20 Apr. 2011, Hur 110274

(KoLRI). JEonAm: WANDO Country, Cheongsan Island, 34°09.187'N 126°52.821’E, alt. 2

m, on rock, 23 Jun. 2011, Hur 110733 (KoLRI).

CoMMENTS — Its tartareous C+ pink thallus distinguishes O. tartarea from the

morphologically similar O. parella, which produces a thallus that is fissured

and C + yellow.

Reported from Europe, Macaronesia, North America, Asia, Africa, and

subantarctic (Galloway 2007, Smith et al. 2009), O. tartarea is new to South

Korea.

Pertusaria flavicans Lamy, Bull. Soc. bot. Fr. 25: 427 (1878). PL. 3D

Thallus crustose, epilithic, rather thick, surface roughened, irregularly

coarsely warted, usually continuous, slightly rimose to areolate, yellowish gray

to light yellowish; areoles irregular in shape or rounded, flat or sometimes

slightly convex, <1 mm in diameter, sometimes papillae present; prothallus

absent; yellow soralia on the surface, abundant, 0.5-1 mm in diameter, often

gathered in the central part of the thallus, color paler than the thallus, coarsely

granular; isidia absent. Apothecia and pycnidia not seen.

Spot TESTS — thallus: K-, C+ orange, KC+ orange, P-.

SECONDARY METABOLITES — norstictic acid, salazinic and xanthones (UV+

orange).

New lichen records for South Korea ... 429

PLATE 3. Habit of newly recorded lichens. A. Lecanora strobilina, Hur 110513; B. Lecidea varians,

Hur 110035; C. Ochrolechia tartarea, Hur 110274; D. Pertusaria flavicans, Hur 110259; E. Ramalina

sekika, Hur 110645; F. Xanthoparmelia congensis, Hur 110949. Scale bars = 5 mm.

SPECIMENS EXAMINED — SOUTH KOREA. GYEONGNAM: TONGYEONG CITY, Salyang

Island, 34°51.016’N 128°11.985’E, alt. 300 m, on rock, 20 Apr. 2011, Hur 110050

(KoLRI). JEonAm: WANDO country, Cheongsan Island, 34°12.218'N 126°54.357'E, alt. 5

m, on rock, 23 Jun. 2011, Hur 110757 (KoLRI). JEONBUK: GUNSAM CITY, Shinsi Island,

35°49.091'N 126°28.159’E, alt. 141 m, on rock, 22 Aug. 2011, Hur 110780 (KoLRI).

430 ... Zhang & al

ComMEnts — Pertusaria flavicans is easily recognized by its yellowish (UV+

orange) thallus, yellow soralia, and growth only in the coastal rocks.

Reported from Europe, Macaronesia, and Asia (Smith et al. 2009), Pertusaria

flavicans is new to South Korea.

Ramalina sekika Asahina, Journ. Jap. Bot. 17: 138 (1941). PL. 3E

Thallus growing on the rock, fruticose, erect and forming tufts, attached by a

basal holdfast, surface dull yellowish green or grayish green, turning brownish

near the base, 1-3 cm long, with a few branches; branch 2-5 mm wide,

flattened and solid, wider in the middle part, irregularly branched near the tips;

surface rather scabrid, covered with numerous pseudocyphellae surrounded by

granules, the other side of the surface often smooth and yellowish; cortex thin,

composed of thick-walled hyphae, medulla white; Apothecia and pycnidia not

found.

SPOT TESTS — cortex: K-, C-, KC+ yellow; medulla: K-, C-, KC+ pale red.

SECONDARY METABOLITES — usnic, sekikaic, 4’-O-demethylsekikaic and

+salazinic acids.

SPECIMENS EXAMINED — SOUTH KOREA. GYEONGNAM: NAMHAE COUNTY, seaside,

34°48.853'N 127°49.698’E, alt. 2 m, on rock, 28 Apr. 2011, Hur 110219 (KoLRI). JEONAM:

YEONGGWANG COUNTY, West seaside, 35°19.635'N 126°22.695’E, alt. 2 m, on rock, 1

Jun. 2011, Hur 110299 (KoLRI); WANDo county, Cheongsan Island, 34°09.187'N

126°52.821'E, alt. 2 m, on rock, 23 Jun. 2011, Hur 110707 (KoLRI).

ComMENTS — Ramalina sekika usually grows together with R. pollinaria; both

species have similar habitat and morphology, but R. pollinaria has fine soralia

on the surface and marginal part, while R. sekika has rough surface covered

with pseudocyphellae and usually contains salazinic acid.

Reported from China and Japan (Asahina 1941, Wei 1991), Ramalina sekika

is new to South Korea.

Xanthoparmelia congensis (J. Steiner) Hale, Phytologia 28: 486 (1974). PL. 3F

Thallus foliose, tightly adnate on the rock, 2-5 cm broad, dark yellowish

green in the central part, turning light yellow-green near the tips; lobes rather

narrow, sublinear, 0.2-0.6 mm wide, sometimes branched, tips subrounded to

rounded; upper surface shiny, covered with dense globose isidia, <0.1 mm in

diameter, paler than the thallus, mainly in the central part of the thallus, tip part

sometimes bursting open but not becoming sorediate, without any branches;

medulla white; lower surface black and shiny, plane and smooth, black rhizines

sparse, simple, c. 0.3 mm long; Apothecia and pycnidia not seen.

SPOT TESTS — cortex: K-, C-, KC-, P+ orange; medulla: K+ yellow to red,

C-, KC-, P+ orange.

SECONDARY METABOLITES — stictic acid (major), constictic, cryptostictic,

norstictic, menegazziaic and usnic acid.

New lichen records for South Korea... 431

SPECIMENS EXAMINED — SOUTH KOREA. JEONAM: GOHONG COUNTY, Wenaro Island,

34°27.236'N 127°31.153’E, alt. 8 m, on rock, 24 Aug. 2011, Hur 110219 (KoLRI). SHINAN

COUNTY, Heuksan Island, 34°39.882'’N 125°26.189’E, alt. 5 m, on rock, 21 Jun. 2011, Hur

110557 (KoLRI).

CoMMENTs — Compared with other Korean Xanthoparmelia species, X. congensis

is relatively small in size and found only in the seaside rocks. It might be

confused with X. orientalis, which also has the black lower surface, which is

distinguished by its larger lobes (1-2. 5 mm) and different chemical compounds

(usnic acid, salazinic acid, consalazinic acid, and trace of norstictic acid).

Reported from Mexico, South Africa, Australia, India and China (Hale

1990), Xanthoparmelia congensis is new to South Korea.

Acknowledgements

This work was supported by a grant from Korea National Research Resource Center

Program (Grant 2010-0000660), Korean Forest Service Program (KNA 2010) through

Korea National Arboretum, and the founding of key laboratory, CAS (KLBB-201210).

We thank Dr. Sergey Kondratyuk (M.H. Kholodny Institute of Botany, Kiev, Ukraine)

and Dr. Shou-Yu Guo (Institute of Microbiology, Chinese Academy of Sciences, Beijing,

China) for kindly reviewing this paper.

References

Asahina Y. 1941. Lichenologische Notizen XVI. Journal of Japanese Botany 17: 136-143.

Galloway DJ. 2007. Flora of New Zealand Lichens. Manaaki Whenua Press, Lincoln. 1046 p.

Hale ME. 1990. A synopsis of the lichen genus Xanthoparmelia (Vainio) Hale (Ascomycotina,

Parmeliaceae). Smithsonian Contributions to Botany 74: 1-250.

http://dx.doi.org/10.5479/si.0081024X.74

Joshi Y, Wang XY, Lee MY, Byun BK, Koh YJ, Hur JS. 2009. Notes on some new records of macro-

and micro-lichens from Korea. Mycobiology 37: 197-202.

http://dx.doi.org/10.4489/MYCO.2009.37.3.197

Joshi Y, Nguyen TT, Wang XY, L6kés L, Koh YJ, Hur JS. 2011. Contribution to the lichen mycota of

South Korea. Mycotaxon 116: 61-74. http://dx.doi.org/10.5248/116.61

Lendemer JC, Morse CA. 2010. Caloplaca yuchiorum (Teloschistaceae, lichenized Ascomycota), a

new sorediate species from North America. Journal of the Torrey botanical Society 137(4):

327-332. http://dx.doi.org/10.3159/10-RA-025.1

Lumbsch HT, Elix JA. 2004. Lecanora. Pp. 12-62, in: PM McCarthy, K Mallett (eds). Flora of

Australia, Vol. 56A, Lichens 4. ABRS and CSIRO Publishing.

Nash TH III, Ryan BD, Diederich P, Gries C, Bungartz F (eds). 2004. Lichen flora of the greater

Sonoran desert region, Vol. 2. Lichens Unlimited, Arizona State University, Tempe, Arizona.

742 p.

Nash TH II, Ryan BD, Gries C, Bungartz F (eds). 2007. Lichen flora of the greater Sonoran desert

region, Vol. 3. Lichens Unlimited, Arizona State University, Tempe, Arizona. 567 p.

Orange A, James PW, White FJ. 2010. Microchemical methods for the identification of lichens. 2nd

edition. London: British Lichen Society.

Park YS. The macrolichen flora of South Korea. 1990. Bryologist 93: 105-160.

http://dx.doi.org/10.2307/3243619

432 ... Zhang & al

Smith CW, Aptroot A, Coppins BJ, Fletcher A, Gilbert OL, James PW, Wolseley PA (eds). 2009. The

lichens of Great Britain and Ireland. Natural History Museum Publications, in association with

The British Lichen Society. 1046 p.

Wei JC. 1991. An enumeration of lichens in China. International Academic Publishers, Beijing.

2TOMD:

MY COTAXON

http://dx.doi.org/10.5248/122.433

Volume 122, pp. 433-441 October-December 2012

Polyporus submelanopus sp. nov. (Polyporales, Basidiomycota)

from Northwest China

HuI-JUN XUE*? & LI-WEI ZHOU"

'State Key Laboratory of Forest and Soil Ecology, Institute of Applied Ecology,

Chinese Academy of Sciences, Shenyang 110164, P. R. China

*Graduate University of the Chinese Academy of Sciences, Beijing 100049, PB. R. China

* CORRESPONDENCE TO: liwei_zhou1982@163.com

ABsTRACT — Polyporus submelanopus, collected from Qinghai Province, Northwest China,

is described and illustrated based on both morphological and phylogenetic analyses. It is

characterized by a terrestrial habit, black-stipitate basidiocarps, circular to angular pores,

two kinds of generative hyphae bearing simple septa and clamp connections respectively,

and cylindrical smooth hyaline basidiospores. Morphologically, P. submelanopus belongs

to the melanopus group and resembles P melanopus in sharing similar pilei with a shallow

central depression, circular to angular pores, basidiospores, and a terrestrial habit. However,

P. melanopus has smaller pores, thicker and entire dissepiment, fusoid cystidioles, and

clamped generative hyphae only. The differences between P. submelanopus and P. badius,

P. xinjiangensis, and P. tubaeformis are discussed as well. Phylogenetic ITS sequence analysis

supports P submelanopus within the melanopus group but distinctly separate from other

sampled species of this group.

Key worps —Polyporaceae, polypore, taxonomy, wood-inhabiting fungi

Introduction

Polyporus P. Micheli ex Adans., type genus of the Polyporaceae, is a well-

known polypore genus. It is characterized by typical formation of stipitate to

substipitate basidiocarps, a dimitic hyphal system with arboriform skeleto-

binding hyphae, smooth cylindrical to subellipsoid inamyloid basidiospores,

and causing a white rot (Gilbertson & Ryvarden 1987, Nunez & Ryvarden

1995).

Nunez & Ryvarden (1995) divided all 32 species of Polyporus into six

morphological groups without taxonomic rank: Admirabilis, Dendropolyporus

[= Dendropolyporus (Pouzar) Jiilich], Favolus (= Favolus Fr.), Polyporellus

(= Polyporellus P. Karst.), Melanopus (= Melanopus Pat.), and Polyporus.

The melanopus group is characterized by coriaceous and _ black-stipitate

434 ... Xue & Zhou

basidiocarps, skeleto-binding hyphae mostly with narrow lumen but solid when

mature, medium to large basidiospores (6-12 x 2-4 um), and growth on dead

woods except for the terrestrial Polyporus melanopus (Pers.) Fr. Since Nufiez

& Ryvarden (1995), some species have been newly described and/or emended

based on morphology (Dai et al. 2003, 2007c, 2009; Sotome et al. 2007; Dai

2012a) or combined morphological and phylogenetic evidence (Sotome et al.

2011).

China is a vast area with varied landscapes and forests inhabited by a high

diversity of wood-decaying fungi. More than 1,200 poroid, corticioid, and

hydnoid taxa have been recorded in China (Dai 2011, 2012b). Polyporus species

have been repeatedly documented from different parts of the country (Dai et

al. 2003, 2004, 2007a,b,c,d, 2009; Dai & Penttila 2006; Cui et al. 2008; Li et al.

2008; Yuan & Dai 2008; Wang et al. 2011), with 36 total species recorded before

this study (Dai 2012b). However, many specimens deposited at the herbarium

of Institute of Applied Ecology, Chinese Academy of Sciences (IFP), are still

not identified to species level. During the re-examination of these specimens,

we found two that match the Polyporus concept but were distinct from any

known species based on both morphological and phylogenetic analyses. They

are described and illustrated here as Polyporus submelanopus.

Materials & methods

The studied specimens are deposited at IFP, China, and Botanical Museum, Finnish

Museum of Natural History (H), Helsinki. The microscopic procedure follows Dai

(2010). Sections were studied at magnifications up to x1000 using a Nikon Eclipse 80i

microscope and phase contrast illumination. Measurements are made from sections

stained with Cotton Blue. In this text, CB stands for Cotton Blue, CB+ for cyanophilous,

CB- for acyanophilous, IKI for Melzer’s reagent, IKI- for negative in Melzer’s reagent,

and KOH for 5% potassium hydroxide. In presenting the variation in the size of the

basidiospores, 5% of measurements were excluded from each end of the range and

given in parentheses. The meanings of other abbreviations are as follows: L = mean

basidiospore length (arithmetic average of all basidiospores), W = mean basidiospore

width (arithmetic average of all basidiospores), Q = variation in the L/W ratios between

the specimens studied, and n = number of basidiospores measured from given number

of specimens. Drawings are made with the aid of a drawing tube. Special color terms

follow Anonymous (1969) and Petersen (1996).

ITS sequences were obtained from herbarium specimens using Phire’ Plant Direct

PCR Kit (Finnzymes Oy, Finland). The primers ITS5 and ITS4 (White et al. 1990)

were used to perform PCR amplifications and subsequent sequencing reactions. Four

newly generated sequences were deposited at GenBank (accession numbers JQ964422-

JQ964425). Other ITS sequences were downloaded from GenBank (TaBLE 1). Polyporus

grammocephalus Berk. and P. pseudobetulinus (Murashk. ex Pilat) Thorn et al. were

selected as outgroup (Kriger et al. 2006). The procedure of phylogenetic analysis was as

below. Firstly, nucleotide sequences were aligned using ClustalX 2.0 (Larkin et al. 2007)

Polyporus submelanopus sp. nov. (China) ... 435

TABLE 1. ITS sequences from Polyporus used in the phylogenetic analysis

SPECIES VOUCHER No.’ ORIGIN GENBANK No.

P. badius - Japan AB587625

- USA AF516558

= USA AF516559

P. guianensis Mont. = Argentina AF516564

- Venezuela AF516566

P leprieurii Mont. - Costa Rica AF516567

P. melanopus = Argentina AF516568

- Argentina AF516569

- Austria AF518759

H 6003449 Finland JQ964422

H 6029190 Finland JQ964423

P. mikawai Lloyd - China AF516570

P. submelanopus IFP 004953 China JQ964424

— (holotype) IFP 004946 China JQ964425

P. tubaeformis - UK AF511438

- UK AF511439

- USA AF511440

ad USA AF511441

= USA AF511442

= Norway AF511443

P. varius (Pers.) Fr. , Germany AF516574

- Germany AF516575

= Russia AF516576

- USA AF516577

- USA AF516578

~ USA AF516579

- USA AF516580

- Japan AB587636

P. grammocephalus - Japan AB587626

P. pseudobetulinus - Japan AB587644

*Provided only for specimens newly sequenced in this study.

with defaulted parameters; secondly, the best-fit evolutionary models for maximum

likelihood (ML) analysis and Bayesian analysis were estimated by jModelTest (Guindon

& Gascuel 2003, Posada 2008) based on corrected Akaike information criterion; finally,

following the optimal models, maximum likelihood (ML) and Bayesian trees were

constructed using PhyML 3.0 (Guindon & Gascuel 2003) and Mrbayes3.2 (Ronquist et

al. 2012), respectively. The ML tree was tested with 100 bootstrap replicates. For Bayesian

analysis, two independent rums were employed. Each run performed a Metropolis-

coupled Markov chain Monte Carlo analysis with four chains for 1,000,000 generations.

Trees were saved per 100th generation. The value of burn-in was set to discard the first

25% trees, and other trees were used to compute a 50% consensus tree and calculate

Bayesian posterior probability.

436 ... Xue & Zhou

Taxonomy

Polyporus submelanopus H.J. Xue & L.W. Zhou, sp. nov. FIG. 1

MycoBAnk MB 800237

Differs from Polyporus melanopus in having two kinds of generative hyphae (one with

simple septa and one with clamp connections), slightly larger pores, thinner and lacerate

dissepiments, and no fusoid cystidioles.

Tye: China, Qinghai Province, Huzhu County, Beishan Forest Farm, on ground in forest

of Picea, 1.1X.2003 Dai 5015 (holotype IFP 004946; GenBank sequence JQ964425).

EryMo.ocy: submelanopus (Lat.): somewhat similar to Polyporus melanopus.

BASIDIOMES: Basidiocarps annual, terrestrial, centrally or laterally stipitate,

solitary. Pilei sometimes slightly infundibuliform, up to 6.2 cm in diam, and

8 mm thick. Pileal surface cinnamon-buff to vinaceous, glabrous, sometimes

wrinkled and faintly zonate when dry; margin acute, concolorous with pileus,

curved down when dry. Pore surface straw-yellow to honey-yellow; pores

circular to angular, 2-3 per mm; dissepiments thin, lacerate. Context white to

cream, soft corky when dry, up to 6 mm thick. Tubes cream to straw-yellow,

decurrent on about three fifths of one side of the stipe with obviously boundary,

up to 2 mm long. Stipe bearing a fuscous to black cuticle, corky, up to 7 cm

long, and 8 mm in diam.

HyPHAL STRUCTURE: Hyphal system dimitic; two kinds of generative hyphae

with one type bearing only simple septa and the other with clamp connections at

each septum; skeletal hyphae arboriform, IKI-, weakly CB+; tissue unchanged

in KOH.

CONTEXT: Generative hyphae common, thin-walled, occasionally branched,

3.5-4 um in diam; arboriform skeletal hyphae frequent, thick-walled with a

wide lumen, moderately branched, aseptate, interwoven, up to 7 um in diam.

TUBES: Generative hyphae frequent, hyaline, thin-walled, frequently

branched and simple septate, clamp connection frequent on the generative

hyphae near the basidia, 1.5-3.5 um in diam; arboriform skeletal hyphae

common, thick-walled with a wide to narrow lumen, moderately branched,

aseptate, interwoven, 1.5-3.2 um in diam; cystidia and cystidioles absent;

basidia clavate, but narrower towards the base, hyaline, thin-walled, bearing

a basal clamp connection and four sterigmata, 24-33 x 5-8 um; basidioles in

shape similar to basidia, but slightly smaller.

STIPE: Generative hyphae scanty; arboriform skeletal hyphae dominant,

thick-walled with a narrow or wide lumen, moderately branched, aseptate,

strongly interwoven, 1.5-7 um in diam. Hyphae in black crust similar to those

in stipe.

Spores: Basidiospores cylindrical, hyaline, thin-walled, smooth, bearing a

large guttule. IKI-, CB-, (7.8-—)8-10(-10.5) x 3-3.9(-4) um, L = 8.95 um, W = 3.38

um, Q = 2.63-2.67 (n = 60/2).

Polyp

SOON

Gp y/o

In avd

WAN Eris

[7 \\

orus submelanopus sp. nov. (China) ... 437

ENS

5 ym

A\at

SA] 5

Fic. 1. Polyporus submelanopus (holotype).

: Basidi : Basidia and basidioles.

spores. b: B

a: Basidiospores.

c: Hyphae from context. d: Hyphae from trama.

438 ... Xue & Zhou

ADDITIONAL SPECIMEN EXAMINED: CHINA, QINGHAI PROVINCE, HuzZHU COUNTY,

Beishan Forest Farm, on ground in forest of Picea, 1.[X.2003 Dai 4997 (IFP 004953;

GenBank sequence JQ964424).

REMARKS: Polyporus submelanopus is characterized by a terrestrial habit,

centrally or laterally black-stipitate basidiocarps, straw-yellow to honey-yellow

pore surface, circular to angular pores, two types of generative hyphae bearing

either simple septa or clamp connections, and cylindrical basidiospores with a

large guttule. Its black stipe and medium basidiospore size match the concept

of the melanopus group (Nufiez & Ryvarden 1995).

Polyporus melanopus resembles P. submelanopus in its similar pileus with a

shallow central depression, circular to angular pore shape, basidiospores, and

terrestrial habit. However, P. melanopus has slightly smaller pores (3-4 per mm,

Gilbertson & Ryvarden 1987; 3-5 per mm, Bernicchia 2005; 3-4(-5) per mm,

Boulet 2007), thicker and entire dissepiments, fusoid cystidioles, and generative

hyphae bearing clamp connections only (Gilbertson & Ryvarden 1987).

Polyporus badius (Pers.) Schwein., a species with simple-septate generative

hyphae, is distinguished from P submelanopus in darker pilei and smaller

pores (5-8 per mm, Nufiez & Ryvarden 1995). In addition, P. badius is a wood-

inhabiting species rather than a terrestrial one.

Polyporus xinjiangensis J.D. Zhao & X.Q. Zhang, originally described from

China, has generative hyphae bearing simple septa like P submelanopus but

produces no generative hyphae with clamp connections (Dai et al. 2007b);

P. xinjiangensis further differs in its wood-inhabiting habit and slightly shorter

basidiospores (7.1-8.5 um long, Dai et al. 2007b).

Macroscopically, P. submelanopus shares similar infundibuliform pilei, a

straw-yellow to pale brownish pore surface, and sharp margin with P tubaeformis

(P. Karst.) Ryvarden & Gilb., which is distinguished by possession of cystidioles

and smaller pores [6-9(-10) per mm, (n = 150/5)] and basidiospores [(5.8-)

6-7.8(-8.2) x (2.1-)2.3-3.2(-3.5) um, L = 6.49 um, W = 2.75 um, Q = 2.27-2.50

(n = 150/5), Dai 1996]. Besides, P tubaeformis has only clamped generative

hyphae and grows on wood rather than ground.

Our ITS dataset had 694 characters. Its best-fit evolutionary models for ML

and Bayesian analyses were estimated as TrN + G and HKY + G, respectively.

The phylogenetic tree (Fic. 2) formed of most members of melanopus group

clusters P submelanopus as a distinct clade within this group. Although

we unfortunately failed to obtain an ITS sequence from P. xinjiangensis, the

ecological habit and morphological differences above are enough to distinguish

P. submelanopus from P. xinjiangensis.

Fic. 2. The phylogenetic tree inferred from ITS sequences of the members of Melanopus group.

Topological structure was from ML analysis. The statistical values both above 75% of bootstrap

value and 0.95 of Bayesian posterior probability are indicated.

Polyporus submelanopus sp. nov. (China) ... 439

P. tubaeformis AF511439

P. tubaeformis AF511438

P. tubaeformis AF511443

P. tubaeformis AF511440

96/1.00

P. tubaeformis AF511441

P. tubaeformis AF511442

P. melanopus JQ964423

tan P. melanopus JQ964422

P. melanopus AF 518759

P. melanopus AF 516569

P. melanopus AF 516568

95/1.00 P. badius AB587625

P. badius AB516559

P. badius AB516558

P. submelanopus JQ964425

100/1.00| P submelanopus JQ964424

P. guianensis AF516566

100/1.00

90/1.00 P. guianensis AF516564

P. leprieurii AF516567

94/1.00- P. varius AF516576

P. varius AF516574

100/1.00 100/1.00) | P varius AB587636

P. varius AF516575

P. varius AF516580

P. varius AF516579

P. varius AF516578

P. varius AF516577

P. mikawai AF516570

P. grammocephalus AB587626

aL P. pseudobetulinus AB587644

0.05

440 ... Xue & Zhou

The ITS tree also shows that the current concept of P. melanopus is not

monophyletic. Five ITS sequences of P melanopus formed two clades according

to the specimens’ origins. One clade comprised three European isolates, while

two isolates from Argentina formed the other clade. Moreover, P. melanopus

was described as a diverse species in pore and basidiospore size (Gilbertson &

Ryvarden 1987, Bernicchia 2005, Niemela 2005, Kriiger et al. 2006, Boulet 2007).

Therefore, more investigations are needed to clarify the exact circumscription

of P. melanopus.

Acknowledgements

We express our gratitude to Drs. Deepika Kumari (Directorate of Mushroom

Research, India), Bao-Kai Cui (Beijing Forest University, China), and Kozue Sotome

(Tottori University, Japan) who reviewed the manuscript prior to submission. The

research was financed by the National Natural Science Foundation of China (Project

No. 30910103907).

Literature cited

Anonymous. 1969. Flora of British fungi. Colour identification chart. Her Majesty’s Stationery

Office, London. 1 p.

Bernicchia A. 2005. Polyporaceae s.]. fungi Europei vol. 10. Edizioni Candusso, Alassio. 808 p.

Boulet B. 2007. Défauts et indices de la carie des arbres. 2e Edition. Les publications du Québec,

Québec. 317 p.

Cui BK, Yuan HS, Dai YC. 2008. Wood-rotting fungi in eastern China 1. Polypores from Wuyi

Mountains, Fujian Province. Sydowia 60: 25-40.

Dai YC. 1996. Changbai wood-rotting fungi 5. Study on Polyporus mongolicus and P. tubaeformis.

Annales Botanici Fennici 133: 153-163.

Dai YC. 2010. Hymenochaetaceae (Basidiomycota) in China. Fungal Diversity 45: 131-343.

http://dx.doi.org/10.1007/s13225-010-0066-9

Dai YC. 2011. A revised checklist of corticioid and hydnoid fungi in China for 2010. Mycoscience

52: 69-79. http://dx.doi.org/10.1007/s10267-010-0068-1

Dai YC. 2012a. Two new polypores from tropical China, and renaming two species of Polyporus

and Phellinus. Mycoscience 53: 40-44. http://dx.doi.org/10.1007/s10267-011-0135-2

Dai YC. 2012b. Polypore diversity in China with an annotated checklist of Chinese polypores.

Mycoscience 53: 49-80. http://dx.doi.org/10.1007/s10267-011-0134-3

Dai YC, Penttila R. 2006. Polypore diversity of Fenglin Nature Reserve, northeastern China.

Annales Botanici Fennici 43: 81-96.

Dai YC, Yuan HS. 2007. Type studies on polypores described by G. Y. Zheng and Z. S. Bi. from

southern China. Sydowia 59: 25-31.

Dai YC, Yuan HS. 2010. Type studies on polypores described by J. D. Zhao. Annales Botanici

Fennici 47: 113-117.

Dai YC, Harkénen M, Niemela T. 2003. Wood-inhabiting fungi in southern China 1. Polypores

from Hunan Province. Annales Botanici Fennici 40: 381-393.

Dai YC, Wei YL, Wang Z. 2004. Wood-inhabiting fungi in southern China 2. Polypores from

Sichuan Province. Annales Botanici Fennici 41: 319-329.

Dai YC, Cui BK, Yuan HS. 2007a. Notes on polypores from Gansu and Qinghai Province, Northwest

China. Cryptogamie Mycologie 28: 177-187.

Polyporus submelanopus sp. nov. (China) ... 441

Dai YC, Wei YL, Yuan HS, Huang MY, Penzina T. 2007b. Polypores from Altay and Tian Mts. in

Xinjiang, northwest China. Cryptogamie Mycologie 28: 269-279.

Dai YC, Yu CJ, Wang HC. 2007c. Polypores from eastern Xizang (Tibet), western China. Annales

Botanici Fennici 44: 135-145.

Dai YC, Cui BK, Huang MY. 2007d. Polypores from eastern Inner Mongolia, northeastern China.

Nova Hedwigia 84: 513-520. http://dx.doi.org/10.1127/0029-5035/2007/0084-0513

Dai YC, Yuan HS, Wang HC, Yang F, Wei YL. 2009. Polypores (Basidiomycota) from Qin Mts. in

Shaanxi Province, Central China. Annales Botanici Fennici 46: 54-61.

Gilbertson RL, Ryvarden L. 1987. North American polypores 2. Megasporoporia — Wrightoporia.

Fungiflora, Oslo. pp. 434-885.

Guindon S, Gascuel O. 2003. A simple, fast and accurate method to estimate large phylogenies by

maximum-likelihood. Systematic Biology 52: 696-704.

http://dx.doi.org/10.1080/10635150390235520

Kriiger D, Petersen RH, Hughes KW. 2006. Molecular phylogenies and mating study data in

Polyporus with special emphasis on group “Melanopus” (Basidiomycota). Mycological Progress

5: 185-206. http://dx.doi.org/10.1007/s11557-006-0512-y

Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F,

Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and

Clustal X version 2.0. Bioinformatics 23: 2947-2948.

http://dx.doi.org/10.1093/bioinformatics/btm404

Li J, Xiong HX, Dai YC. 2008. Polypores from Shennongjia Nature Reserve in Hubei Province,

Central China. Cryptogamie Mycologie 29: 267-277.

Niemela T. 2005. Polyporus, lignicolous fungi. Norrlinia 13: 1-320. [in Finnish, with English

summary]

Nujiez M, Ryvarden L. 1995. Polyporus (Basidiomycotina) and related genera. Synopsis Fungorum

10: 1-85.

Petersen JH. 1996. Farvekort. The Danish Mycological Society’s colour-chart. Foreningen til

Svampekundskabens Fremme, Greve. 6 p.

Posada D. 2008. jModelTest: Phylogenetic model averaging. Molecular Biology and Evolution 25:

1253-1256. http://dx.doi.org/10.1093/molbev/msn083

Ronquist F, Teslenko M, van der Mark P, Ayres D, Darling A, Hohna S, Larget B, Liu L, Suchard

MA, Huelsenbeck JP. 2012. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model

choice across a large model space. Systematic Biology 61: 539-542.

http://dx.doi.org/10.1093/sysbio/sys029

Sotome K, Hattori T, Kakishima M. 2007. Polyporus phyllostachydis sp. nov. with notes on other

rhizophilic species of Polyporus (Basidiomycota, Polyporaceae). Mycoscience 48: 42-46.

http://dx.doi.org/10.1007/s10267-006-0328-2

Sotome K, Hattori T, Ota Y. 2011. Taxonomic study on a threatened polypore, Polyporus

pseudobetulinus, and a morphologically similar species, P subvarius. Mycoscience 52: 319-326.

http://dx.doi.org/10.1007/s10267-011-0111-x

Wang B, Cui BK, Li HJ, Du P, Jia BS. 2011. Wood-rotting fungi in eastern China 5. Polypore

diversity in Jiangxi Province. Annales Botanici Fennici, 48: 237-246.

White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal

RNA genes for phylogenetics. 315-322 in: MA Innis et al. (eds). PCR protocols: a guide to

methods and applications. Academic Press, San Diego.

Yuan HS, Dai YC. 2008. Polypores from northern and central Yunnan Province, Southwestern

China. Sydowia 60: 147-159.

MY COTAXON

http://dx.doi.org/10.5248/122.443

Volume 122, pp. 443-447 October-December 2012

A new species of Clitopilus from southwestern China

WANG-Q!1u DENG, Tal-Hu1 Li, Ya-HENG SHEN

Guangdong Provincial Key Laboratory of Microbial Culture Collection and Application,

Guangdong Open Laboratory of Applied Microbiology & State Key Laboratory of Applied

Microbiology (Ministry—Guangdong Province Jointly Breeding Base), South China,

Guangdong Institute of Microbiology, Guangzhou 510070, China

“CORRESPONDENCE TO: mycolab@263.net

ABSTRACT — Clitopilus ravus is described and illustrated as a new species from southwestern

China. It is characterized by its tawny gray or grayish brown to brown tomentose pileus,

absence of pleuro- and cheilocystidia, subfusiform to amygdaliform basidiospores with

4-5 prominent longitudinal ridges, and cylindric or clavate terminal cells of the pileipellis

filled with brown non-encrusting intracellular pigment. Comparisons with similar taxa and

photographs and drawings of its macroscopical and microscopical characters are provided.

KEY worpDs — taxonomy, Entolomataceae, macrofungi

Introduction

The genus Clitopilus (Fr. ex Rabenh.) P. Kumm. traditionally encompasses

three sections: Clitopilus, Pleurotelloides, and Scyphoides. Section Clitopilus is

characterized by its medium-sized to rather large basidiomata, distinct and

persistent stipe, spores with mostly six reinforced longitudinal angles and

usually 10-14 um long (Singer 1986). Seven species have been reported in sect.

Clitopilus: C. prunulus (Scop.) P. Kumm., C. lignyotus Hongo, C. quisquiliaris

(P. Karst.) Noordel., C. paxilloides Noordel., C. griseobrunneus T.J. Baroni &

Halling, C. amygdaliformis Zhu L. Yang, and C. chrischonensis Musumeci et

al. (Singer 1946; Hongo 1954; Noordeloos 1982, 1993; Baroni & Halling 2000;

Yang 2007; Vizzini et al. 2011).

We describe and illustrate here a new species of sect. Clitopilus discovered

during re-examination of Clitopilus specimens collected from Yunnan

Province.

Materials & methods

Specimens were annotated and photographed in the field, and dried in an electric

drier. Color description was according to Kornerup & Wanscher (1978). We examined

444 ... Deng, Li & Shen

spores, basidia, and cystidia in 5% KOH or 1% Congo Red and the pileipellis in 5% KOH.

Basidiospore dimensions follow the notation (a—)b-c(-d), with at least 25 basidiospores

measured and with the range b-c representing 90% or more of the measured values

and the extreme values ‘a’ and ‘d’ given in parentheses. Abbreviations are L_ = average

length of all basidiospores + sample standard deviation, W., = average width of all

basidiospores + sample standard deviation, Q = individual basidiospore length/width

ratio, Q. = average Q of all basidiospores + sample standard deviation, and n = number

of spores measured per specimen.

Micrographs were taken using an Olympus BX51 trinocular phase contrast

microscope and a Philips FEI-XL30 scanning electron microscope. The dried studied

specimens are deposited in the Herbarium of Cryptogams, Kunming Institute of Botany,

Chinese Academy of Sciences (KUN, with HKAS numbers).

Taxonomy

Clitopilus ravus W.Q. Deng & T.H. Li, sp. nov. FIG. 1

MycoBank MB 800634

Differs from C. griseobrunneus by its much smaller basidiospores and non-encrusting

pigment in pileipellis.

Type: China, Yunnan Province, Jingdong County, Ailaoshan National Nature Reserve,

14 July 2008, Yanchun Li 1213 (Holotype, HKAS 56067).

ETyMOLOGy: ravus refers to the tawny gray or grayish brown color of pileus and stipe.

PiLEus 30-40 mm broad, convex at first, then applanate, tawny gray or grayish

brown to brown (6D3, 6D-E5); brown (6E5) overall under lens, tomentose;

margin incurved, not striate. LAMELLAE white but soon pale flesh-pink to pink

(7A1-2), decurrent, close to crowded; edges concolorous and even; lamellulae

numerous. STIPE paler than pileus to partially concolorous with pileus, orange

gray (6B2), brownish orange (6C3) to light brown (6D4), with white (6A1)

cottony mycelium at the base, 35-45 mm long, 4-6 mm thick at the apex, 7-12

mm thick at the base, tomentose, inconspicuously striate, central to slightly

eccentric, often slightly curved, cylindrical, usually broadening towards base.

CONTEXT white (6A1), unchanging when bruised or exposed to air.

BASIDIOSPORES 11-13(-14) x (5-)5.5-6.5(-7) um, (n = 25, L. = 12.02/+

/0.96, W_ = 6.06/+ 0.46, Q = (1.57—)1.83-2.33(-2.80), Q_ = 1.99 + 0.25), slightly

pinkish to nearly colorless and hyaline, slightly thick-walled, amygdaliform

or subfusiform with longitudinal ridges in profile and face views, angular

in polar view with 4-5 facets separated by obvious rounded ridges. BAsrD1A

(22-)27-35 x 10-13 um, clavate, hyaline, 4-spored; sterigmata 2.5-3.0 um

long. SUBHYMENIUM composed of hyphal elements 5-9 um in diam. LAMELLAR

TRAMA composed of cylindric, hyaline hyphae 2-6 um in diam. PLEUROCYSTIDIA

and CHEILOCYSTIDIA absent. PILEIPELLIS a trichoderm composed of repent,

cylindric or inflated, 5-11 tm wide hyphae; terminal cells cylindric or clavate,

Clitopilus ravus sp. nov. (China) ... 445

Fic. 1: Clitopilus ravus (holotype).

A. Basidiomata.

B. Basidiospores in LM (x1000). c. Basidiospores under SEM. p. Basidia. E. Pileipellis.

446 ... Deng, Li & Shen

15-38 x 5-11 um; brown, intracellular, non-encrusting pigments, some hyphae

have thickened walls. Clamp connections absent in all tissues.

ECOLOGY & DISTRIBUTION — Solitary or scattered on soil under broadleaf

trees.

COMMENTS — Clitopilus ravus is characterized by its tawny gray or grayish brown

to brown tomentose pileus, absence of pleuro- and cheilocystidia, subfusiform

to amygdaliform basidiospores with 4-5 prominent longitudinal ridges, and

pileipellis cylindric or clavate terminal pileipellis cells filled with brown non-

encrusting intracellular pigment. We place the new species in Clitopilus sect.

Clitopilus based on its well-developed stipe and large basidiospores with fewer

than 7 prominent longitudinal ridges (Singer 1986).

Basidiomes are easily distinguished from the white or pale grayish

basidiomata of C. prunulus, C. amygdaliformis and C. chrischonensis. With

C. lignyotus, C. quisquiliaris, C. paxilloides, and C. griseobrunneus, the new

species represents the fifth gray or brown member of sect. Clitopilus. Although

somewhat similar to C. ravus in color and stature, C. lignyotus is distinguished

by a clitocybe-like or (often) phylloporus-like appearance and slightly smaller

basidiospores (9.5-13 x 4.5-6.0 um) with 6 longitudinal ridges (Hongo 1954).

Clitopilus quisquiliaris differs distinctly in its reddish brown or fuscous brown

pileus and smaller basidiospores (8-9.5 x 4.0-5.0 um) (Noordeloos 1982;

Hansen & Knudsen 1992); C. paxilloides has a weakly hygrophanous gray-

brown pileus with numerous gray-brown spots, a strongly tapering stipe base,

and obviously encrusted hyphae in the pileipellis (Noordeloos 1993); and

C. griseobrunneus has much larger basidiospores (9.7-16.9 x 5.7-7.9 um) with

(5-) 6 (-7) longitudinal ridges and encrusted hyphae in the pileipellis (Baroni

& Halling 2000).

Acknowledgments

The authors are grateful to Prof. Zhu L. Yang (Kunming Institute of Botany of the

Chinese Academy of Sciences, KIB) and Dr. Genevieve M. Gates (University of Tasmania)

who reviewed the manuscript, and also to Dr. Yan-Chun Li (KIB) for providing the

photo of the fruiting body in this study. The research was supported by the National

Natural Science Foundation of China (Project Nos. 30970023, 31170026, 30499340 and

31070024), and the Foundation of Guangdong Academy of Sciences, China for 2008

Outstanding Young Science and Technology Talents.

Literature cited

Baroni TJ, Halling RE. 2000. Some Entolomataceae (Agaricales) from Costa Rica. Brittonia 52:

121-135. http://dx.doi.org/10.2307/2666502

Hansen L, Knudsen H. 1992. Nordic Macromycetes. Vol. 2. Polyporales, Boletales, Agaricales,

Russulales. Nordsvamp, Copenhagen.

Hongo T. 1954. Note on Japanese larger fungi (5). Journal of Japanese Botany 29(3): 87-92.

Clitopilus ravus sp. nov. (China) ... 447

Kornerup A, Wanscher JH. 1978. Methuen handbook of colour. Eyre Methuen: London.

Noordeloos ME. 1982. Studies in Entoloma 1-5. International Journal of Mycology and Lichenology

1(1): 49-60.

Noordeloos ME. 1993. Studies in Clitopilus (Basidiomycetes, Agaricales) in Europe. Persoonia 15:

241-248.

Singer R. 1946. The Boletineae of Florida with notes on extralimital species IV. The lamellate

families (Gomphidiaceae, Paxillaceae and Jugasporaceae). Farlowia 2: 427-567.

Singer R. 1986. The Agaricales in modern taxonomy. 4th ed. Koeltz Scientific Books: Koenigstein

(Germany).

Vizzini A, Musumeci E, Ercole E, Contu M. 2011. Clitopilus chrischonensis sp. nov. (Agaricales,

Entolomataceae), a striking new fungal species from Switzerland. Nova Hedwigia 92(3-4):

425-434. http://dx.doi.org/10.1127/0029-5035/2011/0092-0425

Yang ZL. 2007. Clitopilus amygdaliformis, a new species from tropical China. Mycotaxon 100:

241-246.

MY COTAXON

http://dx.doi.org/10.5248/122.449

Volume 122, pp. 449-460 October-December 2012

Arthrinium rasikravindrii sp. nov.

from Svalbard, Norway

SHIV M. SINGH’, LAL S. YADAV’, PARAS N. SINGH’, RAHUL HEPAT’,

RAHUL SHARMA? & SANJAY K. SINGH?*

"National Centre for Antarctic and Ocean Research, Vasco Da Gama, Goa, India

?National Facility for Culture Collection of Fungi, MACS’ Agharkar Research Institute,

G.G. Agarkar Road, Pune, India

CORRESPONDENCE TO *: singhsksingh@gmail.com

ABSTRACT — Arthrinium rasikravindrii sp. nov. was isolated from soil collected in the arctic

archipelago Svalbard, Norway. The new species, distinguished by morphological and in

vitro cultural characters, forms dark brown lenticular conidia with hyaline equatorial germ

slits together with balloon-shaped, anomalous conidia uncommon in the morphologically

similar A. phaeospermum. Additionally, internal transcribed spacer (ITS) rDNA sequence

analyses support this species as distinct within Arthrinium. Isolates previously identified as

A. phaeospermum from China and Japan are re-determined as A. rasikravindrii.

Kry worps — anamorphic fungi, Ny-Alesund, phylogeny, taxonomy

Introduction

The study of fungal diversity in soils from Svalbard, Norway (Elvebakk et

al. 1996, Aarnzes 2002, Kurek et al. 2007), has led to the discovery of novel

genera and species from this region (Pang et al. 2008, 2009). During research

of the soil mycobiota of this Arctic region, a previously unknown Arthrinium

was isolated from a soil sample. Arthrinium Kunze was established in 1817

with A. caricicola Kunze as the type species (Kunze 1817). The genus currently

comprises about 31 species worldwide (Kirk et al. 2008), of which 13 have been

reported from Svalbard (Aarnzes 2002). Most Arthrinium species produce dark,

non-septate, mostly lenticular conidia with a hyaline rim or germ slit. Since

Ellis (1965, 1971, 1976) extensively treated the genus, several species have

been added (Calvo & Guarro 1980, Larrondo & Calvo 1990, 1992). This paper

describes and illustrates another new Arthrinium species isolated from arctic

soil near Svalbard, Norway.

450 ... Singh & al.

Materials & methods

Sampling site

The soil sample was collected from Ny-Alesund (78°55’N 11°56’E) on the west

coast of Spitsbergen, the largest island in the Svalbard archipelago. Topographically,

Ny-Alesund includes east and west glaciers, terminal moraines, and glacial streams

and rivers flowing towards Kongsfjord. The sampling site was situated near an Austre

Broggerbeen glacier (78°55.082'N 11°51.527'E). Mean temperatures are -14°C in the

coldest month (February) and 5°C in the warmest month (July-August) (Nygaard

2009). The loose soil texture supports a tundra vegetation (Klimowicz & Uziak 1998).

Isolation, pure culture, and microscopic examination

The soil was sampled from the surface to 5 cm depth from the Ny-Alesund region

during the first (2007) Indian Arctic expedition. The samples were placed in sterile

ampoules (Hi-media) and stored at -20°C until studied. For the isolation of fungi, 1

gm of soil sample was taken and serially diluted up to 10’ (Waksman 1916). A soil

suspension (1 ml) was used as inoculum on four different culture media — Martin's

Rose Bengal medium (MRB), Malt Extract Agar (MEA), Corn Meal Agar (CMA), and

Potato Dextrose Agar (PDA). The plates were incubated at 15°C for 10 days. Colonies

showing different morphological features were purified and transferred onto PDA

slants for further study. Sporulating cultures were identified based on morphology

using standard literature (Ellis 1971, 1976, Carmichael et al. 1980, Domsch et al. 1980,

Larrondo & Calvo 1990, 1992). We recorded and photographed microscopic details from

specimens mounted in lactophenol-cotton blue and distilled water using an OLympus

CX-41 microscope. Fungal structures were measured with an ocular micrometer. A pure

culture is deposited in the National Fungal Culture Collection of India (NFCcI-wpcM

932), MACS’ Agharkar Research Institute, Pune, India.

Polymerase chain reaction (PCR) and sequencing

Total DNA was extracted from a culture grown on a PDA plate for two weeks at

15°C by the high salt DNA extraction method of Aljanbi & Martinez (1997) using Fast

Prep-24 tissue homogenizer (MP Biomedicals GmbH, Germany). ITS fragments were

amplified using primer pairs ITS4 and ITS5 (White et al. 1990). PCR was performed

in a 25 ul reaction using 2 ul template DNA (10-20 ng), 0.5 U Taq DNA polymerase

(Genei, Bangalore, India), 2.5 ul 10X Taq DNA polymerase buffer, 0.5 ul 200 uM of

each dNTP (Genei, Bangalore, India), 0.5 ul 10 pmol primer, H,O (Sterile Ultra Pure

Water, Sigma) qsp 25 ul. Amplification was performed on an Eppendorf Mastercycler

(Eppendorf, Hamburg, Germany) using the following parameters: 5 min step at 95°C,

followed by 30 cycles of 1 min at 95°C, 30s at 56°C, and 1 min at 72°C for ITS region

amplification, then a final 7 min extension step at 72°C. The PCR products were purified

with Axygen PCR cleanup kit (Axygen Scientific Inc, CA, USA) and sequenced using

the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA). The

cycle sequencing products were run on an ABI Avant 3100 automated DNA sequencer

(Applied Biosystems, USA).

Sequence alignment and phylogenetic analysis

Sequence alignment of internal transcribed spacer and 5.8S regions of Arthrinium

sp. (NECCI 2144) was performed using the Clustal W option of the software Molecular

Arthrinum rasikravindrii sp. nov. ... 451

TABLE 1. Percent ITS sequence similarity of Arthrinium rasikravindrii

with Genbank sequences from related Arthrinium species.

CULTURE GENBANK POSITIONS ; TOTAL SIM. W

SPECIES i # : # : withbase : ALIGNED : NFCCI2144

: : changes : SEQUENCE BP : (%)*

A. rasikravindrii i NECCI 2144 i 326454 ss i - i -

ei eeitn : 67 : 503 86.7

pence IMI 326877 AB220242 64 521 87.7

Gees & Calvo CBee 720 AB220252 65 522 87.5

OE ice IMI 326875 AB220243 62 521 88.0

See ae MAFF 236534 AB220270.1 34 347 90.2

A. serenense Larrondo

& Calvo CBS 498.90 AB220240 52 503 89.6

ero Te PARTY A, See Me OCT RA owe VI BO Wile hie gle es Lan el eee Me Anta Ore Bs cles ord,

(Speg.) MB. Ellis CBS 334.86 AB220257 52 503 89.6

sg eer ATCC 76288 AB220238 52 503 89.6

Nigrospora sphaerica : i i

* ITS1-5.8S-ITS2 sequence of NFCCI 2144 was subjected to pairwise alignment using Clustal W.

* Designated as Arthrinium phaeospermum in Genbank

452 ... Singh & al.

Evolutionary Genetics Analysis (MEGA) software v5.0. (Tamura et al. 2011). The

manually edited sequence of NFCcI 2144 was deposited in the NCBI nucleotide sequence

database (JF326454) and subjected to a NCBI BLAST search. The partial ITS sequences

were aligned using Clustal W together with homologous ITS sequences retrieved from

Genbank of the same and related species of Arthrinium (TABLE 1). Due to inconsistent

sequence lengths, portions of the ITS1 and ITS2 were excluded from the analysis. To

calculate the sequence divergence for ITS, the matrix was analyzed with the Neighbour

Joining method (Saitou & Nei 1987) using the Kimura-2 parameter model (Kimura

1980) and Maximum Parsimony method (Tamura et al. 2011). The bootstrap consensus

tree (Felsenstein 1985) was inferred from 1000 replicates, with all gaps and missing data

eliminated from the dataset (Complete Deletion option).

Taxonomy

Arthrinium rasikravindrii Shiv M. Singh, L.S. Yadav, P.N. Singh, Rahul Sharma &

S.K. Singh, sp. nov. FIGS 1, 21-P

MycoBank MB 800216

Differs from Arthrinium phaeospermum by its larger lenticular conidia and its production

of a second elongate type of conidia.

Type: Norway, Svalbard, Spitsbergen, NyAlesund, 78°55’N 11°56’ E, from soil, 27.07.2010,

leg. S.M.Singh, (Holotype, amu 9435 [dried colony on PDA]; ex-type culture, NFCCI

2144; GenBank JF326454).

Erymo.ocy: The specific epithet refers to Dr Rasik Ravindra, director of the

National Centre for Antarctic & Ocean Research and leader of the first Indian Arctic

Expedition.

Conidiophores arising from swollen basal cells, micro-semi-macronematous,

mononematous, straight or flexuous, unbranched, septate, smooth, thin-walled,

hyaline to sub-hyaline, 5-90 x 1—-1.5 um. Conidia arising acropleurogenously,

dimorphous i) lenticular, ovoid in face view, 10-15 x 6.0-10.5 um (n = 50);

ii) elongate to clavate conidia, 15-25 x 7.5—-10 um (n = 50), smooth, double-

walled, brown to pale olivaceous with prominent truncate base and equatorial

germ slit.

Optimum temperature for growth 15-18°C for the arctic holotype (but 25°C

for isolates from China and Japan). Colonies on PDA, medium to fast growing,

45-70 mm in 7 days at 18°C (arctic isolate) or 25°C with white, floccose aerial

mycelium, reverse uncolored, yellow bright to buff (Rayner 1970). Colony of

MAFF410785 slow growing 17.0 mm in 7 days at 25°C, raised dense cottony

unusually different from other strains. Colony pattern differing among all

four strains tested. Individual strains on OA, PCA, and MEA with similar

morphology as on PDA. Sporulation observed after 7 days to 45 days on PCA,

as dark pinhead spots in the aerial mycelium near the periphery and later the

centre of the colony.

TELEOMORPH: not observed.

DISTRIBUTION—China, Japan, Norway.

Arthrinum rasikravindrii sp. nov. ... 453

—

16kVU XS; 666 Sim 8666 16 36 SEI faku x1:5

Fic. 1. Arthrinium rasikravindrii (NFccI 2144"). a: 7-day old colony on PDA. B-c: Conidia

attached to conidiophores. p: Enlarged anomalous and lenticular conidia. E-F: Conidium and

conidia under SEM.

ADDITIONAL MATERIAL EXAMINED—JAPAN: Fukushima, isolated from leaf of Coffea

arabica, 'T. Sato (MAFEF305708); Chiba, isolated from wood tissue of Pinus thunbergii,

T. Kobayasi (MAFF410785); T. Hasegawa (NBRC6575, I1FO6575).

454 ... Singh & al.

ADDITIONAL SEQUENCED ISOLATES—CHINA: Dalian, isolated from submerged wood

collected from marine coast (DLEN2008007); isolated as endophytes from Oryza

granulata (L10-2-2, L3-4-2). JAPAN: Hiroshima, isolated from stubble of Triticum

aestivum, T. Aoki (MAFF236535, an authentic A. phaeospermum strain).

Discussion

Based on morphological characters and ITS sequence similarity (NCBI

BLAST search), the Arctic isolate was determined to belong to Arthrinium.

Most Arthrinium species produce lenticular conidia. As the new species

abundantly produces conidia that are lenticular but also elongate, it differs from

any previously described Arthrinium species, which rarely or never produce

elongate conidia.

The nrcc12144 ITS region comprised a 534 bp nucleotide sequence with 222

ITS1 bp, 150 5.88 bp, and 160 ITS2 bp. A BLASTn search against the Genbank

DNA database with this ITS sequence showed maximum similarity (99%)

with ambiguous A. phaeospermum strains (HM008624.1 query coverage 93%;

HM008625.1 query coverage 94%), 97% similarity with A. aureum (AB220246.1

query coverage 88%; AB220251.1 query coverage 87%), and only 90% similarity

with the isotype strain from A. phaeospermum (AB220283.1 query coverage

88%).

A previous study by Khan et al. (2009) of A. phaeospermum involving 16

Genbank sequences showed considerable variability among the deposited

sequences. Our search of Genbank for A. phaeospermum ITS sequences as

revealed 25 accessions. A Neighbor Joining tree constructed using these 24

sequences + NFCCI2144 revealed three groups. Our Arctic isolate clustered

with six A. phaeospermum sequences including 1F06575, MAFF410784,

and MAFF305708, which are not monophyletic with the ex-isotype strain of

A. phaeospermum cxBs142.55. Examination of strain 1F06575 revealed the

anomalous conidia characteristic of A. rasikravindrii and measuring 9.5-22.5

um x (6.5-)8.5-14.5(-10) um. Morphological examination of Marr410785

and MAFF305708 (Fic. 21-L, 0, P) belonging to clade Ia (Fic. 3) and clade IIb

(Fic. 4) also showed conidial morphology typical of A. rasikravindrii. Their

ITS sequences showed a 99.4% and 99.8 % similarity, respectively, to the

A. rasikravindrii ex-type strain.

Phylogenetic analysis of 10 related species of Arthrinium using neighbor-

joining method (Fic. 3) placed Arthrinium spp. into three clades: clade I contains

two subclades — Ia with A. rasikravindrii and Ib with two A. aureum strains —

Fic. 2. A-H. Arthrinium phaeospermum (MAFF 236535). A-D, F-H: variously shaped conidia—

typical lenticular, globose, and narrow elongated. £: conidiophores. 1-p. Arthrinium rasikravindrii.

I-L (MAFF 305708): lenticular, globose, and anomalous conidia. M-N (IFO 6575): lenticular, globose,

and anomalous conidia. o0-P (MAFF 410784): globose and anomalous conidia.

455

Arthrinum rasikravindrii sp. nov. ...

456 ... Singh & al.

AB220273.1 Arthrinium rasikravindrii MAFF 410785

HM008625.1 Arthrinium rasikravindrii L10-2-2

HM008624.1 Arthrinium rasikravindrii L3-4-2

AB220272.1 Arthrinium rasikravindrii MAFF 305708

JF326454 Arthrinium rasikravindrii NFCCI2144 T

AB220266.1 Arthrinium rasikravindrii IFO 6575

GU266274.1 Arthrinium rasikravindrii DLEN2008007

AM220246.1 Arthrinium aureum IMI252326

82! AB220251.1 Arthrinium aureum CBS 244.86

AB220252.1 Arthrinium marii CBS 497.90

AB220243.1 Arthrinium mediterranei IMI 326875

AB220242.1 Arthrinium hispanicum IMI 326877

AB220258.1 Apiospora montagnei CBS 301.49

ag | AJ279447.1| Arthrinium phaeospermum CBS 463.83 II

AB220257.1 Arthrinium sacchari CBS 334.86

qq |, AB220256.1 Arthrinium phaeospermum CBS 142.55 isotype |>

AB220240.1 Arthrinium serenense CBS 498.90

AB220238.1 Arthrinium saccharicola ATCC 76288

AB220241.1 Arthrinium euphorbiae IMI 285638b

GU566268.1 Arthrinium arundinis G41

AB220253.1 Arthrinium puccinioides CBS 549.86

GQ919077 Nigrospora sphaerica 9038

0.02

Fic. 3. Neighbor joining tree (1000 bootstrap replications) showing phylogenetic relationship of

Arthrinium rasikravindrii NEFcci 21447 and 22 ITS sequences deposited in Genbank of authentic

strains of 13 Arthrinium species. The tree scale (0.02) represents evolutionary distances in units of

base substitutions per site as computed by Kimura-2 parameter method. Bootstrap values more

than 50 are shown. Gaps are treated as missing data and eliminated from dataset during tree

construction. Nigrospora sphaerica (GQ919077.1) was taken as outgroup.

clade II includes the most species (8), and clade III comprises A. euphorbiae and

an Arthrinium strain wrongly identified as A. arundinis (Apiospora montagnei)

that is non-monophyletic with the authentic strain of Apiospora montagnei CBS

301.49 (clade Ila). Strain 106575 and five others are considered to represent

A. rasikravindrii rather than A. phaeospermum as listed in Genbank because

they cluster with the holotype isolate and are distant from the isotype strain

cBS142.55 of A. phaeospermum (TABLE 1).

Acombinedanalysis of Arthrinium spp. (Fic.4)includingallA. phaeospermum

accessions was consistent with Fic. 3 except that A. phaeospermum strains were

distributed in three major clusters suggesting fungal sequences incorrectly

| nano

0.02

Arthrinum rasikravindrii sp. nov. ... 457

AJ279456.1| Arthrinium phaeospemmum A3

ba AJ279447.1| Arthrinium phaeospermum CBS 463.83

AB220257.1 Arthrinium sacchari CBS 334.86

HQ914944.1| Arthrinium phaeospemum OUCMBIII091005

AB220238.1 Arthrinium saccharicola ATCC 76288

AB220283.1| Arthrinium phaeospermum MUCL 8362

AB220271.1| Arthrinium phaeospermum MAFF 236535

AB220256.1| Arthrinium phaeospermum CBS 142.55

AB220267.1| Arthrinium phaeospermum IFO 31950

HQ914942.1| Arthrinium phaeospemum OUCMBI101209

AB220240.1 Arthrinium serenense CBS 498.90 T I

AB220270.1| Arthrinium phaeospermum MAFF 236534

$i HM222950.1| Arthrinium phaeospermum A218

AB220261.1| Arthrinium phaeospermum DSM 62039

FJ478101.1| Arthrinium phaeospermum XSD08044

AB220269.1| Arthrinium phaeospermum MAFF 235494 | b

EU326184.1| Arthrinium phaeospermum XSD-91

¥ HM222956.1| Arthrinium phaeospermum A229

EU326200.1| Arthrinium phaeospermum XSD-132

907 AM220246.1 Arthrinium aureum IMI 252326

AB220251.1 Arthrinium aureum CBS 244.86 T

AM220272.1 Arthrinium rasikravindrii MAFF 305708

98) |. JF326454 Arthrinium rasikravindrii NFCCI 2144 Il

HM008625.1 Arthrinium rasikravindrii L10-2-2

80 | 4B220266.1 Arthrinium rasikravindrii IFO6575

GU266274.1 Arthrinium rasikravindrii DLEN2008007

AB220273.1 Arthrinium rasikravindrii MAFF 410785

HM008624.1 Arthrinium rasikravindrii L3-4-2

AB220258.1 Apiospora montagnei CBS 301.49 T

DQ865110 Arthrinium phaeospermum 63/2.4

34] AB220252.1 Arthrinium mari CBS 497.90 T

6 FJ462766.1| Arthrinium phaeospermum 157 Il

AB220243.1 Arthrinium mediterranei IM! 326875

AB220242.1 Arthrinium hispanicum IMI 326877

AB220241.1 Arthrinium euphorbiae IMI 285638b | IV

GU566268.1 Arthrinium arundinis G41 | V

AB220253.1 Arthrinium puccinioides CBS 549.86

GQ919077 Nigrospora sphaerica 9038

Fic. 4. Neighbor joining phylogenetic tree (1000 bootstrap replications) constructed using ITS

sequences of NFCCI 2144" and 24 accessions deposited in Genbank as Arthrinium phaeospermum

plus accessions of 13 Arthrinium spp. ‘The tree scale (0.02) represents evolutionary distances in

units of base substitutions per site as computed by Kimura-2 parameter method. Bootstrap values

more than 50 are shown. Gaps are treated as missing data and eliminated from dataset during tree

construction.

assigned to A. phaeospermum. Two strains designated as A. phaeospermum

belonging to clade III in Fic 4 may also have been misidentified because they

are not monophyletic with the A. phaeospermum ex-isotype culture cBs142.55

but group instead with A. hispanicum, A. marii, and A. mediterranei. Also three

‘A. phaeospermum in Fic 4 clade Ic represent an undescribed species.

458 ... Singh & al.

Arthrinium rasikravindrii differs morphologically from A. phaeospermum

in having larger conidia and producing a second type of conidia, also seen

in an unidentified species of Arthrinium by Adelantado et al. (2010) and

the Arthrinium state of Apiospora montagnei by Minter (1985). Additionally

A. phaeospermum forms narrowly elongated pale brown conidia (Fic. 24-D,

F-H) not seen in any of the examined A. rasikravindrii strains (Fics 1,

21-p). Although A. phaeospermum and the Arthrinium state of Apiospora

montagnei form anomalous conidia like A. rasikravindrii, these occur only

rarely. Genetically, A. rasikravindrii differs in 51 positions (10.2%) from

A. phaeospermum cBs142.55 out of the 503 nucleotides in the ITS region.

Arthrinium rasikravindrii differs from A. aureum having conidia 14-30 x

10-15 um, and these species differ in the ITS region at 12 nucleotide positions

(2.4%). All other species are more than 10% distant from A. rasikravindrii

in the ITS region. None of the known Arthrinium species of form elongate

truncate conidia (referred to as anomalous conidia by Adelantado et al. 2010)

in abundance except A. rasikravindrii (Fic. 1B-D) and the Arthrinium state of

Apiospora montagnei that is genetically (>10%) distant from A. rasikravindrii

and A. phaeospermum.

Acknowledgments

We are indebted to Dr. Amy Rossman (USDA-ARS, Beltsville, USA) and Dr.

Rafael F. Castafieda Ruiz (Instituto de Investigaciones Fundamentales en Agricultura

Tropical ‘Alejandro de Humboldt (INIFAT), Santiago de Las Vegas, C. Habana, Cuba)

for reviewing the manuscript. We are grateful to Curators of NITE Biological Resource

Centre (NBRC, Chiba, Japan) and Genetic Resource Centre (National Institute of

Agrobiological Sciences (NIAS), Tsukuba, Japan) for kindly providing fungal cultures

for study. We are highly grateful to Dr. Rasik Ravindra (Director, National Centre for

Antarctic & Ocean Research, Goa (contribution no. 32/2012), and Director, MACS’

Agharkar Research Institute, Pune, India) for encouragement and facilities. The authors

are also thankful to Department of Science and Technology (DST), Govt. of India, New

Delhi) for providing financial support for setting up a National Facility for Culture

Collection of Fungi (No. SP/SO/PS-55/2005) at MACS’ARI.

Literature cited

Aarnes JO. 2002. Katalog over makro- og mikrosopp angitt for Norge og Svalbard. Synopsis

Fungorum 16. 412 p.

Adelantado C, Arosemena EL, Calvo MA. 2010. Electronic microscopy of the genus Arthrinium,

A study model for the knowledge of dematiaceous fungi. 116-127, in: A Mendez- Vilas, J Diaz

(eds.) Microscopy, Science Technology, Applications and Education Vol.1, Formatex Research

Centre, Badajoz, Spain.

Aljanabi SM, Martinez I. 1997. Universal and rapid salt extraction of high quality genomic DNA for

PCR based techniques. Nucl. Acids Res. 25: 4492-4693.

http://dx.doi.org/10.1093/nar25.22.4692

Arthrinum rasikravindrii sp. nov. ... 459

Carmichael JW, Kendrick WB, Conners IL, Sigler L. 1980. Genera of hyphomycetes. The University

of Alberta Press, Canada. 386 p.

Calvo MA, Guarro J. 1980. Arthrinium aureum sp. nov. from Spain. Transactions of British

Mycological Society 75: 156-157.

Domsch KH, Gams W, Anderson TH. 1980. Compendium of soil fungi. Academic Press, London.

Elvebakk A, Gjaerum HB, Sivertsen S. 1996. Myxomycota, Oomycota, Chytridiomycota, Zygomycota,

Ascomycota, Deuteromycota, Basidiomycota, Uredinales and Ustilaginales. 207-259, in: A

Elvebakk, P Prestrud (eds). A catalogue of Svalbard plants, fungi, algae and cyanobacteria. Part

4. Fungi II. Norsk Polarinstitutt Skrifter 198, Oslo, Norway.

Ellis MB. 1965. Dematiaceous hyphomycetes. IV. Mycol. Pap.103: 1-46.

Ellis MB. 1971. Dematiaceous hyphomycetes. CAB International, Kew, England.

Ellis MB. 1976. More dematiaceous hyphomycetes. CAB International, Kew, England.

Felsenstein J. 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution

39: 783-791. http://dx.doi.org/10.2307/2408678

Khan SA, Hamayun M, Kin H, Yoon H, Seo J, Choo Y, Lee I, Kim S, Rhee I, Kim J. 2009. A new

strain of Arthrinium phaeospermum isolated from Carex kobomugi Ohwi is capable of gibberellin

production. Biotechnol. Lett. 31: 283-287. http://dx.doi.org/10.1007/s10529-008-9862-7

Kimura M. 1980. A simple method for estimating evolutionary rate of base substitutions through

comparative studies of nucleotide sequences. Journal of Molecular Evolution 16: 111-120.

http://dx.doi.org/10.1007/BF01731581

Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Ainsworth and Bisby’s dictionary of the fungi,

10" ed. CABI Publishing, Wallingford.

Klimowicz Z, Uziak S. 1988. Soil-forming processes and soil properties in Calypsostranda,

Spitsbergen. Polish Polar Research 9: 61-71.

Kunze G. 1817. Zehn neue Pilzgattungen. Mykologische Hefte 1: 1-18.

Kurek E, Kornijjozwicz-Kowalska T, Sjomka A, Melke J. 2007. Characteristics of soil filamentous

fungi communities isolated from various micro relief forms in the high Arctic tundra (Bellsund

region, Spitsbergen). Polish Polar Research 28: 57-73.

Larrondo JV, Calvo MA. 1990. Two new species of Arthrinium from Spain. Mycologia 82(3):

396-398. http://dx.doi.org/10.2307/3759915

Larrondo JV, Calvo MA. 1992. New contributions to the study of the genus Arthrinium. Mycologia

84(3): 475-478. http://dx.doi.org/10.2307/3760203.

Minter DW. 1985. A re-appraisal of the relationships between Arthrinium and other hyphomycetes.

Proceedings of Indian Academy of Sciences (Plant Sci.) 94(2-3): 281-308.

Nygaard E.J. 2009. Ny-Alesund, International Arctic Research and Monitoring Station at 79°N.

Ny-Alesund: Kings Bay AS.

Pang KL, Chiang MWL, Vrijmoed LLP. 2008. Havispora longyearbyenensis gen. et sp. nov. : an

arctic marine fungus from Svalbard, Norway. Mycologia 100: 291-295.

http://dx.doi.org/10.3852/mycologia.100.2.291

Pang KL, Chiang MWL, Vrijmoed LLP. 2009. Remispora spitsbergenensis sp. nov., a marine

lignicolous ascomycete from Svalbard, Norway. Mycologia 101: 531-534.

http://dx.doi.org/10.3852/08-003

Rayner RW. 1970. A mycological colour chart. CMI, Kew, Surrey, UK.

Saitou N, Nei M. 1987. The neighbor-joining method: A new method for reconstructing

phylogenetic trees. Molecular Biology and Evolution 4:406-425.

460 ... Singh & al.

Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. MEGAS5: Molecular

evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum

parsimony methods. Molecular Biology and Evolution 28: 2731-2739.

http://dx.doi.org/10.1093/molbev/msr121

Waksman SA. 1916. Do fungi live and produce mycelium in the soil? Science, n.s. 44: 320-322.

http://dx.doi.org/10.1126/science.44.1131.320

White TJ, Bruns T, Lee S, Taylor JW. 1990. Amplification and direct sequencing of fungal ribosomal

RNA genes for phylogenetics. 315-322, in MA Innis et al. (eds.) PCR protocols: a guide to

methods and applications. Academic Press, New York.

MY COTAXON

http://dx.doi.org/10.5248/122.461

Volume 122, pp. 461-466 October-December 2012

New records of Ochrolechia and Placopsis

from the Hengduan Mountains, China

TONG-LI GAO & QIANG REN*

College of Life Science, Shandong Normal University, Jinan, 250014, China

*CORRESPONDENCE TO: rendagiang@hotmail.com

ABSTRACT—Based on specimens collected in the Hengduan Mountains, Ochrolechia

laevigata is recorded as new to Asia, O. africana as new to China, and Placopsis gelida as new

to mainland China.

Key worps — Ochrolechiaceae, Trapeliaceae, taxonomy, Yunnan

Introduction

Ochrolechia A. Massal. (Ochrolechiaceae, Pertusariales, Ascomycota), a

widespread genus of crustose lichens, comprises about 60 species worldwide

(Verseghy 1962; Howard 1970; Brodo 1987, 1991; Lumbsch et al. 2003; Kirk

et al. 2008; Kukwa 2009, 2011). In China, 25 species have been reported (Wei

1991, Jia & Zhao 2003, Jia et al. 2008), of which 18 are known from Southwest

China. During our study of lichens collected from the Hengduan Mountains,

we recorded O. africana for the first time from China and O. laevigata for

the first time from Asia. We also collected in the same area Placopsis gelida,

reported here as new to mainland China.

Materials & methods

The specimens studied are preserved in SDNU (Lichen Section of Botanical

Herbarium, Shandong Normal University). The morphological and anatomical

characters of the specimens were examined under a stereomicroscope (Olympus

SZ) and a polarizing microscope (Olympus CX21). The lichen substances were

identified using the standardized thin layer chromatography techniques (TLC)

with C system (Orange et al. 2010) and mercury cadmium telluride [MCT]

crystal analysis. Photographs were taken of the morphology with an Olympus

SZX16 stereomicroscope and of the anatomy with an Olympus BX61 compound

microscope with DP72.

462 ... Gao & Ren

New records

Ochrolechia africana Vain., Ann. Univ. Fenn. Aboénsis, ser. A, 2(3): 3.1926. Fic. 1

MorPHOoLoGy — THALLUS crustose, yellowish grey to grey, thin to thick

and verruculose to verrucose; ISIDIA AND SOREDIA absent; APOTHECIA sessile,

numerous, 1.0-1.8 mm in diam.; Disk light yellowish pink to light orange, with

white and scabrose pruina; THALLINE MARGIN usually concolorous with the

thallus, margins thick, dull, smooth, often prominent; EPITHECIUM pale brown;

HYMENIUM 220-330 um high; HyPOTHECIUM 35-40 um high; EXCIPULUM

PROPRIUM 15-25 um; AMPHITHECIUM with a thick, well-developed medulla,

sometimes with small crystals, and thin cortex (30 um thick); ALGAL LAYER

virtually continuous below hymenium or sometimes sparse; Asci 8-spored;

ASCOSPORES simple, ellipsoid, 55-62.5 x 30-32.5 um; PYCNIDIA absent.

Spot TEsTs — Thallus cortex K-, C-, KC-; medulla K-, C+ red, KC+ red;

apothecial disk K+ yellow, C+ red, KC+ red; apothecial margin cortex K-, C-,

KC-; apothecial margin medulla C+ red; thallus UV-.

SECONDARY METABOLITES — Gyrophoric acid with traces of lecanoric and

4-O-methylhiascic acids.

DISTRIBUTION & HABITAT — Ochrolechia africana is a pantropical species,

reported from southeastern coastal plain, tropical and subtropical areas in

Figure 1. Ochrolechia africana [Z.J. Ren 20113910]. A. Thallus. B. Apothecia. C. Apothecial section.

D. Crystals in apothecial section. Scale bars: A = 1 mm; B = 0.3 mm; C, D = 100 um.

Ochrolechia & Placopsis spp. new to China ... 463

North and South America, Asia, Australia, and southern Africa (Awasthi &

Tewari 1987, Brodo 1991, Aptroot & Feijen 2002, Roemer et al. 2004). The

species grows on wood and the bark of deciduous trees.

SPECIMEN EXAMINED — CHINA. YUNNAN. LYIANG CouNTY, Mt. Laojun, alt. 2800 m,

on bark, 5 Nov. 2009, Z.J. Ren 20113910 (SDNU).

ComMENTs — Ochrolechia africana is characterized by small, pruinose

apothecia with smooth apothecial margins, a C+ red medulla due to the

production of hiascic acids, and a C- negative amphithecial cortex. The species

may be confused with O. mexicana, which can be distinguished by a C+ red

apothecial cortex, a usually more pruinose disk, and the absence of an excipular

ring around the disk (Brodo 1991).

Ochrolechia laevigata (Rasainen) Verseghy ex Kukwa, Lichen Genus Ochrolechia in

Europe: 132. 2011. Fic. 2

MorPHOLOGY — THALLUS crustose, yellow to pale yellow, shiny, very thin,

continuous, thin to moderately thick, not verrucose; APOTHECIA circular,

shallow saucer-shaped, usually regular in outline, 1.0-2.4 mm in diam., sessile,

light orange, epruinose; THALLINE MARGIN 0.2-0.6 mm thick, entire, smooth,

always concolorous with the thallus; EpIrHEcriuM faintly brownish; HYMENIUM

300-340 um high; HyPoTHECIUM about 90 um high, gray; AMPHITHECIUM

medulla lax, alga layer almost absent, or sometimes only in upper lateral

margins not below hypothecium; cortex 45 um thick laterally, expanding to

100 um at base; EXCIPULUM PROPRIUM distinct below hypothecium, 50-60 um

thick; Asc1 6-8 spored; ascospores simple, ellipsoid, 70-75 x 32.5-40 um;

PYCNIDIA absent.

Spot TESTS — Thallus cortex K+ yellow, C+ red, KC+ red; medulla K-, C+

red, KC+ red; apothecial disk K-, C+ red, KC+ red; apothecial margin cortex

K+ yellow, C+ red, KC+ red; margin medulla C+ faintly red.

SECONDARY METABOLITES — Gyrophoric acid with a trace of lecanoric

acid.

DISTRIBUTION & HABITAT — Ochrolechia laevigata, which has been

previously reported only from the west coast of North America (Brodo 1991,

Brodo et al. 2003), grows on deciduous trees.

SPECIMENS EXAMINED — CHINA. YUNNAN. LIJIANG COUNTY, Mt. Laojun, alt. 4000 m,

on bark, 5 Nov. 2009, Q. Tian 20100498, 20100502 (SDNU).

ComMENTS —Ochrolechia laevigata, which is characterized by a thin thallus,

apothecial margins almost without an algal layer, and a distinct excipulum

proprium, resembles O. oregonensis and O. subpallescens morphologically, but

O. oregonensis has a thick, verruculose to verrucose thallus while O. subpallescens

has a continuous algal layer under the hymenium (Brodo 1991). Although our

Chinese specimen does not contain olivetoric and 4-O-demethylmicrophyllinic

464 ... Gao & Ren

FiGuRE 2. Ochrolechia laevigata [Q. Tian 20100498]. A. Thallus. B. Crystals in thallus section.

C. Algal layer section. D. Excipulum proprium below hypothecium. Scale bars: A = 2 mm; B = 50

um; C, D = 100 um.

acids, it agrees morphologically with the description given by Brodo (1991).

The chemical variation of the species may be greater than previously reported

and should be studied further.

Placopsis gelida (L.) Linds., Trans. Linn. Soc. London 25: 536. 1866. Fic. 3

MorpHo.Locy — THALLUS dull grey, cream, pinkish or pale brown, forming

rosettes; LARGE CENTRAL with cracked to rimose-areolate part, with radiating

marginal lobes, 0.4-1.3 mm wide; suRFACE with pinkish to grey-brown,

epruinose, CEPHALODIA deeply plicate, 0.4-4 mm in diam.; sORALIA farinose

green-grey to grayish, generally delimited by a sharply defined and slightly

raised margin; APOTHECIA 0.7-1.8 mm in diam., sessile, pinkish to yellow-

brown, often with whitish pruinose; ascr 8-spored, cylindrical, thin walled;

ASCOSPORES colourless, simple, ellipsoid, 15-17.5 x 8-10 um.

Spot TESTs — Thallus cortex K-, C+ red, KC+ red; medulla K-, C+ red,

KC+ red; apothecial disk K-, C+ red, KC+ red; apothecial margin cortex K-,

C+ red, KC+ red.

SECONDARY METABOLITES — Contains only gyrophoric acid.

DISTRIBUTION & HABITAT — Placopsis gelida is a widespread, saxicolous,

oceanic to arctic species, reported from both the northern and southern

Ochrolechia & Placopsis spp. new to China ... 465

FicureE 3. Placopsis gelida [Z.T. Zhao 20127934]. A. Thallus. B. Apothecial section. C. Asci and

ascospores. Scale bars: A = 2 mm; B =50 um; C = 10 um.

hemispheres (Galloway 2007, Smith et al. 2009). It has been previously reported

from Taiwan.

SPECIMEN EXAMINED —CHINA. YUNNAN. DALI county, Mt. Cang, alt. 3100 m, on

bark, 22 Nov. 2009, Z.T. Zhao 20127934 (SDNU).

ComMENTS —Placopsis gelida is characterized by the matte upper surface, pale

eroded soralia, deeply lobed cephalodia, and gyrophoric acid as the only major

substance. The species is similar to P lambii, which can be separated by its shiny

surface, non-lobate cephalodia, and soralia that are usually blackish, sometimes

capitate, and greenish (Galloway 2007).

Acknowledgements

This present study was supported by the National Natural Science Foundation of

China (31100011), The authors thank Dr. Martin Kukwa (Gdansk University) and

Prof. Shou-Yu Guo (Key Laboratory of Systematic Mycology & Lichenology, Institute

of Microbiology, Chinese Academy of Sciences, Beijing, China) for presubmission

reviews.

Literature cited

Aptroot A, Feijen FJ. 2002: Annotated checklist of the lichens and lichenicolous fungi of Bhutan.

Fungal Diversity 11: 21-48.

Awasthi DD, Tewari R. 1987. Lichen genus Ochrolechia from Indian subcontinent. Kavaka 15(1-2):

2a Dit.

Brodo IM. 1987. Studies of the genus Ochrolechia. 1. A new classification for Pertusaria subplicans

and P. rhodoleuca. Canadian Journal of Botany 66: 1264-1269.

http://dx.doi.org/10.1139/b88-181

Brodo IM. 1991. Studies of the genus Ochrolechia. 2. Corticolous species of North America.

Canadian Journal of Botany 69: 733-772. http://dx.doi.org/10.1139/b91-099

Brodo IM, Sharnoff SD, Sharnoff S. 2003. Lichens of North America. New Haven and London, Yale

University Press.

Galloway DJ. 2007. Flora of New Zealand. Lichens. Revised second edition including lichen-

forming and lichenicolous fungi. Lincoln: Manaaki Whenua Press.

Gilbert OL, Purvis OW. 2009. Placopsis (Nyl.) Linds. (1867). 710-711, in: CW Smith et al. (eds).

The lichens of Great Britain and Ireland. London, British Lichen Society.

466 ... Gao & Ren

Howard GE. 1970. The lichen genus Ochrolechia in North America in north of Mexico. The

Bryologist 73: 93-130. http://dx.doi.org/10.2307/3241590

Jia ZF, Zhao ZT. 2003. A preliminary study of the lichen genus Ochrolechia in China. Mycosystema

22(1): 30-34.

Jia ZF, Ren Q, Zhao ZT. 2008. Ochrolechia pallentiisidiata, a new species from China. Mycotaxon

106: 233-236.

Kirk PM, Cannon PF, Minter DW, Stalpers JA. 2008. Dictionary of the fungi. 10th Edition. Egham,

CABI Bioscience, CAB International.

Kukwa M. 2009. The lichen genus Ochrolechia in Poland III with a key and notes on some taxa.

Herzogia 22: 43-66.

Kukwa M. 2011. The lichen genus Ochrolechia in Europe. Gdansk: Fundacja Rozwoju Uniwersytetu

Gdanskiego.

Lumbsch HT, Messuti MI, Nash TH IIL. 2003. Ochrolechia splendens (Pertusariaceae), a new species

from southwestern North America. Lichenologist 35(5-6): 387-391.

http://dx.doi.org/10.1016/S0024-2829(03)00057-4

Roemer J, Nash III TH, Lumbsch HT, Messuti MI. 2004. Ochrolechia. 381-387, in TH Nash III et

al. (eds). Lichen Flora of the Greater Sonoran Desert Region, Vol. 2. Tempe, Lichens Unlimited,

Arizona State University.

Orange A, James PW, White FJ. 2010. Microchemical methods for the identification of lichens. 2nd

edition. London: British Lichen Society.

Verseghy K. 1962. Die Gattung Ochrolechia. Beihefte zur Nova Hedwigia 1: 1-146.

Wei JC. 1991. An enumeration of lichens in China. Beijing: International Academic Publishers.

MY COTAXON

http://dx.doi.org/10.5248/122.467

Volume 122, pp. 467-482 October-December 2012

Nomenclatural notes on the lichen genera

Leucodecton and Myriotrema (Graphidaceae) in India

SANTOSH JOSHI’, DALIP K. UPRETI** & BIJU HARIDAS?

'Lichenology Laboratory, CSIR-National Botanical Research Institute

Rana Pratap Marg, Lucknow - 226 001, India

?Microfungi & Lichens Unit, Tropical Botanical Garden and Research Institute Palode,

Thiruvananthapuram -695562, India

*CORRESPONDENCE TO: upretidk@rediffmail.com

ABSTRACT —Nine species of Leucodecton and nine species of Myriotrema are recorded

for India. The recently resurrected Leucodecton accommodates species earlier placed in

Leptotrema, Myriotrema, or Thelotrema, which were segregated based primarily on medullary

chemistry such as stictic and norstictic acids, although Myriotrema retains species with a

prosoplectenchymatous cortex and psoromic or protocetraric acid chemosyndromes.

This contribution includes new synonyms, changes in generic placement, new species

distributions, and new records. Leucodecton compunctum and L. subcompunctum are new

records for India.

Key worps — thelotremoid, lepadinoid, taxonomy, delimitation, tropical, Western Ghats

Introduction

The evolving taxonomic and phylogenetic studies on crustose lichens

have resolved numerous worldwide nomenclature fluxes and revealed many

traditionally classified families as poly- or paraphyletic. This has improved the

generic delimitation of Graphidaceae, the largest and core tropical microlichen

family (Hale 1974, 1978, 1980, 1981; Frisch 2006; Staiger 2002; Rivas Plata

et al. 2012). Rivas Plata et al. (2010) revised ca. 16 genera of thelotremoid

Graphidaceae and provided a comprehensive account of more than 260 species

excluding taxa of the Ocellularia-Myriotrema-Stegobolus clade.

Singh & Sinha (2010) cited 130 thelotremoid lichen species from India, of

which the core group includes Chapsa, Chroodiscus, Diploschistes, Fibrillithecis,

Leptotrema, Leucodecton, Melanotrema, Myriotrema, Nadvornikia, Ocellularia,

Reimnitzia, Stegobolus, Thelotrema, Topeliopsis, and Wirthiotrema. Species

delimitation within the genera is based on various morpho-anatomical

468 ... Joshi, Upreti & Haridas

differences represented by thallus and apothecial morphology, photobiont,

presence or absence of lateral paraphyses/fibrils and columella, ascospore color,

excipulum anatomy and carbonization, substratum, and crystal arrangement

(Frisch et al. 2006; Mangold et al. 2009; Rivas Plata et al. 2010).

Based on recent collections and the available literature (Nagarkar et al. 1986,

1987, 1988; Patwardhan & Kulkarni 1977a,b; Patwardhan & Nagarkar 1980;

Patwardhan & Makhija 1980; Patwardhan et al. 1985; Sethy et al. 1987; Awasthi

1991, 2000; Frisch et al. 2006; Mangold et al. 2009; Rivas Plata et al. 2010;

Singh & Sinha 2010), the present study provides a synopsis of the systematics,

taxonomy, and distribution pattern of the lichen genera Leucodecton and

Myriotrema in India according to the current generic classification within the

Graphidaceae.

Materials & methods

We examined and re-determined specimens from Andaman & Nicobar Islands,

Andhra Pradesh, Assam, Kerala, Orissa, Tamil Nadu and West Bengal that were stored

in the herbarium of the National Botanical Research Institute (LWG). We also studied

recent samples collected by one author (Haridas) from different localities in Western

Ghats, India. Morpho-anatomical characters were studied using a LAaBOMED D1GIZOOoM

stereomicroscope and Leica DM500 light microscope. Thin hand-cut sections of

apothecia and thallus were mounted in plain water, cotton blue, 10% KOH, and iodine

solutions and observed under a compound microscope. For secondary metabolites

identification spot tests, calcium hypochlorite (C) and paraphenylenediamine (PD)

were also applied when needed. TLC (solvent system A & C) was performed following

Orange et al. (2001).

We assembled preliminary information on Indian thelotremoids from the literature

(Nagarkar et al. 1986, 1987, 1988; Patwardhan & Kulkarni 1977a,b; Patwardhan &

Nagarkar 1980; Patwardhan & Makhija 1980; Patwardhan et al. 1985; Sethy et al. 1987;

Awasthi 1991, 2000; Singh & Sinha 2010). Earlier generic concepts and identification

keys were revised according to recent world monographs based on modern concepts

and classification (Frisch et al. 2006; Mangold et al. 2009; Rivas Plata et al. 2010).

Taxonomy

Leucodecton A. Massal., Atti Reale Ist. Veneto Sci. Lett. Arti, ser. 3, 5: 325, 1860.

The recently resurrected genus Leucodecton, originally introduced for a

single species, L. compunctum, currently contains ca. 19 species worldwide.

This includes five species each for Africa (Frisch 2006) and Australia (Mangold

et al. 2009) and six from India, with one (L. tarmuguliense) apparently endemic

for the country (Singh & Sinha 2010), although additional sampling is needed

to confirm the endemism of this species. By adding three more taxa, our re-

evaluation of the Indian thelotremoids brings to nine the number of Leucodecton

species represented in the country. Taxonomic and systematic revision of the

Leucodecton and Myriotrema (India) ... 469

thelotremoid Graphidaceae has broaden the generic delimitations so that

the genus now accommodates several stictic and norstictic acid-containing

species earlier placed in Leptotrema, Myriotrema, and Thelotrema. Leptotrema

is separated from Leucodecton based on its apically thickened asci and thick-

walled ascospores, while Myriotrema has parallel hyphae with radiating tips in

the proper exciple and belongs to a separate molecular clade (Frisch et al. 2006).

Thelotrema, on the other hand, acquires a periphysoidal excipulum. Leucodecton

has been re-introduced to accommodate species characterized by apothecioid

ascomata and a + free proper exciple of distinctly paraplectenchymatous

hyphae lacking radially oriented tips, markedly interwoven and often scarcely

branched paraphyses, absence of lateral paraphyses, + muriform brown usually

I- ascospores, and presence of stictic or norstictic acids (Frisch 2006; Mangold

et al. 2009; Rivas Plata et al. 2010).

Key to Leucodecton species recorded from India

la’ <Ascospores-10=50jprm long, (2) 48 per-ascus.: 4%. ce oh eaweee sana chy weve eh naaras takes 2

Ib... ~Ascospores’250;umilong, 14 perascusess ooo wa ey Gly eee ae yee hae Be bad 6

Ja. “Nokstictic acid present’. sts 5 Baki 25a Maye. Sleage lage lege a L. occultum

Zr SlichiodClatpresenty tut Am tate Um al. Uebel Ate, ded, Swe ed Uo Oe 3

3a. Apothecia often aggregated in whitish pseudostromata,

thallustecorticate:! 2.0. ee. . sas kono Stl F seals + Oaalt saa os L. glaucescens

3b. Apothecia solitary (sometimes numerous),

thallus corticate (loose to irregular or prosoplectenchymatous)............... 4

4a. True cortex present, thallus hard to crystalline,

ASCOSWOLESA Fa? 70295) Mt VA. eu ia che oe deed oan Reid ons L. compunctum

4b. True cortex absent, thallus loose, + dull,

ASCOSPONES 2040 MINT LOM GG 2. FB Paes pat at ak age ok Pans tet toe cleaned teas eee fe)

5a. Apothecia lepadinoid with free excipulum................. L. subcompunctum

5b. Apothecia myriotremoid, with + fused excipulum ............... L. fissurinum

Od." “ASCOSPORES FENIAIING NY ALINE oS. once Weds Bau aely nudes peude L. anamalaiense

6b:.~ Ascospores\ brownion maturity so. vas sk si ale stb ele pete Oo sae od a dk 28 7

7a. Apothecia myriotremoid to ocellularioid, thallus with irregular

CIUSIEES OM CiyStalsen stake uate vee ey emcee ties web reed L. tarmuguliense

7b. Apothecia porinoid to myriotremoid, thallus often with large

GO HANATIAT CIUGSTET SOT CLV SEA IC. We aba Me sich ae ty be See ba Ried ered hog ecar gM aes 8

8a. Apothecia porinoid (to indistinctly myriotremoid or lepadinoid with

an apically free exciple), narrow pore surrounded by dark ring

tas lpg Ro A le eg cet, She en See ee L. compunctellum

8b. Apothecia myriotremoid with narrow pore, thallus with small + irregularly

dispersed crystals, narrow pore surrounded by white ring......... L, nuwarense

470 ... Joshi, Upreti & Haridas

Leucodecton anamalaiense (Patw. & C. R. Kulk.) Rivas Plata & Liicking,

Lichenologist 42: 184, 2010.

Patwardhan & Kulkarni (1977b) first described this species from Anamalai

hills in Kerala as Thelotrema anamalaiense. However the lepadinoid

apothecia, brownish excipulum lacking lateral paraphyses, 2-4-spored asci,

muriform hyaline ascospores of 50-80 x 15-20 um, and presence of stictic

acid chemosyndrome agree well with Leucodecton, to which it was recently

transferred. The closely related L. nuwarense differs only in small ascospores

that turn brown at late maturity (Rivas Plata et al. 2010).

Leucodecton compunctellum (Nyl.) Frisch, Biblioth. Lichenol. 92: 155, 2006.

= Leptotrema microglaenoides (Vain.) Zahlbr., Cat. Lich. Univers. 2: 637, 1923

= Leptotrema elachistoteron (Leight.) Patw. & C. R. Kulk, Norweg. J. Bot. 24: 128, 1977

= Leptotrema oligosporum (Mill. Arg.) Patw. & Makhija, Bryologist 83: 368, 1980

= Myriotrema elachistoteron (Leight.) Hale, Mycotaxon 11: 133, 1980

= Myriotrema reclusum (Leight.) Hale, Mycotaxon 11: 135, 1980

The species is diagnosed by pale yellowish-grey to straw colored, finely

rugose to verrucose surface thallus with large columnar clusters of crystals, a

fused proper exciple, porinoid apothecia with very small pores (ca. 0.05 mm),

1-4-spored asci, and brown ascospores up to 140 um long.

Leucodecton compunctellum has previously been reported from India as

Leptotrema elachistoteron, L. microglaenoides, L. oligosporum, Myriotrema

elachistoteron, and M. reclusum (Patwardhan & Makhija 1980; Nagarkar et al.

1986; Awasthi 1991; Singh & Sinha 2010; Mangold et al. 2010). Its distribution

ranges from Andaman Islands to Karnataka and Kerala.

SPECIMENS EXAMINED—INDIA. ANDAMAN & NICOBAR ISLANDs: Unknown Island,

near evergreen forest compound, on bark, 23.04.1961, A. Singh 79745 (LWG); KERALA:

Idukki district, I.C.R.I. campus, Myladumpara, alt. ca. 1200 m, on bark of tree,

01.03.1984, D.D. Awasthi & G. Awasthi 84.116 (LWG).

Leucodecton compunctum (Ach.) A. Massal., Atti Inst. Veneto Sci. lett., Arti, ser. 3,

5: 32571860; PLATE 1A

Thallus corticolous, epiphloeodal, greenish-grey to yellowish-green or olive-

green, glossy, crystalline, smooth, continuous, 114-142 um thick. True cortex

well developed, 15-25 um thick. Prothallus indistinct, brownish. Photobiont

layer inspersed with crystals largely dispersed to aggregate. Medulla indistinct

to endophloeodal. Apothecia solitary, immersed, perithecioid, round, small to

ca. 1.0 mm in diam. Pore minute, round, blackish, 0.2-0.3 um in diam. Margin

thick, entire, often brighter than the thallus. Disc not visible from above. Proper

exciple, pale yellowish to brownish, laterally 20-25 um reaches up to 62(-80)

um in the bottom. Epihymenium hyaline, without granules, 10-20 um high.

Hymenium clear, 150-200 um high. Paraphyses simple, +straight, delicate,

conglutinate apically, 1-2 um thick. Asci 8-spored, clavate, 50-70 x 15-20 um.

Leucodecton and Myriotrema (India) ... 471

Ascospores becoming brown at early maturity, muriform, 6-13 x 4-6 loculate,

oblong to subglobose, 23-27(-33) x 11-14(-16) um in size, endospore thick, I-.

CHEMISTRY: K+ reddish, C-, PD+ orange; stictic acid chemosyndrome

detected in TLC.

ECOLOGY & DISTRIBUTION: Worldwide, L. compunctum is widely distributed in the

tropics, although not recorded from Africa (Frisch et al. 2006). Newly recorded for India,

it is known from tropical evergreen forests of Western Ghats above 1000 m, spreading

in large thallus patches closely associated with L. subcompunctum and Wirthiotrema

glaucopallens (Nyl.) Rivas Plata & Kalb.

SPECIMEN EXAMINED— INDIA. KERALA: Kollam district, Rosemala, on bark,

27.06.2006, Biju Haridas 06-009582 (LWG).

REMARKS: Leucodecton compunctum is characterized by a rather glossy smooth

to crystalline thallus, immersed perithecioid apothecia with minute pores, and

brown muriform ascospores. It is readily distinguished from Leptotrema wightii

(Taylor) Mull. Arg. in lacking red anthraquinone crystals and from Leucodecton

compunctellum and L. subcompunctum in having smaller ascospores. Moreover,

L. subcompunctum has lepadinoid apothecia. Leucodecton compunctum may

sometimes be confused with Wirthiotrema glaucopallens excluding pore

structures; W. glaucopallens is further distinguished by a Myriotrema-type

prosoplectenchymatous cortex with internal splitting (Rivas Plata et al. 2010).

Leucodecton fissurinum (Hale) Frisch, Biblioth. Lichenol. 92: 156, 2006.

A regularly fissured areolate thallus, compact surface, fused to incompletely

free proper exciple bordering the rounded pore as a brownish ring, and

myriotremoid apothecia are the major characters separating L. fissurinum from

the closely related L. subcompunctum. Further differences are the 8-spored asci

and brown muriform (3-10 x 1-3 septate) ascospores of 20-40 x 9-13 um.

The species has been recorded at higher altitudes from Africa (Frisch 2006)

and Sri Lanka (Hale 1981). In India this species was reported as Myriotrema

fissurinum (Awasthi 1991; Singh & Sinha 2010) and is distributed mostly in the

south, including Karnataka, Kerala, Tamil Nadu, and West Bengal.

SPECIMENS EXAMINED—INDIA. Kerata: Idukki district, [IC.RI. campus,

Myladumpara, alt. ca. 1200 m, on bark, 01.03.1984, D.D. Awasthi & G. Awasthi 84.103

(LWG-LWU); Tamit Napv: Nilgiri Hills, Avalanche, Hatchery Shola, alt. ca. 2100 m,

on bark, 23.12.1971, K.P. Singh 71.564 (LWG-LWU); West BENGAL: Eastern Himalaya,

Darjeeling district, Rangit river valley, Rangit, near the bridge, alt. ca. 600 m, on bark,

08.03.1967, D.D. Awasthi & M.R. Agarwal 67.185 (LWG-LWU).

Leucodecton glaucescens (Ny].) Frisch, Biblioth. Lichenol. 92: 164, 2006.

This taxon can easily be recognized by the chroodiscoid-lepadinoid apothecia

aggregated in whitish pseudostromata, + free proper exciple, 8-spored asci, and

small brown muriform ascospores mostly under 20 x 10 um.

472 ... Joshi, Upreti & Haridas

Awasthi (1991) reported the species as Myriotrema glaucescens. The closely

related L. phaeosporum, L. subcompunctum, and L. fissurinum have a loosely

corticate thallus, mostly solitary apothecia, and comparatively larger ascospores.

L. glaucescens occurs in tropical forests of Karnataka, Kerala, and Tamil Nadu.

SPECIMENS EXAMINED— INDIA. KERALA: Palghat district, M.C.L. mines area, Walayar

forest, alt. ca. 300 m, on bark, 22.03.1985, D.D. Awasthi, R. Tewari & R. Mathur

85.35, 85.3 (LWG-LWU)); Idukki district, Munnar, Rajamallay area, alon border of tea

plantation, alt. ca. 1500-1600 m, on bark, 24.03.1985, D.D. Awasthi, R. Tewari & R.

Mathur 85.55 (LWG-LWU); on way Myladumpara to Munnar, Chinnakanal area, alt. ca.

1350 m, on bark, 02.03.1984, D.D. Awasthi & G. Awasthi 84.251 (LWG-LWU).

Leucodecton nuwarense (Hale) Frisch, Biblioth. Lichenol. 92: 155, 2006.

The species is recognized by a pale greenish-grey uneven cracked thallus

containing stictic acid chemosyndrome, numerous immersed apothecia, free

proper exciple, 2-spored asci, and brown muriform ascospores of 42-55 x

10-15 um.

Originally included in Indian thelotremoid group as Leptotrema nuwarense

and Myriotrema nuwarense from South Andaman (Nagarkar et al. 1986;

Awasthi 1991), L. nuwarense is close to L. anamalaiense, which is distinguished

by consistently hyaline and somewhat larger ascospores.

Leucodecton occultum (Eschw.) Frisch, Biblioth. Lichenol. 92: 157, 2006.

= Leptotrema compunctum (Ach.) NyL., Flora 71: 527, 1888

= Leptotrema norstictideum Patw. & Nagarkar, Biovigyanam 6(1): 5, 1980

This species is described for an ecorticate fissured thallus in different shades

of pale and yellow (greenish or grey), immersed to slightly emergent ascomata

with a free proper exciple, small brown submuriform or muriform (5-9 x

1-5 septate), thick-walled ascospores (20-40 x 10-17 um), and presence of

norstictic acid chemosyndrome.

Awasthi & Singh (1975) and Patwardhan & Kulkarni (1977a) cited

L. occultum as Leptotrema compunctum, and Patwardhan & Nagarkar (1980)

as Leptotrema norstictideum. In India the species is found in the Andaman and

Nicobar Islands, Andhra Pradesh, Assam, Kerala, Madhya Pradesh, Meghalaya,

Orissa, Tamil Nadu, and West Bengal. It is the only norstictic acid (major)

containing species of Leucodecton.

SPECIMENS EXAMINED—INDIA. ANDHRA PRADESH: Vishakhapatnam, Simhachadam

area in cashew plantation, on bark of Mango tree, 06.03.1986, D.D. Awasthi, G. Awasthi,

R. Mathur & P. Srivastava 86.240, 86.248 (LWG-LWU); KERALA: Trivandrum Botanical

and Zoological Garden, on bark, 08.05.1979, D.D. Awasthi, D.K. Upreti & U. Mishra

79.898 (LWG-LWU); Orissa: Ganjam district, on way to Seranga, on bark of Pongamia

tree, 03.03.1986, D.D. Awasthi, G. Awasthi, R. Mathur & P. Srivastava 86.128 (LWG-

LWU); WEsT BENGAL: 24 Parganas district, Sunderban, Sajanakholi forest office, on

bark, May 1975, K. N. Roychowdhury 3871, 3862, 3875, 3879 (LWG-CAL).

Leucodecton and Myriotrema (India) ... 473

PLATE 1. New Leucodecton records from India.

A. Leucodecton compunctum. B. Leucodecton subcompunctum.

Scale bars: A = 1 mm; B= 2 mm.

474 ... Joshi, Upreti & Haridas

Leucodecton subcompunctum (Nyl.) Frisch, Biblioth. Lichenol. 92: 162, 2006.

PLATE 1B

Thallus corticolous, epiphloeodal, olive-grey to olive-brown, fissured to

areolate, + glossy, loose, irregularly corticate, crystalline surface. Prothallus

brownish. Photobiont layer well developed, with inclusions of calcium oxalate

crystals, up to 50 um thick. Medulla largely endophloeodal. Apothecia dispersed,

immersed, rounded to angular, up to 1.0 mm wide pore. Disc blackish, usually

covered with white pruina. Proper exciple free to partly fused, pale fawn to

sometimes hyaline, 15-25 um thick. Epihymenium unpigmented, up to 10

um high. Hymenium clear, 100-120 um high. Subhymenium 10-20 um high.

Paraphyses simple, straight, 1.5-2.0 um thick, tips slightly thickened, adspersed

with grayish granules. Asci 8-spored, narrowly clavate, 80-100 x 10-20 um in

size. Ascospores brown, muriform, 3-8 x1-3 septate, 15-35 x 10-20 um in

size, I-.

CHEMISTRY: K+ reddish, PD+ orange, C-. Stictic acid chemosyndrome

detected in TLC.

ECOLOGY & DISTRIBUTION: Previously known from tropical, sub-tropical to

temperate regions in Africa, Asia, and Australia (Frisch 2006), L. subcompunctum

is reported for the first time from India from the tropical evergreen forests of

Western Ghats (Kerala and Tamil Nadu). It can grow in shade but is found

mostly in open sub-temperate forests and avoids humid environment.

SPECIMENS EXAMINED— INDIA. KERALA: Idukki district, Kallar Munnar Hills, alt. 1140

m, on bark, 14.02.1975, A. Singh & M. Ranjan 103044 (LWG); Trivendrum, ABP, way to

Pongalappara, alt. 1150 m, on bark, 26.04.2006, Biju Haridas 06-009580 (LWG); TaMIL

Naov: Nilgiri Hills, Kodanad, tea estate area, alt. ca. 2019 m, on bark, 31.12.1970, D.D.

Awasthi & K.P. Singh 70.1447, 70.1500 (LWG-LWU); In the shola near tea estate, alt. ca.

2010 m, on bark, 31.12.1970, D.D. Awasthi & K.P. Singh 70.1499 (LWG-LWU); Salem

district, Yercaud, Shevaroy Hills, near Shevaroy temple, alt. 1600 m, on bark, 29.12.1990,

D.K. Upreti & Hariharan 202308 (LWG); Palni Hills, Kodaikanal, near Shola, alt. ca.

1800 m, on bark, 13.12.1970, K.P. Singh, 70.849 (LWG-LWU).

REMARKS: Frisch (2006) considered L. subcompunctum a lowland species

and separated it from the customarily high elevation L. fissurinum based on

altitudinal range and certain minor diagnostic differences. But the recent field

survey together with the re-examination of preserved material indicates that

in India L. subcompunctum occurs at significantly higher altitudes in montane

forests. However, the compact crystalline irregularly fissured to areolate thallus

and lepadinoid apothecia with free excipula separate L. subcompunctum from

L. fissurinum. Leucodecton phaeosporum (Nyl.) Rivas Plata & Liicking, which

resembles L. subcompunctum in having a loose and irregular cortex, differs in

columnar crystal arrangement in the thallus and comparatively small ascospores

of 15-25 um.

Leucodecton and Myriotrema (India) ... 475

Leucodecton tarmuguliense (Sethy, Nagarkar & Patw.) Frisch, Biblioth. Lichenol.

92: 155, 2006.

The species is characterized by a pale yellowish-grey to olivaceous thallus

containing stictic acid chemosyndrome, prominent apothecia, a fused proper

exciple, 2-spored asci and brown muriform ascospores of 70-93 x 15-23

uum. Sethy et al. (1987) described this species as Leptotrema tarmuguliense

from south Andaman, which was accommodated in Myriotrema (Awasthi

1991) until the recent thelotremoid taxonomic reclassification. The species

is well separated from the closely related L. compunctellum by its prominent

(emergent) apothecia and irregular clusters of crystals. An Indian endemic,

L. tarmuguliense is reported thus far only from Andaman and Nicobar Islands.

Myriotrema Fée, Essai Crypt. Ecorc. 1: xlix, 103, 1825.

The genus, recognized as a section in Thelotrema (Salisbury 1978), was

reestablished by Hale (1980, 1981) to accommodate species that lack lateral

paraphyses and have non-carbonized proper exciples. Frisch et al. (2006) later

revised Myriotrema for six species in Africa and Mangold et al. (2009) for

17 species in Australia. Worldwide ca. 25 Myriotrema species were recognized

prior to emendation by Rivas Plata et al. (2010), who circumscribed the

genus to emphasize the internally splitting prosoplectenchymatous cortex

and production of psoromic and protocetraric chemosyndromes. In India

the genus was represented by 24 species (Awasthi 1991, 2000), subsequently

reduced to 15, including three endemics (Singh & Sinha 2010). Due to the

most recent generic classification, most Myriotrema taxa have been transferred

to Chapsa, Leucodecton, Ocellularia, Thelotrema, and Wirthiotrema, with

some reduced to synonymy. Currently Myriotrema is represented in India

by nine species (including one endemic) featuring psoromic acid as a major

chemical constituent with some species containing protocetraric acids and

unknown compounds. Other diagnostic characters include an internally

splitting prosoplectenchymatous cortex, small myriotremoid apothecia,

prosoplectenchymatous proper exciples with radiating tips, and an absence of

lateral paraphyses.

Key to Myriotrema species recorded from India

la. <Ascospores: muriform to.submiurifornyr i245 onl d ai cied en slnt eck ed ee 2

1b. | Ascospores transversely septate (sometimes with 1 vertical septum)........... 5

BAY ASCOSPORES DLO WATS, a. Uke actcy Wachee Wey ase ee RS ae 2. M. desquamans

2b... “Ascospotes hyaline: 4)0s09 dist ad bs 8d peg had tcled doped def de Mehta a eects 3

ja, terehen SubstancesaDsent.\ set). b set Stone ent en Mo a ee M. subconforme

SU; sLichen'substances*presenti(psoroimicacidy. 3. ts0 0. tt te ee eee ee a

476 ... Joshi, Upreti & Haridas

4a. Asci 4-8-spored, ascospores small, 15-25 x 7-10 um ............ M. rugiferum

4b. Asci 1-spored, ascospores large, 140-240 x 24-50 um.......... M. masonhalei

5a. ‘Thallus containing protocetraric acid present ............... M. pertusarioides

Spy ihallins lackenisprOtecetratic- acide Pesca tautisne ee eawscen cranks teewe cee ala ara Pear get ee ar 6

6a. Apothecia usually emergent, psoromic acid

GIVE HYOSVTIGTONIG agate wes ona wes oeaesgis cane si orecndee orca te M. glaucophaenum

6b. Apothecia immersed to raised, chemistry variable ......................000. 7

7a. “lhallusveontaining olivacétmianknowin: 1.958 yh dt ed ln M. olivaceum

7b. Thallus containing psoromic acid chemosyndrome .................000e 000s 8

8a. Thallus glossy, + free proper exciple,

ascospores usually with 1 vertical septum.................... M. clandestinum

8b. Thallus fissured, areolate, + fused proper exciple,

ascospores consistently transversely septate................... M. microporum

Myriotrema clandestinum (Fée) Hale, Mycotaxon 11: 133, 1980.

= Ocellularia terebratula (Nyl.) Mull. Arg., Mém. Soc. Phys. Genéve 29(8): 12, 1887

The species is characterized by pale greenish to olivaceous corticate

continuous glossy thallus, immersed apothecia, + free proper exciple, small

hyaline transversely 5-6-septate (with one vertical septum) ascospores of 10-27

x 6-8 um, and the presence of psoromic acid.

Myriotrema clandestinum, reported from India by Nagarkar et al. (1988)

as Ocellularia terebratula, has been included in the synonymy of Myriotrema

clandestinum by Mangold et al. (2009). It has a wide distribution in India and

collected from Andaman & Nicobar Islands, Arunachal Pradesh, Karnataka,

Kerala, Maharashtra, and Meghalaya.

SPECIMENS EXAMINED—INDIA. KERALA: Mallapuram district, Wynad area, Thakarpadi,

A. Singh & M. Ranjan, alt. 450 m, on bark 102217 (LWG); Trivendrum Peppara Wildlife

Sanctuary, on bark, 19.10.2006, Biju Haridas, 06-009586 (LWG); Kollam, Rosemala,

27.6.2006, on bark, B. Hardas, 06-009585 (LWG); Tami NApbu: Palni Hills, Perumal

to Palni road side, via short-cut road, alt. 1350-1500 m., on bark, 15.12.1970, K.P. Singh

70.984 (LWG).

Myriotrema desquamans (Mill. Arg.) Hale, Mycotaxon 11: 133, 1980.

= Leptotrema irosinum (Vain.) Zahlbr., Cat. Lich. Univ. 2: 635, 1923

The taxon is characterized by a glossy corticate thallus, small-pored

immersed perithecioid ascomata, a fused proper exciple, and brown muriform

(5-11 x 1-6 septate) ascospores of 20-35 x 8-18 um.

In India the species was reported as Leptotrema desquamans by Patwardhan

& Makhija (1980) and L. irosinum by Patwardhan & Kulkarni (1977a). The

species shows close affinity with Wirthiotrema and forms a non-inspersed

counterpart of W. trypaneoides (Nyl.) Rivas Plata & Liicking (Rivas Plata et al.

Leucodecton and Myriotrema (India) ... 477

2010). In India the species is known from Andaman & Nicobar Islands and

Kerala.

Myriotrema glaucophaenum (Kremp.) Hale, Mycotaxon 11: 133, 1980.

The greenish to yellowish-grey thallus, + free proper exciple, emergent

apothecia, 8-spored asci, transversely 1-7 septate (with single vertical septum)

hyaline ascospores of 10-20 x 5-8 um, and presence of psoromic acid are the

characteristic features of the species. The closely related M. microporum and

M. clandestinum with psoromic acid differs in having a fissured thallus and a

fused proper exciple, respectively. Myriotrema glaucophaenum is unusual in its

Thelotrema-like ascomata that lack lateral paraphyses (Mangold et al. 2009).

Patwardhan & Kulkarni (1977a) reported the species from Kerala as Ocellularia

glaucophaena.

SPECIMEN EXAMINED—INDIA. KERALA: Trivendrum, ABP, Athirumala Pathalamathy,

alt. 1200 m, on bark, 25.04.2006, Biju Haridas 06—009587 (LWG).

Myriotrema masonhalei (Patw. & C. R. Kulk.) Hale, Mycotaxon 11: 134, 1980.

The species is diagnosed by the dark greenish glaucous, wrinkled to warty

thallus, immersed apothecia, a pale-brown fused proper exciple carbonized

at apices, l-spored asci, and oblong-ellipsoid, large (140-240 x 24-50 um)

ascospores.

This psoromic acid containing species is described from Maharashtra by

Patwardhan & Kulkarni (1977) as Thelotrema masonhalei and has also been

reported from Kerala and Karnataka in Western Ghats in India (Singh & Sinha

2010).

Myriotrema microporum (Mont.) Hale, Mycotaxon 11: 134, 1980.

The taxon is readily recognized by a thick areolate fissured dark dull-

grey thallus, numerous small apothecia, a + fused proper exciple, 8-spored

asci, transversely 2-4-septate hyaline ascospores of 10-18 x 5-8 um, and the

presence of psoromic acid chemosyndrome.

Myriotrema microporum shares the same chemical constituents with

M. clandestinum and M. glaucophaenum but differs in the distinctly fissured,

areolate thallus and slightly small transversely septate ascospores. Earlier it was

reported as Ocellularia micropora from Assam, Karnataka, Kerala, Orissa, Tamil

Nadu, and West Bengal (Nagarkar et al. 1988, Singh & Sinha 2010). The species

is found in Western Ghats, eastern Himalayas, and Eastern Ghats in India.

SPECIMENS EXAMINED—INDIA. Assam: North Cachar Hills district, Haflong, on

bark, D.K. Upreti & Jayshree Rout 05-002992 (LWG); KERALa: Idukki district, I.C.R.I.

campus, Myladumpara, alt. ca. 1200 m, on bark, 01.03.1984, D.D. Awasthi & G. Awasthi

84.118, 84.148 (LWG-LWU); on bark of Vateria indica, 01.03.1984, D.D. Awasthi &

G. Awasthi 84.128 (LWG-LWU); Myladumpara to Munnar, Chinnakanal area, alt. ca.

478 ... Joshi, Upreti & Haridas

1350 m, on bark, 02.03.1984, D.D. Awasthi & G. Awasthi 84.228, 84.248 (LWG-LWU);

Santhampara area, alt. ca. 1200 m, on bark, 02.03.1984, D.D. Awasthi & G. Awasthi

84.177 (LWG-LWU); Kallar Munnar Hills, alt. 1140 m, on bark, 14.02.1975, A. Singh

& M. Ranjan 103065 (LWG)); Travancore, Quilon, on bark, 10.08.1953, O.A. Héeg 2580

(LWG-AWAS); Orissa: Ganjam district, on way to Seranga, on bark of Pongamia tree,

03.03.1986, D.D. Awasthi, G. Awasthi, R. Mathur & P. Srivastava 86.127 (LWG-LWU);

TAMIL NADv: Palni Hills, Perumal to Palni road side, via short cut road, alt. 1350-1500

m, on bark, 15.12.1970, K.P. Singh 70.981 (LWG-LWU); Tiger Shola area, along the

road, alt. ca. 1650 m, on bark, 15.12.1970, K.P. Singh 70.1028 (LWG); Shembaganur to

Periakulum, via short cut road, alt. 1650-1800 m, on bark, 14.12.1970, K.P. Singh 70.935

(LWG-LWU).

Myriotrema olivaceum Fée, Essai Crypt. Ecorc. 1: 103, 1825.

The taxon is distinguished by the thallus compound “olivacea unknown,’ a

light greenish-grey to ashy grey smooth fissured areolate thallus, free proper

exciple, 8-spored asci, and small (10-15 x 5-7 um) transversely 2-4-septate

ascospores.

The unusual chemical compounds separate the species from the closely

related M. microporum, which has similar apothecial morpho-anatomical

characters. Nagarkar et al. (1986) reported M. olivaceum (as Ocellularia olivacea)

from Andaman and Nicobar Islands, the only sites reported for India.

Myriotrema pertusarioides (Nagarkar, Sethy & Patw.) D.D. Awasthi, Biblioth.

Lichenol. 40: 3, 1991.

The species is characterized by a pale to yellowish-grey warty thallus,

numerous emergent basally constricted apothecia, a fused reddish-yellow

proper exciple, 8-spored asci, and 15-18 x 10-12 um ascospores with single

transverse and vertical septa.

Nagarkar et al. (1986) described this protocetraric acid-containing species

(as Leptotrema pertusarioides) from the Andaman and Nicobar Islands, where it

appears endemic. However, further taxonomic study is needed, as its apothecial

morphology is unusual for the genus, and it resembles Ocellularia bahiana

(Ach.) Frisch in having protocetraric acid.

Myriotrema rugiferum (Harm.) Hale, Mycotaxon 11: 135, 1980.

This morphologically variable taxon is characterized by a pale-olive to

greyish and greenish-white thick corticate thallus, small immersed apothecia,

a free proper exciple, 4-8-spored asci, and small (15-25 x 7-10 um) hyaline

submuriform (3-6 x 0-3 septate) ascospores. Similar to M. masonhalei,

M. rugiferum contains psoromic acid but differs in having 1-spored asci and

large ascospores. Myriotrema rugiferum has been collected only from tropical

forests of Kerala in India.

Leucodecton and Myriotrema (India) ... 479

SPECIMENS EXAMINED—INDIA. Kerata: Idukki district, [IC.RI. campus,

Myladumpara, alt. ca. 1200 m, on bark, 01.03.1984, D.D. Awasthi & G. Awasthi 84.136,

84.73, 84.83 (LWG-LWU).

Myriotrema subconforme (Nyl.) Hale, Mycotaxon 11: 135, 1980.

Distinguishing features include a pale-olive to greyish-green or greenish-grey

verruculose rather fragile corticate thallus with numerous crystals inclusions,

a free proper exciple, 8-spored asci, and small (10-20 x 6-9 um) submuriform

(3-5 x 1-3 septate) ascospores.

Myriotrema subconforme appears most closely related to M. album Fée,

M. clandestinum, M. myrioporum (Tuck.) Hale, and M. endoflavescens Hale

ex Liicking in lacking thallus compounds. However, all three species differ

from M. subconforme in their mostly transversely septate ascospores, and

M. endoflavescens has a yellow-pigmented medulla (Lumbsch et al. 2011). The

submuriform species, M. rugiferum, contains psoromic acid and has slightly

larger (ca. 0.4 mm) apothecia (Mangold et al. 2009).

Nagarkar et al. (1987) reported M. subconforme (as Thelotrema subconforme)

from Andaman and Nicobar Islands. Reexamination of certain unidentified

preserved specimens from Kerala has extended the range of this species to

Western Ghats.

SPECIMENS EXAMINED—INDIA. KERALA: Palghat district, M.C. mines area, Walayer

forest, alt. ca. 300 m, on bark, 22.03.1985, D.D. Awasthi, R. Tewari & R. Mathur 85.8

(LWG-LWU); Kollam district, rosemala, on bark, 28.06.2006, Biju Haridas 06-009588

(LWG); Trivendrum, ABP, way to Pongalappara, alt. 1145 m, on bark, 26.04.2006, Biju

Haridas 06-009625 (LWG); Tamit Napv: Nilgiri Hills, Awalanche, in Shola near forest

rest house, alt. ca. 2100 m, on bark, 04.01.1971, D.D. Awasthi & K.P. Singh 71.247 (LWG-

LWU).

Discussion

The Graphidaceae flourish well in India and offer a remarkable diversity in

Andaman & Nicobar Islands, eastern Himalayas, and Western Ghats. Of the 18

taxa studied here, 14 species (seven each of Leucodecton and Myriotrema) occur

in Western Ghats, followed by nine (four Leucodecton and five Myriotrema)

reported from Andaman & Nicobar Islands and four species (two each of

Leucodecton and Myriotrema) from eastern Himalayas. Eastern Ghats harbours

Leucodecton occultum and Myriotrema microporum whereas central India is

represented by Leucodecton occultum. Despite the variations in macro-habitat,

tree species, trunk girth, bark texture, and other microclimate variables, it is

noteworthy that thelotremoid lichens exhibit a uniform pattern of association

with other lichens on different trees of tropical rain forests in India. Although

placed in significantly different clades by molecular analysis, Leucodecton and

Myriotrema especially show morphological similarities and share habitats

480 ... Joshi, Upreti & Haridas

over a broad (300-2100 m) altitudinal range. Leucodecton mostly inhabits the

wide tree trunks and associates with other porinoid or lepadinoid species (e.g.,

Myriotrema, Ocellularia, Thelotrema and Wirthiotrema) in comparatively dry

but shaded undisturbed to semi-disturbed mature secondary lowland forests.

Ecorticate taxa retain their rough texture that easily distinguishes them from

neighbouring corticate taxa. However, the corticate shiny hard texture of

certain Leucodecton taxa is so close to some Myriotrema and Ocellularia species

that field identification is difficult. Superficially, the thallus and apothecial

structures in some Leucodecton species (e.g., L. compunctellum) are enough

similar to those in certain Myriotrema species that chemical tests are needed

for correct determination.

Thelotremoid lichens in India are in great need of systematic revision due

to remaining taxonomic and nomenclatural problems. In certain cases the

taxonomically functional characters for species differentiation are not very

sharp (Staiger et al. 2006, Rivas Plata & Lumbsch 2011). In particular, delimiting

species based on ascospore color changing progressively from hyaline to brown

during development is overemphasized, as for Leucodecton anamalaiense,

L. compunctellum, and L. nuwarense. Differentiation between L. compunctellum

and L. nuwarense is based broadly on crystal arrangement and color of the pore

margins, with separation of the two dependent on rather similar characteristics

of apothecia, pore structures, size, and thallus texture (Rivas Plata et al. 2010).

Further, L. fissurinum is treated as a separate species based on such minor

taxonomic features as a regularly fissured thallus and myriotremoid apothecia

with + fused exciple. The closely related L. subcompunctum, which also exhibits

a fissured thallus, does have a diagnostic lepadinoid apothecial morphology.

Likewise, Myriotrema clandestinum differs from M. microporum in its somewhat

smooth thallus, + fused proper exciple, and ascospores with a single vertical

septum. The closely related M. microporum has a fissured thallus, + free proper

exciple, and transversely septate ascospores within the range of M. clandestinum

(Mangold et al. 2009). Species delimitation based on vertical septum as

suggested by Salisbury (1978) has little taxonomic significance. Moreover,

characters like a fissured thallus, a more or less free to fused excipulum, the

arrangement or abundance of crystals, or the involvement of a periderm layer

in the apothecial margins (Frisch 2006; Mangold et al. 2009; Rivas Plata et al.

2010) seem to have little taxonomic importance and should be considered

ecologically influenced variations. Nonetheless, it might be beneficial to know

whether such morphological variations result from genetic differentiation or

phenotypic plasticity (Rivas Plata & Lumbsch 2011, Rivas Plata et al 2011).

The unrevised taxa, M. masonhalei and M. pertusarioides, both with 1-spored

asci, are currently placed in Myriotrema. Occurrence of a single spore is rare

in Myriotrema. Furthermore, the ascospore size in M. masonhalei is unusually

Leucodecton and Myriotrema (India) ... 481

large for Myriotrema, while the basally constricted emergent apothecia in

M. pertusarioides seems more characteristic of Ocellularia, indicating that

both species need further analysis for proper placement. Several thelotremoid

taxa have uncertain positions in either molecular or traditional taxonomic

classification, suggesting that they need to be split into several different taxa or

delimited more broadly to resolve ambiguities at the generic or species levels.

Acknowledgements

We are grateful to the Director of the CSIR-National Botanical Research Institute,

Lucknow, for providing necessary facilities, and the Ministry of Environment and

Forests, New Delhi, for financial support. One of the authors (DKU) also acknowledges

CSIR 12th Five year Plan project (BSC 0106) for financial assistance. Authors are grateful

to Dr. Eimy Rivas Plata and Dr. Pradeep K. Divakar for their thorough observation and

valuable comments on the manuscript. Santosh Joshi thanks Dr. Sanjeeva Nayaka for

helpful suggestions in manuscript preparation.

Literature cited

Awasthi DD. 1991. A key to microlichens of India, Nepal and Sri Lanka. Bibliotheca Lichenologica

40: 1-337.

Awasthi DD. 2000. Lichenology in Indian subcontinent: a supplement to “A Handbook of Lichens”.

Bishen Singh Mahendra Pal Singh, DehraDun, India.

Frisch A. 2006. Contribution towards a new systematic of the lichen family Thelotremataceae |. The

lichen family Thelotremataceae in Africa. Bibliotheca Lichenologica 92: 3-370.

Frisch A, Kalb K, Grube M. 2006. Contribution towards a new systematic of the lichen family

Thelotremataceae. Bibliotheca Lichenologica 92: 1-556.

Hale ME Jr. 1974. Morden-Smithsonian expedition to Dominica: The lichens (Thelotremataceae).

Smithsonian Contributions to Botany 16: 1-46.

Hale ME Jr. 1978. A revision of the lichen family Thelotremataceae in Panama. Smithsonian

Contributions to Botany 38: 1-60.

Hale ME. Jr. 1980. Generic delimitation in the lichen family Thelotremataceae. Mycotaxon 11:

130-138.

Hale ME. Jr. 1981. A revision of the lichen family Thelotremataceae in Sri Lanka. Bulletin of the

British Museum (Natural History), Botany Series 8: 227-332.

Lumbsch HT, Ahti T, Altermann S, Paz ADG, Aptroot A, Arup U, et al. 2011. One hundred new

species of lichenized fungi: a signature of undiscovered global diversity. Phytotaxa 18: 1-127.

Mangold A, Elix JA, Lumbsch HT. 2009. Thelotremataceae. Flora of Australia 57: 195-420.

Nagarkar MB, Sethy PK, Patwardhan PG. 1986. Materials for a lichen flora of the Andaman

Islands-I. Mycotaxon 27: 71-82.

Nagarkar MB, Sethy PK, Patwardhan PG. 1987. Material for a lichen flora of the Andaman Islands-

V. Mycotaxon 29: 335-343.

Nagarkar MB, Sethy PK, Patwardhan PG. 1988. Lichen genus Ocellularia (Family Thelotremataceae)

from India. Biovigyanam 14: 24-43.

Orange A, James PW, White FJ. 2001. Microchemical methods for the identification of lichens.

British Lichen Society.

Patwardhan PG, Kulkarni CR. 1977a. A contribution to our knowledge of the lichen flora of India

I: Family Thelotremataceae. Kavaka 5: 1-17.

482 ... Joshi, Upreti & Haridas

Patwardhan PG, Kulkarni CR.1977b. Some new taxa of the family Thelotremataceae from Western

Ghats, SW India. Norwegian Journal of Botany 24: 127-131.

Patwardhan PG, Makhija U. 1980. Nomenclatural note on three species of Anthracothecium.

Bryologist 83: 368-369. http://dx.doi.org/10.2307/3242453

Patwardhan PG, Nagarkar MB. 1980. Notes on some lichens from north east India II: family

Thelotremataceae. Biovigyanam 6: 1-10.

Patwardhan PG, Sethy PK, Nagarkar MB. 1985. A contribution to our knowledge of the lichen

family Thelotremataceae from South India. Biovigyanam 11: 133-140.

Rivas Plata E, Lumbsch HT. 2011. Parallel evolution and phenotypic disparity in lichenized

fungi: a case study in the lichen-forming fungal family Graphidaceae (Ascomycota:

Lecanoromycetes: Ostropales). Molecular Phylogenetics and Evolution 61: 45-63.

http://dx.doi.org/10.1016/j.ympev.2011.04.025

Rivas Plata E, Liicking R, Sipman HJM, Mangold A, Kalb K, Lumbsch HT. 2010. A worldwide key

to the thelotremoid Graphidaceae, excluding the Ocellularia-Myriotrema-Stegobolus clade. The

Lichenologist 42(2): 139-185. http://dx.doi.org/10.1017/S0024282909990491

Rivas Plata E, Hernandez JE, Licking R, Staiger B, Kalb K, Caceres MES. 2011. Graphis is two genera

- a remarkable case of parallel evolution in lichenized Ascomycota. Taxon 60(1): 99-107.

Rivas Plata E, Liicking R, Lumbsch HT. 2012. A new classification for the family Graphidaceae

(Ascomycota: Lecanoromycetes: Ostropales). Fungal Diversity 52(1): 107-121.

http://dx.doi.org/10.1007/s13225-011-0135-8

Salisbury G. 1978. Thelotrema Achariana et Feeana. Nova Hedwigia 29: 405-427.

Sethy PK, Nagarkar MB, Patwardhan PG. 1987. Materials for a lichen flora of the Andaman

Islands-III. Mycotaxon 28(1): 191-198.

Singh KP, Sinha GP. 2010. Indian lichens: an annotated checklist. Botanical Survey of India. Shiva

Offset Press, DehraDun, Uttarakhand.

Staiger B. 2002. Die Flechtenfamilie Graphidaceae. Studien in Richtung einer natiirlicheren

Gliederung. Bibliotheca Lichenologica 85: 1-526.

Staiger B, Kalb K, Grube M. 2006. Phylogeny and phenotypic variation in the lichen family

Graphidaceae (Ostropomycetidae, Ascomycota). Mycological Research 110: 765-772.

http://dx.doi.org/10.1016/j.mycres.2006.05.003

MY COTAXON

http://dx.doi.org/10.5248/122.483

Volume 122, pp. 483-490 October-December 2012

Three non-hairy species of Leptogium

from China

Hua-Jige Liu’, JING Cao, SHUAI GUAN & QING-FENG Wu

College of Life Sciences, Hebei University, Baoding, 071002, China

* CORRESPONDENCE TO: liuhuajie@foxmail.com

ABSTRACT — Leptogium javanicum is reported as new to China, and L. austroamericanum

and L. sessile are reported as new to mainland China. Descriptions and comments for the

three species and a key to the non-hairy species known from mainland China are presented.

KEY worps — taxonomy, Ascomycota, Peltigerales, Collemataceae, lichenized fungi

Introduction

The lichen genus Leptogium (Ach.) Gray comprises about 189 species

worldwide (Kirk et al. 2008). Of the 34 species reported for China, 22 have been

recorded from the mainland (Wei 1991, Wang et al. 2010, Liu & Guan 2012).

Eight out of 17 non-hairy species have been recognized in mainland China:

Leptogium azureum (Sw. ex Ach.) Mont., L. cochleatum (Dicks.) P.M. Jorg. & P.

James, L. cyanescens (Pers.) K6rb., L. denticulatum Malme, L. lichenoides (L.)

Zahlbr., L. moluccanum (Pers.) Vain., L. plicatile (Ach.) Leight., and L. subazureum

A. Dube & Makhija (Aptroot et al. 2002, Wei 1991).

In this paper, three additional non-hairy species belonging to the genus are

reported. Leptogium javanicum is new to China, and L. austroamericanum and

L. sessile are new to mainland China.

Material & methods

The specimens studied are housed in the Herbarium of Nanjing Normal University

(NNU), the Herbarium of Cryptogams, Kunming Institute of Botany, Academia Sinica

(KUN-L), and Lichen section of Herbarium of Mycology, Academia Sinica (HMAS-

L). A dissecting microscope (Motic SMZ-140) and a light microscope (Motic B2) were

used for the morphological and anatomical studies. A microtome was routinely used for

frozen sections. Photographs were taken with BX51 fluorescence microscope.

484 ... Liu & al.

New records

Leptogium austroamericanum (Malme) C.W. Dodge, Ann. Mo. Bot. Gdn 20: 419

(1933) Fie. 1A-B

THALLUS foliose, 3-8 cm in diam; UPPER SURFACE grey-blue when dry, with

distinct wrinkles, somewhat shiny; LoBEs orbicular, spreading to erect, 4-10

mm broad, the margin entire to irregularly dentate to isidiate; Is1D1A terete,

simple, laminal to marginal, dense, crowded; LOWER SURFACE Similar to upper

surface.

THALLuS 100-150 um thick when moist, with single-layered cortex on

both sides; UPPER CORTEX cells 3-5 um in diam.; LOWER CORTEX cells 4-7 um

in diam.; PHOTOBIONT Nostoc in chains, spherical, 5-6 um in diam.; hyphae

irregularly interwoven.

APOTHECIA not seen.

Corticolous or muscicolous.

SPECIMENS EXAMINED: CHINA. ZHEJIANG PROVINCE, Mt. Jiulongshan, alt. 570 m, on

moss, 28 Apr. 1987, S.F. Chen Z0193 (NNU); GUANGXI PROVINCE, Longsheng County,

on bark, 21 Aug. 1964, M. Zang 776 (NNU); GUANGDONG PROVINCE, Nanxiong

City, alt. 700 m, on moss, 12 May 1978, A.T. Liu 780087 (NNU); YUNNAN PROVINCE,

Yingjiang County, alt. 1200 m, on moss, 20 Jun. 1981, X.Y. Wang, X. Xiao & J.J. Su 3121

(HMAS-L: 031791).

REMARKS — Leptogium austroamericanum is muscicolous or corticolous in

montane forests from Southeast and Southwest China at elevations of 570-1200

m. It has been reported from North America, Australia, New Zealand, India,

and Taiwan (Sierk 1964, Verdon 1990, Galloway 1999, Awasthi & Akhtar 1979,

Aptroot et al. 2002). It is new to mainland China.

Our materials, while similar to those reported in North America in

morphology and anatomy, have thinner lobes (100-250(-300) um in North

America). They are also similar to those reported in Australia, but the latter

often have squamuliform isidia that were not found in our materials. The

materials in New Zealand have isidia granular at first, then become terete and

simple, and are coralloid-branched when mature, while in our materials the

isidia are always terete and simple. Our materials also differ from those found

in India in having larger thalli (1.5-3 cm in India), thicker lobes (60-150 um

in India), and different isidia (terete and simple to branched and squamuliform

in India).

Fic. 1. Leptogium austroamericanum (M. Zang 776, NNU). A. Thallus with isidia. B. Thallus

cross-section, showing corticated surfaces. Leptogium javanicum (L.S. Wang 05-24176, KUN-L).

C. Thallus with apothecia. D. Thallus cross-section, showing corticated surfaces. E. Apothecial

cross-section. F. Vertical section of the central apothecium. G. Ascus with 8 ascospores. Scale bars:

A, C= 1 cm; B, D-F = 100 um; G = 50 um.

Leptogium spp. new to China... 485

486 ... Liu & al.

The species is similar to L. cyanescens in the colour of the thallus, numerous

simple isidia, and rare apothecia. However, in L. cyanescens the thallus is

smooth, not wrinkled. Another closely related species, L. propaguliferum,

produces flattened phyllidia instead of terete isidia.

Leptogium javanicum Mont., Syll. Gen. Sp. Crypt.: 379 (1856) Fic. 1C-G

THALLUuS 4-7 cm in diam., foliose, outline irregular, crisp; UPPER SURFACE

grey-blue when dry, glabrous, smooth, slightly roughened to striate, without

wrinkles, dull; Lopes 3-5 mm broad, often suberect, the margin wavy, entire

to irregularly lacerate, upturned or downturned; 1stp14 and LOBULES absent;

LOWER SURFACE similar to the upper surface, but with sparse, brown to blackish,

1.5-3.0 mm long rhizines. APOTHECIA abundant, dense, laminal to marginal,

1-3 mm in diam., distinctly stalked, at the apex of dome-shaped, vertically

furrowed (when dry) lobes; pisc plane to concave, red-brown; THALLINE

EXCIPLE glabrous, concolorous with the thallus.

THALLuS 20-50 um thick; coRTEX cells on both sides consisting of a single

layer of globular, isodiametrical cells, 5-8 um in diam.; PHOTOBIONT Nostoc in

chains, spherical, 4-6 um in diam.; HYPHAE irregularly interwoven.

APOTHECIA 300-350 um thick; THALLINE EXCIPLE euparaplectenchymatous,

50-100 um at margin, consisting of 4-6 layers of subglobose to ellipsoid

cells; LOWER CORTEX below the apothecium 100-150 wum_ thick,

euparaplectenchymatous, consisting of 7-8 layers of subglobose to ellipsoid,

thin-walled cells; PROPER EXCIPLE not seen; HYMENIUM cir. 130 um high;

SUBHYMENIUM 20-30 um high; ascus clavate, 100-120 x 15-25 um, with

8 ascospores; Ascospores submuriform, ellipsoid, 10-20 x 8-12 um, 3-5

septate transversely, 1 septate longitudinally, obtuse to slightly acute at both

ends.

Corticolous.

SPECIMENS EXAMINED: CHINA. YUNNAN PROVINCE, Pu’er City, alt. 1420 m, 18 Jan.

2005, L.S. Wang 05-24176 (KUN-L), 05-24195 (KUN-L); Menghai County, 11 Oct.

1974, X.J. Li 487 (KUN-L 3558).

REMARKS — Leptogium javanicum is corticolous in montane forests in Yunnan,

Southwest China, at an elevation of about 1400 m. It has been reported in India

(Awasthi & Akhtar 1979), Nepal, the Galapagos Islands, (Bungartz 2008), and

Australia (Verdon 1992). It is new to China.

The Chinese materials are similar to those reported in the Galapagos, but

with smaller ascospores (22-30 x 10-15 um in the Galapagos), less wrinkled

upper surface and furrowed apothecial stalks. It is also similar to those reported

in Australia (Verdon 1992) in having furrowed, hollow stalks that attach to the

upper apothecial margins, but our materials have smaller ascospores (25-35

Leptogium spp. new to China... 487

x 13-15 um in Australia) and less-wrinkled and thinner thalli (60-120 um in

Australia).

Leptogium javanicum can be readily recognized by its apothecia at the apex

of the dome-shaped lobes and its suberect lobes. It also somewhat resembles

L. verrucosum with respect to the thallus colour and poorly developed proper

exciple. However, L. verrucosum has larger ascospores (15-32 x 6-12 um) and

a warty thallus owing to the presence of numerous pycnidia.

Leptogium sessile Vain., Ann. Acad. Sci. Fenn., Ser. A 6(7): 108 (1915) Fic. 2

THALLUS 2-6 cm in diam., foliose; UPPER SURFACE grey-blue when dry,

with distinct wrinkles, shiny; LoBEs orbicular, 5-10 mm broad, the margin

entire and downturned; Istp1a absent; LOWER SURFACE similar to upper

surface. APOTHECIA common, + dense, laminal to submarginal, sessile, 1-2

mm in diam.; pisc plane to concave, red-brown; THALLINE EXCIPLE wrinkled,

concolorous with the thallus.

THALLUuS 170-450 um thick; coRTEX cells on both sides consisting ofa single

layer of globular, isodiametrical cells, 4-5 um in diam.; PHOTOBIONT Nostoc in

chains, spherical, 4-6 um in diam.; HYPHAE irregularly interwoven.

APOTHECIA 550-700 um thick; THALLINE EXCIPLE 4-5 um thick at margin,

consisting of a single-layered, thin-walled, subglobose cells, 4-5 um in diam.,

and an algal layer with loosely to somewhat densely interwoven hyphae; PROPER

EXCIPLE euparaplectenchymatous, 70-120 um thick; HYMENIUM 175-225 um

high; sUBHYMENIUM 50-70 um high; ascus clavate, 100-125 x 10-15 um;

Ascosporgs 8 per ascus, submuriform to muriform, ellipsoidal, 25-35 x 8-13

um, 3-7 septate transversely, 1-2 septate longitudinally.

Corticolous.

SPECIMENS EXAMINED: CHINA. ANHUI PROVINCE, Mt. Huangshan, on bark, 7 Sept.

1974, J.N. Wu & T. Xiang, 740078 (NNU); YUNNAN PROVINCE, Lvchun County, on

moss, 15 May. 1975, XJ. Li, 74-1724 (KUN-L); Ruili City, on bark, 30 Nov. 1980, Y.M.

Jiang, 587-2 (HMAS-L 031787); Weixi County, alt. 2100 m, on bark, 13 July. 1981, X.Y.

Wang, X. Xiao & J.J. Su, 3699 (HMAS-L 031771).

REMARKS — Leptogium sessile is mainly corticolous in montane forests of

Southwest and Southeast China. This species has been reported from North

America and Taiwan (Sierk 1964, Aptroot et al. 2002). It is new to mainland

China.

Our materials are similar to those reported in North America, but with

somewhat thinner lobes (300-500 um thick in North America), and narrower

ascospores (23-35 x 12-16 um in North America). Although the North American

materials have ascospores with 0-2 longitudinal septa (Sierk 1964), no such septa

were found in our materials from China.

Leptogium spp. new to China... 489

Leptogium sessile resembles L. corticola in having a distinctly wrinkled upper

surface, sessile apothecia, and an euparaplectenchymatous proper exciple.

However, L. sessile can be separated by its larger ascospores (16-26 x 10-13 um

in L. corticola) and downturned lobe margins.

Key to the non-hairy Leptogium species in mainland China

Thallus dark brownish black, often with a reddish tinge.............. L. plicatile

Whallitsere year Ble: os oi on cote baci aie te ete, PY ernie ete Sate hs Neer eAlerts Sk 2

DEUS A STATA: xy aM Ree, ts, lst, hel» Bein wliecl » beesEh pat eet 9 eee Oy arnt» at 3

a Dee OFTESe ake) MIs CaN: Ph AMINE TORR MIE EEA DE On” SLUR), NEVO SURE TOU? SON YOR), SER SRC Rae (RO 5

Stay AE TCA Ly oo Si ae soe 5 deere 9 ne hE ere, PM iene, OS rene cen ht Nid d teNlgn, ble A

Isidia SquammulifOrint:. wi seoa ci 26.0% woot spe ols aie old iat iat L. denticulatum

Thallus pale to dark grayish blue to olive green; isidia granular-furfuraceous,

cylindrical to clavate to lobulate, often branched................. L. cyanescens

Thallus grey-blue; isidia terete, simple................... L. austroamericanum

Pirablerse Stine tly -we RMT Le 5 ef ne ty Sakina toy Reel ay lay afta bead! wAanade ote wide 6

Thallussmoboth-to'sliohtly roushened sc eed, ae kek are hes need ae ae nalgoaa hes 8

Thallus with erect to semi-erect lobes, sometimes forming a dense

CerV/a tou PANNE A AMET a ARE OLRM ch RE On, FAN REM TO, STOR ane cto Raed L. lichenoides

Thallus with numerous, overlapping lobes forms elegant, spreading patches ....7

Lobes distinctly thicker (170-450 um) ........ 02. eee eee eee eee L. sessile

Lobes thinneri(1O0=1S0: pint): oe 2a ns tan in ate te hee L. cochleatum

Apothecia distinctly stalked, at the apex of dome-shaped, vertically furrowed

Gultencd iy) TOROS. o nakee woe ees we low es alec y Mee tice o aigkage v eeioas ¥ eeaee BAe L. javanicum

Apothecia:sessilewot shortly-stipitate occ 2 22a 8 ein chs Sete, te Sele tie Nese lnc nog win tah le 9

Spores larger (25740 % TORTS WIV) he chee ed niin aiiied beatae grew L. subazureum

Spores simalleri(h6=25 x GSPN), eek it ee NE OE PL oe RT oe BEE 2 10

Thallus grey to lead grey, lobes 40-60 um thick................ L. moluccanum

Thallus blue to blue-grey, lobes 50-100 um thick .................. L. azureum

Fic. 2. Leptogium sessile (HMAS-L: 031771). A. Thallus with apothecia. B. Thallus cross-section,

showing corticated surfaces. C. Hymenium with asci. D. Vertical section of the central apothecium

showing euparaplectenchymatous proper exciple with medulla below. E. Thalline margin, showing

euparaplectenchymatous proper exciple and thalline exciple. F Apothecial cross-section. G. Ascus

with 8 ascospores. Scale bars: A = 1 cm; B-F = 100 um; G = 10 um.

A490 ... Liu & al.

Acknowledgements

This study was supported by National Natural Science Foundation of China (31093440,

31000239) and Natural Science Foundation of Hebei Province (C2010000268). The

authors are indebted to Prof. Per M. Jorgensen (University of Bergen) for his kind help

in the identification of Leptogium javanicum. Thanks go to Prof. Jiang-Chun Wei and

Ms. Hong Deng (Institute of Microbiology, Chinese Academy of Sciences), and Mr. Li-

Song Wang (Kunming Institute of Botany, Chinese Academy of Sciences) for sending the

specimens on loan. Thanks go to both Profs. Jae-Seoun Hur (Korean Lichen Research

Institute, Sunchon National University) and Zun-tian Zhao (College of Life Sciences,

Shandong Normal University) for reading and improving the manuscript and for acting

as presubmission reviewers.

Literature cited

Aptroot A, Sparrius LB, Lai MJ. 2002. New Taiwan macrolichens. Mycotaxon 84: 281-292.

Awasthi DD, Akhtar P. 1979. The lichen genus Leptogium (sects. Leptogium, Leptogiopsis and

Homodium) in India. Geophytology 8(2): 189-204.

Bungartz F. 2008. Cyanolichens of the Galapagos Islands - the genera Collema and Leptogium.

Sauteria 15: 139-158.

Galloway DJ. 1999. Notes on the lichen genus Leptogium (Collemataceae, Ascomycota) in New

Zealand. Nova Hedwigia 69(3-4): 317-355.

Kirk PM, Cannon PF, Minter DW, Stalpers JA (eds). 2008. Ainsworth & Bisby’s dictionary of the

fungi. 10th edition. CAB International, Wallingford Oxon. 771 p.

Liu HJ, Guan S. 2012. A new hairy species of Leptogium (Collemataceae) from China. Mycotaxon

119: 413-417. http://dx.doi.org/10.5248/119.413.

Sierk HA. 1964. The genus Leptogium in North America, north of Mexico. Bryologist 67: 245-317.

Verdon D. 1990. New Australasian species and records in the genus Leptogium S. Gray (lichenized

Ascomycotina: Collemataceae). Mycotaxon 37: 413-440.

Verdon D. 1992. Leptogium. Flora of Australia 54: 173-192.

Wang HY, Ren Q, Li HM, Wang HY, Zhao ZT. 2010. Five lichens of Leptogium new to China.

Mycotaxon 111: 161-166. http://dx.doi.org/10.5248/111.161

Wei JC. 1991. An enumeration of lichens in China. International Academic Publishers, Beijing,

China. 278 p.

MYCOTAXON

http://dx.doi.org/10.5248/122.491

Volume 122, pp. 491 October-December 2012

Regional annotated mycobiotas new to the Mycotaxon website

ABSTRACT — MycorTaxon is pleased to announce another new species distribution list to

our ‘weblist’ page. The “Checklist of the Argentine Agaricales 5. Agaricaceae” by Niveiro &

Albert6 brings to 100 the free access mycobiotas now available through the MycoTaxon

webpage <http://www.mycotaxon.com/resources/weblists.html>.

SOUTH AMERICA

Argentina

N. Niveiro & E. Alberté. Checklist of the Argentine Agaricales 5. Agaricaceae. 25 pp.

Axsstract — A checklist of species belonging to the family Agaricaceae

(Agaricomycetes) in Argentina is provided. The list includes all species published up

to 2011. Of the 13 genera and 171 species represented, Agaricus and Lepiota have

the greatest number of species names recorded (85 and 37 respectively) followed by

Leucoagaricus (13 species), Leucocoprinus (8) Cystolepiota (7), Macrolepiota (7), and

Cystoderma (4). The remaining genera — Cystoagaricus, Micropsalliota, Chlorophyllum,

Cystodermella, Pheolepiota — are represented by fewer than 3 species each.

MYCOTAXON

http://dx.doi.org/10.5248/122.493

Volume 122, pp. 493-494 Ooctober-November 2012

NOMENCLATURAL NOVELTIES AND TYPIFICATIONS

PROPOSED IN MYCOTAXON 122

Agaricus murinocephalus R.L. Zhao, Desjardin & K.D. Hyde, p. 189

Arthrinium rasikravindrii Shiv M. Singh, L.S. Yadav, P.N. Singh,

Rahul Sharma & S.K. Singh, p. 452

Boletus atlanticus Blanco-Dios & G. Marques, p. 326

Calonectria nymphaeae Yong Wang bis, S.Y. Qin, P. Tan & K.D. Hyde, p. 181

Caloplaca gyrophorica Jagadeesh, Y. Joshi & G.P. Sinha, p. 304

Clitopilus ravus W.Q. Deng & T.H. Li, p. 444

Coccomyces hubeiensis Y.R. Lin & M.S. Yang, p. 250

Coccomyces ilicis S.J. Wang & Y.R. Lin, p. 288

Coltricia australica L.W. Zhou, Tedersoo & Y.C. Dai, p. 124

Craterellus atratus (Corner) Yomyart, Watling, Phosri,

Piapukiew & Sihan., p. 414

Dendrodontia bispora (Burds. & Nakasone) Guerrero

& C.L.M. Rodrigues, p. 8

Dendrothele syspora C.L.M. Rodrigues & Guerrero, p. 18

Ellisembia heritierae S.C. Ren & X.G. Zhang, p. 83

Ellisembia pistaciae S.C. Ren & X.G. Zhang, p. 85

Exosporium acrocomiae (J.A. Stev.) Chupp ex J.A. Stev. 1975

(lectotypified), p. 62

Geastrum campestre var. famatinum Kuhar & Papinutti, p. 149

Humicola chlamydospora Y.M. Wu & 'T.Y. Zhang, p. 171

Humicola tuberculata Y.M. Wu & T.Y. Zhang, p. 173

Humicola verruculosa Y.M. Wu & T.Y. Zhang, p. 174

Hymenochaete parmastoi S.H. He & Hai J. Li, p. 198

Hypoderma mirabile Y.R. Lin & C.T. Zheng, p. 226

Hypoxylon dengii H.X. Ma, Lar.N. Vassiljeva & Yu Li, p. 2

Lasioderma flavovirens Durieu & Mont. 1845

(lectotypified, epitypified), p. 404

Meliola centellae Pinho & O.L. Pereira, p. 339

Minimelanolocus manifestus Hern.-Rest., R.F. Castafieda, Gené & Guarro, p. 137

Mycena acanthophila J.C. Zamora & Catala, p. 362

494 ... MYCOTAXON 122

Passalora acrocomiae Guatimosim & R.W. Barreto, p. 64

Polyporus submelanopus H.J. Xue & L.W. Zhou, p. 436

Puccinia artemisiae-chamaemelifoliae Aliabadi & M. Abbasi, p. 130

Puccinia crepidis-asadbarensis Aliabadi & M. Abbasi, p. 131

Puccinia jaceae var. elbursensis Aliabadi & M. Abbasi, p. 132

Puccinia punctiformis var. karajensis Aliabadi & M. Abbasi, p.133

Scopinella pyramidospora R.M. Sanchez, L. Giord., F Anderson

& Bianchin., p. 266

Stigmella lycii X.R. Chen & Yan Wang, p. 70

Talaromyces flavovirens (Durieu & Mont.) Visagie, Llimona

& Seifert, p. 404

Terriera angularis Y.R. Lin, F. Zhou & Xiao Y. Wang, p. 356

Ticosynnema R.F. Castaneda, Granados & Mardones, p. 255

Ticosynnema carranzae R.F. Castafieda, Granados & Mardones, p. 256

Tuber huizeanum L. Fan & Yu Li, p. 166

Tuber microverrucosum L. Fan & C.L. Hou, p. 165

Tuber sinoaestivum J.P. Zhang & P.G. Liu, p. 75

Tuber sinosphaerosporum L. Fan, J.Z. Cao & Yu Li, p. 350

Vermiculariopsiella pediculata (J.L. Cunn.) Hern.-Rest., R.E. Castafieda,

Gené & Guarro, p. 138