Volume 11 Number 1 3 February 2023

The Taxonomic Report

OF THE INTERNATIONAL LEPIDOPTERA SURVEY

ISSN 2643-4776 (print) / ISSN 2643-4806 (online)

Additional taxonomic refinements suggested by

genomic analysis of butterflies

Jing Zhang'*°, Qian Cong'*, Jinhui Shen'’, Leina Song'’, Paul A. Opler’, and Nick V. Grishin!”

Departments of 'Biophysics, 7Biochemistry, and 7Eugene McDermott Center For Human Growth & Development, University

of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390-9050, USA; *Department of Agricultural

Biology, Colorado State University, Fort Collins, CO 80523-1177, USA; “Corresponding author: grishin@chop.swmed.edu

ABSTRACT. Comparative analyses of genomic data reveal further insights into the phylogeny and taxonomic

classification of butterflies presented here. As a result, 2 new subgenera and 2 new species of Hesperiidae are described: Borna

Grishin, subgen. n. (type species Godmania borincona Watson, 1937) and Lilla Grishin, subgen. n. (type species Choranthus

lilliae Bell, 1931) of Choranthus Scudder, 1872, Cecropterus (Murgaria) markwalkeri Grishin, sp. n. (type locality in Mexico:

Sonora), and Hedone yunga Grishin, sp. n. (type locality in Bolivia: Yungas, La Paz). The lectotype is designated for Aethilla

toxeus Plotz, 1882. The type locality of Dion uza (Hewitson, 1877) is likely in southern Brazil. A number of taxonomic

changes are proposed. The following taxa are subgenera, not genera: Plebulina Nabokov, 1945 of Icaricia Nabokov, 1945;

Sinia Forster, 1940 of Glaucopsyche Scudder, 1872; Pseudophilotes Beuret, 1958 of Palaeophilotes Forster, 1938; and

Agraulis Boisduval & Le Conte, [1835] of Dione Hubner, [1819]. Asbolis Mabille, 1904 is a subgenus of Choranthus Scudder,

1872 rather than its synonym. The following are species, not subspecies or synonyms: Glaucopsyche algirica (Heyne, 1895)

(not Glaucopsyche melanops (Boisduval, 1829)), Chlosyne flavula (W. Barnes & McDunnough, 1918) (not Chlosyne palla

(Boisduval, 1852)), Cercyonis hypoleuca Hawks & J. Emmel, 1998 (not Cercyonis sthenele (Boisduval, 1852)), Cecropterus

coyote (Skinner, 1892) and Cecropterus nigrociliata (Mabille & Boullet, 1912) (not Aethilla toxeus Plotz, 1882), Aguna malia

Evans, 1952 (not Aguna megaeles (Mabille, 1888)), Polygonus arizonensis (Skinner, 1911), Polygonus histrio Rober, 1925,

Polygonus pallida Rober, 1925, and Polygonus hagar Evans, 1952 (not Polygonus leo (Gmelin, [1790])), Viola kuma (Bell,

1942), comb. nov. (not Pachyneuria helena (Hayward, 1939)), Tamela maura (Snellen, 1886) (not Tamela_ othonias

(Hewitson, 1878)), Tamela diocles (Moore, [1866]) (not Tamela nigrita (Latreille, [1824])), Vinius phellus (Mabille, 1883)

(not Vinius exilis (Pl6tz, 1883)), Vinius sophistes (Dyar, 1918) (not Vinius tryhana (Kaye, 1914)), and Rhinthon andricus

(Mabille, 1895) and Rhinthon aqua (Evans, 1955) (not Rhinthon braesia (Hewitson, 1867)). The following are new and revised

species-subspecies combinations: Cercyonis sthenele damei W. Barnes & Benjamin, 1926 (not Cercyonis meadii (W. H.

Edwards, 1872)) and Chlosyne flavula blackmorei Pelham, 2008 and Chlosyne flavula calydon (W. Holland, 1931) (not

Chlosyne palla). The following are valid subspecies resurrected from synonymy in new and reinstated species-subspecies

combinations: Chlosyne palla pola (Boisduval, 1869) (not Chlosyne gabbii gabbii (Behr, 1863)) and Cercyonis meadii

mexicana R. Chermock, 1949 (not Cercyonis sthenele damei W. Barnes & Benjamin, 1926, comb. rev.). The following are

new junior subjective synonyms: Aethilla toxeus Pl6tz, 1882 of Cecropterus albociliatus (Mabille, 1877) and Viola dagamba

Steinhauser, 1989 of Viola kuma (Bell, 1942), comb. nov., stat. rest. Leucochitonea janice Ehrmann, 1907 is a junior

subjective synonym of Heliopetes alana (Reakirt, 1868) and not of Heliopetes petrus (Hubner, [1819]). The holotype of

Hermeuptychia sinuosa Grishin, 2021 is illustrated after being spread.

Keywords: taxonomy, classification, genomics, phylogeny, biodiversity.

ZooBank registration: http://zoobank.org/0782F3E3-1EC3-4CB5-B548-1F9DCF6C7917

This report is a direct continuation of our previous publications (Zhang et al. 2019, 2020, 2021, 2022a,

2022b, 2022c), and the general philosophy employed is best summarized in the introduction to Zhang et

al. (2023). Details of experimental and computational protocols are provided in the Appendix to Li et al.

(2019). We sequence specimens of any age, with collection year specified in illustrated trees, “old” means

that the specimen comes from old collections, and no date is given on its labels, probably collected more

than 100 years ago, around the turn of the 20" century (most specimens) or before. Phylogenetic tree

construction was carried out as described in the Materials and Methods section by Zhang et al. (2022a).

For each set of specimens, we illustrate at least two trees: constructed from nuclear genomic

regions (either Z chromosome or autosomes) and from the mitogenome DNA. While the two trees

frequently agree, we see instances of confident (i.e., with strong statistical support and therefore unlikely

caused by insufficient or internally inconsistent data) incongruence between nuclear and mitochondrial

genomic trees. Comparing the two trees highlights the pitfalls of relying exclusively on mitochondrial

DNA (and COI barcodes alone) in classification decisions. Even more, including a larger fraction of

mitochondrial genes in a gene marker set used in the PCR amplification approach may bias the tree

toward a mitogenomic signal and thus deviate from the nuclear DNA evolution scenario. In some cases,

we show all three trees: autosomes, Z chromosome, and mitogenome. Their comparison may be most

instructive for the analysis of evolutionary peculiarities.

It is important to note that we do not use specific gene markers. We sequence the whole genomic

shotgun and assemble all protein-coding genes present in the sample by mapping them to a complete set

of genes from a reference genome. This representation gives an unbiased view of the genomic content of

an organism. For computing efficiency, the trees are constructed from a random sample of 100,000

codons (3 bp each) from the entire gene set, which is approximately 6 million codons. Statistical support

is computed on 100 random samples of 10,000 codons each from the original pool of genes. All protein-

coding genes are used in mitochondrial DNA trees, and their statistical support is computed using

ultrafast bootstrap (Hoang et al. 2018).

In addition to phenotypic diagnoses of new taxa, we provide diagnostic DNA characters, both in

the nuclear genome and COI barcode. DNA characters are found in nuclear protein-coding regions using

our previously developed procedure (see SI Appendix to Li et al. 2019). The logic behind the character

selection was detailed in Cong et al. (2019b). The character states are provided in species diagnoses as

abbreviations. E.g., aly728.44.1:G672C means position 672 in exon | of gene 44 from scaffold 728 of the

Cecropterus lyciades (Geyer, 1832) (formerly in Achalarus Scudder, 1872, thus aly) reference genome

(Shen et al. 2017) is C, changed from G in the ancestor. When characters are given for the sister clade of

the diagnosed taxon, the following notation is used: aly5294.20.2:A548A (not C), which means that

position 548 in exon 2 of gene 20 on scaffold 5294 is occupied by the ancestral base pair A, which was

changed to C in the sister clade (so it is not C in the diagnosed taxon). The same notation is used for COI

barcode characters, but without a prefix ending with ‘:’. The sequences of exons from the reference

genome with the positions used as character states highlighted in green are in the supplemental file

deposited at < https://osf.io/nxd5y// >. Linking to these DNA sequences from this publication ensures that

the numbers given in the diagnoses can be readily associated with actual sequences. Whole genome

shotgun datasets we obtained and used in this work are available from the NCBI database

< https://www.ncbi.nlm.nih.gov/ > as BioProject PRJNA927657, and BioSample entries of the project

contain the locality and other collection data of the sequenced specimens shown in the trees. COI barcode

sequences have been deposited in GenBank with accessions O0Q311404—0Q311413. Several photographs

shown in this work are taken from iNaturalist (2022). Links to observations by observation number

reported in figure legends are < https://www. inaturalist.org/observations/xxx >, where xxx 1s the number.

Family Lycaenidae [Leach], [1815]

Plebulina Nabokov, 1945 is a subgenus of [caricia Nabokov, 1945

Genomic sequencing and comparison of the crown group of Polyommatina Swainson, 1827 with a focus

on species found in North America, confirm that the monotypic genus Plebulina Nabokov, 1945 (type

species Lycaena emigdionis F. Grinnell, 1905) is closely related to Icaricia Nabokov, 1945 (type species

Lycaena icarioides Boisduval, 1852) (Fig. la—c). In their pioneering work, Talavera et al. (2012)

proposed to treat Plebulina as a distinct genus because in their time-calibrated tree constructed from

several gene markers, Plebulina was at a larger distance from Icaricia than their (somewhat flexible)

cutoff for congeneric relationship.

a_ nuclear (autosome) tree

7 Wearicia (Icaricia) neurona|18014D01|USA:CA,Los Angeles Co.|1981

; Icaricia (Icaricia) acmon|PAO78|USA:CA, Sierra Co.|2016

glgaricia (Icaricia) lupini lupini|PAO75|USA:CA,Plumas Co.|2016 4

Icaricia (Icaricia) cotundra|19083EQ05|HT|USA:CO,Park Co.|1968 *

Icaricia (Icaricia) shasta pitkinensis|PAO161|USA:CO,Clear Creek Co.|2016

Icaricia (Icaricia) icarioides pembina|6351|USA:CO, Summit Co.|2016

Icaricia (Icaricia) saepiolus|PAO50|USA:CA, Placer Co.|2016

Icaricia (Plebulina) emigdionis [Plebulina emigdionis]|6697|USA:CA,LA Co.|2000

Agriades (Agriades) luana|20124A01|China|2007

Agriades (Agriades) pyrenaica ergane|20071H11|Ukraine|2010

Agriades (Agriades) glandon rustica|6409|USA:CO,Grand Co,.|2016 —

Agriades (Agriades) podarce podarce|PAO94|USA:CA, Sierra Co.|2016 Icaricia emigdionis»

; Agriades (Albulina) optilete|20061H05|Denmark|1940 7 me

Agriades (Albulina) optilete yukona|16107C04|Canada:Yukon|2016_— ’ .

Rueckbeilia fergana|22037H10|Tajikistan|1963 ._ 2

Rueckbeilia fergana|22037H11|"Tura"|old

Plebejus (Plebejus) argus|20066H02|Sweden|1995

Plebejus (Lycaeides) idas alaskensis|16107B12|Canada:Yukon|2016

> blebejus (Lycaeides) anna anna|PAO455|USA:CA, Plumas Co.|2017

5 ab lebejus (Lycaeides) fridayi|17114G12|USA:CA, Alpine Co.|2009

> plebejus (Lycaeides) melissa melissa|6544|USA:CO,Park Co.|2016

Plebejus (Lycaeides) samuelis|7627|USA:NY,Albany Co.|1963

Patricius felicis|22037HO8|Chinalold

Cyaniris semiargus|20058E 12|Russia:South Ural|2020

Aricia agestis]21015A05|India: Uttar Pradesh|1961

Polyommatus icarus|PAOE03|France|2017

Freyeria trochylus|20064E02|Tajikistan|2001

Freyeria trochylus|20064E03|Tajikistan|2001

0.01

Rueckbeilia fergana

b Zchromosome tree C mitochondrial genome tree

> dcaricia (Icaricia) neurona|18014D01|USA:CA,Los Angeles Co.|1981

, }caricia (Icaricia) lupini lupini[PAO75|USA:CA,Plumas Co.|2016 __

ae > caricia (Icaricia) acmon|PAO78|USA:CA, Sierra Co.|2016 0.02

: Icaricia (Icaricia) cotundra|19083E05|HT|USA:CO,Park Co.|1968

1 Icaricia (Icaricia) shasta pitkinensis|PAO161|USA:CO,Clear Creek Co.|2016

Icaricia (Icaricia) icarioides pembina|6351|USA:CO, Summit Co.|2016

Icaricia (Icaricia) saepiolus|PAOQ50|USA:CA, Placer Co.|2016

Icaricia (Plebulina) emigdionis[Plebulina emigdionis]|6697|USA:CA,LA Co.|2000

Agriades (Agriades) luana|20124A01|China|2007

Agriades (Agriades) pyrenaica ergane|20071H11|Ukraine|2010

; Agriades (Agriades) glandon rustica]6409|USA:CO,Grand Co.|2016

“ie Agriades (Agriades) podarce podarce|PAO94|USA:CA, Sierra Co.|2016

; Agriades (Albulina) optilete|20061HO5|Denmark|1940

Agriades (Albulina) optilete yukona|16107C04|Canada:Yukon|2016

1 ; Rueckbeilia fergana|22037H10|Tajikistan|1963

Rueckbeilia fergana|22037H11|"Tura"|old

Plebejus (Plebejus) argus|20066H02|Sweden|1995

1 Plebejus (Lycaeides) idas alaskensis|16107B12|Canada:Yukon|2016

ip plebejus (Lycaeides) anna anna|PAO455|USA:CA,Plumas Co.|2017

1 ; Plebejus (Lycaeides) fridayi]/17114G12|USA:CA, Alpine Co.|2009

,Plebejus (Lycaeides) melissa melissa|6544|USA:CO,Park Co.|2016

Plebejus (Lycaeides) samuelis|7627|USA:NY,Albany Co.|1963

Patricius felicis|22037H0O8|Chinalold

: Cyaniris semiargus|20058E12|Russia:South Ural|2020

" Aricia agestis|21015A05|India:Uttar Pradesh|1961

Polyommatus icarus|PAOE03|France|2017

, Freyeria trochylus|20064E02|Tajikistan|2001

Freyeria trochylus|20064E03|Tajikistan|2001

Icaricia (Icaricia) neurona|18014D01|USA:CA,Los Angeles Co.

ogcaricia (Icaricia) lupini lupini/PAO75|USA:CA,Plumas Co.

golcaricia (Icaricia) cotundra|19083E05|HT|USA:CO,Park Co.

Icaricia (Icaricia) acmon|PAO78|USA:CA, Sierra Co.|2016

Icaricia (Icaricia) icarioides pembina|6351|USA:CO,Summit Co.

Icaricia (Icaricia) shasta pitkinensis|PAO161|USA:CO,Clear Creek Co.

Icaricia (Icaricia) saepiolus|PAO50|USA:CA, Placer Co.|2016

Icaricia (Plebulina) emigdionis [Plebulina emigdionis]|6697

Agriades (Agriades) luana|20124A01|China|2007

Agriades (Agriades) pyrenaica ergane|20071H11|Ukraine

Agriades (Agriades) glandon rustica|6409|USA:CO,Grand Co.

Agriades (Agriades) podarce podarce|PAO94|USA:CA, Sierra Co.

wigriades (Albulina) optilete|20061H05|Denmark|1940

Agriades (Albulina) optilete yukona|16107C04|Canada: Yukon

Cyaniris semiargus|20058E12|Russia:South Ural|2020

Aricia agestis|21015A05|India:Uttar Pradesh|1961

Polyommatus icarus|PAOE03|France|2017

Go Rueckbeilia fergana|22037H11|"Tura"|old

Rueckbeilia fergana|22037H10|Tajikistan|1963

Plebejus (Plebejus) argus|20066H02|Sweden|1995

iPjebejus (Lycaeides) anna anna|PAO455|USA:CA,Plumas Co.

Plebejus (Lycaeides) fridayi|17114G12|USA:CA, Alpine Co.

'y? Plebejus (Lycaeides) idas alaskensis|16107B12|Canada:Yukon

ioplebejus (Lycaeides) melissa melissa|6544|USA:CO,Park Co.

Plebejus (Lycaeides) samuelis|7627|USA:NY,Albany Co.|1963

Patricius felicis|22037H08|China|old

Fpeyeria trochylus|20064E03|Tajikistan|2001

Freyeria trochylus|20064E02|Tajikistan|2001

100

Fig. 1. Plebulina as a subgenus of Jcaricia. a—c. Phylogenetic trees constructed from protein-coding regions in autosomes (a),

Z chromosome (b), and mitochondrial genome (c): /caricia (red, with Icaricia (Plebulina) emigdionis comb. nov. name shown

in magenta), Agriades (blue), Rueckbeilia (green), and Plebejus (purple). Magenta dots mark diversification nodes of genera

Icaricia, Agriades, and Plebejus. For each specimen, the name adopted in this work 1s given first, and a previously used name

is listed in square brackets (if different), supplemented with the DNA sample number, type status (HT holotype, LT lectotype,

NT neotype, ST syntype, PT paratype, and PLT paralectotype), general locality, and year. NCBI database entries in BioProject

PRJNA927657 give additional data about these specimens. Synonyms are given in parentheses preceded by “=”. The type

status refers to this synonym if the synonym name is provided. The same notations are used throughout this work in figures

showing phylogenetic trees. d—e. Live females of Jcaricia from USA: California, iNaturalist observations (data “obscured”): d.

I. (Plebulina) emigdionis 26900315 Kern Co., May-2007 © Nature Ali; e. 1. Ucaricia) neurona 53685349 Ventura Co., Jul-

2020 © Chris. Images are rotated and cropped. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/. f. Rueckbeilia

fergana 2 NVG-22037H11 “Tura”, B. Neumégen collection [USNM], dorsal (left) and ventral (right) views.

In our genome-level phylogeny that includes all known species of /caricia, the clade consisting of

Icaricia and Plebulina taken together is well separated from all others by a prominent branch (Fig. 1 red)

in both nuclear genome trees (autosomes Fig. la and Z chromosome Fig. 1b). However, /caricia 1s not

separated from Plebulina by a prominent branch, and the branch from the last common ancestor of

Icaricia + Plebulina to the last common ancestor of /caricia is shorter compared to the previous branch.

Furthermore, in the nuclear genome trees (Fig. la, b), the distance from the root to the last common

ancestor of Icaricia + Plebulina is larger than that to the last common ancestors of genera Agriades

Hiibner, [1819] (type species Papilio glandon de Prunner, 1798) (Fig. 1 blue) and Plebejus Kluk, 1780

(type species Papilio argus Linnaeus, 1758) (Fig. 1 purple) (nodes marked with magenta dots in Fig 1)

suggesting that the divergence between /caricia and Plebulina might have occurred more recently than

that within Agriades and Plebejus. Finally, the average distances from the leaves to the last common

ancestors of /caricia+ Plebulina, Agriades, and Plebejus are approximately the same, implying that

genetic differentiation in the nuclear genome is similar in the genera Agriades, Plebejus, and a group

consisting of both /caricia and Plebulina. Therefore, due to these genetic similarities and the phylogenetic

tree structure, we propose to treat Plebulina Nabokov, 1945, stat. nov. as a subgenus of Jcaricia

Nabokov, 1945. Plebulina and Icaricia were proposed as genera in the same work issued on the same

date. Being the first reviser, here we give precedence to /caricia because more species are currently

included in /caricia than monotypic Plebulina, resulting in fewer name changes.

Despite a number of morphological differences, including a unique caterpillar foodplant of

Plebulina (Nabokov 1945; Talavera et al. 2012; Ballmer 2022), phenotypic similarities between Plebulina

and /caricia are also notable. For instance, females of both species may have orange streaks along veins

on the dorsal forewing wing surface (Fig. Id, e). Furthermore, we hold an opinion that monotypic genera

(such as Plebulina) should be reserved for species without apparent close relatives. In the presence of

such relatives, it seems more instructive to indicate this relationship with the generic name. In contrast to

Plebulina, genomic analysis supports the distinctness of (nearly monotypic) Rueckbeilia Lukhtanov,

Talavera, Pierce & Vila, 2013 (type species Lycaena loewii var.? fergana Staudinger, 1881, Fig. If) (Fig.

1 green), because, while the statistical support for its placement in the same clade with Agriades and

Icaricia + Plebulina is strong in the Z chromosome tree (1, 1.e., 100%, Fig. 1b), it is not strongly

associated with either of the two genera (less than 0.5). Therefore, if Jcaricia and Agriades are treated as

distinct genera, Rueckbeilia would also be distinct.

Finally, we offer a hypothesis about why Plebulina was more distinct from Jcaricia in the

phylogeny obtained by Talavera et al. (2012) than in our nuclear genome trees. In the mitochondrial

genome tree (Fig. Ic), we observe this more distant relationship: the magenta dot for the red clade

Ucaricia + Plebulina) is closer to the root (left) and farther from the leaves (which are at about the same

level) than the magenta dots for the blue (Agriades) and purple (Plebejus) clades. Because a significant

number of base pairs in the gene markers used by Talavera et al. (2012) came from mitochondrial genes,

we suspect that these genes might have biased the branch lengths around Plebulina in their tree. The

evolution of mitochondrial genomes experiences irregularities such as introgression and may not represent

the organism as well as its nuclear genome. Therefore, we default to nuclear genome results (with an

emphasis on the Z chromosome) for taxonomic classification.

Sinia Forster, 1940 is a subgenus of Glaucopsyche Scudder, 1872

Sinia Forster, 1940 (type species Glaucopsyche (Sinia) leechi Forster, 1940) was originally proposed as a

subgenus of Glaucopsyche Scudder, 1872 (type species Polyommatus lygdamus E. Doubleday, 1841) that

also included Lycaena lanty Oberthiir, 1886 (type locality China: Sichuan Prov., Kangding) and Lycaena

divina Fixsen, 1887 (type locality in North Korea). Recently, Sinia has been treated as a valid genus

(Lukhtanov and Gagarina 2022). However, Lycaena divina has been segregated into a separate genus,

Shijimiaeoides Beuret, 1958 (type species Lycaena barine Leech, [1893], which is a synonym or

subspecies of L. divina). Based on the genomic comparison, we placed Shijimiaeoides as a junior

subjective synonym of Glaucopsyche (Zhang et al. 2022b). Here, we analyze genomic data on Sinia (Fig.

2 red) and find that it originates within Glaucopsyche (Fig. 2 blue), being sister to all others except the

subgenus Phaedrotes Scudder, 1876 (type species Lycaena catalina Reakirt, 1866, which is a junior

subjective synonym of Lycaena piasus Boisduval, 1852) in all three trees (Fig, 2a—c). Therefore, Sinia is a

subgenus unless Phaedrotes is treated as a genus. Hence, we propose to regard Sinia Forster, 1940 a

subgenus of Glaucopsyche Scudder, 1872 as originally described. We also note wing pattern similarities

between the type species of Sinia, G. leechi comb. rest. from China (Fig. 2d) and North American G.

piasus (Fig. 2e): e.g., in the placement of white “arrowheads” on the ventral hindwing.

a_ nuclear (autosome) tree Glaucopsyche

er Glaucopsyche (Glaucopsyche) lygdamus|16106E04|USA:MN,Lake Co,.|2016 piasus

0.4 Glaucopsyche (Glaucopsyche) lycormas|20061G06|Japan|1956

0: Glaucopsyche (Glaucopsyche) alexis|20058D08|Sweden|2007

arse Glaucopsyche (Glaucopsyche) paphos|22027H01|Cyprus|1931

1 Glaucopsyche (Glaucopsyche) divina|22027G10|Japan|1972

, Glaucopsyche (Apelles) melanops|22027HO2|France|1914

1 Glaucopsyche (Apelles) algerica [G. (A.) melanops algerica]|22027G12|Algeria|1928

5 Glaucopsyche (Sinia) lanty [Sinia lanty]]22027G03|China|1928

1 1 Glaucopsyche (Sinia) lanty [Sinia lanty]|22027G02|Chinal|old

Glaucopsyche (Sinia) leechi [Sinia leechi]|22027G01|PT|Chinal|old

Glaucopsyche (Phaedrotes) piasus daunia|9559|USA:UT,Davis Co.|2017

TEA Praephilotes anthracias|22027F07|Turkmenistan|1965

Scolitantides orion|20062A01|Bohemia|1958

Philotes sonorensis|17114F05|USA:CA, Tulare Co.|2015 ; -

lolana iolas|22027F08|Greece|1959 ; @

: Palaeophilotes (Pseudophilotes) baton [Pseudophilotes (P.) baton|22028A12|Germany|1975

0.94 1 Palaeophilotes (Pseudophilotes) sinaicus [Pseudophilotes (P.) s.]|22028A10|PT|Egypt:Sinai|1974

1 Palaeophilotes (Palaeophilotes) triphysina [Palaeophilotes t.]|22028B12|Kazakhstan|1913

Palaeophilotes (Rubrapterus) bavius [Pseudophilotes (Rubrapterus) b.]|22028B07|Macedonia|1956

D.96

Turanana cytis|22027F01|Afghanistan|1963 :

' a Turanana anisophtalma|22028B08|Iran|old Glaucopsyche leechi

tame O68 Turanana ariana|22027F03|Afghanistan|1973

1 Turanana panaegides|22028C04|Central Asia|old

Turanana panagaea|22028C05|Central Asia|old

. Phengaris arion|20061G10|Bohemia|1957

! 1 Phengaris alcon|22028C12|Italy|1972

Caerulea coelestis|22027F11|China|1935

; Euphilotes (Euphilotes) enoptes|PAO65|USA:CA, Sierra Co.|2016

Euphilotes (Euphilotes) bernardino|PAQ378|USA:CA,San Benito Co.|2017

Euphilotes (Euphilotes) rita]7628|USA:TX,Brewster Co.|1971

Euphilotes (Philotiella) speciosa|6698|USA:CA, Imperial Co.|2013

0.007

b Zchromosome tree C_ mitochondrial genome tree

lcm

- Glaucopsyche (Glaucopsyche) lygdamus|16106E04|USA:MN,Lake Co.|2016 Glaucopsyche (Glaucopsyche) lygdamus|16106E04

‘ Glaucopsyche (Glaucopsyche) lycormas|20061G06|Japan|1956 ‘oo Glaucopsyche (Glaucopsyche) lycormas|20061G06

0.007 oa > Glaucopsyche (Glaucopsyche) alexis|20058D08|Sweden|2007 0.02 100 Glaucopsyche (Glaucopsyche) divina|22027G10

0.7% Glaucopsyche (Glaucopsyche) paphos|22027H01|Cyprus|1931 ¥ Glaucopsyche (Glaucopsyche) paphos|22027H01

- ; Glaucopsyche (Apelles) melanops|22027H02|France|1914 ie Glaucopsyche (Glaucopsyche) alexis|20058D08

Glaucopsyche (Apelles) algerica[G. (A.) melanops algerica]|22027G12|Algeria|1928 wo _Glaucopsyche (Apelles) melanops|22027H02

7 Glaucopsyche (Glaucopsyche) divina|22027G10|Japan|1972 100 Glaucopsyche (Apelles) algerica|22027G12

7 Glaucopsyche (Sinia) lanty [Sinia lanty]|22027G03|China|1928 {Glaucopsyche (Sinia) lanty [Sinia lanty]|22027G03

1 1 Glaucopsyche (Sinia) lanty [Sinia lanty]|22027G02|Chinalold api 100 laucopsyche (Sinia) lanty [Sinia lanty]|22027G02

ala Glaucopsyche (Sinia) leechi [Sinia leechi]|22027G01|PT|Chinalold Glaucopsyche (Sinia) leechi [Sinia leechi]|22027G01

Glaucopsyche (Phaedrotes) piasus daunia|9559|USA:UT,Davis Co.|2017 7 Glaucopsyche (Phaedrotes) piasus daunia|9559

O96 lolana iolas|22027F08|Greece|1959 ik oF Praephilotes anthracias|22027F07|Turkmenistan|1965

aoa Enaapilotes SECC CHD GORMSAOLIECHGREOLER a1 A ra ntides CHAMDOOECROAIBORCNGIIOSS.

1 colitantides orion ohemia colitantides orion ohemia

hr Philotes sonorensis|17114F05|USA:CA, Tulare Co.|2015 lolana iolas|22027F08|Greece|1959

; Phengaris arion|20061G10|Bohemia|1957 $Y fe eae (Pseudophilotes) baton|22028A12

1 Phengaris Suis o2027F11(Cnie 1896 100 3 Tena Hier eat sex pH APE

Caerulea coelestis|22027F11|China]1935 100 alaeophilotes (Palaeophilotes) triphysina|2 1

0.92 ; Palaeophilotes (Pseudophilotes) baton [Pseudophilotes (P.) baton|22028A12|Germany|1975 Palaeophilotes (Rubrapterus) bavius [Pseudophilotes|22028B07

1 Palaeophilotes (Pseudophilotes) sinaicus [Pseudophilotes (P.) s.]|22028A10|PT|Eqypt:Sinai]1974-4 100 oe -«CTuranana cytis|22027F01|Afghanistan|1963

1 Palaeophilotes (Palaeophilotes) triphysina[Palaeophilotes t.]|22028B12|Kazakhstan|1913 35 Turanana anisophtalma|22028B08|Iran|old

F on Turanana cytis|22027F01|Afghanistan|1963 of Turanana ariana|22027F03|Afghanistan|1973

Turanana panaegides|22028C04|Central Asialold

**Euphilotes (Euphilotes) bernardino|PAQ378|USA:CA

Turanana panagaea|22028C05|Central Asialold

Euphilotes (Euphilotes) rita]7628|USA:TX,Brewster Co.

a “100

qe Euphilotes (Euphilotes) bernardino|PAQ378|USA:CA,San Benito Co.|2017 aaa Phengaris arion|20061G10|Bohemia|1957

Fig. 2. Trees of Scolitantidina species constructed from protein-coding regions in a. autosomes, b. Z chromosome, and c.

mitochondrial genome: Glaucopsyche (blue) with subgenera Apelles (cyan) and Sinia (red), Palaeophilotes (green,

nominotypical subgenus in magenta), and Euphilotes (purple) with its subgenus Philotiella (orange). Yellow highlights a case

of strongly supported incongruence between nuclear and mitochondrial genome trees. d. Glaucopsyche (Sinia) leechi comb.

rest. 2 paratype ventral view, NVG-22027G01 China: Sichuan Prov., Songpan Co. [ZSMC]. e. Glaucopsyche (Phaedrotes)

piasus iNaturalist observation 125272854 USA: California, Modoc Co., Modoc, 25-Jun-2022 © Paul G. Johnson. The image is

rotated and cropped. CC BY-NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/.

Finally, we note incongruence between the three trees (Fig. 2a—c). While Glaucopsyche is most

confidently monophyletic in both nuclear genome trees (support 1, 1.e., 100%, Fig. 2a, b), subgenus

Phaedrotes is not in the same clade with the rest of Glaucopsyche in the mitogenome tree (Fig. 2c),

cautioning about the reliance on mitochondrial DNA for organism-level phylogenies or a set of gene

markers that may be dominated by mitochondrial genes. More weakly supported incongruence is in the

relative position of Apelles Hemming, 1931 (type species Polyommatus melanops Boisduval, [1828}]),

treated as a valid subgenus by Lukhtanov and Gagarina (2022) and G. divina. Regardless of these

incongruences that would be interesting to understand further, the position of Sinia is the same in all three

trees. Therefore, our conclusion about its placement within Glaucopsyche is strongly supported.

Glaucopsyche algirica (Heyne, 1895), stat. nov. is a species distinct

from Glaucopsyche melanops (Boisduval, 1829)

Genomic sequencing of Glaucopsyche melanops (Boisduval, 1829) (type locality in France) and Lycaena

melanops var. algirica Heyne, 1895 (type locality in Algeria), currently a valid subspecies of G.

melanops, reveals genetic differentiation between them more in line with that known for distinct species

among its relatives (Fig. 2 cyan): e.g., their COI barcodes differ by 1.8% (12 bp), and the genetic distance

between them in the mitogenome ts similar to that between Glaucopsyche paphos Chapman, 1920 (type

locality in Cyprus) and Glaucopsyche alexis (Poda, 1761) (type locality in Austria), or between

Glaucopsyche lygdamus (Doubleday, 1841) (type locality in USA) and Glaucopsyche lycormas (Butler,

1866) (type locality in Japan) (Fig. 2c). Therefore, we propose that Glaucopsyche algirica (Heyne, 1895),

stat. nov. is a species-level taxon.

Pseudophilotes Beuret, 1958 is a subgenus of Palaeophilotes Forster, 1938

Genomic sequencing of Palaeophilotes Forster, 1938 (type species Lycaena triphysina Staudinger, 1892,

Fig. 3a) (Fig. 2 magenta) treated as a distinct genus by Lukhtanov and Gagarina (2022) due to the lack of

its DNA sequences and pronounced phenotypic differences from other genera reveals that it is sister to the

nominotypical subgenus of Pseudophilotes Beuret, 1958 (type species Papilio baton Bergstrasser, 1779,

Fig. 3b) and is much closer to it genetically than the two subgenera of Pseudophilotes—nominotypical

and Rubrapterus Korshunov, 1987 (type species Lycaena bavius Eversmann, 1832)—are to each other

(Fig. 2). This was a surprise given the differences in the appearance of these species (Fig. 3a, b).

Fig. 3. Ultrafast phenotypic evolution in Palaeophilotes. Dorsal view of males, all in ZSMC. a. P. (Palaeophilotes) triphysina

NVG-22028C01 Central Asia, old, coll. Erhardt. b. P. (Pseudophilotes) baton NVG-22028A12 Germany: Bavaria, vic. Jura,

17-May-1975, W. Schatz leg. c. P. (Pseudophilotes) sinaicus paratype NVG-22028A 10 Egypt: Sinai, Wadi Jibal, 1900 m, 26-

May-1974, I. Nakamura leg. COI barcodes differ between (a) and (b) by 2.1% and between (b) and (c) by 0% (probably not a

result of introgression, but the actual lack of genetic differentiation).

We observe that the tree branches in nuclear genome trees (Fig. 2a, b) leading to Palaeophilotes

and the subgenus Pseudophilotes are longer (=reach farther to the right) than for all other Scolitantidina

Tutt, 1907 we sequenced, indicating accelerated evolution. This elevated evolutionary rate in the group is

likely the cause of the observed phenotypic disparity. Notably, the mitochondrial genome tree does not

show elevated rates in this group: branches reach about the same level on the right (Fig. 2c). In accord

with this mitogenome conservation, COI barcodes of Pseudophilotes (Pseudophilotes) baton (Fig. 3b) and

Pseudophilotes (Pseudophilotes) sinaicus Nakamura, 1976 (Fig. 3c) are 100% identical (despite visually

apparent differences in facies) and those of Palaeophilotes triphysina (Fig. 3a) and Pseudophilotes

(Pseudophilotes) baton (Fig. 3b) differ by only 2.1% (14 bp), which is in the range typical for the closest

congeners. To confirm these unexpected results, we sequenced four specimens of P. triphysina (NVG-

22027F04, NVG-22027F05, NVG-22028B12, and NVG-22028C01), and their COI barcodes were 100%

identical (Genbank 0Q311404—0Q3 11407):

AACTTTATATTTTATTTTCGGAAT TTGAGCAGGAATATTAGGAACATCTTTAAGAATTTTAATTCGTATAGAAT TAGGAACACCTGGATCTTTAATTGGAGATGATCAAATTTATAACACT

ATTGTAACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCCTTAATAT TAGGAGCACCTGATATAGCATTTCCACGAA

TAAATAATATAAGATTTTGATTATTACCTCCATCATTAATATTATTAATTTCAAGTAGAAT CGTAGAAAAT GGAGCAGGAACAGGAT GAACAGTGTACCCCCCACTTTCATCTAATATTGC

TCATAGAGGTTCATCTGTTGATTTAGCAATTTTTTCACTTCATTTAGCAGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTAATATACGAGTAAATAATATATCA

TTTGATCAAATATCATTATTTATTTGAGCAGTAGGTATTACAGCATTACTATTATTATTATCTTTACCTGTTTTAGCAGGTGCAATTACTATATTATTAACAGATCGAAATCTTAATACCT

CTTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

Therefore, we propose to treat species of Palaeophilotes and Pseudophilotes as congeneric.

However, due to the elevated rate of evolution in the nuclear genome that resulted in significant

phenotypic differences, we conservatively place Pseudophilotes Beuret, 1958 as a subgenus of

Palaeophilotes Forster, 1938 instead of synonymizing it. Due to the priority of names based on their

dates, this action results in many name changes: we place all species of Pseudophilotes in the genus

Palaeophilotes. However, if Pseudophilotes is kept as a genus, the classification of the group becomes

genetically inconsistent and would require the elevation of Rubrapterus to the genus level (Fig. 2), which

seems unwarranted provided its genetic and phenotypic similarities with Pseudophilotes.

In summary, the variability of evolutionary rates between taxa and rapid phenotypic evolution in

some lineages pose challenges for taxonomic classification because recently diverged species can look

very different from each other (Fig. 3). As a solution, we propose to keep the classification of genera

largely consistent with the estimated divergence times and genetic differentiation, but to use subgenus as

an indicator of phenotypic differences. This approach generally results in a smaller number of genera,

frequently due to the elimination of monotypic genera, which in our opinion, should be used only to

indicate the genetic uniqueness of taxa in the absence of close relatives.

Subgenus Euphilotes Mattoni, [1978] is paraphyletic in mitochondrial DNA

Zhang et al. (2019) placed Philotiella Mattoni, [1978] (type species Lycaena speciosa Hy. Edwards,

1877) as a subgenus of Euphilotes Mattoni, [1978] (type species Lycaena enoptes Boisduval, 1852) due to

their genetic similarity, as recently confirmed by Lukhtanov and Gagarina (2022). Adding to these results,

here we show that Philotiella and Euphilotes are not only very close to each other genetically (Fig. 2a, b

yellow highlight) but also that Philotiella renders Euphilotes paraphyletic in the mitochondrial genome

tree with confident statistical support (Fig. 2c yellow highlight), suggesting introgression of mitochondrial

DNA between the subgenera and a possibility of future synonymization of these two names. Even

phenotypically, some populations of Euphilotes pallescens (Yilden & Downey, 1955) may be

superficially more similar to Philotiella than to Euphilotes species due to reduced spotting and the lack of

orange spots on ventral hindwing. Finally, our current and more comprehensive trees (Fig. 2) strongly

support the distinction of the genus Euphilotes (that includes Philotiella as a subgenus) from other genera

in the subtribe Scolitantidina Tutt, 1907: nuclear genome trees place Euphilotes as sister to all other

sequenced members of the subtribe, with higher confidence (0.92) in the Z chromosome tree (Fig. 2b).

Although members of the New World genus Euphilotes have been placed within some of the Old World

genera in the past, we show that unless the entire subtribe Scolitantidina is unified under a single genus

(Scolitantides Hiibner, 1819), Euphilotes cannot be combined with any other genus to keep it

monophyletic.

Family Nymphalidae Rafinesque, 1815

Agraulis Boisduval & Le Conte, [1835] as a subgenus of Dione Hiibner, [1819]

From the position of consistency and uniformity of taxonomic classification, based on the genetic

closeness of Agraulis Boisduval & Le Conte, [1835] (type species Papilio vanillae Linnaeus, 1758) and

Dione Hibner, [1819] (type species Papilio juno Cramer, 1779) we proposed to regard the former as a

subgenus of the latter, rather than keeping the two as separate genera (Zhang et al. 2019). Treating

Agraulis and Dione as congeneric was not a novel concept (Scott 1986). Recent publications are divided

between the two options: some argue for keeping Agraulis as a genus (Nutfiez et al. 2022; Penz 2022),

while others use Agraulis as a subgenus of Dione (Farfan et al. 2022a; Farfan et al. 2022b; Pelham 2022).

In our opinion, this argument reflects lumping vs. splitting viewpoints. For every monophyletic

lineage, one may find a sufficient number of characters, be it morphological or molecular, to “support”

the distinction of the lineage at the taxonomic rank deemed appropriate. It seems impossible to formulate

criteria for which morphological character differentiates between genera and which refers to subgenera.

Therefore, it is not likely that genus/subgenus disagreement will be resolved by additional studies of

Agraulis morphology. It seems equally unlikely that additional genomic sequencing of Agraulis and

Dione will bring us closer to resolution because the data we have at hand (Zhang et al. 2020; Nufiez et al.

2022) confidently resolve the phylogeny of the group and provide reliable estimates of evolutionary

distances within the group and among their relatives.

While experts in their phylogenetic groups usually find it more aesthetically appealing to split

them into many smaller genera (i.e., the more you study something, the more significant seem the

differences), we think that a more inclusive treatment with a smaller number of distinctive and confidently

monophyletic genera is more practical, both for general biologists (who do not have to learn additional

names) and newcomers. While genetic similarity may be harder to relate to, similarity in facies between

North American species of Agraulis and Dione is illustrated here in Fig. 4 and needs no explanation.

Provided these species are closely related (as judged by genomic analysis), 1t seems meaningful to treat

them as congeneric. From a broader perspective, we do not see an imperative reason to place in different

genera two closely related species that can sometimes be misidentified for each other. We think that

genera are for broader use, and subgenera could be for specialists.

Fig. 4. Two species of Dione, iNaturalist observations: a. Dione (Agraulis) incarnata 140735334 USA: Texas, Cameron Co.

31-Oct-2022 © Jeff Chapman; b. Dione (Dione) moneta 131933192 Mexico: Oaxaca, Tepelmeme Villa de Morelos, 6-Sep-

2017 © Tepelmeme Villa de Morelos. Images are color-corrected, rotated, cropped, and/or flipped. CC BY-NC 4.0

https://creativecommons.org/licenses/by-nc/4.0/.

Genomics-based arguments for Agraulis as a subgenus of Dione from the position of internal

consistency and uniformity of taxonomic classification were stated by Zhang et al. (2019). COI barcodes

of Agraulis and Dione differ by less than 8%. From an even broader perspective of consistent application

of ranks to clades depending on their evolutionary distance, humans (Homo sapiens Linnaeus, 1758) and

chimps (Pan troglodytes (Blumenbach, 1775)), currently attributed to different genera, are 9.6% (63 bp)

different in their barcodes (GenBank accessions MF479728 and HM068586), not 2% as specified by Penz

(2022). Finally, subgenera Agraulis and Dione consist of a small number of species. Unifying them in one

genus does not cause much inconvenience by creating a large genus that is difficult to navigate. On the

contrary, the unification results in a more conveniently sized genus and emphasizes closer evolutionary

connections within it. For all these reasons, we still support the treatment of Agraulis as a subgenus of

Dione; however, placing them in separate genera is not obviously incorrect either.

Chlosyne flavula (W. Barnes & McDunnough, 1918), stat. rest.

is a Species distinct from Chlosyne palla (Boisduval, 1852)

Our recent finding that Melitaea sterope W. H. Edwards, 1870 (type locality in USA: Oregon, Wasco

Co.) is not conspecific with Chlosyne acastus (W. H. Edwards, 1874) (type locality in USA: Utah,

probably Utah Co.) and instead is a subspecies of Chlosyne palla (Boisduval, 1852) (type locality in

USA: California, Plumas Co.) (Zhang et al. 2022b) prompted further discussions and investigations.

Genomic sequencing of all C. palla subspecies partitions them into two clades in the tree constructed

from protein-coding regions in autosomes (Fig. 5a blue and red). While not strongly different in

mitogenomes (Fig. 5b), the two clades are genetically differentiated in the Z chromosome with Fst/Gmin of

0.2/0.016. This differentiation is approximately the same as in the following pairs of species (Fig. 5a):

Chlosyne whitneyi (Behr, 1863) and Chlosyne damoetas (Skinner, 1902), Chlosyne gabbii (Behr, 1863)

and C. acastus, and Chlosyne hoffmanni (Behr, 1863) and Chlosyne harrisii (Scudder, 1863). Therefore,

the two clades represent two distinct species possibly coming in contact at least in Washington state as C.

palla sterope (formerly C. acastus) and Chlosyne palla blackmorei Pelham, 2008 (type locality Canada:

British Columbia, Lytton). The blue clade (Fig. 5) includes the lectotypes of C. palla palla and C. palla

sterope. The oldest name in the red clade (Fig. 5) is Melitaea flavula W. Barnes & McDunnough, 1918

(type locality USA: Colorado, Garfield Co., Glenwood Springs, a syntype sequenced as NVG-22036E05).

Therefore, we propose that Chlosyne flavula (W. Barnes & McDunnough, 1918), stat. rest. is a species

distinct from Chlosyne palla (Boisduval, 1852). We place the following valid taxa (and their synonyms)

as subspecies of Chlosyne flavula: Chlosyne palla blackmorei Pelham, 2008 and Melitaea calydon W.

Holland, 1931 (type locality in USA: Colorado, Jefferson Co.). Other subspecies listed by Pelham (2022)

remain with C. palla.

a_ nuclear (autosomes) tree b mitochondrial genome tree

aan Chlosyne palla palla|18069BO09|LT|USA:CA,Plumas Co.|old C palla pola [C. g. gabbii (=pola)]|21011D02|HT|USA:CA

0.02 Chlosyne palla palla|PAQ335|USA:CA, Stanislaus Co.|2017 fe palla australomontana|17109C07|HT|USA:CA, Tulare Co.

Chlosyne palla pola [C. g. gabbii (=pola)]|21011D02|HT|USA:CAl|old C palla australomontana|21026B03|USA:CA, Tulare Co.|2013

0.002 ame Chlosyne palla sterope|21026A09|USA:WA,Adams Co.|1986 0.02 1G Palla palla]18069B09|LT|USA:CA, Plumas Co.|old

Chlosyne palla altasierrajPAO970|USA:CA,EI Dorado Co.|2019

Chlosyne palla sterope|21011C0O1|LT|USA:ORJold

Chlosyne palla eremita|21026C04|USA:CA,Santa Clara Co.|2002

Chlosyne palla eremita|21026C06|USA:CA, Santa Clara Co.|1963

Chlosyne palla altasierra|17109CO8|HT|USA:CA,EI Dorado Co.|1961

Chlosyne palla australomontana|17109CO7|HT|USA:CA, Tulare Co.|1977

Chlosyne palla australomontana|21026B03|USA:CA, Tulare Co.|2013

Chlosyne flavula blackmorei [C. palla blackmorei]|22022A09|Canada:BC|1970

Chlosyne flavula blackmorei [C. palla blackmorei]|22021H04|Canada:BC|2003

0.86 Chlosyne flavula flavula [C. palla flavula]|22036E05|ST|USA:CO, Garfield Co.|old

Chlosyne flavula flavula [C. palla flavula]|6371|USA:CO,Grand Co.|2016

Chlosyne flavula calydon [C. palla calydon]|PAQ1416|USA:CO, Jefferson Co,|2020

Chlosyne flavula calydon [C. palla calydon]|21026B02|USA:WY, Laramie Co.|1985

Chlosyne whitneyi (=malcolmi)|17109D05|HT|USA:CA,Mono Co.|1921

Chlosyne whitneyi|21084G06|USA:CA,Mono Co.|1974

0.64 Chlosyne damoetas damoetas|21096E07|LT|USA:CO, South Park|1902

Chlosyne damoetas|17115C02|USA:CO, Gilpin Co.|1997

Chlosyne gabbii gabbii|22046A08|USA:CA,Los Angeles Co.|1928

Chlosyne gabbii gabbii]21026C05|USA:CA,Monterey Co.|2003

Chlosyne gabbii gabbii (=sonorae)|22036HO9|LT|USA:CA,Los Angeles Co.|old

C palla pallaJPAO335|USA:CA, Stanislaus Co.|2017

G,palla eremita|21026C06|USA:CA, Santa Clara Co.|1963

C palla eremita|21026C04|USA:CA,Santa Clara Co.|2002

3 ¢ palla altasierra|17109CO8|HT|USA:CA,EI Dorado Co.

qs© Palla altasierra|PAO970|USA:CA,E! Dorado Co.|2019

G palla sterope|21011C01|LT|USA:ORJ|old

oC palla sterope|21026A09|USA:WA,Adams Co.|1986

G, flavula blackmorei [C. palla blackmorei]|22021H04/Can

C flavula blackmorei [C. palla blackmorei]|22022A09|Can

7 flavula flavula [C. palla flavula]|22036E05|ST|USA:CO

¢ flavula flavula [C. palla flavula]|6371|USA:CO,Grand Co.

C flavula calydon [C. palla calydon]|PAO1416|USA:CO

, damoetas damoetas|21096E07|LT|USA:CO,South Park|1902

damoetas|17115C02|USA:CO, Gilpin Co.|1997

C gabbii gabbii|22046A08|USA:CA,Los Angeles Co.|1928

i gabbii gabbii (=sonorae)|22036HO9|LT|USA:CA,Los Ang

&3 gabbii gabbii]/21026C05|USA:CA,Monterey Co.|2003

C gabbii gabbii|PAO375|USA:CA,San Benito Co.|2017

i% Whitneyi (=malcolmi)|17109D05|HT|USA:CA,Mono Co.

1 Oae Chlosyne gabbii gabbii|PAO375|USA:CA,San Benito Co,|2017 C whitneyi|21084G06|USA:CA,Mono Co.|1974

a Chlosyne acastus acastus|21011A04|LT|USA:UT,Utah Co.|old oO” acastus acastus|21011A04|LT|USA:UT, Utah Co.|old

aaa Chlosyne acastus acastus|21026B10|USA:NV,Humboldt Co.|2006 13 acastus acastus|21026B08|USA:UT,Juab Co.|2008

Chlosyne acastus acastus|21026B08|USA:UT,Juab Co.|2008

Chlosyne hoffmanni|PAO971|USA:CA,EI Dorado Co.|2019

Chlosyne hoffmanni|PAO795|USA:CA,Plumas Co.|2018

Chlosyne harrisii|21067F10|USA:NH,Belknap Co.|1957

Chlosyne harrisii|21025G12|USA:ME,Cumberland Co.|1982

C acastus acastus|21026B10|USA:NV,Humboldt Co.|2006

& hoffmanni|PAO795|USA:CA,Plumas Co.|2018

C hoffmanni|PAO971|USA:CA,EI Dorado Co.|2019

7 © harrisiij/21067F10|USA:NH, Belknap Co.|1957

C harrisii]/21025G12|USA:ME,Cumberland Co.|1982

Fig. 5. Trees of Chlosyne species constructed from protein-coding regions in a. autosomes and b. mitochondrial genome: C.

palla (blue), C. flavula stat. rest. (red), C. whitneyi (green), C. damoetas (purple), C. gabbii (olive), C. acastus (orange), C.

hofjmanni (cyan), and C. harrisii (brown). Primary type specimens are labeled in magenta.

Chlosyne palla pola (Boisduval, 1869), comb. nov., stat. rev. is not a junior subjective

synonym of Chlosyne gabbii gabbii (Behr, 1863)

Genomic sequencing of the holotype of Melitaea pola Boisduval, 1869 (type locality “Sonora”,

hypothesized to be USA: California, Los Angeles Co., La Tuna Canyon) currently regarded as a junior

subjective synonym of Chlosyne gabbii gabbii (Behr, 1863) (type locality USA: California, Los Angeles

Co., La Tuna Canyon) is not in the same clade with it, but instead is a specimen of Chlosyne palla

(Boisduval, 1852) (type locality in USA: California, Plumas Co.) (Fig. 5). Therefore, the hypothesized

type locality of M. pola, which is the same as that of C. gabbii, is most likely incorrect. Could it be that

the original type locality stated as “Sonora” was accurate, but instead of Sonora, Mexico, it represents a

homonymous town currently in Tuolumne Co., California? While genomic sequencing of additional

Specimens is necessary to solve this problem confidently, we see that the holotype of M. pola shares

mitochondrial DNA with Chlosyne palla australomontana J. Emmel, T. Emmel & Mattoon, 1998 (type

locality in USA: California, Tulare Co., holotype sequenced as NVG-17109C07) (Fig. 5b), and specimens

of similar appearance are known from Tuolumne Co., suggesting possible synonymy. Until a confidently

supported synonymization solution is found, we conservatively propose to treat M. pola as a valid

subspecies Chlosyne palla pola (Boisduval, 1869), comb. nov., stat. rev.

Cercyonis hypoleuca Hawks & J. Emmel, 1998, stat. nov. is a species distinct from

Cercyonts sthenele (Boisduval, 1852)

Genomic sequencing of Cercyonis Scudder, 1875 (type species Papilio alope Fabricius, 1793, which is a

subspecies of Papilio pegala Fabricius, 1775) specimens reveals that Cercyonis sthenele hypoleuca

Hawks & J. Emmel, 1998 (type locality USA: California, Santa Barbara Co., Santa Cruz Island) is sister

to both Cercyonis sthenele (Boisduval, 1852) (type locality USA: California, San Francisco, lectotype

sequenced as NVG-22036H10) and Cercyonis meadii (W. H. Edwards, 1872) (type locality USA:

Colorado, Park Co. Bailey, lectotype sequenced as NVG-21011E01) in all three trees (Fig. 6). Thus, C.

meadii renders C. sthenele that includes C. sthenele hypoleuca paraphyletic. Moreover, C. sthenele

hypoleuca is genetically differentiated from C. sthenele at the level characteristic of distinct species: e.g.,

COI barcodes of C. sthenele lectotype and C. hypoleuca differ by 3.3% (22 bp). Therefore, we propose

that Cercyonis hypoleuca Hawks & J. Emmel, 1998, stat. nov. is a species-level taxon. Interestingly, the

ventral hindwing with a contrasting whitish pattern of C. hypoleuca (Fig. 6e) is superficially like that of

nominotypical C. sthenele, which is genetically different from it. Instead, C. sthenele sthenele 1s

genetically most similar to its geographical neighbor Cercyonis sthenele behrii (F. Grinnell, 1905) (type

locality in USA: California, Marin Co.) that generally lacks the white pattern.

Cercyonts sthenele damei W. Barnes & Benjamin, 1926, comb. rev. is not a subspecies

of Cercyonis meadii (W. H. Edwards, 1872)

Genomic sequencing of the holotype of Cercyonis damei W. Barnes & Benjamin, 1926 (type locality

USA: Arizona: Coconino Co., Grand Canyon) a taxon treated as a valid subspecies of Cercyonis meadii

(W. H. Edwards, 1872) (type locality USA: Colorado, Park Co. Bailey, lectotype sequenced as NVG-

21011E01) is not conspecific with it and instead is placed among specimens of Cercyonis sthenele

(Boisduval, 1852) (type locality USA: California, San Francisco, lectotype sequenced as NVG-

22036H10) in nuclear genome trees (Fig. 6a, b). Two more recently collected specimens from the general

vicinity of the type locality of C. damei (e.g., Fig. 6d) are in the same clade with the holotype in the Z

chromosome tree (Fig. 6b), which usually agrees well with speciation scenarios (Cong et al. 2019a).

These specimens, including the C. damei holotype, are dark and lack reddish patches of C. meadii, being

more similar phenotypically to C. sthenele. Therefore, from both its nuclear genomic sequences and

superficial appearance, Cercyonis damei is not a subspecies of C. meadii but a subspecies of C. sthenele:

Cercyonis sthenele damei W. Barnes & Benjamin, 1926, comb. rev. However, in the tree constructed

from the protein-coding regions of autosomes (which usually harbor a larger number of introgressed

genes), the three sequences specimens of C. sthenele damei do not form a clade. They are placed at the

base of the C. sthenele clade (Fig. 6a), suggesting some introgression from C. meadii. These introgressed

genomic regions “pull” these specimens closer to C. meadii in the tree and, thus, closer to the base of the

clade. Nevertheless, the amount of introgression is insufficient to “move” any of these specimens into the

C. meadii clade. Furthermore, two C. sthenele damei specimens, including the holotype, possess

mitochondrial DNA of C. meadii and not C. sthenele (Fig. 6c green-labeled in the magenta clade), directly

indicating introgression from C. meadii. The third specimen (Fig. 6c green-labeled in the blue clade) has

mitochondrial DNA of C. sthenele. This polyphyly of C. sthenele damei in the mitochondrial DNA tree

indicates a varying extent of limited hybridization and introgression with C. meadii in its various genomic

regions rather than supporting this taxon’s hybrid origin.

a nuclear (autosome) tree

Cercyonis sthenele sineocellata|21036F08|HT|USA:OR,Lake Co.|1986

Cercyonis sthenele sineocellata|21028A10|USA:OR,Lake Co.|1986

ion ~Cercyonis sthenele behrii|21095D06|USA:CA,Marin Co.|1978

0.004 Cercyonis sthenele sthenele|22036H10|LT|USA:CA,San Francisco Co.|old

ara ~ Cercyonis sthenele sthenele|7259|PLT|USA:CA,San Francisco Co.|old

Cercyonis sthenele behrii|/21028A05|USA:CA,Santa Barbara Co.|2009

da Cercyonis sthenele paulus|20125E10|NT|USA:NV,Storey Co.|1963

— Cercyonis sthenele paulus|PAQO517|USA:NV,Esmeralda Co.|2017

Cercyonis sthenele masoni|20046C11|USA:UT,Grand Co.|2020

Cercyonis sthenele masoni|PAOQ567|USA:CO,Mesa Co.|2017

: Be Cercyonis sthenele damei [C. meadii damei]|22039B03|USA:AZ,Coconino Co.|1980

Coreen suena damel IC. meadii PETE UTES AZ, Coconino Co. |1980

NVG-22039B03

damei

sthenele

0.66

Cercyonis

Bis Cercyonis mesar alamosa|21036HOS|HT|USA: eee Saguache Co.|1964

O74 | OOD Cercyonis meadii alamosa|21027HO8|USA:CO,Alamosa Co.|2006

v.06 Cercyonis meadii meadii|21011E01|LT|USA:CO,Park Co.|old

0.04 Cercyonis meadii meadii|21027HO6|USA:CO,Douglas Co.|1968

1 ore Cercyonis meadii melania|20059B03|USA:TX,Jeff Davis Co.|2002

i Cercyonis meadii melania|9708|USA:TX,Jeff Davis Co|2017

Cercyonis meadii mexicana [C. meadii damei (=mexicana)]|22039B05|USA:AZ,Pima Co.|1910

ties Cercyonis hypoleuca [C. sthenele hypoleuca]|22039B01|USA:CA, Santa Cruz Isl.]1981

Cercyonis hypoleuca [C. sthenele hypoleuca]|22039B02|USA:CA, Santa Cruz Is!.|1981

: Cercyonis oetus|PAQ112|USA:NV,Elko Co.[2016

Cercyonis silvestris incognita|PAO435|USA:CA,Mendocino Co.|2017

Cercyonis pegala texana|4506|USA:TX,Wise Co.|2015

b Zchromosome tree C mitochondrial genome tree

Cercyonis sthenele sineocellata|21028A10|USA:OR,Lake Co.|1986 ,Gsthenele sineocellata|21036F08|HT|USA:OR,Lake Co

Cercyonis sthenele behrii/21095D06|USA:CA,Marin Co.|1978 9,0 sthenele behrii]21028A05|USA:CA, Santa Barbara Co.

Ce evonls step ele behri PALACES eas Santa palpate oo. BIZOOS G nele sthenele|22036H10|LT|USA:CA,SF Co.

onis sthe thene 6b CA, isco Co.|o Csthenele sthenele|7259|PLT|USA:CA,SF Co.|old

toy sthenele masoni|PAO567|USA:CO,Mesa Co.

Csthenele masoni|20046C11|USA:UT,Grand Co.

Csthenele paulus|20125E10|NT|USA:NV, Storey Co.

750 Csthenele paulus|PAQO517|USA:NV,Esmeralda Co.

Csthenele damei [C. meadii damei]|22039B04

Csthenele damei [C. meadii damei]|22039B03

: chi T

ePrc y | >t Siteic 5 if e SOF | bee ein Tne Dan SCO Ul

=“ Gaveyents sthenele paulus|2012 O|NT|USA:NV, Ss rey Lory 11963

Cercyonis sthenele paulus|PAO517|USA:NV,Esmeralda Co.|2017

7, Cercyonis sthenele masoni|20046C11|USA:UT,Grand Co.|2020

Cercyonis sthenele mason A OSS 7 US s. CO. Mesa Co. ol

0.005

Cercyonis ehenele nae Ic. meadii dameil|22039B03|/USA: AZ,Coconino Co.|1980

Cercyonis sthenele damei [C. meadii damei]|22039B04|USA:AZ,Coconino Co.|1980

Cercyonis meadii alamosa|21036HO5|HT|USA:CO,Saguache Co.|1964

Cercyonis meadii alamosa|21027HO8|USA:CO,Alamosa Co.|2006

Cercyonis meadii meadii|21011E01|LT|USA:CO,Park Co.|old

Cercyonis meadii meadii|21027HO6|USA:CO,Douglas Co.|1968

8 le damei[C. meadii i

vo meadii alamosa|21027HO8|USA:CO, Alamosa Co.

Cmeadii alamosa|21036HO5|HT|USA:CO

Cmeadii meadii|21027H06|USA:CO,Douglas Co.

Cmeadii meadii[21011E01|LTJUSA:CO,Park Co.

oGMmeadii melania|20059B03|USA:TX, Jeff Davis Co.

Cmeadii melania|9708|USA:TX, Jeff Davis Co

C meadii mexicana [C. m damei (=mexicana)]|22039B05

Cercyonis meadii melania|20059B03|USA:TX,Jeff Davis Co.|2002

* Cercyonis meadii melania|9708|USA:TX,Jeff Davis Co|2017

Cercyonis meadii mexicana [C. meadii damei (=mexicana)]|22039B05|USA:AZ,Pima Co,.|1910 7 719°

Cercyonis hypoleuca[C. sthenele hypoleuca]|22039B01|USA:CA,Santa Cruz Isl.|1981 hypoleuca [C. sthenele hypoleuca]|22039B02

Cercyonis hypoleuca[C. sthenele hypoleuca]|22039B02|USA:CA,Santa Cruz Isl.|1981 8 hypoleuca [C. sthenele hypoleuca]|22039B01

Cercyonis silvestris incognita|PAO435|USA:CA,Mendocino Co.|2017 C silvestris incognita|PAO435|USA:CA,Mendocino Co.|2017

Cercyonis pegala texana|4506|USA:TX,Wise Co.|2015 3 C pegala texana|4506|USA:TX,Wise Co.|2015

Fig. 6. Trees of Cercyonis species constructed from protein-coding regions in a. autosomes, b. Z chromosome, and c.

mitochondrial genome: C. sthenele (blue) with C. sthenele damei comb. rev. labeled in green, C. meadii (magenta) with C.

meadii mexicana stat. rest. labeled in purple, and C. hypoleuca stat. nov. (red). The lectotype of C. sthenele sthenele and the

holotype of C. sthenele damei are highlighted in yellow. Gaps in branches in (c) indicate where vertical slices of the tree were

removed to reduce its horizontal dimension (to allow an increase of the font size), 1.e., branches with gaps are longer than

shown. d. C. sthenele damei & dorsal (left) and ventral (right) views, NVG-22039B03 USA: Arizona, Coconino Co., 17-Aug-

1980, J. A. Scott leg. e. C. hypoleuca stat. nov., iNaturalist observation 4540707 USA: California, Santa Barbara Co., Santa

Cruz Island, Channel Islands National Park, 3-Jul-2013 © Nature Ali. The image is color-corrected and cropped. CC BY-NC

4.0 https://creativecommons.org/licenses/by-nc/4.0/.

Cercyonis meadti mexicana R. Chermock, 1949, stat. rest.

is a valid subspecies and not a junior subjective synonym

of Cercyonis sthenele damei W. Barnes & Benjamin, 1926, comb. rev.

Genomic sequencing of a specimen from southeastern Arizona identified as Cercyonis meadii mexicana

R. Chermock, 1949 (type locality in Mexico: Chihuahua) (Fig. 6 labeled in purple), a taxon treated as a

junior subjective synonym of “Cercyonis meadii damei’” W. Barnes & Benjamin, 1926 (type locality

USA: Arizona: Coconino Co., Grand Canyon) by Pelham (2022) reveals that it is in a clade different from

the holotype of Cercyonis damei (Fig. 6), which, as we have shown above, is a subspecies of Cercyonis

sthenele (Boisduval, 1852) (type locality USA: California, San Francisco, lectotype sequenced as NVG-

22036H10) and instead belongs to Cercyonis meadii (W. H. Edwards, 1872) (type locality USA:

Colorado, Park Co. Bailey, lectotype sequenced as NVG-21011E01), being sister to all its other

subspecies in all three trees (Fig. 6 magenta) and thus is distinct from them. Therefore, we reinstate it as a

valid subspecies Cercyonis meadii mexicana R. Chermock, 1949, stat. rest.

The holotype of Hermeuptychia sinuosa Grishin, 2021

The original description illustrated the holotype of Hermeuptychia sinuosa Grishin, 2021 (type locality

Guatemala: El Progreso, Morazan) that was pinned through its side, unspread (Cong et al. 2021). Here,

we use this opportunity and publish photographs of the holotype after it has been spread (Fig. 7). Its

genitalia vial is pinned on the same pin as the specimen. The holotype is in the University of Texas Insect

Collection, Austin, TX, USA.

lee eee le ee ker .

Fig. 7. Holotype of Hermeuptychia sinuosa Grishin, 2021 dorsal (left) and ventral (right) views, data in text.

Family Hesperiidae Latreille, 1809

Aethilla toxeus Pl6tz, 1882, syn. nov. is a junior subjective synonym

of Cecropterus albociliatus (Mabille, 1877)

Genomic sequencing of the syntype of Aethilla toxeus Plotz, 1882 (NVG-15032A10, type locality in

Mexico) in MFNB reveals that it is clustered with Cecropterus albociliatus (Mabille, 1877) (type locality

in Colombia, Panama, and Guatemala) (Fig. 8 blue) and not within a species currently called Cecropterus

toxeus (Fig. 8 green and purple). The sequenced specimen is a syntype (possibly the only one ever in

existence) because it matches the original description and carries a label with the number 5054, as stated

in the description. In the interest of stability of nomenclature, N.V.G. hereby designates this specimen in

MENB, a female, bearing the following six rectangular labels, the first is red, the third is green, and others

are white: [ Typus ], [ 5054 |, [ Mexico Deppe ], [ toxeus | PI. | type 5054. |, [| {QR code} http://coll.mfn-

of Aethilla toxeus Plétz, 1882. Because Ferdinand Deppe collected in Mexico in 1824—1829 (Stresemann

1954), the lectotype was likely collected during that time period. The lectotype is missing nearly all its

fringes (the white portion is represented literally by a couple of remaining scales), and all its wings except

the right forewing are chipped at the margins. However, paler postdiscal spots in forewing cells M3-CuA1

and CuAi-CuA2 overlap; therefore, this specimen keys out to Achalarus albociliatus in Evans (1952), and

not to Evans’ “Achalarus toxeus.” Therefore, Aethilla toxeus Pl6tz, 1882, syn. nov. is a junior subjective

synonym of Cecropterus albociliatus (Mabille, 1877).

a Zchromosome tree b mitochondrial genome tree

-CrOpleruS Markwalker [U. d. all

& a. albociliatus (=toxeus) [Cecropterus toxeus]|15032A10|LT|Mexico|MFNB

ecropterus albociliatus albociliatus|19013H04|Mexico:Tam|1974

"Becropterus albociliatus albociliatus|17113H10|Mexico:Tam|1974

ecropterus ar aIKe \,. a, alDOcilatus OUSS UI F EXICO: SON! ZU 10

C. a. albociliatus (=toxeus) [Cecropterus toxeus]|15032A10|LT|Mexico|MFNB

Cecropterus albociliatus albociliatus|19013H04|Mexico:Tam|1974

Cecropterus albociliatus albociliatus|17113H10|Mexico:Tam|1974

, Cecropterus albociliatus albociliatus|5749|07-SRNP-12984|Costa Rica|2007

Cecropterus albociliatus albociliatus|15032A09|?ST|"Hond."|MFNB

33 Cecropterus albociliatus nocera|15031H12|5053|ST|Colombia|MFNB

Cecropterus albociliatus nocera (=mithras)|15031C07|ST|Venezuela|MFNB

sar Cecropterus coyote [Cecropterus toxeus (=coyote)]|15095E12|ST|USA:TX|CMNH

sis Cecropterus coyote [Cecropterus toxeus]|19013G09|Mexico:NL|1979

Cecropterus coyote [Cecropterus toxeus]|19124A10|Mexico:Tam|1965

Cecropterus coyote [Cecropterus toxeus]|19013G10|Mexico:SLP|1980

bap, C&Cropterus coyote [Cecropterus toxeus]|13385A03|USA:TX, Brewster Co.|2004

Cecropterus coyote [Cecropterus toxeus]|3830|USA:TX, Starr Co,|2015

aaa CeCropterus nigrociliata[C. toxeus (=nigrociliata)]|18086A11|HT|Mexico|1905|MNHP

37 Cecropterus nigrociliata [Cecropterus toxeus]|14108E06|Mexico:Col|1953

Cecropterus nigrociliata [Cecropterus toxeus]|14108E05|Mexico:Col|1952

Cecropterus nigrociliata [Cecropterus toxeus]|14108E10|Mexico:Oax|1972

Cecropterus jalapus|17113H11|USA:TX,Hidalgo Co,|1973

Cecropterus jalapus|15032A11|ST|Mexico:Ver|MFNB

Cecropterus jalapus (=xerxes)|15104A07|HT |Belize|1906|AMNH

Cecropterus athesis|13386B08|Panama|1978

Cecropterus athesis (=motilones)|15095B01|HT|Venezuela|CMNH

Cecropterus athesis|13382E09|Venezuela|1989

ecropterus albociliatus albociliatus|15032A09|?ST|"Hond."|MFNB

ecropterus albociliatus albociliatus|5749|07-SRNP-12984|Costa Rica|2007

cbacbelieae albociliatus nocera|15031H12|5053|ST|Colombia|MFNB

ecropterus albociliatus nocera (=mithras)|15031C07|ST|Venezuela|MFNB

Cecropterus coyote [Cecropterus toxeus (=coyote)]|15095E 12|ST|USA:TX|CMNH

ecropterus coyote [Cecropterus toxeus]|3830|USA:TX, Starr Co.|2015

Gecropterus coyote [Cecropterus toxeus]|19013G10|/Mexico:SLP|1980

Gecropterus coyote [Cecropterus toxeus]|13385A03|USA:TX, Brewster Co.|2004

eat ieee coyote [Cecropterus toxeus]|19124A10|Mexico:Tam|1965

ecropterus coyote [Cecropterus toxeus]|19013G09|Mexico:NL|1979

DB eatin nigrociliata [C. toxeus (=nigrociliata)]|18086A11|HT|Mexico|1905|MNHP

ecropterus nigrociliata [Cecropterus toxeus]|14108E06|Mexico:Col|1953

tcecropterus nigrociliata [Cecropterus toxeus]|14108E05|Mexico:Col|1952

Cecropterus nigrociliata [Cecropterus toxeus]|14108E10|Mexico:Oax|1972

Cecropterus jalapus|17113H11|USA:TX,Hidalgo Co.|1973

yal seo St aa 5032A11|ST|Mexico:Ver|MFNB

noc ecropterus jalapus (=xerxes)|15104A07|HT|Belize|1906|AMNH

Cecropterus athesis|13386B08|Panama|1978

gecropterus athesis (=motilones)|15095B01|HT|Venezuela|CMNH

Cecropterus athesis|13382E09|Venezuela|1989

0.006 0.01

Fig. 8. Trees of selected Cecropterus species constructed from protein-coding regions in a. Z chromosome and b.

mitochondrial genome: C. markwalkeri sp. n. (red, highlighted in yellow), C. a/bociliatus (blue), C. coyote stat. rest. (green),

C. nigrociliata stat. rest. (purple), C. jalapus (cyan), and C. athesis (olive). Primary type specimens are labeled in magenta,

and a specimen curated as a possible syntype is labeled in plum color.

Cecropterus coyote (Skinner, 1892), stat. rest. and Cecropterus nigrociliata (Mabille &

Boullet, 1912), stat. nov. are species distinct from Aethilla toxeus Pl6tz, 1882

As shown above, a species currently known as Cecropterus toxeus (P16tz, 1882) (type locality in Mexico)

loses its name to Cecropterus albociliatus (Mabille, 1877) (type locality in Colombia, Panama, and

Guatemala) because the lectotype of the former is conspecific with the latter. The next oldest name for the

Species currently misidentified as C. toxeus 1s Cecropterus coyote (Skinner, 1892) (type locality in USA:

Southern Texas). Genomic sequencing of a syntype of Eudamus coyote places it in the clade with

specimens from the US and eastern Mexico that constitute a species distinct from others (Fig. 8 green).

Moreover, we find that the holotype of Murgaria albociliata var. nigrociliata Mabille & Boullet, 1912

(type locality in Mexico), a taxon currently regarded as a junior subjective synonym of Cecropterus

toxeus (Pl6tz, 1882) and, therefore, given our findings, possibly conspecific with C. coyote, is in the clade

sister to C. coyote, together with several specimens from southwestern Mexico (Fig. 8 purple). The two

clades differ genetically at the level characteristic of distinct species alike genetic differentiation between

sisters Cecropterus jalapus (Pl6tz, 1881) (Fig. 8 cyan) and Cecropterus athesis (Hewitson, 1867) (Fig. 8

olive). COI barcodes of the primary types of E. coyote and M. albociliata var. nigrociliata differ by 1.8%

(12 bp). Hence, we propose that Cecropterus coyote (Skinner, 1892), stat. rest. and Cecropterus

nigrociliata (Mabille & Boullet, 1912), stat. nov. are species-level taxa.

Cecropterus (Murgaria) markwalkeri Grishin, new species

http://zoobank.org/F 1805F4A-DB94-47C9-A 148-82B20B46BA6E

(Figs. 8 part, 9, 10a—b, 11)

Definition and diagnosis. Genomic sequencing of the subgenus Murgaria E. Watson, 1893 (type species

Telegonus albociliatus Mabille, 1877) reveals that two specimens from Sonora, Mexico are sister to a

compact clade of Cecropterus albociliatus (Mabille, 1877) (type locality in Colombia, Panama,

Guatemala) (Fig. 8). The latter clade included a specimen identified by Mabille as “Teleg. albociliatus”

and curated as a type, in addition to the lectotype of Aethilla toxeus Plotz, 1882 (type locality in Mexico)

and syntypes of Aethilla nocera Pl6tz, 1882 (type locality in Colombia) and Telegonus mithras Mabille,

1888 (type locality in Venezuela), the latter being a junior subjective synonym of the former, which is

regarded as a subspecies of C. albociliatus. The two specimens from Sonora (Fig. 8 red) show prominent

genetic differentiation from C. albociliatus (Fig. 8 blue) in the Z chromosome (Fsi/Gmin 0.61/0.001),

which is larger than that between Cecropterus jalapus (Pl6tz, 1881) (Fig. 8 cyan) and Cecropterus athesis

(Hewitson, 1867) (Fig. 8 olive). Therefore, the Sonoran specimens represent a species distinct from C.

albociliatus, and because no available name applies to this species, it is new. Curiously this new species

shares COI barcodes with its sister C. albociliatus (100% identical) but differs from it in male genitalia

morphology (Fig. 10). The new species keys to “Achalarus albociliatus albociliatus” C.17.3(a) in Evans

(1952) sharing with it the lack of costal fold, white (with a gray tint and some scales are more translucent)

hindwing and brownish forewing fringes, but differing in the shape of valva in male genitalia: the valva is

broader, ampulla is less developed, and is more in line with costa, separated from it by a slight concavity

(Fig. 10a), instead of ampulla strongly bulging posterodorsad, separated from costa by a large concavity

in C. albociliatus (Fig. 10c—e); harpe enlarged posteriad and broader, but relatively shorter compared to a

narrower and longer harpe of C. albociliatus. A diagnostic combination of nuclear genome characters is:

aly 1651.25.1:T210C, aly1539.8.1:C888T, aly1089.5.3:G91A, aly1089.5.3:G1I21A, aly1222.33.2:T630C.

eS & het Z >»

b : , d

Fig. 10. Genitalia of Cecropterus (Murgaria). a, b. C. markwalkeri sp. n. holotype in left lateral (a) and dorsal (b) views. c—e.

C. albociliatus albociliatus from Mexico: Veracruz, BMNH(E) 1717074, Godman’s mini-slide preparation [BMNH]: genital

capsule in left lateral view with left valva removed (c), left valva in right lateral view (d), and genitalia illustration from

Godman & Salvin (1894: pl. 80, fig. 14), not to scale (e). Photographs c and d are © The Trustees of the Natural History

Museum London and are made available under Creative Commons License 4.0 (https://creativecommons.org/licenses/by/4.0/).

Fig. 11. Possible Cecropterus markwalkeri sp. n. from Mexico: Sonora, La Aduana near Alamos, 27-Aug-2017, dorsal (left)

and ventral (right) views of the same individual, iNaturalist observation 105683875 © Ken Kertell, color-corrected. CC BY-

NC 4.0 https://creativecommons.org/licenses/by-nc/4.0/.

Barcode sequence of the holotype: Sample NVG-18033E11, GenBank 00311409, 658 base pairs:

AACCTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTAGGAACTTCTTTAAGTTTACTTATTCGAACTGAAT TAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATT TATAATACT

ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTATTATAAT TGGAGGATT TGGAAATTGACTAGTTCCCCTTATATTAGGAGCCCCTGACATAGCTTTCCCTCGTA

TAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATT TCAAGAAGAAT TGTAGAAAATGGTGCAGGTACTGGATGAACAGTTTATCCCCCTTTATCCTCTAATATTGC

CCACCAAGGAGCATCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGAATTTCTTCTATTCTTGGAGCTATTAACTTTATTACAACTATTATTAATATACGAATTAATAATTTATCA

TTTGATCAAATACCATTATTTATTTGAGCTGTCGGAATTACAGCCTTATTATTATTACTT TCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT

CATTTTTTGATCCTGCCGGTGGAGGAGATCCTATTTTATATCAACATTTATTT

Type material. Holotype: & deposited in the National Museum of Natural History, Washington, DC,

USA [USNM], illustrated in Fig. 9, bears four printed labels: three white [ Palm Canyon | 19-IX-05

red [| HOLOTYPE ¢@ | Cecropterus | markwalkeri Grishin |. The first NVG number corresponds to a

sampled leg, and the second is for the abdomen DNA extraction followed by genitalia dissection.

Paratype: lo NVG-18033E10 and NVG-22031H03, the same data as the holotype, but 17-Sep-2010.

Type locality. Mexico: Sonora, Rutal6 at km 196, elevation 896 m, approximate GPS 28.4856,

—109.3605.

Etymology. The name honors Mark Walker, who collected the type series on expeditions with and under

research permits to Paul A. Opler. Mark is a dedicated butterfly explorer who sampled specimens at many

points across the globe, contributing to our knowledge of Lepidoptera by discovering new localities and

range extensions. Mark passionately shares his adventures in words skillfully woven into lepisodes

(essays about field adventures in Lepidoptera) that many of us eagerly await and, more recently, in

pictures. Mark’s kindness in sharing his knowledge and field time with other enthusiasts is unsurpassed.

The name is a noun in the genitive case.

Distribution. Currently known only from the type locality in east-central Sonora, Mexico, but similar in

appearance specimens have been photographed at other places in Sonora (Fig. 11).

Nectaring plant of Epargyreus clarus californicus MacNeill, 1975

in British Columbia, Canada

The caption to figure 38 in Zhang et al. (2022b) stated that Epargyreus clarus californicus MacNeill,

1975 was “nectaring on giant vetch in Canada: British Columbia, Cortes Island”. Instead, the plant shown

is a native Fringed Bleeding Heart, Dicentra eximia (Ker-Gawl.) Torr. We thank Christian Gronau for

kindly informing us about this error.

Aguna malia Evans, 1952, stat. nov. is a species distinct

from Aguna megaeles (Mabille, 1888)

Genomic sequencing of Aguna megaeles (Mabille, 1888) (type locality in Brazil: Santa Catarina)

Specimens, including its lectotype (NVG-15029D11) reveals that Aguna megaeles malia Evans, 1952

(type locality in Venezuela) (Fig. 12 red) is genetically differentiated from the nominotypical subspecies

(Fig. 12 blue) at the level characteristic of species: e.g., their COI barcodes differ by 5.3% (35 bp).

Therefore, we propose that it is a species-level taxon Aguna malia Evans, 1952, stat. nov.

a Zchromosome tree b mitochondrial genome tree

ss,~«CAguna megaeles [A. megaeles megaeles]|15029D11|LT|Brazil:SC|old Aguna megaeles [A. megaeles megaeles]|15029D11|LT|Brazil:SC|old

7 Aguna megaeles [A. megaeles megaeles]|18016D02|Brazil:RJ|1995 | ‘Aguna megaeles [A. megaeles megaeles]|18016D01|Brazil:RJ|1995

; Aguna megaeles [A. megaeles megaeles]|18016D01|Brazil:RJ|1995 100 Aguna megaeles [A. megaeles megaeles]|18016D02|Brazil:RJ|1995

- Aguna malia [A. megaeles malia]|22018A04|Venezuela|old Aguna malia [A. megaeles malia]|22018A04|Venezuela|old

Aguna malia [A. megaeles malia]|17887G06|Venezuela

0,005 0.02

Aguna malia [A. megaeles malia]|17887G06|Venezuela

Fig. 12. Trees of Aguna species constructed from protein-coding regions in a. Z chromosome and b. mitochondrial genome: A.

megaeles (blue) and A. malia stat. nov. (red).

Polygonus arizonensis (Skinner, 1911), stat. nov., Polygonus histrio Rober, 1925, stat.

rest., Polygonus pallida Rober, 1925, stat. nov., and Polygonus hagar Evans, 1952,

Stat. nov. are species distinct from Polygonus leo (Gmelin, [1790])

Genomic sequencing and analysis of Polygonus leo (Gmelin, [1790]) (type locality America, likely in

Hispaniola) specimens from across the range reveal that all five subspecies of P. leo are genetically

differentiated at the species level in both nuclear (Fig. 13a) and mitochondrial (Fig. 13b) DNA. E.g., COI

barcodes of the closest taxa, 1.e., the nominotypical P. /eo (Fig. 13 purple) and Polygonus (Acolastus)

histrio Réber, 1925 (type locality “vermutlich aus Panama”, but likely Cuba as suggested by DNA

comparison) (Fig. 13 green) differ by 2.1% (14 bp). Therefore, we propose that Polygonus arizonensis

(Skinner, 1911), stat. nov., Polygonus histrio Rober, 1925, stat. rest., Polygonus pallida Rober, 1925,

stat. nov., and Polygonus hagar Evans, 1952, stat. nov. are species, not subspecies.

a Zchromosome tree b mitochondrial genome tree

Polygonus arizonensis [P. leo arizonensis]|15095E11|ST|USA:AZ,Pima Co.|old

Polygonus arizonensis [P. leo arizonensis]|19126F10|USA:TX,Presidio Co.|2019

Polygonus arizonensis [P. leo arizonensis]|17101G05|USA:AZ,Gila Co.|1960

Polygonus arizonensis [P. leo arizonensis]|17098B06|14-SRNP-55424|Costa Rica

Polygonus pallida [P. leo pallida]|18094F02|LT|Perulold

Polygonus pallida [P. leo pallida]|18094F03|PLT|Peru:Lima|old

Polygonus pallida [P. leo pallida]|17101G09|Venezuela|1985

Polygonus histrio [P. leo histrio]|18094E04|HT|"Panama"|old

Polygonus histrio [P. leo histrio]|17101HO2|Cuba|1943

Polygonus histrio [P. leo histrio]|5338|USA:FL,Monroe Co.

Polygonus leo [P. leo leoj|17101H07|Dominican Republic|1981

, Polygonus leo [P. leo leo]|17101HO9|British Virgin Islands|1986

Polygonus leo [P. leo leo]|17101H10|St. Eustatius|1981

3, Polygonus hagar [P. leo hagar]|17101H04|Jamaica|1986

Polygonus hagar [P. leo hagar]|10342|Jamaica|2017

Polygonus hagar [P. leo hagar]|10473|Jamaica|2017

ef olygonus arizonensis [P. leo arizonensis]|15095E11|ST|USA:AZ,Pima Co.

,Polygonus arizonensis [P. leo arizonensis]|17098B06|Costa Rica|2014

sPolygonus arizonensis [P. leo arizonensis]|19126F10|USA:TX, Presidio Co.

Polygonus arizonensis [P. leo arizonensis]|17101GO05|USA:AZ,Gila Co.

Rolygonus pallida [P. leo pallida]|18094F02|LT|Perulold

Polygonus pallida [P. leo pallida]|18094F03|PLT|Peru:Lima|old

Polygonus pallida [P. leo pallida]|17101G09|Venezuela|1985

Polygonus histrio [P. leo histrio]|18094E04|HT|"Panama" |old

ikolygonus histrio [P. leo histrio]]17101HO2|Cuba|1943

Polygonus histrio [P. leo histrio]|5338|USA:FL,Monroe Co.

Polygonus leo [P. leo leo]|17101HO7|Dominican Republic|1981

“’Polygonus leo [P. leo leo]|17101HO9|British Virgin Islands|1986

Polygonus leo [P. leo leo]|17101H10|St. Eustatius|1981

Polygonus hagar [P. leo hagar]|17101H04|Jamaica|1986

Polygonus hagar [P. leo hagar]|10342|Jamaica|2017

Polygonus hagar [P. leo hagar]|10473|Jamaica|2017

0.008

Fig. 13. Trees of Polygonus leo species complex constructed from protein-coding regions in a. Z chromosome and b.

mitochondrial genome: P. arizonensis stat. nov. (red), P. pallida stat. nov. (blue), P. histrio stat. rest. (green), P. /eo (purple),

and P. hagar stat. nov. (cyan). Primary type specimens are labeled in magenta.

Viola dagamba Steinhauser, 1989 is a new junior subjective synonym

of Viola kuma (Bell, 1942), comb. nov., stat. rest.

Sequencing of the holotypes of Viola dagamba Steinhauser, 1989 (type locality in Guyana), currently a

valid species, and Pellicia kuma Bell, 1942 (type locality in Venezuela), currently a junior subjective

synonym of Pachyneuria helena (Hayward, 1939) (type locality in Ecuador: Rio Topo) reveals that they

are conspecific (e.g., their COI barcodes are 100% identical) and belong to the genus Viola Evans, 1953

(type species Staphylus alicus Schaus, 1902), not Pachyneuria Mabille, 1888 (type species Pachyneuria

obscura Mabille, 1888) (Fig. 14). Therefore, we reinstate Viola kuma (Bell, 1942), comb. nov., stat. rest.

as a species and treat Viola dagamba Steinhauser, 1989, syn. nov. as its junior subjective synonym.

a Zchromosome tree b mitochondrial genome tree

Njola kuma [Pachyneuria helena (=kuma)]|18024HO7|HT|Venez

Viola kuma (=dagamba) [Viola dagamba]|15038E10|HT|Guyana

Viola egra|18061D03|Colombia|1969

Viola egra|20086A09|Colombia

{¥iola minor|18061D04|Brazil:RJ|1995

Viola minor|22042F11|Paraguaylold

Mjola violella|15098C05|Brazil:RO|1995

Viola violella|7973|Brazil:MT|1991

Viola olla|18061D06|Colombia|1969

Viola olla}18061D07|Colombia|1969

Pachyneuria obscura|15033D07|HT|Peru:Chanchamayolold

Pachyneuria duidae duidae|17105G03|Brazil:MT|1991

, Viola kuma [Pachyneuria helena (=kuma)]|18024HO7|HT|Venezuela|old

Viola kuma (=dagamba) [Viola dagamba]|15038E10|HT|Guyana|1980

Viola egra|18061D03|Colombia|1969 —

Viola egra|20086A09|Colombia 0.02

Viola minor|18061D04|Brazil:RJ|1995

Viola minor|22042F11|Paraguay|old

Viola violella]15098C05|Brazil:RO|1995

Viola violella|7973|Brazil:MT|1991

Viola olla}18061D06|Colombia|1969

Viola olla|18061D07|Colombia|1969

Pachyneuria obscura|15033D07|HT|Peru:Chanchamayolold

Pachyneuria duidae duidae|17105G03|Brazil:MT|1991

Fig. 14. Trees of Viola and Pachyneuria species constructed from protein-coding regions in a. Z chromosome and b.

mitochondrial genome: V. kuma comb. nov., stat. rest. (red) and Pachyneuria (blue).

Leucochitonea janice Ehrmann, 1907 is a junior subjective synonym of

Helitopetes alana (Reakirt, 1868) and not of Heliopetes petrus (Hiibner, [1819])

Genomic sequencing of the holotype of Leucochitonea janice Ehrmann, 1907 (NVG-15095C05, type

locality Venezuela: Suapure) (Fig. 15 magenta) in CMNH, a taxon treated by Mielke (2005) as a junior

subjective synonym of Heliopetes petrus (Htibner, [1819]) (type locality not given) (Fig. 15 red), reveals

that it is not conspecific with it and instead is placed among specimens of Heliopetes alana (Reakirt,

1868) (type locality in Colombia) (Fig. 15 blue) in both nuclear (Fig. 15a) and mitochondrial (Fig. 15b)

DNA trees. Therefore, we conclude that Leucochitonea janice Ehrmann, 1907 is a junior subjective

synonym of Heliopetes alana (Reakirt, 1868) and not of Heliopetes petrus (Hiibner, [1819]).

a Zchromosome tree b mitochondrial genome tree

Heliopetes alana|19091E06|Colombia|1977 Heliopetes alana|19091E06|Colombia|1977

Heliopetes alana|19091E08|French Guiana|1993 idleliopetes alana|19091E08|French Guiana|1993

Heliopetes alana|13383A03|Guyana|1999 atleliopetes alana|13383A03|Guyana|1999

Heliopetes alana (=janice) [H. petrus (=janice)]|15095C05|HT|Venezuela|1899 ,feliopetes alana (=janice) [H. petrus (=janice)]|15095C05|HT|Venez

Heliopetes alana|19091E07|Venezuela|1981 ,bleliopetes alana|19091E07|Venezuela|1981

Heliopetes chimbo|15092D10|Ecuador|1976 Heliopetes chimbo|15092D10|Ecuador|1976

Heliopetes chimbo|19091E02|Ecuador|1984 Heliopetes chimbo|19091E02|Ecuador|1984

Heliopetes chimbo|20017A05|Peru:Piura|2000 Heliopetes chimbo|20017A05|Peru:Piura|2000

Heliopetes ochroleuca|19042A01|Argentina|1928 Heliopetes ochroleuca|19042A01|Argentina|1928

Heliopetes ochroleuca|19091E01|Brazil:MG|old fieliopetes ochroleuca|19091E01|Brazil:MG|old

Heliopetes petrus|17109G06|Bolivia|2003 Heliopetes petrus|17109G06|Bolivia|2003

Heliopetes petrus|19042A02|Brazil:PA|1919 ‘Heliopetes petrus|19042A02|Brazil:PA|1919

Heliopetes petrus|13383A01|Ecuador|2002 Heliopetes petrus|13383A01|Ecuador|2002

0.002

Fig. 15. Trees of Heliopetes species constructed from protein-coding regions in a. Z chromosome and b. mitochondrial

genome: H. alana (blue) with the holotype of Leucochitonea janice Ehrmann, 1907 (magenta), H. chimbo Evans, 1953 (green),

H. ochroleuca J. Zikan, 1938 (cyan), and H. petrus (red).

Tamela maura (Snellen, 1886), stat. rest., and Tamela diocles (Moore, [1866]), stat.

rest., are species distinct from Tamela othonias (Hewitson, 1878)

and Tamela nigrita (Latreille, [1824]), respectively

Based on COI barcodes and morphological evidence, Xue et al. (2022) suggested recently that Tamela

othonias (Hewitson, 1878) (type locality in Borneo) (Fig. 16 purple) and Tamela fumatus (Mabille, 1876)

(type locality in the Philippines) (Fig. 16 cyan) are species distinct from Tamela nigrita (Latreille, [1824])

a Zchromosome tree b mitochondrial genome tree

Tamela fumatus|21105A12|Philippines|old amela fumatus|21105B02|Philippines|old

Tamela fumatus|22048A01|Philippines|1945 iobamela fumatus|21105A12|Philippines|old

Tamela fumatus|21105B02|Philippines|old Tamela fumatus|22048A01|Philippines|1945

Tamela nigrita [T. nigrita nigrita]}18101C12|Javaljold Tamela nigrita [T. nigrita nigrita]|21105B04|Javalold

Tamela othonias|18053B10|Borneo|1894 iamela othonias|18053B10|Borneo|1894

Tamela othonias|18053B11|Borneo|1889 Tamela othonias|18053B11|Borneo|1889

Tamela maura [T. othonias (=maura)]|17118G04|Malaya|1989 jJamela maura [T. othonias (=maura)]|17118G04|Malaya|1989

Tamela maura [T. othonias (=maura)]|19067B02|Malaysia|1992 Tamela maura [T. othonias (=maura)]|19067B02|Malaysia|1992

Tamela maura [T. othonias (=maura)]|22011F02|HT|Sumatra|1877 Tamela maura [T. othonias (=maura)]|22011F02|HT|Sumatra|1877

Tamela diocles [T. nigrita diocles]|18101C10|Indialold s,amela diocles [T. nigrita diocles]|21105A08|India:Sikkim|old

Tamela diocles [T. nigrita diocles]|21105A08|India:Sikkim|old Tamela diocles [T. nigrita diocles]|18101C10|India|old

0.007 0.03

Fig. 16. Trees of Tamela species constructed from protein-coding regions in a. Z chromosome and b. mitochondrial genome:

T. fumatus (cyan), T: nigrita (blue), T. othonias (purple), T; maura stat. rest. (red), and T. diocles stat. rest. (green).

(type locality in Java) (Fig. 16 blue). Our genomic results confirm that but also reveal that Tamela nigrita

diocles (Moore, [1866]) (type locality in Bengal) (Fig. 16 green) is not monophyletic with T. nigrita, but

instead is sister to Tagiades maura Snellen, 1886 (type locality in Sumatra) (Fig. 16 red), which Xue et al.

(2022) regarded as a junior subjective synonym of T. othonias. While the association of T. n. diocles with

T. nigrita is clearly wrong (Fig. 16), it is conceivable to place both 7. maura and T. n. diocles in T.

othonias as subspecies or synonyms. However, both taxa show genetic distinction from T. othonias, so we

propose treating them as distinct species: Tamela maura (Snellen, 1886), stat. rest. and Tamela diocles

(Moore, [1866]), stat. rest., separate from either 7. othonias or T. nigrita.

Hedone yunga Grishin, new species

http://zoobank.org/8575DF83-2451-49B 1-B6C4-AA4F9CS595FF 1

(Figs. 17 part, 18)

Definition and diagnosis. Genomic sequencing of Hedone Scudder, 1872 (type species Hesperia brettus

Boisduval & Le Conte, [1837]) reveals that one specimen from Bolivia was placed in the trees separately

from all others, being sister to Hedone catilina (Pl6tz, 1886) (type locality Brazil: Santa Catarina,

Blumenau; syntype NVG-18052B01 sequenced), but genetically differentiated from it at the level

characteristic of species (Fig. 17). E.g., its COI barcode differs from that of the H. catilina syntype by

3.3% (22 bp). Therefore, this specimen represents a new species. This new species keys to “Polites vibex

catilina”’ M.13.1(d) in Evans (1955) that is also known from Bolivia (Fig. 17) at a lower elevation but

differs from it in females (male unknown) by the pattern of the ventral hindwing, which is whiter (instead

a Zchromosome tree b mitochondrial genome tree

ton ~0 Heddone_vibex brettoides|15096FO2|LT|USA:TX Hedone vibex brettoides|15096FO2|LT|USA:TX

; o.2Hedone vibex brettoides|4117|USA:TX, Tyler Ca.|2015 edone vibex brettoides|4117|USA:TX, Tyler Co.|2015

9 species: o34Hedone vibex brettoides|4135|USA:TX,Tyler Co./2015 edone vibex brettoides|4135|USA:TX, Tyler Co.|2015

Hedone vibex vibex|4784|USA:FL,Levy Co.|2015 Hedone vibex vibex|4784|USA:FL,Levy Co.|2015

Hedone praeceps|4942|USA:TX,Hidalgo Co.|2015 Hedone catilina (=stigma)|15039A04|ST|"TX & NM"

Hedone praeceps|4476|USA:TX,San Patricio Co.|2015 100 | -Hedone catilina]21049A06|Guyana|1993

Hedone praeceps|3438|USA:TX,Cameron Co.|2015 edone catilina|18115E03|Brazil:MT|1990

Hedone praeceps (=hypozona)|15101C02|ST|Mexico:Gue|1916 Hedone catilina|18115E07|Argentina|1979

Hedone praeceps (=lumida)|15034G05|ST|Colombia|1876 sof Hedone catilina|18115E04|Brazil:RJ|1994

1 Hedone praeceps (=lumida)|15034G06|ST|Colombia|1876 edone catilina (=stigma)|15095GO01|ST|"TX & NM"

Hedone praeceps|18115D04|Venezuela|1988 58 Hedone catilina|18115E06|Argentina|2004

Hedone praeceps (=golenia)|18057D06|LT|Colombia|1876 °Hedone catilina|18115E05|Bolivia:Beni|1987

Hedone praeceps|21013B10|Trinidad|1933 Hedone catilina|21013B12|Peru|1920

Hedone praeceps|21013B08|Colombia Hedone vibicoides|22011C10|PT|Suriname|1964

Hedone praeceps|21013B09|Venezuela|1929 too Hedone vibicoides|22011F11|HT|Suriname|1964

Ay Hedone praeceps|18115D02|Panama|2007 Hedone vibicoides|18115D03|Venezuela|1985

Hedone praeceps|18115D06|Guyana|2000 }jedone praeceps|4476|USA:TX,San Patricio Co.|2015

: ——— Hedone praeceps|18013C10|Guyana|1999 ibbedone praeceps|3438|USA:TX,Cameron Co.|2015

Hedone calla|18115D08|Ecuador|1976 Hedone praeceps|4942|USA:TX,Hidalgo Co.|2015

TBD Hedone calla|21013B11|Ecuador|1964 Hedone praeceps|21013B10|Trinidad|1933

calla cae, Hedone calla|18115D09|Ecuador|1988 100 dledone praeceps|21013B09|Venezuela|1929

ee Hedone calla|21013C03|Peru:Lima|1920 4dedone praeceps (=golenia)|18057D06|LT|Colombia|1876

rer Hedone calla|18115D10|Ecuador|1976 *sHedone praeceps|18115D05|Trinidad|2000

Hedone calla|18115E01|Peru:Piura|2000 ‘Hedone praeceps (=lumida)|15034G06|ST|Colombia|1876

ibicoid a Hedone vibicoides|22011F11|HT|Suriname|1964 wledone praeceps|21013B08|Colombia

vibicoldes '—— Hedone vibicoides|22011C10|PT|Suriname|1964 _Hedone praeceps|18115D02|Panama|2007

Hedone catilina|18052B01|ST|Brazil:SC|1881 edone praeceps|18115D06|Guyana|2000

mites “37 ~«Hedone catilina|18115E04|Brazil:RJ|1994 Hedone praeceps (=lumida)|15034G05|ST|Colombia|1876

0 Hedone catilina (=stigma)|15039A04|ST|"TX & NM" Hedone praeceps (=hypozona)|15101C02|ST|Mexico:Gue

Hedone catilina|18115E05|Bolivia: Beni|1987 n *Hedone praeceps|18013C10|Guyana|1999

oyz, Hedone catilina|18115E02|Brazil:MT|1990 oo! 1obledone catilina|18052B01|ST|Brazil:SC|1881

Hedone catilina|18115E03|Brazil:MT|1990 Hedone catilina|21049A10|Peru:MD|1981

0.06 Hedone catilina|18115E06|Argentina|2004 Hedone calla|18115D10|Ecuador|1976

7 1B Hedone catilina]21049A09|Guyana|1980 00 } Medone calla|21013B11|Ecuador|1964

catilina : Hedone catilina|18115E07|Argentina|1979 Hedone calla|18115E01|Peru:Piura|2000

1 Hedone catilina|21049A10|Peru:MD|1981 *Hedone calla|21013C03|Peru:Lima|1920

vunga Hedone catilina (=stigma)|15095GO1|ST|"TX & NM" Hedone calla|18115D08|Ecuador|1976

2. — — Hedone 127C i 9 Hedone yunga

pa, Hedone dictynna|18115C08|Grenada|1986 iddedone dictynna|18115C08|Grenada|1986

ae Hedone dictynna|21013C04|Grenada Hedone dictynna|21013C04|Grenada

Hedone mira|21049A07|HT|Peru:Apurimac|1995 Hedone mira|21049A07|HT|Peru:Apurimac|1995

Hedone bittiae|18115D12|Ecuador|1975 ais pesone bittiae|21049A08|Peru:Lima|2011

bittiae| tou Hedone bittiae|18115D11|Ecuador|1975 edone bittiae|21013C02|PT|Peru|1920

aa Hedone bittiae|18115D07|Ecuador|2002 deledone bittiae|18115D11|Ecuador|1975

op Hedone bittiae|21013C02|PT|Peru|1920 ibbedone bittiae|18033G08|Peru|2009

ote Hedone bittiae|18033G08|Peru|2009 100 Hedone bittiae|21013C01|PT|Peru:Lima|1920

0.005 ne Hedone bittiae|21013C01|PT|Peru:Lima|1920 ee ap orene bittiae|18115D12|Ecuador|1975

Hedone bittiae|21049A08|Peru:Lima|2011 0.009 edone bittiae|18115D07|Ecuador|2002

Fig. 17. Trees of nine Hedone species constructed from protein-coding regions in a. Z chromosome and b. mitochondrial

genome: H. vibex (Geyer, 1832) (blue), H. praeceps Scudder, 1872 (red), H. calla (Evans, 1955) (green), H. vibicoides (de

Jong, 1983) (olive), H. catilina (Plotz, 1886) (cyan), H. yunga sp. n. (highlighted in lime color), H. dictynna (Godman &

Salvin, 1896) (orange), H. mira Grishin & Lamas, 2022 (magenta), and H. bittiae (Lindsey, 1925) (purple).

of yellower) overscaling, with more contrasty and better defined (rather than more diffuse) brown spots

and a darker area by the end of the discal cell. In the absence of known males and without probing female

variation, the most reliable identification is achieved by DNA, and a combination of the following base

pairs is diagnostic in the nuclear genome: aly86.14.2:A4695C, aly23605.1.46:T819C, aly23605.1.46:

G3606A, aly23605.1.46:T9O0A, aly23605.1.46:T2070G, aly127.52.1:T621T (not C), aly671.3.4:A189A

(not G), aly1139.42.1:C165C (not T), aly1060.6.1:C1050C (not T), aly1042.7.1:A2148A (not G), and

COI barcode: T4C, T412C, T406C, T547T, T646C.

be] Lm

Fig. 18. Holotype of Hedone yunga sp. n. dorsal (left) and ventral (right) views, data in text.

Barcode sequence of the holotype: Sample NVG-21127C12, GenBank OQ311411, 658 base pairs:

AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAAT TAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT

ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCTTTCCCTCGAA

TAAATAATATAAGATTTTGAATAT TACCCCCCTCAT TAACATTAT TAAT TTCAAGAAGAAT TGTAGAAAATGGT GCAGGAACAGGTTGAACAGTTTATCCTCCTTTATCTTCAAATATTGC

TCACCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTCTTCACTTAGCCGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAAT TAAAAATTTATCT

TTTGATCAAATACCTTTATTTGTATGATCTGTTGGAATTACAGCTCTTTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTACTTACAGATCGAAATTTAAATACTT

CATTTTTTGATCCAGCAGGTGGAGGAGATCCAATTTTATACCAACATTTATTT

Type material. Holotype: 2 deposited in the Museum fiir Naturkunde, Berlin, Germany (MFNB),

illustrated in Fig. 18, bears the following five rectangular labels, four white: [San Antonio (1800) |

ID: | NVG-21127C12 | c/o Nick V. Grishin ], and one red [ HOLOTYPE ? | Hedone | yunga Grishin ].

Type locality. Bolivia: Yungas Region, La Paz Department, San Antonio.

Etymology. The name is given for the type locality. The name is a feminine noun in apposition.

Distribution. Currently known only from the holotype collected in the Yungas Region of Bolivia.

Comments. Without genomic sequencing that confidently supports the distinctness of this species based

on a single female specimen, it would have been a challenge to describe this species without finding other

Specimens, including its male. Although wing patterns of the female holotype are recognizably different

from other Hedone species, it is conceivable to hypothesize that it could have beeen an individual

variation or aberration. On another note, a comparison of nuclear (Fig. 17a) and mitochondrial (Fig. 17b)

DNA trees reveals incongruence typical for many species complexes in Lepidoptera and non-trivial

evolutionary scenarios of mitogenome evolution that is likely riddled with introgression: Hedone catilina

(Plétz, 1886) is polyphyletic (Fig. 17b cyan), and H. catilina with Hedone bittiae (Lindsey, 1925) (Fig.

17b purple) show several distinct mitogenome clusters that are not evident in nuclear DNA (Fig. 17a).

Similar scenarios have been documented in other species groups (Zakharov et al. 2009; Cong et al. 2017).

Vinuus phellus (Mabille, 1883), stat. rest. is a species distinct

from Vinius exilis (Pl6tz, 1883)

Genomic sequencing reveals prominent genetic differentiation between Hesperia exilis Plétz, 1883 (type

locality “Californien’, in error, a possible (as hypothesized by G. Lamas) syntype in MFNB from Brazil:

Santa Catarina sequenced as NVG-21116A10) (Fig. 19 blue), currently a valid species in the genus Vinius

Godman, 1900 (type species Vinius arignote Godman, 1900, which is a junior subjective synonym of #7.

exilis) and Pamphila phellus Mabille, 1883 (type locality “Malaisie”, in error, probably French Guiana:

Cayenne) (Fig. 19 red), currently a subspecies of the former species: e.g., their COI barcodes differ by 4%

(26 bp). Therefore, we propose that Vinius phellus (Mabille, 1883), stat. rest. is a species-level taxon.

a Zchromosome tree

Vinius exilis exilis]21116A10|?ST|Brazil:SC|old

.28

Vinius sophistes [V. t. tryhana]|19012F04|Mexico:SLP|1976

0.26

Vinius sophistes [V. t. tryhana]|19016E01|Mexico:SLP|1981

>, Vinius tryhana tryhana|19016E02|Suriname|1982

Vinius tryhana tryhana|21013G09|Guyanal|old

, Vinius phellus [V. exilis phellus]|21013G08|French Guiana|1917

" Vinius phellus [V. exilis phellus]|21046E04|French Guiana|1997

Vinius exilis exilis (=arignote)|21118D10|ST|Brazil:SClold

Vinius exilis exilis (=arignote)|21108C09|ST|Brazil:PA|old

Vinius sophistes [V. t. tryhana (=sophistes)]|18116D06|HT|Mexico:Ver|1908

Vinius sophistes [V. t. tryhana]|17111F04|Mexico:SLP|1981

* Vinius sophistes [V. t. tryhana]|19012F05|Mexico:Tam|1974

b mitochondrial genome tree

Vinius phellus [V. exilis phellus]|21013G08|French Guiana

Vinius phellus [V. exilis phellus]|21046E04|French Guiana

Ae Vinius exilis exilis}21116A10|?ST|Brazil:SC|old

Minius exilis exilis (=arignote)|21118D10|ST|Brazil:SClold

Vinius exilis exilis (=arignote)|21108C09|ST|Brazil:PA|old

Vinius sophistes[V. t. tryhana (=sophistes)]|18116D06|HT|Mex

Vinius sophistes [V. t. tryhana]|19016E01|Mexico:SLP|1981

“inius sophistes [V. t. tryhana]|17111F04|Mexico:SLP|1981

ToWinius sophistes [V. t. tryhana]]19012F04|Mexico:SLP|1976

Vinius sophistes [V. t. tryhana]]19012F05|Mexico:Tam

Minius tryhana tryhana|19016E02|Suriname|1982

Minius tryhana tryhana|21013G09|Guyanalold

0.008 Vinius tryhana tryhana|22023G05|French Guiana|2013 002 Vinius tryhana tryhana|22023G05|French Guiana|2013

Fig. 19. Trees of Vinius species constructed from protein-coding regions in a. Z chromosome and b. mitochondrial genome: V.

phellus (red), V. exilis (blue), V. sophistes (green), and V. tryhana (purple). Gaps in branches indicate where vertical slices of

the tree were removed to reduce its horizontal dimension (to allow an increase of the font size), 1.e., branches with gaps are

longer than shown.

Vinus sophistes (Dyar, 1918), stat. rest. is a species distinct

from Vinius tryhana (Kaye, 1914)

Genomic sequencing reveals prominent genetic differentiation between Padraona tryhana Kaye, 1914

(type locality in Trinidad) (Fig. 19 green), currently a valid species in the genus Vinius Godman, 1900

(type species Vinius arignote Godman, 1900, which is a junior subjective synonym of Hesperia exilis

Pl6tz, 1883) and Padraona sophistes Dyar, 1918 (type locality in Mexico: Veracruz) (Fig. 19 purple),

currently a junior subjective synonym of the former species: e.g., their COI barcodes differ by 3.6% (24

bp). Therefore, we propose that Vinius sophistes (Dyar, 1918), stat. rest. is a species-level taxon.

Rhinthon andricus (Mabille, 1895), stat. rest. and Rhinthon aqua (Evans, 1955),

Stat. nov. are Species distinct from Rhinthon braesia (Hewitson, 1867)

Genomic analysis of Rhinthon Godman, 1900 (type species Proteides chiriquensis Mabille, 1889, a junior

subjective synonym of Hesperia osca Pl6tz, 1882) specimens reveals that Proteides andricus Mabille,

1895 (type locality in Brazil: Santa Catarina) (Fig. 20 red) currently treated as a subspecies of Rhinthon

braesia (Hewitson, 1867) (type locality in Brazil: Para) (Fig. 20 blue) is not monophyletic with it and is

distinct from other species. Therefore, we reinstate it as a species-level taxon Rhinthon andricus (Mabille,

1895), stat. rest. Furthermore, Neoxeniades braesia aqua Evans, 1955 (type locality Colombia: Rio

Dagua) is genetically differentiated from the nominotypical R. braesia at the level characteristic of

distinct species (Fig. 20a, Fst/Gmin 0.48/0.003): e.g., compare with the pair Rhinthon molion (Godman,

1901) and Rhinthon bajula (Schaus, 1902). Therefore, we propose to treat Rhinthon aqua (Evans, 1955),

a. nuclear (autosomes) tree b mitochondrial genome tree

Rhinthon cubana|18013C05|Cubalold

Rhinthon osca|19024C08|Panama|1975

Rhinthon andricus [R. braesia andricus]|18119F12|Brazil:SC|old

Rhinthon andricus [R. braesia andricus]|21045HO7|Brazil:SC|1963

ighinthon osca|19024C08|Panama|1975

Rhinthon cubana|18013C05|Cuba|old

Rhinthon andricus [R. braesia andricus]|18119F12|Brazil:SClold

Rhinthon andricus [R. braesia andricus]|21045HO7|Brazil:SC|1963

Rhinthon molion|19024C11|Honduras|1980

Rhinthon molion|18119F05|08-SRNP-40405|Costa Rica|2008

Rhinthon bajula|19024D03|Peru|2001

Rhinthon bajula]18111D08|ST|Brazil:RJ|old

Rhinthon aqua [R. braesia aqua]|18119G01|Panama|1984

Rhinthon aqua [R. braesia aqua]|18119G02|Colombia|1972

Rhinthon braesia [R. braesia braesia]|18119F09|Peru|2002

0.005 Rhinthon braesia [R. braesia braesia]|18119F08|Brazil:RO|1995

Rhinthon molion|19024C11|Honduras|1980

Rhinthon molion|18119F05|08-SRNP-40405|Costa Rica|2008

MRhinthon bajula]18111D08|ST|Brazil:RJ|old

fehinthon bajula|19024D03|Peru|2001

sgninthon aqua [R. braesia aqua]|18119G01|Panama|1984

Rhinthon aqua [R. braesia aqua]|18119G02|Colombia|1972

RRhinthon braesia [R. braesia braesia]|18119F09|Peru|2002

Rhinthon braesia [R. braesia braesia]]18119F08|Brazil:RO|1995

Fig. 20. Trees of Rhinthon species constructed from protein-coding regions in a. autosomes and b. mitochondrial genome: R.

andricus stat. rest. (red), R. molion (green), R. bajula (olive), R. aqua stat. nov. (magenta), and R. braesia (blue).

stat. nov. as a species-level taxon. As a result of this analysis, R. braesia becomes monotypic. The taxon

originally proposed as Neoxeniades bajula peri (Evans, 1955) (type locality in Brazil: Para) has been

regarded as a valid species of Niconiades Hiibner, [1821] (type species Niconiades xanthaphes Hiibner,

[1821]) by Zhang et al. (2022a). Finally, we note that mitochondrial DNA is largely shared among four

species of Rhinthon (Fig. 20b), likely due to introgression.

The type locality of Dion uza (Hewitson, 1877) is likely in southern Brazil,

and Dion agassus (Mabille, 1891) is confirmed as a valid species

The lectotype of Hesperia uza Hewitson, 1877 (type locality not stated) in MFNB designated by Mielke

and Casagrande (2002) sequenced as NVG-18052D10 was subsequently designated as the neotype of

Hesperia pruinosa Plotz, 1882 (type locality South America) in Zhang et al. (2022a), and this species was

placed in the genus Dion Godman, 1901 (type species Carystus gemmatus Butler, 1872). The provenance

of this specimen is unknown: no locality data were given on its labels or in the original description.

Here, we report genomic sequencing of several Dion specimens we found in MFNB that were

collected at about the same time period as the D. uza lectotype. Although none of these specimens is as

uniformly blue on the ventral hindwing as the lectotype, three of them cluster closely with the lectotype in

both nuclear (Fig. 21a) and mitochondrial (Fig. 21b) DNA trees and therefore are conspecific with it.

According to their labels, all three specimens are from southern Brazil: Espirito Santo (Southeast region

of Brazil) and Santa Catarina (South region of Brazil). While it is not possible to pinpoint the type locality

of D. uza with better precision using these specimens due to their genetic similarities, it is most likely that

the lectotype was collected in southern Brazil, possibly in the states of Santa Catarina, Rio de Janeiro, or

Espirito Santo.

a Zchromosome tree

0,003

Dion uza|21127C07|Brazil:ES|old

Dion uza]21127C05|Brazil:SC|old

Dion uza|21127C01|Brazil:ES|old

Dion agassus|15036E10|LT|Brazil:AM|old

Dion agassus|21127C04|Brazil:PA|old

Dion agassus|19023G02|Brazil:AM|1993

Dion agassus|19023G01|French Guiana|1903

b mitochondrial genome tree

Dion uza (& =pruinosa)|18052D10|LT&NT|no data

wWion uza|21127C07|Brazil:ES|old

sa Dion uza|21127C05|Brazil:SC|old

Dion uza]21127C01|Brazil:ES|old

Dion uza (& =pruinosa)|18052D10|LT&NT|no data

0.02

Dion agassus|15036E 10|LT|Brazil:AM|old

Dion agassus|19023G01|French Guiana]1903

Dion agassus|21127C04|Brazil:PA|old

Dion agassus|19023G02|Brazil:AM|1993

Fig. 21. Trees of Dion species constructed from protein-coding regions in a. Z chromosome and b. mitochondrial genome: D.

za (red) and D. agassus (blue). Primary type specimens are labeled in magenta.

Furthermore, Zhang et al. (2022a) treated Dion agassus (Mabille, 1891) (type locality Brazil:

Amazonas, Massauary) as a species distinct from D. uza based on COI barcodes differences and

phenotypic comparison of their lectotypes. Here, we confirm this treatment based on genomic sequencing

of four specimens of each species (including their lectotypes) that support genetic distinction between the

two species (Fig. 21) and report that COI barcodes of lectotypes of Dion uza (Hewitson, 1877) and Dion

agassus (Mabille, 1891) differ by 2.9% (19 bp) (not 2.3% as stated in Zhang et al. (2022a) by mistake).

The COI barcode sequence of the lectotype/neotype of D. uza/H. pruinosa, sample NVG-18052D10,

GenBank accession 0Q311412, 658 base pairs is:

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTCTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGCTCTTTAATTGGAGATGATCAAATTTATAATACT

ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTCTAATACTAGGAGCACCTGATATAGCTTTCCCCCGAA

TAAATAATATAAGATTTTGAATACTGCCACCCTCCCTTATACTATTAACTTTTAGTAGAATTGTAGAAAGTGGAGCAGGTACTGGATGAACAGTTTATCCCCCTCTTTCTTCTAACATTGC

TCATCAAGGTTCTTCAGTTGATTTAGCAATTTTTTCATTACATTTAGCAGGAATTTCTTCTATTTTAGGTGCTATTAATTTTATTACAACAATTATTAACATACGAATTAAAAACTTATCA

TTTGATCAAATACCTTTATTTGTGTGATCTGTAGGTATTACAGCCTTATTATTACTATTATCTTTACCAGTATTAGCAGGAGCTATTACAATACTTCTTACTGATCGAAATTTAAATACTT

CTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT

The COI barcode sequence of the lectotype of D.

OQ31 west 3099: base pairs is:

AACTTTATATTTTAT TATTTGAGCAGGAATAT

ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTCATAGTTATACCTATT

TAAATAATATAAGATTTTGAATACTACCACCCTCCCTTATACTATT

TOATCAAGGTTCLTCAGTTGATTTAGCAATTTTTICATTACATTT

TTTGATCAAATACCTTTATTTGTGTGATCTGTAGGTATTACAGCCTT

CTTTTTTTGACCCAGCAGGAGGAGGAGATCCAATTTTATACCAACAT

TTAGGAACT TTACTAATTCGAACAGAATTAGGTAAT

TTEGAGGATTIGGTAATTGATTAGTOCCCTIT

TAGAAAATGGAGCAGGAACTGGAT

TTTAGGCGCTATTAATTTTAT

TACCAGTATTAGCAGGAGCTATT

TTAATTGGAGACGAT

TAGGAGCACCTGATAT

TACCCCCCTCTTT

TTAATATACGAAT

TTCTCACTGATCGAAATTT

Borna Grishin, new subgenus

http://zoobank. org/C86F2094-5A 1C-417C-AAC4-A9985ED28EDA

Type species. Godmania borincona Watson, 1937.

Definition. This subgenus is represented in all trees by a clade sister to all other known Choranthus

Scudder, 1872 (type species Hesperia radians Lucas, 1857) species (Fig. 22). Keys to M.24.6 in Evans

(1955). Distinguished from its relatives by the following combination of characters: mid-tibiae smooth,

ventral hindwing with dark, brownish (not bright orange) scales, in females uniformly colored, not much

paler by the anal margin, dorsal hindwing in females brown with orange overscaling; in males, subapical

orange spots on forewing form a nearly continuous orange band with other postdiscal spots; valva

terminally deeply indented, shaped like a crab-claw. In DNA, a combination of the following base pairs is

diagnostic in the nuclear genome: aly235.7.6:T37C, aly525.48.6:A129G, aly54.29.3:C201T, aly1022.

3.14:A90G, aly904.12.5:A78T, and COI barcode: GIOIA, T112C, T115C, A376C, C483T, T568C.

a. nuclear (autosomes) tree b mitochondrial genome tree

Borna subgen. n. Choranthus (Borna) borincona|18025E08|HT|Puerto Rico|1915

Choranthus (Borna) borincona|18117E11|Puerto Rico|1982

—— Choranthus (Lilla) lilliae|18026B09/HT|Jamaica|1931

Choranthus (Lilla) lilliae|18021FO05|Jamaica|1959

Choranthus (Choranthus) vitellius]18033G06|Puerto Rico|2015

Choranthus (Choranthus) haitensis|15095HO5|HT|Haiti|1917

Choranthus (Choranthus) melissa|19044C12|Dominican Republic|1990

Choranthus (Choranthus) richmondi|15096F11|HT|Bahamas

Choranthus (Choranthus) radians|18117F01|Cuba|2010

Choranthus (Asbolis) orientis orientis|21012F07|Cuba|1930

Choranthus (Asbolis) orientis eleutherae|18117D02|Bahamas|1978

Borna subgen. n. Choranthus (Borna) borincona|18025E08|HT|Puerto Rico|1915

Choranthus (Borna) borincona|18117E11|Puerto Rico|1982

Lilla subgen. 1.) Choranthus (Lilla) lilliae|18026B09|HT |Jamaica|1931

Choranthus (Lilla) lilliae|18021FO05|Jamaica|1959

Choranthus (Choranthus) vitellius|18033G06|Puerto Rico|2015

Choranthus (Choranthus) haitensis|15095HO5|HT|Haiti|1917

Choranthus (Choranthus) melissa|19044C12|Dominican Rep

Choranthus (Choranthus) richmondi|15096F11|HT|Bahamas

wa Choranthus (Choranthus) radians|18117F01|Cuba|2010

,Choranthus (Asbolis) orientis orientis|21012F07|Cuba|1930

7ooChoranthus (Asbolis) orientis eleutherae|18117D02|Bahamas|1978

Choranthus (Asbolis) antiqua|8060|Dominican Republic|1994 59 Choranthus (Asbolis) antiqua|8060|Dominican Republic|1994

Choranthus (Asbolis) jamaicensis|10491|Jamaica|2017 76 Choranthus (Asbolis) jamaicensis|10491|Jamaica|2017

Choranthus (Asbolis) capucinus|4881|USA:FL,Monroe Co.|2015 Choranthus (Asbolis) capucinus|4881|USA:FL,Monroe Co,|2015

007 Choranthus (Asbolis) capucinus|18057A05|Cuba|2013 a Choranthus (Asbolis) capucinus|18057A05|Cuba|2013

Fig. 22. Trees of Choranthus species constructed from protein-coding regions in a. autosomes and b. mitochondrial genome

colored by subgenus: Borna subgen. n. (green), Lilla subgen. n. (red), Choranthus (blue), and Asbolis (purple).

Etymology. The name is a feminine noun in the nominative singular formed from the type species name

Bor|inco]na.

Species included. Only the type species.

Parent taxon. Genus Choranthus Scudder, 1872.

Lilla Grishin, new subgenus

http://zoobank.org/7AAEDCAD-E796-4E4E-B3F8-3 7ZEFEDSBCF15

Type species. Choranthus lilliae Bell, 1931.

Definition. This subgenus is represented in the autosome genes tree by a clade sister to all other known

Choranthus Scudder, 1872 (type species Hesperia radians Lucas, 1857) species except those in the sub-

genus Borna subgen. n. (Fig. 22). Keys to M.24.5 in Evans (1955). Distinguished from its relatives by the

following combination of characters: mid-tibiae smooth, ventral hindwing with dark, brownish (not bright

orange) scales, in females uniformly colored, not much paler by the anal margin, dorsal hindwing in

females brown with a weak orange postdiscal band; in males, subapical orange spots on forewing clearly

separated from other orange spots; uncus undivided, rounded, valva nearly elliptical in shape, terminally

rounded, harpe not separated from the ampulla. In DNA, a combination of the following base pairs is

diagnostic in the nuclear genome: aly1449.3.1:G59C, aly1603.21.2:C96T, aly145.9.4:GI1OISA, aly2487.

37.1:A115T, aly274.10.13:C109T, and COI barcode: A43T, T121C, A274T, T367C, A430G, T533C.

Etymology. The name is a feminine noun in the nominative singular formed from the type species name

Lillfija{e].

Species included. Only the type species.

Parent taxon. Genus Choranthus Scudder, 1872.

age

Asbolis Mabille, 1904 is a subgenus of Choranthus Scudder, 1872

Both Asbolis Mabille, 1904-[IV]| (type and the only species Goniloba sandarac Herrich-Schaffer, 1865, a

junior subjective synonym of Eudamus capucinus Lucas, 1857) and Pyrrhocalles Mabille, 1904-[V] (type

species Pamphila antiqua Herrich-Schaffer, 1863) were regarded by Zhang et al. (2022a) as junior

subjective synonyms of Choranthus Scudder, 1872 (type species Hesperia radians Lucas, 1857) due to

their genetic similarities. Nevertheless, while being very closely related to each other (COI barcodes differ

by 5.6%, 37 bp), contrasting with their difference in appearance, Asbolis and Pyrrhocalles show larger

genetic differentiation from Choranthus in the nuclear genome (Fig. 22). Treating Asbolis combined with

Pyrrhocalles as a subgenus would mean that the clades of C. borincona and C. lilliae should be

considered subgenera as well, because Asbolis is closer related to Choranthus than Choranthus to C.

borincona and C. lilliae. Presently, because these two clades have been defined as subgenera Borna

subgen. n. and Lil/a subgen. n., it is meaningful to propose that Asbolis Mabille, 1904 is a subgenus of

Choranthus Scudder, 1872 rather than its synonym (Fig. 22). Then, due to genetic similarities, we treat

Pyrrhocalles as a junior (by about a month) subjective synonym of Asbolis. As a result, the subgenus

Asbolis consists of all taxa listed by Mielke (2005) under Pyrrhocalles and Asbolis.

ACKNOWLEDGMENTS

We acknowledge Ping Chen and Ming Tang for their excellent technical assistance. We are grateful to

David Grimaldi and Courtney Richenbacher (AMNH: American Museum of Natural History, New York,

NY, USA), Jason Weintraub (ANSP: The Academy of Natural Sciences of Drexel University,

Philadelphia, PA, USA), Blanca Huertas, David Lees, and Geoff Martin (BMNH: Natural History

Museum, London, UK), Jim Fetzner, Bob Androw, Vanessa Verdecia, Cat Giles, and the late John

Rawlins (CMNH: Carnegie Museum of Natural History, Pittsburgh, PA, USA), Chuck Harp, and the late

Boris Kondratieff (CSUC: C.P. Gillette Museum of Arthropod Diversity, Department of Agricultural

Biology, Colorado State University, Fort Collins, CO, USA), Jason Dombroskie (CUIC: Cornell

University Insect Collection, Ithaca, New York, USA), Crystal Maier and Rebekah Baquiran (FMNH:

Field Museum of Natural History, Chicago, IL, USA), Weiping Xie (LACM: Los Angeles County

Museum of Natural History, Los Angeles, CA, USA), Théo Léger, Wolfram Mey, and Viola Richter

(MFNB: Museum fiir Naturkunde, Berlin, Germany), Andrei Sourakov, Andrew D. Warren, Debbie

Matthews-Lott, Riley J. Gott, and Keith R. Willmott (MGCL: McGuire Center for Lepidoptera and

Biodiversity, Gainesville, FL, USA), Rodolphe Rougerie (MNHP: Muséum National d'Histoire Naturelle,

Paris, France), Matthias Nuss (MTD: Museum fiir Tierkunde, Dresden, Germany), Gerardo Lamas

(MUSM: Museo de Historia Natural, Lima, Peru), Rob de Vos (RMNH: Naturalis Biodiversity Center,

Leiden, Netherlands), Edward G. Riley, Karen Wright, and John Oswald (TAMU: Texas A&M

University Insect Collection, College Station, TX, USA), Alex Wild (TMMC: University of Texas

Biodiversity Center, Austin, TX, USA), Jeff Smith and Lynn Kimsey (UCDC: Bohart Museum of

Entomology, University of California, Davis, CA, USA), Robert K. Robbins, John M. Burns, and Brian

Harris (USNM: National Museum of Natural History, Smithsonian Institution, Washington, DC, USA),

Axel Hausmann, Andreas Segerer, and Ulf Buchsbaum (ZSMC: Zoologische Staatssammlung Miinchen,

Germany), for granting access to the collections under their care, sampling specimens, and stimulating

discussions; to Bill R. Dempwolf, Howard Grisham, Crispin S. Guppy, Robb Hannawacker, Bernard

Hermier, Steve Kohler, Kiyoshi Maruyama, and Mark Walker for specimens and leg samples, to Bernard

Hermier and Jonathan Pelham for critical review of the manuscript and discussions. Evi Buckner-Opler

assisted by providing emotional and logistic support and helped to collect specimens. We are indebted to

the California Department of Fish and Game for collecting permit SC13645, Texas Parks and Wildlife

Department (Natural Resources Program Director David H. Riskind) for the research permit 08-02Rev, to

U. S. National Park Service for the research permits: Big Bend (Raymond Skiles) for BIBE-2004-SCI-

0011 and Yellowstone (Erik Oberg and Annie Carlson) for YELL-2017-SCI-7076, and to the National

Environment & Planning Agency of Jamaica for the permission to collect specimens. Please note that

Natural History Museum, London are made available under Creative Commons License 4.0

(https://creativecommons.org/licenses/by/4.0/), which means in particular that when using the images you

must give appropriate credit and provide a link to the license. We acknowledge the Texas Advanced

Computing Center (TACC) at The University of Texas at Austin for providing HPC resources. This study

was supported in part by the HHMI Investigator funds and by grants from the National Institutes of

Health GM127390 and the Welch Foundation I-1505.

LITERATURE CITED

Ballmer, G. R. 2022. Life History and Ecology of the San Emigdio Blue Butterfly (Lepidoptera:

Lycaenidae). The Taxonomic Report of the International Lepidoptera Survey 10(9): 1-16.

Cong, Q., E. P. Barbosa, M. A. Marin, A. V. L. Freitas, G. Lamas, and N. V. Grishin. 2021. Two

new species of Hermeuptychia from North America and three neotype designations

(Nymphalidae: Satyrinae). The Taxonomic Report of the International Lepidoptera Survey 9(7):

1-20.

Cong, Q., J. Shen, D. Borek, R. K. Robbins, P. A. Opler, Z. Otwinowski, and N. V. Grishin. 2017.

When COI barcodes deceive: complete genomes reveal introgression in hairstreaks. Proceedings

of the Royal Society B: Biological Sciences 284(1848): 20161735.

Cong, Q., J. Zhang, and N. V. Grishin. 2019a. Genomic determinants of speciation. bioRxiv

BIORXIV/2019/83 7666.

Cong, Q., J. Zhang, J. Shen, and N. V. Grishin. 2019b. Fifty new genera of Hesperiidae (Lepidoptera).

Insecta Mundi 0731: 1—56.

Evans, W. H. 1952. A catalogue of the American Hesperiidae indicating the classification and

nomenclature adopted in the British Museum (Natural History). Part II. Pyrginae. Section I. The

Trustees of the British Museum (Natural History); London. v + 178 pp., pls. 10—25.

Evans, W. H. 1955. A catalogue of the American Hesperiidae indicating the classification and

nomenclature adopted in the British Museum (Natural History). Part IV. Hesperiinae and

Megathyminae. The Trustees of the British Museum (Natural History); London. v + 499 pp., pls.

54-88.

Farfan, J., J. Cerdefia, W. Huanca-Mamani, H. A. Vargas, G. L. Goncalves, and G. R. P. Moreira.

2022a. Host plant variation and lack of genetic differentiation in populations of Dione (Agraulis)

dodona Lamas & Farfan (Lepidoptera: Nymphalidae). Insects 13(819): 1-14.

Farfan, J., J. Cerdefia, H. A. Vargas, G. L. Goncalves, G. Lamas, and G. R. P. Moreira. 2022b. A

peculiar new species of Dione (Agraulis) Boisduval & Le Conte (Lepidoptera: Nymphalidae:

Heliconiinae) associated with Malesherbia Ruiz & Pavon (Passifloraceae) in xeric western slopes

of the Andes. Zookeys 1113: 199-227.

Godman, F. D., and O. Salvin. 1894. Pl. 80 in Biologia Centrali-Americana. Insecta. Lepidoptera-

Rhopalocera. Dulau & Co., Bernard Quaritch; London. v. 3 (plates).

Hoang, D. T., O. Chernomor, A. von Haeseler, B. Q. Minh, and L. S. Vinh. 2018. UFBoot2:

Improving the Ultrafast Bootstrap Approximation. Molecular Biology and Evolution 35(2): 518—

522.

iNaturalist. 2022. A Community for Naturalists — 1Naturalist. Available from https://www.inaturalist.org.

Accessed 30 January 2023.

Li, W., Q. Cong, J. Shen, J. Zhang, W. Hallwachs, D. H. Janzen, and N. V. Grishin. 2019. Genomes

of skipper butterflies reveal extensive convergence of wing patterns. Proceedings of the National

Academy of Sciences of the United States of America 116(13): 6232-6237.

Lukhtanov, V. A., and A. V. Gagarina. 2022. Molecular Phylogeny and Taxonomy of the Butterfly

Subtribe Scolitantidina with Special Focus on the Genera Pseudophilotes, Glaucopsyche and

Iolana (Lepidoptera, Lycaenidae). Insects 13(12): 1110.

Mielke, O. H. H. 2005. Catalogue of the American Hesperioidea: Hesperiidae (Lepidoptera). Sociedade

Brasileira de Zoologia; Curitiba, Parana, Brazil. xiii + 1536 pp.

Mielke, O. H. H., and M. M. Casagrande. 2002. Notas taxonédmicas em Hesperiidae neotropicais, com

descricdes de novos taxa (Lepidoptera). Revista brasileira de Zoologia 19(Suplemento 1): 27—76.

Nabokov, V. 1945. Notes on the Morphology of the Genus Lyceides (Lycenide, Lepidoptera). Psyche:

A Journal of Entomology 51(3/4): 104-138.

Nunez, R., K. R. Willmott, Y. Alvarez, J. A. Genaro, A. R. Pérez-Asso, M. Quejereta, T. Turner, J.

Y. Miller, C. Brévignon, G. Lamas, and A. Hausmann. 2022. Integrative taxonomy clarifies

species limits in the hitherto monotypic passion-vine butterfly genera Agraulis and Dryas

(Lepidoptera, Nymphalidae, Helicontinae). Systematic Entomology 47(1): 152-178.

Pelham, J. P. 2022. Catalogue of the Butterflies of the United States and Canada. Revised 2 February

2022. <http://www. butterfliesofamerica.com/US-Can-Cat.htm> Accessed 30 January 2023.

Penz, C. M. 2022. Reinstated status of the butterfly genus Agraulis (Lepidoptera, Nymphalidae,

Heliconiinae). Zootaxa 5209(3): 394-398.

Scott, J. A. 1986. The Butterflies of North America: A Natural History and Field Guide. Standford

University Press; Stanford, CA. xiii + 583 pp

Shen, J., Q. Cong, D. Borek, Z. Otwinowski, and N. V. Grishin. 2017. Complete genome of Achalarus

lyciades, the first representative of the Eudaminae subfamily of skippers. Current Genomics 18(4):

366-374.

Stresemann, E. 1954. Ferdinand Deppe's travels in Mexico, 1824-1829. Condor 56(2): 86—92.

Talavera, G., V. A. Lukhtanovy, N. E. Pierce, and R. Vila. 2012. Establishing criteria for higher-level

classification using molecular data: the systematics of Polyommatus blue butterflies (Lepidoptera,

Lycaenidae). Cladistics 29: 166-192.

Xue, G., P. Qu, M. Li, H. Chiba, and W. Li. 2022. Molecular and morphological evidences confirm the

statuses of Ancistroides othonias (Hewitson, 1878) and the subspecies of A. nigrita (Latreille,

[1824]), sensu Evans 1949 (Lepidoptera, Hesperiidae). Zootaxa 5205(5): 481—490.

Zakharov, E. V., N. F. Lobo, C. Nowak, and J. J. Hellmann. 2009. Introgression as a likely cause of

mtDNA paraphyly in two allopatric skippers (Lepidoptera: Hesperiidae). Heredity (Edinb) 102(6):

590-599.

Zhang, J., Q. Cong, and N. V. Grishin. 2023. Thirteen new species of butterflies (Lepidoptera:

Hesperiidae) from Texas. Insecta Mundi 0969: 1-58.

Zhang, J., Q. Cong, J. Shen, and N. V. Grishin. 2022a. Taxonomic changes suggested by the genomic

analysis of Hesperiidae (Lepidoptera). Insecta Mundi 0921: 1-135.

Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2019. Changes to North American

butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8(2): 1-11.

Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2020. Genomic evidence suggests further

changes of butterfly names. The Taxonomic Report of the International Lepidoptera Survey 8(7):

1-40.

Zhang, J., Q. Cong, J. Shen, P. A. Opler, and N. V. Grishin. 2021. Genomics-guided refinement of

butterfly taxonomy. The Taxonomic Report of the International Lepidoptera Survey 9(3): 1—54.

Zhang, J., Q. Cong, J. Shen, L. Song, R. Gott, J., P. Boyer, C. S. Guppy, S. Kohler, G. Lamas, P. A.

Opler, and N. V. Grishin. 2022b. Taxonomic discoveries enabled by genomic analysis of

butterflies. The Taxonomic Report of the International Lepidoptera Survey 10(7): 1-59.

Zhang, J., Q. Cong, J. Shen, L. Song, and N. V. Grishin. 2022¢c. Genomic DNA sequencing reveals

two new North American species of Staphylus (Hesperiidae: Pyrginae: Carcharodini). The

Taxonomic Report of the International Lepidoptera Survey 10(4): I-13.

The Taxonomic Report

is a platinum open access peer-reviewed publication of

The International Lepidoptera Survey (TILS)

The International Lepidoptera Survey is registered as a non-profit Limited Liability Company (LLC) in

the state of Virginia, U.S.A. The Taxonomic Report (TTR), ISSN 2643-4776 (print) / ISSN 2643-4806

(online) is published for the purpose of providing a public and permanent scientific record. Articles are

peer-reviewed but not necessarily through the anonymous editor-mediated review process. Typically, the

authors are encouraged to solicit reviews of their manuscripts from knowledgeable lepidopterists before

submission. TTR appears in digital, open-access form, is disseminated as a hardcopy to select institutional

repositories, and is available as printed copy upon request at the discretion of authors and/or the editor.

Printing and postage charges may apply. An initial run of 25 copies is printed on paper to meet ICZN

Code recommendation 8B. All published TTR articles are freely available at the archival TTR website

(http:/lepsurvey.carolinanature.com/report.html) and via the following digital repositories:

Internet Archive (https://archive.org/)

Biodiversity Heritage Library (https://www.biodiversitylibrary.org)

Zobodat (https://www.zobodat.at/)

Zenodo (https://zenodo.org)

Digital Commons (https://digitalcommons.unl.edu)

TILS Purpose

TILS is devoted to the worldwide collection of Lepidoptera for the purpose of scientific discovery,

determination, and documentation, without which there can be no preservation.

TILS Motto

“As a world community, we cannot protect that which we do not know”

Articles for publication are sought

Manuscripts may deal with any area of research on Lepidoptera, including faunal surveys, conservation

topics, life histories and foodplant records, matters of nomenclature, descriptions of new taxa, methods,

etc. Taxonomic papers are particularly welcome. There are no publication charges for authors. Before

submitting a manuscript, email TTR editor, Harry Pavulaan, 606 Hunton Place NE, Leesburg, VA,

20176, USA at intlepsurvey@gmail.com (cc: to harrypav@hotmail.com if you do not receive a reply

within one week) to initiate discussion on how to best handle your material for publication, and to discuss

peer review options.

Visit The International Lepidoptera Survey on the World Wide Web at:

http://lepsurvey.carolinanature.com

Join the discussion at our list serve on Groups.1o at:

https://groups.io/g/TILS

You can subscribe by sending an email to: TILS+subscribe@groups.io

Join The International Lepidoptera Survey on Facebook at:

https://www.facebook.com/groups/1072292259768446